UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Overexpression of TDP-43 inhibits NF-κB activity by blocking p65 nuclear translocation Zhu, Jingyan 2013

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2013_spring_zhu_jingyan.pdf [ 2.5MB ]
Metadata
JSON: 24-1.0073733.json
JSON-LD: 24-1.0073733-ld.json
RDF/XML (Pretty): 24-1.0073733-rdf.xml
RDF/JSON: 24-1.0073733-rdf.json
Turtle: 24-1.0073733-turtle.txt
N-Triples: 24-1.0073733-rdf-ntriples.txt
Original Record: 24-1.0073733-source.json
Full Text
24-1.0073733-fulltext.txt
Citation
24-1.0073733.ris

Full Text

OVEREXPRESSION OF TDP-43 INHIBITS NF-κB ACTIVITY BY BLOCKING p65 NUCLEAR TRANSLOCATION    by Jingyan Zhu   B.Med., Norman Bethune College of Medicine Jilin University, 2009   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE  in  THE FACULTY OF GRADUATE STUDIES (Surgery)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  April 2013 ©Jingyan Zhu, 2013 	
   ii	
   ABSTRACT  TDP-43 (TAR DNA binding protein 43) is a heterogeneous nuclear ribonucleoprotein (hnRNP) that has been found to be mainly responsible for neurodegenerative diseases recently. Its involvement in nuclear factor-kappaB pathways has been reported in neuron and microglial cells that are linked to amyotrophic lateral sclerosis (ALS). Nuclear factor-kappaB (NF-κB) is a family that consists of five members that exist and function as dimers. NF-κB pathway targets more than hundreds of genes that are involved in inflammation, immunity and cancer. It also has functions in the nervous system. p50/p65 (p50/RelA) heterodimers, as the major Rel complex in the NF-κB family, are induced by diverse external physiological stimuli and modulate transcriptional activity in almost all cell types. Both p65 and TDP-43 translocation are through the classic nuclear transportation system. In this study, we report that TDP-43 overexpression could block TNF-α induced p65 nuclear translocation dose dependently that further inhibits p65 transactivation activity. Furthermore, the inhibition by TDP-43 is not through preventing IκB degradation but probably by competing the nuclear transporter-importin α3 (KPNA4) and this competition is dependent on the presence of NLS in TDP-43. Silencing TDP-43 by a specific siRNA also increased p65 nuclear localization upon TNF-α stimulation, suggesting that endogenous TDP-43 may be a default suppressor of NF-κB pathway. The above results indicate that TDP-43 may play an important role in regulating the levels of NF-κB activity by control the nuclear translocation of p65.  	
   iii	
   TABLE OF CONTENTS  ABSTRACT..............................................................................................................................ii TABLE OF CONTENTS...................................................................................................... iii LIST OF TABLES................................................................................................................. vi LIST OF FIGURES...............................................................................................................vii LIST OF ABBREVIATIONS..............................................................................................viii ACKNOWLEDGEMENTS....................................................................................................xi CHAPTER 1 INTRODUCTION........................................................................................... 1 1.1 General structure of TDP-43.......................................................................................... 1 1.2 Known functions of TDP-43.......................................................................................... 2 1.3 TDP-43 and neurodegenerative diseases........................................................................ 3     1.3.1 TDP-43 and FTLD................................................................................................... 3 1.3.2 TDP-43 and ALS...................................................................................................... 4 1.4 General structure of nuclear factor-kappaB family........................................................ 5 1.4.1 Structural similarity of five NF-κB subunits............................................................. 5 1.4.2 Structure of RelA (p65) ............................................................................................ 6 1.5 Nuclear factor-kappaB activation pathways.................................................................. 7 1.5.1 Nuclear factor-kappaB canonical pathway............................................................... 8 1.5.2 Nuclear factor-kappaB non-canonical pathway............................................................. 8 1.6 Known functions of nuclear factor-kappaB................................................................... 9 1.7 Nuclear factor-kappaB and cancer............................................................................... 12 1.8 TNF signaling pathways............................................................................................... 15 1.9 Classic nuclear transportation system.......................................................................... 17 1.10 Hypothesis.................................................................................................................. 20 1.11 Aims of the thesis....................................................................................................... 21 CHAPTER 2 MATERIALS AND METHODS.................................................................. 23 	
   iv	
   2.1 Cell cultures ................................................................................................................ 23 2.2 Transfection ................................................................................................................. 23 2.3 siRNA preparation and transfection............................................................................. 24 2.4 Tumor necrosis factor-alpha (TNF-α) stock solution and treatment............................ 25 2.5 Immunocytochemistry.................................................................................................. 25 2.6 Nuclear and cytoplasmic protein extraction................................................................. 26 2.7 Protein extraction and BCA protein assay................................................................... 27 2.8 Western immunoblotting.............................................................................................. 28 2.9 Luciferase assay........................................................................................................... 29 2.10 Coimmunoprecipitation.............................................................................................. 30 2.11 Construction of TDP-43 ΔNLS plasmid.................................................................... 30 2.12 Lactate dehydrogenase (LDH) assay.......................................................................... 31 2.13 Statistical analysis...................................................................................................... 32 CHAPTER 3 RESULTS....................................................................................................... 33 3.1 NF-κB translocate into nuclear after TNF-α treatment in MCF-7 cells ...................... 33 3.2 TDP-43 overexpression blocked NF-κB nuclear translocation in a dose dependent manner................................................................................................................................ 33 3.3 Overexpression of TDP-43 inhibits p65 transactivation activity after TNF-α treatment............................................................................................................................. 34 3.4 Knockdown of endogenous TDP-43 increases the nuclear p65 protein level after TNF-α treatment ................................................................................................................ 35 3.5 Overexpression of TDP-43 accelerates IκB degradation ............................................ 36 3.6 Overexpressing TDP-43 inhibits NF-κB activity by competing the nuclear transporter........................................................................................................................... 37 3.7 The blockade of NF-κB nuclear translocation by TDP-43 can be prevented by overexpression of p65........................................................................................................ 38 3.8 The NLS mutated TDP-43 does not affect p65 nuclear translocation......................... 38 	
   v	
   3.9 Overexpression of TDP-43 sensitizes MCF-7 cells for TNF-α induced apoptosis............................................................................................................................. 39 CHAPTER 4: CONCLUSION DISCUSSION AND FUTURE WORK.......................... 40 4.1 Summary of results ...................................................................................................... 40 4.2 Discussion and future works........................................................................................ 41 BIBLIOGRAPHY................................................................................................................. 58	
   	
   	
   vi	
   LIST OF TABLES Table 1 List of primer for site-directed mutations...................................................................46  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
   	
