Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Mechanism of deposition and functional characterization of the histone variant H2A.Z in Saccharomyces… Wang, Yijun 2012

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2012_fall_wang_yijun.pdf [ 16.99MB ]
Metadata
JSON: 24-1.0073210.json
JSON-LD: 24-1.0073210-ld.json
RDF/XML (Pretty): 24-1.0073210-rdf.xml
RDF/JSON: 24-1.0073210-rdf.json
Turtle: 24-1.0073210-turtle.txt
N-Triples: 24-1.0073210-rdf-ntriples.txt
Original Record: 24-1.0073210-source.json
Full Text
24-1.0073210-fulltext.txt
Citation
24-1.0073210.ris

Full Text

Mechanism of deposition and functional characterization of the histone variant H2A.Z in Saccharomyces cerevisiae  by Yijun Wang B.Sc. The University of British Columbia, 2006  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Doctor of Philosophy in The Faculty of Graduate Studies (Genetics) The University of British Columbia (Vancouver) September 2012 © Yijun Wang, 2012  Abstract  Eukaryotic DNA is packaged into the cell nucleus together with histones and other proteins as a complex called chromatin. The dynamic structure of chromatin is crucial for genome regulation and is created by a variety of mechanisms including post-translational modifications, ATP-dependent remodeling, and replacement by histone variants. My dissertation investigates the structure and function of central players in the biology of histone H2A.Z, an important and yet enigmatic variant of H2A. Unlike H2A, which is deposited randomly in the genome, H2A.Z is deposited to specific locations by its dedicated ATPdependent complex SWR1-C. One subunit that belongs to SWR1-C is Yaf9, which contains the conserved yet largely unexplored YEATS domain. Here, I established the conservation of YEATS domain function from yeast to human. I determined that the three-dimensional structure of the Yaf9 YEATS domain from Saccharyomyces cerevisiae was highly similar to that of the histone chaperone Asf1, a similarity that extended to an ability of Yaf9 to bind histones H3 and H4 in vitro. In addition, I found that the Yaf9 YEATS domain was required for H2A.Z deposition at specific promoters. Focusing on the histone variant itself, I explored the precise features required for H2A.Z to function and specify its unique identity from canonical H2A. I specifically studied the Cterminal docking domain, an area of significant structural and sequence variation between H2A.Z and H2A. I determined that the last 20 amino acids of H2A.Z was required for its  ii  chromatin-anchoring ability and functions in vivo, even though it was not required for SWR1-C interaction. Furthermore, I demonstrated that M6, a region in the docking domain that diverged considerably from H2A, was required but not sufficient for H2A.Z–specific functions, including binding to SWR1-C. Finally, I found that the M6 region was both required and sufficient for binding to the H2A.Z-specific histone chaperone Chz1. In summary, my dissertation contributes to our understanding of the structure and function of the Yaf9 YEATS domain in the context of H2A.Z deposition, as well as the distinct regions of the H2A.Z C-terminal docking domain that are either required for its function or confer its uniqueness.  iii  Preface  Chapter 2 of this dissertation was published in the Proceedings of the National Academy of Sciences U.S.A. (PNAS) in December 2009 (Wang AY, Schulze JM, Skordalakes, Gin JW, Rine J, and Kobor MS, 2009). As co-first author, I was involved in the formation of research questions, research design, data collection, data analysis and writing of the manuscript. Together with Julia Schulze, another graduate student in the lab, I performed the experiments for and created Figures 2.1, 2.4, and 2.6- 2.11. Emmanuel Skordalakes performed the experiments for Figures 2.2, 2.3, and 2.5. Chapter 3 was published in Molecular and Cellular Biology (MCB) in September 2011 (Wang AY, Aristizabal MJ, Ryan C, Krogan NJ, Kobor MS, 2011). As first author of this paper, I provided the primary contribution to research design, data collection, data analysis, and manuscript writing. I created all the yeast strains and performed all experiments for Figures 3.1, and 3.3- 3.8. Maria Aristizabal performed the E-MAP experiments and, together with Colm Ryan, analyzed the data for Figure 3.2. Chapter 4 is based experiments following up the work of Chapter 3. I performed all the experiments and analyzed the data for all the figures in this chapter. In Chapters 2-4, I consistently use “we” to reflect the co-authors that contributed to the studies.  iv  Table of Contents Abstract.................................................................................................................................... ii	
   Preface ..................................................................................................................................... iv	
   Table of Contents .................................................................................................................... v	
   List of Tables ........................................................................................................................... x	
   List of Figures......................................................................................................................... xi	
   Acknowledgements .............................................................................................................. xiv	
   Dedication ............................................................................................................................. xvi	
   Chapter 1: Introduction ........................................................................................................ 1	
   1.1	
   Chromatin Structure and Architecture ......................................................................... 2	
   1.2	
   Chromatin Assembly and Disassembly ....................................................................... 4	
   1.3	
   Nucleosome Positioning .............................................................................................. 6	
   1.4	
   Chromatin Modifications ............................................................................................. 8	
   1.4.1	
   Post-translational addition of chemical groups ..................................................... 9	
   1.4.2	
   ATP-dependent chromatin remodeling complexes ............................................. 11	
   1.4.3	
   Histone variants .................................................................................................. 12	
   1.4.4	
   DNA methylation ................................................................................................ 13	
   1.5	
   Histone Variant H2A.Z .............................................................................................. 13	
   1.5.1	
   H2A.Z and transcription ..................................................................................... 15	
   1.5.2	
   Role of H2A.Z in DNA replication and repair ................................................... 19	
   1.5.3	
   H2A.Z post-translational modifications.............................................................. 19	
    v  1.5.4	
   H2A.Z deposition factors .................................................................................... 20	
   1.5.5	
   H2A.Z and H2A differences ............................................................................... 25	
   1.6	
   Summary .................................................................................................................... 30	
   Chapter 2: Asf1-Like Structure of the Conserved Yaf9 YEATS Domain and Role in H2A.Z Deposition and Acetylation...................................................................................... 32	
   2.1	
   Introduction ................................................................................................................ 32	
   2.2	
   Materials and Methods ............................................................................................... 34	
   2.2.1	
   Yeast strains, plasmids, and yeast techniques ..................................................... 34	
   2.2.2	
   Analytical-scale affinity purifications................................................................. 39	
   2.2.3	
   Protein expression and purification .................................................................... 40	
   2.2.4	
   Crystallization and structure determination ........................................................ 40	
   2.2.5	
   GST-fusion protein purifications and histone binding assays ............................ 41	
   2.2.6	
   Chromatin association and histone acetylation assays........................................ 42	
   2.2.7	
   Genome-wide ChIP-on-Chip .............................................................................. 44	
   2.2.8	
   Data analysis ....................................................................................................... 44	
   2.3	
   Results ........................................................................................................................ 45	
   2.3.1	
   YEATS domain function is conserved from yeast to human ............................. 45	
   2.3.2	
   The YEATS domain of Yaf9 adopts an immunoglobulin fold ........................... 48	
   2.3.3	
   Structural features of the YEATS domain .......................................................... 51	
   2.3.4	
   Yaf9 shares structural and biochemical properties with the Asf1 histone chaperone ........................................................................................................................ 52	
   2.3.5	
   Conserved residues on the YEATS domain surface are important for Yaf9 function ........................................................................................................................... 54	
    vi  2.3.6	
   Yaf9 YEATS domain functions in both SWR1-C and NuA4 ............................ 61	
   2.4	
   Discussion .................................................................................................................. 64	
   Chapter 3: Key Functional Regions in the Histone Variant H2A.Z C-Terminal Docking Domain ................................................................................................................................... 69	
   3.1	
   Introduction ................................................................................................................ 69	
   3.2	
   Materials and Methods ............................................................................................... 73	
   3.2.1	
   Yeast strains, plasmids, and yeast techniques ..................................................... 73	
   3.2.2	
   Analytical-scale affinity purifications................................................................. 76	
   3.2.3	
   Chromatin association assays ............................................................................. 77	
   3.2.4	
   Yeast cultures ...................................................................................................... 77	
   3.2.5	
   RT-PCR .............................................................................................................. 78	
   3.2.6	
   ChIP .................................................................................................................... 78	
   3.2.7	
   E-MAP ................................................................................................................ 79	
   3.3	
   Results ........................................................................................................................ 79	
   3.3.1	
   The C-terminus of H2A.Z is required for its function ........................................ 79	
   3.3.2	
   Genetic dissection of HTZ1 truncation alleles reveal distinct requirements for the C-terminus in H2A.Z function ........................................................................................ 82	
   3.3.3	
   The H2A.Z C-terminus is required for its role in heterochromatic boundary function ........................................................................................................................... 85	
   3.3.4	
   The H2A.Z C-terminus is required for its role in transcriptional activation of the GAL1 gene ...................................................................................................................... 87	
   3.3.5	
   Loss of H2A.Z truncations from chromatin is SWR1- and H2B-independent ... 88	
    vii  3.3.6	
   The C-terminus of histone H2A can replace its variant counterpart in H2A.Z function ........................................................................................................................... 92	
   3.3.7	
   Specific amino acids of the H2A.Z C-terminus are important for its chromatin association and function in vivo ...................................................................................... 94	
   3.4	
   Discussion .................................................................................................................. 97	
   Chapter 4: The M6 Region of the Histone Variant H2A.Z C-Terminal Docking Domain is Required but not Sufficient for H2A.Z Functions ....................................................... 102	
   4.1	
   Introduction .............................................................................................................. 102	
   4.2	
   Materials and Methods ............................................................................................. 105	
   4.2.1	
   Yeast strains, plasmids, and yeast techniques ................................................... 105	
   4.2.2	
   Analytical-scale affinity purifications............................................................... 108	
   4.2.3	
   Chromatin association assays ........................................................................... 108	
   4.2.4	
   ChIP .................................................................................................................. 109	
   4.2.5	
   Genome-wide ChIP-on-chip ............................................................................. 110	
   4.2.6	
   Data analysis ..................................................................................................... 110	
   4.3	
   Results ...................................................................................................................... 111	
   4.3.1	
   A specific region within the H2A.Z C-terminal docking domain confers unique H2A.Z functions ........................................................................................................... 111	
   4.3.2	
   The H2A.Z C-terminal docking domain is required but not sufficient for H2A.Z functions........................................................................................................................ 115	
   4.3.3	
   The M6 region of the H2A.Z C-terminal docking domain is required but not sufficient for H2A.Z functions...................................................................................... 118	
   4.4	
   Discussion ................................................................................................................ 123	
    viii  Chapter 5: Conclusion ....................................................................................................... 127	
   Bibliography ........................................................................................................................ 140	
    ix  List of Tables Table 2.1 Yeast strains used in this study .............................................................................. 35	
   Table 2.2 YAF9 mutants......................................................................................................... 38	
   Table 2.3 Data collection, phasing analysis, and refinement statistics .................................. 49	
   Table 2.4 yaf9 mutant phenotypes ......................................................................................... 59	
   Table 3.1 Yeast strains used in this study .............................................................................. 73	
   Table 3.2 Plasmids used in this study .................................................................................... 75	
   Table 3.3 ChIP-qPCR and RT-qPCR primers ....................................................................... 79	
   Table 4.1 Yeast strains used in this study ............................................................................ 106	
   Table 4.2 Plasmids used in this study ................................................................................... 107	
   Table 4.3 ChIP-qPCR primers used in this study ................................................................. 109	
    x  List of Figures  Figure 1.1 Crystal structure of the nucleosome core particle from Xenopus laevis ................ 4	
   Figure 1.2 Four fundamental chromatin modifications ........................................................... 8	
   Figure 1.3 H2A.Z is involved in a variety of cellular processes in higher eukaryotes .......... 15	
   Figure 1.4 SWR1-C, NuA4 and INO80 complexes share subunits ....................................... 22	
   Figure 1.5 Structural differences between H2A.Z and H2A ................................................. 29	
   Figure 2.2 Secondary structure and amino acid conservation of YEATS domain ................ 50	
   Figure 2.3 Yaf9 YEATS domain structure is similar to histone chaperone Asf1.................. 53	
   Figure 2.4 Yaf9 has similar functions as histone chaperone Asf1 ......................................... 55	
   Figure 2.5 Mutations in conserved surface residues in the Yaf9 YEATS domain affects protein function ....................................................................................................................... 56	
   Figure 2.6 Conserved residues on the YEATS domain surface are important for Yaf9 function ................................................................................................................................... 57	
   Figure 2.7 Growth comparison of Yaf9 mutants that have no phenotype ............................. 58	
   Figure 2.8 Protein levels and over-expression of Yaf9 mutants ............................................ 60	
   Figure 2.9 Yaf9 YEATS domain is required for H2A.Z chromatin deposition .................... 63	
   Figure 2.10 Yaf9 YEATS domain is required for H2A.Z chromatin acetylation.................. 64	
   Figure 2.11 Yaf9 YEATS domain mutants bind to histones H3 and H4 in vitro .................. 68	
   Figure 3.1 The C-terminus of H2A.Z is required for its function.......................................... 81	
    xi  Figure 3.2 Genetic dissection of H2A.Z truncation alleles reveal distinct requirements for the C-terminus in H2A.Z function ................................................................................................ 84	
   Figure 3.3 The H2A.Z C-terminus is required for its role in heterochromatic boundary function ................................................................................................................................... 86	
   Figure 3.4 The H2A.Z C-terminus is required for its role in activation of the GAL1 gene ... 88	
   Figure 3.5 H2A.Z truncations are lost from bulk chromatin ................................................. 89	
   Figure 3.6 Loss of H2A.Z truncations from chromatin is SWR1- and H2B- independent ... 91	
   Figure 3.7 The C-terminus of histone H2A substitutes its variant counterpart in H2A.Z function ................................................................................................................................... 93	
   Figure 3.8 Specific amino acids of the H2A.Z C-terminus are important for its chromatin association and function in vivo .............................................................................................. 96	
   Figure 3.9 Schematic diagram depicting models of wild-type H2A.Z, H2A.Z (1-120), H2A.Z (1-114) and H2A.Z (1-104) nucleosomes ............................................................................... 99	
   Figure 4.1 A specific region within the H2A.Z C-terminal docking domain confers unique H2A.Z functions ................................................................................................................... 113	
   Figure 4.2 H2A.Z and ZA 1-108 are more susceptible to loss from chromatin than H2A and ZA 1-104 ............................................................................................................................... 114	
   Figure 4.3 The H2A.Z C-terminal docking domain is required but not sufficient for its functions................................................................................................................................ 116	
   Figure 4.4 The H2A.Z C-terminal docking domain is required but not sufficient for SWR1-C interaction ............................................................................................................................. 118	
   Figure 4.5 The M6 region of the H2A.Z C-terminal docking domain is required but not sufficient for H2A.Z functions.............................................................................................. 120	
    xii  Figure 4.6 The M6 region of H2A.Z is required but not sufficient for genome-wide localization ............................................................................................................................ 122	
    xiii  Acknowledgements  I would like to first thank my supervisor Dr. Michael Kobor for giving me the opportunity to be in his lab. It has been a great journey, first as an undergraduate summer student when the lab first started out, then as a fourth year directed studies student, and finally as a graduate student. He has been the most enthusiastic and motivational mentor, and contributed significantly to my maturation from a junior undergraduate student to a senior doctoral student. It has been a pleasure to work in the lab, and having the unique perspective of seeing the lab grow from the very beginning to what it has become now, merely seven years after the fact. I would also like to thank my supervisory committee members: Dr. Philip Hieter, Dr. Ross MacGillivray, and Dr. Lawrence McIntosh for their time and guidance over the years. Thank you also to Dr. Hugh Brock and the Genetics Graduate Program for giving me the opportunity to be one of the last students of a flexible, straightforward, and overall enjoyable graduate program. I greatly appreciate and acknowledge the funding agencies Michael Smith Foundation for Health Research and Canadian Institutes of Health Research for granting me graduate fellowships to support my studies, as well as the many incredible international conferences that I had the privilege of attending during the past several years. Words cannot express my gratitude and appreciation for all the past and present members of the Kobor Lab, as I have had the opportunity to overlap with ALL of you over the years. You  xiv  have all made this experience so much more incredible for me and I appreciate each and every one of you. Thank you to Tanya Erb for her tremendous support for me over the years and making my PhD that much smoother! I would also like to give special thanks to Grace, Julia, Kasia, Lucia, Maria, Nancy, Phoebe, Sandra, Sarah, and Bibiana for enduring the trials and tribulations with me for such a significant fraction of my years in the Kobor Lab. I am sincerely grateful for all the lasting friendships that I have had the privilege of forming over the years – you are all wonderful and amazing people. I would also like to thank the community that is CMMT and all the people who have made the research environment stimulating, engaging, and fun. Finally, I would like to thank my family – my parents for everlasting support, encouragement, and always challenging me to be the best that I can be – and my brother Evan, for being a wonderful roommate and companion over the past three years. Last but not least, I would like to thank Tao, for his support, encouragement, patience, and being there when I need it most, even if it is on the other end of the telephone.  xv  Dedication  For My Parents  xvi  Chapter 1: Introduction  DNA encodes the heritable information containing genetic instructions used in the development and functioning of all known organisms. The DNA within a single human cell can reach two meters in length if stretched out from end to end. To be accommodated inside a cell nucleus that is only a few microns in diameter, the DNA must be highly condensed and packaged into complexes with help from structural proteins called histones and also nonhistone proteins. The nucleoprotein complex that forms is called chromatin (Kornberg, 1977). Research from the past two decades or so have clearly demonstrated that the chromatin structure is more than just a static packaging tool. In fact, it is highly dynamic, affecting and being affected by any cellular process that requires access to the underlying DNA template. These include the most fundamental processes that are used by all eukaryotic cells such as gene transcription, DNA replication, repair, and recombination (Kouzarides, 2007). The dynamic nature of the chromatin structure and its ability to be highly modified allows it to hold an additional layer of information on top of the genetic code arising from the naked DNA. This is called epigenetics and refers to the “heritable” changes in phenotype that do not involve changes in genotype. Over the past two decades a vast amount of research has expanded our knowledge of the link between modified chromatin states and genome regulation, and thus having potentially profound impacts on human health and disease.  1  1.1 Chromatin Structure and Architecture A key initial breakthrough in our understanding of chromatin structure and organization came in the 1970s with the discovery that DNA is wrapped around two copies each of the canonical histones H2A, H2B, H3 and H4 to form a regular repeating subunit that can be likened to a string of beads (Kornberg, 1974; Olins and Olins, 1974). We now know that this basic building block of chromatin is the nucleosome, and that it consists of ~147 base pairs of DNA wrapped 1.7 superhelical turns around a core histone octamer that is disk shaped (Luger et al., 1997).  Much progress has been made towards our understanding of the nucleosome structure, especially owing to the original three-dimensional crystal structures of the histone octamer and nucleosome from Gallus gallus (chicken) (Arents et al., 1991), Xenopus laevis (frog) (Luger et al., 1997), and Saccharomyces cerevisae (yeast) (White et al., 2001). There are many interactions within the nucleosome that contribute to the overall stability of the nucleoprotein complex and here I highlight a few of these important interactions (Luger et al., 1997). First, Histones H3 and H4 form a (H3-H4)2 tetramer to organize the central ~80 base pairs of DNA, while two H2A-H2B dimers bind to the more peripheral ~40 base pairs of DNA. Second, the (H3-H4) 2 tetramer itself is tightly held together by salt-bridges and hydrogen bonds to ensure the integrity of the nucleosome core. Third, the H2A-H2B dimer makes contacts with the (H3-H4) 2 tetramer via two interactions - one between the ‘docking domain’ (Figure 1.1) of the H2A C-terminus and the C-terminal β strand of H4 as well as parts of H3, and another between the H2B and H4 histone folds. Functionally, the H2A docking domain has been shown to bind to the linker histone H1 and is required for higher  2  order chromatin structure in mammalian cells (Vogler et al., 2010). The docking domain of H2A is an important focus of my dissertation, and will be explored extensively in Chapters 3 and 4. There is also a minor interaction between the H2A-H2B dimers via the L1 loop of H2A (Luger et al., 1997). Finally, the individual nucleosomes are joined by linker DNA, which in some species is bound by the linker histones H1 or H5 at the entry/exit point of the DNA strand on the nucleosome. This type of nucleosome array can appear as a “beads-on-astring” fiber that is 10nm in diameter and which represents the primary level of DNA packaging (Li and Reinberg, 2011). This beads-on-a-string structure is then further compacted into the 30nm fiber, which is enabled by inter-nucleosomal interactions and stabilized by linker histones. One important interaction that is essential to this secondary level of chromatin organization involves the histone H4 N-terminal tail of one nucleosome directly contacting the acidic patch of H2A and H2B from an adjacent nucleosome (Dorigo et al., 2003; Fan et al., 2004; Gordon et al., 2005; Luger et al., 1997). The formation of higher order chromatin structures beyond the 30nm fiber is dependent on inter-fiber nucleosomenucleosome interactions. These types of interactions are also dependent on the charge, modification states of histone tails and DNA, and the presence of histone variants, which all contribute either positively or negatively to inter-fiber associations (Li and Reinberg, 2011). Finally, long-range interactions between chromatin fibers can occur, in what is termed chromatin looping, to facilitate communication between cis-regulatory elements such as promoters and enhancers in transcription of certain genes in higher eukaryotes (Kadauke and Blobel, 2009). Ultimately, the chromatin fiber can be visualized as the widely recognizable and highly condensed metaphase chromosome that occurs during mitosis or meiosis.  3  Although these hierarchical levels of chromatin organization are well established, we are just beginning to understand these higher order structures and functions.  Docking Domain  Figure 1.1 Crystal structure of the nucleosome core particle from Xenopus laevis This representation was created from existing crystal structure coordinates from NCBI’s Protein Databank (1OAI) (Luger et al. 1997) structure using UCSF Chimera. The nucleosomal DNA strands are in gray, H2A molecules are in yellow, H2B molecules are in orange, H3 molecules are in blue and H4 molecules are in green. The ‘docking domain’ of H2A, an important focus of my dissertation, is circled and labeled.  1.2 Chromatin Assembly and Disassembly Eukaryotic cells have to accommodate the presence of nucleosomes when replicating DNA during S phase of the cell cycle. In this regard, nucleosomes then are required to be disassembled as DNA polymerase travels along the DNA template, and then reassembled after passage of DNA polymerase. Early studies found that histones are conserved rather than turned-over during mitosis (Hancock, 1969) and that newly replicated DNA takes on the nucleosome structure (Hancock, 1969; McKnight and Miller, 1977). However, since DNA  4  replicates in a semi-conservative fashion, the issue of placement of ‘old’ and ‘new’ histones on the mother and daughter DNA strands was controversial at the time. We now know that ‘old’ histones are randomly distributed on both the mother and daughter strands, while the ‘new’ histones are deposited to fill in the gaps on the DNA template, although the exact mechanisms of both these actions are not fully elucidated (Alabert and Groth, 2012). A class of proteins called histone chaperones facilitates the association of new histones with DNA. Nucleoplasmin was the first histone chaperone discovered, having the ability to bind to histones and transferring them to DNA (Laskey et al., 1978). Since then, many more histone chaperones have been identified, including Nap1 and Chz1 which are touched upon in this dissertation, and their structures and functions elucidated through in vitro and in vivo experiments.  The assembly mechanism of nucleosomes, which is mostly tightly coupled to DNA replication, is a contested issue but the general consensus is that it occurs in a step-wise manner using old histones as well as newly synthesized histones (Park and Luger, 2008). First, a (H3-H4)2 tetramer is deposited with help from two histone chaperones, CAF-1 (chromatin assembly factor 1) and Asf1 (anti-silencing factor 1). This is followed by the addition of two H2A-H2B dimers by another histone chaperone called Nap1 (nucleosome assembly protein 1). Nap1 in its role of promoting nucleosome assembly is also required to prevent non-nucleosomal interactions between histones and DNA (Andrews et al., 2010). Linker histones are incorporated at a later stage in chromatin assembly, also with the help of chaperones. Although there are no similarities in the overall fold of all histone chaperones,  5  there is a common four-stranded β structure that has been shown to interact with histones H3 and H4 in Asf1 (Park and Luger, 2008).  The disassembly of nucleosomes not only occurs during DNA replication, but also is an essential pre-requisite for processes such as transcription and DNA repair, as protein factors require access to DNA. It is not known whether the disassembly of nucleosomes occurs by the same mechanism as they are assembled. However, there is more evidence now that histone chaperones are also capable of enabling the reverse reaction of partial or complete nucleosome disassembly. This has been shown for Nap1 and Asf1 (Adkins et al., 2007; Levchenko et al., 2005; Park et al., 2005), and also another histone chaperone FACT (Reinberg and Sims, 2006). Although not much is known about the specific mechanisms of nucleosome disassembly by each histone chaperone, it is thought that these factors are able to disrupt the histone-DNA and histone-histone interactions by competing for binding to their respective histones via the chaperones’ acidic domains. For example, Asf1 uses a “strandcapture” model to release a single H3-H4 dimer from the rest of the nucleosome (English et al., 2006). Taken together, chaperones are now emerging as important factors involved in maintaining the balance of histone assembly and disassembly, and not simply histone binding partners as previously thought.  1.3 Nucleosome Positioning In the last few years several groups have mapped the positioning of nucleosomes across the genome of yeast at high resolutions both in vivo and in vitro (Brogaard et al., 2012; Jiang and Pugh, 2009; Lee et al., 2007; Mavrich et al., 2008; Shivaswamy et al., 2008; Whitehouse et  6  al., 2007). From these studies, it has become clear that nucleosomes are highly organized in Saccharomyces cerevisiae, with ~80% of nucleosomes highly positioned in vivo, occurring nearly at the same location in almost all cells of a population. In addition, nucleosomes are organized in a very specific pattern at most genes. The majority of yeast genes have a nucleosome free region just upstream of the transcription start site (called the 5’NFR). The NFR is sometimes called the nucleosome-depleted region (NDR) and it is still currently debated whether this region is completely free of nucleosomes or depleted. The NFR is flanked by two highly positioned nucleosomes termed the -1 and +1 nucleosomes (Jansen and Verstrepen, 2011). The transcription start site starts ~10bp into the +1 nucleosome. Further downstream from the +1, nucleosomes gradually become less precisely localized. There has been much debate on the idea of intrinsic DNA sequence determinants of nucleosome positioning, especially owing to the original two studies that found seemingly opposing results (Kaplan et al., 2009; Zhang et al., 2009). However, both studies agree that intrinsic DNA sequence does a good job at predicting nucleosome occupancy rather than precise positioning per se. For example, AT rich regions correlate with low nucleosome occupancy and occur in the NFRs, acting as nucleosome-excluding sequences (Jansen and Verstrepen, 2011). In terms of nucleosome positioning, it is possible that most of the DNA sequence determinants are difficult to detect in vivo as ATP-dependent chromatin remodelers can position nucleosomes and override the DNA intrinsic positioning (Zhang et al., 2011). The highly organized nature of chromatin suggests at a prominent role of nucleosome positioning in cellular processes such as transcription, replication, and DNA repair.  7  1.4 Chromatin Modifications In order to access the DNA for various functions, cells have evolved mechanisms to alter the chromatin structure at specific locations in the genome. For example, the chromatin can be more densely packed into regions called heterochromatin that is generally associated with little or no active transcription of resident genes, or more loosely packed with widely spaced nucleosomes into regions called euchromatin that is generally associated with active transcription of genes. However, the heterochromatin versus euchromatin distinction is a gross simplification of chromatin states and it has become more and more clear in recent years that much more complex and dynamic chromatin states exist (Kouzarides, 2007; Misteli, 2007). This overall chromatin landscape is created by the concerted action of four fundamental mechanisms of modifying chromatin structure, which are reversible (Figure 1.2) (Goldberg et al., 2007).  