Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Contributions to the molecular phylogeny, phylogeography, and taxonomy of scyphozoan jellyfish Sparmann, Sarah Franziska 2012

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2012_fall_sparmann_sarah.pdf [ 29.52MB ]
Metadata
JSON: 24-1.0073303.json
JSON-LD: 24-1.0073303-ld.json
RDF/XML (Pretty): 24-1.0073303-rdf.xml
RDF/JSON: 24-1.0073303-rdf.json
Turtle: 24-1.0073303-turtle.txt
N-Triples: 24-1.0073303-rdf-ntriples.txt
Original Record: 24-1.0073303-source.json
Full Text
24-1.0073303-fulltext.txt
Citation
24-1.0073303.ris

Full Text

CONTRIBUTIONS TO THE MOLECULAR PHYLOGENY, PHYLOGEOGRAPHY, AND TAXONOMY OF SCYPHOZOAN JELLYFISH by Sarah Franziska Sparmann B.Sc., The University of British Columbia, 2008  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE  in The Faculty of Graduate Studies (Zoology) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  September 2012   Sarah Franziska Sparmann, 2012  Abstract Scyphozoan jellyfish are a major group of large, bloom-forming marine animals that can disrupt ecological stability and interfere with marine-oriented industries. The widespread geographical distributions and high degrees of morphological plasticity within many species make understanding the overall diversity of scyphozoans difficult. Molecular phylogenetic approaches have the potential to offer powerful insights into many aspects of scyphozoan biology, such as species identification, evolutionary history, and phylogeography that will improve our ability to monitor and manage the roles these animals play in marine ecosystems. We established datasets of 16S rDNA and cytochrome c oxidase subunit I (COI) sequences of several different species of scyphozoans in order to better understand phylogenetic, phylogeographical, and taxonomic patterns within the group. Phylogenetic analysis of 16S rDNA sequences resolved closely related taxa but was too variable to resolve deeper relationships with robust statistical support. Combining this marker with a more conserved dataset of nuclear 18S rDNA sequences resulted in a phylogenetic tree with clades that had higher statistical support than in trees inferred from each marker alone. 16S rDNA sequences also showed phylogeographical patterns in Cyanea, distinguishing clearly between a Northeastern Pacific (NEP) clade and a Northwestern Atlantic clade (NWA) (9.71 9.93% mean genetic difference MGD), as well as two Atlantic subclades (NWA1, NWA2) (1.79% MGD). Distances within clades ranged from 0.05 - 0.2%. Therefore, 16S rDNA sequences were able to delimit different (putative) species that reflected distinct geographical distributions. In addition, comparative analyses of morphological features  ii  and COI sequences from Northeast Pacific isolates of Cyanea demonstrated that C. ferrugenia is a valid lion’s mane species found in the Northeast Pacific Ocean.  iii  Preface Dr. Brian Ortman helped to acquire the scyphozoan samples, both from the field and aquaria. He also obtained some of the molecular sequences used in Chapter 3 and helped to conceptualize the studies described in Chapter 2 and 3. In addition to acquiring the samples, I generated the DNA sequences, performed molecular phylogenetic analyses, characterized morphological features in isolates of Cyanea, and wrote the first drafts of the thesis. Dr. Brian Leander funded and supervised the research project and edited subsequent drafts of the thesis. A version of chapter 2 has been submitted to BMC evolutionary biology. Sparmann SF, Ortman BD, Leander BS: Utility of 16S rDNA sequences for inferring the phylogeny and phylogeography of scyphozoans (Cnidaria, Medusozoa). BMC Evol Biol  iv  Table of Contents Abstract .........................................................................................................................ii Preface .......................................................................................................................... iv Table of Contents .......................................................................................................... v List of Tables ...............................................................................................................vii List of Figures.............................................................................................................viii Acknowledgements....................................................................................................... ix Dedication...................................................................................................................... x 1  Introduction ......................................................................................................... 1 1.1 The Scyphozoa .................................................................................................... 1 1.2 Phylogeny, phylogeography, and species identification........................................ 2 1.3 Taxonomy of Cyanea .......................................................................................... 4 1.4 Study goals.......................................................................................................... 6  2  Utility of 16S rDNA for Phylogenetic Inference and Phylogeography in the Scyphozoa............................................................................................................. 8 2.1 Synopsis .............................................................................................................. 8 2.2 Methods .............................................................................................................. 9 2.2.1 Collection of specimens ................................................................................ 9 2.2.2 DNA extraction, PCR amplification and sequencing ................................... 16 2.2.3 Molecular phylogenetic analysis and distance methods................................ 16 2.3 Results............................................................................................................... 20 2.3.1 Phylogenetic analyses.................................................................................. 20 2.3.2 Phylogenetic analysis of 16S rDNA sequences ............................................ 20 2.3.3 Phylogenetic analysis of 18S rDNA sequences ............................................ 23 2.3.4 Phylogenetic analysis of concatenated 16S and 18S rDNA sequences ......... 25 2.3.5 ML bootstrap comparison............................................................................ 29 2.3.6 Phylogenetic analysis of Cyanea sequences................................................. 30 v  2.4 Discussion ......................................................................................................... 32 2.4.1 Phylogeny ................................................................................................... 32 2.4.2 The phylogeography of Cyanea................................................................... 35 3  Genetic and Morphological Confirmation of Cyanea ferrugenia as a Valid Lion’s Mane Jellyfish Species in the Northeast Pacific Ocean......................... 38 3.1 Synopsis ............................................................................................................ 38 3.2 Methods ............................................................................................................ 39 3.2.1 Collection and preservation of specimens .................................................... 39 3.2.2 DNA extraction, PCR amplification and sequencing ................................... 42 3.2.3 Molecular phylogenetic analysis and distance methods................................ 43 3.2.4 Comparative morphology ............................................................................ 44 3.3 Results............................................................................................................... 44 3.3.1 Molecular phylogenetic analysis.................................................................. 44 3.3.2 Comparative morphology ............................................................................ 47 3.4 Discussion ......................................................................................................... 56  4  Conclusions ........................................................................................................ 60  Bibliography................................................................................................................ 62  vi  List of Tables Table 1.1 - Summary of historical records of Cyanea spp. found in the northern Pacific Ocean. ..................................................................................................................... 5 Table 2.1 - Collection data for species used in this study ............................................... 10 Table 2.2 - GenBank accession numbers for species used in this study .......................... 18 Table 2.3 - Mean genetic distances among Cyanea lineages using 16S rDNA and 18S rDNA sequences.................................................................................................... 32 Table 3.1 - Collection data showing the sampling spots of specimens used for molecular and morphological analyses in this study. .............................................................. 41 Table 3.2 - GenBank accession numbers for species used in this study. ......................... 44 Table 3.3 - Mean genetic distances among Cyanea lineages using COI ......................... 47 Table 3.4 - Morphological features of Cyanea spp......................................................... 53  vii  List of Figures Figure 2.1 - Geographical sampling map ....................................................................... 15 Figure 2.2 - Molecular phylogenetic analysis of 16S rDNA sequences .......................... 22 Figure 2.3 - Molecular phylogenetic analysis of 18S rDNA sequences .......................... 24 Figure 2.4 - Molecular phylogenetic analysis of a concatenated 16S and 18S rDNA sequences .............................................................................................................. 26 Figure 2.5 - Molecular phylogenetic analyses of a 16S rDNA dataset consisting of all available sequences for scyphozoans ..................................................................... 28 Figure 2.6 - Maximum likelihood bootstrap comparison................................................ 29 Figure 2.7 - Cyanea phylogeography ............................................................................. 31 Figure 3.1 - Geographical sampling map ....................................................................... 42 Figure 3.2 - Molecular phylogenetic analysis of cytochrome c oxidase subunit I (COI) sequences .............................................................................................................. 46 Figure 3.3 - Color comparison....................................................................................... 48 Figure 3.4 - Morphological details of Cyanea ferrugenia specimen collected for this study .............................................................................................................................. 51 Figure 3.5 - Line drawings of the oral umbrella side of Cyanea spp............................... 55 Figure 3.6 - Line drawing of the oral umbrella side of Cyanea citrea Kishinouye. ......... 56  viii  Acknowledgements I thank Dr. Brian Leander for giving me the opportunity to pursue a research project of my choice and offering advice, lab space and financial support for my endeavors. Thanks also go to the members of my committee, Dr. Chris Harley and Dr. Patrick Martone, for taking me on and offering helpful feedback. I am appreciative for the financial support given to me directly through a scholarship (NERC CGS) from the National Science and Engineering Research Council of Canada, as well as indirectly through grants provided to Dr. Brian Leander by the National Science and Engineering Research Council of Canada (NSERC 283091-09), the Canadian Institute for Advanced Research, Program in Integrated Microbial Biodiversity, and the Tula Foundation’s Centre for Microbial Diversity and Evolution. I am grateful for all the knowledge passed on to me by Dr. Brian Ortman pertaining to scyphozoans as well as for the general advice given to me throughout my graduate degree. I am thankful to Dr. Naoji Yubuki for enduring my relentless questions with seemingly never-ending patience. I would also like to express my gratitude to the rest of the Leander lab for making the past three years a delightful and interesting experience. Marcel Gijssen and Mackenzie Neale of the Vancouver Aquarium have been essential in offering advice on maintaining polyp cultures and even building our own jellyfish tanks. Thank you! Last but definitely not least I would like to send a big thank you to my family, especially my parents, brother and husband: thank you for letting me choose my path in life and supporting me 100% through it (even if it is windy).  