UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Identification and validation of CDK13 interacting proteins Chun, Stella Soyoung 2012

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2012_fall_chun_stella.pdf [ 13.55MB ]
Metadata
JSON: 24-1.0073117.json
JSON-LD: 24-1.0073117-ld.json
RDF/XML (Pretty): 24-1.0073117-rdf.xml
RDF/JSON: 24-1.0073117-rdf.json
Turtle: 24-1.0073117-turtle.txt
N-Triples: 24-1.0073117-rdf-ntriples.txt
Original Record: 24-1.0073117-source.json
Full Text
24-1.0073117-fulltext.txt
Citation
24-1.0073117.ris

Full Text

 Identification and Validation of CDK13 Interacting Proteins by Stella Soyoung Chun B.Sc., The University of Ottawa, 2009  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in The Faculty of Graduate Studies (Medical Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) August 2012  © Stella Soyoung Chun, 2012  ii Abstract Cyclin dependent kinases (CDKs) are components of signal transduction pathways that regulate cellular functions by phosphorylation of substrate proteins in response to upstream signals. The kinase domains of CDK12 and CDK13 are most similar to CDK9; CDK9 phosphorylates the C terminal domain (CTD) of RNA Polymerase II in order to stimulate processive transcription elongation. However, while most human CDKs consist of little more than a kinase domain, CDK12 and CDK13 are much larger and have several protein-protein interaction domains suggesting that they could participate within regulatory cascades. They also have a RS domain found in the SR protein family of splicing factors. Consistent with these features CDK12 and CDK13 co-localize with splicing factors and RNA Polymerase II in nuclear speckles. Based on these features CDK12 and CDK13 have been proposed to coordinately regulate splicing and transcription. Consistent with this hypothesis, both kinases phosphorylate the CTD of RNA polymerase II and regulate the alternative splicing of the Adenovirus E1a mini-gene model substrate. CDK12 has been found to interact with the splicing factors PRP19, CDC5L, RBM25, FBP11 and SRP55. Due to the similarity of CDK13 to CDK12, I investigated the interacting partners of CDK13 by immunoprecipitation and mass spectrometry and determined that CDK13 interacts with same splicing factors as CDK12. These interactions were validated by immunoprecipitation – western blot analysis. My results also indicated that PRP19 and CDC5L interact as a complex with CDK13. Therefore, the protein interaction partners of CDK13 and CDK12 suggest functional mechanisms for their ability to regulate splicing. In parallel projects, to begin investigating the functional roles of the kinase domain of CDK12 I constructed and  iii expressed different CDK12 mutants in insect cells and in mammalian cells. Also to investigate the role of the CDK12 mutants and the protein-protein interactions of CDK13 in alternative splicing, I also developed a PCR based E1A mini-gene splicing assay.!  iv Table of contents Abstract(....................................................................................................................................................(ii! Table(of(contents(...................................................................................................................................(iv! List(of(tables(.........................................................................................................................................(viii! List(of(figures(..........................................................................................................................................(ix! List(of(abbreviations(..........................................................................................................................(xii! Glossary(.................................................................................................................................................(xiii! Acknowledgements(...........................................................................................................................(xiv! Dedication(..............................................................................................................................................(xv! 1! Introduction(.....................................................................................................................................(1! 1.1! Cyclin)dependent)kinases)(CDK))..............................................................................................................)1!1.1.1! History!of!cyclin!dependent!kinases!........................................................................................!1!1.1.2! CDK!family!...........................................................................................................................................!3!1.1.3! Activation!of!CDKs!by!cyclins!......................................................................................................!5! 1.2! CDK13).................................................................................................................................................................)6!1.2.1! CDK13!structure!...............................................................................................................................!6!1.2.2! CDK13’s!interacting!partners!.....................................................................................................!7!1.2.3! CDK13!in!alternative!splicing!.....................................................................................................!7! 1.2.4! CDK13!–!other!functions!...............................................................................................................!8! 1.3! CDK12).................................................................................................................................................................)8!1.3.1! CDK12’s!structure!............................................................................................................................!8!  v 1.3.2! CDK12’s!interacting!partners!.....................................................................................................!8!1.3.3! CDK12!in!transcription!and!alternative!splicing!................................................................!9!1.3.4! CDK12!H!other!functions!.............................................................................................................!10! 1.4! Alternative)splicing)and)splicing)factors)...........................................................................................)10!1.4.1! Spliceosome!cycle!.........................................................................................................................!10!1.4.2! Alternative!splicing!......................................................................................................................!12!1.4.3! SR!proteins!.......................................................................................................................................!13!1.4.4! Splicing!factor!H!PRP19/CDC5L!...............................................................................................!14!1.4.5! Splicing!factor!H!RBM25!..............................................................................................................!15! 2! Project(description(......................................................................................................................(16! 2.1! Hypothesis).......................................................................................................................................................)16! 2.2! Objectives).........................................................................................................................................................)16!2.2.1! CDK13!................................................................................................................................................!16!2.2.2! CDK12!................................................................................................................................................!16! 3! Methods(...........................................................................................................................................(17! 3.1! Plasmid).............................................................................................................................................................)17! 3.2! Bacterial)DNA)transformation)...............................................................................................................)17! 3.3! Restriction)digests).......................................................................................................................................)18! 3.4! Tissue)culture).................................................................................................................................................)18! 3.5! Transfection)...................................................................................................................................................)18! 3.6! siRNA)knockdown)........................................................................................................................................)19! 3.7! mRNA)extraction)..........................................................................................................................................)19! 3.8! DNase)I)treatment).......................................................................................................................................)20! 3.9! cDNA)generation)..........................................................................................................................................)20!  vi 3.10! qPCR)................................................................................................................................................................)21! 3.11! Immunoprecipitation)..............................................................................................................................)21! 3.12! Mass)spectrometry)....................................................................................................................................)22! 3.13! Western)blot)................................................................................................................................................)23! 3.14! E1A)splicing)assay).....................................................................................................................................)24! 4! Identification(and(validation(of(CDK13(interacting(proteins(.......................................(25! 4.1! Construction)of)epitope)tagged)CDK13)..............................................................................................)26!4.1.1! FlagHCDK13!......................................................................................................................................!26!4.1.2! V5HCDK13!.........................................................................................................................................!27!4.1.3! Green!fluorescent!protein!(GFP)HCDK13!............................................................................!27! 4.2! Expression)of)CDK13)in)mammalian)cell)...........................................................................................)29!4.2.1! FlagHCDK13!expression!..............................................................................................................!29!4.2.2! GFPHCDK13!expression!...............................................................................................................!30!4.2.3! V5HCDK13!expression!.................................................................................................................!30! 4.3! Immunoprecipitation)(IP))and)mass)spectrometry)(MS))of)CDK13)protein)complexes)32!4.3.1! CDK13!IPHMass!Spectrometry!(MS)!......................................................................................!34! 4.4! Expression)of)CDK13)interacting)proteins)in)mammalian)cells)..............................................)35! 4.5! Validation)of)CDK13)interactions)via)IPYWB)...................................................................................)37!4.5.1! Validation!of!CDK13!2Hway!interaction!by!IPHWB!..........................................................!38! 4.6! CDK13)IPYWB)3Yway)interaction)..........................................................................................................)40! 4.7! CDK13)PPI)study)discussion)....................................................................................................................)42! 4.8! CDK13)interaction)study)conclusion)...................................................................................................)45! 5! Expression(of(mutant(CDK12(...................................................................................................(46! 5.1! CDK12)mutant)constructs)........................................................................................................................)47!  vii 5.2! Baculovirus)expression)test).....................................................................................................................)52! 5.3! CDK12)expression)in)mammalian)cells)...............................................................................................)54! 5.4! CDK12)antibody)creation).........................................................................................................................)55! 5.5! CDK12)study)discussions)...........................................................................................................................)60! 5.6! CDK12)study)conclusions)..........................................................................................................................)61! 6! Development(of(alternative(splicing(assay(.........................................................................(62! 6.1! siRNA)knockYdown)......................................................................................................................................)62! 6.2! E1A)miniYgene)splicing)assay).................................................................................................................)65!6.2.1! Optimization!....................................................................................................................................!65!6.2.2! CDK12!splicing!assay!...................................................................................................................!69! 6.3! CDK13)splicing)assay)..................................................................................................................................)71!6.3.1! Restoration!of!normal!splicing!activity!with!CDK13/CCNK!.......................................!73! 6.4! Alternative)splicing)discussion)...............................................................................................................)76! 6.5! CDK12)AS)study)discussion)......................................................................................................................)76! 6.6! CDK13)AS)study)discussion)......................................................................................................................)77! 6.7! Alternative)splicing)assay)conclusion)and)future)experiments)................................................)80! 7! Conclusion(......................................................................................................................................(81! Bibliography(.........................................................................................................................................(83! Appendices(............................................................................................................................................(86!    viii List of tables Table 1.1 Protein protein interactors (PPI) of CDK12.. ..................................................... 9! Table 4.1 CDK13 interactions identified by IP-MS ......................................................... 35!    ix List of figures Figure 1.1 Cell-cycle dependent CDKs and their interacting partners in cell cycle regulation ............................................................................................................................ 3! Figure 1.2 CDK phylogenetic maps. The family map shows each CDKs distance from one another. ......................................................................................................................... 4! Figure 1.3 Depiction of CDK and cyclin interaction .......................................................... 5! Figure 1.4 CDK regulation by phosphorylation. ................................................................ 6! Figure 1.5 Schematic diagram of remodelling of spliceosome complex .......................... 12! Figure 1.6 Different types of alternative splicing resulting .............................................. 13! Figure 4.1 Verification of Flag-CDK13 construction by digesting with HindIII and NcoI. ........................................................................................................................................... 28! Figure 4.2 Verification of V5-CDK13 construction by digesting with DraIII and HindIII. ........................................................................................................................................... 28! Figure 4.3 Verification of GFP-CDK13 plasmid construction by digesting with SfiI ..... 29! Figure 4.4 Confirmation of expression of Flag-CDK13 ................................................... 31! Figure 4.5 Confirmation of expression of GFP-CDK13 in HEK293A ............................ 31! Figure 4.6  Confirmation of expression of nV5-CDK13 .................................................. 32! Figure 4.7 Coomassie blue staining of GFP-CDK13 IP sample ....................................... 33! Figure 4.8 Coomassie blue staining of V5-CDK13 and Flag-CDK13 IP sample ............ 34! Figure 4.9 Expression of N- or C-terminus tagged flag interacting proteins .................... 37! Figure 4.10 CDK13 interacts with differentially tagged interacting proteins .................. 39! Figure 4.11 CDK13 interacts as a complex with CDC5L and PRP19 .............................. 41!  x Figure 4.12 CDK13 interaction model with protein-protein interactors ........................... 44! Figure 5.1 CDK12 and its different mutant forms ............................................................ 49! Figure 5.2 Restriction digest of pIEX9 after inserting three different CDK12s ............... 50! Figure 5.3 Restriction digest of pIEX2 after inserting three different CDK12s ............... 51! Figure 5.4 Sf9 growth curve over 6 days .......................................................................... 53! Figure 5.5 Different forms of CDK12 expressed in Sf9 cells analyzed by western blot .. 53! Figure 5.6 Expression of CDK12 wild-type and mutant proteins in HEK293A cells ...... 55! Figure 5.7 Restriction digest of C-terminal domain CDK12 with PacI and AscI ............ 56! Figure 5.8 Western blot of optimization of GST-CTD CDK12 protein expression level post-induction ................................................................................................................... 57! Figure 5.9 Analysis of FPLC column fractions for CDK12 antigen expression .............. 59! Figure 6.1 siRNA transfection of interacting proteins using different transfection reagents ........................................................................................................................................... 64! Figure 6.2. E1A mini-gene ................................................................................................ 67! Figure 6.3 PCR cycle number optimization for E1A ........................................................ 68! Figure 6.4. PCR cycle number quantified using Fuji MultiGauge ................................... 68! Figure 6.5. Post-transfection harvest time optimization ................................................... 69! Figure 6.6 CDK12 E1A mini-gene splicing assay ............................................................ 70! Figure 6.7 Quantification of the CDK12 effect on alternative splicing ............................ 71! Figure 6.8. CDK13 and PPI overexpression E1A mini-gene splicing assay .................... 72! Figure 6.9. Quantification of E1A splicing assay ............................................................. 73! Figure 6.10 CDK13/CCNK E1A mini-gene splicing assay .............................................. 74!  xi Figure 6.11 Quantification of E1A splicing assay with overexpressed PPI and CDK13/CCNK. ................................................................................................................. 75!  xii List of abbreviations ∆K  Kinase deleted or kinase knock-out AmBic Ammonium bicarbonate AS Alternative splicing CCNK Cyclin K CDC5L Cell-division cycle 5-like protein CDK Cyclin dependent kinase CHED Cholinesterase-related cell division controller CTD C-terminal domain FL Full-length or wild-type IP Immunoprecipitation KD Kinase dead KO Kinase knock-out or kinase deleted MS Mass spectrometry PPI Protein-protein interactor PRP19 Precursor messenger RNA-processing factor 19 RBM25 RNA binding motif 25 RS domain Arginine – serine domain SR protein Serine – arginine protein SRP55 Serine/arginine-rich splicing factor 6. SS Splice site WB Western blot WT Wild-type or full-length   xiii Glossary Alternative splicing Cellular mechanism to produce more than one related protein cDNA DNA synthesized from mRNA and contains only exons Exon Parts of a gene that contribute to mRNA. Immunoprecipitation Immunoprecipitation A technique to purify protein of interest by precipitating it using an antibody that specifically binds to the protein of interest. Intron Parts of gene are removed by splicing and do not contribute to mature RNA. Mass spectrometry An analysis where proteins are enzymatically digested and peptides are identified mRNA Final product of transcription Polymerase Chain Reaction (PCR) A technique to amplify a single region of DNA. Pre-mRNA The intermediate product between DNA and mature RNA that contains both introns and exons Protein Biological macromolecules that consist of one or more polypeptides and have roles in biological functions qPCR A technique to amplify and quantify the amplicon Splicing Cellular process in which introns are removed and exons are joined together to create mRNA Transfection Mechanism to introduce exogenous DNA to eukaryotic cells. Transformation Direct uptake of exogenous DNA through cell membrane in prokaryotic cells. Western blot A technique to detect specific proteins. The proteins are separated by size using gel electrophoresis and transferred to a membrane. The proteins are probed with specific antibody to target protein.  xiv Acknowledgements I like to thank the entire Morin lab. They have continuously supported me during my thesis preparation. Special thanks to Dr. Gregg Morin, who has been a great mentor during my thesis and never gave up on me. I also like to thank Dr. Grace Cheng and Dr. Annie Moradian for all the help and support in the lab and for making me feel at home. The other students at GSC who spent endless hours with me and provided me with snacks as a stress remedy, thank you – you guys definitely made my journey easier. Also, extra thanks to my committee members, Dr. Leonard Foster and Dr. Xiaoyan Jiang who made last minute commitments to help me through my thesis.   xv Dedication I like to dedicate to this to my family – Grandma, Mom, Dad and big brother Mike.    Thank you for the continuous support.      