UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The role of PXL-1 and CPNA-1 in the organization of muscle adhesion complexes in Caenorhabditis elegans… Warner, Adam Dennis 2012

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2012_fall_warner_adam.pdf [ 3.9MB ]
Metadata
JSON: 24-1.0073171.json
JSON-LD: 24-1.0073171-ld.json
RDF/XML (Pretty): 24-1.0073171-rdf.xml
RDF/JSON: 24-1.0073171-rdf.json
Turtle: 24-1.0073171-turtle.txt
N-Triples: 24-1.0073171-rdf-ntriples.txt
Original Record: 24-1.0073171-source.json
Full Text
24-1.0073171-fulltext.txt
Citation
24-1.0073171.ris

Full Text

THE ROLE OF PXL-1 AND CPNA-1 IN THE ORGANIZATION OF MUSCLE ADHESION COMPLEXES IN CAENORHABDITIS ELEGANS MUSCLE by Adam Dennis Warner B.Sc., The University of British Columbia, 2002 M.Sc, The University of British Columbia, 2007 A THESIS SUBMITTED IN PARTIAL FULLFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOHY in THE FACULTY OF GRADUATE STUDIES  (Zoology) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) September 2012 ©Adam Dennis Warner, 2012  ABSTRACT C. elegans is an excellent model organism for the study of muscle development and maintenance, but we lack a full catalog of genes involved and their specific roles. I have identified and characterized two novel genes, pxl-1 which is essential in C. elegans pharyngeal muscle and cpna-1 which is essential in body wall muscle. PXL-1 is the C. elegans homolog of vertebrate paxillin and contains the four C-terminal LIM domains conserved in paxillin across all species and three of the five LD motifs found in the Nterminal half of most paxillins. PXL-1 antibodies and a full-length GFP translational fusion localize to muscle adhesion sites in the sarcomere, the functional repeat unit in muscle responsible for contraction. In pharyngeal muscle, PXL-1 localizes to ring-shaped structures near the sarcolemma corresponding to podosome-like sites of actin attachment. Loss of paxillin results in lack of pharyngeal contraction, developmental arrest, and lethality. Expression of paxillin solely in the pharynx results in wild type in movement and body wall muscle structure. This demonstrates that in pharyngeal muscle PXL-1 is essential for contraction, whereas in body wall muscle it is dispensable for filament assembly, sarcomere stability, and ultimately movement. CPNA-1 is a copine domain protein essential for myofilament stability and viability in C. elegans. Worms lacking cpna-1 arrest at the two-fold stage of embryogenesis and have disruption of the myofilament lattice. CPNA-1 contains an Nterminal trans-membrane domain, and a copine domain near its C-terminal. Both a GFP translational fusion and antibody specific to CPNA-1 localize to muscle adhesion sites in body wall muscle. CPNA-1 also binds to components of muscle adhesion sites including UNC-89 (obscurin), and the essential muscle protein PAT-6 (actopaxin), which CPNA-1 requires for localization. The essential MYO-3 (heavy chain myosin) protein is initially localized normally in cpna-1 null animals, but becomes mislocalized as contraction begins indicating CPNA-1 is not required for initial assembly of the sarcomere, but is required to maintain structural stability through development. Together, the characterization of PXL-1 and CPNA-1 provide new insight into the organization of muscle adhesion sites in Caenorhabditis elegans.  ii  PREFACE Chapter 1. Figures 1.2, 1.3, 1.4, and 1.5 are used with permission from applicable sources. Portions of the introductory text are used with permission from Meissner et al. (2009) of which I am an author. I created Table 1.1, which is modified from Supplementary Table 3 in Meissner et al. (2009). Portions of the introductory text are also modified from previously written introductory material from my masters thesis entitled “Identification of Novel Genes Affecting Body Wall Muscle in Caenorhabditis elegans” (2007) completed at the University of British Columbia.  Chapter 2. A version of this material has been published as Warner, A.D., Qadota H., Benian G., Vogl, A.W., and Moerman D.G. (2011). The Caenorhabditis elegans paxillin orthologue, PXL-1, is required for pharyngeal muscle contraction and for viability. Molecular Biology of the Cell. Jul 15;22(14):2551-63. Hiroshi Qadota and Guy Benian (Emory University, Atlanta, USA) provided data relating to protein interactions including yeast two-hybrid and protein binding assays in Figures 2.4 (A, B, D), 2.6 and 2.7. Hiroshi Qadota and Guy Benian also provided Figure 2.8 and the corresponding data. Electron microscopy imaging was provided by Wayne Vogl (University of British Columbia, Vancouver, Canada), as seen in Figures 2.5 and 2.9. I performed all additional experiments. Don Moerman and I conceived the experiments and I wrote the manuscript for the published paper.  iii  Chapter 3. A portion of this material has been published as Meissner, B., Warner, A., Wong, K., Dube, N., Lorch, A., McKay, S.J., Khattra, J., Rogalski, T., Somasiri, A., Chaudhry, I., Fox, R.M., Miller, D.M., 3rd, Baillie, D.L., Holt, R.A., Jones, S.J., Marra, M.A., and Moerman, D.G. (2009). An integrated strategy to study muscle development and myofilament structure in Caenorhabditis elegans. PLoS Genetics 5, e1000537. I performed all FACS sorting of muscle cells outlined in Figure 1, as well as analysis of the data shown in Figure 3 in Meissner et al. (2009). The liquid culture RNAi screen outlined in Figure 4 was performed primarily by me, with help from Aruna Somasiri, Teresa Rogalski, and Iasha Chaudhry. All data provided in Figure 4 of Meissner et al. (2009) was performed by me. The data shown in Figure 4 is included in this thesis, and is labelled as Figure 3.8, as well as supplementary Figure 3, which I originally made, and is modified and included in this as Table 1. Figure 3.8 has been included to indicate the importance of the experiments I performed that led to the discovery of cpna-1 as a novel essential muscle gene. The remainder of this chapter has been submitted for publication as Warner A.D. *, Xiong G.*, Qadota, H, Rogalski, T.M., Moerman D.G., Benian G.M. CPNA-1, a copine domain protein, is essential for myofilament stability at integrin adhesion sites in C. elegans. Stars indicate that I am a co-first author with G. Xiong. I created Figures 3.1, 3.3, 3.4, the previously mentioned 3.8, and 3.11, and performed all experiments for the data found within. Teresa Rogalski transformed C. elegans with the GFP translational fusion shown in Figure 3.3. All other experiments were performed by Ge Xiong (Emory University, Atlanta, USA), Hiroshi Qadota and Guy Benian. Don Moerman and I conceived experiments and contributed to writing the manuscript for the submitted paper.  iv  TABLE OF CONTENTS ABSTRACT ................................................................................................................................. ii	
   PREFACE................................................................................................................................... iii	
   TABLE OF CONTENTS ........................................................................................................... v	
   LIST OF TABLES ..................................................................................................................... ix	
   LIST OF FIGURES .................................................................................................................... x	
   LIST OF ABBREVIATIONS .................................................................................................. xii	
   ACKNOWLEDGEMENTS .................................................................................................... xiv	
   DEDICATION .......................................................................................................................... xv	
   1.	
   INTRODUCTION ............................................................................................................... 1	
   1.1 C. elegans as a model organism ........................................................................................... 1	
   1.2 C. elegans body wall muscle organization ........................................................................... 2	
   1.3 Comparison of C. elegans body wall muscle and vertebrate muscle .................................. 7	
   1.4 Epistatic pathway for building muscle attachment complexes ......................................... 15	
   1.5 Single sarcomere muscle cells in C. elegans...................................................................... 19	
   1.6 Thesis objectives .................................................................................................................. 23	
   2.	
   THE C. ELEGANS PAXILLIN ORTHOLOG, PXL-1, IS REQUIRED FOR PHARYNGEAL MUSCLE CONTRACTION AND FOR VIABILITY ............................. 24	
    v  2.1 Synopsis ............................................................................................................................... 24	
   2.2 Introduction......................................................................................................................... 25	
   2.3 Methods ............................................................................................................................... 28	
   2.3.1	
  Strains	
  .................................................................................................................................................................	
  28	
   2.3.2	
  Production	
  of	
  ok1483-­‐rescuing	
  GFP	
  translational	
  fusions	
  ...........................................................	
  28	
   2.3.3	
  Construction	
  of	
  a	
  Gateway	
  GFP	
  translational	
  fusion	
  ......................................................................	
  29	
   2.3.4	
  Identification	
  of	
  pxl-­1	
  splice	
  isoforms	
  ...................................................................................................	
  29	
   2.3.5	
  Isolation	
  of	
  a	
  full-­‐length	
  pxl-­1a	
  cDNA	
  ....................................................................................................	
  29	
   2.3.6	
  Microinjection	
  procedure	
  ...........................................................................................................................	
  30	
   2.3.7	
  RNAi	
  feeding	
  .....................................................................................................................................................	
  30	
   2.3.8	
  Antibody	
  production	
  .....................................................................................................................................	
  31	
   2.3.9	
  Yeast	
  two-­‐hybrid	
  method	
  ...........................................................................................................................	
  32	
   2.3.10	
  HA-­‐pulldown	
  assay	
  .....................................................................................................................................	
  32	
   2.3.11	
  Immunostaining	
  ...........................................................................................................................................	
  32	
   2.3.12	
  Microscopic	
  analysis	
  ..................................................................................................................................	
  34	
   2.3.13	
  TEM	
  microscopy	
  ..........................................................................................................................................	
  34	
    2.4 Results ................................................................................................................................. 36	
   2.4.1	
  pxl-­1	
  encodes	
  3	
  splice	
  variants	
  of	
  paxillin	
  ...........................................................................................	
  36	
   2.4.2	
  pxl-­1	
  mutant	
  animals	
  die	
  as	
  young	
  larvae	
  ...........................................................................................	
  40	
   2.4.3	
  Isoform	
  diversity	
  leads	
  to	
  differential	
  sub-­‐cellular	
  location	
  and	
  tissue	
  expression	
   of	
  paxillin	
  ...........................................................................................................................................................	
  43	
   2.4.4	
  Pharyngeal	
  muscle	
  pxl-­1	
  rescue	
  ...............................................................................................................	
  47	
   2.4.5	
  PXL-­‐1	
  LIM	
  domains	
  are	
  sufficient	
  for	
  proper	
  localization	
  in	
  body	
  wall	
  muscle	
  .................	
  50	
   2.4.6	
  PXL-­‐1	
  interacts	
  with	
  DEB-­‐1/vinculin,	
  UIG-­‐1,	
  LIM-­‐8,	
  UNC-­‐96	
  and	
  UNC-­‐95	
  ...........................	
  50	
   2.4.7	
  Comparing	
  protein-­‐protein	
  interactions	
  with	
  genetic	
  interactors	
  of	
  pxl-­1	
   demonstrates	
  unc-­95	
  is	
  necessary	
  for	
  pxl-­‐1	
  localization	
  in	
  body	
  wall	
  muscle.	
  ..................	
  54	
   2.4.8	
  LIM	
  domain	
  redundancy	
  in	
  body	
  wall	
  muscle?	
  .................................................................................	
  56	
   2.4.9	
  Localization	
  of	
  PXL-­‐1	
  interacting	
  proteins	
  in	
  body	
  wall	
  muscle	
  lacking	
  PXL-­‐1	
  ..................	
  58	
   2.4.10	
  Paxillin	
  is	
  localized	
  around	
  a	
  core	
  of	
  actin	
  filaments	
  in	
  pharyngeal	
  muscle	
  ......................	
  61	
    2.5 Discussion ........................................................................................................................... 64	
   2.5.1	
  The	
  pxl-­1	
  gene	
  in	
  C.	
  elegans	
  encodes	
  the	
  ortholog	
  of	
  human	
  paxillin	
  ......................................	
  64	
   2.5.2	
  Paxillin	
  is	
  required	
  in	
  the	
  pharynx	
  for	
  muscle	
  function	
  ................................................................	
  65	
   2.5.3	
  Paxillin’s	
  role	
  in	
  body	
  wall	
  muscle?	
  ........................................................................................................	
  66	
   2.5.4	
  Muscle	
  attachment	
  structures	
  in	
  C.	
  elegans	
  pharyngeal	
  muscle	
  are	
  structurally	
   similar	
  to	
  those	
  found	
  in	
  podosomes	
  ....................................................................................................	
  67	
    3.	
   CPNA-1, A COPINE DOMAIN PROTEIN, IS ESSENTIAL FOR MYOFILAMENT STABILITY AT INTEGRIN ADHESION SITES IN C. ELEGANS .................................................................................................................................. 70	
    vi  3.1 Synopsis ............................................................................................................................... 70	
   3.2 Introduction......................................................................................................................... 71	
   3.3 Materials and Methods ....................................................................................................... 76	
   3.3.1	
  Strains	
  used	
  .......................................................................................................................................................	
  76	
   3.3.2	
  Screening	
  of	
  yeast	
  two-­‐hybrid	
  library	
  ..................................................................................................	
  76	
   3.3.3	
  Construction	
  of	
  2-­‐hybrid	
  clones	
  covering	
  UNC-­‐89-­‐B	
  and	
  its	
  screening	
  with	
  CPNA-­‐ 1	
  .............................................................................................................................................................................	
  77	
   3.3.4	
  Screening	
  of	
  yeast	
  two-­‐hybrid	
  bookshelf	
  of	
  known	
  M-­‐line	
  and	
  dense	
  body	
   proteins	
  ..............................................................................................................................................................	
  78	
   3.3.5	
  Domain	
  mapping	
  of	
  UNC-­‐89	
  Ig1-­‐5,	
  SCPL-­‐1,	
  LIM-­‐9,	
  PAT-­‐6,	
  and	
  UNC-­‐96	
  ................................	
  78	
   3.3.6	
  Testing	
  for	
  interaction	
  of	
  UNC-­‐89	
  Ig1-­‐5	
  against	
  copine	
  domains	
  of	
  other	
  C.	
   elegans	
  proteins	
  ..............................................................................................................................................	
  79	
   3.3.7	
  Testing	
  for	
  interaction	
  of	
  UNC-­‐89	
  Ig1-­‐5	
  and	
  UNC-­‐96	
  (201-­‐418)	
  against	
  single	
   amino	
  acid	
  mutants	
  of	
  the	
  copine	
  domain	
  of	
  CPNA-­‐1	
  ....................................................................	
  79	
   3.3.8	
  Demonstration	
  of	
  interactions	
  using	
  purified	
  proteins	
  .................................................................	
  80	
   3.3.9	
  Generation	
  of	
  antibodies	
  to	
  CPNA-­‐1	
  ......................................................................................................	
  82	
   3.3.10	
  Western	
  blots	
  ................................................................................................................................................	
  83	
   3.3.11	
  Immunolocalization	
  in	
  adult	
  body	
  wall	
  muscle	
  ..............................................................................	
  83	
   3.3.12	
  RNAi	
  screen	
  for	
  essential	
  muscle	
  genes	
  in	
  liquid	
  culture	
  ..........................................................	
  84	
   3.3.13	
  RNAi	
  administered	
  post-­‐embryonically	
  ............................................................................................	
  85	
   3.3.14	
  Generation	
  and	
  characterization	
  of	
  antibodies	
  to	
  PAT-­‐6	
  ...........................................................	
  85	
   3.3.14	
  Localization	
  of	
  CPNA-­‐1	
  in	
  embryonic	
  muscle,	
  and	
  affect	
  of	
  various	
  Pat	
  mutants	
  ...........	
  86	
   3.3.15	
  Generation	
  of	
  a	
  translational	
  GFP	
  fusion	
  for	
  cpna-­1	
  ....................................................................	
  87	
   3.3.16	
  Yeast	
  3-­‐hybrid	
  assay	
  ..................................................................................................................................	
  87	
   3.3.17	
  Sequence	
  analysis	
  ........................................................................................................................................	
  87	
    3.4 Results ................................................................................................................................. 88	
   3.4.1	
  F31D5.3/CPNA-­‐1	
  is	
  an	
  “atypical”	
  copine	
  domain	
  containing	
  protein	
  .....................................	
  88	
   3.4.2	
  CPNA-­‐1	
  localizes	
  to	
  dense	
  body	
  and	
  M-­‐line	
  muscle	
  adhesion	
  complexes	
  and	
  is	
   required	
  for	
  maintenance	
  of	
  muscle	
  stability	
  ....................................................................................	
  92	
   3.4.3	
  CPNA-­‐1	
  acts	
  to	
  maintain	
  sarcomere	
  integrity	
  ...................................................................................	
  95	
   3.4.4	
  Identification	
  of	
  CPNA-­‐1	
  as	
  a	
  binding	
  partner	
  for	
  UNC-­‐89	
  .......................................................	
  101	
   3.4.5	
  CPNA-­‐1	
  interacts	
  with	
  additional	
  adhesion	
  complex	
  proteins	
  ...............................................	
  104	
   3.4.6	
  The	
  role	
  of	
  CPNA-­‐1	
  in	
  postembryonic	
  body	
  wall	
  muscle	
  ...........................................................	
  110	
    3.5 Discussion ......................................................................................................................... 116	
   3.5.1	
  A	
  model	
  for	
  CPNA-­‐1	
  in	
  maintenance	
  of	
  integrin	
  adhesion	
  complexes	
  ................................	
  116	
   3.5.2	
  New	
  classes	
  of	
  copine	
  domain	
  containing	
  proteins	
  .....................................................................	
  119	
   3.5.3	
  Copine	
  domain	
  containing	
  proteins	
  have	
  diverse	
  functions	
  in	
  C.	
  elegans	
  and	
  other	
   species	
  ..............................................................................................................................................................	
  120	
   3.5.4	
  Copine	
  domains	
  as	
  protein	
  interacting	
  modules	
  ...........................................................................	
  121	
   3.5.6	
  Summary	
  .........................................................................................................................................................	
  122	
    vii  4. CONCLUSION ................................................................................................................... 123	
   4.1 Identification of a paxillin homolog in the worm essential in pharyngeal muscle ........ 123	
   4.2 Rethinking the organization of pharyngeal muscle actin attachment complexes .......... 124	
   4.3 The role of paxillin in body wall muscle .......................................................................... 125	
   4.4 Identification of a novel essential body wall muscle gene, cpna-1 ................................. 125	
   4.5 CPNA-1 and it’s role in maintaining sarcomere stability ............................................... 126	
   4.6 Future directions ............................................................................................................... 127	
   BIBLIOGRAPHY ................................................................................................................... 129	
   APPENDIX .............................................................................................................................. 141	
   A.1 Supplemental data for Chapter 3 ..................................................................................... 141	
    viii  LIST OF TABLES Table 1.1 Known muscle affecting genes in Caenorhabditis elegans ......................... 10	
   Table 2.1 RNAi phenotypes of genes coding for LIM domain proteins in DM7335 animals lacking pxl-1 body wall muscle expression .................................. 57	
   Table A.1 Oligonucleotide PCR primers used for constructing the UNC-89 “bookshelf” ................................................................................................. 146	
   Table A.2 Oligonucleotide PCR primers used for other constructs ........................ 147	
   Table A.3 Proteins constituting the M-line/dense body “bookshelf” ...................... 148	
   Table A.4 RNAi screen results for unc-95 and unc-97 hypomorphic strains ......... 150	
    ix  LIST OF FIGURES Figure 1.1 Model of a C. elegans sarcomere ................................................................... 4	
   Figure 1.2 Muscle quadrant arrangement within the worm......................................... 6	
   Figure 1.3 Body wall muscle sarcomere orientation in C. elegans ............................ 13	
   Figure 1.4 Comparison of vertebrate focal adhesions and C. elegans dense bodies . 14	
   Figure 1.5 Assembly pathways for dense bodies and M-lines ..................................... 18	
   Figure 1.6 Organization of pharyngeal muscle in C. elegans..................................... 20	
   Figure 1.7 Structural organization of adhesion proteins in podosome-like structures ........................................................................................................................ 22	
   Figure 2.1 C. elegans paxillin (pxl-1) gene and protein models .................................. 37	
   Figure 2.2 Comparison of PXL-1 protein sequence with paxillin (H. sapiens) ........ 39	
   Figure 2.3 Phenotype of homozygous pxl-1 (ok1483) mutant animals, and subcellular localization of PXL-1::GFP translational fusion products .. 42	
   Figure 2.4 Confirmation of protein interactions and immunostaining with a PXL-1 antibody ........................................................................................................ 46	
   Figure 2.5 Body wall muscle in animals with pxl-1 expression restricted to the pharynx ......................................................................................................... 49	
   Figure 2.6 Protein interactions with PXL-1 ................................................................ 53	
   Figure 2.7 Localization of PXL-1 in the mutant background of binding partners.. 55	
   Figure 2.8 Localization of PXL-1 interacting proteins in body wall muscle lacking pxl-1 ............................................................................................................... 60	
   Figure 2.9 Actin attachment complexes in pharyngeal muscle.................................. 62	
   Figure 3.1 Gene model for cpna-1 and alignment of CPNA-1 with human and mouse homologs ....................................................................................................... 91	
   Figure 3.2 Immunolocalization of CPNA-1 to adult muscle M-lines and dense bodies ............................................................................................................. 94	
   Figure 3.3 Characterization of the cpna-1 null phenotype, and localization of CPNA-1::GFP in body wall muscle ............................................................ 98	
   Figure 3.4 Immunolocalization of CPNA-1 in the null background of essential body wall muscle genes ....................................................................................... 100	
   Figure 3.5 Ig domains 1-3 of UNC-89 interact with CPNA-1 .................................. 103	
   Figure 3.6 CPNA-1 interacts with four known M-line and one M-line/dense body protein ......................................................................................................... 107	
   Figure 3.7 Point mutation of the conserved residues in the copine domain of CPNA1 affects its binding to UNC-89 or UNC-96, and a ternary complex containing PAT-6, CPNA-1 and UNC-89................................................. 109	
   Figure 3.8 Postembryonic requirement for CPNA-1 in body wall muscle .............. 111	
   Figure 3.9 In adult muscle, PAT-6 and UNC-97 are needed for localization of CPNA-1 ....................................................................................................... 113	
   Figure 3.10 Analysis of mutants places the M-line proteins UNC-96, LIM-9 and SCPL-1 downstream of CPNA-1 in adult muscle ................................... 115	
   Figure 3.11 Model for CPNA-1 function in the assembly of integrin adhesion complexes .................................................................................................... 117	
   Figure A.1 Copine family proteins in C. elegans. ....................................................... 142	
    x  Figure A.2 Confirmation of interactions using purified proteins............................ 144	
   Figure A.3 A new anti-PAT-6 antibody detects a protein of expected size from a worm lysate. ................................................................................................ 145	
   Figure A.4 Venn diagram of genes with phenotypes N2 wild type worms, as well as unc-95, and unc-97 animals ....................................................................... 149	
    xi  LIST OF ABBREVIATIONS ºC % µg µl uM A-band ATN Bmd BSA cDNA CGC CPNA DABCO DEB dH20 Dim DL DMD DNA DR Dpy dsRNA ECL ECM EDTA EM Emb FACS FAK FN EST FAK FO GFP GST HA HRP I-band Ig IPTG kb KOH ILK  degrees Celsius percent microgram microlitre micromolar anisotropic band alpha-actinin protein (C. elegans) body morphology defect bovine serum albumen complementary DNA Caenorhabditis Genetics Center copine domain atypical 1,4-diazabicyclo[2.2.2]octane dense body protein distilled water disorganized muscle dorsal left Duchenne Muscular Dystrophy deoxyribonucleic acid dorsal right dumpy double stranded ribonucleic acid enhanced chemiluminescence extracellular matrix ethylenediaminetetraacetic acid electron microscope embryonic lethal fluorescence activated cell sorting focal adhesion kinase fibronectin expressed sequence tag focal adhesion kinase fibrous organelle green fluorescent protein glutathione S-transferase hyaluonan horse radish peroxidase isotropic band immunoglobulin isopropyl-beta-D-thiogalactopyranoside kilo base pairs sodium hydroxide integrin-linked kinase  xii  L1 LD motif LET LIM Lva Lvl M9 mg MBP mL mM M-lines Mup N ng NGM NP-40 ORF Pat PCR PHP PK pmol Prl PXL RISC RNA RNAi Rol SAGE SDS PAGE SQL Ste TAE TBS TEM TMHMM Unc UK USA UV VL VR WT Y2H Z-disc  larval stage 1 Leucine, Aspartic acid rich motif lethal lin-11 isl-1 mec-3 larval arrest larval lethal minimal media salt solution 9 milligram maltose-binding protein millilitre millimolar mittellinie muscle positioning defecive normal nanogram nematode growth medium nonyl phenoxypolyethoxylethanol open reading frame paralyzed arrested elongation at two fold polymerase chain reaction hypertext preprocessor protein kinase picomole paralyzed paxillin RNA-induced silencing complex ribonucleic acid RNA interference Roller serial analysis of gene expression sodium dodecyl sulfate polyacrylamide gel electrophoresis structured query language sterile tris-acetic acid-EDTA tris-buffered saline transmission electron microscopy TransMembrane prediction using Hidden Markov Models uncoordinated United Kingdom United States of America ultraviolet ventral left ventral right wild type yeast 2-hybrid zwischenscheibe disc  xiii  ACKNOWLEDGEMENTS Some strains used in this work were provided by the Caenorhabditis Genetics Center, supported by the National Center for Research Resources of the National Institutes of Health (USA). The C. elegans Gene Knockout Consortium provided the pxl1 knockout strain VC1012 and the cpna-1 knockout strain VC516. I would also like to thank Edward Hedgecock (John Hopkins University, Baltimore, USA) for use of the strain NJ0784 and David Hall and Zeynep Altun (Albert Einstein College of Medicine, NY, USA) for analysis of pxl-1 expression in the pharynx. This research was supported by grants from the Canadian Institute for Health Research and the National Science and Engineering Research Council of Canada to DGM (University of British Columbia, Vancouver, Canada), and grants AR051466 and AR052133 from the National Institutes of Health to GMB (Emory University, Atlanta, USA). DGM also received support from the Canadian Institute for Advanced Research as a research fellow. I would like to acknowledge the excellent guidance and input from my committee members: Linda Matsuuchi, Calvin Roskelley, and Vanessa Auld (University of British Columbia, Vancouver, Canada). My collaborators Guy Benian, Hiroshi Qadota, and Ge Xiong at Emory University, Atlanta, were a great help in proposing experiments and pushing the research forward. Wayne Vogl (University of British Columbia, Vancouver, Canada) was also a fantastic collaborator, helping to take and analyze EM images for Chapter 2, which provided key data. I would like the acknowledge the help from everyone in the Moerman lab, especially Barbara Meissner and Teresa Rogalski (University of British Columbia, Vancouver, Canada) who were key contributors to projects I worked on in the lab. Lastly I would like to acknowledge my supervisor Don Moerman for being an excellent mentor, for providing guidance, and giving me the freedom to carry out scientific research that was fun and interesting.  xiv  DEDICATION  My parents have always stressed the importance of education. They have been supportive every step of the way, from my first day at UBC, to this journey. One of the best things about completing this thesis and PhD is that I know I have made them proud. Thank you for everything Mom and Dad. Over the past five years, my wife Shannon and I have lived apart, with a border and three hours between us while Shannon completes her PhD at the University of Washington. Completing this thesis and degree would not have been possible without Shannon’s love support and encouragement. Shannon, I know you are not a fan of sappiness, but the best way to express how I feel is my wedding vow to you. “I love you for your honesty, your trust, and your heart. I love that you chase your dreams and I'm lucky that we found each other and grow closer year after year. I can't wait to spend the rest of my life with you.” Now we actually can spend the rest of our lives together. I love you.  