UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Developing Arabidopsis thaliana seed coat specific promoter as a tool for basic and applied research Esfandiari, Elahe 2012

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2012_fall_esfandiari_elahe.pdf [ 2.55MB ]
Metadata
JSON: 24-1.0073116.json
JSON-LD: 24-1.0073116-ld.json
RDF/XML (Pretty): 24-1.0073116-rdf.xml
RDF/JSON: 24-1.0073116-rdf.json
Turtle: 24-1.0073116-turtle.txt
N-Triples: 24-1.0073116-rdf-ntriples.txt
Original Record: 24-1.0073116-source.json
Full Text
24-1.0073116-fulltext.txt
Citation
24-1.0073116.ris

Full Text

DEVELOPING ARABIDOPSIS THALIANA SEED COAT SPECIFIC PROMOTER AS A TOOL FOR BASIC AND APPLIED RESEARCH  by Elahe Esfandiari  B.Sc., University of Tehran, 2009  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in The Faculty of Graduate Studies (Botany)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  August 2012 ©Elahe Esfandiari, 2012  ABSTRACT During differentiation of Arabidopsis thaliana seed coat epidermal cells, dramatic changes occur highlighted by the synthesis and secretion of large amounts of pectinaceous mucilage. This cell type, therefore, provides an excellent molecular-genetic model to study the biosynthesis, secretion and modification of plant cell wall polysaccharides. Here, I describe the development of an experimental tool to aid in studying cell wall components found in mucilage. I sought to identify a promoter that drives gene expression specifically in the mucilage secretory cells to investigate the effect of manipulating different cell wall polymers in the mucilage without detrimental effects to the rest of the plant. The search for such a promoter was initiated by analyzing seed coat microarray data, followed by investigating expression pattern of the candidate genes by Reverse Transcription-Polymerase Chain Reaction (RT-PCR). By fusing the regulatory region of these candidate genes to beta-glucuronidase gene (GUS), one promoter was identified, that of the DIRIGENT PROTEIN1 (DP1) gene, that was able to drive expression specifically in the epidermis and palisade layer of Arabidopsis and Brassica napus seed coats. These results were confirmed using Citrine Yellow Fluorescent Protein (YFP). To verify the potential ability of the DP1 promoter (DP1Pro) to express enzyme-encoding genes and determine putative role(s) of homogalacturonan in mucilage, the ARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE2 (ADPG2) encoding a polygalacturonase was expressed under the control of DP1Pro and targeted to the apoplast. Although RT-PCR results showed that the DP1Pro drives expression of this gene in the seed coat, no significant difference was found between transgenic and wild type mucilage or the seed coat epidermal cell morphology.  ii  MUCILAGE-MODIFIED4 (MUM4) gene was found to encode a putative UDP-L-rhamnose synthase, required for synthesis of mucilage. While the transcript of MUM4 is found throughout the plant, it is specifically up-regulated during mucilage biosynthesis. To identify the sequences responsible for this up-regulation, a deletion analysis of the MUM4 transcription regulatory region was undertaken. Dissection of the MUM4 promoter region led to identification of two functional domains: one conferring higher level of gene expression in root, cotyledon and silique walls, and one that promotes expression specifically in the seed coat.  iii  PREFACE Figure 1-1 is previously published image (Nature Reviews Genetics, 2008, by permission) Figure 1-2 is a previously published image (Journal of The Plant Cell, 2008, by permission). A version of chapter 3 has been submitted for publication: Esfandiari, E., Jin, Z., Abdeen, A., Griffiths, J., Western, L.T., Haughn, G.W. “Identification and analysis of an outer-seed-coatspecific promoter from Arabidopsis thaliana”. Mr. Zhaoqing Jin, a former member of the Haughn lab, analyzed seed coat microarray data (Dean et al., 2011) and examined the expression of candidate genes in a public database (the Arabidopsis eFP Browser at the University of Toronto BioArray Resource). As part of a collaborative effort with Dr. Haughn’s laboratory, Dr. Ashraf Abdeen, a former postdoctoral fellow in Tamara Western’s lab (McGill), conducted RT-RCR shown in Figure 3-1. Dr. Abdeen also made At1g09550Pro::GUS and At5g45770Pro::GUS constructs and performed a histochemical GUS assay for the transgenic lines and took the images. At1g02720Pro::GUS transgenic line was provided by Dr. Hahn (Complex Carbohydrate Research Center; The University of Georgia). Dr. Abdeen did GUS assay for the transgenic lines carrying At1g02720Pro::GUS construct and took the images. Mr. Jin designed and made At2g23550Pro::GUS, At2g43050Pro::GUS, At2g47750Pro::GUS, At3g14630Pro::GUS, At3g52550Pro::GUS, At4g11180Pro-a::GUS and At4g11180Pro-b::GUS constructs. Mr. Jin and I performed GUS assays and took the images. Figure 3-2 is a modified version of Mr. Jin’s image. Figure 3-4, 3-5, 3-7A, 3-8 are based on Mr. Jin’s results. I prepared the samples for confocal imaging and Jonathan Griffiths took the confocal images shown in figure 39 (C-E). pAD vecor was provided by Dr. Allan DeBono.  iv  Figure 4-1 was obtained from the Arabidopsis eFP Browser at the University of Toronto BioArray Resource. SEM was performed with the technical assistance of Derrick Horne (Bioimaging facility; UBC). Schematic maps in Chapter 5 are a modified version of Mr. Jin’s images. Mr. Jin designed and made MUM41.7Pro::GUS, MUM41.5Pro::GUS, MUM41.2Pro::GUS, MUM41.0Pro::GUS and MUM40.9Pro::GUS constructs. Mr. Jin and I independently performed histochemical GUS assay and qPCR for the transgenic lines carrying these constructs. Since similar results were obtained, I presented my results.  v  TABLE OF CONTENTS Abstract .............................................................................................................................................ii Preface ............................................................................................................................................. iv Table of Contents .............................................................................................................................. vi List of Tables ...................................................................................................................................... x List of Figures.................................................................................................................................... xi List of Abbreviations ....................................................................................................................... xiii Acknowledgements.......................................................................................................................... xv Dedication ..................................................................................................................................... xvii Chapter 1: general introduction..........................................................................................................1 1.1 The Plant Cell Walls............................................................................................................................. 1 1.1.1 Cellulose and Hemicelluloses ....................................................................................................... 2 1.1.2 Pectins .......................................................................................................................................... 2 1.1.2.1 homogalacturonan ................................................................................................................ 4 1.1.2.2 rhamnogalacturonan (rg) i &ii............................................................................................... 4 1.2 The Arabidopsis Seed Coat Epidermis ................................................................................................ 5 1.2.1 Structure, Polysaccharide Components and Function of Arabidopsis Seed Coat Mucilage ........ 6 1.2.2 Differentiation of the Arabidopsis Seed Coat Epidermal Cells .................................................... 8 1.2.2.1 the mum4 is involved in mucilage biosynthesis .................................................................. 9 1.3 Regulation of Gene Expression ......................................................................................................... 10 1.4 Importance of Tissue Specific Promoters ......................................................................................... 11 1.4.1 Seed Coat Specific Promoters in Arabidopsis thaliana and Brassica napus .............................. 13 1.5 Research Outline and Objectives ...................................................................................................... 14 Chapter 2: Materials and Methods ................................................................................................... 17 2.1 Plant Material and Growth Conditions ............................................................................................. 17 2.1.1 Arabidopsis thaliana Growth Conditions ................................................................................... 17 2.1.1.1 arabidopsis flower development staging ............................................................................ 17 2.1.1.2 crossing arabidopsis plants ................................................................................................. 18 2.1.2 Brassica napus (B. napus) Growth and Flower Development Staging ....................................... 18 2.1.3 Agrobacterium-Mediated Plant Transformation ....................................................................... 18 2.1.3.1 arabidopsis transformation................................................................................................. 18 vi  2.1.3.2 b. Napus transformation ..................................................................................................... 19 2.2 Nucleic Acid Analysis ......................................................................................................................... 20 2.2.1 Arabidopsis Genomic DNA Extraction for Cloning ..................................................................... 20 2.2.2 DNA Extraction for Genotyping of Transgenic Lines .................................................................. 20 2.2.3 RNA Extraction of Arabidopsis Seed Coat .................................................................................. 21 2.2.4 DNA Sequencing and Alignment ................................................................................................ 22 2.3 Agarose Gel Electrophoresis ............................................................................................................. 22 2.3.1 Preparation of Agarose Gel and Imaging ................................................................................... 22 2.3.2 Gel Extraction ............................................................................................................................. 22 2.4 Recombinant DNA Experiments........................................................................................................ 23 2.4.1 Preparation and Heat-Shock Transformation of Escherichia coli Competent Cells ................... 24 2.4.2 Plasmid Miniprep ....................................................................................................................... 25 2.4.3 Preparation and Heat-Shock Transformation of Agrobacterium tumefaciens Competent Cells ............................................................................................................................................................ 25 2.4.4 Construct Design ........................................................................................................................ 26 2.4.4.1 Generation of DP1Pro-c::Citrine and MUM40.3Pro::Citrine YFP Constructs ............................. 27 2.4.4.2 Generation of MUM40.3pro::GUS and MUM40.7pro::GUS Constructs ..................................... 28 2.4.4.3 Generation of DP1Pro::ADPG2-myc and DP1Pro::Signal sequence::ADPG2-myc Constructs 29 2.5 Reverse-Transcriptase PCR and Quantitative PCR Analysis .............................................................. 30 2.6 5’-Rapid Amplification of cDNA End (RACE)...................................................................................... 31 2.6.1 Arabidopsis Total RNA Extraction .................................................................................................. 31 2.7 Histochemical GUS Assay .................................................................................................................. 32 2.8 Western blot ..................................................................................................................................... 32 2.9 Sectioning .......................................................................................................................................... 33 2.9.1 Sectioning of Developing Arabidopsis Seeds ............................................................................. 33 2.9.2 Sectioning of Developing Brassica napus Seeds ........................................................................ 33 2.10 Microscopy Techniques................................................................................................................. 34 2.10.1 Ruthenium Red Staining .......................................................................................................... 34 2.10.2 Fluorescence Microscopy......................................................................................................... 34 2.10.3 Confocal Microscopy ................................................................................................................ 34 2.10.4 Scanning Electron Microscopy ................................................................................................. 35  vii  Chapter 3: Identification and Analysis of an Outer-Seed-Coat-Specific Promoter from Arabidopsis thaliana ........................................................................................................................................... 36 3.1 Synopsis............................................................................................................................................. 36 3.2 Previous and Related Work............................................................................................................... 37 3.2.1 Identification of Genes with Putative Seed-Coat Specific Expression Using Arabidopsis thaliana seed Coat Microarray Data ................................................................................................................. 37 3.2.2 Expression Pattern of Potential Seed Coat Epidermal-Specific Genes .................................... 38 3.3 Results ............................................................................................................................................... 42 3.3.1 The DIRIGENT PROTEIN1 (DP1) Promoter Drives Seed Coat-Specific Expression ..................... 42 3.3.2 DIRIGENT PROTEIN1 transcript distribution correlates well with DP1 promoter activity ......... 47 3.3.3 The DP1 promoter is active in the epidermal and palisade layers of Arabidopsis and Brassica napus seed coats ................................................................................................................................. 49 3.4 Discussion.......................................................................................................................................... 52 3.4.1 DP1 promoter respresents a tool for studying and modifying seed coat properties ................ 52 3.4.2 Different fragments of DP1 transcriptional regulatory region showed a similar seed coat specific pattern of expression ............................................................................................................. 53 3.4.3 The DP1 promoter was the only promoter identified as seed coat-specific during mucilage synthesis.............................................................................................................................................. 53 3.4.4 DP1 may play a role in neolignan biosynthesis .......................................................................... 54 Chapter 4: Expressing A Carbohydrate Active Enzyme Targeted to the Apoplast and Under the Control of the Outer-Seed-Coat-Specific Promoter DP1. ................................................................................ 55 4.1 Synopsis............................................................................................................................................. 55 4.2 Introduction ...................................................................................................................................... 55 4.3 Results ............................................................................................................................................... 57 4.3.1 Expression of ADPG2 under the control of DP1 promoter ........................................................ 57 4.3.2 Expression of ADPG2 did not alter mucilage structure and morphology of seed coat epidermal cells ..................................................................................................................................................... 59 4.4 Discussion.......................................................................................................................................... 63 Chapter 5: Promoter Deletion Analysis of the MUCILAGE-MODIFIED4 gene to Identify the Putative cisRegulatory Element Responsible for Its Up-Regulation in the Seed Coat ............................................ 65 5.1 Synopsis............................................................................................................................................. 65 5.2 Previous and Related Work............................................................................................................... 66 5.2.1 Analyzing the MUM4 Transcriptional Regulatory Region to Search for Putative Transcription Factor Binding Sites............................................................................................................................. 66 viii  5.2.2 Deletion of the 3’UTR of the Upstream Gene Possessing A Putative TFBS Does Not Affect the GUS Expression Pattern. ..................................................................................................................... 67 5.2.3 Absence of the Second and Third Putative TFBSs Does Not Affect Reporter Gene Expression 72 5.3 Results ............................................................................................................................................... 73 5.3.1 The 5’UTR Intron Enhances the Expression of the Reporter Gene in Seedlings and Leaves. .... 73 5.3.2 A Fragment Excluding 5’UTR, Putative TFBSs and the Closest TATA Box to the TSS Restricts Expression of the Reporter Gene to the Seed Coat ............................................................................ 76 5.3.3 Identification of MUM4 Transcription Start Sites by 5′ RACE .................................................... 77 5.3.4 Testing ifthe MUM4 Full-Length Promoter Contains All the Regulatory Elements ................... 80 5.4 Discussion.......................................................................................................................................... 82 5.4.1 The Activity of MUM4 Full-Length Promoter is Consistent with the Expression Pattern of MUM4 Gene in Previous Studies ........................................................................................................ 82 5.4.2 MUM4 Promoter Deletion Analysis Revealed Presence of Two Functional Domains............... 82 5.4.3 Variable qRT-PCR Results ........................................................................................................... 83 Chapter 6: Conclusion and Future Directions..................................................................................... 85 Bibliography .................................................................................................................................... 88 Appendix ......................................................................................................................................... 