UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Regulation of ATP-binding cassette transporter A1 In intimal-type arterial smooth muscle cells Pannu, Parveer Singh 2013

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2013_spring_pannu_parveer.pdf [ 5.88MB ]
Metadata
JSON: 24-1.0073694.json
JSON-LD: 24-1.0073694-ld.json
RDF/XML (Pretty): 24-1.0073694-rdf.xml
RDF/JSON: 24-1.0073694-rdf.json
Turtle: 24-1.0073694-turtle.txt
N-Triples: 24-1.0073694-rdf-ntriples.txt
Original Record: 24-1.0073694-source.json
Full Text
24-1.0073694-fulltext.txt
Citation
24-1.0073694.ris

Full Text

Regulation of ATP-Binding Cassette Transporter A1 In Intimal-type Arterial Smooth Muscle Cells by  PARVEER SINGH PANNU  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in  THE FACULTY OF GRADUATE STUDIES (EXPERIMENTAL MEDICINE)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) April 2013 © Parveer Singh Pannu, 2013  ABSTRACT	
   The	
   removal	
   of	
   cholesterol	
   from	
   cells	
   and	
   formation	
   of	
   high-­‐density	
   lipoprotein	
   (HDL)	
   particles	
   is	
   critically	
   dependent	
   on	
   the	
   membrane	
   lipid	
   transporter	
   ATP-­‐binding	
   cassette	
   transporter	
   A1	
   (ABCA1).	
   Previous	
   studies	
   from	
   the	
   Francis	
   laboratory	
   have	
   determined	
  that	
  the	
  regulation	
  of	
  ATP-­‐binding	
  cassette	
  transporter	
  A1	
  (ABCA1)	
  expression	
   is	
   impaired	
   in	
   model	
   intimal-­‐type	
   arterial	
   smooth	
   muscle	
   cells	
   (SMCs)	
   and	
   human	
   intimal	
   SMCs	
   in	
   atherosclerotic	
   coronary	
   arteries,	
   providing	
   a	
   novel	
   explanation	
   for	
   cholesterol	
   accumulation	
   and	
   foam	
   cell	
   formation	
   in	
   human	
   atheroma.	
   Growing	
   evidence	
   appears	
   to	
   emphasize	
  the	
  importance	
  of	
  the	
  lysosomal-­‐mitochondrial	
  oxysterol	
  pathway	
  in	
  regulating	
   ABCA1	
   expression.	
   We	
   hypothesized	
   that	
   the	
   reduced	
   expression	
   of	
   ABCA1	
   in	
   model	
   intimal-­‐type	
   arterial	
   SMCs	
   is	
   due	
   to	
   impaired	
   enzyme	
   sterol	
   27-­‐hydroxylase	
   (CYP27A1)	
   expression,	
   resulting	
   in	
   impaired	
   oxysterol	
   production	
   critical	
   for	
   the	
   activation	
   of	
   ABCA1	
   gene	
  expression	
  via	
  the	
  Liver	
  X	
  receptor	
  (LXR)	
  pathway.	
   	
    Our	
   results	
   show	
   that	
   intimal-­‐type	
   arterial	
   SMCs	
   exhibit	
   a	
   reduced	
    expression	
   of	
   CYP27A1	
   mRNA	
   and	
   protein.	
   Exogenous	
   treatment	
   of	
   these	
   cells	
   with	
   LXR	
   agonists	
  increases	
  ABCA1	
  expression,	
  indicating	
  an	
  intact	
  LXR-­‐mediated	
  activation	
  of	
  ABCA1	
   gene	
   expression.	
   Despite	
   successful	
   transfection	
   of	
   CYP27A1	
   in	
   these	
   SMCs,	
   intimal-­‐type	
   arterial	
   SMCs	
   do	
   not	
   increase	
   their	
   expression	
   of	
   ABCA1.	
   The	
   expression	
   of	
   steroidogenic	
   acute	
   regulatory	
   protein	
   D1	
   (StARD1),	
   responsible	
   for	
   the	
   delivery	
   of	
   cholesterol	
   to	
   CYP27A1,	
   is	
   also	
   reduced	
   in	
   intima-­‐type	
   SMCs.	
   We	
   also	
   show	
   preliminary	
   results	
   of	
   reduced	
   human	
   arterial	
   intimal	
   SMC-­‐specific	
   CYP27A1	
   expression	
   in	
   coronary	
   arteries	
   with	
   native	
   atherosclerosis.	
  The	
  findings	
  of	
  this	
  thesis	
  provide	
  a	
  narrative	
  highlighting	
  the	
  importance	
  of	
   the	
   intracellular	
   transport	
   of	
   cholesterol	
   via	
   StaRD1	
   to	
   CYP27A1	
   for	
   the	
   activation	
   of	
   LXR-­‐ dependent	
   ABCA1	
   expression	
   in	
   arterial	
   SMCs,	
   and	
   provide	
   further	
   insight	
   into	
   the	
   dysregulation	
   of	
   ABCA1	
   expression	
   in	
   human	
   atherosclerotic	
   arterial	
   SMCs	
   that	
   may	
   contribute	
   to	
   the	
   foam	
   cell	
   population	
   and	
   subsequent	
   plaque	
   formation	
   in	
   human	
   atherogenesis.	
   	
   	
   	
    	
    ii	
    TABLE	
  OF	
  CONTENTS	
   ABSTRACT	
  ...........................................................................................................................................	
  ii	
   	
   TABLE	
  OF	
  CONTENTS	
  .........................................................................................................................	
  iii	
   	
   LIST	
  OF	
  TABLES	
  ...................................................................................................................................	
  v	
   	
   LIST	
  OF	
  FIGURES	
  ................................................................................................................................	
  vi	
   	
   LIST	
  OF	
  ABBREVIATION	
  .....................................................................................................................	
  vii	
   	
   ACKNOWLEDGEMENTS	
  .....................................................................................................................	
  ix	
   	
   DEDICATION	
  .......................................................................................................................................	
  x	
   	
   CHAPTER	
  1:	
  INTRODUCTION	
  ..............................................................................................................	
  1	
   1.1 Cardiovascular	
  Disease	
  ..............................................................................................................	
  2	
   	
  	
  	
  	
  	
  	
  	
  	
  1.1.1	
  Canadian	
  and	
  Global	
  Burden	
  of	
  Cardiovascular	
  Disease	
  .................................................	
  2	
    	
  	
  	
  	
   	
  	
  	
  1.2	
  	
  Atherogenesis	
  ...........................................................................................................................	
  3	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  1.2.1	
  Artery	
  Wall	
  Architecture	
  ...................................................................................................	
  3	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  1.2.2	
  Initiation	
  and	
  Progression	
  of	
  Atherosclerosis	
  ...................................................................	
  4	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  1.2.3	
  Advanced	
  Atherosclerotic	
  Lesions	
  and	
  Thrombosis	
  ..........................................................	
  7	
   	
   	
  	
  	
  1.3	
  Cholesterol	
  Metabolism	
  ............................................................................................................	
  8	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  1.3.1	
  Sources	
  of	
  Cholesterol	
  .......................................................................................................	
  9	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  1.3.2	
  Cholesterogenesis	
  ..............................................................................................................	
  9	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  1.3.3	
  Intracellular	
  Cholesterol	
  Trafficking	
  ................................................................................	
  10	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  1.3.4	
  Liver	
  X	
  Receptors	
  and	
  Oxysterols	
  .....................................................................................	
  11	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  1.3.5	
  Reverse	
  Cholesterol	
  Transport	
  .........................................................................................	
  15	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  1.3.6	
  ABCA1-­‐dependent	
  HDL	
  Formation	
  ..................................................................................	
  17	
   	
   	
   	
  	
  	
  1.4	
  ATP-­‐Binding	
  Cassette	
  Transporter	
  A1	
  (ABCA1)	
  ........................................................................	
  17	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  1.4.1	
  General	
  ............................................................................................................................	
  17	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  1.4.2	
  Structure	
  ..........................................................................................................................	
  18	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  1.4.3	
  Initial	
  HDL	
  Formation	
  and	
  ATP-­‐binding	
  Cassette	
  Transporters	
  .......................................	
  19	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  1.4.4	
  ABCA1	
  Cellular	
  Distribution	
  .............................................................................................	
  20	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  1.4.5	
  Oxysterols	
  and	
  ABCA1	
  Expression	
  ...................................................................................	
  21	
   	
  	
  	
  	
  	
  	
  	
  	
   	
  	
  	
  1.5	
  ABCA1	
  Regulation	
  in	
  Arterial	
  Smooth	
  Muscle	
  Cells	
  .................................................................	
  25	
   	
  	
  	
  	
  	
  	
  	
  	
  1.5.1	
  Arterial	
  Smooth	
  Muscle	
  Cell	
  Heterogeneity	
  ......................................................................	
  25	
   	
  	
  	
  	
  	
  	
  	
  	
  1.5.2	
  Smooth	
  Muscle	
  Cell	
  Cholesterol	
  Homeostasis	
  ..................................................................	
  26	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
   	
  	
  	
  	
  	
  	
  	
  	
  1.5.3	
  ABCA1	
  Expression	
  in	
  Arterial	
  SMCs	
  ..................................................................................	
  29	
   	
  	
  	
  	
  	
  	
  	
  	
  1.5.4	
  Oxysterol-­‐generating	
  Pathways	
  in	
  Arterial	
  SMCs	
  .............................................................	
  31	
  	
    	
    iii	
    	
  	
  	
  1.6	
  Hypothesis	
  and	
  Specific	
  Aims	
  ..................................................................................................	
  33	
   	
   CHAPTER	
  2:	
  MATERIALS	
  AND	
  METHODS	
  ..........................................................................................	
  35	
   	
  	
  	
  2.1	
  Materials	
  ..................................................................................................................................	
  36	
   	
  	
  	
  2.2	
  Methods	
  ...................................................................................................................................	
  36	
   	
  	
  	
  	
  	
  	
  	
  2.2.1	
  Cell	
  Lines	
  Used	
  in	
  This	
  Study	
  ..............................................................................................	
  36	
   	
  	
  	
  	
  	
  	
  	
  2.2.2	
  Cell	
  Culture	
  ........................................................................................................................	
  36	
   	
  	
  	
  	
  	
  	
  	
  2.2.3	
  Quantitative	
  Real-­‐time	
  PCR	
  Analysis	
  of	
  ABCA1,	
  CYP27A1,	
  and	
  StARD1	
  mRNA	
  .................	
  37	
  	
  	
  	
  	
  	
  	
  	
  	
  	
   	
  	
  	
  	
  	
  	
  	
  2.2.4	
  Western	
  Blot	
  Analysis	
  of	
  ABCA1	
  and	
  CYP27A1	
  Protein	
  Expression	
  ...................................	
  38	
   	
  	
  	
  	
  	
  	
  	
  2.2.5	
  CYP27A1	
  cDNA	
  Plasmid	
  Amplification	
  ..............................................................................	
  38	
   	
  	
  	
  	
  	
  	
  	
  2.2.6	
  Transfection	
  of	
  CYP27A1	
  ...................................................................................................	
  39	
   	
  	
  	
  	
  	
  	
  	
  2.2.7	
  27-­‐hydroxycholesterol	
  Efflux	
  Measurement	
  ......................................................................	
  39	
   	
  	
  	
  	
  	
  	
  	
  2.2.8	
  Immunohistochemistry	
  of	
  CYP27A1	
  ..................................................................................	
  40	
   	
  	
  	
  	
  	
  	
  	
  2.2.9	
  Statistical	
  Analysis	
  .............................................................................................................	
  40	
   	
   CHAPTER	
  3:	
  RESULTS	
  ........................................................................................................................	
  41	
   	
  	
  	
  	
  3.1	
  LXR	
  Agonists	
  Upregulate	
  ABCA1	
  Protein	
  Expression	
  in	
  Epithelioid	
  SMCs	
  ..............................	
  42	
   	
  	
  	
  	
  3.2	
  Reduced	
  CYP27A1	
  mRNA	
  Levels	
  in	
  Epithelioid	
  SMCs	
  .............................................................	
  44	
   	
  	
  	
  	
  3.3	
  Reduced	
  CYP27A1	
  Protein	
  Expression	
  in	
  Epithelioid	
  SMCs	
  ....................................................	
  45	
   	
  	
  	
  	
  3.4	
  Transfection	
  Increases	
  CYP27A1	
  mRNA	
  Levels	
  in	
  Spindle	
  and	
  Epithelioid	
  SMCs	
  ....................	
  47	
   	
  	
  	
  	
  3.5	
  Transfection	
  Increases	
  CYP27A1	
  Protein	
  Expression	
  in	
  Spindle	
  and	
  Epithelioid	
  SMCs	
  ..........	
  49	
   	
  	
  	
  	
  3.6	
  Transfection	
  Increases	
  ABCA1	
  Expression	
  in	
  Spindle	
  SMCs	
  But	
  Not	
  in	
  Epithelioid	
  SMC	
  ........	
  51	
   	
  	
  	
  	
  3.7	
  Transfection	
  Increases	
  27-­‐hydroxycholesterol	
  Levels	
  in	
  Spindle	
  SMCs	
  But	
  Not	
  in	
  	
  	
  	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  Epithelioid	
  SMCs	
  ....................................................................................................................	
  54	
  	
  	
   	
  	
  	
  	
  3.8	
  Reduced	
  StARD1	
  mRNA	
  Levels	
  in	
  Epithelioid	
  SMCs	
  ................................................................	
  56	
   	
  	
  	
  	
  3.9	
  Transfection	
  Increases	
  StARD1	
  mRNA	
  Levels	
  in	
  Spindle	
  SMCs	
  But	
  Not	
  in	
  Epithelioid	
  	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  SMCs	
  ......................................................................................................................................	
  57	
   	
  	
  	
  	
  3.10	
  Qualitative	
  Observations	
  of	
  SMC-­‐specific	
  CYP27A1	
  Expression	
  in	
  Human	
  	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  Atherosclerotic	
  Coronary	
  Arteries	
  .......................................................................................	
  59	
  	
    	
  	
   CHAPTER	
  4:	
  DISCUSSION	
  ............................................................................................................	
  62	
   	
  	
  	
  	
  4.1	
  Discussion	
  ..............................................................................................................................	
  63	
   	
  	
  	
  	
  4.2	
  Concluding	
  Remarks	
  ..............................................................................................................	
  66	
   	
   REFERENCES	
  ....................................................................................................................................	
  67	
  	
  	
   	
   	
   	
   	
   	
   	
   	
   	
   	
    	
   	
    iv	
    LIST	
  OF	
  TABLES	
   	
   Table	
  1-­‐1	
  Features	
  of	
  arterial	
  SMC	
  subtypes	
  ....................................................................................	
  25	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
    	
    v	
    LIST	
  OF	
  FIGURES	
   	
   Figure	
  1-­‐1	
  Illustration	
  of	
  normal	
  artery	
  walls	
  .....................................................................................	
  4	
   Figure	
  1-­‐2	
  Formation	
  of	
  an	
  advanced	
  atherosclerotic	
  plaque	
  ...........................................................	
  7	
   Figure	
  1-­‐3	
  Plaque	
  activation,	
  rupture,	
  and	
  thrombosis	
  ......................................................................	
  8	
   Figure	
  1-­‐4	
  Sites	
  of	
  major	
  endogenous	
  oxysterol	
  formation	
  .............................................................	
  13	
   Figure	
  1-­‐5	
  Reverse	
  cholesterol	
  transport	
  .........................................................................................	
  16	
   Figure	
  1-­‐6	
  ABCA1	
  structure	
  ..............................................................................................................	
  19	
   Figure	
  1-­‐7	
  Cholesterol	
  and	
  phospholipid	
  efflux	
  to	
  apo-­‐AI	
  from	
  human	
  and	
  rat	
  arterial	
  	
   	
  	
  	
  	
  	
  SMCs	
  ................................................................................................................................	
  28	
   Figure	
  1-­‐8	
  SMC-­‐specific	
  ABCA1	
  expression	
  in	
  atherosclerotic	
  human	
  coronary	
  arteries	
  ................	
  30	
   Figure	
  1-­‐9	
  Cholesterol	
  efflux	
  from	
  epithelioid	
  and	
  spindle	
  arterial	
  SMCs	
  ........................................	
  31	
   Figure	
  3-­‐1	
  Upregulation	
  of	
  ABCA1	
  gene	
  expression	
  in	
  spindle	
  and	
  epithelioid	
  SMCs	
  by	
  	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  exogenous	
  27-­‐hydroxycholesterol	
  ..................................................................................	
  43	
   Figure	
  3-­‐2	
  Quantitation	
  of	
  ABCA1	
  mRNA	
  levels	
  in	
  spindle	
  and	
  epithelioid	
  SMCs	
  ............................	
  44	
   Figure	
  3-­‐3	
  Protein	
  expression	
  levels	
  of	
  CYP27A1	
  in	
  spindle	
  and	
  epithelioid	
  SMCs	
  ..........................	
  46	
   Figure	
  3-­‐4	
  Quantitation	
  of	
  CYP27A1	
  mRNA	
  levels	
  in	
  transfected	
  spindle	
  and	
  epithelioid	
  	
   	
  	
  	
  	
  	
  SMCs	
  ................................................................................................................................	
  48	
   Figure	
  3-­‐5	
  Quantitation	
  of	
  CYP27A1	
  protein	
  in	
  transfected	
  spindle	
  and	
  epithelioid	
  SMCs	
  .............	
  50	
   Figure	
  3-­‐6	
  Quantitation	
  of	
  ABCA1	
  expression	
  in	
  transfected	
  spindle	
  and	
  epithelioid	
  SMCs	
  ...........	
  53	
   Figure	
  3-­‐7	
  Quantitation	
  of	
  27-­‐hydroxycholesterol	
  levels	
  in	
  transfected	
  SMCs	
  ................................	
  55	
   Figure	
  3-­‐8	
  Quantitation	
  of	
  StARD1	
  mRNA	
  levels	
  in	
  spindle	
  and	
  epithelioid	
  SMCs	
  ...........................	
  56	
   Figure	
  3-­‐9	
  Quantitation	
  of	
  StARD1	
  levels	
  in	
  cholesterol-­‐loaded	
  CYP27A1	
  transfected	
  spindle	
  	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  and	
  epithelioid	
  SMCs	
  .......................................................................................................	
  58	
   Figure	
  3-­‐10	
  SMC-­‐specific	
  CYP27A1	
  expression	
  in	
  a	
  human	
  coronary	
  artery	
  with	
  native	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  atherosclerosis	
   ..............................................................................................................	
  61	
    	
   	
   	
    vi	
    LIST	
  OF	
  ABBREVIATIONS	
   	
   ABCA1	
  	
  	
  	
  	
  ATP-­‐binding	
  cassette	
  transporter	
  A1	
   	
   ABCG1	
  	
  	
  	
  	
  ATP-­‐binding	
  cassette	
  transporter	
  G1	
   	
   ACAT	
  	
  	
  	
  	
  	
  	
  acyl-­‐CoA:cholesterol	
  acyltransferase	
  	
   	
   ApoA-­‐I	
  	
  	
  	
  	
  	
  	
  	
  apolipoprotein	
  A-­‐I	
   	
   ApoE	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  apolipoprotein	
  E	
   	
   cDNA	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  complementary	
  deoxyribonucleic	
  acid	
   	
   CE	
   	
  	
  	
  	
  	
  	
  	
  cholesteryl	
  esters	
   	
   CESD	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  cholesteryl	
  ester	
  storage	
  disease	
   	
   CETP	
   	
  	
  	
  	
  	
  	
  	
  cholesteryl	
  ester	
  transfer	
  protein	
   	
   CVD	
   	
  	
  	
  	
  	
  	
  	
  cardiovascular	
  disease	
   	
   DMEM	
  	
  	
  	
  	
  	
  	
  	
  Dulbecco’s	
  modified	
  Eagle’s	
  medium	
   	
   ECM	
  	
   	
  	
  	
  	
  	
  	
  	
  extracellular	
  matrix	
   	
   FBS	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  fetal	
  bovine	
  serum	
   	
   HDL	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  high-­‐density	
  lipoproteins	
   	
   HMG-­‐CoA	
  	
  3-­‐hydroxy-­‐3-­‐methylglutaryl	
  coenzyme	
  A	
   	
   Insigs	
   	
  	
  	
  	
  	
  	
  	
  insulin-­‐induced	
  genes	
   	
   LAL	
   	
  	
  	
  	
  	
  	
  	
  lysosomal	
  acid	
  lipase	
   	
   LDL	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  low-­‐density	
  lipoprotein	
   	
   LPL	
   	
  	
  	
  	
  	
  	
  	
  lipoprotein	
  lipase	
   	
   LXR	
   	
  	
  	
  	
  	
  	
  	
  liver	
  X	
  receptor	
   	
   MCP-­‐1	
  	
  	
  	
  	
  	
  	
  	
  	
  monocyte	
  chemoattractant	
  protein-­‐1	
   	
   mRNA	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  messenger	
  ribonucleic	
  acid	
    	
    vii	
    nCEH	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  neutral	
  cholesteryl	
  ester	
  hydrolase	
   	
   NPC	
   	
  	
  	
  	
  	
  	
  	
  Niemann-­‐Pick	
  Type	
  C	
  disease	
   	
   PBS	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  phosphate-­‐buffered	
  saline	
   	
   PDI	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  protein	
  disulfide	
  isomerase	
   	
   RCT	
   	
  	
  	
  	
  	
  	
  	
  reverse	
  cholesterol	
  transport	
   	
   SMC	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  smooth	
  muscle	
  cells	
   	
   WKY	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  Wistar-­‐Kyoto	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
    	
    viii	
    ACKNOWLEDGEMENTS	
   	
   I	
   thank	
   and	
   appreciate	
   my	
   supervisor,	
   Dr.	
   Gordon	
   Francis,	
   for	
   providing	
   me	
   with	
   the	
   privilege	
  to	
  learn	
  and	
  grow	
  as	
  a	
  graduate	
  student	
  under	
  his	
  mentorship	
  and	
  guidance.	
  	
   	
   I	
   would	
   like	
   to	
   thank	
   my	
   supervisory	
   committee	
   members	
   Drs.	
   David	
   Granville,	
   Haydn	
   Pritchard,	
  and	
  Chun	
  Seow	
  for	
  their	
  guidance	
  and	
  thought-­‐provoking	
  discussions	
  during	
  my	
   studies.	
  I	
  would	
  also	
  like	
  to	
  thank	
  my	
  External	
  Examiner,	
  Dr.	
  John	
  Hill,	
  for	
  his	
  involvement	
  in	
   the	
  final	
  stages	
  of	
  my	
  program.	
   	
   I’m	
   lucky	
   to	
   have	
   worked	
   with	
   the	
   members	
   of	
   the	
   laboratory	
   and	
   I	
   thank	
   them	
   for	
   their	
   support	
   both	
   as	
   a	
   student	
   and	
   a	
   friend.	
   Thank	
   you	
   to	
   Teddy	
   Chan	
   and	
   Leanne	
   Bilawchuk	
   for	
   their	
   outstanding	
   technical	
   assistance,	
   training,	
   and	
   patience	
   during	
   the	
   course	
   of	
   my	
   program.	
   I	
   would	
   also	
   like	
   to	
   thank	
   Dr.	
   Emmanuel	
   Boadu	
   for	
   his	
   encouragement	
   and	
   technical	
  assistance	
  with	
  plasmid	
  purification.	
  Thank	
  you	
  to	
  Kristen	
  Bowden	
  for	
  her	
  helpful	
   advice	
   and	
   insights	
   over	
   the	
   years.	
   A	
   special	
   thanks	
   to	
   Dr.	
   Sima	
   Allahverdian	
   for	
   her	
   continued	
   encouragement,	
   guidance,	
   and	
   technical	
   assistance	
   with	
   immunohistochemical	
   techniques.	
   	
   Thank	
   you	
   to	
   the	
   Heart	
   and	
   Lung	
   Institute	
   and	
   the	
   James	
   Hogg	
   iCAPTURE	
   Centre	
   for	
   providing	
  a	
  learning	
  environment	
  that	
  has	
  helped	
  forge	
  strong	
  bonds	
  with	
  fellow	
  students	
   during	
  the	
  course	
  of	
  my	
  studies.	
   	
   A	
  special	
  thanks	
  to	
  the	
  funding	
  agencies	
  that	
  supported	
  the	
  research	
  for	
  this	
  project:	
  Grant-­‐ In-­‐Aid	
   from	
   the	
   Heart	
   and	
   Stroke	
   Foundation	
   of	
   British	
   Columbia	
   and	
   Yukon,	
   and	
   CIHR	
   operating	
  Grant	
  MOP-­‐79532.	
   	
   	
   	
   	
   	
    	
    ix	
    DEDICATION	
   I	
   dedicate	
   this	
   to	
   my	
   beloved	
   father	
   and	
   mother,	
   Yashpal	
   Singh	
   Pannu	
   and	
   Surinder	
   Kaur	
   Pannu,	
   for	
   their	
   devoted	
   love	
   and	
   kindness	
   that	
   has	
   provided	
   me	
   with	
   the	
   guidance,	
   strength,	
  and	
  courage	
  to	
  pursue	
  my	
  dreams.	
  	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
  	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
    	
    	
    x	
    	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
    	
   	
   	
   	
   CHAPTER	
  1:	
  INTRODUCTION	
    	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
    	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   1	
   	
    	
    1.1	
  Cardiovascular	
  disease	
   1.1.1	
  Canadian	
  and	
  Global	
  Burden	
  of	
  Cardiovascular	
  Disease	
   	
    Cardiovascular	
  disease	
  (CVD)	
  is	
  the	
  leading	
  cause	
  of	
  death	
  worldwide	
  (WHO,	
  2012).Recent	
    data	
   from	
   Statistics	
   Canada	
   reports	
   nearly	
   70,000	
   deaths	
   annually	
   nationwide	
   attributed	
   to	
   CVD,	
   occurring	
   equally	
   in	
   men	
   and	
   women	
   (Statistics	
   Canada,	
   2009).	
   Globally,	
   CVD	
   has	
   become	
   a	
   true	
   pandemic,	
   accounting	
   for	
   an	
   estimated	
   17.3	
   million	
   deaths	
   in	
   2008,	
   representing	
   30%	
   of	
   global	
   deaths	
   (WHO,	
   2012).	
   Low-­‐income	
   and	
   middle-­‐income	
   countries	
   are	
   disproportionately	
   affected,	
   accounting	
   for	
   over	
   80%	
   of	
   all	
   CVD	
   deaths,	
   occurring	
   almost	
   equally	
   in	
   men	
   and	
   women.	
   The	
   World	
   Health	
  Organization	
  projects	
  that	
  by	
  2030,	
  almost	
  23.6	
  million	
  people	
  will	
  die	
  from	
  CVD,	
  expected	
   to	
   remain	
   the	
   single	
   leading	
   cause	
   of	
   death	
   worldwide.	
   Several	
   factors	
   account	
   for	
   the	
   increasing	
   burden	
   of	
   cardiovascular	
   diseases,	
   including	
   a	
   longer	
   average	
   life	
   span,	
   tobacco	
   use,	
   decreased	
   physical	
   activity,	
   and	
   increased	
   consumption	
   of	
   unhealthy	
   foods.	
   The	
   INTERHEART	
   study	
   demonstrated	
   that	
   over	
   90%	
   of	
   the	
   population	
   attributable	
   risk	
   of	
   acute	
   myocardial	
   infarction	
   is	
   accounted	
   for	
   by	
   nine	
   modifiable	
   risk	
   factors:	
   the	
   apoB/apo-­‐AI	
   ratio,	
   history	
   of	
   smoking,	
   psychosocial	
   stress,	
   diabetes,	
   hypertension,	
   abdominal	
   obesity,	
   alcohol	
   intake,	
   exercise,	
   and	
   fruit	
   and	
   vegetable	
   intake	
   (Yusuf	
   et	
  al.,	
   2004;	
   Joshi	
   et	
  al.,	
   2007;	
   Anand	
   et	
  al.,	
   2008;	
   Teo	
   et	
  al.,	
   2009).	
   The	
   Framingham	
  Heart	
  Study	
  provided	
  the	
  first	
  evidence	
  of	
  low-­‐density	
  lipoprotein	
  cholesterol	
  (LDL-­‐C)	
   as	
  a	
  strong	
  predictor	
  of	
  CVD,	
  shifting	
  the	
  focus	
  on	
  lowering	
  LDL-­‐C	
  as	
  a	
  CVD	
  preventative	
  measure	
   (Castelli,	
  1984).	
  Despite	
  strong	
  evidence	
  for	
  lipid-­‐lowering	
  strategies	
  as	
  an	
  effective	
  tool	
  to	
  reduce	
   cardiac	
  events,	
  LDL-­‐C	
  reduction	
  strategies	
  only	
  reduce	
  CVD	
  clinical	
  outcomes	
  by	
  30-­‐40%	
  (Plehn	
  et	
   al.,	
  1999;	
  Byington	
  et	
  al.,	
  2001;	
  Wierzbicki,	
  2007).	
  	
   	
    Several	
   prospective	
   populations	
   studies	
   have	
   shown	
   low	
   high-­‐density	
   lipoprotein	
   (HDL-­‐C)	
   as	
    a,	
   if	
   not	
   the	
   strongest	
   independent	
   risk	
   factor	
   for	
   CVD,	
   and	
   have	
   shifted	
   the	
   focus	
   of	
   cholesterol	
   research	
   to	
   include	
   raising	
   HDL-­‐C	
   as	
   a	
   potential	
   cardioprotective	
   target	
   (Rubins	
   et	
   al.,	
   1993;	
   Cutri	
   et	
   al.,	
   2006;	
   Chernobelsky	
   et	
   al.,	
   2007).	
   Epidemiological	
   studies	
   provide	
   evidence	
   that	
   plasma	
   HDL-­‐C	
   levels	
  above	
  1.55	
  mM	
  (60	
  mg/dL)	
  are	
  cardioprotective	
  against	
  CVD,	
  and	
  levels	
  below	
  1.04	
  mM	
  (40	
   mg/dL)	
   in	
   males	
   or	
   1.3	
   mM	
   (50	
   mg/dL)	
   in	
   females	
   increases	
   the	
   risk	
   for	
   atherogenesis	
  (Toth,	
   2005).	
   Despite	
   the	
   strong	
   inverse	
   relationship	
   between	
   HDL-­‐C	
   and	
   CVD,	
   and	
   the	
   confirmed	
   cardioprotective	
   effects	
   of	
   reducing	
   LDL-­‐C,	
   there	
   are	
   no	
   HDL-­‐related	
   therapies	
   yet	
   approved	
   for	
   clinical	
  use.	
  The	
  best	
  HDL-­‐C	
  raising	
  agent	
  currently	
  available	
  is	
  niacin	
  (nicotinic	
  acid)	
  (Canner	
  et	
  al.,	
    2	
   	
    	
   1986),	
   but	
   is	
   limited	
   to	
   raising	
   HDL-­‐C	
   by	
   20-­‐30%,	
   plus	
   it	
   causes	
   skin	
   flushing	
   as	
   a	
   commonly	
   experienced	
   side	
   effect.	
   The	
   potential	
   for	
   raising	
   HDL-­‐C	
   as	
   a	
   therapeutic	
   target	
   in	
   the	
   prevention	
   and	
  treatment	
  of	
  CVD	
  is	
  strong	
  and	
  necessitates	
  a	
  focus	
  on	
  increasing	
  HDL	
  formation.	
  (Adams	
  et	
  al.,	
   2004)	
   	
    1.2	
  	
  Atherogenesis	
   	
    Atherosclerosis,	
   a	
   disease	
   affecting	
   arterial	
   blood	
   vessels,	
   is	
   initiated	
   by	
   endothelial	
   injury	
    and	
   the	
   retention	
   of	
   lipids	
   in	
   the	
   subendothelial	
   space	
   that	
   leads	
   to	
   their	
   aggregation	
   and	
   oxidative	
   modifications,	
  infiltration	
  and	
  retention	
  of	
  monocytes	
  and	
  lymphocytes,	
  and	
  eventual	
  induction	
  of	
   chronic	
  inflammation	
  and	
  thrombosis.	
  Consequently,	
  arterial	
  wall	
  architecture	
  is	
  remodeled	
  and	
  the	
   arterial	
   lumen	
   is	
   narrowed,	
   causing	
   constriction	
   and	
   hardening	
   of	
   the	
   arterial	
   blood	
   vessel	
   (Lusis,	
   2000).	
  	
   	
   1.2.1	
  Artery	
  Wall	
  Architecture	
   	
  The	
  lumen	
  of	
  the	
  artery	
  wall	
  is	
  lined	
  by	
  a	
  single	
  layer	
  of	
  endothelial	
  cells	
  followed	
  by	
  three	
  discrete	
   concentric	
   layers:	
   the	
   intima,	
   media	
   and	
   adventitia.	
   The	
   innermost	
   layer	
   is	
   the	
   intima,	
   typically	
   acellular	
   and	
   comprised	
   of	
   connective	
   tissue	
   containing	
   collagen,	
   laminin,	
   heparin	
   sulphate	
   proteoglycans,	
  and	
  bordered	
  by	
  the	
  internal	
  elastic	
  lamina	
  (Keaney,	
  2000;	
  Newby,	
  2000)	
  (Figure	
  1-­‐ 1).	
   Surrounding	
   the	
   intima	
   is	
   the	
   middle	
   layer,	
   or	
   media,	
   populated	
   primarily	
   by	
   vascular	
   smooth	
   muscle	
   cells	
   (SMCs)	
   and	
   a	
   matrix	
   containing	
   type	
   I	
   fibrillar	
   collagen,	
   glycoprotein	
   fibronectin,	
   and	
   chondroitin	
  sulphate	
  proteoglycans	
  (Keaney,	
  2000).	
  The	
  SMCs	
  permit	
  arterial	
  wall	
  contraction	
  and	
   expansion,	
   adjusting	
   the	
   size	
   of	
   the	
   luminal	
   diameter.	
   The	
   outer	
   elastic	
   lamina,	
   a	
   layer	
   of	
   interwoven	
  elastin	
  fibrils,	
  demarcates	
  the	
  media	
  from	
  the	
  outermost	
  layer,	
  the	
  adventitia.	
  Primarily	
   a	
  structural	
  component	
  of	
  the	
  artery	
  wall,	
  the	
  adventitia	
  is	
  comprised	
  of	
  connective	
  tissue,	
  collagen,	
   and	
  elastic	
  fibers,	
  protecting	
  the	
  blood	
  vessel	
  from	
  overexpansion	
  during	
  changes	
  in	
  blood	
  pressure	
   and	
   flow.	
   In	
   addition	
   to	
   providing	
   structural	
   integrity	
   to	
   the	
   artery	
   wall,	
   the	
   adventitia	
   houses	
   nerves,	
  lymphatics,	
  and	
  blood	
  vessels	
  that	
  nourish	
  arterial	
  cells.	
  	
  	
    3	
   	
    	
    	
   Figure	
   1-­‐1.	
   Illustration	
   of	
   normal	
   artery	
   walls.	
   The	
  (A)	
  single	
  layer	
  of	
  endothelial	
  cells	
  overlay	
  the	
   (B)	
  intima.	
  The	
  (C)	
  media	
  is	
  composed	
  of	
  smooth	
  muscle	
  cells	
  that	
  allow	
  the	
  artery	
  to	
  contract	
  and	
   expand.	
   The	
   outer	
   layer,	
   or	
   (D)	
   adventitia	
   is	
   composed	
   of	
   connective	
   tissue.	
   Adapted	
   from	
   (Hahn	
   et	
   al.,	
  2009)	
  with	
  permission	
  from	
  MacMillan	
  Publishers	
  Ltd.,	
  copyright	
  ©	
  2009.	
  	
   	
   1.2.2	
  Initiation	
  and	
  Progession	
  of	
  Atherosclerosis	
   Atherosclerosis	
  is	
  a	
  pathological	
  process	
  and	
  leading	
  contributor	
  of	
  cardiovascular	
  disease	
  leading	
   to	
  myocardial	
  and	
  cerebral	
  infarction,	
  characterized	
  by	
  the	
  thickening,	
  hardening,	
  and	
  eventual	
  loss	
   of	
   arterial	
   blood	
   vessel	
   elasticity.	
   This	
   process	
   is	
   believed	
   to	
   be	
   a	
   response	
   to	
   injury	
   initiated	
   by	
   damage	
  to	
  the	
  endothelial	
  layer	
  that	
  leads	
  to	
  the	
  development	
  and	
  progression	
  of	
  atherosclerotic	
   lesions	
   (Williams	
   et	
   al.,	
   1995;	
   Ross,	
   1999;	
   Newby,	
   2000;	
   Pillarisetti	
   et	
   al.,	
   2004).	
   Multiple	
   factors	
   have	
   been	
   identified	
   that	
   result	
   in	
   endothelial	
   damage	
   including	
   mechanical	
   stresses	
   such	
   as	
   hypertension	
   and	
   low	
   shear	
   stress,	
   dyslipidemias	
   such	
   as	
   elevated	
   plasma	
   cholesterol	
   levels,	
   oxidative	
  stresses	
  such	
  as	
  elevated	
  reactive	
  oxygen	
  species,	
  immunologic	
  stresses	
  such	
  as	
  viruses,	
   diseases	
  such	
  as	
  diabetes,	
  and	
  lifestyle	
  risk	
  factors	
  such	
  as	
  smoking	
  (Keaney,	
  2000;	
  Kher	
  et	
  al.,	
  2004;	
   Pillarisetti	
   et	
   al.,	
   2004).	
   The	
   initial	
   response	
   of	
   the	
   endothelium	
   to	
   injury	
   results	
   in	
   the	
   upregulation	
   of	
   cell	
   surface	
   adhesion	
   molecules	
   such	
   as	
   selectins,	
   vascular	
   cell	
   adhesion	
   molecule-­‐1	
   (VCAM-­‐1)	
   and	
   intracellular	
   adhesion	
   molcule-­‐1	
   (ICAM-­‐1)	
   (Kher	
   et	
   al.,	
   2004;	
   Kaperonis	
   et	
   al.,	
   2006).	
   Consequently,	
  circulating	
  monocytes,	
  T-­‐lymphocytes,	
  and	
  neutrophils	
  adhere	
  to	
  the	
  surface	
  of	
  the	
   endothelium,	
  migrate	
  between	
  the	
  endothelial	
  cells,	
  and	
  infiltrate	
  the	
  subendothelial	
  space	
  under	
    4	
   	
    	
   the	
  influence	
  of	
  growth	
  regulatory	
  molecules	
  and	
  chemoattractants	
  such	
  as	
  platelet-­‐derived	
  growth	
   factor	
   (PDGF)	
   and	
   monocyte	
   chemoattractant	
   protein-­‐1	
   (MCP-­‐1)	
   (Aiello	
   et	
   al.,	
   1999;	
   Doran	
   et	
   al.,	
   2008).	
  Subsequently,	
  retained	
  monocytes	
  differentiate	
  into	
  macrophages	
  and	
  engulf	
  aggregated	
  or	
   oxidized	
   low-­‐density	
   lipoprotein	
   (oxLDL),	
   developing	
   into	
   foam	
   cells	
   that	
   contribute	
   to	
   the	
   formation	
  of	
  fatty	
  streaks.	
  The	
  accompanying	
  lymphocytes	
  not	
  only	
  contribute	
  to	
  the	
  development	
   and	
  progression	
  of	
  foam	
  cell	
  formation,	
  but	
   along	
  with	
  other	
  cell	
  types	
  such	
  as	
  neutrophils	
  produce	
   several	
  cytokines,	
  vasoactive	
  agents,	
  and	
  growth	
  factors	
  that	
  promote	
  the	
  onset	
  of	
  an	
  inflammatory	
   response	
  (Keaney,	
  2000).	
  Activated	
  T-­‐lymphocytes	
  produce	
  cytokines	
  such	
  as	
  tumor	
  necrosis	
  factor-­‐ β	
   and	
   interferon-­‐γ,	
   fibrogenic	
   mediators,	
   and	
   growth	
   factors	
   that	
   promote	
   the	
   migration	
   and	
   proliferation	
   of	
   SMCs	
   and	
   the	
   construction	
   of	
   dense	
   extracellular	
   matrix	
   (ECM).	
   The	
   macrophage-­‐ derived	
   foam	
   cells,	
   T-­‐lymphocytes,	
   and	
   SMCs	
   also	
   secrete	
   pro-­‐inflammatory	
   cytokines	
   such	
   as	
   interleukin-­‐1	
  (IL-­‐1),	
  tumor	
  necrosis	
  factor	
  (TNF),	
  and	
  C-­‐reactive	
  protein	
  (CRP),	
  which	
  induce	
  further	
   expression	
   of	
   cell	
   surface	
   adhesion	
   molecules	
   resulting	
   in	
   increased	
   leukocyte	
   adhesion	
   to	
   endothelial	
  surfaces	
  (Kaperonis	
  et	
  al.,	
  2006).	
  Dendritic	
  cells	
  (DCs)	
  are	
  integral	
  players	
  in	
  innate	
  and	
   adaptive	
  immune	
  responses,	
  present	
  in	
  normal	
  and	
  atherosclerotic	
  arteries,	
  which	
  also	
  contribute	
   to	
   immune	
   processes	
   in	
   atherogenesis	
   (Bobryshev	
   et	
   al.,	
   1995;	
   Erbel	
   et	
   al.,	
   2007;	
   Perrins	
   et	
   al.,	
   2011;	
   Weber	
   et	
   al.,	
   2011).	
   Recent	
   findings	
   that	
   DCs	
   play	
   an	
   important	
   role	
   in	
   the	
   initial	
   stages	
   of	
   atherosclerosis	
   in	
   LDL	
   receptor	
   knockout	
   mice	
   demonstrate	
   that	
   intimal	
   DCs	
   can	
   take	
   up	
   lipoproteins,	
   accumulate	
   lipids,	
   and	
   become	
   foam	
   cells,	
   in	
   response	
   to	
   a	
   cholesterol-­‐rich	
   diet	
   (Paulson	
  et	
  al.,	
  2010).	
  Transmission	
  electron	
  microscopy	
  reveals	
  that	
  DCs	
  resident	
  in	
  the	
  intima	
  of	
   atherosclerotic	
  lesions	
  can	
  precede	
  the	
  appearance	
  of	
  macrophage-­‐derived	
  foam	
  cells,	
  significantly	
   contributing	
  to	
  the	
  foam	
  cell	
  population	
  (Bobryshev	
  et	
  al.,	
  1997).	
  	
   	
    Chemotaxis	
   is	
   a	
   critical	
   event	
   in	
   the	
   development	
   of	
   atherosclerotic	
   lesions,	
   recruiting	
   not	
    only	
  leukocytes	
  and	
  macrophages	
  from	
  circulation,	
  but	
  also	
  SMCs	
  from	
  the	
  media	
  into	
  the	
  intima	
  of	
   the	
   artery.	
   Colony-­‐stimulating	
   factors	
   (CSFs),	
   MCP-­‐1,	
   and	
   oxLDL	
   can	
   be	
   responsible	
   for	
   migration	
   and	
  infiltration	
  of	
  monocytes	
  into	
  the	
  subendothelial	
  space,	
  whereas	
  PDGF	
  and	
  insulin-­‐like	
  growth	
   factor-­‐1	
  (IGF-­‐1)	
  can	
  induce	
  SMC	
  migration	
  into	
  the	
  intima	
  (Lamon	
  et	
  al.,	
  2008;	
  van	
  Oostrom	
  et	
  al.,	
   2009).	
   The	
   atherosclerotic	
   lesion	
   is	
   characterized	
   by	
   a	
   migration	
   and	
   proliferation	
   of	
   SMCs	
   in	
   the	
   intimal	
  space,	
  loss	
  of	
  contractile	
  function,	
  and	
  collagen	
  accumulation.	
  Macrophages	
  residing	
  in	
  the	
   artery	
   wall	
   express	
   a	
   variety	
   of	
   scavenger	
   receptors	
   including	
   scavenger	
   receptor	
   class	
   A	
   (SR-­‐A)	
   types	
  I	
  and	
  II,	
  CD36,	
  LOX-­‐1,	
  CD68,	
  and	
  scavenger	
  receptor	
  class	
  B	
  type	
  I	
  (SR-­‐BI),	
  some	
  of	
  which	
  are	
    5	
   	
    	
   responsible	
  for	
  the	
  uptake	
  of	
  oxLDL	
  (Ramprasad	
  et	
  al.,	
  1995;	
  Chinetti	
  et	
  al.,	
  2000;	
  Smirnova	
  et	
  al.,	
   2004;	
   Greaves	
   et	
   al.,	
   2009;	
   Ishikawa	
   et	
   al.,	
   2009).	
   Like	
   macrophages	
   SMCs	
   have	
   been	
   reported	
   to	
   express	
  class	
  A	
  and	
  CD36	
  receptors	
  in	
  vitro	
  and	
  in	
  vivo,	
  leading	
  to	
  unregulated	
  uptake	
  of	
  modified	
   lipoproteins	
  and	
  the	
  formation	
  of	
  SMC	
  foam	
  cells	
  in	
  the	
  atherosclerotic	
  intima	
  (Allahverdian,	
  et	
  al,	
   2012).	
   Despite	
   the	
   increased	
   uptake	
   of	
   LDL-­‐C,	
   non-­‐LDL-­‐receptor	
   mediated	
   endocytosis	
   does	
   not	
   decrease,	
   resulting	
   in	
   uncontrolled	
   cholesterol	
   accumulation	
   and	
   eventual	
   foam	
   cell	
   formation	
   (Kaperonis	
   et	
   al.,	
   2006).	
   In	
   addition,	
   smooth	
   muscle	
   cells	
   resident	
   in	
   the	
   intima	
   will	
   proliferate	
   under	
  the	
  influence	
  of	
  growth	
  factors,	
  such	
  as	
  PDGF,	
  released	
  by	
  macrophages.	
  	
   	
    A	
   major	
   event	
   in	
   the	
   initial	
   stages	
   of	
   atherosclerosis	
   is	
   the	
   subendothelial	
   retention	
   of	
    apolipoprotein	
   B	
   (apoB)-­‐containing	
   lipoproteins	
   in	
   susceptible	
   pre-­‐lesional	
   areas	
   of	
   the	
   arterial	
   luminal	
   wall	
   characterized	
   by	
   diffuse	
   intimal	
   thickening	
   (DIT).	
   Considered	
   a	
   precursor	
   to	
   atherosclerosis,	
   DIT	
   is	
   universally	
   present	
   in	
   human	
   arteries	
   and	
   shows	
   a	
   well-­‐organized	
   structure	
   with	
   a	
   marked	
   increased	
   proteoglycans,	
   elastin,	
   and	
   smooth	
   muscle	
   cells	
   in	
   the	
   ECM	
   (Nakashima	
   et	
   al.,	
  2008).	
  	
  Prior	
  to	
  macrophage	
  infiltration	
  of	
  the	
  vessel	
  wall,	
  apoB-­‐containing	
  lipoproteins	
  bind	
  to	
   proteoglycans	
  via	
  ionic	
  interactions	
  between	
  the	
  negatively	
  charged	
  sulphate	
  and	
  carboxylic	
  groups	
   on	
   the	
   glycosamnoglycan	
   chains	
   and	
   positively	
   charged	
   residues	
   on	
   apoB	
   (Tannock	
   et	
   al.,	
   2008).	
   Vascular	
   SMCs	
   are	
   believed	
   to	
   be	
   a	
   major	
   source	
   of	
   proteoglycan	
   synthesis,	
   in	
   addition	
   to	
   macrophages	
   and	
   endothelial	
   cells.	
   Subendothelial	
   LDL	
   particles	
   undergo	
   oxidative	
   modifications	
   under	
   the	
   influence	
   of	
   factors	
   secreted	
   by	
   fibroblasts,	
   SMCs,	
   endothelial	
   cells,	
   and	
   macrophages,	
   such	
  as	
  lipoxygenases,	
  NAD(P)H	
  oxidases,	
  xanthine	
  oxidases	
  and	
  nitric	
  oxide,	
  and	
  myeloperoxidase,	
   respectively	
   (Heinecke,	
   1998;	
   Stocker	
   et	
   al.,	
   2004).	
   Modified	
   LDL	
   particles,	
   such	
   as	
   oxLDL,	
   are	
   believed	
   to	
   promote	
   inflammatory	
   responses	
   that	
   recruit	
   macrophages	
   to	
   the	
   arterial	
   wall	
   from	
   circulation,	
  contributing	
  to	
  the	
  formation	
  of	
  foam	
  cells,	
  leading	
  to	
  pathological	
  intimal	
  thickening.	
   Recruitment	
  of	
  SMCs	
  from	
  the	
  media	
  into	
  the	
  intima	
  further	
  promotes	
  the	
  foam	
  cell	
  population	
  as	
   lipids	
  are	
  ingested,	
  contributing	
  to	
  lesion	
  development	
  and	
  progression	
  (Figure	
  1-­‐2).	
  	
    6	
   	
    	
    	
   Figure	
   1-­‐2	
   Formation	
   of	
   an	
   advanced	
   atherosclerotic	
   plaque.	
   The	
   (A)	
   dysfunctional	
   endothelium	
   expresses	
  cell	
  surface	
  adhesion	
  molecules	
  that	
  promote	
  the	
  infiltration	
  of	
  macrophages	
  that	
  leads	
   to	
   the	
   eventual	
   formation	
   of	
   (B)	
   macrophage-­‐derived	
   foam	
   cells.	
   In	
   addition,	
   (C)	
   proliferating	
   smooth	
  muscle	
  cells	
  resident	
  in	
  the	
  intima	
  also	
  contribute	
  to	
  the	
  foam	
  cell	
  population,	
  forming	
  a	
  (D)	
   necrotic	
  core	
  and	
  eventual	
  (E)	
  fibrous	
  cap.	
  Adapted	
  from	
  (Mendelsohn	
  et	
  al.,	
  2005)	
  with	
  permission	
   from	
  AAAS,	
  copyright	
  ©	
  2005.	
  	
   	
   1.2.3	
  Advanced	
  Atherosclerotic	
  Lesions	
  and	
  Thrombosis	
   	
    Advanced	
  atherosclerotic	
  plaques	
  exhibit	
  a	
  dense	
  accumulation	
  of	
  extracellular	
  lipids	
  known	
    as	
  the	
  lipid	
  core.	
  Formation	
  of	
  the	
  lipid	
  core	
  precedes	
  the	
  development	
  of	
  fibrous	
  tissue,	
  composed	
   mainly	
   of	
   collagen,	
   forming	
   a	
   fibrous	
   plaque	
   (Figure	
  1-­‐3).	
   Intimal	
   SMCs	
   produce	
   extracellular	
   matrix	
   molecules	
   such	
   as	
   interstitial	
   collagen	
   and	
   elastin	
   to	
   form	
   a	
   fibrous	
   cap	
   covering	
   the	
   plaque.	
   The	
   failure	
  to	
  clear	
  dead	
  macrophage	
  and	
  SMC-­‐derived	
  foam	
  cells	
  leads	
  to	
  the	
  accumulation	
  of	
  cellular	
   debris	
   and	
   extracellular	
   lipids	
   including	
   free	
   cholesterol	
   crystals,	
   forming	
   the	
   necrotic	
   core	
   of	
   the	
   plaque	
   (Ross,	
   1993).	
   Morbidity	
   and	
   mortality	
   from	
   atherosclerosis	
   is	
   most	
   commonly	
   due	
   to	
   disruption	
  of	
  the	
  surface	
  of	
  advanced	
  lesions.	
  Several	
  factors	
  may	
  contribute	
  to	
  plaque	
  disruption,	
   including	
   macrophage-­‐derived	
   proteolytic	
   enzymes	
   and	
   pro-­‐coagulant	
   tissue	
   factors,	
   structural	
   weaknesses	
  inherent	
  in	
  the	
  lesion	
  architecture,	
  interactions	
  between	
  infiltrating	
  inflammatory	
  cells	
   such	
  as	
  T-­‐lymphocytes	
  and	
  arterial	
  cells	
  such	
  as	
  intimal	
  SMCs	
  and	
  endothelial	
  cells,	
  and	
  shear	
  stress	
   (Stary	
  et	
  al.,	
  1995).	
  	
