UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Cortactin enhances elongation of axons in Drosophila melanogaster and is inhibited by calpain in vivo Mains, Victoria Roslynne 2012

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2012_fall_mains_victoria.pdf [ 15.91MB ]
Metadata
JSON: 24-1.0073180.json
JSON-LD: 24-1.0073180-ld.json
RDF/XML (Pretty): 24-1.0073180-rdf.xml
RDF/JSON: 24-1.0073180-rdf.json
Turtle: 24-1.0073180-turtle.txt
N-Triples: 24-1.0073180-rdf-ntriples.txt
Original Record: 24-1.0073180-source.json
Full Text
24-1.0073180-fulltext.txt
Citation
24-1.0073180.ris

Full Text

Cortactin	
  enhances	
  elongation	
  of	
  axons	
  in	
  Drosophila	
  melanogaster	
  and	
  is	
   inhibited	
  by	
  calpain	
  in	
  vivo	
   	
   by	
   Victoria	
  Roslynne	
  Mains	
   	
   B.Sc.,	
  Queen’s	
  University,	
  2009	
   	
   A	
  THESIS	
  SUBMITTED	
  IN	
  PARTIAL	
  FULFILLMENT	
  OF	
   THE	
  REQUIREMENTS	
  FOR	
  THE	
  DEGREE	
  OF	
   	
   MASTER	
  OF	
  SCIENCE	
   in	
   THE	
  FACULTY	
  OF	
  GRADUATE	
  STUDIES	
   (Neuroscience)	
   	
   THE	
  UNIVERSITY	
  OF	
  BRITISH	
  COLUMBIA	
   (Vancouver)	
  	
   September	
  2012	
   	
   	
   ©	
  Victoria	
  Roslynne	
  Mains,	
  2012	
   	
    Abstract	
   The	
  nervous	
  system	
  of	
  an	
  organism	
  is	
  exceedingly	
  complex	
  and	
  yet	
  highly	
   specific	
  in	
  the	
  connections	
  that	
  it	
  makes.	
  The	
  mechanisms	
  by	
  which	
  a	
  functional	
   nervous	
  system	
  is	
  developed	
  are	
  therefore	
  of	
  great	
  importance	
  and	
  interest.	
   Neurons	
  extend	
  processes	
  over	
  long	
  distances	
  and	
  through	
  various	
  environments	
  in	
   order	
  to	
  form	
  connections	
  with	
  their	
  appropriate	
  targets.	
  The	
  neurites	
  must	
  sense	
   their	
  environment	
  and	
  make	
  decisions	
  based	
  on	
  guidance	
  cues	
  as	
  to	
  which	
  direction	
   to	
  grow.	
  The	
  growth	
  cone	
  of	
  the	
  developing	
  neurite	
  is	
  a	
  dynamic,	
  actin-­‐rich	
  domain	
   at	
  the	
  leading	
  edge	
  and	
  is	
  the	
  site	
  for	
  integration	
  of	
  various	
  guidance	
  cues	
  and,	
   therefore,	
  of	
  this	
  decision	
  making.	
  The	
  molecular	
  mechanisms	
  underlying	
   outgrowth,	
  in	
  particular	
  consolidation	
  of	
  developing	
  axons	
  –	
  the	
  process	
  in	
  which	
   the	
  actin	
  network	
  of	
  the	
  proximal	
  region	
  of	
  the	
  growth	
  cone	
  collapses	
  creating	
  a	
   new	
  segment	
  of	
  axon,	
  remain	
  unclear.	
  Our	
  lab	
  previously	
  uncovered	
  a	
  role	
  for	
  the	
   actin-­‐associated	
  protein	
  cortactin	
  as	
  an	
  enhancer	
  of	
  membrane	
  protrusions	
  in	
   cultured	
  neurons	
  and	
  for	
  calpain	
  as	
  an	
  inhibitor	
  of	
  this	
  process	
  in	
  consolidated	
   regions.	
  However,	
  the	
  physiological	
  roles	
  for	
  cortactin	
  and	
  calpain	
  in	
  axon	
   outgrowth	
  and	
  cell	
  migration	
  have	
  remained	
  elusive	
  as	
  others	
  have	
  observed	
  both	
   similar	
  and	
  opposite	
  effects	
  of	
  these	
  proteins.	
  These	
  discrepancies	
  are	
  likely	
  due	
  to	
   the	
  variability	
  associated	
  with	
  in	
  vitro	
  studies.	
  Therefore,	
  I	
  set	
  out	
  to	
  elucidate	
  the	
   function	
  of	
  these	
  molecules	
  in	
  developing	
  axons	
  in	
  vivo	
  within	
  the	
  model	
  organism	
   Drosophila	
  melanogaster.	
  Using	
  two	
  subsets	
  of	
  neurons	
  within	
  the	
  central	
  nervous	
   system,	
  I	
  observed	
  that	
  the	
  overexpression	
  of	
  cortactin	
  combined	
  with	
  the	
   inhibition	
  of	
  calpain	
  increased	
  the	
  elongation	
  of	
  axons	
  as	
  well	
  as	
  the	
  incidence	
  of	
   	
    ii	
    misguidance.	
  	
  Therefore,	
  it	
  appears	
  that	
  in	
  vivo,	
  cortactin	
  acts	
  as	
  an	
  enhancer	
  of	
   membrane	
  protrusions	
  and	
  elongation	
  and	
  is	
  actively	
  inhibited	
  by	
  calpain.	
  In	
   addition,	
  these	
  two	
  proteins	
  appear	
  to	
  influence	
  guidance,	
  though	
  through	
  what	
   mechanism	
  remains	
  to	
  be	
  investigated.	
  Knowledge	
  of	
  the	
  molecular	
  pathways	
   involved	
  in	
  axon	
  outgrowth	
  and	
  guidance	
  is	
  key	
  to	
  the	
  understanding	
  of	
  not	
  only	
   development,	
  but	
  also	
  plasticity	
  and	
  repair	
  within	
  the	
  nervous	
  system.	
  	
    	
    	
    iii	
    Table	
  of	
  Contents	
   Abstract	
  ....................................................................................................................................................	
  ii	
   Table	
  of	
  Contents	
  ..................................................................................................................................	
  iv	
   List	
  of	
  Tables	
  ..........................................................................................................................................	
  vi	
   List	
  of	
  Figures	
  .......................................................................................................................................	
  vii	
   Acknowledgements	
  ..........................................................................................................................	
  viii	
   Chapter	
  1:	
  Introduction	
  .......................................................................................................................	
  1	
   1.1	
   Neuron	
  growth	
  and	
  morphology	
  ...........................................................................................	
  1	
   1.1.1	
   Axon	
  outgrowth	
  ..........................................................................................................................................	
  4	
   1.2	
   Calpain	
  ............................................................................................................................................	
  5	
   1.2.1	
   Structure	
  and	
  regulation	
  of	
  calpain	
  proteases	
  ..............................................................................	
  5	
   1.2.2	
   Substrate	
  recognition	
  ...............................................................................................................................	
  8	
   1.2.3	
   Calpain	
  in	
  cell	
  motility	
  .............................................................................................................................	
  9	
   1.3	
   Cortactin	
  ......................................................................................................................................	
  10	
   1.3.1	
   Structure	
  and	
  regulation	
  of	
  cortactin	
  .............................................................................................	
  10	
   1.3.2	
   Cortactin	
  promotes	
  actin	
  polymerization	
  and	
  branching	
  .....................................................	
  12	
   1.3.3	
   Cortactin	
  in	
  cell	
  adhesion	
  ....................................................................................................................	
  13	
   1.4	
   Calpain	
  cleavage	
  of	
  cortactin	
  inhibits	
  membrane	
  protrusions	
  ................................	
  14	
   1.5	
   Calpain	
  actively	
  maintains	
  consolidation	
  through	
  cleavage	
  of	
  cortactin	
  ..............	
  15	
   1.6	
   Drosophila	
  melanogaster	
  as	
  a	
  model	
  organism	
  .............................................................	
  18	
   1.6.1	
   GAL4/UAS	
  system	
  ..................................................................................................................................	
  18	
   1.6.2	
   Calpain	
  and	
  cortactin	
  in	
  Drosophila	
  ................................................................................................	
  21	
   1.6.3	
   Apterous-­‐expressing	
  neurons	
  ...........................................................................................................	
  23	
   1.6.4	
   Eclosion	
  hormone-­‐expressing	
  neurons	
  ........................................................................................	
  25	
   1.7	
   Hypothesis	
  ..................................................................................................................................	
  26	
   Chapter	
  2:	
  Methods	
  .............................................................................................................................	
  28	
   2.1	
   2.2	
   2.3	
   2.4	
   2.5	
   2.6	
   2.7	
    Immunohistochemistry	
  ..........................................................................................................	
  28	
   Fly	
  Stocks	
  .....................................................................................................................................	
  29	
   Calpain	
  Inhibition	
  with	
  ALLN/ALLM	
  ..................................................................................	
  30	
   tBoc	
  Assay	
  ...................................................................................................................................	
  31	
   Western	
  Blotting	
  .......................................................................................................................	
  31	
   Image	
  Acquisition	
  and	
  Analysis	
  ...........................................................................................	
  32	
   Statistical	
  Analysis	
  ...................................................................................................................	
  32	
    Chapter	
  3:	
  Results	
  ...............................................................................................................................	
  33	
   3.1	
   Calpain	
  and	
  Cortactin	
  are	
  present	
  and	
  interacting	
  in	
  the	
  developing	
  Drosophila	
   nervous	
  system	
  ....................................................................................................................................	
  33	
   3.2	
   Cortactin	
  overexpression	
  results	
  in	
  axon	
  misguidance	
  and	
  elongation	
  ................	
  40	
   3.2.1	
   Apterous	
  neurons	
  ...................................................................................................................................	
  40	
   3.2.2	
   EH	
  neurons	
  ................................................................................................................................................	
  41	
   3.3	
   Calpain	
  inhibition	
  .....................................................................................................................	
  48	
    	
    iv	
    3.3.1	
   Apterous	
  neurons	
  ...................................................................................................................................	
  48	
   3.3.2	
   EH	
  neurons	
  ................................................................................................................................................	
  49	
   3.4	
   Combined	
  cortactin	
  overexpression	
  and	
  calpain	
  inhibition	
  .....................................	
  50	
   3.4.1	
   Apterous	
  neurons	
  ...................................................................................................................................	
  50	
   3.4.2	
   EH	
  neurons	
  ................................................................................................................................................	
  50	
   Chapter	
  4:	
  Discussion	
  .........................................................................................................................	
  54	
   4.1	
   Cortactin	
  and	
  calpain	
  interact	
  in	
  the	
  developing	
  nervous	
  system	
  of	
  Drosophila	
   melanogaster	
  ........................................................................................................................................	
  55	
   4.2	
   Cortactin	
  and	
  calpain	
  are	
  important	
  in	
  axon	
  outgrowth	
  in	
  vivo	
  ...............................	
  56	
   4.3	
   Calpain	
  as	
  a	
  therapeutic	
  target	
  ............................................................................................	
  59	
   Chapter	
  5:	
  Conclusions	
  ......................................................................................................................	
  61	
   References	
  .............................................................................................................................................	
  62	
    	
    	
    v	
    List	
  of	
  Tables	
   	
    Table	
  3-­‐1.	
  Quantification	
  of	
  cortactin	
  overexpression	
  and	
  calpain	
  inhibition	
  in	
  EH	
   neurons.	
  .............................................................................................................................................	
  47	
   Table	
  3-­‐2.	
  Quantification	
  of	
  exit	
  location	
  of	
  axons	
  in	
  EH	
  neurons.	
  ....................................	
  53	
   	
    	
    	
    vi	
    List	
  of	
  Figures	
   Figure	
  1–1.	
  Domain	
  structure	
  of	
  a	
  growth	
  cone.	
  .........................................................................	
  2	
   Figure	
  1–2.	
  Calpain	
  domain	
  structure	
  and	
  homology.	
  ..............................................................	
  7	
   Figure	
  1–3.	
  Cortactin	
  domain	
  structure	
  and	
  homology.	
  .........................................................	
  11	
   Figure	
  1–4.	
  Calpain	
  activity	
  is	
  restricted	
  to	
  consolidated	
  regions.	
  ....................................	
  16	
   Figure	
  1–5.	
  Calpain	
  inhibition	
  and	
  cortactin	
  overexpression	
  induce	
  membrane	
   protrusions.	
  ......................................................................................................................................	
  17	
   Figure	
  1–6.	
  Model	
  of	
  calpain	
  and	
  cortactin	
  in	
  consolidation.	
  ...............................................	
  19	
   Figure	
  1–7.	
  Apterous	
  expressing	
  neurons.	
  ...................................................................................	
  24	
   Figure	
  1–8.	
  Eclosion	
  hormone	
  expressing	
  neurons.	
  ................................................................	
  27	
   	
   Figure	
  3–1.	
  Calpain	
  activity	
  in	
  the	
  nervous	
  system.	
  .................................................................	
  34	
   Figure	
  3–2.	
  Calpain	
  activity	
  affects	
  cortactin	
  levels	
  in	
  the	
  developing	
  nervous	
   system.	
  ................................................................................................................................................	
  35	
   Figure	
  3–3.	
  Cortactin	
  overexpression.	
  ...........................................................................................	
  39	
   Figure	
  3–4.	
  Cortactin	
  overexpression	
  and	
  calpain	
  inhibition	
  in	
  apterous	
  neurons.	
  ..	
  42	
   Figure	
  3–5.	
  Quantification	
  of	
  effects	
  of	
  cortactin	
  overexpression	
  and	
  calpain	
   inhibition	
  in	
  apterous	
  neurons.	
  ...............................................................................................	
  44	
   Figure	
  3–6.	
  Cortactin	
  overexpression	
  and	
  calpain	
  inhibition	
  in	
  EH	
  neurons.	
  ..............	
  46	
   Figure	
  3–7.	
  Contralateral	
  exit	
  of	
  an	
  EH	
  axon.	
  ..............................................................................	
  52	
    	
    vii	
    Acknowledgements	
   First	
  and	
  foremost,	
  I	
  offer	
  my	
  gratitude	
  to	
  Dr.	
  Timothy	
  O’Connor	
  for	
  his	
   unending	
  patience,	
  encouragement	
  and	
  faith	
  in	
  this	
  project	
  and	
  in	
  me.	
  Thank	
  you	
  for	
   being	
  excited	
  about	
  everything,	
  especially	
  when	
  I	
  was	
  not.	
  I	
  thank	
  Dr.	
  Douglas	
  Allan	
   for	
  his	
  seemingly	
  endless	
  ideas	
  and	
  knowledge	
  and	
  his	
  continual	
  enthusiasm.	
   Additional	
  thanks	
  extend	
  to	
  the	
  remaining	
  members	
  of	
  my	
  supervisory	
  committee,	
   Dr.	
  Vanessa	
  Auld	
  and	
  Dr.	
  Kurt	
  Haas,	
  for	
  their	
  thought-­‐provoking	
  questions,	
   alternative	
  perspectives,	
  and	
  great	
  amount	
  of	
  patience	
  and	
  flexibility	
  with	
  my	
   accelerated	
  timeline	
  towards	
  the	
  end.	
   Heart-­‐felt	
  thanks	
  to	
  the	
  other	
  members	
  of	
  the	
  O’Connor	
  lab:	
  to	
  Xiao	
  Wei	
  for	
   always	
  smiling	
  and	
  for	
  providing	
  company	
  on	
  those	
  frequent	
  late	
  nights	
  in	
  the	
  lab;	
   to	
  Ada	
  Young	
  who	
  lent	
  a	
  very	
  willing	
  and	
  capable	
  hand,	
  especially	
  in	
  those	
  not-­‐so-­‐ exciting-­‐but-­‐oh-­‐so-­‐necessary	
  tasks;	
  and	
  to	
  Matthew	
  Piva	
  for	
  imaging	
  and	
  analyzing	
   with	
  enthusiasm.	
  Last,	
  but	
  most	
  certainly	
  not	
  least,	
  I	
  could	
  not	
  have	
  completed	
  this	
   work	
  without	
  the	
  constant	
  guidance,	
  advice,	
  and	
  empathy	
  of	
  Kristen	
  Browne	
  and	
   the	
  unending	
  and	
  unconditional	
  moral	
  support	
  provided	
  by	
  Qian	
  Qian	
  Liu,	
  both	
  in	
   and	
  out	
  of	
  the	
  lab.	
  	
   I	
  would	
  also	
  like	
  to	
  thank	
  all	
  of	
  the	
  members	
  of	
  the	
  Allan,	
  Auld,	
  and	
  Tanentzapf	
   labs	
  who	
  offered	
  guidance,	
  support,	
  and	
  supplies	
  without	
  hesitation.	
  In	
  particular,	
   but	
  in	
  no	
  particular	
  order,	
  I	
  would	
  like	
  to	
  thank	
  Luba	
  Veverytsa	
  for	
  providing	
  me	
   with	
  most	
  of	
  the	
  CCAP	
  and	
  EH	
  fly	
  lines	
  used	
  and	
  for	
  her	
  wealth	
  of	
  knowledge	
  about	
   them	
  (and	
  everything	
  else);	
  Mònica	
  Castellanos,	
  also	
  for	
  providing	
  flies	
  and	
   guidance,	
  but	
  mostly	
  for	
  her	
  encouragement,	
  company,	
  warmth,	
  and	
  friendship;	
   	
    viii	
    Stephanie	
  Ellis	
  for	
  helping	
  me	
  through	
  real	
  time;	
  Xiaojun	
  Xie	
  for	
  answering	
  any	
  and	
   all	
  of	
  my	
  questions;	
  and	
  finally,	
  Lindsay	
  Petley-­‐Ragan	
  for	
  always	
  being	
  full	
  of	
  life	
  and	
   excited	
  about	
  science	
  –	
  you	
  definitely	
  helped	
  me	
  keep	
  my	
  head	
  above	
  water	
  on	
  more	
   than	
  one	
  occasion.	
  In	
  addition,	
  a	
  great	
  deal	
  of	
  thanks	
  is	
  owed	
  to	
  the	
  wonderful	
  Annie	
   Aftab	
  and	
  Jenya	
  Petoukhov,	
  with	
  whom	
  I	
  shared	
  so	
  many	
  late	
  nights,	
  cups	
  of	
  tea,	
  and	
   pints	
  of	
  beer;	
  and	
  to	
  Michelle	
  Chan	
  for	
  commiserating	
  with	
  me	
  over	
  so	
  many	
   lunches.	
   To	
  my	
  mother,	
  to	
  whom	
  I	
  owe	
  my	
  life,	
  my	
  laugh,	
  and	
  pretty	
  much	
  everything,	
  I	
   thank	
  you.	
  You	
  have	
  continually	
  offered	
  moral,	
  financial	
  and	
  any	
  other	
  support	
  that	
  I	
   have	
  required	
  throughout	
  my	
  entire	
  life	
  and	
  I	
  would	
  never	
  have	
  made	
  it	
  through	
   this,	
  or	
  most	
  anything	
  else,	
  without	
  you.	
   Special	
  thanks	
  to	
  the	
  rest	
  of	
  my	
  friends	
  and	
  family	
  who	
  are	
  always	
  there	
  for	
   me;	
  there	
  is	
  not	
  space	
  enough	
  to	
  list	
  all	
  the	
  ways	
  in	
  which	
  you	
  have	
  supported	
  me	
   during	
  the	
  past	
  3	
  years,	
  nor	
  to	
  give	
  justice	
  to	
  my	
  gratitude.	
   	
   The	
  research	
  performed	
  in	
  this	
  thesis	
  was	
  funded	
  by	
  CIHR	
  and	
  NSERC.	
   	
    	
    ix	
    Chapter	
  1: Introduction	
   A	
  neuron’s	
  morphology	
  is	
  one	
  of	
  its	
  defining	
  characteristics	
  and	
  yet	
  much	
  is	
   still	
  unknown	
  about	
  how	
  it	
  acquires	
  and	
  maintains	
  its	
  shape.	
  Neurons	
  form	
  highly	
   complex	
  dendritic	
  arbours	
  consisting	
  of	
  a	
  varied	
  number	
  of	
  branches	
  depending	
  on	
   its	
  type.	
  A	
  Purkinje	
  cell	
  in	
  the	
  cerebellum,	
  for	
  example,	
  has	
  thousands	
  of	
  branches	
   each	
  of	
  which	
  receives	
  input	
  from	
  dozens	
  of	
  different	
  cells.	
  The	
  establishment	
  of	
   such	
  complex	
  and	
  yet	
  specific	
  neuronal	
  networks	
  is	
  of	
  great	
  importance	
  to	
  the	
   formation	
  of	
  a	
  functional	
  nervous	
  system	
  within	
  an	
  organism.	
  	
    1.1 Neuron	
  growth	
  and	
  morphology	
   Dendrites	
  are	
  one	
  of	
  the	
  two	
  types	
  of	
  processes	
  extended	
  from	
  a	
  neuron,	
  the	
   other	
  being	
  axons.	
  While	
  dendrites	
  tend	
  to	
  grow	
  and	
  branch	
  locally	
  near	
  the	
  cell	
   body	
  of	
  the	
  neuron	
  from	
  which	
  they	
  extend,	
  axons	
  often	
  grow	
  over	
  long	
  distances	
   and	
  through	
  various	
  environments	
  in	
  search	
  of	
  their	
  targets.	
  Both	
  extending	
   processes	
  are	
  led	
  by	
  a	
  distinct	
  structure	
  called	
  a	
  growth	
  cone.	
  This	
  dynamic	
  domain,	
   which	
  was	
  first	
  characterized	
  in	
  1890	
  by	
  Santiago	
  Ramon	
  y	
  Cajal,	
  acts	
  as	
  the	
  sensor	
   for	
  the	
  growing	
  neurite,	
  detecting	
  environmental	
  cues	
  and	
  making	
  decisions	
  as	
  to	
   the	
  direction	
  of	
  growth.	
  The	
  major	
  component	
  of	
  a	
  growth	
  cone’s	
  mobility	
  is	
  the	
   highly	
  dynamic	
  cytoskeletal	
  network	
  within	
  it	
  and	
  the	
  signaling	
  pathways	
  that	
   regulate	
  them.	
  	
   The	
  growth	
  cone	
  can	
  be	
  divided	
  into	
  three	
  domains,	
  the	
  peripheral,	
   transitional,	
  and	
  central	
  domains	
  (Figure	
  1-­‐1).	
  The	
  peripheral	
  domain	
  has	
  a	
  	
    	
    1	
    (a)  !" #" $"  	
   Figure	
  1–1.	
  Domain	
  structure	
  of	
  a	
  growth	
  cone.	
  	
    (b) 60.00  A	
  growth	
  cone	
  of	
  a	
  chick	
  dorsal	
  root	
  ganglion	
  neuron	
  stained	
  with	
  phalloidin,	
  to	
   visualize	
  actin	
  filaments	
  (50.00 green),	
  and	
  anti-­‐Tuj,	
  to	
  visualize	
  microtubules	
  (red).	
    *  *  % Collapse  Filopodia(arrowheads)	
  protruding	
  from	
  the	
  fan-­‐like	
  lamellipodium	
  (arrow)	
  can	
  be	
    40.00  observed	
  (P=	
  peripheral	
  domain;	
  T=	
  transitional	
  domain;	
  C=central	
  domain).	
    lue  30.00 20.00 10.00 0.00  	
    Control  HA5BMyc  HA5B6xHis  Fig. 3 Cleaved Sema5B is repulsive toward dorsal root ganglion growth cones. (a) Not collapsed (left) and collapsed (right) growth cones are shown with anti-Tuj (green) labeling the microtubules and Phalloidin (Red) labeling the actin filaments in growth cones. Growth 2	
   were concones with no lamellopodia and four or less lamellopodia sidered collapsed. (b) Quantification of E8 chick DRG neuron growth cone collapse following application of concentrated conditioned media  morphology	
  consistent	
  with	
  the	
  leading	
  edge	
  of	
  other	
  migrating	
  cell	
  types.	
  This	
   region	
  is	
  actin-­‐rich	
  and	
  consists	
  of	
  lamellipodial	
  and/or	
  filopodial	
  structures.	
   Lamellipodia	
  are	
  flat	
  fan-­‐like	
  structures	
  present	
  at	
  the	
  leading	
  edge	
  and	
   predominantly	
  consist	
  of	
  actin	
  arranged	
  in	
  a	
  meshwork	
  of	
  short	
  branches	
  with	
  their	
   barbed	
  ends	
  at	
  the	
  membrane	
  (Small	
  1988;	
  Ponti	
  et	
  al.	
  2004).	
  Monomeric	
  actin	
   proteins	
  are	
  structurally	
  polarized	
  molecules	
  that	
  combine	
  to	
  form	
  bipolar	
   filamentous	
  polymers.	
  The	
  end	
  of	
  the	
  F-­‐actin	
  (filamentous	
  actin)	
  chain	
  where	
   polymerization	
  mainly	
  occurs	
  is	
  referred	
  to	
  as	
  the	
  barbed	
  or	
  plus	
  end.	
   The	
  orthogonal	
  array	
  of	
  F-­‐actin	
  within	
  lamellipodia	
  is	
  comprised	
  largely	
  of	
   Arp2/3	
  nucleated	
  branches	
  (Small	
  1988;	
  Ponti	
  et	
  al.	
  2004).	
  The	
  Arp2/3	
  complex	
   (Arp:	
  actin-­‐related	
  protein)	
  consists	
  of	
  seven	
  subunits	
  that	
  together	
  facilitate	
  the	
   initiation	
  of	
  F-­‐actin	
  branch	
  formation	
  by	
  binding	
  to	
  a	
  preexisting	
  F-­‐actin	
  filament	
   and	
  nucleating	
  a	
  new	
  filament	
  at	
  a	
  70o	
  angle	
  (Machesky	
  et	
  al.	
  1999;	
  Higgs	
  and	
   Pollard	
  2001).	
  The	
  conformation	
  of	
  Arp2/3	
  resembles	
  that	
  of	
  a	
  barbed	
  end	
  and	
  thus	
   it	
  acts	
  as	
  a	
  nucleation	
  point	
  for	
  subsequent	
  addition	
  of	
  actin	
  monomers	
  (Beltzner	
   and	
  Pollard	
  2004).	
  Elongation	
  of	
  individual	
  chains	
  of	
  F-­‐actin	
  at	
  the	
  barbed	
  ends	
  and	
   bundling	
  of	
  numerous	
  F-­‐actin	
  filaments	
  results	
  in	
  finger-­‐like	
  membrane	
   protrusions,	
  known	
  as	
  filopodia	
  (e.g.,	
  (Yamada,	
  Spooner,	
  and	
  Wessells	
  1971;	
   Letourneau	
  1983;	
  Lewis	
  and	
  Bridgman	
  1992)).	
  	
   Several	
  Rho	
  GTPases	
  are	
  regulators	
  of	
  the	
  formation	
  of	
  lamellipodia	
  and	
   filopodia,	
  including	
  Rho,	
  Rac	
  and	
  Cdc42	
  (Ridley	
  and	
  Hall	
  1992;	
  Hall	
  1998;	
  Hall	
   2005).	
  Rho	
  regulates	
  actomyosin	
  filament	
  assembly	
  and	
  the	
  stable	
  adhesion	
   complexes	
  within	
  more	
  mature	
  regions	
  of	
  lamellipodia.	
  Rac,	
  on	
  the	
  other	
  hand,	
   	
    3	
    regulates	
  lamellipodia	
  formation	
  and	
  induces	
  adhesion	
  contact	
  formation	
  in	
  newly	
   advanced	
  regions	
  of	
  the	
  lamellipodia.	
  Cdc24	
  regulates	
  filopodia	
  formation	
  (Ridley	
  et	
   al.	
  2003).	
  	
   Behind	
  the	
  lamellipodium,	
  there	
  is	
  an	
  actin-­‐	
  and	
  myosin	
  II-­‐rich	
  region,	
  the	
   transitional	
  domain,	
  where	
  the	
  actomyosin	
  network	
  connects	
  to	
  adhesion	
   complexes	
  and	
  transmits	
  the	
  force	
  required	
  for	
  migration	
  (Ponti	
  et	
  al.	
  2004);	
   (Gupton	
  et	
  al.	
  2005).	
  F-­‐actin	
  polymerizes	
  at	
  the	
  membrane	
  and	
  flows	
  in	
  a	
  retrograde	
   motion	
  from	
  the	
  leading	
  edge	
  towards	
  the	
  central	
  domain	
  (Forscher	
  and	
  Smith	
   1988;	
  C.	
  H.	
  Lin	
  and	
  Forscher	
  1995).	
  The	
  central	
  domain	
  consists	
  mainly	
  of	
  stable	
   microtubules	
  and	
  bidirectional	
  vesicle	
  transport	
  occurs	
  in	
  this	
  region	
  (Dent	
  and	
   Gertler	
  2003).	
   1.1.1 Axon	
  outgrowth	
   	
   The	
  process	
  of	
  axon	
  outgrowth	
  can	
  be	
  divided	
  into	
  three	
  main	
  stages:	
   protrusion,	
  engorgement,	
  and	
  consolidation.	
  During	
  protrusion,	
  membrane	
   protrusions,	
  primarily	
  driven	
  by	
  the	
  polymerization	
  of	
  actin,	
  extend	
  at	
  the	
  leading	
   edge	
  of	
  the	
  growth	
  cone.	
  This	
  is	
  then	
  followed	
  by	
  the	
  invasion	
  of	
  organelles,	
   including	
  vesicles	
  and	
  mitochondria,	
  as	
  well	
  as	
  microtubules	
  into	
  the	
  newly	
   extended	
  region.	
  The	
  actin	
  meshwork	
  then	
  collapses	
  at	
  the	
  proximal	
  side	
  of	
  the	
   growth	
  cone	
  leaving	
  a	
  cylindrical,	
  consolidated	
  neurite,	
  giving	
  rise	
  to	
  a	
  new	
  segment	
   of	
  axon	
  (reviewed	
  in	
  Dent	
  and	
  Gertler	
  2003).	
  	
