UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Regulation of the PhoP-PhoQ two-component system in Pseudomonas aeruginosa and its role in virulence Gellatly, Shaan Lae 2012

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2012_fall_gellatly_shaan.pdf [ 3.21MB ]
Metadata
JSON: 24-1.0073032.json
JSON-LD: 24-1.0073032-ld.json
RDF/XML (Pretty): 24-1.0073032-rdf.xml
RDF/JSON: 24-1.0073032-rdf.json
Turtle: 24-1.0073032-turtle.txt
N-Triples: 24-1.0073032-rdf-ntriples.txt
Original Record: 24-1.0073032-source.json
Full Text
24-1.0073032-fulltext.txt
Citation
24-1.0073032.ris

Full Text

REGULATION OF THE PHOP-PHOQ TWO-COMPONENT SYSTEM IN PSEUDOMONAS AERUGINOSA AND ITS ROLE IN VIRULENCE  by  Shaan Lae Gellatly  B.Sc. University of Victoria (2005)  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE STUDIES (Microbiology and Immunology)  THE UNIVERSITY OF BRITISH COLUMBIA  (Vancouver)  August, 2012  © Shaan Lae Gellatly, 2012  Abstract Pseudomonas aeruginosa is an opportunistic bacterial pathogen that can cause severe infections in individuals with underlying medical conditions. P. aeruginosa primarily infects at epithelial surfaces where it interacts initially via type IV pili, flagella and LPS. Two component regulatory systems control many aspects of pseudomonal physiology and mediate adaptation to environmental changes including those that occur in the host. This thesis outlines the contributions of these systems to the cytotoxicity to epithelial cells and sheds light on the regulation mediated by the two-component sensor PhoQ. Systems that contributed to cytotoxicity fell into several themes including motility, cyclic-di-GMP regulation, and carbon and nitrogen utilization. Several genes controlled by PhoQ were shown to be dysregulated during infection of lung epithelial cells, including upregulation of oprH-phoP-phoQ, the lipid A modification gene arnB, and downregulation of a lipid A deacylase, pagL. Consistent with this, lipid A from a phoQ mutant grown in varying magnesium concentrations displayed alterations. LPS of the phoQ mutant revealed increased inflammatory properties as demonstrated by increased secretion of the cytokines IL6, TNF , and IL10 from PBMCs. The decrease in cytotoxicity of a phoQ mutant correlated with a decrease in secretion of lipases and proteases when co-incubated with cultured epithelial cells. These results suggest that the PhoP-PhoQ system might adapt the bacterium to lung epithelia and that this might contribute to and be exacerbated by the selective pressure of inhaled polymyxin therapeutics. Unlike most sensor kinases that phosphorylate their cognate response regulators, PhoQ of P. aeruginosa appears to act only as a phosphatase of its cognate regulator PhoP. Here it was demonstrated that PhoP was not activated by PhoQ in a luminescence reporter screen. The sensor kinase, RoxS, involved in regulation of the cyanide insensitive oxidase, was revealed as a candidate phosphodonor to PhoP. Since mutation of roxS was able to reduce but not eliminate expression from the oprH-phoP-phoQ operon, it is conceivable that other sensors contribute to PhoP phosphorylation. It was also demonstrated that PhoP contributed to the known polymyxin resistance of a phoQ mutant but only partially to cytotoxicity. These results emphasize the complexity of the PhoP-PhoQ regulatory system.  ii  Preface Chapter 2 A portion (~10%) of the cytotoxicity screen in this chapter was performed by undergraduate student Patrick Taylor under my guidance.  One gene analyzed in the cytotoxicity screen was included in the following publication: J.B. McPhee, S. Tamber, M. Bains, E. Maier, S. Gellatly, A. Lo, R. Benz, and R.E.W. Hancock (2009) The major outer membrane protein OprG of Pseudomonas aeruginosa contributes to cytotoxicity and forms an anaerobically regulated, cation-selective channel. FEMS Microbiol. Lett. 296: 241-247. I performed the cytotoxicity experiment for this paper and only this data has been included in this thesis.  The lon mutant cytotoxicity data observed the PAO1 screen has been included in a the following manuscript that has been submitted for peer review: E.B.M. Breidenstein, J. Overhage, I. Kukavica-Ibrulj, S.L. Gellatly, P.K. Taylor, R.C. Levesque, and R.E.W. Hancock. The Lon protease of Pseudomonas aeruginosa is important for in vitro and in vivo virulence. I performed the cytotoxicity experiment for this paper and this result is included in this thesis but is not discussed.  The cytotoxicity screen is being prepared as the following manuscript: S.L. Gellatly, E.B.M. Breidenstein, J. Strehmel, P.K. Taylor, J. Overhage, R.E.W. Hancock. Novel role of twocomponent regulatory systems in cytotoxicity and virulence-related properties in Pseudomonas aeruginosa. Motility and biofilm phenotypes of the FleS-FleR system were initially analyzed by Elena Breidenstein and confirmed by me as demonstrated here. Microscopy of biofilms formed by fleR and fleS mutants, and an assay demonstrating decreased virulence of pilH, pilG, and pilR mutants to amoebae were performed by Janine Strehmel in Dr. Joerg Overhage’s lab at the Karlsruhe Institute of Technology in Germany and are not included in this thesis.  Chapter 3 Much of the PhoP-PhoQ data in Chapter 3 were included in the publication, Gooderham, W.J.; Gellatly, S.L.; Sanschargrin, F.; McPhee, J.B.; Bains, M.; Cosseau, C.; Levesque, R.C.; and iii  Hancock, R.E.W. (2009) The sensor kinase PhoQ mediates virulence in Pseudomonas aeruginosa. Microbiology. 155: 699-711. Included in this publication were many of the characteristics of the phoQ mutant that are mentioned in Chapter 3; specifically these include phoQ cytotoxicity, pyocyanin, lipase, biofilm, and pyoverdine assays which were all performed by me. The growth curves, chronic lung infection model, lettuce leaf model, and microarrays included in this publication were not performed by me and have not been included in Chapter 3 (but are referred to in the text).  Chapter 4 The lipid A isolation and analysis was conducted at the University of Texas at Austin in the lab of Dr. M. Stephen Trent. I performed these experiments with the assistance of Brittany Needham at Dr. Trent’s lab. Laurence Madera isolated and prepared PBMCs from healthy donors and assisted me with the preliminary studies on the inflammatory properties of LPS. A subset of the data in this chapter has been published as: Gellatly, S.L.; Needham, B.; Madera, L.; Trent, M.S.; Hancock, R.E.W. (2012) Pseudomonas aeruginosa PhoP-PhoQ is induced upon interaction with epithelial cells and controls cytotoxicity and inflammation. Infect. Immun. 80: 3122-3131. doi:10.1128/IAI.00382-12.  Chapter 5 The data presented in Chapter 5 is being prepared as a manuscript for publication as SL Gellatly and REW Hancock. The RoxS sensor kinase as a candidate for phosphorylating PhoP in Pseudomonas aeruginosa.  iv  Table of Contents Abstract ........................................................................................................................................... ii Preface............................................................................................................................................ iii Table of Contents ............................................................................................................................ v List of Tables ............................................................................................................................... viii List of Figures ................................................................................................................................ ix List of Abbreviations ..................................................................................................................... xi Acknowledgements ...................................................................................................................... xiii 1. Introduction ............................................................................................................................... 1 1.1. Airway Infections of P. aeruginosa ......................................................................... 1 1.1.1. Acute Lung Infections .............................................................................................. 2 1.1.2. Chronic Lung Infections ........................................................................................... 2 1.1.3. Host Response to Pseudomonal Airway Infection ................................................... 3 1.2. P. aeruginosa: Genomic Context ............................................................................. 7 1.2.1. P. aeruginosa Strains PAO1 and PA14.................................................................... 9 1.3. P. aeruginosa Pathogenesis and Major Virulence Factors ..................................... 11 1.3.1. Flagella and Type IV Pili ....................................................................................... 12 1.3.2. Type 3 Secretion System ........................................................................................ 13 1.3.3. Quorum Sensing ..................................................................................................... 14 1.3.4. Biofilms .................................................................................................................. 14 1.3.5. Proteases ................................................................................................................. 16 1.3.6. Lipopolysaccharide ................................................................................................ 17 1.3.7. Other Virulence Factors ......................................................................................... 20 1.4. Antimicrobial Resistance ....................................................................................... 21 1.5. Two-Component Regulatory Systems .................................................................... 23 1.6. PhoP-PhoQ Two-component Regulatory System .................................................. 24 1.6.1. Role of PhoPQ in Lipid A Modification ................................................................ 26 1.7. Objectives and Goals .............................................................................................. 26 1.7.1. The Contribution of TCSs to Cytotoxicity ............................................................. 26 1.7.2. The Contribution of PhoQ to Virulence ................................................................. 27 1.7.3. The Phosphorylation of PhoP ................................................................................. 27 2. Pseudomonas aeruginosa Interaction with Human Bronchial Epithelial Cells...................... 28 2.1. Introduction ............................................................................................................ 28 2.2. Materials and Methods ........................................................................................... 30 2.2.1. Bacterial Strains and Growth ................................................................................. 30 2.2.2. Cell Culture ............................................................................................................ 31 2.2.3. Stimulation of HBE Cells with TLRs..................................................................... 32 2.2.4. TUNEL and Microscopy ........................................................................................ 32 2.2.5. Cytotoxicity Assays ................................................................................................ 33 2.2.6. Biofilm and Motility Assays .................................................................................. 33 2.3. Results .................................................................................................................... 34 v  2.3.1. 2.3.2. 2.3.3. 2.3.4. 2.3.5. 2.4. 2.4.1.  Response of HBE Cells to TLR Agonists .............................................................. 34 P. aeruginosa Caused HBE Cell Cytotoxicity by Necrosis. .................................. 36 Cytotoxicity Profiles of PAO1 and PA14 .............................................................. 39 Cytotoxicity Screen of PA14 .................................................................................. 40 Cytotoxicity in Strain PAO1 .................................................................................. 55 Discussion .............................................................................................................. 57 Concluding Remarks .............................................................................................. 59  3. The Sensor Kinase PhoQ Mediates Virulence ........................................................................ 60 3.1. Introduction ............................................................................................................ 60 3.2. Materials and Methods ........................................................................................... 60 3.2.1. Bacterial Strains and Growth Conditions ............................................................... 60 3.2.2. Cytotoxicity Assay and Growth Curves ................................................................. 61 3.2.3. Pyocyanin, Pyoverdine and Lipase Assays ............................................................ 62 3.2.4. Biofilm and Motility assays ................................................................................... 62 3.3. Results .................................................................................................................... 64 3.3.1. The phoQ Mutant was Less Cytotoxic in Strain PAO1 ......................................... 64 3.3.2. Known Virulence Factors were Reduced in a phoQ Mutant.................................. 65 3.3.3. Reduced Cytotoxicity of phoQ is not Mediated Through T3SS ............................ 67 3.4. Discussion .............................................................................................................. 68 3.4.1. Concluding Remarks .............................................................................................. 70 4. Pseudomonas aeruginosa PhoP-PhoQ is Induced Upon Interaction with Epithelial Cells and Controls Cytotoxicity and Inflammation ................................................................ 71 4.1. Introduction ............................................................................................................ 71 4.2. Materials and Methods ........................................................................................... 72 4.2.1. Bacterial and Mammalian Cell Culture. ................................................................. 72 4.2.2. RNA Extraction, cDNA Synthesis and qPCR. ....................................................... 73 4.2.3. Adherence assay ..................................................................................................... 74 4.2.4. Lipase and Protease Enzyme Assays, and Cytotoxicity. ........................................ 75 4.2.5. LPS Extraction and Analysis .................................................................................. 75 4.2.6. Mass Spectrometry of Lipid A ............................................................................... 76 4.2.7. Isolation of 32P-labelled Lipid A ............................................................................ 76 4.2.8. LPS Stimulation of PBMCs and Cytokine Analysis by ELISA. ............................ 76 4.3. Results .................................................................................................................... 77 4.3.1. Gene Expression was Altered During Interaction with Human Epithelial Cells In Vitro. ......................................................................................................... 77 4.3.2. Virulence Factors were Downregulated in phoQ During Interaction with Human Epithelial Cells. ......................................................................................... 80 4.3.3. Lipases and Proteases were Reduced in phoQ Mutant........................................... 82 4.3.4. LPS of phoQ was More Inflammatory. .................................................................. 84 4.4. Discussion .............................................................................................................. 90 4.4.1. Concluding Remarks .............................................................................................. 91 5. RoxS Sensor Kinase as a Candidate for Phosphorylating PhoP ............................................. 93 5.1. Introduction ............................................................................................................ 93 5.2. Materials and Methods ........................................................................................... 94 5.2.1. Bacterial Strains and Growth Conditions ............................................................... 94 5.2.2. Site-directed Mutagenesis of phoP......................................................................... 96 vi  5.2.3. 5.2.4. 5.2.5. 5.2.6. 5.2.7. 5.2.8. 5.3. 5.3.1. 5.3.2. 5.3.3. 5.3.4. 5.3.5. 5.4.  Luciferase Reporter Screen of Sensor Kinase Mutants .......................................... 96 Moving Transposon from PA14 Harvard Transposon Mutant to H103 ................ 96 RNA Extraction, cDNA Synthesis and qPCR ........................................................ 97 Catechol 2,3-dioxygenase Reporter Assay ............................................................. 97 Minimal Inhibitory Concentrations (MICs) ........................................................... 98 Growth Assays, Biofilm and Cytotoxicity ............................................................. 98 Results and Discussion ........................................................................................... 98 PhoP Contributed to Resistance to Cationic Antimicrobial Peptides..................... 98 PhoP Might Contribute to Virulence .................................................................... 101 Screen of Sensor Kinase Mutants Reveals a Candidate ....................................... 104 Mutants of roxR and roxS were not Inhibited by Azide or Cyanide .................... 107 Biofilm and Cytotoxicity was Affected................................................................ 108 Concluding Remarks ............................................................................................ 109  6. Conclusion ............................................................................................................................ 111 6.1. The Role of Two-Component Regulatory Systems in Cytotoxicity .................... 111 6.2. The Role of PhoQ-PhoP in Pathogenesis ............................................................. 113 6.3. The Difficulty in Determining the Role of PhoP ................................................. 114 6.4. Overall Conclusions ............................................................................................. 115 6.5. Future Directions .................................................................................................. 116 6.5.1. Epithelial Cell Death ............................................................................................ 116 6.5.2. Cytotoxicity Screen .............................................................................................. 116 6.5.3. Role of PhoQ in Pathogenesis .............................................................................. 117 6.5.4. RoxS as a Candidate Sensor Kinase to PhoP ....................................................... 118 References ................................................................................................................................... 120  vii  List of Tables  Table 2.1  Mutants of PAO1 and plasmids used. .................................................................... 31  Table 2.2  Cytotoxicity screen of P. aeruginosa strain PA14 regulator and sensor kinase mutants to HBE cells at 8 h post-infection. ................................................. 41  Table 2.3  Cytotoxicity of P. aeruginosa strain PAO1 mutants to HBE cells as a percentage of WT. HBE cells were infected at an MOI of 50-100 for 16-20 hours. ...................................................................................................................... 56  Table 3.1  Strains and plasmids used....................................................................................... 61  Table 4.1  Strains used in this study. ....................................................................................... 73  Table 4.2  Gene expression of P. aeruginosa wildtype and phoQ mutant cells adhered to HBE cells as compared to cells from the same co-culture that failed to adhere. .................................................................................................................... 79  Table 4.3  Gene expression of P. aeruginosa environmental strain 62 adhered to HBE epithelial cells as compared to unadhered cells in the supernatant of interaction assays. ................................................................................................... 80  Table 4.4  Effect of phoQ mutation and adherence on expression of known cytotoxicity-associated virulence factors compared to wildtype (WT) during infection of HBE cells. ................................................................................ 81  Table 4.5  Peak assignment of MALDI-TOF in Figure 4.2. ................................................... 86  Table 5.1  Strains and plasmids used in this study .................................................................. 95  Table 5.2  Catechol 2,3-dioxygenase activity in phoP and phoQ mutants harbouring expression plasmids. ............................................................................................... 99  Table 5.3  Polymyxin B MICs for PAO1 WT, phoPphoQ and phoQ mutants with or without various plasmids containing derivatives of phoP.................................... 100  Table 5.4  Cytotoxicity to HBE cells imparted by WT and phoPphoQ mutant expressing various phoP plasmids. ...................................................................... 103  Table 5.5  Transcription of oprH and phoP under low MgSO4 (20 M) compared to high MgSO4 (2 mM) concentrations as determined by qPCR. ............................ 105  viii  List of Figures  Figure 1.1  Virulence factors of P. aeruginosa......................................................................... 11  Figure 1.2  Lipopolysaccharide structure of P. aeruginosa showing glycoforms 1 (left) and 2 (right). ........................................................................................................... 18  Figure 1.3  The PhoP-PhoQ two component system in P. aeruginosa. ................................... 25  Figure 2.1  Polarized HBEs preferentially secreted chemokines in response to TLR agonists polyIC and flagellin. ................................................................................. 35  Figure 2.2  Cytotoxicity of P. aeruginosa to HBEs was necrotic. ........................................... 37  Figure 2.3  P.aeruginosa PAO1 destroyed HBE cells by necrosis rather than apoptosis. ....... 38  Figure 2.4  The cytotoxicity of P. aeruginosa to HBE cells over time. ................................... 39  Figure 2.5  Twitching but not swarming was controlled by regulators of type IV pili. ........... 45  Figure 2.6  Biofilm formation of type IV regulator mutants (A) and flagellum regulator mutants (B) was altered. ......................................................................................... 46  Figure 2.7  Flagella regulator mutants demonstrated deficiencies in swimming (A) and swarming (B) motilities. ......................................................................................... 47  Figure 2.8  Cytotoxicity of cup fimbria mutants to HBEs in strain PA14. ............................... 48  Figure 2.9  The Wsp chemosensary system (A) but not the Roc system (B) affected biofilm formation. .................................................................................................. 49  Figure 2.10  The Wsp chemosensory system but not the Roc system controlled aspects involving twitching and swarming motilities. ........................................................ 50  Figure 2.11  The DctBD two-component regulatory system controlled growth on C4dicarboxylates. ........................................................................................................ 51  Figure 2.12  Growth of dctB and dctD PA14 mutants on HBE cells after 8 h coincubation was normal. ........................................................................................... 52  Figure 2.13  DctB from the DctBD regulatory system controlled twitching (A) and biofilm formation (B). ............................................................................................ 53  Figure 2.14  An oprG mutant is considerably less cytotoxic to cultured HBE cells than the WT at MOI 50 but not at MOI 2. ..................................................................... 54  Figure 3.1  Growth of phoQ was normal when co-cultured with HBEs. ................................. 63  Figure 3.2  Cytotoxicity of phoQ mutant to HBEs ................................................................... 64 ix  Figure 3.3  Swarming, twitching and biofilm formation were reduced in a phoQ mutant. .................................................................................................................... 65  Figure 3.4  The secretion of lipases but not hemolytic enzymes were affected by mutation of phoQ.................................................................................................... 66  Figure 3.5  Pyocyanin (A) and pyoverdine (B) are reduced in a phoQ mutant. ....................... 67  Figure 3.6  Cytotoxicity of T3SS mutant exsA compared to that of phoQ and exsAphoQ double mutant. ........................................................................................................ 68  Figure 4.1  Lipases and proteases affected the cytotoxicity of the phoQ mutant. .................... 83  Figure 4.2  Lipid A was altered in a phoQ mutant. .................................................................. 85  Figure 4.3  Mutation of phoQ or growth in limiting Mg2+ caused increased aminoarabinosylation of lipid A in P. aeruginosa. ................................................ 87  Figure 4.4  LPS from phoQ mutant elicited a greater inflammatory response. ........................ 88  Figure 4.5  Silver stained SDS-PAGE of LPS isolated from PAO1 WT, phoP, and phoQ mutants. ........................................................................................................ 90  Figure 5.1  Expression of oprH is reduced in a PA4494 (roxS) mutant in strain PA14. ........ 104  Figure 5.2  The effect of Mg2+ concentration on the expression of pUCPlux-oprH in a PA4494 (roxS) mutant. ......................................................................................... 106  Figure 5.3  CIO mutants but not roxS or roxR were inhibited in growth by the reducing agencts azide or cyanide. ...................................................................................... 107  Figure 5.4  Biofilm formation of roxR and roxS mutants was reduced in strain PAO1 (A) but not PA14 (B). ........................................................................................... 108  Figure 5.5  The cytotoxicity to HBEs was reduced by mutation in roxR but not roxS........... 109  Figure 6.1  Mutants of phoQ may arise in chronic infections from transcriptional “priming” during an initial acute infection and the selective pressure of subsequent polymyxin B treatment. ..................................................................... 113  Figure 6.2  The PhoP-PhoQ two-component regulatory system of P. aeruginosa interacts with other regulatory systems to control aspects of virulence and resistance to cationic antimicrobial peptides (CAMPs). ...................................... 115  x  List of Abbreviations ADPRT – ADP ribosyltransferase AHL – N-acyl homoserine lactone AIDS – acquired immunodeficiency syndrome ASL – airway surface liquid BM2 – basal medium 2 CAP – community acquired pneumonia c-di-GMP – cyclic-di-guanosine monophosphate CF – cystic fibrosis CFTR – cystic fibrosis transmembrane regulator CIO – cyanide insensitive oxidase COPD – chronic obstructive pulmonary disease DAPI – 4’6-diamindino-2-phenylindole EAL – glutamate-alanine-leucine motif, c-di-GMP diesterase activity EF2 – elongation factor 2 ELISA – enzyme-linked immunosorbant assay EPS – extracellular polymeric substances FBS – fetal bovine serum GAP – GTPase-activating protein GGDEF – glycine-glycine-aspartate-glutamate-phenylalanine motif, c-di-GMP cyclise activity GSH – glutathione HAP – hospital acquired pneumonia HBE – human bronchial epithelial cells, 16HBE14o- cell line HCAP – health-care associated pneumonia HSL – homoserine lactone IL6 – interleukin 6 IL8 – interleukin 8 IL10 – interleukin 10 L-Ara4N – aminoarabinose LB – Lauria Bertani LDH – lactate dehydrogenase LPS – lipopolysaccharide MALDI-TOF – matrix-assisted laser desorption/ionization time of flight MEM – minimal essential medium MOI – multiplicity of infection NCAP – nursing home associated pneumonia NF B – nuclear factor kappa B OD – optical density ORF – open reading frame PL – phospholipid PRR – pathogen recognition receptor qPCR – quantitative polymerase chain reaction QS – quorum sensing RGB – regions of genomic plasticity RR – response regulator SDS-PAGE – sodium dodecyl sulphate polyacrylamide gel electrophoresis xi  SK – sensor kinase T3SS – type 3 secretion system TCA – tricarboxylic acid TCS – two component regulatory system TLC – thin layer chromatography TLR – Toll-like receptor TNF – tumor necrosis factor alpha TUNEL – terminal deoxynucleotidyl transferase dUTP nick end labeling VAP – ventilator acquired pneumonia WT – wildtype  xii  Acknowledgements  Foremost I would like to thank my supervisor, Dr. Bob Hancock, for giving me the opportunity to develop my scientific mind and skills in his lab. His mentorship has taught me independence and self-reliance, skills that will serve me well both within and outside of a scientific career. My committee members, Dr. Brett Finlay, Dr. Stuart Turvey and Dr. Bruce Vallance have been tremendously encouraging. They have asked the hard questions and kept me focused. To Brittany Needham and Dr. Stephen Trent at the University of Texas at Austin, for teaching me lipid A analysis at Dr. Trent’s lab and their wonderful hospitality while I was there. I truly appreciate the patience they showed me and the help I received from them. I would like to thank all my colleagues at the Hancock lab, past and present, for all their technical assistance and for their friendship. Finally, I would like to thank my family for their encouragement, and especially my husband, for his love and support throughout my studies.  xiii  1. Introduction The Gram-negative bacterium P. aeruginosa is an opportunistic pathogen that normally inhabits the soil and surfaces in aqueous environments, yet can survive in a wide range of other natural and artificial environments. It is a highly versatile and persistent organism that is capable of infecting both plant and animal tissues and has been isolated from many locations within medical facilities, including cut flowers, sinks and medical equipment (19). Serious P. aeruginosa infections are often nosocomial and nearly all are associated with compromised host defenses such as neutropenia, severe burns, or cystic fibrosis (155). Therapeutic options are increasingly limited due to the continued emergence and spread of antimicrobial resistant strains; as a result, P. aeruginosa infections demonstrate high morbidity. In the United States, P. aeruginosa is the sixth most common hospital pathogen and the second most common pathogen isolated from patients with ventilator-acquired pneumonia (100). Given the severity of P. aeruginosa infections and the limited antimicrobial arsenal with which to treat them, finding alternative prevention and treatment strategies is an urgent priority.  1.1.  Airway Infections of P. aeruginosa  P. aeruginosa is one of the most common pathogens responsible for respiratory infections of hospitalized patients. Airway infections are often classified into two types, acute or chronic, and transmission can be either hospital- or community-acquired, although the latter is rare and almost always associated with an underlying defect in immunity or a breach of the mechanical barrier of the lung (5, 94). By the same token, acute nosocomial pneumonias are therefore typically the result of direct trauma, such as a breach of the epithelium brought about by mechanical ventilation (223). In a 2008 survey of antimicrobial resistant pathogens with reputations for hospital persistence conducted by the United States Centers for Disease Control and Prevention, P. aeruginosa ranked second for ventilator associated pneumonia (VAP), behind only Staphylococcus aureus (100). In patients with cystic fibrosis (CF), P. aeruginosa becomes the dominant microorganism in the lung by adolescence, and persists in the lungs for the remainder of the patients’ lives (72).  