ATP-dependent chromatin remodeling  Histone variants  Posttranslational Modifications  DNA methylation  eg. H2A.Z eg. by SWI/SNF or RSC  eg. Acetylation by NuA4  ATP  Me ADP + Pi  Ac  Me  H2A.Z  Figure 1.2 Four fundamental chromatin modifications Schematic representation of the four fundamental chromatin modifications including examples.  8  Me  1.4.1  Post-translational addition of chemical groups  One fundamental mechanism of chromatin modification is the post-translational addition of chemical groups on histones. Histones can be acetylated, methylated, phosphorylated, sumoylated, ubiquitinated, and ADP-ribosylated on numerous amino acid residues on the protruding tails and globular cores (Kouzarides, 2007; Peterson and Laniel, 2004). The addition of these chemical groups requires specific enzymes. For example, complexes called histone acetyltransferases (HATs) acetylate the lysine residues of histones, while histone methyltransferases catalyze the addition of methyl groups to lysine residues. While only one acetyl group can be added to a lysine residue, lysine methylation can exist in the mono-, di-, and tri- states, adding to the complexity of histone marks (Kouzarides, 2007).  The enzymatic activity, such as the acetyltransferase activity of HATs, often resides in one subunit of a multi-subunit complex and is responsible for “writing” the histone mark. The other subunits in these complexes usually play auxiliary roles in the recruitment of their resident complex to chromatin and/or in facilitating the enzymatic reaction. These auxiliary functions often reside in signature protein domains that are able to recognize and bind to specific histone marks (Ruthenburg et al., 2007; Taverna et al., 2007). For example, among the well-characterized domains, the bromodomain binds to acetylated histones whereas the chromodomain and the plant homeodomain (PHD finger) bind to methylated histones. The only essential HAT in yeast is the nucleosome acetyltransferase NuA4 complex that acetylates histones H2A and H4 (Doyon and Cote, 2004), as well as the histone variant H2A.Z, which is the focus of my dissertation. NuA4 contains several of these signature domains - its catalytic subunit Esa1 has a chromodomain and the Yng2 subunit contains a  9  PHD finger (Doyon and Cote, 2004). Its Yaf9 subunit contains a lesser-known signature domain called the YEATS domain that is the subject of Chapter 2 of this dissertation and as I will speculate, may have a potential function in recognizing histone marks. These signature domains, therefore, “read” histone marks and facilitate the downstream events of the complexes they reside in (Ruthenburg et al., 2007; Yun et al., 2011). It is important to note that these post-translational modifications are reversible and that another type of protein ultimately removes or “erases” the histone mark. For example, histone deacetyltransferases (HDACs) catalyzes the reverse reaction and removes acetyl groups from lysine residues. Taken together, these “writers”, “readers”, and “erasers” often work together in a combinatorial fashion, capable of generating a tremendous amount of crosstalk between histone marks within a nucleosome and also between nucleosomes (Bannister and Kouzarides, 2011; Ruthenburg et al., 2007).  The past decade has witnessed an extensive amount of research on histone modifications, including many localization studies that have provided high-resolution genome-wide maps of a majority of all histone modifications. We now know that histone marks are usually found in specific locations in the genome. For example, methylation of H3 on its lysine 4 generally occurs at the 5’ end of genes while the methylation of H3 on lysine 36 occurs within the body of genes (Suganuma and Workman, 2011). There are also specific histone modifications that are important for certain cellular processes. For example, acetylation of H3 lysine 56 occurs on newly synthesized histones which are subsequently assembled into nucleosomes during replication, and also has a crucial role in DNA repair (Downs, 2008). However, many questions regarding histone modifications are still largely unanswered. Ever since the initial  10  link of histone acetylation to gene activation (Brownell et al., 1996), the question of whether histone modifications have any effect on gene expression or if they are in fact a result of changes in the transcriptional state is still highly debated. The issue of causality is also a concern for the “histone code” hypothesis in which modifications act in a combinatorial fashion to trigger downstream effects (Strahl and Allis, 2000). The histone code hypothesis has been highly debated ever since its initial coinage. As more and more genome-wide data have emerged in recent years, it is clear that if there is indeed a histone modification “language” that speaks to its resident chromatin landscape and associated functions, it is very much context- and timing-dependent with immense crosstalk and redundancy between modifications that makes its elucidation profoundly difficult (Bannister and Kouzarides, 2011).  1.4.2  ATP-dependent chromatin remodeling complexes  Chromatin can also be altered by ATP-dependent chromatin remodeling complexes, which include enzymes that are able to move, eject, or restructure nucleosomes and possibly alter high-order chromatin structures. These complexes, in effect, are capable of defining specific nucleosome spacing and greater chromatin landscapes for cellular functions. For example, chromatin remodelers move or eject nucleosomes during processes like transcription and DNA repair allowing associated factors access to DNA (Tsukiyama, 2002). To do this, these enzymes use the energy from ATP hydrolysis to disrupt histone-DNA contacts and act like DNA translocases to pump DNA around the histone octamer, forming intranucleosomal DNA loop intermediates in the process (Liu et al., 2011; Zhang et al., 2006). There are at least four classes of ATP-dependent chromatin remodeling complexes that are classified  11  based on the conserved sequence motifs that exist outside of the ATPase domain found in all remodelers (Clapier and Cairns, 2009; Tsukiyama, 2002). These include the SWI/SNF (switching defective/sucrose nonfermenting), ISWI (imitation switch), CHD (chromodomain, helicase, DNA-binding), and the INO80 (inositol requiring 80) families of remodelers. Two remodelers of the SWI/SNF family include the SWI/SNF and RSC complexes, both of which play roles in the remodeling of nucleosomes during transcription. One example of an INO80 family remodeller is the SWR1 (Swi2/Snf2-related) complex (SWR1-C) that shares a highly similar ATPase domain and also a few of the same subunits as the INO80 complex, although SWR1-C has a dominant function in the exchange of a canonical histone with a histone variant, as discussed in more depth below.  1.4.3  Histone variants  Another mechanism of chromatin alteration involves changing the composition of the nucleosome itself. Eukaryotic cells have evolved to harbor non-allelic histone variants to create distinct chromatin regions that have specialized functions (Talbert and Henikoff, 2010). These histone variants are in low abundance and are deposited to replace the core histones in a replication-independent and non-random fashion along the genome. There are known variants of histones H2A, H2B and H3. The histone variants that occur almost universally in eukaryotes are also the most extensively studied variants, including H2A.Z, H2A.X, H3.3, and CENP-A. H3.3 and CENP-A are variants of histone H3. H3.3 is associated with active transcription, while CENP-A is an essential component of centromeres. H2A.X is a variant of histone H2A that has an extra four amino acid sequence (SQEL) on its C-terminus, with the serine residue being phosphorylated during the DNA  12  damage response. Two other H2A variants, macroH2A and H2A.Bbd, are only found in mammals as macroH2A is mainly enriched in the inactive X chromosomes in females whereas H2A.Z.Bbd (Barr body deficient) is associated with active transcription and mRNA processing (Tolstorukov et al., 2012). Another variant of H2A is H2A.Z, which is deposited by the ATP-dependent chromatin remodeler SWR1-C and is the central topic of my dissertation.  1.4.4  DNA methylation  Another well-defined and extensively studied chromatin modification is the methylation of DNA. Methylation occurs on the cytosine base at CpG dinucleotides, which is generally associated with heterochromatin and gene repression (Siegfried and Cedar, 1997). DNA methylation is one of the better-characterized examples of chromatin modifications that can be heritable, as a specific DNA methyltransferase (DNMT1) is dedicated to the maintenance of the methylation pattern after every DNA replication cycle (Cedar and Bergman, 2009). Interestingly, DNA methylation inversely correlates with the presence of histone variant H2A.Z in the plant Arabidopsis thaliana (Zilberman et al., 2008) as well as a mouse B-cell lymphoma model (Conerly et al., 2010), although the exact relationship between the two chromatin marks remains to be determined.  1.5 Histone Variant H2A.Z West and Bonner first discovered H2A.Z via separation of H2A species on sodium dodecyl sulfate and acetic acid-urea gels (West and Bonner, 1980). H2A.Z diverged once very early in evolution, unlike histones H2A and H2A.X, which split multiple times in different  13  lineages (Malik and Henikoff, 2003). Hence, H2A.Z is highly conserved through evolution, having 90% identity among higher eukaryotes, and is even more conserved than its canonical cousin H2A, suggesting it plays a unique and significant role in many cellular functions. Indeed, the histone variant is essential for viability in higher eukaryotes like Drosophila melanogaster (Clarkson et al., 1999; van Daal and Elgin, 1992), Xenopus leavis (Iouzalen et al., 1996; Ridgway et al., 2004), and Mus musculus (mouse) (Faast et al., 2001) and is required for a broad array of genome function including regulation of gene expression, maintenance of boundaries between heterochromatin and euchromatin, chromosome segregation, DNA repair, and progression through the cell cycle (Marques et al., 2010). Illustrating its broad significance in health and disease, alterations in the function or cellular amounts of H2A.Z are associated with misregulation of fundamental biological processes in mammals including development, cell differentiation, proliferation, and maintenance of genomic integrity (Creyghton et al., 2008; Gevry et al., 2007; Hua et al., 2008; Rangasamy et al., 2004; Ridgway et al., 2004) (see Figure 1.3). Recent evidence has also highlighted a potential role of H2A.Z in oncogenesis as high expression of H2A.Z is found in breast cancer patients and is associated with metastasis and poor patient survival (Hua et al., 2008).  14  Cancer  Chromosome segregation  ES cell differentiation  Hua et al., 2008  Rangasamy et al., 2004 H2A.Z  Embryonic development Creyghton et al., 2008  Cell cycle and cellular senescence  Gevry et al., 2007  Ridgeway et al., 2004  Figure 1.3 H2A.Z is involved in a variety of cellular processes in higher eukaryotes  1.5.1  H2A.Z and transcription  The first clue that H2A.Z has a link to transcription came from the discovery that it resided exclusively in the transcriptionally active macronucleus of the protozoan Tetrahymena thermophile (Allis et al., 1980). In S. cerevisiae a nonessential gene named HTZ1 encodes for H2A.Z, allowing for easy genetic and functional interrogation. H2A.Z has unique functions in yeast, as it cannot be replaced by the canonical H2A and vice versa (Jackson and Gorovsky, 2000). Corroborating with a role in transcription, early yeast studies found that cells lacking H2A.Z have defective activation of the inducible genes GAL1, PHO5, and 15  PUR5 (Adam et al., 2001; Larochelle and Gaudreau, 2003; Santisteban et al., 2000). At the GAL1/10 promoter region, H2A.Z is also required for recruitment of RNA polymerase II (RNAPII), the Mediator, the ATP-dependent chromatin remodeling complex SWI/SNF and the chromatin-modifying complex SAGA (Adam et al., 2001; Larochelle and Gaudreau, 2003; Lemieux et al., 2008). Furthermore, H2A.Z’s role in transcription extended to a function in maintenance of heterochromatin, as the histone variant was found to act as a boundary factor between heterochromatin and euchromatin (Meneghini et al., 2003). Unlike its canonical cousin H2A that is deposited randomly across the genome, H2A.Z is deposited in specific regions by the ATP-dependent chromatin remodeling complex SWR1C, the first complex discovered to have a dedicated function in histone variant deposition (Kobor et al., 2004; Krogan et al., 2003; Mizuguchi et al., 2004). Many studies in the past few years have used chromatin immunoprecipitation followed by either microarray (ChIPon-chip) or high-throughput sequencing (ChIP-seq) analysis to interrogate the specific locations of H2A.Z genome-wide. From these studies, H2A.Z was found to be located in nucleosomes near centromeres, at the borders of heterchromatic domains, as well as the majority of promoters and 5’end of genes in yeast (Albert et al., 2007; Guillemette et al., 2005; Li et al., 2005; Raisner et al., 2005; Zhang et al., 2005), consistent with its role in transcription. In particular, at promoter regions H2A.Z is present in two nucleosomes flanking the nucleosome free region (NFR) at the TSSs. Similarly, in human cells, H2A.Z is also located in the two nucleosomes flanking the NFRs at TSSs (Barski et al., 2007), while in Drosophila it is only located in the downstream nucleosome (Mavrich et al., 2008). Interestingly, a 22bp DNA segment from the SNT1 promoter, which contains a binding site for the Reb1 general regulatory protein and a polyAT tract, is sufficient to induce the  16  formation of a NFR flanked by two H2A.Z nucleosomes (Raisner et al., 2005), suggesting there is at least some sequence-dependency of H2A.Z nucleosome formation. Most of these studies found that H2A.Z has a strong preference for promoters of inactive genes rather than active genes (Guillemette et al., 2005; Li et al., 2005; Zhang et al., 2005), although one study found H2A.Z occupancy at promoters of both active and inactive genes (Raisner et al., 2005).  H2A.Z occupancy at promoters suggests that it plays an important role in gene expression. Yet genome-wide microarray analyses found that H2A.Z affects the gene expression of only 5% of genes in S. cerevisiae (Meneghini et al., 2003). How can these results be reconciled in terms of the role of H2A.Z in transcription? One possibility is that the gene expression analysis was conducted under nutrient rich, steady state conditions, and that the role of H2A.Z in gene expression takes place under induction of genes rather than steady-state transcription. As mentioned previously, cells lacking H2A.Z have defective activation of the inducible genes GAL1, PHO5, and PUR5. Under glucose repressing conditions, H2A.Z occupies the GAL1/10 promoter, but upon induction with galactose, the H2A.Z nucleosomes are evicted from the promoter (Workman, 2006; Zlatanova and Thakar, 2008). In addition, H2A.Z has been implicated in nucleosome positioning at the GAL1/10 promoter, which may also play an important role in its activation (Guillemette et al., 2005). Similar to its eviction at inducible genes, the eviction of H2A.Z nucleosomes is also correlated with genes that are actively turned on in response to heat shock (Zanton and Pugh, 2006). Given that promoter nucleosomes are highly dynamic and have high turn over rates (Dion et al., 2007), the presence of H2A.Z at promoter nucleosomes and its eviction upon transcriptional activation  17  suggest that a difference in stability between variant and canonical nucleosomes may have an important role in the regulation of gene promoters.  Taking together the data from genome-wide and individual gene studies, a fraction of H2A.Z is believed to reside at the promoters of silent inducible genes to poise an open chromatin structure surrounding the TSS for transcriptional activation (Marques et al., 2010; Zlatanova and Thakar, 2008). In addition, post-translational modifications of H2A.Z may play a role as the acetylated version of the histone variant is enriched at active promoters (Millar et al., 2006). Indeed, the induction of the GAL1 gene is dramatically slower in an unacetylable mutant of H2A.Z (Halley et al., 2010), suggesting that acetylation may play a significant role in H2A.Z’s function in transcription. Finally, H2A.Z may also play a role in acting as an element of epigenetic memory of recent transcriptional activity (Brickner et al., 2007). It was proposed that H2A.Z is recruited to recently repressed INO1 and GAL1 genes to promote their retention at the nuclear periphery and thereby enabling these genes to be rapidly reactivated. The same group later found that H2A.Z incorporation at the nuclear periphery requires cis-acting DNA zip codes called the Memory Recruitment Sequence, which controls the targeting of the recently repressed INO1 gene to the periphery (Light et al., 2010). However, the transcriptional memory function of H2A.Z is controversial, as other groups found no requirement of H2A.Z for transcriptional memory of the GAL1 gene (Halley et al., 2010; Kundu and Peterson, 2010). Taken together, the roles of H2A.Z in transcription are diverse; however, even with extensive studies over the past decade, the exact mechanism of H2A.Z function in transcription remains elusive.  18  1.5.2  Role of H2A.Z in DNA replication and repair  In addition to transcription, H2A.Z has also been shown to function in DNA replication and repair. Dhillon et al. found that cells lacking H2A.Z had defects in progression through S phase and were delayed in replication initiation (Dhillon et al., 2006). In terms of DNA repair, multiple lines of evidence have implicated H2A.Z, its deposition machinery SWR1-C, and INO80, another chromatin-remodeling complex that shares subunits with SWR1-C. H2A.Z is specifically and rapidly recruited to DNA double-strand breaks (DSBs), presumably by the SWR1-C, while the INO80 complex performs the reverse reaction of taking out H2A.Z and replacing with H2A at DSBs (Kalocsay et al., 2009; PapamichosChronakis et al., 2006; Papamichos-Chronakis et al., 2011; van Attikum et al., 2007). Furthermore, SWR1-C and the acetyltransferase NuA4 in Drosophila appear to work together to promote exchange of phosphorylated H2A.X with H2A.Z at DSBs (Kusch et al., 2004). Interestingly, H2A.Z is sumoylated on its C-terminus in response to DNA damage and its sumoylated form is required for the relocation of persistent unrepaired DSBs to the nuclear periphery (Kalocsay et al., 2009). Although these findings have cemented a role of H2A.Z in the replication and repair pathways, the exact mechanism in which H2A.Z exerts its effect in the DNA replication and repair pathways remains to be fully elucidated.  1.5.3  H2A.Z post-translational modifications  Similar to canonical histones, H2A.Z can be modified by post-translational addition of chemical groups to lysine residues, including the previously mentioned acetylation and sumoylation in yeast, as well as ubiquination in mammalian cells (Babiarz et al., 2006; Kalocsay et al., 2009; Keogh et al., 2006; Millar et al., 2006). These can be linked to specific  19  functions. H2A.Z is acetylated on its N-terminus at lysines 3, 8, 10, and 14 by the HATs NuA4 and SAGA. Acetylation of H2A.Z is required for gene activation (Halley et al., 2010; Millar et al., 2006), heterochromatin boundary formation (Babiarz et al., 2006) and proper chromosome segregation (Keogh et al., 2006; Kim and Buratowski, 2009). Sumoylation and ubiquination both occurs on the C-terminus of H2A.Z, with sumoylation being associated with DNA repair in yeast (Kalocsay et al., 2009) and monoubiquitinated H2A.Z occuring on the female inactive X chromosome in mammalian cells (Sarcinella et al., 2007).  1.5.4  H2A.Z deposition factors  The discovery of SWR1-C as a deposition complex for H2A.Z first linked the fundamental process of ATP-dependent chromatin remodeling to the biology of histone variants, thereby changing the understanding of the role of histone variants in actively shaping distinct chromosomal neighborhoods (Kobor et al., 2004; Krogan et al., 2003; Mizuguchi et al., 2004). SWR1-C preferentially binds to and deposits H2A.Z versus canonical H2A, thereby creating H2A.Z nucleosomes that are located at specific regions as previously discussed. SWR1-C is named after its catalytic subunit Swr1 (Swi2/Snf2-related), a member of the Swi2/Snf2 family of chromatin remodeling enzymes that uses energy from ATP to exchange H2A-H2B dimers with H2A.Z-H2B dimers (Mizuguchi et al., 2004). In the absence of Swr1, there is little to no H2A.Z remaining in chromatin, suggesting that there is no Swr1 substitute that can replace its function in vivo (Kobor et al., 2004; Krogan et al., 2003; Li et al., 2005; Mizuguchi et al., 2004). However, recent evidence reveals that the relationship between SWR1-C and H2A.Z is not as simple and linear as previously believed. In the absence of  20  H2A.Z, SWR1-C is deleterious to yeast cells as the phenotypes of cells lacking H2A.Z are due to SWR1-C’s activity rather than the absence of H2A.Z per se (Halley et al., 2010).  SWR1-C is a large complex composed of about 13 subunits, and similar to its substrate, is largely conserved across eukaryotic species (Kobor et al., 2004). The human counterparts of the catalytic subunit Swr1 also exchange H2A-H2B dimers with H2A.Z-H2B dimers in vitro, and include the SRCAP subunit of the SWR1-C equivalent SRCAP complex and also p400, a subunit of the NuA4 equivalent TIP60 complex (Gevry et al., 2007; Martinato et al., 2008). Interestingly, the SRCAP and TIP60 complexes in human and Drosophila can be co-purified as one large complex, highlighting the importance of the close relationship between SWR1-C and NuA4 complexes in yeast, which share 4 subunits together forming the ‘shared module’ (Lu et al., 2009). SWR1-C and NuA4 also shares subunits with the INO80 ATP-dependent chromatin-remodeling complex (Figure 1.4) (Kobor et al., 2004), underscoring potential cross talk and concerted actions between the three complexes.  The Swr1 subunit also acts as a scaffold for the assembly of numerous SWR1-C components, although a number of other interactions between subunits help to stabilize complex integrity. Binding sites for H2A.Z are located in the Swr1 and Swc2 subunits (Wu et al., 2008; Wu et al., 2005), whereas several other subunits facilitate SWR1-C binding to nucleosomes in vitro and in vivo (Wang et al., 2009; Wu et al., 2005). Besides the Swr1 subunit, the exact nature of how the other subunits of the complex contribute to H2A.Z deposition and function remains to be deciphered comprehensively. There is evidence that the Bdf1 subunit, which is also a subunit of the general transcription factor TFIID and contains two tandem  21  bromodomains (Ladurner et al., 2003; Matangkasombut and Buratowski, 2003), specifically binds to the acetylated tails of H3 and H4, thereby recruiting SWR1-C to deposit H2A.Z in euchromatic regions (Raisner et al., 2005; Zhang et al., 2005). It is proposed that following H2A.Z deposition by SWR1-C, the acetyltransferase NuA4 is recruited via the ‘shared module’ and acetylates the histone variant on its N-terminus (Lu et al., 2009; Wu et al., 2008). The ‘shared module’ consists of the four subunits that SWR1-C shares with the NuA4: Yaf9, Swc4, Arp4 and Act1 (Kobor et al., 2004).  SWR1-C Histone variant exchange  Swr1 Swc2 Bdf1 Swc3 Swc5 Swc6 Swc7 Arp6 Rvb1 Rvb2  NuA4 Histone Acetyltransferase  Swc4 Yaf9  Tra1 Eaf1 Epl1 Esa1 Eaf3 Eaf5 Yng2  Arp4 Act1  INO80 INO80 complex ATP-dependent chromatin remodeling Figure 1.4 SWR1-C, NuA4 and INO80 complexes share subunits Venn diagram of SWR1-C and NuA4 subunits, depicting subunits that overlap between the two complexes and those that also overlap with INO80. The subunit Yaf9 is the focus of Chapter 2 and is highlighted in red.  22  The shared subunit Yaf9 is the focus of Chapter 2 of this dissertation. Yaf9 is the only nonessential shared subunit in yeast and it is important for cellular response to spindle stress, proper DNA repair and metabolism, H2A.Z chromatin deposition and acetylation, and histone H4 acetylation at telomere-proximal genes (Keogh et al., 2006; Le Masson et al., 2003; Wu et al., 2005; Zhang et al., 2004). Yaf9 is one of three yeast proteins containing an evolutionarily conserved YEATS domain, with the most prominent YEATS-proteins in humans (GAS41, ENL, and AF9) all being linked to human cancers (Schulze et al., 2009b). The closest human homologue to Yaf9 is GAS41 (glioma amplified sequence 41), which is also a shared subunit of SRCAP and TIP60. In Chapter 2, I use Yaf9 and GAS41 to establish the functional conservation of the YEATS domain from yeast to human. I also use structurefunction analysis of the most evolutionarily conserved amino acids in the three distinct regions of Yaf9’s YEATS domain to reveal that this domain is required for efficient H2A.Z deposition at specific promoters, global H2A.Z acetylation, and resistance to genotoxic stressors. I discuss in Chapter 5 the possibility of the YEATS domain acting as a ‘reader’ domain in its ability to recognize and bind to histones.  Aside from SWR1-C, another factor, the histone chaperone Chz1, also has preferential affinity to H2A.Z over H2A (Luk et al., 2007). Chz1 by itself is unfolded, but together with H2A.Z-H2B forms a stable heterotrimer through its conserved CHZ motif (Zhou et al., 2008). The N-terminal alpha helix of Chz1 occupies the DNA binding sites of H2A.Z-H2B in the nucleosome, which prevents the dimer from interacting with DNA and suggests that the histone chaperone may have a histone eviction role (Zhou et al., 2008). H2A.Z also binds to Nap1, another histone chaperone discussed previously, which is well-characterized and  23  ubiquitous in eukaryotes and has the ability to assemble both H2A.Z-H2B and H2A-H2B dimers into the nucleosome. Like Swr1, Nap1 also has the ability to exchange H2A-H2B dimers with H2A.Z-H2B dimers in vitro (Park et al., 2005). Although Chz1 and Nap1 are able to bind to H2A.Z, unlike Swr1, they are not essential to the chromatin incorporation of the histone variant. In fact, the two histone chaperones have redundancy with each other and other factors, and when both are lacking from cells, other factors are able to substitute for them in H2A.Z association (Luk et al., 2007). These other factors include FACT, the histone chaperone that mediates H2A-H2B eviction and reassembly during RNAPII transcription elongation (Luk et al., 2007; Orphanides et al., 1999; Schwabish and Struhl, 2004), the major H2A-H2B nuclear importin/karyopherin Kap114 (Mosammaparast et al., 2001), subunits Isw1 and Ioc3 of the ISW1a complex (Vary et al., 2003) and the peptidyl prolyl cis-trans isomerases Fpr3 and Fpr4 (Kuzuhara and Horikoshi, 2004). However, besides Kap114, the biological functions of these interactions remain to be established. Kap114 is the major nuclear importin for H2A-H2B and H2A.Z-H2B dimers (Mosammaparast et al., 2002; Mosammaparast et al., 2001; Straube et al., 2010). Kap114 also interacts with Nap1, an interaction that increases its affinity to H2A-H2B dimers (Mosammaparast et al., 2002), suggesting that Nap1 has a cofactor role in the nuclear import of H2A-H2B family of dimers. Although Nap1 and Chz1 appear to be redundant in the nucleus, Chz1 does not bind to H2A.Z in the cytosol like Nap1 does and is not involved in the import of histones, but rather has a completely distinct import pathway (Straube et al., 2010).  In addition to SWR1-C, another ATP-dependent chromatin remodeler, INO80, has recently been shown to be required for proper H2A.Z positioning genome-wide (Papamichos-  24  Chronakis et al., 2011). However, unlike SWR1-C’s role in H2A.Z deposition, INO80 catalyzes the reverse reaction of exchanging H2A.Z-H2B with H2A-H2B dimers within the coding regions and eviction of H2A.Z during transcriptional activation. Interestingly, this INO80-mediated regulation is essential to genome integrity of yeast cells. The authors propose that SWR1-C deposits H2A.Z over a broad domain genome-wide and that INO80dependent H2A.Z eviction and H2A deposition thereby localize H2A.Z incorporation to specific domains.  Taken together, there are several factors including histone chaperones and one chromatinremodeling complex that are capable of binding to and aiding in the chromatin deposition of H2A.Z. Of these, SWR1-C is the only known factor that is essential to H2A.Z being deposited into chromatin, suggesting it contributes to the specialized locations and functions of the histone variant that distinguishes it from canonical H2A.  1.5.5  H2A.Z and H2A differences  The tight biochemical interaction with SWR1-C is one distinguishing feature of H2A.Z compared to H2A, as is the resulting preferential location of H2A.Z to promoter nucleosomes and to heterochromatin boundaries. H2A.Z is unable to replace the essential function of canonical H2A (Jackson and Gorovsky, 2000). Likewise, the slow growth phenotype and drug sensitivity of yeast cells lacking H2A.Z cannot be rescued by overexpression of canonical H2A, suggesting that the variant has specialized and non-redundant functions in the cell (Jackson and Gorovsky, 2000). But what makes the two histones so different that they have such distinguishing locations and functions? Although H2A.Z is only 60%  25  identical to H2A in its amino acid sequence, its three-dimensional structure within the nucleosome is overall very similar to the H2A nucleosome (Suto et al., 2000). The interaction between the H2A.Z and H2B histone folds are almost identical, as are the contacts between the H2A.Z-H2B dimer with DNA. However, there are subtle differences in specific regions between the structures of the two nucleosomes, likely resulting in their different functionalities (Suto et al., 2000). Specifically, there are three major structural changes: an extended acidic patch in the H2A.Z nucleosome, a different C-terminal ‘docking domain’ that perhaps results in distinct interaction surfaces, and changes in the L1 loop that are responsible for interactions between the two H2A.Z-H2B dimers (Suto et al., 2000) (also see Figure 1.5A). The first difference lies in the acidic patch, which is composed of several amino acids of H2A-H2B on the nucleosome surface that aids in the interaction with DNA and the N-terminal tail of H4 on a neighboring nucleosome. H2A.Z has a few amino acid changes that result in H2A.Z-H2B dimers exhibiting an extended acidic patch that may be important for altered contacts with the N-terminus of H4 from a neighboring nucleosome or non-histone proteins. A recent study found that mutations in two residues of the acidic patch in H2A.Z (D99A/K and E101K) led to defective H2A.Z functions and enrichment at the PHO5 promoter (Jensen et al., 2011). The C-terminal docking domain of H2A.Z includes the most C-terminal alpha helices α3 and αC as well as the unstructured tail (Figure 1.5), and provides an interaction surface for the (H3-H4)2 tetramer and potentially other non-histone factors (Suto et al., 2000). One region of the docking domain that has been shown to be a major determinant of H2A.Z’s identity is the M6 region, named after a mutant first created in Drosophila that resulted in embryonic lethality (Clarkson et al., 1999; Wu et al., 2005). M6 is a short stretch of 11 amino acids in the docking domain that encompasses the aC-helix, part  26  of the extended acidic patch, and is only 45% identical to H2A (Figure 1.5). Further differences in the docking domain lie more distal to the M6 region. Glu104 in H2A corresponds to Gly106 in H2A.Z, a difference that results in the loss of three hydrogen bonds, potentially destabilizing the H2A.Z docking domain interaction with H3 within the nucleosome (Suto et al., 2000). Furthermore, the H2A.Z-containing nucleosome surface contains a metal binding site more distal to the C-terminal alpha helix that is stabilized by two histidine residues, H112 and H114, thus providing another altered interaction surface. This metal binding capability of the H2A.Z nucleosome has not been demonstrated in vivo, although mutation in the histidines results in defective embryonic development in flies (Ridgway et al., 2004). Another significant structural difference is in the interaction between the two H2A.Z-H2B dimers. This change occurs in the L1 loop (Figure 1.5), where the two H2A.Z subunits interact (Suto et al., 2000), leading the authors to speculate that H2A.Z and H2A cannot exist within the same nucleosome due to a steric clash. However, subsequent studies have determined the occurrence of both homotypic (H2A.Z/H2A.Z) and heterotypic (H2A.Z/H2A) nucleosomes in vitro and in vivo (Chakravarthy et al., 2005; Ishibashi et al., 2009; Luk et al., 2010; Weber et al., 2010). In addition, nucleosomes containing canonical H2A have been shown to stimulate the step-wise histone dimer replacement activity by SWR1-C (Luk et al., 2010).  The structural differences between the H2A- and H2A.Z-containing nucleosomes also likely contribute to the differential stabilities of the two histones in chromatin, an issue that is highly contested over the years and remain controversial. In agreement with a more destabilized H2A.Z nucleosome as proposed by the crystal structure, chicken nucleosome 27  core particles (NCPs) reconstituted with human H2A.Z exhibited reduced stability in analytical ultracentrifuge studies (Abbott et al., 2001), and yeast chromatin containing H2A.Z had reduced salt stability as compared to H2A chromatin (Zhang et al., 2005). However, Fluoresence Resonance Energy Transfer (FRET) experiments demonstrated that mouse H2A.Z actually stabilizes the NCP (Park et al., 2004), corroborating with an early report that showed chicken H2A.Z eluted from chromatin at higher salt concentrations than canonical H2A (Li et al., 1993). The Ausio group has since repeated their ultracentrifugation experiments using native chicken H2A.Z (Thambirajah et al., 2006) instead of recombinant protein and determined a subtle stabilization of the H2A.Z nucleosome that is dependent on histone acetylation. Interestingly, nucleosomes containing both H2A.Z and the H3.3 variant are intrinsically unstable or “labile” and have been mapped to human promoters and regulatory elements (Jin et al., 2009). This reconciles with the reduced stability of yeast H2A.Z nucleosomes as all the H3 in Saccharyomyces cerevisiae are of the H3.3 version. In terms of the effect of H2A.Z on higher order chromatin-fiber structure, sedimentation velocity experiments have found that mouse H2A.Z facilitates the folding of nucleosomal arrays, while inhibiting the formation of highly condensed structures (Fan et al., 2002). In addition, mouse and Xenopus H2A.Z promotes chromatin-fiber folding by the heterochromatin protein HP1α, a function mediated by the extended acidic patch on the H2A.Z nucleosome (Fan et al., 2004). In summary, while it might appear that the biochemical stability properties of H2A.Z are highly controversial, it should be noted that differences in H2A.Z stability might exist between the techniques employed as well as eukaryotic species.  28  Figure 1.5 Structural differences between H2A.Z and H2A (A) Representation of a portion of the crystal structure of the H2A.Z-containing nucleosome core particle. Only the DNA strands in gray and two H2A.Z molecules in blue are shown for clarity. The locations of the sequences of considerable divergence are circled and labeled in red. This representation was created from existing crystal structure coordinates from NCBI’s PDB (1F66) (Suto et al. 2000) structure with the help of UCSF Chimera. (B) The amino acid sequences of H2A.Z and H2A from Saccharomyces cerevisiae are aligned (identical amino acids are starred below). The secondary alpha helices are depicted in gray boxes above the sequences. The locations and sequences of considerable divergence are highlighted and labeled in blue. The M6 region is boxed in purple, and the acidic patch residues of H2A.Z are denoted by orange dots above the sequence.  29  Although H2A.Z has been implicated in many cellular processes all the way from yeast to higher eukaryotes, the exact molecular mechanisms it uses to exert these functions remain to be fully characterized. It is interesting to note that although H2A.Z is required for many functions in yeast, a comprehensive mutagenesis approach revealed few single amino acid substitutions that affect its function (Kawano et al., 2011). Within the C-terminal docking domain, I109A appears to be the only amino acid substitution that affects H2A.Z-specific functions (Kawano et al., 2011). It is possible that point mutations only partially disrupt protein functions and due to the relatively mild nature of H2A.Z-specific phenotypes, more dramatic changes are needed to decipher the regions of H2A.Z that are important for its functions in vivo. In Chapters 3 and 4 of this dissertation, I take advantage of truncation and hybrid-protein approaches to determine the amino acids required for H2A.Z deposition and functions.  