ix  Dedication  Für meine Eltern  x  1 Introduction 1.1 The Scyphozoa The Scyphozoa is a diverse group of gelatinous animals, the so-called ‘true’ jellyfish. Members of this class belong to the phylum Cnidaria that also includes the Anthozoa, Staurozoa, Hydrozoa, Cubozoa, and the more elusive parasitic Myxozoa and Polypodiozoa (Collins, 2009). All members of this phylum share a very distinct synapomorphy (shared derived character state), namely the possession of cnidae (= phylum name) or stinging organelles. Many species within the Scyphozoa possess cnidae with more or less potent venoms, utilized for protection or prey capture (e.g., Hand & Fautin, 1988; Fautin, 2009). Jellyfish form an essential part of marine planktonic ecosystems, participating both as predators as well as prey (Mills, 1995). They have been reported from all types of marine environments including coastal areas, the open ocean and the deep sea (Mayer, 1910; Kramp, 1961; Russell, 1970; Arai, 1997). Another feature of the Scyphozoa is their biphasic lifecycle that involves a sessile polyp and a planktonic medusa phase; when triggered by the right stimuli (such as change in light or temperature) the polyps can undergo a process called strobilation, producing large numbers of ephyrae or young jellyfish (Arai, 1997). Strobilation and ephyrae formation distinguishes members of the Scyphozoa from the rest of the Cnidaria. (Marques & Collins, 2004). Strobilation often goes along with a phenomenon called “bloomformation”, where large numbers of jellyfish will appear in a particular place at the same time (Mills, 2001; Purcell et al., 2007; Boero et al., 2008; Dawson & Hamner, 2009; Hamner & Dawson, 2009). These blooms can negatively impact multiple factors, such as local ecology, fisheries, human health, and the economies of marine oriented industries 1  (Arai, 1997; Mills, 2001; Hay, 2006; Graham & Bayha, 2007; Purcell et al., 2007; Pitt et al., 2009; Richardson et al., 2009; West et al., 2009). With mounting reports of increases in bloom formations, interest in jellyfish has been renewed. Increases have been linked to anthropogenic disruptions such as climate change, overfishing, habitat modification and translocation (reviewed in Purcell et al., 2007).  1.2 Phylogeny, phylogeography, and species identification Phylogenetic studies have shown that the Scyphozoa are made up of three orders: the Coronatae, Semaeostomeae and Rhizostomeae (e.g., Collins, 2002; Collins et al., 2006). The Coronatae forms the sister clade to a more inclusive clade called the Discomedusae, wherein the Rhizostomeae is derived from within the (paraphyletic) Semaeostomeae. Coronates and semaeostomes produce ephyrae via polydisk strobilation, while rhizostomes utilize monodisk strobilation and also possess fused mouth arms, a feature that makes this group distinctive (Collins et al., 2006). Members of the Semaeostomeae, which are best represented in this study, are subdivided into five families: the Pelagiidae, Cyaneidae, Drymonematidae, Ulmaridae, and Phacellophoridae (Bayha et al., 2010; Straehler-Pohl et al., 2011). Most phylogenetic studies performed so far have used either morphological characters or nuclear DNA markers, such as 18S rDNA and 28S rDNA sequences, to resolve evolutionary relationships within the Scyphozoa (e.g., Bridge et al., 1995; Dawson, 2004; Collins et al., 2006; Ki et al., 2009; Bayha et al., 2010). Recently, more variable markers, such as nuclear ITS1, mitochondrial cytochrome c oxidase subunit I (COI), and mitochondrial 16S rDNA sequences, have been utilized to discern relationships closer to the genus and species  2  level (e.g., Dawson & Jacobs, 2001; Dawson & Martin, 2001; Schroth et al., 2002; Holland et al., 2004; Dawson, 2005a, b; Ki et al., 2008; Ortman et al., 2010). These more variable markers have been shown to be very informative for understanding phylogeographic patterns and species boundaries in cnidarians. About 200 species of scyphozoans have been described so far (Daly et al., 2007), but this number is likely a gross underestimate because studies using DNA sequence data have started to uncover many cryptic species [e.g., within Aurelia (Dawson & Martin, 2001; Schroth et al., 2002), within Cyanea (Dawson, 2005a), within Cassiopea (Holland et al., 2004)]. Researchers have traditionally used mainly morphological features to distinguish species from one another (e.g., Linnaeus, 1746, 1758; Eschscholtz, 1829; Brandt, 1838; Haeckel, 1879; Mayer, 1910; Stiasny & van der Maaden, 1943; Kramp, 1961, 1965; Russell, 1970). Morphological plasticity (Russell, 1970; Knowlton, 1993; Schierwater, 1994) and the lack of well-established distinguishing features (Mayer, 1910; Kramp, 1961; Dawson, 2003) in scyphozoan species has lead some researchers to synonymize many described species within a genus, creating one more inclusive “species” with a cosmopolitan distribution (Kramp, 1961, 1968). By contrast, more recent studies combining molecular phylogenetic data with morphological and/or ecological features suggest that cryptic species are common in scyphozoans; these new insights are starting to establish more accurate taxonomic relationships within the Scyphozoa and more informed interpretations of their distributions throughout the oceans (Dawson & Jacobs, 2001; Schroth et al., 2002; Dawson, 2003; Dawson, 2005a).  3  1.3 Taxonomy of Cyanea Members of the genus Cyanea were first collected in the North Sea and described by Linnaeus (1746, 1758) as Medusa capillata (a history of Cyanea descriptions in the North Pacific is outlined in Table 1.1). Péron and Lesueur (1809) first introduced the genus name Cyanea. Three Cyanea species were described in the North Pacific Ocean, based solely on morphology; these included Cyanea ferrugenia Eschscholtz (1829), C. postelsi Brandt (1838), C. citrea Kishinouye (1910). These species were subsequently synonymized with Cyanea capillata with the assumption that they represent isolates with a cosmopolitan distribution (Mayer, 1910). By focusing on isolates from the South Pacific Ocean, Dawson (2005a) undertook the first detailed taxonomic revision for this genus using morphology and molecular phylogenetic data (mitochondrial COI and nuclear ITS1). This study showed that C. capillata is not cosmopolitan and instead isolates collected represent different species, namely Cyanea annaskala and C. rosea, within southeastern Australian waters.  4  Table 1.1 - Summary of historical records of Cyanea spp. found in the northern Pacific Ocean.  Source  C. capillata  Linnaeus (1746, also see 1758)  sp. nov. Medusa capillata (North Sea)  Baster (1746)  Medusa capillata (German ocean)  Péron and Lesueur (1809)  Cyanea gen. nov.  Gaede (1816)  as Medusa capillata  C. ferrugenia  C. citrea  sp. nov. Cyanea ferrugenia (coast of Kamtschatka, Aleutian Islands, Northwest coast of America)  Eschscholtz (1829)  C. capillata (North Sea, Baltic Sea, Artic and Baffin Bay)  Brandt (1838)  Kattegat, North Sea, Cape Horn, Bay of Conception  Kamtschatka, Northwest coast of America  Haeckel (1879)  Atlantic coast of Europe: Norway, Sweden, Denmark, Helgoland, North and Baltic Sea of Germany, British coast, Canal de la Manche  Pacific coast of North-Asia and North America, Kamtschatka and Aleutian Islands  Kishinouye (1910)  C. postelsi  sp. nov. Cyanea postelsi (Northfolksund and between Sitka and Unalaska)  sp. nov. Cyanea citrea (Poromushiri, Northwest Pacific)  5  Source  C. capillata  C. ferrugenia  C. postelsi  Mayer (1910)  North Atlantic North Pacific  North Pacific coasts of America and Asia (as C. “arctica” southern coast of New England northward to Arctic Ocean; coasts of France to northern Russia)  North Pacific from Aleutian Islands to Oregon; between Sitka and Aleutian Islands  Stiasny and van der Maaden (1943)  North Atlantic, Australia  Kramp (1961, 1965)  almost cosmopolitan in arctic and temperate seas  Russell (1970)  North Atlantic, Pacific  Dawson (2005)  North Atlantic, North Pacific Ocean  This study  North Atlantic Ocean  North Pacific; Kamtschatka and Aleutian Islands, northwest coast of North America  Northfolksund and between Sitka and Unalaska  North Pacific Ocean  ?  C. citrea  ?  1.4 Study goals With the increasing significance of scyphozoans in marine ecosystems, it is important to not only identify species correctly but also to determine how these species are related to each other. This phylogenetic context is imperative (1) to knowing whether or not a species is invasive to a particular environment, (2) to predict significant traits, such as a potent sting, (3) to understand how jellyfish move through the oceans naturally  6  and through anthropogenic causes, and (4) to infer the evolutionary history of these animals (Hamner & Dawson, 2009). In this study, we explored variation within mitochondrial 16S rDNA sequences in order to test its usefulness for inferring the phylogeny and phylogeography of scyphozoans. Traditionally, nuclear ribosomal genes, such as 18S rDNA and 28S rDNA sequences, have been used for phylogenetic analysis and mitochondrial COI gene sequences have been widely accepted as a marker for species identification in many different animal groups (e.g., Hebert et al., 2003a, b; Dawson, 2004; Collins et al., 2006; Bayha et al., 2010; Bucklin et al., 2010; Ortman et al., 2010). Mitochondrial genes are generally better suited to resolve (species-level) relationships of closely related taxa, while many nuclear genes are more conserved and better suited for inferring more distant relationships between more inclusive clades (Brown et al., 1979; Moritz et al., 1987; Kocher, 1991;). Our analyses of 16S rDNA in scyphozoans reflected these expectations and not only helped resolve the overall tree of scyphozoans but also offered powerful insights into species boundaries and phylogeographical distributions within the group. Another goal of this study was to clarify the taxonomic position of the Cyanea species found in the Northeast Pacific Ocean by generating mitochondrial COI sequences and new morphological data. We then compared our data to previous descriptions of Cyanea in the North Pacific Ocean to establish which one of the original species, if any, corresponds with our findings. These data enable us to confirm that the Northeast Pacific Cyanea is equivalent to C. ferrugenia, a species originally described from the coast of Kamtschatka, the Aleutian Islands and the Northwest coast of America by Eschscholtz in 1829.  7  2 Utility of 16S rDNA for Phylogenetic Inference and Phylogeography in the Scyphozoa 2.1 Synopsis Scyphozoan jellyfish are a major group of large, bloom-forming marine animals that can disrupt ecological stability and interfere with marine-oriented industries. The widespread geographical distributions and high degrees of morphological plasticity within many species make understanding the overall diversity of scyphozoans difficult. Molecular phylogenetic approaches have the potential to offer powerful insights into many aspects of scyphozoan biology, such as species identification, evolutionary history and phylogeography that will improve our ability to monitor and manage the roles these animals play in marine ecosystems. We established datasets of 16S rDNA sequences from 87 scyphozoans (including 45 isolates of Cyanea) in order to better understand phylogenetic and phylogeographical patterns within the group. This phylogenetic marker resolved closely related taxa but was too variable to resolve deeper relationships with robust statistical support. Combining this marker with a more conserved dataset of nuclear 18S rDNA sequences resulted in a phylogenetic tree with clades that had higher statistical support than in trees inferred from each marker alone. 16S rDNA sequences also showed phylogeographical patterns in Cyanea, distinguishing clearly between a Northeastern Pacific (NEP) clade and a Northwestern Atlantic clade (NWA) with a mean genetic difference ranging from 9.71 9.93%. Two Atlantic subclades (NWA1, NWA2) were separated by a sequence divergence of 1.79%. Mean genetic differences within each of the three clades ranged from 0.05 - 0.2%. 8  Phylogenetic analysis of the concatenated dataset of mitochondrial 16S rDNA and nuclear 18S rDNA sequences improved resolution for the overall tree of scyphozoan diversity, especially at shallower levels of divergence. The high level of variation within the new dataset of 16S rDNA sequences, especially within multiple isolates of Cyanea, was also useful for the delimitation of different (putative) species that reflected different geographical distributions. The results of this study suggest that mitochondrial 16S rDNA sequences provide an informative marker for species boundaries that can be applied broadly within the Scyphozoa and perhaps the Cnidaria as a whole.  2.2 Methods 2.2.1 Collection of specimens The specimens for this study were collected using a dip net or field cruises in several areas of the Northeastern Pacific (Table 2.1; Fig. 2.1 shows Cyanea collection locations). They were identified to the lowest possible taxonomic level according to their morphology, which was later confirmed with molecular data. Other species were received as polyp cultures from various aquaria around the world (Table 2.1). Tissue samples were preserved in 95% ethanol for subsequent DNA extraction and sequencing.  