1 1 Introduction 1.1 Cyclin dependent kinases (CDK) 1.1.1 History of cyclin dependent kinases Cyclin-dependent kinases (CDKs) are serine/threonine kinases that play crucial roles in cellular functions such as regulating the cell cycle, transcription and pre-mRNA splicing. CDKs were first discovered as an important regulator for cell-cycle checkpoints. For example, CDK1, CDK2, CDK3, CDK4 and CDK6 activity levels fluctuate throughout the cell cycle in their roles as regulators of cell cycle checkpoints. There are four different phases of the cell cycle: G1, S, G2, and M (Figure 1.1). The G1 is the growth phase where the cell prepares for DNA replication. Synthesis (S) phase is where DNA replication occurs. The G2 phase is when most biosynthesis occurs and the cell prepares for mitosis. Mitotic (M) phase is when mitosis occurs. During G1-S phase, CDK4 and/or CDK6 interact with Cyclin D. The CDK4-Cyclin D and/or CDK6-Cyclin D complex then phosphorylates members of the retinoblastoma (Rb) protein family. Rb protein represses transcription by binding and modulates the activity of transcription factors. Once phosphorylated by CDK4/6, Rb becomes inactive, and further phosphorylation by CDK2- Cyclin E is thought to make it irreversible (Reviewed in 1). Inactivation of Rb promotes the synthesis of A and B-type cyclins that stimulate for the next phase of the cell cycle, the G2-M phase. Initially, Cyclin A level increases and binds to CDK1 and CDK2.  The newly formed CDK1/Cyclin A and CDK2/Cyclin A complexes phosphorylate several proteins that play a role in DNA replication. As G2 progresses, Cyclin A is degraded and  2 CDK1 then binds to Cyclin B. CDK1-Cyclin B phosphorylates several proteins that regulate important processes during mitosis such as chromosome condensation and centrosome separation. The activity levels of the different CDKs are controlled by the fluctuation in the leads of cyclins during the cell cycle. For instance, as mentioned above, Cyclin A and Cyclin B are synthesized only after the inactivation of Rb, but then Cyclin A will eventually be degraded in G2. Other CDK research uncovered other CDKs with functional roles outside of the cell cycle. These are non cell-cycle CDKs. For example, CDK9 interacts with Cyclin T and regulates transcription; CDK12 interacts with Cyclin K and have been implicated in the coupled process of splicing and transcription via phosphorylation of C-terminal domain (CTD) of RNA polymerase II and maintaining genomic stability 2,3; CDK13 also interacts with Cyclin K and affects alternative splicing 3,4.  The activities of these CDKs do not fluctuate during the cell cycle as their cyclin partner is not cell-cycle dependent.  3  Figure 1.1 Cell-cycle dependent CDKs and their interacting partners in cell cycle regulation. Each CDK play different roles in regulating cell cycle progression. The activity of CDK is dependent on their cyclin partner 1. 1.1.2 CDK family CDKs were first identified as kinases that have a specific motif – the PSTAIRE helix in the upper lobe in kinase domain. This motif serves as a key interaction point with a cyclin. As more CDKs were discovered, variations to this motif were observed: PFTAIRE, PCTAIRE, PITAIRE. Based on the sequence homology of kinase domain, a kinase family phylogenetic map was constructed (Figure 1.2).  4  Figure 1.2 CDK phylogenetic maps. The family map shows each CDKs distance from one another based on their kinase domain sequence homology. This is modified from Malumbres 2005 1.  5 1.1.3 Activation of CDKs by cyclins CDKs bind cyclins as their interacting partners and require them to be active. Kinases become active when ATP binds within the active sites. However, ATP access to the active site of CDKs is blocked by a structural feature in CDKs called the T-loop. The interaction between a CDK and a cyclin moves the T-loop out of the active site, allowing for the CDK activating kinase (CAK) to phosphorylate a residue in the T-loop (Figure 1.3). The CDK is now fully active for downstream signalling. Phosphorylation of other residues in the kinase domain can also regulate CDK activity, for instance by regulating the CDK-cyclin interface (Figure 1.4).  Figure 1.3 Depiction of CDK and cyclin interaction. The CDK is inactive in its original form. The CDK becomes partially active when cyclin interacts with CDK and moves the T-loop to make the active site accessible. CAK phosphorylates the active site in the T-loop and fully activates the CDK. Adapted from Molecular Biology of the Cell 4th edition.  6  Figure 1.4 CDK regulation by phosphorylation. Phosphorylation can both activate or inactivate CDK. In this example, fully active CDK binds to a cyclin and its active site is phosphorylated. However, when it is hyperphosphorylated by other regulatory kinases, it can be inactivated. The process is reversible by action of a phosphatase. Adapted from Molecular Biology of the Cell 4th edition. 1.2 CDK13 CDC2L5 or CDK13 is located on chromosome 7p14.1. CDK13 was first identified as CHED (Cholinesterase-related cell division controller) human cdc2 homolog 5. The CDK13 transcript size is 5.3kb and the protein size 180kDa 6,7. In respect to its mRNA level, it is expressed in brain, liver, muscle of fetal origin; in neuroblastoma and glioblastoma; and in adult whole brain, hippocampus and bone marrow, but it is especially highly expressed in liver and placenta 5,6 suggesting that it may be involved in specialized tissue functions. 1.2.1 CDK13 structure CDK13 has a PITAIRE motif that distinguishes it from other cell cycle regulated CDKs except CDK12 6. CDK13 amino acid sequence features three nuclear localization signals (NLS) in the N-terminus 6. Studies have found that the N-terminal domain containing the Arginine – Serine  7 (RS) domain, NLS and the first 15 amino acids are required for nuclear localization of CDK13 7. CDK13 co-localizes with SC35, well-known splicing factor and accordingly, it is shown to localize in nuclear speckles, where splicing factors localize 4,7. 1.2.2 CDK13’s interacting partners As a cyclin-dependent kinase, CDK13 requires an interacting cyclin to become active. CDK13’s interacting partners were first identified as Cyclin L1α and Cyclin L2α 4. It was first thought the CDK13 interacts with Cyclin L because of Cyclin L’s known involvement in splicing, and since CDK11 affects alternative splicing and binds to Cyclin L 8. However, this was later opposed when Cyclin K was identified as a CDK13 partner and not Cyclin L 3,9, and was determined to be the sole activating cyclin (Morin, unpublished). Other protein-protein interactors (PPI) of CDK13 are: p32, a splicing regulator; CHMP4A, a charged multivesicular body protein 10 ; and acetylated Tat, an inhibitor for HIV-1 splicing via p32 11. Despite its localization to nuclear speckles, where splicing and transcription is active, no other studies have focused on identifying splicing factors as PPI of CDK13. 1.2.3 CDK13 in alternative splicing CDK13 is involved in alternative splicing: a N-terminal domain fragment of CDK13 affected TNF β splicing, whereas the kinase domain did not 7; over-expression of CDK13 in HEK293T showed that the 13S product decreased and the 9S product increased in the E1A mini-gene splicing assay 4; and overexpression of CDK13 inhibited the production of US  HIV-1 mRNA and downregulated HIV viral expression by interacting with Tat modulating viral Nef HIV-1 mRNA splicing 11.  8 1.2.4 CDK13 – other functions CDK13 expression increases during development of hematopoiesis and is also required for the proper development of hematopoiesis. This was found when antisense oligodeoxynucleotides of CDK13 diverted hematopoiesis towards this mononuclear lineage 5, suggesting that CDK13 is important for this specialized function. Moreover, recently, it has been shown that 72% of CDK13 mRNA undergo A! I editing that results in the Q103R amino acid substitution in the brain 12 and may have functional consequences, yet to be identified. 1.3 CDK12 CrkRS, Crk7 or CDK12 is located on chromosome 17q21 2. Its transcript size is 5.5kb and its protein size is ~180kDa. In respect to its expression level, CDK12 is ubiquitously expressed in most tissues 2. 1.3.1 CDK12’s structure CDK12 is identified as a CDK that has sequence PITAIRE, unique from other CDKs except CDK13 (Figure 1.2). Its features include a arginine/serine (RS) domain 2 and CDK12 co- localizes with SC35 in nuclear speckles. Nuclear localization signals (NLS) are located in the RS domain and in the kinase domain of CDK12. Out of the many features of CDK12, the RS domain that contains 2 NLS plays a major role in targeting CDK12 to nuclear speckles 2. 1.3.2 CDK12’s interacting partners For CDK12 to exhibit kinase activity, it needs to be activated by a cyclin. At first, Cyclin L1 was identified as CDK12’s interacting partner 13 but later studies have shown that Cyclin K is the  9 interacting partner of CDK12 3,9 Morin lab unpublished. Some other PPI of CDK12 includes CAPER14, estrogen receptor activator; and many splicing factors: SRP55, FBP11, RBM25, PRP19, and CDC5L (unpublished Morin Lab data, Table 1.1). Table 1.1 Protein protein interactors (PPI) of CDK12. Differentially tagged CDK12 pull-down study with Immunoprecipitation (IP) –Mass Spectrometry (MS) to identify PPIs. Cyclin K 42.8 kDa* SRP55 39.6 kDa CDC5L 92.2 kDa PRP19 55.1 kDa FBP11 108.8 kDa RBM25 100.1 kDa - 2  (-8.0) 12 (-73.5) 13 (-47.3) 8  (-20.9) 7  (-26.4) - 2  (-4.8) 12 (-64.6) 9  (-43.4) 4  (-13.2) 7  (-27.2) - - 9  (-57.8) 11 (-39.9) - 10 (-24.6) - - 7  (-31.1) 4  (-19.9) - 5  (-16.7) - - 2 (-6.8) 5  (-14.3) - 4  (-6.8) - - - 4  (-9.7) - - 7  (-14.9) - 2  (-6.9) - 5  (-1.8) 3  (-9.7) 5  (-14.2) - - - 2  (-1.7) - 5  (-10.4) 3  (-3.0) 4  (-9.7) 1  (-1.9) 2 (-12.5) 5  (-33.6) 3  (-10.4) - - - - 4  (-3.8) CDK12 Interactors # peptides  (log expectation value)  1.3.3 CDK12 in transcription and alternative splicing Because of its localization to the nucleus and nuclear speckles, CDK12 was speculated to play a role in coupling splicing and transcription. It was found that CDK12 affects alternative splicing of the E1A mini-gene, where overexpression of CDK12 decreased the amount of 13S product and increased 9S product 13. In addition to its role in alternative splicing, CDK12 promoted  10 transcription elongation of RNA polymerase II (RNAPII) 9. More specifically, CDK12 exhibits kinase activity in Ser-2 C-terminal domain (CTD) of RNAPII 2,9. 1.3.4 CDK12 - other functions CDK12 is located proximal to ERBB2. ERBB2 is highly expressed in 25% of breast cancers due to genome amplification 15. Because CDK12 and ERBB2 are proximal to each other it was observed that CDK12 was also frequently amplified with ERBB2, suggesting CDK12 may have a role in cancer susceptibility or progression. Also, CDK12 interacts with CAPER 14, an estrogen receptor activator. The interaction of CDK12 and CAPER may play a role in activating the estrogen receptor gene, suggesting an increase in CDK12 may result up-regulation of estrogen receptor alpha, which is frequently associated with many breast cancers 16. The CAPER interaction may inference the functional consequence of CDK12’s high expression in ERRB2 gene in breast cancer. In addition, CDK12 was identified as a novel determinant in resistance to the estrogen receptor antagonist, tamoxifen 17. Silencing CDK12 increases cell survival by reducing tamoxifen induced G1 arrest by enhancing the phosphorylation of p42/p44 MAPK pathway 17. A recent study showed that CDK12/Cyclin K is required for genomic stability. Knock-down study of CDK12/Cyclin K enhanced apoptosis and DNA damage response (DDR) 3. 1.4 Alternative splicing and splicing factors 1.4.1 Spliceosome cycle The DNA of genes, which contains introns and exons, gets transcribed into RNA and the RNA gets translated into protein. During the transcription process, introns are excised and exons  11 joined together to form messenger RNA (mRNA). The process of excising introns and joining exons together is called splicing. Splicing occurs through the interactions of many small nuclear ribonucleoproteins (snRNP) in the spliceosome complex with the pre-mRNA 18,19 (Figure 1.5). snRNPs contains a strand of RNA (snRNA) that interacts with pre-mRNA and different proteins to make up a snRNP. The first step of spliceosome complex assembly is the formation of complex A – the pre-spliceosome complex. Complex A is formed as U1 snRNP binds to the 5’ splice site (SS) of the intron. Binding of U1 commits the pre-mRNA to the splicing pathway. Then, the U2 snRNP binds to branch point sequence upstream of the 3’ SS and forms “complex A”. U4 and U6 that are usually found as a di-snRNP, interact with U5 to form a tri-snRNP that interacts with complex A to form “complex B”. Because complex B is not catalytic, a major protein rearrangement occurs to make it into catalytic spliceosome “complex B*”. The PRP19 associated complex hPrp19/CDC5L, which consist of at least 7 proteins 20 or the yeast homolog nineteen-complex (NTC) binds to the “complex B” to cause the formation of “complex B*”. The NTC forms a stable association with U5 and U6 and helps promote release of U4. Then, the U6 snRNA base-pairs with the 5’ SS replacing U1 and with U2 snRNA to form the catalytic centre of the spliceosome which is now called “complex B*”. “Complex B*” undergoes two trans- esterification reactions. In the first trans-esterification reaction, the 5’ end of the intron is released forming a lariat, the intermediate, and becomes “complex C”. Then, the second trans- esterification occurs where the 5’ and 3’ SS are joined and releasing the intron lariat, and leaving only exon containing mRNA (Figure 1.5).   12  Figure 1.5 Schematic diagram of remodelling of spliceosome complex. The diagram shows the assembly and disassembly of major spliceosome components. Spliceosome components bind to pre- mRNA resulting in mature-RNA 44. 1.4.2 Alternative splicing Originally, it was thought that one gene became one protein. However, it was found that one gene will give rise to multiple protein isoforms through a process called alternative splicing. Alternative splicing is when the splicing occurs at a different splice site than expected. Hence, unlike constitutive splicing, where contiguous exons are joined, different mRNAs can be formed by joining various combinations of exons from a single gene. At least 74% of human genes have 2 or more isoforms resulting from alternative splicing 21. Currently, there are various types of alternative splicing 22 (Figure 1.6). These different types of alternative splicing affect the primary structure and function of the protein product by several methods such as: introduction of a stop  13 codon, addition/deletion of domains, change in ligand or protein binding properties, intracellular localization, change in enzymatic activities, change in protein stability or different post- translational modifications. In a larger context, different isoforms can give rise to diseases and can be a marker for the detection of diseases 23.  Figure 1.6 Different types of alternative splicing resulting. a) cassette exons b) mutually exclusive exons c) competing 5’ splice site d) competing 3’ splice site e) retained introns f) multiple promoters g) multiple poly(A) sites 22. 1.4.3 SR proteins Alternative splicing is regulated via splicing factors’ interaction with sequences in pre-mRNA exons or introns called exon splicing enhancers or silencers (ESE or ESS) or intron splicing enhancers or silencers (ISE and ISS). Through these interactions, SR proteins regulate the formation of complex A during the pre-spliceosome assembly. SR proteins have a domain that is  14 rich in arginine/serine (RS) dipeptides. The first SR proteins discovered, ASF/SF2 and SC35 were shown to alter 5’ splice site (SS) selection and modulate alternative splicing 24. 5’ SS modulating SR proteins share a structural similarity – an RS domain near the C-terminus followed by one or more RNA recognition motifs (RRM). The RS domain is required to interact with other SR proteins, with other RS domain containing proteins, and with splicing regulators. In addition, recent studies have also found that the RS domains themselves interact with RNA, in addition to the RNA binding function of the RRM domain. This dynamic interaction between the RS domain and the RRM domain with RNA suggests that SR proteins are critically involved in the remodelling of the spliceosome complex. SR proteins recognize and bind to different RNA regions such as ESE 25,26. The arginine rich feature of the RS domains is thought to promote RNA binding to enhancer regions. RS domains are frequently phosphorylated at their serine residues and the phosphorylation controls cellular localization, intranuclear localization and mRNP formation. SR proteins also help shuttle RNA containing elements out of the nucleus to the cytoplasm and it is thought that their phosphorylation status can modulate their localization 27. In addition to RNA shuttling, SR proteins are recruited to the pre-mRNAs for splicing in their hyper-phosphorylated form, but then become dephosphorylated during the spliceosome cycle progression. If kept in their hyper-phosphorylated form, there is an accumulation of SR proteins in nuclear speckles. 1.4.4 Splicing factor - PRP19/CDC5L Precursor messenger RNA-processing factor 19 (PRP19) and cell-division cycle 5-like protein (CDC5L) exists as a complex in human cells or as the Nineteen-complex (NTC) in yeast.  15 PRP19/CDC5L exist in a heteromeric protein complex with at least seven proteins 28-30. The PRP19-associated complex is required to activate complex B and stabilize the spliceosome after the release of U1 and U4 31. Also, the PRP19-U2AF65 complex is recruited to the C-terminal domain (CTD) of RNA polymerase II to enhance splicing 32. CDC5L complex is required for pre-mRNA splicing as studies have shown that immunodepletion of CDC5L inhibits splicing. CDC5L also exists in a core spliceosome complex, with an important role in second catalytic step of pre-mRNA splicing 33. It was found that the interaction of CDC5L with the WD40 domain of PLRG1 is required for splicing 34. 1.4.5 Splicing factor - RBM25 hRED120 (human Arg/Glu/Asp-rich protein of 120) 35 or RNA Binding Motif 25 (RBM25) was shown to be a splicing regulatory protein. It localizes to nuclear speckles via the RE/RD-rich domain in its central region. Overexpression of RBM25 caused increased amount of apoptosis by promoting the production of proapoptotic Bcl-xs via alternative splicing 36. RBM25 was also observed as a complex with U1 snRNP-associated factor, hLuc7A 36..  16 2 Project description 2.1 Hypothesis The primary hypothesis of this thesis is that CDK13 interacts with splicing factors. Secondary hypotheses were 1) the kinase domain of CDK12 modulates alternative splicing and 2) that the interaction of CDK13 with splicing factors modulates alternative splicing. 2.2 Objectives 2.2.1 CDK13 The objective of the CDK13 studies was to 1) find the CDK13 interacting splicing factors via immunoprecipitation and mass-spectrometry and 2) determine if the interaction of the splicing factors and CDK13 affects alternative splicing. 2.2.2 CDK12 The objective of the CDK12 studies was to understand the functional role of kinase domain in splicing. Different mutant forms of CDK12 were created and they were investigated for their effect in the E1A mini-gene splicing assay.  17 3  Methods 3.1 Plasmid To construct a cDNA expression vector for CDK13, a LR reaction was performed using donor clone: pDONR CDK13 (Open Biosystems #100068276) and destination clones: pCDNA6.2 GFP, pcDNA-flag (LMBP 4704), and pcDNA 3.1 nV5-Dest. Successful CDK13 shuttling was confirmed by DNA sequencing and restriction mapping. 3.2 Bacterial DNA transformation 50µl of Library Efficiency DH5α were transformed with 3µl of DNA sample into and incubated on ice for 30 minutes. Cells were heat-shocked by incubating at 42°C for 30 seconds and kept on ice for 2 minutes. 250µl of S.O.C medium were added to the cells and incubated at 37°C for 1 hour with shaking. The cells were centrifuged at 3000 rpm for 5 minutes. 900µl of supernatant were discarded and cells were resuspended in 100µl. Cells were plated on LB plates with selective antibiotics and incubated overnight at 37°C. 50µl of Subcloning Efficiency DH5α were transformed with 3µl of DNA sample and incubated on ice for 30 minutes. Cells were heat-shocked by incubating at 42°C for 15 seconds and kept on ice for 2 minutes. 250µl of S.O.C medium were added to the cells and incubated at 37°C for 1 hour with shaking. The cells were centrifuged at 3000 rpm for 5 minutes. 900µl of supernatant were discarded and cells were resuspended in 100µl. Cells were plated on LB plates with selective antibiotics and incubated overnight at 37°C.  18 3.3 Restriction digests Restriction digests were performed using NEB enzymes according to their protocol. Digestion incubations were performed overnight. The analysis of digestion was done by separating the fragments on 0.8% agarose gel at 100V for 1 hour and visualized by staining with 0.0001% Sybr Green for 15 minutes. 3.4 Tissue culture HEK293A and HeLa mammalian cells were grown at 37°C with 5% CO2 in 10% FBS DMEM without antibiotics. All transfections were done at passages below 30. Sf9 insect cells were grown as adherent or suspension cells at 28°C with Insect Cell Medium. Suspension cells were cultured in a shaking flask at 150 rpm. 3.5 Transfection For IP-MS analysis, four 15cm plates that were 80-90% confluent with HEK293A were prepared for Polyethylamine (PEI) transfection or 50% confluent plates for Calcium Phosphate transfection. Calcium phosphate transfection was performed by the user protocol. For PEI transfection, the cells were transfected with 12µg of total plasmid per plate using PEI. Total DNA of 12ug were diluted 12µg in 1mL of Opti-MEM without serum and mixed. The DNA was heated at 72 °C for 10 minutes. Tube was centrifuged briefly and cooled down to room temperature for 5 minutes. 30µl of PEI (1ug/µl) was added to give 1:3 ratio of DNA:PEI. The mixture was vortexed, centrifuged, and incubated at room temperature for 20 minutes. Meanwhile, I changed media on the plates (DMEM + 10% FBS without antibiotics). After 20  19 minutes of incubation, the DNA/PEI complex was added to each plate. The plates were rocked to evenly distribute DNA/PEI complex and were incubated at 37 C with 5% CO2 for 48 hours. For Co-IP assay, 10cm plate was prepared at 80-90% confluent HEK293A cells. The cells were transfected with 10µg of total plasmid using Polyethylamine (PEI), as described above. For test expression transfections, Lipofectamine transfections were performed in a 6-well plates according to the manufacturer protocol. 3.6 siRNA knockdown In a 24-well plate, X-treme Gene transfection reagent were used to knock-down gene expression. 20pmol of siRNA were diluted in 50µl Opti-MEM Medium and mixed gently. 5µl of X-treme Gene was diluted in 50µl Opti-MEM Medium. siRNA and X-treme Gene were mixed and incubated for 20 minutes at room temperature. The cells were 50% confluent when siRNA/X- treme Gene complex was added. Cells were incubated for 24 hours and 37°C in CO2 incubator. After 24 hours, cells were harvested and analyzed for knock-down expression. 3.7 mRNA extraction Cells were washed with PBS twice. For 24-well plates, 200ul of TRIzol was directly added into the wells for lysis of cells. Cells were incubated with TRIzol for 5 minutes at room temperature and then kept on ice. The homogenized samples were transferred into Eppendorf tubes on ice. 40µl of chloroform were added to each tube and was shaken vigorously for 15 seconds followed by incubation at room temperature for 5 minutes. The tubes were centrifuged at 12,000 x g for 15 minutes at 4°C. The aqueous (top) phase containing the RNA was transferred to a fresh Eppendorf tube. 100µl of isopropanol was added to the aqueous phase and tubes were inverted 6  20 times. The aqueous phase/isopropanol was incubated at room temperature for 10 minutes. The tubes were centrifuged at 12,000 x g for 10 minutes at 4°C and supernatant were carefully removed to not disrupt the RNA pellet. RNA pellet was washed with 200µl of 75% ethanol and mixed by vortex. The tube was centrifuged at 7,500 x g for 5 minutes at 4°C and supernatant was carefully removed. P20 was used to remove as much as liquid as possible from RNA pellet. RNA pellet was air dried at room temperature for 5-10 minutes. RNA was dissolved in 10µl of RNase- free water depending on the cell line and incubated at 55°C for 10 minutes. The RNA concentration was quantified using a NanoDrop UV spectrophotometer. 