   vii	
   LIST OF FIGURES  Figure 1.1 schematic structure of RelA (p65) domains and properties................................... 22 Figure 3.1 NF-κB translocate into nuclear after TNF-α treatment in MCF-7 cells................ 47 Figure 3.2 TDP-43 overexpression blocked NF-κB nuclear translocation in a dose dependent manner..................................................................................................................................... 49 Figure 3.3 Overexpression of TDP-43 inhibits p65 transactivation activity after TNF-α treatment.................................................................................................................................. 51 Figure 3.4 Knockdown of endogenous TDP-43 increases the nuclear p65 protein level after TNF-α treatment...................................................................................................................... 52 Figure 3.5 Overexpression of TDP-43 accelerates IκB degradation....................................... 53 Figure 3.6 Overexpressing TDP-43 inhibits NF-κB activity by competing the nuclear transporter............................................................................................................................... 54 Figure 3.7 The blockade of NF-κB nuclear translocation by TDP-43 can be prevented by overexpression of p65............................................................................................................. 55 Figure 3.8 The NLS mutated TDP-43 does not affect p65 nuclear translocation................... 56 Figure 3.9 overexpression of TDP-43 sensitizes MCF-7 cells against TNF-α may through NF-κB pathway....................................................................................................................... 57    	
   viii	
   LIST OF ABBREVIATIONS  TDP-43        TAR DNA binding protein 43 RRM          RNA recognition motif hnRNP         Heterogeneous nuclear ribonucleoprotein NLS           Nuclear localization signal NES           Nuclear export signal HIV-1          Human immunodeficiency virus type 1 CFTR          Cystic fibrosis transmembrane conductance regulator apoA-II         Apolipoprotein A-II SMN2          Survival of motor neuron 2 CDK6          Cyclin-dependent kinase 6 HDAC6         Histone deacetylase 6 FTLD           Frontotemporal dementia ALS            Amyotrophic lateral sclerosis FTLD-U         FTLD with ubiquitin positive inclusions VCP            Valosin containing protein SOD1           Superoxide dismutase 1 AD             Alzheimer’s Diseases RHD           Rel homology domain TAD            Transactivation domains NF-κB          Nuclear factor-kappaB NTD            N-terminal domain DD             Dimerization domain IKK            IκB kinase TNF-α          Tumor necrosis factor IL-1β           Interleukin 1β 	
   ix	
   LPS             Lipopolysaccharide BAFF           B-cell activating factor NIK             NF-κB inducing kinase IL-1             Interleukin 1 COPD           Chronic obstructive pulmonary disease MS              Multiple sclerosis IBD             Inflammatory bowel disease Bcl-2            B-cell lymphoma 2 c-IAP-2          Cellular-inhibitor of apoptosis 2 Bcl-xl           B-cell lymphoma-extra large VEGF           Vascular endothelial growth factor MMPs           Matrix metalloproteinases CYLD           Cylindromatosis ER              Estrogen receptor Akt              Protein Kinase B FADD           Fas-associated protein containing death domain TNF-R1          TNF receptor type 1 TRADD          TNFR-associated factor containing death domains TRAFs           TNFR-associated factors TNF-RSC         TNF receptor-signaling complex LUBAC          Linear ubiquitin assembly complex RIP1             Receptor-interacting protein 1 TAK1            TGFβ-activated kinase 1 tBid              Truncated Bid Apaf1            Apoptotic protease activating factor 1 NPCs            Nuclear pore complexes CAS             Cell apoptosis susceptibility 	
   x	
   IBB               Importin β-binding domain GST              Glutathione S-transferase PEI               Polyethylenimine DNA              Deoxyribonucleic acid mRNA            Messenger RNA siRNA            Small interfering RNA ICC               Immunocytochemistry PBS              Phosphate Buffered Saline PFA              Paraformaldehyde BSA              Bovine serum albumin SDS              Sodium dodecyl sulfate PVDF             Polyvinylidene fluoride PCR              Polymerase chain reaction LDH              Lactate dehydrogenase           	
   xi	
   ACKNOWLEDGEMENTS  I would like to thank my supervisor, Dr. William Jia, who inspired, guided, encouraged me throughout my project and gave me the opportunity to pursue my study.  My special thanks also would be given to Dr. Max Cynader, who offered me valuable ideas, suggestions and inspirit for my research. I would also like to thank my committee member Dr. Yu Tian Wang for the helpful discussion and advice.  I would like to express my special thanks to Guang Yang. His critical thinking on research and precise technical skills guide me walk out of bottleneck time and let me know the science world. I gratefully acknowledge my colleagues, Guoyu Liu, Luke Bu, Wendy Wen, Dong Qiang, Rui Liu, Jun Ding, Xun Zhou, Yongting Chen, Si Zhang, etc. for their great help and support during my two years work and life.  Last but not least, My special thanks to my beloved parents who do not understand why I choose this path but still believe in me and support in all my endeavors. I am thankful to my dear friends for their loving consideration and great confidence in me all through these two years. 	
   1	
    CHAPTER 1. INTRODUCTION 	
   1.1 General structure of TDP-43  The TAR DNA binding protein 43 (TARDBP) also referred to as TDP-43, is a 414-amno acid protein of 43 kDa that encoded by six exons of the TARDBP gene, which is highly conserved in human, mouse,	
   Drosophila melanogaster, and Caenorhabditis elegans (Wang HY et al. 2004). TDP-43 consists of two RNA recognition motifs (RRM1 and RRM2) and a carboxy-terminal glycine-rich domain that is characteristics of ribonucleoproteins (hnRNPs) (Krecic AM and Swanson MS. 1999). The RRMs have high affinity with UG repeat sequences in RNA and are involved in binding to TAR DNA sequences (Ou SH et al. 1995). The C-terminal glycine-rich domain has been reported to mediate protein-protein interaction and interact with hnRNP family members in splicing inhibitory activity (Buratti E et al. 2005). Recently, clinical mutations have been identified to remarkably concentrate in the glycine-rich region that link to neurodegenerative diseases (Pesiridis GS et al. 2009). The N-terminal region contains a nuclear localization signal (NLS) at around residues 82-98 and a nuclear export signal (NES) that manipulate the translocation of TDP-43 between the cytoplasm and the nucleus (Winton MJ et al. 2008). TDP-43 intrinsically has three potential caspase-3 cleavage consensus sites (DXXD) at residues 10, 86 and 216, but usually only two fragments are seen by caspase- dependent cleavage that have been identified in vivo (Zhang YJ et al. 2007). 	
   2	
    1.2 Known functions of TDP-43  TDP-43 was originally cloned and identified as a transcriptional repressor that binds to TAR DNA sequence motifs of human immunodeficiency virus type 1 (HIV-1) (Ou SH et al. 1995). Subsequent studies of RRMs have shown that TDP-43 can bind to both DNA and RNA. Then, its function in pre-mRNA splicing was widely discovered, including promoting exon 9 skipping in human cystic fibrosis transmembrane conductance regulator (CFTR) gene, exon 3 splicing of the human apolipoprotein A-II (apoA-II) gene, inhibiting the binding of SC35 to the terminal exon and enhancing the SMN2 exon 7 inclusion (Buratti E et al. 2001; Mercado PA et al. 2005; Dreumont N et al. 2010; Bose JK et al. 2008). In addition, recent studies have revealed the function of TDP-43 in mRNA stability, mRNA transport, transcriptional regulation and microRNA biogenesis (Kawahara Y and Mieda-Sato A 2012; Acharya KK et al. 2006; Buratti E and Baralle FE 2008). For example, TDP-43 was found to repress cyclin-dependent kinase 6 (Cdk6) protein and transcript levels in human cells (Ayala YM et al. 2008). Moreover, TDP-43 has been reported to bind specifically to HDAC6 mRNA and silencing TDP-43 was known to down-regulate HDAC6 both in mRNA and protein level (Fiesel FC et al. 2010). Recent years, aberrant location and inclusions in cytoplasm of TDP-43 were proved to be hallmarks of frontotemporal dementia (FTLD) and amyotrophic lateral sclerosis (ALS) (Hasegawa M et al. 2008). TDP-43 proteinopathies are associated with neurodegenerative diseases. 	
   3	
    1.3 TDP-43 and neurodegenerative diseases  TDP-43 was found to be one of the major components of the ubiquitin-positive insoluble inclusions in and around neurons that is the pathological feature of amyotrophic lateral sclerosis (ALS) and FTLD, which makes TDP-43 as the major proteinopathies linking with neurodegenerative diseases. Since then, many groups have confirmed this discovery rapidly and the functions of TDP-43 in neurodegenerative diseases have been revealed (Giordana MT et al. 2010; Brandmeir NJ et al. 2008; Dickson DW et al. 2007; Davidson Y et al. 2007).  1.3.1 TDP-43 and FTLD In FTLD-U (FTLD with ubiquitin positive inclusions) patients, TDP-43 was the main protein composition in ubiquitin-positive, tau- and a-synuclein- negative inclusions. TDP-43 is usually located in the nucleus. However, the pathological TDP-43 is mostly mislocated in the cytoplasm and forms the inclusions of which TDP-43 is hyperphosphorylated, ubiquitinated and cleaved to truncated fragments (Arai T et al. 2006; Neumann M et al. 2006). The pathological TDP-43 findings of FTLD-TDP patients can be divided into four main subtypes by neuronal inclusions, distribution, density, and immunohistochemical profile. Type 1 is characterized by neuritis cytoplasmic inclusions. In type 2, the inclusions were found throughout cortical layers whereas type 3 TDP-43 inclusions mainly in superficial cortical layers, and type 4 is associated with VCP gene mutations (Cairns NJ et al. 2007; Neumann M 	
   4	
   et al. 2006). A small proportion of FTLD-U cases did not demonstrate TDP-43 pathology (Roeber S et al. 2008), but it doesn’t affect the predominant pathological role of TDP-43 in FTLD-U.  1.3.2 TDP-43 and ALS Another major pathological TDP-43 related disease is amyotrophic lateral sclerosis (ALS). One character of TDP-43 dysfunction in ALS is that the inclusions are normally distributed to the cytoplasm. TDP-43 inclusions are predominantly found in sporadic ALS patients who are composed of majority of ALS cases and it is also found in patients with familial ALS. Interestingly, TDP-43 inclusions have never been found in the cases with superoxide dismutase gene (SOD1) mutations, which is the most common genetic abnormality in ALS (Mackenzie IR et al. 2007) that implicated different mechanism in these ALS cases. Recent years, some clinical mutations in TARDBP gene have been identified in ALS patients and some of them were proved for their pathological functions (Johnson BS et al. 2009; Nonaka T et al. 2009) indicating that aberrant TDP-43 is sufficient for genesis of neurodegeneration.  Moreover, many other disorders were also reported with TDP-43 dysfunction, such as Alzheimer’s Diseases (AD) (Rohn TT 2008); Parkinson disease (PD) (Wider C and Wszolek ZK 2008) and Huntington disease (Schwab C et al. 2008). However, TDP-43 pathology in these neurodegenerative diseases is an important but secondary clinicopathological feature.  	
   5	
   1.4 General structure of nuclear factor-kappaB family  1.4.1 structural similarity of five NF-κB subunits The nuclear factor-kappaB (NF-κB) is a family consists of five members: RelA (p65), c-Rel, RelB, p50/p105 and p52/p100. These five proteins share approximately 300 amino acids homologous sequences near N-terminal called the Rel homology domain (RHD) (Baldwin 1996) which is responsible for critical functions including dimerization, nuclear translocation, DNA binding, as well as interaction with IκB inhibitors (Ghosh et al. 1995). Base on the activity of transactivation, the five NF-κB subunits can be functionally divided into two groups because only RelA (p65), RelB and c-Rel have the transactivation domains (TAD) in their C-terminal, which is capable of promoting transcription activation. This TAD region of RelA (p65), RelB and c-Rel is not conserved at aa sequence level but only is defined by their function. On the contrary, the smaller p50 and p52 proteins, as the mature NF-κB subunits, generated by removing the C-terminal halves of the large precursors p105 and p100, are lack of the C-terminal transactivation domains (TAD) (Fan et al. 1991; Betts et al. 1996). As the consequence, NF-κB dimers which contain only p50, p52 or both fail to activate transcription. The five NF-κB subunits only exist and function as dimers. They associate with each other to form several homodimers or heterodimers (Ghosh et al. 1998) that bind to discrete DNA sequence in promoters and enhancers of a large number of genes and the DNA-binding site is also known as κB elements. Although NF-κB dimers are diverse, p50/p65 (p50/RelA) heterodimers as the major Rel complex have been found in almost all cell types. It was also 	
   6	
   the first NF-κB dimer that was identified by Ranjan Sen and David Baltimore in 1986 as a sequence specific binding protein that can interact with the immunoglobulin enhancer sequences (Sen R and Baltimore D 1986). Therefore, the general term NF-KappaB traditionally refers specifically to p50/p65 dimers. Since RelA (p65) is the one containing the transactivation domains (TAD) in p50/p65 heterodimers, it has been the focus of interest for the most studies.  1.4.2 structure of RelA (p65) In human, the transcription factor p65 is a 551 amino acid protein encoded by the RELA gene on chromosome 11. It contains a 288 amino acid Rel homology domain (RHD) as other NF-κB subunits. p65 RHD has several specific phosphorylation sites in which are involved in modulation of transcriptional activity (Vermeulen et al. 2003, Anrather et al. 2005). The RHD can be further divided into three structural subregions: the N-terminal domain (NTD), nuclear localization signal (NLS) and the dimerization domain (DD). The DNA binding function is mainly regulated by NTD and DD together. DD is responsible for dimerization of NF-κB subunits and stabilization of p50/p65 heterodimers, which are the most stable dimers in NF-κB family. The residues 290-325 are generally identified as nuclear localization sequence (NLS) of p65 that is directly engaged in nuclear transportation and formation of the complex with IκBα, which retain NF-κB in the cytoplasm (Malek et al. 1998). The C-terminal transactivation domains (TADs) of p65 experience the phosphorylation by a series of kinase when p65 is activated (Schmitz et al. 1995) and strongly activate 	
   7	
   transcription from κB elements in multiple promoters. According to a common sequence motif, at least two strong TADs have been found (TA1 and TA2), but they can only activate transcription as a multimer (Figure 1.1).  1.5 Nuclear factor-kappaB activation pathways  NF-κB is activated through two main signaling pathways: the canonical (or classical) pathway and the non-canonical (or alternative) pathway (Tergaonkar 2006; Gilmore 2006; Scheidereit 2006). The difference between these two pathways is in respect to the types of stimuli, the IKK complex and the targeted NF-κB dimers. In most resting cells, NF-κB dimers are in an inactive form by interacting with their inhibitor proteins–IκB proteins, which determine their cytosolic localization by masking the NLS. The IκB proteins include: IκBα, IκBβ, IκBε, p105, p100, IκBζ and Bcl-3. All IκB proteins are characterized by sharing the 5-7 ankyrin repeat motifs that mediate the interaction with RHD of NF-κB dimers. IκBα and IκBβ function as the inhibitor of p65 containing complexes, with IκBα having a higher affinity with p50/p65 heterodimers rather than p65/p65 homodimers (Malek etal. 2003). The p105 and p100 act as both precursors of p50 and p52 subunits and inhibitors that are responsible for nearly half of the NF-κB inhibition. p105 and p100 also can assemble to form inhibitory complex that inhibits several different NF-κB subunits. When expressed in cells, IκBζ and Bcl-3 concentrate within the nucleus and prefer binding with the p50 and p52 	
   8	