   	
   Much	
  of	
  the	
  research	
  investigating	
  growth	
  cone	
  migration	
  has	
  focused	
  on	
  the	
   first	
  two	
  of	
  these	
  stages	
  and	
  little	
  is	
  known	
  about	
  the	
  process	
  of	
  consolidation;	
   however,	
  understanding	
  how	
  neurons	
  develop,	
  maintain,	
  and	
  alter	
  their	
   	
    4	
    morphology	
  is	
  of	
  crucial	
  importance	
  to	
  the	
  understanding	
  of	
  the	
  mechanisms	
   involved	
  in	
  plasticity	
  and	
  repair.	
  In	
  a	
  2009	
  paper	
  from	
  our	
  lab	
  (Mingorance-­‐Le	
  Meur	
   and	
  O'Connor	
  2009),	
  we	
  sought	
  out	
  to	
  examine	
  whether	
  axon	
  consolidation	
  was	
  a	
   process	
  requiring	
  active	
  maintenance,	
  as	
  seen	
  in	
  other	
  cell	
  types,	
  or	
  a	
  latent	
  state,	
  as	
   had	
  been	
  previously	
  assumed.	
  If,	
  as	
  predicted,	
  consolidation	
  required	
  active	
   maintenance,	
  a	
  repressor	
  or	
  repressors	
  would	
  be	
  necessary.	
  Calpain	
  was	
  examined	
   as	
  a	
  potential	
  candidate	
  for	
  this	
  role.	
    1.2 Calpain	
   Calpain	
  was	
  initially	
  considered	
  as	
  a	
  candidate	
  to	
  be	
  involved	
  in	
  the	
  process	
  of	
   axon	
  consolidation	
  due	
  to	
  its	
  previously	
  determined	
  roles	
  in	
  modulating	
  cell	
   adhesion	
  and	
  actin	
  dynamics	
  in	
  non-­‐neuronal	
  cell	
  migration	
  (Franco	
  and	
   Huttenlocher	
  2005;	
  Flevaris	
  et	
  al.	
  2007)	
  as	
  well	
  as	
  in	
  growth	
  cone	
  guidance	
  (Robles,	
   Huttenlocher,	
  and	
  Gomez	
  2003;	
  Wu	
  and	
  Lynch	
  2006).	
  	
   1.2.1 Structure	
  and	
  regulation	
  of	
  calpain	
  proteases	
   Calpains	
  are	
  intracellular	
  calcium-­‐dependent	
  cysteine	
  proteases	
  which	
  are	
   widely	
  expressed	
  throughout	
  various	
  animal	
  tissues,	
  including	
  nervous	
  tissue	
   (Sorimachi,	
  Saido,	
  and	
  Suzuki	
  1994),	
  and	
  which	
  play	
  integral	
  roles	
  in	
  several	
   developmentally	
  relevant	
  processes.	
  There	
  are	
  16	
  known	
  calpain	
  genes	
  in	
  humans,	
   14	
  of	
  which	
  encode	
  catalytic	
  subunits	
  and	
  2	
  of	
  which	
  encode	
  regulatory	
  subunits	
   (reviewed	
  in	
  Sorimachi,	
  Hata,	
  and	
  Ono	
  2011).	
  Calpain	
  1	
  and	
  2	
  (or	
  μ-­‐	
  and	
  m-­‐calpain,	
   respectively	
  –	
  so	
  named	
  for	
  the	
  concentration	
  of	
  Ca2+	
  required	
  for	
  their	
  activation)	
    	
    5	
    are	
  described	
  as	
  ‘typical’	
  or	
  ‘canonical’	
  calpains.	
  They	
  each	
  consist	
  of	
  a	
  large	
   catalytic	
  subunit	
  and	
  a	
  small,	
  common,	
  regulatory	
  subunit.	
   The	
  catalytic	
  domain	
  of	
  each	
  calpain,	
  domain	
  II,	
  contains	
  three	
  residues	
  on	
   which	
  protease	
  activity	
  depends,	
  cysteine,	
  histidine	
  and	
  asparagine	
  –	
  the	
  catalytic	
   triad	
  (Figure	
  1-­‐2).	
  These	
  are	
  arranged	
  such	
  that	
  in	
  the	
  inactive	
  conformation	
  of	
  the	
   protein,	
  catalytic	
  activity	
  is	
  not	
  possible,	
  indicating	
  the	
  need	
  for	
  conformational	
   change	
  in	
  order	
  for	
  activation	
  (Strobl	
  et	
  al.	
  2000;	
  Hosfield	
  et	
  al.	
  1999).	
   A	
  number	
  of	
  mechanisms	
  have	
  been	
  implicated	
  in	
  the	
  regulation	
  of	
  the	
   activation	
  of	
  calpain.	
  Firstly	
  is	
  calpain’s	
  calcium	
  requirement.	
  Domain	
  IV	
  of	
  calpain	
   contains	
  five	
  calcium-­‐binding	
  EF-­‐hand	
  motifs	
  (Blanchard	
  et	
  al.	
  1997;	
  Hosfield	
  et	
  al.	
   1999);	
  however,	
  Ca2+	
  binding	
  in	
  the	
  EF-­‐hands	
  is	
  insufficient	
  for	
  the	
  conformational	
   changes	
  required	
  for	
  calpain	
  activation	
  –	
  Ca2+	
  must	
  also	
  bind	
  in	
  domain	
  II	
  (Hata	
  et	
   al.	
  2001).	
  In	
  addition,	
  in	
  vivo	
  levels	
  of	
  calcium	
  rarely	
  reach	
  those	
  necessary	
  for	
   optimal	
  activation	
  of	
  calpain,	
  as	
  determined	
  in	
  vitro,	
  except	
  in	
  pathological	
   situations	
  such	
  as	
  axonal	
  transection.	
  Therefore,	
  it	
  is	
  thought	
  that	
  other	
  regulatory	
   mechanisms	
  are	
  likely	
  at	
  play	
  in	
  order	
  to	
  lower	
  the	
  Ca2+	
  requirement	
  of	
  calpain	
  and	
   enhance	
  activation.	
  One	
  possible	
  mechanism	
  through	
  which	
  this	
  occurs,	
  is	
  through	
   phospholipid	
  binding	
  in	
  domain	
  III,	
  a	
  C2-­‐like	
  domain	
  –	
  known	
  to	
  bind	
   phospholipids,	
  (Tompa	
  et	
  al.	
  2001)	
  which	
  has	
  been	
  demonstrated	
  to	
  decrease	
  the	
   calcium	
  requirement	
  of	
  calpain	
  in	
  vitro	
  (Arthur	
  and	
  Crawford	
  1996;	
  Melloni	
  et	
  al.	
   1996).	
  The	
  relevance	
  of	
  this	
  process	
  in	
  vivo,	
  however,	
  is	
  yet	
  unknown.	
  	
   One	
  of	
  the	
  most	
  well	
  characterized	
  mechanisms	
  of	
  regulation	
  of	
  mammalian	
   calpains	
  is	
  its	
  interaction	
  with	
  the	
  endogenous	
  inhibitor	
  calpastatin	
  (reviewed	
  by	
  	
   	
    6	
    !,-(((((./-(((()-0(  !"#"$%&'()*%$ !"#$%&'(  !,-(((((./-(((()-0(  +,"%"'-(.&$#).&*"/&%0),$ !"#$)(  !,-(((((./-(((()-0(  !"#$*( 1((((((((1((((((((1(  !"#$!( !,-(((((./-(((()-0(  !"#$+(  234564#,78( 94:"/0(  234#/06<3/8?( 94:"/0(  !'<#/C6( 94:"/0(  ;0<=0>63( 94:"/0(  @AB( 94:"/0(  D<563:/0"#( 36>/40(  2605"<EF< ?"09(:47G(  	
    Figure	
  1–2.	
  Calpain	
  domain	
  structure	
  and	
  homology.	
  	
   Domain	
  structure	
  of	
  calpain	
  proteases	
  is	
  mainly	
  conserved	
  between	
  humans	
  and	
   Drosophila	
  melanogaster,	
  in	
  particular	
  the	
  proteolytic	
  domain	
  (blue)	
  and	
  the	
   catalytic	
  triad	
  (except	
  for	
  CalpC).	
    	
    7	
    (Wendt,	
  Thompson,	
  and	
  Goll	
  2004).	
  It	
  appears	
  that	
  calpastatin	
  may	
  bind	
   preferentially	
  to	
  calpains	
  in	
  their	
  active	
  state	
  implicating	
  a	
  role	
  in	
  tempering	
  rather	
   than	
  prevention	
  of	
  activation.	
  In	
  addition,	
  autolysis	
  has	
  been	
  shown	
  to	
  occur	
  with,	
   but	
  is	
  not	
  necessary	
  for,	
  the	
  activation	
  of	
  calpain	
  1	
  and	
  2	
  (Baki	
  et	
  al.	
  1996;	
  Cong	
  et	
  al.	
   1989),	
  and	
  the	
  resultant	
  autolyzed	
  product	
  has	
  a	
  lower	
  calcium	
  requirement	
  (Baki	
   et	
  al.	
  1996;	
  Imajoh,	
  Kawasaki,	
  and	
  Suzuki	
  1986).	
  	
   Calpain	
  is	
  also	
  differentially	
  regulated	
  by	
  phosphorylation	
  in	
  response	
  to	
  the	
   activation	
  of	
  various	
  signaling	
  pathways.	
  For	
  example,	
  calpain	
  2	
  is	
  activated	
  by	
   phosphorylation	
  by	
  the	
  mitogen-­‐activated	
  protein	
  kinase	
  (MAPK)	
  in	
  response	
  to	
   epidermal	
  growth	
  factor	
  (EGF)	
  signaling	
  during	
  migration	
  in	
  fibroblasts	
  (Glading	
  et	
   al.	
  2000;	
  Glading	
  et	
  al.	
  2004;	
  Satish	
  et	
  al.	
  2005).	
  Contrastingly,	
  calpain	
  2	
  activity	
  is	
   inhibited	
  by	
  phosphorylation	
  by	
  protein	
  kinase	
  A	
  (PKA)	
  and	
  this	
  inhibition	
  is	
  able	
  to	
   prevent	
  calpain	
  2	
  activation	
  in	
  EGF-­‐mediated	
  migration	
  (Shiraha	
  et	
  al.	
  2002).	
  	
   1.2.2 Substrate	
  recognition	
   Substrates	
  of	
  calpain	
  include	
  many	
  different	
  classes	
  of	
  molecules	
  important	
  in	
   various	
  developmental	
  processes,	
  such	
  as	
  cytoskeletal	
  proteins,	
  adhesion	
  molecules,	
   transcription	
  factors,	
  and	
  signaling	
  enzymes	
  (reviewed	
  in	
  Sorimachi,	
  Hata,	
  and	
  Ono	
   2011).	
  Proteolysis	
  by	
  calpain	
  can	
  lead	
  to	
  degradation	
  of	
  the	
  substrate	
  or	
  to	
   modification,	
  due	
  to	
  limited	
  cleavage,	
  resulting	
  in	
  the	
  production	
  of	
  stable	
  cleavage	
   products	
  –	
  the	
  latter	
  being	
  more	
  common	
  (Franco	
  and	
  Huttenlocher	
  2005).	
   Although	
  many	
  substrates	
  of	
  calpain	
  are	
  known,	
  no	
  single	
  consensus	
  sequence	
  for	
   cleavage	
  has	
  been	
  identified.	
  There	
  are,	
  however,	
  several	
  factors	
  that	
  seem	
  to	
  play	
  a	
   role	
  in	
  the	
  recognition	
  of	
  targets	
  by	
  calpain	
  including	
  secondary	
  structure,	
  with	
  a	
   	
    8	
    preference	
  for	
  disordered	
  regions,	
  and	
  PEST	
  score	
  (Tompa	
  2004).	
  The	
  PEST	
  score	
  is	
   characterized	
  by	
  the	
  concentrated	
  presence	
  of	
  the	
  amino	
  acids	
  proline	
  (P),	
  glutamic	
   acid	
  (E),	
  serine	
  (S),	
  and	
  threonine	
  (T),	
  which	
  can	
  act	
  as	
  a	
  signal	
  for	
  proteolysis,	
  and	
   although	
  this	
  is	
  correlated	
  with	
  calpain	
  recognition,	
  it	
  is	
  not	
  always	
  necessary	
  or	
   sufficient	
  for	
  cleavage	
  by	
  calpain	
  (Molinari,	
  Anagli,	
  and	
  Carafoli	
  1995).	
  	
   1.2.3 Calpain	
  in	
  cell	
  motility	
   Many	
  proteins	
  involved	
  in	
  cell	
  migration	
  have	
  been	
  shown	
  to	
  be	
  substrates	
  of	
   calpains	
  in	
  vitro	
  and	
  in	
  cell	
  culture	
  but	
  their	
  in	
  vivo	
  relevance	
  has	
  yet	
  to	
  be	
   determined.	
  RNA	
  interference	
  (RNAi)	
  experiments	
  in	
  fibroblasts	
  demonstrated	
  that	
   calpain	
  2	
  is	
  necessary	
  for	
  the	
  proper	
  regulation	
  of	
  leading	
  edge	
  dynamics	
  and	
   membrane	
  protrusion	
  and	
  that	
  in	
  its	
  absence,	
  there	
  was	
  a	
  decrease	
  in	
  proteolysis	
  of	
   proteins	
  including	
  talin,	
  cortactin,	
  spectrin,	
  and	
  focal	
  adhesion	
  kinase	
  (FAK)	
   (Franco,	
  Perrin,	
  and	
  Huttenlocher	
  2004).	
  	
   Calpain	
  was	
  initially	
  described	
  in	
  cell	
  migration	
  as	
  a	
  result	
  of	
  its	
  role	
  in	
  the	
   turnover	
  of	
  adhesion	
  complexes.	
  Inhibition	
  of	
  calpain	
  slows	
  migration	
  due	
  to	
  the	
   increased	
  stabilization	
  of	
  adhesion	
  complexes	
  and	
  thus,	
  the	
  reduced	
  rate	
  of	
   detachment	
  of	
  the	
  rear	
  of	
  the	
  cell	
  (Huttenlocher	
  et	
  al.	
  1997;	
  Palecek	
  et	
  al.	
  1998).	
  In	
   addition,	
  inhibition	
  of	
  calpain	
  2	
  in	
  fibroblasts	
  resulted	
  in	
  a	
  decrease	
  in	
  cell	
  spreading	
   and	
  the	
  formation	
  of	
  abnormal	
  lamellipodia	
  and	
  filopodia	
  (Potter	
  et	
  al.	
  1998)	
   further	
  implicating	
  calpain	
  as	
  an	
  enhancer	
  of	
  cell	
  motility.	
  However,	
  in	
  a	
  separate	
   study,	
  inhibition	
  of	
  calpain	
  in	
  neutrophils	
  increased	
  cell	
  spreading	
  (Lokuta,	
  Nuzzi,	
   and	
  Huttenlocher	
  2003)	
  indicating	
  a	
  complex	
  role	
  for	
  calpains	
  in	
  cell	
  motility.	
    	
    9	
    Calpain	
  not	
  only	
  affects	
  adhesion	
  complexes	
  at	
  the	
  rear	
  of	
  migrating	
  cells,	
  but	
   also	
  actin	
  regulatory	
  proteins	
  at	
  the	
  leading	
  edge.	
  One	
  such	
  protein,	
  cortactin,	
  is	
  a	
   substrate	
  of	
  calpain	
  and	
  an	
  important	
  effector	
  of	
  membrane	
  protrusions.	
  The	
  fact	
   that	
  calpains	
  are	
  involved	
  in	
  various	
  pathways	
  even	
  within	
  a	
  single	
  cellular	
  process,	
   such	
  as	
  adhesion	
  complex	
  turnover	
  and	
  membrane	
  protrusion	
  in	
  cell	
  migration,	
   stresses	
  the	
  importance	
  of	
  the	
  strict	
  spatial	
  and	
  temporal	
  regulation	
  of	
  calpain	
   activity	
  within	
  the	
  cell.	
    1.3 Cortactin	
   1.3.1 Structure	
  and	
  regulation	
  of	
  cortactin	
   Cortactin	
  is	
  a	
  monomeric,	
  rod-­‐shaped	
  protein	
  of	
  approximately	
  65	
  kDa	
   (Weaver	
  et	
  al.	
  2002).	
  It	
  was	
  initially	
  described	
  as	
  a	
  substrate	
  of	
  the	
  tyrosine	
  kinase	
   Src	
  (Kanner	
  et	
  al.	
  1990;	
  Wu	
  et	
  al.	
  1991).	
  Cortactin	
  is	
  comprised	
  of	
  several	
  functional	
   domains,	
  which,	
  in	
  the	
  murine	
  form	
  of	
  the	
  protein,	
  have	
  been	
  well	
  characterized	
   (Figure	
  1-­‐3).	
  At	
  the	
  N-­‐terminus,	
  there	
  is	
  an	
  amino	
  terminal	
  acidic	
  domain	
  (NTA)	
   which	
  is	
  the	
  domain	
  that	
  interacts	
  with	
  Arp2/3	
  (Weed	
  et	
  al.	
  2000;	
  Weaver	
  et	
  al.	
   2002).	
  C-­‐terminal	
  to	
  the	
  NTA	
  is	
  a	
  group	
  of	
  tandem	
  repeats,	
  termed	
  cortactin	
  repeats,	
   consisting	
  of	
  six	
  full	
  repeats	
  and	
  one	
  partial	
  repeat	
  of	
  a	
  37	
  amino	
  acid	
  segment.	
  This	
   is	
  the	
  actin	
  biding	
  region	
  (ABR)	
  of	
  the	
  molecule	
  which	
  directly	
  binds	
  to	
  F-­‐actin	
   (reviewed	
  in	
  Ammer	
  and	
  Weed	
  2008).	
  Adjacent	
  to	
  that	
  is	
  the	
  α-­‐helical	
  domain.	
   Located	
  between	
  these	
  two	
  domains	
  are	
  four	
  known	
  calpain	
  cleavage	
  sites	
  (Huang	
   et	
  al.	
  1997;	
  Perrin,	
  Amann,	
  and	
  Huttenlocher	
  2006).	
  In	
  addition,	
  the	
  proline-­‐rich	
   domain	
  contains	
  several	
  regulatory	
  phosphorylation	
  sites,	
  both	
  Tyr	
  and	
  Ser.	
  Finally,	
  	
   	
    10	
    :'.2;&2<,' .;=2>2?='@<1=@' $0&-AB'  !  !"#$%&' #()' *+,-'  E  !"#$#%&'()'./012.3,' 44522'  E  6782,*./012.3,' 44922'  C"2.3,'  !  !"1=08<,2;' D/82<,'  F<,G=0' 0=?</,'  )0/;<,="0<.I' D/82<,'  J+0'&I/@'@<1='  E/012.3,' 0=&=21'  H"I=;<.2;' D/82<,'  %6B'' D/82<,'  %=0'&I/@'@<1='  	
    Figure	
  1–3.	
  Cortactin	
  domain	
  structure	
  and	
  homology.	
  	
   The	
  domain	
  structure	
  of	
  cortactin	
  is	
  highly	
  conserved	
  between	
  humans	
  and	
   Drosophila.	
  Examples	
  of	
  binding	
  partners	
  of	
  cortactin	
  are	
  indicated	
  in	
  the	
  same	
   colour	
  as	
  the	
  domain	
  with	
  which	
  they	
  interact	
  (e.g.,	
  Arp2/3	
  interacts	
  with	
  the	
  N-­‐ terminal	
  domain	
  and	
  both	
  are	
  displayed	
  in	
  blue).	
  The	
  cortactin	
  repeats	
  comprise	
  the	
   actin-­‐binding	
  region	
  (ABR).	
  Exact	
  phosphorylation	
  sites	
  of	
  Drosophila	
  cortactin	
  are	
   unknown,	
  and	
  therefore	
  not	
  indicated.	
    	
    11	
    the	
  C-­‐terminal	
  domain	
  is	
  a	
  Src	
  homology	
  3	
  (SH3)	
  domain.	
  The	
  proline-­‐rich	
  regions	
   of	
  many	
  of	
  cortactin’s	
  binding	
  partners	
  interact	
  with	
  this	
  domain	
  including,	
  N-­‐WASp	
   (Weaver	
  et	
  al.	
  2002),	
  WIP	
  (WASP	
  interacting	
  protein)	
  (Kinley	
  et	
  al.	
  2003),	
  and	
   dynamin	
  2	
  (McNiven	
  et	
  al.	
  2000).	
   Various	
  post-­‐translational	
  modifications	
  are	
  implicated	
  in	
  the	
  regulation	
  of	
   cortactin.	
  For	
  example,	
  cortactin	
  can	
  be	
  acetylated	
  by	
  PCAF	
  (P300/CBP-­‐associated	
   factor),	
  which	
  inhibits	
  binding	
  to	
  F-­‐actin	
  and	
  prevents	
  localization	
  to	
  the	
  cell	
   periphery,	
  and	
  deacetylated	
  by	
  HDAC6	
  (Zhang	
  et	
  al.	
  2007).	
  Cortactin	
  is	
  also	
   phosphorylated	
  at	
  several	
  sites	
  within	
  the	
  proline-­‐rich	
  domain.	
  Phosphorylation	
  by	
   Src	
  induces	
  a	
  conformational	
  change	
  allowing	
  for	
  more	
  efficient	
  cleavage	
  of	
   cortactin	
  by	
  calpain	
  (Huang	
  et	
  al.	
  1997;	
  Perrin,	
  Amann,	
  and	
  Huttenlocher	
  2006)	
   promoting	
  its	
  degradation	
  and	
  decreasing	
  N-­‐WASp	
  binding	
  (Martinez-­‐Quiles	
  et	
  al.	
   2004)	
  .	
  Cortactin	
  is	
  also	
  phosphorylated	
  by	
  Erk1/2	
  (or	
  MAPK)	
  (Campbell,	
   Sutherland,	
  and	
  Daly	
  1999),	
  and	
  this	
  modification	
  increases	
  N-­‐WASp	
  binding	
  and	
   Arp2/3	
  activation	
  (Martinez-­‐Quiles	
  et	
  al.	
  2004).	
   1.3.2 Cortactin	
  promotes	
  actin	
  polymerization	
  and	
  branching	
   Cortactin	
  acts	
  as	
  a	
  nucleation-­‐promoting	
  factor	
  (NPF)	
  through	
  its	
  direct	
   association	
  with,	
  and	
  facilitation	
  of,	
  the	
  Arp2/3	
  complex	
  (Uruno	
  et	
  al.	
  2001;	
  Weaver	
   et	
  al.	
  2001;	
  Welch	
  and	
  Mullins	
  2002).	
  Cortactin	
  stabilizes	
  the	
  active	
  conformation	
  of	
   Arp2/3	
  enhancing	
  polymerization	
  (Weaver	
  et	
  al.	
  2002;	
  Pollard	
  2007),	
  and	
  stabilizes	
   Arp2/3	
  nucleated	
  branch	
  points	
  (Weaver	
  et	
  al.	
  2001).	
  The	
  Wiskott-­‐Aldrich	
   syndrome	
  protein	
  (WASP)	
  family,	
  including	
  WASP	
  and	
  N-­‐WASp	
  also	
  act	
  as	
  NPFs	
  for	
   Arp2/3	
  (Pollard	
  2007).	
  N-­‐WASp	
  binds	
  F-­‐actin,	
  Arp2/3,	
  and	
  G-­‐actin	
  monomers	
   	
    12	
    effectively	
  localizing	
  monomers	
  to	
  the	
  Arp2/3	
  complex	
  thereby	
  enhancing	
   polymerization	
  (Machesky	
  et	
  al.	
  1999).	
  Cortactin	
  enhances	
  N-­‐WASp’s	
  activation	
  of	
   Arp2/3	
  (Weaver	
  et	
  al.	
  2001)	
  and,	
  upon	
  binding,	
  relieves	
  its	
  autoinhibition	
  (Mizutani	
   et	
  al.	
  2002).	
  There	
  is	
  evidence	
  that	
  these	
  two	
  NPFs	
  may	
  act	
  concomitantly,	
  as	
  both	
   are	
  able	
  to	
  bind	
  Arp2/3	
  at	
  the	
  same	
  time	
  (Weaver	
  et	
  al.	
  2002),	
  or	
  sequentially,	
   where	
  N-­‐WASp	
  binds	
  Arp2/3	
  activating	
  it	
  and	
  is	
  then	
  displaced	
  by	
  cortactin,	
  which	
   stabilizes	
  the	
  complex	
  and	
  the	
  new	
  branch	
  point	
  (Uruno	
  et	
  al.	
  2003).	
  	
   1.3.3 Cortactin	
  in	
  cell	
  adhesion	
   Adhesive	
  contacts	
  are	
  necessary	
  in	
  order	
  to	
  provide	
  traction	
  force.	
  Cortactin	
   appears	
  to	
  be	
  involved	
  in	
  both	
  actin	
  dynamics	
  and	
  adhesion	
  formation	
  enabling	
  it	
  to	
   integrate	
  these	
  two	
  crucial	
  processes	
  in	
  cell	
  migration.	
  However,	
  research	
  into	
   exactly	
  how	
  cortactin	
  is	
  involved	
  in	
  the	
  formation	
  of	
  adhesion	
  contacts	
  has	
  yielded	
   varying	
  results.	
  For	
  example,	
  it	
  has	
  been	
  demonstrated	
  that	
  RNAi	
  knockdown	
  of	
   cortactin	
  decreases	
  the	
  rate	
  of	
  new	
  adhesion	
  formation	
  (Bryce	
  et	
  al.	
  2005)	
  and	
   lamellipodial	
  persistence	
  (Illés	
  et	
  al.	
  2006).	
  Conversely,	
  some	
  studies	
  have	
  shown	
   the	
  opposite	
  effect:	
  enhanced	
  lamellipodia	
  formation	
  with	
  reduction	
  in	
  cortactin	
   expression	
  (Kempiak	
  et	
  al.	
  2005).	
  Discrepancies	
  in	
  results	
  may	
  be	
  a	
  result	
  of	
  various	
   factors	
  likely	
  including	
  different	
  cell	
  types	
  examined,	
  the	
  context	
  in	
  which	
  they	
  are	
   studied,	
  substrate	
  on	
  which	
  they	
  are	
  plated	
  and	
  the	
  type	
  of	
  growth	
  stimulus	
  applied.	
   Therefore,	
  it	
  is	
  of	
  importance	
  to	
  deduce	
  the	
  physiological	
  role	
  of	
  cortactin	
  in	
  an	
  in	
   vivo	
  setting.	
    	
    13	
    1.4 Calpain	
  cleavage	
  of	
  cortactin	
  inhibits	
  membrane	
  protrusions	
   Perrin	
  et	
  al,	
  2006,	
  reported	
  on	
  the	
  calpain-­‐mediated	
  cleavage	
  of	
  cortactin	
  and	
   its	
  role	
  in	
  the	
  formation	
  of	
  membrane	
  protrusions	
  during	
  fibroblast	
  cell	
  migration.	
   In	
  this	
  study,	
  the	
  researchers	
  uncovered	
  four	
  unique	
  sites	
  for	
  proteolysis	
  in	
  the	
   region	
  linking	
  the	
  cortactin	
  repeats	
  and	
  the	
  α-­‐helical	
  domain	
  of	
  cortactin.	
  With	
  this	
   knowledge,	
  they	
  developed	
  a	
  calpain-­‐resistant	
  mutant	
  of	
  cortactin	
  whose	
   overexpression	
  resulted	
  in	
  an	
  increase	
  in	
  the	
  formation	
  of	
  transient	
  membrane	
   protrusions	
  and	
  impairment	
  in	
  migration.	
  This	
  indicates	
  that	
  normally	
  calpain	
   cleavage	
  of	
  cortactin	
  suppresses	
  membrane	
  protrusions.	
  As	
  previously	
  indicated,	
   researchers	
  have	
  observed	
  varied	
  results	
  with	
  the	
  overexpression	
  of	
  cortactin.	
  In	
   some	
  studies,	
  an	
  enhancement	
  of	
  protrusion	
  and	
  migration	
  is	
  observed	
  (Patel	
  et	
  al.	
   1998;	
  Bryce	
  et	
  al.	
  2005);	
  whereas	
  in	
  others,	
  no	
  effect	
  or	
  the	
  opposite	
  is	
  seen	
  (Kinley	
   et	
  al.	
  2003;	
  Lua	
  and	
  Low	
  2004;	
  Perrin,	
  Amann,	
  and	
  Huttenlocher	
  2006).	
  	