3.8 DNase I treatment On ice, 1µg RNA samples (up to a maximum of 8µl) were prepared in fresh tubes and added RNase-free water to 8µl. 1µl DNase I Reaction Buffer (10x) and 1µl DNase I (Amp Grade, 1U/µl) were added to each tube and incubated for 15 minutes at room temperature. 1µl of 25mM EDTA was added to each reaction, and heat inactivated at 65°C for 10 minutes. 3.9 cDNA generation On ice, 1µl random hexamer primer (50ng/µl), 2µl 10mM dNTP mix were added to each tube from the DNase I reaction and incubated at 65°C for 5 minutes, and then placed the tubes on ice. During the 5 minutes, I created master mix for cDNA generation: 4µl 5x First Strand Buffer, 1µl 0.1M DTT, 1µl RNaseOUT (40U/µl) and 1µl SuperScriptIII. 7µl of master mix was added into each reaction tube on ice. 21ul of mixture was then transferred to 96-well PCR plate. Program for cDNA synthesis was as follows: 10 minutes at 25°C, 40 minutes at 50°C, 5 minutes at 85°C, and held at 4°C.  21 3.10 qPCR Using Express Sybr Green ER qPCR with ROX, every sample was analyzed in triplicates.  For each triplicate, master mix was made: 15µl of Sybr green mix, 12.6µl of ddH2O, 0.6µl of 10uM forward primer, 0.6µl of 10µM reverse primer, and 1.2µl of cDNA. Then, 10ul was aliquoted into each well. For analysis on HT7900, the program was set to: Stage 1: 2 minutes at 50°C, Stage 2: 2 minutes at 95 °C, Stage 3: 15 seconds at 95°C, 1 minute at 60°C, Repeats 40. Stage 4: Dissociation stage. 3.11 Immunoprecipitation Cells were washed twice with cold PBS and harvested using cell scraper in PBS. Cells were centrifuged at 3000 rpm for 5 minutes at 4°C. Supernatant was aspirated. Lysis buffer (TBS 1X, EDTA 1mM, NP-40 0.1%v/v, deoxycholate 0.05% w/v, Na3VO4 2mM, β-glycerohposphate 10mM, Roche Protease Complete Inhibitor) was added to cell pellet and nutated for 30 minutes at 4°C. The lysate was centrifuged at 20,000 x g for 15 minutes at 4°C. Lysate was clarified by passing through 0.45µm nylon syringe filter. Then, the lysate was pre-cleared by adding 50% slurry of Sepharose 4B and nutated for 1 hour at 4°C. The tubes were centrifuged at 3000rpm at 4°C for 3 minutes. Supernatants were transferred to a fresh tube. Supernatant was immunoprecipitated with GFPTrap, anti-V5 agarose or M2 Flag beads as appropriate and nutated overnight at 4°C. Beads were washed with lysis buffer and eluted with 2X SDS-PAGE Sample Buffer by heating it at 95°C for 5 minutes. Proteins were separated by electrophoresis using 8%- 12% SDS NuPage Gel and visualized by colloidal Coomassie Blue stain.  22 3.12 Mass spectrometry Proteins for MS analysis were recovered from SDS-PAGE gel slices.  Gels slices were cut into 1mm by 1mm cubes and placed in 96-well plate. Drops of water were added to each well to prevent dehydration during the cutting of gels. After all the gels were cut, the water was carefully removed from the gel cut samples with a plastic pipette and discarded. 200µl of acetonitrile was added to dehydrate the gel pieces for ~5min at room temperature (RT). When dehydrated, the gel pieces had an opaque white colour and were significantly smaller in size. Carefully removed the acetonitrile from the sample with a plastic pipette and discarded. The gel pieces were completely dried at ambient temperature in a vacuum centrifuge for 3 minutes. 30µl of 10mM DTT was added to reduce the protein for 30min at RT. Carefully removed the DTT from the sample with a plastic pipette and discarded. 30µl of 100mM iodoacetamide was added to alkylate the protein for 30min at RT. Carefully removed the iodoacetamide from the sample with a plastic pipette and discarded. 200µl of acetonitrile was added to dehydrate the gel pieces for 5min at RT. When dehydrated, the gel pieces had an opaque white colour and were significantly smaller in size. Carefully removed the acetonitrile from the sample with a plastic pipette and discarded. Gel pieces were rehydrated in 200µl of 100mM ammonium bicarbonate (AmBic) and incubated for 10 minutes at RT. Carefully removed the AmBic from the sample with a plastic pipette and discarded. 200µl of acetonitrile was added to dehydrate the gel pieces for 5min at room temperature. When dehydrated, the gel pieces had an opaque white colour and were significantly smaller in size. Carefully removed the acetonitrile from the sample with a plastic pipette and discarded. The gel pieces were completely dried at ambient temperature in a vacuum centrifuge for 3 minutes. Prepared trypsin reagent by adding 1mL of ice-cold 50mM AmBic with 10%  23 acetonitrile to 20µg of trypsin. Trypsin solution was kept on ice until use. 30µl of the trypsin solution was added to the sample and allowed the gel pieces to rehydrate on ice for 10 minutes. Once the gel pieces were rehydrated by the trypsin, excess trypsin solution were removed. 5µl of 50mM AmBic was added to the sample. Digestion was performed overnight at 37°C. The peptides produce by the digestion was extracted in three steps. 30µl of 50mM AmBic was added to the sample and incubated the sample for 10 minutes. The supernatant was collected in a 96- well plate. 30µl of extraction buffer was added to the wells containing the gel pieces and incubated for 10 minutes. The supernatant was collected and combined in the white 96-well plate. Second 30µl of extraction buffer was added to the well containing the gel pieces and incubated the sample for 10 minutes. Supernatant was collected and combined in the white 96- well plate. Samples were vacuum centrifuged in Speed Vac at 55°C until dried (usually 2-3hr). The samples were then analyzed on a 4000 QTrap mass spectrometer. 3.13 Western blot Samples were loaded into 4%-12% NuPage Gel or 3%-8% Tris-Acetate gel for protein separation through gel electrophoresis. The gel was ran at 150V for 1 hour in NuPage or Tris- Acetate running buffer. The gel was transferred to nitrocellulose membrane over night at 100mA.The membrane was placed in blocking buffer for 1 hour. Primary antibody was added and incubated for 1hour. The membrane was washed with TBS-tween for 5 minutes and repeated 3 times. The membrane was incubated in secondary antibody diluted in blocking buffer for 1 hr. The membrane was washed with TBS-tween for 5 minutes and repeated 3 times. Imaged on Odyssey scanner.  24 3.14 E1A splicing assay cDNA was prepared from HeLa cells 48 hours after transfection by the modified Qiagen protocol (Section 3.7-3.9). 1µl of cDNA was used as the template for PCR using the E1A forward primer and E1A reverse primer to detect E1A mini-gene mRNA splicing products. PCR condition were: 98°C for 30 seconds, 98°C for 10 seconds , 64°C for 10 seconds, 72°C for 1 minute, repeated 25 cycles, 72°C for 5 minutes, 4°C forever. Following the PCR, 10µl of amplicon was separated by size on 6% native acrylamide gel (filtered 7mL of 10X TBE, filtered 14mL of 39.5:1 Bis- acrylamide, 560µl of 10% ammonium persulfate, 30µl TEMED, final volume of 70mL). Gel electrophoresis was performed at constant 13W for 1.5hour. Then, the gel was stained in fresh 0.0001% Sybr Green for 15 minutes and imaged on a FujiFilm FLA-7000.   25 4  Identification and validation of CDK13 interacting proteins Overview CDK12 and CDK13 are known to affect alternative splicing 4,13. The Morin lab showed that CDK12 interacts with splicing factors through immunoprecipitation (IP) – mass spectrometry (MS) studies. Since CDK12 and CDK13 are homologous and are both large CDK proteins that contain a splicing factor RS domain and a kinase domain, I hypothesized that CDK13 would have the same or similar protein - protein interactors (PPI) as CDK12. In order to test this hypothesis, I constructed epitope-tagged CDK13 in order to express and to purify CDK13 complexes in mammalian cells. Once they were confirmed to be expressed in HEK293A cells, CDK13 protein complexes were immunoprecipitated from cell lysates. This process should purify CDK13 and any other proteins that may associate with CDK13. To maximize the identification of CDK13 and its interacting proteins by mass spectrometry (MS), CDK13 and its interacting proteins were separated by size using sodium dodecyl sulfate – polyacrylamide gel electrophoresis (SDS – PAGE). Then, the proteins were digested with trypsin and analyzed by MS to identify the proteins that associated with CDK13. My results showed the splicing factors that interacted with CDK12 were also identified as CDK13 PPIs. To validate the interactions, differentially tagged PPIs were co-expressed with CDK13 in mammalian cells and IP’d for either CDK13 or the PPI and analyzed it by western blot. These results confirmed that CDK13 interacts with splicing factors in vivo.  26 4.1 Construction of epitope tagged CDK13 In order to IP CDK13, three differentially tagged CDK13 were constructed – Flag-CDK13, V5- CDK13 and GFP-CDK13. All three were constructed using the Invitrogen Gateway system, where the gene insert in donor vector was recombined into the destination vector using LR clonase. Once CDK13 was inserted into acceptor vector that expressed different tags, the constructs were expressed in mammalian tissue culture using several different transfection methods.  The donor vector containing CDK13 was obtained from Open Biosystems (pDONR CDK13 Cat:#100068276) 4.1.1 Flag-CDK13 CDK13 has a transcript size of 6985bp and ORF cDNA of 4473bp. After the LR reaction between pDONR CDK13 and the Flag destination vector, LMBP 4704, the final plasmid size was 10250bp. To confirm the transfer by restriction mapping, two different enzymes were used: NcoI and HindIII. NcoI cuts the LMBP4704 at four different sites (position 403, 692, 3446, 4181) and CDK13 at one site (position 4324). HindIII cuts LMBP4704 at one site (position 682) and CDK13 at one site (position 1497). When the recombined plasmid was digested with NcoI and HindIII, the expecting fragment sizes were 3344bp, 2827bp, 1642bp, 1413bp, 735bp, 279bp, and 10bp. The DNA agarose gel showed all the expected sizes except for 297bp and 10bp (Figure 4.1). The two fragments, 279bp and 10bp, were too small to be detected on the 0.8% agarose gel.  27 4.1.2 V5-CDK13 After the LR reaction between pDONR CDK13 and the destination vector pcDNA3.1 nV5-Dest, the final plasmid size was predicted to be 11252bp. For restriction mapping, DraIII and HindIII were used. DraIII cuts the pcDNA3.1 nV5-Dest at one site (position 3240). HindIII cuts pcDNA3.1 nV5-Dest at one site (position 903) and CDK13 at one site (position 1463). The expecting fragment sizes of 6255bp, 3434bp, and 1563bp were observed (Figure 4.2). 4.1.3 Green fluorescent protein (GFP)-CDK13 After the LR reaction between pDONR CDK13 and the destination vector pcDNA6.2 GFP DEST, the final plasmid size was predicted to be 11,573bp. For restriction mapping verification, SfiI was used. SfiI restriction sites in pcDNA6.2 GFP DEST are located near the recombinant sites and will release the gene insert. The expecting fragment sizes of 4,473bp and 5,996bp were observed (Figure 4.3).  28  Figure 4.1 Verification of Flag-CDK13 construction by digesting with HindIII and NcoI. Each clone was digested and ran on 0.8% agarose gel, stained with 0.0001% Sybr Green. The double digest resulted in seven different fragments. However, 297bp and 10bp are too small to be detected on 0.8% agarose gel. The numbers indicate different clones.  Figure 4.2 Verification of V5-CDK13 construction by digesting with DraIII and HindIII. Each clone was digested and ran on 0.8% agarose gel, stained with 0.0001% Sybr Green. The double digestion resulted in three different fragments. The numbers indicate different clones.  29  Figure 4.3 Verification of GFP-CDK13 plasmid construction by digesting with SfiI. Each clone was digested with SfiI and ran on 0.8% agarose gel, stained with 0.0001% Sybr Green. The digestion resulted in two different fragments: The upper fragment is the destination vector and the lower fragment is CDK13. The numbers indicate different clones. 4.2 Expression of CDK13 in mammalian cell The V5, Flag and GFP tagged CDK13 gene constructs were expressed in the mammalian cell, HEK293A. Whole cell lysates were then analyzed for CDK13 expression by western blot using the appropriate anti-tag antibody. The expected protein size of CDK13 is ~180kDa. Depending on the tag size, differentially tagged CDK13 will slightly differ in protein size. Once expression of CDK13 protein was confirmed, it was used in the immunoprecipitation study. 4.2.1 Flag-CDK13 expression For Flag-CDK13, the first four clones from LR reaction were selected for expression in HEK293A. The anti-Flag M2 antibody identified Flag-CDK13 band and near the 188kDa marker. Due to the high expression of Flag-CDK13 clone 4 (Figure 4.4), clone 4 was used for future experiments.  30 4.2.2 GFP-CDK13 expression For GFP-CDK13, the two clones were selected to transfect HEK293A and tested for expression using an anti-GFP antibody to identify GFP-CDK13. Both plasmids produced proteins of the expected size of ~200kDa (Figure 4.5) due to addition of that GFP protein that adds ~28kDa. I also monitored GFP-CDK13 expression by fluorescent microscopy. Expression of the vector containing only GFP showed that the entire cell fluoresced for GFP transfected cells, while for GFP-CDK13 transfected cells, only a nuclear portion of the cell fluoresced (image not shown). 4.2.3 V5-CDK13 expression For V5-CDK13, two clones were selected for expression in HEK293A. Using an anti-V5 antibody, bands were observed at ~180kDa consistent with V5-CDK13. For this experiment, V5- FOXL2 was used as a positive control for the V5 epitope (Figure 4.6).  31  Figure 4.4 Confirmation of expression of Flag-CDK13. Expression of four different clones in HEK293A using PEI transfection. Whole cell lysates were run on 8%-12% NuPage gel and transferred to nitrocellulose membrane. Western blot probed with anti-Flag M2 antibody, followed by anti-rabbit secondary antibody. The numbers indicate different clones. GFP-CDK13 was used as a positive control to look under the fluorescent microscope for transfection efficiency (image not shown) and its lysate was used as a negative control.  Figure 4.5 Confirmation of expression of GFP-CDK13 in HEK293A. Two different clones of GFP- CDK13 were expressed in HEK293A using lipofectamine transfection method. Whole cell lysates were run on 8%-12% NuPage gel and transferred to nitrocellulose membrane. Western blot probed with mouse anti-GFP antibody and then with anti-mouse secondary antibody. The arrow indicates CDK13.  32  CDK13     FoxL2  Figure 4.6  Confirmation of expression of nV5-CDK13. Expression of two different clones of V5- CDK13 clone #1 and #3 in HEK293A using Lipofectamine 2000 transfection method. Whole cell lysates were run on 8%-12% NuPage gel and transferred to nitrocellulose membrane. The membrane was probed with mouse anti-V5 antibody, and then anti-mouse secondary antibody. V5-FOXL2 was positive control for V5 tag. 4.3 Immunoprecipitation (IP) and mass spectrometry (MS) of CDK13 protein complexes CDK13 and its appropriate controls were expressed in HEK293A at a large scale (four 10cm plates) sufficient for IP and identification of MS. After 48hours post-transfection, the cells were harvested, lysed in IP-MS buffer and incubated overnight with appropriate antibody. The proteins were eluted according to our in-house protocol and the eluents were analyzed by SDS- PAGE to separate the proteins by size. The gels were then sliced into smaller pieces and digested  33 with trypsin into peptides to facilitate mass spectrometry analysis. The corresponding empty vector was used as a negative control. GFP-CDK13 and its corresponding negative control, GFP, were IP’d with GFPTrap. Because GFP is ~28kDa, the final mass of GFP-CDK13 was ~206kDa. Three separate experiments were performed for reproducibility. The GFP-CDK13 bait protein was observed near the 220kDa marker in each replicates (Figure 4.7). The gel was sliced into 1mm by 1mm size pieces and processed for mass spectrometry analysis with trypsin. Unfortunately, Flag-CDK13 and V5- CDK13 were IP’d with low efficiency. Flag-CDK13 could not be detected and only a minimal amount of V5-CDK13 was detected (Figure 4.8). Nevertheless, Flag and V5 tagged CDK13 IPs were analyzed by MS but showed only minimal levels of bait protein and PPIs (discussed below). a) b) c) Figure 4.7 Coomassie blue staining of GFP-CDK13 IP sample. IP eluent is run on 8%-12% NuPage gel. a) GFP-CDK13total lysate IP’d and its corresponding negative sample (MS0158) b) GFP-CDK13 nuclear fraction IP’d and its corresponding negative sample (MS0173) c) GFP-CDK13total lysate IP’d and its corresponding negative sample (MS0190)  34 a)  b) Figure 4.8 Coomassie blue staining of V5-CDK13 and Flag-CDK13 IP sample. IP eluent is run on 8%-12% NuPage gel. a) nV5-CDK13 total lysate IP’d with agarose V5 beads and its corresponding negative sample b) Flag-CDK13 total lysate IP’d with M2 flag beads and its corresponding negative sample (MS0173) 4.3.1 CDK13 IP-mass spectrometry (MS) MS was used as an unbiased approach to identify the interacting partners in CDK13 complexes purified from HEK293A cells. MS spectra were matched to human proteins using the Mascot algorithm. The proteins that were identified in the negative control were considered to be background proteins and were subtracted from the list of proteins that were identified in the GFP-CDK13 IP. Since CDK13 is similar to CDK12, I predicted that CDK13 would have similar interacting protein as CDK12. The IP was found to be inefficient for V5-CDK13 and Flag- CDK13 and as a result, there were only low levels of CDK13 and its interacting cyclin, CCNK, and splicing factors could not be detected.  35 On the other hand, the GFP-CDK13 IPs were very efficient and MS analysis showed abundant amount of proteins that co-IP’d with CDK13. As predicted, many proteins that are splicing factors co-purified with CDK13. The proteins identified were: CDC5L, PRP19, RBM25, SRP55, FBP11 and its interacting partner, Cyclin K (Table 4.1). Table 4.1 CDK13 interactions identified by IP-MS. Over-expression of GFP-CDK13 were isolated by IP and analyzed by MS for interacting proteins. The number of unique peptides (in bold) and the number of total peptides are shown for both the bait CDK13 and its interacting proteins, followed by the Mascot score in parentheses’. CDK13 interactions identified by IP-MS in HEK293A CDK13 Bait Protein Unique Peptides: Total peptides (Mascot Score)  Prey Proteins Unique Peptides: Total peptides (Mascot Score)  CCNK SRP55 CDC5L PRP19 FBP11 RBM25 GFP-CDK13 (MS0158) 74:355 (4522.4)  13:15 (567.4) 10:10 (539.4) 7:8 (265.1) 0 15:16 (692.5) 12:12 (582.1) GFP-CDK13 nuclear fraction (MS0173) 57:139 (3267.4)  0 8:9 (388.0) 4:4 (142.0) 8:8 (326.8) 3:3 (84.8) 8:8 (293.5) GFP-CDK13 (MS0190) 64:237 (3793.8)  6:10 (258.7) 9:16 (464.2) 6:7 (204.0) 4:4 (173.3) 7:7 (241.8) 6:7 (317)  4.4 Expression of CDK13 interacting proteins in mammalian cells Based on the IP-MS data for CDK13 PPIs, four interacting proteins, CCNK, CDC5L, PRP19, and RBM25 were chosen for study. As CDK13’s interacting cyclin, CCNK would be required to activate kinase activity of CDK13. CDC5L and PRP19 are known splicing factors that are required to activate the spliceosome from complex B to complex B*. RBM25 was found to alter alternative splicing patterns in some studies. The plan was to first verify the CDK13 – PPI interactions identified by IP-MS then, hopefully, to perform functional experiments. However, before any of these experiments could be done, I needed to express constructs containing these  36 genes in mammalian cells. Because the same proteins were identified for CDK12 the constructs were already available for use. These constructs were tested to confirm their expression in HEK293A. The cDNAs available for CCNK, CDC5L, PRP19, and RBM25 were inserted in the V180 and V181 destination vectors. V180 adds a N-terminal Flag tag and V181 adds a C-terminal Flag tag. The plasmids were transfected into HEK293A cells and total cell lysate was analyzed by western blot using the anti-Flag M2 antibody. RBM25 protein size is 100kDa and PRP19 is 50kDa. For my initial studies N-terminal Flag tagged RBM25 and PRP19 were chosen due to better expression (Figure 4.9 lane 1 and 3). C-terminal Flag tagged PRP19 had higher background compared to PRP19 and C-terminal Flag tagged RBM25 had lower expression (Figure 4.9 lane 2 and 4). The empty backbone vectors V180 and V181 were used as negative controls. RBM25- Flag, V180 and V181 showed a band at ~50kDa, which was a result of the Flag-PRP19 sample leaking into those gel lanes during gel loading.  37  Figure 4.9 Expression of N- or C-terminus tagged flag interacting proteins. The entire cell lysate was ran on 8%-12% NuPage Gel, and transferred to nitrocellulose membrane. The membranes were probed with anti-flag M2 antibody. V180 and V181 are empty vectors to detect any background signals. The proteins are boxed. 4.5 Validation of CDK13 interactions via IP-WB Although the IP-MS experiment data were reproducible, it needed to be validated by a different method to ensure that the results from IP-MS were not artifacts. In order to validate the IP-MS data, IP-WB analysis was performed. Constructs of CDK13 PPIs containing Flag-tag and V5- CDK13 were co-transfected into HEK293. Flag-tagged PPIs were IP’d with an anti-Flag antibody and the eluent was analyzed by western blot with a V5 antibody to detect the presence  38 of V5-CDK13. This result showed that CDK13 interacts with CCNK, PRP19, CDC5L, and RBM25 (Figure 4.10). I then checked to see if PRP19 and CDC5L will IP together with CDK13 since PRP19 and CDC5L exist as a complex in cells. V5-CDK13, Flag-PRP19 and Flag-CDC5L are co-transfected together and IP’d with a V5 antibody, both PRP19 and CDC5L were observed (Figure 4.11). The 3-way interaction IP-WB showed the yield of PRP19 and CDC5L were more efficient when they were co-expressed. 4.5.1 Validation of CDK13 2-way interaction by IP-WB V5-CDK13 was co-transfected with the Flag-tagged interacting proteins. The antibody eluents were run on SDS-PAGE for western blot analysis. The western blot was probed with anti-V5 antibody, the V5-CDK13 protein was detected near the 188kDa marker (Figure 4.10).$CCNK and RBM25 showed strong interaction with CDK13, whereas CDC5L and PRP19 showed little or no interaction $(Figure 4.10$a). The same membrane was re-probed with anti-Flag antibody to confirm the pull-down of the bait proteins (Figure 4.10 b). In this experiment an abundant amount of PRP19 was pulled down but CDK13 was almost undetectable. With CDC5L, there was a relatively less amount of CDC5L compared to PRP19, but CDK13 was still observed at a minimum level.  