  Thrombogenic	
  factors	
  that	
  lead	
  to	
  plaque	
  rupture	
  and	
  clot	
  formation	
  can	
  lead	
   to	
   blood	
   flow	
   obstruction	
   in	
   arterial	
   lumens	
   and	
   tissue	
   ischemia,	
   and	
   by	
   lodging	
   in	
   distal	
   arteries	
   cause	
  myocardial	
  or	
  cereberal	
  infarctions	
  (Insull,	
  2009).	
  	
    7	
   	
    	
    	
   Figure	
   1-­‐3	
   Plaque	
   activation,	
   rupture,	
   and	
   thrombosis.	
   When	
  activated,	
  immune	
  cells	
  such	
  as	
  (A)	
   macrophages	
   release	
   growth	
   factors	
   that	
   induce	
   the	
   proliferation	
   of	
   (B)	
   smooth	
   muscle	
   cells,	
   which	
   both	
   contribute	
   to	
   (C)	
   foam	
   cell	
   formation	
   that	
   increase	
   plaque	
   size.	
   Proteases,	
   also	
   released	
   by	
   immune	
  cells,	
  weaken	
  the	
  structural	
  integrity	
  of	
  the	
  plaque	
  surface	
  and	
  lead	
  to	
  (D)	
  rupture.	
  A	
  (E)	
   thrombus	
   forms	
   and	
   might	
   occlude	
   the	
   lumen	
   of	
   the	
   artery,	
   leading	
   to	
   acute	
   ischemia.	
   Adapted	
   from	
  (Hansson	
  et	
  al.,	
  2006)	
  with	
  permission	
  from	
  MacMillan	
  Publishers	
  Ltd.,	
  copyright	
  ©	
  2006.	
  	
   	
    1.3	
  Cholesterol	
  Metabolism	
  	
    Cholesterol,	
   an	
   organic	
   molecule	
   essential	
   for	
   normal	
   cellular	
   function,	
   is	
   tightly	
   regulated	
   in	
   its	
   synthesis,	
  distribution,	
  trafficking,	
  and	
  metabolism.	
  Cholesterol	
  is	
  a	
  major	
  structural	
  component	
  of	
   cellular	
   membranes,	
   modulating	
   membrane	
   fluidity	
   and	
   ion	
   permeability	
   (Haines,	
   2001).	
   In	
   conjunction	
   with	
   sphingolipids,	
   cholesterol	
   forms	
   membrane	
   lipid	
   rafts	
   involved	
   in	
   signal	
   transduction	
  (Simons	
  et	
  al.,	
  2000;	
  Kurzchalia	
  et	
  al.,	
  2003).	
  Cholesterol	
  is	
  an	
  important	
  precursor	
  in	
   the	
   synthesis	
   of	
   bile	
   acids	
   formed	
   in	
   the	
   liver,	
   oxysterols	
   formed	
   in	
   various	
   tissues,	
   vitamin	
   D	
   in	
   the	
   skin,	
   and	
   steroid	
   hormones	
   formed	
   in	
   steroidogenic	
   tissue	
   such	
   as	
   adrenal	
   glands,	
   ovaries,	
   and	
   testes	
   (Katsuda	
   et	
   al.,	
   1992;	
   Kurzchalia	
   et	
   al.,	
   2003).	
   Pathologically,	
   the	
   overaccumulation	
   of	
   cholesterol	
   in	
   arterial	
   wall	
   macrophages	
   and	
   smooth	
   muscle	
   cells	
   is	
   the	
   biochemical	
   hallmark	
   of	
   atherosclerosis,	
   manifested	
   clinically	
   as	
   ischemic	
   vascular	
   disease	
   (Katsuda	
   1992;	
   (Maxfield	
   et	
   al.,	
   2006).	
  	
  	
  	
   	
    8	
   	
    	
   1.3.1	
  Sources	
  of	
  Cholesterol	
   	
    The	
  vital	
  role	
  of	
  cholesterol	
  requires	
  a	
  tightly	
  regulated	
  homeostasis,	
  involving	
  both	
  dietary	
    and	
  de	
  novo	
  sources.	
  Exogenous	
  cholesterol	
  from	
  the	
  diet	
  is	
  absorbed	
  by	
  intestinal	
  enterocytes	
  and	
   packaged	
  into	
  chylomicrons	
  (CM),	
  also	
  containing	
  triglycerides	
  (TG)	
  (Chappell	
  et	
  al.,	
  1998;	
  Ginsberg,	
   1998;	
   Oram	
   et	
   al.,	
   2005).	
   Hepatic	
   cholesterol	
   is	
   released	
   into	
   circulation	
   with	
   TG-­‐rich	
   very-­‐low	
   density	
   lipoproteins	
   (VLDL),	
   which	
   is	
   subject	
   to	
   hydrolysis	
   by	
   peripheral	
   tissue-­‐bound	
   lipoprotein	
   lipase	
   (LPL)	
   (Ginsberg,	
   1998).	
   As	
   the	
   level	
   of	
   TG	
   decreases,	
   VLDL	
   particles	
   become	
   intermediate-­‐ density	
   lipoproteins	
   that	
   can	
   further	
   interact	
   with	
   hepatic	
   lipases	
   to	
   become	
   cholesterol-­‐rich	
   LDL	
   particles,	
  the	
  primary	
  carriers	
  of	
  cholesterol	
  for	
  delivery	
  to	
  all	
  non-­‐central	
  nervous	
  system	
  tissues.	
  	
   	
    LDL-­‐C	
  or	
  modified	
  forms	
  of	
  LDL	
  (e.g.,	
  aggregated	
  LDL,	
  oxLDL)	
  bind	
  to	
  LDL	
  receptors	
  (LDLr)	
  or	
    scavenger	
  receptors,	
  respectively,	
  expressed	
  within	
  the	
  plasma	
  membrane	
  and	
  are	
  taken	
  up	
  by	
  cells	
   by	
  receptor-­‐mediated	
  endocytosis	
  (Goldstein	
  et	
  al.,	
  1985).	
  Binding	
  to	
  the	
  LDLr	
  causes	
  invagination	
   of	
   the	
   membrane	
   and	
   formation	
   of	
   coated	
   intracellular	
   vesicles	
   (Chiang,	
   2009;	
   Goldstein	
   et	
   al.,	
   2009).	
   The	
   intracellular	
   vesicles	
   form	
   early	
   endosomes	
   which,	
   following	
   progressive	
   acidification,	
   lead	
  to	
  lysosomal	
  acid	
  lipase-­‐mediated	
  hydrolysis	
  of	
  LDL	
  cholesteryl	
  esters	
  in	
  late	
  endosomes	
  and	
   lysosomes.	
   The	
   pool	
   of	
   cholesterol	
   derived	
   from	
   LDL	
   can	
   then	
   be	
   transported	
   back	
   to	
   the	
   plasma	
   membrane,	
  to	
  the	
  endoplasmic	
  reticulum	
  for	
  re-­‐esterification,	
  or	
  to	
  the	
  mitochondria	
  (Miller,	
  2007;	
   Ohsaki	
  et	
  al.,	
  2009;	
  Olofsson	
  et	
  al.,	
  2009).	
  Hepatic	
  LDLr-­‐mediated	
  uptake	
  of	
  LDL-­‐C	
  is	
  the	
  major	
  mode	
   of	
   clearing	
   cholesterol	
   from	
   circulation,	
   where	
   it	
   is	
   metabolized	
   into	
   bile	
   acids	
   to	
   be	
   excreted	
   in	
  the	
   feces,	
  or	
  used	
  again	
  to	
  make	
  lipoproteins.	
   	
   1.3.2	
  Cholesterogenesis	
   	
    Endogenous	
   or	
   de	
   novo	
   cholesterol	
   synthesis	
   is	
   a	
   tightly	
   regulated	
   process	
   revolving	
   around	
    the	
   rate-­‐limiting	
   enzyme	
   3-­‐hydroxy-­‐3-­‐methyglutaryl	
   coenzyme	
   A	
   reductase	
   (HMG-­‐CoA	
   reductase)	
   located	
   in	
   the	
   ER	
   (Reinhart	
   et	
   al.,	
   1987).	
   HMG-­‐CoA	
   reductase	
   is	
   responsible	
   for	
   the	
   reduction	
   of	
   HMG-­‐CoA	
   to	
   mevalonate	
   using	
   two	
   molecules	
   of	
   NADPH,	
   and	
   is	
   highly	
   regulated	
   by	
   the	
   cellular	
   cholesterol	
   content	
   via	
   a	
   consensus	
   sequence	
   found	
   in	
   the	
   promoter	
   region	
   of	
   many	
   cholesterol-­‐ responsive	
   genes	
   called	
   the	
   sterol	
   regulatory	
   element	
   (SRE)	
   (Brown	
   et	
   al.,	
   1997;	
   Edwards	
   et	
   al.,	
   2000;	
   Sakai	
   et	
   al.,	
   2001).	
   	
   Sterol	
   regulatory	
   element	
   binding	
   proteins	
   (SREBPs)	
   play	
   a	
   vital	
   role	
   in	
   cholesterol	
  homeostasis	
  and	
  fatty	
  acid	
  metabolism,	
  regulating	
  over	
  30	
  genes,	
  including	
  ER-­‐derived	
   cholesterol	
   synthesis	
   by	
   HMG-­‐CoA	
   reductase	
   (Horton,	
   2002;	
   Horton	
   et	
   al.,	
   2002).	
   There	
   are	
   three	
    9	
   	
    	
   known	
  isoforms	
  of	
  SREBPs,	
  SREBP-­‐1a,	
  SREBP-­‐1c,	
  and	
  SREBP-­‐2;	
  the	
  former	
  two	
  isoforms	
  are	
  involved	
   in	
   fatty	
   acid	
   metabolism,	
   whereas	
   SREBP-­‐2	
   is	
   a	
   major	
   transcription	
   factor	
   regulating	
   de	
   novo	
   cholesterol	
   synthesis	
   (Goldstein	
   et	
   al.,	
   2006).	
   When	
   cell	
   cholesterol	
   levels	
   are	
   low,	
   SREBP-­‐2	
   is	
   synthesized	
  and	
  localized	
  to	
  the	
  ER	
  membrane	
  where	
  a	
  chaperone	
  protein	
  called	
  SREBP	
  cleavage-­‐ activating	
   protein	
   (SCAP)	
   escorts	
   SREBP-­‐2	
   to	
   the	
   Golgi	
   (Brown	
   et	
   al.,	
   2002).	
   At	
   the	
   Golgi,	
   two	
   separate	
  proteases,	
  site-­‐1	
  protease	
  and	
  site-­‐2	
  protease,	
  cleave	
  SREBP-­‐2	
  into	
  its	
  active	
  fragments,	
  of	
   which	
  two	
  nuclear	
  fragments	
  dimerize,	
  enter	
  the	
  nucleus,	
  and	
  upregulate	
  the	
  transcription	
  of	
  SRE-­‐ containing	
   target	
   genes	
   such	
   as	
   HMG-­‐CoA	
   reductase	
   and	
   LDLR.	
   Conversely,	
   when	
   cellular	
   cholesterol	
  levels	
  are	
  high,	
  cholesterol	
  binds	
  to	
  SCAP,	
  inducing	
  a	
  conformational	
  change	
  promoting	
   the	
  binding	
  of	
  an	
  ER	
  retention	
  protein	
  called	
  insulin-­‐induce	
  gene	
  protein	
  (Insig)	
  (Yang	
  et	
  al.,	
  2002).	
   The	
  Insig-­‐SCAP	
  complex	
  elicits	
  the	
  retention	
  of	
  SREBP	
  in	
  the	
  ER,	
  preventing	
  the	
  SREBP	
  migration	
  to	
   the	
   Golgi	
   and	
   consequent	
   upregulation	
   of	
   SREBP-­‐target	
   genes	
   in	
   the	
   nucleus.	
   Further,	
   high	
   cholesterol	
   levels	
   promote	
   the	
   degradation	
   of	
   HMG-­‐CoA	
   reductase	
   by	
   promoting	
   the	
   association	
   of	
   its	
  sterol-­‐sensing	
  domain	
  with	
  Insig	
  (Sever	
  et	
  al.,	
  2003).	
  	
   	
    In	
   addition	
   to	
   the	
   inhibition	
   of	
   de	
   novo	
   cholesterol	
   synthesis	
   and	
   downregulation	
   of	
   LDLr,	
    high	
   cellular	
   cholesterol	
   content	
   upregulates	
   the	
   activity	
   of	
   acyl-­‐coenzyme	
   A:cholesterol	
   acyltransferase	
   (ACAT),	
   an	
   ER	
   enzyme	
   responsible	
   for	
   the	
   re-­‐esterification	
   of	
   excess	
   unesterified	
   cholesterol	
   into	
   cholesteryl	
   esters;	
   the	
   cholesteryl	
   esters	
   are	
   stored	
   with	
   triglycerides	
   as	
   cytosolic	
   lipid	
   droplets.	
   This	
   process	
   is	
   reversed	
   by	
   neutral	
   cholesteryl	
   ester	
   hydrolase	
   (nCEH),	
   which	
   hydrolyzes	
  the	
  cholesteryl	
  esters	
  into	
  unesterified	
  cholesterol.	
  ACAT	
  and	
  nCEH	
  work	
  in	
  a	
  continuous	
   cycle	
  to	
  always	
  ensure	
  availability	
  of	
  cholesterol	
  for	
  processes	
  such	
  as	
  membrane	
  synthesis	
  (Chang	
   et	
  al.,	
  1997).	
  	
   	
   1.3.3	
  Intracellular	
  Cholesterol	
  Trafficking	
   	
    LDL-­‐receptor	
  mediated	
  uptake	
  of	
  LDL-­‐C	
  results	
  in	
  the	
  formation	
  of	
  clathrin-­‐coated	
  vesicles	
    that	
  are	
  uncoated	
  and	
  acidified	
  by	
  protons	
  pumped	
  into	
  endocytic	
  vesicular	
  lumen	
  (Mukherjee	
  et	
   al.,	
  1999;	
  Soccio	
  et	
  al.,	
  2004).	
  The	
  low	
  pH	
  of	
  the	
  endosome	
  causes	
  the	
  release	
  of	
  LDL	
  particle	
  from	
   the	
   LDLr,	
   permitting	
   the	
   recycling	
   of	
   the	
   receptors	
   and	
   other	
   proteins	
   back	
   to	
   the	
   plasma	
   membrane	
  via	
  the	
  endocytic	
  recycling	
  compartment.	
  In	
  addition	
  to	
  a	
  lower	
  pH,	
  the	
  cholesteryl	
  ester	
   containing	
   late	
   endosome	
   acquires	
   acid	
   hydrolases	
   from	
   the	
   trans-­‐Golgi	
   network	
   via	
   mannose-­‐6-­‐ phosphate	
   receptors,	
   a	
   hallmark	
   of	
   late	
   endosomes	
   (Soccio	
   et	
   al.,	
   2004).	
   The	
   late	
   endosome	
    10	
   	
    	
   delivers	
  its	
  remaining	
  contents	
  to	
  lysosomes	
  where	
  an	
  important	
  hydrolase,	
  lysosomal	
  acid	
  lipase,	
   hydrolyzes	
   triglycerides	
   and	
   LDL-­‐derived	
   cholesteryl	
   esters	
  (Sando	
   et	
   al.,	
   1985).	
   The	
   movement	
   of	
   cholesterol	
   out	
   of	
   late	
   endosomes/lysosomes	
   is	
   dependent	
   on	
   the	
   coordinate	
   actions	
   of	
   the	
   Niemann-­‐Pick	
  type	
  C2	
  (NPC2)	
  and	
  Niemann-­‐Pick	
  type	
  C1	
  (NPC1)	
  proteins	
  (Garver	
  et	
  al.,	
  2002;	
  Kwon	
   et	
   al.,	
   2009;	
   Storch	
   et	
   al.,	
   2009).	
   In	
   addition	
   to	
   the	
   NPC	
   proteins,	
   members	
   of	
   the	
   steroidogenic	
   acute	
   regulatory-­‐related	
   lipid	
   transfer	
   (START)	
   domain	
   superfamily	
   play	
   an	
   important	
   role	
   in	
   cholesterol	
   trafficking	
   throughout	
   the	
   cell,	
   exhibiting	
   the	
   ability	
   to	
   bind	
   and	
   transport	
   cholesterol	
   (Miller,	
   2007).	
   Steroidogenic	
   regulatory	
   protein	
   D3	
   (StARD3)	
   is	
   localized	
   with	
   NPC1	
   in	
   late	
   endosomes/lysosomes	
  and	
  facilitates	
  the	
  movement	
  of	
  lysosomal	
  cholesterol	
  to	
  the	
  mitochondria,	
   an	
   important	
   site	
   of	
   steroidogenic	
   hormone	
   synthesis	
   and	
   oxysterol	
   formation	
   (Alpy	
   et	
   al.,	
   2001;	
   Zhang	
   et	
   al.,	
   2002;	
   Miller,	
   2007;	
   Charman	
   et	
   al.,	
   2010).	
   Steroidogenic	
   regulatory	
   protein	
   D1	
   (StARD1),	
  considered	
  the	
  prototypical	
  member	
  of	
  the	
  StAR	
  family,	
  is	
  responsible	
  for	
  the	
  delivery	
  of	
   cholesterol	
   to	
   the	
   inner	
   mitochondrial	
   membrane.	
   Considered	
   the	
   rate-­‐limiting	
   enzyme	
   in	
   the	
   production	
   of	
   oxysterols	
   by	
   inner	
   mitochondrial	
   enzymes	
   such	
   as	
   sterol-­‐27-­‐hydroxlase,	
   overexpression	
  of	
   	
   StARD1	
   in	
   murine	
   macrophages	
   has	
   been	
   shown	
   to	
   increase	
   oxysterol-­‐mediated	
   cholesterol	
  efflux	
  (Taylor	
  et	
  al.,	
  2010).	
  	
   	
   1.3.4	
  Liver	
  X	
  Receptors	
  and	
  Oxysterols	
   	
    Liver	
  X	
  receptors	
  (LXR)	
  are	
  members	
  of	
  the	
  nuclear	
  hormone	
  receptor	
  superfamily	
  that	
  bind	
    both	
   steroidal	
   and	
   non-­‐steroidal	
   ligands	
   (Edwards	
   et	
   al.,	
   2002;	
   Francis	
   et	
   al.,	
   2003).	
   The	
   LXR	
   subfamily	
   is	
   further	
   divided	
   into	
   two	
   isoforms,	
   alpha	
   (α)	
   and	
   beta	
   (β),	
   which	
   respond	
   similarly	
   to	
   oxysterol	
  and	
  nonoxysterol	
  ligands	
  (Ulven	
  et	
  al.,	
  2005).	
  Mangelsdorf	
  and	
  colleagues	
  demonstrated	
   that	
  LXRα	
  and	
  LXRβ	
  partner	
  with	
  retinoid	
  X	
  receptor	
  (RXR)	
  to	
  form	
  obligate	
  heterodimers	
  for	
  gene	
   activation	
  (Willy	
  et	
  al.,	
  1995;	
  Willy	
  et	
  al.,	
  1997;	
  Ulven	
  et	
  al.,	
  2005).	
  Without	
  a	
  ligand,	
  the	
  LXR-­‐RXR	
   heterodimer,	
   bound	
   to	
   LXR	
   response	
   elements	
   (LXREs)	
   in	
   the	
   promoter	
   region	
   of	
   target	
   genes,	
   interacts	
  with	
  corepressors	
  and	
  remains	
  inactive	
  (Hu	
  et	
  al.,	
  2003).	
  When	
  bound	
  but	
  its	
  ligands,	
  LXR	
   undergoes	
  a	
  conformational	
  change	
  (Glass	
  et	
  al.,	
  2000)	
  whereby	
  the	
  corepressors	
  are	
  released	
  and	
   coactivators	
   are	
   recruited,	
   leading	
   to	
   gene	
   activation	
   (Glass	
   et	
   al.,	
   2000;	
   Svensson	
   et	
   al.,	
   2003;	
   Herzog	
  et	
  al.,	
   2007;	
  Lee	
  et	
  al.,	
   2008).	
   LXRs	
   are	
   thought	
   to	
   be	
   activated	
   predominantly	
   by	
   binding	
   of	
   oxysterols,	
   thus	
   serving	
   a	
   critical	
   role	
   as	
   cholesterol	
   sensors,	
   and	
   are	
   themselves	
   dependent	
   on	
   cholesterol	
  transport	
  pathways	
  and	
  oxysterol	
  generation	
  for	
  this	
  activity.	
  	
    11	
   	
    	
   	
    In	
   addition	
   to	
   genes	
   involved	
   in	
   RCT,	
   LXRs	
   regulate	
   a	
   diverse	
   array	
   of	
   genes	
   involved	
   in	
   fatty	
    acid	
   synthesis	
   (Repa	
   et	
   al.,	
   2000),	
   triglyceride	
   metabolism	
   by	
   lipoprotein	
   lipase	
   (Zhang	
   et	
   al.,	
   2001),	
   de	
  novo	
  cholesterol	
  synthesis	
  (Wang	
  et	
  al.,	
  2008),	
  degradation	
  of	
  LDLr	
  (Zelcer	
  et	
  al.,	
  2009)	
  ,	
  and	
  bile	
   acid	
   detoxification	
   (Barbier	
   et	
   al.,	
   2009).	
   LXR	
   activation	
   is	
   also	
   thought	
   to	
   play	
   a	
   protective	
   role	
   against	
   Alzheimer’s	
   disease	
   (Koldamova	
   et	
   al.,	
   2005;	
   Adighibe	
   et	
   al.,	
   2006;	
   Donkin	
   et	
   al.,	
   2010;	
   Infante	
  et	
  al.,	
  2010),	
  and	
  may	
  have	
  varying	
  effects	
  on	
  cancer	
  development	
  (Pommier	
  et	
  al.,	
  2010;	
   Villablanca	
   et	
   al.,	
   2010).	
   In	
   addition,	
   LXR	
   can	
   upregulate	
   its	
   own	
   expression	
   (Laffitte	
   et	
   al.,	
   2001;	
   Whitney	
   et	
   al.,	
   2001).	
   LXR	
   isoforms	
   are	
   also	
   important	
   regulators	
   of	
   inflammation,	
   acting	
   as	
   anti-­‐ inflammatory	
  transcription	
  factors	
  during	
  innate	
  and	
  adaptive	
  immune	
  responses	
  (Tint	
  et	
  al.,	
  1982).	
   The	
  physiological	
  ligand	
  for	
  LXR	
  in	
  these	
  pathways	
  also	
  appears	
  to	
  be	
  oxysterols.	
  Genes	
  regulated	
   by	
   oxysterol-­‐dependent	
   activation	
   of	
   LXRs	
   in	
   the	
   RCT	
   pathway	
   include	
   ATP-­‐binding	
   cassette	
   transporters	
   ABCA1,	
   ABCG1,	
   ABCG5,	
   and	
   ABCG8,	
   as	
   well	
   as	
   apolipoprotein	
   E,	
   cholesteryl	
   ester	
   transfer	
   protein,	
   phospholipid	
   transfer	
   protein,	
   scavenger	
   receptor	
   BI,	
   and	
   cholesterol	
   7alpha-­‐ hydroxylase	
  (Pannu	
  et	
  al.,	
  2012)	
  (Figure	
  1-­‐4).	
  	
   	
   	
   	
   	
   	
   	
   	
   	
    12	
   	
    	
    	
   Figure	
  1-­‐4	
  Sites	
  of	
  major	
  endogenous	
  oxysterol	
  formation.	
  The	
  uptake	
  of	
  LDL-­‐derived	
  cholesterol	
   by	
   the	
   LDL	
   receptor	
   (LDLr)	
   produces	
   an	
   endosomal/lysosomal	
   pool	
   of	
   cholesteryl	
   esters	
   (CE).	
   Lysosomal	
   acid	
   lipase	
   (LAL)	
   in	
   late	
   endosomes/lysosomes	
   hydrolyzes	
   CE	
   to	
   cholesterol	
   (C).	
   Niemann–Pick	
   type	
   C2	
   (NPC2)	
   and	
   Niemann–Pick	
   type	
   C1	
   (NPC1)	
   proteins	
   function	
   in	
   concert	
   to	
   release	
   cholesterol	
   from	
   the	
   late	
   endosomal/lysosomal	
   compartment.	
   Steroidogenic	
   acute	
   regulatory	
  protein	
  D3	
  (StARD3),	
  co-­‐localized	
  with	
  NPC1	
  at	
  the	
  lysosome,	
  facilitates	
  the	
  movement	
   of	
   cholesterol	
   to	
   mitochondria,	
   while	
   StARD4	
   may	
   play	
   a	
   role	
   in	
   trafficking	
   cholesterol	
   to	
   the	
   endoplasmic	
   reticulum.	
   The	
   mitochondrial	
   enzymes	
   sterol	
   27-­‐hydroxylase	
   (CYP27A1)	
   and	
   cholesterol	
   side-­‐chain	
   cleavage	
   P450	
   (CYP11A1)	
   produce	
   27-­‐	
   hydroxycholesterol	
   (27-­‐OHC)	
   and	
   22(R)-­‐hydroxycholesterol/20,22-­‐dihydroxycholesterol,	
   respectively.	
   The	
   endoplasmic	
   reticulum	
   enzymes	
   sterol	
   46-­‐hydroxylase	
   (CYP46A1)	
   and	
   cholesterol	
   25-­‐hydroxylase	
   (CH25H)	
   produce	
   24(S)-­‐ hydroxycholesterol	
  (24(S)-­‐OHC)	
  and	
  25-­‐OHC,	
  respectively.	
  De	
  novo	
  cholesterol	
  synthesis	
  produces	
   24(S),25-­‐epoxycholesterol	
  (24(S)-­‐25,EC).	
  Liver	
  X	
  receptor	
  (LXR)	
  forms	
  a	
  heterodimer	
  with	
  retinoid	
  X	
   receptor	
   (RXR)	
   that	
   is	
   bound	
   to	
   the	
   LXR	
   response	
   element	
   (LXRE)	
   in	
   the	
   promoter	
   region	
   of	
   LXR	
   target	
   genes.	
   Binding	
   of	
   oxysterols	
   to	
   LXR	
   activates	
   this	
   heterodimer	
   to	
   upregulate	
   expression	
   of	
   genes	
   including	
   those	
   involved	
   in	
   reverse	
   cholesterol	
   transport:	
   the	
   ATP-­‐binding	
   cassette	
   transporters	
   A1,	
   G1,	
   G5	
   and	
   G8	
   (ABCs),	
   apolipoproteins	
   including	
   apoE,	
   cholesteryl	
   ester	
   transfer	
   protein	
  (CETP),	
  phospholipid	
  transfer	
  protein	
  (PLTP),	
  scavenger	
  receptor	
  B1	
  (SR-­‐B1),	
  and	
  cholesterol	
   7a-­‐hydroxylase	
   (CYP7A1).	
   Reprinted	
   from	
   (Pannu	
   et	
   al.,	
   2012)	
   with	
   permission	
   from	
   Elsevier,	
   copyright	
  ©	
  2012.	
  	
    13	
   	
    	
   	
    Important	
   physiologic	
   activators	
   of	
   cholesterol	
   homeostasis	
   genes	
   are	
   monooxygenated	
    derivatives	
   of	
   cholesterol	
   known	
   as	
   oxysterols,	
   which	
   can	
   be	
   derived	
   from	
   enzymatic	
   and	
   nonenzymatic	
   pathways	
   (Janowski	
   et	
   al.,	
   1996;	
   Lehmann	
   et	
   al.,	
   1997).	
   Oxysterol	
   production	
   is	
   increased	
   in	
   parallel	
   with	
   increasing	
   cellular	
   cholesterol	
   content,	
   and	
   impacts	
   cell	
   cholesterol	
   homeostasis	
   by	
   both	
   liver	
   X	
   receptor	
   (LXR)	
   dependent	
   and	
   independent	
   mechanisms.	
   Therefore,	
   the	
   conversion	
   of	
   cellular	
   cholesterol	
   into	
   oxysterols	
   is	
   a	
   key	
   driving	
   force	
   in	
   upregulating	
   LXR-­‐ mediated	
   ABCA1	
   expression.	
   The	
   role	
   of	
   oxysterols	
   as	
   natural	
   ligands	
   for	
   LXR	
   was	
   initially	
   demonstrated	
   by	
   Lehmann	
   et	
   al.,	
   showing	
   activation	
   of	
   a	
   chimeric	
   LXRα-­‐LXRβ	
   plasmid	
   using	
   physiological	
   doses	
   of	
   24(S)-­‐25	
   epoxycholesterol	
   and	
   24(S)-­‐hydroxycholesterol	
   (Janowski	
   et	
   al.,	
   1996;	
   Lehmann	
   et	
   al.,	
   1997).	
   Mangelsdorf’s	
   group	
   demonstrated	
   that	
   mice	
   lacking	
   LXRα	
   rapidly	
   accumulate	
  cholesteryl	
  esters	
  in	
  the	
  liver	
  in	
  response	
  to	
  excess	
  dietary	
  cholesterol,	
  suggesting	
  a	
  key	
   role	
  of	
  LXRs	
  as	
  cholesterol	
  and	
  oxysterol	
  sensors	
  and	
  regulators	
  of	
  cholesterol	
  homeostasis	
  (Peet	
  et	
   al.,	
   1998).	
   Janowski	
   et	
   al.	
   subsequently	
   identified	
   several	
   more	
   oxysterols	
   as	
   natural	
   LXR	
   ligands,	
   further	
   supporting	
   an	
   LXR-­‐mediated	
   oxysterol	
   signaling	
   pathway.	
   DeBose-­‐Boyd	
   et	
   al.	
   showed	
   that	
   blocking	
  cholesterol	
  synthesis	
  in	
  hepatoma	
  cells	
  decreased	
  expression	
  of	
  LXR-­‐dependent	
  SREBP-­‐1c,	
   suggesting	
   transcription	
   of	
   this	
   gene	
   in	
   hepatocytes	
   requires	
   tonic	
   activation	
   of	
   LXR	
   by	
   an	
   oxysterol	
   intermediate	
   in	
   the	
   cholesterol	
   biosynthetic	
   pathway	
   (Berginer	
   et	
   al.,	
   1984).	
   The	
   first	
   evidence	
   of	
   oxysterols	
   as	
   in	
   vivo	
   LXR	
   ligands	
   was	
   reported	
   by	
   Chen	
   et	
   al.,	
   who	
   showed	
   that	
   modification	
   of	
   oxysterols	
   by	
   sulfonation	
   or	
   impairment	
   of	
   endogenous	
   oxysterol	
   production	
   diminishes	
   the	
   induction	
   of	
   LXR	
   target	
   genes	
   (Chen	
   et	
   al.,	
   2007).	
   In	
   contrast	
   to	
   the	
   mainly	
   LXR-­‐independent	
   inhibition	
   of	
   de	
   novo	
   cholesterol	
   synthesis	
   by	
   cholesterol	
   and	
   its	
   oxysterol	
   metabolite,	
   oxysterol-­‐ dependent	
   activation	
   of	
   LXRs	
   leads	
   to	
   upregulation	
   of	
   target	
   genes	
   for	
   RCT.	
   In	
   addition	
   to	
   the	
   evidence	
   that	
   endogenous	
   oxysterols	
   regulate	
   cholesterol	
   homeostasis	
   via	
   an	
   LXR-­‐dependent	
   pathway,	
   oxysterols	
   exhibit	
   other	
   activities	
   such	
   as	
   inhibiting	
   and	
   promoting	
   platelet	
   aggregation,	
   inducing	
  apoptosis,	
  and	
  modifying	
  proteins	
  including	
  by	
  post-­‐translational	
  prenylation	
  (Wolthers	
  et	
   al.,	
  1990).	
  	
   	
    The	
   most	
   potent	
   LXR-­‐activating	
   oxysterols,	
   including	
   24(S),25-­‐epoxycholesterol,	
   20(S)-­‐,	
    22(R)-­‐,	
  24(S)-­‐,	
  25-­‐,	
  and	
  27-­‐hydroxycholesterol,	
  are	
  derived	
  from	
  enzymatic	
  processing	
  (Brown	
  et	
  al.,	
   2009).	
   Weaker	
   or	
   LXR-­‐inactive	
   oxysterols	
   generated	
   non-­‐enzymatically	
   include	
   7-­‐keto-­‐,	
   7alpha-­‐ hydroxy-­‐,	
  7beta-­‐hydroxy-­‐,	
  and	
  5,6-­‐epoxycholesterol	
  (Brown	
  et	
  al.,	
  2009).	
  With	
  the	
  exception	
  of	
  25-­‐ hydroxycholesterol,	
   enzymatically-­‐derived	
   oxysterols	
   are	
   detected	
   in	
   higher	
   amounts	
   in	
   human	
    14	
   	
    	
   plasma	
  than	
  non-­‐enzymatically	
  derived	
  oxysterols	
  (Schroepfer,	
  2000),	
  and	
  the	
  former	
  are	
  believed	
   to	
  be	
  the	
  physiologically	
  relevant	
  LXR	
  agonists.	
  	
   	
   1.3.5	
  Reverse	
  Cholesterol	
  Transport	
   	
    The	
  fact	
  that	
  cholesterol	
  escapes	
  catabolism	
  in	
  most	
  cells	
  requires	
  that	
  a	
  mechanism	
  be	
  in	
    place	
   for	
   its	
   removal	
   (Pannu	
   et	
   al.,	
   2012).	
   Cholesterol	
   removal	
   from	
   non-­‐hepatic	
   cells	
   and	
   its	
   delivery	
   back	
   to	
   the	
   liver	
   for	
   excretion	
   is	
   mediated	
   by	
   multiple	
   steps	
   collectively	
   termed	
   ‘reverse	
   cholesterol	
   transport’	
   (RCT)	
   (Figure	
   1-­‐5).	
   This	
   coordinated	
   pathway	
   involves	
   the	
   activation	
   of	
   nuclear	
   liver	
   X	
   receptors	
   on	
   the	
   promoter	
   regions	
   of	
   several	
   genes,	
   including	
   those	
   encoding	
   cholesterol	
  metabolizing	
  enzymes,	
  membrane	
  lipid	
  transporters,	
  apolipoproteins,	
  and	
  lipid	
  transfer	
   proteins.	
  HDL	
  particles	
  play	
  a	
  central	
  role	
  in	
  the	
  removal	
  of	
  cholesterol	
  from	
  peripheral	
  tissues	
  and	
   delivery	
  to	
  the	
  liver	
  (Francis,	
  2010).	
  	
   	
    In	
  response	
  to	
  increased	
  cell	
  cholesterol	
  content,	
  not	
  only	
  are	
  cholesterol	
  synthesis	
  and	
  LDL-­‐  C	
   uptake	
   downregulated,	
   cholesterol	
   efflux	
   pathways	
   are	
   activated	
   leading	
   to	
   the	
   formation	
   of	
   HDL	
   particles	
  at	
  the	
  cell	
  surface.	
  Apolipoprotein	
  A-­‐I	
  (apoA-­‐I)	
  and	
  A-­‐II	
  (apoA-­‐II),	
  the	
  major	
  proteins	
  of	
  HDL	
   particles,	
   are	
   synthesized	
   by	
   the	
   liver	
   and	
   intestine,	
   and	
   are	
   secreted	
   into	
   circulation	
   in	
   a	
   non-­‐ lipidated	
   or	
   lipid-­‐poor	
   form	
   (pre-­‐β	
   HDL)	
   (Castro	
   et	
   al.,	
   1988).	
   Further	
   lipidation	
   of	
   apo-­‐AI	
   with	
   cholesterol	
  and	
  phospholipids	
  at	
  peripheral	
  tissue	
  cell	
  surfaces	
  forms	
  discoidal	
  alpha-­‐HDL	
  particles,	
   thereby	
   removing	
   tissue	
   cholesterol	
   (Davidson	
   et	
   al.,	
   2007).	
   Additional	
   lipid	
   transfers	
   to	
   HDL	
   can	
   also	
   occur	
   from	
   other	
   lipoproteins,	
   such	
   as	
   CMs	
   and	
   VLDL.	
   In	
   plasma,	
   the	
   nascent	
   HDL	
   particle	
   undergoes	
   further	
   modification	
   by	
   hepatic-­‐derived	
   lecithin-­‐cholesterol	
   acyltransferase	
   (LCAT),	
   which	
  esterifies	
  the	
  cholesterol	
  into	
  cholesteryl	
  esters.	
  The	
  newly	
  formed	
  cholesteryl	
  esters	
  migrate	
   to	
   centre	
   of	
   the	
   mature	
   HDL,	
   forming	
   a	
   spherical	
   particle	
   with	
   an	
   encapsulating	
   monolayer	
   of	
   phospholipids	
   at	
   the	
   surface.	
   Mature	
   HDL	
   particles	
   are	
   further	
   modified	
   by	
   cholesteryl	
   ester	
   transfer	
   protein	
   (CETP),	
   which	
   mediates	
   the	
   exchange	
   of	
   neutral	
   lipids	
   between	
   lipoproteins,	
   particularly	
  cholesteryl	
  esters	
  from	
  HDL	
  to	
  VLDL	
  and	
  LDL,	
  and	
  triglycerides	
  onto	
  HDL	
  (Barter	
  et	
  al.,	
   2003;	
   Park	
   et	
   al.,	
   2008).	
   The	
   presence	
   of	
   an	
   LXRE	
   in	
   the	
   CETP	
   gene	
   promoter	
   and	
   activation	
   by	
   cholesterol	
   feeding	
   highlights	
   the	
   importance	
   of	
   CETP	
   in	
   the	
   coordinate	
   movement	
   of	
   cholesterol	
   from	
  tissues	
  via	
  HDL	
  onto	
  apoB-­‐containing	
  lipoproteins,	
  for	
  uptake	
  by	
  the	
  liver	
  (Fielding	
  et	
  al.,	
  1995;	
   Barter	
   et	
   al.,	
   2003;	
   Park	
   et	
   al.,	
   2008;	
   Tall	
   et	
   al.,	
   2008).	
   HDL	
   triglyceride	
   is	
   metabolized	
   by	
   hepatic	
   lipase	
  located	
  on	
  hepatocyte	
  surfaces	
  (Fielding	
  et	
  al.,	
  1995;	
  Mak	
  et	
  al.,	
  2002;	
  Laffitte	
  et	
  al.,	
  2003;	
    15	
   	
    	
   Oram	
   et	
   al.,	
   2005;	
   Hoekstra	
   et	
   al.,	
   2010).	
   The	
   phospholipid	
   transfer	
   protein	
   gene,	
   the	
   product	
   of	
   which	
  is	
  responsible	
  for	
  the	
  transfer	
  of	
  phospholipids	
  and	
  cholesterol	
  from	
  VLDL	
  and	
  chylomicrons	
   to	
  HDL,	
  is	
  also	
  an	
  LXR	
  target	
  and	
  contains	
  an	
  LXRE	
  (Mak	
  et	
  al.,	
  2002;	
  Laffitte	
  et	
  al.,	
  2003;	
  Hoekstra	
  et	
   al.,	
   2010).	
   Scavenger	
   receptor	
   type	
   B1	
   (SR-­‐B1)	
   is	
   believed	
   to	
   have	
   a	
   major	
   role,	
   among	
   others,	
   in	
   delivery	
   of	
   HDL-­‐derived	
   cholesteryl	
   esters	
   to	
   the	
   liver	
   and	
   steroidogenic	
   tissue	
   (Hoekstra	
   et	
   al.,	
   2010).	
  The	
  SR-­‐B1	
  gene	
  also	
  has	
  an	
  LXRE	
  region	
  that	
  responds	
  to	
  oxysterol-­‐stimulated	
  LXR	
  activation	
   (Malerod	
   et	
   al.,	
   2002).	
   This	
   pathway	
   regenerates	
   lipid-­‐poor	
   apoA-­‐I	
   that	
   recycles	
   through	
   the	
   RCT	
   pathway.	
  	
  	
    	
   Figure	
  1-­‐5	
  Reverse	
  cholesterol	
  transport.	
  HDL	
  has	
  a	
  central	
  role	
  in	
  the	
  reverse	
  cholesterol	
  transport	
   pathway.	
   Lipid-­‐poor	
   apo	
   A-­‐I	
   is	
   secreted	
   by	
   the	
   liver	
   and	
   rapidly	
   acquires	
   cholesterol	
   via	
   the	
   hepatocyte	
   ABCA1	
   transporter	
   and	
   promotes	
   cholesterol	
   efflux	
   from	
   macrophages	
   and	
   smooth	
   muscle	
  cells.	
  Free	
  cholesterol	
  is	
  esterified	
  to	
  cholesteryl	
  esters	
  by	
  LCAT	
  to	
  form	
  mature	
  HDL,	
  which	
   transfers	
  its	
  cholesterol	
  to	
  apo	
  B-­‐containing	
  lipoproteins,	
  such	
  as	
  VLDL	
  and	
  LDL,	
  via	
  CETP-­‐mediated	
   transfer.	
  This	
  cholesterol	
  is	
  subsequently	
  taken	
  up	
  by	
  the	
  liver	
  via	
  the	
  LDL	
  receptor.	
  PLTP	
  transfers	
   phospholipids	
  from	
  triglyceride-­‐rich	
  lipoproteins	
  to	
  HDL,	
  which	
  promotes	
  HDL	
  remodeling.	
  Hepatic	
   cholesterol	
  can	
  be	
  excreted	
  into	
  the	
  bile	
  after	
  conversion	
  to	
  bile	
  acid	
  or	
  expelled	
  directly	
  into	
  the	
   bile	
   as	
   cholesterol.	
   Bile	
   and	
   its	
   components	
   are	
   either	
   reabsorbed	
   by	
   the	
   intestine	
   or	
   ultimately	
   excreted	
  in	
  feces.	
  HDL	
  can	
  be	
  remodeled	
  by	
  lipases,	
  such	
  as	
  endothelial	
  lipase	
  and	
  hepatic	
  lipase,	
   which	
   hydrolyze	
   HDL	
   phospholipids	
   and	
   HDL	
   triglycerides,	
   respectively.	
   Reprinted	
   from	
   (Navab	
   et	
   al.,	
  2011)	
  with	
  permission	
  from	
  MacMillan	
  Publishers	
  Ltd.,	
  copyright	
  ©	
  2011.	
  	
    16	
   	
    	
   1.3.6	
  ABCA1-­‐dependent	
  HDL	
  Formation	
   	
    The	
   ATP-­‐binding	
   cassette	
   (ABC)	
   transporters	
   responsible	
   for	
   the	
   delivery	
   of	
   excess	
    cholesterol	
   belong	
   to	
   a	
   superfamily	
   of	
   48	
   members	
   subdivided	
   into	
   7	
   families,	
   ABC	
   A	
   to	
   G	
  (Oram	
   et	
   al.,	
  2005;	
  Kaminski	
  et	
  al.,	
  2006).	
  The	
  hallmark	
  characteristic	
  of	
  these	
  transporters	
  is	
  the	
  hydrolysis	
   of	
  adenosine	
  triphosphate	
  for	
  the	
  translocation	
  of	
  substrates	
  across	
  membranes	
  (Rees	
  et	
  al.,	
  2009).	
   The	
  removal	
  of	
  cholesterol	
  from	
  peripheral	
  tissues	
  is	
  dependent	
  on	
  the	
  binding	
  of	
  lipid-­‐free	
  or	
  lipid-­‐ poor	
  apolipoprotein	
  A-­‐I	
  (apoA-­‐I),	
  the	
  major	
  acceptor	
  of	
  unesterified	
  cholesterol	
  effluxed	
  at	
  cellular	
   surfaces.	
   Francis	
   et	
   al	
   demonstrated	
   that	
   cells	
   from	
   patients	
   with	
   the	
   severe	
   hypoalphalipoproteinemia	
   condition	
   Tangier	
   disease	
   are	
   deficient	
   in	
   apo-­‐AI	
   mediated	
   removal	
   of	
   unesterified	
   cholesterol	
   and	
   phospholipids,	
   strongly	
   suggesting	
   that	
   HDL	
   formation	
   is	
   apoA-­‐I	
   dependent	
  (Francis	
  et	
  al.,	
  1995)	
  and	
  that	
  these	
  cells	
  have	
  a	
  lipid	
  efflux	
  defect.	
  In	
  1999,	
  the	
  discovery	
   of	
  ABCA1	
  mutations	
  as	
  the	
  underlying	
  molecular	
  defect	
  in	
  Tangier	
  disease	
  by	
  several	
  independent	
   groups	
   identified	
   ABCA1	
   as	
   a	
   major	
   regulator	
   of	
   HDL	
   metabolism	
   and	
   pivotal	
   to	
   the	
   apoA-­‐I	
   dependent	
  efflux	
  of	
  cell	
  phospholipids	
  and	
  cholesterol	
  to	
  form	
  nascent	
  HDL	
  particles	
  (Bodzioch	
  et	
   al.,	
  1999;	
  Brooks-­‐Wilson	
  et	
  al.,	
  1999;	
  Lawn	
  et	
  al.,	
  1999;	
  Rust	
  et	
  al.,	
  1999;	
  Brousseau	
  et	
  al.,	
  2000).	
   Humans	
  heterozygous	
  for	
  ABCA1	
  mutations	
  exhibit	
  approximately	
  half-­‐normal	
  levels	
  of	
  circulating	
   plasma	
  HDL,	
  further	
  establishing	
  that	
  apoA-­‐I	
  mediated	
  HDL	
  formation	
  is	
  exclusively	
  dependent	
  on	
   ABCA1	
  (Frikke-­‐Schmidt	
  et	
  al.,	
  2004).	
  	
   	
    1.4	
  ATP-­‐binding	
  cassette	
  transporter	
  A1	
  (ABCA1)	
   1.4.1	
  General	
  	
   	
    ABC	
   transporters	
   are	
   primary	
   active	
   transporters,	
   whereby	
   they	
   bind	
   their	
   substrate	
   and	
    move	
   it	
   through	
   the	
   membrane	
   using	
   ATP	
   hydrolysis	
   to	
   pump	
   against,	
   or	
   sometimes	
   with,	
   a	
   substrate	
   concentration	
   gradient	
   (Rees	
   et	
   al.,	
   2009).	
   The	
   prototypical	
   ABC	
   transporter	
   is	
   a	
   large	
   protein	
   with	
   12	
   transmembrane	
   domains	
   and	
   two	
   nucleotide	
   binding	
   sites,	
   assembled	
   from	
   half-­‐ molecules,	
  quarter	
  molecules,	
  or	
  as	
  one	
  piece	
  (Kaminski	
  et	
  al.,	
  2006).	
  A	
  significant	
  number	
  of	
  the	
   ABC	
   transporter	
   family	
   have	
   been	
   identified	
   as	
   lipid	
   transporters	
   for	
   substrates	
   such	
   as	
   phospholipids,	
   sterols,	
   and	
   sphingolipids,	
   playing	
   key	
   roles	
   in	
   lipoprotein	
   and	
   cholesterol	
   metabolism	
   and	
   homeostasis,	
   including	
   ABCA1,	
   ABCA3,	
   ABCA12,	
   ABCB4,	
  and	
   ABCG5/G8.	
   Mutations	
   in	
  ABCA1	
  cause	
  Tangier	
  disease,	
  a	
  rare	
  genetic	
  disorder	
  characterized	
  by	
  the	
  virtual	
  absence	
  of	
  HDL,	
   resulting	
  from	
  defective	
  cholesterol	
  and	
  phospholipid	
  efflux	
  from	
  the	
  plasma	
  membrane	
  to	
  apoA-­‐I,	
    17	
   	
    	
   causing	
   cholesteryl	
   ester	
   accumulation	
   in	
   several	
   tissues	
   such	
   as	
   tonsils,	
   lymph	
   nodes,	
   liver,	
   spleen,	
   thymus,	
   intestine,	
   and	
   Schwann	
   cells	
   (Oram,	
   2000).	
   Mutations	
   in	
   ABCA3	
   inhibit	
   pulmonary	
   surfactant	
  lipid	
  efflux	
  from	
  the	
  lungs	
  of	
  newborns	
  causing	
  neonatal	
  surfactant	
  deficiency	
  (Shulenin	
   et	
  al.,	
  2004).	
  Mutations	
  in	
  ABCA12	
  cause	
  defective	
  lipid	
  trafficking	
  in	
  keratinocytes,	
  causing	
  the	
  skin	
   diseases	
  harlequin	
  and	
  lamellar	
  ichthyosis	
  (Kelsell	
  et	
  al.,	
  2005).	
  Mutations	
  in	
  ABCB4	
  and	
  ABCG5/G8	
   cause	
   defective	
   phospholipid	
   and	
   sterol	
   transport,	
   respectively,	
   leading	
   to	
   intrafamilial	
   hepatic	
   disease	
  and	
  sitosterolemia,	
  respectively	
  (Hubacek	
  et	
  al.,	
  2001;	
  Rosmorduc	
  et	
  al.,	
  2007).	
  	