   Although	
  calpain	
  cleavage	
  of	
  many	
  of	
  its	
  substrates	
  is	
  limited	
  and	
  results	
  in	
  the	
   formation	
  of	
  active	
  products,	
  cleavage	
  of	
  cortactin	
  seems	
  to	
  be	
  degradative.	
  This	
   was	
  implicated	
  through	
  an	
  siRNA	
  knockdown	
  of	
  calpain	
  which	
  resulted	
  in	
  the	
   doubling	
  of	
  cortactin	
  levels.	
  In	
  addition,	
  expression	
  of	
  the	
  cleavage	
  products	
  had	
  no	
   observable	
  effect	
  indicating	
  they	
  have	
  no	
  independent	
  function	
  (Perrin,	
  Amann,	
  and	
   Huttenlocher	
  2006).	
  They	
  also	
  demonstrated	
  that	
  although	
  the	
  association	
  of	
   cortactin	
  with	
  Arp2/3	
  is	
  important	
  in	
  its	
  role	
  in	
  membrane	
  protrusion,	
  it	
  is	
  not	
   essential.	
  A	
  cortactin	
  mutant	
  lacking	
  the	
  NTA	
  domain,	
  and	
  therefore	
  the	
  ability	
  to	
   bind	
  Arp2/3,	
  was	
  still	
  able	
  to	
  facilitate	
  protrusions.	
  This	
  likely	
  occurred	
  through	
  its	
   association	
  with	
  other	
  polymerization	
  enhancing	
  proteins	
  through	
  its	
  SH3	
  domain.	
   	
    14	
    The	
  results	
  of	
  their	
  work	
  lead	
  to	
  the	
  conclusions	
  that	
  the	
  spatially	
  restricted	
  calpain	
   cleavage	
  of	
  cortactin	
  may	
  restrict	
  the	
  formation	
  of	
  membrane	
  protrusions	
  to	
  specific	
   regions,	
  increasing	
  the	
  efficacy	
  of	
  migration.	
  Also,	
  calpain-­‐mediated	
  degradation	
  of	
   cortactin	
  may	
  result	
  in	
  the	
  destabilization	
  of	
  the	
  cortical	
  actin	
  network	
  effectively	
   regulating	
  membrane	
  protrusion.	
    1.5 Calpain	
  actively	
  maintains	
  consolidation	
  through	
  cleavage	
  of	
   cortactin	
   Much	
  of	
  the	
  research	
  performed	
  examining	
  the	
  role	
  of	
  cortactin	
  and	
  calpain	
  in	
   leading	
  edge	
  dynamics	
  has	
  been	
  performed	
  in	
  non-­‐neuronal	
  cell	
  types.	
  These	
  two	
   proteins	
  are,	
  however,	
  also	
  important	
  in	
  neuronal	
  outgrowth	
  and	
  branching	
   (Mingorance-­‐Le	
  Meur	
  and	
  O'Connor	
  2009).	
  Calpain	
  activity	
  was	
  found	
  to	
  be	
   restricted	
  to	
  consolidated	
  regions	
  of	
  growing	
  neurites	
  in	
  vitro	
  and	
  absent	
  from	
  the	
   growth	
  cone	
  based	
  on	
  the	
  immunostaining	
  of	
  the	
  proteolyzed	
  substrate	
  fodrin,	
  also	
   known	
  as	
  brain	
  spectrin	
  (Figure	
  1-­‐4).	
  This	
  finding	
  was	
  consistent	
  with	
  previous	
   findings	
  in	
  non-­‐neuronal	
  cells	
  showing	
  that	
  calpain	
  2	
  localizes	
  to	
  the	
  rear	
  of	
   migrating	
  cells	
  where	
  it	
  represses	
  protrusions	
  (Franco,	
  Perrin,	
  and	
  Huttenlocher	
   2004;	
  Flevaris	
  et	
  al.	
  2007).	
  In	
  addition,	
  the	
  inhibition	
  of	
  calpain	
  through	
  different	
   means,	
  including	
  the	
  use	
  of	
  pharmaceutical	
  agents	
  as	
  well	
  as	
  a	
  dominant	
  negative,	
   resulted	
  in	
  an	
  increase	
  in	
  sprouting	
  implicating	
  calpain’s	
  role	
  in	
  the	
  active	
   maintenance	
  of	
  consolidation	
  (Figure	
  1-­‐5).	
  	
  Specific	
  knockdown	
  of	
  calpain	
  2	
  proved	
   technically	
  difficult	
  and	
  therefore	
  it	
  was	
  difficult	
  to	
  elucidate	
  the	
  specific	
  role	
  of	
   calpain	
  2	
  in	
  consolidation.	
  Some	
  supporting	
  evidence,	
  however,	
  lies	
  in	
  the	
  fact	
  that	
   cortactin	
  is	
  a	
  substrate	
  of	
  calpain	
  2.	
  In	
  line	
  with	
  the	
  previously	
  demonstrated	
  role	
  of	
  	
   	
    15	
    !"#$%#&'(%)*+#)",-*  .  1%"2%*  ./0-*  3  4  	
    Figure 2 Calpain spatial distribution and activity correlate with neurite maturation. (A, as shown by immunolabelling of 1-day-old hippocampal neurons. Both calpain isof arrowhead) than in the neurite shaft (arrowhead). (C–E) In polarized neurons (6 days Cultured	
   ouse	
  has ippocampal	
   eurons	
   stained	
  with	
  (A)	
  an	
  antibody	
   against	
   and -2 together with entiremcell, shown nby immunocytochemistry of calpain-1 (F) Immunohistochemistry of calpain-2 in the hippocampus CA1 field shows expressi proteolyzed	
   fodrin	
   nd	
  (B)	
  in anti-­‐actin	
   ((C)	
   erge).	
  Arrowheads	
   the	
   in t-Boc reporter or pro (G) Calpain is aactive neurons asmdemonstrated by iandicate	
   decrease doses of the calpain inhibitor ALLM (w/o ¼ wash out). Results are mean±s.e.m. *Po0 boundary	
   between	
   the	
  consolidated	
   shaft	
  and	
  consolidated the	
  growth	
  cone.	
   Scale	
  bar	
   =	
  10	
  μm.	
   	
   observed in neurites that are partially (cons.), whereas portions that remai both proteins. (J) Western blot analysis of calpain-2 in 1-, 4- and 9-day in vitro culture fodrin (L) showing that calpain activity (proteolysis of fodrin) is restricted to the soma boundary (arrowheads). Abbreviations: SLM: stratum lacunosum moleculare; SP: strat Scale bars: (A–D) ¼ 10 mm, (E, F) ¼ 25 mm, (H–L) ¼ 10 mm. Figure	
  1–4.	
  Calpain	
  activity	
  is	
  restricted	
  to	
  consolidated	
  regions.	
  	
    Intraperiton was confirmed by time-lapse imaging of 4div neurons transdecreased t fected with DsRed (Supplementary Movie 1). Treatment of an assessed by axon with the calpain inhibitor calpeptin elicited an early in full-len response in the form of numerous transient filopodia and a (Supplemen later appearance of more stable protrusions (Supplementary of PSA-NCA Movie 1), as described in Figure 3E–I. As seen in Figure 3J, (Durbec an the protrusive response can start as rapidly as 30 seconds creased, in after calpain inhibition and it occurs both in axons (Figure 3J) hippocampu and dendrites (see Figure). These results implicate calpain in (Supplemen the regulation of neurite sprouting and in controlling both logical chan axon and dendrite consolidation. 2 days follo To determine the extent to which calpain inhibition also branches to promotes neurite sprouting in vivo, we investigated the changes in plasticity induced by calpain inhibition in the 16	
   tions to for 	
   the effect o hippocampus of adult mice, a well-characterized model focusing on of neuronal plasticity (Represa and Ben-Ari, 1992).  0  !"#$%&'()*'+%  //%  /%  9  ,-%./(%011"%  ///%  5'*)6&7(8234%  234%&'()*'+%  /%  :./(%011"%;%<='%  //%  	
   Figure	
  1–5.	
  Calpain	
  inhibition	
  and	
  cortactin	
  overexpression	
  induce	
  membrane	
   protrusions.	
  	
   (A)	
  Axons	
  of	
  cultured	
  hippocampal	
  neurons	
  treated	
  for	
  30	
  min	
  with	
  (i)	
  DMSO	
    control,	
  (ii)10	
  μM	
  ALLN,	
  or	
  (iii)	
  for	
  5	
  min	
  w ith	
  ALLN	
   followed	
  by	
  25	
   min	
  of	
  wash	
   ut	
   Figure 3 Pharmacological manipulation ofocalpain alters sproutin followed in (B–G). Representative images (B, C) and quantificati phalloidin and pseudocoloured to show(i)	
   intensity (w/o).	
  Scale	
  bar	
  =	
  10	
  μm.	
  (B)	
  Axons	
  of	
  hippocampal	
   neurons	
   overexpressing	
   RFP	
   levels, in neurites (E–G) showing induction of filopodia and branches by 10 mM ALL before and after treatment with ALLM showing the generation or	
  (ii)	
  cortactin-­‐RFP.	
   PSA-NCAM-positive neurons from the subgranular layer of the ad PSA-NCAM-positive neurons exposed to calpain inhibitors have i Scale bars: (A–J) ¼ 10 mm, (K–L) ¼ 25 mm. *Po0.05, **Po0.01, **  Figure 3 Pharmacological manipulation of calpain alters sprouting in vitro and in vivo. (A followed in (B–G). Representative images (B, C) and quantification (D) of neurites show phalloidin and pseudocoloured to show intensity levels, in neurites treated with the calpain & 2009 European Molecular Organization (E–G) showing induction of filopodia and branchesBiology by 10 mM ALLM (quantified in H, I, w before and after treatment with ALLM showing the generation of new sprouts (arrow PSA-NCAM-positive neurons from the subgranular layer of the adult dentate gyrus (cont 	
   17	
   PSA-NCAM-positive neurons exposed to calpain inhibitors have increased branching com Scale bars: (A–J) ¼ 10 mm, (K–L) ¼ 25 mm. *Po0.05, **Po0.01, ***Po0.001. Figure 3 Pharmacological manipulation of calpain alters sprouting in vitro and in vivo. (A) Schematic diagram of followed in (B–G). Representative images (B, C) and quantification (D) of neurites showing the appearance of a  cortactin	
  in	
  the	
  enhancement	
  of	
  membrane	
  protrusions,	
  as	
  described	
  above,	
   overexpression	
  of	
  cortactin	
  in	
  cultured	
  hippocampal	
  neurons	
  induced	
  sprouting	
   (Figure	
  1-­‐5).	
  The	
  expression	
  of	
  a	
  dominant	
  negative	
  form	
  of	
  cortactin	
  was	
  also	
  able	
   to	
  prevent	
  the	
  branching	
  phenotype	
  induced	
  by	
  inhibition	
  of	
  calpain	
  implying	
  that	
   cortactin	
  is	
  a	
  downstream	
  effector	
  of	
  calpain.	
   Finally,	
  through	
  these	
  experiments,	
  an	
  upstream	
  regulator	
  of	
  calpain	
  was	
   elucidated	
  –	
  PKA	
  (protein	
  kinase	
  A).	
  High	
  levels	
  of	
  cAMP	
  in	
  the	
  growth	
  cone	
  activate	
   PKA,	
  which	
  then	
  phosphorylates	
  calpain	
  repressing	
  its	
  activity.	
  cAMP	
  has	
  previously	
   been	
  demonstrated	
  to	
  promote	
  neurite	
  plasticity	
  and	
  branching	
  (Gallo	
  and	
   Letourneau	
  1998;	
  Kalil,	
  Szebenyi,	
  and	
  Dent	
  2000;	
  Spencer	
  and	
  Filbin	
  2004).	
  The	
   results	
  of	
  this	
  report	
  demonstrated	
  that	
  calpain	
  acts	
  as	
  a	
  repressor,	
  inhibiting	
  actin	
   polymerization	
  and	
  therefore,	
  sprouting,	
  in	
  the	
  consolidated	
  neurite	
  shaft	
   (summarized	
  in	
  Figure	
  1-­‐6).	
  	
    1.6 Drosophila	
  melanogaster	
  as	
  a	
  model	
  organism	
   1.6.1 GAL4/UAS	
  system	
   In	
  order	
  to	
  determine	
  the	
  effects	
  of	
  calpain	
  and	
  cortactin	
  on	
  axon	
  outgrowth	
  in	
   vivo,	
  I	
  turned	
  to	
  the	
  highly	
  versatile	
  model	
  organism	
  of	
  Drosophila	
  melanogaster.	
   One	
  major	
  benefit	
  of	
  using	
  Drosophila	
  is	
  the	
  plethora	
  of	
  readily	
  available	
  genetic	
   tools.	
  Central	
  to	
  these	
  is	
  the	
  GAL4/UAS	
  system	
  for	
  targeted	
  gene	
  expression.	
  GAL4	
  is	
   a	
  transcriptional	
  regulator,	
  originally	
  discovered	
  in	
  the	
  yeast	
  Saccharomyces	
   cerevisiae	
  which	
  regulates	
  the	
  expression	
  of	
  several	
  genes	
  (Laughon	
  et	
  al.	
  1984;	
   Laughon	
  and	
  Gesteland	
  1984).	
  The	
  genes	
  regulated	
  by	
  GAL4	
  were	
  found	
  to	
  have	
  	
   	
    18	
    Neurite consolidation requi A Mingorance-Le  of these neurites to sprout. We also found gical inhibition of calpain in vivo prom dendritic plasticity, which could lead to en genesis. Although this latter observation is carefully, given the known role of calpain delling synapses, including the proteolysi et al, 2008), it is reasonable to expect clo cesses such as synaptogenesis and morph (protrusion formation or repression) to sha ways, making it difficult to discriminate be interfere with one and not with the other. I calpain functions as a repressor that main shaft consolidated, therefore limiting neur during neuronal morphogenesis and in th mature neuronal projections. Our data suggest that a key downstream in regulating neurite consolidation is cortac by calpain in neurons, its overexpression 	
   branching and a dominant-negative form pr Indeed, overexpression of cortactin is suffic Figure 8 A model for calpain maintenance of neurite consolidation. We propose that calpain functions as a repressor of the sprouting of previously aspiny neurons (H Figure	
  1–6.	
  Model	
  o f	
  calpain	
   and	
   cortactin	
   in	
  orcgrowth onsolidation.	
   	
   protrusive activity needed for branching cone formation, 2003), and cortactin is required for the form therefore maintaining the shaft consolidated. Below a threshold spines in mature neurons (Hering and Sh level of active PKA, calpain is left unrepressed and it prevents actin et al, 2005). Thus, cortactin seems to regul patch formation though proteolysis of cortactin (soma and shaft). Consolidation	
  is	
  actively	
   mcAMP aintained	
   within	
   neurite	
   shaft	
   through	
   tof he	
  new activity	
   of	
   by controlling the ini branches Levels of and active PKA arethe	
   higher at the growth cone, so PKA inhibits calpain that allows de-repression of cortactin and actin filopodia. Several aspects of our findings on polymerization. Acute elevation of cAMP at the consolidated areas additional comment. First, we found that calpain	
  and	
  its	
  repression	
   of	
  cortactin.	
   Calpain	
   is	
  ngrowth egatively	
   regulated	
   b y	
   (centre) reproduces the signalling of the cone and leads stantly proteolysed by calpain in neurons, to deconsolidation and branch creation. the soma and neurite shaft. This implie phosphorylation	
  by	
  1990), PKA,	
  proteolysed and	
  therefore,	
   cAMP	
   levels,	
   which	
   high	
  in	
  cortactin the	
  growth	
   activity by protein levels, a regu fodrin is restricted to the neuriteare	
   shaft, other proteins such as b-catenin but so f beginning at the first signs of consolidation and persisting cortactin. Indeed, cortactin overexpression development. Not only do these results implicate cone	
  and	
  stimulated	
  throughout by	
  branching	
   factors.	
  An	
  increase	
  in	
  cAMP	
  leads	
  to	
   activation	
  of	
   in a hyper-branched and hyper-motile p calpain in the consolidation process but they also raise the three stimuli used to induce sprouting—c possibility that proteolysis of fodrin is used by calpain to PKA,	
  inhibition	
  of	
  calpain	
   derepression	
   of	
  actin cortactin	
   and	
   consolidation.	
   neurotrophins and netrin-1—produced an induce aand	
   local disconnection of filaments from the tactin levels. Finally, when calpain is ov plasma membrane (Hu and Bennett, 1991). Such a pattern dominant-negative form of cortactin is expr of activation is consistent with the reported role of calpain-2 ing response of the neuron to branching fac in non-neuronal migrating cells, where it preferentially locaor even prevented. This result strongly im lizes to the rear and represses the formation of protrusions branching is accomplished, at least in p (Franco et al, 2004; Flevaris et al, 2007). In addition to the calpain and therefore by ‘relieving’ the dow localization of calpain, we provide pharmacological and The finding that calpain expression cann molecular data (overexpression and dominant negative) domain-specific location of calpain activity that lead us to propose that calpain has a critical function upstream regulators of calpain determine in maintaining neurite consolidation. Although pharmacololocation of consolidation. Interestingly, gical inhibition of calpain and a dominant-negative calpain-2 cAMP, a well-known promoter of neuri promoted neurite branching, we do not know whether a branching (Gallo and Letourneau, 1998; specific knockdown of calpain-2 can also result in the formaSpencer and Filbin, 2004), is responsible fo tion of hyperbranched neurites, a task that has so far proven specific activation in neurons. Interestingly, difficult. However, in support of our conclusions, the knockactivation of calpain at the neurite sha down in hippocampal neurons of the calpain-2 target cortacrepression at the growth cone through tin results in the marked reduction of dendritic protrusions calpain active along the neurite and inact (Hering and Sheng, 2003), demonstrating a new and cone. These results imply that, in non-pa important function for calpain in the prevention of neurite tions, neuronal calpain appears to be regula sprouting. This resembles the regulation of GSK-3b in The growth, guidance and branching of neuronal proactive throughout the cell with the excepti cesses in the nervous system is controlled by multiple extracone, where local activation of PI3K resu cellular cues (Chilton, 2006), but can also be modulated pool of GSK-3b (Eickholt et al, 2002). Indeed intracellularly (Zhou and Snider, 2006). In this report, we is known to require interactions between demonstrate that inhibition of calpain enhances the capacity 	
   19	
  Kalil, 2001), and inhibi tubules (Dent and of young granule neurons to branch in vivo, indicating that regulator of microtubules, promotes neurite calpain is constitutively activated in growing neurites and et al, 2005). The similar pattern of subcellu regulates neuronal morphogenesis by controlling the capacity & 2009 European Molecular Biology Organization  The EMBO Journal  VO  common	
  enhancer	
  elements	
  that	
  were	
  bound	
  by	
  GAL4	
  known	
  as	
  the	
  Upstream	
   Activating	
  Sequences	
  (UAS)	
  (Giniger,	
  Varnum,	
  and	
  Ptashne	
  1985).	
  It	
  was	
  later	
   demonstrated	
  in	
  1988	
  that	
  GAL4	
  could	
  induce	
  expression	
  of	
  a	
  reporter	
  gene	
  under	
   the	
  control	
  of	
  UAS	
  in	
  Drosophila	
  (Fischer	
  et	
  al.	
  1988).	
   This	
  knowledge	
  was	
  then	
  transformed	
  into	
  a	
  universal	
  system	
  in	
  which	
  any	
   gene	
  of	
  interest	
  under	
  UAS	
  control	
  could	
  be	
  expressed	
  in	
  a	
  particular	
  subset	
  of	
  cells	
   expressing	
  GAL4	
  under	
  a	
  selected	
  endogenous	
  enhancer	
  (Brand	
  and	
  Perrimon	
   1993).	
  Brand	
  and	
  Perrimon	
  (1993)	
  developed	
  the	
  pUASt	
  vector	
  containing	
  five	
   tandem	
  optimized	
  GAL4	
  binding	
  sites,	
  the	
  hsp70	
  TATA	
  box,	
  and	
  a	
  multiple	
  cloning	
   site	
  for	
  insertion	
  of	
  the	
  coding	
  sequence	
  of	
  a	
  gene	
  of	
  interest	
  followed	
  by	
  a	
   polyadenylation	
  site.	
  They	
  also	
  developed	
  the	
  pGAWb	
  vector	
  containing	
  the	
  GAL4	
   coding	
  sequence.	
  This	
  transposable	
  P-­‐element	
  can	
  be	
  inserted	
  randomly	
  into	
  the	
   genome	
  resulting	
  in	
  the	
  production	
  of	
  various	
  fly	
  lines	
  with	
  the	
  GAL4	
  protein	
  driven	
   by	
  different	
  genomic	
  enhancers.	
  Mating	
  flies	
  with	
  enhancer-­‐GAL4	
  to	
  those	
  with	
  UAS-­‐ Gene	
  X	
  therefore	
  results	
  in	
  the	
  specific	
  misexpression	
  of	
  Gene	
  X	
  uniquely	
  in	
  the	
  cells	
   expressing	
  GAL4,	
  while	
  remaining	
  silent	
  in	
  all	
  other	
  cells.	
  Thus,	
  target	
  directed	
  gene	
   expression	
  can	
  be	
  achieved	
  by	
  selecting	
  an	
  enhancer	
  that	
  drives	
  GAL4	
  expression	
  in	
   cells	
  of	
  interest	
  and	
  crossing	
  flies	
  containing	
  that	
  driver	
  element	
  to	
  those	
  containing	
   an	
  insertion	
  of	
  a	
  gene	
  of	
  interest	
  under	
  UAS	
  control	
  (reviewed	
  by	
  Duffy	
  2002).	
  	
    	
    20	
    1.6.2 Calpain	
  and	
  cortactin	
  in	
  Drosophila	
   1.6.2.1 Calpain	
   There	
  are	
  four	
  calpain	
  genes	
  in	
  Drosophila	
  melanogaster	
  (reviewed	
  by	
   Friedrich,	
  Tompa,	
  and	
  Farkas	
  2004).	
  The	
  first	
  to	
  be	
  discovered	
  in	
  Drosophila	
  was	
   CalpD,	
  originally	
  referred	
  to	
  as	
  SOL	
  –	
  small	
  optic	
  lobe	
  –	
  since	
  mutations	
  in	
  this	
  gene	
   result	
  in,	
  as	
  one	
  might	
  expect,	
  a	
  small	
  optic	
  lobe.	
  This	
  phenotype	
  arose	
  from	
  the	
   absence	
  of	
  certain	
  neuron	
  classes	
  within	
  the	
  optic	
  lobe	
  (Delaney	
  et	
  al.	
  1991).	
   Subsequently,	
  the	
  other	
  Drosophila	
  calpain	
  genes,	
  CalpA,	
  CalpB,	
  and	
  CalpC,	
  were	
   identified	
  due	
  to	
  their	
  sequence	
  similarity	
  to	
  mammalian	
  calpains	
  (reviewed	
  in	
   Friedrich,	
  Tompa,	
  and	
  Farkas	
  2004).	
  	
   The	
  proteolytic	
  activity	
  of	
  Drosophila	
  calpains	
  is	
  dependent	
  on	
  the	
  same	
   catalytic	
  triad	
  as	
  that	
  of	
  mammalian	
  calpains:	
  Cys,	
  His,	
  Asn	
  –	
  also	
  located	
  in	
  domain	
   II	
  of	
  the	
  protein	
  (except	
  for	
  CalpC,	
  in	
  which	
  none	
  of	
  three	
  residues	
  is	
  conserved	
  most	
   likely	
  rendering	
  it	
  protease	
  dead)	
  (Figure	
  1-­‐2).	
  Unlike	
  the	
  mammalian	
  calpains,	
   however,	
  they	
  are	
  comprised	
  solely	
  of	
  the	
  catalytic	
  subunit	
  and	
  lack	
  the	
  small	
   regulatory	
  subunit.	
  The	
  catalytic	
  domain	
  of	
  CalpD	
  (SOL)	
  is	
  the	
  only	
  conserved	
   region	
  of	
  the	
  enzyme;	
  the	
  remainder	
  of	
  its	
  domain	
  structure	
  deviates	
  from	
  that	
  of	
  a	
   typical	
  calpain	
  (Delaney	
  et	
  al.	
  1991).	
  CalpA	
  and	
  CalpB,	
  on	
  the	
  other	
  hand,	
  have	
  a	
   relatively	
  conserved	
  domain	
  structure	
  compared	
  to	
  typical	
  mammalian	
  calpains	
  and	
   they	
  are	
  the	
  most	
  similar	
  to	
  calpain	
  1	
  and	
  2,	
  respectively.	
  CalpB,	
  without	
  its	
  N-­‐ terminal	
  domain	
  I,	
  shares	
  43%	
  identity	
  and	
  73%	
  similarity	
  to	
  calpain	
  2,	
  and	
  domain	
   III	
  of	
  both	
  enzymes	
  is	
  Ca2+	
  and	
  phosopholipid	
  binding	
  (Tompa	
  et	
  al.	
  2001).	
  In	
   addition,	
  autolysis	
  in	
  response	
  to	
  calcium,	
  similar	
  to	
  that	
  which	
  occurs	
  with	
   	
    21	
    mammalian	
  calpains,	
  has	
  also	
  been	
  demonstrated	
  in	
  Drosophila	
  Calpains	
  A	
  and	
  B	
   (Jékely	
  and	
  Friedrich	
  1999;	
  Farkas	
  et	
  al.	
  2004).	
  CalpA	
  has	
  two	
  splice	
  variants,	
  the	
   relative	
  expression	
  of	
  which	
  varies	
  throughout	
  development.	
  The	
  mRNA	
  expression	
   is	
  more	
  diffuse	
  than	
  the	
  protein	
  expression	
  pattern	
  indicating	
  post-­‐transcriptional	
   regulation	
  (Theopold	
  et	
  al.	
  1995).	
  CalpB	
  mRNA	
  is	
  also	
  expressed	
  differentially	
   throughout	
  the	
  developmental	
  timecourse.	
  It	
  is	
  expressed	
  at	
  high	
  levels	
  in	
  the	
   embryo	
  then	
  drops	
  temporarily	
  during	
  the	
  1st	
  instar	
  larval	
  stage	
  (Farkas	
  et	
  al.	
   2004).	
  Both	
  CalpA	
  and	
  B	
  show	
  nearly	
  ubiquitous	
  expression	
  patterns	
  and	
  are	
   present	
  in	
  most	
  tissues.	
  	
   Previous	
  research	
  performed	
  by	
  Emori	
  and	
  Saigo	
  (1994)	
  demonstrated	
   colocalization	
  of	
  CalpA	
  to	
  dynamic	
  actin-­‐based	
  structures	
  during	
  the	
   precellularization	
  stages	
  of	
  embryogenesis	
  and	
  implicated	
  a	
  role	
  for	
  CalpA	
  in	
   cytoskeletal	
  rearrangements	
  (Emori	
  and	
  Saigo	
  1994).	
  In	
  another	
  study,	
   phosphorylation	
  of	
  CalpB	
  by	
  MAPK	
  has	
  been	
  demonstrated	
  in	
  vitro.	
  This	
   phosphorylation	
  led	
  to	
  activation	
  of	
  CalpB,	
  increasing	
  autolysis	
  and	
  lowering	
  its	
  Ca2+	
   requirement	
  for	
  activation.	
  Further,	
  MAPK	
  phosphorylation	
  in	
  cultured	
  Drosophila	
   S2	
  cells	
  upon	
  stimulation	
  with	
  epidermal	
  growth	
  factor	
  (EGF)	
  was	
  observed	
  (Kovács	
   et	
  al.	
  2009).	
  The	
  results	
  of	
  these	
  experiments	
  recapitulate	
  observations	
  of	
  calpain	
   function	
  and	
  regulation	
  in	
  mammalian	
  cells,	
  further	
  indicating	
  homologous	
  roles	
  for	
   CalpA	
  and	
  CalpB.	
   1.6.2.2 Cortactin	
   Cortactin	
  is	
  highly	
  expressed	
  throughout	
  the	
  development	
  of	
  Drosophila	
  but	
   levels	
  drop	
  in	
  the	
  adult.	
  Drosophila	
  cortactin	
  also	
  has	
  a	
  conserved	
  domain	
  structure	
   	
    22	
    compared	
  to	
  human	
  cortactin	
  with	
  the	
  same	
  five	
  main	
  domains	
  and	
  >40%	
  identity	
   within	
  each	
  one	
  (Figure	
  1-­‐3)	
  (Katsube	
  et	
  al.	
  1998).	
  In	
  Drosophila,	
  cortactin	
  has	
  been	
   implicated	
  in	
  cell	
  adhesion	
  and	
  potentially	
  as	
  a	
  bridge	
  between	
  cell	
  adhesion	
   complexes	
  and	
  the	
  cortical	
  actin	
  network.	
  Homozygous	
  cortactin	
  null	
  mutants	
  were	
   viable	
  but	
  demonstrated	
  distinct	
  defects	
  during	
  oogenesis.	
  Cortactin	
  was	
  found	
  to	
   be	
  involved	
  in	
  the	
  proper	
  regulation	
  and	
  execution	
  of	
  border	
  cell	
  migration	
  in	
   coordination	
  with	
  Src	
  and	
  Arp2/3	
  complex	
  proteins	
  (Somogyi	
  and	
  Rørth	
  2004).	
  	