9  Table 2.1 - Collection data for species used in this study  Species  Sampling Date  Sampling Site  Latitude  Longitude  GenBank Accession number  Atolla vanhoeffeni  Sept. 16, 2004  North Atlantic  40.15  -68.163833  JX393250 JX393273  Atolla wyvillei  Sept. 23, 2004  North Atlantic  40.333717  -68.1342  JX393251 JX393274  Aurelia aurita  n/a  Kamo Aquarium, Japan  n/a  n/a  JX393252 JX393275  Aurelia labiata (OP)  June 6, 2010  Ogden Point, Canada  48.413076  -123.387675  JX393255 JX393278  Aurelia labiata (B)  April 21, 2010  Bamfield, Canada  48.828125  -125.137511  JX393253 JX393276  Aurelia limbata  n/a  Kamo Aquarium, Japan  n/a  n/a  JX393254 JX393277  Chrysaora fuscescens  June 13, 2010  Bamfield, Canada  48.828125  -125.137511  JX393256 JX393279  Chrysaora helova  n/a  Kamo Aquarium, Japan  n/a  n/a  JX393257 JX393280  Chrysaora pacifica  n/a  Vancouver Aquarium, Canada  n/a  n/a  JX393258 JX393281  Chrysaora quinquecirrha  n/a  Mystic Aquarium, USA  n/a  n/a  JX393259 JX393282  Craterolophus convolvulus  n/a  North Atlantic  43.071667  -70.756667  JX393269 JX393283  Cyanea sp. (A1; NEP)  Sept. 13, 2005  Knight Island Passage, Alaska  60.292718  -147.984317  JX393211  Cyanea sp. (A2; NEP)  Sept. 13, 2005  60.292718  -147.984317  JX393210  Knight Island Passage, Alaska  10  Species  Sampling Date  Sampling Site  Latitude  Longitude  GenBank Accession number  Alaska Cyanea sp. (A3; NEP)  Sept. 13, 2005  Knight Island Passage, Alaska  60.292718  -147.984317  JX393212  Cyanea sp. (A4; NEP)  Sept. 13, 2005  Knight Island Passage, Alaska  60.292718  -147.984317  JX393213  Cyanea sp. (A5; NEP)  Sept. 13, 2005  Knight Island Passage, Alaska  60.292718  -147.984317  JX393214  Cyanea sp. (APB,1; NWA2)  Aug. 24, 2008  Avery Point Beach, Connecticut, USA  41.318333  -72.058167  JX393248  Cyanea sp. (APB,2; NWA2)  Aug. 24, 2008  Avery Point Beach, Connecticut, USA  41.318333  -72.058167  JX393249  Cyanea sp. (B1; NEP)  May, 2011  Bamfield, Canada  48.828125  -125.137511  JX393208  Cyanea sp. (B2; NEP)  May, 2011  Bamfield, Canada  48.828125  -125.137511  JX393209  Cyanea sp. (CB,1; NWA1)  n/a  Chesapeake Bay, USA  37.728333  -76.198333  JX393242  Cyanea sp. (CB,2; NWA1)  n/a  Chesapeake Bay, USA  37.728333  -76.198333  JX393243  Cyanea sp. (CB,3; NWA1)  n/a  Chesapeake Bay, USA  37.728333  -76.198333  JX393244  Cyanea sp. (EPB,1; NWA2)  Aug. 21, 2008  Esker Point Beach Connecticut, USA  41.344049  -71.964653  JX393245 JX393286  Cyanea sp. (EPB,2; NWA2)  Aug. 21, 2008  41.344049  -71.964653  JX393246  Esker Point Beach Connecticut, USA  11  Species  Sampling Date  Sampling Site  Latitude  Longitude  GenBank Accession number  41.344049  -71.964653  JX393247  Connecticut, USA Cyanea sp. (EPB,3; NWA2)  Aug. 21, 2008  Esker Point Beach, Connecticut, USA  Cyanea sp. (GM)  n/a  Gulf of Mexico, USA  30.256424  -88.681635  JX393270  Cyanea sp. (IA,1; NEP)  Aug., 2011  Indian Arm, Canada  49.375031  -122.885353  JX393206 JX393284  Cyanea sp. (IA,2; NEP)  Aug., 2011  Indian Arm, Canada  49.375031  -122.885353  JX393207  Cyanea sp. (JB; NEP)  Sept., 2010  Jericho Beach, Canada  49.2761  -123.200841  JX393216  Cyanea sp. (LIS,1; NWA1)  n/a  Long Island Sound, USA  41.273333  -72.793165  JX393232  Cyanea sp. (LIS,2; NWA1)  n/a  Long Island Sound, USA  41.273333  -72.793165  JX393233  Cyanea sp. (LIS,3; NWA1)  n/a  Long Island Sound, USA  41.273333  -72.793165  JX393234  Cyanea sp. (LIS,4; NWA1)  n/a  Long Island Sound, USA  41.273333  -72.793165  JX393235 JX393285  Cyanea sp. (LIS,5; NWA1)  n/a  Long Island Sound, USA  41.273333  -72.793165  JX393236  Cyanea sp. (LIS,6; NWA1)  n/a  Long Island Sound, USA  41.273333  -72.793165  JX393237  Cyanea sp. (LIS,7; NWA1)  n/a  Long Island Sound, USA  41.273333  -72.793165  JX393238  Cyanea sp. (NRE,1; NWA1)  n/a  Niantic River Estuary, USA  41.339199  -72.179989  JX393239  Cyanea sp. (NRE,2; NWA1)  n/a  Niantic River Estuary, USA  41.339199  -72.179989  JX393240  12  Species  Sampling Date  Sampling Site  Latitude  Longitude  GenBank Accession number  Cyanea sp. (NRE,3; NWA1)  n/a  Niantic River Estuary, USA  41.339199  -72.179989  JX393241  Cyanea sp. (OP,1; NEP)  Aug. 10, 2010  Ogden Point, Canada  48.413076  -123.387675  JX393215 JX393287  Cyanea sp. (OP,2; NEP)  Aug. 27, 2011  Ogden Point, Canada  48.413076  -123.387675  JX393205  Cyanea sp. (SG,1; NEP)  Sept. 16, 2011  Strait of Georgia, Canada  49.75688  -124.3429  JX393218  Cyanea sp. (SG,2; NEP)  Sept. 16, 2011  Strait of Georgia, Canada  49.76423  -124.4557  JX393219  Cyanea sp. (SG,3; NEP)  Sept. 16, 2011  Strait of Georgia, Canada  49.78942  -124.5345  JX393220  Cyanea sp. (SG,4; NEP)  Sept. 16, 2011  Strait of Georgia, Canada  49.82685  -124.5731  JX393221  Cyanea sp. (SG,5; NEP)  Sept. 17, 2011  Strait of Georgia, Canada  49.97927  -125.1071  JX393222  Cyanea sp. (SG,6; NEP)  Sept. 17, 2011  Strait of Georgia, Canada  49.9674  -124.9836  JX393223  Cyanea sp. (SG,7; NEP)  Sept. 17, 2011  Strait of Georgia, Canada  49.90015  -124.9395  JX393224  Cyanea sp. (SG,8; NEP)  Sept. 17, 2011  Strait of Georgia, Canada  49.79042  -124.8089  JX393225  Cyanea sp. (SG,9; NEP)  Sept. 17, 2011  Strait of Georgia  49.84585  -124.7308  JX393226  Cyanea sp. (SG,10; NEP)  Sept. 18, 2011  Strait of Georgia, Canada  49.48  -124.5656  JX393227  13  Species  Sampling Date  Sampling Site  Latitude  Longitude  GenBank Accession number  Canada Cyanea sp. (SG,11; NEP)  Sept. 18, 2011  Strait of Georgia, Canada  49.42477  -124.5502  JX393228  Cyanea sp. (SG,12; NEP)  Sept. 19, 2011  Strait of Georgia, Canada  49.35322  -124.2225  JX393229  Cyanea sp. (SG,13; NEP)  Sept. 20, 2011  Strait of Georgia, Canada  49.33113  -123.7671  JX393230  Cyanea sp. (SG,14; NEP)  Sept. 20, 2011  Strait of Georgia, Canada  49.22218  -123.7374  JX393231  Cyanea sp. (VA; NEP)  n/a  Vancouver Aquarium, Canada  n/a  n/a  JX393217  Haliclystus sp.  Feb., 2011  Ogden Point, Canada  48.413076  -123.387675  JX393268 JX393288  Pelagia noctiluca (NA)  Sept. 14, 2003  North Atlantic  40.3  -68.116667  JX393260 JX393289  Phacellophora camtschatica  n/a  Vancouver Aquarium, Canada  n/a  n/a  JX393261 JX393290  Phacellophora sp. (NA)  Sept. 22, 2003  North Atlantic  42.297667  -67.498333  JX393262 JX393291  Phacellophora sp. (B1)  June 12, 2010  Bamfield, Canada  48.828125  -125.137511  JX393263 JX393292  Phacellophora sp. (B2)  April 21, 2010  Bamfield, Canada  48.828125  -125.137511  JX393264 JX393293  Phyllorhiza punctata  n/a  Gulf of Mexico. USA  30.366667  -88.883333  JX393272  Sept. 25, 2003  North Atlantic  40.076833  -68.081  JX393265 JX393294  Poralia sp.  14  Species  Sampling Date  Sampling Site  Latitude  Longitude  GenBank Accession number  Rhopilema sp.  n/a  Kamo Aquarium, Japan  n/a  n/a  JX393266 JX393295  Rhopilema verrilli  n/a  Gulf of Mexico, USA  30.218667  -88.928333  JX393271  Sanderia malayensis  n/a  Mystic Aquarium, USA  n/a  n/a  JX393267 JX393296  Figure 2.1 - Geographical sampling map Collection locations in North America for Cyanea specimens used for molecular phylogenetic analysis.  15  2.2.2 DNA extraction, PCR amplification and sequencing DNA was purified from individuals using the Qiagen DNAeasy purification kit (Invitrogen Inc.). Genes were amplified utilizing the polymerase chain reaction (PCR) with the following primers: 1.) 16S: 16Sg-5’ (5’-TCGACTGTTTACCAAAAACATAGC-3’) (Hamner & Dawson, 2009) and 16Sr (5’-ACGGAATGAACTCAAATCATGTAA3’) (Palumbi, 1996) 2.) 18S: 18Sa (5’- AACCTGGTTGATC-CTGCCAGT-3’), 18Sb (5’GATCCTTCTGCAGGTTCACCTAC-3’) (Medlin et al., 1988), C (5’- CGGTAATTCCAGCTCCAATAG-3’) (Apakupakul et al., 1999), and Aa_H18S_1318 (5’- CAGACAAATCACTCCACCAAC-3’) (Bayha et al., 2010). The PCR protocol was as follows: 1.) 16S rDNA sequences were amplified with an initial denaturing period (95°C for 120s), 40 cycles of denaturing (96°C for 30s), annealing (50°C for 30s), and extension (72°C for 60s), with a final extension period (72°C for 300s) and storage at 4°C. 2.) 18S rDNA sequences were amplified with an initial denaturing period (94°C for 120s), 38 cycles of denaturing (94°C for 45s), annealing (48°C for 60s), and extension (72°C for 120s) (90s with Aa_H18S_1318 and C), with a final extension period (72°C for 600s) and storage at 4º C. Sequencing was performed directly from purified PCR amplification products with ABI big-dye reaction mix using the amplification primers. All new16S rDNA and 18S rDNA sequences were submitted to GenBank (Table 2.1).  2.2.3 Molecular phylogenetic analysis and distance methods 54 sequences from GenBank (Table 2.2) and 92 new sequences, including 45 Cyanea isolates, (Table 2.1) were aligned with Clustal W (Thompson et al., 1994) and manually fine tuned by eye with the use of MacClade 4 (Maddison & Maddison, 2001).  16  Indels were excluded. The best-fit model of evolution for the Maximum Likelihood analysis was found using jModelTest (Guindon & Gascuel, 2003; Posada, 2008). The alpha shape parameters were estimated from the data using the General Time Reversible (GTR) model for base substitutions, a gamma distribution with invariable sites and six rate categories, respectively. Phylogenetic relationships were reconstructed using Paup* V 4.0.b10 (Swofford, 2002) for Maximum Parsimony (MP) and GARLI (Zwickl, 2006) for Maximum Likelihood (ML). Paup* V 4.0.b10 was also used to construct a distance matrix. Posterior probabilities using Bayesian analysis were performed in MrBayes 3.0 (Huelsenbeck & Ronquist, 2001). The program was set to operate with GTR, a gamma distribution and four Monte-Carlo-Markov chains (MCMC) (default temperature. 0.2). A total of 2,000,000 generations were calculated with trees sampled every 100 generations and with a prior burn-in of 200,000 generations (2000 sampled trees were discarded). A majority rule consensus tree was constructed from 18,000 post-burn-in trees with PAUP* 4.0. Posterior probabilities correspond to the frequency at which a given node is found in the post-burn-in trees.  17  Table 2.2 - GenBank accession numbers for species used in this study  Species  GenBank Accession number 16S 18S  Aglauropsis aeora  EU293973.1  AY920754.1  Aurelia aurita  U19373.1  AY428815.1  Aurelia labiata  AF461401.1  Aurelia limbata  AF461403.1  Aurelia sp. 1  AF461404.1  Aurelia sp. 2  AF461402.1  Aurelia sp. 3  AF461400.1  Aurelia sp. 4  AF461399.1  Chrysaora quinquecirrha  GU300724.2  Chrysaora sp. 1  JN184787.1  Chrysaora sp. 2  JN184784.1  Craspedacusta ziguiensis  EU293974.1  Depastromorpha africana  AY845341.1  Drymonema dalmatinum  HQ234634.1  HQ234658.1  Drymonema larsoni 1  HQ234651.1  HQ234660.1  Drymonema larsoni 2  HQ234635.1  HQ234659.1  Eucheilota menoni  FJ550493.1  FJ550570.1  Geryonia proboscidalis  EU293979.1  Gonionemus vertens  EU293976.1  Haliclystus antarcticus  FJ874775.1  Haliclystus californiensis 1  GU201828.1  Haliclystus californiensis 2  GU201829.1  18  Species  GenBank Accession number 16S 18S  Haliclystus octoradiatus  AY845338.1  Haliclystus sanjuanensis 1  AY845339.1  Haliclystus sanjuanensis 2  HM022149.1  Haliclystus sanjuanensis 3  HM022150.1  Haliclystus sanjuanensis 4  HM022151.1  Haliclystus sp.  AY845340.1  Haliclystus stejnegeri 1  HM022152.1  Haliclystus stejnegeri 2  HM022153.1  Haliclystus tenuis  HM022154.1  Liriope tetraphylla  U19377.1  Lucernaria janetae  AY845342.1  Lucernaria sp. 1  DQ465036.1  Lucernaria sp. 2  DQ465037.1  Maeotias marginata  AY512508.1  Olindias sambaquiensis  EU293977.1  EU247814.1  Pelagia noctiluca  EU999227.1  HM194812.1  Phyllorhiza sp.  JN184783.1  Podocorynoides minima  EU883541.1  EU883546.1  Rhopilema esculentum 1  EU373726.1  HM194794.1  Rhopilema esculentum 2  EU373725.1  Varitentacula yantaiensis  HM053551.1  AY428814.1  19  2.3 Results 2.3.1 Phylogenetic analyses Three different datasets consisting of 35 sequences, 24 new and 11 from GenBank, were constructed for phylogenetic analysis: a 16S rDNA alignment containing 373 aligned sites, an 18S rDNA alignment containing 1,485 aligned sites, and a concatenated 16S/18S rDNA alignment containing 1,858 aligned sites. Semaeostome scyphozoans were best represented in these alignments, including members of all recognized families: the Cyaneidae (Cyanea spp.), Pelagiidae (Chrysaora spp.), Phacellophoridae (Phacellophora spp.) and Ulmaridae (Aurelia spp). Rhizostomes and coronates were each represented by two isolates belonging to the same genus. Representative sequences from the Hydrozoa and the Staurozoa were included as outgroup taxa. Because 16S rDNA sequences were not available for members of the Cubozoa, representatives from this group were also excluded from the 18S rDNA datasets.  