   homodimers (Hoffmann et al. 2006). The role of these two inhibitors in NF-κB signaling and mechanism of action are not fully understood.  1.5.1 Nuclear factor-kappaB canonical pathway The canonical pathway mostly targets p50/p65 dimers and is induced by diverse external physiological stimuli, such as tumor necrosis factor (TNF-α), interleukin 1β (IL-1β) and lipopolysaccharide (LPS). These agents stimulate the I-kappaB kinase complex (IKK), which is activated through ubiquitination of the regulatory subunit IKKγ (NEMO) (Chen et al. 2005) and further activate IKKβ. Activation of IKKβ results in the phosphorylation of IκBα at Ser32 and Ser36 in the N-terminal and subsequent ubiquitination, then, IκBα is degraded by the 26S proteasome. Consequently, NF-κB dimers are free to relocate to the nucleus and bind to κB sites initiating target gene transcription. However, IκBα gene is one of the targeted genes of p65, the active NF-κB promotes IκBα expression, the newly synthesized IκBα enter the nucleus and bond to NF-κB dimers, then shuttle back to the cytosol together (Hayden and Ghosh 2004). This negative feedback of NF-κB regulation is crucial for the control of inflammation and other diseases (Hoffmann et al. 2002).  1.5.2 Nuclear factor-kappaB non-canonical pathway The non-canonical (or alternative) pathway is activated by a limited quantity of stimuli and is mainly responded to the stimulation of specific members TNF-receptor subfamily, such as BAFF, CD40 ligand, or lymphotoxin-β. The non-canonical pathway selectively requires 	
   9	
   IKKα, which is only phosphorylated by protein kinase NF-κB inducing kinase (NIK) (Xiao et al. 2004). IKKα then phosphorylate p100 and results in proteasomal degradation of the C-terminal half of p100 to form p52 (Qing et al. 2005). The activated p52/RelB dimers translocate into nucleus and start gene transcription mainly involved in the development of peripheral lymphoid organs, maturation of B cells and bone metabolism (Sun, 2011).  1.6 Known functions of nuclear factor-kappaB  NF-κB was first discovered as a DNA-binding protein that recognized an 11-base pair sequence in the immunoglobulin light-chain enhancer of mouse B cells by Sen and Baltimore in 1986 (Sen R and Baltimore D, 1986). NF-κB was only known as the p50/p65 heterodimers at that time. After that, NF-κB has been detected in many other cells demonstrating that the inducible NF-κB was not a cell type specific component. All five NF-κB family members were then identified and shown as the transcriptional regulators (Ghosh et al. 1998). Further work revealed that NF-κB knockout mice show strong phenotypes (Gerondakis et al. 1999), such as embryonic lethal, liver apoptosis (Beg and Baltimore, 1996); systemic arthritis resistance (Campbell et al, 2000); skin inflammation (Freyschmidt et al. 2007) and neural degeneration (Lu et al. 2006). These discoveries attracted many researchers because very few genes had been identified to exhibit strong requirements for live. Later on, based on the sequence of κB sites, hundreds of genes have been identified to link to NF-κB manipulations.  	
   10	
   Among the first κB-site containing genes found were those coding proteins involved in inflammation and immunity as well as the activation of NF-κB signaling pathway by proinflammatory cytokines such as interleukin 1 (IL-1) and tumor necrosis factor α (TNF-α), establishing the critical role of NF-κB in inflammation and immunity. However, inflammation is a complicated physiological process and genetic evidence has revealed	
   bifacial role of NF-κB pathway in inflammation. The inflammatory response is characterized by regulation of both pro-inflammatory and anti-inflammatory mediators. Current knowledge of IL-1 and TNF-α represent the proinflammatory cytokines that are quickly released following injury and infection that activate the NF-κB canonical pathway leading to RelA or c-Rel containing complexes activation. In inflammation, the non-canonical pathway is activated by CD40 ligand (Senftleben et al. 2001), lymphotoxin β (TNFSF3) and BAFF (Bonizzi et al. 2004), but not TNF-α (Dejardin et al. 2002) stimulating the activation of the RelB/p52 complexes.	
  Naturally, the proinflammatory cytokines involved in NF-κB canonical pathway have significant functions in chronic inflammatory diseases, such as asthma, chronic obstructive pulmonary disease (COPD) and multiple sclerosis (MS) (Tak and Firestein 2001; Holgate 2004; Williams et al. 2007). There are also several studies have shown that production of these cytokines by disease tissue is NF-κB dependent (Monaco et al. 2004). Previous studies in animal models correlate the NF-κB activation with inflammatory diseases like allergic airway disease (Poynter et al. 2002), but it is not easy to fully demonstrate because the disease progression is most likely the balance of generation of both pro- inflammatory and anti-inflammatory mediators during inflammation (Lawrence and Gilroy 	
   11	
   2007). Instead, p50/p50 homodimers have been shown to repress inflammation genes like IL-2 in T cells (Kang 1992) and anti-inflammatory role of NF-κB have also shown the in inflammatory bowel disease (IBD) in gene knockout studies (Erdman et al. 2001). In brief, the anti-inflammatory function of NF-κB is by inhibition of proinflammatory genes and manipulating the anti-inflammatory cytokines production. The opposite roles of NF-κB in inflammation make it difficult to be a therapeutic target for inflammation diseases.  NF-κB is also involved in the regulation of cell death. The evidence first demonstrated by Beg and Baltimore (Beg et al. 1995). They generated RelA/p65 gene knockout mice that showed liver apoptosis and resulted in embryonic lethality at day 15. As well, Gilmore group reported that v-Rel suppressed death in transformed chicken spleen cells (White et al. 1995). The experiments performed in cell lines indicated that loss of RelA (p65) or overexpression of IκB led to increased apoptosis in response to TNF treatment (Van Antwerp et al. 1996). There also exists a regulation between NF-κB activity and intracellular proteases caspases that is consistent with the role of NF-κB in cell survival (Staal et al. 2011). IκB kinase β (IKKβ), which is the upstream of NF-κB, is found to be inactivated by caspases cleavage at multiple sites at residues 78, 242, 373, and 546 during TNF-induced apoptosis and mutations in these cleavage suppressed TNF-induced apoptosis (Tang et al. 2001). The function of NF-κB in cell proliferation is also found in immune system, NF-κB activation is essential for B-lymphocytes survival (Tumang et al.1998).  	
   12	
   1.7 Nuclear factor-kappaB and cancer  Cancer is characterized as uncontrolled cell growth involving in all kinds of organs in human that medically defined as solid or fluid-filled malignant neoplasm. In cancer, cells divide and grow uncontrollably which tend to proliferate and migrate to nearby organs or spread through the lymphatic system or bloodstream to far distant parts of the body. So far, over hundreds of different human cancers have been found.  NF-κB was first linked to cancer because of the discovery of the similarity with oncoprotein c-Rel which causes aggressive lymphomas and leukemia in chickens (Nolan et al. 1991; Gilmore 1999). Then the rearrangement of p52 gene was found in B-cell and T-cell lymphomas (Neri et al. 1991). In addition, c-rel gene amplification that resulting in an increased expression was found in various B-cell lymphomas. As well, Bcl-3, normally acts as the coactivator of p50 or p52 homodimers, was found to present a translocation that increased NF-κB DNA binding activity (Caamaño et al. 1996). Recent studies found constitutively activation of NF-κB in a wide range of human cancers (Staudt 2010; Bassères and Baldwin 2006) and NF-κB activity has been shown to promote the oncogenic phenotype, such as angiogenesis, tumor cell survival, cancer invasion and inflammation in tumor microenvironment (Baud and Karin 2009). NF-κB potentiates cancer cell growth through regulation of survival genes. For example, it could bind to cyclin D1 promoter (Cao et al. 2001). Furthermore, IKKα has been proposed to induce cyclin D1 expression through a 	
   13	
   T-cell factor activity (Albanese et al. 2003). Consistent with these results, NF-κB inhibition suppressed tumor growth in animal models (Baldwin 2001). NF-κB regulates antiapoptosis in oncogenesis through maintaining antiapoptotic gene expression. Inhibition of NF-κB leads to loss of antiapoptotic protein expression, such as Bcl-2, cellular-inhibitor of apoptosis 2 (c-IAP-2) and Bcl-xL (Hinz et al. 2001). The NF-κB pathway upstream regulator IKKβ also found to suppress tumor apoptosis by regulation of FOXO factors (Hu et al. 2004). In tumor progression, NF-κB regulates vascular endothelial growth factor (VEGF) and MMPs to promote angiogenesis and metastasis (Baldwin 2001) and this effect can be reversed by overexpression of IκB in lung cancer cells (Jiang et al. 2001).  Although NF-κB can modulate oncoproteins in cancer, evidence has also been revealed that NF-κB activation can be blocked by tumor suppressors, such as ARF, CYLD, menin and p53. The tumor suppressor ARF represses the transcriptional activity of NF-κB p65 subunit by phosphorylation of TAD at aa 505 (Rocha at al. 2005), CYLD inhibits cytokine-mediated activation of NF-κB through deubiquitination. (Massoumi et al. 2006; Trompouki et al. 2003). Tumor suppressor p53 has been reported to generally inhibit NF-κB pathway (Hwang et al. 2012).  The NF-κB activation and its involvement present diverse alterations in different cancers. In breast cancer, p50/p65 heterodimer is activated in estrogen receptor (ER) negative subtype that suggests loss of ER could contribute to strongly DNA binding potential by p50/p65 	
   14	
   pathway and ER regulates NF-κB activity negatively (Jana et al. 2012). Moreover, the increased binding activity of p50 and p52 containing complex has been found to associate with ER-positive breast cancer (Cogswell et al. 2000). In pancreatic cancer, NF-κB constitutive activation has been observed in various cell lines, animal models and human tissue from pancreatic tumors. Mechanisms involved including K-Ras point mutation, Akt activation, Notch-1 signaling and IL-1 stimulation (Niu et al. 2004; Wang et al. 2006; Asano et al. 2004). In skin cancer, especially the malignant tumor melanoma, several NF-κB regulated chemokines are expressed constitutively though autocrine and paracrine mechanisms (Ueda et al. 2006). Based on these mechanisms, cancer therapies targeted on NF-κB suppressor IκB or IL-8 inhibition are effective (Shao L et al. 2012).  During the past 10 years, researchers attempted to link inflammation with cancer. NF-κB signaling has functions in both diseases leading the investigators to postulate that NF-κB may have mechanistic relations between inflammation and cancer. Animal models were first set up to mimic inflammation-driven human cancer (Greten et al. 2004), such as colitis-associated colon cancer and hepatitis virus infected carcinoma. It was found that NF-κB canonical pathway activation is essential for cancer development and the targeted genes in these models function as cell survival, demonstrating that NF-κB plays an anti-apoptotic role in the cancer development.  Due to the critical role of NF-κB in regulation of cell death, angiogenesis and resistance to 	
   15	
   anticancer therapies, numerous inhibitors targeting the NF-κB pathway are under development. Compounds inhibit IKK has been shown to induce apoptosis; proteasome inhibitors were used to prevent IκB degradation and some anti-inflammation drugs that can block NF-κB activity. All of these confirmed the role of NF-κB in cancer therapy. Therefore, it seems promising and will become reality in the future as we well understanding the NF-κB pathway.  1.8  TNF signaling pathways  TNF-α was first identified in 1984 as a cytokine that produced by macrophages. It has anti-tumor effects and induces a wide range of cellular activities	
   by activating signal transduction pathways, like NF-κB pathway (Gaur U and Aggarwal BB 2003). In patients with solid tumors, higher TNF-α secretion in blood has been observed that linked with the development of metastasis (Ardizzoia A et al. 1992) and studies revealed the function of TNF-α in embryo development and the sleep wake cycle in TNF-α knockout mice (Pollmacher T et al. 2000). TNF-α exists in two forms: the transmembrane form (mTNF-α) and soluble form (sTNF-α). The mTNF-α acts as	
  the precursor of sTNF-α by which activates the TNF signaling (Xin L et al. 2006). TNF-α induces effects of both cell survival and cell apoptosis. The NF-κB pathway activated by TNF-α usually results in the up-regulation of survival genes (James MA et al. 2006; Turner DJ et al. 2007; Benayoun B et al. 2008). On the other hand, recruiting Fas-associated protein containing death domain (FADD) by TNF-α 	
   16	
   receptor, TNF-R1 leads to Caspase-8 activation and apoptosis (Schneider-Brachert W et al. 2004).  The activation of NF-κB pathway initialized by the binding of TNF-α to TNF-R1 (TNF receptor type 1). The TNF-R1 interacts with TNFR-associated factor containing death domains (TRADD), which further recruits TNFR-associated factors (TRAFs). The TRAFs have two isoforms (TRAF2 and TRAF5) that bind to cellular inhibitor of apoptosis protein 1 and 2 (c-IAP1 and c-IAP2). The TRADD, TRAF2 and TRAF5, c-IAP1 and c-IAP2 together form the TNF receptor-signaling complex (TNF-RSC) by which then take in the linear ubiquitin assembly complex (LUBAC) (B. Gerlach et al. 2011) and receptor-interacting protein 1 (RIP1). The LUBAC contains three elements: HOIL-1, HOIP and Sharpin that adding the ubiquitin chains to RIP1 and NEMO. The polyubiquitinated RIP1 activates the IKKβ through TGFβ-activated kinase 1 (TAK1). IKKβ further ubiquitinate and degradate IκB, then release the NF-κB to translocate into nucleus initializing the transcription of NF-κB dependent gene (Chu WM 2013).  TNF-induced apoptosis also start with TNFR1 activation and TRADD interaction. In the apoptosis pathway, The TRADD associate with deubiquitinated receptor- interacting protein 1 (RIP1) and Fas- associated protein containing death domain (FADD). Then the complex interacts with the death domain (DD) of pro-caspase 8 which next cleave to form the activated caspase-8. The cleavage of pro-apoptotic protein Bid is triggered by activated 	
   17	
   caspase-8 to produce a truncated Bid (tBid) which results in cytochrome C release from mitochondria by inserting into mitochondrial membrane. The apoptotic protease activating factor 1 (Apaf1) and cytochrome C associates with pro-caspase 9 to form a complex that induces the downstream caspase-3 and caspase-7 activation and leads to programmed cell death (Sartorius U et al. 2001). In addition, active caspase-8 can directly depart from FADD and RIP1 in some cell types to activate downstream caspases including caspases-3, caspase-7 and caspase-6 and result in apoptosis.  From present understanding of TNF signaling, both apoptosis and cell survival are triggered by TNF-α and not only one survival pathway exists in TNF signaling, such as NF-κB pathway and JNK. The choice of TNF-α between cell death and survival has been found in a dose dependent manner. High dose of TNF-α is likely to cause cell apoptosis and lower dosages of TNF-α increase cell proliferation (Tang X et al. 2013). Moreover, NF-κB has been reported to play an important role in mediating survival of hepatocytes in response to TNF-α induced apoptosis (Geisler F et al. 2007) suggests the multiple choices in TNF signaling.  1.9 Classic nuclear transportation system  Nuclear envelope is a structure that separates nucleus and cytoplasm in eukaryotic cells. The macromolecular traffic into nucleus is through the structure named nuclear pore complexes (NPCs) in the nuclear envelope and is regulated by specific nuclear import receptors. These 	
   18	
   carriers are termed as karyopherins, including importins and exportins for nuclear import and export, respectively (Mattaj and Englmeier 1998). Importin α is an adaptor protein that recognizes the nuclear localization signal (NLS) within the cargo proteins and its N-terminal importin β-binding domain (IBB) directly dimerize with importin β, which interacts with NPC (Mattaj and Englmeier 1998). After passage through the NPC, importin β rapidly back to the cytoplasm via its association with NPC and the unloaded importin α is transported out of the nucleus by forming a complex with cell apoptosis susceptibility gene (CAS) and RanGTP (Kutay et al. 1997).  In human, only one importin β has been confirmed to interact with importin α. However, it has been identified that importin α have six isoforms: importin α1, importin α3, importin α4, importin α5, importin α6 and importin α7 (Seki et al. 1997; Kohler et al. 1999; Kohler et al. 1997;). Base on sequence homology, these six isoforms can be further divided into three groups: first group only contains importin α1; importin α3 and importin α4 belong to the second group; importin α5, importin α6 and importin α7 are the third group. Recently, a new member of importin family has been found in bovine oocyte, it is named importin α8 which is more closely related to importin α1 (Tejomurtula et al. 2009). All of these isoforms function to mediate the import of proteins containing the NLS sequence. However, there are some evidences showing different proteins could be recognized specifically by only one importin α or one subset (Arataniet al. 2006; Ma and Cao. 2006). Importantly, it has been demonstrated that importin α could be saturated by peptides containing NLS and the binding 	