For Shannon  xv  1. INTRODUCTION  1.1 C. elegans as a model organism  Muscle tissue is important for humans in a myriad of processes including movement, digestion, and the pumping of blood through the cardiovascular system. Afflictions that affect muscle can be debilitating in any of these processes. The underlying cause of many myopathies lies within the cells that make up muscle tissue. Specifically, defects in components of the functional repeat unit of muscle, the sarcomere, are implicated in over 20 diseases (Nowak et al., 2005). In order to aid the development of treatment for myopathies, a basic understanding is needed of how a muscle cell is developed, how all of the proteins that form a muscle cell are assembled, and how the structure of the sarcomere is maintained. C. elegans has proven to be an excellent model organism to answer the basic questions of how muscle is organized, and develops. C. elegans is a small roundworm that has many benefits for genetic and developmental research. It also has traits that will be outlined below that make it possible to study muscle in ways that are not possible in more complex systems. It is small (~1 mm at adulthood), cost effective to culture, has a short generation time (~ 3 days) and is semi-transparent which allows for detailed in vivo observation (Brenner, 1974). In addition, a fully sequenced genome and a large number of genetic tools in turn make the worm a powerful tool for many types of research. The production of a large number of mutations in genes by both individual labs, and the International C. elegans Gene Knockout Consortium are invaluable. The worm is an excellent model to study mammailian cell and tissue function. Over 40% of C. elegans genes have a human homolog (Ahringer, 1997; Blaxter, 1998), which enables us to gain insight into 1  gene function in C. elegans that should be applicable to the homologous gene function in humans and other mammals. A large community of researchers uses the worm to investigate a variety of particular developmental or genetic pathways, including the study of muscle development and structure. The study of mutations in key C. elegans muscle genes has laid much of the groundwork for what we now know about mammalian muscle structure and function (Epstein et al., 1974; MacLeod et al., 1977a; MacLeod et al., 1977b; Waterston et al., 1980; Zengel and Epstein, 1980). For example, the pioneering work on myosin heavy chain proteins was carried out in C. elegans (Epstein et al., 1974; MacLeod et al., 1977b). Building on studies first done in C. elegans and other model systems we now have at least a glimpse of how sarcomeres are initiated and assembled in all systems. As C. elegans develops, it proceeds through both embryonic stages, and five postembryonic larval stages. Initially, a gravid adult worm lays an egg containing a developing embryo and this embryo proceeds to develop within the eggshell. As the developing embryo proceeds through numerous cell divisions and growth, the embryo is folded over as it lengthens into what is called the 1.5-fold stage. At this point the developing muscle begins to contract and the animal continues to grow, eventually reaching a length that requires the worm to fold over upon itself fully, known as the two-fold stage. After further elongation, the worm becomes folded over three times upon itself and moves vigourously within the eggshell. After hatching from the eggshell, the worm then proceeds to go from the first larval stage (L1), through the second third and fourth larval stages (L2, L3, L4), and finally the adult stage. 1.2 C. elegans body wall muscle organization The smallest complete unit of the contractile machinery in muscle is called the sarcomere. In vertebrate skeletal muscle and C. elegans body wall muscle, the sarcomere  2  repeats, thus forming a chain of sarcomeres within a cell. Single sarcomere muscle cells are also present in the worm, and will be discussed in section 1.5. The sarcomere consists of anchored thick (myosin based) filaments, which pull against the interdigitated thin (actin based) filaments, which are also anchored, in order to contract the sarcomere and thus the muscle. Thin filaments are connected to the muscle cell membrane, or sarcolemma, by the dense body in C. elegans. The dense body is analogous to the Zwischenscheibe disc (Z-disc) in vertebrate skeletal muscle and shares many of the same components (reviewed in Moerman and Williams, 2006). The thick filaments are associated with the Mitteline (M-line) in both vertebrate and worm muscle, and the M-line links the thick filaments to the sarcolemma. One sarcomere is defined as the distance between two dense bodies/Z- discs. The area over which thick and thin filaments overlap is known as the anisotropic (A) band, and the portion of the thin filaments that do not overlap the thick filaments is known as the isotropic (I) band (Figure 1.1).  3  Figure 1.1 Model of a C. elegans sarcomere Attachment structures known as dense bodies and M-lines anchor thin and thick filaments respectively. Thin filaments are represented here by dark blue lines, while the thick filaments are represented by light blue lines associated with circular spheres symbolizing myosin motor proteins. Dense body and M-line anchoring complexes transmit force to the cuticle through association with hemidesmisome-like complexes in the hypodermis that are connected in turn to the cuticle by intermediate filaments.  4  In total, body wall muscle in C. elegans is comprised of 95 cells, divided into the ventral left (VL), ventral right (VR), dorsal left (DL), and dorsal right (DR) quadrants. The disbursement is equal between the VR, DL and DR quadrants, but the VL quadrant only has 23 cells (Sulston and Horvitz, 1977). Only 81 of these cells are present in a fully developed embryo prior to hatching, with the remaining 14 cells developing after hatching (Sulston et al., 1983). Post-embryonic growth of all muscle cells also occurs, extending the width from two A-bands to ten A-bands by the time a nematode reaches the adult stage (Mackenzie et al., 1978). Each of these 95 cells is oriented in a flattened formation within each quadrant (Figure 1.2), with the hypodermis and outer cuticle encompassing the muscle mass (Hresko et al., 1994). An ovoid flat muscle cell shape is necessary to make optimal contact with hypodermal cells because, unlike vertebrate striated muscle in which cells can fuse to form multinucleated myotubes, C. elegans muscle cells do not fuse with each other. Rather, each cell is connected laterally to hypodermal cells surrounding the muscle tissue by interactions between dense bodies and hypodermal fibrous organelles (FO), which are similar to hemidesmosomes in vertebrates (Francis and Waterston, 1985). In each FO, one subcomplex is found at the inner surface of the cuticle that surrounds the hypodermis, and one subcomplex at the interface between hypodermal cells and the basal lamina of muscle cells (Ding et al., 2004). Intermediate filaments link the two, and this chain of attachments from muscle cell to cuticle allows for the kinetic energy produced through contraction of the full complement of sarcomeres in a single cell to be transferred to the worm’s outer surface (Bartnik et al., 1986).  5  Figure 1.2 Muscle quadrant arrangement within the worm Muscle cells are arranged into four quadrants that are flattened against hypodermal cells surrounding the muscle tissue (Hresko et al., 1994). An outer cuticle envelops all internal organs and tissues. As body wall muscle matures, an increase in the number of muscle arms also occurs. Muscle arms are processes that elongate and stretch from muscle cells to a proximal nerve cord in order to make synaptic connections (White et al., 1986). Figure modified with permission from (Altun and Hall, 2005), www.wormatlas.org.  6  1.3 Comparison of C. elegans body wall muscle and vertebrate muscle While C. elegans and vertebrates share many similarities in muscle structure, there are some differences. As C. elegans is an invertebrate, it does not have bones, and thus force from muscle contraction is transduced in a different manner. In vertebrates, the force of sarcomere contraction is transduced by linkage of muscle to the ECM via costameres, and subsequent muscle attachment to bone via tendons (Ervasti, 2003). Structurally, the costamere contains some of the same proteins as a dense body, including an integrin heterodimer, vinculin, and talin, as well as dystrophin and associated proteins (Ervasti, 2003). While this thesis will not focus on the dystrophin complex in the worm, C .elegans does have homologous components of the dystrophin complex, however, they have not been shown to be essential for viability (reviewed in Segalat, 2002). In C. elegans, body wall muscle cells do not fuse to form myotubes, and the contractile force is transmitted laterally through dense bodies and M-lines (Francis and Waterston, 1985). In this way, the dense body and M-line carry out the same role as both Z-discs and costameres and subsequent muscle to bone attachment to transduce the force of contraction (reviewed in Lecroisey et al., 2007). The myofilament lattice is oriented parallel to the direction of movement, but dense bodies and M-lines are offset by 5-7° (Figure 1.3) (Mackenzie and Epstein, 1980). This offset arrangement is thought to accommodate the sinusoidal movement of the animal by distributing force evenly over the surface of the cuticle (Burr and Gans, 1998). It is also possible that the position of dense bodies relies on the shape of muscle cells at the time of association with hypodermal contacts (Moerman and Williams, 2006). The 5-7° offset from an obliquely striated orientation is in contrast to the 90° offset observed in vertebrate cross-striated muscle. Another difference is the presence of the protein UNC-15/paramyosin in C. elegans, which is structurally similar to heavy chain myosin but lacks the functional head of the protein (Epstein 7  et al., 1993). UNC-15/paramyosin forms the inner core of myosin filaments and because of this additional protein constituent, C. elegans thick filaments have a larger diameter (~14-34 nm) than vertebrate filaments (~14 nm) (Mackenzie and Epstein, 1980). C. elegans thick and thin filaments are also ~6x longer than their vertebrate counterparts, with a greater proportion of thin filaments to thick filaments in the worm (12:1) than vertebrates (6:1) (Waterston, 1988; Moerman and Fire, 1997). Interestingly, whereas neurons in vertebrates extend axons that migrate in order to synapse with their target muscle cells, projections are extended from each body wall muscle cell in the worm to contact a proximal nerve cord (Figure 1.2) (White et al., 1986; Dixon and Roy, 2005). This unique extension of a muscle cell to synapse with, and receive input from a motor neuron increases in prominence as the worm grows; the number of muscle arms per cell increases from ~1.7 in the embryo to ~4 in an adult worm (Dixon and Roy, 2005). While it is evident that there are differences between C. elegans and vertebrate muscle, there are overall enough cellular architecture similarities to allow genetic studies in the worm to inform studies on vertebrate muscle. Over ninety genes have been found to affect muscle in C. elegans and many of these have vertebrate counterparts (Table 1.1). Most importantly, the attachment complexes themselves have similarities in composition and function, which makes the C. elegans counterparts an excellent model for muscle studies. Furthermore, the proteins needed to form a functional sarcomere in the worm bear remarkable resemblance to those required in vertebrate focal adhesions (Figure 1.4) (Moerman and Williams, 2006). These structures are found in migrating cells involved in a number of processes including tissue repair, immune responses, and tumor formation (Ridley et al., 2003). Movement of such cells involves polymerization of actin filaments, and subsequent attachment to the extracellular matrix (ECM) (Burridge et al., 1988; Ridley et al., 2003). The process of energy transmission 8  mediated by focal adhesions is similar to that carried out by the anchorage of filaments to the sarcolemma via attachment complexes in C. elegans.  9  Table 1.1 Known muscle affecting genes in Caenorhabditis elegans Gene Name  Sequence Name  Role/Affect in Muscle  myo-3 mlc-3 act-4 lev-11 pat-10  K12F2.1 F09F7.2 M03F4.2 Y105E8B.1 F54C1.7  thick filaments MHC regulation thin filaments thick filaments thin filaments  let-2  F01G12.5  muscle attachment  mlc-2 dim-1 mup-2  C36E6.5 C18A11.7 T22E5.5  sup-12  T22B2.4  emb-9 unc-15 act-3  K04H4.1 F07A5.7 T04C12.4  MHC regulation myofilament organization thin filaments recessive suppressor of unc-60, muscle structure abnormalities muscle basement membrane thick filament core thin filaments  mlc-1 unc-87 act-1  C36E6.3 F08B6.4 T04C12.6  unc-97  F14D12.2  unc-54  F11C3.3  unc-112  C47E8.7  unc-35 unc-95  Y105E8A.6  deb-1  ZC477.9  pat-2 unc-60 unc-45  C38C3.5 F30H5.1  ketn-1  F54E2.3  pat-6  T21D12.4  etr-1  T01D1.2  MHC regulation M-line, thin filaments thin filaments dense body/M-line assembly thick filament function dense body/M-line assembly dense body/M-line assembly dense body/M-line function dense body/M-line assembly dense body/M-line assembly thin filaments thick filaments thin filaments, excluded from dense bodies dense body/M-line assembly post transcriptional processing of an undefined essential body wall muscle gene  Protein name /Homolog myosin heavy chain IIA myosin light chain Actin-4 tropomyosin troponin C α-2 type IV collagen myosin light chain 2 troponin T  Mutant Phenotype Pat Unc Lvl, Unc Pat Pat  Lvl (with mlc-1 double) WT Pat  Bmd type IV collagen paramyosin Actin-3 myosin light chain 1 calponin Actin-1  Pat Unc Lvl, Unc Lvl (with mlc-2 double) Unc Lvl, Unc  PINCH myosin heavy chain IIB  Pat  mig-2  Pat  talin  Pat  Unc  Unc vinculin  Pat  α-integrin ADF/cofilin myosin chaperone  Pat Unc Pat  kettin  Unc  actopaxin  Pat  ELAV  Pat  10  Gene Name  Sequence Name  act-2  T04C12.5  pat-3  ZK1058.2  pat-4 unc-96  C29F9.7 F13C5.6  thin filaments dense body/M-line assembly dense body/M-line assembly thick filament attachment  spc-1 dys-1  K10B3.10 F15D3.1  muscle attachment/positioning muscle degeneration  unc-82  B0496.3  mec-8  F46A9.6  Role/Affect in Muscle  thick filament regulation alternative splicing of unc-52  unc-23 epi-1 ttn-1 unc-89  H14N18.1 K08C7.3 W06H8.8 C09D1.1  head muscle dystrophy muscle attachment I-band M-line  unc-68  K11C4.5  muscle contraction  pat-12 tmd-1 unc-94  C06A5.7  muscle attachment myofilament organization myofilament organization  egl-19 unc-98 atn-1  C48A7.1 F08C6.7 W04D2.1  unc-52 uig-1 hlh-1  ZC101.2 F32F2.1 B0304.1  let-268  F52H3.1  unc-78 unc-105 dyc-1 ace-3 lam-1 mua-3 ace-1 vab-10 unc-93 mua-6  C04F6.4 C41C4.5 C33G3.1 Y48B6A.8 W03F8.5 K08E5.3 W09B12.1 ZK1151.1 C46F11.1 W10G6.3  mup-4  K07D8.1  muscle contraction thick filament attachment actin attachment dense body/M-line assembly myofilament organization transcription factor muscle attachment thin filament localization/organization muscle contraction muscle degeneration muscle contraction muscle attachment muscle attachment muscle contraction muscle attachment muscle contraction muscle attachment muscle attachment/positioning  Protein name /Homolog  Mutant Phenotype  Actin-2  Lvl, Unc  β-integrin  Pat  ILK  Pat Unc Pat, wide muscle quadrants Hyperactive  α-spectrin dystrophin serine/threonine kinase  Unc, Slo Pat  BAG family chaperone laminin, α-chain titin obscurin ryanodine receptor GEX interacting protein tropomodulin L-type calcium channel α-actinin perlecan myo-D procollagen lysyl hydroxylase actin interacting protein 1 muscle degenerin CAPON acetylcholinesterase laminin, β-chain fibrillin acetylcholinesterase spectraplakin K+ channel IF protein  Unc WT Unc Unc, weak kinker Pat Unc, Egl Unc Pat Unc WT Pat WT Emb, Lvl Pat Unc, Slo Unc Hyperactive  Unc Unc, Prl Unc, Prl Lvl, Unc Lvl, Prl  11  Gene Name  Sequence Name  let-805  H19M22.2  sup-9  F34D6.3  unc-120 mua-1 vab-19 ace-2  D1081.2 F54H5.4 T22D2.1 Y44E3A.2  sup-10 unc-22 unc-27  R09G11.1 ZK617.1 ZK721.2  pxl-1 cpna-1  C28H8.6 F31D5.3  unc-109 unc-90 sup-11 mua-2 mua-4 mua-5 mua-7 mup-1  unc-111  unc-113  unc-114 sup-13  sup-38 mau-3 mau-5 pat-11 pat-9  Protein name /Homolog  Mutant Phenotype  muscle patterning recessive suppressor of unc-93, muscle contraction actin and myosin transcriptional regulation gene regulation muscle attachment muscle contraction recessive suppressor of unc-93 thick filaments thin filaments  myotactin  Pat  TWK K+ channel MADS-box transcription factor transcription factor KRANK acetylcholinesterase transmembrane protein twitchin tropinin I  WT  myofilament organization muscle stability abnormal muscle structure abnormal muscle structure dominant suppressor of unc-93 muscle attachment muscle attachment muscle attachment muscle attachment muscle attachment myofilament organization, partial suppressor of unc-105 myofilament organization, partial suppressor of unc-106 myofilament organization, partial suppressor of unc-107 recessive suppressor of unc-78 semidominant suppressor of viable unc-52, some muscle abnormalities/fragility unknown unknown unknown unknown  paxillin copine  Role/Affect in Muscle  Unc, Prl Prl Emb  Unc Unc, twitcher Unc pharyngeal muscle paralyzed Pat Emb, Unc, Prl Sma, Prl Slo Unc Unc Unc Unc Emb Slightly Unc, moves well  Unc, Slo  Unc, Prl WT  Small brood size Unc Unc, Prl Pat Pat  12  Figure 1.3 Body wall muscle sarcomere orientation in C. elegans Adjacent sarcomeres are offset from one another by 5-7º (Mackenzie and Epstein, 1980). The force transmitted by muscle contraction is spread evenly across the cuticle surface. Proteins that are localized in dense bodies form punctate dots in micrographs similar to what is depicted in this figure, and proteins localized to M-lines are visualized as localizing to a continuous line between rows of dense bodies. Figure modified with permission from Altun and Hall (2005), www.wormatlas.org.  13  Figure 1.4 Comparison of vertebrate focal adhesions and C. elegans dense bodies Many of the principal components of focal adhesions and dense bodies are conserved. While several additional proteins such as paxillin and focal adhesion kinase (FAK) are required in focal adhesions, but not in body wall muscle attachment complexes, the structure and function of each of the represented proteins is very similar between focal adhesions and the dense body. Figure used with permission from Moerman and Williams, (2006), www.wormbook.org.  14  1.4 Epistatic pathway for building muscle attachment complexes The initial step in the formation of a dense body or M-line is the deposition of the perlecan homolog UNC-52 in the basement membrane of muscle cells (Rogalski et al., 1993; Mullen et al., 1999). UNC-52 localization is concentrated into a pattern that corresponds with the future sites of both dense bodies and M-lines (Francis and Waterston, 1985). Animals lacking functional UNC-52 display a paralyzed and arrested elongation at two-fold stage of embryogenesis (Pat) phenotype, arresting elongation while continuing to develop and eventually dying as hatched animals (Williams and Waterston, 1994). Furthermore, antibody staining for other key attachment complex proteins in unc-52 mutants has shown that proper localization of these other components requires deposition of UNC-52 in the basement membrane before sarcomere assembly can proceed (Rogalski et al., 1993). This method of observing localization of key attachment complex proteins in other muscle mutants has established an assembly dependence pathway for both M-lines and dense bodies (Figure 1.5). The α and β integrin homologs PAT-2 and PAT-3 are next in the assembly pathway after UNC-52/perlecan, and are localized in the muscle cell membrane in a pattern corresponding with that of UNC-52 in the basal lamina (Rogalski et al., 1993; Hresko et al., 1994; Williams and Waterston, 1994). The C. elegans genome codes for two α-integrins PAT2 and INA-1, and one β-integrin, PAT-3. While INA-1/ α-integrin is not essential in body wall muscle (Baum and Garriga, 1997), PAT-2 and PAT-3 are essential and form the transmembrane integrin heterodimer (Gettner et al., 1995). The aggregation of integrin provides a platform from which subsequent dense body and M-line assembly can proceed, and without proper localization of the transmembrane integrin heterodimer, muscle assembly fails and the animals die (Williams and Waterston, 1994; Gettner et al., 1995). As attachment complex precursors accumulate, they underlying hypodermal tissue is also important, as the 15  hypodermal protein LET-805/myotactin, a 500kd transmembrane protein, appears to play a role in patterning the underlying hypodermis with associated hemidesmosome-like FO complexes (Hresko et al., 1999). Myotactin is required for attachment between muscle and the hypodermis, but how it does this specifically is not known (Hresko et al., 1999). Additional proteins must associate with either the dense body or M-line before each can carry out its specific task of providing linkage to actin and myosin filaments respectively. Two parallel but dependent pathways are present that allow for the eventual linking of the vinculin homolog DEB-1 with actin filaments (Moerman and Williams, 2006). One fork of this pathway involves two proteins, the MIG-2 homolog UNC-112 and the integrin-linked kinase (ILK) homolog PAT-4. These two cytoskeletal adapter proteins are dependent on the presence of each other in order to properly associate with the nascent dense body structure (Rogalski et al., 2000; Mackinnon et al., 2002). Removal of either UNC-112 or PAT-4 blocks the recruitment of the other, and prevents subsequent recruitment of PAT-6/actopaxin (Lin et al., 2003), which forms a complex with UNC-112 and PAT-4. Before actin attachment can occur however, an additional branch of the pathway must be completed. Recruitment of the LIM domain protein UNC-95 (Broday et al., 2004) and DEB-1/vinculin (Barstead and Waterston, 1991) is needed and both UNC-95 and DEB-1 require the presence of each other for proper assimilation into the maturing dense body structure. Some properly localized DEB-1 is present in unc-95 animals however, suggesting that DEB-1 is not completely dependent on UNC-95 for proper integration into the dense body (Broday et al., 2004). Still, these mutants are uncoordinated (Unc), as most DEB-1 remains in the cytosol resulting in severely disrupted myofilament organization. When both the DEB1/UNC-95, and UNC-112/PAT-4 pathways are complete, actin filaments can attach properly to  16  the dense body via interactions with the essential protein DEB-1/vinculin and the non-essential protein ATN-1/alpha-actinin. M-line assembly is similar to that of the dense body. It follows a comparable route as the UNC-112/PAT-4 branch of the pathway, but diverges after PAT-6/actopaxin recruitment. Instead of the dense body specific DEB-1/vinculin or ATN-1/α-actinin mediating actin attachment, the myosin linker UNC-89 is only present in M-lines (Benian et al., 1996) and aids in attachment of myosin filaments to the M-line. While many components are shared between these two major structures, DEB-1 and UNC-89 are unique to each respectively (Figure 1.5).  17  Figure 1.5 Assembly pathways for dense bodies and M-lines Two parallel pathways are present for dense bodies that are dependent for final linkage of actin filaments to the structure (Moerman and Williams, 2006). Proteins listed within each level of the pathway require the presence of each other for proper function or localization. A similar pathway exists for M-line formation, but with UNC-89/obscurin and associated proteins linking myosin to the M-line as opposed to DEB-1/vinculin linkage of actin filaments to the dense body (Barstead and Waterston, 1991; Benian et al., 1996). Solid arrows indicate progression of assembly can occur after proper localization of previous components, while a dashed arrow indicates a feedback interaction where loss of a protein further down the pathway can have an adverse effect on an earlier component. Figure used with permission from Moerman and Williams (2006), www.wormbook.org.  18  While researchers have discovered many proteins needed for the initial assembly of body wall muscle, until my work with the protein Copine Atypical 1 (CPNA-1), a protein involved in maintenance of the sarcomere rather than in sarcomere assembly had not been characterized, and this will be described in Chapter 3. Other than UNC-89/obscurin, each of the proteins indicated in Figure 1.5 is required for the sarcomere to begin contraction. Of note, not all of the proteins listed in Table 1.1 are shown in Figure 1.5. Only the essential proteins have been depicted. Without even one of the essential muscle proteins listed, downstream components in the assembly pathway fail to localize. CPNA-1, while not required for initial assembly, is required for the maintenance and structural integrity of the sarcomere both embryonically, and post-embryonically (see Chapter 3). 1.5 Single sarcomere muscle cells in C. elegans Most of our knowledge about muscle structure and function in C. elegans has been gleaned from work with body wall muscle, which has multiple sarcomeres per cell. Single sarcomere muscles are also important in the worm and are specialized for smaller areas of contraction, rather than movement of the whole animal. Single sarcomere muscle cells are used for vulval contraction, defecation, and for contraction of the pharynx, which is required for feeding (Albertson and Thomson, 1976; Moerman and Fire, 1997). The pharynx contains 8 muscle cells (Figure 1.6A), which have sarcomeres spanning the length of the cell (Figure 1.6B, C). In single sarcomere muscle cells thin filaments project from adhesion sites at each end of the cell, interacting with thick filaments in the middle of the cell for contraction (Albertson and Thomson, 1976) (see Chapter 2 for further details).  19  Figure 1.6 Organization of pharyngeal muscle in C. elegans The pharynx contains eight muscle cells organized to form a tissue specialized for internalizing and grinding food sources (A). Intermediate filament rich marginal cells (purple) help provide structural stability to the muscle cells (green) in the pharynx (B). Each muscle cell has sarcomeres that span the length of the cell. At the basal membrane, filament attachment sites project further into the cell and appear much larger than those at the apical face (B, C). At the apical membrane facing the lumen of the pharynx, it appears that intermediate filaments may project from the attachment complex, and interface with actin filaments. Thick filaments associate with thin filaments projecting from each face of the cell to complete the myofilament lattice (C). Figure modified with permission from (Altun and Hall, 2005), www.wormatlas.org.  20  Historically, the structure of the thin filament attachment sites in single sarcomere cells was assumed to be similar to the dense body found in body wall muscle. My findings in Chapter 2 of this thesis demonstrate that the actin attachment complex in pharyngeal muscle may be quite different from that in body wall muscle. Whereas in body wall muscle the dense body resembles a vertebrate focal adhesion complex, in the pharyngeal muscle the actin attachments may more closely resemble that of a podosome-like attachment. A podosome or podosome-like adhesion complex contains many of the same proteins as a vertebrate adhesion complex, but the proteins are organized in a different structural orientation (Marchisio et al., 1984). Whereas in a dense body, the integrin based adhesion complex forms the core, with actin projecting outward from the complex (see Figure 1.4 for clarification), in a podosomelike complex, the actin filaments form the core of the complex and a number of key attachment proteins including paxillin and vinculin surround the thin filaments (Bowden et al., 1999; Murphy and Courtneidge, 2011) (Figure 1.6). Paxillin is one of the key proteins found in focal adhesion complexes, and is necessary for proper turnover and maintenance of the structure (Hagel et al., 2002), but little is known about its role in muscle even though it is highly expressed in muscle tissue (Turner et al., 1991). Paxillin has also been found to localize to podosome-like structures in smooth muscle cells (Kaverina et al., 2003). Paxillin and its role in podosome-like structures in the pharyngeal muscle of C. elegans will be described in depth in Chapter 2.  21  Figure 1.7 Structural organization of adhesion proteins in podosome-like structures Podosomes contain many of the same proteins as a focal adhesion complex, including the integrin heterodimer, paxillin, talin, and vinculin. In a podosome-like structure, actin forms the core of the complex, with the transmembrane integrin heterodimer, and paxillin, talin, and vinculin forming a ring around the actin filaments. While the signaling molecule CDC42 is a component of podosome like structures in other systems (reviewed in Murphy and Courtneidge, 2011), it is not known whether it plays in C. elegans podosome like structures.  22  1.6 Thesis objectives Muscle adhesion structures are required in C. elegans for proper muscle structure and function. Our knowledge, however, of the proteins involved and their organization is incomplete. In fact, an in depth analysis of the organization of proteins within the pharyngeal muscle attachment complexes has not been previously published. Using the worm as a model, I will test whether additional proteins are required in the muscle adhesion structures in C. elegans body wall and pharyngeal muscle, and what their role may be. As well, I will look at how proteins in the pharyngeal muscle attachment complex are organized to demonstrate whether or not they differ significantly from those observed in body wall muscle. In C. elegans pharyngeal muscle, I have found that both vinculin (DEB-1) and paxillin (PXL-1) are arranged in a ring-like pattern of localization around actin filaments at the sarcolemma. In addition, loss of paxillin in pharyngeal muscle causes the myofilaments within pharyngeal muscle to become disorganized leading to an inability of the pharyngeal muscles to contract, which leads to death of the animal. The observation of paxillin and vinculin in this ring shaped localization pattern is the first to be reported in the worm, and changes our fundamental understanding of how the adhesion complexes in pharyngeal muscle are organized. In Chapter 2, I describe my studies with the C. elegans paxillin homolog, pxl-1, and its role in the muscle adhesion sites in the pharynx. In Chapter 3, I describe the role of CPNA-1 to maintain sarcomere integrity in body wall muscle of the worm, and how it fits into the model of sarcomere assembly and maintenance. Together these two chapters provide insight into how two different types of adhesion complexes in C. elegans muscle are organized, as well as demonstrating that pxl-1 is essential in pharyngeal muscle, and cpna-1 is essential in body wall muscle. 23  2. THE C. ELEGANS PAXILLIN ORTHOLOG, PXL-1, IS REQUIRED FOR PHARYNGEAL MUSCLE CONTRACTION AND FOR VIABILITY  2.1 Synopsis Vertebrate focal adhesion complexes and C. elegans muscle adhesion complexes contain a number of homologous proteins, but until recently it was not known whether the worm genome coded for a protein similar to paxillin, a component of vertebrate focal adhesions. I have identified the gene C28H8.6 (pxl-1) as the C. elegans ortholog of vertebrate paxillin. PXL-1 contains the four C-terminal LIM domains conserved in paxillin across all species, and three of the five LD motifs (Leucine, and Aspartic acid rich motifs) found in the N-terminal half of most paxillins. In body wall muscle, PXL-1 antibodies and a full-length GFP translational fusion localize to adhesion sites in the sarcomere, the functional repeat unit in muscle responsible for contraction. PXL-1 also localizes to ring shaped structures near the sarcolemma in pharyngeal muscle corresponding to podosome-like sites of actin attachment. Analysis of a loss-of-function allele of pxl-1, ok1483, demonstrates that loss of paxillin leads to early larval arrested animals with paralyzed pharyngeal muscles and eventual lethality, presumably due to an inability to feed. I rescued the mutant phenotype by expressing paxillin solely in the pharynx and found these animals survived and are essentially wild type in movement and body wall muscle structure. This indicates a differential requirement for paxillin in these two types of muscle. In pharyngeal muscle it is essential for contraction, while in body wall muscle it is dispensable for filament assembly, sarcomere stability and ultimately movement.  