2.3.2 Phylogenetic analysis of 16S rDNA sequences Phylogenetic analysis of the 16S rDNA dataset was unable to resolve the deepest relationships (the “backbone”) within the Cnidaria as a whole and the Scyphozoa in particular (Fig. 2.2). The sequences representing the Semaeostomeae and Rhizostomeae formed monophyletic sister groups, albeit with weak statistical support. The two highly divergent sequences representing the Coronatae, namely Atolla vanhoeffeni and A. wyvillei, also formed a robust monophyletic group that branched from the unresolved cnidarian backbone. More closely related taxa received higher statistical support. For  20  instance, bootstrap support of 95% and higher was observed for several scyphozoan clades: the Aurelia labiata clade, the Phacellophora clade, a clade consisting of Cyanea sp. (IA,1) and Cyanea sp. (OP,1), the Pelagia clade, the Drymonema clade, and the Rhopilema clade. The Phacellophora clade branched as the sister group to Poralia sp. with ≥90% bootstrap support. The four sequences from Chrysaora spp. grouped within a clade also including Sanderia malayensis and Pelagia with Drymonema as a sister clade, albeit with weak statistical support.  21  Figure 2.2 - Molecular phylogenetic analysis of 16S rDNA sequences Gamma-corrected maximum likelihood tree (-lnL = 4045.97813, γ = 0.3440, 6 rate categories: AC, 2.3180; A-G, 10.3546; A-T, 5.6004; C-G, 1.7865; C-T, 22.6480; and G-T, 1.0000) inferred using the GTR model of substitution on an alignment of 35 16S rDNA sequences and 373 unambiguously aligned sites. Gaps were excluded. Numbers at the branches denote bootstrap values of maximum likelihood (ML, >60%) and Bayesian posterior probabilities (PP, >0.95). Black dots on branches denote robust bootstrap percentages and posterior probabilities of 90% and higher. The sequences derived from this study are highlighted in the shaded boxes. Branches A-O show clades that are represented in all three analyses (16S, 18S and 16S/18S concatenated).  22  2.3.3 Phylogenetic analysis of 18S rDNA sequences Phylogenetic analysis of the 18S rDNA dataset was able to resolve a robust monophyletic group consisting of all scyphozoan sequences (Fig. 2.3). A Rhizostomeae clade was nested within the paraphyletic Semaeostomeae sequences; the Coronatae, represented by Atolla spp., formed the sister group to the much larger clade consisting of the Rhizostomeae and Semaeostomeae sequences. The 18S rDNA sequences from the two species of Atolla were not highly divergent like the 16S rDNA sequences from the same taxa (Fig. 2.2 and 2.3). Generally speaking, the scyphozoan genera formed clades with high statistical support: Rhopilema spp., Phacellophora spp., Aurelia spp., Cyanea spp., Drymonema spp., Pelagia spp., Atolla spp. The only exceptions to this pattern within the Scyphozoa were the sequences representing Chrysaora, which branched independently from an unresolved semaeostome backbone. Nonetheless, phylogenetic analysis of this dataset did provide high statistical support for some deeper phylogenetic relationships within the Cnidaria, such as a clade consisting of Phacellophora and Poralia, a clade consisting of the Semaeostomeae and the Rhizostomeae, a hydrozoan clade, and a staurozoan clade.  23  Figure 2.3 - Molecular phylogenetic analysis of 18S rDNA sequences Gamma-corrected maximum likelihood tree (-lnL = 4523.98074, γ = 0.5570, proportion of invariable sites = 0.7050, 6 rate categories: A-C, 2.3632; A-G, 5.2187; A-T, 2.3632; C-G, 1.0000; C-T, 8.9155; and G-T, 1.0000) inferred using the GTR model of substitution on an alignment of 35 18S rDNA sequences and 1485 unambiguously aligned sites. Gaps were excluded. Numbers at the branches denote bootstrap values of maximum likelihood (ML, >60%) and Bayesian posterior probabilities (PP, >0.95). Black dots on branches denote robust bootstrap percentages and posterior probabilities of 90% and higher. The sequences derived from this study are highlighted in the shaded boxes. Branches A-O show clades that are represented in all three analyses (16S, 18S and 16S/18S concatenated).  24  2.3.4 Phylogenetic analysis of concatenated 16S and 18S rDNA sequences Phylogenetic analysis of the concatenated dataset of 16S and 18S rDNA sequences formed a much more resolved tree than analyses of each of the two datasets alone (Fig. 2.2-4). The tree resulting from analyses of the concatenated dataset grouped all scyphozoan sequences within a robust clade that had a well-resolved internal topology. The Coronatae formed the sister lineage to a robust clade consisting of all semaeostomes and rhizostomes. Similar to the tree derived from the 18S rDNA dataset, the semaeostomes were paraphyletic to rhizostomes. The rhizostome clade was most closely related to a robust clade of semaeostomes consisting of Aurelia, Phacellophora and Poralia with strong statistical support (Fig. 2.4). A robust Cyanea clade formed the nearest sister group to the more inclusive clade consisting of rhizostomes, Aurelia, Phacellophora and Poralia, albeit with weak statistical support. A robust Drymonema clade branched as an unresolved subgroup within the semaeostomes. The sequences representing Chrysaora spp. did not cluster together and instead clustered weakly with Sanderia and a robust Pelagia clade. Chrysaora pacifica and C. quinquecirrha formed a modestly supported clade with Sanderia malayensis in phylogenetic analyses of all three datasets (Fig. 2.2-4).  25  Figure 2.4 - Molecular phylogenetic analysis of a concatenated 16S and 18S rDNA sequences Gamma-corrected maximum likelihood tree (-lnL = 8974.86936, γ = 0.3980, proportion of invariable sites = 0.5630, 6 rate categories: A-C, 2.2957; A-G, 7.0606; A-T, 4.8628; C-G, 1.0779; C-T, 12.7589; and G-T, 1.0000) inferred using the GTR model of substitution on an alignment of 35 concatenated 16S/18S rDNA sequences and 1858 unambiguously aligned sites. Gaps were excluded. Numbers at the branches denote bootstrap values of maximum likelihood (ML, >60%) and Bayesian posterior probabilities (PP, >0.95). Black dots on branches denote robust bootstrap percentages and posterior probabilities of 90% and higher. The sequences derived from this study are highlighted in the shaded boxes. Branches A-O show clades that are represented in all three analyses (16S, 18S and 16S/18S concatenated).  26  One of the main differences in the tree derived from the concatenated dataset and the trees derived from the 16S rDNA datasets was the position of the Rhizostomeae within the Scyphozoa. The tree derived from the concatenated dataset showed a wellresolved sister relationship between rhizostomes and a robust clade of semaeostomes consisting of Aurelia, Phacellophora and Poralia (Fig. 2.4); this result was similar to the much less resolved tree derived from the 18S rDNA dataset (Fig. 2.3). By contrast, trees derived from the 16S rDNA datasets placed rhizostomes as the sister group to a monophyletic group of semaeostomes, albeit with very weak statistical support (Fig. 2.2, Fig. 2.5).  27  Figure 2.5 - Molecular phylogenetic analyses of a 16S rDNA dataset consisting of all available sequences for scyphozoans Gamma-corrected maximum likelihood tree (-lnL = 5263.35355, γ = 0.3220, proportion of invariable sites = 0.1040, 6 rate categories: A-C, 1.0000; A-G, 5.2870; A-T, 1.8204; C-G, 1.8204; C-T, 9.5166; and G-T, 1.0000) inferred using the GTR model of substitution on an alignment of 68 16S rDNA sequences and 334 unambiguously aligned sites. Gaps were excluded. Numbers at the branches denote bootstrap values of maximum likelihood (ML) and Bayesian posterior probabilities (PP). Black dots on branches denote robust bootstrap percentages and posterior probabilities of 90% and higher. The sequences derived from this study are highlighted in the shaded boxes.  28  2.3.5 ML bootstrap comparison We compared the ML bootstrap values for clades that were represented in all three phylogenetic analyses (labeled A through O in Fig. 2.2-4). The concatenated dataset outperformed the 16S rDNA and 18S rDNA datasets by increasing the ML bootstrap values close to 100% for 60% of these clades (9/15) (Fig. 2.6). The remaining clades (6/15) already showed high bootstrap support in the trees derived from both the16S rDNA sequence and 18S rDNA sequence datasets. In addition to this, the combined dataset was able to resolve additional clades, such as the scyphozoan clade, the relationship between rhizostomes and semaeostomes, and between Chrysaora fuscescens and C. helova (Fig. 2.2 – 2.4). These first two clades were unresolved in the 16S rDNA dataset, while the third was unresolved in the 18S rDNA dataset.  Figure 2.6 - Maximum likelihood bootstrap comparison Maximum likelihood bootstrap comparison between the 16S rDNA, 18S rDNA and concatenated 16S/18S rDNA analysis. Only clades (A-O) found in all three analyses were evaluated.  29  2.3.6 Phylogenetic analysis of Cyanea sequences Forty-five 16S rDNA sequences were acquired from Cyanea isolates collected on the west and east coasts of North America (Fig. 2.1, Table 2.1). Chrysaora pacifica and C. quinquecirrha were used as outgroup taxa forming a 47-taxon alignment with 507 sites for phylogenetic analysis and genetic distances. The tree derived from this dataset consisted of two major clades that divided the Cyanea isolates into one Northeast Pacific (NEP) clade and two Northwest Atlantic subgroups (NWA1 and NWA2) (Fig. 2.7). The mean genetic distance between the Pacific and Atlantic populations was close to 10% (Table 2.3). The two Atlantic subgroups had neighboring distributions in the Long Island Sound (Fig. 2.1, Table 2.1) and a mean genetic distance of close to 2% (Table 2.3). The mean genetic distance within the NEP, NWA1, and NWA2 is lowest in the Pacific population with 0.05% and highest in the NWA1 with 0.2% (Table 2.3). All three clades (NEP, NWA1, NWA2) are well supported by high bootstrap values (Figure 2.7). Distance methods were also applied to 18S rDNA sequences representing the three clades (Table 2.3). 18S rDNA sequences showed no genetic distance between the Atlantic clades and a 0.13% distance between Atlantic and Pacific populations.  30  Figure 2.7 - Cyanea phylogeography Gamma-corrected maximum likelihood tree (-lnL = 1678.32977, γ = 0.24, 6 rate categories: A-C, 2.4514; A-G, 15.0961; A-T, 8.7875; C-G, 0.0060; C-T, 28.8540; and G-T, 1.0000) inferred using the GTR model of substitution on an alignment of 47 16S rDNA sequences and 507 unambiguously aligned sites. Gaps were excluded. Numbers at the branches denote bootstrap values of maximum likelihood (ML, >60%; above branch) and maximum parsimony (MP, >60%; below branch). All sequences were derived from this study. The total number of mtDNA haplotypes investigated for each geographic location is given (N). The Northeast Pacific (NEP) clade includes specimens sampled from Bamfield (B), Indian Arm (IA), Jericho Beach (JB), Ogden Point (OP), Strait of Georgia (SG), Knight Island Passage (A), and the Vancouver Aquarium (VA). Specimens of the Northwest Atlantic (NWA1) clade were collected in Long Island Sound (LIS), Niantic River Estuary (NRE), and Chesapeake Bay (CB), of NWA2 in Esker Point Beach (EPB), and Avery Point Beach (APB).  31  Table 2.3 - Mean genetic distances among Cyanea lineages using 16S rDNA and 18S rDNA sequences. Distances were derived using the GTR substitution model for 16S rDNA sequences (lower half) and 18S rDNA sequences (upper half). The diagonal shows variation in 16S rDNA sequences within genetic lineages.  