   Thus,	
  it	
  appears	
  that	
  cortactin	
  and	
  calpain	
  function	
  in	
  a	
  similar	
  manner	
  and	
  in	
   similar	
  cell	
  processes	
  in	
  Drosophila	
  as	
  in	
  higher	
  order	
  animals.	
  In	
  order	
  to	
  further	
   study	
  their	
  roles	
  within	
  Drosophila	
  melanogaster,	
  in	
  particular	
  in	
  neuron	
  outgrowth,	
   two	
  different	
  subsets	
  of	
  neurons	
  were	
  utilized	
  –	
  apterous-­‐expressing	
  neurons	
  and	
   eclosion	
  hormone-­‐expressing	
  neurons.	
   1.6.3 Apterous-­‐expressing	
  neurons	
   The	
  apterous	
  gene	
  encodes	
  a	
  member	
  of	
  the	
  LIM	
  homeodomain	
  transcriptional	
   regulators	
  and	
  is	
  expressed	
  in	
  a	
  subset	
  of	
  developing	
  neurons	
  within	
  the	
  central	
   nervous	
  system	
  (Lundgren	
  et	
  al.	
  1995),	
  as	
  well	
  as	
  other	
  tissues	
  including	
  the	
  wing	
   discs	
  (Blair	
  et	
  al.	
  1994).	
  Ap	
  is	
  transcribed	
  in	
  three	
  cells	
  (two	
  ventral,	
  one	
  dorsal)	
  per	
   hemisegment	
  of	
  the	
  ventral	
  nerve	
  cord	
  (VNC).	
  In	
  each	
  thoracic	
  hemisegment,	
  there	
   is	
  transcription	
  in	
  an	
  additional	
  four	
  cells	
  located	
  lateral	
  to	
  the	
  other	
  three	
  (Figure	
   1-­‐7).	
  The	
  cells	
  expressing	
  apterous	
  are	
  interneurons	
  that	
  have	
  a	
  specific	
  pattern	
  of	
   outgrowth	
  –	
  they	
  extend	
  axons	
  anteriorly	
  and	
  medially	
  within	
  the	
  ipsilateral	
   longitudinal	
  fascicle	
  around	
  11	
  hours	
  into	
  embryogenesis	
  (approximately	
  stage	
  14)	
   reaching	
  the	
  adjacent	
  anterior	
  segment	
  at	
  around	
  11.5	
  hours.	
  They	
  then	
  tightly	
  	
   	
    23	
    !  "#  $#  	
   Figure	
  1–7.	
  Apterous	
  expressing	
  neurons.	
  	
   (A)	
  Stage	
  16	
  embryonic	
  fillet	
  (ap-­‐GAL4,	
  UASCD8::GFP/+)	
  demonstrating	
  ap	
   expression	
  pattern	
  (scale	
  bar	
  =	
  100μm).	
  (B)	
  magnification	
  of	
  two	
  abdominal	
   segments.	
  Ventral	
  cells	
  indicated	
  by	
  arrow,	
  dorsal	
  cell	
  indicated	
  by	
  arrowhead.	
  (C)	
   Magnification	
  of	
  third	
  thoracic	
  segment	
  in	
  (A)	
  (outlined	
  in	
  orange).	
  The	
  additional	
   lateral	
  cells	
  	
  present	
  within	
  each	
  thoracic	
  hemisegment	
  are	
  outlined	
  by	
  a	
  circle.	
    	
    24	
    fasciculate	
  with	
  the	
  axons	
  of	
  ap-­‐expressing	
  cells	
  in	
  their	
  neighbouring	
  segments	
  and	
   continue	
  to	
  elongate	
  anteriorly	
  along	
  the	
  VNC.	
  In	
  apterous	
  null	
  mutants,	
  the	
  ap	
   neurons	
  are	
  still	
  present	
  and	
  extend	
  axons	
  around	
  the	
  correct	
  time	
  during	
   embryogenesis.	
  However,	
  the	
  axons	
  project	
  abnormally	
  deviating	
  from	
  the	
   longitudinal	
  fascicle	
  and	
  occasionally	
  projecting	
  laterally	
  or	
  crossing	
  the	
  midline.	
   The	
  ap	
  null	
  neurons	
  also	
  do	
  not	
  fasciculate	
  with	
  each	
  other,	
  although	
  fasciculation	
  of	
   other	
  neuron	
  classes	
  within	
  the	
  longitudinal	
  connectives	
  was	
  unaffected	
  in	
  these	
   mutants.	
  	
   Subsequent	
  research	
  investigating	
  the	
  signaling	
  pathways	
  involved	
  in	
  the	
   differentiation	
  and	
  development	
  of	
  a	
  subset	
  of	
  these	
  neurons	
  also	
  expressing	
   FMRFamide	
  led	
  to	
  the	
  generation	
  of	
  an	
  ap-­‐GAL4	
  driver	
  (apmd544;	
  (Allan	
  et	
  al.	
  2003)).	
   The	
  availability	
  of	
  this	
  genetic	
  tool	
  and	
  the	
  previous	
  characterization	
  of	
  their	
   specific	
  pathway	
  formation,	
  and	
  of	
  pathfinding	
  defects	
  within	
  it,	
  made	
  the	
  ap	
   neurons	
  a	
  excellent	
  potential	
  model	
  for	
  observing	
  effects	
  of	
  disruption	
  of	
   consolidation	
  and	
  branching	
  in	
  Drosophila.	
   1.6.4 Eclosion	
  hormone-­‐expressing	
  neurons	
   Research	
  into	
  the	
  role	
  of	
  the	
  neuropeptide	
  eclosion	
  hormone	
  (EH)	
  led	
  to	
  the	
   generation	
  of	
  a	
  GAL4	
  driver	
  line	
  EHups-­‐GAL4	
  (which	
  will	
  be	
  called	
  simply	
  EH-­‐GAL4	
   from	
  here	
  on)	
  (McNabb	
  et	
  al.	
  1997).	
  This	
  driver	
  induces	
  expression	
  of	
  GAL4	
   specifically	
  in	
  two	
  EH-­‐expressing	
  neurons.	
  Eclosion	
  hormone	
  is	
  important	
  in	
  the	
   process	
  of	
  ecdysis	
  between	
  developmental	
  stages	
  and	
  the	
  ablation	
  of	
  these	
   particular	
  two	
  cells	
  was	
  found	
  to	
  cause	
  delays	
  in	
  eclosion	
  and	
  deficits	
  in	
  related	
   responses	
  and	
  behaviours	
  (McNabb	
  et	
  al.	
  1997).	
  	
   	
    25	
    These	
  neurons	
  were	
  of	
  interest	
  in	
  the	
  current	
  work	
  due	
  to	
  the	
  specificity	
  of	
  the	
   driver	
  and	
  the	
  morphology	
  of	
  the	
  neurons.	
  The	
  cell	
  body	
  of	
  each	
  of	
  the	
  two	
  EH-­‐ expressing	
  neurons	
  is	
  located	
  in	
  the	
  anterior-­‐medial	
  region	
  of	
  the	
  brain	
  lobe	
  of	
  third	
   instar	
  larvae	
  with	
  a	
  dendritic	
  arbour	
  extending	
  laterally	
  within	
  the	
  brain	
  lobe.	
  Each	
   cell	
  extends	
  an	
  axon	
  anteriorly	
  out	
  of	
  the	
  CNS	
  and	
  in	
  the	
  corpora	
  cardiaca	
  and	
   another	
  posteriorly	
  through	
  the	
  VNC	
  (Figure	
  1-­‐8)	
  (McNabb	
  et	
  al.	
  1997).	
  It	
  is	
  this	
   second	
  axon	
  that	
  projects	
  through	
  the	
  VNC	
  with	
  little	
  to	
  no	
  branching	
  that	
  was	
  of	
   interest	
  to	
  me	
  because	
  if	
  any	
  branching	
  phenotype	
  were	
  to	
  arise	
  from	
  our	
   experiments,	
  it	
  should	
  be	
  readily	
  detectable	
  in	
  these	
  cells.	
  	
    1.7 Hypothesis	
   It	
  is	
  my	
  aim	
  to	
  begin	
  to	
  elucidate	
  the	
  roles	
  of	
  cortactin	
  and	
  calpain	
  in	
  axon	
   outgrowth	
  in	
  vivo	
  using	
  two	
  different	
  subsets	
  of	
  neurons	
  in	
  Drosophila,	
  apterous-­‐ expressing	
  and	
  EH-­‐expressing	
  neurons.	
  It	
  is	
  my	
  hypothesis	
  that	
  cortactin	
  promotes	
   axon	
  protrusion	
  and	
  outgrowth	
  and	
  that	
  it,	
  and	
  these	
  processes,	
  are	
  negatively	
   regulated	
  by	
  Calpain	
  B.	
    	
    26	
    !  "  #  	
   Figure	
  1–8.	
  Eclosion	
  hormone	
  expressing	
  neurons.	
  	
   (A)	
  Central	
  nervous	
  system	
  of	
  wandering	
  third	
  instar	
  larva	
  (outlined)	
  EH-­‐ GAL4,UASCD8::GFP/+	
  (scale	
  bar	
  =	
  50	
  μm).	
  (B)	
  magnification	
  of	
  VNC	
  in	
  A.	
  (C)	
  3-­‐D	
   projection	
  of	
  cell	
  bodies	
  and	
  neurite	
  structure	
  within	
  the	
  brain	
  lobes	
  of	
  another	
  EH-­‐ GAL4,UASCD8::GFP/+	
  larva	
  (generated	
  using	
  Simple	
  Neurite	
  Tracer	
  in	
  ImageJ)	
  (scale	
   bar	
  =	
  50	
  μm).	
    	
    27	
    Chapter	
  2: Methods	
   2.1 Immunohistochemistry	
   	
   Tissue	
  was	
  dissected	
  in	
  cold	
  PBS	
  and	
  fixed	
  in	
  4%	
  paraformaldehyde	
  (PFA)	
   for	
  25	
  minutes.	
  If	
  tissue	
  was	
  used	
  in	
  an	
  assay,	
  dissections	
  were	
  performed	
  in	
  an	
   appropriate	
  media	
  instead	
  of	
  PBS	
  before	
  fixing	
  (as	
  described	
  below).	
  Embryonic	
   tissue	
  was	
  dissected,	
  fixed,	
  and	
  stained	
  on	
  poly-­‐L-­‐lysine	
  (Sigma)	
  coated	
  slides.	
   Larval	
  tissue	
  was	
  dissected	
  and	
  fixed	
  pinned	
  to	
  dissection	
  pads	
  composed	
  of	
  Sylgard	
   184	
  (Dow	
  Corning)	
  and	
  transferred	
  to	
  500μL	
  eppendorf	
  tubes	
  for	
  staining.	
  After	
   fixation,	
  tissue	
  was	
  washed	
  repeatedly	
  in	
  PBT	
  (0.1%	
  Triton-­‐X100	
  (Fisher	
  Scientific)	
   in	
  PBS)	
  then	
  incubated	
  in	
  blocking	
  solution	
  (5%	
  bovine	
  serum	
  albumin	
  (BSA,	
  Fisher	
   Scientific)	
  in	
  PBT)	
  for	
  20	
  minutes.	
  The	
  primary	
  antibodies,	
  diluted	
  in	
  blocking	
   solution,	
  were	
  then	
  applied	
  and	
  samples	
  were	
  left	
  rocking	
  overnight	
  at	
  4oC.	
  Tissue	
   was	
  then	
  washed	
  and	
  reblocked	
  (as	
  before)	
  and	
  incubated	
  in	
  secondary	
  antibody	
   solution	
  for	
  2	
  hours	
  at	
  room	
  temperature	
  on	
  a	
  nutator.	
  Finally,	
  tissue	
  was	
  washed	
   repeatedly	
  again	
  in	
  PBT,	
  then	
  PBS	
  and	
  mounted	
  in	
  VectaShield	
  (Vector	
   Laboratories).	
  Slides	
  were	
  stored	
  at	
  4oC	
  until	
  imaged.	
   	
   Primary	
  antibodies	
  used	
  were:	
  goat	
  anti-­‐HRP	
  (1:300)	
  (Jackson	
   ImmunoResearch);	
  mouse	
  anti-­‐discs	
  large	
  (4F3)	
  (1:50)	
  (Developmental	
  Studies	
   Hybridoma	
  Bank,	
  developed	
  by	
  C.	
  Goodman);	
  mouse	
  anti-­‐GFP	
  (1:300)	
  (Abcam);	
   mouse	
  anti-­‐myc	
  (1:100)	
  (W.	
  Wang);	
  and	
  rabbit	
  anti-­‐HA	
  (1:500)	
  (Cell	
  Signaling	
   Technology).	
  Secondary	
  antibodies	
  from	
  Molecular	
  Probes,	
  Invitrogen	
  were:	
  goat	
    	
    28	
    anti-­‐rabbit	
  Alexa568	
  (1:500);	
  goat	
  anti-­‐mouse	
  Alexa488	
  (1:500);	
  donkey	
  anti-­‐ mouse	
  Alexa488	
  (1:300).	
  Other	
  secondary	
  antibodies	
  used	
  were:	
  donkey	
  anti-­‐rabbit	
   Texas	
  Red	
  (1:50)	
  (Jackson	
  ImmunoResearch)	
  and	
  donkey	
  anti-­‐goat	
  Rhodamine	
   (1:100)	
  (Jackson	
  ImmunoResearch).	
  Actin	
  staining	
  was	
  performed	
  to	
  visualize	
   muscle	
  tissue	
  using	
  phalloidin	
  conjugated	
  to	
  one	
  of	
  the	
  following	
  fluorophores:	
   Alexa350,	
  568	
  or	
  635	
  (1:500)	
  (Invitrogen,	
  Molecular	
  Probes).	
    2.2 Fly	
  Stocks	
   	
   The	
  following	
  fly	
  stocks	
  were	
  used:	
  ap-­‐GAL4,	
  Dilp7-­‐GAL4,	
  and	
  EH-­‐GAL4	
  (D.W.	
   Allan,	
  University	
  of	
  British	
  Columbia);	
  Pdf-­‐GAL4	
  (a	
  gift	
  from	
  Paul	
  Taghert,	
   Washington	
  University,	
  School	
  of	
  Medicine);	
  and	
  from	
  Bloomington	
  Drosophila	
   Stock	
  Center:	
  UAS-­‐CD8::EGFP	
  ;	
  elavC155-­‐GAL4	
  (D.	
  M.	
  Lin	
  and	
  Goodman	
  1994);	
   P{EPGY}CalpBEY08042	
  (BL17422);	
  UAS-­‐Cortactin.HA3	
  (BL9368);	
  Df(3L)BSC394	
   (BL24418).	
  Lethal	
  alleles	
  were	
  maintained	
  over	
  CyO,	
  Act-­‐EGFP	
  or	
  TM3,	
  Ser,	
  Act-­‐ EGFP.	
  	
  The	
  genotype	
  used	
  as	
  control/wild	
  type	
  in	
  all	
  experiments	
  was	
  w1118	
  crossed	
   to	
  the	
  driver	
  line	
  combined	
  with	
  UASCD8::GFP.	
  Fly	
  stocks	
  were	
  maintained	
  at	
  25oC	
   on	
  yeast-­‐supplemented	
  potato	
  media	
  and	
  embryos	
  were	
  collected	
  on	
  apple	
  juice-­‐ based	
  agar	
  plates	
  containing	
  0.12%	
  methylparaben	
  (BioShop).	
   	
   The	
  transformant	
  fly	
  line	
  UASCalpainB	
  was	
  generated	
  by	
  P-­‐element	
  insertion	
   of	
  a	
  myc-­‐tagged	
  CalpB	
  cDNA	
  sequence	
  in	
  the	
  pUASt	
  vector	
  by	
  Genetic	
  Services	
  Inc.	
   Three	
  myc	
  tags	
  (each	
  with	
  the	
  amino	
  acid	
  sequence:	
  N-­‐EQKLISEEDL-­‐C)	
  were	
  added	
   to	
  the	
  5’	
  end	
  of	
  the	
  CalpB	
  cDNA	
  construct	
  (LD23014,	
  Drosophila	
  Genomics	
  Resource	
   Center)	
  directly	
  following	
  the	
  translation	
  start	
  site	
  ATG	
  (indicated	
  in	
  bold)	
  via	
  PCR	
   using	
  the	
  following	
  primers:	
  5’-­‐	
   	
    29	
    CGCGGCGGCCGCAAACCAGTAAAAATGGAACAAAAACTCATCTCAGAAGAGGATCTGGA ACAAAAACTCATCTCAGAAGAGGATCTGGAACAAAAACTCATCTCAGAAGAGGATCTGC CGCGGATGTACGGCATTGATAATTACCCC-­‐	
  3’	
  (forward)	
  and	
  5’	
   GCGAACAATTTACTCTTAAATTTCTAGACGCG	
  3’	
  (reverse;	
  italics	
  indicates	
  the	
  stop	
   codon)	
  (Integrated	
  DNA	
  Technologies).	
  The	
  underlined	
  regions	
  indicate	
  the	
  added	
   restriction	
  sites,	
  NotI	
  and	
  SacII	
  (forward),	
  and	
  XbaI	
  (reverse),	
  respectively.	
  In-­‐ Fusion	
  recombinant	
  cloning	
  (Clonetech)	
  was	
  then	
  utilized	
  to	
  insert	
  the	
  tagged	
   construct	
  into	
  a	
  pUASt	
  vector	
  (a	
  gift	
  from	
  V.	
  Auld,	
  University	
  of	
  British	
  Columbia)	
   using	
  the	
  primers:	
  5’-­‐ACAGATCTTGCGGCCGCGCCGCAAACCAGTAAAAATG-­‐3’	
  and	
  5’-­‐ ACAAAGATCCTCTAGAGTCTAGAAATTTAAGAGTAAATTGTTCG	
  -­‐3’.	
  The	
  final	
  product	
   was	
  sequenced	
  (Genewiz,	
  Inc.)	
  and	
  sent	
  to	
  Genetic	
  Services	
  for	
  injection.	
  The	
   transformant	
  lines	
  were	
  screened	
  for	
  the	
  presence	
  of	
  the	
  insertion	
  and	
  the	
  location	
   of	
  insertion	
  was	
  then	
  mapped.	
  Effective	
  expression	
  of	
  the	
  construct	
  was	
   demonstrated	
  via	
  detection	
  with	
  an	
  anti-­‐myc	
  antibody	
  (Figure	
  3-­‐2Bii)	
    2.3 Calpain	
  Inhibition	
  with	
  ALLN/ALLM	
   	
   The	
  calpain	
  inhibitors	
  ALLN	
  (N-­‐Acetyl-­‐Leu-­‐Leu-­‐norleucine)	
  (Millipore,	
   CalBiochem)	
  and	
  ALLM	
  (N-­‐Acetyl-­‐Leu-­‐Leu-­‐Met)	
  (Santa	
  Cruz	
  Biotechnology)	
  were	
   used	
  in	
  the	
  various	
  assays	
  involving	
  acute	
  calpain	
  inhibition.	
  Concentrations	
  used	
   were	
  based	
  on	
  previously	
  published	
  results	
  (Mingorance-­‐Le	
  Meur	
  and	
  O'Connor	
   2009).	
  Tissue	
  was	
  bathed	
  in	
  either	
  Schneider’s	
  media	
  (Sigma),	
  for	
  short	
  term	
   experiments,	
  or	
  HL6	
  (hemolymph-­‐like	
  saline)	
  solution	
  (from	
  M.	
  Klose,	
  University	
  of	
   British	
  Columbia)	
  (Stewart	
  et	
  al.	
  1994)	
  for	
  time	
  specified	
  with	
  media	
  changes	
  every	
   15-­‐20	
  minutes.	
  The	
  media	
  contained	
  either	
  the	
  specified	
  concentration	
  of	
   	
    30	
    ALLN/ALLM	
  or	
  an	
  equivalent	
  volume	
  of	
  DMSO	
  vehicle	
  control.	
  All	
  acute	
  inhibition	
   assays	
  were	
  performed	
  at	
  room	
  temperature.	
  After	
  the	
  allotted	
  time,	
  tissue	
  was	
   fixed	
  and	
  stained	
  according	
  to	
  the	
  immunohistochemical	
  protocol	
  as	
  described	
   above.	
    2.4 tBoc	
  Assay	
   	
   Tissue	
  was	
  bathed	
  in	
  tBoc	
  (7-­‐amino-­‐4-­‐chloromethylcoumarin,t-­‐BOC-­‐L-­‐ leucyl-­‐L-­‐methionine	
  amide)	
  (Invitrogen,	
  Molecular	
  Probes),	
  a	
  fluorogenic	
  substrate	
   of	
  calpain	
  that	
  fluoresces	
  upon	
  cleavage	
  (Sasaki	
  et	
  al.	
  1984),	
  in	
  the	
  presence	
  or	
   absence	
  of	
  calpain	
  inhibitor	
  (25μM	
  ALLM)	
  for	
  15	
  minutes	
  before	
  imaging.	
    2.5 Western	
  Blotting	
   	
   Protein	
  samples	
  were	
  isolated	
  from	
  the	
  central	
  nervous	
  systems	
  of	
   wandering	
  third	
  instar	
  larvae	
  via	
  larval	
  pulls	
  in	
  cold	
  PBS	
  (if	
  immediately	
  extracted)	
   or	
  in	
  cold	
  HL6	
  media	
  (if	
  treated	
  with	
  ALLN,	
  see	
  above)	
  and	
  prepared	
  in	
  RIPA	
  buffer	
   containing	
  protease	
  inhibitors	
  (Mini-­‐Complete	
  Protease	
  Inhibitor	
  Cocktail,	
  Roche).	
   Protein	
  was	
  extracted	
  using	
  physical	
  disruption	
  of	
  the	
  cells	
  (by	
  mashing	
  with	
  a	
   dounce)	
  and	
  then	
  sonicated	
  to	
  shear	
  genomic	
  DNA,	
  which	
  was	
  then	
  removed	
  via	
   centrifugation.	
  Samples	
  were	
  stored	
  at	
  -­‐20oC	
  until	
  needed.	
  A	
  Pierce	
  BCA	
  protein	
   assay	
  (Thermo	
  Scientific)	
  was	
  performed	
  in	
  order	
  to	
  quantify	
  the	
  protein	
   concentration	
  of	
  each	
  sample	
  and	
  equal	
  amounts	
  of	
  each	
  were	
  diluted	
  in	
  2x	
  loading	
   buffer	
  and	
  loaded	
  onto	
  an	
  8%	
  acrylamide	
  gel,	
  which	
  was	
  run	
  at	
  100V	
  until	
   completion.	
  The	
  protein	
  was	
  then	
  transferred	
  to	
  a	
  nitrocellulose	
  membrane	
  at	
  100V	
   for	
  1	
  hour.	
  All	
  staining	
  was	
  performed	
  in	
  blocking	
  solution	
  composed	
  of	
  5%	
  blotting	
   	
    31	
    grade	
  milk	
  (BioRad)	
  in	
  PBST	
  (0.1%	
  Tween20	
  (Fisher	
  Scientific)	
  in	
  PBS).	
  Membranes	
   were	
  washed	
  three	
  times	
  for	
  5	
  minutes	
  each	
  in	
  PBST	
  between	
  each	
  staining	
  step.	
   The	
  membranes	
  were	
  stripped	
  with	
  Restore	
  Western	
  Blot	
  Stripping	
  Buffer	
  (Thermo	
   Scientific)	
  between	
  each	
  different	
  antibody	
  probing.	
  Primary	
  antibodies	
  used	
  were:	
   mouse	
  anti-­‐cortactin	
  (1:2500)	
  (Upstate	
  Cell	
  Signaling	
  Solutions),	
  rabbit	
  anti-­‐HA	
   (1:2500)	
  (Cell	
  Signaling	
  Technology),	
  mouse	
  anti-­‐myc	
  (1:1)	
  (W.	
  Wang),	
  mouse	
  anti	
   β-­‐tubulin	
  (E7-­‐S)	
  (1:50)	
  (Developmental	
  Studies	
  Hybridoma	
  Bank,	
  developed	
  by	
  M.	
   Klymkowsky),	
  and	
  mouse	
  anti-­‐spectrin	
  (3A9)	
  (1:50)	
  (Developmental	
  Studies	
   Hybridoma	
  Bank,	
  developed	
  by	
  D.	
  Branton	
  and	
  R.	
  Dubreuil).	
  Secondary	
  antibodies	
   used	
  were	
  horseradish	
  peroxidase-­‐conjugated	
  goat	
  anti-­‐mouse	
  and	
  goat	
  anti-­‐rabbit,	
   which	
  were	
  both	
  used	
  at	
  a	
  concentration	
  of	
  1:10	
  000	
  (Jackson	
  ImmunoResearch).	
    2.6 Image	
  Acquisition	
  and	
  Analysis	
   	
   Images	
  were	
  acquired	
  using	
  a	
  Leica	
  DM6000	
  CS	
  confocal	
  microscope	
  (M.	
   Gordon)	
  or	
  a	
  Zeiss	
  Axioscope	
  (C.	
  Naus).	
  Control	
  images	
  were	
  acquired	
  using	
   identical	
  settings	
  as	
  those	
  used	
  in	
  acquiring	
  images	
  displaying	
  overexpression.	
   Images	
  were	
  analyzed	
  with	
  ImageJ	
  (National	
  Institutes	
  of	
  Health).	
    2.7 Statistical	
  Analysis	
   An	
  unpaired	
  two-­‐tailed	
  student	
  T-­‐test	
  was	
  performed	
  in	
  order	
  to	
  compare	
  the	
   differences	
  among	
  experimental	
  and	
  control	
  groups	
  in	
  quantification	
  of	
  the	
   phenotypes	
  observed	
  in	
  apterous	
  neurons.	
  	
    	
    32	
    Chapter	
  3: Results	
   3.1 Calpain	
  and	
  Cortactin	
  are	
  present	
  and	
  interacting	
  in	
  the	
  developing	
   Drosophila	
  nervous	
  system	
   To	
  determine	
  the	
  presence	
  and	
  activity	
  of	
  calpain	
  in	
  the	
  nervous	
  system,	
  an	
   assay	
  was	
  performed	
  using	
  the	
  calpain	
  substrate	
  tBOC	
  (tBoc-­‐Leu-­‐Met-­‐CMAC),	
  which	
   fluoresces	
  upon	
  cleavage	
  (Sasaki	
  et	
  al.	
  1984).	
  Wild	
  type	
  stage	
  15	
  embryos	
  were	
   filleted	
  in	
  Schneider’s	
  media	
  (Figure	
  3-­‐1A)	
  and	
  bathed	
  in	
  25μM	
  of	
  the	
  calpain	
   inhibitor	
  ALLM	
  for	
  35	
  minutes.	
  The	
  substrate	
  tBOC	
  was	
  then	
  applied	
  for	
  15	
  minutes	
   after	
  which	
  the	
  nervous	
  system	
  was	
  imaged	
  (Figure	
  3-­‐1B).	
  A	
  low	
  level	
  of	
   fluorescence	
  was	
  detected	
  in	
  the	
  presence	
  of	
  ALLM.	
  The	
  same	
  tissue	
  was	
  then	
   washed	
  to	
  remove	
  the	
  inhibitor,	
  bathed	
  again	
  in	
  tBOC,	
  and	
  reimaged	
  (Figure	
  3-­‐1C).	
   After	
  washing	
  out	
  the	
  calpain	
  inhibitor,	
  an	
  increased	
  level	
  of	
  fluorescence	
  was	
   detected	
  indicating	
  the	
  presence	
  of	
  calpain	
  activity	
  and	
  the	
  successful	
  reversal	
  of	
   calpain	
  inhibition	
  with	
  washout.	
  	
