Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Activity-mediated secretion of progranulin-containing granules Petoukhov, Eugenia 2012

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2012_fall_petoukhov_eugenia.pdf [ 2.38MB ]
Metadata
JSON: 24-1.0073145.json
JSON-LD: 24-1.0073145-ld.json
RDF/XML (Pretty): 24-1.0073145-rdf.xml
RDF/JSON: 24-1.0073145-rdf.json
Turtle: 24-1.0073145-turtle.txt
N-Triples: 24-1.0073145-rdf-ntriples.txt
Original Record: 24-1.0073145-source.json
Full Text
24-1.0073145-fulltext.txt
Citation
24-1.0073145.ris

Full Text

ACTIVITY-MEDIATED SECRETION OF PROGRANULIN-CONTAINING GRANULES  by  EUGENIA PETOUKHOV B.Sc., Carleton University, 2008   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF   MASTER OF SCIENCE  in  THE FACULTY OF GRADUATE STUDIES  (Neuroscience)  THE UNIVERSITY OF BRITISH COLUMBIA  (Vancouver) August 2012 © Eugenia Petoukhov, 2012  ii     ABSTRACT Progranulin (PGRN) is a multi-functional, secreted growth factor expressed in a variety of tissues throughout the body. In the central nervous system (CNS), PGRN is expressed in microglia as well as in a number of neuronal populations and has been shown to promote neuronal survival, enhance neurite outgrowth and regulate inflammation and development. Mutations in the progranulin (GRN) gene have been identified as a major cause of autosomal dominant frontotemporal dementia (FTD) with tau-negative inclusions.  The majority of GRN mutations result in the production of a null allele and reduced PGRN expression. However, the normal functions of PGRN in the CNS remain poorly understood. Our study examines the secretion characteristics of PGRN in neurons. To study the secretion of PGRN from axons and dendrites, we have fused a pH-sensitive optical reporter of exocytosis, superecliptic pHluorin, to PGRN (PGRN-SEP). We demonstrate that activity enhances the secretion of PGRN from axons and dendrites with different temporal profiles of secretion. We show, using calcium blockers and calcium-free media, that activity-mediated secretion of PGRN requires Ca2+ entry via voltage- gated calcium channels (VGCC). We postulate that activity-dependent secretion of PGRN may enhance the formation and maturation of synapses as treatment of hippocampal neurons with recombinant PGRN results in an increase in synapse density.               iii     PREFACE The research included in this thesis was approved by Animal Care Committee (Animal Certificate  # A10-0316) and by Biosafety Committee (Biohazard Certificate  # B10-0019).                                              iv     TABLE OF CONTENTS ABSTRACT .................................................................................................................................... ii PREFACE ...................................................................................................................................... iii TABLE OF CONTENTS ............................................................................................................... iv LIST OF FIGURES ....................................................................................................................... vi LIST OF ABBREVIATIONS ....................................................................................................... vii ACKNOWLEDGEMENTS ........................................................................................................... ix CHAPTER I: INTRODUCTION .................................................................................................... 1 PROGRANULIN ........................................................................................................................ 1 Overview of progranulin expression and function outside the CNS ....................................... 1 Structure and processing .......................................................................................................... 4 Progranulin and Binding Partners ............................................................................................ 4 Progranulin and Frontotemporal Dementia ............................................................................. 6 PGRN expression and function in the nervous system............................................................ 7 NEUROTROPHINS .................................................................................................................... 8 Brain-derived Neurotrophic Factor ......................................................................................... 9 Activity-Mediated Secretion of BDNF.................................................................................. 10 VESICLE BIOGENESIS AND SECRETION ......................................................................... 11 NEURONAL TRANSPORT..................................................................................................... 14 Axonal Transport ................................................................................................................... 17 Dendritic Transport................................................................................................................ 17 REGULATED EXOCYTOSIS ................................................................................................. 18 Docking and Priming ............................................................................................................. 18  v     Vesicular Fusion .................................................................................................................... 19 Kiss and Run Exocytosis ....................................................................................................... 22 OVERALL OBJECTIVE .............................................................................................................. 23 HYPOTHESIS .............................................................................................................................. 23 CHAPTER II: MATERIALS AND METHODS .......................................................................... 24 DNA Constructs: ....................................................................................................................... 24 Hippocampal culture and transfection: ..................................................................................... 24 Immunohistochemistry: ............................................................................................................. 24 PGRN ELISA: ........................................................................................................................... 25 Image Acquisition: .................................................................................................................... 25 Image Analysis: ......................................................................................................................... 26 Recombinant PGRN treatment: ................................................................................................. 28 CHAPTER III: RESULTS ............................................................................................................ 29 Expression of endogenous and fluorescently tagged PGRN ..................................................... 29 Activity-induced translocation of PGRN .................................................................................. 29 Activity enhances PGRN Secretion .......................................................................................... 31 Examining PGRN secretion using ELISA ................................................................................ 39 Recombinant PGRN treatment increases synapse density but decreases Integrated Density of VGlut-1 puncta .......................................................................................................................... 41 Activity-mediated PGRN exocytosis of PGRN mutants ........................................................... 41 CHAPTER IV: DISCUSSION ..................................................................................................... 47 BIBLIOGRAPHY: ........................................................................................................................ 52   vi      LIST OF FIGURES  Figure 1. Schematic representation of the GRN gene structure and the corresponding mRNA encoding the PGRN protein………………………………………………………….…….……..2   Figure 2. Schematic of two proposed models to explain sorting mechanisms for the formation of secretory granules in the TGN……………………………………………………………..…….13  Figure 3. Axonal and dendritic transport of cargoes within a neuron…………………………..16  Figure 4. Molecular model of vesicle exocytosis……………………………………………….21  Figure 5. PGRN-eGFP is localized to both axons and dendrites and to a subset of synapses……………………………………………………………………………………….....30  Figure 6. Activity enhances the density of PGRN-eGFP puncta at axons and enhances the recruitment of PGRN-eGFP to synapses…………………………………………………….…..32  Figure 7. Treatment of neurons expressing PGRN-SEP with NH4Cl and MES……………......34  Figure 8. Activity enhances the secretion of PGRN from axons and dendrites………………...36  Figure 9. Measuring PGRN concentration following high KCl stimulation using ELISA…......40  Figure 10. Synapse density is increased, but integrated density of VGlut-1 puncta is decreased following treatment with recombinant PGRN protein…………………………………………...42  Figure 11. There is no significant difference in secretion of PGRN mutants from axons at basal conditions or following activity………………………………………………………………….44  Figure 12. Puncta density, integrated density and percent colocalization with synapses of PGRN mutants A9D, P248L and R432C………………………………………………………………..45            vii      LIST OF ABBREVIATIONS  AMPA – (2-amino-3-(5-methyl-3-oxo-1,2-oxazol-4-yl)propanoic acid) BDNF – brain-derived neurotrophic factor CamKII - calcium/calmodulin-dependent kinase II CNS – central nervous system CPE –  carboxypeptidase E DCV – dense-core vesicle DIV – days in vitro FTD – frontotemporal dementia ECM – extracellular matrix EGTA – ethylene glycol tetraacetic acid ELISA – enzyme-linked immunosorbent assay ER – endoplasmic reticulum GRN – granulin GRN – progranulin gene GTPase – guanosine triphosphate (GTP) hydrolase H2O2 – hydrogen peroxide HBSS – Hank’s balanced salt solution KCl – potassium chloride LTP – long-term potentiaion MAPs – microtubule-associated proteins MAPK – mitogen-activated protein kinase mGlu – metabotropic glutamate receptor  viii     NMDA – N-Methyl-D-aspartate NGF – nerve growth factor NSF – N-ethylmaleimide sensitive fusion protein NT3 – neurotrophin 3 NT4 – neurotrophin 4 p75NTR –  p75 neurotrophin receptor PBS – phosphate buffered saline PGRN – progranulin PI3-K - phosphatidylinositol 3-kinase PLC-γ – phospholipase C-γ PSD-95 – postsynaptic density protein 95 RyR – ryanodine receptor SLPI – secretory leukocyte protease inhibitor SNARE – SNAP (Soluble NSF Attachment Protein) REceptor SVs – synaptic vesicles TDP-43 – TAR DNA-binding protein 43 TGN – trans-Golgi network TNFR – tumor necrosis factor receptor TNFα – tumor necrosis factor alpha VAMP – vesicle-associated membrane protein VGlut-1 – vesicular glutamate transporter 1 VGCC- voltage-gated calcium channels v-SNARE – vesicle membrane SNARE t-SNARE – target membrane SNARE  ix     ACKNOWLEDGEMENTS I would like to express my deepest gratitude to my supervisor Dr. Shernaz Bamji for her excellent guidance and support on this project. Thank you for believing in me and mentoring me every single step of the way.  I am also thankful to the members of my committee: Dr. Tim O’Connor, Dr. Jim Johnson and Dr. Y.N. Kwok for their mentorship and helpful input.  A special thanks to all the members of the Bamji lab, old and new. In particular, I would like to thank Dr. Yu Sun for all her unconditional and valuable help on my project. I would also like to thank Farhan Shivji, Stefano Brigidi, Fergil Mills and Andrea Globa for their unwavering support and friendship.  Many thanks to my collaborators, Sarah Fernando and Dr. Michael Silverman, for their important contributions and advice.  I am thankful to my friends Jan Kozicky, Swetha Popuri, Kyle Maynard and Jaya Wiswanathan for their continuous encouragement.  I would like to thank the Canadian Institute of Health Research for awarding me the Frederick Banting and Charles Best Canada Graduate Scholarships – Master’s Award and the University of British Columbia for awarding me the Pacific Century Graduate Scholarship, as well as the UBC Graduate Fellowship.  I wish to express my eternal gratitude to my dearly loved parents and brother: Sergei, Irina and Konstantin Petoukhov for their love and support.        1     CHAPTER I: INTRODUCTION PROGRANULIN Overview of progranulin expression and function outside the CNS Progranulin (PGRN) is a widely expressed secreted growth factor implicated in proliferation, wound repair, embryonic development, signal transduction, tumorigenesis, host defense and inflammation (Bateman and Bennett, 2009; Daniel et al., 2000; He et al., 2003; Kessenbrock et al., 2008; Yin et al., 2010). PGRN was independently isolated by several different laboratories as a secreted glycoprotein composed of a signal peptide and 7.5 tandem repeats of a cysteine-rich motif that can be proteolytically cleaved to form several smaller granulin (GRN) peptides (Fig. 1) (Plowman et al., 1992; Baba et al., 1993; Zhou et al., 1993). PGRN is highly expressed in a subset of epithelial cells, including those in the intestinal crypt, skin and reproductive tracts (Daniel et al., 2003; Daniel et al., 2000). PGRN is also expressed in immune cells of the spleen and the lymph nodes, as well as in cells of the innate immune system, such as bone marrow cells (Bhandari et al., 1992; Daniel et al., 2000). During development, PGRN is widely expressed in the placenta, epidermis and microvasculature (Daniel et al., 2003). In addition, some human cancers also express PGRN, and it has been shown to contribute to tumorigenesis in breast cancer, ovarian carcinoma and multiple myeloma (reviewed in Bateman and Bennett, 2009). The function of PGRN in regulating cellular proliferation has been extensively studied (Bateman et al., 1990; Plowman et al., 1992; Xu et al., 1998). Initial evidence of PGRN’s function as proliferation factor originated from cancer studies, which demonstrated that PGRN acts as an autocrine growth factor in aggressive teratomas (Bateman and Bennett, 2009; Zhou et al., 1993). During tumorigenesis, PGRN increases proliferation, inhibits apoptosis and increases  2     GRN gene on chromosome  17q2131            12 coding exons PGRN mRNA  563 codons Figure 1       Figure 1. Schematic representation of the GRN gene structure and the corresponding mRNA encoding the PGRN protein. Numbered boxes (1-12) depict exons in the GRN gene, whereas lettered boxes (A-G) represent each of the individual GRN domains in the PGRN protein product. Modified with permission from (Gass et al., 2006).      