24  2.2 Introduction  Adhesion complexes are highly dynamic structures involved in the extension of a cell membrane for the purposes of locomotion. Movement of such cells involves polymerization of actin filaments and subsequent attachment to the extracellular matrix (Burridge et al., 1988; Ridley et al., 2003). Through studies on cultured murine fibroblasts, paxillin has been shown to be one of the key proteins required for proper maintenance and/or turnover of focal adhesion complexes (Hagel et al., 2002). Much of the work on paxillin has focused on its role in adhesion structures in cultured cells, but paxillin is also highly expressed in skeletal muscle, cardiac muscle, and smooth muscle (Turner et al., 1991). Because relatively little is known about the function of paxillin in muscle, the study of this protein in model organisms may help to elucidate its in vivo function (reviewed in Brown and Turner, 2004; Deakin and Turner, 2008). Caenorhabditis elegans is an appropriate organism with which to study the role of paxillin in muscle because nematode body wall muscles contain actin attachment structures called dense bodies that are analogous to Z-discs in vertebrate muscle. Dense bodies bear striking resemblance to adhesion complexes in terms of protein composition and function (Labouesse and Georges-Labouesse, 2003). Paxillin is a well-conserved protein found in many organisms, including humans (Turner et al., 1990), zebrafish (Crawford et al., 2003), and fruitflies (Wheeler and Hynes, 2001). Human paxillin is a 591–amino acid protein with five LD motifs in its N-terminal region and four lin-11, isl-1, mec-3 (LIM) domains in its C-terminal half (Turner et al., 1990; Turner and Miller, 1994). LD motifs are short stretches of amino acids with a consensus sequence of LDXLLXXL where X represents any amino acid (Brown et al., 1996), although variations from this sequence are possible across species and even within the third LD motif 25  (reviewed in Tumbarello et al., 2002). The LD motifs are responsible for mediating many of the direct interactions that paxillin has with other proteins in focal adhesion complexes (Brown et al., 1996; Brown and Turner, 2004). LIM domains are tandem zinc fingers that are responsible for mediating interactions with other proteins (Schmeichel and Beckerle, 1994), and the four LIM domains in paxillin have been shown to be sufficient for its localization to adhesion complexes (Brown et al., 1996). Paxillin is found in another type of adhesion complex called the podosome (Bowden et al., 1999). Similar to focal adhesion structures, podosomes are dynamic structures and include many of the same proteins but have a different structural arrangement of these proteins in relation to the membrane. Whereas focal adhesions comprise a complex of proteins extending inward from the cell membrane and anchoring actin filaments, podosomes have a core of Factin (Marchisio et al., 1984), which has focal adhesion components such as paxillin, vinculin, and talin organized around the actin core in a ring-shaped formation (Bowden et al., 1999). Recently, podosome-like structures in cultured myotubes have been shown to play a role at neuromuscular junctions by guiding and remodeling the postsynaptic membrane as it matures (Proszynski et al., 2009). Podosomes are found in a variety of cell types, including smooth muscle cells (Hai et al., 2002; Kaverina et al., 2003) and migrating cells (Linder, 2007), and, like adhesion complexes, are able to play a role in cell movement (Linder, 2007), including the direction of movement. Previously, little work has been done on the structural organization of actin attachment sites in C. elegans pharyngeal muscle. Much of the work directed on muscle in the worm has focused on the body wall muscle. Whereas body wall muscle is comprised of cells with multiple sarcomeres in register (reviewed in Moerman and Fire, 1997; Moerman and Williams, 2006), pharyngeal muscles contain a series of single sarcomeres that traverse the diameter of 26  the cell (Albertson and Thomson, 1976). Pharyngeal muscle in the worm has been proposed as a possible model for cardiac (heart) muscle, albeit with limitations (Mango, 2007), whereas body wall muscle is generally used as a model for mammalian skeletal muscle, again with limitations (Moerman and Williams, 2006). As previously mentioned, dense bodies in body wall muscle are actin attachment sites functionally similar to Z-discs in mammalian muscle (Moerman and Williams, 2006) and transmission electron microscope (TEM) images of pharyngeal muscle cells also show similar electron-dense structures at the ends of actin filaments (Albertson and Thomson, 1976). Whereas GFP tagged body wall muscle proteins that localize to dense bodies show a punctate pattern indicating localization throughout the sarcolemmal plane of the dense body, to date the specific organization of muscle proteins within the pharyngeal muscle dense bodies has not been established. I have found that a single paxillin homologue is present in the genome of C. elegans and is expressed in body wall and pharyngeal muscle cells at sites of actin attachment. Animals homozygous for a pxl-1 deletion have paralyzed pharyngeal muscle and arrest and die as firststage larvae. A GFP translational fusion for pxl-1 expressed exclusively in pharyngeal muscle and marginal cells restores pharyngeal muscle function in pxl-1 mutants, indicating that although pxl-1 is expressed in body wall muscle and pharyngeal muscle, its essential role is within the pharynx.  27  2.3 Methods 2.3.1 Strains N2 (Bristol) is the principal wild type strain used in C. elegans research, and was grown using standard conditions (Brenner, 1974). The VC1012 tag-327(ok1483)/mT1[dpy-10(e128)] III strain was provided by the International C. elegans Gene Knockout Consortium, Vancouver (Canada). The ok1483 mutation is a 943 bp deletion in the pxl-1 gene and animals homozygous for ok1483 arrest development as L1 larvae. Balancing of the homozygous lethal mutation was accomplished by crossing in the chromosome III balancer mT1, a dpy-10 marked translocation. Strain GE24 pha-1(e2123ts) III was used for one microinjection because of its temperature sensitive lethal phenotype (Granato et al., 1994). Animals homozygous for pha-1(e2123ts) arrest development during embryogenesis at 25˚C, but are viable at 15˚C. Adult animals grown at 15˚C can be injected with DNA encoding a wild type pha-1 gene and then transferred to 25˚C. Only progeny harboring the injected DNA as an extrachromosomal array survive. Strain NJ0784 +N2; rhIs1[pat-3::GFP; pRf4(rol-6)] produces GFP tagged PAT-3, and was used to confirm co-localization of PXL-1 with PAT-3 in body wall muscle. 2.3.2 Production of ok1483-rescuing GFP translational fusions Construction of a GFP translational fusion able to rescue animals homozygous for the ok1483 allele was accomplished by using PCR to amplify the full sequence of C28H8.6b along with ~2.4 kb of endogenous promoter region to clone into the pPD95.75 GFP expression vector provided by Andrew Fire, Stanford University (USA). Similarly, the coding sequence of C28H8.6a along with ~150bp of its endogenous promoter was amplified and cloned into pPD95.75. Primers were designed to eliminate the stop codon in C28H8.6b and C28H8.6a  28  while also allowing for it to be inserted into pPD95.75 such that it would be in frame with GFP sequence downstream of the multiple cloning site. The 3’UTR for unc-54 is downstream of the coding sequence for GFP in the pPD95.75 vector. 2.3.3 Construction of a Gateway GFP translational fusion A GFP translational fusion for the LIM domain coding portion of pxl-1 was produced by taking advantage of the ORFeome (Reboul et al., 2003) publicly available from Open Biosystems (USA). The C. elegans ORFeome consists of 12,625 open reading frames (ORFs) cloned into a Gateway (Walhout et al., 2000) donor vector. Using methodology described in Meissner et al. 2009, a GFP tagged ‘LIM domain only’ paxillin construct was created, driven by the body wall muscle specific promoter T05G5.1. 2.3.4 Identification of pxl-1 splice isoforms Forward primers specific to the exons in the 5’ portion of the previously named C28H8.13 gene were used to attempt to amplify RT-PCR products using each of the two 3’ exons of C28H8.6. Three splice isoforms were confirmed by sequencing the isolated cDNAs and named C28H8.6a, C28H8.6b, and C28H8.6c, with Genbank accession numbers EU239658, EU239659, and EU239660 respectively. Our analysis demonstrates that C28H8.13 and C28H8.6 are one gene, now termed C28H8.6 or pxl-1. Our analysis of the alternative splicing of pxl-1 is also supported by data from whole genome transcriptional tiling array experiments by He et al. (2007). 2.3.5 Isolation of a full-length pxl-1a cDNA Primers flanking the 5’ and 3’ exons of pxl-1a were used to amplify the pxl-1a cDNA using RTPCR. The forward primer contained a 5’ HindIII restriction site and the reverse  29  primer contained a 3’ EcoRV site to allow for cloning into the pBlueScript SK- plasmid vector. The cloned cDNA was sequenced to confirm identical sequence to annotated NCBI sequence. 2.3.6 Microinjection procedure Transformation of worms with GFP translational fusion contructs was carried out using microinjection. Two co-injection markers were used in this process: pRF4 [rol-6(su1006dm)] which contains a copy of rol-6 and results in a Rol phenotype in sucessful transformants, and pBx [pha-1::pha-1(+)] which is able to rescue the embryonic lethal pha-1 phenotype of the strain GE24. Injection mixes were prepared containing either 45 ng/µl pRF4, 45 ng/µl pBx and 10 ng/µl of GFP tagged construct for injection into GE24 animals, 90 ng/µl pRF4 rol6(su1006dm), and 10 ng/µl GFP tagged construct for injection into animals heterozygous for the ok1483 null allele of pxl-1 and genetically balanced by the recessive mutation dpy-17. All injections were carried out using a microinjection setup featuring a Zeiss inverted compound microscope (IM35) by conventional methods (Mello et al. 1991). The four transgenic strains obtained were DM7055 pha-1(e2123) III; raEx55[pha-1(+); rol-6(su1006); pT05G5.1::C28H8.6a::GFP], DM7082 tag-327(ok1483) III; raEx82[rol-6(su1006); C28H8.6b::GFP], DM7335 tag-327(ok1483) III; raEx335[rol-6(su1006); C28H8.6a/c::GFP], DM7438 tag-327(ok1483) III; raEx438[rol-6(su1006); pC28H8.6::C28H8.6a(cDNA)::GFP] 2.3.7 RNAi feeding RNAi feeding clones from the frozen Geneservice feeding library were picked and grown overnight in Luria (L) broth containing 50 µg/mL ampicillin. Specialized NGM plates were prepared containing 1 mM isopropyl-beta-D-thiogalactopyranoside (IPTG) to induce production of dsRNA in bacteria, and 50 µg/mL carbenicillin to select for bacteria containing an RNAi construct. These plates were then streaked with 50 µl of overnight culture and  30  incubated at room temperature overnight to allow for dsRNA production. Approximately 20 L1 worms were spotted onto each RNAi plate by transferring a small aliquot of the previously prepared M9 solution containing the hatched animals. These plates were then incubated at 20ºC until the worms reached the young adult stage (~60-68 hours). Four worms from each plate were then transferred to fresh RNAi plates corresponding to the same feeding construct (2 plates, each with 2 worms), and left for ~18 hours to lay eggs at which time they were removed. The phenotype of affected worms was assayed over the next two days. 2.3.8 Antibody production An MBP fusion of the PXL-1a N-terminus (residues 1-112) was used as immunogen for preparation of anti-PXL-1 antibodies. The cDNA fragment was cloned into pMAL-KK-1. BL21 (DE3) codonplus bacteria (Stratagene, USA) were used for production of MBP-PXL-1 (residues 1-112), which was supplied to Spring Valley Laboratories (USA) for production of rabbit antibodies. After affinity purification using a column containing MBP-PXL-1 (residues 1-112), antibodies were evaluated by reaction to a western blot containing a lysate of soluble C. elegans proteins, and a lysate from yeast expressing HA-tagged PXL-1 full-length cDNA. A yeast expression plasmid for HA-tagged PXL-1 full-length (residues 1-413) was constructed by two-step cloning: first, the cDNA of PXL-1-full-length was cloned into pKA-HA(Nhex2); second, the NheI fragment containing HA-tagged PXL-1 full-length (residues 1-413) was cloned into pGAP-C-Nhe (Lin et al., 2003; Norman et al., 2007). The PJ69-4A yeast strain harboring pGAP-C-HA-PXL-1 plasmid was cultured in 2 ml media until saturation, and the cells were collected. Yeast lysate was prepared by suspending yeast cells in Laemmli buffer, and heated at 95°C for 5 min. The western blot was performed as described previously (Mercer et al., 2006). Antibody production was carried out by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA). 31  2.3.9 Yeast two-hybrid method Yeast two-hybrid assays were performed as described previously (Mackinnon et al., 2002). The PCR amplified cDNA fragments of PXL-1a full-length (residues 1-413), PXL-1a N-terminus (residues 1-112), and PXL-1a LIM domains (residues 113-413) tagged with BamHI and SalI were cloned into pGBDU-C1 (Bait) and pGAD-C1 (Prey) yeast two-hybrid vectors (James et al., 1996). Yeast host strain, PJ69-4A, harboring a combination of PXL-1 bait and “bookshelf” collection (Qadota et al., 2007) preys or PXL-1 prey and “bookshelf” collection bait plasmids were examined for HIS3 and ADE2 reporters on selective plates. See Table A.3 for the full list of proteins constituting the “bookshelf.” Y2H was carried out by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA). 2.3.10 HA-pulldown assay Bacterial expression plasmids for MBP fusions of UNC-95 full-length, UNC-96 Cterminal half (residues 201-411), and LIM-8 (residues 635-1004) were described previously (Mercer et al., 2006; Qadota et al., 2007). Bacterial expression plasmids for the MBP fusion of DEB-1 (residues 1-291) and UIG-1 (residues 1-638) were made by cloning each cDNA fragment into a pMAL vector. MBP and other MBP fusions were expressed in E. coli and purified as described previously (Mercer et al., 2006). Using a yeast lysate containing HAtagged PXL-1 full-length (residues 1-413) and purified MBP or MBP fusion proteins, a HApull down assay was carried out as described previously (Qadota et al., 2008b). HA-pulldowns were carried out by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA). 2.3.11 Immunostaining For the images shown in Figure 2.7 and Figure 2.8, worms were fixed by the Nonet method (Nonet et al., 1993) and the staining was carried out by Ge Xiong, Hiroshi Qadota, and 32  Guy Benian (Emory University, Atlanta, USA). Antibody staining with anti-PXL-1 (1/100 dilution) and anti-α-actinin (MH35, 1/200 dilution) was performed as described previously (Qadota et al., 2007). Secondary antibodies were anti-rabbit Alexa 488 (Invitrogen, USA) for anti-PXL-1 and anti-mouse Alexa 594 (Invitrogen, USA) for anti-α-actinin, each used at 1/200 dilution. Stained samples were mounted on a glass slide with a coverslip containing mounting solution (20 mM Tris (pH 8.0), 0.2 M DABCO, and 90% glycerol). Images were captured with a Zeiss confocal system (LSM510) equipped with an Axiovert 100M microscope using an Apochromat 63x/1.4 Oil objective, in 2.5x zoom mode. The color balances of the images were adjusted using Adobe Photoshop. All additional antibody staining was carried out using a method modified from Albertson (1984). Worms were washed off plates and suspended into a 4% sucrose, 1 mM EDTA pH 7.4 solution. Some animals were dissected to expose the pharynx for images in Figure 2.9. The worm suspensions were transferred to glass slides coated with 2 mg/ml poly-L-lysine, covered by a rectangular glass coverslip, and frozen on an aluminum slab at -80 °C overnight. The coverslips were removed from the slides using a razor blade, and slides were transferred to -20 °C methanol for 4 minutes, -20 °C acetone for 4 minutes, and subsequent 1 minute intervals at 20 °C of 75% acetone, 50% acetone, 25% acetone, and then Tween-TBS for 2 minutes. Primary antibody solutions were added to the slides for 5 hours, and included anti-PXL-1 (1/100 dilution), anti-actin (AbCam8224) at 1/500 dilution, antivinculin (MH24) (Francis and Waterston, 1985) at 1/250 dilution and anti-GFP (AbCam13970) at 1/1000 dilution. After one hour in TBS-Tween, slides were coated with secondary antibodies for 3 hours, Alexa 488 (Invitrogen) anti-rabbit for anti-PXL-1, Alexa 594 anti-mouse for antiactin and anti-vinculin, and Dylight 488 (Jackson ImmunoResearch, USA) anti-chicken for anti-GFP. After 1 hour in TBS-Tween, mounting solution was added (20 mM Tris (pH 8.0), 0.2 M DABCO, and 90% glycerol), and slides were sealed with nail polish. 33  2.3.12 Microscopic analysis Visual analyses of worms homozygous for the mutant allele ok1483, or affected by RNAi targeting C28H8.6 was carried out using a dissecting microscope (Wild Heerbrugg model), and a fluorescence dissecting microscope (Zeiss Stemi SV11). Whole worm images and immunofluorescence images were also taken using a Zeiss Axiophot D-7082 Oberkochen compound microscope with a Q imaging QICAM digital camera running Qcapture version 1.68.4, and a Zeiss Axioplan 2 imaging compound microscope with 2.5x Optivar and a Q imaging Retiga Exi digital camera. Images in Figure 4C were obtained using a Zeiss Axiovert inverted compound microscope with a Zeiss Pascal confocal setup (LSM5) using Pascal imaging software version 3.2sp2. Fluorescence images in Figure 2.9 were processed with Image J software using the Parallel Iterative Deconvolution 2D plugin (version 1.11). 2.3.13 TEM microscopy Worms were removed from growth media and immersed in fixative (1.5% paraformaldehyde, 1.5% glutaraldehyde, 0.1 M sodium cacodylate, pH 7.3, room temperature). Under a microscope, the anterior halves of the animals were removed and collected in a small vial. After fixing for approximately 3 hours, the fixative was replaced with buffer (0.1 M sodium cacodylate, pH 7.3) and the samples left at room temperature until the following day. Samples were washed twice with buffer, post-fixed (1% OsO4 in 0.1 M sodium cacodylate) for 1 hr on ice, washed three times with dH20, en bloc stained for 1 hr with 1% uranyl acetate (aqueous), and then washed again three times with dH2O. Samples were dehydrated through a graded series of ETOH, and then infiltrated through propylene oxide into EMbed-812 (Electron Microscopy Sciences, USA). The worm halves were oriented in the embedding molds so that the midsection of the worm and the pharynx could be transversely cut when sectioned, and  34  then the resin hardened at 60oC overnight. Thin sections were stained with uranyl acetate and lead citrate and photographed on a Philips 300 operated at 60 kV. EM microscopy was carried out by Wayne Vogl, University of British Columbia, Vancouver, Canada.  35  2.4 Results 2.4.1 pxl-1 encodes 3 splice variants of paxillin The gene C28H8.6 (pxl-1) found near the centre of chromosome III, encodes three splice variants of a paxillin-like gene (Figure 2.1A). The largest of these splice variants encodes a 413 amino acid protein with sequence similarity to paxillin in other species, including humans. Human paxillin is a 557 amino acid protein containing an LD motif rich region in its N-terminal half, and four LIM domains in its C-terminal half (Brown et al., 1996). Splice variant ‘a’ of C. elegans paxillin codes for a protein product with LD motifs in its amino half, albeit fewer than in its human counterpart, and 4 LIM domains in its C-terminal half (Figure 2.1B). An alignment of the two proteins using ClustalW2 (Chenna et al., 2003) reveals significant similarity between C. elegans and human paxillin throughout the protein, with some gaps in the C. elegans portion of the alignment in the LD motif region due to its shorter sequence length (Figure 2.2). In terms of the LD motifs themselves, PXL-1 appears to share LD motifs 1, 3, and 5, but not 2 and 4 (Figure 2.1C). This overall similarity, and the fact that there are no other predicted nematode proteins with this combination of domains, supports the possibility that PXL-1 may be the nematode ortholog of human paxillin.  36  Figure 2.1 C. elegans paxillin (pxl-1) gene and protein models The pxl-1 gene in C. elegans has three alternatively spliced isoforms (A), which are all affected by the deletion allele ok1483. Exons are colored black with the UTR in white. Conservation of three of the 5 LD motifs found in the N-terminal half of paxillin in H. sapiens (PXN) is found in the ‘a’ isoform of PXL-1, two of the 5 LD motifs in isoform ‘c’ and only one LD motif is conserved in isoform ‘b.’ (B). Sequence homology between the LD motifs can be seen in panel C. Amino acid alignments were marked using ClustalW2 conventions (Larkin et al., 2007): * identical amino acids, : conserved substitutions, . semi-conserved substitutions. Bar, 500 bp.  37  38  Figure 2.2 Comparison of PXL-1 protein sequence with paxillin (H. sapiens) PXL-1a aligns with human, fly, and frog paxillin, especially in the LIM domain C-terminal half of the protein (A) using ClustalW2 software. Within the N-terminal half of PXL-1, homology is seen between species with PXL-1 containing three of the five LD motifs in boxes found in the each of the other proteins represented (Panel B). Amino acid alignments were marked using ClustalW2 conventions (Larkin et al., 2007): * identical amino acids, : conserved substitutions, . semi-conserved substitutions. Boxes indicate LD motifs, and bars below the LIM domains mark their boundaries.  39  2.4.2 pxl-1 mutant animals die as young larvae The C. elegans Gene Knockout Consortium provided the strain VC1012, which carries a 943bp deletion within the coding sequence of C28H8.6 (Figure 2.1A). When homozygous for the mutant allele ok1483, animals arrest at the first larval stage of development (L1), at approximately 0.2 mm in length, and die. Whereas a wild type worm grows to ~1 mm in length at the adult stage after 3 days and begins to lay eggs, pxl-1 mutants remain at ~0.2 mm in length. Upon close examination of the pharynx in mutant animals, a lack of pumping is clearly noticeable. The pharynx structure appears to be normal and we detect no visible attachment defects (Figure 2.3B) like those seen in the α-integrin mutant ina-1 (Baum and Garriga, 1997), but the pharyngeal muscles do not contract. The internal pharyngeal muscle structure can be observed using polarized light microscopy (Avery, 1993), and upon closer examination, the birefringence of myofilaments in animals lacking PXL-1 is reduced throughout most of the pharyngeal muscle (Figure 2.3D). The reduced birefringence of pharyngeal myofilaments we observe is very similar to that observed in an actin mutant (see Figure 5, C-D in Avery, (1993)). This lack of organized myofilament structure and thus pharyngeal pumping in pxl1(ok1483) homozygotes means the animals cannot feed, so we presume the animals die of starvation as L1 larvae. The RNAi phenotype of worms fed dsRNA for pxl-1 is similar in appearance to ok1483 lethal homozygotes. Whereas a balanced lethal animal contributes maternal transcripts due to its heterozygous genotype, RNAi knocks down the gene product for pxl-1 in the treated adult animals, and thus a maternal contribution of pxl-1 cannot occur in its progeny. The lack of a stronger phenotype using RNAi indicates there is no maternal contribution of pxl-1 that is critical to the developing embryo.  40  41  Figure 2.3 Phenotype of homozygous pxl-1 (ok1483) mutant animals, and subcellular localization of PXL-1::GFP translational fusion products The pharynx of pxl-1 mutants does not pump, but the physical structure of the pharynx in wild type worms (A) appears similar to the structure in pxl-1 mutant animals (B). Within the pharyngeal muscle, polarized light microscopy was used to look at the myofilament structure. In worms with pxl-1 expression restored in the pharynx, myofilaments extend across the pharyngeal muscle cells, indicated by arrows highlighting the birefringence of the myofilaments (C). Animals not expressing pxl-1::GFP arrest at the L1 stage of development, and have a lack of myofilament birefringence in pharyngeal muscle (D). pxl-1a(cDNA)::GFP is expressed strongly in body wall muscle (E) and pharyngeal muscle under control of its endogenous promoter. PXL-1a(cDNA)::GFP is localized to dense bodies (arrows), adhesion plaques (star), and weakly to M-lines (not shown). A GFP fusion product containing only the four LIM domains of PXL-1 fused to GFP also localizes to dense bodies (arrows), adhesion plaques (star), and weakly to M-lines (arrowhead) (F). pxl-1a/c::GFP under control of a minimal promoter lacking body wall muscle promoter elements is expressed strongly in the pharyngeal muscle, and weakly to in body wall muscle (arrow) solely at the anterior tip of the animal (G). Within pharyngeal muscle, PXL-1a/c::GFP and PXL-1a(CDNA)::GFP (not shown but identical to PXL-1a/c::GFP) is localized to ring-shaped structures near the muscle cell membrane (H). Bar for A-D, 10 µm. Bar for E-F, 2 µm.  42  2.4.3 Isoform diversity leads to differential sub-cellular location and tissue expression of paxillin We first rescued the pxl-1 mutant phenotype with a GFP translational fusion containing ~2.4 kb of upstream promoter sequence, the full coding sequence, and GFP sequence tagged to the terminal exon of pxl-1 in the expression vector pPD95.75 (provided by Andrew Fire, Stanford University). As the 3’ exon for the ‘b’ isoform is downstream of the terminal exon for pxl-1a and pxl-1c, non-GFP tagged PXL-1a and PXL-1c are produced from the extrachromosomal array, along with GFP tagged PXL-1b. This construct fully rescued the first larval stage arrest phenotype. In addition we noted that PXL-1b::GFP is diffusely expressed in the pharyngeal epithelial cells, and weakly in pharyngeal muscles one and three. Isoform a is most similar to human paxillin, sharing three LD motifs and all four LIM domains. We used a full-length cDNA for pxl-1a to create a GFP tagged construct, under the control of a ~2.5 kb endogenous promoter. We found the ‘a’ isoform of paxillin in all 95 body wall muscle cells in an adult animal, as well as in the pharyngeal muscle cells. Strong localization of PXL-1a(cDNA)::GFP is seen in adult body wall muscle at dense bodies, as well as adhesion plaques between adjacent muscle cells (Figure 2.3E). Weak GFP localization also can be observed at the M-line (not shown). In the pharynx, expression of PXL-1a(cDNA)::GFP can be seen in all muscle cells, localized to both the luminal and cuticular membranes. PXL1a(cDNA)::GFP is localized in small punctae, as well in ring like structures near muscle cell membranes (identical to Figure 2.3F). We were unable to design a c isoform specific GFP reporter because it shares its 3’ terminal exon with the a isoform, so we do not know whether the distribution of this isoform partially or entirely overlaps that of the a and/or b isoforms.  43  To confirm this subcellular localization a polyclonal antibody was raised against the full-length PXL-1a protein. This antiserum binds to PXL-1 in both nematode lysate and yeast lysate expressing HA-tagged PXL-1 via Western blot (Figure 2.4D). Within adult body wall muscle the PXL-1a antibody localizes to dense bodies and adhesion plaques, and very weakly to M-lines (Figure 2.4C), co-localizing with PAT-3/beta-integrin. Within the pharynx, there is staining within the muscle cells, but the staining is somewhat fuzzy and punctate and not as clear to interpret as the GFP localization (data not shown).  44  45  Figure 2.4 Confirmation of protein interactions and immunostaining with a PXL-1 antibody (A) Screening by the yeast 2-hybrid method of a collection of 30 known components of dense bodies and M-lines revealed that the six indicated proteins interact with PXL-1. By domain mapping, the LD motif region is sufficient for interaction with DEB-1 (vinculin) and LIM-8, and the LIM domain region is sufficient for interaction with UNC-95 and UIG-1 (a Cdc42 GEF). UNC-96 and HUM-6 are also able to bind to PXL-1. (B) These interactions, except that with HUM-6, were verified using purified proteins. Yeast expressed HA-tagged PXL-1 was precipitated with anti-HA beads, washed, incubated with bacterially expressed MBP of the indicated MBP fusion proteins, washed and the eluted proteins separated on a gel, blotted, and reacted with either anti-MBP or anti-HA. All tested proteins except UNC-96 showed conclusive results, with a faint band observed for UNC-96 when reacted with anti-MBP. A paxillin (PXL-1) polyclonal rabbit antibody was produced to detect PXL-1 in C. elegans as well as in yeast expressing HA-PXL-1. PAT-3/beta integrin (GFP, Panel Ci) is a major component of dense bodies, M-lines, and attachment plaques, and the PXL-1 antibody (Panel Cii) clearly co-localizes with PAT-3/beta integrin in dense bodies and adhesion plaques (Panel Ciii). The PXL-1 antibody also stains M-lines, but very weakly (not shown). Paxillin from the nematode lysate displays a slower mobility than that of nematode paxillin expressed in yeast (see Discussion) (D). Bar, 2 µm. Figure 2.4 A, B, D and related experiments were the work of Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA).  46  2.4.4 Pharyngeal muscle pxl-1 rescue It was not clear why pxl-1 null animals die, although we suspected that it was a result of starvation, not a problem with the body wall muscle. To test this possibility we designed a pxl1 construct with expression only in the pharynx. Using the C. elegans muscle cis-regulatory module locator (Zhao et al., 2007) the pxl-1 promoter has multiple body wall muscle specific expression motifs between 250 bp upstream of the transcriptional start site, and 3 kb upstream. We cloned the genomic region of pxl-1 covering the ‘a’ and ‘c’ isoforms along with the immediate 5’ ~150 bp of the endogenous promoter in frame with sequence encoding GFP. The translational fusion construct produces GFP tagged PXL-1a and PXL-1c, but because the terminal exon for pxl-1b is downstream of the terminal exon for pxl-1a/c, PXL-1b is not produced, at least not as a full-length protein (see Figure 2.1, panels A and B for clarification). The L1 arrest phenotype was fully rescued using this construct. The tissue expression using the minimal promoter is almost solely within the pharyngeal muscle cells. Only a few body wall muscle cells around the anterior tip of the worm display a faint GFP signal, but otherwise expression from this PXL1a/c::GFP construct is pharyngeal specific (Figure 2.3G). Progeny carrying this extrachromosomal array display wild type movement and the body wall muscle structure appears wild type using both polarized light microscopy (Figure 2.5, A-B) and transmission electron microscopy (Figure 2.5, E-F). Within the pharynx, we again observe that paxillin is associated with ring-like structures similar to those previously described (Figure 2.3H). Rescue of mutant lethality by expressing paxillin only within the pharynx supports our earlier speculation that animals lacking paxillin starve to death. It also leads us to the unexpected conclusion that paxillin is not necessary for the function of body wall muscle in the nematode.  47  48  Figure 2.5 Body wall muscle in animals with pxl-1 expression restricted to the pharynx Animals that were transformed using a pxl-1a/c::GFP construct with only ~150 bp of endogenous promoter have pxl-1 expression almost exclusively in the pharynx. Compared with the body wall muscle structure in wild type worms observed using polarized light microscopy (A), the muscle structure looks identical in pharyngeal specific pxl-1 rescued animals (B). In animals lacking paxillin in the body wall muscle, actin (antibody C4) is clearly seen (C), whereas a GFP antibody does not detect any GFP tagged paxillin, with only background fluorescence from the secondary antibody observed (D). TEM was also used to look at the body wall muscle structure in wild type animals (E) and animals lacking pxl-1 expression in body wall muscle (F), which showed properly formed dense bodies (arrows) and no structural differences. Bar for A-D, 5 µm. Bar for E,F, 1 µm. EM microscopy in Figure 2.5 E-F was carried out by Wayne Vogl, University of British Columbia, Canada.  49  2.4.5 PXL-1 LIM domains are sufficient for proper localization in body wall muscle Previous studies by Brown et al. (1996) have shown that LIM domains, (specifically LIM domain 3), are necessary and sufficient for the localization of paxillin to focal adhesion complexes. To test whether the LIM domains of pxl-1 are sufficient for proper localization of paxillin in the worm, we constructed a GFP expression construct coding for only the four LIM domains of PXL-1 fused to GFP and under the control of the body wall muscle specific promoter from the gene T05G5.1 (Meissner et al., 2011). The extrachromosomal array does not rescue the mutant phenotype, but the GFP tagged protein containing only LIM domains is localized to dense bodies, adhesion plaques, and M-lines in body wall muscle (Figure 2.3F). The identical subcellular localization pattern seen with the LIM only portion of PXL-1 and the full-length PXL-1 indicates that the LIM domains are sufficient for localization of the protein to its proper subcellular locations. 2.4.6 PXL-1 interacts with DEB-1/vinculin, UIG-1, LIM-8, UNC-96 and UNC-95 LIM domain proteins, including paxillin have been implicated as adapter molecules, responsible for the recruitment of proteins and acting as a scaffold for protein complexes to assemble (Schmeichel and Beckerle, 1994), reviewed in Brown and Turner, (2004). We used the yeast two-hybrid method to screen a “bookshelf” of primarily known dense body and Mline proteins using PXL-1a as bait (Table A.3). Six interactors were detected: DEB-1/vinculin, the guanine nucleotide exchange factor UIG-1, the LIM domain containing proteins LIM-8 and UNC-95, the thick filament component UNC-96, and the myosin VII homolog HUM-6 (Figure 2.4A). Except for HUM-6 (to be described elsewhere), each positive hit was then retested by fixing HA-tagged PXL-1a to anti-HA beads, and incubating with a purified MBP-tagged  50  sample of each putative interactor. Western blots confirm that each of the putative yeast twohybrid interactors do bind to PXL-1 in vitro (Figure 2.4B). Vinculin is a major interactor of paxillin across species (reviewed in Brown and Turner, 2004), and this relationship is conserved in C. elegans. Along with DEB-1/vinculin, we also observe in vitro binding between the LD motifs of PXL-1 and the muscle protein LIM-8, and in vitro binding between the LIM domains of PXL-1 and the proteins UIG-1, and UNC-95 (Figure 2.4A). Two additional proteins, UNC-96 and HUM-6 can bind PXL-1 along the length of the protein. Each of UNC96 (Mercer et al., 2006), UIG-1 (Hikita et al., 2005), and LIM-8 (Qadota et al., 2007) are expressed in body wall and pharyngeal muscle in vivo. In addition, DEB-1/vinculin is detected in pharyngeal and body wall muscle using the monoclonal antibody MH24, and both DEB-1 and UNC-95 have Serial Analysis of Gene Expression (SAGE) data indicating expression in those two tissues (Meissner et al., 2009). Each of the interactions between paxillin and its binding partners can be further expanded by mapping out in vitro interactions between these partners and other proteins found in attachment complexes to show what is likely occurring in vivo (Figure 2.6). The protein- protein interactions at body wall muscle adhesion junctions have been mapped (reviewed in Moerman and Williams, 2006; Qadota and Benian, 2010). In pharyngeal muscle, however, the network of interactions is less well studied as a number of body wall muscle proteins are not found in this tissue, including PAT-3/β-integrin. To date, only one integrin, the alpha integrin ina-1 (Baum and Garriga, 1997) has been found to be expressed in pharyngeal muscle. This means there is not a one–to-one correspondence between attachment sites between these two types of muscle.  51  52  Figure 2.6 Protein interactions with PXL-1 PXL-1 is found in dense bodies (A) and M-lines (B), as well as attachment sites in the pharynx (C). When mapped out, the interactions found in each of these structures can be compared with previously documented interactions. In each panel, a solid line indicates a confirmed in vitro interaction, while a dotted line indicates that an interaction has only been observed using yeast two-hybrid. Proteins highlighted in yellow are found in both dense bodies and M-lines. Proteins found only in dense bodies (green) and those found only in M-lines (red) have also been included. All of the interactions confirmed in this study are labeled with blue lines and confirmed as shown in Figure 2.4. Figure 2.6 and related experiments were the work of Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA).  