   	
    ABCA1	
   is	
   the	
   preeminent	
   member	
   of	
   the	
   ABCA	
   subfamily	
   of	
   ABC	
   transporters,	
   widely	
    expressed	
   in	
   a	
   diverse	
   number	
   of	
   tissues,	
   especially	
   placenta,	
   liver,	
   lung,	
   adrenal	
   glands,	
   fetal	
   capillaries,	
   and	
   small	
   intestine,	
   with	
   moderate	
   expression	
   in	
   the	
   heart,	
   aorta,	
   brain,	
   and	
   spleen	
   (Langmann	
   et	
   al.,	
   1999;	
   Wellington	
   et	
   al.,	
   2002).	
   Although	
   first	
   cloned	
   in	
   1994	
   by	
   the	
   Chimini	
   group	
   (Luciani	
  et	
  al.,	
  1994),	
  discovering	
  the	
  definitive	
  role	
  of	
  ABCA1	
  as	
  a	
  principal	
  lipid	
  transporter	
  began	
   from	
   the	
   study	
   of	
   Tangier	
   disease	
   patients	
   from	
   Tangier	
   Island	
   in	
   Chesapeake	
   Bay,	
   Virginia	
   (Fredrickson	
  D	
  S,	
  1961),	
  and	
  the	
  studies	
  of	
  Francis	
  et	
  al.	
  showing	
  that	
  phospholipid	
  and	
  cholesterol	
   efflux	
  to	
  apoA-­‐I	
  is	
  defective	
  in	
  cells	
  from	
  Tangier	
  disease	
  patients	
  (Francis	
  et	
  al.,	
  1995).	
  Consistent	
   with	
   the	
   findings	
   of	
   Tangier	
   disease,	
   mice	
   with	
   a	
   targeted	
   inactivation	
   of	
   ABCA1	
   display	
   near	
   absence	
   of	
   HDL,	
   as	
   ABCA1-­‐mediated	
   lipid	
   efflux	
   is	
   the	
   rate-­‐limiting	
   step	
   in	
   HDL	
   formation	
   (McNeish	
   et	
   al.,	
   2000;	
   Timmins	
   et	
   al.,	
   2005).	
   In	
   addition	
   to	
   HDL	
   deficiency,	
   ABCA1	
   mutations	
   result	
   in	
   premature	
  atherosclerosis,	
  highlighting	
  the	
  importance	
  of	
  ABCA1	
  in	
  HDL-­‐dependent	
  prevention	
  of	
   atherosclerosis	
  (Bodzioch	
  et	
  al.,	
  1999;	
  Oram,	
  2000).	
  	
   	
   	
   1.4.2	
  	
  	
  Structure	
  	
   	
    Structurally,	
  all	
  ABCA	
  transporters	
  are	
  full-­‐size	
  transporters	
  characterized	
  by	
  two	
  cytosolic-­‐  facing	
  nucleotide-­‐binding	
  domains	
  and	
  two	
  transmembrane	
  domains,	
  each	
  containing	
  six	
  to	
  eleven	
   membrane-­‐spanning	
   α-­‐helices	
   (Cavelier	
   et	
   al.,	
   2006)	
   (Figure	
   1-­‐6).	
   ABCA1	
   is	
   a	
   2261	
   amino	
   acid	
   integral	
   membrane	
   associated	
   multiunit	
   complex	
   arranged	
   in	
   two	
   similar	
   halves,	
   each	
   half	
   containing	
  a	
  six	
  transmembrane-­‐spanning	
  domain	
  and	
  a	
  nucleotide-­‐binding	
  domain	
  containing	
  two	
   conserved	
  peptide	
  motifs	
  termed	
  Walker	
  A	
  and	
  Walker	
  B.	
  Each	
  half	
  of	
  ABCA1	
  is	
  predicted	
  to	
  have	
  a	
   large	
   and	
   highly	
   glycosylated	
   extracellular	
   loop	
   with	
   both	
   loops	
   linked	
   by	
   one	
   or	
   more	
   disulfide	
   bonds	
  between	
  cysteine	
  residues	
  (Bungert	
  et	
  al.,	
  2001;	
  Fitzgerald	
  et	
  al.,	
  2001;	
  Oram,	
  2003).	
  	
  	
    18	
   	
    	
    	
   Figure	
   1-­‐6	
   ABCA1	
   structure.	
   ABCA1	
  is	
  composed	
  of	
  two	
  domains	
  with	
  six	
  helices	
  each.	
  The	
  cytosolic	
   parts	
   of	
   the	
   transmembrane	
   protein	
   consist	
   of	
   the	
   nucleotide	
   binding	
   domains	
   containing	
   the	
   Walker	
   A	
   and	
   Walker	
   B	
   conserved	
   peptide	
   motifs.	
   Adapted	
   from	
   (Maxfield	
   et	
   al.,	
   2005)	
   with	
   permission	
  from	
  MacMillan	
  Publishers	
  Ltd.,	
  copyright	
  ©	
  2005.	
  Permissions	
  pending	
   	
   1.4.3	
  Initial	
  HDL	
  Formation	
  and	
  ATP-­‐binding	
  Cassette	
  Transporters	
   	
    	
  ATP-­‐binding	
   cassette	
   transporter	
   A-­‐1	
   (ABCA1)	
   is	
   an	
   integral	
   membrane	
   transporter	
   that	
    facilitates	
   the	
   movement	
   of	
   cell	
   phospholipids	
   and	
   cholesterol	
   onto	
   exchangeable	
   lipid-­‐poor	
   apolipoproteins,	
  in	
  particular	
  apoA-­‐I,	
  to	
  initiate	
  the	
  formation	
  of	
  nascent	
  HDL	
  particles	
  (Remaley	
  et	
   al.,	
   2001;	
   Oram	
   et	
   al.,	
   2005).	
   Another	
   ABC	
   transporter,	
   ABCG1,	
   is	
   believed	
   to	
   promote	
   additional	
   efflux	
  of	
  cellular	
  cholesterol	
  to	
  preformed	
  HDL	
  particles	
  (Rothblat	
  et	
  al.,	
  1999;	
  Klucken	
  et	
  al.,	
  2000;	
   Cavelier	
  et	
  al.,	
  2006;	
  Lund-­‐Katz	
  et	
  al.,	
  2010).	
  ABCG1	
  mediates	
  cholesterol	
  efflux	
  to	
  small	
  and	
  larger	
   HDL	
  subclasses,	
  HDL3	
  and	
  HDL2	
  respectively,	
  but	
  not	
  lipid-­‐poor	
  apo-­‐AI.	
  The	
  induction	
  of	
  ABCA1	
  and	
   ABCG1	
   expression	
   by	
   cholesterol	
   loading	
   and	
   synthetic	
   LXR	
   agonists,	
   in	
   various	
   cell	
   types	
   and	
   tissues	
  including	
  macrophages	
  (Venkateswaran	
  et	
  al.,	
  2000;	
  Aye	
  et	
  al.,	
  2010;	
  Jiang	
  et	
  al.,	
  2010)	
  and	
   placenta	
   (Venkateswaran	
   et	
   al.,	
   2000;	
   Aye	
   et	
   al.,	
   2010;	
   Jiang	
   et	
   al.,	
   2010),	
   suggest	
   a	
   coordinated	
   role	
   of	
   these	
   two	
   transporters	
   in	
   managing	
   cellular	
   cholesterol	
   overload.	
   The	
   ABCA-­‐1	
   mediated	
   cholesterol	
  efflux	
  model	
  suggests	
  that	
  lipid-­‐rich	
  microdomains	
  in	
  the	
  plasma	
  membrane	
  are	
  formed	
   by	
  ABCA1,	
  promoting	
  the	
  binding	
  of	
  apoA-­‐I	
  to	
  which	
  cholesterol	
  and	
  phospholipids	
  are	
  transferred	
    19	
   	
    	
   to	
  form	
  nascent	
  HDL	
  particles.	
  In	
  addition	
  to	
  this	
  indirect	
  interaction,	
  it	
  has	
  also	
  been	
  demonstrated	
   that	
  ABCA1	
  directly	
  interacts	
  with	
  apoA-­‐I	
  [reviewed	
  in	
  (Boadu	
  et	
  al.,	
  2008)].	
  	
   	
    In	
   addition	
   to	
   active	
   cholesterol	
   transport	
   across	
   the	
   plasma	
   membrane	
   via	
   ABCA1,	
    cholesterol	
  efflux	
  can	
  also	
  occur	
  by	
  passive	
  diffusion	
  down	
  a	
  concentration	
  gradient	
  from	
  the	
  cell	
   surface	
   to	
   HDL,	
   LDL,	
   albumin,	
   and	
   protein-­‐free	
   phospholipid	
   vesicles	
   (Kawano	
   et	
   al.,	
   1993).	
   This	
   gradient	
   can	
   be	
   created	
   by	
   extracellular	
   cholesterol	
   esterification	
   by	
   LCAT,	
   and	
   augmented	
   by	
   ABCG1	
  and	
  SR-­‐B1,	
  which	
  redistribute	
  cholesterol	
  across	
  the	
  plasma	
  membrane	
  (Ji	
  et	
  al.,	
  1997;	
  Jian	
   et	
  al.,	
  1998;	
  Gu	
  et	
  al.,	
  2000;	
  de	
  La	
  Llera-­‐Moya	
  et	
  al.,	
  2001).	
  	
   	
   1.4.4	
  ABCA1	
  Cellular	
  Distribution	
   	
    Primarily	
   localized	
   to	
   the	
   plasma	
   membrane	
   (PM),	
   ABCA1	
   is	
   also	
   found	
   in	
   the	
   Golgi	
   and	
    endocytic	
   vesicles	
   such	
   as	
   early	
   endosomes,	
   late	
   endosomes,	
   and	
   lysosomes	
   (Orso	
   et	
   al.,	
   2000;	
   Neufeld	
   et	
   al.,	
   2001;	
   Neufeld	
   et	
   al.,	
   2002).	
   The	
   predominant	
   presence	
   of	
   ABCA1	
   at	
   the	
   PM	
   emphasizes	
   the	
   important	
   function	
   of	
   ABCA1	
   at	
   the	
   cell	
   surface	
   to	
   lipidate	
   apo-­‐AI.	
   Cell-­‐surface	
   labeling	
  and	
  immunoprecipitation	
  studies	
  provided	
  the	
  initial	
  evidence	
  of	
  ABCA1	
  localization	
  at	
  the	
   PM,	
   with	
   lipid	
   efflux	
   rates	
   correlating	
   with	
   the	
   amount	
   of	
   ABCA1	
   present	
   (Lawn	
   et	
   al.,	
   1999).	
   Further	
   studies	
   observing	
   ABCA1-­‐FLAG-­‐transfected	
   Human	
   Embryonic	
   Kidney	
   cells	
   using	
   immunofluoresence	
  confocal	
  microscopy	
  support	
  the	
  localization	
  of	
  ABCA1	
  at	
  the	
  PM	
   (Wang	
  et	
  al.,	
   2000).	
   The	
   presence	
   of	
   ABCA1	
   in	
   endocytic	
   vesicles	
   has	
   suggested	
   a	
   retroendocytic	
   mechanism	
   involving	
   endocytosis	
   of	
   an	
   ABCA1-­‐apoA-­‐I	
   complex,	
   lipidation	
   of	
   apoA-­‐I	
   to	
   form	
   HDL,	
   and	
   resecretion	
   of	
   the	
   HDL	
   particle.	
   The	
   inhibition	
   of	
   receptor-­‐mediated	
   endocytosis	
   in	
   murine	
   macrophages	
  and	
  consequent	
  reduction	
  in	
  apoA-­‐I-­‐mediated	
  cholesterol	
  efflux	
  supports	
  the	
  concept	
   of	
   ABCA1	
   migration	
   from	
   the	
   PM	
   to	
   intracellular	
   compartments	
   (Takahashi	
   et	
   al.,	
   1999)	
   and	
   recycling	
  of	
  ABCA1	
  back	
  to	
  the	
  cell	
  surface	
  (Neufeld	
  et	
  al.,	
  2001;	
  Neufeld	
  et	
  al.,	
  2004).	
  Time-­‐lapse	
   fluorescence	
   microscopy	
   studies	
   show	
   ABCA1-­‐green	
   fluorescent	
   protein	
   fusion	
   complexes	
   travel	
   between	
   the	
   PM	
   and	
   late	
   endosome/lysosomal	
   compartments,	
   which	
   when	
   disrupted	
   by	
   intracellular	
  vesicular	
  traffic	
  blocking	
  agents,	
  traps	
  the	
  ABCA1	
  complex	
  intracellularly	
  and	
  markedly	
   reduces	
  apoA-­‐I-­‐mediated	
  cholesterol	
  efflux	
  (Neufeld	
  et	
  al.,	
  2001).	
  The	
  trafficking	
  of	
  ABCA1	
  between	
   the	
  late	
  endosomal/lyosomal	
  compartments	
  and	
  the	
  PM	
  suggests	
  intracellular	
  pools	
  of	
  unesterified	
   cholesterol	
  contribute	
  to	
  the	
  lipidation	
  of	
  apoA-­‐I	
  to	
  form	
  nascent	
  HDL	
  particles.	
  	
   	
    20	
   	
    	
   1.4.5	
  Oxysterols	
  and	
  ABCA1	
  Expression	
   	
    	
  ABCA1	
   protein	
   has	
   a	
   high	
   turnover	
   rate	
   with	
   a	
   short	
   half-­‐life	
   of	
   1-­‐2	
   hours,	
   suggesting	
   levels	
    of	
   ABCA1	
   are	
   tightly	
   regulated	
   by	
   transcriptional	
   factors	
   (Wang	
   et	
   al.,	
   2002;	
   Wang	
   et	
   al.,	
   2003;	
   Schmitz	
  et	
  al.,	
  2005).	
  ABCA1	
  transcription	
  is	
  regulated	
  by	
  numerous	
  molecules	
  such	
  as	
  cholesterol,	
   dietary	
   lipids,	
   hormones,	
   and	
   cytokines	
   (Schmitz	
   et	
   al.,	
   2005).	
   Cellular	
   cholesterol	
   overload	
   stimulates	
   the	
   transcription	
   of	
   ABCA1	
   via	
   oxysterol	
   activation	
   of	
   the	
   nuclear	
   transcription	
   factors	
   liver	
  X	
  receptors	
  (LXR)	
  (Schwartz	
  et	
  al.,	
  2000).	
   	
    Sterol	
   27-­‐hydroxylase	
   (CYP27A1)	
   was	
   the	
   first	
   oxysterol-­‐producing	
   enzyme	
   to	
   be	
   discovered	
    (Wikvall,	
   1984).	
   It	
   is	
   one	
   of	
   the	
   cytochrome	
   P-­‐450	
   enzymes	
   localized	
   to	
   the	
   inner	
   mitochondrial	
   membrane,	
   and	
   produces	
   27-­‐hydroxycholesterol	
   (27-­‐OHC)	
   (Russell,	
   2000).	
   The	
   severe	
   clinical	
   phenotype	
  of	
  patients	
  with	
  CYP27A1	
  deficiency,	
  known	
  as	
  cerebrotendinous	
  xanthomatosis	
  (CTX),	
   indicates	
   the	
   critical	
   role	
   of	
   27-­‐OHC	
   in	
   cholesterol	
   homeostasis	
   (Oftebro	
   et	
   al.,	
   1980;	
   Cali	
   et	
   al.,	
   1991;	
  Bjorkhem,	
  2001).	
  Patients	
  with	
  this	
  rare	
  autosomal	
  recessive	
  disease	
  accumulate	
  cholesterol	
   and	
   its	
   metabolite	
   cholestanol	
   in	
   many	
   tissues,	
   exhibiting	
   multiple	
   xanthomas	
   in	
   the	
   brain	
   and	
   tendons,	
   and	
   dysfunction	
   of	
   myelin	
   sheaths	
   leading	
   to	
   a	
   potentially	
   fatal	
   neuropathy	
   (Moghadasian	
   et	
   al.,	
   2002).	
   Many	
   CTX	
   patients	
   develop	
   premature	
   atherosclerosis	
   with	
   excess	
   cholesterol	
   accumulation	
   in	
   the	
   artery	
   wall,	
   evidence	
   that	
   CYP27A1	
   plays	
   an	
   essential	
   role	
   in	
   modulating	
   cholesterol	
   overload	
   (Potkin	
   et	
   al.,	
   1988;	
   Segev	
   et	
   al.,	
   1995;	
   von	
   Bahr	
   et	
   al.,	
   2002).	
   CYP27A1	
   is	
   unique	
   in	
   that	
   it	
   plays	
   a	
   role	
   in	
   both	
   oxysterol	
   and	
   bile	
   acid	
   synthesis,	
   with	
   the	
   former	
   mediating	
   LXR-­‐dependent	
   and	
   independent	
   effects	
   on	
   cholesterol	
   homeostasis.	
   CYP27A1	
   acts	
   on	
   multiple	
   intermediates	
  in	
  bile	
  acid	
  synthesis	
  pathway	
  to	
  initiate	
  bile	
  acid	
  formation	
  and	
  side	
  chain	
  oxidation	
   (Russell,	
  2003).	
  CYP27A1	
  is	
  expressed	
  in	
  human	
  liver	
  and	
  fibroblasts	
  (Cali	
  et	
  al.,	
  1991),	
  and	
  is	
  also	
   found	
  in	
  lung	
  macrophages	
  and	
  arterial	
  endothelial	
  cells	
  (Babiker	
  et	
  al.,	
  1997).	
  Importantly,	
  27-­‐OHC	
   is	
  the	
  most	
  abundant	
  oxysterol	
  in	
  the	
  human	
  artery	
  wall	
  (Bjorkhem	
  et	
  al.,	
  1994;	
  Dzeletovic	
  et	
  al.,	
   1995;	
   Brown	
   et	
   al.,	
   1999;	
   Meaney	
   et	
   al.,	
   2002).	
   27-­‐OHC	
   is	
   not	
   only	
   capable	
   of	
   inducing	
   ABCA1,	
   ABCG1,	
   and	
   apoE	
   expression	
   via	
   LXR	
   activation	
   (Kim	
   et	
   al.,	
   2009),	
   its	
   secretion	
   may	
   also	
   be	
   a	
   significant	
   form	
   of	
   HDL-­‐independent	
   cholesterol	
   efflux	
   (Bjorkhem	
   et	
   al.,	
   1994).	
   27-­‐ hydroxycholesterol	
   is	
   present	
   in	
   higher	
   amounts	
   in	
   the	
   plasma	
   of	
   patients	
   with	
   atherosclerosis	
   (Babiker	
  et	
  al.,	
  2005).	
  	
  	
   	
    CYP27A1	
  expression	
  in	
  human	
  atherosclerotic	
  lesions	
  has	
  been	
  reported	
  to	
  be	
  higher	
  than	
    in	
  normal	
  arteries	
  (Shanahan	
  et	
  al.,	
  2001).	
  Fu	
  et	
  al.	
  demonstrated	
  the	
  critical	
  role	
  of	
  27-­‐OHC	
  over	
    21	
   	
    	
   other	
  oxysterols	
  as	
  an	
   endogenous	
   LXR	
   ligand	
   and	
   in	
   activating	
   ABCA1	
   in	
   human	
   monocyte-­‐derived	
   macrophages	
   and	
   fibroblasts	
   (Fu	
   et	
   al.,	
   2001).	
   Our	
   group’s	
   recent	
   findings	
   of	
   reduced	
   ABCA1	
   expression	
   in	
   human	
   intimal	
   smooth	
   muscle	
   cells	
   and	
   the	
   ability	
   of	
   exogenous	
   oxysterols	
   to	
   correct	
   reduced	
  ABCA1	
  expression	
  in	
  cultured	
  intima-­‐type	
  smooth	
  muscle	
  cells	
  suggests	
  a	
  possible	
  defect	
  of	
   CYP27A1	
  expression	
  in	
  these	
  cells	
  (Choi	
  et	
  al.,	
   2009).	
   The	
   second	
   product	
   of	
   CYP27A1,	
   cholestenoic	
   acid,	
  is	
  believed	
  to	
  be	
  more	
  potent	
  than	
  27-­‐OHC	
  as	
  an	
  LXR	
  ligand,	
  but	
  is	
  produced	
  predominantly	
  in	
   the	
  lung	
  (Babiker	
  et	
  al.,	
  1999;	
  Song	
  et	
  al.,	
  2000).	
  	
  	
   	
    2,3-­‐oxidosqualene	
  cyclase,	
  an	
  intermediate	
  enzyme	
  in	
  the	
  cholesterol	
  biosynthetic	
  pathway,	
    is	
   directly	
   responsible	
   for	
   the	
   production	
   of	
   24(S),25-­‐epoxycholesterol	
   (24,25EC)	
   in	
   the	
   ER	
   and	
   cytoplasm.	
   Although	
   initially	
   considered	
   a	
   liver-­‐specific	
   oxysterol,	
   24,25EC	
   is	
   believed	
   to	
   be	
   produced	
  by	
  all	
  cells	
  that	
  synthesize	
  cholesterol	
  including	
  macrophages	
  (Rowe	
  et	
  al.,	
  2003;	
  Wong	
  et	
   al.,	
   2004)	
   and	
   fibroblasts	
   (Spencer	
   et	
   al.,	
   1985).	
   The	
   addition	
   of	
   24,25EC	
   to	
   cultured	
   cells	
   downregulates	
  the	
  rate-­‐limiting	
  enzyme	
  in	
  cholesterol	
  synthesis,	
  hydroxymethylglutaryl-­‐CoA	
  (HMG-­‐ CoA)	
   reductase	
   (Spencer	
   et	
   al.,	
   1985;	
   Soccio	
   et	
   al.,	
   2004).	
   The	
   epoxide	
   group	
   on	
   24,25EC	
   is	
   responsible	
  for	
  the	
  increased	
  polarity	
  of	
  the	
  molecule,	
  and	
  thus,	
  its	
  ability	
  to	
  be	
  transported	
  quickly	
   intra-­‐	
   and	
   intercellulary.	
   Evidence	
   suggests	
   a	
   role	
   for	
   24,25EC	
   in	
   fine	
   tuning	
   acute	
   regulation	
   of	
   cholesterol	
   homeostasis,	
   if	
   not	
   a	
   major	
   role	
   in	
   LXR-­‐dependent	
   upregulation	
   of	
   ABCA1	
   in	
   RCT	
   (Wong	
   et	
  al.,	
  2008).	
  	
   	
    CYP11A1,	
   also	
   known	
   as	
   the	
   cytochrome	
   P450	
   side-­‐chain	
   cleavage	
   enzyme,	
   is	
   responsible	
    for	
  production	
  of	
  two	
  other	
  potent	
  LXR	
  agonists,	
  22(R)-­‐hydroxycholesterol	
  (22(R)-­‐OHC)	
  and	
  20,22-­‐ dihydroxycholesterol.	
  	
  This	
  enzyme	
  belongs	
  to	
  a	
  group	
  of	
  inner	
  mitochondrial	
  membrane	
  enzymes	
   responsible	
   for	
   the	
   production	
   of	
   oxysterols,	
   and	
   is	
   highly	
   expressed	
   in	
   steroidogenic	
   tissue	
   such	
   as	
   the	
   adrenal	
   glands,	
   ovaries,	
   testis,	
   placenta,	
   and	
   brain	
   (Waterman	
   et	
   al.,	
   1989;	
   Mellon	
   et	
   al.,	
   2002),	
   in	
  addition	
  to	
  the	
  pancreas	
  (Morales	
  et	
  al.,	
  1999),	
  skin	
  (Thiboutot	
  et	
  al.,	
  2003),	
  heart	
  (Young	
  et	
  al.,	
   2001),	
   and	
   nervous	
   system	
   (Mellon	
   et	
   al.,	
   1993;	
   Guarneri	
   et	
   al.,	
   1994;	
   Compagnone	
   et	
   al.,	
   1995;	
   Sanne	
  et	
  al.,	
  1995).	
  The	
  major	
  role	
  of	
  CYP11A,	
  however,	
  appears	
  to	
  be	
  as	
  the	
  rate-­‐limiting	
  enzyme	
   in	
   steroidogenesis,	
   responsible	
   for	
   the	
   conversion	
   of	
   cholesterol	
   to	
   pregnenolone,	
   and	
   when	
   mutated	
   manifests	
   clinically	
   as	
   adrenal	
   insufficiency	
   (Tajima	
   et	
   al.,	
   2001).	
   22(R)-­‐OHC	
   has	
   been	
   shown	
  to	
  induce	
  LXRα	
  and	
  ABCA1	
  in	
  vitro	
  in	
  human	
  myotubes	
  (Kase	
  et	
  al.,	
  2006),	
  and	
  to	
  increase	
   efflux	
  of	
  cholesterol	
  in	
  macrophages	
  (Tang	
  et	
  al.,	
  2004a;	
  Ouimet	
  et	
  al.,	
  2008).	
  However,	
  since	
  the	
   production	
   of	
   22(R)-­‐OHC	
   and	
   20,22-­‐dihydroxycholesterol	
   occurs	
   during	
   steroidogenesis	
   and	
   is	
    22	
   	
    	
   mainly	
   localized	
   to	
   the	
   adrenals	
   (Gill	
   et	
   al.,	
   2008),	
   it	
   is	
   not	
   certain	
   whether	
   it	
   is	
   a	
   major	
   LXR-­‐ activating	
  oxysterol	
  in	
  vivo.	
  	
   	
    24(S)-­‐hydroxycholesterol	
  (24(S)-­‐OHC)	
  is	
  the	
  most	
  abundant	
  oxysterol	
  produced	
  in	
  the	
  brain,	
    specifically	
   by	
   neurons,	
   and	
   is	
   the	
   product	
   of	
   the	
   ER-­‐specific	
   enzyme	
   cholesterol	
   24-­‐hydroxylase	
   (CYP46A1)	
   (Lin	
   et	
   al.,	
   1974;	
   Lund	
   et	
   al.,	
   1999).	
   24(S)-­‐OHC	
   is	
   able	
   to	
   cross	
   the	
   blood-­‐brain	
   barrier	
   (BBB),	
  and	
  represents	
  the	
  key	
  mechanism	
  for	
  turnover	
  of	
  brain	
  cholesterol	
  (Bjorkhem	
  et	
  al.,	
  1997).	
   24(S)-­‐OHC	
   circulates	
   in	
   plasma	
   and	
   is	
   taken	
   up	
   and	
   metabolized	
   by	
   the	
   liver.	
   24(S)-­‐OHC	
   activates	
   LXR	
  to	
  upregulate	
  glial	
  cell	
  ABCA1	
  and	
  ABCG1	
  (Janowski	
  et	
  al.,	
  1996;	
  Lehmann	
  et	
  al.,	
  1997;	
  Russell,	
   2000)	
   mediating	
   lipid	
   efflux	
   to	
   apoE	
   to	
   form	
   HDL	
   particles,	
   which	
   then	
   provide	
   lipids	
   to	
   neurons	
   (Kim	
  et	
  al.,	
  2007).	
  This	
  in	
  turn	
  leads	
  to	
  further	
  conversion	
  of	
  cholesterol	
  to	
  24(S)-­‐OHC	
  by	
  neurons	
   (Bjorkhem,	
  2006).	
  	
   	
    Unlike	
   the	
   CYP	
   enzymes	
   already	
   mentioned	
   previously,	
   sterol	
   25-­‐hydroxylase	
   (CH25H),	
    responsible	
  for	
  the	
  production	
  of	
  25-­‐hydroxycholesterol	
  (25-­‐OHC),	
  is	
  a	
  member	
  of	
  a	
  non-­‐heme	
  iron-­‐ containing	
   protein	
   family	
   and	
   not	
   a	
   cytochrome	
   P-­‐450	
   (Lund	
   et	
   al.,	
   1998),	
   and	
   is	
   localized	
   to	
   the	
   ER	
   and	
   Golgi	
   (Russell,	
   2000;	
   Soccio	
   et	
   al.,	
   2004).	
   In	
   addition	
   to	
   CH25H,	
   25-­‐OHC	
   is	
   produced	
   enzymatically	
  as	
  a	
  minor	
  product	
  of	
  CYP27A1	
  (Lund	
  et	
  al.,	
  1993)	
  and	
  CYP46A1	
  (Lund	
  et	
  al.,	
  1999).	
   There	
   is	
   some	
   evidence	
   that	
   ABC	
   transporters	
   may	
   be	
   involved	
   in	
   the	
   transport	
   of	
   25-­‐OHC,	
   suggesting	
   an	
   alternate	
   mechanism	
   of	
   cholesterol	
   efflux,	
   similar	
   to	
   HDL-­‐independent	
   27-­‐OHC	
   efflux	
   mentioned	
   previously	
   (Tam	
   et	
   al.,	
   2006).	
   In	
   vitro	
   experiments	
   demonstrate	
   that	
   25-­‐OHC	
   inhibits	
   sterol	
   synthesis	
   by	
   reducing	
   HMG-­‐CoA-­‐reductase	
   (Kandutsch	
   et	
   al.,	
   1974; Panini	
   et	
   al.,	
   1984;	
   Tanaka	
  et	
  al.,	
  1986;	
  Brown	
  et	
  al.,	
  1997;	
  Ravid	
  et	
  al.,	
  2000),	
  mediated	
  by	
  the	
  suppression	
  of	
  SREBP1-­‐ c	
   and	
   its	
   target	
   genes	
   (Lund	
   et	
   al.,	
   1998).	
   Interestingly,	
   the	
   sulfation	
   of	
   25-­‐OHC	
   may	
   not	
   only	
   inactivate	
   the	
   oxysterol,	
   but	
   confer	
   antagonistic	
   effects	
   on	
   LXR	
   (Xu	
   et	
   al.,	
   2010;	
   Bai	
   et	
   al.,	
   2011).	
   Despite	
  strong	
  expression	
  of	
  CH25H	
  in	
  mice	
   (Bauman	
  et	
  al.,	
  2009;	
  Diczfalusy	
  et	
  al.,	
  2009),	
  human	
   levels	
  of	
  the	
  enzyme	
  are	
  reportedly	
  very	
  low	
  and	
  25-­‐OHC	
  is	
  considered	
  a	
  minor	
  oxysterol	
  in	
  humans	
   (Lund	
  et	
  al.,	
  1998).	
  	
  Its	
  overall	
  importance	
  as	
  an	
  LXR	
  ligand	
  therefore	
  seems	
  in	
  question.	
  	
   	
    Desmosterol	
   is	
   a	
   cholesterol	
   precursor,	
   differing	
   from	
   cholesterol	
   by	
   only	
   one	
   additional	
    double	
  bond	
  on	
  the	
  side	
  chain	
  at	
  carbon	
  24	
  (Stevenson	
  et	
  al.,	
  2009).	
  The	
  conversion	
  of	
  desmosterol	
   to	
   cholesterol	
   is	
   mediated	
   by	
   the	
   enzyme	
   3-­‐beta-­‐hydroxysterol	
   delta-­‐24-­‐reductase	
   (DHCR24),	
   located	
   in	
   the	
   endoplasmic	
   reticulum	
   (Stevenson	
   et	
   al.,	
   2009).	
   Although	
   not	
   an	
   oxysterol,	
   in	
   vitro	
   evidence	
   indicates	
   direct	
   binding	
   of	
   desmosterol	
   to	
   LXR	
   and	
   upregulation	
   of	
   ABCA1	
   (Yang	
   et	
   al.,	
    23	
   	
    	
   2006).	
  In	
  addition	
  to	
  activating	
  ABCA1-­‐mediated	
  cholesterol	
  efflux,	
  desmosterol	
  decreases	
  de	
  novo	
   cholesterol	
   synthesis	
   by	
   inhibiting	
   the	
   sterol	
   response	
   element-­‐binding	
   protein-­‐2	
   and	
   HMG-­‐CoA	
   reductase	
  (Yang	
  et	
  al.,	
  2006).	
  	
  	
   	
    Although	
   oxysterols	
   are	
   the	
   primary	
   ligands	
   for	
   LXR	
   activation,	
   peroxisome	
   proliferator-­‐  activated	
  receptors	
  alpha,	
  gamma,	
  and	
  delta	
  (PPARα,	
  PPARγ,	
  PPARδ)	
  also	
  modulate	
  LXR	
  activity	
  at	
   the	
  transcriptional	
  level	
  (Ide	
  et	
  al.,	
  2003;	
  Yoshikawa	
  et	
  al.,	
  2003).	
  ABCA1	
  gene	
  transcription	
  is	
  also	
   suppressed	
   by	
   other	
   transcription	
   factors	
   such	
   as	
   zing	
   finger	
   protein	
   ZNF202,	
   SP3,	
   USF1/USF2/Fra2,	
   and	
   thyroid	
   and	
   glucocorticoid	
   hormone	
   receptors	
   (Schmitz	
   et	
   al.,	
   2005).	
   Additionally,	
   interferon	
   gamma,	
  oncostatin,	
  and	
  angiotensin	
  II	
  can	
  downregulate	
  ABCA1	
  expression	
  (Schmitz	
  et	
  al.,	
  2005).	
   Activated	
   by	
   apoA-­‐I,	
   cyclic	
   AMP	
   can	
   bind	
   to	
   motifs	
   in	
   the	
   ABCA1	
   promoter	
   region	
   leading	
   to	
   increased	
  expression	
  and	
  phosphorylation	
  of	
  ABCA1	
  in	
  macrophages	
  (Oram	
  et	
  al.,	
  2000;	
  Haidar	
  et	
   al.,	
   2002;	
   Haidar	
   et	
   al.,	
   2004).	
   Janus	
   kinase	
   2	
   can	
   also	
   phosphorylate	
   ABCA1,	
   increasing	
   apo-­‐AI-­‐ dependent	
  cholesterol	
  efflux	
  (Tang	
  et	
  al.,	
  2004b).	
  	
   	
    In	
   addition	
   to	
   mediating	
   cholesterol	
   efflux	
   and	
   forming	
   nascent	
   HDL	
   particles,	
   lipid-­‐free	
    apoA-­‐I	
  binding	
  prevents	
  the	
  degradation	
  of	
  ABCA1.	
  Our	
  group	
  has	
  shown	
  that,	
  like	
  lipid-­‐free	
  apo-­‐AI,	
   tyrosyl	
   radical-­‐oxidized	
   HDL	
   reduces	
   calpain-­‐dependent	
   and	
   independent	
   degradation	
   of	
   ABCA1,	
   providing	
   further	
   stabilization	
   and	
   leading	
   to	
   enhanced	
   ABCA1	
   expression	
   and	
   activity	
   (Hossain	
   et	
   al.,	
  2012).	
  In	
  the	
  absence	
  of	
  apolipoproteins,	
  calpain-­‐dependent	
  proteolysis	
  of	
  ABCA1	
  is	
  mediated	
   through	
  a	
  proline,	
  glutamic	
  acid,	
  serine,	
  and	
  threonine-­‐rich	
  (PEST)	
  sequence	
  (Martinez	
  et	
  al.,	
  2003;	
   Chen	
   et	
   al.,	
   2005).	
   Unsaturated	
   fatty	
   acids	
   can	
   also	
   induce	
   proteosome-­‐mediated	
   degradation	
   of	
   ABCA1	
  via	
  a	
  phospholipase	
  D2-­‐dependent	
  pathway	
  (Wang	
  et	
  al.,	
  2002).	
  	
    1.5	
  ABCA1	
  Regulation	
  in	
  Arterial	
  Smooth	
  Muscle	
  Cells	
   	
   	
    Smooth	
  muscle	
  cells	
  (SMCs)	
  are	
  a	
  major	
  component	
  of	
  the	
  intima	
  in	
  human	
  atherosclerosis-­‐  susceptible	
   arteries,	
   prior	
   even	
   to	
   any	
   pathological	
   evidence	
   of	
   atherosclerosis	
   (Orekhov	
   et	
   al.,	
   1986;	
  Bauriedel	
  et	
  al.,	
  1999).	
  In	
  early	
  stages	
  of	
  atherosclerosis	
  extracellular	
  lipid	
  deposition	
  occurs	
   in	
  SMC-­‐	
  and	
  extracellular	
  matrix-­‐rich	
  areas	
  (Nakashima	
  et	
  al.,	
  2008).	
  Pericellular	
  lipids	
  are	
  therefore	
   in	
  close	
  and	
  constant	
  contact	
  with	
  SMCs	
  in	
  developing	
  lesions	
  (Nakashima	
  et	
  al.,	
  2008).	
  SMCs	
  are	
   the	
   main	
   cell	
   type	
   in	
   intimal	
   thickenings	
   and	
   some	
   stages	
   of	
   atherosclerosis,	
   engulfing	
   and	
   accumulating	
  excess	
  lipids	
  like	
  monocyte-­‐derived	
  macrophages	
  and	
  contributing	
  to	
  the	
  total	
  intimal	
   foam	
   cell	
   population	
   (Mietus-­‐Snyder	
   et	
   al.,	
   2000;	
   Rong	
   et	
   al.,	
   2003).	
   Additional	
   work	
   from	
   our	
    24	
   	
    	
   laboratory	
   also	
   suggests	
   that	
   SMCs	
   form	
   a	
   much	
   larger	
   percentage	
   of	
   total	
   foam	
   cells	
   in	
   human	
   atherosclerotic	
  intima	
  than	
  previously	
  appreciated	
  (Allahverdian	
  S	
  et	
  al.	
  in	
  preparation).	
  Thus,	
  it	
  is	
   critical	
   to	
   focus	
   on	
   the	
   prevention	
   of	
   cholesterol	
   overload	
   in	
   intimal	
   SMCs	
   for	
   the	
   reduction	
   and	
   prevention	
  of	
  atherosclerotic	
  lesions.	
  	
  	
   	
   1.5.1	
  Arterial	
  Smooth	
  Muscle	
  Cell	
  Heterogeneity	
   	
    Arterial	
   SMCs	
   have	
   been	
   identified	
   to	
   be	
   heterogeneous	
   in	
   morphology	
   and	
   biochemical	
    properties	
   in	
   various	
   species	
   including	
   humans,	
   and	
   can	
   be	
   classified	
   into	
   at	
   least	
   two	
   distinct	
   subtypes:	
   spindle-­‐shaped	
   SMCs	
   and	
   epithelioid-­‐shaped	
   SMCs	
   (Hao	
   et	
   al.,	
   2003a).	
   A	
   third	
   subtype,	
   rhomboid-­‐shaped	
   SMCs,	
   exhibits	
   similar	
   traits	
   to	
   epithelioid-­‐shaped	
   SMCs	
   such	
   as	
   increased	
   proliferation,	
   faster	
   migration,	
   and	
   poor	
   differentiation	
   as	
   defined	
   by	
   the	
   expression	
   levels	
   of	
   cytoskeletal	
  and	
  contractile	
  proteins,	
  compared	
  to	
  spindle-­‐shaped	
  SMCs	
  (Hao	
  et	
  al.,	
  2003a).	
  	
    	
   Table	
  1-­‐1	
  	
  Features	
  of	
  arterial	
  SMC	
  subtypes.	
  *	
  Under	
  platelet-­‐derived	
  growth	
  factor.	
  SM,	
  smooth	
   muscle;	
  SMMHC,	
  smooth	
  muscle	
  myosin	
  heavy	
  chain;	
  ND,	
  not	
  determined.	
  Reprinted	
  from	
  (Hao	
  et	
   al.,	
  2003b)	
  with	
  permission	
  from	
  Wolters	
  Kluwer	
  Health,	
  copyright	
  ©	
  2003.	
  	
   	
   	
   Spindle-­‐shaped	
   contractile	
   SMCs	
   are	
   typically	
   resident	
   in	
   the	
   medial	
   layer	
   of	
   the	
   artery	
   wall,	
   whereas	
   epithelioid-­‐shaped	
   synthetic	
   SMCs	
   are	
   predominantly	
   found	
   in	
   the	
   intimal	
   layer	
   of	
   atherosclerotic	
  artery	
  walls	
  (Bochaton-­‐Piallat	
  et	
  al.,	
  1996;	
  Hao	
  et	
  al.,	
  2003a;	
  Stolle	
  et	
  al.,	
  2004).	
  In	
   addition	
   to	
   excess	
   cholesterol	
   accumulation	
   (Batetta	
   et	
   al.,	
   2001;	
   Llorente-­‐Cortes	
   et	
   al.,	
   2002),	
   intimal	
   SMCs	
   are	
   characterized	
   by	
   a	
   dedifferentiated	
   state,	
   an	
   increased	
   rate	
   of	
   proliferation,	
   a	
   loss	
   of	
   contractility,	
   an	
   increased	
   synthesis	
   of	
   extracellular	
   matrix	
   components,	
   and	
   a	
   reduced	
   expression	
   of	
   SMC	
   markers	
   such	
   as	
   smooth	
   muscle	
   α-­‐actin	
   and	
   smooth	
   muscle	
   cell	
   myosin	
   heavy	
   chain	
  (Mulvihill	
  et	
  al.,	
  2004;	
  Owens	
  et	
  al.,	
  2004).	
  Intimal	
  layer	
  SMCs	
  are	
  epithelioid	
  or	
  cuboidal	
  in	
    25	
   	
    	
   morphology	
  compared	
  to	
  medial	
  layer	
  SMCs,	
  which	
  are	
  predominantly	
  spindle-­‐shaped	
  and	
  have	
  a	
   contractile	
   phenotype	
   (Schwartz	
   et	
   al.,	
   1995).	
   In	
   addition	
   to	
   distinct	
   phenotypes,	
   gene	
   array	
   expression	
   analysis	
   studies,	
   examinations	
   of	
   human	
   atherosclerotic	
   plaques,	
   and	
   investigation	
   of	
   behavioural	
   differences	
   have	
   identified	
   differences	
   so	
   extensive	
   that	
   intimal	
   SMCs	
   have	
   been	
   proposed	
  to	
  be	
  of	
  distinct	
  clonal	
  origins	
  than	
  those	
  in	
  the	
  medial	
  layer	
  (Mulvihill	
  et	
  al.,	
  2004).	
  The	
   accumulation	
   of	
   cholesteryl	
   esters	
   in	
   atherosclerotic	
   intimal	
   SMCs,	
   but	
   not	
   in	
   normal	
   SMCs,	
   suggests	
   that	
   altered	
   cholesterol	
   metabolism	
   in	
   intimal	
   SMCs	
   may	
   be	
   a	
   key	
   contributing	
   factor	
   in	
   the	
  progression	
  of	
  atherosclerosis.	
  	
   	
   1.5.2	
  Smooth	
  Muscle	
  Cell	
  Cholesterol	
  Homeostasis	
   	
  	
   	
    The	
   exact	
   origins	
   of	
   intimal	
   SMCs	
   remains	
   unclear,	
   with	
   some	
   evidence	
   suggesting	
   that	
    medial	
   SMCs	
   undergo	
   a	
   phenotypic	
   change	
   leading	
   to	
   or	
   during	
   migration	
   of	
   these	
   cells	
   into	
   the	
   intima	
  space	
  during	
  atherogenesis	
  (Ross,	
  1995),	
  while	
  other	
  in	
  vivo	
  and	
  in	
  vitro	
  evidence	
  supports	
   the	
   notion	
   that	
   bone	
   marrow	
   progenitor	
   cells	
   such	
   as	
   hematopoietic	
   stem	
   cells	
   can	
   differentiate	
   into	
  intimal	
  SMCs	
  (Sata	
  et	
  al.,	
  2002;	
  Caplice	
  et	
  al.,	
  2003).	
  In	
  addition,	
  endothelial	
  cells	
  (Arciniegas	
  et	
   al.,	
   2000;	
   Frid	
   et	
   al.,	
   2002)	
   and	
   adventitial	
   fibroblasts	
  (Scott	
   et	
   al.,	
   1996;	
   Shi	
   et	
   al.,	
   1996)	
   have	
   been	
   shown	
  to	
  have	
  the	
  capacity	
  to	
  transdifferentiate	
  into	
  intimal	
  SMCs.	
  	
   	
    Like	
   intimal	
   macrophages,	
   intimal	
   SMCs,	
   characterized	
   by	
   a	
   dedifferentiated	
   and	
   synthetic	
    state,	
   accumulate	
   cholesteryl	
   esters	
   when	
   compared	
   to	
   contractile,	
   mature	
   medial	
   SMCs	
  (Campbell	
   et	
  al.,	
  1983;	
  Batetta	
  et	
  al.,	
  2001).	
  SMCs	
  also	
  express	
  receptors	
  that	
  mediate	
  uptake	
  of	
  LDL	
  and	
  VLDL	
   such	
  as	
  LDLr	
  (Takahashi	
  et	
  al.,	
  2005;	
  Ruan	
  et	
  al.,	
  2006),	
  VLDLr	
  (Takahashi	
  et	
  al.,	
  2005),	
  and	
  class	
  A	
   and	
  CD36	
  scavenger	
  receptors	
  (Mietus-­‐Snyder	
  et	
  al.,	
  2000;	
  Zingg	
  et	
  al.,	
  2002;	
  Rong	
  et	
  al.,	
  2003).	
  In	
   vitro	
  evidence	
  shows	
  that	
  cholesterol-­‐loaded	
  mouse	
  SMCs	
  lose	
  SMC-­‐specific	
  markers	
  and	
  transition	
   into	
   a	
   macrophage-­‐like	
   state	
   including	
   expression	
   of	
   macrophage	
   markers	
   (Rong	
   et	
   al.,	
   2003).	
   Atherosclerotic	
   lesion	
   foam	
   cells	
   exhibiting	
   CD68,	
   a	
   marker	
   commonly	
   used	
   to	
   identify	
   macrophages,	
  may	
  be	
  expressed	
  by	
  SMCs	
  and	
  induced	
  by	
  intracellular	
  lipid	
  accumulation	
  (Rong	
  et	
   al.,	
   2003).	
   These	
   observations	
   suggest	
   that	
   SMCs,	
   SMC-­‐derived	
   macrophages,	
   and	
   SMC-­‐derived	
   foam	
   cells	
   may	
   be	
   of	
   relatively	
   greater	
   importance	
   when	
   compared	
   to	
   monocyte-­‐derived	
   macrophages	
   in	
   the	
   development	
   of	
   intimal	
   atherosclerotic	
   lesions	
   (Allahverdian	
   et	
   al.,	
   2012).	
   Recently,	
   Yu	
   et	
   al.	
   showed	
   that	
   SMCs	
   incubated	
   with	
   oxLDL	
   results	
   in	
   foam-­‐like	
   cell	
   formation,	
    26	
   	
    	
   associated	
  with	
  a	
  decrease	
  in	
  SMC-­‐specific	
  marker	
  genes	
  SM	
  α	
  -­‐actin	
  and	
  SM	
  myosin	
  heavy	
  chain	
   (Yu	
  et	
  al.,	
  2010).	
  	
   	
    Until	
   1999,	
   the	
   correlation	
   between	
   apoA-­‐I	
   binding	
   and	
   lipid	
   efflux	
   in	
   arterial	
   SMCs	
    remained	
  unknown.	
  Francis	
  et	
  al.	
  compared	
  two	
  human	
  aortic	
  SMC	
  lines	
  with	
  two	
  rat	
  aortic	
  SMC	
   lines	
   and	
   found	
   that	
   unlike	
   the	
   rat	
   aortic	
   SMCs,	
   human	
   aortic	
   SMCs	
   readily	
   bind	
   to	
   apoA-­‐I	
   with	
   high	
   affinity,	
   efficiently	
   mediating	
   cholesterol	
   and	
   phospholipid	
   efflux	
   to	
   form	
   HDL	
   particles	
   (Francis	
   et	
   al.,	
   1999a).	
   Since	
   human	
   apoA-­‐I	
   readily	
   depletes	
   excess	
   cholesterol	
   from	
   human,	
   mouse,	
   and	
   rat	
   macrophages	
   (Miyazaki	
   et	
   al.,	
   1994;	
   Li	
   et	
   al.,	
   1997),	
   these	
   findings	
   suggest	
   that	
   an	
   impaired	
   apolipoprotein	
   interaction	
   is	
   responsible	
   for	
   the	
   defective	
   efflux	
   of	
   lipids	
   from	
   rat	
   SMCs.	
   These	
   differences	
   in	
   the	
   rat	
   and	
   human	
   SMC	
   response	
   to	
   apoA-­‐I	
   provided	
   an	
   excellent	
   model	
   to	
   study	
   the	
   critical	
  factors	
  necessary	
  for	
  apoA-­‐I-­‐mediated	
  cholesterol	
  efflux	
  of	
  cellular	
  lipids	
  for	
  the	
  formation	
  of	
   HDL	
   particles.	
   The	
   phenotypic	
   differences	
   in	
   SMCs	
   in	
   the	
   intima	
   versus	
   the	
   media	
   might	
   explain	
   differences	
  in	
  the	
  ability	
  of	
  these	
  cells	
  to	
  efflux	
  cholesterol	
  and	
  phospholipids.	
  	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
    27	
   	
    	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  A	
    	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  B	
    	
    	
    	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  C	
    	
    	
    	
   Figure	
  1-­‐7	
  Cholesterol	
  	
  and	
  phospholipid	
  efflux	
  to	
  apo-­‐AI	
  from	
  human	
  and	
  rat	
  arterial	
  SMCs	
  (From	
   1999	
   Francis	
   paper).	
  (A)	
  Measuring	
  cholesterol	
  efflux	
  to	
  apoAI-­‐containing	
  medium	
  from	
  human	
  and	
   rat	
   arterial	
   smooth	
   muscle	
   cells	
   showed	
   that	
   the	
   rat	
   SMC	
   released	
   only	
   3.25%	
   of	
   cellular	
   [3H]cholesterol	
   to	
   medium	
   containing	
   this	
   concentration	
   of	
   apo-­‐AI.	
   (B)	
   Measuring	
   phosphatidyl[3H]choline	
   efflux	
   to	
   apoAI-­‐containing	
   medium	
   from	
   human	
   and	
   rat	
   arterial	
   smooth	
   muscle	
  cells	
  show	
  that	
  only	
  2.9%	
  more	
  phosphatidyl[3H]choline	
  was	
  released	
  to	
  apo-­‐AI	
  than	
  control	
   medium	
   from	
   rat	
   SMC.	
   (C)	
   Measuring	
   [3H]sphingomyelin	
   efflux	
   to	
   apoAI-­‐containing	
   medium	
   from	
   human	
  and	
  rat	
  arterial	
  smooth	
  muscle	
  cells	
  show	
  that	
  release	
  of	
  [3H]sphingomyelin	
  by	
  apoAI	
  from	
   rat	
   SMC	
   was	
   absent.	
   ( )	
   Human	
   skin	
   fibroblasts;	
   ( )	
   human	
   arterial	
   smooth	
   muscle	
   cell;	
   (□)	
   rat	
   arterial	
   smooth	
   muscle	
   cell.	
   Adapted	
   from	
   (Francis	
   et	
   al.,	
   1999b)	
   with	
   permission	
   from	
   Elsevier,	
   copyright	
  ©	
  1999.	
  	
   	
    28	
   	
    	
   1.5.3	
  ABCA1	
  Expression	
  in	
  Arterial	
  SMCs	
   	
    Until	
   recently,	
   investigations	
   of	
   ABCA1	
   expression	
   in	
   atherosclerotic	
   arteries	
   have	
   been	
    conflicting,	
  reporting	
  both	
  increased	
  and	
  decreased	
  expression.	
  Albrecht	
  et	
  al.	
  reported	
  increased	
   ABCA1	
  messenger	
  RNA	
  (mRNA),	
  but	
  decreased	
  ABCA1	
  protein	
  expression	
  in	
  human	
  atherosclerotic	
   carotid	
  arteries	
  when	
  compared	
  with	
  nondiseased	
  arteries	
  (Albrecht	
  et	
  al.,	
  2004).	
  Contrary	
  to	
  this,	
   Forcheron	
   et	
   al.	
   reported	
   no	
   change	
   in	
   ABCA1	
   mRNA,	
   but	
   reduced	
   ABCA1	
   protein	
   in	
   carotid	
   endarterectomy	
   specimens	
   compared	
   to	
   nonatherosclerotic	
   tissues	
   (Forcheron	
   et	
   al.,	
   2005).	
   However,	
  Soumian	
  et	
  al.	
  reported	
  increased	
  ABCA1	
  mRNA	
  levels	
  in	
  carotid	
  atherosclerotic	
  arteries	
   compared	
  with	
  nondiseased	
  arteries	
  (Soumian	
  et	
  al.,	
  2005).	
  These	
  discrepancies	
  can	
  be	
  explained	
   by	
  the	
  methodology	
  by	
  which	
  these	
  arteries	
  were	
  assessed	
  in	
  that	
  whole	
  arteries	
  were	
  pulverized	
   to	
   measure	
   ABCA1	
   mRNA	
   and	
   protein	
   levels,	
   neglecting	
   to	
   distinguish	
   the	
   relative	
   expression	
   of	
   ABCA1	
  in	
  the	
  intimal	
  versus	
  the	
  medial	
  layer	
  of	
  atherosclerotic	
  arteries.	
  Recently,	
  our	
  group	
  showed	
   that	
  total	
  ABCA1	
  mRNA	
  and	
  SMC-­‐specific	
  ABCA1	
  protein	
  levels	
  were	
  high	
  in	
  the	
  medial	
  layer,	
  but	
   significantly	
  reduced	
  in	
  the	
  intimal	
  layer	
  of	
  atherosclerotic	
  coronary	
  arteries,	
  a	
  novel	
  explanation	
  for	
   the	
  accumulation	
  of	
  excess	
  cholesterol	
  in	
  intimal	
  SMC	
  foam	
  cells	
  (Choi	
  et	
  al.,	
  2009).	
  	