3     migration through the extracellular matrix (ECM), resulting in increased tumour expansion (Liu and Bosch, 2012). During wound repair, PGRN inhibits TNF-α induced signaling in neutrophils and thereby reduces inflammation (Zhu et al., 2002). Additionally, in early stages of wound healing, PGRN increases the recruitment of fibroblasts, endothelial cells, macrophages, neutrophis and blood vessels to the wounded areas, thus regulating the wound response and accelerating tissue repair (He et al., 2003). PGRN also plays an important role during embryonic development (reviewed in Gass et al., 2012). PGRN has been shown to stimulate blastocyst formation and the subsequent formation of the placenta (Desmarais et al., 2008; Diaz-Cueto et al., 2000; Qin et al., 2005).  Moreover, PGRN stimulates the development of early embryonic epithelia, resulting in normal progression of embryonic development to the blastocyst stage (Diaz-Cueto et al., 2000). Despite its apparent importance in early development, constitutive GRN knockout mice survive to late adulthood (Kayasuga et al., 2007; Petkau et al., 2011). PGRN also contributes to normal brain development since it regulates the male-specific sexual differentiation of the hypothalamus during perinatal development (Suzuki and Nishiahara, 2002).   Interest in PGRN has increased since the discovery that mutations in the GRN gene are linked to frontotemporal dementia (FTD), a set of progressive disorders characterized by widespread degeneration of the frontal and temporal lobes of the brain (Baker et al., 2006; Cruts et al., 2006; Gass et al., 2006). FTD and the function of PGRN in hippocampal neurons will be further discussed below.    4     Structure and processing PGRN is a 68 kDa glycoprotein, comprised of a signal peptide followed by seven and a half tandem repeats of 12 cysteine-rich granulin (GRN) motifs (Bateman et al., 1990) (Fig. 1). The cysteine-rich motifs give rise to each of the GRNs having a unique structure of four stacked beta-hairpins held together by six disulphide bridges (Hrabal et al., 1996). PGRN can be proteolytically processed by elastase and proteinase-3 into individual 6-25 kDa GRN peptides (granulins A-G) corresponding to each of the GRN domains by cleavage at the inter-GRN linker regions (Fig. 1) (reviewed in Bateman and Bennett, 1998).  The balance between PGRN and its cleaved GRN peptides is maintained by the secretory leukocyte protease inhibitor (SLPI), which can bind to PGRN and prevent its proteolysis (Zhu et al., 2002). Evidence suggests that full-length PGRN and individual GRN peptides have opposing functions. For instance, full-length PGRN decreases neutrophil activation and enhances the secretion of an anti-inflammatory cytokike, IL-10 in macrophages (Zhu et al., 2002). In contrast, some of the individual GRNs are thought to exert pro-inflammatory effects on neutrophils (Zhu et al., 2002). Progranulin and Binding Partners Although full-length PGRN had been identified as early as 1992 (Bhandari et al., 1992; Plowman et al., 1992) and known to be a secreted protein involved in multiple processes throughout the body, efforts to determine its mechanism of action were obstructed by the lack of knowledge of its binding receptor (Bateman and Bennett, 2009). Recently, using an expression cloning screen, Hu and colleagues demonstrated that PGRN binds to sortilin via its C terminus with high affinity (Hu et al., 2010). Sortilin is a type I single pass transmembrane protein and is a member of the Vps10p family of receptors expressed mainly in neurons, which act as sorting  5     receptors for molecules in the secretory pathway and on the cell membrane (Nielsen et al., 2001; Willnow et al., 2008). Sortilin regulates intracellular protein trafficking and by shuttling between the cell surface and intracellular compartments, directs target proteins to their specific fates including signal transduction, regulated secretion, endocytic uptake, anterograde and/or retrograde sorting (reviewed in Nykjaer and Willnow, 2012). In addition, sortilin can also form a complex with the nerve-growth factor (NGF) receptor p75NTR  to activate pro-NGF and pro- BDNF mediated cell death (reviewed in Hermey, 2009). By binding to PGRN, sortilin mediates PGRN endocytosis and delivery to the lysosome, thereby regulating the level of PGRN in the brain (Hu et al., 2010). Direct binding studies revealed that PGRN and proNGF bind distinct sites on the sortilin ectodomain, suggesting that PGRN and pro-neurotrophins interact with sortilin through different mechanisms (Zheng et al., 2011). In addition, PGRN shows no affinity for p75NTR and the Sortilin/p75NTR co-expressing cells display no increase of affinity for PGRN (Hu et al., 2010). Although PGRN functions in promoting neuronal survival (Ryan et al., 2009; Van Damme et al., 2008), it remains unknown whether sortilin is able to act as a signaling receptor for PGRN, and whether PGRN is able to inhibit pro-neurotrophin-induced apoptosis through its interaction with sortilin. PGRN has also been shown to bind to tumour necrosis factor receptors 1 and 2 (TNFR1 and TNFR2), thereby inhibiting the interaction between TNFα and TNFR and blocking TNFα- induced pro-inflammatory intracellular signaling pathways (Tang et al., 2011). Using a collagen- induced arthritis mouse model, Tang et al. (2011) showed that loss of PGRN increased inflammation and joint damage induced by arthritis (Tang et al., 2011). Conversely, treatment with recombinant PGRN protein delayed the symptoms of arthritis in this model (Tang et al., 2011). These two recently identified PGRN receptors may help provide critical mechanistic links  6     to our understanding of normal PGRN functions in the CNS and how loss of PGRN function results in FTD. In addition, the discovery of sortilin and TNFR as PGRN receptors may help in the development of novel therapeutics targeted to regulate PGRN levels. Progranulin and Frontotemporal Dementia Frontotemporal dementia (FTD) is a clinical syndrome that accounts for 5-10% of all dementia, and 10-20% of dementia in patients with the onset before 65 years of age (Neary et al., 1998). FTD is a set of progressive disorders, which affects the frontal and/or temporal lobes of the brain, characterized by language and memory impairments, behavioural abnormalities and personality changes (McKhann et al., 2001; Neary et al., 1998). Mutations in the PGRN gene have been previously shown to be the major cause of FTD with tau-negative, ubiquitin and TAR DNA-binding protein 43 (TDP-43) positive inclusions (Baker et al., 2006; Cruts et al., 2006; Gass et al., 2006) Thus far, 69  PGRN mutations have been identified, responsible for 5-10% of all FTD mutations (http://www.molgen.ua.ac.be/FTDMutations). Most of the PGRN mutations result in a loss-of-function due to nonsense-mediated mRNA decay and a decrease in the amount of expressed and secreted PGRN (Baker et al., 2006; Cruts et al., 2006). Indeed, patients with PGRN mutations exhibit a >50% decrease in PGRN levels in the blood and cerebrospinal fluid (Finch et al., 2009; Van Damme et al., 2008). In addition, several missense mutations that lead to FTD and that disrupt PGRN secretion have been identified (Mukherjee et al., 2008; Shankaran et al., 2008; Wang et al., 2010). For example, a point mutation in the signal peptide of PGRN (PGRN A9D) results in an inability of PGRN to be glycosylated or secreted, leading to PGRN insufficiency without affecting PGRN mRNA levels (Mukherjee et al., 2008). Two other missense mutations, P248L and R432C result in reduced PGRN secretion, potentially due to  7     being inefficiently transported and partially degraded within the secretory pathway (Shankaran et al., 2008). Despite the evidence of PGRN acting as a growth factor mediating neuronal survival and neurite outgrowth (Ryan et al., 2009; Van Damme et al., 2008), a precise understanding of the functional roles for PGRN and GRNs in the brain is lacking. The following sections will focus on PGRN expression and function in the brain. PGRN expression and function in the nervous system The expression of PGRN in the CNS is developmentally regulated. During early stages of development, PGRN mRNA is widely expressed in the olfactory bulbs, retinal ganglia, forebrain and the spinal cord (Daniel et al., 2003), and then becomes progressively restricted as brain development progresses. In the adult brain, PGRN is limited to discrete neuronal populations including pyramidal neurons of the cortex and hippocampus, as well as cerebellar Purkinje cells and spinal motor neurons (Petkau et al., 2010). Importantly, PGRN expression is dramatically upregulated in activated microglial cells, indicating a neuroinflammatory role for PGRN (reviewed in Baker and Manuelidis, 2003). The function of PGRN in the brain is not well understood. Previous work has shown that full-length PGRN and its peptide, GRN E, can act as a survival factor for cultured cortical and motor neurons (Ryan et al., 2009; Van Damme et al., 2008).  Conversely, PGRN knockdown increases caspase-3 activation and neuronal vulnerability to normally sublethal doses of N- methyl-D-aspartic acid (NMDA) and hydrogen peroxide (H2O2), resulting in cell death (Guo et al., 2010; Yin et al., 2010). Interestingly, the ability of PGRN to promote neuronal survival seems to depend on its cleavage into GRNs, since the addition of SLPI diminishes the effects of PGRN on neuronal survival (Van Damme et al., 2008).  8     Previous work from our lab has demonstrated that knocking down PGRN levels in primary hippocampal neurons using siRNA decreases neuronal arborization (Tapia et al., 2011). PGRN depletion has also been shown to attenuate the outgrowth of spinal motor axons in zebrafish embryos, demonstrating that PGRN displays neurotrophic properties properties in vitro and in vivo (Laird et al., 2010). Conversely, treatment with full-length PGRN (Gao et al., 2010) and a GRN-domain peptide, GRN-E (Gao et al., 2010; Van Damme et al., 2008), was shown to enhance  neurite outgrowth in cortical neurons, and overexpression of PGRN found to induce the appearance of dendritic structures in NSC-34 motor neuron cells (Ryan et al., 2009). PGRN knock down in hippocampal neurons results in reduced synapse density, but increased number of synaptic vesicles per synapse and the frequency of miniature excitatory post-synaptic currents (mEPSCs) (Tapia et al., 2011). In addition, constitutive PGRN knockout mice display altered synaptic connectivity and impaired synaptic plasticity (Petkau et al., 2011). Taken together, these data suggest PGRN plays an important role in neuronal morphology and connectivity. NEUROTROPHINS Neurotrophins have many diverse functions in the CNS, from regulating differentiation to neuronal survival, synaptogenesis and activity-dependent forms of synaptic plasticity (reviewed in Lu et al., 2005). Four neurotrophins have been identified so far: nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin 3 (NT3), and neurotrophin 4 (NT4). These molecules exert their actions by binding to two classes of transmembrane receptors: p75NTR and the Trk family of receptor tyrosine kinases, which includes TrkA, TrkB and TrkC (reviewed in Huang and Reichardt, 2003). Neurotrophins arise from precursor pro-neurotrophins, which are proteolytically cleaved to produce mature proteins (Seidah et al., 1996). Pro-  9     neurotrophins bind to p75NTR with high affinity and promote cell death, while mature neurotrophins preferentially bind to Trk receptors and promote survival (reviewed in Hempstead, 2002; Lu et al., 2005). One of the main signaling pathways important in cell survival was identified as the phosphatidylinositol 3-kinase (PI3-K)-Akt pathway, which prevents cell death by blocking the apoptotic actions of BCL2-associated death protein BAD (Brunet et al., 2001; Reichardt, 2006). The other important pathway in cell survival is the mitogen-activated protein kinase (MAPK)- MEK signaling cascade, which results in stimulating the activity and the expression of anti- apoptotic proteins, such as BCL2 (reviewed in Blum and Konnerth, 2005; Kaplan and Miller, 2000). In addition, the MAPK pathway plays an important role in neurite outgrowth (reviewed in Pullikuth and Catling, 2007). The detailed examination of neurotrophin function and signaling are beyond of the scope of this work, and have been described in several excellent reviews (Chao, 2003; Lu et al., 2005; Poo, 2001; Vicario-Abejon et al., 2002) Brain-derived Neurotrophic Factor Brain-derived neurotrophic factor (BDNF) is a neurotrophin that has been shown to play an important role in the development of the nervous system, in the survival of specific populations of neurons, as well as in the modulation of synaptic transmission (Murray and Holmes, 2011). BDNF is widely expressed in most brain structures, including the hippocampus, amygdala and cerebellum and its expression and secretion is regulated by neuronal activity (Gall and Isackson, 1989; Kuczewski et al., 2009). BDNF is initially synthesized in the endoplasmic reticulum (ER) as its precursor, proBDNF (reviewed in Lu et al., 2005). Following the cleavage of proBDNF by the extracellular proteinase plasmin into its mature form (Pang et al., 2004), BDNF is sorted into either constitutive or regulated pathway  10     (Farhadi et al., 2000). The cleavage of proBDNF to BDNF is an important step in regulating the neurotrophic action of BDNF, since its precursor and mature form have been demonstrated to have opposing effects (reviewed in Chao and Bothwell, 2002). BDNF is transported from