1.6 Summary In summary, much progress has been achieved over the last few decades towards the understanding of the structure and function of chromatin. We have gained a vast amount of knowledge regarding the dynamic and nuanced nature of chromatin and a broad picture of the protein factors and mechanisms involved in altering the chromatin state has gradually emerged. However, the picture is far from complete – many questions still remain. Specifically, how are chromatin landscapes formed – what are the combinatorial effects of having certain chromatin modifications? Are chromatin modifications requirements or consequences of cellular processes? How are histone variants different from canonical histones and what make them distinct from one another to have such specific locations and 30  functions? In this dissertation, I address the latter question and expand on our current knowledge of the histone variant H2A.Z and tackle how it is deposited into chromatin, which regions of the protein are important for its functions, and how it is distinct from its canonical cousin H2A. In Chapter 2 of this dissertation I demonstrate that the protein Yaf9, which has a conserved YEATS domain and was not previously classified as a histone chaperone, has a similar β structure as the histone chaperone Asf1 and is also capable of binding to histones H3 and H4. I also used structure and function analyses to expand our understanding of the Yaf9 YEATS domain, its evolutionary conservation from yeast to human, and as a member of the SWR1-C and NuA4 complexes, its requirement for H2A.Z deposition and acetylation. In Chapter 3, I present work that the H2A.Z C-terminus is required for its functions. Specifically, there is a broad functional requirement of the last 20 amino acids of the H2A.Z C-terminus distal to the M6 region, although this was independent of SWR1-C. However, this required region does not confer variant specificity as it could be replaced with the corresponding region from H2A. In Chapter 4, I have teased apart the H2A.Z C-terminus in more detail, specifically investigating the M6 region. I present work that the M6 region in yeast H2A.Z is required but not sufficient for some H2A.Z-specific functions, such as interaction with its deposition complex SWR1-C, but is sufficient for binding to the histone chaperone Chz1. In Chapter 5 I discuss the findings from Chapters 2-4 and how my results contribute to the biology of histone variant H2A.Z. In addition, I suggest future experiments that will further contribute to our knowledge relating to the mechanism of H2A.Z deposition.  31  Chapter 2: Asf1-Like Structure of the Conserved Yaf9 YEATS Domain and Role in H2A.Z Deposition and Acetylation1  2.1  Introduction  Histones are the major protein constituent of chromatin and can be modified in several fundamental ways, including the addition of posttranslational modifications, ATP-dependent chromatin remodeling, and incorporation of histone variants (Kusch and Workman, 2007). H2A.Z, encoded by the HTZ1 gene in Saccharomyces cerevisiae, is an H2A variant with roles in transcriptional repression and activation, chromosome segregation, DNA replication and repair, and heterochromatin-euchromatin boundary formation (Guillemette and Gaudreau, 2006). H2A.Z is incorporated into nucleosomes by the conserved ATP-dependent chromatin remodeling complex SWR1-C, the first complex discovered to be dedicated to variant histone deposition (Kobor et al., 2004; Krogan et al., 2003; Mizuguchi et al., 2004). SWR1-C shares four subunits with the NuA4 histone H4 acetyltransferase complex, which among other substrates, also acetylates H2A.Z to restrict spreading of heterochromatin and to prevent chromosome missegregation (Babiarz et al., 2006; Keogh et al., 2006; Millar et al., 2006). One of the shared subunits, Yaf9, is important for cellular response to spindle stress, 1  This chapter is published in the Proceedings of the National Academy of Sciences U.S.A. Wang AY, Schulze JM, Skordalakes E, Gin JW, Berger JM, Rine J, Kobor MS. (2009). Asf1-like structure of the conserved Yaf9 YEATS domain and role in H2A.Z deposition and acetylation. Proc Natl Acad Sci USA. 106, 21573-8. See Preface on page iv for details of my contributions.  32  proper DNA repair and metabolism, H2A.Z chromatin deposition and acetylation, and histone H4 acetylation at telomere-proximal genes (Keogh et al., 2006; Le Masson et al., 2003; Wu et al., 2005; Zhang et al., 2004). Yaf9 contains an evolutionarily conserved YEATS domain found in more than a hundred different eukaryotic proteins (Schulze et al., 2009b). In human, GAS41 is the closest relative of Yaf9 based on sequence identity, domain organization, and its presence in human SRCAP and TIP60 complexes, which respectively correspond to yeast SWR1-C and NuA4 (Le Masson et al., 2003; Zhang et al., 2004). Yaf9 and GAS41 have an N-terminal YEATS domain followed by a conserved region of unknown function called the A-box and a C-terminal coiled-coil domain (Zhang et al., 2004). Interestingly, YEATS domain proteins have several connections to cancer. First, GAS41 is highly amplified in human glioblastomas and astrocytomas (Fischer et al., 1997) and is required for repression of the p53 tumor suppressor pathway during normal cellular proliferation (Park and Roeder, 2006). Second, two other YEATS domain containing proteins, ENL and AF9, are frequent fusion partners of the mixed-lineage leukemia protein in leukemia (Daser and Rabbitts, 2004). This study established the conservation of YEATS domain function from yeast to human. To better understand the physical organization of the YEATS domain, we determined the structure of this region from Yaf9 to 2.3Å resolution. Interestingly, the Yaf9 YEATS domain structure was highly similar to the structure of the Asf1 histone chaperone, a congruence that extended to an ability of Yaf9 to bind histones H3 and H4 in vitro. Using structure-function analysis in yeast, we found that the YEATS domain was required for Yaf9 function, H2A.Z deposition at specific promoters, and H2A.Z acetylation.  33  2.2 Materials and Methods  2.2.1  Yeast strains, plasmids, and yeast techniques  All strains used in this study are listed in Table 2.1 and were created using standard yeast genetic techniques (Ausubel, 1987b). Complete deletion of genes and integration of a triple HA-tag (Longtine et al., 1998) or triple FLAG tag (Gelbart et al., 2001) in frame at the 3´ end of genes were achieved using the one-step gene integration of PCR-amplified modules (Longtine et al., 1998). Plasmid shuffling experiments were performed using 5-FOA as a counter-selecting agent for the URA3 plasmid p(URA3, CEN, ARS, HHT2-HHF2), and shuffling in plasmids containing histone H3 K56 mutations (TRP1, CEN, hht2-HHF2). The YAF9 gene, including 300bp up- and downstream of the ORF, was PCR-amplified from genomic DNA and cloned into the centromeric vector plasmid pRS314 (TRP1). The plasmid was subsequently modified by integrating the triple HA-tag downstream of the gene using site-directed mutagenesis using the adapted protocol of the QuickChange method (Stratagene). Mutations in specific amino acids of YAF9 were generated by site-directed mutagenesis in a similar manner as described above following the protocol of the manufacturer (all primers used are available upon request). Multiple rounds of mutagenesis were conducted for mutations that are at large distances apart in the primary sequence. All mutations were confirmed by DNA sequencing and are listed in Table 2.2. To determine the expression level of the mutated Yaf9 proteins, yeast whole cell extracts were prepared using the NaOH extraction protocol as previously described (Kushnirov, 2000). Immunoblotting was performed using anti-HA (Applied Biological Materials) and anti-α-tubulin (Sigma) antibodies.  34  YAF9 and human GAS41 were cloned into a Gateway Entry vector (Invitrogen). For this purpose, GAS41 sequences were amplified by PCR from a cDNA clone generously provided by Ivan Still (Roswell Park Cancer Institute) (Lauffart et al., 2002). Four GAS41-Yaf9 hybrids (YGG [Yaf9 1-118, GAS41 122-227]; YYG [Yaf9 1-171, GAS41 161-227]; GGY [GAS41 1-160, Yaf9 172-226]; GYY [GAS41 1-121, Yaf9 119-226]) were constructed in the respective Gateway Entry vectors by amplifying DNA sequences corresponding to individual segments and replacing the corresponding parental segments using a modified insertion mutagenesis by the QuickChange method described above (details available upon request). The parental YAF9 and GAS41 sequences, along with the four hybrid constructs were subsequently transposed into the Gateway destination vector pVV221, encoding an Nterminal TAP-tag under the control of the tetO promoter, which is constitutively active in the absence of tetracycline (Van Mullem et al., 2003), using standard procedures.  Table 2.1 Yeast strains used in this study All strains except for DDY1810 were constructed for this work or from the laboratory collections and are of the W303 background. DDY1810 is of the S288C background and from D. Drubin’s laboratory. Name DDY1810 MKY5 MKY7 MKY844 MKY845 MKY846 MKY847 MKY848 MKY849 MKY850 MKY227 MKY228 MKY229 MKY230 MKY231 MKY232 MKY233  Relevant Genotype MATA leu2 ura3-52 trp1 prb1-1122 pep4-3 pre1-451 MATα ade2-1 can1-100 his3-11 leu2-3,112 trp1-1 ura3-1 LYS2 MATA ade2-1 can1-100 his3-11 leu2-3,112 trp1-1 ura3-1 LYS2 MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, 5'TAP-YAF9] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 pVV221 [CEN, ARS, TRP1, 5'TAP] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, 5'TAP-GAS41] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, 5'TAP-GGY] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, 5'TAP-GYY] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, 5'TAP-YYG] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, 5'TAP-YGG] MKY5, yaf9Δ::HIS5 SWC2-3HA::KanMX6 pVV221 [CEN, ARS, TRP1, 5'TAP] MKY5, yaf9Δ::HIS5 SWC2-3HA::KanMX6 p[CEN, ARS, TRP1, 5'TAP-YAF9] MKY5, yaf9Δ::HIS5 SWC2-3HA::KanMX6 p[CEN, ARS, TRP1, 5'TAP-GAS41] MKY5, yaf9Δ::HIS5 SWC2-3HA::KanMX6 p[CEN, ARS, TRP1, 5'TAP-GGY] MKY5, yaf9Δ::HIS5 SWC2-3HA::KanMX6 p[CEN, ARS, TRP1, 5'TAP-GYY] MKY5, yaf9Δ::HIS5 SWC2-3HA::KanMX6 p[CEN, ARS, TRP1, 5'TAP-YYG] MKY5, yaf9Δ::HIS5 SWC2-3HA::KanMX6 p[CEN, ARS, TRP1, 5'TAP-YGG]  35  Name MKY235 MKY236 MKY237 MKY238 MKY239 MKY240 MKY241 MKY284 MKY285 MKY286 MKY287 MKY288 MKY289 MKY290 MKY888 MKY889 MKY890 MKY891 MKY892 MKY893 MKY894 MKY256 MKY257 MKY258 MKY874 MKY875 MKY876 MKY877 MKY878 MKY879 MKY880 MKY819 MKY820 MKY821 MKY822 MKY823 MKY824 MKY825 MKY826 MKY827 MKY828 MKY829 MKY830 MKY831 MKY832 MKY833 MKY834 MKY835  Relevant Genotype MKY5, yaf9Δ::HIS5 SWC3-3HA::KanMX6 pVV221 [CEN, ARS, TRP1, 5'TAP] MKY5, yaf9Δ::HIS5 SWC3-3HA::KanMX6 p[CEN, ARS, TRP1, 5'TAP-YAF9] MKY5, yaf9Δ::HIS5 SWC3-3HA::KanMX6 p[CEN, ARS, TRP1, 5'TAP-GAS41] MKY5, yaf9Δ::HIS5 SWC3-3HA::KanMX6 p[CEN, ARS, TRP1, 5'TAP-GGY] MKY5, yaf9Δ::HIS5 SWC3-3HA::KanMX6 p[CEN, ARS, TRP1, 5'TAP-GYY] MKY5, yaf9Δ::HIS5 SWC3-3HA::KanMX6 p[CEN, ARS, TRP1, 5'TAP-YYG] MKY5, yaf9Δ::HIS5 SWC3-3HA::KanMX6 p[CEN, ARS, TRP1, 5'TAP-YGG] MKY5, yaf9Δ::HIS5 SWR1-3Flag::KanMX6 pVV221 [CEN, ARS, TRP1, 5'TAP] MKY5, yaf9Δ::HIS5 SWR1-3Flag::KanMX6 p[CEN, ARS, TRP1, 5'TAP-YAF9] MKY5, yaf9Δ::HIS5 SWR1-3Flag::KanMX6 p[CEN, ARS, TRP1, 5'TAPGAS41] MKY5, yaf9Δ::HIS5 SWR1-3Flag::KanMX6 p[CEN, ARS, TRP1, 5'TAP-GGY] MKY5, yaf9Δ::HIS5 SWR1-3Flag::KanMX6 p[CEN, ARS, TRP1, 5'TAP-GYY] MKY5, yaf9Δ::HIS5 SWR1-3Flag::KanMX6 p[CEN, ARS, TRP1, 5'TAP-YYG] MKY5, yaf9Δ::HIS5 SWR1-3Flag::KanMX6 p[CEN, ARS, TRP1, 5'TAP-YGG] MKY5, yaf9Δ::HIS5 EPL1-3HA::KanMX6 pVV221 [CEN, ARS, TRP1, 5'TAP] MKY5, yaf9Δ::HIS5 EPL1-3HA::KanMX6 p[CEN, ARS, TRP1, 5'TAP-YAF9] MKY5, yaf9Δ::HIS5 EPL1-3HA::KanMX6 p[CEN, ARS, TRP1, 5'TAP-GAS41] MKY5, yaf9Δ::HIS5 EPL1-3HA::KanMX6 p[CEN, ARS, TRP1, 5'TAP-GGY] MKY5, yaf9Δ::HIS5 EPL1-3HA::KanMX6 p[CEN, ARS, TRP1, 5'TAP-GYY] MKY5, yaf9Δ::HIS5 EPL1-3HA::KanMX6 p[CEN, ARS, TRP1, 5'TAP-YYG] MKY5, yaf9Δ::HIS5 EPL1-3HA::KanMX6 p[CEN, ARS, TRP1, 5'TAP-YGG] MKY7, asf1Δ::HIS5 MKY7, yaf9Δ::KanMX6 MKY7, yaf9Δ::KanMX6 asf1Δ::HIS5 DDY1810, pYEX-4T3 [GST-YAF9] DDY1810, pYEX-4T3 [GST] DDY1810, pYEX-4T3 [GST-yaf9-1] DDY1810, pYEX-4T3 [GST-yaf9-3] DDY1810, pYEX-4T3 [GST-yaf9-4] DDY1810, pYEX-4T3 [GST-yaf9-22] DDY1810, pYEX-4T3 [GST-yaf9-23] MKY5, pRS314 [CEN, ARS, TRP1] MKY5, yaf9Δ::HIS5 p[CEN, ARS, TRP1, YAF9-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, YAF9-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 pRS314 [CEN, ARS, TRP1] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-1-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-2-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-3-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-4-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-17-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-18-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-19-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-20-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-21-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-22-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-23-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-24-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-26-3HA]  36  Name MKY836 MKY837 MKY838 MKY839 MKY840 MKY841 MKY842 MKY843 MKY881 MKY882 MKY883 MKY884 MKY885 MKY886 MKY887 MKY851 MKY852 MKY853 MKY854 MKY855 MKY856 MKY857 MKY858 MKY859 MKY860 MKY861 MKY862 MKY863 MKY864 MKY865 MKY866 MKY867 MKY868 MKY869 MKY870 MKY871 MKY872 MKY873  Relevant Genotype MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-27-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-28-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-29-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-30-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-31-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-32-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-33-3HA] MKY7, yaf9Δ::HIS5 HTZ1-3Flag::KanMX6 p[CEN, ARS, TRP1, yaf9-34-3HA] MKY5, yaf9Δ::HIS5 p[2µ, TRP1, pGPD::YAF9-3HA::HIS5] MKY5, yaf9Δ::HIS5 p[2µ, TRP1, pGPD] MKY5, yaf9Δ::HIS5 p[2µ, TRP1, pGPD::yaf9-1-3HA] MKY5, yaf9Δ::HIS5 p[2µ, TRP1, pGPD::yaf9-4-3HA] MKY5, yaf9Δ::HIS5 p[2µ, TRP1, pGPD::yaf9-22-3HA] MKY5, yaf9Δ::HIS5 p[2µ, TRP1, pGPD::yaf9-23-3HA] MKY5, yaf9Δ::HIS5 p[2µ, TRP1, pGPD::yaf9-34-3HA] MKY258, p[CEN, ARS, TRP1, YAF9-3HA] MKY258, pRS314 [CEN, ARS, TRP1] MKY258, p[CEN, ARS, TRP1, yaf9-1-3HA] MKY258, p[CEN, ARS, TRP1, yaf9-2-3HA] MKY258, p[CEN, ARS, TRP1, yaf9-3-3HA] MKY258, p[CEN, ARS, TRP1, yaf9-4-3HA] MKY258, p[CEN, ARS, TRP1, yaf9-17-3HA] MKY258, p[CEN, ARS, TRP1, yaf9-18-3HA] MKY258, p[CEN, ARS, TRP1, yaf9-19-3HA] MKY258, p[CEN, ARS, TRP1, yaf9-20-3HA] MKY258, p[CEN, ARS, TRP1, yaf9-21-3HA] MKY258, p[CEN, ARS, TRP1, yaf9-22-3HA] MKY258, p[CEN, ARS, TRP1, yaf9-23-3HA] MKY258, p[CEN, ARS, TRP1, yaf9-24-3HA] MKY258, p[CEN, ARS, TRP1, yaf9-26-3HA] MKY258, p[CEN, ARS, TRP1, yaf9-27-3HA] MKY258, p[CEN, ARS, TRP1, yaf9-28-3HA] MKY258, p[CEN, ARS, TRP1, yaf9-29-3HA] MKY258, p[CEN, ARS, TRP1, yaf9-30-3HA] MKY258, p[CEN, ARS, TRP1, yaf9-31-3HA] MKY258, p[CEN, ARS, TRP1, yaf9-32-3HA] MKY258, p[CEN, ARS, TRP1, yaf9-33-3HA] MKY258, p[CEN, ARS, TRP1, yaf9-34-3HA]  37  Table 2.2 YAF9 mutants  Name  Mutations  Class  yaf9-2  Y112A  A  yaf9-4  K60E, K61E, K65E, H67A, K97E, K107E, H113A, R116E  A  yaf9-6  H39A. T40A, Y70A  A  yaf9-7  K65A, H67A, T69A, Y70A  A  yaf9-8  E86A, T87A, W89A, E91A, F92A  A  yaf9-9  L117A, H118A  A  yaf9-10  W89D  A  yaf9-11  F92D  A  yaf9-12  W89D, F92D  A  yaf9-13  K60E, K61E, K65E, H67A  A  yaf9-14  K60E, K61E, K65E, H67A, K97E, K107E  A  yaf9-15  I9D  A  yaf9-16  2-10∆, T11M  A  yaf9-24  Y112E  A  yaf9-1  H39A, T40A, H41A, H67A, Y70A, W89A, F92A, L117A, H118A  B  yaf9-3  W89K E91K D93K  B  yaf9-23  H39W, F46D, D54L, T85D, F92W  B  yaf9-26  H39W  B  yaf9-27  H39W, F46D  B  yaf9-28  H39W, F46D, T85D, F92W  B  yaf9-30  F92W  B  yaf9-31  D54L  B  yaf9-32  T85D  B  38  Name  Mutations  Class  yaf9-33  F46D  B  yaf9-34  W89K E91K D93K I94M  B  yaf9-17  L109D  C  yaf9-18  V47M, V98I  C  yaf9-19  I18W  C  yaf9-20  I153W  C  yaf9-21  F111W  C  yaf9-22  V47M, V98I, F111W  C  yaf9-25  V98I  C  yaf9-29  V47M, V70H, V98I, F111W  C  2.2.2  Analytical-scale affinity purifications  Coprecipitation assays were performed as described previously (Kobor et al., 2004). Briefly, yeast cells were harvested, and lysed in TAP-IP Buffer (50 mM Tris [pH 7.8], 150mM NaCl, 1.5mM MgAc, 0.15% NP-40, 1mM DTT, 10mM NaPPi, 5mM EGTA, 5mM EDTA, 0.1 mM Na3VO4, 5mM NaF, CompleteTM Protease inhibitor cocktail) using acid-washed glass beads and mechanically disrupting using a bead beater (BioSpec Products, Bartlesville, Oklahoma, United States). TAP-tagged fusion proteins were captured using IgG sepharose beads (Amersham Biosciences), and subsequently washed in TAP-IP buffer. Captured material was analyzed by immunoblotting and co-purifying proteins were detected with anti-HA (Applied Biological Materials), anti-FLAG M2 (Sigma), Tra1 and Eaf1 antibodies (generous gifts from J. Workman and J. Coté, respectively). Bands were visualized using the Odyssey Infrared Imaging System (Licor). 39  2.2.3  Protein expression and purification  An N-terminally hexa-histidine tagged Yaf9 construct spanning amino acids 8-171 was cloned into a pET28b derivative and expressed in E. coli BL21 (DE3)-RIL cells by IPTG induction (1.0 mM for 6 h at 37˚, added after cells reached an A600 of 0.5). Selenomethionine-labeled protein was made similarly, with additions to the previously described protocol (Van Duyne et al., 1993). Cells were harvested by centrifugation, resuspended in lysis buffer containing 25 mM Tris-Cl [pH 7.5], 0.5 M KCl, 10% glycerol, 10 mM imidazole, 5 mM β-mercaptoethanol and 1 mg/mL lysozyme. Cells were lysed by sonication and insoluble material removed by centrifugation. The supernatant was passed over a Nickel column (Pharmacia AKTA FPLC) and eluted using a gradient of 10-0.5 M imidazole. Fractions containing Yaf9 were identified by SDS-PAGE, concentrated to 1 ml and treated with TEV protease overnight at 4oC to cleave the His-tag. The TEV-cleaved protein was passed over a Ni column to remove the His-tag and the flow-through, thereby concentrating the sample to 1 ml. The protein sample was purified on a size exclusion column (Sephacryl S200) equilibrated with 50 mM Tris (pH 7.5), 10% glycerol, 0.5 M KCl and 1 mM TCEP. Fractions containing pure, monodisperse protein (as indicated by SDSPAGE and dynamic light scattering) were concentrated to 10 mg/ml using ultrafiltration (Centriprep-10, Millipore).  2.2.4  Crystallization and structure determination  The purified Yaf9 YEATS domain was crystallized by microbatch under paraffin oil. The stock protein solution was dialyzed in 10 mM Tris, 100 mM KCl and 1 mM TCEP, pH 7.5 at 4º C prior to crystallization. One volume of protein was mixed with one volume of  40  crystallization solution, which contained 10% PEG 3350, 100 mM Na-Tartrate and 20% glycerol. Crystals appeared in 3-5 days and grew to average dimensions (100 x 100 x 20 µm) in a week. For cryoprotection, crystals were introduced into 15% PEG 3350, 100 mM NaTartrate and 25% glycerol, pH 7.5 slowly, in five successive steps and then flash frozen in liquid nitrogen. All data were collected at beam line 8.3.1 at the advanced light source (MacDowell et al., 2004). Native data were collected to 2.3 Å resolution. Initial phases were calculated to 2.9 Å resolution using a two-wavelength MAD dataset from selenomethionine-substituted crystals, and the phases extended to 2.3 Å resolution in DM (Cowtan, 1994). The model was built in O (Jones and Kjeldgaard, 1997) and the structure was refined to a final Rwork=21.8 and Rfree=25.8 using REFMAC5 (Murshudov, 1997) with TLS refinement in the last steps. Superpositions of Yaf9 with Asf1 were performed using LSQMAN (Kleywegt, 1999), and sequence alignments using MAFFT (Katoh et al., 2005) and JALVIEW (Waterhouse et al., 2009).  2.2.5  GST-fusion protein purifications and histone binding assays  GST and GST-YAF9 plasmids for protein over-expression in yeast were kindly provided by Robert Slany (Bittner et al., 2004). GST-fusion proteins were expressed and purified in yeast (YEXpress system, Clontech) according to the instructions of the manufacturer. Cultures were grown in SC-URA with 0.5 mM copper (Ouspenski et al.) sulfate for 4 hours to induce protein expression. Cell pellets were lysed in Extraction Buffer (EB: 50mM Tris-Cl [pH 7.5], 1mM EDTA, 4mM MgCl2, 5mM DTT, 10% glycerol, 150mM NaCl, and protease inhibitor cocktail) using acid washed glass beads and mechanically disrupted using a bead beater.  41  Whole cell extracts were incubated with glutathione sepharose beads (GE Healthcare), the beads were washed with Wash Buffer (50mM Tris-Cl [pH 7.5], 4mM MgCl2, 1mM DTT, 10% glycerol, 150mM NaCl) and the purified GST-fusion protein was eluted with 7 mg/ml glutathione (Sigma) in EB. The purified protein was dialyzed in GST Binding Buffer (50 mM HEPES [pH 7.5], 100 mM potassium acetate, 20 mM magnesium acetate, 5 mM EGTA, 1 µM DTT, 10% glycerol, 0.5% NP-40, 1 mM PMSF, 0.03% Triton X-100 and protease inhibitor cocktail). The histone binding assay was performed essentially as previously described with minor modifications (Matangkasombut and Buratowski, 2003). Briefly, 10 µg of purified GSTfusion proteins were incubated with 20 µl of 0.5 mg/ml calf thymus histones (Sigma) in GST Binding Buffer (50mM HEPES [pH 7.5], 100mM potassium acetate, 20mM magnesium acetate, 5mM EGTA, 1uM DTT, 10% glycerol, 0.5% NP-40, 1mM PMSF, 0.03% Triton X100 and protease inhibitor cocktail) for 45 min at 37°C, then subsequently loaded onto glutathione-agarose (Sigma) and incubated overnight at 4°C. The supernatant was saved for input and the beads were washed in GST Binding Bufffer with increasing NaCl concentration (ie. 0.2 M, 0.4 M, 0.8 M, 1 M NaCl). The input and material bound to the beads were subjected to SDS-PAGE and immunoblotted using anti-GST (Applied Biological Materials), anti-H3 (Abcam), anti-H4 (Abcam), and anti-H2B (Upstate) antibodies. Immunoblots were analyzed using the Odyssey Infrared Imaging System (Licor).  2.2.6  Chromatin association and histone acetylation assays  The chromatin association assay was adapted from a protocol previously described with minor modifications (Liang and Stillman, 1997). Yeast cells were incubated in Pre-  42  Spheroblast Buffer (100mM PIPES/KOH [pH 9.4], 10mM DTT, 0.1% sodium azide) for 10 min at room temperature, and spheroblasted with 20 mg/ml Zymolyase-100T (Seikagaku Corporation) in Spheroblast Buffer (50mM KPO4 [pH 7.5], 0.6 M Sorbitol, 10mM DTT) at 37°C for 15 min. Spheroblasts were washed with Wash Buffer (50mM HEPES/KOH [pH 7.5], 100mM KCl, 2.5mM MgCl2, 0.4M sorbitol), resuspended in equal volume of EB (50mM HEPES/KOH [pH 7.5], 100mM KCl, 2.5mM MgCl2, 1mM DTT, 1mM PMSF, and protease inhibitor cocktail), and lysed with 1% Triton X-100. Whole cell extract (WCE) was saved, and the remaining lysate was separated into chromatin pellet (Pellet) and supernatant (SUP) fractions by centrifugation through EBSX (EB+ 0.25% Triton X-100 and 30% sucrose). WCE, Pellet, and SUP were subjected to SDS-PAGE and immunoblotted with antiFLAG M2 (Sigma), anti-H2A (Upstate) and anti-Pgk (Molecular Probes) antibodies. Immunoblots were scanned with the Odyssey Infrared Imaging System (Licor). The average intensities of bands were deduced using the Odyssey V3.0 software. H2A.Z-Flag was normalized against H2A in chromatin and Pgk1 in supernatant. The enrichment ratios were calculated by dividing the normalized intensity by the total intensity (sum of chromatin and supernatant) for quantification. This ratio was averaged for four independent assays. To determine the relative amounts of H2A.Z K14 acetylation, the chromatin fractions were subjected to SDS-PAGE, immunoblotted with anti-H2A.Z K14ac (Upstate), anti-FLAG M2 (Sigma), and anti-H4 (Abcam) antibodies, and scanned with the Odyssey Infrared Imaging System (Licor).  43  2.2.7  Genome-wide ChIP-on-Chip  ChIP was performed as described previously, using the adapted linear amplification method that involves two rounds of T7 RNA polymerase amplification (van Bakel et al., 2008). In brief, yeast cells (500 ml) were grown in SC-TRP media to an OD600 of 0.8–0.9 and were crosslinked with 1% formaldehyde for 20 min before chromatin was extracted. The chromatin was sonicated (Bioruptor, Diagenode; Sparta, NJ: 10 cycles, 30 s on/off, high setting) to yield an average DNA fragment of 500 bp. FLAG antibody (Sigma, F3165) for H2A.Z pull-down (4 µl) was coupled to 60 µl of protein A magnetic beads (Invitrogen). After reversal of the crosslinking and DNA purification, the immunoprecipitated and input DNA were amplified to about 6 µg aRNA using T7 RNA polymerase in two rounds. Samples were labeled with biotin, and the immunoprecipitated and input samples were hybridized to two Affymetrix 1.0R S. cerevisiae microarrays, which are comprised of over 3.2 million probes covering the complete genome. Probes (25-mer) are tiled at an average of 5 bp resolution, creating an overlap of approximately 20 bp between adjacent probes.  2.2.8  Data analysis  We used an adapted version of the MAT algorithm to reliably detect enriched regions (J.M.S., A. Droit, T.H., H.B. Fraser, R. Gottardo, M.S.K., unpublished data) (Johnson et al., 2006). MAT was applied to corresponding immunoprecipitated and input sample arrays, and the probe behavior model was estimated by examining the signal intensity, sequence, and copy number of all probes on an array. After probe behavior model fitting, the residuals between the model and observation were normally distributed and centered at 0. MAT uses a score function to identify regions of ChIP enrichment, which allows robust p-value and false-  44  discovery-rate calculations. MAT scores were calculated for all probes using a 300 bp sliding window. Annotations for ORFs and ARS were derived from the SGD database. An ORF was termed enriched if at least 50% of all probes had a MAT score above a threshold of 1.5. Promoters were defined as enriched if 50% of all probes 500 bp upstream of the transcriptional start site were above the MAT score cutoff. Promoters which overlap with ORFs of other genes were not considered. To compare our data sets with H3K56ac ChIP-on-chip data from previously published studies, we used the supplemental data available from Rufiange et al. (Rufiange et al., 2007). In order to explore this statistical significance between the H2A.Z and H3K56ac ChIP-on-chip data, we used the hypergeometric test as described (Tavazoie et al., 1999).  2.3 Results  2.3.1  YEATS domain function is conserved from yeast to human  The primary sequence similarity between human GAS41 and yeast Yaf9 predicted a functional conservation. We tested whether any of the three domains (YEATS domain, Abox and coiled-coil) of GAS41 could substitute for its Yaf9 counterpart in yeast. Genes encoding for hybrid proteins, each carrying a distinct module from either GAS41 or Yaf9 (Figure 2.1A), were tested for their ability to complement growth phenotypes caused by loss of YAF9. Strains lacking Yaf9 are sensitive to chemical stressors including formamide, hydroxyurea (HU), and benomyl (Schulze et al., 2009b). Hybrid proteins carrying the YEATS domain of GAS41 and at least the coiled-coil region of Yaf9 rescued most of the growth defects caused by loss of Yaf9 (Figure 2.1B). In contrast, hybrid proteins carrying  45  the GAS41 coiled-coil and the Yaf9 YEATS domain were unable to support growth of strains lacking Yaf9, irrespective of the source of the A-box (Figure 2.1B). Expression of the human GAS41 construct alone was unable to complement any of the phenotypes caused by loss of YAF9 (Figure 2.1B), as was expected from the GAS41-Yaf9 hybrid results. The function of the GAS41-Yaf9 hybrid proteins reflected their incorporation into SWR1-C and NuA4. Functional TAP-GAS41-Yaf9 hybrids and full length TAP-Yaf9 protein all copurified with SWR1-C subunits Swr1, Swc2 and Swc3, as well as NuA4 subunits Eaf1, Epl1 and Tra1 (Figure 2.1C). In contrast, much less SWR1-C and NuA4 co-purified with hybrids containing the GAS41 coiled-coil or with full-length TAP-GAS41.  46  CC  GYY  YEATS  A-box  CC  YYG  YEATS  A-box  CC  YGG  YEATS  A-box  CC  GAS41  YEATS  A-box  CC  vector  A-box  GAS41  YEATS  yaf9Δ YGG  GGY  B  YYG  CC  GYY  A-box  GGY  YEATS  YAF9  Yaf9  WT  A  -TRP  C  Co-Purifying Protein  vector  GAS41  YGG  YYG  GYY  GGY  YAF9  Captured Protein  Formamide Swr1-FLAG Swc2-HA  SWR1-Com  Swc3-HA  Hydroxyurea Tra1 NuA4  Eaf1 Epl1-HA  Benomyl  Figure 2.1 YEATS domain function is conserved from yeast and human (A) Schematic representation of Yaf9-GAS41 hybrid proteins constructed with modules originating from Yaf9 in green and GAS41 in yellow. The nomenclature indicates the origin of a given module where “G” refers to GAS41 and “Y” to Yaf9, in order of YEATS domain, A-box and coiled-coil. For simplicity, the N-terminal TAP-tag present in all constructs was omitted. (B) GAS41 YEATS domain conferred resistance to genotoxic stress in yeast when fused to Yaf9 coiled-coil. Tenfold serial dilution from stationary overnight cultures of yaf9Δ strains carrying the indicated plasmids, with TRP1 as the selectable marker, were plated and incubated at 30oC for 2 days. CSM plates lacking tryptophan with the following concentrations of chemicals were used: 2% formamide, 30 µg/ml benomyl and 75mM HU. (C) GAS41 YEATS domain fused to Yaf9 coiled-coil was incorporated into SWR1-C and NuA4. Analytical-scale affinity purifications of TAP-Yaf9-GAS41 hybrids from cells containing affinity-tagged versions of 3 representative SWR1-C and 3 representative NuA4 subunits were performed and immunoblotted for the indicated proteins.  47  2.3.2  The YEATS domain of Yaf9 adopts an immunoglobulin fold  To better understand the function of the evolutionary conserved Yaf9 YEATS domain, we determined its high-resolution structure using X-ray crystallography. The crystallized fragment (Yaf9 amino acids 8-171 determined by mass spectrometry) contained the YEATS domain and A-box, suggesting that these components of Yaf9 form a stable structural element, with a less-structured linker connecting to the coiled-coil domain. The Yaf9 YEATS domain crystallized in the space group P6522. The structure of the selenomethionine-substituted protein was determined by multi-wavelength anomalous dispersion, and refined to a final resolution of 2.3Å (Table 2.3). Three copies of the YEATS domain were present in the asymmetric unit. The final model included residues 8-119 and 143-169 for each of the three protomers, and was refined to an Rwork/Rfree of 21.8/25.8% with no residues in disallowed regions of Ramachandran space (Table 2.3). The three protomers were highly similar to each other, displaying an average rmsd of ~0.25 Å across all atoms. The YEATS domain folded into an elongated β-sandwich consisting of eight antiparallel βstrands capped on one end by two short α-helices (Fig. 2.2A, B). Structural comparison of the YEATS domain against the protein databank using the DALI server showed that it adopted an Immunoglobulin (Ig) fold (Holm and Sander, 1995). Ig folds are common macromolecular interaction modules, and are found in proteins with a variety of cellular functions (Bork et al., 1994). The YEATS domain was structurally homologous to the Ig folds of a broad number of factors (over 200 hits with Z-scores smoothly varying from 3-6), with no evidence of any particular standout among fold homologs.  48  Table 2.3 Data collection, phasing analysis, and refinement statistics  Data Collection Yaf9(8-171) Wavelength, Å Space group Cell dimensions, Å Resolution, Å Redundancy Completeness (%) Rsym (%)*  Native λ 1.11587 P6522 84.725 288.212 50-2.3 (2.42-2.3) 6.3 (5.0) 95.8 (92.8) 7.5 (36.8) 16.2 (4.4)  I/σ (I) Phasing Analysis Resolution No. sites Mean figure of merit (FOM) Refinement Statistics Resolution (Å) Rwork (%)† Rfree (%)‡ RMSD bonds, Å RMSD angles, º No. protein atoms No. water atoms Ramachandran % (no res.) Most favored Allowed Gen. allowed  Se-Derivative Se-λ1 0.9795 P6522 84.582 286.531 50-2.90 (3.02-2.90) 3.8 (3.8) 100 (100) 13.5 (43.1) 8.7 (2.9) 40-2.9 6 0.36 20-2.3 21.8 25.8 0.009 1.143 3671 200 89.7 10.0 0.3  49  Se-λ2 1.0199 84.636 286.639 50-2.90 (3.02-2.9) 3.8 (3.8) 100 (100) 12.3 (41.4) 9.2 (3.0)  A  B  C  D  Figure 2.2 Secondary structure and amino acid conservation of YEATS domain  (A) Sequence alignment of YEATS domains showing amino acid conservation. Secondary structure elements and specific classes of mutations are labeled. (B) Ribbon diagram of the Yaf9 YEATS domain. Structural elements are labeled and conserved sequence motifs highlighted. This and all other molecular graphics figures were generated using PYMOL. (C) View of the three YEATS domains protomers (green, cyan, yellow) as related by noncrystallographic symmetry. The extended N-terminal tail of each domain docks into the hydrophobic groove of a neighboring molecule, forming a pseudocontinuous sheet with strand β7 across the domain. (D) Surface view of the Yaf9 YEATS domain (boxed region in panel C) highlighting the conserved cleft motifs (purple, magenta, and pink), and hydrophobic groove (yellow). The N-terminus of an adjacent protomer is shown as cyan sticks.  50  2.3.3  Structural features of the YEATS domain  Our structure revealed three interesting physical features of the YEATS domain. One feature was the presence of a highly conserved cleft located on the end of the Ig fold opposite the two capping helices (Figure 2.2B, D). This region was composed of three surface-exposed loops emanating from the core β-sheet region. The first was a His-Thr-His (HTH) triad, which preceded strand β2 and was invariant in Yaf9/GAS41 family members, but not in Taf14 and Sas5, the two other YEATS domain-containing proteins in yeast (Schulze et al., 2009b). The other two loops included a Leu-His-X-Ser/Thr-Tyr/Phe (LHx(S/T)(Y/F)) pentad that connected strands β3 and β4, and a Gly-Trp-Gly sequence wedged between strands β5 and β6. Both of these segments were essentially invariant across all YEATS proteins and constituted the defining signature sequence motifs of the clade. The presence of this conservation within the external loops of an Ig fold was intriguing, as these regions often form the principal surface used by such proteins to engage client molecules. A second feature consisted of a relatively shallow groove near the N- and C- termini of the YEATS domain (colored yellow in Figure 2.2D). Formed in part by the capping helices, the groove was relatively nonpolar, and displayed only a modest degree of surface amino acid conservation. The groove was distinguished, however, by the presence of a narrow, but deep, hydrophobic pocket that extruded ~7-8 Å down into the core of the β-sheet region (Figure 2.2D, also see Figure 2.5A). The hydrophobic character of the groove and pocket was conserved among all YEATS domains. Moreover, in the crystal, the groove served to bind the extended Nterminal arm of an adjacent YEATS domain protomer, such that the N-terminal tail formed an extra strand of the β4-3-6-7 sheet, in trans. This interaction was recapitulated between the three YEATS domains present in the asymmetric unit to form a trimeric array of protomers 51  with rotational, three-fold non-crystallographic symmetry (Figure 2.2C). Although the YEATS fragment we crystallized was monomeric in solution (as determined by gel filtration and dynamic light scattering), the surface features of the groove and its ability to associate with the N-terminus of a partner molecule suggested that the grove may also constitute a peptide binding surface. The third feature, between the cleft and putative peptide-binding groove, was a region rich in conserved charged residues, particularly basic amino acids. Although the charged patch did not have any notable structural features, such as a deep depression or any particularly marked curvature, it was one of the most electropositive surfaces on the YEATS domain (Figure 2.5B). 2.3.4  Yaf9 shares structural and biochemical properties with the Asf1 histone  chaperone In the course of analyzing the Yaf9 YEATS domain, we noted a marked similarity to the histone chaperone Asf1 (Figure 2.3A, B). Like Yaf9, the core region of Asf1 is also predicated on an Ig fold. Moreover, of the several different topological groups of Ig fold categorized to date, both proteins belong to the same “switched” Ig subclass (Figure 2.3C). Although the surface features of the two proteins are relatively distinct – for example, Asf1 lacks the deep conserved cleft formed by apical loops of the Yaf9 Ig fold – there were some intriguing similarities beyond the level of fold topology. In particular, Asf1 binds short peptide segments using the edges of its β-sheets, such as with the Hir1 B-box of CAF1 or the C-terminal tail of histone H4 (Antczak et al., 2006; English et al., 2006; Natsume et al., 2007). In our structure, the Yaf9 YEATS domain used one of its β-sheets and a hydrophobic groove to associate with the N-terminal peptide of an adjoining protomer in a similar fashion (Figure 2.2C). 