96  ix  LIST OF TABLES Table 2-1 Antibiotics required for selection of Agrobacterium tumefaciens...............................26 Table 2-2 Name and antibiotics used to select for specific vectors.............................................27 Table 3-1 Fold changes in gene expression in wild type compared to ap2 at 7 DPA and in Col-2 at 7 DPA compared to 3 DPA........................................................................................................38 Table 3-2 Summary of GUS histochemical assay in different transgenic lines.............................42  x  LIST OF FIGURES Figure 1-1 Structure of the primary cell wall.................................................................................3 Figure 1-2 Development of seed coat epidermal cells in Arabidopsis during mucilage biosynthesis....................................................................................................................................................9 Figure 3-1 Expression analysis of seed coat-specific candidate genes in Arabidopsis by RTPCR................................................................................................................................................40 Figure 3-2 Schematic representation of the transcriptional regulatory sequences of nine genes cloned upstream of a promoterless GUS reporter gene..............................................................41 Figure 3-3 Expression of the GUS reporter gene driven by transcriptional regulatory regions of putative seed coat-specific genes.................................................................................................43 Figure 3-4 More detailed histochemical GUS assay of tissues of Arabidopsis transformed with DP1Pro-b::GUS.................................................................................................................................44 Figure 3-5 RT-PCR analysis of GUS transcript...............................................................................45 Figure 3-6 Expression of the Citrine YFP reporter gene driven by the DP1 promoter..................46 Figure 3-7 DP1 seed coat expression analysis..............................................................................48 Figure 3-8 qPCR analysis of DP1 transcript in seed coat, embryo and silique wall at 7 DPA........49 Figure 3-9 DP1Pro expression pattern in Arabidopsis thaliana......................................................50 Figure 3-10 Quantitative comparison between the activity of DP1Pro-b and 35SPro by measuring levels of transcript of GUS driven by each of the promoters.......................................................51 Figure 3-11 Thick cross sections of transgenic B. napus..............................................................51 Figure 4-1 Expression pattern of ADPG2......................................................................................58 Figure 4-2 Schematic representation of DP1Pro::ADPG2-myc, DP1Pro:: LTPGSignal seq::PG-myc and DP1Pro::MUM2Signal seq::PG-myc constructs..................................................................................59 Figure 4-3 Expression analysis of ADPG2 driven by DP1 promoter in two independent transgenic lines by RT-PCR.............................................................................................................................60 Figure 4-4 Mucilage analysis of DP1Pro::ADPG2-myc....................................................................61 Figure 4-5 Scanning electron micrograph of DP1Pro::ADPG2-myc and wild type (Col-2) mature seeds.............................................................................................................................................62 xi  Figure 5-1 Schematic map of the MUM4 locus............................................................................67 Figure 5-2 Nucleotide sequence of the transcriptional regulatory region of MUM4 from position -1203 to +518............................................................................................................................................68 Figure 5-3 Schematic map of the MUM4 locus representing MUM41.7Pro and MUM41.5Pro constructs...........................................................................................................................................69 Figure 5-4 Expression of the GUS reporter gene driven by putative full length promoter of MUM4 and truncated promoter fragments.................................................................................70 Figure 5-5 MUM41.5Pro::GUS expression analysis..........................................................................71 Figure 5-6 Schematic map of the MUM4 locus representing MUM41.0Pro and MUM40.9Pro constructs...........................................................................................................................................72 Figure 5-7 MUM40.9Pro::GUS and MUM41.0Pro::GUS expression analysis.......................................73 Figure 5-8 Schematic map of the MUM4 locus representing MUM41.2Pro and MUM40.7Pro constructs...........................................................................................................................................74 Figure 5-9 MUM41.2Pro::GUS and MUM40.7::GUS expression analysis..........................................75 Figure 5-10 Schematic map of the MUM4 locus representing MUM40.3Pro constructs................76 Figure 5-11 MUM40.3::GUS expression analysis...........................................................................77 Figure 5-12 The 5’RACE products of MUM4 using leaves RNA of Arabidopsis Col-2 as template..............................................................................................................................................78 Figure 5-13 Nucleotide alignment of 5’RACE product aligned with the MUM4 sequence ..........79 Figure 5-14 Expression analysis of GUS driven by MUM41.5Pro in gl2, ttg1 and ap2 background using qPCR....................................................................................................................................81  xii  LIST OF ABBREVIATIONS 35S  Promoter of Cauliflower Mosaic Virus, widely used for its strong and constitutive activity in dicot plants.  ADPG2  ARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE 2.  AP2  APETALA2.  ATG  Adenosine, thymine, guanidine. Triplet code for the amino acid methionine, Also known as start codon.  Bp  Base pairs  cDNA  Complementary DNA.  Col-2  Columbia-2, a common Arabidopsis ecotype.  DNA  Deoxyribonucleic acid.  DP1  DIRIGENT PROTEIN 1.  DPA  Days post anthesis.  EDTA  Ethylenediaminetetraacetic acid.  GL2  GLABRA 2.  GUS  β-glucuronidase.  HG  Homogalacturonan.  LTPG  Lipid transfer protein with a predicted GPI (glycosylphosphatidylinositol)-anchor domain.  MUM2  MUCILAGE-MODIFIED 2.  MUM4  MUCILAGE-MODIFIED 4.  Myc-tag  A polypeptide protein tag (N-EQKLISEEDL-C; size: 1.202 kDa) derived from the cMyc gene.  PCR  Polymerase chain reaction.  PG  Polygalacturonase. xiii  Pro  Promoter.  qPCR  Quantitative polymerase chain reaction.  RG I  Rhamnogalacturonan I.  RG II  Rhamnogalacturonan II.  RNA  Ribonucleic acid.  RT-PCR  Reverse-transcription polymerase chain reaction.  SEM  Scanning electron microscopy.  Signal seq  Signal sequence.  T3  Transgenic plants generation #3.  TFBS  Transcription factor binding sites.  TSS  Transcription start site.  TTG1  TRANSPARENT TESTA GLABRA 1.  UBC  University of British Columbia  UTR  Untranslated region of DNA.  WT  Wild type.  X-Gluc  5-bromo-4-chloro-3-indolyl glucuronide.  YFP  Yellow florescent protein.  xiv  ACKNOWLEDGEMENTS First and foremost, I offer my sincere gratitude to my supervisor Dr. George W. Haughn for his excellent guidance, continuous support, and exceptional patience in expanding my vision of Genetics. It has been my absolute honor to be a member of his lab. I would also like to express my enduring gratitude to my committee members Dr. Ljerka Kunst and Dr. Lacey Samuels for their insightful suggestions for improvement on both my research and my course work. I also gratefully acknowledge Mr. Zhaoqing Jin for his generous and invaluable assistance at the beginning of my studies and teaching me the techniques of molecular biology. In addition I would like to thank Dr. Tamara Western and Dr. Ashraf Abdeen, our collaborators at McGill University for their help on the DP1 paper and Dr. Michael Hahn at the Complex Carbohydrate Research Center, The University of Georgia, for providing At1g02720Pro::GUS transgenic plants. Special thanks, as well, to Dr. Jun Huang, a former PhD student in the Haughn lab for collaboration on the MUM1 paper. I also owe particular thanks to the faculty, staff, postdoctoral fellows and graduate students in the Botany department at the UBC, who have inspired me to continue my work in this field and helped to train me in the many techniques needed to complete this research. I give special thanks to Dr. Aurora Mañas Fernandez and Dr. Allan DeBono, as well, for consistent and substantial help on molecular cloning and for generously sharing their protocols and their time with me. Thanks also to Dr. Chris Ambrose for training me in fluorescent microscopy, Dr. Michael Friedmann for excellent suggestions on performing qPCR, Jonathan Griffiths for resin embedding training and confocal imaging and Dr. Robin Young for instruction in sectioning. In adxv  dition, a big thank you to Gabriel Lévesque-Tremblay for considerable and generous help with molecular cloning, western blot analyses, microscopy and imaging. I also appreciate continuous support and patient assistance of Lin Shi, and countless discussions with Lifang Zhao . I would like to thank the staff of the UBC Bioimaging Facility as well (Kevin Hodgson, Derrick Horne, Garnet Martens, and Bradford Ross) for their invaluable assistance. I also thank all current and former members of the Haughn and Kunst labs, including Dr. Erin Gilchrist and Dr. Gillian Dean for comments and critical reading of the DP1 manuscript, Dr. Vesna Katavic, Scott Liang, Patricia Lam, Catalin Voiniciuc and Tegan Haslam for many helpful discussions and for their friendship. Finally, I owe thanks and send very warm regards to my family and friends. Profound thanks go to my beloved husband for being an incredible friend and supportive advisor over the years. I owe him more thanks than I can ever put in words.  xvi  DEDICATION To my beloved Husband, Mohamad  xvii  CHAPTER 1: GENERAL INTRODUCTION 1.1 THE PLANT CELL WALLS Cells of land plants are encased by a complex, polysaccharide-rich wall, the architecture and composition of which differs in various cell types and different stages of development (Freshour et al., 1996; Derbyshire et al., 2007; Roppolo et al., 2011). Although the cell wall is rigid, it is flexible enough to allow cell expansion and division. As the outermost layer of the cell, the wall performs many significant protective roles against biotic and abiotic stresses. It provides structural support for the cell, determines cell shape and establishes a defence barrier against pathogens (Vorwerk et al., 2004; Boudart et al., 2005; Abbott and Boraston, 2008; Liepman et al., 2010). In addition, pectins, one of the components of the cell walls, are involved in the control of tissue cohesion, and influences ion-exchange, and cell-cell interactions (Willats and Knox, 1996; Rose et al., 1998; Atkinson et al., 2002; Hall and Cannon, 2002; Proper, 2008). From the industrial perspective, the cell wall is utilized in many ways including for food, textiles, paper, wood and fuel. Cell walls can be divided into two types with respect to the timing of their synthesis relative to cell growth: primary cell wall and secondary cell wall. All growing and dividing cells have a primary cell wall. Following the cessation of cell growth, some differentiated cell types synthesize a secondary cell wall inside the primary cell wall. Primary cell walls are composed predominantly of cellulose microfibrils embedded in a matrix of hemicelluloses, pectins and glycoproteins. Based on a model proposing organization of different polysaccharides in the cell wall, cellulose is the load-bearing structure and serves  1  as a scaffold. Cellulose microfibrils are interconnected by hemicelluloses. Pectins form a gellike phase in which the cellulose-hemicellulose network is embedded (Liepman et al., 2010). Secondary cells walls can include other components such as lignin that provides additional support following the cessation of cell growth.  1.1.1 CELLULOSE AND HEMICELLULOSES Almost 30-40% of the primary cell wall is constituted of cellulose-crystalline arrays of β1,4-glucan-which makes it the most abundant biopolymer on Earth (Somerville, 2006). The percentage of cellulose in certain types of secondary cell walls can reach 90%. Cellulose gives the cell the rigidity to resist internal turgor pressure. Mutations in genes required for cellulose synthesis for the primary cell wall typically result in a dwarf phenotype indicating that cellulose is required for normal growth (Nicole et al., 1998) and formation of the cell plate (Zuo et al., 2000). Hemicelluloses are a heterogeneous group of polysaccharides with a common feature of possessing a β-linked sugar backbone. This family of carbohydrates have been divided into xyloglucans, xylans, mannans, glucomannans, and β-(1→3,1→4)-glucans by Scheller and Ulvoskov (2010). The primary function of hemicelluloses is providing strength to the cell wall by interacting with cellulose microfibrils to provide a cross-linked matrix.  1.1.2 PECTINS Pectins are a group of structurally and functionally complex anionic polysaccharides with galacturonic acid-rich backbones. This group of carbohydrates typically comprises ~30-40% of primary cell wall of dicots and non-gramineae monocots (Ridley et al., 2001; Caffall and 2  Mohnen, 2009). Pectins greatly influence wall porosity, provide the environment for control of charge density and pH, and are needed for cell-cell adhesion (Ridley et al., 2001; Naran et al., 2008). The most abundant monosaccharide in pectins is galacturonic acid, the hexose which makes this group acidic and hydrophilic. In addition, some neutral monosaccharides are found such as rhamnose (in backbone of rhamnogalacturonan I) galactose and arabinose (in side chains). The pectin macromolecule is comprised of three main domains: homogalacturonan (HG), rhamnogalacturonan I (RG I), and rhamnogalacturonan II (RG II). Other pectin polysaccharides found in walls of some species are xylogalacturonan (abundant in reproductive tissues) and apiogalacturonic acid (Zandleven et al., 2007; Wong, 2008). Figure 1-1 represents the organization of different cell wall polysaccharides proteins in primary cell wall.  Figure 1-1 Structure of the primary cell wall (This figure is reprinted from Nature Reviews Genetics 2008, Volume 9, 433-443, by permission).  3  1.1.2.1 HOMOGALACTURONAN HG, the most abundant (up to 60% of primary cell wall pectin, Ridley et al., 2001) and the simplest among of the pectic molecules is a linear polymer with the backbone of α-(1→4)linked D-galacturonic acid. The degree of polymerization may be as high as 150 residues in vitro (Doong and Mohnen, 1998). It was proposed that HG acts in cell adhesion. This was confirmed by analysing mutants with lower HG content (Bouton et al., 2002; Mouille et al., 2007). In addition, a decrease in the amount of HG has been correlated with an increased flexibility of pectins (Ralet et al., 2008). In HG, the charged carboxyl group can be methyl-esterified up to 70-80% (Ridley et al., 2001; Wong, 2008) at the C-6 carboxyl or partially O-acetylated at the O-2 or O-3 (Ishii, 1997; Ridley et al., 2001). The unesterified carboxyl group of galacturonic acid residues in parallel chains of HG can form ionic bonds with Ca+2 and generate a tight complex network. Therefore, the porosity and rigidity of the cell wall matrix depends on the degree of methyl esterification of the HG molecule (Wolf et al., 2009).  1.1.2.2 RHAMNOGALACTURONAN (RG) I &II Another type of pectin, that is structurally more variable than HG, is rhamnogalacturonan I (RG I). RG I comprises about 20%-35% of pectin (Mohnen, 2008) in the primary cell wall. RG I has a backbone of disaccharide repeat of α-(1→2)-L-rhamnose, and β-(1→4)-D galacturonic acid. Rhamnose residues can be substituted with a variety of linear or branched side chains (20%-80%) such as arabinans and arabinogalactans with a degree of polymerization up to 47 (Mohnen, 2008; Harholt et al., 2010).  4  RG II, the most highly branched and complex pectic polysaccharide which comprises almost 10% of pectin in the primary cell wall (O’Neil et al., 2004), has a conserved structure across all analyzed plant species suggesting that it has an important role in all plant cells. The backbone of RG II is composed of galacturonic acid and has four standard side chains with 12 different monosaccharides and 20 different linkages. RG II molecules can be found as homodimers formed through borate diesters in which the borate forms covalent bonds with four oxygen atoms of two D-apiosyl residues (Ishii et al., 1999). Mutant analysis suggests that dimerization of RG II is essential for plant growth and development since mutants with changes in RG II structure exhibit defects in growth (O’ Neil et al., 2001; Ryden et al., 2003). The traditional model for the arrangement of various pectin polysaccharides and how they are linked together in the cell wall suggests that HG and RG I compose the backbone, and other pectin polysaccharides branch from RG I. A more recent model suggests that the backbone is made up of RG I and that all other pectin polymers are side chains (Taiz and Zeiger, 2006).  1.2 THE ARABIDOPSIS SEED COAT EPIDERMIS Although biosynthesis and modification of pectin has been studied for many years, there is still much to learn about these processes as well as the role of pectins and their interactions with other components of the plant cell wall. In recent years, forward and reverse genetic analyses, in parallel with plant genomics strategies have led to the identification and characterization of genes encoding proteins that play significant roles in cell wall biosynthesis and its modification during growth and development.  5  One problem with a genetic approach, however, is that cell wall modification can be lethal and even when viable, phenotypes can be extremely complex and difficult to interpret. A solution to this problem is to focus on a single cell type that is not required for viability. One such plant cell type that synthesizes copious amounts of pectin are the seed coat epidermal cells of species within a number of families including Brassicaceae, Solanaceae, Linaceae, and Plantaginaceae. These seed coat epidermal cells synthesize and secrete copious amount of mucilage into the apoplast. Upon seed hydration, such cells release mucilage to form a capsule-like structure that surrounds the seed. Arabidopsis thaliana (Arabidopsis), a member of the Brassicaceae, is an example of a species that contains seed mucilage. Seeds of an Arabidopsis mutant lacking normal seed coat epidermal cells can germinate normally, indicating that seed mucilage is dispensable under laboratory conditions. Therefore, the seed coat epidermis presents a useful model for studying the structure and function of cell wall components, especially pectin.  1.2.1 STRUCTURE, POLYSACCHARIDE COMPONENTS AND FUNCTION OF ARABIDOPSIS SEED COAT MUCILAGE Staining of seed coat mucilage with ruthenium red (ammoniated ruthenium oxychloride) suggests that Arabidopsis seed mucilage has a component of acidic pectic polysaccharide (Western et al., 2000). This hypothesis was confirmed by monosaccharide, and linkage analysis of extracted mucilage and with pectin specific antibodies (Willats et al., 2001; Macquet et al., 2007; Young et al., 2008; Pattathil et al., 2010; Sullivan et al., 2011). The composition of pectin found in mucilage is different from the one in primary cell wall and middle lamella mentioned above since the main component of mucilage is unbranched RGI and relatively highly methyl6  esterified HG (Willats et al., 2001). The presence of cellulose in mucilage was suggested by using calcofluor white, a fluorescent stain for detecting β-1,4-glycans (Windsor et al., 2000; Willats et al., 2001). These results were supported by using other cellulose binding stains such as pontamine fast scarlet 4B, and with fluorescently labeled prokaryotic cellulose binding domains (Blake et al., 2006; Young et al., 2008; Harpaz-Saad et al., 2011; Mendu et al., 2011). Furthermore, xyloglucan was detected using a polyclonal antibody (Young et al., 2008)The Ruthenium red staining also shows that the mucilage has two distinct layers: an inner layer that stains brightly, has a characteristic ray-like structure and adheres strongly to the seed and a poorly staining non-adherent outer layer (Western et al., 2000; Willats et al., 2001). It has been reported that the sugar content of two layers of mucilage is different. Using an immersion immunofluorescence labelling technique and linkage analysis it has been demonstrated that the adherent layer is mainly composed of unbranded RG I, both low and highly methylesterified HG and low amount of cellulose in the inner layer (12-19% of inner layer is cellulose) which is required for binding of the mucilage to the seed. Unbranched RG I comprises >80-90% of the outer mucilage layer. The presence of HG domains with various degree of methylation (by using dot blots with JIM 5 and JIM 7; monoclonal antibodies that recognize portions of homogalacturonan with low or no methyl esters and more heavily methyl esterified, respectively) and small amount of branched RG I has also been indicated by different research groups (Willats et al., 2001; Dean et al., 2007; Macquet et al., 2007; Naran et al., 2008; Arsovski et al., 2009). The functions of mucilage are still a matter of debate. It has been proposed that mucilage may help in seed germination by providing a hydrated environment for seeds specifically under harsh environmental conditions (e.g. drought and salt stress). Furthermore, mucilage could aid in  7  seed dispersal either by sticking to animals, or by providing protection from digestion in the gut (Western, 2012).  1.2.2 DIFFERENTIATION OF THE ARABIDOPSIS SEED COAT EPIDERMAL CELLS After fertilization, the seed coat of angiosperms differentiates from cells of the ovule integuments. In Arabidopsis, the ovule integuments have five layers, three layers in the inner integument and two layers in the outer integument (reviewed in Haughn and Chaudhury, 2005). Fertilization is the starting point of seed and seed coat development. Since determining the exact time of fertilization is difficult, developmental time is commonly measured as Days Post Anthesis (DPA; the time of releasing pollen from the anthers). Up to 4 DPA the epidermal cells of the outer integument undergo cell division and expansion (Figure 1-2). Between 5 and 8 DPA, pectin-rich mucilage is synthesized in the Golgi apparatus and secreted to the apoplast at the junction of the radial and outer primary cell walls, forming a donut-shaped pocket. During mucilage secretion, the vacuole becomes smaller and the cytoplasm forms a volcanoshaped cytoplasmic column. When production of mucilage is completed, a secondary cell wall is deposited (9-15 DPA) until the cytoplasmic column is completely replaced. This volcanoshaped secondary cell wall, termed a columella, is mainly composed of cellulose (Western et al., 2000; Windsor et al., 2000). The mature seed coat epidermal cell of Arabidopsis, therefore, has a primary wall, columella and a donut-shaped mucilage pocket between the two walls (Figure 1-2).  