53  2.4.7 Comparing protein-protein interactions with genetic interactors of pxl-1 demonstrates unc-95 is necessary for pxl-1 localization in body wall muscle. In order to further characterize the interactions we discovered between PXL-1 and four of its binding partners: LIM-8, UIG-1, UNC-95, and UNC-96, we examined PXL-1 localization in body wall and pharyngeal muscle in the mutant background of each interactor. We concentrated our examination on the dense body localization of PXL-1 rather than the Mline localization because of the weak signal for PXL-1::GFP at M-lines. While PXL-1 is properly localized at dense bodies in lim-8, uig-1, and unc-96 mutant animals, PXL-1 is diffuse in unc-95 mutants and does not integrate into the dense body structure (Figure 2.7). The same experiment was carried out testing pharyngeal muscle in the four mutant backgrounds. In lim8, uig-1, unc-95, and unc-96 mutant worms, PXL-1 was properly localized to the pharyngeal muscle membrane (data not shown). While loss of unc-95 alters the localization of PXL-1 in body wall muscle, it does not affect its localization in the pharynx.  54  Figure 2.7 Localization of PXL-1 in the mutant background of binding partners PXL-1 immuno-staining was used to observe the subcellular localization of PXL-1 in four mutant backgrounds. A monoclonal antibody for actin binding protein α-actinin (ATN-1) was used to label dense bodies. While PXL-1 is properly localized to dense bodies in the lim-8, uig1, and unc-96 backgrounds, it is diffuse in the cytoplasm in the unc-95 background (PXL-1 staining is green in overlay, ATN-1 is purple). Bar, 10 µm. Figure 2.7 and related experiments were the work of Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA).  55  2.4.8 LIM domain redundancy in body wall muscle? Due to the number of different LIM domain containing proteins in the worm, it is possible that animals lacking pxl-1 expression have phenotypically wild type body wall muscle due to another LIM domain protein compensating for its loss. To test this, we used the strain DM7335, which has pxl-1 expression in the pharynx but not body wall muscle, and used RNAi feeding to knock down the expression of eight genes coding for LIM domain proteins with known expression in body wall muscle (Meissner et al. 2009) including zyx-1/zyxin, and alp1/enigma (Table 2.1). Other than our pxl-1 RNAi control, each tested gene does not have an RNAi phenotype in wild type animals, so we screened RNAi treated DM7335 animals for uncoordinated movement as well as observing the myofilament organization in muscle cells using polarized light microscopy. Only lim-8 had any significant effect, with RNAi treated animals displaying uncoordinated movement, and mildly disorganized myofilaments in body wall muscle cells.  56  Table 2.1 RNAi phenotypes of genes coding for LIM domain proteins in DM7335 animals lacking pxl-1 body wall muscle expression  Gene pxl-1 zyx-1 alp-1 mlp-1 lim-9 F42H10.3 lim-8  RNAi phenotype L1 arrest Wild type Wild type Wild type Wild type Wild type Uncoordinated  Body wall muscle structure Wild type Wild type Wild type Wild type Wild type Wild type Myofilaments mildly disorganized  57  2.4.9 Localization of PXL-1 interacting proteins in body wall muscle lacking PXL-1 PXL-1 is localized properly in the mutant background of each of its interactors except for unc-95 (Figure 2.7), so we examined the localization of interacting proteins in body wall muscle lacking pxl-1 expression using antibodies to stain the strain DM7335 in order to see if PXL-1 interacting proteins would be mislocalized (Figure 2.8). ATN-1/alpha-actinin, is normally localized in a pxl-1 background and was used to co-stain animals to mark dense body adhesion complexes (Figure 2.8). Each of the proteins tested that interact with PXL-1 are normally localized in body wall muscle lacking PXL-1. UNC-95 localization was normal, indicating that in body wall muscle PXL-1 requires UNC-95 for proper localization (Figure 2.7), but UNC-95 does not require PXL-1. UNC-112/kindlin, and DEB-1/vinculin are essential muscle proteins needed early in sarcomere assembly (as reviewed in Moerman and Williams, 2006) and are normally localized in a pxl-1 background (Figure 2.8) as expected. As seen in Figure 2.7, each of the proteins that PXL-1 interacts with also interact with multiple other proteins so PXL-1 may not be solely responsible for their proper localization. Normally UNC-96 is observed at dense bodies and M-lines using an unc-96::GFP translational fusion, but only at M-lines using antibody staining (Mercer et al., 2006). In animals lacking pxl-1 body wall muscle expression, however, we see M-line and dense body localization using the same UNC-96 antibody. It is possible that PXL-1 may normally sterically block the UNC-96 antibody from binding UNC-96 in dense bodies due to a physical interaction with UNC-96, but in dense bodies lacking PXL-1, the antibody is able to bind UNC-96 with better access to the molecule.  58  59  Figure 2.8 Localization of PXL-1 interacting proteins in body wall muscle lacking pxl-1 Immunostaining for proteins that interact with PXL-1 was carried out using worms that are viable due to pxl-1 expression in the pharynx, but lack body wall muscle expression of pxl-1. In body wall muscle lacking PXL-1, each of UNC-95, UNC-96, LIM-8, UIG-1, and UNC-112 are localized normally. UNC-96 is not normally observed in dense bodies with antibody staining in wild type animals (Mercer et al., 2006) but in nematodes lacking PXL-1, dense body (arrowheads) and M-line (arrows) localization of UNC-96 is clearly seen in animals stained with anti-UNC-96. Antibodies in column 1 are shown in green, and column 2 in purple in the overlay (column 3). Bar,10 µm. Figure 2.8 and related experiments were the work of Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA).  60  2.4.10 Paxillin is localized around a core of actin filaments in pharyngeal muscle The ring-like localization pattern of paxillin in the pharynx is intriguing because the attachment structures in pharyngeal muscle have previously been assumed to be structurally similar to dense bodies in body wall muscle, albeit with a different complement of proteins. We looked at the distribution of both actin and vinculin in pharyngeal muscle to determine their location relative to paxillin. DEB-1/vinculin co-localizes with PXL-1 in the pharynx in a mix of ring-like and smaller punctate structures (Figure 2.9F). As PXL-1 and DEB-1/vinculin are proteins that are in structures that anchor actin, we also looked at the distribution of actin in the pharynx. Antibody staining for actin in animals expressing PXL-1a/c::GFP shows that actin is distributed within the middle of the ring-like structures in pharyngeal muscle, as well as adjacent to the smaller punctate structures containing PXL-1 and DEB-1/vinculin (Figure 2.9C). Comparison of the actin anchoring structures in the pharyngeal muscle indicates a structural difference between attachments at the basal membrane and those at the apical (luminal) membrane (Figure 2.9, G-H). The adhesion complexes at basal membrane have a dome-like shape with actin filaments extending from middle of the structure. Attachment complexes at the luminal membrane are comparatively flatter, with little extension into the cell. Each of these attachment structures differs from those in body wall muscle, which extend from the sarcolemma deep into the cell. The visible structural difference between each attachment, and the intriguing pattern of localization for paxillin, vinculin, and actin raises questions about the organization of actin attachment structures found in pharyngeal muscle.  61  Figure 2.9 Actin attachment complexes in pharyngeal muscle Paxillin is localized to both full, and partial ring like structures in pharyngeal muscle. Full and partial ring-like PXL-1 localization using an anti-GFP antibody is shown in panel A, along with punctate actin localization in panel B using an anti-actin antibody. In the panel C overlay, actin is shown to be at the middle of the PXL-1 ring-like pattern with arrows indicating podosome-like attachment structures. The PXL-1 localization in pharyngeal muscle using an anti-GFP antibody (D) is identical to that of DEB-1/vinculin antibody staining (E), as shown in the overlay (F) of their localization patterns. The apical/lumenal face of the pharyngeal muscle (G) contains attachment structures (arrows) that differ in size and shape from those found in the basal/cuticular face (H) as shown by TEM. Filaments can be seen projecting into the muscle cell from each type of attachment as indicated by arrowheads. Membrane invaginations are also visible projecting inward from the basal membrane of the muscle cell as marked by a  62  star. Bar, 1 µm. EM images in Figure 2.9 were provided by Wayne Vogl, University of British Columbia, Canada.  63  2.5 Discussion 2.5.1 The pxl-1 gene in C. elegans encodes the ortholog of human paxillin The initial observation that C. elegans paxillin has only three strong LD motifs left open the possibility that it is not a true paxillin ortholog, but rather another member of the paxillin superfamily, more similar perhaps to Leupaxin or Hic-5. Leupaxin and Hic-5 are two proteins similar to paxillin, each with four LD motifs, compared with five in paxillin (reviewed in Tumbarello et al., 2002). Members of the paxillin superfamily have four LIM domains in the same synteny as paxillin (reviewed in Tumbarello et al., 2002) making them possible homologs of pxl-1. However, with the possible exception of zebrafish pxn (Crawford et al., 2003) only mammalian proteomes have paxillin and paxillin-related proteins. The third LD motif provides another convincing piece of data in support of PXL-1 being a true paxillin ortholog rather than a homolog of the paxillin superfamily. LD motif 3 is not a conventional LD motif in paxillin, as it does not fit the consensus sequence. This sets it apart from all other members of the paxillin superfamily, which have an LD3 motif that strongly matches the consensus sequence (Tumbarello et al., 2002). The sequence surrounding LD3 in H. sapiens paxillin aligns strongly with the LD3 sequence in C. elegans PXL-1 (Figure 2.1C) while PXL-1 is not similar to the LD3 of other members of the paxillin superfamily. Our protein interaction studies also support the idea that pxl-1 encodes a paxillin homolog. We found that PXL-1 binds DEB-1 (vinculin), a primary interacting protein of paxillin in adhesion complexes. DEB-1 is expressed in body wall muscle and pharyngeal muscle and is localized to actin attachment complexes (Barstead and Waterston, 1989). The gene unc-95 has also been proposed as a homolog of vertebrate paxillin (Broday et al., 2004). UNC-95 is 350 amino acids long, and contains one LIM domain near its carboxyl 64  terminus (Broday et al., 2004). Structurally, PXL-1 has much stronger domain conservation with all four LIM domains and three of five LD motifs found in vertebrate paxillin. Of note, UNC-95 has an important role in the assembly of body wall muscle (Broday et al., 2004), while PXL-1 is necessary for the structural integrity of pharyngeal muscle. Both genes are expressed in each muscle tissue, but each appears to only be necessary in one type of muscle. Whether UNC-95 is a weak paxillin homolog with a role in body wall muscle, or more similar to another LIM domain containing protein will require further study. Finally, it is known that vertebrate paxillin is heavily phosphorylated at tyrosines by Src family kinases (Turner et al., 1991); paxillin was originally identified as a phosphoprotein, 65-70 kD. In the western blot in Figure 2.4D, we noticed that nematode PXL-1 has a slower gel mobility than yeast-expressed nematode PXL-1. This would be compatible with PXL-1 being phosphorylated, since C. elegans has, but yeast lack, Src family tyrosine kinases. These combined observations lead us to conclude that PXL-1 is a paxillin homolog and is the nematode ortholog of paxillin. 2.5.2 Paxillin is required in the pharynx for muscle function We have found that paxillin is expressed in all body wall and pharyngeal muscle cells in C. elegans. Antibody staining and GFP fusion experiments have shown that paxillin is localized to actin attachment structures in each of these muscle types, as well as weakly to the M-line (myosin attachment structure) in body wall muscle. In animals lacking paxillin the pharynx appears to be properly formed, but internally the myofilaments of the pharyngeal sarcomeres are disorganized. This lack of organized sarcomeres is likely what is leading to paralysis and lack of contraction of the pharyngeal muscle and in turn starvation due to an inability to feed (Figure 2.3, A-D). Expressing pxl-1 in pharyngeal muscle of pxl-1 animals is  65  sufficient to rescue the L1 arrest phenotype and pharyngeal muscle functions normally. While the rescued animals display weak expression in the body wall muscle around the anterior tip of the worm, expression is almost fully restricted to the pharyngeal muscle. In body wall muscle cells posterior to the pharynx lacking paxillin, the cells are wild type in structure and movement is not impaired. It is unlikely that weak expression in a small subset of anterior body wall muscle cells is sufficient to rescue a body wall muscle specific phenotype. Thus, we conclude that PXL-1 has an integral role in the contraction of pharyngeal muscle, possibly in transmitting the forces generated by myosin/actin interaction, but no obvious functional role within body wall muscle. Loss of beta-integrin, ILK, UNC-112 or PINCH (Gettner et al., 1995; Hobert et al., 1999; Rogalski et al., 2000; Mackinnon et al., 2002; Norman et al., 2007) all lead to embryonic lethality in C. elegans. The characteristic phenotype of mutations in these genes is a Pat animal (Paralyzed and Arrested at Two-fold) (Williams and Waterston, 1994). These proteins are all involved in integrin placement and organization of the adhesion complex to accept thick and thin filaments in the initial phase of myofilament formation during development. By contrast, PXL-1 is not required until later in development as pxl-1 animals die as normal length animals during the first larval stage. While the function of paxillin remains to be determined in body wall muscle, it is clearly important for pharyngeal muscle function. This difference in paxillin function in two different muscle tissues is intriguing, and may be the result of how myofilaments are organized in body wall muscle versus the pharynx (see below). 2.5.3 Paxillin’s role in body wall muscle? While pxl-1 is expressed in both pharyngeal and body wall muscle, we have found it to only be essential in the pharynx. In the strain DM7335, which lacks pxl-1 expression in body  66  wall muscle, the myofilament structure is wild type (Figure 2.5). It is surprising that pxl-1 appears to be dispensable in body wall muscle. However, other body wall muscle genes encoding LIM domain proteins lack a mutant or RNAi phenotype including zyx-1/zyxin (Smith et al., 2002), and alp-1 (Han and Beckerle, 2009), which encodes homologs for both alphaactinin associated LIM protein, and the LIM protein enigma (McKeown et al., 2006). The lack of a mutant or RNAi phenotype for these genes raises the question of whether there is redundancy, or genetic buffering, where more than one of these LIM domain proteins would need to be lost in order to elicit a phenotype. In our RNAi screen of genes encoding LIM domain proteins carried out using strain DM7335 that lacks pxl-1 expression in body wall muscle (Table 2.1), lim-8 knockdown resulted in uncoordinated movement and mild disorganization of the myofilaments. In a wild type background, RNAi for lim-8 does not have such an effect (Qadota et al., 2007). While pxl-1 does not have a clear role in body wall muscle and its loss does not cause any visual changes to the tissue, our observations with lim-8 indicate that muscle lacking pxl-1 is not as robust as wild type muscle when exposed to additional gene loss. 2.5.4 Muscle attachment structures in C. elegans pharyngeal muscle are structurally similar to those found in podosomes The actin anchoring dense bodies in the worm have attracted interest from researchers studying focal adhesion complexes due to the similarity in protein composition between these two dynamic structures. Less well studied are the attachment structures of the nematode pharynx, which we propose resemble those in podosomes. In podosomes, actin filaments form the core of the attachment complex, and are surrounded by a ring of proteins found in focal adhesion proteins such as vinculin, paxillin, and integrin heterodimers (reviewed in Wernimont  67  et al., 2008). Whereas the dense body structures in C. elegans body wall muscle appear punctate when observed using a fluorescent marker for paxillin, the attachment structures in the pharynx appear ring-like, which is what we would expect to see with a podosome-like structure. In EM images, the body wall muscle dense body (Figure 2.5, D-F) and pharyngeal attachment complex (Figure 2.9, G-H) appear as dense structures at their respective membranes. Membrane invaginations are also present projecting inwards from the basal membrane of the pharyngeal muscle as well, however they do not appear to be associated with the sarcomere itself (Figure 2.9H). The assumption has been that the attachment structure in pharyngeal muscle is similar to the dense body in body wall muscle, with actin filaments attaching outward from a core of attachment proteins, rather than actin forming a core upon which attachment proteins form a ring-like structure to anchor it. Here we provide the first data that indicates otherwise. PXL-1a/c::GFP localization in the pharynx is in ring like structures within the muscle cell membranes as well as comparatively smaller punctate structures. Actin staining reveals that actin is localized within the middle of the paxillin containing rings, as well as directly adjacent to paxillin punctae (Figure 2.9C). This raises an interesting question as to how ring like adhesion structures are formed in pharyngeal muscle. It is possible that the initial accumulation of paxillin in the membrane leads to actin recruitment and attachment, and subsequent encircling of the actin core by paxillin and other attachment proteins. In Figure 2.9C, both partial and full paxillin containing rings can be seen, each encircling concentrated actin. Determining the exact mechanism of building a podosome-like structure will require future experimentation. Defining the pharyngeal muscle attachment structure as podosome-like is supported by the expression and localization of a number of other podosome associated proteins. DEB-1  68  (vinculin) co-localizes with PXL-1 in the pharyngeal muscle membrane in a ring-like pattern (Figure 2.9F). INA-1 (alpha-integrin), and ATN-1 (alpha-actinin) are expressed in pharyngeal muscle (Hresko et al., 1994; Baum and Garriga, 1997), but their exact localization pattern has not been established. Surprisingly, PAT-3 (beta-integrin) is not expressed in developing and mature pharyngeal muscle. It is possible that there is another beta-integrin in the C. elegans genome, however a suitable candidate has not yet been identified. While a null mutant for DEB-1 arrests embryonically and has paralyzed body wall muscle, the pharyngeal muscle is not completely paralyzed in all animals (Barstead and Waterston, 1991). In contrast, the pharyngeal muscle in pxl-1 null mutants is paralyzed, while the body wall muscle appears unaffected. The requirement of paxillin in the pharyngeal muscle for proper sarcomere organization and muscle contraction indicates paxillin is a key component of the pharyngeal sarcomere. Further investigation into the requirement and localization of proteins found within pharyngeal muscle will hopefully lead to a more complete understanding of the structure and function of the sarcomere in the pharynx.  69  3. CPNA-1, A COPINE DOMAIN PROTEIN, IS ESSENTIAL FOR MYOFILAMENT STABILITY AT INTEGRIN ADHESION SITES IN C. ELEGANS 3.1 Synopsis I have identified cpna-1 (F31D5.3) as a novel essential muscle gene in the nematode C. elegans. Antibodies specific to CPNA-1, as well as a GFP translational fusion, are localized to integrin attachment sites in the body wall muscle of C. elegans. CPNA-1 contains an Nterminal transmembrane domain and a C-terminal copine domain, and binds to other sarcomeric proteins including PAT-6 (actopaxin), and UNC-89 (obscurin). Proper CPNA-1 localization is dependent upon PAT-6 in embryonic and adult muscle. Nematodes lacking cpna-1 arrest at the two-fold stage of embryogenesis, and display disruption of the myofilament lattice. While the thick filament component myosin heavy chain, MYO-3, and the M-line component, UNC-89, are initially able to properly localize in cpna-1 null mutants, when contraction would normally begin, MYO-3 and UNC-89 become mislocalized into large foci and the animals die. Based on protein interaction data, I propose that CPNA-1 acts as a linker between an integrin associated protein, PAT-6, and membrane-distal components of focal adhesions in the muscle of C. elegans in the role of maintaining sarcomere integrity.  70  3.2 Introduction Sarcomeres, highly ordered assemblages of several hundred proteins, perform the work of muscle contraction. Despite ever increasing knowledge of the components and functions of individual sarcomeric proteins, we still do not understand how sarcomeres are assembled during development, or maintained during muscle contraction. The nematode, C. elegans, is an excellent model genetic system in which to characterize proteins in the sarcomere, and the order in which they are important in development (Waterston, 1988; Moerman and Fire, 1997; Moerman and Williams, 2006). In addition to being an excellent system in which to carry out mutational analysis in a whole organism, through forward and reverse genetics, this organism offers several advantages for studying striated muscle. Two advantages of particular note are its optical transparency and its mode of reproduction. The transparency of the nematode allows for evaluation of sarcomeric structure by polarized light and visualization of GFP tagged proteins. As the nematode can propagate as a self-fertilizing hermaphrodite many muscle mutants can be maintained even though these mutants are unable to mate. Two major attachment complexes are responsible for building a functional sarcomere in C. elegans body wall muscle: the dense body and the M-line. Prominent proteins in these complexes are alpha and beta integrin (PAT-2, PAT-3) (Gettner et al., 1995), kindlin (UNC112) (Rogalski et al., 2000), PINCH (UNC-97) (Hobert et al., 1999), ILK (PAT-4) (Mackinnon et al., 2002), and actopaxin (PAT-6) (Lin et al., 2003). Another essential protein, vinculin (DEB-1) is found only within dense bodies (Barstead and Waterston, 1991), and the giant protein UNC-89 is found solely within M-lines (Benian et al., 1996). The Z-disc analog in C. elegans body wall muscle is the dense body, an array of proteins anchored by the PAT-2/PAT3 integrin heterodimer to the sarcolemma, and responsible for anchoring thin filaments composed mainly of actin (see Figure 1.4). The M-line anchors myosin heavy chain containing 71  thick filaments and is structurally similar to a dense body, but lacks the actin anchoring proteins DEB-1/vinculin and ATN-1/alpha-actinin (Francis and Waterston, 1991). Each of these attachment complexes is needed to transmit the force generated by muscle contraction into movement of the worm. Hypodermal cells lie between the body wall muscle cells and the cuticle, and the body wall muscle contraction force is stabilized through the hypodermal cells by hemidesmosome-like fibrous organelles (Bartnik et al., 1986; Francis and Waterston, 1991). The aforementioned adhesion proteins are required in body wall muscle in C. elegans to initiate sarcomere assembly and for muscle to function properly. Without these essential attachment complex proteins, embryos arrest at the two-fold stage of embryonic development (Williams and Waterston, 1994), a phenotype unique to defects in genes required for structure, muscle assembly, and muscle maintenance in C. elegans. Early work on beta-integrin (PAT-3) (Gettner et al., 1995) and kindlin (UNC-112) (Rogalski et al., 2000) in C. elegans first implicated these proteins as key molecules in muscle assembly and maintenance. The worm has continued to be a valuable model organism for identification and study of genes required for early steps in muscle assembly (reviewed in Moerman and Williams, 2006). There are many similarities between dense body and M-line assembly and the formation of focal adhesion complexes found in tissue culture cells (reviewed in Cox and Hardin, 2004; Moerman and Williams, 2006). Focal adhesion complexes are dynamic structures involved in the extension of a cell membrane for the purposes of movement. The polymerization of actin combined with attachment of the cell surface to the extracellular matrix allows for the movement of cells (Burridge et al., 1988; Ridley et al., 2003). The process of energy transmission mediated by focal adhesions is similar to that carried out by the anchorage of filaments to the sarcolemma via attachment complexes in C. elegans.  72  In addition to the essential components for initiating sarcomere assembly, the sarcomere contains a number of extraordinarily large polypeptides (700,000 Da—4 MDa) composed of multiple copies of immunoglobulin (Ig) and fibronectin type 3 (Fn3) domains, one and even two protein kinase domains, and in some proteins, elastic regions. In general, results indicate that these giants act as scaffolds for the assembly of other proteins into the sarcomere (Kontrogianni-Konstantopoulos et al., 2009). The giant protein for which most is known is vertebrate titin (Granzier and Labeit, 2004; Linke, 2008). In addition to its role in sarcomere assembly and passive tension, there is experimental support for the idea that the protein kinase domain of titin acts as a sensor of muscle activity, and transmits signals to the nucleus to increase sarcomere gene expression as a way to maintain and build muscle mass (Lange et al., 2005). Much less is currently known about the function of the other titin-like giant proteins. C. elegans striated muscle contains three such polypeptides: twitchin (754,000 Da) located in the outer region of the A-band (Moerman et al., 1988; Benian et al., 1989; Benian et al., 1993), TTN-1 (2.2 MDa) located in the I-band (Flaherty et al., 2002; Forbes et al., 2010), and UNC-89 (as large as 900,000 Da) located at the M-line (Benian et al., 1996; Small et al., 2004). Loss of function mutations in unc-89 result in animals that display reduced locomotion, disorganized myofibrils, especially at the A-band, and lack M-lines (Waterston et al., 1980; Benian et al., 1999). unc-89 mutants show a disorganization of myosin thick filaments by immunostaining (Qadota et al., 2008a). unc-89 is a complex gene: through the use of 3 promoters and alternative splicing, at least 6 major polypeptides are generated, ranging in size from 156,000 to 900,000 Da (Benian et al., 1996; Small et al., 2004; Ferrara et al., 2005). The largest of these isoforms, UNC-89-B and UNC-89-F, which are each ~900,000 Da, consist of 53 Ig domains, 2 Fn3 domains, a triplet of SH3, DH and PH domains near their N-termini, and  73  two protein kinase domains (called PK1 and PK2) near their C termini. Antibodies show UNC89 localizes to the M-line (Benian et al., 1996; Small et al., 2004). The human homolog of UNC-89 is obscurin (Bang et al., 2001; Young et al., 2001; Kontrogianni-Konstantopoulos et al., 2009). Using high throughput RNAi, I propose that identification of additional proteins involved in sarcomere assembly can be identified by focusing on the paralyzed and arrested at two-fold stage (Pat) phenotype that occurs with loss of essential muscle genes in nematodes. After identification, of novel genes, they can be linked into the existing network of identified proteins. Four additional Pat genes, not previously annotated, were identified from a muscle transcriptome-wide RNAi screen designed to identify novel Pat genes (Meissner et al., 2009). One of the genes F31D5.3, codes for a protein with an integrin-like A domain at its C-terminal, and bears strong homology to the human copine family of proteins. Little is known about copines in other organisms, although some copines have been found to be present in human heart and skeletal muscle (Cowland et al., 2003). In a second and parallel approach we identified F31D5.3 through a 2-hybrid screen as a new binding partner for the N-terminal region of the giant protein UNC-89. The gene has been named cpna-1 for copine domain atypical. A deletion allele for F31D5.3/cpna-1, called gk266, provided by the C. elegans Gene Knockout Consortium (Vancouver), is lethal, arresting elongation at the two-fold stage of embryogenesis, a phenotype similar to mutations in muscle-affecting genes. We have previously shown that treatment of worms with cpna-1 RNAi after they hatch from embryos leads to severely disorganized myofilaments in body wall muscle. Expression data from SAGE experiments (Meissner et al., 2009) shows highly elevated expression of cpna-1 in embryonic body wall muscle compared to other tissue types, and a ~3.5 fold enrichment in expression  74  levels compared with whole embryos. Using an antibody specific to the protein as well as a GFP translational fusion, we have determined that CPNA-1 localizes to muscle adhesion complexes (M-lines and dense bodies) at or near the plasma membrane. In addition to interacting with UNC-89 and three other M-line proteins, we found that CPNA-1 interacts with PAT-6 (actopaxin), located at the base of M-lines and dense bodies, and a member of a conserved four-protein complex that associates with integrin. In this chapter of the thesis I will demonstrate using epistatic analysis and protein interaction data, that CPNA-1 is required for structural integrity of the sarcomere and proper myofilament localization.  75  3.3 Materials and Methods 3.3.1 Strains used N2 (Bristol) is the primary wild-type strain used for C. elegans research, and standard growth conditions were used (Brenner, 1974). VC516 (cpna-1(gk266)/mIn1[mIs14 dpy10(e128)] II) contains a deletion in cpna-1 and VC209 (lim-9(gk106) I) and VC349 (lim9(gk210) I) carry mutations in the gene lim-9, and each was provided by the International C. elegans Gene Knockout Consortium (Vancouver, Canada). DM7439 (ex217) was created by transforming wild type worms with the GFP recombineered fosmid fDM1217, and by crossing in the gk266 allele from strain VC516, the strain DM5151 (cpna-1(gk266)/+; ex217) was created. Strain WB201 (pat-4(st587) III; ex(pat-4::GFP/pat-3::YFP)) was provided by Ben Williams (University of Illinois, Chicago, USA). Strains RW3600 (pat-3(st564)/qC1 dpy19(e1259) glp-1(q339) III), and RW3568 (pat-6(st561)/dpy-9(e12) IV) were provided by Robert Waterston (University of Washington, Seattle, USA), and RW1596 (myo-3(st386) V; stEx30) was provided by Pam Hoppe (Western Michigan University, Kalamazoo, USA). Strain GB244 (unc-96(sf18) X) was provided by the Caenorhabditis Genetics Center (University of Minnesota, Minneapolis, USA). Strain HE75 (unc-89(su75)I) was provided by Henry Epstein (University of Texas Medical Branch at Galveston, Galveston, USA). 3.3.2 Screening of yeast two-hybrid library Two-hybrid screening was performed as described in Miller et al. (2006). The first screen of the RB2 library of C. elegans random primed cDNAs (kindly provided by Robert Barstead, Oklahoma Medical Research Foundation, Oklahoma, USA), used the bait plasmid pGBDU-UNC-89 GX34 which contains coding sequence for UNC-89 Ig1-5. To make the Ig176  5 bait, an insert generated by PCR using primers GX3 with added BamHI site and GX4 with added XhoI site was ligated into pGBDU-C1 (see Table A.1 for primer sequences). From a screen of 819,500 colonies, the following prey clones were isolated: 35 preys representing VIG-1, one prey from UNC-54 (residues 1-602), one prey from KETN-1 (residues 4394-4889), and one prey from CPNA-1 (called GX9-109, residues 173-1107). A second screen of the library used a bait plasmid that contains coding sequence for UNC-89 Ig2-5. This bait was generated by insertion of a PCR fragment using primers GX2/5 with added BamHI site and GX4. From a screen of 1,206,000 colonies, the following prey clones were isolated: 4 preys from VIG-1, one prey from UNC-54 (residues 1-602), one prey from MEL-26 (residues 25343), and one prey from CPNA-1 (called B15-101, residues 825-1058). Interaction with VIG-1 was not pursued because it is part of a RISC complex (Caudy et al., 2003). We did not pursue interaction with UNC-54 (myosin heavy chain B), which is located in the polar regions of the A-band (Miller et al., 1983), rather than the M-line where UNC-89 is located. Similarly, interaction with KETN-1 was not pursued, as KETN-1 is located in the I-band/dense body region of the sarcomere (Ono et al., 2006). The interaction of UNC-89 and MEL-26 has been previously described (Wilson et al., 2012). Yeast two-hybrid screening was performed by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA). 3.3.3 Construction of 2-hybrid clones covering UNC-89-B and its screening with CPNA-1 Seventeen segments (Figure 3.5B), covering all of UNC-89-B, were cloned into 2hybrid bait and prey vectors. Three of these segments were described previously: Fn1-Ig52PK1 and Ig53-Fn2-PK2 (Qadota et al., 2008b); and Interkinase (Xiong et al., 2009). For the other segments, corresponding cDNA fragments of UNC-89-B were amplified by using PCR with primers listed in Table A.1 and cloned into pBluescript. After confirming that the DNA  77  sequence of each fragment was error-free, each fragment was cloned into pGBDU or pGAD yeast 2-hybrid plasmids. To screen for interaction with CPNA-1, first, PJ69-4A yeast host strains carrying each fragment of UNC-89-B in pGBDU were prepared, then each of these strains was transformed with CPNA-1 prey clone B15-101 (residues 825-1058). The yeast 2hybrid assay was performed by scoring growth on media lacking histidine or adenine. This was performed by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA). 