   	
   	
   	
   	
   	
   	
    29	
   	
    	
    	
   Figure	
   1-­‐8	
   SMC-­‐specific	
   ABCA1	
   expression	
   in	
   atherosclerotic	
   human	
   coronary	
   arteries.	
   Representative	
  dark-­‐field	
  photomicrographs	
  of	
  smooth	
  muscle	
  α-­‐actin	
  in	
  (A)	
  green	
  and	
  ABCA1	
  in	
   (B)	
   (red)	
   detected	
   immunohistochemically.	
   (C)	
   Color	
   segmentation	
   analysis	
   showing	
   colocalization	
   of	
  ABCA1	
  and	
  smooth	
  muscle	
  α-­‐actin	
  (pink).	
  (E)	
  ABCA1	
  immunoreactivity	
  as	
  a	
  percentage	
  of	
  total	
   area	
  is	
  significantly	
  higher	
  in	
  media	
  (53%)	
  compared	
  with	
  intima	
  (31%).	
  (F)	
  Colocalization	
  of	
  ABCA1	
   and	
   smooth	
   muscle	
   α-­‐actin	
   indicates	
   a	
   significantly	
   higher	
   degree	
   of	
   ABCA1	
   immunoreactivity	
   in	
   SMCs	
  in	
  media	
  (43%)	
  versus	
  intima	
  (28%).	
  Reprinted	
  from	
  (Choi	
  et	
  al.,	
  2009)	
  with	
  permission	
  from	
   Wolters	
  Kluwer	
  Health,	
  copyright	
  ©	
  2009.	
  Permissions	
  pending	
   	
   	
   	
    Our	
  group	
  also	
  showed	
  low	
  ABCA1	
  mRNA	
  and	
  protein	
  in	
  epithelioid	
  SMCs	
  when	
  compared	
    to	
  spindle-­‐shaped	
  SMCs,	
  even	
  when	
  loaded	
  with	
  cholesterol	
  (Choi	
  et	
  al.,	
  2009).	
  The	
  accumulation	
  of	
   cholesteryl	
   esters	
   in	
   these	
   epithelioid	
   SMCs	
   indicates	
   that	
   the	
   trafficking	
   of	
   unesterified	
   cholesterol	
   to	
  the	
  ER	
  for	
  ACAT-­‐mediated	
  esterification	
  is	
  intact	
  (Fig.	
  1.8).	
  The	
  absence	
  of	
  ABCA1	
  upregulation	
  in	
   response	
  to	
  cholesterol	
  loading	
  suggests	
  that	
  these	
  cells	
  have	
  a	
  defect	
  in	
  oxysterol	
  generation	
  for	
    30	
   	
    	
   the	
  activation	
  of	
  LXR-­‐mediated	
  ABCA1	
  expression.	
  Choi	
  et	
  al.	
  also	
  demonstrated	
  that	
  the	
  epithelioid	
   rat	
  SMCs,	
  like	
  spindle	
  rat	
  SMCs,	
  upregulate	
  ABCA1	
  mRNA	
  and	
  protein	
  expression	
  when	
  treated	
  with	
   exogenous	
   oxysterol	
   22-­‐hydroxycholesterol,	
   with	
   or	
   without	
   RXR	
   agonist	
   retinoic	
   acid	
   or	
   with	
   addition	
  of	
  the	
  synthetic	
  nonoxysterol	
  LXR	
  agonist	
  TO-­‐901317,	
  evidence	
  that	
  oxysterol	
  activation	
  of	
   LXR-­‐mediated	
   ABCA1	
   expression	
   is	
   intact	
   in	
   both	
   cell	
   lines.	
   These	
   findings	
   establish	
   that	
   intima-­‐ phenotype,	
   epithelioid	
   SMCs	
   have	
   impaired	
   apo-­‐mediated	
   lipid	
   efflux,	
   and	
   suggested	
   this	
   may	
   be	
   due	
  to	
  impaired	
  oxysterol	
  generation	
  necessary	
  to	
  activate	
  LXR	
  in	
  intimal	
  phenotype	
  SMCs.	
  	
    	
   Figure	
  1-­‐9	
  Cholesterol	
  efflux	
  from	
  epithelioid	
  and	
  spindle	
  arterial	
  SMCs.	
  Impaired	
  apoA-­‐I-­‐mediated	
   cholesterol	
  efflux	
  from	
   WKY	
  epithelioid	
  SMC.	
  (A)	
  and	
  (C)	
  show	
  a	
  marked	
  reduction	
  and	
  impairment	
   in	
   cholesterol	
   efflux	
   of	
   WKY	
   epithelioid	
   SMC.	
   (B)	
   The	
   cellular	
   pool	
   of	
   CE	
   remained	
   high	
   despite	
   increasing	
   concentrations	
   of	
   apo-­‐AI	
   treatment	
   in	
   WKY	
   epithelioid	
   SMC.	
   CE,	
   cholesteryl	
   ester;	
   UC,	
   unesterified	
   cholesterol.	
   Reprinted	
   from	
   (Choi	
   et	
   al.,	
   2009)	
   with	
   permission	
   from	
   Wolters	
   Kluwer	
   Health,	
  copyright	
  ©	
  2009.	
  	
   	
  	
   1.5.4	
  Oxysterol-­‐generating	
  Pathways	
  in	
  Arterial	
  SMCs	
   	
    As	
   noted	
   above,	
   oxysterols	
   that	
   activate	
   LXR	
   can	
   be	
   produced	
   in	
   different	
   cell	
    compartments,	
  and	
  findings	
  from	
  several	
  studies	
  indicate	
  that	
  not	
  all	
  sites	
  of	
  oxysterol	
  production	
   are	
   equal	
   contributors	
   to	
   activation	
   of	
   LXR	
   target	
   genes.	
   	
   The	
   pools	
   of	
   cholesterol	
   that	
   regulate	
   oxysterol	
   generation	
   in	
   the	
   ER	
   or	
   mitochondria	
   are	
   not	
   yet	
   fully	
   understood.	
   Several	
   lines	
   of	
   evidence	
   using	
   cells	
   from	
   patients	
   with	
   lysosomal	
   cholesterol	
   storage	
   disorders	
   indicate	
   a	
   major	
   role	
  for	
  the	
  trafficking	
  of	
  cholesterol	
  from	
  late	
  endosomes/lysosomes	
  to	
  mitochondria	
  in	
  generating	
   oxysterols,	
   particularly	
   27-­‐OHC,	
   required	
   to	
   activate	
   LXR	
   and	
   upregulate	
   genes	
   for	
   RCT.	
   Niemann-­‐  31	
   	
    	
   Pick	
  disease	
  types	
  C1	
  and	
  C2	
  human	
  fibroblasts	
  both	
  show	
  impaired	
  flux	
  of	
  cholesterol	
  out	
  of	
  the	
   late	
  endosomes/lysosomes	
  and	
  reduced	
  production	
  of	
  27-­‐OHC	
  in	
  response	
  to	
  LDL	
  loading	
  (Frolov	
  et	
   al.,	
  2003).	
  Our	
  group	
  has	
  demonstrated	
  a	
  marked	
  reduction	
  in	
  ABCA1	
  expression	
  in	
  response	
  to	
  LDL	
   or	
   free	
   cholesterol	
   loading	
   of	
   human	
   NPC1-­‐deficient	
   fibroblasts	
   (Choi	
   et	
   al.,	
   2003).	
   Our	
   group	
   similarly	
  demonstrated	
  reduced	
  ABCA1	
  expression	
  in	
  LDL-­‐loaded	
  NPC2-­‐deficient	
  fibroblasts	
  (Boadu	
   et	
  al.,	
  2012).	
  We	
  also	
  recently	
  reported	
  that	
  fibroblasts	
  from	
  patients	
  with	
  cholesteryl	
  ester	
  storage	
   disease,	
   due	
   to	
   lyosomal	
   acid	
   lipase	
   (LAL)	
   deficiency,	
   similarly	
   exhibit	
   reduced	
   27-­‐OHC	
   formation	
   and	
  impaired	
  ABCA1	
  expression	
  and	
  activity	
  following	
  LDL	
  loading,	
  with	
  correction	
  of	
  these	
  defects	
   following	
   rescue	
   of	
   LAL	
   activity	
   (Bowden	
   et	
   al.,	
   2011).	
   In	
   both	
   NPC	
   disease	
   and	
   LAL	
   deficiency,	
   in	
   addition	
   to	
   reduced	
   flow	
   of	
   cholesterol	
   to	
   mitochondria,	
   there	
   is	
   reduced	
   delivery	
   of	
   LDL-­‐derived	
   cholesterol	
   to	
   the	
   ER,	
   resulting	
   in	
   increased	
   de	
   novo	
   cholesterol	
   synthesis	
   and	
   LDL	
   receptor	
   expression	
  (Goldstein	
  et	
  al.,	
  1975;	
  Pentchev	
  et	
  al.,	
  1987).	
  	
   	
    While	
  these	
  and	
  other	
  studies	
  suggest	
  a	
  key	
  role	
  for	
  27-­‐OHC	
  in	
  regulating	
  ABCA1	
  expression,	
    it	
   is	
   still	
   possible	
   that	
   oxysterols	
   generated	
   in	
   the	
   ER	
   in	
   response	
   to	
   cholesterol	
   loading	
   are	
   also	
   major	
   LXR	
   activators.	
   A	
   possible	
   answer	
   to	
   that	
   question	
   can	
   be	
   found	
   in	
   CTX	
   cells	
   with	
   CYP27A1	
   deficiency.	
  In	
  CTX,	
  the	
  defect	
  lies	
  in	
  conversion	
  of	
  cholesterol	
  to	
  27-­‐OHC	
  in	
  the	
  mitochondria,	
  rather	
   than	
   intracellular	
   cholesterol	
   trafficking.	
   CTX	
   cells	
   exhibit	
   increased	
   cholesterol	
   synthesis,	
   and	
   it	
   has	
   been	
  suggested	
  that	
  this	
  feature	
  is	
  secondary	
  either	
  to	
  the	
  accumulation	
  of	
  cholestanol	
  (Shefer	
  et	
   al.,	
   1984),	
   or	
   that	
   the	
   lack	
   of	
   27-­‐OHC	
   prevents	
   suppression	
   of	
   cholesterogenesis	
   (Javitt,	
   2002).	
   Although	
  cholestanol	
  is	
  a	
  major	
  contributor	
  to	
  the	
  xanthomatosis	
  observed	
  in	
  CTX,	
  a	
  post-­‐mortem	
   investigation	
   of	
   CTX	
   patients	
   reported	
   that	
   cholestanol	
   contributed	
   only	
   2.8%	
   of	
   total	
   sterols	
   in	
   atherosclerotic	
   plaques,	
   versus	
   97.2%	
   by	
   cholesterol,	
   suggesting	
   cholestanol	
   is	
   not	
   a	
   major	
   contributor	
  to	
  the	
  development	
  of	
  premature	
  atheroma	
  in	
  CTX	
  (Salen,	
  1971).	
  CTX	
  patients	
  treated	
   with	
  chenodeoxycholic	
  acid	
  show	
  reduction	
  in	
  xanthomas	
  and	
  neurologic	
  complications	
  (Berginer	
  et	
   al.,	
  1984;	
  Wolthers	
  et	
  al.,	
  1990);	
  however,	
  this	
  treatment	
  did	
  not	
  correct	
  the	
  pro-­‐atherogenic	
  lipid	
   profile	
  including	
  increased	
  plasma	
  total	
  cholesterol,	
  LDL-­‐C,	
  triglycerides,	
  and	
  low	
  HDL-­‐C	
  (Fujiyama	
  et	
   al.,	
   1991).	
   CTX	
   cells	
   show	
   downregulation	
   of	
   HMG-­‐CoA	
   reductase	
   and	
   stimulation	
   of	
   cholesterol	
   esterification	
  in	
  response	
  to	
  LDL	
  loading	
  (Tint	
  et	
  al.,	
  1982),	
  indicating	
  normal	
  delivery	
  of	
  LDL-­‐derived	
   cholesterol	
   to	
   the	
   ER.	
   However,	
   CTX	
   cells	
   also	
   exhibit	
   markedly	
   reduced	
   expression	
   of	
   ABCA1	
   in	
   response	
   to	
   cholesterol	
   loading	
   (Fu	
   et	
   al.,	
   2001),	
   suggesting	
   increased	
   synthesis	
   of	
   ER-­‐derived	
   oxysterols	
  in	
  response	
  to	
  excess	
  cholesterol	
  is	
  not	
  overcoming	
  the	
  defect	
  in	
  27-­‐OHC	
  production.	
  The	
    32	
   	
    	
   fact	
   that	
   CTX	
   patients	
   also	
   exhibit	
   low	
   plasma	
   HDL-­‐C,	
   consistent	
   with	
   impaired	
   LXR-­‐dependent	
   ABCA1	
  expression,	
  indicates	
  increased	
  production	
  of	
  sterol	
  intermediates	
  24,	
  25	
  epoxycholesterol	
   (24,25EC)	
  (Wong	
   et	
  al.,	
   2008)	
   and	
   desmosterol	
   produced	
   with	
   the	
   increased	
   cholesterol	
   synthesis	
   are	
  not	
  able	
  to	
  overcome	
  the	
  defect	
  in	
  27-­‐OHC	
  production	
  to	
  correct	
  activation	
  of	
  LXR-­‐dependent	
   genes	
   (Pannu	
   et	
   al,	
   2012).	
   24,25EC	
   synthesis	
   has	
   been	
   shown	
   to	
   be	
   reduced	
   in	
   response	
   to	
   cholesterol	
   loading	
   in	
   Chinese	
   Hamster	
   Ovary	
   cells,	
   when	
   the	
   need	
   for	
   LXR-­‐mediated	
   ABCA1	
   expression	
  is	
  greatest.	
  It	
  appears	
  that	
  the	
  role	
  of	
  24,25EC	
  made	
  in	
  the	
  ER	
  is	
  not	
  to	
  protect	
  the	
  cell	
   from	
  excess	
  cholesterol	
  accumulation,	
  but	
  rather	
  to	
  inhibit	
  de	
  novo	
  cholesterol	
  synthesis	
  (Wong	
  et	
   al.,	
  2007).	
  	
   	
    1.6	
  Hypothesis	
  and	
  Specific	
  Aims	
   	
    Diminished	
   ABCA1	
   expression	
   in	
   rat	
   arterial	
   epithelioid	
   SMCs,	
   despite	
   increased	
   levels	
   of	
    cholesteryl	
   esters,	
   strongly	
   suggests	
   that	
   trafficking	
   of	
   cholesterol	
   to	
   the	
   endoplasmic	
   reticulum	
   for	
   esterification	
   by	
   ACAT	
   is	
   intact.	
   However,	
   LXR-­‐activating	
   oxysterol	
   generation	
   appears	
   to	
   be	
   impaired,	
  impeding	
  the	
  transcription	
  of	
  ABCA1	
  in	
  these	
  cells.	
  The	
  addition	
  of	
  exogenous	
  oxysterol	
   or	
   LXR	
   agonist	
   to	
   these	
   cells	
   increases	
   ABCA1	
   expression,	
   strengthening	
   the	
   notion	
   that	
   the	
   impairment	
  of	
  ABCA1	
  expression	
  is	
  at	
  the	
  level	
  of	
  oxysterol	
  generation.	
  Our	
  laboratory’s	
  previous	
   findings	
  that	
  ABCA1	
  mRNA	
  levels	
  are	
  diminished	
  in	
  human	
  atherosclerotic	
  intima	
  and	
  that	
  ABCA1	
   protein	
  levels	
  are	
  significantly	
  reduced	
  in	
  human	
  coronary	
  artery	
  intimal	
  SMCs	
  directly	
  agrees	
  with	
   the	
   results	
   from	
   our	
   epithelioid	
   cell	
   culture	
   model,	
   and	
   presents	
   a	
   strong	
   argument	
   that	
   the	
   reason	
   for	
  lower	
  ABCA1	
  expression	
  in	
  human	
  atheromas,	
  specifically	
  atheroma	
  SMCs,	
  is	
  impaired	
  oxysterol	
   generation.	
   The	
   combined	
   data	
   from	
   normal	
   cells	
   and	
   monogenic	
   disorders	
   of	
   cholesterol	
   trafficking	
   and	
   oxysterol	
   generation	
   suggest	
   that	
   production	
   of	
   oxysterols	
   or	
   LXR-­‐activating	
   sterol	
   intermediates	
   in	
   the	
   ER	
   is	
   incapable	
   of	
   overcoming	
   a	
   defect	
   in	
   27-­‐hydroxycholesterol	
   (27-­‐OHC)	
   production	
  in	
  the	
  mitochondria	
  to	
  correct	
  LXR-­‐dependent	
  gene	
  activation	
  of	
  genes	
  including	
  ABCA1	
   for	
  reverse	
  cholesterol	
  transport,	
  a	
  critical	
  component	
  of	
  cell	
  cholesterol	
  homeostasis.	
  Cholesterol	
   trafficking	
  from	
  late	
  endosomes/lysosomes	
  to	
  the	
  mitochondria	
  and	
  generation	
  of	
  27-­‐OHC	
  appear	
   to	
   be	
   the	
   predominant	
   requirements	
   for	
   effective	
   activation	
   of	
   LXR-­‐dependent	
   gene	
   activation,	
   implicating	
  sterol	
  27-­‐hydroxylase	
  as	
  a	
  key	
  oxysterol	
  generating	
  enzyme	
  for	
  the	
  activation	
  of	
  ABCA1	
   expression.	
  	
   	
    	
    	
    33	
   	
    	
   	
   Based	
   on	
   these	
   findings,	
   we	
   hypothesize	
   that	
   the	
   reduced	
   expression	
   of	
   ABCA1	
   in	
   intimal-­‐type	
   arterial	
   SMCs	
   is	
   due	
   to	
   an	
   impairment	
   of	
   CYP27A1	
   expression	
   in	
   the	
   lysosomal-­‐mitochondrial	
   oxysterol	
   generating	
   pathway.	
   To	
   test	
   this	
   reasoning,	
   epithelioid-­‐shaped	
   synthetic	
   SMC	
   and	
   spindle-­‐shaped	
  contractile	
  SMC	
  lines	
  have	
  been	
  utilized	
  as	
  models	
  of	
  the	
  major	
  intimal	
  and	
  normal	
   arterial	
  SMC	
  subtypes,	
  respectively.	
  	
   	
   	
  The	
  objectives	
  of	
  this	
  thesis	
  are:	
   1.	
   To	
   determine	
   whether	
   CYP27A1	
   mRNA	
   and	
   protein	
   levels	
   in	
   cultured	
   rat	
   arterial	
   epithelioid	
   (intima-­‐type)	
   smooth	
   muscle	
   cells	
   are	
   reduced	
   when	
   compared	
   to	
   spindle	
   (medial-­‐type)	
   smooth	
  muscle	
  cells.	
   2.	
   To	
   determine	
   whether	
   the	
   transfection	
   of	
   cultured	
   arterial	
   SMCs	
   with	
   human	
   CYP27A1	
   increases	
  ABCA1	
  expression	
  levels.	
   3.	
   To	
   determine	
   whether	
   CYP27A1	
   expression	
   in	
   atherosclerotic	
   human	
   coronary	
   arteries	
   is	
   reduced.	
  	
   	
   	
   	
   	
   	
   	
   	
    34	
   	
    	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
    	
   	
   	
   CHAPTER	
  2:	
  MATERIALS	
  AND	
  METHODS	
    	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
    	
   	
   	
   	
   	
   	
   	
   	
   35	
   	
    	
    2.1	
  Materials	
   Cholesterol	
  and	
  essentially	
  fatty	
  acid-­‐free	
  bovine	
  serum	
  albumin	
  (BSA)	
  were	
  purchased	
  from	
  Sigma-­‐ Aldrich.	
  Dulbecco’s	
  modified	
  Eagle’s	
  medium	
  (DMEM)	
  was	
  purchased	
  from	
  Fisher	
  and	
  fetal	
  bovine	
   serum	
   from	
   Sigma-­‐Aldrich.	
   Nitrocellulose	
   membranes,	
   sodium	
   dodecyl	
   sulfate	
   polyacrylamide	
   gel	
   electrophoresis	
   (SDS-­‐PAGE)	
   reagents,	
   and	
   pre-­‐stained	
   protein	
   molecular	
   mass	
   markers	
   were	
   purchased	
   from	
   Bio-­‐Rad.	
   The	
   full-­‐length	
   sterol	
   27-­‐hydroxylase	
   (CYP27A1)	
   pcDNA3.1	
   plasmid	
   was	
   purchased	
  from	
  Origene.	
  	
   	
    2.2	
  Methods	
   2.2.1	
  Cell	
  Lines	
  Used	
  in	
  This	
  Study	
   No	
  human	
  atherosclerotic	
  intima	
  SMC	
  line	
  suitable	
  for	
  use	
  in	
  continuous	
  culture	
  studies	
  is	
  presently	
   available.	
   In	
   order	
   to	
   examine	
   the	
   regulation	
   of	
   ABCA1	
   expression	
   in	
   intimal-­‐phenotype	
   SMC,	
   rat	
   SMC	
   lines	
   characterized	
   as	
   epithelioid-­‐	
   or	
   spindle-­‐shaped	
   were	
   used	
   (Choi	
   et	
   al,	
   2009).	
   The	
   WKY12-­‐ 22	
   SMC	
   line	
   derived	
   from	
   thoracic	
   aortas	
   of	
   12-­‐day	
   old	
   Wistar-­‐Kyoto	
   rats	
   were	
   characterized	
   as	
   epithelioid	
  (Lemire	
  et	
  al.,	
  1996).	
  The	
  WKY3M-­‐22	
  SMC	
  line	
  derived	
  from	
  3-­‐month	
  old	
  Wistar-­‐Kyoto	
   rats	
  were	
  characterized	
  as	
  spindle-­‐shaped	
  SMC	
  (Lemire	
  et	
  al.,	
  1996).	
  These	
  cell	
  lines	
  were	
  a	
  kind	
  gift	
   from	
  Dr.	
  Joan	
  Lemire	
  of	
  the	
  University	
  of	
  Washington.	
  	
  	
  	
   2.2.2	
  Cell	
  Culture	
   Frozen	
   vials	
   of	
   the	
   WKY12-­‐22	
   epithelioid-­‐shaped	
   SMC	
   lines	
   and	
   WKY3M-­‐22	
   spindle-­‐shaped	
   SMCs	
   were	
   thawed	
   and	
   cultures	
   re-­‐established	
   in	
   Dulbecco’s	
   modified	
   Eagle’s	
   medium	
   (DMEM)	
   supplemented	
  with	
  10%	
  FBS,	
  50	
  units/mL	
  penicillin,	
  and	
  50	
  ug/mL	
  streptomycin	
  in	
  humidified	
  95%	
   air	
   and	
   5%	
   CO2	
   at	
   37°C,	
   as	
   a	
   single	
   monolayer	
   of	
   cells	
   in	
   75	
   cm2	
   stock	
   flasks	
   containing	
   10	
   mL	
   of	
   growth	
   medium.	
   Cells	
   were	
   sub-­‐cultured	
   using	
   0.25%	
   trypsin-­‐EDTA	
   at	
   confluence	
   and	
   were	
   used	
   between	
   the	
   17th	
   and	
   25th	
   passage.	
   Both	
   cell	
   lines	
   maintained	
   their	
   distinct	
   phenotypes	
   and	
   growth	
   rates	
  during	
  these	
  passages.	
  	
   To	
   load	
   cells	
   with	
   non-­‐lipoprotein	
   cholesterol,	
   confluent	
   cells	
   were	
   rinsed	
   twice	
   with	
   phosphate-­‐ buffered	
   saline	
   (PBS)	
   and	
   incubated	
   for	
   24	
   h	
   in	
   DMEM	
   containing	
   30	
   ug/mL	
   cholesterol	
   added	
   from	
   a	
   10	
   mg/mL	
   stock	
   in	
   ethanol	
   (Choi	
   et	
   al.,	
   2003).	
   To	
   allow	
   equilibration	
   of	
   added	
   cholesterol,	
   cells	
   were	
  rinsed	
  with	
  PBS	
  and	
  incubated	
  for	
  an	
  additional	
  24	
  h	
  in	
  DMEM	
  only.	
   	
    36	
   	
    	
   2.2.3	
  Quantitative	
  Real-­‐time	
  PCR	
  Analysis	
  of	
  ABCA1,	
  CYP27A1,	
  and	
  StARD1	
  mRNA	
   Cells	
   were	
   grown	
   to	
   confluence	
   on	
   35-­‐mm	
   wells	
   in	
   DMEM	
   containing	
   10%	
   FBS,	
   50	
   units/mL	
   penicillin,	
   and	
   50	
   μg/mL	
   streptomycin.	
   Total	
   RNA	
   was	
   isolated	
   from	
   cells	
   using	
   Trizol	
   Reagent	
   extraction	
   (Invitrogen).	
   The	
   concentration	
   of	
   RNA	
   was	
   measured	
   spectrophotometrically	
   at	
   a	
   wavelength	
   of	
   260	
   nm,	
   and	
   2	
   μg	
   of	
   RNA	
   was	
   treated	
   with	
   DNase	
   I	
   (Invitrogen)	
   following	
   the	
   manufacturer's	
   guidelines.	
   First	
   strand	
   cDNA	
   synthesis	
   was	
   performed	
   using	
   500	
   nM	
   of	
   oligo(dT)	
   primer	
   and	
   Superscript™	
   RNase	
   H	
   (Invitrogen).	
   Each	
   reaction	
   mixture	
   contained	
   100	
   units	
   of	
   Superscript™	
   enzyme,	
   1×	
   first	
   strand	
   buffer	
   (50	
   mM	
   Tris-­‐HCl,	
   pH	
   8.0),	
   0.5	
   μM	
   dNTP	
   mix,	
   0.01	
   M	
   dithiothreitol,	
   0.05	
   μg/μl	
   BSA,	
   and	
   2	
   units	
   of	
   RNase	
   inhibitor	
   (Invitrogen).	
   The	
   mixtures	
   were	
   incubated	
   at	
   45°C	
   for	
   90	
   min	
   followed	
   by	
   incubation	
   at	
   95°C	
   for	
   3	
   min	
   (Whatman	
   Biometra	
   T-­‐ gradient	
   thermocycler)	
   and	
   then	
   put	
   promptly	
   on	
   ice.	
   Amplification	
   of	
   ABCA1	
   and	
   cyclophilin	
   mRNAs	
   was	
   performed	
   in	
   tandem	
   to	
   ensure	
   equal	
   amounts	
   of	
   starting	
   cDNA	
   for	
   each	
   sample.	
   Diethyl	
  pyrocarbonate-­‐treated	
  water,	
  1×	
  PCR	
  buffer	
  (20	
  mM	
  Tris-­‐HCl,	
  pH	
  8.4,	
  and	
  50	
  mM	
  KCl),	
  1.5	
   mM	
   MgCl2,	
   0.1	
   mM	
   dNTPs,	
   and	
   cDNA	
   were	
   added	
   to	
   200	
   μl	
   of	
   thin	
   walled	
   PCR	
   tubes	
   and	
   mixed,	
   and	
   one-­‐half	
   volume	
   was	
   transferred	
   to	
   another	
   PCR	
   tube.	
   Then	
   1	
   unit	
   of	
   Taq	
   DNA	
   polymerase	
   (Invitrogen)	
  and	
  2	
  μl	
  of	
  10	
  μM	
  forward	
  and	
  reverse	
  primers	
  (ABCA1	
  or	
  cyclophilin)	
  were	
  added	
  to	
   complete	
  the	
  reaction	
  mixture.	
  ABCA1	
  amplification	
  was	
  performed	
  by	
  initially	
  denaturing	
  DNA	
  at	
   95°C	
   for	
   3	
   min.	
   Thereafter,	
   denaturing	
   was	
   at	
   95°C	
   for	
   75	
   seconds,	
   annealing	
   at	
   54.6°C	
   for	
   75	
   seconds,	
  and	
  extension	
  at	
  72°C	
  for	
  55	
  seconds	
  for	
  a	
  total	
  of	
  31	
  cycles	
  with	
  a	
  final	
  extension	
  period	
   of	
   5	
   minutes	
   (Choi	
   et	
   al,	
   2009).	
   CYP27A1	
   amplification	
   was	
   performed	
   using	
   similar	
   conditions	
   except	
   the	
   annealing	
   temperature	
   was	
   56.8°C	
   with	
   a	
   total	
   of	
   32	
   cycles.	
   StARD1	
   amplification	
   was	
   performed	
   using	
   similar	
   conditions	
   except	
   the	
   annealing	
   temperature	
   was	
   58°C	
   with	
   a	
   total	
   of	
   35	
   cycles.	
   Cyclophilin	
   amplification	
   was	
   performed	
   using	
   similar	
   conditions	
   except	
   the	
   annealing	
   temperature	
   was	
   48	
   °C	
   with	
   a	
   total	
   of	
   33	
   cycles.	
   SYBR	
   Green	
   was	
   used	
   to	
   detect	
   and	
   quantitate	
   the	
   PCR	
   products	
   by	
   quantitative	
   real-­‐time	
   PCR.	
   SYBR	
   Green	
   binds	
   double-­‐stranded	
   DNA,	
   and	
   upon	
   excitation	
  emits	
  light.	
  As	
  the	
  quantity	
  of	
  PCR	
  product	
  accumulates,	
  the	
  fluorescent	
  signal	
  increases	
   correspondingly.	
   The	
   reactions	
   were	
   measured	
   using	
   the	
   Realplex2	
   Mastercyler	
   (Eppendorf).	
   The	
   primers	
  used	
  are	
  as	
  follows:	
  ABCA1,	
  5ʹ′-­‐GAC	
  ATC	
  CTG	
  AAG	
  CCA	
  ATC	
  CTG	
  (forward),	
  5ʹ′-­‐CCT	
  TGT	
  GGC	
   TGG	
  AGT	
  GTC	
  AGG	
  T	
  (reverse);	
  CYP27A1,	
  TGC	
  GCC	
  AGG	
  CTC	
  TGA	
  ACC	
  AG	
  (forward),	
  5’-­‐ TCC	
  ACT	
  TGG	
   GGA	
   GGA	
   AGG	
   TG	
   (reverse);	
   StARD1,	
   ACT	
   TGG	
   TTC	
   TCA	
   ACT	
   GGA	
   AGC	
   AAC	
   A	
   (forward),	
   5’-­‐  37	
   	
    	
   TGGCACCACCTTACTTAGCACTTCAT	
  (reverse);	
  cyclophilin,	
  5ʹ′-­‐ACC	
  CAA	
  AGG	
  GAA	
  CTG	
  CAG	
  CGA	
  GAG	
  C	
   (forward),	
  5ʹ′-­‐CCG	
  CGT	
  CTC	
  CTT	
  TGA	
  GCT	
  GTT	
  TGC	
  AG	
  (reverse).	
   	
   2.2.4	
  Western	
  Blot	
  Analysis	
  of	
  ABCA1	
  and	
  CYP27A1	
  Protein	
  Expression 	
   Cells	
   grown	
   in	
   35	
   mm	
   dishes	
   were	
   harvested	
   with	
   300	
   μL	
   of	
   extraction	
   buffer	
   containing	
   20	
   mM	
   Tris,	
   5	
   mM	
   EGTA,	
   0.5%	
   Maltoside	
   and	
   1x	
   Complete	
   Mini	
   Protease	
   Inhibitor	
   (Roche).	
   Cells	
   were	
   scraped	
   using	
   disposable	
   Cell	
   Lifters	
   (Fisher	
   Scientific)	
   and	
   homogenized	
   using	
   a	
   Teflon	
   tissue	
   homogenizer	
   pestle.	
   Samples	
   were	
   centrifuged	
   at	
   2500	
   rpm	
   for	
   10	
   minutes	
   at	
   4°C	
   to	
   separate	
   protein	
   from	
   nucleic	
   acids.	
   A	
   Bio-­‐Rad	
   protein	
   assay	
   was	
   used	
   to	
   calculate	
   protein	
   concentration.	
   Samples	
  to	
  be	
  used	
  for	
  ABCA1	
  analysis	
  were	
  incubated	
  at	
  room	
  temperature	
  for	
  one	
  hour,	
  whereas	
   samples	
  used	
  for	
  CYP27A1	
  analysis	
  were	
  boiled	
  for	
  5	
  minutes	
  at	
  approximately	
  100°C.	
  For	
  ABCA1,	
   approximately	
   35	
   to	
   50	
   μg	
   of	
   protein	
   was	
   separated	
   by	
   a	
   5%	
   and	
   15%	
   SDS-­‐PAGE	
   under	
   reducing	
   conditions	
  and	
  transferred	
  to	
  a	
  nitrocellulose	
  membrane.	
  For	
  CYP27A1,	
  approximately	
  35	
  to	
  50	
  μg	
   of	
   protein	
   was	
   separated	
   by	
   a	
   7.5%	
   SDS-­‐PAGE	
   under	
   reducing	
   conditions	
   and	
   transferred	
   to	
   a	
   nitrocellulose	
  membrane.	
  Immunoblotting	
  was	
  performed	
  according	
  to	
  standard	
  protocols	
  using	
  a	
   rabbit	
  polyclonal	
  ABCA1	
  antibody	
  (1:1000	
  dilution,	
  Novus	
  Biologicals),	
  a	
  rabbit	
  polyclonal	
  CYP27A1	
   antibody	
   (1:1000	
   dilution,	
   Cedarlane	
   Labs),	
   and	
   a	
   goat	
   anti-­‐rabbit	
   IgG	
   horseradish	
   peroxidase-­‐ conjugated	
   secondary	
   antibody	
   (1:10,000	
   dilution,	
   Sigma	
   Aldrich).	
   Chemiluminescence	
   was	
   detected	
   using	
   Super	
   Signal	
   West	
   Femto	
   Maximum	
   Sensitivity	
   Substrate	
   (Pierce	
   Protein	
   Research	
   Products)	
  and	
  the	
  Chemigenius	
  BioImaging	
  System	
  (Syngene).	
  	
   	
   2.2.5	
  CYP27A1	
  cDNA	
  Plasmid	
  Amplification	
   Full-­‐length	
   human	
   CYP27A1	
   cDNA	
   cloned	
   in	
   a	
   pcDNA3.1	
   vector	
   (Origene)	
   was	
   used	
   to	
   transform	
   DH5α	
   Escherichia	
   coli	
   (E.coli)	
   cells	
   (Origene).	
   Briefly,	
   competent	
   DH5α	
   E.coli	
   cells	
   were	
   incubated	
   with	
  50	
  ng	
  of	
  CYP27A1	
  cDNA	
  on	
  ice	
  for	
  30	
  minutes.	
  The	
  DH5α	
   E.coli	
  cells	
  were	
  heat	
  shocked	
  for	
  45	
   seconds	
  at	
  42°C	
  and	
  immediately	
  placed	
  on	
  ice	
  for	
  2	
  minutes,	
  allowing	
  for	
  the	
  bacterial	
  cell	
  walls	
  to	
   become	
  permeable	
  to	
  the	
  CYP27A1	
  cDNA	
  plasmid	
  (Uetz	
  et	
  al.,	
  2010).	
  The	
  transformed	
  DH5α	
  E.coli	
   cells	
  were	
  incubated	
  in	
  lysogeny	
  broth	
  (LB)	
  (Invitrogen)	
  and	
  incubated	
  at	
  37°C	
  for	
  1	
  hour.	
  Samples	
   were	
  then	
  centrifuged	
  at	
  3000	
  RPM	
  for	
  3	
  minutes	
  and	
  the	
  supernatant	
  was	
  re-­‐suspended	
  in	
  equal	
   volumes	
  of	
  LB	
  and	
  ampicillin	
  (Sigma).	
  Samples	
  were	
  plated	
  on	
  ampicillin-­‐treated	
  LB	
  plates	
  overnight	
   to	
  obtain	
  colonies.	
  Colonies	
  were	
  picked	
  to	
  inoculate	
  LB	
  growth	
  media	
  for	
  an	
  overnight	
  (16	
  hours)	
    38	
   	
    	
   incubation	
   at	
   37°C	
   and	
   then	
   centrifuged	
   at	
   8000	
   RPM,	
   4°C	
   for	
   15	
   minutes.	
   The	
   supernatant	
   was	
   discarded	
  and	
  the	
  remaining	
  pellet	
  was	
  used	
  to	
  purify	
  the	
  CYP27A1	
  cDNA	
  plasmid	
  using	
  the	
  QIAGEN	
   maxi-­‐prep	
   EndoFree®	
   purification	
   kit	
   (Qiagen).	
   Purified	
   CYP27A1	
   cDNA	
   plasmid	
   concentration	
   was	
   determined	
  by	
  spectrophotometry	
  at	
  an	
  optical	
  density	
  wavelength	
  of	
  260	
  nm.	
  	
  	
   	
   2.2.6	
  Transfection	
  of	
  CYP27A1	
   Cells	
   were	
   grown	
   to	
   100%	
   confluence	
   on	
   35	
   mm	
   wells	
   in	
   DMEM	
   containing	
   10%	
   FBS.	
   Prior	
   to	
   transfection,	
   confluent	
   wells	
   were	
   washed	
   3x	
   with	
   DMEM	
   only.	
   Cells	
   were	
   transfected	
   with	
   for	
   6	
   hours	
   with	
   a	
   full-­‐length	
   human	
   CYP27A1	
   cDNA	
   cloned	
   in	
   a	
   pcDNA3.1	
   vector	
   transcribed	
   via	
   a	
   cytomegalovirus	
  promoter	
  (Origene),	
  or	
  with	
  empty	
  vector,	
  using	
  Lipofectamine	
  2000	
  (Invitrogen)	
   incubated	
   in	
   Opti-­‐MEM®	
   I	
   Reduced	
   Serum	
   Medium	
   (Invitrogen)	
   with	
   1%	
   FBS,	
   according	
   to	
   Invitrogen	
   protocol.	
   The	
   cells	
   were	
   washed	
   twice	
   with	
   DMEM	
   only	
   and	
   incubated	
   for	
   24	
   hours	
   in	
   DMEM	
   with	
   or	
   without	
   cholesterol	
   as	
   described	
   in	
   Section	
   2.2.1.	
   Cells	
   were	
   then	
   washed	
   3x	
   with	
   DMEM	
  only	
  and	
  incubated	
  for	
  24	
  hours	
  in	
  DMEM	
  only.	
  After	
  this	
  period	
  of	
  incubation,	
  cells	
  were	
   washed	
   twice	
   with	
   cold	
   PBS,	
   harvested,	
   and	
   homogenized	
   in	
   active	
   lysis	
   buffer	
   as	
   described	
   in	
   Section	
   2.2.3.	
   To	
   measure	
   ABCA1	
   and	
   CYP27A1	
   levels,	
   protein	
   were	
   subjected	
   to	
   SDS-­‐PAGE	
   and	
   western	
  blot	
  analysis	
  as	
  described	
  in	
  Section	
  2.2.3.	
   	
   	
   2.2.7	
  27-­‐hydroxycholesterol	
  Efflux	
  Measurement	
   Oxysterols	
   were	
   extracted	
   from	
   the	
   cells	
   and	
   media:	
   briefly,	
   Bligh	
   and	
   Dyer	
   lipid	
   extraction	
   was	
   performed	
   using	
   a	
   1:2	
   v/v	
   chloroform:methanol	
   solvent	
   mixture	
   with	
   10	
   µg/mL	
   butylated	
   hydroxytoluene	
   and	
   0.04	
   ng/µL	
   24-­‐hydroxycholesterol	
   surrogate	
   standard.	
   Solid	
   phase	
   extraction	
   was	
   performed	
   using	
   solvent	
   mixtures	
   containing	
   a	
   19:1	
   v/v	
   hexane:diethyl	
   ether,	
   9:1	
   v/v	
   hexane:diethyl	
  ether,	
  and	
  4:1	
  v/v	
  hexane:diethyl	
  ether	
  for	
  rinsing	
  and	
  3:1	
  v/v	
  acetone:methanol	
  for	
   elution.	
   Samples	
   were	
   resuspended	
   in	
   hexane	
   for	
   measurement.	
   Samples	
   were	
   run	
   using	
   Helium	
   as	
   a	
  carrier	
  gas	
  on	
  an	
  Agilent	
  7890A	
  GC	
  equipped	
  with	
  a	
  7683	
  Automatic	
  Injector	
  and	
  a	
  5975C	
  VL	
  MSD.	
   Installed	
   were	
   a	
   Zebron	
   5HT	
   Inferno	
   column	
   (15m,	
   0.25mm	
   ID,	
   0.1	
   µm	
   film	
   thickness)	
   and	
   a	
   Zebron	
   HT-­‐Deactivated	
   Guard	
   Column	
   (5m,	
   0.25mm	
   ID).	
   Samples	
   were	
   injected	
   (2	
   µL)	
   at	
   an	
   inlet	
   temperature	
   of	
   250°C	
   at	
   a	
   pressure	
   of	
   10.6	
   psi	
   in	
   pulsed	
   splitless	
   mode.	
   The	
   oven	
   temperature	
   program	
   was:	
   160°C	
   hold	
   1	
   minutes,	
   ramp	
   20°C/min	
   to	
   240°C,	
   ramp	
   5°C	
   /min	
   to	
   270°C	
   with	
   a	
   detector	
   temperature	
   of	
   200°C.	
   Spectra	
   were	
   quantified	
   using	
   a	
   standard	
   curve	
   made	
   from	
   purified	
    39	
   	
    	
   chemicals	
   purchased	
   from	
   Avanti	
   Polar	
   Lipids	
   (Ory	
   et	
   al,	
   2003).	
   Quantitative	
   gas	
   chromatography/mass	
   spectrometery	
   determinations	
   for	
   27-­‐hydroxycholesterol	
   were	
   calculated	
   from	
  triplicate	
  injections.	
  Total	
  oxysterol	
  production	
  was	
  determined	
  as	
  the	
  sum	
  of	
  oxysterols	
  in	
  the	
   cells	
   and	
   secreted	
   into	
   the	
   medium.	
   These	
   experiments	
   were	
   performed	
   with	
   the	
   assistance	
   of	
   Leanne	
  Bilawchuk.	
  	
   	
   2.2.8	
  Immunohistochemistry	
  of	
  CYP27A1	
   Coronary	
  artery	
  sections	
  from	
  patients	
  with	
  the	
  primary	
  diagnosis	
  of	
  coronary	
  heart	
  disease	
  were	
   obtained	
   with	
   approval	
   from	
   the	
   University	
   of	
   British	
   Columbia	
   Research	
   Ethics	
   Board,	
   from	
   the	
   Cardiovascular	
   Registry	
   at	
   St.	
   Paul’s	
   Hospital,	
   University	
   of	
   British	
   Columbia.	
   Sections	
   with	
   native	
   atherosclerosis	
   were	
   formalin-­‐fixed,	
   paraffin-­‐embedded,	
   sectioned	
   and	
   mounted	
   on	
   glass	
   slides.	
   Sections	
   were	
   dewaxed	
   and	
   rehydrated,	
   and	
   immunohistochemical	
   staining	
   for	
   smooth	
   muscle-­‐α	
   actin,	
   CYP27A1,	
   and	
   CD68	
   was	
   performed	
   using	
   Shandon	
   disposable	
   immunostaining	
   coverplates	
   (Thermo	
  Shandon).	
  Briefly,	
  slides	
  were	
  blocked	
  with	
  10%	
  normal	
  donkey	
  serum	
  for	
  one	
  hour,	
  then	
   co-­‐incubated	
  with	
  polyclonal	
  rabbit	
  anti-­‐CYP27A1	
  antibody	
  (Cedarlane	
  Labs)	
  and	
  polyclonal	
  mouse	
   anti-­‐smooth	
   muscle	
   (SM)	
   α-­‐actin	
   (Sigma)	
   monoclonal	
   mouse	
   anti-­‐CD68	
   antibody	
   (Dako	
   Canada)	
   overnight.	
  AlexaFluor®	
  488-­‐conjugated	
  goat	
  anti-­‐mouse	
  IgG	
  (Invitrogen)	
  was	
  used	
  to	
  detect	
  SM	
  α-­‐ actin	
   and	
   CD68,	
   and	
   AlexaFluor®	
   594-­‐conjugated	
   goat	
   anti-­‐rabbit	
   IgG	
   (Invitrogen)	
   was	
   used	
   to	
   detect	
  CYP27A1,	
  by	
  dual	
  immunofluorescent	
  staining	
  (Choi	
  et	
  al.,	
  2009).	
  Nuclei	
  were	
  stained	
  using	
   4'-­‐6-­‐Diamidino-­‐2-­‐phenylindole	
  (DAPI),	
  then	
  slides	
  were	
  mounted	
  using	
  SloFade®	
  mounting	
  reagent	
   (Molecular	
   Probes).	
   Isotype-­‐matched	
   IgG	
   and	
   omission	
   of	
   the	
   primary	
   antibody	
   were	
   used	
   as	
   negative	
   controls.	
   Slides	
   were	
   viewed	
   using	
   a	
   Nikon	
   Eclipse	
   TE300	
   inverted	
   microscope,	
   illuminated	
   by	
  a	
  Nikon	
  Super	
  High	
  Pressure	
  Mercury	
  Lamp,	
  and	
  captured	
  using	
  a	
  Spot	
  digital	
  camera	
  (Diagnostic	
   Instruments).	
   	
   2.2.9	
  Statistical	
  Analysis	
   Results	
   were	
   analyzed	
   using	
   GraphPad	
   Prism	
   version	
   5.0	
   and	
   are	
   presented	
   as	
   the	
   mean	
   ±	
   S.D.	
   Significant	
  differences	
  between	
  experimental	
  groups	
  were	
  determined	
  using	
  the	
  one-­‐way	
  analysis	
   of	
  variance	
  test,	
  and	
  differences	
  between	
  experimental	
  groups	
  were	
  determined	
  using	
  a	
  Bonferroni	
   post	
  hoc	
  comparison.	
  	
   	
    40	
   	
    	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
    	
   	
   	
   	
   CHAPTER	
  3:	
  RESULTS	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
    	
   	
   	
   	
   	
   	
   41	
   	
    	
    3.1	
  LXR	
  Agonists	
  Upregulate	
  ABCA1	
  Protein	
  Expression	
  in	
  Epithelioid	
  SMCs	
  	
   Transcription	
   of	
   ABCA1	
   is	
   strongly	
   induced	
   through	
   the	
   activation	
   of	
   the	
   nuclear	
   receptor	
   LXR,	
  which	
  binds	
  to	
  RXR	
  to	
  form	
  a	
  heterodimer.	
  Without	
  a	
  ligand,	
  the	
  LXR–RXR	
  heterodimer,	
  bound	
   to	
   LXR	
   response	
   elements	
   (LXREs)	
   in	
   the	
   promoter	
   region	
   of	
   target	
   genes,	
   interacts	
   with	
   corepressors	
   and	
   remains	
   inactive	
   (Hu	
   et	
   al.,	
   2003).	
   When	
   bound	
   by	
   its	
   ligands,	
   LXR	
   undergoes	
   a	
   conformational	
   change	
   (Glass	
   and	
   Rosenfeld,	
   2000)	
   whereby	
   the	
   corepressors	
   are	
   released	
   and	
   coactivators	
  are	
  recruited,	
  leading	
  to	
  gene	
  activation	
  (Herzog	
  et	
  al.,	
  2007,	
  Lee	
  et	
  al.,	
  2008,	
  Svensson	
   et	
  al.,	
  2003),	
  such	
  as	
  binding	
  to	
  an	
  LXRE	
  region	
  in	
  the	
  ABCA1	
  gene	
  (Schwartz	
  et	
  al.,	
  2000).	
  To	
  test	
   whether	
  the	
  impaired	
  regulation	
  of	
  ABCA1	
  mRNA	
  in	
  epithelioid	
  SMC	
  in	
  response	
  to	
  increased	
  cell	
   cholesterol	
   content	
   (Choi	
   et	
   al.,	
   2009)	
   is	
   due	
   to	
   a	
   defective	
   responsiveness	
   of	
   the	
   ABCA1	
   gene	
   to	
   its	
   inducers,	
   cells	
   were	
   treated	
   with	
   exogenous	
   LXR	
   ligands.	
   Treatment	
   of	
   cells	
   with	
   10	
   μM	
   27-­‐ hydroxycholesterol	
   or	
   10	
   μM	
   LXR	
   agonist	
   TO-­‐901317	
   markedly	
   increased	
   cellular	
   ABCA1	
   protein	
   levels	
  in	
  both	
  epithelioid	
  and	
  spindle	
  cells	
  (Figure	
   3-­‐1).	
  These	
  results	
  suggest	
  that	
  the	
  ABCA1	
  gene	
  in	
   both	
   SMC	
   lines	
   is	
   normally	
   regulated	
   by	
   exogenously	
   added	
   LXR	
   ligands,	
   specifically	
   27-­‐ hydroxycholesterol.	
  	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
   	
   	
   	
   	
   	
   	
   	
    42	
   	
    	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  A	
    	
  	
  	
  	
  	
  B	
    	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
    	
    	
   Figure	
  3-­‐1.	
  Upregulation	
  of	
  ABCA1	
  gene	
  expression	
  in	
  spindle	
  and	
  epithelioid	
  SMCs	
  by	
  exogenous	
   27-­‐hydroxycholesterol.	
  Confluent	
  cells	
  were	
  incubated	
  for	
  24	
  hours	
  in	
  the	
  presence	
  of	
  10	
  μM	
  27-­‐ hydroxycholesterol	
  (27-­‐OHC)	
  or	
  10	
  μM	
  LXR	
  agonist	
  TO-­‐901317	
  prior	
  to	
  determination	
  of	
  ABCA1	
   protein	
  levels.	
  ABCA1	
  protein	
  was	
  detected	
  by	
  Western	
  blotting	
  of	
  40	
  μg	
  of	
  crude	
  membrane	
   proteins	
  with	
  a	
  rabbit	
  polyclonal	
  antibody	
  of	
  ABCA1	
  The	
  loading	
  control	
  used	
  for	
  Western	
  blot	
   analysis	
  was	
  protein	
  disulfide	
  isomerase	
  (PDI).	
  (B.)	
  Numeric	
  densitometry	
  values	
  represent	
  (A)	
  the	
   intensities	
  of	
  CYP27A1	
  normalized	
  to	
  non-­‐treated	
  spindle	
  SMC	
  levels.	
  Results	
  are	
  representative	
  of	
   two	
  experiments	
  with	
  similar	
  results.	
   	