Cyanea sp. (NEP)  Cyanea sp. (NWA1)  Cyanea sp. (NWA2)  Cyanea sp. (NEP)  0.0005 ± 0.0009  0.0013  0.0013  Cyanea sp. (NWA1)  0.0993 ± 0.0012  0.0020 ± 0.0023  0  Cyanea sp. (NWA2)  0.0971 ± 0.0012  0.0179 ± 0.0011  0.0007 ± 0.0010  2.4 Discussion 2.4.1 Phylogeny Previous studies on the diversity of anthozoans and hydrozoans have shown that 16S rDNA sequences were most suitable for inferring phylogenetic relationships among closely related taxa (Romano & Palumbi, 1997; Schierwater & Ender, 2000; Collins et al., 2005; Cantero et al., 2010). This is true for mitochondrial DNA sequences in general because they have very low levels of recombination, maternal inheritance, simple genetic structure, reduced effective population size (Ne), and relatively rapid rates of evolution (Avise et al., 1983; Moritz et al., 1987; Piganeau et al., 2004; Rubinoff & Holland, 2005). However, relatively rapid rates of evolution also limits the utility of mtDNA for resolving deeper relationships because phylogenetic signal at deeper levels is obliterated by homoplasy (Reed & Sperling, 1999; Caterino et al., 2001; Rubinoff & Sperling, 2002; Holland et al., 2004). Nuclear 18S rDNA sequences, by contrast, are more conserved and 32  thus more informative when inferring deeper relationships and less informative when inferring relationships among more closely related taxa. In principle, phylogenetic analysis of concatenated alignments of 16S rDNA and 18S rDNA sequences offer the potential to infer a highly resolved tree at both deep and shallow levels of relatedness. We tested this approach within the Scyphozoa and demonstrated that our concatenated dataset increased bootstrap values for most of the clades (Fig. 2.6) in our analyses, most often to 100%. Even when specific relationships in the trees inferred from the 16S rDNA and 18S rDNA alignments alone were inconsistent with weak statistical support, the concatenated alignment was able to resolve the inconsistency with robust support (e.g., the position of rhizostomes). For instance, phylogenetic analysis of the dataset of 16S rDNA sequences did not resolve the position of the Coronatae because the two sequences in this clade (Atolla sp.) had highly variable 16S rDNA sequences that resulted in very long branches. The position of the coronates within the Hydrozoa, although with very weak statistical support, is most likely due to long branch attraction as well as a low sample number. The more comprehensive 16S rDNA dataset (Fig. 2.5), the 18S rDNA sequence dataset (Fig. 2.3) and the concatenated 16S/18S rDNA sequence (Fig. 2.4) dataset showed the Coronatae as the sister group to a clade consisting of all other scyphozoans (i.e., semaeostomes and rhizostomes) with high statistical support; this position is consistent with previous molecular phylogenetic studies and comparative morphology (Collins, 2002; Dawson, 2004; Marques & Collins, 2004; Collins et al., 2006; Bayha et al., 2010). The tree inferred from the concatenated alignment of 16S rDNA and 18S rDNA sequences represents some of the relationships shown in previous studies using 18S  33  rDNA and 28S rDNA sequences that included members of all scyphozoan families (Bayha et al., 2010). The main unresolved relationships involve the Cyanea, Drymonema, and Chrysaora clades. Phylogenetic analyses of concatenated 18S rDNA and 28S rDNA sequences show a clade of Chrysaora species. Our concatenated 16S rDNA and 18S rDNA datasets did not unify all Chrysaora species to the exclusion of Sanderia malayensis and Pelagia noctiluca. This discrepancy might reflect a more limited number of sequences included in our study. Nonetheless, our study has shown that the use of only one type of data set limits the confidence in the results and that each data source has its strengths and limitations. Mitochondrial genes, especially COI, have been used frequently for clarifying intra- and interspecific relationships in many different groups of organisms, including the Scyphozoa (e.g., Dawson & Jacobs, 2001; Holland et al., 2004; Dawson, 2005a,b; Bayha & Dawson, 2010; Ortman et al., 2010). DNA barcoding with COI sequences has worked well for many cnidarian taxa but could not be universally applied. Especially in the Anthozoa, COI was not well suited to resolve species relationships due to a very slow substitution rate (Romano & Palumbi, 1997; Medina et al., 1999; Van Oppen et al., 1999). Furthermore, acquiring COI genes in some members of the Medusozoa is extremely difficult (Miglietta et al., 2009; Moura et al., 2011; unpublished observations by SFS). Therefore, 16S rDNA sequences have been explored as an alternative “barcoding gene” in hydrozoans and anthozoans with great success (Schierwater & Ender, 2000; Govindarajan et al., 2004; Collins et al., 2005; Cantero et al., 2010; Moura et al., 2011). 16S rDNA sequences are much easier to amplify, so this marker should be explored more comprehensively within the Scyphozoa. Until this study, very few 16S  34  rDNA sequences from scyphozoans have been added to GenBank. With this project we added 70 more to the 17 previously existing 16S rDNA sequences available from the Scyphozoa. This will hopefully encourage future work involving this mitochondrial gene.  2.4.2 The phylogeography of Cyanea Mitochondrial markers, like 16S rDNA sequences, have been used successfully in previous studies of cnidarian phylogeography (e.g., Schroth et al., 2002; Govindarajan et al., 2004). The 16S rDNA sequences generated in this study distinguished the North Pacific and North Atlantic clades of Cyanea with an almost 10% mean genetic distance, which falls into the 7.8-14% range of divergences shown previously in putative species of Aurelia (Schroth et al., 2002). Therefore, the genetic distance between the North Atlantic and North Pacific isolates of Cyanea as well as their physical separation suggests that the two clades represent separate species. The separation of the two North Atlantic subclades was not as clear because the mean genetic distance between them was only about 2%. However, because the genetic variation within all three clades (NEP, NWA1 and NWA2) was less than 0.2%, there was still a recognizable difference between the two Atlantic clades. Our interpretation for this pattern of genetic distances is that reproductive isolation took place more recently between the two Atlantic populations or that gene exchange still takes place at least occasionally. Isolates of the NWA1 clade were collected in more northern regions of the Atlantic compared to the specimens of the NWA2 clade. The close proximity of the two populations may have allowed occasional interbreeding and thus prevented a clear molecular separation as could be seen between the Atlantic and Pacific clades of Cyanea. It would be interesting to know if the two  35  Atlantic subclades were correlated with different life history traits such as differences in the onset of strobilation. If the appearance of sexually mature adults representing each Atlantic subgroup did not overlap in time, then the exchange of genes would be less likely; this could have allowed for (sympatric) speciation in Cyanea despite their close physical proximity like that shown previously in Aurelia (Schroth et al., 2002) and Cyanea (Brewer, 1991). The original scyphozoan species descriptions were based mostly on morphological characters (e.g. Linnaeus, 1746, 1758; Eschscholtz, 1829; Brandt, 1838; Haeckel, 1879). Because traits that distinguish scyphozoan species from one another are scarce, many species within a genus, like Cyanea, were later collapsed into one or very few cosmopolitan species (Kramp, 1961). The use of molecular data in more recent years has revealed the existence of many more, often cryptic, species within the Scyphozoa (Dawson & Jacobs, 2001; Schroth et al., 2002; Dawson, 2003, 2005a, b). Dawson (2005a) performed the first detailed study on Cyanea using both morphological and molecular data in an attempt to unravel the taxonomy of species found in the South Pacific. Our study suggests more work needs to be done for populations of Cyanea found in the North Pacific and Atlantic Oceans. It would be especially relevant to determine how the Pacific and Atlantic species relate to Cyanea capillata, the type species found in European waters. If speciation took place due to geographic distance, we would expect the Northwest Atlantic species to be more closely related to the European species, rather than the Northeast Pacific species. At the time of this study, the only available 16S rDNA sequence for Cyanea capillata was not assigned to a specific collection area, but was acquired from the Marine Biological Laboratory at Woods Hole (Kayal et al., 2011). Our  36  phylogenetic analysis showed Cyanea capillata as the sister to the NWA2 clade (data not shown), which suggests that this particular specimen was most likely collected in the Northwest Atlantic Ocean and did not actually represent the type species. Phylogeographic studies like this one could also help shed light on hybridization events and invasive species. For example, Dawson (2004) found essentially no mean genetic difference in the ITS1 sequences of Cyanea specimens collected in Alaskan and Norwegian waters (assumed to be Cyanea capillata type species). Because of the physical distance between populations found in European waters and ones found in the North Pacific Ocean it can be argued that regular gene exchange between those groups is not likely to take place without anthropogenic interference, such as the transport of specimens in ballast water (Greenberg et al., 1996). More comprehensive studies including 16S rDNA sequences (or another DNA barcode) would be necessary to elucidate the full breadth of taxonomic relationships between Cyanea populations and to determine the global distribution of this group of scyphozoans.  37  3 Genetic and Morphological Confirmation of Cyanea ferrugenia as a Valid Lion’s Mane Jellyfish Species in the Northeast Pacific Ocean 3.1 Synopsis Taxonomy in the Scyphozoa was historically based on morphological characters. The dearth of easily discernable features that could be used for species identification in jellyfish eventually led to the establishment of species with global distributions. One of these cosmopolitan species is Cyanea capillata, which represents a particular morphotype found in temperate and arctic waters. Molecular phylogenetic studies on different isolates of this morphotype have subsequently uncovered several distinct genetic lineages (or “cryptic species”), which suggest the need for a taxonomic reconsideration and revision (Dawson, 2005a). Since the mid 1700s, four different Cyanea species have been described in the North Pacific Ocean, namely C. capillata Eschscholtz, C. ferrugenia Eschscholtz, C. postelsi Brandt, and C. citrea Kishinouye (Table 1.1). Mayer (1910) later synonymized the latter three species with C. capillata. Stiasny and van der Maaden (1943) undertook a detailed morphological revision of Cyanea and concluded that of the previously mentioned species found in the North Pacific Ocean, only C. capillata and C. ferrugenia (tentatively) should be considered valid. Kramp (1961) concurred with this interpretation. Molecular phylogenetic and morphological data were collected for this study to determine the taxonomic position of several Cyanea isolates found in the Northeast Pacific Ocean. We utilized mitochondrial cytochrome c subunit I (COI) sequences to determine the phylogenetic relationship and mean genetic distances of the Northeast Pacific Cyanea isolates to other Cyanea species with available sequences, most 38  importantly Cyanea capillata, the assumed cosmopolitan species. Comparative morphology helped us determine which Cyanea species previously described in the North Pacific Ocean corresponded to the individuals collected for this study. Phylogenetic analysis using mitochondrial COI sequences showed that the Northeastern Pacific Cyanea isolates formed a sister clade to Cyanea capillata found in the Northeast Atlantic Ocean and was separate from that species by a 5% mean genetic distance. The Northeast Pacific Cyanea isolates are therefore molecularly distinct from Cyanea capillata, but the low mean genetic distance suggests a more recent split between the two populations. This split may have occurred naturally or through anthropogenic means. The Northeast Pacific Cyanea isolates shared the most features with Cyanea ferrugenia Eschscholtz, namely the similar width of ocular and tentacular gastric pouches, long and straight marginal canals located in the tentacular lobes, and the square appearance of the marginal lobes including relatively deep tertiary clefts. This study shows that Cyanea capillata has a range more limited than previously assumed by Mayer (1910). The Cyanea isolates collected in the Northeast Pacific Ocean are a distinct molecular lineage with morphological features that correspond most closely to Cyanea ferrugenia originally described by Eschscholtz in 1829.  3.2 Methods 3.2.1 Collection and preservation of specimens The specimens for this study were collected using a dip net in several areas of the Northeastern Pacific Ocean (Table 3.1; Fig. 3.1 shows Cyanea collection locations). The jellyfish were identified to the lowest possible taxonomic level according to their  39  morphology, which was later confirmed with molecular phylogenetic markers. Some species were received as polyp cultures from different aquaria around the world (Table 3.1). Tissue samples were preserved in 95% ethanol for subsequent DNA extraction and sequencing and in 10% formaldehyde for morphological characterization.  40  Table 3.1 - Collection data showing the sampling spots of specimens used for molecular and morphological analyses in this study.  Species  Sampling Date  Sampling Site  Latitude  Longitude  Aurelia labiata  June 6, 2010  Bamfield, Canada  48.828125  -125.137511  Chrysaora fuscescens (1-3)  June 13, 2010  Bamfield, Canada  48.828125  -125.137511  Chrysaora helova  n/a  Kamo Aquarium, Japan  n/a  n/a  Chrysaora pacifica  n/a  Vancouver Aquarium, Canada  n/a  n/a  Cyanea ferrugenia (A)  Sept. 13, 2005  Knight Island Passage, Alaska  60.292718  -147.984317  Cyanea ferrugenia (B1)  May, 2011  Bamfield, Canada  48.828125  -125.137511  Cyanea ferrugenia (B2)  May, 2011  Bamfield, Canada  48.828125  -125.137511  Cyanea ferrugenia (IA)  August, 2011  Indian Arm, Canada  49.375031  -122.885353  Cyanea ferrugenia (JB)  Sept., 2010  Jericho Beach, Canada  49.2761  -123.200841  Cyanea ferrugenia (OP)  Aug. 10, 2010  Ogden Point, Canada  48.413076  -123.387675  Cyanea ferrugenia (VA)  n/a  Vancouver Aquarium, Canada  n/a  n/a  Pelagia noctiluca  Sept. 14, 2003  North Atlantic  40.3  -68.116667  Sanderia malayensis  n/a  Mystic Aquarium, U.S.A.  n/a  n/a  41  Figure 3.1 - Geographical sampling map Collection locations for Cyanea ferrugenia specimens used for morphological and genetic analyses: Knight Island Passage in Alaska, U.S.A.; Bamfield and Victoria on Vancouver Island, Jericho Beach (Vancouver) on the mainland, British Columbia, Canada.  