3.3.4 Screening of yeast two-hybrid bookshelf of known M-line and dense body proteins CPNA-1 was used as both bait and prey to screen a collection (“bookshelf”) of 30 known components of nematode M-lines and dense bodies (Table A.3). Both CPNA-1 (8251058) and CPNA-1 (173-1107) were used. This was performed by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA). 3.3.5 Domain mapping of UNC-89 Ig1-5, SCPL-1, LIM-9, PAT-6, and UNC-96 To map the region of UNC-89 Ig1-5 minimally required for interaction with CPNA-1, the following deletion derivatives of Ig1-5 were generated by PCR using the following primers (sequences given in Table A.1 and Table A.2): for Ig1-4, primers GX3 (5’) and GX1/4 (3’); for Ig1-3, primers GX3 (5’) and GX1/3 (3’); for Ig2-5, primers GX2/5 (5’) and GX4 (3’); for Ig35, primers GX3/5 (5’) and GX4 (3’); and for Ig2-3, primers GX2/5 (5’) and GX1/3 (3’). In each case, the 5’ primer has an added BamHI site, and the 3’ primer has an added XhoI site for cloning each fragment into pBluescript. After identifying pBluescript clones lacking PCR induced errors, the fragments were cloned into pGBDU and then tested by 2-hybrid against GX9-109 library prey clone (CPNA-1 (173-1107). The domain mapping experiments utilized deletion derivatives described previously: SCPL-1 (Qadota et al., 2008b), LIM-9 (Qadota et al.,  78  2007), PAT-6 (Lin et al., 2003), and UNC-96 (Mercer et al., 2006; Qadota et al., 2007). Derivatives of SCPL-1, LIM-9 and PAT-6 in pGAD were tested against CPNA-1 (173-1107) in pGBDU. Derivatives of UNC-96 in pGBDU were tested against CPNA-1 (825-1058) in pACT. This was performed by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA). 3.3.6 Testing for interaction of UNC-89 Ig1-5 against copine domains of other C. elegans proteins To test the specificity of interaction between UNC-89 Ig 1-5 and the copine domain of CPNA-1, the copine domains of other copine domain containing proteins were generated by PCR using the primers listed in Table A.2. The 5’ primers have added BamHI or SmaI sites and the 3’ primers have added XhoI sites. The products were ligated into pBluescript, and after identification of clones containing correct sequences, the inserts were excised and cloned into pGBDU and pGAD vectors (available from Addgene, USA). Yeast two hybrid assays were performed by using pGAD copine domain clones against pGBDU UNC-89 Ig 1-5 yeast strain, and pGBDU copine domain clones against the pGAD UNC-89 Ig1-5 clone respectively. The results of both assays are consistent and presented in Figure A.1. This was performed by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA). 3.3.7 Testing for interaction of UNC-89 Ig1-5 and UNC-96 (201-418) against single amino acid mutants of the copine domain of CPNA-1 To test if the conserved amino acid residues within the copine domain of CPNA-1 are important for the binding with other proteins, four point mutants were generated by two rounds of PCR using the primers listed in Table A.2. The first round of PCR used the following primer  79  combinations: for mutant G922V, the first pair of primers are pGBDU-B15-5 (5’) and G922V2 (3’) and the second pair of primers are G922V-1(5’) and pGBDU-B15-3 (3’); for mutant Y985A, the first pair of primers are pGBDU-B15-5 (5’) and Y985A-2 (3’) and the second pair of primers are Y985A-1 (5’) and pGBDU-b15-3(3’); for mutant Y985F, the first pair of primers are pGBDU-B15-5 (5’) and Y985F-2 (3’) and the second pair of primers are Y985F-2 (5’) and pGBDU-B15-3(3’); and for mutant S1015A , the first pair of primers are pGBDUB15-5 (5’) and S1015A-2 (3’) and the second pair of primers are S1015-1(5’) and pGBDUB15-3(3’). Each mutant primer pair has added an BamHI site for the 5’ primer and an EcoRI site for the 3’ primer. The products of the first round of PCR were gel purified and used as templates after 1: 10 dilution with water the second round of PCR by using 5’ primer pGBDUB15-5 site and 3’ primer pGBDU-B15-3. Then the products of the second round of PCR were gel purified and cloned into the pBluescript vector. After identification of error free clones, the mutant fragments were cloned into pGAD and tested against pGBDU UNC-89 Ig1-5 and pGBDU UNC-96 (201-418) yeast strains respectively. Mutant fragments were also cloned into pGBDU and tested against pGAD UNC-89 Ig1-5 and pGAD UNC-96 (201-418). The results of yeast two hybrid assays are presented in Figure 3.7B. This was performed by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA). 3.3.8 Demonstration of interactions using purified proteins To verify the interaction of CPNA-1 with UNC-89 Ig1-3, CPNA-1 was pulled out of a worm lysate using GST tagged protein containing the Ig 1-3 domains of UNC-89. To generate GST-Ig1-3, the insert from pGBDU-Ig1-3 was excised with BamHI and BglII and cloned into the BamHI site of pGEX-KK1. After identifying a clone with the proper orientation, a GST fusion protein was prepared. Worm lysate was prepared as follows: a mixed population of wild  80  type strain N2 was ground to a fine powder in a mortar and pestle in liquid nitrogen; this powder was added at a ratio of approximately 1:5 to 1 ml of a lysis buffer ( 20 mM Tris pH8.0, 10% glycerol, 0.5% NP-40, 2 mM EDTA, 150 mM NaCl, and protease inhibitors cocktail (Roche mini-Complete)), vortexed for 1 minute, and then debris was pelleted by spinning at top speed in a microcentrifuge at 4oC for 10 minutes. Thirty µl of packed glutathione agarose beads (Sigma-Aldrich, USA, cat. no. G4510) coated with either GST or GST-Ig1-3 (30 µgs each) were incubated with 500 µl worm lysate (approximately 5-10 mg/ml total protein) for 2 hours with mixing at 4o. The beads were then washed 3 times with cold lysis buffer, and the bound proteins were eluted in 2X Laemmli sample buffer (vortexed, heated at 95o 5 min, vortexed, spun hard in microcentrifuge, and the supernatants saved). Eluted proteins were separated by SDS-PAGE, blotted and reacted with either anti-CPNA-1 or anti-GST (SigmaAldrich, USA, cat. no. A7340), and detected by ECL. An HA bead pulldown assay, performed essentially as described in Qadota et al. 2008 was used to verify the interaction between CPNA-1 (825-1058) and UNC-96 (201-418). In this assay yeast was used to express HA tagged CPNA-1 (copine), using primers listed in Table A.2. Construction and purification of MBP-UNC-96 (201-418) was described in Mercer et al. (2006). Far western assays, performed essentially as described in Mercer et al. 2006 were used to verify the interactions between CPNA-1 and UNC-89 Ig1-3, and between CPNA-1 and either SCPL-1, LIM-9 or PAT-6. To express MBP-CPNA-1 (825-1058), the B15-101 prey clone was digested with XhoI and the insert was cloned into the XhoI site of pMAL-KK2. After identifying a clone with proper orientation, MBP-CPNA-1 (825-1058) was expressed and purified. To express 6His-Ig1-3, pGBDU-Ig1-3 was digested with BamHI and BglII and the insert was ligated into pET28a. A clone with the proper orientation was used to produce 6His-Ig1-3. MBP-CPNA-1 (825-1058) was run on SDS-PAGE, transferred to a blot, incubated with 6His-Ig1-3, and then detected 81  with anti-His and anti-rabbit-HRP. To express His-CPNA-1 (173-1107), pGBDU-CPNA-1 (173-1107) was digested with EcoRI (site in the vector) and SalI (in the insert), and this fragment, encoding the N-terminal 2/3 of CPNA-1 (173-1107) was ligated into pET28a, to create “clone a”. The C-terminal 1/3 of CPNA-1 (173-1107) was generated by PCR using primers and having added HindIII and XhoI sites, and cloned into pBluescript. After finding an error free pBluescript clone, the insert was excised with HindIII and XhoI and ligated into pET28a. The resulting clone was digested with EcoRI (in the vector) and SalI (in the CPNA-1 insert), and the large fragment containing mostly vector sequence and the 3’ portion of the insert was ligated to insert of “clone a” previously digested with EcoRI and SalI, to produce a plasmid that could produce His-CPNA-1 (173-1107). His-CPNA-1 (173-1107) was run on SDS-PAGE, transferred to a blot, incubated with either MBP-SCPL-1 (phosphatase domain; Qadota et al., 2008b), or MBP-PAT-6 (full length; Lin et al., 2003), or MBP-LIM-9 (LIM domains; Qadota et al., 2007), and then detected with anti-MBP-HRP. Procedures for growth of yeast for expressing HA tagged proteins, and growth of bacteria and purification of GST, MBP and His tagged proteins were described previously (Mercer et al., 2006; Qadota et al., 2008b). This was performed by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA). 3.3.9 Generation of antibodies to CPNA-1 Residues 176-385 of CPNA-1b were expressed and purified in E. coli as a GST fusion protein. To do this, primers tag-149-1 and tag-149-2 with added EcoRI and XhoI sites were used to create a PCR fragment using cDNA GX9-109 as template. This fragment was cloned into pBluescript, and a clone without PCR-induced errors was used for excising the insert. This insert was ligated into pGEX-KK1 using the same enzyme sites. Using methods described in  82  Mercer et al. (2006), GST-CPNA-1(176-385) was expressed, purified and shipped to Spring Valley Laboratories (Woodbine, USA) for generation of rabbit polyclonal antibodies. Most of the anti-GST antibodies were removed by immunoprecipitation using GST, and anti-CPNA-1 was affinity purified using Affigel conjugated with GST-CPNA-1(176-385), as described previously (Mercer et al., 2003). Antibody production was carried out by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA). 3.3.10 Western blots A procedure was used to prepare total protein lysates (Hannak et al., 2002) from wild type and from worms that had undergone pat-6 (RNAi) by L1 feeding (Miller et al., 2006). Approx. 50-100 µgs total protein were separated by a 10% SDS-PAGE, transferred to nitrocellulose membrane, and reacted with affinity purified and OP50 E. coli absorbed antiCPNA-1 at 1:100 or 1:500 dilution, or affinity purified and OP50 E. coli absorbed anti-PAT-6 at 1:200 dilution, followed by reaction with appropriate HRP-conjugated secondary antibodies and visualization using enhanced chemiluminescence (Pierce, USA, cat. no. 32106). This was performed by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA). 3.3.11 Immunolocalization in adult body wall muscle Worms were fixed by the Nonet method (Nonet et al., 1993) for immunostaining. Primary antibodies were used at the following dilutions: anti-CPNA-1 at 1:100, anti-UNC-89 (monoclonal MH42 (Benian et al., 1996)) at 1:200, anti-α-actinin (MH35 (Francis and Waterston, 1991) at 1:200, anti-myosin heavy chain A (MHC A)(5-6 (Miller et al., 1983)) at 1:200, and anti-PAT-6 at 1:100. For anti-CPNA-1, the secondary was anti-rabbit conjugated to Alexa488 (the one exception was when DM5115 was stained; then we used anti-rabbit-Cy3); for the monoclonals (MH35, MH42 and 5-6) the secondary was anti-mouse-Alexa 594; and for 83  anti-PAT-6, we used anti-rat-Alexa594. Images were captured at room temperature with a Zeiss confocal system (LSM510) equipped with an Axiovert 100M microscope using an Apochromat 63x/1.4 oil objective in 2.5x zoom mode. The color balances of the images were adjusted with Adobe Photoshop. This was performed by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA). 3.3.12 RNAi screen for essential muscle genes in liquid culture The N2 strain was used for these experiments following the protocol described previously (Lehner et al., 2006). RNAi clones were grown in 96-well plates overnight at 37°C in 150 ml of L-broth containing 50 mg/ml carbenicillin and 8% glycerol. The following morning, 10 ml of each freshly grown bacterial stock was transferred to 96- well plates of Liquid NGM media (50 µl per well) containing 4 mM IPTG and 50 mg/ml carbenicillin. Liquid NGM plates were incubated for 16 hours at 20 °C and then 37 °C for 2 hours. Four synchronized L3 worms were then transferred into each well using a Copas Biosorter-250 (Union Biometrica) and incubated at 20°C for 72 hours. Each well was scored for animals that exhibited embryonic lethality, paralysis, or sterility. All RNAi treatments that resulted in animals with the aforementioned phenotypes were re-screened using solid NGM media. RNAi bacterial cultures were grown overnight in 96-well plates containing 200 µl of L-broth with 50 mg/ml carbenicillin. NGM plates containing 1 mM IPTG and 50 mg/ml carbenicillin and were then streaked with the freshly grown RNAi bacterial cultures and incubated at 20°C for 24 hours. Two L4 animals were then transferred to each plate, and incubated for 72 hours at 20°C. Two F1 progeny at the L4 stage were then transferred to each of three replicate plates for each RNAi treatment, and incubated at 20°C for 24 hours to lay eggs. All of the plates were examined for animals exhibiting an early embryonic arrest phenotype, a mixed stage  84  embryonic arrest phenotype, or a two-fold stage arrest phenotype. The same protocol was used to test strains with hypomorphic alleles for unc-95 and unc-97 as found in the Appendix. 3.3.13 RNAi administered post-embryonically RNAi of cpna-1, pat-6 and unc-97 was performed by feeding wild type strain N2 worms bacteria expressing double-stranded RNA beginning at the L1 larval stage and continuing until the animals reached adulthood. Adults were then fixed and immunostained for pat-6 and unc-97 (carried out by Ge Xiong, Hiroshi Qadota, and Guy Benian, Emory University, Atlanta, USA), and polarized light microscopy was used to observe the myofilaments in cpna-1 (RNAi) animals. 3.3.14 Generation and characterization of antibodies to PAT-6 Residues 1-99 of PAT-6 were expressed in E. coli and purified as a GST fusion protein. Primers PAT-6-1 and PAT-6-99 with added BamHI and XhoI sites were used to amplify a fragment from the full length clone of pat-6 in the 2-hybrid bait vector. The resulting fragment was cloned directly into BamHI and XhoI cut pGEX-KK1. After identification of a clone with an error-free insert, the clone was used to produce GST-PAT-6(1-99). This protein was shipped to Spring Valley Laboratories (USA) for generation of polyclonal antibodies in rats. Affinity purification was performed using Affigel conjugated to GST-PAT-6(1-99). Western blot extracts, as described above, were prepared from adults that had been subjected to RNAi by feeding beginning at the L1 stage, either with bacteria containing the empty vector or pat-6 cDNA sequence, and subjected to western blot analysis using anti-PAT-6 (see Figure A.3). Wild type adult muscle was co-stained with anti-CPNA-1 and anti-PAT-6 and imaged as  85  described above. This was performed by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA). 3.3.14 Localization of CPNA-1 in embryonic muscle, and affect of various Pat mutants Antibody staining of C. elegans embryos was carried out using a method modified from (Albertson, 1984). Adult worms were washed off plates and incubated for five minutes in embryo preparation solution containing 75% dH20, 20% sodium hypochlorite, and 5% 10 M NaOH to dissolve the adult worm cuticles. After spinning the suspension down, the remaining embryos and worm carcasses were incubated for another 2 minutes in the embryo preparation solution, followed by 3 washes in M9 buffer. The remaining embryos were then either suspended into a 4% sucrose, 1 mM EDTA pH 7.4 solution, or left to incubate for 6 hours to obtain later stage embryos prior to resuspension. The egg suspension was transferred to glass slides coated with 2 mg/ml poly-L-lysine, covered by a rectangular glass coverslip, and frozen on an aluminum slab at -80 °C overnight. The coverslips were removed from the slides using a razor blade, and slides were transferred to -20 °C acetone for 4 minutes, and subsequent 1 minute intervals of 75% acetone at 20 °C, 50% acetone, 25% acetone, and Tween-TBS for 2 minutes. Primary antibodies solutions were added to the slides for 5 hours, and included anti PAT-3 (MH25 (Francis and Waterston, 1985)) at 1/500 dilution, anti-DEB-1/vinculin (MH24 (Francis and Waterston, 1985)) at 1/250 dilution, anti-PAT-4 at 1/40 dilution, anti-PAT-6 at 1/40 dilution, anti MYO-3 (DM5-6) (Miller et al., 1983) at 1/250 dilution. After incubation, slides were washed for one hour in TBS-Tween, then removed and coated with secondary antibodies for 3 hours: anti-rabbit Alexa 488 (Invitrogen) for PAT-4 and CPNA-1 antibodies, anti-mouse Alexa 594 (Invitrogen) for MH25, MH24, DM5-6, and anti-rat Alexa 594 (Invitrogen) for anti-PAT-6. After a 1 hour wash in TBS-Tween, mounting solution was added  86  (20 mM Tris (pH 8.0), 0.2 M DABCO, and 90% glycerol), and slides were sealed with nail polish. 3.3.15 Generation of a translational GFP fusion for cpna-1 A C-terminal GFP translational fusion construct was created for cpna-1 using the fosmid recombineering method described previously (Tursun et al., 2009). The recombineered fosmid was named fDM1217 and a solution containing 94 ng/µl pRF4 rol-6(su1006dm) and 6 ng/µl fDM1217 was injected into the gonad of adult N2 animals using a microinjection setup featuring a Zeiss inverted compound microscope (IM35), using conventional methods as described in Mello et al. (1991). 3.3.16 Yeast 3-hybrid assay The yeast three-hybrid assay was done essentially as described in Lin et al. (2003) and carried out by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA).  3.3.17 Sequence analysis BLAST, using CPNA-1 as query against the C. elegans translated genome was used to identify the complete set of copine containing proteins in this organism. PFAM was used to identify the copine domain boundaries, and to identify other possible domains (e.g. C2 domains). The multisequence alignment of copine domains from C. elegans was performed using http://www.genome.jp/tools/clustalw/. To predict possible transmembrane helices in the copine family, we used TMHMM Server v. 2.0 (http://www.cbs.dtu.dk/services/TMHMM/).  87  3.4 Results 3.4.1 F31D5.3/CPNA-1 is an “atypical” copine domain containing protein From existing Serial Analysis of Gene Expression libraries, we determined that cpna-1 is significantly enriched or specific to body wall muscle (Meissner et al., 2009). During an RNAi screen of ~3300 genes known to be expressed in muscle, cpna-1 was identified in C. elegans as one of four new Pat mutants. The Pat embryonic lethal phenotype has been found in loss of function mutants for 20 genes that are essential for embryonic muscle development and most of these genes encode proteins localized to muscle focal adhesions (M-lines and dense bodies) (Williams and Waterston, 1994; Meissner et al., 2009). We examined the phenotype of an intragenic deletion, and likely null mutation, for cpna-1, gk266, provided by the C. elegans Gene Knockout Consortium. The gk266 mutation has a 9 bp insertion in the 3’ end of intron 5, followed by a 393 bp deletion that extends into the 5’ end of exon 6 (Figure 3.1A), and the phenotype of worms homozygous for the gk266 allele is Pat, identical to the RNAi phenotype. CPNA-1 (F31D5.3) similar to mammalian copines. An alignment of CPNA-1 with human Copine V isoform CRA d, and a copine domain containing protein (UniProt entry Q8BIJ1) in the mouse is shown in Figure 3.1B using Clustal W (Larkin et al., 2007). Copine domains (Pfam entry PF07002; InterPro entry IPRO10734), also known as von Willebrand Alike or A domains, are approximately 180 residues long, and have weak homology to the extracellular A domain of integrins. Copine domains have an unknown function, although they are considered to be cytoplasmic and to be involved in protein-protein interactions (Tomsig and Creutz, 2002). All previously characterized proteins containing copine domains also have two membrane targeting C2 domains, which are calcium dependent phospholipid binding motifs. CPNA-1 does not have C2 domains, but it does have a predicted transmembrane  88  domain near the N-terminal end of the protein and a predicted signal peptide according to the Phobius prediction program. Our BLAST search of the C. elegans genome revealed that C. elegans has 7 genes that encode proteins containing copine domains (Figure A.1). When compared to CPNA-1, the sequence identity of copine domains in C. elegans ranges from 5528%. There is little homology between them outside of he copine domains. Of the 7 genes, only nra-1 (Gottschalk et al., 2005) and gem-4 (Church and Lambie, 2003), encode proteins that contain C2 domains. Thus, we have designated F31D5.3 as CPNA-1, and the 5 other copine domain proteins that lack C2 domains, as “copine domain atypical”, cpna-1 through cpna-5.  89  90  Figure 3.1 Gene model for cpna-1 and alignment of CPNA-1 with human and mouse homologs cpna-1 has four predicted splice isoforms, with the largest isoform (isoform b) spanning 21834 nucleotides (a). The gk266 allele has a 9 bp insertion at the 3’ end of intron 5, followed by a 393 bp deletion that extends into the 5’ end of exon 6 (a). When aligned with human and mouse homologs, CPNA-1 does not align at its amino terminal due to its longer length, but there is strong conservation between each protein in the copine domain and surrounding region (b). Vertical bars on the gene model are spaced every 1000 bp. In (b), asterisks (*) indicate identical amino acids, colons (:) indicate conserved substitutions, and periods (.) indicate semiconserved substitutions.  91  3.4.2 CPNA-1 localizes to dense body and M-line muscle adhesion complexes and is required for maintenance of muscle stability To determine the localization of CPNA-1 in nematode muscle, we expressed a region of CPNA-1 (176-385) as a GST fusion protein (Figure 3.2), and it was used to raise rabbit antibodies. After affinity purification, these antibodies detected a single band on western blot using a protein lysate from C. elegans (Figure 3.2B). The size of this band, approx. 130 kDa, is very similar to the size of the predicted CPNA-1b isoform. Anti-CPNA-1 antibodies were used to visualize CPNA-1 localization in wild type adult body wall muscle. As shown in Figure 3.2C, CPNA-1 localizes to both M-lines and dense bodies, co-localizing with UNC-89 (Mlines), and with α-actinin (dense bodies). In cpna-1 (gk266) animals we do not observe any CPNA-1 staining, indicating the mutation is likely a protein null. Anti-CPNA-1 antibodies were also used to stain transgenic animals expressing GFP tagged UNC-112 (Kindlin), which is located at M-lines and dense bodies (Rogalski et al., 2000), and has been shown to interact with the cytoplasmic tail of PAT-3 (β-integrin) (Qadota et al., 2012). Thus, UNC-112 can be considered as a marker for proteins that are located close to the muscle cell membrane. As shown in Figure 3.2C (third row), CPNA-1 co-localizes with UNC-112, and therefore CPNA-1 is membrane-proximal in both dense bodies and M-lines. In addition, we co-stained for CPNA1 and one more membrane-proximal component, PAT-6 (actopaxin), which is a member of the conserved four-protein complex that associates with the cytoplasmic tail of PAT-3/β-integrin (Lin et al., 2003). As shown in Figure 3.2C (last row), CPNA-1 and PAT-6 co-localize to both dense bodies and M-lines.  92  93  Figure 3.2 Immunolocalization of CPNA-1 to adult muscle M-lines and dense bodies (A) Schematic of the CPNA-1 protein indicating the location of the predicted transmembrane domain (TM), and the boundaries of the copine domain (residues 825-1058) and the region (residues 176-385; purple box) used as immunogen to generate rabbit polyclonal antibodies. (B) Immunoblot of Laemmli-soluble proteins from a mixed stage population of C. elegans reacted with anti-CPNA-1 and visualized by ECL. A single band of ~130 kDa, the size expected from the CPNA-1b predicted isoform, is detected. (C) Localization of anti-CPNA-1 in adult body wall muscle. Wild type adults were co-stained with anti-CPNA-1 and anti-UNC89 (first row), or anti-CPNA-1 and anti-α-actinin (second row); a transgenic line carrying UNC-112::GFP was also stained with anti-CPNA-1 (third row); co-staining with CPNA-1 and PAT-6 is shown in the fourth row. CPNA-1 clearly localizes to both M-lines (co-localizing with the M-line protein UNC-89), and to dense bodies (co-localizing with the dense body protein α-actinin). At least some CPNA-1 localizes near the muscle cell membrane, since some CPNA-1 co-localizes with the membrane-proximal proteins UNC-112 and PAT-6. Colocalization is indicated by white (overlap of green (CPNA-1) and magenta (all other proteins)). Bar, 10 µm. Figure 3.2 and related experiments were done by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA).  94  As described previously, worms lacking cpna-1 due to either mutation or RNAi arrest elongation at the two-fold stage of embryogenesis. As shown in Figure 3.3A, while a wild type worm hatches and progresses normally to the first larval stage, cpna-1(gk266) homozygotes (Figure 3.3B) arrest elongation during embryogenesis. In an attempt to rescue the embryonic lethal phenotype, we constructed a GFP translational fusion. The recombineered fosmid fDM1217 did not successfully rescue the lethal phenotype. However, GFP tagged CPNA-1 localizes to dense bodies and M-lines (Figure 3.3C) in a pattern identical to that seen with our CPNA-1 immunostaining. Co-localization with PAT-3 staining (Figure 3.3D) is shown in Figure 3.3E. The localization pattern of CPNA-1::GFP is similar to that of PAT-3 in dense bodies and M-lines, and it also seen surrounding the dense bodies compared with the localization pattern of PAT-3. 3.4.3 CPNA-1 acts to maintain sarcomere integrity We examined the localization pattern of essential body wall muscle proteins in the cpna-1 mutant background using immunostaining for each protein. PAT-3 (β-integrin) (Figure 3.3G), DEB-1 (vinculin) (Figure 3.3I), PAT-4 (ILK) (Figure 3.3K), and PAT-6 (actopaxin) (Figure 3.3M), were localized at adhesion complexes in muscle quadrants, albeit with some minor disorganization when compared to wild type embryos. These results are typical for proteins that act earlier in sarcomere assembly when staining embryos that are null for genes that function downstream (Williams and Waterston, 1994; Norman et al., 2007). In cpna-1 mutant embryos UNC-89 (obscurin) is properly localized to M-lines in early embryogenesis (Figure 3.3O), but prior to the two-fold stage, and coinciding with initial contraction of the sarcomere, it aggregates within muscle cells (Figure 3.3Q). Similarily, when comparing the tight organized arrays of thick filaments in MYO-3 stained wild type embryos  95  to those in cpna-1 arrested embryos, MYO-3 is initially able to organize into discrete thick filaments (Figure 3.3S), but in older embryos, severe disorganization (clumping) of MYO-3 is observed (Figure 3.3U). Proper localization of MYO-3 is required for progression past the twofold stage of embryogenesis, so due to MYO-3 mislocalization or other factors, cpna-1 embryos arrest. These observations suggest CPNA-1 is essential to maintain the integrity of both UNC-89 and MYO-3 at sarcomere adhesion sites.  96  97  Figure 3.3 Characterization of the cpna-1 null phenotype, and localization of CPNA1::GFP in body wall muscle Wild type C. elegans proceeds through embryogenesis to hatch as a first larval stage animal (A), whereas a cpna-1 null animal of the same age is arrested at the two-fold stage of embryogenesis (B). CPNA-1::GFP is localized to dense body (arrows) and M-line attachment structures (arrowheads) in adult body wall muscle (C), and in worms immunostained for PAT3 (D), a key constituent of the same attachment structures, co-localization is observed (E), with CPNA-1 also localized to areas directly adjacent to the dense body structure, observed by the green localization pattern around the dense body, and stronger M-line staining by PAT-3 (red) overshadowing that of CPNA-1 in (E) (arrowhead). Compared to wild type staining (F, H, J, L), when cpna-1 embryos are immunostained with antisera for PAT-3 (G), DEB-1 (I), PAT-4 (K), and PAT-6 (M), only slight disorganization is seen and each of the four proteins is still localized to the appropriate adhesion sites (arrowheads). In early embryos, UNC-89 is able to localize to M-lines in both wild type embryos (N) and cpna-1 null embryos (O), but as the embryo proceeds later in embryogenesis, compared with a wild type embryo (P), the cpna-1 null embryo arrests and UNC-89 is mislocalized into large foci within muscle cells (Q) (arrows). Similarily, MYO-3 is able to organize into nascent thick filaments in both early wild type (R) and cpna-1 null embryos (S), but unlike late stage wild type late embryos (T), MYO-3 is disorganized and mislocalized into large aggregates within the muscle cells (U) (arrows). Bars: A- B, 20 µm; C-U, 2 µm.  98  Using anti-CPNA-1 antibodies, we carried out the reciprocal experiment, and examined the localization of CPNA-1 in the mutant background of a number of Pat mutants. In pat-3 (Figure 3.4), and pat-4 (Figure 3.4C) arrested embryos, CPNA-1 is mislocalized, clumping within the muscle cells (arrows). In pat-6 embryos (Figure 3.4, D-E), CPNA-1 shows some variability in its localization, ranging from severe mislocalization (Figure 3.4D), similar to that seen in the pat-3 and pat-4 backgrounds to proper polarization in the membrane but disorganized (Figure 3.4E). In contrast, CPNA-1 is localized normally in myo-3 arrested embryos (Figure 3.4F) closely resembling the localization of CPNA in wild type embryos (Figure 3.4A). These cumulative results place cpna-1 in between pat-6 and myo-3 in the Mline/dense body assembly pathway. This suggests a role for CPNA-1 in maintaining the proper structural organization of sarcomeres as the embryo and larvae develop.  99  Figure 3.4 Immunolocalization of CPNA-1 in the null background of essential body wall muscle genes In late stage wild type embryos, CPNA-1 is organized into bands of dense bodies and M-lines in the muscle cell quadrants (A) (arrowheads). In null pat-3 embryos however, CPNA-1 is mislocalized into large aggregates within body wall muscle cells (B) (arrows). Similarly, large aggregates of CPNA-1 are also seen in null embryos for pat-4 (C), and pat-6 (D) (arrows), although in some pat-6 embryos, CPNA-1 is mislocalized to a lesser extent than in pat-3 and pat-4 embryos (E) (arrow). In arrested two-fold embryos lacking MYO-3 however, CPNA-1 is organized properly into bands of dense bodies and M-lines (F) as it is in wild type embryos (A) (arrowheads). Bars: 2 µm.  100  3.4.4 Identification of CPNA-1 as a binding partner for UNC-89 In an effort to identify new binding partners for UNC-89, a portion of UNC-89 comprised of Ig domains 1-5 (Ig1-5) was used as bait to screen a yeast 2-hybrid library of C. elegans cDNAs (Fig. 5A). Two positive preys representing CPNA-1 were recovered. The smallest prey clone (residues 825-1058) contains essentially just the copine domain, suggesting that this region of CPNA-1 is minimally required for interaction with UNC-89. To determine how specific the interaction of CPNA-1 is for this small portion of UNC-89, CPNA-1 was used in yeast 2-hybrid assays as both bait and prey to test for interaction with an additional 16 portions of UNC-89 that comprise the entire largest isoform of UNC-89 (UNC-89-B). As indicated in Figure 3.5B, CPNA-1 (825-1058) only interacts with Ig1-5. Deletion derivatives of Ig1-5 were used in 2-hybrid assays against CPNA-1. As shown in Figure 3.5C, the minimal region necessary and sufficient to interact with CPNA-1 is Ig1-3. Two biochemical approaches were used to verify the interaction. In the first approach, beads coated with GST-UNC-89 Ig13, but not GST, were used to pull out CPNA-1 from a worm lysate (Figure 3.5D1). Because this result could have occurred via an intermediary protein in the worm lysate, we also performed a binding assay using purified proteins. A “far western” experiment in which either MBP or MBP-CPNA-1 (825-1058) was separated on a gel, transferred to a blot, and reacted to a solution containing His-tagged UNC-89 Ig1-3, demonstrates direct interaction between CPNA-1 and UNC-89 Ig1-3 (Figure 3.5D2). When tested by 2-hybrid assays against copine domains from each of the 7 copine domain containing proteins, UNC-89 Ig1-5 only interacted with the copine domain from CPNA-1 (Figure A.1). This is a further indication of the specificity of the UNC-89 to CPNA-1 interaction.  101  102  Figure 3.5 Ig domains 1-3 of UNC-89 interact with CPNA-1 (A) Schematic representation of domains within the largest isoform of UNC-89, and indication that Ig1-5 was used as bait to screen a yeast 2-hybrid library. Two positive preys representing CPNA-1 were recovered, as indicated. CPNA-1, isoform b, has a predicted transmembrane domain (TM) and a copine domain (copine). (B) When CPNA-1 was used to test for interaction with the other 16 clones that fully cover UNC-89, interaction was only found with Ig1-5. (C) Domain mapping of UNC-89 Ig1-5 shows that Ig1-3 are minimally required for interaction with CPNA-1 (173-1107). (D) Confirmation of the interaction using purified proteins. (1) CPNA-1 can be pulled out of a worm lysate using GST-Ig1-3. Glutathione agarose beads coated with either GST or GST-Ig1-3 were incubated with a worm lysate, washed, eluted and aliquots separated by SDS-PAGE and reacted with either anti-CPNA-1 or anti-GST. (2) 6His-Ig1-3 interacts with MBP-CPNA-1 by far western. SDS-PAGE was used to separate MBP (~40 kDa) and MBP-CPNA-1 (copine domain)(~60 kDa), transferred to membrane, incubated with 6His-Ig1-3 in solution, washed, and detected with anti-His followed by anti-rabbit-horse radish peroxidase (HRP), and the reaction detected by ECL. (3) Coomassie stained gels of proteins used in the binding assays. The set of numbers along the left side of each blot or gel represent the position of molecular weight markers of the indicated sizes in kDa. Figure 3.5 and related experiments were done by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA).  