   	
   	
    	
   43	
   	
    	
    3.2	
  Reduced	
  CYP27A1	
  mRNA	
  Levels	
  in	
  Epithelioid	
  SMCs	
   Although	
   ABCA1	
   transcription	
   is	
   strongly	
   upregulated	
   in	
   response	
   to	
   increasing	
   cell	
   cholesterol	
   content	
   and	
   spindle	
   SMCs	
   have	
   a	
   high	
   basal	
   level	
   of	
   ABCA1	
   mRNA	
   and	
   significantly	
   increased	
  ABCA1	
  transcription	
  in	
  response	
  to	
  cholesterol	
  loading,	
  epithelioid	
  SMCs	
  have	
  a	
  markedly	
   low	
  basal	
  level	
  of	
  ABCA1	
  mRNA	
  and	
  show	
  no	
  significant	
  increase	
  after	
  cholesterol	
  loading	
  (Choi	
  et	
   al.,	
  2009).	
  This	
  suggested	
  that	
  the	
  ability	
  of	
  the	
  epithelioid	
  SMCs	
  to	
  generate	
  oxysterols	
  necessary	
   to	
   upregulate	
   LXR	
   is	
   impaired.	
   Both	
   SMC	
   lines	
   increase	
   ABCA1	
   expression	
   in	
   response	
   to	
   exogenous	
   treatment	
  of	
  27-­‐hydroxycholesterol,	
  suggesting	
  impairment	
  in	
  27-­‐hydroxycholesterol	
  production	
  in	
   these	
  cells	
  via	
  CYP27A1	
  (Figure	
  3-­‐1).	
  To	
  find	
  if	
  CYP27A1	
  expression	
  is	
  impaired	
  in	
  epithelioid	
  SMCs,	
   we	
   measured	
   CYP27A1	
   mRNA	
   levels	
   by	
   quantitative	
   real-­‐time	
   PCR.	
   The	
   spindle	
   SMCs	
   had	
   a	
   high	
   basal	
   level	
   of	
   CYP27A1	
   mRNA,	
   whereas	
   the	
   epithelioid	
   SMCs	
   had	
   a	
   markedly	
   low	
   basal	
   level	
   of	
   CYP27A1	
  mRNA	
  (Figure	
  3-­‐2).	
  	
  	
    	
  	
  	
  	
  	
  	
  	
    	
    Figure	
   3-­‐2	
   Quantitation	
   of	
   ABCA1	
   mRNA	
   levels	
   in	
   spindle	
   and	
   epithelioid	
   SMCs.	
   Cells	
   were	
   incubated	
  in	
  DMEM	
  with	
  10%	
  FBS	
  supplemented	
  with	
  1%	
  penicillin/streptomycin,	
  maintained	
  in	
  a	
   humidified	
   incubator	
   at	
   37	
   °C	
   and	
   5%	
   CO2,	
   prior	
   to	
   determination	
   of	
   CYP27A1	
   levels	
   by	
   quantitative	
   real-­‐time	
   PCR.	
   Levels	
   of	
   CYP27A1	
   mRNA	
   were	
   normalized	
   to	
   cyclophilin	
   mRNA	
   levels.	
   Results	
   are	
   averages	
  ±	
  S.D.	
  of	
  three	
  determinations	
  representative	
  of	
  three	
  separate	
  experiments	
  with	
  similar	
   results.	
  and	
  relative	
  to	
  the	
  ratio	
  of	
  CYP27A1/cyclophilin	
  mRNA	
  in	
  spindle	
  SMCs.	
  *,	
  p	
  <	
  0.05	
  level	
  of	
   significance.	
  	
    44	
   	
    	
    3.3	
  Reduced	
  CYP27A1	
  Protein	
  Expression	
  in	
  Epithelioid	
  SMCs	
   In	
   order	
   to	
   confirm	
   whether	
   reduced	
   CYP27A1	
   mRNA	
   levels	
   in	
   epithelioid	
   SMCs	
   are	
   also	
   associated	
   with	
   reduced	
   CYP27A1	
   protein	
   levels,	
   Western	
   blot	
   analysis	
   was	
   performed.	
   In	
   the	
   spindle	
   SMCs,	
   CYP27A1	
   protein	
   expression	
   was	
   present,	
   whereas,	
   the	
   epithelioid	
   SMCs	
   did	
   not	
   express	
   detectable	
   levels	
   of	
   CYP27A1	
   protein	
   (Figure	
   3-­‐3).	
   These	
   results	
   are	
   consistent	
   with	
   CYP27A1	
  mRNA	
  expression	
  as	
  seen	
  in	
  Figure	
  3-­‐2,	
  and	
  suggest	
  that	
  CYP27A1	
  expression	
  is	
  impaired	
   in	
   the	
   epithelioid	
   SMCs,	
   but	
   intact	
   in	
   spindle	
   SMCs.	
   In	
   addition	
   to	
   measuring	
   basal	
   level	
   of	
   CYP27A1	
   protein	
  expression,	
  we	
  cholesterol-­‐loaded	
  both	
  SMC	
  lines.	
  The	
  CYP27A1	
  gene	
  does	
  not	
  contain	
  an	
   LXR	
   response	
   element	
   (LXRE)	
   sequence,	
   and	
   thus,	
   is	
   not	
   expected	
   to	
   turn	
   on	
   in	
   response	
   to	
   cellular	
   cholesterol	
   overload.	
   Although	
   densitometry	
   analysis	
   of	
   the	
   Western	
   blot	
   shows	
   an	
   increased	
   expression	
  of	
  CYP27A1	
  protein	
  levels	
  in	
  spindle	
  SMCs	
  (Figure	
  3-­‐3B),	
  these	
  observed	
  ABCA1	
  bands	
  in	
   Figure	
  3-­‐3A	
  do	
  not	
  reflect	
  a	
  significant	
  difference	
  from	
  a	
  single	
  experiment.	
  	
  	
  	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
    45	
   	
    	
   	
  	
  	
  	
  A	
    	
  	
  	
  	
  	
  	
  	
  	
    	
    	
  	
  B	
    	
    	
    	
    	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  Spindle	
  	
   	
    	
    	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  Epithelioid	
  	
    	
    Figure	
   3-­‐3	
   Protein	
   expression	
   levels	
   of	
   CYP27A1	
   in	
   spindle	
   and	
   epithelioid	
   SMCs.	
   Cells	
   were	
   incubated	
  in	
  DMEM	
  with	
  10%	
  FBS	
  supplemented	
  with	
  1%	
  penicillin/streptomycin,	
  maintained	
  in	
  a	
   humidified	
  incubator	
  at	
  37	
  °C	
  and	
  5%	
  CO2,	
  prior	
  to	
  determination	
  of	
  CYP27A1	
  levels	
  by	
  Western	
  blot	
   analysis.	
   Cholesterol-­‐loaded	
   cells	
   were	
   treated	
   as	
   described	
   in	
   section	
   2.2.2.	
   The	
   loading	
   control	
   used	
   for	
   Western	
   blot	
   analysis	
   was	
   protein	
   disulfide	
   isomerase	
   (PDI).	
   (B)	
   Numeric	
   densitometry	
   values	
   represent	
   (A)	
   the	
   intensities	
   of	
   CYP27A1	
   normalized	
   to	
   non-­‐treated	
   spindle	
   SMC	
   levels.	
   Results	
  are	
  from	
  a	
  single	
  experiment.	
  	
   	
   	
   	
    46	
   	
    	
    3.4	
   CYP27A1	
   Transfection	
   Increases	
   CYP27A1	
   mRNA	
   Levels	
   in	
   Spindle	
   and	
   Epithelioid	
  SMCs	
   The	
   synthetic	
   LXR	
   agonist	
   TO-­‐901317	
   and	
   exogenous	
   27-­‐hydroxycholesterol	
   can	
   turn	
   on	
   ABCA1	
   expression	
   in	
   both	
   spindle	
   and	
   epithelioid	
   SMCs	
   (Figure	
   3-­‐1).	
   The	
   reduced	
   expression	
   of	
   CYP27A1	
  mRNA	
  and	
  protein	
  in	
  epithelioid	
  SMCs	
  suggests	
  that	
  impaired	
  expression	
  of	
  CYP27A1	
  is	
  a	
   strong	
   candidate	
   to	
   explain	
   the	
   reduced	
   basal	
   ABCA1	
   expression	
   in	
   these	
   cells.	
   To	
   examine	
   the	
   specific	
  effect	
  of	
  CYP27A1	
  expression	
  in	
  these	
  SMCs,	
  we	
  transfected	
  both	
  cell	
  lines	
  with	
  a	
  full-­‐length	
   human	
   CYP27A1	
   cDNA	
   plasmid	
   using	
   Lipofectamine	
   2000,	
   as	
   described	
   in	
   section	
   2.2.6.	
   The	
   spindle	
   SMCs	
   transfected	
   with	
   the	
   CYP27A1	
   construct	
   showed	
   an	
   increase	
   in	
   CYP27A1	
   mRNA	
   levels	
   in	
   both	
   non-­‐cholesterol	
   loaded	
   and	
   cholesterol	
   loaded	
   conditions.	
   Epithelioid	
   SMCs	
   transfected	
   with	
   the	
   CYP27A1	
   construct	
   also	
   showed	
   an	
   increase	
   in	
   CYP27A1	
   mRNA	
   levels	
   in	
   both	
   non-­‐cholesterol	
   loaded	
   and	
   cholesterol	
   loaded	
   conditions.	
   Unexpectedly,	
   CYP27A1	
   mRNA	
   levels	
   further	
   increased	
   slightly	
   in	
   both	
   cell	
   lines	
   when	
   cholesterol-­‐loaded,	
   although	
   insignificantly.	
   These	
   results	
   suggest	
   that	
  the	
  transfection	
  of	
  CYP27A1	
  using	
  Lipofectamine	
  is	
  successful	
  in	
  expressing	
  CYP27A1	
  mRNA	
  in	
   both	
  cell	
  lines.	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
    47	
   	
    	
   	
   	
    	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  A	
    	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  Spindle	
   	
    	
    	
    B	
    	
  	
  	
  	
  	
  	
  	
  Epithelioid	
    	
    Figure	
   3-­‐4	
   Quantitation	
   of	
   CYP27A1	
   mRNA	
   levels	
   in	
   transfected	
   spindle	
   and	
   epithelioid	
   SMCs.	
   Spindle	
   and	
   epithelioid	
   SMCs	
   were	
   transfected	
   as	
   described	
   in	
   section	
   2.2.6.	
   Cholesterol-­‐loaded	
   conditions	
   are	
   as	
   described	
   in	
   section	
   2.2.2.	
   Levels	
   of	
   CYP27A1	
   mRNA	
   were	
   normalized	
   to	
   cyclophilin	
  mRNA	
  levels.	
  Results	
  are	
  averages	
  ±	
  S.D.	
  of	
  triplicate	
  determinations	
  representative	
  of	
   three	
   experiments	
   with	
   similar	
   results	
   and	
   relative	
   to	
   the	
   ratio	
   of	
   CYP27A1/cyclophilin	
   mRNA	
   in	
   untreated	
  spindle	
  SMCs.	
  *,	
  p	
  <	
  0.05	
  level	
  of	
  significance.	
   	
   	
    48	
   	
    	
    3.5	
  CYP27A1	
  Transfection	
  Increases	
  CYP27A1	
  Protein	
  Expression	
  in	
  Spindle	
  and	
   Epithelioid	
  SMCs	
   In	
   order	
   to	
   confirm	
   whether	
   CYP27A1	
   transfection	
   with	
   Lipofectamine	
   increases	
   CYP27A1	
   protein	
   expression,	
   Western	
   blot	
   analysis	
   was	
   performed.	
   Spindle	
   SMCs	
   transfected	
   with	
   the	
   CYP27A1	
   construct	
   showed	
   an	
   increase	
   in	
   CYP27A1	
   protein	
   in	
   both	
   non-­‐cholesterol	
   loaded	
   and	
   cholesterol	
  loaded	
  conditions	
  (Figure	
  3-­‐5).	
  These	
  results	
  are	
  consistent	
  with	
  CYP27A1	
  mRNA	
  levels	
   in	
  transfected	
  spindle	
  SMCs	
  (Figure	
  3-­‐4).	
  Epithelioid	
  SMCs	
  transfected	
  with	
  the	
  CYP27A1	
  construct	
   also	
   showed	
   an	
   increase	
   in	
   CYP27A1	
   protein	
   in	
   both	
   non-­‐cholesterol	
   loaded	
   and	
   cholesterol	
   loaded	
   conditions	
  (Figure	
  3-­‐5).	
  As	
  expected,	
  there	
  was	
  no	
  marked	
  increase	
  in	
  CYP27A1	
  protein	
  expression	
   in	
   cholesterol-­‐loaded	
   conditions	
   in	
   either	
   SMC	
   line.	
   	
   Although	
   the	
   level	
   of	
   CYP27A1	
   protein	
   in	
   transfected	
  epithelioid	
  SMCs	
  is	
  modest	
  relative	
  to	
  the	
  increase	
  in	
  CYP27A1	
  mRNA	
  seen	
  in	
  Figure	
  3-­‐ 1,	
   these	
   results	
   suggest	
   that	
   the	
   transfection	
   of	
   CYP27A1	
   using	
   Lipofectamine	
   is	
   successful	
   in	
   expressing	
  CYP27A1	
  in	
  both	
  SMC	
  lines.	
   	
   	
   	
  	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
    49	
   	
    	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  A	
    	
    	
    	
  	
  	
  	
  	
  B	
    	
   Figure	
  3-­‐5	
  Quantitation	
  of	
  CYP27A1	
  protein	
  in	
  transfected	
  spindle	
  and	
  epithelioid	
  SMCs.	
  Spindle	
   and	
   epithelioid	
   cells	
   were	
   transfected	
   as	
   described	
   in	
   section	
   2.2.6.	
   Levels	
   of	
   CYP27A1	
   protein	
   were	
   normalized	
   to	
   PDI	
   levels.	
   Cholesterol-­‐loaded	
   cells	
   were	
   treated	
   as	
   described	
   in	
   section	
   2.2.2.	
   The	
   loading	
  control	
  used	
  for	
  Western	
  analysis	
  was	
  PDI.	
  (B)	
  Numeric	
  densitometry	
  values	
  represent	
  (A)	
   the	
   intensities	
   of	
   CYP27A1	
   normalized	
   to	
   non-­‐treated	
   spindle	
   levels.	
   Results	
   are	
   from	
   a	
   single	
   experiment.	
  	
   	
   	
    50	
   	
    	
    3.6	
  CYP27A1	
  Transfection	
  Increases	
  ABCA1	
  Expression	
  in	
  Spindle	
  SMCs	
  But	
  Not	
   in	
  Epithelioid	
  SMCs	
  	
   To	
  determine	
  whether	
  transfection	
  of	
  CYP27A1	
  increases	
  the	
  expression	
  of	
  ABCA1,	
  as	
  would	
   be	
   expected	
   if	
   the	
   CYP27A1	
   enhances	
   27-­‐hydroxycholesterol	
   production,	
   we	
   next	
   tested	
   whether	
   ABCA1	
  expression	
  was	
  increased	
  by	
  this	
  treatment.	
  CYP27A1	
  transfection	
  of	
  spindle	
  SMCs	
  increased	
   ABCA1	
  mRNA	
  expression	
  (Figure	
  3-­‐6	
  A),	
  consistent	
  with	
  the	
  increase	
  in	
  CYP27A1	
  mRNA	
  and	
  protein	
   levels	
   (Figures	
   3-­‐4	
   and	
   3-­‐5).	
   Confirming	
   this	
   increase	
   in	
   ABCA1	
   expression,	
   Western	
   blot	
   analysis	
   also	
  demonstrated	
  an	
  increase	
  in	
  ABCA1	
  protein	
  expression	
  in	
  spindle	
  SMCs	
  (Figures	
  3-­‐6	
  C	
  and	
  D).	
   Despite	
  the	
  successful	
  transfection	
  of	
  CYP27A1	
  in	
  epithelioid	
  SMCs	
  as	
  indicated	
  by	
  the	
  increase	
  in	
   CYP27A1	
   mRNA	
   and	
   protein	
   levels	
   (Figures	
   3-­‐4	
   and	
   3-­‐5),	
   CYP27A1	
   transfection	
   failed	
   to	
   increase	
   ABCA1	
   mRNA	
   expression	
   (Figure	
   3-­‐6	
   B).	
   Western	
   blot	
   analysis	
   confirmed	
   that	
   the	
   increase	
   in	
   CYP27A1	
   mRNA	
   and	
   protein	
   did	
   not	
   increase	
   ABCA1	
   protein	
   expression	
   (Figures	
   3-­‐6	
   C	
   and	
   D).	
   In	
   addition,	
   cholesterol-­‐loaded	
   transfected	
   spindle	
   SMCs	
   showed	
   a	
   further	
   increase	
   in	
   ABCA1	
   mRNA	
   and	
  protein	
  expression.	
  These	
  results	
  suggest	
  either	
  that	
  the	
  increase	
  in	
  CYP27A1	
  expression	
  is	
  not	
   sufficient	
  for	
  an	
  increase	
  in	
  ABCA1	
  mRNA	
  expression	
  in	
  epithelioid	
  cells,	
  or	
  that	
  CYP27A1	
  is	
  failing	
  to	
   generate	
  27-­‐hydroxycholesterol,	
  despite	
  sufficient	
  protein	
  levels.	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
   	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
   	
   	
   	
   	
   	
   	
   	
  	
  	
  	
  	
  	
  	
   	
  	
    51	
   	
    	
   A	
  	
  	
  	
  	
  	
  	
  	
  	
  	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  Spindle	
   	
   	
   	
   B	
    	
    	
  	
  	
   	
    	
    	
    	
    	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  Epithelioid	
    52	
   	
    	
    	
   	
  C	
    	
    D	
    	
   	
   Figure	
  3-­‐6	
  Quantitation	
  of	
  ABCA1	
  expression	
  in	
  transfected	
  spindle	
  and	
  epithelioid	
  SMCs.	
   Spindle	
   and	
   epithelioid	
   cells	
   were	
   transfected	
   as	
   described	
   in	
   section	
   2.2.6.	
   Cholesterol-­‐loaded	
   cells	
   were	
   treated	
   as	
   described	
   in	
   section	
   2.2.2.	
   (A)	
   Levels	
   of	
   ABCA1	
   mRNA	
   were	
   normalized	
   to	
   cyclophilin	
   mRNA	
   levels.	
   (B)	
   Results	
   are	
   averages	
   ±	
   S.D.	
   of	
   triplicate	
   determinations	
   representative	
   of	
   two	
   experiments	
  with	
  similar	
  results	
  and	
  relative	
  to	
  the	
  ratio	
  of	
  ABCA1/cyclophilin	
  mRNA	
  in	
  untreated	
   spindle	
   SMCs.	
   The	
   loading	
   control	
   used	
   for	
   Western	
   analysis	
   was	
   PDI.	
   (D)	
   Numeric	
   densitometry	
   values	
  represent	
  (C)	
  the	
  intensities	
  of	
  ABCA1	
  normalized	
  to	
  non-­‐treated	
  spindle	
  levels.	
  Results	
  are	
   representative	
  of	
  two	
  experiments	
  with	
  similar	
  results.	
  	
   	
    53	
   	
    	
    3.7	
  Transfection	
  Increases	
  27-­‐hydroxycholesterol	
  Levels	
  in	
  Spindle	
  SMCs	
  But	
  Not	
   in	
  Epithelioid	
  SMCs	
   CYP27A1	
   transfection	
   of	
   spindle	
   and	
   epithelioid	
   SMCs	
   successfully	
   increased	
   CYP27A1	
   mRNA	
   and	
   protein	
  expression	
  in	
  both	
  cell	
  lines	
  (Figures	
  3-­‐4	
  and	
  3-­‐5).	
   Despite	
   an	
   increase	
   in	
   ABCA1	
   mRNA	
   and	
   protein	
   levels	
   in	
   spindle	
   SMCs,	
   epithelioid	
   SMCs	
   cells	
   did	
   not	
   show	
   an	
   increase	
   in	
   either	
   ABCA1	
   mRNA	
  levels	
  or	
  protein	
  levels	
  (Figures	
  3-­‐6	
  and	
  3-­‐7).	
  These	
  results	
  suggest	
  that	
  activation	
  of	
  ABCA1	
   expression	
  in	
  epithelioid	
  cells	
  is	
  still	
  impaired	
  at	
  the	
  transcriptional	
  level.	
  The	
  LXR-­‐mediated	
  ABCA1	
   activation	
   is	
   intact	
   in	
   both	
   cell	
   lines,	
   using	
   exogenous	
   27-­‐hydroxycholesterol	
   or	
   LXR	
   agonist	
   TO-­‐ 901317	
   (Figure	
   3-­‐1),	
   suggesting	
   that	
   27-­‐hydroxycholesterol	
   production	
   may	
   still	
   be	
   impaired	
   in	
   epithelioid	
  SMCs	
  despite	
  an	
  increase	
  CYP27A1	
  mRNA	
  and	
  protein	
  expression	
  following	
  transfection	
   with	
  CYP27A1	
  cDNA.	
  To	
  test	
  this	
  possibility,	
  we	
  measured	
  the	
  level	
  of	
  27-­‐hydroxycholesterol	
  in	
  both	
   cell	
  types	
  before	
  and	
  after	
  transfection	
  and	
  in	
  the	
  absence	
  or	
  presence	
  of	
  cholesterol	
  loading.	
  The	
   levels	
   of	
   27-­‐hydroxycholesterol	
   increased	
   in	
   CYP27A1-­‐transfected	
   spindle	
   cells	
   in	
   both	
   non-­‐ cholesterol	
  and	
  cholesterol-­‐loaded	
  conditions	
  (Figure	
  3-­‐7).	
  These	
  preliminary	
  results	
  are	
  consistent	
   with	
  the	
  observed	
  increase	
  in	
  CYP27A1	
  and	
  ABCA1	
  mRNA	
  and	
  protein	
  levels	
  in	
  this	
  cell	
  line.	
  Despite	
   an	
   increase	
   in	
   CYP27A1	
   mRNA	
   and	
   protein	
   levels	
   in	
   epithelioid	
   cells,	
   however,	
   27-­‐ hydroxycholesterol	
   levels	
   showed	
   a	
   limited	
   increase	
   in	
   these	
   cells.	
   The	
   further	
   increase	
   in	
   ABCA1	
   expression	
   in	
   cholesterol-­‐loaded	
   transfected	
   spindle	
   SMCs	
   relative	
   to	
   non-­‐cholesterol	
   loaded	
   conditions	
  suggests	
  that	
  cholesterol	
  delivery	
  to	
  CYP27A1	
  may	
  be	
  impaired	
  in	
  transfected	
  epithelioid	
   SMCs	
   resulting	
   in	
   modest	
   increases	
   in	
   27-­‐OHC,	
   which	
   are	
   not	
   sufficient	
   to	
   increase	
   ABCA1	
   expression.	
   	
   	
  	
  	
   	
   	
    54	
   	
    	
    	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
   Figure	
   3-­‐7	
   Quantitation	
   of	
   27-­‐hydroxcholesterol	
   levels	
   in	
   transfected	
   SMCs.	
   Oxysterols	
   were	
   collected	
   and	
   measured	
   as	
   described	
   in	
   section	
   2.2.7.	
   Quantitative	
   gas	
   chromatography/mass	
   spectrometry	
   determinations	
   for	
   27-­‐hydroxycholesterol	
   were	
   calculated	
   from	
   triplicate	
   injections.	
   Total	
  oxysterol	
  production	
  was	
  determined	
  as	
  the	
  sum	
  of	
  oxysterols	
  in	
  the	
  cells	
  and	
  secreted	
  into	
   the	
  medium.	
  Results	
  are	
  from	
  a	
  single	
  experiment.	
  	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
    55	
   	
    	
    3.8	
  Reduced	
  StARD1	
  mRNA	
  Levels	
  in	
  Epithelioid	
  SMCs	
   Members	
   of	
   the	
   steroidogenic	
   acute	
   regulatory-­‐related	
   lipid	
   transfer	
   (START)	
   domain	
   superfamily	
   play	
   an	
   important	
   role	
   in	
   cholesterol	
   trafficking	
   throughout	
   the	
   cell,	
   exhibiting	
   the	
   ability	
   to	
   bind	
   and	
  transport	
  cholesterol	
  (Miller,	
  2007).	
  StARD1,	
  the	
  prototypical	
  START	
  lipid	
  trafficking	
  protein,	
  is	
   the	
  rate-­‐limiting	
  enzyme	
  for	
  CYP27A1-­‐dependent	
  oxysterol	
  production	
  in	
  the	
  mitochondria,	
  and	
  has	
   been	
   shown	
   to	
   increase	
   27-­‐OHC	
   production,	
   ABCA1	
   expression,	
   and	
   LXR-­‐dependent	
   cholesterol	
   efflux	
   when	
   overexpressed	
   in	
   murine	
   macrophages	
   (Taylor	
   et	
   al.,	
   2010).	
   Our	
   microarray	
   data	
   indicates	
  that	
  the	
  epithelioid	
  SMCs	
  express	
  StARD1	
  at	
  only	
  40%	
  of	
  the	
  level	
  seen	
  in	
  	
  spindle	
  SMCs	
   (data	
   not	
   shown).	
   In	
   order	
   to	
   investigate	
   the	
   levels	
   of	
   StaRD1	
   expressed	
   in	
   epithelioid	
   SMCs,	
   we	
   measured	
   StARD1	
   mRNA	
   expression	
   in	
   both	
   WKY	
   SMC	
   lines.	
   We	
   observed	
   a	
   significantly	
   lower	
   expression	
   of	
   StARD1	
   mRNA	
   in	
   epithelioid	
   SMCs	
   (Figure	
  3.8).	
   	
   These	
   results,	
   while	
   requiring	
   further	
   confirmation,	
  are	
  consistent	
  with	
  our	
  other	
  data	
  and	
  suggest	
  that	
  cholesterol	
  delivery	
  to	
  CYP27A1	
   for	
  the	
  generation	
  of	
  27-­‐hydroxycholesterol	
  is	
  impaired	
  in	
  the	
  epithelioid	
  SMCs.	
  	
    	
    	
    	
    	
    	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  Spindle	
   	
    	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  Epithelioid	
    	
    Figure	
   3-­‐8	
   Quantitation	
   of	
   StARD1	
   mRNA	
   levels	
   in	
   spindle	
   and	
   epithelioid	
   SMCs.	
   Cells	
   were	
   incubated	
  in	
  DMEM	
  with	
  10%	
  FBS	
  supplemented	
  with	
  1%	
  penicillin/streptomycin,	
  maintained	
  in	
  a	
   humidified	
  incubator	
  at	
  37	
  °C	
  and	
  5%	
  CO2,	
  prior	
  to	
  determination	
  of	
  StARD1	
  levels	
  by	
  quantitative	
   real-­‐time	
   PCR.	
   Levels	
   of	
   StARD1	
   mRNA	
   were	
   normalized	
   to	
   cyclophilin	
   mRNA	
   levels.	
   Results	
   are	
   averages	
  ±	
  S.D.	
  of	
  triplicate	
  determinations	
  of	
  two	
  experiments	
  with	
  similar	
  results	
  and	
  normalized	
   to	
   the	
   relative	
   to	
   the	
   ratio	
   of	
   StARD1/cyclophilin	
   mRNA	
   in	
   spindle	
   SMCs.	
   *,	
   p	
   <	
   0.05	
   level	
   of	
   significance.	
   	
    56	
   	
    	
    3.9	
   Transfection	
   Increases	
   StARD1	
   mRNA	
   Levels	
   in	
   Spindle	
   SMCs	
   But	
   Not	
   in	
   Epithelioid	
  SMCs	
   StARD1	
   contains	
   an	
   LXRE	
   sequence	
   in	
   the	
   promoter	
   region	
   of	
   its	
   gene,	
   which	
   responds	
   to	
   the	
   activation	
   of	
   LXR.	
   In	
   order	
   to	
   further	
   investigate	
   the	
   affect	
   of	
   cholesterol	
   overload	
   on	
   ABCA1	
   expression,	
   WKY	
   SMCs	
   were	
   transfected	
   with	
   CYP27A1	
   in	
   cholesterol-­‐loaded	
   conditions.	
   Spindle	
   SMCs	
  exhibited	
  a	
  marked	
  increase	
  in	
  StARD1	
  mRNA	
  expression;	
  however,	
  epithelioid	
  SMCs	
  failed	
  to	
   do	
  so.	
  These	
  results	
  are	
  consistent	
  with	
  our	
  GC	
  data	
  measuring	
  27-­‐hydroxycholesterol	
  (Figure	
  3-­‐8),	
   in	
   that	
   the	
   increase	
   of	
   27-­‐hydroxycholesterol	
   levels	
   in	
   cholesterol	
   loaded	
   CYP27A1	
   transfected	
   spindle	
   SMCs	
   should	
   increase	
   StARD1	
   expression	
   via	
   the	
   LXRE	
   region.	
   	
   The	
   failure	
   to	
   significantly	
   increase	
   27-­‐hydroxycholesterol	
   levels	
   in	
   cholesterol	
   loaded	
   CYP27A1	
   transfected	
   epithelioid	
   SMCs	
   should	
  also	
  fail	
  to	
  increase	
  StARD1	
  expression.	
  These	
  results	
  suggest	
  that	
  an	
  intact	
  StARD1-­‐CYP27A1	
   pathway	
   in	
   epithelioid	
   SMCs	
   may	
   increase	
   LXR-­‐dependent	
   ABCA1	
   expression	
   under	
   cholesterol-­‐ loaded	
  conditions.	
  	
  	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
    57	
   	
    	
   A.	
    	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  Spindle	
    	
    B.	
    	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  Epithelioid	
    	
    	
   Figure	
  3-­‐9	
  Quantitation	
  of	
  StARD1	
  levels	
  in	
  cholesterol-­‐loaded	
  CYP27A1	
  transfected	
  spindle	
  and	
   epithelioid	
  SMCs.	
  Spindle	
  and	
  epithelioid	
  SMCs	
  were	
  transfected	
  as	
  described	
  in	
  section	
  2.2.6	
  and	
   cholesterol-­‐loaded	
   as	
   described	
   in	
   section	
   2.2.2.	
   Levels	
   of	
   StARD1	
   mRNA	
   were	
   normalized	
   to	
   cyclophilin	
  levels.	
  Results	
  are	
  averages	
  ±	
  S.D.	
  of	
  triplicate	
  determinations	
  of	
  two	
  experiments	
  with	
   similar	
   results	
   and	
   relative	
   to	
   the	
   ratio	
   of	
   StARD1/cyclophilin	
   mRNA	
   in	
   non-­‐cholesterol	
   loaded	
   mocked	
  transfected	
  spindle	
  SMCs.	
  *,	
  p	
  <	
  0.05	
  level	
  of	
  significance.	
    58	
   	
    	
    3.10	
   Qualitative	
   Observations	
   of	
   SMC-­‐specific	
   CYP27A1	
   Expression	
   in	
   Human	
   Atherosclerotic	
  Coronary	
  Arteries	
   SMCs	
  are	
  the	
  main	
  cell	
  type	
  in	
  intimal	
  thickenings	
  and	
  some	
  stages	
  of	
  atherosclerosis,	
  engulfing	
  and	
   accumulating	
  excess	
  lipids	
  like	
  monocyte-­‐derived	
  macrophages	
  and	
  contributing	
  to	
  the	
  total	
  intimal	
   foam	
   cell	
   population	
   (Mietus-­‐Snyder	
   et	
   al.,	
   2000;	
   Rong	
   et	
   al.,	
   2003).	
   Additional	
   work	
   from	
   our	
   laboratory	
   also	
   suggests	
   that	
   SMCs	
   form	
   a	
   much	
   larger	
   percentage	
   of	
   total	
   foam	
   cells	
   in	
   human	
   atherosclerotic	
   intima	
   than	
   previously	
   appreciated	
   (Allahverdian,	
   S.	
   et	
   al.	
   in	
   preparation).	
   Previously,	
   our	
   laboratory	
   has	
   reported	
   an	
   intimal	
   arterial	
   SMC-­‐specific	
   reduction	
   in	
   ABCA1	
   expression	
  in	
  human	
  atherosclerotic	
  coronary	
  arteries,	
  consistent	
  with	
  findings	
  of	
  impaired	
  ABCA1	
   expression	
   in	
   intimal-­‐like	
   epithelioid	
   SMCs	
   (Choi,	
   H.Y.	
   et	
   al.,	
   2009).	
   We	
   have	
   shown	
   that	
   CYP27A1	
   mRNA	
  and	
  protein	
  expression	
  is	
  reduced	
  in	
  epithelioid	
  SMCs	
  (Figure	
   3-­‐2).	
  These	
  results	
  suggest	
  that	
   SMC-­‐specific	
  CYP27A1	
  expression	
  may	
  also	
  be	
  reduced	
  in	
  human	
  atherosclerotic	
  coronary	
  arteries.	
   In	
   order	
   to	
   investigate	
   this,	
   immunohistochemistry	
   was	
   performed	
   on	
   a	
   cross-­‐section	
   of	
   a	
   human	
   coronary	
   artery	
   with	
   native	
   atherosclerosis	
   as	
   described	
   in	
   section	
   2.2.7,	
   in	
   order	
   to	
   distinguish	
   SMC-­‐specific	
   CYP27A1	
   versus	
   macrophage-­‐specific	
   CYP27A1	
   expression.	
   Qualitative	
   observations	
   provide	
   preliminary	
   evidence	
   that	
   SMC-­‐specific	
   CYP27A1	
   expression	
   appears	
   to	
   be	
   reduced,	
   as	
   evidenced	
   by	
   α	
   SM-­‐actin-­‐positive	
   intimal	
   SMCs	
   failing	
   to	
   express	
   CYP27A1	
   expression	
   (Figure	
  3-­‐10).	
   In	
   order	
   to	
   draw	
   strong	
   conclusions	
   about	
   the	
   in	
   vitro	
   nature	
   of	
   CYP27A1	
   expression	
   in	
   intimal-­‐	
   verses	
   medial	
   SMCs,	
   additional	
   patients	
   will	
   need	
   to	
   be	
   included	
   and	
   CYP27A1	
   expression	
   quantified.	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
    59	
   	
    	
    	
   	
    	
  	
  	
  α	
  SM-­‐actin	
   	
    	
    	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  CYP27A1	
    	
    	
    	
  Co-­‐localization	
    	
   	
   	
   	
   	
   	
   	
    60	
   	
    	
    	
   CD68	
   	
    	
    	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  CYP27A1	
    	
    	
    	
  Co-­‐localization	
    	
   	
   Figure	
   3-­‐10	
   SMC-­‐specific	
   CYP27A1	
   expression	
   in	
   a	
   human	
   coronary	
   artery	
   with	
   native	
   atherosclerosis.	
   AlexaFluor®	
   488-­‐conjugated	
   goat	
   anti-­‐mouse	
   IgG	
   (Invitrogen)	
   was	
   used	
   to	
   detect	
   SM	
  α-­‐actin	
  and	
  CD68,	
  and	
  AlexaFluor®	
  594-­‐conjugated	
  goat	
  anti-­‐rabbit	
  IgG	
  (Invitrogen)	
  was	
  used	
  to	
   detect	
  CYP27A1,	
  by	
  dual	
  immunofluorescent	
  staining.	
  Nuclei	
  were	
  stained	
  using	
  4'-­‐6-­‐Diamidino-­‐2-­‐ phenylindole	
   (DAPI),	
   then	
   slides	
   were	
   mounted	
   using	
   SloFade®	
   mounting	
   reagent	
   (Molecular	
   Probes).	
  Isotype-­‐matched	
  IgG	
  and	
  omission	
  of	
  the	
  primary	
  antibody	
  were	
  used	
  as	
  negative	
  controls.	
   Results	
  are	
  from	
  a	
  single	
  experiment.	
  I	
  =	
  intima;	
  M	
  =	
  media	
   	
   	
   	
   	
   	
   	
    61	
   	
    	
   	
   	
   	
   	
   	
   	
   	
    	
   	
   	
   	
   	
   	
   	
   	
   CHAPTER	
  4:	
  DISCUSSION	
    	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
    	
   62	
   	
    	
    4.1	
  Discussion	
   Our	
   laboratory	
   has	
   previously	
   reported	
   reduced	
   ABCA1	
   expression	
   in	
   cultured	
   intima-­‐type	
   and	
   human	
   atherosclerotic	
   lesion	
   intimal	
   SMCs,	
   presenting	
   a	
   novel	
   explanation	
   for	
   cholesterol	
   accumulation	
  in	
  the	
  arterial	
  intima	
  and	
  subsequent	
  SMC	
  foam	
  cell	
  formation	
  during	
  atherogenesis	
   (Choi	
  et	
  al.,	
  2009).	
  In	
  the	
  studies	
  presented	
  here,	
  we	
  have	
  extended	
  these	
  findings	
  to	
  show	
  that	
  the	
   regulation	
   of	
   ABCA1	
   is	
   impaired	
   at	
   the	
   level	
   of	
   LXR	
   activation,	
   with	
   strong	
   evidence	
   that	
   the	
   impairment	
  is	
  found	
  in	
  the	
  production	
  of	
  27-­‐hydroxycholesterol	
  in	
  the	
  intima-­‐type	
  SMCs.	
  The	
  key	
   findings	
   of	
   these	
   studies	
   are	
   that:	
   1)	
   epithelioid	
   SMCs,	
   as	
   models	
   of	
   human	
   arterial	
   intimal	
   SMCs,	
   exhibit	
  reduced	
  CYP27A1	
  mRNA	
  and	
  protein	
  levels	
  relative	
  to	
  arterial	
  medial-­‐like	
  spindle	
  SMCs;	
  2)	
   successful	
   transfection	
   of	
   CYP27A1	
   alone	
   in	
   epithelioid	
   SMCs	
   fails	
   to	
   restore	
   ABCA1	
   mRNA	
   or	
   protein	
   levels;	
   3)	
   the	
   rate-­‐limiting	
   step	
   in	
   delivering	
   cholesterol	
   to	
   CYP27A1	
   via	
   StARD1	
   may	
   be	
   impaired	
   in	
   epithelioid	
   SMCs,	
   as	
   evidenced	
   by	
   reduced	
   StARD1	
   mRNA	
   levels	
   in	
   these	
   cells;	
   and	
   4)	
   preliminary	
  evidence	
  suggests	
  that	
  CYP27A1	
  expression	
  is	
  reduced	
  in	
  human	
  intimal	
  SMCs	
  found	
   in	
   human	
   atherosclerotic	
   coronary	
   arteries.	
   These	
   studies	
   provide	
   evidence	
   that	
   the	
   regulation	
   of	
   ABCA1	
  in	
  intimal	
  SMCs	
  is	
  due	
  to	
  impaired	
  oxysterol	
  production,	
  specifically	
  via	
  the	
  StARD1-­‐CYP27A1	
   27-­‐hydroxycholesterol	
  pathway.	
  	
   	
    We	
   initially	
   determined	
   that	
   epithelioid	
   SMCs	
   exhibited	
   an	
   intact	
   LXR-­‐dependent	
   ABCA1	
    activation	
   pathway	
   following	
   treatment	
   with	
   exogenous	
   27-­‐hydroxycholesterol	
   and	
   LXR	
   agonist	
   TO-­‐ 901317.	
  These	
  results	
  suggested	
  that	
  the	
  impairment	
  of	
  ABCA1	
  was	
  at	
  the	
  level	
  of	
  LXR	
  activation.	
   Since	
   LXR	
   activation	
   is	
   primarily	
   oxysterol-­‐dependent	
   (Pannu	
   et	
   al.,	
   2012),	
   we	
   investigated	
   the	
   expression	
  level	
  of	
  CYP27A1	
  mRNA	
  and	
  protein	
  levels	
  in	
  epithelioid	
  SMCs	
  relative	
  to	
  spindle	
  SMCs.	
   The	
   intimal-­‐like	
   epithelioid	
   SMCs	
   expressed	
   reduced	
   or	
   absent	
   levels	
   of	
   CYP27A1	
   mRNA	
   and	
   protein.	
   These	
   results	
   suggested	
   that	
   27-­‐hydroxycholesterol	
   production	
   was	
   impaired	
   in	
   epithelioid	
   SMCs	
   and	
   may	
   explain	
   the	
   reduced	
   ABCA1	
   expression	
   as	
   previously	
   reported.	
   To	
   investigate	
   the	
   effect	
  of	
  CYP27A1	
  on	
  ABCA1	
  expression,	
  we	
  transfected	
  spindle	
  and	
  epithelioid	
  SMCs	
  with	
  a	
  human	
   CYP27A1	
  plasmid.	
  Both	
  cell	
  lines	
  expressed	
  CYP27A1	
  mRNA	
  and	
  protein	
  in	
  response	
  to	
  transfection.	
   Also	
   in	
   response	
   to	
   CYP27A1	
   transfection,	
   spindle	
   SMCs	
   exhibited	
   increased	
   expression	
   of	
   ABCA1	
   mRNA	
   and	
   protein;	
   however,	
   epithelioid	
   SMCs	
   failed	
   to	
   do	
   so,	
   suggesting	
   a	
   lack	
   of	
   27-­‐ hydroxycholesterol-­‐induced	
  LXR-­‐dependent	
  activation	
  of	
  ABCA1.	
  To	
  investigate	
  the	
  low	
  production	
   of	
   27-­‐hydroxycholesterol	
   observed	
   in	
   transfected	
   epithelioid	
   SMCs,	
   we	
   transfected	
   the	
   cells	
   in	
    63	
   	
    	
   cholesterol-­‐loaded	
   conditions,	
   in	
   order	
   to	
   increase	
   the	
   substrate	
   availability	
   to	
   CYP27A1.	
   In	
   response	
   to	
   this	
   new	
   condition,	
   transfected	
   spindle	
   SMCs	
   exhibited	
   a	
   marked	
   increase	
   in	
   ABCA1	
   mRNA	
   levels.	
   However,	
   CYP27A1	
   transfected	
   epithelioid	
   SMCs	
   failed	
   to	
   increase	
   ABCA1	
   mRNA	
   or	
   protein	
   expression	
   in	
   response	
   to	
   cholesterol-­‐loaded	
   conditions.	
   To	
   investigate	
   the	
   activity	
   levels	
   of	
   CYP27A1,	
   27-­‐hydroxycholesterol	
   levels	
   were	
   measured	
   using	
   gas	
   chromatography	
   as	
   described	
   in	
   section	
   2.2.6.	
   CYP27A1	
   transfected	
   medial-­‐like	
   spindle	
   SMCs	
   exhibited	
   a	
   marked	
   increased	
   in	
   27-­‐ hydroxycholesterol,	
   consistent	
   with	
   increased	
   CYP27A1	
   mRNA	
   and	
   protein	
   levels	
   and	
   subsequent	
   ABCA1	
  mRNA	
  and	
  protein	
  expression.	
  However,	
  despite	
  a	
  marked	
  increase	
  in	
  CYP27A1	
  mRNA,	
  and	
   an	
   increase	
   in	
   protein	
   levels,	
   27-­‐hydroxycholesterol	
   levels	
   measured	
   in	
   CYP27A1	
   transfected	
   epithelioid	
   SMCs	
   were	
   only	
   modestly	
   increased.	
   These	
   results	
   suggested	
   that	
   although	
   CYP27A1	
   protein	
   is	
   successfully	
   expressed	
   in	
   CYP27A1	
   transfected	
   epithelioid	
   SMCs,	
   the	
   enzyme	
   does	
   not	
   produce	
   27-­‐hydroxycholesterol	
   at	
   levels	
   akin	
   to	
   similarly	
   transfected	
   spindle	
   SMCs.	
   These	
   results	
   suggested	
  the	
  possibility	
  that	
  the	
  delivery	
  of	
  cholesterol	
  to	
  CYP27A1	
  may	
  be	
  impaired.	
  	
   Recently,	
  the	
  StAR	
  family	
  of	
  lipid	
  transporters	
  has	
  been	
  shown	
  to	
  traffic	
  cholesterol	
  to	
  and	
   from	
   multiple	
   cellular	
   compartments.	
   The	
   prototypical	
   member	
   of	
   the	
   StAR	
   family,	
   StARD1,	
   is	
   responsible	
  for	
  the	
  delivery	
  of	
  cholesterol	
  across	
  the	
  mitochondrial	
  membrane	
  to	
  CYP27A1,	
  and	
  is	
   the	
   rate-­‐limiting	
   enzyme	
   for	
   CYP27A1-­‐dependent	
   oxysterol	
   production	
   in	
   the	
   mitochondria.	
   A	
   previous	
  study	
  has	
  shown	
  an	
  increase	
  in	
  27-­‐hydroxycholesterol	
  production,	
  ABCA1	
  expression,	
  and	
   LXR-­‐dependent	
   cholesterol	
   efflux	
   in	
   murine	
   macrophages	
   overexpressing	
   StARD1.	
   Our	
   previous	
   microarray	
  data	
  indicated	
  a	
  lower	
  StARD1	
  expression	
  in	
  epithelioid	
  SMCs	
  relative	
  to	
  spindle	
  SMCs	
   and	
   led	
   us	
   to	
   investigate	
   StARD1	
   mRNA	
   expression	
   levels	
   in	
   our	
   cell	
   lines.	
   To	
   investigate,	
   we	
   designed	
   StARD1	
   primers	
   for	
   use	
   in	
   quantitative	
   real-­‐time	
   PCR,	
   and	
   found	
   that	
   epithelioid	
   SMCs	
   have	
   a	
   markedly	
   reduced	
   expression	
   of	
   StARD1	
   mRNA	
   as	
   compared	
   to	
   spindle	
   SMCs.	
   This	
   finding	
   was	
   consistent	
   with	
   the	
   inability	
   of	
   CYP27A1	
   transfected	
   epithelioid	
   SMCs	
   to	
   upregulate	
   ABCA1	
   expression	
   despite	
   a	
   cholesterol-­‐loaded	
   condition.	
   In	
   addition,	
   we	
   found	
   that	
   cholesterol-­‐loaded	
   CYP27A1	
  transfected	
  spindle	
  SMCs	
  showed	
  a	
  marked	
  increase	
  in	
  StARD1	
  expression	
  as	
  compared	
  to	
   non-­‐cholesterol	
   conditions.	
   The	
   StARD1	
   gene	
   contains	
   an	
   LXR	
   response	
   element	
   (LXRE)	
   sequence	
   that	
   acts	
   as	
   a	
   part	
   of	
   a	
   positive	
   feedback	
   mechanism	
   in	
   response	
   to	
   an	
   increase	
   in	
   cellular	
   cholesterol.	
   Thus,	
   the	
   increase	
   in	
   StARD1	
   mRNA	
   in	
   CYP27A1	
   transfected	
   and	
   cholesterol-­‐loaded	
   spindle	
   SMCs	
   is	
   consistent	
   with	
   an	
   intact	
   cholesterol	
   transport	
   pathway	
   to	
   the	
   mitochondria	
   via	
   StaRD1,	
   intact	
   CYP27A1-­‐mediated	
   production	
   of	
   27-­‐hydroxycholesterol,	
   and	
   intact	
   LXR-­‐dependent	
    64	
   	
    	
   activation	
  of	
  ABCA1	
  expression.	
  The	
  failure	
  to	
  increase	
  StARD1	
  expression	
  in	
  CYP27A1	
  transfected	
   epithelioid	
   SMCs	
   in	
   response	
   to	
   cholesterol-­‐loading	
   is	
   consistent	
   with	
   an	
   impaired	
   cholesterol	
   transport	
   pathway	
   to	
   the	
   mitochondria	
   via	
   StARD1	
   resulting	
   in	
   an	
   impaired	
   CYP27A1-­‐mediated	
   production	
   of	
   27-­‐hydroxycholesterol,	
   and	
   consequent	
   impairment	
   of	
   LXR-­‐dependent	
   activation	
   of	
   ABCA1.	
  These	
  results	
  combined	
  with	
  data	
  from	
  normal	
  cells	
  and	
  monogenic	
  disorders	
  (NPC	
  disease,	
   CESD	
  and	
  CTX)	
  of	
  cholesterol	
  trafficking	
  and	
  oxysterol	
  generation	
  suggest	
  that	
  a	
  major	
  role	
  for	
  the	
   trafficking	
   of	
   cholesterol	
   from	
   late	
   endosomes/lysosomes	
   to	
   mitochondria	
   in	
   generating	
   oxysterols,	
   particularly	
  27-­‐OHC,	
  required	
  to	
  activate	
  LXR	
  and	
  upregulate	
  genes	
  for	
  RCT	
  (Pannu	
  et	
  al.,	
  2012).	
  In	
   addition	
   to	
   this	
   in	
   vitro	
   work,	
   we	
   showed	
   preliminary	
   qualitative	
   data	
   of	
   reduced	
   SMC-­‐specific	
   reduction	
  of	
  CYP27A1	
  in	
  human	
  atherosclerotic	
  coronary	
  arteries,	
  which	
  may	
  confirm	
  our	
  findings	
   in	
  intimal-­‐like	
  epithelioid	
  SMCs	
  with	
  human	
  atherosclerotic	
  arterial	
  intimal	
  SMCs	
  that	
  the	
  CYP27A1	
   pathway	
  may	
  be	
  the	
  cause	
  of	
  observed	
  lower	
  ABCA1	
  expression.	
  	
   For	
   several	
   of	
   these	
   lines	
   of	
   investigation,	
   further	
   experiments	
   are	
   needed	
   to	
   confirm	
   the	
   consistency	
  of	
  the	
  findings.	
  	
  Further	
  experiments	
  are	
  also	
  needed	
  to	
  confirm	
  the	
  role	
  of	
  StARD1	
  in	
   the	
   impaired	
   ABCA1	
   expression	
   in	
   intimal-­‐type	
   arterial	
   SMCs.	
   Specifically,	
   a	
   co-­‐transfection	
   of	
   StARD1	
   and	
   CYP27A1	
   in	
   non-­‐cholesterol	
   and	
   cholesterol-­‐loaded	
   conditions	
   may	
   provide	
   further	
   evidence	
   of	
   the	
   importance	
   of	
   the	
   lysosomal-­‐mitochondrial	
   pathway	
   in	
   the	
   activation	
   of	
   ABCA1	
   expression	
   in	
   arterial	
   SMCs.	
   Further	
   immunohistochemistry	
   and	
   quantitation	
   of	
   human	
   atherosclerotic	
   arterial	
   intimal	
   SMC-­‐specific	
   CYP27A1	
   expression	
   will	
   provide	
   evidence	
   of	
   the	
   relevance	
   of	
   our	
   in	
   vitro	
   work	
   to	
   the	
   pathology	
   of	
   atherogenesis	
   in	
   humans.	
   Future	
   experiments	
   should	
   also	
   include	
   a	
   quantitative	
   assessment	
   of	
   StARD1	
   expression	
   by	
   immunohistochemistry	
   in	
   human	
  atherosclerotic	
  arterial	
  intimal-­‐specific	
  SMCs.	
  	