39 a)     b) Figure 4.10 CDK13 interacts with differentially tagged interacting proteins. IP of interacting proteins a) Western blot probed for CDK13 (anti-V5 antibody) b) Western blot probed for interacting proteins (anti-flag M2 antibody) to detect the level of bait protein. The interacting proteins are boxed. IP: anti-flag WB: anti-V5  40 4.6 CDK13 IP-WB 3-way interaction PRP19 and CDC5L interact with each other in the Nineteen spliceosome sub-complex 37. My 2- way interaction results showed that the precipitation of CDK13 was weak with PRP19 and CDC5L when co-expressed individually with these proteins. Here, I did a three-way transfection to see if the proteins interact as a three protein complex. The transfection consisted of PRP19, CDC5L and CDK13. RBM25, CCNK and CDK13 were also transfected together to test their potential interaction as a three protein complex. The samples were IP’d with anti-V5 agarose beads to precipitate V5-CDK13 and then probed for the Flag-tagged interacting proteins. CDK13 was successfully observed in individual PRP19 and CDC5L transfections, but PRP19 or CDC5L were observed (Figure 4.11a lane 7, 8). However, when all three were transfected together a greater amount of PRP19 and CDC5L was observed to interact with CDK13 (Figure 4.11a lane 6). For the RBM25 and CCNK co-transfection, the transfection of RBM25 was very inefficient (Figure 4.11b lane 9, 10, 11) and it was not possible to draw a conclusion about the interaction between the three proteins. However, when only RBM25 and CDK13 were transfected, V5- CDK13 did not pull down Flag-RBM25, even through the Flag-RBM25 was highly expressed. (Figure 4.11a lane 5 and b lane 5).  The difference seen here as to the result above (section 4.5.1) was discussed below. Since the overall V5-CDK13 pull-down efficiency was consistent for each sample (Figure 4.11c), IP inefficiency could not have been the reason for lack of RBM25 in western blots during three-way transfection.  41 a) b) c) Figure 4.11 CDK13 interacts as a complex with CDC5L and PRP19. The eluent was run on 8-12% NuPage and transferred to nitrocellulose membrane a) IP of V5-CDK13 (anti-V5 agarose beads) and WB probed for interacting proteins (anti-flag antibody) to detect CDK13 interactions. b) Non-bound sample from IP, WB probed for interacting proteins (anti-flag antibody) to detect the level of expression and unbound protein c) IP of V5-CDK13 (anti-V5 agarose beads) and WB probed with for CDK13 (anti-V5 antibody) to detect the efficiency of pull-down  42 4.7 CDK13 PPI study discussion In this study, three differentially tagged CDK13 versions were created: Flag-CDK13, V5- CDK13 and GFP-CDK13. GFP-CDK13 was used for IP-MS analysis to identify CDK13 interacting proteins. The IP of GFP-CDK13 with GFPTrap was more efficient than V5- CDK13 or Flag-CDK13 (Figure 4.7 b, c). When these samples were analyzed by MS, the V5-CDK13 and Flag-CDK13 proteins precipitated fewer proteins compared to GFP- CDK13. Therefore, GFP-CDK13 was chosen for the reproducibility IP-MS studies. The analysis of the IP-MS data excluded proteins identified in the negative control, in this case GFP, to eliminate any unspecific proteins to create a list of candidate interacting proteins that were unique to GFP-CDK13. Three different fusion tags were used because any one epitope may cause disruption in the structure of the protein or it may interfere with the interaction of proteins. For this IP-MS study, GFP-CDK13 had the best IP efficiency for MS analysis. CDK13 and CDK12 have RS domain and RRM motifs, which are prominent in splicing factors 38. These domains are also important for binding to other splicing factors.  Due to the similarity between CDK13 and CDK12 (Figure 1.2), I expected the two proteins to have similar PPIs. The Morin lab showed that CDK12 interacts with CCNK and the splicing factors, PRP19, RBM25, FBP11 and SRP55 (Table 1.1). As predicted, IP-MS analysis showed that CDK13 interacts with CCNK and the splicing factors – PRP19, CDC5L, RBM25, FBP11, and SRP55. PRP19 and CDC5L exist as a complex in cells and this complex is required for activation of the spliceosome complex  43 B. Previous studies on RBM25 had shown that RBM25 affects alternative splicing of the Bcl-x gene. FBP11 and SRP55 are also well-documented splicing factors. The cyclin interaction partner of CDK13, Cyclin K was identified in this study as the 70kDa Cyclin K. The smaller 40kDa isoform of CCNK was not identified (Table 4.1). These data support other studies that show the longer isoform of CCNK interacts with CDK13 9. My IP-MS data showed that CCNK was detected in the whole lysate of IP-MS sample but not in the nuclear fraction (Table 4.1). This suggests CCNK activates the kinase activity of CDK13. After identifying the PPIs of CDK13 by IP-MS, I validated the candidate interactions by co-expression V5-CDK13 and Flag-tagged PPIs for IP-WB analysis. IP-WB analysis showed CDK13 and CCNK interact and that each can precipitate the other (Figure 4.10). This suggests CCNK activates the kinase activity functions of CDK13. For the CDK13 and RBM25 interaction, Flag-RBM25 successfully precipitated V5- CDK13 (Figure 4.10) but not the other way around (Figure 4.11). This may be because the V5 tag was inaccessible or the interaction of the proteins hindered access to the V5 tag. Note that the identification of PPIs by V5 IP of V5-CDK13 was inefficient. Nonetheless, the Flag-RBM25 IPs validated the initial GFP-CDK13 results that CDK13 and RBM25 are interacting proteins. The interaction of CDK13 with RBM25 suggests that CDK13 may play a role in the substrate specific alternative splicing function of RBM25 36 The interaction of CDK13, PRP19 and CDC5L appear to be a three-way interaction. Since PRP19 and CDC5L exist as a complex, it is likely that when one is precipitated the  44 other is co-precipitated. My data suggested that CDK13 interacts with both PRP19 and CDC5L. The whole cell lysates of GFP-CDK13 IP-MS data showed a higher score for CDC5L and a lower score for PRP19 (Table 4.1). However, the nuclear fraction GFP- CDK13 sample showed the reverse, where CDC5L presented with a lower score than PRP19. These data made if difficult to make any conclusions about interaction contacts between the three proteins. To further test the possibility of existence of all three proteins as a complex, IP-WB was performed by transfecting HEK293A with all three genes. The western blot suggested that with CDK13 as the bait protein, CDC5L and PRP19 were precipitated with greater efficiency when both were expressed together rather than when CDC5L and PRP19 were individually expressed with CDK13 (Figure 4.10). PRP19/CDC5L is an important splicing factor in the spliceosome cycle. The complex is required to activate the splice complex B to B* through remodelling of the snRNP interactions 39. The interaction of CDK13 with PRP19 and CDC5L suggested that CDK13 may be part of a bigger complex of PRP19/CDC5L and may also play a role in activating or regulating the spliceosome complex.  Figure 4.12. CDK13 interaction model with protein-protein interactors. The proteins in red boxes have been identified and validated by IP-MS and IP-WB respectively. The proteins in grey boxes have been identified by IP-MS, yet to be validated.  45 4.8 CDK13 interaction study conclusion This study showed that CDK13 interacts with CCNK, RBM25, PRP19 and CDC5L as demonstrated by both IP-MS and IP-WB experiments. My data also suggest that CDK13, PRP19, and CDC5L form a three protein complex. The two splicing factors, FBP11 and SRP55, detected by IP-MS were not confirmed for their interaction with CDK13 by IP-WB. Future validation of these interactions may provide a better insight in CDK13s role in the spliceosome complex. Another study that remains to be performed is to validate the CDK12 IP-MS data to ensure that those interactions are not artifacts.  Once the CDK12 and CDK13 interactions are validated, we can investigate how these interactions are important for the spliceosome reaction and alternative splicing.  46 5 Expression of mutant CDK12 Overview My initial project was to study the functional role of CDK12’s kinase domain. Several studies have shown the importance of kinase domain of CDK12 in transcription. However, no studies focused on CDK12’s kinase domain in alternative splicing (AS). Currently, the studies on CDK12’s effect on AS were performed with the Adenovirus E1A mini-gene splicing assay. When CDK12 was over-expressed in mammalian cells, the splicing pattern of the E1A mini-gene differed than of the control. CDK12 has unique feature for a CDK – it has a RS domain, a feature commonly found in AS regulators. Exploring the role of CDK12’s kinase domain in AS can reveal many aspects of CDK12 function in alternative splicing. It can show us: 1. If CDK12 is phosphorylating any spliceosomal splicing factors; 2. If kinase domain activity is required for CDK12’s role in splicing; 3. If CDK12 can behave as a SR protein splicing factor without a functional kinase domain. The planned assay to explore CDK12’s function in AS was an in vitro splicing assay where the presence and amounts of CDK12 could be changed.  Thus several reagents were required: different mutants of CDK12, semi-purified proteins of the mutant versions of CDK12, the means to deplete CDK12 protein, and a splicing assay to monitor the effect of mutant CDK12 in AS. This section describes my progress towards these goals. Three different CDK12 expression vectors were created: wild-type (or full-length), kinase dead, and kinase deleted (or kinase knock-out). The kinase dead version had two different inactivating mutations introduced into the kinase domain. The kinase dead  47 mutant was created previously and was ready for use. I created the kinase deleted construct by cloning the regions before and after the kinase domain and ligating them together. To make protein all three forms of CDK12 was inserted into a baculovirus vector for expression in insect cells and into the pcDNA vector for expression in mammalian cells. For the in vitro splicing assay, I needed a method to deplete CDK12 from cell extracts so that I could observe the effect of added mutant CDK12 protein in the assay. To do this I pursued two different methods: creating an anti-CDK12 antibody for depletion of the protein from extracts (Chapter 5) and a siRNA CDK12 knock-down reagent to deplete CDK12 from cell extracts and for an in vivo AS assay (Chapter 6). 5.1 CDK12 mutant constructs To test the function of CDK12’s kinase domain in alternative splicing (AS), three different types of CDK12 were required – wild-type (WT or FL), kinase dead (KD), and kinase deleted (ΔK or KO). WT CDK12 was ready for use, KD CDK12 was already created through site-directed mutagenesis, and I had to create KO CDK12. Because the AS study was going to be done in vitro by addition of exogenous CDK12 protein, I needed a method to produce the epitope-tagged mutant CDK12 proteins and purify them. Therefore, the CDK12 mutants were inserted into two different baculovirus for protein expression in Sf9 insect cells. The proteins would be purified by fast-protein liquid chromatography (FPLC). The CDK12 mutants were also cloned into pcDNA3.1 vector for in vivo splicing assay in mammalian cells. WT or full length (FL) and KD CDK12 were amplified with primers PTXSC007 and PTX008 for the pIEX2 vector and PTXSC022/PTXSC010 for the pIEX9 vector. The  48 plasmids pIEX2 and pIEX9 are Sf9 insect cell expression vectors that allow the fusion of epitope tags to gene inserts for affinity purification. To create ΔK CDK12 the N-terminal region before the kinase domain and the C-terminal region after the kinase domain (Figure 5.1) were amplified by PCR and ligated together to create a kinase deleted CDK12 insert.  The inserts were then cloned into pIEX2 to create a GST-tag, S-tag, and His-tag fusion to the N-terminus of CDK12 and into pIEX9 create C-terminal His-tag and Strep-tag fusion constructs. The vector inserts were verified by restriction mapping (Figure 5.2 and Figure 5.3). Because the kinase domain of CDK12 spans nucleotides 2206bp to 3076bp, the final size of kinase-deleted CDK12 is 3603bp. The WT and KD were also cloned into pIEX2 and pIEX9 baculovirus vector for expression in insect cells. Later, all three CDK12s were cloned into pcDNA3.1 for protein expression in mammalian cells and were confirmed by restriction mapping (result not shown).  49  Figure 5.1 CDK12 and its different mutant forms. This diagram shows the three different forms of CDK12. Kinase-dead CDK12 has two mutations created by site-directed mutagenesis and kinase-deleted has the entire kinase domain deleted resulting in smaller size. The numbers represent the amino acids.  50  Figure 5.2 Restriction digest of pIEX9 after inserting three different CDK12s. Plasmid digests were analyzed on a 0.8% agarose gel stained with 0.0001% Sybr Green. Full-length (WT) CDK12 is digested with NotI  and NcoI, Kinase deleted (KO) is digested with NotI and SalI, and Kinase Dead (KD) is digested with NcoI and NotI. The numbers indicate different clones.  NotI NcoI  51  Figure 5.3 Restriction digest of pIEX2 after inserting three different CDK12s. Plasmid digests were analyzed on a 0.8% agarose gel stained with 0.0001% Sybr Green. Full-length (FL) CDK12 is digested with HindIII, NotI, and BamHI;  kinase dead (KD) is digested with BamH, BaeI, and NotI; Kinase deleted (KO) is digested with NotI and BamHI. The numbers indicate different clones.  52  5.2 Baculovirus expression test After the CDK12 mutants were successfully inserted into pIEX baculovirus vectors, their expression in Sf9 insect cells were tested and analyzed by western blot. Once expression was confirmed, then large-scale transfection could be done to produce large amounts of CDK12 mutants for FPLC purification. For Sf9 cells growing at an exponential rate from suspension culture, 1 million cells per well were seeded in a 6-well plate one hour prior to transfection. Cell counts were done to ensure Sf9 were within the linear range of the growth curve (Figure 5.4 day 2 and 3). The cells were harvested after 48 hours post-transfection and tested for its expression by running the entire cell lysate in SDS-PAGE and probing it with anti-CDK12 (anti-crk7) antibody (Pines lab). GST protein is 25kDa, so GST-tagged CDK12s should appear 25kDa higher (at ~200kDa) than the CDK12 protein alone. Indeed, GST-tagged WT CDK12 and KD CDK12 appeared around 200kDa, and ΔK CDK12 protein appeared at ~180kDa (Figure 5.5 lane 1, 2, 3). The C-terminus His-tagged WT CDK12 was observed at ~180kDa and ΔK CDK12 at ~160kDa. His-tagged KD CDK12 did not express (Figure 5.5 lane 4, 6, 5).  53  Figure 5.4 Sf9 growth curve over 6 days. Sf9 growing in suspension cells were counted to determine their growth rate. Cells were counted using Trypan Blue dye.   Figure 5.5 Different forms of CDK12 expressed in Sf9 cells analyzed by western blot. Total cell lysate was run on 3% - 8% tris-acetate gel, and transferred to nitrocellulose membrane. The membrane was probed with anti-crk7 antibody (Novus) and then with anti-mouse antibody. Proteins are boxed. pIEX2 FL=200kDa, KD=200kDa, KO=180kDa; pIEX9 FL=180kDa; KD=180kDa; KO=160kDa  54 5.3 CDK12 expression in mammalian cells For studying CDK12 in vivo, the CDK12 mutants needed to be expressed in mammalian cells. The mutant cDNAs were inserted into the pcDNA3.1 mammalian CMV expression vector. These were transfected into HEK293A cells and the whole lysates were analyzed for CDK12 expression by western blots. HEK293A cells were transfected and harvested at 48 hours post-transfection and entire cell lysate was run on SDS-PAGE for western blot analysis. The anti-sera (Section 5.4) were used to detect CDK12 expression. WT CDK12 and KD CDK12 were detected at 180kDa and ΔK CDK12 was detected at 160kDa (Figure 5.6).  55  Figure 5.6 Expression of CDK12 wild-type and mutant proteins in HEK293A cells. Cell lysates were run on 3%-8% Tris-Acetate gel and transferred to nitrocellulose membrane. CDK12 was detected using anti-CDK12 sera followed by anti-rabbit secondary antibody. Wild-type and kinase-dead detected at ~180kDa and kinase-deleted detected at 160kDa. The numbers depict different clone numbers. 5.4 CDK12 antibody creation A CDK12 antibody was needed for various reasons: 1. The stock of CDK12 antibody we received from the Pines lab was depleted; 2. A CDK12 antibody was needed to deplete CDK12 for in vitro splicing assays; 3. A CDK12 antibody was needed for IP and western blots. My role was to create the antigen for CDK12. The antigen was then used to immunize rabbits for the production of a polyclonal CDK12 antibody by a commercial vendor. The anti-CDK12 sera are now available for use in the lab. The antigen needed to generate a CDK12 antibody was created against amino acids 1218 to 1492. This was the same region that Pines lab created their CDK12 antibody 2. Primer  56 PTX3043 and PTXSC001 were used to clone the region from nucleotide 3652 to 4474 resulting in a 822 nucleotide amplicon, which was then inserted into the donor vector V1544 using T4 ligase.  The size and sequence was verified by restriction mapping by PacI and AscI (Figure 5.7).  Figure 5.7 Restriction digest of C-terminal domain CDK12 with PacI and AscI. Ran on 0.8% agarose gel stained with 0.0001% Sybr Green. The upper band at ~5kb is the V1544 and the lower band ~0.8kb is the CTD CDK12. The lanes correspond to different clones. The antigen insert containing V1544 was named CTD CDK12. BL21RP cells transformed with CTD CDK12 were plated on LB with carbenicillin plates for selection. From the selection plate, 2 to 3 colonies were pooled together for protein expression. When the culture optical density read 0.5 on 600nm, IPTG and arabinose were added to induce transcription and subsequent protein translation. After collecting the sample every  57 hour for 6 hours, it was determined that the protein expression level was at its maximum at 2 hours post-induction (Figure 5.8) by western blot.  Figure 5.8 Western blot of optimization of GST-CTD CDK12 protein expression level post- induction. Two different clones were used to express GST-CDK CDK12: 4-2 and 4-3. Samples were taken out every hour for 6 hours. Samples were lysed by freeze-thaw and sonication. Whole lysate was run on 8%-12% Nu-Page gel. For western blot analysis, anti-GST antibody was used to detect GST-tagged CTD CDK12, followed by anti-rabbit antibody The three clones (4-1, 4-2, 4-3) expressing CTD CDK12 were harvested at 2 hours post- induction and lysed for protein extraction. Since the protein was tagged with glutathione S-transferase (GST), I used a GST column on a fast protein liquid chromatography (FPLC) system to purify CTD CDK12.The protein concentration of each fraction was determined by Bradford assay. For the fractions collected, 1µg or the maximum well loading volume was loaded onto SDS-PAGE for Coomassie blue staining (Figure 5.9a) or for western blot (Figure 5.9b). The fractions used for CTD CDK12 detection for colony 4-1 were A3, A4, A5, A11 and the flowthru; for colony 4-2 fractions B1, C1, C2 and flow-through (FT); and for colony 4-3 fractions D11, D10, D9, D9 and flowthru, as  58 these had most abundant protein concentration. For the western blot, the membrane was probed with anti-GST and with the anti-rabbit secondary antibody IR800. For both types of detection, GST-CTD CDK12 was detected at ~50kDa as expected, but there were also degraded or truncated forms of GST-CTD CDK12.  The flowthru contained the proteins from entire cell lysate. Fractions containing the purified CTD-CDK12 were sent to a vendor to produce rabbit anti-CDK12 antibody sera.  59 a) b) Figure 5.9 Analysis of FPLC column fractions for CDK12 antigen expression. Each fraction was run on 8%-12% NuPage gel and stained with a) Coomassie blue or b) detected for GST-CTD CDK12 by western blot using anti-GST. The fraction number is as indicated and flowthru is indicated by FT. We received the sera from the vendor and tested for their ability to detect CDK12 by western blot. Indeed, the sera containing CDK12 antibody successfully detected all the mutants that I created (Figure 5.6). The antibody sera is now available for use for western blot. Further purification of the CDK12-antibody will be required for use in IP and/or splicing assay.  60 5.5  CDK12 study discussions CDK12 has two primary domains, the kinase domain and the RS domain. The RS domain, which is commonly found in splicing factors, play roles in protein-protein binding25,26 and the kinase domain of CDKs can phosphorylates itself or other protein substrates 40. CDK12 was previously shown to affect alternative splicing 13 and the kinase domain can phosphorylate the C-terminal domain (CTD) of RNA polymerase II during transcription 9. Here, I wanted to determine if kinase domain of CDK12 played a role in alternative splicing. To do this, different kinase mutant forms of CDK12 had to be made. WT CDK12 was created so that it can be used as a positive control. The kinase-dead (KD) CDK12 was created by site-directed mutagenesis by previous students in the Morin lab. The KD CDK12 had two different mutation sites – one in amino acid K756R where ATP-binding site resides and other in amino acid D859A, which is in the active site. These mutations cause loss of kinase activity in CDKs and caused CDK12 to lose its ability to phosphorylate substrates (Morin lab). The kinase deleted (ΔK) CDK12 was created by cloning the region before and after the kinase domain and ligating the two regions together (Figure 5.1). Although KD CDK12 will show if the kinase activity is required for regulating AS, ΔK CDK12 will show if CDK12 can act like an SR protein 25. By having kinase-dead and kinase-deleted, it would be possible to test if the kinase activity of CDK12 affects alternative splicing or if the presence of kinase or RS domain is important for regulating alternative splicing. To develop the CDK12 protein reagents for an in vitro splicing assay, Sf9 cells were transfected with CDK12 mutants (Figure 5.1). Exponentially growing Sf9 were used (Figure 5.4) for transfections, since transfection is most efficient when they are actively  61 growing. All three different forms of CDK12 expressed very well, with the exception of pIEX9 KD CDK12 (Figure 5.5). So, unless a C-terminal his-tag on CDK12 is required, N-terminal GST-tagged pIEX2 KD CDK12 is ready for future experiments. In mammalian cells, all three CDK12 expressed well (Figure 5.6). Also, for both mammalian and insect cell lines, kinase deleted (KO) CDK12 had higher expression levels than the kinase domain included versions suggesting that the lack of kinase domain may facilitate better transgene expression. 5.6 CDK12 study conclusions In this study, three different mutant of CDK12 were successfully constructed for expression in both mammalian and insect cell lines. These three forms of CDK12 can be used in future experiments to assess functional role of the kinase domain of CDK12 in alternative splicing assay and also to determine whether or not kinase domain plays a role in protein – protein interaction of CDK12. The CDK12 antibody created could detect the three different types of CDK12 in western blot. However, for its further use in assays such as in vitro alternative splicing assay and immunoprecipitation – mass spectrometry, the CDK12 antibody containing sera needs to be purified.   62 6 Development of alternative splicing assay Overview To test the effect of CDK12 mutants on alternative splicing (AS), a splicing assay was developed using the adenovirus E1A mini-gene. The E1A mini-gene has five different 5’ splice sites resulting in five different isoforms. Initially, I wanted to develop a in vitro splicing assay but realized that it was not feasible given time the constraints. So, I decided to develop an in vivo assay. Depleting the CDK12 protein for in vitro splicing would have been with CDK12 antibody I helped develop (created in section 5.4). For the in vivo assays, I needed a method to knock-down endogenous CDK12 expression; this was done by siRNA transfection. CDK12 siRNAs were already designed and confirmed previously by a co-op student in the lab. I also wanted to test CDK13 and its PPIs interaction (Section 4: Chapter 1) in the alternative splicing assay. Hence, I designed siRNAs that would knock-down CDK13 and its PPIs. Then, I optimized the E1A mini- gene spicing assay, which is now ready for use. For the CDK12 study, CDK12 was knocked-down and rescued by one of the CDK12 mutants. For CDK13 study, CDK13 and/or the PPI of interest would be knocked-down and then rescued or just overexpressed. I was able to optimize the splicing assay but was unable to obtain reproducible results for the affects of CDK12 and CDK13 on alternative splicing.  