the cell body to the axon and dendrites, where can be secreted in response to neuronal activity (reviewed in Hartmann et al., 2012). Following the transport of BDNF from the cell body to the axon terminal BDNF can be secreted presynaptically and act in an autocrine or paracrine manner, depending on the site of TrkB receptor expression (reviewed in Lessmann et al., 2003). In axons, BDNF is transported in both anterograde and retrograde directions in dense-core vesicles (DCVs) to be secreted in response to neuronal activity (Adachi et al., 2005; Altar et al., 1997; Cheng et al., 2011; DiStefano et al., 1992; Matsuda et al., 2009). BDNF transport has not been extensively studied in dendrites; however, bidirectional movements of BDNF-GFP have been observed in the neurites of cultured cortical neurons (Kohara et al., 2001). Similarly to axons, BDNF is transported in the DCVs in the regulated secretory pathway and secreted in an activity-dependent manner in dendrites (Cheng et al., 2011; Gottmann et al., 2009; Kuczewski et al., 2010; Matsuda et al., 2009; Smith et al., 1997). Activity-Mediated Secretion of BDNF Activity-dependent secretion of BDNF plays an important role in modulating synaptic efficacy and neuronal morphology, and is involved in the maintenance long-term potentiation (LTP) (Bramham and Messaoudi, 2005; Lu et al., 2005; Lu et al., 2008). Activity-mediated secretion of BDNF has been well characterized in response to a variety of stimuli, including patterned electrical stimulation (Balkowiec and Katz, 2000), high K+  (Egan et al., 2003) and the excitatory neurotransmitter glutamate (reviewed in Lu, 2003). Secretion of BDNF is dependent upon the intracellular rise in Ca2+ concentration, which occurs following the activation of either  11     voltage-gated Ca2+ channels (VGCC) or NMDA receptors following membrane deporarization (reviewed in Kuczewski et al., 2010).The intracellular increase in  Ca2+ concentration and the subsequent BDNF secretion can also occur after the activation of the IP3 receptors on the ER membrane following the activation of metabotropic glutamatergic receptors (mGlu) (Canossa et al., 2001; Griesbeck et al., 1999; Kuczewski et al., 2010; Kuczewski et al., 2009).The intracellular rise in Ca2+ concentration is further amplified by Ca2+-triggered Ca2+ secretion mediated by the ryanodine receptors (RyR) (reviewed in Lessmann et al., 2003). Consequently, Calcium/Calmodulin-dependent Kinase II (CamKII) is activated by intracellular Ca2+, which leads to the fusion of BDNF-containing vesicles with the cell membrane and exocytosis (reviewed in Kuczewski et al., 2010). Experiments using GFP-tagged BDNF have demonstrated that BDNF can be released both pre-synaptically and post-synaptically, and that the amount of BDNF released depends on the pattern of electrical stimulation (reviewed in Lu, 2003). The most effective stimulus for BDNF secretion has been shown to be LTP-inducing tetanic stimulation, as opposed to low- frequency stimulation (Balkowiec and Katz, 2000). Prior to the activity-mediated release of BDNF in axons and dendrites, it needs to be packaged into secretory vesicles and transported along microtubules to its site of secretion. VESICLE BIOGENESIS AND SECRETION All proteins destined for secretion enter the secretory pathway in ER and the trans-Golgi network (TGN), where they are sorted and transported to their destinations (reviewed in Stephens and Pepperkok, 2001). From there, the proteins destined for secretion are sorted into two types of vesicles. In all cell types, some of the secretory proteins are to be secreted continuously with no extracellular stimulation needed to trigger their release and belong to the  12     constitutive secretory pathway. These vesicles are sorted within the TGN into transport vesicles, and move immediately to fuse with the plasma membrane in order to release their contents by exocytosis (reviewed in Lodish et al., 2000). The regulated secretory pathway occurs in specialized secretory cells, such as neurons, and involves the secretion of vesicular contents in response to a specific signal. The proteins destined for regulated secretion are packaged into secretory vesicles, and are secreted in response to specific hormonal or neural stimuli (reviewed in Lodish et al., 2000). Peptide hormones and neurotransmitters are synthesized as larger precursors at the rough ER, followed by their insertion into the ER cisternae and transport to the Golgi apparatus. Subsequently, the precursors are packaged into secretory granules at the TGN to be later processed to active peptides (reviewed in Kim et al., 2006). At this point, the molecules destined for the constitutive secretory pathway need to be sorted from those destined to be in the regulated secretory pathway. Currently, there are two models to explain how molecules are sorted to DCVs (reviewed in Borgonovo et al., 2006). This section and the following will focus on the biogenesis, transport and secretion of DCVs as PGRN is thought to be localized in a DCV (see Results section). The first model, “sorting for entry”, suggests that packaging of DCV cargoes takes place within the TGN (Fig. 2) (reviewed in Griffiths and Simons, 1986). In this model, the aggregation of cargo destined for the regulated secretory pathway is thought to occur at specialized locations within the TGN, which have higher Ca2+ concentrations and a pH above 6.5. These conditions are thought to facilitate the precipitation of cargoes destined for the regulated pathway, which are subsequently packaged into DCVs (reviewed in Borgonovo et al., 2006). The second model for the sorting of molecules into DCVs is called “sorting by retention”, and proposes that all  13     Figure 2  A           B    Figure 2. Schematic of two proposed models to explain sorting mechanisms for the formation of secretory granules in the TGN. A, The “sorting for entry” model suggests that the selection of specific cargo and the exclusion of non-secretory granule proteins occurs prior to the formation of secretory granules in the TGN. B, The “sorting by retention” model suggests that following the formation of an immature secretory granule, secretory granule specific proteins are retained while non-secretory granule proteins are removed from vesicles. This gives rise to a mature secretory granule. Reproduced with permission from (Tooze, 1998).        14     secretory proteins not aimed for the regulated secretory pathway are removed from immature DCVs via clathrin-coated vesicles and redirected into the constitutive secretory pathway (Fig. 2) (reviewed in Arvan and Castle, 1992). Likewise, there are also two models proposed for DCV budding from the TGN. The vesicular trafficking model of DCV formation suggests they are produced by active budding from the TGN, in a manner similar to constitutive vesicle formation (reviewed in Schekman and Orci, 1996). The active budding requires lipid and protein components for the initiation of membrane curvature at the TGN in order to achieve DCV budding (reviewed in Schekman and Orci, 1996). In addition, an alternative passive model has also been proposed, in which DCV formation does not require active vesicle budding from the TGN. In the passive model of DCV formation, polynodular tubular progranules form along the TGN, and subsequently result in the segregation of DCVs (Rambourg et al., 1992). Following the budding of the immature secretory granules from the TGN, they undergo several maturation steps including acidification and removal of constitutive secretory proteins, and are then transported to their sites of secretion. Interestingly, regulated vesicular exocytosis from neurons in response to extracellular stimulation is immediately followed by an increase in secretory granule biogenesis in order to replenish the number of vesicles available for exocytosis (reviewed in Kim et al., 2006). Signals inducing exocytosis of DCVs have been demonstrated to initiate transcriptional activations of the mRNAs encoding DCV proteins (Mahapatra et al., 2003). NEURONAL TRANSPORT Since neurons are highly polarized cells, secreted proteins need to be able to travel long distances from the site of their production, typically located in the cell body, to the site of their  15     secretion in the axon or dendrites (reviewed in Horton and Ehlers, 2003). DCVs are actively transported along the microtubules by molecular motors. In both axons and dendrites, microtubules are arranged in a longitudinal orientation and serve as a framework for the transport of vesicles and organelles (Fig. 3). Microtubules are assembled from α- and β-tubulin subunits asymmetrically, which results in a fast-growing “plus” end and a slow-growing “minus” end (reviewed in Hirokawa and Takemura, 2005). The polarity of microtubules allows for the directionality of axonal and dendritic transport (reviewed in Horton and Ehlers, 2003). The molecular motors of the kinesin and dynein superfamilies enable cargo movement along microtubules. Many of the kinesin superfamily proteins (KIFs) transport cargoes towards the plus end of microtubules, and are called termed “plus-end-directed motors”.  These proteins regulate anterograde transport of cargoes from the cell body to axons and dendrites (reviewed in Vallee et al., 2004). Conversely, cytoplasmic dyneins, also referred to as “minus-end-directed motors” mediate retrograde transport from the axons or dendrites back to the cell body (reviewed in Hirokawa, 1998). Dynein forms a large multisubuit complex and is associated with the protein complex dynactin, which mediates the interaction between cytoplamic dynein and its cargoes (reviewed in Vallee et al., 2004). In some cases, these motor proteins require an adaptor/scaffolding proteins associated with them in order to recognize, bind and transport the components of the cargo complex (reviewed in Hirokawa and Takemura, 2005). Due to the existing neuronal polarity, cargoes destined for either axons or dendrites must be targeted to their appropriate domain. It is thought that microtubules at the initial axonal segment function as the cue for the KIFs to be directed into the axon, as opposed to the dendrites (reviewed in Nakata and Hirokawa, 2003). The delivery of cargoes to axons and dendrites is aided by the presence of specialized membrane subdomains, enriched in exocyst and SNARE proteins, which coordinate  16     Figure 3               Figure 3. Axonal and dendritic transport of cargoes within a neuron. Cargoes are transported in axons and dendrites by molecular motors. In axons, microtubules are unipolar with the plus ends directed towards axonal terminals and the minus ends towards the cell body. The orientation of microtubules in dendrites is of mixed polarity. Reproduced with permission from (Cai & Sheng, 2009).       17     targeted vesicle fusion with the plasma membrane (reviewed in Horton and Ehlers, 2003). Axonal Transport Proteins transported from the cell body to the axon include components of synaptic vesicles and plasma membrane at synaptic terminals, as well as molecules destined for growth cones (reviewed in Hirokawa and Takemura, 2005). In axons, the organization of microtubules is such that the plus ends face the axonal terminus, and the minus end directed towards the cell body (Fig. 3) (reviewed in Guzik and Goldstein, 2004). Several KIFs have been demonstrated to be involved in the transport of axonal cargoes (reviewed in Hirokawa and Takemura, 2005). Axonal cargo can undergo either fast or slow axonal transport, with cytosolic proteins and cytoskeletal components undergoing slow axonal transport at a rate of about 0.1 µm/s, and membrane organelles, synaptic vesicle precursors and DCVs undergoing fast axonal transport at a rate of approximately 1-5 µm/s (reviewed in Brown, 2003). The same types of molecular motors regulate both slow and fast axonal transport; however, these two modes of axonal transport are regulated differently (Brown, 2003). Slow axonal transport is typically comprised of short-range anterograde and retrograde movements, which leads to a slower net anterograde distance covered (reviewed in Brown, 2003). In contrast, fast axonal transport is comprised of continuous unidirectional movement, resulting in a faster overall distance gain (reviewed in Brown, 2003). Dendritic Transport Most of the proteins that are needed in the dendrites are transported from the cell body. Molecules transported in dendrites include specific mRNAs to support local protein synthesis, proteins associated with postsynaptic densities, neurotransmitters and ion channels (reviewed in Hirokawa and Takemura, 2005). Similar to axons, most of the microtubules present in dendrites  18     are unipolar, with the plus end pointing away from the cell body (Burton and Paige, 1981). However, the microtubules in proximal dendrites are of mixed polarity (Fig. 3) (Baas et al., 1988). In addition, the microtubule organization also differs between axons and dendrites. Axons and dendrites express different microtubule-associated proteins (MAPs) that form crossbridges between microtubules, resulting in smaller spacing between microtubules in axons compared to dendrites (reviewed in Hirokawa and Takemura, 2005). In dendrites, the transport of neurotransmitter receptors, such as NMDA and AMPA (α-amino-3-hydroxy-5-methyl-4- isoxazole propionic acid) glutamate receptors is necessary for synaptic function. The KIF17 motors have been shown to transport NMDAR and KIF5s (KIF5A, KIF5B and KIF5C) mediate the transport AMPAR (Setou et al., 2000; Setou et al., 2002). It is currently thought that KIFs use an adaptor/protein scaffolding protein complex for cargo recognition and binding in order for the secretory vesicle to undergo membrane fusion with the plasma membrane and release their contents into the extracellular space. REGULATED EXOCYTOSIS Docking and Priming A vesicular fusion event involves many precisely coordinated steps. Vesicles in the constitutive pathway are secreted upon their arrival to the plasma membrane, whereas secretory vesicles in the regulated pathway typically wait at the plasma membrane until the cell receives a signal to secrete (reviewed in Alberts et al., 2002). In neurons, two types of vesicles undergo activity-mediated secretion: DCVs and synaptic vesicles (SVs) (reviewed in Martin, 2003). SVs are transported into the axon to be released at the presynaptic terminals, whereas DCVs can be transported into both axon and dendrites (reviewed in Ludwig and Leng, 2006). Prior to fusion, these two types of vesicles are transported to the membrane and become docked or tethered  19     (Pfeffer, 1999). Tethering is regulated by members of the Rab family of small GTPases, which act in concert with several Rab effector proteins (reviewed in Zerial and McBride, 2001). Typically, docked synaptic vesicles (SVs) are positioned in active zones, whereas most DCVs are located outside of active zones (Thureson-Klein, 1983). Subsequently, both SVs and DCVs must undergo several “priming” events, regulated by members of the Munc and Rab families of proteins and their effectors  in order to prepare for the release in response to extracellular stimulation, such as Ca2+ (reviewed in Gundelfinger et al., 2003; Heidelberger et al., 1994; Klenchin and Martin, 2000; Tsuboi, 2009). Rab proteins are key players in determining the specificity of vesicular transport. They are monomeric GTPases and are thought to facilitate and mediate the rate of vesicle docking and the union of the vesicular membrane and the plasma membrane necessary for exocytosis. Rab proteins are inactive in their GDP-bound state, and in their GTP-bound state they are active and associated with the membrane of the secretory vesicle. In its active state, the Rab protein is thought to bind to Rab effectors that facilitates the tethering and docking of SVs and DCVs at their target sites and initiate the formation of the soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) complex (Tsuboi and Fukuda, 2006; van Weering et al., 2007). Vesicular Fusion SNARE proteins are main components of the vesicle fusion apparatus and are crucial in regulating calcium-dependent fusion of synaptic vesicles, as well as DCVs (Augustine et al., 1999; Shin et al., 2002). The SNARE complex is composed of trimolecular helical bundles of syntaxin, vesicle-associated membrane protein (VAMP), which is also called synaptobrevin, and the membrane associated protein SNAP-25 (reviewed in Burgoyne and Morgan, 2003). The  20     interaction of these three proteins leads to the formation of a tight complex that brings the vesicle and plasma membrane in close proximity and is crucial in membrane fusion and vesicular exocytosis (Fig. 4). VAMP is anchored to the vesicle by a single transmembrane domain, and also has a cytoplasmic domain, which interacts with the core complex. Syntaxin is primarily located in the plasma membrane, with its extracellular domain interacting with the core complex. It is thought that syntaxin gets incorporated into the SNARE core complex through its interaction with another protein involved in vesicular secretion, n-Sec1 (also called Munc18) (reviewed in Burgoyne and Morgan, 2003). SNAP-25 is a plasma membrane protein lacking an intracellular domain; it is anchored to the plasma membrane by acetylations and contributes two strands to the SNARE coiled-coil. Together, the four strands of the SNARE complex on the opposing vesicular and plasma membranes form a tight bundle comprised of the four tightly intertwined α helices. The rapid intracellular rise in Ca2+ following neuronal activity triggers the full zipping of the coiled coiled- coil complex, which results in membrane fusion and secretion of the vesicle contents into extracellular space (reviewed in Chen and Scheller, 2001) (Fig. 4). Vesicle membrane SNAREs (v-SNAREs) and target membrane SNAREs (t-SNAREs) have characteristic helical domains that interact with each other. In order for a v-SNARE to interact with a t-SNARE, the helical domains of one of them must wrap around the helical domains of the other in order to form the stable trans-SNARE-complexes, which result in the locking of two juxtaposing membranes together. There are at least 20 different SNARE proteins in mammalian cells, and each is associated with a specific membrane-enclosed organelle involved in the secretory or endocytic pathway (reviewed in Chen and Scheller, 2001). Indeed, the specificity with which SNAREs interact with each other is thought to determine the  21     Figure 4         Figure 4. Molecular model of vesicle exocytosis. Prior to the formation of the core complex, syntaxin is bound to n-Sec1. Rab proteins facilitate the dissociation of n-Sec from syntaxin for vesicle priming and the nucleation between the three neuronal SNAREs: syntaxin, SNAP-25 and VAMP. Ca2+ initiates the complete zipping of the coiled-coil complex, which results in membrane fusion and release of the vesicle contents into the extracellular space. Reproduced with permission from (Chen and Scheller, 2001).         22     specificity of vesicle docking and fusion, thus specifying the compartment identity (Sollner et al., 1993). Kiss and Run Exocytosis In addition to “full-collapse” vesicular fusion, there is another mode of regulated exocytosis/endocytosis referred to as “kiss-and-run” (Ceccarelli et al., 1973; Fesce et al., 1994). The kiss-and-run model of vesicular fusion involves the incomplete fusion of the vesicle and its subsequent retrieval, as opposed to the complete flattening of the vesicle in a full-collapse exocytic event. Kiss and run events have been demonstrated in both synaptic vesicles and DCVs (reviewed in Burgoyne et al., 2001). The significance of kiss-and-run in neuropeptide and neurotransmitter release remains controversial. However, there is some evidence to suggest that kiss-and-run may be a regulated process that allows regulated exocytosis to switch from full vesicle fusion to partial fusion under certain conditions (reviewed in Burgoyne and Morgan, 2003). It is possible that the transient fusion pore formation, which takes place during a kiss-and- run exocytic event, results in a partial release of the vesicular contents and thereby allows regulation of the amount of the vesicular contents secreted per fusion event (Barg et al., 2002). Another potential physiological advantage to kiss-and-run fusion is that it seems to provide more efficient vesicle recycling (Sankaranarayanan and Ryan, 2000).  In the context of neurotransmission, rapid vesicle recycling would result in the modification of the size and kinetics of the synaptic current and might provide a mechanism to regulate synaptic strength and synaptic plasticity (Choi et al., 2000). Further studies are needed to determine what proportion of fusion events is comprised of kiss-and-run exocytosis, as well as the molecular machinery of kiss-and-run events.  23     OVERALL OBJECTIVE The overall objective of the study was to investigate the subcellular distribution and transport characteristics of PGRN, as well as to determine the mechanism by which PGRN is secreted from cultured hippocampal neurons. HYPOTHESIS We hypothesize that PGRN is transported to both axons and dendrites in DCVs and is secreted in an activity-dependent manner.     24     CHAPTER II: MATERIALS AND METHODS DNA Constructs: PGRN-eGFP, BDNF-RFP, PGRN-eGFP A9D,  PGRN- eGFP P248L and PGRN-eGFP R432C constructs were kind gifts from Dr. Michael Silverman SFU.  PSD-95-RFP and SynRFP were kind gifts from David Bredt (UCSF) and Louis Reichardt of (UCSF). PGRN-superecliptic pHluorin (PGRN-SEP): Superecliptic pHluorin (SEP) [kind gift from Michael Ehlers (Duke University, Durham, NC)] was PCR-amplified Forward: ACCGGTCATGAGTAAAGGAG and reverse: TCTAGAATTATTTGTATAGTTCA and subcloned into the  pJPA7 vector replacing eGFP to produce PGRN-SEP. Mutant PGRN constructs: PGRN-SEP P248L and PGRN-SEP R432C constructs were made by replacing eGFP from PGRN-eGFP P248L and PGRN-eGFP R432C mutants using the cut sites AgeI and SmaI. Hippocampal culture and transfection: Primary hippocampal cultures were prepared from embryonic day 18 (E18) Sprague Dawley rats and C57BL/6 mice as previously described (Xie et al, 2000) and plated at a density of 197 cells/mm2 and  46 cells/mm2, respectively. Neurons were transfected using Lipofectamine 2000 (Invitrogen) at 9-10 days in vitro (DIV) according to manufacturer's protocol and imaged at 13- 16 DIV. Immunohistochemistry: Neuron cultures were fixed in a solution of 4% paraformaldehyde/4% sucrose for 10 min, followed by permeabilization in 0.1% Triton-X for 10 min, and blocked in 10% goat serum for 1 h at room temperature. Primary antibodies were diluted in PBS with 1% goat serum and incubated overnight at 4°C, and secondary antibodies were diluted in PBS with 1% goat serum  25     for 1 h at room temperature. Primary antibodies: rabbit anti-PGRN (Invitrogen), rabbit anti- MAP2 (Abcam), guinea pig anti-VGlut-1 (Millipore), mouse anti-PSD-95 (Affinity BioReagents). Secondary antibodies: Alexa 488, Texas Red, Cy5-conjugated goat anti-rabbit, anti-mouse or anti-guinea pig (Molecular Probes). PGRN ELISA:  Primary hippocampal neuronal cultures were prepares as described above and plated at a density of 260 cells/mm2. At 13 DIV, neurons were treated with 1 µM tetrodotoxin (TTX) or 20 µM bicuculline overnight, and the experiment was performed at 14 DIV. For the control experiment, the conditioned media was aspirated off the cells, followed by three quick rinses, replaced with a 2.5 mM KCl solution and incubated for 10 min at 37°C. The solution was then collected, followed by three quick rinses, and replaced with 2.5 mM KCl solution for another 10 min incubation at 37°C. For the high KCl stimulation experiment, the conditioned media was aspirated off the cells, followed by three quick rinses, replaced with a 2.5 mM KCl solution and incubated for 10 min at 37°C. The solution was then collected, and following three quick rinses it was replaced with a 70 mM KCl solution for 10 min incubation at 37°C. All samples were concentrated using filtration tubes (Amicon), and the PGRN ELISA assay (Adipogen) was performed according to the manufacturer’s instructions. Image Acquisition: Neurons were imaged using an inverted confocal Olympus FV1000 microscope (60×/1.4 Oil Plan-Apochromat). All images in a given experiment were captured and analyzed using the same exposure time and conditions.  26     Image Analysis: PGRN-eGFP Colocalization to Synapses: Images of PGRN-eGFP , VGlut-1 and PSD-95 were thresholded using ImageJ. The puncta were thresholded subjectively, but once the appropriate thereshold was chosen, it was applied to all the images in the experiment.  Points of colocalization were determined using the ImageJ colocalization plugin downloaded from the program’s website (http://grove.ufl.edu/~ksamn2/plugins.html#COLOC). Points of colocalization were defined as regions >4 pixels in size where the intensity ratio of the three channels was >50. PGRN-eGFP Puncta Density, Puncta Area and Puncta Integrated Density: Neurons expressing PGRN-eGFP and SynRFP were treated with 0.5 mM 4-aminopyridine (4-AP) and 10 µM biccucculine and imaged 5 and 10 mins following treatment. Images were thresholded using ImageJ. The puncta were thresholded subjectively, but once the appropriate thereshold was chosen, it was applied to all the images in the experiment. Puncta density was determined by dividing the total number of PGRN-eGFP puncta by the total axon length. PGRN-eGFP puncta area and Integrated Density (IntDen; product of the area and the mean grey value) were then determined before and after treatment of cells using ImageJ. Synapse Density: Masks of GFP transfected neurons were made using Adobe Photoshop enabling the visualization of all synaptophysin and PSD-95 immunolabelling associated with the transfected cell.  Images of synaptophysin and PSD-95 immunolabelling were then thresholded by subtracting background immunofluorescence signal using ImageJ, and points of colocalization were analyzed using the ImageJ colocalization plugin. Live imaging of PGRN-SEP: Neurons transfected with PGRN-SEP and SynRFP or BDNF-RFP were imaged every 12 s at 37ºC.Neurons were initially imaged for 5 minutes in a control solution  27     (119 mM NaCl, 2.5 mM KCl, 0.5 mM CaCl2, 3.5 mM MgCl2, 25 mM HEPES and 30 mM glucose), pH adjusted to 7.4. After 5 minutes of imaging the baseline, cells were switched to the various treatments and imaged for an additional 10 min. High KCl (51.5 mM NaCl, 70 mM KCl, 2 mM CaCl2, 2 mM MgCl2, 25 mM HEPES and 30 mM glucose, pH 7.4);  4-aminopyridine (4- AP) (119 mM NaCl, 2.5 mM KCl, 0.5 mM CaCl2, 3.5 mM MgCl2, 25 mM HEPES and 30 mM glucose, 0.5 mM 4-AP and 10 µM bicuculline, pH 7.4);  CdCl2 treatment ( 119 mM NaCl, 2.5 mM KCl, 0.5 mM CaCl2, 3.5 mM MgCl2, 25 mM HEPES and 30 mM glucose, 100 µM CdCl2); calcium-free media (119 mM NaCl, 2.5 mM KCl, 7 mM MgCl2, 25 mM HEPES , 30 mM glucose and 100 µM EGTA pH 7.4). In order to validate the pH-dependent fluorescence changes of SEP, cells were treated with a solution containing NH4Cl solution (pH 7.4), and subsequently with one containing 2-(N- morpholino)ethanesulfonic acid (MES). 50 mM NaCl was substituted with NH4Cl, and all other components remained unchanged. For the treatment with acidic MES solution, HEPES was replaced with MES while all other components remained unchanged and the pH was adjusted to 5.2. The average PGRN-SEP fluorescent event density was calculated by dividing the total number of PGRN-SEP fluorescent events in each frame by the total neurite length, and averaging for all the frames in the 10 min time-lapse imaging series. The number of PGRN-SEP fluorescent events was manually counted for each of the time-lapse images. All visible puncta more than 2 pixels in size were counted.   Colocalization of PGRN-SEP fluorescent puncta and Syn-RFP or PSD-95-RFP puncta was determined by manually counting all overlapping puncta (>1 pixel overlap) in each frame.  