52  A  C  B  Figure 2.3 Yaf9 YEATS domain structure is similar to histone chaperone Asf1 (A) Topology diagram of the Yaf9 YEATS domain and Asf1 switched-type Ig folds. Conserved β-strands are shown as purple arrows. A swap of the last strand has occurred between the two proteins, pairing the “h” strand of Yaf9 and Asf1 with either the “a-b-e” sheet (gray) or “g-f-c-d” sheet (green). The corresponding β-strands are shown below. (B) Structural comparison of the Yaf9 YEATS domain and Asf1 core. The ribbon diagram is rainbow colored from the N-terminus (blue) to the C-terminus (red) of each protein. (C) Topology diagram of the switched-type Ig GST folds asGST-Yaf9 well as the Yaf9 YEATS domain and Asf1. Conserved β-strands are shown as purple arrows,sup and 10 α-helices are shown in cyan cylinders. The two proteins have a swap of the last strand, 0 10 0 Histones pairing the “h” strand of Yaf9 and Asf1 (µg) with either the “a-b-e” sheet or “g-f-c-d” sheet, respectively.  To test H3 whether the structural similarity between the Yaf9 YEATS domain and Asf1 was H2B  H4  reflected in a genetic interaction, we used an assay for which double mutant haploid segregants were obtained from a diploid strain with only one copy of ASF1 and YAF9. The GST-Yaf9 10  0  asf1Δ yaf9Δ double mutants were viable but grew dramatically more slowly than either Histones (µg)  single mutant, particularly at a higher temperature or on media with low levels of HU (Figure 2.4A). Consistent with ASF1 being required for acetylation of H3K56 (Recht et al., 2006), 53  the yaf9Δ H3K56R double mutant had a synthetic growth defect (Figure 2.4B). Moreover, this interaction was likely due to Yaf9’s role in H2A.Z deposition but not H2A.Z acetylation, as the htz1Δ H3K56R double mutant also exhibited a synergistic growth defect while the htz1K3,8,10,14R H3K56R double mutant did not (Figure 2.4B). Given the diversity of folds involved in chromatin remodeling, it was unexpected to find that the Yaf9 YEATS domain was a structural homolog of Asf1, a chaperone for histones H3-H4. Consistent with the structural similarity between the Yaf9 YEATS domain and Asf1, in vitro protein-interaction assays showed that GST-Yaf9 bound to histones H3 and H4 (Figure 2.4C). These associations were not likely to reflect non-specific binding to basic charged proteins as Yaf9 did not bind H2B.  2.3.5  Conserved residues on the YEATS domain surface are important for Yaf9  function To better understand the role of the YEATS domain in vivo, we constructed three classes of mutant Yaf9 proteins. Each mutant carried multiple amino acid substitutions of conserved residues on the surface of one of the three structural features. Class A mutants were in the charged surface region of the protein (yaf9-2, yaf9-4, and yaf9-24). Class B mutants were in the conserved cleft (yaf9-1, yaf9-3, yaf9-34, along with yaf9-23 and various dissections of it: yaf9-26, yaf9-27, yaf9-28, yaf9- 29, yaf9-30, yaf9-31, yaf9-32 and yaf9-33). Class C mutants were in the groove that associated with the N-terminal segment of Yaf9 with potential to be a peptide-binding groove (yaf9-17, yaf9-18, yaf9-19, yaf9-20, yaf9-21, and yaf9- 22). The locations of the altered residues in the proteins encoded by yaf9 alleles are shown in Figure 2.2A and Figure 2.5C, with an exact description in Table 2.2.  54  YPD 30°CYPD 30°C  YPD 30ºCYPD 30ºC  YPD 37°CYPD 37°C  YPD 37ºCYPD 37ºC  10mM Hydroxyurea 10mM Hydroxyurea  10mM Hydroxyurea 10mM Hydroxyurea  C  GST sup  10  hht1-K56Q  hht1-K56R  HHT1 hht1-K56Q  HHT1 hht1-K56Q  hht1-K56Q hht1-K56R  hht1-K56R HHT1  hht1-K56R HHT1 hht1-K56Q hht1-K56R  htz1-K3,8,10,14R htz1-K3,8,10,14R htz1∆ -3Flag -3Flag  yaf9∆htz1∆  HHT1 hht1-K56Q  hht1-K56Q hht1-K56R  hht1-K56R HHT1  HHT1 hht1-K56Q  hht1-K56R  yaf9∆  HHT1  yaf9∆asf1∆  asf1∆  yaf9∆ yaf9∆asf1∆  B WT asf1∆  yaf9∆  WT  A  GST-Yaf9  0  10  0  Histones (µg)  H3 H2B H4  Figure 2.4 Yaf9 has similar functions as histone chaperone Asf1 (A) YAF9 and ASF1 interacted genetically. Cells lacking both ASF1 and YAF9 were hypersensitive to high temperature (37oC) and HU. Tenfold serial dilution of strains from stationary overnight cultures with the indicated deletions were plated and incubated on YPD at 30°C, 37°C and 10mM HU for 2 days. (D) YAF9 and HTZ1 interacted genetically with H3K56R. Cells expressing H3K56R in combination with either yaf9∆ or htz1∆ were hypersensitive to HU. Cells expressing H3K56R htz1- K3,8,10,14R showed no obvious synthetic interaction. Tenfold serial dilution of strains from stationary overnight cultures with the indicated deletions were plated and incubated on YPD at 30°C, 37°C and 10mM HU for 2 days. (C) Yaf9 bound to histones H3 and H4 in vitro. Calf thymus histones bound to the indicated amounts of purified GST or GST-Yaf9 from yeast. After extensive washing, the pellets were resolved by SDS-PAGE, immunoblotted, and probed with -H3, H4, and -H2B histone antibodies (Abcam).  55  Figure 2.5 Mutations in conserved surface residues in the Yaf9 YEATS domain affects protein function (A) Yaf9(8-171) surface representation showing YEATS residue conservation as mapped by Consurf (dark green invariant, light green - conserved, white - variable), based on an alignment of more than 30 Yaf9 and GAS41 orthologs (Sas5 and Taf14 were excluded). The peptide (cyan sticks)/hydrophobic groove interaction seen between Yaf9 protomers is highlighted. (B) Surface stereo-representation of Yaf9(8-171) showing charge distribution (red – negative, blue – positive, contoured at +/- 5kBT by APBS). The view is rotated ~60˚ to that shown in A. (C) Surface of Yaf9(8-171) showing the where the three mutant classes map with respect to the structure and each other. The orientation is the same as in A.  Yaf9 YEATS domain mutants were tested for their ability to complement the sensitivity of yaf9Δ strains to genotoxic agents formamide, HU and benomyl. Drug-sensitivity phenotypes were conferred by mutations in two of the three conserved areas to varying degrees, with Class A allele yaf9-4 and Class B alleles yaf9-23, yaf9-27, yaf9-28 having growth defects similar to those of yaf9Δ (Figure 2.6A). The yaf9-1 strain had growth defects similar to those of yaf9Δ on formamide and HU, but grew similar to wild type on benomyl, while yaf9-3 and yaf9-34 strains had growth defects only on formamide and grew comparable to wild type on HU and benomyl. These results hinted at regional specialization of function, with yaf9-1 being defective in processes leading to formamide and HU sensitivity, whereas the other Class B alleles yaf9-3 and yaf9-34 were defective in a process leading only to formamide sensitivity. Strains with mutations in the putative peptide-binding pocket (Class C) had no  56  discernable phenotypes (Figure 2.6A), suggesting this feature played no discernable role in the Yaf9-dependent functions tested here. In addition to the 20 alleles shown in Figures 2.6A and 2.7, 13 alleles with mutations in other conserved residues were tested without revealing noticeable phenotypes (Table 2.4).  -TR P 30C  yaf9-23 (B)  yaf9-28 (B)  yaf9-27 (B)  yaf9-18 (C)  vector  YAF9  yaf9-34 (B)  yaf9-3 (B)  yaf9-4 (A)  yaf9-1 (B)  vector  yaf9 Δ  YAF9  yaf9-33 (B)  yaf9 Δ asf1 Δ  yaf9 Δ a sf1 Δ  yaf9-22 (C)  B E WT  yaf9-23 (B)  yaf9-28 (B)  yaf9-27 (B)  yaf9-30 (B)  yaf9-26 (B)  vector  YAF9  yaf9-22 (C)  yaf9-18 (C)  yaf9 Δ  yaf9-34 (B)  yaf9-3 (B)  yaf9-4 (A)  yaf9-1 (B)  vector  YAF9  yaf9 Δ  yaf9-33 (B)  A  -TR P 30C  2.5 % Formamide  -TR P 37C  125 m M Hydroxyurea  10 m M H ydroxyurea  30 ug/ul Benom yl  Figure 2.6 Conserved residues on the YEATS domain surface are important for Yaf9 function (A) Cells with yaf9 alleles of Classes A and B were sensitive to genotoxic stressors. Ten-fold serial dilution from stationary overnight cultures of yaf9Δ strains carrying the indicated plasmids were plated and incubated at 30oC for 2 days. CSM plates lacking tryptophan with the following concentrations of chemicals were used: 2.5% formamide, 125mM HU, and 30µg/ml benomyl. (B) Yaf9 YEATS domain was involved in similar process with Asf1. Tenfold serial dilution from stationary overnight cultures of yaf9Δ asf1Δ double deletion strains carrying yaf9 mutant alleles were plated and incubated at 30oC, 37oC and 10mM HU for 2 days. The alleles carrying mutations in the charged surface or conserved cleft were unable to rescue growth defects of the double mutant. Note that the yaf9-4, yaf9-23 and yaf9-28 alleles caused approximately a 10-fold greater growth retardation of the asf1Δ yaf9Δ strain than empty vector alone in cells grown at 37oC.  57  yaf9-20 (C)  yaf9-21 (C)  yaf9-17 (C)  yaf9-19 (C)  vector  YAF9  yaf9-32 (B)  yaf9Δ yaf9-31 (B)  yaf9-24 (A)  yaf9-2 (A)  vector  YAF9  yaf9Δ  -TRP 30C  2.5% Formamide  125 mM Hydroxyurea  30 ug/ul Benomyl  Figure 2.7 Growth comparison of Yaf9 mutants that have no phenotype Cells with the indicated YAF9 mutations were not sensitive to genotoxic stressors. Ten-fold serial dilution from stationary overnight cultures of yaf9Δ strains carrying the indicated plasmids were plated and incubated at 30oC for 2-3 days. CSM plates lacking tryptophan with the indicated concentrations of chemicals were used.  58  Table 2.4 yaf9 mutant phenotypes § (+++) indicates growth comparable to wild type, (-) indicates significant growth defect, (+) and (++) indicates intermediate phenotypes. ¶Phenotypes on both 37°C and hydroxyurea were included as there was no difference between the two conditions. Growth under the following conditions§: Allele Class Formamide Hydroxyurea Benomyl yaf9Δasf1Δ¶ YAF9 wild type +++ +++ +++ +++ yaf9Δ deletion + + + yaf9-2 A +++ +++ +++ +++ yaf9-4 A + + + yaf9-6 A +++ +++ +++ +++ yaf9-7 A +++ +++ +++ +++ yaf9-8 A +++ +++ +++ +++ yaf9-9 A +++ +++ +++ +++ yaf9-10 A +++ +++ +++ +++ yaf9-11 A +++ +++ +++ +++ yaf9-12 A +++ +++ +++ +++ yaf9-13 A +++ +++ +++ +++ yaf9-14 A +++ +++ +++ +++ yaf9-15 A +++ +++ +++ +++ yaf9-16 A +++ +++ +++ +++ yaf9-24 A +++ +++ +++ +++ yaf9-1 B + ++ ++ yaf9-3 B + +++ +++ ++ yaf9-34 B + +++ +++ ++ yaf9-23 B + + yaf9-26 B +++ +++ +++ +++ yaf9-27 B + + yaf9-28 B + + yaf9-30 B +++ +++ +++ +++ yaf9-31 B +++ +++ +++ +++ yaf9-32 B +++ +++ +++ +++ yaf9-33 B +++ +++ +++ +++ yaf9-17 C +++ +++ +++ +++ yaf9-18 C +++ +++ +++ +++ yaf9-19 C +++ +++ +++ +++ yaf9-20 C +++ +++ +++ +++ yaf9-21 C +++ +++ +++ +++ yaf9-22 C +++ +++ +++ +++ yaf9-25 C +++ +++ +++ +++ yaf9-29 C +++ +++ +++ +++  The amount of Yaf9 mutant protein was similar to the level in wild type strains in most mutants, including the yaf9-1 and yaf9-3 strains (Figure 2.8A), further supporting the view that the different phenotypes resulted from qualitative rather than quantitative differences in Yaf9 function. Over-expression experiments of alleles encoding Yaf9 protein with normal or reduced levels showed that the phenotypes of these mutants were not solely due to reduced protein level and that many of the yaf9 alleles behaved as hypomorphs (Figure 2.8B). 59  yaf9-33(B)  yaf9-31(B)  yaf9-32(B)  yaf9-30(B)  yaf9-24 (A)  yaf9-19 (C)  yaf9-18 (C)  yaf9-22 (C)  yaf9-23 (B)  yaf9-26(B)  yaf9-21 (C)  yaf9-22 (C)  yaf9-34(B) yaf9-20(C)  yaf9-34 (B)  yaf9-3(B) yaf9-17(C)  yaf9-4 (A)  yaf9-2 (A) yaf9-23(B)  yaf9-1 (B)  yaf9-4 (A) yaf9-28(B)  vector  yaf9-1(B)  yaf9-27(B)  YAF9  vector vector  2 micron overexpression vector  YAF9  YAF9  B  YAF9  A  Yaf9-HA a-tubulin  -TR P  Yaf9-HA a-tubulin  yaf9-22 (C)  yaf9-23(B)  yaf9-34(B)  yaf9-4 (A)  yaf9-1(B)  vector  YAF9  vector  YAF9  2 micron overexpression vector  2.5 % Formamide  Yaf9-HA  125 m M H ydroxyurea  30 ug/ul B enom yl  Figure 2.8 Protein levels and over-expression of Yaf9 mutants (A) Protein levels of Yaf9 with mutations in conserved residues were similar to wild-type except for the protein encoded by the yaf9-4, yaf9-27, yaf9-28, and yaf9-23 alleles which had somewhat lower levels. Note that yaf94 also migrates slower through the SDS-PAGE gel due to its altered charge properties. Over-expression of the mutant Yaf9 proteins restores their expression levels to that of wild type. Shown is an immunoblot analysis of yeast whole cell extracts, in which levels of Yaf9-HA were compared to each other. An antibody against αtubulin was used as loading control. (B) Over-expression of mutant Yaf9 proteins revealed their hypomorphic nature. The indicated Yaf9 alleles were over-expressed from the constitutive GPD1 promoter on a multicopy plasmid and tested for their sensitivity to genotoxic stressors, similar to A.  The enhanced growth defect of the yaf9∆ asf1∆ double mutant was contributed by the YEATS domain, as a subset of yaf9 alleles were unable to complement the loss of YAF9 in an asf1Δ strain and failed to restore growth on HU and higher temperature (37oC) (Figure 2.6B). Therefore, as the structural similarity implied, it was indeed the YEATS domain, and in particular the charged surface region and cleft of Yaf9, whose function was linked to Asf1. 60  Interestingly, the subset of yaf9 alleles with lower protein levels (yaf9-4, yaf9-23 and yaf928) consistently caused approximately a 10-fold greater growth retardation of the asf1Δ yaf9Δ strain than empty vector alone in strains grown at 37oC (Figure 2.6B). Thus, although the absence of ASF1 magnified the growth defect of yaf9Δ strains, it magnified the growth defect of the yaf9-4, yaf9-23 and yaf9-28 mutants even further.  2.3.6  Yaf9 YEATS domain functions in both SWR1-C and NuA4  To examine the role of the Yaf9 YEATS domain in histone variant H2A.Z biology, we assayed the activity of yaf9 mutants biochemically. Bulk chromatin fractionation assays showed that, as expected for cells lacking a component of the SWR1-C, yaf9Δ strains had reduced H2A.Z levels in the chromatin pellet and increased levels in the non-chromatin supernatant fraction as compared to wild type (Figure 2.9A). In contrast, the level of H2A in chromatin and the level of Pgk1 in supernatant, were unchanged. Strains with Yaf9 mutations located in the charged surface area (Class A allele yaf9-4,) or in the conserved cleft (Class B alleles yaf9-1, yaf9-23, yaf9-27, yaf9-28, and yaf9-34) had less H2A.Z in the chromatin pellet, comparable to the yaf9∆ strain (Figure 2.9A). Therefore, residues in the conserved charged surface (Class A) and cleft (Class B) of the Yaf9 YEATS domain were important for H2A.Z deposition. To further explore the conclusions derived from these crude chromatin association assays, the requirement of the Yaf9 YEATS domain for H2A.Z deposition at specific promoters was determined by chromatin immunoprecipitation (ChIP)on-Chip. H2A.Z occupancy was compared between YAF9 and the yaf9-1 and yaf9-3 mutants, which were chosen based on their differences in growth phenotypes (Figure 2.6A). Consistent with previous studies, H2A.Z was present at 2928 promoters in wild type strains,  61  using our enrichment criteria (Figure 2.9B, C) (Guillemette and Gaudreau, 2006). In contrast, H2A.Z-ChIP efficiency in both yaf9∆ and yaf9-1mutants was equal to a non-antibody control resulting in background peaks (Figure 2.9C), as reported previously for other SWR1-C subunits (Li et al., 2005). Interestingly, in the yaf9-3 mutant, H2A.Z was specifically lost at about one third of promoters but was present at almost wild type levels at the other two-thirds (Figure 2.9B, C). Further supporting the functional link between Yaf9 and Asf1, promoters reported to contain H3K56ac (Rufiange et al., 2007) preferentially lost H2A.Z in the yaf9-3 mutant (p-value < 10-8).  Acetylation of H2A.Z on K14 is catalyzed, at least in part, by NuA4 following H2A.Z deposition into chromatin (Babiarz et al., 2006; Keogh et al., 2006; Millar et al., 2006). Yaf9 is required for H2A.Z acetylation in vivo, however, it is not known whether this dependency solely reflects Yaf9’s contribution to SWR1-C, or Yaf9’s contribution to NuA4 function, or both (Keogh et al., 2006). To determine the role of the Yaf9 YEATS domain in H2A.Z acetylation, we used the chromatin-associated H2A.Z fraction that remained in each yaf9 mutant strain (Figure 2.9A) and measured acetylation at K14. This approach allowed for the evaluation of NuA4-dependent activities of Yaf9 mutants uncoupled from their H2A.Z deposition effects. Strains carrying yaf9 alleles in the charged surface region (yaf9-4) or in the conserved cleft (yaf9-1, yaf9-3, yaf9-23, yaf9-27, yaf9-28, and yaf9-34) exhibited reduced H2A.Z K14 acetylation, similar to that of yaf9∆ strains (Figure 2.10).  62  A  YAF9 vector yaf9-1 (B) yaf9-4 (A) W S C W S C W S C W S C  yaf9-3 (B) yaf9-34 (B) yaf9-18 (C) yaf9-22 (C) W S C W S C W S C W S C  H2A.Z -FLAG H2A PGK yaf9-26 (B) yaf9-33 (B) yaf9-30 (B) yaf9-27 (B) W S C W S C W S C W S C  yaf9-28 (B) yaf9-23 (B) W S C W S C  H2A.Z -FLAG  W S C  H2A  Whole Cell Extract Supernatant Chromatin Pellet  PGK  B Relative occupancy  H2A.Z in YAF9 H2A.Z in yaf9-3  C  Relative occupancy  Position  Number of H2A.Z enriched promoters (x1000)  3 YAF9 2928  2 yaf9-3 1724 1 yaf9-1/ yaf9∆  0  Position  Figure 2.9 Yaf9 YEATS domain is required for H2A.Z chromatin deposition (A) Yaf9 YEATS domain mutant strains had decreased H2A.Z-FLAG chromatin deposition. W = whole cell extract, S = supernatant, C = chromatin pellet. The relative amount of H2A.Z-FLAG in each fraction was determined by immunoblotting in the different strains. Antibodies against histone H3 and Pgk1 were used as loading controls for chromatin pellet and supernatant, respectively. (B) ChIP-on-chip profiles of H2A.Z in YAF9 and yaf9-3 strains. Sample genomic positions for chromosomes 4 and 8 were plotted along the x-axis against the relative occupancy of H2A.Z on the y-axis. ORFs are indicated as light grey rectangles above the xaxis for Watson genes and below the x-axis for Crick genes. ARS are indicated as dark grey rectangles. Regions considered enriched above a certain threshold are shown as colored bars on the x-axis. (C) Mutation in Yaf9 YEATS domain resulted in loss of H2A.Z at specific promoters. Shown is the number of H2A.Z enriched promoters determined by ChIP-on-Chip in YAF9 and yaf9-3 strains. Both yaf9∆ and yaf9-1 strains had low immunoprecipitation efficiency resulting in no detection of H2A.Z enriched regions above background level.  63  yaf9-18 (C)  yaf9-22 (C)  yaf9-23 (B)  yaf9-28 (B)  yaf9-27 (B)  yaf9-34 (B)  yaf9-3 (B)  yaf9-4 (A)  yaf9-1 (B)  vector  YAF9 H2A.Z K14ac H2A.Z-Flag  H4 Figure 2.10 Yaf9 YEATS domain is required for H2A.Z chromatin acetylation Mutations in the Yaf9 YEATS domain resulted in decreased H2A.Z K14ac in chromatin. Chromatin extracts from the bulk chromatin association assays shown in A were immunoblotted with an antibody against H2A.Z K14ac. Antibodies against Flag and H4 were used as loading controls.  2.4 Discussion YEATS domain proteins are found in many protein complexes involved in chromatin biology and are linked to cancers in humans. Despite these intriguing connections, little is known about the specific functions of YEATS domains, or their interaction partners and structure. Here, we demonstrate that there is a functional conservation between the YEATS domain of yeast Yaf9 and human GAS41. The extent of incorporation of the YEATS domain hybrid proteins into SWR1-C and NuA4 closely paralleled their ability to function in place of Yaf9. Furthermore, these results confirmed earlier findings that the coiled-coil of Yaf9 is required for interactions with NuA4 (Zhang et al., 2004), and extended these findings to define the coiled-coil region to also be important for Yaf9 to associate with SWR1-C. Likewise, the GAS41 coiled-coil is required for interaction with the human TIP60 and SRCAP complexes (Park and Roeder, 2006). The ability of the human GAS41 YEATS domain to complement in yeast showed that YEATS domain function was evolutionary conserved and implied that its structure was very similar.  64  The first structure of a YEATS domain reported here revealed that this domain in Yaf9 consisted of an Ig fold with 3 distinct conserved surface features, of which at least 2 were important for function. The strong defects in H2A.Z chromatin deposition caused by mutations in Yaf9 established that the YEATS domain was required for the proper activity of SWR1-C. Promoter-specific measurements of H2A.Z occupancy in two yaf9 mutants suggested that different amino acid changes in the YEATS domain had distinct effects on H2A.Z deposition. The phenotypically moderate yaf9-3 mutant surprisingly lost H2A.Z at a particular set of promoters, while retaining normal levels at the remaining promoters. This contrasted with the more severe yaf9-1 mutant that completely lost H2A.Z at all promoters, similar to the yaf9Δ. Furthermore, the YEATS domain was important for H2A.Z K14ac by NuA4 in chromatin, which most likely occurs after H2A.Z has been deposited by SWR1-C (Babiarz et al., 2006; Keogh et al., 2006). A common function of Yaf9 as part of the module of subunits shared between SWR1-C and NuA4 (Yaf9, Swc4, Arp4 and Act1) was consistent with recent data suggesting that this module has similar roles in both complexes (Wu et al., 2008).  From a conceptual viewpoint, the results from the mutant analysis aimed at determining the functional relevance of the 3 conserved YEATS domain features were counter-intuitive. A priori, one might assume that a protein such as Yaf9, which must function in two different complexes, would be even more constrained than a protein that acts on its own or in only one complex and hence might be more vulnerable to mutation. However, of the 33 mutant alleles that we constructed, 26 had no discernable phenotype despite the 40 mutated amino acids among these 26 mutants. Indeed, no phenotype was observed from single amino acid  65  substitutions even though these were conserved residues. This was an unexpectedly low frequency of phenotypes, especially considering the functional conservation of the YEATS domain from yeast Yaf9 to human GAS41 reported here. Of the seven mutants with phenotypes, four exhibited reduced protein levels (yaf9-4, yaf9-23, yaf9-27 and yaf9-28), and three (yaf9-1, as well as yaf9-3 and yaf9-34; differing by the I94M substitution) had normal protein levels. These results had practical significance for forward genetic studies suggesting that even for non-essential subunits of protein complexes like SWR1-C, discovering their function from mutant screens could be unexpectedly difficult.  Given the lack of amino acid sequence similarity, it was unexpected to discover that the Yaf9 YEATS domain was a structural homolog of the histone chaperone Asf1. Similar to Asf1, Yaf9 bound to histones H3-H4 in vitro. The enhanced growth defect of the yaf9Δ asf1Δ mutant indicated an involvement of Yaf9 and Asf1 in a similar process. More precisely, we determined that loss of Asf1-dependent H3K56 acetylation caused enhanced growth defects in the absence of either Yaf9 or H2A.Z, but had no effect in the absence of H2A.Z acetylation. This suggested that it was primarilyYaf9’s SWR1-C dependent role in H2A.Z deposition and not its role in NuA4-mediated H2A.Z acetylation that was affected by loss of Asf1. The lack of interaction with the N-terminal lysines of H2A.Z contrasts with the previously reported requirement for Asf1 and H3K56 acetylation in cells with mutations in the N-terminal lysines of H3 or H4 (Li et al., 2008).  The similar process that Asf1 and Yaf9 ordinarily facilitate might be reflected in our finding that three yaf9 alleles with lower protein levels had greater growth retardation than the  66  yaf9∆asf1∆ strain with empty vector. It would appear that the three mutant proteins interfered with whatever process Asf1 and Yaf9 converge on. A possible explanation may involve nucleosome assembly and disassembly by Asf1, presumably through its ability to bind to H3-H4 dimer intermediates (Li et al., 2008; Williams et al., 2008). SWR1-C performs a conceptually similar function, disassembling H2A-H2B dimers from nucleosomes and reassembling them with H2A.Z-H2B dimers (5). Perhaps in the absence of Asf1, SWR1C promotes a more extensive dismantling and reassembly of nucleosomes in a Yaf9dependent way. If so, the paradoxical phenotype of yaf9-4, yaf9-23 and yaf9-28 being more defective than yaf9∆ in cells lacking Asf1 might reflect their competence in only the disassembly reaction, leaving chromatin in a more compromised state than if Yaf9 were completely absent.  We note that histone binding might be a common feature of YEATS domains since human ENL, through its YEATS domain, specifically binds to histones H3 and H1, without having affinity for H4, H2A and H2B (Zeisig et al., 2005). However, our data suggested that additional relevant targets must exist to facilitate YEATS domain-dependent activities, at least in the case of Yaf9, because mutations in the YEATS domain of Yaf9 that affected H2A.Z chromatin deposition still bound to histones H3 and H4 (Figure 2.11). This eliminates a simple model by which diminished interaction of Yaf9 with H3 or H4 results in loss of Yaf9-dependent H2A.Z chromatin deposition, and raises the need for more detailed binding studies.  67  In summary, this study for the first time established the structure of the YEATS domain, its evolutionary conservation, a close structural and functional relationship with Asf1, as well as a differential requirement of the Yaf9 YEATS domain for H2A.Z deposition at specific  GST-Yaf9-23 (B)  GST-Yaf9-22 (C)  GST-Yaf9-3 (B)  GST-Yaf9-4 (A)  GST-Yaf9-1 (B)  GST-Yaf9  GST  sup  genes.  H3 H2B  H4  Figure 2.11 Yaf9 YEATS domain mutants bind to histones H3 and H4 in vitro Yaf9 mutants interacted with histones H3 and H4 in vitro. Calf thymus histones were bound to the indicated amounts of purified GST or GST-Yaf9 carrying the yaf9-1, yaf9-4, yaf9-3, yaf9-22 and yaf9-23 alleles.  68  Chapter 3: Key Functional Regions in the Histone Variant H2A.Z C-Terminal Docking Domain2  3.1 Introduction At its most basic level, the eukaryotic genome is organized as chromatin, which consists of repeating nucleoprotein moieties called nucleosomes. An individual nucleosome is formed from 146bp of DNA wrapped around an octameric histone core containing two copies of each H2A, H2B, H3 and H4. Several fundamental mechanisms can alter the chromatin structure, including ATP-dependent chromatin remodeling (Eberharter and Becker, 2004), posttranslational modifications of histones (Gelato and Fischle, 2008), and the replacement of canonical histones with non-allelic histone variants that change the protein composition of nucleosomes (Henikoff and Ahmad, 2005). Whereas canonical histones are deposited into chromatin during DNA replication, histone variants often are deposited in a replicationindependent manner by a class of specialized deposition complexes to specific locations in the genome in a non-random fashion (Jin et al., 2005).  One such histone variant, H2A.Z, is conserved from yeast to human and replaces the canonical H2A in 5-10% of nucleosomes (Zlatanova and Thakar, 2008). H2A.Z has roles in regulation of gene expression, maintenance of heterochromatin-euchromatin boundaries, 2  This chapter is published in Molecular and Cellular Biology. Wang AY, Aristizabal M, Ryan C, Krogan NJ, Kobor MS. (2011). Key functional regions in the histone variant H2A.Z docking domain. MCB. 18, 3871-84. See Preface on page iv for details of my contributions.  69  DNA repair, chromosome segregation and resistance to genotoxic stress (Zlatanova and Thakar, 2008). In the budding yeast Saccharomyces cerevisiae, H2A.Z is encoded by the non-essential HTZ1 gene, which greatly facilitates the functional analysis of this histone variant. For example, the slow growth phenotype and drug sensitivity of htz1Δ yeast cells cannot be rescued by overexpression of canonical H2A, suggesting that the variant has specialized and non-redundant functions in the cell (Jackson and Gorovsky, 2000). The latter may be attributed to the distinct location of H2A.Z in gene promoters and subtelomeric regions, catalyzed by the conserved ATP-dependent chromatin-remodeling complex SWR1C (Albert et al., 2007; Guillemette et al., 2005; Kobor et al., 2004; Krogan et al., 2003; Li et al., 2005; Mizuguchi et al., 2004; Raisner et al., 2005; Zhang et al., 2005). SWR1-C can replace canonical H2A-H2B dimers with H2A.Z-H2B in a step-wise manner in vitro, and is required for H2A.Z chromatin deposition in vivo (Luk et al., 2010; Mizuguchi et al., 2004). In addition to SWR1-C, the histone chaperones Chz1 and Nap1 are closely linked to H2A.Z biology. While these two histone chaperones are functionally redundant in aiding the deposition of H2A.Z-H2B into chromatin in vitro (Luk et al., 2007), they have different binding affinities with Nap1 capable of binding both H2A-H2B and H2A.Z-H2B dimers (Park et al., 2005) and Chz1 having specificity for H2A.Z-H2B (Luk et al., 2007).  On the amino acid sequence level, H2A.Z shares 60% sequence identity with its canonical cousin, and the three-dimensional structure of an H2A.Z-containing nucleosome is overall similar to the H2A nucleosome (Suto et al., 2000). Similar to H2A, H2A.Z molecules are engaged in multiple protein-protein and protein-DNA interactions within the nucleosome, with the points of contact being distributed across the length of the protein (Luger et al.,  70  1997; Suto et al., 2000). However, there are subtle differences in specific regions between the structures of the two nucleosomes that might explain their functional differences. One of these is the L1 loop, a region where the two H2A.Z molecules in the nucleosome interact with each other. Another main structural divergence resides in the C-terminal “docking domain”, a region having less than 40% amino acid identity with H2A which constitutes an interaction surface with H3/H4, and likely provides a binding platform for nucleosome remodeling activities (Suto et al., 2000). Further supporting the possibility that this region is a major determinant of H2A.Z’s identity, amino acids around the αC helix in the docking domain form the M6 region (Fig. 1A) (Suto et al., 2000), which is essential for H2A.Z function as swapping it with its counterpart from H2A results in embryonic lethality of Drosophila melanogaster (Clarkson et al., 1999). A similar M6 swap mutant in budding yeast has decreased binding to SWR1-C and causes cellular sensitivity to formamide (Wu et al., 2005). When it replaces the corresponding region in the canonical histone, the H2A.Z docking domain can confer H2A.Z-like abilities to H2A by supporting induction of the GAL1 gene (Adam et al., 2001), further suggesting that this region is critical to the function of H2A.Z. The C-terminus of H2A.Z is also modified, as K126 and K133 are sites of sumoylation, with this modified form being associated with DNA double stranded breaks and DNA repair (Kalocsay et al., 2009). In contrast, canonical H2A in yeast has a SQEL motif at its very C-terminus, which similar to mammalian H2A.X, is phosphorylated upon DNA damage (Downs et al., 2000). Lastly, the docking domain also includes acidic surface residues that are part of an extended acidic patch, which may be important for contacting either the N-terminal tail of H4 from a neighboring nucleosome or non-histone proteins (Suto et al., 2000). This acidic patch is required for H2A.Z to promote higher order chromatin  71  folding in higher eukaryotes (Fan et al., 2004), and specific mutations in the acidic patch result in sensitivity to genotoxic stress (Jensen et al., 2011).  Here, we further explore two critical questions concerning H2A.Z biology. Specifically, the identification of regions required for H2A.Z function, and the determination of regions that distinguish H2A.Z from its canonical counterpart H2A. Although different functions have been attributed to the C-terminus of H2A.Z, the necessity of the docking domain has not been extensively studied with regard to H2A.Z binding to chromatin, cellular functions and genetic interactions. A recent comprehensive alanine scan of yeast H2A.Z identified relatively few residues that resulted in sensitivity to genotoxic stressors (Kawano et al., 2011). Pointing towards an important contribution of the C-terminus for H2A histone family function, a recently published deletion analysis of human H2A identified its C-terminus as being required for nucleosome stability, chromatin remodeling and binding to histone H1 (Vogler et al., 2010). Thus, to better understand the docking domain of H2A.Z in yeast, we created truncation mutants of its C-terminus. Using Epistatic Miniarray Profile (E-MAP) (Schuldiner et al., 2006) analyses of H2A.Z truncation alleles, we revealed nuanced requirements for the H2A.Z C-terminus and demonstrated the effectiveness of this method in identifying differential sensitivities of genetic interaction profiles. Furthermore, we determined that the last 20 amino acids in the C-terminus distal to amino acid 114 were critical for H2A.Z functions in resistance to genotoxic stress, restriction of heterochromatin at several loci in their native context, and GAL1 gene activation, but not for retaining the ability to bind SWR1-C, H2B and Chz1. However, this region was not unique to H2A.Z as it could be replaced by the corresponding region in H2A. Consistent with this region being  72  required for chromatin anchoring, it contained three important amino acids that facilitated H2A.Z residence in nucleosomes and associated functions, as well as H2A function in vivo.  3.2 Materials and Methods  3.2.1  Yeast strains, plasmids, and yeast techniques  All strains used in this study are listed in Table 3.1 and were created using standard yeast genetic techniques (Ausubel, 1987a). Complete and partial deletion of genes and integration of a VSV tag (Funakoshi and Hochstrasser, 2009) or 3xFLAG tag (Gelbart et al., 2001) in frame at the 3´ end of genes were achieved using the one-step gene integration of PCRamplified modules (Longtine et al., 1998).  Table 3.1 Yeast strains used in this study  Stain  Relevant Genotype  MKY5 MKY357 MKY1133 MKY1134 MKY1135 MKY1136 MKY1137 MKY1138 MKY1139 MKY1140 MKY1141 MKY1142 MKY1143 MKY1144 MKY1145 MKY1146 MKY1147 MKY1148  W303, MATα ade2-1 can1-100 his3-11 leu2-3,112 trp1-1 ura3-1 LYS2 MKY5, htz1∆::NATMX MKY5, H2A.Z (1-134)-3xFLAG::NATMX MKY5, H2A.Z (1-131)-3xFLAG::NATMX MKY5, H2A.Z (1-128)-3xFLAG::NATMX MKY5, H2A.Z (1-124)-3xFLAG::NATMX MKY5, H2A.Z (1-120)-3xFLAG::NATMX MKY5, H2A.Z (1-117)-3xFLAG::NATMX MKY5, H2A.Z (1-114)-3xFLAG::NATMX MKY5, H2A.Z (1-111)-3xFLAG::NATMX MKY5, H2A.Z (1-108)-3xFLAG::NATMX MKY5, H2A.Z (1-106)-3xFLAG::NATMX MKY5, H2A.Z (1-104)-3xFLAG::NATMX MKY5, htz1∆::HYGMX MKY5, SWC2-VSV::KANMX MKY5, H2A.Z (1-134)-3xFLAG::NATMX SWC2-VSV::KANMX MKY5, H2A.Z (1-124)-3xFLAG::NATMX SWC2-VSV::KANMX MKY5, H2A.Z (1-117)-3xFLAG::NATMX SWC2-VSV::KANMX 73  Stain  Relevant Genotype  MKY1149 MKY1150 MKY1151 MKY1152 MKY1153 MKY1154 MKY1155 MKY1156 MKY1157 MKY1158 MKY1159 MKY1160 MKY1161 MKY1162 MKY1163 MKY1164 MKY1165 MKY1166 MKY1167 MKY1168 MKY1169 MKY1170 MKY1171 MKY1172 MKY1173 MKY1174 MKY1175 MKY1176 MKY1177 MKY1178 MKY1179 MKY1180 MKY1181 MKY1182 MKY1183 MKY1184 MKY1185 MKY1186 MKY1187  MKY5, H2A.Z (1-114)-3xFLAG::NATMX SWC2-VSV::KANMX MKY5, H2A.Z (1-108)-3xFLAG::NATMX SWC2-VSV::KANMX MKY5, H2A.Z (1-106)-3xFLAG::NATMX SWC2-VSV::KANMX MKY5, H2A.Z (1-104)-3xFLAG::NATMX SWC2-VSV::KANMX MKY5, SWC3-VSV::KANMX MKY5, H2A.Z (1-134)-3xFLAG::NATMX SWC3-VSV::KANMX MKY5, H2A.Z (1-124)-3xFLAG::NATMX SWC3-VSV::KANMX MKY5, H2A.Z (1-117)-3xFLAG::NATMX SWC3-VSV::KANMX MKY5, H2A.Z (1-114)-3xFLAG::NATMX SWC3-VSV::KANMX MKY5, H2A.Z (1-108)-3xFLAG::NATMX SWC3-VSV::KANMX MKY5, H2A.Z (1-106)-3xFLAG::NATMX SWC3-VSV::KANMX MKY5, H2A.Z (1-104)-3xFLAG::NATMX SWC3-VSV::KANMX MKY5, SWC4-VSV::KANMX MKY5, H2A.Z (1-134)-3xFLAG::NATMX SWC4-VSV::KANMX MKY5, H2A.Z (1-124)-3xFLAG::NATMX SWC4-VSV::KANMX MKY5, H2A.Z (1-117)-3xFLAG::NATMX SWC4-VSV::KANMX MKY5, H2A.Z (1-114)-3xFLAG::NATMX SWC4-VSV::KANMX MKY5, H2A.Z (1-108)-3xFLAG::NATMX SWC4-VSV::KANMX MKY5, H2A.Z (1-106)-3xFLAG::NATMX SWC4-VSV::KANMX MKY5, H2A.Z (1-104)-3xFLAG::NATMX SWC4-VSV::KANMX MKY5, ARP4-VSV::KANMX MKY5, H2A.Z (1-134)-3xFLAG::NATMX ARP4-VSV::KANMX MKY5, H2A.Z (1-124)-3xFLAG::NATMX ARP4-VSV::KANMX MKY5, H2A.Z (1-117)-3xFLAG::NATMX ARP4-VSV::KANMX MKY5, H2A.Z (1-114)-3xFLAG::NATMX ARP4-VSV::KANMX MKY5, H2A.Z (1-108)-3xFLAG::NATMX ARP4-VSV::KAN MKY5, H2A.Z (1-106)-3xFLAG::NATMX ARP4-VSV::KANMX MKY5, H2A.Z (1-104)-3xFLAG::NATMX ARP4-VSV::KANMX MKY5, CHZ1-VSV::KANMX MKY5, H2A.Z (1-134)-3xFLAG::NATMX CHZ1-VSV::KANMX MKY5, H2A.Z (1-124)-3xFLAG::NATMX CHZ1-VSV::KANMX MKY5, H2A.Z (1-117)-3xFLAG::NATMX CHZ1-VSV::KANMX MKY5, H2A.Z (1-114)-3xFLAG::NATMX CHZ1-VSV::KANMX MKY5, H2A.Z (1-108)-3xFLAG::NATMX CHZ1-VSV::KANMX MKY5, H2A.Z (1-106)-3xFLAG::NATMX CHZ1-VSV::KANMX MKY5, H2A.Z (1-104)-3xFLAG::NATMX CHZ1-VSV::KANMX MKY1144, [pRS314] MKY1144, [pRS314 HTZ1] MKY1144, [pRS314 HTZ1-3xFLAG::KANMX]  74  All plasmids used in this study are listed in Table 3.2 and created using standard molecular biology techniques. The parental HTZ1 pRS314 plasmid (Babiarz et al., 2006) was used for subsequent manipulations including site-directed mutagenesis and construction of the HTA1 and ZA hybrid. The HTA1-FLAG vector was created by amplification of the entire HTA1 gene using primers containing overhangs that anneal to the promoter region of HTZ1 and the beginning of the 3×FLAG. This double stranded product was gel-purified and used as primers in a site-directed mutagenesis reaction with the HTZ1-FLAG vector as template using the QuickChange method (Stratagene) following the protocol of the manufacturer (primers used are available upon request). All mutations were confirmed by DNA sequencing. The hybrid vector ZA was created in a similar manner, except the amplified region of HTA1 corresponded to the last 20 amino acids in H2A.Z. Mutations in specific amino acids of HTZ1 and HTA1 were also generated by site-directed mutagenesis (primers available upon request).  