Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Yeast population dynamics during inoculated and spontaneous fermentations at three local British Columbia… Lange, Jessica Nicole 2012

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2013_spring_lange_jessica.pdf [ 2.16MB ]
Metadata
JSON: 24-1.0073412.json
JSON-LD: 24-1.0073412-ld.json
RDF/XML (Pretty): 24-1.0073412-rdf.xml
RDF/JSON: 24-1.0073412-rdf.json
Turtle: 24-1.0073412-turtle.txt
N-Triples: 24-1.0073412-rdf-ntriples.txt
Original Record: 24-1.0073412-source.json
Full Text
24-1.0073412-fulltext.txt
Citation
24-1.0073412.ris

Full Text

YEAST POPULATION DYNAMICS DURING INOCULATED AND SPONTANEOUS FERMENTATIONS AT THREE LOCAL BRITISH COLUMBIA WINERIES by JESSICA NICOLE LANGE B.Sc., The University of British Columbia, 2010 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in The College of Graduate Studies (Biology) THE UNIVERSITY OF BRITISH COLUMBIA (Okanagan) December 2012 © Jessica Nicole Lange, 2012  ABSTRACT Little assessment of yeast assemblages has occurred in Canadian wineries, unlike other large wine producing regions (Spain, Italy, Argentina). The aim of this study was to compare yeast assemblages during inoculated and spontaneous fermentations at three Canadian wineries. The wineries (Quails’ Gate Estate Winery, QGEW; Cedar Creek Estate Winery, CCEW; and Road13 Estate Winery, R13EW) are located in the Okanagan wine region, British Columbia. All three wineries have a history of using commercial yeast. During the 2010 vintage, nine inoculated and three spontaneous Vitis vinifera L. var. Pinot noir fermentations were sampled from four distinct stages of fermentation. Yeast populations from inoculated fermentations were also assessed at QGEW during the following vintage in 2011. Saccharomyces cerevisiae isolates were discriminated at the strain level by microsatellite analysis of hyperviariable trinucelotide loci. NonSaccharomyces species were identified by sequencing the ITS and the D1/D2 domain regions of the large subunit of rDNA. Non-Saccharomyces spp., particularly Henseniaspora uvarum, were the dominant yeasts detected during cold-soak at all three wineries. Spontaneous fermentation appeared to have a greater species/strain diversity/richness than inoculated fermentation at the youngest (R13EW) of the three wineries. Commercial strains were isolated in relatively low frequencies in the spontaneous fermentation at this winery, whereas at the older wineries (QGEW and CCEW) commercial strains dominated fermentation. R13EW was the only winery where the commercial ADY inoculant fully implanted. At QGEW and CCEW, a commercial yeast, Lalvin® ICV-D254, was the major non-inoculant strain detected in both inoculated and spontaneous fermentations. Only QGEW and CCEW reported previous use of this  ii  strain in other varietals. Nevertheless, the different wineries exhibited unique yeast species/strain assemblages at all stages of fermentation, even cold-soak. During both vintages studied at QGEW, the non-inoculant ADY strain (Lalvin® ICV-D254) was dominant or co-dominant in inoculated fermentation. Thus, mixed-strain populations in inoculated tanks were observed in both years. This study emphasizes the need for further research on whether the age of a winery is a major factor in affecting the yeast assemblage of fermenting wine, the source(s) of non-inoculant yeast, and the effects yeasts have on the sensorial attributes of the finished wine product.  iii  PREFACE The samples for this study were collected from three local British Columbia wineries, including Quail’s Gate, Cedar Creek, and Road13 Estate Wineries. With guidance from my supervisor, Dr. Daniel Durall, I was responsible for developing the experimental design, collecting all experimental data during the 2010 vintage, and writing the thesis. Mansak (Ben) Tantikachornkiat (BSc with Honors candidate, UBCO) was responsible for collecting data from the 2011 vintage at Quails’ Gate Estate Winery for an Honor’s study. His data were utilized for comparing the 2010 and 2011 inoculated populations detected at this winery. The data described in this thesis were presented as an invited oral presentation at the Annual Conference of the American Society of Ecology and Viticulture in Portland, OR, USA and at the Annual Conference of the British Columbia Wine Grape Council in Penticton, BC, Canada in June and July, 2012, respectively. Portions of the abstract were published in the American Journal of Enology and Viticulture. This thesis was reviewed by the following members of my supervisory committee, all faculty at the University of British Columbia (Okanagan): Dr. Dan Durall, Dr. Louise Nelson, and Dr. Cedric Saucier.  iv  TABLE OF CONTENTS ABSTRACT.………………………………………………………………….…………..ii PREFACE………………………………………………………………………..……….iv TABLE OF CONTENTS…………………………………………………….…...……….v LIST OF TABLES………………………………………….……………….………….viii LIST OF FIGURES………………………………………………………...….………….x LIST OF ABBREVIATIONS……………………………………………..…..….……..xii ACKNOWLEDGEMENTS……………………………………………………………..xiv CHAPTER 1: INTRODUCTION…………………………...…...……………...………...1 1.1 INTRODUCTION TO WINEMAKING……………………………………...1 1.2 THE ORIGIN AND NATURAL HABITAT OF WINE YEAST……...……..2 1.3 SUCCESSION OF WINE YEAST SPECIES DURING FERMENTATION..5 1.4 INOCULATED AND SPONTANEOUS FERMENTATIONS………………9 1.5 THE USE OF MICROSATELLITE MARKERS FOR S. CEREVISIAE STRAIN-LEVEL IDENTIFICATION……..………………………………..12 1.6 RESEARCH OBJECTIVES…………………………………………...…….13 1.7 RESEARCH HYPOTHESES………………………………………………..14 1.8 RATIONALE OF HYPOTHESES…………………………………………..15 CHAPTER 2: AN ASSESSMENT OF YEAST POPULATION DYNAMICS DURING INOCULATED AND SPONTANEOUS FERMENTATIONS AT THREE LOCAL BRITISH COLUMBIA WINERIES…...…………….……………….………..17 2.1 SYNOPSIS…………………………………………………….……………..17 2.2 MATERIALS AND METHODS………………………………...…………..19 2.2.1 Study sites and experimental design……………………….....……19 2.2.2 Collection of samples………………………………..……………..20 2.2.3 Inoculation………………………………………………..………..22  v  2.2.4 Yeast isolation……………………………………………….…..…23 2.2.5 Identification of yeast strains and species…………………...…..…25 2.2.6 UBCO ADY commercial S. cerevisiae microsatellite comparative database…………………...………………...……..…29 2.2.7 Data analysis……………………………………………..…...……31 2.3 RESULTS……………………………………..……………….…………….34 2.3.1 Isolation and identification of yeasts……………………..….…….34 2.3.2 Succession of non-Saccharomyces and S. cerevisiae yeasts..….….37 2.3.3 Detection of the commercial ADY inoculant……………..……….38 2.3.4 Comparison of species/strain diversity and richness between spontaneous and inoculated fermentations………………….……..40 2.3.5 Comparison of yeast assemblages between wineries………….…...41 2.3.6 Comparison of inoculated yeast populations between 2010 and 2011 vintages at Quails’ Gate Estate Winery………………….….42 2.4 DISCUSSION……………………………………..……………….……..….43 2.4.1 Species/strain accumulation curves and study sample size………..43 2.4.2 The effectiveness of microsatellite DNA analysis and comparative commercial ADY database…………………….…….44 2.4.3 Commercial S. cerevisiae yeast dominate fermentation…….....…..46 2.4.4 Non-Saccharomyces spp. and S. cerevisiae succession……..….….50 2.4.5 Implantation of the commercial ADY inoculant…………………..53 2.4.6 Species/strain diversity and richness of spontaneous fermentation..56 2.4.7 Comparison of cold-soak, inoculated, and spontaneous yeast assemblages between wineries………………………………...…58 2.4.8 Comparison of inoculated yeast populations detected between two vintages at Quails’ Gate Estate Winery……...……...………..61 2.5 SUMMARY……………..……………..……………..………………......….63  vi  CHAPTER 3: CONCLUSION……...………………………...……..…………...……...66 3.1 CONCLUSION SUMMARY.………….……………..…...……...…..…..…66 3.2 NOVELTY OF THE RESEARCH……………..……………..……………..67 3.3 MANAGEMENT IMPLICATIONS……………..……………..………...…68 3.4 ASSUMPTIONS AND LIMITATIONS……………..……………….…..…70 3.5 SUGGESTIONS FOR FURTHER RESEARCH……………..…..…………71 REFERENCES……………..……………..……………..…….……..…………….…....93 APPENDIX A……………………….………..……………..………………….………102  vii  LIST OF TABLES Table 1.1: Comparative table of literature on wine yeast ecology studies..……………..74 Table 2.1: Fermentation data of 2010 tanks at (A) QGEW; (B) CCEW; (C) R13EW.….76 Table 2.2: Fermentation data of inoculated tanks from the 2011vintage at QGEW…..…79 Table 2.3: Commercial S. cerevisiae strains reported used since the establishment of QGEW, CCEW, and R13EW. ‘x’ indicates strain used………………………80 Table 2.4: Total number of commercial and non-commercial ‘unknown’ S. cerevisiae strains, Saccharomyces spp., and non-Saccharomyces yeasts detected at QGEW, CCEW, and R13EW in the 2010 vintage.……….…..………..……..81 Table 2.5: Simpson’s diversity index (D) and abundance-based coverage (ACE) estimators of yeast species/strain richness and diversity of (A) QGEW; (B) CCEW; and (C) R13EW inoculated and spontaneous tanks during cold-soak (CS), early (ER), mid (M), and end (F) stages of fermentation...….81 Table 2.6: Similarity indices of inoculated (T1-T3) and spontaneous (W) population assemblages during cold-soak (CS), early (ER), mid (M), and end (F) stages of fermentation at (A) QGEW1; (B) CCEW1; (C) R13EW1. Grey shading indicates ≥ 80% shared similarity yeast species/strain assemblages between tanks and stages of fermentation…………….…………...………….82 Table 2.7: Permutational MANOVAs from QGEW, CCEW, and R13EW’s inoculated, spontaneous, cold-soak, and QGEW year-to-year non-metric multidimensional scaling (NMS) ordinations. DF= degrees of freedom; SS= sum of squares……………........……………………………………...…83 Table A.1: Commercial S. cerevisiae ADY microsatellite database constructed at UBCO...........................................................................................................102 Table A.2: Primer information for ten loci evaluated by microsatellite DNA analysis (bp = basepairs)……………….……………………………………………103 Table A.3: Yeast species/strain frequency of occurrence from inoculated (T1-T3) tanks during cold-soak (CS), early (ER), mid (M), and end (F) stages of fermentation at QGEW, CCEW, and R13EW in the 2010 vintage…….….104 Table A.4: Yeast species/strain frequency of occurrence from the spontaneous (W) tank during early (ER), mid (M), and end (F) stages of fermentation at QGEW, CCEW, and R13EW in the 2010 vintage…………………………105  viii  Table A.5: Yeast species/strain frequency of occurrence from inoculated tanks during cold-soak (CS), early (ER), mid (M), and end (F) stages of fermentation at QGEW from the 2011 vintage……………...….………….106 Table A.6: Accession number (#) and percent (%) similarity for the BLAST matches of non-Saccharomyces isolates detected in inoculated (T1-T3) or spontaneous (W) fermentation tanks for Quails’ Gate (QG); Cedar Creek (CC); Road13 (R13) Estate Wineries; and Quails’ Gate 2011 vintage (QG-2011) isolated in cold-soak (CS), early (ER), or mid (M) stages of fermentation. Amplification of ITS and D1/D2 regions of ribosomal DNA using ITS1f/ITS4 and NL1/NL4 universal primer sets..…107  ix  LIST OF FIGURES Figure 2.1: Yeast species/strain frequency of occurrence at QGEW (2010) during cold-soak (CS), early (ER), mid (M), and end (F) stages of inoculated (A-C) and spontaneous (D) fermentation. (A) QG-T1; (B) QG-T2; (C) QG-T3; (D) QG-W.……………………………………………...…..….84 Figure 2.2: Yeast species/strain frequency of occurrence at CCEW (2010) during cold-soak (CS), early (ER), mid (M), and end (F) stages of inoculated (A-C) and spontaneous (D) fermentation. (A) CC-T1; (B) CC-T2; (C) CC-T3; (D) CC-W.…..................................................................……….85 Figure 2.3: Yeast species/strain frequency of occurrence at R13EW (2010) during cold-soak (CS), early (ER), mid (M), and end (F) stages of inoculated (A-C) and spontaneous (D) fermentation. (A) R13-T1; (B) R13-T2; (C) R13-T3; (D) R13-W.…………………………………………….…..….86 Figure 2.4: Species/strain accumulation curves of the 2010 vintage using Mao Tau individual-based rarefaction with replacement during cold-soak (CS), early (ER), mid (M), and end (F) stages of fermentation from inoculated tanks (n=3) at: QGEW (QG- A through D); CCEW (CC- E through H); and R13EW (R13- I through L). Dashed lines indicate Mao Tau 95% upper and lower bound confidence intervals.………………………........….87 Figure 2.5: Species/strain accumulation curves using Mao Tau individual-based rarefaction with replacement during early (solid), mid (dashed), and end (double dashed) stages of fermentation from spontaneous tanks (W, n=1) at (A) QGEW; (B) CCEW; and (C) R13EW…………………….………….88 Figure 2.6: Species/strain accumulation curves using Mao Tau individual-based rarefaction with replacement during cold-soak (CS), early (ER), mid (M), and end (F) stages (A-D) of the 2011 fermentation from inoculated tanks (n=3) at QGEW. Dashed lines indicate Mao Tau 95% upper and lower bound confidence intervals..……………………………………………..….88 Figure 2.7: 2D nonmetric multidimensional scaling (NMS) ordination of QGEW (QG - red triangles), CCEW (CC- orange squares), and R13EW (R13- green circles) yeast species/strain assemblages detected in inoculated tanks (T1-T3) for early (ER), mid (M), and end (F) stages of fermentation. The percent of variation is 23.7% for the x-axis and 48.4% for the y-axis. The final stress is 15.90 and the resulting p-value is p = 0.002………………….89  x  Figure 2.8: 2D nonmetric multidimensional scaling (NMS) ordination of QGEW (QG - red triangles), CCEW (CC- orange squares), and R13EW (R13- green circles) yeast species/strain assemblages detected in spontaneous (W) fermentation tanks for early (ER), mid (M), and end (F) stages of fermentation. The percent of variation is 64.9% for the x-axis and 15.0% for the y-axis. The final stress is 0.096 and the resulting p-value is p = 0.003....................................................................................................….90 Figure 2.9: 2D nonmetric multidimensional scaling (NMS) ordination of QGEW (QG - red triangles), CCEW (CC- orange squares), and R13EW (R13- green circles) yeast species/strain assemblages detected in cold-soak (CS) stage of fermentation in tanks (T1-T3). The percent of variation is 46.3% for the x-axis and 34.2% for the y-axis. The final stress is 12.37 and the resulting p-value is p = 0.003…………………………………...…………………..…91 Figure 2.10: 2D nonmetric multidimensional scaling (NMS) ordination of QGEW inoculated fermentation tanks (T1-T3) yeast species/strain communities between years 2010 (red triangles) and 2011 (blue squares). The percent of variation is 54.4% for the x-axis and 17.8% for the y-axis. The final stress is 9.27 and the resulting p-value is p = 0.110…………………….…92  xi  LIST OF ABBREVIATIONS ACE  Abundance-based coverage estimator  ADY  Active dry yeast  AMH  Assmanshausen (Enoferm®)  AP  Arome Plus (Lalvin®)  BLAST  Basic Alignment Search Tool  BSA  Bovine Serum Albumin  CC  Cedar Creek  CCEW  Cedar Creek Estate Winery  CS  Cold-soak  D  Simpson’s Index  DNA  Deoxyribonucleic Acid  dNTP  Deoxynucleoside Triphosphate  ER  Early  EW  Estate Winery  F  End  FADSS  Fragment Analysis and DNA Sequencing Services  FAGE  Fast Adaptive Genome Evolution  ITS  Internal Transcribed Region  NCBI  National Centre for Biotechnology Information  NGS  Next Generation Sequencing  NMS  Nonmetric multidimensional scaling  M  Mid  MCT  Microcentrifuge Tube  PCR  Polymerase Chain Reaction  PCuvee  Premium Cuvee (Red Star®)  perMANOVA Permutational Multivariate Analysis of Variance QG  Quails’ Gate  QGEW  Quails’ Gate Estate Winery  R13  Road13  R13EW  Road13 Estate Winery xii  SD  Standard Deviation  Sobs  Species Observed  T  Tank (Inoculated Fermentation)  UBCO  University of British Columbia Okanagan  UN  Unknown  Var.  Varietal  W  Spontaneous Fermentation  WL  Wallerstein Laboratory  YEPD  Yeast Extract Peptone Dextrose  xiii  ACKNOWLEDGEMENTS A sincere thank-you to my supervisor, Dr. Daniel Durall for all of his direction and invaluable guidance throughout this project. I would also like to thank my supervisory committee members, Dr. Louise Nelson and Dr. Cedric Saucier, for all of their encouragement, interest, constructive criticism, and positive feedback to my thesis. A big thank-you is given to all those who assisted me with lab work and statistical analysis. I was assisted with sampling and molecular work at Quails’ Gate Estate Winery by Liz Halverson (BSc with Honors, UBCO), plate streaking by Hannah Pawluck (BSc, UBCO), DNA analysis by Sheri Maxwell (UBCO FADSS Technician); and with statistical analysis by Dr. Melanie Jones, post-docs Dr. Matthew Whiteside and Dr. Brian Pickles, and Brian Ohsowski (PhD candidate). Additionally, I would like to thank Mansak (Ben) Tantikachornkiat for processing data collected from Quails’ Gate Estate Winery during the 2011 vintage. A sincere thanks is given to the winemakers Grant Stanley of Quails’ Gate Estate Winery, Darryl Brooker of Cedar Creek Estate Winery, and Michael Bartier of Road13 Estate Winery for their patience and support while I collected samples during the 2010 vintage. Also, thank-you to David Ledderhof of Quails’ Gate Estate Winery for being so informative throughout this project. Funding for this project was graciously provided by Quails’ Gate Estate Winery and Natural Sciences and Engineering Research Council (NSERC) through a collaborative research development (CRD) grant.  xiv  CHAPTER 1: INTRODUCTION 1.1 INTRODUCTION TO WINEMAKING Winemaking is an ancient art, which dates back to the Neolithic period (8500 to 4000 B.C.). One piece of evidence for early winemaking lies in the discovery of Egyptian fermentation jars containing Saccharomyces cerevisiae cell remnants and Vitis vinifera plant material (Cavalieri et al. 2003). By 2000 B.C., the cultivation of Vitis vinifera and production of wine was heavily practiced in Greece and Crete. By 500 B.C., winemaking became well established in Sicily, Italy, France, Spain, Portugal and northern Africa. Subsequently, it spread to Germany and to the greater portion of Europe (Pretorius 2000). The practice of viticulture, storage, and aging of wine has developed tremendously over the years; yet, the primary organisms responsible for alcoholic fermentation during vinification, i.e., Saccharomyces and non-Saccharomyces species, remain unchanged.  The main yeast involved in alcoholic fermentation is Saccharomyces cerevisiae; however, the transformation of macerated grapes into a finished wine product involves an array of complex interactions between related genera (S. uvarum, S. bayanus, S. paradoxus), non-Saccharomyces spp., filamentous fungi (Aspergillus, Botrytis and Penicillium), lactic and acetic acid bacteria (those organisms responsible for malolactic fermentation), mycoviruses, and bacteriophages (Pretorius 2000; Fleet 2007; Garijo et al. 2008). Together, their dynamics, development, succession, and metabolic activity during fermentation generate a variety of secondary metabolites, higher alcohols, esters, aldehydes, ketones, volatile compounds, organic acids, and enzymes, which affect the final organoleptic and aromatic properties of wine (Mateo et al.1992; Romano et al.  1  2003; Bisson and Karpel, 2010). There are two methods of fermentation practiced by winemakers today: spontaneous and inoculated fermentation. Spontaneous fermentation is the traditional approach to winemaking and it relies on the spontaneous entrance of indigenous (native) yeast into the grape must. It is thought to achieve increased yeast diversity and wine complexity (Maro et al. 2007; Tello et al. 2011). Inoculated fermentation is a modern approach to winemaking and involves the addition of a commercial active dry yeast (ADY) to the grape must in order to initiate fermentation. Inoculated fermentation attempts to achieve a yeast monoculture through the dominance of a particular ADY added to the must.  Inoculation usually results in an efficient  fermentation with a consistent, predictable, and reproducible wine product (Pretorius 2000; Maro et al. 2007). Wine yeast species affect aromatic and sensorial characteristics of wine and have a unique impact on the oenological properties. The frequency, diversity, and dynamics of yeast populations may affect the overall characteristics of the wine; therefore, making the study of yeast population dynamics an important part of the wine industry (Schutz and Gafner, 1993; Mateo et al. 1992; Maro et al. 2007).  1.2 THE ORIGIN AND NATURAL HABITAT OF WINE YEAST The origin and natural habitat of non-Saccharomyces and Saccharomyces wine yeast species are not fully understood, although analysis of yeast ecology performed at various wineries has given insight to this topic of study. The standing hypothesis for the initial origin of wine yeast in a newly established winery is as follows: Saccharomyces and non-Saccharomyces species are thought to have been deposited naturally onto the surface of the grapes by wind currents and insects including bees, wasps, and Drosophila  2  species (Stevic 1962; Lachance et al. 1994; Mortimer and Polsinelli, 1999). Clusters of grapes analyzed from various areas of the vineyard show the dominance of particular yeast species while some non-Saccharomyces species are inconsistent in their occurrence. For example, some grape clusters show a large dominance of the yeast Metschnikowia, while other clusters show no sign of this yeast, indicating that the source of this indigenous yeast may be from an insect that carried the particular yeast species from its origin to the vineyard (Mortimer and Polsinelli, 1999). Samples taken from grape skins in the vineyard report Hanseniaspora uvarum (anamorph Kloeckera apiculata) and Candida stellata as the dominant non-Saccharomyces species isolated with minor detection of species belonging to Torulospora, Metschnikowia, Kluyveromyces, Cryptococcus, Oenococcus, Pichia, Issatchenkia, and Rhodotorula genera (Zott et al. 2008; Ocon et al. 2010; Barata et al. 2012). The non-Saccharomyces yeast population peaks when the berry is most ripe, as it provides a nutritious medium and a large surface area for growth (Renouf et al. 2005).  There are two conceptual views held with respect to the predominance and natural habitat of non-Saccharomyces and S. cerevisiae yeasts. The first view argues that nonSaccharomyces spp. are ‘vineyard’ resident and Saccharomyces spp. are ‘winery’ resident yeasts. Non-Saccharomyces spp. have been detected in large numbers within the vineyard and as mentioned previously are found to heavily colonize the surface of Vitis vinifera grapes, as opposed to their low detection in the winery establishment (VaughanMartini and Martini, 1995; Jolly et al. 2003; Mercado et al. 2007). The view of S. cerevisiae as ‘winery’ resident yeast is based on widespread sampling of wineries with  3  detection of S. cerevisiae occurring on winery equipment, hoses, walls, stemmercrushers, pumps, (Martini 1993; Ciani et al. 2004; Clavijo et al. 2010) and in the winery air (Garijo et al. 2008). Furthermore, the same S. cerevisiae strains have been isolated over multiple sampling years indicating their ability to reside within the winery from one year to another (Beltran et al. 2002; Santamaria et al. 2005; Clavijo et al. 2010). Although sanitization measures are employed in the winery, some yeasts are able to survive these cleaning measures (Pretorius 2000; Ocon et al. 2010). This may be due to some yeasts ability to produce ascospores, enabling their survival over long periods of time (Vaughan-Martini and Martini, 1995).  In contrast, the second view argues that non-Saccharomyces and S. cerevisiae yeasts reside in both the vineyard and the winery. Non-Saccharomyces and S. cerevisiae isolates may be detected in greater numbers in the vineyard and within the winery, respectively; however, the detection of both species in the vineyard and winery has been well reported in the literature (Sabate et al. 2002; Le Jeune et al. 2006; Cordero-Bueso et al. 2011; Hall et al. 2011). The transport of Vitis vinifera grapes into the winery creates a large-scale introduction of the non-Saccharomyces population into the winery setting, while humans, insects, and the common practice of recycling and distributing lees back into the vineyard as natural fertilizer exposes the vineyard to an S. cerevisiae population making it plausible that S. cerevisiae and non-Saccharomyces are both vineyard and winery resident yeasts (Ganga and Martinez, 2004; Clavijo et al. 2010; Hall et al. 2011).  4  The reports of varying composition and transient detection of S. cerevisiae and non-Saccharomyces spp. in the vineyard may be due to a number of environmental and conditional factors affecting their survival, such as climatic conditions (rain, temperature, humidity), viticulture practice (leaf thinning), geographical zone, insects, and vintage (Valero et al. 2005; Mercado et al. 2007; Maro et al. 2007). Furthermore, the reporting from some studies of an absence of S. cerevisiae in the vineyard may be due to procedural limitations. Without the use of enrichment methods, some wine yeast species on natural vineyard surfaces, including soil, V. vinifera vines, and grape skins may go undetected (Fleet and Heard, 1993; Beltran et al. 2002; Barata et al. 2012). Future research using next-generation sequencing (NGS) may help to elucidate the seemingly undetectable S. cerevisiae population residing in the vineyard as thousands of samples may be multiplexed using DNA sequence “barcodes” able to characterize 99.99% of the microbiota (Hamady et al. 2008; Bokulich et al. 2012). A recent study revealed the power of NGS in wine microbial ecology upon analyzing the bacterial diversity of botrytized wine (Bokulich et al. 2012); however, to my current knowledge, NGS has not been employed on wine yeast populations present in the vineyard or during fermentation. This technique appears to analyze populations at more in-depth levels then first-generation profiling technologies can provide (Bokulich et al. 2012), seemingly beneficial for future wine yeast ecology studies.  1.3 SUCCESSION OF WINE YEAST SPECIES DURING FERMENTATION The yeast population dynamics of wine fermentation involve complex interactions between a vast collection of non-Saccharomyces and Saccharomyces species and strains.  5  Wine fermentation is generally divided into the following stages: cold-soak, early, mid, and end fermentative stages. The conversion of grape must into wine involves the development and succession of non-Saccharomyces and S. cerevisiae populations throughout these stages. Wine yeast fermentation succession includes the development of non-Saccharomyces species during the cold-soak stage followed by their replacement with S. cerevisiae yeasts during the early, mid, and end stages of fermentation. The nonSaccharomyces species are generally ethanol-intolerant, heat intolerant, oxygen dependent, and less competitive by nature ultimately leading to their death as fermentation progresses (Hansen et al. 2001; Combina et al. 2005; Le Jeune et al. 2006).  