8  Figure 1-2 Development of seed coat epidermal cells in Arabidopsis during mucilage biosynthesis. From Young, et al., 2008. (a) amyloplast, (n) nucleus, (m) mucilage, (2cw) secondary cell wall, (v) vacuole.  1.2.2.1  THE MUM 4 IS INVOLVED IN MUCILAGE BIOSYNTHESIS  Considering the fact that the presence of mucilage is dispensable under laboratory conditions, isolations and characterizations of mutants with defects in mucilage production can be useful for increasing our understanding of pectic polysaccharide synthesis and modification. This strategy led to the identification of several genes including the MUCILAGE-MODIFIED4 (MUM4), required for mucilage biosynthesis. The MUM4 gene (At1g53500), encodes a UDP-Lrhamnose synthase. Although MUM4 is expressed in tissues throughout the plant, RNA blot, RT-PCR, microarray analysis and real-time PCR results have shown that during mucilage production, MUM4 expression in the seed coat gradually increases from 4 DPA (before the mucilage synthesis) to 7 DPA. At 10 DPA (when mucilage biosynthesis has been completed) MUM4 expression level is again low (Western et al., 2004; Dean et al., 2011; Jin and Haughn, unpublished data). Three transcription factors, APETALA2 (AP2), TRANSPARENT TESTA GLABRA1 (TTG1), and GLABRA2 (GL2) are required for this MUM4 up-regulation at 7 DPA (Western et al., 2004), however, the key regulatory element involved in this process has not been identified.  9  1.3 REGULATION OF GENE EXPRESSION Classically, the regulation of gene expression includes any event that controls the amount of active gene product at any time during its synthesis: from transcriptional initiation to post-translational modification. During transcription in eukaryotes, cis-acting elements in the DNA are targets for RNA polymerase and transcription factors to initiate and modulate gene expression. One of these cis-acting elements is the promoter, a binding site for RNA polymerase and associated general transcription factors. The promoter is typically located close to and upstream of the gene’s coding region and determines the transcription start site (TSS). Surrounding sequences either upstream or downstream are recognized and bound by regulatory transcription factors that determine the time, location and level of gene expression. Eukaryotic promoter and transcriptional regulatory regions have three parts: 1- The core promoter: the minimal portion of transcription regulatory region required for appropriate positioning of RNA polymerase and other trans-regulatory elements. If the TSS is defined as +1, the core promoter region typically extends between 80 to 100 base pairs (bp) upstream and/or downstream of the TSS. The basal preinitiation transcription complex binds to the TATA box (TATAWAAR), the main element of the core promoter-to guide RNA polymerase. 2- The proximal promoter: this region is located a few hundred base pairs upstream of the core promoter, 250-1000 bp from TSS. In addition to some general regulatory region, DNA sequences in this region often encompass binding sites (DNA motifs) for tissue-specific transcription factors that accurately position RNA polymerase II and regulate the rate of polymerase initiation leading to gene expression in a tissue specific manner (Zhang et al., 2006; Heintzman and Ren, 2007). 10  3- The distal promoter: this part is located several kilobase pairs away from the TSS and may include additional elements required for controlling gene expression. Regulatory regions which exert their effects on transcription in a positional and/or orientation independent manner such as enhancers, silencers and insulators are not considered to be part of the distal promoter. Another important regulatory region is the 5’UnTranslated Region (5’UTR) regulating gene expression translationally and post-translationally. The average length of a 5’UTR in eukaryotic mRNAs is ~150 bp, however some mRNAs have atypical 5’UTR’s that are much longer, up to several thousand nucleotides. Aberrantly long 5’UTRs might possess specific regulatory motifs. Such regulatory elements can act as a binding site for proteins that regulate RNA stability or it might contain some sequences that are required for translation initiation or inhibition. In both plants and animals, the 5’UTR of a considerable number of genes possesses an intron: ~35% of human and 19.9% of Arabidopsis genes (Chung et al., 2006; Cenic et al., 2010). Several studies demonstrated that the introns residing in the 5’UTR may enhance the mRNA accumulation between 100-1000 fold in a size dependent manner (Chung et al., 2006) through a mechanism termed Intron-Mediated Enhancement (Mascarenhas et al., 1990). The distributions of 5’UTR introns are not random and they are frequently located close to the translation start codon.  1.4 IMPORTANCE OF TISSUE SPECIFIC PROMOTERS A tissue specific promoter is defined as a promoter that initiates and regulates gene expression in a specific cell type at certain developmental stages. Such promoters can be used to  11  restrict the expression of a transgene to a desired tissue, thus avoiding pleiotropic effects of ectopic expression in transgenic plants. Tissue-specific promoters can be classified into two groups: native and composite promoters. The native promoter is the core promoter of a gene including its 5’UTR. However, composite promoters consist of the core promoter of a gene fused to some regulatory elements of a different gene. Tissue-specific promoters may be utilized for various purposes including expressing a foreign gene in a specific tissue to explore the function of the transgene and modifying the organisms for a specific biotechnological application. As mentioned before, studying the plant cell wall is challenging due to its complexity and its necessity for normal growth and development. Since the Arabidopsis seed coat epidermal cell synthesizes both pectinaceous mucilage and a thick cellulosic secondary cell wall (columella), it is beginning to be exploited as a model system for molecular genetic analysis of the biosynthesis, secretion, modification, and metabolism of plant cell wall carbohydrates (reviewed in Arsovski et al. 2010; Haughn and Western, 2012). There is potential for probing the consequences of manipulating cell wall structure through targeting the expression of specific carbohydrate-active enzymes to the epidermal cells. To accomplish this goal, promoters driving expression at different times during seed coat epidermal differentiation are required. Seed coat specific promoters are preferred for this purpose to avoid potential deleterious effects of changing cell walls in other parts of the plant. In addition to their use as research tools, seed coat specific promoters could also be employed for crop improvement through either manipu-  12  lation of seed coat properties or the deposition of commercially important recombinant proteins.  1.4.1 SEED COAT SPECIFIC PROMOTERS IN ARABIDOPSIS THALIANA AND BRASSICA NAPUS Relatively few seed coat specific genes have been identified in plants. The SEED COAT SUBTILISIN1 (SCS1) gene, expressed specifically in the thick-walled parenchyma cells of the outer integument in soybean seed coat (Batchelor et al. 2000), and CYSTEINE PROTEASE1 (CYSP1; Wan et al. 2002) gene, expressed in the inner integument cells of the developing seed coat of Brassica napus (B. napus), are examples. Several Arabidopsis genes expressed specifically in the seed coat have also been described. The δVACUOLAR PROCESSING ENZYME (δVPE) transcript is specific to the outer two cell layers of the inner integument (Nakaune et al. 2005). It has been shown that TRANSPARENT TESTA2 (TT2) is expressed in the outer two cell layers as well as the innermost pigmented layer of the seed coat (Nesi et al. 2001; Gonzalez et al. 2009). Furthermore, promoter regulatory regions of the Arabidopsis genes BAN and LACCASE15 (LAC15), have been shown to drive expression of a reporter gene in the pigmented layer in Arabidopsis (Devic et al. 1999; Debeaujon et al. 2003; Liang et al. 2006). No Arabidopsis promoters have been reported to be specific to the outer layers of the Arabidopsis seed coat. However, the GAMMA INTERFERON-RESPONSIVE LYSOSOMAL THIOL REDUCTASE (AtGILT) promoter described as specific to the Arabidopsis seed coat (Tiwari et al. 2006) was shown to drive expression of a reporter gene in the outer seed coat layers of B. napus (Wu et al. 2011). In addition, unlike its expression in Arabidopsis, the promoter of the Arabidopsis gene LAC15  13  also directed expression specifically in the outer integument layers of B. napus seed coats (EIMezawy et al. 2009). Currently, no Arabidopsis promoters have been shown to be specific to the outer layers of the Arabidopsis seed coat.  1.5 RESEARCH OUTLINE AND OBJECTIVES Pectins are heterogeneous polysaccharides of the plant cell walls, which are mainly found in primary cell walls and middle lamellae. They play essential roles in cell adhesion, defence responses, fruit ripening and organ abscission. In addition to their nutritional importance, it has also been shown that pectin inhibits metastasis and induces apoptosis in prostate cancer (Pienta et al., 1995; Jackson et al., 2007) indicating that it has beneficial effects on human health. Pectin polysaccharides have been studied for many years, however, their complexity and their critical role in cell biology makes it challenging to determine and investigate their biosynthesis, modification, and organization in the plant cell wall. The overall goal of my M.Sc. research project is to identify and develop an experimental tool to simplify the studying of plant cell wall polysaccharides, especially pectin. I utilized Arabidopsis seed coat epidermal cells as a model system. I sought to identify a promoter that drives gene expression specifically in the Arabidopsis seed coat epidermis to investigate the effect of manipulating different polysaccharides in the mucilage without detrimental effects to the rest of the plant. My research project was driven by the following three major goals: 1. To Identify and analyze a promoter specific to the Arabidopsis seed coat. 2. To verify the ability of the seed coat specific promoter to express carbohydrate active enzymes specifically in the seed coat. 14  3. To identify the putative cis-regulatory element responsible for up-regulation of MUM4 gene in the seed coat. To address the first objective, we analyzed seed coat microarray data (Dean et al., 2011) and published expression browser (Winter et al., 2007) for genes expressed in the wild type seed coat but not the seed coat of the apetala2 mutant where the epidermal cells fail to differentiate. This search led to the identification of 14 genes that are expressed and upregulated during mucilage synthesis. Fusing the regulatory region of these candidate genes to beta-glucuronidase reporter gene (GUS) revealed that the promoter of DIRIGENT PROTEIN1 (DP1) is specifically expressed in the Arabidopsis seed coat at 7 DPA. This work is described in chapter 3. My second objective was to investigate the potential ability of the DP1 promoter to express enzyme-encoding genes and determine putative roles of HG in mucilage. I cloned a gene encoding a polygalacturonase (ARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE2; ADPG2) and expressed it under the control of DP1 promoter and targeted it to the mucilage pocket by fusing signal sequences . Although RT-PCR results showed that the DP1 promoter drove expression of this gene in the seed coat, I found no significant difference between mucilage of transgenic lines and wild type. This work is described in chapter 4. Previous studies by Western et al., (2004) showed that MUM4 gene encodes UDP-Lrhamnose synthase which is required for providing the rhamnose needed for RG I biosynthesis during differentiation of the seed coat epidermis. Using quantitative PCR (q-PCR, it has been shown that this gene is up-regulated during mucilage biosynthesis in the seed coat. My third objective was to identify the sequences responsible for this up-regulation, which may provide  15  a useful tool for engineering the enhanced expression of other genes in the seed coat epidermis. To accomplish this goal, I carried out a deletion analysis of the MUM4 promoter regulatory region. I fused different fragments of MUM4 promoter were fuse to the GUS reporter gene. Histochemical GUS assays demonstrated that the full-length MUM4 promoter (from the end of 3’UTR of upstream gene to the ATG) expressed the reporter gene in all tissues examined. Surprisingly, analysis of transgenic lines carrying a fragment of MUM4 promoter extending from a nucleotide position -406 to -100 relative to the transcription initiation site can mediate expression of the GUS reporter gene specifically in the seed coat during mucilage biosynthesis. This work is described in chapter 5.  16  CHAPTER 2: MATERIALS AND METHODS 2.1 PLANT MATERIAL AND GROWTH CONDITIONS Arabidopsis thaliana Columbia-2 (Col-2) and Landsberg erecta (Ler) ecotypes were used as wild type. Mutant lines used in this thesis include apetala (ap)2-7 (Col background), transparent testa glabra (ttg)1-1 (Ler background) and glabra (gl)2-7 (Col background).  2.1.1 ARABIDOPSIS THALIANA GROWTH CONDITIONS Seeds were planted without sterilization or surface-sterilized by washing with 70% (v/v) ethanol for 3 min followed by rinsing with ddH2O (twice) on AT-agar (3.5 g agar/500 mL of AT medium) plates (Haughn and Somerville, 1986). To break dormancy, the seeds were incubated at 4◦C for 48 h in darkness. The plates were then transferred to a growth chamber under continuous light (90-120 μEm-2s-1 of photosynthetically active radiation) at 20◦C and were grown for 10-14 days. The seedlings were transplanted to soil (Sunshine Mix 4, SunGro, Kelowna, BC) fertilized by AT medium and were grown in the same growth conditions until maturity.  2.1.1.1 ARABIDOPSIS FLOWER DEVELOPMENT STAGING Since determining the exact time of fertilization is difficult, the time at which pollen is released from the anthers is used as the approximate time of fertilization and is denoted as 0 Days Post Anthesis (DPA; Western et al., 2000). The pedicels of flowers that were just opening (petals visible; 0 DPA), were marked with a water-soluble non-toxic paint and harvested at the desired DPA. To confirm that the harvested seeds are at the correct developmental stage, the embryo was dissected from the seed coat, the size and morphology of the embryo was exam-  17  ined using a Leica M80 stereomicroscope, and compared with the previously published images (Haughn and Chaudhury, 2005).  2.1.1.2 CROSSING ARABIDOPSIS PLANTS Arabidopsis flowers naturally self-pollinate. For cross-pollination the sepals, petals and stamens were removed from the female parent before anthesis. Open flowers from the male parent were used to pollinate the stigma of the female parent.  2.1.2 BRASSICA NAPUS (B. NAPUS) GROWTH AND FLOWER DEVELOPMENT STAGING B. napus seeds were planted directly on soil enriched by AT medium (Haughn and Somerville, 1986) and were grown in a growth chamber under 24 h light (100 to 120 µE m-2 s1) at 20°C. To improve seed set, hand-pollination was performed. The day of pollination was considered as 0 DPA.  2.1.3 AGROBACTERIUM-MEDIATED PLANT TRANSFORMATION 2.1.3.1 ARABIDOPSIS TRANSFORMATION Arabidopsis (Col-2) seeds were grown on soil fertilized by AT medium at a density of 100150 plants per pot. The pots were covered with plastic wrap incubated at 4 ◦C in darkness for 48 h and transferred to a growth chamber under continuous light (90-120 μEm-2s-1 of photosynthetically active radiation) at 20◦C. The plastic cover was removed after a week. To increase the number of immature flowers, primary bolts were removed. When the secondary inflorescences were 10-12 cm tall, the plants were used for transformation.  18  Agrobacterium tumefaciens (A. tumefaciens) cells were grown to an appropriate concentration (OD600: 1.6-1.8), followed by centrifugation at 5009 X g for 10 min at RT. The pellet was resuspended in 100 mL of 5% sucrose (w/v) and the centrifugation repeated. The cell pellet was resuspended in 100 mL of 5% sucrose (w/v) supplemented by 25 μL Silwet L-77 (LEHLE SEEDS, Round Rock, TX), and applied to the plants using an aerosol spray bottle. The plants were then covered with a black plastic bag, kept at RT for 12-15 h and then grown under the normal growth conditions until maturity. To select transgenic plants, after surface sterilizing, the seeds were germinated on ATagar plates supplemented with the appropriate amount of antibiotic. Alternatively, if Basta resistance was to be selected, seeds were planted on soil stratified at 4˚C for 48 h and transferred to a growth chamber. After 5 days, the seedlings were sprayed with 200 μM basta (glufosinateamonium, C5H15N2O4P; FW: 198.16) twice a week for 2 weeks. The resistant plants were then transferred to a new pot and grown to maturity.  2.1.3.2 B. NAPUS TRANSFORMATION The National Research Council of Canada Plant Biotechnology Institute (Saskatoon, SK) carried out transformation of B. napus as follows. The double haploid (a genotype derived from haploid microspore cells that are induced in culture to undergo chromosomal duplication forming new diploid plants) B. napus line DH12075 was transformed using Agrobacterium as  described in Moloney et al. (1989) with the exception that explants were inoculated in bulk and co-cultivated without medium. Batches of 50 to 60 cotyledons from 5-day-old seedlings were pooled in a 7 cm Petri dish. The cotyledons were immersed in 4.5 mL inoculation medium (MS, 3% sucrose, 0.5 mg/L benzyl adenine, pH 5.8). Agrobacterium was grown approx. 20 h in 19  5 mL LB medium supplemented with appropriate antibiotics (28°C, 250 rpm). The cells were pelleted (2,000 g, 10 min), re-suspended in 5 mL inoculation medium, and then added to the cotyledons. After mixing to ensure all cotyledons were inoculated, as much fluid as possible was removed by aspiration. Plates were sealed and wrapped in foil. Co-cultivation took place first at 25°C for 2 d, then at 4°C for 2 d. Shoot induction, selection, elongation and rooting were essentially as in Moloney et al. (1989). All solid media were supplemented with 300 mg/L Timentin (GlaxoSmithKline) to kill the Agrobacterium and 25 μg/mL kanamycin to select for transformed shoots.  2.2 NUCLEIC ACID ANALYSIS 2.2.1 ARABIDOPSIS GENOMIC DNA EXTRACTION FOR CLONING 0.1-0.15 g of Arabidopsis young leaf was ground using a mortar and pestle with liquid nitrogen. Plant DNAzol® Reagent (Invitrogen) was used for DNA isolation. All the steps were followed as described in manufacturer’s instructions, except the last step. Unlike the protocol, the DNA pellet was dissolved in 50 μL autoclaved ddH2O. The concentration and quality of DNA was determined by running 1-2 µL of DNA on an agarose gel and also using a NanoDrop 8000 Spectrophotometer (Thermo Scientific).  2.2.2 DNA EXTRACTION FOR GENOTYPING OF TRANSGENIC LINES DNA for genotyping transgenic lines was isolated using FTA® paper (Whatman Inc., Clifton, NJ). A small young leaf was placed on FTA paper, covered with parafilm, and pressed with a small glass tube. The leaf print was dried for 2-4 h at RT. A small disc of the leaf print was punched and transferred into a PCR tube. The disc was washed twice with FTA paper re20  agent (10 mM Tris, pH 7.5, 2 mM ethylenediaminetetraacetic acid (EDTA), Tween 20 0.1%; tween 20 was added after autoclaving the buffer) for 10 min each. The reagent was removed, the disc was rinsed twice with TE (10 mM Tris, pH 8.0 and 0.1mM EDTA) for 20 min each and then used for PCR. PCR reactions were performed using gene specific primers and GenScript DNA polymerase (GenScript USA Inc.). The reaction conditions were 94˚C for 3 min, 32-34 cycles of 94˚C for 45 s, annealing temperature (3°C above the Tm of the primer with the lower Tm) for 30 s, and 68˚C for 2-3 min (depending on the size of the amplifying fragment, 1 min/1 kilobase pair [kb]).  2.2.3 RNA EXTRACTION OF ARABIDOPSIS SEED COAT For extracting seed coat RNA for RT-PCR and qPCR, seed coats were separated from the developing embryos at 7 and 10 DPA using a Leica M80 stereomicroscope. First, the seeds of 15 siliques were removed using tweezers and the embryo was dissected on a wet filter paper by applying pressure on each seed until the embryo was separated from the seed coat. Because the embryo is very small at 4 DPA, whole seeds were used for RNA extraction at this stage. Following dissection, tissues were placed into a 1.5 RNase free microcentrifuge tube and kept on dry ice until enough material was gathered. Tissues were submerged in liquid nitrogen and ground using a Kontes pellet pestle, followed by total RNA extraction using the RNAqueous®Micro Kit (Ambion®) according to the manufacturer’s protocol.  21  2.2.4 DNA SEQUENCING AND ALIGNMENT DNA sequencing was performed by Nucleic Acid and Protein Service (NAPS) at University of British Columbia. The reaction was prepared as recommended is the guidelines described at http://naps.msl.ubc.ca. For identity verification, ClustalW2, a sequence alignment program at European Bioinformatics Institute (EBI) at http://www.ebi.ac.uk/Tools/msa/clustalw2/ and the Basic Local Alignment Search Tool (BLAST) at The Arabidopsis Information Resource (TAIR) (http://www.Arabidopsis.org/BLAST) were used.  2.3 AGAROSE GEL ELECTROPHORESIS 2.3.1 PREPARATION OF AGAROSE GEL AND IMAGING In all experiments, 1% (w/v) agarose-TAE (Tris-Acetate-EDTA; 0.04 M Tris-acetate, 0.001 M EDTA) gel was used for separating nucleic acids (DNA and RNA). GeneRuler 1 kb Plus DNA Ladder (Thermo Scientific) or Fast DNA Ladder (New England Biolab) were run in parallel with the samples. To visualize nucleic acids, gel red stain (2.5 µL for 50 mL of agarose gel) was used. The images were taken using a ChemiDoc™ MP System (Bio-Rad).  