Table 3.2 Plasmids used in this study  Plasmid pMK148 pMK149 pMK418 pMK420 pMK509 pMK400 pMK429 pMK510 pMK511 pMK513  Relevant Genotype pRS314, HTZ1 pRS314, HTZ1-3xFLAG::KANMX pRS314, HTA1-3xFLAG::KANMX pRS314, ZA-3xFLAG::KANMX pRS314, htz1-H118A,I119A,N120A-3xFLAG::KANMX pRS316, HTA1-HTB1 pRS413, HTA1-HTB1 pRS413, HTA1-3FLAG-HTB1 pRS413, hta1-N112A-3xFLAG-HTB1 pRS413, hta1-H114A-3xFLAG-HTB1  75  Reference/source 4 This study This study This study This study 39 39 This study This study This study  MKY985 has chromosomal deletions of the HTA-HTB genes (hta1htb1Δ::NAT hta2htb2Δ::HYG) that is complemented by the plasmid pMK400 (Moore et al., 2007) containing genomic HTA1-HTB1 on the URA CEN/ARS plasmid pRS316. The plasmid shuffle experiments were performed by transformation of MKY985 with HTA1-HTB1, HTA1-FLAG-HTB1 or various hta1 mutant genes on plasmids containing a HIS3-selective marker (pRS413) (Moore et al., 2007) and subsequent counterselection of the URA3 marker on SC plates containing 5-fluoroorotic acid (5-FOA) (Sikorski and Boeke, 1991). To determine the expression level of the truncated H2A.Z proteins, yeast whole cell extracts were prepared using the NaOH extraction protocol as previously described (Kushnirov, 2000). Immunoblotting was performed using anti-FLAG M2 (Sigma) and anti-H2A (Upstate) antibodies.  3.2.2  Analytical-scale affinity purifications  Co-immunoprecipitation assays were performed as described previously (Kobor et al., 2004). Briefly, yeast cells were harvested, and lysed in IP Buffer (50 mM Tris [pH 7.8], 150mM NaCl, 1.5mM MgAc, 0.15% NP-40, 1mM DTT, 10mM NaPPi, 5mM EGTA, 5mM EDTA, 0.1 mM Na3VO4, 5mM NaF, CompleteTM Protease inhibitor cocktail) using acid-washed glass beads and mechanically disrupting using a bead beater (BioSpec Products, Bartlesville, Oklahoma, United States). FLAG-tagged fusion proteins were captured using FLAG M2 agarose beads (Sigma), and subsequently washed in IP buffer. Captured material was analyzed by immunoblotting and co-purifying proteins were detected with anti-VSV (Applied Biological Materials), anti-Nap1 (Santa Cruz Biotechnology), and anti-H2B  76  (Upstate) antibodies. Bands were visualized using the Odyssey Infrared Imaging System (Licor).  3.2.3  Chromatin association assays  Chromatin association assays were performed as previously described (Wang et al., 2009). Briefly, yeast cells were incubated in Pre-Spheroplast Buffer (100mM PIPES/KOH [pH 9.4], 10mM DTT, 0.1% sodium azide) for 10 min at room temperature, and spheroplasted with 20 mg/ml Zymolyase-100T (Seikagaku Corporation) in Spheroplast Buffer (50mM KPO4 [pH 7.5], 0.6 M Sorbitol, 10mM DTT) at 37°C for 15 min. Spheroplasts were washed with Wash Buffer (50mM HEPES/KOH [pH 7.5], 100mM KCl, 2.5mM MgCl2, 0.4M sorbitol), resuspended in equal volume of EB (50mM HEPES/KOH [pH 7.5], 100mM KCl, 2.5mM MgCl2, 1mM DTT, 1mM PMSF, and protease inhibitor cocktail), and lysed with 1% Triton X-100. Whole cell extract (WCE) was saved, and the remaining lysate was separated into chromatin pellet (Pellet) and supernatant (SUP) fractions by centrifugation through EBSX (EB+ 0.25% Triton X-100 and 30% sucrose). WCE, Pellet, and SUP were subjected to SDSPAGE and immunoblotted with anti-FLAG M2 (Sigma), anti-H2A (Upstate) and anti-Pgk1 (Sigma) antibodies. Immunoblots were scanned with the Odyssey Infrared Imaging System (Licor).  3.2.4  Yeast cultures  Yeast cultures for GAL1 induction were performed as previously described (Halley et al., 2010). Briefly, seed cultures were grown in YP-Dextrose (D-glucose, 2%) overnight with shaking at 30°C. 40 OD600 units of cells were harvested by centrifugation at 3000rpm,  77  washed with sterile water and resuspended in 200ml of YP-galactose (2% galactose). The volume of culture removed for each time point was replaced with the same volume of YPgalactose.  3.2.5  RT-PCR  Cells were grown in YPD to an OD600 of 0.5. 10 OD600 units of cells were harvested for RNA extraction and purification using the Qiagen RNeasy Mini Kit as per the manufacturer protocol. RNA was digested with RNase-free DNase I (Qiagen). cDNA was synthesized using SuperScript III First-Strand Synthesis System for RT–PCR and oligo(dT) (Invitrogen). cDNA was analyzed using a Rotor-Gene 6000 (Corbett Research) and PerfeCTa SYBR Green FastMix (Quanta Biosciences). mRNA levels were normalized to ACT1 mRNA. Samples were analyzed in triplicate for three independent RNA preparations. Primer sequences are listed in Table 3.3.  3.2.6  ChIP  ChIP experiments were performed as described previously (Schulze et al., 2009a). In brief, yeast cells (500 ml) were grown in a rich medium to an OD600 of 0.5-0.6 and were crosslinked with 1% formaldehyde for 20 min before chromatin was extracted. The chromatin was sonicated (Bioruptor, Diagenode; Sparta, NJ: 10 cycles, 30 s on/off, high setting) to yield an average DNA fragment of 500 bp. Anti-FLAG antibody (Sigma, 4 µl) were coupled to 60 µl of protein A magnetic beads (Invitrogen). After reversal of the crosslinking and DNA purification, the immunoprecipitated and input DNA were analyzed  78  by qPCR. Samples were analyzed in triplicate for at three independent ChIP experiments. Primer sequences are listed in Table 3.3.  Table 3.3 ChIP-qPCR and RT-qPCR primers  Primer name PRP8-ChIP GIT1-ChIP  Forward sequence  Reverse sequence  GGATGTATCCAGAGGCCAAT TTCATGAATTTCCTTACTGGAC  AACCCGCGTATTAAGCCATA GTTGACTAGTCACAAGAAACA G TGCGCTAGAATTGAACTCAGGT AC CCGGCCAAATCGATTCTCAA TTACCAGTCCAGCCATTGG TCATATAGACAGCTGCCCAATG CTG  GAL1-ChIP GGGTAATTAATCAGCGAAGCGA TG ACT1-RT TGTCCTTGTACTCTTCCGGT GIT1-RT ATCGGTTCTGTAGTAGGCG GAL1-RT GGTGGTTGTACTGTTCACTTGGT TCC 3.2.7  E-MAP  E-MAP screens were performed as described previously (Schuldiner et al., 2006). Briefly HTZ1 truncation alleles were crossed using a Singer Robot to a library of 1536 mutants covering a number of processes including RNA processing and chromatin biology. All strains were screened three to four times and scores were calculated as previously described (Collins et al., 2010; Schuldiner et al., 2006).  3.3 Results  3.3.1  The C-terminus of H2A.Z is required for its function  To more closely dissect the requirements of the docking domain for H2A.Z function in yeast, we constructed a set of HTZ1 truncation alleles encoding successively shortened versions of H2A.Z distal to the C-terminal α-helix containing the M6 region (Figure 3.1A). To facilitate 79  functional and biochemical analyses, the alleles were generated through insertion of a 3×FLAG epitope tag followed by a stop codon. For simplicity, we omit writing out the 3xFLAG tag in all subsequent descriptions of H2A.Z truncations and mutations. We first tested the ability of the truncation alleles to confer resistance to genotoxic stress, as cells lacking H2A.Z are sensitive to genotoxic stressors such as formamide, caffeine, and hydroxyurea (HU) (Jackson and Gorovsky, 2000; Kobor et al., 2004). Yeast cells containing the full length H2A.Z (1-134) and the longer truncations had normal growth comparable to wild-type cells (Fig. 1B). The short truncations up to and including H2A.Z (1-114) exhibited retarded growth on all three drugs, similar to the htz1Δ mutant (Figure 3.1B). Cells containing H2A.Z (1-120) and H2A.Z (1-117) had noticeable growth defects on all three drugs, suggesting that the effects these two truncations had on H2A.Z function were intermediate in nature. The growth defects observed for the H2A.Z truncations were not due to lower expression levels as all FLAG-tagged proteins were expressed similar to wild-type levels except for a slight decrease in H2A.Z (1-104) (Figure 3.1C). Furthermore, the same phenotypic pattern of drug sensitivity was observed in the S288c strain background, suggesting that it was a general feature rather than one specific to the W303 strain background (data not shown).  80  A  Docking Domain  M6 αN  B  α1  α2  YPD  α3  2% Formamide  αC 104  114  3mM Caffeine  120  134  100m M HU  WT  H2A.Z (1-134) htz1∆ H2A.Z (1-131) H2A.Z (1-128) H2A.Z (1-124) H2A.Z (1-120) H2A.Z (1-117) H2A.Z (1-134) htz1∆ H2A.Z (1-114) H2A.Z (1-111) H2A.Z (1-108) H2A.Z (1-106)  (1 -1 H 34 2A ) .Z (1 H 2A -13 1) .Z (1 H 2A -12 8) .Z (1 H 12 2A 4) .Z ( 1 H 12 2A 0) .Z ( 1 H 2A - 11 7) .Z (1 H 2A - 11 4) .Z (1 H 2A - 11 1) .Z (1 H 10 2A 8) .Z ( 1 H 1 2A 06 .Z ) (1 -1 04 )  H2A.Z (1-104)  H 2A .Z  C FLAG H2A  Figure 3.1 The C-terminus of H2A.Z is required for its function (A) Schematic representation of the H2A.Z protein indicating the positions of the alpha helices, the M6 domain (5) and the docking domain (49). The important C-terminal positions from which H2A.Z was truncated in this study are also shown. (B) The H2A.Z C-terminus was required for its resistance to genotoxic stress. Ten-fold serial dilutions of strains containing the indicated H2A.Z truncations with C-terminal 3×FLAG tags were plated and incubated on YPD media containing the indicated concentrations of formamide, caffeine, and HU. (C) FLAG-tagged H2A.Z truncations were expressed to wild-type levels except for a slight decrease in H2A.Z (1104). Protein expression levels as analyzed by immunoblotting of whole cell extracts of the indicated strains with an anti-FLAG antibody. Antibody against histone H2A was used as loading control.  81  3.3.2  Genetic dissection of HTZ1 truncation alleles reveal distinct requirements for  the C-terminus in H2A.Z function To extend our analysis of the H2A.Z C-terminus, we adapted the Epistatic Miniarray Profile (E-MAP) approach (Collins et al., 2010; Schuldiner et al., 2006) to determine requirements of the H2A.Z C-terminal region for cell growth when additional genes were compromised. To quantitatively analyze global genetic interaction patterns, query strains containing sequentially shorter HTZ1 truncation alleles generated by placing a TAG stop codon followed by a NAT resistance marker at the appropriate open reading frame (ORF) location were analyzed using a library of 1536 mutants representing various processes including chromatin biology and RNA processing (Collins et al., 2010; Schuldiner et al., 2006). To control for effects of the truncation strategy, we included two additional alleles, H2A.Z (1134) and H2A.Z (1-134-200bp), which respectively contain the NAT marker immediately adjacent to the natural stop codon or 200bp downstream. Comparing the genetic profiles of H2A.Z (1-134) and H2A.Z (1-134-200bp), we determined that integration of the NAT marker immediately following the ORF generated a “decreased abundance by mRNA perturbation” (DAmP)-like allele (Schuldiner et al., 2005), suggesting that the interactions observed in the E-MAP were a combination of loss of function due to the truncation and a decrease in mRNA stability. To evaluate the extent of the DAmP effect in our data we counted the number of interactions that have a magnitude of S>2 or S<-2.5 compared to H2A.Z (1-134) (Fiedler et al., 2009) (Figure 3.2A). This analysis revealed that only 23 interactions meet these criteria when compared to H2A.Z (1-134-200bp) suggesting that the DAmP effect in our data is minimal (Figure 3.2A). Conversely, the shorter truncations starting at H2A.Z (1-  82  117) have upwards of a hundred interactions, demonstrating that the influence of the truncations was much greater than that of the DAmP.  The E-MAP approach allowed us not only to identify specific interactions that were dependent on the H2A.Z C-terminus, but also to dissect the strength of a number of negative and positive genetic interactions. Several distinct interactions patterns were revealed. For example, loss of genes encoding the histone chaperone/H3K56 acetylase complex ASF1/RTT109/VPS75, the SAS silencing complex, and the H2A.Z-specific histone chaperone Chz1 had increasingly aggravating interactions as H2A.Z was shortened (Figure 3.2B). In contrast, loss of GAL80, the gene encoding the repressor of the Gal4 transcriptional activation domain (Johnston, 1987), had progressively alleviating interactions with the truncated alleles (Figure 3.2B). Representing a different pattern, genes encoding members of the COMPASS complex that is involved in transcription regulation had similar aggravating interactions regardless of H2A.Z length, suggesting that this interaction was not dependent on the C-terminus of H2A.Z and instead was highly sensitive to reduction in H2A.Z protein caused by the destabilization of its mRNA (Figure 3.2B).  83  AA  Number of Interac ons Significantly Different from H2A.Z (1-134) 500  Number of Interacions  450 400 350 300 250 200 150 100 50  SPP1  SDC1  BRE2  SPP1  BRE2  H2A.Z (1-53)  SDC1  SWD3  SWD3  SWD1  SWD1  GAL80 GAL80  CHZ1  CHZ1  ASF1  RTT109 RTT109 VPS75 VPS75  ASF1  SAS5  SAS4  SAS5  SAS4  B  SAS2  B  SAS2  0  H2A.Z (1-82) H2A.Z (1-88) H2A.Z (1-99) H2A.Z (1-53) H2A.Z (1-104) H2A.Z (1-82) H2A.Z (1-106) H2A.Z (1-88) H2A.Z (1-108) H2A.Z (1-99) H2A.Z (1-111)  H2A.Z (1-104)  H2A.Z (1-114)  H2A.Z (1-106)  H2A.Z (1-117)  H2A.Z (1-108)  H2A.Z (1-121)  H2A.Z (1-111)  H2A.Z (1-124)  H2A.Z (1-114)  H2A.Z (1-134)  H2A.Z (1-117) H2A.Z (1-134-200bp) SAS  COMPASS  3"""2"""1"""0"""&1"""&2"""&3  SAS  Alleviating  Aggravating COMPASS  H2A.Z (1-121) H2A.Z (1-124) H2A.Z (1-134) H2A.Z (1-134-200bp)  Figure 3.2 Genetic dissection of H2A.Z alleles reveal distinct requirements for the C-terminus 3 2 1truncation 0 -1 -2 -3 in H2A.Z function (A) Bar graph illustrating the number of genetic interactions that differ significantly from H2A.Z (1–134) with Alleviating Aggravating thresholds of S>2 or S<-2.5 (10). (B) Individual interaction profiles of H2A.Z truncation alleles with various complexes. The intensity of blue and yellow represents the strength of aggravating and alleviating interactions, respectively. Gray represents missing data. Note that the nomenclature indicates the H2A.Z protein truncated at Genetic the dissection of H2A.Z truncation alleles revealed distinct requirements for the C-terminus corresponding amino acids.  FIG. 2. in H2A.Z function. (A) Bar graph illustrating the number of genetic interactions that differ significantly from H2A.Z (1–134) thresholds of S>2 or S<-2.5 (10). (B) Individual interaction profiles of H2A.Z truncation alleles with various complexes. The intensity of blue and yellow represents the strength of aggravating and alleviating interact respectively. Gray represents missing data. Note that the nomenclature indicates the H2A.Z protein truncated at the corresponding amino acids. 84  3.3.3  The H2A.Z C-terminus is required for its role in heterochromatic boundary  function H2A.Z is required to restrict the spread of heterochromatin at boundaries with euchromatin (Meneghini et al., 2003). To test whether its C-terminus is important for this boundary function in a native context, we measured the expression of two ORFs near the left and right boundaries of the silent HMR locus on chromosome III (YCR095c and GIT1, respectively), as well as three ORFs in the sub-telomeric regions of chromosomes III (YCR100c and RDS1) (Figure 3.3A) and IX (YIR042c). In the absence of H2A.Z, the Sir protein complex spreads from either the HMR or telomere into the respective ORFs, causing decreased mRNA levels to be transcribed from these genes (Babiarz et al., 2006; Meneghini et al., 2003). At the boundaries of HMR and in sub-telomeric regions, cells containing htz1Δ, H2A.Z (1-114), and H2A.Z (1-104) had similar defects in boundary function as reflected by the reduction in mRNA expression of all genes tested compared with wild-type (Figure 3.3B). H2A.Z (1-120) was more variable in its effect on boundary function with GIT1, YCR095c and RDS1 mRNA expression levels showing intermediate reduction, whereas YCR100c and YIR042c mRNA expression was reduced to levels similar to htz1Δ. We next used chromatin immunoprecipitation (ChIP) followed by qPCR to determine if the decreased expression of these genes at the heterochromatin boundaries was due to loss of binding of H2A.Z truncations at the respective promoter regions. H2A.Z (1-114) and H2A.Z (1-104) were completely lost from all five promoters, while H2A.Z (1-120) enrichment was intermediate, decreasing by more than half as compared to wild-type (Figure 3.3C).  85  A  RDS1  HMRa YCR095c  B  GIT1  YCR100c  C  GIT1 Expression  GIT1 Expression  1.2  H2A.Z Enrichment at GIT1 Promoter  1.2  12  H2A.Z fold enrichment/ PRP8  GIT1/ACT1 mRN A levels GIT1/ACT1 mRN A levels  1.0  1.0  0.8  0.8  0.60.6 0.40.4 0.20.2  0 0 H2A.Z H2A.Z (no tag)  (no tag)  H2A.Z H2A.Z (1-134)  H2A.Z H2A.Z (1-120)  (1-134)  (1-120)  H2A.Z H2A.Z (1-114)  (1-114)  H2A.Z H2A.Z (1-104)  tz11ΔΔ hhtz  10  8 6  4 2 0  (1-104)  GIT1 Expression  0.40.4 0.20.2  00 H2A.Z (1-134)  H2A.Z (1-120)  H2A.Z (1-114)  H2A.Z (1-104)  h tz 1 Δ  PRP8  0.60.6  H2A.Z fold enrichment/  0.8  0.8  5  PRP8  1.0  1  7  35  H2A.Z fold enrichment/  1.2  H2A.Z (no tag)  H2A.Z (1-134)  H2A.Z (1-120)  H2A.Z (1-114)  H2A.Z (1-104)  H2A.Z Enrichment at YCR100c Promoter  1.2  GIT1/ACT1 mRN A levels  YCR100c/ACT1 mRN A levels  YCR100c Expression  H2A.Z (no tag)  25  6  4 3 2 1  0  H2A.Z (no tag)  H2A.Z (1-134)  H2A.Z (1-120)  H2A.Z (1-114)  H2A.Z (1-104)  GIT1 Expression  RDS1 Expression  1.2 RDS1/ACT1 mRN A levels GIT1/ACT1 mRN A levels  1 .2  1  0 .8  H2A.Z Enrichment at RDS1 Promoter  1.0  0.8 0.6  0 .6 0 .4 0 .2  0.4 0.2  0  0  H2A.Z (no tag)  H2A.Z (1-134)  H2A.Z (1-120)  H2A.Z (1-114)  H2A.Z (1-104)  h tz 1 Δ  30  20 15 10 5 0  H2A.Z (no tag)  H2A.Z (1-134)  H2A.Z (1-120)  H2A.Z (1-114)  H2A.Z (1-104)  GIT1 Expression  YCR095c Expression PRP8  H2A.Z Enrichment at YCR095c Promoter  1 . 21.0  40  H2A.Z fold enrichment/  YCR095c/ACT1 mRN A levels GIT1/ACT1 mRN A levels  1.2  30  1  0.8  0 .8  0.6  0 .6  0.4  0 .4  0.2  0 .2 0  0 H2A.Z (no tag)  H2A.Z (1-134)  H2A.Z (1-120)  H2A.Z (1-114)  H2A.Z (1-104)  h tz 1 Δ  35  25 20 15 10 5 0  H2A.Z (no tag)  H2A.Z (1-134)  H2A.Z (1-120)  H2A.Z (1-114)  H2A.Z (1-104)  Figure 3.3 The H2A.Z C-terminus is required for its role in heterochromatic boundary function (A) Schematic representation of the tested ORFs located at the boundaries of the HMR locus and telomere of chromosome III. Note that YIR042c is located at the telomere on the right arm of chromosome IX. (B) qRTPCR of the mRNA levels of indicated genes normalized to levels of ACT1. (C) ChIP analysis of H2A.Z enrichment at the indicated promoters normalized to the PRP8 ORF. Error bars represent standard deviations of values from three replicates.  86  3.3.4  The H2A.Z C-terminus is required for its role in transcriptional activation of  the GAL1 gene In addition to its role in restricting heterochromatin spread, H2A.Z has more direct roles in regulating gene expression. Among the best documented ones is the requirement for H2A.Z in GAL1 induction after shifting cells grown in long-term repressing conditions (glucose) to galactose medium. This requirement is mediated by H2A.Z-containing nucleosomes in the divergent GAL1/GAL10 promoter (Gligoris et al., 2007; Halley et al., 2010; Lemieux et al., 2008; Santisteban et al., 2000). To determine whether the C-terminus of H2A.Z facilitated GAL1 expression, mRNA levels were monitored at 2-hour intervals by quantitative reverse transcriptase (qRT)-PCR after shifting from long-term growth in glucose to galactosecontaining media. Similar to previous reports (Halley et al., 2010), the htz1Δ mutant induced GAL1 expression at a significantly slower rate than wild-type or H2A.Z (1-134) cells (Figure 3.4A). The GAL1 induction patterns of cells containing H2A.Z (1-114) and H2A.Z (1-104) were similar to that of the htz1Δ mutant whereas cells containing H2A.Z (1-120) had an intermediate phenotype with induction being faster than in htz1Δ mutants, but slower than in wild-type and H2A.Z (1-134) strains (Figure 3.4A). Consistent with the expression results, H2A.Z (1-114) and H2A.Z (1-104) were completely lost from the GAL1/10 promoter while the level of H2A.Z (1-120) was reduced by about one third compared to H2A.Z (1-134) (Figure 3.4B).  87  A  1.2  GAL1 /ACT1 mRNA levels  1.0  H2A.Z &(no&tag ) H2A.Z &(1/134) H2A.Z &(1/120) H2A.Z &(1/114) H2A.Z &(1/104) h tz1 ∆  0.8 0.6  0.4 0.2 0  0  120  240  360  480  Minutes of GAL1 induction  B  H2A.Z Enrichment at GAL1 Promoter H2A.Z fold enrichment/ PRP8  3.0 2.5 2.0  1.5 1.0 0.5 0  H2A.Z (no tag)  H2A.Z (1-134)  H2A.Z (1-120)  H2A.Z (1-114)  H2A.Z (1-104)  Figure 3.4 The H2A.Z C-terminus is required for its role in activation of the GAL1 gene (A) qRT-PCR of GAL1 mRNA performed on the indicated cultures that were grown long-term in YP-glucose (2%) prior to being transferred to YP-galactose (2%) and collected at 120-minute intervals. GAL1 mRNA levels were normalized to levels of ACT1. Solid lines represent the smoothed curves through the averages of three replicates. (B) ChIP analysis of H2A.Z enrichment at the GAL1/10 promoter under repressive YP-glucose (2%) conditions. Enrichment is normalized to the PRP8 ORF and error bars represent standard deviations of values from three replicates.  3.3.5  Loss of H2A.Z truncations from chromatin is SWR1- and H2B-independent  Having established that the H2A.Z C-terminus was required for binding to specific promoter regions, we tested whether this reflected a general inability of the truncated proteins to incorporate into chromatin. Cellular fractionation assays (Liang and Stillman, 1997) revealed that H2A.Z (1-134) was predominantly present in the chromatin fraction with low levels found in the non-chromatin fraction (Figure 3.5). In contrast, the short truncations including 88  H2A.Z (1-114) were completely lost from chromatin while H2A.Z (1-120) and H2A.Z (1117) were partially associated with chromatin (Figure 3.5). The bulk chromatin association assay thus recapitulated the findings from the gene-specific location analysis. The chromatin association of H2A and the non-chromatin association of Pgk1 were unchanged for all experiments (Figure 3.5).  H2A.Z (134) W  S  C  H2A.Z (124) W  S  C  H2A.Z (120) W  S  C  H2A.Z (117) W  S  C  FLAG  H2A  Pgk1  H2A.Z (114) W  S  C  H2A.Z (108) W  S  C  H2A.Z (106) W  S  C  H2A.Z (104) W  S  C  FLAG  H2A  Pgk1  W S C  Whole Cell Extract Supernatant Chromatin Pellet  Figure 3.5 H2A.Z truncations are lost from bulk chromatin Bulk fractionations were performed and the amount of H2A.Z-FLAG in each fraction was determined by immunoblotting in the different strains. W, whole cell extract; S, supernatant; C, chromatin pellet. Antibodies against histone H2A and Pgk1 were used as loading controls for chromatin pellet and supernatant, respectively.  We next set out to determine if the loss from chromatin of the short H2A.Z truncations was due to a loss of binding to known factors involved in H2A.Z biology, including the ATPdependent remodeler SWR1-C, and the histone chaperones Nap1 and Chz1. We performed analytical-scale affinity purifications of truncated versions of H2A.Z from cells containing 89  VSV epitope-tagged SWR1-C subunits Swc2, Swc3, Swc4 and Arp4. All truncations copurified with SWR1-C components with the exception of H2A.Z (1-104) (Figure 3.6A), consistent with the overlapping M6 region being important for engagement of SWR1-C (Wu et al., 2005). This suggested the loss of H2A.Z truncations from chromatin was not due to their inability to associate with SWR1-C. Similar to SWR1-C, Chz1 bound all truncations except H2A.Z (1-104), while Nap1 co-purified with all H2A.Z truncations but had reduced affinity to H2A.Z (1-106) and H2A.Z (1-108) (Figure 3.6A).  Given that H2A.Z is deposited into chromatin as a dimer with H2B (Kobor et al., 2004; Krogan et al., 2003; Mizuguchi et al., 2004), we tested how this interaction was affected by the H2A.Z truncations. Interestingly, all truncations bound to H2B except for H2A.Z (1-104), mimicking the binding pattern for SWR1-C and Chz1 (Figure 3.6B).  90  Captured Protein  A  ) 14  H 2A .Z  (n o H 2A ta g) .Z (1 -1 34 H 2A ) .Z (1 -1 H 24 2A ) .Z (1 -1 H 2A .Z (1 -1 H 2A .Z (1 -1 H 08 2A ) .Z (1 -1 H 2A 06 ) .Z (1 -1 04 )  ) 17  FLAG  SWR1-C  Swc2-VSV  Swc3-VSV  Swc4-VSV  Arp4-VSV  Chz1-VSV  Nap1 Co-purifying protein  Captured Protein  H2 A. Z  (n o H2 ta g) A. Z (1 -1 H 34 2A ) .Z (1 -1 H 20 2A ) .Z (1 H2 11 4) A. Z (1 -1 H 08 2A ) .Z (1 -1 H 06 2A ) .Z (1 -1 04 )  B  FLAG H2B  Co-purifying protein  Figure 3.6 Loss of H2A.Z truncations from chromatin is SWR1- and H2B- independent (A) Analytical-scale affinity purifications of FLAG-tagged H2A.Z truncations from cells containing affinitytagged versions of SWR1-C subunits, Chz1 and Nap1 were performed and immunoblotted for the indicated copurifying proteins. (B) Analytical-scale affinity purifications of indicated FLAG-tagged H2A.Z truncations were performed and immunoblotted for histone H2B.  91  3.3.6  The C-terminus of histone H2A can replace its variant counterpart in H2A.Z  function Our results revealed that the last 20 amino acids of the H2A.Z C-terminus were required for function of the histone variant. To test whether this region also contributed to the differences between the variant and its canonical cousin, we replaced it by the corresponding region from canonical H2A. To this end, a plasmid-borne allele encoding a H2A.Z derivative containing the corresponding C-terminus of H2A distal to amino acid 114 (hereafter termed “ZA”) was compared to wild-type H2A.Z and H2A (Figure 3.7A). All plasmids were driven by the endogenous HTZ1 promoter and furnished with a C-terminal 3xFLAG-tag. In contrast to H2A or the empty control vector, ZA complemented the sensitivity of the htz1Δ mutant to formamide, caffeine and HU similar to H2A.Z (Figure 3.7B).  These results suggested that the last 20 amino acids of H2A.Z could functionally be replaced by H2A, likely through restoring its ability to bind chromatin. To more formally test this possibility, we performed chromatin fractionation assays of htz1Δ cells containing plasmidborne versions of H2A.Z, H2A, and ZA. The ratio of ZA between chromatin-bound and unbound fraction was similar to that of wild-type H2A.Z (Figure 3.7C). In contrast, more of H2A was found in the chromatin-bound fraction compared to the non-chromatin fraction, a pattern seen also for the endogenous H2A control (Fig. 6D). Further supporting the conclusion that ZA behaved like H2A.Z, the hybrid protein co-purified SWR1-C, Chz1, and Nap1 in analytical-scale affinity purification assays similar to H2A.Z, whereas these proteins had much lower binding to H2A (Figure 3.7D).  92  A H2A.Z  αN  α1  α2  α3  αC  H2A  αN  α1  α2  α3  αC  ZA  αN  α1  α2  α3  αC  B  2.5% Formamide  -TR P  4mM Caffeine  125m M HU  htz1∆  pHTZ1 pHTZ1-FLAG vector pHTA1-FLAG pZA-FLAG  C  D H2A.Z W  S  H2A C  W  S  ZA C  W  S  Captured Protein .Z T 2A 2A W H H  C  ZA  FLAG  FLAG  Swc2-VSV  Pgk1 Swc3-VSV  H2A  Swc4-VSV  W S C  Chz1-VSV  Whole Cell Extract Supernatant Chromatin Pellet  Nap1  Co-purifying protein  Figure 3.7 The C-terminus of histone H2A substitutes its variant counterpart in H2A.Z function (A) Schematic representation of the ZA hybrid constructed with regions originating from H2A.Z in blue and H2A in yellow. (B) ZA was able to substitute H2A.Z function on drugs. Ten-fold serial dilutions of htz1Δ strains carrying the indicated plasmids were plated and incubated on CSM plates containing the indicated concentrations of formamide, caffeine, and HU. (C) ZA was incorporated into chromatin. Bulk fractionations were performed and the amount of FLAG-tagged proteins in each fraction was determined by immunoblotting. W, whole cell extract; S, supernatant; C, chromatin pellet. Antibodies against histone H2A and Pgk1 were used as loading controls for chromatin pellet and supernatant, respectively. (D) H2A.Z and ZA co-purified with SWR1-C subunits, while H2A did not. Analytical-scale affinity purifications of FLAG-tagged proteins from cells containing VSV-tagged SWR1-C subunits, Chz1-VSV and Nap1 were performed and immunoblotted for the indicated co-purifying proteins.  93  3.3.7  Specific amino acids of the H2A.Z C-terminus are important for its chromatin  association and function in vivo Since our data thus far suggested that amino acids between 114 and 120 were critical for H2A.Z function and chromatin binding, we inspected this region more closely in the mouse H2A.Z nucleosome (Suto et al., 2000). The crystal structure shows that the C-terminus is anchored in the nucleosome, at least in part through hydrophobic interactions of side chains and backbone residues with histone H3. Specifically, we identified three corresponding amino acids (H118, I119, N120) in this region of yeast H2A.Z that likely perform an analogous anchoring function (Figure 3.8A). Functional analysis of a mutant strain having these residues changed to alanine (htz1-H118A, I119A, N120A) revealed an intermediate phenotype compared to the htz1Δ mutant when exposed to genotoxic stress (Figure 3.8B), most likely due to the decreased incorporation into chromatin of the mutant protein (Figure 3.8C) as the protein level of this mutant was normal (Figure 3.8D). In addition, this htz1 mutant caused an intermediate defect in heterochromatic boundary function as measured by mRNA levels of the GIT1 gene, which coincided with reduced binding to the GIT1 promoter (Figure 3.8E). Thus, these three residues contributed to the association of H2A.Z with chromatin, thereby likely regulating its function.  Given that the region distal of amino acid 114 was required for H2A.Z function but not unique to the variant, we tested whether the importance of the H2A.Z H118, I119, and N120 residues in chromatin binding was conserved in the corresponding amino acids of H2A (N112, I113 and H114) (Figure 3.8A). We tested the ability of various hta1-HTB1 mutants to complement the chromosomal deletion of the two copies of genes encoding for H2A and  94  H2B in yeast. Strains containing both the wild-type HTA1-HTB1 on a plasmid with a UR3Aselective marker and various hta1-FLAG-HTB1 mutants on plasmids with a HIS3 marker were counterselected on media containing 5-fluoroorotic acid (5-FOA) to test for viability upon loss of the URA3 plasmid, an indication of complementation (Kolodrubetz et al., 1982). The triple mutant, the double mutant hta1-N112A H114A and the single mutant hta1-I113A were not viable and therefore unable to confer the requirement for HTA1/2, while the hta1H114A mutant was viable but had slow growth (Figure 3.8F). In contrast, the hta1-N112A fully complemented the chromosomal deletion of HTA1/2. To investigate the viable hta1N112A and hta1-H114A mutations further, we tested their growth at high temperature and in the presence of the drugs formamide, caffeine, HU and methyl methanesulfonate (MMS). As expected from the initial complementation assays, hta1-H114A mutants were very sick on all conditions tested, whereas hta1-N112A mutants grew robustly (Figure 3.8F).  95  H2A.Z C-terminus H2A C-terminus  12 0  11 4  10 4  A  PRHLQLAIRGDDELDSLIR-ATIASGGVLPHINKALLLKVEKKGSKK---PRHLQLAIRNDDELNKLLGNVTIAQGGVLPNIHQNLLPKKSAKATKASQEL  α3  αC  B  C -TRP  2.5% Formamide 4mM Caffeine  125mM HU  pHTZ1  htz1∆  Pgk1  vector  H2A W S C  E  H2A  1.0 0.8 0.6 0.4 0.2 0  H2A.Z (no tag)  H 2 A.Z  h tz 1 Δ  H 2 A.Z-H 118A, I119A, N120A  H2A.Z fold enrichment/PRP8  FLAG  Whole Cell Extract Supernatant Chromatin Pellet  H2A.Z Enrichment at GIT1 Promoter  GIT1 Expression 1.2  GIT1/ACT1 mRNA levels  H  2A  .Z H 2 I1 A 19 .Z A -H ,N 11 12 8 0A A,  phtz1-H118A,I119A, N120A-FLAG  F  H2A.Z-H118A, I119A,N120A W S C  FLAG  pHTZ1-FLAG  D  H2A.Z W S C  10 8 6 4 2 0  H2A.Z (no tag)  H 2 A.Z  H 2 A.Z-H 118A, I119A, N120A  HTA1FLAG HTA1-HTB1 HTB1  hta1N112A,I113A H114A  vector  hta1-N112A H114A  hta1H114A  hta1N112A  hta1I113A  + 5-FOA  hta1/2-­htb1/2∆  G  YPD 30°  - 5-FOA  YPD 37° 2% Formamide 3mM Caffeine 75mM HU 0.005% MMS  pHTA1-HTB1 pHTA1-FLAG-HTB1 phta1-N112A-FLAG-HTB1 phta1-H114A-FLAG-HTB1  FIG. 7. Specific amino acids of the H2A.Z C-terminus were important for its chromatin association and function  Figure 3.8 (A) Specific amino acids of the C-terminus for its chromatin association in vivo. Schematic representation andH2A.Z sequence alignment ofare the important H2A.Z and H2A C-termini with the H2A.Z and aminoin acids function vivoH118, I119 and N120 highlighted in red. (B) The htz1-H118A, I119A, N120A mutant had an intermediate plates containing andof HU. H2A.Z-H118A, N120A had (A) phenotype Schematiconrepresentation andformamide, sequence caffeine alignment the(C) H2A.Z and H2A I119A, C-termini with thereduced H2A.Zbinding amino chromatin the bulk fractionation assay. (D)(B) Protein of the H2A.Z-H118A, I119A,had N120A mutant was acidstoH118, I119inand N120 highlighted in red. Theexpression htz1-H118A, I119A, N120A mutant an intermediate the sameonasplates wild-type levels, asformamide, analyzed by caffeine immunoblotting of (C) whole cell extracts of the indicated strains an phenotype containing and HU. H2A.Z-H118A, I119A, N120A hadwith reduced anti-FLAG antibody. histone assay. H2A was as loading control.of(E) The same htz1 mutant had an binding to chromatin inAntibody the bulk against fractionation (D)used Protein expression the H2A.Z-H118A, I119A, intermediate defect in same heterochromatic boundary as measured by mRNA levels GIT1 cell normalized ACT1 N120A mutant was the as wild-type levels,function as analyzed by immunoblotting ofof whole extractstoof the and reduced binding to the GIT1 promoter as measured by ChIP followed by qPCR. (F) Mutating the same amino acids indicated strains with an anti-FLAG antibody. Antibody against histone H2A was used as loading control. (E) in H2A to alanine resulted in lethality of yeast cells. The abilities of the hta1 mutants to complement the The same htz1 mutant had an intermediate defect in heterochromatic boundary function as measured by mRNA HTA1/2-HTB1/2 chromosomal deletion were tested by plasmid shuffling on medium containing 5-FOA to levels of GIT1 normalized to ACT1 and reduced binding to the GIT1 promoter as measured by ChIP followed counterselect the URA marker. (G) Cells containing hta1-H114A were sensitive to higher temperature and genotoxic by qPCR. stress. (F) Mutating the same amino acids in H2A to alanine resulted in lethality of yeast cells. The abilities of the hta1 mutants to complement the HTA1/2-HTB1/2 chromosomal deletion were tested by plasmid shuffling on medium containing 5-FOA to counterselect the URA marker. (G) Cells containing hta1-H114A were sensitive to higher temperature and genotoxic stress.  96  3.4 Discussion Here we have identified key functional regions located in the C-terminal docking domain in histone variant H2A.Z. Importantly, the last 20 amino acids of the C-terminus were essential for H2A.Z function as they were required for resistance to genotoxic stress, heterochromatin boundary function at HMR and sub-telomeres, activation of the GAL1 gene and incorporation of H2A.Z into chromatin. Thus, our data strongly suggested these important aspects of H2A.Z function were closely related. In spite of its profound loss of functions, H2A.Z (1114) was fully capable of binding to the key H2A.Z interaction partners SWR1-C, Chz1 and histone H2B. Interestingly, the corresponding region from canonical H2A could functionally replace this essential 20 amino acid region in H2A.Z. Supporting the functional relevance of this region, we identified 3 specific amino acids in this region that facilitated chromatin anchoring and function of H2A.Z, and were important for H2A to function in vivo. Further illuminating the importance of the C-terminus for H2A.Z biology, we have uncovered a more nuanced requirement of this region for cell growth using E-MAP, establishing the utility of this method for dissecting the sensitivity of genetic interaction profiles.  