Species belonging to Hanseniaspora (anamorph Kloeckera apiculata) and Candida have been isolated in greatest numbers during the cold-soak stage of fermentation  along  with  a  minor  sub-population  composed  of  Torulospora,  Metschnikowia, Cryptococcus, Oenococcus, Pichia, Issatchenkia, and Rhodotorula species (Hierro et al. 2006; Zott et al. 2008; Ocon et al. 2010). The degree of berry ripeness, the cold maceration process, and sulphur dioxide (SO2) addition prior to coldsoak have been shown to greatly affect the predominance and diversity of nonSaccharomyces species during the initial phases of fermentation (Hierro et al. 2006). For example, Candida diversa and Issatchenkia sp. are detected in higher numbers when the must contains a lower sugar concentration due to the maceration of un-ripe grapes. In contrast, the maceration of very ripe grapes generates a must with high sugar concentration promoting the dominance of Candida stellata and H. uvarum populations (Hierro et al. 2006). Furthermore, age of the vineyard, grape variety and, as previously  6  mentioned, climatic conditions, geographical location, insects, and vintage may greatly affect the composition of vineyard yeast and, consequently, affect the yeast population during the initial stages of fermentation (Mercado et al. 2007; Maro et al. 2007; Barata et al. 2012). During the time of cold-soak, the must’s nutrient composition and oxygen concentration are high and the tank temperature, ethanol, and competition relatively low. These conditions support the development and growth of the sensitive nonSaccharomyces yeast population (Combina et al. 2004).  As fermentation progresses, S. cerevisiae increase in density and nonSaccharomyces species decline (Zott et al. 2008). The resultant increased temperature along with increased ethanol and carbon dioxide create unfavourable living conditions for non-Saccharomyces species (Vaughan-Martini and Martini, 1995). The production of ethanol, heat, and carbon dioxide with the ability to ferment in the presence of high glucose and low oxygen concentrations is thought to be an evolved mechanism in S. cerevisiae, known as the Crabtree effect. The Crabtree effect decreases competition with surrounding microbiota and increases the fitness and survival of the S. cerevisiae population (Goddard 2008). Other factors may cause the death of non-Saccharomyces species. These include the presence of toxic compounds secreted by killer yeasts (Heard and Fleet, 1987; Zargoc et al. 2001), nutrient depletion (glucose, nitrogen, amino acids), and cell-to-cell contact (Nissen et al. 2003). Cell-to-cell contact may cause the death of non-Saccharomyces populations in response to space limitation due to inter-species space competition (Nissen et al. 2003). Furthermore, the non-Saccharomyces density may be adversely affected by the addition of sulphur dioxide to the must, which is intended to kill  7  off any bacterial or hyphal fungal microbiota (Ocon et al. 2010). As ethanol concentrations rise during the initial stages of fermentation (cold-soak and early), parabolic death kinetics are expressed by the non-Saccharomyces population (Nissen and Arneborg, 2003). The parabolic death curve is expressed when different times of death between various non-Saccharomyces species occur. Initially, the least tolerant species to ethanol and depleting sugar concentrations begin to die, followed by the mid-tolerant species, and then lastly, the death of the most tolerant non-Saccharomyces species (Nissen and Arneborg, 2003).  The occurrence of S. cerevisiae in the must during the early, mid, and end stages of fermentation may occur spontaneously or by the addition of a commercial ADY by the winemaker. On average, a winery is exposed to billions of yeast cells every vintage making the spontaneous implantation of various S. cerevisiae strains into the must very probable (Beltran et al. 2002). Saccharomyces cerevisiae strains are commonly isolated on winery equipment, tanks, hoses, walls, and floors of the winery establishment, are able to survive on winery surfaces for extended periods of time and between annual harvests, and may enter tanks via airborne transfer or by the placement of winery machinery or tools into the must (Vaughan-Martini and Martini, 1995; Constanti et al. 1997; Torija et al. 2000; Valero et al. 2005). Because of these various sources by which S. cerevisiae is introduced, as well as other varying conditions, the S. cerevisiae populations often show considerable diversity in strain dynamics during fermentation within or between wineries (Schutz and Gafner, 1993; Beltran et al. 2000; Mercado et al. 2007). Another likely mode by which S. cerevisiae is introduced into a fermentative tank is through airborne  8  mechanisms. Saccharomyces cerevisiae cells are thought to travel in the form of a single particle, attached to a dust particle, or as a suspended aerosol droplet (Garijo et al. 2008).  1.4 INOCULATED AND SPONTANEOUS FERMENTATIONS Commercial ADY originate from indigenous strains isolated in wine-producing regions (Pretorius 2000; Schuller and Casal, 2007).  In 1965, S. cerevisiae strains,  Montrachet and Pasteur Champagne, were the first commercial ADY to be manufactured and sold for inoculating purposes as these specific strains appeared to harbour good fermentation parameters (Pretorius 2000). Today, several manufacturing companies exist distributing a wide selection of commercial ADY. Commercial ADY aid in the prevention of stuck fermentations, a risk taken when performing spontaneous fermentations (Bisson 1999). Because of this, the practice of adding commercial ADY to the grape must is becoming more and more popular within the wine industry as it has proven to decrease the risk of wine spoilage and promote a complete and rapid fermentation (Valero et al. 2007).  Spontaneous fermentation is the traditional approach to winemaking and is still heavily practiced in ‘Old World’ wine-producing regions, although the practice of wild ferments in North American wineries is becoming increasingly common. There is a claim that spontaneous fermentation allows for the development of indigenous yeast and a ‘terrior’ associated with the vineyard and winery, promoting the development of a distinct wine product unique and reflective of its producing region (Pretorius 2000; Vilanova et al. 2005; Fleet 2007). In comparison to inoculated fermentation, spontaneous  9  fermentation arises independently of yeast inoculation and relies on the introduction and completion of fermentation by the S. cerevisiae microflora of the vineyard and winery. Spontaneous fermentation is thought to achieve increased strain diversity as no one particular strain was intentionally added to the tank. This allows for the development of many different wine yeasts (Barrajón et al. 2009; Csoma et al. 2010; Tello et al. 2011). Strains of S. cerevisiae generate unique aromatic, sensorial, and chemical compounds in the grape juice and a fermentation composed of many wine yeasts is thought to yield a wine product composed of many sensorial and organoleptic properties (Mateo et al. 1991).  Concerns of competition and dominance of commercial S. cerevisiae over indigenous yeasts have been raised (Santamaria et al. 2005; Maro et al. 2007). Commercial S. cerevisiae strains have been isolated in spontaneous tanks and found to compete with the indigenous strains (Constanti et al. 1997; Beltran et al. 2000; Hall et al. 2011). Commercial ADY are chosen based on specific fermentative characteristics, such as quick fermentation initiation, fermentation at low temperatures, tolerance to high temperatures, low hydrogen sulfide production, and high ethanol intolerance; most of which may aid in their ability to out-compete weaker yeasts (Barrajón et al. 2009). The better adapted commercial ADY for fermentation may decrease the overall diversity of weaker wine yeasts by out-competing them and predominantly performing fermentation (Ganga and Martinez, 2003). It has been suggested that a decrease in strain diversity during fermentation may affect the overall distinctive aromatic qualities of the final wine product (Ganga and Martinez, 2003; Vilanova et al. 2005; Fleet 2007). Furthermore,  10  wineries using the same commercial ADY may begin to generate wine varietals that share similar characteristics since each strain is thought to generate specific organoleptic properties in the wine. Thus, the use of similar commercial ADY between wineries and regions may standardize wine properties and diminish region-specific properties generated by indigenous yeasts (Raineria and Pretorius, 2000).  Additionally, inoculated fermentations are also subject to competition with indigenous or other commercial yeast. Studies conducted on inoculated tanks resulted in the detection of S. cerevisiae strains other than the ADY added (Beltran et al. 2002; Clavijo et al. 2011; Tello et al. 2011). A study performed by Barrajón et al. (2009) noted that some ADY were scarce or non-existent in several inoculated fermentation tanks and concluded that ADY implantation is not always guaranteed. Effective implantation of ADY depends on temperature, water hardness, sugar concentration, agitation, and rehydration duration (Soubeyard et al. 2006; Barrajón et al. 2009). Failure to properly rehydrate the starter culture prior to inoculation may adversely modify the viability, physiological, and fermentation behaviour of ADY (Soubeyard et al. 2006). Furthermore, improper rehydration and implantation of the ADY may generate a longer than desired lag phase and allow for the entrance and establishment of other commercial and, or, indigenous yeast (Barrajón et al. 2009; Soubeyard et al. 2006; Lopes et al. 2007). Despite the correct practice and steps involved in ADY rehydration and inoculation, unsuccessful commercial ADY implantation may still be observed, possibly due to competition between indigenous and commercial yeast (Barrajón et al. 2009). An overview of literature from various wine producing regions that have studied various aspects of wine  11  yeast ecology, including yeast population dynamics in inoculated fermentation, spontaneous fermentation, on winery surfaces, and/or in vineyards, and their molecular method of choice, can be viewed in Table 1-1.  1.5 THE USE OF MICROSATELLITE MARKERS FOR S. CEREVISIAE STRAIN-LEVEL IDENTIFICATION The identification of yeast using molecular techniques has gone through ample development over the years. Characterization of S. cerevisiae yeast strains has occurred by various molecular measures including restriction fragment length polymorphism (RFLP), karyotyping, DNA hydridization, PCR-based assays, and mitochondrial restriction digests (Perez et al. 2001). A more modern approach to strain determination of S. cerevisiae wine yeast involves analysis of simple sequence repeats (SSRs) or microsatellites. Microsatellites are short repetitive DNA sequences varying in tandem repeat number, due to DNA replication errors including base pair additions, deletions, and slipped-strand mis-pairing (Strand et al. 1993; Legras et al. 2004). Microsatellites are dispersed throughout the Saccharomyces genome and act as molecular markers used for strain identification. An ideal molecular marker should be highly polymorphic, numerous, and provide reproducible results in order to grant a high degree of discrimination (Field et al. 1996). Various reports in the literature concluded that the use of microsatellites for molecular analysis and identification of S. cerevisiae at the strain-level is highly accurate and preferable over other molecular methods (Techera et al. 2001; Richards et al. 2009; Hall et al. 2011). The molecular techniques for this research utilized microsatellite fingerprint analysis as a means of S. cerevisiae strain identification.  12  1.6 RESEARCH OBJECTIVES Population dynamics of yeasts during fermentation have been well studied in more traditional wine-producing regions such as Spain (Santamaria et al. 2005; Garijo et al. 2008; Clavijo et al. 2011), Argentina (Lopes et al. 2002; Combina et al. 2005; Mercado et al. 2007), and Italy (Ciani et al. 2004; Maro et al. 2007; Tofalo et al. 2011). To my knowledge, with the exception of a previous study conducted at Quails’ Gate Estate Winery in 2007 (Hall et al. 2011), wine yeast population studies have yet to be reported from Canadian wineries. To better assess wine yeast population dynamics during inoculated and spontaneous fermentations in British Columbia’s Okanagan wine region, an intensive sampling was performed during the 2010 and 2011 vintages at three local wineries, including Quails’ Gate (QG), Cedar Creek (CC), and Road13 (R13) Estate Wineries (EW). The three overarching objectives of this thesis were to:  (1) Assess the population dynamics of wine yeast species and strains in both inoculated and spontaneous Vitis vinifera L. varietal (var.) Pinot noir fermentations during the 2010 vintage at three Okanagan wineries: QGEW, CCEW, R13EW.  (2) Perform a year-to-year comparison of wine yeast species and strain composition of inoculated Vitis vinifera L. var Pinot noir fermentations between the 2010 and 2011 vintages at QGEW.  13  (3) Construct a comparative commercial S. cerevisiae ADY microsatellite database for CCEW and R13EW and combine it with the already existing QGEW database constructed at UBCO (Hall et al. 2011).  1.7 RESEARCH HYPOTHESES The following are hypotheses that were tested for two of the three overarching objectives:  (1a) Commercial S. cerevisiae strains will be more prevalent and will occur in higher frequency than non-commercial S. cerevisiae strains during the early, mid, and end stages of inoculated and spontaneous fermentations at all three wineries.  (1b) Non-Saccharomyces spp., particularly Henseniaspora uvarum, will be the dominant yeasts detected in the cold-soak stage at all three wineries.  (1c) A succession from non-Saccharomyces spp. to S. cerevisiae strains will occur as fermentation progresses from cold-soak to the later fermentation stages in both inoculated and spontaneous fermentations at all three wineries.  (1d) The commercial S. cerevisiae ADY inoculant will be the dominant yeast detected during inoculated fermentation at all three wineries.  14  (1e) Yeast species/strain richness and diversity will be greater in spontaneous than inoculated fermentations during the early, mid, and end stages at all three wineries.  (1f) At each winery, yeast assemblages will differ between the inoculated and spontaneous fermentations.  (1g) Inoculated tanks at QGEW and R13EW will have similar yeast assemblages, whereas at CCEW yeast assemblages will differ between the inoculated tanks of study.  (1h) Each winery will express distinct yeast species/strain assemblages during cold-soak, inoculated, and spontaneous fermentations.  (2a) The 2010 and 2011 vintages at QGEW will exhibit similar yeast assemblages and strain diversities during the inoculated fermentation.  1.8 RATIONALE OF HYPOTHESES I expected support for hypothesis 1a because commercial S. cerevisiae strains tend to be the most prevalent yeast isolated from fermentation when both inoculated and spontaneous fermentations are conducted at a winery (Kluftinger et al., data unpublished; Constanti et al. 1997; Santamaria et al. 2005; Hall et al. 2011), whereas in traditional wine-producing areas, non-commercial indigenous (native) strains tend to dominate when the sole type of fermentation used is spontaneous (Frezier and Dubourdieu, 1992; Le Jeune et al. 2002; Combina at el. 2005; Le Jeune et al. 2006). I expected support for  15  hypothesis 1b because H. uvarum is typically the most commonly isolated nonSaccharomyces yeast during cold-soak (Maro et al. 2007; Barrajón et al. 2009; Clavijo et al. 2011). Other non-Saccharomyces spp. that I expected to observe in lower frequencies include species belonging to Pichia, Wickerhamomyces, Metschnikowia, or Torulaspora genera. I expected support for hypothesis 1c because the succession from nonSaccharomyces yeast to S. cerevisiae yeast during fermentation has been consistently reported in the literature (Combina et al. 2005; Zott et al. 2008; Barrajón et al. 2009; Tello et al. 2011). I expected support for hypothesis 1d because the intention of inoculation is to achieve successful implantation and dominance of the commercial ADY (Barrajón et al. 2009). I expected support for hypothesis 1e because the consensus of the literature suggests that spontaneous fermentation tends not to favour one species/strain over another, which results in a relatively high species/strain diversity (Schutz and Gafner, 1993; Pretorius 2000; Mercado et al. 2007). I expected inoculated and spontaneous yeast assemblages to differ from one another assuming the reasons outlined in hypotheses 1d and 1e are true, thereby supporting hypothesis 1f. I expected support for hypothesis 1g because the same commercial ADY strain was used in each inoculated tank at QGEW and R13EW, and a different commercial ADY strain was added to each of CCEW inoculated tanks. I expected support of hypothesis 1h because the three wineries were located in different regions of the Okanagan Valley and each winery was subjected to different viticulture and vinification practices, which may affect yeast composition (Cordero-Bueso et al. 2011; Tello et al. 2011). I expected to support hypothesis 2a because the two years were identical with respect to ADY inoculants; and viticulture and vinification practices (Cordero-Bueso et al. 2011; Tello et al. 2011).  16  CHAPTER 2: AN ASSESSMENT OF YEAST POPULATION DYNAMICS DURING INOCULATED AND SPONTANEOUS FERMENTATIONS AT THREE LOCAL BRITISH COLUMBIA WINERIES 2.1 SYNOPSIS Inoculated fermentation has been shown to provide a rapid, reliable, and controlled fermentation that facilitates the production of predictable and consistent wine quality while reducing the risk of wine spoilage (Pretorius 2000; Beltran et al. 2002; Santamaria et al. 2005). On the other hand, spontaneous fermentation facilitates the development of a diverse assortment of strains, which may be indigenous to the local region. The presence of various strains in the must is said to generate complexity, sensory attributes unique to the region, and vintage variability in the finished wine product (Maro et al. 2007; Mortimer and Polsinelli, 1999; Pretorius 2000). Interestingly, the assumed inoculated and spontaneous population dynamics described above are not always achieved. In some studies, the ADY inoculant either fail to successfully implant in the must (Barrajón et al. 2009) or appear to behave as competitors able to enter spontaneous and inoculated fermentation tanks (Schutz and Gafner, 1993; Hall et al. 2011; Tello et al. 2011). Commercial S. cerevisiae strains have appeared to: 1) decrease species/strain diversity and richness in spontaneous fermentations (Beltran et al. 2002; Santamaria et al. 2005; Hall et al. 2011); 2) compete against the ADY inoculant (Torija et al. 2001; Lopes et al. 2007; Kluftinger et al., unpublished data; Clavijo et al. 2011); and 3) survive between vintages and re-emerge in the following year’s fermentations (Torija et al. 2001; Beltran et al. 2002; Constanti et al. 2007). These findings solidify the complexity and ignorance of understanding towards inoculated and spontaneous population dynamics during fermentation, and highlight the potentially negative or positive impact they may  17  have on sensory attributes of the finished wine product (Mateo et al. 1991; Santamaria et al. 2005; Blanco et al. 2006).  Unlike other well-studied wine regions of the world, a large-scale comparative assessment of inoculated and spontaneous fermentation population dynamics among multiple Canadian wineries has not been reported in the literature. In order to evaluate the yeast population dynamics in one of Canada’s growing wine regions, a study was conducted to address three main objectives: 1) to assess the population dynamics of wine yeast species and strains in both inoculated and spontaneous Vitis vinifera L. var Pinot noir fermentations of three Okanagan wineries; 2) perform a year-to-year comparison of wine yeast species and strain composition of inoculated var. Pinot noir fermentations between 2010 and 2011 harvests at QGEW; and 3) construct a comparative commercial S. cerevisiae ADY microsatellite database for CCEW and R13EW in order to build onto the already existing QGEW database constructed at UBCO in 2007 (Hall et al. 2011). This third objective allowed for the identification of S. cerevisiae strains from three different wineries.  This present work was novel to Canada by specifically answering the question of which specific yeasts were responsible for conducting inoculated and spontaneous var. Pinot noir fermentations at several local wineries in an operational setting. My results provided fuel for future studies that are interested in determining: 1) whether the age of a winery affects fermenting yeast assemblages; 2) the source(s) of non-inoculant yeasts in  18  fermentation; 3) the rationale for unsuccessful ADY implantation; and 4) how a winery’s yeast microflora affects the sensory attributes of wine.  2.2 MATERIALS AND METHODS 2.2.1 Study sites and experimental design Samples were collected during the 2010 vintage from QGEW, CCEW, and R13EW located in the Okanagan Valley of British Columbia, Canada. Quails’ Gate Estate Winery was established in 1989 and produces on average 55,000 cases of wine annually; CCEW was established in 1983 and produces 40, 000 cases of wine annually; and R13EW was established in 1998 and produces on average 15,000 cases of wine annually. Yeasts were isolated and identified from three inoculated and one spontaneous Vitis vinifera L. varietal (var.) Pinot noir fermentation tanks at each of the three wineries. Four distinct stages of fermentation were sampled, including: cold-soak (CS), early (ER), mid (M), and end (F) stages. Sixteen isolates were identified from each stage, which resulted in the identification of 720 yeast species/strains. Similarly, samples were collected from three inoculated V. vinifera L. var Pinot noir fermentation tanks in 2011 at QGEW during the four fermentation stages described previously. Eight isolates were identified from the cold-soak stage and sixteen isolates were identified from the early, mid, and end stages of fermentation. In total, 168 yeasts were identified in 2011 from the inoculated fermentation tanks.  All equipment involved in the var. Pinot noir winemaking process, including the receiving area, crusher/de-stemmer, and press was located within the winery  19  establishment. The fields/blocks from which var. Pinot noir grapes were harvested, along with other supplemental data, are listed for QGEW (2010) in Table 2-1a; CCEW in Table 2-1b; R13EW in Table 2-1c; and QGEW (2011) in Table 2-2. Some data were unable to be retrieved due to the succession of winemakers between the 2010 and 2011 year at R13EW, which resulted in missing values. The grapes were located in vineyards within 1 km of the winery and were fermented in 5300 L stainless steel vessels (fermentation tanks) at all three wineries. Each tank of study was treated with sulphur dioxide (SO2) after the grapes were harvested, de-stemmed, crushed, and loaded into the fermentation tanks. Dates of SO2 addition are shown in Table 2-1a-c for the 2010 vintage (all three wineries) and Table 2-2 for the 2011 vintage (QGEW). All sampling occurred after the completion of these steps. Prior to early stage sampling, the inoculated tanks of study were inoculated with a commercial ADY strain. It should be noted that nutritional supplements, such as Diammonium phosphate (DAP) and Superfood™, were not added to any of the ADY at time of rehydration. Furthermore, there was no intentional addition of commercial ADY to any of the spontaneous tanks of study.  2.2.2 Collection of samples Approximately 500 mL of var. Pinot noir must samples were collected from each tank at the following fermentation stages: cold-soak, early, mid, and end stages. The coldsoak stage included freshly crushed and SO2 treated var. Pinot noir must soaking with skins, seeds, and stems in its chilled 5300 L stainless steel fermentation tank. Cold-soak samples were collected from those fermentation tanks to be inoculated, after SO2 addition, and prior to any addition of commercial ADY. Cold-soak samples were not collected from  20  the spontaneous tanks; however, the cold-soak samples collected from the fermentation tanks to be inoculated were considered samples representative of the cold-soak stage in the spontaneous fermentation tanks. This is because similar var. Pinot noir blocks (regions of var. Pinot noir growth in the vineyard) used for inoculated fermentations were also used for spontaneous fermentation (Table 2-1a-c). The remainder of the fermentation stages were defined by the °Brix concentration (residual sugar) of the must. Residual sugar concentration of the must correlates with yeast fermentation kinetics. For the inoculated tanks, early stage sampling occurred approximately two days after commercial ADY addition and when the must measured between 10-20 °Brix. An ADY strain was not added to any of the spontaneous tanks, therefore, an early sample was collected from the spontaneous tanks when the must measured between 10-20 °Brix. For both inoculated and spontaneous fermentations, the third sample was taken during the ‘mid’ stage of fermentation when the must measured between 5-15°Brix, and once the must concentration approached 0°Brix, the ‘end’ sample was collected. This was when the fermentation was considered finished. All fermentations lasted approximately 10-20 days in duration. Tables 2-1 and 2-2 show the specific dates and fermentation parameters.  Samples collected from QGEW were obtained from the center of each tank, approximately 0.5 m below the ‘cap’ (a thick top-layer of grape skins, stems, and seeds) using a sterilized stainless steel collecting apparatus. The collection apparatus was first washed in caustic soda (sodium hydroxide), neutralized with citric acid, and then sprayed with 90% denatured ethanol immediately prior to every sample collection. The sample was poured into an autoclaved sterile glass or nalgene bottle that was immediately capped  21  and sealed. Cedar Creek Estate Winery and R13EW samples were obtained from a tank spout located approximately 0.5 m from the surface of the ‘cap’. Prior to collecting the sample, the spout was thoroughly sanitized with 90% denatured ethanol and approximately 500 mL of must were drained through the spout and discarded. This was repeated two times and then approximately 500 mL of must was collected in an autoclaved sterile glass or nalgene bottle and immediately capped and sealed. All samples were collected mid-day after first ‘pump-over’ or ‘punch-down’ had occurred. ‘Pumpingover’ is the process of pumping wine up from the bottom of the tank to the top using a hose, while ‘punch-down’ is the physical pushing of the ‘cap’ back down into the must using a ‘punch-down basket’. Both of these techniques mix the yeast population, help to introduce oxygen to the must, and release carbon dioxide. Samples were collected after either of these two processes in order to ensure the fermenting yeast population was well agitated.  