2.3.2 GEL EXTRACTION DNA was excised from the agarose gel, placed in a 1.5 mL microcentrifuge tube and weight. Three volumes of QG (gel solubilizing) buffer (containing 5.5 M guanidine thiocyanate (GuSCN), 20 mM Tris-HCl, pH 6.6) was added to 1 volume of gel (100 mg ~ 100 μL) and incubated at 50°C in a water bath until the gel was melted completely. The sample was passed through the silica membrane spin column (EconoSpinTM, Epoch life science) by centrifuging at 22  13,226 X g for 1 min) then washed with 0.75 mL PE (wash) buffer (2 mM Tris-HCl, pH 7.5 with 70% ethanol), followed by centrifugation at 13,226 X g for 1 min in a table-top Eppendorf 5424 microcentrifuge. Residual PE buffer was removed by centrifugation for another 2 min. The column was dried under the flow hood for 10 min. To elute DNA, 30-50 µL elution buffer (10 mM Tris-HCl, pH 8.5) was added to the center of the column, kept for 1-2 min on the bench, then centrifuged at 13,226 X g for 1 min and stored at -20˚C.  2.4 RECOMBINANT DNA EXPERIMENTS In this thesis, common steps in all recombinant DNA experiments include: 1- Amplification: Amplifications of the target fragments were carried out using genomic DNA as a template and Phusion (high-fidelity DNA polymerase, New England Biolab) DNA polymerase with gene specific primers. Preparations of solutions and reaction conditions were according to the manufacture’s instructions. 2- Purification: PCR products were cleaned using agarose gel electrophoresis. The band was excised and purified as described previously (2.3.2). The quality and concentration of the purified PCR product was verified by running on an agarose gel and using a NanoDrop8000 Spectrophotomer (Thermo Scientific). 3- Endonuclease Digestion: 1-4 μg DNA was added to a total volume of 50 μL of digestion reaction. The incubation time and temperature was 37˚C for 2 h. The amount of enzymes was as recommended by the manufacturer. 4- Purification: To remove restriction enzymes and buffer, the digestion product was run on an agarose gel, washed and purified as described.  23  5- The concentration of purified insert and vector were verified using agarose gel electrophoresis (1-3 μL of DNA) and using NanoDrop8000 Spectrophotometer (Thermo Scientific). 6- Ligation: For designing ligation reaction, the formula below was applied:  = [insert]: Amount of insert based on gel and/or NanoDrop results (ng) [vector]: Amount of vector based on gel and/or NanoDrop results(ng) Vi: Required volume of insert for ligation reaction (μL) Vv: Required volume of vector for ligation reaction (μL) T4 DNA ligase isolated from E. coli lambda lysogen NM989 (Invitrogen) was used for all ligation reactions. Ligation reaction (total volume of 20 µL) was performed for 3 h at RT or for 12-14 h at 16˚C. 10-20 μL of ligation reaction was used for transformation.  2.4.1 PREPARATION AND HEAT-SHOCK TRANSFORMATION OF ESCHERICHIA COLI COMPETENT CELLS One colony of Escherichia coli (E.coli) DH5α strain grown on LB (Luria Broth)-agar (7 g agar/ 500 mL LB medium) plate was inoculated into 2 mL LB medium and shaken at 37◦C for 14-15 h. One mL of overnight bacterial culture was added to 100 mL of LB medium and shaken vigorously for 2-3 h (to get OD600: 0.25-0.3). The culture was chilled on ice for 15 min followed by centrifugation at 2,504 X g at 4◦C for 10 min. The pellet was resuspended in 40 mL of autoclaved, ice-cold 0.1 M CaCl2, stored on ice for 30 min, and pelleted as described above. The pellet was resuspended in 6 mL of ice-cold 0.1 M CaCl2 containing 15% (v/v) glycerol. 450 μLaliquots of cell suspension were instantly frozen on dry ice, then transferred and stored at  24  -80˚C. For transformation, competent cells were thawed on ice for 5-10 min. 10-20 µL of ligation product was added and kept on ice for 30 min. The cells were transferred and incubated at 42˚C water bath for 40 s, then placed on ice and kept for another 5 min. 0.9 mL of LB medium was added, shaken at 37˚C for 1-2 h and the cells pelleted at 6339 X g for a minute. The cell pellet was resuspended in 100 μL LB medium and plated on LB containing the appropriate antibiotics. The plates were incubated at 37˚C for 16-22 h.  2.4.2 PLASMID MINIPREP Plasmid miniprep was performed using QIAprep® Miniprep (Qiagen) according to the manufacturer’s protocol using buffers: Buffer P1 (Suspension buffer): 50 mM Tris-HCl, 10 mM EDTA, pH 8.0 and 50 µg/mL RNase A (Invitrogen). Buffer P2  (Lysis buffer):  0.2 M  NaOH and  1%  Sodium Dodecyl  Sulfate  (SDS,CH3(CH2)11OSO3Na). Buffer PE (Wash buffer): 2 mM Tris-HCl, pH 7.5 with 70% ethanol.  2.4.3 PREPARATION AND HEAT-SHOCK TRANSFORMATION OF AGROBACTERIUM TUMEFACIENS COMPETENT CELLS All the recombinant plasmids (except the constructs made in pAD; DeBono, 2011) were transformed into A. tumefaciens cells GV3101 containing pMP90 Ti-plasmid. Those constructs made in pAD was transformed into A. tumefaciens GV3101 strain containing pMP90 and pSoup Ti-plasmid.  25  Table 2-1 indicates the selectable makers used for A. tumefaciens.  Strain  Table 2-1 Antibiotics required for selection of A. tumefaciens. Chromosomal selection Selection  GV3101 with pMP90 GV3101 with pMP90 and pSoup  Rifampicin (25 µL/mL) Rifampicin (25 µL/mL)  Gentamycin (25 µL/mL) Gentamycin (25 µL/mL) and Tetracycline (10 µL/mL)  To make heat shock Agrobacterium competent cells, a colony was inoculated into 5 mL of LB medium (containing appropriate antibiotics) and shaken overnight at 28˚C. Approximately 3-4 mL of overnight culture were added to 100 mL of LB medium (with antibiotics) and shaken for 5 h at 28˚C. The cell culture was centrifuged at 2504 x g 4˚C for 10 min. The pellet was resuspended in 50 mL of autoclaved, ice-cold CaCl2 (50 mM) by pipetting up and down on ice. The cells were spun down as described above and the pellet resuspended in 1 mL of autoclaved, ice-cold CaCl2 (50 mM) containing 15% (v/v) glycerol. 100 µL aliquots were immediately frozen in liquid nitrogen and stored at -80˚C. To transform competent Agrobacterium cells, a tube of competent cells was chilled on ice and 5-10 µL of recombinant plasmid was added. Then, the cells were incubated in 37˚C water bath for 5 min. 500 µL of LB medium was added and shaken for 3 h at 28˚C. The cells were centrifuged at 6339 x g for 30 s, resuspended in 100 µL of LB and plated on LB with appropriate antibiotics.  2.4.4 CONSTRUCT DESIGN Table 2-2 represents the list of vectors used for cloning and the antibiotics used to select for their presence.  26  Plasmid pAD (modified pGreen0029) pBI101.1  Table 2-2 Name and antibiotics used to select for specific vectors. Selectable Selectable Refrence marker in bacteria marker in plants Kanamycin (50 µg/mL) Basta (200 µM) DeBono, 2011 Kanamycin (50 µg/mL)  Kanamycin (50 µg/mL)  Jefferson et al., 1987  pCambia 1380 &1390  Kanamycin (50 µg/mL)  Hygromycin (50 µg/mL)  http://www.cam bia.org  2.4.4.1 GENERATION OF DP1PRO-C::CITRINE AND MUM40.3PRO::CITRINE YFP CONSTRUCTS DIRIGENT PROTEIN1 promoter (DP1Pro) and MUCILAGE-MODIFIED4-0.3 promoter (MUM40.3Pro) fragments were amplified from genomic DNA by PCR reaction using the primers below (In all the primers, the underlined sequence represents recognition site for restriction enzymes and name of the enzyme is given in parenthesis): DP1Pro-c primers: Forward (37F): 5’-ATTCTCGAGCTTTTCTGGGAAGCTCGTTGT-3’ (XhoI) Reverse (15R): 5’-ATCTGCAGTGTCATTGTTAGAGTGTTAAGT-3’ (PstI) MUM40.3Pro primers: Forward (79F): 5’-ATCTCGAGGACGGTGGCATTAAGCATCTTGCAT-3’ (XhoI) Reverse (80R): 5’-ATCTGCAGGAAATTTTGATAATTAATTAAGTATGTGTATAAAG-3’ (PstI). The PCR products and pAD binary vector were both digested with XhoI and PstI (Invitrogen) at 37◦C for 2 h. The digested insert and vector were purified on an agarose gel and ligated using T4 DNA ligase (Invitrogen) at RT for 3 h. The ligation product was transformed into E.coli strain DH5α and approximately 100 μL of the bacterial culture was plated on LB medium con-  27  taining 50 μg/mL of Kanamycin (Gold Biotechnology®). The plates were incubated at 37 ◦C for 16-22 h. Kanamycin-resistant colonies were picked and grown overnight at 37 ◦C in 5 mL liquid LB supplemented by 50 μg/mL kanamycin. After a miniprep, the plasmid DNAs were digested and separated on an agarose gel to confirm the presence of an insert. The plasmids possessing the insert were sent for sequencing.  2.4.4.2 GENERATION OF MUM40.3PRO::GUS AND MUM40.7PRO::GUS CONSTRUCTS Two fragments of MUM4 promoter were cloned upstream of promoterless GUS gene in pBI101.1 binary vector. For generating MUM40.3Pro::GUS and MUM40.7Pro constructs, genomic DNA was used as the template for amplification. The primers below were used: MUM40.3Pro primers: Forward (26F): 5’-ATAAGCTTGACGGTGGCATTAAGCATCTTGCAT-3’ (HindIII) Reverse (MUM4-pro15 R100): 5’-ATTCTAGAGAAATTTTGATAATTAATTAAGTATGT GTATAAAG-3’ (XbaI) MUM40.7Pro primers: Forward (MUM4-pro17-F796): 5’-ATAAGCTTGACGGTGGCATTAAGCATCT-3’(HindIII) Reverse (MUM4-pro15-R1480): 5’-ATTCTAGACGACACAATTCTGGTTAGAGTCA-3’ (XbaI). After purification by agarose gel electrophoresis, the PCR product and pBI101.1 vector were digested by HindIII and XbaI (Invitrogen), ligated and transformed into E.coli. Plasmids containing the insert were sent for sequencing using a primer specific to the sequence upstream  of  multiple  cloning  sites  in  pBI101.1  vector  (pBI101  seq  primer:  5’-  TTAGGCACCCCAGGCTTTACACTTTA-3’).  28  2.4.4.3 GENERATION OF DP1PRO::ADPG2-MYC AND DP1PRO::SIGNAL SEQUENCE::ADPG2MYC CONSTRUCTS DP1Pro DNA fragments were amplified from genomic DNA using the primers below: Forward (F65): 5’-AATTCTGCAGCTTTTCTGGGAAGCTCGTTG-3’ (PstI) Reverse (R66): 5’-ATGTCGACCATTGTTAGAGTGTTAAGTA-3’ (SalI) The DP1Pro was digested with PstI and SalI restriction endonucleases (Invitrogen) and cloned into pCambia 1390 (DP1-1390 recombinant plasmid). A Myc-tag is a small polypeptide (sequence: N-EQKLISEEDL-C [1202 Da]) derived from the c-MYC gene. Since it is encoded by only 30 nucleotied, I included it as part of the reverse primer when amplifying the ARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE2 (ADPG2) gene (ADPG2-myc). To clone ADPG2-myc downstream of DP1Pro, the genomic copy of ADPG2 (after ATG to the end of the coding region) was amplified using genomic DNA as template with the primers below: Forward (F69): 5’-ATGGATCCGCCCGTTGTACCAACCTTGT-3’ (BamHI) Reverse (R70):5’-ATGAATTCCAGATCTTCTTCAGAAATAAGTTTTTGTTCAGTGGAGTTGCACTGAG GCAGA-3’ (EcoRI) After digestion with BamHI and EcoRI restriction enzymes (Invitrogen) the amplified ADPG2-myc was ligated to DP1-1390 and the correctness of the new plasmids confirmed by sequencing using the following primers targeting sequences in the coding region of ADPG2: 1- Mid-DP1 for seq: 5’-GGTAAAAGAAGACAAATGTCAACAAACCAATTTTGTGC-3’ 2- Mid-ADPG2-1: 5’-ACTCGAAAAGTCTGATAGTGAAGAATCTGA-3’  29  3- Mid-ADPG2-2: 5’-AAATCCGCGGTCCAAGTGAAGA-3’ The recombinant plasmid containing DP1Pro and ADPG2-myc was called DP1-ADPG21390. To introduce the signal sequences of GLYCOSYLPHOSPHATIDYLINOSITOL-ANCHORED LIPID TRANSFER PROTEIN (LTPG; DeBono, 2011) or MUCILAGE MODIFIED2 (MUM2, Dean et al., 2007) between DP1Pro and ADPG2-myc, the fragments were amplified using the primers below: LTPG signal sequence (99 bp of the first exon of LTPG): Forward (F67): 5’-AATTGTCGACATGAAGGGTCTTCATCTCCACCTC-3’ (SalI) Reverse (R68): 5’-AATTGGATCCTTCATCAGCCAGAGCTCCTC (BamHI) MUM2 signal sequence (the entire of the first exon of MUM2): Forward (F74): 5’-ATGTCGACGAGATGGGTCGTCTGGTCTT-3’ (SalI) Reverse (R24): 5’-ATGGATCCAACATTTACCTCGGGTGTGC-3’ (BamHI) Digestion of the inserts and DP1-ADPG2-1390 vector was performed with high fidelity Sal I and BamHI restriction endonucleases (New England Biolab). These signal sequences were ligated to the DP1-ADPG2-1390 upstream of ADPG2. The sequence and orientation of the inserts were confirmed by sequencing the recombinant plasmid DNA with Mid-DP1 for seq primer (see above).  2.5 REVERSE-TRANSCRIPTASE PCR AND QUANTITATIVE PCR ANALYSIS To remove residual DNA, extracted RNA was treated with DNaseI Amplification Grade (Invitrogen) and then DNase was deactivated as recommended by the manufacturer. The re-  30  sulting RNA was used for cDNA synthesis using SuperScript III reverse transcriptase (Invitrogen) following the manufacturer's protocol. cDNA was used for RT-PCR using primers flanking the position of an intron and GenScript DNA polymerase (GeneScript, USA Inc.). PCR conditions were 94˚C for 3 min and then 26-32 cycles of 94˚C for 45 s, 56-63 (annealing temperature was 3°C above the melting temperature (Tm) of the lower Tm primer) for 30 s and 68˚C for 1 min. To confirm the results, RT-PCR was performed three times using the same primers. For qPCR, in a total reaction volume of 20 µL, 11 µL of SYBR Green Supermix reagent (Bio-Rad), 0.5 μL of cDNA, and 0.5 µL each primer (with a concentration of 10 μM) was added. Thermal cycling conditions included 95˚C for 3 min and then 42 cycles of 95˚C for 10 s, 56˚C for 10 s, and 72˚C for 20 s. Data were analyzed using Bio-Rad iQ5 – Standard Edition (version 2.0; Bio-Rad). For all PCR reactions, GAPC was used as an internal control.  2.6 5’-RAPID AMPLIFICATION OF CDNA END (RACE) 2.6.1 ARABIDOPSIS TOTAL RNA EXTRACTION 0.15-0.2 g of Arabidopsis young leaves were ground with liquid nitrogen in a mortar. Total RNA was extracted using Trizol reagent (Invitrogen) according to the manufacturer’s protocol. The purity and concentration of the extracted RNA was verified using NanoDrop8000 (Thermo Scientist) as well as running 1 µL of extracted RNA on an agarose gel. RNA control (Invitrogen) was run in parallel with the sample as a control. The 5’-RACE experiment was performed using the 5’-RACE kit (Invitrogen) and conducted according to manufacturer’s instructions. The Gene-Specific Primers (GSP) used in this experiment were as follows: 31  GSP1: AAACCTCCTGATCTGTCCTGTAACTTTA Nest GSP: AATGAGAATGTTCTTTGGCTTATACGTAGTAT GSP seq (for sequencing): ATATCTCCTTTGACAAACTTGAAATTTGGT  2.7 HISTOCHEMICAL GUS ASSAY For detection of GUS activity, fresh samples from various tissues at different developmental stages were incubated in a solution containing 100 mM Phosphate buffer (sodium dihydrogen phosphate and disodium hydrogen phosphate) pH 7.0, 0.5 mM potassium ferricyanide, 0.5 mM potassium ferrocyanide, 20 mM Na2EDTA, 0.1% (v/v) Triton X-100 supplemented with 1 mg/mL 5-bromo-4-chloro-3-indolyl-b-D-glucuronide (Gold BioTechnology, St. Louis, Missouri, USA). The samples were incubated at 37◦C for 2-18 h (Jefferson et al., 1987). The staining buffer was gently removed and the samples were washed several times with 75% (v/v) ethanol and stored in 75% ethanol. Tissues were viewed and photographed using Olympus stereomicroscope SZX10.  2.8 WESTERN BLOT The harvested siliques (100-150 mg) were ground with liquid nitrogen and suspended in a cold extraction buffer (20 mM Tris-HCl pH 8, 200 mM NaCl, 1 mM EDTA and one complete protease inhibitor cocktail tablet (Roche) for 10 mL buffer). The cell mixtures were then centrifuged at 7826 X g for 10 min and the supernatant collected as soluble protein extract for immunoblotting analysis. Total soluble proteins of each sample were separated by Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis (SDS-PAGE) on a 10% SDS-  polyacylamide gel. After the separation, the protein was transferred to a nitrocellulose  32  membrane (0.2 µm, Bio-Rad) using a Trans-Blot SD semi-dry transfer cell following manufacturer’s instructions (Bio-Rad). To detect the presence of the Myc tag, c-myc monoclonal antibody (9E10; Santa Cruz Biotechnology, Inc.) was used as primary antibody (1:1000), and anti-mouse IgG (whole molecule)-alkaline phosphatase goat antibody (Sigma-Aldrich) was used as secondary antibody. Nitro blue tetrazolium chloride (NBT)/ 5-bromo-4-chloro-3-indolyl phosphate toluidine (BCIT) were used to detect the binding of antibodies.  2.9 SECTIONING 2.9.1 SECTIONING OF DEVELOPING ARABIDOPSIS SEEDS Upon dehydration, GUS stained seeds of DP1Pro-b::GUS transgenic line were embedded in standard Spurr’s resin as described by Kaneda et al., 2011. Using a Leica Vibratome (series 1000), 5-8 μm cross sections of the samples were cut, and viewed and photographed using Olympus stereomicroscope SZX10.  2.9.2 SECTIONING OF DEVELOPING BRASSICA NAPUS SEEDS B. napus developing seeds were assayed for GUS activity as described above and stored in 75% ethanol. Fixed seeds were embedded in 5% low melt agarose and 20-40 μm sections generated using a Leica Vibratome (series 1000). Tissues were viewed and photographed using Olympus stereomicroscope SZX10.  33  2.10 MICROSCOPY TECHNIQUES 2.10.1 RUTHENIUM RED STAINING Mature and dry seeds were placed in 1.5 mL microcentrifuge tubes containing 1 mL ddH2O or 0.05 M EDTA as indicated, and were shaken for an hour. The first solution was replaced by an aqueous solution of 0.01% (w/v) freshly prepared ruthenium red (Sigma, Aldrich) and shaken for 45 min. The images were taken by Olympus Stereomicroscope SZX10.  2.10.2 FLUORESCENCE MICROSCOPY Fluorescence microscopy was done using a Leica stereomicroscope (M216FA) equipped with a Leica DC500 digital camera. The images were obtained using a YFP filter (510-520 nm) with exposure time of 5.1 s, using 50% lamp intensity.  2.10.3 CONFOCAL MICROSCOPY Cut seeds were incubated in 2% propidium iodide (Sigma-Aldrich) and shaken for 10-15 min at RT followed by rinsing twice with distilled water. Confocal images were acquired using a Perkin Elmer Ultraview VoX Spinning Disk Confocal microscope (PerkinElmer; Waltham Massachusetts). YFP was excited with the 514 laser, and emissions were detected with a 540/30 nm filter. Propidium iodide was excited using a 488 nm laser, with an emission filter of 527/55 nm. Images were processed with Volocity 4.3.2 (Improvision).  34  2.10.4 SCANNING ELECTRON MICROSCOPY Samples were dry-mounted on stubs and coated with gold-palladium in a SEMPrep2 sputter coater (Nanotech). For imaging, a Hitachi S4700 scanning electron microscope (Hitachi High-Technologies, Canada) was used.  35  CHAPTER 3: IDENTIFICATION AND ANALYSIS OF AN OUTER-SEED-COATSPECIFIC PROMOTER FROM ARABIDOPSIS THALIANA 3.1 SYNOPSIS Differentiation of the Arabidopsis thaliana (Arabidopsis) seed coat epidermal cells involves pronounced changes highlighted by the synthesis and secretion of copious amounts of dispensable, pectinaceous mucilage followed by a thick cellulosic secondary cell wall. This cell type, therefore, represents an excellent molecular-genetic model to study the biosynthesis and modification of cell wall components, particularly pectin. To support such research, we sought to identify a promoter that drives expression specifically in the Arabidopsis seed coat epidermis. Arabidopsis seed coat microarray data was analyzed for genes expressed in the wild type seed coat but not the seed coat of the apetala2 mutant where the epidermal cells fail to differentiate. Of fourteen candidate genes, nine showed a seed-specific expression pattern by reverse transcriptase-PCR. Transcriptional regulatory region-beta-glucuronidase (GUS) reporter gene fusions introduced into Arabidopsis identified one promoter, that of the DIRIGENT PROTEIN1 (DP1) gene, as seed coat specific. The specificity of the expression was confirmed using a second reporter gene, Citrine YFP. Expression of both reporter genes was limited to the epidermal and palisade cell layers of the seed coat. Quantitative PCR data using wild type seed coat RNA suggested that the promoter is particularly active at 7 days post anthesis. The DP1 promoter. * A version of this chapter has been submitted for publication: Esfandiari, E., Jin, Z., Abdeen, A., Griffiths, J., Western, L.T., Haughn, G.W. “Identification and analysis of an outer-seed-coat-specific promoter from Arabidopsis thaliana”  36  was able to direct transcription of GUS in a similar pattern in the Brassica napus seed coat. Thus, in addition to its application in studying the plant cell wall, this promoter will provide an experimental tool for expressing high-valued recombinant proteins as well as modifying seed coat traits in economically important crops.  