UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Identification and validation of CDK13 interacting proteins Chun, Stella Soyoung 2012

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
24-ubc_2012_fall_chun_stella.pdf [ 13.55MB ]
Metadata
JSON: 24-1.0073117.json
JSON-LD: 24-1.0073117-ld.json
RDF/XML (Pretty): 24-1.0073117-rdf.xml
RDF/JSON: 24-1.0073117-rdf.json
Turtle: 24-1.0073117-turtle.txt
N-Triples: 24-1.0073117-rdf-ntriples.txt
Original Record: 24-1.0073117-source.json
Full Text
24-1.0073117-fulltext.txt
Citation
24-1.0073117.ris

Full Text

Identification and Validation of CDK13 Interacting Proteins by Stella Soyoung Chun B.Sc., The University of Ottawa, 2009  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in The Faculty of Graduate Studies (Medical Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) August 2012  © Stella Soyoung Chun, 2012  Abstract Cyclin dependent kinases (CDKs) are components of signal transduction pathways that regulate cellular functions by phosphorylation of substrate proteins in response to upstream signals. The kinase domains of CDK12 and CDK13 are most similar to CDK9; CDK9 phosphorylates the C terminal domain (CTD) of RNA Polymerase II in order to stimulate processive transcription elongation. However, while most human CDKs consist of little more than a kinase domain, CDK12 and CDK13 are much larger and have several protein-protein interaction domains suggesting that they could participate within regulatory cascades. They also have a RS domain found in the SR protein family of splicing factors. Consistent with these features CDK12 and CDK13 co-localize with splicing factors and RNA Polymerase II in nuclear speckles. Based on these features CDK12 and CDK13 have been proposed to coordinately regulate splicing and transcription. Consistent with this hypothesis, both kinases phosphorylate the CTD of RNA polymerase II and regulate the alternative splicing of the Adenovirus E1a mini-gene model substrate. CDK12 has been found to interact with the splicing factors PRP19, CDC5L, RBM25, FBP11 and SRP55. Due to the similarity of CDK13 to CDK12, I investigated the interacting partners of CDK13 by immunoprecipitation and mass spectrometry and determined that CDK13 interacts with same splicing factors as CDK12. These interactions were validated by immunoprecipitation – western blot analysis. My results also indicated that PRP19 and CDC5L interact as a complex with CDK13. Therefore, the protein interaction partners of CDK13 and CDK12 suggest functional mechanisms for their ability to regulate splicing. In parallel projects, to begin investigating the functional roles of the kinase domain of CDK12 I constructed and ii  expressed different CDK12 mutants in insect cells and in mammalian cells. Also to investigate the role of the CDK12 mutants and the protein-protein interactions of CDK13 in alternative splicing, I also developed a PCR based E1A mini-gene splicing assay.!  iii  Table of contents Abstract(....................................................................................................................................................(ii! Table(of(contents(...................................................................................................................................(iv! List(of(tables(.........................................................................................................................................(viii! List(of(figures(..........................................................................................................................................(ix! List(of(abbreviations(..........................................................................................................................(xii! Glossary(.................................................................................................................................................(xiii! Acknowledgements(...........................................................................................................................(xiv! Dedication(..............................................................................................................................................(xv! 1! Introduction(.....................................................................................................................................(1! 1.1! Cyclin)dependent)kinases)(CDK))..............................................................................................................)1! 1.1.1! History!of!cyclin!dependent!kinases!........................................................................................!1! 1.1.2! CDK!family!...........................................................................................................................................!3! 1.1.3! Activation!of!CDKs!by!cyclins!......................................................................................................!5! 1.2! CDK13).................................................................................................................................................................)6! 1.2.1! CDK13!structure!...............................................................................................................................!6! 1.2.2! CDK13’s!interacting!partners!.....................................................................................................!7! 1.2.3! CDK13!in!alternative!splicing!.....................................................................................................!7! 1.2.4! CDK13!–!other!functions!...............................................................................................................!8! 1.3! CDK12).................................................................................................................................................................)8! 1.3.1! CDK12’s!structure!............................................................................................................................!8! iv  1.3.2! CDK12’s!interacting!partners!.....................................................................................................!8! 1.3.3! CDK12!in!transcription!and!alternative!splicing!................................................................!9! 1.3.4! CDK12!H!other!functions!.............................................................................................................!10! 1.4! Alternative)splicing)and)splicing)factors)...........................................................................................)10! 1.4.1! Spliceosome!cycle!.........................................................................................................................!10! 1.4.2! Alternative!splicing!......................................................................................................................!12! 1.4.3! SR!proteins!.......................................................................................................................................!13! 1.4.4! Splicing!factor!H!PRP19/CDC5L!...............................................................................................!14! 1.4.5! Splicing!factor!H!RBM25!..............................................................................................................!15! 2! Project(description(......................................................................................................................(16! 2.1! Hypothesis).......................................................................................................................................................)16! 2.2! Objectives).........................................................................................................................................................)16! 2.2.1! CDK13!................................................................................................................................................!16! 2.2.2! CDK12!................................................................................................................................................!16! 3! Methods(...........................................................................................................................................(17! 3.1! Plasmid).............................................................................................................................................................)17! 3.2! Bacterial)DNA)transformation)...............................................................................................................)17! 3.3! Restriction)digests).......................................................................................................................................)18! 3.4! Tissue)culture).................................................................................................................................................)18! 3.5! Transfection)...................................................................................................................................................)18! 3.6! siRNA)knockdown)........................................................................................................................................)19! 3.7! mRNA)extraction)..........................................................................................................................................)19! 3.8! DNase)I)treatment).......................................................................................................................................)20! 3.9! cDNA)generation)..........................................................................................................................................)20! v  3.10! qPCR)................................................................................................................................................................)21! 3.11! Immunoprecipitation)..............................................................................................................................)21! 3.12! Mass)spectrometry)....................................................................................................................................)22! 3.13! Western)blot)................................................................................................................................................)23! 3.14! E1A)splicing)assay).....................................................................................................................................)24! 4! Identification(and(validation(of(CDK13(interacting(proteins(.......................................(25! 4.1! Construction)of)epitope)tagged)CDK13)..............................................................................................)26! 4.1.1! FlagHCDK13!......................................................................................................................................!26! 4.1.2! V5HCDK13!.........................................................................................................................................!27! 4.1.3! Green!fluorescent!protein!(GFP)HCDK13!............................................................................!27! 4.2! Expression)of)CDK13)in)mammalian)cell)...........................................................................................)29! 4.2.1! FlagHCDK13!expression!..............................................................................................................!29! 4.2.2! GFPHCDK13!expression!...............................................................................................................!30! 4.2.3! V5HCDK13!expression!.................................................................................................................!30! 4.3! Immunoprecipitation)(IP))and)mass)spectrometry)(MS))of)CDK13)protein)complexes)32! 4.3.1! CDK13!IPHMass!Spectrometry!(MS)!......................................................................................!34! 4.4! Expression)of)CDK13)interacting)proteins)in)mammalian)cells)..............................................)35! 4.5! Validation)of)CDK13)interactions)via)IPYWB)...................................................................................)37! 4.5.1! Validation!of!CDK13!2Hway!interaction!by!IPHWB!..........................................................!38! 4.6! CDK13)IPYWB)3Yway)interaction)..........................................................................................................)40! 4.7! CDK13)PPI)study)discussion)....................................................................................................................)42! 4.8! CDK13)interaction)study)conclusion)...................................................................................................)45! 5! Expression(of(mutant(CDK12(...................................................................................................(46! 5.1! CDK12)mutant)constructs)........................................................................................................................)47! vi  5.2! Baculovirus)expression)test).....................................................................................................................)52! 5.3! CDK12)expression)in)mammalian)cells)...............................................................................................)54! 5.4! CDK12)antibody)creation).........................................................................................................................)55! 5.5! CDK12)study)discussions)...........................................................................................................................)60! 5.6! CDK12)study)conclusions)..........................................................................................................................)61! 6! Development(of(alternative(splicing(assay(.........................................................................(62! 6.1! siRNA)knockYdown)......................................................................................................................................)62! 6.2! E1A)miniYgene)splicing)assay).................................................................................................................)65! 6.2.1! Optimization!....................................................................................................................................!65! 6.2.2! CDK12!splicing!assay!...................................................................................................................!69! 6.3! CDK13)splicing)assay)..................................................................................................................................)71! 6.3.1! Restoration!of!normal!splicing!activity!with!CDK13/CCNK!.......................................!73! 6.4! Alternative)splicing)discussion)...............................................................................................................)76! 6.5! CDK12)AS)study)discussion)......................................................................................................................)76! 6.6! CDK13)AS)study)discussion)......................................................................................................................)77! 6.7! Alternative)splicing)assay)conclusion)and)future)experiments)................................................)80! 7! Conclusion(......................................................................................................................................(81! Bibliography(.........................................................................................................................................(83! Appendices(............................................................................................................................................(86!  vii  List of tables Table 1.1 Protein protein interactors (PPI) of CDK12.. ..................................................... 9! Table 4.1 CDK13 interactions identified by IP-MS ......................................................... 35!  viii  List of figures Figure 1.1 Cell-cycle dependent CDKs and their interacting partners in cell cycle regulation ............................................................................................................................ 3! Figure 1.2 CDK phylogenetic maps. The family map shows each CDKs distance from one another. ......................................................................................................................... 4! Figure 1.3 Depiction of CDK and cyclin interaction .......................................................... 5! Figure 1.4 CDK regulation by phosphorylation. ................................................................ 6! Figure 1.5 Schematic diagram of remodelling of spliceosome complex .......................... 12! Figure 1.6 Different types of alternative splicing resulting .............................................. 13! Figure 4.1 Verification of Flag-CDK13 construction by digesting with HindIII and NcoI. ........................................................................................................................................... 28! Figure 4.2 Verification of V5-CDK13 construction by digesting with DraIII and HindIII. ........................................................................................................................................... 28! Figure 4.3 Verification of GFP-CDK13 plasmid construction by digesting with SfiI ..... 29! Figure 4.4 Confirmation of expression of Flag-CDK13 ................................................... 31! Figure 4.5 Confirmation of expression of GFP-CDK13 in HEK293A ............................ 31! Figure 4.6 Confirmation of expression of nV5-CDK13 .................................................. 32! Figure 4.7 Coomassie blue staining of GFP-CDK13 IP sample....................................... 33! Figure 4.8 Coomassie blue staining of V5-CDK13 and Flag-CDK13 IP sample ............ 34! Figure 4.9 Expression of N- or C-terminus tagged flag interacting proteins.................... 37! Figure 4.10 CDK13 interacts with differentially tagged interacting proteins .................. 39! Figure 4.11 CDK13 interacts as a complex with CDC5L and PRP19.............................. 41! ix  Figure 4.12 CDK13 interaction model with protein-protein interactors........................... 44! Figure 5.1 CDK12 and its different mutant forms ............................................................ 49! Figure 5.2 Restriction digest of pIEX9 after inserting three different CDK12s ............... 50! Figure 5.3 Restriction digest of pIEX2 after inserting three different CDK12s ............... 51! Figure 5.4 Sf9 growth curve over 6 days .......................................................................... 53! Figure 5.5 Different forms of CDK12 expressed in Sf9 cells analyzed by western blot .. 53! Figure 5.6 Expression of CDK12 wild-type and mutant proteins in HEK293A cells ...... 55! Figure 5.7 Restriction digest of C-terminal domain CDK12 with PacI and AscI ............ 56! Figure 5.8 Western blot of optimization of GST-CTD CDK12 protein expression level post-induction ................................................................................................................... 57! Figure 5.9 Analysis of FPLC column fractions for CDK12 antigen expression .............. 59! Figure 6.1 siRNA transfection of interacting proteins using different transfection reagents ........................................................................................................................................... 64! Figure 6.2. E1A mini-gene................................................................................................ 67! Figure 6.3 PCR cycle number optimization for E1A ........................................................ 68! Figure 6.4. PCR cycle number quantified using Fuji MultiGauge ................................... 68! Figure 6.5. Post-transfection harvest time optimization ................................................... 69! Figure 6.6 CDK12 E1A mini-gene splicing assay ............................................................ 70! Figure 6.7 Quantification of the CDK12 effect on alternative splicing ............................ 71! Figure 6.8. CDK13 and PPI overexpression E1A mini-gene splicing assay .................... 72! Figure 6.9. Quantification of E1A splicing assay ............................................................. 73! Figure 6.10 CDK13/CCNK E1A mini-gene splicing assay.............................................. 74!  x  Figure 6.11 Quantification of E1A splicing assay with overexpressed PPI and CDK13/CCNK. ................................................................................................................. 75!  xi  List of abbreviations ∆K  Kinase deleted or kinase knock-out  AmBic  Ammonium bicarbonate  AS  Alternative splicing  CCNK  Cyclin K  CDC5L  Cell-division cycle 5-like protein  CDK  Cyclin dependent kinase  CHED  Cholinesterase-related cell division controller  CTD  C-terminal domain  FL  Full-length or wild-type  IP  Immunoprecipitation  KD  Kinase dead  KO  Kinase knock-out or kinase deleted  MS  Mass spectrometry  PPI  Protein-protein interactor  PRP19  Precursor messenger RNA-processing factor 19  RBM25  RNA binding motif 25  RS domain Arginine – serine domain SR protein  Serine – arginine protein  SRP55  Serine/arginine-rich splicing factor 6.  SS  Splice site  WB  Western blot  WT  Wild-type or full-length  xii  Glossary Alternative splicing  Cellular mechanism to produce more than one related protein  cDNA  DNA synthesized from mRNA and contains only exons  Exon  Parts of a gene that contribute to mRNA.  Immunoprecipitation  A technique to purify protein of interest by precipitating it using an antibody that specifically binds to the protein of interest.  Immunoprecipitation Intron  Parts of gene are removed by splicing and do not contribute to mature RNA.  Mass spectrometry  An analysis where proteins are enzymatically digested and peptides are identified  mRNA  Final product of transcription  Polymerase Chain Reaction (PCR)  A technique to amplify a single region of DNA.  Pre-mRNA  The intermediate product between DNA and mature RNA that contains both introns and exons  Protein  Biological macromolecules that consist of one or more polypeptides and have roles in biological functions  qPCR  A technique to amplify and quantify the amplicon  Splicing  Cellular process in which introns are removed and exons are joined together to create mRNA  Transfection  Mechanism to introduce exogenous DNA to eukaryotic cells.  Transformation  Direct uptake of exogenous DNA through cell membrane in prokaryotic cells.  Western blot  A technique to detect specific proteins. The proteins are separated by size using gel electrophoresis and transferred to a membrane. The proteins are probed with specific antibody to target protein.  xiii  Acknowledgements I like to thank the entire Morin lab. They have continuously supported me during my thesis preparation. Special thanks to Dr. Gregg Morin, who has been a great mentor during my thesis and never gave up on me. I also like to thank Dr. Grace Cheng and Dr. Annie Moradian for all the help and support in the lab and for making me feel at home. The other students at GSC who spent endless hours with me and provided me with snacks as a stress remedy, thank you – you guys definitely made my journey easier. Also, extra thanks to my committee members, Dr. Leonard Foster and Dr. Xiaoyan Jiang who made last minute commitments to help me through my thesis.  xiv  Dedication I like to dedicate to this to my family – Grandma, Mom, Dad and big brother Mike. Thank you for the continuous support.  