2.2.3 Inoculation At QGEW, all inoculated fermentation tanks were inoculated with the commercial S. cerevisiae ADY strain Lalvin® RC212. The inoculant was rehydrated using the following protocol: 1) yeast was added to 40°C water and stirred gently (2 lb ADY/ 1000 gal H2O (25g ADY / hL H2O)); 2) the mixture was left to stand for 15-30 minutes; 3) the volume of the inoculum (L) was doubled with var. Pinot noir must over a period of 5 minutes; 4) the inoculum/must mixture was added to the tank once its temperature was similar to that of the tanks, followed by pump-over to ensure the ADY inoculant was well dispersed throughout the must in the tank.  22  At CCEW, tank CC-T1 was inoculated with Lalvin® Level L2TD 7013/7315. This was a two-step inoculation. Firstly, non-Saccharomyces species, Toluspora delbrueckii (7013) was added, followed by the addition of S. cerevisiae (strain 7315). Tank CC-T2 was inoculated with the commercial S. cerevisiae ADY strain Enoferm® Assmanshausen (AMH), and tank CC-T3 was inoculated with commercial S. cerevisiae ADY strain Lalvin©RC212. Rehydration was reported as follows: 1) the inoculum was added to 37°C water and left to sit for 15 minutes (2 lb ADY/ 1000 gal H2O (25g ADY / hL H2O)); 2) the inoculum was gently mixed; 3) the volume of the inoculum (L) was doubled with var. Pinot noir must; 4) the inoculum/must mixture was added to the tank followed by punch-down.  At R13EW, all inoculated fermentation tanks were inoculated with commercial the S. cerevisiae ADY strain Lalvin® RC212, using the following protocol: 1) the yeast was added to 40°C tap water and left to sit for 5 minutes; 2) the yeast was gently hand-mixed and left to sit for 10 minutes (2 lb ADY/ 1000 gal H2O (25g ADY / hL H2O)); 3) var. Pinot noir must was added to the yeast/water mixture slowly until the solution dropped by 5°C; 4) the inoculum was aerated and left to sit for 15 minutes; 5) steps 2-4 were repeated until the yeast inoculum was within 5°C of the tank, and then the inoculum/must mixture was added to the tank followed by pump-over.  2.2.4 Yeast isolation All samples were immediately transported back to University of British Columbia (UBCO), where a dilution series (10-1-10-8) was prepared under a Biological Safety  23  Cabinet Class II Type A2, (Plymouth, USA) laminar flow hood (NuAire©). A 0.1mL aliquot of the 10-3 - 10-8 dilution was spread plated onto Yeast Extract Peptone Dextrose (YEPD) nutrient agar containing yeast extract [10 g], peptone [10 g], glucose [20 g] and agar [20 g], and incubated at 28°C for 48-72 hours. This medium allowed for the general growth of wine yeast species. One plate containing 20-300 colonies was selected from the 10-3 - 10-8 dilution series. This plate, used for the random selection of sixteen isolated colonies, represented the yeast assemblage of a tank at a given fermentation stage. NonSaccharomyces and Saccharomyces colonies all grew as round, white, smooth colonies on the YEPD agar; therefore, no bias towards the selection of either species had occurred while selecting isolates for identification purposes.  Each isolate was removed aseptically from the YEPD plate and was streaked onto Wallerstein Laboratory (WL) nutrient agar (pH 5.5, Oxoid Ltd., Hampshire, England, UK). All work occurred under a Biological Safety Cabinet Class II Type A2, Plymouth, USA laminar flow hood. Wallerstein Laboratory medium is a differential medium that allows for the differentiation between Saccharomyces cerevisiae and non-Saccharomyces spp. (Pallmann et al. 2001). The WL plates were incubated for 4 days at 28°C and were subsequently evaluated for non-Saccharomyces and Saccharomyces spp. colony morphology. Saccharomyces spp. grew as a cream colored colony with a darker green, knoblike centre, whereas non-Saccharomyces spp. grew as a flat, shiny, dark green colony on WL agar (Pallmann et al. 2001). The choice of the molecular analysis method (microsatellite analysis or DNA sequencing), performed subsequently to yeast isolation, was dependent on whether the isolate was S. cerevisiae or a non-Saccharomyces spp.  24  Those colonies depicting non-Saccharomyces morphology underwent subsequent DNA sequencing. The yeast species were identified based on homology of their ITS regions using  Basic  Alignment  Search  (http://www.ncbi.nlm.nih.Gov/BLAST)  Tool at  (BLAST) National  (Altschul Centre  for  et  al.  1997)  Biotechnology  Information (NCBI) database. The colonies exhibiting Saccharomyces cerevisiae morphology underwent subsequent microsatellite fingerprint analysis.  2.2.5 Identification of yeast strains and species DNA extraction was performed on all isolates using the recommended protocol of the SIGMA Extract-N-Amp™ DNA Extraction and Dilution kit (Oakville, Canada). One isolated colony from the WL nutrient agar plate was loaded into a 1.5 mL sterile microcentrifuge tube (MCT). Following this, 50 µL of SIGMA Extract-N-Amp™ DNA Extraction solution were added to the tube. The tube was then placed in a MJ Research Engine PTC 200 Peltier Thermal Cycler (Watertown, USA) for 10 minutes at 90°C. Immediately following this, 50µL of SIGMA Extract-N-Amp™ DNA Dilution solution were added. The samples were vortexed, centrifuged (rpm), and stored in a -20°C freezer for future use.  To determine the DNA microsatellite fingerprint of an S. cerevisiae strain, six different hypervariable microsatellite loci were amplified. These loci were specific to the S. cerevisiae genome. The following six primer sets were used: C11, C5, C4, SCAAT1, SCYOR267c, and YPL009c (Legras et al. 2005). These primers were modified to include the M-13 tack-on sequence TCC CAG TCA CGA CGT at the 5’ end of the forward  25  primer (Integrated DNA Technologies Inc., Coralville, USA). The M-13 tack-on sequences were associated with the fluorogenic compounds NED, PET, VIC (Applied Biosystems, Foster City, USA), and 6-FAM (Integrated DNA Technologies, Coralville, USA). The final volume for all microsatellite Polymerase Chain Reaction (PCR) reactions was 12.5 µL, and included the following reagents: 2.5 µL of 5X colorless GoTaq® reaction buffer (Promega©, USA), 1.00 µL of dNTP mix (10mM), 0.20 µL of the appropriate 5’-labelled M-13 tack-on sequence (10 µM), 0.5 µL of the forward primer (1 µM), 0.5 µL of the reverse primer (10 µM), 0.20 µL of each dye (VIC/C11, VIC/SCYOR267c, PET/C5, NED/YPL009c, 6-FAM/SCAAT1, and PET/C4), 0.40 µL of 1% BSA (10mg/mL), 1.25 µL of MgCl2 (25mM), 0.10 µL of GoTaq® DNA Polymerase (Promega©, USA), 1.00 µL of genomic yeast DNA, and 5.55 µL of sterilized milliQ-H2O to make up the volume to 12.5 µL. Amplification was performed in an MJ Research Engine PTC 200 Peltier Thermal Cycler (Watertown, USA), following a three-phase program: 95°C for 10 min (1 cycle), 95°C for 30 secs, 54°C for 1 min, 72°C for 1 min (34 cycles), 72°C for 10 min (1 cycle). Amplification was confirmed by visualizing a 1.5% agarose gel using a Gel Logic 400 Imaging System (Mandel, Rochester, USA). All six amplification products were multi-loaded for fragment analysis by the Fragment Analysis and DNA Sequencing Service (FADSS) at UBCO, which uses an ABI 3130 XL Genetic Analyzer (Applied Biosystems, Foster City, USA). Gene Mapper® 4.0 Software (Applied Biosystems, Foster City, CA, USA) was used to analyze microsatellite fragments.  A comparison of the isolate microsatellite fingerprints to the UBCO commercial S. cerevisiae ADY microsatellite database allowed identification of most yeast isolates;  26  however, some S. cerevisiae isolates were not identified as commercial with this comparison. These isolates were amplified with four additional primers: C3 and C8 (Legras et al. 2005) and YML and SCAAT3 (Field and Willis, 1998; Perez et al. 2001). Primer choice was based on the database constructed by Richards et al. (2009). Richards’ database consists of approximately 75 commercial ADY S. cerevisiae strains, 19 of which are shared with UBCO constructed comparative database. Following DNA analysis, the new genomic fingerprints were compared to the Richards et al. (2009) database in an attempt to attain commercial identity. If the strains were still unidentifiable as a commercial strain, they were titled as ‘unknown’ (UN) S. cerevisiae strains. The final volume for the PCR reactions of these four additional microsatellite loci was 12.5 µL, and included the following reagents: 2.5 µL of 5X colorless GoTaq® reaction buffer (Promega©, USA), 0.50 µL of dNTP mix (10mM), 0.5 µL of the forward primer with attached fluorescent dye (1 µM; C3/FAM, C8/NED, YML/FAM, SCAAT3/NED), 0.5 µL of the reverse primer (10 µM), 0.75 µL of 1% BSA (10mg/mL), 1.25 µL of MgCl2 (25mM), 0.25 µL of GoTaq® DNA Polymerase (Promega©, USA), 1.00 µL of genomic yeast DNA, and 5.25 µL of sterilized milliQ-H2O to make up the volume to 12.5 µL. Amplification was performed in an MJ Research Engine PTC 200 Peltier Thermal Cycler (Watertown, USA), following a three-phase program: 94°C for 3 min (1 cycle), 94°C for 30s, 54°C for 30 sec, 72°C for 1 min (35 cycles), 72°C for 10 min (1 cycle). Amplification visualization (1.5% agarose gel), multi-loading, and fragment analysis by FADSS (UBCO) occurred as previously described.  27  Isolates expressing non-Saccharomyces spp. morphology on WL medium were amplified with the universal primers ITS1f (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns, 1993) and ITS4 (TCCTCCGCTTATTGATATGG) (White et al. 1990);  and  NL1  (5’GCATATCAATAAGCGGAGGAAAAG)  /NL4  (5’GGTCCGTGTTTCAAGACGG) (Maier et al. 2003) (specific to the D1/D2 domain of ITS) to amplify parts of the Internal Transcribed Region (ITS) regions of ribosomal DNA. The final volume for all PCR reactions was 25.0 µL, and included the following reagents: 5.0 µL of 5X colorless GoTaq® reaction buffer (Promega©, USA), 0.50 µL of dNTP mix (10mM), 0.5 µL of the forward primer (either ITS1f or NL1; 10 µM), 0.5 µL of the reverse primer (either ITS4 or NL4; 10 µM), 0.40 µL of 1% BSA (10mg/mL), 2.50 µL of MgCl2 (25mM), 0.25 µL of GoTaq® DNA Polymerase (Promega©, USA), 1.00 µL of genomic yeast DNA, and 14.35 µL of sterilized milliQ-H2O to make up the volume to 25.0 µL. Amplification was performed in an MJ Research Engine PTC 200 Peltier Thermal Cycler (Watertown, USA), following a three-phase program: 94°C for 3 min (1 cycle), 94°C for 1 min, 50°C for 1 min, 72°C for 1 min (40 cycles), and 72°C for 10 min (1 cycle). The amplified products were sent to FADSS, which used the ABI Prism® Big Dye® Terminator v 3.1 Cycle Sequence Kit (Applied Biosystems, Foster City, USA) with a Gene Amp PCR System 9700 (Applied Biosystems, Foster City, USA). An ABI 3130 XL Genetic Analyzer (Applied Biosystems, Foster City, USA) was used for the analysis of the cycle sequence reaction. Prior to submission to UBCO-FADSS for DNA sequencing, the post-PCR product was cleaned using Affymetrix ExoSAP-IT® XP for PCR-Product Clean-Up (Cleveland, USA), following the manufacturer’s instructions.  28  Following post-PCR clean-up and DNA sequencing by UBCO-FADSS, the sequences were imported to Sequencher® 4.6 to form a consensus for each isolate. The yeast consensus sequences were identified based on homology of the ITS regions to those present in NCBI genbank database using the BLAST tool (Altschul et al. 1997) (http://www.ncbi.nlm.nih.Gov/BLAST). The WL medium method for screening nonSaccharomyces and Saccharomyces yeasts spp. was not always accurate. Isolates, appearing as non-Saccharomyces sp. on WL medium were occasionally identified as Saccharomyces cerevisiae upon BLAST analysis. These isolates were then amplified, as previously described, and were submitted for microsatellite fragment analysis in order to attain strain-level identification.  2.2.6 UBCO ADY commercial S. cerevisiae microsatellite comparative database The commercial S. cerevisiae ADY database compiled by Barbara Hall at UBCO in 2007 was used to identify those yeast strains isolated from the samples collected at QGEW (Hall et al. 2011). Hall’s database of S. cerevisiae starter strains included the following: Lalvin® BRL-97, Lalvin® CY3079, Lalvin® RC212, and Lalvin® ICVD254, Red Star® Premium Cuvee (PCuvee), Red Star® Cote des Blancs, and Red Star® Montrachet, Fermol® Arome-Plus (AP), Fermol® Premier Cru, and Fermol® Super 16 and Fermol® Complete Killer. Additionally, two yeast strains were added to this database: Anchor® VIN 13 and SIHA® Active Yeast 7, Riesling Yeast (Kluftinger et al., unpublished data). Together, these yeasts currently encompass all commercial S. cerevisiae ADY strains previously used at QGEW. One pair of strains shared identical microsatellite fingerprints: Lalvin® ICV-D254 and Fermol® Premier Cru. This suggests  29  these strains are identical, yet they were packaged and sold commercially as two different strains (Hall et al. 2011). With respect to this study, one commercial name was used when identifying the strain: Lalvin® ICV-D254.  In the 2010-sampling year, a comparative commercial S. cerevisiae ADY microsatellite database was constructed for both CCEW and R13EW. All commercial S. cerevisiae ADY strains, reported as used by the wineries, were donated by Lallemand®, Lalvin®, AEB-Fermol® Group, Anchor®, and Laffort® yeast companies. The commercial S. cerevisiae ADY strains were donated in a dry form upon arrival at UBCO, with the exception of those yeasts donated by Lallemand®. Yeast shipped from Lallemand® were live cultures growing individually on YEPD slant medium. Prior to DNA extraction and amplification, those ADY yeasts in a dry form were rehydrated as follows: 1.0 g of ADY was added to 10 mL of sterile de-ionized H2O (37°C); the solution was mixed twice, with an interval of 20 minutes between mixings; a dilution series (10-110-8) was prepared and a 0.1 mL aliquot of each dilution was spread plated onto YEPD agar plates in a laminar flow hood (NuAire Biological Safety Cabinets, Class II Type A2, Plymouth, USA); and the plates were incubated at 28°C for 48-72 hours. Live ADY cultures were re-streaked onto YEPD agar in order to achieve the growth of isolated colonies and incubated at 28°C for 48-72 hours. Three isolated colonies from the YEPD plate containing 20-300 colonies underwent DNA extraction and were amplified with the C11, C5, C4, SCAAT1, SCYOR267c, and YPL009c primer sets (Legras et al. 2005), as described earlier. Thus, microsatellite genomic fingerprints were produced for the following strains: Lallemand® W15, Lallemand® L2056, Lallemand® BA11,  30  Lallemand® BM45, Lallemand® D47, Lallemand® QA23, Lallemand® EC118, Lallemand® Syrah, Lallemand® DV10, Lalvin® Level L2TD 7013/7035, AEB® Fermol Blanc, AEB® Fermol Chardonnay, AEB Fermol® Mediterranean, AEB® Fermol Sauvignon, Anchor® Vin 7, Anchor® Exotic, Anchor® NT116, Laffort® Zymaflore FX10, Laffort® Zymaflore VL1, Laffort® Zymaflore VL3, Laffort® Zymaflore RB2, Laffort® Zymaflore RX60, Laffort® Zymaflore X16, Laffort® Zymaflore X5. Table 2-3 lists the commercial S. cerevisiae ADY strains previously used in each of the wineries and the year in which the wineries were established. The microsatellite fingerprints of each strain from all three wineries are listed as the most current commercial S. cerevisiae ADY microsatellite database constructed at UBCO (Table A1) and additional information on the microsatellite loci can be viewed in Table A2.  2.2.7 Data analysis The species/strains isolated from the inoculated and spontaneous tanks were converted to numerical data in frequencies of occurrence. Frequency was determined by dividing the total number of a particular yeast specie or strain by all yeast species and strains present in the inoculated (n=3) and spontaneous (n=1) tanks at each fermentation stage (CS, ER, M, F). In order to evaluate the adequacy of the sampling size for the inoculated and spontaneous tanks throughout the four stages of fermentation, species accumulation curves were calculated using the Mao Tau estimator with EstimateS v.8.2 software (Colwell, 2005) (http://purl.oclc.org/estimates) under the analytical formulas of Colwell et al. (2004). The frequencies of occurrence of species/strains in each tank at each stage sampled was randomized with replacement. The richness estimator used for  31  the species accumulation curves was abundance-based coverage estimator (ACE) along with its 95% confidence limit. This method was chosen because it yielded the expected value of species/strains observed (Sobs) richness for each stage of each tank sampled. To test hypothesis 1e, yeast species/strain richness and diversity of inoculated and spontaneous tank assemblages were assessed using ACE and Simpsons Index (D), respectively. Abundance-based coverage estimator is a richness estimator that computes non-parametric species richness for abundance-based data and was the method of choice because several dominant and some rare species/strains were present in inoculated and spontaneous assemblages (Chao et al. 2000; Chazdon et al. 1998; Colwell 2005). Simpson’s Index (D) is an index of diversity and was used because it is the least sensitive diversity test to the presence of rare species/strains in an assemblage, as opposed to other index of diversity tests (Fisher's alpha, Shannon diversity, exponential Shannon diversity) (Colwell, 2005). The variables and statistics that EstimateS v.8.2 uses to compute ACE and Simpsons Index are as outlined in Colwell (2005) (http://purl.oclc.org/estimates). Both ACE and Simpson’s bootstrap standard deviation (SD) values were included to assess uncertainty in the estimation procedures. To test hypotheses 1f and 1g, a classic abundance-based Bray-Curtis similarity index was generated on the frequencies of occurrence of yeast species/strains present in the inoculated and spontaneous tanks throughout the four sampled stages of fermentation using EstimateS v. 8.2 (Colwell 2005). This method was used to assess similarity of species/strain assemblages between the inoculated and spontaneous tanks using formulas as outlined in Magurran (1988, eq. 5.9), Magurran (2004), and Colwell (2005) (http://purl.oclc.org/estimates).  32  To test hypothesis 1h, non-metric multidimensional scaling (NMS) was used in concert with a permutational multivariate analysis of variance (perMANOVA) using PCORD, version 6 (McCune and Mefford, 1995-2011). NMS is an ordinational method and was used to graphically observe distance between yeast assemblages of inoculated and spontaneous tanks during cold-soak, early, mid, and end stages of fermentation for the three wineries; and of inoculated tanks from two different years at QGEW; therefore, four NMS ordinations were constructed in total. The final NMS ordination graphs were selected based on the following principles: an appropriate number of dimensions (axes), reduced stress levels, and zero instability (McCune and Grace 2002). These principles were selected after an optimization run was performed under the following settings: a Bray-Curtis distance measure, 6 axes, 200 iterations, random start co-ordinations, a stepdown dimensionality of 1.0, instability of 0.0005, and 10 runs with real data. The optimization runs indicated the use of 2 axes for all four ordinations. In order to assess whether the number of axes and corresponding final stress values were obtained by chance, and therefore not useful, a Monte Carlo test was ran (McCune and Grace 2002). “Stress” is a measure of departure from the relationship between the originally calculated p-dimensional space and the ordination points placed in the NMS k-dimensional space (McCune and Grace 2002). Interpreting an ordination with a stress value greater than 20 suggests the ordination points were placed in the k-dimensional space at random with little relation to the original ranked p-dimensional space, and not much reliance should be placed on the details of this plot (Clarke 19993). Following Clarke’s rule of thumb (Clarke 1993), dimensions resulting in stress levels below 5 (excellent representation, no risk of misinterpretation), between 5 and 10 (good with no real chance of drawing false  33  conclusions), and 10-15 (corresponds to a usable ordination) were selected to prevent the interpretation of an ordination where points were placed in k-dimensional space at random. To test whether the observable separation of ordination points among wineries was obtained by chance, a perMANOVA test was performed. This test was performed because parametric statistics would violate normality, independence, and homogeneity of variance. Three out of the four perMANOVAs were based on a one-way design testing for differences among wineries (fixed) at three levels (wineries) for inoculated, spontaneous, and cold-soak assemblages. A fourth perMANOVA was based on a oneway design testing for differences among a single winery (fixed) at two levels (years) for inoculated assemblages. The perMANOVAs distance measure was based on Bray-Curtis dissimilarity. Significance was indicated when a p-value of less than 0.05 was obtained.  2.3 RESULTS 2.3.1 Isolation and identification of yeasts A total of 720 yeasts was isolated from the inoculated and spontaneous fermentation tanks sampled at QGEW, CCEW, and R13EW’s during the 2010 vintage. A total of 168 yeasts was isolated from the inoculated tanks during the 2011 vintage at QGEW. All isolates were identified to the species or commercial strain level, or were designated as a non-commercial ‘unknown’ S. cerevisiae strain. In the 2010 vintage, 240 isolates were identified from each of the three wineries. Yeast species/strain frequencies of occurrence during inoculated and spontaneous fermentation for the 2010 vintage can be observed in Figures 2-1 (QGEW), 2-2 (CCEW), and 2-3 (R13EW). As well, these frequencies can be viewed in table format (Tables A2 and A3). Table A4 includes  34  QGEW’s 2011 inoculated fermentation yeast species/strain frequencies of occurrence. Of these isolates, R13EW had the highest number of S. cerevisiae yeast identified with 196, while QGEW and CCEW had similar amounts with 188 and 189, respectively (Table 24). Except for R13EW’s spontaneous fermentations, species accumulation curves of both spontaneous and inoculated fermentations from all three wineries reached or approached an asymptote (Figures 2-4, 2-5, and 2-6).  Including both inoculated and spontaneous fermentations, the greatest number of different S. cerevisiae strains was detected at R13EW (18 total), followed by QGEW (10 total), and CCEW (9 total). The UBCO comparative commercial S. cerevisiae ADY microsatellite database helped to identify the majority of isolated strains as commercial S. cerevisiae. The use of four additional loci comparable to Richards et al. (2009) database did not appear to sufficiently aid in the identification of non-commercial ‘unknown’ strains as commercial. Cedar Creek Estate Winery had the greatest number of commercial S. cerevisiae strains detected (8 out of 9 were commercial), followed by QGEW (5 out of 10), and then R13EW (3 out of 18) (Table 2-4). At all three wineries, the non-inoculated commercial S. cerevisiae strains isolated from the inoculated and spontaneous fermentations were strains previously used as ADY in other inoculated fermentations in the winery. At QGEW, the five commercial S. cerevisiae strains isolated from the tanks of study include: Lalvin® RC212, Lalvin® ICV-D254, Lalvin® CY3079, AEB® Fermol AP, and Red Star® PCuvee. At CCEW, the eight commercial S. cerevisiae strains isolated from the tanks of study include: Lalvin® RC212, Lalvin® ICV-D254, Lallemand® D47, Lallemand® EC1118, Lallemand® Rhone L2056, Enoferm® AMH, Zymaflore X5,  35  FX10, and VL1. At R13EW, the three commercial S. cerevisiae strains isolated from the tanks of study include: Lalvin® RC212, Lallemand® Rhone L2056, and Lallemand® EC1118.  During inoculated and spontaneous fermentations, the dominant commercial S. cerevisiae strains detected at QGEW and CCEW were Lalvin® ICV-D254 and Lalvin® RC212. Two additional commercial S. cerevisiae strains were also predominantly isolated at CCEW, and include: Lallemand® D47 and Zymaflore X5. Commercial S. cerevisiae strains Lalvin® RC212 and Lalvin® ICV-D254 appeared to co-ferment in almost equal ratios during the early and mid stages of inoculated and spontaneous fermentation at QGEW and CCEW. Lalvin® ICV-D254 was the prevalent strain isolated at the end of fermentation at these wineries. Unlike QGEW and CCEW, Lalvin® ICV-D254 was not isolated at R13EW. It should be noted that Lalvin® ICV-D254 has no history of use at R13EW. The major commercial S. cerevisiae strain isolated at R13EW was Lalvin® RC212.  The comparative microsatellite databases assisted in identifying the majority of S. cerevisiae strains. Nevertheless, there were still several strains that remained unidentifiable as commercial at all three wineries, especially at R13EW. Road13 Estate Winery had the greatest number of different non-commercial ‘unknown’ S. cerevisiae strains (15 total) (Table 2-4). The majority of these strains was isolated from the spontaneous fermentation tank (R13-W). All of the non-commercial ‘unknown’ strains were unique to their winery and were abbreviated as QG-UN01 through QG-UN05 for  36  QGEW, CC-UN01 for CCEW, and R13-UN01 through R13-UN15 for R13EW. It should be noted that the non-commercial ‘unknown’ S. cerevisiae strains were isolated at low frequencies of occurrence in comparison to commercial S. cerevisiae strains. Thus, the majority of S. cerevisiae yeasts detected in inoculated and spontaneous fermentations were commercial at all three wineries, with the exception of R13EW’s spontaneous fermentation. Non-Saccharomyces yeasts were identified by DNA sequencing and included Henseniaspora uvarum (anamorph Kloeckera apiculata), Pichia anomala, Wickerhamomyces anomalus, Metschnikowia pulcherrima, Metschnikowia fructicola, Torulaspora delbrueckii, or as non-cerevisiae Saccharomyces species including Saccharomyces uvarum and Saccharomyces bayanus.  2.3.2 Succession of non-Saccharomyces and S. cerevisiae yeasts At all three wineries, the major yeasts present during the cold-soak stage of fermentation were non-Saccharomyces spp. followed by the succession and dominance of S. cerevisiae into the early, mid, and end stages of inoculated and spontaneous fermentation. In particular, the dominant non-Saccharomyces sp. isolated at all three wineries was H. uvarum. At QGEW, H. uvarum was the only yeast isolated during coldsoak, whereas at CCEW and R13EW, rare isolates of P. anomala, W. anomalus, M. pulcherrima or M. fructicola, and T. delbrueckii were observed. Non-Saccharomyces yeasts extended past the cold-soak stage of fermentation in some cases. This occurred in the early and mid stages of fermentation in the following tanks: QG-T2 (Fig. 2-1b), QGW (Fig 2-1d.), CC-T3 (Fig 2-2c), R13-T2 (Fig. 2-3b), and R13-T3 (Fig. 2-3c). However, the frequencies of occurrence of non-Saccharomyces spp. during the early and mid stages  37  of fermentation in the latter tanks were low in comparison to the S. cerevisiae population. Non-Saccharomyces yeasts were never isolated from the end stage of fermentation. At CCEW, commercial S. cerevisiae strains Lalvin® ICV-D254 and Zymaflore® X5 were isolated during cold-soak. At R13EW, Lalvin® RC212 was isolated during cold-soak. No S. cerevisiae strains were isolated from the cold-soak stage at QGEW (Figure 2-1). The only tank that had a high detection of S. cerevisiae during the cold-soak stage of fermentation was tank R13-T3 at R13EW. Saccharomyces cerevisiae comprised 40% of the yeast population at the time of cold-soak sampling in this tank (Figure 2-3c). Saccharomyces bayanus and Saccharomyces uvarum were isolated at low frequencies of occurrence during the early stage of fermentation at CCEW and R13EW, but were never isolated from QGEW.  2.3.3 Detection of the commercial ADY inoculant At all wineries, non-inoculant yeasts were present during inoculated fermentation. At QGEW, Lalvin® RC212 was the commercial ADY used in all three inoculated fermentation tanks. Lalvin® RC212 was the dominant strain detected in tank QG-T3 during the early and mid stages of fermentation (≥ 80%), but declined to 69% at the end of fermentation (Figure 2-1c). In tank QG-T1, Lalvin® RC212 was detected at a frequency of 25% at the early stage of fermentation and dropped to 19% at the end stage of fermentation (Figure 2-1a). In QG-T2, Lalvin® RC212 was detected at a frequency of 25% at the early stage of fermentation and dropped to 13% at the end stage of fermentation (Figure 2-1b). Non-inoculant commercial S. cerevisiae strains were detected in all three inoculated tanks, mainly Lalvin® ICV-D254. This strain was persistently  38  isolated and found to co-ferment with other non-commercial and commercial S. cerevisiae strains in the must, including the ADY inoculant. Although the addition of a commercial ADY inoculant occurred, all inoculated fermentations at QGEW appeared to express mixed species/strain assemblages.  