3.2 PREVIOUS AND RELATED WORK 3.2.1 IDENTIFICATION OF GENES WITH PUTATIVE SEED-COAT SPECIFIC EXPRESSION USING ARABIDOPSIS THALIANA SEED COAT MICROARRAY DATA Prior to the research described in this dissertation, Mr. Zhaoqing Jin, a former Ph.D. student in George Haughn’s lab (UBC), carried out a search to identify those genes specifically expressed in the differentiating seed coat epidermis of Arabidopsis during the period of mucilage biosynthesis. He utilized Arabidopsis Columbia-2 ecotype (Col-2) and apetala2 (ap2) mutant seed coat microarray data (Dean et al., 2011). In wild type seed coat epidermal cells, mucilage is synthesized between 4 and 9 Days Post Anthesis (DPA). However, in an ap2 mutant, mucilage is not synthesized because the epidermal cells of the seed coat fail to differentiate. Consequently, he screened for genes with higher expression at 5-7 DPA compared to 3 DPA, and with low expression in ap2 mutant seed coats at 7 DPA compared to wild type seed coat of the same age. Eighty-seven genes were found to match these criteria. To determine which of these genes might be transcribed specifically in the seed coat, Mr. Jin examined the expression of each in public databases using the Arabidopsis eFP Browser at the University of Toronto BioArray Resource (http://bar.utoronto.ca/efp/cgi-bin/efpWeb.cgi; Winter et al., 2007, data source: developmental map and seed). Fourteen of the eighty-seven genes showed expression  37  specifically in seeds approximately 5-7 DPA (bent cotyledon stage of embryo development). The list of these genes, fold changes in their expression level in Arabidopsis Columbia-2 (Col-2) ecotype at 7 DPA compared to 3 DPA and in Col-2 compared to ap2 at 7 DPA from the seed coat microarray data (Dean et al., 2011) are presented in Table 3-1. Table 3-1 Fold changes in gene expression in wild type compared to ap2 at 7 DPA and in Col-2 at 7 DPA compared to 3 DPA. Gene name  Col-2 (7 DPA)/Col-2 (3 DPA)  Col-2 (7 DPA)/ap2 (7 DPA)  At1g02720  8.87  4.96  At1g09550 At2g43050  2.61 9.61  3.29 9.44  At3g52550 At4g37520 At5g39130  7.56 4.28 2.59  4.94 3.69 2.09  At5g45770 At2g23550 At3g14760  4.33 3.82 5.61  3.14 3.14 2.49  At4g11180 At1g62070 At2g47750  7.06 9.57 3.73  5.74 7.58 2.35  At3g14630 At5g07200  3.77 4.26  2.04 2.03  3.2.2 EXPRESSION PATTERN OF POTENTIAL SEED COAT EPIDERMALSPECIFIC GENES As part of a collaborative effort with Dr. Haughn’s laboratory, Dr. Ashraf Abdeen, a former postdoctoral fellow in Tamara Western’s lab (McGill), investigated the expression pattern of the fourteen potential seed coat epidermal-specific genes in Arabidopsis using RT-PCR. Total RNA was isolated from 7 to 12 day old seedlings, roots, rosettes, cauline leaves, stems, inflorescences, whole siliques and seeds at different developmental stages (4, 7 and 10 DPA). As  38  shown in figure 3-1, transcripts of five genes (At1g02720, At2g43050, At3g14760, At4g37520 and At5g39130) were detected in tissues other than seeds and siliques. The transcripts of the remaining nine genes (At1g09550, At1g62070, At2g23550, At2g47750, At3g14630, At3g52550, At4g11180, At5g07200 and At5g45770) were found exclusively in seeds and whole siliques. However, two of the latter group (At1g62070 and At5g07200) appear to have higher transcript levels in whole siliques at 10 DPA compare to seeds at the same developmental stage, suggesting that these genes are expressed in the silique wall. Therefore, genes At1g09550, At2g23550, At2g47750, At3g14630, At3g52550, At4g11180 and At5g45770 were selected as potential genes with seed coat epidermal specific expression. In addition, At1g02720 and At2g43050 were examined further despite of their expression in inflorescence and/or stem because of their high expression level in seeds at 7 DPA and low expression in seeds and whole siliques at 10 DPA (Figure 3-1).  39  Figure 3-1 Expression analysis of seed coat-specific candidate genes in Arabidopsis by RT-PCR. Total RNA was extracted from seedling, root, rosette and cauline leaves, stem, inflorescence, whole siliques and seeds at three different developmental stages. RT-PCR was used to determine expression of candidate genes listed in the column on the right. The expression of the GAPC gene was used as a control.“This image is reprinted from Dr. Abdeen’s results”.  In order to identify promoter and regulatory sequences that drive expression specifically in the seed coat, Mr. Jin and Dr. Abdeen cloned the putative transcriptional regulatory region of each of the nine candidate genes (Figure 3-2) upstream of the promoterless betaglucuronidase (GUS) gene and transformed each construct into Arabidopsis. The sequences of the transcriptional regulatory regions of selected genes were obtained from The Arabidopsis 40  Information Resource (TAIR) website at http://www.arabidopsis.org/ using SeqViewer tool. Complete list of primers used for gene cloning, RT-PCR and qPCR is presented in Appendix.  Figure 3-2 Schematic representation of the transcriptional regulatory sequences of eight genes cloned upstream of a promoterless GUS reporter gene. The fragment used is indicated by a double-headed arrow. The numbers indicate the nucleotide position relative to the predicted transcription start (+1 for At1g09950, At2g23550, At2g43050, At2g47750, At3g52550, At4g11180) or translation start codon (+1 for At3g14630, At5g45770). For five of the genes, all or part of the neighbouring gene immediately upstream is shown to the left. “This image is a modified version of Mr. Jin’s results”.  41  3.3 RESULTS 3.3.1 THE DIRIGENT PROTEIN1 (DP1) PROMOTER DRIVES SEED COATSPECIFIC EXPRESSION Several transformants for each construct were selected (Table 3-2) and a histochemical GUS assay performed using seedlings, leaves, inflorescences, developing seeds and embryos. Transformants of five constructs showed a distinct pattern of GUS expression (Figure 3-3) while those of the other four constructs lacked expression in all transformants examined.  Table 3-2 Summary of GUS histochemical assay in different transgenic lines. Gene # of tested transgenic # of Transgenic lines lines showed GUS expression  At1g02720*┼  2  2  At1g09550*  24  10  At2g23550  11  0  At2g43050  40  0  At2g47750  10  0  At3g14630  28  0  At3g52550  19  18  At4g11180  15  8  *  22  4  At5g45770  * Histochemical GUS assay was done by Dr. Abdeen (Western lab). ┼ This line provided by Dr. Hahn (CCRC)  As shown in figure 3-3A, a-c and 3-3B, a-d, GUS expression under the control of the promoter of At1g02720 was detected in root tissue, seeds at different developmental stages and in the embryo.  42  Figure 3-3 Expression of the GUS reporter gene driven by transcriptional regulatory regions of putative seed coat-specific genes. Transgenic Arabidopsis plants were assayed histochemically for GUS activity. (A) Seedlings, leaves and inflorescences. (B) Developing seeds at three developmental stages and embryos at 7 DPA.  The promoter of At1g09550, At3g52550 and At5g45770 caused GUS to be expressed in seedlings, roots, rosette and cauline leaves, and whole seeds at several developmental stages (Figure 3-3). The promoter of At4g11180, the DIRIGENT PROTEIN1 gene (DP1; Matsuda et al. 2010; sequences 1160 bp upstream of the putative DP1 start codon [-991 to +169, see Figure 3-2 At4g11180a]), was the only promoter tested that resulted in seed coat specific GUS expression (data not shown), consistent with Arabidopsis eFP Browser (Winter et al. 2007, data source: developmental map and seed; data not shown) and RT-PCR results (Figure 3-1). Transgenic lines carrying a smaller fragment containing 988 bp of sequence from the same region but lacking the -119 bp immediately upstream of the putative transcription start site (-1107 to -119; see Figure 3-2 At4g11180b; DP1Pro-b) showed a similar seed coat specific  43  pattern of expression (Figure 3-3A, j-l; Figure 3-3B, m-p) and were analyzed in more detail (see below). The transgenic lines transformed with At2g23550Pro::GUS, At2g43050Pro::GUS, At2g47750Pro::GUS and At3g14630Pro::GUS constructs did not show GUS activity in any examined tissues (data not shown). Mr. Jin examined the expression of GUS under the control of the DP1 promoter (DP1Pro-b) in more detail (Figure 3-4). There was no GUS expression detected in developing silique walls. GUS was expressed strongly on the seed coat surface at 7 DPA but not at 4 or 10 DPA (Figure 3-4 A-C).  Figure 3-4 More detailed histochemical GUS assay of tissues of Arabidopsis transformed with DP1Prob::GUS. (A-C) Seeds at 4, 7 and 10 DPA respectively. Bars= 100 µm. (D) Seed coat at 7 DPA. (E) Embryo at 7 DPA. (F) Seed coat at 10 DPA. (G) Embryo at 10 DPA. Bars= 100 µm. (H) Flower of DP1Pro-b ::GUS. (I) Flower of wild type. (J) Flower of 35SPro::GUS. Bars= 1 mm.  44  To examine whether the expression of GUS is limited to the seed coat, Mr. Jin separated seed coats from embryos at 7 and 10 DPA prior to performing the GUS assay. GUS expression was specifically found in the seed coats but not in the embryos at 7 DPA (Figure 3-4D and E), and no GUS activity was observed in the seed coats and embryos at 10 DPA (Figure 3-4F and G). In DP1Pro-b::GUS transgenic flowers, the anthers stained weakly but this was also true for wild type flowers (Figure 3-4H and I). The staining in flowers of both lines was much weaker than in the positive control 35SPro::GUS transgenic plants as shown in figure 3-4J. To confirm that DP1Pro-b does not drive expression of GUS in anthers, RT-PCR analysis using RNA extracted from inflorescences of DP1Pro-b::GUS transgenic plants was done by Mr. Jin. GUS transcript was not detected (Figure 3-5).  Figure 3-5 RT-PCR analysis of GUS transcript. mRNA level of GUS in flowers of wild type, DP1Prob::GUS (a) and 35SPro::GUS (b) plants using gene-specific primers for GUS. GAPC was used as a loading control.  In order to confirm the seed coat specificity of the DP1Pro expression, I cloned the DP1Pro regulatory region (from -1107 to +20; including the putative DP1 start codon; Figure 3-2 A4g11180c) in front of a promoterless Citrine YFP gene (Griesbeck et al., 2001) in the pAD binary vector (DeBono, 2011). Consistent with the results using GUS as a reporter expression of Citrine YFP driven by DP1Pro-c was found only in the seed coat (Figure 3-6A and B). The expression of Citrine YFP under the control of DP1Pro-c was first observed at 6 DPA and was absent by 9-10 DPA (data not shown). Fluorescence intensity suggested that the 45  maximum expression of the reporter gene occurs at approximately 7 DPA. This hypothesis was confirmed by qPCR measurements (see below). Separation of the embryo and seed coat at 7 DPA showed that Citrine YFP expression was found only in the seed coat (Figure 3-6C and D).  Figure 3-6 Expression of the Citrine YFP reporter gene driven by the DP1 promoter. Seeds at 7 DPA from Arabidopsis transgenic lines expressing DP1Pro-c::Citrine YFP are shown. Plants were imaged using (A) light microscopy and (B) fluorescent microscopy where Citrine YFP expression was found in the seed coat. The embryo dissected from the seed coat and imaged with (C) light microscopy and (D) fluorescence microscopy showing that expression of Citrine YFP was limited to the seed cpoat. Bars= 100 µm.  46  3.3.2 DIRIGENT PROTEIN1 TRANSCRIPT DISTRIBUTION CORRELATES WELL WITH DP1 PROMOTER ACTIVITY Mr. Jin used RT-PCR and I carried out qPCR to determine if the amount of DP1 mRNA in the seed coat during development is similar to that observed for GUS under the control of DP1Pro-b. Seed coats were separated from developing embryos at 4, 7 and 10 DPA. Total RNA was extracted and first strand cDNA was synthesized using DP1 specific primers. Since the outermost endosperm layer tightly adheres to the seed coat at 7 and 10 DPA, the samples also contained some endosperm RNA. Consistent with the previous results using reporter genes (Figure 3-3, 3-6), DP1 transcript was detected in seed coats at 7 DPA but not at 4 and only slightly at 10 DPA (Figure 3-7).  47  A)  B)  Relative expression level  3.00  Replicate 1 Replicate 2  2.50  Replicate 3  2.00 1.50 1.00 0.50 0.00  DPA 4  7  10  Figure 3-7 DP1 seed coat expression analysis. (A) RT-PCR and (B) qRT-PCR using RNA extracted from wild type Arabidopsis seed coats at three developmental stages (4, 7 and 10 DPA). DP1 transcript level was determined relative to GAPC using three biological replicates and four technical replicates. Bars represent the average ± SD (n=4).  This expression correlates with the period of mucilage biosynthesis. Mr. Jin used qPCR to determine the quantity of DP1 mRNA in seed coats relative to expression in embryos and silique walls (including the suspensor and funiculus) at 7 DPA. As shown in figure 3-8A, DP1 transcript is found mainly in the seed coat (1255-fold higher than in embryos, Figure 3-8B). Very low expression was found in silique walls (65-fold higher than in embryos) and almost no expression was detected in embryos (Figure 3-8).  48  A)  B) 1600  0.7  1400  0.6  1200  Relative fold  Relative Expression Level  1800 0.8  0.5 0.4 0.3  1000 800 600  0.2  400  0.1  200  0  0 7 dpacoat SC Seed  7Embryo dpa EM Silique 7 dpawall SW  Replicate 1 Replicate 2  Seedcoat Coat Embryo Embryo Silique Seed Valve wall  Figure 3-8 qPCR analysis of DP1 transcript in seed coat, embryo and silique wall at 7 DPA. (A) RNA was extracted from seed coats, embryos and silique walls (including the suspensor and funiculus) at 7 DPA, and the DP1 transcript level determined relative to GAPC using two biological replicates and three technical replicates. Bars represent the average ± SD (n=3). (B) Data are presented as relative fold levels, where the transcript level in embryos at 7 DPA was set at 1.0. “This figure is based on Mr. Jin’s results”.  3.3.3 THE DP1 PROMOTER IS ACTIVE IN THE EPIDERMAL AND PALISADE LAYERS OF ARABIDOPSIS AND BRASSICA NAPUS SEED COATS For examining the spatial expression of DP1Pro-b::GUS within the seed coat of Arabidopsis, I embedded GUS stained 7 DPA developing seeds of the DP1Pro-b::GUS transgenic line in resin and sectioned. As a positive control, I used 35SPro::GUS transgenic line. GUS activity was detected specifically in the seed coat epidermis and palisade layers of DP1Pro-b::GUS transgenic plants (Figure 3-9A and B). This result was confirmed using confocal microscopy to examine the expression of Citrine YFP in 7 DPA developing seeds of DP1Pro-c::Citrine YFP transgenic lines. Consistent with the previous results, expression is limited to the outer two cell layers of the seed coat (Figure 3-9C-E). To compare the activity of DP1Pro to 35SPro quantitatively, GUS expression level was measured in 2 independent T4 DP1Pro::GUS lines and one 35SPro::GUS transgenic line using 49  qPCR (Figure 3-10). Total RNA was isolated from the seed coat at 7 DPA. The expression level of GUS driven by 35SPro was found to be 5-6 fold higher than those obtained with the DP1Pro although it is important to consider that DP1Pro is active only in the outer two cell layers whereas 35SPro is active in all cell layers of the seed coat as well as in endosperm (Figure 3-10).  Figure 3-9 DP1Pro expression pattern in Arabidopsis thaliana. (A) Seeds (7 DPA) of DP1Pro-b::GUS and (B) 35SPro::GUS transgenic plants were assayed for GUS activity, embedded in resin, and sectioned. Bars= 100 µm. (C-E) Confocal analysis of DP1Pro-c::Citrine YFP expression in 7 DPA seeds. (C) Light micrograph, (D) Confocal fluorescence micrograph in which cell walls are stained by propidium iodide in green. 1: epidermis, 2: palisade layer, 3/4: cells of the other two inner integument layers, 5: endothelium (E) Confocal fluorescence micrograph showing expression of Citrine YFP in epidermis and palisade layer of the seed coat. Bars= 28 µm. “C-E were taken by Jonathan Griffiths.”  50  Relative expression level  0.35 0.30 0.25  Replicate1 Replicate 2  0.20 0.15 0.10 0.05 0.00  Figure 3-10 Quantitative comparison between the activity of DP1Pro-b and 35SPro by measuring levels of transcript of GUS. RNA was isolated from the seed coat at 7DPA. The quantity of GUS transcript relative to GAPC was determined using two biological replicates and four technical replicates. Bars represent the average ± SD (n=4).  To determine whether the DP1Pro behaved similarly in other Brassicaceae, the DP1Prob::GUS  construct was used to transform Brassica napus (B. napus). Based on histochemcal GUS  assays, no GUS expression was found in leaves, inflorescences, silique walls or embryos (data not shown). However, as in Arabidopsis, GUS was highly expressed in seed coats. I embedded the seeds expressing GUS in 5% agarose and sectioned them (Figure 3-11).  Figure 3-11 Thick cross sections of transgenic B. Napus seed coat. DP1Pro-b::GUS developing seeds at approximately 15 DPA and 25 DPA; wild type (20 DPA) was used as negative control. Oi: outer integu-  51  ment, Ii: inner integument, Oi3: epidermis, Oi2: parenchymatous cell layer, Oi1: palisade layer. Bar= 100 µm.  The expression of GUS found in the outer integument (Oi) of developing seed coats which includes epidermis (Oi3), 2-3 parenchymatous cell layers (Oi2) and palisade layer (Oi1).The expression is detectable from the mid (~15 DPA) to the late developmental stages (~25 DPA).  3.4 DISCUSSION 3.4.1 DP1 PROMOTER RESPRESENTS A TOOL FOR STUDYING AND MODIFYING SEED COAT PROPERTIES In this chapter, identification and characterization of the promoter regulatory region from the Arabidopsis DP1 gene was described. The DP1 promoter (DP1Pro) fragment is sufficient to drive the expression of a reporter gene specifically in the two outer layers of the seed coat. Expression occurs during a narrow window of developmental time of approximately 3 days from 6-8 DPA. This period corresponds closely to the period of mucilage secretion in the epidermal cells (5-8 DPA). Seed coat mucilage is being used as a model system for studying the synthesis and function of plant cell wall components (Arsovski et al., 2010; Haughn and Western, 2012). Therefore, the DP1Pro could serve as a useful tool for testing the activity of carbohydrate active enzymes and engineering the production of specific types of cell wall carbohydrates in the mucilage pocket. Alternatively, it can be used for the modification of the outer cell layers of the seed coat to address questions concerning seed coat structure and function. In addition, because spatial and temporal expression driven by DP1Pro is conserved in B. napus, the promoter could be used to modify the seed coat properties or express valuable recombinant proteins in the seed coat of Brassica crops. 52  3.4.2 DIFFERENT FRAGMENTS OF DP1 TRANSCRIPTIONAL REGULATORY REGION SHOWED A SIMILAR SEED COAT SPECIFIC PATTERN OF EXPRESSION The DP1Pro transcriptional regulatory region includes the 990 bp of sequence upstream of the annotated transcription start site (+1; see Figure 3-2). The 119 bp immediately upstream of this putative transcription start site are not necessary for the seed coat specific promoter activity, as a fragment from -119 to -1107 was able to promote a pattern of expression similar to ones extending from +169 to -991 and +20 to -1107 (Figure 3-2). These data suggest that either the DP1Pro is positioned more than 119 bp upstream of the transcription start site and/or the transcription start site is incorrectly annotated. Promoters that initiate transcription over a broad region of 100 bp are common in eukaryotes (reviewed in Stamatoyannopoulos, 2010).  3.4.3 THE DP1 PROMOTER WAS THE ONLY PROMOTER IDENTIFIED AS SEED COAT-SPECIFIC DURING MUCILAGE SYNTHESIS Our search for seed coat specific promoters identified only one. Several factors could have contributed to this low number. First, it is possible that relatively few such promoters exist. Indeed most of the genes known to have specific roles in the seed coat, are also expressed in other tissues (e.g. Jofuku et al., 1994; Zhang et al., 2003; Dean et al., 2007). Second, because of our interest in seed coat mucilage as a model for cell wall component biosynthesis, our search was designed to identify promoters with a very specific pattern of expression. Genes expressed constitutively, or at different time points, and those not regulated by AP2 would have been missed. Finally, nine genes appeared to be seed coat specific based on RT-PCR results, but four of these did not show expression when their putative transcriptional regulatory regions were tested using a reporter gene. Since these negative results could have arisen from  53  the failure to include the entire transcriptional regulatory sequences, the sensitivity of the promoter region to the genomic insertion site following transformation or errors in chimeric gene construction, it is possible that one or more might show seed coat specific expression if re-examined.  3.4.4 DP1 MAY PLAY A ROLE IN NEOLIGNAN BIOSYNTHESIS The DP1 gene (At4g11180) is a member of the dirigent protein gene family. Dirigent proteins have been associated with the synthesis of the phenylpropanoid compounds, neolignans (Burlat et al., 2001; Davin and Lewis, 2005). Indeed, although the exact role of the DP1 protein has not been determined, a dp1 mutant has been shown to lack seed specific neolignans (Matsuda et al., 2010) suggesting a role in their synthesis. The presence of neolignans specifically in the outer seed coat is significant because different lignans act as antioxidants, antiviral, antibacterial, antifungal, and cytotoxic compounds (Nitao et al., 1991; Asano et al., 1996; Miyazawa et al., 1996; Day et al., 1999; Harper et al., 1999). Neolignans could, therefore, increase the efficiency of the seed coat’s role as in protecting the embryo against pathogens. Indeed, it has been demonstrated that the expression level of a DP1 homolog is increased in B.napus following infection by the necrotrophic plant pathogen Sclerotinia sclerotiorum (Zhao et al., 2007), suggesting a role in plant defence.  54  CHAPTER 4: EXPRESSING A CARBOHYDRATE ACTIVE ENZYME TARGETED TO THE APOPLAST AND UNDER THE CONTROL OF THE OUTER-SEEDCOAT-SPECIFIC PROMOTER DP1. 