103  3.4.5 CPNA-1 interacts with additional adhesion complex proteins The interaction of CPNA-1 with UNC-89 suggests one function for CPNA-1 at Mlines, but not at dense bodies, as UNC-89 is located exclusively to M-lines (Benian et al., 1996). In order to identify other CPNA-1 binding partners, we used CPNA-1 to conduct a yeast 2-hybrid screen of a collection of 23 known components of dense bodies and M-lines (Table A.3), to identify which proteins CPNA-1 might interact with at dense bodies, and perhaps additional proteins at M-lines. As indicated in Figure 3.6, we identified 4 additional CPNA-1 interacting proteins: SCPL-1 (a carboxy-terminal domain-type phosphatase), LIM-9 (FHL), PAT-6 (actopaxin) and UNC-96. The minimal portions of each of these proteins required for interaction with CPNA-1 were also determined. We found that although only the copine domain of CPNA-1 is required to interact with UNC-96, nearly full-length CPNA-1 is required for interaction with SCPL-1, LIM-9 and PAT-6. As shown in Figure A.2, these interactions were confirmed using in vitro binding experiments with purified proteins that demonstrate the proteins are able to not only bind via 2-hybrid, but also when incubated together in vitro. Yeast-expressed and HA tagged copine domain of CPNA-1(825-1058) was shown to interact with UNC-96 C-terminal half (201-418) (Figure A.2A), the minimal region of UNC-96 defined by 2-hybrid experiments. A far Western blot experiment showed that His tagged CPNA-1 (173-1107) can interact with MBP fusions of SCPL-1 (phosphatase domain), PAT-6 (fulllength) and LIM-9 (LIM domains only) (Figure A.2B). By antibody staining, UNC-96 is localized only to M-lines (Mercer et al., 2006), and SCPL-1 (Qadota et al., 2008b), and LIM-9 (Qadota et al., 2007) are found at M-lines and I-bands (but not at dense bodies). In contrast, PAT-6 is located at both M-lines and dense bodies (Lin et al., 2003) (Figure 3.2C). Thus, our screens have revealed 5 proteins CPNA-1 can interact with at M-lines (UNC-89, PAT-6,  104  SCPL-1, LIM-9 and UNC-96), and one protein with which CPNA-1 can interact with at dense bodies (PAT-6).  105  106  Figure 3.6 CPNA-1 interacts with four known M-line and one M-line/dense body protein Five proteins were identified using the 2-hybrid method in which CPNA-1 was used to screen a collection of 23 known components of nematode M-lines and dense bodies. (A-D) Depiction of the results of domain mapping to determine the minimal region (indicated as a blue bar) of each protein required for interaction with the indicated regions of CPNA-1. (E) Summary of the results showing domains of each protein and the regions involved in the interactions. Figure 3.6 and related experiments were done by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA). We have demonstrated that the copine domain of CPNA-1 can interact with UNC-89 Ig1-5 and with UNC-96 (201-418). We used in vitro mutagenesis to test whether this copine domain has distinct binding sites for each of these proteins. Alignment of copine domains from the C. elegans proteins reveals 12 positions that have the same residue (shaded green in Figure 3.7A) which are also conserved in the consensus sequence derived by PFAM for all copine proteins in all species. We mutated 3 of the 12 conserved residues (indicated with asterisks in Figure 3.7A). As indicated below, we have demonstrated that the copine domain of CPNA-1 can interact with UNC-89 Ig1-5 and with UNC-96 (201-418). To obtain insight into whether this copine domain has distinct binding sites for each of these proteins, we mutated 3 of the 12 conserved residues (indicated with asterisks in Figure 3.7A): G922 was changed to V, which has a larger side chain and may cause a local conformational change; Y985 to A to or F, which eliminates a possible phosphorylation site. Similarly, S1015 to A to eliminates a possible phosphorylation site. As shown in Figure 3.7B, the G922V mutation eliminates only the interaction with UNC-89, and S1015A eliminates only the interaction with UNC-96, suggesting the copine domain of CPNA-1 has distinct binding sites for these two M-line proteins. 107  108  Figure 3.7 Point mutation of the conserved residues in the copine domain of CPNA-1 affects its binding to UNC-89 or UNC-96, and a ternary complex containing PAT-6, CPNA-1 and UNC-89 (A) Green shading indicates residues present in all 7 copine proteins, and yellow shading indicates residues present in 4 or more copine proteins. “Consensus” represents the green (uppercase) and yellow (lowercase) shaded residues. Beneath the C. elegans consensus is that generated by PFAM for all copine domains across all species. Asterisks denote conserved residues that were mutated. (B) The copine domain of CPNA-1 has distinct sequence requirements for binding UNC-89 and UNC-96. Three of these 12 conserved residues (indicated with asterisks in (A)): G922 was changed to V; Y985 was changed to A and F respectively; S1015 was changed to A. The G922V mutation eliminates binding to UNC-89 but not UNC-96. Similarly, the S1015A mutation eliminates the binding to UNC-96 but not UNC-89. (C) UNC-89 Ig1-5 as bait was co-expressed with HA-tagged CPNA-1 (residues 1731107) (or empty vector as control), and PAT-6 (full length) as prey. +, growth on –Ade plates; -, no growth on –Ade plates. The right-hand panel shows the yeast growth on –Ade plates from each experiment from 3 independent colonies. Figure 3.7 related experiments were done by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA).  109  Based on the mutant analysis (Fig. 3.3 and 3.4), PAT-6 is required for assembly of CPNA-1 and CPNA-1 is required for assembly of UNC-89. As such, we might expect to obtain evidence that PAT-6, CPNA-1 and UNC-89 form a ternary structure. To test this idea, we performed a yeast 3-hybrid assay. UNC-89 Ig1-5 as bait, was co-expressed with HA-tagged CPNA-1 (173-1107), or empty vector as control, and PAT-6 as prey. As shown in Figure 3.7C, the interaction of UNC-89 Ig1-5 with PAT-6 is dependent on the presence of CPNA-1. This result is consistent with the existence of a ternary complex containing PAT-6, CPNA-1 and UNC-89. 3.4.6 The role of CPNA-1 in postembryonic body wall muscle We used RNAi on postembryonic stage animals to investigate whether CPNA-1 was required in body wall muscle (Meissner et al., 2009). The feeding clone JA:F31D5.3 (Kamath et al., 2003) was used from Geneservice (UK), which contains a 1038 bp segment of the gene cpna-1. Of note, in C. elegans RNAi is mediated by the protein Dicer (Bernstein et al., 2001), which cuts the dsRNA into 22mers, thus creating multiple specific small dsRNAs to knock down one transcript rather that a single siRNAs as used in experiments in other species. In control animals fed an empty RNAi vector, all body wall muscle cells in each of the 30 animals observed had wild type myofilament organization. However, in cpna-1 (RNAi) treated animals (n=30), the myofilaments were highly disorganized in some body wall muscle cells (Figure 3.8). This suggests that CPNA-1 is required to maintain the structural integrity of muscle at life stages past embryogenesis.  110  Figure 3.8 Postembryonic requirement for CPNA-1 in body wall muscle When animals were fed HT115 RNAi bacteria containing only an empty vector, the body wall muscle structure looks wild type using polarized light microscopy (A) (arrow). When fed dsRNA for F31D5.3 (cpna-1) (C) and two other genes (B) and (D), found to be required in muscle (Meissner et al., 2009), the myofilament structure was deteriorated with large gaps in the myofilament structure (stars).  111  We hypothesize that PAT-6 directs the assembly of CPNA-1 to M-lines and dense bodies in embryonic muscle. To test the relationship of PAT-6 and CPNA-1 in adult, we used RNAi to knockdown pat-6, beginning at the L1 larval stage and continuing into adulthood, in order to avoid the embryonic requirement of pat-6. Adults resulting from this type of RNAi for another Pat gene, the PINCH homolog unc-97, show a mosaic pattern of knockdown, with some adult body wall muscle cells showing normal expression of the gene, whereas others showing a large reduction in expression (Miller et al., 2006). As shown in Figure 3.9A, this phenomenon was also seen for pat-6 RNAi beginning at the L1 stage. Most importantly, in muscle cells in which PAT-6 was nearly undetectable, CPNA-1 was mislocalized, found in aggregates (arrowhead), or abnormally at the edges of the muscle cell (arrows). RNAi was also used to knockdown unc-97 beginning at the L1 stage, and the resulting adults were immunostained for MYO-3 (MHC A) myosin and CPNA-1. Previously we had reported that unc-97 RNAi results in large aggregates of MHC A (Miller et al., 2006). As shown in Figure 3.9B, the muscle cell showing the clump of MHC A, also shows mislocalization of CPNA-1 in clumps, but not localization to the edges of the cell, as was found for pat-6 RNAi.  112  Figure 3.9 In adult muscle, PAT-6 and UNC-97 are needed for localization of CPNA-1 (A) RNAi was used to knockdown pat-6 beginning at the L1 larval stage, and the resulting adults were immunostained for PAT-6 and CPNA-1. Top and bottom rows show portions of body wall muscle from two such animals. In muscle cells in which PAT-6 was knocked down, CPNA-1 is found in aggregates (arrowhead) or abnormally located at the edge of the muscle cell near the muscle cell membrane (arrows). (B) RNAi was also used to knockdown unc-97 beginning at the L1 larval stage, and the resulting adults were immunostained for MYO-3 (MHC A) and CPNA-1. In the image, the bottom cell shows that CPNA-1, and downstream MHC A, are found in a large aggregate, but not localized to the edge of the cell. Bars, 10 µm. Figure 3.9 related experiments were done by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA). 113  We next asked what would be the effect in adult muscle of deficiency of the other proteins that interact with CPNA-1 and are located at the M-lines, namely UNC-89, SCPL-1, UNC-96 and LIM-9. Each of these four proteins is not required for embryonic muscle development, but when deficient, have phenotypes in adult muscle (Waterston et al., 1980; Mercer et al., 2006; Qadota et al., 2007; Nahabedian et al., 2012). To do this, we used antiCPNA-1 to immunostain adult body wall muscle from loss of function mutants or animals subjected to RNAi. unc-89(su75) is an unc-89 allele that lacks all the large UNC-89 isoforms (Small et al., 2004), and thus all CPNA-1 binding sites on. unc-96(sf18) is a nonsense mutation with no detectable UNC-96 protein by Western blot, and thus is a putative null allele (Miller et al., 2006). The lim-9 alleles, gk106 and gk210, are also likely null mutants, as they are intragenic deletions with undetectable LIM-9 protein (Qadota et al., 2007). As shown in Figure 3.10, the localization of CPNA-1 at M-lines (indicated by arrows) is unaffected by the absence or reduced levels of UNC-89, SCPL-1, UNC-96 or LIM-9. These results are consistent with these proteins being downstream of CPNA-1 in the M-line assembly pathway.  114  Figure 3.10 Analysis of mutants places the M-line proteins UNC-96, LIM-9 and SCPL-1 downstream of CPNA-1 in adult muscle The indicated adult loss-of-functions mutants or RNAi animals were co-immnunostained with anti-CPNA-1 and anti-a-actinin. The localization of CPNA-1 at M-lines (indicated by yellow arrows) is unaffected by the absence or reduced levels of UNC-89, SCPL-1, UNC-96 or LIM9. Note that the unc-89 mutant allele, su75, which lacks all large UNC-89 isoforms, lacks CPNA-1 binding sites. In column 3, CPNA-1 is shown in green, ATN-1 in purple. Bar, 10 mm. Figure 3.10 and related experiments were done by Ge Xiong, Hiroshi Qadota, and Guy Benian (Emory University, Atlanta, USA). 115  3.5 Discussion 3.5.1 A model for CPNA-1 in maintenance of integrin adhesion complexes This study has identified CPNA-1 as a new component of integrin adhesion complexes, based on four criteria. First, CPNA-1 is localized to M-lines and dense bodies, similar to integrin and integrin-associated proteins. Second, loss of function of CPNA-1 is Pat embryonic lethal, a phenotype that is characteristic of any protein required for muscle contraction. Third, while MYO-3 and UNC-89 are initially localized normally in cpna-1 null embryos, as the embryo proceeds to the two-fold stage both proteins become mislocalized and aggregate at the edges of muscle cells. This demonstrates that CPNA-1 is required for maintaining the structural stability of thick filament attachments. Lastly, CPNA-1 binds directly to PAT-6, one of the integrin associated proteins. These data suggest that CPNA-1 acts as a linker between integrin associated proteins near the muscle cell membrane, and proteins that are found deeper inside the muscle cell (Figure 3.11). In striated muscle of C. elegans, both the M-lines and dense bodies are integrin adhesion complexes containing both shared and specific protein components. At the base of each M-line and dense body, associated with the cytoplasmic tail of β-integrin, is a complex of four conserved proteins including UNC-112 (Kindlin), PAT-4 (ILK) and UNC-97 (PINCH). Lin et al. (2003) showed that PAT-4 (ILK) interacts with the Cterminal CH domain of PAT-6 (actopaxin). Here, we show that the N-terminal portion of PAT6, including the first CH domain), interacts with CPNA-1. CPNA-1, in turn, interacts with UNC-89 (obscurin), LIM-9 (FHL), SCPL-1 (SCP) and UNC-96 at M-lines (Figure 3.11). Dense body-specific proteins that interact with CPNA-1 have yet to be identified.  116  Figure 3.11 Model for CPNA-1 function in the assembly of integrin adhesion complexes UNC-112 (Kindlin), PAT-4 (ILK), UNC-97 (PINCH) and PAT-6 (actopaxin) are in a 4-protein complex associated with the cytoplasmic tail of β-integrin. Lin et al. (2003) showed that the 2nd CH domain of PAT-6 interacts with PAT-4. Here we show that PAT-6 (actopaxin) is needed to localize CPNA-1 to the muscle focal adhesions. CPNA-1, in turn, is needed for proper localization of of UNC-89 (obscurin), LIM-9 (FHL), SCPL-1 (SCP) and UNC-96 to M-lines. CPNA-1 has a transmembrane domain at its amino terminus, and a copine domain that is able to bind PAT-6, and UNC-96 near its carboxy terminus. CPNA-1 likely stretches from where it is anchored in the membrane, to the more membrane-distal portion of the adhesion complexes where it binds PAT-6, UNC-96, LIM-9, SCPL-1, and UNC-89.  117  I have shown that loss of function of cpna-1 is embryonic lethal, displaying the characteristic Pat phenotype common to genes that are essential for embryonic muscle development. Indeed, many of the Pat genes encode other components of muscle adhesion complexes, including UNC-52 (perlecan) (Rogalski et al., 1993), PAT-3 (β-integrin) (Gettner et al., 1995), UNC-112 (Kindlin) (Rogalski et al., 2000), PAT-4 (ILK) (Mackinnon et al., 2002), UNC-97 (PINCH) (Hobert et al., 1999), PAT-6 (actopaxin) (Lin et al., 2003), and DEB1 (vinculin) (Barstead and Waterston, 1991). By examining localization of Pat proteins in cpna-1 mutant embryos, and examining CPNA-1 in other Pat mutants, I have shown that PAT6 is needed for the localization of CPNA-1 to the adhesion complexes during embryonic development. Similarly, by knocking down pat-6 transcripts after embryonic development, my collaborators have shown that PAT-6 is required for the localization of CPNA-1 to adult Mlines and dense bodies. CPNA-1 is localized normally in loss of function for UNC-89, LIM-9, SCPL-1 and UNC-96, which is consistent with the model that CPNA-1 acts upstream of these four M-line proteins in adult muscle. CPNA-1 is not required for the initial assembly of sarcomeric componenents, but embryonic muscle lacking CPNA-1 falls apart after muscle contraction begins. There are two possibilities for this. First, CPNA-1 may bind to PAT-6, UNC-89, and other adhesion complex proteins to hold together the adhesion complex. In this manner, MYO-3 (myosin) and other membrane distal components of the sarcomere remain in their their proper locations, and the sarcomere is stable. Second, CPNA-1 may maintain stability by recycling damaged sarcomere components or recruiting new proteins to the adhesion complex.  118  3.5.2 New classes of copine domain containing proteins Copines, containing 2 C2 domains and a copine domain, are evolutionarily conserved proteins found in plants and animals. They were first identified as Ca 2+-dependent phospholipid binding proteins in Paramecium (Creutz et al., 1998), and because of this property are thought to be involved in membrane trafficking. CPNA-1 is the first characterized copine domain containing protein that lacks C2 domains. The Pfam website, as of April 2011, notes 200 sequences from diverse organisms that have a copine domain plus 2 C2 domains, 25 with a copine domains plus a single C2 domain, and 168 containing only a copine domain. Significantly, this copine domain-only category includes a putative uncharacterized protein from the mouse (UniProt entry Q8BIJ1 MOUSE; 346 amino acids), and isoform CRA_d of copine V from humans (UniProt entry Q7Z6C8 HUMAN; 301 amino acids), as shown aligned with CPNA-1 in Figure 3.1. These are the two closest homologs to CPNA-1 in those species. Among the copine domain containing proteins in the C. elegans proteome, both typical and atypical, only CPNA-1 contains a predicted transmembrane domain. In fact, our in silico analysis of copine domain containing proteins in humans, has not revealed any copine proteins that also have predicted transmembrane domains. As CPNA-1 is found near the muscle membrane associated with integrin adhesion sites, its transmembrane domain may be important for the localization of CPNA-1 to the plasma membrane. Note that our domain mapping in  119  Figure 3.6 indicates that the transmembrane domain of CPNA-1 is not required for its association with PAT-6. Thus, CPNA-1 may have two ways to localize to adhesion complexes—binding to the integrin associated protein PAT-6, and direct insertion of its transmembrane domain into the muscle cell membrane. 3.5.3 Copine domain containing proteins have diverse functions in C. elegans and other species The biological roles of a few copine proteins have been studied by genetic analysis. The first to be genetically analyzed was the BON1/CPN1 gene from Arabidopsis thaliana (Hua et al., 2001; Jambunathan et al., 2001). Loss of function causes de-repression of defense responses and a reduction in plant growth. In Dictyostelium, knockout of cpnA, one of 6 copine genes, suggests that cpnA plays a role in cytokinesis and contractile vacuole function (Damer et al., 2007). In C. elegans, two copine domain proteins, each with two C2 domains, have been characterized, GEM-4 and NRA-1. Mutations in gem-4 (Church and Lambie, 2003) were isolated as extragenic suppressors of loss of function alleles of gon-2, which is required for gonadal cell divisions. GON-2 is a cation channel of the TRPM family. The copine protein GEM-4 antagonizes the channel GON-2, but the mechanism is unknown. NRA-1 was identified as an interactor of nicotinic acetylcholine receptors (nAChR) by a tandem affinity purification procedure (Gottschalk et al., 2005). Loss of function of nra-1 results in nicotine resistance and reduced synaptic nAChR expression, suggesting a normal role as positive regulator of nAChRs. Both CPNA-and NRA-1 appear to play roles in maintaining a multiprotein complex at the membrane.  120  3.5.4 Copine domains as protein interacting modules CPNA-1 was identified as an interacting partner for the giant polypeptide UNC-89 and this interaction is specific in two ways: (1) Only Ig domains 1-3, and not any of the other 50 Ig domains or any other segment of UNC-89 interact with CPNA-1. (2) Only the copine domain of CPNA-1, and none of the copine domains from the 6 other copine domain containing proteins in C. elegans, interacts with UNC-89. Four other proteins that interact with CPNA-1 at muscle focal adhesions, PAT-6 (actopaxin), LIM-9 (FHL), SCPL-1 (a CTD type phosphatase) and UNC-96 were also identified. For UNC-89 and UNC-96, the minimal portion of CPNA-1 required for interaction is essentially the copine domain. Previous studies have demonstrated that the copine domain is a protein-protein interacting domain: For example, in Arabidopsis, the copine domain of BON1/CPN1 has been shown to interact with BAP1 (Hua et al., 2001; Yang et al., 2006; Li et al., 2010). Tomsig et al. (2003) used the copine domains of three human copine proteins (copines I, II, and IV) to screen a mouse embryo 2-hybrid library and identified 21 interacting proteins. Some proteins interacted with only a single copine domain, whereas others were less specific. The interactions were verified using an in vitro binding assay with purified proteins. The targets fell into several functional categories, including regulators of protein phosphorylation, regulators of transcription, calcium binding proteins, regulators of ubiquitination, and cytoskeletal or structural proteins. The authors found that a majority of the interactors (14 of 21) contained sequences predicted to form coiled-coils. CPNA-1 interactors are also regulators of phosphorylation (UNC-89 has two kinase domains, SCPL-1 is a phosphatase), and cytoskeletal proteins (PAT-6, LIM-9 and UNC-96). None of the interactors uncovered in this study, however, contain predicted coiled-coil regions.  121  3.5.6 Summary I have identified an unusual type of copine domain containing protein that lacks C2 domains, and contains a transmembrane domain. I have shown that this protein, CPNA-1, is essential for sarcomere maintenance throughout the life of the animal. This is the first description of a protein in C. elegans with an essential role in the structural maintenance of the sarcomere. While not needed to initiate sarcomere assembly, the absence of CPNA-1 leads to mislocalization of MYO-3 (myosin), which is required for progression past the two-fold stage, as well as UNC-89 (obscurin). My collaborators have also shown that CPNA-1 is an adapter protein, as it is able to link an integrin associated protein, PAT-6 (actopaxin) to the giant protein UNC-89 (obscurin) and to three additional proteins at the sarcomeric M-line, and most likely other proteins. For this linking function of CPNA-1, the copine domain is required. The adapter function as of now is unclear, but it may be to hold together and maintain the integrin based adhesion complexes in body wall muscle.  122  4. CONCLUSION Two different types of muscle in C. elegans were investigated in this thesis: multisarcomere body wall muscle and single sarcomere muscle of the pharynx. I describe a key discovery relative to sarcomere organization and stability in each type of muscle in this thesis. In pharyngeal muscle, I have shown that the organization of adhesion complexes is much different than the organization observed in body wall muscle. I propose that the organization of the adhesion structure in pharyngeal muscle is more similar to a podosome-like structure than a focal adhesion structure. In body wall muscle, I have identified and characterized a novel protein, CPNA-1, that is essential in muscle tissue and for viability. In addition, CPNA-1 is the first muscle protein identified that, while not essential for assembly, is essential for maintaining the structure of the sarcomere throughout development. 4.1 Identification of a paxillin homolog in the worm essential in pharyngeal muscle Paxillin is an important protein found at focal adhesion sites in vertebrate muscle, but until I carried out the experiments in this thesis, a paxillin homolog had not been identified in the worm. I determined that two mis-annotated adjacent genes (C28H8.13 and C28H8.6) were in fact one gene with significant homology to paxillin and named it pxl-1. Using RNAi and characterizing a null mutant for pxl-1 I was able to determine that the terminal arrest point at the L1 stage was due to a lack of pharyngeal muscle pumping. This was an important discovery because other mutants with pumping defect phenotypes identified by Avery (1993) have not been shown to be components of the muscle adhesion sites, but rather mutants in genes that have a role in cells that innervate the muscle, or are involved in morphogenesis of the pharynx. PXL-1 however, is found in muscle adhesion complexes, and is necessary for myofilament organization and muscle contraction. 123  4.2 Rethinking the organization of pharyngeal muscle actin attachment complexes The structure of the pharyngeal muscle actin adhesion sites is not well studied in C. elegans, but I have shown that it has a different organization than what is observed in body wall muscle. This was accomplished by observing the differential localization of paxillin (PXL-1) and vinculin (DEB-1) in each muscle type. In body wall muscle, both PXL-1 and DEB-1 are organized in a punctate pattern consistent with other proteins such as the integrin heterodimer, ILK, and PINCH. In pharyngeal muscle, however, PXL-1 and DEB-1 are localized in a ring like pattern with actin forming the core of the complex. This arrangement of proteins is consistent with what is observed in a podosome-like adhesion. This is an important finding because it fundamentally changes the model of pharyngeal muscle attachment. While the work with paxillin has led to a greater understanding of how pharyngeal muscle is structured, questions remain. I have shown that PXL-1 and DEB-1 are organized in a ring-like pattern of localization in the basal membrane, but the pattern at the apical membrane adjacent to the lumen where bacteria are passed through the pharynx is inconclusive. Looking at the structure of the two types of adhesion complexes in pharyngeal muscle in Figure 2.9, it is clear that they are different. While the apical adhesion sites project into the cell and appear globular, the basal adhesion sites project very little, and appear flat to the membrane. It may be that within pharyngeal muscle, there two very different adhesion sites. Wayne Vogl and I have shown that the apical adhesion sites in pharyngeal muscle differ from those in body wall muscle, but we still have much more to learn about both the apical and basal adhesion sites. Lastly, in Figure 2.9, membrane projections can be seen protruding into the pharyngeal muscle. To my knowledge these membrane protrusions have not been documented or studied, so it would be interesting to investigate their role in pharyngeal muscle.  124  4.3 The role of paxillin in body wall muscle I have shown that pxl-1 is essential in pharyngeal muscle, but pxl-1 is also expressed in body wall muscle where PXL-1 localizes to dense body and M-line adhesion sites. On its own, loss of pxl-1 does not cause any defects in myofilament stability. Loss of another gene lim-8 which is expressed in body wall muscle also does not lead to defects in myofilament stability (Qadota et al., 2007). However, in worms lacking pxl-1 expression in body wall muscle, I have shown that RNAi for lim-8 does lead to minor defects in sarcomere structure. This demonstrates that genes expressed in muscle that lack a phenotype when mutated could still have an important role in body wall muscle in conjunction with one or more proteins. It is possible that in the future, further dissection of how a sarcomere is built will need to rely on a multi gene approach, rather than looking at individual genes to fully reconstruct sarcomere assembly. 4.4 Identification of a novel essential body wall muscle gene, cpna-1 Body wall muscle in the worm has been well studied, with a number of key proteins implicated in the early assembly and this work has led to a greater understanding of how muscle is built in vertebrates. CPNA-1 is the first protein in the worm found to be essential not in early assembly, but in maintaining the structural stability of the sarcomere in embryonic, and in post-embryonic muscle. I identified cpna-1 as an essential muscle gene by performing a high throughput RNAi screen of over 3,000 genes expressed in muscle along with help from lab members Aruna Somasiri, Iasha Chaudhry, and Teresa Rogalski. This approach proved to be highly effective, identifying three additional novel essential muscle genes (Meissner et al., 2009). Along with help from Iasha Chaudhry to use the wormsorter, I screened two strains with hypomorphic mutations in essential muscle genes, unc-95, and unc-97 in order to look for synthetic lethal phenotypes and identified a number of other potential candidates (see 125  Appendix). I have shown that high throughput RNAi in liquid culture can be an effective method for identifying genes important in muscle. 4.5 CPNA-1 and it’s role in maintaining sarcomere stability As shown in Figure 3.3 and Figure 3.4, CPNA-1 is not required for initial sarcomere assembly, as both MYO-3 and UNC-89 are able to localize in the cpna-1 background. However, as the embryo develops past the onset of muscle contraction, both MYO-3 and UNC-89 become mis-localized and the embryos arrest in cpna-1 null animals. This demonstrates that CPNA-1 is required to maintain the structural stability of the sarcomere. Interestingly, I have demonstrated that CPNA-1 is found not only within dense body and Mline adhesions, but also at the edges of the dense body. In addition, CPNA-1 can bind to a number of adhesion site proteins including PAT-6, UNC-89, UNC-96, LIM-9, and SCPL-1. One model we consider involves the transmembrane anchored CPNA-1 helping to stabilize the adhesion structure (see Figure 3.11). Considering the continual force generated by myofilament dynamics, it is conceivable that one or more proteins are needed to hold the structure together. The force of contraction most likely causes damage to proteins within the adhesion complexes over time, requiring them to be replaced with newly translated protein. Without proper turnover or repair, the muscle structure may begin to degenerate. This is reminiscent of what is observed in myopathies where the dystrophin complex is defective, leading to a breakdown in muscle integrity over time (reviewed in Nowak et al., 2005). While the dystrophin complex has not been shown to be essential in C. elegans (reviewed in Segalat, 2002) it is possible that CPNA-1 and possibly additional proteins play a similar role as the dystrophin complex does in vertebrate muscle in terms of maintaining sarcomere integrity. Based on the muscle degeneration I have observed in cpna-1 null animals, another model proposes that CPNA-1 acts to aid in the turnover process, acting as a scaffold for new protein to enter the complex, 126  promoting the inflow or recycling of protein. This differs from the previous model, in that CPNA-1 may not be providing structural stability through binding with other adhesion proteins, but rather by promoting recycling of necessary components such as the heavy chain myosin, MYO-3. In cpna-1 null animals MYO-3 progressivly becomes mislocalized and as such the embryos cannot progress through development to the larval stages due to their lack of muscle function. While the definitive mode of action for CPNA-1 is unclear, its role in maintaining sarcomere stability is clear. 4.6 Future directions I have shown that paxillin is required in pharyngeal muscle attachment complexes, and that the organization of the attachment complex is closer to that of a podosome than that of a focal adhesion complex. However, we still do not have a full catalog of all of the proteins that constitute a pharyngeal muscle sarcomere or how they are organized. For instance, while we know that an alpha-integrin ina-1 is expressed in the pharyngeal muscle, pat-3 is the only characterized beta-integrin in the C. elegans genome and to date it has not been observed during embryogenesis or larval stages in pharyngeal muscle. Given that an integrin heterodimer is a component of podosome-like structures, further study may help answer whether this is so in pharyngeal muscle attachment sites as well. It is possible that another beta-integrin may exist in the C. elegans genome, as the gene C09D5.3 also has sequence similarity to beta-integrins, but has not been studied in depth. A full analysis of where sarcomeric proteins are organized in pharyngeal muscle would also further our understanding of the tissue. I have shown that PXL-1 and DEB-1 are organized in a ring-like pattern in pharyngeal muscle, and that thin filaments form the core of the attachment structure, but assessing the localization pattern of known pharyngeal muscle  127  proteins will help to place where these proteins are localized, and may reinforce my model that the adhesion complex in pharyngeal muscle is most similar to a podosome. My work with the gene cpna-1 has shown that a new class of protein (copine domain containing) plays a role in maintaining the structural integrity of muscle in C. elegans. Whether or not CPNA-1 is the only copine domain containing gene in the worm that is an important in body wall muscle is yet to be determined. Another gene, cpna-2 is expressed in body wall muscle and pharyngeal muscle (Hunt-Newbury et al., 2007). To date, only the expression pattern of the gene has been published. Further work with cpna-2 to see whether it has a mutant phenotype (to date no phenotype has been described), and whether the protein it codes for can bind to components of the sarcomere will enable us to see whether it has a role in sarcomere assembly/maintenance. The demonstration that the copine domain protein CPNA-1 is needed to maintain sarcomere integrity raises the question of whether copines in other species play a similar role. CPNA-1 has homology to both mouse and human proteins (see Figure 3.1), yet their function has yet to be determined. Copines have been shown to be expressed in human muscle tissue (Cowland et al., 2003), so it will be interesting to see whether copine domain containing proteins play a role in maintaining muscle integrity in human muscle as well. If a role for copines in human muscle is demonstrated, it will reinforce the power of using a model organism like C. elegans for primary muscle research and the elucidation of gene function, and using that knowledge to further our understanding of how our own muscles are built and maintained in humans.  