28     Recombinant PGRN treatment:  Neurons were treated with recombinant PGRN protein (R&D Systems) at concentrations of 0ng, 100ng and 250ng on 0 DIV, 3 DIV, 7 DIV and 10 DIV.      29     CHAPTER III: RESULTS Expression of endogenous and fluorescently tagged PGRN Previous immunostaining of cultured hippocampal neurons done in the Silverman laboratory (Simon Fraser University, BC) had demonstrated that endogenous PGRN is distributed in a punctate pattern in both dendrites and axons (data not shown). Moreover, the Silverman demonstrated that16% ± 1.1% of endogenous PGRN puncta were localized at synapses (n = 35 neurons, 3 cultures), indicating that the majority of PGRN is localized at extrasynaptic sites. The goal of the current project was to examine PGRN transport and secretion. To do this we tagged PGRN with either eGFP or its pH sensitive variant SEP and expressed them in cultured neurons. To validate that these constructs faithfully reflected PGRN distribution, cells were transfected with PGRN-eGFP and its distribution and localization to synapses was examined. The distribution of PGRN-eGFP was similar to that of endogenous PGRN, with a punctate pattern of PGRN-eGFP in both dendrites and axons (Fig. 5A). The distribution of PGRN-eGFP at synapses was similar to that of endogenous with 11.2% ± 1.4% of PGRN-eGFP puncta localized to synapses (n = 35 neurons, 3 cultures) (Fig. 5B). Together, this demonstrates that fluorescently-tagged PGRN is a faithful marker for endogenous PGRN similar to that shown for many neuronal proteins. Activity-induced translocation of PGRN Previous work has demonstrated activity-dependent recruitment of BDNF to synapses (Dean et al., 2012). To determine whether PGRN is also recruited to synapses following enhanced neuronal activity, we co-transfected neurons with PGRN-eGFP and the pre-synaptic marker synaptophysin-RFP (syn-RFP) at 10 DIV and imaged at 13 DIV.  30     Figure 5                                  Figure 5. PGRN-eGFP is localized to both axons and dendrites and to a subset of synapses. A, Confocal image of a 14DIV rat hippocampal neuron expressing PGRN-eGFP and imunolabelled for MAP2. Insets b’ and b” represent higher magnifications of a dendrite and an axon, respectively. Scale bar on the low magnification image = 10 µm; scale bar on the high magnification images = 5 µm B, Dendrite transfected with PGRN-eGFP and  immunolabelled for PSD-95 and VGlut-1. Arrowheads, points of triple colocalization. Scale bar = 2 µm.  31     To enhance neuronal activity, cells were treated with 0.5 mM 4-aminopyridine (4-AP) plus 10 µm bicuculline and imaged 0, 5 min and 10 min after treatment. 4-AP is a K+ channel blocker, and induces neuronal activity by increasing the amplitude and duration of action potentials (Alkadhi and Hogan, 1989). Bicuculline acts as a GABAA receptor antagonist, thus blocking the inhibitory input to the target neuron (Curtis et al., 1970). 0.5 mM 5-AP has previously been used to enhance activity in hippocampal neurons (Kuriu et al., 2006).We observed a significant increase in the density of PGRN-eGFP puncta 5 and 10 min after 4-AP/Bic treatment, whereas the density of SynRFP was unchanged (Fig. 6A). There was a significant increase in the size and integrated density of PGRN-eGFP puncta that were colocalized with SynRFP, suggesting that activity enhances the recruitment of PGRN to synapses (Fig. 6 B-D). Activity enhances PGRN Secretion To directly visualize PGRN secretion from cultured hippocampal neurons, we used a construct expressing PGRN fused to SEP, a pH-sensitive marker for vesicular exocytosis (Miesenbock et al., 1998; Sankaranarayanan, 2000; Ghandi and Stevens, 2003). The fluorescence of SEP is quenched at pH<6 and therefore not visible while inside the acidic lumen of a secretory vesicle, which has the pH of about 5.5 (Mellman et al., 1986; Njus et al., 1986). When the acidified vesicle fuses with the plasma membrane, the vesicle lumen undergoes a rapid increase in pH to ~7.4 resulting in SEP fluorescence becoming unquenched and visible (Miesenbock et al., 1998). PGRN–SEP puncta were sparsely distributed in both dendrites (Fig 7A) and axons (Fig 7B).  To demonstrate that PGRN-SEP fluorescence was quenched in a majority of vesicles, cells were treated with a solution of 50 mM NH4Cl (pH 7.4), which has been demonstrated to rapidly diffuse across cell membranes and neutralize the acidic vesicular lumen (Miesenbock et   32     Figure 6    33     Figure 6. Activity enhances the density of PGRN-eGFP puncta at axons and enhances the recruitment of PGRN-eGFP to synapses. A, The density of PGRN-eGFP puncta in axons is increased following treatment with 0.5 mM 4- AP/10 µM Bic (normalized to controls). Conversely, the density of synRFP puncta is unchanged (n=8-14 neurons per condition, 3 cultures). *p<0.05, student’s t-test. B, The integrated density of PGRN-eGFP puncta co-localized with synRFP puncta is increased 5 min and 10 min following treatment with 0.5 mM 4-AP/10 µM Bic in 14 DIV rat hippocampal neurons (normalized to controls). (n=8-14 neurons per condition, 3 cultures). *p<0.05, **p<0.05; student’s t-test. C, Confocal images of axons of 14 DIV hippocampal neurons co-transfected with PGRN-eGFP and synRFP before activity induction and following a 10 min treatment with 0.5 mM 4-AP/10 µM Bic. White arrowheads denote existing PGRN-eGFP puncta colocalized with synRFP that increase in integrated density 10 min following activity induction; black arrowheads depict PGRN-eGFP puncta that are newly recruited to synRFP puncta 10 min following activity induction. Scale bar, 5 µm. D, Graph depicting mean grey value of PGRN-eGFP puncta  in relation to mean grey value of synRFP puncta along a length of axon (from inset in C).                34     Figure 7  Figure 7. Treatment with NH4Cl and MES of neurons expressing PGRN-SEP. Confocal images of (A ) dendrites co- transfected with PGRN-SEP and PSD-95-RFP, or (B) axons co-transfected with PGRN-SEP and SynRFP from 14 DIV rat hippocampal neurons. The treatment with NH4Cl (pH 7.4) unquenches the SEP fluorescence and reveals many PGRN-SEP puncta along the dendrite and the axon (middle panel). The treatment with MES (pH 5.2) quenches SEP fluorescence (right panel). Scale bar = 2 µm.   35     al., 1998). PGRN–SEP puncta were sparsely distributed in both dendrites (Fig 7A) and axons (Fig 7B).  To demonstrate that PGRN-SEP fluorescence was quenched in a majority of vesicles, cells were treated with a solution of 50 mM NH4Cl (pH 7.4), which has been demonstrated to rapidly diffuse across cell membranes and neutralize the acidic vesicular lumen (Miesenbock et al.,1998). Following a brief application of NH4Cl, we observed an increase in the number of fluorescent PGRN-SEP puncta in the axon and dendrites at both synapses and extrasynaptic sites, suggesting that the majority of PGRN is localized intracellularly (Fig. 7 A, B). To demonstrate that the few PGRN-SEP puncta represent unquenched PGRN-SEP at the surface, cells were treated with an acidic solution containing 2-(N-morpholino)ethanesulfonic acid (MES), pH 5.2. Following the treatment of PGRN-SEP transfected neurons with MES, we observed a rapid decrease in PGRN-SEP fluorescence in both axons and dendrites (Fig. 7 A, B). The exocytosis of BDNF–pHluorin-containing vesicles has been described in cultured hippocampal neurons (Cheng et al., 2011; Dean et al., 2009; Matsuda et al., 2009). To determine whether the secretion of PGRN is similarly regulated by neuronal activity, the change in SEP fluorescence following activity induction was monitored using confocal time-lapse imaging. Specifically, cells were transfected with PGRN-SEP to visualize exocytotic events and either SynRFP or PSD-95-RFP to visualize synapses in axons and dendrites, respectively. Cells were imaged for 5 min in a low KCl solution to obtain baseline levels of PGRN secretion (see Methods) and then switched to a solution containing 70 mM KCl, or 0.5 mM 4AP/ 10 µM Bic and imaged every 12 s for 10 mins. We observed a rapid increase in the average density of PGRN-SEP fluorescent puncta in both axons (Fig. 8 A-C) and dendrites (Fig. 8 E,F) following stimulation. The average density of PGRN-SEP fluorescent puncta was also dramatically   36     Figure 8                       37     Figure 8. Activity enhances the secretion of PGRN from axons and dendrites. A, Confocal images of axons in 14 DIV cultures expressing PGRN-SEP and SynRFP following stimulation with 0.5 mM 4-AP/10 µM Bic. Scale bar = 5 µm. B, There is an increase in the average density of PGRN-SEP fluorescent events in axons following stimulation with 0.5 mM 4-AP/10 µm Bic.  This is abolished in Ca2+-free media or in the presence of CdCl2 (n=10-23 neurons per condition, 3 cultures). ***p<0.001; two-way ANOVA with Bonferroni post-hoc. C, There is an increase in the average density of PGRN-SEP fluorescent events in axons following stimulation with 70 mM KCl. This is abolished in Ca2+-free media or in the presence of CdCl2 (n=9-28 neurons per condition, 3 cultures). ***p<0.001; two-way ANOVA with Bonferroni post-hoc. D, There is no significant difference in the proportion of PGRN-SEP fluorescent events that colocalize with synRFP puncta after stimulation with KCl or 4-AP/Bic (n = 10 neurons per condition, 3 cultures). p>0.05, student’s t-test. E, Confocal images of dendrites in 14 DIV cultures expressing PGRN-SEP and PSD-95-RFP following stimulation with 0.5 mM 4-AP/10 µM Bic. Scale bar = 5 µm. F, There is an increase in the average density of PGRN-SEP fluorescent events in dendrites following stimulation with 0.5 mM 4-AP/10 µm Bic. This is abolished in Ca2+-free media or in the presence of CdCl2 (n=9-28 neurons per condition, 3 cultures). ***p<0.001; two-way ANOVA with Bonferroni post-hoc. G, There is no significant difference in the proportion of PGRN-SEP fluorescent events in the dendrites that colocalize with PSD-95-RFP puncta following stimulation with 4-AP/Bic (n = 10 neurons per condition, 3 cultures). p>0.05; student’s t-test.             38     increased in axons following treatment with 0.5 mM 4-AP/10 µM Bic, reaching a steady level following the initial peak (Fig 8B).  There was also a dramatic increase in the average density of PGRN-SEP fluorescent puncta in axons following stimulation with 70 mM KCl (Fig. 8C), which was slightly larger in magnitude than that induced by stimulation with 0.5 mM 4-AP/10 µM Bic. The difference in the average PGRN-SEP event density observed in the two modes of stimulation in the axon may be due to their different mechanisms of inducing depolarization (Moretto et al., 2003), as well as the differences in the concentration used. Similarly, stimulation triggered a rapid increase in the density of PGRN-SEP fluorescent events in the dendrite (Fig. 8F); however, the increase in the average density of PGRN-SEP events was closely followed by decay and nearly reaching original levels. The differences in the temporal profiles of the average density of PGRN-SEP fluorescent events in the axon and dendrites may be due to different modes of secretion. A previous study examining the activity-induced release of BDNF indicates incomplete fusion of BDNF vesicles in the axon, in contrast to the full collapse observed in the dendrites (Matsuda et al., 2009). Indeed, the recycling of vesicles following multiple kiss-and-run events at the axon may explain the sustained levels of PGRN-SEP fluorescent events in the axon following stimulation. Conversely, complete fusion of PGRN-SEP containing vesicles in the dendrites may account for the decay in the average density of PGRN-SEP fluorescent events after the initial activity- induced increase. To examine the role of Ca2+ in activity-mediated exocytosis of PGRN-containing vesicles, we stimulated the cells with high K+ in Ca2+-free media and examined the average density of PGRN-SEP fluorescent puncta. We found that stimulating the cells with 70 mM KCl in Ca2+-free media results in a significant decrease of PGRN-SEP fluorescent events (Fig. 8B). In  39     addition, blocking voltage-gated calcium channels (VGCCs) with CdCl2 similarly resulted in a significant decrease in PGRN-SEP fluorescent event density (Fig. 8B). These data suggest that Ca2+ influx through the VGCC is necessary to produce the fusion of PGRN-SEP containing vesicles in axons and dendrites. To determine whether activity-mediated secretion of PGRN is enriched at synapses, we analyzed the number of PGRN-SEP events that colocalized with either SynRFP or PSD-95. We found no significant difference in the percentage of PGRN-SEP fluorescent events at SynRFP puncta following stimulation with 70 mM KCl or 0.5 mM 4-AP/10 µM Bic in axons indicating that PGRN is not preferentially secreted from synapses following activity (Fig. 8 D,G). Examining PGRN secretion using ELISA To examine the concentration of endogenous PGRN in cell culture media after stimulation, we treated primary hippocampal neurons with a solution containing high K+ and measured endogenous PGRN levels using sandwich ELISA. The use of ELISA in measuring BDNF levels following neuronal stimulation has been well characterized (Balkowiec and Katz, 2002; Griesbeck et al., 1999; Hartmann et al., 2012). The treatment of neurons with high K+ has been shown to increase BDNF secretion as detected by the ELISA assay (Griesbeck et al., 1999). As expected, we observed no significant difference in PGRN levels in the concentrated cell culture media following the treatment of neurons with 2.5 mM KCl control solution for 30 min across all the treatment groups (Fig. 9A). Surprisingly, we also observed no significant difference in PGRN levels in the concentrated cell culture media following a 30 min treatment with 70 mM KCl across all the treatment groups (Fig. 9B). It is possible that the binding of PGRN to sortilin and its rapid endocytosis following secretion into the extracellular space (Hu et al., 2010) prevented its detection in the cell culture media. It is also possible that the increase in  40     Figure 9 Figure 9. Measuring PGRN concentration following high KCl stimulation using ELISA. A, Endogenous PGRN levels measured by ELISA in cell culture media are unchanged following O/N pre-incubation with 1 µM TTX or 20 µM Bic and treatment with 2.5 mM KCl for 30 min. p>0.05; student’s t-test. B, Endogenous PGRN levels measured by ELISA in cell culture media are unchanged following O/N pre-incubation with 1 µM TTX or 20 µM Bic and treatment with 70 mM KCl for 30 min (n=3 experiments from 3 separate cultures). p>0.05; student’s t-test.         41     PGRN secretion following stimulation with high K+ was not detected due to the sensitivity limits of the ELISA assay. Recombinant PGRN treatment increases synapse density but decreases Integrated Density of VGlut-1 puncta  To examine the effects of secreted PGRN on synapse density and morphology, we treated