   	
    	
   	
   	
   	
   	
   	
   	
   	
   	
   65	
   	
    	
    4.2	
  Concluding	
  Remarks	
   The	
   findings	
   of	
   this	
   thesis	
   provide	
   a	
   narrative	
   highlighting	
   the	
   importance	
   of	
   the	
   intracellular	
   transport	
  of	
  cholesterol	
  to	
  mitochondria	
  for	
  the	
  activation	
  of	
  LXR-­‐dependent	
  ABCA1	
  expression	
  in	
   arterial	
   SMCs.	
   Our	
   finding	
   of	
   CYP27A1	
   and	
   StARD1	
   expression	
   deficiency	
   in	
   intimal-­‐like	
   arterial	
   SMCs,	
   and	
   dependency	
   of	
   an	
   intact	
   delivery	
   of	
   cholesterol	
   to	
   the	
   mitochondrial	
   compartment	
   for	
   the	
   production	
   of	
   27-­‐hydroxycholesterol	
   may	
   provide	
   insight	
   into	
   the	
   dysregulation	
   of	
   ABCA1	
   expression	
  in	
  human	
  atherosclerotic	
  arterial	
  SMCs	
  that	
  may	
  contribute	
  to	
  the	
  foam	
  cell	
  population	
   and	
   subsequent	
   plaque	
   formation	
   in	
   human	
   atherogenesis.	
   An	
   understanding	
   of	
   basic	
   defects	
   in	
   gene	
  regulation	
  and	
  cholesterol	
  metabolism	
  in	
  the	
  atherosclerotic	
  lesion	
  will	
  provide	
  novel	
  insights	
   into	
   the	
   prevention	
   and	
   treatment	
   of	
   the	
   major	
   cause	
   of	
   death	
   worldwide,	
   ischemic	
   vascular	
   disease.	
  	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
   	
    66	
   	
    	
    REFERENCES	
   [1]	
   [2]	
   [3]	
    [4]	
    [5]	
    [6]	
    [7]	
   [8]	
    [9]	
    [10]	
   [11]	
    [12]	
   [13]	
    [14]	
   [15]	
    WHO,	
   2012.	
   Global	
   atlas	
   on	
   cardiovascular	
  disease	
  prevention	
   and	
   control,	
   in:	
   Organization,	
   W.W.H.F.W.S.	
  (Ed.).	
   Statistics	
  Canada,	
  C.,	
  2009.	
  Summary	
  List	
  of	
  Causes,	
  in:	
  Canada,	
  G.o.	
  (Ed.).	
   Yusuf,	
  S.,	
  Hawken,	
  S.,	
  Ounpuu,	
  S.,	
  Dans,	
  T.,	
  Avezum,	
  A.,	
  Lanas,	
  F.,	
  McQueen,	
  M.,	
  Budaj,	
  A.,	
   Pais,	
   P.,	
   Varigos,	
   J.	
   and	
   Lisheng,	
   L.,	
   2004.	
   Effect	
   of	
   potentially	
   modifiable	
   risk	
   factors	
   associated	
  with	
  myocardial	
  infarction	
  in	
  52	
  countries	
  (the	
  INTERHEART	
  study):	
  case-­‐control	
   study,	
  Lancet.	
  364,	
  937-­‐52.	
   Joshi,	
   P.,	
   Islam,	
   S.,	
   Pais,	
   P.,	
   Reddy,	
   S.,	
   Dorairaj,	
   P.,	
   Kazmi,	
   K.,	
   Pandey,	
   M.R.,	
   Haque,	
   S.,	
   Mendis,	
  S.,	
  Rangarajan,	
  S.	
  and	
  Yusuf,	
  S.,	
  2007.	
  Risk	
  factors	
  for	
  early	
  myocardial	
  infarction	
  in	
   South	
   Asians	
   compared	
   with	
   individuals	
   in	
   other	
   countries,	
   JAMA	
   :	
   the	
   journal	
   of	
   the	
   American	
  Medical	
  Association.	
  297,	
  286-­‐94.	
   Anand,	
  S.S.,	
  Islam,	
  S.,	
  Rosengren,	
  A.,	
  Franzosi,	
  M.G.,	
  Steyn,	
  K.,	
  Yusufali,	
  A.H.,	
  Keltai,	
  M.,	
  Diaz,	
   R.,	
  Rangarajan,	
  S.	
  and	
  Yusuf,	
  S.,	
  2008.	
  Risk	
  factors	
  for	
  myocardial	
  infarction	
  in	
  women	
  and	
   men:	
  insights	
  from	
  the	
  INTERHEART	
  study,	
  European	
  heart	
  journal.	
  29,	
  932-­‐40.	
   Teo,	
  K.K.,	
  Liu,	
  L.,	
  Chow,	
  C.K.,	
  Wang,	
  X.,	
  Islam,	
  S.,	
  Jiang,	
  L.,	
  Sanderson,	
  J.E.,	
  Rangarajan,	
  S.	
  and	
   Yusuf,	
   S.,	
   2009.	
   Potentially	
   modifiable	
   risk	
   factors	
   associated	
   with	
   myocardial	
   infarction	
   in	
   China:	
  the	
  INTERHEART	
  China	
  study,	
  Heart.	
  95,	
  1857-­‐64.	
   Castelli,	
   W.P.,	
   1984.	
   Epidemiology	
   of	
   coronary	
   heart	
   disease:	
   the	
   Framingham	
   study,	
   The	
   American	
  journal	
  of	
  medicine.	
  76,	
  4-­‐12.	
   Plehn,	
   J.F.,	
   Davis,	
   B.R.,	
   Sacks,	
   F.M.,	
   Rouleau,	
   J.L.,	
   Pfeffer,	
   M.A.,	
   Bernstein,	
   V.,	
   Cuddy,	
   T.E.,	
   Moye,	
  L.A.,	
  Piller,	
  L.B.,	
  Rutherford,	
  J.,	
  Simpson,	
  L.M.	
  and	
  Braunwald,	
  E.,	
  1999.	
  Reduction	
  of	
   stroke	
   incidence	
   after	
   myocardial	
   infarction	
   with	
   pravastatin:	
   the	
   Cholesterol	
   and	
   Recurrent	
   Events	
  (CARE)	
  study.	
  The	
  Care	
  Investigators,	
  Circulation.	
  99,	
  216-­‐23.	
   Byington,	
  R.P.,	
  Davis,	
  B.R.,	
  Plehn,	
  J.F.,	
  White,	
  H.D.,	
  Baker,	
  J.,	
  Cobbe,	
  S.M.	
  and	
  Shepherd,	
  J.,	
   2001.	
  Reduction	
  of	
  stroke	
  events	
  with	
  pravastatin:	
  the	
  Prospective	
  Pravastatin	
  Pooling	
  (PPP)	
   Project,	
  Circulation.	
  103,	
  387-­‐92.	
   Wierzbicki,	
   A.S.,	
   2007.	
   Lipid-­‐altering	
   therapies	
   and	
   the	
   progression	
   of	
   atherosclerotic	
   disease,	
  Cardiovascular	
  and	
  interventional	
  radiology.	
  30,	
  155-­‐60.	
   Rubins,	
   H.B.,	
   Robins,	
   S.J.,	
   Iwane,	
   M.K.,	
   Boden,	
   W.E.,	
   Elam,	
   M.B.,	
   Fye,	
   C.L.,	
   Gordon,	
   D.J.,	
   Schaefer,	
  E.J.,	
  Schectman,	
  G.	
  and	
  Wittes,	
  J.T.,	
  1993.	
  Rationale	
  and	
  design	
  of	
  the	
  Department	
   of	
   Veterans	
   Affairs	
   High-­‐Density	
   Lipoprotein	
   Cholesterol	
   Intervention	
   Trial	
   (HIT)	
   for	
   secondary	
   prevention	
   of	
   coronary	
   artery	
   disease	
   in	
   men	
   with	
   low	
   high-­‐density	
   lipoprotein	
   cholesterol	
   and	
   desirable	
   low-­‐density	
   lipoprotein	
   cholesterol,	
   The	
   American	
   journal	
   of	
   cardiology.	
  71,	
  45-­‐52.	
   Cutri,	
  B.A.,	
  Hime,	
  N.J.	
  and	
  Nicholls,	
  S.J.,	
  2006.	
  High-­‐density	
  lipoproteins:	
  an	
  emerging	
  target	
   in	
  the	
  prevention	
  of	
  cardiovascular	
  disease,	
  Cell	
  research.	
  16,	
  799-­‐808.	
   Chernobelsky,	
   A.,	
   Ashen,	
   M.D.,	
   Blumenthal,	
   R.S.	
   and	
   Coplan,	
   N.L.,	
   2007.	
   High-­‐density	
   lipoprotein	
   cholesterol:	
   a	
   potential	
   therapeutic	
   target	
   for	
   prevention	
   of	
   coronary	
   artery	
   disease,	
  Preventive	
  cardiology.	
  10,	
  26-­‐30.	
   Toth,	
  P.P.,	
  2005.	
  Cardiology	
  patient	
  page.	
  The	
  "good	
  cholesterol":	
  high-­‐density	
  lipoprotein,	
   Circulation.	
  111,	
  e89-­‐91.	
   Canner,	
   P.L.,	
   Berge,	
   K.G.,	
   Wenger,	
   N.K.,	
   Stamler,	
   J.,	
   Friedman,	
   L.,	
   Prineas,	
   R.J.	
   and	
   Friedewald,	
   W.,	
   1986.	
   Fifteen	
   year	
   mortality	
   in	
   Coronary	
   Drug	
   Project	
   patients:	
   long-­‐term	
   benefit	
  with	
  niacin,	
  Journal	
  of	
  the	
  American	
  College	
  of	
  Cardiology.	
  8,	
  1245-­‐55.	
    67	
   	
    	
   [16]	
    [17]	
   [18]	
   [19]	
   [20]	
   [21]	
   [22]	
   [23]	
    [24]	
   [25]	
    [26]	
    [27]	
    [28]	
   [29]	
    [30]	
    [31]	
    [32]	
    Adams,	
  C.M.,	
  Reitz,	
  J.,	
  De	
  Brabander,	
  J.K.,	
  Feramisco,	
  J.D.,	
  Li,	
  L.,	
  Brown,	
  M.S.	
  and	
  Goldstein,	
   J.L.,	
   2004.	
   Cholesterol	
   and	
   25-­‐hydroxycholesterol	
   inhibit	
   activation	
   of	
   SREBPs	
   by	
   different	
   mechanisms,	
   both	
   involving	
   SCAP	
   and	
   Insigs,	
   The	
   Journal	
   of	
   biological	
   chemistry.	
   279,	
   52772-­‐80.	
   Lusis,	
  A.J.,	
  2000.	
  Atherosclerosis,	
  Nature.	
  407,	
  233-­‐41.	
   Keaney,	
   J.F.,	
   Jr.,	
   2000.	
   Atherosclerosis:	
   from	
   lesion	
   formation	
   to	
   plaque	
   activation	
   and	
   endothelial	
  dysfunction,	
  Molecular	
  aspects	
  of	
  medicine.	
  21,	
  99-­‐166.	
   Newby,	
   A.C.,	
   2000.	
   An	
   overview	
   of	
   the	
   vascular	
   response	
   to	
   injury:	
   a	
   tribute	
   to	
   the	
   late	
   Russell	
  Ross,	
  Toxicology	
  letters.	
  112-­‐113,	
  519-­‐29.	
   Hahn,	
   C.	
   and	
   Schwartz,	
   M.A.,	
   2009.	
   Mechanotransduction	
   in	
   vascular	
   physiology	
   and	
   atherogenesis,	
  Nat	
  Rev	
  Mol	
  Cell	
  Biol.	
  10,	
  53-­‐62.	
   Williams,	
   K.J.	
   and	
   Tabas,	
   I.,	
   1995.	
   The	
   response-­‐to-­‐retention	
   hypothesis	
   of	
   early	
   atherogenesis,	
  Arteriosclerosis,	
  thrombosis,	
  and	
  vascular	
  biology.	
  15,	
  551-­‐61.	
   Ross,	
   R.,	
   1999.	
   Atherosclerosis-­‐-­‐an	
   inflammatory	
   disease,	
   The	
   New	
   England	
   journal	
   of	
   medicine.	
  340,	
  115-­‐26.	
   Pillarisetti,	
   S.,	
   Alexander,	
   C.W.	
   and	
   Saxena,	
   U.,	
   2004.	
   Atherosclerosis	
   -­‐-­‐	
   new	
   targets	
   and	
   therapeutics,	
  Current	
  medicinal	
  chemistry.	
  Cardiovascular	
  and	
  hematological	
  agents.	
  2,	
  327-­‐ 34.	
   Kher,	
  N.	
  and	
  Marsh,	
  J.D.,	
  2004.	
  Pathobiology	
  of	
  atherosclerosis-­‐-­‐a	
  brief	
  review,	
  Seminars	
  in	
   thrombosis	
  and	
  hemostasis.	
  30,	
  665-­‐72.	
   Kaperonis,	
   E.A.,	
   Liapis,	
   C.D.,	
   Kakisis,	
   J.D.,	
   Dimitroulis,	
   D.	
   and	
   Papavassiliou,	
   V.G.,	
   2006.	
   Inflammation	
  and	
  atherosclerosis,	
  European	
  journal	
  of	
  vascular	
  and	
  endovascular	
  surgery	
  :	
   the	
  official	
  journal	
  of	
  the	
  European	
  Society	
  for	
  Vascular	
  Surgery.	
  31,	
  386-­‐93.	
   Aiello,	
   R.J.,	
   Bourassa,	
   P.A.,	
   Lindsey,	
   S.,	
   Weng,	
   W.,	
   Natoli,	
   E.,	
   Rollins,	
   B.J.	
   and	
   Milos,	
   P.M.,	
   1999.	
  Monocyte	
  chemoattractant	
  protein-­‐1	
  accelerates	
  atherosclerosis	
  in	
  apolipoprotein	
  E-­‐ deficient	
  mice,	
  Arteriosclerosis,	
  thrombosis,	
  and	
  vascular	
  biology.	
  19,	
  1518-­‐25.	
   Doran,	
   A.C.,	
   Meller,	
   N.	
   and	
   McNamara,	
   C.A.,	
   2008.	
   Role	
   of	
   smooth	
   muscle	
   cells	
   in	
   the	
   initiation	
  and	
  early	
  progression	
  of	
  atherosclerosis,	
  Arteriosclerosis,	
  thrombosis,	
  and	
  vascular	
   biology.	
  28,	
  812-­‐9.	
   Bobryshev,	
   Y.V.	
   and	
   Lord,	
   R.S.,	
   1995.	
   S-­‐100	
   positive	
   cells	
   in	
   human	
   arterial	
   intima	
   and	
   in	
   atherosclerotic	
  lesions,	
  Cardiovascular	
  research.	
  29,	
  689-­‐96.	
   Erbel,	
   C.,	
   Sato,	
   K.,	
   Meyer,	
   F.B.,	
   Kopecky,	
   S.L.,	
   Frye,	
   R.L.,	
   Goronzy,	
   J.J.	
   and	
   Weyand,	
   C.M.,	
   2007.	
   Functional	
   profile	
   of	
   activated	
   dendritic	
   cells	
   in	
   unstable	
   atherosclerotic	
   plaque,	
   Basic	
   research	
  in	
  cardiology.	
  102,	
  123-­‐32.	
   Perrins,	
   C.J.	
   and	
   Bobryshev,	
   Y.V.,	
   2011.	
   Current	
   advances	
   in	
   understanding	
   of	
   immunopathology	
   of	
   atherosclerosis,	
   Virchows	
   Archiv	
   :	
   an	
   international	
   journal	
   of	
   pathology.	
  458,	
  117-­‐23.	
   Weber,	
   C.,	
   Meiler,	
   S.,	
   Doring,	
   Y.,	
   Koch,	
   M.,	
   Drechsler,	
   M.,	
   Megens,	
   R.T.,	
   Rowinska,	
   Z.,	
   Bidzhekov,	
  K.,	
  Fecher,	
  C.,	
  Ribechini,	
  E.,	
  van	
  Zandvoort,	
  M.A.,	
  Binder,	
  C.J.,	
  Jelinek,	
  I.,	
  Hristov,	
   M.,	
   Boon,	
   L.,	
   Jung,	
   S.,	
   Korn,	
   T.,	
   Lutz,	
   M.B.,	
   Forster,	
   I.,	
   Zenke,	
   M.,	
   Hieronymus,	
   T.,	
   Junt,	
  T.	
   and	
   Zernecke,	
   A.,	
   2011.	
   CCL17-­‐expressing	
   dendritic	
   cells	
   drive	
   atherosclerosis	
   by	
   restraining	
   regulatory	
  T	
  cell	
  homeostasis	
  in	
  mice,	
  The	
  Journal	
  of	
  clinical	
  investigation.	
  121,	
  2898-­‐910.	
   Paulson,	
   K.E.,	
   Zhu,	
   S.N.,	
   Chen,	
   M.,	
   Nurmohamed,	
   S.,	
   Jongstra-­‐Bilen,	
   J.	
   and	
   Cybulsky,	
   M.I.,	
   2010.	
   Resident	
   intimal	
   dendritic	
   cells	
   accumulate	
   lipid	
   and	
   contribute	
   to	
   the	
   initiation	
   of	
   atherosclerosis,	
  Circulation	
  research.	
  106,	
  383-­‐90.	
    68	
   	
    	
   [33]	
    [34]	
    [35]	
    [36]	
    [37]	
    [38]	
    [39]	
   [40]	
    [41]	
    [42]	
    [43]	
   [44]	
   [45]	
   [46]	
   [47]	
    Bobryshev,	
  Y.V.	
  and	
  Watanabe,	
  T.,	
  1997.	
  Ultrastructural	
  evidence	
  for	
  association	
  of	
  vascular	
   dendritic	
   cells	
   with	
   T-­‐lymphocytes	
   and	
   with	
   B-­‐cells	
   in	
   human	
   atherosclerosis,	
   Journal	
   of	
   submicroscopic	
  cytology	
  and	
  pathology.	
  29,	
  209-­‐21.	
   Lamon,	
   B.D.	
   and	
   Hajjar,	
   D.P.,	
   2008.	
   Inflammation	
   at	
   the	
   molecular	
   interface	
   of	
   atherogenesis:	
   an	
   anthropological	
   journey,	
   The	
   American	
   journal	
   of	
   pathology.	
   173,	
   1253-­‐ 64.	
   van	
   Oostrom,	
   O.,	
   Fledderus,	
   J.O.,	
   de	
   Kleijn,	
   D.,	
   Pasterkamp,	
   G.	
   and	
   Verhaar,	
   M.C.,	
   2009.	
   Smooth	
   muscle	
   progenitor	
   cells:	
   friend	
   or	
   foe	
   in	
   vascular	
   disease?,	
   Current	
   stem	
   cell	
   research	
  &	
  therapy.	
  4,	
  131-­‐40.	
   Ramprasad,	
   M.P.,	
   Fischer,	
   W.,	
   Witztum,	
   J.L.,	
   Sambrano,	
   G.R.,	
   Quehenberger,	
   O.	
   and	
   Steinberg,	
   D.,	
   1995.	
   The	
   94-­‐	
   to	
   97-­‐kDa	
   mouse	
   macrophage	
   membrane	
   protein	
   that	
   recognizes	
   oxidized	
   low	
   density	
   lipoprotein	
   and	
   phosphatidylserine-­‐rich	
   liposomes	
   is	
   identical	
  to	
  macrosialin,	
  the	
  mouse	
  homologue	
  of	
  human	
  CD68,	
  Proceedings	
  of	
  the	
  National	
   Academy	
  of	
  Sciences	
  of	
  the	
  United	
  States	
  of	
  America.	
  92,	
  9580-­‐4.	
   Chinetti,	
   G.,	
   Gbaguidi,	
   F.G.,	
   Griglio,	
   S.,	
   Mallat,	
   Z.,	
   Antonucci,	
   M.,	
   Poulain,	
   P.,	
   Chapman,	
   J.,	
   Fruchart,	
  J.C.,	
  Tedgui,	
  A.,	
  Najib-­‐Fruchart,	
  J.	
  and	
  Staels,	
  B.,	
  2000.	
  CLA-­‐1/SR-­‐BI	
  is	
  expressed	
  in	
   atherosclerotic	
  lesion	
  macrophages	
  and	
  regulated	
  by	
  activators	
  of	
  peroxisome	
  proliferator-­‐ activated	
  receptors,	
  Circulation.	
  101,	
  2411-­‐7.	
   Smirnova,	
   I.V.,	
   Kajstura,	
   M.,	
   Sawamura,	
   T.	
   and	
   Goligorsky,	
   M.S.,	
   2004.	
   Asymmetric	
   dimethylarginine	
  upregulates	
  LOX-­‐1	
  in	
  activated	
  macrophages:	
  role	
  in	
  foam	
  cell	
  formation,	
   American	
  journal	
  of	
  physiology.	
  Heart	
  and	
  circulatory	
  physiology.	
  287,	
  H782-­‐90.	
   Greaves,	
   D.R.	
   and	
   Gordon,	
   S.,	
   2009.	
   The	
   macrophage	
   scavenger	
   receptor	
   at	
   30	
   years	
   of	
   age:	
   current	
  knowledge	
  and	
  future	
  challenges,	
  Journal	
  of	
  lipid	
  research.	
  50	
  Suppl,	
  S282-­‐6.	
   Ishikawa,	
  Y.,	
  Kimura-­‐Matsumoto,	
  M.,	
  Murakami,	
  M.,	
  Yamamoto,	
  K.,	
  Akasaka,	
  Y.,	
  Uzuki,	
  M.,	
   Yuri,	
   Y.,	
   Inomata,	
   N.,	
   Yokoo,	
   T.	
   and	
   Ishii,	
   T.,	
   2009.	
   Distribution	
   of	
   smooth	
   muscle	
   cells	
   and	
   macrophages	
   expressing	
   scavenger	
   receptor	
   BI/II	
   in	
   atherosclerosis,	
   Journal	
   of	
   atherosclerosis	
  and	
  thrombosis.	
  16,	
  829-­‐39.	
   Nakashima,	
   Y.,	
   Wight,	
   T.N.	
   and	
   Sueishi,	
   K.,	
   2008.	
   Early	
   atherosclerosis	
   in	
   humans:	
   role	
   of	
   diffuse	
   intimal	
   thickening	
   and	
   extracellular	
   matrix	
   proteoglycans,	
   Cardiovascular	
   research.	
   79,	
  14-­‐23.	
   Tannock,	
   L.R.	
   and	
   King,	
   V.L.,	
   2008.	
   Proteoglycan	
   mediated	
   lipoprotein	
   retention:	
   a	
   mechanism	
   of	
   diabetic	
   atherosclerosis,	
   Reviews	
   in	
   endocrine	
   &	
   metabolic	
   disorders.	
   9,	
   289-­‐ 300.	
   Heinecke,	
   J.W.,	
   1998.	
   Oxidants	
   and	
   antioxidants	
   in	
   the	
   pathogenesis	
   of	
   atherosclerosis:	
   implications	
  for	
  the	
  oxidized	
  low	
  density	
  lipoprotein	
  hypothesis,	
  Atherosclerosis.	
  141,	
  1-­‐15.	
   Stocker,	
   R.	
   and	
   Keaney,	
   J.F.,	
   Jr.,	
   2004.	
   Role	
   of	
   oxidative	
   modifications	
   in	
   atherosclerosis,	
   Physiological	
  reviews.	
  84,	
  1381-­‐478.	
   Mendelsohn,	
   M.E.	
   and	
   Karas,	
   R.H.,	
   2005.	
   Molecular	
   and	
   cellular	
   basis	
   of	
   cardiovascular	
   gender	
  differences,	
  Science.	
  308,	
  1583-­‐7.	
   Ross,	
   R.,	
   1993.	
   The	
   pathogenesis	
   of	
   atherosclerosis:	
   a	
   perspective	
   for	
   the	
   1990s,	
   Nature.	
   362,	
  801-­‐9.	
   Stary,	
   H.C.,	
   Chandler,	
   A.B.,	
   Dinsmore,	
   R.E.,	
   Fuster,	
   V.,	
   Glagov,	
   S.,	
   Insull,	
   W.,	
   Jr.,	
   Rosenfeld,	
   M.E.,	
  Schwartz,	
  C.J.,	
  Wagner,	
  W.D.	
  and	
  Wissler,	
  R.W.,	
  1995.	
  A	
  definition	
  of	
  advanced	
  types	
   of	
   atherosclerotic	
   lesions	
   and	
   a	
   histological	
   classification	
   of	
   atherosclerosis.	
   A	
   report	
   from	
   the	
   Committee	
   on	
   Vascular	
   Lesions	
   of	
   the	
   Council	
   on	
   Arteriosclerosis,	
   American	
   Heart	
   Association,	
  Circulation.	
  92,	
  1355-­‐74.	
    69	
   	
    	
   [48]	
   [49]	
   [50]	
   [51]	
   [52]	
   [53]	
    [54]	
   [55]	
   [56]	
   [57]	
   [58]	
    [59]	
   [60]	
   [61]	
   [62]	
    [63]	
    [64]	
    [65]	
   [66]	
   [67]	
    [68]	
    Insull,	
   W.,	
   Jr.,	
   2009.	
   The	
   pathology	
   of	
   atherosclerosis:	
   plaque	
   development	
   and	
   plaque	
   responses	
  to	
  medical	
  treatment,	
  The	
  American	
  journal	
  of	
  medicine.	
  122,	
  S3-­‐S14.	
   Hansson,	
   G.K.	
   and	
   Libby,	
   P.,	
   2006.	
   The	
   immune	
   response	
   in	
   atherosclerosis:	
   a	
   double-­‐edged	
   sword,	
  Nat	
  Rev	
  Immunol.	
  6,	
  508-­‐19.	
   Haines,	
   T.H.,	
   2001.	
   Do	
   sterols	
   reduce	
   proton	
   and	
   sodium	
   leaks	
   through	
   lipid	
   bilayers?,	
   Progress	
  in	
  lipid	
  research.	
  40,	
  299-­‐324.	
   Simons,	
  K.	
  and	
  Ikonen,	
  E.,	
  2000.	
  How	
  cells	
  handle	
  cholesterol,	
  Science.	
  290,	
  1721-­‐6.	
   Kurzchalia,	
  T.V.	
  and	
  Ward,	
  S.,	
  2003.	
  Why	
  do	
  worms	
  need	
  cholesterol?,	
  Nature	
  cell	
  biology.	
  5,	
   684-­‐8.	
   Katsuda,	
  S.,	
  Boyd,	
  H.C.,	
  Fligner,	
  C.,	
  Ross,	
  R.	
  and	
  Gown,	
  A.M.,	
  1992.	
  Human	
  atherosclerosis.	
   III.	
   Immunocytochemical	
   analysis	
   of	
   the	
   cell	
   composition	
   of	
   lesions	
   of	
   young	
   adults,	
   The	
   American	
  journal	
  of	
  pathology.	
  140,	
  907-­‐14.	
   Maxfield,	
  F.R.	
  and	
  Menon,	
  A.K.,	
  2006.	
  Intracellular	
  sterol	
  transport	
  and	
  distribution,	
  Current	
   opinion	
  in	
  cell	
  biology.	
  18,	
  379-­‐85.	
   Chappell,	
   D.A.	
   and	
   Medh,	
   J.D.,	
   1998.	
   Receptor-­‐mediated	
   mechanisms	
   of	
   lipoprotein	
   remnant	
  catabolism,	
  Progress	
  in	
  lipid	
  research.	
  37,	
  393-­‐422.	
   Ginsberg,	
  H.N.,	
  1998.	
  Lipoprotein	
  physiology,	
  Endocrinology	
  and	
  metabolism	
  clinics	
  of	
  North	
   America.	
  27,	
  503-­‐19.	
   Oram,	
  J.F.	
  and	
  Heinecke,	
  J.W.,	
  2005.	
  ATP-­‐binding	
  cassette	
  transporter	
  A1:	
  a	
  cell	
  cholesterol	
   exporter	
  that	
  protects	
  against	
  cardiovascular	
  disease,	
  Physiological	
  reviews.	
  85,	
  1343-­‐72.	
   Goldstein,	
   J.L.,	
   Brown,	
   M.S.,	
   Anderson,	
   R.G.,	
   Russell,	
   D.W.	
   and	
   Schneider,	
   W.J.,	
   1985.	
   Receptor-­‐mediated	
  endocytosis:	
  concepts	
  emerging	
  from	
  the	
  LDL	
  receptor	
  system,	
  Annual	
   review	
  of	
  cell	
  biology.	
  1,	
  1-­‐39.	
   Chiang,	
  J.Y.,	
  2009.	
  Bile	
  acids:	
  regulation	
  of	
  synthesis,	
  Journal	
  of	
  lipid	
  research.	
  50,	
  1955-­‐66.	
   Goldstein,	
   J.L.	
   and	
   Brown,	
   M.S.,	
   2009.	
   The	
   LDL	
   receptor,	
   Arteriosclerosis,	
   thrombosis,	
   and	
   vascular	
  biology.	
  29,	
  431-­‐8.	
   Miller,	
   W.L.,	
   2007.	
   Steroidogenic	
   acute	
   regulatory	
   protein	
   (StAR),	
   a	
   novel	
   mitochondrial	
   cholesterol	
  transporter,	
  Biochimica	
  et	
  biophysica	
  acta.	
  1771,	
  663-­‐76.	
   Ohsaki,	
  Y.,	
  Cheng,	
  J.,	
  Suzuki,	
  M.,	
  Shinohara,	
  Y.,	
  Fujita,	
  A.	
  and	
  Fujimoto,	
  T.,	
  2009.	
  Biogenesis	
   of	
   cytoplasmic	
   lipid	
   droplets:	
   from	
   the	
   lipid	
   ester	
   globule	
   in	
   the	
   membrane	
   to	
   the	
   visible	
   structure,	
  Biochimica	
  et	
  biophysica	
  acta.	
  1791,	
  399-­‐407.	
   Olofsson,	
   S.O.,	
   Bostrom,	
   P.,	
   Andersson,	
   L.,	
   Rutberg,	
   M.,	
   Perman,	
   J.	
   and	
   Boren,	
   J.,	
   2009.	
   Lipid	
   droplets	
   as	
   dynamic	
   organelles	
   connecting	
   storage	
   and	
   efflux	
   of	
   lipids,	
   Biochimica	
   et	
   biophysica	
  acta.	
  1791,	
  448-­‐58.	
   Reinhart,	
  M.P.,	
  Billheimer,	
  J.T.,	
  Faust,	
  J.R.	
  and	
  Gaylor,	
  J.L.,	
  1987.	
  Subcellular	
  localization	
  of	
   the	
   enzymes	
   of	
   cholesterol	
   biosynthesis	
   and	
   metabolism	
   in	
   rat	
   liver,	
   The	
   Journal	
   of	
   biological	
  chemistry.	
  262,	
  9649-­‐55.	
   Brown,	
   M.S.	
   and	
   Goldstein,	
   J.L.,	
   1997.	
   The	
   SREBP	
   pathway:	
   regulation	
   of	
   cholesterol	
   metabolism	
  by	
  proteolysis	
  of	
  a	
  membrane-­‐bound	
  transcription	
  factor,	
  Cell.	
  89,	
  331-­‐40.	
   Edwards,	
   P.A.,	
   Tabor,	
   D.,	
   Kast,	
   H.R.	
   and	
   Venkateswaran,	
   A.,	
   2000.	
   Regulation	
   of	
   gene	
   expression	
  by	
  SREBP	
  and	
  SCAP,	
  Biochimica	
  et	
  biophysica	
  acta.	
  1529,	
  103-­‐13.	
   Sakai,	
   J.	
   and	
   Rawson,	
   R.B.,	
   2001.	
   The	
   sterol	
   regulatory	
   element-­‐binding	
   protein	
   pathway:	
   control	
   of	
   lipid	
   homeostasis	
   through	
   regulated	
   intracellular	
   transport,	
   Current	
   opinion	
   in	
   lipidology.	
  12,	
  261-­‐6.	
   Horton,	
  J.D.,	
  2002.	
  Sterol	
  regulatory	
  element-­‐binding	
  proteins:	
  transcriptional	
  activators	
  of	
   lipid	
  synthesis,	
  Biochemical	
  Society	
  transactions.	
  30,	
  1091-­‐5.	
    70	
   	
    	
   [69]	
    [70]	
   [71]	
    [72]	
    [73]	
    [74]	
   [75]	
   [76]	
   [77]	
    [78]	
    [79]	
    [80]	
   [81]	
    [82]	
    [83]	
    [84]	
    Horton,	
   J.D.,	
   Goldstein,	
   J.L.	
   and	
   Brown,	
   M.S.,	
   2002.	
   SREBPs:	
   activators	
   of	
   the	
   complete	
   program	
   of	
   cholesterol	
   and	
   fatty	
   acid	
   synthesis	
   in	
   the	
   liver,	
   The	
   Journal	
   of	
   clinical	
   investigation.	
  109,	
  1125-­‐31.	
   Goldstein,	
   J.L.,	
   DeBose-­‐Boyd,	
   R.A.	
   and	
   Brown,	
   M.S.,	
   2006.	
   Protein	
   sensors	
   for	
   membrane	
   sterols,	
  Cell.	
  124,	
  35-­‐46.	
   Brown,	
   A.J.,	
   Sun,	
   L.,	
   Feramisco,	
   J.D.,	
   Brown,	
   M.S.	
   and	
   Goldstein,	
   J.L.,	
   2002.	
   Cholesterol	
   addition	
   to	
   ER	
   membranes	
   alters	
   conformation	
   of	
   SCAP,	
   the	
   SREBP	
   escort	
   protein	
   that	
   regulates	
  cholesterol	
  metabolism,	
  Molecular	
  cell.	
  10,	
  237-­‐45.	
   Yang,	
  T.,	
  Espenshade,	
  P.J.,	
  Wright,	
  M.E.,	
  Yabe,	
  D.,	
  Gong,	
  Y.,	
  Aebersold,	
  R.,	
  Goldstein,	
  J.L.	
  and	
   Brown,	
  M.S.,	
  2002.	
  Crucial	
  step	
  in	
  cholesterol	
  homeostasis:	
  sterols	
  promote	
  binding	
  of	
  SCAP	
   to	
   INSIG-­‐1,	
   a	
   membrane	
   protein	
   that	
   facilitates	
   retention	
   of	
   SREBPs	
   in	
   ER,	
   Cell.	
   110,	
   489-­‐ 500.	
   Sever,	
   N.,	
   Yang,	
   T.,	
   Brown,	
   M.S.,	
   Goldstein,	
   J.L.	
   and	
   DeBose-­‐Boyd,	
   R.A.,	
   2003.	
   Accelerated	
   degradation	
   of	
   HMG	
   CoA	
   reductase	
   mediated	
   by	
   binding	
   of	
   insig-­‐1	
   to	
   its	
   sterol-­‐sensing	
   domain,	
  Molecular	
  cell.	
  11,	
  25-­‐33.	
   Chang,	
  T.Y.,	
  Chang,	
  C.C.	
  and	
  Cheng,	
  D.,	
  1997.	
  Acyl-­‐coenzyme	
  A:cholesterol	
  acyltransferase,	
   Annual	
  review	
  of	
  biochemistry.	
  66,	
  613-­‐38.	
   Mukherjee,	
  S.	
  and	
  Maxfield,	
  F.R.,	
  1999.	
  Cholesterol:	
  stuck	
  in	
  traffic,	
  Nature	
  cell	
  biology.	
  1,	
   E37-­‐8.	
   Soccio,	
   R.E.	
   and	
   Breslow,	
   J.L.,	
   2004.	
   Intracellular	
   cholesterol	
   transport,	
   Arteriosclerosis,	
   thrombosis,	
  and	
  vascular	
  biology.	
  24,	
  1150-­‐60.	
   Sando,	
   G.N.	
   and	
   Rosenbaum,	
   L.M.,	
   1985.	
   Human	
   lysosomal	
   acid	
   lipase/cholesteryl	
   ester	
   hydrolase.	
   Purification	
   and	
   properties	
   of	
   the	
   form	
   secreted	
   by	
   fibroblasts	
   in	
   microcarrier	
   culture,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
  260,	
  15186-­‐93.	
   Garver,	
   W.S.	
   and	
   Heidenreich,	
   R.A.,	
   2002.	
   The	
   Niemann-­‐Pick	
   C	
   proteins	
   and	
   trafficking	
   of	
   cholesterol	
   through	
   the	
   late	
   endosomal/lysosomal	
   system,	
   Current	
   molecular	
   medicine.	
   2,	
   485-­‐505.	
   Kwon,	
   H.J.,	
   Abi-­‐Mosleh,	
   L.,	
   Wang,	
   M.L.,	
   Deisenhofer,	
   J.,	
   Goldstein,	
   J.L.,	
   Brown,	
   M.S.	
   and	
   Infante,	
  R.E.,	
  2009.	
  Structure	
  of	
  N-­‐terminal	
  domain	
  of	
  NPC1	
  reveals	
  distinct	
  subdomains	
  for	
   binding	
  and	
  transfer	
  of	
  cholesterol,	
  Cell.	
  137,	
  1213-­‐24.	
   Storch,	
  J.	
  and	
  Xu,	
  Z.,	
  2009.	
  Niemann-­‐Pick	
  C2	
  (NPC2)	
  and	
  intracellular	
  cholesterol	
  trafficking,	
   Biochimica	
  et	
  biophysica	
  acta.	
  1791,	
  671-­‐8.	
   Alpy,	
  F.,	
  Stoeckel,	
  M.E.,	
  Dierich,	
  A.,	
  Escola,	
  J.M.,	
  Wendling,	
  C.,	
  Chenard,	
  M.P.,	
  Vanier,	
  M.T.,	
   Gruenberg,	
   J.,	
   Tomasetto,	
   C.	
   and	
   Rio,	
   M.C.,	
   2001.	
   The	
   steroidogenic	
   acute	
   regulatory	
   protein	
   homolog	
   MLN64,	
   a	
   late	
   endosomal	
   cholesterol-­‐binding	
   protein,	
   The	
   Journal	
   of	
   biological	
  chemistry.	
  276,	
  4261-­‐9.	
   Zhang,	
   M.,	
   Liu,	
   P.,	
   Dwyer,	
   N.K.,	
   Christenson,	
   L.K.,	
   Fujimoto,	
   T.,	
   Martinez,	
   F.,	
   Comly,	
   M.,	
   Hanover,	
   J.A.,	
   Blanchette-­‐Mackie,	
   E.J.	
   and	
   Strauss,	
   J.F.,	
   3rd,	
   2002.	
   MLN64	
   mediates	
   mobilization	
   of	
   lysosomal	
   cholesterol	
   to	
   steroidogenic	
   mitochondria,	
   The	
   Journal	
   of	
   biological	
  chemistry.	
  277,	
  33300-­‐10.	
   Charman,	
  M.,	
  Kennedy,	
  B.E.,	
  Osborne,	
  N.	
  and	
  Karten,	
  B.,	
  2010.	
  MLN64	
  mediates	
  egress	
  of	
   cholesterol	
   from	
   endosomes	
   to	
   mitochondria	
   in	
   the	
   absence	
   of	
   functional	
   Niemann-­‐Pick	
   Type	
  C1	
  protein,	
  Journal	
  of	
  lipid	
  research.	
  51,	
  1023-­‐34.	
   Taylor,	
   J.M.,	
   Borthwick,	
   F.,	
   Bartholomew,	
   C.	
   and	
   Graham,	
   A.,	
   2010.	
   Overexpression	
   of	
   steroidogenic	
   acute	
   regulatory	
   protein	
   increases	
   macrophage	
   cholesterol	
   efflux	
   to	
   apolipoprotein	
  AI,	
  Cardiovascular	
  research.	
  86,	
  526-­‐34.	
    71	
   	
    	
   [85]	
    Edwards,	
   P.A.,	
   Kennedy,	
   M.A.	
   and	
   Mak,	
   P.A.,	
   2002.	
   LXRs;	
   oxysterol-­‐activated	
   nuclear	
   receptors	
   that	
   regulate	
   genes	
   controlling	
   lipid	
   homeostasis,	
   Vascular	
   pharmacology.	
   38,	
   249-­‐56.	
   [86]	
   Francis,	
  G.A.,	
  Fayard,	
  E.,	
  Picard,	
  F.	
  and	
  Auwerx,	
  J.,	
  2003.	
  Nuclear	
  receptors	
  and	
  the	
  control	
   of	
  metabolism,	
  Annual	
  review	
  of	
  physiology.	
  65,	
  261-­‐311.	
   [87]	
   Ulven,	
   S.M.,	
   Dalen,	
   K.T.,	
   Gustafsson,	
   J.A.	
   and	
   Nebb,	
   H.I.,	
   2005.	
   LXR	
   is	
   crucial	
   in	
   lipid	
   metabolism,	
  Prostaglandins,	
  leukotrienes,	
  and	
  essential	
  fatty	
  acids.	
  73,	
  59-­‐63.	
   [88]	
   Willy,	
  P.J.,	
  Umesono,	
  K.,	
  Ong,	
  E.S.,	
  Evans,	
  R.M.,	
  Heyman,	
  R.A.	
  and	
  Mangelsdorf,	
  D.J.,	
  1995.	
   LXR,	
   a	
   nuclear	
   receptor	
   that	
   defines	
   a	
   distinct	
   retinoid	
   response	
   pathway,	
   Genes	
   &	
   development.	
  9,	
  1033-­‐45.	
   [89]	
   Willy,	
   P.J.	
   and	
   Mangelsdorf,	
   D.J.,	
   1997.	
   Unique	
   requirements	
   for	
   retinoid-­‐dependent	
   transcriptional	
  activation	
  by	
  the	
  orphan	
  receptor	
  LXR,	
  Genes	
  &	
  development.	
  11,	
  289-­‐98.	
   [90]	
   Hu,	
   X.,	
   Li,	
   S.,	
   Wu,	
   J.,	
   Xia,	
   C.	
   and	
   Lala,	
   D.S.,	
   2003.	
   Liver	
   X	
   receptors	
   interact	
   with	
   corepressors	
   to	
  regulate	
  gene	
  expression,	
  Molecular	
  endocrinology.	
  17,	
  1019-­‐26.	
   [91]	
   Glass,	
  C.K.	
  and	
  Rosenfeld,	
  M.G.,	
  2000.	
  The	
  coregulator	
  exchange	
  in	
  transcriptional	
  functions	
   of	
  nuclear	
  receptors,	
  Genes	
  &	
  development.	
  14,	
  121-­‐41.	
   [92]	
   Svensson,	
   S.,	
   Ostberg,	
   T.,	
   Jacobsson,	
   M.,	
   Norstrom,	
   C.,	
   Stefansson,	
   K.,	
   Hallen,	
   D.,	
   Johansson,	
   I.C.,	
  Zachrisson,	
  K.,	
  Ogg,	
  D.	
  and	
  Jendeberg,	
  L.,	
  2003.	
  Crystal	
  structure	
  of	
  the	
  heterodimeric	
   complex	
  of	
  LXRalpha	
  and	
  RXRbeta	
  ligand-­‐binding	
  domains	
  in	
  a	
  fully	
  agonistic	
  conformation,	
   The	
  EMBO	
  journal.	
  22,	
  4625-­‐33.	
   [93]	
   Herzog,	
  B.,	
  Hallberg,	
  M.,	
  Seth,	
  A.,	
  Woods,	
  A.,	
  White,	
  R.	
  and	
  Parker,	
  M.G.,	
  2007.	
  The	
  nuclear	
   receptor	
   cofactor,	
   receptor-­‐interacting	
   protein	
   140,	
   is	
   required	
   for	
   the	
   regulation	
   of	
   hepatic	
   lipid	
  and	
  glucose	
  metabolism	
  by	
  liver	
  X	
  receptor,	
  Molecular	
  endocrinology.	
  21,	
  2687-­‐97.	
   [94]	
   Lee,	
  S.,	
  Lee,	
  J.,	
  Lee,	
  S.K.	
  and	
  Lee,	
  J.W.,	
  2008.	
  Activating	
  signal	
  cointegrator-­‐2	
  is	
  an	
  essential	
   adaptor	
   to	
   recruit	
   histone	
   H3	
   lysine	
   4	
   methyltransferases	
   MLL3	
   and	
   MLL4	
   to	
   the	
   liver	
   X	
   receptors,	
  Molecular	
  endocrinology.	
  22,	
  1312-­‐9.	
   [95]	
   Repa,	
  J.J.,	
  Liang,	
  G.,	
  Ou,	
  J.,	
  Bashmakov,	
  Y.,	
  Lobaccaro,	
  J.M.,	
  Shimomura,	
  I.,	
  Shan,	
  B.,	
  Brown,	
   M.S.,	
   Goldstein,	
   J.L.	
   and	
   Mangelsdorf,	
   D.J.,	
   2000.	
   Regulation	
   of	
   mouse	
   sterol	
   regulatory	
   element-­‐binding	
  protein-­‐1c	
  gene	
  (SREBP-­‐1c)	
  by	
  oxysterol	
  receptors,	
  LXRalpha	
  and	
  LXRbeta,	
   Genes	
  &	
  development.	
  14,	
  2819-­‐30.	
   [96]	
   Zhang,	
   Y.,	
   Repa,	
   J.J.,	
   Gauthier,	
   K.	
   and	
   Mangelsdorf,	
   D.J.,	
   2001.	
   Regulation	
   of	
   lipoprotein	
   lipase	
  by	
  the	
  oxysterol	
  receptors,	
  LXRalpha	
  and	
  LXRbeta,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
   276,	
  43018-­‐24.	
   [97]	
   Wang,	
  Y.,	
  Rogers,	
  P.M.,	
  Su,	
  C.,	
  Varga,	
  G.,	
  Stayrook,	
  K.R.	
  and	
  Burris,	
  T.P.,	
  2008.	
  Regulation	
  of	
   cholesterologenesis	
  by	
  the	
  oxysterol	
  receptor,	
  LXRalpha,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
   283,	
  26332-­‐9.	
   [98]	
   Zelcer,	
  N.,	
  Hong,	
  C.,	
  Boyadjian,	
  R.	
  and	
  Tontonoz,	
  P.,	
  2009.	
  LXR	
  regulates	
  cholesterol	
  uptake	
   through	
  Idol-­‐dependent	
  ubiquitination	
  of	
  the	
  LDL	
  receptor,	
  Science.	
  325,	
  100-­‐4.	
   [99]	
   Barbier,	
   O.,	
   Trottier,	
   J.,	
   Kaeding,	
   J.,	
   Caron,	
   P.	
   and	
   Verreault,	
   M.,	
   2009.	
   Lipid-­‐activated	
   transcription	
  factors	
  control	
  bile	
  acid	
  glucuronidation,	
  Molecular	
  and	
  cellular	
  biochemistry.	
   326,	
  3-­‐8.	
   [100]	
   Koldamova,	
  R.P.,	
  Lefterov,	
  I.M.,	
  Staufenbiel,	
  M.,	
  Wolfe,	
  D.,	
  Huang,	
  S.,	
  Glorioso,	
  J.C.,	
  Walter,	
   M.,	
   Roth,	
   M.G.	
   and	
   Lazo,	
   J.S.,	
   2005.	
   The	
   liver	
   X	
   receptor	
   ligand	
   T0901317	
   decreases	
   amyloid	
   beta	
   production	
   in	
   vitro	
   and	
   in	
   a	
   mouse	
   model	
   of	
   Alzheimer's	
   disease,	
   The	
   Journal	
   of	
   biological	
  chemistry.	
  280,	
  4079-­‐88.	
    72	
   	