128  BIBLIOGRAPHY Ahringer, J. (1997). Turn to the worm! Curr Opin Genet Dev 7, 410-415. Albertson, D.G. (1984). Formation of the first cleavage spindle in nematode embryos. Dev Biol 101, 61-72. Albertson, D.G., and Thomson, J.N. (1976). The pharynx of Caenorhabditis elegans. Philos Trans R Soc Lond B Biol Sci 275, 299-325. Altun, S.F., and Hall, D.H. (2005). Handbook of C. elegans Anatomy. In: Wormatlas. Avery, L. (1993). The genetics of feeding in Caenorhabditis elegans. Genetics 133, 897917. Bang, M.L., Centner, T., Fornoff, F., Geach, A.J., Gotthardt, M., McNabb, M., Witt, C.C., Labeit, D., Gregorio, C.C., Granzier, H., and Labeit, S. (2001). The complete gene sequence of titin, expression of an unusual approximately 700-kDa titin isoform, and its interaction with obscurin identify a novel Z-line to I-band linking system. Circ Res 89, 1065-1072. Barstead, R.J., and Waterston, R.H. (1989). The basal component of the nematode densebody is vinculin. J Biol Chem 264, 10177-10185. Barstead, R.J., and Waterston, R.H. (1991). Vinculin is essential for muscle function in the nematode. J Cell Biol 114, 715-724. Bartnik, E., Osborn, M., and Weber, K. (1986). Intermediate filaments in muscle and epithelial cells of nematodes. J Cell Biol 102, 2033-2041. Baum, P.D., and Garriga, G. (1997). Neuronal migrations and axon fasciculation are disrupted in ina-1 integrin mutants. Neuron 19, 51-62. Benian, G.M., Ayme-Southgate, A., and Tinley, T.L. (1999). The genetics and molecular biology of the titin/connectin-like proteins of invertebrates. Rev Physiol Biochem Pharmacol 138, 235-268. Benian, G.M., Kiff, J.E., Neckelmann, N., Moerman, D.G., and Waterston, R.H. (1989). Sequence of an unusually large protein implicated in regulation of myosin activity in C. elegans. Nature 342, 45-50.  129  Benian, G.M., L'Hernault, S.W., and Morris, M.E. (1993). Additional sequence complexity in the muscle gene, unc-22, and its encoded protein, twitchin, of Caenorhabditis elegans. Genetics 134, 1097-1104. Benian, G.M., Tinley, T.L., Tang, X., and Borodovsky, M. (1996). The Caenorhabditis elegans gene unc-89, required fpr muscle M-line assembly, encodes a giant modular protein composed of Ig and signal transduction domains. J Cell Biol 132, 835-848. Bernstein, E., Caudy, A.A., Hammond, S.M., and Hannon, G.J. (2001). Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409, 363-366. Blaxter, M. (1998). Caenorhabditis elegans is a nematode. Science 282, 2041-2046. Bowden, E.T., Barth, M., Thomas, D., Glazer, R.I., and Mueller, S.C. (1999). An invasion-related complex of cortactin, paxillin and PKCmu associates with invadopodia at sites of extracellular matrix degradation. Oncogene 18, 4440-4449. Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics 77, 71-94. Broday, L., Kolotuev, I., Didier, C., Bhoumik, A., Podbilewicz, B., and Ronai, Z. (2004). The LIM domain protein UNC-95 is required for the assembly of muscle attachment structures and is regulated by the RING finger protein RNF-5 in C. elegans. J Cell Biol 165, 857-867. Brown, M.C., Perrotta, J.A., and Turner, C.E. (1996). Identification of LIM3 as the principal determinant of paxillin focal adhesion localization and characterization of a novel motif on paxillin directing vinculin and focal adhesion kinase binding. J Cell Biol 135, 1109-1123. Brown, M.C., and Turner, C.E. (2004). Paxillin: adapting to change. Physiol Rev 84, 1315-1339. Burr, A.H., and Gans, C. (1998). Mechanical significance of obliquely striated architecture in nematode muscle. Biol Bull 194, 1-6. Burridge, K., Fath, K., Kelly, T., Nuckolls, G., and Turner, C. (1988). Focal adhesions: transmembrane junctions between the extracellular matrix and the cytoskeleton. Annu Rev Cell Biol 4, 487-525. Caudy, A.A., Ketting, R.F., Hammond, S.M., Denli, A.M., Bathoorn, A.M., Tops, B.B., Silva, J.M., Myers, M.M., Hannon, G.J., and Plasterk, R.H. (2003). A micrococcal nuclease homologue in RNAi effector complexes. Nature 425, 411-414.  130  Chenna, R., Sugawara, H., Koike, T., Lopez, R., Gibson, T.J., Higgins, D.G., and Thompson, J.D. (2003). Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res 31, 3497-3500. Church, D.L., and Lambie, E.J. (2003). The promotion of gonadal cell divisions by the Caenorhabditis elegans TRPM cation channel GON-2 is antagonized by GEM-4 copine. Genetics 165, 563-574. Cowland, J.B., Carter, D., Bjerregaard, M.D., Johnsen, A.H., Borregaard, N., and Lollike, K. (2003). Tissue expression of copines and isolation of copines I and III from the cytosol of human neutrophils. J Leukoc Biol 74, 379-388. Cox, E.A., and Hardin, J. (2004). Sticky worms: adhesion complexes in C. elegans. J Cell Sci 117, 1885-1897. Crawford, B.D., Henry, C.A., Clason, T.A., Becker, A.L., and Hille, M.B. (2003). Activity and distribution of paxillin, focal adhesion kinase, and cadherin indicate cooperative roles during zebrafish morphogenesis. Mol Biol Cell 14, 3065-3081. Creutz, C.E., Tomsig, J.L., Snyder, S.L., Gautier, M.C., Skouri, F., Beisson, J., and Cohen, J. (1998). The copines, a novel class of C2 domain-containing, calcium-dependent, phospholipid-binding proteins conserved from Paramecium to humans. J Biol Chem 273, 1393-1402. Damer, C.K., Bayeva, M., Kim, P.S., Ho, L.K., Eberhardt, E.S., Socec, C.I., Lee, J.S., Bruce, E.A., Goldman-Yassen, A.E., and Naliboff, L.C. (2007). Copine A is required for cytokinesis, contractile vacuole function, and development in Dictyostelium. Eukaryot Cell 6, 430-442. Deakin, N.O., and Turner, C.E. (2008). Paxillin comes of age. J Cell Sci 121, 2435-2444. Ding, M., Woo, W.M., and Chisholm, A.D. (2004). The cytoskeleton and epidermal morphogenesis in C. elegans. Exp Cell Res 301, 84-90. Dixon, S.J., and Roy, P.J. (2005). Muscle arm development in Caenorhabditis elegans. Development 132, 3079-3092. Epstein, H.F., Casey, D.L., and Ortiz, I. (1993). Myosin and paramyosin of Caenorhabditis elegans embryos assemble into nascent structures distinct from thick filaments and multi-filament assemblages. J Cell Biol 122, 845-858. Epstein, H.F., Waterston, R.H., and Brenner, S. (1974). A mutant affecting the heavy chain of myosin in Caenorhabditis elegans. J Mol Biol 90, 291-300.  131  Ervasti, J.M. (2003). Costameres: the Achilles' heel of Herculean muscle. J Biol Chem 278, 13591-13594. Ferrara, T.M., Flaherty, D.B., and Benian, G.M. (2005). Titin/connectin-related proteins in C. elegans: a review and new findings. J Muscle Res Cell Motil 26, 435-447. Flaherty, D.B., Gernert, K.M., Shmeleva, N., Tang, X., Mercer, K.B., Borodovsky, M., and Benian, G.M. (2002). Titins in C.elegans with unusual features: coiled-coil domains, novel regulation of kinase activity and two new possible elastic regions. J Mol Biol 323, 533-549. Forbes, J.G., Flaherty, D.B., Ma, K., Qadota, H., Benian, G.M., and Wang, K. (2010). Extensive and modular intrinsically disordered segments in C. elegans TTN-1 and implications in filament binding, elasticity and oblique striation. J Mol Biol 398, 672-689. Francis, G.R., and Waterston, R.H. (1985). Muscle organization in Caenorhabditis elegans: localization of proteins implicated in thin filament attachment and I-band organization. J Cell Biol 101, 1532-1549. Francis, R., and Waterston, R.H. (1991). Muscle cell attachment in Caenorhabditis elegans. J Cell Biol 114, 465-479. Gettner, S.N., Kenyon, C., and Reichardt, L.F. (1995). Characterization of beta pat-3 heterodimers, a family of essential integrin receptors in C. elegans. J Cell Biol 129, 11271141. Gottschalk, A., Almedom, R.B., Schedletzky, T., Anderson, S.D., Yates, J.R., 3rd, and Schafer, W.R. (2005). Identification and characterization of novel nicotinic receptorassociated proteins in Caenorhabditis elegans. EMBO J 24, 2566-2578. Granato, M., Schnabel, H., and Schnabel, R. (1994). pha-1, a selectable marker for gene transfer in C. elegans. Nucleic Acids Res 22, 1762-1763. Granzier, H.L., and Labeit, S. (2004). The giant protein titin: a major player in myocardial mechanics, signaling, and disease. Circ Res 94, 284-295. Hagel, M., George, E.L., Kim, A., Tamimi, R., Opitz, S.L., Turner, C.E., Imamoto, A., and Thomas, S.M. (2002). The adaptor protein paxillin is essential for normal development in the mouse and is a critical transducer of fibronectin signaling. Mol Cell Biol 22, 901-915. Hai, C.M., Hahne, P., Harrington, E.O., and Gimona, M. (2002). Conventional protein kinase C mediates phorbol-dibutyrate-induced cytoskeletal remodeling in a7r5 smooth muscle cells. Exp Cell Res 280, 64-74. 132  Han, H.F., and Beckerle, M.C. (2009). The ALP-Enigma protein ALP-1 functions in actin filament organization to promote muscle structural integrity in Caenorhabditis elegans. Mol Biol Cell 20, 2361-2370. Hannak, E., Oegema, K., Kirkham, M., Gonczy, P., Habermann, B., and Hyman, A.A. (2002). The kinetically dominant assembly pathway for centrosomal asters in Caenorhabditis elegans is gamma-tubulin dependent. J Cell Biol 157, 591-602. He, H., Wang, J., Liu, T., Liu, X.S., Li, T., Wang, Y., Qian, Z., Zheng, H., Zhu, X., Wu, T., Shi, B., Deng, W., Zhou, W., Skogerbo, G., and Chen, R. (2007). Mapping the C. elegans noncoding transcriptome with a whole-genome tiling microarray. Genome Res 17, 1471-1477. Hikita, T., Qadota, H., Tsuboi, D., Taya, S., Moerman, D.G., and Kaibuchi, K. (2005). Identification of a novel Cdc42 GEF that is localized to the PAT-3-mediated adhesive structure. Biochem Biophys Res Commun 335, 139-145. Hobert, O., Moerman, D.G., Clark, K.A., Beckerle, M.C., and Ruvkun, G. (1999). A conserved LIM protein that affects muscular adherens junction integrity and mechanosensory function in Caenorhabditis elegans. J Cell Biol 144, 45-57. Hresko, M.C., Schriefer, L.A., Shrimankar, P., and Waterston, R.H. (1999). Myotactin, a novel hypodermal protein involved in muscle-cell adhesion in Caenorhabditis elegans. J Cell Biol 146, 659-672. Hresko, M.C., Williams, B.D., and Waterston, R.H. (1994). Assembly of body wall muscle and muscle cell attachment structures in Caenorhabditis elegans. J Cell Biol 124, 491506. Hua, J., Grisafi, P., Cheng, S.H., and Fink, G.R. (2001). Plant growth homeostasis is controlled by the Arabidopsis BON1 and BAP1 genes. Genes Dev 15, 2263-2272. Hunt-Newbury, R., Viveiros, R., Johnsen, R., Mah, A., Anastas, D., Fang, L., Halfnight, E., Lee, D., Lin, J., Lorch, A., McKay, S., Okada, H.M., Pan, J., Schulz, A.K., Tu, D., Wong, K., Zhao, Z., Alexeyenko, A., Burglin, T., Sonnhammer, E., Schnabel, R., Jones, S.J., Marra, M.A., Baillie, D.L., and Moerman, D.G. (2007). High-throughput in vivo analysis of gene expression in Caenorhabditis elegans. PLoS Biol 5, e237. Jambunathan, N., Siani, J.M., and McNellis, T.W. (2001). A humidity-sensitive Arabidopsis copine mutant exhibits precocious cell death and increased disease resistance. Plant Cell 13, 2225-2240. James, P., Halladay, J., and Craig, E.A. (1996). Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144, 1425-1436.  133  Kamath, R.S., Fraser, A.G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, A., Le Bot, N., Moreno, S., Sohrmann, M., Welchman, D.P., Zipperlen, P., and Ahringer, J. (2003). Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421, 231-237. Kaverina, I., Stradal, T.E., and Gimona, M. (2003). Podosome formation in cultured A7r5 vascular smooth muscle cells requires Arp2/3-dependent de-novo actin polymerization at discrete microdomains. J Cell Sci 116, 4915-4924. Kontrogianni-Konstantopoulos, A., Ackermann, M.A., Bowman, A.L., Yap, S.V., and Bloch, R.J. (2009). Muscle giants: molecular scaffolds in sarcomerogenesis. Physiol Rev 89, 1217-1267. Labouesse, M., and Georges-Labouesse, E. (2003). Cell adhesion: parallels between vertebrate and invertebrate focal adhesions. Curr Biol 13, R528-530. Lange, S., Xiang, F., Yakovenko, A., Vihola, A., Hackman, P., Rostkova, E., Kristensen, J., Brandmeier, B., Franzen, G., Hedberg, B., Gunnarsson, L.G., Hughes, S.M., Marchand, S., Sejersen, T., Richard, I., Edstrom, L., Ehler, E., Udd, B., and Gautel, M. (2005). The kinase domain of titin controls muscle gene expression and protein turnover. Science 308, 1599-1603. Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J., and Higgins, D.G. (2007). Clustal W and Clustal X version 2.0. Bioinformatics 23, 2947-2948. Lecroisey, C., Segalat, L., and Gieseler, K. (2007). The C. elegans dense body: anchoring and signaling structure of the muscle. J Muscle Res Cell Motil 28, 79-87. Lehner, B., Tischler, J., and Fraser, A.G. (2006). RNAi screens in Caenorhabditis elegans in a 96-well liquid format and their application to the systematic identification of genetic interactions. Nat Protoc 1, 1617-1620. Li, Y., Gou, M., Sun, Q., and Hua, J. (2010). Requirement of calcium binding, myristoylation, and protein-protein interaction for the Copine BON1 function in Arabidopsis. J Biol Chem 285, 29884-29891. Lin, X.Y., Qadota, H., Moerman, D.G., and Williams, B.D. (2003). C-elegans PAT6/actopaxin plays a critical role in the assembly of integrin adhesion complexes in vivo. Curr Biol 13, 922-932. Linder, S. (2007). The matrix corroded: podosomes and invadopodia in extracellular matrix degradation. Trends Cell Biol 17, 107-117.  134  Linke, W.A. (2008). Sense and stretchability: the role of titin and titin-associated proteins in myocardial stress-sensing and mechanical dysfunction. Cardiovasc Res 77, 637-648. Mackenzie, J.M., Jr., and Epstein, H.F. (1980). Paramyosin is necessary for determination of nematode thick filament length in vivo. Cell 22, 747-755. Mackenzie, J.M., Jr., Garcea, R.L., Zengel, J.M., and Epstein, H.F. (1978). Muscle development in Caenorhabditis elegans: mutants exhibiting retarded sarcomere construction. Cell 15, 751-762. Mackinnon, A.C., Qadota, H., Norman, K.R., Moerman, D.G., and Williams, B.D. (2002). C. elegans PAT-4/ILK functions as an adaptor protein within integrin adhesion complexes. Curr Biol 12, 787-797. MacLeod, A.R., Waterston, R.H., and Brenner, S. (1977a). An internal deletion mutant of a myosin heavy chain in Caenorhabditis elegans. Proc Natl Acad Sci U S A 74, 5336-5340. MacLeod, A.R., Waterston, R.H., Fishpool, R.M., and Brenner, S. (1977b). Identification of the structural gene for a myosin heavy-chain in Caenorhabditis elegans. J Mol Biol 114, 133-140. Mango, S.E. (January 7, 2007). The C. elegans pharynx: a model for organogenesis. WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook.1.129.1, http://www.wormbook.org. Marchisio, P.C., Cirillo, D., Naldini, L., Primavera, M.V., Teti, A., and ZamboninZallone, A. (1984). Cell-substratum interaction of cultured avian osteoclasts is mediated by specific adhesion structures. J Cell Biol 99, 1696-1705. McKeown, C.R., Han, H.F., and Beckerle, M.C. (2006). Molecular characterization of the Caenorhabditis elegans ALP/Enigma gene alp-1. Dev Dyn 235, 530-538. Meissner, B., Rogalski, T., Viveiros, R., Warner, A., Plastino, L., Lorch, A., Granger, L., Segalat, L., and Moerman, D.G. (2011). Determining the Sub-Cellular Localization of Proteins within Caenorhabditis elegans Body Wall Muscle. PLoS One 6, e19937. Meissner, B., Warner, A., Wong, K., Dube, N., Lorch, A., McKay, S.J., Khattra, J., Rogalski, T., Somasiri, A., Chaudhry, I., Fox, R.M., Miller, D.M., 3rd, Baillie, D.L., Holt, R.A., Jones, S.J., Marra, M.A., and Moerman, D.G. (2009). An integrated strategy to study muscle development and myofilament structure in Caenorhabditis elegans. PLoS Genet 5, e1000537. Mercer, K.B., Flaherty, D.B., Miller, R.K., Qadota, H., Tinley, T.L., Moerman, D.G., and Benian, G.M. (2003). Caenorhabditis elegans UNC-98, a C2H2 Zn finger protein, is a 135  novel partner of UNC-97/PINCH in muscle adhesion complexes. Mol Biol Cell 14, 24922507. Mercer, K.B., Miller, R.K., Tinley, T.L., Sheth, S., Qadota, H., and Benian, G.M. (2006). Caenorhabditis elegans UNC-96 is a new component of M-lines that interacts with UNC98 and paramyosin and is required in adult muscle for assembly and/or maintenance of thick filaments. Mol Biol Cell 17, 3832-3847. Miller, D.M., Ortiz, I., Berliner, G.C., and Epstein, H.F. (1983). Differential Localization of 2 Myosins within Nematode Thick Filaments. Cell 34, 477-490. Miller, R.K., Qadota, H., Landsverk, M.L., Mercer, K.B., Epstein, H.F., and Benian, G.M. (2006). UNC-98 links an integrin-associated complex to thick laments in Caenorhabditis elegans muscle. J Cell Biol 175, 853-859. Moerman, D.G., Benian, G.M., Barstead, R.J., Schriefer, L.A., and Waterston, R.H. (1988). Identification and intracellular localization of the unc-22 gene product of Caenorhabditis elegans. Genes Dev 2, 93-105. Moerman, D.G., and Fire, A. (1997). Muscle: Structure, function and development. In: C. elegans II, eds. D.L. Riddle, T. Blumenthal, B.J. Meyer, and J.R. Priess, Cold Spring Harbor: Cold Spring Harbor Press, 417-470. Moerman, D.G., and Williams, B.D. (2006). Sarcomere assembly in C. elegans muscle. WormBook, 1-16. Mullen, G.P., Rogalski, T.M., Bush, J.A., Gorji, P.R., and Moerman, D.G. (1999). Complex patterns of alternative splicing mediate the spatial and temporal distribution of perlecan/UNC-52 in Caenorhabditis elegans. Mol Biol Cell 10, 3205-3221. Murphy, D.A., and Courtneidge, S.A. (2011). The 'ins' and 'outs' of podosomes and invadopodia: characteristics, formation and function. Nat Rev Mol Cell Biol 12, 413-426. Nahabedian, J.F., Qadota, H., Stirman, J.N., Lu, H., and Benian, G.M. (2012). Bending amplitude - a new quantitative assay of C. elegans locomotion: identification of phenotypes for mutants in genes encoding muscle focal adhesion components. Methods 56, 95-102. Nonet, M.L., Grundahl, K., Meyer, B.J., and Rand, J.B. (1993). Synaptic function is impaired but not eliminated in C. elegans mutants lacking synaptotagmin. Cell 73, 12911305. Norman, K.R., Cordes, S., Qadota, H., Rahmani, P., and Moerman, D.G. (2007). UNC97/PINCH is involved in the assembly of integrin cell adhesion complexes in Caenorhabditis elegans body wall muscle. Dev Biol 309, 45-55. 136  Nowak, K., McCullagh, K., Poon, E., and Davies, K.E. (2005). Muscular dystrophies related to the cytoskeleton/nuclear envelope. Novartis Found Symp 264, 98-111; discussion 112-117, 227-130. Ono, K., Yu, R., Mohri, K., and Ono, S. (2006). Caenorhabditis elegans kettin, a large immunoglobulin-like repeat protein, binds to filamentous actin and provides mechanical stability to the contractile apparatuses in body wall muscle. Mol Biol Cell 17, 2722-2734. Proszynski, T.J., Gingras, J., Valdez, G., Krzewski, K., and Sanes, J.R. (2009). Podosomes are present in a postsynaptic apparatus and participate in its maturation. Proc Natl Acad Sci U S A 106, 18373-18378. Qadota, H., and Benian, G.M. (2010). Molecular structure of sarcomere-to-membrane attachment at M-Lines in C. elegans muscle. J Biomed Biotechnol 2010, 864749. Qadota, H., Blangy, A., Xiong, G., and Benian, G.M. (2008a). The DH-PH region of the giant protein UNC-89 activates RHO-1 GTPase in Caenorhabditis elegans body wall muscle. J Mol Biol 383, 747-752. Qadota, H., McGaha, L.A., Mercer, K.B., Stark, T.J., Ferrara, T.M., and Benian, G.M. (2008b). A novel protein phosphatase is a binding partner for the protein kinase domains of UNC-89 (Obscurin) in Caenorhabditis elegans. Mol Biol Cell 19, 2424-2432. Qadota, H., Mercer, K.B., Miller, R.K., Kaibuchi, K., and Benian, G.M. (2007). Two LIM domain proteins and UNC-96 link UNC-97/pinch to myosin thick filaments in Caenorhabditis elegans muscle. Mol Biol Cell 18, 4317-4326. Qadota, H., Moerman, D.G., and Benian, G.M. (2012). A Molecular Mechanism for the Requirement of PAT-4 (Integrin-linked Kinase (ILK)) for the Localization of UNC-112 (Kindlin) to Integrin Adhesion Sites. J Biol Chem 287(34), 28537-51 Reboul, J., Vaglio, P., Rual, J.F., Lamesch, P., Martinez, M., Armstrong, C.M., Li, S., Jacotot, L., Bertin, N., Janky, R., Moore, T., Hudson, J.R., Jr., Hartley, J.L., Brasch, M.A., Vandenhaute, J., Boulton, S., Endress, G.A., Jenna, S., Chevet, E., Papasotiropoulos, V., Tolias, P.P., Ptacek, J., Snyder, M., Huang, R., Chance, M.R., Lee, H., Doucette-Stamm, L., Hill, D.E., and Vidal, M. (2003). C. elegans ORFeome version 1.1: experimental verification of the genome annotation and resource for proteome-scale protein expression. Nat Genet 34, 35-41. Ridley, A.J., Schwartz, M.A., Burridge, K., Firtel, R.A., Ginsberg, M.H., Borisy, G., Parsons, J.T., and Horwitz, A.R. (2003). Cell migration: integrating signals from front to back. Science 302, 1704-1709. Rogalski, T.M., Mullen, G.P., Gilbert, M.M., Williams, B.D., and Moerman, D.G. (2000). The UNC-112 gene in Caenorhabditis elegans encodes a novel component of cell-matrix 137  adhesion structures required for integrin localization in the muscle cell membrane. J Cell Biol 150, 253-264. Rogalski, T.M., Williams, B.D., Mullen, G.P., and Moerman, D.G. (1993). Products of the unc-52 gene in Caenorhabditis elegans are homologous to the core protein of the mammalian basement membrane heparan sulfate proteoglycan. Genes Dev 7, 1471-1484. Schmeichel, K.L., and Beckerle, M.C. (1994). The LIM domain is a modular proteinbinding interface. Cell 79, 211-219. Segalat, L. (2002). Dystrophin and functionally related proteins in the nematode Caenorhabditis elegans. Neuromuscul Disord 12 Suppl 1, S105-109. Small, T.M., Gernert, K.M., Flaherty, D.B., Mercer, K.B., Borodovsky, M., and Benian, G.M. (2004). Three new isoforms of Caenorhabditis elegans UNC-89 containing MLCKlike protein kinase domains. J Mol Biol 342, 91-108. Smith, P., Leung-Chiu, W.M., Montgomery, R., Orsborn, A., Kuznicki, K., GressmanCoberly, E., Mutapcic, L., and Bennett, K. (2002). The GLH proteins, Caenorhabditis elegans P granule components, associate with CSN-5 and KGB-1, proteins necessary for fertility, and with ZYX-1, a predicted cytoskeletal protein. Dev Biol 251, 333-347. Sulston, J.E., and Horvitz, H.R. (1977). Post-embryonic cell lineages of the nematode, Caenorhabditis elegans. Dev Biol 56, 110-156. Sulston, J.E., Schierenberg, E., White, J.G., and Thomson, J.N. (1983). The embryonic cell lineage of the nematode Caenorhabditis elegans. Dev Biol 100, 64-119. Tomsig, J.L., and Creutz, C.E. (2002). Copines: a ubiquitous family of Ca(2+)-dependent phospholipid-binding proteins. Cell Mol Life Sci 59, 1467-1477. Tumbarello, D.A., Brown, M.C., and Turner, C.E. (2002). The paxillin LD motifs. FEBS Lett 513, 114-118. Turner, C.E., Glenney, J.R., Jr., and Burridge, K. (1990). Paxillin: a new vinculinbinding protein present in focal adhesions. J Cell Biol 111, 1059-1068. Turner, C.E., Kramarcy, N., Sealock, R., and Burridge, K. (1991). Localization of paxillin, a focal adhesion protein, to smooth muscle dense plaques, and the myotendinous and neuromuscular junctions of skeletal muscle. Exp Cell Res 192, 651-655. Turner, C.E., and Miller, J.T. (1994). Primary sequence of paxillin contains putative SH2 and SH3 domain binding motifs and multiple LIM domains: identification of a vinculin and pp125Fak-binding region. J Cell Sci 107 ( Pt 6), 1583-1591. 138  Tursun, B., Cochella, L., Carrera, I., and Hobert, O. (2009). A toolkit and robust pipeline for the generation of fosmid-based reporter genes in C. elegans. PLoS One 4, e4625. Walhout, A.J., Temple, G.F., Brasch, M.A., Hartley, J.L., Lorson, M.A., van den Heuvel, S., and Vidal, M. (2000). GATEWAY recombinational cloning: application to the cloning of large numbers of open reading frames or ORFeomes. Methods Enzymol 328, 575-592. Waterston, R.H. (1988). Muscle. In: The nematode Caenorhabditis elegans, ed. W.B. Wood, New York: Cold Spring Harbor Press, 281-335. Waterston, R.H., Thomson, J.N., and Brenner, S. (1980). Mutants with altered muscle structure of Caenorhabditis elegans. Dev Biol 77, 271-302. Wernimont, S.A., Cortesio, C.L., Simonson, W.T., and Huttenlocher, A. (2008). Adhesions ring: a structural comparison between podosomes and the immune synapse. Eur J Cell Biol 87, 507-515. Wheeler, G.N., and Hynes, R.O. (2001). The cloning, genomic organization and expression of the focal contact protein paxillin in Drosophila. Gene 262, 291-299. White, J.G., Southgate, E., Thomson, J.N., and Brenner, S. (1986). The structure of the nervous system of the nematode Caenorhabditis elegans. Philos Trans R Soc Lond B Biol Sci 314, 1-340. Williams, B.D., and Waterston, R.H. (1994). Genes critical for muscle development and function in Caenorhabditis elegans identified through lethal mutations. J Cell Biol 124, 475-490. Wilson, K.J., Qadota, H., Mains, P.E., and Benian, G.M. (2012). UNC-89 (obscurin) binds to MEL-26, a BTB domain protein, and affects the function of MEI-1 (katanin) in striated muscle of C. elegans. Mol Biol Cell. Xiong, G., Qadota, H., Mercer, K.B., McGaha, L.A., Oberhauser, A.F., and Benian, G.M. (2009). A LIM-9 (FHL)/SCPL-1 (SCP) complex interacts with the C-terminal protein kinase regions of UNC-89 (obscurin) in Caenorhabditis elegans muscle. J Mol Biol 386, 976-988. Yang, H., Li, Y., and Hua, J. (2006). The C2 domain protein BAP1 negatively regulates defense responses in Arabidopsis. Plant J 48, 238-248. Young, P., Ehler, E., and Gautel, M. (2001). Obscurin, a giant sarcomeric Rho guanine nucleotide exchange factor protein involved in sarcomere assembly. J Cell Biol 154, 123136.  139  Zengel, J.M., and Epstein, H.F. (1980). Identification of genetic elements associated with muscle structure in the nematode Caenorhabditis elegans. Cell Motil 1, 73-97. Zhao, G., Schriefer, L.A., and Stormo, G.D. (2007). Identification of muscle-specific regulatory modules in Caenorhabditis elegans. Genome Res 17, 348-357.  140  APPENDIX A.1 Supplemental data for Chapter 3  141  Figure A.1 Copine family proteins in C. elegans. The C. elegans genome has 7 genes (1-7) that encode proteins containing copine domains. The protein names shown are based on gene names (e.g. CPNA-1) and sequence names (e.g. F31D5.3). Percentages refer to the percent of identical amino acid residues in each copine domain, as compared to the copine domain of CPNA-1. The numbers in parentheses after the total number of amino acid residues in each protein, denote the positions of copine domains. Note that only NRA-1 and GEM-4 are “typical” in that they also contain C2 domains. Only CPNA-1 also has a predicted transmembrane domain. Also, some isoforms of CPNA-1 and CPNA-2 are not shown. These isoforms, predicted on WormBase (CPNA-1c, CPNA-1d, CPNA-2b, and CPNA-2d) lack copine domains. The right-most column represents results of yeast 2-hybrid assays in which UNC-89 Ig1-5 was tested for interaction with copine domains from each of the 7 C. elegans genes. +, interaction; -, no interaction.  142  143  Figure A.2 Confirmation of interactions using purified proteins. (A) CPNA-1 (825-1058) interacts with UNC-96 (201-418) in vitro. Yeast expressed HAtagged CPNA-1(825-1058) was precipitated with anti-HA beads, washed, incubated with bacterially expressed MBP or MBP-UNC-96 (201-418), washed, and the proteins eluted, separated on a gel, blotted, and reacted with either anti-HA or anti-MBP. (B) CPNA-1 (1731107) interacts with SCPL-1, PAT-6 and LIM-9 in vitro. SDS-PAGE was used to separate 2 µg of His-tagged CPNA-1(173-1107) in each of 4 lanes, and the proteins were transferred to a membrane. One blot strip was incubated with MBP-SCPL-1 (phosphatase domain), one with MBP-PAT-6 (full length), one with MBP-LIM-9 (LIM domains) and the final one with MBP. After washing, each blot strip was incubated with antibodies to MBP coupled to horseradish peroxidase (anti-MBP-HRP), and reactions visualized by ECL. (C) A Coomassie-stained 10% SDS-PAGE shows 2 µg of each bacterially expressed protein used in the anti-HA bead assay and far westerns. Asterisks denote the positions of full-length fusion proteins for His-CPNA1(173-1107) and MBP-SCPL-1. (D) The multiple protein bands detected by far western likely represent degradation products of His-CPNA-1 (173-1107). His-CPNA-1(173-1107) was separated on a gel, blotted and reacted with either anti-CPNA-1 or anti-His. Although the main reaction (indicted by asterisks) of each antibody is to full-length His-CPNA-1(173-1107), expected to be ~140 kDa, reaction to other bands are detected. For each blot or gel, the positions of molecular-weight markers in kDa are indicated.  144  Figure A.3 A new anti-PAT-6 antibody detects a protein of expected size from a worm lysate. The N-terminal 99 residues of PAT-6 were used as immunogen to generate antibodies in rats, and affinity purified. Western blot reaction of anti-PAT-6 to nematode lysates from animals fed empty RNAi vector, or RNAi vector containing pat-6. Note the presence of a 43 kDa protein (arrowhead), the size expected for PAT-6, from worms fed empty vector, and its substantial reduction in animals that have undergone RNAi for pat-6 beginning at the L1 stage.  145  Table A.1 Oligonucleotide PCR primers used for constructing the UNC-89 “bookshelf” Name  Sequence  UNC-89 Segments  Bam-unc-89(N)  GGCGGATCCATGGCTAGTCGACGCCAAAAG  SH3-DH-PH  unc-89(N)-Xho  CGGCTCGAGTTAACCAGGGAACAAGCTGCTCTT  SH3-DH-PH  GX3  GGACGGATCCATTGATTGGACAACAACTGGAAC  Ig1-5  GX4  CCGTCTCGAGTCACTCCACGAATTTCGGTGGTTTC  Ig1-5  GX25  GCGGATATCAAAGTCAGAGTTCCACCAGCA  Ig4-7  GX6  CGCCTCGAGTTACTTCTTCGGCTCGATCGTCAA  Ig4-7  89KSPYF  GCGATCGTAAAAGAAGCTTCTCCTGAGG  KSP  89KSPYR  GCGATCTGACTTCTTCTTCTTTGGTGAGC  KSP  GX7  GCGGATATCCCGGAAGCCGAAAAGCCTCCA  Ig8-13  GX8  CGCCTCGAGTTATGCATCACCGACCTTTTTAAC  Ig8-13  GX9  GCGGATATCAAGGTTGACAAAAAGACTGAA  Ig13-18  GX10  CGCCTCGAGTTACTTCTCCAATGATTCAATGAC  Ig13-18  GX11  GCGGATATCCGTACTCCAACTCCAGTTATG  Ig18-23  GX12  CGCGTCGACTTATGGAATAGAATCCCTGATGAT  Ig18-23  GX132  GCGGATATCGCAGTTGTCAAGAACTTGGTTCCA  Ig23-28  GX142  CGCCTCGAGTTAAACTTGAGCTGGTTCCTTGACTGT  Ig23-28  GX151  GCGGATATCGAAGGAGCTCCAAAGATTGAC  Ig28-33  GX161  CGCCTCGAGTTAAACAATAGCGATTCCAGGAAG  Ig28-33  GX17  GCGGATATCGACGATGGAAAGGATAAGGTG  Ig33-38  GX18  CGCGTCGACTTACAGAACATTTGGCTTGACAAC  Ig33-38  GX19  GCGGATATCAAGGGAGAGGTTGATGAGAAA  Ig38-43  GX20  CGCCTCGAGTTATTCCTGCTTCGGAACCTTGAC  Ig38-43  GX212  GCGGATATCGAGGAGAAGCGCCGAGAATATGCT  Ig43-48  GX222  CGCCTCGAGTTAAATAGTTCGGTCTCCTTCGATAAG  Ig43-48  GX23  GCGCCCGGGTCGTCCATTCGTGAAGGAAAG  Ig48-51-Fn1-Ig52  GX24  CGCCTCGAGTTAGTAGTCGCCTTCAGCTTCAAC  Ig48-51-Fn1-Ig52  YIKL KJW1  GTACCCGGGTCTCCACGCCGTTCCACT CGCCTCGAGTCACTTGAACTTGAG  1/3 IK-Ig53-Fn2 1/3 IK-Ig53-Fn2  146  Table A.2 Oligonucleotide PCR primers used for other constructs Name  Sequence  Purpose  GX1/4  CCGTCTCGAGTCACAAGAAAGTCGGCGC  UNC-89 Ig1-4( 3' )  GX1/3 GX2/5  CCGTCTCGAGTCAATTAAAGGTTGGTGG GGACGGATCCGCATCCACTTCTGCCTTTTTC  UNC-89 Ig1-3( 3' ) UNC-89 Ig2-5( 5' )  GX3/5 TAG149-1  GGACGGATCCGAAAGCAAGGCTGAGCTC GTACGAATTCGAGCAAATTCCATCTATTGCACCG  UNC-89 Ig3-5( 5' ) CPNA-1 Antigen( 5' )  TAG149-2 GX3-SmaI  GATGCTCGAGCTACTTCTTCAGACGGTCAGCTTC GGACCCCGGGATTGATTGGACAACAACTGGA  CPNA-1 Antigen( 3' ) UNC-89 HA-Ig1-3( 5' )  pGBDU-B15-5 pGBDU-B15-3  CGATGAATTCCAGAGCTCACTTCTATCAGTA CGATGGATCCTCAATTTGTCGACTTCTTCAC  HA-CPNA-1(COPINE,5' ) HA-CPNA-1(COPINE,3' )  tag308-5'  GGACCCCGGGCGCCGAAACTCTCTTCTCCAG  CPNA-2 COPINE( 5' )  tag308-3' C01F6.1-5'  CCCGTCTCGAGTCAATTTGGTGCATTGAACATTAC GGACCCCGGGAATTCTTACATGCTGATGGAG  CPNA-2 COPINE( 3' ) CPNA-3 COPINE( 5' )  C01F6.1-3' tag64-5'  CCGTCTCGAGTCAGATCATTGCTAACACATCACT GGACCCCGGGGAGACTATTATGCTCTAC  CPNA-3 COPINE( 3' ) CPNA-4 COPINE( 5' )  tag64-3' tag178-5' tag178-3' NRA-1-5' NRA-1-3'  CCGTCTCGAGTCATTTTGTGGCGTTTACAAACTG GGACCCCGGGTATTCTTTCTTGGATTATATT CGTCTCGAGTCACTGAATTGGCGGTTTTGCAGC GCATGGATCCCTCACCAACGAGAAGAAGAAG CGTAGTCGACCTACTCGCGCATCGTTACAAACTG  CPNA-4 COPINE( 3' ) CPNA-5 COPINE( 5' ) CPNA-5 COPINE( 3' ) NRA-1 COPINE( 5' ) NRA-1 COPINE( 3' )  GEM-4-5' GEM-4-3' CPNA-1Hind3 G CPNA-1F  GCCGATGGATCCCTGATTAATGAAAAAAAGAAG CGTAGTCGACCTAATCACGCATTGTCACAAATTG GACTAAGCTTCTCTTGGCAATCACCTCTCTC CGATCTCGAGTTACAGCGGATTATGCATCAT  GEM-4 COPINE( 5' ) GEM-4 COPINE( 3' ) HIS-CPNA( 5' ) HIS-CPNA( 3' )  PAT6-1 PAT6-99  GTCGGATCCATGTCAACACTTGGTCGTAGT GACCTCGAGTTATGCCAACTTCTGATCGCGGGC  PAT-6 antigen( 5' ) PAT-6 antigen( 3' )  147  Table A.3 Proteins constituting the M-line/dense body “bookshelf”  148  Figure A.4 Venn diagram of genes with phenotypes N2 wild type worms, as well as unc95, and unc-97 animals To screen for essential muscle genes, we screened the muscle transcriptome for embryonic lethality and sterility using N2 worms, and identified 280 genes that elicited those phenotypes in at least two of three replicates. To identify genes synthetically lethal with hypomorphs for both unc-95 and unc-97, two important muscle genes, we screened the muscle transcriptome using hypomorphic strains. We identified 329 total genes with phenotypes, in the unc-95 background, 68 of which did not have a phenotype in either the unc-97 or wild type background We also identified 318 genes in the unc-97 background with phenotypes, 61 of which did not have a phenotype in the unc-95 or wild type background.  149  Table A.4 RNAi screen results for unc-95 and unc-97 hypomorphic strains N2 results from Meissner et al. (2009) were compared with phenotypes observed using RNAi on unc-95 and unc-97 strains. This table lists all phenotypes noted in Figure 3S.4. RNAi well refers to the location in the genome wide Ahringer library available from Geneservice Ltd. Phenotypes listed are “Early Emb” for early embryonic arrest, “Late Emb” for late embryonic arrest, and “Ste” for sterile. SWEM1(tags) and SWO31(tags) indicates the number of SAGE tags recorded in embryonic body wall muscle cell libraries (Meissner et al., 2009). Gene R06F6.5	
   ZK858.4	
   H39E23.1	
   ZC518.2	
   T19E10.1	
   W02B12.9	
   F07A11.2	
   ZK686.3	
   C06C3.6	
   Y37D8A.2	
   Y6B3A.1	
   Y37D8A.9	
   F20D1.3	
   T01H3.2	
   H38K22.3	
   D2007.5	
   C01B10.5	
   H34C03.2	
   T04G9.5	
   F27D4.2	
   K05C4.6	
   T26A5.9	
   T12D8.6	
   T01G9.6	
   W10D5.3	
   F46A9.6	
   F54D5.5	
   T26A5.7	
   R13A5.5	
   Y39A1B.3	
   K10B3.10	
    RNAi well II-­‐7D03	
   I-­‐4D17	
   V-­‐9E06	
   IV-­‐6H01	
   II-­‐7B17	
   II-­‐7H04	
   II-­‐7L24	
   III-­‐4I01	
   II-­‐6P01	
   III-­‐6M10	
   I-­‐6L24	
   III-­‐6M24	
   X-­‐6P02	
   II-­‐5J18	
   III-­‐2K15	
   III-­‐4G02	
   IV-­‐3C24	
   IV-­‐3G06	
   X-­‐1K15	
   I-­‐3F24	
   I-­‐7E20	
   III-­‐3O12	
   III-­‐6D22	
   I-­‐4G07	
   I-­‐4D09	
   I-­‐4N13	
   II-­‐7L04	
   III-­‐3O08	
   III-­‐4C05	
   III-­‐5B22	
   X-­‐2I13	
    N2 screen 	
  	