   In	
  vertebrates	
  it	
  has	
  previously	
  been	
  demonstrated	
  that	
  calpain	
  can	
   proteolytically	
  regulate	
  the	
  levels	
  of	
  cortactin;	
  however,	
  a	
  similar	
  interaction	
  has	
  not	
   been	
  examined	
  in	
  Drosophila.	
  In	
  order	
  to	
  test	
  this,	
  the	
  central	
  nervous	
  system	
  was	
   isolated	
  from	
  wandering	
  third	
  instar	
  larvae	
  and	
  incubated	
  in	
  HL6	
  media	
  containing	
   either	
  calpain	
  inhibitor	
  ALLN	
  or	
  DMSO	
  vehicle	
  control	
  for	
  2	
  hours.	
  These	
  samples	
   were	
  then	
  run	
  for	
  western	
  blotting	
  and	
  probed	
  with	
  three	
  different	
  antibodies	
   (Figure	
  3-­‐2A).	
  The	
  presence	
  of	
  cortactin	
  was	
  detected	
  with	
  an	
  anti-­‐cortactin	
  	
    	
    33	
    !  "  '  #!$$%&  ()*&  	
    Figure	
  3–1.	
  Calpain	
  activity	
  in	
  the	
  nervous	
  system.	
  	
   tBoc	
  assay:	
  tissue	
  is	
  bathed	
  in	
  a	
  substrate	
  of	
  calpain	
  (tBoc-­‐Leu-­‐Met-­‐CMAC)	
  that	
   fluoresces	
  upon	
  cleavage.	
  (A)	
  DIC	
  image	
  of	
  a	
  stage	
  15	
  wild	
  type	
  embryonic	
  ventral	
   nerve	
  cord	
  (VNC).	
  (B)	
  Image	
  of	
  the	
  same	
  nerve	
  cord	
  as	
  (A)	
  in	
  the	
  presence	
  of	
  calpain	
   inhibitor	
  ALLM	
  (25μM).	
  (C)	
  After	
  washing	
  out	
  the	
  ALLM,	
  tBoc	
  fluorescence	
  becomes	
   visible	
  indicating	
  calpain	
  activity	
  is	
  present	
  and	
  reversibly	
  inhibited	
  by	
  ALLM.	
  	
    	
    34	
    9:"  33" ;:8" 7:8" 788" 9:"  333"  :8"  3" 788"  '"()*+,(-."  9:" 7:8" 33" 788"  '"456(+*3."  333" '"/%+01023." 3@"  ;:8" 7:8" 788" 9:" :8"  -'&.$/$$ 012%&'()$  %&'()+,<&"  %&'()*$  ?"  %""""&"  3" 788"  !"""#$  !##$"  !"  '"()*+,(-." '"=>(" '"456(+*3." '"/%+01023."  	
    	
   Figure	
  3–2.	
  Calpain	
  activity	
  affects	
  cortactin	
  levels	
  in	
  the	
  developing	
  nervous	
   system.	
  	
   (A)	
  Protein	
  was	
  isolated	
  from	
  w1118	
  third	
  instar	
  larvae	
  VNCs	
  treated	
  with	
  DMSO	
   control	
  (-­‐)	
  or	
  20	
  μM	
  ALLN	
  (+)	
  in	
  HL6	
  media	
  for	
  2	
  hours.	
  Membranes	
  were	
  stained	
   with	
  an	
  anti-­‐cortactin	
  (i)	
  and	
  anti-­‐spectrin	
  (ii)	
  antibodies	
  to	
  determine	
  the	
  effects	
  of	
   the	
  pharmacological	
  inhibition	
  of	
  calpain	
  on	
  their	
  expression	
  levels.	
  (B)	
  Protein	
  was	
   isolated	
  from	
  VNCs	
  of	
  third	
  instar	
  larvae	
  with	
  the	
  indicated	
  genotype	
  to	
  determine	
   the	
  effects	
  of	
  decreased	
  levels	
  (homozygous	
  CalpBP,	
  CalpBDf/+)	
  and	
  increased	
  levels	
   (Elavc155x	
  x	
  UASCalpB)	
  of	
  calpain	
  on	
  cortactin	
  (i)	
  and	
  spectrin	
  (ii).	
  β-­‐tubulin	
  was	
   used	
  as	
  a	
  loading	
  control	
  ((A)iii	
  and	
  (B)iv).	
  	
    	
    35	
    antibody	
  and	
  a	
  significant	
  increase	
  in	
  the	
  level	
  of	
  cortactin	
  was	
  observed	
  with	
  the	
   pharmacological	
  inhibition	
  of	
  calpain	
  (Figure	
  3-­‐2Ai)	
  indicating	
  that	
  calpain	
   negatively	
  regulates	
  cortactin	
  levels.	
  It	
  is	
  important	
  to	
  note	
  that	
  although	
  the	
   predicted	
  molecular	
  weight	
  of	
  cortactin	
  is	
  61kDa,	
  in	
  SDS-­‐PAGE	
  analysis,	
  it	
  runs	
   much	
  higher	
  at	
  approximately	
  100	
  kDa	
  (Katsube	
  et	
  al.	
  1998).	
  A	
  similar	
  phenomenon	
   has	
  also	
  been	
  observed	
  with	
  the	
  murine	
  form	
  of	
  cortactin	
  where	
  the	
  65kDa	
  protein	
   runs	
  as	
  a	
  80/85kDa	
  doublet,	
  though	
  why	
  this	
  occurs	
  is	
  still	
  unclear	
  since	
  it	
  appears	
   not	
  to	
  be	
  due	
  to	
  post-­‐translational	
  modifications	
  (Wu	
  and	
  Parsons	
  1993).	
   The	
  presence	
  of	
  spectrin,	
  a	
  well-­‐known	
  substrate	
  for	
  calpain	
  (Roberts-­‐Lewis	
  et	
   al.	
  1994),	
  was	
  also	
  detected	
  and	
  the	
  same	
  trend	
  was	
  observed	
  as	
  that	
  of	
  cortactin	
  –	
   the	
  level	
  of	
  full	
  length	
  spectrin	
  increased	
  with	
  the	
  inhibition	
  of	
  calpain	
  (top	
  band,	
   Figure	
  3-­‐2Aii);	
  thus,	
  further	
  suggesting	
  that	
  the	
  inhibitor	
  ALLN	
  could	
  significantly	
   inhibit	
  calpain	
  activity.	
  In	
  addition,	
  with	
  the	
  inhibition	
  of	
  calpain,	
  there	
  is	
  a	
  decrease	
   in	
  the	
  presence	
  of	
  the	
  two	
  lower	
  bands,	
  likely	
  representing	
  cleavage	
  products,	
  and	
   therefore	
  a	
  reduction	
  of	
  cleavage	
  of	
  spectrin	
  by	
  calpain.	
  β-­‐tubulin	
  was	
  used	
  as	
  a	
   loading	
  control	
  (Figure	
  3-­‐2Aiii).	
  	
   In	
  a	
  separate	
  experiment,	
  protein	
  was	
  extracted	
  directly	
  from	
  the	
  central	
   nervous	
  systems	
  of	
  third	
  instar	
  larvae	
  with	
  different	
  genotypes.	
  A	
  decrease	
  in	
   cortactin	
  levels	
  was	
  detected	
  when	
  CalpB	
  was	
  overexpressed	
  pan-­‐neuronally	
  using	
   the	
  driver	
  Elavc155x-­‐GAL4	
  (Figure	
  3-­‐2B).	
  In	
  addition,	
  the	
  myc	
  tagged	
  overexpressed	
   calpain	
  was	
  specifically	
  detectable	
  with	
  an	
  anti-­‐myc	
  antibody	
  (Figure	
  3-­‐2Bii).	
  No	
   change	
  in	
  cortactin	
  level	
  was	
  observed	
  in	
  the	
  heterozygous	
  calpain	
  B	
  deficiency	
   background	
  (CalpBDf)	
  (Figure	
  3-­‐2Bi)	
  likely	
  due	
  to	
  an	
  insufficient	
  decrease	
  in	
   	
    36	
    endogenous	
  calpain	
  level.	
  Surprisingly,	
  in	
  the	
  case	
  of	
  the	
  homozygous	
  mutant	
   (CalpBP),	
  a	
  decrease	
  in	
  cortactin	
  is	
  also	
  observed	
  despite	
  the	
  fact	
  that	
  this	
  allele	
  has	
   previously	
  been	
  demonstrated	
  to	
  be	
  effective	
  in	
  reducing	
  the	
  expression	
  of	
  calpain	
  B	
   to	
  approximately	
  70%	
  that	
  of	
  wild	
  type	
  levels	
  (Reinecke	
  et	
  al.	
  2011).	
   These	
  samples	
  were	
  also	
  probed	
  for	
  spectrin.	
  An	
  increase	
  in	
  the	
  level	
  of	
   cleavage	
  products	
  was	
  observed	
  in	
  the	
  CalpBP	
  mutant,	
  which	
  corresponds	
  with	
  the	
   observed	
  decrease	
  in	
  cortactin.	
  A	
  decrease	
  in	
  the	
  level	
  of	
  full	
  length	
  spectrin	
  and	
  the	
   appearance	
  of	
  an	
  additional	
  band	
  occurred	
  with	
  the	
  overexpression	
  of	
  CalpB	
   indicating	
  increased	
  cleavage	
  (Figure	
  3-­‐2Biii).	
  	
   Both	
  immunohistochemistry	
  and	
  western	
  blot	
  analysis	
  were	
  utilized	
  in	
  order	
   to	
  demonstrate	
  the	
  effective	
  overexpression	
  of	
  cortactin	
  using	
  the	
  Gal4/UAS	
  system.	
   Cortactin	
  was	
  overexpressed	
  in	
  pigment-­‐dispersing	
  factor	
  (Pdf)	
  expressing	
  neurons	
   with	
  the	
  use	
  of	
  the	
  Pdf-­‐GAL4	
  driver.	
  These	
  neurons	
  exist	
  in	
  a	
  cluster	
  of	
  four	
  cells	
  in	
   each	
  brain	
  lobe	
  and	
  contribute	
  to	
  the	
  establishment	
  of	
  circadian	
  rhythm	
  in	
  the	
  fly	
  (Y.	
   Lin,	
  Stormo,	
  and	
  Taghert	
  2004).	
  Cortactin	
  overexpression	
  was	
  detectable	
  with	
  an	
   anti-­‐HA	
  antibody	
  in	
  the	
  cell	
  bodies	
  and	
  the	
  growth	
  cones	
  of	
  these	
  neurons	
  (Figure	
  3-­‐ 3).	
  It	
  is	
  important	
  to	
  note	
  that	
  cortactin	
  levels	
  were	
  low	
  in	
  the	
  consolidated	
  regions	
   of	
  these	
  neurons	
  indicating	
  endogenous	
  calpain	
  levels	
  were	
  likely	
  sufficient	
  to	
  keep	
   even	
  overexpressed	
  levels	
  of	
  cortactin	
  at	
  bay.	
  	
   Cortactin	
  levels	
  in	
  protein	
  extracts	
  from	
  the	
  central	
  nervous	
  systems	
  of	
   wandering	
  third	
  instar	
  larvae	
  were	
  compared	
  between	
  those	
  with	
  cortactin	
   overexpression	
  driven	
  pan-­‐neuronally	
  (Elavc155x-­‐GAL4/+;	
  UASCortactin.HA3/+)	
  and	
   control	
  animals	
  (wild	
  type,	
  w1118,	
  and	
  genetic	
  construct	
  controls,	
  Elavc155x-­‐GAL4	
  and	
  	
   	
    37	
    	
    	
    	
    38	
    Figure	
  3–3.	
  Cortactin	
  overexpression.	
  	
   Pdf-­‐GAL4;UASCD8::GFP/UASCortactin.HA3	
  wandering	
  third	
  instar	
  larval	
  brains	
   stained	
  with	
  anti-­‐GFP	
  (A),	
  anti-­‐HA	
  (B),	
  and	
  merged	
  image	
  (C)	
  (arrows	
  indicate	
   examples	
  of	
  growth	
  cones;	
  scale	
  bar	
  10	
  μm).	
  (D)	
  Magnification	
  of	
  outlined	
  region	
  in	
   (C)	
  (scale	
  bar	
  5μm).	
  (E)	
  Western	
  blot	
  demonstrating	
  effective	
  overexpression	
  of	
   cortactin	
  with	
  pan-­‐neuronal	
  driver	
  Elavc155x-­‐GAL4.	
  Overexpressed	
  protein	
  can	
  be	
   detected	
  with	
  anti-­‐cortactin	
  (i)	
  and	
  anti-­‐HA	
  (ii)	
  antibodies.	
  β-­‐tubulin	
  was	
  used	
  as	
  a	
   loading	
  control	
  (iii).	
  	
   	
    	
    39	
    UASCortactin.HA3)	
  (Figure	
  3-­‐3E).	
  An	
  increase	
  in	
  cortactin	
  was	
  observed	
  with	
   overexpression	
  and	
  the	
  overexpressed	
  version	
  ran	
  several	
  kDa	
  higher	
  than	
  the	
   endogenous	
  protein	
  due	
  to	
  the	
  presence	
  of	
  the	
  triple	
  HA	
  tag	
  (with	
  a	
  molecular	
   weight	
  of	
  approximately	
  3.3	
  kDa)	
  and	
  was	
  detectable	
  with	
  an	
  anti-­‐HA	
  antibody.	
  In	
   addition,	
  there	
  was	
  a	
  faint	
  band	
  indicating	
  some	
  low	
  expression	
  of	
  HA-­‐tagged	
   cortactin	
  in	
  the	
  UASCortactin.HA3	
  animals	
  in	
  the	
  absence	
  of	
  a	
  driver.	
  	
    3.2 Cortactin	
  overexpression	
  results	
  in	
  axon	
  misguidance	
  and	
   elongation	
   	
   Cortactin	
  overexpression	
  was	
  expected	
  to	
  increase	
  the	
  presence	
  of	
   protrusive	
  activity	
  in	
  developing	
  neurons	
  in	
  vivo,	
  reflecting	
  our	
  previously	
   established	
  in	
  vitro	
  phenotype	
  (Figure	
  1-­‐5B)	
  (Mingorance-­‐Le	
  Meur	
  and	
  O'Connor	
   2009).	
  This	
  increase	
  in	
  protrusive	
  activity	
  was	
  expected	
  to	
  result	
  in	
  increased	
   branch	
  formation	
  and/or	
  elongation	
  of	
  previously	
  established	
  branches.	
   3.2.1 Apterous	
  neurons	
   Cortactin	
  was	
  overexpressed	
  in	
  the	
  developing	
  embryonic	
  apterous	
   interneurons.	
  The	
  ap-­‐GAL4	
  driver	
  initiates	
  expression	
  at	
  embryonic	
  stage	
  14	
  during	
   axon	
  outgrowth	
  (Lundgren	
  et	
  al.	
  1995);	
  therefore,	
  any	
  effects	
  of	
  cortactin	
   overexpression	
  as	
  visualized	
  at	
  stage	
  15/16	
  would	
  occur	
  during	
  the	
  outgrowth	
   process	
  and	
  before	
  the	
  neurons	
  have	
  connected	
  with	
  their	
  targets.	
  	
   Two	
  measures	
  were	
  used	
  to	
  determine	
  the	
  effects	
  of	
  cortactin	
  overexpression	
  on	
   apterous	
  neuron	
  outgrowth:	
  1)	
  the	
  appearance	
  of	
  processes	
  that	
  deviate	
  from	
  the	
   longitudinal	
  tracts	
  (examples	
  of	
  which	
  are	
  indicated	
  by	
  arrowhead	
  in	
  Figure	
  3-­‐4)	
   	
    40	
    and	
  2)	
  projections	
  that	
  cross	
  over	
  the	
  ventral	
  midline	
  between	
  longitudinal	
  tracts	
   (as	
  indicated	
  by	
  arrows	
  in	
  Figure	
  3-­‐4).	
  The	
  overexpression	
  of	
  cortactin	
  resulted	
  in	
  a	
   significant	
  increase	
  in	
  deviation	
  events,	
  with	
  numerous	
  ectopic	
  branches	
  extending	
   away	
  from	
  the	
  longitudinal	
  tract;	
  however,	
  there	
  was	
  not	
  a	
  significant	
  increase	
  in	
   number	
  of	
  crossover	
  events	
  when	
  compared	
  to	
  controls	
  (pictured	
  in	
  Figure	
  3-­‐4,	
   quantification	
  in	
  Figure	
  3-­‐5).	
   3.2.2 EH	
  neurons	
   	
   The	
  effects	
  of	
  cortactin	
  overexpression	
  were	
  also	
  analyzed	
  in	
  the	
  neurons	
   expressing	
  eclosion	
  hormone	
  (with	
  EH-­‐GAL4).	
  These	
  are	
  an	
  ideal	
  model	
  system	
  for	
   these	
  studies	
  as	
  the	
  two	
  EH	
  neurons	
  extend	
  a	
  single	
  unbranched	
  axon	
  into	
  the	
   ventral	
  nerve	
  cord	
  (VNC)	
  (Figure	
  1-­‐8;	
  Figure	
  3-­‐6A).	
  With	
  the	
  overexpression	
  of	
   cortactin,	
  extension	
  of	
  at	
  least	
  one	
  of	
  the	
  axons	
  through	
  the	
  VNC	
  and	
  out	
  into	
  a	
   peripheral	
  nerve	
  was	
  seen	
  in	
  73.3%	
  of	
  the	
  larvae	
  examined,	
  compared	
  to	
  7%	
  in	
  wild	
   type	
  (which	
  represented	
  a	
  single	
  observation)	
  	
  (Figure	
  3-­‐6B,	
  quantification	
  in	
  Table	
   3-­‐1).	
  In	
  order	
  to	
  quantify	
  this,	
  the	
  average	
  length	
  of	
  the	
  increased	
  extension	
  of	
  axons	
   was	
  measured	
  from	
  the	
  point	
  of	
  exit	
  from	
  the	
  VNC	
  and	
  it	
  was	
  found	
  that,	
  with	
   cortactin	
  overexpression,	
  the	
  axons	
  were	
  on	
  average	
  113.1	
  ±	
  27.2	
  μm	
  (compared	
  to	
   3.1	
  μm	
  in	
  the	
  single	
  wild	
  type	
  observation).	
  On	
  occasion,	
  in	
  6.7%	
  of	
  cases,	
  both	
   axons	
  exited	
  the	
  VNC,	
  a	
  phenomenon	
  that	
  never	
  occurred	
  in	
  the	
  wild	
  type.	
  Thus,	
  the	
   overexpression	
  of	
  cortactin	
  resulted	
  in	
  a	
  drastic	
  increase	
  in	
  the	
  elongation	
  of	
  EH	
   neurons	
  and	
  promoted	
  the	
  aberrant	
  exit	
  of	
  these	
  axons	
  from	
  the	
  VNC	
  into	
  the	
   peripheral	
  nervous	
  system.	
  In	
  addition,	
  the	
  overexpressed	
  cortactin	
  appeared	
  to	
  be	
  	
   	
   	
    41	
    +,-./01%  +,-.2*%  3)45)%  "% "%  ""%  """%  :%  "%  ""%  """%  674&89%  !"#$%&'()%  *%  	
  	
   Figure	
  3–4.	
  Cortactin	
  overexpression	
  and	
  calpain	
  inhibition	
  in	
  apterous	
   neurons.	
  	
  	
   Abdominal	
  segments	
  1-­‐5	
  of	
  stage	
  15/16	
  embryonic	
  ventral	
  nerve	
  cords:	
  (A)	
  ap-­‐ GAL4,	
  UASCD8::GFP/+	
  (Wild	
  Type);	
  and	
  (B)	
  ap-­‐GAL4,	
   UASCD8::GFP/UASCortactin.HA3	
  (CortOE).	
  Embryos	
  were	
  stained	
  with	
  anti-­‐GFP	
  (i),	
   anti-­‐HA	
  (ii),	
  with	
  the	
  merged	
  image	
  in	
  (iii)	
  (arrow	
  indicates	
  example	
  of	
  crossover	
   event;	
  arrowhead	
  indicates	
  example	
  of	
  deviation	
  from	
  longitudinal	
  tract;	
  scale	
  bar	
   10	
  μm).	
   	
    	
    42	
    	
    +, 23 3  01 4"  +,  -./  23 3  01  23 3  4"  4"  0"  &#$"  -./  (#$" (" '#$" '" &#$" &" %#$" %" !#$" !"  ) *1  -./  '"  4"  0"  +,  ) *"  '#$"  23 3  -./  ) *"  !"#$%&'#$()"*%;'1**-$/%4)"% !-67-$"%9"'%:"/2"$4%  2"  ) *1  +,  6" !"#$%&'#$()"*%+",-#.$/%0'12% 31$/-456-$#7%8'#(4*%9"'%:"/2"$4%  	
    55" 55" 5"  &"  %#$"  %"  !#$"  !"  5 5  5"  	
    43	
    Figure	
  3–5.	
  Quantification	
  of	
  effects	
  of	
  cortactin	
  overexpression	
  and	
  calpain	
   inhibition	
  in	
  apterous	
  neurons.	
  	
   Quantification	
  of	
  (A)	
  crossover	
  events	
  and	
  (B)	
  deviations	
  from	
  the	
  longitudinal	
   tracts.	
  Asterisks	
  over	
  individual	
  bars	
  represent	
  statistical	
  difference	
  when	
   compared	
  to	
  wild	
  type	
  control;	
  asterisks	
  over	
  lines	
  indicate	
  statistical	
  difference	
   between	
  the	
  two	
  bars	
  connected	
  by	
  the	
  line	
  (error	
  bars	
  represent	
  SEM;	
  *	
  indicates	
   p<0.05;	
  **	
  indicates	
  p<0.005).	
    	
    44	
    !"#$%&'(  +,-.,(  !"  !!"  !!!"  !"  !!"  !!!"  !"  !!"  !!!"  /012(345,(  #"  !"#$)*(  6*789-:(  $"  6*789-:;(8!15<'(  %"  	
    	
    45	
    Figure	
  3–6.	
  Cortactin	
  overexpression	
  and	
  calpain	
  inhibition	
  in	
  EH	
  neurons.	
   Wandering	
  L3	
  VNCs	
  of	
  (A)	
  EH-­‐GAL4,	
  UASCD8::GFP/+;	
  (B)	
  EH-­‐GAL4,	
   UASCD8::GFP/UASCortactin.HA3;	
  (C)	
  EH-­‐GAL4,	
  UASCD8::GFP/UASCortactin.HA3;	
   CalpBP/+	
  stained	
  with	
  anti-­‐GFP	
  (i),	
  anti-­‐HA	
  (ii)	
  ((iii)merged	
  image;	
  outline	
  of	
  central	
   nervous	
  system	
  is	
  indicated	
  by	
  grey	
  lines;	
  scale	
  bar	
  =	
  25	
  μm	
  (A,	
  B)	
  and	
  50μm	
  (C);	
   arrow	
  indicates	
  localization	
  of	
  cortactin	
  to	
  elongated	
  region	
  of	
  the	
  axon;	
  arrowhead	
   indicates	
  exit	
  point	
  from	
  VNC).	
   	
   	
    	
    46	
    Table	
  3-­‐1.	
  Quantification	
  of	
  cortactin	
  overexpression	
  and	
  calpain	
  inhibition	
  in	
   EH	
  neurons.	
  	
    Genotype	
    %	
  with	
  an	
  axon	
   that	
  exit	
  CNS	
  (n)	
    %	
  with	
  2	
  axons	
   that	
  exit	
  the	
  CNS	
    Avg	
  length	
  of	
  axon	
   beyond	
  VNC	
  ±	
  SEM	
   (μm)	
    Wild	
  Type	
    7%	
  	
  (1/15)	
    0%	
    3.1	
  ±	
  0	
    CortOE	
    73.3%	
  	
  (11/15)	
    6.7%	
    113.1	
  ±	
  27.2	
    CalpBP/+	
    50%	
  	
  (9/18)	
    11%	
    207.6	
  ±	
  56.0	
    CalpBDf/+	
    36.4%	
  	
  (4/11)	
    0%	
    498.0	
  ±	
  250.3	
    CalpBP/CalpBDf	
    30%	
  	
  (3/10)	
    10%	
    101.6	
  ±	
  57.8	
    CortOE;	
  CalpBP/+	
    55.2%	
  	
  (16/29)	
    10%	
    212.4	
  ±	
  44.1	
    CortOE;	
  CalpBDf/+	
    7.1%	
  	
  (1/14)	
    0%	
    36.7	
  ±	
  0	
    CortOE;	
   CalpBP/CalpBDf	
    60%	
  	
  (6/10)	
    0%	
    86.2	
  ±	
  62.3	
    	
  	
    	
    47	
    localized	
  to	
  the	
  extended,	
  and	
  therefore	
  presumably	
  more	
  dynamic,	
  regions	
  of	
  the	
   axon	
  (arrow,	
  Figure	
  3-­‐6).	
  	
    3.3 Calpain	
  inhibition	
   I	
  hypothesize	
  that	
  calpain	
  normally	
  suppresses	
  axon	
  outgrowth	
  and	
  branching	
   by	
  regulating	
  the	
  endogenous	
  levels	
  of	
  cortactin	
  and	
  that	
  inhibiting	
  calpain	
  activity	
   may	
  result	
  in	
  similar	
  phenotypes	
  as	
  those	
  observed	
  with	
  cortactin	
  overexpression.	
   Thus	
  to	
  test	
  this,	
  calpain	
  inhibition	
  was	
  achieved	
  through	
  various	
  means.	
  Firstly,	
   developing	
  embryos	
  were	
  bathed	
  in	
  the	
  pharmacological	
  inhibitors	
  ALLN	
  and	
  ALLM	
   as	
  I	
  have	
  shown	
  that	
  they	
  are	
  effective	
  inhibitors	
  of	
  calpain	
  activity	
  in	
  Drosophila	
   (Figure	
  3-­‐1).	
  	
  In	
  addition,	
  genetic	
  inhibition	
  of	
  CalpB	
  in	
  particular	
  was	
  obtained	
   through	
  the	
  use	
  of	
  a	
  hypomorphic	
  allele,	
  referred	
  to	
  as	
  CalpBP,	
  which	
  contains	
  a	
  P-­‐ element	
  insertion	
  in	
  the	
  untranslated	
  region	
  of	
  the	
  CalpB	
  gene	
  which	
  is	
  expected	
  to	
   disrupt	
  transcription	
  and/or	
  translation	
  of	
  CalpB	
  (Bellen	
  et	
  al.	
  2004),	
  and	
  the	
   deficiency	
  line	
  Df(3L)BSC394	
  uncovering	
  the	
  CalpB	
  gene	
  (CalpBDf).	
   3.3.1 Apterous	
  neurons	
   	
   The	
  same	
  measures	
  were	
  used	
  as	
  with	
  cortactin	
  overexpression,	
  deviations	
   from	
  the	
  longitudinal	
  tracts	
  and	
  cross	
  over	
  events,	
  to	
  determine	
  the	
  effects	
  of	
  the	
   pharmacological	
  inhibition	
  of	
  calpain	
  on	
  these	
  neurons.	
  In	
  these	
  experiments,	
   embryos	
  were	
  filleted	
  at	
  stage	
  15	
  or	
  16	
  and	
  bathed	
  in	
  HL6	
  media	
  containing	
  either	
   100	
  μM	
  ALLN	
  or	
  DMSO	
  vehicle	
  control	
  for	
  2	
  hours.	
  Calpain	
  inhibition	
  resulted	
  in	
  a	
   significant	
  increase	
  in	
  cross	
  over	
  events	
  but	
  not	
  deviations	
  from	
  the	
  longitudinal	
   tracts	
  (quantification	
  in	
  Figure	
  3-­‐5).	
   	
    48	
    3.3.2 EH	
  neurons	
   	
   To	
  examine	
  EH	
  neuron	
  outgrowth	
  after	
  in	
  the	
  presence	
  of	
  reduced	
  calpain	
   activity,	
  projections	
  in	
  larvae	
  possessing	
  the	
  CalpBP	
  allele	
  were	
  examined.	
  The	
   heterozygous	
  presence	
  of	
  this	
  allele	
  resulted	
  in	
  a	
  similar	
  phenotype	
  as	
  observed	
   with	
  cortactin	
  overexpression;	
  that	
  is	
  the	
  extension	
  of	
  the	
  axon	
  throughout	
  the	
  VNC	
   and	
  into	
  a	
  peripheral	
  nerve.	
  Althought	
  the	
  penetrance	
  was	
  slightly	
  reduced	
  (50%	
  of	
   the	
  CalpBP	
  larvae	
  exhibited	
  an	
  exit	
  phenotype	
  compared	
  to	
  73.3%	
  seen	
  with	
   cortactin	
  overexpression),	
  the	
  average	
  length	
  of	
  these	
  extensions	
  (as	
  measured	
  from	
   the	
  exit	
  point)	
  was	
  207.6	
  ±	
  56.0	
  μm,	
  which	
  is	
  almost	
  double	
  that	
  observed	
  with	
   cortactin	
  overexpression	
  (Table	
  3-­‐1).	
  In	
  addition,	
  both	
  axons	
  exited	
  the	
  VNC	
  in	
  11%	
   of	
  cases,	
  almost	
  double	
  that	
  observed	
  with	
  cortactin	
  overexpression	
  (6.7%).	
  	