    	
   [101]	
   Adighibe,	
  O.,	
  Arepalli,	
  S.,	
  Duckworth,	
  J.,	
  Hardy,	
  J.	
  and	
  Wavrant-­‐De	
  Vrieze,	
  F.,	
  2006.	
  Genetic	
   variability	
   at	
   the	
   LXR	
   gene	
   (NR1H2)	
   may	
   contribute	
   to	
   the	
   risk	
   of	
   Alzheimer's	
   disease,	
   Neurobiology	
  of	
  aging.	
  27,	
  1431-­‐4.	
   [102]	
   Donkin,	
  J.J.,	
  Stukas,	
  S.,	
  Hirsch-­‐Reinshagen,	
  V.,	
  Namjoshi,	
  D.,	
  Wilkinson,	
  A.,	
  May,	
  S.,	
  Chan,	
  J.,	
   Fan,	
  J.,	
  Collins,	
  J.	
  and	
  Wellington,	
  C.L.,	
  2010.	
  ATP-­‐binding	
  cassette	
  transporter	
  A1	
  mediates	
   the	
   beneficial	
   effects	
   of	
   the	
   liver	
   X	
   receptor	
   agonist	
   GW3965	
   on	
   object	
   recognition	
   memory	
   and	
   amyloid	
   burden	
   in	
   amyloid	
   precursor	
   protein/presenilin	
   1	
   mice,	
   The	
   Journal	
   of	
   biological	
  chemistry.	
  285,	
  34144-­‐54.	
   [103]	
   Infante,	
   J.,	
   Rodriguez-­‐Rodriguez,	
   E.,	
   Mateo,	
   I.,	
   Llorca,	
   J.,	
   Vazquez-­‐Higuera,	
   J.L.,	
   Berciano,	
   J.	
   and	
   Combarros,	
   O.,	
   2010.	
   Gene-­‐gene	
   interaction	
   between	
   heme	
   oxygenase-­‐1	
   and	
   liver	
   X	
   receptor-­‐beta	
  and	
  Alzheimer's	
  disease	
  risk,	
  Neurobiology	
  of	
  aging.	
  31,	
  710-­‐4.	
   [104]	
   Pommier,	
   A.J.,	
   Alves,	
   G.,	
   Viennois,	
   E.,	
   Bernard,	
   S.,	
   Communal,	
   Y.,	
   Sion,	
   B.,	
   Marceau,	
   G.,	
   Damon,	
   C.,	
   Mouzat,	
   K.,	
   Caira,	
   F.,	
   Baron,	
   S.	
   and	
   Lobaccaro,	
   J.M.,	
   2010.	
   Liver	
   X	
   Receptor	
   activation	
   downregulates	
   AKT	
   survival	
   signaling	
   in	
   lipid	
   rafts	
   and	
   induces	
   apoptosis	
   of	
   prostate	
  cancer	
  cells,	
  Oncogene.	
  29,	
  2712-­‐23.	
   [105]	
   Villablanca,	
   E.J.,	
   Raccosta,	
   L.,	
   Zhou,	
   D.,	
   Fontana,	
   R.,	
   Maggioni,	
   D.,	
   Negro,	
   A.,	
   Sanvito,	
   F.,	
   Ponzoni,	
   M.,	
   Valentinis,	
   B.,	
   Bregni,	
   M.,	
   Prinetti,	
   A.,	
   Steffensen,	
   K.R.,	
   Sonnino,	
   S.,	
   Gustafsson,	
   J.A.,	
  Doglioni,	
  C.,	
  Bordignon,	
  C.,	
  Traversari,	
  C.	
  and	
  Russo,	
  V.,	
  2010.	
  Tumor-­‐mediated	
  liver	
  X	
   receptor-­‐alpha	
  activation	
  inhibits	
  CC	
  chemokine	
  receptor-­‐7	
  expression	
  on	
  dendritic	
  cells	
  and	
   dampens	
  antitumor	
  responses,	
  Nature	
  medicine.	
  16,	
  98-­‐105.	
   [106]	
   Laffitte,	
   B.A.,	
   Joseph,	
   S.B.,	
   Walczak,	
   R.,	
   Pei,	
   L.,	
   Wilpitz,	
   D.C.,	
   Collins,	
   J.L.	
   and	
   Tontonoz,	
   P.,	
   2001.	
  Autoregulation	
  of	
  the	
  human	
  liver	
  X	
  receptor	
  alpha	
  promoter,	
  Molecular	
  and	
  cellular	
   biology.	
  21,	
  7558-­‐68.	
   [107]	
   Whitney,	
   K.D.,	
   Watson,	
   M.A.,	
   Goodwin,	
   B.,	
   Galardi,	
   C.M.,	
   Maglich,	
   J.M.,	
   Wilson,	
   J.G.,	
   Willson,	
   T.M.,	
   Collins,	
   J.L.	
   and	
   Kliewer,	
   S.A.,	
   2001.	
   Liver	
   X	
   receptor	
   (LXR)	
   regulation	
   of	
   the	
   LXRalpha	
  gene	
  in	
  human	
  macrophages,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
  276,	
  43509-­‐15.	
   [108]	
   Tint,	
   G.S.	
   and	
   Salen,	
   G.,	
   1982.	
   Biosynthesis	
   of	
   cholesterol,	
   lanosterol,	
   and	
   delta	
   7-­‐ cholestenol,	
   but	
   not	
   cholestanol,	
   in	
   cultured	
   fibroblasts	
   from	
   normal	
   individuals	
   and	
   patients	
  with	
  cerebrotendinous	
  xanthomatosis,	
  Journal	
  of	
  lipid	
  research.	
  23,	
  597-­‐603.	
   [109]	
   Pannu,	
   P.S.,	
   Allahverdian,	
   S.	
   and	
   Francis,	
   G.A.,	
   2012.	
   Oxysterol	
   generation	
   and	
   liver	
   X	
   receptor-­‐dependent	
   reverse	
   cholesterol	
   transport:	
   Not	
   all	
   roads	
   lead	
   to	
   Rome,	
   Molecular	
   and	
  cellular	
  endocrinology.	
   [110]	
   Janowski,	
   B.A.,	
   Willy,	
   P.J.,	
   Devi,	
   T.R.,	
   Falck,	
   J.R.	
   and	
   Mangelsdorf,	
   D.J.,	
   1996.	
   An	
   oxysterol	
   signalling	
  pathway	
  mediated	
  by	
  the	
  nuclear	
  receptor	
  LXR	
  alpha,	
  Nature.	
  383,	
  728-­‐31.	
   [111]	
   Lehmann,	
  J.M.,	
  Kliewer,	
  S.A.,	
  Moore,	
  L.B.,	
  Smith-­‐Oliver,	
  T.A.,	
  Oliver,	
  B.B.,	
  Su,	
  J.L.,	
  Sundseth,	
   S.S.,	
  Winegar,	
  D.A.,	
  Blanchard,	
  D.E.,	
  Spencer,	
  T.A.	
  and	
  Willson,	
  T.M.,	
  1997.	
  Activation	
  of	
  the	
   nuclear	
  receptor	
  LXR	
  by	
  oxysterols	
  defines	
  a	
  new	
  hormone	
  response	
  pathway,	
  The	
  Journal	
   of	
  biological	
  chemistry.	
  272,	
  3137-­‐40.	
   [112]	
   Peet,	
   D.J.,	
   Turley,	
   S.D.,	
   Ma,	
   W.,	
   Janowski,	
   B.A.,	
   Lobaccaro,	
   J.M.,	
   Hammer,	
   R.E.	
   and	
   Mangelsdorf,	
  D.J.,	
  1998.	
  Cholesterol	
  and	
  bile	
  acid	
  metabolism	
  are	
  impaired	
  in	
  mice	
  lacking	
   the	
  nuclear	
  oxysterol	
  receptor	
  LXR	
  alpha,	
  Cell.	
  93,	
  693-­‐704.	
   [113]	
   Berginer,	
   V.M.,	
   Salen,	
   G.	
   and	
   Shefer,	
   S.,	
   1984.	
   Long-­‐term	
   treatment	
   of	
   cerebrotendinous	
   xanthomatosis	
   with	
   chenodeoxycholic	
   acid,	
   The	
   New	
   England	
   journal	
   of	
   medicine.	
   311,	
   1649-­‐52.	
    73	
   	
    	
   [114]	
   Chen,	
   W.,	
   Chen,	
   G.,	
   Head,	
   D.L.,	
   Mangelsdorf,	
   D.J.	
   and	
   Russell,	
   D.W.,	
   2007.	
   Enzymatic	
   reduction	
   of	
   oxysterols	
   impairs	
   LXR	
   signaling	
   in	
   cultured	
   cells	
   and	
   the	
   livers	
   of	
   mice,	
   Cell	
   metabolism.	
  5,	
  73-­‐9.	
   [115]	
   Wolthers,	
  B.G.,	
  van	
  der	
  Molen,	
  J.C.,	
  Walrecht,	
  H.	
  and	
  Hesselmans,	
  L.F.,	
  1990.	
  Reduction	
  of	
   urinary	
   bile	
   alcohol	
   excretion	
   and	
   serum	
   cholestanol	
   in	
   patients	
   with	
   cerebrotendinous	
   xanthomatosis	
   after	
   oral	
   administration	
   of	
   deoxycholic	
   acid,	
   Clinica	
   chimica	
   acta;	
   international	
  journal	
  of	
  clinical	
  chemistry.	
  193,	
  113-­‐8.	
   [116]	
   Brown,	
   A.J.	
   and	
   Jessup,	
   W.,	
   2009.	
   Oxysterols:	
   Sources,	
   cellular	
   storage	
   and	
   metabolism,	
   and	
   new	
  insights	
  into	
  their	
  roles	
  in	
  cholesterol	
  homeostasis,	
  Molecular	
  aspects	
  of	
  medicine.	
  30,	
   111-­‐22.	
   [117]	
   Schroepfer,	
   G.J.,	
   Jr.,	
   2000.	
   Oxysterols:	
   modulators	
   of	
   cholesterol	
   metabolism	
   and	
   other	
   processes,	
  Physiological	
  reviews.	
  80,	
  361-­‐554.	
   [118]	
   Francis,	
  G.A.,	
  2010.	
  The	
  complexity	
  of	
  HDL,	
  Biochimica	
  et	
  biophysica	
  acta.	
  1801,	
  1286-­‐93.	
   [119]	
   Castro,	
  G.R.	
  and	
  Fielding,	
  C.J.,	
  1988.	
  Early	
  incorporation	
  of	
  cell-­‐derived	
  cholesterol	
  into	
  pre-­‐ beta-­‐migrating	
  high-­‐density	
  lipoprotein,	
  Biochemistry.	
  27,	
  25-­‐9.	
   [120]	
   Davidson,	
   W.S.	
   and	
   Thompson,	
   T.B.,	
   2007.	
   The	
   structure	
   of	
   apolipoprotein	
   A-­‐I	
   in	
   high	
   density	
  lipoproteins,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
  282,	
  22249-­‐53.	
   [121]	
   Barter,	
   P.J.,	
   Brewer,	
   H.B.,	
   Jr.,	
   Chapman,	
   M.J.,	
   Hennekens,	
   C.H.,	
   Rader,	
   D.J.	
   and	
   Tall,	
   A.R.,	
   2003.	
   Cholesteryl	
   ester	
   transfer	
   protein:	
   a	
   novel	
   target	
   for	
   raising	
   HDL	
   and	
   inhibiting	
   atherosclerosis,	
  Arteriosclerosis,	
  thrombosis,	
  and	
  vascular	
  biology.	
  23,	
  160-­‐7.	
   [122]	
   Park,	
   S.S.,	
   Choi,	
   H.,	
   Kim,	
   S.J.,	
   Kim,	
   O.J.,	
   Chae,	
   K.S.	
   and	
   Kim,	
   E.,	
   2008.	
   FXRalpha	
   down-­‐ regulates	
   LXRalpha	
   signaling	
   at	
   the	
  CETP	
  promoter	
  via	
  a	
  common	
  element,	
  Molecules	
  and	
   cells.	
  26,	
  409-­‐14.	
   [123]	
   Fielding,	
   C.J.	
   and	
   Fielding,	
   P.E.,	
   1995.	
   Molecular	
   physiology	
   of	
   reverse	
   cholesterol	
   transport,	
   Journal	
  of	
  lipid	
  research.	
  36,	
  211-­‐28.	
   [124]	
   Tall,	
   A.R.,	
   Yvan-­‐Charvet,	
   L.,	
   Terasaka,	
   N.,	
   Pagler,	
   T.	
   and	
   Wang,	
   N.,	
   2008.	
   HDL,	
   ABC	
   transporters,	
   and	
   cholesterol	
   efflux:	
   implications	
   for	
   the	
   treatment	
   of	
   atherosclerosis,	
   Cell	
   metabolism.	
  7,	
  365-­‐75.	
   [125]	
   Mak,	
   P.A.,	
   Laffitte,	
   B.A.,	
   Desrumaux,	
   C.,	
   Joseph,	
   S.B.,	
   Curtiss,	
   L.K.,	
   Mangelsdorf,	
   D.J.,	
   Tontonoz,	
  P.	
  and	
  Edwards,	
  P.A.,	
  2002.	
  Regulated	
  expression	
  of	
  the	
  apolipoprotein	
  E/C-­‐I/C-­‐ IV/C-­‐II	
   gene	
   cluster	
   in	
   murine	
   and	
   human	
   macrophages.	
   A	
   critical	
   role	
   for	
   nuclear	
   liver	
   X	
   receptors	
  alpha	
  and	
  beta,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
  277,	
  31900-­‐8.	
   [126]	
   Laffitte,	
  B.A.,	
  Joseph,	
  S.B.,	
  Chen,	
  M.,	
  Castrillo,	
  A.,	
  Repa,	
  J.,	
  Wilpitz,	
  D.,	
  Mangelsdorf,	
  D.	
  and	
   Tontonoz,	
   P.,	
   2003.	
   The	
   phospholipid	
   transfer	
   protein	
   gene	
   is	
   a	
   liver	
   X	
   receptor	
   target	
   expressed	
   by	
   macrophages	
   in	
   atherosclerotic	
   lesions,	
   Molecular	
   and	
   cellular	
   biology.	
   23,	
   2182-­‐91.	
   [127]	
   Hoekstra,	
  M.,	
  Van	
  Berkel,	
  T.J.	
  and	
  Van	
  Eck,	
  M.,	
  2010.	
  Scavenger	
  receptor	
  BI:	
  a	
  multi-­‐purpose	
   player	
  in	
  cholesterol	
  and	
  steroid	
  metabolism,	
  World	
  journal	
  of	
  gastroenterology	
  :	
  WJG.	
  16,	
   5916-­‐24.	
   [128]	
   Malerod,	
  L.,	
  Juvet,	
  L.K.,	
  Hanssen-­‐Bauer,	
  A.,	
  Eskild,	
  W.	
  and	
  Berg,	
  T.,	
  2002.	
  Oxysterol-­‐activated	
   LXRalpha/RXR	
   induces	
   hSR-­‐BI-­‐promoter	
   activity	
   in	
   hepatoma	
   cells	
   and	
   preadipocytes,	
   Biochem	
  Biophys	
  Res	
  Commun.	
  299,	
  916-­‐23.	
   [129]	
   Navab,	
  M.,	
  Reddy,	
  S.T.,	
  Van	
  Lenten,	
  B.J.	
  and	
  Fogelman,	
  A.M.,	
  2011.	
  HDL	
  and	
  cardiovascular	
   disease:	
  atherogenic	
  and	
  atheroprotective	
  mechanisms,	
  Nat	
  Rev	
  Cardiol.	
  8,	
  222-­‐32.	
   [130]	
   Kaminski,	
  W.E.,	
  Piehler,	
  A.	
  and	
  Wenzel,	
  J.J.,	
  2006.	
  ABC	
  A-­‐subfamily	
  transporters:	
  structure,	
   function	
  and	
  disease,	
  Biochimica	
  et	
  biophysica	
  acta.	
  1762,	
  510-­‐24.	
    74	
   	
    	
   [131]	
   Rees,	
   D.C.,	
   Johnson,	
   E.	
   and	
   Lewinson,	
   O.,	
   2009.	
   ABC	
   transporters:	
   the	
   power	
   to	
   change,	
   Nature	
  reviews.	
  Molecular	
  cell	
  biology.	
  10,	
  218-­‐27.	
   [132]	
   Francis,	
  G.A.,	
  Knopp,	
  R.H.	
  and	
  Oram,	
  J.F.,	
  1995.	
  Defective	
  removal	
  of	
  cellular	
  cholesterol	
  and	
   phospholipids	
  by	
  apolipoprotein	
  A-­‐I	
  in	
  Tangier	
  Disease,	
  The	
  Journal	
  of	
  clinical	
  investigation.	
   96,	
  78-­‐87.	
   [133]	
   Bodzioch,	
  M.,	
  Orso,	
  E.,	
  Klucken,	
  J.,	
  Langmann,	
  T.,	
  Bottcher,	
  A.,	
  Diederich,	
  W.,	
  Drobnik,	
  W.,	
   Barlage,	
   S.,	
   Buchler,	
   C.,	
   Porsch-­‐Ozcurumez,	
   M.,	
   Kaminski,	
   W.E.,	
   Hahmann,	
   H.W.,	
   Oette,	
   K.,	
   Rothe,	
  G.,	
  Aslanidis,	
  C.,	
  Lackner,	
  K.J.	
  and	
  Schmitz,	
  G.,	
  1999.	
  The	
  gene	
  encoding	
  ATP-­‐binding	
   cassette	
  transporter	
  1	
  is	
  mutated	
  in	
  Tangier	
  disease,	
  Nature	
  genetics.	
  22,	
  347-­‐51.	
   [134]	
   Brooks-­‐Wilson,	
   A.,	
   Marcil,	
   M.,	
   Clee,	
   S.M.,	
   Zhang,	
   L.H.,	
   Roomp,	
   K.,	
   van	
   Dam,	
   M.,	
   Yu,	
   L.,	
   Brewer,	
   C.,	
   Collins,	
   J.A.,	
   Molhuizen,	
   H.O.,	
   Loubser,	
   O.,	
   Ouelette,	
   B.F.,	
   Fichter,	
   K.,	
   Ashbourne-­‐ Excoffon,	
   K.J.,	
   Sensen,	
   C.W.,	
   Scherer,	
   S.,	
   Mott,	
   S.,	
   Denis,	
   M.,	
   Martindale,	
   D.,	
   Frohlich,	
   J.,	
   Morgan,	
   K.,	
   Koop,	
   B.,	
   Pimstone,	
   S.,	
   Kastelein,	
   J.J.,	
   Genest,	
   J.,	
   Jr.	
   and	
   Hayden,	
   M.R.,	
   1999.	
   Mutations	
   in	
   ABC1	
   in	
   Tangier	
   disease	
   and	
   familial	
   high-­‐density	
   lipoprotein	
   deficiency,	
   Nature	
  genetics.	
  22,	
  336-­‐45.	
   [135]	
   Lawn,	
   R.M.,	
   Wade,	
   D.P.,	
   Garvin,	
   M.R.,	
   Wang,	
   X.,	
   Schwartz,	
   K.,	
   Porter,	
   J.G.,	
   Seilhamer,	
   J.J.,	
   Vaughan,	
   A.M.	
   and	
   Oram,	
   J.F.,	
   1999.	
   The	
   Tangier	
   disease	
   gene	
   product	
   ABC1	
   controls	
   the	
   cellular	
   apolipoprotein-­‐mediated	
   lipid	
   removal	
   pathway,	
   The	
   Journal	
   of	
   clinical	
   investigation.	
  104,	
  R25-­‐31.	
   [136]	
   Rust,	
   S.,	
   Rosier,	
   M.,	
   Funke,	
   H.,	
   Real,	
   J.,	
   Amoura,	
   Z.,	
   Piette,	
   J.C.,	
   Deleuze,	
   J.F.,	
   Brewer,	
   H.B.,	
   Duverger,	
  N.,	
  Denefle,	
  P.	
  and	
  Assmann,	
  G.,	
  1999.	
  Tangier	
  disease	
  is	
  caused	
  by	
  mutations	
  in	
   the	
  gene	
  encoding	
  ATP-­‐binding	
  cassette	
  transporter	
  1,	
  Nature	
  genetics.	
  22,	
  352-­‐5.	
   [137]	
   Brousseau,	
  M.E.,	
  Schaefer,	
  E.J.,	
  Dupuis,	
  J.,	
  Eustace,	
  B.,	
  Van	
  Eerdewegh,	
  P.,	
  Goldkamp,	
  A.L.,	
   Thurston,	
   L.M.,	
   FitzGerald,	
   M.G.,	
   Yasek-­‐McKenna,	
   D.,	
   O'Neill,	
   G.,	
   Eberhart,	
   G.P.,	
   Weiffenbach,	
   B.,	
   Ordovas,	
   J.M.,	
   Freeman,	
   M.W.,	
   Brown,	
   R.H.,	
   Jr.	
   and	
   Gu,	
   J.Z.,	
   2000.	
   Novel	
   mutations	
   in	
   the	
   gene	
   encoding	
   ATP-­‐binding	
   cassette	
   1	
   in	
   four	
   tangier	
   disease	
   kindreds,	
   Journal	
  of	
  lipid	
  research.	
  41,	
  433-­‐41.	
   [138]	
   Frikke-­‐Schmidt,	
  R.,	
  Nordestgaard,	
  B.G.,	
  Jensen,	
  G.B.	
  and	
  Tybjaerg-­‐Hansen,	
  A.,	
  2004.	
  Genetic	
   variation	
   in	
   ABC	
   transporter	
   A1	
   contributes	
   to	
   HDL	
   cholesterol	
   in	
   the	
   general	
   population,	
   The	
  Journal	
  of	
  clinical	
  investigation.	
  114,	
  1343-­‐53.	
   [139]	
   Oram,	
  J.F.,	
  2000.	
  Tangier	
  disease	
  and	
  ABCA1,	
  Biochimica	
  et	
  biophysica	
  acta.	
  1529,	
  321-­‐30.	
   [140]	
   Shulenin,	
   S.,	
   Nogee,	
   L.M.,	
   Annilo,	
   T.,	
   Wert,	
   S.E.,	
   Whitsett,	
   J.A.	
   and	
   Dean,	
   M.,	
   2004.	
   ABCA3	
   gene	
   mutations	
   in	
   newborns	
   with	
   fatal	
   surfactant	
   deficiency,	
   The	
   New	
   England	
   journal	
   of	
   medicine.	
  350,	
  1296-­‐303.	
   [141]	
   Kelsell,	
   D.P.,	
   Norgett,	
   E.E.,	
   Unsworth,	
   H.,	
   Teh,	
   M.T.,	
   Cullup,	
   T.,	
   Mein,	
   C.A.,	
   Dopping-­‐ Hepenstal,	
   P.J.,	
   Dale,	
   B.A.,	
   Tadini,	
   G.,	
   Fleckman,	
   P.,	
   Stephens,	
   K.G.,	
   Sybert,	
   V.P.,	
   Mallory,	
   S.B.,	
  North,	
  B.V.,	
  Witt,	
  D.R.,	
  Sprecher,	
  E.,	
  Taylor,	
  A.E.,	
  Ilchyshyn,	
  A.,	
  Kennedy,	
  C.T.,	
  Goodyear,	
   H.,	
   Moss,	
   C.,	
   Paige,	
   D.,	
   Harper,	
   J.I.,	
   Young,	
   B.D.,	
   Leigh,	
   I.M.,	
   Eady,	
   R.A.	
   and	
   O'Toole,	
   E.A.,	
   2005.	
  Mutations	
  in	
  ABCA12	
  underlie	
  the	
  severe	
  congenital	
  skin	
  disease	
  harlequin	
  ichthyosis,	
   American	
  journal	
  of	
  human	
  genetics.	
  76,	
  794-­‐803.	
   [142]	
   Hubacek,	
   J.A.,	
   Berge,	
   K.E.,	
   Cohen,	
   J.C.	
   and	
   Hobbs,	
   H.H.,	
   2001.	
   Mutations	
   in	
   ATP-­‐cassette	
   binding	
  proteins	
  G5	
  (ABCG5)	
  and	
  G8	
  (ABCG8)	
  causing	
  sitosterolemia,	
  Human	
  mutation.	
  18,	
   359-­‐60.	
   [143]	
   Rosmorduc,	
  O.	
  and	
  Poupon,	
  R.,	
  2007.	
  Low	
  phospholipid	
  associated	
  cholelithiasis:	
  association	
   with	
  mutation	
  in	
  the	
  MDR3/ABCB4	
  gene,	
  Orphanet	
  journal	
  of	
  rare	
  diseases.	
  2,	
  29.	
    75	
   	
    	
   [144]	
   Langmann,	
  T.,	
  Klucken,	
  J.,	
  Reil,	
  M.,	
  Liebisch,	
  G.,	
  Luciani,	
  M.F.,	
  Chimini,	
  G.,	
  Kaminski,	
  W.E.	
  and	
   Schmitz,	
   G.,	
   1999.	
   Molecular	
   cloning	
   of	
   the	
   human	
   ATP-­‐binding	
   cassette	
   transporter	
   1	
   (hABC1):	
   evidence	
   for	
   sterol-­‐dependent	
   regulation	
   in	
   macrophages,	
   Biochemical	
   and	
   biophysical	
  research	
  communications.	
  257,	
  29-­‐33.	
   [145]	
   Wellington,	
   C.L.,	
   Walker,	
   E.K.,	
   Suarez,	
   A.,	
   Kwok,	
   A.,	
   Bissada,	
   N.,	
   Singaraja,	
   R.,	
   Yang,	
   Y.Z.,	
   Zhang,	
  L.H.,	
  James,	
  E.,	
  Wilson,	
  J.E.,	
  Francone,	
  O.,	
  McManus,	
  B.M.	
  and	
  Hayden,	
  M.R.,	
  2002.	
   ABCA1	
   mRNA	
   and	
   protein	
   distribution	
   patterns	
   predict	
   multiple	
   different	
   roles	
   and	
   levels	
   of	
   regulation,	
   Laboratory	
   investigation;	
   a	
   journal	
   of	
   technical	
   methods	
   and	
   pathology.	
   82,	
   273-­‐ 83.	
   [146]	
   Luciani,	
   M.F.,	
   Denizot,	
   F.,	
   Savary,	
   S.,	
   Mattei,	
   M.G.	
   and	
   Chimini,	
   G.,	
   1994.	
   Cloning	
   of	
   two	
   novel	
  ABC	
  transporters	
  mapping	
  on	
  human	
  chromosome	
  9,	
  Genomics.	
  21,	
  150-­‐9.	
   [147]	
   Fredrickson	
  D	
  S,	
  A.P.H.,	
  Avioli	
  L	
  V,	
  Goodman	
  D	
  S,	
  Goodman	
  H	
  C,	
  1961.	
  Ann	
  Intern	
  Med.	
  55,	
   1016-­‐1031.	
   [148]	
   McNeish,	
  J.,	
  Aiello,	
  R.J.,	
  Guyot,	
  D.,	
  Turi,	
  T.,	
  Gabel,	
  C.,	
  Aldinger,	
  C.,	
  Hoppe,	
  K.L.,	
  Roach,	
  M.L.,	
   Royer,	
   L.J.,	
   de	
   Wet,	
   J.,	
   Broccardo,	
   C.,	
   Chimini,	
   G.	
   and	
   Francone,	
   O.L.,	
   2000.	
   High	
   density	
   lipoprotein	
  deficiency	
  and	
  foam	
  cell	
  accumulation	
  in	
  mice	
  with	
  targeted	
  disruption	
  of	
  ATP-­‐ binding	
   cassette	
   transporter-­‐1,	
   Proceedings	
   of	
   the	
   National	
   Academy	
   of	
   Sciences	
   of	
   the	
   United	
  States	
  of	
  America.	
  97,	
  4245-­‐50.	
   [149]	
   Timmins,	
   J.M.,	
   Lee,	
   J.Y.,	
   Boudyguina,	
   E.,	
   Kluckman,	
   K.D.,	
   Brunham,	
   L.R.,	
   Mulya,	
   A.,	
   Gebre,	
   A.K.,	
  Coutinho,	
  J.M.,	
  Colvin,	
  P.L.,	
  Smith,	
  T.L.,	
  Hayden,	
  M.R.,	
  Maeda,	
  N.	
  and	
  Parks,	
  J.S.,	
  2005.	
   Targeted	
   inactivation	
   of	
   hepatic	
   Abca1	
   causes	
   profound	
   hypoalphalipoproteinemia	
   and	
   kidney	
  hypercatabolism	
  of	
  apoA-­‐I,	
  The	
  Journal	
  of	
  clinical	
  investigation.	
  115,	
  1333-­‐42.	
   [150]	
   Cavelier,	
   C.,	
   Lorenzi,	
   I.,	
   Rohrer,	
   L.	
   and	
   von	
   Eckardstein,	
   A.,	
   2006.	
   Lipid	
   efflux	
   by	
   the	
   ATP-­‐ binding	
  cassette	
  transporters	
  ABCA1	
  and	
  ABCG1,	
  Biochimica	
  et	
  biophysica	
  acta.	
  1761,	
  655-­‐ 66.	
   [151]	
   Bungert,	
   S.,	
   Molday,	
   L.L.	
   and	
   Molday,	
   R.S.,	
   2001.	
   Membrane	
   topology	
   of	
   the	
   ATP	
   binding	
   cassette	
   transporter	
   ABCR	
   and	
   its	
   relationship	
   to	
   ABC1	
   and	
   related	
   ABCA	
   transporters:	
   identification	
  of	
  N-­‐linked	
  glycosylation	
  sites,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
  276,	
  23539-­‐ 46.	
   [152]	
   Fitzgerald,	
   M.L.,	
   Mendez,	
   A.J.,	
   Moore,	
   K.J.,	
   Andersson,	
   L.P.,	
   Panjeton,	
   H.A.	
   and	
   Freeman,	
   M.W.,	
   2001.	
   ATP-­‐binding	
   cassette	
   transporter	
   A1	
   contains	
   an	
   NH2-­‐terminal	
   signal	
   anchor	
   sequence	
   that	
   translocates	
   the	
   protein's	
   first	
   hydrophilic	
   domain	
   to	
   the	
   exoplasmic	
  space,	
   The	
  Journal	
  of	
  biological	
  chemistry.	
  276,	
  15137-­‐45.	
   [153]	
   Oram,	
   J.F.,	
   2003.	
   HDL	
   apolipoproteins	
   and	
   ABCA1:	
   partners	
   in	
   the	
   removal	
   of	
   excess	
   cellular	
   cholesterol,	
  Arteriosclerosis,	
  thrombosis,	
  and	
  vascular	
  biology.	
  23,	
  720-­‐7.	
   [154]	
   Maxfield,	
   F.R.	
   and	
   Tabas,	
   I.,	
   2005.	
   Role	
   of	
   cholesterol	
   and	
   lipid	
   organization	
   in	
   disease,	
   Nature.	
  438,	
  612-­‐21.	
   [155]	
   Remaley,	
   A.T.,	
   Stonik,	
   J.A.,	
   Demosky,	
   S.J.,	
   Neufeld,	
   E.B.,	
   Bocharov,	
   A.V.,	
   Vishnyakova,	
   T.G.,	
   Eggerman,	
   T.L.,	
   Patterson,	
   A.P.,	
   Duverger,	
   N.J.,	
   Santamarina-­‐Fojo,	
   S.	
   and	
   Brewer,	
   H.B.,	
   Jr.,	
   2001.	
   Apolipoprotein	
   specificity	
   for	
   lipid	
   efflux	
   by	
   the	
   human	
   ABCAI	
   transporter,	
   Biochemical	
  and	
  biophysical	
  research	
  communications.	
  280,	
  818-­‐23.	
   [156]	
   Rothblat,	
  G.H.,	
  de	
  la	
  Llera-­‐Moya,	
  M.,	
  Atger,	
  V.,	
  Kellner-­‐Weibel,	
  G.,	
  Williams,	
  D.L.	
  and	
  Phillips,	
   M.C.,	
   1999.	
   Cell	
   cholesterol	
   efflux:	
   integration	
   of	
   old	
   and	
   new	
   observations	
   provides	
   new	
   insights,	
  Journal	
  of	
  lipid	
  research.	
  40,	
  781-­‐96.	
   [157]	
   Klucken,	
   J.,	
   Buchler,	
   C.,	
   Orso,	
   E.,	
   Kaminski,	
   W.E.,	
   Porsch-­‐Ozcurumez,	
   M.,	
   Liebisch,	
   G.,	
   Kapinsky,	
   M.,	
   Diederich,	
   W.,	
   Drobnik,	
   W.,	
   Dean,	
   M.,	
   Allikmets,	
   R.	
   and	
   Schmitz,	
   G.,	
   2000.	
    76	
   	
    	
    [158]	
   [159]	
    [160]	
    [161]	
    [162]	
    [163]	
    [164]	
    [165]	
    [166]	
    [167]	
    [168]	
    [169]	
    [170]	
    ABCG1	
   (ABC8),	
   the	
   human	
   homolog	
   of	
   the	
   Drosophila	
   white	
   gene,	
   is	
   a	
   regulator	
   of	
   macrophage	
  cholesterol	
  and	
  phospholipid	
  transport,	
  Proceedings	
  of	
  the	
  National	
  Academy	
   of	
  Sciences	
  of	
  the	
  United	
  States	
  of	
  America.	
  97,	
  817-­‐22.	
   Lund-­‐Katz,	
  S.	
  and	
  Phillips,	
  M.C.,	
  2010.	
  High	
  density	
  lipoprotein	
  structure-­‐function	
  and	
  role	
  in	
   reverse	
  cholesterol	
  transport,	
  Sub-­‐cellular	
  biochemistry.	
  51,	
  183-­‐227.	
   Venkateswaran,	
  A.,	
  Repa,	
  J.J.,	
  Lobaccaro,	
  J.M.,	
  Bronson,	
  A.,	
  Mangelsdorf,	
  D.J.	
  and	
  Edwards,	
   P.A.,	
   2000.	
   Human	
   white/murine	
   ABC8	
   mRNA	
   levels	
   are	
   highly	
   induced	
   in	
   lipid-­‐loaded	
   macrophages.	
   A	
   transcriptional	
   role	
   for	
   specific	
   oxysterols,	
   The	
   Journal	
   of	
   biological	
   chemistry.	
  275,	
  14700-­‐7.	
   Aye,	
   I.L.,	
   Waddell,	
   B.J.,	
   Mark,	
   P.J.	
   and	
   Keelan,	
   J.A.,	
   2010.	
   Placental	
   ABCA1	
   and	
   ABCG1	
   transporters	
   efflux	
   cholesterol	
   and	
   protect	
   trophoblasts	
   from	
   oxysterol	
   induced	
   toxicity,	
   Biochimica	
  et	
  biophysica	
  acta.	
  1801,	
  1013-­‐24.	
   Jiang,	
   Y.J.,	
   Lu,	
   B.,	
   Tarling,	
   E.J.,	
   Kim,	
   P.,	
   Man,	
   M.Q.,	
   Crumrine,	
   D.,	
   Edwards,	
   P.A.,	
   Elias,	
   P.M.	
   and	
   Feingold,	
   K.R.,	
   2010.	
   Regulation	
   of	
   ABCG1	
   expression	
   in	
   human	
   keratinocytes	
   and	
   murine	
  epidermis,	
  Journal	
  of	
  lipid	
  research.	
  51,	
  3185-­‐95.	
   Boadu,	
   E.,	
   Bilbey,	
   N.J.	
   and	
   Francis,	
   G.A.,	
   2008.	
   Cellular	
   cholesterol	
   substrate	
   pools	
   for	
   adenosine-­‐triphosphate	
   cassette	
   transporter	
   A1-­‐dependent	
   high-­‐density	
   lipoprotein	
   formation,	
  Current	
  opinion	
  in	
  lipidology.	
  19,	
  270-­‐6.	
   Kawano,	
  M.,	
  Miida,	
  T.,	
  Fielding,	
  C.J.	
  and	
  Fielding,	
  P.E.,	
  1993.	
  Quantitation	
  of	
  pre	
  beta-­‐HDL-­‐ dependent	
   and	
   nonspecific	
   components	
   of	
   the	
   total	
   efflux	
   of	
   cellular	
   cholesterol	
   and	
   phospholipid,	
  Biochemistry.	
  32,	
  5025-­‐8.	
   Ji,	
  Y.,	
  Jian,	
  B.,	
  Wang,	
  N.,	
  Sun,	
  Y.,	
  Moya,	
  M.L.,	
  Phillips,	
  M.C.,	
  Rothblat,	
  G.H.,	
  Swaney,	
  J.B.	
  and	
   Tall,	
  A.R.,	
  1997.	
  Scavenger	
  receptor	
  BI	
  promotes	
  high	
  density	
  lipoprotein-­‐mediated	
  cellular	
   cholesterol	
  efflux,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
  272,	
  20982-­‐5.	
   Jian,	
   B.,	
   de	
   la	
   Llera-­‐Moya,	
   M.,	
   Ji,	
   Y.,	
   Wang,	
   N.,	
   Phillips,	
   M.C.,	
   Swaney,	
   J.B.,	
   Tall,	
   A.R.	
   and	
   Rothblat,	
  G.H.,	
  1998.	
  Scavenger	
  receptor	
  class	
  B	
  type	
  I	
  as	
  a	
  mediator	
  of	
  cellular	
  cholesterol	
   efflux	
  to	
  lipoproteins	
  and	
  phospholipid	
  acceptors,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
  273,	
   5599-­‐606.	
   Gu,	
   X.,	
   Kozarsky,	
   K.	
   and	
   Krieger,	
   M.,	
   2000.	
   Scavenger	
   receptor	
   class	
   B,	
   type	
   I-­‐mediated	
   [3H]cholesterol	
   efflux	
   to	
   high	
   and	
   low	
   density	
   lipoproteins	
   is	
   dependent	
   on	
   lipoprotein	
   binding	
  to	
  the	
  receptor,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
  275,	
  29993-­‐30001.	
   de	
   La	
   Llera-­‐Moya,	
   M.,	
   Connelly,	
   M.A.,	
   Drazul,	
   D.,	
   Klein,	
   S.M.,	
   Favari,	
   E.,	
   Yancey,	
   P.G.,	
   Williams,	
   D.L.	
   and	
   Rothblat,	
   G.H.,	
   2001.	
   Scavenger	
   receptor	
   class	
   B	
   type	
   I	
   affects	
   cholesterol	
   homeostasis	
  by	
  magnifying	
  cholesterol	
  flux	
  between	
  cells	
  and	
  HDL,	
  Journal	
  of	
  lipid	
  research.	
   42,	
  1969-­‐78.	
   Orso,	
   E.,	
   Broccardo,	
   C.,	
   Kaminski,	
   W.E.,	
   Bottcher,	
   A.,	
   Liebisch,	
   G.,	
   Drobnik,	
   W.,	
   Gotz,	
   A.,	
   Chambenoit,	
   O.,	
   Diederich,	
   W.,	
   Langmann,	
   T.,	
   Spruss,	
   T.,	
   Luciani,	
   M.F.,	
   Rothe,	
   G.,	
   Lackner,	
   K.J.,	
  Chimini,	
  G.	
  and	
  Schmitz,	
  G.,	
  2000.	
  Transport	
  of	
  lipids	
  from	
  golgi	
  to	
  plasma	
  membrane	
  is	
   defective	
  in	
  tangier	
  disease	
  patients	
  and	
  Abc1-­‐deficient	
  mice,	
  Nature	
  genetics.	
  24,	
  192-­‐6.	
   Neufeld,	
   E.B.,	
   Remaley,	
   A.T.,	
   Demosky,	
   S.J.,	
   Stonik,	
   J.A.,	
   Cooney,	
   A.M.,	
   Comly,	
   M.,	
   Dwyer,	
   N.K.,	
   Zhang,	
   M.,	
   Blanchette-­‐Mackie,	
   J.,	
   Santamarina-­‐Fojo,	
   S.	
   and	
   Brewer,	
   H.B.,	
   Jr.,	
   2001.	
   Cellular	
   localization	
   and	
   trafficking	
   of	
   the	
   human	
   ABCA1	
   transporter,	
   The	
   Journal	
   of	
   biological	
  chemistry.	
  276,	
  27584-­‐90.	
   Neufeld,	
   E.B.,	
   Demosky,	
   S.J.,	
   Jr.,	
   Stonik,	
   J.A.,	
   Combs,	
   C.,	
   Remaley,	
   A.T.,	
   Duverger,	
   N.,	
   Santamarina-­‐Fojo,	
   S.	
   and	
   Brewer,	
   H.B.,	
   Jr.,	
   2002.	
   The	
   ABCA1	
   transporter	
   functions	
   on	
   the	
    77	
   	
    	
    [171]	
    [172]	
    [173]	
    [174]	
    [175]	
    [176]	
   [177]	
    [178]	
    [179]	
   [180]	
    [181]	
    [182]	
    [183]	
   [184]	
    [185]	
    basolateral	
  surface	
  of	
  hepatocytes,	
  Biochemical	
  and	
  biophysical	
  research	
  communications.	
   297,	
  974-­‐9.	
   Wang,	
   N.,	
   Silver,	
   D.L.,	
   Costet,	
   P.	
   and	
   Tall,	
   A.R.,	
   2000.	
   Specific	
   binding	
   of	
   ApoA-­‐I,	
   enhanced	
   cholesterol	
  efflux,	
  and	
  altered	
  plasma	
  membrane	
  morphology	
  in	
  cells	
  expressing	
  ABC1,	
  The	
   Journal	
  of	
  biological	
  chemistry.	
  275,	
  33053-­‐8.	
   Takahashi,	
   Y.	
   and	
   Smith,	
   J.D.,	
   1999.	
   Cholesterol	
   efflux	
   to	
   apolipoprotein	
   AI	
   involves	
   endocytosis	
  and	
  resecretion	
  in	
  a	
  calcium-­‐dependent	
  pathway,	
  Proceedings	
  of	
  the	
  National	
   Academy	
  of	
  Sciences	
  of	
  the	
  United	
  States	
  of	
  America.	
  96,	
  11358-­‐63.	
   Neufeld,	
  E.B.,	
  Stonik,	
  J.A.,	
  Demosky,	
  S.J.,	
  Jr.,	
  Knapper,	
  C.L.,	
  Combs,	
  C.A.,	
  Cooney,	
  A.,	
  Comly,	
   M.,	
  Dwyer,	
  N.,	
  Blanchette-­‐Mackie,	
  J.,	
  Remaley,	
  A.T.,	
  Santamarina-­‐Fojo,	
  S.	
  and	
  Brewer,	
  H.B.,	
   Jr.,	
   2004.	
   The	
   ABCA1	
   transporter	
   modulates	
   late	
   endocytic	
   trafficking:	
   insights	
   from	
   the	
   correction	
   of	
   the	
   genetic	
   defect	
   in	
   Tangier	
   disease,	
   The	
   Journal	
   of	
   biological	
   chemistry.	
   279,	
   15571-­‐8.	
   Wang,	
   Y.	
   and	
   Oram,	
   J.F.,	
   2002.	
   Unsaturated	
   fatty	
   acids	
   inhibit	
   cholesterol	
   efflux	
   from	
   macrophages	
  by	
  increasing	
  degradation	
  of	
  ATP-­‐binding	
  cassette	
  transporter	
  A1,	
  The	
  Journal	
   of	
  biological	
  chemistry.	
  277,	
  5692-­‐7.	
   Wang,	
  N.,	
  Chen,	
  W.,	
  Linsel-­‐Nitschke,	
  P.,	
  Martinez,	
  L.O.,	
  Agerholm-­‐Larsen,	
  B.,	
  Silver,	
  D.L.	
  and	
   Tall,	
  A.R.,	
  2003.	
  A	
  PEST	
  sequence	
  in	
  ABCA1	
  regulates	
  degradation	
  by	
  calpain	
  protease	
  and	
   stabilization	
  of	
  ABCA1	
  by	
  apoA-­‐I,	
  The	
  Journal	
  of	
  clinical	
  investigation.	
  111,	
  99-­‐107.	
   Schmitz,	
  G.	
  and	
  Langmann,	
  T.,	
  2005.	
  Transcriptional	
  regulatory	
  networks	
  in	
  lipid	
  metabolism	
   control	
  ABCA1	
  expression,	
  Biochimica	
  et	
  biophysica	
  acta.	
  1735,	
  1-­‐19.	
   Schwartz,	
  K.,	
  Lawn,	
  R.M.	
  and	
  Wade,	
  D.P.,	
  2000.	
  ABC1	
  gene	
  expression	
  and	
  ApoA-­‐I-­‐mediated	
   cholesterol	
   efflux	
   are	
   regulated	
   by	
   LXR,	
   Biochemical	
   and	
   biophysical	
   research	
   communications.	
  274,	
  794-­‐802.	
   Wikvall,	
  K.,	
  1984.	
  Hydroxylations	
  in	
  biosynthesis	
  of	
  bile	
  acids.	
  Isolation	
  of	
  a	
  cytochrome	
  P-­‐ 450	
  from	
  rabbit	
  liver	
  mitochondria	
  catalyzing	
  26-­‐hydroxylation	
  of	
  C27-­‐steroids,	
  The	
  Journal	
   of	
  biological	
  chemistry.	
  259,	
  3800-­‐4.	
   Russell,	
   D.W.,	
   2000.	
   Oxysterol	
   biosynthetic	
   enzymes,	
   Biochimica	
   et	
   biophysica	
   acta.	
   1529,	
   126-­‐35.	
   Oftebro,	
   H.,	
   Bjorkhem,	
   I.,	
   Skrede,	
   S.,	
   Schreiner,	
   A.	
   and	
   Pederson,	
   J.I.,	
   1980.	
   Cerebrotendinous	
   xanthomatosis:	
   a	
   defect	
   in	
   mitochondrial	
   26-­‐hydroxylation	
   required	
   for	
   normal	
  biosynthesis	
  of	
  cholic	
  acid,	
  The	
  Journal	
  of	
  clinical	
  investigation.	
  65,	
  1418-­‐30.	
   Cali,	
   J.J.	
   and	
   Russell,	
   D.W.,	
   1991.	
   Characterization	
   of	
   human	
   sterol	
   27-­‐hydroxylase.	
   A	
   mitochondrial	
   cytochrome	
   P-­‐450	
   that	
   catalyzes	
   multiple	
   oxidation	
   reaction	
   in	
   bile	
   acid	
   biosynthesis,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
  266,	
  7774-­‐8.	
   Bjorkhem,	
  I.,	
  Boberg,	
  K.M.,	
  Leitersdorf,	
  E.,	
  2001.	
  The	
  Online	
  Metabolic	
  &	
  Molecular	
  Bases	
  of	
   Inherited	
   Disease,	
   in:	
   Valle,	
   D.,	
   Beaudet,	
   A.L.,	
   Vogelstein,	
   B.,	
   Kinzler,	
   K.W.,	
   Antonarakis,	
   S.E.,	
   Ballabio,	
  A.,	
  Scriver,	
  C.R.,	
  Sly,	
  W.S.,	
  Childs,	
  B.,	
  (Ed.).	
   Moghadasian,	
   M.H.,	
   Salen,	
   G.,	
   Frohlich,	
   J.J.	
   and	
   Scudamore,	
   C.H.,	
   2002.	
   Cerebrotendinous	
   xanthomatosis:	
  a	
  rare	
  disease	
  with	
  diverse	
  manifestations,	
  Archives	
  of	
  neurology.	
  59,	
  527-­‐9.	
   Potkin,	
   B.N.,	
   Hoeg,	
   J.M.,	
   Connor,	
   W.E.,	
   Salen,	
   G.,	
   Quyyumi,	
   A.A.,	
   Brush,	
   J.E.,	
   Jr.,	
   Roberts,	
   W.C.	
   and	
   Brewer,	
   H.B.,	
   Jr.,	
   1988.	
   Aneurysmal	
   coronary	
   artery	
   disease	
   in	
   cerebrotendinous	
   xanthomatosis,	
  The	
  American	
  journal	
  of	
  cardiology.	
  61,	
  1150-­‐2.	
   Segev,	
  H.,	
  Reshef,	
  A.,	
  Clavey,	
  V.,	
  Delbart,	
  C.,	
  Routier,	
  G.	
  and	
  Leitersdorf,	
  E.,	
  1995.	
  Premature	
   termination	
   codon	
   at	
   the	
   sterol	
   27-­‐hydroxylase	
   gene	
   causes	
   cerebrotendinous	
   xanthomatosis	
  in	
  a	
  French	
  family,	
  Human	
  genetics.	
  95,	
  238-­‐40.	
    78	
   	
    	
   [186]	
   von	
   Bahr,	
   S.,	
   Movin,	
   T.,	
   Papadogiannakis,	
   N.,	
   Pikuleva,	
   I.,	
   Ronnow,	
   P.,	
   Diczfalusy,	
   U.	
   and	
   Bjorkhem,	
   I.,	
   2002.	
   Mechanism	
   of	
   accumulation	
   of	
   cholesterol	
   and	
   cholestanol	
   in	
   tendons	
   and	
  the	
  role	
  of	
  sterol	
  27-­‐hydroxylase	
  (CYP27A1),	
  Arteriosclerosis,	
  thrombosis,	
  and	
  vascular	
   biology.	
  22,	
  1129-­‐35.	
   [187]	
   Russell,	
   D.W.,	
   2003.	
   The	
   enzymes,	
   regulation,	
   and	
   genetics	
   of	
   bile	
   acid	
   synthesis,	
   Annual	
   review	
  of	
  biochemistry.	
  72,	
  137-­‐74.	
   [188]	
   Babiker,	
   A.,	
   Andersson,	
   O.,	
   Lund,	
   E.,	
   Xiu,	
   R.J.,	
   Deeb,	
   S.,	
   Reshef,	
   A.,	
   Leitersdorf,	
   E.,	
   Diczfalusy,	
   U.	
   and	
   Bjorkhem,	
   I.,	
   1997.	
   Elimination	
   of	
   cholesterol	
   in	
   macrophages	
   and	
   endothelial	
  cells	
   by	
   the	
   sterol	
   27-­‐hydroxylase	
   mechanism.	
   Comparison	
   with	
   high	
   density	
   lipoprotein-­‐ mediated	
  reverse	
  cholesterol	
  transport,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
  272,	
  26253-­‐61.	
   [189]	
   Bjorkhem,	
  I.,	
  Andersson,	
  O.,	
  Diczfalusy,	
  U.,	
  Sevastik,	
  B.,	
  Xiu,	
  R.J.,	
  Duan,	
  C.	
  and	
  Lund,	
  E.,	
  1994.	
   Atherosclerosis	
  and	
  sterol	
  27-­‐hydroxylase:	
  evidence	
  for	
  a	
  role	
  of	
  this	
  enzyme	
  in	
  elimination	
   of	
  cholesterol	
  from	
  human	
  macrophages,	
  Proceedings	
  of	
  the	
  National	
  Academy	
  of	
  Sciences	
   of	
  the	
  United	
  States	
  of	
  America.	
  91,	
  8592-­‐6.	
   [190]	
   Dzeletovic,	
   S.,	
   Breuer,	
   O.,	
   Lund,	
   E.	
   and	
   Diczfalusy,	
   U.,	
   1995.	
   Determination	
   of	
   cholesterol	
   oxidation	
   products	
   in	
   human	
   plasma	
   by	
   isotope	
   dilution-­‐mass	
   spectrometry,	
   Analytical	
   biochemistry.	
  225,	
  73-­‐80.	
   [191]	
   Brown,	
  A.J.	
  and	
  Jessup,	
  W.,	
  1999.	
  Oxysterols	
  and	
  atherosclerosis,	
  Atherosclerosis.	
  142,	
  1-­‐28.	
   [192]	
   Meaney,	
  S.,	
  Bodin,	
  K.,	
  Diczfalusy,	
  U.	
  and	
  Bjorkhem,	
  I.,	
  2002.	
  On	
  the	
  rate	
  of	
  translocation	
  in	
   vitro	
   and	
   kinetics	
   in	
   vivo	
   of	
   the	
   major	
   oxysterols	
   in	
   human	
   circulation:	
   critical	
   importance	
   of	
   the	
  position	
  of	
  the	
  oxygen	
  function,	
  Journal	
  of	
  lipid	
  research.	
  43,	
  2130-­‐5.	
   [193]	
   Kim,	
   W.S.,	
   Chan,	
   S.L.,	
   Hill,	
   A.F.,	
   Guillemin,	
   G.J.	
   and	
   Garner,	
   B.,	
   2009.	
   Impact	
   of	
   27-­‐ hydroxycholesterol	
   on	
   amyloid-­‐beta	
   peptide	
   production	
   and	
   ATP-­‐binding	
   cassette	
   transporter	
  expression	
  in	
  primary	
  human	
  neurons,	
  Journal	
  of	
  Alzheimer's	
  disease	
  :	
  JAD.	
  16,	
   121-­‐31.	
   [194]	
   Babiker,	
  A.,	
  Dzeletovic,	
  S.,	
  Wiklund,	
  B.,	
  Pettersson,	
  N.,	
  Salonen,	
  J.,	
  Nyyssonen,	
  K.,	
  Eriksson,	
   M.,	
  Diczfalusy,	
  U.	
  and	
  Bjorkhem,	
  I.,	
  2005.	
  Patients	
  with	
  atherosclerosis	
  may	
  have	
  increased	
   circulating	
   levels	
   of	
   27-­‐hydroxycholesterol	
   and	
   cholestenoic	
   acid,	
   Scandinavian	
   journal	
   of	
   clinical	
  and	
  laboratory	
  investigation.	
  65,	
  365-­‐75.	
   [195]	
   Shanahan,	
   C.M.,	
   Carpenter,	
   K.L.	
   and	
   Cary,	
   N.R.,	
   2001.	
   A	
   potential	
   role	
   for	
   sterol	
   27-­‐ hydroxylase	
  in	
  atherogenesis,	
  Atherosclerosis.	
  154,	
  269-­‐76.	
   [196]	
   Fu,	
  X.,	
  Menke,	
  J.G.,	
  Chen,	
  Y.,	
  Zhou,	
  G.,	
  MacNaul,	
  K.L.,	
  Wright,	
  S.D.,	
  Sparrow,	
  C.P.	
  and	
  Lund,	
   E.G.,	
   2001.	
   27-­‐hydroxycholesterol	
   is	
   an	
   endogenous	
   ligand	
   for	
   liver	
   X	
   receptor	
   in	
   cholesterol-­‐loaded	
  cells,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
  276,	
  38378-­‐87.	
   [197]	
   Choi,	
  H.Y.,	
  Rahmani,	
  M.,	
  Wong,	
  B.W.,	
  Allahverdian,	
  S.,	
  McManus,	
  B.M.,	
  Pickering,	
  J.G.,	
  Chan,	
   T.	
   and	
   Francis,	
   G.A.,	
   2009.	
   ATP-­‐binding	
   cassette	
   transporter	
   A1	
   expression	
   and	
   apolipoprotein	
   A-­‐I	
   binding	
   are	
   impaired	
   in	
   intima-­‐type	
   arterial	
   smooth	
   muscle	
   cells,	
   Circulation.	
  119,	
  3223-­‐31.	
   [198]	
   Babiker,	
   A.,	
   Andersson,	
   O.,	
   Lindblom,	
   D.,	
   van	
   der	
   Linden,	
   J.,	
   Wiklund,	
   B.,	
   Lutjohann,	
   D.,	
   Diczfalusy,	
   U.	
   and	
   Bjorkhem,	
   I.,	
   1999.	
   Elimination	
   of	
   cholesterol	
   as	
   cholestenoic	
   acid	
   in	
   human	
   lung	
   by	
   sterol	
   27-­‐hydroxylase:	
   evidence	
   that	
   most	
   of	
   this	
   steroid	
   in	
   the	
   circulation	
   is	
   of	
  pulmonary	
  origin,	
  Journal	
  of	
  lipid	
  research.	
  40,	
  1417-­‐25.	
   [199]	
   Song,	
   C.	
   and	
   Liao,	
   S.,	
   2000.	
   Cholestenoic	
   acid	
   is	
   a	
   naturally	
   occurring	
   ligand	
   for	
   liver	
   X	
   receptor	
  alpha,	
  Endocrinology.	
  141,	
  4180-­‐4.	
   [200]	
   Rowe,	
  A.H.,	
  Argmann,	
  C.A.,	
  Edwards,	
  J.Y.,	
  Sawyez,	
  C.G.,	
  Morand,	
  O.H.,	
  Hegele,	
  R.A.	
  and	
  Huff,	
   M.W.,	
   2003.	
   Enhanced	
   synthesis	
   of	
   the	
   oxysterol	
   24(S),25-­‐epoxycholesterol	
   in	
   macrophages	
    79	
   	