   Early	
  Emb	
   Early	
  Emb	
   Late	
  Emb	
   Ste	
   Ste	
   Ste	
   	
  	
   Early	
  Emb	
   Late	
  Emb	
   Ste	
   Ste	
   Ste	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Ste	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
    unc-95 screen Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
    unc-97 screen Early	
  Emb	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   150  Gene F44A6.2	
   C35C5.1	
   F46A9.5	
   F59G1.5	
   F22B5.7	
   M106.5	
   R07E5.14	
   F08B4.1	
   F25B3.6	
   F37E3.1	
   H06I04.4	
   F42A6.7	
   C26C6.1	
   C26C6.5	
   C36B1.5	
   F42A8.2	
   K08D12.1	
   C49F5.1	
   F31D5.3	
   T04A8.7	
   T03F6.5	
   T13F2.7	
   F13H10.3	
   K04D7.1	
   R31.1	
   C09B8.7	
   D2021.1	
   F46G10.5	
   F46G10.6	
   K02D7.1	
   F11A10.2	
   Y41E3.4	
   T28F12.2a	
   Y32F6A.3	
   W07E11.1	
   F01G12.5a	
   F23C8.6	
   C32F10.8	
   T05F1.1	
   Y87G2A.8	
   K07D4.7	
   C18A3.5	
    RNAi well X-­‐5C07	
   X-­‐5D07	
   I-­‐4N11	
   II-­‐4B04	
   II-­‐6M11	
   II-­‐7F03	
   III-­‐2A02	
   IV-­‐4K18	
   V-­‐6P13	
   I-­‐3G09	
   III-­‐1L19	
   IV-­‐1D04	
   I-­‐3P13	
   I-­‐3P21	
   I-­‐4G06	
   II-­‐6N13	
   IV-­‐1F23	
   X-­‐5P21	
   II-­‐3P23	
   III-­‐2I20	
   III-­‐6L07	
   IV-­‐5G01	
   IV-­‐5H12	
   IV-­‐5K04	
   V-­‐8C09	
   X-­‐3E04	
   X-­‐4I10	
   X-­‐6C14	
   X-­‐6C16	
   IV-­‐1G11	
   IV-­‐6M14	
   IV-­‐7L19	
   V-­‐3B18	
   V-­‐7A16	
   X-­‐4P18	
   X-­‐7K18	
   I-­‐1E04	
   I-­‐2P01	
   I-­‐4D18	
   I-­‐6L08	
   II-­‐3L15	
   II-­‐4J05	
    N2 screen 	
  	
   	
  	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Ste	
   Ste	
   Ste	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
    unc-95 screen Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
    unc-97 screen Late	
  Emb	
   Late	
  Emb	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   151  Gene F32A5.1	
   C15F1.6	
   C08H9.2	
   F33H1.3	
   T24A11.1	
   F25F2.2	
   ZK121.1	
   F54E7.3	
   B0336.6	
   C16A3.8	
   F57B9.7	
   B0523.5	
   Y47D3B.5	
   Y47D3B.7	
   K08E3.5	
   F38A5.1	
   F20C5.1	
   F58G6.1	
   C28D4.1	
   F25H8.1	
   C47E12.4	
   R07H5.2	
   B0564.7	
   Y57G11C.24	
   F11E6.5	
   T03E6.7	
   K02G10.6	
   C45B2.5	
   F42E11.4	
   T04F8.6	
   F13D2.1	
   C34F6.4	
   C34F6.8	
   C34E11.1	
   C27B7.7	
   R10E4.4	
   F26E4.8	
   T28D9.1	
   T06E6.2	
   R12C12.9	
   R07G3.1	
   F48E8.5	
    RNAi well II-­‐5D07	
   II-­‐5G06	
   II-­‐7C09	
   II-­‐7M15	
   III-­‐1L08	
   III-­‐2C14	
   III-­‐2F14	
   III-­‐3A01	
   III-­‐3A21	
   III-­‐3K12	
   III-­‐3L09	
   III-­‐4L03	
   III-­‐6A21	
   III-­‐6C01	
   III-­‐6H10	
   IV-­‐3A12	
   IV-­‐4O12	
   IV-­‐5A11	
   IV-­‐5E01	
   IV-­‐5M03	
   IV-­‐5M21	
   IV-­‐5P12	
   IV-­‐7A19	
   IV-­‐7L05	
   IV-­‐8I10	
   V-­‐11I07	
   X-­‐2D18	
   X-­‐3E14	
   X-­‐5B01	
   X-­‐5H05	
   X-­‐5I20	
   X-­‐5K10	
   X-­‐5K18	
   X-­‐5L09	
   IV-­‐4F15	
   III-­‐2I21	
   I-­‐4L06	
   II-­‐5C05	
   V-­‐10K05	
   II-­‐4F04	
   II-­‐5P13	
   III-­‐2J10	
    N2 screen 	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   Late	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
    unc-95 screen Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
    unc-97 screen 	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   Early	
  Emb	
   Sge	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   152  Gene R07E5.3	
   F01F1.8	
   ZK637.8	
   Y49E10.15	
   C55A6.9	
   K07C5.6	
   D1054.14	
   D1054.15	
   C53A5.3	
   F14D12.2	
   C01C10.4	
   B0403.4	
   F53G12.5	
   C53H9.2	
   Y23H5A.7	
   ZC123.3	
   R06A10.2	
   W01B11.3	
   T21E12.4	
   F54C1.7	
   C34G6.6	
   Y110A7A.8	
   C32E12.4	
   T19B4.2	
   F55A12.8	
   T08B2.9	
   ZC308.1	
   F20G4.3	
   F57B10.1	
   F22D6.3	
   C54G4.8	
   K04G2.1	
   R05D11.3	
   K07A1.12	
   F25H5.3	
   F25H5.4	
   C36B1.4	
   DY3.2	
   F14B4.3	
   T19A6.2	
   F26H9.6	
   D1081.8	
    RNAi well III-­‐2O05	
   III-­‐3G13	
   III-­‐4D10	
   III-­‐6E10	
   V-­‐7H20	
   V-­‐7M23	
   V-­‐7O04	
   V-­‐7O06	
   V-­‐9F11	
   X-­‐3I11	
   X-­‐3J22	
   X-­‐3P19	
   I-­‐1A23	
   I-­‐1A24	
   I-­‐1G22	
   I-­‐1I07	
   I-­‐1M23	
   I-­‐1O18	
   I-­‐1P04	
   I-­‐2A10	
   I-­‐2B12	
   I-­‐2E12	
   I-­‐2G16	
   I-­‐2J13	
   I-­‐2M04	
   I-­‐2P10	
   I-­‐3E11	
   I-­‐3L24	
   I-­‐3M11	
   I-­‐3O22	
   I-­‐3P14	
   I-­‐3P18	
   I-­‐4A02	
   I-­‐4D14	
   I-­‐4F07	
   I-­‐4F09	
   I-­‐4G04	
   I-­‐4G24	
   I-­‐4H13	
   I-­‐4I17	
   I-­‐4J01	
   I-­‐4M13	
    N2 screen Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
    unc-95 screen Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
    unc-97 screen Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   153  Gene K02B12.3	
   F32H2.5	
   H28O16.1	
   Y105E8A.9	
   Y39G10AR.8	
   Y39G10AR.10	
   Y54E10BR.6	
   Y105E8A.17	
   Y65B4BR.5	
   Y71G12B.11	
   F23F1.8	
   T28D9.10	
   C56C10.3	
   T01H3.1	
   T05C12.7	
   K01C8.10	
   C26D10.1	
   C26D10.2	
   F22B5.9	
   C09H10.3	
   K12D12.2	
   F26F4.10	
   R74.1	
   F23F12.6	
   C27D11.1	
   ZK652.1	
   K02D10.5	
   F58A4.8	
   Y49E10.1	
   T27E9.1	
   ZK180.4	
   T07A9.9	
   M03D4.1	
   F49C12.8	
   F49C12.12	
   R11A8.6	
   C47E12.5	
   Y116A8C.42	
   Y38F2AL.3	
   F26D10.3	
   C37H5.8	
   T22F3.4	
    RNAi well I-­‐4M19	
   I-­‐4O12	
   I-­‐6M02	
   I-­‐7A02	
   I-­‐7J09	
   I-­‐7J23	
   I-­‐7N08	
   I-­‐7O07	
   I-­‐8A11	
   I-­‐8M01	
   II-­‐1C09	
   II-­‐5C19	
   II-­‐5G17	
   II-­‐5J16	
   II-­‐6C15	
   II-­‐6G17	
   II-­‐6G23	
   II-­‐6I01	
   II-­‐6M15	
   II-­‐7L05	
   II-­‐8E07	
   III-­‐2F13	
   III-­‐2G07	
   III-­‐3O22	
   III-­‐4I13	
   III-­‐4I15	
   III-­‐4P13	
   III-­‐5K19	
   III-­‐6C12	
   III-­‐6N21	
   IV-­‐2G06	
   IV-­‐1K05	
   IV-­‐3I07	
   IV-­‐4D24	
   IV-­‐4F08	
   IV-­‐5B17	
   IV-­‐5M23	
   IV-­‐8K09	
   IV-­‐8M20	
   IV-­‐8O17	
   V-­‐3J20	
   V-­‐3O13	
    N2 screen Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
    unc-95 screen Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
    unc-97 screen Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   154  Gene F29G9.4	
   F19F10.9	
   F17C11.9	
   F53B7.3	
   T04C12.4	
   H19N07.1	
   F55A11.2	
   F55C5.8	
   F53F4.11	
   C47E8.7	
   M03F4.2	
   C33D3.1	
   F55F3.3	
   R09G11.2	
   F28H1.3	
   R12E2.3	
   C01G8.9	
   F26A3.2	
   C36B1.3	
   T23D8.3	
   Y106G6H.2	
   W08E3.1	
   Y18D10A.17	
   F10G7.1	
   C08B11.1	
   F44G4.1	
   D2085.3	
   D2013.7	
   B0491.5	
   F54B3.1	
   W01D2.2	
   R06A4.4	
   C29F9.7	
   W07B3.2	
   F30H5.1	
   C36E8.5	
   C34E10.2	
   C34E10.6	
   C07G2.3	
   F35G12.10	
   F26F4.11	
   F56D2.1	
    RNAi well V-­‐4F03	
   V-­‐5D01	
   V-­‐7D21	
   V-­‐7F03	
   V-­‐7H05	
   V-­‐7H19	
   V-­‐7P06	
   V-­‐8A18	
   V-­‐9A05	
   V-­‐9L03	
   X-­‐2J16	
   X-­‐5I11	
   X-­‐6O20	
   X-­‐7H18	
   I-­‐1B08	
   I-­‐1F10	
   I-­‐2I20	
   I-­‐3D16	
   I-­‐4G02	
   I-­‐5A17	
   I-­‐5O21	
   I-­‐6D12	
   I-­‐6F13	
   II-­‐3N24	
   II-­‐5N06	
   II-­‐6B21	
   II-­‐6E20	
   II-­‐6N03	
   II-­‐7D06	
   II-­‐7O23	
   II-­‐9E18	
   II-­‐9I19	
   III-­‐1C19	
   III-­‐1I13	
   III-­‐1K05	
   III-­‐2A15	
   III-­‐2B08	
   III-­‐2B16	
   III-­‐2C10	
   III-­‐2E22	
   III-­‐2F15	
   III-­‐2N12	
    N2 screen Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
    unc-95 screen Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
    unc-97 screen Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   155  Gene T10F2.1	
   C23G10.8	
   K04G7.4	
   F37C12.13	
   T20H4.3	
   C16A3.5	
   C16A3.6	
   F57B9.2	
   F57B9.5	
   ZK328.2	
   ZK328.5	
   T20B12.1	
   K07D8.1	
   C07H6.5	
   K12H4.3	
   R13A5.12	
   C02F5.1	
   F54H12.1	
   T05G5.10	
   R10E11.1	
   R10E11.2	
   R10E11.8	
   Y111B2A.18	
   T21D12.4	
   W03F8.10	
   F20D12.4	
   T10B5.5	
   F46E10.1	
   T05H4.6	
   C06H2.1	
   K07C5.4	
   C52E4.3	
   C52E4.6	
   K12F2.1	
   C53A5.1	
   Y49A3A.2	
   F02E8.1	
   C45B2.7	
   F31B12.1	
   F21A10.2	
   F17E5.2	
   F48F7.1	
    RNAi well III-­‐2N17	
   III-­‐3C12	
   III-­‐3F02	
   III-­‐3H04	
   III-­‐3J12	
   III-­‐3K06	
   III-­‐3K08	
   III-­‐3L13	
   III-­‐3L19	
   III-­‐3M07	
   III-­‐3M13	
   III-­‐3N20	
   III-­‐4A07	
   III-­‐4A17	
   III-­‐4A22	
   III-­‐4C19	
   III-­‐4I12	
   III-­‐4O01	
   III-­‐5A04	
   III-­‐5A06	
   III-­‐5A08	
   III-­‐5A20	
   III-­‐6K04	
   IV-­‐1E21	
   IV-­‐2P15	
   IV-­‐4E07	
   V-­‐1N06	
   V-­‐4D12	
   V-­‐4P21	
   V-­‐7J03	
   V-­‐7M19	
   V-­‐8E09	
   V-­‐8E15	
   V-­‐8O03	
   V-­‐9F07	
   V-­‐9O06	
   X-­‐2N13	
   X-­‐3E18	
   X-­‐5A04	
   X-­‐5A23	
   X-­‐5N12	
   X-­‐6D15	
    N2 screen 	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
    unc-95 screen Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
    unc-97 screen Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   156  Gene C44H4.4	
   R03E1.2	
   W04H10.3	
   C17G10.4	
   T24H7.2	
   F13H8.9	
   T05H10.6	
   F13D12.4	
   T13H5.4	
   ZK1058.2	
   F57B9.6	
   F27C1.7	
   F58F12.1	
   F28C6.7a	
   F22B5.2	
   R53.4	
   C06E1.10	
   T26G10.1	
   F43D9.3	
   T21C12.2	
   T14G10.5	
   T11G6.1	
   Y113G7A.3	
   T27B1.2	
   C53D5.6	
   M05B5.4	
   F26E4.9	
   F25H2.9	
   F25H2.10	
   B0511.6	
   C01A2.5	
   Y37H9A.6	
   C14A4.4	
   H06I04.6	
   C27F2.8	
   C16A3.3	
   C16A3.4	
   T20B12.3	
   ZK1236.3	
   C29E4.8	
   F54F2.1	
   T20D3.8	
    RNAi well X-­‐6D24	
   X-­‐6J17	
   II-­‐1E24	
   II-­‐4D15	
   II-­‐4J20	
   II-­‐4L20	
   II-­‐5P10	
   II-­‐7P24	
   II-­‐6O15	
   III-­‐1P02	
   III-­‐3L21	
   I-­‐2O16	
   II-­‐4P22	
   II-­‐6C16	
   II-­‐6M01	
   II-­‐7G09	
   III-­‐4H17	
   III-­‐5C07	
   III-­‐5J15	
   III-­‐5J23	
   IV-­‐5I20	
   IV-­‐5P23	
   V-­‐12J06	
   X-­‐7O02	
   I-­‐1C13	
   I-­‐3D21	
   I-­‐4L08	
   I-­‐5G02	
   I-­‐5G04	
   I-­‐5I18	
   I-­‐6F12	
   I-­‐7A07	
   II-­‐7K20	
   III-­‐1L21	
   III-­‐2J05	
   III-­‐3K02	
   III-­‐3K04	
   III-­‐3N24	
   III-­‐4B21	
   III-­‐4M21	
   III-­‐4P15	
   IV-­‐4H04	
    N2 screen 	
  	
   	
  	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
    unc-95 screen Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
    unc-97 screen Ste	
   Ste	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   157  Gene C33A12.4	
   C46C2.2	
   H01G02.2	
   F48A11.1	
   C02F5.7	
   Y49E10.6	
   T20F7.6	
   PAR2.4	
   F29D11.2	
   T01G9.4	
   T23D8.1	
   F28C6.3	
   C05D11.12	
   Y39E4B.1	
   Y38A10A.5	
   C14C10.4	
   K04C1.3	
   C17E4.5	
   ZK675.2	
   Y41D4B.19	
   F54D7.2	
   T21G5.3	
   F43G9.1	
   C08B11.3	
   ZC101.2	
   C03C10.3	
   F20H11.3	
   Y71H2AM.5	
   M117.2	
   T27F2.1	
   C48E7.2	
   T10E9.7	
   Y54E5A.4	
   F40H3.5	
   Y38A8.2	
   F56D1.7	
   T13H5.5	
   C47D12.6	
   H19M22.2	
   M88.6	
   F57B9.10	
   C30C11.2	
    RNAi well IV-­‐4L18	
   IV-­‐4P17	
   IV-­‐6E02	
   II-­‐1I01	
   III-­‐4I24	
   III-­‐6C20	
   X-­‐7F21	
   III-­‐4P03	
   I-­‐3D12	
   I-­‐4G03	
   I-­‐5A13	
   II-­‐6C08	
   III-­‐3M16	
   III-­‐6D15	
   V-­‐4H05	
   V-­‐8M04	
   X-­‐6L17	
   I-­‐4L13	
   II-­‐5L04	
   IV-­‐8D05	
   I-­‐2I23	
   I-­‐3I12	
   I-­‐4A14	
   II-­‐5N10	
   II-­‐9A20	
   III-­‐2C17	
   III-­‐3D03	
   III-­‐7K04	
   IV-­‐6E06	
   V-­‐7L14	
   I-­‐2P20	
   I-­‐3M05	
   I-­‐7C24	
   II-­‐4J02	
   II-­‐4K15	
   II-­‐4M10	
   II-­‐6O17	
   II-­‐7P06	
   III-­‐1J01	
   III-­‐2E02	
   III-­‐3N05	
   III-­‐4D09	
    N2 screen 	
  	
   	
  	
   	
  	
   Early	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Ste	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
    unc-95 screen Ste	
   Ste	
   Ste	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
    unc-97 screen 	
  	
   	
  	
   	
  	
   Early	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   158  Gene Y39A1C.1	
   Y39A1A.14	
   Y56A3A.18	
   F38E11.5	
   K08F4.2	
   F18E2.3	
   C52E4.4	
   T01C3.7	
   C54D1.6	
   T28B4.3	
   F52D10.3	
   C09D1.1	
   C46H11.6	
   F33D11.10	
   T25G3.3	
   T23H2.5	
   C36F7.4	
   F43G9.10	
   F36A2.3	
   T08G11.4	
   T23D8.4	
   T23D8.9	
   F10G8.3	
   F59C6.5	
   Y71F9AM.5	
   Y105E8A.6	
   W10D9.5	
   W07E6.1	
   F08B1.1	
   EEED8.5	
   C18A3.4	
   C30B5.6	
   T27F7.3	
   F54C9.1	
   C06C3.1	
   C14A4.1	
   E01G4.5	
   F23H11.5	
   T04A8.14	
   F09F7.3	
   R07E5.10	
   B0336.2	
    RNAi well III-­‐5D12	
   III-­‐5N21	
   III-­‐6K13	
   IV-­‐4L04	
   IV-­‐5G18	
   V-­‐8D05	
   V-­‐8E11	
   V-­‐9D24	
   X-­‐3B22	
   X-­‐3D09	
   X-­‐5F07	
   I-­‐1B22	
   I-­‐2A24	
   I-­‐2P21	
   I-­‐3B10	
   I-­‐3G23	
   I-­‐4B08	
   I-­‐4C08	
   I-­‐4I16	
   I-­‐4M12	
   I-­‐5A19	
   I-­‐5C05	
   I-­‐5C15	
   I-­‐5C22	
   I-­‐8C19	
   I-­‐7A12	
   II-­‐1A14	
   II-­‐1A16	
   II-­‐4G06	
   II-­‐4I20	
   II-­‐4J03	
   II-­‐4J14	
   II-­‐4K23	
   II-­‐6A06	
   II-­‐6N17	
   II-­‐7K14	
   II-­‐8B12	
   III-­‐1G06	
   III-­‐2K08	
   III-­‐2L24	
   III-­‐2O17	
   III-­‐3A13	
    N2 screen Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
    unc-95 screen 	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
    unc-97 screen Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   159  Gene F47D12.4	
   T20H4.5	
   T20B12.8	
   C30C11.4	
   R08D7.3	
   F54H12.6	
   T07C4.7	
   Y111B2A.11	
   Y71H2AM.23	
   Y66H1B.3	
   C09G4.2	
   W02F12.5	
   B0365.3	
   F53F4.10	
   C04F6.4	
   R07E4.6	
   T28B4.1	
   R03G5.1	
   C35B8.3	
   K02A4.1	
   C02C6.1	
   C24A11.8	
   R119.6	
   C46H11.10	
   Y110A7A.13	
   F28B3.1	
   F22D6.6	
   F52B5.5	
   C04F12.10	
   F16D3.4	
   C41G7.1	
   C01B12.7	
   C04A2.3	
   B0495.6	
   C06A1.5	
   F13D12.7	
   C07A9.3	
   C17H12.1	
   K08B4.1	
   F28D1.11	
   F43H9.1	
   F40A3.6	
    RNAi well III-­‐3G18	
   III-­‐3J16	
   III-­‐3P10	
   III-­‐4D13	
   III-­‐4F18	
   III-­‐4O11	
   III-­‐5F11	
   III-­‐6I14	
   III-­‐7I08	
   IV-­‐1I09	
   IV-­‐4I06	
   V-­‐4L14	
   V-­‐8P13	
   V-­‐9A03	
   X-­‐2A18	
   X-­‐3C08	
   X-­‐3D05	
   X-­‐4E01	
   X-­‐4L09	
   X-­‐6G09	
   X-­‐7K09	
   I-­‐2M22	
   I-­‐1E17	
   I-­‐2C08	
   I-­‐2C24	
   I-­‐2M19	
   I-­‐3B03	
   I-­‐4G17	
   I-­‐4H24	
   I-­‐4I07	
   I-­‐4P11	
   II-­‐1A15	
   II-­‐5A24	
   II-­‐5D08	
   II-­‐7K10	
   II-­‐8A05	
   III-­‐5M13	
   IV-­‐3G08	
   IV-­‐3G19	
   IV-­‐6J03	
   V-­‐5B18	
   V-­‐5P19	
    N2 screen 	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   Earlly	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
    unc-95 screen 	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
    unc-97 screen Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   160  Gene ZK287.5	
   R07B7.11	
   T14G12.4	
   F13E6.4	
   C43E11.4	
   C46H11.4	
   F46F11.4	
   C48E7.4	
   Y106G6H.7	
   Y65B4BR.4	
   Y71F9B.4	
   T13H5.3	
   F57C2.5	
   R10F2.1	
   C23G10.4	
   F22B7.5	
   ZK1098.10	
   ZK180.5	
   F54D1.6	
   ZC302.1	
   C54G10.2	
   F38A6.2	
   C25A11.4	
   R07E3.5	
   R119.4	
   B0261.1	
   D2030.4	
   H15N14.2	
   ZK265.6	
   F36H2.1	
   F36A2.7	
   K02A11.1	
   F15D3.1	
   ZC247.2	
   K05C4.1	
   F56F3.1	
   Y39A1A.7	
   Y71H2AM.10	
   F38H4.9	
   F40F11.2	
   Y73F8A.6	
   Y105C5A.14	
    RNAi well V-­‐6D08	
   V-­‐8I15	
   X-­‐2K08	
   X-­‐5M19	
   I-­‐1J12	
   I-­‐2A20	
   I-­‐2H01	
   I-­‐2P24	
   I-­‐5A08	
   I-­‐8A15	
   I-­‐8I01	
   II-­‐6O13	
   II-­‐9O05	
   III-­‐1L03	
   III-­‐3C04	
   III-­‐4J09	
   III-­‐5I05	
   IV-­‐2G08	
   IV-­‐6C07	
   V-­‐7K02	
   V-­‐9J09	
   V-­‐13O03	
   X-­‐4J03	
   X-­‐5G01	
   I-­‐1E13	
   I-­‐2G18	
   I-­‐3B20	
   I-­‐3H12	
   I-­‐4E15	
   I-­‐4H03	
   I-­‐4I22	
   I-­‐4J10	
   I-­‐5D24	
   I-­‐5K07	
   I-­‐7E10	
   III-­‐2A18	
   III-­‐5N07	
   III-­‐7I16	
   IV-­‐6G06	
   IV-­‐6M11	
   IV-­‐7B10	
   IV-­‐7F18	
    N2 screen Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Early	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Late	
  Emb	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
   Ste	
    unc-95 screen 	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
    unc-97 screen 	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   	
  	
   161  Gene F32D1.2	
   D1014.3	
   H14N18.1	
   R04F11.2	
   W06B11.2	
    RNAi well V-­‐3L15	
   V-­‐5H12	
   V-­‐6E04	
   V-­‐8C04	
   X-­‐3O11	
    N2 screen Ste	
   Ste	
   Ste	
   Ste	
   Ste	
    unc-95 screen 	
  	
   	
  	
   	
  	
   	
  	
   	
  	
    unc-97 screen 	
  	
   	
  	
   	
  	
   	
  	
   	
  	
    162  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0073171/manifest

Comment

Related Items