   A	
  deficiency	
  uncovering	
  the	
  CalpB	
  gene	
  (CalpBDf)	
  was	
  also	
  used	
  with	
  the	
   expectation	
  that	
  calpain	
  B	
  expression	
  would	
  be	
  lower	
  in	
  the	
  heterozygous	
  deficiency	
   background	
  than	
  with	
  the	
  hypomorphic	
  allele	
  (CalpBP).	
  Therefore,	
  comparison	
  was	
   made	
  among	
  the	
  following	
  genotypes	
  with	
  the	
  expectation	
  of	
  a	
  positive	
  correlation	
   of	
  enhancement	
  of	
  phenotype	
  and	
  the	
  reduction	
  of	
  calpain	
  expression	
  associated	
   with	
  each	
  respectively:	
  CalpBP/+	
  >	
  CalpBDf/+	
  >	
  CalpBP/CalpBDf	
  (Table	
  3-­‐1).	
  Indeed,	
   an	
  increase	
  in	
  axon	
  length	
  was	
  observed	
  between	
  CalpBP	
  (207.6	
  ±	
  56.0	
  μm)	
  and	
   CalpBDf	
  (498	
  ±	
  250.3	
  μm).	
  Surprisingly,	
  the	
  combined	
  mutant	
  CalpBP/CalpBDf	
   showed	
  a	
  decrease	
  in	
  exuberant	
  growth	
  when	
  compared	
  to	
  the	
  single	
  mutants.	
   Nonetheless	
  the	
  additional	
  outgrowth	
  was	
  greater	
  than	
  wild	
  type	
  resulting	
  in	
   extended	
  outgrowth	
  that	
  was	
  more	
  similar	
  to	
  the	
  cortactin	
  overexpression	
  larvae	
   (101.6	
  ±	
  57.8	
  μm	
  compared	
  to	
  113.1	
  ±	
  27.2	
  μm).	
  A	
  decrease	
  in	
  frequency	
  of	
   	
    49	
    phenotype	
  was	
  also	
  observed	
  with	
  a	
  rate	
  of	
  36.4%	
  and	
  30%	
  for	
  CalpBDf	
  and	
   CalpBP/CalpBDf,	
  respectively.	
    3.4 Combined	
  cortactin	
  overexpression	
  and	
  calpain	
  inhibition	
   3.4.1 Apterous	
  neurons	
   	
   	
   Embryos	
  specifically	
  overexpressing	
  cortactin	
  in	
  the	
  apterous	
  neurons	
  were	
   bathed	
  in	
  ALLN	
  to	
  determine	
  the	
  combined	
  effects	
  of	
  cortactin	
  overexpression	
  with	
   calpain	
  inhibition.	
  A	
  significant	
  increase	
  in	
  deviations	
  from	
  the	
  longitudinal	
  tracts	
   was	
  observed	
  when	
  compared	
  to	
  the	
  wild	
  type	
  as	
  well	
  as	
  to	
  cortactin	
   overexpression.	
  In	
  addition,	
  a	
  significant	
  increase	
  in	
  cross	
  over	
  events	
  was	
  observed	
   compared	
  to	
  wild	
  type	
  and	
  to	
  cortactin	
  overexpression	
  alone.	
  However,	
  in	
  both	
   cases,	
  there	
  was	
  no	
  significant	
  difference	
  between	
  the	
  combined	
  effects	
  and	
  calpain	
   inhibition	
  alone	
  (quantification	
  in	
  Figure	
  3-­‐5).	
   3.4.2 EH	
  neurons	
   	
   The	
  overexpression	
  of	
  cortactin	
  in	
  EH	
  neurons	
  was	
  performed	
  in	
  a	
   heterozygous	
  CalpBP	
  background	
  in	
  order	
  to	
  observe	
  any	
  combined	
  effects	
  (Figure	
   3-­‐6C).	
  As	
  with	
  the	
  phenotypes	
  observed	
  with	
  the	
  individual	
  mutants,	
  an	
  elongation	
   of	
  the	
  EH	
  axons	
  through	
  the	
  VNC	
  into	
  the	
  peripheral	
  nervous	
  system	
  was	
  observed	
   (Table	
  3-­‐1).	
  The	
  average	
  length	
  of	
  the	
  exited	
  axon	
  was	
  212.4	
  ±	
  44.1	
  μm,	
  which	
  was	
   about	
  double	
  that	
  of	
  cortactin	
  overexpression	
  alone	
  and	
  comparable	
  to	
  CalpBP	
   alone.	
  Contrary	
  to	
  these	
  results,	
  when	
  cortactin	
  was	
  overexpressed	
  in	
  the	
  CalpBDf	
   background,	
  in	
  only	
  one	
  case	
  did	
  an	
  axon	
  exit	
  the	
  VNC.	
    	
    50	
    	
   Another	
  interesting	
  occurrence	
  was	
  the	
  exit	
  location	
  observed	
  in	
  the	
  mutant	
   phenotypes.	
  In	
  the	
  majority	
  of	
  cases,	
  axons	
  exiting	
  the	
  nerve	
  cord	
  extended	
  straight	
   along	
  the	
  typical	
  trajectory	
  of	
  EH	
  axons	
  and	
  exited	
  through	
  the	
  most	
  medial	
   peripheral	
  nerve.	
  However,	
  in	
  approximately	
  12%	
  of	
  CortOE;	
  CalpBP	
  animals,	
  the	
   exit	
  point	
  for	
  the	
  axons	
  was	
  not	
  the	
  most	
  medial	
  peripheral	
  nerve,	
  but	
  a	
  more	
  lateral	
   one	
  (Figure	
  3-­‐6C,	
  arrowhead)	
  and	
  29.4%	
  of	
  the	
  time,	
  the	
  axon	
  crossed	
  the	
  midline	
   and	
  exited	
  contralaterally	
  (Figure	
  3-­‐7,	
  quantification	
  in	
  Table	
  3-­‐2).	
  The	
  proportion	
   of	
  cases	
  exiting	
  in	
  this	
  manner	
  did	
  not	
  vary	
  greatly	
  among	
  genotypes.	
  This	
  indicates	
   that	
  the	
  observed	
  effect	
  is	
  not	
  just	
  strictly	
  due	
  to	
  elongation	
  of	
  the	
  axon,	
  but	
  also	
   that	
  pathfinding	
  decisions	
  are	
  being	
  effected	
  and	
  that	
  aberrant	
  projections	
  are	
  being	
   established.	
    	
    51	
    	
   Figure	
  3–7.	
  Contralateral	
  exit	
  of	
  an	
  EH	
  axon.	
  	
   EH-­‐GAL4,	
  UASCD8::GFP;	
  CalpBP.	
  Left	
  axon	
  crosses	
  the	
  midline	
  and	
  exits	
   contralaterally	
  (highlighted	
  in	
  white,	
  left)	
  it	
  also	
  branches	
  and	
  the	
  branch	
  extends	
   and	
  exits	
  ipsilaterally	
  (highlighted	
  in	
  orange,	
  left)	
  (scale	
  bar	
  =	
  75	
  μm).	
  	
    	
    52	
    Table	
  3-­‐2.	
  Quantification	
  of	
  exit	
  location	
  of	
  axons	
  in	
  EH	
  neurons.	
    Genotype	
    %	
  of	
  axons	
  that	
   exit	
  contralaterally	
    %	
  with	
  lateral	
  exit	
   point	
    Wild	
  Type	
    0%	
  (0/1)	
    0%	
  (0/1)	
    CortOE	
    18.2%	
  (2/11)	
    27.2%	
  (3/11)	
    CalpBP/+	
    12.5%	
  (1/8)	
    25%	
  (2/8)	
    CalpBDf/+	
    25%	
  (1/4)	
    25%	
  (1/4)	
    CalpBP/CalpBDf	
    0%	
  (0/3)	
    0%	
  (0/3)	
    CortOE;	
  CalpBP/+	
    29.4%	
  (4/16)	
    11.8%	
  (2/16)	
    Cort;	
  CalpBDf/+	
    0%	
  (0/1)	
    100%	
  (1/1)	
    20%	
  (1/5)	
    20%	
  (1/5)	
    P  Df  CortOE;	
  CalpB /CalpB  	
    	
   	
    	
    53	
    Chapter	
  4: Discussion	
   Both	
  calpain	
  and	
  cortactin	
  have	
  been	
  previously	
  implicated	
  in	
  several	
  roles	
  in	
   migration	
  in	
  various	
  cell	
  types	
  in	
  vitro.	
  Calpain	
  enhances	
  turnover	
  of	
  adhesion	
   complexes	
  (Huttenlocher	
  et	
  al.,	
  1997;	
  Palecek,	
  Huttenlocher,	
  Horwitz,	
  &	
   Lauffenburger,	
  1998)	
  and	
  suppresses	
  membrane	
  protrusions	
  (Perrin	
  et	
  al.,	
  2006)	
  at	
   the	
  trailing	
  edge	
  of	
  migrating	
  cells.	
  Cortactin,	
  a	
  substrate	
  of	
  calpain,	
  enhances	
   membrane	
  protrusions	
  through	
  its	
  facilitation	
  and	
  stabilization	
  of	
  actin	
   polymeriziation	
  and	
  branching	
  (Pollard,	
  2007;	
  Weaver	
  et	
  al.,	
  2002).	
  Calpain	
   represses	
  cortactin	
  activity	
  at	
  the	
  trailing	
  edge	
  (Perrin	
  et	
  al.,	
  2006)	
  as	
  well	
  as	
  in	
   consolidated	
  regions	
  of	
  axons	
  during	
  outgrowth	
  but	
  is	
  inactive	
  at	
  the	
  leading	
  edge	
   allowing	
  for	
  protrusion	
  to	
  occur	
  (Mingorance-­‐Le	
  Meur	
  &	
  O'Connor,	
  2009).	
  The	
   physiological	
  role	
  for	
  calpain	
  and	
  cortactin	
  within	
  outgrowth	
  and	
  migration	
  has	
   been	
  difficult	
  to	
  elucidate	
  from	
  cell	
  culture	
  studies	
  due	
  to	
  the	
  discrepancies	
  in	
   results	
  observed.	
  These	
  differences	
  are	
  likely	
  due	
  to	
  the	
  varying	
  parameters	
   between	
  different	
  in	
  vitro	
  experiments.	
  Therefore,	
  I	
  set	
  out	
  to	
  investigate	
  the	
  role	
  for	
   calpain	
  and	
  cortactin	
  in	
  axon	
  outgrowth	
  in	
  vivo	
  in	
  order	
  to	
  determine	
  the	
   physiological	
  importance	
  of	
  these	
  molecules.	
  It	
  was	
  found	
  that	
  cortactin	
  enhances	
   elongation	
  of	
  axons	
  in	
  the	
  developing	
  nervous	
  system	
  of	
  Drosophila	
  and	
  that	
  calpain	
   acts	
  as	
  a	
  repressor	
  of	
  cortactin’s	
  actions	
  recapitulating	
  previous	
  in	
  vitro	
  results	
  from	
   our	
  lab	
  (Mingorance-­‐Le	
  Meur	
  &	
  O'Connor,	
  2009).	
  The	
  work	
  presented	
  here	
   establishes	
  an	
  interaction	
  between	
  calpain	
  and	
  cortactin	
  and	
  demonstrates	
  their	
   importance	
  within	
  the	
  developing	
  nervous	
  system	
  in	
  vivo.	
   	
    54	
    4.1 Cortactin	
  and	
  calpain	
  interact	
  in	
  the	
  developing	
  nervous	
  system	
  of	
   Drosophila	
  melanogaster	
   	
   Calpain	
  activity	
  and	
  its	
  interaction	
  with	
  cortactin	
  within	
  the	
  developing	
   nervous	
  system	
  were	
  demonstrated	
  through	
  various	
  means;	
  thus,	
  providing	
  support	
   for	
  the	
  legitimacy	
  of	
  the	
  use	
  of	
  Drosophila	
  melanogaster	
  as	
  a	
  model	
  organism	
  in	
  the	
   present	
  study,	
  and	
  for	
  future	
  research,	
  into	
  their	
  roles	
  in	
  axon	
  outgrowth	
  and	
   consolidation.	
  Calpain	
  was	
  found	
  to	
  be	
  active	
  within	
  the	
  embryonic	
  nerve	
  cord,	
   reported	
  by	
  tBoc	
  fluorescence,	
  and	
  was	
  reversibly	
  inhibited	
  by	
  the	
  calpain	
  inhibitor	
   ALLM.	
  In	
  addition,	
  inhibition	
  of	
  calpain	
  in	
  intact	
  larval	
  brains,	
  through	
   pharmacological	
  or	
  genetic	
  means,	
  resulted	
  in	
  an	
  accumulation	
  of	
  cortactin	
   indicating	
  that	
  calpain	
  activity	
  causes	
  a	
  decrease	
  in	
  cortactin	
  levels.	
  Interestingly,	
   however,	
  in	
  the	
  CalpBP	
  homozygous	
  mutant,	
  cortactin	
  levels	
  decreased.	
  One	
   possibility	
  is	
  that	
  the	
  decrease	
  in	
  CalpB	
  expression	
  resulted	
  in	
  the	
  compensatory	
   activity	
  of	
  another	
  calpain,	
  for	
  example,	
  CalpA.	
  It	
  is	
  possible	
  then	
  that	
  the	
  increased	
   action	
  of	
  CalpA,	
  or	
  another	
  molecule,	
  resulted	
  in	
  the	
  degradation	
  of	
  cortactin.	
  It	
   would	
  be	
  interesting	
  to	
  perform	
  an	
  experiment	
  using	
  RNA	
  interference	
  (RNAi)	
  in	
  a	
   temporally	
  restricted	
  manner	
  (i.e.	
  using	
  the	
  temperature	
  sensitive	
  GAL4	
  inhibitor	
   GAL80)	
  to	
  bypass	
  any	
  compensation	
  required	
  for	
  proper	
  development.	
  In	
  this	
   situation,	
  one	
  would	
  expect	
  that	
  the	
  acute	
  decrease	
  in	
  CalpB	
  levels	
  would	
  allow	
  for	
   the	
  build	
  up	
  of	
  cortactin	
  as	
  seen	
  with	
  acute	
  pharmacological	
  inhibition.	
    	
    55	
    4.2 Cortactin	
  and	
  calpain	
  are	
  important	
  in	
  axon	
  outgrowth	
  in	
  vivo	
   	
   Previous	
  research	
  has	
  demonstrated	
  the	
  importance	
  of	
  cortactin	
  and	
  calpain	
   in	
  non-­‐neuronal	
  cell	
  migration	
  (Franco	
  and	
  Huttenlocher	
  2005;	
  Flevaris	
  et	
  al.	
  2007)	
   and	
  in	
  axon	
  outgrowth	
  (Mingorance-­‐Le	
  Meur	
  and	
  O'Connor	
  2009)	
  in	
  vitro.	
  However,	
   many	
  of	
  these	
  studies	
  produced	
  conflicting	
  results	
  due	
  to	
  differences	
  in	
   experimental	
  conditions.	
  For	
  example,	
  calpain	
  inhibition	
  was	
  found	
  to	
  decrease	
  cell	
   spreading	
  in	
  fibroblasts	
  (Potter	
  et	
  al.	
  1998)	
  but	
  also	
  to	
  increase	
  cell	
  spreading	
  in	
   neutrophils	
  (Lokuta,	
  Nuzzi,	
  and	
  Huttenlocher	
  2003).	
  Therefore,	
  it	
  was	
  of	
  importance	
   to	
  determine	
  the	
  physiological	
  roles	
  of	
  these	
  proteins	
  within	
  their	
  native	
   environments	
  in	
  vivo.	
  A	
  major	
  goal	
  of	
  my	
  work	
  then	
  was	
  to	
  use	
  different	
  subsets	
  of	
   neurons	
  within	
  the	
  developing	
  nervous	
  system	
  of	
  Drosophila	
  melanogaster	
  to	
   address	
  their	
  roles	
  in	
  vivo.	
  	
   Within	
  apterous-­‐expressing	
  interneurons	
  in	
  stage	
  15/16	
  embryos,	
  cortactin	
   overexpression	
  and	
  calpain	
  inhibition	
  resulted	
  in	
  pathfinding	
  defects.	
  Cortactin	
   overexpression	
  increased	
  the	
  occurrence	
  of	
  deviations	
  from	
  the	
  longitudinal	
   fascicles	
  and	
  calpain	
  inhibition	
  resulted	
  in	
  misguidance	
  and	
  aberrant	
  midline	
   crossing.	
  	
  The	
  combination	
  of	
  cortactin	
  overexpression	
  with	
  calpain	
  inhibition	
   resulted	
  in	
  an	
  enhancement	
  of	
  both	
  of	
  these	
  phenotypes	
  suggesting	
  that	
  they	
   interact.	
  These	
  findings	
  recapitulate	
  the	
  pathfinding	
  defects	
  previously	
  observed	
  in	
   ap	
  null	
  versions	
  of	
  these	
  neurons	
  (Lundgren	
  et	
  al.	
  1995)	
  implicating	
  a	
  role	
  for	
   calpain	
  and	
  cortactin	
  in	
  axon	
  guidance	
  during	
  outgrowth	
  of	
  apterous	
  neurons.	
  It	
  is	
   conceivable	
  that	
  altering	
  the	
  expression	
  and	
  activity	
  of	
  cortactin	
  and	
  calpain,	
  which	
   are	
  downstream	
  effectors	
  of	
  guidance	
  cues	
  (Glading	
  et	
  al.	
  2004;	
  Mingorance-­‐Le	
   	
    56	
    Meur	
  and	
  O'Connor	
  2009;	
  Somogyi	
  and	
  Rørth	
  2004;	
  Satish	
  et	
  al.	
  2005),	
  enhances	
   the	
  process	
  of	
  protrusion/elongation	
  such	
  that	
  it	
  overrides	
  response	
  to	
  guidance	
   cues	
  and	
  therefore	
  results	
  in	
  pathfinding	
  defects.	
   	
   In	
  EH	
  neurons,	
  a	
  striking	
  phenotype	
  was	
  observed	
  with	
  cortactin	
   overexpression	
  as	
  well	
  as	
  with	
  calpain	
  inhibition,	
  that	
  is	
  the	
  elongation	
  of	
  the	
   posteriorly	
  projecting	
  axon	
  and	
  aberrant	
  extension	
  into	
  the	
  peripheral	
  nervous	
   system.	
  In	
  only	
  a	
  single	
  wild	
  type	
  case	
  (7%)	
  was	
  this	
  observed	
  compared	
  to	
  73.3%	
   with	
  cortactin	
  overexpression,	
  50%	
  with	
  CalpBP,	
  and	
  55.2%	
  with	
  the	
  combined	
   genotype.	
  Not	
  only	
  did	
  the	
  axons	
  extend	
  several	
  hundred	
  micrometers	
  out	
  of	
  the	
   VNC,	
  they	
  also	
  sometimes	
  crossed	
  the	
  midline,	
  exited	
  contralaterally,	
  and/or	
  exited	
   from	
  a	
  lateral	
  peripheral	
  nerve.	
  This	
  indicates	
  that	
  while	
  extending,	
  the	
  axons	
  are	
   making	
  aberrant	
  pathfinding	
  decisions	
  and	
  not	
  remaining	
  confined	
  to	
  their	
  typical	
   trajectory.	
  This	
  again	
  could	
  be	
  due	
  to	
  the	
  fact	
  that	
  cortactin	
  and	
  calpain	
  act	
   downstream	
  of	
  guidance	
  cues	
  and	
  thus,	
  inhibiting	
  calpain	
  and/or	
  overexpressing	
   cortactin	
  could	
  bypass	
  the	
  relevant	
  signaling	
  pathways	
  and	
  lead	
  to	
  aberrant	
   response	
  to	
  external	
  cues.	
  	
   	
   Unanticipated	
  results	
  were	
  observed	
  in	
  the	
  presence	
  of	
  the	
  CalpB	
  deficiency	
   (CalpBDf).	
  A	
  decrease	
  in	
  penetrance	
  and	
  axon	
  length	
  were	
  observed	
  when	
  other	
   mutants	
  were	
  combined	
  with	
  CalpBDf;	
  however,	
  CalpBDf	
  alone	
  displayed	
  the	
  longest	
   axons	
  of	
  any	
  genotype.	
  For	
  example,	
  cortactin	
  overexpression	
  alone	
  resulted	
  in	
   73.3%	
  exit	
  rate	
  and	
  an	
  average	
  axon	
  length	
  of	
  113.1	
  ±	
  27.2	
  μm	
  compared	
  to	
  55.2%	
   and	
  212.4	
  ±	
  44.1	
  μm	
  in	
  EH-­‐GAL4/UASCortactin;	
  CalpBP	
  and	
  7.1%	
  and	
  36.7	
  ±	
  0	
  μm	
  in	
   EH-­‐GAL4/	
  UASCortactin;	
  CalpBDf.	
  There	
  are	
  a	
  number	
  of	
  possible	
  reasons	
  for	
  this.	
   	
    57	
    Firstly,	
  it	
  is	
  possible	
  that	
  in	
  the	
  combined	
  mutants	
  there	
  is	
  too	
  little	
  CalpB.	
   Mingorance-­‐Le	
  Meur	
  and	
  O’Connor	
  (2009)	
  suggested	
  that	
  maturation	
  of	
  protrusions	
   may	
  require	
  re-­‐consolidation	
  after	
  a	
  brief	
  period	
  of	
  deconsolidation	
  and	
  therefore,	
   some	
  calpain	
  activity	
  is	
  necessary.	
  This	
  was	
  based	
  on	
  the	
  observation	
  of	
  an	
  increase	
   in	
  the	
  formation	
  of	
  branches,	
  rather	
  than	
  transient	
  protrusions,	
  with	
  the	
  application	
   of	
  the	
  calpain	
  inhibitor	
  ALLM	
  for	
  a	
  brief	
  period	
  (5	
  minutes)	
  followed	
  by	
  washout	
   (Figure	
  1-­‐5Aiii)	
  (Mingorance-­‐Le	
  Meur	
  and	
  O'Connor	
  2009).	
  Live	
  imaging	
  of	
  the	
   developing	
  neurons	
  would	
  be	
  one	
  possible	
  way	
  to	
  determine	
  if	
  in	
  the	
  deficiency	
   background,	
  there	
  was	
  an	
  increase	
  in	
  transient	
  filopodia	
  formation	
  and	
  a	
  decrease	
   in	
  stable	
  branch	
  formation	
  compared	
  to	
  the	
  other	
  genotypes.	
  Similarly,	
  if	
  CalpBDf	
   alone	
  has	
  only	
  slightly	
  reduced	
  levels	
  of	
  CalpB	
  –	
  as	
  may	
  be	
  suggested	
  by	
  the	
  lack	
  of	
   affect	
  on	
  cortactin	
  levels	
  (Figure	
  3-­‐2Bi)	
  –	
  it	
  may	
  be	
  a	
  reduction	
  to	
  an	
  optimal	
  level	
   where	
  outgrowth	
  is	
  enhanced	
  resulting	
  in	
  the	
  extensive	
  elongation	
  observed	
  in	
  the	
   axons	
  that	
  exited	
  with	
  this	
  genotype	
  (mean	
  =	
  498.0	
  ±	
  250.3	
  μm).	
   	
   An	
  alternate	
  possibility	
  is	
  that	
  one	
  or	
  more	
  of	
  the	
  14	
  other	
  genes	
  deleted	
  in	
   the	
  CalpBDf	
  affects	
  axon	
  outgrowth.	
  Included	
  in	
  these	
  14	
  genes	
  are	
  five	
  with	
   unknown	
  functions	
  and	
  three	
  with	
  known	
  functions	
  with	
  the	
  potential	
  to	
  affect	
   neuron	
  development	
  and	
  growth	
  –	
  Cdk8,	
  Gap1,	
  and	
  Taf2.	
  Cyclin-­‐dependent	
  kinase	
  8	
   (Cdk8)	
  has	
  been	
  identified	
  in	
  a	
  large-­‐scale	
  forward	
  genetic	
  screen	
  to	
  be	
  involved	
  in	
   axon	
  guidance	
  (Berger	
  et	
  al.	
  2008).	
  Gap1	
  and	
  Taf2	
  are	
  both	
  important	
  in	
   neurogenesis	
  (Neumüller	
  et	
  al.	
  2011).	
  The	
  deletion	
  of	
  these	
  genes	
  may	
  therefore	
   affect	
  the	
  observed	
  phenotype.	
    	
    58	
    It	
  is	
  important	
  to	
  note	
  that	
  the	
  SEM	
  of	
  axon	
  lengths	
  varied	
  between	
  about	
  25-­‐ 50%	
  of	
  the	
  mean	
  for	
  most	
  of	
  the	
  genotypes	
  tested.	
  This	
  large	
  amount	
  of	
  variance	
  is	
  a	
   result	
  of	
  the	
  low	
  penetrance	
  of	
  the	
  phenotype	
  and	
  likely	
  indicates	
  the	
  presence	
  of	
   compensatory	
  mechanisms.	
  A	
  possible	
  means	
  to	
  determine	
  if	
  this	
  is	
  indeed	
  the	
  case	
   is	
  to	
  more	
  completely	
  disrupt	
  the	
  system.	
  For	
  example,	
  a	
  plausible	
  candidate	
  for	
   compensation	
  of	
  the	
  lack	
  of	
  CalpB	
  activity	
  in	
  mutants	
  is	
  CalpA.	
  A	
  simple	
  way	
  to	
  test	
   for	
  redundancy	
  of	
  calpains	
  is	
  to	
  use	
  acute	
  pharmacological	
  inhibition	
  with	
  ALLN.	
  A	
   more	
  genetically	
  tractable	
  approach	
  would	
  be	
  to	
  test	
  combined	
  mutants.	
  Double	
   stranded	
  RNAi	
  lines	
  for	
  both	
  genes	
  are	
  publicly	
  available	
  and	
  could	
  be	
  combined	
  in	
  a	
   CalpA	
  and	
  CalpB	
  mutant	
  background.	
  In	
  these	
  animals,	
  an	
  enhancement	
  of	
  both	
  the	
   intensity	
  and	
  the	
  penetrance	
  of	
  the	
  phenotype	
  would	
  be	
  expected.	
    	
    Despite	
  the	
  limitations	
  of	
  this	
  work,	
  it	
  is	
  clear	
  that	
  cortactin	
  and	
  calpain	
  both	
   affect	
  axon	
  outgrowth	
  in	
  terms	
  of	
  elongation	
  as	
  well	
  as	
  pathfinding.	
    4.3 Calpain	
  as	
  a	
  therapeutic	
  target	
   The	
  involvement	
  of	
  calpain	
  and	
  cortactin	
  in	
  axon	
  outgrowth	
  makes	
  them	
   prime	
  targets	
  for	
  therapy	
  in	
  conditions	
  involving	
  neuronal	
  damage.	
  For	
  example,	
   treatment	
  may	
  be	
  targeted	
  at	
  recruiting	
  developmental	
  pathways	
  in	
  order	
  to	
  induce	
   growth	
  in	
  the	
  case	
  of	
  traumatic	
  brain	
  injury	
  (TBI)	
  or	
  spinal	
  cord	
  injury	
  (SCI).	
  Thus,	
   as	
  calpain	
  acts	
  as	
  an	
  inhibitor	
  of	
  cortactin,	
  and	
  therefore	
  axon	
  outgrowth,	
  inhibiting	
   calpain	
  may	
  be	
  effective	
  in	
  the	
  enhancement	
  of	
  axon	
  growth	
  after	
  injury.	
   Not	
  only	
  is	
  calpain	
  activity	
  relevant	
  to	
  the	
  development	
  of	
  neurons,	
  it	
  also	
   plays	
  a	
  role	
  in	
  pathologies	
  associated	
  with	
  neuron	
  death.	
  Many	
  neurodegenerative	
   disorders	
  stem	
  from	
  the	
  death	
  of	
  neurons	
  within	
  the	
  central	
  nervous	
  system,	
   	
    59	
    including	
  Parkinson’s	
  disease,	
  Huntington’s	
  disease,	
  amyotrophic	
  lateral	
  sclerosis	
   (ALS),	
  Alzheimer’s	
  disease,	
  and	
  TBI	
  (reviewed	
  in	
  Vosler,	
  Brennan,	
  and	
  Chen	
  2008).	
   The	
  pathology	
  within	
  each	
  of	
  these	
  disease	
  states	
  includes	
  dysfunctional	
  calcium	
   regulation	
  within	
  the	
  neurons	
  leading	
  to	
  increased	
  cytoplasmic	
  calcium	
  levels	
  and	
   hyperactivation	
  of	
  calpain	
  proteases.	
  Thus,	
  inhibition	
  of	
  calpain	
  has	
  been	
  found	
  to	
   be	
  neuroprotective	
  in	
  models	
  of	
  these	
  diseases	
  (Camins	
  et	
  al.	
  2006;	
  Ray	
  2006;	
  Saez	
   et	
  al.	
  2006;	
  Vosler,	
  Brennan,	
  and	
  Chen	
  2008).	
  However,	
  knowledge	
  of	
  calpain’s	
  role	
   in	
  the	
  progression	
  of	
  neurodegeneration	
  is	
  limited.	
  Substrates	
  of	
  calpain	
  include	
   various	
  proteins	
  involved	
  in	
  cell	
  death	
  including	
  Bcl-­‐xL,	
  which	
  becomes	
   proapoptotic	
  upon	
  cleavage	
  by	
  calpain	
  in	
  ischemia	
  and	
  Alzheimer’s	
  disease	
   (Nakagawa	
  and	
  Yuan	
  2000),	
  and	
  several	
  caspases	
  (Chua,	
  Guo,	
  and	
  Li	
  2000;	
  Ruiz-­‐ Vela,	
  González	
  de	
  Buitrago,	
  and	
  Martínez-­‐A	
  1999).	
  Therefore,	
  having	
  a	
  viable	
  model	
   system	
  in	
  which	
  to	
  elucidate	
  the	
  role	
  of	
  calpain	
  in	
  such	
  pathologies	
  is	
  of	
  great	
   importance.	
  There	
  are	
  currently	
  models	
  of	
  neurodegenerative	
  disease	
  in	
  Drosophila	
   including	
  Alzheimer’s	
  (Cowan,	
  Shepherd,	
  and	
  Mudher	
  2010)	
  and	
  Parkinson’s	
   disease	
  (Siddique	
  et	
  al.	
  2012),	
  in	
  which	
  the	
  effects	
  of	
  calpain	
  regulation	
  could	
  be	
   tested.	
  In	
  addition,	
  the	
  EH	
  neurons	
  in	
  Drosophila	
  offer	
  one	
  such	
  model	
  system.	
   Benefits	
  of	
  these	
  neurons	
  include	
  that	
  there	
  is	
  already	
  a	
  characterized	
  behavioural	
   phenotype	
  associated	
  with	
  the	
  ablation	
  of	
  these	
  neurons	
  (McNabb	
  et	
  al.	
  1997)	
  and	
   that	
  these	
  neurons	
  are	
  sensitive	
  to	
  changes	
  in	
  calpain	
  levels,	
  as	
  demonstrated	
  by	
  the	
   results	
  of	
  this	
  work.	
  	