1  1.1.1. ACUTE LUNG INFECTIONS Most acute lung infections due to P. aeruginosa are acquired in hospitals or other health care institutions and several names exist within the medical literature to reflect this, such as VAP, hospital-acquired pneumonia (HAP), health-care associated pneumonia (HCAP), and nursing-home associated pneumonia (NHAP) (4). The high incidence of P. aeruginosa nosocomial pneumonias is contributed to by the poor health status of the patients, the high carriage rate of often multi-drug resistant strains in hospital wards, and prior use of broad spectrum antibiotics (16, 204). Although rates vary between studies and institutions, VAP generally demonstrates the highest mortality, as much as 30% (61, 262). Patients with VAP often suffer from a breached epithelium induced by the insertion of the endotrachial tube which itself can serve as a reservoir for P. aeruginosa growing as a biofilm on the plastic surface (262). These biofilms are difficult to treat as biofilm-associated bacteria themselves exhibit increased resistance to antibiotics as well as being shielded from antimicrobials by the exopolysaccharide matrix. This in part explains the success of antibiotic treatment regimens that are started prior to the formation of biofilms and the persistence of P. aeruginosa infections after a biofilm has developed (105). Acute lung infections also occur in those who suffer from an immunodeficiency as a vigorous neutrophilic response is a hallmark of a pseudomonal lung infection. These immunodeficiencies include AIDS, neutropenia due to cancer chemotherapy, or immunosuppression due to organ transplant. Due to these deficiencies, community acquired pneumonia (CAP) is more common in these patients than in patients who are otherwise healthy (262). Even so, HAP and HCAP are also of high incidence since immunodeficient patients are frequently hospitalized and therefore exposed to the same pseudomonal reservoirs in the health care setting as non-immunodeficient patients.  1.1.2. CHRONIC LUNG INFECTIONS If not eradicated during the acute infection phase, P. aeruginosa can adapt to the lung environment to grow as a biofilm. This biofilm mode of growth cannot be easily treated with antibiotics and this often results in a chronic infection. The most well-known cases of chronic pseudomonal lung infections are those of CF patients, most of whom develop a pseudomonal lung infection by adolescence and who may live with such an infection for 20 or more years (23, 234). In CF, a mutation in the cystic fibrosis transmembrane regulator (CFTR), a cAMP2  dependent chloride channel, results in a dehydrated and thickened airway surface liquid (ASL) that hinders the mucociliary clearance of the conducting airways. Inhaled bacteria take up residence in the altered ASL and result in an initial acute infection which then develops into a persistent infection. The thickened ASL severely impairs the immune response and the persistent immunological stimulation by the bacteria results in chronic inflammation of the lung (223, 262). A combination of bacterial toxins and a hyperactive immune response makes this infection of the lung ultimately fatal. Chronic pseudomonal lung infections (CAP and/or HCAP) are also frequently associated with people who have chronic obstructive pulmonary disease (COPD), a condition where chronic inflammation leads to the narrowing of airway passages resulting in a restriction of airflow. Cigarette smoking is considered the major risk factor for the development of COPD (194), as the noxious chemicals in cigarette smoke dysregulate the normal responses of the innate immune system within the lung (216). Patients with COPD are frequently elderly, as the complex process of aging contributes to a general decline in lung function and the changes brought about by the cigarette smoke typically occur gradually over decades (2, 216). The incidence of pseudomonal infections in COPD patients ranges from 4-15% and the clinical manifestations of these infections blur the boundary between acute and chronic as both mild bronchitis and CAP with sepsis are common (163, 193, 262). Many COPD patients who develop a lung infection with P. aeruginosa are able to clear the infection, but almost as many develop a persistent infection that is characterized by periodic exacerbations (193). The one and two year mortality rates after hospitalization due to an acute exacerbation of COPD are high, ranging from 22-49%, and with the current global increase in smoking rates (mostly in low-income countries) it is a leading cause of death that is increasing in prevalence (82, 86, 109, 266).  1.1.3. HOST RESPONSE TO PSEUDOMONAL AIRWAY INFECTION Humans can breathe in excess of 10,000 L per day (62) and although the air inhaled is not sterile and contains particulates from the environment, the lungs of a healthy individual remain free from infection. In the conducting airways, the epithelium is the first line of defense against infectious agents, playing a broad range of roles in the innate response to infection. Several other cell types also play a role in the immunological defenses of the airways, including dendritic cells, T cells, macrophages, and neutrophils (108, 223). The 3  contribution of each of these cell types will be discussed in turn in the subsequent sections. The clearance of P. aeruginosa from the airways therefore involves the coordinated effort of a multitude of cell types, and the symptoms and outcome of a P. aeruginosa infection in turn depends on both the virulence factors expressed by the bacterium as well as the host response. 1.1.3.1. EPITHELIAL CELLS Inhaled air starts its journey in the nasal and tracheal passages. From there the conducting airways branch multiple times into ever smaller passages where they end in the gasexchanging alveoli (128). The conducting passages are lined with a pseudostratified epithelium consisting of several morphologically distinct cell types that fulfill a number of critical functions related to normal homeostasis. Based on structural, functional and biochemical criteria, these cell types can be classified into three categories: ciliated, basal and secretory (126). As the first site of contact for inhaled particles, including pathogens, the epithelial cells form a physical barrier to infection and act as sentinels to alert the innate and adaptive immune system to infection (260). Damage to the epithelium causes the lung to be much more easily colonized by P. aeruginosa or other pathogens. Ciliated epithelial cells are the predominant cell type within the airway, comprising over 50% of the epithelium. Each ciliated cell contains approximately 300 hair-like extensions of the cell membrane called cilia which are powered by numerous mitochondria. These cells rhythmically beat their cilia in a unidirectional manner that is upwards and out of the lung. Thus the primary role of these cells is the transport of mucous from the lung to the throat (126). Basal cells in the epithelium are the only epithelial cells that are firmly attached to the basal lamina, a 20-100 nm thick felt-like sheet of fine fibrous molecules that lies at the interface of the epithelium and the connective tissue (126, 176). Basal cells are numerous in the conducting airway passages, yet the number of basal cells decreases as the airway passages become smaller. Similar to the skin, the basal cell in the lung epithelium is thought to be the primary progenitor cell, giving rise to the both the mucus and ciliated epithelial cells (126). Secretory cells contain numerous granules for the production, storage and secretion of mucin glycolipids (goblet cells) and bronchiolar surfactant (Clara cells and type II epithelial 4  cells). Mucins are high molecular weight and highly glycosylated macromolecules that effectively bind and trap many foreign particles. The unfolding of the diverse carbohydrate chains of the mucus layer is dependent on proper hydration, ion concentration and pH (128). It has been proposed that one consequence of the CFTR mutation is the dehydration of the mucus layer, the result of which is two-fold: the carbohydrate side chains of the mucins are unable to properly unfold causing a hampering of their ability to bind foreign particles, and the mucins more likely to increasing the likelihood of the mucins to contact and bind the celltethered mucins MUC1 and MUC4 effectively gluing the mucus layer to the epithelia and preventing mucociliary clearance (128). In the healthy human trachea, it is estimated that there are up to 6800 mucus-secreting cells/mm2 of surface epithelium. Both the number of mucin-secreting granules per cell and the number of secretory cells can be increased due to acute exposure to irritants such as tobacco smoke or by chronic airway inflammatory diseases such as asthma. This is thought to contribute to the persistent cough associated with these diseases (126). Clara cells in the lower bronchial passages and type II epithelial cells in the alveoli secrete pulmonary surfactant (164). The major constituents of surfactant are phospholipids (80%), neutral lipids such as cholesterol (10%) and surfactant proteins A through D (1-2%). Together these molecules function to lower the surface tension at the air-liquid interface and thereby prevent alveolar collapse at the end of exhalation (33). The surfactant proteins have additional roles in binding and opsonising microbial pathogens (124). Epithelia also secrete many other molecules that may play roles in the defense of the lung. Complement proteins secreted by the epithelial cells act to bind infectious agents and promote phagocytosis. Cytokines and chemokines, particularly the powerful human neutrophil attractant IL8, are also secreted by epithelial cells upon activation of their Tolllike receptors (TLRs) (108). Antimicrobial peptides such as  -defensins, lysozyme, and  lactoferrin are secreted into the lumen of the lung and are upregulated during infection (9, 49). However the role of these peptides in the defense of the lung is unclear. The antimicrobial activity of these peptides has been shown to be sensitive to high salt concentration, particularly to divalent cations such as Ca2+ and Mg2+ which exist in millimolar concentrations in most tissues (48). It is hypothesized that because many of these antimicrobial peptides are salt sensitive, the dehydrated ASL of the CF lung renders these peptides ineffective and this contributes to CF pathogenesis (141). Furthermore, 5  polysaccharides such as mucins abound within the lung and are likely to bind and render ineffective these peptides, which are generally cationic. Therefore it seems more probable that these secreted peptides play some role in innate lung defenses that is not due to direct killing or growth inhibition of inhaled microbes, for example in tissue repair (48). Epithelial cells act as sentinels in the lung, alerting the innate and adaptive branches of the immune system to infection. TLRs function to bind conserved pathogen moieties such as flagellin (TLR5) and LPS (TLR4). When bound to their specific ligand, TLRs initiate a signaling cascade primarily through mitogen-activated protein (MAP) kinases and several transcription factors including NF B and interferon regulatory factors 3 and 7 (IRF3, IRF7) that results in the production and secretion of pro-inflammatory cytokines and chemokines, which in turn activate and recruit other cells of the innate and adaptive immune systems (252). Compared to the basal surface, there are few TLRs on the apical surface of epithelial cells, perhaps so that transient contamination of the lower airways does not result in an excessive immunological response. It is believed that TLRs can be mobilized to the apical surface during a significant bacterial challenge (141). Nevertheless, there is controversy over which TLRs are expressed by epithelial cells, even by a given immortalized epithelial cell line. There is general agreement that most TLRs, if not all, are produced at the mRNA level, but this consensus disintegrates when protein levels and cellular responses to TLR ligands are examined (79, 111, 118, 192, 231).  1.1.3.2. PHAGOCYTIC CELLS Two phagocytic cells, macrophages and neutrophils, play key roles in the defense of the lung. Alveolar macrophages phagocytose particles, sequester antigen and secrete small amounts of cytokines and chemokines in the steady state but when activated during infection these antimicrobial functions become enhanced. Although macrophages are well known for their phagocytic capabilities, the role they play in pseudomonal infections is ambiguous. Some evidence suggests that CFTR deficiency alters the ability of macrophages to respond appropriately to a pseudomonal infection. CFTR-deficient murine alveolar macrophages were able to phagocytose bacteria but could not properly acidify their phagolysosomes, allowing the ingested bacteria to survive (50). Conversely, CFTR-deficient macrophages demonstrated a more pronounced inflammatory response when stimulated with LPS (177). In 6  some murine acute infection models, depletion of lung macrophages have resulted in a lack of chemokine production, neutrophil recruitment and defective phagocytosis (67, 130, 197) while other studies demonstrated that macrophage depletion did not affect the severity of the infection (30, 187). A hallmark of the inflammatory response to a pseudomonal lung infection is the recruitment of neutrophils (119). This recruitment is dependent on the production of chemokines, particularly IL-8 (human) and KC (mouse), members of the CXC chemokine family. Mice that were administered anti-CXCR antibody demonstrated a 50% reduction in the number of neutrophils recruited to the lungs when subsequently challenged with P. aeruginosa. These mice also had much poorer survival rates (249). Neutrophils phagocytose and kill bacteria in the lung using a number of microbicidal molecules including reactive oxygen and nitrogen species, lysozyme and neutrophil elastase. Towards the end of their lives, neutrophils die through apoptosis, a process that allows the highly toxic species used by neutrophils to be contained, preventing damage to the surrounding tissues. Lung expectorant during a neutrophilic response is purulent and sputum samples allow the identification of P. aeruginosa as the causative agent. In chronic infections where the stimulation of the immune system by the bacteria is unrelenting, the merciless neutrophilic response may serve to injure surrounding host tissues (262). This certainly appears to be the case for CF; however, the neutrophils in the CF lung also seem functionally defective, as they are unable to clear the infection. This is likely due to a combination of defects within the CF neutrophils themselves and hampering of proper neutrophil functions due to the altered state of the CF lung. For example, CF neutrophils appear resistant to anti-inflammatory signals such as those brought about by the anti-inflammatory mediator IL10 and seem more ready to spontaneously degranulate and release elastase (used in the degradation of phagocytosed proteins). The dehydration of the ASL in CF may trap neutrophils in a localized site and cause the induction of neutrophil necrosis rather than apoptosis, contributing to lung pathology (52, 97).  1.2.  P. aeruginosa: Genomic Context  P. aeruginosa is considered one of the most versatile and adaptable bacteria known. Normally a soil and aquatic organism, it is capable of infecting a number of plant and animal 7  species. Fifteen strains of P. aeruginosa have been sequenced in their entirety or are listed as draft or incomplete sequences on the NCBI Entrez database. Compared to other sequenced bacteria that can cause disease, it has a relatively large genome, ranging from 6.22 Mb for strain C3719, a cystic fibrosis isolate known for its high transmissibility, to 6.91 Mb for strain PA2192, a mucoid cystic fibrosis isolate (233). This sequencing of multiple strains has revealed that the genomes of P. aeruginosa strains are arranged as an assortment of conserved regions interspersed by “regions of genomic plasticity” (RGB) that contain genes unique to each strain (165). This has lead to P. aeruginosa being described as having a “core” genome, containing a conserved set of genes common to the species, and an “accessory” genome, containing the genes that are missing from one or more strains. The genome of P. aeruginosa contains a large number of paralogous groups, regions that have arisen by genetic duplication that have since evolved independently to create families that are functionally similar but may be regulated differently. The number of paralogous groups in P. aeruginosa is considerably larger than would be predicted by the size of the genome when compared to Escherichia coli, Bacillus subtilis, and Mycobacterium tuberculosis (242). Nevertheless, the distribution of open reading frame (ORF) sizes, spacing between ORFs, as well as the number of evolutionarily recent genetic duplications between E. coli and P. aeruginosa are quite comparable. Couple this with the increased metabolic and functional diversity displayed by P. aeruginosa and it seems likely that the evolution of the P. aeruginosa genome arose out of selective pressure for environmental versatility (233). The first strain sequenced was PAO1, revealing ~300 cytoplasmic transport systems (242). The vast majority of these transport systems were for the import of nutrients and other small molecules. Several mono-, di-, and tri-carboxylate transport systems were identified yet very few sugar transporters were revealed when compared with the intensely scrutinized E. coli, the most closely related bacterium that had been fully sequenced at the time. Nevertheless, a substantial number of genes were predicted to encode enzymes involved in oxidation of various carbon compounds. Indeed, in the laboratory setting, P. aeruginosa is well known for its preference for growth on TCA cycle intermediates over sugars. Furthermore, P. aeruginosa has been isolated from numerous nutrient-poor settings (223). The sequencing of PAO1 predicted 521 genes encoding regulatory proteins, nearly 10% of its genome, a far higher proportion than any other sequenced bacteria (242). Similar analyses of other bacterial genomes have demonstrated that bacteria that can survive in 8  diverse environments have a larger proportion of the genome dedicated to regulatory proteins than bacteria that are specialized to survive in a specific environment. For example, the specialized pathogen M. tuberculosis dedicates only 3% of its genome to regulatory proteins, while E. coli reserves 5.8% of its genome (242). Further analysis revealed that many of identified regulatory genes in P. aeruginosa belonged to the two-component class of regulatory systems, which allow the bacterium to rapidly adapt to a change in the environment. Two-component systems are discussed in detail in Section 1.5. Many other systems were identified in P. aeruginosa which gave insights into the pathogenicity and persistence of this bacterium. These included numerous intrinsic drug resistance and efflux systems (detailed in Section 1.4), protein secretion systems, and virulence factors (Section 1.3) (242). Perhaps more telling, 45.8% of predicted ORFs contained genes for which no function could be assigned or predicted. While many of these shared sequence homology to predicted genes of unknown function in other sequenced bacteria, the majority did not show homology to any previously sequenced gene. Over a decade after PAO1 was sequenced, only about 100 of these unknown genes have been functionally characterized (233).  1.2.1. P. AERUGINOSA STRAINS PAO1 AND PA14 Two of the most commonly studied and completely sequenced P. aeruginosa strains are the wound isolate PAO1 (~6.26 Mb, 5671 predicted genes) (106) and the slightly larger burn wound isolate PA14 (~6.54 Mb, 5994 predicted genes) (142, 242), both of which were utilized in this thesis. PA14 shows greater virulence than PAO1 in several models, yet 92% of the PA14 genome is present in PAO1 and 96% of the PAO1 genome is present in PA14. Both strains also contain genes that are not found in any other sequenced strain – 54 for PAO1, 143 for PA14 (233). Contributing to the increased virulence of PA14 is the presence of two pathogenicity islands. PAPI-1 is a large 108 kb pathogenicity island between loci PA4541 and PA4542 which is entirely absent from PAO1. Over 80% of PAPI-1 is unique, encoding proteins of unknown function. Among those ORFs to which a function can be assigned are the cupD fimbrial gene cluster and a type IV pili biogenesis cluster, both of which have been shown to directly or indirectly contribute to the virulence of PA14. Two unique pairs of two9  component regulatory systems have also been identified in PAPI-1: pvrR-pvrS, and rcsBrcsC (98). PAPI-2 is an ~11 kb pathogenicity island located between loci PA0976 and PA0988 in strain PA14. Half of this island is homologous to a genomic island in PAO1 (PA0977 – PA0987). One notable exception pertaining to the virulence of PA14 is the substitution of PAO1 genes PA0984 and PA0985 with the type 3 secretion system effector protein exoU and its chaperone spcU (98). Recently, it was revealed that the increased pathogenicity of PA14 compared to PAO1 may also be due to a duplication event within the ladS gene in PA14. The sensor kinases LadS and RetS inversely regulate the GacS-GacA two-component system which controls the expression of the two small RNAs RsmY and RsmZ which in turn are involved in regulating biofilm formation. LadS activates GacS-GacA, suppressing cytotoxicity and promoting biofilm formation. The duplication of a 49 bp region within ladS in PA14 results in a frameshift in the reading frame and truncation of the resulting peptide (180). The effect is that the truncated LadS is unable to suppress cytotoxicity through regulation of GacS-GacA.  10  Figure 1.1 Virulence factors of P. aeruginosa. This figure has been adapted with permission from Kipnis et al (124).  1.3.  P. aeruginosa Pathogenesis and Major Virulence Factors  P. aeruginosa is capable of causing both acute and chronic infections. Acute infections typically occur where the epithelia have been damaged (e.g. severe burns) or the immune system rendered defective (e.g. post-chemotherapy). These infections are severe and can be rapidly fatal. In contrast, chronic infections can persist for years in those with specific underlying medical conditions, such as cystic fibrosis (CF). While P. aeruginosa is capable of infecting any epithelial surface, infections of the lung are most intensely scrutinized. In 85% of patients with CF, the lungs are chronically infected with P. aeruginosa by adolescence (44). The combined effect of secreted bacterial virulence factors and the  11  pathology associated with an unremitting neutrophil response makes this infection ultimately fatal. Analyses have revealed that P. aeruginosa isolated from acute infections differ substantially in phenotype from those isolated from chronic infections (234). Isolates from acute infections express a wealth of virulence factors while in contrast, many isolates from chronic CF lung infections lack some of the most inflammatory bacterial features, such as flagella and pili, and downregulate other virulence mechanisms such as the type 3 secretion system (104). Furthermore, isolates from chronic infections more readily form biofilms and overexpress the exopolysaccharide alginate, causing these strains to become mucoid (125, 223). A summary of virulence factors is depicted in Figure 1.1.  1.3.1. FLAGELLA AND TYPE IV PILI Each P. aeruginosa cell possesses a single polar flagellum and several much shorter type IV pili also localized at a cell pole. These proteinaceous appendages function both as adhesins and as major means of motility. Flagella and pili can also initiate an inflammatory response. The whip-looking flagellum provides swimming motility through a rotating cork-screw motion in an aqueous environment and is an essential part of bacterial chemotaxis. Bursts of straight line swimming are interspersed with “tumbles”, where flagella rotation is transiently reversed and motility is halted in order for the bacterium to orient itself. During an infection, the bacterium can adhere to host epithelial cells through the binding of its flagellum to the asialyated glycolipid asialoGM1 and can elicit a strong NF B-mediated inflammatory response via signaling through TLR5 (58, 125) and a caspase-1-mediated response through the Nod-like receptor (NLR), Ipaf (65, 178). Non-flagellated mutants are defective in models of acute infection (25, 58) yet a large proportion of isolates from chronic infections demonstrate downregulation of flagella or flagella-mediated motility (160, 265). As flagella are believed to be required for the establishment of infections, clinical vaccine trials have been undertaken in order to prevent initial infection and thereby the subsequent progression to a chronic infection; however to date these have not shown much success (51, 117). Type IV pili are the dominant adhesins of P. aeruginosa, and are involved in twitching motility and the formation of biofilms. Located at one cell pole, type IV pili extend and retract like grappling hooks to pull the cell along solid surfaces (125). Together with flagella, 12  they also facilitate swarming motility, a highly coordinated form of motility in semi-solid media (129). Pili have been shown to bind asialoGM1 and asialoGM2 on epithelial cells and can initiate an inflammatory response, although it is unclear how this occurs (6). Pili can also lead to aggregation, causing the bacteria to form microcolonies on target tissues, effectively concentrating the bacteria in one location and potentially offering protection from the host immune system and from antibiotics (39, 238). Pilin-deficient mutants or those impaired in twitching motility demonstrate reduced virulence in various models. Like flagella, pili are targets of anti-pseudomonal therapy, including immunization; however these efforts are hampered by the antigenic variability of pili across P. aeruginosa strains (125, 169).  1.3.2. TYPE 3 SECRETION SYSTEM Type 3 secretion systems (T3SS) are shared amongst many pathogenic Gram-negatives as a means of injecting toxins directly into host cells. As such, the P. aeruginosa T3SS is a major determinant of virulence and is frequently associated with acute invasive infections (223). The needle-like appendage of the T3SS, evolutionarily related to flagella, permits the translocation of effector proteins from the bacterium into the host cell through a pore formed in the host cell membrane. Only four effectors have been identified – ExoY, ExoS, ExoT, and ExoU – far fewer than many other well-characterized T3SS (e.g. Salmonella enterica SPI-1 has 13, Shigella sp. have 25) (95). The T3SS of P. aeruginosa is encoded by thirty-six genes on five operons, with six other genes encoding the effector proteins and their chaperones scattered elsewhere in the chromosome (95). The entire system is transcriptionally controlled by ExsA, a member of the AraC family of transcriptional activators (268). The four effector proteins of P. aeruginosa T3SS are expressed variably in different strains and isolates. Nearly all strains express one of the two major exotoxins exoU or exoS but very rarely both (232), while most strains express exoY and exoT¸ which have minor roles (95). ExoS is bifunctional, including both N-terminal GTPase-activating protein (GAP) activity and C-terminal ADP ribosyltransferase (ADPRT) activity. Both activities have an effect on actin cytoskeletal organization although the ADPRT activity is understood to play a larger part in pathogenesis. ExoU is a phospholipase and is estimated to be 100 times more potent a cytotoxin than ExoS, capable of causing rapid death of host eukaryotic cells. In contrast to ExoS, death due to ExoU is a result of a rapid loss of plasma membrane integrity consistent with necrosis (95, 125). In this thesis, strains 13  PA14 and PAO1 have been used; the former produces ExoU making it much more cytotoxic than the latter strain which produces ExoS (142, 242).  1.3.3. QUORUM SENSING Quorum sensing (QS) is a mechanism shared by many bacteria that allows for a coordinated adaptation of a bacterial population to environmental changes. This adaptation is mediated by small membrane-diffusible molecules called autoinducers. These molecules are constitutively produced by each bacterium and act as cofactors of transcriptional regulators when they reach high enough threshhold concentrations. The concentration of autoinducers in the medium is proportional to the concentration of bacteria so when the bacterial population increases to a critical mass (i.e. “quorum”), the concentration of these autoinducers becomes sufficient to effect coordinated gene expression across the entire bacterial population. It is estimated that as much as 10% of the genome and over 20% of the expressed bacterial proteome are affected by QS (46). P. aeruginosa produces three autoinducers. Two of these autoinducers are acyl homoserine lactones (AHLs): 3-oxo-dodecanoyl homoserine lactone (3-oxo-C12 HSL) is produced by the LasI AHL synthase and acts on the LasR transcriptional activator, and butyryl homoserine lactone (C4 HSL) is produced by the RhlI AHL synthase which acts on the RhlR transcriptional activator. The third more recently discovered autoinducer is a 2heptyl-3-hydroxy-4-quinolone designated the Pseudomonas Quinolone Signal (PQS), the synthesis of which is a complex multistep process involving two operons, pqsABCDE and phnAB, and three genes located elsewhere, pqsR, pqsH, and pqsL (46, 99). The QS systems act in a hierarchical manner, with the las system positively regulating both rhl and the production of quinolones (99). Cell survival, biofilm formation and virulence are controlled by these systems, thus strains deficient in one of these systems demonstrate reduced pathogenicity (125, 209, 223).  1.3.4. BIOFILMS Biofilms are highly organized communities of bacteria attached to each other and/or a surface and their formation is intricately linked to quorum sensing (19, 87, 149). These communities are encased in extracellular polymeric substances (EPS) that can consist of polysaccharide, nucleic acids, lipids and proteins. The EPS matrix makes up the majority 14  (50-90%) of the volume of the biofilm and imparts both a physical and chemical robustness to the community by resisting mechanical forces (e.g. flowing water) and dissuading the entry of toxic chemicals (e.g. antibiotics, host defense molecules) (87, 149). Furthermore, the bacteria within the biofilm also differ substantially from their planktonic brethren in terms of their transcriptional profile (254). Relative oxygen and nutrient limitation within the biofilm may contribute to the slow mode of growth observed by biofilm bacteria as well as to an upregulation of the general stress response alternate sigma factor RpoS; all of these factors could lead to increased antibiotic resistance (159). The antibiotic resistance of bacterial biofilms contributes in a massive way to their resilience and as such biofilms are a major medical problem. Biofilms can form on inserted medical equipment such as catheters and endotracheal tubes (253) and it has been proposed that P. aeruginosa can grow as a biofilm on host tissues during chronic infections, particularly in the CF lung (19, 71, 238, 273). The transition of P. aeruginosa from the motile to sessile state and back again manifests itself as a multitude of physiological changes. The first phase is initial contact followed by strong (effectively irreversible) attachment. This is mediated by type IV pili, long known to move bacteria across biotic or abiotic surfaces, as well as flagella, and the more recently discovered Cup fimbria (179). What initiates this transition is partly dependent on cell-to-cell signaling via the Las and Rhl quorum sensing systems and on environmental cues such as antibiotics, pigments and siderophores (154). For example, the antibiotic imipenem has been shown to cause a thickening of biofilms due to the induced expression of alginate, a polysaccharide shown to play a role in the formation of some pseudomonal biofilms (8). After irreversible attachment, bacteria in the biofilm multiply as microcolonies and produce an extracellular polysaccharide (EPS) matrix. Three polysaccharides are produced for the P. aeruginosa EPS, with the importance and contributions of each varying according to the strain. Alginate is overproduced by mucoid strains that are often isolated from the lungs of CF patients. It is widely considered to participate in the formation of biofilms in the CF lung where it is thought to protect the bacteria from the host response; however, evidence also suggests that alginate itself is not a requirement for biofilm formation (222, 267). The Pel polysaccharide is produced by most strains, while the Psl polysaccharide is not fully encoded in all strains (i.e. strain PA14 contains a partial deletion in the psl locus) (154). Continued maturation of the biofilm leads to mushroom-shaped structures that are interspersed with fluid-filled channels allowing for the exchange of waste products and nutrients (121). Finally, 15  biofilm cells detach from the biofilm and disperse through the environment, where they are able to adhere to another surface, renewing the cycle of biofilm formation.  