xv  1  Introduction  1.1 Cyclin dependent kinases (CDK) 1.1.1 History of cyclin dependent kinases Cyclin-dependent kinases (CDKs) are serine/threonine kinases that play crucial roles in cellular functions such as regulating the cell cycle, transcription and pre-mRNA splicing. CDKs were first discovered as an important regulator for cell-cycle checkpoints. For example, CDK1, CDK2, CDK3, CDK4 and CDK6 activity levels fluctuate throughout the cell cycle in their roles as regulators of cell cycle checkpoints. There are four different phases of the cell cycle: G1, S, G2, and M (Figure 1.1). The G1 is the growth phase where the cell prepares for DNA replication. Synthesis (S) phase is where DNA replication occurs. The G2 phase is when most biosynthesis occurs and the cell prepares for mitosis. Mitotic (M) phase is when mitosis occurs. During G1-S phase, CDK4 and/or CDK6 interact with Cyclin D. The CDK4-Cyclin D and/or CDK6-Cyclin D complex then phosphorylates members of the retinoblastoma (Rb) protein family. Rb protein represses transcription by binding and modulates the activity of transcription factors. Once phosphorylated by CDK4/6, Rb becomes inactive, and further phosphorylation by CDK2Cyclin E is thought to make it irreversible (Reviewed in 1). Inactivation of Rb promotes the synthesis of A and B-type cyclins that stimulate for the next phase of the cell cycle, the G2-M phase. Initially, Cyclin A level increases and binds to CDK1 and CDK2. The newly formed CDK1/Cyclin A and CDK2/Cyclin A complexes phosphorylate several proteins that play a role in DNA replication. As G2 progresses, Cyclin A is degraded and 1  CDK1 then binds to Cyclin B. CDK1-Cyclin B phosphorylates several proteins that regulate important processes during mitosis such as chromosome condensation and centrosome separation. The activity levels of the different CDKs are controlled by the fluctuation in the leads of cyclins during the cell cycle. For instance, as mentioned above, Cyclin A and Cyclin B are synthesized only after the inactivation of Rb, but then Cyclin A will eventually be degraded in G2. Other CDK research uncovered other CDKs with functional roles outside of the cell cycle. These are non cell-cycle CDKs. For example, CDK9 interacts with Cyclin T and regulates transcription; CDK12 interacts with Cyclin K and have been implicated in the coupled process of splicing and transcription via phosphorylation of C-terminal domain (CTD) of RNA polymerase II and maintaining genomic stability 2,3; CDK13 also interacts with Cyclin K and affects alternative splicing 3,4. The activities of these CDKs do not fluctuate during the cell cycle as their cyclin partner is not cell-cycle dependent.  2  Figure 1.1 Cell-cycle dependent CDKs and their interacting partners in cell cycle regulation. Each CDK play different roles in regulating cell cycle progression. The activity of CDK is dependent on their cyclin partner 1.  1.1.2 CDK family CDKs were first identified as kinases that have a specific motif – the PSTAIRE helix in the upper lobe in kinase domain. This motif serves as a key interaction point with a cyclin. As more CDKs were discovered, variations to this motif were observed: PFTAIRE, PCTAIRE, PITAIRE. Based on the sequence homology of kinase domain, a kinase family phylogenetic map was constructed (Figure 1.2).  3  Figure 1.2 CDK phylogenetic maps. The family map shows each CDKs distance from one another based on their kinase domain sequence homology. This is modified from Malumbres 2005 1.  4  1.1.3  Activation of CDKs by cyclins  CDKs bind cyclins as their interacting partners and require them to be active. Kinases become active when ATP binds within the active sites. However, ATP access to the active site of CDKs is blocked by a structural feature in CDKs called the T-loop. The interaction between a CDK and a cyclin moves the T-loop out of the active site, allowing for the CDK activating kinase (CAK) to phosphorylate a residue in the T-loop (Figure 1.3). The CDK is now fully active for downstream signalling. Phosphorylation of other residues in the kinase domain can also regulate CDK activity, for instance by regulating the CDK-cyclin interface (Figure 1.4).  Figure 1.3 Depiction of CDK and cyclin interaction. The CDK is inactive in its original form. The CDK becomes partially active when cyclin interacts with CDK and moves the T-loop to make the active site accessible. CAK phosphorylates the active site in the T-loop and fully activates the CDK. Adapted from Molecular Biology of the Cell 4th edition.  5  Figure 1.4 CDK regulation by phosphorylation. Phosphorylation can both activate or inactivate CDK. In this example, fully active CDK binds to a cyclin and its active site is phosphorylated. However, when it is hyperphosphorylated by other regulatory kinases, it can be inactivated. The process is reversible by action of a phosphatase. Adapted from Molecular Biology of the Cell 4th edition.  1.2 CDK13 CDC2L5 or CDK13 is located on chromosome 7p14.1. CDK13 was first identified as CHED (Cholinesterase-related cell division controller) human cdc2 homolog 5. The CDK13 transcript size is 5.3kb and the protein size 180kDa 6,7. In respect to its mRNA level, it is expressed in brain, liver, muscle of fetal origin; in neuroblastoma and glioblastoma; and in adult whole brain, hippocampus and bone marrow, but it is especially highly expressed in liver and placenta 5,6 suggesting that it may be involved in specialized tissue functions. 1.2.1  CDK13 structure  CDK13 has a PITAIRE motif that distinguishes it from other cell cycle regulated CDKs except CDK12 6. CDK13 amino acid sequence features three nuclear localization signals (NLS) in the N-terminus 6. Studies have found that the N-terminal domain containing the Arginine – Serine 6  (RS) domain, NLS and the first 15 amino acids are required for nuclear localization of CDK13 7. CDK13 co-localizes with SC35, well-known splicing factor and accordingly, it is shown to localize in nuclear speckles, where splicing factors localize 4,7. 1.2.2  CDK13’s interacting partners  As a cyclin-dependent kinase, CDK13 requires an interacting cyclin to become active. CDK13’s interacting partners were first identified as Cyclin L1α and Cyclin L2α 4. It was first thought the CDK13 interacts with Cyclin L because of Cyclin L’s known involvement in splicing, and since CDK11 affects alternative splicing and binds to Cyclin L 8. However, this was later opposed when Cyclin K was identified as a CDK13 partner and not Cyclin L 3,9, and was determined to be the sole activating cyclin (Morin, unpublished). Other protein-protein interactors (PPI) of CDK13 are: p32, a splicing regulator; CHMP4A, a charged multivesicular body protein 10 ; and acetylated Tat, an inhibitor for HIV-1 splicing via p32 11. Despite its localization to nuclear speckles, where splicing and transcription is active, no other studies have focused on identifying splicing factors as PPI of CDK13. 1.2.3  CDK13 in alternative splicing  CDK13 is involved in alternative splicing: a N-terminal domain fragment of CDK13 affected TNF β splicing, whereas the kinase domain did not 7; over-expression of CDK13 in HEK293T showed that the 13S product decreased and the 9S product increased in the E1A mini-gene splicing assay 4; and overexpression of CDK13 inhibited the production of US HIV-1 mRNA and downregulated HIV viral expression by interacting with Tat modulating viral Nef HIV-1 mRNA splicing 11.  7  1.2.4  CDK13 – other functions  CDK13 expression increases during development of hematopoiesis and is also required for the proper development of hematopoiesis. This was found when antisense oligodeoxynucleotides of CDK13 diverted hematopoiesis towards this mononuclear lineage 5, suggesting that CDK13 is important for this specialized function. Moreover, recently, it has been shown that 72% of CDK13 mRNA undergo A! I editing that results in the Q103R amino acid substitution in the brain 12 and may have functional consequences, yet to be identified.  1.3 CDK12 CrkRS, Crk7 or CDK12 is located on chromosome 17q21 2. Its transcript size is 5.5kb and its protein size is ~180kDa. In respect to its expression level, CDK12 is ubiquitously expressed in most tissues 2. 1.3.1  CDK12’s structure  CDK12 is identified as a CDK that has sequence PITAIRE, unique from other CDKs except CDK13 (Figure 1.2). Its features include a arginine/serine (RS) domain 2 and CDK12 colocalizes with SC35 in nuclear speckles. Nuclear localization signals (NLS) are located in the RS domain and in the kinase domain of CDK12. Out of the many features of CDK12, the RS domain that contains 2 NLS plays a major role in targeting CDK12 to nuclear speckles 2. 1.3.2  CDK12’s interacting partners  For CDK12 to exhibit kinase activity, it needs to be activated by a cyclin. At first, Cyclin L1 was identified as CDK12’s interacting partner 13 but later studies have shown that Cyclin K is the 8  interacting partner of CDK12 3,9 Morin lab unpublished. Some other PPI of CDK12 includes CAPER14, estrogen receptor activator; and many splicing factors: SRP55, FBP11, RBM25, PRP19, and CDC5L (unpublished Morin Lab data, Table 1.1). Table 1.1 Protein protein interactors (PPI) of CDK12. Differentially tagged CDK12 pull-down study with Immunoprecipitation (IP) –Mass Spectrometry (MS) to identify PPIs. CDK12 Interactors # peptides (log expectation value) Cyclin K  SRP55  CDC5L  PRP19  FBP11  RBM25  42.8 kDa*  39.6 kDa  92.2 kDa  55.1 kDa  108.8 kDa  100.1 kDa  -  2 (-8.0)  12 (-73.5)  13 (-47.3)  8 (-20.9)  7 (-26.4)  -  2 (-4.8)  12 (-64.6)  9 (-43.4)  4 (-13.2)  7 (-27.2)  -  -  9 (-57.8)  11 (-39.9)  -  10 (-24.6)  -  -  7 (-31.1)  4 (-19.9)  -  5 (-16.7)  -  -  2 (-6.8)  5 (-14.3)  -  4 (-6.8)  -  -  -  4 (-9.7)  -  -  7 (-14.9)  -  2 (-6.9)  -  5 (-1.8)  3 (-9.7)  5 (-14.2)  -  -  -  2 (-1.7)  -  5 (-10.4)  3 (-3.0)  4 (-9.7)  1 (-1.9)  2 (-12.5)  5 (-33.6)  3 (-10.4)  -  -  -  -  4 (-3.8)  1.3.3  CDK12 in transcription and alternative splicing  Because of its localization to the nucleus and nuclear speckles, CDK12 was speculated to play a role in coupling splicing and transcription. It was found that CDK12 affects alternative splicing of the E1A mini-gene, where overexpression of CDK12 decreased the amount of 13S product and increased 9S product 13. In addition to its role in alternative splicing, CDK12 promoted  9  transcription elongation of RNA polymerase II (RNAPII) 9. More specifically, CDK12 exhibits kinase activity in Ser-2 C-terminal domain (CTD) of RNAPII 2,9. 1.3.4  CDK12 - other functions  CDK12 is located proximal to ERBB2. ERBB2 is highly expressed in 25% of breast cancers due to genome amplification 15. Because CDK12 and ERBB2 are proximal to each other it was observed that CDK12 was also frequently amplified with ERBB2, suggesting CDK12 may have a role in cancer susceptibility or progression. Also, CDK12 interacts with CAPER 14, an estrogen receptor activator. The interaction of CDK12 and CAPER may play a role in activating the estrogen receptor gene, suggesting an increase in CDK12 may result up-regulation of estrogen receptor alpha, which is frequently associated with many breast cancers 16. The CAPER interaction may inference the functional consequence of CDK12’s high expression in ERRB2 gene in breast cancer. In addition, CDK12 was identified as a novel determinant in resistance to the estrogen receptor antagonist, tamoxifen 17. Silencing CDK12 increases cell survival by reducing tamoxifen induced G1 arrest by enhancing the phosphorylation of p42/p44 MAPK pathway 17. A recent study showed that CDK12/Cyclin K is required for genomic stability. Knock-down study of CDK12/Cyclin K enhanced apoptosis and DNA damage response (DDR) 3  .  1.4 Alternative splicing and splicing factors 1.4.1  Spliceosome cycle  The DNA of genes, which contains introns and exons, gets transcribed into RNA and the RNA gets translated into protein. During the transcription process, introns are excised and exons 10  joined together to form messenger RNA (mRNA). The process of excising introns and joining exons together is called splicing. Splicing occurs through the interactions of many small nuclear ribonucleoproteins (snRNP) in the spliceosome complex with the pre-mRNA 18,19 (Figure 1.5). snRNPs contains a strand of RNA (snRNA) that interacts with pre-mRNA and different proteins to make up a snRNP. The first step of spliceosome complex assembly is the formation of complex A – the pre-spliceosome complex. Complex A is formed as U1 snRNP binds to the 5’ splice site (SS) of the intron. Binding of U1 commits the pre-mRNA to the splicing pathway. Then, the U2 snRNP binds to branch point sequence upstream of the 3’ SS and forms “complex A”. U4 and U6 that are usually found as a di-snRNP, interact with U5 to form a tri-snRNP that interacts with complex A to form “complex B”. Because complex B is not catalytic, a major protein rearrangement occurs to make it into catalytic spliceosome “complex B*”. The PRP19 associated complex hPrp19/CDC5L, which consist of at least 7 proteins 20 or the yeast homolog nineteen-complex (NTC) binds to the “complex B” to cause the formation of “complex B*”. The NTC forms a stable association with U5 and U6 and helps promote release of U4. Then, the U6 snRNA base-pairs with the 5’ SS replacing U1 and with U2 snRNA to form the catalytic centre of the spliceosome which is now called “complex B*”. “Complex B*” undergoes two transesterification reactions. In the first trans-esterification reaction, the 5’ end of the intron is released forming a lariat, the intermediate, and becomes “complex C”. Then, the second transesterification occurs where the 5’ and 3’ SS are joined and releasing the intron lariat, and leaving only exon containing mRNA (Figure 1.5).  11  Figure 1.5 Schematic diagram of remodelling of spliceosome complex. The diagram shows the assembly and disassembly of major spliceosome components. Spliceosome components bind to premRNA resulting in mature-RNA 44.  1.4.2  Alternative splicing  Originally, it was thought that one gene became one protein. However, it was found that one gene will give rise to multiple protein isoforms through a process called alternative splicing. Alternative splicing is when the splicing occurs at a different splice site than expected. Hence, unlike constitutive splicing, where contiguous exons are joined, different mRNAs can be formed by joining various combinations of exons from a single gene. At least 74% of human genes have 2 or more isoforms resulting from alternative splicing 21. Currently, there are various types of alternative splicing 22 (Figure 1.6). These different types of alternative splicing affect the primary structure and function of the protein product by several methods such as: introduction of a stop 12  codon, addition/deletion of domains, change in ligand or protein binding properties, intracellular localization, change in enzymatic activities, change in protein stability or different posttranslational modifications. In a larger context, different isoforms can give rise to diseases and can be a marker for the detection of diseases 23.  Figure 1.6 Different types of alternative splicing resulting. a) cassette exons b) mutually exclusive exons c) competing 5’ splice site d) competing 3’ splice site e) retained introns f) multiple promoters g) multiple poly(A) sites 22.  1.4.3  SR proteins  Alternative splicing is regulated via splicing factors’ interaction with sequences in pre-mRNA exons or introns called exon splicing enhancers or silencers (ESE or ESS) or intron splicing enhancers or silencers (ISE and ISS). Through these interactions, SR proteins regulate the formation of complex A during the pre-spliceosome assembly. SR proteins have a domain that is 13  rich in arginine/serine (RS) dipeptides. The first SR proteins discovered, ASF/SF2 and SC35 were shown to alter 5’ splice site (SS) selection and modulate alternative splicing 24. 5’ SS modulating SR proteins share a structural similarity – an RS domain near the C-terminus followed by one or more RNA recognition motifs (RRM). The RS domain is required to interact with other SR proteins, with other RS domain containing proteins, and with splicing regulators. In addition, recent studies have also found that the RS domains themselves interact with RNA, in addition to the RNA binding function of the RRM domain. This dynamic interaction between the RS domain and the RRM domain with RNA suggests that SR proteins are critically involved in the remodelling of the spliceosome complex. SR proteins recognize and bind to different RNA regions such as ESE 25,26. The arginine rich feature of the RS domains is thought to promote RNA binding to enhancer regions. RS domains are frequently phosphorylated at their serine residues and the phosphorylation controls cellular localization, intranuclear localization and mRNP formation. SR proteins also help shuttle RNA containing elements out of the nucleus to the cytoplasm and it is thought that their phosphorylation status can modulate their localization 27  . In addition to RNA shuttling, SR proteins are recruited to the pre-mRNAs for splicing in their  hyper-phosphorylated form, but then become dephosphorylated during the spliceosome cycle progression. If kept in their hyper-phosphorylated form, there is an accumulation of SR proteins in nuclear speckles. 1.4.4  Splicing factor - PRP19/CDC5L  Precursor messenger RNA-processing factor 19 (PRP19) and cell-division cycle 5-like protein (CDC5L) exists as a complex in human cells or as the Nineteen-complex (NTC) in yeast.  14  PRP19/CDC5L exist in a heteromeric protein complex with at least seven proteins 28-30. The PRP19-associated complex is required to activate complex B and stabilize the spliceosome after the release of U1 and U4 31. Also, the PRP19-U2AF65 complex is recruited to the C-terminal domain (CTD) of RNA polymerase II to enhance splicing 32. CDC5L complex is required for pre-mRNA splicing as studies have shown that immunodepletion of CDC5L inhibits splicing. CDC5L also exists in a core spliceosome complex, with an important role in second catalytic step of pre-mRNA splicing 33. It was found that the interaction of CDC5L with the WD40 domain of PLRG1 is required for splicing 34. 1.4.5  Splicing factor - RBM25  hRED120 (human Arg/Glu/Asp-rich protein of 120) 35 or RNA Binding Motif 25 (RBM25) was shown to be a splicing regulatory protein. It localizes to nuclear speckles via the RE/RD-rich domain in its central region. Overexpression of RBM25 caused increased amount of apoptosis by promoting the production of proapoptotic Bcl-xs via alternative splicing 36. RBM25 was also observed as a complex with U1 snRNP-associated factor, hLuc7A 36..  15  2  Project description  2.1 Hypothesis The primary hypothesis of this thesis is that CDK13 interacts with splicing factors. Secondary hypotheses were 1) the kinase domain of CDK12 modulates alternative splicing and 2) that the interaction of CDK13 with splicing factors modulates alternative splicing.  2.2 Objectives 2.2.1  CDK13  The objective of the CDK13 studies was to 1) find the CDK13 interacting splicing factors via immunoprecipitation and mass-spectrometry and 2) determine if the interaction of the splicing factors and CDK13 affects alternative splicing. 2.2.2  CDK12  The objective of the CDK12 studies was to understand the functional role of kinase domain in splicing. Different mutant forms of CDK12 were created and they were investigated for their effect in the E1A mini-gene splicing assay.  16  3  Methods  3.1 Plasmid To construct a cDNA expression vector for CDK13, a LR reaction was performed using donor clone: pDONR CDK13 (Open Biosystems #100068276) and destination clones: pCDNA6.2 GFP, pcDNA-flag (LMBP 4704), and pcDNA 3.1 nV5-Dest. Successful CDK13 shuttling was confirmed by DNA sequencing and restriction mapping.  3.2 Bacterial DNA transformation 50µl of Library Efficiency DH5α were transformed with 3µl of DNA sample into and incubated on ice for 30 minutes. Cells were heat-shocked by incubating at 42°C for 30 seconds and kept on ice for 2 minutes. 250µl of S.O.C medium were added to the cells and incubated at 37°C for 1 hour with shaking. The cells were centrifuged at 3000 rpm for 5 minutes. 900µl of supernatant were discarded and cells were resuspended in 100µl. Cells were plated on LB plates with selective antibiotics and incubated overnight at 37°C. 50µl of Subcloning Efficiency DH5α were transformed with 3µl of DNA sample and incubated on ice for 30 minutes. Cells were heat-shocked by incubating at 42°C for 15 seconds and kept on ice for 2 minutes. 250µl of S.O.C medium were added to the cells and incubated at 37°C for 1 hour with shaking. The cells were centrifuged at 3000 rpm for 5 minutes. 900µl of supernatant were discarded and cells were resuspended in 100µl. Cells were plated on LB plates with selective antibiotics and incubated overnight at 37°C.  17  3.3 Restriction digests Restriction digests were performed using NEB enzymes according to their protocol. Digestion incubations were performed overnight. The analysis of digestion was done by separating the fragments on 0.8% agarose gel at 100V for 1 hour and visualized by staining with 0.0001% Sybr Green for 15 minutes.  3.4 Tissue culture HEK293A and HeLa mammalian cells were grown at 37°C with 5% CO2 in 10% FBS DMEM without antibiotics. All transfections were done at passages below 30. Sf9 insect cells were grown as adherent or suspension cells at 28°C with Insect Cell Medium. Suspension cells were cultured in a shaking flask at 150 rpm.  3.5 Transfection For IP-MS analysis, four 15cm plates that were 80-90% confluent with HEK293A were prepared for Polyethylamine (PEI) transfection or 50% confluent plates for Calcium Phosphate transfection. Calcium phosphate transfection was performed by the user protocol. For PEI transfection, the cells were transfected with 12µg of total plasmid per plate using PEI. Total DNA of 12ug were diluted 12µg in 1mL of Opti-MEM without serum and mixed. The DNA was heated at 72 °C for 10 minutes. Tube was centrifuged briefly and cooled down to room temperature for 5 minutes. 30µl of PEI (1ug/µl) was added to give 1:3 ratio of DNA:PEI. The mixture was vortexed, centrifuged, and incubated at room temperature for 20 minutes. Meanwhile, I changed media on the plates (DMEM + 10% FBS without antibiotics). After 20  18  minutes of incubation, the DNA/PEI complex was added to each plate. The plates were rocked to evenly distribute DNA/PEI complex and were incubated at 37 C with 5% CO2 for 48 hours. For Co-IP assay, 10cm plate was prepared at 80-90% confluent HEK293A cells. The cells were transfected with 10µg of total plasmid using Polyethylamine (PEI), as described above. For test expression transfections, Lipofectamine transfections were performed in a 6-well plates according to the manufacturer protocol.  3.6 siRNA knockdown In a 24-well plate, X-treme Gene transfection reagent were used to knock-down gene expression. 20pmol of siRNA were diluted in 50µl Opti-MEM Medium and mixed gently. 5µl of X-treme Gene was diluted in 50µl Opti-MEM Medium. siRNA and X-treme Gene were mixed and incubated for 20 minutes at room temperature. The cells were 50% confluent when siRNA/Xtreme Gene complex was added. Cells were incubated for 24 hours and 37°C in CO2 incubator. After 24 hours, cells were harvested and analyzed for knock-down expression.  3.7 mRNA extraction Cells were washed with PBS twice. For 24-well plates, 200ul of TRIzol was directly added into the wells for lysis of cells. Cells were incubated with TRIzol for 5 minutes at room temperature and then kept on ice. The homogenized samples were transferred into Eppendorf tubes on ice. 40µl of chloroform were added to each tube and was shaken vigorously for 15 seconds followed by incubation at room temperature for 5 minutes. The tubes were centrifuged at 12,000 x g for 15 minutes at 4°C. The aqueous (top) phase containing the RNA was transferred to a fresh Eppendorf tube. 100µl of isopropanol was added to the aqueous phase and tubes were inverted 6 19  times. The aqueous phase/isopropanol was incubated at room temperature for 10 minutes. The tubes were centrifuged at 12,000 x g for 10 minutes at 4°C and supernatant were carefully removed to not disrupt the RNA pellet. RNA pellet was washed with 200µl of 75% ethanol and mixed by vortex. The tube was centrifuged at 7,500 x g for 5 minutes at 4°C and supernatant was carefully removed. P20 was used to remove as much as liquid as possible from RNA pellet. RNA pellet was air dried at room temperature for 5-10 minutes. RNA was dissolved in 10µl of RNasefree water depending on the cell line and incubated at 55°C for 10 minutes. The RNA concentration was quantified using a NanoDrop UV spectrophotometer.  3.8 DNase I treatment On ice, 1µg RNA samples (up to a maximum of 8µl) were prepared in fresh tubes and added RNase-free water to 8µl. 1µl DNase I Reaction Buffer (10x) and 1µl DNase I (Amp Grade, 1U/µl) were added to each tube and incubated for 15 minutes at room temperature. 