   19	
   abilities to importin α were competitive (Goldfarb et al. 1986).  In unstimulated conditions, NF-κB p50/p65 heterodimers are sequestered in the cytoplasm and they can be activated by various physiological stimuli, include TNF-α. TNF-α can stimulate p65 activation in many cell lines and mainly activates NF-κB canonical pathway leading to IKKβ activation then results in the IκBα phosphorylation and degradation. As a result, NF-κB p50/p65 heterodimers are free to translocate into the nucleus and regulate target genes. Importantly, IκBα gene itself is one of the NF-κB targets that is upregulated by activation of NF-κB. The newly expressed IκBα rapidly enter the nucleus and take the NF-κB back to the cytoplasm (Tam, W. F. and R. Sen. 2001). Moreover, the transportation of NF-κB between the nucleus and cytoplasm is mediated by classic nuclear import and export systems (Fagerlund et al. 2005).  NF-κB p65 subunit possesses a NLS partially overlaps with its RHD. It has been identified that p65 nuclear transportation is through binding with importin α3 but only when it is released from IκB (Fagerlund et al. 2005). There is also a NLS in IκBα structure, but so far it has not been found to bind to any importins. Thus, the importin transportation system plays important role in NF-κB signaling for its transactivation activity in the nucleus.  TDP-43 also possesses a NLS that causes TDP-43 to predominantly locate in the nucleus. TDP-43 has been shown to have the abilities to bind with importin α1, importin α3, importin 	
   20	
   α4, importin α5, importin α7 and importin β in vitro GST pull down assay (Nishimura AL et al. 2010). Knockdown of importin β results in redistribution of TDP-43 to the cytoplasm, indicating that TDP-43 nuclear transportation might be through the classic nuclear import pathway (Nishimura AL et al. 2010) by binding to different importin α isoforms.  The fact that both p65 and TDP-43 bind to importin α3 leading a hypothesis that p65 and TDP-43 might compete each other, which may regulate their cellular activities.  In 2011, Jean-Pierre Julien’s group first reported the association of TDP-43 and NF-κB in neuron and microglia cells. They demonstrated that TDP-43 colocalized with p65 subunit in ALS patients but not in normal person, then they found that TDP-43 acted as a co-activator of p65 in the nucleus of microglial cells (Swarup V et al. 2011).  1.10 Hypothesis The possible connection between TDP-43 and NF-κB pathway revealed by Julien’s group inspired us to investigate more details of the relationship between the two proteins. Since p65 nuclear translocation is a critical step for activation of NF-κB pathway and both p65 and TDP-43 share the same classic nuclear transportation system, we hypothesis that TDP-43 may affect p65 nuclear transportation to interfere activity of NF-κB pathway. Given the importance of NF-κB pathway in cancer cells, we decided to use a human breast cancer cell line MCF-7 to investigate the above hypothesis. 	
   21	
    1.11 Aims of the thesis Aim1: To investigate the role of TDP-43 in NF-κB pathway in cancer cells. Aim2: To understand the mechanism of TDP-43 in NF-κB pathway.            	
   22	
    Figure 1.1 schematic structure of RelA (p65) domains and properties.              	
   23	
   CHAPTER 2.	
  MATERIALS AND METHODS  2.1 Cell cultures  One human cell line: human breast cancer (MCF-7) cells, was obtained from the American Type Culture Collection. The cells were maintained in Dulbecco's modified Eagle's medium (DMEM; Sigma Chemical Co., St. Louis, MO) supplemented with 10% fetal bovine serum (FBS) (GIBCO BRL, Grand Island, NY) and 1% antibiotics (Gibco-BRL, Grand Island, NY). Cultures were maintained at 37 °C in a humidified incubator (NuAir, Plymouth, MN) with 5% CO2 and were passaged every 3-4 days.  2.2 Transfection  The plasmids were transfected into the MCF-7 cells using the Polyethylenimine (PEI) transfection system. The cells were plated at 90% confluent and cultured in DMEM containing 10% fetal bovine serum one day before the transfection experiment. Before dilution, PEI needed to vortex for 1 minute. For 6 well plates, 4µg DNA and 16µl PEI were diluted separately in 250µl opti-MEM Reduced Serum Medium (Invitrogen, Carlsbad, CA) per well. After 5 minutes of incubation, the diluted DNA and PEI were combined, mixed gently and stood for 15 minutes at room temperature. After that, 500µl Opti-MEM І Reduced Serum Medium was added to the DNA-PEI mixture and mixed well. Then, the total 1ml of 	
   24	
   the mixture was added into each well of 6-well dishes with cultured cells. After 5 hours of incubation, 1ml of fresh DMEM containing 10% fetal bovine serum was added into wells. The cells were returned to the incubator for an additional 24 hours.  2.3 siRNA preparation and transfection  We used the RNA interference technology to silence human TDP-43 expression. The siRNA was designed as described previously (Fabienne C Fiesel et al. 2010) and targeted the 3’UTR of human TDP-43 mRNA (GenBank accession no. NM_007375). The sequences are as follows: TDP-43 siRNA sense: 5′-CACUACAAUUGAUAUCAAAUU-3′; antisense: 5′-UUUGAUAUCAAUUGUAGUGUU-3′. The negative control siRNA (scrambled-siRNA) (Life Technologies Co.) was used to account for the nonsequence-specific effects. TDP-43 siRNA was suspended in diethyl pyro-carbonate water to the final concentration of 20µM and was transfected using Lipofectamine RNAiMAX reagent (Invitrogen, Carlsbad, CA). Cells were plated in 6-well plates one day before transfection and each well was transfected with 5µl siRNAs and 5µl Lipofectamine RNAiMAX complex. After 5 hours incubation, medium was replaced with 10%FBS/DMEM. The RNA interference effect was detected after 48 hours or 72 hours.    	
   25	
   2.4 Tumor necrosis factor-alpha (TNF-α) stock solution and treatment  Recombinant human TNF-α (R&D systems, Minneapolis, MN) was dissolved in PBS with 0.1% BSA to 100µg/ml. To observe the p65 nuclear transportation, the TNF-α solution was added to the culture medium at 1:10000 to reach a final concentration of 10ng/ml. TNF-α was pre-incubated with cells for 30 minutes at 37°C before furthering the experiments. Control cultures (without TNF-α) were underwent the same medium changes. We used 50ng/ml TNF-α to induce cell death that was reported previously (Lüpertz R et al. 2008). TNF-α was incubated with cells for 24 hours at 37°C and subjected to further experiments. Control cultures were underwent the same amount of media changes. 	
   2.5 Immunocytochemistry  	
   The MCF-7 cells were plated and cultured on poly-D-lysine coated glass coverslips at a density of 5 x 105 cells per well in 12-well plate. After 24 hours of transfection, the cells were treated with TNF-α for 30 minutes. After that, cells were washed with cold PBS (pH 7.4) 3 times and fixed with 4% Paraformaldehyde (PFA; Sigma, Saint Louis, MO) in PBS (pH 7.4) for 15 minutes at room temperature. The cells were rinsed with cold PBS 2 times and permeabilized with PBS containing 0.25% Triton X-100 (Sigma, Saint Louis, MO) for 10 minutes at room temperature and followed by washing with PBS 3 times for 5 minutes. To block the unspecific binding of the antibodies, samples were incubated with 1% Bovine 	
   26	
   serum albumin (BSA; Invitrogen, Carlsbad, CA) in PBST (0.1% Tween 20 in 1x PBS) for 30 minutes at room temperature. Primary antibody against p65 (1:1000; Abcam, Cambridge, MA) was added to the samples and incubated for 1 hour at room temperature. After washing with PBS 5 minutes×3 times, the cells were incubated with anti-rabbit secondary antibody conjugated with Alexa 488 (Invitrogen, Carlsbad, CA) for 1 hour at room temperature followed by wash with PBS 5 minutes×3 times. The coverslips were mounted on glass slides with antifade reagent with DAPI (Invitrogen, Carlsbad, CA). The samples were stored at 4°C in dark. Images were obtained with an Olympus Fluoview FV1000 Confocal scanning microscope.  2.6 Nuclear and Cytoplasmic protein Extraction  NE-PER Nuclear and Cytoplasmic Extraction kit (Pierce, Rockford, IL) was used to extract the nuclear fraction from treated cells. Cells were washed with PBS 3 times and completely air-dried. 200µl ice-cold CER I reagent was added to each well and stood on ice for 10 minutes. The cell lysates were collected into pre-chilled tubes and votexed for 15 seconds. After 5 minutes incubation, 11µl ice-cold CER II was added to each tube. After 5 seconds vortexing, the tubes were incubated on ice for 1 minute. To separate cytoplasmic protein, the tubes were centrifuged for 5 minutes at 14,000×g. The supernatant was transferred to a clean pre-chilled tube. To extract nuclear protein the insoluble pellet was suspended in 100µl ice-cold NER reagent and votexed for 15 seconds for 10 minutes, for a total of 40 minutes. 	
   27	
   After centrifugation for 10 minutes at 14,000×g, the supernatant (nuclear extract) was transferred to a clean pre-chilled tube and stored at -80°C. Protein samples were further analyzed by Western blotting.  2.7 Protein extraction and BCA protein assay  To terminate the treatment and further analysis, cells were washed with cold PBS three times and lysed by 2х sample buffer which containing 62.5mM Tris-HCl (pH 6.8), 2% sodium dodecyl sulfate (SDS), 25% Glycerol, 0.02% (w/v) Bromophenol blue and 5% β-mercaptoethanol. For 6-well plates, each well was added 500µl sample buffer and the plates were placed on ice for 10 minutes. The cell lysate was boiled at 100°C for 8 minutes to denature proteins for further analysis. The protein concentrations were determined by BCA protein assay (Pierce, Rockford, IL). Serial dilutions of bovine serum albumin (BSA) were prepared to generate a standard curve of known protein concentrations including 25µg/ml, 125µg/ml, 250µg/ml, 500µg/ml, 750µg/ml, 1000µg/ml, 1500µg/ml and 2000µg/ml. Following the manufacturer’s instructions, 10µl cell lysates were mixed well with 200µl WR reagents in a 96-well plate and incubated at 37°C for 30 minutes. The protein concentrations were finally analyzed by measuring the absorbance of each sample at the wavelength 560nm using the “uQuant” microplate spectrophotometer (Bio-Tek Instruments, USA).   	
   28	
   2.8 Western immunoblotting  For each sample, 35ug of protein was loaded in 12% SDS-polyacrylamide resolving gels and 5% stacking gels followed by analysis using a Bio-Rad Gel electrophoresis system (Bio-Rad, Hercules, CA). The molecular weight of proteins was determined comparing with PageRulerTM Plus Prestained Protein ladder (Fermentas, CA). Then, proteins were transferred from SDS-PAGE gels to PVDF membranes using the Bio-Rad Wet Transfer System (Bio-Rad, Hercules, CA) running at 100 volts for 90 minutes at 4°C. To activate PVDF membrane, membranes were soaked in methanol for one minute and rinsed with transfer buffer. After transfer, the membrane was blocked in 5% non-fat milk in TBST (Tris buffered saline tween 20) for 1 hour at room temperature. Then, the membrane was stained by primary antibody dissolved in 3% BSA-TBST (Sigma, Saint Louis, MO) at 4°C overnight. The primary antibodies used included: Rabbit polyclonal NFkB p65 antibody (1:2000; Abcam, Cambridge, MA); Rabbit polyclonal Lamin B1 antibody (1:1000; Abcam, Cambridge, MA); Rabbit polyclonal TARDBP antibody (1:1000; ProteinTech, Chicago, IL); Rabbit polyclonal KPNA4 antibody (1:1000; Novus, Littleton, CO); Rabbit monoclonal IKB alpha antibody (1:2000; Abcam, Cambridge, MA); Mouse monoclonal IKB alpha (phospho S32 + S36) antibody (1:500; Abcam, Cambridge, MA); Rabbit polyclonal Histone H3 antibody (1:1000, Cell Signaling, Danvers, MA) and rabbit polyclonal Actin antibody (1:1000, Cell Signaling, Danvers, MA). Membranes were washed three times in TBST for 10 minutes and incubated with HRP-conjugated goat anti- mouse or goat anti- rabbit secondary 	
   29	
   antibody (1:5000, PerkinElmer Life Sciences) for 1 hour. After another three 10 minute washes in TBST, signal images of targeted proteins were acquired	
   using the enhanced chemiluminescence reaction assay (ECL, PerkinElmer Life Sciences). Calculation of protein intensity and normalization with actin (or other internal controls) were done using Image J software (NIH).  2.9 Luciferase assay  NF-kB-luciferase reporter construct (consensus NF-kB binding sequence) was generous gift provided by Dr. Song (University of British Columbia, B.C.). Transfections were performed using the Lipofectamine 2000 system (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. Briefly, cells were plated in 6-well plate and cultured in DMEM containing 10% FBS one-day prior to the transfection experiment. The cells were transfected with wild type TDP-43+ NF-kB-luciferase reporter or mcherry+ NF-kB-luciferase reporter at 1:1 ratio. After 24 hours transfection, cells were stimulated with 10ng/ml TNF-α for 30 minutes. After two times washing with DMEM, the cells were cultured in the medium with 10% FBS. One day after, the cells were removed from culture medium and washed twice with cold PBS, then lysed in 200ul 1× lysis reagent provided in the luciferase kit (Promega, Madison, WI). The cell lysate was transferred to a pre-chilled microcentrifuge tube followed by a brief centrifugation. 20ul cell lysate was mixed with 100ul of luciferase assay reagent and the light products were measured in an assay plate (Coring, NY). All transfections were 	
   30	
   done in triplicate.  2.10 Co-immunoprecipitation  After transfection with wild-type TDP-43 and mcherry plasmids, the cells were cultured for 24 hours and then treated with 10ng/ml TNF-α for 30 minutes. After that, the cells were harvested with gentle lysis buffer (25mM Tris-Hcl, 10mM NaCl, 20mM EDTA, 10mM EGTA, 0.5% Triton-100, 10% Glyceral, 1mM dithiothreitol and protease inhibitor). The cell lysate was treated with ultrasound for three times and centrifuged at max speed at 4 degree for 10 minutes. The supernatant was transferred to a new tube and incubated with 10ul 50% protein A/G magnetic beads (Themo, Rockford, IL) for 1 hour to remove unspecific binding. The supernatant was recollected and incubated with 5ug KPNA4 antibody, then incubated at 4 degree overnight. 50ul 50% protein A/G magnetic beads were added into the cell lysate for 2 hours on the next day. At last, the beads were washed for 3 times with gentle lysis buffer. The proteins were eluted from the beads with 35-50ul 2×lysis buffer and boiled for 3 minutes. The samples were further analyzed by western immunoblotting.  2.11 Construction of TDP-43 ΔNLS plasmid  TDP-43 ΔNLS plasmid was generated to test the involvement of binding competition with the transporter. The site- directed mutations was generated using wild type TDP-43 plasmid 	
   31	
   as template. We changed three amino acids: K82A, R83A, K84A, which are the first three amino acids of the TDP-43 NLS sequence that had confirmed to redistribute to cytoplasm (Winton MJ et al. 2008). The PCR product was subcloned into mcherry-pcDNA3 vector using restriction sites HindIII and BamH1. Primers were listed in Table 1.  2.12 Lactate dehydrogenase (LDH) assay  The Lactate dehydrogenase (LDH) based In Vitro Toxicology Assay Kit (Sigma, Saint Louis, MO) was using to assess the cell death via total cytoplasmic lactate dehydrogenase. The LDH is an enzyme exists in the cytoplasm and it is released in the medium when the cell membrane is compromised. The MCF-7 cells were incubated with TNF-α for 24 hours and the 50ul of culture medium was incubated with 100ul of mixture (LDH Assay Substrate Solution: LDH Assay Cofactor Preparation: LDH Assay Dye Solution; 1:1:1) for 1 hour in the 96-well plate at room temperature according to the manufacturer’s instructions.  The optical density of each sample was quantified by measuring the wavelength absorbance at 490nm and a reference filter of 750nm using the “uQuant” microplate spectrophotometer (Bio-Tek Instruments, USA). The percentage of cell death was quantified by using the formula % cytotoxicity = each sample-LDH release (OD490 – OD750)/ maximum LDH release (OD490 – OD750). The maximum LDH release was measured from a well treating with 0.3% Triton X-100 for 5 minutes which represented the 100% cell death for the same number of cells. 	
   32	
    2.13 Statistical analysis  All data are expressed as mean ± standard error mean (S.E.M). Student’s t test was used to test statistical significance of the differences in two groups and one-way ANOVA was used to analyze the statistical significance of the differences among three or more groups of data. Statistical significance was considered as p < 0.05. For all experiments, data was obtained from at least 3 times of independent cultures. 	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
         	