1.3.5. PROTEASES Several proteases are secreted by P. aeruginosa. These proteases have established roles in ocular infection and in sepsis, where they can degrade immunoglobulin, and fibrin, and disrupt epithelial tight junctions (20, 125). While their contribution to lung infection is less clear, proteases have been shown to contribute to tissue damage in respiratory infections, including the degradation of host lung surfactant, a lipoprotein complex that reduces surface tension to prevent alveolar collapse during breathing (63, 103, 211). Alkaline protease is a type 1 secreted zinc metalloprotease that is known for its degradation of host complement proteins and host fibronectin (85, 136). In a murine model of sepsis, alkaline protease in combination with pseudomonal exotoxin A was prepared and administered as an inactivated toxoid vaccine and demonstrated statistically significant protection against subsequent infection by P. aeruginosa (167). Moreover, alkaline protease has been shown to interfere with flagellin signaling through host TLR5 by degrading free flagellin monomers and thereby helping P. aeruginosa to avoid immune detection (11). P. aeruginosa produces two elastases, LasA and LasB, which are regulated by the lasI quorum sensing system and secreted via type 2 secretion systems (45, 225, 246). Most P. aeruginosa investigations reserve the term “elastase” for LasB and “staphylolysin” for LasA. This is because LasA has only a fraction of the elastolytic abilities of LasB and is thought to enhance the proteolytic activity of LasB (28, 166, 246). LasB has been observed to degrade lung surfactant proteins A and D which function to bind and opsonize microbes in the lung for phagocytosis (162). As a result, lasB mutants are more susceptible to phagocytosis and are attenuated for virulence in a murine lung infection model (131). LasA, or staphylolysin, is a serine protease able to hydrolyze the penta-glycine bridge required for peptidoglycan stabilization in the cell wall of staphylococci and is being studied as a potential therapy against methicillin resistant Staphylococcus aureus (MRSA) infections (12). Protease IV is a serine protease that can degrade complement proteins, immunoglobulin and fibrinogen. Injections of protease IV onto corneas in a rabbit model of ocular infection caused erosion of the corneal epithelia while infection of corneas with a protease IV deficient strain showed reduced virulence (54). Furthermore, protease IV degradation of host 16  surfactant proteins A and D has been shown to inhibit the association of P. aeruginosa with alveolar macrophages, demonstrating a role for this protease in P. aeruginosa survival during infection (161).  1.3.6. LIPOPOLYSACCHARIDE P. aeruginosa produces a three domain lipopolysaccharide (LPS) consisting of a membrane-anchored lipid A, polysaccharide core region, and a highly variable O-specific polysaccharide (O-antigen or O-polysaccharide) (Figure 1.2). It is a complex glycolipid that forms the major outer leaflet of the outer membrane and has roles in antigenicity and the host inflammatory response, exclusion of external molecules, and in mediating direct interactions with host cell receptors and with antibiotics (123).  1.3.6.1. O-POLYSACCHARIDE The importance of LPS to the bacterium and to host pathology and antibiotic resistance has subjected it to intense study and now a great deal is known about its biosynthesis and the contributions of each of its three domains to the above observations. In all wildtype strains, the lipid A domain is attached to a nine or ten sugar, branched oligosaccharide core; a proportion of LPS molecules on any given cell have only these two domains. This lipid Acore can be further substituted by O-polysaccharide (“O-antigen”), a carbohydrate polymer covalently attached to the core (so-called “smooth” isolates). Two types of O-antigen can exist simultaneously within a given P. aeruginosa cell and they are distinct structurally and serologically. A-band polysaccharide (“common”) is a homopolymer of D-rhamnose usually about 70 sugars long and which elicits a weak antibody response. In contrast, B-band polysaccharide (“O-specific”) is a variable heteropolymer both in chain length and in nature of the sugars (usually 3-5 in each repeating unit). It elicits a strong antibody response and is the chemical basis for serotyping (123, 137). Some strains of P. aeruginosa produce no Opolysaccharide at all (“rough” strains) while others substitute the lipid A and core with only one O-saccharide unit, rather than an entire polymer (“semi-rough”). Interestingly, many chronic P. aeruginosa isolates lose their expression of the B-band polysaccharide with the Aband polysaccharide becoming the dominant antigen over time. This may be driven by  17  Figure 1.2 Lipopolysaccharide structure of P. aeruginosa showing glycoforms 1 (left) and 2 (right). Rha (D-rhamnose), Hep (L-glycero-D-manno-heptose), Glc (D-glucose), GalN (2-amino-2-deoxy-galactose), Kdo (3-deoxy-D-manno-oct-2-ulosonic acid), Ala (alanine), Cm (carbamoyl), Etn (ehtanolamine), P (phosphate). Dotted lines indicate nonstoichiometric substitutions or substitutions not present in all strains.  selective pressure for the bacteria to evade host immune responses by suppressing the more antigenic O-specific polysaccharide (123). 1.3.6.2. CORE The core domain of P. aeruginosa LPS, much like other Gram-negatives, is divided into an inner and an outer core. The inner core is composed of two residues each of 3-deoxy-Dmanno-oct-2-ulosonic acid (KdoI and KdoII) and L-glycero-D-manno-heptose (HepI and 18  HepII) (123, 127, 137). HepII is stoichiometrically 7-O-carbamoylated, a feature which is common to other Pseudomonads, and both HepI and HepII serve as phosphorylation sites (127). P. aeruginosa has the most phosphorylated core known and forms intermolecular ionic bridges involving divalent cations such as Mg2+ which stabilize the negatively charged outer membrane (127). It is possible that this phosphorylation contributes to the bacterium’s intrinsic resistance to several antibiotics; mutation of waaP, a gene that adds phosphate to HepI of the inner core is fatal to P. aeruginosa but not Salmonella typhimurium and expression of P. aeruginosa waaP in a S. typhimurium waaP- mutant resulted in a 35-fold increase in resistance to novobiocin (255). It is also possible that this phosphorylation is responsible for making P. aeruginosa more susceptible to lysis by divalent cation chelators, such as EDTA (123). The outer core of P. aeruginosa can exist as one of two glycoforms (Figure 1.2) but is always composed of one L-rhamnose, one D-galactosamine, and three or four D-glucose residues. The glycoforms differ only in the position of L-rhamnose which denotes whether the core can be substituted with O-polysaccharide (“capped”) (123, 137). These glycoforms are present in comparable amounts in any given cell and the monosaccharide residues can be further substituted by O-acetyl groups. Like O-carbamoylation of the inner core HepII, the biological significance of O-acetylation of the outer core remains to be determined (127).  1.3.6.3. LIPID A Lipid A is a glucosamine-based lipid that anchors the LPS into the outer membrane. Like the lipid A from other Gram-negative bacteria, P. aeruginosa lipid A is composed of a diglucosamine biphosphate backbone with O- and N-linked primary and secondary fatty acids. Structurally, it varies in the number, position and nature of the linked acyl groups as well as modifications of the phosphate groups. Structural variations exist between strains and isolates and modifications can arise due to growth conditions (137). Commonly thought of as the “business end” of LPS, lipid A can be sequentially bound by host cell co-receptors MD2 and CD14 leading to activation of the Toll-like receptor 4 (TLR4) to NF B signaling pathway and triggering the production of pro-inflammatory cytokines and chemokines, inflammation and eventually endotoxic shock (1, 245).  19  Modifications to lipid A can alter the bacterium’s susceptibility to cationic antimicrobial peptides as well as change its inflammatory properties (137, 189). Laboratory-adapted P. aeruginosa strains grown in rich medium exhibit penta- or hexa-acylated lipid A forms which differ by the presence of a decanoic acid at the 3-position. Penta-acylated species are predominant (~75%) in laboratory strains and in isolates from acute infections but this is not true for isolates of chronic infections (57, 123, 137). Isolates from chronically infected cystic fibrosis (CF) lungs demonstrate hexa- and sometimes hepta-acylated species. Modifications in the lipid A of these isolates appear to increase with the severity of lung disease and can include the secondary addition of palmitate at the 3’-position, the addition of aminoarabinose to the phosphate groups, and the retained presence of the decanoic acid at the 3-position (57). Hyperacylated lipid A species have been shown to have increased inflammatory potency which is thought to be due to an alteration in the binding of lipid A to MD2 (245) while the addition of aminoarabinose has been shown to contribute to resistance to cationic antimicrobial peptides (17, 55). Lipid A and LPS from chronic CF lung isolates demonstrate increased NF B signaling and this is thought to be due to increased acylation. Many lipid A modifications are regulated and can be induced as a response to an environmental change; for example, limiting Mg2+ or the presence of antimicrobial peptides in laboratory adapted strains can induce the addition of aminoarabinose (55).  1.3.7. OTHER VIRULENCE FACTORS A number of other virulence factors are secreted by P. aeruginosa and can contribute to its pathogenicity. Exotoxin A is an ADP-ribosyltransferase (ADPRT) that inhibits host elongation factor 2 (EF2) thereby inhibiting protein synthesis and leading to cell death. This inhibition of protein synthesis also likely leads to the repression of the host immune response as has been observed by the decrease of cytokines released from whole blood stimulated with heat-killed P. aeruginosa with or without exotoxin A (226). Exotoxin A producing strains show a 20-fold increase in virulence in a murine model compared to exotoxin A deficient mutants (184). The toxic properties of exotoxin A have also been shown to induce host cell death by apoptosis and for that reason, exotoxin A is currently being investigated in the development of an immunotoxin that targets tumor cells for anti-cancer therapy (53, 263). Lipases and phospholipases break down surfactant lipids and the phospholipids of host cell membranes (125). Lung surfactant is composed 90% of lipids and functions to reduce the 20  surface tension in alveoli to prevent alveolar collapse during exhalation and thereby reduce the work of breathing. Phospholipases have been shown to degrade surfactant causing an increase in surface tension (107). Hemolytic phospholipases are able to directly lyse human and sheep erythrocytes (200, 201). The blue-green pigment pyocyanin gives P. aeruginosa colonies their distinct color and causes oxidative stress to the host, disrupting host catalase and mitochondrial electron transport (139). Purified pyocyanin has been shown in vitro to induce apoptosis in neutrophils as well as inhibit the phagocytosis of apoptotic bodies by macrophages (18, 139). It is also able to modulate the expression of the chemokines IL-8 and RANTES by airway epithelial cells (47).  1.4.  Antimicrobial Resistance  Infections by P. aeruginosa are difficult to treat due to its intrinsic ability to resist many classes of antibiotics and its ability to acquire resistance to others. All known mechanisms of antibiotic resistance can be displayed by this bacterium (intrinsic, acquired, and adaptive), sometimes all within the same isolate. Resistance rates are on the rise despite the use of combination drug therapies (186). As few new drugs are available to combat P. aeruginosa infections, there has begun a return to the use of older drugs such as polymyxins that fell out of favor as improved classes of antibiotics with fewer adverse effects were developed (150). Intrinsic resistance is resistance that is encoded in the microorganism’s chromosome. In the case of P. aeruginosa, intrinsic resistance is due to the low permeability of its outer membrane, the constitutive expression of membrane efflux (Mex) pumps (of which 12 are known), and the natural occurrence of a -lactamase, AmpC (243). The outer membrane is a semi-permeable barrier that restricts the uptake of small hydrophilic molecules such as lactam antibiotics to porin proteins embedded within the outer membrane. It is estimated that the P. aeruginosa outer membrane is 10-100-fold less permeable than that of E. coli, having fewer large channel porins (formed by OprF) and a number of small channel porins (formed by proteins such as OprD and OprB) (24, 89). Six resistance-nodulation division (RND) family efflux pumps have been described for P. aeruginosa, although 12 have been identified genetically (230). These efflux pumps can eject a wide range of antibiotics; for example 21  MexAB-OprM and MexXY-OprM can efflux -lactams, chloramphenicol, fluoroquinolones, macrolides, novobiocin, sulphonamides, tetracycline, and trimethoprim and aminoglycosides (150, 230). The -lactamase, AmpC, is located in the periplasm and can efficiently hydrolyze penicillins and cephalosporins (and other classes of -lactams but to a lesser degree). It is expressed at low levels but can be induced by sub-inhibitory concentrations of -lactams. The resistance imparted by AmpC is intricately connected to low outer membrane permeability, as the concentration of efficiency and rate by which  -lactams in the periplasm is dependent on the  -lactams are transported through the porins of the outer  membrane (113). Acquired resistance can be the result of the genetic transfer and subsequent expression of a resistance cassette taken up by the bacterium or it may be the result of mutations in the regulatory genes that stabilize or enhance intrinsic resistance mechanisms (24). DNA elements such as plasmids and transposons can be passed among bacteria via conjugation, transformation or transduction. DNA elements that contain drug resistance cassettes can impart resistance to one or more antibiotics in the otherwise susceptible recipient. Transferred genetic elements can also reinforce the intrinsic resistance of P. aeruginosa; for example, the transfer and expression of a second  -lactamase can increase resistance to  particular -lactam antibiotics and/or increase the range of -lactams that can be resisted. Acquired resistance also occurs when a mutational event in a regulatory gene causes dysregulation of a pre-existing resistance mechanism. For example, mutation in mexZ, which suppresses expression of mexXY, leads to overexpression of the MexXY efflux pump (168). Mutations that result in alterations of an antibiotic’s target can also confer resistance as is the case for flouroquinolone resistance where a mutation in DNA gyrase or topoisomerase reduces the binding affinity of the enzyme for this antibiotic (24, 230). Adaptive resistance occurs when exposure to sub-lethal levels of antibiotics causes a change in gene expression resulting in an upregulation of genes that can confer resistance, as is the case for AmpC as described above (24). Another well-known adaptive resistance mechanism in P. aeruginosa causes resistance to cationic antimicrobial peptides. Under conditions of limiting Mg2+, the sensor kinases PhoQ and PmrB independently upregulate the expression of the arnBCADTEF-udg operon which causes the synthesis and addition of aminoarabinose to lipid A (172, 174). This modification lessens interactions of these cationic 22  peptides with the outer membrane by reducing the negative charge of LPS. In sub-lethal concentrations of cationic peptides, the sensor kinase ParS also induces expression from this operon to give the same effect (59). When Mg2+ levels return to millimolar concentrations or when the cationic peptide concentration is reduced, susceptibility eventually returns.  1.5.  Two-Component Regulatory Systems  Two-component regulatory systems (TCSs) are one of the main regulatory families that are used by a bacterium to rapidly adapt to changes in its environment. These systems generally consist of a membrane-bound sensor kinase (SK) that detects an extracellular stimulus and a cytoplasmic response regulator (RR) that acts to affect cellular change. In the classical scheme of two-component signal transduction, the SK detects an external signal (e.g. ligand binding) which causes a conformational change and autophosphorylation at a conserved histidine residue. The SK then transfers the phosphate group to a conserved aspartate on the N-terminal of the RR, thereby activating the regulator’s C-terminal output domain, frequently a helix-turn-helix DNA-binding domain (70, 74). The activated RR proceeds to alter the expression of particular genes to cause a response to the stimulus. This process is reversible and dephosphorylation of the RR serves to return the cell to its previous state TCSs are diverse and as such structural and functional modifications of this classical system exist. Hybrid SKs can contain multiple phosphodonor and phosphoacceptor sites and can promote multi-step phosphorelay schemes with small histidine relay proteins while not all RRs have DNA-binding effector domains (240). The effector domain of a RR may function as an enzyme, an intermediary in a phospho-transfer reaction, or may interact with other proteins. Further, small molecules such as acetyl phosphate can serve as phosphodonors to RRs (240). It is also possible for multiple SKs to phosphorylate the same RR or for a single SK to phosphorylate several RRs, as is the case for chemotaxis, in which a single SK, CheA, phosphorylates two RRs, CheB and CheY (146) or in the quorum sensing cascade of Vibrio harveyi where the SKs LuxN, LuxQ and CqsS can each transfer the phosphate to LuxU (120). In P. aeruginosa there are a predicted 64 sensor kinases and 72 response regulators, the highest of any known bacterium that can act as a pathogen (74, 220). For comparison, this is 23  roughly twice the number found in Escherichia coli (30 and 32 respectively) while the tiny 0.58 Mb genome of Mycoplasma genitalium encodes none at all (120). Some non-pathogenic bacteria have considerably more, including the similarly sized genome of Anabaena sp. (131 and 80) and the very large genome of Myxococcus xanthus (132 and 119), while others such as Bacillus subtilis have fewer (36 and 34) (120). The two-component systems in P. aeruginosa are often arranged as a RR encoded upstream of its cognate SK in an operon (29 systems) although almost as many are encoded in the reverse orientation (21 systems). The rest are not physically linked to any other two-component gene and are termed “orphans”; this physical separation makes it difficult to predict cognate pairings (74).  1.6.  PhoP-PhoQ Two-component Regulatory System  The two-component system PhoP-PhoQ has been identified in several pathogenic Gramnegative bacteria where it functions in controlling virulence, cationic antimicrobial peptide resistance, and response to Mg2+-limiting environments. The response regulator, PhoP, was first identified in Salmonella as controlling the expression of a nonspecific acid phosphatase, hence the “pho” in phoPphoQ. Only later was it realized to be necessary for virulence in mice and survival inside phagocytic cells (80, 182). This moniker has stuck even though it does not reflect the PhoP-PhoQ system as we currently understand it. In Salmonella as well as a host of other pathogenic bacteria in which the PhoP-PhoQ system has been identified, including Shigella flexneri, Yersinia pestis, Photorhabdus luminescens, and Erwinia carotovora, inactivation of either of the phoP or phoQ genes attenuates virulence (122). In P. aeruginosa, only inactivation of phoQ results in attenuated virulence, making the system in this bacterium noticeably different (75). A schematic is shown in Figure 1.3. It is not just virulence by which the PhoP-PhoQ system differs between Salmonella and P. aeruginosa. Mutations of either phoP or phoQ in Salmonella result in super-susceptibility to cationic antimicrobial peptides such as polymyxin B; further, in the wildtype, both genes are induced upon exposure to such peptides, as well as acidic pH or limiting Mg2+ or Ca2+. In contrast, mutations of P. aeruginosa phoQ result in as much as 64-fold increased resistance (not super-susceptibility) to polymyxins, and PhoQ seems only to respond to limited Mg2+. Previous studies, and data presented in this thesis, have also shown that P. aeruginosa phoQ 24  Figure 1.3 The PhoP-PhoQ two component system in P. aeruginosa. Surplus Mg2+ causes the sensor kinase PhoQ to dephosphorylate PhoP. Under limiting Mg2+ conditions, the response regulator PhoP is thought to be phosphorylated by an unknown sensor kinase, indicated by a question mark. The operon consists of three genes: oprH is the first gene and encodes an outer membrane protein that becomes the major protein in the outer membrane under Mg2+-limiting conditions; phoP and phoQ follow and overlap each other by 13 bp.  mutants demonstrate deficiencies in biofilm formation, attachment, twitching and swarming motilities and in virulence (26, 75). Mutations in phoP result in a phenotype that is barely distinguishable from the wildtype (75, 157). The PhoQ sensors of P. aeruginosa and Salmonella are structurally and functionally different. Salmonella PhoQ-null strains that are complemented with phoQ from P. aeruginosa can grow well in low divalent cation medium, but are unable to respond to cationic antimicrobial peptides and respond poorly to acidic pH (7). Further, these strains remain defective for virulence in a systemic infection of mice (213). These differences may reflect the distinct environmental niches these two bacteria inhabit. Salmonella is an intracellular pathogen which invades macrophages, where phagosomes would be both acidic and rife with cationic antimicrobial peptides. P. aeruginosa in contrast is an extracellular pathogen; therefore the role of pseudomonal PhoQ in contributing to virulence is less obvious. 25  The observation that phoP mutants of P. aeruginosa are phenotypically similar to the wildtype and that phoQ mutants are phenotypically different (75, 157) suggests that the classical two-component signal transduction cascade described previously whereby the SK phosphorylates its cognate RR might not be relevant for the Pseudomonas system. Furthermore, phoQ mutants demonstrate dysregulation of more than 450 genes (75) whereas phoP mutants show dysregulation in only 19 (172). It has been proposed (157) that PhoQ acts primarily as a phosphatase of PhoP, rather than as a kinase, although the nature of the kinase that phosphorylates PhoP and the signal to which it responds are unknown.  1.6.1. ROLE OF PHOPQ IN LIPID A MODIFICATION A major phenotype of a phoQ mutant in P. aeruginosa is its high resistance to cationic antimicrobial peptides, such as polymyxins (75, 156, 157). This is mediated largely by the induction of the arnBCADTEF-udg operon (a.k.a. pmrHFIJKLME) which encodes a series of enzymes responsible for the synthesis and addition of aminoarabinose (L-Ara4N) to one or both phosphates of the lipid A moiety (17, 174, 190). This modification lessens the overall negative charge of lipid A, making it less susceptible to disruption by large cationic molecules during their self promoted uptake across the outer membrane. The induction of the arn operon is dually controlled by the PmrA-PmrB and PhoP-PhoQ two-component systems in response to limiting Mg2+ and further regulated by ParR-ParS in response to cationic antimicrobial peptides (59). Polymyxin resistant clinical isolates have had their resistance traced to mutations in the regulatory regions of either of the PhoP-PhoQ or PmrA-PmrB systems (13, 227). While phoQ mutants demonstrate substantial upregulation of the arn operon (75, 258), the lipid A of phoP mutants is not modified with aminoarabinose (55) and the overexpression of phoP in a wildtype background leads to a phoQ-like constitutive polymyxin resistance (156). Lipid A modifications due to PhoQ have only recently been investigated (181), revealing the addition of L-Ara4N.  1.7.  Objectives and Goals  1.7.1. THE CONTRIBUTION OF TCSS TO CYTOTOXICITY TCSs control many aspects of bacterial physiology and are therefore intensely scrutinized by bacteriologists. One aspect of P. aeruginosa virulence is toxicity to host cells yet the 26  contributions of various TCSs to cytotoxicity remains patchy as few large scale screens have been performed to identify those TCSs that might contribute. A screen of TCS mutants with respect to their abilities to cause cytotoxicity would help to increase our understanding of how P. aeruginosa adapts to a host environment as well how its toxic mechanisms are regulated. My first objective was to perform such a screen.  1.7.2. THE CONTRIBUTION OF PHOQ TO VIRULENCE The observation that phoQ disruption in P. aeruginosa results in both reduced pathogenesis and increased cationic antimicrobial peptide resistance indicates that its effects on virulence and persistence in vivo are not necessarily mediated through such resistance to host peptides (which would logically lead to increased competitiveness in vivo). Furthermore, mammals are not deficient in divalent cations having millimolar Mg2+ and Ca2+ in most tissues and body fluids so induction of PhoQ by limiting Mg2+ is unlikely. The potential for cationic antimicrobial peptides to serve as the major host-induced mechanism for induction of this system, as in the case of Salmonella and Yersinia, is also unlikely as studies have shown that P. aeruginosa PhoQ does not respond to cationic antimicrobial peptides (144, 213). While it is known that phoQ mutants are deficient in several virulence-associated factors, their contribution to the known phoQ defects in cytotoxicity and in vivo competitiveness are unclear. An objective of my thesis was to elucidate these contributions.  1.7.3. THE PHOSPHORYLATION OF PHOP As evidence suggests that PhoQ acts primarily to dephosphorylate PhoP, some other sensor kinase must act as the phospho-donor. My third objective was to find that sensor kinase.  27  2. Pseudomonas aeruginosa Interaction with Human Bronchial Epithelial Cells 2.1.  Introduction  P. aeruginosa is one of the most common pathogens responsible for respiratory infections of hospitalized patients. Airway infections can be of two types, acute or chronic, and transmission can be either hospital- or community-acquired, although the latter is rare (5, 94). The vast majority of patients with a pseudomonal lung infection have a serious underlying medical condition, such as neutropenia, cystic fibrosis, or obstructive pulmonary disease. In such cases, the development of acute nosocomial pneumonias is often facilitated by the alteration of the natural defensive state of the conducting airways that results from endotracheal intubation; specifically these are mechanical injury to the epithelia due to insertion of the endotracheal tube, the colonization of the endotracheal tube by microorganisms, and the entry of pathogens through aspiration of oral and gastric contents (223). In a 2008 survey of antimicrobial resistant pathogens, P. aeruginosa ranked second for ventilator associated pneumonia (VAP), behind only Staphylococcus aureus (100). Chronic lung infections are also commonly caused by P. aeruginosa. In patients with cystic fibrosis (CF), P. aeruginosa becomes the dominant microorganism in the lung by adolescence (72). The airway epithelium is the first line of defense against infectious agents, acting as a physical barrier, an escalator for the mucociliary removal of particulate matter, a sentry for the innate immune system, and a factory for the production and secretion of mucins, surfactant proteins, complement molecules, and antimicrobial peptides (108, 252). Several other cell types also play a role in the immunological defense of the airways, including dendritic cells, T cells, macrophages, and neutrophils (108, 223). The clearance of P. aeruginosa from the airways therefore involves the coordinated effort of a multitude of cell types, and the symptoms and outcome of a P. aeruginosa infection in turn depends on both the virulence factors expressed by the bacterium as well as the host response. P. aeruginosa produces many enzymes that contribute to the death of host epithelial cells and which serve to cause new tissue damage or to exacerbate previous tissue damage leading to dissemination of the pathogen. These cytotoxic effectors have been best described in acute infections, as isolates from chronic infections show wide phenotypic variation and have a 28  tendency to down-regulate their cytotoxic capabilities. The T3SS has been well documented as contributing to the severity of acute lung infections, particularly so for the T3SS effector ExoU, a potent phospholipase that degrades cell membranes (96, 221). Proteases such as alkaline protease and protease IV have been shown to degrade corneal epithelia in murine models and participate in the pathogenesis of acute keratitis (103, 166). Although their role in lung infection is less clear, pseudomonal proteases can disrupt tight junctions. These junctions bind epithelial cells together at the apical surface and prevent the movement of molecules between neighboring cells (256). Exotoxin A is an ADP-ribosylating protein that binds host cell elongation factor 2 (EF2), halting protein synthesis and leading to the death of the host cell (226). The ability of P. aeruginosa to inhabit and adapt to different environments is due largely to its repertoire of two-component regulatory systems (TCSs). These systems control practically all aspects of cellular function and multiple systems regulate various aspects of virulence, one facet of which is direct cytotoxicity to host epithelium. A few of these two-component systems have been identified and characterized in their contribution to virulence or to virulence-related phenotypes, but relatively few have shown direct contributions to the cytotoxic aspect. One of the best described systems is GacA-GacS. The GacA-GacS is a TCS which controls various aspects of virulence through a multi-tiered regulatory network involving the hybrid sensors LadS and RetS (reciprocally regulating GacA) and the small RNAs RsmZ and RsmY (which control levels of free RsmA) (74). The GacA-GacS-Rsm system controls the switch between a virulent motile state with increased expression of T3SS effectors and a sessile state in which the bacteria down-regulate several virulence factors and grow as a biofilm (76, 188). Other systems which have shown a role in the cytotoxic aspect of virulence include CbrA-CbrB (271)and PhoP-PhoQ (75), but many more remain uncharacterized and it is likely that many of the uncharacterized systems also play a role in virulence. In this chapter, I developed an airway epithelial model for P. aeruginosa cytotoxicity and used it to screen P. aeruginosa two-component system mutants for altered cytotoxic ability. Some non-two-component system mutants were also tested and have been included here.  29  2.2.  Materials and Methods  2.2.1. BACTERIAL STRAINS AND GROWTH For the cytotoxicity screen, transposon mutants of P. aeruginosa strain PAO1 were obtained from the UBC mini-Tn5-lux library (145) or the University of Washington library (112) as indicated in Table 2.1. All strain PA14 transposon mutants were obtained from the Harvard University library (148). P. aeruginosa strain PAO1 phoQ, phoP, and phoQ complemented with pucPphoQ+ have been described previously (75, 156). P. aeruginosa strain PAK was used for specific experiments where indicated. All strains were grown in Luria-Bertani broth (LB) or Basal Medium 2 (BM2, 7 mM (NH4)2SO4, 40 mM K2PO4, 22 mM KH2PO4, 20 mM glucose, 2 mM MgSO4, 40  M FeSO4) at 37°C overnight with agitation and applicable antibiotics: 30  g/ml tetracycline for PAO1 transposon mutants, 15  g/ml gentamicin for PA14 transposon  mutants, phoP and phoQ mutants in PAO1, and 300  g/ml carbenicillin for phoQ+. For  interaction assays, strains and mutants were grown to log phase in LB without antibiotics. Growth curves were performed using a 1/100 dilution of overnight LB culture into 100 l/well fresh BM2 media containing 20 mM glucose, succinate, fumarate or malate in a 96-well plate. Growth was measured as turbidity at optical density (OD) at 620 nm in a TECAN Spectrafluor Plus.  30  Table 2.1 Mutants of PAO1 and plasmids used. PA14 mutants were all from the Harvard University transposon library (148) and are listed in Table 2.2. Locus ID (PA number) PAO1 PA1179 PA1180 pUCPphoQ+ 1080 1092 1098 1099 1249 1803 2862 2863  Gene name  Genotype  Reference  WT phoP phoQ phoQ+  Wild-type P. aeruginosa PAO1; lab strain H103 phoP::xylE-aacC1; GmR, derivative of WT phoQ::xylE-aacC1; GmR, derivative of WT phoQ mutant with pUCP22-phoQ+; GmR, CbR  Lab collection (156) (75) (75)  flgE fliC fleS fleR aprA lon lipA lipH  Flagellar hook protein, FlgE Flagellin type B Two-component sensor kinase FleS Two-component response regulator, FleR Alkaline metalloproteinase precursor Lon protease Lactonizing lipase precursor Lipase modulator protein  3191 3724 4175  lasB piv  4493  roxR  4494 4525 4813 5255  roxS pilA lipC algQ  pUCP20gfpmut3  (145) (112) (145) (145) (112) (145) (145) (112) (112) transformed Probable two-component sensor into H103 Elastase LasB (112) Protease IV (112) (148) transformed Two-component response regulator, RoxR into H103 (148) transformed Two-component sensor kinase, RoxS into H103 Type 4 fimbrial precursor (112) Lipase LipC (145) Alginate regulatory protein, AlgQ (145) Green fluorescent protein (gfp) mutated at S65G (37, 40) and S72A (clone 3 or “mut3”) and cloned behind lac promoter in pUCP20  2.2.2. CELL CULTURE The SV40-transformed, immortalized 16HBE14o- human bronchial epithelial cell line (HBE cells) was a gift from Dr. D. Gruenert (University of California, San Francisco, CA). These cells were grown as monolayers in minimal essential medium (MEM) with Earle’s salts containing 10% FBS and 2 mM L-glutamine with phenol red (Gibco). Polarized cells were induced by seeding HBE cells onto Transwell plates (Corning) in complete MEM containing 100 U/ml penicillin and 100 g/ml streptomycin (Invitrogen) and growing for approximately 14 days while 31  monitoring transepithelial resistance (Millipore) and changing media every 2 days. Experiments (infections and stimulations) were performed in MEM containing 1% FBS and 2 mM Lglutamine.  