At CCEW there was partial-to-zero detection of the three different ADY inoculants used in each of the three inoculated tanks. In tank CC-T1, the ADY inoculant Lalvin® Level L2TD strain 7013 was never isolated. Only T. delbrueckii (strain 7315) was isolated from this two-step inoculant at a frequency of 25% during the early stage of fermentation (Figure 2-2a). In tank CC-T2, the ADY inoculant Enoferm® AMH was isolated during the early stage of fermentation at a frequency of 6% and then never again (Figure 2-2b). In CC-T3, the ADY inoculant Lalvin® RC212 was isolated at a frequency of 56% at the early stage of fermentation and then dropped to 31% at the end stage of fermentation (Figure 2-2c). Similar to QGEW, the remainder of fermentation was carried out by non-inoculant commercial S. cerevisiae strains, in particular Lalvin® ICV-D254, and all inoculated fermentations expressed mixed species/strain assemblages even though an ADY inoculant strain was added. Again, Lalvin® ICV-D254 was persistently detected in fermentation. Other non-inoculant strains frequently isolated from CCEW’s inoculated fermentations include: Lalvin® RC212 (when not used as the ADY inoculant), and Lallemand® D47, and/or Zymaflore X5.  In contrast with QGEW and CCEW, frequent detection of the commercial ADY inoculant was observed in R13EW’s inoculated fermentations. The ADY inoculant,  39  Lalvin® RC212, was detected at a frequency of ≥80% throughout the entirety of fermentation (Figure 2-3a-c). The only exception to this observation was seen in tank R13-T2, where the Lalvin® RC212 was isolated at a frequency of 63% at the early stage of fermentation but then regained dominance to 81% and 100% during the mid and end stages of fermentation, respectively (Figure 2-2b). The S. cerevisiae populations of R13EW’s inoculated tanks were similar to each other and there were no major commercial S. cerevisiae strains present with a frequency of ≥80% except for the inoculant.  2.3.4 Comparison of species/strain diversity and richness between spontaneous and inoculated fermentations The diversity and richness of spontaneous fermentation was similar or less than that of inoculated fermentation at both QGEW and CCEW, whereas at R13EW, spontaneous fermentation appeared to have a greater diversity and richness than inoculated fermentation (Table 2-5a-c). At QGEW and CCEW, the spontaneous S. cerevisiae population was largely commercial except for the presence of two noncommercial ‘unknown’ strains (QG-UN01 and QG-UN03), which were isolated at relatively low frequencies in tank QG-W (Figure 2-1). Lalvin® ICV-D254 and Lalvin® RC212 were the dominant commercial strains detected at approximately equal ratios throughout the spontaneous fermentation at QGEW (Figure 2-1d). Similarly, Lalvin® ICV-D254 was also the dominant strain detected in CCEW’s spontaneous fermentation and found co-fermenting with Lalvin® RC212 at approximately equal ratios during mid and end stages of fermentation (Figure 2-2d). Unlike QGEW and CCEW, the  40  spontaneous fermentation at R13EW was not performed by several dominant commercial S. cerevisiae strains. Instead, the fermentation was carried out by a diverse assortment of non-commercial ‘unknown’ S. cerevisiae strains with no one particular strain dominating fermentation (Figure 2-3d). A commercial strain was detected in R13EW’s spontaneous tank (Lalvin® RC212), but at a relatively low frequency in comparison to the ‘unknown’ S. cerevisiae strains.  2.3.5 Comparison of yeast assemblages between wineries Road13 Estate Winery’s inoculated fermentation tanks shared the greatest similarity between one another throughout fermentation (≥ 80% in most cases) (Table 26c), while the inoculated tanks at QGEW shared, on average, shared only 50-70% similarity throughout the fermentation. This result was observed even though the same ADY inoculant was added to each tank (Table 2-6a). Cedar Creek Estate Winery’s inoculated tanks shared between 30% to 80% similarity throughout fermentation in most cases (Table 2-6b) even though a different ADY inoculant was added to each tank of study. Additionally, both QGEW and CCEW’s spontaneous tanks shared 40% to 70% similarity with their inoculated tanks throughout fermentation (Tables 2-6a and b) wherease Road13 Estate Winery’s spontaneous tank shared the least similarity with the inoculated fermentation tanks (≤ 25%) (Table 2-6c).  A non-metric multidimensional scaling (NMS) ordination of yeast species/strain communities detected in the inoculated fermentation tanks from QGEW, CCEW, and R13EW resulted in a 2D solution with a final stress value of 15.90 (Figure 2-7). Axis 1  41  represented 23.7% of the variation, while axis 2 represented 48.4% of the variation, for a total of 72.1%. Tanks belonging to a given winery appeared to cluster together and away from other wineries. A similar pattern was observed upon performing an NMS ordination on the three winery’s spontaneous fermentation tanks (Figure 2-8b: 2D; final stress of 0.096; axis 1 = 64.9% of variation; axis 2, 15.0% of variation; total variation = 79.9%). Furthermore, an NMS ordination of cold-soak yeast communities expressed clustering of tanks based on winery in a similar fashion (Figure 2-9: 2D; final stress = 12.37; axis 1 = 46.3% of variation; axis 2 = 34.2% of variation; total variation = 80.5%). The NMS ordination perMANOVAs yielded p-values of: 0.002 (Inoculated tanks- Figure 2-7); 0.003 (Spontaneous tanks- Figure 2-8); and 0.003 (cold-soak stage- Figure 2-9).  2.3.6 Comparison of inoculated yeast populations between 2010 and 2011 vintages at Quails’ Gate Estate Winery A total of 192 and 168 isolates were identified from three inoculated tanks during the 2010 and 2011 vintages, respectively. In both years, the dominant yeast detected during cold-soak was non-Saccharomyces species, H. uvarum, and the dominant yeast detected during early, mid, and end stages of inoculated fermentation was commercial S. cerevisiae yeast. There were four similar commercial strains detected between the two years and they included: Lalvin® RC212, Lalvin® ICV-D254, AEB® Fermol AP, and RedStar® PCuvee. Three additional ‘unknown’ strains, not detected in 2010, were isolated in the 2011 vintage and titled as QG-UN06 through QG-UN08 (Table A4). The persistent detection of Lalvin® ICV-D254 in the 2010 vintage was also observed in the 2011 vintage; however, it appeared as if the frequency of Lalvin® ICV-D254 decreased  42  slightly in the 2011 vintage. In the 2010 vintage, Lalvin® ICV-D254 was isolated in all three inoculated tanks in frequencies of up to 75%, while in the 2011 vintage Lalvin® ICV-D254 was isolated in only two out of the three inoculated tanks in frequencies of up to 56% (Table A4). The NMS ordination of QGEW 2010 and 2011 inoculated fermentation tanks resulted in a 2D solution with a final stress value of 9.27 (Figure 2-10). Axis 1 represented 54.4% of the variation, while axis 2 represented 17.8% of the variation, for a total of 72.2%. The NMS ordination did not result in a distinct separation between tanks based on vintage. The perMANOVA for this NMS ordination (Figure 210) yielded a p-value of 0.110. The perMANOVA DF, SS, pseudo F-test, and p-values can be viewed in Table 2-7.  2.4 DISCUSSION 2.4.1 Species/strain accumulation curves and study sample size In order to assess whether the number of isolates identified during the 2010 and 2011 vintages was adequate in representing the yeast population at the time of sampling, species accumulation curves were generated. All three wineries species accumulation curves either reached an asymptote, or appeared to be approaching an asymptote, with the exception of R13EW’s spontaneous species accumulation curve. The finding that R13EW’s spontaneous species accumulation curve did not approach an asymptote suggests that there were additional species/strains of yeast that were not isolated and that the sampling size could have been increased in order to better represent the fermenting population. Nevertheless, it is likely that any additional strains recovered from a more intensive sampling would be relatively rare and would not be dominant strains. Various  43  sampling sizes have been reported within the literature. For example, the isolation and identification of 8, 12, and 30 isolates at time of sampling have been reported by Hall et al. (2011), Pulvirenti et al. (2009), and Schuller and Casal (2007), respectively. It appears that Hall et al. (2011) is the only one of these studies that constructed wine yeast species accumulation curves in order to confirm adequate sampling size. The lack of a universal sampling size and the failure of authors to generate species accumulation curves make it difficult to determine what the most appropriate sampling size is in order to accurately represent the yeast population. Based on my species accumulation curves, this study’s sampling size appears to detect the major yeast population present during fermentation. In some cases, particularly the spontaneous fermentations at R13EW, the number of isolates identified from each stage of fermentation could have been increased to better represent the true yeast community at time of sampling. It could be suggested that for future studies, the sampling size be anywhere between 24 to 32 isolates.  2.4.2 The effectiveness of microsatellite DNA analysis and comparative commercial ADY databases Microsatellite analysis was an efficient and accurate tool for discriminating between strains of S. cerevisiae. Studies that used microsatellite loci as the molecular screening method reached similar conclusions (Techera et al. 2001; Schuller et al. 2004; Schuller and Casal, 2007; Hall et al. 2011). The majority of the S. cerevisiae strains were successfully identified as commercial using the UBCO database that encompasses all commercial yeast as reported previously used at each of the three wineries. Amplifying the ‘unknown’ S. cerevisiae strains with four additional loci (C3, C8, YML, SCAAT3)  44  and comparing these fingerprints to the Richards at al. (2009) database did not appear to improve the identification of  non-commercial ‘unknown’ S. cerevisiae strains as  commercial.  The detection of ‘unknown’ S. cerevisiae strains in this study may be due to several factors. Firstly, these non-commercial ‘unknown’ strains could, in-fact, be commercial strains. The comparative databases used in this study do not encompass all commercial S. cerevisiae strains on the market. There are over 200 different strains of commercial S. cerevisiae on the market and the two databases utilized in this study (Richards et al. (2009) and UBCO comparative database) encompass approximately 90 of these strains; therefore, the non-commercial ‘unknown’ strains may have gone unidentified as ‘commercial’ if the necessary commercial fingerprint was not available for comparison in this study.  Secondly, the winemaker’s report of commercial S.  cerevisiae utilization in the winery may not be accurate. All three wineries have gone through several different winemakers, and records of commercial yeast usage may not be accurate, building onto the first point. Thirdly, the non-commercial ‘unknown’ strains may be indigenous strains. Indigenous yeasts are non-Saccharomyces or Saccharomyces yeasts originating from the local region of the winery. For this study, commercial S. cerevisiae  strains or commercial non-Saccharomyces spp. were not considered  indigenous yeasts to the wineries of study nor to the Okanagan wine region. It was not confirmed whether the non-commercial ‘unknown’ S. cerevisiae strains were indigenous; therefore, they were considered non-commercial ‘unknown’ yeast as opposed to indigenous (native). Further investigation is required to determine whether these non-  45  commercial ‘unknown’ S. cerevisiae strains are indigenous yeast. Determining whether the non-commercial ‘unknown’ S. cerevisiae strains are indigenous may be facilitated upon the construction of a complete commercial S. cerevisiae microsatellite database, which encompasses all commercial strains available on the market.  2.4.3 Commercial S. cerevisiae yeast dominate fermentation We accepted hypothesis 1A at all wineries, except for R13EW’s spontaneous fermentation where commercial strains were relatively rare. There have been similar reports of commercial S. cerevisiae as the dominant yeasts present in fermentation whenever there was a history of their use in the winery (Beltran et al. 2002; Clavajio et al. 2011; Hall et al. 2011). Also, Cedar Creek Estate Winery appeared to have the greatest number of different commercial S. cerevisiae strains isolated from inoculated and spontaneous var. Pinot noir fermentations in comparison to QGEW and R13EW. Perhaps this was due to CCEW reporting the greatest number of different commercial ADY strains used in the past, and therefore facilitating the increased commercial diversity in active fermentations (31 different strains were previously used at CCEW, whereas 12 and 7 were used at QGEW and R13EW, respectively).  Two additional Saccharomyces species were isolated from CCEW and R13EW, including S. uvarum and S. bayanus. Because neither of these species have been introduced into either of the wineries in a commercial ADY form, these species can be considered indigenous (native) to the wineries. These species also play a role in wine fermentation, but to a lesser extent than S. cerevisiae. Saccharomyces uvarum and  46  S. bayanus have been described as relatively similar to each other with regard to their oenological effects on the wine, but differ significantly from S. cerevisiae from an oenological stand point (Magyar and Toth, 2011). Generally, they produce less acetic acid and ethanol than S. cerevisiae, have different organoleptic properties, and are slower fermenters (Magyar and Toth, 2011).  There were several specific commercial S. cerevisiae strains frequently detected at all three wineries. The main commercial strains detected at QGEW and CCEW were Lalvin® ICV-D254 and Lalvin® RC212. The main commercial strain detected at R13EW was limited to Lalvin® RC212. At all three wineries, Lalvin® RC212 was used as an ADY inoculant, so a large detection of this strain was not surprising. What was interesting, however, was that Lalvin® ICV-D254 was found in both inoculated and spontaneous fermentations at often similar ratios with Lalvin® RC212 at QGEW and CCEW, although it was a strain never intentionally added to any of the tanks of study. Similar results with these two strains were also observed in 2007 and 2009 at QGEW (Kluftinger et al., unpublished data; Hall et al. 2011). This observation was not noted at R13EW and is most likely due to Lalvin® ICV-D254 not having a history of use at R13EW. Perhaps the observation of Lalvin® ICV-D254 and Lalvin® RC212 commonly fermenting together is due to an unknown symbiotic relationship. Or, perhaps its due to genetic/genomic differences of Lalvin® ICV-D254 correlating to enological properties (Sipiczki 2011) that better able it to persist in a majority of fermentations, opposed to other strains. However, further investigation is required to support the latter two suggestions.  47  Non-commercial ‘unknown’ S. cerevisiae strains were isolated at each of the three wineries, but at a lower frequency in comparison to commercial S. cerevisiae. The isolation of non-commercial ‘unknown’ S. cerevisiae strains in inoculated and spontaneous fermentation has been reported elsewhere in the literature despite the winery’s use of commercial yeast (Constanti et al. 1997; Mercado et al. 2007). The noncommercial ‘unknown’ S. cerevisiae strains isolated from QGEW, CCEW, and R13EW were unique for each winery. Thus, a non-commercial ‘unknown’ S. cerevisiae strain, representative of the Okanagan wine region, was not detected. Two separate studies conducted in Spain and Portugal also failed to isolate similar non-commercial S. cerevisiae strains upon the assessment of wine yeast across a wine region (Pulvirenti et al. 2009; Schuller et al. 2012). On the other hand, Beltran et al. (2002) and Vilanova et al. (2011) reported the isolation of similar non-commercial S. cerevisiae strains from different wineries located in the same wine region.  Road13 Estate Winery had the greatest number of different non-commercial ‘unknown’ S. cerevisiae profiles detected (15 total) in comparison with QGEW (5 total) and with CCEW (1 total). The majority of R13EW’s non-commercial ‘unknown’ S. cerevisiae strains were isolated from the spontaneous fermentation tank (R13-W). The only time non-commercial ‘unknown’ S. cerevisiae strains out-numbered commercial S. cerevisiae strains was in R13EW’s spontaneous fermentation. All other fermentations were dominated by commercial S. cerevisiae at each of the three wineries. The elevated number of different non-commercial ‘unknown’ profiles detected at R13EW may, in part, be due to the age of the winery and the number of different commercial strains used in  48  its’ history. Road13 Estate Winery’s first vintage was 1998 and is the youngest of the three wineries (QGEW, 1989; CCEW, 1983). Also, R13EW reported utilizing the least amount of different commercial strains compared to QGEW and CCEW. Perhaps a commercial S. cerevisiae microflora is better established within older wineries or those wineries that use a large number of different commercial yeasts. These factors may possibly play a role in the presence of multiple commercial strains in the must, which in turn, suppress the development of a winery’s indigenous yeast microflora (Clavija et al. 2011b). For example, a winery using commercial ADY strains reported that as the winery became older, the isolation of commercial S. cerevisiae strains increased and indigenous strains decreased in spontaneous fermentations (Santamaria et al. 2005).  The non-commercial ‘unknown’ S. cerevisiae strains isolated from QGEW, CCEW, and R13EW may be due to several factors. As previously mentioned, they may be commercial strains with an unreported history in the winery. Furthermore, the noncommercial ‘unknown’ isolates may also be a result of commercial yeast mating, meiotic, and sporulation events creating mutant recombinants no longer recognizable as commercial strains. The changing genetic structure of the S. cerevisiae population is defined by fast adaptive genome evolution (FAGE). The FAGE model suggests that yeast cells undergo multiple successive series of genomic rearrangements during vegetative growth and conjugation-meosis-sporulation events (Sipiczki 2010). Diverse assortments of genetic profiles and naturally evolving populations during fermentation have been reported (Mortimer, 1999; Cavalieri et al. 2003; Clavijo et al. 2011b) and may be due to these genetic events. The plasticity of the S. cerevisiae genome allows adaptation of  49  yeast populations to the ever-changing fermentation environment. It promotes genetic differentiation and changes in allele frequencies among subpopulations (Schuller and Casal, 2007; Sipiczki 2010). Genetic rearrangements can occur through a variety of mechanisms, one of which is homologous recombination and may be stimulated by a variety of factors, such as: ethanol levels, acetaldehyde concentrations (Ristow et al. 1995; Infante et al. 2003), and nutrient starvation (Sipiczki, 2010). These recombination events lead to gross chromosomal rearrangements and genetically unique individuals (Boeke, 1989; (Mieczkowski et al. 2006) and may have an impact the final sensorial properties of the wine (Sipiczki, 2010).  2.4.4 Non-Saccharomyces spp. and S. cerevisiae succession In support of my hypotheses 1b and 1c, the major yeasts detected during coldsoak at all three wineries were non-Saccharomyces species, followed by the succession and detection of S. cerevisiae into the early, mid, and end stages of fermentation. Henseniaspora uvarum was the most frequently detected non-Saccharomyces species at all three wineries during cold-soak. This suggests that H. uvarum is indigenous to the vineyards of the Okanagan wine region because it has not been introduced to the wineries in a commercial form; therefore, it can be thought to have developed naturally and is thus indigenous, or native, to the Okanagan. Other studies have also reported H. uvarum being the major non-Saccharomyces species present at the time of cold-soak (Maro et al. 2007; Barrajón et al. 2009; Clavijo et al. 2011). Unlike QGEW, where the only nonSaccharomyces species isolated during cold-soak was H. uvarum, CCEW and R13EW had the presence of species belonging to the genera Pichia, Tolurospora, Metschnikowia,  50  and Wickerhamomyces. Like H. uvarum, species belonging to these genera can also be considered indigenous (native) yeasts of the Okanagan wine region as they too have not been introduced to the wineries in a commercial form, with the exception of Tolurospora sp. detected at CCEW since it was used in a commercial ADY form in the past at this winery. These species are often detected during fermentation but were isolated at lower frequencies than H. uvarum (Combina et al. 2005; Maro et al. 2007; Ocon et al. 2010). Furthermore, it should be noted that SO2 was added to each of the tanks of study at all three wineries immediately prior to commencement of cold-soak. Sulfur dioxide (SO2) is added at the initial stages of red wine production in order to help suppress the development of spoilage bacteria or hyphal-growing fungi. This treatment may also negatively impact the development of non-Saccharomyces species in the initial stages of fermentation; however, it appears that at least a portion of the non-Saccharomyces species remained viable at all three wineries.  Non-Saccharomyces spp. were also detected beyond cold-soak and into the early and mid stages of fermentation in several inoculated and spontaneous tanks at all three wineries. The species detected beyond cold-soak included H. uvarum, and Pichia, Tolurospora, Metschnikowia, and Wickerhamomyces spp., comparable to other studies conducted elsewhere in the world (Torija et al. 2001; Barrajón et al. 2009; Li et al. 2011). It has been suggested that non-Saccharomyces species belonging to Hanseniaspora (Kloeckera), Candida, Metschnikowia, and Pichia can survive into the early and mid stages of fermentation even when the ethanol rises to 3-4%. This prolonged activity is attributed to their ability to withstand elevated ethanol concentrations (Pretorius, 2000).  51  Detection of non-Saccharomyces spp. into the later stages of fermentation may affect the final sensory characteristics of the wine. Studies suggest that non-Saccharomyces species produce an array of secondary metabolites; therefore, their prolonged presence in the medium may significantly enhance the overall complexity and sensorial properties of wine (Ciani and Maccarelli, 1998; Fleet 2003; Ocon et al. 2010).  As fermentation progressed, S. cerevisiae began to displace the nonSaccharomyces population and became the dominant yeast detected during the early, mid, and end stages of fermentation at all three wineries. In the inoculated tanks, this succession was encouraged by the addition of the ADY inoculant. However, in the spontaneous tanks at all three wineries, non-commercial ‘unknown’ and commercial S. cerevisiae strains were detected during early, mid, and end stages of fermentation without their intentional addition. It should also be noted that besides the ADY inoculant, noncommercial ‘unknown’ and commercial S. cerevisiae strains were also isolated from the inoculated tanks of study, although never intentionally added. The detection of these noninoculated S. cerevisiae strains is likely due to the presence of non-commercial ‘unknown’ and commercial S. cerevisiae strains on the winery’s equipment, walls, and surfaces where they establish as resident yeast microflora, particularly in relatively old wineries (Martini 1993; Ciani et al. 2004; Clavijo et al. 2010). Based on the literature, it can be assumed that the S. cerevisae microflora of all three wineries has become well developed over the 14 years plus that they have been in operation. The continuous exposure of the must to tools, winery surfaces, people, and the airborne entrance of yeasts into the must may explain the imposition of non-commercial ‘unknown’ and commercial  52  S. cerevisiae strains without intentional inoculation. Furthermore, it should be noted that non-commercial ‘unknown’ and commercial S. cerevisiae was isolated from the coldsoak stage of fermentation, but at low frequency of occurrence in comparison with the non-Saccharomyces spp. population. The only tank that had a strikingly high proportion of S. cerevisiae strains to non-Saccharomyces species in the cold-soak stage of fermentation was R13EW’s tank, R13-T3. In this tank, commercial strain Lalvin®RC212 and two additional ‘unknown’ S. cerevisiae strains represented approximately 40% of the yeast population during cold-soak. Perhaps this tank was exposed by some unintentional means to a source of S. cerevisiae (e.g- dirty tools, un-sanitized tank surfaces). Further investigation is necessary in order to determine the source of non-inoculant S. cerevisiae strains by performing a large-scale sampling of winery equipment, surfaces, and air.  2.4.5 Implantation of the commercial ADY inoculant Hypothesis 1d was fully supported by the successful implantation of the ADY inoculant at R13EW; however, this hypothesis was not supported by the results obtained from QGEW and CCEW since the commercial ADY inoculant was not necessarily the dominant yeast detected in inoculated tanks. Mixed strain population dynamics were observed throughout the early, mid, and end stages of inoculated fermentation at these wineries. Effective inoculation is achieved when 80% of the population is composed of the ADY inoculant (Delteil et al. 2001; Barrajón et al. 2009). The only winery that had successful implantation was R13EW. Both CCEW and QGEW had ADY implantation ranging from approximately 6 to 80%. At CCEW, there were some instances where noninoculant commercial strains displaced the ADY inoculant entirely, as observed in tanks  53  CC-T1 and CC-T2. Interestingly, relatively low ADY implantation was also observed in the three inoculated Pinot noir fermentations studied at QGEW in 2009 (Kluftinger et al., unpublished data) and similar results have been reported in other studies (Constanti et al. 1997; Barrajón et al. 2009; Tello et al. 2011). Further research is necessary to determine whether low implantation of the inoculum is a common occurrence at wineries of the Okanagan similar to QGEW and CCEW, or whether implantation is successful resembling the results obtained from R13EW.  