4.1 SYNOPSIS The promoter of Arabidopsis DIRIGENT PROTEIN1 (DP1) gene was found to be seed coatspecific (Chapter 3). The DP1 promoter (DP1Pro) is the only identified promoter which drives the expression of a reporter gene specifically in the epidermis and palisade layer of Arabidopsis seed coat during mucilage biosynthesis. Seed-coat mucilage, produced by epidermal cells, is being used as a model to study plant cell walls components; DP1Pro represents a useful molecular genetic tool in such a system because carbohydrate active enzymes can be targeted specifically to the outer seed coat, avoiding potential pleiotropic effects on plant growth and development. Here, I describe the expression of a gene encoding a polygalacturonase (ARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE2; ADPG2) under the control of DP1Pro and targeted to the apoplast where the pectinaceous mucilage accumulates. Although reverse transcriptase-PCR (RT-PCR) results using seed coat RNA extracted from the transgenic lines showed that the chimeric gene was transcribed, no significant difference was found in mucilage structure or the morphology of epidermal cells between the seed of transgenic lines compared to wild type.  4.2 INTRODUCTION For more than a decade, Arabidopsis seed coat mucilage has been utilized as a model system to expand our knowledge about the synthesis, modification and function of the cell  55  wall. Seed mucilage is produced by the epidermal cells of the seed coat and secreted to the apoplast during seed coat development. As has been shown in chapter 3, the DP1Pro shows strong activity in the palisade and epidermal layers of Arabidopsis seed coat during mucilage secretion. Therefore, DP1Pro provides a valuable tool to investigate the role(s) of the cell wall components found in mucilage. Based on chemical analysis and immunoflourescence studies of extracted mucilage, it has been proposed that mucilage is composed mainly of unbranched rhamnogalacturonan I (RG I), homogalacturonan (HG), xyloglucan and cellulose (Penfield et al., 2001, Willats et al., 2001; Western et al., 2004; Young et al., 2008). So far, the exact roles of these carbohydrates are still a matter of debate. In order to verify the potential applicability of DP1Pro to express enzyme-coding genes as well as investigating the putative role(s) of HG in mucilage, I cloned a polygalacturonase: ARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE2 (ADPG2) under the control of DP1Pro and targeted it to the apoplast. This gene was chosen based on two criteria: it is not normally expressed in the seed coat during mucilage synthesis (Figure 4-1) and its activity has been characterized in vitro. The expected results in transgenic lines expressing ADPG2 were as follows: 1- Mucilage in transgenic plants might be looser and more easily-detachable from the seed compared to the wild type. The unesterified carboxyl group of galacturonic acid residues in parallel chains of HG can form ionic bonds with Ca+² and form a tight complex network. Expression of a polygalacturonase (PG) will result in hydrolysis of the glycosidic bonds that link galacturonic acid residues in HG. Therefore, I postulated that the lower amount of polymerized 56  HG in the transgenic lines expressing ADPG2, would make the mucilage looser compared to that in the wild type. 2- There would not be any significant differences in the extruded mucilage of transgenic seeds treated with EDTA (Ethylenediaminetetraacetic acid): The heavy metal chelating agents such as EDTA extract Ca+2-cross-linked pectins and results in weakening of the cell wall. If the ADPG2 affects mucilage, I would expect not to find any differences between the transgenic and wild type seeds treated with EDTA.  4.3 RESULTS 4.3.1 EXPRESSION OF ADPG2 UNDER THE CONTROL OF DP1 PROMOTER It has been shown that ADPG2 encodes a polygalacturonase which is involved in anther and silique dehiscence, and floral organ abscission (Ogawa et al., 2009). Polygalacturonase activity of ADPG2 was confirmed in vitro by expressing the protein in Escherichia coli (Ogawa et al., 2009). Based on localization (Ogawa et al., 2009) and eFP browser data (Data source: developmental map and seed; Winter et al., 2007), ADPG2 gene is expressed in roots and the abscission zone of the sepals, petals, and stamens of flowers. However, no expression of ADPG2 gene was found in the seed coat (Figure 4-1).  57  Figure 4-1 Expression pattern of ADPG2. This expression map was obtained from eFP browser at University of Toronto (Data source: Developmental map and seed; Winter et al., 2007).  I cloned ADPG2 downstream of the DP1Pro in the pCAMBIA 1390 binary vector (http://www.cambia.org/daisy/cambia/585) to make a DP1Pro::ADPG2 construct. In order to detect the protein, an in-frame protein fusion of ADPG2 with a Myc-tag was made (DP1Pro::ADPG2-myc; Figure 4-2A). Since I was not able to find any direct evidence indicating the presence of a signal sequence in ADPG2, I made two more constructs using two different signal sequences upstream of ADPG2 (Figure 4-2B); one from the GLYCOSYLPHOSPHATIDYLINOSITOL-ANCHORED LIPID TRANSFER protein (LTPG; DeBono et al., 2009) to make the DP1Pro::LTPGSignal  seq::ADPG2-myc  construct and the other, the first exon of MUCILAGE-  MODIFIED2 (MUM2) which was proposed by Dean et al. (2007) to encode the signal sequence required for the secretion of MUM2 (DP1Pro::MUM2Signal  seq::ADPG2-myc).  Arabidopsis Col-2  was transformed with these three constructs. For each construct, more than twenty transgenic lines were selected for further analysis. 58  Figure 4-2 Schematic representation of DP1Pro::ADPG2-myc, DP1Pro::LTPGSignal seq::ADPG2-myc and DP1Pro::MUM2Signal seq::ADPG2-myc constructs. APDG2 was cloned downstream of the DP1Pro without a signal sequence (A) and it was fused to two different signal sequences (B) at the N-terminus of ADPG2.  4.3.2 EXPRESSION OF ADPG2 DID NOT ALTER MUCILAGE STRUCTURE AND MORPHOLOGY OF SEED COAT EPIDERMAL CELLS To determine whether DP1Pro-ADPG2, was transcribed in the transgenic plants, I carried out RT-PCR using RNA isolated from the seed coat of two independent transgenic lines of DP1Pro::ADPG2-myc at 7 Days Post Anthesis (DPA). As a control, I used RNA isolated from Col-2 wild type as well as genomic DNA extracted from Col-2 leaves (to verify the presence of any genomic DNA contamination in the seed coat RNA). The size of full length genomic ADPG2 is 2.507 kb and the size of its cDNA is 1.667 kb (TAIR website; SeqViewer tool). As is shown in figure 4-3, the transcript of ADPG2 was detected in both transgenic lines but not in wild type. There was a faint band of a size similar to the full length ADPG2 (white arrow in figure 4-3) when I used genomic DNA as a template. This band is absent when I used seed coat RNA, indicating that the RNA was not contaminated with genomic DNA. No transcript of ADPG2 was found using RNA extracted from the seed coat of wild type confirming that ADPG2 is not normally expressed in the seed coat.  59  Figure 4-3 Expression analysis of ADPG2 driven by DP1 promoter in two independent transgenic lines by RT-PCR. Total RNA was extracted from the seed coat at 7 DPA. RT-PCR was used to verify the presence of ADPG2 transcript in the seed coat. In parallel, RNA from seed coat and genomic DNA extracted from leaves of Col-2 were used. The white arrow points to a faint band of a size similar to the full length genomic ADPG2. The expression of the GAPC gene was analyzed as a control. The numbers on the right indicates the size of DNA marker.  To investigate if the expression of the transgene affects the mucilage structure and/or extrusion, I carried out mucilage analysis using Ruthenium red staining. I verified more than 20 independent  T2  lines  of  DP1Pro::ADPG2-myc,  DP1Pro::LTPGSignal  seq::ADPG2-myc  and  60  DP1Pro::MUM2Signal seq::ADPG2-myc and compared their morphology to Arabidopsis Col-2 wildtype. The mature seeds were shaken in water/EDTA for 2 h following by shaking in Ruthenium red for 30 min. As a control, wild type Col-2 seeds were used. If the mucilage was loose (see above), this treatment would be expected to detach the mucilage from the seed resulting in a reduced mucilage halo compared to wild type. However, the mucilage halo of the examined transgenic seeds of each construct and the wild type were indistinguishable (Figure 4-4). Since the similar results were obtained for DP1Pro::ADPG2-myc, DP1Pro::LTPGSignal seq::ADPG2-myc, and DP1Pro::MUM2Signal  seq::ADPG2-myc,  only the results of DP1Pro:: ADPG2-myc are presented in  figure 4-4. In addition, seeds were directly stained with ruthenium red without shaking, however, no difference was found between mucilage of transgenic lines and wild type (data not shown).  Figure 4-4 Mucilage analysis of DP1Pro::ADPG2-myc. A layer of stained mucilage is visible around the Col-2 (Control) seed as well as transgenic seeds. (Mucilage analysis of only two of the transgenic lines tested is shown). Bars= 1mm  61  Furthermore, I used scanning electron microscopy of mature, dry seeds to verify if the expression of the transgenes affects the shape of the seed epidermal cells. However, again no difference was found between transgenic lines and the wild type seeds (Figure 4-5).  DP1Pro::ADPG2-myc-1  Col-2  Figure 4-5 Scanning electron micrograph of DP1Pro::ADPG2-myc and wild type (Col-2) mature seeds. The verified transgenic seeds are indistinguishable from the wild type.  While the mRNA of ADPG2 (Figure 4-3) was detected by RT-PCR in the transgenic lines, the mucilage phenotype and the morphology of the epidermal cells remained unaltered compared to the wild type. These results might be due to the fact that the amount of the ADPG2 protein produced is not high enough to affect the mucilage structure. Therefore, to verify the presence and approximate amount of the ADPG2 protein, I carried out a western blot on protein extracted from the siliques at 7 DPA using anti-myc antibody. I chose 3 independent transgenic  lines  carrying  DP1Pro::ADPG2-myc,  DP1Pro::LTPGSignal  seq::ADPG2-myc  and  DP1Pro::MUM2Signal seq::ADPG2-myc constructs. As a negative control, I used wild type and as a positive control, I used protein extracted from seedlings and leaves of GNOMPro::GNOM-3xmyc transgenic lines (GNOM gene driven by endogenous promoter which is translationally fused to 3 X myc-tag; Glender et al., 2003). Although I found a band for the positive control (approxi62  mately 130 KDa; the size of GNOM protein is 126 KDa), there was no band detected for any of the transgenic lines (data not shown).  4.4 DISCUSSION I expressed a carbohydrate active enzyme under the control of the DP1Pro to investigate the utility of DP1Pro in expressing genes in the epidermal cells during mucilage biosynthesis as well as determining the putative roles of HG in seed coat mucilage. The first goal was achieved since RT-PCR results demonstrated that the transcript of ADPG2 was detected in the seed coat. This result combined with the results for DP1Pro-reporter gene fusions (Chapter 3) indicates that DP1Pro is effective for this purpose. However, no obvious differences were found in the mucilage structure and epidermal cell morphology of the transgenic lines compared to wild type. Furthermore, I failed to detect the ADPG2 protein in the transgenic lines using anti myctag antibody. Failure to detect the protein might be due to several reasons: 1- Since this protein is not normally expressed in the seed coat, it might be sensitive to some peptidases found in the epidermal cells and therefore be unstable in the new environment. 2- I used protein extracted from the developing siliques as a template; however, DP1Pro is active in the seed coat. Including the embryo and silique wall might decrease the percentage of ADPG2 in the total amount of extracted protein to the point where it is undetectable with the antibody. Extracting seed coat protein at 7 DPA and using it as a template might be a way to solve this problem.  63  3- In the positive control GNOMPro::GNOM-3 X myc, GNOM is fused to 3 X myc-tag while PG was fused to 1 X myc-tag. The antibody may not efficiently detect the 1 X myc-tag. Fusing more than one myc-tag at the C-terminus of ADPG2 might affect the detection of the protein by antibody.  64  CHAPTER 5: PROMOTER DELETION ANALYSIS OF THE MUCILAGEMODIFIED4 GENE TO IDENTIFY THE PUTATIVE CIS-REGULATORY ELEMENT RESPONSIBLE FOR ITS UP-REGULATION IN THE SEED COAT 5.1 SYNOPSIS The Arabidopsis thaliana (Arabidopsis) MUCILAGE-MODIFIED4 (MUM4) gene was found to encode a putative NDP-L-rhamnose synthase, required for synthesis of rhamnose, a substrate of rhamnogalacturonan I (RG I), the main component of seed coat mucilage in Arabidopsis. While the transcript of MUM4 is found throughout the plant, it is specifically up-regulated during mucilage biosynthesis at 7 DPA in the seed coat. Several transcription factors including APETALA2 (AP2), TRANSPARENT TESTA GLABRA1 (TTG1), and GLABRA2 (GL2) are required for this up-regulation (Western et al., 2004); however, the key regulatory element(s) involved in this process have not been identified. To identify regions that control the spatio-temporal expression of the MUM4 gene and elucidate the basis for this up-regulation, promoter deletion analysis was carried out using beta-glucuronidase (GUS) as a reporter gene. The transcriptional regulatory region of MUM4 was analyzed to determine putative transcription factor binding sites (TFBSs) and TATA/CAAT elements. Based on the obtained results, a series of truncated promoters were designed and fused to the GUS reporter gene. The full-length promoter (a 1424 base pair fragment from the end of 3’UTR of the closest gene upstream of MUM4 to the MUM4 translational start codon) drives the expression of GUS in various tissues of Arabidopsis in a manner similar to that of the endogenous MUM4 gene. Deletion of much of the promoter regulatory region did not alter the observed expression pattern. However, deletion of the 5’UTR intron causes a decrease in GUS expression in seedlings and leaves but not in seeds indi65  cating its essential role for maximum expression. Surprisingly, a fragment from -407 to -100 excluding the annotated 5’UTR and approximately 100 bp upstream of the annotated transcription start site resulted in seed coat specific expression. Thus, the dissection of the MUM4 promoter has led to identification of two regions: one conferring higher level of gene expression in seedlings and silique walls and one that promotes expression specifically in the seed coat. This study furthers our understanding of molecular mechanisms involved in regulation of MUM4 expression which can be applied to develop effective promoters to drive a transgene expression in a desired manner.  5.2 PREVIOUS AND RELATED WORK 5.2.1 ANALYZING THE MUM4 TRANSCRIPTIONAL REGULATORY REGION TO SEARCH FOR PUTATIVE TRANSCRIPTION FACTOR BINDING SITES MUM4 gene (At1g53500), encodes a putative NDP-L-rhamnose synthase, an enzyme required for the biosynthesis of rhamnose. Rhamnose is a subunit of RG I, the major component of Arabidopsis mucilage. Although it is expressed throughout the plant, RNA gel-blot and qPCR results have shown that MUM4 expression is gradually increasing in the seed coat from 4 DPA (before mucilage synthesis) to 7 DPA (during mucilage synthesis). At 10 DPA (when mucilage biosynthesis has been completed) MUM4 expression level is again low. Prior to the research described in this dissertation, Zhaoqing Jin, a former Ph.D. student in George Haughn’s lab (UBC) analyzed the transcriptional regulatory region of the MUM4 gene from the end of coding region of the upstream gene (At1g53510) located 1203 bp upstream of MUM4 transcription start site (TSS) to the MUM4 start codon (Figure 5-1).  66  He searched for different motifs (http://www.dna.affrc.go.jp/PLACE/signalup.html; highlighted with pink in figure 5-2) and putative transcription factor binding sites (TFBS) (http://www.cbrc.jp/papia/papia.html highlighted in purple in figure 5-2). This search led to the identification of eleven putative TATA/CAAT boxes and four putative TFBSs. Based on these data, a series of promoter deletion constructs were designed and cloned upstream of a promoterless beta-glucuronidase (GUS; Jefferson et al., 1987). In each construct, one or more of these motifs and/or TFBSs were eliminated to investigate their potential role in spatial and temporal expression pattern of MUM4.  Figure 5-1 Schematic map of the MUM4 locus. This map represents relative positions of transcriptional regulatory and coding regions of MUM4 as well as the 3’ end of the upstream gene (At1g53510).The numbers indicate the nucleotide position relative to the annotated transcription start site (TSS) of MUM4 (+1). This map is based on the information found in TAIR’s website using SeqViewer tool (http://www.arabidopsis.org/servlets/sv) and on Mr. Jin’s results.  5.2.2 DELETION OF THE 3’UTR OF THE UPSTREAM GENE POSSESSING A PUTATIVE TFBS DOES NOT AFFECT THE GUS EXPRESSION PATTERN. As it has shown in the figure 5-2, there is a predicted TFBS in the 3’UTR of At1g53510 gene. Mr. Jin designed and made MUM41.7Pro::GUS (-1203 to 518) construct to include this  67  -1203 acaacacttcagacagatctttaaccaccacatcttcctccaccaggtgattct -1150ctagtttttatgtaagtattattcagtccaggctctgatatgaactacgt -1100tgcaatgatataagaaagacttttatttagttgtaactctccagaacaag -1050atcgccttggattagtctgattgcgggtcagtcccggttattgtttcggt -1000tatcttgttggctccataatctttgaatttgccataagcgtagttcaccg -950tagagaagaatatcgtggtgattatatacttcttaaacttcttaatcggt -900 cccattagtctttattgttcttcaacaaaaaaaggaatctctttggttat -850 tggaaaatatggtcttgattggttaatatagacaacattatgccgaagaa -800 tgtggaagtaacaaaataaaacattggtccttagatttttcttctgtaaa -750 ccactctttctcagattatataattagtcaattttattcaatggttacaa -700 aaagaaaaaaaaaaacttgccaatgaaaaaaaggaatgctcttgacctca -650 agactcatcatggttaacaatgaaattcgccttaacttcgaaattttgac -600 gccgttgaaatgtttataatttacccgccaagtttgtaggcctgagttta -550 gcccattaaaggtaatattaggcgtccattaatcataacgaatatcactt -500 tctcaatttaacaagtcatgagaaagtgtacacatttgatctatttaata -450 tttattaaccaaaaaggaagcaaatcaattatttcgttacgtgacggtgg -400 cattaagcatcttgcattgaatgatccgttatatataatctcaggttttt -350 tttgggttgaaatgatgatattaaattttaggttgacatgtacttatctt -300 tgtaatcaactaattaaatatttgaactgacatgtctacgttatatcata -250 aataaaccaggtgttttaattaaataccacgattaaccttctaaaataag -200 gaaaatcatattttattcgtcaatcactataatttggaaaacgatgcaat -150 atatttatttctttctttatacacatacttaattaattatcaaaatttca -100 ttctattttaattgatctgaaatgtcctaatttagtagagagctaataaa -50 tagactcacatttatgttgaaaaacaaaacaagaaagagaaaaagacat +1 gagtttaatgtcggacgctagactcacgagaaatccgtaatatctaagacg 50atcaagggtaaattagtcaatttcctcctacggttctccgtaactgtct 100cagaatataagaggcacattgctgagagaagctccgtagaccgtagattc 150cctcttcttcttcttcctcttcctctctactgttttttcttttcatattt 200ctctctctctctctctctatagttggtgaagtttctatctttatctctct 250taagatctctttctctcttgggttatctgactctaaccagaattgtgtcg 300 gtacgtgaaattgtttctctctttctgtttctatttctaaaactaatttt 350gtgaaatgttgtacgtgagtgacaaatacatctctatgttgtctgtttat 400gatcccatgtgacatgtttaagatctgttgctgaattggagatctggatc 450tgacttctttttcatatgatccgcttctgaattttccatttgatgttttt 500tttttgcagatttcaagg atcg: 3’UTR of upstream gene atcg: 5’UTR atcg:Intron atcg::Transcription factor binding site atcg:TATA-Box or CAAT-Box  Figure 5-2 Nucleotide sequence of the transcriptional regulatory region of MUM4 from position -1203 to +518. Nucleotide positions shown on the left are relative to the predicted transcription start site of MUM4 (+1). In this region, various putative TFBSs and TATA/CAAT elements were identified and labelled based on bioinformatics data.  68  region to the sequences upstream of the MUM4. In another construct (MUM41.5Pro; from -906 to 518), he excluded the 3’UTR of At1g53510 to elucidate the effect of the putative TFBS residing in it on the expression pattern of MUM4 (Figure 5-2 and 5-3). These fragments were cloned upstream of GUS and transformed into Arabidopsis Col-2 wild type.  Figure 5-3 Schematic map of the MUM4 locus representing MUM41.7Pro and MUM41.5Pro constructs. The numbers indicate the nucleotide position relative to the annotated transcription start site of MUM4 (+1). 1.7 and 1.5 Kb labels indicate approximate length of the truncated promoter.  Mr. Jin and I performed histochemical GUS assay using various tissues of transgenic lines including 10-14 day old seedlings, leaves, inflorescences, siliques and developing seeds at 3, 7 and 10 DPA. Consistent with the previous RT-PCR results on expression pattern of MUM4 gene (Western et al., 2004), the GUS transcripts were detectable in all tissues examined (Figure 5-4) and no significant differences were detected between the expression patterns of GUS driven by these two fragments (Since the results of MUM41.7Pro::GUS and MUM41.5Pro::GUS were similar, only the images of MUM41.5Pro::GUS transgenic lines are presented in figure 5-4). This suggests that the 3’UTR of the upstream gene does not control the regulation of MUM4 expression. Therefore, we used the shorter fragment, MUM41.5Pro for further analysis.  69  Figure 5-4 Expression of the GUS reporter gene driven by putative full length promoter of MUM4 and truncated promoter fragments. Various parts of transgenic Arabidopsis plants including seedlings, leaves, inflorescences, and developing seeds at three developmental stages were assayed histochemically for GUS activity. Since the results of MUM41.7Pro::GUS and MUM41.5Pro::GUS were similar, only the images of MUM41.5Pro::GUS transgenic lines are presented.  70  It was shown that MUM4 transcript levels increase from 3 DPA to 7 DPA in the silique (Western et al., 2004). By performing a qPCR, Mr. Jin showed that the MUM4 follows a similar pattern in the seed coat (data not shown), consistent with Arabidopsis seed coat microarray data (Dean et al., 2011). To verify if the selected fragment (MUM41.5Pro) is able to increase the GUS transcript levels in the same manner as the MUM4 endogenous promoter, Mr. Jin and I carried out qPCR. In parallel, MUM4 expression from the endogenous gene was measured as an internal control in both Arabidopsis Col-2 and transgenic lines (Figure 5-5).The results showed that the full-length promoter drives the expression of the reporter gene in a pattern similar to the internal control (Figure 5-5). The expression of GUS increased from 3 DPA to 7 DPA, at which time the mucilage is being synthesized. At 10 DPA, following the completion of mucilage synthesis, the expression was again low (Figure 5-5). These findings suggested that the cis-regulatory elements required for MUM4 up-regulation during seed coat development is located in this region. The MUM41.5Pro was considered to be a full-length promoter and used for further analysis.  Relative expression level  Relative expression level  Col-2 MUM41.5Pro::GUS 0.3 0.25 0.2 0.15 0.1 0.05 0 3  7  10  DPA  MUM4  GUS  0.3 0.25 0.2 0.15 0.1 0.05 0 3  7  10  DPA  Figure 5-5 MUM41.5Pro::GUS expression analysis. qPCR using RNA extracted from seed coats at three developmental stages (3, 7 and 10 DPA) from MUM41.5Pro::GUS transgenic lines. GUS transcripts level was determined relative to GAPC using four technical replicates. As a control, expression level of MUM4 in both Arabidopsis Col-2 and transgenic lines was measured.  