Given the extensive contacts made by H2A.Z with other histones and DNA in the nucleosome, it was surprising that removal of the last 20 amino acids caused a dramatic reduction of the amount of H2A.Z associated with chromatin. Specifically, these molecular interactions not involving residues located in the C-terminal region include the acidic patch that interacts with histone H4, the α3 helix that forms a β-sheet with the H4 C-terminal tail, and the α1 helix/L1/L2 that interacts with DNA (Luger et al., 1997; Suto et al., 2000). Contrasting the complete loss of function associated with H2A.Z (1-114), H2A.Z (1-120) 97  generally had intermediate defects in conferring resistance to genotoxic stress, heterochromatin boundary formation, transcriptional activation and chromatin binding. Multiple studies show that SWR1-C is required for chromatin deposition of H2A.Z-H2B dimers with this process likely being stimulated by H2A (Kobor et al., 2004; Krogan et al., 2003; Luk et al., 2010; Mizuguchi et al., 2004). The fact that both H2A.Z (1-114) and H2A.Z (1-120) retained binding to SWR1-C and H2B suggests that anchoring of H2A.Z to chromatin through its C-terminus is at least equally important for function in vivo. Based on our data, we propose a model for the sequential nature underlying the stable formation of H2A.Z nucleosomes. Upon deposition by SWR1-C, the H2A.Z C-terminus is required to retain the histone in chromatin, with failure to do so leading to grave consequences for the ability of H2A.Z to perform its function. Accordingly, we postulate that based on their ability to interact with SWR1-C and H2B, both H2A.Z (1-114) and H2A.Z (1-120) are efficiently deposited as dimers with H2B into chromatin by SWR1-C but dissociate thereafter, resulting in decreased residency in nucleosomes (Figure 3.9). This is likely in part due to weakened interactions with other nucleosomal histones, specifically H3, as indicated by the effect of the htz1-H118A, I119A, N120A mutant on chromatin binding.  98  SWR1-C  SWR1-C  HIN  12  1-  H2 HIN A. Z  0  HIN  H2B  H4  H4  H3  SWR1-C  1-120  HIN  H2B H2A.Z  N HI 1-120  H3  SWR1-C  X  1-  11 4  1-104 1-114  H2B 1-114 H4  H3  H2B  H2A  H4  H3  Figure 3.9 Schematic diagram depicting models of wild-type H2A.Z, H2A.Z (1-120), H2A.Z (1-114) and H2A.Z (1-104) nucleosomes SWR1-C binds to H2A.Z, 1-120, and 1-114 and deposits them into chromatin. However, H2A.Z (1-120) and H2A.Z (1-114) are not stably anchored into the nucleosome. The grey arrows represent the relative amount of H2A.Z that dissociates from the nucleosome. H2A.Z (1-104) cannot bind to SWR1-C and thus cannot be deposited into chromatin in the first place. HIN represents the H2A.Z residues H118, I119, and N120. The diagram does not necessarily represent real intra-nucleosomal structure and interactions.  Support for our model is provided by the ability of the corresponding region of H2A to fully rescue the strong defects caused by loss of the last 20 amino acids in H2A.Z. These data suggested that this region of the docking domain might play a similar role in chromatin anchoring of both histone H2A forms. Consistent with this, the Xenopus laevis H2A docking domain is critical to stabilize its interactions within the nucleosome in vitro (Shukla et al., 2010) and the human H2A C-terminus is required for proper nucleosome stability in vivo 99  (Vogler et al., 2010). The general functional requirement of this region is further supported by our own data showing that the H2A residues corresponding to H2A.Z H118, I119, and N120 were important in vivo. Specifically, the H2A mutant hta1-I113A was lethal while the mutant hta1-H114A had strong sensitivity to genotoxic stress. While this result was in slight contrast to published point mutant analyses of H2A reporting that both mutants hta1-I113A and hta1-H114A were viable but had strong phenotypes on HU and MMS, the difference may be due to strain background as all the previous studies were performed with S288c strains (Huang et al., 2009; Matsubara et al., 2007; Nakanishi et al., 2008),  The intermediate effects of the htz1-H118A, I119A, N120A mutant and of the H2A.Z (1-120) derivative indicate that additional residues distal to amino acid 120 were required for proper H2A.Z function in chromatin. While the nature of these is unclear at present, the crystal structure of the mouse H2A.Z suggests that L124 makes a polar contact with H3 within the nucleosome (Suto et al., 2000). In contrast to H118, I119, N120 residues, this interaction involves the backbone and not the side chain of the amino acid. In addition, K126 and K133 of H2A.Z may be functionally important as these residues can be sumoylated during DNA double strand breaks and DNA repair (Kalocsay et al., 2009), although H2A.Z derivatives lacking just this region did not have appreciable defects in our assays. Despite our clear evidence for last 20 amino acids being important for function, the C-terminal truncation approach employed here does not exclude the possibility of residues located before amino acid 114 also contributing to H2A.Z function. As such, an alanine scan of H2A.Z identified two residues I109 and G113 in the C-terminus that have mild sensitivity to genotoxic  100  stressors (Kawano et al., 2011), as do some mutants in the H2A.Z acidic patch region (Jensen et al., 2011).  In contrast to the clear boundary at H2A.Z amino acid 114 derived from the growth assay and biochemical measures, E-MAP analysis uncovered a more intricate and nuanced nature of this region. In addition to the robust binding of derivatives longer than H2A.Z (1-104) to SWR1-C, Chz1, and H2B, the gradual loss of function caused by progressively longer Cterminal truncations suggests that removal of these residues did not result in structurally defective or unfolded proteins. We dissected the sensitivity of biologically interesting negative and positive interactions to distinct HTZ1 truncation alleles, and highlighted the differences in strength of genetic interaction that a few amino acids can make. For example, the HTZ1 truncation alleles exhibited a very good correlation between their progressively negative genetic interactions with the silencing factors Asf1 and SAS complex and their ability to restrict the spread of heterochromatin at GIT1, suggesting that perhaps H2A.Z acts together with other silencing factors to maintain the boundaries of heterochromatin. Similarly, the progressive positive interaction profile with GAL80 was consistent with the requirement of the last 20 amino acids for GAL1 activation, which is regulated by Gal4 in concert with Gal80 (Johnston, 1987). Lastly, CHZ1 had a transition from no interaction to negative interaction at H2A.Z (1-106) and H2A.Z (1-104), correlating well with H2A.Z (1104) losing binding to Chz1. The interaction profiles described here suggested that the phenotypes observed on drugs for the HTZ1 alleles were a result of specific and not global functional changes.  101  Chapter 4: The M6 Region of the Histone Variant H2A.Z C-Terminal Docking Domain is Required but not Sufficient for H2A.Z Functions  4.1 Introduction DNA is packaged into the eukaryotic nucleus as a structure called chromatin. The fundamental unit of chromatin is the nucleosome, which consists of 146bp of DNA wrapped around an octamer of histones, two each of the canonical histones H2A, H2B, H3, and H4 (Luger et al., 1997). Chromatin is highly flexible and dynamic in order to allow or prevent access of the DNA template to regulatory proteins. Several mechanisms exist in the regulation of chromatin structure and function, one of which involves the replacement of canonical histones with non-allelic histone variants in specific regions of the genome (Talbert and Henikoff, 2010). Whereas canonical histones are deposited randomly during replication, histone variants are deposited in a replication-independent manner at distinct locations and correspondingly have very specific functions in the cell (Jin et al., 2005).  The H2A family of histone variants is more diverse than any other histone family, consisting of members that have very distinct functions from each other. Interestingly, the C-terminus of H2A variants contains the most sequence variation, suggesting it contributes significantly to the structural and functional divergence of H2A family members (Ausio and Abbott, 2002). One H2A family member that has been investigated in great depth in the past decade 102  or so, but whose distinct features from canonical H2A have not been fully characterized is the variant H2A.Z. H2A.Z is even more evolutionarily conserved than canonical H2A and replaces its cousin in 5-10% of all nucleosomes (Malik and Henikoff, 2003). Overexpression of H2A cannot replace H2A.Z function in Saccharyomyces cerevisiae (Adam et al., 2001) and Tetrahymena thermophile (Jackson and Gorovsky, 2000), suggesting the histone variant has specialized and non-redundant functions in the cell. Indeed, H2A.Z is involved in a variety of cellular process including transcriptional regulation, maintenance of heterochromatin-euchromatin boundaries, chromosome segregation, DNA repair, and resistance to genotoxic stress (Zlatanova and Thakar, 2008). These specialized functions of the histone variant may be ascribed to its deposition at specific locations like gene promoters and broader subtelomeric regions by the conserved ATP-dependent chromatin-remodeling complex SWR1-C (Albert et al., 2007; Guillemette et al., 2005; Kobor et al., 2004; Krogan et al., 2003; Li et al., 2005; Mizuguchi et al., 2004; Raisner et al., 2005; Zhang et al., 2005). SWR1-C catalyzes the reaction of removing H2A-H2B dimers and replacing them with H2A.Z-H2B dimers in vitro, and is required for H2A.Z deposition in vivo (Mizuguchi et al., 2004). Other factors also bind to H2A.Z, such as the histone chaperones Chz1 and Nap1 (Kobor et al., 2004; Luk et al., 2007; Park et al., 2005). Although Nap1 can also exchange reaction of H2A-H2B dimers with H2A.Z-H2B dimers in vitro (Park et al., 2005), SWR1-C is the only known non-redundant factor that is required for H2A.Z chromatin deposition in vivo (Kobor et al., 2004; Krogan et al., 2003; Li et al., 2005; Mizuguchi et al., 2004).  H2A.Z shares 60% amino acid identity with canonical H2A, and the three-dimensional structure of an H2A.Z-containing nucleosome is overall similar to the H2A nucleosome  103  (Suto et al., 2000). However, as described in more detail in Chapter 1, the two nucleosomes do have subtle differences in three specific regions that may explain the functional uniqueness of H2A.Z (Suto et al., 2000). The first difference lies in the L1 loop, where two H2A.Z moieties interact, and which results in significant structural difference in the interaction between two H2A.Z-H2B dimers. Second, the H2A.Z nucleosome has an extended acidic patch on its surface that may be important for altered contacts with the Nterminus of H4 from a neighboring nucleosome or non-histone proteins. A recent study found that mutations in two residues of the acidic patch in H2A.Z led to defective H2A.Z resistance to genotoxic agents and loss of the histone at the PHO5 promoter (Jensen et al., 2011). A significant part of the acidic patch lies in the C-terminal “docking domain”, an area of considerable sequence divergence having less than 40% amino acid identity with H2A and providing an interaction surface for the (H3-H4)2 tetramer and potentially other non-histone factors (Suto et al., 2000) (also see Figure 4.1A). One region of the docking domain that has been shown to be a major determinant of H2A.Z’s identity is the M6 region, an 11 amino acid stretch named after a mutant first created in Drosophila that swapped H2A.Z residues with that of H2A and resulted in embryonic lethality (Clarkson et al., 1999; Wu et al., 2005). A similar M6 swap mutant in budding yeast has decreased binding to SWR1-C and results in cellular sensitivity to formamide (Wu et al., 2005). Upon replacing the corresponding region in H2A, the larger H2A.Z docking domain can bestow H2A.Z-like capabilities of GAL1 gene induction to canonical H2A when driven from a constitutive and highly expressed promoter (Adam et al., 2001), further suggesting that the docking domain is critical to the unique function of H2A.Z.  104  Having established in the previous chapter that the last 20 amino acids of the C-terminus were essential for H2A.Z function, yet were not required for SWR1-C interaction nor to distinguish the histone variant from canonical H2A, here we further explore other regions of the C-terminal docking domain that confer H2A.Z-specific properties. Using H2A.Z-H2A and H2A-H2A.Z hybrid proteins, we determined that although the M6 region of H2A.Z was required for its function and SWR1-C interaction, it was not sufficient for these functions, suggesting that either this region indirectly interacts with SWR1-C or that there are multiple SWR1-C binding sites on H2A.Z. In addition, we demonstrate a novel role of the H2A.Z M6 region as required and also sufficient for interaction with the histone chaperone Chz1.  4.2 Materials and Methods  4.2.1  Yeast strains, plasmids, and yeast techniques  All strains used in this study are listed in Table 4.1 and were created using standard yeast genetic techniques (Ausubel, 1987a). Complete and partial deletion of genes and integration of a VSV tag (Funakoshi and Hochstrasser, 2009) or 3xFLAG tag (Gelbart et al., 2001) in frame at the 3´ end of genes were achieved using the one-step gene integration of PCRamplified modules (Longtine et al., 1998). All plasmids used in this study are listed in Table 4.2 and created using standard molecular biology techniques. The parental HTZ1 pRS314 plasmid (Babiarz et al., 2006) was used for subsequent manipulations including site-directed mutagenesis and construction of the HTA1, ZA and AZ hybrids. The HTA1-FLAG vector was created by amplification of the entire HTA1 gene using primers containing overhangs that anneal to the promoter region of HTZ1 and the  105  beginning of the 3×FLAG. This double stranded product was gel-purified and used as primers in a site-directed mutagenesis reaction with the HTZ1-FLAG vector as template using the QuickChange method (Stratagene) following the protocol of the manufacturer (primers used are available upon request). All mutations were confirmed by DNA sequencing. The hybrid vector ZA was created in a similar manner, except the amplified region of HTA1 corresponded to the last 20 amino acids in H2A.Z. Mutations in specific amino acids of HTZ1 and HTA1 were also generated by site-directed mutagenesis (primers available upon request). To determine the expression level of the truncated H2A.Z proteins, yeast whole cell extracts were prepared using the NaOH extraction protocol as previously described (Kushnirov, 2000). Immunoblotting was performed using anti-FLAG M2 (Sigma) and anti-H2A (Upstate) antibodies. Table 4.1 Yeast strains used in this study Stain  Relevant Genotype  MKY5 MKY1144 MKY1185 MKY1187 MKY1459 MKY1460 MKY1461 MKY1462 MKY1463 MKY1464 MKY1465 MKY1466 MKY1467 MKY1468 MKY1469 MKY1470 MKY1471 MKY1145 MKY1472 MKY1473 MKY1474 MKY1475 MKY1476  W303, MATα ade2-1 can1-100 his3-11 leu2-3,112 trp1-1 ura3-1 LYS2 MKY5, htz1∆::HYGMX MKY1144, [pRS314] MKY1144, [pMK149] MKY1144, [pMK418] MKY1144, [pMK419] MKY1144, [pMK420] MKY1144, [pMK421] MKY1144, [pMK422] MKY1144, [pMK423] MKY1144, [pMK424] MKY1144, [pMK425] MKY1144, [pMK502] MKY1144, [pMK503] MKY1144, [pMK504] MKY1144, [pMK172] MKY1144, [pMK538] MKY5, SWC2-VSV::KANMX MKY1145, [pMK148] MKY1145, [pMK149] MKY1145, [pMK418] MKY1145, [pMK421] MKY1145, [pMK423]  106  Stain  Relevant Genotype  MKY1477 MKY1478 MKY1479 MKY1480 MKY1481 MKY1482 MKY1153 MKY1483 MKY1484 MKY1485 MKY1486 MKY1487 MKY1488 MKY1489 MKY1490 MKY1491 MKY1492 MKY1493 MKY1177 MKY1494 MKY1495 MKY1496 MKY1497 MKY1498 MKY1499 MKY1500 MKY1501 MKY1502 MKY1503 MKY1504  MKY1145, [pMK425] MKY1145, [pMK502] MKY1145, [pMK503] MKY1145, [pMK504] MKY1145, [pMK172] MKY1145, [pMK538] MKY5, SWC3-VSV::KANMX MKY1153, [pMK148] MKY1153, [pMK149] MKY1153, [pMK418] MKY1153, [pMK421] MKY1153, [pMK423] MKY1153, [pMK425] MKY1153, [pMK502] MKY1153, [pMK503] MKY1153, [pMK504] MKY1153, [pMK172] MKY1153, [pMK538] MKY5, CHZ1-VSV::KANMX MKY1177, [pMK148] MKY1177, [pMK149] MKY1177, [pMK418] MKY1177, [pMK421] MKY1177, [pMK423] MKY1177, [pMK425] MKY1177, [pMK502] MKY1177, [pMK503] MKY1177, [pMK504] MKY1177, [pMK172] MKY1177, [pMK538]  Table 4.2 Plasmids used in this study  Plasmid pMK148 pMK149 pMK172 pMK418 pMK419 pMK420 pMK421 pMK422 pMK423 pMK424 pMK425 pMK502 pMK503 pMK504 pMK538  Relevant Genotype pRS314, HTZ1 pRS314, HTZ1-3xFLAG::KANMX pRS314, Z-AM6-3xFLAG::KANMX pRS314, HTA1-3xFLAG::KANMX pRS314, ZA 1-124-3xFLAG::KANMX pRS314, ZA 1-114-3xFLAG::KANMX pRS314, ZA 1-108-3xFLAG::KANMX pRS314, ZA 1-106-3xFLAG::KANMX pRS314, ZA 1-104-3xFLAG::KANMX pRS314, ZA 1-98-3xFLAG::KANMX pRS314, ZA 1-97-3xFLAG::KANMX pRS314, AZ 98-134-3xFLAG::KANMX pRS314, AZ 105-134-3xFLAG::KANMX pRS314, AZ 109-134-3xFLAG::KANMX pRS314, A-ZM6-3xFLAG::KANMX 107  4.2.2  Analytical-scale affinity purifications  Co-immunoprecipitation assays were performed as described previously (Kobor et al., 2004). Briefly, yeast cells were harvested, and lysed in IP Buffer (50 mM Tris [pH 7.8], 150mM NaCl, 1.5mM MgAc, 0.15% NP-40, 1mM DTT, 10mM NaPPi, 5mM EGTA, 5mM EDTA, 0.1 mM Na3VO4, 5mM NaF, CompleteTM Protease inhibitor cocktail) using acid-washed glass beads and mechanically disrupting using a bead beater (BioSpec Products, Bartlesville, Oklahoma, United States). FLAG-tagged fusion proteins were captured using FLAG M2 agarose beads (Sigma), and subsequently washed in IP buffer. Captured material was analyzed by immunoblotting and co-purifying proteins were detected with anti-VSV (Applied Biological Materials), anti-Nap1 (Santa Cruz Biotechnology), and anti-H2B (Upstate) antibodies. Bands were visualized using the Odyssey Infrared Imaging System (Licor).  4.2.3  Chromatin association assays  Chromatin association assays were performed as previously described (Wang et al., 2009). Briefly, yeast cells were incubated in Pre-Spheroplast Buffer (100mM PIPES/KOH [pH 9.4], 10mM DTT, 0.1% sodium azide) for 10 min at room temperature, and spheroplasted with 20 mg/ml Zymolyase-100T (Seikagaku Corporation) in Spheroplast Buffer (50mM KPO4 [pH 7.5], 0.6 M Sorbitol, 10mM DTT) at 37°C for 15 min. Spheroplasts were washed with Wash Buffer (50mM HEPES/KOH [pH 7.5], 100mM KCl, 2.5mM MgCl2, 0.4M sorbitol), resuspended in equal volume of EB (50mM HEPES/KOH [pH 7.5], 100mM KCl, 2.5mM MgCl2, 1mM DTT, 1mM PMSF, and protease inhibitor cocktail), and lysed with 1% Triton  108  X-100. Whole cell extract (WCE) was saved, and the remaining lysate was separated into chromatin pellet (Pellet) and supernatant (SUP) fractions by centrifugation through EBSX (EB+ 0.25% Triton X-100 and 30% sucrose). WCE, Pellet, and SUP were subjected to SDSPAGE and immunoblotted with anti-FLAG M2 (Sigma), anti-H2A (Upstate) and anti-Pgk1 (Sigma) antibodies. Immunoblots were scanned with the Odyssey Infrared Imaging System (Licor).  4.2.4  ChIP  ChIP experiments were performed as described previously (Schulze et al., 2009a). In brief, yeast cells (500 ml) were grown in a rich medium to an OD600 of 0.5-0.6 and were crosslinked with 1% formaldehyde for 20 min before chromatin was extracted. The chromatin was sonicated (Bioruptor, Diagenode; Sparta, NJ: 10 cycles, 30 s on/off, high setting) to yield an average DNA fragment of 500 bp. Anti-FLAG antibody (Sigma, 4 µl) were coupled to 60 µl of protein A magnetic beads (Invitrogen). After reversal of the crosslinking and DNA purification, the immunoprecipitated and input DNA were analyzed by qPCR. Samples were analyzed in triplicate for three independent ChIP experiments. Primer sequences are listed in Table 4.3.  Table 4.3 ChIP-qPCR primers used in this study Primer name PRP8 GIT1 YCR095c RDS1 YIR042c YIR043c  Forward sequence GGATGTATCCAGAGGCCAAT TTCATGAATTTCCTTACTGGAC TACCGTATGCGGTATAATGA TGTGCTATCTAAGAGGATGGTTCA TACGCCACTCGCTGAATTTG CGAAACGAATTGACCTGGTT  109  Reverse sequence AACCCGCGTATTAAGCCATA GTTGACTAGTCACAAGAAACAG GTCTCCACTTTAGAACATCT CAGCAGCCAATTTCATGTTC TTGTAAGCCCAGTAAACAGCTTC CGATAAGGAGCGCTTACGAG  4.2.5  Genome-wide ChIP-on-chip  ChIP was performed as described previously, using the adapted linear amplification method that involves two rounds of T7 RNA polymerase amplification (van Bakel et al., 2008). In brief, yeast cells (500 ml) were grown in SC-TRP media to an OD600 of 0.4–0.5 and were crosslinked with 1% formaldehyde for 20 min before chromatin was extracted. The chromatin was sonicated (Bioruptor, Diagenode; Sparta, NJ: 10 cycles, 30 s on/off, high setting) to yield an average DNA fragment of 500 bp. FLAG antibody (Sigma, F3165) for H2A.Z pull-down (4 µl) was coupled to 60 µl of protein A magnetic beads (Invitrogen). After reversal of the crosslinking and DNA purification, the immunoprecipitated and input DNA were amplified to about 6 µg aRNA using T7 RNA polymerase in two rounds. Samples were labeled with biotin, and the immunoprecipitated and input samples were hybridized to two Affymetrix 1.0R S. cerevisiae microarrays, which are comprised of over 3.2 million probes covering the complete genome. Probes (25-mer) are tiled at an average of 5 bp resolution, creating an overlap of approximately 20 bp between adjacent probes.  4.2.6  Data analysis  An adapted version of the model-based analysis of tiling arrays (MAT) algorithm (Droit et al. 2010) was used to reliably detect enriched regions as described previously (Schulze et al. 2009), using input DNA for normalization. Annotations for ORFs and ARS were derived from the SGD database. An ORF was termed enriched if at least 50% of all probes had a MAT score above a threshold of 1.5. Promoters were defined as enriched if 50% of all probes 300 bp upstream of the transcriptional start site were above the MAT score cutoff. Promoters that overlap with ORFs of other genes were not considered.  110  4.3 Results  4.3.1  A specific region within the H2A.Z C-terminal docking domain confers unique  H2A.Z functions To test which regions in the docking domain contributed to the differences between H2A.Z and its canonical cousin, we constructed an additional set of HTZ1 alleles encoding H2A.ZH2A hybrid proteins that have successively longer sequences from the corresponding H2A docking domain (Figure 4.1A, B) using the same strategy as in Chapter 3 Section 3.3.6. Key features of the H2A.Z and H2A docking domain and the acidic patch of H2A.Z are highlighted in Figure 4.1A. Plasmid-borne alleles encoding the H2A.Z-H2A or “ZA” hybrid derivatives were compared to wild-type H2A.Z and H2A (Figure 4.1C). All plasmids were driven by the endogenous HTZ1 promoter and furnished with a C-terminal 3xFLAG-tag. ZA 1-108 fully complemented the sensitivity of the htz1Δ mutant to formamide, caffeine and HU similar to wild-type H2A.Z. In contrast, cells containing ZA 1-97 and ZA 1-98 were similar to H2A and the empty vector (Figure 4.1C). ZA 1-104, interestingly, only partially complemented the sensitivity of htz1Δ to genotoxic agents, while cells containing ZA 1-106 also had a slight growth defect. These results suggested that the last 26 amino acids (from amino acid 108 to 134) of the H2A.Z C-terminus were replaceable by the corresponding region from H2A and did not confer H2A.Z-specific properties, further extending our findings from Chapter 3.  We next tested whether the inability of ZA 1-97 and ZA 1-98 to complement the htz1Δ phenotype was attributable to a failure of the hybrid proteins to be incorporated into 111  chromatin. Cellular fractionation assays (Wang et al., 2011) revealed that there was a different pattern of protein present in the bulk chromatin versus non-chromatin fractions for histones H2A.Z and H2A (Figure 4.1D). H2A was predominantly present in the chromatin fraction with very low levels found in the non-chromatin fraction, whereas H2A.Z was present at higher levels in the non-chromatin fraction (Figure 4.1D). Interestingly, the chromatin association patterns of the ZA hybrids formed two distinct groups, as ZA 1-98 and ZA 1-104 were more similar to H2A, while ZA 1-108 was more similar to H2A.Z in terms of their chromatin versus non-chromatin fractions (Figure 4.1D). Thus, all hybrids tested were incorporated into bulk chromatin, either in a pattern similar to H2A.Z or H2A, indicating that the growth defect of cells containing ZA 1-98 and ZA 1-104 were not attributable to an inability to incorporate into bulk chromatin.  112  Figure 4.1 A specific region within the H2A.Z C-terminal docking domain confers unique H2A.Z functions (A) Amino acid sequence alignment comparison of H2A.Z and H2A (identical amino acids are starred below). The secondary alpha helices are depicted in gray boxes above the sequences. The docking domain is highlighted and labeled in blue. Residues contributing to the acidic patch of H2A.Z are denoted by an orange dot above the H2A.Z sequence. The M6 region is boxed in purple, and the three important amino acids are indicated in red. (B) Schematic representation of the H2A.Z-H2A hybrids. Regions from H2A.Z are shown in blue and regions from H2A are shown in yellow. (C) Most of the H2A C-terminus was able to replace H2A.Z function in its resistance to genotoxic stress. Ten-fold serial dilutions of strains containing the indicated ZA hybrid proteins with C-terminal 3×FLAG tags were plated and incubated on SC-TRP media containing the indicated concentrations of formamide, caffeine, and HU. (D) Two groups of ZA hybrids had distinguishing patterns of bulk chromatin association: ZA 1-104 was similar to H2A and ZA 1-108 was similar to H2A.Z. Bulk fractionations wre performed and the amount of H2A.Z-FLAG in each fraction was determined by immunoblotting in the different strains. W, whole cell extract; S, supernatant; C, chromatin pellet. Antibody against histone H2A was used as loading control.  113  Next we sought to further investigate the different chromatin association patterns between the hybrids ZA 1-104 and ZA 1-108. Yeast H2A.Z and H2A have previously been shown to exhibit different biochemical stabilities when the chromatin fractions are subjected to salt washes of increasing ionic strength (Zhang et al., 2005). We employed a similar method and washed the chromatin fractions from Figure 4.1C with potassium chloride (KCl) of increasing ionic strength (Figure 4.2). Similar to H2A.Z, ZA 1-108 was partially removed under conditions of higher ionic strength at 0.75M of KCl as compared to 0.25M or 0.5M (Figure 4.2). In contrast, little or no H2A or ZA 1-104 was removed even at 0.75M KCl. Taken together, chromatin bearing ZA 1-108 were less stable than ZA 1-104, suggesting the region between amino acids 104 and 108 distinguishes the biochemical property of H2A.Z from canonical H2A.  Figure 4.2 H2A.Z and ZA 1-108 are more susceptible to loss from chromatin than H2A and ZA 1-104 Bulk fractionations were performed and chromatin fractions were subsequently washed with the indicated concentrations of KCl and the amount of FLAG-tagged protein in whole cell extract (W), supernantant (S) and from each wash of the chromatin pellet were determined by immunoblotting in the different strains. Antibody against histone H2A was used as loading control.  114  4.3.2  The H2A.Z C-terminal docking domain is required but not sufficient for H2A.Z  functions Having established that the C-terminal docking domain of H2A.Z confers one of its unique biochemical properties, we sought to establish whether specific regions on the docking domain were sufficient for its functions. We used a reciprocal hybrid approach and tested whether attaching regions of the H2A.Z C-terminus to H2A would make the canonical histone more H2A.Z-like. As ZA 1-104 and ZA 1-108 had distinguishing biochemical properties, We focused on these two hybrids along with ZA 1-97, which demarcates the Nterminal boundary of the M6 region, a region that is essential for development of Drosophila melanogaster (Clarkson et al., 1999). We constructed another set of alleles encoding for H2A-H2A.Z or “AZ” hybrids (AZ 109-134, AZ 105-134, and AZ 98 -134) that correspond to the three aforementioned ZA hybrids (Figure 4.3A). Interestingly, while the three AZ hybrids did not fully complement the sensitivity of the htz1Δ mutant to caffeine, HU and formamide at a higher concentration, AZ 98-134 and AZ 103-134 partially complemented the sensitivity of the htz1Δ mutant to formamide at a lower concentration (Figure 4.3C). As expected by having the endogenous HTZ1 promoter, almost all hybrids had similar expression levels as wild-type H2A.Z, with the only exception being AZ 98-134 (Figure 4.3B). AZ 98-134 had a slight decrease in expression level, suggesting the inability of AZ 98-134 to fully complement the sensitivity of the htz1Δ mutant to drugs might be due to its lower expression level. Similar to the phenotypes seen in Figure 3.7B, ZA 1-108 complemented, ZA 1-104 partially complemented, while ZA 1-97 did not complement to formamide, caffeine and HU (Figure 4.3C). It should be noted that AZ 109-134 and AZ 103-134 migrated slower and AZ 98-134 migrated faster than H2A.Z on the protein gel (Figure 4.3B), most likely due to a  115  combination of the different lengths between the docking domains of H2A.Z and H2A, and a difference in charge of exchanged residues.  2.5% Formamide  H2A.Z-FLAG  AZ#109%134#  htz1Δ  AZ#105%134#  H2A-FLAG  -1 3 98 4 -1 34  -1 34  A  Z  10 3  10 9  Z A  A  Z  110  4mM Caffeine  125m M HU  4mM Caffeine  125m M HU  H2A  AZ#98%134#  Z-M6  C  2% Formamide  110  FLAG  ZA#1%97# -TRP  ZA  H  ZA#1%104#  ZA  2A  .Z  8  ZA#1%108#  4 197  B ZA  A  A-M6 -TRP  2% Formamide  2.5% Formamide  H2A.Z-FLAG H2A.Z-FLAG htz1Δ htz1Δ H2A-FLAG H2A-FLAG Z-M6 ZA 1-108 ZA A-M6 1-104 ZA 1-97 H2A.Z-FLAG  htz1Δ H2A.Z-FLAG H2A-FLAG htz1Δ ZA 1-108 H2A-FLAG 1-104 AZZA 109-134 ZA 1-97 AZ 103-134 AZ 98-134 H2A.Z-FLAG  htz1Δ  Figure 4.3 The H2A.Z C-terminal docking domain is required but not sufficient for its functions H2A-FLAG (A) Schematic representation of the H2A.Z-H2A (ZA) and H2A-H2A.Z (AZ) hybrids. Regions from H2A.Z are shown in blue and regions from H2A are shown in yellow. (B) FLAG-tagged hybrid proteins were expressed to AZ 109-134 wild-type levels except for a slight decrease in AZ 98-134. Protein expression levels as analyzed by AZ 103-134 immunoblotting of whole cell extracts of the indicated strains with an anti-FLAG antibody. Antibody against 98-134 histone H2AAZwas used as loading control. (C) AZ hybrids could not complement H2A.Z function in resistance to genotoxic stress. Ten-fold serial dilutions of strains containing the indicated ZA and AZ hybrid proteins with C-terminal 3×FLAG tags were plated and incubated on SC-TRP media containing the indicated concentrations of formamide, caffeine, and HU.  116  We next tested whether the inability of the ZA and AZ hybrids to fully complement the sensitivity of the htz1Δ mutant to drugs was due to a loss of binding to known factors involved in H2A.Z biology, including the ATP-dependent remodeler SWR1-C, and the histone chaperones Nap1 and Chz1. We performed analytical-scale affinity purifications of the hybrid proteins from cells containing VSV epitope-tagged SWR1-C subunits Swc2 and Swc3. ZA 1-108, and to some extent, ZA 1-104 co-purified with SWR1-C components, whereas ZA 1-97 did not bind SWR1-C components (Figure 4.4). These results are consistent with the overlapping H2A.Z M6 region in the proximity of amino acid 104 being critical and unique for engagement of SWR1-C, a function irreplaceable by the same region from canonical H2A (Wang et al., 2011; Wu et al., 2005). Similar to SWR1-C, Chz1 bound to ZA hybrids except for ZA 1-97, while Nap1 co-purified with all ZA hybrids (Figure 4.4). Surprisingly, the AZ hybrids did not co-purify with SWR1-C components, suggesting that the C-terminus of H2A.Z is not sufficient for SWR1-C interaction. Intriguingly, unlike SWR1-C, Chz1 co-purified with AZ 98-134 (Figure 4.4). As expected for SWR1-C specificity to variant H2A.Z, H2A did not purify with SWR1-C components in all experiments (see Figure 4.5C). Taken together, these results suggest that the H2A.Z Cterminal docking domain is required but not sufficient for interaction with SWR1-C, as the corresponding region from H2A was unable to replace this function of the histone variant.  117  134  4 -13  AZ  98-  4  103  -13 AZ  109  AZ  -97  4 ZA 1  ZA 1  -10  -10 ZA 1  A.Z H2  No  tag  8  Captured Protein  FLAG Swc2-VSV Swc3-VSV Chz1-VSV Nap1 Co-Purifying Protein Figure 4.4 The H2A.Z C-terminal docking domain is required but not sufficient for SWR1-C interaction Analytical-scale affinity purifications of FLAG-tagged hybrid proteins from cells containing affinity-tagged versions of SWR1-C subunits, Chz1 and Nap1 were performed and immunoblotted for the indicated copurifying proteins.  4.3.3  The M6 region of the H2A.Z C-terminal docking domain is required but not  sufficient for H2A.Z functions Having established that the amino acids in the M6 region of the H2A.Z docking domain were required but not sufficient for H2A.Z functions, we next set out to focus solely on the M6 region by modeling after a similar approach from previous studies (Clarkson et al., 1999; Wu et al., 2005). We constructed two more alleles that encoded for hybrids that swap the M6 region (H2A.Z amino acids 98-108) from H2A.Z and H2A, respectively, termed “Z-AM6” (H2A.Z with M6 region from H2A) and “A-ZM6” (H2A with M6 region from H2A.Z) 118  (Figure 4.5A). The Z-AM6 hybrid almost completely restored H2A.Z resistance to caffeine, HU and formamide at a lower concentration, although it was clear that this restoration was only partial when tested at a higher formamide concentration in agreement with a previous study (Figure 4.5B) (Wu et al., 2005). Hence, the M6 region of H2A.Z may be partially required for its unique function. I extended these findings to show that cells containing the reciprocal A-ZM6 hybrid were just as sensitive to genotoxic agents as cells lacking H2A.Z entirely, suggesting that the M6 region from H2A.Z was not sufficient for its functions in vivo (Figure 4.5B).  We next tested whether Z-AM6 and A-ZM6 could interact with SWR1-C, and the histone chaperones Nap1 and Chz1. As expected, Z-AM6 had dramatically reduced binding to SWR1-C, confirming previous reports (Figure 4.5C, Wu et al. 2005). However, there may be some residual interaction between Z-AM6 and Swc2, the subunit that directly binds to H2A.Z (Wu et al. 2005). Surprisingly, A-ZM6 did not restore binding to SWR1-C, although it also had slight interaction with Swc2 (Figure 4.5C). Both hybrids bound to Nap1, as expected due to Nap1’s equal affinity to H2A.Z and H2A. Chz1, on the other hand, purified with A-ZM6 but had reduced binding to Z-AM6, consistent with the results from the Cterminal docking domain hybrids (Figure 4.4). The inability of Z-AM6 and A-ZM6 to interact with SWR1-C could result in decreased incorporation into bulk chromatin. However, unexpectedly, cellular fractionation assays indicated that both Z-AM6 and A-ZM6 were incorporated into bulk chromatin similar to H2A.Z (data not shown).  119  Z"AM6&  A  A"ZM6& B -TRP  2% Formamide  2.5% Formamide  4mM Caffeine  125m M HU  H2A.Z-FLAG H2A.Z& htz1Δ htz1Δ& H2A-FLAG H2A& Z-M6 Z"AM6& A-M6 A"ZM6&  A-Z M6  6 Z-A M  A  H2A-FLAG  H2  No  tag  htz1Δ  A.Z  Captured Protein  C  H2  H2A.Z-FLAG  ZA 1-108 ZA 1-104  FLAG  ZA 1-97  Swc2-VSV  H2A.Z-FLAG  Swc3-VSV  htz1Δ H2A-FLAG  AZ 109-134 AZ 103-134 AZ 98-134  Chz1-VSV Nap1 Co-Purifying Protein  Figure 4.5 The M6 region of the H2A.Z C-terminal docking domain is required but not sufficient for H2A.Z functions (A) Schematic representation of the hybrids exchanging the M6 regions. Regions from H2A.Z are shown in blue and regions from H2A are shown in yellow. (B) The M6 region was required but not sufficient for H2A.Z function in resistance to genotoxic stress. Ten-fold serial dilutions of strains containing the indicated ZA and AZ hybrid proteins with C-terminal 3×FLAG tags were plated and incubated on SC-TRP media containing the indicated concentrations of formamide, caffeine, and HU. (C) The M6 region from H2A.Z was required but not sufficient for binding to SWR1-C. Analytical-scale affinity purifications of FLAG-tagged hybrid proteins from cells containing affinity-tagged versions of SWR1-C subunits, Chz1 and Nap1 were performed and immunoblotted for the indicated co-purifying proteins.  