2.2.3. STIMULATION OF HBE CELLS WITH TLRS Polarized HBE cells were stimulated either apically or basolaterally for 12 hours with 1 g/ml flagellin from Salmonella typhimurium (InvivoGen), 50  g/ml polyIC (InvivoGen), 3  g/ml peptidoglycan from Staphylococcus aureus (InvivoGen), 2 g/ml lipotechoic acid from S. aureus (InvivoGen), or 500 ng/ml lipopolysaccharide from P. aeruginosa isolated via the Darveau-Hancock method as described in Chapter 4 (42). Release of chemokines into the cell culture supernatant was measured by enzyme-linked immunosorbant assay (ELISA) using antihuman IL8 (Biosource cat. # AHC0982 and AHC0789) and anti-human GRO antibodies (R&D Biosystems cat. # MAB275 and BAF275).  2.2.4. TUNEL AND MICROSCOPY HBE cells were seeded into an 8-well chamber slide (Nunc Lab-Tek), in complete MEM and grown to confluence at 37°C and 5% CO2. HBE cells were washed with serum free MEM and then rested for a minimum of 30 min in the same medium. Logarithmic phase WT strain PAK was washed with PBS and resuspended in serum-free MEM before inoculation onto the HBE cells at an MOI of 100. As a positive control, the apoptosis inducer H2O2 (Sigma) was added to the chamber at 300 M. HBE cells were then incubated at 37°C and 5% CO2 for 5hrs. TUNEL staining (terminal deoxynucleotidyl transferase dUTP nick end labeling) was performed as per the manufacturer’s instructions (Promega). HBE nuclei were stained with DAPI (4',6-diamidino2-phenylindole) (Vector Laboratories). The cultures were visualized on a Nikon Eclipse TE20005 with a CoolSnap ES camera and Image Pro Plus software. Confocal microscopy was performed on an Olympus Fluoview 1000 microscope at the Centre for Drug Research and Development (CDRD) using P. aeruginosa PAO1 harboring plasmid pucP20::gfpmut3. Rhodamine phalloidin was used to stain actin (Invitrogen), and DAPI to stain HBE nuclei. For direct visualization of the effects of P. aeruginosa interaction with the monolayer, HBE cells were seeded onto sterile 25 mm diameter round glass coverslips placed on the bottom of 6-well plates. A low inoculum of MOI 20 P. aeruginosa PAO1 was used in an attempt to reduce the stress on the monolayer from 32  the combined stresses of infection and subsequent staining procedures. 100 mM NaN3 was used as a control for toxic lysis. After 1 and 5 hours co-incubation, the glass coverslips were removed, washed with PBS, fixed with 4% formaldehyde in PBS, and stained with 0.7% crystal violet.  2.2.5. CYTOTOXICITY ASSAYS HBE cells were seeded into 96-well tissue-culture treated plates and grown to confluence at 37°C and 5% CO2 in minimal essential medium (MEM) containing 10% fetal bovine serum (FBS) and 2 mM L-glutamine with phenol red (Gibco). The monolayer was washed with MEM containing 1% FBS and 2 mM L-glutamine then rested for a minimum of 30 min in the same medium. Bacteria were grown to logarithmic phase in LB at 37°C with agitation, enumerated by optical density (OD) at 600 nm, washed in PBS, then resuspended and diluted in MEM plus 1% FBS and 2 mM L-glutamine. The HBE monolayer was infected at starting multiplicity of infection (MOI) 50 to 100 for 16-20 h for strain PAO1 and at a MOI 2 for 8-10 h for strain PA14 at 37°C and 5% CO2. Media was removed after co-culturing and centrifuged to remove bacteria and stored at 4ºC. Cytotoxicity was measured by the release of cytosolic lactate dehydrogenase (LDH) from epithelial cells into the media using a kit (Roche Applied Sciences).  2.2.6. BIOFILM AND MOTILITY ASSAYS Static microtitre biofilm assays were performed as previously described (205). After overnight incubation at 37°C without agitation in LB, media and non-adhered cells were discarded and the wells washed with deionized H2O. Surface-attached (biofilm) bacteria were stained with 0.1% crystal violet for 20 min, then washed again with deionized H2O. Crystal violet bound to attached cells was dissolved with ethanol and the biofilm quantified by absorbance at 600 nm. Flagellar based swimming motility was analyzed by inoculating 1 l of overnight culture into LB containing 0.25% agar and the within-agar swim zone diameter measured after overnight incubation at 37°C. Type IV pili mediated twitching motility was performed by inoculating 1 l of an overnight culture through to the plastic surface of a thinly poured 1% agar LB plate and, after overnight incubation at 37°C measuring the diameter of the twitch zone that formed at the interface between the plastic surface and the agar. Swarming motility was carried out on BM2-glucose plates containing 0.5% agar and 0.1% casamino acids  33  in place of (NH4)2SO4. 1 l of overnight culture was inoculated onto the surface of swarm plates and the plates were incubated at 37°C overnight.  2.3.  Results  2.3.1. RESPONSE OF HBE CELLS TO TLR AGONISTS Airway epithelial cells protect the lungs from infection by forming a physical barrier and by acting as sentinels to assist in the initiation of an inflammatory response (108). Nevertheless, conflicting results exist in the literature for airway epithelial cell lines in terms of the pattern recognition receptors (PRRs) expressed, and in particular the Toll-like receptors (TLRs). Studies typically demonstrate the transcription of nearly all TLRs (79, 111, 192, 231), however data regarding protein expression of the TLRs varies and reports seem to suggest polarization of TLRs to either the apical or basolateral surfaces of the epithelial cells (118, 192). Further, expression of the TLRs does not necessarily result in signal transduction and an inflammatory response as accessory molecules are often required (e.g. MD2 for TLR4 signaling). I wished to use the SV40-immortalized cell line 16HBE14o- (HBE cells) as an in vitro infection model for P. aeruginosa. These cells can be polarized and are capable of forming tight junctions (135, 256). To observe how the HBE cells responded to conserved pathogen signature molecules known to induce TLR-mediated responses, they were polarized and stimulated apically or basolaterally with different TLR agonists for 12 hours (Figure 2.1). Release of the chemokines IL8 and GRO  were strongest when the HBE cells were stimulated with the TLR3 agonist  polyIC, a synthetic compound of polyI:polyC mimicking dsRNA of viruses, and next strongest when stimulated with the TLR5 agonist bacterial flagellin (Figure 2.1); most of this release was at the apical surface, regardless of which surface of the cell was stimulated. Very little release of chemokines was observed for the TLR2 agonists peptidoglycan and Gram positive bacterial lipotechoic acid or for the TLR4 agonist lipopolysaccharide from Gram negative bacteria. This test revealed that the HBE cells were able to induce an inflammatory response to some but not all conserved pathogen moieties.  34  Figure 2.1 Polarized HBEs preferentially secreted chemokines in response to TLR agonists polyIC and flagellin. Shown is the secretion of GRO (A) and IL8 (B) into the upper (dark grey) and lower chambers (light grey) of a transwell plate when the agonist was applied to the apical or basolateral sides as indicated. Lipotechoic acid (LTA) 2 g/ml, poly IC 50 g/ml, lipopolysaccharide (LPS) 0.5 g/ml, peptidoglycan (PGN) 3 g/ml, flagellin (FLA) 1 g/ml. Shown is the mean with standard deviation.  35  2.3.2. P. AERUGINOSA CAUSED HBE CELL CYTOTOXICITY BY NECROSIS. While the HBE cells were able to respond strongly only to TLR5 and TLR3 agonists (Figure 2.1), in culture, epithelial cells cannot eradicate a P. aeruginosa infection, a task that is normally performed by neutrophils or alveolar macrophages in vivo (223). Furthermore, P. aeruginosa has many known cytotoxins that can be secreted (by type 1 or 2 secretion systems) or injected (by T3SS) to cause host cell death. Many of these toxins, such as the phospholipases which degrade host cell membrane phospholipids, cause cell lysis, yet P. aeruginosa has been shown to induce apoptosis in a variety of cell types, including bronchial epithelial cells (78, 218, 228). To see if P. aeruginosa caused apoptosis in this cultured epithelial cell infection model, the TUNEL system (Figure 2.2A) was utilized to detect DNA fragmentation resulting from apoptotic signaling cascades. While the H2O2 positive control demonstrated a majority of HBE cells with fragmented DNA, very few HBE cells showed this when infected with P. aeruginosa for 5 hours, revealing that apoptosis did not play a significant role in early epithelial cell death in this model system. Necrosis of the HBE cells, as indicated by the disappearance of cytoplasm and the emergence of lesions in the monolayer, was apparent when infected epithelial monolayers were stained with crystal violet and compared with azide as the lytic control (Figure 2.2B). No membrane blebbing consistent with apoptosis was visible. Confocal fluorescent microscopy further confirmed death by necrosis (Figure 2.3) as HBE cells lost their cytoplasm as indicated by the disappearance of actin filaments leaving an intact nucleus that was not fragmented or condensed as would be the case in apoptosis.  36  Figure 2.2 Cytotoxicity of P. aeruginosa to HBEs was necrotic. (A) Log phase WT strain PAK was inoculated onto the HBE cells at an MOI of 100. As a positive control, the apoptosis inducer H2O2 (Sigma) was added to the chamber at 300 M. HBE cells were then incubated at 37°C and 5% CO2 for 5 hours. TUNEL staining (green) for DNA nicks characteristic of apoptosis using H2O2 as an apoptosis positive control. P. aeruginosa PAO1 caused limited apoptosis. Nuclei of HBEs were stained with DAPI (blue). (B) Crystal violet staining of HBEs incubated with an MOI of 20 P. aeruginosa PAO1 per HBE cell for 1 and 5 hours. NaN3 caused lysis of the cells and was used as a lytic control. Lesions appear in both NaN 3-treated and P. aeruginosa infected HBE monolayers particularly at 5 h post-infection. Bacteria appear as small black specs in the monolayer. 37  Figure 2.3 P.aeruginosa PAO1 destroyed HBE cells by necrosis rather than apoptosis. HBE nuclei (blue) remained intact (arrows) rather than fragmenting or condensing which would occur in apoptosis. Cellular membranes did not show ruffling typical of apoptosis. Rather the cytoplasm was ruptured to leave the intact nucleus exposed (arrows). Cellular actin is stained red, P. aeruginosa is green.  38  Figure 2.4 The cytotoxicity of P. aeruginosa to HBE cells over time. (A) Strain PAO1 was inoculated onto HBE cells at MOI 50-100 and co-incubated at 37°C and 5% CO2. Media was removed at the indicated time points and assayed for the release of LDH from the HBE cells as an indicator of HBE cell death. The percentage of cytotoxicity compared to HBE cells lysed with 1% Triton X-100 is shown. (B) Strain PA14 was inoculated onto the HBE cells at MOI 2 owing to its known increased virulence. These results represent one representative experiment of each PAO1 and PA14 with standard deviation of the means.  2.3.3. CYTOTOXICITY PROFILES OF PAO1 AND PA14 A major concern regarding P. aeruginosa is its ability to cause opportunistic nosocomial lung infections in humans. Two-component regulatory systems (TCS) provide Pseudomonas with the ability to rapidly adjust to changing conditions in the environment, including the host, and in this respect potentially control many aspects of P. aeruginosa cellular life, including virulence. As one aspect of P. aeruginosa virulence is cytotoxicity, I sought to determine which TCSs contributed to this phenotype by screening a mutant library for increased or decreased ability to kill cultured HBE cells. However, prior to conducting this screen, it was first necessary to determine the kinetics of HBE cell death when infected with wildtype P. aeruginosa in order to choose an appropriate starting inoculum of bacteria and an end time point. A time course was set up for strain PAO1 at a multiplicity of infection (MOI) of 50-100 based on similar techniques used by others in this laboratory (38, 153). The cytotoxic effects were measured by the release of lactate dehydrogenase (LDH) from the epithelial cells (Figure 2.4A). As expected, the toxicity to the HBE cells gradually increased over time, but never 39  reached 100% cell death. Based on this, I chose an MOI of 50-100 and an incubation time of approximately 20 hours for strain PAO1. The strain PA14 is well known to be considerably more virulent than strain PAO1. Initial experiments using MOI of 50-100 resulted in an extremely rapid destruction of HBEs that made quantification of death difficult. To account for this, the MOI was reduced to 2 for a PA14 infection, a number that still ensured that every HBE cell would be outnumbered by bacteria. The kinetics of strain PA14 differed considerably from PAO1 (Figure 2.4B). The death of the HBE cells increased to a peak of 75% at 7 h post-infection, then drastically and surprisingly decreased. This decrease in cytotoxicity was at first perplexing, since it was not possible that HBE cells could be returning to life. It was more likely due to the secreted pseudomonal proteases degrading the released LDH enzyme. For this reason, an MOI of 2 and a time of 8 h postinfection were selected for strain PA14.  2.3.4. CYTOTOXICITY SCREEN OF PA14 To determine which TCSs contributed to cytotoxicity, all available two component regulatory system mutants from the Harvard University strain PA14 library were screened for cytotoxicity to HBE cells (Table 2.2). These consisted of 48 sensor kinases, 51 response regulators, 6 hybrid sensor/regulators, and 4 other regulators. A few non-regulatory genes were included as part of collaborations with others in the lab. Although preliminary experiments were performed with strain PAO1, the limited reliability and scope (with respect to TCS mutants) of the PAO1 mutant library meant that only a limited number of PAO1 mutants were studied. Some mutants demonstrated obvious deficiencies in their ability to lyse epithelial cells compared to WT. Specifically, several regulators relating to adherence and biofilm formation showed decreased cytotoxicity relative to WT. The regulator algR of the AlgR-FimS twocomponent system showed a substantial decrease in cytotoxicity (39% of WT). This regulator is known to have a role in several aspects of P. aeruginosa virulence, including alginate, LPS, biofilm, and hydrogen cyanide production (29, 259), twitching and swarming motilities (74, 205), as well as a demonstrated attenuation in murine models (151). To my knowledge, this is the first account that algR contributes to cytotoxicity. Several other TCSs demonstrated a contribution to cytotoxicity, including those involved in type IV pili (pilG, pilH, pilS-pilR) and flagella mediated motility (fleQ, fleS-fleR), cyclic-di-GMP signaling (Roc and WspR systems), 40  metabolism (cbrA-cbrB, dctB-dctD, ntrB-ntrC), as well as some systems that remain unannotated. The cytotoxicity of each of these systems is discussed in detail below.  Table 2.2 Cytotoxicity screen of P. aeruginosa strain PA14 regulator and sensor kinase mutants to HBE cells at 8 h post-infection. Shown is the mean average of the mutant as a percentage of WT. A minimum of three experiments were performed for each unless otherwise noted. PAO1 reference number 34 150 178 179 408 409 463 464 600 601 756 757 928 930 1097 1098 1099 1157 1158 1179 1180 1243 1301 1336 1347 1396 1422 1437 1438 1458 1636 1727  Gene name  pilG pilH creB creC  gacS fleQ fleS fleR  phoP phoQ  gbuR  kpdD  Description  Avg. %WT  Std. Error  Probable two-component response regulator Putative transmembrane sensor Putative two-component sensor Probable two-component response regulator Type IV pili response regulator PilG Type IV pilus response regulator PilH Two-component response regulator CreB Two-component sensor CreC Putative histidine kinase Probable two-component response regulator Probable two-component response regulator Probable two-component sensor Sensor/response regulator hybrid Two-component sensor Transcriptional regulator FleQ Two-component sensor, FleS Two-component response regulator, FleR Probable two-component response regulator Putative two-component sensor Two-component response regulator PhoP Two-component sensor PhoQ Probable sensor/regulator hybrid Putative transmembrane sensor Putative two-component sensor Probable transcriptional regulator Probably two-component sensor Transcriptional regulator GbuR Probable two-component response regulator Probable two-component sensor Probable two-component sensor Two-component sensor KdpD Putative integral membrane sensor domain  108.9 101.4 107.5 103.1 28.8 26.8 94.2 109.9 95.9 119.9 103.3 109.4 129.7 109.9 77.6 20.6 12.3 107.5 113.8 105.4 121.1 94.9 111.2 110.1 106.6 98.5 95.5 106.7 111.6 144.3 109.8 113.0  5.1 3.0 4.1 4.1 4.4 2.7* 3.3 5.4 7.0 4.2 1.3 4.9 12.5* 3.5 12.7 6.7 0.8 3.8 5.7 2.7* 5.7 2.6* 8.2 0.3 1.3 3.5 4.5 3.1 4.5 6.3 4.5 4.5 41  PAO1 reference number 1785 1798 1799 1803 1851 1976 1980  Gene name nasT parS lon ercS  2051 2177 2388 2409 2479 2523 2524 2572 2583 2586 2656 2687 2798 2809 2810 2824 2882 3044 3045  gacA pfeS copR copS  3077 3078 3191 3192 3206 3271 3343 3346 3409 3587  gltR  Description Response regulator NasT Two-component sensor, ParS Putative two-component response regulator Lon protease Putative two-component response regulator Putative two-component sensor ErcS Putative two-component response regulator Putative Fe2+-dicitrate sensor, membrane component Putative histidine kinase Putative transmembrane sensor Putative permease of ABC transporter Probable two-component response regulator Probable two-component response regulator Probable two-component sensor Probable two-component response regulator Probable sensor/regulator hybrid Response regulator GacA Probable two-component sensor Two-component sensor PfeS Probable two-component response regulator Two-component response regulator CopR Two-component sensor, CopS Probable sensor/regulator hybrid Probable two-component sensor Probable two-component sensor Probable two-component response regulator Putative two-component system regulatory protein Probable two-component sensor Probable two-component sensor Two-component response regulator GltR Probable two-component sensor Probable two-component sensor Putative two-component response regulator Probable two-component response regulator Putative Fe2+-dicitrate sensor, membrane component Transcriptional regulator MetR  Avg. %WT  Std. Error  103.2 101.9 110.8 105.7 104.4 112.7 98.7  2.6 7.4* 13.4* 6.9 1.9 5.1 5.0  103.9  5.7  100.6 121.6 105.8 107.3 107.4 107.5 111.9 107.9 130.9 98.2 83.7 108.6 106.4 93.7 93.6 139.3 94.1 103.2  4.6 7.9 7.0 4.7 4.1 1.0 5.2 7.6* 13.7 13.6* 5.4* 3.4 5.3 2.3 17.5* 15.7  112.8  9.5  93.9 107.3 98.6 95.9 119.0 108.8 105.7  4.3* 4.4 2.6 16.2* 27.7* 7.1 3.9  102.5  5.7  112.4  1.2  4.0  42  PAO1 reference number  Gene name  Putative DNA-binding response regulator,  3604 3702 3704 3714 3878 3900 3946 3947 3948 4032 4036 4112 4196 4197 4293 4296 4381 4396 4396 4398 4493 4494 4546 4547 4725 4726 4776 4777 4843 4845 4983 5117 5124 5125 5165 5166  Description  LuxR family wspR wspE  narX rocS1 rocR rocA1  bfiS pprA colR  roxR roxS pilS pilR cbrA cbrB pmrA pmrB dipZ typA ntrB ntrC dctB dctD  Two-component response regulator WspR Probable chemotaxis sensor/effector fusion protein Probable two-component response regulator Two-component sensor NarX Putative transmembrane sensor protein, FecR Two-component sensor RocS1 Antagonist of RocA1 response regulator Two-component response regulator RocA1 Probable two-component response regulator Probable two-component sensor Probable sensor/regulator hybrid Putative two-component response regulator Two-component sensor BfiS Two-component sensor PprA Putative two-component response regulator Putative DNA-binding response regulator ColR Putative two-component response regulator Putative two-component response regulator Putative two-component response regulator Two-component response regulator RoxR Two-component sensor kinase RoxS Two-component sensor PilS Two-component response regulator PilR Two-component sensor CbrA Two-component response regulator CbrB Two-component response regulator Two-component sensor kinase PmrB Putative two-component response regulator Thiol:disulfide interchange protein DipZ Putative two-component response regulator Regulatory protein TypA Two-component sensor NtrB Two-component response regulator NtrC Two-component sensor DctB Two-component response regulator DctD  Avg. %WT  Std. Error  99.4  10.1  18.5  2.5  135.2  35.9*  110.9 100.5 110.9 106.1 92.4 53.2 106.0 110.9 97.4 97.7 97.5 112.7 101.9  5.3 10.9 5.6 16.8* 5.3* 0.9 2.6 3.8 9.40 23.7* 2.9 2.4* 1.2*  103.8  2.5  103.0 123.9 105.5 107.0 108.1 113.5 15.7 158.8 133.3 102.1 101.1 108.8 120.5 108.5 109.6 107.6 122.6 13.0 97.1  10.0 15.2* 12.7 3.8 6.4 5.3 15.7* 9.1 14.7* 0.2* 14.3* 3.0 25.7* 5.4 16.6* 13.4* 4.1 5.5* 3.6 43  PAO1 Gene Avg. reference Description name %WT number envZ 5199 Two-component sensor EnvZ 88.5 algR 5261 Alginate biosynthesis regulatory protein AlgR 39.0 5360 Hypothetical protein 104.1 phoR Two-component sensor PhoR 5361 109.6 5364 Putative two-component response regulator 130.4 algB 5483 Two-component response regulator AlgB 98.2 5484 Putative two-component sensor 89.1 mifS 5512 Two-component sensor MifS 125.3 5515 Hypothetical protein 113.9 PA14_59 pvrR Two component response regulator 103.6 790† PA14_59 rcsB Two component response regulator 104.0 770† PA14_59 pvrS Sensor kinase protein 110.0 800† *Standard deviation is given where only two repeat experiments were performed. †  Std. Error 3.6* 25.0* 7.3* 7.8* 9.1 5.9* 8.2* 29.0* 5.6* 4.7 5.2 4.2  The PA14 locus number is given where no homolog exists within PAO1.  44  Figure 2.5 Twitching but not swarming was controlled by regulators of type IV pili. (A) Twitching motility along the agar-plastic interface of LB plates containing 1% agar could be observed as a halo around the surface colony in PA14 WT and a pilS mutant. The non-pilated pilB was used as a control. (B) Swarming motility across the surface of semi-solid 0.5% agar produces colonies with dendritic-like appendages. Only the non-pilated pilB mutant demonstrated a reduction in swarming. 2.3.4.1. MUTANTS  IN TYPE  IV  PILI AND FLAGELLA REGULATORS DEMONSTRATED DECREASED  CYTOTOXICITY  The PilS-PilR two-component system controls the transcription of pilA which encodes the type IV pilin subunit (169). A pilR mutant demonstrated 16% of the cytotoxicity of WT, in stark contrast to a mutant in the sensor kinase pilS which showed no difference. The pilGHIJKLchpABCDE chemosensory gene cluster contributes to the biogenesis of type IV pili and also to the direction and pattern of twitching motility which are essential for initial attachment to inert surfaces, biofilm formation, and pathogenesis in many models (31, 39, 92, 203, 251). The type IV pili regulators, pilG and pilH demonstrated respectively 29% and 27% of the cytotoxicity of WT. Consistent with this pattern, I found that twitching (type IV pili mediated motility along a 45  Figure 2.6 Biofilm formation of type IV regulator mutants (A) and flagellum regulator mutants (B) was altered. Overnight cultures were diluted into LB and grown for 24 hours in polystyrene 96-well plates. The cultures were then removed, the wells washed, and the remaining biofilm stained with crystal violet. The amount of crystal violet bound corresponds directly to the amount of biolfm formed. Student’s t-test, mean average with standard error. Pvalue * <0.05, ** < 0.01, NS not significant.  solid surface) was def icient in the pilG, pilH, and pilR mutants but not in a pilS mutant (Figure 2.5A). Biofilm formation followed a different trend (Figure 2.6A) as only pilR demonstrated a reduction, while pilG demonstrated a slight increase. Swarming motility in P. aeruginosa requires type IV pili as revealed by most analyses (129, 272) consistent with the result for the non-pilated control mutant, pilB (Figure 2.5B) (196); however none of the pilus regulators identified in the cytotoxicity screen demonstrated swarming abnormalities (Figure 2.5B). This indicates that pilus-mediated cytotoxicity is not simply due to the existence of pili but rather must be a function of the way they are controlled that regulates their interaction with epithelial cells. A similar decrease in cytotoxicity was demonstrated for mutants of the flagella twocomponent regulatory system, FleS-FleR (21% and 12% of WT respectively) (Table 2.2). The FleS-FleR system controls the expression of genes encoding basal body, hook and filament proteins in flagellum biogenesis and is itself controlled by the master regulator, FleQ (43), disruption of which led to only a marginal decrease in cytotoxicity. Accordingly, neither fleS nor fleR mutants produce flagella and it has been reported that neither can swim (219) (Figure 2.7A). Mutation of fleQ caused the mutant to swim aberrantly, which was consistent with its partial decrease in cytotoxicity compared to fleR and fleS mutants. Flagella as well as pili are required 46  Figure 2.7 Flagella regulator mutants demonstrated deficiencies in swimming (A) and swarming (B) motilities. Swimming was measured as the ability of bacteria to move through LB-containing 0.25% agar. Swarming was performed on BM2-glucose containing 0.1% casamino acids and 0.5% agar. A non-flagellated fliC mutant was used as a control.  for biofilm formation (203) and swarmin (129), and similarly to the trends shown for swimming and cytotoxicity, fleR and fleS mutants demonstrated approximately 4-fold reductions in biofilm formation, wherease the magnitude of the fleQ reduction was not as great (Figure 2.6B). All three mutants demonstrated substantial deficiencies in swarming (Figure 2.7B). Interestingly, disruption of fleS in strain PAO1 resulted in a much more modest reduction in cytotoxicity compared to the WT (58%), while fleR resulted in very little change (Table 2.3).  47  Figure 2.8 Cytotoxicity of cup fimbria mutants to HBEs in strain PA14.  2.3.4.2. CYTOTOXICITY WAS AFFECTED BY REGULATORS OF C-DI-GMP Two mutants in regulators involved in cyclic-di-GMP (c-di-GMP) signaling networks, wspR and rocA1, were found to display respectively 19% and 53% of the cytotoxicity of the WT bacterium (Table 2.2). C-di-GMP is proposed to principally affect functions related to the switch between the motile, single cell state and the attached multicellular state of a biofilm (115). The levels of c-di-GMP are regulated by diguanyl cyclases (e.g. WspR) and c-di-GMP phosphodiesterases (41, 92). Generally, increased levels of c-di-GMP have been associated with increased matrix production and biofilm formation while low levels of c-di-GMP downregulate matrix production and promote a planktonic lifestyle (92). Signaling via the Wsp chemosensory system (WspABCDEF) results in the activation of the WspR regulator causing the upregulation of adhesion factors, including upregulation of the cupA gene cluster (one of five Cup fimbrial clusters in P. aeruginosa) (41, 73). Mutation of wspE, a predicted sensor/effector hybrid, did not alter cytotoxicity. The Roc two-component system controls the expression of the cupB and cupC gene clusters through the activation of regulator RocA1. RocR acts as a negative regulator of RocA1 by degrading c-di-GMP. Neither RocR nor PvrR (also a c-di-GMP phosphodiesterase which controls the expression of the cupD cluster) altered cytotoxicity in this study or in results reported by others (41). Cytotoxicity was also not altered by mutation of the sensor kinase rocS1, 48  Figure 2.9 The Wsp chemosensary system (A) but not the Roc system (B) affected biofilm formation.Student’s t-test, p-value * < 0.05, *** < 0.001, NS not significant.  suggesting that RocA1 regulates processes pertaining to cytotoxicity independently of activation by RocS1. While the Roc and Wsp systems have been implicated in the regulation of the Cup fimbria, individual mutants of Cup fimbria genes did not show altered cytotoxicity (Figure 2.8). Therefore changes in cytotoxicity may have had more to do with other aspects of c-di-GMP regulation than with Cup fimbria per se. As c-di-GMP is involved in the switch from a planktonic to sessile lifestyle, the ability of Roc and Wsp mutants to form biofilms (Figure 2.9) and to swarm (Figure 2.10) was tested. Mutations in rocA1, rocS1, and rocR did not alter biofilm ability or swarming. Since RocA1 upregulates the cupB and cupC gene clusters, this result may indicate that these two Cup fimbria offer limited contributions to biofilm formation under normal laboratory conditions, a result that has been previously reported (251). Mutation in the Wsp system caused reductions in biofilm formation for the regulator mutant wspR and a probable chemotaxis transducer wspA. In terms of motility, the extent of swarming was diminished in both wspE and wspB. Mutation in wspE led to a slight defect in twitching while a wpsR mutant was completely impaired (Figure 2.10C). Since WspR activates the expression of cupA fimbrial genes which, unlike cupB and cupC, were previously demonstrated to have a role in laboratory induced biofilm formation (251), this may explain why the wspR mutation led to a defect in biofilm formation. The twitching deficiency of wspR might indicate that the Wsp chemosensory system plays a role in regulating type IV pili. 49  Figure 2.10 The Wsp chemosensory system but not the Roc system controlled aspects involving twitching and swarming motilities. (A) Swarming motility of Wsp system mutants. Mutations in wspE and wspB caused reduced swarming. (B) Roc regulatory system did not alter swarming. (C) Mutations in wspE and wspR caused reduction and total inhibition of twitching motilities, respectively.  2.3.4.3. DCTBD TWO-COMPONENT SYSTEM AFFECTS CYTOTOXICITY One additional mutant that demonstrated substantially reduced cytotoxicity was that of the sensor kinase dctB (PA5165), which showed only 13% of the cytotoxicity of WT (Table 2.2). The DctB-DctD two-component system has been well described in rhizobia but has only recently been identified in P. aeruginosa (116, 250, 257). In P. aeruginosa this system controls the expression of two C4-dicarboxylate transport systems, dctA and dctPQM, which are involved in the utilization of tricarboxylic acid (TCA) cycle intermediates as carbon and energy sources (250).  50  Figure 2.11 The DctBD two-component regulatory system controlled growth on C4dicarboxylates. Growth in BM2 minimal media containing glucose (A), succinate (B), fumarate (C) or malate (D).  Inactivation of the DctA and DctPQM transport systems has been shown to reduce growth on the C4-dicarboxylates succinate, fumarate and malate in strain PAO1 (250). Similar growth experiments were repeated here for DctB-DctD regulatory system mutants as well as for individual mutants of the DctA and DctPQM transport systems (Figure 2.11). Growth on glucose was normal for all mutants. Mutations in either the sensor DctB or the regulator DctD caused growth inhibition on the C4-dicarboxylates succinate, malate, and fumarate, similar to a previous report (250); however, mutations in the DctA or DctPQM systems had no apparent effect, in contrast to the study performed by Valentini and colleagues (250). In their study, the PAO1 51  Figure 2.12 Growth of dctB and dctD PA14 mutants on HBE cells after 8 h co-incubation was normal. The MEM medium contained glucose as a basic carbon source and vitamins. The medium was supplemented with 2 mM L-glutamine and 1% FBS.  mutants utilized were deletions of dctA and of the entire dctPQM operon, whereas here I utilized independent dctA, dctP, dctQ, and dctM transposon mutants. It is possible that a partial product could be produced in the dctA mutant that I used, and it may require disruption of all three genes in the dctPQM operon to cause growth deficiency. It is also possible that these differing results may reflect an alternative regulation of the transport system in PA14. The media used in the cytotoxicity experiment contained glucose as a primary carbon source as well as a number of amino acids and vitamins as included by the manufacturer. The turbidity of the co-culture was routinely assessed at the end of the incubation period to ensure that any cytotoxic deficiencies were not due to bacterial growth defects. No change in turbidity was noted for either dctB or dctD mutants; therefore the decrease in cytotoxicity was likely not due to a growth defect during co-culturing (Figure 2.12). Biofilm and motility assays were performed for Dct mutants. In keeping with its reduced cytotoxicity towards HBE cells, the dctB mutant, but not a dctD mutant, revealed reduced biofilm formation and twitching motilities (Figure 2.13)  52  Figure 2.13 DctB from the DctBD regulatory system controlled twitching (A) and biofilm formation (B). Only mutation in dctB caused significant alterations in these properties while mutation in dctD had no effect. Student’s t-test *** p-value < 0.001.  