71  5.2.3 ABSENCE OF THE SECOND AND THIRD PUTATIVE TFBSS DOES NOT AFFECT REPORTER GENE EXPRESSION Mr. Jin designed and made two more constructs: MUM41.0Pro and MUM40.9Pro to exclude the second and third putative TFBSs and several TATA/CAAT elements (Figure 5-6).  Figure 5-6 Schematic map of the MUM4 locus representing MUM41.0Pro and MUM40.9Pro constructs. The numbers indicate the nucleotide position relative to the annotated transcription start site of MUM4 (+1). 1.0 and 0.9Kb labels indicate approximate length of truncated promoter.  I used a histochemical GUS assay in order to verify the ability of these two fragments to express the reporter gene. The detection of GUS activity in 5 to 7 independent transgenic plants demonstrated that GUS was expressed in all tissues examined and deletion of the TFBSs did not change the spatiotemporal expression (Figure 5-4). Based on qPCR results (Figure 5-7), the transcript level of GUS under the control of MUM40.9Pro is higher at 7 DPA compared to 3 and 10 DPA consistent with the internal control. However, this pattern was not observed for GUS driven by MUM41.0Pro and showed high level of mRNA at 3 DPA. This result might be an artifact because our histochemical assays clearly show that the expression of GUS was considerably lower at 3 DPA compared to 7 DPA and qPCR with smaller fragments showing the stereotypical expression pattern (Figure 5-4).  72  The smaller promoter fragment (MUM40.9Pro) was able to increase the expression of GUS indicating the presence of cis-regulatory element in this region. Therefore, it was subjected to further deletion analysis.  Relative expression level  Relative expression level  0.25 0.2 0.15 0.1 0.05 0  DPA 3  7  MUM4  MUM41.0Pro::GUS  MUM40.9Pro::GUS  10  GUS  0.025 0.02 0.015 0.01 0.005 0  DPA 3  7  10  Figure 5-7 MUM40.9Pro::GUS and MUM41.0Pro::GUS expression analysis. qPCR using RNA extracted from the seed coat of MUM40.9Pro::GUS and MUM41.0Pro::GUS transgenic lines at three developmental stages (3, 7 and 10 DPA). GUS transcript level was determined relative to GAPC using four technical replicates. Expression level of MUM4 was measured as an internal control.  5.3 RESULTS 5.3.1 THE 5’UTR INTRON ENHANCES THE EXPRESSION OF THE REPORTER GENE IN SEEDLINGS AND LEAVES. The first intron of MUM4 resides in the 5’UTR (Figure 5-1). Numerous studies have shown that introns in the 5’UTRs can enhance the expression of the adjacent gene through a phenomenon called Intron-Mediated Enhancement (IME) of gene expression (Mascarenhas et al., 1990). To verify the role of the MUM4 proximal intron, Mr. Jin and I excluded this region  73  from the full-length promoter by making two different constructs: Mr. Jin cloned MUM41.2Pro (from the end of 3’UTR of upstream gene to the start point of intron [300]) and I cloned MUM40.7Pro (from -407 to the start point of the intron [300]; Figure 5-8).  Figure 5-8 Schematic map of the MUM4 locus representing MUM41.2Pro and MUM40.7Pro constructs. The numbers indicate the nucleotide position relative to the annotated transcription start site of MUM4 (+1). 1.2 and 0.7Kb labels indicate the approximate length of the truncated promoter region.  Both of the fragments were fused to the GUS reporter gene. Arabidopsis transgenic plants transformed with the MUM41.2Pro::GUS construct, showed lower GUS activity in the roots, cotyledons, the first true leaves of seedlings and rosette leaves compared to transgenic plants carrying MUM41.5Pro::GUS, MUM41.0Pro::GUS, and MUM40.9Pro::GUS constructs (Figure 54). While visible GUS expression was found in trichomes and petioles of seedlings, no significant difference was found in the expression of GUS in the inflorescence and seeds (Figure 5-4). Interestingly, the expression of GUS in MUM40.7Pro::GUS transgenic lines was even lower compared to MUM41.2Pro::GUS. GUS expression was very low in rosette leaves of MUM40.7Pro::GUS transgenic lines and no GUS expression was found in root tissue, silique walls and seeds at 3 DPA (Figure 5-4). To quantify GUS expression driven by MUM41.2Pro and MUM40.7Pro in the seeds, I performed qPCR. In the MUM41.2Pro::GUS transgenic line, while the transcript level of MUM4 driven by its endogenous promoter slightly changed at 7 DPA compared to 3 DPA, GUS driven 74  by MUM41.2Pro showed a significant up-regulation at 7 DPA (Figure 5-9).  In both  MUM40.7Pro::GUS transgenic lines examined, MUM4 mRNA level was higher at 7 DPA compared to 3 and 10 DPA but in one of the lines, GUS showed similar expression pattern to the internal control, however, MUM4 expression was more than 2 fold higher compared to GUS expression at 7 DPA (Figure 5-9). MUM4  Relative expression level  MUM41.2Pro::GUS  GUS  0.2 0.15 0.1 0.05 0  Relative expression level  3  7  11  DPA  0.09  MUM4-0.7Pro-1  0.08  MUM4-0.7Pro-2  0.07 0.06 0.05 0.04 0.03 0.02 0.01 0 3  7 MUM4  10  3  7  10  GUS  Figure 5-9 MUM41.2Pro::GUS and MUM40.7::GUS expression analysis. qPCR using RNA extracted from seed coats of MUM41.2Pro::GUS and MUM40.7Pro::GUS transgenic lines at three developmental stages (3, 7 and 10 DPA). GUS transcript level was determined relative to GAPC using four technical replicates. Expression level of MUM4 was measured as an internal control. 75  5.3.2 A FRAGMENT EXCLUDING 5’UTR, PUTATIVE TFBSS AND THE CLOSEST TATA BOX TO THE TSS RESTRICTS EXPRESSION OF THE REPORTER GENE TO THE SEED COAT To further analyze the MUM4 promoter, I designed and made a construct (MUM40.3Pro), to exclude all TFBSs, the closest TATA element to the TSS as well as putative core promoter, which is commonly located -70 to -40 bp upstream of TSS (Figure 5-10).  Figure 5-10 Schematic map of the MUM4 locus representing MUM40.3Pro constructs. The numbers indicate the nucleotide position relative to the annotated transcription start site of MUM4 (+1). 0.3 Kb label indicates approximate length of truncated promoter region.  I postulated that if the key element is located in this region of the MUM4 promoter, by fusing it to a minimal promoter and using it to drive expression of a reporter gene, the reporter gene should be up-regulated in the seed coat. However, I decided to first clone MUM40.3Pro upstream of promoterless GUS as a control to show that it had no promoter activity on its own.Twenty-two independent transgenic lines were chosen for analysis the GUS activity in seedlings and different tissues including, stems, inflorescences, and siliques with seeds at different developmental stages. In twelve transgenic lines, while the GUS expression was abolished in most tissues examined, strong GUS expression was visible in the seed coat at 7 and 10 DPA. These results indicate that this region of the MUM4 promoter is sufficient to express the reporter gene in a seed coat-specific manner. 76  In order to confirm the seed coat specificity of the MUM40.3Pro expression, I cloned the MUM40.3Pro regulatory region (from -407 to -100; including ATG in the reverse primer) in front of a promoterless Citrine YFP gene (Griesbeck et al., 2001) in the pAD binary vector (DeBono, 2011). I verified 10 T1 transgenic lines, however, the fluorescent signal was faint in seed coats. qPCR was used to measure the level of GUS transcript under the control of MUM40.3Pro. As shown in figure 5-11, mRNA levels of GUS in the seed coat of all three transgenic lines meas-  Relative expression level  ured was very low compared with the internal control (MUM4).  0.18  MUM4-0.3Pro-1  0.16  MUM4-0.3Pro-2  0.14  MUM4-0.3Pro-3  0.12 0.1 0.08 0.06 0.04 0.02 DPA  0 3  7 MUM4  10  3  7  10  GUS  Figure 5-11 MUM40.3::GUS expression analysis. qPCR using RNA extracted from the seed coat of MUM40.3Pro::GUS transgenic lines seed coats at three developmental stages (3, 7 and 10 DPA). GUS transcript level was determined relative to GAPC using three biological replicates and four technical replicates. Expression level of MUM4 was measured as an internal control.  5.3.3 IDENTIFICATION OF MUM4 TRANSCRIPTION START SITES BY 5′ RACE As mentioned before, to make MUM40.3::GUS construct, I excluded the predicted 5’UTR and core promoter (based on The Arabidopsis Information Resource (TAIR)'s SeqViewer tool; 77  http://www.arabidopsis.org). However, MUM40.3Pro was able to express the reporter gene in the seed coat. I postulated that the transcription start site might be different from the annotated one. In order to identify the MUM4 TSS, I performed 5′ Rapid Amplification of cDNA Ends (5’ RACE) on total RNA isolated from young leaves of Arabidopsis Col-2. Using reverse specific primers for the MUM4 gene optimized for 5’RACE, the first strand cDNA was synthesized. The cDNA was subjected to a tailing reaction. The tailed cDNA was then used for amplification by PCR using a nested gene specific primer. By running 5’RACE products in a 1% agarose gel, I found two distinct sizes of product (Figure 5-12). These products were excised and sequenced. Since the amount of the minor 5′ RACE product (~500 bp) was much lower compared to the major one (~300 bp), I was not able to get sequencing results for it.  Figure 5-12 The 5’RACE products of MUM4 using leaves RNA of Arabidopsis Col-2 as template. The products were run on a 1% agarose gel stained with gel-red. The numbers on the right represent the size of the DNA standards.  Considering the size of 5’RNA intron (209 bp; Figure 5-1), the minor bands may represent unspliced RNA. Comparing the sequence of MUM4 with the sequencing results (despite some  78  mismatches) suggests that the annotated transcription start site might be correct in the leaves of Arabidopsis Col-2 plants (Figure 5-13).  -seq -MUM4 -seq -MUM4  +1  AAAAAAAAGNGGAAAAAGAAAAGAGGAAAAGAAAAAAAGGGGGGANAGAAAANT 60 ---------------GAGTTTAATGTC-GGACGCTAGACTCACGAGAAATCCGTAATATCTAAG 48 * * ** * * * * * * * * * ** CCCCCCAAGGGAGGAAAAGGGGAGGGGGTGTTTGNTTTT----TCCCCCTTTGTTGT--- 113 ACGATCAAGGGTAAATTAGTCAA-----------TTTCCTCCTACGGTTCTCCGTAACTGTCTC 101 * ******* * * * * * ** * * * ***  -seq -MUM4  -GGGGGGGGGGGG---------GGGGGGGG------------GGAGACCGTAGATTCCCTCTTCTTCT 159 AGAATATAAGAGGCACATTGCTGAGAGAAGCTCCGTAGACCGTAGATTCCCTCTTCTTCT 161 * * * * * * * * *************************  -seq -MUM4  TCTTCCTCTTCCTCTCTACTGTTTTTTCTTTTCATATTTCTCTCTCTCTCTCTCTCTATA219 TCTTCCTCTTCCTCTCTACTGTTTTTTCTTTTCATATTTCTCTCTCTCTCTCTCTCTATA 221 *************************************************************  -seq -MUM4  GTTGGTGAAGTTTCTATCTTTATCTCTCTTAAGATCTCTTTCTCTCTTGGGTTATCTGAC 279 GTTGGTGAAGTTTCTATCTTTATCTCTCTTAAGATCTCTTTCTCTCTTGGGTTATCTGAC 281 ****************************************************************  -seq -MUM4  TCTAACCAGAATTGTGTCGATTTCAAGGATGGATGATACTACGTATAAGCCAAAGAACAT 339 TCTAACCAGAATTGTGTCGATTTCAAGGATGGATGATACTACGTATAAGCCAAAGAACAT 341 *******************************************************************  -seq -MUM4  TCTCATTACTGGAGCTGCTGGATTTATTGCTTCTCATGTTGCCAACAGATTAATCCGTAA 399 TCTCATTACTGGAGCTGCTGGATTTATTGCTTCTCATGTTGCCAACAGATTAATCCGTAA 401 ******************************************************************  -seq -MUM4  CTATCCTGATTACAAGATCGTTGTTCTTGACAAGCTTGATTACTGTTCAGATCTGAAGAA 459 CTATCCTGATTACAAGATCGTTGTTCTTGACAAGCTTGATTACTGTTCAGATCTGAAGAA 461 ************************************************************  -seq -MUM4  TCTTGATCCTTCTTTTTCTTCNCCAAATTTCAAGTTTGTCAAAGGAGATATCGCGAGTGA 519 TCTTGATCCTTCTTTTTCTTCACCAAATTTCAAGTTTGTCAAAGGAGATATCGCGAGTGA 521 ********************* **************************************  -seq -MUM4  TGATCTCGTTAACTNCCT-CTCATC---------------------------------------------------------------543 TGATCTCGTTAACTACCTTCTCATCACTGAAAACATTGATACGATAATGCATTTTGCTGC 581 ************** *** ******  -seq -MUM4  ------------------------------------------------------TCAAACTCATGTTGATAACTCTTTTGGTAATA 613  Figure 5-13 Nucleotide alignment of 5’ RACE product with the MUM4 sequence. (seq: sequencing results; MUM4: nucleotide sequence of MUM4 obtained from TAIR website). Alignment was carried out using ClustalW2; http://www.ebi.ac.uk/Tools/msa/clustalw2/. The annotated transcriptional start site showed with a red box (defined as +1) and annotated translational start codon showed in a black box. Red sequence represents 5’UTR. The underlined nucleotides indicate the sequence of the primer used for sequencing. The black arrow points to the 5’UTR intron which has been spliced.  79  5.3.4 TESTING IFTHE MUM4 FULL-LENGTH PROMOTER CONTAINS ALL THE REGULATORY ELEMENTS It was shown that three transcription factors APETALA2 (AP2), TRANSPARENT TESTA GLABRA1 (TTG1), and GLABRA2 (GL2) are required for MUM4 up-regulation (Western et al., 2004). To analyze the transcriptional activity of MUM41.5Pro, the transgenic line transformed with MUM41.5Pro::GUS construct was crossed to ap2, ttg1, and gl2 mutants. Since the seed coat is a maternal tissue, the mutants were used as maternal parents in crosses. I crossed two independent lines of MUM41.5Pro::GUS transformants to these mutants lines. The predicted result was expression of GUS in all tissues but lower expression in the seeds at 7 DPA. GUS expression was found in seedlings, roots, stems, leaves and seeds similar to MUM41.5Pro::GUS transgenic lines (data not shown). Since it was difficult to visualize any difference in GUS expression during seeds development, I measured the level of GUS transcript at 3, 7 and 10 developmental stages using qPCR (Figure 5-14). As is shown in figure 5-14, expression of MUM4 in Col-2 followed the expected pattern. However, the GUS and MUM4 in the transgenic lines showed a lot of variability and were not consistent with previous results. In gl2 X MUM41.5Pro::GUS-1, MUM4 is not up-regulated and the level of GUS transcript remains almost unaltered. However, in gl2 X MUM41.5Pro::GUS-2, MUM4 mRNA was increased at 7 DPA but expression of GUS at 3 and 7 DPA are similar but higher than 10 DPA. In addition, in two independent lines of ttg1 X MUM41.5Pro::GUS (Figure 5-14), both MUM4 and GUS showed a considerable up-regulation at 7 DPA. Furthermore, a similar pattern was observed in ap2 X MUM41.5Pro::GUS (Figure 5-14).  80  Relative expression level  0.08  WT  0.07  gl2XMUM41.5Pro::GUS-1  0.06  gl2XMUM41.5Pro::GUS-2  0.05 0.04 0.03 0.02 0.01 DPA  0 3  7  10  3  7  MUM4  10  GUS  WT ttg1XMUM41.5Pro::GUS-1 ttg1XMUM41.5Pro::GUS-2  Relative expression level  0.7 0.6 0.5 0.4 0.3 0.2 0.1 0  DPA 3  7  10  3  7  Relative expression level  MUM4  10  GUS  0.08 0.07 0.06 0.05 0.04 0.03 0.02 0.01 0  WT  ap2XMUM4-1.5Pro::GUS  DPA 3  7 MUM4  10  3  7  10  GUS  Figure 5-14 Expression analysis of GUS driven by MUM41.5Pro in gl2, ttg1 and ap2 background using qPCR. RNA was extracted from the seed coats at three developmental stages (3, 7 and 10 DPA). GUS transcript level was determined relative to GAPC using four technical replicates. Expression level of MUM4 was measured as an internal control. WT: wild type.  81  5.4 DISCUSSION 5.4.1 THE ACTIVITY OF MUM4 FULL-LENGTH PROMOTER IS CONSISTENT WITH THE EXPRESSION PATTERN OF MUM4 GENE IN PREVIOUS STUDIES Previous RT-PCR and microarray results (Western et al. 2004; Dean et al., 2011; respectively), have shown that MUM4 is expressed throughout all plant tissues and is up-regulated in the seed coat during mucilage biosynthesis. This dissertation describes the dissection of MUM4 promoter to find the cis-regulatory element responsible for this up-regulation. This was done by generating a series of truncated MUM4 promoter fragments fused to the GUS reporter gene. A MUM41.5Pro fragment can promote a similar pattern of transcription suggesting that all MUM4 promoter regulatory elements are located on this fragment.  5.4.2 MUM4 PROMOTER DELETION ANALYSIS REVEALED PRESENCE OF TWO FUNCTIONAL DOMAINS Many studies have described the enhancement effect of 5’UTR intron on gene expression. As mentioned before, in transgenic lines transformed with two different constructs that excluded the intron (MUM41.2Pro::GUS and MUM40.7Pro::GUS) , GUS activity was abolished or decreased in some tissues including roots, cotyledons, leaves and seeds at 3 DPA although expression in the inflorescence and seed coat remained relatively strong (Figure 5-4). These results suggest that while expression of the MUM4 promoter in some tissues is dependent on the 5’UTR intron, in the seed coat is not to the same extent, a hypothesis supported by the seed coat specific expression promoted by the MUM40.3Pro (see below). The second domain is MUM40.3Pro (-407 to -100) that drives the expression of GUS specifically in the seed coat (Figure 5-4). This result was unexpected since MUM40.3Pro does not 82  contain sequences from -1 to -99 that in many promoters include the core promoter sequences. The MUM4 TSS could be mis-annotated. Although my 5’ RACE supports the annotated position of the transcriptional start site, it is possible that the TSS is different in seeds and/or seed coat. Determination of the transcription start site of MUM40.3Pro::GUS RACE and/or minor start sites for the MUM4 gene itself might help to elucidate how and where MUM40.3Pro initiates transcription. MUM40.3Pro, similar to the DP1 promoter (Chapter 3) drives expression of a reporter gene specifically in the seed coat. To determine whether any similarity could be found in their sequences, I compared the sequences using Basic Local Alignment Search Tool (BLAST) on NCBI website (http://blast.ncbi.nlm.nih.gov/). However, no highly similar sequence was found. Both DP1 promoter (Chapter 3) and MUM40.3Pro drive expression of a reporter gene in the seed coat. Therefore, both of these seed coat specific promoters can be used in molecular genetic analysis as well as manipulating seed coat traits. Since MUM40.3Pro is shorter (307 bp) compared to the DP1 promoter (988 bp), MUM40.3Pro can be more practical compared to DP1 promoter in some cases (because it is shorter compared to DP1 promoter). DP1 drives expression of a reporter gene in the outer-integument of seed coat, however, I have not verified spatial expression of the reporter gene driven by MUM40.3Pro.  5.4.3 VARIABLE QRT-PCR RESULTS Throughout my thesis research, I experienced variability in qPCR results that were difficult to explain. In some cases, my q-PCR results were not consistent with the histochemical GUS assay. For instance, based on the histochemical GUS assay, seeds of MUM41.0Pro transgenic lines at 3 DPA, showed lower GUS expression than at 7 or 10 DPA (Figure 5-4 ), however, 83  qPCR results showed that GUS was expressed higher at 3 DPA. Another unexpected result was that while it has been demonstrated that MUM4 expression is regulated by AP2, TTG1 and GL2 in the silique and seed coat (Western et al., 2004; Dean et al., 2011), my qPCR results measuring the level of GUS transcript driven by MUM4 full-length promoter (MUM41.5Pro) or for MUM4 itself in the ap2, ttg1 and gl2 mutant did not show this effect. Although qPCR is an accurate quantitative method for measuring the transcript level of a gene, many factors affect the efficiency of this method and may cause variable results. Variation in RNA quality and quantity, reverse transcription reaction efficiency, cDNA sample loading variation and pipeting errors are some of the most common factors. RNA integrity is especially important when the samples have been obtained from different individuals and different developmental stages. In all experiments, seed coat RNA was used as template. Since the amount of collected tissue for each developmental stage was extremely limited, the quality and quantity of isolated RNA may have been affected. I attempted to minimize variation by normalizing the amount of RNA used for each reaction. Furthermore, cDNA synthesis was done using the same conditions and the efficiency of the primers was verified before using in qPCR. However, given the variable nature of my qPCR results throughout this thesis and the differences with published results (see below), these experiments need to be repeated.  84  CHAPTER 6: CONCLUSION AND FUTURE DIRECTIONS This dissertation described the development of an experimental tool to simplify the studies of plant cell wall polysaccharides, especially pectins. Because of their complexity and critical roles in plant growth and development, studying the biosynthesis, modification, and organization of pectins in the plant cell wall is challenging. I employed Arabidopsis seed coat epidermal cells as a model system to investigate the effect of pectin manipulation in the mucilage without detrimental effects to the rest of the plant. In my M.Sc. research project, I focused on three major objectives: 1- To Identify and analyze a promoter specific to the Arabidopsis seed coat. 2- To verify the ability of the seed coat specific promoter to express carbohydrate active enzymes specifically in the seed coat. 3- To identify the putative cis-regulatory element responsible for up-regulation of MUM4 gene in the seed coat. Research described in chapter 3 indicates that promoter of DIRIGENT PROTEIN1 (DP1) is a unique seed coat specific promoter which drives the expression of reporter genes in the epidermal and palisade layers during the period of mucilage biosynthesis and secretion. I also showed that DP1 promoter (DP1Pro) is active in Brassica napus and results in a pattern of expression similar to that in Arabidopsis. Therefore, in addition to its application in addressing questions concerning seed coat structure and function, DP1Pro can be used in the manipulation of seed coat properties as well as the expression of valuable recombinant proteins in the seed coat of economically important Brassica crops. As the first step toward such research, I investigated the ability of DP1Pro to promote the expression of an enzyme-coding 85  gene (ADPG2 encoding a PG) in the Arabidopsis seed coat (Chapter 4). Although RT-PCR results showed that ADPG2 was expressed under the control of the DP1Pro, ADPG2 protein was not detected. For immunoblotting, I used protein extracted from siliques. Considering the fact that the activity of DP1Pro is restricted to two layers of the seed coat, the inclusion of the embryo and silique wall might have decreased the percentage of ADPG2 in the total amount of extracted protein to the point where it was undetectable with the antibody. Extracting protein from the seed coat at 7 DPA may be required to investigate the presence of the protein in the seed coat. Furthermore, using more than one myc-tag at the C-terminus of ADPG2 (as in the positive control) may be necessary to detect it in the seed coat. Deletion analysis of the MUM4 promoter to identify the putative cis-regulatory element responsible for MUM4 up-regulation in the seed coat led to the identification of a seed coatspecific promoter (Chapter 5). I found that a small fragment of MUM4 full length promoter (MUM40.3Pro; -407 to -100) which does not contain sequences that in many promoters include the core promoter, is able to drive expression of the GUS reporter gene specifically in the seed coat. There are several points that remained to be addressed: 1- Spatial expression of MUM40.3Pro::GUS: embedding GUS stained seeds of the MUM40.3Pro::GUS transgenic lines in resin and sectioning them will demonstrate spatial expression of MUM40.3Pro::GUS within the seed coat. 2- Determination of the TSS: to address this point, I performed 5’RACE using RNA isolated from Col-2 leaves. Since the determined TSS was the same as annotated one, 5’RACE using siliques and/or seed coat RNA as template might help to determine transcription initiation site.  86  3- Variable qPCR results: for qPCR experiments, seed coat RNA was used. Considering that the amount of tissue for each developmental stage is limited, RNA quantity will be low and any small contamination will significantly affect RNA integrity and the experiments in which the RNA is used. Using RNA isolated from siliques may help to get more reproducible results.  