Improper ADY inoculant rehydration or competition factors are proposed explanations of this phenomenon (Barrajón et al. 2009). Effective implantation of the commercial ADY inoculant depends on a variety of factors, including: dosage, temperature, water hardness, osmotic stress, residual sugar concentration, agitation, nutrient availability, and rehydration duration (Soubeyard et al. 2006; Barrajón et al. 2009). Improper rehydration or poor must conditions, such as limited nutrient availability, may negatively impact the viability, implantation, and fermentation behavior of the inoculant, and therefore, decrease its presence and isolation from the must (Soubeyard et al. 2006). All three wineries reported that the manufacturer’s instructions for rehydration of the ADY inoculant were closely followed and they added nutrients to the must in the form of DAP and Superfood™. This should have promoted the successful establishment and dominance of the inoculant within the must. Since this was rarely observed, except at R13EW, competition between the inoculant and the winery’s resident microflora could partially explain the low implantation of the ADY inoculant (Schutz and Gafner, 1993). As discussed previously, the ability of other S. cerevisiae strains to enter  54  inoculated fermentation tanks is very probable. Yeasts are able to survive on winery surfaces for extended periods of time and between vintages. Thus, they may enter tanks via airborne transfer or by contacting the must with winery machinery or tools (Constanti et al. 1997; Torija et al. 2001; Valero et al. 2005; Garijo et al. 2008). The ease with which non-inoculant S. cerevisiae strains entered and established within the ferments may have subjected the inoculant to competition, and this may have prevented it from achieving full dominance in the must. The unsuccessful implantation of the ADY inoculant may also be due to a large diversity of strains present in the must immediately prior to inoculation. A study performed by Clavijo et al. (2011) sampled the must immediately prior to inoculation and observed an already well-established population of different S. cerevisiae strains. Similar to my study, the ADY inoculant was present but was not dominant (Clavijo et al. 2011). Perhaps at R13EW, a limited number of S. cerevisiae strains was present in the must immediately prior to inoculation. This may have fostered successful implantation of the ADY inoculant due to decreased competitive factors, whereas the opposite may have been true for QGEW and CCEW. Although the must was not sampled immediately prior to the addition of the inoculant at any of the wineries, sampling of this stage is highly recommended for future studies. The importance of this stage is highlighted by the following finding: Lalvin® ICV-D254 was detected at small frequencies during cold-soak in two of the inoculated tanks at CCEW (CC-T1 and CCT2). Then, Lalvin® ICV-D254 was largely present thereafter and the inoculant was detected at low frequencies. It may have been that between the time of cold-soak and inoculant addition, Lalvin® ICV-D254 increased in number, thus contributing to unsuccessful implantation of the commercial ADY strain. Detection of mixed-strain  55  fermentation is well reported in the literature and provides insight towards the complex yeast population dynamics during fermentation, even when inoculated with a commercial ADY strain (Schutz and Gafner, 1993; Beltran et al. 2000; Mercado et al. 2007).  2.4.6 Species/strain diversity and richness of spontaneous fermentation The spontaneous fermentation at R13EW appeared to have greater species/strain diversity of non-commercial yeast than the inoculated fermentations. In contrast, QGEW and CCEW species/strain diversity and richness from the spontaneous fermentations appeared to be similar or less than inoculated fermentations. Furthermore, the spontaneous fermentation populations at QGEW and CCEW were composed of similar commercial yeast that were present in the inoculated fermentations, as opposed to noncommercial yeast. Therefore, hypothesis 1e was not supported at QGEW and CCEW, while it was fully supported at R13EW. Different studies have shown that spontaneous fermentation can promote the development of a diverse assortment of indigenous yeasts in the fermenting must. This often achieves relatively high species/strain diversity, as opposed to the dominance of fermentation by commercial yeast (Pretorius 2000; Torija et al. 2001). Concerns that commercial yeast will compete with and dominate over indigenous yeast have been raised by those wineries that use commercial ADY (Maro et al. 2007; Csoma et al. 2010; Tello et al. 2011). This is because the isolation and persistence of commercial yeast in the spontaneous tanks of wineries that utilize commercial ADY for inoculated fermentations have been well reported within literature (Constanti et al. 1997; Beltran et al. 2000; Hall et al. 2011). A winery that never used  56  commercial ADY reported relatively high indigenous species/strain diversity compared with those wineries that used commercial ADY (Torija et al. 2001).  Commercial S. cerevisiae strains were the dominant yeast detected in both QGEW and CCEW’s spontaneous tanks. In particular, the dominant commercial S. cerevisiae strain noted in both QGEW and CCEW’s spontaneous fermentations was Lalvin® ICVD254. Interestingly, there was a relatively large occurrence of Lalvin® ICV-D254 in QGEW’s spontaneous fermentations observed in 2007 by Hall et al. (2011). A decrease in species/strain diversity of indigenous yeasts in spontaneous fermentations at wineries that utilize commercial ADY has been reported by other studies (Beltran et al. 2002; Santamaria et al. 2005). These studies proposed that the use of commercial ADY in a winery decrease indigenous species/strain diversity. Perhaps this is due commercial yeast having better fermentation aptitude and competitive traits then indigenous yeast thereby preventing their successful development in fermentation. In contrast to QGEW and CCEW, a largely diverse non-commercial ‘unknown’ S. cerevisiae population was detected in R13EW’s spontaneous fermentation. This may be due, again, to the age of the winery and the limited number of different commercial ADY as previously described in section 2.4.3.  The ability of some commercial yeast to persist more readily in fermentation over the inoculant ADY was seen in two out of the three wineries of study. This raises concern over whether the increased use of commercial strains within a winery may impact the effectiveness of ADY inoculants or decrease the overall diversity of wine yeasts in  57  spontaneous fermentation due to their competitive nature (Ganga and Martinez, 2004; Beltran et al. 2002). Strains of S. cerevisiae produce unique organoleptic properties in the wine during vinification and it is thought that species/strain diversity positively affects wine complexity (Fleet 2007). The presence of unwanted yeasts, for example commercial as opposed to indigenous, or a decrease in the overall diversity of yeast species/strains in a spontaneous fermentation, may undesirably affect the complexity and overall sensory attributes of the final wine product (Ganga and Martinez, 2004; Vilanova et al. 2005; Fleet 2007). Further investigations are necessary to determine the impact that high or low species/strain diversity has on sensory characteristics of wine.  2.4.7 Comparison of cold-soak, inoculated, and spontaneous yeast assemblages between wineries Differences between inoculated and spontaneous yeast species/strain assemblages were observed solely at R13EW. Similar species/strain assemblages were observed between the spontaneous and inoculated fermentation tanks at QGEW and CCEW; therefore, hypothesis 1f was fully supported by R13EW’s results and not supported by QGEW and CCEW results. The similar yeast species/strain assemblages (40% to 75% shared similarity) observed between the inoculated and spontaneous fermentation tanks at QGEW and CCEW was likely due to the presence of similar commercial S. cerevisiae strains in both of these tanks, as opposed to the presence of a homogenous population composed of the ADY inoculant in the inoculated fermentation and a diverse assortment of non-commercial yeast in the spontaneous fermentation, which would have fostered the detection of dissimilar assemblages between these two types of fermentation. However,  58  dissimilarity was observed between the inoculated and spontaneous fermentation tanks (≤ 25% shared similarity) at R13EW. This was likely due to the extremely diverse assortment of non-commercial ‘unknown’ S. cerevisiae strains performing fermentation in the spontaneous tank and a homogenous population composed of the ADY inoculant performing fermentation in the inoculated tank. Thus, two dissimilar populations were performing these two types of fermentation. To my knowledge, similarity indices have not been used by other authors to compare species/strain assemblages between inoculated and spontaneous fermentations tanks. Most studies are descriptive in terms of yeast population diversity and dynamics. However, upon the assessment of yeast species/strain frequencies reported by other authors, similar results to QGEW and CCEW have been reported. For example, Constanti et al. (1997) and Clavijo et al. (2011) reported that spontaneous and inoculated tanks had similar assemblages of commercial S. cerevisiae strains.  The ADY inoculant, Lalvin® RC212, was added to QGEW and R13EW’s inoculated tanks; however, very different results occurred. For example, ≥80% species/strain similarity was observed between the inoculated tanks at R13EW, whereas at QGEW the similarity of inoculated tanks was between 50% to 80%, even though the same ADY inoculant was added to each tank. The inoculated tanks of CCEW shared between 30% to 80% similarity, even though a different ADY inoculant was added to each of CCEW’s inoculated tanks. Therefore, hypothesis 1g was supported at R13EW, whereas QGEW and CCEW it was not supported. If each tank was inoculated with the same ADY inoculant and the inoculant successfully implants (i.e- isolated at ≥80% in  59  comparison to all other yeast species/strains present) then the inoculated tanks, in theory, should share ≥80% species/strain assemblage similarity. The high assemblage similarities observed between the inoculated tanks at R13EW were most likely a result of successful ADY implantation and, therefore, the development of similar homogeneous populations in each tank of study. Similarly to R13EW, Capece et al. (2012) reported successful ADY implantation and similar yeast populations between the inoculated tanks of study; however, they also reported a result similar to what I found at QGEW. Capece et al. (2012) found that one of the inoculated tank’s yeast assemblages did not resemble any of the others. The low assemblage similarity observed in both Capece et al. (2012) and QGEW inoculated tanks was most likely due to the unsuccessful implantation of the ADY inoculant and the entrance, establishment, and fermentation of other yeasts in the must; therefore, unsuccessful implantation of the ADY inoculant fostered species/strain assemblage similarities of less than 80% between the inoculated tanks. The similarity of species/strain assemblages between 30% to 80% observed between majority of CCEW’s inoculated tanks was most likely due to the low implantation rate of each of the three ADY inoculants in each of the inoculated tanks and the finding that each of the inoculated tank’s fermentation was performed by similar non-inoculant strains. It appears as though low ADY inoculant implantation and in inoculated fermentation tanks are a common phenomenon in the industry and frequently reported in the literature (Schutz and Gafner, 1993; Beltran et al. 2002; Capece et al. 2012). Further research is necessary to determine whether low implantation of ADY inoculum is a common occurrence in wineries of the Okanagan wine region and to determine the factors responsible for this result.  60  The NMS ordination patterns indicate that cold-soak, inoculated, and spontaneous yeast species/strain assemblages are distinct to a winery. The perMANOVA results confirmed these observations; therefore, hypothesis 1h was fully supported. The use of similar commercial ADY strains between the wineries appeared to have no effect on the distinctiveness of each winery’s cold-soak, inoculated, and spontaneous yeast assemblages. The perMANOVA results on the NMS ordinations indicated that each winery’s yeast assemblages are significantly unique to one another. Differences in geographic location, age of the vineyard, age of the winery, soil type, climate, the use of varying commercial ADY, the presence of different non-commercial ‘unknown’ S. cerevisiae strains, various sanitization measures, and differing viticulture and vinification practices may have accounted for the variance of yeast assemblages between these wineries (Maro et al. 2007; Cordero-Bueso et al. 2011; Barata et al. 2012). Visualization of wine yeast species/strain assemblages through NMS ordination, to my knowledge, has not been performed in previous wine yeast population studies.  2.4.8 Comparison of inoculated yeast populations detected between two vintages at Quails’ Gate Estate Winery Similar non-Saccharomyces yeast and commercial S. cerevisiae strains were isolated between two consecutive years at a single winery (QGEW) indicating a wellestablished and stable temporal vineyard and winery microflora, supporting hypothesis 2a. In both years, H. uvarum was the only non-Saccharomyces species detected at the time of cold-soak sampling. This was the only species detected during cold-soak in the 2009 study at QGEW as well (Kluftinger et al., unpublished data). It appears as though  61  H. uvarum is the major resident yeast of QGEW’s vineyard. Another study has reported H. uvarum as the major yeast present during cold-soak over consecutive years (Beltran et al. 2002); however, many studies isolate other non-Saccharomyces spp. during cold-soak, and not solely H. uvarum (Maro et al. 2007; Ocon et al. 2010; Li et al. 2011). Perhaps the climatic conditions or viticulture practices were consistent between years at QGEW, fostering the development of this particular species on the var. Pinot noir grapes. Further investigation into the effects of varietal, climatic conditions, and viticulture practices on species development is needed to better understand the preference of H. uvarum to QGEW’s var. Pinot noir blocks.  In addition to the commercial ADY inoculant, Lalvin® RC212, the following commercial S. cerevisiae strains were detected in both years of study: Lalvin® ICVD254, AEB® Fermol AP, and RedStar® PCuvee. Similarly, these commercial S. cerevisiae strains were isolated in 2007 (Hall et al. 2011) and in 2009 (Kluftinger et al., unpublished data) at QGEW. This suggests that these commercial S. cerevisiae strains are well established in the winery. Other authors have reported the detection of similar commercial strains between vintages (Constanti et al. 1997; Santamaria et al. 2005; Mercado et al. 2007). The survival of S. cerevisiae between years is most likely due to their ability to produce ascospores, survive on winery surfaces (Torija et al. 2001; Beltran et al. 2002; Santamaria et al. 2005), and persist through cleaning practices (Pretorius, 2000; Mercado et al. 2007). In my study, there were three additional non-commercial ‘unknown’ S. cerevisiae strains isolated in the 2011 vintage (QG-UN06, QG-UN07, and QG-UN08) that were not isolated in the 2010 vintage. Several authors have also reported  62  the isolation of unique non-commercial S. cerevisiae strains that were not re-isolated between consecutive years (Constanti et al. 2007; Torija et al. 2001; Mercado et al. 2007; Schuller at al. 2012). The isolation of new non-commercial ‘unknown’ S. cerevisiae strains may be the result of S. cerevisiae genetic recombination (FAGE model) as previously discussed in section 2.4.3 (Mortimer, 2000; Schuller et al. 2012).  Implantation of the commercial starter strain, Lalvin® RC212, appeared more successful in the 2011 inoculated tanks; however, there was still considerable detection of other commercial strains in the must, mainly Lalvin® ICV-D254, although its presence decreased slightly in the 2011 year. It was reported by the winemaker that Lalvin® ICVD254 was not used during the 2011 year for any of the fermenting varietals (pers. Comm. Grant Stanley). Its lack of use in 2011 may partially explain its decreased detection in the 2011 vintage, but it still appears that this strain was able to survive between years and persist through sanitization measures. A study performed by Constanti et al. (1997) also reported the detection of one particularly dominant commercial S. cerevisiae strain between two consecutive years of study.  2.5 SUMMARY This study was the first step to understanding how yeast populations affect the resulting product of var. Pinot noir fermentation at three wineries of the Okanagan, British Columbia. Many results obtained in this study are in agreement with literature published from some of the world’s largest wine producing regions. For example, nonSaccharomyces and S. cerevisiae species succession throughout fermentation was  63  observed (Combina et al. 2005; Barrajón et al. 2009; Ocon et al. 2010); commercial S. cerevisiae was isolated from spontaneous fermentations at wineries that utilize commercial ADY (Beltran et al. 2002; Mercado et al. 2007; Tello et al. 2011); and similar yeast species/strains were detected at a single winery between vintages (Constanti et al. 1997; Santamaria et al. 2005; Mercado et al. 2007). However, there were some intriguing findings in this study. Firstly, with the exception to R13EW, the commercial ADY inoculant was not necessarily the dominant yeast detected in the inoculated tanks of study. There was partial-to-zero detection of the inoculant, which resulted in a mixedstrain population throughout the early, mid, and end stages of inoculated fermentation at both QGEW and CCEW. Secondly, at only one of the wineries (R13EW) was there an increase in species/strain diversity and richness observed during spontaneous fermentation. Furthermore, only at R13EW was the spontaneous fermentation carried-out by non-commercial ‘unknown’ S. cerevisiae strains. And lastly, each winery expressed unique cold-soak, inoculated, and spontaneous fermentation yeast assemblages. An indigenous S. cerevisiae strain was not isolated among the three wineries; however, it appears as though H. uvarum is an indigenous non-Saccharomyces species commonly present in the vineyards of the Okanagan wine region. Further study is necessary to determine whether the majority of wineries in the Okanagan tend to have successful ADY inoculant implantation combined with relatively high yeast diversity in spontaneous ferments, as observed at R13EW, or whether the inoculated and spontaneous yeast assemblages observed at QGEW and CCEW are representative of the region. In addition, further information of what the source(s) of non-inoculant yeasts are and how a winery’s  64  microflora affects the finished var. Pinot noir sensorial attributes at an operational scale would be useful.  65  CHAPTER 3: CONCLUSION 3.1 CONCLUSION SUMMARY This is the first study in Canada to compare wine yeast populations between different wineries. Although a small-scale study was conducted at QGEW in 2007 on spontaneous fermentations (Hall et al. 2010), a large-scale investigation of cold-soak, inoculated, and spontaneous yeast population dynamics of several Okanagan wineries has been left unexamined until now. Additionally, this study is the first assessment of inoculated fermentation yeast populations between two consecutive years at a single British Columbia winery. The observation of non-Saccharomyces and S. cerevisiae succession during fermentation, as well as the ability of non-inoculant commercial and ‘unknown’ S. cerevisiae strains to contribute to fermentation, indicates that the wineries of study have a well-established vineyard and winery yeast microflora. As well, the isolation of similar S. cerevisiae strains between vintages at a single winery, even when their use had been discontinued, suggests that a temporally stable S. cerevisiae microflora can survive between vintages and participate in subsequent fermentations.  Furthermore, relatively low ADY inoculant implantation and spontaneous fermentation species/strain diversity and richness occurred in two of the three wineries of study. Road13 Estate Winery, the youngest of the three wineries, was the only winery observed to have full implantation of the commercial ADY in inoculated fermentation and increased species/strain diversity during spontaneous fermentation. These findings were in contrast to the two older wineries (QGEW and CCEW). Although factors other than age, such as location and difference in winery practices, may be responsible for the  66  differences observed, age of the winery should not be discounted. It has been postulated that as a winery utilizing commercial ADY ages, the presence of commercial strains in fermentation increases (Santamaria et al. 2005).  At the two older wineries (QGEW and CCEW), it was observed that the noninoculant commercial strain, Lalvin® ICV-D254, established in both spontaneous and inoculated fermentations. It appears as though some commercial strains hold the ability to persist throughout fermentation, even when never intentionally added to the must. Although all three wineries had a few non-Saccharomyces and commercial strains that were the same, overall it was found that the yeast assemblages were unique to each of the wineries at all stages of inoculated and spontaneous fermentation, including cold-soak. In the two older wineries, where commercial strains dominated in the fermentations, differences between the wineries were likely due to their use of different commercial strains and subsequently the ability of these commercial strains to become long-term residents of the winery. The youngest of the three wineries; however, had a more limited use of commercial strains, which may have contributed to the diverse presence of noncommercial ‘unknown’ S. cerevisiae yeasts to ferment the wine, particularly in the spontaneous fermentation.  3.2 NOVELTY OF THE RESEARCH This study has contributed to the literature in several areas. As previously mentioned in section 3.1, the assessment of inoculated and spontaneous fermenting yeast populations of several Canadian wineries has not been reported in the literature. From this  67  study, inoculated and spontaneous yeast population data from several local Canadian wineries are now available for comparative purposes. Furthermore, this study was the first, to my knowledge, to analyze wine yeast fermentation species/strain assemblages using analytical tools, such as similarity indices, richness and diversity tests, and NMS ordination. These tests were useful for assessing wine yeast species/strain assemblages and are recommended for future studies. This study also revealed the complexity of yeast species/strain assemblages in wineries of the Okanagan. In the future, inoculated and spontaneous fermentation yeast populations of additional wineries in the Okanagan region need to be assessed in both young and old wineries. This will foster a large-scale assessment and comparison of wine yeast population dynamics of young and old wineries in the Okanagan.  3.3 MANAGEMENT IMPLICATIONS In an applied sense, revealing yeast population dynamics at an operational setting is highly beneficial for the local industry. Firstly, it shows winemakers the complexity of the yeast populations in their fermenting varietals. For example, I found that the commercial ADY inoculant did not always implant fully, which resulted in a ferment resembling a spontaneous fermentation (as was found at QGEW and CCEW). Secondly, the presence of indigenous yeasts and the resulting increased strain diversity and richness in a spontaneous fermentation, as compared with an inoculated ferment, are not always achieved. I found that in the two out of the three wineries non-inoculant commercial strains appeared to become residents of the winery and may have reduced the ability of the ADY inoculant to successfully implant and the ability of potential indigenous strains  68  to perform spontaneous fermentation. These results may be opposite to what a winemaker assumes is happening in their winery and it is only through annual microbiological monitoring does a winemaker know what is truly happening in their ferments.  There are various practices that winemakers can implement to achieve implantation of the inoculum and to encourage a diversity of potentially indigenous yeast in spontaneous fermentations. Unfortunately, these practices may work against each other. For example, a winemaker may feel that consistency of the wine product is the most important factor. Under these set of goals, full implantation of the ADY inoculant should try to be achieved by improving cleanliness, decreasing cross-use of tools, and promoting extra care when rehydrating the ADY inoculant. Of course, the implementation of these practices can be time consuming and comes with a cost. On the other hand, the winemaker may feel that complexity and ‘terrior’ of a spontaneous wine product is the most important factor. Under these set of goals, where a diverse assortment of potential indigenous yeast in spontaneous ferments would be preferred, a reduction of inoculated ferments with commercial ADY may be warranted in order to better promote the presence of potentially indigenous yeast in spontaneous fermentation. In any event, these management decisions must be dependent on the goals of the winemaker and the results of a microbiological survey. Unfortunately, these managerial decisions are usually not possible, because microbiological testing to the level that was conducted in this study are usually not performed on an annual basis. For example, these tests may foster decisionmaking, such as the use or disuse of commercial strains, increase the number of  69  spontaneous fermentations in a vintage upon learning they have a well-established vineyard and winery yeast microflora.  