This chapter presents the results of the splicing assay development. 6.1 siRNA knock-down To study the effect of CDK12 mutants on AS and CDK13 PPI interactions on AS, knock- down of endogenous CDK12, CDK13 and its PPIs was required. I designed two siRNAs  63 for each gene that targeted regions in the 3’ UTR.  This design allowed for the ectopic re- expression of the protein in the absence of the endogenous protein. Once I confirmed that endogenous protein expression was decreased, I transfected HEK293A cells with appropriate plasmid to rescue the expression of the gene and determined if there were any changes to the alternative splicing pattern. Two different siRNAs were designed to the 3’ UTR for each gene and were transfected individually or mixed using three different transfection reagents: X-treme gene, polyethylenimine (PEI), and Lipofectamine 2000 RNAiMaxx. X-treme gene transfection reagents knocked down the expression of CDK13, PRP19 and RBM25. The other reagents were not efficient in knocking-down gene expression ( Figure 6.1). The siRNAs CDK13_5284, RBM25_3378, and PRP19_2117 were successful in decreasing the expression levels. CDC5L siRNAs were tested later on only with X-treme gene, but did not get effective knock-down.  64  Figure 6.1 siRNA transfection of interacting proteins using different transfection reagents. Blue: X-treme Gene. Red: PEI. Green: Lipo2000 RNAiMaxx. The relative expression was measured using ∆∆CT.  65 6.2 E1A mini-gene splicing assay The study was designed to test the effect of CDK12 mutants and effect of CDK13 and its PPIs on alternative splicing using the E1A mini-gene splicing assay. Although there are other splicing substrates, I choose E1A because previous studies have shown that E1A can be regulated by CDK13 and CDK12. Measuring the expression level of different splice isoforms of the E1A mRNA will determine any changes in the AS pattern. The mRNA was extracted from samples transfected with the appropriate genes, and cDNA was synthesized from the mRNA. Then, the cDNA was used as a template in a PCR reaction to amplify E1A mRNA isoforms. The amplified E1A products were run on polyacrylamide gel and measured with Fuji Multi-gauge software to quantify the levels of each isoform product. 6.2.1 Optimization E1A mini-gene has 5 different splice sites and through alternative splicing, 5 isoform exists. From the literatures it is known that the 11S and 10S isoforms are not abundant and hard to detect, whereas 13S, 12S and 9S are more abundant. I designed primers to the 1st and 6th exons of E1A, with these primers all 5 isoforms can be amplified by one PCR reaction. I optimized the number of PCR cycles to determine when the most abundant isoform became saturated. Samples for PCR cycles from 18 cycles to 35 cycles were obtained and ran on 1.5% agarose gel (Figure 6.3). The most abundant isoform was 13S and it became saturated at 25 cycles (Figure 6.4). Therefore, I selected 25 as the maximum cycle number used for the splicing assay.  66 Another optimization performed was to determine the time of harvest post-E1A transfection. Adenovirus E1A mini-gene is known to express differentially depending on the stage of the virus infection. To determine if this also holds true for my transfection protocols, I harvested the E1A transfected cells at different time-point ranging from 0 – 8 hours and then at 24hours (Figure 6.5). 48 hours was skipped since the previous transfections were done at 48 hour. The different isoforms of E1A started expressing at the 7 hour point and at 24 hours, all 5 forms were present with minimum levels of the unspliced form. When each sample was subjected to 25 PCR cycles, I saw that unlike the previous data at 48 hours (Figure 6.3), 12S was more abundant than 13S but no other differences were observed. Since the cells have to undergo multiple transfections – siRNA transfection, protein cDNA construct transfection, and E1A transfection - I decided to harvest the cells 24 hours post – E1A transfections for the splicing assay.  67  Figure 6.2. E1A mini-gene. Depicted is a figure of the E1A mini-gene with its known splice sites. There are 5 different spliced isoform that give rises to 5 different isoform: 13S, 12S, 11S, 10S and 9S.  68  Figure 6.3 PCR cycle number optimization for E1A. Samples were analyzed on a 1.5% agarose gel ran for 1hr at 100V. Five different E1A isoforms are labeled by the arrow. From top, unspliced, 13S, 12S, 11S, 10S, and 9S  Figure 6.4. PCR cycle number quantified using Fuji MultiGauge. The density minus background per area ((Q-B)/pixel2) value was used to calculate the density for three most abundant spliced isoforms: 13S, 12S and 9S.  69  Figure 6.5. Post-transfection harvest time optimization. Samples were analyzed on a 1.5% agarose gel, stained with 0.0001% Sybr Green. E1A transfected cells were harvested at indicated times to determine the optimal harvest time. Different isoforms of spliced E1As are indicated by the arrows. From top, unspliced, 13S, 12S, 10S, and 9S 6.2.2 CDK12 splicing assay To test the effect of CDK12 mutants on alternative splicing, on consecutive days the endogenous CDK12 was knocked down using siRNAs in HeLa cells, followed by rescue with CDK12 mutant transgenes, and finally E1A mini-gene transfection on the third day. This assay can show if kinase activity of CDK12 is required for CDK12’s function in AS by using the kinase dead CDK12, or if CDK12 can act like a SR protein in AS by using the kinase deleted CDK12. On the 4th day of the experiment, mRNA was extracted from the sample and cDNA was synthesized. Then, E1A and GAPDH were amplified by PCR. GAPDH was run as a control for loading and quantification. Through gel analysis and quantification, neither the KD CDK12 nor the KO CDK12 affected AS (Figure 6.6 and Figure 6.7). However, qPCR showed that the CDK12 knock-down was not efficient  70 (results not shown) and the GAPDH loading was not consistent, therefore no conclusions could be drawn for the effect of CDK12 on AS.   GADPH Figure 6.6 CDK12 E1A mini-gene splicing assay. The PCR products were analyzed on 6% native acrylamide gel and stained with 0.0001% Sybr Green. Knock down of CDK12 and rescue by different forms of CDK12s in HeLa cells. cDNA was synthesized from mRNA extraction. cDNA was used as the template for amplification of E1A products using PCR at 25 cycles.  71  Figure 6.7 Quantification of the CDK12 effect on alternative splicing. Quantitation of the depletion and rescue study of CDK12 as quantified using Fuji MultiGauge. 6.3 CDK13 splicing assay In order to determine if the interaction of CDK13 and its PPIs (Section 4: Chapter 1) affected alternative splicing, the E1A mini-gene splicing assay was used. There are few ways to explore the role of these proteins: over-expression, knock-down, and knock- down and rescue experiments. Initially, I assessed the effect of each CDK13 interactions – CCNK, RBM25, CDC5L, PRP19 and CDC5L/PRP19 by overexpression. However, later realizing that CCNK is needed to activate CDK13, the transfections were repeated by adding CCNK to all the transfections. This experiment was designed to show the importance of each PPI interaction with CDK13 on AS. From the initial experiment where CDK13 was transfected with individual PPIs, most did not show much affect of the splicing pattern, except the interaction of CDK13/CDC5L/PRP19. The overexpression of three proteins partially inhibited the splicing of E1A (Figure 6.8). To ensure other interactions did not affect alternative  72 splicing, each band was quantitated with densitometry and normalized against GADPH (Figure 6.9). Other than the potential CDK13, CDC5L, PRP19 overexpression result that partially inhibited splicing, no other conclusions could be made.  Figure 6.8. CDK13 and PPI overexpression E1A mini-gene splicing assay. CDK13 and its PPI were overexpressed in HeLa cells with E1A. cDNA was synthesized from mRNA extraction. cDNA was used as the template for amplification of E1A products using PCR at 23 cycles. The PCR products were analyzed on 6% native acrylamide gel and stained with 0.0001% Sybr Green.  73  Figure 6.9. Quantification of E1A splicing assay. Quantitated data of CDK13 and PPI overexpression using FujiFilm Multigauge densitometry. All values were normalized against GADPH. All values are normalized against GAPDH. 6.3.1 Restoration of normal splicing activity with CDK13/CCNK CDKs require an interacting cyclin for full kinase activity. The previous data showed that overexpression of CDK13, PRP19 and CDC5L inhibited splicing. However, it was without the co-expression of CCNK – CDK13’s interacting cyclin. In these experiments, I overexpressed the PPI with CDK13 and CCNK, or just the PPI by itself to see an effect on AS. Unfortunately, the assay did not amplify the 9S product, the isoform that is most sensitive to splicing. Although there is no significant difference between the splicing activities, there was splicing of E1A isoforms when PRP19/CDC5L with or without CDK13/Cyclin K was overexpressed (Figure 6.10). The overall results  74 show that when the PPIs are overexpressed without CDK13/CCNK, there is an overall decrease in different isoforms and the splicing pattern returns to normal when CDK13/CCNK is co-expressed with the PPIs.  Figure 6.10 CDK13/CCNK E1A mini-gene splicing assay. CDK13/CCNK and its interacting proteins were overexpressed in HeLa cells with E1A. cDNA was synthesized from mRNA extraction. cDNA was used as the template for amplification of E1A products using PCR at 23 cycles. The PCR products are run on 6% acrylamide gel and stained with 0.0001% Sybr Green.   75  Figure 6.11 Quantification of E1A splicing assay with overexpressed PPI and CDK13/CCNK. Quantification of E1A splicing assay when CDK13/CCNK and PPI are overexpressed using FujiFilm Multigauge densitometry. All values are normalized against GAPDH.  76 6.4 Alternative splicing discussion For the splicing assay, the E1A mini gene was used. Since the single set of primer was designed to detect all 5 different isoforms, it was important to optimize the protocol to prevent any bias when quantifying the amount of the different isoforms. The most abundant isoform, 13S at 48 hours post-transfection started to plateau in its intensity after 25 cycles, so the cycles were performed at a maximum of 25 cycles. Optimization of harvesting time was also done to measure time dependent – expression levels of each isoform. During adenovirus infection, 13S and 9S were shown to express abundantly during the initial stage of virus replication and during the lytic stage 41. In this study we harvested the cells at 10 different time-points to determine the optimal harvesting time. E1A gene starts to express at 7 hours post-transfection and the expression level does not seem to differ between 24 hour (Figure 6.5 lane 10) and 48 hour (Figure 6.4 lane 4). Therefore, the experiments were performed by harvesting the cells 24 hours post-E1A transfection and setting the PCR cycle to either 23 cycles or 25 cycles. 6.5 CDK12 AS study discussion Splicing and transcription is believed to be a coupled simultaneous reaction. Recent studies have shown that CDK12 phosphorylates the CTD RNA Polymerase II 9 and CDK12 affects alternative splicing (AS) 13. Based on these results, it can be inferred that CDK12 is a protein that affects this coupled reaction. We know that kinase domain, which can phosphorylate its substrates, is active against CTD of RNA polymerase II and affects transcription. Yet studies did not show if the kinase domain played a role in splicing. Since splicing is also a process of constant interaction and remodelling of many SR proteins and splicing factors that each have phosphorylation sites, I hypothesized that  77 an active kinase domain of CDK12 would be required for CDK12s role in alternative splicing. The three CDK12 mutants were designed for this study – wild-type (WT or FL), kinase-dead (KD) and kinase-deleted (ΔK or KO). First, endogenous CDK12 expression was knocked down via siRNA transfection. Then, the cells were rescued with one of the three forms of CDK12. Potentially, the wild-type CDK12 will restore the cells normal splicing activity, kinase-dead will show if the kinase domain is required for splicing and the kinase-deleted CDK12 will show if CDK12, a CDK with RS domain, can act like an SR protein in regulating AS. Despite the initially achieving endogenous knock-down of CDK12, there were no changes observed in splicing activity. This made it difficult to determine of KD CDK12 or ΔK CDK12 affected splicing. However, further analysis showed that the endogenous knock-down of CDK12 was not effective (results not shown), so the rescue with CDK12 mutants nor the siRNA knock-down sample would not have affected AS. In future experiments, ensuring endogenous CDK12 is knocked- down will be essential.  Simultaneous knock-down of endogenous CDK13 should be considered since CDK12 and CDK13 are very similar to each other in respect to its structure and may be functionally redundant (Figure 1.2). 6.6 CDK13 AS study discussion The CDK13 interaction study presented in the earlier chapter of this thesis, showed that CDK13 interacts with splicing factors. Since, previous papers have shown the CDK13 plays a role in alternative splicing 4,7,11, I wanted to see the effect of these interactions in the context of alternative splicing. There were several ways to test this: 1. Over- expression of CDK13 and its protein-protein interactors (PPI); 2. Knock-down of CDK13 and its PPIs; 3. Knock-down and rescue of CDK13 and its PPIs. Assessing the E1A mini-  78 gene pattern on these individual assays would provide information on whether or not CDK13’s interaction with PPI is important for alternative splicing regulation. Before I could perform these assays, I created a method to knock-down the gene expression of CDK13, CCNK and the interacting splicing factors: RBM25, CDC5L and PRP19. Two different siRNAs were designed for each gene (Appendix 5). The method to detect siRNA knock-down efficiency was through measuring mRNA level by RT-qPCR. The siRNA transfection successfully knocked-down the gene of interest, and siRNAs were ready for future assays. For the over-expression splicing assay, splicing factors were over-expressed with or without CDK13 and/or CCNK. The initial splicing assay consisted of overexpression of CDK13 with its individual PPI. The results showed that most interactions between CDK13 and each PPI did not affect splicing (Figure 6.8). However, an interesting result was observed when CDK13/PRP19/CDC5L were overexpressed, only the 9S product was produced and there was a high level of unspliced precursor. This might have been due the presence of inactive CDK13 in the cytoplasm. To see the effect of CCNK on the CDK13/PRP19/CDC5L result the four proteins were overexpressed together. The results showed that all three isoforms of E1A were present. However, this was done in a separate experiment than the CDK13/PRP19/CDC5L alone overexpression.  The CDK13/PRP19/CDC5L alone overexpression was not repeated and firm conclusions could not be made. Although I cannot draw any conclusions regarding PRP19/CDC5L interaction with CDK13, the overall consensus suggests that CDK13/CCNK is required for normal  79 alternative splicing activity (Figure 6.11). When the splicing factors are over-expressed without CDK13/CCNK, there was an overall decrease in E1A isoforms. However, when CDK13/CCNK was overexpressed with the splicing factors, the normal splicing activity was rescued. This implied that active CDK13 may play an importance role in regulating alternative splicing and transcription. SR family proteins have been implicated in alternative splicing by various ways: protein-protein interaction, RNA binding, roles in splice-site choices, exon splicing enhancer (ESE) binding. Although I am not sure about the mechanism behind CDK13’s ability to affect alternative splicing, the two domains of CDK13, the kinase domain and RS domain, may play a role in splicing regulation and further experimentation is required.  80 6.7  Alternative splicing assay conclusion and future experiments In this chapter, I described experiments that developed the reagents and assays to study the roles of CDK12, CDK13 and their interacting proteins in alternative splicing. I first made the antigen for CDK12, which was used to produce a CDK12 antibody. Although this polyclonal antibody needs to be purified for further uses in IP, the polyclonal antibody can be used to detect CDK12 in western blots. In preparation for an assay to test for a role of CDK12 alternative splicing I created three CDK12 mutants: wild-type, kinase dead, and kinase deleted CDK12.  These were made and tested for expression in insect cells for use in a in vitro splicing assay or in mammalian cells for a in vivo splicing assay. In future studies using the in vivo assay while the knock-down of endogenous CDK12 is essential the knock-down of CDK13 may also be required.  . For measuring CDK13 alternative splicing using the E1a mini-gene in vivo assay, there are still many optimizations that are required. Although the number of PCR cycle and when to harvest E1A was determined, other aspects of experiments, such as determining the best transfection efficiency when there are more than 3 plasmids, the amount of total plasmid that can be transfected without being too toxic, and optimizing the protocol using 6-well or 10cm plate rather than 24-well plates in order to have enough sample to determine the protein level in western blot. The CDK13 and PPI overexpression suggested that CDK13/CCNK was important in regulating alternative splicing, but knock-down of CDK13 and its PPIs, and knock-down and rescue experiments are still required to get a better idea of their role in regulating AS.  81 7 Conclusion In this thesis, I investigated two hypotheses. The first primary hypothesis was CDK13 interacts with splicing factors. I have successfully identified and validated CDK13 protein-protein interacting partners by IP-MS and IP-WB approaches. These results led to my secondary hypothesis: the interaction of CDK13 and splicing factors, identified above, modulates alternative splicing. In order to investigate my secondary hypothesis, an alternative splicing assay needed to be developed. This assay would also be used to address another secondary hypothesis: the kinase domain of CDK12 modulates alternative splicing. During my thesis I successfully developed an Adenovirus E1A mini- gene splicing assay. While unable to address the secondary hypotheses the assay and the preliminary work for these experiments have been performed and they are ready for use by other scientists in the Morin lab. This project has enabled future investigations: 1) Since the many of the interaction partners of CDK12 were never validated, the methods and insights gained in validating the CDK13 interactions can be applied to validating the CDK12 interactions; 2) Some of the assays needed to investigate the role of CDK13 and CDK12 and their interaction partners in alternative splicing are now in place; 3) Similarly, the assays and reagents needed to assess the role of CDK12’s kinase domain on alternative splicing have been prepared. Future studies on CDK13 and CDK12 using, in part, the results and the assays developed in my thesis project, will provide insights on the roles of these CDKs in alternative  82 splicing and on the bigger picture of the mechanisms and regulation of alternative splicing in general.  83 Bibliography 1. Malumbres, M. & Barbacid, M. Mammalian cyclin-dependent kinases. Trends in Biochemical Sciences 30, 630–641 (2005). 2. Ko, T. K., Kelly, E. & Pines, J. CrkRS. Journal of cell science 114, 2591–2603 (2001). 3. Blazek, D. et al. The Cyclin K/Cdk12 complex maintains genomic stability via regulation of expression of DNA damage response genes. Genes & Development 25, 2158–2172 (2011). 4. Chen, H.-H., Wong, Y.-H., Geneviere, A.-M. & Fann, M.-J. CDK13/CDC2L5 interacts with L-type cyclins and regulates alternative splicing. Biochemical and Biophysical Research Communications 354, 735–740 (2007). 5. Lapidot-Lifson, Y. et al. Cloning and antisense oligodeoxynucleotide inhibition of a human homolog of cdc2 required in hematopoiesis. Proceedings of the National Academy of Sciences of the United States of America 89, 579 (1992). 6. Marqués, F. et al. A New Subfamily of High Molecular Mass CDC2-Related Kinases with PITAI/VRE Motifs. Biochemical and Biophysical Research Communications 279, 832–837 (2000). 7. Even, Y. et al. CDC2L5, a Cdk-like kinase with RS domain, interacts with the ASF/SF2-associated protein p32 and affects splicing in vivo. J. Cell. Biochem. 99, 890–904 (2006). 8. Loyer, P. et al. Characterization of Cyclin L1 and L2 Interactions with CDK11 and Splicing Factors. Journal of Biological Chemistry 283, 7721–7732 (2008). 9. Bartkowiak, B. et al. CDK12 is a transcription elongation-associated CTD kinase, the metazoan ortholog of yeast Ctk1. Genes & Development 24, 2303–2316 (2010). 10. Tsang, H. T. H. et al. A systematic analysis of human CHMP protein interactions: Additional MIT domain-containing proteins bind to multiple components of the human ESCRT III complex. Genomics 88, 333–346 (2006). 11. Berro, R. et al. CDK13, a New Potential Human Immunodeficiency Virus Type 1 Inhibitory Factor Regulating Viral mRNA Splicing. Journal of Virology 82, 7155– 7166 (2008). 12. Chepelev, I. Methods in Molecular Biology. 815, 91–102 (Springer New York: New York, NY, 2011). 13. Chen, H. H., Wang, Y. C. & Fann, M. J. Identification and characterization of the CDK12/cyclin L1 complex involved in alternative splicing regulation. Molecular and Cellular Biology 26, 2736 (2006). 14. Jung, S. Y. Proteomic Analysis of Steady-State Nuclear Hormone Receptor Coactivator Complexes. Molecular Endocrinology 19, 2451–2465 (2005). 15. Haverty, P. M. et al. High-resolution genomic and expression analyses of copy number alterations in breast tumors. Genes Chromosom. Cancer 47, 530–542 (2008). 16. Henry, J., Nicholson, S. & Farndon, J. Measurement of oestrogen receptor mRNA levels in human breast tumours. British journal of … (1988).  84 17. Iorns, E., Martens-de Kemp, S. R., Lord, C. J. & Ashworth, A. CRK7 modifies the MAPK pathway and influences the response to endocrine therapy. Carcinogenesis 30, 1696–1701 (2009). 18. Staley, J. P. & Guthrie, C. Mechanical devices of the spliceosome: review motors, clocks, springs, and things. Cell 92, 315–326 (1998). 19. Wahl, M. C., Will, C. L. & LUhrmann, R. The Spliceosome: Design Principles of a Dynamic RNP Machine. Cell 136, 701–718 (2009). 20. Makarova, O. V. et al. A subset of human 35S U5 proteins, including Prp19, function prior to catalytic step 1 of splicing. The EMBO Journal 23, 2381–2391 (2004). 21. Johnson, J. M. et al. Genome-wide survey of human alternative pre-mRNA splicing with exon junction microarrays. Science 302, 2141–2144 (2003). 22. Matlin, A. J., Clark, F. & Smith, C. W. J. Understanding alternative splicing: towards a cellular code. Nat Rev Mol Cell Biol 6, 386–398 (2005). 23. Venables, J. P. et al. Identification of Alternative Splicing Markers for Breast Cancer. Cancer Research 68, 9525–9531 (2008). 24. Valcárcel, J. & Green, M. R. The SR protein family: pleiotropic functions in pre- mRNA splicing. Trends in Biochemical Sciences 21, 296–301 (1996). 25. Tacke, R. & Manley, J. L. Determinants of SR protein specificity. Current opinion in cell biology 11, 358–362 (1999). 26. R J Nagel, A. M. L. A. M. Z. Specific binding of an exonic splicing enhancer by the pre-mRNA splicing factor SRp55. RNA 4, 11 (1998). 27. Stamm, S. Regulation of Alternative Splicing by Reversible Protein Phosphorylation. Journal of Biological Chemistry 283, 1223–1227 (2007). 