1µl of 25mM EDTA was added to each reaction, and heat inactivated at 65°C for 10 minutes.  3.9 cDNA generation On ice, 1µl random hexamer primer (50ng/µl), 2µl 10mM dNTP mix were added to each tube from the DNase I reaction and incubated at 65°C for 5 minutes, and then placed the tubes on ice. During the 5 minutes, I created master mix for cDNA generation: 4µl 5x First Strand Buffer, 1µl 0.1M DTT, 1µl RNaseOUT (40U/µl) and 1µl SuperScriptIII. 7µl of master mix was added into each reaction tube on ice. 21ul of mixture was then transferred to 96-well PCR plate. Program for cDNA synthesis was as follows: 10 minutes at 25°C, 40 minutes at 50°C, 5 minutes at 85°C, and held at 4°C.  20  3.10 qPCR Using Express Sybr Green ER qPCR with ROX, every sample was analyzed in triplicates. For each triplicate, master mix was made: 15µl of Sybr green mix, 12.6µl of ddH2O, 0.6µl of 10uM forward primer, 0.6µl of 10µM reverse primer, and 1.2µl of cDNA. Then, 10ul was aliquoted into each well. For analysis on HT7900, the program was set to: Stage 1: 2 minutes at 50°C, Stage 2: 2 minutes at 95 °C, Stage 3: 15 seconds at 95°C, 1 minute at 60°C, Repeats 40. Stage 4: Dissociation stage.  3.11 Immunoprecipitation Cells were washed twice with cold PBS and harvested using cell scraper in PBS. Cells were centrifuged at 3000 rpm for 5 minutes at 4°C. Supernatant was aspirated. Lysis buffer (TBS 1X, EDTA 1mM, NP-40 0.1%v/v, deoxycholate 0.05% w/v, Na3VO4 2mM, β-glycerohposphate 10mM, Roche Protease Complete Inhibitor) was added to cell pellet and nutated for 30 minutes at 4°C. The lysate was centrifuged at 20,000 x g for 15 minutes at 4°C. Lysate was clarified by passing through 0.45µm nylon syringe filter. Then, the lysate was pre-cleared by adding 50% slurry of Sepharose 4B and nutated for 1 hour at 4°C. The tubes were centrifuged at 3000rpm at 4°C for 3 minutes. Supernatants were transferred to a fresh tube. Supernatant was immunoprecipitated with GFPTrap, anti-V5 agarose or M2 Flag beads as appropriate and nutated overnight at 4°C. Beads were washed with lysis buffer and eluted with 2X SDS-PAGE Sample Buffer by heating it at 95°C for 5 minutes. Proteins were separated by electrophoresis using 8%12% SDS NuPage Gel and visualized by colloidal Coomassie Blue stain.  21  3.12 Mass spectrometry Proteins for MS analysis were recovered from SDS-PAGE gel slices. Gels slices were cut into 1mm by 1mm cubes and placed in 96-well plate. Drops of water were added to each well to prevent dehydration during the cutting of gels. After all the gels were cut, the water was carefully removed from the gel cut samples with a plastic pipette and discarded. 200µl of acetonitrile was added to dehydrate the gel pieces for ~5min at room temperature (RT). When dehydrated, the gel pieces had an opaque white colour and were significantly smaller in size. Carefully removed the acetonitrile from the sample with a plastic pipette and discarded. The gel pieces were completely dried at ambient temperature in a vacuum centrifuge for 3 minutes. 30µl of 10mM DTT was added to reduce the protein for 30min at RT. Carefully removed the DTT from the sample with a plastic pipette and discarded. 30µl of 100mM iodoacetamide was added to alkylate the protein for 30min at RT. Carefully removed the iodoacetamide from the sample with a plastic pipette and discarded. 200µl of acetonitrile was added to dehydrate the gel pieces for 5min at RT. When dehydrated, the gel pieces had an opaque white colour and were significantly smaller in size. Carefully removed the acetonitrile from the sample with a plastic pipette and discarded. Gel pieces were rehydrated in 200µl of 100mM ammonium bicarbonate (AmBic) and incubated for 10 minutes at RT. Carefully removed the AmBic from the sample with a plastic pipette and discarded. 200µl of acetonitrile was added to dehydrate the gel pieces for 5min at room temperature. When dehydrated, the gel pieces had an opaque white colour and were significantly smaller in size. Carefully removed the acetonitrile from the sample with a plastic pipette and discarded. The gel pieces were completely dried at ambient temperature in a vacuum centrifuge for 3 minutes. Prepared trypsin reagent by adding 1mL of ice-cold 50mM AmBic with 10% 22  acetonitrile to 20µg of trypsin. Trypsin solution was kept on ice until use. 30µl of the trypsin solution was added to the sample and allowed the gel pieces to rehydrate on ice for 10 minutes. Once the gel pieces were rehydrated by the trypsin, excess trypsin solution were removed. 5µl of 50mM AmBic was added to the sample. Digestion was performed overnight at 37°C. The peptides produce by the digestion was extracted in three steps. 30µl of 50mM AmBic was added to the sample and incubated the sample for 10 minutes. The supernatant was collected in a 96well plate. 30µl of extraction buffer was added to the wells containing the gel pieces and incubated for 10 minutes. The supernatant was collected and combined in the white 96-well plate. Second 30µl of extraction buffer was added to the well containing the gel pieces and incubated the sample for 10 minutes. Supernatant was collected and combined in the white 96well plate. Samples were vacuum centrifuged in Speed Vac at 55°C until dried (usually 2-3hr). The samples were then analyzed on a 4000 QTrap mass spectrometer.  3.13 Western blot Samples were loaded into 4%-12% NuPage Gel or 3%-8% Tris-Acetate gel for protein separation through gel electrophoresis. The gel was ran at 150V for 1 hour in NuPage or TrisAcetate running buffer. The gel was transferred to nitrocellulose membrane over night at 100mA.The membrane was placed in blocking buffer for 1 hour. Primary antibody was added and incubated for 1hour. The membrane was washed with TBS-tween for 5 minutes and repeated 3 times. The membrane was incubated in secondary antibody diluted in blocking buffer for 1 hr. The membrane was washed with TBS-tween for 5 minutes and repeated 3 times. Imaged on Odyssey scanner.  23  3.14 E1A splicing assay cDNA was prepared from HeLa cells 48 hours after transfection by the modified Qiagen protocol (Section 3.7-3.9). 1µl of cDNA was used as the template for PCR using the E1A forward primer and E1A reverse primer to detect E1A mini-gene mRNA splicing products. PCR condition were: 98°C for 30 seconds, 98°C for 10 seconds , 64°C for 10 seconds, 72°C for 1 minute, repeated 25 cycles, 72°C for 5 minutes, 4°C forever. Following the PCR, 10µl of amplicon was separated by size on 6% native acrylamide gel (filtered 7mL of 10X TBE, filtered 14mL of 39.5:1 Bisacrylamide, 560µl of 10% ammonium persulfate, 30µl TEMED, final volume of 70mL). Gel electrophoresis was performed at constant 13W for 1.5hour. Then, the gel was stained in fresh 0.0001% Sybr Green for 15 minutes and imaged on a FujiFilm FLA-7000.  24  4  Identification and validation of CDK13 interacting proteins  Overview CDK12 and CDK13 are known to affect alternative splicing 4,13. The Morin lab showed that CDK12 interacts with splicing factors through immunoprecipitation (IP) – mass spectrometry (MS) studies. Since CDK12 and CDK13 are homologous and are both large CDK proteins that contain a splicing factor RS domain and a kinase domain, I hypothesized that CDK13 would have the same or similar protein - protein interactors (PPI) as CDK12. In order to test this hypothesis, I constructed epitope-tagged CDK13 in order to express and to purify CDK13 complexes in mammalian cells. Once they were confirmed to be expressed in HEK293A cells, CDK13 protein complexes were immunoprecipitated from cell lysates. This process should purify CDK13 and any other proteins that may associate with CDK13. To maximize the identification of CDK13 and its interacting proteins by mass spectrometry (MS), CDK13 and its interacting proteins were separated by size using sodium dodecyl sulfate – polyacrylamide gel electrophoresis (SDS – PAGE). Then, the proteins were digested with trypsin and analyzed by MS to identify the proteins that associated with CDK13. My results showed the splicing factors that interacted with CDK12 were also identified as CDK13 PPIs. To validate the interactions, differentially tagged PPIs were co-expressed with CDK13 in mammalian cells and IP’d for either CDK13 or the PPI and analyzed it by western blot. These results confirmed that CDK13 interacts with splicing factors in vivo.  25  4.1 Construction of epitope tagged CDK13 In order to IP CDK13, three differentially tagged CDK13 were constructed – Flag-CDK13, V5CDK13 and GFP-CDK13. All three were constructed using the Invitrogen Gateway system, where the gene insert in donor vector was recombined into the destination vector using LR clonase. Once CDK13 was inserted into acceptor vector that expressed different tags, the constructs were expressed in mammalian tissue culture using several different transfection methods. The donor vector containing CDK13 was obtained from Open Biosystems (pDONR CDK13 Cat:#100068276) 4.1.1  Flag-CDK13  CDK13 has a transcript size of 6985bp and ORF cDNA of 4473bp. After the LR reaction between pDONR CDK13 and the Flag destination vector, LMBP 4704, the final plasmid size was 10250bp. To confirm the transfer by restriction mapping, two different enzymes were used: NcoI and HindIII. NcoI cuts the LMBP4704 at four different sites (position 403, 692, 3446, 4181) and CDK13 at one site (position 4324). HindIII cuts LMBP4704 at one site (position 682) and CDK13 at one site (position 1497). When the recombined plasmid was digested with NcoI and HindIII, the expecting fragment sizes were 3344bp, 2827bp, 1642bp, 1413bp, 735bp, 279bp, and 10bp. The DNA agarose gel showed all the expected sizes except for 297bp and 10bp (Figure 4.1). The two fragments, 279bp and 10bp, were too small to be detected on the 0.8% agarose gel.  26  4.1.2  V5-CDK13  After the LR reaction between pDONR CDK13 and the destination vector pcDNA3.1 nV5-Dest, the final plasmid size was predicted to be 11252bp. For restriction mapping, DraIII and HindIII were used. DraIII cuts the pcDNA3.1 nV5-Dest at one site (position 3240). HindIII cuts pcDNA3.1 nV5-Dest at one site (position 903) and CDK13 at one site (position 1463). The expecting fragment sizes of 6255bp, 3434bp, and 1563bp were observed (Figure 4.2). 4.1.3  Green fluorescent protein (GFP)-CDK13  After the LR reaction between pDONR CDK13 and the destination vector pcDNA6.2 GFP DEST, the final plasmid size was predicted to be 11,573bp. For restriction mapping verification, SfiI was used. SfiI restriction sites in pcDNA6.2 GFP DEST are located near the recombinant sites and will release the gene insert. The expecting fragment sizes of 4,473bp and 5,996bp were observed (Figure 4.3).  27  Figure 4.1 Verification of Flag-CDK13 construction by digesting with HindIII and NcoI. Each clone was digested and ran on 0.8% agarose gel, stained with 0.0001% Sybr Green. The double digest resulted in seven different fragments. However, 297bp and 10bp are too small to be detected on 0.8% agarose gel. The numbers indicate different clones.  Figure 4.2 Verification of V5-CDK13 construction by digesting with DraIII and HindIII. Each clone was digested and ran on 0.8% agarose gel, stained with 0.0001% Sybr Green. The double digestion resulted in three different fragments. The numbers indicate different clones. 28  Figure 4.3 Verification of GFP-CDK13 plasmid construction by digesting with SfiI. Each clone was digested with SfiI and ran on 0.8% agarose gel, stained with 0.0001% Sybr Green. The digestion resulted in two different fragments: The upper fragment is the destination vector and the lower fragment is CDK13. The numbers indicate different clones.  4.2 Expression of CDK13 in mammalian cell The V5, Flag and GFP tagged CDK13 gene constructs were expressed in the mammalian cell, HEK293A. Whole cell lysates were then analyzed for CDK13 expression by western blot using the appropriate anti-tag antibody. The expected protein size of CDK13 is ~180kDa. Depending on the tag size, differentially tagged CDK13 will slightly differ in protein size. Once expression of CDK13 protein was confirmed, it was used in the immunoprecipitation study. 4.2.1  Flag-CDK13 expression  For Flag-CDK13, the first four clones from LR reaction were selected for expression in HEK293A. The anti-Flag M2 antibody identified Flag-CDK13 band and near the 188kDa marker. Due to the high expression of Flag-CDK13 clone 4 (Figure 4.4), clone 4 was used for future experiments.  29  4.2.2  GFP-CDK13 expression  For GFP-CDK13, the two clones were selected to transfect HEK293A and tested for expression using an anti-GFP antibody to identify GFP-CDK13. Both plasmids produced proteins of the expected size of ~200kDa (Figure 4.5) due to addition of that GFP protein that adds ~28kDa. I also monitored GFP-CDK13 expression by fluorescent microscopy. Expression of the vector containing only GFP showed that the entire cell fluoresced for GFP transfected cells, while for GFP-CDK13 transfected cells, only a nuclear portion of the cell fluoresced (image not shown). 4.2.3  V5-CDK13 expression  For V5-CDK13, two clones were selected for expression in HEK293A. Using an anti-V5 antibody, bands were observed at ~180kDa consistent with V5-CDK13. For this experiment, V5FOXL2 was used as a positive control for the V5 epitope (Figure 4.6).  30  Figure 4.4 Confirmation of expression of Flag-CDK13. Expression of four different clones in HEK293A using PEI transfection. Whole cell lysates were run on 8%-12% NuPage gel and transferred to nitrocellulose membrane. Western blot probed with anti-Flag M2 antibody, followed by anti-rabbit secondary antibody. The numbers indicate different clones. GFP-CDK13 was used as a positive control to look under the fluorescent microscope for transfection efficiency (image not shown) and its lysate was used as a negative control.  Figure 4.5 Confirmation of expression of GFP-CDK13 in HEK293A. Two different clones of GFPCDK13 were expressed in HEK293A using lipofectamine transfection method. Whole cell lysates were run on 8%-12% NuPage gel and transferred to nitrocellulose membrane. Western blot probed with mouse anti-GFP antibody and then with anti-mouse secondary antibody. The arrow indicates CDK13. 31  CDK13  FoxL2  Figure 4.6 Confirmation of expression of nV5-CDK13. Expression of two different clones of V5CDK13 clone #1 and #3 in HEK293A using Lipofectamine 2000 transfection method. Whole cell lysates were run on 8%-12% NuPage gel and transferred to nitrocellulose membrane. The membrane was probed with mouse anti-V5 antibody, and then anti-mouse secondary antibody. V5-FOXL2 was positive control for V5 tag.  4.3 Immunoprecipitation (IP) and mass spectrometry (MS) of CDK13 protein complexes CDK13 and its appropriate controls were expressed in HEK293A at a large scale (four 10cm plates) sufficient for IP and identification of MS. After 48hours post-transfection, the cells were harvested, lysed in IP-MS buffer and incubated overnight with appropriate antibody. The proteins were eluted according to our in-house protocol and the eluents were analyzed by SDSPAGE to separate the proteins by size. The gels were then sliced into smaller pieces and digested  32  with trypsin into peptides to facilitate mass spectrometry analysis. The corresponding empty vector was used as a negative control. GFP-CDK13 and its corresponding negative control, GFP, were IP’d with GFPTrap. Because GFP is ~28kDa, the final mass of GFP-CDK13 was ~206kDa. Three separate experiments were performed for reproducibility. The GFP-CDK13 bait protein was observed near the 220kDa marker in each replicates (Figure 4.7). The gel was sliced into 1mm by 1mm size pieces and processed for mass spectrometry analysis with trypsin. Unfortunately, Flag-CDK13 and V5CDK13 were IP’d with low efficiency. Flag-CDK13 could not be detected and only a minimal amount of V5-CDK13 was detected (Figure 4.8). Nevertheless, Flag and V5 tagged CDK13 IPs were analyzed by MS but showed only minimal levels of bait protein and PPIs (discussed below).  a)  b)  c)  Figure 4.7 Coomassie blue staining of GFP-CDK13 IP sample. IP eluent is run on 8%-12% NuPage gel. a) GFP-CDK13total lysate IP’d and its corresponding negative sample (MS0158) b) GFP-CDK13 nuclear fraction IP’d and its corresponding negative sample (MS0173) c) GFP-CDK13total lysate IP’d and its corresponding negative sample (MS0190)  33  a)  b)  Figure 4.8 Coomassie blue staining of V5-CDK13 and Flag-CDK13 IP sample. IP eluent is run on 8%-12% NuPage gel. a) nV5-CDK13 total lysate IP’d with agarose V5 beads and its corresponding negative sample b) Flag-CDK13 total lysate IP’d with M2 flag beads and its corresponding negative sample (MS0173)  4.3.1  CDK13 IP-mass spectrometry (MS)  MS was used as an unbiased approach to identify the interacting partners in CDK13 complexes purified from HEK293A cells. MS spectra were matched to human proteins using the Mascot algorithm. The proteins that were identified in the negative control were considered to be background proteins and were subtracted from the list of proteins that were identified in the GFP-CDK13 IP. Since CDK13 is similar to CDK12, I predicted that CDK13 would have similar interacting protein as CDK12. The IP was found to be inefficient for V5-CDK13 and FlagCDK13 and as a result, there were only low levels of CDK13 and its interacting cyclin, CCNK, and splicing factors could not be detected.  34  On the other hand, the GFP-CDK13 IPs were very efficient and MS analysis showed abundant amount of proteins that co-IP’d with CDK13. As predicted, many proteins that are splicing factors co-purified with CDK13. The proteins identified were: CDC5L, PRP19, RBM25, SRP55, FBP11 and its interacting partner, Cyclin K (Table 4.1). Table 4.1 CDK13 interactions identified by IP-MS. Over-expression of GFP-CDK13 were isolated by IP and analyzed by MS for interacting proteins. The number of unique peptides (in bold) and the number of total peptides are shown for both the bait CDK13 and its interacting proteins, followed by the Mascot score in parentheses’. CDK13 interactions identified by IP-MS in HEK293A CDK13 Bait Protein  GFP-CDK13 (MS0158) GFP-CDK13 nuclear fraction (MS0173) GFP-CDK13 (MS0190)  Unique Peptides: Total peptides (Mascot Score) 74:355 (4522.4) 57:139 (3267.4) 64:237 (3793.8)  Prey Proteins Unique Peptides: Total peptides (Mascot Score) CCNK  SRP55  CDC5L  PRP19  FBP11  RBM25  13:15 (567.4) 0  10:10 (539.4) 8:9 (388.0) 9:16 (464.2)  7:8 (265.1) 4:4 (142.0) 6:7 (204.0)  0  15:16 (692.5) 3:3 (84.8) 7:7 (241.8)  12:12 (582.1) 8:8 (293.5) 6:7 (317)  6:10 (258.7)  8:8 (326.8) 4:4 (173.3)  4.4 Expression of CDK13 interacting proteins in mammalian cells Based on the IP-MS data for CDK13 PPIs, four interacting proteins, CCNK, CDC5L, PRP19, and RBM25 were chosen for study. As CDK13’s interacting cyclin, CCNK would be required to activate kinase activity of CDK13. CDC5L and PRP19 are known splicing factors that are required to activate the spliceosome from complex B to complex B*. RBM25 was found to alter alternative splicing patterns in some studies. The plan was to first verify the CDK13 – PPI interactions identified by IP-MS then, hopefully, to perform functional experiments. However, before any of these experiments could be done, I needed to express constructs containing these  35  genes in mammalian cells. Because the same proteins were identified for CDK12 the constructs were already available for use. These constructs were tested to confirm their expression in HEK293A. The cDNAs available for CCNK, CDC5L, PRP19, and RBM25 were inserted in the V180 and V181 destination vectors. V180 adds a N-terminal Flag tag and V181 adds a C-terminal Flag tag. The plasmids were transfected into HEK293A cells and total cell lysate was analyzed by western blot using the anti-Flag M2 antibody. RBM25 protein size is 100kDa and PRP19 is 50kDa. For my initial studies N-terminal Flag tagged RBM25 and PRP19 were chosen due to better expression (Figure 4.9 lane 1 and 3). C-terminal Flag tagged PRP19 had higher background compared to PRP19 and C-terminal Flag tagged RBM25 had lower expression (Figure 4.9 lane 2 and 4). The empty backbone vectors V180 and V181 were used as negative controls. RBM25Flag, V180 and V181 showed a band at ~50kDa, which was a result of the Flag-PRP19 sample leaking into those gel lanes during gel loading.  36  Figure 4.9 Expression of N- or C-terminus tagged flag interacting proteins. The entire cell lysate was ran on 8%-12% NuPage Gel, and transferred to nitrocellulose membrane. The membranes were probed with anti-flag M2 antibody. V180 and V181 are empty vectors to detect any background signals. The proteins are boxed.  4.5 Validation of CDK13 interactions via IP-WB Although the IP-MS experiment data were reproducible, it needed to be validated by a different method to ensure that the results from IP-MS were not artifacts. In order to validate the IP-MS data, IP-WB analysis was performed. Constructs of CDK13 PPIs containing Flag-tag and V5CDK13 were co-transfected into HEK293. Flag-tagged PPIs were IP’d with an anti-Flag antibody and the eluent was analyzed by western blot with a V5 antibody to detect the presence 37  of V5-CDK13. This result showed that CDK13 interacts with CCNK, PRP19, CDC5L, and RBM25 (Figure 4.10). I then checked to see if PRP19 and CDC5L will IP together with CDK13 since PRP19 and CDC5L exist as a complex in cells. V5-CDK13, Flag-PRP19 and Flag-CDC5L are co-transfected together and IP’d with a V5 antibody, both PRP19 and CDC5L were observed (Figure 4.11). The 3-way interaction IP-WB showed the yield of PRP19 and CDC5L were more efficient when they were co-expressed. 4.5.1  Validation of CDK13 2-way interaction by IP-WB  V5-CDK13 was co-transfected with the Flag-tagged interacting proteins. The antibody eluents were run on SDS-PAGE for western blot analysis. The western blot was probed with anti-V5 antibody, the V5-CDK13 protein was detected near the 188kDa marker (Figure 4.10).$CCNK and RBM25 showed strong interaction with CDK13, whereas CDC5L and PRP19 showed little or no interaction $(Figure 4.10$a). The same membrane was re-probed with anti-Flag antibody to confirm the pull-down of the bait proteins (Figure 4.10 b). In this experiment an abundant amount of PRP19 was pulled down but CDK13 was almost undetectable. With CDC5L, there was a relatively less amount of CDC5L compared to PRP19, but CDK13 was still observed at a minimum level.  38  a) IP: anti-flag WB: anti-V5  b) Figure 4.10 CDK13 interacts with differentially tagged interacting proteins. IP of interacting proteins a) Western blot probed for CDK13 (anti-V5 antibody) b) Western blot probed for interacting proteins (anti-flag M2 antibody) to detect the level of bait protein. The interacting proteins are boxed.  39  4.6 CDK13 IP-WB 3-way interaction PRP19 and CDC5L interact with each other in the Nineteen spliceosome sub-complex 37. My 2way interaction results showed that the precipitation of CDK13 was weak with PRP19 and CDC5L when co-expressed individually with these proteins. Here, I did a three-way transfection to see if the proteins interact as a three protein complex. The transfection consisted of PRP19, CDC5L and CDK13. RBM25, CCNK and CDK13 were also transfected together to test their potential interaction as a three protein complex. The samples were IP’d with anti-V5 agarose beads to precipitate V5-CDK13 and then probed for the Flag-tagged interacting proteins. CDK13 was successfully observed in individual PRP19 and CDC5L transfections, but PRP19 or CDC5L were observed (Figure 4.11a lane 7, 8). However, when all three were transfected together a greater amount of PRP19 and CDC5L was observed to interact with CDK13 (Figure 4.11a lane 6). For the RBM25 and CCNK co-transfection, the transfection of RBM25 was very inefficient (Figure 4.11b lane 9, 10, 11) and it was not possible to draw a conclusion about the interaction between the three proteins. However, when only RBM25 and CDK13 were transfected, V5CDK13 did not pull down Flag-RBM25, even through the Flag-RBM25 was highly expressed. (Figure 4.11a lane 5 and b lane 5). The difference seen here as to the result above (section 4.5.1) was discussed below. Since the overall V5-CDK13 pull-down efficiency was consistent for each sample (Figure 4.11c), IP inefficiency could not have been the reason for lack of RBM25 in western blots during three-way transfection.  