3.2.2 DNA extraction, PCR amplification and sequencing DNA was purified from individuals using the Qiagen DNAeasy purification kit (Invitrogen Inc.). Genes were amplified utilizing the polymerase chain reaction (PCR) with the following primers: LCO-1490 (5’-3’) GGTCAACAAATCATAAAGATATTGG (Folmer et al., 1994); MedCOIR (5’-3’) GGAACTGCTATAATCATAGT-TGC (Ortman et al., 2010). The PCR protocol was as follows: DNA was amplified with an initial denaturing period (94°C for 120s), 40 cycles of denaturing (94°C for 60s), annealing (45°C for 120s), and extension (72°C for 180s), with a final extension period (72°C for 42  300s) and storage at 4°C. Sequencing was performed directly from purified PCR amplification products with ABI big-dye reaction mix using the amplification primers.  3.2.3 Molecular phylogenetic analysis and distance methods Eighteen sequences acquired in this study (Table 2.1) and fourteen sequences from GenBank (Table 3.2) were aligned with Clustal W (Thompson et al., 1994) and manually refined by eye with the use of MacClade 4 (Maddison & Maddison, 2001). The best-fit model of evolution for the Maximum Likelihood analysis was found using jModelTest (Guindon & Gascuel, 2003; Posada, 2008). The alpha shape parameters were estimated from the data using the General Time Reversible (GTR) model for base substitutions, a gamma distribution with invariable sites and six rate categories, respectively. Phylogenetic relationships were reconstructed using Paup* V 4.0.b10 (Swofford, 2002) for Maximum Parsimony (MP) and GARLI (Zwickl, 2006) for Maximum Likelihood (ML). Paup* V 4.0.b10 was also used to construct a distance matrix. Posterior probabilities using Bayesian analysis were performed in MrBayes 3.0 (Huelsenbeck & Ronquist, 2001). The program was set to operate with GTR, a gamma distribution and four Monte-Carlo-Markov chains (MCMC) (default temperature. 0.2). A total of 2,000,000 generations were calculated with trees sampled every 100 generations and with a prior burn-in of 200,000 generations (2000 sampled trees were discarded). A majority rule consensus tree was constructed from 18,000 post-burn-in trees with PAUP* 4.0. Posterior probabilities correspond to the frequency at which a given node is found in the post-burn-in trees.  43  Table 3.2 - GenBank accession numbers for species used in this study.  Species  GenBank Accession number  Cyanea capillata  AY902911  Cyanea annaskala  AY902912 AY902913 AY902914 AY902915 AY902916 AY902917 AY902923  Cyanea rosea  AY902919 AY902920 AY902921 AY902922  3.2.4 Comparative morphology The majority of measurements and observations were done on freshly caught specimens (e.g., bell diameter, color, and width of ocular and tentacular gastric pouches); some were performed in the laboratory using a Leica MZ6 stereomicroscope (exumbrella papillae, number and depth of coronal muscle folds, presence of GVC pits in muscle folds, and marginal lobe canals). Pictures were taken with a Canon PowerShot SD800 IS Digital Elph, close-ups with a PixeLink Megapixel color digital camera connected to the stereomicroscope.  3.3 Results 3.3.1 Molecular phylogenetic analysis A phylogenetic tree was constructed consisting of 14 COI sequences, 11 new and three from GenBank (Fig. 3.2). The alignment contained 770 aligned sites. The analysis 44  included only semaeostome scyphozoans, mainly members of the Cyanea genus with a Chrysaora clade (including Sanderia malayensis and Pelagia noctiluca) and an Aurelia clade as outgroup taxa. All Cyanea sequences formed a robust monophyletic group. Within this clade the two Cyanea species found in the Southern Pacific Ocean, namely C. annaskala and C. rosea, branched as a sister clade to the rest of the Cyanea species. The specimens collected for this study in the Northeast Pacific Ocean formed a monophyletic group with high statistical support. Isolates of Cyanea capillata found in European waters grouped as a sister clade to the Northeast Pacific species with high statistical support.  45  Figure 3.2 - Molecular phylogenetic analysis of cytochrome c oxidase subunit I (COI) sequences Gamma-corrected maximum likelihood tree (-lnL = 4073.37495, γ = 1.3140, proportion of invariable sites = 0.5610, 6 rate categories: A-C, 1.0000; A-G, 79663.1392; A-T, 27141.5820; CG, 27141.5820; C-T, 172042.4089; and G-T, 1.0000) inferred using the GTR model of substitution on an alignment of 14 COI sequences and 770 unambiguously aligned sites. Numbers at the branches denote bootstrap values of maximum parsimony (MP, >60%), maximum likelihood (ML, >60%) and Bayesian posterior probabilities (PP, >0.95) in the format: (MP/ML over PP). Black dots on branches denote robust bootstrap percentages and posterior probabilities of 90% and higher. Specimens of the North-east Pacific clade were collected in Knight Island Passage (A), Jericho Beach (JB), and Bamfield (B).  Ten COI sequences from different isolates of C. ferrugenia were acquired from the Northeast Pacific Ocean (Fig. 3.1, Table 3.1). Thirteen C. annaskala and C. rosea sequences were obtained from GenBank (Table 3.2) and Chrysaora quinquecirrha was used as an outgroup for a 24-taxon alignment consisting of 456 sites. The mean genetic 46  distances between the South Pacific species, between the South Pacific species and C. capillata, and between the South Pacific species and C. ferrugenia ranged from 15 to 17% (Table 3.3). A 5% mean genetic distance separated C. capillata and C. ferrugenia. Intraspecific distances range from 0.09 in C. ferrugenia to 0.7% in C. rosea.  Table 3.3 - Mean genetic distances among Cyanea lineages using COI Distances were derived using the k2p substitution model. The diagonal shows variation within genetic lineages.  Cyanea annaskala  Cyanea rosea  Cyanea capillata  Cyanea annaskala  0.0031 ± 0.0020  Cyanea rosea  0.1748 ± 0.0038  0.0071 ± 0.0042  Cyanea capillata  0.1642 ± 0.0010  0.1570 ± 0.0037  -  Cyanea ferrugenia  0.1700 ± 0.0024  0.1536 ± 0.0031  0.0534 ± 0.0010  Cyanea ferrugenia  0.0009 ± 0.0012  3.3.2 Comparative morphology Cyanea specimens used for comparative morphological analysis were collected in waters around Bamfield, Victoria, and Vancouver, British Columbia (Fig. 3.1). Two animals sampled in Bamfield displayed very different color despite having identical COI sequences (Fig. 3.3).  47  Figure 3.3 - Color comparison Cyanea ferrugenia specimens collected in Bamfield, May 2011. Note the difference in color, even though molecular analysis shows they belong to the same species. A. Scale bar = 215 mm. B. Scale bar = 200 mm.  The following features can generally be found in all Cyanea species and are important for species discrimination (Fig. 3.4). The umbrella is subdivided into eight main lobes, separated by eight primary clefts (Fig. 3.4 A). Each main lobe is subdivided by a secondary cleft into two secondary lobes (also called ephyrae lobes), for a total number of 16 secondary lobes. The tertiary cleft splits the secondary lobes into one ocular and one tentacular lobe. The first faces the rhopalium at the base of the secondary cleft; the latter is positioned on the side of the tentacles. The gastrovascular cavity (GVC) splits into radiating gastric pouches ending in marginal canals (Fig. 3.4 B). These gastric pouches may be ocular reaching toward the rhopalia or tentacular toward the tentacle bundles. On the subumbrella, coronal muscle folds run along the periphery of the GVC opening, while radial muscle folds radiate out on either side of the tentacle bundles (Fig. 48  3.4 B). Figure 4 C-F show close-ups of the radial and coronal muscle folds, as well as the marginal lobe canals in the tentacular and ocular lobe. In both types of muscle folds GVC pits are visible (Fig. 3.4 C, D); these are pouches formed by the GVC, they are continuous with the GVC and reach into the muscle folds. The marginal lobe canals in the tentacular lobes are roughly six in number and run relatively straight toward the outer periphery of the umbrella (Fig. 3.4 E). One large curved canal branches extensively through the ocular lobe (Fig. 3.4 F).  49  50  Figure 3.4 - Morphological details of Cyanea ferrugenia specimen collected for this study A. Aboral view of live specimen; ml - main lobe, sl - secondary lobe (alternatively called ephyra lobe), ol - ocular lobe, tl - tentacular lobe, pc - primary cleft, sc - secondary cleft, tc - tertiary cleft, triple arrow head - rhopalium. Scale bar = 215 mm. B. Subumbrella view of live specimen; ogp - ocular gastric pouch, tgp - tentacular gastric pouch, single arrow head - coronal muscle folds, double arrow head - radial muscle folds. Scale bar = 10 mm. C. Subumbrella close-up of preserved specimen; arrow - gastro-vascular cavity (GVC) pits in lateral muscle folds. Scale bar = 4 mm. D. Subumbrella close-up of preserved specimen; arrow – GVC pits in coronal muscle folds. Scale bar = 4 mm. E. Close-up of preserved specimen’s tentacular lobe; asterisk – marginal lobe canal. Scale bar = 4 mm. F. Close-up of preserved specimen’s ocular lobe; asterisk – marginal lobe canal. Scale bar = 4 mm.  Table 3.4 is a summary of features described for Cyanea species found in the North Pacific Ocean in the literature as well as what was recorded for the specimens collected for this study in comparison with C. capillata, the type species from the North Atlantic. The C. ferrugenia described here as well as the C. ferrugenia described in the literature were found in the Northeast Pacific Ocean. The range for C. postelsi is less specific (North Pacific), while C. citrea was found closer to Japan in the Northwest Pacific Ocean. The two types of gastric pouches (ocular and tentacular) are much more equal in width in all but C. capillata; here the tentacular pouch can be up to three times as wide as the ocular pouch. The marginal canals in the tentacular lobes differ between the species; C. capillata has canals that are bent with rare anastomoses (Fig. 3.5 A); both C. ferrugenia species display long and straight canals without anastomoses (Fig. 3.4 E, Fig. 3.5 C), while C. citrea has canals that are mostly dendritic with rare anastomoses (Fig. 3.6); C. postelsi has canals that are extensively branched (Fig. 3.5 B). C. postelsi has clearly distinct marginal lobes that are quite rounded with a very deep concave tertiary cleft (Fig. 3.5 B). Both C. capillata (Fig. 3.5 A) and C. citrea (Fig. 3.6) have marginal lobes that are rounded and separated by a shallow tertiary cleft. The lobes in C.  51  ferrugenia appear almost square with a deep tertiary cleft (Fig. 3.4 A, E, F; Fig. 3.5 A). Only C. capillata displays faint papillae (nematocyst clusters) on the periphery of the exumbrella, while the other species have a smooth bell. The umbrella size measurements had a broad range, with C. capillata and C. ferrugenia reaching the largest size with up to 1000 mm in the first and up to 500 mm in the latter. The other three species reach smaller sizes with roughly 300 mm as their maximum. Specimens of Cyanea ferrugenia were observed around Victoria, B.C., in the late summer of 2010 that exceeded the recorded measurements; they were approximately 1000 mm in diameter. Color descriptions more or less cover the same hews for all species, mostly red, yellow, and brown (Table 3.4). All but C. ferrugenia (10 folds) have on average the same number of coronal muscle folds (~14); the muscle folds in all species are shallow in depth and possess GVC pits. A tertiary cleft is present in all species and all possess 16 secondary lobes (Fig. 3.4 A, Fig. 3.5 A-C, Fig. 3.6).  52  Table 3.4 - Morphological features of Cyanea spp. Comparison of morphological features important for the taxonomy of Cyanea spp. in the North Pacific Ocean. The table includes records documented by other researchers as well as findings of this study. (1) Brandt 1838, (2) Dawson 2005a, (3) Eschscholtz 1829, (4) Forbes 1848, (5) Gaede 1816, (6) Haeckel 1879, (7) Kishinouye 1910, (8) Mayer 1910, (9) Russell 1970, (10) Stiasny and van der Maaden 1943.  