2.3.4.4. ALTERED CYTOTOXICITY BY OTHER REGULATORY MUTANTS Other regulatory mutants demonstrated increased cytotoxicity to HBE cells. Two of these, the probable sensor PA1458 (144% of WT) and putative regulator PA5364 (130%) show sequence similarities to CheA of P. putida and E. coli and CheY respectively, potentially linking them to chemotaxis (43). The expression of PA1458 is dependent on FleQ (43), while a transposon mutant in this gene displayed deficiencies in swimming and swarming motilities, although not in biofilm formation (272). Information on PA5364 is even more limited with sequence homology only predicting it as a regulator. Transposon mutants of cbrA and cbrB also displayed increased cytotoxicity at 8 h (159%, 133%), agreeing with previously described results (271). The CbrA-CbrB two component system controls catabolite repression by regulating the transcription of the small RNA crcZ (236). CbrB belongs to the NtrC family of two-component regulators (147, 195), yet only marginally increased cytotoxicity was observed for the ntrC mutant (123% of WT). Despite the known growth deficiencies of cbrA-cbrB and ntrB-ntrC mutants on several carbon (i.e. acetate, pyruvate, lactate), nitrogen (i.e. nitrite, nitrate, urea) and carbon-nitrogen sources (i.e. arginine, histidine, proline) (147), growth during infections in this experiment was no different from WT as assessed by turbidity measurements taken at the end of the experiment. Interestingly, both 53  Figure 2.14 An oprG mutant is considerably less cytotoxic to cultured HBE cells than the WT at MOI 50 but not at MOI 2.  cbrA-cbrB and ntrB-ntrC mutants show deficiencies in swarming with the former also demonstrating increased biofilm formation (272). Motility and biofilm formation are considered virulence related phenotypes, but they have not been shown to contribute to the cytotoxicity aspect; thus the basis for the increased cytotoxicity of the cbrA and cbrB mutants is not yet understood.  2.3.4.5. THE OUTER MEMBRANE PROTEIN OPRG CONTRIBUTED TO CYTOTOXICITY A few mutants that were not sensors or regulators were included in the cytotoxicity screen; one such mutant was in the gene for OprG, an outer membrane protein belonging to the OmpW family of 8- -barrel porins (210, 247). The outer membrane of Gram-negative bacteria acts as an effective barrier to the translocation of small molecules. To allow for the selective translocation of small molecules into and out of the cell, bacteria express various outer membrane proteins that act as passive or active channels. P. aeruginosa encodes a predicted 31 outer membrane proteins (88). The expression of OprG alters dramatically and is dependent on growth conditions; for example studies have indicated that OprG expression is favored during growth under iron rich and anaerobic conditions (173) and repressed under growth with sub-MIC concentrations of 54  kanamycin or tetracycline (210). Nevertheless, OprG remains poorly characterized and its specific function is not known. As an outer membrane protein, it was possible that OprG might interact with host cells during an infection. It was revealed that mutation of oprG caused a significant 2 to 3-fold reduction in cytotoxicity at an MOI of 50 at 4, 7, and 9 h post-infection (Figure 2.14), but this was not as evident at a lower MOI. This result may reflect a role for OprG in bacterium-epithelial cell contact at this high MOI allowing more bacteria to be available for direct contact with epithelial cells.  2.3.5. CYTOTOXICITY IN STRAIN PAO1 The above assays were performed with strain PA14 mutants since the available library tends to be more reliable. However historically strain PAO1 has been the most widely utilized strain of P. aeruginosa and the best defined with respect to overall behavior and genetics, and differs substantially in several phenotypes, including cytotoxicity as shown here. In collaboration with colleagues in the lab, I also tested a number of strain PAO1 isolates (Table 2.3), several of which were in genes other than two-component systems. Nevertheless, some comparisons between PAO1 and PA14 could be drawn. Intriguingly, mutagenesis of the two-component sensor kinase phoQ resulted in substantially reduced cytotoxicity in PAO1 (49% of WT PAO1) but not in PA14, while a fleS mutant demonstrated considerably reduced cytotoxicity in PA14 but less so in PAO1 (58% compared to 20%). These results indicate that the regulation of cytotoxicity differs to some extent between PAO1 and PA14. Comparisons of the PAO1 (242) and PA14 (142) genomes demonstrate that approximately 90% of the P. aeruginosa genome is highly conserved while the remaining 10% is highly variable (134). For example, PA14 contains the pathogenicity islands, PAPI-1 and PAPI-2 in entirety; PAPI-2 exists in PAO1 in an altered and truncated form. One part of PAPI-2 that exists in PA14 but not in PAO1 is that encoding the type 3 secretion effector, exoU, which encodes a potent phospholipase that destroys the phospholipids of host cell membranes (98, 142, 224). Together, these genetic differences result in PA14 being considerably more virulent in animal models than PAO1. Consistent with this, my experiments clearly demonstrated that a much smaller multiplicity of infection (MOI) and a shorter time point was sufficient to achieve comparable cytotoxicity of PA14 when compared to PAO1. It has been shown that the acute cytotoxicity mediated by PA14 is largely due to ExoU, rather than ExoS (which is encoded in PAO1) or other cytotoxic secreted proteins (224). Since 55  ExoU is lacking in PAO1, it is possible that ExoU-mediated cytotoxicity masked any effects of phoQ mutation in strain PA14 (given that the T3SS is not controlled by PhoQ (75)). Conversely, in PAO1 other cytotoxins must play a larger role (e.g. elastase demonstrating 13% of the cytotoxicity of WT, and lipase modulator protein, LipH demonstrating 62% cytotoxicity; Table 2.3 and Chapter 4). In contrast, for example, the fleS and fleR strain PA14 mutants (219), which showed dramatically diminished cytotoxicity, control the production of flagella that are crucial in the initial stages of acute infection, including binding to host cells (58). This may explain why they drastically affected cytotoxicity in PA14 (Table 2.2), since the T3SS requires adherence to function. Conversely they had a much more modest effect on cytotoxicity in strain PAO1 (Table 2.3). Table 2.3 Cytotoxicity of P. aeruginosa strain PAO1 mutants to HBE cells as a percentage of WT. HBE cells were infected at an MOI of 50-100 for 16-20 hours. Cytotoxicity was measured by the release of lactate dehydrogenase from the epithelial cells and compared to a lytic control (1% Triton X-100). PAO1 reference # 1080 1092 1098 1099 1179 1180 1249 1803 2862 2863 3191 3724 4175 4493 4494 4525 4813 5255  Gene  Description  flgE Flagellar hook protein, FlgE fliC Flagellin type B fleS Two-component sensor kinase FleS fleS complemented fleR Two-component response regulator, FleR phoP Two-component response regulator PhoP phoQ Two-component sensor kinase PhoQ phoQ complemented aprA Alkaline metalloproteinase precursor lon Lon protease lon complemented lipA Lactonizing lipase precursor lipH Lipase modulator protein Probable two-component sensor lasB Elastase LasB piv Protease IV roxR Two-component response regulator RoxR roxS Two-component sensor kinase RoxS pilA Type 4 fimbrial precursor lipC Lipase LipC algQ Alginate regulatory protein, AlgQ  Avg. %WT  Std.Err.  106.3 42.4 58.7 85.3 84.1 103.9 50.9 90.0 92.6 102.7 90.7 93.1 62.4 108.7 13.2 79.2 75.0 83.9 69.8 94.5 110.0  6.2 7.0 8.5 2.7 4.1 4.3 2.9 2.8 11.0 2.8 5.8 19.8 12.5 3.1 7.3 7.8 7.9 8.8 4.3 3.9 6.2 56  2.4.  Discussion  Lung infection is one of the most serious conditions caused by P. aeruginosa. The pathogenesis and the outcome of such an infection are influenced by the host immune response and the virulence factors of the infectious organism. These virulence factors are controlled in part by bacterial TCSs that can rapidly adjust bacterial physiology to changing medium conditions. Here, TCS mutants of P. aeruginosa strain PA14 were co-cultured with lung epithelial cells with the purpose of uncovering which TCSs were involved in the necrotic killing of these epithelial cells. Studies on cytotoxicity of WT and mutants in this chapter were consistent with the large differences in virulence between PA14 and PAO1. In particular, the genes influencing cytotoxicity in PA14 seemed to be grouped into several themes: motility (pilG, pilH, pilR, fleQ, fleR, fleS), c-di-GMP signaling (wspR, rocA1), control of carbon and nitrogen utilization (dctB, cbrA, cbrB), and a specific outer membrane protein (oprG). Control of the type IV pili and flagellum surface appendages may also be related to adherence, as both can bind asialoGM1 on host cells and are required for the initial attachment in biofilm formation (31, 223). That adherence should so substantially affect the cytotoxicity of PA14 was not surprising as its main cytotoxin is the phospholipase ExoU which cannot carry out its lytic effects without direct contact of the bacterium with a host cell. In PAO1, a larger dose of bacteria and a longer incubation time was required to kill the epithelial cells, indicating that non-T3SS toxins play a much larger role in causing direct damage to epithelia in this strain. Therefore cytotoxicity as with other aspects of P. aeruginosa virulence was strain specific. The analyses of the Roc, Wsp, Pil, and Fle systems performed here, while not comprehensive, reveal the extent of their involvement in motility and biofilm formation. While type IV pili and flagella have established roles in motility, biofilm formation and virulence (25, 58, 125, 129, 169), comparatively little data exists concerning their regulators. The data here concerning FleQ, FleS, and FleR were consistent with one another and demonstrated a role for FleS-FleR in cytotoxicity, swimming and swarming motilities, and biofilm formation. The literature reveals that FleS and FleR mutants do not produce flagella (219), and when compared to the near identical results obtained for the non-flagellated fliC mutant, this could contribute to all of the deficiencies we observed here. As these mutants are all non-flagellated, the small and aberrant motility that were observed on the swim plates would not have been due to flagella, and therefore must be mediated by some other mechanism, perhaps by pili. FleQ only demonstrated 57  partial deficiencies. In particular, the aberrant swimming pattern exhibited by the fleQ mutant suggests that a flagellum is made but that perhaps it does not function properly or efficiently. This same consistency did not exist for the type IV pilus regulators. The abilities of these mutants to form biofilms, twitch, swarm, and kill epithelial cells were generally all different such that one phenotype could not be predicted based on another. Most analyses of P. aeruginosa type IV pili have been performed in strain PAK where pilR and pilS mutants are reportedly nonpilated (21); however in this analysis using PA14, the pilS mutant was able to twitch, indicating that functional pili must have been produced. Furthermore, the signal to which PilS responds is unknown. It seems likely that pilus-mediated cytotoxicity, biofilm formation and motility as shown here were due to the proper functioning of pili rather than the presence or absence of type IV pili. The role of c-di-GMP in bacterial cell physiology is complex and multi-faceted due to its role as a second messenger. In P. aeruginosa the level of c-di-GMP has been linked to biofilm formation and as an extension of this to virulence (92, 115, 133). Several EAL and GGDEF amino acid domains representing diesterase and cyclase activities respectively have been found in the protein sequences of pseudomonads, including those belonging to the Roc and Wsp systems which are probably the best characterized (115). A virulence screen of EAL and GGDEF mutants in PA14 revealed RocR, WspR, PvrR, and FimX as contributing to the cytotoxicity of CHO cells (132). When subsequently analyzed using an acute murine burn model, pvrR and rocR mutants were avirulent, with all mice surviving (132). It is still unknown how EAL and GGDEFcontaining proteins alter bacterial physiology to adapt to environmental changes and up or downregulate virulence factors. Several genes that play some role in the utilization of carbon and nitrogen sources also affected cytotoxicity and the roles these genes play in cytotoxicity were harder to explain. Disruption of dctB caused a decrease in cytotoxicity while disruption of cbrA or cbrB caused an increase in host cell death. It is quite possible that disruption of a gene controlling the uptake or utilization of a particular carbon or nitrogen source could render the bacterium less able to survive under certain environmental conditions, whether through direct starvation or through an inability to make certain metabolites required for adaptation; however if this were the case for the dctB mutant, then it should have also demonstrated a growth defect on the HBE cells, which was not observed. DctB reportedly responds to the presence of C4-dicarboxylates leading to activation of DctD and the DctA and DctPQM transport systems (114). Dct mutants of 58  Rhizobium failed to fix nitrogen when grown in symbiotic nodules with alfalfa plants, where C4dicarboxylates become the major food source, resulting in plants that were stunted (270). These Rhizobium mutants were able to produce root nodules but not fix nitrogen; in other words they were able to grow but unable to utilize molecular nitrogen. Therefore it is possible that in P. aeruginosa, DctB mutants were able to grow in co-culture with HBE cells but were lacking in some unknown cellular function that otherwise might contribute to cytotoxicity. An explanation for the increase in cytotoxicity observed for the cbrA and cbrB mutants requires more information. It could be that regulatory networks have sufficient overlap that the disruption of one regulator results in the compensatory upregulation of another, with increased cytotoxicity to gain nutrients being the consequence.  2.4.1. CONCLUDING REMARKS Several regulatory systems were identified in strain PA14 as contributing to the cytotoxicity of cultured HBE cells and could be broadly classified into the control of motility (pilG, pilH, pilR, fleQ, fleR, fleS), c-di-GMP signaling (wspR, rocA1), carbon and nitrogen utilization (dctB, cbrA, cbrB), and the expression of a specific outer membrane protein (oprG). Some mutants were also screened in strain PAO1, revealing differences that might be attributed to the relatively decreased contribution of the T3SS effector proteins encoded in PAO1. In particular, a mutation of phoQ in PAO1 revealed a dramatic reduction in cytotoxicity, but not in PA14 (a detailed analysis of this follows in Chapter 3). A brief analysis describing how each identified TCS might contribute to cytotoxicity was subsequently initiated here. Future studies should involve more extensive analysis to define the role of each identified TCS to epithelial cell cytotoxicity. Overall, these data revealed that multiple TCSs are involved in cytotoxicity. As TCSs are responsible for the adaptation of bacteria to environmental changes, understanding which TCSs are involved in direct cytotoxic damage of the host are likely to provide clues for treating P. aeruginosa infections.  59  3. The Sensor Kinase PhoQ Mediates Virulence 3.1.  Introduction  Bacteria use two-component regulatory systems to sense and respond to environmental cues. The PhoP-PhoQ system has been identified and linked to virulence and cationic antimicrobial peptide resistance in several Enterobacteriaciae, including Salmonella, Yersinia sp. and E. coli (122). Until the studies initiated by my colleagues and I, this system had not been linked with virulence in P. aeruginosa. Previous published reports showed similarities and highlighted key differences between the PhoP-PhoQ systems of P. aeruginosa and other bacteria. Under Mg2+ and Ca2+-limiting (i.e. micromolar) conditions, both Salmonella and P. aeruginosa PhoPregulated transcription is induced while the system is strongly repressed when these cations are plentiful (7, 80, 156). The system also regulates resistance to cationic antimicrobial peptides including polymyxin B in both bacterial genera, but the regulatory architecture differs substantially. In Salmonella, phoQ and phoP mutants demonstrate null phenotypes (i.e. no induction in response to deficient Mg2+) (157, 172) while in P. aeruginosa, phoP mutants have no phenotype while phoQ mutants are constitutive (i.e. phoQ mutants are continuously induced regardless of Mg2+ concentration) (156, 157). These differences in the sensing capabilities of PhoQ and the different role of PhoP may reflect the different ecological niches inhabited by intracellular pathogens such as Salmonella and extracellular opportunists such as P. aeruginosa. In Chapter 2 the sensor kinase PhoQ was demonstrated to have a role in the cytotoxicity of P. aeruginosa strain PAO1 whereby phoQ demonstrated a 50% decrease in cytotoxicity although phoP mutation had little effect. A microarray analysis of a phoQ mutant versus the wildtype (75), was used as a guide to provide clues how PhoQ might contribute to pathogenesis.  3.2.  Materials and Methods  3.2.1. BACTERIAL STRAINS AND GROWTH CONDITIONS P. aeruginosa strain PAO1 mutants used in this study are listed in Table 3.1. All strains were grown in Lauria-Bertani broth (LB) or Basal Medium 2 (BM2, 7 mM (NH4)2SO4, 40 mM K2PO4, 22 mM KH2PO4, 20 mM glucose, 2 mM MgSO4, 40 M FeSO4) at 37°C overnight with agitation and applicable antibiotics: 15  g/ml tetracycline for phoP and phoQ mutants, 15  g/ml 60  streptomycin for the exsA mutant, and 300  g/ml carbenicillin for the phoQ+ complemented  strain. Mutants of phoQ were created in a PAO1 exsA null mutant background as previously described (156). Briefly, an overnight culture of E. coli S17-1 harboring pEX::phoQ suicide vector containing a sacB sucrose sensitivity gene was mixed 3:1 with an overnight culture of recipient exsA mutant and spotted as a single large pool onto a LB agar plate and incubated overnight at 37°C. The resulting large colony was resuspended in 0.9% sterile saline and plated onto LB containing 50  g/ml gentamicin to select for transformed P. aeruginosa. Several  resulting colonies were picked from this plate and transferred to LB containing 5% sucrose and 50 g/ml gentamicin to select for recombinants. Recombination was confirmed by PCR. For analysis of hemolysis, bacteria were streaked out onto 5% sheep blood agar and incubated overnight at 37°C. Clear zones around colonies represented lysis of red blood cells.  Table 3.1 Strains and plasmids used Strain or plasmid PAO1 PA1179 PA1180 pUCP-phoQ+ PAO1 exsA:: PAO1 phoQ PAO1 exsAphoQ  Genotype Wild-type P. aeruginosa PAO1; lab strain H103 phoP::xylE-aacC1; GmR, derivative of WT phoQ::xylE-aacC1; GmR, derivative of WT phoQ mutant with pUCP22-phoQ+; GmR, CbR insertion at bp 2358 within exsA phoP::xylE-aacC1; GmR, derivative of PAO1 DF PAO1 exsA:: phoQ::xylE-aacC1  Reference Lab collection (156) (75) (75) (66) This study This study  3.2.2. CYTOTOXICITY ASSAY AND GROWTH CURVES The SV40-transformed, immortalized 16HBE14o- cell line (human bronchial epithelial cells, HBE cells) was a gift from Dr. D. Gruenert (University of California, San Francisco, CA). HBE cells were seeded into 96-well tissue-culture treated plates and grown to confluence in minimal essential medium (MEM) with Earle’s salts containing 10% FBS and 2 mM L-glutamine with phenol red (Gibco). The monolayer was washed with MEM containing 1% FBS and 2 mM Lglutamine then rested in the same medium. Bacteria were grown to log phase in LB at 37°C with agitation, enumerated by optical density (OD) at 600 nm, washed in PBS, then resuspended and 61  diluted in MEM plus 1% FBS and 2 mM L-glutamine. The HBE monolayer was infected at a starting MOI of 50 for 16-20 h at 37°C and 5% CO2. Media was removed after co-culturing, centrifuged to remove bacteria and stored at 4ºC. Cytotoxicity was measured by assessing the release of lactate dehydrogenase (LDH) from epithelial cells into the media using a kit (Roche Applied Sciences). For the growth assessments, the HBE cells were infected with P. aeruginosa as previously described for cytotoxicity determinations, with or without 2  g/ml polymyxin B. Turbidity  (OD600) of the cultures in the 96-well plates was measured every 30 minutes.  3.2.3. PYOCYANIN, PYOVERDINE AND LIPASE ASSAYS Strains were grown at 37°C for 48h in LB for the secretion of pyocyanin and BM2 glucose with 2 mM MgSO4 for the secretion of pyoverdine as previously described (14, 170, 183, 261). Cell free supernatants were obtained by centrifugation of cultures at 3,000 rpm in a GH 3.8 rotor. Total protein secreted was measured by the BCA assay (Pierce). Pyocyanin was extracted from cell-free supernatants with one volume of chloroform then re-extracted with one volume of 0.2 N HCl before measurement by spectrophotometry at an absorbance of 520 nm (170, 261). For pyoverdine measurements, supernatants were diluted 1/70 to 1/100 in 10 mM Tris-HCl pH 7.5 and excited at 410 nm with a spectrofluorimeter (14, 183). Lipase secretion was determined by enzymatic assay according to Furutani et al (69). Briefly, cell-free supernatants were diluted in 0.1 M NaH2PO4/K2HPO4 enzyme buffer to give equal protein concentrations. An equal volume of 4 mM p-nitrophenyl palmitate in enzyme buffer was added as the substrate. The reactions were incubated at 37°C overnight then read by spectrophotometry at an absorbance of 410nm compared to a standard curve of p-nitrophenol.  3.2.4. BIOFILM AND MOTILITY ASSAYS Static microtitre biofilm assays were performed in 96-well polystyrene plates as previously described (202). After 20 h incubation at 37°C without agitation in LB, media and non-adhered cells were discarded and the wells washed with deionized H2O. Surface-attached bacteria were stained with 0.1% crystal violet for 20 min then washed again with deionized H2O. The crystal violet bound to biofilm cells was dissolved with ethanol, and the biofilm quantified by absorbance at 600 nm. 62  Figure 3.1 Growth of phoQ was normal when co-cultured with HBEs. The PAO1 WT (●) retained its sensitivity to 2 g/ml polymyxin B (○). The phoQ mutant grew just as well in the presence (□) or absence (■) of polymyxin B. Complemented phoQ+ with (∆) and without (▲) polymyxin B behaved like the wild type.  Swimming motility was assessed by inoculating 1 l of overnight culture into LB containing 0.25% agar and the swim zone diameter measured after overnight incubation at 37°C. Twitching motility was performed by inoculating 1 l of an overnight culture onto the plastic surface of a thinly poured 1% agar LB plate and measuring the diameter of the twitch zone that formed after overnight incubation at 37°C. Swarming motility was carried out on BM2-glucose plates containing 0.5% agar and 0.1% casamino acids in place of (NH4)2SO4. 1 l of overnight culture was inoculated onto the surface or swarm plates and plates were incubated at 37°C overnight.  63  Figure 3.2 Cytotoxicity of phoQ mutant to HBEs at 9 hrs (dark grey) and 18 hrs (light grey). Shown is the mean average with standard error. Student’s t-test, p-value * <0.05.  3.3.  Results  3.3.1. THE PHOQ MUTANT WAS LESS CYTOTOXIC IN STRAIN PAO1 As the two-component system PhoP-PhoQ has been shown to play a role in virulence and cationic antimicrobial peptide resistance in other pathogens, the ability of the phoQ mutant in P. aeruginosa PAO1 to infect and destroy a monolayer of cultured HBE cells was more closely examined here. In control experiments, WT and the phoQ mutant bacteria cultured with HBE cells displayed the same growth properties with the WT retaining its polymyxin B sensitivity (Figure 3.1). However, the WT P. aeruginosa demonstrated a 2.2-fold (P <0.05) greater cytotoxicity than the phoQ mutant after 9 hours of interaction (Figure 3.2). This difference was also observed at 18 hours, with the wild-type strain always showing greater cytotoxicity than the phoQ mutant. Introducing the wild-type phoQ+ allele into the phoQ mutant in trans restored cytotoxicity to wild-type levels at both time points. These results showed that P. aeruginosa PhoQ was necessary for wild-type levels of cytotoxicity towards HBE cells in vitro. Additional studies revealed that the phoQ mutation also led to reduced virulence in the lettuce leaf and chronic rat lung infection models (75).  64  Figure 3.3 Swarming, twitching and biofilm formation were reduced in a phoQ mutant. (A) Swarming and (B) twitching motility were reduced but not completely inhibited, and could be restored with complementation. (C) Biofilm measured by the amount of crystal violet staining of surface associated cells. Shown are the means with standard error bars. * Student’s t-test p < 0.05.  3.3.2. KNOWN VIRULENCE FACTORS WERE REDUCED IN A PHOQ MUTANT The PhoP-PhoQ regulatory system has been shown to control several aspects of virulence in other Gram-negatives, particularly Salmonella, therefore the phoQ mutant of P. aeruginosa PAO1 was assessed for its ability to contribute to other known aspects of virulence. It has been previously shown that a phoQ mutant was deficient in swarming (26), a motility exhibited on the surface of semi-solid media, which is highly regulated and requires both type IV pili and flagella (129, 205, 272). This result was confirmed here (Figure 3.3A). Type IV pili also regulate twitching motility, and biofilm formation (203). Consistent with this, twitching motility was impaired in the phoQ mutant as was the formation of biofilm (Figure 3.3B, C). Both defects were restored by complementation. 65  Figure 3.4 The secretion of lipases but not hemolytic enzymes were affected by mutation of phoQ. (A) Lipase enzyme assay. Lipase was detected by the ability to break down pnitrophenyl palmitate into p-nitrophenol and palmitate. Average mean with standard error. * Student’s t-test, p < 0.005. (B) Hemolysis demonstrated by cultures streaked on to a 5% sheep’s blood agar. The clear zones represented lysis of blood cells.  A microarray previously performed in the Hancock lab compared phoQ mutant to its parent PAO1 (75), and was used as a way of predicting which virulence related genes might be responsible for the virulence phenotype of a phoQ mutant. This microarray revealed that the lipA lipase was downregulated in phoQ. Using an enzyme assay, it was confirmed here that 1.6-fold less lipase was secreted into the medium by the phoQ mutant when compared to the WT (Figure 3.4A). Two hemolysins are found in P. aeruginosa, a hemolytic phospholipase C and a rhamnolipid (68, 201). No phospholipases or hemolysins appeared to be dysregulated by phoQ based on the array, and consistent with this, hemolysis of a phoQ mutant on blood agar demonstrated no difference (Figure 3.4B). Furthermore several genes relating to pigment and siderophore production were dysregulated; indeed phoQ mutant cultures were more yellow in color than the WT which tended to demonstrate green pigmentation. Extractions from broth cultures demonstrated that the phoQ mutant relative to WT produced less pyocyanin, a bluegreen pigment and redox-active secondary metabolite (139), and less of the siderophore pyoverdine (Figure 3.5).  66  Figure 3.5 Pyocyanin (A) and pyoverdine (B) are reduced in a phoQ mutant. Shown is the mean with standard deviation for one representative experiment. Mean average with standard error. * Student’s t-test, p < 0.05.  3.3.3. REDUCED CYTOTOXICITY OF PHOQ IS NOT MEDIATED THROUGH T3SS A substantial part of the cytotoxicity mediated by P. aeruginosa is attributed to the T3SS (95). Despite this, different isolates expressing T3SS effectors exoS (or exoU) can present different cytotoxic phenotypes (239). A phoQ mutant demonstrated no dysregulation of this system when grown in high (2 mM) or low (20 M) MgSO4 (75) or during infection of HBE cells (see Chapter 4). An exsA mutation affecting the ExsA master regulator of the T3SS demonstrated a 3-fold decrease in cytotoxicity (Figure 3.6), a slightly greater decrease in cytotoxicity than that of phoQ alone. In an attempt to examine whether the T3SS played a role in PhoQ-mediated pathogenesis, a phoQ mutation was created in an exsA-null background. It was predicted that if PhoQ and ExsA contributed to cytotoxicity independently, then an exsAphoQ double mutant would demonstrate a further reduction in cytotoxicity than that of exsA or phoQ alone. When the experiment was performed, the exsAphoQ mutant demonstrated a 1.8-fold reduction in cytotoxicity when compared to phoQ alone (Figure 3.6) but was not significantly different from the cytotoxicity of the exsA mutant alone. Thus while it seems possible that ExsA and PhoQ contributed to different aspects of toxicity, the result that exsAphoQ did not cause a further reduction in cytotoxicity when compared to exsA alone might indicate some potential 67  Figure 3.6 Cytotoxicity of T3SS mutant exsA compared to that of phoQ and exsAphoQ double mutant. Shown is the mean average with standard error of more than three independent experiments. The difference between exsA and exsAphoQ was not significant. Student’s t-test * p-value <0.05.  overlap between the two systems. The discrepancy could however also be explained by the limitations of the assay used, which may not be sensitive enough to detect differences at the very low levels of cytotoxicity observed after mutation of exsA. Considering that only one T3SS gene appeared on the phoQ microarray and at a very low level of dysregulation (75) and that follow up qPCR failed to find dysregulation of T3SS in phoQ, it seems likely that PhoQ did not contribute to cytotoxicity via the T3SS. This was further probed in subsequent research (Chapter 4).  3.4.  Discussion  The PhoP-PhoQ system has been identified in other Enterobacteriaceae, notably Salmonella, as contributing to the pathogenesis of these organisms. The cytotoxicity data presented here marks the first time that the system has been shown to play a role in P. aeruginosa virulence. Further analysis demonstrated that the phoQ mutant resulted in decreased pathogenesis in a plant model of infection and decreased survivability in a rat model of chronic lung infection (75). Since almost all of the other Enterobacteriaceae in which the PhoP-PhoQ system has been characterized are intracellular pathogens, the manner in which the system contributes to virulence in the extracellular pathogen P. aeruginosa is presumably somewhat different. 68  There are several ways in which the P. aeruginosa PhoQ sensor might contribute to virulence. Attachment to a surface is considered a requirement for the initiation of an infection as well as for the formation of a biofilm. Type IV pili and flagella are considered the major adhesins of P. aeruginosa and non-pilated and non-flagellated mutants demonstrate decreased virulence in several models (25, 58, 125, 169). In the P. aeruginosa phoQ mutant several processes to which type IV pili contribute were hampered, including swarming motility, biofilm formation and twitching. Both biofilm formation and swarming motility are highly coordinated events that require bacterial quorum sensing (125, 208, 223). In chronic infections such as those of the CF lung, P. aeruginosa is thought to exist as biofilms (71, 198, 238). The biofilm consists of bacteria enclosed in a matrix of polysaccharides, nucleic acids and proteins that serve to protect the bacteria from mechanical forces, antibiotics, host defense molecules and phagocytic cells (87, 149). The biofilm deficiency seen here in the phoQ mutant may thus have been the result of a number of contributing processes that were also found to be hampered in the mutant, but that nonetheless resulted in an inability to persist as an infection in plant and animal models (75). Purified pyocyanin has been observed to induce epithelial cell damage in a variety of ways, including inhibition of ciliary function and cellular respiration and inactivation of catalase and these effects are likely due to its interference with cellular glutathione (GSH) redox cycling (139). The reduced level of pyocyanin of the phoQ mutant might therefore have contributed to its attenuated cytotoxicity. Pyoverdine is one of two well characterized iron siderophores produced by P. aeruginosa, the other being pyochelin (138). Natural iron limitation in the host due to transferrin and lactoferrin has been shown to play a crucial role in the host’s resistance to several bacterial pathogens (27); hence, the scavenging of iron by pyoverdine is crucial to the bacterium’s survival within the host. Additionally, pyoverdine is important for proper biofilm development as P. aeruginosa mutants that do not produce pyoverdine are unable to form biofilms in iron-limiting environments (10, 208). The deficiency of pyoverdine production in the phoQ mutant could therefore explain in part why it was less competitive in a rat model of chronic lung infection (75). The decrease in cytotoxicity by the phoQ mutant is likely due to several contributing factors. Although the T3SS system did not appear altered by mutation of phoQ, there are several other cytotoxins produced by P. aeruginosa. Microarray analysis hinted that production of such secreted toxins might be downregulated (75), a result that was confirmed here for lipases and 69  pyocyanin. However, the analyses of these two toxins were performed on bacteria grown in normal lab media without the influence of the HBE cells or the microaerobic environment of the co-culturing conditions; therefore, it is uncertain to what extent the downregulation of these toxins might have been affected by the co-culturing conditions. This was subsequently investigated in the following chapters. As there are several other toxins that are produced by P. aeruginosa which were not analyzed, it seems unlikely that lipases and pyocyanin by themselves were the only contributors to cytotoxicity thus leaving room for further analyses.  