40  a)  b)  c) Figure 4.11 CDK13 interacts as a complex with CDC5L and PRP19. The eluent was run on 8-12% NuPage and transferred to nitrocellulose membrane a) IP of V5-CDK13 (anti-V5 agarose beads) and WB probed for interacting proteins (anti-flag antibody) to detect CDK13 interactions. b) Non-bound sample from IP, WB probed for interacting proteins (anti-flag antibody) to detect the level of expression and unbound protein c) IP of V5-CDK13 (anti-V5 agarose beads) and WB probed with for CDK13 (anti-V5 antibody) to detect the efficiency of pull-down 41  4.7 CDK13 PPI study discussion In this study, three differentially tagged CDK13 versions were created: Flag-CDK13, V5CDK13 and GFP-CDK13. GFP-CDK13 was used for IP-MS analysis to identify CDK13 interacting proteins. The IP of GFP-CDK13 with GFPTrap was more efficient than V5CDK13 or Flag-CDK13 (Figure 4.7 b, c). When these samples were analyzed by MS, the V5-CDK13 and Flag-CDK13 proteins precipitated fewer proteins compared to GFPCDK13. Therefore, GFP-CDK13 was chosen for the reproducibility IP-MS studies. The analysis of the IP-MS data excluded proteins identified in the negative control, in this case GFP, to eliminate any unspecific proteins to create a list of candidate interacting proteins that were unique to GFP-CDK13. Three different fusion tags were used because any one epitope may cause disruption in the structure of the protein or it may interfere with the interaction of proteins. For this IP-MS study, GFP-CDK13 had the best IP efficiency for MS analysis. CDK13 and CDK12 have RS domain and RRM motifs, which are prominent in splicing factors 38. These domains are also important for binding to other splicing factors. Due to the similarity between CDK13 and CDK12 (Figure 1.2), I expected the two proteins to have similar PPIs. The Morin lab showed that CDK12 interacts with CCNK and the splicing factors, PRP19, RBM25, FBP11 and SRP55 (Table 1.1). As predicted, IP-MS analysis showed that CDK13 interacts with CCNK and the splicing factors – PRP19, CDC5L, RBM25, FBP11, and SRP55. PRP19 and CDC5L exist as a complex in cells and this complex is required for activation of the spliceosome complex  42  B. Previous studies on RBM25 had shown that RBM25 affects alternative splicing of the Bcl-x gene. FBP11 and SRP55 are also well-documented splicing factors. The cyclin interaction partner of CDK13, Cyclin K was identified in this study as the 70kDa Cyclin K. The smaller 40kDa isoform of CCNK was not identified (Table 4.1). These data support other studies that show the longer isoform of CCNK interacts with CDK13 9. My IP-MS data showed that CCNK was detected in the whole lysate of IP-MS sample but not in the nuclear fraction (Table 4.1). This suggests CCNK activates the kinase activity of CDK13. After identifying the PPIs of CDK13 by IP-MS, I validated the candidate interactions by co-expression V5-CDK13 and Flag-tagged PPIs for IP-WB analysis. IP-WB analysis showed CDK13 and CCNK interact and that each can precipitate the other (Figure 4.10). This suggests CCNK activates the kinase activity functions of CDK13. For the CDK13 and RBM25 interaction, Flag-RBM25 successfully precipitated V5CDK13 (Figure 4.10) but not the other way around (Figure 4.11). This may be because the V5 tag was inaccessible or the interaction of the proteins hindered access to the V5 tag. Note that the identification of PPIs by V5 IP of V5-CDK13 was inefficient. Nonetheless, the Flag-RBM25 IPs validated the initial GFP-CDK13 results that CDK13 and RBM25 are interacting proteins. The interaction of CDK13 with RBM25 suggests that CDK13 may play a role in the substrate specific alternative splicing function of RBM25 36 The interaction of CDK13, PRP19 and CDC5L appear to be a three-way interaction. Since PRP19 and CDC5L exist as a complex, it is likely that when one is precipitated the 43  other is co-precipitated. My data suggested that CDK13 interacts with both PRP19 and CDC5L. The whole cell lysates of GFP-CDK13 IP-MS data showed a higher score for CDC5L and a lower score for PRP19 (Table 4.1). However, the nuclear fraction GFPCDK13 sample showed the reverse, where CDC5L presented with a lower score than PRP19. These data made if difficult to make any conclusions about interaction contacts between the three proteins. To further test the possibility of existence of all three proteins as a complex, IP-WB was performed by transfecting HEK293A with all three genes. The western blot suggested that with CDK13 as the bait protein, CDC5L and PRP19 were precipitated with greater efficiency when both were expressed together rather than when CDC5L and PRP19 were individually expressed with CDK13 (Figure 4.10). PRP19/CDC5L is an important splicing factor in the spliceosome cycle. The complex is required to activate the splice complex B to B* through remodelling of the snRNP interactions 39. The interaction of CDK13 with PRP19 and CDC5L suggested that CDK13 may be part of a bigger complex of PRP19/CDC5L and may also play a role in activating or regulating the spliceosome complex.  Figure 4.12. CDK13 interaction model with protein-protein interactors. The proteins in red boxes have been identified and validated by IP-MS and IP-WB respectively. The proteins in grey boxes have been identified by IP-MS, yet to be validated. 44  4.8 CDK13 interaction study conclusion This study showed that CDK13 interacts with CCNK, RBM25, PRP19 and CDC5L as demonstrated by both IP-MS and IP-WB experiments. My data also suggest that CDK13, PRP19, and CDC5L form a three protein complex. The two splicing factors, FBP11 and SRP55, detected by IP-MS were not confirmed for their interaction with CDK13 by IP-WB. Future validation of these interactions may provide a better insight in CDK13s role in the spliceosome complex. Another study that remains to be performed is to validate the CDK12 IP-MS data to ensure that those interactions are not artifacts. Once the CDK12 and CDK13 interactions are validated, we can investigate how these interactions are important for the spliceosome reaction and alternative splicing.  45  5  Expression of mutant CDK12  Overview My initial project was to study the functional role of CDK12’s kinase domain. Several studies have shown the importance of kinase domain of CDK12 in transcription. However, no studies focused on CDK12’s kinase domain in alternative splicing (AS). Currently, the studies on CDK12’s effect on AS were performed with the Adenovirus E1A mini-gene splicing assay. When CDK12 was over-expressed in mammalian cells, the splicing pattern of the E1A mini-gene differed than of the control. CDK12 has unique feature for a CDK – it has a RS domain, a feature commonly found in AS regulators. Exploring the role of CDK12’s kinase domain in AS can reveal many aspects of CDK12 function in alternative splicing. It can show us: 1. If CDK12 is phosphorylating any spliceosomal splicing factors; 2. If kinase domain activity is required for CDK12’s role in splicing; 3. If CDK12 can behave as a SR protein splicing factor without a functional kinase domain. The planned assay to explore CDK12’s function in AS was an in vitro splicing assay where the presence and amounts of CDK12 could be changed. Thus several reagents were required: different mutants of CDK12, semi-purified proteins of the mutant versions of CDK12, the means to deplete CDK12 protein, and a splicing assay to monitor the effect of mutant CDK12 in AS. This section describes my progress towards these goals. Three different CDK12 expression vectors were created: wild-type (or full-length), kinase dead, and kinase deleted (or kinase knock-out). The kinase dead version had two different inactivating mutations introduced into the kinase domain. The kinase dead 46  mutant was created previously and was ready for use. I created the kinase deleted construct by cloning the regions before and after the kinase domain and ligating them together. To make protein all three forms of CDK12 was inserted into a baculovirus vector for expression in insect cells and into the pcDNA vector for expression in mammalian cells. For the in vitro splicing assay, I needed a method to deplete CDK12 from cell extracts so that I could observe the effect of added mutant CDK12 protein in the assay. To do this I pursued two different methods: creating an anti-CDK12 antibody for depletion of the protein from extracts (Chapter 5) and a siRNA CDK12 knock-down reagent to deplete CDK12 from cell extracts and for an in vivo AS assay (Chapter 6).  5.1 CDK12 mutant constructs To test the function of CDK12’s kinase domain in alternative splicing (AS), three different types of CDK12 were required – wild-type (WT or FL), kinase dead (KD), and kinase deleted (ΔK or KO). WT CDK12 was ready for use, KD CDK12 was already created through site-directed mutagenesis, and I had to create KO CDK12. Because the AS study was going to be done in vitro by addition of exogenous CDK12 protein, I needed a method to produce the epitope-tagged mutant CDK12 proteins and purify them. Therefore, the CDK12 mutants were inserted into two different baculovirus for protein expression in Sf9 insect cells. The proteins would be purified by fast-protein liquid chromatography (FPLC). The CDK12 mutants were also cloned into pcDNA3.1 vector for in vivo splicing assay in mammalian cells. WT or full length (FL) and KD CDK12 were amplified with primers PTXSC007 and PTX008 for the pIEX2 vector and PTXSC022/PTXSC010 for the pIEX9 vector. The 47  plasmids pIEX2 and pIEX9 are Sf9 insect cell expression vectors that allow the fusion of epitope tags to gene inserts for affinity purification. To create ΔK CDK12 the N-terminal region before the kinase domain and the C-terminal region after the kinase domain (Figure 5.1) were amplified by PCR and ligated together to create a kinase deleted CDK12 insert. The inserts were then cloned into pIEX2 to create a GST-tag, S-tag, and His-tag fusion to the N-terminus of CDK12 and into pIEX9 create C-terminal His-tag and Strep-tag fusion constructs. The vector inserts were verified by restriction mapping (Figure 5.2 and Figure 5.3). Because the kinase domain of CDK12 spans nucleotides 2206bp to 3076bp, the final size of kinase-deleted CDK12 is 3603bp. The WT and KD were also cloned into pIEX2 and pIEX9 baculovirus vector for expression in insect cells. Later, all three CDK12s were cloned into pcDNA3.1 for protein expression in mammalian cells and were confirmed by restriction mapping (result not shown).  48  Figure 5.1 CDK12 and its different mutant forms. This diagram shows the three different forms of CDK12. Kinase-dead CDK12 has two mutations created by site-directed mutagenesis and kinase-deleted has the entire kinase domain deleted resulting in smaller size. The numbers represent the amino acids.  49  NotI NcoI  Figure 5.2 Restriction digest of pIEX9 after inserting three different CDK12s. Plasmid digests were analyzed on a 0.8% agarose gel stained with 0.0001% Sybr Green. Full-length (WT) CDK12 is digested with NotI and NcoI, Kinase deleted (KO) is digested with NotI and SalI, and Kinase Dead (KD) is digested with NcoI and NotI. The numbers indicate different clones.  50  Figure 5.3 Restriction digest of pIEX2 after inserting three different CDK12s. Plasmid digests were analyzed on a 0.8% agarose gel stained with 0.0001% Sybr Green. Full-length (FL) CDK12 is digested with HindIII, NotI, and BamHI; kinase dead (KD) is digested with BamH, BaeI, and NotI; Kinase deleted (KO) is digested with NotI and BamHI. The numbers indicate different clones. 51  5.2 Baculovirus expression test After the CDK12 mutants were successfully inserted into pIEX baculovirus vectors, their expression in Sf9 insect cells were tested and analyzed by western blot. Once expression was confirmed, then large-scale transfection could be done to produce large amounts of CDK12 mutants for FPLC purification. For Sf9 cells growing at an exponential rate from suspension culture, 1 million cells per well were seeded in a 6-well plate one hour prior to transfection. Cell counts were done to ensure Sf9 were within the linear range of the growth curve (Figure 5.4 day 2 and 3). The cells were harvested after 48 hours post-transfection and tested for its expression by running the entire cell lysate in SDS-PAGE and probing it with anti-CDK12 (anti-crk7) antibody (Pines lab). GST protein is 25kDa, so GST-tagged CDK12s should appear 25kDa higher (at ~200kDa) than the CDK12 protein alone. Indeed, GST-tagged WT CDK12 and KD CDK12 appeared around 200kDa, and ΔK CDK12 protein appeared at ~180kDa (Figure 5.5 lane 1, 2, 3). The C-terminus His-tagged WT CDK12 was observed at ~180kDa and ΔK CDK12 at ~160kDa. His-tagged KD CDK12 did not express (Figure 5.5 lane 4, 6, 5).  52  Figure 5.4 Sf9 growth curve over 6 days. Sf9 growing in suspension cells were counted to determine their growth rate. Cells were counted using Trypan Blue dye.  Figure 5.5 Different forms of CDK12 expressed in Sf9 cells analyzed by western blot. Total cell lysate was run on 3% - 8% tris-acetate gel, and transferred to nitrocellulose membrane. The membrane was probed with anti-crk7 antibody (Novus) and then with anti-mouse antibody. Proteins are boxed. pIEX2 FL=200kDa, KD=200kDa, KO=180kDa; pIEX9 FL=180kDa; KD=180kDa; KO=160kDa 53  5.3 CDK12 expression in mammalian cells For studying CDK12 in vivo, the CDK12 mutants needed to be expressed in mammalian cells. The mutant cDNAs were inserted into the pcDNA3.1 mammalian CMV expression vector. These were transfected into HEK293A cells and the whole lysates were analyzed for CDK12 expression by western blots. HEK293A cells were transfected and harvested at 48 hours post-transfection and entire cell lysate was run on SDS-PAGE for western blot analysis. The anti-sera (Section 5.4) were used to detect CDK12 expression. WT CDK12 and KD CDK12 were detected at 180kDa and ΔK CDK12 was detected at 160kDa (Figure 5.6).  54  Figure 5.6 Expression of CDK12 wild-type and mutant proteins in HEK293A cells. Cell lysates were run on 3%-8% Tris-Acetate gel and transferred to nitrocellulose membrane. CDK12 was detected using anti-CDK12 sera followed by anti-rabbit secondary antibody. Wild-type and kinase-dead detected at ~180kDa and kinase-deleted detected at 160kDa. The numbers depict different clone numbers.  5.4 CDK12 antibody creation A CDK12 antibody was needed for various reasons: 1. The stock of CDK12 antibody we received from the Pines lab was depleted; 2. A CDK12 antibody was needed to deplete CDK12 for in vitro splicing assays; 3. A CDK12 antibody was needed for IP and western blots. My role was to create the antigen for CDK12. The antigen was then used to immunize rabbits for the production of a polyclonal CDK12 antibody by a commercial vendor. The anti-CDK12 sera are now available for use in the lab. The antigen needed to generate a CDK12 antibody was created against amino acids 1218 to 1492. This was the same region that Pines lab created their CDK12 antibody 2. Primer 55  PTX3043 and PTXSC001 were used to clone the region from nucleotide 3652 to 4474 resulting in a 822 nucleotide amplicon, which was then inserted into the donor vector V1544 using T4 ligase. The size and sequence was verified by restriction mapping by PacI and AscI (Figure 5.7).  Figure 5.7 Restriction digest of C-terminal domain CDK12 with PacI and AscI. Ran on 0.8% agarose gel stained with 0.0001% Sybr Green. The upper band at ~5kb is the V1544 and the lower band ~0.8kb is the CTD CDK12. The lanes correspond to different clones.  The antigen insert containing V1544 was named CTD CDK12. BL21RP cells transformed with CTD CDK12 were plated on LB with carbenicillin plates for selection. From the selection plate, 2 to 3 colonies were pooled together for protein expression. When the culture optical density read 0.5 on 600nm, IPTG and arabinose were added to induce transcription and subsequent protein translation. After collecting the sample every 56  hour for 6 hours, it was determined that the protein expression level was at its maximum at 2 hours post-induction (Figure 5.8) by western blot.  Figure 5.8 Western blot of optimization of GST-CTD CDK12 protein expression level postinduction. Two different clones were used to express GST-CDK CDK12: 4-2 and 4-3. Samples were taken out every hour for 6 hours. Samples were lysed by freeze-thaw and sonication. Whole lysate was run on 8%-12% Nu-Page gel. For western blot analysis, anti-GST antibody was used to detect GST-tagged CTD CDK12, followed by anti-rabbit antibody  The three clones (4-1, 4-2, 4-3) expressing CTD CDK12 were harvested at 2 hours postinduction and lysed for protein extraction. Since the protein was tagged with glutathione S-transferase (GST), I used a GST column on a fast protein liquid chromatography (FPLC) system to purify CTD CDK12.The protein concentration of each fraction was determined by Bradford assay. For the fractions collected, 1µg or the maximum well loading volume was loaded onto SDS-PAGE for Coomassie blue staining (Figure 5.9a) or for western blot (Figure 5.9b). The fractions used for CTD CDK12 detection for colony 4-1 were A3, A4, A5, A11 and the flowthru; for colony 4-2 fractions B1, C1, C2 and flow-through (FT); and for colony 4-3 fractions D11, D10, D9, D9 and flowthru, as 57  these had most abundant protein concentration. For the western blot, the membrane was probed with anti-GST and with the anti-rabbit secondary antibody IR800. For both types of detection, GST-CTD CDK12 was detected at ~50kDa as expected, but there were also degraded or truncated forms of GST-CTD CDK12. The flowthru contained the proteins from entire cell lysate. Fractions containing the purified CTD-CDK12 were sent to a vendor to produce rabbit anti-CDK12 antibody sera.  58  a)  b)  Figure 5.9 Analysis of FPLC column fractions for CDK12 antigen expression. Each fraction was run on 8%-12% NuPage gel and stained with a) Coomassie blue or b) detected for GST-CTD CDK12 by western blot using anti-GST. The fraction number is as indicated and flowthru is indicated by FT.  We received the sera from the vendor and tested for their ability to detect CDK12 by western blot. Indeed, the sera containing CDK12 antibody successfully detected all the mutants that I created (Figure 5.6). The antibody sera is now available for use for western blot. Further purification of the CDK12-antibody will be required for use in IP and/or splicing assay.  59  5.5  CDK12 study discussions  CDK12 has two primary domains, the kinase domain and the RS domain. The RS domain, which is commonly found in splicing factors, play roles in protein-protein binding25,26 and the kinase domain of CDKs can phosphorylates itself or other protein substrates 40. CDK12 was previously shown to affect alternative splicing 13 and the kinase domain can phosphorylate the C-terminal domain (CTD) of RNA polymerase II during transcription 9. Here, I wanted to determine if kinase domain of CDK12 played a role in alternative splicing. To do this, different kinase mutant forms of CDK12 had to be made. WT CDK12 was created so that it can be used as a positive control. The kinase-dead (KD) CDK12 was created by site-directed mutagenesis by previous students in the Morin lab. The KD CDK12 had two different mutation sites – one in amino acid K756R where ATP-binding site resides and other in amino acid D859A, which is in the active site. These mutations cause loss of kinase activity in CDKs and caused CDK12 to lose its ability to phosphorylate substrates (Morin lab). The kinase deleted (ΔK) CDK12 was created by cloning the region before and after the kinase domain and ligating the two regions together (Figure 5.1). Although KD CDK12 will show if the kinase activity is required for regulating AS, ΔK CDK12 will show if CDK12 can act like an SR protein 25. By having kinase-dead and kinase-deleted, it would be possible to test if the kinase activity of CDK12 affects alternative splicing or if the presence of kinase or RS domain is important for regulating alternative splicing. To develop the CDK12 protein reagents for an in vitro splicing assay, Sf9 cells were transfected with CDK12 mutants (Figure 5.1). Exponentially growing Sf9 were used (Figure 5.4) for transfections, since transfection is most efficient when they are actively 60  growing. All three different forms of CDK12 expressed very well, with the exception of pIEX9 KD CDK12 (Figure 5.5). So, unless a C-terminal his-tag on CDK12 is required, N-terminal GST-tagged pIEX2 KD CDK12 is ready for future experiments. In mammalian cells, all three CDK12 expressed well (Figure 5.6). Also, for both mammalian and insect cell lines, kinase deleted (KO) CDK12 had higher expression levels than the kinase domain included versions suggesting that the lack of kinase domain may facilitate better transgene expression.  5.6 CDK12 study conclusions In this study, three different mutant of CDK12 were successfully constructed for expression in both mammalian and insect cell lines. These three forms of CDK12 can be used in future experiments to assess functional role of the kinase domain of CDK12 in alternative splicing assay and also to determine whether or not kinase domain plays a role in protein – protein interaction of CDK12. The CDK12 antibody created could detect the three different types of CDK12 in western blot. However, for its further use in assays such as in vitro alternative splicing assay and immunoprecipitation – mass spectrometry, the CDK12 antibody containing sera needs to be purified.  61  6  Development of alternative splicing assay  Overview To test the effect of CDK12 mutants on alternative splicing (AS), a splicing assay was developed using the adenovirus E1A mini-gene. The E1A mini-gene has five different 5’ splice sites resulting in five different isoforms. Initially, I wanted to develop a in vitro splicing assay but realized that it was not feasible given time the constraints. So, I decided to develop an in vivo assay. Depleting the CDK12 protein for in vitro splicing would have been with CDK12 antibody I helped develop (created in section 5.4). For the in vivo assays, I needed a method to knock-down endogenous CDK12 expression; this was done by siRNA transfection. CDK12 siRNAs were already designed and confirmed previously by a co-op student in the lab. I also wanted to test CDK13 and its PPIs interaction (Section 4: Chapter 1) in the alternative splicing assay. Hence, I designed siRNAs that would knock-down CDK13 and its PPIs. Then, I optimized the E1A minigene spicing assay, which is now ready for use. For the CDK12 study, CDK12 was knocked-down and rescued by one of the CDK12 mutants. For CDK13 study, CDK13 and/or the PPI of interest would be knocked-down and then rescued or just overexpressed. I was able to optimize the splicing assay but was unable to obtain reproducible results for the affects of CDK12 and CDK13 on alternative splicing. This chapter presents the results of the splicing assay development.  6.1 siRNA knock-down To study the effect of CDK12 mutants on AS and CDK13 PPI interactions on AS, knockdown of endogenous CDK12, CDK13 and its PPIs was required. I designed two siRNAs 62  for each gene that targeted regions in the 3’ UTR. This design allowed for the ectopic reexpression of the protein in the absence of the endogenous protein. Once I confirmed that endogenous protein expression was decreased, I transfected HEK293A cells with appropriate plasmid to rescue the expression of the gene and determined if there were any changes to the alternative splicing pattern. Two different siRNAs were designed to the 3’ UTR for each gene and were transfected individually or mixed using three different transfection reagents: X-treme gene, polyethylenimine (PEI), and Lipofectamine 2000 RNAiMaxx. X-treme gene transfection reagents knocked down the expression of CDK13, PRP19 and RBM25. The other reagents were not efficient in knocking-down gene expression ( Figure 6.1). The siRNAs CDK13_5284, RBM25_3378, and PRP19_2117 were successful in decreasing the expression levels. CDC5L siRNAs were tested later on only with X-treme gene, but did not get effective knock-down.  63  Figure 6.1 siRNA transfection of interacting proteins using different transfection reagents. Blue: X-treme Gene. Red: PEI. Green: Lipo2000 RNAiMaxx. The relative expression was measured using ∆∆CT.  64  6.2 E1A mini-gene splicing assay The study was designed to test the effect of CDK12 mutants and effect of CDK13 and its PPIs on alternative splicing using the E1A mini-gene splicing assay. Although there are other splicing substrates, I choose E1A because previous studies have shown that E1A can be regulated by CDK13 and CDK12. Measuring the expression level of different splice isoforms of the E1A mRNA will determine any changes in the AS pattern. The mRNA was extracted from samples transfected with the appropriate genes, and cDNA was synthesized from the mRNA. Then, the cDNA was used as a template in a PCR reaction to amplify E1A mRNA isoforms. The amplified E1A products were run on polyacrylamide gel and measured with Fuji Multi-gauge software to quantify the levels of each isoform product. 