   33	
   CHAPTER 3.	
  RESULTS  3.1 NF-κB translocate into nuclear after TNF-α treatment in MCF-7 cells  MCF-7 cells were treated with 10ng/ml TNF-α for 30 minutes and then preceded to the ICC procedure. The intracellular p65 normally stayed in the cytoplasm (Figure 3.1 top row, Green), but translocated into the nucleus after TNF-α treatment (Figure 3.1 bottom row, Green). This confirmed that endogenous p65 could be activated by TNF-α in MCF-7 cells. The results were observed in 3 independent experiments.  3.2 TDP-43 overexpression blocked NF-κB nuclear translocation in a dose dependent manner  Cells were transfected with different doses of wild type TDP-43 tagged with mcherry (50ng, 100ng, 500ng, 1µg and 2µg) (Figure 3.2 A, Red). Twenty-four hours after the transfection, the cells were treated with TNF-α for 30 minutes. At the low dose transfection (50ng and 100ng), the nuclear translocation of p65 was still seen in some cells after the treatment and the p65 and TDP-43 were co-localized in the nucleus (Figure 3.2A). However, the translocation of p65 was significantly blocked in cells transfected with higher doses (500ng, 1µg and 2µg). In cells expressing high level of exogenous TDP-43, p65 was totally prevented from transporting into the nucleus. Based on my previous experience with DAPI 	
   34	
   counter-staining, it was apparent that TDP-43 was localized in the nucleus. This experiment was repeated over 3 times. To rule out the possibility that the tag of the wild type TDP-43 (mcherry) or the vector (pcDNA3) might affect p65 translocation, cells were also transfected with a plasmid pcDNA3-mcherry as a control (Figure 3.2 B). Apparently, mcherry (Left two Columns, Red) did not affect p65 intercellular localization in cells with or without TNF-α treatment.  To quantitatively confirm that p65 nuclear translocation was inhibited by overexpressing TDP-43 by immunofluorescence images, nuclear proteins were extracted and p65 proteins were quantified by western blotting (Figure 3.2C). After 30 minutes TNF-α treatment, nuclear p65 protein level was dramatically increased compared to untreated cells. In the cells transfected with wild-type TDP-43, the TNF-α induced increase of nuclear p65 protein was significantly less than the controls. Histone H3 was used as a marker for nuclear proteins. Figure 2.4 is the average of the results from 3 individual experiments.  3.3 Overexpression of TDP-43 inhibits p65 transactivation activity after TNF-α treatment  To further confirm that inhibition in p65 nuclear translocation by TDP-43 overexpression was associated with reduced activity of p65 induced transactivation. We used a construct containing a luciferase reporter gene driven by a NF-κB response element (κB site). The 	
   35	
   results showed that luciferase activity in cells co-transfected with both reporter gene construct and the TDP-43 was lower than that of the controls, indicating that overexpression TDP-43 in those cells indeed suppressed TNF-α induced transactivation activity of NF-κB (Figure 3.3), which was in consistent with the results of p65 nuclear translocation. The data were expressed as mean ± standard error mean (S.E.M) from three independent experiments.  3.4 Knockdown of endogenous TDP-43 increases the nuclear p65 protein level after TNF-α treatment  Since overexpressing TDP-43 inhibits p65 nuclear translocation, I speculated that absence of TDP-43 might have the opposite effect. To test this hypothesis, we used short interference RNA (siRNA) to suppress endogenous TDP-43 expression by targeting the 3’UTR region of human TDP-43 mRNA. The control group was transfected with a scramble siRNA (Figure 3.4A). The TDP-43 protein level of the knockdown group was dramatically decreased comparing to the control group. Knockdown TDP-43 did not affect subcellular distribution of p65 under resting condition. However, nuclear p65 protein level was higher than that of the control cells after TNF-α stimulation (Figure 3.4B and C). This suggested TDP-43 exists as an inhibitor for p65 nuclear transportation.    	
   36	
   3.5 Overexpression of TDP-43 accelerates IκB degradation  Inhibitor of NF-κB (IκB), is phosphorylated by IκB kinase (IKK) and degraded by proteasome rapidly after TNF-α stimulation, which releases p65 to translocate into the nucleus. A common mechanism of p65 inhibition is by inhibition of IκB phosphorylation and degradation (Bonizzi G et al. 2004). To ask whether this is the case in TDP-43 overexpression caused NF-κB inhibition, IκB levels were measured. Cells were transfected with TDP-43 expressing plasmid or mcherry (as the control) followed by treatment with 10ng/ml TNF-α. Levels of IκB were measured after 30 minutes with TNF-α treatment by western blots using an antibody recognizing both phosphorylated and total IκB. The IκB protein level was dramatically decreased by 30 minutes after TNF-α treatment (Figure 3.5A) and no difference was seen between the two groups. However, when we looked at the very early time points (0 to 5 minutes) after TNF-α treatment, cells overexpressing TDP-43 showed much less IκB than the control group, (Figure 3.5B). Interestingly, overexpression of TDP-43 had no effect on IκB level in cells without TNF-α treatment. Therefore, it is clear that overexpression of TDP-43 caused increased rate of degradation of IκB upon stimulation by TNF-α. This results, while rather surprising, indicate that reduced translocation of p65 by overexpressing TDP-43 was not by inhibition of IκB degradation to maintain the p65/IκB complex in the cytoplasm.   	
   37	
   3.6 Overexpressing TDP-43 inhibits NF-κB activity by competing the nuclear transporter  The next possible mechanism for inhibition of NF-κB activity by overexpressed TDP-43 is that TDP-43 may directly block the nuclear translocation of p65. Previous studies have revealed that NF-κB was transported into nucleus by importin α3 (KPNA4) (Fagerlund et al. 2005). Normally NF-κB located in the cytoplasm in an inactive form and the NLS of p65 was masked by IκB. Upon stimulation, IκB is degraded and the NLS in p65 is exposed that allows its binding to importin α3 (KPNA4) and its nuclear translocation. Since TDP-43 also contains a NLS and is known for its nuclear translocation by the classic nuclear transportation system that is the same as that for NF-κB (Nishimura AL et al. 2010), we speculated that TDP-43 might compete with NF-κB for the same transporter that causes inhibition of p65 nuclear translocation. To test whether TDP-43 could affect p65- importin α3 (KPNA4) interaction, we used co-immunoprecipitation to measure association of p65 and importin α3 (KPNA4). Cell extracts were prepared from cultured MCF-7 cells and the proteins in the cell extracts were incubated with KPNA4 antibody attached to protein A/G magnetic beads. Proteins bound to the beads were analyzed by Western blotting for the presence of p65 and TDP-43. As shown in Figure 3.6, without the stimulation, TDP-43 but not p65 was strongly associated with KPNA4. Upon TNF-α treatment, p65 drastically increased its association with KPNA4 in control cells. However, when TDP-43 was overexpressed in the cells, the amount of p65 associated with KPNA4 was significantly reduced and the same as TDP-43. Thus, these 	
   38	
   results suggest that TDP-43 may compete with p65 for the binding to KPNA4 nuclear transporter to reduce the nuclear presence of p65 resulting in inhibiting NF-κB activity upon stimulation of TNF-α.  3.7 The blockade of NF-κB nuclear translocation by TDP-43 can be prevented by overexpression of p65  To verify whether the inhibition by TDP-43 for p65 binding to KPNA4 nuclear transporter is indeed a simple competition. We co-transfected cells with plasmids expressing TDP-43 and p65. Cells were transfected with 1µg TDP-43 and a control plasmid or with 1µg TDP-43 and 1µg p65 expressing plasmid. 24 hours after transfection, cells were treated with 10ng/ml TNF-α for 30 minutes, then fixed and probed with p65 antibody. As shown in Fig.3.7, p65 was totally present in the nucleus in p65 and TDP-43 co-transfected cells. This phenomenon was observed in 3 independent experiments.  3.8 The NLS mutated TDP-43 does not affect p65 nuclear translocation  Finally, we want to confirm that the NLS contained in TDP-43 was responsible for the competition between TDP-43 and p65 for nuclear transportation. For that, we mutated three amino acids in the TDP-43 NLS sequence that will abolish the ability of TDP-43 binding to KPNA4. We transfected the NLS mutated TDP-43 plasmid followed by stimulation with 	
   39	
   TNF-α (Figure 3.8). As expected, the NLS mutated TDP-43 stayed in the cytoplasm. More importantly, nuclear translocation of p65 upon stimulation was not affected by overexpression of mutant TDP-43 at all. These results clearly demonstrated that the NLS sequence of TDP-43 is critical for its ability to compete with p65 for nuclear transportation.  3.9 overexpression of TDP-43 sensitizes MCF-7 cells to TNF-α induced cytotoxicity  TNF-α could trigger both survival pathways like NF-κB pathway and apoptosis pathways. The choice between cell death and survival upon TNF-α stimulation has been found in a dose dependent manner (Tang X et al. 2013). Indeed, NF-κB has been reported to activate survival pathway in response to TNF-α induced apoptosis (Geisler F et al. 2007). Since we found that TDP-43 overexpression could inhibit NF-κB activation, we expect that the TNF-α induced cell death would be enhanced by overexpressing TDP-43. MCF-7 cells were incubated with 50ng/ml TNF-α resulted in 35.34±1.76% of total cell death at 24 hours (Figure 3.9). As we expected, the cell death increased to 46.98±3.42% after TNF-α treatment in TDP-43 overexpression group that was significantly higher than the control group (p<0.05). Therefore, overexpression TDP-43 enhanced TNF-α induced cell death in MCF-7 cells.    	
   40	
   CHAPTER 4. CONCLUSION DISCUSSION AND FUTURE WORK  4.1 Summary of our results  1. In MCF-7 cells, NF-κB translocated into nuclear after TNF-α treatment. 2. TDP-43 overexpression blocked NF-κB nuclear translocation in a dose dependent manner demonstrated by both immunofluorescence and western blots. The blockade could be abolished by co-expression of p65. 3. The luciferase reporter assay proved that	
  TDP-43 overexpression inhibits TNF-α induced NF-κB transactivation activity. 4. At normal condition, TDP-43 constantly suppresses p65 translocation since knockdown endogenous TDP-43 caused increased p65 nuclear localization after treatment with TNF-α. 5. Overexpression of TDP-43 may accelerate IκB degradation after treatment with TNF-α with an unknown mechanism. 6. Overexpressing TDP-43 reduced association of p65 with the nuclear transporter-KPNA4. 7 Overexpression of a TDP-43 with mutated NLS abolished its effect on p65 nuclear translocation. 8. Overexprssion of TDP-43 enhanced TNF-α induced cytotoxicity in MCF-7 cells.   	
   41	
   4.2 Discussion and future works  In this study, we used multiple approaches to demonstrate that TDP-43 influences p65 nuclear translocation through binding to the transporter importin α3 binding site, which might be a new factor regulating the canonical NF-κB pathway and might have significant effect on gene transcription. First we confirmed that TNF-α activated NF-κB signaling is associated with the nuclear translocation of p65 protein via immunocytochemistry (ICC) method, which is consistent with many reports by other groups (Matsumoto G et al. 2005; Lüpertz R et al. 2008; Yoon H et al. 2008).  We observed that p65 failed to translocate into the nucleus in TDP-43 overexpressing cells in a dose dependent manner. This dose-dependency is shown by the presence of co-localized nuclear p65 and exogenous TDP-43 in cells transfected with less amount of plasmid DNA but not seen when the amount of TDP-43 plasmid was increased to 2uM where no p65 was seen in the nuclei of TDP-43 overexpressing cells. The reduced nuclear presence of p65 by overexpression of TDP-43 can be confirmed by quantitative measurement of western blotting on the nuclear fraction of treated cells. We also confirmed that the inhibition in p65 nuclear translocation by TDP-43 overexpression was associated with reduced activity of transactivation by NF-κB reporter assay. We have also concluded that the blockade of p65 nuclear translocation by overexpressing TDP-43 is attributed to the binding of TDP-43 to nuclear transporter importin a3 through its NLS. This is supported by the following evidence: 	
   42	
   1) Overexpression of TDP-43 does not inhibit but accelerate the degradation of IκB; 2) Association of p65 with its nuclear transporter importin a3 was reduced in the presence of overexpressed TDP-43 by co-immunoprecipitation assay; 3) the inhibition of p65 nuclear translocation by overexpressed TDP-43 can be completely removed by simultaneous overexpression of p65; 4) A mutant TDP-43 that lacks NLS was completely unable to inhibit p65 nuclear translocation.  A possible explanation for lack of nuclear p65 in TDP-43 overexpressing cells is because that the antibody we used could not recognize the p65 in the nuclei as overexpressed nuclear TDP-43 may mask the antibody epitopes to block its recognition. However, this is an unlikely possibility since western blots, where the proteins are denatured, showed reduced nuclear p65 (Figure 2.2C). In addition, the luciferase activity (Figure 2.3) of the transactivation assay was also reduced. Finally, when we silenced the endogenous TDP-43, the nuclear p65 protein level was increased.  It is interesting that overexpression of TDP-43 caused accelerated IκB degradation shortly after TNF-a stimulation but not in the unstimulated cells. It is not known how TDP-43 does that nor whether this is an artifact due to overexpressed TDP-43. The latter can be verified by comparing the rate of IκB degradation upon TNF-α stimulation in cells with or without reduced endogenous TDP-43 by siRNA knockdown. Interestingly, overexpression of TDP-43 does not change the level of IκB in unstimulated cells. This suggests that overexpressed 	
   43	
   TDP-43 only selectively accelerate the degradation of phosphorylated IκB. This does not exclude the possibility that TDP-43 could activate upstream kinases of IκBα, such as RIP, NEMO and IKKβ, to promote the phosphorylation of IκBα. As a stress related protein (Vaccaro A et al. 2012), TDP-43 could also promote degradation of IκBα through increased ER stress, since ER stress was found to activate NF-κB through increasing basal IKK kinase activity (Tam AB et al. 2012).  Since both subunits of p50 and p65 contain the NLS sequence (Fagerlund et al. 2005), and only the NLS in p65 is masked by IκBα, it is proposed that the p50/p65/IκBα complex is continuously shuttled between the nucleus and cytoplasm in unstimulated condition (Huang T. T. et al. 2000). Since it is not clear whether nuclear translocation of the inactivated NF-κB complex is also dependent on importin α3, we don’t know whether TDP-43 can also affect the transportation of the NF-κB complex in the resting status.  It is worth pointing out that there is a large amount of TDP-43 associated with importin α3 in unstimulated cells shown by co-immunoprecipitation. Considering that the most of TDP-43 is nuclear localized, there is a possibility that TDP-43 may bind to nuclearly located importin α. Unlike overexpression of TDP-43 for p65, overexpression of p65 did not change the nuclear localization of endogenous TDP-43 albeit more nuclear localized p65 was evident. Therefore, it seems that the binding to importin α3 by TDP-43 may only affect the activity of NF-κB but not vice versa. An obvious explanation is that TDP-43 is transported by multiple nuclear 	
   44	
   transporters while importin α3 is the major one for NF-κB. GST pull down experiment has revealed that TDP-43 can bind to importin α1, importin α3, importin α4, importin α5, importin α7 and importin β (Nishimura AL et al. 2010).  Taking together, we can propose two hypothetic modes to explain how TDP-43 blocks p65 nuclear translocation. The first possible mode (cytoplasmic mode) is that TDP-43 competes with p65 for importin α3 in the cytoplasm, which reduces the efficiency of p65 nuclear transportation. The second mode (nuclear mode) is that TDP-43 binds to nuclear importin α3 and retains the transporter in the nucleus, which reduced the concentration of importin α3 in the cytoplasm resulting in less p65 nuclear translocation. We will verify the two modes in our further studies.  It is important to note that p65 level was increased in the nuclei upon TNF-α stimulation when we knockdown the endogenous TDP-43 by a siRNA. This suggests that TDP-43 may constantly inhibit p65 nuclear translocation and therefore, it may act as a negative regulator on NF-κB transactivation activity. These findings are important in cancer and neurodegenerative diseases. Up-regulation of TDP-43 could be a therapeutic strategy for a wide range of human cancers in which NF-κB is constitutively activated and is related to various oncogenic phenotype, such as angiogenesis, tumor cell survival, cancer invasion and inflammation in tumor microenvironment. Inflammation is also a hallmark of various neurodegenerative disorders such as Alzheimer’s disease, Huntington's disease and Parkinson's disease (Dauer W and Przedborski S 2003; Kaltschmidt B and Kaltschmidt C 2009). NF-κB activation mediates over hundreds of genes in inflammation and immunity in 	
   45	
   microglia cells. Thus, NF-κB is also a therapeutic target for treating neuroinflammatory diseases. Our finding that TDP-43 constitutively inhibits NF-κB pathway by blocking nuclear transportation of p65 suggests a novel and important role of TDP-43 in inflammatory response in neurodegenerative diseases.                  	
   46	
   Table 1 List of primer for site-directed mutations Forward   GCAGCAGCAATGGATGAGACAGATGCTTCATCA Reverse    TGCTGCTGCGTTATCTTTTGGATAGTTGACAAC            	
   47	
     Figure 3.1	
  NF-κB translocate into nuclear after TNF-α treatment in MCF-7 cells. After 30 minutes 10ng/ml TNF-α treatment p65 is translocated into the nuclei n=3 repeats.    	
   48	
    	