28. Tarn, W. et al. Functional association of essential splicing factor (s) with PRP19 in a protein complex. The EMBO Journal 13, 2421 (1994). 29. Ajuh, P. et al. Functional analysis of the human CDC5L complex and identification of its components by mass spectrometry. The EMBO Journal 19, 6569–6581 (2000). 30. Tsai, W., Chow, Y., Chen, H. & Huang, K. Cef1p is a component of the Prp19p- associated complex and essential for pre-mRNA splicing. Journal of Biological … (1999). 31. Chan, S. P. The Prp19-associated Complex Is Required for Specifying Interactions of U5 and U6 with Pre-mRNA during Spliceosome Activation. Journal of Biological Chemistry 280, 31190–31199 (2005). 32. David, C. J., Boyne, A. R., Millhouse, S. R. & Manley, J. L. The RNA polymerase II C-terminal domain promotes splicing activation through recruitment of a U2AF65-Prp19 complex. Genes & Development 25, 972–983 (2011). 33. Ajuh, P. Identification of peptide inhibitors of pre-mRNA splicing derived from the essential interaction domains of CDC5L and PLRG1. Nucleic Acids Research 31, 6104–6116 (2003). 34. Ajuh, P. A Direct Interaction between the Carboxyl-terminal Region of CDC5L and the WD40 Domain of PLRG1 Is Essential for Pre-mRNA Splicing. Journal of Biological Chemistry 276, 42370–42381 (2001). 35. Fortes, P. et al. Identification and characterization of RED120: A conserved PWI domain protein with links to splicing and 3′-end formation. FEBS Letters 581,  85 3087–3097 (2007). 36. Zhou, A., Ou, A. C., Cho, A., Benz, E. J. & Huang, S. C. Novel Splicing Factor RBM25 Modulates Bcl-x Pre-mRNA 5' Splice Site Selection. Molecular and Cellular Biology 28, 5924–5936 (2008). 37. Grote, M. et al. Molecular Architecture of the Human Prp19/CDC5L Complex. Molecular and Cellular Biology 30, 2105–2119 (2010). 38. Birney, E., Kumar, S. & Krainer, A. R. Analysis of the RNA-recognition motif and RS and RGG domains: conservation in metazoan pre-mRNA splicing factors. Nucleic Acids Research 21, 5803–5816 (1993). 39. Chan, S. P. The Prp19p-Associated Complex in Spliceosome Activation. Science 302, 279–282 (2003). 40. K A Won, S. I. R. Activation of cyclin E/CDK2 is coupled to site-specific autophosphorylation and ubiquitin-dependent degradation of cyclin E. The EMBO Journal 15, 4182 (1996). 41. Gattoni, R., Schmitt, P. & Stevenin, J. In vitro splicing of adenovirus E1A transcripts: characterization of novel reactions and of multiple branch points abnormally far from the 3′ splice site. Nucleic Acids Research 16, 2389–2409 (1988). 44.      Grainger and Beggs. Prp8 protein: At the heart of the spliceosome. RNA 11, 533- 557 (2005).     86  Appendices Appendix 1    20110314, MS0158_GFP_CDK13 minus ctrl Accession Ion Score Mass Unique Discrete Total Description sp|Q14004|CDK13_HUMAN 4522.4 165.6 74 74 355 Cell division protein kinase 13 OS=Homo sapiens GN=CDK13 PE=1 SV=2 sp|P78527-2|PRKDC_HUMAN 2089.5 470.2 47 47 64 Isoform 2 of DNA-dependent protein kinase catalytic subunit OS=Homo sapiens GN=PRKDC sp|P07900|HS90A_HUMAN 1189.4 85 24 24 27 Heat shock protein HSP 90-alpha OS=Homo sapiens GN=HSP90AA1 PE=1 SV=5 sp|Q08211|DHX9_HUMAN 852.2 142.2 19 19 23 ATP-dependent RNA helicase A OS=Homo sapiens GN=DHX9 PE=1 SV=4 sp|Q00839|HNRPU_HUMAN 967 91.3 19 19 23 Heterogeneous nuclear ribonucleoprotein U OS=Homo sapiens GN=HNRNPU PE=1 SV=6 sp|P62424|RL7A_HUMAN 934.4 30.1 18 18 23 60S ribosomal protein L7a OS=Homo sapiens GN=RPL7A PE=1 SV=2 sp|P68363|TBA1B_HUMAN 903.2 50.8 17 17 24 Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 sp|P12956|XRCC6_HUMAN 931.8 70.1 17 17 19 X-ray repair cross-complementing protein 6 OS=Homo sapiens GN=XRCC6 PE=1 SV=2 sp|P23396|RS3_HUMAN 842.5 26.8 17 17 25 40S ribosomal protein S3 OS=Homo sapiens GN=RPS3 PE=1 SV=2 sp|P18124|RL7_HUMAN 714.9 29.3 16 16 32 60S ribosomal protein L7 OS=Homo sapiens GN=RPL7 PE=1 SV=1 sp|Q13310-2|PABP4_HUMAN 700.5 69.8 15 15 20 Isoform 2 of Polyadenylate-binding protein 4 OS=Homo sapiens GN=PABPC4 sp|Q9BVA1|TBB2B_HUMAN 894.9 50.4 15 15 22 Tubulin beta-2B chain OS=Homo sapiens GN=TUBB2B PE=1 SV=1 sp|O75400-2|PR40A_HUMAN 692.5 104.5 15 15 16 Isoform 2 of Pre-mRNA-processing factor 40 homolog A OS=Homo sapiens GN=PRPF40A sp|P46781|RS9_HUMAN 641.4 22.6 15 15 17 40S ribosomal protein S9 OS=Homo sapiens GN=RPS9 PE=1  87 Accession Ion Score Mass Unique Discrete Total Description SV=3 sp|P13010|XRCC5_HUMAN 763.5 83.2 14 14 14 X-ray repair cross-complementing protein 5 OS=Homo sapiens GN=XRCC5 PE=1 SV=3 sp|P04350|TBB4_HUMAN 780.9 50 14 14 21 Tubulin beta-4 chain OS=Homo sapiens GN=TUBB4 PE=1 SV=2 sp|P61247|RS3A_HUMAN 671.5 30.2 14 14 18 40S ribosomal protein S3a OS=Homo sapiens GN=RPS3A PE=1 SV=2 sp|P68366|TBA4A_HUMAN 707.6 50.6 14 14 21 Tubulin alpha-4A chain OS=Homo sapiens GN=TUBA4A PE=1 SV=1 sp|O75909|CCNK_HUMAN 567.4 64.6 13 13 15 cyclin-K OS=Homo sapiens GN=CCNK PE=1 SV=2 sp|Q8WZ42-4|TITIN_HUMAN 333.1 3742.3 13 13 16 Isoform Soleus of Titin OS=Homo sapiens GN=TTN sp|Q93008-2|USP9X_HUMAN 452 294.5 13 13 15 Isoform Long of Probable ubiquitin carboxyl-terminal hydrolase FAF-X OS=Homo sapiens GN=USP9X sp|P09651-2|ROA1_HUMAN 718.9 34.3 13 13 21 Isoform A1-A of Heterogeneous nuclear ribonucleoprotein A1 OS=Homo sapiens GN=HNRNPA1 sp|P68032|ACTC_HUMAN 603.9 42.3 13 13 19 Actin, alpha cardiac muscle 1 OS=Homo sapiens GN=ACTC1 PE=1 SV=1 sp|P62701|RS4X_HUMAN 670.1 29.8 13 13 21 40S ribosomal protein S4, X isoform OS=Homo sapiens GN=RPS4X PE=1 SV=2 sp|Q9NYF8-2|BCLF1_HUMAN 533 106 12 12 14 Isoform Btf-l of Bcl-2-associated transcription factor 1 OS=Homo sapiens GN=BCLAF1 sp|P49756|RBM25_HUMAN 582.1 100.5 12 12 12 RNA-binding protein 25 OS=Homo sapiens GN=RBM25 PE=1 SV=3 sp|Q02878|RL6_HUMAN 636.9 32.8 12 12 16 60S ribosomal protein L6 OS=Homo sapiens GN=RPL6 PE=1 SV=3 sp|Q07955|SRSF1_HUMAN 643.9 27.8 12 12 21 Serine/arginine-rich splicing factor 1 OS=Homo sapiens GN=SRSF1 PE=1 SV=2 sp|Q9NYV4|CrkRS_HUAMN_6 728.3 140.8 12 12 56 CrkRS_HumanIsoform6 sp|Q7L2E3-2|DHX30_HUMAN 465.5 137.1 12 12 14 Isoform 2 of Putative ATP-dependent RNA helicase DHX30 OS=Homo sapiens GN=DHX30 sp|Q16629|SRSF7_HUMAN 511.1 27.6 11 11 24 Serine/arginine-rich splicing factor 7 OS=Homo sapiens GN=SRSF7 PE=1 SV=1  88 Accession Ion Score Mass Unique Discrete Total Description sp|Q96SB4|SRPK1_HUMAN 473 75 11 11 15 Serine/threonine-protein kinase SRPK1 OS=Homo sapiens GN=SRPK1 PE=1 SV=2 sp|P61254|RL26_HUMAN 513.1 17.2 11 11 14 60S ribosomal protein L26 OS=Homo sapiens GN=RPL26 PE=1 SV=1 sp|P62241|RS8_HUMAN 623.1 24.5 11 11 15 40S ribosomal protein S8 OS=Homo sapiens GN=RPS8 PE=1 SV=2 sp|P17844|DDX5_HUMAN 619.8 69.6 11 11 15 Probable ATP-dependent RNA helicase DDX5 OS=Homo sapiens GN=DDX5 PE=1 SV=1 sp|P07355|ANXA2_HUMAN 561.2 38.8 11 11 17 Annexin A2 OS=Homo sapiens GN=ANXA2 PE=1 SV=2 sp|P62750|RL23A_HUMAN 458.6 17.7 10 10 14 60S ribosomal protein L23a OS=Homo sapiens GN=RPL23A PE=1 SV=1 sp|P78362-2|SRPK2_HUMAN 368.8 79.7 10 10 16 Isoform 2 of Serine/threonine-protein kinase SRPK2 OS=Homo sapiens GN=SRPK2 sp|Q9UNX3|RL26L_HUMAN 465.4 17.2 10 10 12 60S ribosomal protein L26-like 1 OS=Homo sapiens GN=RPL26L1 PE=1 SV=1 sp|P27635|RL10_HUMAN 364.3 25 10 10 14 60S ribosomal protein L10 OS=Homo sapiens GN=RPL10 PE=1 SV=4 sp|Q9NR30-2|DDX21_HUMAN 534 80.1 10 10 19 Isoform 2 of Nucleolar RNA helicase 2 OS=Homo sapiens GN=DDX21 sp|O43143|DHX15_HUMAN 425.4 91.7 10 10 10 Putative pre-mRNA-splicing factor ATP-dependent RNA helicase DHX15 OS=Homo sapiens GN=DHX15 PE=1 SV=2 sp|P78362|SRPK2_HUMAN 357.9 78.2 10 10 15 Serine/threonine-protein kinase SRPK2 OS=Homo sapiens GN=SRPK2 PE=1 SV=3 sp|P15880|RS2_HUMAN 503.1 31.6 10 10 14 40S ribosomal protein S2 OS=Homo sapiens GN=RPS2 PE=1 SV=2 sp|Q13247-3|SRSF6_HUMAN 539.4 38.6 10 10 26 Isoform SRP55-3 of Serine/arginine-rich splicing factor 6 OS=Homo sapiens GN=SRSF6 sp|P62081|RS7_HUMAN 473.2 22.1 10 10 10 40S ribosomal protein S7 OS=Homo sapiens GN=RPS7 PE=1 SV=1 sp|P62906|RL10A_HUMAN 489.6 25 10 10 19 60S ribosomal protein L10a OS=Homo sapiens GN=RPL10A PE=1 SV=2 sp|P40429|RL13A_HUMAN 397.6 23.6 9 9 12 60S ribosomal protein L13a OS=Homo sapiens GN=RPL13A PE=1 SV=2  89 Accession Ion Score Mass Unique Discrete Total Description sp|Q9NZI8|IF2B1_HUMAN 422.5 63.8 9 9 11 Insulin-like growth factor 2 mRNA-binding protein 1 OS=Homo sapiens GN=IGF2BP1 PE=1 SV=2 sp|P16402|H13_HUMAN 556.9 22.3 9 9 19 Histone H1.3 OS=Homo sapiens GN=HIST1H1D PE=1 SV=2 sp|P17066|HSP76_HUMAN 438.9 71.4 8 8 15 Heat shock 70 kDa protein 6 OS=Homo sapiens GN=HSPA6 PE=1 SV=2 sp|Q14145|KEAP1_HUMAN 520.5 71.2 8 8 8 Kelch-like ECH-associated protein 1 OS=Homo sapiens GN=KEAP1 PE=1 SV=2 sp|Q08170|SRSF4_HUMAN 370.2 56.8 8 8 20 Serine/arginine-rich splicing factor 4 OS=Homo sapiens GN=SRSF4 PE=1 SV=2 sp|Q9Y2W1|TR150_HUMAN 369.9 108.7 8 8 8 Thyroid hormone receptor-associated protein 3 OS=Homo sapiens GN=THRAP3 PE=1 SV=2 sp|P55060-3|XPO2_HUMAN 308.8 108.5 8 8 10 Isoform 3 of Exportin-2 OS=Homo sapiens GN=CSE1L sp|P84103|SRSF3_HUMAN 434.6 19.5 8 8 17 Serine/arginine-rich splicing factor 3 OS=Homo sapiens GN=SRSF3 PE=1 SV=1 sp|P67809|YBOX1_HUMAN 628.9 35.9 8 8 11 Nuclease-sensitive element-binding protein 1 OS=Homo sapiens GN=YBX1 PE=1 SV=3 sp|Q12905|ILF2_HUMAN 397.7 43.3 8 8 10 Interleukin enhancer-binding factor 2 OS=Homo sapiens GN=ILF2 PE=1 SV=2 sp|Q12906-2|ILF3_HUMAN 345.3 76.4 8 8 9 Isoform DRBP76 of Interleukin enhancer-binding factor 3 OS=Homo sapiens GN=ILF3 sp|Q13243|SRSF5_HUMAN 312.6 31.4 8 8 13 Serine/arginine-rich splicing factor 5 OS=Homo sapiens GN=SRSF5 PE=1 SV=1 sp|P62995-3|TRA2B_HUMAN 425.6 22 8 8 12 Isoform HTRA2-beta3 of Transformer-2 protein homolog beta OS=Homo sapiens GN=TRA2B sp|P62979|RS27A_HUMAN 337.7 18.3 7 7 25 Ubiquitin-40S ribosomal protein S27a OS=Homo sapiens GN=RPS27A PE=1 SV=2 sp|Q9BQG0-2|MBB1A_HUMAN 323.4 150.2 7 7 8 Isoform 2 of Myb-binding protein 1A OS=Homo sapiens GN=MYBBP1A sp|Q99729-2|ROAA_HUMAN 321.2 36.1 7 7 8 Isoform 2 of Heterogeneous nuclear ribonucleoprotein A/B OS=Homo sapiens GN=HNRNPAB sp|O43390-2|HNRPR_HUMAN 319.3 71.5 7 7 9 Isoform 2 of Heterogeneous nuclear ribonucleoprotein R OS=Homo sapiens GN=HNRNPR  90 Accession Ion Score Mass Unique Discrete Total Description sp|Q99459|CDC5L_HUMAN 265.1 92.4 7 7 8 Cell division cycle 5-like protein OS=Homo sapiens GN=CDC5L PE=1 SV=2 sp|P05141|ADT2_HUMAN 298.3 33.1 7 7 7 ADP/ATP translocase 2 OS=Homo sapiens GN=SLC25A5 PE=1 SV=6 sp|Q13242|SRSF9_HUMAN 277.3 25.6 7 7 10 Serine/arginine-rich splicing factor 9 OS=Homo sapiens GN=SRSF9 PE=1 SV=1 sp|P16989|DBPA_HUMAN 476.9 40.1 7 7 10 DNA-binding protein A OS=Homo sapiens GN=CSDA PE=1 SV=4 sp|P18077|RL35A_HUMAN 286.2 12.6 7 7 16 60S ribosomal protein L35a OS=Homo sapiens GN=RPL35A PE=1 SV=2 sp|P18621|RL17_HUMAN 278 21.6 7 7 14 60S ribosomal protein L17 OS=Homo sapiens GN=RPL17 PE=1 SV=3 sp|P22626-2|ROA2_HUMAN 348.9 36 7 7 10 Isoform A2 of Heterogeneous nuclear ribonucleoproteins A2/B1 OS=Homo sapiens GN=HNRNPA2B1 sp|Q07020|RL18_HUMAN 436.4 21.7 7 7 15 60S ribosomal protein L18 OS=Homo sapiens GN=RPL18 PE=1 SV=2 sp|P30050|RL12_HUMAN 382.3 18 7 7 13 60S ribosomal protein L12 OS=Homo sapiens GN=RPL12 PE=1 SV=1 sp|P46779|RL28_HUMAN 352.1 15.8 7 7 13 60S ribosomal protein L28 OS=Homo sapiens GN=RPL28 PE=1 SV=3 sp|P46778|RL21_HUMAN 262.6 18.6 6 6 8 60S ribosomal protein L21 OS=Homo sapiens GN=RPL21 PE=1 SV=2 sp|Q14568|HS902_HUMAN 238.4 39.5 6 6 6 Putative heat shock protein HSP 90-alpha A2 OS=Homo sapiens GN=HSP90AA2 PE=1 SV=2 sp|P62280|RS11_HUMAN 278.9 18.6 6 6 6 40S ribosomal protein S11 OS=Homo sapiens GN=RPS11 PE=1 SV=3 sp|P62266|RS23_HUMAN 295.9 16 6 6 10 40S ribosomal protein S23 OS=Homo sapiens GN=RPS23 PE=1 SV=3 sp|Q01081|U2AF1_HUMAN 345.8 28.4 6 6 7 Splicing factor U2AF 35 kDa subunit OS=Homo sapiens GN=U2AF1 PE=1 SV=3 sp|O75643|U520_HUMAN 213.8 246 6 6 6 U5 small nuclear ribonucleoprotein 200 kDa helicase OS=Homo sapiens GN=SNRNP200 PE=1 SV=2 sp|P26373|RL13_HUMAN 345 24.3 6 6 9 60S ribosomal protein L13 OS=Homo sapiens GN=RPL13 PE=1 SV=4  91 Accession Ion Score Mass Unique Discrete Total Description sp|P51991-2|ROA3_HUMAN 205.5 37.2 6 6 9 Isoform 2 of Heterogeneous nuclear ribonucleoprotein A3 OS=Homo sapiens GN=HNRNPA3 sp|P82650|RT22_HUMAN 295.3 41.4 6 6 6 28S ribosomal protein S22, mitochondrial OS=Homo sapiens GN=MRPS22 PE=1 SV=1 sp|P62917|RL8_HUMAN 288.8 28.2 6 6 14 60S ribosomal protein L8 OS=Homo sapiens GN=RPL8 PE=1 SV=2 sp|Q9BWF3|RBM4_HUMAN 264.6 40.7 6 6 6 RNA-binding protein 4 OS=Homo sapiens GN=RBM4 PE=1 SV=1 sp|P49207|RL34_HUMAN 294.7 13.5 6 6 9 60S ribosomal protein L34 OS=Homo sapiens GN=RPL34 PE=1 SV=3 sp|P62888|RL30_HUMAN 376.5 12.9 6 6 7 60S ribosomal protein L30 OS=Homo sapiens GN=RPL30 PE=1 SV=2 sp|Q16543|CDC37_HUMAN 202.3 45 5 5 5 Hsp90 co-chaperone Cdc37 OS=Homo sapiens GN=CDC37 PE=1 SV=1 sp|Q9UII4|HERC5_HUMAN 240.5 118.2 5 5 6 E3 ISG15--protein ligase HERC5 OS=Homo sapiens GN=HERC5 PE=1 SV=2 sp|P00338|LDHA_HUMAN 193.1 37 5 5 5 L-lactate dehydrogenase A chain OS=Homo sapiens GN=LDHA PE=1 SV=2 sp|Q5QNW6|H2B2F_HUMAN 255.2 13.9 5 5 12 Histone H2B type 2-F OS=Homo sapiens GN=HIST2H2BF PE=1 SV=3 sp|O95232|LC7L3_HUMAN 345.9 51.8 5 5 5 Luc7-like protein 3 OS=Homo sapiens GN=LUC7L3 PE=1 SV=2 sp|O76021|RL1D1_HUMAN 246.4 55.2 5 5 6 Ribosomal L1 domain-containing protein 1 OS=Homo sapiens GN=RSL1D1 PE=1 SV=3 sp|Q9UQ35|SRRM2_HUMAN 248.7 300.2 5 5 10 Serine/arginine repetitive matrix protein 2 OS=Homo sapiens GN=SRRM2 PE=1 SV=2 sp|P51398|RT29_HUMAN 185.2 45.9 5 5 5 28S ribosomal protein S29, mitochondrial OS=Homo sapiens GN=DAP3 PE=1 SV=1 sp|P62910|RL32_HUMAN 314.4 16 5 5 7 60S ribosomal protein L32 OS=Homo sapiens GN=RPL32 PE=1 SV=2 sp|P22087|FBRL_HUMAN 217.7 33.9 5 5 7 rRNA 2'-O-methyltransferase fibrillarin OS=Homo sapiens GN=FBL PE=1 SV=2  92 Accession Ion Score Mass Unique Discrete Total Description sp|Q9Y383-2|LC7L2_HUMAN 181.5 46.9 5 5 8 Isoform 2 of Putative RNA-binding protein Luc7-like 2 OS=Homo sapiens GN=LUC7L2 sp|Q99623|PHB2_HUMAN 198.2 33.3 5 5 5 Prohibitin-2 OS=Homo sapiens GN=PHB2 PE=1 SV=2 sp|Q03001-8|BPA1_HUMAN 125.9 593.8 5 5 6 Isoform EA of Bullous pemphigoid antigen 1 OS=Homo sapiens GN=DST sp|Q9Y399|RT02_HUMAN 217 33.5 5 5 6 28S ribosomal protein S2, mitochondrial OS=Homo sapiens GN=MRPS2 PE=1 SV=1 sp|P27348|1433T_HUMAN 205.1 28 5 5 5 14-3-3 protein theta OS=Homo sapiens GN=YWHAQ PE=1 SV=1 sp|P84090|ERH_HUMAN 194.7 12.4 5 5 8 Enhancer of rudimentary homolog OS=Homo sapiens GN=ERH PE=1 SV=1 sp|P33993|MCM7_HUMAN 187.6 81.9 5 5 5 DNA replication licensing factor MCM7 OS=Homo sapiens GN=MCM7 PE=1 SV=4 sp|P37108|SRP14_HUMAN 265.2 14.7 5 5 5 Signal recognition particle 14 kDa protein OS=Homo sapiens GN=SRP14 PE=1 SV=2 sp|P38159|HNRPG_HUMAN 236.9 42.3 5 5 5 Heterogeneous nuclear ribonucleoprotein G OS=Homo sapiens GN=RBMX PE=1 SV=3 sp|P83731|RL24_HUMAN 300 17.9 5 5 10 60S ribosomal protein L24 OS=Homo sapiens GN=RPL24 PE=1 SV=1 sp|P82675|RT05_HUMAN 204.2 48.5 5 5 5 28S ribosomal protein S5, mitochondrial OS=Homo sapiens GN=MRPS5 PE=1 SV=2 sp|P62277|RS13_HUMAN 296.2 17.2 5 5 6 40S ribosomal protein S13 OS=Homo sapiens GN=RPS13 PE=1 SV=2 sp|P47914|RL29_HUMAN 162.5 17.8 5 5 9 60S ribosomal protein L29 OS=Homo sapiens GN=RPL29 PE=1 SV=2 sp|Q9BVP2-2|GNL3_HUMAN 147.5 61 5 5 5 Isoform 2 of Guanine nucleotide-binding protein-like 3 OS=Homo sapiens GN=GNL3 sp|P50914|RL14_HUMAN 302.2 23.5 5 5 8 60S ribosomal protein L14 OS=Homo sapiens GN=RPL14 PE=1 SV=4 sp|Q14103-2|HNRPD_HUMAN 235.3 36.4 5 5 5 Isoform Dx4 of Heterogeneous nuclear ribonucleoprotein D0 OS=Homo sapiens GN=HNRNPD sp|P06899|H2B1J_HUMAN 284.7 13.9 5 5 12 Histone H2B type 1-J OS=Homo sapiens GN=HIST1H2BJ  93 Accession Ion Score Mass Unique Discrete Total Description PE=1 SV=3 sp|Q14444-2|CAPR1_HUMAN 181.1 77 5 5 5 Isoform 2 of Caprin-1 OS=Homo sapiens GN=CAPRIN1 sp|Q9BRJ6|CG050_HUMAN 200.6 22.1 4 4 4 Uncharacterized protein C7orf50 OS=Homo sapiens GN=C7orf50 PE=1 SV=1 sp|P62805|H4_HUMAN 212.2 11.4 4 4 5 Histone H4 OS=Homo sapiens GN=HIST1H4A PE=1 SV=2 sp|P62829|RL23_HUMAN 176.3 15 4 4 4 60S ribosomal protein L23 OS=Homo sapiens GN=RPL23 PE=1 SV=1 sp|P0C0S8|H2A1_HUMAN 187.9 14.1 4 4 6 Histone H2A type 1 OS=Homo sapiens GN=HIST1H2AG PE=1 SV=2 sp|Q9NWB6|ARGL1_HUMAN 148.9 33.2 4 4 4 Arginine and glutamate-rich protein 1 OS=Homo sapiens GN=ARGLU1 PE=1 SV=1 sp|P84085|ARF5_HUMAN 154.4 20.6 4 4 4 ADP-ribosylation factor 5 OS=Homo sapiens GN=ARF5 PE=1 SV=2 sp|Q9BUJ2-2|HNRL1_HUMAN 152 90.8 4 4 4 Isoform Isoform b of Heterogeneous nuclear ribonucleoprotein U-like protein 1 OS=Homo sapiens GN=HNRNPUL1 sp|P83881|RL36A_HUMAN 190.1 12.7 4 4 4 60S ribosomal protein L36a OS=Homo sapiens GN=RPL36A PE=1 SV=2 sp|P11021|GRP78_HUMAN 183.2 72.4 4 4 6 78 kDa glucose-regulated protein OS=Homo sapiens GN=HSPA5 PE=1 SV=2 sp|Q9H0A0|NAT10_HUMAN 187.9 116.6 4 4 5 N-acetyltransferase 10 OS=Homo sapiens GN=NAT10 PE=1 SV=2 sp|P38919|IF4A3_HUMAN 201.5 47.1 4 4 4 Eukaryotic initiation factor 4A-III OS=Homo sapiens GN=EIF4A3 PE=1 SV=4 sp|P05783|K1C18_HUMAN 158.9 48 4 4 4 Keratin, type I cytoskeletal 18 OS=Homo sapiens GN=KRT18 PE=1 SV=2 sp|Q09666|AHNK_HUMAN 141.4 629.2 4 4 9 Neuroblast differentiation-associated protein AHNAK OS=Homo sapiens GN=AHNAK PE=1 SV=2 sp|P82933|RT09_HUMAN 158.8 46 4 4 4 28S ribosomal protein S9, mitochondrial OS=Homo sapiens GN=MRPS9 PE=1 SV=2 sp|P08708|RS17_HUMAN 201.8 15.6 4 4 4 40S ribosomal protein S17 OS=Homo sapiens GN=RPS17 PE=1 SV=2 sp|P42285|SK2L2_HUMAN 144.3 118.8 4 4 4 Superkiller viralicidic activity 2-like 2 OS=Homo sapiens GN=SKIV2L2 PE=1 SV=3  94 Accession Ion Score Mass Unique Discrete Total Description sp|P42677|RS27_HUMAN 214.4 9.8 4 4 4 40S ribosomal protein S27 OS=Homo sapiens GN=RPS27 PE=1 SV=3 sp|P42766|RL35_HUMAN 186.8 14.5 4 4 6 60S ribosomal protein L35 OS=Homo sapiens GN=RPL35 PE=1 SV=2 sp|P82673|RT35_HUMAN 176.6 37.1 4 4 5 28S ribosomal protein S35, mitochondrial OS=Homo sapiens GN=MRPS35 PE=1 SV=1 sp|P46777|RL5_HUMAN 229.2 34.6 4 4 4 60S ribosomal protein L5 OS=Homo sapiens GN=RPL5 PE=1 SV=3 sp|Q92522|H1X_HUMAN 238.1 22.5 4 4 7 Histone H1x OS=Homo sapiens GN=H1FX PE=1 SV=1 sp|Q7L7L0|H2A3_HUMAN 184.4 14.1 4 4 6 Histone H2A type 3 OS=Homo sapiens GN=HIST3H2A PE=1 SV=3 sp|P51114-2|FXR1_HUMAN 156 61.2 4 4 4 Isoform Short of Fragile X mental retardation syndrome-related protein 1 OS=Homo sapiens GN=FXR1 sp|Q9Y5A9-2|YTHD2_HUMAN 204.8 57 4 4 4 Isoform 2 of YTH domain family protein 2 OS=Homo sapiens GN=YTHDF2 sp|Q6PKG0|LARP1_HUMAN 165.1 123.8 4 4 4 La-related protein 1 OS=Homo sapiens GN=LARP1 PE=1 SV=2 sp|Q92552|RT27_HUMAN 198.9 47.9 4 4 4 28S ribosomal protein S27, mitochondrial OS=Homo sapiens GN=MRPS27 PE=1 SV=3 sp|Q969Q0|RL36L_HUMAN 170.6 12.7 4 4 4 60S ribosomal protein L36a-like OS=Homo sapiens GN=RPL36AL PE=1 SV=3 sp|P63241|IF5A1_HUMAN 174.5 17 4 4 5 Eukaryotic translation initiation factor 5A-1 OS=Homo sapiens GN=EIF5A PE=1 SV=2 sp|O60762|DPM1_HUMAN 181.5 29.7 4 4 4 Dolichol-phosphate mannosyltransferase OS=Homo sapiens GN=DPM1 PE=1 SV=1 sp|Q9UN86-2|G3BP2_HUMAN 164.6 50.8 4 4 4 Isoform B of Ras GTPase-activating protein-binding protein 2 OS=Homo sapiens GN=G3BP2 sp|Q9NQ29-2|LUC7L_HUMAN 163.7 38.8 4 4 7 Isoform 2 of Putative RNA-binding protein Luc7-like 1 OS=Homo sapiens GN=LUC7L sp|Q9Y3D9|RT23_HUMAN 167.9 21.8 4 4 4 28S ribosomal protein S23, mitochondrial OS=Homo sapiens GN=MRPS23 PE=1 SV=2 sp|P06493|CDK1_HUMAN 186 34.1 4 4 12 Cell division protein kinase 1 OS=Homo sapiens GN=CDK1  95 Accession Ion Score Mass Unique Discrete Total Description PE=1 SV=2 sp|P11387|TOP1_HUMAN 146.8 91.1 4 4 4 DNA topoisomerase 1 OS=Homo sapiens GN=TOP1 PE=1 SV=2 sp|Q02543|RL18A_HUMAN 172.2 21 4 4 4 60S ribosomal protein L18a OS=Homo sapiens GN=RPL18A PE=1 SV=2 sp|Q08J23|NSUN2_HUMAN 146.1 87.2 4 4 5 tRNA (cytosine-5-)-methyltransferase NSUN2 OS=Homo sapiens GN=NSUN2 PE=1 SV=2 REV_sp|Q8WXX0|DYH7_HUM AN 118.2 464.4 4 4 8 Dynein heavy chain 7, axonemal OS=Homo sapiens GN=DNAH7 PE=1 SV=2 sp|P62826|RAN_HUMAN 228.7 24.6 4 4 4 GTP-binding nuclear protein Ran OS=Homo sapiens GN=RAN PE=1 SV=3 sp|O00425|IF2B3_HUMAN 202.9 64 4 4 4 Insulin-like growth factor 2 mRNA-binding protein 3 OS=Homo sapiens GN=IGF2BP3 PE=1 SV=2 sp|P18085|ARF4_HUMAN 183.7 20.6 4 4 4 ADP-ribosylation factor 4 OS=Homo sapiens GN=ARF4 PE=1 SV=3 sp|P55795|HNRH2_HUMAN 211 49.5 4 4 5 Heterogeneous nuclear ribonucleoprotein H2 OS=Homo sapiens GN=HNRNPH2 PE=1 SV=1 sp|P31689|DNJA1_HUMAN 161.1 45.6 4 4 4 DnaJ homolog subfamily A member 1 OS=Homo sapiens GN=DNAJA1 PE=1 SV=2 sp|Q8TE73|DYH5_HUMAN 67.7 532.5 3 3 3 Dynein heavy chain 5, axonemal OS=Homo sapiens GN=DNAH5 PE=1 SV=3 REV_sp|P42229|STA5A_HUMA N 80.4 91.2 3 3 3 Signal transducer and activator of transcription 5A OS=Homo sapiens GN=STAT5A PE=1 SV=1 REV_sp|Q7Z2Y5|NRK_HUMA N 74 179.5 3 3 3 Nik-related protein kinase OS=Homo sapiens GN=NRK PE=2 SV=2 sp|O00483|NDUA4_HUMAN 103.7 9.4 3 3 3 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 4 OS=Homo sapiens GN=NDUFA4 PE=1 SV=1 sp|O43809|CPSF5_HUMAN 113.6 26.3 3 3 3 Cleavage and polyadenylation specificity factor subunit 5 OS=Homo sapiens GN=NUDT21 PE=1 SV=1 sp|O60506-2|HNRPQ_HUMAN 105.5 65.9 3 3 4 Isoform hnRNP Q2 of Heterogeneous nuclear ribonucleoprotein Q OS=Homo sapiens GN=SYNCRIP  96 Accession Ion Score Mass Unique Discrete Total Description sp|O75494-3|SRS10_HUMAN 141 22.3 3 3 7 Isoform SRp38-2 of Serine/arginine-rich splicing factor 10 OS=Homo sapiens GN=SRSF10 sp|O75694-2|NU155_HUMAN 138.6 150.5 3 3 3 Isoform 2 of Nuclear pore complex protein Nup155 OS=Homo sapiens GN=NUP155 sp|O95793-2|STAU1_HUMAN 102 55.1 3 3 3 Isoform Short of Double-stranded RNA-binding protein Staufen homolog 1 OS=Homo sapiens GN=STAU1 sp|O95816|BAG2_HUMAN 157.3 23.9 3 3 5 BAG family molecular chaperone regulator 2 OS=Homo sapiens GN=BAG2 PE=1 SV=1 sp|P02533|K1C14_HUMAN 146.1 51.9 3 3 7 Keratin, type I cytoskeletal 14 OS=Homo sapiens GN=KRT14 PE=1 SV=4 sp|P12004|PCNA_HUMAN 108.9 29.1 3 3 3 Proliferating cell nuclear antigen OS=Homo sapiens GN=PCNA PE=1 SV=1 sp|P20700|LMNB1_HUMAN 78.6 66.7 3 3 3 Lamin-B1 OS=Homo sapiens GN=LMNB1 PE=1 SV=2 sp|P22061-2|PIMT_HUMAN 156.1 24.8 3 3 3 Isoform 2 of Protein-L-isoaspartate(D-aspartate) O- methyltransferase OS=Homo sapiens GN=PCMT1 sp|P22392|NDKB_HUMAN 101.2 17.4 3 3 4 Nucleoside diphosphate kinase B OS=Homo sapiens GN=NME2 PE=1 SV=1 sp|P26641|EF1G_HUMAN 110 50.4 3 3 3 Elongation factor 1-gamma OS=Homo sapiens GN=EEF1G PE=1 SV=3 sp|P35232|PHB_HUMAN 118.7 29.8 3 3 3 Prohibitin OS=Homo sapiens GN=PHB PE=1 SV=1 sp|P35250-2|RFC2_HUMAN 124.5 35.7 3 3 3 Isoform 2 of Replication factor C subunit 2 OS=Homo sapiens GN=RFC2 sp|P47756-2|CAPZB_HUMAN 121.5 31 3 3 3 Isoform 2 of F-actin-capping protein subunit beta OS=Homo sapiens GN=CAPZB sp|P61204|ARF3_HUMAN 158.9 20.6 3 3 3 ADP-ribosylation factor 3 OS=Homo sapiens GN=ARF3 PE=1 SV=2 sp|P61289-2|PSME3_HUMAN 117.4 31 3 3 3 Isoform 2 of Proteasome activator complex subunit 3 OS=Homo sapiens GN=PSME3 sp|P61513|RL37A_HUMAN 124.6 10.5 3 3 4 60S ribosomal protein L37a OS=Homo sapiens GN=RPL37A PE=1 SV=2 sp|P61619|S61A1_HUMAN 138.8 52.7 3 3 3 Protein transport protein Sec61 subunit alpha isoform 1 OS=Homo sapiens GN=SEC61A1 PE=1 SV=2  97 Accession Ion Score Mass Unique Discrete Total Description sp|P62314|SMD1_HUMAN 132 13.3 3 3 3 Small nuclear ribonucleoprotein Sm D1 OS=Homo sapiens GN=SNRPD1 PE=1 SV=1 sp|P62847-2|RS24_HUMAN 176 15.1 3 3 6 Isoform 2 of 40S ribosomal protein S24 OS=Homo sapiens GN=RPS24 sp|P62851|RS25_HUMAN 176.6 13.8 3 3 3 40S ribosomal protein S25 OS=Homo sapiens GN=RPS25 PE=1 SV=1 sp|P62854|RS26_HUMAN 133.8 13.3 3 3 4 40S ribosomal protein S26 OS=Homo sapiens GN=RPS26 PE=1 SV=3 sp|Q09161|NCBP1_HUMAN 144.5 92.9 3 3 3 Nuclear cap-binding protein subunit 1 OS=Homo sapiens GN=NCBP1 PE=1 SV=1 sp|Q13151|ROA0_HUMAN 173.4 31 3 3 5 Heterogeneous nuclear ribonucleoprotein A0 OS=Homo sapiens GN=HNRNPA0 PE=1 SV=1 sp|Q13595-2|TRA2A_HUMAN 199 13 3 3 4 Isoform Short of Transformer-2 protein homolog alpha OS=Homo sapiens GN=TRA2A sp|Q14493|SLBP_HUMAN 102.5 31.6 3 3 3 Histone RNA hairpin-binding protein OS=Homo sapiens GN=SLBP PE=1 SV=1 sp|Q53GQ0|DHB12_HUMAN 101.8 34.4 3 3 3 Estradiol 17-beta-dehydrogenase 12 OS=Homo sapiens GN=HSD17B12 PE=1 SV=2 sp|Q7Z739|YTHD3_HUMAN 102.6 63.9 3 3 3 YTH domain family