6.2.1 Optimization E1A mini-gene has 5 different splice sites and through alternative splicing, 5 isoform exists. From the literatures it is known that the 11S and 10S isoforms are not abundant and hard to detect, whereas 13S, 12S and 9S are more abundant. I designed primers to the 1st and 6th exons of E1A, with these primers all 5 isoforms can be amplified by one PCR reaction. I optimized the number of PCR cycles to determine when the most abundant isoform became saturated. Samples for PCR cycles from 18 cycles to 35 cycles were obtained and ran on 1.5% agarose gel (Figure 6.3). The most abundant isoform was 13S and it became saturated at 25 cycles (Figure 6.4). Therefore, I selected 25 as the maximum cycle number used for the splicing assay.  65  Another optimization performed was to determine the time of harvest post-E1A transfection. Adenovirus E1A mini-gene is known to express differentially depending on the stage of the virus infection. To determine if this also holds true for my transfection protocols, I harvested the E1A transfected cells at different time-point ranging from 0 – 8 hours and then at 24hours (Figure 6.5). 48 hours was skipped since the previous transfections were done at 48 hour. The different isoforms of E1A started expressing at the 7 hour point and at 24 hours, all 5 forms were present with minimum levels of the unspliced form. When each sample was subjected to 25 PCR cycles, I saw that unlike the previous data at 48 hours (Figure 6.3), 12S was more abundant than 13S but no other differences were observed. Since the cells have to undergo multiple transfections – siRNA transfection, protein cDNA construct transfection, and E1A transfection - I decided to harvest the cells 24 hours post – E1A transfections for the splicing assay.  66  Figure 6.2. E1A mini-gene. Depicted is a figure of the E1A mini-gene with its known splice sites. There are 5 different spliced isoform that give rises to 5 different isoform: 13S, 12S, 11S, 10S and 9S.  67  Figure 6.3 PCR cycle number optimization for E1A. Samples were analyzed on a 1.5% agarose gel ran for 1hr at 100V. Five different E1A isoforms are labeled by the arrow. From top, unspliced, 13S, 12S, 11S, 10S, and 9S  Figure 6.4. PCR cycle number quantified using Fuji MultiGauge. The density minus background per area ((Q-B)/pixel2) value was used to calculate the density for three most abundant spliced isoforms: 13S, 12S and 9S.  68  Figure 6.5. Post-transfection harvest time optimization. Samples were analyzed on a 1.5% agarose gel, stained with 0.0001% Sybr Green. E1A transfected cells were harvested at indicated times to determine the optimal harvest time. Different isoforms of spliced E1As are indicated by the arrows. From top, unspliced, 13S, 12S, 10S, and 9S  6.2.2 CDK12 splicing assay To test the effect of CDK12 mutants on alternative splicing, on consecutive days the endogenous CDK12 was knocked down using siRNAs in HeLa cells, followed by rescue with CDK12 mutant transgenes, and finally E1A mini-gene transfection on the third day. This assay can show if kinase activity of CDK12 is required for CDK12’s function in AS by using the kinase dead CDK12, or if CDK12 can act like a SR protein in AS by using the kinase deleted CDK12. On the 4th day of the experiment, mRNA was extracted from the sample and cDNA was synthesized. Then, E1A and GAPDH were amplified by PCR. GAPDH was run as a control for loading and quantification. Through gel analysis and quantification, neither the KD CDK12 nor the KO CDK12 affected AS (Figure 6.6 and Figure 6.7). However, qPCR showed that the CDK12 knock-down was not efficient 69  (results not shown) and the GAPDH loading was not consistent, therefore no conclusions could be drawn for the effect of CDK12 on AS.  GADPH Figure 6.6 CDK12 E1A mini-gene splicing assay. The PCR products were analyzed on 6% native acrylamide gel and stained with 0.0001% Sybr Green. Knock down of CDK12 and rescue by different forms of CDK12s in HeLa cells. cDNA was synthesized from mRNA extraction. cDNA was used as the template for amplification of E1A products using PCR at 25 cycles.  70  Figure 6.7 Quantification of the CDK12 effect on alternative splicing. Quantitation of the depletion and rescue study of CDK12 as quantified using Fuji MultiGauge.  6.3 CDK13 splicing assay In order to determine if the interaction of CDK13 and its PPIs (Section 4: Chapter 1) affected alternative splicing, the E1A mini-gene splicing assay was used. There are few ways to explore the role of these proteins: over-expression, knock-down, and knockdown and rescue experiments. Initially, I assessed the effect of each CDK13 interactions – CCNK, RBM25, CDC5L, PRP19 and CDC5L/PRP19 by overexpression. However, later realizing that CCNK is needed to activate CDK13, the transfections were repeated by adding CCNK to all the transfections. This experiment was designed to show the importance of each PPI interaction with CDK13 on AS. From the initial experiment where CDK13 was transfected with individual PPIs, most did not show much affect of the splicing pattern, except the interaction of CDK13/CDC5L/PRP19. The overexpression of three proteins partially inhibited the splicing of E1A (Figure 6.8). To ensure other interactions did not affect alternative 71  splicing, each band was quantitated with densitometry and normalized against GADPH (Figure 6.9). Other than the potential CDK13, CDC5L, PRP19 overexpression result that partially inhibited splicing, no other conclusions could be made.  Figure 6.8. CDK13 and PPI overexpression E1A mini-gene splicing assay. CDK13 and its PPI were overexpressed in HeLa cells with E1A. cDNA was synthesized from mRNA extraction. cDNA was used as the template for amplification of E1A products using PCR at 23 cycles. The PCR products were analyzed on 6% native acrylamide gel and stained with 0.0001% Sybr Green.  72  Figure 6.9. Quantification of E1A splicing assay. Quantitated data of CDK13 and PPI overexpression using FujiFilm Multigauge densitometry. All values were normalized against GADPH. All values are normalized against GAPDH.  6.3.1 Restoration of normal splicing activity with CDK13/CCNK CDKs require an interacting cyclin for full kinase activity. The previous data showed that overexpression of CDK13, PRP19 and CDC5L inhibited splicing. However, it was without the co-expression of CCNK – CDK13’s interacting cyclin. In these experiments, I overexpressed the PPI with CDK13 and CCNK, or just the PPI by itself to see an effect on AS. Unfortunately, the assay did not amplify the 9S product, the isoform that is most sensitive to splicing. Although there is no significant difference between the splicing activities, there was splicing of E1A isoforms when PRP19/CDC5L with or without CDK13/Cyclin K was overexpressed (Figure 6.10). The overall results 73  show that when the PPIs are overexpressed without CDK13/CCNK, there is an overall decrease in different isoforms and the splicing pattern returns to normal when CDK13/CCNK is co-expressed with the PPIs.  Figure 6.10 CDK13/CCNK E1A mini-gene splicing assay. CDK13/CCNK and its interacting proteins were overexpressed in HeLa cells with E1A. cDNA was synthesized from mRNA extraction. cDNA was used as the template for amplification of E1A products using PCR at 23 cycles. The PCR products are run on 6% acrylamide gel and stained with 0.0001% Sybr Green.  74  Figure 6.11 Quantification of E1A splicing assay with overexpressed PPI and CDK13/CCNK. Quantification of E1A splicing assay when CDK13/CCNK and PPI are overexpressed using FujiFilm Multigauge densitometry. All values are normalized against GAPDH.  75  6.4 Alternative splicing discussion For the splicing assay, the E1A mini gene was used. Since the single set of primer was designed to detect all 5 different isoforms, it was important to optimize the protocol to prevent any bias when quantifying the amount of the different isoforms. The most abundant isoform, 13S at 48 hours post-transfection started to plateau in its intensity after 25 cycles, so the cycles were performed at a maximum of 25 cycles. Optimization of harvesting time was also done to measure time dependent – expression levels of each isoform. During adenovirus infection, 13S and 9S were shown to express abundantly during the initial stage of virus replication and during the lytic stage 41. In this study we harvested the cells at 10 different time-points to determine the optimal harvesting time. E1A gene starts to express at 7 hours post-transfection and the expression level does not seem to differ between 24 hour (Figure 6.5 lane 10) and 48 hour (Figure 6.4 lane 4). Therefore, the experiments were performed by harvesting the cells 24 hours post-E1A transfection and setting the PCR cycle to either 23 cycles or 25 cycles.  6.5 CDK12 AS study discussion Splicing and transcription is believed to be a coupled simultaneous reaction. Recent studies have shown that CDK12 phosphorylates the CTD RNA Polymerase II 9 and CDK12 affects alternative splicing (AS) 13. Based on these results, it can be inferred that CDK12 is a protein that affects this coupled reaction. We know that kinase domain, which can phosphorylate its substrates, is active against CTD of RNA polymerase II and affects transcription. Yet studies did not show if the kinase domain played a role in splicing. Since splicing is also a process of constant interaction and remodelling of many SR proteins and splicing factors that each have phosphorylation sites, I hypothesized that 76  an active kinase domain of CDK12 would be required for CDK12s role in alternative splicing. The three CDK12 mutants were designed for this study – wild-type (WT or FL), kinase-dead (KD) and kinase-deleted (ΔK or KO). First, endogenous CDK12 expression was knocked down via siRNA transfection. Then, the cells were rescued with one of the three forms of CDK12. Potentially, the wild-type CDK12 will restore the cells normal splicing activity, kinase-dead will show if the kinase domain is required for splicing and the kinase-deleted CDK12 will show if CDK12, a CDK with RS domain, can act like an SR protein in regulating AS. Despite the initially achieving endogenous knock-down of CDK12, there were no changes observed in splicing activity. This made it difficult to determine of KD CDK12 or ΔK CDK12 affected splicing. However, further analysis showed that the endogenous knock-down of CDK12 was not effective (results not shown), so the rescue with CDK12 mutants nor the siRNA knock-down sample would not have affected AS. In future experiments, ensuring endogenous CDK12 is knockeddown will be essential. Simultaneous knock-down of endogenous CDK13 should be considered since CDK12 and CDK13 are very similar to each other in respect to its structure and may be functionally redundant (Figure 1.2).  6.6 CDK13 AS study discussion The CDK13 interaction study presented in the earlier chapter of this thesis, showed that CDK13 interacts with splicing factors. Since, previous papers have shown the CDK13 plays a role in alternative splicing 4,7,11, I wanted to see the effect of these interactions in the context of alternative splicing. There were several ways to test this: 1. Overexpression of CDK13 and its protein-protein interactors (PPI); 2. Knock-down of CDK13 and its PPIs; 3. Knock-down and rescue of CDK13 and its PPIs. Assessing the E1A mini77  gene pattern on these individual assays would provide information on whether or not CDK13’s interaction with PPI is important for alternative splicing regulation. Before I could perform these assays, I created a method to knock-down the gene expression of CDK13, CCNK and the interacting splicing factors: RBM25, CDC5L and PRP19. Two different siRNAs were designed for each gene (Appendix 5). The method to detect siRNA knock-down efficiency was through measuring mRNA level by RT-qPCR. The siRNA transfection successfully knocked-down the gene of interest, and siRNAs were ready for future assays. For the over-expression splicing assay, splicing factors were over-expressed with or without CDK13 and/or CCNK. The initial splicing assay consisted of overexpression of CDK13 with its individual PPI. The results showed that most interactions between CDK13 and each PPI did not affect splicing (Figure 6.8). However, an interesting result was observed when CDK13/PRP19/CDC5L were overexpressed, only the 9S product was produced and there was a high level of unspliced precursor. This might have been due the presence of inactive CDK13 in the cytoplasm. To see the effect of CCNK on the CDK13/PRP19/CDC5L result the four proteins were overexpressed together. The results showed that all three isoforms of E1A were present. However, this was done in a separate experiment than the CDK13/PRP19/CDC5L alone overexpression. The CDK13/PRP19/CDC5L alone overexpression was not repeated and firm conclusions could not be made. Although I cannot draw any conclusions regarding PRP19/CDC5L interaction with CDK13, the overall consensus suggests that CDK13/CCNK is required for normal 78  alternative splicing activity (Figure 6.11). When the splicing factors are over-expressed without CDK13/CCNK, there was an overall decrease in E1A isoforms. However, when CDK13/CCNK was overexpressed with the splicing factors, the normal splicing activity was rescued. This implied that active CDK13 may play an importance role in regulating alternative splicing and transcription. SR family proteins have been implicated in alternative splicing by various ways: protein-protein interaction, RNA binding, roles in splice-site choices, exon splicing enhancer (ESE) binding. Although I am not sure about the mechanism behind CDK13’s ability to affect alternative splicing, the two domains of CDK13, the kinase domain and RS domain, may play a role in splicing regulation and further experimentation is required.  79  6.7  Alternative splicing assay conclusion and future experiments  In this chapter, I described experiments that developed the reagents and assays to study the roles of CDK12, CDK13 and their interacting proteins in alternative splicing. I first made the antigen for CDK12, which was used to produce a CDK12 antibody. Although this polyclonal antibody needs to be purified for further uses in IP, the polyclonal antibody can be used to detect CDK12 in western blots. In preparation for an assay to test for a role of CDK12 alternative splicing I created three CDK12 mutants: wild-type, kinase dead, and kinase deleted CDK12. These were made and tested for expression in insect cells for use in a in vitro splicing assay or in mammalian cells for a in vivo splicing assay. In future studies using the in vivo assay while the knock-down of endogenous CDK12 is essential the knock-down of CDK13 may also be required. . For measuring CDK13 alternative splicing using the E1a mini-gene in vivo assay, there are still many optimizations that are required. Although the number of PCR cycle and when to harvest E1A was determined, other aspects of experiments, such as determining the best transfection efficiency when there are more than 3 plasmids, the amount of total plasmid that can be transfected without being too toxic, and optimizing the protocol using 6-well or 10cm plate rather than 24-well plates in order to have enough sample to determine the protein level in western blot. The CDK13 and PPI overexpression suggested that CDK13/CCNK was important in regulating alternative splicing, but knock-down of CDK13 and its PPIs, and knock-down and rescue experiments are still required to get a better idea of their role in regulating AS. 80  7  Conclusion  In this thesis, I investigated two hypotheses. The first primary hypothesis was CDK13 interacts with splicing factors. I have successfully identified and validated CDK13 protein-protein interacting partners by IP-MS and IP-WB approaches. These results led to my secondary hypothesis: the interaction of CDK13 and splicing factors, identified above, modulates alternative splicing. In order to investigate my secondary hypothesis, an alternative splicing assay needed to be developed. This assay would also be used to address another secondary hypothesis: the kinase domain of CDK12 modulates alternative splicing. During my thesis I successfully developed an Adenovirus E1A minigene splicing assay. While unable to address the secondary hypotheses the assay and the preliminary work for these experiments have been performed and they are ready for use by other scientists in the Morin lab. This project has enabled future investigations: 1) Since the many of the interaction partners of CDK12 were never validated, the methods and insights gained in validating the CDK13 interactions can be applied to validating the CDK12 interactions; 2) Some of the assays needed to investigate the role of CDK13 and CDK12 and their interaction partners in alternative splicing are now in place; 3) Similarly, the assays and reagents needed to assess the role of CDK12’s kinase domain on alternative splicing have been prepared. Future studies on CDK13 and CDK12 using, in part, the results and the assays developed in my thesis project, will provide insights on the roles of these CDKs in alternative  81  splicing and on the bigger picture of the mechanisms and regulation of alternative splicing in general.  82  Bibliography 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16.  Malumbres, M. & Barbacid, M. Mammalian cyclin-dependent kinases. Trends in Biochemical Sciences 30, 630–641 (2005). Ko, T. K., Kelly, E. & Pines, J. CrkRS. Journal of cell science 114, 2591–2603 (2001). Blazek, D. et al. The Cyclin K/Cdk12 complex maintains genomic stability via regulation of expression of DNA damage response genes. Genes & Development 25, 2158–2172 (2011). Chen, H.-H., Wong, Y.-H., Geneviere, A.-M. & Fann, M.-J. CDK13/CDC2L5 interacts with L-type cyclins and regulates alternative splicing. Biochemical and Biophysical Research Communications 354, 735–740 (2007). Lapidot-Lifson, Y. et al. Cloning and antisense oligodeoxynucleotide inhibition of a human homolog of cdc2 required in hematopoiesis. Proceedings of the National Academy of Sciences of the United States of America 89, 579 (1992). Marqués, F. et al. A New Subfamily of High Molecular Mass CDC2-Related Kinases with PITAI/VRE Motifs. Biochemical and Biophysical Research Communications 279, 832–837 (2000). Even, Y. et al. CDC2L5, a Cdk-like kinase with RS domain, interacts with the ASF/SF2-associated protein p32 and affects splicing in vivo. J. Cell. Biochem. 99, 890–904 (2006). Loyer, P. et al. Characterization of Cyclin L1 and L2 Interactions with CDK11 and Splicing Factors. Journal of Biological Chemistry 283, 7721–7732 (2008). Bartkowiak, B. et al. CDK12 is a transcription elongation-associated CTD kinase, the metazoan ortholog of yeast Ctk1. Genes & Development 24, 2303–2316 (2010). Tsang, H. T. H. et al. A systematic analysis of human CHMP protein interactions: Additional MIT domain-containing proteins bind to multiple components of the human ESCRT III complex. Genomics 88, 333–346 (2006). Berro, R. et al. CDK13, a New Potential Human Immunodeficiency Virus Type 1 Inhibitory Factor Regulating Viral mRNA Splicing. Journal of Virology 82, 7155– 7166 (2008). Chepelev, I. Methods in Molecular Biology. 815, 91–102 (Springer New York: New York, NY, 2011). Chen, H. H., Wang, Y. C. & Fann, M. J. Identification and characterization of the CDK12/cyclin L1 complex involved in alternative splicing regulation. Molecular and Cellular Biology 26, 2736 (2006). Jung, S. Y. Proteomic Analysis of Steady-State Nuclear Hormone Receptor Coactivator Complexes. Molecular Endocrinology 19, 2451–2465 (2005). Haverty, P. M. et al. High-resolution genomic and expression analyses of copy number alterations in breast tumors. Genes Chromosom. Cancer 47, 530–542 (2008). Henry, J., Nicholson, S. & Farndon, J. Measurement of oestrogen receptor mRNA levels in human breast tumours. British journal of … (1988). 83  17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35.  Iorns, E., Martens-de Kemp, S. R., Lord, C. J. & Ashworth, A. CRK7 modifies the MAPK pathway and influences the response to endocrine therapy. Carcinogenesis 30, 1696–1701 (2009). Staley, J. P. & Guthrie, C. Mechanical devices of the spliceosome: review motors, clocks, springs, and things. Cell 92, 315–326 (1998). Wahl, M. C., Will, C. L. & LUhrmann, R. The Spliceosome: Design Principles of a Dynamic RNP Machine. Cell 136, 701–718 (2009). Makarova, O. V. et al. A subset of human 35S U5 proteins, including Prp19, function prior to catalytic step 1 of splicing. The EMBO Journal 23, 2381–2391 (2004). Johnson, J. M. et al. Genome-wide survey of human alternative pre-mRNA splicing with exon junction microarrays. Science 302, 2141–2144 (2003). Matlin, A. J., Clark, F. & Smith, C. W. J. Understanding alternative splicing: towards a cellular code. Nat Rev Mol Cell Biol 6, 386–398 (2005). Venables, J. P. et al. Identification of Alternative Splicing Markers for Breast Cancer. Cancer Research 68, 9525–9531 (2008). Valcárcel, J. & Green, M. R. The SR protein family: pleiotropic functions in premRNA splicing. Trends in Biochemical Sciences 21, 296–301 (1996). Tacke, R. & Manley, J. L. Determinants of SR protein specificity. Current opinion in cell biology 11, 358–362 (1999). R J Nagel, A. M. L. A. M. Z. Specific binding of an exonic splicing enhancer by the pre-mRNA splicing factor SRp55. RNA 4, 11 (1998). Stamm, S. Regulation of Alternative Splicing by Reversible Protein Phosphorylation. Journal of Biological Chemistry 283, 1223–1227 (2007). Tarn, W. et al. Functional association of essential splicing factor (s) with PRP19 in a protein complex. The EMBO Journal 13, 2421 (1994). Ajuh, P. et al. Functional analysis of the human CDC5L complex and identification of its components by mass spectrometry. The EMBO Journal 19, 6569–6581 (2000). Tsai, W., Chow, Y., Chen, H. & Huang, K. Cef1p is a component of the Prp19passociated complex and essential for pre-mRNA splicing. Journal of Biological … (1999). Chan, S. P. The Prp19-associated Complex Is Required for Specifying Interactions of U5 and U6 with Pre-mRNA during Spliceosome Activation. Journal of Biological Chemistry 280, 31190–31199 (2005). David, C. J., Boyne, A. R., Millhouse, S. R. & Manley, J. L. The RNA polymerase II C-terminal domain promotes splicing activation through recruitment of a U2AF65-Prp19 complex. Genes & Development 25, 972–983 (2011). Ajuh, P. Identification of peptide inhibitors of pre-mRNA splicing derived from the essential interaction domains of CDC5L and PLRG1. Nucleic Acids Research 31, 6104–6116 (2003). Ajuh, P. A Direct Interaction between the Carboxyl-terminal Region of CDC5L and the WD40 Domain of PLRG1 Is Essential for Pre-mRNA Splicing. Journal of Biological Chemistry 276, 42370–42381 (2001). Fortes, P. et al. Identification and characterization of RED120: A conserved PWI domain protein with links to splicing and 3′-end formation. FEBS Letters 581, 84  36. 37. 38. 39. 40. 41.  44.  3087–3097 (2007). Zhou, A., Ou, A. C., Cho, A., Benz, E. J. & Huang, S. C. Novel Splicing Factor RBM25 Modulates Bcl-x Pre-mRNA 5' Splice Site Selection. Molecular and Cellular Biology 28, 5924–5936 (2008). Grote, M. et al. Molecular Architecture of the Human Prp19/CDC5L Complex. Molecular and Cellular Biology 30, 2105–2119 (2010). Birney, E., Kumar, S. & Krainer, A. R. Analysis of the RNA-recognition motif and RS and RGG domains: conservation in metazoan pre-mRNA splicing factors. Nucleic Acids Research 21, 5803–5816 (1993). Chan, S. P. The Prp19p-Associated Complex in Spliceosome Activation. Science 302, 279–282 (2003). K A Won, S. I. R. Activation of cyclin E/CDK2 is coupled to site-specific autophosphorylation and ubiquitin-dependent degradation of cyclin E. The EMBO Journal 15, 4182 (1996). Gattoni, R., Schmitt, P. & Stevenin, J. In vitro splicing of adenovirus E1A transcripts: characterization of novel reactions and of multiple branch points abnormally far from the 3′ splice site. Nucleic Acids Research 16, 2389–2409 (1988). Grainger and Beggs. Prp8 protein: At the heart of the spliceosome. RNA 11, 533557 (2005).  