hippocampal neurons with different concentrations of recombinant PGRN protein (R&D Systems). The cells were transfected with GFP at 10 DIV to determine neuronal morphology, and coimmunolabeled for PSD-95 and VGlut-1 at 14DIV (Fig. 10 A-C). The density of synapses (defined as the density of colocalized PSD-95/VGlut-1 puncta along the GFP mask) was analyzed. There was a trend toward increase in synapse density following treatment with 100 ng PGRN, and a small but significant increase in synapse density following treatment with 250 ng PGRN (Fig. 10A). These results are consistent with a previously described decrease in synapse density following PGRN knockdown in primary hippocampal neurons (Tapia et al., 2011). Knockdown of PGRN results in an increase in the size and efficacy of synapses (Tapia et al., 2011). To determine whether treatment with PGRN affects synapse size, we examined the Integrated Density (product of puncta size and mean grey value) of PGRN puncta. Although PGRN treatment did not affect on the Integrated Density of PSD-95 puncta (Fig. 10B), treatment with 250ng PGRN resulted in a significant decrease in the Integrated Density of VGlut-1 puncta (Fig. 10C). These findings suggest that PGRN may regulate synapse formation. Activity-mediated PGRN exocytosis of PGRN mutants Several PGRN point mutations, including A9D, P248L and R432C have been identified in patients with FTD and were shown to affect PGRN secretion without affecting PGRN mRNA levels (Mukherjee et al., 2008; Shankaran et al., 2008). Specifically, the mutation A9D has been  42     Figure 10  Figure 10. Synapse density is increased, but integrated density of VGlut-1 puncta is decreased following treatment with recombinant PGRN protein. A, Synapse density at 14 DIV, determined by the colocalization of presynaptic and postsynaptic markers, is significantly increased following treatment with 250 ng of recombinant PGRN protein. **p<0.01; student’s t-test. B, Integrated density of PSD-95 puncta at 14 DIV is unchanged following treatment with recombinant PGRN protein. p>0.05; student’s t-test. C, Integrated density of VGlut-1 puncta is significantly decreased following treatment with 250 ng of recombinant PGRN protein (n=24 cells per condition, 3 cultures). *p<0.05; student’s t- test.             43     demonstrated to result in the cytoplasmic missorting and low expression of PGRN, whereas the mutations P248L and R432C have been demonstrated to be partially degraded within the secretory pathway and to have reduced secretion in HEK cells (Shankaran et al., 2008).  We set out to examine the secretion of PGRN mutants P248L and R432C in hippocampal neurons under basal conditions and following neuronal activity. In order to do this, we transfected the constructs expressing PGRN-SEP P248L and R432C mutations in neurons and using live imaging, examined the density of PGRN-SEP fluorescent events before and after stimulating the cells with high K+ (Fig. 11 A,B). Under basal conditions, we observed a slight but not significant decrease in the average density of PGRN-SEP fluorescent events for PGRN mutants P248L and R432C (Fig. 11A). Surprisingly, we also did not find any significant difference in PGRN-SEP event density under following stimulation with 70 mM KCl for both of the point mutants compared to WT PGRN-SEP (Fig. 11B). It is possible that since we had not performed these experiments in a PGRN knockdown background, the mutant forms of PGRN were transported, packaged and secreted with the native protein, thereby masking any aberrations in their secretion. Further, in order to examine the expression levels of the three PGRN point mutants in neurons, we transfected the constructs expressing PGRN-eGFP A9D, P248L and R432C mutations and examined puncta density, integrated density, as well as co-localization with synapses (Fig. 12 A-C ). We observed a significantly lower density of PGRN-eGFP A9D puncta, indicating that there was a decrease in PGRN expression (Fig. 12A). This is in accord with a previous study carried out in HEK cells that demonstrated the failure of PGRN A9D to undergo maturation, as well as decreased expression (Shankaran et al., 2008). The other two point mutants examined, PGRN-eGFP P248L and R432C had exhibited puncta densities similar to that of control (Fig. 12A).  44     Figure 11            Figure 11. There is no significant difference in secretion of PGRN mutants from axons at basal conditions or following activity. A, There is no significant difference in the average density of PGRN-SEP fluorescent events in the axon of PGRN-SEP mutants P248L and R432C under basal conditions at 14DIV. p>0.05; student’s t-test. B, There is no significant difference in the average density of PGRN-SEP fluorescent events in the axon of PGRN-SEP mutants P248L and R432C following treatment with 70 mM KCl at 14DIV (n=12-32 neurons per condition, 3 experiments). p>0.05; student’s t-test.   45     Figure 12   Figure 12. Puncta density, integrated density and percent colocalization with synapses of PGRN mutants A9D, P248L and R432C. A, There is a significant decrease in the puncta density of PGRN-eGFP A9D compared to WT PGRN-eGFP. ***p<0.001; student’s t-test. B, There is a significant decrease in the integrated density of PGRN-eGFP A9D puncta compared to WT PGRN-eGFP. ***p<0.001; student’s t-test. C, There is a significant increase in the percentage of PGRN-eGFP R432C puncta colocalized with synapses (n=25-36 cells, 3 experiments). *p<0.05; student’s t-test.            46     In order to further examine the levels of expression of these three PGRN point mutants, we examined the integrated density of their puncta. The integrated density of PGRN-eGFP A9D puncta was significantly lower compared to control, consistent with reports of its low expression in HEK cells (Fig. 12B) (Shankaran et al., 2008). In contrast, PGRN-eGFP P248L and PGRN- eGFP R432C exhibited integrated densities comparable to control and consistent with previously reported normal levels of expression (Fig. 12B) (Shankaran et al., 2008). In order to examine the colocalization of the PGRN mutants with synapses, we examined their colocalization with VGlut-1 and PSD-95. We observed no significant difference in percentage of PGRN-eGFP mutants A9D and P248L puncta colocalization to synapses (VGlut-1 and PSD-95) compared to WT (Fig. 12C). However, there was a significant increase in the percentage of PGRN-eGFP R432C puncta colocalized with synapses, which may be due to aberrant transport and mislocalization of PGRN R432C as a result (Fig. 12C) (Shankaran et al., 2008).   47     CHAPTER IV: DISCUSSION The present study demonstrates for the first time the properties of PGRN transport and secretion in cultured hippocampal neurons. Specifically, we demonstrate that PGRN is transported bidirectionally in the axons and dendrites, and is co-transported with BDNF. In addition, we have shown that PGRN undergoes activity-dependent secretion from axons and dendrites, and this release requires an increase in intracellular Ca2+ and VGCC activation. Our data indicates that PGRN is expressed in a punctate pattern in both axons and dendrites. We have found that about 16% of endogenous PGRN is colocalized with synapses, with the majority of PGRN puncta residing at extrasynaptic sites. These results are similar to what has been previously demonstrated regarding the synaptic localization of BDNF (Dean et al., 2012). Following the induction of neuronal activity, we have observed an increase in the localization of PGRN-containing vesicles to synapses, consistent with the recent finding that BDNF also increasingly targeted to synapses following neuronal activity (Dean et al., 2012). It is possible that the recruitment of PGRN to synapses may result in local modulation of synaptic strength. Our results indicate that PGRN is secreted pre- and postsynaptically, both constitutively and in response to neuronal depolarization since we have observed the appearance of PGRN-SEP fluorescent events at SynRFP and PSD-95-RFP puncta, as well as extrasynaptically, at basal levels and following stimulation with high K+ and 4-AP. Considering the co-transport and high degree of colocalization between PGRN and BDNF suggests their being transported in the same vesicle, and therefore it is not surprising that PGRN would also be secreted in an activity-dependent manner. The activity-mediated secretion of BDNF has been well characterized and shown to be crucial to neuronal function, since a single amino acid substitution (val66met) in the pro-region of BDNF that inhibits its trafficking  48     and regulated secretion results in impaired hippocampal function (Balkowiec and Katz, 2000; Egan et al., 2003; Hartmann et al., 2001; Kuczewski et al., 2008; Matsuda et al., 2009).  In both axons and dendrites, we observed a rapid increase in the average density of PGRN-SEP fluorescent events following neuronal depolarization. However, in axons the number of PGRN-SEP events reached a plateau for the duration of the stimulation, whereas in dendrites we observed a decay in the number of PGRN-SEP fluorescent events. Previous work by Matsuda et al., 2009 has demonstrated partial fusion of BDNF-pHluorin containing vesicles at the axon and full fusion at the dendrite following activity. Axonal and dendritic PGRN vesicles may in fact belong to two distinct populations, containing different sets of associated proteins. Indeed, it has been previously shown that distinct subsets of syt-IV and BDNF-containing vesicles are differentially sorted to axons and dendrites (Dean et al., 2012). Our findings indicate that the activity-mediated secretion of PGRN in both axons and dendrites requires an increase in intracellular Ca2+ concentration through VGCC, an observation, which is consistent with what has been reported in terms of the mechanism for regulated BDNF secretion (Balkowiec and Katz, 2002; Goodman et al., 1996; Hartmann et al., 2001; Santi et al., 2006). We have found no significant differences in secretion of PGRN mutants P248L and R432C, previously linked to FTD (Mukherjee et al., 2008; van der Zee et al., 2007). These two particular point mutations have been predicted to have folding and processing defects, and were shown to be secretion-deficient when expressed in HEK cells (van der Zee et al., 2007; Shankaran et al., 2008). One possibility is that since our studies were not done in a knockdown/knockout background, wild-type PGRN masked any secretion defects of the two mutants studied. Future work is needed in order to further investigate P248L and R432C PGRN secretion from neurons following a shRNA-mediated PGRN knock-down.  49     Previous studies have demonstrated that PGRN plays an important role in neuronal survival and treatment of cultured neurons with exogenous PGRN has been shown to increase neurite outgrowth (Van Damme et al., 2008; Ryan et al., 2009). We demonstrate that treatment of neurons with recombinant PGRN significantly increases synapse density. In addition, we demonstrate that exogenous PGRN treatment has no effect on the integrated density of the post- synaptic marker PSD-95, while significantly decreasing the integrated density of the pre-synaptic marker VGlut-1. Indeed, these findings are consistent with our previous work, which demonstrates a significant decrease in synapse density and a significant increase in the size of synaptophysin puncta following PGRN knock-down in cultured hippocampal neurons (Tapia et al., 2011).  In addition to its function in neuronal survival, there is increasing evidence that PGRN plays an important role in neuronal connectivity and synaptic plasticity (Petkau et al., 2011; Tapia et al., 2011). Previous work from our lab has demonstrated decreased neuronal arborization and synapse density, as well as increased synaptic vesicle recycling and frequency of miniature excitatory post-synaptic currents (mEPSC) following PGRN knock-down in hippocampal neurons (Tapia et al., 2011). In accordance with this, progranulin knockout mice show decreased dendritic length and reduced spine number in the apical dendritic arbor, as well as behavioural abnormalities (Petkau et al., 2011). In addition, PGRN knockout mice display altered synaptic connectivity and impaired synaptic plasticity (Petkau et al., 2011). The activity-dependent regulation of synaptic efficacy enables neuronal networks to develop the appropriate connections (reviewed in Lu, 2003). One of the mechanisms employed by neurons to regulate synapse formation and function is to release target-derived neurotrophins, such as BDNF, from their cell bodies, axons and dendrites in response to neuronal activity in  50     order to deliver sufficient quantities of the neurotrophin depending on the level and/or pattern of neuronal activity to control the strength of synaptic connections (reviewed in Kuczewski et al., 2010; Lu, 2003). Indeed, a recent study has demonstrated that acute and gradual increases in BDNF concentration activate different intracellular cascades, leading to differences in spine morphology (Ji et al., 2010). These results suggest that it is not only the concentration of secreted BDNF that is important in the regulation of neuronal function and morphology, but also the manner in which it is secreted: constitutively or in response to neuronal activity. It is possible that activity-mediated PGRN secretion plays an important role in the modulation of synapse morphology and neuronal architecture. For instance, PGRN secreted in response to synaptic activity may be able to exert morphological changes at the level of synapse, resulting in new synapse formation. Indeed, we have shown that long-term treatment of hippocampal neurons with PGRN results in increased synapse density. However, many questions regarding the action of secreted PGRN remain to be addressed. It is not yet clear whether PGRN acts locally or globally once secreted in response to neuronal activity. In addition, it is not known whether secreted PGRN exerts its neurotrophic actions in a paracrine or in an autocrine manner. PGRN seems to play an important role in regulating neurite outgrowth (Gao et al., 2010; Laird et al., 2010; Ryan et al., 2009; Van Damme et al., 2008), and neuronal activity may be a key factor in modulating the manner in which PGRN exerts its effects on neuronal arborization. For instance, acute increases in BDNF concentration and resulting transient activation of TrkB enhances neurite elongation and spine head enlargement (Ji et al., 2010). Conversely, gradual increases in BDNF concentration and sustained TrkB activation promote neurite branching and spine neck elongation (Ji et al., 2010). In addition, local acute applications of BDNF to the  51     neurites of cultured hippocampal neurons have been demonstrated to induce axon differentiation (Shelly et al., 2007). Despite the evidence of PGRN’s function as a neuronal growth factor, the mechanism behind its neurotrophic action and its relationship to neurodegeneration is currently not known. Activity-mediated secretion of PGRN may be an important factor in how PGRN contributes to the regulation of synapse morphology and neuronal connectivity by controlling the kinetics of PGRN-induced signal transduction. Gaining further insight of the basic biology of PGRN in the brain may help to provide the necessary foundation for understanding the pathophysiology of FTD.    52     BIBLIOGRAPHY:  Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. (2002). Molecular biology of the cell, fourth edition.  