    	
    60	
    Chapter	
  5: Conclusions	
   This	
  study	
  set	
  out	
  to	
  elucidate	
  the	
  role	
  of	
  cortactin	
  and	
  calpain	
  in	
  axon	
   outgrowth	
  and	
  consolidation	
  in	
  vivo.	
  Utilizing	
  cell	
  targeted	
  gene	
  expression	
  of	
  the	
   GAL4/UAS	
  system	
  and	
  various	
  available	
  genetic	
  mutants,	
  it	
  was	
  established	
  that	
   calpain	
  and	
  cortactin	
  interact	
  within	
  developing	
  neurons	
  within	
  the	
  central	
  nervous	
   system	
  during	
  axon	
  outgrowth.	
  Cortactin	
  was	
  shown	
  to	
  enhance	
  elongation	
  of	
  axons	
   and	
  to	
  be	
  regulated	
  by	
  calpain	
  activity.	
  Future	
  experiments	
  are	
  necessary	
  to	
   investigate	
  the	
  upstream	
  regulators	
  and	
  downstream	
  effectors	
  of	
  these	
  molecules	
   within	
  axons	
  and	
  particular	
  roles	
  for	
  different	
  calpains,	
  specifically	
  CalpA	
  and	
  CalpB,	
   in	
  outgrowth.	
  In	
  addition,	
  it	
  would	
  be	
  important	
  in	
  uncovering	
  whether	
  cortactin	
  or	
   calpain	
  serve	
  as	
  potential	
  targets	
  for	
  treatment	
  in	
  injury	
  and	
  disease	
  to	
  determine	
   whether	
  these	
  processes	
  are	
  maintained,	
  and	
  therefore	
  can	
  be	
  recruited,	
  in	
  adult	
   neurons	
  for	
  plasticity	
  and	
  repair.	
    	
    61	
    References	
   Allan,	
  Douglas	
  W,	
  Susan	
  E	
  St	
  Pierre,	
  Irene	
  Miguel-­‐Aliaga,	
  and	
  Stefan	
  Thor.	
  2003.	
   “Specification	
  of	
  Neuropeptide	
  Cell	
  Identity	
  by	
  the	
  Integration	
  of	
  Retrograde	
   BMP	
  Signaling	
  and	
  a	
  Combinatorial	
  Transcription	
  Factor	
  Code..”	
  Cell	
  113	
  (1)	
   (April	
  4):	
  73–86.	
   Ammer,	
  Amanda	
  Gatesman,	
  and	
  Scott	
  A	
  Weed.	
  2008.	
  “Cortactin	
  Branches	
  Out:	
  Roles	
   in	
  Regulating	
  Protrusive	
  Actin	
  Dynamics..”	
  Cell	
  Motility	
  and	
  the	
  Cytoskeleton	
  65	
   (9)	
  (September):	
  687–707.	
  doi:10.1002/cm.20296.	
   Arthur,	
  J	
  S,	
  and	
  C	
  Crawford.	
  1996.	
  “Investigation	
  of	
  the	
  Interaction	
  of	
  M-­‐Calpain	
  with	
   Phospholipids:	
  Calpain-­‐Phospholipid	
  Interactions..”	
  Biochimica	
  Et	
  Biophysica	
   Acta	
  1293	
  (2)	
  (April	
  16):	
  201–206.	
   Baki,	
  A,	
  P	
  Tompa,	
  A	
  Alexa,	
  O	
  Molnár,	
  and	
  P	
  Friedrich.	
  1996.	
  “Autolysis	
  Parallels	
   Activation	
  of	
  Mu-­‐Calpain..”	
  The	
  Biochemical	
  Journal	
  318	
  (	
  Pt	
  3)	
  (September	
  15):	
   897–901.	
   Bellen,	
  Hugo	
  J,	
  Robert	
  W	
  Levis,	
  Guochun	
  Liao,	
  Yuchun	
  He,	
  Joseph	
  W	
  Carlson,	
  Garson	
   Tsang,	
  Martha	
  Evans-­‐Holm,	
  et	
  al.	
  2004.	
  “The	
  BDGP	
  Gene	
  Disruption	
  Project:	
   Single	
  Transposon	
  Insertions	
  Associated	
  with	
  40%	
  of	
  Drosophila	
  Genes..”	
   Genetics	
  167	
  (2)	
  (June):	
  761–781.	
  doi:10.1534/genetics.104.026427.	
   Beltzner,	
  Christopher	
  C,	
  and	
  Thomas	
  D	
  Pollard.	
  2004.	
  “Identification	
  of	
  Functionally	
   Important	
  Residues	
  of	
  Arp2/3	
  Complex	
  by	
  Analysis	
  of	
  Homology	
  Models	
  From	
   Diverse	
  Species..”	
  Journal	
  of	
  Molecular	
  Biology	
  336	
  (2)	
  (February	
  13):	
  551–565.	
   Berger,	
  Jürg,	
  Kirsten-­‐André	
  Senti,	
  Gabriele	
  Senti,	
  Timothy	
  P	
  Newsome,	
  Bengt	
  Asling,	
   Barry	
  J	
  Dickson,	
  and	
  Takashi	
  Suzuki.	
  2008.	
  “Systematic	
  Identification	
  of	
  Genes	
   That	
  Regulate	
  Neuronal	
  Wiring	
  in	
  the	
  Drosophila	
  Visual	
  System..”	
  PLoS	
  Genetics	
   4	
  (5)	
  (May):	
  e1000085.	
  doi:10.1371/journal.pgen.1000085.	
   Blair,	
  S	
  S,	
  D	
  L	
  Brower,	
  J	
  B	
  Thomas,	
  and	
  M	
  Zavortink.	
  1994.	
  “The	
  Role	
  of	
  Apterous	
  in	
   the	
  Control	
  of	
  Dorsoventral	
  Compartmentalization	
  and	
  PS	
  Integrin	
  Gene	
   Expression	
  in	
  the	
  Developing	
  Wing	
  of	
  Drosophila..”	
  Development	
  (Cambridge,	
   England)	
  120	
  (7)	
  (July):	
  1805–1815.	
   Blanchard,	
  H,	
  P	
  Grochulski,	
  Y	
  Li,	
  J	
  S	
  Arthur,	
  P	
  L	
  Davies,	
  J	
  S	
  Elce,	
  and	
  M	
  Cygler.	
  1997.	
   “Structure	
  of	
  a	
  Calpain	
  Ca(2+)-­‐Binding	
  Domain	
  Reveals	
  a	
  Novel	
  EF-­‐Hand	
  and	
   Ca(2+)-­‐Induced	
  Conformational	
  Changes..”	
  Nature	
  Structural	
  Biology	
  4	
  (7)	
   (July):	
  532–538.	
   Brand,	
  A	
  H,	
  and	
  N	
  Perrimon.	
  1993.	
  “Targeted	
  Gene	
  Expression	
  as	
  a	
  Means	
  of	
   Altering	
  Cell	
  Fates	
  and	
  Generating	
  Dominant	
  Phenotypes..”	
  Development	
   	
    62	
    (Cambridge,	
  England)	
  118	
  (2)	
  (June):	
  401–415.	
   Bryce,	
  Nicole	
  S,	
  Emily	
  S	
  Clark,	
  Ja'Mes	
  L	
  Leysath,	
  Joshua	
  D	
  Currie,	
  Donna	
  J	
  Webb,	
  and	
   Alissa	
  M	
  Weaver.	
  2005.	
  “Cortactin	
  Promotes	
  Cell	
  Motility	
  by	
  Enhancing	
   Lamellipodial	
  Persistence..”	
  Current	
  Biology	
  :	
  CB	
  15	
  (14)	
  (July	
  26):	
  1276–1285.	
   doi:10.1016/j.cub.2005.06.043.	
   Campbell,	
  D	
  H,	
  R	
  L	
  Sutherland,	
  and	
  R	
  J	
  Daly.	
  1999.	
  “Signaling	
  Pathways	
  and	
   Structural	
  Domains	
  Required	
  for	
  Phosphorylation	
  of	
  EMS1/Cortactin..”	
  Cancer	
   Research	
  59	
  (20)	
  (October	
  15):	
  5376–5385.	
   Chua,	
  B	
  T,	
  K	
  Guo,	
  and	
  P	
  Li.	
  2000.	
  “Direct	
  Cleavage	
  by	
  the	
  Calcium-­‐Activated	
  Protease	
   Calpain	
  Can	
  Lead	
  to	
  Inactivation	
  of	
  Caspases..”	
  The	
  Journal	
  of	
  Biological	
   Chemistry	
  275	
  (7)	
  (February	
  18):	
  5131–5135.	
   Cong,	
  J,	
  D	
  E	
  Goll,	
  A	
  M	
  Peterson,	
  and	
  H	
  P	
  Kapprell.	
  1989.	
  “The	
  Role	
  of	
  Autolysis	
  in	
   Activity	
  of	
  the	
  Ca2+-­‐Dependent	
  Proteinases	
  (Mu-­‐Calpain	
  and	
  M-­‐Calpain)..”	
  The	
   Journal	
  of	
  Biological	
  Chemistry	
  264	
  (17)	
  (June	
  15):	
  10096–10103.	
   Cowan,	
  Catherine	
  M,	
  David	
  Shepherd,	
  and	
  Amritpal	
  Mudher.	
  2010.	
  “Insights	
  From	
   Drosophila	
  Models	
  of	
  Alzheimer's	
  Disease..”	
  Biochemical	
  Society	
  Transactions	
  38	
   (4)	
  (August):	
  988–992.	
  doi:10.1042/BST0380988.	
   Delaney,	
  S	
  J,	
  D	
  C	
  Hayward,	
  F	
  Barleben,	
  K	
  F	
  Fischbach,	
  and	
  G	
  L	
  Miklos.	
  1991.	
   “Molecular	
  Cloning	
  and	
  Analysis	
  of	
  Small	
  Optic	
  Lobes,	
  a	
  Structural	
  Brain	
  Gene	
  of	
   Drosophila	
  Melanogaster..”	
  Proceedings	
  of	
  the	
  National	
  Academy	
  of	
  Sciences	
  of	
   the	
  United	
  States	
  of	
  America	
  88	
  (16)	
  (August	
  15):	
  7214–7218.	
   Dent,	
  Erik	
  W,	
  and	
  Frank	
  B	
  Gertler.	
  2003.	
  “Cytoskeletal	
  Dynamics	
  and	
  Transport	
  in	
   Growth	
  Cone	
  Motility	
  and	
  Axon	
  Guidance..”	
  Neuron	
  40	
  (2)	
  (October	
  9):	
  209–227.	
   Duffy,	
  Joseph	
  B.	
  2002.	
  “GAL4	
  System	
  Indrosophila:	
  a	
  Fly	
  Geneticist's	
  Swiss	
  Army	
   Knife.”	
  Genesis	
  34	
  (1-­‐2)	
  (September	
  25):	
  1–15.	
  doi:10.1002/gene.10150.	
   Emori,	
  Y,	
  and	
  K	
  Saigo.	
  1994.	
  “Calpain	
  Localization	
  Changes	
  in	
  Coordination	
  with	
   Actin-­‐Related	
  Cytoskeletal	
  Changes	
  During	
  Early	
  Embryonic	
  Development	
  of	
   Drosophila..”	
  The	
  Journal	
  of	
  Biological	
  Chemistry	
  269	
  (40)	
  (October	
  7):	
  25137– 25142.	
   Farkas,	
  Attila,	
  Peter	
  Tompa,	
  Eva	
  Schád,	
  Rita	
  Sinka,	
  Gáspár	
  Jékely,	
  and	
  Peter	
   Friedrich.	
  2004.	
  “Autolytic	
  Activation	
  and	
  Localization	
  in	
  Schneider	
  Cells	
  (S2)	
  of	
   Calpain	
  B	
  From	
  Drosophila..”	
  The	
  Biochemical	
  Journal	
  378	
  (Pt	
  2)	
  (March	
  1):	
  299– 305.	
  doi:10.1042/BJ20031310.	
   Fischer,	
  J	
  A,	
  E	
  Giniger,	
  T	
  Maniatis,	
  and	
  M	
  Ptashne.	
  1988.	
  “GAL4	
  Activates	
   Transcription	
  in	
  Drosophila..”	
  Nature	
  332	
  (6167)	
  (April	
  28):	
  853–856.	
   doi:10.1038/332853a0.	
   	
    63	
    Flevaris,	
  Panagiotis,	
  Aleksandra	
  Stojanovic,	
  Haixia	
  Gong,	
  Athar	
  Chishti,	
  Emily	
  Welch,	
   and	
  Xiaoping	
  Du.	
  2007.	
  “A	
  Molecular	
  Switch	
  That	
  Controls	
  Cell	
  Spreading	
  and	
   Retraction..”	
  The	
  Journal	
  of	
  Cell	
  Biology	
  179	
  (3)	
  (November	
  5):	
  553–565.	
   doi:10.1083/jcb.200703185.	
   Forscher,	
  P,	
  and	
  S	
  J	
  Smith.	
  1988.	
  “Actions	
  of	
  Cytochalasins	
  on	
  the	
  Organization	
  of	
   Actin	
  Filaments	
  and	
  Microtubules	
  in	
  a	
  Neuronal	
  Growth	
  Cone..”	
  The	
  Journal	
  of	
   Cell	
  Biology	
  107	
  (4)	
  (October):	
  1505–1516.	
   Franco,	
  S,	
  B	
  Perrin,	
  and	
  A	
  Huttenlocher.	
  2004.	
  “Isoform	
  Specific	
  Function	
  of	
  Calpain	
   2	
  in	
  Regulating	
  Membrane	
  Protrusion..”	
  Experimental	
  Cell	
  Research	
  299	
  (1)	
   (September	
  10):	
  179–187.	
  doi:10.1016/j.yexcr.2004.05.021.	
   Franco,	
  Santos	
  J,	
  and	
  Anna	
  Huttenlocher.	
  2005.	
  “Regulating	
  Cell	
  Migration:	
  Calpains	
   Make	
  the	
  Cut..”	
  Journal	
  of	
  Cell	
  Science	
  118	
  (Pt	
  17)	
  (September	
  1):	
  3829–3838.	
   doi:10.1242/jcs.02562.	
   Friedrich,	
  Peter,	
  Peter	
  Tompa,	
  and	
  Attila	
  Farkas.	
  2004.	
  “The	
  Calpain-­‐System	
  of	
   Drosophila	
  Melanogaster:	
  Coming	
  of	
  Age..”	
  BioEssays	
  :	
  News	
  and	
  Reviews	
  in	
   Molecular,	
  Cellular	
  and	
  Developmental	
  Biology	
  26	
  (10)	
  (October):	
  1088–1096.	
   doi:10.1002/bies.20106.	
   Gallo,	
  G,	
  and	
  P	
  C	
  Letourneau.	
  1998.	
  “Axon	
  Guidance:	
  GTPases	
  Help	
  Axons	
  Reach	
   Their	
  Targets..”	
  Current	
  Biology	
  :	
  CB	
  8	
  (3)	
  (January	
  29):	
  R80–2.	
   Giniger,	
  E,	
  S	
  M	
  Varnum,	
  and	
  M	
  Ptashne.	
  1985.	
  “Specific	
  DNA	
  Binding	
  of	
  GAL4,	
  a	
   Positive	
  Regulatory	
  Protein	
  of	
  Yeast..”	
  Cell	
  40	
  (4)	
  (April):	
  767–774.	
   Glading,	
  A,	
  P	
  Chang,	
  D	
  A	
  Lauffenburger,	
  and	
  A	
  Wells.	
  2000.	
  “Epidermal	
  Growth	
   Factor	
  Receptor	
  Activation	
  of	
  Calpain	
  Is	
  Required	
  for	
  Fibroblast	
  Motility	
  and	
   Occurs	
  via	
  an	
  ERK/MAP	
  Kinase	
  Signaling	
  Pathway..”	
  The	
  Journal	
  of	
  Biological	
   Chemistry	
  275	
  (4)	
  (January	
  28):	
  2390–2398.	
   Glading,	
  A,	
  R	
  J	
  Bodnar,	
  I	
  J	
  Reynolds,	
  H	
  Shiraha,	
  L	
  Satish,	
  D	
  A	
  Potter,	
  H	
  C	
  Blair,	
  and	
  A	
   Wells.	
  2004.	
  “Epidermal	
  Growth	
  Factor	
  Activates	
  M-­‐Calpain	
  (Calpain	
  II),	
  at	
  Least	
   in	
  Part,	
  by	
  Extracellular	
  Signal-­‐Regulated	
  Kinase-­‐Mediated	
  Phosphorylation..”	
   Molecular	
  and	
  Cellular	
  Biology	
  24	
  (6)	
  (March):	
  2499–2512.	
   Gupton,	
  Stephanie	
  L,	
  Karen	
  L	
  Anderson,	
  Thomas	
  P	
  Kole,	
  Robert	
  S	
  Fischer,	
  Aaron	
   Ponti,	
  Sarah	
  E	
  Hitchcock-­‐DeGregori,	
  Gaudenz	
  Danuser,	
  et	
  al.	
  2005.	
  “Cell	
   Migration	
  Without	
  a	
  Lamellipodium:	
  Translation	
  of	
  Actin	
  Dynamics	
  Into	
  Cell	
   Movement	
  Mediated	
  by	
  Tropomyosin..”	
  The	
  Journal	
  of	
  Cell	
  Biology	
  168	
  (4)	
   (February	
  14):	
  619–631.	
  doi:10.1083/jcb.200406063.	
   Hall,	
  A.	
  1998.	
  “Rho	
  GTPases	
  and	
  the	
  Actin	
  Cytoskeleton..”	
  Science	
  (New	
  York,	
  N.Y.)	
   279	
  (5350)	
  (January	
  23):	
  509–514.	
   	
    64	
    Hall,	
  A.	
  2005.	
  “Rho	
  GTPases	
  and	
  the	
  Control	
  of	
  Cell	
  Behaviour..”	
  Biochemical	
  Society	
   Transactions	
  33	
  (Pt	
  5)	
  (November):	
  891–895.	
  doi:10.1042/BST20050891.	
   Hata,	
  S,	
  H	
  Sorimachi,	
  K	
  Nakagawa,	
  T	
  Maeda,	
  K	
  Abe,	
  and	
  K	
  Suzuki.	
  2001.	
  “Domain	
  II	
  of	
   M-­‐Calpain	
  Is	
  a	
  Ca(2+)-­‐Dependent	
  Cysteine	
  Protease..”	
  FEBS	
  Letters	
  501	
  (2-­‐3)	
   (July	
  20):	
  111–114.	
   Higgs,	
  H	
  N,	
  and	
  T	
  D	
  Pollard.	
  2001.	
  “Regulation	
  of	
  Actin	
  Filament	
  Network	
  Formation	
   Through	
  ARP2/3	
  Complex:	
  Activation	
  by	
  a	
  Diverse	
  Array	
  of	
  Proteins..”	
  Annual	
   Review	
  of	
  Biochemistry	
  70:	
  649–676.	
  doi:10.1146/annurev.biochem.70.1.649.	
   Hosfield,	
  C	
  M,	
  J	
  S	
  Elce,	
  P	
  L	
  Davies,	
  and	
  Z	
  Jia.	
  1999.	
  “Crystal	
  Structure	
  of	
  Calpain	
   Reveals	
  the	
  Structural	
  Basis	
  for	
  Ca(2+)-­‐Dependent	
  Protease	
  Activity	
  and	
  a	
  Novel	
   Mode	
  of	
  Enzyme	
  Activation..”	
  The	
  EMBO	
  Journal	
  18	
  (24)	
  (December	
  15):	
  6880– 6889.	
  doi:10.1093/emboj/18.24.6880.	
   Huang,	
  C,	
  N	
  N	
  Tandon,	
  N	
  J	
  Greco,	
  Y	
  Ni,	
  T	
  Wang,	
  and	
  X	
  Zhan.	
  1997.	
  “Proteolysis	
  of	
   Platelet	
  Cortactin	
  by	
  Calpain..”	
  The	
  Journal	
  of	
  Biological	
  Chemistry	
  272	
  (31)	
   (August	
  1):	
  19248–19252.	
   Huttenlocher,	
  A,	
  S	
  P	
  Palecek,	
  Q	
  Lu,	
  W	
  Zhang,	
  R	
  L	
  Mellgren,	
  D	
  A	
  Lauffenburger,	
  M	
  H	
   Ginsberg,	
  and	
  A	
  F	
  Horwitz.	
  1997.	
  “Regulation	
  of	
  Cell	
  Migration	
  by	
  the	
  Calcium-­‐ Dependent	
  Protease	
  Calpain..”	
  The	
  Journal	
  of	
  Biological	
  Chemistry	
  272	
  (52)	
   (December	
  26):	
  32719–32722.	
   Illés,	
  András,	
  Balázs	
  Enyedi,	
  Péter	
  Tamás,	
  Annamária	
  Balázs,	
  Gábor	
  Bogel,	
  Melinda,	
   Lukács,	
  and	
  László	
  Buday.	
  2006.	
  “Cortactin	
  Is	
  Required	
  for	
  Integrin-­‐Mediated	
   Cell	
  Spreading..”	
  Immunology	
  Letters	
  104	
  (1-­‐2)	
  (April	
  15):	
  124–130.	
   doi:10.1016/j.imlet.2005.11.011.	
   Imajoh,	
  S,	
  H	
  Kawasaki,	
  and	
  K	
  Suzuki.	
  1986.	
  “Limited	
  Autolysis	
  of	
  Calcium-­‐Activated	
   Neutral	
  Protease	
  (CANP):	
  Reduction	
  of	
  the	
  Ca2+-­‐Requirement	
  Is	
  Due	
  to	
  the	
   NH2-­‐Terminal	
  Processing	
  of	
  the	
  Large	
  Subunit..”	
  Journal	
  of	
  Biochemistry	
  100	
  (3)	
   (September):	
  633–642.	
   Jékely,	
  G,	
  and	
  P	
  Friedrich.	
  1999.	
  “Characterization	
  of	
  Two	
  Recombinant	
  Drosophila	
   Calpains.	
  CALPA	
  and	
  a	
  Novel	
  Homolog,	
  CALPB..”	
  The	
  Journal	
  of	
  Biological	
   Chemistry	
  274	
  (34)	
  (August	
  20):	
  23893–23900.	
   Kalil,	
  K,	
  G	
  Szebenyi,	
  and	
  E	
  W	
  Dent.	
  2000.	
  “Common	
  Mechanisms	
  Underlying	
  Growth	
   Cone	
  Guidance	
  and	
  Axon	
  Branching..”	
  Journal	
  of	
  Neurobiology	
  44	
  (2)	
  (August):	
   145–158.	
   Kanner,	
  S	
  B,	
  A	
  B	
  Reynolds,	
  R	
  R	
  Vines,	
  and	
  J	
  T	
  Parsons.	
  1990.	
  “Monoclonal	
  Antibodies	
   to	
  Individual	
  Tyrosine-­‐Phosphorylated	
  Protein	
  Substrates	
  of	
  Oncogene-­‐Encoded	
   Tyrosine	
  Kinases..”	
  Proceedings	
  of	
  the	
  National	
  Academy	
  of	
  Sciences	
  of	
  the	
  United	
   States	
  of	
  America	
  87	
  (9)	
  (May):	
  3328–3332.	
   	