3.4.1. CONCLUDING REMARKS The PhoP-PhoQ two-component system was identified as contributing to cytotoxicity in P. aeruginosa. A broad screen of mechanisms that could contribute to this phenotype followed and revealed that PhoQ is involved in the regulation of pyocyanin, pyoverdine, lipase, biofilm formation, swarming, and twitching motility.  70  4. Pseudomonas aeruginosa PhoP-PhoQ is Induced Upon Interaction with Epithelial Cells and Controls Cytotoxicity and Inflammation 4.1.  Introduction  One of the most clinically important adaptations of P. aeruginosa is to the lungs of cystic fibrosis (CF) patients. Several virulence factors have been characterized in P. aeruginosa; however their expression and contributions to CF lung disease are for the most part incompletely defined. It was previously observed in CF that many of the virulence factors proposed to be essential for establishing a lung infection are actually down-regulated or lost during the progression to a chronic infection (44, 56, 207, 234, 237). Notable bacterial factors required for the initial colonization of the lungs, but which are down-regulated or lost in chronic CF isolates, include flagella, pili, proteases and the O-antigen of lipopolysaccharide (LPS). Furthermore, isolates from chronic infections typically overproduce the exopolysaccharide alginate to become mucoid, can have altered LPS which lack B-band O-antigen (123) and add aminoarabinose and palmitic acid to lipid A (57). Despite these observations, the adaptive response of P. aeruginosa to the lung, whereby gene expression is adapted to adjust to the new environment, is not well understood. Bacterial adaptations to environmental changes are mediated by two-component regulatory systems. PhoP-PhoQ is one such two-component system that has been identified in many Gramnegative bacteria, including Salmonella, Yersinia, and P. aeruginosa (75, 122, 206), as playing roles in the detection of Mg2+ levels, cationic peptide resistance and pathogenesis. P. aeruginosa polymyxin-resistant clinical isolates and early stage CF isolates have shown dysregulation of this system (13, 181, 227, 237), highlighting its role in resistance and suggesting a possible role in colonization. The PhoP-PhoQ system of P. aeruginosa is distinctly different from those of intracellular pathogens such as Salmonella and Yersinia, possibly reflecting the distinct infection strategies and ecological niches of these organisms. In Salmonella and Yersinia, both phoP and phoQ mutants demonstrate reduced virulence and have been shown to be required for invasion of macrophages and intracellular survival. Furthermore, both mutants are supersusceptible to cationic antimicrobial peptides, including polymyxin B (22, 215). In contrast, P. aeruginosa is an extracellular pathogen and only phoQ mutants demonstrate a distinct phenotype from the 71  wildtype, including reduced virulence and resistance rather than increased susceptibility to polymyxins (75, 157). In both genera, resistance to cationic antimicrobial peptides is believed to be mediated in part by the addition of aminoarabinose (L-Ara4N) to lipid A, which reduces the overall negative charge of the membrane and thereby reduces the attraction of cationic antimicrobial peptides (84, 123). In Salmonella, PhoQ senses the presence of these peptides through direct binding, leading to upregulation of phoP and phoQ and the induction of PhoPregulated genes (7). In contrast, P. aeruginosa PhoQ has no cationic antimicrobial peptide sensing ability and this role is instead performed in part by the ParR-ParS system (59). The observation that phoQ disruption in P. aeruginosa results in both reduced pathogenesis and increased cationic antimicrobial peptide resistance, indicates that its effects on virulence and persistence in vivo are not mediated through such resistance to host peptides (which might logically lead to increased competitiveness). Furthermore, mammals are not deficient in divalent cations, having millimolar Mg2+ and Ca2+ in most tissues and body fluids, and although cationic peptides serve as the major potential host-induced mechanism for induction of this system in the case of Salmonella and Yersinia, the mechanism by which P. aeruginosa PhoP-PhoQ might be upregulated in the host has not yet been elucidated. In this chapter, the PhoP-PhoQ system was demonstrated to be substantially induced during colonization of epithelial cells when compared to planktonic cells that failed to adhere. Moreover it was confirmed that PhoQ controlled the ability of P. aeruginosa to destroy epithelial cells, and that this was mediated primarily via lipases and proteases rather than toxins from the type 3 secretion system (T3SS). It was also shown that PhoQ altered the structure and inflammatory properties of the lipid A portion of LPS.  4.2.  Materials and Methods  4.2.1. BACTERIAL AND MAMMALIAN CELL CULTURE. P. aeruginosa strains and plasmids used in this study are listed in Table 4.1. Strains were grown in Lauria-Bertani (LB) broth or BM2-glucose minimal media (7 mM (NH4)2SO4, 40 mM K2PO4, 22 mM KH2PO4, 20 mM glucose, 40 M FeSO4) with high (2 mM) or low (20 M) MgSO4 at 37ºC with aeration. The antibiotics gentamicin (50  g/ml) and carbenicillin (300  g/ml) were added to overnight cultures where necessary to maintain plasmids or mutant phenotypes. The SV40-transformed, immortalized human bronchial epithelial cell line 72  16HBE14o- (HBE) was a gift from Dr. D. Gruenert (University of California, San Francisco, CA, USA). It was grown in minimal essential medium (MEM) with Earle's salts (Gibco) supplemented with 10% fetal bovine serum (FBS) and 2 mM L-glutamine and incubated at 37ºC and 5% CO2. Cells were passaged (for no more than 16 passages from the primary culture) by treating the monolayer with trypsin-EDTA (Invitrogen) at 37°C for 5 min to detach the cells from the flask. Detached cells were diluted with complete MEM.  Table 4.1 Strains used in this study. Strain WT phoP  Genotype Wildtype P. aeruginosa PAO1 phoP : : xylE-aacC1; GmR derivative of WT  Reference Lab strain (156)  phoQ  phoQ : : xylE-aacC1; GmR, derivative of WT phoQ mutant with pUCP22-phoQ+; GmR  (75, 156)  phoQ (pUC-phoQ+) exsA lipH piv lasB 62  CbR insertion at bp 2358 within exsA PAO1 transposon mutant ID51115 PAO1 transposon mutant ID31339 and ID31393 PAO1 transposon mutant ID32737 Environmental strain from soil  (156) (66) (112) (112) (112) (264)  *Antibiotic resistance: CbR, carbenicillin; GmR, gentamicin. 4.2.2. RNA EXTRACTION, CDNA SYNTHESIS AND QPCR. HBEs were seeded into tissue-culture treated culture dishes and grown to 100% confluence (2-3 days) at 37°C and 5% CO2 in complete MEM. The day of the experiment, HBEs were washed with MEM containing reduced FBS (1%) and rested for a minimum of 30 min. P. aeruginosa WT and its phoQ mutant were grown in LB to mid-log phase, washed with PBS and resuspended in the reduced serum MEM. Bacterial cells were added to the HBE monolayer at a MOI of 100. HBEs and bacteria were co-cultured at 37ºC and 5% CO2 for 5 hours. This MOI maximized the amount of adhered bacteria that could be obtained for RNA extraction while the 5 hour time point gave ample time for transcriptional changes to occur while minimizing cytotoxic effects to the HBEs. Media containing planktonic bacteria was removed after co-culture, the cells precipitated by centrifugation, and the pellet treated with RNAprotect (Qiagen) and stored at 80ºC. Monolayers containing adhered bacteria were washed twice with phosphate buffered saline 73  (PBS), and incubated at 37ºC for 5 min with 0.48 mM EDTA in PBS followed by scraping to detach the cells, resuspension and washing of the culture dish with PBS. The combined detached adhered fraction was centrifuged, treated with RNAprotect and stored at -80ºC. RNA was extracted with an RNEasy Mini Kit (Qiagen) using the company protocol adapted for RNAprotect. Contaminating DNA was removed using a DNA-free kit (Ambion). RNA quality was checked by spectrophotometry and by agarose gel electrophoresis and stored at 80ºC with 20 U of SUPERase-In RNase Inhibitor (Ambion). One hundred picomoles of random primers (Invitrogen) was annealed to 3 g total RNA at 70ºC for 10 min followed by 25ºC for 10 min. RNA was then reverse transcribed with 600 U superscript II reverse transcriptase (Invitrogen) in solution containing 1 X first strand buffer, 10 mM DTT, 500 M dNTPs, and 30 U SUPERase In at 37ºC for 1 h, 42ºC for 3 h, and 72ºC for 10 min. Analysis was carried out in the ABI Prism 7300 sequence detection system (Applied Biosystems) using the two-step qPCR kit with SYBR Green detection (Invitrogen). Melting curve analysis was performed to ensure specificity. Fold-change was determined using the comparative Ct method by comparison to the rpsL gene, encoding the 30S ribosomal protein S12. Experiments were repeated with three independent cultures.  4.2.3. ADHERENCE ASSAY HBE cells were seeded into 6-well tissue-culture treated plates and grown to confluency as described above. The monolayer was infected with bacteria at a final OD600 of 0.15-0.2 in MEM containing reduced serum (1%). Media was removed after 5h of co-culturing at 37C and 5% CO2 and the turbidity measured to estimate the number of cfu in the planktonic fraction. The HBE monolayer was washed three times with PBS to remove non-interacting bacteria, then HBEs lysed in 0.5 ml of 1% triton X-100 in PBS on a gentle rotory shaker for 5 min at room temperature. This fraction (adhered) was removed to a microfuge tube, the wells washed with 0.5 ml PBS and the washings added to the microfuge tube. Serial dilutions of both the planktonic and adhered fractions were plated onto LB agar plates and incubated overnight at 37C. Adherence was calculated as the total number of adhered cells divided by the total number of cells in the coculture (adhered + planktonic) multiplied by 100 to give a percentage.  74  4.2.4. LIPASE AND PROTEASE ENZYME ASSAYS, AND CYTOTOXICITY. HBE cells were seeded into 24-well tissue-culture treated plates and grown to confluence in MEM containing 10% FBS and 2 mM L-glutamine without phenol red (Gibco). The monolayer was infected at an MOI 100 for 5 h for lipase and protease assays, and an MOI of 50 for 16-18 h for cytotoxicity assessment. Media was removed after co-culture and centrifuged to remove bacteria and stored at 4ºC. Supernatants for enzyme assays were further purified by filtration through a 0.22 M pore size membrane filter. Lipase assays were performed as adapted from the method of Furutani (69). Briefly, 180 l of cell free supernatant was combined with 20 l of 4 mM p-nitrophenyl palmitate (Sigma) in 0.1 M NaH2PO4/K2HPO4 enzyme buffer in a 96-well plate. The reactions were incubated at 37ºC overnight, then read at 410 nm compared to a standard curve of p-nitrophenol (Sigma). For the protease assay equal volumes of cell free supernatant and 0.8 mM N-succinyl-(alanine)3-p-nitroaniline (Sigma) were combined in a 96well plate. The reactions were incubated at 37ºC overnight and read at 410 nm compared to a standard curve of p-nitroaniline (Sigma). Cytotoxicity was measured by the release of lactate dehydrogenase (LDH) using a kit (Roche Applied Sciences).  4.2.5. LPS EXTRACTION AND ANALYSIS Bacteria were grown in LB broth at 37ºC with aeration. LPS was isolated using the DarveauHancock method (42) then extracted twice with chloroform/methanol (2:1) to remove contaminating phospholipids and dialyzed 5-times against 0.5 mM Hepes pH 7.4 / 5 mM Na2EDTA pH 8, twice against 5 mM Hepes pH 7.4 / 50 mM NaCl, and twice against distilled water. The concentration of LPS was estimated from the amount of 2-keto-3-deoxyoctonate (199). LPS for O-polysaccharide analysis was isolated by the method of Hitchcock & Brown (101) and run on 12.5% SDS-PAGE containing 37.5% urea in glycine running buffer (25 mM Tris, 190 mM glycine, 0.1% SDS) for resolution of high molecular weight species or in tricine running buffer (100 mM Tris, 100 mM tricine, 0.1% SDS) for resolution of low molecular weight species. Gels were silver stained by the method of Fomsgaard et al (64). LPS from E. coli O55:B5 (Sigma) was used as a control.  75  4.2.6. MASS SPECTROMETRY OF LIPID A Bacteria were grown in LB, BM2-glucose high (2 mM) or low (20 M) MgSO4 for lipid A isolation until they reached an OD600 of ~1. Lipid A was isolated according to Zhou et al (274). Briefly, cells were harvested in a clinical centrifuge and washed with PBS. Cell pellets were resuspended and lysed in single phase Bligh/Dyer mixture of chloroform/methanol/water (1:2:0.8 v/v). After 20 minutes, the insoluble material was released by hydrolysis for 30 min at 100ºC in the presence of 12.5 mM sodium acetate, pH 4.5, and 1% SDS. Lipid A was recovered by a twophase Bligh/Dyer extraction then dried under a stream of nitrogen, resuspended in 2 ml distilled water and 10 ml of acidified ethanol (100 l HCl to 20 ml ethanol) and centrifuged. The pellet was washed twice with 95% ethanol and dried under a stream of nitrogen. Lipid A species were analyzed at the University of Texas at Austin Analytical Instrumentation Facility Core using a MALDI-TOF/TOF (ABI 4700 Proteomics Analyzer) mass spectrometer in the negative ion mode with the linear detector as previously described (91). 4.2.7. ISOLATION OF 32P-LABELLED LIPID A Bacteria were grown in LB, BM2-glucose high (2 mM) or low (20 M) MgSO4 for lipid A isolation containing 2.5 Cu/ml of 32Pi (Amersham) until they reached an OD600 of ~1. Lipid A was isolated as described above but without the ethanol washes. 32P-lipid A species (equal counts per lane) were analyzed by thin layer chromatography (TLC) in a 50:50:16:5 solvent system (pyridine:chloroform:88% formic acid:water v/v). The TLC plate was dried under hot air and then exposed overnight to a PhosphorImager screen before phosphorimaging analysis.  4.2.8. LPS STIMULATION OF PBMCS AND CYTOKINE ANALYSIS BY ELISA. Peripheral blood mononuclear cells (PBMCs) were isolated from healthy human donors in accordance with UBC ethics guidelines as described previously (185). PBMCs were seeded at 5 x 105 cells/well in a 24-well tissue culture treated plate in RPMI media (Invitrogen) supplemented with 10% FBS and 2 mM L-glutamine. The cells were rested at 37°C and 5% CO2 for a minimum of 30 min prior to addition of LPS at 10, 50, and 100 ng/ml. Media was collected at 4 and 24 hours after stimulation, centrifuged and supernatants stored at -20°C. Cytokine levels were measured by enzyme-linked immunosorbant assay (ELISA) using anti-human IL-6 antibody clones MQ2-1345 and Mq2-39C3 (eBioscience), anti-human TNF  antibody clones 76  MAb1 and MAb11 (eBioscience), and anti-human IL10 antibody clone JES3-9D7 and JES312G8 (eBioscience) all followed by avidin horse radish peroxidase (eBioscience) as per manufacturer’s protocols. ELISAs were developed using TMB liquid substrate system (Sigma) and imaged with a PowerWave x 340 plate-reader (Bio-Tek Instruments). Cytokine quantification was performed against a standard curve of recombinant cytokines IL-6 (eBioscience, Cat. #14-8069), TNF (eBioscience, Cat. #14-8329), and IL-10 (eBioscience, Cat. #14-8109).  4.3.  Results  4.3.1. GENE EXPRESSION WAS ALTERED DURING INTERACTION WITH HUMAN EPITHELIAL CELLS IN VITRO. Adherence to epithelial surfaces is considered a key factor in the initial stages of most bacterial infections. It is well documented that strains of P. aeruginosa isolated from chronic infections are genetically distinct from commonly used lab strains, from environmental isolates, and from strains isolated from acute infections (23, 57, 104, 175, 234). It is believed that over time unknown selective pressures during a chronic infection give rise to strains that have lost the ability to express numerous virulence factors, such the type 3 secretion apparatus or O-antigen of LPS, yet little is known about the transcriptional and physiological changes that occur during or immediately following colonization. To provide insights into how P. aeruginosa initially adapts itself to the host lung environment, I analyzed by qPCR the transcriptional profiles of several bacterial genes pertaining to virulence when P. aeruginosa was co-incubated with HBE cells for 5 hours. The two-component regulatory system sensor kinase PhoQ has demonstrated roles in virulence, response to limiting Mg2+, and cationic antimicrobial peptide resistance in several Gram-negative bacteria, including P. aeruginosa (75). The phoQ gene is transcribed as part of two transcripts, oprH-phoP-phoQ and weakly as phoP-phoQ, where oprH is an outer membrane protein and phoP is the cognate response regulator (157). In bacteria adhered to HBE cells, phoP was upregulated 116-fold and oprH by even more at >5000-fold when compared to bacterial cells that did not adhere (Table 4.2). This is despite the fact that the cell culture media contained millimolar concentrations of Mg2+, which would normally suppress transcription from the oprHphoP-phoQ operon (156). That the oprH gene was upregulated much more than the phoP gene 77  possibly reflected its demonstrated ability to be transcribed as a single gene without phoP or phoQ (156). Genes in the known PhoQ regulon (75) were also upregulated in adhered bacteria, including arnB (1000-fold), encoding an enzyme involved in the addition of aminoarabinose to lipid A, and pmrB (3.7-fold), a two component regulator that also upregulates the expression of arnB in response to limiting Mg2+. Another lipid A modification gene, pagL, which encodes a 3O-deacylase that removes a C10-acyl chain from lipid A, was also upregulated by 3.7-fold, although this gene had not previously been shown to be part of the PhoQ regulon. Strains of P. aeruginosa isolated from early CF lung disease (i.e. prior to development of a chronic infection) have been shown to differ substantially from strains isolated during the chronic state, instead resembling environmental isolates. Therefore, we repeated the transcriptional analysis in an environmental strain, 62. Similar to PAO1, strain 62 demonstrated substantial upregulation of oprH, phoP, arnB and pmrB during interaction with HBE cells (Table 4.3), indicating that strain PAO1 adequately reflected an early colonizing strain of P. aeruginosa in CF lung disease. Other virulence related genes were analyzed by qPCR to see if there were changes in expression between bacteria adhered to HBE cells and bacteria that were non-adhered in the supernatant. Previous studies by Chugani and Greenberg (34) demonstrated that bacteria cocultured with epithelial cells, when compared to the same bacteria grown in normal lab medium, had upregulated quorum sensing systems and secreted proteases and lipases. In my study, the comparison was performed between adhered and non-adhered bacteria within the same coculture. We found that three notable genes were upregulated in the adhered WT cells, namely fliC (5-fold) encoding the flagellin subunit, aprA (2.6-fold) encoding the secreted alkaline protease, and lipA (4.3-fold) encoding a secreted lipase. These genes were also upregulated in a phoQ mutant when adhered to HBE cells as compared to a non-adhered phoQ mutant (Table 4.2). Interestingly, several known virulence factors displayed no altered transcription between adhered and non-adhered bacterial cells in our system, including the type 3 secreted exoenzyme S (exoS), a type IV pilus biogenesis protein (pilB), a phospholipase (plcB), exotoxin A (toxA), and the quorum sensing regulator lasR. Many of these virulence factors have been shown to play roles in virulence in acute infections. In particular the type 3 secretion system is correlated with increased negative outcomes in acute clinical infections (96, 143, 239). As shown in Chapter 3, the laboratory strain PAO1 used here could effectively induce HBE cell cytotoxicity via the type 3 secretion system (Figure 3.6). 78  Table 4.2 Gene expression of P. aeruginosa wildtype and phoQ mutant cells adhered to HBE cells as compared to cells from the same co-culture that failed to adhere. Shown is the fold change with standard error of the means of at least three biological repeats. Ratio of gene expression in adhered compared to non adhered bacteria PA number Gene Description Wildtype phoQ PA1178 oprH Outer membrane protein in 5200 ± 950 2.8 ± 0.8 operon with phoP-phoQ PA1179  phoP  Two-component regulator  response  116 ± 43  2.8 ± 0.5  PA4777  pmrB  Two-component regulator  response  3.7 ± 1.6  6.0 ± 1.7  PA3552  arnB  Aminoarabinose synthesis; lipid A modification  995 ± 223  2.2 ± 0.7  PA4661  pagL  Lipid A 3-O-deacylase  3.9 ± 1.0  3.5 ± 0.5  PA1092  fliC  Flagellin subunit  5 ± 2.1  14.9 ± 3.6  PA2862  lipA  Lipase  4.3 ± 1.8  13.1 ± 2.5  PA1249  aprA  Alkaline protease  2.6 ± 0.8  2.2 ± 0.7  PA3841  exoS  Type 3 secreted effector, exoenzyme S  1.36 ± 0.3  1.31 ± 0.2  PA4626  pilB  Type IV pilin biogenesis protein  1.5 ± 0.3  1.1 ± 0.3  79  Table 4.3 Gene expression of P. aeruginosa environmental strain 62 adhered to HBE epithelial cells as compared to unadhered cells in the supernatant of interaction assays. Shown is fold change with standard error of the means of at least three biological repeats. PA  Gene  Description  Ratio  number PA1178  adhered/unadhered oprH  Outer membrane protein in operon with phoP-  159,000 ± 44,000  phoQ PA1179  phoP  Two-component response regulator  PA4777  pmrB Two-component response regulator  PA3552  arnB  640 ± 90 20 ± 2  Aminoarabinose synthesis; lipid A modification  4.3.2. VIRULENCE FACTORS  WERE  DOWNREGULATED  IN PHOQ  14,000 ± 3400  DURING INTERACTION  WITH  HUMAN EPITHELIAL CELLS. It was previously demonstrated in a microarray that deletion of phoQ from P. aeruginosa resulted in the dysregulation of >450 genes (75). Although some of these genes were involved in virulence, no satisfactory explanation was obtained as to how a phoQ mutant showed such a marked attenuation, possibly because these data were obtained from strains grown in defined laboratory medium. To resolve this, the expression of known virulence genes was compared by qPCR in a phoQ mutant relative to that of the WT when co-cultured on a monolayer of HBE cells (Table 4.4). Several proteases and lipases are secreted by P. aeruginosa and many have well-established roles in virulence (63, 103, 125, 223). Several of these were downregulated in the phoQ mutant during co-culture with epithelial cells as assessed by qPCR (Table 4.4), including some that were not dysregulated when these strains were grown in normal lab broth medium. Proteases contribute significantly to tissue damage in respiratory infections, influencing the degradation of host surfactant proteins, immunoglobulin, and fibrin, and the disruption of epithelial tight junctions (20, 125). Of the proteases checked, the gene for elastase B (lasB) revealed the largest difference from the WT demonstrating 26-fold reduced expression in the phoQ mutant. The P. aeruginosa elastase B is regulated by the LasRI quorum sensing system (45, 225), which was downregulated to a much lesser degree (-2.6-fold). There was also a 3-fold downregulation of the 80  Table 4.4 Effect of phoQ mutation and adherence on expression of known cytotoxicityassociated virulence factors compared to wildtype (WT) during infection of HBE cells. Shown is fold change with standard error of the means of gene expression by qPCR of at least three biological repeats. Fold change PA number  Gene  Description  phoQ/WT  PA3724  lasB  Elastase B  -26 ± 10.5  PA4175  piv  Protease IV  -3.0 ± 1.3  PA2862  lipA  Lipase A  -4.4 ± 2.2  PA2863  lipH  Lipase modulator protein  -5.7 ± 2.9  PA4813  lipC  Lipase C  -3.0 ± 0.4  PA1092  fliC  Flagellin subunit  -13.1 ± 4.3  PA4526  pilB  Type IV pilin subunit  -1.1 ± 0.1  PA1178  oprH  Outer membrane protein, OprH, in operon  5500 ± 1000  with phoPphoQ PA1179  phoP  Response regulator  10.5 ± 1.8  PA3552  arnB  Lipid A aminoarabinosylation  143 ± 59  PA4661  pagL  Lipid A 3-O-deacylase  -7.4 ± 2.1  PA4209  phzM  Pyocyanin biosynthesis  -4.1 ± 1.4  PA2399  pvdD  Pyoverdine synthetase  -1.5 ± 0.1  PA3841  exoS  Exoenzyme S, type 3 secretion effector  0.9 ± 0.3  PA1148  toxA  Exotoxin A  -1.5 ± 0.5  PA3477  rhlR  Quorum sensing regulator, RhlR  -2.8 ± 0.8  PA1430  lasR  Quorum sensing regulator, LasR  -2.6 ± 0.9  gene encoding protease IV (piv), a protease which has an established role in bacterial keratitis, but is less recognized in lung infections (103, 161, 166). No difference was found for alkaline protease (aprA, -1.2-fold) relative to WT. Lipases lipA and lipC, as well as the lipase modulator lipH which controls both LipA and LipC, were downregulated in the phoQ mutant by 3 to 5.7 fold. Both lipases and phospholipases have been shown to break down lung surfactant, which is 90% composed of lipid, and to directly target host cell membranes (102, 235). No dysregulation was found for a phospholipase (plcB, 1.1-fold). Interestingly, neither the T3SS 81  (exoS, 0.9-fold) nor the type two secreted exotoxin A (toxA,-1.5-fold) was dysregulated in a phoQ mutant. These results infer that PhoQ controlled cytotoxicity through lipases and proteases, rather than through the T3SS or exotoxin A.  4.3.3. LIPASES AND PROTEASES WERE REDUCED IN PHOQ MUTANT. As the transcription of lipases and proteases was downregulated in the phoQ mutant, enzyme assays were used to test if the quantity of lipases and proteases was also reduced (Figure 4.1A and B). These assays showed clear reductions in both classes of enzymes in the phoQ mutant, particularly for proteases which showed a 2.5-fold reduction. However, these assays did not distinguish the specific proteases and lipases produced by P. aeruginosa. The phoQ mutant has previously been shown to have a deficiency in rapid attachment to polystyrene (75), therefore the lipase and protease transcriptional differences seen here for the phoQ mutant could have been influenced by differing abilities of the phoQ mutant and the WT to adhere to HBE cells. It was determined that 10.4 ± 1.4% of WT and 9.5 ± 3.5% of the phoQ mutant adhered to epithelial cells and this difference was not statistically significantly different (p = 0.84). To confirm that the dysregulated lipases and proteases might be involved in the altered virulence of the phoQ mutant, lipase and protease-deficient strains were tested and demonstrated to have reduced cytotoxicity towards HBE cells (Figure 4.1C). In particular, a mutation in lasB almost totally abrogated epithelial cell cytotoxicity. This was consistent with the known ability of P. aeruginosa elastase to degrade a variety of host proteins and cause tissue damage, as well as the attenuation of virulence of a lasB mutant in a murine acute lung infection model (131).  82  Figure 4.1 Lipases and proteases affected the cytotoxicity of the phoQ mutant. Less total protease (A) and lipase (B) were secreted by the phoQ mutant during interaction with HBEs at 5 h (dark grey) and 20 h (light grey). Transposon mutants of the lipase modulator protein, lipH, or the proteases elastase B (lasB) and protease IV (piv) reduced the cytotoxic propensity of P. aeruginosa (C). Student’s t-test, p-value ** <0.01, *** < 0.001.  83  4.3.4. LPS OF PHOQ WAS MORE INFLAMMATORY. Both the presence of the C10 acyl chain at the 3-position of lipid A and of a L-Ara4N sugar to the 1 and 4’-phosphate groups have been demonstrated in laboratory phoQ mutants and in CF clinical isolates that contain a phoQ mutation (57, 181). The results here indicated >100-fold upregulation of the arn operon in the phoQ mutant incubated with HBEs and a 7.4-fold downregulation of the lipid A deacylase, pagL, responsible for the removal of the C10-acyl chain. Consistent with this our phoQ mutant grown under both Mg2+-rich and depleted conditions demonstrated the presence of a C10 acyl chain (to give a hexa-acylated species) and the addition of L-Ara4N (Figure 4.2). Interestingly, the phoQ mutant revealed a variety of modified lipid A's, including penta- (1447 m/z) and hexa-acylated species (1617 m/z) containing one (1578, 1747 m/z) and two (1709, 1879 m/z) L-Ara4N sugars and another hexa-acylated species that differed in acyl chain and length containing L-Ara4N (1919 m/z). A similar trend was observed for WT and phoQ mutant grown in LB (data not shown). Additional peak assignments are presented in Table 4.5. While such changes have been shown to impact on resistance to polymyxins and antimicrobial peptides (181, 190, 248), I examined here whether they could also affect the inflammatory response.  84  A  B  WT 20 M MgSO4  E  WT 2 mM MgSO4  Voyager Spec #1=>BC[BP = 1916.8, 2741] Voyager Spec #1=>BC[BP = 1615.7, 10894]2740.9  100  Penta 1446.86 + 1 L-Ara4N 1577.92 +2 L-Ara4N 1708.98  100  90 90  80 80  1.1E+4  70  % Int e ns it y  % Int e ns it y  70  60  50  50  40  40  30  30  20  20  10  10  0 999.0  1399.4  1799.8  Mass (m/z)  C 100  100  90  90  80  80  70  70  60  60  50  40  30  30  20  20  10  10  1399.4  2200.2  1399.4  2600.6  1799.8  Mass (m/z)  Mass (m/z)  D  phoQ 2 mM MgSO4  Mass (m/z)  0 3001.0  2600.6  Voyager Spec #1=>BC[BP = 1747.0, 3692] 3691.8  4926.2  Hexa +2 L-Ara4N 1919.18  0 1799.8 999.0  Mass (m/z)  Hexa 1617.00 2200.2 +1 L-Ara4N 1748.05 +2 L-Ara4N 1879.11 0 3001.0  50  40  0 999.0  0 999.0  phoQ 20 M MgSO4Voyager Spec #1=>BC[BP = 1916.9, 4926]  % Int e ns it y  % Int e ns it y  60  2200.2 1399.4 Mass (m/z)  0 3001.0 2200.2  2600.6 1799.8  Mass (m/z)  2600.6  0 3001.0  Mass (m/z)  Figure 4.2 Lipid A was altered in a phoQ mutant. MALDI-TOF mass spectrometry showing the relative levels of intensities of different lipid A species isolated from P. aeruginosa PAO1. (A) Wildtype grown in BM2-glucose containing 20 M MgSO4 demonstrated addition of L-Ara4N to lipid A, but not when grown with 2 mM MgSO4 (B). L-Ara4N was added to the lipid A of the phoQ mutant grown in either 20 M MgSO4 (C) or 2 mM MgSO4 (D). Adjacent peaks that differed by 16 m/z units represented the addition of a hydroxyl group (OH). (E) Lipid A structures of common mass peaks showing exact masses. L-Ara4N can be added to either or both of 1 or 4’-phosphate groups and is shown in blue.  85  Table 4.5 Peak assignment of MALDI-TOF in Figure 4.2. Exact mass  Proposed lipid A structure  1367.72  Tetra-acylated, includes a single L-Ara4N  1498.78  Tetra-acylated, includes two L-Ara4N  1446.86  Penta-acylated, missing C10 at position 3  1462.85  Hydroxylation of 1446.86  1577.92  1446.86 structure including a single L-Ara4N  1708.98  1446.86 structure including two L-Ara4N  1617.00  Hexa-acylated, includes C10 at position 3  1632.99  Hydroxylation of 1617.00  1748.05  1617.00 structure including a single L-Ara4N  1764.04  Hydroxylation of 1748.05  1879.11  1617.00 structure including two L-Ara4N  1919.18  Hexa-acylated, includes secondary acylation (C16) at 3’ position, missing secondary acylation (C12) at position 2  Peaks (m/z) 1484  Sodium adduct of 1462.85  1770  Sodium adduct of 1748.05  1901  Sodium adduct of 1879.11  86  Figure 4.3 Mutation of phoQ or growth in limiting Mg2+ caused increased aminoarabinosylation of lipid A in P. aeruginosa. (A) TLC of lipid A from P. aeruginosa grown LB rich media additionally showing isolated phospholipids (PLs) and the well-characterised lipid A from E. coli W3110. (B) TLC of lipid A grown in BM2-glucose containing surplus or limiting Mg2+.  87  Figure 4.4 LPS from phoQ mutant elicited a greater inflammatory response. LPS isolated from log phase bacteria grown in LB were used to stimulate human PBMCs from healthy donors at 10, 50 and 100 ng/ml. Secretion of TNF (A), IL6 (B), and IL10 (C) from PBMCs were analysed at 4 h and 24 h after stimulation. Shown is the mean average of three donors with standard error. P-value * <0.05, ** <0.01, *** <0.001, † p-value = 0.091.  