New York: Garland Science.  Adachi, N., Kohara, K., and Tsumoto, T. (2005). Difference in trafficking of brain-derived neurotrophic factor between axons and dendrites of cortical neurons, revealed by live-cell imaging. BMC Neurosci 6, 42.  Alkadhi, K.A., and Hogan, Y.H. (1989). Effect of calcium on synaptic facilitation by potassium channel blockers in superior cervical ganglion of rat. Neuropharmacology 28, 75-81.  Altar, C.A., Cai, N., Bliven, T., Juhasz, M., Conner, J.M., Acheson, A.L., Lindsay, R.M., and            Wiegand, S.J. (1997). Anterograde transport of brain-derived neurotrophic factor and its             role inthe brain. Nature 389, 856-860.  Arvan, P., and Castle, D. (1992). Protein sorting and secretion granule formation in regulated secretory cells. Trends Cell Biol 2, 327-331.  Augustine, G.J., Burns, M.E., DeBello, W.M., Hilfiker, S., Morgan, J.R., Schweizer, F.E., Tokumaru, H., and Umayahara, K. (1999). Proteins involved in synaptic vesicle             trafficking. J Physiol 520 Pt 1, 33-41.  Baas, P.W., Deitch, J.S., Black, M.M., and Banker, G.A. (1988). Polarity orientation of microtubules in hippocampal neurons: uniformity in the axon and nonuniformity in the dendrite. Proc Natl Acad Sci U S A 85, 8335-8339.  Baker, C.A., and Manuelidis, L. (2003). Unique inflammatory RNA profiles of microglia in Creutzfeldt-Jakob disease. Proc Natl Acad Sci U S A 100, 675-679.  Baker, M., Mackenzie, I.R., Pickering-Brown, S.M., Gass, J., Rademakers, R., Lindholm, C., Snowden, J., Adamson, J., Sadovnick, A.D., Rollinson, S., et al. (2006). Mutations in progranulin cause tau-negative frontotemporal dementia linked to chromosome 17. Nature 442, 916-919.  Balkowiec, A., and Katz, D.M. (2000). Activity-dependent release of endogenous brain-derived neurotrophic factor from primary sensory neurons detected by ELISA in situ. J Neurosci 20, 7417-7423.  Balkowiec, A., and Katz, D.M. (2002). Cellular mechanisms regulating activity-dependent release of native brain-derived neurotrophic factor from hippocampal neurons. J Neurosci 22, 10399-10407.     53     Barg, S., Olofsson, C.S., Schriever-Abeln, J., Wendt, A., Gebre-Medhin, S., Renstrom, E., and Rorsman, P. (2002). Delay between fusion pore opening and peptide release from large dense-core vesicles in neuroendocrine cells. Neuron 33, 287-299.  Bateman, A., Belcourt, D., Bennett, H., Lazure, C., and Solomon, S. (1990). Granulins, a novel class of peptide from leukocytes. Biochem Biophys Res Commun 173, 1161-1168.  Bateman, A., and Bennett, H.P. (1998). Granulins: the structure and function of an emerging family of growth factors. J Endocrinol 158, 145-151.  Bateman, A., and Bennett, H.P. (2009). The granulin gene family: from cancer to dementia. Bioessays 31, 1245-1254.  Bhandari, V., Palfree, R.G., and Bateman, A. (1992). Isolation and sequence of the granulin precursor cDNA from human bone marrow reveals tandem cysteine-rich granulin domains. Proc Natl Acad Sci U S A 89, 1715-1719.  Blum, R., and Konnerth, A. (2005). Neurotrophin-mediated rapid signaling in the central nervous system: mechanisms and functions. Physiology (Bethesda) 20, 70-78.  Borgonovo, B., Ouwendijk, J., and Solimena, M. (2006). Biogenesis of secretory granules. Curr Opin Cell Biol 18, 365-370.  Bramham, C.R., and Messaoudi, E. (2005). BDNF function in adult synaptic plasticity: the synaptic consolidation hypothesis. Prog Neurobiol 76, 99-125.  Brown, A. (2003). Axonal transport of membranous and nonmembranous cargoes: a unified perspective. J Cell Biol 160, 817-821.  Brunet, A., Datta, S.R., and Greenberg, M.E. (2001). Transcription-dependent and -independent control of neuronal survival by the PI3K-Akt signaling pathway. Curr Opin Neurobiol 11, 297-305.  Burgoyne, R.D., Fisher, R.J., and Graham, M.E. (2001). Regulation of kiss-and-run exocytosis. Trends Cell Biol 11, 404-405.  Burgoyne, R.D., and Morgan, A. (2003). Secretory granule exocytosis. Physiol Rev 83, 581-632. Burton, P.R., and Paige, J.L. (1981). Polarity of axoplasmic microtubules in the olfactory nerve of the frog. Proc Natl Acad Sci U S A 78, 3269-3273.  Canossa, M., Gartner, A., Campana, G., Inagaki, N., and Thoenen, H. (2001). Regulated secretion of neurotrophins by metabotropic glutamate group I (mGluRI) and Trk receptor activation is mediated via phospholipase C signalling pathways. EMBO J 20, 1640-1650.    54     Ceccarelli, B., Hurlbut, W.P., and Mauro, A. (1973). Turnover of transmitter and synaptic vesicles at the frog neuromuscular junction. J Cell Biol 57, 499-524.  Chao, M.V. (2003). Neurotrophins and their receptors: a convergence point for many signalling pathways. Nat Rev Neurosci 4, 299-309.  Chao, M.V., and Bothwell, M. (2002). Neurotrophins: to cleave or not to cleave. Neuron 33, 9- 12.  Chen, Y.A., and Scheller, R.H. (2001). SNARE-mediated membrane fusion. Nat Rev Mol Cell Biol 2, 98-106.  Cheng, P.L., Song, A.H., Wong, Y.H., Wang, S., Zhang, X., and Poo, M.M. (2011). Self- amplifying autocrine actions of BDNF in axon development. Proc Natl Acad Sci U S A 108, 18430-18435.  Choi, S., Klingauf, J., and Tsien, R.W. (2000). Postfusional regulation of cleft glutamate concentration during LTP at 'silent synapses'. Nat Neurosci 3, 330-336.  Cruts, M., Gijselinck, I., van der Zee, J., Engelborghs, S., Wils, H., Pirici, D., Rademakers, R., Vandenberghe, R., Dermaut, B., Martin, J.J., et al. (2006). Null mutations in progranulin cause ubiquitin-positive frontotemporal dementia linked to chromosome 17q21. Nature 442, 920-924.  Curtis, D.R., Duggan, A.W., Felix, D., and Johnston, G.A. (1970). GABA, bicuculline and central inhibition. Nature 226, 1222-1224.  Daniel, R., Daniels, E., He, Z., and Bateman, A. (2003). Progranulin (acrogranin/PC cell-derived growth factor/granulin-epithelin precursor) is expressed in the placenta, epidermis, microvasculature, and brain during murine development. Dev Dyn 227, 593-599.  Daniel, R., He, Z., Carmichael, K.P., Halper, J., and Bateman, A. (2000). Cellular localization of gene expression for progranulin. J Histochem Cytochem 48, 999-1009. de Jong, E.K., Vinet, J., Stanulovic, V.S., Meijer, M., Wesseling, E., Sjollema, K., Boddeke, H.W., and Biber, K. (2008). Expression, transport, and axonal sorting of neuronal CCL21 in large dense-core vesicles. FASEB J 22, 4136-4145.  Dean, C., Liu, H., Dunning, F.M., Chang, P.Y., Jackson, M.B., and Chapman, E.R. (2009). Synaptotagmin-IV modulates synaptic function and long-term potentiation by regulating BDNF release. Nat Neurosci 12, 767-776.  Dean, C., Liu, H., Staudt, T., Stahlberg, M.A., Vingill, S., Buckers, J., Kamin, D., Engelhardt, J., Jackson, M.B., Hell, S.W., and Chapman, E.R. (2012). Distinct Subsets of Syt-IV/BDNF Vesicles Are Sorted to Axons versus Dendrites and Recruited to Synapses by Activity. J Neurosci 32, 5398-5413.  55     Desmarais, J.A., Cao, M., Bateman, A., and Murphy, B.D. (2008). Spatiotemporal expression pattern of progranulin in embryo implantation and placenta formation suggests a role in cell proliferation, remodeling, and angiogenesis. Reproduction 136, 247-257.  Diaz-Cueto, L., Stein, P., Jacobs, A., Schultz, R.M., and Gerton, G.L. (2000). Modulation of mouse preimplantation embryo development by acrogranin (epithelin/granulin precursor). Dev Biol 217, 406-418.  DiStefano, P.S., Friedman, B., Radziejewski, C., Alexander, C., Boland, P., Schick, C.M., Lindsay, R.M., and Wiegand, S.J. (1992). The neurotrophins BDNF, NT-3, and NGF display distinct patterns of retrograde axonal transport in peripheral and central neurons. Neuron 8, 983-993.  Egan, M.F., Kojima, M., Callicott, J.H., Goldberg, T.E., Kolachana, B.S., Bertolino, A., Zaitsev, E., Gold, B., Goldman, D., Dean, M., et al. (2003). The BDNF val66met polymorphism affects activity-dependent secretion of BDNF and human memory and hippocampal function. Cell 112, 257-269.  Farhadi, H.F., Mowla, S.J., Petrecca, K., Morris, S.J., Seidah, N.G., and Murphy, R.A. (2000). Neurotrophin-3 sorts to the constitutive secretory pathway of hippocampal neurons and is diverted to the regulated secretory pathway by coexpression with brain-derived neurotrophic factor. J Neurosci 20, 4059-4068.  Fesce, R., Grohovaz, F., Valtorta, F., and Meldolesi, J. (1994). Neurotransmitter release: fusion or 'kiss-and-run'? Trends Cell Biol 4, 1-4.  Finch, N., Baker, M., Crook, R., Swanson, K., Kuntz, K., Surtees, R., Bisceglio, G., Rovelet- Lecrux, A., Boeve, B., Petersen, R.C., et al. (2009). Plasma progranulin levels predict progranulin mutation status in frontotemporal dementia patients and asymptomatic family members. Brain 132, 583-591.  Gall, C.M., and Isackson, P.J. (1989). Limbic seizures increase neuronal production of messenger RNA for nerve growth factor. Science 245, 758-761. Gao, X., Joselin, A.P., Wang, L., Kar, A., Ray, P., Bateman, A., Goate, A.M., and Wu, J.Y. (2010). Progranulin promotes neurite outgrowth and neuronal differentiation by regulating GSK-3beta. Protein Cell 1, 552-562.  Gass, J., Cannon, A., Mackenzie, I.R., Boeve, B., Baker, M., Adamson, J., Crook, R., Melquist, S., Kuntz, K., Petersen, R., et al. (2006). Mutations in progranulin are a major cause of ubiquitin-positive frontotemporal lobar degeneration. Hum Mol Genet 15, 2988-3001.  Gass, J., Prudencio, M., Stetler, C., and Petrucelli, L. (2012). Progranulin: An emerging target for FTLD therapies. Brain Res 1462, 118-128.    56     Goodman, L.J., Valverde, J., Lim, F., Geschwind, M.D., Federoff, H.J., Geller, A.I., and Hefti, F. (1996). Regulated release and polarized localization of brain-derived neurotrophic factor in hippocampal neurons. Mol Cell Neurosci 7, 222-238.  Gottmann, K., Mittmann, T., and Lessmann, V. (2009). BDNF signaling in the formation, maturation and plasticity of glutamatergic and GABAergic synapses. Exp Brain Res 199, 203-234.  Griesbeck, O., Canossa, M., Campana, G., Gartner, A., Hoener, M.C., Nawa, H., Kolbeck, R., and Thoenen, H. (1999). Are there differences between the secretion characteristics of NGF and BDNF? Implications for the modulatory role of neurotrophins in activity- dependent neuronal plasticity. Microsc Res Tech 45, 262-275.  Griffiths, G., and Simons, K. (1986). The trans Golgi network: sorting at the exit site of the Golgi complex. Science 234, 438-443.  Gundelfinger, E.D., Kessels, M.M., and Qualmann, B. (2003). Temporal and spatial coordination of exocytosis and endocytosis. Nat Rev Mol Cell Biol 4, 127-139.  Guo, A., Tapia, L., Bamji, S.X., Cynader, M.S., and Jia, W. (2010). Progranulin deficiency leads to enhanced cell vulnerability and TDP-43 translocation in primary neuronal cultures. Brain Res 1366, 1-8.  Guzik, B.W., and Goldstein, L.S. (2004). Microtubule-dependent transport in neurons: steps towards an understanding of regulation, function and dysfunction. Curr Opin Cell Biol 16, 443-450.  Hartmann, D., Drummond, J., Handberg, E., Ewell, S., and Pozzo-Miller, L. (2012). Multiple approaches to investigate the transport and activity-dependent release of BDNF and their application in neurogenetic disorders. Neural Plast 2012, 203734.  Hartmann, M., Heumann, R., and Lessmann, V. (2001). Synaptic secretion of BDNF after high- frequency stimulation of glutamatergic synapses. EMBO J 20, 5887-5897.  He, Z., Ong, C.H., Halper, J., and Bateman, A. (2003). Progranulin is a mediator of the wound response. Nat Med 9, 225-229.  Heidelberger, R., Heinemann, C., Neher, E., and Matthews, G. (1994). Calcium dependence of the rate of exocytosis in a synaptic terminal. Nature 371, 513-515.  Hempstead, B.L. (2002). The many faces of p75NTR. Curr Opin Neurobiol 12, 260-267.  Hermey, G. (2009). The Vps10p-domain receptor family. Cell Mol Life Sci 66, 2677-2689.  Hirokawa, N. (1998). Kinesin and dynein superfamily proteins and the mechanism of organelle  57     transport. Science 279, 519-526.  Hirokawa, N., and Takemura, R. (2005). Molecular motors and mechanisms of directional transport in neurons. Nat Rev Neurosci 6, 201-214.  Horton, A.C., and Ehlers, M.D. (2003). Neuronal polarity and trafficking. Neuron 40, 277-295.  Hrabal, R., Chen, Z., James, S., Bennett, H.P., and Ni, F. (1996). The hairpin stack fold, a novel protein architecture for a new family of protein growth factors. Nat Struct Biol 3, 747- 752.  Hu, F., Padukkavidana, T., Vaegter, C.B., Brady, O.A., Zheng, Y., Mackenzie, I.R., Feldman, H.H., Nykjaer, A., and Strittmatter, S.M. (2010). Sortilin-mediated endocytosis determines levels of the frontotemporal dementia protein, progranulin. Neuron 68, 654- 667.  Huang, E.J., and Reichardt, L.F. (2003). Trk receptors: roles in neuronal signal transduction. Annu Rev Biochem 72, 609-642.  Ji, Y., Lu, Y., Yang, F., Shen, W., Tang, T.T., Feng, L., Duan, S., and Lu, B. (2010). Acute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons. Nat Neurosci 13, 302-309.  Kaplan, D.R., and Miller, F.D. (2000). Neurotrophin signal transduction in the nervous system. Curr Opin Neurobiol 10, 381-391.  Kayasuga, Y., Chiba, S., Suzuki, M., Kikusui, T., Matsuwaki, T., Yamanouchi, K., Kotaki, H., Horai, R., Iwakura, Y., and Nishihara, M. (2007). Alteration of behavioural phenotype in mice by targeted disruption of the progranulin gene. Behav Brain Res 185, 110-118.  