3.4 ASSUMPTIONS AND LIMITATIONS Determining an appropriate sample size to accurately represent the major fermenting yeast species/strain population was a challenge since sample sizes varied immensely among previously published studies. In order to alleviate this issue, species/strain rarefaction curves were generated. This study’s sample size represented the major fermenting yeast populations in all tanks, except for R13EW’s spontaneous tank. For future studies, it is recommended to increase the sample size by eight isolates in order to avoid potential sampling size issues. One part of the experimental design was to assess the cold-soak yeast population of var. Pinot noir fermentation. In this study, the spontaneous cold-soak stage of fermentation was not sampled; however, it was assumed that the cold-soak population detected in the inoculated tanks was representative of the spontaneous cold-soak population. This assumption was based on the fact that similar blocks were harvested and fermented in the inoculated tanks as in the spontaneous tanks. Additionally, only one spontaneous tank was sampled at each of the wineries. For future studies, replicates of spontaneous fermentation tanks should be sampled to allow for statistical analysis between inoculated and spontaneous tanks.  Furthermore, a  comparative microsatellite database containing all commercial strains available for purchase on the market, to my knowledge, does not exist; therefore, another limitation was determining whether the ‘unknown’ S. cerevisiae strains were indigenous. The ‘unknown’ S. cerevisiae strains may be commercial, but not recognized as commercial,  70  since a complete comparative microsatellite database was not available at this time. Therefore, the ‘unknown’ strains could be characterized as indigenous.  3.5 SUGGESTIONS FOR FURTHER RESEARCH The results of this study suggest a number of new avenues for research, such as the mode of entrance of non-inoculant yeast, the effect of winery age on yeast assemblages, the presence of S. cerevisiae in the vineyard, the existence of indigenous S. cerevisiae strain(s) common to the Okanagan wine region, the effects a winery’s yeast species/strain microflora have on the aromatic and sensory attributes of the finished wine product, and the generation of a universal comparative S. cerevisiae database.  This study fuels future investigation into the source of non-inoculant yeast species/strains isolated from fermentation. The mixed-yeast species/strain dynamics observed during fermentation in the majority of tanks raises the question as to what are the mechanisms of entrance of non-inoculant yeast. It is interesting that several other studies reveal the presence of S. cerevisiae on the surfaces of winery cellar walls, equipment, and tanks and their ability to spontaneously contribute to fermentation (Sabate et al. 2004; Ciani et al. 2004; Mercado et al. 2007). Further investigation into the origin of non-inoculant yeast should occur in wineries of the Okanagan. Surfaces, such as tanks, pump-over tools, crusher/de-stemmer, reception equipment, and plunging tools should be assessed for yeast. Furthermore, a study conducted by Garijo et al. (2008) assessed the presence of microorganisms of enological interest in the air of a Spanish wine cellar. Interestingly, many organisms directly related to fermentation were isolated. A similar  71  study like this one should be conducted in wineries of the Okanagan as this would help determine whether the microbial load in the air correlates with the source of non-inoculant yeast in fermentation tanks. Studies that assess a winery’s surface and air microflora may promote the action of control tactics, such as elevated sanitization measures, which may prevent the entrance of unwanted yeasts or other related wine microorganisms in fermenting tanks. Nevertheless, as mentioned previously, it depends on the managerial goals of the winemaker and it may be that the winemaker wants to encourage a diversity of yeasts within the winery. Additionally, it would be interesting to observe the development of a winery’s microflora starting from the first vintage. This would aid in understanding the effect of age of a winery on the ability of potentially indigenous yeasts to spontaneously enter spontaneous or inoculated fermentations.  It would be interesting to assess whether a source of non-inoculant S. cerevisiae is from the vineyard. Taking direct surface samples of grape skins prior to harvest, conducting spontaneous bench-top fermentations from the juice of these grapes, and identifying the yeast species/strains present on the skins and responsible for carrying-out the micro-fermentations would give insight to a winery’s vineyard microflora. Furthermore, it would help to determine whether Okanagan vineyards are a source of commercial or indigenous S. cerevisiae and whether these strains play a role in subsequent cellar fermentations.  The impact that a winery’s major fermenting yeasts have on a finished wine product’s sensorial properties should be investigated. Yeast carrying-out fermentation  72  influence the sensory and chemical quality of the wine due to the release of metabolic byproducts during fermentation (Romano et al. 2003, Vilanova et al. 2005, Fleet 2008). This study identified several wineries’ yeast populations of fermenting var. Pinot noir; however, continual yearly assessments of a wineries’ fermentation population dynamics should occur. This would provide information on a winery’s major fermenting populations. For example, several studies conducted at QGEW (vintage 2007 (Hall et al. 2010); vintage 2009 (Kluftinger et al., unpublished data); and vintages 2010 and 2011 (current thesis) revealed the consistent presence of Lalvin® RC212 and Lalvin® ICVD254 at almost equal proportions in inoculated and spontaneous var. Pinot noir fermentations. Now, the effects that these species/strains have on the QGEW var. Pinot noir wine product’s organoleptic properties at a pilot-scale level would greatly bridge yeast ecology and sensory fields of study.  Additionally, the construction and utilization of a universal commercial S. cerevisiae microsatellite comparative database would greatly benefit the field. To my knowledge, the short communication released by Richards et al. (2009) has been the only attempt at constructing a comparative S. cerevisiae microsatellite database; however, this database does not encompass all commercial S. cerevisiae strains on the market. A database, like Richards et al. (2009), including all commercial profiles of S. cereivisae strains should be constructed for an easy and accurate identification of yeasts. Furthermore, if microsatellite analysis and the use of similar primers was the universal molecular method of choice by researchers, then microsatellite profiles of indigenous S. cerevisiae yeasts isolated from the vineyard, winery, or fermentations could be compared.  73  Table 1-1 Comparative table of literature on wine yeast ecology studies Study  Country (year)  Grape Skins  Winery Surfaces  Air  Inoculated Spontaneous Molecular Method Fermentation Fermentation  Previous Use of Age of the Commercial Winery Yeast  Distinction btwn Commer. and/or Indig. Yeast (dominant)  Schutz and Gafner (1993)  Various areas  No  No  No  Yes  Yes  Karyotyping  Yes  N/A  Yes, (Indig. in spontaneous & commer. in inoculated)1, 2  Constanti et al. (1997)  Spain, (19941995)  No  No  No  Yes  Yes  mtDNA RFLP  Yes  1-2  Yes, (commer. in year 1; indig. in year 2)1,2  Torija et al. (2001)  Spain (19961998)  No  No  No  No  Yes  mtDNA RFLP  No  N/A  Yes, (indig. only) 1  Beltran et al. (2002)  Spain, (19952000)  No  No  No  No  Yes  mtDNA RFLP  Yes  1-6  Yes, (both apprx. equally detected) 1,2  Lopes et al. (2002)  Argentina, (1999)  No  No  No  No  Yes  mtDNA RFLP, !PCR  No  N/A  Yes, (indig. only) 1  Sabate et al. (2002)  Spain (19951996)  Yes  Yes  No  No  Yes  mtDNA RFLP, RE digests  No  N/A  Yes, (indig. only) 1  Ciani et al. (2004)  Italy (N/A)  Yes  Yes  No  No  Yes  !-PCR  No  70  Yes, (indig. only) 1  Valero et al. (2005)  France/Portu gal, (20002003)  Yes  No  No  No  No  Microsatellites, mtDNA RFLP  Yes  N/A  Yes, (both apprx. equally detected) 1,2  Combina et al. (2005)  Argentina (2000-2001)  No  No  No  No  Yes  DNA Sequencing, RE Digests  No  N/A  Yes, (indig. only) 1  Santamaria et al. (2005)  Spain (19972003)  No  No  No  No  Yes  mtDNA RFLP  Yes (in new winery only)  100 (old Yes,(indig. dominant in winery); 3 (new old, commer. dominant in winery) new)1,2  Le Jeune et al. (2006)  Germany (1997)  Yes  No  No  No  Yes  !-PCR  No  N/A  Yes, (indig. only) 1  Maro et al. (2007)  Italy (2004)  No  No  No  No  Yes  PCR-DGGE, DNA Sequencing, RAPD-PCR  No  N/A  Yes, (indig. only) 1  74  Table 1-1 continued … Mercado et al. (2007)  Argentina, (2001-2002)  Yes  Yes  No  No  Yes  mtDNA RFLP, !-PCR  No  N/A  Yes, (commer. Detected but indig. was dominant)1,2  Garijo et al. (2008)  Spain (2006)  No  No  Yes  No  Yes  mtDNA RFLP  No  N/A  Yes, (indig. only) 1  Goddard et al. (2010)  New Zealand (2005)  No  No  No  No  Yes  Microsatellites, DNA Sequencing, mtDNA RFLP  No  N/A  Yes, (indig. only) 1  Mercado et al. (2010)  Argentina (2001-2002)  Yes  Yes  No  No  Yes  mtDNA RFLP, !-PCR, Microsatellites  Yes  N/A  Yes, (indig. only) 1  Ocon et al. (2010)  Spain (N/A)  No  No  No  No  Yes  PCR-RFLP  No  N/A  Yes, (indig. only) 1  Clavijo et al. (2011)  Spain, (2005)  No  No  No  Yes  Yes  mtDNA RFLP  Yes  3  Yes, (commer. only)2  Hall et al. (2011)  Canada, (2007)  Yes  Yes  No  No  No  Microsatellites, DNA Sequencing  Yes  23  Yes, (commer. only)2  Li et al. (2011)  China (2006)  Yes  No  No  No  Yes  DNA Sequencing, RAPD-PCR  No  N/A  Yes, (indig. only) 1  Tofalo et al. (2011)  Italy (20082009)  Yes  No  No  Yes  Yes  PCR-RFLP, DNA Sequencing  Yes  N/A  No3  Schuller et al. (2012)  Portugal (N/A)  Yes  No  No  No  Yes  DNA Sequencing, !-PCR, Microsatellites  No  N/A  Yes, (indig. only) 1  1  Distinction between indigenous S. cerevisiae strains Distinction between commercial S. cerevisiae strains 3 No distinction between strains of S. cerevisiae 2  Table 1-1 end.  75  Table 2-1 Fermentation data of 2010 tanks at (A) QGEW; (B) CCEW; and (C) R13EW (A) Fermentation Data  QGEW Tanks  Winery tank ID Referenced tank ID Vintage (year) Fermentation style Varietal Field/Block Date of harvest/crush (mm/dd/yy) Tartaric Acid (TA) (g/L) at crush pH at crush Date of SO 2 addition SO 2 addition (ppm) Cold-soak Date of sample (mm/dd/yy) Depth of sample (!m) Temperature of tank (°C) pH Residual sugar (sucrose) °Brix Cell density (CFUs/mL) Inoculation Commercial yeast inoculant Date of inoculation Temp. of tank (°C) at time of inoculation pH of tank at time of inoculation Residual sugar (sucrose) °Brix Early Date of sample (mm/dd/yy) Depth of sample (!m) Temperature of tank (°C) pH Residual sugar (sucrose) °Brix Cell density (CFUs/mL) Use of Nutrients DAP (g/hL) (approx.) Superfood TM (g/hL) (approx.) Date DAP and/or Superfood™ added Mid Date of sample (mm/dd/yy) Depth of sample (!m) Temperature of tank (°C) pH Residual sugar (sucrose) °Brix Cell density (CFUs/mL) End Date of sample (mm/dd/yy) Depth of sample (!m) Temperature of tank (°C) pH Residual sugar (sucrose) °Brix Cell density (CFUs/mL) Final notes Date pressed (mm/dd/yy) Duration of fermentation (days)  R3 QG-T1 2010 Inoculated L. var Pinot noir F4B10 10/07/10 10.5 3.45 10/07/10 40  R4 QG-T2 2010 Inoculated L. var Pinot noir F3B5,7,8 10/07/10 10.6 3.39 10/07/10 40  R18 QG-T3 2010 Inoculated L. var Pinot noir F4B3 10/07/10 10.3 3.09 10/07/10 40  R19 QG-W 2010 Spontaneous L. var Pinot noir F4B3 10/07/10 10.4 3.18 10/07/10 40  10/12/10 0.5 10 3.52 25 4.7 x 106  10/12/10 0.5 10 3.51 25 2.7 x 107  10/12/10 0.5 10 3.54 24.8 6.5 x 105  -  Lalvin® RC212 10/14/10 18 3.61 25  Lalvin® RC212 10/14/10 18 3.55 24.5  Lalvin® RC212 10/14/10 18 3.49 25  -  10/16/10 0.5 25 3.37 15 2.0 x 107  10/16/10 0.5 26 3.4 15 1.2 x 105  10/16/10 0.5 17.5 3.44 23 6.3 x 107  10/18/10 0.5 26 3.44 15 1.4 x 107  10 20 10/17/10  10 20 10/17/10  10 20 10/17/10  10 20 10/17/10  10/18/10 0.5 30 3.68 2 6.7 x 108  10/18/10 0.5 27 3.63 3 1.2 x 108  10/18/10 0.5 23 3.43 7 6.4 x 107  10/20/10 0.5 28 3.56 3 1.3 x 108  10/26/10 0.5 20 3.46 0 4.5 x 107  10/26/10 0.5 20 3.51 0 1.1 x 107  10/26/10 0.5 23 3.6 0 1.6 x 106  10/20/10 0.5 28  10/27/10 20  10/27/10 20  10/28/10 19  10/28/10 19  3 1.7 x 107  76  (B) Fermentation Data  CCEW Tanks  Winery tank ID Referenced tank ID Vintage (year) Fermentation style Varietal Field/Block Date of harvest/crush (mm/dd/yy) Tartaric Acid (TA) (g/L) at crush pH at crush Date of SO 2 addition SO 2 addition (ppm) Cold-soak Date of sample (mm/dd/yy) Depth of sample (!m) Temperature of tank (°C) pH Residual sugar (sucrose) °Brix Cell density (CFUs/mL) Inoculation Commercial yeast inoculant Date of inoculation Temp. of tank (°C) at time of inoculation pH of tank at time of inoculation Residual sugar (sucrose) °Brix Early Date of sample (mm/dd/yy) Depth of sample (!m) Temperature of tank (°C) pH Residual sugar (sucrose) °Brix Cell density (CFUs/mL) Use of Nutrients DAP (ppm) (approx.) Superfood TM (g/hL) (approx.) Date DAP and/or Superfood™ added Mid Date of sample (mm/dd/yy) Depth of sample (!m) Temperature of tank (°C) pH Residual sugar (sucrose) °Brix Cell density (CFUs/mL) End Date of sample (mm/dd/yy) Depth of sample (!m) Temperature of tank (°C) pH Residual sugar (sucrose) °Brix Cell density (CFUs/mL) Final notes Date pressed (mm/dd/yy) Duration of fermentation (days)  IOPNCC102 CC-T1 2010 Inoculated L. var Pinot noir Block 1 10/18/10 9.3 3.11 10/18/10 40  IOPN402 CC-T2 2010 Inoculated L. var Pinot noir Block 4 10/21/10 8.1 3.24 10/21/10 40  IOPN401 CC-T3 2010 Inoculated L. var Pinot noir Block 4 10/21/10 8.1 3.24 10/21/10 40  10PNCC101 CC-W 2010 Spontaneous L. var Pinot noir Block 1 10/18/10 9.3 3.11 10/18/10 40  10/19/10 0.5 10 3.19 23.9 1.1 x 106  10/23/10 0.5 9 3.33 21 8.0 x 105  10/23/10 0.5 9 3.4 21 1.5 x 105  -  Lallemand® L2TD Enoferm® AMH 10/25/10 10/27/10 15 15 3.27 3.39 23.3 24.1  Lalvin® RC212 10/27/10 15 3.44 24.6  -  10/27/10 0.5 13 3.33 20 1.2 x 107  10/27/10 0.5 14 3.48 19 1.4 x 108  10/27/10 0.5 14 3.51 20 9.6 x 108  10/29/10 0.5 13 3.34 20 7.8 x 107  300 200 10/29/10  300 200 10/30/10  300 200 10/30/10  300 200 10/30/10  11/01/10 0.5 19 3.51 14.5 1.2 x 107  10/29/10 0.5 20 3.54 14.9 1.0 x 108  10/29/10 0.5 21 3.52 13.6 1.4 x 108  11/01/10 0.5 23 3.47 14 2.3 x 108  11/05/10 0.5 16 3.61 0.7 1.7 x 108  11/01/10 0.5 25 3.57 0 1.9 x 107  11/05/10 0.5 21 3.59 1 4.6 x 107  11/05/10 0.5 18 3.64 0 1.3 x 107  11/10/10 20  11/04/10 15  11/06/10 15  11/06/10 16  77  (C) Fermentation Data  R13EW Tanks  Winery Winery tank ID Referenced tank ID Vintage (year) Fermentation style Varietal Field/Block Date of harvest/crush (mm/dd/yy) Tartaric Acid (TA) (g/L) at crush pH at crush Date of SO 2 addition SO 2 addition (ppm) Cold-soak Date of sample (mm/dd/yy) Depth of sample (!m) Temperature of tank (°C) pH Residual sugar (sucrose) °Brix Cell density (CFUs/mL) Inoculation Commercial yeast inoculant Date of inoculation Temp. of tank (°C) at time of inoculation pH of tank at time of inoculation Residual sugar (sucrose) °Brix Early Date of sample (mm/dd/yy) Depth of sample (!m) Temperature of tank (°C) pH Residual sugar (sucrose) °Brix Cell density (CFUs/mL) Use of Nutrients DAP (g/hL) (approx.) Superfood TM (g/hL) (approx.) Date DAP and/or Superfood™ added Mid Date of sample (mm/dd/yy) Depth of sample (!m) Temperature of tank (°C) pH Residual sugar (sucrose) °Brix Cell density (CFUs/mL) End Date of sample (mm/dd/yy) Depth of sample (!m) Temperature of tank (°C) pH Residual sugar (sucrose) °Brix Cell density (CFUs/mL) Final notes Date pressed (mm/dd/yy) Duration of fermentation (days)  R13EW IOPIN13U1 R13-T1 2010 Inoculated L. var Pinot noir Upper 1 09/28/10 09/28/10 -  R13EW IOPIN13U2 R13-T2 2010 Inoculated L. var Pinot noir Upper 2 09/28/10 09/28/10 -  R13EW IOPIN13L R13-T3 2010 Inoculated L. var Pinot noir Lower 1 09/28/10 09/28/10 -  R13EW PINC4YRN R13-W 2010 Spontaneous L. var Pinot noir Lower 1 09/28/10 09/28/10 -  09/29/10 0.5 10 23 4.4 x 103  09/29/10 0.5 10 23 5.3 x 103  09/29/10 0.5 10 22 1.9 x 103  -  Lalvin® RC212 10/02/19 -  Lalvin® RC212 10/02/19 -  Lalvin® RC212 10/02/19 -  -  10/04/10 0.5 18 20 6.8 x 107  10/04/10 0.5 24 18 70 x 10 5  10/04/10 0.5 25 15 6.8 x 107  10/04/10 0.5 24 20 5.6 x 107  -  -  -  -  10/05/10 0.5 23 12 7.8 x 108  10/05/10 0.5 26 6 1.1 x 108  10/05/10 0.5 26 7 7.8 x 108  10/05/10 0.5 23 13 1.6 x 108  10/08/10 0.5 22 0 8.1 x 107  10/08/10 0.5 22 0 1.3 x 107  10/08/10 0.5 23 0 1.1 x 107  10/08/10 0.5 23 2 1.7 x 107  -  -  -  -  78  Table 2-2 Fermentation data of inoculated tanks (T1-T3) from the 2011vintage at QGEW Fermentation Data  QGEW Tanks  Winery Winery tank ID Referenced tank ID Vintage (year) Fermentation style Varietal Field/Block Date of harvest/crush (mm/dd/yy) Tartaric Acid (TA) (g/L) at crush pH at crush Date of SO 2 addition SO 2 addition (ppm) Cold-soak Date of sample (mm/dd/yy) Depth of sample (!m) Temperature of tank (°C) pH Residual sugar (sucrose) °Brix Cell density (CFUs/mL) Inoculation Commercial yeast inoculant Date of inoculation Temp. of tank (°C) at time of inoculation pH of tank at time of inoculation Residual sugar (sucrose) °Brix Early Date of sample (mm/dd/yy) Depth of sample (!m) Temperature of tank (°C) pH Residual sugar (sucrose) °Brix Cell density (CFUs/mL) Use of Nutrients DAP (g/hL) (approx.) Superfood TM (g/hL) (approx.) Date DAP and/or Superfood™ added Mid Date of sample (mm/dd/yy) Depth of sample (!m) Temperature of tank (°C) pH Residual sugar (sucrose) °Brix Cell density (CFUs/mL) End Date of sample (mm/dd/yy) Depth of sample (!m) Temperature of tank (°C) pH Residual sugar (sucrose) °Brix Cell density (CFUs/mL) Final notes Date pressed (mm/dd/yy) Duration of fermentation (days)  QGEW R6 2011: QG-T1 2011 Inoculated L. var Pinot noir F4B9 10/17/11 7.7 3.52 10/17/11 40  QGEW R16 2011: QG-T2 2011 Inoculated L. var Pinot noir F3B3 10/17/11 7.05 3.56 10/17/11 40  QGEW 2801 2011: QG-T3 2011 Inoculated L. var Pinot noir F4B7 10/17/11 7.5 3.54 10/17/11 40  10/20/11 0.5 15 3.64 23 -  10/21/11 0.5 9 3.53 23 -  10/20/11 0.5 15 3.65 23 -  Lalvin® RC212 10/22/11 18 3.67 23  Lalvin® RC212 10/25/11 18 3.69 23.2  Lalvin® RC212 10/22/11 18 3.7 23  10/24/11 0.5 26 3.58 15.4 -  10/28/11 0.5 28 3.55 14.5 -  10/24/11 0.5 28 3.6 17.4 -  not added not added -  10 10 10/27/11  not added not added -  10/26/11 0.5 30 3.74 2 -  10/30/11 0.5 30 3.58 5 -  10/26/11 0.5 30 3.75 1 -  10/31/11 0.5 27 3.51 0 -  11/02/11 0.5 27 3.47 0 -  11/01/11 0.5 23 3.49 0 -  11/08/11 21  11/06/11 16  11/07/11 20  79  Table 2-3 Commercial S. cerevisiae strains reported used since the establishment of QGEW, CCEW, and R13EW. ‘x’ indicates strain used Commercial yeast  Wineries QGEW x  CCEW x  R13EW -  Anchor® Vin 7  -  x  -  Anchor® NT116  -  x  -  Anchor® Exotic  -  x  -  Laffort® Zymaflore X5  -  x  -  Laffort® Zymaflore FX10  -  x  -  Laffort® Zymaflore VL1  -  x  -  Laffort® Zymaflore VL3  -  x  -  Laffort® Zymaflore X16  -  x  -  Laffort® Zymaflore RB2  -  x  -  Laffort® Zymaflore RX60  -  x  -  Lalvin® ICV-D254  x  x  -  Lalvin® RC212  x  x  x  Lalvin® CY3079  x  x  -  Lalvin® Level 2TD (7013)  -  x  -  Lallemand® W15  -  x  -  Lallemand® Rhone L2056  -  x  -  Lallemand® BA11  -  x  -  Lallemand® BM45  -  x  -  Lallemand® BRL 97  x  x  x  Lallemand® D47  -  x  -  Lallemand® EC118  -  x  x  Lallemand® QA23  -  x  -  Lallemand® DV10  -  -  x  Lallemand® Syrah  -  x  -  Enoferm® Assmanhausen  -  x  -  Red Star® Premium Cuvee  x  -  -  Red Star® Cotes des Blancs  x  -  -  Red Star® Montrachet  x  x  -  AEB Fermol® Chardonnay  -  x  -  AEB Fermol® Mediterranean  -  x  x  AEB Fermol® Sauvignon  -  x  x  AEB Fermol® Arome Plus  x  x  x  AEB Fermol® Super16  x  -  -  AEB Fermol® Complete Killer  x  -  -  x 12 1989  31 1983  7 1998  Anchor® Vin 13  SIHA Active Yeast 7 Total no. different strains used in winery Year Winery was Established  80  Table 2-4 Total number of commercial and non-commercial ‘unknown’ S. cerevisiae strains, Saccharomyces spp., and non-Saccharomyces yeasts detected at QGEW, CCEW, and R13EW in the 2010 vintage No. of Isolates*  Wineries QGEW Total S. cerevisiae 188 Commercial S. cerevisiae 169 (5 a) Non-commercial 'unknown' S. cerevisiae 19 (5 b) Total non-Saccharomyces spp. 52 Saccharomyces bayanus 0 Saccharomyces uvarum 0  CCEW 189 188 (8 a) 1 (1 b) 50 0 1  R13EW 196 148 (3 a) 48 (15 b) 38 1 5  a  No. of different commercial strains No. of different ‘unknown’ strains *n=720 b  Table 2-5 Simpson’s diversity index (D) and abundance-based coverage (ACE) estimators of yeast species/strain richness and diversity of (A) QGEW; (B) CCEW; and (C) R13EW inoculated and spontaneous tanks during cold-soak (CS), early (ER), mid (M), and end (F) stages of fermentation (A) Specie/Strain richness/diversity Inoculated fermentation QG-CS 1 QG-ER 1 ACE 1±0 8.84 ± 2.88  QG-M1 QG-F1 9.15 ± 4.03 7.22 ± 1.57  Spontaneous fermentation QG-W-ER 2 QG-W-M2 QG-W-F 2 5 5.5 3  Simpson Index (D)  3.03 ± 0.67 2.87 ± 0.64  4.44  1±0  3.28 ± 1.14  3.87  2.18  (B) Specie/Strain richness/diversity Inoculated fermentation CC-CS1 CC-ER1 CC-M 1 CC-F1 ACE 7.42 ± 2.87 11.38 ± 4.68 9.52 ± 3.6 6.83 ± 1.21  Spontaneous fermentation CC-W-ER 2 CC-W-M 2 CC-W-F2 3 3 5  Simpson Index (D)  1.45 ± 0.16  5.53 ± 1.75  3.95 ± 0.48 3.81 ± 0.30  1.52  2.31  2.35  Specie/Strain richness/diversity Inoculated fermentation R13-CS1 R13-ER1 ACE 7.06 ± 1.24 5.18 ± 2.16  R13-M1 R13-F 1 4.24 ± 2.55 2.31 ± 0.58  Spontaneous fermentation R13-W-ER2 R13-W-M 2 R13-W-F 2 10 13 10  Simpson Index (D)  1.14 ± 0.12 1.19 ± 0.09  8.57  (C)  1 2  2.56 ± 0.23  1.63 ± 0.25  6.32  8.57  sample size (n)=3 sample size (n)=1  81  Table 2-6 Similarity indices of inoculated (T1-T3) and spontaneous (W) population assemblages during cold-soak (CS), early (ER), mid (M), and end (F) stages of fermentation at (A) QGEW1; (B) CCEW1; (C) R13EW1. Grey shading indicates ≥ 80% shared similarity yeast species/strain assemblages between tanks and stages of fermentation (A) Similarity of yeast species/strain assemblage Winery/Tank/Stage Winery/Tank/Stage QG-T1-CS QG-T2-CS QG-T3-CS QG-T1-ER QG-T2-ER QG-T3-ER QG-W-ER QG-T1-M QG-T2-M QG-T1-CS QG-T2-CS 1.000 QG-T3-CS 1.000 1.000 QG-T1-ER 0.000 0.000 0.000 QG-T2-ER 0.063 0.063 0.063 0.563 QG-T3-ER 0.000 0.000 0.000 0.250 0.250 QG-W-ER 0.125 0.125 0.125 0.500 0.688 0.313 QG-T1-M 0.000 0.000 0.000 0.625 0.625 0.250 0.688 QG-T2-M 0.000 0.000 0.000 0.438 0.688 0.063 0.500 0.500 QG-T3-M 0.000 0.000 0.000 0.438 0.438 0.813 0.438 0.438 0.250 QG-W-M 0.063 0.063 0.063 0.563 0.688 0.375 0.875 0.750 0.500 QG-T1-F 0.000 0.000 0.000 0.625 0.625 0.188 0.625 0.813 0.625 QG-T2-F 0.000 0.000 0.000 0.438 0.750 0.125 0.563 0.563 0.875 QG-T3-F 0.000 0.000 0.000 0.500 0.500 0.688 0.563 0.500 0.375 QG-W-F 0.000 0.000 0.000 0.500 0.813 0.313 0.750 0.625 0.750  QG-T3-M QG-W-M QG-T1-F QG-T2-F QG-T3-F QG-W-F 0.500 0.375 0.688 0.313 0.563 0.625 0.813 0.625 0.438 0.375 0.438 0.750 0.625 0.813 0.563 -  (B) Similarity of yeast species/strain assemblage Winery/Tank/Stage Winery/Tank/Stage CC-T1-CS CC-T2-CS CC-T3-CS CC-T1-ER CC-T2-ER CC-T3-ER CC-W-ER CC-T1-M CC-T2-M CC-T1-CS CC-T2-CS 0.875 CC-T3-CS 0.813 0.813 CC-T1-ER 0.125 0.125 0.063 CC-T2-ER 0.063 0.125 0.063 0.438 CC-T3-ER 0.188 0.250 0.188 0.375 0.688 CC-W-ER 0.063 0.125 0.063 0.313 0.250 0.313 CC-T1-M 0.063 0.125 0.063 0.375 0.375 0.313 0.688 CC-T2-M 0.063 0.125 0.063 0.500 0.563 0.438 0.625 0.750 CC-T3-M 0.063 0.063 0.000 0.375 0.813 0.688 0.188 0.313 0.563 CC-W-M 0.063 0.125 0.063 0.313 0.250 0.313 0.813 0.688 0.625 CC-T1-F 0.063 0.125 0.063 0.375 0.250 0.313 0.625 0.688 0.625 CC-T2-F 0.063 0.125 0.063 0.438 0.563 0.500 0.563 0.688 0.875 CC-T3-F 0.063 0.125 0.063 0.500 0.625 0.625 0.500 0.563 0.750 CC-W-F 0.063 0.063 0.000 0.250 0.188 0.250 0.688 0.563 0.563  CC-T3-M CC-W-M CC-T1-F CC-T2-F CC-T3-F CC-W-F 0.188 0.250 0.688 0.625 0.563 0.563 0.625 0.500 0.563 0.813 0.250 0.875 0.563 0.563 0.438 -  82  (C) Similarity of yeast species/strain assemblage Winery/Tank/Stage Winery/Tank/Stage R13-T1-CS R13-T2-CS R13-T3-CS R13-T1-ER R13-T2-ER R13-T3-ER R13-W-ER R13-T1-M R13-T2-M R13-T3-M R13-W-M R13-T1-F R13-T2-F R13-T3-F R13-W-F 0.750 0.625 0.688 0.000 0.125 0.313 0.000 0.125 0.313 0.750 0.000 0.125 0.313 0.813 0.625 0.000 0.125 0.125 0.125 0.125 0.125 0.000 0.125 0.313 0.813 0.625 0.938 0.125 0.000 0.125 0.313 0.813 0.688 0.813 0.125 0.813 0.000 0.125 0.313 0.813 0.625 0.938 0.125 1.000 0.813 0.000 0.125 0.188 0.188 0.188 0.188 0.313 0.188 0.250 0.188 0.000 0.125 0.313 0.813 0.625 0.875 0.125 0.875 0.813 0.875 0.188 0.000 0.125 0.313 0.813 0.625 0.938 0.125 1.000 0.813 1.000 0.188 0.875 -  R13-T1-CS R13-T2-CS R13-T3-CS R13-T1-ER R13-T2-ER R13-T3-ER R13-W-ER R13-T1-M R13-T2-M R13-T3-M R13-W-M R13-T1-F R13-T2-F R13-T3-F R13-W-F  1  0.000 0.000  0.125 0.125  0.313 0.125  0.813 0.125  0.625 0.125  0.875 0.125  0.125 0.500  0.875 0.125  0.875 0.125  0.875 0.125  0.188 0.625  0.875 0.125  0.875 0.125  0.125  -  Values are based on Bray-Curtis dissimilarity quantification.  