Cyanea capillata  Cyanea postelsi  Cyanea citrea  Cyanea ferrugenia  Cyanea ferrugenia  (2-6, 9, 10)  (1, 8)  (7, 10)  (3, 6, 10)  (this study)  distribution  North Atlantic  North Pacific  Northwest Pacific  Northeast Pacific  Northeast Pacific  width ratio of ocular gastric pouch to tentacular gastric pouch  proximal edge 1:2 distal edge (at level of rhopalia) 1:3  -  distal edge (at level of rhopalia) 1:2  proximal edge 1:1.25 distal edge (at level of rhopalia) 1:1.5-2  proximal edge 1:1.4 distal edge (at level of rhopalia) 1:1.8  marginal lobe canals  canals in tentacular lobes somewhat bend, anastomoses rare (Fig. 3.5A)  Fig. 3.5B  canals mostly dendritic, anastomoses very rare (Fig. 3.6)  straight canals in tentacular lobes, without anastomoses (Fig. 3.5C)  canals in tentacular lobes long and straight (Fig. 3.4E)  shape of marginal lobes  rounded, with shallow tertiary cleft (Fig. 3.5A)  rounded, very deep concave tertiary cleft (Fig. 3.5B)  rounded, with shallow tertiary cleft (Fig. 3.6)  almost square, deep tertiary cleft (Fig. 3.5C)  almost square, deep tertiary cleft (Fig. 3.4A, E, F)  exumbrella papillae  centre smooth, periphery faintly papillose  -  -  -  absent  bell diameter  300-600 mm, rarely 1000 mm  63.5-304.8 mm  300 mm  400-500 mm  80-260 mm (observed at ~ 1000 mm)  53  Cyanea capillata  Cyanea postelsi  Cyanea citrea  Cyanea ferrugenia  Cyanea ferrugenia  (2-6, 9, 10)  (1, 8)  (7, 10)  (3, 6, 10)  (this study)  mainly yellow with some brown or rusty brown  red-brown or light yellow, sometimes oral arms almost pink (Fig. 3.3A & B)  color  variation of yellow, red and brown  light rustyyellow  mainly orange and orangebrown  # of coronal muscle folds  13-15  13-15  ~15  10  12-16  depth of coronal muscle folds  shallow (~0.5-2 mm)  -  -  -  shallow (0.5-2 mm)  GVC pits in muscle folds  present  present  -  present  present  tertiary cleft  present (Fig. 3.5A)  present (Fig. 3.5B)  present (Fig. 3.6)  present (Fig. 3.5C)  present (Fig. 3.4A)  # of secondary lobes  16 (Fig. 3.5A)  16 (Fig. 3.5B)  16 (Fig. 3.6)  16 (Fig. 3.5C)  16 (Fig. 3.4A)  54  Figure 3.5 - Line drawings of the oral umbrella side of Cyanea spp.  A. Cyanea capillata Eschscholtz; diagram redrawn and modified from Stiasny and van der Maaden (1943). B. Cyanea postelsi Brandt; diagram redrawn and modified from Brandt (1838). C. Cyanea ferrugenia Eschscholtz; diagram redrawn and modified from Stiasny and van der Maaden (1943). 55  Figure 3.6 - Line drawing of the oral umbrella side of Cyanea citrea Kishinouye. Diagram redrawn and modified from Stiasny and van der Maaden (1943).  3.4 Discussion The phylogenetic analysis and genetic distances clearly separated the South Pacific species from each other and from the North Atlantic C. capillata and the North Pacific Cyanea isolates collected for this study (Fig. 3.2, Table 3.3). The mean genetic distances fall within the range of 10 to 24% that has typically been reported for different species of scyphozoans (Dawson & Jacobs, 2001; Holland et al., 2004; Dawson, 2005a); however the 5% genetic distance between the Northeast Pacific population and C. capillata from the North Atlantic was lower (Table 3.3). Because the genetic variation within the ten C. ferrugenia isolates reported here reached at most 0.09%, we argue that the Northeast Pacific group represents a distinct genetic lineage from the type species found in the North Atlantic Ocean. Five percent genetic difference may represent a more recent split between the type species population and C. ferrugenia. This split could have taken place when members of the North Atlantic population moved into the North Pacific via a route through the Artic oceans. This could also explain the low intraspecific 56  variation within the C. ferrugenia clade, because older populations, such as those found in the South Pacific Ocean, have had more time for mutations to accumulate. For the morphological analysis, the sampled Cyanea specimens were compared to the four Cyanea species previously described in the North Pacific Ocean, namely C. capillata, C. postelsi, C. citrea, and C. ferrugenia. The sampled specimens shared the most morphological characters with C. ferrugenia (Table 3.4). These included (1) the lack of exumbrella papillae, (2) a similar width of ocular and tentacular gastric pouches (1:1.25 - 1.2 in C. ferrugenia and 1:1.4 - 1.8 in 8 in C. ferrugenia (this study), (3) long and straight marginal canals located in the tentacular lobes (Fig. 3.4 E, Fig. 3.5 C), and (4) the square appearance of the marginal lobes including relatively deep tertiary notches (Fig. 3.4 A & Fig. 3.5 C). The lack of exumbrella papillae helped distinguish the sampled Cyanea from C. capillata. This is a feature that was shown to be significant in species distinction within the Cyanea genus (Dawson, 2005a). The descriptions of C. postelsi, C. citrea, and C. ferrugenia did not mention nematocyst clusters on the subumbrella; this might mean that they were not observed or that they were deemed unimportant and hence not recorded. Stiasny and van der Maaden (1943) suggested that C. citrea might in fact be C. ferrugenia. Very little morphological data has been recorded for C. citrea (Kishinouye, 1910). If the two nominal species were indeed identical, then the distribution of C. ferrugenia would reach from the Northeastern Pacific Ocean all the way to the waters of Northern Japan. Though easily distinguishable from C. ferrugenia, the validity of C. postelsi still needs to be demonstrated with additional morphological as well as molecular data. During this study, individuals with features distinctive of C. postelsi (e.g. very  57  curved lobes, deep clefts, and extensively branched marginal canals, as seen in Fig. 3.5 B) were not found. Reports of this species have been limited (e.g. Brandt, 1938; Haeckel, 1879) and the authenticity of this group has been questioned (e.g. Mayer, 1910; Stiasny, 1930). The morphological comparisons made in this study indicated that some features are problematic in their use for species distinction. Because the growth of scyphozoan jellyfish is gradual and continuous starting off from a small ephyra stage, it is hard to determine with certainty at what time during development specimens should be measured. Medusae may also vary in size in different years (personal observation by BDO and SFS) and because of differences in food availability (Lucas, 1996). The size of medusae also tends to shrink by general deterioration after reaching a maximum size (Rasmussen, 1973; Hamner & Jenssen, 1974; Kakinuma, 1975). Umbrella size was also shown to correlate with mass, mean depth of primary clefts and secondary clefts, bell thickness, number of exumbrella nematocyst clusters and mean number of radial muscle folds (Dawson, 2005a). Therefore, only one of these features, or useful ratios of some of these features, should be measured for comparison. The usefulness of umbrella size measurements appears doubtful. Color can occasionally help to distinguish between species, as seen in the red C. capillata Linnaeus (1758) and the blue C. lamarckii Péron and Lesueur (1810); however, this study shows that variation of color may not necessarily correspond to distinctiveness at the molecular level (Fig. 3.3). Color can thus only be a helpful feature in combination with other more definite characters, such as molecular data. The number of coronal muscle folds can help distinguish between Cyanea species (Dawson, 2005a). According  58  to Eschscholtz (1829), C. ferrugenia has considerably fewer coronal muscle folds (10) than the other Cyanea species (~14) (Table 3.4). The counting of coronal muscle folds can be somewhat subjective. While counting muscle folds I noticed the difficulty of clearly distinguishing folds at the top and bottom of each gastric pouch section (Fig. 3.4 D). Depending on the decision of each researcher and the equipment (such as microscopes) available to them, they may count these as clearly distinct folds or not. It is possible that Eschscholtz (1829) either decided not to count these edge folds or that the equipment available to him did not allow him to clearly distinguish them. For this study all folds visible under the microscope were counted. The depth of the coronal muscle folds and the presence of GVC pits in the muscle folds can distinguish Cyanea species (Dawson, 2005a), but did not prove useful for this study. The data is now recorded, and together with the presence/absence of tertiary clefts and the number of secondary lobes will be available for comparisons with future studies. For any of these features, clear guidelines should be established to assure measurements are consistent and therefore comparable. Phylogenetic analysis using COI sequences established that the Northeast Pacific Cyanea is most closely related to the European Cyanea capillata, but distinct enough to be considered a separate species. Comparative morphology suggests that the Northeast Pacific Cyanea most likely corresponds to C. ferrugenia originally described by Eschscholtz in 1829.  59  4 Conclusions Determining the phylogenetic relationships and species boundaries within scyphozoans is especially important in light of the changes that are currently taking place in the world’s oceans as a consequence of global climate change (Brodeur et al., 1999; Hays, et al., 2005; Attrill et al., 2007). Jellyfish seem to be on the rise and can cause considerable damage to multiple economic sectors, e.g. fisheries, tourism, and hatcheries (Mills, 1995; Arai, 1997; Hay, 2006; Graham & Bayha, 2007; Purcell et al., 2007; Pitt et al., 2009; Richardson et al., 2009; West et al., 2009). In order to interpret the role of scyphozoan jellyfish in different environments, it is important to put the diversity of jellyfish species within a phylogenetic context. Relatively variable DNA markers that are straightforward to acquire, such as 16S rDNA sequences, provide powerful tools to investigate species boundaries and phylogeographies. We demonstrated the usefulness of 16S rDNA sequences for phylogenetic analysis and for determining genetic boundaries between species within the Scyphozoa. Phylogenetic analysis of datasets that combine this mitochondrial gene with the more conserved 18S rDNA gene greatly increased the resolution of relationships within the Scyphozoa. The use of the faster evolving mitochondrial genes was also especially insightful in more comprehensive analyses of diversity involving many cogeneric species. 16S rDNA sequences were shown to be a great candidate gene for such studies, not least of which because they are relatively easy to acquire. Nonetheless, this marker was able to discern phylogeographic patterns of Cyanea populations found in the Northeast Pacific and Northwest Atlantic Oceans. The three clades demonstrated in this study (NEP, NWA1, NWA2) represent at least two, possibly three putative species that  60  can be explored further with comparative morphology and ecology. A 16S rDNA sequence comparison of the Pacific and Atlantic Ocean isolates reported here to the European type species for Cyanea would shed additional light on taxonomic relationships and patterns of phylogeography within the group and perhaps scyphozoans in general. Similar to the conclusions drawn by Dawson (2005a), the COI data described here also showed that Cyanea capillata is not a cosmopolitan species, but in fact consists of several cryptic species with more limited ranges than previously thought. Although morphological characters can be useful to distinguish different Cyanea species from one another, these data should always be used in combination with molecular markers, such as 16S rDNA and COI, for taxonomic purposes. A comparison to historical records raised several issues pertaining to which characters were valuable in distinguishing Cyanea species from one another and how the measurements for these characters were obtained, such as color and bell diameter (Table 3.4). It is nonetheless important that future studies include detailed morphology in order to help sort out the validity of species described previously based solely on morphology. Many of the studies done in the past 200 years on jellyfish taxonomy could thus be validated and revised, if necessary, with modern insights derived from the variability present in molecular data.  61  Bibliography Apakupakul K, Siddall ME, Burrelson E: Higher-level relationships of leeches based on morphology and gene sequences. Mol Phylogenet Evol 1999, 12:350–359. Arai MN: A functional biology of Scyphozoa. London: Chapman and Hall; 1997. Attrill MJ, Wright J, Edwards M: Climate related increases in jellyfish frequency suggest a more gelatinous future for the North Sea. Limnol Oceanogr 2007, 52:480–485. Avise, JC, Shapiro JF, Daniel SW, Aquadro CF, Lansman RA: Mitochondrial DNA differentiation during the speciation process in Peromyscus. Mol Biol Evol 1983, 1:38–56. Bayha KM, Dawson MN: New family of allomorphic jellyfishes, Drymonematidae (Scyphozoa, Discomedusae), emphasizes evolution in the functional morphology and trophic ecology of gelatinous zooplankton. Biol Bull 2010, 219:249-267. Bayha KM, Dawson MN, Collins AG, Barbeitos MS, Haddock SHD: Evolutionary relationships among scyphozoan jellyfish families based on complete taxon sampling and phylogenetic analyses of 18S and 28S ribosomal DNA. Integr Comp Biol 2010, 50(3):436-455. Boero F, Bouillon J, Gravili C, Miglietta MP, Parsons T, Piraino S: Gelatinous plankton: irregularities rule the world (sometimes). Mar Ecol Prog Ser 2008, 356:299-310. Brandt JF von: Über Schirmquallen. In: Mémoires de L’académie impériale des Sciences de Saint-Pétersbourg Tome II. St.