   	
   A	
   	
   49	
   	
  	
     Figure 3.2 TDP-43 overexpression blocked NF-κB nuclear translocation in a dose dependent manner. A. MCF-7 cells were transfected with various dose (indicated on the right) of TDP-43 with a mcherry tag (middle panel, red) and were treated with 10ng/ml TNF-α for 30 minutes. On the 	
   50	
   up right corner, insets of higher magnification show localization of p65 and nuclear TDP-43 staining. n≥ 3 independent experiments. B. MCF-7 cells were transfected with the pcDNA3-mcherry plasmids and with or without TNF-α treatment. n≥ 3 independent experiments. C. Cells were transfected with TDP-43 or mcherry (control) and treated with 10ng/ml TNF-α for 30 minutes. Nuclear proteins were isolated and detected by western immunoblotting. Histone H3 was used as nucleus marker. The relative density was averaged by 3 individual experiments.            	
   51	
    Figure 3.3 Overexpression of TDP-43 inhibits p65 transactivation activity after TNF-α treatment TDP-43 or pcDNA3-mcherry (control) was cotransfected along with NF-κB-luc (containing wild type NF-κB-binding site). Cells were treated with 10ng/ml TNF-α for 30 minutes. Luciferase activity was measured after 24 hours. The plotted error bar represent mean±SEM from 3 independent experiments; *p < 0.05 compared to control, one-way ANOVA. ** p < 0.05 compared to the TNF-α treated control samples, Student's t test.      	
   52	
     Figure 3.4 Knockdown of endogenous TDP-43 increases the nuclear p65 protein level after TNF-α treatment A. Location of targeted siRNA within the TDP-43 mRNA. B. MCF-7 cells were transfected with TDP-43 siRNA or scramble siRNA, treated with 10ng/ml TNF-α for 30 minutes. Nuclear proteins were analyzed by western blot and detected with antibodies against TDP-43, p65 and Lumin B1 as indicated. Lumin B1 was used as nucleus marker. n=3 independent experiments. C. The relative density of p65 as showed in B. *p < 0.05 compared to control, one-way ANOVA, ** p < 0.05. 	
   53	
     Figure 3.5 Overexpression of TDP-43 accelerates IκB degradation. Cells were transfected with wild type TDP-43 or mcherry (control) and were treated with 10ng/ml TNF-α for the indicated time points. The total proteins were extracted for Western blot analysis using antibodies as indicated. n = 3 independent cultures; A. 30 min after TNF-α treatment, the degradation of IκB happened in both control group and TDP-43 overexpression group. B. Overexpression of TDP-43 facilitates the degradation of IκB in 5 minutes after TNF-α treatment.   	
   	
   54	
    Figure 3.6 Overexpressing TDP-43 inhibits NF-κB activity by competing the nuclear transporter. A. Cells were transfected with wild type TDP-43 (tagged with mcherry) or mcherry (control) and then were treated with 10ng/ml TNF-α for 30 minutes. Cell lysates were subjected to coimmunoprecipitation and western blot for the presence of p65 and TDP-43. 10% cell lysate were reserved as input. p65, TDP-43 and KPNA4 was used to detect input. n=3 repeats. B. The relative density of p65 as showed in A (IP), *p<0.05. C. The relative density of wild type TDP-43 as showed in A (IP), *p<0.05.       	
   55	
     Figure 3.7 The blockade of NF-κB nuclear translocation by TDP-43 can be prevented by overexpression of p65. MCF-7 cells were transfected with wild type TDP-43 (top row) alone or cotransfected with TDP-43 and p65 plasmids (bottom row). After 30 minutes TNF-α treatment, p65 was found co-localized with TDP-43 in the nuclei.      	
   56	
     Figure 3.8 The NLS mutated TDP-43 does not affect p65 nuclear translocation. MCF-7 cells were transfected with TDP-43 ΔNLS (middle panel, Red). After 30 minutes TNF-α treatment, labeled p65 (Left panel, Green) was found in the nuclei. n=3 independent experiments.         	
   57	
     Figure 3.9 overexpression of TDP-43 sensitizes MCF-7 cells to TNF-α induced cytotoxicity. MCF-7 cells were transfected with mcherry (control) or wild type TDP-43. Cell death was assessed 24 hours after 50ng/ml TNF-α treatment as indicated. The means ± SEMs are plotted, *p < 0.05 with respect to control, one-way ANOVA. **p < 0.05, Student’s t test. n=3 repeats.     	
  	