    	
    [201]	
    [202]	
    [203]	
    [204]	
    [205]	
   [206]	
   [207]	
    [208]	
   [209]	
   [210]	
   [211]	
    [212]	
    [213]	
    [214]	
    [215]	
    by	
   inhibitors	
   of	
   2,3-­‐oxidosqualene:lanosterol	
   cyclase:	
   a	
   novel	
   mechanism	
   for	
   the	
   attenuation	
  of	
  foam	
  cell	
  formation,	
  Circulation	
  research.	
  93,	
  717-­‐25.	
   Wong,	
  J.,	
  Quinn,	
  C.M.	
  and	
  Brown,	
  A.J.,	
  2004.	
  Statins	
  inhibit	
  synthesis	
  of	
  an	
  oxysterol	
  ligand	
   for	
   the	
   liver	
   x	
   receptor	
   in	
   human	
   macrophages	
   with	
   consequences	
   for	
   cholesterol	
   flux,	
   Arteriosclerosis,	
  thrombosis,	
  and	
  vascular	
  biology.	
  24,	
  2365-­‐71.	
   Spencer,	
   T.A.,	
   Gayen,	
   A.K.,	
   Phirwa,	
   S.,	
   Nelson,	
   J.A.,	
   Taylor,	
   F.R.,	
   Kandutsch,	
   A.A.	
   and	
   Erickson,	
   S.K.,	
   1985.	
   24(S),25-­‐Epoxycholesterol.	
   Evidence	
   consistent	
   with	
   a	
   role	
   in	
   the	
   regulation	
  of	
  hepatic	
  cholesterogenesis,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
  260,	
  13391-­‐4.	
   Wong,	
   J.,	
   Quinn,	
   C.M.,	
   Gelissen,	
   I.C.	
   and	
   Brown,	
   A.J.,	
   2008.	
   Endogenous	
   24(S),25-­‐ epoxycholesterol	
  fine-­‐tunes	
  acute	
  control	
  of	
  cellular	
  cholesterol	
  homeostasis,	
  The	
  Journal	
  of	
   biological	
  chemistry.	
  283,	
  700-­‐7.	
   Waterman,	
  M.R.	
  and	
  Simpson,	
  E.R.,	
  1989.	
  Regulation	
  of	
  steroid	
  hydroxylase	
  gene	
  expression	
   is	
  multifactorial	
  in	
  nature,	
  Recent	
  progress	
  in	
  hormone	
  research.	
  45,	
  533-­‐63;	
  discussion	
  563-­‐ 6.	
   Mellon,	
   S.H.	
   and	
   Griffin,	
   L.D.,	
   2002.	
   Neurosteroids:	
   biochemistry	
   and	
   clinical	
   significance,	
   Trends	
  in	
  endocrinology	
  and	
  metabolism:	
  TEM.	
  13,	
  35-­‐43.	
   Morales,	
   A.,	
   Cuellar,	
   A.,	
   Ramirez,	
   J.,	
   Vilchis,	
   F.	
   and	
   Diaz-­‐Sanchez,	
   V.,	
   1999.	
   Synthesis	
   of	
   steroids	
  in	
  pancreas:	
  evidence	
  of	
  cytochrome	
  P-­‐450scc	
  activity,	
  Pancreas.	
  19,	
  39-­‐44.	
   Thiboutot,	
   D.,	
   Jabara,	
   S.,	
   McAllister,	
   J.M.,	
   Sivarajah,	
   A.,	
   Gilliland,	
   K.,	
   Cong,	
   Z.	
   and	
   Clawson,	
   G.,	
   2003.	
   Human	
   skin	
   is	
   a	
   steroidogenic	
   tissue:	
   steroidogenic	
   enzymes	
   and	
   cofactors	
   are	
   expressed	
   in	
   epidermis,	
   normal	
   sebocytes,	
   and	
   an	
   immortalized	
   sebocyte	
   cell	
   line	
   (SEB-­‐1),	
   The	
  Journal	
  of	
  investigative	
  dermatology.	
  120,	
  905-­‐14.	
   Young,	
   M.J.,	
   Clyne,	
   C.D.,	
   Cole,	
   T.J.	
   and	
   Funder,	
   J.W.,	
   2001.	
   Cardiac	
   steroidogenesis	
   in	
   the	
   normal	
  and	
  failing	
  heart,	
  The	
  Journal	
  of	
  clinical	
  endocrinology	
  and	
  metabolism.	
  86,	
  5121-­‐6.	
   Mellon,	
   S.H.	
   and	
   Deschepper,	
   C.F.,	
   1993.	
   Neurosteroid	
   biosynthesis:	
   genes	
   for	
   adrenal	
   steroidogenic	
  enzymes	
  are	
  expressed	
  in	
  the	
  brain,	
  Brain	
  research.	
  629,	
  283-­‐92.	
   Guarneri,	
   P.,	
   Guarneri,	
   R.,	
   Cascio,	
   C.,	
   Pavasant,	
   P.,	
   Piccoli,	
   F.	
   and	
   Papadopoulos,	
   V.,	
   1994.	
   Neurosteroidogenesis	
  in	
  rat	
  retinas,	
  Journal	
  of	
  neurochemistry.	
  63,	
  86-­‐96.	
   Compagnone,	
   N.A.,	
   Bulfone,	
   A.,	
   Rubenstein,	
   J.L.	
   and	
   Mellon,	
   S.H.,	
   1995.	
   Expression	
   of	
   the	
   steroidogenic	
  enzyme	
  P450scc	
  in	
  the	
  central	
  and	
  peripheral	
  nervous	
  systems	
  during	
  rodent	
   embryogenesis,	
  Endocrinology.	
  136,	
  2689-­‐96.	
   Sanne,	
   J.L.	
   and	
   Krueger,	
   K.E.,	
   1995.	
   Expression	
   of	
   cytochrome	
   P450	
   side-­‐chain	
   cleavage	
   enzyme	
   and	
   3	
   beta-­‐hydroxysteroid	
   dehydrogenase	
   in	
   the	
   rat	
   central	
   nervous	
   system:	
   a	
   study	
  by	
  polymerase	
  chain	
  reaction	
  and	
  in	
  situ	
  hybridization,	
  Journal	
  of	
  neurochemistry.	
  65,	
   528-­‐36.	
   Tajima,	
  T.,	
  Fujieda,	
  K.,	
  Kouda,	
  N.,	
  Nakae,	
  J.	
  and	
  Miller,	
  W.L.,	
  2001.	
  Heterozygous	
  mutation	
  in	
   the	
   cholesterol	
   side	
   chain	
   cleavage	
   enzyme	
   (p450scc)	
   gene	
   in	
   a	
   patient	
   with	
   46,XY	
   sex	
   reversal	
  and	
  adrenal	
  insufficiency,	
  The	
  Journal	
  of	
  clinical	
  endocrinology	
  and	
  metabolism.	
  86,	
   3820-­‐5.	
   Kase,	
   E.T.,	
   Andersen,	
   B.,	
   Nebb,	
   H.I.,	
   Rustan,	
   A.C.	
   and	
   Thoresen,	
   G.H.,	
   2006.	
   22-­‐ Hydroxycholesterols	
   regulate	
   lipid	
   metabolism	
   differently	
   than	
   T0901317	
   in	
   human	
   myotubes,	
  Biochimica	
  et	
  biophysica	
  acta.	
  1761,	
  1515-­‐22.	
   Tang,	
  C.K.,	
  Yi,	
  G.H.,	
  Yang,	
  J.H.,	
  Liu,	
  L.S.,	
  Wang,	
  Z.,	
  Ruan,	
  C.G.	
  and	
  Yang,	
  Y.Z.,	
  2004a.	
  Oxidized	
   LDL	
   upregulated	
   ATP	
   binding	
   cassette	
   transporter-­‐1	
   in	
   THP-­‐1	
   macrophages,	
   Acta	
   pharmacologica	
  Sinica.	
  25,	
  581-­‐6.	
    80	
   	
    	
   [216]	
   Ouimet,	
   M.,	
   Wang,	
   M.D.,	
   Cadotte,	
   N.,	
   Ho,	
   K.	
   and	
   Marcel,	
   Y.L.,	
   2008.	
   Epoxycholesterol	
   impairs	
   cholesteryl	
   ester	
   hydrolysis	
   in	
   macrophage	
   foam	
   cells,	
   resulting	
   in	
   decreased	
   cholesterol	
  efflux,	
  Arteriosclerosis,	
  thrombosis,	
  and	
  vascular	
  biology.	
  28,	
  1144-­‐50.	
   [217]	
   Gill,	
   S.,	
   Chow,	
   R.	
   and	
   Brown,	
   A.J.,	
   2008.	
   Sterol	
   regulators	
   of	
   cholesterol	
   homeostasis	
   and	
   beyond:	
  the	
  oxysterol	
  hypothesis	
  revisited	
  and	
  revised,	
  Progress	
  in	
  lipid	
  research.	
  47,	
  391-­‐ 404.	
   [218]	
   Lin,	
   Y.Y.	
   and	
   Smith,	
   L.L.,	
   1974.	
   Sterol	
   metabolism.	
   28.	
   Biosynthesis	
   and	
   accumulation	
   of	
   cholest-­‐5-­‐ene-­‐3beta,	
   24-­‐diol	
   (cerebrosterol)	
   in	
   developing	
   rat	
   brain,	
   Biochimica	
   et	
   biophysica	
  acta.	
  348,	
  189-­‐96.	
   [219]	
   Lund,	
   E.G.,	
   Guileyardo,	
   J.M.	
   and	
   Russell,	
   D.W.,	
   1999.	
   cDNA	
   cloning	
   of	
   cholesterol	
   24-­‐ hydroxylase,	
   a	
   mediator	
   of	
   cholesterol	
   homeostasis	
   in	
   the	
   brain,	
   Proceedings	
   of	
   the	
   National	
  Academy	
  of	
  Sciences	
  of	
  the	
  United	
  States	
  of	
  America.	
  96,	
  7238-­‐43.	
   [220]	
   Bjorkhem,	
  I.,	
  Lutjohann,	
  D.,	
  Breuer,	
  O.,	
  Sakinis,	
  A.	
  and	
  Wennmalm,	
  A.,	
  1997.	
  Importance	
  of	
  a	
   novel	
   oxidative	
   mechanism	
   for	
   elimination	
   of	
   brain	
   cholesterol.	
   Turnover	
   of	
   cholesterol	
   and	
   24(S)-­‐hydroxycholesterol	
  in	
  rat	
  brain	
  as	
  measured	
  with	
  18O2	
  techniques	
  in	
  vivo	
  and	
  in	
  vitro,	
   The	
  Journal	
  of	
  biological	
  chemistry.	
  272,	
  30178-­‐84.	
   [221]	
   Kim,	
   W.S.,	
   Rahmanto,	
   A.S.,	
   Kamili,	
   A.,	
   Rye,	
   K.A.,	
   Guillemin,	
   G.J.,	
   Gelissen,	
   I.C.,	
   Jessup,	
   W.,	
   Hill,	
   A.F.	
   and	
   Garner,	
   B.,	
   2007.	
   Role	
   of	
   ABCG1	
   and	
   ABCA1	
   in	
   regulation	
   of	
   neuronal	
   cholesterol	
   efflux	
   to	
   apolipoprotein	
   E	
   discs	
   and	
   suppression	
   of	
   amyloid-­‐beta	
   peptide	
   generation,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
  282,	
  2851-­‐61.	
   [222]	
   Bjorkhem,	
   I.,	
   2006.	
   Crossing	
   the	
   barrier:	
   oxysterols	
   as	
   cholesterol	
   transporters	
   and	
   metabolic	
  modulators	
  in	
  the	
  brain,	
  Journal	
  of	
  internal	
  medicine.	
  260,	
  493-­‐508.	
   [223]	
   Lund,	
  E.G.,	
  Kerr,	
  T.A.,	
  Sakai,	
  J.,	
  Li,	
  W.P.	
  and	
  Russell,	
  D.W.,	
  1998.	
  cDNA	
   cloning	
  of	
  mouse	
  and	
   human	
  cholesterol	
  25-­‐hydroxylases,	
  polytopic	
  membrane	
  proteins	
  that	
  synthesize	
  a	
  potent	
   oxysterol	
  regulator	
  of	
  lipid	
  metabolism,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
  273,	
  34316-­‐27.	
   [224]	
   Lund,	
   E.,	
   Bjorkhem,	
   I.,	
   Furster,	
   C.	
   and	
   Wikvall,	
   K.,	
   1993.	
   24-­‐,	
   25-­‐	
   and	
   27-­‐hydroxylation	
   of	
   cholesterol	
   by	
   a	
   purified	
   preparation	
   of	
   27-­‐hydroxylase	
   from	
   pig	
   liver,	
   Biochimica	
   et	
   biophysica	
  acta.	
  1166,	
  177-­‐82.	
   [225]	
   Tam,	
   S.P.,	
   Mok,	
   L.,	
   Chimini,	
   G.,	
   Vasa,	
   M.	
   and	
   Deeley,	
   R.G.,	
   2006.	
   ABCA1	
   mediates	
   high-­‐ affinity	
   uptake	
   of	
   25-­‐hydroxycholesterol	
   by	
   membrane	
   vesicles	
   and	
   rapid	
   efflux	
   of	
   oxysterol	
   by	
  intact	
  cells,	
  American	
  journal	
  of	
  physiology.	
  Cell	
  physiology.	
  291,	
  C490-­‐502.	
   [226]	
   Kandutsch,	
  A.A.	
  and	
  Chen,	
  H.W.,	
  1974.	
  Inhibition	
  of	
  sterol	
  synthesis	
  in	
  cultured	
  mouse	
  cells	
   by	
  cholesterol	
  derivatives	
  oxygenated	
  in	
  the	
  side	
  chain,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
   249,	
  6057-­‐61.	
   [227]	
   Panini,	
   S.R.,	
   Sexton,	
   R.C.	
   and	
   Rudney,	
   H.,	
   1984.	
   Regulation	
   of	
   3-­‐hydroxy-­‐3-­‐methylglutaryl	
   coenzyme	
   A	
   reductase	
   by	
   oxysterol	
   by-­‐products	
   of	
   cholesterol	
   biosynthesis.	
   Possible	
   mediators	
  of	
  low	
  density	
  lipoprotein	
  action,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
  259,	
  7767-­‐ 71.	
   [228]	
   Tanaka,	
   R.D.,	
   Li,	
   A.C.,	
   Fogelman,	
   A.M.	
   and	
   Edwards,	
   P.A.,	
   1986.	
   Inhibition	
   of	
   lysosomal	
   protein	
  degradation	
  inhibits	
  the	
  basal	
  degradation	
  of	
  3-­‐hydroxy-­‐3-­‐methylglutaryl	
  coenzyme	
   A	
  reductase,	
  Journal	
  of	
  lipid	
  research.	
  27,	
  261-­‐73.	
   [229]	
   Ravid,	
   T.,	
   Doolman,	
   R.,	
   Avner,	
   R.,	
   Harats,	
   D.	
   and	
   Roitelman,	
   J.,	
   2000.	
   The	
   ubiquitin-­‐ proteasome	
   pathway	
   mediates	
   the	
   regulated	
   degradation	
   of	
   mammalian	
   3-­‐hydroxy-­‐3-­‐ methylglutaryl-­‐coenzyme	
  A	
  reductase,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
  275,	
  35840-­‐7.	
    81	
   	
    	
   [230]	
   Xu,	
  L.,	
  Bai,	
  Q.,	
  Rodriguez-­‐Agudo,	
  D.,	
  Hylemon,	
  P.B.,	
  Heuman,	
  D.M.,	
  Pandak,	
  W.M.	
  and	
  Ren,	
   S.,	
   2010.	
   Regulation	
   of	
   hepatocyte	
   lipid	
   metabolism	
   and	
   inflammatory	
   response	
   by	
   25-­‐ hydroxycholesterol	
  and	
  25-­‐hydroxycholesterol-­‐3-­‐sulfate,	
  Lipids.	
  45,	
  821-­‐32.	
   [231]	
   Bai,	
  Q.,	
  Xu,	
  L.,	
  Kakiyama,	
  G.,	
  Runge-­‐Morris,	
  M.A.,	
  Hylemon,	
  P.B.,	
  Yin,	
  L.,	
  Pandak,	
  W.M.	
  and	
   Ren,	
   S.,	
   2011.	
   Sulfation	
   of	
   25-­‐hydroxycholesterol	
   by	
   SULT2B1b	
   decreases	
   cellular	
   lipids	
   via	
   the	
  LXR/SREBP-­‐1c	
  signaling	
  pathway	
  in	
  human	
  aortic	
  endothelial	
  cells,	
  Atherosclerosis.	
  214,	
   350-­‐6.	
   [232]	
   Bauman,	
   D.R.,	
   Bitmansour,	
   A.D.,	
   McDonald,	
   J.G.,	
   Thompson,	
   B.M.,	
   Liang,	
   G.	
   and	
   Russell,	
   D.W.,	
   2009.	
   25-­‐Hydroxycholesterol	
   secreted	
   by	
   macrophages	
   in	
   response	
   to	
   Toll-­‐like	
   receptor	
   activation	
   suppresses	
   immunoglobulin	
   A	
   production,	
   Proceedings	
   of	
   the	
   National	
   Academy	
  of	
  Sciences	
  of	
  the	
  United	
  States	
  of	
  America.	
  106,	
  16764-­‐9.	
   [233]	
   Diczfalusy,	
   U.,	
   Olofsson,	
   K.E.,	
   Carlsson,	
   A.M.,	
   Gong,	
   M.,	
   Golenbock,	
   D.T.,	
   Rooyackers,	
   O.,	
   Flaring,	
   U.	
   and	
   Bjorkbacka,	
   H.,	
   2009.	
   Marked	
   upregulation	
   of	
   cholesterol	
   25-­‐hydroxylase	
   expression	
  by	
  lipopolysaccharide,	
  Journal	
  of	
  lipid	
  research.	
  50,	
  2258-­‐64.	
   [234]	
   Stevenson,	
  J.	
  and	
  Brown,	
  A.J.,	
  2009.	
  How	
  essential	
  is	
  cholesterol?,	
  The	
  Biochemical	
  journal.	
   420,	
  e1-­‐4.	
   [235]	
   Yang,	
  C.,	
  McDonald,	
  J.G.,	
  Patel,	
  A.,	
  Zhang,	
  Y.,	
  Umetani,	
  M.,	
  Xu,	
  F.,	
  Westover,	
  E.J.,	
  Covey,	
  D.F.,	
   Mangelsdorf,	
  D.J.,	
  Cohen,	
  J.C.	
  and	
  Hobbs,	
  H.H.,	
  2006.	
  Sterol	
  intermediates	
  from	
  cholesterol	
   biosynthetic	
   pathway	
   as	
   liver	
   X	
   receptor	
   ligands,	
   The	
   Journal	
   of	
   biological	
   chemistry.	
   281,	
   27816-­‐26.	
   [236]	
   Ide,	
   T.,	
   Shimano,	
   H.,	
   Yoshikawa,	
   T.,	
   Yahagi,	
   N.,	
   Amemiya-­‐Kudo,	
   M.,	
   Matsuzaka,	
   T.,	
   Nakakuki,	
   M.,	
  Yatoh,	
  S.,	
  Iizuka,	
  Y.,	
  Tomita,	
  S.,	
  Ohashi,	
  K.,	
  Takahashi,	
  A.,	
  Sone,	
  H.,	
  Gotoda,	
  T.,	
  Osuga,	
  J.,	
   Ishibashi,	
   S.	
   and	
   Yamada,	
   N.,	
   2003.	
   Cross-­‐talk	
   between	
   peroxisome	
   proliferator-­‐activated	
   receptor	
   (PPAR)	
   alpha	
   and	
   liver	
   X	
   receptor	
   (LXR)	
   in	
   nutritional	
   regulation	
   of	
   fatty	
   acid	
   metabolism.	
  II.	
  LXRs	
  suppress	
  lipid	
  degradation	
  gene	
  promoters	
  through	
  inhibition	
  of	
  PPAR	
   signaling,	
  Molecular	
  endocrinology.	
  17,	
  1255-­‐67.	
   [237]	
   Yoshikawa,	
  T.,	
  Ide,	
  T.,	
  Shimano,	
  H.,	
  Yahagi,	
  N.,	
  Amemiya-­‐Kudo,	
  M.,	
  Matsuzaka,	
  T.,	
  Yatoh,	
  S.,	
   Kitamine,	
  T.,	
  Okazaki,	
  H.,	
  Tamura,	
  Y.,	
  Sekiya,	
  M.,	
  Takahashi,	
  A.,	
  Hasty,	
  A.H.,	
  Sato,	
  R.,	
  Sone,	
   H.,	
   Osuga,	
   J.,	
   Ishibashi,	
   S.	
   and	
   Yamada,	
   N.,	
   2003.	
   Cross-­‐talk	
   between	
   peroxisome	
   proliferator-­‐activated	
   receptor	
   (PPAR)	
   alpha	
   and	
   liver	
   X	
   receptor	
   (LXR)	
   in	
   nutritional	
   regulation	
   of	
   fatty	
   acid	
   metabolism.	
   I.	
   PPARs	
   suppress	
   sterol	
   regulatory	
   element	
   binding	
   protein-­‐1c	
  promoter	
  through	
  inhibition	
  of	
  LXR	
  signaling,	
  Molecular	
  endocrinology.	
  17,	
  1240-­‐ 54.	
   [238]	
   Oram,	
   J.F.,	
   Lawn,	
   R.M.,	
   Garvin,	
   M.R.	
   and	
   Wade,	
   D.P.,	
   2000.	
   ABCA1	
   is	
   the	
   cAMP-­‐inducible	
   apolipoprotein	
  receptor	
  that	
  mediates	
  cholesterol	
  secretion	
  from	
  macrophages,	
  The	
  Journal	
   of	
  biological	
  chemistry.	
  275,	
  34508-­‐11.	
   [239]	
   Haidar,	
  B.,	
  Denis,	
  M.,	
  Krimbou,	
  L.,	
  Marcil,	
  M.	
  and	
  Genest,	
  J.,	
  Jr.,	
  2002.	
  cAMP	
  induces	
  ABCA1	
   phosphorylation	
   activity	
   and	
   promotes	
   cholesterol	
   efflux	
   from	
   fibroblasts,	
   Journal	
   of	
   lipid	
   research.	
  43,	
  2087-­‐94.	
   [240]	
   Haidar,	
   B.,	
   Denis,	
   M.,	
   Marcil,	
   M.,	
   Krimbou,	
   L.	
   and	
   Genest,	
   J.,	
   Jr.,	
   2004.	
   Apolipoprotein	
   A-­‐I	
   activates	
   cellular	
   cAMP	
   signaling	
   through	
   the	
   ABCA1	
   transporter,	
   The	
   Journal	
   of	
   biological	
   chemistry.	
  279,	
  9963-­‐9.	
   [241]	
   Tang,	
  C.,	
  Vaughan,	
  A.M.	
  and	
  Oram,	
  J.F.,	
  2004b.	
  Janus	
  kinase	
  2	
  modulates	
  the	
  apolipoprotein	
   interactions	
  with	
  ABCA1	
  required	
  for	
  removing	
  cellular	
  cholesterol,	
  The	
  Journal	
  of	
  biological	
   chemistry.	
  279,	
  7622-­‐8.	
    82	
   	
    	
   [242]	
   Hossain,	
   M.A.,	
   Ngeth,	
   S.,	
   Chan,	
   T.,	
   Oda,	
   M.N.	
   and	
   Francis,	
   G.A.,	
   2012.	
   Lipid-­‐bound	
   apolipoproteins	
  in	
  tyrosyl	
  radical-­‐oxidized	
  HDL	
  stabilize	
  ABCA1	
  like	
  lipid-­‐free	
  apolipoprotein	
   A-­‐I,	
  BMC	
  biochemistry.	
  13,	
  1.	
   [243]	
   Martinez,	
   L.O.,	
   Agerholm-­‐Larsen,	
   B.,	
   Wang,	
   N.,	
   Chen,	
   W.	
   and	
   Tall,	
   A.R.,	
   2003.	
   Phosphorylation	
  of	
  a	
  pest	
  sequence	
  in	
  ABCA1	
  promotes	
  calpain	
  degradation	
  and	
  is	
  reversed	
   by	
  ApoA-­‐I,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
  278,	
  37368-­‐74.	
   [244]	
   Chen,	
  W.,	
  Wang,	
  N.	
  and	
  Tall,	
  A.R.,	
  2005.	
  A	
  PEST	
  deletion	
  mutant	
  of	
  ABCA1	
  shows	
  impaired	
   internalization	
   and	
   defective	
   cholesterol	
   efflux	
   from	
   late	
   endosomes,	
   The	
   Journal	
   of	
   biological	
  chemistry.	
  280,	
  29277-­‐81.	
   [245]	
   Orekhov,	
   A.N.,	
   Andreeva,	
   E.R.,	
   Krushinsky,	
   A.V.,	
   Novikov,	
   I.D.,	
   Tertov,	
   V.V.,	
   Nestaiko,	
   G.V.,	
   Khashimov	
   Kh,	
   A.,	
   Repin,	
   V.S.	
   and	
   Smirnov,	
   V.N.,	
   1986.	
   Intimal	
   cells	
   and	
   atherosclerosis.	
   Relationship	
   between	
   the	
   number	
   of	
   intimal	
   cells	
   and	
   major	
   manifestations	
   of	
   atherosclerosis	
  in	
  the	
  human	
  aorta,	
  The	
  American	
  journal	
  of	
  pathology.	
  125,	
  402-­‐15.	
   [246]	
   Bauriedel,	
   G.,	
   Hutter,	
   R.,	
   Welsch,	
   U.,	
   Bach,	
   R.,	
   Sievert,	
   H.	
   and	
   Luderitz,	
   B.,	
   1999.	
   Role	
   of	
   smooth	
   muscle	
   cell	
   death	
   in	
   advanced	
   coronary	
   primary	
   lesions:	
   implications	
   for	
   plaque	
   instability,	
  Cardiovascular	
  research.	
  41,	
  480-­‐8.	
   [247]	
   Mietus-­‐Snyder,	
   M.,	
   Gowri,	
   M.S.	
   and	
   Pitas,	
   R.E.,	
   2000.	
   Class	
   A	
   scavenger	
   receptor	
   up-­‐ regulation	
   in	
   smooth	
   muscle	
   cells	
   by	
   oxidized	
   low	
   density	
   lipoprotein.	
   Enhancement	
   by	
   calcium	
   flux	
   and	
   concurrent	
   cyclooxygenase-­‐2	
   up-­‐regulation,	
   The	
   Journal	
   of	
   biological	
   chemistry.	
  275,	
  17661-­‐70.	
   [248]	
   Rong,	
   J.X.,	
   Shapiro,	
   M.,	
   Trogan,	
   E.	
   and	
   Fisher,	
   E.A.,	
   2003.	
   Transdifferentiation	
   of	
   mouse	
   aortic	
  smooth	
  muscle	
  cells	
  to	
  a	
  macrophage-­‐like	
  state	
  after	
  cholesterol	
  loading,	
  Proceedings	
   of	
  the	
  National	
  Academy	
  of	
  Sciences	
  of	
  the	
  United	
  States	
  of	
  America.	
  100,	
  13531-­‐6.	
   [249]	
   Hao,	
   H.,	
   Gabbiani,	
   G.	
   and	
   Bochaton-­‐Piallat,	
   M.L.,	
   2003a.	
   Arterial	
   smooth	
   muscle	
   cell	
   heterogeneity:	
   implications	
   for	
   atherosclerosis	
   and	
   restenosis	
   development,	
   Arteriosclerosis,	
  thrombosis,	
  and	
  vascular	
  biology.	
  23,	
  1510-­‐20.	
   [250]	
   Hao,	
   H.,	
   Gabbiani,	
   G.	
   and	
   Bochaton-­‐Piallat,	
   M.L.,	
   2003b.	
   Arterial	
   smooth	
   muscle	
   cell	
   heterogeneity:	
   implications	
   for	
   atherosclerosis	
   and	
   restenosis	
   development,	
   Arterioscler	
   Thromb	
  Vasc	
  Biol.	
  23,	
  1510-­‐20.	
   [251]	
   Bochaton-­‐Piallat,	
   M.L.,	
   Ropraz,	
   P.,	
   Gabbiani,	
   F.	
   and	
   Gabbiani,	
   G.,	
   1996.	
   Phenotypic	
   heterogeneity	
  of	
  rat	
  arterial	
  smooth	
  muscle	
  cell	
  clones.	
  Implications	
  for	
  the	
  development	
  of	
   experimental	
   intimal	
   thickening,	
   Arteriosclerosis,	
   thrombosis,	
   and	
   vascular	
   biology.	
   16,	
   815-­‐ 20.	
   [252]	
   Stolle,	
   K.,	
   Weitkamp,	
   B.,	
   Rauterberg,	
   J.,	
   Lorkowski,	
   S.	
   and	
   Cullen,	
   P.,	
   2004.	
   Laser	
   microdissection-­‐based	
  analysis	
  of	
  mRNA	
  expression	
  in	
  human	
  coronary	
  arteries	
  with	
  intimal	
   thickening,	
   The	
   journal	
   of	
   histochemistry	
   and	
   cytochemistry	
   :	
   official	
   journal	
   of	
   the	
   Histochemistry	
  Society.	
  52,	
  1511-­‐8.	
   [253]	
   Batetta,	
   B.,	
   Mulas,	
   M.F.,	
   Petruzzo,	
   P.,	
   Putzolu,	
   M.,	
   Bonatesta,	
   R.R.,	
   Sanna,	
   F.,	
   Cappai,	
   A.,	
   Brotzu,	
  G.	
  and	
  Dessi,	
  S.,	
  2001.	
  Opposite	
  pattern	
  of	
  MDR1	
  and	
  caveolin-­‐1	
  gene	
  expression	
  in	
   human	
   atherosclerotic	
   lesions	
   and	
   proliferating	
   human	
   smooth	
   muscle	
   cells,	
   Cellular	
   and	
   molecular	
  life	
  sciences	
  :	
  CMLS.	
  58,	
  1113-­‐20.	
   [254]	
   Llorente-­‐Cortes,	
   V.,	
   Otero-­‐Vinas,	
   M.,	
   Hurt-­‐Camejo,	
   E.,	
   Martinez-­‐Gonzalez,	
   J.	
   and	
   Badimon,	
   L.,	
   2002.	
   Human	
   coronary	
   smooth	
   muscle	
   cells	
   internalize	
   versican-­‐modified	
   LDL	
   through	
   LDL	
   receptor-­‐related	
   protein	
   and	
   LDL	
   receptors,	
   Arteriosclerosis,	
   thrombosis,	
   and	
   vascular	
   biology.	
  22,	
  387-­‐93.	
    83	
   	
    	
   [255]	
   Mulvihill,	
  E.R.,	
  Jaeger,	
  J.,	
  Sengupta,	
  R.,	
  Ruzzo,	
  W.L.,	
  Reimer,	
  C.,	
  Lukito,	
  S.	
  and	
  Schwartz,	
  S.M.,	
   2004.	
   Atherosclerotic	
   plaque	
   smooth	
   muscle	
   cells	
   have	
   a	
   distinct	
   phenotype,	
   Arteriosclerosis,	
  thrombosis,	
  and	
  vascular	
  biology.	
  24,	
  1283-­‐9.	
   [256]	
   Owens,	
   G.K.,	
   Kumar,	
   M.S.	
   and	
   Wamhoff,	
   B.R.,	
   2004.	
   Molecular	
   regulation	
   of	
   vascular	
   smooth	
   muscle	
   cell	
   differentiation	
   in	
   development	
   and	
   disease,	
   Physiological	
   reviews.	
   84,	
   767-­‐801.	
   [257]	
   Schwartz,	
  S.M.,	
  deBlois,	
  D.	
  and	
  O'Brien,	
  E.R.,	
  1995.	
  The	
  intima.	
  Soil	
  for	
  atherosclerosis	
  and	
   restenosis,	
  Circulation	
  research.	
  77,	
  445-­‐65.	
   [258]	
   Sata,	
   M.,	
   Saiura,	
   A.,	
   Kunisato,	
   A.,	
   Tojo,	
   A.,	
   Okada,	
   S.,	
   Tokuhisa,	
   T.,	
   Hirai,	
   H.,	
   Makuuchi,	
   M.,	
   Hirata,	
   Y.	
   and	
   Nagai,	
   R.,	
   2002.	
   Hematopoietic	
   stem	
   cells	
   differentiate	
   into	
   vascular	
   cells	
   that	
   participate	
  in	
  the	
  pathogenesis	
  of	
  atherosclerosis,	
  Nature	
  medicine.	
  8,	
  403-­‐9.	
   [259]	
   Caplice,	
  N.M.,	
  Bunch,	
  T.J.,	
  Stalboerger,	
  P.G.,	
  Wang,	
  S.,	
  Simper,	
  D.,	
  Miller,	
  D.V.,	
  Russell,	
  S.J.,	
   Litzow,	
   M.R.	
   and	
   Edwards,	
   W.D.,	
   2003.	
   Smooth	
   muscle	
   cells	
   in	
   human	
   coronary	
   atherosclerosis	
   can	
   originate	
   from	
   cells	
   administered	
   at	
   marrow	
   transplantation,	
   Proceedings	
   of	
   the	
   National	
   Academy	
   of	
   Sciences	
   of	
   the	
   United	
   States	
   of	
   America.	
   100,	
   4754-­‐9.	
   [260]	
   Arciniegas,	
   E.,	
   Ponce,	
   L.,	
   Hartt,	
   Y.,	
   Graterol,	
   A.	
   and	
   Carlini,	
   R.G.,	
   2000.	
   Intimal	
   thickening	
   involves	
  transdifferentiation	
  of	
  embryonic	
  endothelial	
  cells,	
  The	
  Anatomical	
  record.	
  258,	
  47-­‐ 57.	
   [261]	
   Frid,	
  M.G.,	
  Kale,	
  V.A.	
  and	
  Stenmark,	
  K.R.,	
  2002.	
  Mature	
  vascular	
  endothelium	
  can	
  give	
  rise	
   to	
   smooth	
   muscle	
   cells	
   via	
   endothelial-­‐mesenchymal	
   transdifferentiation:	
   in	
   vitro	
   analysis,	
   Circulation	
  research.	
  90,	
  1189-­‐96.	
   [262]	
   Scott,	
   N.A.,	
   Cipolla,	
   G.D.,	
   Ross,	
   C.E.,	
   Dunn,	
   B.,	
   Martin,	
   F.H.,	
   Simonet,	
   L.	
   and	
   Wilcox,	
   J.N.,	
   1996.	
  Identification	
  of	
  a	
  potential	
  role	
  for	
  the	
  adventitia	
  in	
  vascular	
  lesion	
  formation	
  after	
   balloon	
  overstretch	
  injury	
  of	
  porcine	
  coronary	
  arteries,	
  Circulation.	
  93,	
  2178-­‐87.	
   [263]	
   Shi,	
   Y.,	
   O'Brien,	
   J.E.,	
   Fard,	
   A.,	
   Mannion,	
   J.D.,	
   Wang,	
   D.	
   and	
   Zalewski,	
   A.,	
   1996.	
   Adventitial	
   myofibroblasts	
   contribute	
   to	
   neointimal	
   formation	
   in	
   injured	
   porcine	
   coronary	
   arteries,	
   Circulation.	
  94,	
  1655-­‐64.	
   [264]	
   Campbell,	
   J.H.,	
   Popadynec,	
   L.,	
   Nestel,	
   P.J.	
   and	
   Campbell,	
   G.R.,	
   1983.	
   Lipid	
   accumulation	
   in	
   arterial	
  smooth	
  muscle	
  cells.	
  Influence	
  of	
  phenotype,	
  Atherosclerosis.	
  47,	
  279-­‐95.	
   [265]	
   Takahashi,	
  M.,	
  Takahashi,	
  S.,	
  Suzuki,	
  C.,	
  Jia,	
  L.,	
  Morimoto,	
  H.,	
  Ise,	
  H.,	
  Iwasaki,	
  T.,	
  Hattori,	
  H.,	
   Suzuki,	
  J.,	
  Miyamori,	
  I.,	
  Kobayashi,	
  E.	
  and	
  Ikeda,	
  U.,	
  2005.	
  Interleukin-­‐1beta	
  attenuates	
  beta-­‐ very	
  low-­‐density	
  lipoprotein	
  uptake	
  and	
  its	
  receptor	
  expression	
  in	
  vascular	
  smooth	
  muscle	
   cells,	
  Journal	
  of	
  molecular	
  and	
  cellular	
  cardiology.	
  38,	
  637-­‐46.	
   [266]	
   Ruan,	
   X.Z.,	
   Moorhead,	
   J.F.,	
   Tao,	
   J.L.,	
   Ma,	
   K.L.,	
   Wheeler,	
   D.C.,	
   Powis,	
   S.H.	
   and	
   Varghese,	
   Z.,	
   2006.	
   Mechanisms	
   of	
   dysregulation	
   of	
   low-­‐density	
   lipoprotein	
   receptor	
   expression	
   in	
   vascular	
   smooth	
   muscle	
   cells	
   by	
   inflammatory	
   cytokines,	
   Arteriosclerosis,	
   thrombosis,	
   and	
   vascular	
  biology.	
  26,	
  1150-­‐5.	
   [267]	
   Zingg,	
   J.M.,	
   Ricciarelli,	
   R.,	
   Andorno,	
   E.	
   and	
   Azzi,	
   A.,	
   2002.	
   Novel	
   5'	
   exon	
   of	
   scavenger	
   receptor	
   CD36	
   is	
   expressed	
   in	
   cultured	
   human	
   vascular	
   smooth	
   muscle	
   cells	
   and	
   atherosclerotic	
  plaques,	
  Arteriosclerosis,	
  thrombosis,	
  and	
  vascular	
  biology.	
  22,	
  412-­‐7.	
   [268]	
   Yu,	
   J.,	
   Li,	
   Y.,	
   Li,	
   M.,	
   Qu,	
   Z.	
   and	
   Ruan,	
   Q.,	
   2010.	
   Oxidized	
   low	
   density	
   lipoprotein-­‐induced	
   transdifferentiation	
  of	
  bone	
  marrow-­‐derived	
  smooth	
  muscle-­‐like	
  cells	
  into	
  foam-­‐like	
  cells	
  in	
   vitro,	
  International	
  journal	
  of	
  experimental	
  pathology.	
  91,	
  24-­‐33.	
    84	
   	
    	
   [269]	
   Francis,	
   G.A.,	
   Tsujita,	
   M.	
   and	
   Terry,	
   T.L.,	
   1999a.	
   Apolipoprotein	
   AI	
   efficiently	
   binds	
   to	
   and	
   mediates	
   cholesterol	
   and	
   phospholipid	
   efflux	
   from	
   human	
   but	
   not	
   rat	
   aortic	
   smooth	
   muscle	
   cells,	
  Biochemistry.	
  38,	
  16315-­‐22.	
   [270]	
   Miyazaki,	
   A.,	
   Sakai,	
   M.,	
   Suginohara,	
   Y.,	
   Hakamata,	
   H.,	
   Sakamoto,	
   Y.,	
   Morikawa,	
   W.	
   and	
   Horiuchi,	
   S.,	
   1994.	
   Acetylated	
   low	
   density	
   lipoprotein	
   reduces	
   its	
   ligand	
   activity	
   for	
   the	
   scavenger	
  receptor	
  after	
  interaction	
  with	
  reconstituted	
  high	
  density	
  lipoprotein,	
  The	
  Journal	
   of	
  biological	
  chemistry.	
  269,	
  5264-­‐9.	
   [271]	
   Li,	
   Q.,	
   Tsujita,	
   M.	
   and	
   Yokoyama,	
   S.,	
   1997.	
   Selective	
   down-­‐regulation	
   by	
   protein	
   kinase	
   C	
   inhibitors	
   of	
   apolipoprotein-­‐mediated	
   cellular	
   cholesterol	
   efflux	
   in	
   macrophages,	
   Biochemistry.	
  36,	
  12045-­‐52.	
   [272]	
   Francis,	
   G.A.	
   and	
   Perry,	
   R.J.,	
   1999b.	
   Targeting	
   HDL-­‐mediated	
   cellular	
   cholesterol	
   efflux	
   for	
   the	
  treatment	
  and	
  prevention	
  of	
  atherosclerosis,	
  Clinica	
  chimica	
  acta;	
  international	
  journal	
   of	
  clinical	
  chemistry.	
  286,	
  219-­‐30.	
   [273]	
   Albrecht,	
  C.,	
  Soumian,	
  S.,	
  Amey,	
  J.S.,	
  Sardini,	
  A.,	
  Higgins,	
  C.F.,	
  Davies,	
  A.H.	
  and	
  Gibbs,	
  R.G.,	
   2004.	
   ABCA1	
   expression	
   in	
   carotid	
   atherosclerotic	
   plaques,	
   Stroke;	
   a	
   journal	
   of	
   cerebral	
   circulation.	
  35,	
  2801-­‐6.	
   [274]	
   Forcheron,	
   F.,	
   Legedz,	
   L.,	
   Chinetti,	
   G.,	
   Feugier,	
   P.,	
   Letexier,	
   D.,	
   Bricca,	
   G.	
   and	
   Beylot,	
   M.,	
   2005.	
   Genes	
   of	
   cholesterol	
   metabolism	
   in	
   human	
   atheroma:	
   overexpression	
   of	
   perilipin	
   and	
   genes	
  promoting	
  cholesterol	
  storage	
  and	
  repression	
  of	
  ABCA1	
  expression,	
  Arteriosclerosis,	
   thrombosis,	
  and	
  vascular	
  biology.	
  25,	
  1711-­‐7.	
   [275]	
   Soumian,	
   S.,	
   Albrecht,	
   C.,	
   Davies,	
   A.H.	
   and	
   Gibbs,	
   R.G.,	
   2005.	
   ABCA1	
   and	
   atherosclerosis,	
   Vascular	
  medicine.	
  10,	
  109-­‐19.	
   [276]	
   Frolov,	
  A.,	
  Zielinski,	
  S.E.,	
  Crowley,	
  J.R.,	
  Dudley-­‐Rucker,	
  N.,	
  Schaffer,	
  J.E.	
  and	
  Ory,	
  D.S.,	
  2003.	
   NPC1	
  and	
  NPC2	
  regulate	
  cellular	
  cholesterol	
  homeostasis	
  through	
  generation	
  of	
  low	
  density	
   lipoprotein	
  cholesterol-­‐derived	
  oxysterols,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
  278,	
  25517-­‐ 25.	
   [277]	
   Choi,	
  H.Y.,	
  Karten,	
  B.,	
  Chan,	
  T.,	
  Vance,	
  J.E.,	
  Greer,	
  W.L.,	
  Heidenreich,	
  R.A.,	
  Garver,	
  W.S.	
  and	
   Francis,	
   G.A.,	
   2003.	
   Impaired	
   ABCA1-­‐dependent	
   lipid	
   efflux	
   and	
   hypoalphalipoproteinemia	
   in	
  human	
  Niemann-­‐Pick	
  type	
  C	
  disease,	
  The	
  Journal	
  of	
  biological	
  chemistry.	
  278,	
  32569-­‐77.	
   [278]	
   Boadu,	
   E.,	
   Nelson,	
   R.C.	
   and	
   Francis,	
   G.A.,	
   2012.	
   ABCA1-­‐dependent	
   mobilization	
   of	
   lysosomal	
   cholesterol	
   requires	
   functional	
   Niemann-­‐Pick	
   C2	
   but	
   not	
   Niemann-­‐Pick	
   C1	
   protein,	
   Biochimica	
  et	
  biophysica	
  acta.	
  1821,	
  396-­‐404.	
   [279]	
   Bowden,	
   K.L.,	
   Bilbey,	
   N.J.,	
   Bilawchuk,	
   L.M.,	
   Boadu,	
   E.,	
   Sidhu,	
   R.,	
   Ory,	
   D.S.,	
   Du,	
   H.,	
   Chan,	
   T.	
   and	
  Francis,	
  G.A.,	
  2011.	
  Lysosomal	
  acid	
  lipase	
  deficiency	
  impairs	
  regulation	
  of	
  ABCA1	
  gene	
   and	
  formation	
  of	
  high	
  density	
  lipoproteins	
  in	
  cholesteryl	
  ester	
  storage	
  disease,	
  The	
  Journal	
   of	
  biological	
  chemistry.	
  286,	
  30624-­‐35.	
   [280]	
   Goldstein,	
  J.L.,	
  Dana,	
  S.E.,	
  Faust,	
  J.R.,	
  Beaudet,	
  A.L.	
  and	
  Brown,	
  M.S.,	
  1975.	
  Role	
  of	
  lysosomal	
   acid	
   lipase	
   in	
   the	
   metabolism	
   of	
   plasma	
   low	
   density	
   lipoprotein.	
   Observations	
   in	
   cultured	
   fibroblasts	
   from	
   a	
   patient	
   with	
   cholesteryl	
   ester	
   storage	
   disease,	
   The	
   Journal	
   of	
   biological	
   chemistry.	
  250,	
  8487-­‐95.	
   [281]	
   Pentchev,	
   P.G.,	
   Comly,	
   M.E.,	
   Kruth,	
   H.S.,	
   Tokoro,	
   T.,	
   Butler,	
   J.,	
   Sokol,	
   J.,	
   Filling-­‐Katz,	
   M.,	
   Quirk,	
  J.M.,	
  Marshall,	
  D.C.,	
  Patel,	
  S.	
  and	
  et	
  al.,	
  1987.	
  Group	
  C	
  Niemann-­‐Pick	
  disease:	
  faulty	
   regulation	
  of	
  low-­‐density	
  lipoprotein	
  uptake	
  and	
  cholesterol	
  storage	
  in	
  cultured	
  fibroblasts,	
   FASEB	
   journal	
   :	
   official	
   publication	
   of	
   the	
   Federation	
   of	
   American	
   Societies	
   for	
   Experimental	
   Biology.	
  1,	
  40-­‐5.	
    85	
   	
    	
   [282]	
   Shefer,	
   S.,	
   Hauser,	
   S.,	
   Salen,	
   G.,	
   Zaki,	
   F.G.,	
   Bullock,	
   J.,	
   Salgado,	
   E.	
   and	
   Shevitz,	
   J.,	
   1984.	
   Comparative	
   effects	
   of	
   cholestanol	
   and	
   cholesterol	
   on	
   hepatic	
   sterol	
   and	
   bile	
   acid	
   metabolism	
  in	
  the	
  rat,	
  The	
  Journal	
  of	
  clinical	
  investigation.	
  74,	
  1773-­‐81.	
   [283]	
   Javitt,	
  N.B.,	
  2002.	
  25R,26-­‐Hydroxycholesterol	
  revisited:	
  synthesis,	
  metabolism,	
  and	
  biologic	
   roles,	
  Journal	
  of	
  lipid	
  research.	
  43,	
  665-­‐70.	
   [284]	
   Salen,	
   G.,	
   1971.	
   Cholestanol	
   deposition	
   in	
   cerebrotendinous	
   xanthomatosis.	
   A	
   possible	
   mechanism,	
  Annals	
  of	
  internal	
  medicine.	
  75,	
  843-­‐51.	
   [285]	
   Fujiyama,	
   J.,	
   Kuriyama,	
   M.,	
   Arima,	
   S.,	
   Shibata,	
   Y.,	
   Nagata,	
   K.,	
   Takenaga,	
   S.,	
   Tanaka,	
   H.	
   and	
   Osame,	
   M.,	
   1991.	
   Atherogenic	
   risk	
   factors	
   in	
   cerebrotendinous	
   xanthomatosis,	
   Clinica	
   chimica	
  acta;	
  international	
  journal	
  of	
  clinical	
  chemistry.	
  200,	
  1-­‐11.	
   [286]	
   Wong,	
   J.,	
   Quinn,	
   C.M.,	
   Guillemin,	
   G.	
   and	
   Brown,	
   A.J.,	
   2007.	
   Primary	
   human	
   astrocytes	
   produce	
   24(S),25-­‐epoxycholesterol	
   with	
   implications	
   for	
   brain	
   cholesterol	
   homeostasis,	
   Journal	
  of	
  neurochemistry.	
  103,	
  1764-­‐73.	
   [287]	
   Lemire,	
  J.M.,	
  Potter-­‐Perigo,	
  S.,	
  Hall,	
  K.L.,	
  Wight,	
  T.N.	
  and	
  Schwartz,	
  S.M.,	
  1996.	
  Distinct	
  rat	
   aortic	
  smooth	
  muscle	
  cells	
  differ	
  in	
  versican/PG-­‐M	
  expression,	
  Arteriosclerosis,	
  thrombosis,	
   and	
  vascular	
  biology.	
  16,	
  821-­‐9.	
   	
   	
   	
    86	
   	
    

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0073694/manifest

Comment

Related Items