85  Appendices Appendix 1  20110314, MS0158_GFP_CDK13 minus ctrl  Accession  Ion Score  Mass  Unique  Discrete  Total  sp|Q14004|CDK13_HUMAN  4522.4  165.6  74  74  355  Description Cell division protein kinase 13 OS=Homo sapiens GN=CDK13 PE=1 SV=2  sp|P78527-2|PRKDC_HUMAN  2089.5  470.2  47  47  64  Isoform 2 of DNA-dependent protein kinase catalytic subunit OS=Homo sapiens GN=PRKDC  sp|P07900|HS90A_HUMAN  1189.4  85  24  24  27  sp|Q08211|DHX9_HUMAN  852.2  142.2  19  19  23  967  91.3  19  19  23  sp|P62424|RL7A_HUMAN  934.4  30.1  18  18  23  sp|P68363|TBA1B_HUMAN  903.2  50.8  17  17  24  sp|P12956|XRCC6_HUMAN  931.8  70.1  17  17  19  sp|P23396|RS3_HUMAN  842.5  26.8  17  17  25  sp|P18124|RL7_HUMAN  714.9  29.3  16  16  32  sp|Q13310-2|PABP4_HUMAN  700.5  69.8  15  15  20  sp|Q9BVA1|TBB2B_HUMAN  894.9  50.4  15  15  22  X-ray repair cross-complementing protein 6 OS=Homo sapiens GN=XRCC6 PE=1 SV=2 40S ribosomal protein S3 OS=Homo sapiens GN=RPS3 PE=1 SV=2 60S ribosomal protein L7 OS=Homo sapiens GN=RPL7 PE=1 SV=1 Isoform 2 of Polyadenylate-binding protein 4 OS=Homo sapiens GN=PABPC4 Tubulin beta-2B chain OS=Homo sapiens GN=TUBB2B PE=1 SV=1  sp|O75400-2|PR40A_HUMAN sp|P46781|RS9_HUMAN  692.5  104.5  15  15  16  Isoform 2 of Pre-mRNA-processing factor 40 homolog A OS=Homo sapiens GN=PRPF40A  641.4  22.6  15  15  17  40S ribosomal protein S9 OS=Homo sapiens GN=RPS9 PE=1  sp|Q00839|HNRPU_HUMAN  Heat shock protein HSP 90-alpha OS=Homo sapiens GN=HSP90AA1 PE=1 SV=5 ATP-dependent RNA helicase A OS=Homo sapiens GN=DHX9 PE=1 SV=4 Heterogeneous nuclear ribonucleoprotein U OS=Homo sapiens GN=HNRNPU PE=1 SV=6 60S ribosomal protein L7a OS=Homo sapiens GN=RPL7A PE=1 SV=2 Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1  86  Accession  Ion Score  Mass  Unique  Discrete  Total  Description SV=3  sp|P13010|XRCC5_HUMAN  763.5  83.2  14  14  14  sp|P04350|TBB4_HUMAN  780.9  50  14  14  21  sp|P61247|RS3A_HUMAN  671.5  30.2  14  14  18  sp|P68366|TBA4A_HUMAN sp|O75909|CCNK_HUMAN sp|Q8WZ42-4|TITIN_HUMAN  707.6  50.6  14  14  21  X-ray repair cross-complementing protein 5 OS=Homo sapiens GN=XRCC5 PE=1 SV=3 Tubulin beta-4 chain OS=Homo sapiens GN=TUBB4 PE=1 SV=2 40S ribosomal protein S3a OS=Homo sapiens GN=RPS3A PE=1 SV=2 Tubulin alpha-4A chain OS=Homo sapiens GN=TUBA4A PE=1 SV=1  567.4  64.6  13  13  15  cyclin-K OS=Homo sapiens GN=CCNK PE=1 SV=2  333.1  3742.3  13  13  16  Isoform Soleus of Titin OS=Homo sapiens GN=TTN  sp|Q93008-2|USP9X_HUMAN  452  294.5  13  13  15  Isoform Long of Probable ubiquitin carboxyl-terminal hydrolase FAF-X OS=Homo sapiens GN=USP9X  sp|P09651-2|ROA1_HUMAN  718.9  34.3  13  13  21  sp|P68032|ACTC_HUMAN  603.9  42.3  13  13  19  sp|P62701|RS4X_HUMAN  670.1  29.8  13  13  21  533  106  12  12  14  sp|P49756|RBM25_HUMAN  582.1  100.5  12  12  12  sp|Q02878|RL6_HUMAN  636.9  32.8  12  12  16  sp|Q07955|SRSF1_HUMAN sp|Q9NYV4|CrkRS_HUAMN_6  643.9  27.8  12  12  21  Isoform Btf-l of Bcl-2-associated transcription factor 1 OS=Homo sapiens GN=BCLAF1 RNA-binding protein 25 OS=Homo sapiens GN=RBM25 PE=1 SV=3 60S ribosomal protein L6 OS=Homo sapiens GN=RPL6 PE=1 SV=3 Serine/arginine-rich splicing factor 1 OS=Homo sapiens GN=SRSF1 PE=1 SV=2  728.3  140.8  12  12  56  CrkRS_HumanIsoform6  sp|Q7L2E3-2|DHX30_HUMAN  465.5  137.1  12  12  14  sp|Q16629|SRSF7_HUMAN  511.1  27.6  11  11  24  sp|Q9NYF8-2|BCLF1_HUMAN  Isoform A1-A of Heterogeneous nuclear ribonucleoprotein A1 OS=Homo sapiens GN=HNRNPA1 Actin, alpha cardiac muscle 1 OS=Homo sapiens GN=ACTC1 PE=1 SV=1 40S ribosomal protein S4, X isoform OS=Homo sapiens GN=RPS4X PE=1 SV=2  Isoform 2 of Putative ATP-dependent RNA helicase DHX30 OS=Homo sapiens GN=DHX30 Serine/arginine-rich splicing factor 7 OS=Homo sapiens GN=SRSF7 PE=1 SV=1 87  Accession  Ion Score  Mass  Unique  Discrete  Total  473  75  11  11  15  513.1  17.2  11  11  14  sp|P62241|RS8_HUMAN  623.1  24.5  11  11  15  Serine/threonine-protein kinase SRPK1 OS=Homo sapiens GN=SRPK1 PE=1 SV=2 60S ribosomal protein L26 OS=Homo sapiens GN=RPL26 PE=1 SV=1 40S ribosomal protein S8 OS=Homo sapiens GN=RPS8 PE=1 SV=2  sp|P61254|RL26_HUMAN  sp|P17844|DDX5_HUMAN sp|P07355|ANXA2_HUMAN  619.8  69.6  11  11  15  Probable ATP-dependent RNA helicase DDX5 OS=Homo sapiens GN=DDX5 PE=1 SV=1  561.2  38.8  11  11  17  sp|P62750|RL23A_HUMAN  458.6  17.7  10  10  14  sp|P78362-2|SRPK2_HUMAN  368.8  79.7  10  10  16  sp|Q9UNX3|RL26L_HUMAN  465.4  17.2  10  10  12  sp|P27635|RL10_HUMAN  364.3  25  10  10  14  534  80.1  10  10  19  Isoform 2 of Serine/threonine-protein kinase SRPK2 OS=Homo sapiens GN=SRPK2 60S ribosomal protein L26-like 1 OS=Homo sapiens GN=RPL26L1 PE=1 SV=1 60S ribosomal protein L10 OS=Homo sapiens GN=RPL10 PE=1 SV=4 Isoform 2 of Nucleolar RNA helicase 2 OS=Homo sapiens GN=DDX21  sp|O43143|DHX15_HUMAN  425.4  91.7  10  10  10  Putative pre-mRNA-splicing factor ATP-dependent RNA helicase DHX15 OS=Homo sapiens GN=DHX15 PE=1 SV=2  sp|P78362|SRPK2_HUMAN  357.9  78.2  10  10  15  sp|P15880|RS2_HUMAN  503.1  31.6  10  10  14  sp|Q13247-3|SRSF6_HUMAN  539.4  38.6  10  10  26  sp|P62081|RS7_HUMAN  473.2  22.1  10  10  10  sp|P62906|RL10A_HUMAN  489.6  25  10  10  19  sp|P40429|RL13A_HUMAN  397.6  23.6  9  9  12  sp|Q96SB4|SRPK1_HUMAN  sp|Q9NR30-2|DDX21_HUMAN  Description  Annexin A2 OS=Homo sapiens GN=ANXA2 PE=1 SV=2 60S ribosomal protein L23a OS=Homo sapiens GN=RPL23A PE=1 SV=1  Serine/threonine-protein kinase SRPK2 OS=Homo sapiens GN=SRPK2 PE=1 SV=3 40S ribosomal protein S2 OS=Homo sapiens GN=RPS2 PE=1 SV=2 Isoform SRP55-3 of Serine/arginine-rich splicing factor 6 OS=Homo sapiens GN=SRSF6 40S ribosomal protein S7 OS=Homo sapiens GN=RPS7 PE=1 SV=1 60S ribosomal protein L10a OS=Homo sapiens GN=RPL10A PE=1 SV=2 60S ribosomal protein L13a OS=Homo sapiens GN=RPL13A PE=1 SV=2 88  Accession  Ion Score  Mass  Unique  Discrete  Total  Description  sp|Q9NZI8|IF2B1_HUMAN sp|P16402|H13_HUMAN  422.5  63.8  9  9  11  Insulin-like growth factor 2 mRNA-binding protein 1 OS=Homo sapiens GN=IGF2BP1 PE=1 SV=2  556.9  22.3  9  9  19  sp|P17066|HSP76_HUMAN  438.9  71.4  8  8  15  sp|Q14145|KEAP1_HUMAN  520.5  71.2  8  8  8  sp|Q08170|SRSF4_HUMAN  370.2  56.8  8  8  20  Histone H1.3 OS=Homo sapiens GN=HIST1H1D PE=1 SV=2 Heat shock 70 kDa protein 6 OS=Homo sapiens GN=HSPA6 PE=1 SV=2 Kelch-like ECH-associated protein 1 OS=Homo sapiens GN=KEAP1 PE=1 SV=2 Serine/arginine-rich splicing factor 4 OS=Homo sapiens GN=SRSF4 PE=1 SV=2  sp|Q9Y2W1|TR150_HUMAN sp|P55060-3|XPO2_HUMAN  369.9  108.7  8  8  8  Thyroid hormone receptor-associated protein 3 OS=Homo sapiens GN=THRAP3 PE=1 SV=2  308.8  108.5  8  8  10  sp|P84103|SRSF3_HUMAN  434.6  19.5  8  8  17  sp|P67809|YBOX1_HUMAN  628.9  35.9  8  8  11  sp|Q12905|ILF2_HUMAN  397.7  43.3  8  8  10  sp|Q12906-2|ILF3_HUMAN  345.3  76.4  8  8  9  sp|Q13243|SRSF5_HUMAN  312.6  31.4  8  8  13  Isoform DRBP76 of Interleukin enhancer-binding factor 3 OS=Homo sapiens GN=ILF3 Serine/arginine-rich splicing factor 5 OS=Homo sapiens GN=SRSF5 PE=1 SV=1  sp|P62995-3|TRA2B_HUMAN  425.6  22  8  8  12  Isoform HTRA2-beta3 of Transformer-2 protein homolog beta OS=Homo sapiens GN=TRA2B  sp|P62979|RS27A_HUMAN  337.7  18.3  7  7  25  sp|Q9BQG0-2|MBB1A_HUMAN  323.4  150.2  7  7  8  Ubiquitin-40S ribosomal protein S27a OS=Homo sapiens GN=RPS27A PE=1 SV=2 Isoform 2 of Myb-binding protein 1A OS=Homo sapiens GN=MYBBP1A  sp|Q99729-2|ROAA_HUMAN  321.2  36.1  7  7  8  Isoform 2 of Heterogeneous nuclear ribonucleoprotein A/B OS=Homo sapiens GN=HNRNPAB  sp|O43390-2|HNRPR_HUMAN  319.3  71.5  7  7  9  Isoform 2 of Heterogeneous nuclear ribonucleoprotein R OS=Homo sapiens GN=HNRNPR  Isoform 3 of Exportin-2 OS=Homo sapiens GN=CSE1L Serine/arginine-rich splicing factor 3 OS=Homo sapiens GN=SRSF3 PE=1 SV=1 Nuclease-sensitive element-binding protein 1 OS=Homo sapiens GN=YBX1 PE=1 SV=3 Interleukin enhancer-binding factor 2 OS=Homo sapiens GN=ILF2 PE=1 SV=2  89  Accession  Ion Score  Mass  Unique  Discrete  Total  sp|Q99459|CDC5L_HUMAN  265.1  92.4  7  7  8  sp|P05141|ADT2_HUMAN  298.3  33.1  7  7  7  sp|Q13242|SRSF9_HUMAN  277.3  25.6  7  7  10  sp|P16989|DBPA_HUMAN  476.9  40.1  7  7  10  sp|P18077|RL35A_HUMAN  286.2  12.6  7  7  16  278  21.6  7  7  14  sp|P22626-2|ROA2_HUMAN  348.9  36  7  7  10  sp|Q07020|RL18_HUMAN  436.4  21.7  7  7  15  sp|P30050|RL12_HUMAN  382.3  18  7  7  13  sp|P46779|RL28_HUMAN  352.1  15.8  7  7  13  sp|P46778|RL21_HUMAN  262.6  18.6  6  6  8  sp|Q14568|HS902_HUMAN  238.4  39.5  6  6  6  sp|P62280|RS11_HUMAN  278.9  18.6  6  6  6  sp|P62266|RS23_HUMAN  295.9  16  6  6  10  sp|Q01081|U2AF1_HUMAN  345.8  28.4  6  6  7  sp|O75643|U520_HUMAN  213.8  246  6  6  6  sp|P26373|RL13_HUMAN  345  24.3  6  6  9  sp|P18621|RL17_HUMAN  Description Cell division cycle 5-like protein OS=Homo sapiens GN=CDC5L PE=1 SV=2 ADP/ATP translocase 2 OS=Homo sapiens GN=SLC25A5 PE=1 SV=6 Serine/arginine-rich splicing factor 9 OS=Homo sapiens GN=SRSF9 PE=1 SV=1 DNA-binding protein A OS=Homo sapiens GN=CSDA PE=1 SV=4 60S ribosomal protein L35a OS=Homo sapiens GN=RPL35A PE=1 SV=2 60S ribosomal protein L17 OS=Homo sapiens GN=RPL17 PE=1 SV=3 Isoform A2 of Heterogeneous nuclear ribonucleoproteins A2/B1 OS=Homo sapiens GN=HNRNPA2B1 60S ribosomal protein L18 OS=Homo sapiens GN=RPL18 PE=1 SV=2 60S ribosomal protein L12 OS=Homo sapiens GN=RPL12 PE=1 SV=1 60S ribosomal protein L28 OS=Homo sapiens GN=RPL28 PE=1 SV=3 60S ribosomal protein L21 OS=Homo sapiens GN=RPL21 PE=1 SV=2 Putative heat shock protein HSP 90-alpha A2 OS=Homo sapiens GN=HSP90AA2 PE=1 SV=2 40S ribosomal protein S11 OS=Homo sapiens GN=RPS11 PE=1 SV=3 40S ribosomal protein S23 OS=Homo sapiens GN=RPS23 PE=1 SV=3 Splicing factor U2AF 35 kDa subunit OS=Homo sapiens GN=U2AF1 PE=1 SV=3 U5 small nuclear ribonucleoprotein 200 kDa helicase OS=Homo sapiens GN=SNRNP200 PE=1 SV=2 60S ribosomal protein L13 OS=Homo sapiens GN=RPL13 PE=1 SV=4 90  Accession  Ion Score  Mass  Unique  Discrete  Total  sp|P51991-2|ROA3_HUMAN  205.5  37.2  6  6  9  sp|P82650|RT22_HUMAN  295.3  41.4  6  6  6  sp|P62917|RL8_HUMAN  288.8  28.2  6  6  14  sp|Q9BWF3|RBM4_HUMAN  264.6  40.7  6  6  6  sp|P49207|RL34_HUMAN  294.7  13.5  6  6  9  sp|P62888|RL30_HUMAN  376.5  12.9  6  6  7  sp|Q16543|CDC37_HUMAN  202.3  45  5  5  5  sp|Q9UII4|HERC5_HUMAN  240.5  118.2  5  5  6  sp|P00338|LDHA_HUMAN  193.1  37  5  5  5  sp|Q5QNW6|H2B2F_HUMAN  255.2  13.9  5  5  12  sp|O95232|LC7L3_HUMAN  345.9  51.8  5  5  5  28S ribosomal protein S22, mitochondrial OS=Homo sapiens GN=MRPS22 PE=1 SV=1 60S ribosomal protein L8 OS=Homo sapiens GN=RPL8 PE=1 SV=2 RNA-binding protein 4 OS=Homo sapiens GN=RBM4 PE=1 SV=1 60S ribosomal protein L34 OS=Homo sapiens GN=RPL34 PE=1 SV=3 60S ribosomal protein L30 OS=Homo sapiens GN=RPL30 PE=1 SV=2 Hsp90 co-chaperone Cdc37 OS=Homo sapiens GN=CDC37 PE=1 SV=1 E3 ISG15--protein ligase HERC5 OS=Homo sapiens GN=HERC5 PE=1 SV=2 L-lactate dehydrogenase A chain OS=Homo sapiens GN=LDHA PE=1 SV=2 Histone H2B type 2-F OS=Homo sapiens GN=HIST2H2BF PE=1 SV=3 Luc7-like protein 3 OS=Homo sapiens GN=LUC7L3 PE=1 SV=2  sp|O76021|RL1D1_HUMAN  246.4  55.2  5  5  6  Ribosomal L1 domain-containing protein 1 OS=Homo sapiens GN=RSL1D1 PE=1 SV=3  sp|Q9UQ35|SRRM2_HUMAN  248.7  300.2  5  5  10  Serine/arginine repetitive matrix protein 2 OS=Homo sapiens GN=SRRM2 PE=1 SV=2  sp|P51398|RT29_HUMAN  185.2  45.9  5  5  5  sp|P62910|RL32_HUMAN  314.4  16  5  5  7  sp|P22087|FBRL_HUMAN  217.7  33.9  5  5  7  Description Isoform 2 of Heterogeneous nuclear ribonucleoprotein A3 OS=Homo sapiens GN=HNRNPA3  28S ribosomal protein S29, mitochondrial OS=Homo sapiens GN=DAP3 PE=1 SV=1 60S ribosomal protein L32 OS=Homo sapiens GN=RPL32 PE=1 SV=2 rRNA 2'-O-methyltransferase fibrillarin OS=Homo sapiens GN=FBL PE=1 SV=2  91  Accession  Ion Score  Mass  Unique  Discrete  Total  sp|Q9Y383-2|LC7L2_HUMAN sp|Q99623|PHB2_HUMAN  181.5  46.9  5  5  8  198.2  33.3  5  5  5  sp|Q03001-8|BPA1_HUMAN  125.9  593.8  5  5  6  sp|Q9Y399|RT02_HUMAN  217  33.5  5  5  6  sp|P27348|1433T_HUMAN  205.1  28  5  5  5  sp|P84090|ERH_HUMAN  194.7  12.4  5  5  8  28S ribosomal protein S2, mitochondrial OS=Homo sapiens GN=MRPS2 PE=1 SV=1 14-3-3 protein theta OS=Homo sapiens GN=YWHAQ PE=1 SV=1 Enhancer of rudimentary homolog OS=Homo sapiens GN=ERH PE=1 SV=1  sp|P33993|MCM7_HUMAN  187.6  81.9  5  5  5  DNA replication licensing factor MCM7 OS=Homo sapiens GN=MCM7 PE=1 SV=4  sp|P37108|SRP14_HUMAN  265.2  14.7  5  5  5  Signal recognition particle 14 kDa protein OS=Homo sapiens GN=SRP14 PE=1 SV=2  sp|P38159|HNRPG_HUMAN  236.9  42.3  5  5  5  sp|P83731|RL24_HUMAN  300  17.9  5  5  10  sp|P82675|RT05_HUMAN  204.2  48.5  5  5  5  sp|P62277|RS13_HUMAN  296.2  17.2  5  5  6  sp|P47914|RL29_HUMAN  162.5  17.8  5  5  9  sp|Q9BVP2-2|GNL3_HUMAN  147.5  61  5  5  5  sp|P50914|RL14_HUMAN  302.2  23.5  5  5  8  Isoform 2 of Guanine nucleotide-binding protein-like 3 OS=Homo sapiens GN=GNL3 60S ribosomal protein L14 OS=Homo sapiens GN=RPL14 PE=1 SV=4  sp|Q14103-2|HNRPD_HUMAN sp|P06899|H2B1J_HUMAN  235.3  36.4  5  5  5  Isoform Dx4 of Heterogeneous nuclear ribonucleoprotein D0 OS=Homo sapiens GN=HNRNPD  284.7  13.9  5  5  12  Histone H2B type 1-J OS=Homo sapiens GN=HIST1H2BJ  Description Isoform 2 of Putative RNA-binding protein Luc7-like 2 OS=Homo sapiens GN=LUC7L2 Prohibitin-2 OS=Homo sapiens GN=PHB2 PE=1 SV=2 Isoform EA of Bullous pemphigoid antigen 1 OS=Homo sapiens GN=DST  Heterogeneous nuclear ribonucleoprotein G OS=Homo sapiens GN=RBMX PE=1 SV=3 60S ribosomal protein L24 OS=Homo sapiens GN=RPL24 PE=1 SV=1 28S ribosomal protein S5, mitochondrial OS=Homo sapiens GN=MRPS5 PE=1 SV=2 40S ribosomal protein S13 OS=Homo sapiens GN=RPS13 PE=1 SV=2 60S ribosomal protein L29 OS=Homo sapiens GN=RPL29 PE=1 SV=2  92  Accession  Ion Score  Mass  Unique  Discrete  Total  Description PE=1 SV=3  sp|Q14444-2|CAPR1_HUMAN  181.1  77  5  5  5  sp|Q9BRJ6|CG050_HUMAN sp|P62805|H4_HUMAN  200.6  22.1  4  4  4  212.2  11.4  4  4  5  sp|P62829|RL23_HUMAN  176.3  15  4  4  4  sp|P0C0S8|H2A1_HUMAN  187.9  14.1  4  4  6  sp|Q9NWB6|ARGL1_HUMAN  148.9  33.2  4  4  4  sp|P84085|ARF5_HUMAN  154.4  20.6  4  4  4  152  90.8  4  4  4  sp|P83881|RL36A_HUMAN  190.1  12.7  4  4  4  sp|P11021|GRP78_HUMAN  183.2  72.4  4  4  6  sp|Q9H0A0|NAT10_HUMAN  187.9  116.6  4  4  5  sp|P38919|IF4A3_HUMAN  201.5  47.1  4  4  4  sp|P05783|K1C18_HUMAN  158.9  48  4  4  4  Isoform Isoform b of Heterogeneous nuclear ribonucleoprotein U-like protein 1 OS=Homo sapiens GN=HNRNPUL1 60S ribosomal protein L36a OS=Homo sapiens GN=RPL36A PE=1 SV=2 78 kDa glucose-regulated protein OS=Homo sapiens GN=HSPA5 PE=1 SV=2 N-acetyltransferase 10 OS=Homo sapiens GN=NAT10 PE=1 SV=2 Eukaryotic initiation factor 4A-III OS=Homo sapiens GN=EIF4A3 PE=1 SV=4 Keratin, type I cytoskeletal 18 OS=Homo sapiens GN=KRT18 PE=1 SV=2  sp|Q09666|AHNK_HUMAN  141.4  629.2  4  4  9  Neuroblast differentiation-associated protein AHNAK OS=Homo sapiens GN=AHNAK PE=1 SV=2  sp|P82933|RT09_HUMAN  158.8  46  4  4  4  sp|P08708|RS17_HUMAN  201.8  15.6  4  4  4  28S ribosomal protein S9, mitochondrial OS=Homo sapiens GN=MRPS9 PE=1 SV=2 40S ribosomal protein S17 OS=Homo sapiens GN=RPS17 PE=1 SV=2  sp|P42285|SK2L2_HUMAN  144.3  118.8  4  4  4  Superkiller viralicidic activity 2-like 2 OS=Homo sapiens GN=SKIV2L2 PE=1 SV=3  sp|Q9BUJ2-2|HNRL1_HUMAN  Isoform 2 of Caprin-1 OS=Homo sapiens GN=CAPRIN1 Uncharacterized protein C7orf50 OS=Homo sapiens GN=C7orf50 PE=1 SV=1 Histone H4 OS=Homo sapiens GN=HIST1H4A PE=1 SV=2 60S ribosomal protein L23 OS=Homo sapiens GN=RPL23 PE=1 SV=1 Histone H2A type 1 OS=Homo sapiens GN=HIST1H2AG PE=1 SV=2 Arginine and glutamate-rich protein 1 OS=Homo sapiens GN=ARGLU1 PE=1 SV=1 ADP-ribosylation factor 5 OS=Homo sapiens GN=ARF5 PE=1 SV=2  93  Accession  Ion Score  Mass  Unique  Discrete  Total  sp|P42677|RS27_HUMAN  214.4  9.8  4  4  4  sp|P42766|RL35_HUMAN  186.8  14.5  4  4  6  sp|P82673|RT35_HUMAN  176.6  37.1  4  4  5  sp|P46777|RL5_HUMAN sp|Q92522|H1X_HUMAN  229.2  34.6  4  4  4  238.1  22.5  4  4  7  sp|Q7L7L0|H2A3_HUMAN  184.4  14.1  4  4  6  156  61.2  4  4  4  sp|Q9Y5A9-2|YTHD2_HUMAN  204.8  57  4  4  4  sp|Q6PKG0|LARP1_HUMAN  165.1  123.8  4  4  4  sp|Q92552|RT27_HUMAN  198.9  47.9  4  4  4  sp|Q969Q0|RL36L_HUMAN  170.6  12.7  4  4  4  28S ribosomal protein S27, mitochondrial OS=Homo sapiens GN=MRPS27 PE=1 SV=3 60S ribosomal protein L36a-like OS=Homo sapiens GN=RPL36AL PE=1 SV=3  sp|P63241|IF5A1_HUMAN  174.5  17  4  4  5  Eukaryotic translation initiation factor 5A-1 OS=Homo sapiens GN=EIF5A PE=1 SV=2  sp|O60762|DPM1_HUMAN  181.5  29.7  4  4  4  Dolichol-phosphate mannosyltransferase OS=Homo sapiens GN=DPM1 PE=1 SV=1  sp|Q9UN86-2|G3BP2_HUMAN  164.6  50.8  4  4  4  Isoform B of Ras GTPase-activating protein-binding protein 2 OS=Homo sapiens GN=G3BP2  sp|Q9NQ29-2|LUC7L_HUMAN  163.7  38.8  4  4  7  Isoform 2 of Putative RNA-binding protein Luc7-like 1 OS=Homo sapiens GN=LUC7L  sp|Q9Y3D9|RT23_HUMAN sp|P06493|CDK1_HUMAN  167.9  21.8  4  4  4  28S ribosomal protein S23, mitochondrial OS=Homo sapiens GN=MRPS23 PE=1 SV=2  186  34.1  4  4  12  Cell division protein kinase 1 OS=Homo sapiens GN=CDK1  sp|P51114-2|FXR1_HUMAN  Description 40S ribosomal protein S27 OS=Homo sapiens GN=RPS27 PE=1 SV=3 60S ribosomal protein L35 OS=Homo sapiens GN=RPL35 PE=1 SV=2 28S ribosomal protein S35, mitochondrial OS=Homo sapiens GN=MRPS35 PE=1 SV=1 60S ribosomal protein L5 OS=Homo sapiens GN=RPL5 PE=1 SV=3 Histone H1x OS=Homo sapiens GN=H1FX PE=1 SV=1 Histone H2A type 3 OS=Homo sapiens GN=HIST3H2A PE=1 SV=3 Isoform Short of Fragile X mental retardation syndrome-related protein 1 OS=Homo sapiens GN=FXR1 Isoform 2 of YTH domain family protein 2 OS=Homo sapiens GN=YTHDF2 La-related protein 1 OS=Homo sapiens GN=LARP1 PE=1 SV=2  94  Accession  Ion Score  Mass  Unique  Discrete  Total  Description PE=1 SV=2 DNA topoisomerase 1 OS=Homo sapiens GN=TOP1 PE=1 SV=2 60S ribosomal protein L18a OS=Homo sapiens GN=RPL18A PE=1 SV=2  sp|P11387|TOP1_HUMAN  146.8  91.1  4  4  4  sp|Q02543|RL18A_HUMAN  172.2  21  4  4  4  sp|Q08J23|NSUN2_HUMAN REV_sp|Q8WXX0|DYH7_HUM AN  146.1  87.2  4  4  5  118.2  464.4  4  4  8  sp|P62826|RAN_HUMAN  228.7  24.6  4  4  4  sp|O00425|IF2B3_HUMAN  202.9  64  4  4  4  sp|P18085|ARF4_HUMAN  183.7  20.6  4  4  4  Insulin-like growth factor 2 mRNA-binding protein 3 OS=Homo sapiens GN=IGF2BP3 PE=1 SV=2 ADP-ribosylation factor 4 OS=Homo sapiens GN=ARF4 PE=1 SV=3  211  49.5  4  4  5  Heterogeneous nuclear ribonucleoprotein H2 OS=Homo sapiens GN=HNRNPH2 PE=1 SV=1  161.1  45.6  4  4  4  67.7  532.5  3  3  3  80.4  91.2  3  3  3  74  179.5  3  3  3  Signal transducer and activator of transcription 5A OS=Homo sapiens GN=STAT5A PE=1 SV=1 Nik-related protein kinase OS=Homo sapiens GN=NRK PE=2 SV=2  sp|O00483|NDUA4_HUMAN  103.7  9.4  3  3  3  NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 4 OS=Homo sapiens GN=NDUFA4 PE=1 SV=1  sp|O43809|CPSF5_HUMAN  113.6  26.3  3  3  3  Cleavage and polyadenylation specificity factor subunit 5 OS=Homo sapiens GN=NUDT21 PE=1 SV=1  sp|O60506-2|HNRPQ_HUMAN  105.5  65.9  3  3  4  Isoform hnRNP Q2 of Heterogeneous nuclear ribonucleoprotein Q OS=Homo sapiens GN=SYNCRIP  sp|P55795|HNRH2_HUMAN sp|P31689|DNJA1_HUMAN sp|Q8TE73|DYH5_HUMAN REV_sp|P42229|STA5A_HUMA N REV_sp|Q7Z2Y5|NRK_HUMA N  tRNA (cytosine-5-)-methyltransferase NSUN2 OS=Homo sapiens GN=NSUN2 PE=1 SV=2 Dynein heavy chain 7, axonemal OS=Homo sapiens GN=DNAH7 PE=1 SV=2 GTP-binding nuclear protein Ran OS=Homo sapiens GN=RAN PE=1 SV=3  DnaJ homolog subfamily A member 1 OS=Homo sapiens GN=DNAJA1 PE=1 SV=2 Dynein heavy chain 5, axonemal OS=Homo sapiens GN=DNAH5 PE=1 SV=3  95  Accession  Ion Score  Mass  Unique  Discrete  Total  sp|O75494-3|SRS10_HUMAN  141  22.3  3  3  7  Isoform SRp38-2 of Serine/arginine-rich splicing factor 10 OS=Homo sapiens GN=SRSF10  sp|O75694-2|NU155_HUMAN  138.6  150.5  3  3  3  Isoform 2 of Nuclear pore complex protein Nup155 OS=Homo sapiens GN=NUP155  sp|O95793-2|STAU1_HUMAN  102  55.1  3  3  3  Isoform Short of Double-stranded RNA-binding protein Staufen homolog 1 OS=Homo sapiens GN=STAU1  sp|O95816|BAG2_HUMAN  157.3  23.9  3  3  5  sp|P02533|K1C14_HUMAN  146.1  51.9  3  3  7  sp|P12004|PCNA_HUMAN sp|P20700|LMNB1_HUMAN  108.9  29.1  3  3  3  BAG family molecular chaperone regulator 2 OS=Homo sapiens GN=BAG2 PE=1 SV=1 Keratin, type I cytoskeletal 14 OS=Homo sapiens GN=KRT14 PE=1 SV=4 Proliferating cell nuclear antigen OS=Homo sapiens GN=PCNA PE=1 SV=1  78.6  66.7  3  3  3  Lamin-B1 OS=Homo sapiens GN=LMNB1 PE=1 SV=2  sp|P22061-2|PIMT_HUMAN  156.1  24.8  3  3  3  sp|P22392|NDKB_HUMAN  101.2  17.4  3  3  4  Description  Isoform 2 of Protein-L-isoaspartate(D-aspartate) Omethyltransferase OS=Homo sapiens GN=PCMT1 Nucleoside diphosphate kinase B OS=Homo sapiens GN=NME2 PE=1 SV=1 Elongation factor 1-gamma OS=Homo sapiens GN=EEF1G PE=1 SV=3  sp|P26641|EF1G_HUMAN sp|P35232|PHB_HUMAN  110  50.4  3  3  3  118.7  29.8  3  3  3  sp|P35250-2|RFC2_HUMAN  124.5  35.7  3  3  3  sp|P47756-2|CAPZB_HUMAN  121.5  31  3  3  3  sp|P61204|ARF3_HUMAN  158.9  20.6  3  3  3  sp|P61289-2|PSME3_HUMAN  117.4  31  3  3  3  sp|P61513|RL37A_HUMAN  124.6  10.5  3  3  4  Isoform 2 of Proteasome activator complex subunit 3 OS=Homo sapiens GN=PSME3 60S ribosomal protein L37a OS=Homo sapiens GN=RPL37A PE=1 SV=2  sp|P61619|S61A1_HUMAN  138.8  52.7  3  3  3  Protein transport protein Sec61 subunit alpha isoform 1 OS=Homo sapiens GN=SEC61A1 PE=1 SV=2  Prohibitin OS=Homo sapiens GN=PHB PE=1 SV=1 Isoform 2 of Replication factor C subunit 2 OS=Homo sapiens GN=RFC2 Isoform 2 of F-actin-capping protein subunit beta OS=Homo sapiens GN=CAPZB ADP-ribosylation factor 3 OS=Homo sapiens GN=ARF3 PE=1 SV=2  96  Accession  Ion Score  Mass  Unique  Discrete  Total  sp|P62314|SMD1_HUMAN  132  13.3  3  3  3  176  15.1  3  3  6  sp|P62851|RS25_HUMAN  176.6  13.8  3  3  3  sp|P62854|RS26_HUMAN  133.8  13.3  3  3  4  sp|Q09161|NCBP1_HUMAN  144.5  92.9  3  3  3  Small nuclear ribonucleoprotein Sm D1 OS=Homo sapiens GN=SNRPD1 PE=1 SV=1 Isoform 2 of 40S ribosomal protein S24 OS=Homo sapiens GN=RPS24 40S ribosomal protein S25 OS=Homo sapiens GN=RPS25 PE=1 SV=1 40S ribosomal protein S26 OS=Homo sapiens GN=RPS26 PE=1 SV=3 Nuclear cap-binding protein subunit 1 OS=Homo sapiens GN=NCBP1 PE=1 SV=1  sp|P62847-2|RS24_HUMAN  sp|Q13151|ROA0_HUMAN  173.4  31  3  3  5  Heterogeneous nuclear ribonucleoprotein A0 OS=Homo sapiens GN=HNRNPA0 PE=1 SV=1  199  13  3  3  4  sp|Q14493|SLBP_HUMAN  102.5  31.6  3  3  3  sp|Q53GQ0|DHB12_HUMAN  101.8  34.4  3  3  3  sp|Q7Z739|YTHD3_HUMAN  102.6  63.9  3  3  3  IPI:CON_00131368.3|SWISSPROT:P50446  99.1  59.6  3  3  3  95  83.3  3  3  3  sp|Q9C0C9|UBE2O_HUMAN  107  142.6  3  3  3  sp|Q9H6S0|YTDC2_HUMAN  124.4  161.6  3  3  3  sp|Q9NTZ6|RBM12_HUMAN  90.3  97.6  3  3  3  118.3  75.7  3  3  3  Probable ATP-dependent RNA helicase YTHDC2 OS=Homo sapiens GN=YTHDC2 PE=1 SV=2 RNA-binding protein 12 OS=Homo sapiens GN=RBM12 PE=1 SV=1 ATP-dependent RNA helicase DDX18 OS=Homo sapiens GN=DDX18 PE=1 SV=2  123.4  58.3  3  3  3  Isoform 2 of Poly(U)-binding-splicing factor PUF60 OS=Homo  sp|Q13595-2|TRA2A_HUMAN  sp|Q92499|DDX1_HUMAN  sp|Q9NVP1|DDX18_HUMAN sp|Q9UHX1-2|PUF60_HUMAN  Description  Isoform Short of Transformer-2 protein homolog alpha OS=Homo sapiens GN=TRA2A Histone RNA hairpin-binding protein OS=Homo sapiens GN=SLBP PE=1 SV=1 Estradiol 17-beta-dehydrogenase 12 OS=Homo sapiens GN=HSD17B12 PE=1 SV=2 YTH domain family protein 3 OS=Homo sapiens GN=YTHDF3 PE=1 SV=1 Tax_Id=10090 Gene_Symbol=Krt6a Keratin, type II cytoskeletal 6A ATP-dependent RNA helicase DDX1 OS=Homo sapiens GN=DDX1 PE=1 SV=2 Ubiquitin-conjugating enzyme E2 O OS=Homo sapiens GN=UBE2O PE=1 SV=3  97  Accession  Ion Score  Mass  Unique  Discrete  Total  Description sapiens GN=PUF60  sp|Q9UKD2|MRT4_HUMAN  124.5  27.7  3  3  3  sp|Q9Y224|CN166_HUMAN  111.9  28.2  3  3  3  mRNA turnover protein 4 homolog OS=Homo sapiens GN=MRTO4 PE=1 SV=2 UPF0568 protein C14orf166 OS=Homo sapiens GN=C14orf166 PE=1 SV=1  sp|Q9Y2Q9|RT28_HUMAN  139.6  21  3  3  4  28S ribosomal protein S28, mitochondrial OS=Homo sapiens GN=MRPS28 PE=1 SV=1  sp|Q9Y2R4|DDX52_HUMAN  103.3  67.8  3  3  7  Probable ATP-dependent RNA helicase DDX52 OS=Homo sapiens GN=DDX52 PE=1 SV=3  sp|Q9Y2R9|RT07_HUMAN  135.2  28.2  3  3  3  sp|Q9Y3U8|RL36_HUMAN  142.8  12.3  3  3  6  28S ribosomal protein S7, mitochondrial OS=Homo sapiens GN=MRPS7 PE=1 