    65	
    Katsube,	
  T,	
  M	
  Takahisa,	
  R	
  Ueda,	
  N	
  Hashimoto,	
  M	
  Kobayashi,	
  and	
  S	
  Togashi.	
  1998.	
   “Cortactin	
  Associates	
  with	
  the	
  Cell-­‐Cell	
  Junction	
  Protein	
  ZO-­‐1	
  in	
  Both	
  Drosophila	
   and	
  Mouse..”	
  The	
  Journal	
  of	
  Biological	
  Chemistry	
  273	
  (45)	
  (November	
  6):	
  29672– 29677.	
   Kempiak,	
  Stephan	
  J,	
  Hideki	
  Yamaguchi,	
  Corina	
  Sarmiento,	
  Mazen	
  Sidani,	
  Mousumi	
   Ghosh,	
  Robert	
  J	
  Eddy,	
  Vera	
  Desmarais,	
  Michael	
  Way,	
  John	
  Condeelis,	
  and	
  Jeffrey	
   E	
  Segall.	
  2005.	
  “A	
  Neural	
  Wiskott-­‐Aldrich	
  Syndrome	
  Protein-­‐Mediated	
  Pathway	
   for	
  Localized	
  Activation	
  of	
  Actin	
  Polymerization	
  That	
  Is	
  Regulated	
  by	
  Cortactin..”	
   The	
  Journal	
  of	
  Biological	
  Chemistry	
  280	
  (7)	
  (February	
  18):	
  5836–5842.	
   doi:10.1074/jbc.M410713200.	
   Kinley,	
  Andrew	
  W,	
  Scott	
  A	
  Weed,	
  Alissa	
  M	
  Weaver,	
  Andrei	
  V	
  Karginov,	
  Eric	
   Bissonette,	
  John	
  A	
  Cooper,	
  and	
  J	
  Thomas	
  Parsons.	
  2003.	
  “Cortactin	
  Interacts	
   with	
  WIP	
  in	
  Regulating	
  Arp2/3	
  Activation	
  and	
  Membrane	
  Protrusion..”	
  Current	
   Biology	
  :	
  CB	
  13	
  (5)	
  (March	
  4):	
  384–393.	
   Kovács,	
  László,	
  Anita	
  Alexa,	
  Eva	
  Klement,	
  Endre	
  Kókai,	
  Ágnes	
  Tantos,	
  Gergö	
  Gógl,	
   Tamás	
  Sperka,	
  et	
  al.	
  2009.	
  “Regulation	
  of	
  Calpain	
  B	
  From	
  Drosophila	
   Melanogaster	
  by	
  Phosphorylation.”	
  FEBS	
  Journal	
  276	
  (17).	
  Phosphorylation	
  of	
   Calpain	
  B	
  (August	
  4):	
  4959–4972.	
  doi:10.1111/j.1742-­‐4658.2009.07198.x.	
   Laughon,	
  A,	
  and	
  R	
  F	
  Gesteland.	
  1984.	
  “Primary	
  Structure	
  of	
  the	
  Saccharomyces	
   Cerevisiae	
  GAL4	
  Gene..”	
  Molecular	
  and	
  Cellular	
  Biology	
  4	
  (2)	
  (February):	
  260– 267.	
   Laughon,	
  A,	
  R	
  Driscoll,	
  N	
  Wills,	
  and	
  R	
  F	
  Gesteland.	
  1984.	
  “Identification	
  of	
  Two	
   Proteins	
  Encoded	
  by	
  the	
  Saccharomyces	
  Cerevisiae	
  GAL4	
  Gene..”	
  Molecular	
  and	
   Cellular	
  Biology	
  4	
  (2)	
  (February):	
  268–275.	
   Letourneau,	
  P	
  C.	
  1983.	
  “Differences	
  in	
  the	
  Organization	
  of	
  Actin	
  in	
  the	
  Growth	
  Cones	
   Compared	
  with	
  the	
  Neurites	
  of	
  Cultured	
  Neurons	
  From	
  Chick	
  Embryos..”	
  The	
   Journal	
  of	
  Cell	
  Biology	
  97	
  (4)	
  (October):	
  963–973.	
   Lewis,	
  A	
  K,	
  and	
  P	
  C	
  Bridgman.	
  1992.	
  “Nerve	
  Growth	
  Cone	
  Lamellipodia	
  Contain	
  Two	
   Populations	
  of	
  Actin	
  Filaments	
  That	
  Differ	
  in	
  Organization	
  and	
  Polarity..”	
  The	
   Journal	
  of	
  Cell	
  Biology	
  119	
  (5)	
  (December):	
  1219–1243.	
   Lin,	
  C	
  H,	
  and	
  P	
  Forscher.	
  1995.	
  “Growth	
  Cone	
  Advance	
  Is	
  Inversely	
  Proportional	
  to	
   Retrograde	
  F-­‐Actin	
  Flow..”	
  Neuron	
  14	
  (4)	
  (April):	
  763–771.	
   Lin,	
  D	
  M,	
  and	
  C	
  S	
  Goodman.	
  1994.	
  “Ectopic	
  and	
  Increased	
  Expression	
  of	
  Fasciclin	
  II	
   Alters	
  Motoneuron	
  Growth	
  Cone	
  Guidance..”	
  Neuron	
  13	
  (3)	
  (September):	
  507– 523.	
   Lin,	
  Yiing,	
  Gary	
  D	
  Stormo,	
  and	
  Paul	
  H	
  Taghert.	
  2004.	
  “The	
  Neuropeptide	
  Pigment-­‐ Dispersing	
  Factor	
  Coordinates	
  Pacemaker	
  Interactions	
  in	
  the	
  Drosophila	
   	
    66	
    Circadian	
  System..”	
  Journal	
  of	
  Neuroscience	
  24	
  (36)	
  (September	
  8):	
  7951–7957.	
   doi:10.1523/JNEUROSCI.2370-­‐04.2004.	
   Lokuta,	
  M	
  A,	
  P	
  A	
  Nuzzi,	
  and	
  A	
  Huttenlocher.	
  2003.	
  “Calpain	
  Regulates	
  Neutrophil	
   Chemotaxis..”	
  Proceedings	
  of	
  the	
  National	
  Academy	
  of	
  Sciences	
  of	
  the	
  United	
   States	
  of	
  America	
  100	
  (7)	
  (April	
  1):	
  4006–4011.	
  doi:10.1073/pnas.0636533100.	
   Lua,	
  Bee	
  Leng,	
  and	
  Boon	
  Chuan	
  Low.	
  2004.	
  “BPGAP1	
  Interacts	
  with	
  Cortactin	
  and	
   Facilitates	
  Its	
  Translocation	
  to	
  Cell	
  Periphery	
  for	
  Enhanced	
  Cell	
  Migration..”	
   Molecular	
  Biology	
  of	
  the	
  Cell	
  15	
  (6)	
  (June):	
  2873–2883.	
  doi:10.1091/mbc.E04-­‐ 02-­‐0141.	
   Lundgren,	
  S	
  E,	
  C	
  A	
  Callahan,	
  S	
  Thor,	
  and	
  J	
  B	
  Thomas.	
  1995.	
  “Control	
  of	
  Neuronal	
   Pathway	
  Selection	
  by	
  the	
  Drosophila	
  LIM	
  Homeodomain	
  Gene	
  Apterous..”	
   Development	
  (Cambridge,	
  England)	
  121	
  (6)	
  (June):	
  1769–1773.	
   Machesky,	
  L	
  M,	
  R	
  D	
  Mullins,	
  H	
  N	
  Higgs,	
  D	
  A	
  Kaiser,	
  L	
  Blanchoin,	
  R	
  C	
  May,	
  M	
  E	
  Hall,	
   and	
  T	
  D	
  Pollard.	
  1999.	
  “Scar,	
  a	
  WASp-­‐Related	
  Protein,	
  Activates	
  Nucleation	
  of	
   Actin	
  Filaments	
  by	
  the	
  Arp2/3	
  Complex..”	
  Proceedings	
  of	
  the	
  National	
  Academy	
   of	
  Sciences	
  of	
  the	
  United	
  States	
  of	
  America	
  96	
  (7)	
  (March	
  30):	
  3739–3744.	
   Martinez-­‐Quiles,	
  Narcisa,	
  Hsin-­‐Yi	
  Henry	
  Ho,	
  Marc	
  W	
  Kirschner,	
  Narayanaswamy	
   Ramesh,	
  and	
  Raif	
  S	
  Geha.	
  2004.	
  “Erk/Src	
  Phosphorylation	
  of	
  Cortactin	
  Acts	
  as	
  a	
   Switch	
  on-­‐Switch	
  Off	
  Mechanism	
  That	
  Controls	
  Its	
  Ability	
  to	
  Activate	
  N-­‐WASP..”	
   Molecular	
  and	
  Cellular	
  Biology	
  24	
  (12)	
  (June):	
  5269–5280.	
   doi:10.1128/MCB.24.12.5269-­‐5280.2004.	
   McNabb,	
  S	
  L,	
  J	
  D	
  Baker,	
  J	
  Agapite,	
  H	
  Steller,	
  L	
  M	
  Riddiford,	
  and	
  J	
  W	
  Truman.	
  1997.	
   “Disruption	
  of	
  a	
  Behavioral	
  Sequence	
  by	
  Targeted	
  Death	
  of	
  Peptidergic	
  Neurons	
   in	
  Drosophila..”	
  Neuron	
  19	
  (4)	
  (October):	
  813–823.	
   McNiven,	
  M	
  A,	
  L	
  Kim,	
  E	
  W	
  Krueger,	
  J	
  D	
  Orth,	
  H	
  Cao,	
  and	
  T	
  W	
  Wong.	
  2000.	
  “Regulated	
   Interactions	
  Between	
  Dynamin	
  and	
  the	
  Actin-­‐Binding	
  Protein	
  Cortactin	
   Modulate	
  Cell	
  Shape..”	
  The	
  Journal	
  of	
  Cell	
  Biology	
  151	
  (1)	
  (October	
  2):	
  187–198.	
   Melloni,	
  E,	
  M	
  Michetti,	
  F	
  Salamino,	
  R	
  Minafra,	
  and	
  S	
  Pontremoli.	
  1996.	
  “Modulation	
   of	
  the	
  Calpain	
  Autoproteolysis	
  by	
  Calpastatin	
  and	
  Phospholipids..”	
  Biochemical	
   and	
  Biophysical	
  Research	
  Communications	
  229	
  (1)	
  (December	
  4):	
  193–197.	
   doi:10.1006/bbrc.1996.1779.	
   Mingorance-­‐Le	
  Meur,	
  Ana,	
  and	
  Timothy	
  P	
  O'Connor.	
  2009.	
  “Neurite	
  Consolidation	
  Is	
   an	
  Active	
  Process	
  Requiring	
  Constant	
  Repression	
  of	
  Protrusive	
  Activity..”	
  The	
   EMBO	
  Journal	
  28	
  (3)	
  (February	
  4):	
  248–260.	
  doi:10.1038/emboj.2008.265.	
   Mizutani,	
  Kiyohito,	
  Hiroaki	
  Miki,	
  Hong	
  He,	
  Hiroshi	
  Maruta,	
  and	
  Tadaomi	
  Takenawa.	
   2002.	
  “Essential	
  Role	
  of	
  Neural	
  Wiskott-­‐Aldrich	
  Syndrome	
  Protein	
  in	
  Podosome	
   Formation	
  and	
  Degradation	
  of	
  Extracellular	
  Matrix	
  in	
  Src-­‐Transformed	
   	
    67	
    Fibroblasts..”	
  Cancer	
  Research	
  62	
  (3)	
  (February	
  1):	
  669–674.	
   Molinari,	
  M,	
  J	
  Anagli,	
  and	
  E	
  Carafoli.	
  1995.	
  “PEST	
  Sequences	
  Do	
  Not	
  Influence	
   Substrate	
  Susceptibility	
  to	
  Calpain	
  Proteolysis..”	
  The	
  Journal	
  of	
  Biological	
   Chemistry	
  270	
  (5)	
  (February	
  3):	
  2032–2035.	
   Nakagawa,	
  T,	
  and	
  J	
  Yuan.	
  2000.	
  “Cross-­‐Talk	
  Between	
  Two	
  Cysteine	
  Protease	
   Families.	
  Activation	
  of	
  Caspase-­‐12	
  by	
  Calpain	
  in	
  Apoptosis..”	
  The	
  Journal	
  of	
  Cell	
   Biology	
  150	
  (4)	
  (August	
  21):	
  887–894.	
   Neumüller,	
  Ralph	
  A,	
  Constance	
  Richter,	
  Anja	
  Fischer,	
  Maria	
  Novatchkova,	
  Klaus	
  G	
   Neumüller,	
  and	
  Juergen	
  A	
  Knoblich.	
  2011.	
  “Genome-­‐Wide	
  Analysis	
  of	
  Self-­‐ Renewal	
  in	
  Drosophila	
  Neural	
  Stem	
  Cells	
  by	
  Transgenic	
  RNAi..”	
  Cell	
  Stem	
  Cell	
  8	
   (5)	
  (May	
  6):	
  580–593.	
  doi:10.1016/j.stem.2011.02.022.	
   Palecek,	
  S	
  P,	
  A	
  Huttenlocher,	
  A	
  F	
  Horwitz,	
  and	
  D	
  A	
  Lauffenburger.	
  1998.	
  “Physical	
   and	
  Biochemical	
  Regulation	
  of	
  Integrin	
  Release	
  During	
  Rear	
  Detachment	
  of	
   Migrating	
  Cells..”	
  Journal	
  of	
  Cell	
  Science	
  111	
  (	
  Pt	
  7)	
  (April):	
  929–940.	
   Patel,	
  A	
  S,	
  G	
  L	
  Schechter,	
  W	
  J	
  Wasilenko,	
  and	
  K	
  D	
  Somers.	
  1998.	
  “Overexpression	
  of	
   EMS1/Cortactin	
  in	
  NIH3T3	
  Fibroblasts	
  Causes	
  Increased	
  Cell	
  Motility	
  and	
   Invasion	
  in	
  Vitro..”	
  Oncogene	
  16	
  (25)	
  (June	
  25):	
  3227–3232.	
   doi:10.1038/sj.onc.1201850.	
   Perrin,	
  Benjamin	
  J,	
  Kurt	
  J	
  Amann,	
  and	
  Anna	
  Huttenlocher.	
  2006.	
  “Proteolysis	
  of	
   Cortactin	
  by	
  Calpain	
  Regulates	
  Membrane	
  Protrusion	
  During	
  Cell	
  Migration..”	
   Molecular	
  Biology	
  of	
  the	
  Cell	
  17	
  (1)	
  (January):	
  239–250.	
  doi:10.1091/mbc.E05-­‐ 06-­‐0488.	
   Pollard,	
  Thomas	
  D.	
  2007.	
  “Regulation	
  of	
  Actin	
  Filament	
  Assembly	
  by	
  Arp2/3	
   Complex	
  and	
  Formins..”	
  Annual	
  Review	
  of	
  Biophysics	
  and	
  Biomolecular	
  Structure	
   36:	
  451–477.	
  doi:10.1146/annurev.biophys.35.040405.101936.	
   Ponti,	
  A,	
  M	
  Machacek,	
  S	
  L	
  Gupton,	
  C	
  M	
  Waterman-­‐Storer,	
  and	
  G	
  Danuser.	
  2004.	
  “Two	
   Distinct	
  Actin	
  Networks	
  Drive	
  the	
  Protrusion	
  of	
  Migrating	
  Cells..”	
  Science	
  (New	
   York,	
  N.Y.)	
  305	
  (5691)	
  (September	
  17):	
  1782–1786.	
   doi:10.1126/science.1100533.	
   Potter,	
  D	
  A,	
  J	
  S	
  Tirnauer,	
  R	
  Janssen,	
  D	
  E	
  Croall,	
  C	
  N	
  Hughes,	
  K	
  A	
  Fiacco,	
  J	
  W	
  Mier,	
  M	
   Maki,	
  and	
  I	
  M	
  Herman.	
  1998.	
  “Calpain	
  Regulates	
  Actin	
  Remodeling	
  During	
  Cell	
   Spreading..”	
  The	
  Journal	
  of	
  Cell	
  Biology	
  141	
  (3)	
  (May	
  4):	
  647–662.	
   Reinecke,	
  J	
  B,	
  DeVos,	
  S	
  L,	
  McGrath,	
  J	
  P,	
  Shepard,	
  A	
  M,	
  Goncharoff,	
  D	
  K,	
  Fleming,	
  S	
  R,	
   Vincent,	
  M	
  P,	
  Steinhilb.	
  2011.	
  "Implicating	
  Calpain	
  in	
  Tau-­‐Mediated	
  Toxicity	
  In	
   Vivo."	
  Public	
  Library	
  of	
  Science	
  6(8):e23865.	
   Ridley,	
  A	
  J,	
  and	
  A	
  Hall.	
  1992.	
  “Distinct	
  Patterns	
  of	
  Actin	
  Organization	
  Regulated	
  by	
   	
    68	
    the	
  Small	
  GTP-­‐Binding	
  Proteins	
  Rac	
  and	
  Rho..”	
  Cold	
  Spring	
  Harbor	
  Symposia	
  on	
   Quantitative	
  Biology	
  57:	
  661–671.	
   Ridley,	
  Anne	
  J,	
  Martin	
  A	
  Schwartz,	
  Keith	
  Burridge,	
  Richard	
  A	
  Firtel,	
  Mark	
  H	
  Ginsberg,	
   Gary	
  Borisy,	
  J	
  Thomas	
  Parsons,	
  and	
  Alan	
  Rick	
  Horwitz.	
  2003.	
  “Cell	
  Migration:	
   Integrating	
  Signals	
  From	
  Front	
  to	
  Back..”	
  Science	
  (New	
  York,	
  N.Y.)	
  302	
  (5651)	
   (December	
  5):	
  1704–1709.	
  doi:10.1126/science.1092053.	
   Roberts-­‐Lewis,	
  J	
  M,	
  M	
  J	
  Savage,	
  V	
  R	
  Marcy,	
  L	
  R	
  Pinsker,	
  and	
  R	
  Siman.	
  1994.	
   "Immunolocalization	
  of	
  calpain	
  I-­‐mediated	
  spectrin	
  degradation	
  to	
  vulnerable	
   neurons	
  in	
  the	
  ischemic	
  gerbil	
  brain."	
  Journal	
  of	
  Neuroscience	
  14:	
  3932-­‐3944.	
   Robles,	
  Estuardo,	
  Anna	
  Huttenlocher,	
  and	
  Timothy	
  M	
  Gomez.	
  2003.	
  “Filopodial	
   Calcium	
  Transients	
  Regulate	
  Growth	
  Cone	
  Motility	
  and	
  Guidance	
  Through	
  Local	
   Activation	
  of	
  Calpain..”	
  Neuron	
  38	
  (4)	
  (May	
  22):	
  597–609.	
  doi:10.1091/mbc.E05.	
   Ruiz-­‐Vela,	
  A,	
  G	
  González	
  de	
  Buitrago,	
  and	
  C	
  Martínez-­‐A.	
  1999.	
  “Implication	
  of	
   Calpain	
  in	
  Caspase	
  Activation	
  During	
  B	
  Cell	
  Clonal	
  Deletion..”	
  The	
  EMBO	
  Journal	
   18	
  (18)	
  (September	
  15):	
  4988–4998.	
  doi:10.1093/emboj/18.18.4988.	
   Sasaki,	
  T,	
  T	
  Kikuchi,	
  N	
  Yumoto,	
  N	
  Yoshimura,	
  and	
  T	
  Murachi.	
  1984.	
  “Comparative	
   Specificity	
  and	
  Kinetic	
  Studies	
  on	
  Porcine	
  Calpain	
  I	
  and	
  Calpain	
  II	
  with	
  Naturally	
   Occurring	
  Peptides	
  and	
  Synthetic	
  Fluorogenic	
  Substrates..”	
  The	
  Journal	
  of	
   Biological	
  Chemistry	
  259	
  (20)	
  (October	
  25):	
  12489–12494.	
   Satish,	
  Latha,	
  Harry	
  C	
  Blair,	
  Angela	
  Glading,	
  and	
  Alan	
  Wells.	
  2005.	
  “Interferon-­‐ Inducible	
  Protein	
  9	
  (CXCL11)-­‐Induced	
  Cell	
  Motility	
  in	
  Keratinocytes	
  Requires	
   Calcium	
  Flux-­‐Dependent	
  Activation	
  of	
  Mu-­‐Calpain..”	
  Molecular	
  and	
  Cellular	
   Biology	
  25	
  (5)	
  (March):	
  1922–1941.	
  doi:10.1128/MCB.25.5.1922-­‐1941.2005.	
   Shiraha,	
  Hidenori,	
  Angela	
  Glading,	
  Jeffrey	
  Chou,	
  Zongchao	
  Jia,	
  and	
  Alan	
  Wells.	
  2002.	
   “Activation	
  of	
  M-­‐Calpain	
  (Calpain	
  II)	
  by	
  Epidermal	
  Growth	
  Factor	
  Is	
  Limited	
  by	
   Protein	
  Kinase	
  a	
  Phosphorylation	
  of	
  M-­‐Calpain..”	
  Molecular	
  and	
  Cellular	
  Biology	
   22	
  (8)	
  (April):	
  2716–2727.	
   Siddique,	
  Yasir	
  Hasan,	
  Gulshan	
  Ara,	
  Smita	
  Jyoti,	
  and	
  Mohammad	
  Afzal.	
  2012.	
  “The	
   Dietary	
  Supplementation	
  of	
  Nordihydroguaiaretic	
  Acid	
  (NDGA)	
  Delayed	
  the	
   Loss	
  of	
  Climbing	
  Ability	
  in	
  Drosophila	
  Model	
  of	
  Parkinson's	
  Disease..”	
  Journal	
  of	
   Dietary	
  Supplements	
  9	
  (1)	
  (March):	
  1–8.	
  doi:10.3109/19390211.2011.630716.	
   Small,	
  J	
  V.	
  1988.	
  “The	
  Actin	
  Cytoskeleton..”	
  Electron	
  Microscopy	
  Reviews	
  1	
  (1):	
  155– 174.	
   Somogyi,	
  Kálmán,	
  and	
  Pernille	
  Rørth.	
  2004.	
  “Cortactin	
  Modulates	
  Cell	
  Migration	
  and	
   Ring	
  Canal	
  Morphogenesis	
  During	
  Drosophila	
  Oogenesis..”	
  Mechanisms	
  of	
   Development	
  121	
  (1)	
  (January):	
  57–64.	
   	
    69	
    Sorimachi,	
  H,	
  T	
  C	
  Saido,	
  and	
  K	
  Suzuki.	
  1994.	
  “New	
  Era	
  of	
  Calpain	
  Research.	
   Discovery	
  of	
  Tissue-­‐Specific	
  Calpains..”	
  FEBS	
  Letters	
  343	
  (1)	
  (April	
  18):	
  1–5.	
   Sorimachi,	
  Hiroyuki,	
  Shoji	
  Hata,	
  and	
  Yasuko	
  Ono.	
  2011.	
  “Calpain	
  Chronicle-­‐-­‐an	
   Enzyme	
  Family	
  Under	
  Multidisciplinary	
  Characterization..”	
  Proceedings	
  of	
  the	
   Japan	
  Academy,	
  Series	
  B	
  87	
  (6):	
  287–327.	
   Spencer,	
  Tim,	
  and	
  Marie	
  T	
  Filbin.	
  2004.	
  “A	
  Role	
  for	
  cAMP	
  in	
  Regeneration	
  of	
  the	
   Adult	
  Mammalian	
  CNS..”	
  Journal	
  of	
  Anatomy	
  204	
  (1)	
  (January):	
  49–55.	
   doi:10.1111/j.1469-­‐7580.2004.00259.x.	
   Stewart,	
  B	
  A,	
  H	
  L	
  Atwood,	
  J	
  J	
  Renger,	
  J	
  Wang,	
  and	
  C	
  F	
  Wu.	
  1994.	
  “Improved	
  Stability	
   of	
  Drosophila	
  Larval	
  Neuromuscular	
  Preparations	
  in	
  Haemolymph-­‐Like	
   Physiological	
  Solutions..”	
  Journal	
  of	
  Comparative	
  Physiology.	
  a,	
  Sensory,	
  Neural,	
   and	
  Behavioral	
  Physiology	
  175	
  (2)	
  (August):	
  179–191.	
   Strobl,	
  S,	
  C	
  Fernandez-­‐Catalan,	
  M	
  Braun,	
  R	
  Huber,	
  H	
  Masumoto,	
  K	
  Nakagawa,	
  A	
  Irie,	
   et	
  al.	
  2000.	
  “The	
  Crystal	
  Structure	
  of	
  Calcium-­‐Free	
  Human	
  M-­‐Calpain	
  Suggests	
   an	
  Electrostatic	
  Switch	
  Mechanism	
  for	
  Activation	
  by	
  Calcium..”	
  Proceedings	
  of	
   the	
  National	
  Academy	
  of	
  Sciences	
  of	
  the	
  United	
  States	
  of	
  America	
  97	
  (2)	
  (January	
   18):	
  588–592.	
   Theopold,	
  U,	
  M	
  Pintér,	
  S	
  Daffre,	
  Y	
  Tryselius,	
  P	
  Friedrich,	
  D	
  R	
  Nässel,	
  and	
  D	
  Hultmark.	
   1995.	
  “CalpA,	
  a	
  Drosophila	
  Calpain	
  Homolog	
  Specifically	
  Expressed	
  in	
  a	
  Small	
   Set	
  of	
  Nerve,	
  Midgut,	
  and	
  Blood	
  Cells..”	
  Molecular	
  and	
  Cellular	
  Biology	
  15	
  (2)	
   (February):	
  824–834.	
   Tompa,	
  P.	
  2004.	
  “On	
  the	
  Sequential	
  Determinants	
  of	
  Calpain	
  Cleavage.”	
  Journal	
  of	
   Biological	
  Chemistry	
  279	
  (20)	
  (March	
  15):	
  20775–20785.	
   doi:10.1074/jbc.M313873200.	
   Tompa,	
  P,	
  Y	
  Emori,	
  H	
  Sorimachi,	
  K	
  Suzuki,	
  and	
  P	
  Friedrich.	
  2001.	
  “Domain	
  III	
  of	
   Calpain	
  Is	
  a	
  Ca2+-­‐Regulated	
  Phospholipid-­‐Binding	
  Domain..”	
  Biochemical	
  and	
   Biophysical	
  Research	
  Communications	
  280	
  (5)	
  (February	
  9):	
  1333–1339.	
   doi:10.1006/bbrc.2001.4279.	
   Uruno,	
  T,	
  J	
  Liu,	
  P	
  Zhang,	
  Fan	
  Yx,	
  C	
  Egile,	
  R	
  Li,	
  S	
  C	
  Mueller,	
  and	
  X	
  Zhan.	
  2001.	
   “Activation	
  of	
  Arp2/3	
  Complex-­‐Mediated	
  Actin	
  Polymerization	
  by	
  Cortactin..”	
   Nature	
  Cell	
  Biology	
  3	
  (3)	
  (March):	
  259–266.	
  doi:10.1038/35060051.	
   Uruno,	
  Takehito,	
  Jiali	
  Liu,	
  Yansong	
  Li,	
  Nicole	
  Smith,	
  and	
  Xi	
  Zhan.	
  2003.	
  “Sequential	
   Interaction	
  of	
  Actin-­‐Related	
  Proteins	
  2	
  and	
  3	
  (Arp2/3)	
  Complex	
  with	
  Neural	
   Wiscott-­‐Aldrich	
  Syndrome	
  Protein	
  (N-­‐WASP)	
  and	
  Cortactin	
  During	
  Branched	
   Actin	
  Filament	
  Network	
  Formation..”	
  The	
  Journal	
  of	
  Biological	
  Chemistry	
  278	
   (28)	
  (July	
  11):	
  26086–26093.	
  doi:10.1074/jbc.M301997200.	
   Weaver,	
  A	
  M,	
  A	
  V	
  Karginov,	
  A	
  W	
  Kinley,	
  S	
  A	
  Weed,	
  Y	
  Li,	
  J	
  T	
  Parsons,	
  and	
  J	
  A	
  Cooper.	
   	
    70	
    2001.	
  “Cortactin	
  Promotes	
  and	
  Stabilizes	
  Arp2/3-­‐Induced	
  Actin	
  Filament	
   Network	
  Formation..”	
  Current	
  Biology	
  :	
  CB	
  11	
  (5)	
  (March	
  6):	
  370–374.	
   Weaver,	
  Alissa	
  M,	
  John	
  E	
  Heuser,	
  Andrei	
  V	
  Karginov,	
  Wei-­‐lih	
  Lee,	
  J	
  Thomas	
  Parsons,	
   and	
  John	
  A	
  Cooper.	
  2002.	
  “Interaction	
  of	
  Cortactin	
  and	
  N-­‐WASp	
  with	
  Arp2/3	
   Complex..”	
  Current	
  Biology	
  :	
  CB	
  12	
  (15)	
  (August	
  6):	
  1270–1278.	
   Weed,	
  S	
  A,	
  A	
  V	
  Karginov,	
  D	
  A	
  Schafer,	
  A	
  M	
  Weaver,	
  A	
  W	
  Kinley,	
  J	
  A	
  Cooper,	
  and	
  J	
  T	
   Parsons.	
  2000.	
  “Cortactin	
  Localization	
  to	
  Sites	
  of	
  Actin	
  Assembly	
  in	
  Lamellipodia	
   Requires	
  Interactions	
  with	
  F-­‐Actin	
  and	
  the	
  Arp2/3	
  Complex..”	
  The	
  Journal	
  of	
  Cell	
   Biology	
  151	
  (1)	
  (October	
  2):	
  29–40.	
   Welch,	
  Matthew	
  D,	
  and	
  R	
  Dyche	
  Mullins.	
  2002.	
  “Cellular	
  Control	
  of	
  Actin	
   Nucleation..”	
  Annual	
  Review	
  of	
  Cell	
  and	
  Developmental	
  Biology	
  18:	
  247–288.	
   doi:10.1146/annurev.cellbio.18.040202.112133.	
   Wendt,	
  Amanda,	
  Valery	
  F	
  Thompson,	
  and	
  Darrel	
  E	
  Goll.	
  2004.	
  “Interaction	
  of	
   Calpastatin	
  with	
  Calpain:	
  a	
  Review..”	
  Biological	
  Chemistry	
  385	
  (6)	
  (June):	
  465– 472.	
  doi:10.1515/BC.2004.054.	
   Wu,	
  H,	
  A	
  B	
  Reynolds,	
  S	
  B	
  Kanner,	
  R	
  R	
  Vines,	
  and	
  J	
  T	
  Parsons.	
  1991.	
  “Identification	
   and	
  Characterization	
  of	
  a	
  Novel	
  Cytoskeleton-­‐Associated	
  Pp60src	
  Substrate..”	
   Molecular	
  and	
  Cellular	
  Biology	
  11	
  (10)	
  (October):	
  5113–5124.	
   Wu,	
  H,	
  and	
  J	
  T	
  Parsons.	
  1993.	
  “Cortactin,	
  an	
  80/85-­‐Kilodalton	
  Pp60src	
  Substrate,	
  Is	
   a	
  Filamentous	
  Actin-­‐Binding	
  Protein	
  Enriched	
  in	
  the	
  Cell	
  Cortex..”	
  The	
  Journal	
  of	
   Cell	
  Biology	
  120	
  (6)	
  (March):	
  1417–1426.	
   Wu,	
  Hai-­‐Yan,	
  and	
  David	
  R	
  Lynch.	
  2006.	
  “Calpain	
  and	
  Synaptic	
  Function..”	
  Molecular	
   Neurobiology	
  33	
  (3)	
  (June):	
  215–236.	
  doi:10.1385/MN:33:3:215.	
   Yamada,	
  K	
  M,	
  B	
  S	
  Spooner,	
  and	
  N	
  K	
  Wessells.	
  1971.	
  “Ultrastructure	
  and	
  Function	
  of	
   Growth	
  Cones	
  and	
  Axons	
  of	
  Cultured	
  Nerve	
  Cells..”	
  The	
  Journal	
  of	
  Cell	
  Biology	
  49	
   (3)	
  (June):	
  614–635.	
   Zhang,	
  Xiaohong,	
  Zhigang	
  Yuan,	
  Yingtao	
  Zhang,	
  Sarah	
  Yong,	
  Alexis	
  Salas-­‐Burgos,	
   John	
  Koomen,	
  Nancy	
  Olashaw,	
  et	
  al.	
  2007.	
  “HDAC6	
  Modulates	
  Cell	
  Motility	
  by	
   Altering	
  the	
  Acetylation	
  Level	
  of	
  Cortactin..”	
  Molecular	
  Cell	
  27	
  (2)	
  (July	
  20):	
  197– 213.	
  doi:10.1016/j.molcel.2007.05.033.	
   	
   	
    	
    71	
    

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0073180/manifest

Comment

Related Items