Although Z-AM6 and A-ZM6 were incorporated into bulk chromatin, it is possible that the two hybrid proteins were not deposited into the correct locations in the genome, and thereby failed to complement H2A.Z functions. To test this possibility, we first performed chromatin 120  immunoprecipitation of FLAG-tagged H2A.Z, Z-AM6, and A-ZM6 proteins followed by quantitative PCR (ChIP-qPCR) of five promoters of representative genes on chromosomes 3 and 9 that are normally enriched for H2A.Z (Wang et al. 2011). At all five promoters, ZAM6 had reduced enrichment as compared to H2A.Z, while A-ZM6 was not enriched and comparable to the no tag mock IP control (Figure 4.6A). These ChIP-qPCR results indicated that the hybrids did indeed have decreased enrichment at loci normally enriched for H2A.Z, which promped me to perform ChIP followed by microarray analysis (ChIP-on-chip) to determine the genome-wide occupancy of Z-AM6 and A-ZM6 as compared to wild-type H2A.Z. Average signal profiles over open reading frames and intergenic regions were obtained and presented in Figure 4.6B. Consistent with previous studies, H2A.Z was predominantly enriched at the promoter and 5’end of genes that are transcribed less frequently as measured by production of mRNA per hour (Albert et al., 2007; Guillemette et al., 2005; Li et al., 2005). Similar to the results obtained from ChIP-qPCR analysis at individual genes, Z-AM6 also had decreased enrichment as compared to wild-type H2A.Z in the promoter and 5’end of genes (Figure 4.6B). The lower enrichment, but not complete absence at most promoters of Z-AM6 is in agreement with its mild phenotypes observed on drugs. In contrast, A-ZM6 was not enriched in intergenic regions and only slightly enriched in open reading frames of lowly transcribed genes, suggesting it is more randomly located in the genome, similar to H2A. Gene-by-gene analysis indicated that although Z-AM6 had decreased or no enrichment at most H2A.Z-occupied promoters, it was present at levels equal to H2A.Z at a small subset of promoters (Figure 4.6C, see sample region highlighted in red box), suggesting the allele encoding for Z-AM6 was hypomorphic in nature. Taken together, these results suggest that the M6 region of H2A.Z was necessary but not sufficient for its  121  functions in vivo and that the allele encoding for Z-AM6 was a hypomorph in terms of  8" 7" 6" 5"  H2A.Z&(no&tag)&  4"  H2A.Z&  3"  Z.AM6&  2"  A.ZM6&  1" 0"  GIT1% YCR095c% RDS1%  YIR042c%YIR043c%  ChrIII  ChrIX  B  ORF  3’ IGR  Relative Occupancy  Relative Occupancy  5’ IGR  A-ZM6  Z-AM6  H2A.Z  5’ IGR  ORF  3’ IGR  Relative Occupancy  A  Promoter fold enrichment /PRP8  H2A.Z functions and genome-wide localization.  5’ IGR  ORF  <1 mRNA/h 1–4 mRNA/h 4–16 mRNA/h 16–50 mRNA/h >50 mRNA/h  3’ IGR  C ChrIII  H2A.Z Z-AM6 A-ZM6  ChrV  Figure 4.6 The M6 region of H2A.Z is required but not sufficient for genome-wide localization (A) ChIP-qPCR analysis of H2A.Z enrichment at heterochromatic promoters normalized to the PRP8 ORF. Error bars represent standard deviations of values from two replicates. (B) Genome-wide average profiles of signals in relation to transcription activity obtained from anti-FLAG ChIP-chip from the indicated strains. Similar to an approach by the Young lab (Pokholok et al. 2005), each ORF was divided into 40 bins (independent of gene length), and average enrichment values were calculated for each bin. Probes in promoter regions (500 bp upstream of coding start) and 3’UTR (500 bp downstream of coding stop) were assigned to 20 bins, respectively. Genes were divided into five classes according to their transcriptional frequency (Holstege et al, 1998) and the average enrichment value for each bin was plotted for all five transcriptional classes. (C) Two sample signal profiles at chromosomes 3 and 5. Average signals are based on two independent experiments. Red box highlights an example of a promoter in which there was no change in Z-AM6 enrichment.  122  4.4 Discussion Here we have used ZA and AZ hybrid proteins to identify a region of the H2A.Z C-terminal docking domain that confers its unique biochemical stability, and is required for resistance to genotoxic stress and SWR1-C interaction. In addition, these amino acids lie within the M6 region that is required for Drosophila development (Clarkson et al., 1999). A swap mutant of the M6 region from H2A.Z with that of H2A (Z-AM6) resulted in sensitivity to genotoxic stress of yeast cells, decreased binding to SWR1-C, and decreased binding to H2A.Z-bound promoters genome-wide. The reverse swap mutant (A-ZM6) was not sufficient for restoration of the aforementioned H2A.Z functions. Surprisingly, the M6 region of H2A.Z was both required and sufficient for binding to the histone chaperone Chz1.  The M6 region, which includes the 11 residues between amino acids 98 and 108, is likely the only region in the docking domain that confers H2A.Z-specific properties, as amino acids proximal to M6 (residues 88 to 97) in the docking domain are 100% conserved between H2A.Z and H2A. The M6 region contributes to the extended acidic patch on the surface of the H2A.Z nucleosome (Suto et al., 2000). The sequence differences in this region between H2A.Z and canonical H2A include the H2A.Z D103, S104, and R107 residues (corresponding respectively to N, K and N in H2A), along with a deletion of one amino acid between H2A.Z I106 and R107, all contributing to an altered, uninterrupted acidic surface on the face of the H2A.Z-containing nucleosome. Although these differences would suggest that residues D103 and S104 may contribute to the key determinantion in the C-terminus for H2A.Z uniqueness, a recent study looking specifically at the H2A.Z acidic patch substituted these two amino acids to those of H2A (htz1-DS103,104NK) and did not detect any  123  noticeable sensitivity to genotoxic agents (Jensen et al., 2011). Our results suggest that the amino acids between 105 and 108 are the key determinants for H2A.Z uniqueness as the bulk chromatin association patterns of ZA 1-104 and ZA 1-108 were remarkably distinct and mirrored the patterns of H2A.Z and H2A, respectively. However, ZA 1-104 only partially lost binding to SWR1-C, an affect that was not as dramatic as the decrease in binding seen for Z-AM6. Taken together, it is possible that these amino acids in the M6 define H2A.Z specificity in the docking domain, but their effects can only be detected when the entire M6 is altered, potentially creating a more H2A-like nucleosome surface and interfering with H2A.Z functions.  How might these altered residues in the M6 affect the functions of H2A.Z? H2A.Z interaction with SWR1-C is a critical aspect of the unique properties of the histone variant, as well as its in vivo functions. Having dramatically reduced binding to SWR1-C substantially affected Z-AM6’s genome-wide chromatin deposition levels, suggesting SWR1-C binds to H2A.Z in its M6 region as proposed by others (Wu et al., 2005). However, it was surprising then to find that neither the reverse hybrid A-ZM6 nor the hybrid swapping the entire docking domain (AZ 98-134) interacted with SWR1-C. Thus, neither the H2A.Z M6 region nor the entire docking domain was sufficient for binding to the deposition machinery. This raises at least two possibilities for the H2A.Z and SWR1-C binding interface. First, although the M6 region directly interacts with SWR1-C, presumably through the Swc2 subunit that has direct contact with H2A.Z (Wu et al., 2005), this interaction is facilitated by other amino acids either in the histone core or the N-terminus of H2A.Z. Second, SWR1-C interacts with H2A.Z using more than one direct binding site. We propose that the second scenario is more  124  likely, as the Z-AM6 was, to some degree, still incorporated into correct genomic regions, which suggests that it retains some binding to SWR1-C, consistent with the affinity purification results and its mild phenotypes on drugs. The hypomorphic nature of the allele encoding for Z-AM6 also suggest that H2A.Z levels have gradual or step-wise decreases, rather than an all or none scenario. These data also suggest that altering the M6 region does not completely abolish SWR1-C interaction and H2A.Z function, and other binding interfaces may exist between the histone variant and SWR1-C. Consistent with this hypothesis, in addition to the subunit Swc2, the catalytic subunit Swr1 also has a direct binding surface to H2A.Z, an interaction that requires the N-terminus of Swr1 (Wu et al., 2008). Thus, this possibility can be examined in more detail in future studies by testing whether the residual occupancy of Z-AM6 at promoters is lost in either swr1Δ cells and/or swc2Δ cells. However, it may not be easy to tease apart the precise relationship between the M6 region and SWR1-C. Previous studies have demonstrated that SWR1-C is deleterious to yeast cells in the absence of H2A.Z (Halley et al., 2010; Morillo-Huesca et al., 2010), suggesting that the H2A.Z-SWR1 relationship is non-linear and potentially very complex.  Here, we have also discovered a novel function of the M6 region of H2A.Z being required for binding to the histone chaperone Chz1. Unlike SWR1-C, the M6 region of H2A.Z was sufficient in Chz1 interaction as demonstrated by the A-ZM6 hybrid. This result was surprising, especially in the context of the structure of the yeast Chz1 interaction with the Drosophila H2A.Z-H2B dimer as determined by NMR spectroscopy (Zhou et al., 2008). There are both electrostatic and hydrophobic interactions between the Chz1 and the H2A.ZH2B dimer that involve multiple residues in both H2A.Z and H2B throughout the two  125  proteins. These residues occur in the α1 helix, L1 loop, α2, α3 and αC helices of H2A.Z. Within the αC helix of H2A.Z, the residues DEE of H2A.Z corresponding to DDE99,100,101 in yeast are involved in electrostatic interactions with positively charged residues in Chz1 and mutating them results in decreased affinity of the H2A.Z-H2B dimer for Chz1 (Zhou et al., 2008). While these three amino acids reside in the M6 region, they are conserved between H2A.Z and H2A, so it is unexpected that substituting the M6 region of H2A.Z to H2A amino acids would reduce binding to Chz1. However, these results can be reconciled by the possibility that altering the M6 of H2A.Z significantly impacts the acidic patch surface of the H2A.Z-H2B dimer and that this area is of key importance to interaction with the histone chaperone. Thus, due to the significant change of the acidic patch surface in the Z-AM6 hybrid, the Chz1 interaction was likely substantially affected resulting in decreased binding affinity. Similarly, the A-ZM6 hybrid was capable of binding to Chz1 because this region was sufficient for the interaction. Although the α1 helix, L1 loop, α2 and α3 helices of H2A.Z are involved in the Chz1 interaction, 4 out of the 9 amino acids in these regions responsible for electrostatic and hydrophobic interactions are conserved with canonical H2A, suggesting these residues from H2A are sufficient for the interaction.  126  Chapter 5: Conclusion  Ever since the initial revolutionary discovery of the nucleosome in the early 1970s (Kornberg, 1974; Olins and Olins, 1974), the field of chromatin structure and its related functions in genome regulation has made significant advancements. From the wealth of information that we have gained, it is clear that understanding chromatin structure and function is an essential component to the understanding of all cellular processes that require access to the underlying DNA template. However, not all chromatin is created equal, and many studies over the years have contributed to the discoveries of histone modifications, chromatin-remodeling complexes, and the existence of histone variants that modify local chromatin structure. Histone variants provide an ideal model to study how changes in local chromatin structure affect cellular processes as they alter the inherent nucleosome composition of specific regions of the genome, allowing for precise and unique functions. The histone variant H2A.Z, a variant of canonical H2A, has been studied extensively over the past decade. Although these efforts led to the many cellular functions that H2A.Z has been implicated in, as well as its genome-wide occupancy, many questions are still largely unanswered.  My dissertation contributes to the biology of H2A.Z, specifically characterizing the structure and function of a previously poorly understood chromatin modifier domain that is required for H2A.Z deposition and acetylation, and determining the amino acids on the H2A.Z Cterminal docking domain that are required for its function as well as amino acids that confer H2A.Z-specific functions. 127  I present work in Chapter 2 that elucidates the structure and function of the Yaf9 YEATS domain. Building upon previous reports that loss of Yaf9 affects the ability of H2A.Z to be exchanged in vitro (Wu et al., 2005) and also its deposition and acetylation in vivo (Keogh et al., 2006; Zhang et al., 2005), I found that specifically the Yaf9 YEATS domain is required for H2A.Z deposition and acetylation. In this regard, as the Yaf9 YEATS domain has no known catalytic activity, it most likely acts as an auxiliary domain to facilitate the enzymatic actions of the SWR1-C and NuA4 complexes. What is this auxiliary function that Yaf9 plays in the deposition of H2A.Z? Based on previous reports and the evidence presented in Chapter 2, we can speculate on the type of auxiliary role Yaf9 has in these two complexes. Loss of Yaf9 does not affect the complex integrity of SWR1-C (Wu et al., 2005; Zhang et al., 2004), so presumably SWR1-C remains intact in yaf9Δcells and yet is unable to deposit H2A.Z into chromatin. Perhaps the YEATS domain of Yaf9 acts as a ‘reader’ domain by binding to modified histones H3, H4 or both and recruits SWR1-C and NuA4 to chromatin, much like how bromodomains and chromodomains recruit their resident complexes to chromatin. It is also possible that the YEATS domain of Yaf9 can bind to DNA, since it has both positivelyand negatively-charged surfaces, and which can potentially facilitate its histone binding ability. DNA-binding capabilities have been demonstrated for other signature domains like the SANT domain (Ryan et al., 2011; Sharma et al., 2011), which also resides in a shared subunit of SWR1-C and NuA4 (Swc4). However, there currently is no evidence that Yaf9 or any other YEATS-domain containing protein has the ability to bind modified histones or DNA. Nevertheless, upon a more in-depth modeling analysis of the Yaf9 YEATS domain structure, we suggest that one of the distinguishing features in the YEATS domain that has a  128  shallow groove and harbors a hydrophobic groove is, in fact, an acetyl-lysine binding pocket (Schulze et al., 2010). This proposal raises interesting questions - like which particular acetyl-lysine does Yaf9 bind to? And what is the function of this potential interaction? As the structure of the Yaf9 YEATS domain is very similar to histone chaperone Asf1, one obvious target candidate for the putative acetyl-lysine pocket of Yaf9 is the binding target of Asf1 – the acetyl mark on H3 lysine 56 (H3K56ac). The fact that YAF9 interacts genetically with ASF1 lends further support to the idea that Yaf9 and Asf1 share a common function and that function might involve the ability to bind H3K56ac. It is known that Asf1/H3K56ac is required for chromatin assembly and checkpoint recovery after DNA repair, leading to the inactivation of the DNA damage checkpoint and cell survival (Downs, 2008). The SWR1-C and NuA4 complexes also have important roles during the DNA damage response and both are recruited to DNA damage sites together with the INO80 complex (Bird et al., 2002; Downs et al., 2004; Papamichos-Chronakis et al., 2006; van Attikum et al., 2007). Arp4, another member of the shared module of SWR1-C and NuA4, and also part of INO80, recruits these complexes to double strand breaks through an interaction with phosphorylated H2A.X, a well-established mark in the DNA damage response (Bird et al., 2002; Downs et al., 2004). Interestingly, Arp4 is required for Yaf9 association with SWR1-C (Wu et al., 2009), and therefore these two subunits of the shared module of SWR1-C and NuA4 might work together during the DNA damage response to recruit their resident complexes to DNA damage sites. Yaf9, via its YEATS domain, perhaps binds to the H3K56ac mark during the DNA repair process. Although this hypothesis is consistent with data presented in Chapter 2, the ability of Yaf9 to recruit SWR1-C or NuA4 to DNA damage sites has not been tested and  129  is thus a crucial piece of information if this proposed function of YEATS domain is to be examined in more detail.  Further supporting the functional link between Yaf9 and the H3K56ac mark, data in Chapter 2 show that promoters containing H3K56ac preferentially lost H2A.Z in a YEATS domain mutant, suggesting a potential interesting relationship between SWR1-C and H3K56ac in transcription. These data coincide with recent reports that Asf1 and H3K56ac are required for maximal induced transcription of a metabolic gene (Lin and Schultz, 2011) and that Asf1 is required for maintenance of promoter fidelity (Silva et al., 2012).  As part of the shared module of SWR1-C and NuA4, the Yaf9 YEATS domain could also be an important player in a current model of the shared module during transcription (Lu et al. 2009). The model suggests that NuA4 initially acetylates H4 at promoters, which is recognized and bound by the bromodomains of the Bdf1 subunit of SWR1-C, which subsequently recruits SWR1-C to deposit H2A.Z, and also NuA4 to acetylate H2A.Z. Thus, Yaf9 may play an analogous role to Bdf1 via its YEATS domain, by binding to acetylated H4 and recruiting SWR1-C and NuA4 to chromatin. This is in line with data from Chapter 2 in which disrupting the Yaf9 YEATS domain results in the loss of H2A.Z at specific promoters. However, more experimentation is needed to address this scenario, including chromatin immunoprecipitation of SWR1-C and NuA4, either at specific sites or genomewide, in the absence of the Yaf9 YEATS domain.  130  The similarity in structure and function between the Yaf9 YEATS domain and histone chaperone Asf1 provides another interesting possibility for a more general function of the YEATS domain. The Yaf9 YEATS domain has a β-sandwich characteristic of the Ig fold family and is very similar to the β-sandwich structure of Asf1. Similarly, Yaf9 is capable of binding to histones H3 and H4 in vitro, a function that is well established for Asf1 in its role as a histone chaperone. Yaf9 has never been classified as a histone chaperone prior to its structure determination, but has been proposed recently to be of the same β-sandwich structural family of histone chaperones as Asf1 (Das et al., 2010). If Yaf9 indeed turns out to have histone chaperone-like functions, it will be the first of its kind that exists within both a chromatin-remodeling complex and a HAT complex. This would have profound implications to the other two YEATS-domain containing proteins in yeast, Taf14 and Sas5, which also are present in complexes involved in chromatin-remodeling and transcription. Although the YEATS domains of Taf14 and Sas5 are conserved with that of Yaf9, they cannot replace the function of Yaf9’s YEATS domain in yeast (Phoebe Lu, unpublished data), suggesting the three YEATS domains are not redundant and have unique functions within the cell. Thus, perhaps other subunits and domains that are present in their respective complexes determine which histone marks the three YEATS domains are capable of binding to. In this regard, the YEATS domain may be a context-dependent signature domain that works closely with other signature domains to achieve a specific function, which is consistent with the fact that together, the three YEATS-domain containing proteins are members of 8 complexes involved in chromatin remodeling and transcription (Schulze et al., 2009b).  131  The Yaf9 YEATS domain mutants that I created in Chapter 2 will be useful in investigating other aspects of Yaf9 function, including a curious interaction with Mps2 (monopolar spindle 2) and Bbp1, both part of the spindle pole body (SPB) and nuclear envelope (Le Masson et al., 2003). Interestingly, H2A.Z interacts with Mps3, another SPB and nuclear envelope protein, independent of chromatin, SWR1-C, Chz1, and Nap1 (Gardner et al., 2011). The H2A.Z-Mps3 interaction is highly specific and does not require the M6 region that is central to Chapter 4 of this dissertation, but instead requires regions in the N-terminus and histonefold of the histone variant. This result is consistent with my findings that the M6 region of H2A.Z is required for its interaction with chromatin and SWR1-C. Thus, it will be interesting to study whether H2A.Z and Yaf9 work together or independently at the spindle pole body and nuclear envelope, and whether the YEATS domain of Yaf9 is required for this specific function.  My work in Chapter 2, therefore, provides the Yaf9 YEATS domain as another key player in the mechanism of H2A.Z deposition in chromatin and also opens the door for future experiments to examine the exact function of Yaf9 in the H2A.Z incorporation pathway. This is especially important given our lack of knowledge regarding the specific functions of individual SWR1-C subunits, with the exception of the catalytic subunit Swr1 and the H2A.Z-binding module Swc2 (Mizuguchi et al., 2004; Wu et al., 2005). Previous work have identified that both Swr1 and Swc2 subunits as having direct binding capability to H2A.Z and proposed that one SWR1-C can bind two H2A.Z-H2B dimers through Swr1 and Swc2 (Wu et al., 2008; Wu et al., 2005).  132  My work in Chapter 4 supports this idea as the M6 region of the H2A.Z C-terminal docking domain is required but not sufficient for SWR1-C interaction, suggesting other SWR1-C binding sites exist more proximal to the docking domain of H2A.Z. In addition, disrupting the SWR1-C binding site at the M6 region leads to partial and not complete loss of function of H2A.Z, adding further support to the dual binding capability of SWR1-C. Moreover, the surprising finding that M6 is also required and sufficient for binding to the histone chaperone Chz1 creates further complexity in the relationship between H2A.Z interaction partners. It is tempting to speculate, therefore, that SWR1-C and Chz1 either have a competitive relationship for H2A.Z-H2B dimers, or they work together to relay the histone dimers to each other in a linear fashion. It is also possible that both scenarios can occur together as the competitive relationship contributes to the passage of H2A.Z-H2B dimers from Chz1 to SWR1-C, and possibly vice versa. This hypothesis is consistent with a previous study that demonstrated that Chz1 is displaced from H2A.Z-H2B upon binding of the dimer to Swc2 and is capable of transferring H2A.Z-H2B dimers to SWR1-C for subsequent replacement to a canonical nucleosome (Luk et al., 2007). Since both Chz1 and Swc2 require the M6 region of H2A.Z for interaction, it remains to be tested which amino acids form a binding interface between H2A.Z and the Swr1 subunit. My data in Chapters 3 and 4 show that the histone chaperone Nap1 does not have a binding interface with the H2A.Z C-terminus, and therefore possibly binds to the N-terminus or histone core of the variant. The fact that Nap1 and Chz1 may bind to different regions on H2A.Z is consistent with their redundant functions in binding soluble pools of H2A.Z-H2B dimers and delivering them to SWR1-C (Luk et al., 2007).  133  The recent finding, in which I have made contributions to, that SWR1-C is deleterious to yeast cells when H2A.Z is absent (Halley et al., 2010; Morillo-Huesca et al., 2010) adds another layer of complexity to the H2A.Z-SWR1 relationship. It is proposed that the function of SWR1-C, in the absence of H2A.Z, might be doing something harmful to those nucleosomes that are normally destined to receive H2A.Z. What does this mean for the M6 region of H2A.Z? It is conceivable that the decreased interaction of SWR1-C to H2A.Z when M6 is swapped to that of H2A partially relieves SWR1-C from chromatin, and thereby also eases SWR1-C’s harmful effects. It will be useful in future studies to investigate in more detail the promoters that have decreased enrichment of the hybrid Z-AM6, whether they are completely lost in cells lacking SWR1-C components, and how they compare with the promoters that lose H2A.Z when the YEATS domain of Yaf9 is compromised.  Although the N-terminus of histones H2A and H2A.Z have been studied extensively, especially in regards to their acetylated residues and associated functions, the C-terminus has not been characterized in detail until recently. The C-terminus is the site of the greatest sequence variations within the H2A family of histones, and indeed contributes significantly to the unique functions of H2A family members. The histone variants H2A.X, macroH2A, and H2A.Bbd all have distinguishing features in their C-termini (Talbert and Henikoff, 2010). H2A.X has a SQEL motif that is phosphorylated upon DNA damage and helps to recruit and/or retain DNA repair proteins, histone modifying enzymes and chromatin remodeling complexes. MacroH2A has an extended >200 residue C-terminal domain and is enriched in the inactive X chromosome in higher eukaryotes. H2A.Bbd, which is a mammalspecific variant that seems to be associated with active chromatin and is deficient from the  134  inactive X chromosome, has a truncated C-terminal docking domain and lacks an acidic patch, making H2A.Bbd nucleosomes less stable. H2A.Lap1, a recently discovered mouse H2A variant that is most similar to H2A.Bbd and is only expressed during specific stages of spermatogenesis, exhibits a single amino acid difference from H2A.Bbd in the C-terminal αhelix that imparts unique folding properties to a nucleosomal array (Soboleva et al., 2012). Therefore, it is not unreasonable to expect the C-terminus of the more ubiquitous variant H2A.Z to also harbor its unique features, as my work in Chapter 4 has demonstrated. Taken together, my dissertation contributes to the idea that the C-terminus is a functionally defining region of the H2A family of histone variants and an area that is susceptible to evolutionary changes, evolving drastically to take on new functions in the case of each unique variant.  However, my results from Chapters 3 and 4 demonstrate that the last 26 amino acids of H2A.Z are fully replaceable by the corresponding region from canonical H2A, indicating the C-terminal tail is not only an area of uniqueness between H2A variants, but also one that shares similar functions. Supporting my results that the last 20 amino acids of the H2A.Z docking domain are required for chromatin anchoring is the recent discovery of a human splice variant of H2A.Z, H2A.Z.2.2, which has a truncated and distinct C-terminus that causes severe nucleosome destabilization (Bonisch et al., 2012; Wratting et al., 2012). The chromatin stabilization role provided by the C-terminus of H2A.Z is analogous to evidence that the H2A C-terminal tail is also required for nucleosome stability and mobility (Vogler et al., 2010). Thus, a prevailing theme of the functions that lie within the C-terminus of H2A family members is a nucleosome stabilization/destabilization role. Each H2A family member has a unique C-terminus that allows for a certain degree of stabilization, enabling it to be  135  folded a certain way in a nucleosome array and ultimately conferring its specialized functions in specific locations in the genome. Beyond H2A.Z and H2A stabilization differences, which are still controversial as described in Chapter 1, the C-terminal docking domain appears to impart other differences that regulate interactions to associated protein factors, as my data from Chapters 3 and 4 have demonstrated for SWR1-C and Chz1 in the case of H2A.Z, and another study has demonstrated for linker histone H1 and ISWI-type of remodelers in the case of H2A (Vogler et al., 2010).  The ability of H2A to replace H2A.Z in its last 26 amino acids also suggest that the unique H2A.Z functions that are conferred by the last 26 amino acids are nonessential to the histone variant, or at least not detectable using my assays. For example, H2A.Z is sumoylated on lysines 126 and 127 in its C-terminus in response to DNA damage and its sumoylated form is required for the relocation of persistent unrepaired DSBs to the nuclear periphery (Kalocsay et al., 2009). Because the sumoylation only occurs during and is required for the DNA damage response, its effects may not be detectable under our conditions. In addition, the genetic interaction results provided by the E-MAP analyses in Chapter 3 demonstrated a more nuanced effect of the truncation mutants, which suggests that the phenotypes on drugs are a result of more specific versus global effects. This idea is perhaps not as surprising as we first believed it to be when taking into account everything we know so far about H2A.Z and the effects of cells that lack the histone variant. Due to the high resistance of cells to the loss of H2A.Z and also the minimal gene expression effects under normal conditions, global effects of H2A.Z mutants are conceivably not easy to detect. However, there is a growing list of genes that are affected under specific conditions in cells lacking H2A.Z. Besides the initial  136  inducible genes that involve H2A.Z function, genes that are turned on in response to heatshock (Zanton and Pugh, 2006) and fatty acids (Wan et al., 2009) also involve H2A.Z at their promoters. Evidence that H2A.Z is required for genes to be turned on during specific stages of the cell cycle (Dhillon et al., 2006) further suggest that the function of H2A.Z in gene expression is highly context-specific. Moreover, genes encoding for H2A.Z and components of the SWR1-C appear to be some of the most ubiquitous in genetic interaction networks (Fiedler et al., 2009; Keogh et al., 2005; Wilmes et al., 2008; Zheng et al., 2010), suggesting that H2A.Z function is easily perturbed in the absence of other genes. It also appears that H2A.Z is not unique in its gene-dependent effects as many other chromatin-related factors also display similar gene-dependent effects (Lenstra et al., 2011). To fully understand H2A.Z functions, we need to study the histone variant when cells are already undergoing a certain amount of stress, whether that stress results from heat-shock, different stages of the cell cycle, absence of nutrients, or absence of certain genes. Therefore, it is imperative that future studies on histone variant H2A.Z are more context- and condition-specific as its functions cannot be justifiably detected under steady state conditions.  As the hybrid-construct approach I have used in Chapters 3 and 4 have proven to be useful for deciphering H2A.Z/H2A similarities and differences, it could prove an effective tool for resolving the issue of nucleosome stability differences between the two histones. As the acidic patch of H2A.Z has been shown to mediate chromatin fiber folding (Fan et al., 2004), an H2A.Z/H2A hybrid approach can also be used to elucidate the role of H2A.Z in higher order chromatin structure, a function that we know very little about. In this regard, the localization of H2A.Z to both promoters and enhancers in higher eukaryotes suggest H2A.Z  137  could have a potential role in chromatin looping, which often occurs to facilitate long-range communications between cis-regulatory elements. Involvement of the histone variant in these higher-order chromatin structures can be tested, especially with the advent of recent technologies such as 3C (Chromosome Conformation Capture) and its various derivatives, as well as EM (Electron Microscopy) and cryo-EM that allow for higher structure resolutions.  Although yeast has been a highly useful model organism to study H2A.Z functions and mechanisms that are conserved in higher eukaryotes, there are certain processes that involve H2A.Z in higher organisms that cannot be adequately addressed in yeast. For example, H2A.Z has important roles in embryonic stem cell differentiation and embryotic development in organisms like Drosophila and mouse (Clarkson et al., 1999; Creyghton et al., 2008; Ridgway et al., 2004). In addition, there is an interesting antagonistic relationship between DNA methylation and H2A.Z occupancy in plants (Zilberman et al., 2008) and a mouse Bcell lymphoma model (Conerly et al., 2010). It has been proposed that the DNA methylation machinery can discriminate between H2A.Z and canonical H2A nucleosomes through either unique post-translational modifications or the recruitment of a demethylase by H2A.Z (Kobor and Lorincz, 2009). This hypothesis can also be tested using an H2A.Z/H2A hybrid approach with a combination of ChIP-seq and high throughput protein purifications. Taken together, the hybrid construct approach that I have used in Chapters 3 and 4 can be adapted to plants and higher eukaryotes to further help define the regions of H2A.Z that are required and sufficient for specific functions in these organisms.  138  In closing, although there are specific cellular processes that cannot be addressed in yeast, many of the basic mechanisms and structure-function relationships that we discover and learn about from yeast have profound implications to human health and disease. Besides having important roles in genome integrity and development, the histone variant H2A.Z also plays roles in various forms of breast cancers (Gevry et al., 2009; Hua et al., 2008), and has been proposed to serve as a new target of breast cancer therapy (Rangasamy, 2010). Thus, deciphering the residues that are important for its function and residues that distinguish it from canonical H2A are essential to discovering future therapies relating to H2A.Z. In addition, our structural determination and functional analyses of the YEATS domain of Yaf9 opens the door for future structure-function studies of YEATS domain containing proteins in human like ENL and AF9, which are frequent fusion partners with the mixed lineage leukemia protein MLL. More recently, mutations in SRCAP, the SWR1-C analog in human, have been found to cause the rare disease Floating-Harbor Syndrome (Hood et al., 2012), adding another avenue in which understanding the H2A.Z-SWR1 relationship will contribute to human heath and disease.  139  Bibliography Abbott, D.W., Ivanova, V.S., Wang, X., Bonner, W.M., and Ausio, J. (2001). Characterization of the stability and folding of H2A.Z chromatin particles: implications for transcriptional activation. J Biol Chem 276, 41945-41949. Adam, M., Robert, F., Larochelle, M., and Gaudreau, L. (2001). H2A.Z is required for global chromatin integrity and for recruitment of RNA polymerase II under specific conditions. Mol Cell Biol 21, 6270-6279. Adkins, M.W., Williams, S.K., Linger, J., and Tyler, J.K. (2007). Chromatin disassembly from the PHO5 promoter is essential for the recruitment of the general transcription machinery and coactivators. Mol Cell Biol 27, 6372-6382. Alabert, C., and Groth, A. (2012). Chromatin replication and epigenome maintenance. Nat Rev Mol Cell Biol 13, 153-167. Albert, I., Mavrich, T.N., Tomsho, L.P., Qi, J., Zanton, S.J., Schuster, S.C., and Pugh, B.F. (2007). Translational and rotational settings of H2A.Z nucleosomes across the Saccharomyces cerevisiae genome. Nature 446, 572-576. Allis, C.D., Glover, C.V., Bowen, J.K., and Gorovsky, M.A. (1980). Histone variants specific to the transcriptionally active, amitotically dividing macronucleus of the unicellular eucaryote, Tetrahymena thermophila. Cell 20, 609-617. Andrews, A.J., Chen, X., Zevin, A., Stargell, L.A., and Luger, K. (2010). The histone chaperone Nap1 promotes nucleosome assembly by eliminating nonnucleosomal histone DNA interactions. Mol Cell 37, 834-842. Antczak, A.J., Tsubota, T., Kaufman, P.D., and Berger, J.M. (2006). Structure of the yeast histone H3-ASF1 interaction: implications for chaperone mechanism, species-specific interactions, and epigenetics. BMC Struct Biol 6, 26.  140  Arents, G., Burlingame, R.W., Wang, B.C., Love, W.E., and Moudrianakis, E.N. (1991). The nucleosomal core histone octamer at 3.1 A resolution: a tripartite protein assembly and a lefthanded superhelix. Proc Natl Acad Sci U S A 88, 10148-10152. Ausio, J., and Abbott, D.W. (2002). The many tales of a tail: carboxyl-terminal tail heterogeneity specializes histone H2A variants for defined chromatin function. Biochemistry 41, 5945-5949. Ausubel, F.M. (1987a). Current protocols in molecular biology (New York, N.Y., J. Wiley). Ausubel, F.M. (1987b). Current protocols in molecular biology. Babiarz, J.E., Halley, J.E., and Rine, J. (2006). Telomeric heterochromatin boundaries require NuA4-dependent acetylation of histone variant H2A.Z in Saccharomyces cerevisiae. Genes Dev 20, 700-710. Bannister, A.J., and Kouzarides, T. (2011). Regulation of chromatin by histone modifications. Cell Res 21, 381-395. Barski, A., Cuddapah, S., Cui, K., Roh, T.Y., Schones, D.E., Wang, Z., Wei, G., Chepelev, I., and Zhao, K. (2007). High-resolution profiling of histone methylations in the human genome. Cell 129, 823-837. Bird, A.W., Yu, D.Y., Pray-Grant, M.G., Qiu, Q., Harmon, K.E., Megee, P.C., Grant, P.A., Smith, M.M., and Christman, M.F. (2002). Acetylation of histone H4 by Esa1 is required for DNA double-strand break repair. Nature 419, 411-415. Bittner, C.B., Zeisig, D.T., Zeisig, B.B., and Slany, R.K. (2004). Direct physical and functional interaction of the NuA4 complex components Yaf9p and Swc4p. Eukaryot Cell 3, 976-983. Bonisch, C., Schneider, K., Punzeler, S., Wiedemann, S.M., Bielmeier, C., Bocola, M., Eberl, H.C., Kuegel, W., Neumann, J., Kremmer, E., et al. (2012). H2A.Z.2.2 is an alternatively spliced histone H2A.Z variant that causes severe nucleosome destabilization. Nucleic Acids Res. 141  Bork, P., Holm, L., and Sander, C. (1994). The immunoglobulin fold. Structural classification, sequence patterns and common core. J Mol Biol 242, 309-320. Brickner, D.G., Cajigas, I., Fondufe-Mittendorf, Y., Ahmed, S., Lee, P.C., Widom, J., and Brickner, J.H. (2007). H2A.Z-mediated localization of genes at the nuclear periphery confers epigenetic memory of previous transcriptional state. PLoS Biol 5, e81. Brogaard, K., Xi, L., Wang, J.P., and Widom, J. (2012). A map of nucleosome positions in yeast at base-pair resolution. Nature 486, 496-501. Brownell, J.E., Zhou, J., Ranalli, T., Kobayashi, R., Edmondson, D.G., Roth, S.Y., and Allis, C.D. (1996). Tetrahymena histone acetyltransferase A: a homolog to yeast Gcn5p linking histone acetylation to gene activation. Cell 84, 843-851. Cedar, H., and Bergman, Y. (2009). Linking DNA methylation and histone modification: patterns and paradigms. Nat Rev Genet 10, 295-304. Chakravarthy, S., Park, Y.J., Chodaparambil, J., Edayathumangalam, R.S., and Luger, K. (2005). Structure and dynamic properties of nucleosome core particles. FEBS Lett 579, 895898. Clapier, C.R., and Cairns, B.R. (2009). The biology of chromatin remodeling complexes. Annu Rev Biochem 78, 273-304. Clarkson, M.J., Wells, J.R., Gibson, F., Saint, R., and Tremethick, D.J. (1999). Regions of variant histone His2AvD required for Drosophila development. Nature 399, 694-697. Collins, S.R., Roguev, A., and Krogan, N.J. (2010). Quantitative genetic interaction mapping using the E-MAP approach. Methods Enzymol 470, 205-231. Conerly, M.L., Teves, S.S., Diolaiti, D., Ulrich, M., Eisenman, R.N., and Henikoff, S. (2010). Changes in H2A.Z occupancy and DNA methylation during B-cell lymphomagenesis. Genome Res 20, 1383-1390.  