SV=2 60S ribosomal protein L36 OS=Homo sapiens GN=RPL36 PE=1 SV=3  Appendix 2 20110602_MS0173_CDK13 Nuclear extract minus control Accession  IonScore  Mass  Unique  Discrete  Total  sp|Q14004|CDK13_HUMAN  3267.4  165.6  57  57  139  sp|P08107|HSP71_HUMAN  1095.6  70.3  20  20  25  705  48  16  16  16  sp|Q00839-2|HNRPU_HUMAN sp|P19338|NUCL_HUMAN  737.3 663.6  89.7 76.6  15 15  15 15  18 17  sp|P39023|RL3_HUMAN  661.2  46.4  15  15  16  sp|P62906|RL10A_HUMAN sp|P18124|RL7_HUMAN  550.5 613.8  25 29.3  14 14  14 14  17 14  sp|P36578|RL4_HUMAN  Description Cell division protein kinase 13 OS=Homo sapiens GN=CDK13 PE=1 SV=2 Heat shock 70 kDa protein 1A/1B OS=Homo sapiens GN=HSPA1A PE=1 SV=5 60S ribosomal protein L4 OS=Homo sapiens GN=RPL4 PE=1 SV=5 Isoform Short of Heterogeneous nuclear ribonucleoprotein U OS=Homo sapiens GN=HNRNPU Nucleolin OS=Homo sapiens GN=NCL PE=1 SV=3 60S ribosomal protein L3 OS=Homo sapiens GN=RPL3 PE=1 SV=2 60S ribosomal protein L10a OS=Homo sapiens GN=RPL10A PE=1 SV=2 60S ribosomal protein L7 OS=Homo sapiens GN=RPL7 PE=1 98  Accession  IonScore  Mass  Unique  Discrete  Total  sp|P17844|DDX5_HUMAN  702  69.6  14  14  15  sp|P52272-2|HNRPM_HUMAN  631  73.9  14  14  14  sp|P62701|RS4X_HUMAN  532.6  29.8  13  13  13  sp|Q02878|RL6_HUMAN  589.6  32.8  13  13  16  sp|P61247|RS3A_HUMAN  647.8  30.2  13  13  19  sp|P62424|RL7A_HUMAN  650.1  30.1  13  13  13  sp|P35527|K1C9_HUMAN  687.4  62.3  12  12  30  sp|P07900|HS90A_HUMAN  442.3  85  12  12  12  sp|P46781|RS9_HUMAN IPI:CON_GFP|SWISSPROT:Q9U6Y5  467.9  22.6  12  12  14  674.9  28.2  11  11  73  sp|P62241|RS8_HUMAN  564.3  24.5  11  11  13  sp|P11142|HSP7C_HUMAN  547.5  71.1  11  11  13  sp|P08238|HS90B_HUMAN  406.6  83.6  10  10  10  sp|P26373|RL13_HUMAN  467.7  24.3  10  10  14  sp|O00571|DDX3X_HUMAN  423.4  73.6  10  10  14  430  50.3  9  9  9  335.1  24.2  9  9  9  sp|P68371|TBB2C_HUMAN sp|P61313|RL15_HUMAN  Description SV=1 Probable ATP-dependent RNA helicase DDX5 OS=Homo sapiens GN=DDX5 PE=1 SV=1 Isoform M1-M2 of Heterogeneous nuclear ribonucleoprotein M OS=Homo sapiens GN=HNRNPM 40S ribosomal protein S4, X isoform OS=Homo sapiens GN=RPS4X PE=1 SV=2 60S ribosomal protein L6 OS=Homo sapiens GN=RPL6 PE=1 SV=3 40S ribosomal protein S3a OS=Homo sapiens GN=RPS3A PE=1 SV=2 60S ribosomal protein L7a OS=Homo sapiens GN=RPL7A PE=1 SV=2 Keratin, type I cytoskeletal 9 OS=Homo sapiens GN=KRT9 PE=1 SV=3 Heat shock protein HSP 90-alpha OS=Homo sapiens GN=HSP90AA1 PE=1 SV=5 40S ribosomal protein S9 OS=Homo sapiens GN=RPS9 PE=1 SV=3 Green fluorescent protein (GFP-Cter-HisTag) 40S ribosomal protein S8 OS=Homo sapiens GN=RPS8 PE=1 SV=2 Heat shock cognate 71 kDa protein OS=Homo sapiens GN=HSPA8 PE=1 SV=1 Heat shock protein HSP 90-beta OS=Homo sapiens GN=HSP90AB1 PE=1 SV=4 60S ribosomal protein L13 OS=Homo sapiens GN=RPL13 PE=1 SV=4 ATP-dependent RNA helicase DDX3X OS=Homo sapiens GN=DDX3X PE=1 SV=3 Tubulin beta-2C chain OS=Homo sapiens GN=TUBB2C PE=1 SV=1 60S ribosomal protein L15 OS=Homo sapiens GN=RPL15 PE=1 SV=2 99  Accession  IonScore  Mass  Unique  Discrete  Total  sp|P62917|RL8_HUMAN  389.6  28.2  9  9  10  sp|P61254|RL26_HUMAN  404.7  17.2  9  9  10  sp|Q07020|RL18_HUMAN  515.5  21.7  9  9  13  sp|P40429|RL13A_HUMAN  385.4  23.6  9  9  9  sp|P60709|ACTB_HUMAN sp|P07437|TBB5_HUMAN  397.6 378  42.1 50.1  9 9  9 9  9 9  sp|P62753|RS6_HUMAN  493.6  28.8  9  9  10  sp|P15880|RS2_HUMAN  384.7  31.6  9  9  11  sp|P11940-2|PABP1_HUMAN  469.8  61.4  9  9  13  sp|P62280|RS11_HUMAN  344.2  18.6  9  9  10  sp|P09651-3|ROA1_HUMAN  380.9  29.5  9  9  10  sp|P62249|RS16_HUMAN  350.8  16.5  8  8  11  sp|Q9BQE3|TBA1C_HUMAN  376.2  50.5  8  8  8  sp|Q96SB4|SRPK1_HUMAN  321.9  75  8  8  8  388  38.6  8  8  9  sp|Q08211|DHX9_HUMAN  280.4  142.2  8  8  8  sp|Q9UMS4|PRP19_HUMAN  326.8  55.6  8  8  8  sp|Q07955|SRSF1_HUMAN  340.1  27.8  8  8  8  sp|Q13247-3|SRSF6_HUMAN  Description 60S ribosomal protein L8 OS=Homo sapiens GN=RPL8 PE=1 SV=2 60S ribosomal protein L26 OS=Homo sapiens GN=RPL26 PE=1 SV=1 60S ribosomal protein L18 OS=Homo sapiens GN=RPL18 PE=1 SV=2 60S ribosomal protein L13a OS=Homo sapiens GN=RPL13A PE=1 SV=2 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 Tubulin beta chain OS=Homo sapiens GN=TUBB PE=1 SV=2 40S ribosomal protein S6 OS=Homo sapiens GN=RPS6 PE=1 SV=1 40S ribosomal protein S2 OS=Homo sapiens GN=RPS2 PE=1 SV=2 Isoform 2 of Polyadenylate-binding protein 1 OS=Homo sapiens GN=PABPC1 40S ribosomal protein S11 OS=Homo sapiens GN=RPS11 PE=1 SV=3 Isoform 2 of Heterogeneous nuclear ribonucleoprotein A1 OS=Homo sapiens GN=HNRNPA1 40S ribosomal protein S16 OS=Homo sapiens GN=RPS16 PE=1 SV=2 Tubulin alpha-1C chain OS=Homo sapiens GN=TUBA1C PE=1 SV=1 Serine/threonine-protein kinase SRPK1 OS=Homo sapiens GN=SRPK1 PE=1 SV=2 Isoform SRP55-3 of Serine/arginine-rich splicing factor 6 OS=Homo sapiens GN=SRSF6 ATP-dependent RNA helicase A OS=Homo sapiens GN=DHX9 PE=1 SV=4 Pre-mRNA-processing factor 19 OS=Homo sapiens GN=PRPF19 PE=1 SV=1 Serine/arginine-rich splicing factor 1 OS=Homo sapiens GN=SRSF1 PE=1 SV=2 100  Accession sp|P62263|RS14_HUMAN sp|Q9P258|RCC2_HUMAN  418.5 293.8  16.4 56.8  8 8  8 8  11 8  sp|P49756|RBM25_HUMAN IPI:CON_00697851.1|SWISSPROT:Q5XQN5 IPI:CON_00714876.1|ENSEMBL:E NSBTAP00000038253  293.8  100.5  8  8  8  Description 40S ribosomal protein S14 OS=Homo sapiens GN=RPS14 PE=1 SV=3 Protein RCC2 OS=Homo sapiens GN=RCC2 PE=1 SV=2 RNA-binding protein 25 OS=Homo sapiens GN=RBM25 PE=1 SV=3  300.2  63.1  7  7  20  (Bos taurus) Keratin, type II cytoskeletal 5  382.5  63.4  7  7  39  sp|P62750|RL23A_HUMAN  366.5  17.7  7  7  9  sp|P78362-2|SRPK2_HUMAN  264.2  79.7  7  7  7  sp|P23396|RS3_HUMAN  355.2  26.8  7  7  7  sp|P60866|RS20_HUMAN  319.8  13.5  7  7  10  sp|Q13310-2|PABP4_HUMAN  347.6  69.8  7  7  8  sp|P27635|RL10_HUMAN  258.8  25  7  7  8  sp|P49207|RL34_HUMAN  298.5  13.5  7  7  7  sp|P38646|GRP75_HUMAN  345.4  73.9  7  7  8  sp|P11387|TOP1_HUMAN sp|P10412|H14_HUMAN sp|P06748-2|NPM_HUMAN  310.8 437.3 324.3  91.1 21.9 29.6  7 7 7  7 7 7  7 13 7  sp|P18077|RL35A_HUMAN  263.6  12.6  7  7  12  sp|P18621|RL17_HUMAN  288.3  21.6  7  7  10  281  22.1  7  7  7  (Bos taurus) 63 kDa protein 60S ribosomal protein L23a OS=Homo sapiens GN=RPL23A PE=1 SV=1 Isoform 2 of Serine/threonine-protein kinase SRPK2 OS=Homo sapiens GN=SRPK2 40S ribosomal protein S3 OS=Homo sapiens GN=RPS3 PE=1 SV=2 40S ribosomal protein S20 OS=Homo sapiens GN=RPS20 PE=1 SV=1 Isoform 2 of Polyadenylate-binding protein 4 OS=Homo sapiens GN=PABPC4 60S ribosomal protein L10 OS=Homo sapiens GN=RPL10 PE=1 SV=4 60S ribosomal protein L34 OS=Homo sapiens GN=RPL34 PE=1 SV=3 Stress-70 protein, mitochondrial OS=Homo sapiens GN=HSPA9 PE=1 SV=2 DNA topoisomerase 1 OS=Homo sapiens GN=TOP1 PE=1 SV=2 Histone H1.4 OS=Homo sapiens GN=HIST1H1E PE=1 SV=2 Isoform 2 of Nucleophosmin OS=Homo sapiens GN=NPM1 60S ribosomal protein L35a OS=Homo sapiens GN=RPL35A PE=1 SV=2 60S ribosomal protein L17 OS=Homo sapiens GN=RPL17 PE=1 SV=3 40S ribosomal protein S7 OS=Homo sapiens GN=RPS7 PE=1 SV=1  sp|P62081|RS7_HUMAN  IonScore  Mass  Unique  Discrete  Total  101  Accession  IonScore  Mass  Unique  Discrete  Total  sp|P61353|RL27_HUMAN sp|P07355-2|ANXA2_HUMAN  251.9 245.2  15.8 40.7  7 6  7 6  12 8  sp|Q9NZI8|IF2B1_HUMAN  258.9  63.8  6  6  6  sp|P84098|RL19_HUMAN  249.4  23.6  6  6  7  sp|P62888|RL30_HUMAN  323  12.9  6  6  7  sp|Q07021|C1QBP_HUMAN  429.8  31.7  6  6  9  sp|P05141|ADT2_HUMAN  252.2  33.1  6  6  6  sp|P50914|RL14_HUMAN  290.6  23.5  6  6  6  sp|P52597|HNRPF_HUMAN  296.4  46  6  6  6  sp|Q9NR30-2|DDX21_HUMAN IPI:CON_00136056.1|SWISSPROT:P08730-1 REV_sp|Q8WZ423|TITIN_HUMAN  262.7  80.1  6  6  6  259.1  5  5  22  130.5  48.1 3011. 5  5  5  5  sp|P12956|XRCC6_HUMAN  170.6  70.1  5  5  5  sp|P13010|XRCC5_HUMAN  169.3  83.2  5  5  5  sp|P26599-2|PTBP1_HUMAN  258.8  59.2  5  5  7  sp|P30050|RL12_HUMAN  262.9  18  5  5  5  sp|P46779|RL28_HUMAN  218.1  15.8  5  5  9  sp|P62266|RS23_HUMAN  280.9  16  5  5  7  Description 60S ribosomal protein L27 OS=Homo sapiens GN=RPL27 PE=1 SV=2 Isoform 2 of Annexin A2 OS=Homo sapiens GN=ANXA2 Insulin-like growth factor 2 mRNA-binding protein 1 OS=Homo sapiens GN=IGF2BP1 PE=1 SV=2 60S ribosomal protein L19 OS=Homo sapiens GN=RPL19 PE=1 SV=1 60S ribosomal protein L30 OS=Homo sapiens GN=RPL30 PE=1 SV=2 Complement component 1 Q subcomponent-binding protein, mitochondrial OS=Homo sapiens GN=C1QBP PE=1 SV=1 ADP/ATP translocase 2 OS=Homo sapiens GN=SLC25A5 PE=1 SV=6 60S ribosomal protein L14 OS=Homo sapiens GN=RPL14 PE=1 SV=4 Heterogeneous nuclear ribonucleoprotein F OS=Homo sapiens GN=HNRNPF PE=1 SV=3 Isoform 2 of Nucleolar RNA helicase 2 OS=Homo sapiens GN=DDX21 Tax_Id=10090 Gene_Symbol=Krt13 Isoform 1 of Keratin, type I cytoskeletal 13 Isoform Small cardiac N2-B of Titin OS=Homo sapiens GN=TTN X-ray repair cross-complementing protein 6 OS=Homo sapiens GN=XRCC6 PE=1 SV=2 X-ray repair cross-complementing protein 5 OS=Homo sapiens GN=XRCC5 PE=1 SV=3 Isoform PTB2 of Polypyrimidine tract-binding protein 1 OS=Homo sapiens GN=PTBP1 60S ribosomal protein L12 OS=Homo sapiens GN=RPL12 PE=1 SV=1 60S ribosomal protein L28 OS=Homo sapiens GN=RPL28 PE=1 SV=3 40S ribosomal protein S23 OS=Homo sapiens GN=RPS23 PE=1 SV=3 102  Accession  IonScore  Mass  Unique  Discrete  Total  sp|P62277|RS13_HUMAN  230.4  17.2  5  5  7  sp|P62829|RL23_HUMAN  211  15  5  5  6  sp|P84103|SRSF3_HUMAN  174.9  19.5  5  5  5  sp|Q02543|RL18A_HUMAN  184.8  21  5  5  5  sp|Q12905|ILF2_HUMAN  249.5  43.3  5  5  5  sp|Q16629-2|SRSF7_HUMAN  219.1  15.8  5  5  5  sp|Q8NC51-2|PAIRB_HUMAN  207.4  44.3  5  5  5  sp|Q92841-2|DDX17_HUMAN  265.6  73.1  5  5  6  sp|P62913-2|RL11_HUMAN  206.5  20.3  4  4  4  sp|P05787|K2C8_HUMAN  219.3  53.7  4  4  10  sp|P62854|RS26_HUMAN  131.9  13.3  4  4  4  sp|P42766|RL35_HUMAN  199.4  14.5  4  4  5  142  92.4  4  4  4  sp|P25398|RS12_HUMAN sp|Q92522|H1X_HUMAN  150.2 155.5  14.9 22.5  4 4  4 4  4 4  sp|P31943|HNRH1_HUMAN  233.7  49.5  4  4  4  sp|P35268|RL22_HUMAN sp|Q14739|LBR_HUMAN sp|P46776|RL27A_HUMAN  238.2 145 214.5  14.8 71.1 16.7  4 4 4  4 4 4  6 5 4  sp|Q99459|CDC5L_HUMAN  Description 40S ribosomal protein S13 OS=Homo sapiens GN=RPS13 PE=1 SV=2 60S ribosomal protein L23 OS=Homo sapiens GN=RPL23 PE=1 SV=1 Serine/arginine-rich splicing factor 3 OS=Homo sapiens GN=SRSF3 PE=1 SV=1 60S ribosomal protein L18a OS=Homo sapiens GN=RPL18A PE=1 SV=2 Interleukin enhancer-binding factor 2 OS=Homo sapiens GN=ILF2 PE=1 SV=2 Isoform 2 of Serine/arginine-rich splicing factor 7 OS=Homo sapiens GN=SRSF7 Isoform 2 of Plasminogen activator inhibitor 1 RNA-binding protein OS=Homo sapiens GN=SERBP1 Isoform 2 of Probable ATP-dependent RNA helicase DDX17 OS=Homo sapiens GN=DDX17 Isoform 2 of 60S ribosomal protein L11 OS=Homo sapiens GN=RPL11 Keratin, type II cytoskeletal 8 OS=Homo sapiens GN=KRT8 PE=1 SV=7 40S ribosomal protein S26 OS=Homo sapiens GN=RPS26 PE=1 SV=3 60S ribosomal protein L35 OS=Homo sapiens GN=RPL35 PE=1 SV=2 Cell division cycle 5-like protein OS=Homo sapiens GN=CDC5L PE=1 SV=2 40S ribosomal protein S12 OS=Homo sapiens GN=RPS12 PE=1 SV=3 Histone H1x OS=Homo sapiens GN=H1FX PE=1 SV=1 Heterogeneous nuclear ribonucleoprotein H OS=Homo sapiens GN=HNRNPH1 PE=1 SV=4 60S ribosomal protein L22 OS=Homo sapiens GN=RPL22 PE=1 SV=2 Lamin-B receptor OS=Homo sapiens GN=LBR PE=1 SV=2 60S ribosomal protein L27a OS=Homo sapiens GN=RPL27A 103  Accession  IonScore  Mass  Unique  Discrete  Total  sp|O43143|DHX15_HUMAN  168.6  91.7  4  4  4  sp|P67809|YBOX1_HUMAN  167.4  35.9  4  4  6  sp|P16989-3|DBPA_HUMAN  152.2  37  4  4  6  sp|P62244|RS15A_HUMAN  171.9  14.9  4  4  4  sp|P12235|ADT1_HUMAN  184.6  33.3  4  4  4  sp|P63244|GBLP_HUMAN  185.1  35.5  4  4  4  sp|P05388|RLA0_HUMAN sp|Q86YZ3|HORN_HUMAN  202.3 100.8  34.4 283.1  4 3  4 3  4 4  sp|P22626-2|ROA2_HUMAN  126.2  36  3  3  3  sp|P61978-2|HNRPK_HUMAN  132.7  51.3  3  3  4  sp|P62899|RL31_HUMAN  121.7  14.5  3  3  5  sp|P62910|RL32_HUMAN  106.6  16  3  3  5  sp|P83731|RL24_HUMAN  169.6  17.9  3  3  5  sp|O75400-2|PR40A_HUMAN  84.8  104.5  3  3  3  sp|O00425|IF2B3_HUMAN IPI:CON_00468956.4|SWISSPROT:Q9R0H5  128.7  64  3  3  3  157.2  57.9  3  3  12  sp|Q14498-2|RBM39_HUMAN sp|Q15365|PCBP1_HUMAN  109.6 115.5  58.9 38  3 3  3 3  3 3  Description PE=1 SV=2 Putative pre-mRNA-splicing factor ATP-dependent RNA helicase DHX15 OS=Homo sapiens GN=DHX15 PE=1 SV=2 Nuclease-sensitive element-binding protein 1 OS=Homo sapiens GN=YBX1 PE=1 SV=3 Isoform 3 of DNA-binding protein A OS=Homo sapiens GN=CSDA 40S ribosomal protein S15a OS=Homo sapiens GN=RPS15A PE=1 SV=2 ADP/ATP translocase 1 OS=Homo sapiens GN=SLC25A4 PE=1 SV=4 Guanine nucleotide-binding protein subunit beta-2-like 1 OS=Homo sapiens GN=GNB2L1 PE=1 SV=3 60S acidic ribosomal protein P0 OS=Homo sapiens GN=RPLP0 PE=1 SV=1 Hornerin OS=Homo sapiens GN=HRNR PE=1 SV=2 Isoform A2 of Heterogeneous nuclear ribonucleoproteins A2/B1 OS=Homo sapiens GN=HNRNPA2B1 Isoform 2 of Heterogeneous nuclear ribonucleoprotein K OS=Homo sapiens GN=HNRNPK 60S ribosomal protein L31 OS=Homo sapiens GN=RPL31 PE=1 SV=1 60S ribosomal protein L32 OS=Homo sapiens GN=RPL32 PE=1 SV=2 60S ribosomal protein L24 OS=Homo sapiens GN=RPL24 PE=1 SV=1 Isoform 2 of Pre-mRNA-processing factor 40 homolog A OS=Homo sapiens GN=PRPF40A Insulin-like growth factor 2 mRNA-binding protein 3 OS=Homo sapiens GN=IGF2BP3 PE=1 SV=2 Tax_Id=10090 Gene_Symbol=Krt71 Keratin, type II cytoskeletal 6G Isoform HCC1.3 of RNA-binding protein 39 OS=Homo sapiens GN=RBM39 Poly(rC)-binding protein 1 OS=Homo sapiens GN=PCBP1 104  Accession  IonScore  Mass  Unique  Discrete  Total  sp|Q15366|PCBP2_HUMAN  128.5  39  3  3  3  sp|Q2M2I5|K1C24_HUMAN  158.9  55.6  3  3  7  99.8  300.2  3  3  3  sp|Q9Y3U8|RL36_HUMAN  131.9  12.3  3  3  6  sp|P46778|RL21_HUMAN  153.4  18.6  3  3  5  sp|P38159|HNRPG_HUMAN  131.8  42.3  3  3  3  sp|P47914|RL29_HUMAN  119.1  17.8  3  3  3  sp|P32969|RL9_HUMAN  86.5  22  3  3  3  sp|P42677|RS27_HUMAN  102.7  9.8  2  2  2  sp|P23246-2|SFPQ_HUMAN  84.2  72.3  2  2  2  sp|Q8IXJ9|ASXL1_HUMAN  63.5  167  2  2  2  sp|P61513|RL37A_HUMAN  64.4  10.5  2  2  3  sp|Q13283|G3BP1_HUMAN sp|P23528|COF1_HUMAN  79.4 70.2  52.2 18.7  2 2  2 2  2 2  sp|P30048|PRDX3_HUMAN  89.3  28  2  2  2  sp|P60842|IF4A1_HUMAN  72.2  46.4  2  2  2  sp|Q969Q0|RL36L_HUMAN sp|P22087|FBRL_HUMAN  66.2 68.4  12.7 33.9  2 2  2 2  2 2  sp|Q9UQ35|SRRM2_HUMAN  Description PE=1 SV=2 Poly(rC)-binding protein 2 OS=Homo sapiens GN=PCBP2 PE=1 SV=1 Keratin, type I cytoskeletal 24 OS=Homo sapiens GN=KRT24 PE=1 SV=1 Serine/arginine repetitive matrix protein 2 OS=Homo sapiens GN=SRRM2 PE=1 SV=2 60S ribosomal protein L36 OS=Homo sapiens GN=RPL36 PE=1 SV=3 60S ribosomal protein L21 OS=Homo sapiens GN=RPL21 PE=1 SV=2 Heterogeneous nuclear ribonucleoprotein G OS=Homo sapiens GN=RBMX PE=1 SV=3 60S ribosomal protein L29 OS=Homo sapiens GN=RPL29 PE=1 SV=2 60S ribosomal protein L9 OS=Homo sapiens GN=RPL9 PE=1 SV=1 40S ribosomal protein S27 OS=Homo sapiens GN=RPS27 PE=1 SV=3 Isoform F of Splicing factor, proline- and glutamine-rich OS=Homo sapiens GN=SFPQ Putative Polycomb group protein ASXL1 OS=Homo sapiens GN=ASXL1 PE=1 SV=2 60S ribosomal protein L37a OS=Homo sapiens GN=RPL37A PE=1 SV=2 Ras GTPase-activating protein-binding protein 1 OS=Homo sapiens GN=G3BP1 PE=1 SV=1 Cofilin-1 OS=Homo sapiens GN=CFL1 PE=1 SV=3 Thioredoxin-dependent peroxide reductase, mitochondrial OS=Homo sapiens GN=PRDX3 PE=1 SV=3 Eukaryotic initiation factor 4A-I OS=Homo sapiens GN=EIF4A1 PE=1 SV=1 60S ribosomal protein L36a-like OS=Homo sapiens GN=RPL36AL PE=1 SV=3 rRNA 2'-O-methyltransferase fibrillarin OS=Homo sapiens 105  Accession  IonScore  Mass  Unique  Discrete  Total  sp|P0C0S5|H2AZ_HUMAN  82.4  13.5  2  2  2  sp|Q01081|U2AF1_HUMAN  92.6  28.4  2  2  2  72.5 118.6  50.8 15.4  2 2  2 2  2 2  sp|Q12906-2|ILF3_HUMAN  72.6  76.4  2  2  2  sp|Q13151|ROA0_HUMAN  79  31  2  2  2  sp|P62847-2|RS24_HUMAN  97.6  15.1  2  2  4  sp|P62979|RS27A_HUMAN  104.1  18.3  2  2  5  sp|Q6P158|DHX57_HUMAN  64.5  157.1  2  2  2  sp|P06733-2|ENOA_HUMAN  69.1  37.2  2  2  3  sp|P25705|ATPA_HUMAN sp|P10599|THIO_HUMAN  60.7 139  59.8 12  2 2  2 2  2 3  sp|P10809|CH60_HUMAN  66  61.2  2  2  2  sp|Q9NYF8-2|BCLF1_HUMAN  83.9  106  2  2  2  sp|Q7L2E3-2|DHX30_HUMAN  72.4  137.1  2  2  2  sp|P62937|PPIA_HUMAN  77.3  18.2  2  2  4  sp|Q9UN86-2|G3BP2_HUMAN sp|P35080|PROF2_HUMAN  Description GN=FBL PE=1 SV=2 Histone H2A.Z OS=Homo sapiens GN=H2AFZ PE=1 SV=2 Splicing factor U2AF 35 kDa subunit OS=Homo sapiens GN=U2AF1 PE=1 SV=3 Isoform B of Ras GTPase-activating protein-binding protein 2 OS=Homo sapiens GN=G3BP2 Profilin-2 OS=Homo sapiens GN=PFN2 PE=1 SV=3 Isoform DRBP76 of Interleukin enhancer-binding factor 3 OS=Homo sapiens GN=ILF3 Heterogeneous nuclear ribonucleoprotein A0 OS=Homo sapiens GN=HNRNPA0 PE=1 SV=1 Isoform 2 of 40S ribosomal protein S24 OS=Homo sapiens GN=RPS24 Ubiquitin-40S ribosomal protein S27a OS=Homo sapiens GN=RPS27A PE=1 SV=2 Putative ATP-dependent RNA helicase DHX57 OS=Homo sapiens GN=DHX57 PE=1 SV=2 Isoform MBP-1 of Alpha-enolase OS=Homo sapiens GN=ENO1 ATP synthase subunit alpha, mitochondrial OS=Homo sapiens GN=ATP5A1 PE=1 SV=1 Thioredoxin OS=Homo sapiens GN=TXN PE=1 SV=3 60 kDa heat shock protein, mitochondrial OS=Homo sapiens GN=HSPD1 PE=1 SV=2 Isoform Btf-l of Bcl-2-associated transcription factor 1 OS=Homo sapiens GN=BCLAF1 Isoform 2 of Putative ATP-dependent RNA helicase DHX30 OS=Homo sapiens GN=DHX30 Peptidyl-prolyl cis-trans isomerase A OS=Homo sapiens GN=PPIA PE=1 SV=2  Appendix 3 MS0190 GFP_CDK13 106  Accession(  IonScore(  Mass(  Unique(  sp|Q14004|CDK13_HUMAN2  3793.8  165. 6  64  64  237  sp|P1194052|PABP1_HUMAN2  1176.8  61.4  23  23  29  tr|Q4VC03|Q4VC03_HUMAN2  950.8  72.7  21  21  26  sp|P10809|CH60_HUMAN2  938.4  61.2  21  21  29  1043.7  106  20  20  24  sp|P17844|DDX5_HUMAN2 sp|P19338|NUCL_HUMAN2  851.9 862.8  69.6 76.6  18 17  18 17  21 22  sp|O00571|DDX3X_HUMAN2  781.5  73.6  17  17  25  sp|Q00839|HNRPU_HUMAN2 tr|Q5SU16|Q5SU16_HUMAN2  817.9 967.3  91.3 50.1  17 16  17 16  27 22  sp|Q8NC51|PAIRB_HUMAN2  613.3  16  16  18  sp|Q9Y2W1|TR150_HUMAN2  770.8  45 108. 7  16  16  17  tr|Q5T6W5|Q5T6W5_HUMAN2  882.7  47.8  15  15  17  tr|Q59F66|Q59F66_HUMAN2  706.7  81.7  15  15  21  700  73.9  15  15  22  sp|Q9NR30|DDX21_HUMAN2 sp|Q9P258|RCC2_HUMAN2  697.4 608.8  15 14  15 14  17 15  sp|Q7L2E352|DHX30_HUMAN2 tr|E7EWF1|E7EWF1_HUMAN2  482.8 640.8  87.8 56.8 137. 1 45.8  14 14  14 14  14 15  sp|Q9NYF852|BCLF1_HUMAN2  sp|P5227252|HNRPM_HUMAN2  Discrete( Total(  Description Cyclin-dependent kinase 13 OS=Homo sapiens GN=CDK13 PE=1 SV=2 Isoform 2 of Polyadenylate-binding protein 1 OS=Homo sapiens GN=PABPC1 PABPC4 protein OS=Homo sapiens GN=PABPC4 PE=2 SV=1 60 kDa heat shock protein, mitochondrial OS=Homo sapiens GN=HSPD1 PE=1 SV=2 Isoform 2 of Bcl-2-associated transcription factor 1 OS=Homo sapiens GN=BCLAF1 Probable ATP-dependent RNA helicase DDX5 OS=Homo sapiens GN=DDX5 PE=1 SV=1 Nucleolin OS=Homo sapiens GN=NCL PE=1 SV=3 ATP-dependent RNA helicase DDX3X OS=Homo sapiens GN=DDX3X PE=1 SV=3 Heterogeneous nuclear ribonucleoprotein U OS=Homo sapiens GN=HNRNPU PE=1 SV=6 Beta 5-tubulin OS=Homo sapiens GN=TUBB PE=2 SV=1 Plasminogen activator inhibitor 1 RNA-binding protein OS=Homo sapiens GN=SERBP1 PE=1 SV=2 Thyroid hormone receptor-associated protein 3 OS=Homo sapiens GN=THRAP3 PE=1 SV=2 Heterogeneous nuclear ribonucleoprotein K OS=Homo sapiens GN=HNRNPK PE=2 SV=1 DEAD box polypeptide 17 isoform p82 variant (Fragment) OS=Homo sapiens PE=2 SV=1 Isoform 2 of Heterogeneous nuclear ribonucleoprotein M OS=Homo sapiens GN=HNRNPM Nucleolar RNA helicase 2 OS=Homo sapiens GN=DDX21 PE=1 SV=5 Protein RCC2 OS=Homo sapiens GN=RCC2 PE=1 SV=2 Isoform 2 of Putative ATP-dependent RNA helicase DHX30 OS=Homo sapiens GN=DHX30 Uncharacterized protein OS=Homo sapiens GN=RPL4 107  Accession(  IonScore(  Mass(  Unique(  tr|A9C4C1|A9C4C1_HUMAN2  497.4  22.6  13  13  17  sp|Q9NZI8|IF2B1_HUMAN2  748.5  63.8  13  13  13  sp|P05787|K2C8_HUMAN2  619.8  53.7  13  13  15  tr|B4DW52|B4DW52_HUMAN2  753.5  39  13  13  24  sp|Q9BVA1|TBB2B_HUMAN2  728.9  50.4  13  13  18  tr|Q5VX58|Q5VX58_HUMAN2  571.2  70.2  12  12  14  626  30.2  12  12  13  tr|B2R491|B2R491_HUMAN2 sp|Q9BQG05 2|MBB1A_HUMAN2  480.8  29.8  12  12  13  448  150. 2  12  12  12  sp|Q07955|SRSF1_HUMAN2  578.4  27.8  12  12  15  tr|Q5T8U4|Q5T8U4_HUMAN2  567.3  30.1  11  11  14  sp|P25705|ATPA_HUMAN2  690.8  59.8  11  11  12  tr|F5H288|F5H288_HUMAN2  434.6  47.1  11  11  11  tr|A8K579|A8K579_HUMAN2  491.7  71.3  11  11  11  sp|P67809|YBOX1_HUMAN2  653  35.9  11  11  18  sp|P18124|RL7_HUMAN2 sp|P13010|XRCC5_HUMAN2  442.8 434.1  29.3 83.2  11 10  11 10  13 10  sp|P61247|RS3A_HUMAN2  Discrete( Total(  Description PE=4 SV=1 Ribosomal protein S9 OS=Homo sapiens GN=RPS9 PE=3 SV=1 Insulin-like growth factor 2 mRNA-binding protein 1 OS=Homo sapiens GN=IGF2BP1 PE=1 SV=2 Keratin, type II cytoskeletal 8 OS=Homo sapiens GN=KRT8 PE=1 SV=7 Uncharacterized protein OS=Homo sapiens GN=ACTB PE=2 SV=1 Tubulin beta-2B chain OS=Homo sapiens GN=TUBB2B PE=1 SV=1 Poly(A) binding protein, cytoplasmic 3 OS=Homo sapiens GN=PABPC3 PE=2 SV=1 40S ribosomal protein S3a OS=Homo sapiens GN=RPS3A PE=1 SV=2 Ribosomal protein S4, X-linked, isoform CRA_c OS=Homo sapiens GN=RPS4X PE=2 SV=1 Isoform 2 of Myb-binding protein 1A OS=Homo sapiens GN=MYBBP1A Serine/arginine-rich splicing factor 1 OS=Homo sapiens GN=SRSF1 PE=1 SV=2 Ribosomal protein L7a OS=Homo sapiens GN=RPL7A PE=2 SV=1 ATP synthase subunit alpha, mitochondrial OS=Homo sapiens GN=ATP5A1 PE=1 SV=1 Uncharacterized protein OS=Homo sapiens GN=VIM PE=3 SV=1 Plastin 3 (T isoform) OS=Homo sapiens GN=PLS3 PE=2 SV=1 Nuclease-sensitive element-binding protein 1 OS=Homo sapiens GN=YBX1 PE=1 SV=3 60S ribosomal protein L7 OS=Homo sapiens GN=RPL7 PE=1 SV=1 X-ray repair cross-complementing protein 5 OS=Homo 108  Accession(  IonScore(  Mass(  Unique(  sp|P0965152|ROA1_HUMAN2  478  34.3  10  10  13  sp|P0039052|GSHR_HUMAN2  464.5  52.2  10  10  12  415  59.8  9  9  10  tr|D6RH20|D6RH20_HUMAN2  366.1  34.7  9  9  9  tr|C9JFV5|C9JFV5_HUMAN2  398.2  83.7  9  9  12  tr|B1AHC9|B1AHC9_HUMAN2  498  64.5  9  9  10  tr|A2A3R6|A2A3R6_HUMAN2  447.7  28.8  9  9  9  sp|P15880|RS2_HUMAN2  434.4  31.6  9  9  10  sp|Q1324753|SRSF6_HUMAN2  464.2  38.6  9  9  16  sp|Q02878|RL6_HUMAN2  443.9  32.8  9  9  9  357  79.7  9  9  10  sp|P38919|IF4A3_HUMAN2  438.3  47.1  9  9  9  sp|P38159|HNRPG_HUMAN2  495.3  42.3  9  9  10  tr|B2R6F3|B2R6F3_HUMAN2 IPI:CON_00714876.1|ENSEMBL :ENSBTAP000000382532  453.4  19.5  8  8  11  367.9  63.4  8  8  34  sp|O4368452|BUB3_HUMAN2 sp|P02533|K1C14_HUMAN2  376.8 451  37.3 51.9  8 8  8 8  9 35  tr|Q9BUQ0|Q9BUQ0_HUMAN2  sp|P7836252|SRPK2_HUMAN2  Discrete( Total(  Description sapiens GN=XRCC5 PE=1 SV=3 Isoform A1-A of Heterogeneous nuclear ribonucleoprotein A1 OS=Homo sapiens GN=HNRNPA1 Isoform Cytoplasmic of Glutathione reductase, mitochondrial OS=Homo sapiens GN=GSR Polypyrimidine tract binding protein 1 OS=Homo sapiens GN=PTBP1 PE=2 SV=1 Uncharacterized protein OS=Homo sapiens GN=MRPS27 PE=4 SV=1 Uncharacterized protein OS=Homo sapiens GN=ILF3 PE=4 SV=1 Uncharacterized protein OS=Homo sapiens GN=XRCC6 PE=4 SV=1 40S ribosomal protein S6 OS=Homo sapiens GN=RPS6 PE=2 SV=1 40S ribosomal protein S2 OS=Homo sapiens GN=RPS2 PE=1 SV=2 Isoform SRP55-3 of Serine/arginine-rich splicing factor 6 OS=Homo sapiens GN=SRSF6 60S ribosomal protein L6 OS=Homo sapiens GN=RPL6 PE=1 SV=3 Isoform 2 of Serine/threonine-protein kinase SRPK2 OS=Homo sapiens GN=SRPK2 Eukaryotic initiation factor 4A-III OS=Homo sapiens GN=EIF4A3 PE=1 SV=4 Heterogeneous nuclear ribonucleoprotein G OS=Homo sapiens GN=RBMX PE=1 SV=3 Splicing factor arginine/serine-rich 3 OS=Homo sapiens GN=SFRS3 PE=2 SV=1 (Bos taurus) 63 kDa protein Isoform 2 of Mitotic checkpoint protein BUB3 OS=Homo sapiens GN=BUB3 Keratin, type I cytoskeletal 14 OS=Homo sapiens 109  Accession(  IonScore(  Mass(  Unique(  Discrete( Total(  sp|P16989|DBPA_HUMAN2  479.7  40.1  8  8  15  sp|P2206152|PIMT_HUMAN2  379.6  24.8  8  8  8  sp|P23396|RS3_HUMAN2  358.3  26.8  8  8  8  sp|P39023|RL3_HUMAN2  395.9  46.4  8  8  11  sp|P52597|HNRPF_HUMAN2  438.6  46  8  8  11  sp|P61254|RL26_HUMAN2  331.5  17.2  8  8  16  sp|P62750|RL23A_HUMAN2  409.4  17.7  8  8  12  sp|P82650|RT22_HUMAN2  436.9  8  8  9  sp|Q08211|DHX9_HUMAN2  363.9  41.4 142. 2  8  8  11  tr|E9PB24|E9PB24_HUMAN2  394.6  19.5  8  8  15  tr|Q5JR94|Q5JR94_HUMAN2  416.8  24.5  8  8  8  sp|P62906|RL10A_HUMAN2  324.7  25  7  7  12  tr|B4DP59|B4DP59_HUMAN2  278.2  41.4  7  7  9  sp|O00425|IF2B3_HUMAN2  325.1  7  7  8  sp|Q9290052|RENT1_HUMAN2  253.7  64 124. 