-Pétersbourg: De L’imprimerie de L’académie impériale des Sciences; 1838. Brewer RH: Morphological differences between, and reproductive isolation of, two populations of the jellyfish Cyanea in Long Island Sound, USA. Hydrobiologia 1991, 216/217:471-477. Bridge D, Cunningham CW, DeSalle R, Buss LW: Class-level relationships in the phylum Cnidaria: molecular and morphological evidence. Mol Biol Evol 1995, 12(4):679-689. Brodeur RD, Mills CE, Overland JE, Walters GE, Schumacher JD: Evidence for a substantial increase in gelatinous zooplankton in the Bering Sea, with possible links to climate change. Fish Oceanogr 1999, 8(4): 296-306. Brown WM, George Jr M, Wilson AC: Rapid evolution of animal mitochondrial DNA. Proc Natl Acad Sci USA 1979, 76:1967–1971. 62  Bucklin A, Hopcroft RR, Kosobokova KN, Nigro LM, Ortman BD, Jennings RM, Sweetman CJ: DNA barcoding of Arctic Ocean holozooplankton for species identification and recognition. Deep-Sea Res Pt II 2010, 57(1-2):40-48. Cantero ÁLP, Sentandreu V, Latorre A: Phylogenetic relationships of the endemic Antarctic benthic hydroids (Cnidaria, Hydrozoa): what does the mitochondrial 16S rRNA tell us about it? Polar Biol 2010, 33:41-57. Caterino MS, Reed RD, Kuo MM, Sperling FAH: A partitioned likelihood analysis of swallowtail butterfly phylogeny (Lepidoptera: Papilionidae). Syst Biol 2001, 50:106–127. Collins AG: Phylogeny of Medusozoa and the evolution of cnidarian life cycles. J Evol Biol 2002, 15:418–432. Collins AG: Recent insights into cnidarian phylogeny. Smithson Contrib Mar Sci 2009, 38:139-149. Collins AG, Winkelmann S, Hadrys H, Schierwater B: Phylogeny of Capitata and Corynidae (Cnidaria, Hydrozoa) in light of mitochondrial 16S rDNA data. Zool Scr 2005, 34:91-99. Collins AG, Schuchert P, Marques AC, Jankowski T, Medina M, Schierwater B: Medusozoan phylogeny and character evolution clarified by new large and small subunit rDNA data and an assessment of the utility of phylogenetic mixture models. Syst Biol 2006, 55:97–115. Daly M, Brugler MR, Cartwright P, Collins AG, Dawson MN, Fautin DG, France SC, McFadden CS, Opresko DM, Rodriguez E, Romano SL, Stake JL: The phylum Cnidaria: A review of phylogenetic patterns and diversity 300 years after Linnaeus. Zootaxa 2007, 1668:127-182. Dawson MN: Macro-morphological variation among cryptic species of the moon jellyfish, Aurelia (Cnidaria: Scyphozoa). Mar Biol 2003, 143:369-379. Dawson MN: Some implications of molecular phylogenetics for understanding biodiversity in jellyfishes, with emphasis on Scyphozoa. Hydrobiologia 2004, 530/531:249-260. Dawson MN: Cyanea capillata is not a cosmopolitan jellyfish: morphological and molecular evidence for C. annaskala and C. rosea (Scyphozoa: Semaeostomeae: Cyaneidae) in south-eastern Australia. Invertebr Syst 2005a, 19:361-370.  63  Dawson MN: Incipient speciation of Catostylus mosaicus (Scyphozoa, Rhizostomeae, Catostylidae), comparative phylogeography and biogeography in south-east Australia. J Biogeogr 2005b, 32:515-533. Dawson MN, & Hamner WM: A character-based analysis of the evolution of jellyfish blooms: adaptation and exaptation. Hydrobiologia 2009, 616:193-215. Dawson MN, Jacobs DK: Molecular Evidence for Cryptic Species of Aurelia aurita (Cnidaria, Scyphozoa). Biol Bull 2001, 200:92-96. Dawson MN, Martin LE: Geographic variation and ecological adaptation in Aurelia (Scyphozoa, Semaeostomeae): some implications from molecular phylogenetics. Hydrobiologia 2001, 451:259-273. Eschscholtz JF: System der Acalephen: eine ausführliche Beschreibung aller medusenartigen Strahlthiere. Berlin: Dummler F; 1829. Fautin DG: Structural diversity, systematics, and evolution of cnidae. Toxicon 2009, 54(8):1054-64. Folmer O, Black M, Hoen W, Lutz R, Vrijenhoek R: DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol 1994, 3:294–299. Forbes E: A monograph of the British naked-eyed medusae with figures of all the species. London: Adlard C & J; 1848. Gäde HM: Beiträge zur Anatomie und Physiologie der Medusen : nebst einem Versuch einer Einleitung über das, was den ältern Naturforschern in Hinsicht dieser Thiere bekannt war. Berlin: Maurer'schen Buchhandlung; 1816. Govindarajan AF, Halanych KM, Cunningham CW: Mitochondrial evolution and phylogeography in the hydrozoan Obelia geniculata (Cnidaria). Mar Biol 2004, 146:213-222. Graham WM, Bayha KM: Biological invasions by marine jellyfish. In Ecological studies, Biological Invasions. Volume 193. Edited by Nentwig W. Berlin: Springer 2007, 240-255. Greenberg N, Garthwaite RL, Potts DC: Allozyme and morphological evidence for a newly introduced species of Aurelia in San Francisco Bay, California. Mar Biol 1996, 125:401-410. Guindon S, Gascuel O: A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol 2003, 52:696-704.  64  Haeckel E: Monographie der Medusen. Jena: Fischer G; 1879. Hamner WM, Dawson MN: A systematic review of the evolution of jellyfish blooms: advantageous aggregations and adaptive assemblages. Hydrobiologia 2009, 616:161191. Hamner WM, Jenssen RM: Growth, degrowth, and irreversible cell differentiation in Aurelia aurita. Am Zool 1974, 14:833-849. Hand CH, Fautin, DG: Cnidarians. In Encyclopedia Britannica. 16th edition; 1988:523528. Hay S: Gelatinous bells may ring change in marine ecosystems. Curr Biol 2006, 16:679-682. Hays GC, Richardson AJ, Robinson C: Climate change and marine plankton. Trends Ecol Evol 2005, 20(6):337-344. Hebert PDN, Ratnasingham Sv, deWaard JR: Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc R Soc Lond B 2003a, 270(Suppl):96-99. Hebert PDN, Cywinska A, Ball SL, deWaard JR: Biological identification through DNA barcodes. Proc R Soc Lond B 2003b, 270:313-321. Holland BS, Dawson MN, Crow GL, Hofmann DK: Global phylogeography of Cassiopea (Scyphozoa: Rhizostomeae): molecular evidence for cryptic species and multiple invasions of the Hawaiian Islands. Mar Biol 2004, 145:1119-1128. Huelsenbeck JP, Ronquist F: MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics 2001, 17:754-755. Kakinuma Y: An experimental study of the life cycle and organ differentiation of Aurelia aurita Lamarck. Bull of the Mar Biol Stat of Asamushi 1975, 15(3):101-112. Kayal E, Bentlage B, Collins AG, Kayal M, Pirro S, Lavrov DV: Evolution of linear mitochondrial genomes in medusozoan cnidarians. Genome Biol Evol 2011, 4(1):1-12. Ki JS, Hwang DS, Shin K, Yoon WD, Lim D, Kang YS, Lee Y, Lee JS: Recent moon jelly (Aurelia sp.1) blooms in Korean coastal waters suggest global expansion: examples inferred from mitochondrial COI and nuclear ITS-5.8S rDNA sequences. ICES J Mar Sci 2008, 65:443-452. Ki JS, Kim IC, Lee JS: Comparative analysis of nuclear ribosomal DNA from the moon jelly Aurelia sp.1 (Cnidaria: Scyphozoa) with characterizations of the 18S, 28S genes, and the intergenic spacer (IGS). Hydrobiologica 2009, 616:229-239. 65  Kishinouye K: Some medusae of Japanese waters. Japan Jour Coll Sc Tokyo 1910, 27:1-35. Knowlton N: Sibling species in the sea. A Rev Ecol Syst 1993, 24:189-216. Kocher TD: Sequence evolution of mitochondrial DNA in human and chimpanzees: Control region and protein coding region. In: Evolution of life: fossils, molecules, and culture. Edited by Osawa S, Honjo T. Springer, Tokyo 1991, 391-413. Kramp PL: Synopsis of the medusae of the world. J mar biol Ass UK 1961, 40:337342. Kramp PL: Some medusae (mainly scyphomedusae) from Australian coastal waters. Trans R Soc S Aust 1965, 89:257-278. Linnaeus, C von: Fauna Suecica. Sumtu and literis Salvii L. Stockholm, Sweden; 1746. Linnaeus, C von: Systema Naturae. 10th edn. Holmiae Salvii L. Stockholm, Sweden; 1758. Lucas CH: Population dynamics of Aurelia aurita (Scyphozoa) from an isolated brackish lake, with particular reference to sexual reproduction. J Plankton Res 1996, 18(6):987-1007. Maddison DR, Maddison WP: MacClade 4: analysis of phylogeny and character evolution. Sunderland, Massachusetts: Sinauer Associates, Inc.; 2001. Marques AC, Collins AG: Cladistic analysis of Medusozoa and cnidarian evolution. Invertebr Biol 2004, 123(1):23-42. Mayer AG: The Scyphomedusae. In Medusae of the world. Volume 3. Washington, D.C.: Carnegie Institution of Washington; 1910:603-630. Medina M, Weil E, Szmant AM: Examination of the Montastraea annularis species complex (Cnidaria: Scleractinia) using ITS and COI sequences. Mar Biotechnol 1999, 1:89–97. Medlin LK, Elwood HJ, Stickel S, Sogin ML: The characterization of enzymatically amplified eukaryotic 16S-like rRNA-coding regions. Gene 1988, 71:491–499. Miglietta MP, Schuchert P, Cunningham C: Reconciling genealogical and morphological species in a worldwide study of the Family Hydractiniidae (Cnidaria, Hydrozoa). Zool Scr 2009, 38:403–430.  66  Mills CE: Medusae, siphonophores, and ctenophores as planktivorous predators in changing global ecosystems. ICES J mar Sci 1995, 52:575-581. Mills CE: Jellyfish blooms: are populations increasing globally in response to changing ocean conditions? Hydrobiologia 2001, 451:55-68. Moritz, C, Dowling TE, Brown WM: Evolution of animal mitochondrial DNA: Relevance for population biology and systematics. Ann Rev Ecol Syst 1987, 18:269–292. Moura CJ, Cunha MR, Porteiro FM, Rogers AD: The use of the DNA barcode gene 16S mRNA for the clarification of taxonomic problems within the family Sertulariidae (Cnidaria, Hydrozoa). Zool Scr 2011, 40(5):520-537. Ortman BD, Bucklin A, Pages F, Youngbluth M: DNA barcoding the Medusozoa using mtCOI. Deep-Sea Res Pt II 2010, 57:2148-2156. Palumbi SR: Nucleic acids II: The polymerase chain reaction. In Molecular systematics. Edited by Hillis DM, Moritz C, Mable BK. Sinauer Associates, Inc.; 1996, 205-247. Péron F, Lesueur CA: Histoire générale et particulière de tous les animaux qui composent la famille des Méduses. Annls Mus Hist Nat 1809, 14:312-366. Péron F, Lesueur CA: Histoire générale et particulière de tous les animaux qui composent la famille des méduses. Annls Mus Hist nat Paris 1810, 14 :217-228. Piganeau, G, Gardner M, Eyre-Walker A: A broad survey of recombination in animal mitochondria. Mol Biol Evol 2004, 21:2319–2325. Pitt KA, Welsh DT, Condon RH: Influence of jellyfish blooms on carbon, nitrogen and phosphorus cycling and plankton production. Hydrobiologia 2009, 616: 133-149. Posada D: jModelTest: Phylogenetic model averaging. Mol Biol Evol 2008, 25:12531256. Purcell JE, Uye S, Lo W: Anthropogenic causes of jellyfish blooms and their direct consequences for humans: a review. Mar Ecol Prog Ser 2007, 350:153-174. Rasmussen E: Systematics and ecology of the Isefjord marine fauna (Denmark). Ophelia, 11:41-46. Reed RD, Sperling FAH: The interaction of process partitions in phylogenetic analysis: an example from the swallowtail butterfly genus Papilio. Mol Biol Evol 1999, 16:286-297.  67  Richardson AJ, Bakun A, Hays GC, Gibbons MJ: The jellyfish joyride: causes, consequences and management responses to a more gelatinous future. Trends Ecol Evol 2009, 24:312-322. Romano SL, Palumbi SR: Molecular evolution of a portion of the mitochondrial 16S ribosomal gene region in scleractinian corals. J Mol Evol 1997, 45:397-411. Rubinoff D, Holland BS: Between two extremes: Mitochondrial DNA is neither the panacea nor the nemesis of phylogenetic and taxonomic inference. Syst Biol 2005, 54(6):952-961. Rubinoff D, Sperling FAH: Evolution of ecological traits and wing morphology in Hemileuca (Saturniidae) based on a two-gene phylogeny. Mol Phylogenet Evol 2002, 25:70–86. Russell FS: The medusae of the British Isles. New York: Cambridge University Press; 1970. Schierwater B: Die Bedeutung von DNA-Merkmalen für die Analyse phylogenetischer Beziehungen innerhalb der Cnidaria. In Morphologie & Evolution. Edited by Gutman WF, Mollenhauer D, Peters DS. Frankfurt/M: J Senck Naturf Ges Kramer Verlag; 1994, 435-442. Schierwater B, Ender A: Sarsia marii n. sp. (Hydrozoa, Anthomedusae) and the use of 16S rDNA sequences for unpuzzling systematic relationships in Hydrozoa. Sci Mar 2000, 64(Supl.1):117-122. Schroth W, Jarms G, Streit B, Schierwater B: Speciation and phylogeography in the cosmopolitan marine moon jelly, Aurelia sp. BMC Evol Biol 2002, 2:1-10. Stiasny G: Scyphomedusen. Res scient du voy aux Indes orient néerl Mém Musée roy d’hist nat Bruxelles 1930, 11. Stiasny G, Maaden H van der: Über Scyphomedusen aus dem Ochotskishen und Kamtschatka Meer nebst einer Kritik der Genera Cyanea und Desmonema. ZJAS 1943, 76:227-266. Straehler-Pohl I, Widmer, CL, Morandini AC: Characterizations of juvenile stages of some semaeostome Scyphozoa (Cnidaria), with recognition of a new family (Phacellophoridae). Zootaxa 2011, 2741:1-37. Swofford DL: PAUP*: phylogenetic analysis using parsimony (* and other methods), v. 4.0.b10. Sunderland, Massachusetts: Sinauer Associates, Inc.; 2002. Thompson JD, Higgins DG, Gibson TJ: CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions68  specific gap penalties and weight matrix choice. Nucl Acids Res 1994, 22:4673-4680. Van Oppen MJH, Willis BL, Miller DJ: Atypically low rate of cytochrome b evolution in the scleractinian coral genus Acropora. Proc R Soc Lond B Biol Sci 1999, 266:179–183. West EJ, Welsh DT, Pitt KA: Influence of decomposing jellyfish on the sediment oxygen demand and nutrient dynamics. Hydrobiologia 2009, 616:151-160. Zwickl DJ: Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion. Ph.D. thesis. The University of Texas at Austin; 2006. www.bio.utexas.edu/faculty/antisense/garli/Garli.html  69  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0073303/manifest

Comment

Related Items