87  BIBLIOGRAPHY Abbott, D.W., Boraston, A.B. (2008) Structural biology of pectin degradation by Enterobacteriaceae. Microbiol. Mol. Biol. Rev. 72: 301-316. Arsovski, A.A., Popma, T.M., Haughn, G.W., Carpita, N.C., McCann, M.C., Western, T.L. (2009) AtBXL1 encodes a bifunctional beta-D-xylosidase/alpha-L-arabinofuranosidase required for pectic arabinan modification in Arabidopsis mucilage secretory cells. Plant Physiol. 150: 12191234. Asano, J., Chiba, K., Tada, M., Yoshii, T. (1996) Antiviral activity of lignans and their glysosides from Justicia procumbens. Phytochemistry. 42: 713–717. Atkinson, R.G., Schröder, R., Hallett, I.C., Cohen, D., MacRae, E.A. (2002) Overexpression of polygalacturonase in transgenic apple trees leads to a range of novel phenotypes involving changes in cell adhesion. Plant Physiol. 129: 122-133. Batchelor, A.K., Boutilier, K., Miller, S.S., Labbe, H., Bowman, L., Hu, M., Johnson, D.A., Gijzen, M., Miki, B.L. (2000) The seed coat-specific expression of a subtilisin-like gene, SCS1, from soybean. Planta 211: 484-492. Blake, A.W., McCartney, L., Flint, J.E., Bolam, D.N., Boraston, A.B., Gilbert, H.J., Knox, J.P. (2006) Understanding the biological rationale for the diversity of cellulose-directed carbohydrate binding modules in prokaryotic enzymes. J. Biol. Chem. 281: 29321-29329. Boudart, G., Jamet, E., Rossignol, M., Lafitte, C., Borderies, G., Jauneau, A., Esquerré-Tugayé, M.T., Pont-Lezica, R. (2005) Cell wall protein in apoplastic fluids of Arabidopsis rossets: identification by mass spectrometry and bioinformatics. Proteomics. 5: 212-221. Bouton, S., Leboeuf, E., Mouille, G., Leydecker, M.T., Talbotec, J., Granier, F., Lahaye, M., Höfte, H., Truong, H.N. (2002) QUASIMODO1 encodes a putative membrane-bound glycosyltransferase required for normal pectin synthesis and cell adhesion in Arabidopsis. Plant Cell. 14: 2577-2590. Burlat, V., Kwon, M., Davin, L.B., Lewis, N.G. (2001) Dirigent proteins and dirigent sites in lignifying tissues. Phytochemistry. 57: 883-897. Caffall, K.H., Mohnen, D. (2009) The structure, function, and biosynthesis of plant cell wall pectic polysaccharides. Carbohydr. Res. 344: 1879-1900. Cenik, C., Derti, A., Mellor, J.C., Berriz, G.F., Roth, F.P. (2010) Genome-wide functional analysis of human 5' untranslated region introns. Genome Biol. 11: R29. 88  Chung, B.Y., Simons, C., Firth, A.E., Brown, C.M., Hellens, R.P. (2006) Effect of 5'UTR introns on gene expression in Arabidopsis thaliana. BMC Genomics. 7: 120. Davin, L.B., Lewis, N.G. (2005) Dirigent phenoxy radical coupling: advances and challenges. Curr. Opin. Biotechnol. 16: 398-406. Day, S.H., Chiu, N.Y., Won, S.J., Lin, C.N. (1999) Cytotoxic lignans of Justicia ciliata. J. Nat. Prod. 62: 1056–1058. Dean, G.H., Cao, Y., Xiang, D., Provart, N.J., Ramsay, L., Ahad, A., White, R., Selvaraj, G., Datla, R., Haughn, G.W. (2011) Analysis of gene expression pattern during seed coat development in Arabiopsis. Mol. Plant. 4: 1074-1091. Dean, G.H., Zheng, H., Tewari, J., Huang, J., Young, D.S., Hwang, Y.T., Western, T.L., Carpita, N.C., McCann, M.C., Mansfield, S.D., Haughn, G.W. (2007) The Arabidopsis MUM2 gene encodes a beta-galactosidase required for the production of seed coat mucilage with correct hydration properties. Plant Cell. 19: 4007-4021. Debeaujon, I., Nesi, N., Perez, P., Devic, M., Grandjean, O., Caboche, M., Lepiniec, L. (2003) Proanthocyanidin-accumulating cells in Arabidopsis testa: regulation of differentiation and role in seed development. Plant Cell 15: 2514-2531. DeBono, A.G. (2011) The role and behavior of Arabidopsis thaliana lipid transfer proteins during cuticular wax deposition. Dissertation, University of British Columbia. DeBono, A., Yeats, T.H., Rose, J.K., Bird, D., Jetter, R., Kunst, L., Samuels, L. (2009) Arabidopsis LTPG is a glycosylphosphatidylinositol-anchored lipid transfer protein required for export of lipids to the plant surface. Plant Cell. 21: 1230-1238. Derbyshire, P., McCann, M.C., Roberts, K. (2007) Restricted cell elongation in Arabidopsis hypocotyls is associated with a reduced average pectin esterification level. BMC Plant Biol. 7: 31. Devic, M., Guilleminot, J., Debeaujon, I., Bechtold, N., Bensaude, E., Koornneef, M., Pelletier, G., Delseny, M. (1999) The BANYULS gene encodes a DFR-like protein and is a marker of early seed coat development. Plant J. 19:387-398. Doong, R.L., Mohnen, D. (1998) Solubilization and characterization of a galacturonyltransferase that synthesizes the pectic polysaccharide homogalacturonan. Plant J. 13: 363-374. El-Mezawy, A., Wu, L., Shah, S. (2009) A seed coat-specific promoter for canola. Biotechnol. Lett. 31: 1961-1965.  89  Freshour, G., Clay, R.P., Fuller, M.S., Albersheim, P., Darvill, A.G., Hahn, M.G. (1996) Developmental and tissue-specific structural alterations of the cell-wall polysaccharides of Arabidopsis thaliana roots. Plant Physiol. 110: 1413-1429. Geldner, N., Anders, N., Wolters, H., Keicher, J., Kornberger, W., Muller, P., Delbarre, A., Ueda, T., Nakano, A., Jürgens, G. (2003) The Arabidopsis GNOM ARF-GEF mediates endosomal recycling, auxin transport, and auxin-dependent plant growth. Cell. 112: 219-230. Gonzalez, A., Mendenhall, J., Huo, Y., Lloyd, A. (2009) TTG1 complex MYBs, MYB5 and TT2, control outer seed coat differentiation. Dev. Biol. 325: 412-421. Hall, Q., Cannon, M.C. (2002) The cell wall hydroxyproline-rich glycoprotein RSH is essential for normal embryo development in Arabidopsis. Plant Cell. 14: 1161-1172. Harholt, J., Suttangkakul, A., Scheller, H.V. (2010) Biosynthesis of pectins. Plant Physiol. 153: 384-395. Harpaz-Saad, S., McFarlane, H.E., Xu, S., Divi, U.K., Forward, B., Western, T.L., Kieber, J.J. (2011) Cellulose synthesis via the FEI2 RLK/SOS5 pathway and cellulose synthase 5 is required for the structure of seed coat mucilage in Arabidopsis. Plant J. 68: 941-953. Harper, A., Kerr, D.J., Gescher, A., Chipman, J.K. (1999) Antioxidant effects of isoflavonoids and lignans, and protection against DNA oxidation. Free Radic. Res. 31: 149–160. Haughn, G.W., Western, T.L. (2012) Arabidopsis seed coat mucilage is a specialized cell wall that can be used as a model for genetic analysis of plant cell wall structure and function. Front. Plant Sci. 3: 64. Haughn, G.W., Chaudhury, A. (2005) Genetic analysis of seed coat development in Arabidopsis. Trends Plant Sci. 10: 472-477. Haughn, G.W., Somerville, C. (1986) Sulfonylurea-resistant mutants of Arabidopsis thaliana. Mol. Gen. Genet. 204: 430-434. Heintzman, N.D., Ren, B. (2007) The gateway to transcription: identifying, characterizing and understanding promoters in the eukaryotic genome. Cell. Mol. Life Sci. 64: 386-400. Hong, X., Scofield, D.G., Lynch, M. (2006) Intron size, abundance, and distribution within untranslated regions of genes. Mol. Biol. Evol. 23: 2392-2404. Ishii, T., Ono, H. (1999) NMR spectroscopic analysis of the borate diol esters of methyl apiofuranosoide. Carbohydrate Research. 321: 257-260.  90  Ishii, T. (1997) O-acetylateed oligosaccharides from pectin of potato tuber cell wall. Plant Physiol. 113: 111-127. Jackson, C.L., Dreaden, T.M., Theobald, L.K., Tran, N.M., Beal, T.L., Eid, M., Gao, M.Y., Shirley, R.B., Stoffel, M.T., Kumar, M.V., Mohnen, D. (2007) Pectin induces apoptosis in human prostate cancer cells: correlation of apoptotic function with pectin structure. Glycobiology. 17: 805819. Jefferson, R.A., Kavanagh, T.A., Bevan, M.W. (1987) GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO. J. 6: 3901-3907. Jofuku, K.D., den Boer, B.G., Van Montagu, M., Okamuro, J.K. (1994) Control of Arabidopsis flower and seed development by the homeotic gene APETALA2. Plant Cell. 6: 1211–1225. Kaneda, M., Schuetz, M., Lin, B.S., Chanis, C., Hamberger, B., Western, T.L., Ehlting, J., Samuels, A.L. (2011) ABC transporters coordinately expressed during lignification of Arabidopsis stems include a set of ABCBs associated with auxin transport. J. Exp. Bot. 6: 2063-2077. Liang, M., Davis, E., Gardner, D., Cai, X., Wu, Y. (2006) Involvement of AtLAC15 in lignin synthesis in seeds and in root elongation of Arabidopsis. Planta. 224: 1185-1196. Liepman, A.H., Wightman, R., Geshi, N., Turner, S.R., Scheller, H.V. (2010) Arabidopsis - a powerful model system for plant cell wall research. Plant J. 61: 1107-1121. Macquet, A., Ralet, M.C., Kronenberger, J., Marion-Poll, A., North, H.M. (2007) In situ, chemical and macromolecular study of the composition of Arabidopsis thaliana seed coat mucilage. Plant Cell Physiol. 48: 984-999. Mascarenhas, D., Mettler, I.J., Pierce, D.A., Lowe, H.W. (1990) Intron-mediated enhancement of heterologous gene expression in maize. Plant Mol. Biol. 15: 913-920. Matsuda, F., Hirai, M.Y., Sasaki, E., Akiyama, K., Yonekura-Sakakibara, K., Provart, N.J., Sakurai, T., Shimada, Y., Saito, K. (2010) AtMetExpress development: a phytochemical atlas of Arabidopsis development. Plant Physiol. 152: 566-578. Mendu, V., Griffiths, J.S., Persson, S., Stork, J., Downie, A.B., Voiniciuc, C., Haughn, G.W., DeBolt, S. (2011) Subfunctionalization of cellulose synthases in seed coat epidermal cells mediates secondary radial wall synthesis and mucilage attachment. Plant Physiol. 157: 441-453. Mohnen, D. (2008) Pectin structure and biosynthesis. Curr. Opin. Plant Biol. 11: 266-277. Moloney, M.M., Walker, J.M., Sharma, K.K. (1989) High efficiency transformation of Brassica napus using Agrobacterium vectors. Plant Cell Rep. 8: 238-242. 91  Mouille, G., Ralet, M.C., Cavelier, C., Eland, C., Effroy, D., Hématy, K., McCartney, L., Truong, H.N., Gaudon, V., Thibault, J.F., Marchant, A., Höfte, H. (2007) Homogalacturonan synthesis in Arabidopsis thaliana requires a Golgi-localized protein with a putative methyltransferase domain. Plant J. 50: 605-614. Nakaune, S., Yamada, K., Kondo, M., Kato, T., Tabata, S., Nishimura, M., Hara-Nishimura, I. (2005) A vacuolar processing enzyme, δVPE, is involved in seed coat formation at the early stage of seed development. Plant Cell. 17: 876-887. Naran, R., Chen, G., Carpita, N.C. (2008) Novel rhamnogalacturonan I and arabinoxylan polysaccharides of flax seed mucilage. Plant Physiol. 148: 132-141. Nesi, N., Jond, C., Debeaujon, I., Caboche, M., Lepiniec, L. (2001) The Arabidopsis TT2 gene encodes an R2R3 MYB domain protein that acts as a key determinant for proanthocyanidin accumulation in developing seed. Plant Cell. 13: 2099-2114. Nicol, F., His, I., Jauneau, A., Vernhettes, S., Canut, H., Höfte, H. (1998) A plasma membrane– bound putative endo-1,4-b-D-glucanase is required for normal wall assembly and cell elongation in Arabidopsis. EMBO. J. 17: 5563-5576. Nitao, J.K., Nair, M.G., Thorogood, D.L., Johnson, K.S., Scriber, J.M. (1991) Bioactive neolignans from the leaves of Magnolia virginiana. Phytochemistry. 30: 2193–2195. Ogawa, M., Kay, P., Wilson, S., Swaina, S.M. (2009) ARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE1 (ADPG1), ADPG2, and QUARTET2 are polygalacturonases required for cell separation during reproductive development in Arabidopsis. Plant Cell. 21: 216–233. O'Neill, M.A., Ishii, T., Albersheim, P., Darvill, A.G. (2004) Rhamnogalacturonan II: structure and function of a borate cross-linked cell wall pectic polysaccharide. Annu. Rev. Plant Biol. 55: 109-139. O'Neill, M.A., Eberhard, S., Albersheim, P., Darvill, A.G. (2001) Requirement of borate crosslinking of cell wall rhamnogalacturonan II for Arabidopsis growth. Science 294: 846-849. Pattathil, S., Avci, U., Baldwin, D., Swennes, A.G., McGill, J.A., Popper, Z., Bootten, T., Albert, A., Davis, R.H., Chennareddy, C., Dong, R., O'Shea, B., Rossi, R., Leoff, C., Freshour, G., Narra, R., O'Neil, M., York, W.S., Hahn, M.G. (2010) A comprehensive toolkit of plant cell wall glycandirected monoclonal antibodies. Plant Physiol. 153: 514-525. Penfield, S., Meissner, R.C., Shoue, D.A., Carpita, N.C., Bevan, M.W. (2001) MYB61 is required for mucilage deposition and extrusion in the Arabidopsis seed coat. Plant Cell. 13: 2777–2791.  92  Pienta, K.J., Naik, H., Akhtar, A., Yamazaki, K., Replogle, T.S., Lehr, J., Donat, T.L., Tait, L., Hogan, V., Raz, A. (1995) Inhibition of spontaneous metastasis in a rat prostate cancer model by oral administration of modified citrus pectin. J. Natl. Cancer Inst. 87: 348-353. Proper, Z.A. (2008) Evolution and diversity of green plant cell walls. Curr. Opin. Plant Biol. 11: 286-292. Ralet, M.C., Crépeau, M.J., Lefèbvre, J., Mouille, G., Höfte, H, Thibault, J.F. (2008) Reduced number of homogalacturonan domains in pectins of an Arabidopsis mutant enhances the flexibility of the polymer. Biomacromolecules. 9: 1454–1460. Ridley, B.L., O’Neill, M.A., Mohnen, D. (2001) Pectins: structure, biosynthesis, and oligogalacturonide-related signaling. Phytochemistry. 57: 929-967. Roppolo, D., De Rybel, B., Tendon, V.D.,Pfister, A., Alassimone, J., Vermeer, J.E., Yamazaki, M., Stierhof, Y.D., Beeckman, T., Geldner, N. (2011) A novel protein family mediates Casparian strip formation in the endodermis. Nature. 473: 380-383. Rose, J.K., Hadfield, K.A., Labavitch, J.M., Bennett, A.B. (1998) Temporal sequence of cell wall disassembly in rapidly ripening melon fruit. Plant Physiol. 117: 345-361. Ryden, P., Sugimoto-Shirasu, K., Smith, A.C., Findlay, K., Reiter, W.D., McCann, M.C. (2003) Tensile properties of Arabidopsis cell walls depend on both a xyloglucan cross-linked microfibrillar network and rhamnogalacturonan II-borate complexes. Plant Physiol. 132: 1033-1040. Scheller, H.V., Ulvoskov, P. (2010) Hemicelluloses. Annu. Rev. Plant Biol. 61: 263-289. Somerville, C.R. (2006) Cellulose synthesis in higher plants. Annu. Rev. Cell Dev. Biol. 22: 53– 78. Stamatoyannopoulos, J.A. (2010) Illuminating eukaryotic transcription start sites. Nat. Methods. 7: 501-503. Sticklen, M. B. (2008) Plant genetic engineering for biofuel production: towards affordable cellulosic ethanol. Nat. Rev. Genet. 9: 433-443. Sullivan, S., Ralet, M.C., Berger, A., Diatloff, E., Bischoff, V., Gonneau, M., Marion-Poll, A., North, H.M. (2011) CESA5 is required for the synthesis of cellulose with a role in structuring the adherent mucilage of Arabidopsis seeds. Plant Physiol. 156: 1725-1739. Taiz, L., Zeiger, E. (2006) Plant Physiology. Sinauer Associates, Inc. 349-375.  93  Tiwari, S., Spielman, M., Day, R.C., Scott, R.J. (2006) Proliferative phase endosperm promoters from Arabidopsis thaliana. Plant Biotechnol. J. 4: 393-407. Vorwerk, S., Somerville, S., Somerville, C. (2004) The role of plant cell wall polysaccharide composition in disease resistance. Trends Plant Sci. 9: 203-209. Wan, L., Xia, Q., Qiu, X., Selvaraj, G. (2002) Early stages of seed development in Brassica napus: a seed coat-specific cysteine proteinase associated with programmed cell death of the inner integument. Plant J. 30: 1-10. Western, T.L. (2012). The sticky tale of seed coat mucilages: production, genetics, and role in seed germination and dispersal. Seed Sci. Res. 22: 1-25. Western, T.L., Young, D.S., Dean, G.H., Tan, W.L., Samuels, A.L., Haughn, G.W. (2004) MUCILAGEMODIFIED4 encodes a putative pectin biosynthetic enzyme developmentally regulated by APETALA2, TRANSPARENT TESTA GLABRA1, and GLABRA2 in the Arabidopsis seed coat. Plant Physiol. 134: 296-306. Western, T.L., Skinner, D.J., Haughn, G.W. (2000) Differentiation of mucilage secretory cells of the Arabidopsis seed coat. Plant Physiol. 122: 345-355. Willats, W.G., McCartney, L., Knox, J.P. (2001) In-situ analysis of pectic polysaccharides in seed mucilage and at the root surface of Arabidopsis thaliana. Planta. 213: 37-44. Willats, W.G., Knox, J.P. (1996) A role for arabinogalactan-proteins in plant cell expansion: evidence from studies on the interaction of beta-glucosyl Yariv reagent with seedlings of Arabidopsis thaliana. Plant J. 9: 919-925. Windsor, J.B., Symonds, V.V., Mendenhall, J., Lloyd, A.M. (2000) Arabidopsis seed coat development: morphological differentiation of the outer integument. Plant J. 22: 483-493. Winter, D., Vinegar, B., Nahal, H., Ammar, R., Wilson, G.V., Provart, N.J. (2007) An “electronic fluorescent pictograph” browser for exploring and analyzing large-scale biological data sets. PLoS ONE. 8: e718. Wolf, S., Mouille, G., Pelloux, J. (2009) Homogalacturonan methyl-esterification and plant development. Molecular Plant. 2: 851-860. Wong, D. (2008) Enzymatic deconstruction of backbone structures of the ramified regions in pectins. Protein J. 27: 30-42. Wu, L., El-Mezawy, A., Shah, S. (2011) A seed coat outer integument-specific promoter for Brassica napus. Plant Cell Rep. 30: 75-80. 94  Young, R.E., McFarlane, H.E., Hahn, M.G., Western, T.L., Haughn, G.W., Samuels, A.L. (2008) Analysis of the Golgi apparatus in Arabidopsis seed coat cells during polarized secretion of pectin-rich mucilage. Plant Cell. 20: 1623-1638. Zandleven, J., Sørensen, S.O., Harholt, J., Beldman, G., Schols, H.A., Scheller, H.V., Voragen, A.J. (2007) Xylogalacturonan exists in cell walls from various tissues of Arabidopsis thaliana. Phytochemistry. 68: 1219-1226. Zhang, M.Q. (2007) Computational analyses of eukaryotic promoters. BMC Bioinformatics. 8: S3. Zhang, F., Gonzalez, A., Zhao, M., Payne, C.T., Lloyd, A. (2003) A network of redundant bHLH proteins functions in all TTG1-dependent pathways of Arabidopsis. Development. 130: 48594869. Zhao, J., Wang, J., An, L., Doerge, R.W., Chen, Z.J., Grau, C.R., Meng, J., Osborn, T.C. (2007) Analysis of gene expression profiles in response to Sclerotinia sclerotiorum in Brassica napus. Planta. 227: 13-24. Zuo, J., Niu, Q.W., Nishizawa, N., Wu, Y., Kost, B., Chua, N.H. (2000) KORRIGAN, an Arabidopsis endo-1,4-beta-glucanase, localizes to the cell plate by polarized targeting and is essential for cytokinesis. Plant Cell. 12: 1137-1152.  95  APPENDIX Appendix: Complete list of primers used for gene cloning, RT-PCR and qPCR in Chapter 3. Gene At1g02720  At1g09550  At1g62070  At2g23550  Primer name  Sequence  RT-P1  CCCCAACAAAACTCCGATTACTC  RT-P2  TTGGGGAAAGTAGAACGAATCAG  Pro-F  GAAGAGAATTAATGAATTATGGTTTA  Pro-R  AAAATAAAGCATCCGTCTTGGTCTTTTG  RT-P3  GTATCTTGTCTCTCCGCTTGAC  RT-P4  GTTTAGCCCCACCATCTGC  RT-F  CCTTGGCCTTGAGCGTGAGG  RT-R  CACATAGAAAGTAGCATTTC  Pro-F  RT-F  GGGGACAAGTTTGTACAAAAAAGCAGGCTCCGCCAATGTTCTCTAAGCCTCA (Gateway) GGGGACCACTTTGTACAAGAAAGCTGGGTCCACACAGTGACCTGCAACCT (Gateway) GAAGTAATGGAGATCAAATGTG  RT-R  CTACTTCTCTGTGTAATACAG  Pro-F  RT-P1  GGGGACAAGTTTGTACAAAAAAGCAGGCTCCGGCGTTGGGAAACATCTAAA (Gateway) GGGGACCACTTTGTACAAGAAAGCTGGGTCTGTGTTTGGAATCTTGTGATTTG (Gateway) CACACACTCCAAACGACAATTCT  RT-P2  GAAACCACCCGACCAAGGAGA  Pro-F  ATCTGCAGTCCAAAGCTCACTAAGGACTTG  Pro-R  ATCCCGGGTGACTGCCTCAGGACTCAAA  RT-F  CGAAGAAGATCTACACAGGAG  RT-R  CCTATCGATCTCTCTTTCGTC  Pro-F  RT-F  GGGGACAAGTTTGTACAAAAAAGCAGGCTCCCATGCTCTGAAATCGAGTCAC(Gateway) GGGGACCACTTTGTACAAGAAAGCTGGGTCAACGAGTTCCGACAAGACCT way) GCAAGCTCGTGCACGAGAGG  RT-R  GTGTCACGGTGGATTAGCAG  RT-F  GGCAGCGACCAATTCTGAATGG  RT-R  CTGACCTTTAATTTCATTGTG  Pro-R  At2g43050  Pro-R  At2g47750  At3g14630  Pro-R  At3g14760  (Gate-  96  At3g52550  Pro-F  RT-F  GGGGACAAGTTTGTACAAAAAAGCAGGCTCCTGTCCGATTGATCATCTGAAGT (Gateway) GGGGACCACTTTGTACAAGAAAGCTGGGTCGGGTTTTGGTGACAAGAAGG (Gateway) GATGAGGAACAAGGATTCATGC  RT-R  CAATCATTCTAGACGTAACTCG  Pro-F1  Pro-F2  GGGGACAAGTTTGTACAAAAAAGCAGGCTCCCTTTGCGGTTTCCTAACCAG (Gateway) GGGGACCACTTTGTACAAGAAAGCTGGGTCACCGTCGTAGGCGATGTTAT (Gateway) ATCTGCAGCTTTTCTGGGAAGCTCGTTG  Pro-R2  ATGGATCCCGCACAAAATTGGTTTGTTG  Pro-F3  ATTCTCGAGCTTTTCTGGGAAGCTCGTTGT  Pro-R3  ATCTGCAGTGTCATTGTTAGAGTGTTAAGT  RT-F  CCAGAGATCTATCGATCGTTG  RT-R  CTGCCAACACACGAAGATCAA  qRT-F  CCTGTGACACTGGACCAGAA  qRT-R  ATGTAGCGATCCCACGAGTC  RT-F  CTTAGCCTTAACGACATGATC  RT-R RT-F RT-R RT-F RT-R Pro-F Pro-R RT-F RT-R RT-F & qRT-F RT-R & qRT-R qRT-F qRT-R  CTTGATCCGACGTGAACAATCC CGGAGTGAAGTCTGGTGAAAG GCTCTATACATAACTACAAGTG CAGAGATCCTTGTCCTTGTCG GGGTTTGACCCGAACACAGTG ACTATCATCAACTTCATTACGTAC AGTGGACAGAAGAGGAATGTTGG CAAACTATCAGGAACAATCCC CGGAGCAAGACCCTCCAATTTC TCAGACTCGAGAAAGCTGCTAC GATCAAGTCGACCACACGG ACAGCCAAAAGCCAGACAGA TGACGACCAAAGCCAGTAAA  Pro-R  At4g11180a  Pro-R1 At4g11180b  At4g11180c  At4g11180  At4g37520 At5g07200 At5g39130 At5g45770  GAPC GUS  Pro: Primers used for promoter cloning RT: Primers used for RT-PCR qRT: Primers used for qRT-PCR  97  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0073116/manifest

Comment

Related Items