Table 2-7 Permutational MANOVAs from QGEW, CCEW, and R13EW’s inoculated, spontaneous, cold-soak, and QGEW year-to-year non-metric multidimensional scaling (NMS) ordinations. DF= degrees of freedom; SS= sum of squares NMS Ordination Inoculated  Design one-way  DF 2  SS 3.3379  pseudo F-test 9.2054  p-value 0.002  Spontaneous  one-way  2  1.9233  7.3834  0.003  Cold-soak  one-way  2  0.99068  5.2918  0.003  QGEW Year-Year  one-way  1  0.61809  1.9172  0.110  83  B Species/Strain Frequency of Occurrence  Species/Strain Frequency of Occurrence  A 1 0.75 0.5 0.25 0 CS  ER  M  1 0.75 0.5 0.25 0  F  ER  M  F  CS  ER  M  F  D  1  Species/Strain Frequency of Occurrence  Species/strain Frequency of Occurrence  C  CS  0.75 0.5 0.25 0 CS  ER  M  F  1 0.75 0.5 0.25 0  Figure 2-1 Yeast species/strain frequency of occurrence at QGEW (2010) during cold-soak (CS), early (ER), mid (M), and end (F) stages of inoculated (A-C) and spontaneous (D) fermentation. (A) QG-T1; (B) QG-T2; (C) QG-T3; (D) QG-W  84  B Species/Strain Frequency of Occurrence  Species/Strain Frequency of Occurrence  A 1 0.75 0.5 0.25 0 CS  ER  M  1 0.75 0.5 0.25 0  F  ER  M  F  CS  ER  M  F  D  1  Species/Strain Frequency of Occurrence  Species/Strain Frequency of Occurrence  C  CS  0.75 0.5 0.25 0 CS  ER  M  F  1 0.75 0.5 0.25 0  Figure 2-2 Yeast species/strain frequency of occurrence at CCEW (2010) during cold-soak (CS), early (ER), mid (M), and end (F) stages of inoculated (A-C) and spontaneous (D) fermentation. (A) CC-T1; (B) CC-T2; (C) CC-T3; (D) CC-W  85  B Species/Strain Frequency of Occurrence  Species/Strain Frequency of Occurrence  A 1 0.75 0.5 0.25 0 CS  ER  M  1 0.75 0.5 0.25 0  F  ER  M  F  CS  ER  M  F  D  1  Species/Strains Frequency of Occurrence  Species/Strain Frequency of Occurrence  C  CS  0.75 0.5 0.25 0 CS  ER  M  F  1 0.75 0.5 0.25 0  Figure 2-3 Yeast species/strain frequency of occurrence at R13EW (2010) during cold-soak (CS), early (ER), mid (M), and end (F) stages of inoculated (A-C) and spontaneous (D) fermentation. (A) R13-T1; (B) R13-T2; (C) R13-T3; (D) R13-W  86  Figure 2-4 Species/strain accumulation curves of the 2010 vintage using Mao Tau individual-based rarefaction with replacement during cold-soak (CS), early (ER), mid (M), and end (F) stages of fermentation from inoculated tanks (n=3) at: QGEW (QG- A through D); CCEW (CC- E through H); and R13EW (R13- I through L). Dashed lines indicate Mao Tau 95% upper and lower bound confidence intervals  87  A  B  No. Species / Strains  12  6  6  A  B  15  4  15  4  12  12  9  2  9  2  QG - W6 0 0  4  8  9  15  6  12  16  0  0 0  4  8  QG - ER  12  16  0  6 12 18 24 30 36 42 48  0  R13 - W  6 0  3  D  9  3  6 -W CC 0  3  12  QG - CS  C  C  0  4  QG - M  8  3  12  0  6 12 18 24 30 36 42 48  0  16  QG - F  6 12 18 24 30 36 42 48  No. Individuals  No. Species / Strains  Figure 2-5 No. Individuals Species/strain accumulation curves using Mao Tau individual-based rarefaction with F E G H 15 replacement during early (solid), mid (dashed), and end (double 15 15 dashed) stages of 15 fermentation from spontaneous tanks (W, n=1) at (A) QGEW; (B) CCEW; and (C) 12 12 12 12 R13EW 9 9 6  6  3  3 CC - CS  0  No. Species / Strains  0 4  0  6 12 18 24 30 36 42 48  A  10  3 2 1 QG - CS  CC - ER  0  6 12 18 24 30 36 42 48  B  0  6  12  18  24  9  6  6  3  CC - M  3  0  0  6 12 18 24 30 36 42 48  C  10  8  8  8  6  6  6  4  4  4  2  QG - ER  2  QG - M  0 0  6 12 18 24 30 36 42 48  CC - F  0  0  10  0  0  9  6 12 18 24 30 36 42 48  D  2  QG - F  0 0  6 12 18 24 30 36 42 48  0  6 12 18 24 30 36 42 48  No. Individuals  Figure 2-6 Species/strain accumulation curves using Mao Tau individual-based rarefaction with replacement during cold-soak (CS), early (ER), mid (M), and end (F) stages (A-D) of the 2011 fermentation from inoculated tanks (n=3) at QGEW. Dashed lines indicate Mao Tau 95% upper and lower bound confidence intervals  88  Figure 2-7 2D nonmetric multidimensional scaling (NMS) ordination of QGEW (QG- red triangles), CCEW (CC- orange squares), and R13EW (R13- green circles) yeast species/strain assemblages detected in inoculated tanks (T1-T3) for early (ER), mid (M), and end (F) stages of fermentation. The percent of variation is 23.7% for the x-axis and 48.4% for the y-axis. The final stress is 15.90 and the resulting p-value is p = 0.002  89  Figure 2-8 2D nonmetric multidimensional scaling (NMS) ordination of QGEW (QG- red triangles), CCEW (CC- orange squares), and R13EW (R13- green circles) yeast species/strain assemblages detected in spontaneous (W) fermentation tanks for early (ER), mid (M), and end (F) stages of fermentation. The percent of variation is 64.9% for the x-axis and 15.0% for the y-axis. The final stress is 0.096 and the resulting p-value is p = 0.003  90  Figure 2-9 2D nonmetric multidimensional scaling (NMS) ordination of QGEW (QG- red triangles), CCEW (CC- orange squares), and R13EW (R13- green circles) yeast species/strain assemblages detected in cold-soak (CS) stage of fermentation in tanks (T1-T3). The percent of variation is 46.3% for the x-axis and 34.2% for the y-axis. The final stress is 12.37 and the resulting p-value is p = 0.003  91  Figure 2-10 2D nonmetric multidimensional scaling (NMS) ordination of QGEW inoculated fermentation tanks (T1-T3) yeast species/strain communities between years 2010 (red triangles) and 2011 (blue squares). The percent of variation is 54.4% for the x-axis and 17.8% for the y-axis. The final stress is 9.27 and the resulting p-value is p = 0.110  92  REFERENCES Altschul, S. F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D.J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nuc. Acids. Res. 25(17): 3389-3402. Barata, A., Malfeito-Ferreira, M., Loureiro V. 2012. The microbial ecology of wine grape berries. Int. J. Food Microbiol. 153: 243-259. Barrajón, N., Arevalo-Villena, M., Rodriguez-Aragon, L.J., and Briones, A. 2009. Ecological study of wine yeast in inoculated vats from La Mancha region. Food Control 20(9): 778-783. Beltran, G., Torija, M.J., Novo, M., Ferrer, N., Poblet, M., Guillamon, J.M., Rozes, N., and Mas, A. 2002. Analysis of yeast populations during alcoholic fermentation: A six year follow-up study. Syst. Appl. Microbiol. 25(2): 287-293. Bisson, L. 1999. Stuck and sluggish fermentations. American Journal of Enology and Viticulture. 50: 107–119. Bisson, L. and Karpel, J. 2010. Genetics of yeast impacting wine quality. Annu. Rev. Food Sci. Technol. 1:139–62. Blanco, P., R. Ramilo, M., Cerdeira, I., Orriols. 2006. Genetic diversity of wine Saccharomyces cerevisiae strains in an experimental winery from Galicia (NW Spain). Antonie van Leeuwenhoek. 89: 351-357. Boeke, JD. 1989. Transposable elements in Saccharomyces cerevisiae, in Howe MM (ed): Mobile DNA, pp 335–374. Bokulich, NA., Joesph, CML., Allen, G., Benson, AK., Mills, DA. 2012. Next-Generation Sequencing Reveals Significant Bacterial Diversity of Botrytized Wine. PLoS ONE. 7(5): e36357. doi:10.1371/journal.pone.0036357 Capece, A., Romaniello, R., Siesto, G., Romano, P. 2012. Diversity of Saccharomyces cerevisiae yeasts associated to spontaneously fermenting grapes from an Italian “heroic vine-growing area.” Food Microbiol. 31: 159-166. Cavalieri, D., McGovern, P., Hartl, D., Mortimer, R., Polsinelli, M. 2003. Evidence for S. cerevisiae fermentation in ancient wine. Mol Evol. 57:226–232. Chao, A., W.-H. Hwang, Y.-C. Chen, and C.-Y. Kuo. 2000. Estimating the number of shared species in two communities. Statistica Sinica. 10:227-246.  93  Chazdon, R. L., R. K. Colwell, J. S. Denslow, & M. R. Guariguata. 1998. Statistical methods for estimating species richness of woody regeneration in primary and secondary rain forests of NE Costa Rica. Pp. 285-309 in F. Dallmeier and J. A. Comiskey, eds. Forest biodiversity research, monitoring and modeling: Conceptual background and Old World case studies. Parthenon Publishing, Paris. Ciani, M., and Maccarelli, F. 1998. Oenological properties of non-Saccharomyces yeasts associated with winemaking. World J. Microbiol. Biotechnol. 14(2): 199-203. Ciani, M., Mannazzu, I., Marinangeli, P., Clementi, F., and Martini, A. 2004. Contribution of winery-resident Saccharomyces cerevisiae strains to spontaneous grape must fermentation. Antonie Van Leeuwenhoek. 85(2): 159-164. Clarke, K. R. 1993. Non-parametric multivariate analyses of changes in community structure. Australian Journal of Ecology. 18: 117-143. Clavijo, A., Calderon, I.L., and Paneque, P. 2011. Yeast assessment during alcoholic fermentation inoculated with a natural "pied de cuve" or a commercial yeast strain. World J. Microbiol. Biotechnol. 27(7): 1569-1577. Clavijo, A., Calderon, I.L., and Paneque, P. 2011b. Effect of the use of commercial Saccharomyces strains in a newly established winery in Rond (Malaga, Spain). Antonie van Leeuwenhoek. 99: 727-731. Colwell, R. K., C. X. Mao, & J. Chang. 2004. Interpolating, extrapolating, and comparing incidence-based species accumulation curves. Ecology. 85: 2717-2727. Colwell, R. K. 2005. EstimateS: Statistical estimation of species richness and shared species from samples. Version 8.2. User's Guide and application published at: http://purl.oclc.org/estimates. Combina, M., Elia, A., Mercado, L., Catania, C., Ganga, A., and Martinez, C. 2005. Dynamics of indigenous yeast populations during spontaneous fermentation of wines from Mendoza, Argentina. Int. J. Food Microbiol. 99(3): 237-243. Constanti, M., Poblet, M., Arola, L., Mas, A., and Guillamon, J.M. 1997. Analysis of yeast populations during alcoholic fermentation in a newly established winery. Am. J. Enol. Vitic. 48(3): 339-344. Cordero-Bueso, G., Arroyo, T., Serrano, A., Tello, J., Aporta, I., Dolores Velez, M., and Valero, E. 2011. Influence of the farming system and vine variety on yeast communities associated with grape berries. Int. J. Food Microbiol. 145(1): 132139.  94  Csoma, H., Zakany, N., Capece, A., Romano, P., and Sipiczki, M. 2010. Biological diversity of Saccharomyces yeasts of spontaneously fermenting wines in four wine regions: Comparative genotypic and phenotypic analysis. Int. J. Food Microbiol. 140(2-3): 239-248. Delteil, D. 2001. Aspectos prácticos del levadurado en condiciones mediterráneas. Técnica de inoculación y relación entre la población seleccionada y la población indígena. Revue Française d’nologie, 189. Field, D., and Wills, C. 1998. Abundant microsatellite polymorphism in Saccharomyces cerevisiae, and the different distributions of microsatellites in eight prokaryotes and S-cerevisiae, result from strong mutation pressures and a variety of selective forces. Proc. Natl. Acad. Sci. U. S. A. 95(4): 1647-1652. Fleet, G.H. 2003. Yeast interactions and wine flavor. Int. J. Food Microbiol. 86:11-22. Fleet, G.H. 2007. Yeasts in foods and beverages: impact on product quality and safety. Curr. Opin. Biotechnol. 18(2): 170-175. Fleet, G.H. 2008. Wine yeasts for the future. FEMS Yeast Research. 8:979-995. Fleet, G. and Heard, G. 1993. Yeast growth during fermentation. In G. Fleet (Ed.), Wine Microbiology and Biotechnology (pp. 27–57). Berna: Harwood Academic Publishers. Frezier, V., and Dubourdieu, D. 1992. Ecology of Yeast-Strain Saccharomyces cerevisiae during spontaneous fermentation in a Bordeaux winery. Am. J. Enol. Vitic. 43(4): 375-380. Ganga, M.A., and Martinez, C. 2004. Effect of wine yeast monoculture practice on the biodiversity of non-Saccharomyces yeasts. J. Appl. Microbiol. 96(1): 76-83. Gardes M and TD Bruns. 1993. ITS primers with enhanced specificity for basidiomycetes-application to the identification of mycorrhizae and rusts. Mol Ecol, 2: 113-118. Garijo, P., Santamaria, P., Lopez, R., Sanz, S., Olarte, C., and Gutierrez, A.R. 2008. The occurrence of fungi, yeasts and bacteria in the air of a Spanish winery during vintage. Int. J. Food Microbiol. 125(2): 141-145. Goddard, M.R. 2008. Quantifying the complexities of Saccharomyces cerevisiae's ecosystem engineering via fermentation. Ecology. 89(8): 2077-2082. Goddard, M.R., Anfang, N., Tang, R., Gardner, R.C., and Jun, C. 2010. A distinct population of Saccharomyces cerevisiae in New Zealand: evidence for local dispersal by insects and human-aided global dispersal in oak barrels. Environ. Microbiol. 12(1): 63-73. 95  Hall, B., Durall, D., Stanley, G. 2011. Population dynamics of Saccharomyces cerevisiae during spontaneous fermentation at a British Columbia Winery. Am. J. Enol. Vitic. 62: 66-72. Hamady M, Walker JJ, Harris JK, Gold NJ, Knight R. 2008. Error-correcting barcoded primers for pyrosequencing hundreds of samples in multiplex. Nat Methods. 5: 235–237. Hansen, E., Nissen, P., Sommer, P., Nielsen, J., Arneborg, N. 2001. The effect of oxygen on the survival of non-Saccharomyces yeasts during mixed culture fermentation of grape juice with Saccharomyces cerevisiae. J. Appl. Microbiol. 91: 541– 547. Hayek, L. C., & M. A. Buzas. 1996. Surveying natural populations. Columbia University Press, NY. Heard GM & Fleet GH. 1987. Occurrence and growth of killer yeasts during wine fermentation. J. Appl. Envir. Microbiol. 53: 2171-2174. Hierro, N., Gonzalez, A., Mas, A., and Guillamon, J.M. 2006. Diversity and evolution of non-Saccharomyces yeast populations during wine fermentation: effect of grape ripeness and cold maceration. Fems Yeast Res. 6(1): 102-111. Infante, JJ., Dombek, KM., Rebordinos, L. 2003. Genome-wide amplifications caused by chromosomal rearrangements play a major role in the adaptive evolution of natural yeast. Genetics. 165(4): 1745-1759. Jolly, N.P., Augustyn, O.P.H., Pretorius, I.S., 2003. The occurrence of nonSaccharomyces cerevisiae yeast species over three vintages in four vineyards and grape musts from four production regions of the Western Cape, South Africa. South African. J. Enol. Viticul. 24(2): 35– 42. Kluftinger, A., Durall, D., Stanley, G. 2009; unpublished data. Assessment of wine yeast from cold-soak and end stage fermentation at a British Columbia winery. Lachance M.A., Gilbert D.G., Starmer W.T. 1994. Yeast communities associated with Drosophila species and related flies in eastern oak-pine forests: a comparison with western communities, J. Industr. Microbiol. 14: 484–494. Le Jeune, C., Erny, C., Demuyter, C., and Lollier, M. 2006. Evolution of the population of Saccharomyces cerevisiae from grape to wine in a spontaneous fermentation. Food Microbiol. 23(8): 709-716. Legras, J.L., Ruh, O., Merdinoglu, D., and Karst, F. 2005. Selection of hypervariable microsatellite loci for the characterization of Saccharomyces cerevisiae strains. Int. J. Food Microbiol. 102(1): 73-83.  96  Li, E., Liu, A., Xue, B., and Liu, Y. 2011. Yeast species associated with spontaneous wine fermentation of Cabernet Sauvignon from Ningxia, China. World J. Microbiol. Biotechnol. 27(10): 2475-2482. Lopes, C.A., van Broock, M., Querol, A., and Caballero, A.C. 2002. Saccharomyces cerevisiae wine yeast populations in a cold region in Argentinean Patagonia. A study at different fermentation scales. J. Appl. Microbiol. 93(4): 608-615. Lopes, C. A., Rodríguez, M. E., Sangorrín, M., Querol, A., & Caballero, A. C. 2007. Patagonian wines: Implantation of an indigenous strain of Saccharomyces cerevisiae in fermentations conducted in traditional and modern cellars. J. Ind. Microbiol. Biotechnol. 34: 139–149. Magurran, A. E. 1988. Ecological diversity and its measurement. Princeton University Press, Princeton, N. J. Magurran, A. E. 2004. Measuring biological diversity. Blackwell. Magyar, I; and Toth, T. 2011. Comparative evaluation of some oenological properties in wine strains of Candida stellata, Candida zemplinina, Saccharomyces uvarum and Saccharomyces cerevisiae. J. Food Microbiol. 28(1): 94-100. Mao, C. X., R. K. Colwell, and J. Chang. 2005. Estimating species accumulation curves using mixtures. Biometrics. 61:433–441. Maier, W., Begerow, D., Weiss, M., and Oberwinkler, F. 2003. Phylogeny of the rust fungi: an approach using nuclear large subunit ribosomal DNA sequences. Can. J. Bot. 81, 12–23. Maro, E.D., Ercolini, D., Coppola, S. 2007. Yeast dynamics during spontaneous wine fermentation of the Catalenesca grape. In. J. Food Microbiol. 117: 201-210. Martini, A. 1993. Origin and domestication of the wine yeast Saccharomyces cerevisiae. J. Wine Res. 4(3): 165– 176. Mateo, J., Jimenez, M., Huerta, T., Pastor, A. 1991. Contribution of different yeasts isolated from musts of Monastrell grapes to the aroma of wine. Int. J. Food Microbiol. 12: 153-160. Mateo, J.J., Jimenez, M., Huerta, T., and Pastor, A. 1992. Comparison of volatiles produced by 4 Saccharomyces cerevisiae strains isolated from Monastrell musts. Am. J. Enol. Vitic. 43(2): 206-209. McCune, B., and J. B. Grace. 2002. Analysis of Ecological Communities. MJM Software Design, Gleneden Beach, Oregon. McCune, B., and M. J. Mefford. 2011. PC-ORD. Multivariate analysis of ecological data. MJM Software design. Gleneden Beach, Oregon, USA. 97  Mercado, L., Dalcero, A., Masuelli, R., and Combina, M. 2007. Diversity of Saccharomyces strains on grapes and winery surfaces: Analysis of their contribution to fermentative flora of Malbec wine from Mendoza (Argentina) during two consecutive years. Food Microbiol. 24(4): 403-412. Mercado, L., Jubany, S., Gaggero, C., Masuelli, R., and Combina, M. 2010. Molecular relationships between Saccharomyces cerevisiae strains involved in winemaking from Mendoa, Argentina. Curr Microbiol. 61: 506-514. Mieczkowski Piotr A., Lemoine Francene J., Petes Thomas D. 2006. Recombination between retrotransposons as a source of chromosome rearrangements in the yeast Saccharomyces cerevisiae. DNA Repair. 5(9-10): 1010-1020. Mortimer, RK. 2000. Evolution and variation of the yeast (Saaccharomyces) genome. J. Genome Res. 10(4): 403-409. Mortimer, R., and Polsinelli, M. 1999. On the origins of wine yeast. Res. Microbiol. 150(3): 199-204. Nissen, P., and Arneborg, N. 2003. Characterization of early deaths of nonSaccharomyces yeasts in mixed cultures with Saccharomyces cerevisiae. Arch. Microbiol. 180(4): 257-263. Nissen, P., Nielsen, D., and Arneborg, N. 2003. Viable Saccharomyces cerevisiae cells at high concentrations cause early growth arrest of non-Saccharomyces yeasts in mixed cultures by a cell-cell contact-mediated mechanism. Yeast 20(4): 331-341. Ocon, E., Gutierrez, A.R., Garijo, P., Tenorio, C., Lopez, I., Lopez, R., and Santamaria, P. 2010. Quantitative and qualitative analysis of non-Saccharomyces yeasts in spontaneous alcoholic fermentations. Euro. Food Res. Technol. 230(6): 885-891. Pallmann, C.L., J.A. Brown, T.L. Olineka, L. Cocolin, D.A. Mills, and L.F. Bisson. 2001. Use of WL medium to profile native flora fermentations. Am. J. Enol. Vitic. 52:198-203. Peck, J.E. 2010. Multivariate Analysis for Community Ecologists. Step-by-Step using PCORD. MJM Software Design, Gleneden Beach, Oregon. 162 pp. Perez, M.A., Gallego, F.J., Martinez, I., and Hidalgo, P. 2001. Detection, distribution and selection of microsatellites (SSRs) in the genome of the yeast Saccharomyces cerevisiae as molecular markers. Lett. Appl. Microbiol. 33(6): 461-466. Pina, C., Santos, C., Couto, J.A., and Hogg, T. 2004. Ethanol tolerance of five nonSaccharomyces wine yeasts in comparison with a strain of Saccharomyces cerevisiae - influence of different culture conditions. Food Microbiol. 21(4): 439447.  98  Pretorius, I.S. 2000. Tailoring wine yeast for the new millennium: novel approaches to the ancient art of winemaking. Yeast 16(8): 675-729. Pulvirenti, A., Rainieri, S., Boveri, S., and Giudici, P. 2009. Optimizing the selection process of yeast starter cultures by preselecting strains dominating spontaneous fermentations. Can. J. Microbiol. 55(3): 326-332. Rainieri S and Pretorious IS. 2000. Selection and improvement of wine yeasts. Annals. Microbiol. 50: 15-31. Renouf, V., Claisse, O., and Lonvaud-Funel, A. 2005. Understanding the microbial ecosystem on the grape berry surface through numeration and identification of yeast and bacteria. Aust. J. Grape Wine Res. 11(3): 316-327. Ribereau-Gayon, P., Dubourdieu, D., Doneche, B., and Lonvaud, A. Handbook of Enology, Vol.1: The microbiology of Wine and Vinifications. (John Wiley and Sons Ldt. eds.) West Sussex, England 2000. Richards, K.D., Goddard, M.R., and Gardner, R.C. 2009. A database of microsatellite genotypes for Saccharomyces cerevisiae. Antonie Van Leeuwenhoek. 96(3): 355-359. Ristow, H., Seyfarth, A., Lochmann, E-R. 1995. Chromosomal damages by ethanol and acetaldehyde in Saccharomyces cerevisiae as studied by pulsed field gel electrophoresis. Mutat Res. 326:165–170. Romano, P., Fiore, C., Paraggio, M., Caruso, M., and Capece, A. 2003. Function of yeast species and strains in wine flavour. Int. J. Food Microbiol. 86(1-2): 169-180. Sabate, J., Cano, J., Esteve-Zarzoso, B., and Guillamon, J.M. 2002. Isolation and identification of yeasts associated with vineyard and winery by RFLP analysis of ribosomal genes and mitochondrial DNA. Microbiol. Res. 157(4): 267-274. Santamaria, P., Garijo, P., Lopez, R., Tenorio, C., and Gutierrez, A.R. 2005. Analysis of yeast population during spontaneous alcoholic fermentation: Effect of the age of the cellar and the practice of inoculation. Int. J. Food Microbiol. 103(1): 49-56. Schuller, D; Valero, E; Dequin, S; Casal, M. 2004. Survey of molecular methods for the typing of wine yeast strains. FEMS Microbiol. Lett. 231(1): 19-26. Schuller, D., and Casal, M. 2007. The genetic structure of fermentative vineyardassociated Saccharomyces cerevisiae populations revealed by microsatellite. Antonie Van Leeuwenhoek. 91(2): 137-150. Schuller D, Cardoso F, Sousa S, Gomes P, Gomes AC, et al. 2012. Genetic diversity and population structure of Saccharomyces cerevisiae strains isolated from different grape varieties and winemaking regions. PLoS ONE 7(2): e32507.  99  Schutz, M., and Gafner, J. 1993. Analysis of yeast diversity during spontaneous and induced alcoholic fermentations. J. Appl. Bacteriol. 75(6): 551-558. Soubeyrand, V., Julien, A., and Sablayrolles, J. 2006. Rehydration protocols for active dry wine yeasts and the search for early indicators of yeast activity. Am. J. Enol. Vitic. 57(4): 474-480. Sipiczki, M. 2011. Diversity, variability and fast adaptive evolution of the wine yeast (Saccharomyces cerevisiae) genome-a review. Ann. Microbiol. 61(1): 85-93. Stevic, S. 1962. The significance of bees (Apis sp.) and wasps (Vespa sp.) as carriers of yeast for the micoflora of grapes and the quality of wine, Arkhiv. Poljjoprivredne Nauke. 50: 80–92. Strand, M., Prolla, T.A., Liskay, R.M., and Petes, T.D. 1993. Destabilization of tracts of simple repetitive DNA in yeast by mutations affecting DNA mismatch repair. Nature. 365: 274-276. Techera, A.G., Jubany, S., Carrau, F.M., and Gaggero, C. 2001. Differentiation of industrial wine yeast strains using microsatellite markers. Lett. Appl. Microbiol. 33(1): 71-75. Tello, J., Cordero-Bueso, G., Aporta, I., Cabellos, J.M., and Arroyo, T. 2012. Genetic diversity in commercial wineries: effects of the farming system and vinification management on wine yeasts. J. Appl. Microbiol. 112(2): 302-315. Tofalo, R., Schirone, M., Telera, G.C., Manetta, A.C., Corsetti, A., and Suzzi, G. 2011. Influence of organic viticulture on non-Saccharomyces wine yeast populations. Ann. Microbiol. 61(1): 57-66. Torija, M.J., Rozes, N., Poblet, M., Guillamon, J.M., and Mas, A. 2001. Yeast population dynamics in spontaneous fermentations: Comparison between two different wine-producing areas over a period of three years. Antonie Van Leeuwenhoek. 79(3-4): 345-352. Valero, E., Schuller, D., Cambon, B., Casal, M., and Dequin, S. 2005. Dissemination and survival of commercial wine yeast in the vineyard: A large-scale, three-years study. FEMS Yeast Res. 5(10): 959-969. Vaughan-Martini, A., and Martini, A. 1995. Facts, myths and legends on the prime industrial microorganism. J. Ind. Microbiol. 14(6): 514-522. Vilanova, M., and Masneuf-Pomarede, I. 2005. Effect of three Saccharomyces cerevisiae strains on the volatile composition of Albarino wines. Ital. J. Food Sci. 17(2): 221-227.  100  White TJ, T Burn, S Lee and J Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Shinsky JJ, White TJ (eds). PCR Protocols: A Guide to Methods & Applications, Academic Press, San Diego, USA, pp: 315-322. Zagorc T, Maraz A, Cadez N, Povhe Jemec K, Peter G, Resnik M, Nemanic J., and Raspor, R. 2001. Indigenous wine killer yeasts and their application as a start culture in wine fermentation. J. Food Microbiol. 18: 441-451. Zott, K., Miot-Sertier, C., Claisse, O., Lonvaud-Funel, Aline., Masneuf-Pomarede, I. 2008. Dynamics and diversity of non-Saccharomyces yeasts during the early stages in winemaking. Int. J. Food Microbiol. 125: 197-203.  101  APPENDIX A Table A-1 Commercial S. cerevisiae ADY microsatellite database constructed at UBCO Strain  Loci C5 Lallemand W15 c 136 Lallemand L2056 c 133/175 Lallemand BA11 c 133 Lallemand BM45c 132 Lallemand D47 c 133 Lallemand QA23 c Lallemand EC1118 c 136/145 Lallemand Syrahc 133/172 Lallemand DV10c 135/146 Lalvin Level 2TD 7315 c 133 Lalvin RC212a 132 Lalvin ICV-D254a* 134 Lalvin BRL97 a 133 Lalvin CY3079a 134 SIHA® Active Yeast 7b 178 Fermol Blancc 133 Fermol Chardonnay c 133/144 Fermol Mediterranean c 133 Fermol Arome Plusa 134/150 Fermol Super 16 a 150 Fermol Sauvignon c 134 Fermol Premier Cru a* 134 Fermol Complete Killera 145 Red Star Cotes des Blancsa 154 Red Start Montracheta 132 Red Star Premier Cuveea 136/145 Anchor Vin 13 b 133 Anchor Vin 7 c 133 Anchor Exoticc 133 Anchor NT116 c 133 Zymaflore FX10 c 134 Zymaflore VL1c 133/150 Zymaflore VL3c 133 Zymaflore RB2c 133 Zymaflore RX60 c 131/150 Zymaflore X16c 131/151 Zymaflore X5 c 133/150  C11 235 215/225 221 237 207/214 204/230 205/229 215/225 205/229 207/237 201/233 201 207/215 229 206 204/229 204/229 206/215 229 211/235 210/236 201 205/229 236/244 229/252 205/229 206/229 205 206 205 235 226 226 231 207/229 229 229  C4 271 260/276 275 272 255/261 321 321 260/275 321 263/272 267/273 267 255 255 264 322 322 254 264/273 263/267 263/267 267 319/322 273 264 322 263 260 263 263 269 263/272 263/272 269 269/272 269/272 263/272  SCAAT1 228 222/271 231 228 249 216/ 265 216/ 265 222/ 272 216/ 265 265 222 249 222/240 243 231 198/231 222 216/265 216/ 225 219 216/265 216/256 219 231/246 243/246 299/308  SCYOR267c 293/326 293 293/304 293/337 293 292 319/325 293 293 293 326/370 293 293 293 338 319/325 319/325 293 305 305 303 293 320 335 357 320/326 293/326 318 293/326 325 337 305 293 360 304/357 305/356 293/326  YPL009c 300 260/323 281 316 316 291/304 291/303 260/323 290/303 291/316 319/322 319 316 316 275 291/303 291/303 316 316/319 316 316 319 290/303 319 316/325 290/303 291/295 305 293 290/303 315 316/319 316/319 319 316 316 290/319  a  Yeast added to UBCO microsatellite database in 2007 (Hall et al. 2011) Yeast added to UBCO microsatellite database in 2009 (Kluftinger et al unpublished data) c Most recent yeast added to commercial ADY microsatellite database in 2010 *Strains that share identical microsatellite fingerprints b  102  Table A-2 Primer information for ten loci evaluated by microsatellite DNA analysis (bp = basepairs) Primer Name C3  Locus YGL139W  Chromosome VII  C5  YFR028C  VI  C8  YGL014W  VII  C11  C11  X  C4  C4  XV  YPL009c  YPL009c  XV1  YML091c  YML091C  XIII  SCYOR267C  SCYOR267C  -  SCAAT1  SCAAT1  XIII  SCAAT3  YDR160W  IV  1 2  Sequence GTGTCTCTTTTTATTTACGAGCGGGCCAT1 AAATCTCATGCCTGTGAGGGGTAT2 GTGTCTTGACACAATAGCAATGGCCTTCA1 GCAAGCGACTAGAACAACAATCACA2 GTGTCTCAGGTCGTTCTAACGTTGGTAAAATG 1 GCTGTTGCTGTTGGTAGCATTACTGT 2 TTCCATCATAACCGTCTGGGATT 1 TGCCTTTTTCTTAGATGGGCTTTC 2 AGGAGAAAAATGCTGTTTATTCTGACC1 TTTTCCTCCGGGACGTGAAATA 2 AACCCATTGACCTCGTTACTATCGT 1 TTCGATGGCTCTGATAACTCCATTC 2 GTGTCTAAGCCTCTTCAAGCATGAC1 GTGTCTGGACAATTTTGCCACCTTA2 TACTAACGTCAACACTGCTGCCAA 1 GGATCTACTTGCAGTATACGGG2 AAAGCGTAAGCAATGGTGTAGATACTT 1 CAAGCCTCTTCAAGCATGACCTTT2 GTGTCTGAGGAGGGAAATGGACAG 1 GCCTGAAGATGCTTTTAG2  Range (bp) 95 - 135  Reference Legras et al. 2005  112-189  Legras et al. 2005  124-156  Legras et al. 2005  179-249  Legras et al. 2005  226-372  Legras et al. 2005  231-306  Legras et al. 2005  245-327 266-425  Field and Wills 1999 Perez et al. 2001 Legras et al. 2005  266-425  Legras et al. 2005  379-484  Field and Wills 1999 Perez et al. 2001  Forward primer Reverse primer  103  Table A-3 Yeast species/strain frequency of occurrence from inoculated (T1-T3) tanks during cold-soak (CS), early (ER), mid (M), and end (F) stages of fermentation at QGEW, CCEW, and R13EW in the 2010 vintage Species/Strain  QGEW- Inoculated fermentaton tanks QG-T1 QG-T2  CCEW- Inoculated fermentation tanks CC-T1 CC-T2  QG-T3  R13EW- Inoculated fermentation tanks R13-T1 R13-T2  CC-T3  R13-T3  Henseniaspora uvarum  CS 1.00  ER -  M -  F -  CS 1.00  ER 0.06  M -  F -  CS 1.00  ER -  M -  F -  CS 0.88  ER -  M -  F -  CS 0.82  ER -  M -  F -  CS 0.94  ER 0.13  M -  F -  CS 0.75  ER -  M -  F -  CS 0.75  ER -  M -  F -  CS 0.50  ER -  M -  F -  Saccharomyces uvarum  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  0.06  -  -  -  -  -  -  -  -  0.13  -  -  -  0.19  -  -  -  -  -  -  Saccharomyces bayanus  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  0.06  -  -  -  -  -  -  -  -  -  -  Metschnikowia pulcherrima  -  -  -  -  -  -  -  -  -  -  -  -  0.06  0.13  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  Metschnikowia fructicola  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  0.13  -  -  -  -  -  -  -  0.06  -  -  -  Torulaspora delbrueckii  -  -  -  -  -  -  -  -  -  -  -  -  -  0.25  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  0.19  0.06  -  -  -  -  -  