142  Cowtan, K. (1994). 'DM': An Automated Procedure for Phase Improvement by Density Modification. Joint CCP4 and ESF-EACBM Newsletter on Protein Crystallography 31, 3438. Creyghton, M.P., Markoulaki, S., Levine, S.S., Hanna, J., Lodato, M.A., Sha, K., Young, R.A., Jaenisch, R., and Boyer, L.A. (2008). H2AZ is enriched at polycomb complex target genes in ES cells and is necessary for lineage commitment. Cell 135, 649-661. Das, C., Tyler, J.K., and Churchill, M.E. (2010). The histone shuffle: histone chaperones in an energetic dance. Trends Biochem Sci 35, 476-489. Daser, A., and Rabbitts, T.H. (2004). Extending the repertoire of the mixed-lineage leukemia gene MLL in leukemogenesis. Genes Dev 18, 965-974. Dhillon, N., Oki, M., Szyjka, S.J., Aparicio, O.M., and Kamakaka, R.T. (2006). H2A.Z functions to regulate progression through the cell cycle. Mol Cell Biol 26, 489-501. Dion, M.F., Kaplan, T., Kim, M., Buratowski, S., Friedman, N., and Rando, O.J. (2007). Dynamics of replication-independent histone turnover in budding yeast. Science 315, 14051408. Dorigo, B., Schalch, T., Bystricky, K., and Richmond, T.J. (2003). Chromatin fiber folding: requirement for the histone H4 N-terminal tail. J Mol Biol 327, 85-96. Downs, J.A. (2008). Histone H3 K56 acetylation, chromatin assembly, and the DNA damage checkpoint. DNA Repair (Amst) 7, 2020-2024. Downs, J.A., Allard, S., Jobin-Robitaille, O., Javaheri, A., Auger, A., Bouchard, N., Kron, S.J., Jackson, S.P., and Cote, J. (2004). Binding of chromatin-modifying activities to phosphorylated histone H2A at DNA damage sites. Mol Cell 16, 979-990. Downs, J.A., Lowndes, N.F., and Jackson, S.P. (2000). A role for Saccharomyces cerevisiae histone H2A in DNA repair. Nature 408, 1001-1004.  143  Doyon, Y., and Cote, J. (2004). The highly conserved and multifunctional NuA4 HAT complex. Curr Opin Genet Dev 14, 147-154. Eberharter, A., and Becker, P.B. (2004). ATP-dependent nucleosome remodelling: factors and functions. J Cell Sci 117, 3707-3711. English, C.M., Adkins, M.W., Carson, J.J., Churchill, M.E., and Tyler, J.K. (2006). Structural basis for the histone chaperone activity of Asf1. Cell 127, 495-508. Faast, R., Thonglairoam, V., Schulz, T.C., Beall, J., Wells, J.R., Taylor, H., Matthaei, K., Rathjen, P.D., Tremethick, D.J., and Lyons, I. (2001). Histone variant H2A.Z is required for early mammalian development. Curr Biol 11, 1183-1187. Fan, J.Y., Gordon, F., Luger, K., Hansen, J.C., and Tremethick, D.J. (2002). The essential histone variant H2A.Z regulates the equilibrium between different chromatin conformational states. Nat Struct Biol 9, 172-176. Fan, J.Y., Rangasamy, D., Luger, K., and Tremethick, D.J. (2004). H2A.Z alters the nucleosome surface to promote HP1alpha-mediated chromatin fiber folding. Mol Cell 16, 655-661. Fiedler, D., Braberg, H., Mehta, M., Chechik, G., Cagney, G., Mukherjee, P., Silva, A.C., Shales, M., Collins, S.R., van Wageningen, S., et al. (2009). Functional organization of the S. cerevisiae phosphorylation network. Cell 136, 952-963. Fischer, U., Heckel, D., Michel, A., Janka, M., Hulsebos, T., and Meese, E. (1997). Cloning of a novel transcription factor-like gene amplified in human glioma including astrocytoma grade I. Hum Mol Genet 6, 1817-1822. Funakoshi, M., and Hochstrasser, M. (2009). Small epitope-linker modules for PCR-based Cterminal tagging in Saccharomyces cerevisiae. Yeast 26, 185-192. Gardner, J.M., Smoyer, C.J., Stensrud, E.S., Alexander, R., Gogol, M., Wiegraebe, W., and Jaspersen, S.L. (2011). Targeting of the SUN protein Mps3 to the inner nuclear membrane by the histone variant H2A.Z. J Cell Biol 193, 489-507. 144  Gelato, K.A., and Fischle, W. (2008). Role of histone modifications in defining chromatin structure and function. Biol Chem 389, 353-363. Gelbart, M.E., Rechsteiner, T., Richmond, T.J., and Tsukiyama, T. (2001). Interactions of Isw2 chromatin remodeling complex with nucleosomal arrays: analyses using recombinant yeast histones and immobilized templates. Mol Cell Biol 21, 2098-2106. Gevry, N., Chan, H.M., Laflamme, L., Livingston, D.M., and Gaudreau, L. (2007). p21 transcription is regulated by differential localization of histone H2A.Z. Genes Dev 21, 18691881. Gevry, N., Hardy, S., Jacques, P.E., Laflamme, L., Svotelis, A., Robert, F., and Gaudreau, L. (2009). Histone H2A.Z is essential for estrogen receptor signaling. Genes Dev 23, 15221533. Gligoris, T., Thireos, G., and Tzamarias, D. (2007). The Tup1 corepressor directs Htz1 deposition at a specific promoter nucleosome marking the GAL1 gene for rapid activation. Mol Cell Biol 27, 4198-4205. Goldberg, A.D., Allis, C.D., and Bernstein, E. (2007). Epigenetics: a landscape takes shape. Cell 128, 635-638. Gordon, F., Luger, K., and Hansen, J.C. (2005). The core histone N-terminal tail domains function independently and additively during salt-dependent oligomerization of nucleosomal arrays. J Biol Chem 280, 33701-33706. Guillemette, B., Bataille, A.R., Gevry, N., Adam, M., Blanchette, M., Robert, F., and Gaudreau, L. (2005). Variant histone H2A.Z is globally localized to the promoters of inactive yeast genes and regulates nucleosome positioning. PLoS Biol 3, e384. Guillemette, B., and Gaudreau, L. (2006). Reuniting the contrasting functions of H2A.Z. Biochem Cell Biol 84, 528-535.  145  Halley, J.E., Kaplan, T., Wang, A.Y., Kobor, M.S., and Rine, J. (2010). Roles for H2A.Z and its acetylation in GAL1 transcription and gene induction, but not GAL1-transcriptional memory. PLoS Biol 8, e1000401. Hancock, R. (1969). Conservation of histones in chromatin during growth and mitosis in vitro. J Mol Biol 40, 457-466. Henikoff, S., and Ahmad, K. (2005). Assembly of variant histones into chromatin. Annu Rev Cell Dev Biol 21, 133-153. Holm, L., and Sander, C. (1995). Dali: a network tool for protein structure comparison. Trends Biochem Sci 20, 478-480. Hood, R.L., Lines, M.A., Nikkel, S.M., Schwartzentruber, J., Beaulieu, C., Nowaczyk, M.J., Allanson, J., Kim, C.A., Wieczorek, D., Moilanen, J.S., et al. (2012). Mutations in SRCAP, encoding SNF2-related CREBBP activator protein, cause Floating-Harbor syndrome. Am J Hum Genet 90, 308-313. Hua, S., Kallen, C.B., Dhar, R., Baquero, M.T., Mason, C.E., Russell, B.A., Shah, P.K., Liu, J., Khramtsov, A., Tretiakova, M.S., et al. (2008). Genomic analysis of estrogen cascade reveals histone variant H2A.Z associated with breast cancer progression. Mol Syst Biol 4, 188. Huang, H., Maertens, A.M., Hyland, E.M., Dai, J., Norris, A., Boeke, J.D., and Bader, J.S. (2009). HistoneHits: a database for histone mutations and their phenotypes. Genome Res 19, 674-681. Iouzalen, N., Moreau, J., and Mechali, M. (1996). H2A.ZI, a new variant histone expressed during Xenopus early development exhibits several distinct features from the core histone H2A. Nucleic Acids Res 24, 3947-3952. Ishibashi, T., Dryhurst, D., Rose, K.L., Shabanowitz, J., Hunt, D.F., and Ausio, J. (2009). Acetylation of vertebrate H2A.Z and its effect on the structure of the nucleosome. Biochemistry 48, 5007-5017.  146  Jackson, J.D., and Gorovsky, M.A. (2000). Histone H2A.Z has a conserved function that is distinct from that of the major H2A sequence variants. Nucleic Acids Res 28, 3811-3816. Jansen, A., and Verstrepen, K.J. (2011). Nucleosome positioning in Saccharomyces cerevisiae. Microbiol Mol Biol Rev 75, 301-320. Jensen, K., Santisteban, M.S., Urekar, C., and Smith, M.M. (2011). Histone H2A.Z acid patch residues required for deposition and function. Mol Genet Genomics 285, 287-296. Jiang, C., and Pugh, B.F. (2009). Nucleosome positioning and gene regulation: advances through genomics. Nat Rev Genet 10, 161-172. Jin, C., Zang, C., Wei, G., Cui, K., Peng, W., Zhao, K., and Felsenfeld, G. (2009). H3.3/H2A.Z double variant-containing nucleosomes mark 'nucleosome-free regions' of active promoters and other regulatory regions. Nat Genet 41, 941-945. Jin, J., Cai, Y., Li, B., Conaway, R.C., Workman, J.L., Conaway, J.W., and Kusch, T. (2005). In and out: histone variant exchange in chromatin. Trends Biochem Sci 30, 680-687. Johnson, W.E., Li, W., Meyer, C.A., Gottardo, R., Carroll, J.S., Brown, M., and Liu, X.S. (2006). Model-based analysis of tiling-arrays for ChIP-chip. Proc Natl Acad Sci U S A 103, 12457-12462. Johnston, M. (1987). A model fungal gene regulatory mechanism: the GAL genes of Saccharomyces cerevisiae. Microbiol Rev 51, 458-476. Jones, T.A., and Kjeldgaard, M. (1997). O - the manual, ver. 5.10 (Uppsala). Kadauke, S., and Blobel, G.A. (2009). Chromatin loops in gene regulation. Biochim Biophys Acta 1789, 17-25. Kalocsay, M., Hiller, N.J., and Jentsch, S. (2009). Chromosome-wide Rad51 spreading and SUMO-H2A.Z-dependent chromosome fixation in response to a persistent DNA doublestrand break. Mol Cell 33, 335-343.  147  Kaplan, N., Moore, I.K., Fondufe-Mittendorf, Y., Gossett, A.J., Tillo, D., Field, Y., LeProust, E.M., Hughes, T.R., Lieb, J.D., Widom, J., et al. (2009). The DNA-encoded nucleosome organization of a eukaryotic genome. Nature 458, 362-366. Katoh, K., Kuma, K., Toh, H., and Miyata, T. (2005). MAFFT version 5: improvement in accuracy of multiple sequence alignment. Nucleic Acids Res 33, 511-518. Kawano, A., Hayashi, Y., Noguchi, S., Handa, H., Horikoshi, M., and Yamaguchi, Y. (2011). Global analysis for functional residues of histone variant Htz1 using the comprehensive point mutant library. Genes Cells 16, 590-607. Keogh, M.C., Kurdistani, S.K., Morris, S.A., Ahn, S.H., Podolny, V., Collins, S.R., Schuldiner, M., Chin, K., Punna, T., Thompson, N.J., et al. (2005). Cotranscriptional set2 methylation of histone H3 lysine 36 recruits a repressive Rpd3 complex. Cell 123, 593-605. Keogh, M.C., Mennella, T.A., Sawa, C., Berthelet, S., Krogan, N.J., Wolek, A., Podolny, V., Carpenter, L.R., Greenblatt, J.F., Baetz, K., et al. (2006). The Saccharomyces cerevisiae histone H2A variant Htz1 is acetylated by NuA4. Genes Dev 20, 660-665. Kim, T., and Buratowski, S. (2009). Dimethylation of H3K4 by Set1 recruits the Set3 histone deacetylase complex to 5' transcribed regions. Cell 137, 259-272. Kleywegt, G.J. (1999). Experimental assessment of differences between related protein crystal structures. Acta Crystallogr D Biol Crystallogr 55, 1878-1884. Kobor, M.S., and Lorincz, M.C. (2009). H2A.Z and DNA methylation: irreconcilable differences. Trends Biochem Sci 34, 158-161. Kobor, M.S., Venkatasubrahmanyam, S., Meneghini, M.D., Gin, J.W., Jennings, J.L., Link, A.J., Madhani, H.D., and Rine, J. (2004). A protein complex containing the conserved Swi2/Snf2-related ATPase Swr1p deposits histone variant H2A.Z into euchromatin. PLoS Biol 2, E131.  148  Kolodrubetz, D., Rykowski, M.C., and Grunstein, M. (1982). Histone H2A subtypes associate interchangeably in vivo with histone H2B subtypes. Proc Natl Acad Sci U S A 79, 7814-7818. Kornberg, R.D. (1974). Chromatin structure: a repeating unit of histones and DNA. Science 184, 868-871. Kornberg, R.D. (1977). Structure of chromatin. Annu Rev Biochem 46, 931-954. Kouzarides, T. (2007). Chromatin modifications and their function. Cell 128, 693-705. Krogan, N.J., Keogh, M.C., Datta, N., Sawa, C., Ryan, O.W., Ding, H., Haw, R.A., Pootoolal, J., Tong, A., Canadien, V., et al. (2003). A Snf2 family ATPase complex required for recruitment of the histone H2A variant Htz1. Mol Cell 12, 1565-1576. Kundu, S., and Peterson, C.L. (2010). Dominant role for signal transduction in the transcriptional memory of yeast GAL genes. Mol Cell Biol 30, 2330-2340. Kusch, T., Florens, L., Macdonald, W.H., Swanson, S.K., Glaser, R.L., Yates, J.R., 3rd, Abmayr, S.M., Washburn, M.P., and Workman, J.L. (2004). Acetylation by Tip60 is required for selective histone variant exchange at DNA lesions. Science 306, 2084-2087. Kusch, T., and Workman, J.L. (2007). Histone variants and complexes involved in their exchange. Subcell Biochem 41, 91-109. Kushnirov, V.V. (2000). Rapid and reliable protein extraction from yeast. Yeast 16, 857-860. Kuzuhara, T., and Horikoshi, M. (2004). A nuclear FK506-binding protein is a histone chaperone regulating rDNA silencing. Nat Struct Mol Biol 11, 275-283. Ladurner, A.G., Inouye, C., Jain, R., and Tjian, R. (2003). Bromodomains mediate an acetylhistone encoded antisilencing function at heterochromatin boundaries. Mol Cell 11, 365-376. Larochelle, M., and Gaudreau, L. (2003). H2A.Z has a function reminiscent of an activator required for preferential binding to intergenic DNA. EMBO J 22, 4512-4522.  149  Laskey, R.A., Honda, B.M., Mills, A.D., and Finch, J.T. (1978). Nucleosomes are assembled by an acidic protein which binds histones and transfers them to DNA. Nature 275, 416-420. Lauffart, B., Howell, S.J., Tasch, J.E., Cowell, J.K., and Still, I.H. (2002). Interaction of the transforming acidic coiled-coil 1 (TACC1) protein with ch-TOG and GAS41/NuBI1 suggests multiple TACC1-containing protein complexes in human cells. Biochem J 363, 195-200. Le Masson, I., Yu, D.Y., Jensen, K., Chevalier, A., Courbeyrette, R., Boulard, Y., Smith, M.M., and Mann, C. (2003). Yaf9, a novel NuA4 histone acetyltransferase subunit, is required for the cellular response to spindle stress in yeast. Mol Cell Biol 23, 6086-6102. Lee, W., Tillo, D., Bray, N., Morse, R.H., Davis, R.W., Hughes, T.R., and Nislow, C. (2007). A high-resolution atlas of nucleosome occupancy in yeast. Nat Genet 39, 1235-1244. Lemieux, K., Larochelle, M., and Gaudreau, L. (2008). Variant histone H2A.Z, but not the HMG proteins Nhp6a/b, is essential for the recruitment of Swi/Snf, Mediator, and SAGA to the yeast GAL1 UAS(G). Biochem Biophys Res Commun 369, 1103-1107. Lenstra, T.L., Benschop, J.J., Kim, T., Schulze, J.M., Brabers, N.A., Margaritis, T., van de Pasch, L.A., van Heesch, S.A., Brok, M.O., Groot Koerkamp, M.J., et al. (2011). The specificity and topology of chromatin interaction pathways in yeast. Mol Cell 42, 536-549. Levchenko, V., Jackson, B., and Jackson, V. (2005). Histone release during transcription: displacement of the two H2A-H2B dimers in the nucleosome is dependent on different levels of transcription-induced positive stress. Biochemistry 44, 5357-5372. Li, B., Pattenden, S.G., Lee, D., Gutierrez, J., Chen, J., Seidel, C., Gerton, J., and Workman, J.L. (2005). Preferential occupancy of histone variant H2AZ at inactive promoters influences local histone modifications and chromatin remodeling. Proc Natl Acad Sci U S A 102, 18385-18390. Li, G., and Reinberg, D. (2011). Chromatin higher-order structures and gene regulation. Curr Opin Genet Dev 21, 175-186.  150  Li, Q., Zhou, H., Wurtele, H., Davies, B., Horazdovsky, B., Verreault, A., and Zhang, Z. (2008). Acetylation of histone H3 lysine 56 regulates replication-coupled nucleosome assembly. Cell 134, 244-255. Li, W., Nagaraja, S., Delcuve, G.P., Hendzel, M.J., and Davie, J.R. (1993). Effects of histone acetylation, ubiquitination and variants on nucleosome stability. Biochem J 296 ( Pt 3), 737744. Liang, C., and Stillman, B. (1997). Persistent initiation of DNA replication and chromatinbound MCM proteins during the cell cycle in cdc6 mutants. Genes Dev 11, 3375-3386. Light, W.H., Brickner, D.G., Brand, V.R., and Brickner, J.H. (2010). Interaction of a DNA zip code with the nuclear pore complex promotes H2A.Z incorporation and INO1 transcriptional memory. Mol Cell 40, 112-125. Lin, L.J., and Schultz, M.C. (2011). Promoter regulation by distinct mechanisms of functional interplay between lysine acetylase Rtt109 and histone chaperone Asf1. Proc Natl Acad Sci U S A 108, 19599-19604. Liu, N., Peterson, C.L., and Hayes, J.J. (2011). SWI/SNF- and RSC-catalyzed nucleosome mobilization requires internal DNA loop translocation within nucleosomes. Mol Cell Biol 31, 4165-4175. Longtine, M.S., McKenzie, A., 3rd, Demarini, D.J., Shah, N.G., Wach, A., Brachat, A., Philippsen, P., and Pringle, J.R. (1998). Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14, 953-961. Lu, P.Y., Levesque, N., and Kobor, M.S. (2009). NuA4 and SWR1-C: two chromatinmodifying complexes with overlapping functions and components. Biochem Cell Biol 87, 799-815. Luger, K., Mader, A.W., Richmond, R.K., Sargent, D.F., and Richmond, T.J. (1997). Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 389, 251-260.  151  Luk, E., Ranjan, A., Fitzgerald, P.C., Mizuguchi, G., Huang, Y., Wei, D., and Wu, C. (2010). Stepwise Histone Replacement by SWR1 Requires Dual Activation with Histone H2A.Z and Canonical Nucleosome. Cell 143, 725-736. Luk, E., Vu, N.D., Patteson, K., Mizuguchi, G., Wu, W.H., Ranjan, A., Backus, J., Sen, S., Lewis, M., Bai, Y., et al. (2007). Chz1, a nuclear chaperone for histone H2AZ. Mol Cell 25, 357-368. MacDowell, A.A., Celestre, R.S., Howells, M., McKinney, W., Krupnick, J., Cambie, D., Domning, E.E., Duarte, R.M., Kelez, N., Plate, D.W., et al. (2004). Suite of three protein crystallography beamlines with single superconducting bend magnet as the source. J Synchrotron Radiat 11, 447-455. Malik, H.S., and Henikoff, S. (2003). Phylogenomics of the nucleosome. Nat Struct Biol 10, 882-891. Marques, M., Laflamme, L., Gervais, A.L., and Gaudreau, L. (2010). Reconciling the positive and negative roles of histone H2A.Z in gene transcription. Epigenetics 5, 267-272. Martinato, F., Cesaroni, M., Amati, B., and Guccione, E. (2008). Analysis of Myc-induced histone modifications on target chromatin. PLoS One 3, e3650. Matangkasombut, O., and Buratowski, S. (2003). Different sensitivities of bromodomain factors 1 and 2 to histone H4 acetylation. Mol Cell 11, 353-363. Matsubara, K., Sano, N., Umehara, T., and Horikoshi, M. (2007). Global analysis of functional surfaces of core histones with comprehensive point mutants. Genes Cells 12, 1333. Mavrich, T.N., Ioshikhes, I.P., Venters, B.J., Jiang, C., Tomsho, L.P., Qi, J., Schuster, S.C., Albert, I., and Pugh, B.F. (2008). A barrier nucleosome model for statistical positioning of nucleosomes throughout the yeast genome. Genome Res 18, 1073-1083. McKnight, S.L., and Miller, O.L., Jr. (1977). Electron microscopic analysis of chromatin replication in the cellular blastoderm Drosophila melanogaster embryo. Cell 12, 795-804. 152  Meneghini, M.D., Wu, M., and Madhani, H.D. (2003). Conserved histone variant H2A.Z protects euchromatin from the ectopic spread of silent heterochromatin. Cell 112, 725-736. Millar, C.B., Xu, F., Zhang, K., and Grunstein, M. (2006). Acetylation of H2AZ Lys 14 is associated with genome-wide gene activity in yeast. Genes Dev 20, 711-722. Misteli, T. (2007). Beyond the sequence: cellular organization of genome function. Cell 128, 787-800. Mizuguchi, G., Shen, X., Landry, J., Wu, W.H., Sen, S., and Wu, C. (2004). ATP-driven exchange of histone H2AZ variant catalyzed by SWR1 chromatin remodeling complex. Science 303, 343-348. Moore, J.D., Yazgan, O., Ataian, Y., and Krebs, J.E. (2007). Diverse roles for histone H2A modifications in DNA damage response pathways in yeast. Genetics 176, 15-25. Morillo-Huesca, M., Clemente-Ruiz, M., Andujar, E., and Prado, F. (2010). The SWR1 histone replacement complex causes genetic instability and genome-wide transcription misregulation in the absence of H2A.Z. PLoS One 5, e12143. Mosammaparast, N., Ewart, C.S., and Pemberton, L.F. (2002). A role for nucleosome assembly protein 1 in the nuclear transport of histones H2A and H2B. EMBO J 21, 65276538. Mosammaparast, N., Jackson, K.R., Guo, Y., Brame, C.J., Shabanowitz, J., Hunt, D.F., and Pemberton, L.F. (2001). Nuclear import of histone H2A and H2B is mediated by a network of karyopherins. J Cell Biol 153, 251-262. Murshudov, G.N., Vagin, A.A., and Dodson, E.J. (1997). Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr D 53, 240-255. Nakanishi, S., Sanderson, B.W., Delventhal, K.M., Bradford, W.D., Staehling-Hampton, K., and Shilatifard, A. (2008). A comprehensive library of histone mutants identifies nucleosomal residues required for H3K4 methylation. Nat Struct Mol Biol 15, 881-888.  153  Natsume, R., Eitoku, M., Akai, Y., Sano, N., Horikoshi, M., and Senda, T. (2007). Structure and function of the histone chaperone CIA/ASF1 complexed with histones H3 and H4. Nature 446, 338-341. Olins, A.L., and Olins, D.E. (1974). Spheroid chromatin units (v bodies). Science 183, 330332. Orphanides, G., Wu, W.H., Lane, W.S., Hampsey, M., and Reinberg, D. (1999). The chromatin-specific transcription elongation factor FACT comprises human SPT16 and SSRP1 proteins. Nature 400, 284-288. Ouspenski, II, Elledge, S.J., and Brinkley, B.R. (1999). New yeast genes important for chromosome integrity and segregation identified by dosage effects on genome stability. Nucleic Acids Res 27, 3001-3008. Papamichos-Chronakis, M., Krebs, J.E., and Peterson, C.L. (2006). Interplay between Ino80 and Swr1 chromatin remodeling enzymes regulates cell cycle checkpoint adaptation in response to DNA damage. Genes Dev 20, 2437-2449. Papamichos-Chronakis, M., Watanabe, S., Rando, O.J., and Peterson, C.L. (2011). Global regulation of H2A.Z localization by the INO80 chromatin-remodeling enzyme is essential for genome integrity. Cell 144, 200-213. Park, J.H., and Roeder, R.G. (2006). GAS41 is required for repression of the p53 tumor suppressor pathway during normal cellular proliferation. Mol Cell Biol 26, 4006-4016. Park, Y.J., Chodaparambil, J.V., Bao, Y., McBryant, S.J., and Luger, K. (2005). Nucleosome assembly protein 1 exchanges histone H2A-H2B dimers and assists nucleosome sliding. J Biol Chem 280, 1817-1825. Park, Y.J., Dyer, P.N., Tremethick, D.J., and Luger, K. (2004). A new fluorescence resonance energy transfer approach demonstrates that the histone variant H2AZ stabilizes the histone octamer within the nucleosome. J Biol Chem 279, 24274-24282.  154  Park, Y.J., and Luger, K. (2008). Histone chaperones in nucleosome eviction and histone exchange. Curr Opin Struct Biol 18, 282-289. Peterson, C.L., and Laniel, M.A. (2004). Histones and histone modifications. Curr Biol 14, R546-551. Raisner, R.M., Hartley, P.D., Meneghini, M.D., Bao, M.Z., Liu, C.L., Schreiber, S.L., Rando, O.J., and Madhani, H.D. (2005). Histone variant H2A.Z marks the 5' ends of both active and inactive genes in euchromatin. Cell 123, 233-248. Rangasamy, D. (2010). Histone variant H2A.Z can serve as a new target for breast cancer therapy. Curr Med Chem 17, 3155-3161. Rangasamy, D., Greaves, I., and Tremethick, D.J. (2004). RNA interference demonstrates a novel role for H2A.Z in chromosome segregation. Nat Struct Mol Biol 11, 650-655. Recht, J., Tsubota, T., Tanny, J.C., Diaz, R.L., Berger, J.M., Zhang, X., Garcia, B.A., Shabanowitz, J., Burlingame, A.L., Hunt, D.F., et al. (2006). Histone chaperone Asf1 is required for histone H3 lysine 56 acetylation, a modification associated with S phase in mitosis and meiosis. Proc Natl Acad Sci U S A 103, 6988-6993. Reinberg, D., and Sims, R.J., 3rd (2006). de FACTo nucleosome dynamics. J Biol Chem 281, 23297-23301. Ridgway, P., Brown, K.D., Rangasamy, D., Svensson, U., and Tremethick, D.J. (2004). Unique residues on the H2A.Z containing nucleosome surface are important for Xenopus laevis development. J Biol Chem 279, 43815-43820. Rufiange, A., Jacques, P.E., Bhat, W., Robert, F., and Nourani, A. (2007). Genome-wide replication-independent histone H3 exchange occurs predominantly at promoters and implicates H3 K56 acetylation and Asf1. Mol Cell 27, 393-405. Ruthenburg, A.J., Li, H., Patel, D.J., and Allis, C.D. (2007). Multivalent engagement of chromatin modifications by linked binding modules. Nat Rev Mol Cell Biol 8, 983-994.  155  Ryan, D.P., Sundaramoorthy, R., Martin, D., Singh, V., and Owen-Hughes, T. (2011). The DNA-binding domain of the Chd1 chromatin-remodelling enzyme contains SANT and SLIDE domains. EMBO J 30, 2596-2609. Santisteban, M.S., Kalashnikova, T., and Smith, M.M. (2000). Histone H2A.Z regulats transcription and is partially redundant with nucleosome remodeling complexes. Cell 103, 411-422. Sarcinella, E., Zuzarte, P.C., Lau, P.N., Draker, R., and Cheung, P. (2007). Monoubiquitylation of H2A.Z distinguishes its association with euchromatin or facultative heterochromatin. Mol Cell Biol 27, 6457-6468. Schuldiner, M., Collins, S.R., Thompson, N.J., Denic, V., Bhamidipati, A., Punna, T., Ihmels, J., Andrews, B., Boone, C., Greenblatt, J.F., et al. (2005). Exploration of the function and organization of the yeast early secretory pathway through an epistatic miniarray profile. Cell 123, 507-519. Schuldiner, M., Collins, S.R., Weissman, J.S., and Krogan, N.J. (2006). Quantitative genetic analysis in Saccharomyces cerevisiae using epistatic miniarray profiles (E-MAPs) and its application to chromatin functions. Methods 40, 344-352. Schulze, J.M., Jackson, J., Nakanishi, S., Gardner, J.M., Hentrich, T., Haug, J., Johnston, M., Jaspersen, S.L., Kobor, M.S., and Shilatifard, A. (2009a). Linking cell cycle to histone modifications: SBF and H2B monoubiquitination machinery and cell-cycle regulation of H3K79 dimethylation. Mol Cell 35, 626-641. Schulze, J.M., Wang, A.Y., and Kobor, M.S. (2009b). YEATS domain proteins: a diverse family with many links to chromatin modification and transcription. Biochem Cell Biol 87, 65-75. Schulze, J.M., Wang, A.Y., and Kobor, M.S. (2010). Reading chromatin: Insights from yeast into YEATS domain structure and function. Epigenetics 5.  156  Schwabish, M.A., and Struhl, K. (2004). Evidence for eviction and rapid deposition of histones upon transcriptional elongation by RNA polymerase II. Mol Cell Biol 24, 1011110117. Sharma, A., Jenkins, K.R., Heroux, A., and Bowman, G.D. (2011). Crystal structure of the chromodomain helicase DNA-binding protein 1 (Chd1) DNA-binding domain in complex with DNA. J Biol Chem 286, 42099-42104. Shivaswamy, S., Bhinge, A., Zhao, Y., Jones, S., Hirst, M., and Iyer, V.R. (2008). Dynamic remodeling of individual nucleosomes across a eukaryotic genome in response to transcriptional perturbation. PLoS Biol 6, e65. Shukla, M.S., Syed, S.H., Goutte-Gattat, D., Richard, J.L., Montel, F., Hamiche, A., Travers, A., Faivre-Moskalenko, C., Bednar, J., Hayes, J.J., et al. (2010). The docking domain of histone H2A is required for H1 binding and RSC-mediated nucleosome remodeling. Nucleic Acids Res. Siegfried, Z., and Cedar, H. (1997). DNA methylation: a molecular lock. Curr Biol 7, R305307. Sikorski, R.S., and Boeke, J.D. (1991). In vitro mutagenesis and plasmid shuffling: from cloned gene to mutant yeast. Methods Enzymol 194, 302-318. Silva, A.C., Xu, X., Kim, H.S., Fillingham, J., Kislinger, T., Mennella, T.A., and Keogh, M.C. (2012). The replication-independent histone H3-H4 chaperones HIR, ASF1, and RTT106 co-operate to maintain promoter fidelity. J Biol Chem 287, 1709-1718. Soboleva, T.A., Nekrasov, M., Pahwa, A., Williams, R., Huttley, G.A., and Tremethick, D.J. (2012). A unique H2A histone variant occupies the transcriptional start site of active genes. Nat Struct Mol Biol 19, 25-30. Strahl, B.D., and Allis, C.D. (2000). The language of covalent histone modifications. Nature 403, 41-45.  157  Straube, K., Blackwell, J.S., Jr., and Pemberton, L.F. (2010). Nap1 and Chz1 have separate Htz1 nuclear import and assembly functions. Traffic 11, 185-197. Suganuma, T., and Workman, J.L. (2011). Signals and combinatorial functions of histone modifications. Annu Rev Biochem 80, 473-499. Suto, R.K., Clarkson, M.J., Tremethick, D.J., and Luger, K. (2000). Crystal structure of a nucleosome core particle containing the variant histone H2A.Z. Nat Struct Biol 7, 11211124. Talbert, P.B., and Henikoff, S. (2010). Histone variants--ancient wrap artists of the epigenome. Nat Rev Mol Cell Biol 11, 264-275. Tavazoie, S., Hughes, J.D., Campbell, M.J., Cho, R.J., and Church, G.M. (1999). Systematic determination of genetic network architecture. Nat Genet 22, 281-285. Taverna, S.D., Li, H., Ruthenburg, A.J., Allis, C.D., and Patel, D.J. (2007). How chromatinbinding modules interpret histone modifications: lessons from professional pocket pickers. Nat Struct Mol Biol 14, 1025-1040. Thambirajah, A.A., Dryhurst, D., Ishibashi, T., Li, A., Maffey, A.H., and Ausio, J. (2006). H2A.Z stabilizes chromatin in a way that is dependent on core histone acetylation. J Biol Chem 281, 20036-20044. Tolstorukov, M.Y., Goldman, J.A., Gilbert, C., Ogryzko, V., Kingston, R.E., and Park, P.J. (2012). Histone Variant H2A.Bbd Is Associated with Active Transcription and mRNA Processing in Human Cells. Mol Cell 47, 596-607. Tsukiyama, T. (2002). The in vivo functions of ATP-dependent chromatin-remodelling factors. Nat Rev Mol Cell Biol 3, 422-429. van Attikum, H., Fritsch, O., and Gasser, S.M. (2007). Distinct roles for SWR1 and INO80 chromatin remodeling complexes at chromosomal double-strand breaks. EMBO J 26, 41134125.  158  van Bakel, H., van Werven, F.J., Radonjic, M., Brok, M.O., van Leenen, D., Holstege, F.C., and Timmers, H.T. (2008). Improved genome-wide localization by ChIP-chip using doubleround T7 RNA polymerase-based amplification. Nucleic Acids Res 36, e21. van Daal, A., and Elgin, S.C. (1992). A histone variant, H2AvD, is essential in Drosophila melanogaster. Mol Biol Cell 3, 593-602. Van Duyne, G.D., Standaert, R.F., Karplus, A.P., Schreiber, S.L., and Clardy, J. (1993). Atomic Structures of the Human Immunophilin FKBP-12 Complexes with FK506 and Rapamycin. J Mol Biol 229, 105-124. Van Mullem, V., Wery, M., De Bolle, X., and Vandenhaute, J. (2003). Construction of a set of Saccharomyces cerevisiae vectors designed for recombinational cloning. Yeast 20, 739746. Vary, J.C., Jr., Gangaraju, V.K., Qin, J., Landel, C.C., Kooperberg, C., Bartholomew, B., and Tsukiyama, T. (2003). Yeast Isw1p forms two separable complexes in vivo. Mol Cell Biol 23, 80-91. Vogler, C., Huber, C., Waldmann, T., Ettig, R., Braun, L., Izzo, A., Daujat, S., Chassignet, I., Lopez-Contreras, A.J., Fernandez-Capetillo, O., et al. (2010). Histone H2A C-terminus regulates chromatin dynamics, remodeling, and histone H1 binding. PLoS Genet 6, e1001234. Wan, Y., Saleem, R.A., Ratushny, A.V., Roda, O., Smith, J.J., Lin, C.H., Chiang, J.H., and Aitchison, J.D. (2009). Role of the histone variant H2A.Z/Htz1p in TBP recruitment, chromatin dynamics, and regulated expression of oleate-responsive genes. Mol Cell Biol 29, 2346-2358. Wang, A.Y., Aristizabal, M.J., Ryan, C., Krogan, N.J., and Kobor, M.S. (2011). Key functional regions in the histone variant H2A.Z C-terminal docking domain. Mol Cell Biol 31, 3871-3884.  159  Wang, A.Y., Schulze, J.M., Skordalakes, E., Gin, J.W., Berger, J.M., Rine, J., and Kobor, M.S. (2009). Asf1-like structure of the conserved Yaf9 YEATS domain and role in H2A.Z deposition and acetylation. Proc Natl Acad Sci U S A 106, 21573-21578. Waterhouse, A.M., Procter, J.B., Martin, D.M., Clamp, M., and Barton, G.J. (2009). Jalview Version 2 - a multiple sequence alignment editor and analysis workbench. Bioinformatics. Weber, C.M., Henikoff, J.G., and Henikoff, S. (2010). H2A.Z nucleosomes enriched over active genes are homotypic. Nat Struct Mol Biol 17, 1500-1507. West, M.H., and Bonner, W.M. (1980). Histone 2A, a heteromorphous family of eight protein species. Biochemistry 19, 3238-3245. White, C.L., Suto, R.K., and Luger, K. (2001). Structure of the yeast nucleosome core particle reveals fundamental changes in internucleosome interactions. EMBO J 20, 52075218. Whitehouse, I., Rando, O.J., Delrow, J., and Tsukiyama, T. (2007). Chromatin remodelling at promoters suppresses antisense transcription. Nature 450, 1031-1035. Williams, S.K., Truong, D., and Tyler, J.K. (2008). Acetylation in the globular core of histone H3 on lysine-56 promotes chromatin disassembly during transcriptional activation. Proc Natl Acad Sci U S A 105, 9000-9005. Wilmes, G.M., Bergkessel, M., Bandyopadhyay, S., Shales, M., Braberg, H., Cagney, G., Collins, S.R., Whitworth, G.B., Kress, T.L., Weissman, J.S., et al. (2008). A genetic interaction map of RNA-processing factors reveals links between Sem1/Dss1-containing complexes and mRNA export and splicing. Mol Cell 32, 735-746. Workman, J.L. (2006). Nucleosome displacement in transcription. Genes Dev 20, 20092017. Wratting, D., Thistlethwaite, A., Harris, M., Zeef, L.A., and Millar, C.B. (2012). A Conserved Function for the H2A.Z C Terminus. J Biol Chem 287, 19148-19157.  160  Wu, W.-H., Wu, C.-H., Ladurner, A., Mizuguchi, G., Wei, D., Xiao, H., Luk, E., Ranjan, A., and Wu, C. (2008). N-terminus of Swr1 binds to histone H2AZ and provides a platform for subunit assembly in the chromatin remodeling complex. J Biol Chem, M808830200. Wu, W.H., Alami, S., Luk, E., Wu, C.H., Sen, S., Mizuguchi, G., Wei, D., and Wu, C. (2005). Swc2 is a widely conserved H2AZ-binding module essential for ATP-dependent histone exchange. Nat Struct Mol Biol 12, 1064-1071. Wu, W.H., Wu, C.H., Ladurner, A., Mizuguchi, G., Wei, D., Xiao, H., Luk, E., Ranjan, A., and Wu, C. (2009). N terminus of Swr1 binds to histone H2AZ and provides a platform for subunit assembly in the chromatin remodeling complex. J Biol Chem 284, 6200-6207. Yun, M., Wu, J., Workman, J.L., and Li, B. (2011). Readers of histone modifications. Cell Res 21, 564-578. Zanton, S.J., and Pugh, B.F. (2006). Full and partial genome-wide assembly and disassembly of the yeast transcription machinery in response to heat shock. Genes Dev 20, 2250-2265. Zeisig, D.T., Bittner, C.B., Zeisig, B.B., Garcia-Cuellar, M.P., Hess, J.L., and Slany, R.K. (2005). The eleven-nineteen-leukemia protein ENL connects nuclear MLL fusion partners with chromatin. Oncogene 24, 5525-5532. Zhang, H., Richardson, D.O., Roberts, D.N., Utley, R., Erdjument-Bromage, H., Tempst, P., Cote, J., and Cairns, B.R. (2004). The Yaf9 component of the SWR1 and NuA4 complexes is required for proper gene expression, histone H4 acetylation, and Htz1 replacement near telomeres. Mol Cell Biol 24, 9424-9436. Zhang, H., Roberts, D.N., and Cairns, B.R. (2005). Genome-wide dynamics of Htz1, a histone H2A variant that poises repressed/basal promoters for activation through histone loss. Cell 123, 219-231. Zhang, Y., Moqtaderi, Z., Rattner, B.P., Euskirchen, G., Snyder, M., Kadonaga, J.T., Liu, X.S., and Struhl, K. (2009). Intrinsic histone-DNA interactions are not the major determinant of nucleosome positions in vivo. Nat Struct Mol Biol 16, 847-852.  161  Zhang, Y., Smith, C.L., Saha, A., Grill, S.W., Mihardja, S., Smith, S.B., Cairns, B.R., Peterson, C.L., and Bustamante, C. (2006). DNA translocation and loop formation mechanism of chromatin remodeling by SWI/SNF and RSC. Mol Cell 24, 559-568. Zhang, Z., Wippo, C.J., Wal, M., Ward, E., Korber, P., and Pugh, B.F. (2011). A packing mechanism for nucleosome organization reconstituted across a eukaryotic genome. Science 332, 977-980. Zheng, J., Benschop, J.J., Shales, M., Kemmeren, P., Greenblatt, J., Cagney, G., Holstege, F., Li, H., and Krogan, N.J. (2010). Epistatic relationships reveal the functional organization of yeast transcription factors. Mol Syst Biol 6, 420. Zhou, Z., Feng, H., Hansen, D.F., Kato, H., Luk, E., Freedberg, D.I., Kay, L.E., Wu, C., and Bai, Y. (2008). NMR structure of chaperone Chz1 complexed with histones H2A.Z-H2B. Nat Struct Mol Biol 15, 868-869. Zilberman, D., Coleman-Derr, D., Ballinger, T., and Henikoff, S. (2008). Histone H2A.Z and DNA methylation are mutually antagonistic chromatin marks. Nature 456, 125-129. Zlatanova, J., and Thakar, A. (2008). H2A.Z: view from the top. Structure 16, 166-179.  162  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0073210/manifest

Comment

Related Items