88  The LPS of P. aeruginosa plays a key role in virulence and in host innate and acquired responses during infection. The lipid A portion of LPS triggers an inflammatory response by sequentially binding host co-receptors CD14 and MD2 leading to activation of the Toll-like receptor 4 (TLR4) to NF B pathway and triggering the production of pro-inflammatory cytokines, inflammation and eventually endotoxic shock (1, 245). Hyperacylated forms of lipid A (i.e. hexa- and hepta-acylated) have been shown to be more inflammatory (3, 245) and isolates of P. aeruginosa from chronic infections of the CF lung demonstrate increased lipid A acylation and increased NF B-mediated responses in the host (55, 189). As the lipid A of the phoQ mutant was modified, I hypothesized that its inflammatory properties might also be altered. To ascertain whether the lipid A from the phoQ mutant was more or less inflammatory, whole LPS was isolated from this mutant and wild type and used to stimulate PBMCs (Figure 4.4). After 4 and 24 hours, the pro-inflammatory cytokine TNF  was produced over 5-fold and 9-fold more  respectively from PBMCs stimulated with LPS from the phoQ mutant than WT. Similarly, the secretion of pro-inflammatory IL6 was approximately 5-fold and 2-fold greater with phoQ LPS at 4 and 24 hours. The anti-inflammatory cytokine, IL10, was also secreted to a greater extent (3fold) although this effect was seen only at 24 hours, consistent with its role as a homeostatic regulator of inflammation (15). The O-polysaccharide of LPS can elicit an antibody response and has been shown to have a role in virulence (123). Many CF isolates have lost the capability to produce O-polysaccharide (90) and such “rough” strains demonstrate loss of virulence in several models (93, 244). Although the phoQ mutant had demonstrated reduced virulence (75) and modified lipid A, I showed that a phoQ mutant made O-polysaccharide; thus the attenuated virulence phenotype is not due to the loss of this antigen (Figure 4.5). Nevertheless, this is at best a qualitative observation, and changes to the O-antigen that affect antibody responses may not be apparent using electrophoresis. Notably, when LPS was isolated from bacteria interacting with HBE cells, a clear increase in the molecular weight and staining pattern of the lipid A and core regions was observed, indicating changes to either or both of these LPS regions.  89  Figure 4.5 Silver stained SDS-PAGE of LPS isolated from PAO1 WT, phoP, and phoQ mutants. All are substituted with O-polysaccharide. LPS was isolated via the Hitchcock & Brown method from colonies picked from LB agar or from 5 hr co-culturing with HBEs as indicated. An increase in the molecular weight of the lipid A / core region can be seen in bacteria interacting with HBEs. (A) Glycine gel for separation of high molecular weight species such as the O-polysaccharide. (B) Tricine gel for the separation of low molecular weight species such as lipid A and core.  4.4.  Discussion  Isolates of P. aeruginosa from chronically infected CF patients have revealed genotypic changes that resulted in marked phenotypic differences from isolates of newly acquired or acute infections (104, 175, 234, 269). Specifically this includes a change to a mucoid, non-motile state due to the overproduction of alginate and the loss of pili and flagella (234), changes to lipid A including aminoarabinosylation and hyper-acylation (55), LPS that displays shortened or a complete lack of O-antigen (90), and a reduction in secreted virulence factors including elastase (104). These changes have been proposed to reflect adaptations to a chronic infection state aided by changes in mutators (175), or stepwise mutations as an adaptation to specific selective pressures. However the early-term adaptive responses of P. aeruginosa to the lung environment are not well understood. In this chapter it has been demonstrated that the PhoP-PhoQ regulon was substantially upregulated in response to interaction with epithelial surfaces and that PhoQ controls a number of relevant adaptations. 90  The PhoP-PhoQ two-component system has a profound role in the pathogenesis of several Gram-negative organisms (75, 77, 80, 122, 152, 182). Adherence to epithelial cells as revealed here affected a number of genes known to be PhoQ or Mg2+-regulated, as well as causing upregulation of the oprH-phoP-phoQ operon, suggesting that PhoP-PhoQ may partially control the adaptation of P. aeruginosa to epithelial surfaces. Several studies have identified phoQ mutations in polymyxin resistant clinical isolates from both acute and chronic infections (13, 181, 227, 237). Since the PhoPQ system is transcriptionally upregulated in the WT upon adherence to epithelial cells, it is possible that the PhoPQ system contributes to early adaptations to the lung environment that are later stabilized by mutation. Since polymyxins are increasingly utilized as a drug of last resort in patients with recalcitrant multi-resistant infections and aerosolized polymyxin is routinely used in European CF patients (35, 117, 191), the combined selective pressures of adherence and polymyxins may expedite the emergence of resistant strains due to mutations in phoQ. The acylation state of lipid A is known to affect the extent to which it can initiate an inflammatory response. CF is already described as a hyper-inflammatory disease and part of this may be due to the more inflammatory lipid A produced by infecting strains of P. aeruginosa (189). In this study, a phoQ mutant similarly produced more inflammatory LPS, which in turn was likely due to its altered lipid A. It is interesting that a phoQ mutant demonstrated reduced virulence and cytotoxicity while possessing more inflammatory LPS. Together these attributes could contribute to the lowered competitiveness previously shown in a chronic lung infection model (75) where less cytotoxic damage would be caused to the host epithelia while a strong inflammatory response is initiated by the host in response to a more inflammatory LPS. While further work is required to understand this phenotype in the context of the CF lung, it is well known that both antibiotic resistance development and uncontrolled inflammation are hallmarks of chronic CF lung disease. Possibly, the suppression of specific virulence factors and decreased toxicity towards epithelial cells would favor the chronic lifestyle established in this disease.  4.4.1. CONCLUDING REMARKS In this chapter it was shown that the PhoP-PhoQ system was induced upon adherence to epithelial cells and mediated virulence through reduced secreted cytotoxic enzymes and altered inflammatory properties of LPS. I suggest that PhoQ-mediated control of virulence may occur as an inducible adaptation to the lung environment which involves adherence to the epithelia and 91  which would contribute to and be exacerbated by the selective pressure of inhaled polymyxins. Since evidence suggests that PhoQ acts primarily as a phosphatase rather than a kinase for PhoP (156, 157), adherence may be a primary signal that promotes PhoP phosphorylation in vivo. Consistent with this was the fact that the epithelial cell medium employed contained sufficient divalent cations to prevent induction of the oprH-phoP-phoQ operon through divalent cation deficiency. Understanding how P. aeruginosa adapts to favor a chronic infection in the CF lung may provide avenues for preventing the advancement of this debilitating disease as well as suggest antibiotic treatment regimens that are less likely to result in the emergence of resistant strains.  92  5. RoxS Sensor Kinase as a Candidate for Phosphorylating PhoP 5.1.  Introduction  The PhoP-PhoQ two-component regulatory system has been identified in many Gramnegative bacteria and shown to be essential for virulence and resistance to cationic antimicrobial peptides. The system has been well characterized in Salmonella where the PhoQ sensor responds to limitations in divalent cations and increasing acidity causing (via the PhoP response regulator) induced resistance to host antimicrobial peptides (7, 80, 215). Together, the Salmonella PhoPPhoQ regulator and sensor have also been shown to regulate invasion, motility, transport of small molecules, acid tolerance and bacterial surface remodeling (80, 215). The analogous PhoP-PhoQ system in P. aeruginosa has some similarities, including mediating resistance to cationic antimicrobial peptides and contributing to virulence (75); however fundamental differences have been identified. One major difference lies in the phenotype of phoP-null strains. In Salmonella, disruption of either phoP or phoQ results in attenuated virulence and an increased susceptibility to cationic antimicrobial peptides (122). In contrast, only the inactivation of phoQ in P. aeruginosa results in attenuated virulence; inactivation of phoP causes no change (75). Another major difference is that inactivation of phoQ in P. aeruginosa causes a substantial increase in resistance to cationic antimicrobial peptides, rather than the supersusceptibility seen in Salmonella (75, 80). Additionally the PhoQ sensors differ structurally and functionally. In Salmonella, PhoQ binds to and is activated by cationic antimicrobial peptides and low Mg2+ or Ca2+ and is also activated by acidic pH leading to phosphorylation of PhoP (7). In contrast, PhoQ of P. aeruginosa does not respond to cationic antimicrobial peptides, is much more sensitive to changes in Mg2+ than Ca2+, and is comparatively weakly responsive to acidity (7, 213, 214). This is largely due to the presence of a large cluster of acidic amino acids in the Salmonella PhoQ sensor which binds cationic peptides and Mg2+. This acidic patch does not exist in the PhoQ of P. aeruginosa and instead a region with a much smaller charge exists which can bind Mg2+ but not cationic peptides (32). The reasons for these differences between Salmonella and P. aeruginosa PhoP-PhoQ systems might reflect the distinct selective pressures provided by the environmental niches these two bacteria normally inhabit. Salmonella is an intracellular pathogen that invades macrophages, 93  where phagosomes would be both acidic and rife with cationic antimicrobial peptides. P. aeruginosa in contrast is an environmental microorganism that usually acts as an opportunistic extracellular pathogen; its normal niche of soil and water would not typically expose it to high acidity or concentrated cationic peptides. Nevertheless the observations that phoP mutants of P. aeruginosa are phenotypically similar to the wildtype and that phoQ mutants are phenotypically different (75, 157) suggests that this system must differ from the classical two-component signal transduction cascade whereby the sensor kinase phosphorylates its cognate response regulator. It was proposed based on this and evidence demonstrating that phoP overexpression led to a constitutive phenotype, that P. aeruginosa PhoQ acts primarily as a phosphatase of PhoP during growth in high Mg2+ concentrations (156, 157), rather than as a kinase under low Mg2+ conditions. The nature of the kinase that phosphorylates PhoP, the signal that this kinase senses and whether the phosphorylation/activation status of PhoP is in itself key to the phenotypes displayed by phoQ mutants is unknown. The goal here was to uncover whether and how much PhoP contributes to cytotoxicity and resistance as well as to identify the sensor kinase that might phosphorylate PhoP in P. aeruginosa.  5.2.  Materials and Methods  5.2.1. BACTERIAL STRAINS AND GROWTH CONDITIONS P. aeruginosa PAO1 and PA14 strains were used in this study. Transposon mutants in PA14 originated from the Harvard University Non-Redundant Library (148) and were grown with 20 g/ml gentamicin in Lauria-Bertani broth (LB) or Basal Medium 2 (BM2, 7 mM (NH4)2SO4, 40 mM K2PO4, 22 mM KH2PO4, 20 mM glucose, 2 mM MgSO4, 40 M FeSO4) at 37°C overnight with agitation. Other strains and plasmids used are listed in Table 5.1.  94  Table 5.1 Strains and plasmids used in this study Strain or plasmid PAO1 H103 PA1179 (phoPphoQ) PA1180 (phoQ) PA4493 (roxR)  PA4494 (roxS) PA14 WT PA4494 (roxR) PA4494 (roxS) PA1179 (phoP) PA1179 (phoQ) PA3930 (cioA) PA3929 (cioB) Plasmids pUCP-phoQ+ pEMPQ2a pPQD51A pEMR3 pPC3-2 pUCPlux-oprH pUCP19  Description Wild-type P. aeruginosa PAO1; lab strain H103 phoP::xylE-aacC1; derivative of H103, has polar effect on phoQ phoQ::xylE-aacC1; derivative of H103 MAR2xT7 transposon from Harvard University mutant moved into H103 (Mutant ID 40945) MAR2xT7 transposon from Harvard University mutant moved into H103 (Mutant ID 33385)  Reference Lab collection (156) (75) (148) and this study  (148) and this study  PA14 wildtype MAR2xT7 transposon mutant from Harvard University (Mutant ID 40945) MAR2xT7 transposon mutant from Harvard University (Mutant ID 33385) MAR2xT7 transposon mutant from Harvard University (Mutant ID 40573) MAR2xT7 transposon mutant from Harvard University (Mutant ID 33095) MAR2xT7 transposon mutant from Harvard University (Mutant ID 28496) MAR2xT7 transposon mutant from Harvard University (Mutant ID 31844, 48456)  (148)  phoQ cloned into pUCP22 phoP-phoQ in opposite orientation to the lac promoter in pUCP20 pEMPQ2a site-directed mutagenesis of Asp51 to Ala phoP cloned behind lac promoter in pUCP19 Constitutive phoP from Salmonella enterica in pWSK29 oprH promoter cloned in front of luxCDABE cassette in pUCPlux Empty shuttle vector  (75)  (148) (148) (148) (148) (148) (148)  (156) This study (156) (83) Joe McPhee, unpublished (229)  95  5.2.2. SITE-DIRECTED MUTAGENESIS OF PHOP The phosphorylation site of PhoP was predicted by amino acid sequence comparison to the known sequences of conserved domains maintained at the National Centre for Biotechnology Information (NCBI). To change the conserved phosphate-accepting aspartic acid at position 51 of PhoP to an alanine, the Quikchange XL Site-Directed Mutagenesis kit (Stratagene) was employed and used according to manufacturer’s instructions using pEMPQ2a plasmid methylated by propagation in dam+ E.coli TOP10 (Invitrogen) as the template (156). Complementary oligos containing the codon to be mutated were designed and are as follows: 5’GGCGGTGATCGCCCTCGGCCTGC and 5’-GCAGGCCGAGGGCGATCACCGCC. Plasmid pEMPQ2a contains phoP-phoQ cloned in reverse orientation relative to a lac promoter and is able to complement both phoP and phoQ mutants. LB Miller broth was used for the recovery of competent E. coli after transformation. Transformants were selected on LB agar containing 100 g/ml of ampicillin. Plasmids from resulting colonies were isolated and sent for sequencing at the Nucleic Acid Protein Service Unit (NAPS) at UBC.  5.2.3. LUCIFERASE REPORTER SCREEN OF SENSOR KINASE MUTANTS Sensor kinase transposon mutants were obtained from the Harvard University Mutant Library (148) and were transformed with plasmid pUCPlux-oprH by electroporation with selection on LB agar containing 350 g/ml carbenicillin. Transformed mutants were grown in LB broth with 350 g/ml carbenicillin overnight at 37°C with shaking then diluted 1/100 into 100 l/well of BM2-glucose 20 M and 2 mM MgSO4 in a white-walled, clear and flat bottomed 96-well plate. The plate was incubated for ~15 h at 37°C with agitation in a TECAN SpectroFluor Plus spectrometer with luminescence readings taken approximately every 16 min.  5.2.4. MOVING TRANSPOSON FROM PA14 HARVARD TRANSPOSON MUTANT TO H103 Genomic DNA was isolated using a DNeasy kit (Qiagen) from the Harvard University MAR2xT7 transposon mutants 33385 (roxS) and 40945 (roxR) and electroporated into the lab PAO1 wildtype strain H103 in order to create mutants isogenic to the PAO1 phoP and phoQ mutants. Selection of positive transformants was made on LB agar with 50 g/ml gentamicin. Transposon insertion was confirmed through colony PCR using primers that flanked the  96  transposon insertions sites and compared to H103, PA14 WT and the original 33385 and 40945 mutants.  5.2.5. RNA EXTRACTION, CDNA SYNTHESIS AND QPCR P. aeruginosa strains were grown in BM2 supplemented with 20 mM succinate, 10  M  FeSO4, and 2 mM or 20 M MgSO4 to mid-log phase, the cells precipitated by centrifugation, and the pellet treated with RNAprotect (Qiagen) and stored at -80ºC. RNA was extracted with an RNEasy Mini Kit (Qiagen) using the company protocol adapted for RNAprotect. Contaminating DNA was removed using a DNA-free kit (Ambion). RNA quality was checked by spectrophotometry and by agarose gel electrophoresis and stored at -80ºC with 20 U of SUPERase-In RNase Inhibitor (Ambion). Six micrograms of random primers (Invitrogen) was annealed to 3 g total RNA at 70ºC for 10 min followed by 25ºC for 10 min. RNA was then reverse transcribed with 600 U of Superscript II reverse transcriptase (Invitrogen) in solution containing 1 X first strand buffer, 10 mM DTT, 500 M dNTPs, and 30 U SUPERase-In at 37ºC for 1 h, 42ºC for 3 h, and 72ºC for 10 min. Analysis was carried out in the ABI Prism 7300 sequence detection system (Applied Biosystems) using the two-step qPCR kit with SYBR Green detection (Invitrogen). Melting curve analysis was performed to ensure specificity. Fold-change was determined using the comparative Ct method by comparison to the rpsL gene, encoding the 30S ribosomal protein S12. Experiments were repeated with three independent cultures.  5.2.6. CATECHOL 2,3-DIOXYGENASE REPORTER ASSAY Bacteria were grown in BM2-glucose supplemented with 20 M or 2 mM MgSO4 at 37°C overnight with agitation. Cells were harvested through centrifugation, washed once with PBS, then resuspended in ice cold 50 mM K2HPO4 pH 7.5 with 10% acetone and sonicated with a probe for 1 minute. Equal amounts of protein (BCA kit, Pierce) were diluted in 50 mM K2HPO4 pH 7.5 in a 96-well polystyrene plate and serially diluted in the same buffer to give 100 l/well. Five hundred microlitres of 1,2-dihydroxybenzene (catechol) were added per well of sample and the colorimetric change to 1,2-hydroxymuconic semialdehyde monitored over time at 375 nm. The extinction coefficient used was 4.4 x 104 Lmol-1cm-1.  97  5.2.7. MINIMAL INHIBITORY CONCENTRATIONS (MICS) Bacteria were grown in half strength LB broth overnight at 37°C with agitation. Strains were diluted 1/100 into BM2-glucose minimal media containing 20 M or 2 mM MgSO4 and 2-fold serial dilutions of polymyxin B starting at a maximal concentration of 64 g/ml. Cultures were grown at 100  l/well in a 96-well polypropylene plate at 37°C for 24 hours. The MIC was  defined as the minimum concentration of polymyxin B at which growth was not visible. Median values are reported from at least five repeat experiments.  5.2.8. GROWTH ASSAYS, BIOFILM AND CYTOTOXICITY In all cases, bacteria were diluted 1/100 from overnight LB cultures into fresh LB. For the growth assays, cultures were grown with or without 500 M NaN3 or KCN, and growth was estimated by measuring culture turbidity at OD600 every hour for 8 h. Static microtitre biofilm assays were performed as previously described (202). After 20 h incubation at 37°C without agitation in LB, media and non-adhered cells were discarded and the wells washed with dH2O. Surface-attached bacteria were stained with 0.1% crystal violet for 20 min then washed again with deionized H2O. Crystal violet bound to biofilm cells was dissolved with ethanol and the biofilm quantified by absorbance at 600 nm. Cytotoxicity was performed as previously described in Chapter 2.  5.3.  Results and Discussion  5.3.1. PHOP CONTRIBUTED TO RESISTANCE TO CATIONIC ANTIMICROBIAL PEPTIDES Published microarray analyses showed that PhoP controls the expression of only 19 genes, compared to >450 for PhoQ (75, 172). None of the 19 genes is involved in resistance to cationic antimicrobial peptides and interestingly only one is not Mg2+-regulated. To date the role of PhoP in resistance to cationic antimicrobial peptides is controversial, with one group showing clearly increased susceptibility of a phoP mutant to polymyxin (57) and another group showing marginal sensitivity of a phoP mutant to the peptide CP28 (157). Nevertheless, the phoP mutant that was used in these studies was functionally a phoPphoQ double mutant as 332 bp of the phoQ gene was also deleted along with the entirety of phoP. Furthermore, the omega fragments that flank the xylE-GmR cassette used to construct the phoP deletion mutant prevent read-through from the 98  aacC1 (gentamycin resistance gene) promoter and hence affect the expression of the downstream phoQ. Catechol 2,3-dioxygenase (xylE) reporter assays have indicated that deletion of phoQ could theoretically leave PhoP in a constitutively activated (i.e. phosphorylated) state and that PhoP must therefore be phosphorylated by something else, as yet unknown (156). I confirmed these results using the same method (Table 5.2) and considered that the phosphorylation state of PhoP might contribute to some of the phenotypes displayed by a phoQ mutant.  Table 5.2 Catechol 2,3-dioxygenase activity in phoP and phoQ mutants harbouring expression plasmids. Plasmid pPC3-2 contains mutated phoP from Salmonella that forms a product which is able to effect transcription of PhoP-regulated genes regardless of phosphorylation state. Plasmid pPQD51A is a mutated version of pEMPQ2a (contains phoPphoQ) in which phoP has been mutated so that it cannot accept a phosphate at aspartate residue 51. Plasmid pUCP(phoQ+) complements the phoQ mutant.  phoP (effectively phoPphoQ) + pEMR3 (phoP+) + pPC3 (phoP constitutive) + pPQD51A (phoP-phoQ+) + pucP19 + pEMPQ2a (phoPphoQ) phoQ + pucP(phoQ+)  Catechol-2,3-dioxygenase activity (pmole/min) 20 M MgSO4 2 mM MgSO4 23 ± 5 9±2 6936 ± 471 4985 ± 480 1502 ± 169 1432 ± 225 19 ± 4 6±1 20 ± 4 10 ± 2 2160 ± 599 7±2 1882 ± 146 1451 ± 205 233 ± 44 7±2  99  Table 5.3 Polymyxin B MICs for PAO1 WT, phoPphoQ and phoQ mutants with or without various plasmids containing derivatives of phoP. Bacteria were grown in half strength LB and diluted 1/100 into BM2-glucose minimal media supplemented with 20 M or 2 mM MgSO4. Shown is the median of at least five independent experiments. Plasmid pEMR3 is a high copy plasmid which causes overexpression of phoP. Plasmid pPC3-2 contains mutated phoP from Salmonella that forms a product which is able to effect transcription of PhoP-regulated genes regardless of phosphorylation state. Plasmid pPQD51A is a mutated version of pEMPQ2a (contains phoPphoQ) in which phoP has been mutated so that it cannot accept a phosphate at aspartate residue 51. Plasmid pUCP(phoQ+) complements the phoQ mutant. MIC ( g/ml) at different growth concentrations of Mg2+ 20 M  2 mM  1  2  + pEMR3 (phoP+)  0.25  0.5  + pPC3-2 (phoP constitutive)  0.75  1  + pPQD51A (phoP-phoQ+)  0.75  1  + pEMPQ2a (phoPphoQ)  1  1  + pucP19  2  1.5  0.5  1  + pEMR3 (phoP+)  12  64  + pPC3-2 (phoP constitutive)  16  64  0.1875  0.75  1  1  0.5  0.5  16  64  1  2  PAO1 WT  Polar phoP (effectively phoPphoQ)  + pPQD51A (phoP-phoQ+) + pEMPQ2a (phoPphoQ) + pUCP19 phoQ + pUCP(phoQ+)  Polymyxin B MICs of phoP (functionally phoPphoQ and thus termed polar phoP below) and phoQ mutants containing various plasmids were checked to confirm that PhoP itself did not contribute to resistance (Table 5.3). As anticipated, the WT and polar phoP mutant demonstrated susceptibility to polymyxin B, with the polar phoP mutant being slightly more susceptible (2fold) than the WT. In contrast, a phoQ mutant showed 16 to 32-fold increased resistance when cultured in limiting or high Mg2+ conditions; susceptibility could be restored by complementation. Overexpression of phoP from the lac promoter in pEMR3 (157) in the WT 100  caused a 4-fold reduction in the MIC. This increase in susceptibility of the WT demonstrated that PhoP played some role in the susceptibility of P. aeruginosa to cationic antimicrobial peptides, and highlights the importance of the relative balance of PhoP and PhoQ. The same plasmid expressed in the polar phoP mutant resulted in a phoP+phoQ- genotype and therefore gave a phenotype identical to that of a phoQ mutant (Table 5.3). Plasmid pPC3-2 carries a Salmonella constitutive phoP mutation whereby the resulting PhoP is able to mimic activated PhoP regardless of phosphorylation state (83). This plasmid was propagated in the polar phoP mutant causing a 32 to 64-fold increase in MIC, similar to the result obtained from overexpression of phoP in this clone. When expressed in WT, pPC3-2 caused little to no change in the MIC value, in contrast to the result observed for the overexpression of Pseudomonas phoP in WT. The observation that pPC3-2 appeared to complement the polar phoP mutant leading to a phoQ mutant phenotype but did not result in supersusceptibility in the WT might indicate a genus specificity, whereby the constitutive Salmonella PhoP was either relatively weakly expressed or only inefficiently functioned as a transcription factor in P. aeruginosa in the absence of phosphorylation. The amino acid sequence of PhoP, and alignment with other response regulators, predicts that phosphorylation would occur at a conserved aspartate residue at position 51. To demonstrate that the phosphorylation status of PhoP was responsible for polymyxin B susceptibility after overexpression in the WT, a mutant was created in which this conserved aspartate residue in phoP was mutated to an alanine through site-directed mutagenesis of plasmid pEMPQ2 containing functional phoPphoQ. The resulting plasmid, pPQD51A, contained a non-functional copy of phoP as well as a functional copy of phoQ. Expressing this plasmid in a phoPphoQ mutant thus resulted in a true phoP mutant genotype and a slight 2.5-fold decrease in the MIC under low Mg2+ conditions only as well as a failure to complement the polar PhoP mutant to constitutive phoQ mutant status. In the WT, pPQD51A reduced the MIC very slightly to that of the polar phoP mutant (Table 5.3), consistent with hypothesis that the phosphorylation state of PhoP plays some role in the peptide resistance via the PhoPQ system.  5.3.2. PHOP MIGHT CONTRIBUTE TO VIRULENCE Apart from cationic peptide resistance, the other major phenotype of phoQ is reduced virulence including cytotoxicity (75, 156). As the phosphorylation/activation state of PhoP seemed to influence cationic peptide resistance, it was possible that PhoP activation might also play a role 101  in cytotoxicity. As the reduction in cytotoxicity by phoQ is only apparent in strain PAO1, I checked the various plasmids expressing phoP and/or phoQ for their effect on cytotoxicity in this strain rather than in PA14 (Table 5.4). As shown previously (Figure 2.3 and Figure 3.2 from earlier in this thesis), the phoQ mutant demonstrated reduced cytotoxicity compared to WT (~50%), while the polar phoP mutant showed no difference and complementation of phoQ restored cytotoxicity to near WT levels. Overexpression of phoP (pEMR3) or expression of the constitutive Salmonella phoP (pPC3-2) in the polar phoP mutant reduced the cytotoxicity to levels similar to that of the phoQ mutant (62 and 46% of WT), in keeping with the fact that these plasmids restore phoP sufficiently to give a phoQ genotype in this clone. Restoring phoQ only in the polar phoP mutant with pPQD51A caused a very slight reduction in cytotoxicity compared to the WT (89%) but not different than that of the complemented phoQ mutant. This is similar to the marginal 2-fold reduction in MIC of this clone, relative to WT, when grown in 2 mM Mg2+ (the cell culture medium also contained millimolar concentrations of divalent cations). Overexpression of phoP (pEMR3) in the WT also caused a marginal decrease in cytotoxicity (75%) while expression of the constitutive Salmonella phoP (pPC3-2) showed a marginal decrease (86%) similar to that of the complemented phoQ. I was possible that some of these results may have been due to a vector effect, a result that is further indicated by the slight reduction in cytotoxicity exhibited by WT and phoP when expressing the empty vector pUCP19 (88% and 93% of WT respectively). Overexpression of PhoP might interfere strongly with systems that control resistance to peptides, but less so with systems that affect cytotoxicity.  102  Table 5.4 Cytotoxicity to HBE cells imparted by WT and phoPphoQ mutant expressing various phoP plasmids. HBE cells were infected at MOI 50-100 for 16 – 20 h and cytotoxicity measured by the amount of LDH released into the culture medium. Plasmid pEMR3 is a high copy plasmid which causes overexpression of phoP. Plasmid pPC3-2 contains mutated phoP from Salmonella that forms a product which is able to effect transcription of PhoP-regulated genes regardless of phosphorylation state. Plasmid pPQD51A is a mutated version of pEMPQ2a (contains phoPphoQ) in which phoP has been mutated so that it cannot accept a phosphate at aspartate residue 51. Plasmid pUCP(phoQ+) complements the phoQ mutant. % of WT cytotoxicity ± SE PAO1 WT  100  + pEMR3 (phoP+)  78 ± 4  + pPC3-2 (phoP constitutive) -  +  86 ± 4  + pPQD51A (phoP phoQ )  102 ± 8  + pUCP19  88 ± 4  phoPphoQ  101 ± 4  + pEMR3 (phoP+)  57 ± 4  + pPC3-2 (phoP constitutive)  46 ± 3  + pPQD51A (phoP-phoQ+)  88 ± 5  + pEMPQ2a (phoPphoQ)  66 ± 12  + pUCP19  93 ± 6  phoQ + pUCP(phoQ+)  50 ± 3 86 ± 4  103  Figure 5.1 Expression of oprH is reduced in a PA4494 (roxS) mutant in strain PA14. Shown is the relative luminescence of WT, phoP, phoQ, and roxS transformed with reporter plasmid pUCPlux-oprH in BM2-glucose minimal media supplemented with 20 M (A) or 2 mM (B) MgSO4. Shown is one of several independent experiments demonstrating identical trends.  5.3.3. SCREEN OF SENSOR KINASE MUTANTS REVEALS A CANDIDATE As PhoP appeared to play a role at least in peptide resistance, I sought the signal and sensor kinase that causes its activation (i.e. phosphorylation). Sensor kinase mutants available from the PA14 Harvard University transposon mutant library (148) were transformed with plasmid pUCPlux-oprH, in which the promoter for oprH operon controls the expression of the luxCDABE cassette. The switch from strain PAO1 to PA14 for screening purposes, was necessitated due to the lower reliability of the mutants available in the PAO1 library. Light production from the pUCPlux-oprH plasmid should only occur in these mutants when PhoP is phosphorylated since phosphorylated PhoP is required for transcription of the oprH-phoP-phoQ operon. Transformed mutants were grown in BM2-glucose containing 20 M MgSO4 (under which conditions PhoP is activated and light is produced) or 2 mM MgSO4 (under which conditions PhoP is repressed by PhoQ and no light is produced) and luminescence monitored over time. Transformed phoQ and polar phoP mutants were used as controls. A sensor kinase that phosphorylates PhoP should demonstrate reduced or no light production when its mutant is grown under Mg2+-deficient conditions. As expected, the polar phoP mutant showed no luminescence when grown in either 20 M or 2 mM MgSO4 while the phoQ mutant showed high levels of luminescence under both conditions confirming that PhoP regulates its own operon. One of the sensor kinase mutants of the 61 tested repeatedly demonstrated reduced, but not absent, luminescence when grown in 20 104  M MgSO4 (Figure 5.1). This mutant carried a transposon in the gene roxS (PA4494). Disruption of roxS also reduced transcription of oprH and phoP under low magnesium conditions (Table 5.5).  Table 5.5 Transcription of oprH and phoP under low MgSO4 (20 M) compared to high MgSO4 (2 mM) concentrations as determined by qPCR. Mutation of roxS caused a 2-3-fold reduction in transcription compared to that under limiting MgSO4 conditions but did not eliminate it entirely. Ratio of level of transcription low/high MgSO4 1178 (oprH)  1179 (phoP)  PA14 WT  512  14.3  phoP  0.8  1.8  phoQ  3.0  3.0  roxS  240  5.4  105  Figure 5.2 The effect of Mg2+ concentration on the expression of pUCPlux-oprH in a PA4494 (roxS) mutant. Strains were diluted from overnight cultures into BM2-glucose with varying concentrations of MgSO4 and grown at 37°C with agitation for 11 h.  As a roxS mutant could reduce but not eliminate transcription from the oprH operon under limiting Mg2+ conditions, it seemed possible that specific concentrations of Mg2+ might influence the levels of luminescence or transcription of the oprHphoPphoQ operon by favoring a particular sensor over another. To check whether RoxS was favored by Mg2+ concentrations other than 20 M or 2 mM, the roxS mutant was grown in varying concentrations of Mg2+ and the luminescence analyzed (Figure 5.2). However the same two fold reduced but not eliminated luminescence was observed for each concentration of Mg2+ that could be considered limiting. At higher concentrations where luminescence was abolished in the roxS mutant, it was also abolished in the WT, indicating that the sensor RoxS was not favored at particular Mg2+ concentrations and consistent with the likelihood that RoxS did not per se sense Mg2+.  106  Figure 5.3 CIO mutants but not roxS or roxR were inhibited in growth by the reducing agencts azide or cyanide. Strains were grown in LB with or without 500 M NaN3 (A) or KCN (B).  5.3.4. MUTANTS OF ROXR AND ROXS WERE NOT INHIBITED BY AZIDE OR CYANIDE RoxS and its cognate response regulator, RoxR, have been reported to control the expression of cyanide insensitive oxidase (CIO, encoded by cioA-cioB) an enzyme that terminates one of the many aerobic electron transport pathways in P. aeruginosa, and is insensitive to the respiratory inhibitors cyanide and azide (36). RoxR was first identified by sequence homology to the response regulator PrrA in Rhodobacter sphaeroides, a purple non-sulfur bacterium which is extremely metabolically versatile, being able to grow by aerobic or anaerobic respiration, photosynthesis or fermentation (36, 158). In R. sphaeroides, the two-component system PrrBPrrA is a master regulator of metabolic processes within the cell, with the response regulator PrrA controlling more than 850 genes (>20% of the genome), including photosynthesis, carbon dioxide and nitrogen fixation, hydrogen uptake, aerotaxis, and electron transport among others (158). Relatively little is known about the RoxR-RoxS system in P. aeruginosa. In P. aeruginosa strain PAK, Rox and CIO mutants have been reported to be sensitive to both cyanide and azide during aerobic growth (36, 110). I found that both cyanide and azide slightly repressed growth for the WT, as expected; however both roxR and roxS mutants were repressed to levels similar to the WT and only the growth of CIO mutants was severely inhibited by azide and cyanide (Figure 5.3). This discrepancy with published results for roxR and roxS might be the result of the fact that transposon mutants were used in this study compared to 107  Figure 5.4 Biofilm formation of roxR and roxS mutants was reduced in strain PAO1 (A) but not PA14 (B).  