Kessenbrock, K., Frohlich, L., Sixt, M., Lammermann, T., Pfister, H., Bateman, A., Belaaouaj, A., Ring, J., Ollert, M., Fassler, R., and Jenne, D.E. (2008). Proteinase 3 and neutrophil elastase enhance inflammation in mice by inactivating antiinflammatory progranulin. J Clin Invest 118, 2438-2447.  Kim, T., Gondre-Lewis, M.C., Arnaoutova, I., and Loh, Y.P. (2006). Dense-core secretory granule biogenesis. Physiology (Bethesda) 21, 124-133.  Klenchin, V.A., and Martin, T.F. (2000). Priming in exocytosis: attaining fusion-competence after vesicle docking. Biochimie 82, 399-407.  Kohara, K., Kitamura, A., Morishima, M., and Tsumoto, T. (2001). Activity-dependent transfer of brain-derived neurotrophic factor to postsynaptic neurons. Science 291, 2419-2423.    58     Kuczewski, N., Porcher, C., Ferrand, N., Fiorentino, H., Pellegrino, C., Kolarow, R., Lessmann, V., Medina, I., and Gaiarsa, J.L. (2008). Backpropagating action potentials trigger dendritic release of BDNF during spontaneous network activity. J Neurosci 28, 7013- 7023.  Kuczewski, N., Porcher, C., and Gaiarsa, J.L. (2010). Activity-dependent dendritic secretion of brain-derived neurotrophic factor modulates synaptic plasticity. Eur J Neurosci 32, 1239- 1244.  Kuczewski, N., Porcher, C., Lessmann, V., Medina, I., and Gaiarsa, J.L. (2009). Activity- dependent dendritic release of BDNF and biological consequences. Mol Neurobiol 39, 37-49.  Kuriu, T., Inoue, A., Bito, H., Sobue, K., and Okabe, S. (2006). Differential control of postsynaptic density scaffolds via actin-dependent and -independent mechanisms. J Neurosci 26, 7693-7706.  Kwinter, D.M., and Silverman, M.A. (2009). Live imaging of dense-core vesicles in primary cultured hippocampal neurons. J Vis Exp.  Laird, A.S., Van Hoecke, A., De Muynck, L., Timmers, M., Van den Bosch, L., Van Damme, P.,             and Robberecht, W. (2010). Progranulin is neurotrophic in vivo and protects against a mutant TDP-43 induced axonopathy. PLoS One 5, e13368.  Lessmann, V., Gottmann, K., and Malcangio, M. (2003). Neurotrophin secretion: current facts and future prospects. Prog Neurobiol 69, 341-374.  Liu, C.J., and Bosch, X. (2012). Progranulin: a growth factor, a novel TNFR ligand and a drug target. Pharmacol Ther 133, 124-132.  Lodish, H., Berk, A., Zipursky, S., Matsusaira, P., Baltimore, D., and Darnell, J. (2000). Molecular Cell Biology (4th Edition). Freeman & Co. New York.  Lu, B. (2003). BDNF and activity-dependent synaptic modulation. Learn Mem 10, 86-98. Lu, B., Pang, P.T., and Woo, N.H. (2005). The yin and yang of neurotrophin action. Nat Rev Neurosci 6, 603-614.  Lu, Y., Christian, K., and Lu, B. (2008). BDNF: a key regulator for protein synthesis-dependent LTP and long-term memory? Neurobiol Learn Mem 89, 312-323.  Ludwig, M., and Leng, G. (2006). Dendritic peptide release and peptide-dependent behaviours. Nat Rev Neurosci 7, 126-136.  Mahapatra, N.R., Mahata, M., O'Connor, D.T., and Mahata, S.K. (2003). Secretin activation of  59     chromogranin A gene transcription. Identification of the signaling pathways in cis and in trans. J Biol Chem 278, 19986-19994.  Martin, T.F. (2003). Tuning exocytosis for speed: fast and slow modes. Biochim Biophys Acta 1641, 157-165.  Matsuda, N., Lu, H., Fukata, Y., Noritake, J., Gao, H., Mukherjee, S., Nemoto, T., Fukata, M., and Poo, M.M. (2009). Differential activity-dependent secretion of brain-derived neurotrophic factor from axon and dendrite. J Neurosci 29, 14185-14198.  McKhann, G.M., Albert, M.S., Grossman, M., Miller, B., Dickson, D., and Trojanowski, J.Q. (2001). Clinical and pathological diagnosis of frontotemporal dementia: report of the Work Group on Frontotemporal Dementia and Pick's Disease. Arch Neurol 58, 1803- 1809.  Mellman, I., Fuchs, R., and Helenius, A. (1986). Acidification of the endocytic and exocytic pathways. Annu Rev Biochem 55, 663-700.  Moretto, M.B., Rossato, J.I., Nogueira, C.W., Zeni, G., and Rocha, J.B. (2003). Voltage- dependent ebselen and diorganochalcogenides inhibition of 45Ca2+ influx into brain synaptosomes. J Biochem Mol Toxicol 17, 154-160.  Mukherjee, O., Wang, J., Gitcho, M., Chakraverty, S., Taylor-Reinwald, L., Shears, S., Kauwe, J.S., Norton, J., Levitch, D., Bigio, E.H., et al. (2008). Molecular characterization of novel progranulin (GRN) mutations in frontotemporal dementia. Hum Mutat 29, 512- 521.  Murray, P.S., and Holmes, P.V. (2011). An overview of brain-derived neurotrophic factor and implications for excitotoxic vulnerability in the hippocampus. Int J Pept 2011, 654085.  Nakata, T., and Hirokawa, N. (2003). Microtubules provide directional cues for polarized axonal transport through interaction with kinesin motor head. J Cell Biol 162, 1045-1055.  Neary, D., Snowden, J.S., Gustafson, L., Passant, U., Stuss, D., Black, S., Freedman, M.,             Kertesz, A., Robert, P.H., Albert, M., et al. (1998). Frontotemporal lobar degeneration: a consensus on clinical diagnostic criteria. Neurology 51, 1546-1554.  Nielsen, M.S., Madsen, P., Christensen, E.I., Nykjaer, A., Gliemann, J., Kasper, D., Pohlmann, R., and Petersen, C.M. (2001). The sortilin cytoplasmic tail conveys Golgi-endosome transport and binds the VHS domain of the GGA2 sorting protein. EMBO J 20, 2180- 2190.  Njus, D., Kelley, P.M., and Harnadek, G.J. (1986). Bioenergetics of secretory vesicles. Biochim Biophys Acta 853, 237-265.   60     Nykjaer, A., and Willnow, T.E. (2012). Sortilin: a receptor to regulate neuronal viability and function. Trends Neurosci 35, 261-270.  Pang, P.T., Teng, H.K., Zaitsev, E., Woo, N.T., Sakata, K., Zhen, S., Teng, K.K., Yung, W.H.,            Hempstead, B.L., and Lu, B. (2004). Cleavage of proBDNF by tPA/plasmin is essential            for long-term hippocampal plasticity. Science 306, 487-491.  Petkau, T.L., Neal, S.J., Milnerwood, A., Mew, A., Hill, A.M., Orban, P., Gregg, J., Lu, G., Feldman, H.H., Mackenzie, I.R., et al. (2011). Synaptic dysfunction in progranulin- deficient mice. Neurobiol Dis 45, 711-722.  Petkau, T.L., Neal, S.J., Orban, P.C., MacDonald, J.L., Hill, A.M., Lu, G., Feldman, H.H., Mackenzie, I.R., and Leavitt, B.R. (2010). Progranulin expression in the developing and adult murine brain. J Comp Neurol 518, 3931-3947.  Pfeffer, S.R. (1999). Transport-vesicle targeting: tethers before SNAREs. Nat Cell Biol 1, E17- 22.  Plowman, G.D., Green, J.M., Neubauer, M.G., Buckley, S.D., McDonald, V.L., Todaro, G.J., and Shoyab, M. (1992). The epithelin precursor encodes two proteins with opposing activities on epithelial cell growth. J Biol Chem 267, 13073-13078.  Poo, M.M. (2001). Neurotrophins as synaptic modulators. Nat Rev Neurosci 2, 24-32.  Pullikuth, A.K., and Catling, A.D. (2007). Scaffold mediated regulation of MAPK signaling and cytoskeletal dynamics: a perspective. Cell Signal 19, 1621-1632.  Qin, J., Diaz-Cueto, L., Schwarze, J.E., Takahashi, Y., Imai, M., Isuzugawa, K., Yamamoto, S., Chang, K.T., Gerton, G.L., and Imakawa, K. (2005). Effects of progranulin on blastocyst hatching and subsequent adhesion and outgrowth in the mouse. Biol Reprod 73, 434-442.  Rambourg, A., Clermont, Y., Chretien, M., and Olivier, L. (1992). Formation of secretory granules in the Golgi apparatus of prolactin cells in the rat pituitary gland: a stereoscopic study. Anat Rec 232, 169-179.  Reichardt, L.F. (2006). Neurotrophin-regulated signalling pathways. Philos Trans R Soc Lond B Biol Sci 361, 1545-1564.  Ryan, C.L., Baranowski, D.C., Chitramuthu, B.P., Malik, S., Li, Z., Cao, M., Minotti, S., Durham, H.D., Kay, D.G., Shaw, C.A., et al. (2009). Progranulin is expressed within motor neurons and promotes neuronal cell survival. BMC Neurosci 10, 130.  Sankaranarayanan, S., and Ryan, T.A. (2000). Real-time measurements of vesicle-SNARE recycling in synapses of the central nervous system. Nat Cell Biol 2, 197-204.   61     Santi, S., Cappello, S., Riccio, M., Bergami, M., Aicardi, G., Schenk, U., Matteoli, M., and Canossa, M. (2006). Hippocampal neurons recycle BDNF for activity-dependent secretion and LTP maintenance. EMBO J 25, 4372-4380.  Schekman, R., and Orci, L. (1996). Coat proteins and vesicle budding. Science 271, 1526-1533. Seidah, N.G., Benjannet, S., Pareek, S., Chretien, M., and Murphy, R.A. (1996). Cellular processing of the neurotrophin precursors of NT3 and BDNF by the mammalian proprotein convertases. FEBS Lett 379, 247-250.  Setou, M., Nakagawa, T., Seog, D.H., and Hirokawa, N. (2000). Kinesin superfamily motor protein KIF17 and mLin-10 in NMDA receptor-containing vesicle transport. Science 288, 1796-1802.  Setou, M., Seog, D.H., Tanaka, Y., Kanai, Y., Takei, Y., Kawagishi, M., and Hirokawa, N. (2002). Glutamate-receptor-interacting protein GRIP1 directly steers kinesin to dendrites. Nature 417, 83-87.  Shankaran, S.S., Capell, A., Hruscha, A.T., Fellerer, K., Neumann, M., Schmid, B., and Haass, C. (2008). Missense mutations in the progranulin gene linked to frontotemporal lobar degeneration with ubiquitin-immunoreactive inclusions reduce progranulin production and secretion. J Biol Chem 283, 1744-1753.  Shelly, M., Cancedda, L., Heilshorn, S., Sumbre, G., and Poo, M.M. (2007). LKB1/STRAD promotes axon initiation during neuronal polarization. Cell 129, 565-577.  Shin, O.H., Rizo, J., and Sudhof, T.C. (2002). Synaptotagmin function in dense core vesicle exocytosis studied in cracked PC12 cells. Nat Neurosci 5, 649-656.  Smith, M.A., Zhang, L.X., Lyons, W.E., and Mamounas, L.A. (1997). Anterograde transport of endogenous brain-derived neurotrophic factor in hippocampal mossy fibers. Neuroreport 8, 1829-1834.  Sollner, T., Bennett, M.K., Whiteheart, S.W., Scheller, R.H., and Rothman, J.E. (1993). A protein assembly-disassembly pathway in vitro that may correspond to sequential steps of synaptic vesicle docking, activation, and fusion. Cell 75, 409-418.  Stephens, D.J., and Pepperkok, R. (2001). Illuminating the secretory pathway: when do we need vesicles? J Cell Sci 114, 1053-1059.  Suzuki, M., and Nishiahara, M. (2002). Granulin precursor gene: a sex steroid-inducible gene involved in sexual differentiation of the rat brain. Mol Genet Metab 75, 31-37.  Tang, W., Lu, Y., Tian, Q.Y., Zhang, Y., Guo, F.J., Liu, G.Y., Syed, N.M., Lai, Y., Lin, E.A., Kong, L., et al. (2011). The growth factor progranulin binds to TNF receptors and is therapeutic against inflammatory arthritis in mice. Science 332, 478-484.  62     Tapia, L., Milnerwood, A., Guo, A., Mills, F., Yoshida, E., Vasuta, C., Mackenzie, I.R., Raymond, L., Cynader, M., Jia, W., and Bamji, S.X. (2011). Progranulin deficiency decreases gross neural connectivity but enhances transmission at individual synapses. J Neurosci 31, 11126-11132.  Thureson-Klein, A. (1983). Exocytosis from large and small dense cored vesicles in noradrenergic nerve terminals. Neuroscience 10, 245-259.  Tooze, S.A. (1998). Biogenesis of secretory granules in the trans-Golgi network of neuroendocrine and endocrine cells. Biochim Biophys Acta 1404, 231-244.  Tsuboi, T. (2009). Molecular mechanism of attachment process of dense-core vesicles to the plasma membrane in neuroendocrine cells. Neurosci Res 63, 83-88.  Tsuboi, T., and Fukuda, M. (2006). Rab3A and Rab27A cooperatively regulate the docking step of dense-core vesicle exocytosis in PC12 cells. J Cell Sci 119, 2196-2203.  Vallee, R.B., Williams, J.C., Varma, D., and Barnhart, L.E. (2004). Dynein: An ancient motor protein involved in multiple modes of transport. J Neurobiol 58, 189-200.  Van Damme, P., Van Hoecke, A., Lambrechts, D., Vanacker, P., Bogaert, E., van Swieten, J., Carmeliet, P., Van Den Bosch, L., and Robberecht, W. (2008). Progranulin functions as a neurotrophic factor to regulate neurite outgrowth and enhance neuronal survival. J Cell Biol 181, 37-41.  van der Zee, J., Le Ber, I., Maurer-Stroh, S., Engelborghs, S., Gijselinck, I., Camuzat, A.,            Brouwers, N., Vandenberghe, R., Sleegers, K., Hannequin, D., et al. (2007). Mutations other than null mutations producing a pathogenic loss of progranulin in frontotemporal dementia. Hum Mutat 28, 416.  van Weering, J.R., Toonen, R.F., and Verhage, M. (2007). The role of Rab3a in secretory vesicle docking requires association/dissociation of guanidine phosphates and Munc18-1. PLoS One 2, e616.  Vicario-Abejon, C., Owens, D., McKay, R., and Segal, M. (2002). Role of neurotrophins in central synapse formation and stabilization. Nat Rev Neurosci 3, 965-974.  Wang, J., Van Damme, P., Cruchaga, C., Gitcho, M.A., Vidal, J.M., Seijo-Martinez, M., Wang, L., Wu, J.Y., Robberecht, W., and Goate, A. (2010). Pathogenic cysteine mutations affect progranulin function and production of mature granulins. J Neurochem 112, 1305-1315.  Willnow, T.E., Petersen, C.M., and Nykjaer, A. (2008). VPS10P-domain receptors - regulators of neuronal viability and function. Nat Rev Neurosci 9, 899-909.  Xu, S.Q., Tang, D., Chamberlain, S., Pronk, G., Masiarz, F.R., Kaur, S., Prisco, M., Zanocco-  63     Marani, T., and Baserga, R. (1998). The granulin/epithelin precursor abrogates the requirement for the insulin-like growth factor 1 receptor for growth in vitro. J Biol Chem 273, 20078-20083.  Yin, F., Banerjee, R., Thomas, B., Zhou, P., Qian, L., Jia, T., Ma, X., Ma, Y., Iadecola, C., Beal, M.F., et al. (2010). Exaggerated inflammation, impaired host defense, and neuropathology in progranulin-deficient mice. J Exp Med 207, 117-128.  Zerial, M., and McBride, H. (2001). Rab proteins as membrane organizers. Nat Rev Mol Cell Biol 2, 107-117.  Zheng, Y., Brady, O.A., Meng, P.S., Mao, Y., and Hu, F. (2011). C-terminus of progranulin interacts with the beta-propeller region of sortilin to regulate progranulin trafficking. PLoS One 6, e21023.  Zhou, J., Gao, G., Crabb, J.W., and Serrero, G. (1993). Purification of an autocrine growth factor homologous with mouse epithelin precursor from a highly tumorigenic cell line. J Biol Chem 268, 10863-10869.  Zhu, J., Nathan, C., Jin, W., Sim, D., Ashcroft, G.S., Wahl, S.M., Lacomis, L., Erdjument- Bromage, H., Tempst, P., Wright, C.D., and Ding, A. (2002). Conversion of proepithelin to epithelins: roles of SLPI and elastase in host defense and wound repair. Cell 111, 867- 878.             

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0073145/manifest

Comment

Related Items