Wickerhamomyces anomalus -  -  -  -  -  -  -  -  -  -  -  -  -  0.06  -  -  -  -  -  -  -  -  -  -  -  -  -  -  0.06  -  -  -  -  -  -  -  Pichia anomala  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  0.06  -  -  -  -  -  -  -  -  -  -  -  Lalvin® RC212  -  0.25  0.25  0.19  -  0.25  0.06  0.13  -  1.00  0.81  0.69  -  0.13  -  -  -  0.44  0.13  0.25  -  0.56  0.50  0.31  -  0.81  1.00  0.88  0.13  0.63  0.81  1.00  0.31  0.94  1.00  0.94  Lalvin® ICV-D254  -  0.25  0.31  0.38  -  0.56  0.69  0.75  -  -  0.13  0.25  0.06  0.13  0.50  0.44  0.06  0.13  0.50  0.50  -  0.19  0.19  0.38  -  -  -  -  -  -  -  -  -  -  -  -  Lalvin® CY3079  -  0.19  -  0.06  -  -  0.06  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  Fermol® AP  -  0.06  0.25  0.19  -  0.06  0.06  0.06  -  -  0.06  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  RS® PCuvee  -  -  -  -  -  -  0.06  -  -  -  -  0.06  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  Laffort® Zymaflore FX10  -  -  -  -  -  -  -  -  -  -  -  -  -  0.06  -  0.06  -  -  0.06  0.06  -  -  0.06  0.13  -  -  -  -  -  -  -  -  -  -  -  -  Laffort® Zymaflore X5  -  -  -  -  -  -  -  -  -  -  -  -  -  0.13  0.19  0.31  0.06  0.13  0.13  0.06  0.06  0.13  -  0.13  -  -  -  -  -  -  -  -  -  -  -  -  Laffort® Zymaflore VL1  -  -  -  -  -  -  -  -  -  -  -  -  -  -  0.13  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  Lallemand® D47  -  -  -  -  -  -  -  -  -  -  -  -  -  0.06  0.13  -  -  0.25  0.19  0.13  -  -  0.25  0.06  -  -  -  -  -  -  -  -  -  -  -  -  Lallemand® L2056  -  -  -  -  -  -  -  -  -  -  -  -  -  0.06  0.06  0.13  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  Enoferm® AMH  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  0.06  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  Lallemand® EC1118  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  0.13  -  -  -  -  -  -  -  -  QG-UN01  -  -  0.13  0.06  -  -  0.06  0.06  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  QG-UN02  -  0.06  0.06  0.13  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  QG-UN03  -  0.13  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  QG-UN04  -  0.06  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  QG-UN05  -  -  -  -  -  0.06  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  CC-UN01  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  0.06  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  R13-UN01  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  0.06  -  -  R13-UN02  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  0.06  -  -  -  -  -  R13-UN04  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  0.06  -  -  -  -  0.06  R13-UN15  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  -  0.06  -  -  -  0.06  -  -  -  0.13  -  -  -  104  Table A-4 Yeast species/strain frequency of occurrence from the spontaneous (W) tank during early (ER), mid (M), and end (F) stages of fermentation at QGEW, CCEW, and R13EW in the 2010 vintage  Henseniaspora uvarum  Spontaneous fermentation tanks QG-W CC-W ER M F ER M 0.13 0.06 -  F -  R13-W ER M -  F -  Lalvin® RC212  0.31  0.38  0.31  -  -  0.06  0.13  0.19  0.13  Lalvin® ICV-D254  0.38  0.38  0.63  0.81  0.63  0.63  -  -  -  Fermol® AP  0.06  -  -  -  -  -  -  -  -  Lallemand® L2056  -  -  -  0.06  0.25  0.25  -  0.06  0.06  Laffort® Zymaflore X5  -  -  -  0.13  0.13  -  -  -  -  Lallemand® EC1118  -  -  -  -  -  0.06  -  -  -  QG-UN01  0.13  0.13  0.06  -  -  -  -  -  -  QG-UN02  -  0.06  -  -  -  -  -  -  -  R13-UN02  -  -  -  -  -  -  -  0.06  -  R13-UN03  -  -  -  -  -  -  0.06  -  -  R13-UN05  -  -  -  -  -  -  0.13  -  -  R13-UN06  -  -  -  -  -  -  -  0.38  0.25  R13-UN07  -  -  -  -  -  -  -  0.06  0.13  R13-UN08  -  -  -  -  -  -  0.06  -  -  R13-UN09  -  -  -  -  -  -  0.06  -  -  R13-UN10  -  -  -  -  -  -  0.06  -  -  R13-UN11  -  -  -  -  -  -  -  0.06  -  R13-UN12  -  -  -  -  -  -  0.25  0.06  0.06  R13-UN13  -  -  -  -  -  -  -  -  0.06  R13-UN14  -  -  -  -  -  -  0.25  0.13  0.30  105  Table A-5 Yeast species/strain frequency of occurrence from inoculated tanks during cold-soak (CS), early (ER), mid (M), and end (F) stages of fermentation at QGEW from the 2011 vintage Species/Strain  H. uvarum  2011 Inoculated fermentation tanks QG-T1 QG-T2 CS ER M F CS ER 1.00 0.88 -  M -  F -  QG-T3 CS ER 1.00 -  M -  F -  Lalvin® RC212  -  0.63  0.19  0.60  -  0.94  1.00  0.94  -  0.56  0.81  0.75  Lalvin® ICV-D254  -  0.25  0.56  0.40  -  -  -  -  -  0.38  0.13  0.25  Lalvin® BRL97  -  -  -  -  -  0.06  -  -  -  -  -  -  Fermol® AP  -  0.06  0.13  -  -  -  -  -  -  -  -  -  RS® PCuvee  -  -  0.13  -  0.12  -  -  -  -  -  -  -  QG-UN06  -  0.06 -  -  -  -  -  -  -  -  -  -  QG-UN07  -  -  -  -  -  -  -  -  -  -  0.06  -  QG-UN08  -  -  -  -  -  -  -  0.06  -  0.06  -  -  106  Table A-6 Accession number (#) and percent (%) similarity for the BLAST matches of nonSaccharomyces isolates detected in inoculated (T1-T3) or spontaneous (W) fermentation tanks for Quails’ Gate (QG); Cedar Creek (CC); Road13 (R13) Estate Wineries; and Quails’ Gate 2011 vintage (QG-2011) isolated in cold-soak (CS), early (ER), or mid (M) stages of fermentation. Amplification of ITS and D1/D2 regions of ribosomal DNA using ITS1f/ITS4 and NL1/NL4 universal primer sets Winery-Tank-Stage-IsolatePrimer QG-T1-CS-1-ITS1f/ITS4 QG-T1-CS-1-NL1/NL4  Identification  Accession #  % Similarity  Hanseniaspora uvarum Hanseniaspora uvarum  AY235806.1 JN083823.1  99 100  QG-T1-CS-2-ITS1f/ITS4 QG-T1-CS-2-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515233.1 FJ515233.1  99 100  QG-T1-CS-3-ITS1f/ITS4 QG-T1-CS-3-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515233.1 FJ515233.1  99 100  QG-T1-CS-4-ITS1f/ITS4 QG-T1-CS-4-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515233.1 FJ515233.1  99 100  QG-T1-CS-5-ITS1f/ITS4 QG-T1-CS-5-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  AY235806.1 JN083823.1  98 100  QG-T1-CS-6-ITS1f/ITS4 QG-T1-CS-6-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515233.1 FJ515233.1  99 100  QG-T1-CS-7-ITS1f/ITS4 QG-T1-CS-7-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515233.1 FJ515233.1  99 100  QG-T1-CS-8-ITS1f/ITS4 QG-T1-CS-8-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515233.1 JN377483.1  99 100  QG-T1-CS-9-ITS1f/ITS4 QG-T1-CS-9-NL1/NL4  Hanseniaspora uvarum -  GU237050.1 -  99 -  QG-T1-CS-10-ITS1f/ITS4 QG-T1-CS-10-NL1/NL4  Hanseniaspora uvarum -  GU237050.1 -  99 -  QG-T1-CS-11-ITS1f/ITS4 QG-T1-CS-11-NL1/NL4  Hanseniaspora uvarum  JN083823.1  100  QG-T1-CS-12-ITS1f/ITS4 QG-T1-CS-12-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  98 100  QG-T1-CS-13-ITS1f/ITS4 QG-T1-CS-13-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  98 100  QG-T1-CS-14-ITS1f/ITS4 QG-T1-CS-14-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  AY046200 JN214494.1  100 100  107  Table A-6 continued… QG-T1-CS-15-ITS1f/ITS4 QG-T1-CS-15-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  HM601459.1 JN377483.1  100 100  QG-T1-CS-16-ITS1f/ITS4 QG-T1-CS-16-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  100 100  QG-T2-CS-1-ITS1f/ITS4 QG-T2-CS-1-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  AY235806.1 FM180536  99 99  QG-T2-CS-2-ITS1f/ITS4 QG-T2-CS-2-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  AY235806.1 FM180536  99 99  QG-T2-CS-3-ITS1f/ITS4 QG-T2-CS-3-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  AY235806.1 JN083823.1  99 100  QG-T2-CS-4-ITS1f/ITS4 QG-T2-CS-4-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  AY235806.1 JN083819.1  99 100  QG-T2-CS-5-ITS1f/ITS4 QG-T2-CS-5-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  99 99  QG-T2-CS-6-ITS1f/ITS4 QG-T2-CS-6-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  99 99  QG-T2-CS-7-ITS1f/ITS4 QG-T2-CS-7-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GQ480362.1 JN083823.1  100 100  QG-T2-CS-8-ITS1f/ITS4 QG-T2-CS-8-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  98 100  QG-T2-CS-9-ITS1f/ITS4 QG-T2-CS-9-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GU237050.1 JN214494.1  99 100  QG-T2-CS-10-ITS1f/ITS4 QG-T2-CS-10-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GU237050.1 JN214494.1  99 100  QG-T2-CS-11-ITS1f/ITS4 QG-T2-CS-11-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GU237050.1 JN214494.1  99 100  QG-T2-CS-12-ITS1f/ITS4 QG-T2-CS-12-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GU237050.1 JN214494.1  100 100  QG-T2-CS-13-ITS1f/ITS4 QG-T2-CS-13-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GU237050.1 JN214494.1  100 100  QG-T2-CS-14-ITS1f/ITS4 QG-T2-CS-14-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GU237050.1 JN214494.1  100 100  QG-T2-CS-15-ITS1f/ITS4 QG-T2-CS-15-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  100 100  108  Table A-6 continued… QG-T2-CS-16-ITS1f/ITS4 QG-T2-CS-16-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GU237050.1 JN214494.1  100 100  QG-T3-CS-1-ITS1f/ITS4 QG-T3-CS-1-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  99 100  QG-T3-CS-2-ITS1f/ITS4 QG-T3-CS-2-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  99 100  QG-T3-CS-3-ITS1f/ITS4 QG-T3-CS-3-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FM180535.1  99 98  QG-T3-CS-4-ITS1f/ITS4 QG-T3-CS-4-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FM199954  99 99  QG-T3-CS-5-ITS1f/ITS4 QG-T3-CS-5-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  99 100  QG-T3-CS-6-ITS1f/ITS4 QG-T3-CS-6-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GU237050 JN083823.1  100 99  QG-T3-CS-7-ITS1f/ITS4 QG-T3-CS-7-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  99 100  QG-T3-CS-8-ITS1f/ITS4 QG-T3-CS-8-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 FR751341.1  99 99  QG-T3-CS-9-ITS1f/ITS4 QG-T3-CS-9-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  100 100  QG-T3-CS-10-ITS1f/ITS4 QG-T3-CS-10-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  AY235806 JN214494.1  100 100  QG-T3-CS-11-ITS1f/ITS4 QG-T3-CS-11-NL1/NL4  Hanseniaspora uvarum -  FR751341.1 -  99 -  QG-T3-CS-12-ITS1f/ITS4 QG-T3-CS-12-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  HM601459.1 HM988687.1  100 100  QG-T3-CS-13-ITS1f/ITS4 QG-T3-CS-13-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GU237050.1 JN214494.1  100 100  QG-T3-CS-14-ITS1f/ITS4 QG-T3-CS-14-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  99 100  QG-T3-CS-15-ITS1f/ITS4 QG-T3-CS-15-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  99 100  QG-T3-CS-16-ITS1f/ITS4 QG-T3-CS-16-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GU237050.1 JN214494.1  100 100  109  Table A-6 continued… CC-T1-CS-1-ITS1f/ITS4 CC-T1-CS-1-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  99 100  CC-T1-CS-2-ITS1f/ITS4 CC-T1-CS-2-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  JN377484 DQ659342.1  100 97  CC-T1-CS-3-ITS1f/ITS4 CC-T1-CS-3-NL1/NL4  Hanseniaspora uvarum -  JN377484 -  100 -  CC-T1-CS-4-ITS1f/ITS4 CC-T1-CS-4-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  96 98  CC-T1-CS-5-ITS1f/ITS4 CC-T1-CS-5-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  100 100  CC-T1-CS-6-ITS1f/ITS4 CC-T1-CS-6-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  98 100  CC-T1-CS-7-ITS1f/ITS4 CC-T1-CS-7-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  JN214494.1 FR751341  100 100  CC-T1-CS-8-ITS1f/ITS4 CC-T1-CS-8-NL1/NL4  Metschnikowia pulcherrima Metschnikowia sp.  HM627099.1 AY235809  100 89  CC-T1-CS-9-ITS1f/ITS4 CC-T1-CS-9-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515178.1  97 99  CC-T1-CS-10-ITS1f/ITS4 CC-T1-CS-10-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  96 100  CC-T1-CS-11-ITS1f/ITS4 CC-T1-CS-11-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  96 100  CC-T1-CS-12-ITS1f/ITS4 CC-T1-CS-12-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  DQ659342.1 JN377484  97 100  CC-T1-CS-13-ITS1f/ITS4 CC-T1-CS-13-NL1/NL4  1  S. cerevisiae (Lalvin® D254) S. cerevisiae (Lalvin® D254)  FN393995.1 JN214501.1  100 100  CC-T1-CS-14-ITS1f/ITS4 CC-T1-CS-14-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  100 100  CC-T1-CS-15-ITS1f/ITS4 CC-T1-CS-15-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  100 100  CC-T1-CS-16-ITS1f/ITS4 CC-T1-CS-16-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  100 100  CC-T2-CS-1-ITS1f/ITS4 CC-T2-CS-1-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  JN709466.1 HM601459.1  100 100  1  110  Table A-6 continued… CC-T2-CS-2-ITS1f/ITS4 CC-T2-CS-2-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  JN709466.1 HM601459.1  100 100  CC-T2-CS-3-ITS1f/ITS4 CC-T2-CS-3-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  96 100  CC-T2-CS-4-ITS1f/ITS4 CC-T2-CS-4-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  98 100  CC-T2-CS-5-ITS1f/ITS4 CC-T2-CS-5-NL1/NL4  Saccharomyces uvarum Saccharomyces uvarum  EU145761.1 EU145773  100 100  CC-T2-CS-6-ITS1f/ITS4 CC-T2-CS-6-NL1/NL4  Hanseniaspora uvarum -  JN709466.1 -  100 -  CC-T2-CS-7-ITS1f/ITS4 CC-T2-CS-7-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  100 100  CC-T2-CS-8-ITS1f/ITS4 CC-T2-CS-8-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 DQ683115.1  98 100  CC-T2-CS-9-ITS1f/ITS4 CC-T2-CS-9-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 EU809448.1  98 100  CC-T2-CS-10-ITS1f/ITS4 CC-T2-CS-10-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  100 100  CC-T2-CS-11-ITS1f/ITS4 CC-T2-CS-11-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GU237050 FR819702.1  100 100  CC-T2-CS-12-ITS1f/ITS4 CC-T2-CS-12-NL1/NL4  1  S. cerevisiae (Lalvin® D254) S. cerevisiae (Lalvin® D254)  JN942842.1 HQ711331.1  100 100  CC-T2-CS-13-ITS1f/ITS4 CC-T2-CS-13-NL1/NL4  Hanseniaspora uvarum  EU004081.1  100  CC-T2-CS-14-ITS1f/ITS4 CC-T2-CS-14-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  96 100  CC-T2-CS-15-ITS1f/ITS4 CC-T2-CS-15-NL1/NL4  1  S. cerevisiae (Zymaflore® X5) FN393995.1 S. cerevisiae (Zymaflore® X5) JN214501.1  100 100  CC-T2-CS-16-ITS1f/ITS4 CC-T2-CS-16-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GQ480362 HQ845017.1  98 96  CC-T3-CS-1-ITS1f/ITS4 CC-T3-CS-1-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  100 100  CC-T3-CS-2-ITS1f/ITS4 CC-T3-CS-2-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GQ480362.1 JN083811.1  100 100  1  1  111  Table A-6 continued… CC-T3-CS-3-ITS1f/ITS4 CC-T3-CS-3-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  100 100  CC-T3-CS-4-ITS1f/ITS4 CC-T3-CS-4-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  100 100  CC-T3-CS-5-ITS1f/ITS4 CC-T3-CS-5-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  100 97  CC-T3-CS-6-ITS1f/ITS4 CC-T3-CS-6-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  AY235806 JN083811.1  100 100  CC-T3-CS-7-ITS1f/ITS4 CC-T3-CS-7-NL1/NL4  Hanseniaspora uvarum  JN214494.1  100  CC-T3-CS-8-ITS1f/ITS4 CC-T3-CS-8-NL1/NL4  1  S. cerevisiae (Zymaflore® X5) AB212254.1 S. cerevisiae (Zymaflore® X5) HM191676.1  98 99  CC-T3-CS-9-ITS1f/ITS4 CC-T3-CS-9-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  98 100  CC-T3-CS-10-ITS1f/ITS4 CC-T3-CS-10-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN083823  98 100  CC-T3-CS-11-ITS1f/ITS4 CC-T3-CS-11-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  98 100  CC-T3-CS-12-ITS1f/ITS4 CC-T3-CS-12-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  96 100  CC-T3-CS-13-ITS1f/ITS4 CC-T3-CS-13-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  98 100  CC-T3-CS-14-ITS1f/ITS4 CC-T3-CS-14-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  100 100  CC-T3-CS-15-ITS1f/ITS4 CC-T3-CS-15-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  AY235806 JN083811  94 100  CC-T3-CS-16-ITS1f/ITS4 CC-T3-CS-16-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN377483  99 100  R13-T1-CS-1-ITS1f/ITS4 R13-T1-CS-1-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN377483.1  99 100  R13-T1-CS-2-ITS1f/ITS4 R13-T1-CS-2-NL1/NL4  1  S. cerevisiae (Unknown 15) S. cerevisiae (Unknown 15)  JN942842.1 JN938921.1  98 100  R13-T1-CS-3-ITS1f/ITS4 R13-T1-CS-3-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  AY235806.1 HM988687  100 100  1  1  112  Table A-6 continued… R13-T1-CS-4-ITS1f/ITS4 R13-T1-CS-4-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  100 100  R13-T1-CS-5-ITS1f/ITS4 R13-T1-CS-5-NL1/NL4  Pichia sp. Pichia anomala  HQ631071.1 EF532302.1  100 100  R13-T1-CS-6-ITS1f/ITS4 R13-T1-CS-6-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GU237050.1 JN377483.1  100 100  R13-T1-CS-7-ITS1f/ITS4 R13-T1-CS-7-NL1/NL4  Metschnikowia sp. Metschnikowia fructicola  JN083815.1 AM286805.1  99 100  R13-T1-CS-8-ITS1f/ITS4 R13-T1-CS-8-NL1/NL4  Metschnikowia sp. Metschnikowia fructicola  JN083815.1 AM286805.1  99 100  R13-T1-CS-9-ITS1f/ITS4 R13-T1-CS-9-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GU237050.1 JN377483.1  100 100  R13-T1-CS-10-ITS1f/ITS4 R13-T1-CS-10-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GU237050.1 FJ515233.1  100 99  R13-T1-CS-11-ITS1f/ITS4 R13-T1-CS-11-NL1/NL4  Hanseniaspora uvarum  JN083823.1  100  R13-T1-CS-12-ITS1f/ITS4 R13-T1-CS-12-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  100 100  R13-T1-CS-13-ITS1f/ITS4 R13-T1-CS-13-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  100 100  R13-T1-CS-14-ITS1f/ITS4 R13-T1-CS-14-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GU237050.1 JN083811.1  100 100  R13-T1-CS-15-ITS1f/ITS4 R13-T1-CS-15-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  100 100  R13-T1-CS-16-ITS1f/ITS4 R13-T1-CS-16-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GU237050.1 JN083811.1  100 100  R13-T2-CS-1-ITS1f/ITS4 R13-T2-CS-1-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR75134.1 HQ149311.1  100 100  R13-T2-CS-2-ITS1f/ITS4 R13-T2-CS-2-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR75134.1 HQ149311.1  100 100  R13-T2-CS-3-ITS1f/ITS4 R13-T2-CS-3-NL1/NL4  Hanseniaspora uvarum  JN214494.1  100  R13-T2-CS-4-ITS1f/ITS4 R13-T2-CS-4-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR75134.1 HQ149311.1  100 100  113  Table A-6 continued… R13-T2-CS-5-ITS1f/ITS4 R13-T2-CS-5-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  100 100  R13-T2-CS-6-ITS1f/ITS4 R13-T2-CS-6-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  100 100  R13-T2-CS-7-ITS1f/ITS4 R13-T2-CS-7-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  100 100  R13-T2-CS-8-ITS1f/ITS4 R13-T2-CS-8-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  100 100  R13-T2-CS-9-ITS1f/ITS4 R13-T2-CS-9-NL1/NL4  1  S. cerevisiae (Lalvin® RC212) JN942842.1 S. cerevisiae (Lalvin® RC212) JN938921.1  98 100  R13-T2-CS-10-ITS1f/ITS4 R13-T2-CS-10-NL1/NL4  Wickerhamomyces anomolas Wickerhamomyces anomolas  GQ280811.1 JN941190.1  100 100  R13-T2-CS-11-ITS1f/ITS4 R13-T2-CS-11-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GU237050.1 JN377483.1  100 100  R13-T2-CS-12-ITS1f/ITS4 R13-T2-CS-12-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  100 100  R13-T2-CS-13-ITS1f/ITS4 R13-T2-CS-13-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  100 100  R13-T2-CS-14-ITS1f/ITS4 R13-T2-CS-14-NL1/NL4  1  S. cerevisiae (Unknown 15) S. cerevisiae (Unknown 15)  JN942842.1 JN938921.1  91 100  R13-T2-CS-15-ITS1f/ITS4 R13-T2-CS-15-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  100 100  S. cerevisiae (Lalvin® RC212) JN938921.1  100  R13-T3-CS-1-ITS1f/ITS4 R13-T3-CS-1-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GU237050.1 JN083823.1  100 100  R13-T3-CS-2-ITS1f/ITS4 R13-T3-CS-2-NL1/NL4  1  S. cerevisiae (Lalvin® RC212) FJ793809 S. cerevisiae (Lalvin® RC212) JN214501.1  100 100  R13-T3-CS-3-ITS1f/ITS4 R13-T3-CS-3-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GU237050.1 JN377483.1  100 100  R13-T3-CS-4-ITS1f/ITS4 R13-T3-CS-4-NL1/NL4  1  S. cerevisiae (Lalvin® RC212) FJ793809 S. cerevisiae (Lalvin® RC212) JN214501.1  100 100  R13-T3-CS-5-ITS1f/ITS4 R13-T3-CS-5-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  100 100  R13-T2-CS-16-ITS1f/ITS4 R13-T2-CS-16-NL1/NL4  1  1  1  1  1  GU237050.1 JN377483.1  114  Table A-6 continued… R13-T3-CS-6-ITS1f/ITS4 R13-T3-CS-6-NL1/NL4  Hanseniaspora uvarum  JN083823.1  100  R13-T3-CS-7-ITS1f/ITS4 R13-T3-CS-7-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  100 97  R13-T3-CS-8-ITS1f/ITS4 R13-T3-CS-8-NL1/NL4  1  S. cerevisiae (Unknown 15) S. cerevisiae (Unknown 15)  JN942842.1 JN938921.1  98 98  R13-T3-CS-9-ITS1f/ITS4 R13-T3-CS-9-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GU237050.1 JN083823.1  97 100  R13-T3-CS-10-ITS1f/ITS4 R13-T3-CS-10-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515233.1  100 97  R13-T3-CS-11-ITS1f/ITS4 R13-T3-CS-11-NL1/NL4  1  R13-T3-CS-12-ITS1f/ITS4 R13-T3-CS-12-NL1/NL4  1  R13-T3-CS-13-ITS1f/ITS4 R13-T3-CS-13-NL1/NL4  1  1  S. cerevisiae (Lalvin® RC212) JN942842.1 S. cerevisiae (Lalvin® RC212) JN938921.1  98 98  S. cerevisiae (Unknown 15) S. cerevisiae (Unknown 15)  JN942842.1 JN938921.1  99 100  S. cerevisiae (Lalvin® RC212) JN942842.1 S. cerevisiae (Lalvin® RC212) JN938921.1  98 100  R13-T3-CS-14-ITS1f/ITS4 R13-T3-CS-14-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  100 100  R13-T3-CS-15-ITS1f/ITS4 R13-T3-CS-15-NL1/NL4  1  S. cerevisiae (Lalvin® RC212) JN942842.1 S. cerevisiae (Lalvin® RC212) JN938921.1  98 100  R13-T3-CS-16-ITS1f/ITS4 R13-T3-CS-16-NL1/NL4  Metschnikowia sp. Metschnikowia fructicola  DQ367882.1 AM286805.1  82 100  QG-2011-T1-CS-1-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T1-CS-1-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T1-CS-2-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T1-CS-2-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T1-CS-3-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T1-CS-3-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T1-CS-4-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T1-CS-4-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T1-CS-5-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T1-CS-5-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T1-CS-6-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T1-CS-6-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  1  1  1  1  115  Table A-6 continued… QG-2011-T1-CS-7-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T1-CS-7-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T1-CS-8-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T1-CS-8-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T2-CS-1-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T2-CS-1-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T2-CS-2-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T2-CS-2-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T2-CS-3-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T2-CS-3-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T2-CS-4-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T2-CS-4-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T2-CS-5-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T2-CS-5-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T2-CS-6-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T2-CS-6-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T2-CS-7-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T2-CS-7-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T2-CS-8-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T2-CS-8-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T3-CS-1-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T3-CS-1-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T3-CS-2-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T3-CS-2-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T3-CS-3-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T3-CS-3-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T3-CS-4-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T3-CS-4-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T3-CS-5-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T3-CS-5-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T3-CS-6-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T3-CS-6-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-2011-T3-CS-7-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T3-CS-7-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  116  Table A-6 continued… QG-2011-T3-CS-8-ITS1f/ITS4 Hanseniaspora uvarum QG-2011-T3-CS-8-NL1/NL4 Hanseniaspora uvarum  FR751341.1 EU386753.1  99 100  QG-T2-ER-10-ITS1f/ITS4 QG-T2-ER-10-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515178.1  100 99  QG-W-ER-1-ITS1f/ITS4 QG-W-ER-1-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  GQ480362.1 JN377484.1  93 99  QG-W-ER-3-ITS1f/ITS4 QG-W-ER-3-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515178.1  100 99  QG-W-M-5-ITS1f/ITS4 QG-W-M-5-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FJ515178.1 FJ515178.1  100 99  CC-T1-ER-1-ITS1f/ITS4 CC-T1-ER-1-NL1/NL4  Metschnikowia sp. Metschnikowia pulcherrima  DQ367882.1 HE572532.1  100 100  CC-T1-ER-4-ITS1f/ITS4 CC-T1-ER-4-NL1/NL4  Torulaspora delbrueckii Torulaspora delbrueckii  HE616749.1 HE616749.1  100 100  CC-T1-ER-6-ITS1f/ITS4 CC-T1-ER-6-NL1/NL4  Wickerhamomyces anomalus Wickerhamomyces anomalus  GQ280811.1 JN938925.1  99 100  CC-T1-ER-8-ITS1f/ITS4 CC-T1-ER-8-NL1/NL4  Torulaspora delbrueckii Torulaspora delbrueckii  HE616749.1 HE616749.1  100 100  CC-T1-ER-9-ITS1f/ITS4 CC-T1-ER-9-NL1/NL4  Torulaspora delbrueckii Torulaspora delbrueckii  HE616749.1 HE616749.1  100 99  CC-T1-ER-10-ITS1f/ITS4 CC-T1-ER-10-NL1/NL4  Torulaspora delbrueckii Torulaspora delbrueckii  HE616749.1 HE616749.1  100 100  CC-T1-ER-13-ITS1f/ITS4 CC-T1-ER-13-NL1/NL4  Metschnikowia pulcherrima Metschnikowia pulcherrima  AY235809.1 HE572532.1  90 100  CC-T3-ER-14-ITS1f/ITS4 CC-T3-ER-14-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  100 100  CC-T3-ER-16-ITS1f/ITS4 CC-T3-ER-16-NL1/NL4  Hanseniaspora uvarum Hanseniaspora uvarum  FR751341.1 JN214494.1  100 100  R13-T1-ER-8-ITS1f/ITS4 R13-T1-ER-8-NL1/NL4  Saccharomyces uvarum Saccharomyces uvarum  EU145773.1 EU145760.1  100 99  R13-T1-ER-11-ITS1f/ITS4 R13-T1-ER-11-NL1/NL4  Saccharomyces uvarum Saccharomyces uvarum  EU145773.1 EU145760.1  100 99  R13-T1-ER-14-ITS1f/ITS4 R13-T1-ER-14-NL1/NL4  Saccharomyces bayanus Saccharomyces bayanus  AY130306.1 AY130339.1  99 98  117  Table A-6 continued… R13-T2-ER-4-ITS1f/ITS4 R13-T2-ER-4-NL1/NL4  Saccharomyces uvarum Saccharomyces uvarum  EU145773.1 EU145773.1  100 100  R13-T2-ER-6-ITS1f/ITS4 R13-T2-ER-6-NL1/NL4  Torulaspora delbrueckii Torulaspora delbrueckii  FN394007.1 FR870025.1  100 100  R13-T2-ER-7-ITS1f/ITS4 R13-T2-ER-7-NL1/NL4  Saccharomyces uvarum Saccharomyces uvarum  EU145773.1 EU145773.1  100 100  R13-T2-ER-8-ITS1f/ITS4 R13-T2-ER-8-NL1/NL4  Torulaspora delbrueckii Torulaspora delbrueckii  HE616749.1 HE616749.1  100 100  R13-T2-ER-11-ITS1f/ITS4 R13-T2-ER-11-NL1/NL4  Saccharomyces uvarum Saccharomyces uvarum  EU145773.1 EU145773.1  100 100  R13-T2-ER-13-ITS1f/ITS4 R13-T2-ER-13-NL1/NL4  Torulaspora delbrueckii Torulaspora delbrueckii  HE616749.1 HE616749.1  100 100  R13-T2-M-7-ITS1f/ITS4 R13-T2-M-7-NL1/NL4  Torulaspora delbrueckii Torulaspora delbrueckii  HE616749.1 HE616749.1  100 100  1  S. cerevisiae isolate was identified at the strain-level using microsatellite DNA analysis  Table A-6 end.  118  119  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0073412/manifest

Comment

Related Items