  	
  	
  	
  	
   	
   58	
   BIBLIOGRAPHY  Acharya KK et al. 2006. cis-requirement for the maintenance of round spermatid-specific transcription. Dev Biol. 295(2):781-90. Albanese C et al. 2003. IKKalpha regulates mitogenic signaling through transcriptional induction of cyclin D1 via Tcf. Mol Biol Cell. 14(2):585-99. Albensi BC et al. 2000. Evidence for the involvement of TNF and NF-kappaB in hippocampal synaptic plasticity. Synapse. 35(2):151-9. Alvarez SE et al. 2010, Sphingosine-1-phosphate is a missing cofactor for the E3 ubiquitin ligase TRAF2. Nature. 465(7301): 1084-8. Anrather J et al. 2005, cis-acting, element-specific transcriptional activity of differentially phosphorylated nuclear factor-kappa B. J Biol Chem. 280(1):244-52. Arai T et al. 2006. TDP-43 is a component of ubiquitin-positive tau-negative inclusions in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Biochem Biophys Res Commun. 351(3):602-11. Aratani S et al. 2006. The nuclear import of RNA helicase A is mediated by importin-alpha3. Biochem Biophys Res Commun 340:125-33. Ardizzoia A et al. 1992. Tumor necrosis factor in solid tumors: increased blood levels in the metastatic disease. J Biol Reg Hom Agentes 6:103–107 Asano T et al. 2004. The PI 3-kinase/Akt signaling pathway is activated due to aberrant Pten expression and targets transcription factors NF-kappaB and c-Myc in pancreatic cancer 	
   59	
   cells. Oncogene. 23(53):8571-80. Ayala YM et al. 2008. TDP-43 regulates retinoblastoma protein phosphorylation through the repression of cyclin-dependent kinase 6 expression. Proc Natl Acad Sci U S A. 105(10):3785-9. B. Gerlach et al. 2011. Linear ubiquitination prevents inflammation and regulates immune signaling. Nature, 471 pp. 591–596 Baldwin AS 2001. Control of oncogenesis and cancer therapy resistance by the transcription factor NF-kappaB. J Clin Invest. 107(3):241-6. Baldwin AS 1996, The NF-kappa B and I kappa B proteins: new discoveries and insights. Annu Rev Immunol. 14:649-83. Barger, SW, et al. 1995. Tumor necrosis factors α and β protect neurons against amyloid β-peptide toxicity: evidence for involvement of a κB-binding factor and attenuation of peroxide and Ca2+ accumulation. Proc Natl Acad Sci USA 92:9328-9332. Bassères and Baldwin 2006. Nuclear factor-kappaB and inhibitor of kappaB kinase pathways in oncogenic initiation and progression. Oncogene. 25(51):6817-30. Baud and Karin 2009. Is NF-kappaB a good target for cancer therapy? Hopes and pitfalls. Nat Rev Drug Discov. 8(1):33-40. Beg AA et al. 1995. Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-kappaB. Nature 376:167–170 Beg and Baltimore. 1996. An essential role for NF-kappaB in preventing TNF-alpha-induced cell death. Science. 274(5288):782-4. 	
   60	
   Benayoun B et al. 2008. NF-kappaB-dependent expression of the antiapoptotic factor c-FLIP is regulated by calpain 3, the protein involved in limb-girdle muscular dystrophy type 2A. FASEB J. 22(5):1521-9. Betts, J. C., and G. J. Nabel. 1996. Differential regulation of NF-kappaB2 (p100) processing and control by amino-terminal sequences. Mol Cell Biol 16:6363-71. Bonizzi G et al. 2004. The two NF-kappaB activation pathways and their role in innate and adaptive immunity. Trends Immunol. 25(6):280-8. Bose JK et al. 2008. TDP-43 overexpression enhances exon 7 inclusion during the survival of motor neuron pre-mRNA splicing. J Biol Chem. 283(43):28852-9. Braun RJ et al. 2011. Neurotoxic 43-kDa TAR DNA-binding protein (TDP-43) triggers mitochondrion-dependent programmed cell death in yeast. J Biol Chem. 286(22):19958-72. Brandmeir NJ et al. 2008. Severe subcortical TDP-43 pathology in sporadic frontotemporal lobar degeneration with motor neuron disease. Acta Neuropathol. 115, 123–131. Brenner D et al. 2008. Concepts of activated T cell death. Crit Rev Oncol Hematol. 66(1):52-64. Buratti E et al. 2001. Nuclear factor TDP-43 and SR proteins promote in vitro and in vivo CFTR exon 9 skipping. EMBO J. 20(7):1774-84. Buratti E et al. 2005. TDP-43 binds heterogeneous nuclear ribonucleoprotein A/B through its C-terminal tail: an important region for the inhibition of cystic fibrosis transmembrane conductance regulator exon 9 splicing. J Biol Chem. 280(45):37572-84. 	
   61	
   Buratti E and Baralle FE 2008. Multiple roles of TDP-43 in gene expression, splicing regulation, and human disease. Front Biosci. 13:867-78. Caamaño JH et al. 1996. Constitutive expression of Bc1-3 in thymocytes increases the DNA binding of NF-kappaB1 (p50) homodimers in vivo. Mol Cell Biol.16(4):1342-8. Cairns NJ et al. 2007. TDP-43 in familial and sporadic frontotemporal lobar degeneration with ubiquitin inclusions. Am J Pathol. 171(1):227-40. Catz SD and Johnson JL 2001. Transcriptional regulation of bcl-2 by nuclear factor kappa B and its significance in prostate cancer. Oncogene. 20(50):7342-51. Campbell IK et al. 2000. Distinct roles for the NF-kappaB1 (p50) and c-Rel transcription factors in inflammatory arthritis. J Clin Invest. 105(12):1799-806. Cao Y et al. 2001. IKKalpha provides an essential link between RANK signaling and cyclin D1 expression during mammary gland development. Cell. 107(6):763-75. Chen, Z. J. 2005. Ubiquitin signalling in the NF-kappaB pathway. Nat Cell Biol 7:758-65. Chu WM 2013. Tumor necrosis factor. Cancer Lett. 328(2):222-5. Cogswell PC et al. 2000. Selective activation of NF-kappa B subunits in human breast cancer: potential roles for NF-kappa B2/p52 and for Bcl-3. Oncogene. 19(9):1123-31. Dauer W and Przedborski S 2003. Parkinson's disease: mechanisms and models. Neuron. 39(6):889-909. Davidson Y et al. 2007. Ubiquitinated pathological lesions in frontotemporal lobar degeneration contain the TAR DNA-binding protein, TDP-43. Acta Neuropathol. 113, 521–533. 	
   62	
   Dejardin E et al. 2002. The lymphotoxin-beta receptor induces different patterns of gene expression via two NF-kappaB pathways. Immunity. 17(4):525-35. Dickson DW et al. 2007. TDP-43 in differential diagnosis of motor neuron disorders. Acta Neuropathol. 114, 71–79. Dreumont N et al. 2010. Antagonistic factors control the unproductive splicing of SC35 terminal intron. Nucleic Acids Res. 38(4):1353-66. Erdman S et al. 2001. Typhlocolitis in NF-kappa B-deficient mice. J Immunol. 166(3):1443-7. Fiesel FC et al. 2010, Knockdown of transactive response DNA-binding protein (TDP-43) downregulates histone deacetylase 6. EMBO J. 29 (1): 209–221. Fagerlund R et al. 2005. NF-{kappa}B is transported into the nucleus by importin {alpha}3 and importin {alpha}4. J Biol Chem. 280(16):15942-51. Fan, C. M., and T. Maniatis. 1991. Generation of p50 subunit of NF-kappa B by processing of p105 through an ATP-dependent pathway. Nature 354:395-8. Feuillard J et al. 2000. Inducible loss of NF-kappaB activity is associated with apoptosis and Bcl-2 down-regulation in Epstein-Barr virus-transformed B lymphocytes. Blood. 95(6):2068-75. Feng Z and Porter AG 1999. NF-kappaB/Rel proteins are required for neuronal differentiation of SH-SY5Y neuroblastoma cells. J Biol Chem. 274(43):30341-4. Freyschmidt EJ et al. 2007. Skin inflammation in RelB(-/-) mice leads to defective immunity and impaired clearance of vaccinia virus. J Allergy Clin Immunol. 119(3):671-9. Fujiwara Y et al. 2013. Inhibition of nuclear factor kappa-B enhances the antitumor effect of 	
   63	
   combination treatment with tumor necrosis factor-alpha gene therapy and gemcitabine for pancreatic cancer in mice. J Am Coll Surg. 216(2):320-32.e3. Gao FB and	
   Taylor JP 2012. RNA-binding proteins in neurological disease. Brain Res. 1462:1-2. Gaur U and Aggarwal BB 2003. Regulation of proliferation, survival and apoptosis by members of the TNF superfamily. Biochem Pharmacol. 66(8):1403-8. Geisler F et al. 2007. Genetic inactivation of RelA/p65 sensitizes adult mouse hepatocytes to TNF-induced apoptosis in vivo and in vitro. Gastroenterology. 132(7):2489-503. Gerondakis S et al. 1999. Genetic approaches in mice to understand Rel/NF-kappaB and IkappaB function: transgenics and knockouts. Oncogene. 18(49):6888-95. Ghosh G et al. 1995. Structure of NF-kappa B p50 homodimer bound to a kappa B site. Nature. 373 (6512): 303-10. Ghosh S et al. 1998. NF-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu Rev Immunol. 16:225-60. Gilmore TD 1999. Multiple mutations contribute to the oncogenicity of the retroviral oncoprotein v-Rel. Oncogene. 18(49):6925-37. Gilmore T. D. 2006. Introduction to NFkB: players, pathways, perspectives. Oncogene. 25, 6680-6684. Giordana MT et al. 2010. TDP-43 redistribution is an early event in sporadic amyotrophic lateral sclerosis. Brain Pathol. 20, 351–360. Goldfarb DS et al. 1986. Synthetic peptides as nuclear localization signals. Nature. 	
   64	
   14-20;322(6080):641-4. Greten FR et al. 2004. IKKbeta links inflammation and tumorigenesis in a mouse model of colitis-associated cancer. Cell. 118(3):285-96. Hasegawa M et al. 2008. Significance of the TDP-43 deposition in FTLD-U and ALS. Rinsho Shinkeigaku. 48(11):994-7. Hayden MS, Ghosh S 2004. Signaling to NF-kappaB. Genes Dev. 18(18):2195-224. Heckman CA et al. 2002. NF-kappaB activates Bcl-2 expression in t(14;18) lymphoma cells. Oncogene. 21(24):3898-908. Herman AM et al. 2011. β-amyloid triggers ALS-associated TDP-43 pathology in AD models. Brain Res. 1386:191-9. Hinz M et al. 2001. Constitutive NF-kappaB maintains high expression of a characteristic gene network, including CD40, CD86, and a set of antiapoptotic genes in Hodgkin/Reed-Sternberg cells. Blood. 97(9):2798-807. Hockenbery D et al. 1990. Bcl-2 is an inner mitochondrial membrane protein that blocks programmed cell death. Nature. 348(6299):334-6. Hoffmann A et al. 2002, The IkappaB-NF-kappaB signaling module: temporal control and selective gene activation. Science. 298(5596):1241-5. Hoffmann A at al. 2006. Transcriptional regulation via the NF-kappaB signaling module. Oncogene. 25(51):6706-16. Holgate ST 2004. Cytokine and anti-cytokine therapy for the treatment of asthma and allergic disease. Cytokine 28:152–157. 	
   65	
   Hu MC et al. 2004. IkappaB kinase promotes tumorigenesis through inhibition of forkhead FOXO3a. Cell. 117(2):225-37. Hu J et al. 2005. Suppression of p65 phosphorylation coincides with inhibition of IkappaBalpha polyubiquitination and degradation. Mol Carcinog. 44(4):274-84. Huang T. T. et al. 2000. A nuclear export signal in the N-terminal regulatory domain of IkappaBalpha controls cytoplasmic localization of inactive NF-kappaB/IkappaBalpha complexes. Proc Natl Acad Sci U S A 97:1014-9. Hwang et al. 2012. Anti-cancer activity of a novel small molecule compound that simultaneously activates p53 and inhibits NF-κB signaling. PLoS One. 7(9):e44259. James MA et al. 2006. Human papillomavirus type 16 E6 activates NF-kappaB, induces cIAP-2 expression, and protects against apoptosis in a PDZ binding motif-dependent manner. J Virol. 80(11):5301-7. Jänicke RU 2009. MCF-7 breast carcinoma cells do not express caspase-3. Breast Cancer Res Treat. 117(1):219-21. Jana D et al. 2012. Role of nuclear factor-κB in female breast cancer: a study in Indian patients. Asian Pac J Cancer Prev. 13(11):5511-5. Jiang Y et al. 2001. Inhibition of anchorage-independent growth and lung metastasis of A549 lung carcinoma cells by IkappaBbeta. Oncogene. 20(18):2254-63. Johnson BS et al. 2009. TDP-43 is intrinsically aggregation-prone and ALS-linked mutations accelerate aggregation and increase toxicity. J. Biol. Chem. 284, 20329-20339 Kadomatsu M et al. 2012. Cordycepin as a sensitizer to tumour necrosis factor 	
   66	
   (TNF)-α-induced apoptosis through eukaryotic translation initiation factor 2α (eIF2α)- and mammalian target of rapamycin complex 1 (mTORC1)-mediated inhibition of nuclear factor (NF)-κB. Clin Exp Immunol. 168(3):325-32. Kaltschmidt B and Kaltschmidt C 2009. NF-kappaB in the nervous system. Cold Spring Harb Perspect Biol. 1(3):a001271. Kang SM et al. 1992. NF-kappa B subunit regulation in nontransformed CD4+ T lymphocytes. Science. 256(5062):1452-6. Kawahara Y and Mieda-Sato A 2012. TDP-43 promotes microRNA biogenesis as a component of the Drosha and Dicer complexes. Proc Natl Acad Sci U S A. 109(9):3347-52. Kishore N et al. 2003. A selective IKK-2 inhibitor blocks NF-kappa B-dependent gene expression in interleukin-1 beta-stimulated synovial fibroblasts. J Biol Chem. 278(35):32861-71. Krecic AM and Swanson MS. 1999. hnRNP complexes: composition, structure, and function. Curr Opin Cell Biol. 11(3):363-71. Kohler M et al. 1997. Cloning of two novel human importin-alpha subunits and analysis of the expression pattern of the importin-alpha protein family. FEBS Lett 417:104-8. Kohler M et al. 1999. Evidence for distinct substrate specificities of importin alpha family members in nuclear protein import. Mol Cell Biol 19:7782-91. Kutay U et al. 1997. Export of importin alpha from the nucleus is mediated by a specific nuclear transport factor. Cell. 90(6):1061-71. 	