protein 3 OS=Homo sapiens GN=YTHDF3 PE=1 SV=1 IPI:CON_00131368.3|SWISS- PROT:P50446 99.1 59.6 3 3 3 Tax_Id=10090 Gene_Symbol=Krt6a Keratin, type II cytoskeletal 6A sp|Q92499|DDX1_HUMAN 95 83.3 3 3 3 ATP-dependent RNA helicase DDX1 OS=Homo sapiens GN=DDX1 PE=1 SV=2 sp|Q9C0C9|UBE2O_HUMAN 107 142.6 3 3 3 Ubiquitin-conjugating enzyme E2 O OS=Homo sapiens GN=UBE2O PE=1 SV=3 sp|Q9H6S0|YTDC2_HUMAN 124.4 161.6 3 3 3 Probable ATP-dependent RNA helicase YTHDC2 OS=Homo sapiens GN=YTHDC2 PE=1 SV=2 sp|Q9NTZ6|RBM12_HUMAN 90.3 97.6 3 3 3 RNA-binding protein 12 OS=Homo sapiens GN=RBM12 PE=1 SV=1 sp|Q9NVP1|DDX18_HUMAN 118.3 75.7 3 3 3 ATP-dependent RNA helicase DDX18 OS=Homo sapiens GN=DDX18 PE=1 SV=2 sp|Q9UHX1-2|PUF60_HUMAN 123.4 58.3 3 3 3 Isoform 2 of Poly(U)-binding-splicing factor PUF60 OS=Homo  98 Accession Ion Score Mass Unique Discrete Total Description sapiens GN=PUF60 sp|Q9UKD2|MRT4_HUMAN 124.5 27.7 3 3 3 mRNA turnover protein 4 homolog OS=Homo sapiens GN=MRTO4 PE=1 SV=2 sp|Q9Y224|CN166_HUMAN 111.9 28.2 3 3 3 UPF0568 protein C14orf166 OS=Homo sapiens GN=C14orf166 PE=1 SV=1 sp|Q9Y2Q9|RT28_HUMAN 139.6 21 3 3 4 28S ribosomal protein S28, mitochondrial OS=Homo sapiens GN=MRPS28 PE=1 SV=1 sp|Q9Y2R4|DDX52_HUMAN 103.3 67.8 3 3 7 Probable ATP-dependent RNA helicase DDX52 OS=Homo sapiens GN=DDX52 PE=1 SV=3 sp|Q9Y2R9|RT07_HUMAN 135.2 28.2 3 3 3 28S ribosomal protein S7, mitochondrial OS=Homo sapiens GN=MRPS7 PE=1 SV=2 sp|Q9Y3U8|RL36_HUMAN 142.8 12.3 3 3 6 60S ribosomal protein L36 OS=Homo sapiens GN=RPL36 PE=1 SV=3  Appendix 2 20110602_MS0173_CDK13 Nuclear extract minus control Accession IonScore Mass Unique Discrete Total Description sp|Q14004|CDK13_HUMAN 3267.4 165.6 57 57 139 Cell division protein kinase 13 OS=Homo sapiens GN=CDK13 PE=1 SV=2 sp|P08107|HSP71_HUMAN 1095.6 70.3 20 20 25 Heat shock 70 kDa protein 1A/1B OS=Homo sapiens GN=HSPA1A PE=1 SV=5 sp|P36578|RL4_HUMAN 705 48 16 16 16 60S ribosomal protein L4 OS=Homo sapiens GN=RPL4 PE=1 SV=5 sp|Q00839-2|HNRPU_HUMAN 737.3 89.7 15 15 18 Isoform Short of Heterogeneous nuclear ribonucleoprotein U OS=Homo sapiens GN=HNRNPU sp|P19338|NUCL_HUMAN 663.6 76.6 15 15 17 Nucleolin OS=Homo sapiens GN=NCL PE=1 SV=3 sp|P39023|RL3_HUMAN 661.2 46.4 15 15 16 60S ribosomal protein L3 OS=Homo sapiens GN=RPL3 PE=1 SV=2 sp|P62906|RL10A_HUMAN 550.5 25 14 14 17 60S ribosomal protein L10a OS=Homo sapiens GN=RPL10A PE=1 SV=2 sp|P18124|RL7_HUMAN 613.8 29.3 14 14 14 60S ribosomal protein L7 OS=Homo sapiens GN=RPL7 PE=1  99 Accession IonScore Mass Unique Discrete Total Description SV=1 sp|P17844|DDX5_HUMAN 702 69.6 14 14 15 Probable ATP-dependent RNA helicase DDX5 OS=Homo sapiens GN=DDX5 PE=1 SV=1 sp|P52272-2|HNRPM_HUMAN 631 73.9 14 14 14 Isoform M1-M2 of Heterogeneous nuclear ribonucleoprotein M OS=Homo sapiens GN=HNRNPM sp|P62701|RS4X_HUMAN 532.6 29.8 13 13 13 40S ribosomal protein S4, X isoform OS=Homo sapiens GN=RPS4X PE=1 SV=2 sp|Q02878|RL6_HUMAN 589.6 32.8 13 13 16 60S ribosomal protein L6 OS=Homo sapiens GN=RPL6 PE=1 SV=3 sp|P61247|RS3A_HUMAN 647.8 30.2 13 13 19 40S ribosomal protein S3a OS=Homo sapiens GN=RPS3A PE=1 SV=2 sp|P62424|RL7A_HUMAN 650.1 30.1 13 13 13 60S ribosomal protein L7a OS=Homo sapiens GN=RPL7A PE=1 SV=2 sp|P35527|K1C9_HUMAN 687.4 62.3 12 12 30 Keratin, type I cytoskeletal 9 OS=Homo sapiens GN=KRT9 PE=1 SV=3 sp|P07900|HS90A_HUMAN 442.3 85 12 12 12 Heat shock protein HSP 90-alpha OS=Homo sapiens GN=HSP90AA1 PE=1 SV=5 sp|P46781|RS9_HUMAN 467.9 22.6 12 12 14 40S ribosomal protein S9 OS=Homo sapiens GN=RPS9 PE=1 SV=3 IPI:CON_GFP|SWISS- PROT:Q9U6Y5 674.9 28.2 11 11 73 Green fluorescent protein (GFP-Cter-HisTag) sp|P62241|RS8_HUMAN 564.3 24.5 11 11 13 40S ribosomal protein S8 OS=Homo sapiens GN=RPS8 PE=1 SV=2 sp|P11142|HSP7C_HUMAN 547.5 71.1 11 11 13 Heat shock cognate 71 kDa protein OS=Homo sapiens GN=HSPA8 PE=1 SV=1 sp|P08238|HS90B_HUMAN 406.6 83.6 10 10 10 Heat shock protein HSP 90-beta OS=Homo sapiens GN=HSP90AB1 PE=1 SV=4 sp|P26373|RL13_HUMAN 467.7 24.3 10 10 14 60S ribosomal protein L13 OS=Homo sapiens GN=RPL13 PE=1 SV=4 sp|O00571|DDX3X_HUMAN 423.4 73.6 10 10 14 ATP-dependent RNA helicase DDX3X OS=Homo sapiens GN=DDX3X PE=1 SV=3 sp|P68371|TBB2C_HUMAN 430 50.3 9 9 9 Tubulin beta-2C chain OS=Homo sapiens GN=TUBB2C PE=1 SV=1 sp|P61313|RL15_HUMAN 335.1 24.2 9 9 9 60S ribosomal protein L15 OS=Homo sapiens GN=RPL15 PE=1 SV=2  100 Accession IonScore Mass Unique Discrete Total Description sp|P62917|RL8_HUMAN 389.6 28.2 9 9 10 60S ribosomal protein L8 OS=Homo sapiens GN=RPL8 PE=1 SV=2 sp|P61254|RL26_HUMAN 404.7 17.2 9 9 10 60S ribosomal protein L26 OS=Homo sapiens GN=RPL26 PE=1 SV=1 sp|Q07020|RL18_HUMAN 515.5 21.7 9 9 13 60S ribosomal protein L18 OS=Homo sapiens GN=RPL18 PE=1 SV=2 sp|P40429|RL13A_HUMAN 385.4 23.6 9 9 9 60S ribosomal protein L13a OS=Homo sapiens GN=RPL13A PE=1 SV=2 sp|P60709|ACTB_HUMAN 397.6 42.1 9 9 9 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 sp|P07437|TBB5_HUMAN 378 50.1 9 9 9 Tubulin beta chain OS=Homo sapiens GN=TUBB PE=1 SV=2 sp|P62753|RS6_HUMAN 493.6 28.8 9 9 10 40S ribosomal protein S6 OS=Homo sapiens GN=RPS6 PE=1 SV=1 sp|P15880|RS2_HUMAN 384.7 31.6 9 9 11 40S ribosomal protein S2 OS=Homo sapiens GN=RPS2 PE=1 SV=2 sp|P11940-2|PABP1_HUMAN 469.8 61.4 9 9 13 Isoform 2 of Polyadenylate-binding protein 1 OS=Homo sapiens GN=PABPC1 sp|P62280|RS11_HUMAN 344.2 18.6 9 9 10 40S ribosomal protein S11 OS=Homo sapiens GN=RPS11 PE=1 SV=3 sp|P09651-3|ROA1_HUMAN 380.9 29.5 9 9 10 Isoform 2 of Heterogeneous nuclear ribonucleoprotein A1 OS=Homo sapiens GN=HNRNPA1 sp|P62249|RS16_HUMAN 350.8 16.5 8 8 11 40S ribosomal protein S16 OS=Homo sapiens GN=RPS16 PE=1 SV=2 sp|Q9BQE3|TBA1C_HUMAN 376.2 50.5 8 8 8 Tubulin alpha-1C chain OS=Homo sapiens GN=TUBA1C PE=1 SV=1 sp|Q96SB4|SRPK1_HUMAN 321.9 75 8 8 8 Serine/threonine-protein kinase SRPK1 OS=Homo sapiens GN=SRPK1 PE=1 SV=2 sp|Q13247-3|SRSF6_HUMAN 388 38.6 8 8 9 Isoform SRP55-3 of Serine/arginine-rich splicing factor 6 OS=Homo sapiens GN=SRSF6 sp|Q08211|DHX9_HUMAN 280.4 142.2 8 8 8 ATP-dependent RNA helicase A OS=Homo sapiens GN=DHX9 PE=1 SV=4 sp|Q9UMS4|PRP19_HUMAN 326.8 55.6 8 8 8 Pre-mRNA-processing factor 19 OS=Homo sapiens GN=PRPF19 PE=1 SV=1 sp|Q07955|SRSF1_HUMAN 340.1 27.8 8 8 8 Serine/arginine-rich splicing factor 1 OS=Homo sapiens GN=SRSF1 PE=1 SV=2  101 Accession IonScore Mass Unique Discrete Total Description sp|P62263|RS14_HUMAN 418.5 16.4 8 8 11 40S ribosomal protein S14 OS=Homo sapiens GN=RPS14 PE=1 SV=3 sp|Q9P258|RCC2_HUMAN 293.8 56.8 8 8 8 Protein RCC2 OS=Homo sapiens GN=RCC2 PE=1 SV=2 sp|P49756|RBM25_HUMAN 293.8 100.5 8 8 8 RNA-binding protein 25 OS=Homo sapiens GN=RBM25 PE=1 SV=3 IPI:CON_00697851.1|SWISS- PROT:Q5XQN5 300.2 63.1 7 7 20 (Bos taurus) Keratin, type II cytoskeletal 5 IPI:CON_00714876.1|ENSEMBL:E NSBTAP00000038253 382.5 63.4 7 7 39 (Bos taurus) 63 kDa protein sp|P62750|RL23A_HUMAN 366.5 17.7 7 7 9 60S ribosomal protein L23a OS=Homo sapiens GN=RPL23A PE=1 SV=1 sp|P78362-2|SRPK2_HUMAN 264.2 79.7 7 7 7 Isoform 2 of Serine/threonine-protein kinase SRPK2 OS=Homo sapiens GN=SRPK2 sp|P23396|RS3_HUMAN 355.2 26.8 7 7 7 40S ribosomal protein S3 OS=Homo sapiens GN=RPS3 PE=1 SV=2 sp|P60866|RS20_HUMAN 319.8 13.5 7 7 10 40S ribosomal protein S20 OS=Homo sapiens GN=RPS20 PE=1 SV=1 sp|Q13310-2|PABP4_HUMAN 347.6 69.8 7 7 8 Isoform 2 of Polyadenylate-binding protein 4 OS=Homo sapiens GN=PABPC4 sp|P27635|RL10_HUMAN 258.8 25 7 7 8 60S ribosomal protein L10 OS=Homo sapiens GN=RPL10 PE=1 SV=4 sp|P49207|RL34_HUMAN 298.5 13.5 7 7 7 60S ribosomal protein L34 OS=Homo sapiens GN=RPL34 PE=1 SV=3 sp|P38646|GRP75_HUMAN 345.4 73.9 7 7 8 Stress-70 protein, mitochondrial OS=Homo sapiens GN=HSPA9 PE=1 SV=2 sp|P11387|TOP1_HUMAN 310.8 91.1 7 7 7 DNA topoisomerase 1 OS=Homo sapiens GN=TOP1 PE=1 SV=2 sp|P10412|H14_HUMAN 437.3 21.9 7 7 13 Histone H1.4 OS=Homo sapiens GN=HIST1H1E PE=1 SV=2 sp|P06748-2|NPM_HUMAN 324.3 29.6 7 7 7 Isoform 2 of Nucleophosmin OS=Homo sapiens GN=NPM1 sp|P18077|RL35A_HUMAN 263.6 12.6 7 7 12 60S ribosomal protein L35a OS=Homo sapiens GN=RPL35A PE=1 SV=2 sp|P18621|RL17_HUMAN 288.3 21.6 7 7 10 60S ribosomal protein L17 OS=Homo sapiens GN=RPL17 PE=1 SV=3 sp|P62081|RS7_HUMAN 281 22.1 7 7 7 40S ribosomal protein S7 OS=Homo sapiens GN=RPS7 PE=1 SV=1  102 Accession IonScore Mass Unique Discrete Total Description sp|P61353|RL27_HUMAN 251.9 15.8 7 7 12 60S ribosomal protein L27 OS=Homo sapiens GN=RPL27 PE=1 SV=2 sp|P07355-2|ANXA2_HUMAN 245.2 40.7 6 6 8 Isoform 2 of Annexin A2 OS=Homo sapiens GN=ANXA2 sp|Q9NZI8|IF2B1_HUMAN 258.9 63.8 6 6 6 Insulin-like growth factor 2 mRNA-binding protein 1 OS=Homo sapiens GN=IGF2BP1 PE=1 SV=2 sp|P84098|RL19_HUMAN 249.4 23.6 6 6 7 60S ribosomal protein L19 OS=Homo sapiens GN=RPL19 PE=1 SV=1 sp|P62888|RL30_HUMAN 323 12.9 6 6 7 60S ribosomal protein L30 OS=Homo sapiens GN=RPL30 PE=1 SV=2 sp|Q07021|C1QBP_HUMAN 429.8 31.7 6 6 9 Complement component 1 Q subcomponent-binding protein, mitochondrial OS=Homo sapiens GN=C1QBP PE=1 SV=1 sp|P05141|ADT2_HUMAN 252.2 33.1 6 6 6 ADP/ATP translocase 2 OS=Homo sapiens GN=SLC25A5 PE=1 SV=6 sp|P50914|RL14_HUMAN 290.6 23.5 6 6 6 60S ribosomal protein L14 OS=Homo sapiens GN=RPL14 PE=1 SV=4 sp|P52597|HNRPF_HUMAN 296.4 46 6 6 6 Heterogeneous nuclear ribonucleoprotein F OS=Homo sapiens GN=HNRNPF PE=1 SV=3 sp|Q9NR30-2|DDX21_HUMAN 262.7 80.1 6 6 6 Isoform 2 of Nucleolar RNA helicase 2 OS=Homo sapiens GN=DDX21 IPI:CON_00136056.1|SWISS- PROT:P08730-1 259.1 48.1 5 5 22 Tax_Id=10090 Gene_Symbol=Krt13 Isoform 1 of Keratin, type I cytoskeletal 13 REV_sp|Q8WZ42- 3|TITIN_HUMAN 130.5 3011. 5 5 5 5 Isoform Small cardiac N2-B of Titin OS=Homo sapiens GN=TTN sp|P12956|XRCC6_HUMAN 170.6 70.1 5 5 5 X-ray repair cross-complementing protein 6 OS=Homo sapiens GN=XRCC6 PE=1 SV=2 sp|P13010|XRCC5_HUMAN 169.3 83.2 5 5 5 X-ray repair cross-complementing protein 5 OS=Homo sapiens GN=XRCC5 PE=1 SV=3 sp|P26599-2|PTBP1_HUMAN 258.8 59.2 5 5 7 Isoform PTB2 of Polypyrimidine tract-binding protein 1 OS=Homo sapiens GN=PTBP1 sp|P30050|RL12_HUMAN 262.9 18 5 5 5 60S ribosomal protein L12 OS=Homo sapiens GN=RPL12 PE=1 SV=1 sp|P46779|RL28_HUMAN 218.1 15.8 5 5 9 60S ribosomal protein L28 OS=Homo sapiens GN=RPL28 PE=1 SV=3 sp|P62266|RS23_HUMAN 280.9 16 5 5 7 40S ribosomal protein S23 OS=Homo sapiens GN=RPS23 PE=1 SV=3  103 Accession IonScore Mass Unique Discrete Total Description sp|P62277|RS13_HUMAN 230.4 17.2 5 5 7 40S ribosomal protein S13 OS=Homo sapiens GN=RPS13 PE=1 SV=2 sp|P62829|RL23_HUMAN 211 15 5 5 6 60S ribosomal protein L23 OS=Homo sapiens GN=RPL23 PE=1 SV=1 sp|P84103|SRSF3_HUMAN 174.9 19.5 5 5 5 Serine/arginine-rich splicing factor 3 OS=Homo sapiens GN=SRSF3 PE=1 SV=1 sp|Q02543|RL18A_HUMAN 184.8 21 5 5 5 60S ribosomal protein L18a OS=Homo sapiens GN=RPL18A PE=1 SV=2 sp|Q12905|ILF2_HUMAN 249.5 43.3 5 5 5 Interleukin enhancer-binding factor 2 OS=Homo sapiens GN=ILF2 PE=1 SV=2 sp|Q16629-2|SRSF7_HUMAN 219.1 15.8 5 5 5 Isoform 2 of Serine/arginine-rich splicing factor 7 OS=Homo sapiens GN=SRSF7 sp|Q8NC51-2|PAIRB_HUMAN 207.4 44.3 5 5 5 Isoform 2 of Plasminogen activator inhibitor 1 RNA-binding protein OS=Homo sapiens GN=SERBP1 sp|Q92841-2|DDX17_HUMAN 265.6 73.1 5 5 6 Isoform 2 of Probable ATP-dependent RNA helicase DDX17 OS=Homo sapiens GN=DDX17 sp|P62913-2|RL11_HUMAN 206.5 20.3 4 4 4 Isoform 2 of 60S ribosomal protein L11 OS=Homo sapiens GN=RPL11 sp|P05787|K2C8_HUMAN 219.3 53.7 4 4 10 Keratin, type II cytoskeletal 8 OS=Homo sapiens GN=KRT8 PE=1 SV=7 sp|P62854|RS26_HUMAN 131.9 13.3 4 4 4 40S ribosomal protein S26 OS=Homo sapiens GN=RPS26 PE=1 SV=3 sp|P42766|RL35_HUMAN 199.4 14.5 4 4 5 60S ribosomal protein L35 OS=Homo sapiens GN=RPL35 PE=1 SV=2 sp|Q99459|CDC5L_HUMAN 142 92.4 4 4 4 Cell division cycle 5-like protein OS=Homo sapiens GN=CDC5L PE=1 SV=2 sp|P25398|RS12_HUMAN 150.2 14.9 4 4 4 40S ribosomal protein S12 OS=Homo sapiens GN=RPS12 PE=1 SV=3 sp|Q92522|H1X_HUMAN 155.5 22.5 4 4 4 Histone H1x OS=Homo sapiens GN=H1FX PE=1 SV=1 sp|P31943|HNRH1_HUMAN 233.7 49.5 4 4 4 Heterogeneous nuclear ribonucleoprotein H OS=Homo sapiens GN=HNRNPH1 PE=1 SV=4 sp|P35268|RL22_HUMAN 238.2 14.8 4 4 6 60S ribosomal protein L22 OS=Homo sapiens GN=RPL22 PE=1 SV=2 sp|Q14739|LBR_HUMAN 145 71.1 4 4 5 Lamin-B receptor OS=Homo sapiens GN=LBR PE=1 SV=2 sp|P46776|RL27A_HUMAN 214.5 16.7 4 4 4 60S ribosomal protein L27a OS=Homo sapiens GN=RPL27A  104 Accession IonScore Mass Unique Discrete Total Description PE=1 SV=2 sp|O43143|DHX15_HUMAN 168.6 91.7 4 4 4 Putative pre-mRNA-splicing factor ATP-dependent RNA helicase DHX15 OS=Homo sapiens GN=DHX15 PE=1 SV=2 sp|P67809|YBOX1_HUMAN 167.4 35.9 4 4 6 Nuclease-sensitive element-binding protein 1 OS=Homo sapiens GN=YBX1 PE=1 SV=3 sp|P16989-3|DBPA_HUMAN 152.2 37 4 4 6 Isoform 3 of DNA-binding protein A OS=Homo sapiens GN=CSDA sp|P62244|RS15A_HUMAN 171.9 14.9 4 4 4 40S ribosomal protein S15a OS=Homo sapiens GN=RPS15A PE=1 SV=2 sp|P12235|ADT1_HUMAN 184.6 33.3 4 4 4 ADP/ATP translocase 1 OS=Homo sapiens GN=SLC25A4 PE=1 SV=4 sp|P63244|GBLP_HUMAN 185.1 35.5 4 4 4 Guanine nucleotide-binding protein subunit beta-2-like 1 OS=Homo sapiens GN=GNB2L1 PE=1 SV=3 sp|P05388|RLA0_HUMAN 202.3 34.4 4 4 4 60S acidic ribosomal protein P0 OS=Homo sapiens GN=RPLP0 PE=1 SV=1 sp|Q86YZ3|HORN_HUMAN 100.8 283.1 3 3 4 Hornerin OS=Homo sapiens GN=HRNR PE=1 SV=2 sp|P22626-2|ROA2_HUMAN 126.2 36 3 3 3 Isoform A2 of Heterogeneous nuclear ribonucleoproteins A2/B1 OS=Homo sapiens GN=HNRNPA2B1 sp|P61978-2|HNRPK_HUMAN 132.7 51.3 3 3 4 Isoform 2 of Heterogeneous nuclear ribonucleoprotein K OS=Homo sapiens GN=HNRNPK sp|P62899|RL31_HUMAN 121.7 14.5 3 3 5 60S ribosomal protein L31 OS=Homo sapiens GN=RPL31 PE=1 SV=1 sp|P62910|RL32_HUMAN 106.6 16 3 3 5 60S ribosomal protein L32 OS=Homo sapiens GN=RPL32 PE=1 SV=2 sp|P83731|RL24_HUMAN 169.6 17.9 3 3 5 60S ribosomal protein L24 OS=Homo sapiens GN=RPL24 PE=1 SV=1 sp|O75400-2|PR40A_HUMAN 84.8 104.5 3 3 3 Isoform 2 of Pre-mRNA-processing factor 40 homolog A OS=Homo sapiens GN=PRPF40A sp|O00425|IF2B3_HUMAN 128.7 64 3 3 3 Insulin-like growth factor 2 mRNA-binding protein 3 OS=Homo sapiens GN=IGF2BP3 PE=1 SV=2 IPI:CON_00468956.4|SWISS- PROT:Q9R0H5 157.2 57.9 3 3 12 Tax_Id=10090 Gene_Symbol=Krt71 Keratin, type II cytoskeletal 6G sp|Q14498-2|RBM39_HUMAN 109.6 58.9 3 3 3 Isoform HCC1.3 of RNA-binding protein 39 OS=Homo sapiens GN=RBM39 sp|Q15365|PCBP1_HUMAN 115.5 38 3 3 3 Poly(rC)-binding protein 1 OS=Homo sapiens GN=PCBP1  105 Accession IonScore Mass Unique Discrete Total Description PE=1 SV=2 sp|Q15366|PCBP2_HUMAN 128.5 39 3 3 3 Poly(rC)-binding protein 2 OS=Homo sapiens GN=PCBP2 PE=1 SV=1 sp|Q2M2I5|K1C24_HUMAN 158.9 55.6 3 3 7 Keratin, type I cytoskeletal 24 OS=Homo sapiens GN=KRT24 PE=1 SV=1 sp|Q9UQ35|SRRM2_HUMAN 99.8 300.2 3 3 3 Serine/arginine repetitive matrix protein 2 OS=Homo sapiens GN=SRRM2 PE=1 SV=2 sp|Q9Y3U8|RL36_HUMAN 131.9 12.3 3 3 6 60S ribosomal protein L36 OS=Homo sapiens GN=RPL36 PE=1 SV=3 sp|P46778|RL21_HUMAN 153.4 18.6 3 3 5 60S ribosomal protein L21 OS=Homo sapiens GN=RPL21 PE=1 SV=2 sp|P38159|HNRPG_HUMAN 131.8 42.3 3 3 3 Heterogeneous nuclear ribonucleoprotein G OS=Homo sapiens GN=RBMX PE=1 SV=3 sp|P47914|RL29_HUMAN 119.1 17.8 3 3 3 60S ribosomal protein L29 OS=Homo sapiens GN=RPL29 PE=1 SV=2 sp|P32969|RL9_HUMAN 86.5 22 3 3 3 60S ribosomal protein L9 OS=Homo sapiens GN=RPL9 PE=1 SV=1 sp|P42677|RS27_HUMAN 102.7 9.8 2 2 2 40S ribosomal protein S27 OS=Homo sapiens GN=RPS27 PE=1 SV=3 sp|P23246-2|SFPQ_HUMAN 84.2 72.3 2 2 2 Isoform F of Splicing factor, proline- and glutamine-rich OS=Homo sapiens GN=SFPQ sp|Q8IXJ9|ASXL1_HUMAN 63.5 167 2 2 2 Putative Polycomb group protein ASXL1 OS=Homo sapiens GN=ASXL1 PE=1 SV=2 sp|P61513|RL37A_HUMAN 64.4 10.5 2 2 3 60S ribosomal protein L37a OS=Homo sapiens GN=RPL37A PE=1 SV=2 sp|Q13283|G3BP1_HUMAN 79.4 52.2 2 2 2 Ras GTPase-activating protein-binding protein 1 OS=Homo sapiens GN=G3BP1 PE=1 SV=1 sp|P23528|COF1_HUMAN 70.2 18.7 2 2 2 Cofilin-1 OS=Homo sapiens GN=CFL1 PE=1 SV=3 sp|P30048|PRDX3_HUMAN 89.3 28 2 2 2 Thioredoxin-dependent peroxide reductase, mitochondrial OS=Homo sapiens GN=PRDX3 PE=1 SV=3 sp|P60842|IF4A1_HUMAN 72.2 46.4 2 2 2 Eukaryotic initiation factor 4A-I OS=Homo sapiens GN=EIF4A1 PE=1 SV=1 sp|Q969Q0|RL36L_HUMAN 66.2 12.7 2 2 2 60S ribosomal protein L36a-like OS=Homo sapiens GN=RPL36AL PE=1 SV=3 sp|P22087|FBRL_HUMAN 68.4 33.9 2 2 2 rRNA 2'-O-methyltransferase fibrillarin OS=Homo sapiens  106 Accession IonScore Mass Unique Discrete Total Description GN=FBL PE=1 SV=2 sp|P0C0S5|H2AZ_HUMAN 82.4 13.5 2 2 2 Histone H2A.Z OS=Homo sapiens GN=H2AFZ PE=1 SV=2 sp|Q01081|U2AF1_HUMAN 92.6 28.4 2 2 2 Splicing factor U2AF 35 kDa subunit OS=Homo sapiens GN=U2AF1 PE=1 SV=3 sp|Q9UN86-2|G3BP2_HUMAN 72.5 50.8 2 2 2 Isoform B of Ras GTPase-activating protein-binding protein 2 OS=Homo sapiens GN=G3BP2 sp|P35080|PROF2_HUMAN 118.6 15.4 2 2 2 Profilin-2 OS=Homo sapiens GN=PFN2 PE=1 SV=3 sp|Q12906-2|ILF3_HUMAN 72.6 76.4 2 2 2 Isoform DRBP76 of Interleukin enhancer-binding factor 3 OS=Homo sapiens GN=ILF3 sp|Q13151|ROA0_HUMAN 79 31 2 2 2 Heterogeneous nuclear ribonucleoprotein A0 OS=Homo sapiens GN=HNRNPA0 PE=1 SV=1 sp|P62847-2|RS24_HUMAN 97.6 15.1 2 2 4 Isoform 2 of 40S ribosomal protein S24 OS=Homo sapiens GN=RPS24 sp|P62979|RS27A_HUMAN 104.1 18.3 2 2 5 Ubiquitin-40S ribosomal protein S27a OS=Homo sapiens GN=RPS27A PE=1 SV=2 sp|Q6P158|DHX57_HUMAN 64.5 157.1 2 2 2 Putative ATP-dependent RNA helicase DHX57 OS=Homo sapiens GN=DHX57 PE=1 SV=2 sp|P06733-2|ENOA_HUMAN 69.1 37.2 2 2 3 Isoform MBP-1 of Alpha-enolase OS=Homo sapiens GN=ENO1 sp|P25705|ATPA_HUMAN 60.7 59.8 2 2 2 ATP synthase subunit alpha, mitochondrial OS=Homo sapiens GN=ATP5A1 PE=1 SV=1 sp|P10599|THIO_HUMAN 139 12 2 2 3 Thioredoxin OS=Homo sapiens GN=TXN PE=1 SV=3 sp|P10809|CH60_HUMAN 66 61.2 2 2 2 60 kDa heat shock protein, mitochondrial OS=Homo sapiens GN=HSPD1 PE=1 SV=2 sp|Q9NYF8-2|BCLF1_HUMAN 83.9 106 2 2 2 Isoform Btf-l of Bcl-2-associated transcription factor 1 OS=Homo sapiens GN=BCLAF1 sp|Q7L2E3-2|DHX30_HUMAN 72.4 137.1 2 2 2 Isoform 2 of Putative ATP-dependent RNA helicase DHX30 OS=Homo sapiens GN=DHX30 sp|P62937|PPIA_HUMAN 77.3 18.2 2 2 4 Peptidyl-prolyl cis-trans isomerase A OS=Homo sapiens GN=PPIA PE=1 SV=2  Appendix 3 MS0190 GFP_CDK13  107 Accession( IonScore( Mass( Unique( Discrete( Total( Description sp|Q14004|CDK13_HUMAN2 3793.8 165. 6 64 64 237 Cyclin-dependent kinase 13 OS=Homo sapiens GN=CDK13 PE=1 SV=2 sp|P1194052|PABP1_HUMAN2 1176.8 61.4 23 23 29 Isoform 2 of Polyadenylate-binding protein 1 OS=Homo sapiens GN=PABPC1 tr|Q4VC03|Q4VC03_HUMAN2 950.8 72.7 21 21 26 PABPC4 protein OS=Homo sapiens GN=PABPC4 PE=2 SV=1 sp|P10809|CH60_HUMAN2 938.4 61.2 21 21 29 60 kDa heat shock protein, mitochondrial OS=Homo sapiens GN=HSPD1 PE=1 SV=2 sp|Q9NYF852|BCLF1_HUMAN2 1043.7 106 20 20 24 Isoform 2 of Bcl-2-associated transcription factor 1 OS=Homo sapiens GN=BCLAF1 sp|P17844|DDX5_HUMAN2 851.9 69.6 18 18 21 Probable ATP-dependent RNA helicase DDX5 OS=Homo sapiens GN=DDX5 PE=1 SV=1 sp|P19338|NUCL_HUMAN2 862.8 76.6 17 17 22 Nucleolin OS=Homo sapiens GN=NCL PE=1 SV=3 sp|O00571|DDX3X_HUMAN2 781.5 73.6 17 17 25 ATP-dependent RNA helicase DDX3X OS=Homo sapiens GN=DDX3X PE=1 SV=3 sp|Q00839|HNRPU_HUMAN2 817.9 91.3 17 17 27 Heterogeneous nuclear ribonucleoprotein U OS=Homo sapiens GN=HNRNPU PE=1 SV=6 tr|Q5SU16|Q5SU16_HUMAN2 967.3 50.1 16 16 22 Beta 5-tubulin OS=Homo sapiens GN=TUBB PE=2 SV=1 sp|Q8NC51|PAIRB_HUMAN2 613.3 45 16 16 18 Plasminogen activator inhibitor 1 RNA-binding protein OS=Homo sapiens GN=SERBP1 PE=1 SV=2 sp|Q9Y2W1|TR150_HUMAN2 770.8 108. 7 16 16 17 Thyroid hormone receptor-associated protein 3 OS=Homo sapiens GN=THRAP3 PE=1 SV=2 tr|Q5T6W5|Q5T6W5_HUMAN2 882.7 47.8 15 15 17 Heterogeneous nuclear ribonucleoprotein K OS=Homo sapiens GN=HNRNPK PE=2 SV=1 tr|Q59F66|Q59F66_HUMAN2 706.7 81.7 15 15 21 DEAD box polypeptide 17 isoform p82 variant (Fragment) OS=Homo sapiens PE=2 SV=1 sp|P5227252|HNRPM_HUMAN2 700 73.9 15 15 22 Isoform 2 of Heterogeneous nuclear ribonucleoprotein M OS=Homo sapiens GN=HNRNPM sp|Q9NR30|DDX21_HUMAN2 697.4 87.8 15 15 17 Nucleolar RNA helicase 2 OS=Homo sapiens GN=DDX21 PE=1 SV=5 sp|Q9P258|RCC2_HUMAN2 608.8 56.8 14 14 15 Protein RCC2 OS=Homo sapiens GN=RCC2 PE=1 SV=2 sp|Q7L2E352|DHX30_HUMAN2 482.8 137. 1 14 14 14 Isoform 2 of Putative ATP-dependent RNA helicase DHX30 OS=Homo sapiens GN=DHX30 tr|E7EWF1|E7EWF1_HUMAN2 640.8 45.8 14 14 15 Uncharacterized protein OS=Homo sapiens GN=RPL4  108 Accession( IonScore( Mass( Unique( Discrete( Total( Description PE=4 SV=1 tr|A9C4C1|A9C4C1_HUMAN2 497.4 22.6 13 13 17 Ribosomal protein S9 OS=Homo sapiens GN=RPS9 PE=3 SV=1 sp|Q9NZI8|IF2B1_HUMAN2 748.5 63.8 13 13 13 Insulin-like growth factor 2 mRNA-binding protein 1 OS=Homo sapiens GN=IGF2BP1 PE=1 SV=2 sp|P05787|K2C8_HUMAN2 619.8 53.7 13 13 15 Keratin, type II cytoskeletal 8 OS=Homo sapiens GN=KRT8 PE=1 SV=7 tr|B4DW52|B4DW52_HUMAN2 753.5 39 13 13 24 Uncharacterized protein OS=Homo sapiens GN=ACTB PE=2 SV=1 sp|Q9BVA1|TBB2B_HUMAN2 728.9 50.4 13 13 18 Tubulin beta-2B chain OS=Homo sapiens GN=TUBB2B PE=1 SV=1 tr|Q5VX58|Q5VX58_HUMAN2 571.2 70.2 12 12 14 Poly(A) binding protein, cytoplasmic 3 OS=Homo sapiens GN=PABPC3 PE=2 SV=1 sp|P61247|RS3A_HUMAN2 626 30.2 12 12 13 40S ribosomal protein S3a OS=Homo sapiens GN=RPS3A PE=1 SV=2 tr|B2R491|B2R491_HUMAN2 480.8 29.8 12 12 13 Ribosomal protein S4, X-linked, isoform CRA_c OS=Homo sapiens GN=RPS4X PE=2 SV=1 sp|Q9BQG05 2|MBB1A_HUMAN2 448 150. 2 12 12 12 Isoform 2 of Myb-binding protein 1A OS=Homo sapiens GN=MYBBP1A sp|Q07955|SRSF1_HUMAN2 578.4 27.8 12 12 15 Serine/arginine-rich splicing factor 1 OS=Homo sapiens GN=SRSF1 PE=1 SV=2 tr|Q5T8U4|Q5T8U4_HUMAN2 567.3 30.1 11 11 14 Ribosomal protein L7a OS=Homo sapiens GN=RPL7A PE=2 SV=1 sp|P25705|ATPA_HUMAN2 690.8 59.8 11 11 12 ATP synthase subunit alpha, mitochondrial OS=Homo sapiens GN=ATP5A1 PE=1 SV=1 tr|F5H288|F5H288_HUMAN2 434.6 47.1 11 11 11 Uncharacterized protein OS=Homo sapiens GN=VIM PE=3 SV=1 tr|A8K579|A8K579_HUMAN2 491.7 71.3 11 11 11 Plastin 3 (T isoform) OS=Homo sapiens GN=PLS3 PE=2 SV=1 sp|P67809|YBOX1_HUMAN2 653 35.9 11 11 18 Nuclease-sensitive element-binding protein 1 OS=Homo sapiens GN=YBX1 PE=1 SV=3 sp|P18124|RL7_HUMAN2 442.8 29.3 11 11 13 60S ribosomal protein L7 OS=Homo sapiens GN=RPL7 PE=1 SV=1 sp|P13010|XRCC5_HUMAN2 434.1 83.2 10 10 10 X-ray repair cross-complementing protein 5 OS=Homo  109 Accession( IonScore( Mass( Unique( Discrete( Total( Description sapiens GN=XRCC5 PE=1 SV=3 sp|P0965152|ROA1_HUMAN2 478 34.3 10 10 13 Isoform A1-A of Heterogeneous nuclear ribonucleoprotein A1 OS=Homo sapiens GN=HNRNPA1 sp|P0039052|GSHR_HUMAN2 464.5 52.2 10 10 12 Isoform Cytoplasmic of Glutathione reductase, mitochondrial OS=Homo sapiens GN=GSR tr|Q9BUQ0|Q9BUQ0_HUMAN2 415 59.8 9 9 10 Polypyrimidine tract binding protein 1 OS=Homo sapiens GN=PTBP1 PE=2 SV=1 tr|D6RH20|D6RH20_HUMAN2 366.1 34.7 9 9 9 Uncharacterized protein OS=Homo sapiens GN=MRPS27 PE=4 SV=1 tr|C9JFV5|C9JFV5_HUMAN2 398.2 83.7 9 9 12 Uncharacterized protein OS=Homo sapiens GN=ILF3 PE=4 SV=1 tr|B1AHC9|B1AHC9_HUMAN2 498 64.5 9 9 10 Uncharacterized protein OS=Homo sapiens GN=XRCC6 PE=4 SV=1 tr|A2A3R6|A2A3R6_HUMAN2 447.7 28.8 9 9 9 40S ribosomal protein S6 OS=Homo sapiens GN=RPS6 PE=2 SV=1 sp|P15880|RS2_HUMAN2 434.4 31.6 9 9 10 40S ribosomal protein S2 OS=Homo sapiens GN=RPS2 PE=1 SV=2 sp|Q1324753|SRSF6_HUMAN2 464.2 38.6 9 9 16 Isoform SRP55-3 of Serine/arginine-rich splicing factor 6 OS=Homo sapiens GN=SRSF6 sp|Q02878|RL6_HUMAN2 443.9 32.8 9 9 9 60S ribosomal protein L6 OS=Homo sapiens GN=RPL6 PE=1 SV=3 sp|P7836252|SRPK2_HUMAN2 357 79.7 9 9 10 Isoform 2 of Serine/threonine-protein kinase SRPK2 OS=Homo sapiens GN=SRPK2 sp|P38919|IF4A3_HUMAN2 438.3 47.1 9 9 9 Eukaryotic initiation factor 4A-III OS=Homo sapiens GN=EIF4A3 PE=1 SV=4 sp|P38159|HNRPG_HUMAN2 495.3 42.3 9 9 10 Heterogeneous nuclear ribonucleoprotein G OS=Homo sapiens GN=RBMX PE=1 SV=3 tr|B2R6F3|B2R6F3_HUMAN2 453.4 19.5 8 8 11 Splicing factor arginine/serine-rich 3 OS=Homo sapiens GN=SFRS3 PE=2 SV=1 IPI:CON_00714876.1|ENSEMBL :ENSBTAP000000382532 367.9 63.4 8 8 34 (Bos taurus) 63 kDa protein sp|O4368452|BUB3_HUMAN2 376.8 37.3 8 8 9 Isoform 2 of Mitotic checkpoint protein BUB3 OS=Homo sapiens GN=BUB3 sp|P02533|K1C14_HUMAN2 451 51.9 8 8 35 Keratin, type I cytoskeletal 14 OS=Homo sapiens  110 Accession( IonScore( Mass( Unique( Discrete( Total( Description GN=KRT14 PE=1 SV=4 sp|P16989|DBPA_HUMAN2 479.7 40.1 8 8 15 DNA-binding protein A OS=Homo sapiens GN=CSDA PE=1 SV=4 sp|P2206152|PIMT_HUMAN2 379.6 24.8 8 8 8 Isoform 2 of Protein-L-isoaspartate(D-aspartate) O- methyltransferase OS=Homo sapiens GN=PCMT1 sp|P23396|RS3_HUMAN2 358.3 26.8 8 8 8 40S ribosomal protein S3 OS=Homo sapiens GN=RPS3 PE=1 SV=2 sp|P39023|RL3_HUMAN2 395.9 46.4 8 8 11 60S ribosomal protein L3 OS=Homo sapiens GN=RPL3 PE=1 SV=2 sp|P52597|HNRPF_HUMAN2 438.6 46 8 8 11 Heterogeneous nuclear ribonucleoprotein F OS=Homo sapiens GN=HNRNPF PE=1 SV=3 sp|P61254|RL26_HUMAN2 331.5 17.2 8 8 16 60S ribosomal protein L26 OS=Homo sapiens GN=RPL26 PE=1 SV=1 sp|P62750|RL23A_HUMAN2 409.4 17.7 8 8 12 60S ribosomal protein L23a OS=Homo sapiens GN=RPL23A PE=1 SV=1 sp|P82650|RT22_HUMAN2 436.9 41.4 8 8 9 28S ribosomal protein S22, mitochondrial OS=Homo sapiens GN=MRPS22 PE=1 SV=1 sp|Q08211|DHX9_HUMAN2 363.9 142. 