3  7  7  7  tr|D2K8Q1|D2K8Q1_HUMAN2  271.1  66.3  7  7  7  sp|O75400|PR40A_HUMAN2  241.8  109  7  7  7  Description GN=KRT14 PE=1 SV=4 DNA-binding protein A OS=Homo sapiens GN=CSDA PE=1 SV=4 Isoform 2 of Protein-L-isoaspartate(D-aspartate) Omethyltransferase OS=Homo sapiens GN=PCMT1 40S ribosomal protein S3 OS=Homo sapiens GN=RPS3 PE=1 SV=2 60S ribosomal protein L3 OS=Homo sapiens GN=RPL3 PE=1 SV=2 Heterogeneous nuclear ribonucleoprotein F OS=Homo sapiens GN=HNRNPF PE=1 SV=3 60S ribosomal protein L26 OS=Homo sapiens GN=RPL26 PE=1 SV=1 60S ribosomal protein L23a OS=Homo sapiens GN=RPL23A PE=1 SV=1 28S ribosomal protein S22, mitochondrial OS=Homo sapiens GN=MRPS22 PE=1 SV=1 ATP-dependent RNA helicase A OS=Homo sapiens GN=DHX9 PE=1 SV=4 Uncharacterized protein OS=Homo sapiens GN=RPL28 PE=4 SV=1 40S ribosomal protein S8 OS=Homo sapiens GN=RPS8 PE=2 SV=1 60S ribosomal protein L10a OS=Homo sapiens GN=RPL10A PE=1 SV=2 Death associated protein 3, isoform CRA_d OS=Homo sapiens GN=DAP3 PE=2 SV=1 Insulin-like growth factor 2 mRNA-binding protein 3 OS=Homo sapiens GN=IGF2BP3 PE=1 SV=2 Isoform 2 of Regulator of nonsense transcripts 1 OS=Homo sapiens GN=UPF1 AAA domain containing 3A protein OS=Homo sapiens GN=ATAD3A PE=2 SV=1 Pre-mRNA-processing factor 40 homolog A OS=Homo sapiens GN=PRPF40A PE=1 SV=2 110  Accession(  IonScore(  Mass(  Unique(  tr|F5H6G5|F5H6G5_HUMAN2  327.6  55.8  7  7  13  sp|P05141|ADT2_HUMAN2  361.1  7  7  10  sp|Q6PKG0|LARP1_HUMAN2 sp|Q16658|FSCN1_HUMAN2  298.5 267.2  33.1 123. 8 55.1  7 7  7 7  9 7  sp|P11387|TOP1_HUMAN2  254.3  91.1  7  7  9  sp|O6050653|HNRPQ_HUMAN2  299.9  62.8  7  7  10  300  19.9  7  7  8  tr|Q5JW30|Q5JW30_HUMAN2  253.3  54.9  7  7  7  sp|Q07021|C1QBP_HUMAN2  486.6  31.7  7  7  11  sp|Q07020|RL18_HUMAN2  444.1  21.7  7  7  10  sp|Q04695|K1C17_HUMAN2  399  48.4  7  7  16  sp|O95232|LC7L3_HUMAN2  350.4  51.8  7  7  7  sp|P1461852|KPYM_HUMAN2  277.7  58.5  7  7  7  sp|Q96EY7|PTCD3_HUMAN2  353.5  79.2  7  7  7  tr|A6NNE8|A6NNE8_HUMAN2  377.3  19.1  7  7  15  sp|P61313|RL15_HUMAN2  257.9  24.2  7  7  8  sp|P82675|RT05_HUMAN2 sp|P09661|RU2A_HUMAN2  218.2 281.1  48.5 28.5  6 6  6 6  6 6  sp|P1553152|NDKA_HUMAN2  Discrete( Total(  Description Uncharacterized protein OS=Homo sapiens GN=KRT6B PE=3 SV=1 ADP/ATP translocase 2 OS=Homo sapiens GN=SLC25A5 PE=1 SV=7 La-related protein 1 OS=Homo sapiens GN=LARP1 PE=1 SV=2 Fascin OS=Homo sapiens GN=FSCN1 PE=1 SV=3 DNA topoisomerase 1 OS=Homo sapiens GN=TOP1 PE=1 SV=2 Isoform 3 of Heterogeneous nuclear ribonucleoprotein Q OS=Homo sapiens GN=SYNCRIP Isoform 2 of Nucleoside diphosphate kinase A OS=Homo sapiens GN=NME1 Staufen, RNA binding protein, homolog 1 (Drosophila) OS=Homo sapiens GN=STAU1 PE=2 SV=1 Complement component 1 Q subcomponent-binding protein, mitochondrial OS=Homo sapiens GN=C1QBP PE=1 SV=1 60S ribosomal protein L18 OS=Homo sapiens GN=RPL18 PE=1 SV=2 Keratin, type I cytoskeletal 17 OS=Homo sapiens GN=KRT17 PE=1 SV=2 Luc7-like protein 3 OS=Homo sapiens GN=LUC7L3 PE=1 SV=2 Isoform M1 of Pyruvate kinase isozymes M1/M2 OS=Homo sapiens GN=PKM2 Pentatricopeptide repeat-containing protein 3, mitochondrial OS=Homo sapiens GN=PTCD3 PE=1 SV=3 Uncharacterized protein OS=Homo sapiens GN=SRSF7 PE=4 SV=3 60S ribosomal protein L15 OS=Homo sapiens GN=RPL15 PE=1 SV=2 28S ribosomal protein S5, mitochondrial OS=Homo sapiens GN=MRPS5 PE=1 SV=2 U2 small nuclear ribonucleoprotein A' OS=Homo sapiens 111  Accession(  IonScore(  Mass(  Unique(  tr|A3R0T8|A3R0T8_HUMAN2  358.7  21.9  6  6  15  sp|P0790052|HS90A_HUMAN2  281.4  98.7  6  6  6  sp|P61353|RL27_HUMAN2  286.2  15.8  6  6  12  sp|P62263|RS14_HUMAN2  384.5  16.4  6  6  8  tr|B4DXZ6|B4DXZ6_HUMAN2  263.9  68.6  6  6  7  tr|B4DVB8|B4DVB8_HUMAN2  261.9  39.2  6  6  6  sp|P2636852|U2AF2_HUMAN2  286.3  53.4  6  6  6  sp|P27348|1433T_HUMAN2  263.3  28  6  6  6  sp|Q0678753|FMR1_HUMAN2  244.1  6  6  7  tr|Q5HY54|Q5HY54_HUMAN2  208.4  70.3 279. 1  6  6  6  sp|Q13162|PRDX4_HUMAN2 sp|O75909|CCNK_HUMAN2  293.4 258.7  6 6  6 6  10 10  sp|Q1514952|PLEC_HUMAN2  178.7  30.7 64.6 520. 1  6  6  6  sp|O75439|MPPB_HUMAN2  255.7  55.1  6  6  7  sp|P42167|LAP2B_HUMAN2  210.5  50.7  6  6  6  tr|F5H3H6|F5H3H6_HUMAN2  253.6  80.5 111. 3  6  6  8  6  6  6  tr|F5H2F4|F5H2F4_HUMAN2  241  Discrete( Total(  Description GN=SNRPA1 PE=1 SV=2 Histone 1, H1e OS=Homo sapiens GN=HIST1H1E PE=2 SV=1 Isoform 2 of Heat shock protein HSP 90-alpha OS=Homo sapiens GN=HSP90AA1 60S ribosomal protein L27 OS=Homo sapiens GN=RPL27 PE=1 SV=2 40S ribosomal protein S14 OS=Homo sapiens GN=RPS14 PE=1 SV=3 Uncharacterized protein OS=Homo sapiens GN=FXR1 PE=2 SV=1 cDNA FLJ60076, highly similar to ELAV-like protein 1 OS=Homo sapiens PE=2 SV=1 Isoform 2 of Splicing factor U2AF 65 kDa subunit OS=Homo sapiens GN=U2AF2 14-3-3 protein theta OS=Homo sapiens GN=YWHAQ PE=1 SV=1 Isoform 2 of Fragile X mental retardation 1 protein OS=Homo sapiens GN=FMR1 Filamin A, alpha (Actin binding protein 280) OS=Homo sapiens GN=FLNA PE=2 SV=1 Peroxiredoxin-4 OS=Homo sapiens GN=PRDX4 PE=1 SV=1 Cyclin-K OS=Homo sapiens GN=CCNK PE=1 SV=2 Isoform 2 of Plectin OS=Homo sapiens GN=PLEC Mitochondrial-processing peptidase subunit beta OS=Homo sapiens GN=PMPCB PE=1 SV=2 Lamina-associated polypeptide 2, isoforms beta/gamma OS=Homo sapiens GN=TMPO PE=1 SV=2 Uncharacterized protein OS=Homo sapiens GN=DDX50 PE=4 SV=1 Uncharacterized protein OS=Homo sapiens GN=MTHFD1 PE=3 SV=1 112  Accession( sp|Q92522|H1X_HUMAN2  IonScore(  Mass(  Unique(  354.1  6  Discrete( Total( 6  9  6  6  6  sp|O7540053|PR40A_HUMAN2  212.4  22.5 107. 1  sp|P17987|TCPA_HUMAN2  257.9  60.8  6  6  6  tr|E9PKZ0|E9PKZ0_HUMAN2  311.6  6  6  11  sp|P49756|RBM25_HUMAN2  317  22.6 100. 5  6  6  7  tr|E7EUB4|E7EUB4_HUMAN2  204  89.3  6  6  7  sp|O43175|SERA_HUMAN2  315.2  57.4  6  6  6  tr|E7EMJ8|E7EMJ8_HUMAN2  331.5  46.8  6  6  12  tr|E5RI99|E5RI99_HUMAN2  283.7  12.8  6  6  7  tr|B4E3C2|B4E3C2_HUMAN2  269.4  17.3  5  5  6  sp|P27635|RL10_HUMAN2  192.8  25  5  5  7  sp|P55795|HNRH2_HUMAN2  283.6  49.5  5  5  8  sp|Q9Y399|RT02_HUMAN2  173.1  33.5  5  5  5  tr|B7Z9L0|B7Z9L0_HUMAN2  243.6  52.8  5  5  5  tr|D3YTB1|D3YTB1_HUMAN2  139.9  15.7  5  5  5  tr|Q6IB29|Q6IB29_HUMAN2  202.7  34.9  5  5  6  sp|P12268|IMDH2_HUMAN2  212.7  56.2  5  5  5  sp|P2262652|ROA2_HUMAN2  242.7  36  5  5  5  Description Histone H1x OS=Homo sapiens GN=H1FX PE=1 SV=1 Isoform 3 of Pre-mRNA-processing factor 40 homolog A OS=Homo sapiens GN=PRPF40A T-complex protein 1 subunit alpha OS=Homo sapiens GN=TCP1 PE=1 SV=1 Uncharacterized protein OS=Homo sapiens GN=RPL8 PE=4 SV=1 RNA-binding protein 25 OS=Homo sapiens GN=RBM25 PE=1 SV=3 Uncharacterized protein OS=Homo sapiens GN=CDC5L PE=4 SV=1 D-3-phosphoglycerate dehydrogenase OS=Homo sapiens GN=PHGDH PE=1 SV=4 Uncharacterized protein OS=Homo sapiens GN=SRSF4 PE=4 SV=2 Uncharacterized protein OS=Homo sapiens GN=RPL30 PE=3 SV=1 Uncharacterized protein OS=Homo sapiens GN=RPL17 PE=2 SV=1 60S ribosomal protein L10 OS=Homo sapiens GN=RPL10 PE=1 SV=4 Heterogeneous nuclear ribonucleoprotein H2 OS=Homo sapiens GN=HNRNPH2 PE=1 SV=1 28S ribosomal protein S2, mitochondrial OS=Homo sapiens GN=MRPS2 PE=1 SV=1 T-complex protein 1 subunit delta OS=Homo sapiens GN=CCT4 PE=2 SV=1 Uncharacterized protein OS=Homo sapiens GN=RPL32 PE=4 SV=1 EBNA1 binding protein 2 OS=Homo sapiens GN=EBNA1BP2 PE=2 SV=1 Inosine-5'-monophosphate dehydrogenase 2 OS=Homo sapiens GN=IMPDH2 PE=1 SV=2 Isoform A2 of Heterogeneous nuclear ribonucleoproteins A2/B1 OS=Homo sapiens GN=HNRNPA2B1 113  Accession(  IonScore(  Mass(  Unique(  Discrete( Total(  sp|Q9Y383|LC7L2_HUMAN2  206.1  46.9  5  5  6  sp|Q9BY77|PDIP3_HUMAN2  179.3  46.3  5  5  6  sp|O76021|RL1D1_HUMAN2 tr|Q6IAX2|Q6IAX2_HUMAN2  220.7 207.4  55.2 18.6  5 5  5 5  5 6  sp|P22087|FBRL_HUMAN2  260.6  33.9  5  5  5  sp|P51991|ROA3_HUMAN2 tr|Q5T081|Q5T081_HUMAN2  221.5 156.9  39.8 45.4  5 5  5 5  7 6  tr|Q57Z92|Q57Z92_HUMAN2  177.5  22.1  5  5  7  sp|Q16543|CDC37_HUMAN2 IPI:CON_00462140.1|SWISS5 PROT:Q6IFZ62  193.5  45  5  5  6  260.1  61.4  5  5  18  sp|Q9BVP252|GNL3_HUMAN2  185.3  61  5  5  5  sp|P18077|RL35A_HUMAN2  216.3  12.6  5  5  9  sp|P3194652|1433B_HUMAN2  190  27.9  5  5  5  tr|E9PCZ6|E9PCZ6_HUMAN2  250  56.2  5  5  5  tr|D6R956|D6R956_HUMAN2  242.1  27.1  5  5  5  sp|Q96SB4|SRPK1_HUMAN2  203.1  75  5  5  6  tr|B4DDE4|B4DDE4_HUMAN2  262.4  65.2  4  4  4  tr|B4DDZ8|B4DDZ8_HUMAN2  146.1  55.8  4  4  4  Description Putative RNA-binding protein Luc7-like 2 OS=Homo sapiens GN=LUC7L2 PE=1 SV=2 Polymerase delta-interacting protein 3 OS=Homo sapiens GN=POLDIP3 PE=1 SV=2 Ribosomal L1 domain-containing protein 1 OS=Homo sapiens GN=RSL1D1 PE=1 SV=3 RPL21 protein OS=Homo sapiens GN=RPL21 PE=2 SV=1 rRNA 2'-O-methyltransferase fibrillarin OS=Homo sapiens GN=FBL PE=1 SV=2 Heterogeneous nuclear ribonucleoprotein A3 OS=Homo sapiens GN=HNRNPA3 PE=1 SV=2 CHC1 protein OS=Homo sapiens GN=RCC1 PE=2 SV=1 Putative uncharacterized protein RPS7 OS=Homo sapiens GN=RPS7 PE=2 SV=1 Hsp90 co-chaperone Cdc37 OS=Homo sapiens GN=CDC37 PE=1 SV=1 Tax_Id=10090 Gene_Symbol=Krt77 Keratin, type II cytoskeletal 1b Isoform 2 of Guanine nucleotide-binding protein-like 3 OS=Homo sapiens GN=GNL3 60S ribosomal protein L35a OS=Homo sapiens GN=RPL35A PE=1 SV=2 Isoform Short of 14-3-3 protein beta/alpha OS=Homo sapiens GN=YWHAB Uncharacterized protein OS=Homo sapiens GN=RBM39 PE=4 SV=1 Uncharacterized protein OS=Homo sapiens GN=UCHL1 PE=4 SV=1 Serine/threonine-protein kinase SRPK1 OS=Homo sapiens GN=SRPK1 PE=1 SV=2 Ubiquitin-activating enzyme E1 OS=Homo sapiens GN=UBA1 PE=2 SV=1 Serine/threonine-protein phosphatase OS=Homo sapiens GN=PPP5C PE=2 SV=1 114  Accession(  IonScore(  Mass(  Unique(  Discrete( Total(  tr|A8K517|A8K517_HUMAN2  221.9  16  4  4  9  sp|P62841|RS15_HUMAN2  112.4  17  4  4  4  sp|Q9NSB2|KRT84_HUMAN2  150.1  65.9  4  4  6  sp|P00492|HPRT_HUMAN2  221.8  24.8  4  4  4  sp|P68036|UB2L3_HUMAN2  160.6  18  4  4  5  sp|P8291252|RT11_HUMAN2 sp|P18583510|SON_HUMAN2  163.2 144.7  20.6 248  4 4  4 4  5 4  sp|Q01081|U2AF1_HUMAN2  230.3  28.4  4  4  4  sp|Q9NTZ6|RBM12_HUMAN2  204.9  97.6  4  4  4  tr|D6RBZ0|D6RBZ0_HUMAN2  199.6  35.8  4  4  5  tr|A4D0Z3|A4D0Z3_HUMAN2 tr|Q5HY57|Q5HY57_HUMAN2  147.6 164.1  20.6 25  4 4  4 4  4 4  tr|E7ET98|E7ET98_HUMAN2  212.1  46  4  4  4  sp|Q13242|SRSF9_HUMAN2  177.6  25.6  4  4  4  sp|Q1324353|SRSF5_HUMAN2  191.8  31  4  4  8  sp|Q1383852|DX39B_HUMAN2  181.5  51.1  4  4  6  tr|E7ERE4|E7ERE4_HUMAN2  191.4  4  4  6  sp|Q6P2Q9|PRP8_HUMAN2  122.8  71.6 274. 7  4  4  4  Description Ribosomal protein S23, isoform CRA_a OS=Homo sapiens GN=RPS23 PE=2 SV=1 40S ribosomal protein S15 OS=Homo sapiens GN=RPS15 PE=1 SV=2 Keratin, type II cuticular Hb4 OS=Homo sapiens GN=KRT84 PE=1 SV=2 Hypoxanthine-guanine phosphoribosyltransferase OS=Homo sapiens GN=HPRT1 PE=1 SV=2 Ubiquitin-conjugating enzyme E2 L3 OS=Homo sapiens GN=UBE2L3 PE=1 SV=1 Isoform 2 of 28S ribosomal protein S11, mitochondrial OS=Homo sapiens GN=MRPS11 Isoform J of Protein SON OS=Homo sapiens GN=SON Splicing factor U2AF 35 kDa subunit OS=Homo sapiens GN=U2AF1 PE=1 SV=3 RNA-binding protein 12 OS=Homo sapiens GN=RBM12 PE=1 SV=1 Uncharacterized protein OS=Homo sapiens GN=HNRNPAB PE=4 SV=1 ADP-ribosylation factor 5 OS=Homo sapiens GN=ARF5 PE=2 SV=1 Emerin OS=Homo sapiens GN=EMD PE=2 SV=1 Uncharacterized protein OS=Homo sapiens GN=KHDRBS1 PE=4 SV=2 Serine/arginine-rich splicing factor 9 OS=Homo sapiens GN=SRSF9 PE=1 SV=1 Isoform SRP40-4 of Serine/arginine-rich splicing factor 5 OS=Homo sapiens GN=SRSF5 Isoform 2 of Spliceosome RNA helicase DDX39B OS=Homo sapiens GN=DDX39B Uncharacterized protein OS=Homo sapiens GN=HNRNPR PE=4 SV=1 Pre-mRNA-processing-splicing factor 8 OS=Homo sapiens GN=PRPF8 PE=1 SV=2 115  Accession(  IonScore(  Mass(  Unique(  185  23.6  4  4  5  sp|Q6YN1652|HSDL2_HUMAN2  155.4  37.5  4  4  4  tr|Q1W6G4|Q1W6G4_HUMAN2  135.2  38.8  4  4  5  sp|P42766|RL35_HUMAN2  172.3  14.5  4  4  7  187  61.9  4  4  4  tr|E7EP00|E7EP00_HUMAN2  161.6  108  4  4  4  sp|Q9UMS4|PRP19_HUMAN2  173.3  4  4  4  sp|Q99575|POP1_HUMAN2 sp|Q9Y265|RUVB1_HUMAN2  170.1 186.9  55.6 116. 3 50.5  4 4  4 4  4 4  tr|E9PG15|E9PG15_HUMAN2  179.8  17.2  4  4  4  sp|Q9H0C2|ADT4_HUMAN2  144.1  35.3  4  4  5  tr|C9JXK0|C9JXK0_HUMAN2  135.8  24.3  4  4  6  tr|C9JD32|C9JD32_HUMAN2  147.7  9.8  4  4  5  tr|B7Z6S8|B7Z6S8_HUMAN2  193.9  15.2  4  4  6  182  14.9  4  4  5  sp|P62277|RS13_HUMAN2  201.9  17.2  4  4  5  sp|P62280|RS11_HUMAN2 tr|Q6IRZ0|Q6IRZ0_HUMAN2  122.5 188.4  18.6 14  4 4  4 4  5 6  sp|P40429|RL13A_HUMAN2  sp|Q9Y6M151|IF2B2_HUMAN2  tr|B2R4W8|B2R4W8_HUMAN2  Discrete( Total(  Description 60S ribosomal protein L13a OS=Homo sapiens GN=RPL13A PE=1 SV=2 Isoform 2 of Hydroxysteroid dehydrogenase-like protein 2 OS=Homo sapiens GN=HSDL2 LUC7-like (S. cerevisiae) OS=Homo sapiens GN=LUC7L PE=2 SV=1 60S ribosomal protein L35 OS=Homo sapiens GN=RPL35 PE=1 SV=2 Isoform 2 of Insulin-like growth factor 2 mRNA-binding protein 2 OS=Homo sapiens GN=IGF2BP2 Uncharacterized protein OS=Homo sapiens GN=SEC24C PE=4 SV=2 Pre-mRNA-processing factor 19 OS=Homo sapiens GN=PRPF19 PE=1 SV=1 Ribonucleases P/MRP protein subunit POP1 OS=Homo sapiens GN=POP1 PE=1 SV=2 RuvB-like 1 OS=Homo sapiens GN=RUVBL1 PE=1 SV=1 Uncharacterized protein OS=Homo sapiens GN=YWHAQ PE=4 SV=1 ADP/ATP translocase 4 OS=Homo sapiens GN=SLC25A31 PE=1 SV=1 Uncharacterized protein OS=Homo sapiens GN=LBR PE=4 SV=1 Uncharacterized protein OS=Homo sapiens GN=RPL23 PE=3 SV=1 Uncharacterized protein OS=Homo sapiens GN=RPL14 PE=2 SV=1 HCG1994130, isoform CRA_a OS=Homo sapiens GN=hCG_1994130 PE=2 SV=1 40S ribosomal protein S13 OS=Homo sapiens GN=RPS13 PE=1 SV=2 40S ribosomal protein S11 OS=Homo sapiens GN=RPS11 PE=1 SV=3 RPL31 protein OS=Homo sapiens GN=RPL31 PE=2 SV=1 116  Accession(  IonScore(  Mass(  Unique(  199.9  20.6  4  4  4  sp|Q8WVV954|HNRLL_HUMAN2  96.1  60.5  3  3  3  sp|P16455|MGMT_HUMAN2  92.7  3  3  3  sp|Q9UQ35|SRRM2_HUMAN2  100.3  21.9 300. 2  3  3  3  sp|Q92665|RT31_HUMAN2  133.2  45.4  3  3  4  tr|D6RFJ8|D6RFJ8_HUMAN2  83.3  47.3  3  3  3  sp|Q92901|RL3L_HUMAN2  134.4  46.6  3  3  3  tr|F5GYJ8|F5GYJ8_HUMAN2  132.8  33  3  3  3  sp|Q9Y3U8|RL36_HUMAN2  127.4  12.3  3  3  4  sp|P43487|RANG_HUMAN2  128  23.5  3  3  3  tr|E9PMN9|E9PMN9_HUMAN2  76.6  70.4  3  3  3  tr|A6NIT8|A6NIT8_HUMAN2  122.3  51.2  3  3  5  tr|B2R4S9|B2R4S9_HUMAN2  179.5  13.9  3  3  8  sp|Q99832|TCPH_HUMAN2 PPP2R1A:P179R2  116.2 124.9  59.8 66.1  3 3  3 3  3 3  sp|Q9Y224|CN166_HUMAN2  127.2  28.2  3  3  3  sp|Q9Y3I0|RTCB_HUMAN2  121.3  55.7  3  3  3  tr|E9PLL6|E9PLL6_HUMAN2  155.2  12.3  3  3  4  tr|B4DQI6|B4DQI6_HUMAN2  Discrete( Total(  Description cDNA FLJ50614, highly similar to Transformer-2 protein homolog OS=Homo sapiens PE=2 SV=1 Isoform 4 of Heterogeneous nuclear ribonucleoprotein L-like OS=Homo sapiens GN=HNRPLL Methylated-DNA--protein-cysteine methyltransferase OS=Homo sapiens GN=MGMT PE=1 SV=1 Serine/arginine repetitive matrix protein 2 OS=Homo sapiens GN=SRRM2 PE=1 SV=2 28S ribosomal protein S31, mitochondrial OS=Homo sapiens GN=MRPS31 PE=1 SV=3 Uncharacterized protein OS=Homo sapiens GN=G3BP2 PE=4 SV=1 60S ribosomal protein L3-like OS=Homo sapiens GN=RPL3L PE=1 SV=3 Uncharacterized protein OS=Homo sapiens GN=OTUB1 PE=4 SV=1 60S ribosomal protein L36 OS=Homo sapiens GN=RPL36 PE=1 SV=3 Ran-specific GTPase-activating protein OS=Homo sapiens GN=RANBP1 PE=1 SV=1 Uncharacterized protein OS=Homo sapiens GN=NAT10 PE=4 SV=1 Uncharacterized protein OS=Homo sapiens GN=HNRNPL PE=2 SV=1 Histone H2B OS=Homo sapiens GN=HIST1H2BC PE=2 SV=1 T-complex protein 1 subunit eta OS=Homo sapiens GN=CCT7 PE=1 SV=2 UPF0568 protein C14orf166 OS=Homo sapiens GN=C14orf166 PE=1 SV=1 tRNA-splicing ligase RtcB homolog OS=Homo sapiens GN=C22orf28 PE=1 SV=1 Uncharacterized protein OS=Homo sapiens GN=RPL27A PE=3 SV=1 117  Accession(  IonScore(  Mass(  sp|Q9Y2Q9|RT28_HUMAN2  138.9  21  3  3  3  tr|A8K4C8|A8K4C8_HUMAN2  190.7  24.3  3  3  6  sp|Q02543|RL18A_HUMAN2  98  21  3  3  4  tr|E9PC80|E9PC80_HUMAN2  128.7  57.8  3  3  3  sp|P31153|METK2_HUMAN2  170.7  44  3  3  3  sp|P49207|RL34_HUMAN2  142  13.5  3  3  3  sp|P84098|RL19_HUMAN2  110.9  23.6  3  3  3  sp|P82933|RT09_HUMAN2  115.3  46  3  3  3  sp|Q9BYN8|RT26_HUMAN2  174.5  24.3  3  3  3  sp|P82932|RT06_HUMAN2  111.2  14.3  3  3  3  sp|P62851|RS25_HUMAN2  133.6  13.8  3  3  3  tr|E7EWH4|E7EWH4_HUMAN2  122.7  22.4  3  3  3  tr|E7EUT4|E7EUT4_HUMAN2  124.5  31.7  3  3  3  tr|B4DL14|B4DL14_HUMAN2 2  140.3  2  Unique(  27.6  2  Discrete( Total(  3  2  3  2  3  2  Description 28S ribosomal protein S28, mitochondrial OS=Homo sapiens GN=MRPS28 PE=1 SV=1 60S ribosomal protein L13 OS=Homo sapiens GN=RPL13 PE=2 SV=1 60S ribosomal protein L18a OS=Homo sapiens GN=RPL18A PE=1 SV=2 Uncharacterized protein OS=Homo sapiens GN=EIF2AK2 PE=4 SV=1 S-adenosylmethionine synthase isoform type-2 OS=Homo sapiens GN=MAT2A PE=1 SV=1 60S ribosomal protein L34 OS=Homo sapiens GN=RPL34 PE=1 SV=3 60S ribosomal protein L19 OS=Homo sapiens GN=RPL19 PE=1 SV=1 28S ribosomal protein S9, mitochondrial OS=Homo sapiens GN=MRPS9 PE=1 SV=2 28S ribosomal protein S26, mitochondrial OS=Homo sapiens GN=MRPS26 PE=1 SV=1 28S ribosomal protein S6, mitochondrial OS=Homo sapiens GN=MRPS6 PE=1 SV=3 40S ribosomal protein S25 OS=Homo sapiens GN=RPS25 PE=1 SV=1 Uncharacterized protein OS=Homo sapiens GN=AK2 PE=3 SV=1 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=3 SV=1 ATP synthase gamma chain OS=Homo sapiens GN=ATP5C1 PE=2 SV=1  2  tr|C9JNW5|C9JNW5_HUMAN2  190.2  17.6  3  3  4  tr|B4DUR8|B4DUR8_HUMAN2  174.9  56.2  3  3  3  tr|A3KFK8|A3KFK8_HUMAN2  95.7  61.9  3  3  3  Ribosomal protein L24, isoform CRA_e OS=Homo sapiens GN=RPL24 PE=4 SV=1 Uncharacterized protein OS=Homo sapiens GN=CCT3 PE=2 SV=1 Far upstream element (FUSE) binding protein 3 OS=Homo sapiens GN=FUBP3 PE=2 SV=1 118  Accession(  IonScore(  Mass(  Unique(  97.8  14.7  3  3  3  sp|Q4G17652|ACSF3_HUMAN2  141.6  58.5  3  3  3  tr|Q68CR9|Q68CR9_HUMAN2  113.3  3  3  3  126  46.1 110. 3  3  3  3  tr|A3RJH1|A3RJH1_HUMAN2  141.6  83.3  3  3  3  sp|P30050|RL12_HUMAN2  124.4  18  3  3  3  tr|Q53XR2|Q53XR2_HUMAN2  135.1  31.6  3  3  3  tr|A2RUM7|A2RUM7_HUMAN2  153.9  34.6  3  3  3  tr|Q5QPQ0|Q5QPQ0_HUMAN2  122.5  17.9  3  3  3  tr|B4DS01|B4DS01_HUMAN2  132.9  40.8  3  3  3  sp|P33993|MCM7_HUMAN2  132.9  81.9  3  3  3  sp|Q9Y3D9|RT23_HUMAN2  127.8  21.8  3  3  3  tr|B5MDF5|B5MDF5_HUMAN2  118.2  3  3  3  sp|Q9NTJ352|SMC4_HUMAN2  81.7  26.4 140. 9  3  3  3  tr|B1ALY5|B1ALY5_HUMAN2  115.1  57.1  3  3  3  tr|B4E1T7|B4E1T7_HUMAN2  100  53.5  3  3  3  170.4  15.1  3  3  5  sp|P37108|SRP14_HUMAN2  sp|Q5JWF252|GNAS1_HUMAN2  tr|Q5T0P8|Q5T0P8_HUMAN2  Discrete( Total(  Description Signal recognition particle 14 kDa protein OS=Homo sapiens GN=SRP14 PE=1 SV=2 Isoform 2 of Acyl-CoA synthetase family member 3, mitochondrial OS=Homo sapiens GN=ACSF3 Putative uncharacterized protein DKFZp781B11202 OS=Homo sapiens GN=DKFZp781B11202 PE=2 SV=1 Isoform XLas-2 of Guanine nucleotide-binding protein G(s) subunit alpha isoforms XLas OS=Homo sapiens GN=GNAS ATP-dependent RNA helicase DDX1 OS=Homo sapiens GN=DDX1 PE=2 SV=1 60S ribosomal protein L12 OS=Homo sapiens GN=RPL12 PE=1 SV=1 Stem-loop (Histone) binding protein OS=Homo sapiens GN=SLBP PE=2 SV=1 Ribosomal protein L5 OS=Homo sapiens GN=RPL5 PE=2 SV=1 Lysophospholipase II OS=Homo sapiens GN=LYPLA2 PE=2 SV=1 Uncharacterized protein OS=Homo sapiens GN=EIF4B PE=2 SV=1 DNA replication licensing factor MCM7 OS=Homo sapiens GN=MCM7 PE=1 SV=4 28S ribosomal protein S23, mitochondrial OS=Homo sapiens GN=MRPS23 PE=1 SV=2 RAN, member RAS oncogene family, isoform CRA_c OS=Homo sapiens GN=RAN PE=4 SV=1 Isoform 2 of Structural maintenance of chromosomes protein 4 OS=Homo sapiens GN=SMC4 ROD1 regulator of differentiation 1 (S. pombe) OS=Homo sapiens GN=ROD1 PE=2 SV=1 cDNA FLJ58665, highly similar to Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform OS=Homo sapiens PE=2 SV=1 40S ribosomal protein S24 OS=Homo sapiens GN=RPS24 PE=2 SV=1 119  Accession(  IonScore(  Mass(  Unique(  Discrete( Total(  sp|Q8NFW8|NEUA_HUMAN2  137.6  3  3  3  tr|F5H2U2|F5H2U2_HUMAN2 tr|E5KMT5|E5KMT5_HUMAN2  99.9 87.4  49 115. 7 48  3 2  3 2  3 2  Description N-acylneuraminate cytidylyltransferase OS=Homo sapiens GN=CMAS PE=1 SV=2 Uncharacterized protein OS=Homo sapiens GN=PRPF4B PE=4 SV=1 Pseudouridine synthase OS=Homo sapiens PE=3 SV=1  120  Appendix 4 PCR primer sequences  Primer name  Gene  Vector  PTX3043  CrkRS CTD  V954  PTXSC001  CDK12  V954  5'  AscI  PTXSC002  CDK13  V954  Sequencing  X  56.9 CGG ACT AAG TCG TCC AAG GAG  PTXSC003  CDK13  V954  Sequencing  X  CAA AGC AAA AAC AAA GCC ACC 56.9 TCT  PTXSC004  CDK13  V954  Sequencing  X  54.9 TAT ATG GAC CAT GAT CTG ATG  PTXSC005  CDK13  V954  Sequencing  X  PTXSC006  CDK13  V954  Sequencing  X  PTXSC007  CDK12  pIEX2  5'  BamHI  61.6  A ACG GAT CC AT GCC CAA T TC AGA 50.5 GAGA  PTXSC008  CDK12  pIEX2  3' (open)  Not I  67.1  A TAC AGC TGT GCG GCC GC TTAG 41.8 TAA GGA ACT CCT  PTXSC009  CDK12  pIEX9  5'  BamHI  59.5  CAG GAT CCT ATG CCC AAT TCA 50.5 GAGAGA  PTXSC010  CDK12  pIEX9  3' (closed)  Not I  70.5  ATA CAG CTG T GCG GCC GC GTA 51.2 AGG AAC TCC TCT CCC  5' or 3'  RE Site  MP full  MP seq Sequence  59.5  56.3  73.6  ATC GGG CGC GCC AAA ACC CAA 60.9 GAG CCA GCA GGC  56 TGT TTC CAC AAT TAA AGC CCC C 55.3 ACA GAA AAC CAG CAT GTA CCC  121  Primer name  Gene  Vector  5' or 3'  RE Site  PTXSC011  CycK  pIEX9  5'  BamHI  61.4  GGG TAC CAG GAT CCT ATG AAG 49.2 GAG AAT AAA GAA AAT TCA A  PTXSC012  CycK  pIEX9  3' (open)  NotI  69.9  ATA CAG CTG T GCG GCC GC TTA TCT 51.6 CAT CCA GGC TGC  PTXSC013  CycK  pIEX9  3'  NotI  72.1  ATA CAG CTG T GCG GCC GC TCT 54.4 CAT CCA GGC TGC C  MP full  MP seq Sequence  PTXSC014  CycK  pIEX9  5'  BamHI  69.9  GGGTACCAGGATCCTATGAAGGAGAA TAAAGAAAATTCAAGCCCTTCAGTAA 68.1 CTTCAGCAAACCTGGACCACACA  PTXSC015  CDK12  pIEX9  5'  BamHI  69.4  CAGGATCCTATGCCCAATTCAGAGAG 64.8 ACATGGGGGCAAGAAGGACG  PTXSC016  CDK12  pIEX9  5'  NcoI  66  AAC CCA TGG TGC CCA ATT CAG 62.4 AGA GAC ATG GG  PTXSC017  CycK  pIEX9  5'  NcoI  57  AAC CCA TGG ATA AGG AGA ATA 51.6 AAG AAA ATT CAA  PTXSC018  NTD CDK12  PTXSC019  CTD CDK12  PTXSC020  NTD  pIEX2  3'  AscI  73  pIEX2  5'  AscI  66  pIEX9  3'  SalI  67.4  AAC GGC GCG CC 58 CACACAGCGTTTCCCCCA AAC GGC GCG CCT CAG AGC GAC 50.6 TTC CTT AAA 58  AAC GTC GAC CAC ACA GCG TTT CCC 122  Primer name  Gene  Vector  5' or 3'  RE Site  MP full  CDK12  MP seq Sequence CCA  PTXSC021  CTD CDK12  pIEX9  5'  SalI  PTXSC022  CDK12  pIEX9  5'  PciI  PTXSC023  CDK12  pIEX2  5'  BamHI  63  A ACG GAT CCC ATG CCC AAT TCA 50.5 GAG AGA  PTXSCGF P5  GFP  pIEX  5'  NcoI  64  AAC CCA TGG TGA GCA AGG GCG 60.3 AGG  PTXSCGF P3  PTXSC024  PTXSC025  PTXSC026  GFP  CDK12  CDK12  CDK12  pIEX  3' (open)  Bsu36I  Gateway 5'  Gateway 3' (open)  Gateway 3' (closed)  AttL recom. site  62.4  AAC GTC GAC CAG AGC GAC TTC CTT 52.1 AAA GAT AAC ACA TGT TGC CCA ATT CAG AGA 60.8 GAC ATG GG  64  AAC CCT GAG GTT ACG TTT CTC GTT 57 CAG CTT TTT TGT ACA AA  71.6  GGGG ACA AGT TTG TAC AAA AAA GCA GGC TTC GAA GGA GAT AGA ACC ATG GGG CCC AAT TCA GAG 65.4 AGA CAT GGG G  69.2  GGGGACCAC TTT GTA CAA GAA AGC TGG GTC TTA GTA AGG AAC TCC TCT 56.1 CCC TCT  70.2  GGGGACCAC TTT GTA CAA GAA AGC TGG GTC GTA AGG AAC 58 TCCTCTCCCTCTTCC 123  Primer name  PTXSC027  PTXSC028  Gene  CDK13  CDK13  Vector  5' or 3'  RE Site  MP full  Gateway 5'  Gateway 3' (closed)  MP seq Sequence  71.3  GGGGACAAGTTTGTACAAAAAAGCA GGCT TC ATG CCG AGC AGC TCG 64.6 GAC ACG  71.7  GGGGACCACTTTGTACAAGAAAGCT GGGTC 62 GTATGGTAACCCTCTGCCTCTGCCT  Appendix 5 qPCR primer sequences  Primer Name  Primer Sequence  CDK13F_3404  AAGCCCCCAGGAAGGACTTGTCT  CDK13R_3542  AAGTGCTGTCCAGGGCCTGTTTT  CDK13F_3442  AGCAGAACCAACACACCCCAGGG  CDK13R_3544  TTAAGTGCTGTCCAGGGCCTGTT  CDK13F_3422  TGTCTCTGGGCTTGGATGACAGC  CDK13R_3551  CTGTGGTTTAAGTGCTGTCCAGGGC  RBM25F_159  AGGTCGCGAAGGCAGTACCGT  RBM25R_288  GGAAACTGCGGGGGTGGGATC 124  Primer Name  Primer Sequence  RBM25F_89  TCAGTCTCCCTGGCGAGCGAC  RBM25R_276  GGTGGGATCCCTGGTGGGAGT  RBM25F_123  GAACCAGTGGAGCGCACTCGT  RBM25R_256  TGGTGGGAGTGCTGGGATTCCC  PRP19F_917  TCCTCACTGGTGGGGCGGAT  PRP19R_1098  AGAGGCATTGGGGACCGACCA  PRP19F_1556  TGGCTCTTGGGGGCACGGA  PRP19R_1663  GATGCCCGAAGGCCACCCCT  PRP19F_135  AAGTGGCTCGCGGAGGCTCA  PRP19R_254  CATGGGTGCTCCGGCACTTCG  CDC5LF_2283  GCCGCTACACACGGGCCAAT  CDC5LR_2391  GCAGCCCTCTTGGCTTCTGTCG  CDC5LF_1525  GCTGACTCCCCGGAGTGGAACA  CDC5LF_R1716  GGGGCAGGAAGGCCCAACAA  CDC5LF_1369  GGCCCTCACCAATGTGGACACC  CDC5LR_1541  CACTCCGGGGAGTCAGCCCTT  125  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0073117/manifest

Comment

Related Items