   67	
   Lakhani SA et al. 2006. Caspases 3 and 7: key mediators of mitochondrial events of apoptosis. Science. 311(5762):847-51. Lawrence and Gilroy 2007. Chronic inflammation: A failure of resolution? Int J Exp Pathol 88:85–94. Lee K et al. 2012. Overexpression of TDP-43 causes partially p53-dependent G2/M arrest and p53-independent cell death in HeLa cells. Neurosci Lett. 506(2):271-6. Lu ZY et al. 2006. Age-related neural degeneration in nuclear-factor kappaB p50 knockout mice. Neuroscience. 139(3):965-78. Luo JL et al. 2005. IKK/NF-kappaB signaling: balancing life and death--a new approach to cancer therapy. J Clin Invest. 115(10):2625-32. Lüpertz R et al. 2008. Catalase overexpression impairs TNF-alpha induced NF-kappaB activation and sensitizes MCF-7 cells against TNF-alpha. J Cell Biochem. 103(5):1497-511. Ma J and Cao X 2006. Regulation of Stat3 nuclear import by importin alpha5 and importin alpha7 via two different functional sequence elements. Cell Signal 18:1117-26. Mackenzie IR et al. 2007. Pathological TDP-43 distinguishes sporadic amyotrophic lateral sclerosis from amyotrophic lateral sclerosis with SOD1 mutations. Ann Neurol. 61(5):427-34. Malek S et al. 1998. Ikappa Balpha functions through direct contacts with the nuclear localization signals and the DNA binding sequences of NF-kappaB. J Biol Chem. 273(39):25427-35. 	
   68	
   Malek S et al. 2003. X-ray crystal structure of an IkappaBbeta x NF-kappaB p65 homodimer complex. J Biol Chem. 278(25):23094-100. Massoumi R et al. 2006. Cyld inhibits tumor cell proliferation by blocking Bcl-3-dependent NF-kappaB signaling. Cell. 125(4):665-77. Matsumoto G et al. 2005. Targeting of nuclear factor kappaB Pathways by dehydroxymethylepoxyquinomicin, a novel inhibitor of breast carcinomas: antitumor and antiangiogenic potential in vivo. Clin Cancer Res. 11(3):1287-93. Mattaj IW and Englmeier L 1998. Nucleocytoplasmic transport: the soluble phase. Annu Rev Biochem. 67:265-306. Mercado PA et al. 2005. Depletion of TDP 43 overrides the need for exonic and intronic splicing enhancers in the human apoA-II gene. Nucleic Acids Res. 33(18):6000-10. Monaco C et al. 2004. Canonical pathway of nuclear factor κ B activation selectively regulates proinflammatory and prothrombotic responses in human atherosclerosis. Proc Natl Acad Sci U S A 101:5634–5639. Nelson G et al. 2002. Multi-parameter analysis of the kinetics of NF-kappaB signalling and transcription in single living cells. J Cell Sci. 115 ( Pt 6):1137-48. Neri A et al. 1991. B cell lymphoma-associated chromosomal translocation involves candidate oncogene lyt-10, homologous to NF-kappa B p50. Cell. 67(6):1075-87. Neumann, M. et al. 2006. Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science 314: 130-133. Nishimura AL et al. 2010. Nuclear import impairment causes cytoplasmic trans-activation 	
   69	
   response DNA-binding protein accumulation and is associated with frontotemporal lobar degeneration. Brain. 133(Pt 6):1763-71. Niu J et al. 2004. Identification of an autoregulatory feedback pathway involving interleukin-1alpha in induction of constitutive NF-kappaB activation in pancreatic cancer cells. J Biol Chem. 279(16):16452-62. Nolan GP et al. 1991. DNA binding and I kappa B inhibition of the cloned p65 subunit of NF-kappa B, a rel-related polypeptide. Cell. 64(5):961-9. Nonaka T et al. 2009. Truncation and pathogenic mutations facilitate the formation of intracellular aggregates of TDP-43. Hum. Mol. Genet. 18, 3353-3364 Ou SH et al. 1995. Cloning and characterization of a novel cellular protein, TDP-43, that binds to human immunodeficiency virus type 1 TAR DNA sequence motifs. J Virol. 69(6):3584-96. Park KS et al. 2011, TNF-alpha mediated NF-kappaB activation is constantly extended by transglutaminase 2. Front Biosci (Elite Ed). 3:341-54. Perkins, N. D. 2006. Post-translational modifications regulating the activity and function of the nuclear factor kappa B pathway. Oncogene 25:6717-30. Pesiridis GS et al. 2009. Mutations in TDP-43 link glycine-rich domain functions to amyotrophic lateral sclerosis. Hum Mol Genet. 18(R2):R156-62. Pollmacher T et al. 2000. Experimental immunomodulation, sleep, and sleepiness in humans. Ann N Y Acad Sci. 917:488–499. Poynter ME et al. 2002. Rapid activation of nuclear factor-κB in airway epithelium in a 	
   70	
   murine model of allergic airway inflammation. Am J Pathol 160:1325–1334. Qing G et al. 2005, Regulation of NF-kappa B2 p100 processing by its cis-acting domain. J Biol Chem 280:18-27. Rocha S at al. 2005. Regulation of NF-kappaB and p53 through activation of ATR and Chk1 by the ARF tumour suppressor. EMBO J. 24(6):1157-69. Roeber S et al. 2008. TDP-43-negative FTLD-U is a significant new clinico-pathological subtype of FTLD. Acta Neuropathol. 116(2):147-57. Rohn TT 2008. Caspase-cleaved TAR DNA-binding protein-43 is a major pathological finding in Alzheimer's disease. Brain Res 1228:189-198 Sartorius U et al. 2001. Molecular mechanisms of death-receptor-mediated apoptosis. Chembiochem. 2(1):20-9. Sasaki CY et al. 2005. Phosphorylation of RelA/p65 on serine 536 defines an I{kappa}B{alpha}-independent NF-{kappa}B pathway. J Biol Chem. 280(41):34538-47. Senftleben U et al. 2001. Activation by IKKalpha of a second, evolutionary conserved, NF-kappa B signaling pathway. Science. 293(5534):1495-9. Schmitz ML et al. 1995. Transactivation domain 2 (TA2) of p65 NF-kappa B. Similarity to TA1 and phorbol ester-stimulated activity and phosphorylation in intact cells. J Biol Chem. 270(26):15576-84. Scheidereit C et al. 2006. IkB kinase complexes: gateways to NFkB activation and transcription. Oncogene. 25, 6685-6705. Schwab C et al. 2008. Colocalization of transactivation-responsive DNA-binding protein 43 	
   71	
   and huntingtin in inclusions of Huntington disease. J Neuropathol Exp Neurol 67:1159-1165. Schneider-Brachert W et al. 2004. Compartmentalization of TNF receptor 1 signaling: internalized TNF receptosomes as death signaling vesicles. Immunity. 21(3):415-28. Seki T et al. 1997. Cloning of a cDNA encoding a novel importin-alpha homologue, Qip1: discrimination of Qip1 and Rch1 from hSrp1 by their ability to interact with DNA helicase Q1/RecQL. Biochem Biophys Res Commun 234:48-53. Sen R, Baltimore D 1986, Inducibility of kappa immunoglobulin enhancer-binding protein Nf -kappa B by a posttranslational mechanism. Cell. 47(6):921-8. Sen R and Baltimore D 1986, Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell. 46(5):705-16. Seto M et al. 1988. Alternative promoters and exons, somatic mutation and deregulation of the Bcl-2-Ig fusion gene in lymphoma. EMBO J. 7(1):123-31. Shao L et al. 2012. Sensitization of tumor cells to cancer therapy by molecularly targeted inhibition of the inhibitor of nuclear factor κB kinase. Transl Cancer Res. 1(2):100-108. Staal J et al. 2011. Regulation of NF-κB signaling by caspases and MALT1 paracaspase. Cell Res. 21(1):40-54. Staudt LM 2010. Oncogenic activation of NF-kappaB. Cold Spring Harb Perspect Biol. 2(6):a000109. Sun SC. 2011. Non-canonical NF-κB signaling pathway. Cell Res. 21(1):71-85. Suzuki H et al. 2011. TDP-43-induced death is associated with altered regulation of BIM and 	
   72	
   Bcl-xL and attenuated by caspase-mediated TDP-43 cleavage. J Biol Chem. 286(15):13171-83. Swarup V et al. 2011. Deregulation of TDP-43 in amyotrophic lateral sclerosis triggers nuclear factor κB-mediated pathogenic pathways. J Exp Med. 208(12):2429-47. Tak PP and Firestein GS 2001. NF-κB: A key role in inflammatory diseases. J Clin Invest 107:7–11. Tam AB et al. 2012. ER stress activates NF-κB by integrating functions of basal IKK activity, IRE1 and PERK. PLoS One. 2012;7(10):e45078. Tam, W. F. and R. Sen. 2001. IkappaB family members function by different mechanisms. J Biol Chem 276:7701-4. Tang X et al. 2013. Signaling pathways regulating dose-dependent dual effects of TNF-α on primary cultured Schwann cells. Mol Cell Biochem. [Epub ahead of print] Tang G et al. 2001. Blocking caspase-3-mediated proteolysis of IKKbeta suppresses TNF-alpha-induced apoptosis. Mol Cell. 8(5):1005-16. Tejomurtula J et al. 2009. Role of importin alpha8, a new member of the importin alpha family of nuclear transport proteins, in early embryonic development in cattle. Biol Reprod. 81(2):333-42. Tergaonkar V. et al. 2006. NFkB pathway: A good signaling paradigm and therapeutic target. Int J. Biochem. Cell Biol. 38, 1647-1653. Trompouki E et al. 2003. CYLD is a deubiquitinating enzyme that negatively regulates NF-kappaB activation by TNFR family members. Nature. 424(6950):793-6. 	
   73	
   Turner DJ et al. 2007. Bile salts induce resistance to apoptosis through NF-kappaB-mediated XIAP expression. Ann Surg. 245(3):415-25. Tumang JR et al.1998. c-Rel is essential for B lymphocyte survival and cell cycle progression. Eur J Immunol. 28(12):4299-312. Ueda Y and Richmond A. 2006. NF-kappaB activation in melanoma. Pigment Cell Res. 19(2):112-24. Vaccaro A et al. 2012. TDP-1/TDP-43 regulates stress signaling and age-dependent proteotoxicity in Caenorhabditis elegans. PLoS Genet. 8(7):e1002806. Van Antwerp et al. 1996. Suppression of TNF-alpha-induced apoptosis by NF-kappaB. Science. 274(5288):787-9. Vermeulen L et al. 2003, Transcriptional activation of the NF-kappaB p65 subunit by mitogen- and stress-activated protein kinase-1 (MSK1). EMBO J. 22(6):1313-24. Wang Z et al. 2006. Down-regulation of notch-1 inhibits invasion by inactivation of nuclear factor-kappaB, vascular endothelial growth factor, and matrix metalloproteinase-9 in pancreatic cancer cells. Cancer Res. 66(5):2778-84. Wang Y et al. 2012. Clusterin confers resistance to TNF-alpha-induced apoptosis in breast cancer cells through NF-kappaB activation and Bcl-2 overexpression. J Chemother. 24(6):348-57. Wang HY et al. 2004. Structural diversity and functional implications of the eukaryotic TDP gene family. Genomics. 83(1):130-9. White DW et al. 1995. The v-Rel oncoprotein blocks apoptosis and proteolysis of IκBα in 	
   74	
   transformed chicken spleen cells. Oncogene 10:857–868. Wider C and Wszolek ZK 2008. Etiology and pathophysiology of frontotemporal dementia, Parkinson disease and Alzheimer disease: lessons from genetic studies. Neurodegener Dis 5:122-125. Winton MJ et al. 2008. Disturbance of nuclear and cytoplasmic TAR DNA-binding protein (TDP-43) induces disease-like redistribution, sequestration, and aggregate formation. J Biol Chem. 283(19):13302-9. 27. Williams RO et al. 2007. Cytokine inhibitors in rheumatoid arthritis and other autoimmune diseases. Curr Opin Pharmacol 7:412–417. Xiao G et al. 2004, Induction of p100 processing by NF-kappaB inducing kinase involves docking IkappaB kinase alpha (IKKalpha) to p100 and IKKalpha-mediated phosphorylation. J Biol Chem 279:30099-105. Xin L et al. 2006. Dual regulation of soluble tumor necrosis factor-alpha induced activation of human monocytic cells via modulating transmembrane TNF-alpha-mediated 'reverse signaling'. Int J Mol Med. 18(5):885-92. Yoon H et al. 2008. Effect of 2alpha-hydroxyursolic acid on NF-kappaB activation induced by TNF-alpha in human breast cancer MCF-7 cells. J Agric Food Chem. 56(18):8412-7. Zhang T et al. 2011. TDP-43 neurotoxicity and protein aggregation modulated by heat shock factor and insulin/IGF-1 signaling. Hum Mol Genet. 20(10):1952-65. Zhang YJ et al. 2007. Progranulin mediates caspase-dependent cleavage of TAR DNA binding protein-43. J Neurosci. 27(39):10530-4. 	
   75	
   Zhang Y.J. et al. 2009. Aberrant cleavage of TDP-43 enhances aggregation and cellular toxicity. Proc Natl Acad Sci U S A, 21: p. 7607-7612.  	
  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0073733/manifest

Comment

Related Items