2 8 8 11 ATP-dependent RNA helicase A OS=Homo sapiens GN=DHX9 PE=1 SV=4 tr|E9PB24|E9PB24_HUMAN2 394.6 19.5 8 8 15 Uncharacterized protein OS=Homo sapiens GN=RPL28 PE=4 SV=1 tr|Q5JR94|Q5JR94_HUMAN2 416.8 24.5 8 8 8 40S ribosomal protein S8 OS=Homo sapiens GN=RPS8 PE=2 SV=1 sp|P62906|RL10A_HUMAN2 324.7 25 7 7 12 60S ribosomal protein L10a OS=Homo sapiens GN=RPL10A PE=1 SV=2 tr|B4DP59|B4DP59_HUMAN2 278.2 41.4 7 7 9 Death associated protein 3, isoform CRA_d OS=Homo sapiens GN=DAP3 PE=2 SV=1 sp|O00425|IF2B3_HUMAN2 325.1 64 7 7 8 Insulin-like growth factor 2 mRNA-binding protein 3 OS=Homo sapiens GN=IGF2BP3 PE=1 SV=2 sp|Q9290052|RENT1_HUMAN2 253.7 124. 3 7 7 7 Isoform 2 of Regulator of nonsense transcripts 1 OS=Homo sapiens GN=UPF1 tr|D2K8Q1|D2K8Q1_HUMAN2 271.1 66.3 7 7 7 AAA domain containing 3A protein OS=Homo sapiens GN=ATAD3A PE=2 SV=1 sp|O75400|PR40A_HUMAN2 241.8 109 7 7 7 Pre-mRNA-processing factor 40 homolog A OS=Homo sapiens GN=PRPF40A PE=1 SV=2  111 Accession( IonScore( Mass( Unique( Discrete( Total( Description tr|F5H6G5|F5H6G5_HUMAN2 327.6 55.8 7 7 13 Uncharacterized protein OS=Homo sapiens GN=KRT6B PE=3 SV=1 sp|P05141|ADT2_HUMAN2 361.1 33.1 7 7 10 ADP/ATP translocase 2 OS=Homo sapiens GN=SLC25A5 PE=1 SV=7 sp|Q6PKG0|LARP1_HUMAN2 298.5 123. 8 7 7 9 La-related protein 1 OS=Homo sapiens GN=LARP1 PE=1 SV=2 sp|Q16658|FSCN1_HUMAN2 267.2 55.1 7 7 7 Fascin OS=Homo sapiens GN=FSCN1 PE=1 SV=3 sp|P11387|TOP1_HUMAN2 254.3 91.1 7 7 9 DNA topoisomerase 1 OS=Homo sapiens GN=TOP1 PE=1 SV=2 sp|O6050653|HNRPQ_HUMAN2 299.9 62.8 7 7 10 Isoform 3 of Heterogeneous nuclear ribonucleoprotein Q OS=Homo sapiens GN=SYNCRIP sp|P1553152|NDKA_HUMAN2 300 19.9 7 7 8 Isoform 2 of Nucleoside diphosphate kinase A OS=Homo sapiens GN=NME1 tr|Q5JW30|Q5JW30_HUMAN2 253.3 54.9 7 7 7 Staufen, RNA binding protein, homolog 1 (Drosophila) OS=Homo sapiens GN=STAU1 PE=2 SV=1 sp|Q07021|C1QBP_HUMAN2 486.6 31.7 7 7 11 Complement component 1 Q subcomponent-binding protein, mitochondrial OS=Homo sapiens GN=C1QBP PE=1 SV=1 sp|Q07020|RL18_HUMAN2 444.1 21.7 7 7 10 60S ribosomal protein L18 OS=Homo sapiens GN=RPL18 PE=1 SV=2 sp|Q04695|K1C17_HUMAN2 399 48.4 7 7 16 Keratin, type I cytoskeletal 17 OS=Homo sapiens GN=KRT17 PE=1 SV=2 sp|O95232|LC7L3_HUMAN2 350.4 51.8 7 7 7 Luc7-like protein 3 OS=Homo sapiens GN=LUC7L3 PE=1 SV=2 sp|P1461852|KPYM_HUMAN2 277.7 58.5 7 7 7 Isoform M1 of Pyruvate kinase isozymes M1/M2 OS=Homo sapiens GN=PKM2 sp|Q96EY7|PTCD3_HUMAN2 353.5 79.2 7 7 7 Pentatricopeptide repeat-containing protein 3, mitochondrial OS=Homo sapiens GN=PTCD3 PE=1 SV=3 tr|A6NNE8|A6NNE8_HUMAN2 377.3 19.1 7 7 15 Uncharacterized protein OS=Homo sapiens GN=SRSF7 PE=4 SV=3 sp|P61313|RL15_HUMAN2 257.9 24.2 7 7 8 60S ribosomal protein L15 OS=Homo sapiens GN=RPL15 PE=1 SV=2 sp|P82675|RT05_HUMAN2 218.2 48.5 6 6 6 28S ribosomal protein S5, mitochondrial OS=Homo sapiens GN=MRPS5 PE=1 SV=2 sp|P09661|RU2A_HUMAN2 281.1 28.5 6 6 6 U2 small nuclear ribonucleoprotein A' OS=Homo sapiens  112 Accession( IonScore( Mass( Unique( Discrete( Total( Description GN=SNRPA1 PE=1 SV=2 tr|A3R0T8|A3R0T8_HUMAN2 358.7 21.9 6 6 15 Histone 1, H1e OS=Homo sapiens GN=HIST1H1E PE=2 SV=1 sp|P0790052|HS90A_HUMAN2 281.4 98.7 6 6 6 Isoform 2 of Heat shock protein HSP 90-alpha OS=Homo sapiens GN=HSP90AA1 sp|P61353|RL27_HUMAN2 286.2 15.8 6 6 12 60S ribosomal protein L27 OS=Homo sapiens GN=RPL27 PE=1 SV=2 sp|P62263|RS14_HUMAN2 384.5 16.4 6 6 8 40S ribosomal protein S14 OS=Homo sapiens GN=RPS14 PE=1 SV=3 tr|B4DXZ6|B4DXZ6_HUMAN2 263.9 68.6 6 6 7 Uncharacterized protein OS=Homo sapiens GN=FXR1 PE=2 SV=1 tr|B4DVB8|B4DVB8_HUMAN2 261.9 39.2 6 6 6 cDNA FLJ60076, highly similar to ELAV-like protein 1 OS=Homo sapiens PE=2 SV=1 sp|P2636852|U2AF2_HUMAN2 286.3 53.4 6 6 6 Isoform 2 of Splicing factor U2AF 65 kDa subunit OS=Homo sapiens GN=U2AF2 sp|P27348|1433T_HUMAN2 263.3 28 6 6 6 14-3-3 protein theta OS=Homo sapiens GN=YWHAQ PE=1 SV=1 sp|Q0678753|FMR1_HUMAN2 244.1 70.3 6 6 7 Isoform 2 of Fragile X mental retardation 1 protein OS=Homo sapiens GN=FMR1 tr|Q5HY54|Q5HY54_HUMAN2 208.4 279. 1 6 6 6 Filamin A, alpha (Actin binding protein 280) OS=Homo sapiens GN=FLNA PE=2 SV=1 sp|Q13162|PRDX4_HUMAN2 293.4 30.7 6 6 10 Peroxiredoxin-4 OS=Homo sapiens GN=PRDX4 PE=1 SV=1 sp|O75909|CCNK_HUMAN2 258.7 64.6 6 6 10 Cyclin-K OS=Homo sapiens GN=CCNK PE=1 SV=2 sp|Q1514952|PLEC_HUMAN2 178.7 520. 1 6 6 6 Isoform 2 of Plectin OS=Homo sapiens GN=PLEC sp|O75439|MPPB_HUMAN2 255.7 55.1 6 6 7 Mitochondrial-processing peptidase subunit beta OS=Homo sapiens GN=PMPCB PE=1 SV=2 sp|P42167|LAP2B_HUMAN2 210.5 50.7 6 6 6 Lamina-associated polypeptide 2, isoforms beta/gamma OS=Homo sapiens GN=TMPO PE=1 SV=2 tr|F5H3H6|F5H3H6_HUMAN2 253.6 80.5 6 6 8 Uncharacterized protein OS=Homo sapiens GN=DDX50 PE=4 SV=1 tr|F5H2F4|F5H2F4_HUMAN2 241 111. 3 6 6 6 Uncharacterized protein OS=Homo sapiens GN=MTHFD1 PE=3 SV=1  113 Accession( IonScore( Mass( Unique( Discrete( Total( Description sp|Q92522|H1X_HUMAN2 354.1 22.5 6 6 9 Histone H1x OS=Homo sapiens GN=H1FX PE=1 SV=1 sp|O7540053|PR40A_HUMAN2 212.4 107. 1 6 6 6 Isoform 3 of Pre-mRNA-processing factor 40 homolog A OS=Homo sapiens GN=PRPF40A sp|P17987|TCPA_HUMAN2 257.9 60.8 6 6 6 T-complex protein 1 subunit alpha OS=Homo sapiens GN=TCP1 PE=1 SV=1 tr|E9PKZ0|E9PKZ0_HUMAN2 311.6 22.6 6 6 11 Uncharacterized protein OS=Homo sapiens GN=RPL8 PE=4 SV=1 sp|P49756|RBM25_HUMAN2 317 100. 5 6 6 7 RNA-binding protein 25 OS=Homo sapiens GN=RBM25 PE=1 SV=3 tr|E7EUB4|E7EUB4_HUMAN2 204 89.3 6 6 7 Uncharacterized protein OS=Homo sapiens GN=CDC5L PE=4 SV=1 sp|O43175|SERA_HUMAN2 315.2 57.4 6 6 6 D-3-phosphoglycerate dehydrogenase OS=Homo sapiens GN=PHGDH PE=1 SV=4 tr|E7EMJ8|E7EMJ8_HUMAN2 331.5 46.8 6 6 12 Uncharacterized protein OS=Homo sapiens GN=SRSF4 PE=4 SV=2 tr|E5RI99|E5RI99_HUMAN2 283.7 12.8 6 6 7 Uncharacterized protein OS=Homo sapiens GN=RPL30 PE=3 SV=1 tr|B4E3C2|B4E3C2_HUMAN2 269.4 17.3 5 5 6 Uncharacterized protein OS=Homo sapiens GN=RPL17 PE=2 SV=1 sp|P27635|RL10_HUMAN2 192.8 25 5 5 7 60S ribosomal protein L10 OS=Homo sapiens GN=RPL10 PE=1 SV=4 sp|P55795|HNRH2_HUMAN2 283.6 49.5 5 5 8 Heterogeneous nuclear ribonucleoprotein H2 OS=Homo sapiens GN=HNRNPH2 PE=1 SV=1 sp|Q9Y399|RT02_HUMAN2 173.1 33.5 5 5 5 28S ribosomal protein S2, mitochondrial OS=Homo sapiens GN=MRPS2 PE=1 SV=1 tr|B7Z9L0|B7Z9L0_HUMAN2 243.6 52.8 5 5 5 T-complex protein 1 subunit delta OS=Homo sapiens GN=CCT4 PE=2 SV=1 tr|D3YTB1|D3YTB1_HUMAN2 139.9 15.7 5 5 5 Uncharacterized protein OS=Homo sapiens GN=RPL32 PE=4 SV=1 tr|Q6IB29|Q6IB29_HUMAN2 202.7 34.9 5 5 6 EBNA1 binding protein 2 OS=Homo sapiens GN=EBNA1BP2 PE=2 SV=1 sp|P12268|IMDH2_HUMAN2 212.7 56.2 5 5 5 Inosine-5'-monophosphate dehydrogenase 2 OS=Homo sapiens GN=IMPDH2 PE=1 SV=2 sp|P2262652|ROA2_HUMAN2 242.7 36 5 5 5 Isoform A2 of Heterogeneous nuclear ribonucleoproteins A2/B1 OS=Homo sapiens GN=HNRNPA2B1  114 Accession( IonScore( Mass( Unique( Discrete( Total( Description sp|Q9Y383|LC7L2_HUMAN2 206.1 46.9 5 5 6 Putative RNA-binding protein Luc7-like 2 OS=Homo sapiens GN=LUC7L2 PE=1 SV=2 sp|Q9BY77|PDIP3_HUMAN2 179.3 46.3 5 5 6 Polymerase delta-interacting protein 3 OS=Homo sapiens GN=POLDIP3 PE=1 SV=2 sp|O76021|RL1D1_HUMAN2 220.7 55.2 5 5 5 Ribosomal L1 domain-containing protein 1 OS=Homo sapiens GN=RSL1D1 PE=1 SV=3 tr|Q6IAX2|Q6IAX2_HUMAN2 207.4 18.6 5 5 6 RPL21 protein OS=Homo sapiens GN=RPL21 PE=2 SV=1 sp|P22087|FBRL_HUMAN2 260.6 33.9 5 5 5 rRNA 2'-O-methyltransferase fibrillarin OS=Homo sapiens GN=FBL PE=1 SV=2 sp|P51991|ROA3_HUMAN2 221.5 39.8 5 5 7 Heterogeneous nuclear ribonucleoprotein A3 OS=Homo sapiens GN=HNRNPA3 PE=1 SV=2 tr|Q5T081|Q5T081_HUMAN2 156.9 45.4 5 5 6 CHC1 protein OS=Homo sapiens GN=RCC1 PE=2 SV=1 tr|Q57Z92|Q57Z92_HUMAN2 177.5 22.1 5 5 7 Putative uncharacterized protein RPS7 OS=Homo sapiens GN=RPS7 PE=2 SV=1 sp|Q16543|CDC37_HUMAN2 193.5 45 5 5 6 Hsp90 co-chaperone Cdc37 OS=Homo sapiens GN=CDC37 PE=1 SV=1 IPI:CON_00462140.1|SWISS5 PROT:Q6IFZ62 260.1 61.4 5 5 18 Tax_Id=10090 Gene_Symbol=Krt77 Keratin, type II cytoskeletal 1b sp|Q9BVP252|GNL3_HUMAN2 185.3 61 5 5 5 Isoform 2 of Guanine nucleotide-binding protein-like 3 OS=Homo sapiens GN=GNL3 sp|P18077|RL35A_HUMAN2 216.3 12.6 5 5 9 60S ribosomal protein L35a OS=Homo sapiens GN=RPL35A PE=1 SV=2 sp|P3194652|1433B_HUMAN2 190 27.9 5 5 5 Isoform Short of 14-3-3 protein beta/alpha OS=Homo sapiens GN=YWHAB tr|E9PCZ6|E9PCZ6_HUMAN2 250 56.2 5 5 5 Uncharacterized protein OS=Homo sapiens GN=RBM39 PE=4 SV=1 tr|D6R956|D6R956_HUMAN2 242.1 27.1 5 5 5 Uncharacterized protein OS=Homo sapiens GN=UCHL1 PE=4 SV=1 sp|Q96SB4|SRPK1_HUMAN2 203.1 75 5 5 6 Serine/threonine-protein kinase SRPK1 OS=Homo sapiens GN=SRPK1 PE=1 SV=2 tr|B4DDE4|B4DDE4_HUMAN2 262.4 65.2 4 4 4 Ubiquitin-activating enzyme E1 OS=Homo sapiens GN=UBA1 PE=2 SV=1 tr|B4DDZ8|B4DDZ8_HUMAN2 146.1 55.8 4 4 4 Serine/threonine-protein phosphatase OS=Homo sapiens GN=PPP5C PE=2 SV=1  115 Accession( IonScore( Mass( Unique( Discrete( Total( Description tr|A8K517|A8K517_HUMAN2 221.9 16 4 4 9 Ribosomal protein S23, isoform CRA_a OS=Homo sapiens GN=RPS23 PE=2 SV=1 sp|P62841|RS15_HUMAN2 112.4 17 4 4 4 40S ribosomal protein S15 OS=Homo sapiens GN=RPS15 PE=1 SV=2 sp|Q9NSB2|KRT84_HUMAN2 150.1 65.9 4 4 6 Keratin, type II cuticular Hb4 OS=Homo sapiens GN=KRT84 PE=1 SV=2 sp|P00492|HPRT_HUMAN2 221.8 24.8 4 4 4 Hypoxanthine-guanine phosphoribosyltransferase OS=Homo sapiens GN=HPRT1 PE=1 SV=2 sp|P68036|UB2L3_HUMAN2 160.6 18 4 4 5 Ubiquitin-conjugating enzyme E2 L3 OS=Homo sapiens GN=UBE2L3 PE=1 SV=1 sp|P8291252|RT11_HUMAN2 163.2 20.6 4 4 5 Isoform 2 of 28S ribosomal protein S11, mitochondrial OS=Homo sapiens GN=MRPS11 sp|P18583510|SON_HUMAN2 144.7 248 4 4 4 Isoform J of Protein SON OS=Homo sapiens GN=SON sp|Q01081|U2AF1_HUMAN2 230.3 28.4 4 4 4 Splicing factor U2AF 35 kDa subunit OS=Homo sapiens GN=U2AF1 PE=1 SV=3 sp|Q9NTZ6|RBM12_HUMAN2 204.9 97.6 4 4 4 RNA-binding protein 12 OS=Homo sapiens GN=RBM12 PE=1 SV=1 tr|D6RBZ0|D6RBZ0_HUMAN2 199.6 35.8 4 4 5 Uncharacterized protein OS=Homo sapiens GN=HNRNPAB PE=4 SV=1 tr|A4D0Z3|A4D0Z3_HUMAN2 147.6 20.6 4 4 4 ADP-ribosylation factor 5 OS=Homo sapiens GN=ARF5 PE=2 SV=1 tr|Q5HY57|Q5HY57_HUMAN2 164.1 25 4 4 4 Emerin OS=Homo sapiens GN=EMD PE=2 SV=1 tr|E7ET98|E7ET98_HUMAN2 212.1 46 4 4 4 Uncharacterized protein OS=Homo sapiens GN=KHDRBS1 PE=4 SV=2 sp|Q13242|SRSF9_HUMAN2 177.6 25.6 4 4 4 Serine/arginine-rich splicing factor 9 OS=Homo sapiens GN=SRSF9 PE=1 SV=1 sp|Q1324353|SRSF5_HUMAN2 191.8 31 4 4 8 Isoform SRP40-4 of Serine/arginine-rich splicing factor 5 OS=Homo sapiens GN=SRSF5 sp|Q1383852|DX39B_HUMAN2 181.5 51.1 4 4 6 Isoform 2 of Spliceosome RNA helicase DDX39B OS=Homo sapiens GN=DDX39B tr|E7ERE4|E7ERE4_HUMAN2 191.4 71.6 4 4 6 Uncharacterized protein OS=Homo sapiens GN=HNRNPR PE=4 SV=1 sp|Q6P2Q9|PRP8_HUMAN2 122.8 274. 7 4 4 4 Pre-mRNA-processing-splicing factor 8 OS=Homo sapiens GN=PRPF8 PE=1 SV=2  116 Accession( IonScore( Mass( Unique( Discrete( Total( Description sp|P40429|RL13A_HUMAN2 185 23.6 4 4 5 60S ribosomal protein L13a OS=Homo sapiens GN=RPL13A PE=1 SV=2 sp|Q6YN1652|HSDL2_HUMAN2 155.4 37.5 4 4 4 Isoform 2 of Hydroxysteroid dehydrogenase-like protein 2 OS=Homo sapiens GN=HSDL2 tr|Q1W6G4|Q1W6G4_HUMAN2 135.2 38.8 4 4 5 LUC7-like (S. cerevisiae) OS=Homo sapiens GN=LUC7L PE=2 SV=1 sp|P42766|RL35_HUMAN2 172.3 14.5 4 4 7 60S ribosomal protein L35 OS=Homo sapiens GN=RPL35 PE=1 SV=2 sp|Q9Y6M151|IF2B2_HUMAN2 187 61.9 4 4 4 Isoform 2 of Insulin-like growth factor 2 mRNA-binding protein 2 OS=Homo sapiens GN=IGF2BP2 tr|E7EP00|E7EP00_HUMAN2 161.6 108 4 4 4 Uncharacterized protein OS=Homo sapiens GN=SEC24C PE=4 SV=2 sp|Q9UMS4|PRP19_HUMAN2 173.3 55.6 4 4 4 Pre-mRNA-processing factor 19 OS=Homo sapiens GN=PRPF19 PE=1 SV=1 sp|Q99575|POP1_HUMAN2 170.1 116. 3 4 4 4 Ribonucleases P/MRP protein subunit POP1 OS=Homo sapiens GN=POP1 PE=1 SV=2 sp|Q9Y265|RUVB1_HUMAN2 186.9 50.5 4 4 4 RuvB-like 1 OS=Homo sapiens GN=RUVBL1 PE=1 SV=1 tr|E9PG15|E9PG15_HUMAN2 179.8 17.2 4 4 4 Uncharacterized protein OS=Homo sapiens GN=YWHAQ PE=4 SV=1 sp|Q9H0C2|ADT4_HUMAN2 144.1 35.3 4 4 5 ADP/ATP translocase 4 OS=Homo sapiens GN=SLC25A31 PE=1 SV=1 tr|C9JXK0|C9JXK0_HUMAN2 135.8 24.3 4 4 6 Uncharacterized protein OS=Homo sapiens GN=LBR PE=4 SV=1 tr|C9JD32|C9JD32_HUMAN2 147.7 9.8 4 4 5 Uncharacterized protein OS=Homo sapiens GN=RPL23 PE=3 SV=1 tr|B7Z6S8|B7Z6S8_HUMAN2 193.9 15.2 4 4 6 Uncharacterized protein OS=Homo sapiens GN=RPL14 PE=2 SV=1 tr|B2R4W8|B2R4W8_HUMAN2 182 14.9 4 4 5 HCG1994130, isoform CRA_a OS=Homo sapiens GN=hCG_1994130 PE=2 SV=1 sp|P62277|RS13_HUMAN2 201.9 17.2 4 4 5 40S ribosomal protein S13 OS=Homo sapiens GN=RPS13 PE=1 SV=2 sp|P62280|RS11_HUMAN2 122.5 18.6 4 4 5 40S ribosomal protein S11 OS=Homo sapiens GN=RPS11 PE=1 SV=3 tr|Q6IRZ0|Q6IRZ0_HUMAN2 188.4 14 4 4 6 RPL31 protein OS=Homo sapiens GN=RPL31 PE=2 SV=1  117 Accession( IonScore( Mass( Unique( Discrete( Total( Description tr|B4DQI6|B4DQI6_HUMAN2 199.9 20.6 4 4 4 cDNA FLJ50614, highly similar to Transformer-2 protein homolog OS=Homo sapiens PE=2 SV=1 sp|Q8WVV954|HNRLL_HUMAN2 96.1 60.5 3 3 3 Isoform 4 of Heterogeneous nuclear ribonucleoprotein L-like OS=Homo sapiens GN=HNRPLL sp|P16455|MGMT_HUMAN2 92.7 21.9 3 3 3 Methylated-DNA--protein-cysteine methyltransferase OS=Homo sapiens GN=MGMT PE=1 SV=1 sp|Q9UQ35|SRRM2_HUMAN2 100.3 300. 2 3 3 3 Serine/arginine repetitive matrix protein 2 OS=Homo sapiens GN=SRRM2 PE=1 SV=2 sp|Q92665|RT31_HUMAN2 133.2 45.4 3 3 4 28S ribosomal protein S31, mitochondrial OS=Homo sapiens GN=MRPS31 PE=1 SV=3 tr|D6RFJ8|D6RFJ8_HUMAN2 83.3 47.3 3 3 3 Uncharacterized protein OS=Homo sapiens GN=G3BP2 PE=4 SV=1 sp|Q92901|RL3L_HUMAN2 134.4 46.6 3 3 3 60S ribosomal protein L3-like OS=Homo sapiens GN=RPL3L PE=1 SV=3 tr|F5GYJ8|F5GYJ8_HUMAN2 132.8 33 3 3 3 Uncharacterized protein OS=Homo sapiens GN=OTUB1 PE=4 SV=1 sp|Q9Y3U8|RL36_HUMAN2 127.4 12.3 3 3 4 60S ribosomal protein L36 OS=Homo sapiens GN=RPL36 PE=1 SV=3 sp|P43487|RANG_HUMAN2 128 23.5 3 3 3 Ran-specific GTPase-activating protein OS=Homo sapiens GN=RANBP1 PE=1 SV=1 tr|E9PMN9|E9PMN9_HUMAN2 76.6 70.4 3 3 3 Uncharacterized protein OS=Homo sapiens GN=NAT10 PE=4 SV=1 tr|A6NIT8|A6NIT8_HUMAN2 122.3 51.2 3 3 5 Uncharacterized protein OS=Homo sapiens GN=HNRNPL PE=2 SV=1 tr|B2R4S9|B2R4S9_HUMAN2 179.5 13.9 3 3 8 Histone H2B OS=Homo sapiens GN=HIST1H2BC PE=2 SV=1 sp|Q99832|TCPH_HUMAN2 116.2 59.8 3 3 3 T-complex protein 1 subunit eta OS=Homo sapiens GN=CCT7 PE=1 SV=2 PPP2R1A:P179R2 124.9 66.1 3 3 3 sp|Q9Y224|CN166_HUMAN2 127.2 28.2 3 3 3 UPF0568 protein C14orf166 OS=Homo sapiens GN=C14orf166 PE=1 SV=1 sp|Q9Y3I0|RTCB_HUMAN2 121.3 55.7 3 3 3 tRNA-splicing ligase RtcB homolog OS=Homo sapiens GN=C22orf28 PE=1 SV=1 tr|E9PLL6|E9PLL6_HUMAN2 155.2 12.3 3 3 4 Uncharacterized protein OS=Homo sapiens GN=RPL27A PE=3 SV=1  118 Accession( IonScore( Mass( Unique( Discrete( Total( Description sp|Q9Y2Q9|RT28_HUMAN2 138.9 21 3 3 3 28S ribosomal protein S28, mitochondrial OS=Homo sapiens GN=MRPS28 PE=1 SV=1 tr|A8K4C8|A8K4C8_HUMAN2 190.7 24.3 3 3 6 60S ribosomal protein L13 OS=Homo sapiens GN=RPL13 PE=2 SV=1 sp|Q02543|RL18A_HUMAN2 98 21 3 3 4 60S ribosomal protein L18a OS=Homo sapiens GN=RPL18A PE=1 SV=2 tr|E9PC80|E9PC80_HUMAN2 128.7 57.8 3 3 3 Uncharacterized protein OS=Homo sapiens GN=EIF2AK2 PE=4 SV=1 sp|P31153|METK2_HUMAN2 170.7 44 3 3 3 S-adenosylmethionine synthase isoform type-2 OS=Homo sapiens GN=MAT2A PE=1 SV=1 sp|P49207|RL34_HUMAN2 142 13.5 3 3 3 60S ribosomal protein L34 OS=Homo sapiens GN=RPL34 PE=1 SV=3 sp|P84098|RL19_HUMAN2 110.9 23.6 3 3 3 60S ribosomal protein L19 OS=Homo sapiens GN=RPL19 PE=1 SV=1 sp|P82933|RT09_HUMAN2 115.3 46 3 3 3 28S ribosomal protein S9, mitochondrial OS=Homo sapiens GN=MRPS9 PE=1 SV=2 sp|Q9BYN8|RT26_HUMAN2 174.5 24.3 3 3 3 28S ribosomal protein S26, mitochondrial OS=Homo sapiens GN=MRPS26 PE=1 SV=1 sp|P82932|RT06_HUMAN2 111.2 14.3 3 3 3 28S ribosomal protein S6, mitochondrial OS=Homo sapiens GN=MRPS6 PE=1 SV=3 sp|P62851|RS25_HUMAN2 133.6 13.8 3 3 3 40S ribosomal protein S25 OS=Homo sapiens GN=RPS25 PE=1 SV=1 tr|E7EWH4|E7EWH4_HUMAN2 122.7 22.4 3 3 3 Uncharacterized protein OS=Homo sapiens GN=AK2 PE=3 SV=1 tr|E7EUT4|E7EUT4_HUMAN2 124.5 31.7 3 3 3 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=3 SV=1 tr|B4DL14|B4DL14_HUMAN2 140.3 27.6 3 3 3 ATP synthase gamma chain OS=Homo sapiens GN=ATP5C1 PE=2 SV=1 2 2 2 2 2 2 2 tr|C9JNW5|C9JNW5_HUMAN2 190.2 17.6 3 3 4 Ribosomal protein L24, isoform CRA_e OS=Homo sapiens GN=RPL24 PE=4 SV=1 tr|B4DUR8|B4DUR8_HUMAN2 174.9 56.2 3 3 3 Uncharacterized protein OS=Homo sapiens GN=CCT3 PE=2 SV=1 tr|A3KFK8|A3KFK8_HUMAN2 95.7 61.9 3 3 3 Far upstream element (FUSE) binding protein 3 OS=Homo sapiens GN=FUBP3 PE=2 SV=1  119 Accession( IonScore( Mass( Unique( Discrete( Total( Description sp|P37108|SRP14_HUMAN2 97.8 14.7 3 3 3 Signal recognition particle 14 kDa protein OS=Homo sapiens GN=SRP14 PE=1 SV=2 sp|Q4G17652|ACSF3_HUMAN2 141.6 58.5 3 3 3 Isoform 2 of Acyl-CoA synthetase family member 3, mitochondrial OS=Homo sapiens GN=ACSF3 tr|Q68CR9|Q68CR9_HUMAN2 113.3 46.1 3 3 3 Putative uncharacterized protein DKFZp781B11202 OS=Homo sapiens GN=DKFZp781B11202 PE=2 SV=1 sp|Q5JWF252|GNAS1_HUMAN2 126 110. 3 3 3 3 Isoform XLas-2 of Guanine nucleotide-binding protein G(s) subunit alpha isoforms XLas OS=Homo sapiens GN=GNAS tr|A3RJH1|A3RJH1_HUMAN2 141.6 83.3 3 3 3 ATP-dependent RNA helicase DDX1 OS=Homo sapiens GN=DDX1 PE=2 SV=1 sp|P30050|RL12_HUMAN2 124.4 18 3 3 3 60S ribosomal protein L12 OS=Homo sapiens GN=RPL12 PE=1 SV=1 tr|Q53XR2|Q53XR2_HUMAN2 135.1 31.6 3 3 3 Stem-loop (Histone) binding protein OS=Homo sapiens GN=SLBP PE=2 SV=1 tr|A2RUM7|A2RUM7_HUMAN2 153.9 34.6 3 3 3 Ribosomal protein L5 OS=Homo sapiens GN=RPL5 PE=2 SV=1 tr|Q5QPQ0|Q5QPQ0_HUMAN2 122.5 17.9 3 3 3 Lysophospholipase II OS=Homo sapiens GN=LYPLA2 PE=2 SV=1 tr|B4DS01|B4DS01_HUMAN2 132.9 40.8 3 3 3 Uncharacterized protein OS=Homo sapiens GN=EIF4B PE=2 SV=1 sp|P33993|MCM7_HUMAN2 132.9 81.9 3 3 3 DNA replication licensing factor MCM7 OS=Homo sapiens GN=MCM7 PE=1 SV=4 sp|Q9Y3D9|RT23_HUMAN2 127.8 21.8 3 3 3 28S ribosomal protein S23, mitochondrial OS=Homo sapiens GN=MRPS23 PE=1 SV=2 tr|B5MDF5|B5MDF5_HUMAN2 118.2 26.4 3 3 3 RAN, member RAS oncogene family, isoform CRA_c OS=Homo sapiens GN=RAN PE=4 SV=1 sp|Q9NTJ352|SMC4_HUMAN2 81.7 140. 9 3 3 3 Isoform 2 of Structural maintenance of chromosomes protein 4 OS=Homo sapiens GN=SMC4 tr|B1ALY5|B1ALY5_HUMAN2 115.1 57.1 3 3 3 ROD1 regulator of differentiation 1 (S. pombe) OS=Homo sapiens GN=ROD1 PE=2 SV=1 tr|B4E1T7|B4E1T7_HUMAN2 100 53.5 3 3 3 cDNA FLJ58665, highly similar to Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform OS=Homo sapiens PE=2 SV=1 tr|Q5T0P8|Q5T0P8_HUMAN2 170.4 15.1 3 3 5 40S ribosomal protein S24 OS=Homo sapiens GN=RPS24 PE=2 SV=1  120 Accession( IonScore( Mass( Unique( Discrete( Total( Description sp|Q8NFW8|NEUA_HUMAN2 137.6 49 3 3 3 N-acylneuraminate cytidylyltransferase OS=Homo sapiens GN=CMAS PE=1 SV=2 tr|F5H2U2|F5H2U2_HUMAN2 99.9 115. 7 3 3 3 Uncharacterized protein OS=Homo sapiens GN=PRPF4B PE=4 SV=1 tr|E5KMT5|E5KMT5_HUMAN2 87.4 48 2 2 2 Pseudouridine synthase OS=Homo sapiens PE=3 SV=1    121 Appendix 4 PCR primer sequences Primer name Gene Vector 5' or 3' RE Site MP full MP seq Sequence PTX3043 CrkRS CTD  V954     59.5 56.3 PTXSC001 CDK12 V954 5' AscI 73.6 60.9 ATC GGG CGC GCC AAA ACC CAA GAG CCA GCA GGC PTXSC002 CDK13 V954 Sequencing  X   56.9 CGG ACT AAG TCG TCC AAG GAG PTXSC003 CDK13 V954 Sequencing X   56.9 CAA AGC AAA AAC AAA GCC ACC TCT PTXSC004 CDK13 V954 Sequencing X   54.9 TAT ATG GAC CAT GAT CTG ATG PTXSC005 CDK13 V954 Sequencing X   56 TGT TTC CAC AAT TAA AGC CCC C PTXSC006 CDK13 V954 Sequencing X   55.3 ACA GAA AAC CAG CAT GTA CCC PTXSC007 CDK12 pIEX2 5' BamHI 61.6 50.5 A ACG GAT CC AT GCC CAA T TC AGA GAGA PTXSC008 CDK12 pIEX2 3' (open) Not I 67.1 41.8 A TAC AGC TGT GCG GCC GC TTAG TAA GGA ACT CCT PTXSC009 CDK12 pIEX9 5' BamHI 59.5 50.5 CAG GAT CCT ATG CCC AAT TCA GAGAGA PTXSC010 CDK12 pIEX9 3' (closed) Not I  70.5 51.2 ATA CAG CTG T GCG GCC GC GTA AGG AAC TCC TCT CCC  122 Primer name Gene Vector 5' or 3' RE Site MP full MP seq Sequence PTXSC011 CycK pIEX9 5' BamHI  61.4 49.2 GGG TAC CAG GAT CCT ATG AAG GAG AAT AAA GAA AAT TCA A PTXSC012 CycK pIEX9 3' (open) NotI  69.9 51.6 ATA CAG CTG T GCG GCC GC TTA TCT CAT CCA GGC TGC PTXSC013 CycK pIEX9 3' NotI  72.1 54.4 ATA CAG CTG T GCG GCC GC TCT CAT CCA GGC TGC C PTXSC014 CycK pIEX9 5' BamHI  69.9 68.1 GGGTACCAGGATCCTATGAAGGAGAA TAAAGAAAATTCAAGCCCTTCAGTAA CTTCAGCAAACCTGGACCACACA PTXSC015 CDK12 pIEX9 5' BamHI 69.4 64.8 CAGGATCCTATGCCCAATTCAGAGAG ACATGGGGGCAAGAAGGACG PTXSC016 CDK12 pIEX9 5' NcoI 66 62.4 AAC CCA TGG TGC CCA ATT CAG AGA GAC ATG GG PTXSC017 CycK pIEX9 5' NcoI 57 51.6 AAC CCA TGG ATA AGG AGA ATA AAG AAA ATT CAA PTXSC018 NTD CDK12 pIEX2 3' AscI 73 58 AAC GGC GCG CC CACACAGCGTTTCCCCCA PTXSC019 CTD CDK12 pIEX2 5' AscI 66 50.6 AAC GGC GCG CCT CAG AGC GAC TTC CTT AAA PTXSC020 NTD pIEX9 3' SalI 67.4 58 AAC GTC GAC CAC ACA GCG TTT CCC  123 Primer name Gene Vector 5' or 3' RE Site MP full MP seq Sequence CDK12 CCA PTXSC021 CTD CDK12 pIEX9 5' SalI 62.4 52.1 AAC GTC GAC CAG AGC GAC TTC CTT AAA GAT PTXSC022 CDK12 pIEX9 5' PciI  60.8 AAC ACA TGT TGC CCA ATT CAG AGA GAC ATG GG PTXSC023 CDK12 pIEX2 5' BamHI 63 50.5 A ACG GAT CCC ATG CCC AAT TCA GAG AGA PTXSCGF P5 GFP pIEX 5' NcoI 64 60.3 AAC CCA TGG TGA GCA AGG GCG AGG PTXSCGF P3 GFP pIEX 3' (open) Bsu36I 64 57 AAC CCT GAG GTT ACG TTT CTC GTT CAG CTT TTT TGT ACA AA PTXSC024 CDK12 Gateway 5' AttL recom. site 71.6 65.4 GGGG ACA AGT TTG TAC AAA AAA GCA GGC TTC GAA GGA GAT AGA ACC ATG GGG CCC AAT TCA GAG AGA CAT GGG G PTXSC025 CDK12 Gateway 3' (open) 69.2 56.1 GGGGACCAC TTT GTA CAA GAA AGC TGG GTC TTA GTA AGG AAC TCC TCT CCC TCT PTXSC026 CDK12 Gateway 3' (closed) 70.2 58 GGGGACCAC TTT GTA CAA GAA AGC TGG GTC GTA AGG AAC TCCTCTCCCTCTTCC  124 Primer name Gene Vector 5' or 3' RE Site MP full MP seq Sequence PTXSC027 CDK13 Gateway 5' 71.3 64.6 GGGGACAAGTTTGTACAAAAAAGCA GGCT TC ATG CCG AGC AGC TCG GAC ACG PTXSC028 CDK13 Gateway 3' (closed) 71.7 62 GGGGACCACTTTGTACAAGAAAGCT GGGTC GTATGGTAACCCTCTGCCTCTGCCT  Appendix 5 qPCR primer sequences Primer Name Primer Sequence CDK13F_3404 AAGCCCCCAGGAAGGACTTGTCT CDK13R_3542 AAGTGCTGTCCAGGGCCTGTTTT CDK13F_3442 AGCAGAACCAACACACCCCAGGG CDK13R_3544 TTAAGTGCTGTCCAGGGCCTGTT CDK13F_3422 TGTCTCTGGGCTTGGATGACAGC CDK13R_3551 CTGTGGTTTAAGTGCTGTCCAGGGC RBM25F_159 AGGTCGCGAAGGCAGTACCGT RBM25R_288 GGAAACTGCGGGGGTGGGATC  125 Primer Name Primer Sequence RBM25F_89 TCAGTCTCCCTGGCGAGCGAC RBM25R_276 GGTGGGATCCCTGGTGGGAGT RBM25F_123 GAACCAGTGGAGCGCACTCGT RBM25R_256 TGGTGGGAGTGCTGGGATTCCC PRP19F_917 TCCTCACTGGTGGGGCGGAT PRP19R_1098 AGAGGCATTGGGGACCGACCA PRP19F_1556 TGGCTCTTGGGGGCACGGA PRP19R_1663 GATGCCCGAAGGCCACCCCT PRP19F_135 AAGTGGCTCGCGGAGGCTCA PRP19R_254 CATGGGTGCTCCGGCACTTCG CDC5LF_2283 GCCGCTACACACGGGCCAAT CDC5LR_2391 GCAGCCCTCTTGGCTTCTGTCG CDC5LF_1525 GCTGACTCCCCGGAGTGGAACA CDC5LF_R1716 GGGGCAGGAAGGCCCAACAA CDC5LF_1369 GGCCCTCACCAATGTGGACACC CDC5LR_1541 CACTCCGGGGAGTCAGCCCTT 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0073117/manifest

Comment

Related Items