complete deletions in literature studies and also that the strain background (PAK) was different(36, 110). Both phoP and phoQ mutants showed growth curves similar to that of the WT.  5.3.5. BIOFILM AND CYTOTOXICITY WAS AFFECTED RoxS and RoxR have been shown to be involved in interactions with the airway epithelia. RoxR was identified in a screen as reducing the migration of neutrophils across a monolayer of lung epithelial cells by greater than 50% (110). This mutant was also found to reduce the adherence of the bacteria to epithelial cells, despite the mutant demonstrating normal twitching and swimming motilities indicating intact and functional type IV pili and flagella (110). Due to this reported deficiency in adherence in the roxR mutant it seemed possible that roxR and roxS mutants might therefore affect biofilm and cytotoxicity which are also influenced by the PhoPPhoQ system. In Chapter 2 it was revealed that the cytotoxicity of phoQ in PA14 was considerably different from PAO1, however neither roxR nor roxS PA14 mutants demonstrated reduced or increased cytotoxicity in this screen (Table 2.2). PA14 is also known to form poor biofilms compared to PAO1. For these reasons, PAO1 roxS and roxR mutants were created by moving the transposons from the PA14 mutants to PAO1. This allowed the testing of the cytotoxicity and biofilm phenotypes of roxS and roxR in both strains. It was found that both roxR and roxS mutants demonstrated reduced biofilm-forming abilities in strain PAO1 but not in PA14 (Figure 5.4). Neither roxS nor roxR affected cytotoxicity in strain PA14 (Table 2.2) but roxR marginally reduced cytotoxicity in strain PAO1 to 75% of that of the WT (Figure 5.5, p<0.05), 108  Figure 5.5 The cytotoxicity to HBEs was reduced by mutation in roxR but not roxS at 16-20 hours post-infection at MOI 50. Shown is standard error of the means of at least three independent experiments. Student’s t-test, p-value * < 0.05, *** < 0.001, NS not significant.  analagous with published data (110). Furthermore, I observed by qPCR that roxS was downregulated upon adherence of WT P. aeruginosa to epithelial cells (-3.59 ± 0.21 SE; performed as per Chapter 3).  5.4.  Concluding Remarks  Two-component regulatory systems (TCSs) are one of the main regulatory families that are used by a bacterium to rapidly adapt to changes in its environment, and P. aeruginosa has more TCSs than most other pathogens (74, 220). In the classical scheme of two-component signal transduction, the sensor kinase detects an external signal (e.g. ligand binding) which causes a conformational change and autophosphorylation at a conserved histidine residue. The sensor kinase then transfers the phosphate group to a conserved aspartate on the N-terminal part of the response regulator, causing activation (70, 74). The activated response regulator proceeds to alter the expression of a particular set of genes to cause a response to the stimulus. The sensor kinase can sometimes cause dephosphorylation of the response regulator in order to rapidly return the cell to its previous state.  109  It has been proposed that it is possible for multiple sensor kinases to phosphorylate the same response regulator or for a single sensor kinase to phosphorylate several response regulators, as indicated for chemotaxis, in which a single sensor kinase, CheA, phosphorylates two response regulator s, CheB and CheY (146). This phenomenon, termed cross talk, seems to also occur for the PhoP-PhoQ system in P. aeruginosa. The evidence to date is consistent with PhoQ itself phosphorylating several response regulators as it controls the expression of >450 genes yet apparently does not phosphorylate PhoP, which controls only 19 genes (172). Alternatively, PhoQ could be acting via accessory proteins in a type of “cross-regulation” of other regulatory systems. For example, in Salmonella the PhoP-PhoQ system cross-regulates the PmrA-PmrB system via PmrD which binds and protects PmrA from dephosphorylation (140). In this chapter, it was revealed that the sensor kinase RoxS likely phosphorylated PhoP, but mutation of roxS was only able to decrease the expression of the oprH-phoP-phoQ operon by approximately half. Therefore it is conceivable that other sensor kinases contribute to PhoP phosphorylation. Indeed, one of the limitations of the luminescence screen performed here was that it was performed under the assumption that the activated PhoP is phosphorylated only under limiting Mg2+ conditions, since the possible other stimuli that could result in activated PhoP cannot be predicted. It is very likely that RoxS responds to a signal other than Mg2+. However only three publications on the Pseudomonas RoxS/RoxR system are available (36, 60, 110), with only a suggestion rather than proof that the stimulus to which RoxS responds must have something to do with the redox state, based on the azide and cyanide growth inhibition phenotype, which was not observed in the PA14 strain background employed here. The R. sphaeroides homologue to RoxS, PrrB, senses and autophosphorylates in response to changes in redox potential, specifically to reducing conditions (212), therefore it is possible that RoxS of P. aeruginosa may also respond to a change in the redox state. Considerably more work needs to be performed to illuminate the signal to which RoxS actually responds and more importantly with respect to this thesis, whether RoxS functions as a phosphor-donor to PhoP.  110  6. Conclusion This thesis highlights the complexity of the roles of two-component systems (TCS) in cytotoxicity. In particular, the PhoP-PhoQ system of P. aeruginosa seems to act in the global regulation of several cellular processes.  6.1.  The Role of Two-Component Regulatory Systems in Cytotoxicity  In Chapter 2 several two-component regulatory systems (TCSs) were identified that demonstrated an involvement in cytotoxicity toward cultured epithelial cells. These regulators could be grouped into several themes: motility (pilG, pilH, pilR, fleQ, fleR, fleS), c-di-GMP signaling (wspR, rocA1), control of carbon and nitrogen utilization (dctB, cbrA, cbrB), and global regulators known to control several aspects of cell physiology (phoQ, algR). I was also able to demonstrate a role in cytotoxicity for an outer membrane protein (oprG) and confirmed the cytotoxic role of the type 3 secretion system regulator, ExsA. Many of the TCS mutants that demonstrated reduced cytotoxicity were involved in adherence or motility whether directly, as for the flagella and pilus regulators, or indirectly, for the regulators of c-di-GMP, a bacterial secondary messenger known to reciprocally regulate adherence and motility (115). The observation that adherence and motility are involved in various aspects of virulence such as cytotoxicity has been suggested previously, however the data from this thesis highlight the importance of strain variations when studying the contribution of TCSs to cytotoxicity. This cytotoxicity screen was performed in strain PA14 due to the availability of a reliable and almost comprehensive PA14 transposon mutant library (148). A few genes, where mutants were available, were also analyzed in the considerably less toxic strain PAO1. Genes directly involved in the adherence of PAO1 or PA14 showed decreased cytotoxicity. In contrast, the comparison of PA14 and PAO1 phoQ mutants demonstrated a large divergence in the control of cytotoxicity by this regulatory system between the two strain backgrounds. This discrepancy might be in a large part the result of differences in the T3SS, due to the high cytotoxic capability of ExoU that is present only in strain PA14 (224). As shown here and as previously published (75), PhoQ does not regulate the T3SS, and likely works through other toxic enzymes such as lipases and proteases as indicated by the large reduction in cytotoxicity of mutants of non-T3SS toxins in PAO1 observed in this thesis. Nonetheless, few TCSs were analyzed in PAO1 due to the limited availability of reliable mutants in that strain at 111  the time the screen was performed (there were numerous anecdotal reports and our own lab’s experience that mutants of this library have become somewhat cross contaminated). It would thus be advantageous to expand the screen into PAO1 as mutants become available to see which other TCSs show substantial differences in this strain background. I hypothesize that several more TCSs will be identified that contribute differentially to cytotoxicity between strains PAO1 and PA14. Another theme involved in PA14 cytotoxicity appeared to be genes involved in nitrogen and carbon utilization (cbrA, cbrB, dctB); however proposing explanations for these regulatory genes is more difficult than for the systems regulating adherence and motility. In this thesis and elsewhere, the mutants, cbrA, cbrB, and dctB have demonstrated growth defects on certain carbon and nitrogen sources (147, 250) but did not demonstrate growth defects when co-cultured with HBE cells. It is logical that disruption of a key gene involved in carbon and nitrogen utilization could render the bacterium less able to survive under certain environmental conditions, whether through direct starvation or through inability to make certain metabolites required for adaptation. However, such an explanation would only explain a decrease in cytotoxicity. The observed increase in cytotoxicity likely reflects the global regulatory function of these regulators. A key finding of Chapter 2 was that not all predicted sensor/regulator pairs demonstrated equivalent changes in cytotoxicity. For example, mutants of pilR, dctB and phoQ demonstrated a change in cytotoxicity to HBE cells compared to the WT, yet their cognate pairs pilS, dctD and phoP did not. It is possible that these cognate pairs were simply not expressed under the experimental conditions; however this result could also be due to cross-regulation with other systems. As the data presented here and in the literature for the PhoP-PhoQ system implies, some TCSs might play more of a global regulatory role, where for example a sensor regulates a large regulon, or phosphorylates more than one cognate response regulator, or phosphorylates an adapter protein which relays signals between regulatory networks. A study which systematically checked for interacting partners of this type of TCS would be extremely beneficial to the understanding of pseudomonal signaling networks.  112  Figure 6.1 Mutants of phoQ may arise in chronic infections from transcriptional “priming” during an initial acute infection and the selective pressure of subsequent polymyxin B treatment. In the initial acute infection, adherence to lung epithelia trigger the upregulation of phoQ, lipid A modification systems, and secreted toxins (e.g. proteases and lipases) (A). The innate immune system responds to the infection by recruiting neutrophils (B) which together with bacterial toxins cause damage to the host epithelia (C). If the bacteria cannot be effectively cleared by the host, subsequent measures to eliminate the infection via treatment with polymyxin B (D) may provide the selective pressure required to transition to a mutation in phoQ, causing the permanent upregulation of the PhoPQ and lipid A modification systems (E). In the phoQ mutant, the bacterial toxins are downregulated yet the lipid A is more inflammatory, leading to a hyperactive neutrophil response which causes most of the damage to epithelia (C).  6.2.  The Role of PhoQ-PhoP in Pathogenesis  This thesis demonstrated in Chapters 3 and 4 that P. aeruginosa PhoQ contributes to cytotoxicity and inflammation in addition to its established role in resistance to cationic antimicrobial peptides (156, 157). The decrease in cytotoxicity of a phoQ mutant can be explained by the decrease in secreted lipolytic and proteolytic toxins, while the alterations to 113  lipid A caused increased inflammation and a resistance to cationic antimicrobial peptides. Nevertheless, it is immediately confounding that a mutation in this single sensor kinase could cause such seemingly contrasting phenotypes. As PhoQ does not seem to activate PhoP and likely signals in part through a myriad of incompletely identified regulators (75), it is possible that the decreased pathogenicity and increased peptide resistance phenotypes are a consequence of the global regulatory role played by PhoQ. In Chapter 4 it was shown that the PhoPQ system is induced upon adherence to epithelial cells. Combined with the observation that polymyxinresistant clinical phoQ mutants exist (181), it seems probable that the PhoQ-mediated control of virulence may occur as an inducible adaptation to the lung environment initiated by adherence to epithelia and that this would contribute to and be exacerbated by the selective pressure of inhaled polymyxins. A schematic is shown in Figure 6.1. If pseudomonal mRNA was isolated directly from infected lung sputum and compared to the mRNA isolated from those same clinical strains grown in laboratory conditions, as has been similarly performed by Storey and colleagues (241) then this might enable demonstration of the upregulation of the expression of oprH, phoP, and lipid A modification genes, and thus help to bolster this hypothesis. Indeed, Storey et al found transcripts of elastase (lasB) in the sputum of CF patients (241), however this group did not look at the PhoPQ regulatory system.  6.3.  The Difficulty in Determining the Role of PhoP  Evidence presented in Chapter 5 of this thesis and in the literature suggested that PhoQ serves only to dephosphorylate PhoP (75, 156, 157, 172). Finding a possible sensor kinase responsible for the phosphorylation of PhoP was quite difficult, as the signal for activation of that sensor kinase was unknown. A candidate, RoxS, was revealed, yet its external stimulus is also currently unidentified and in this thesis it could only be determined that its stimulus was not magnesium ion concentration. It seems likely, based on a homologous system in Rhodobacter species and data demonstrating RoxR-RoxS control of CIO in P. aeruginosa (36), that RoxS should respond to a change in redox potential. Consistent with this, the gene sodB, encoding a superoxide dismutase of P. aeruginosa was found to be at least partially controlled by PhoP (172), suggesting that PhoP and RoxS may together play a role in aerobic respiration. Analysis of phoP and roxS mutants under various redox-altering conditions may reveal what if any role PhoP has in aerobic respiration and how it is linked to RoxS. 114  Figure 6.2 The PhoP-PhoQ two-component regulatory system of P. aeruginosa interacts with other regulatory systems to control aspects of virulence and resistance to cationic antimicrobial peptides (CAMPs). In Mg2+-rich conditions, PhoQ dephosphorylates PhoP, while in Mg2+-limiting conditions, PhoP is retained in a phosphorylated (active) state and the PmrA-PmrB system is activated (both via PhoP and independently of PhoP). Activated PmrA and PhoP induce modifications to lipid A leading to resistance to CAMPs. Resistance to CAMPs can also be induced by sub-inhibitory concentrations of CAMPs which are detected via the ParR-ParS system. PhoQ controls the expression of >450 genes, including those involved in aspects of virulence, although it is not known how, possibly through an unknown response regulator (RR). RoxS was identified here as a possible sensor kinase that might phosphorylate PhoP. The homologous system in Rhodobacter suggests that RoxS detects changes in the redox state, particularly the presence of reducing agents such as azide.  6.4.  Overall Conclusions  The objectives of this thesis were to determine which TCSs contributed to the cytotoxicity of P. aeruginosa to cultured epithelial cells, the contribution of PhoQ to pathogenesis and to find the sensor kinase that phosphorylates PhoP. In accomplishing this, the data has stressed that several key systems are involved in toxicity and that the PhoP-PhoQ system in P. aeruginosa is highly complex and regulates multiple cellular processes as a key global regulatory system that interacts with the two-component systems PmrA-PmrB, ParR-ParS, and possibly RoxR-RoxS (Figure 6.2). Here it is revealed that PhoQ contributes to cytotoxicity of epithelial cells in strain 115  PAO1 primarily through the expression of proteolytic and lipolytic toxins, and not through the more well-known T3SS or type 2-secreted exotoxin A. Moreover, PhoQ demonstrated involvement in modifications to lipid A structure, resulting in an increased inflammatory response as well as increased resistance to cationic antimicrobial peptides. The PhoP-PhoQ system was upregulated during adherence to epithelial cells, suggesting that PhoQ-mediated control of virulence may be an inducible adaptation to the lung environment. These data also inferred that sensitivity to cationic antimicrobial peptides and alterations to cytotoxicity could be partially contributed to through regulation via activated PhoP and that PhoP phosphorylation may occur through the activation of the sensor RoxS.  6.5.  Future Directions  6.5.1. EPITHELIAL CELL DEATH The human bronchial epithelial cells utilized here (16HBE14o-) were immortalized by transformation with simian virus 40 (SV40) (81). SV40 is thought to interfere with the activities of tumor suppressor proteins such as p53, allowing the cell to delay senescence for several generations (217). The consequence of this is that 16HBE14o- cells are likely to be somewhat resistant to cell death mechanisms induced by the host such as apoptosis or necroptosis. Primary normal HBE cells (pnHBE) reach senescence earlier and are more likely to die by hostdependent mechanisms. While it is unlikely that the death of pnHBE cells when infected by P. aeruginosa would be via a different mechanism than that of 16HBE14o- cells (i.e. not by necrosis), this should at minimum be checked.  6.5.2. CYTOTOXICITY SCREEN The cytotoxicity data presented here have demonstrated the involvement of TCSs in this aspect of pathogenesis. A few broad themes were revealed in strain PA14, however differences observed in cytotoxicity between strains PAO1 and PA14 highlight the need for this screen to be repeated in PAO1 as reliable TCS mutants in that strain become available. Furthermore, the screen utilized mutants which were created via the insertion of a MAR2xT7 transposon containing a gentamicin resistance gene as a selection marker (148) which disrupts the continuity of the gene but does not remove it; consequently, partial products of these genes may be transcribed and/or translated. While most partial products are likely to be non-functional and 116  subsequently degraded by cellular machinery, it remains possible that such a product could retain some activity (although in such an event the transposon mutant is may have a phenotype resembling that of the wildtype). It is also entirely possible that the discrepancy in phenotypes seen in this screen between some cognate sensor and regulator pairs is due to a polar effect of the transposon on a downstream gene in the same operon. For these reasons, clean, in-frame, nonpolar deletions of the genes identified as contributing to cytotoxicity should be generated for confirmation. Along these same lines, complementation of these mutants would serve to confirm that these genes – rather than a downstream gene – is responsible for the cytotoxic phenotype. As the T3SS accounts for most of the cytotoxic ability of strain PA14 (224), it is possible that the carbon and nitrogen utilization mutants that demonstrated reduced (dctB) or increased (cbrA, cbrB) cytotoxicity may also demonstrate dysregulation of this key virulence factor and this could be checked by qPCR. This has been determined for CbrA-CbrB, deletion mutants of which demonstrate a 2-4-fold upregulation of the T3SS when co-cultured with HBEs (271). The DctBDctD system, however, remains poorly studied in P. aeruginosa. If dysregulation of the T3SS in dct mutants is not observed, this could indicate that the change in cytotoxicity is not through the T3SS. In addition, the differences observed in the cytotoxicity phenotypes of some sensor kinases and their cognate response regulators suggests the involvement (cross talk) of the individual components with other systems, countering the concept of “one sensor, one regulator”. Thus a systematic interaction analysis between regulators and kinases, whether through radiolabeled phosphotransfer studies or via a two-hybrid system, would tremendously aid in determining cognate pairings and would shed light on the complexity of regulatory networks in the cell. This analysis would also help to determine whether RoxS and/or some other sensor kinase(s) is/are responsible for the phosphorylation of PhoP as outlined in Chapter 5.  6.5.3. ROLE OF PHOQ IN PATHOGENESIS In Chapter 4 PhoQ was shown to play a role in pathogenicity in terms of cytotoxicity and inflammation and furthermore the PhoP-PhoQ system was observed to be induced upon adherence to epithelial cells. This suggests that PhoQ-mediated control of virulence may occur as an inducible adaptation to the lung environment which involves adherence to the epithelia and which would contribute to and be exacerbated by the selective pressure of inhaled polymyxins. If this is the case, we should expect that clinical, non-polymyxin resistant strains would show an upregulation of the PhoP-PhoQ regulon during adherence to lung epithelia. This could be 117  analyzed in a murine model (e.g. acute or chronic lung infection), whereby RNA is extracted directly from lung homogenates and compared to strains grown in laboratory medium, or from CF patients where RNA is extracted directly from a sample of lung sputum and compared to RNA from the strains isolated from the sputum and then grown under laboratory conditions. The LPS data presented in this thesis coupled with the known hyperinflammatory disease state of CF lungs suggests that PhoQ may partly control the inflammatory aspects of pathogenesis but no study has examined this question directly. Comparative analysis of neutrophil recruitment and of cytokine levels within a phoQ infected murine lung compared to the WT could provide this direct link. Furthermore, the polyacrilamide gel electrophoresis of the LPS samples shown here in order to look at the presence of O-antigen were at best qualitative and could not demonstrate whether the antibody response would actually be different. Commericial P. aeruginosa serotyping kits could be utilized to show whether the O-antigen of phoQ mutant is different enough to elicit an altered antibody response. These experiments would contribute to the collective understanding of the persistence and adaptability of this opportunistic pathogen.  6.5.4. ROXS AS A CANDIDATE SENSOR KINASE TO PHOP Previously published data (156, 157) and the data demonstrated in Chapter 5 of this thesis indicate that the sensor kinase PhoQ serves only to dephosphorylate its predicted cognate response regulator PhoP. Various expression plasmids employed in this thesis revealed a role for the phosphorylation status of PhoP in resistance to polymyxin B, and suggested that deletion of phoP led to an increase in polymyxin B susceptibility as shown by MICs. However, MICs demonstrate only how well a mutant or strain can resist the effect of antimicrobials. A better test of susceptibility is that of kill curves, whereby the death (or survival) of bacteria when exposed to a bacterialcidal antibiotic several times the MIC is monitored over time by plate counts. Such a test may reveal a bigger difference in the polymyxin B susceptibilities between a phoP mutant and WT. The phoP mutant utilized here was a clean deletion that had a polar effect on the expression of the downstream phoQ. The polar effect likely has two contributing factors. The first is that in generating the phoP deletion mutant, 332 bp of the phoQ gene was also deleted beyond the 13 bp shared by both genes. Second, the omega fragments that flank the xylE-GmR cassette used to construct this mutant prevent read-through from the aacC1 (gentamycin resistance gene) 118  promoter and would also affect the expression of phoQ (156). The use of several of the expression plasmids could have been eliminated if a clean, in-frame, non-polar deletion of phoP were made. Such a deletion mutant would be subsequently useful for all further studies involving the PhoP-PhoQ system. The RoxS sensor kinase was identified as a candidate for the phosphorylation of PhoP. Two of the major limitations of this chapter are the use of transposon mutants and the use of PAO1 for some experiments (in keeping with the historical studies of the PhoP-PhoQ system) with the use of PA14 for the sensor kinase screen. At minimum, a clean deletion mutant of roxS should be generated for both PAO1 and PA14 and the the experiments repeated using these deletion mutants. The luciferase reporter assay should be repeated in PAO1. The phosphorylation of some response regulators is usually by a sensor kinase but in some cases, a secondary source of phosphate can be donated by acetyl phosphate (171). The contribution of acetyl phosphate to the phosphorylation of PhoP in P. aeruginosa has not been either demonstrated or eliminated and should be investigated by radiolabelled phosphotransfer assays. Very few studies on the RoxR-RoxS system in P. aeruginosa exist and it is not known to what external signal RoxS responds. Based on the analogous system in Rhodobacter, it is likely that it responds to reducing agents. Since very little is known about this system in P. aeruginosa, discovering this signal is likely to be difficult but could aid in the understanding of the role of PhoP. A typical approach would be to fuse a reporter to a gene known to be transcribed upon activation of RoxS (perhaps roxS itself) and monitor this reporter’s activity in a roxS mutant and in WT when exposed to a reducing agent such as azide. Unfortunately, the RoxS-RoxR regulon in P. aeruginosa is unknown.  119  References 1.  Akira, S., S. Uematsu, and O. Takeuchi. 2006. Pathogen recognition and innate immunity. Cell. 124:783-801.  2.  Albertson, T. E., S. Louie, and A. L. Chan. 2010. The diagnosis and treatment of elderly patients with acute exacerbation of chronic obstructive pulmonary disease and chronic bronchitis. J. Am. Geriatr. Soc. 58:570-579.  3.  Alexander, C., and E. T. Rietschel. 2001. Bacterial lipopolysaccharides and innate immunity. J. Endotoxin Res. 7:167-202.  4.  Anand, N., and M. H. Kollef. 2009. The alphabet soup of pneumonia: CAP, HAP, HCAP, NHAP, and VAP. Semin. Respir. Crit. Care. Med. 30:3-9.  5.  Arancibia, F., T. T. Bauer, S. Ewig, J. Mensa, J. Gonzalez, M. S. Niederman, and A. Torres. 2002. Community-acquired pneumonia due to gram-negative bacteria and Pseudomonas aeruginosa: incidence, risk, and prognosis. Arch. Intern. Med. 162:18491858.  6.  Arlehamn, C., and T. Evans. 2010. Pseudomonas aeruginosa pilin activates the inflammasome. Cell Microbiol. 13:388-401.  7.  Bader, M. W., S. Sanowar, M. E. Daley, A. R. Schneider, U. Cho, W. Xu, R. E. Klevit, H. Le Moual, and S. I. Miller. 2005. Recognition of antimicrobial peptides by a bacterial sensor kinase. Cell. 122:461-472.  8.  Bagge, N., M. Schuster, M. Hentzer, O. Ciofu, M. Givskov, E. P. Greenberg, and N. Hoiby. 2004. Pseudomonas aeruginosa biofilms exposed to imipenem exhibit changes in global gene expression and beta-lactamase and alginate production. Antimicrob. Agents Chemother. 48:1175-1187.  9.  Bals, R., D. J. Weiner, A. D. Moscioni, R. L. Meegalla, and J. M. Wilson. 1999. Augmentation of innate host defense by expression of a cathelicidin antimicrobial peptide. Infect. Immun. 67:6084-6089.  10.  Banin, E., M. L. Vasil, and E. P. Greenberg. 2005. Iron and Pseudomonas aeruginosa biofilm formation. Proc. Natl. Acad. Sci. U. S. A. 102:11076-11081.  11.  Bardoel, B. W., S. van der Ent, M. J. Pel, J. Tommassen, C. M. Pieterse, K. P. van Kessel, and J. A. van Strijp. 2011. Pseudomonas evades immune recognition of flagellin in both mammals and plants. PLoS Pathog. 7:e1002206.  120  12.  Barequet, I. S., Z. Habot-Wilner, O. Mann, M. Safrin, D. E. Ohman, E. Kessler, and M. Rosner. 2009. Evaluation of Pseudomonas aeruginosa staphylolysin (LasA protease) in the treatment of methicillin-resistant Staphylococcus aureus endophthalmitis in a rat model. Graefes Arch. Clin. Exp. Ophthalmol. 247:913-917.  13.  Barrow, K., and D. H. Kwon. 2009. Alterations in two-component regulatory systems of phoPQ and pmrAB are associated with polymyxin B resistance in clinical isolates of Pseudomonas aeruginosa . Antimicrob. Agents Chemother. 53:5150-5154.  14.  Baysse, C., H. Budzikiewicz, D. Uría Fernández, and P. Cornelis. 2002. Impaired maturation of the siderophore pyoverdine chromophore in Pseudomonas fluorescens ATCC 17400 deficient for the cytochrome c biogenesis protein CcmC. FEBS Letters. 523:23-28.  15.  Bazzoni, F., N. Tamassia, M. Rossato, and M. A. Cassatella. 2010. Understanding the molecular mechanisms of the multifaceted IL-10-mediated anti-inflammatory response: Lessons from neutrophils. Eur. J. Immunol. 40:2360-2368.  16.  Beer, D., B. Vandermeer, C. Brosnikoff, S. Shokoples, R. Rennie, and S. Forgie. 2006. Bacterial contamination of health care workers' pagers and the efficacy of various disinfecting agents. Pediatr. Infect. Dis. J. 25:1074-1075.  17.  Bhat, R., A. Marx, C. Galanos, and R. S. Conrad. 1990. Structural studies of lipid A from Pseudomonas aeruginosa PAO1: occurrence of 4-amino-4-deoxyarabinose. J. Bacteriol. 172:6631-6636.  18.  Bianchi, S. M., L. R. Prince, K. McPhillips, L. Allen, H. M. Marriott, G. W. Taylor, P. G. Hellewell, I. Sabroe, D. H. Dockrell, P. W. Henson, and M. K. B. Whyte. 2008. Impairment of apoptotic cell engulfment by pyocyanin, a toxic metabolite of Pseudomonas aeruginosa. Am. J. Resp. Crit. Care Med. 177:35-43.  19.  Bjarnsholt, T., T. Tolker-Nielsen, N. Hoiby, and M. Givskov. 2010. Interference of Pseudomonas aeruginosa signalling and biofilm formation for infection control. Expert Rev. Mol. Med. 12:e11.  20.  Bleves, S., V. Viarre, R. Salacha, G. P. F. Michel, A. Filloux, and R. Voulhoux. 2010. Protein secretion systems in Pseudomonas aeruginosa: A wealth of pathogenic weapons. Int. J. Med. Microbiol. 300:534-543.  21.  Boyd, J. M., and S. Lory. 1996. Dual function of PilS during transcriptional activation of the Pseudomonas aeruginosa pilin subunit gene. J. Bacteriol. 178:831-839.  121  22.  Bozue, J., S. Mou, K. L. Moody, C. K. Cote, S. Trevino, D. Fritz, and P. Worsham. 2011. The role of the phoPQ operon in the pathogenesis of the fully virulent CO92 strain of Yersinia pestis and the IP32953 strain of Yersinia pseudotuberculosis. Microb. Pathog. 50:314-321.  23.  Bragonzi, A., M. Paroni, A. Nonis, N. Cramer, S. Montanari, J. Rejman, C. Di Serio, G. Doring, and B. Tummler. 2009. Pseudomonas aeruginosa microevolution during cystic fibrosis lung infection establishes clones with adapted virulence. Am. J. Respir. Crit. Care Med. 180:138-145.  24.  Breidenstein, E. B. M., C. de la Fuente-Núñez, and R. E. W. Hancock. 2011. Pseudomonas aeruginosa: all roads lead to resistance. Trends Microbiol. 8:419-426.  25.  Brimer, C. D., and T. C. Montie. 1998. Cloning and comparison of fliC genes and identification of glycosylation in the flagellin of Pseudomonas aeruginosa A-type strains. J. Bacteriol. 180:3209-3217.  26.  Brinkman, F. S., E. L. Macfarlane, P. Warrener, and R. E. Hancock. 2001. Evolutionary relationships among virulence-associated histidine kinases. Infect. Immun. 69:5207-5211.  27.  Bullen, J. J., H. J. Rogers, P. B. Spalding, and C. G. Ward. 2005. Iron and infection: the heart of the matter. FEMS Immunol. Med. Microbiol. 43:325-330.  28.  Caballero, A. R., J. M. Moreau, L. S. Engel, M. E. Marquart, J. M. Hill, and R. J. O'Callaghan. 2001. Pseudomonas aeruginosa protease IV enzyme assays and comparison to other Pseudomonas proteases. Anal. Biochem. 290:330-337.  29.  Carterson, A. J., L. A. Morici, D. W. Jackson, A. Frisk, S. E. Lizewski, R. Jupiter, K. Simpson, D. A. Kunz, S. H. Davis, J. R. Schurr, D. J. Hassett, and M. J. Schurr. 2004. The transcriptional regulator AlgR controls cyanide production in Pseudomonas aeruginosa. J. Bacteriol. 186:6837-6844.  30.  Cheung, D. O., K. Halsey, and D. P. Speert. 2000. Role of pulmonary alveolar macrophages in defense of the lung against Pseudomonas aeruginosa. Infect. Immun. 68:4585-4592.  31.  Chiang, P., and L. L. Burrows. 2003. Biofilm formation by hyperpiliated mutants of Pseudomonas aeruginosa. J. Bacteriol. 185:2374-2378.  32.  Cho, U. S., M. W. Bader, M. F. Amaya, M. E. Daley, R. E. Klevit, S. I. Miller, and W. Xu. 2006. Metal bridges between the PhoQ sensor domain and the membrane regulate transmembrane signaling. J. Mol. Biol. 356:1193-1206. 122  33.  Chroneos, Z. C., Z. Sever-Chroneos, and V. L. Shepherd. 2010. Pulmonary surfactant: an immunological perspective. Cell. Physiol. Biochem. 25:13-26.  34.  Chugani, S., and E. P. Greenberg. 2006. The influence of human respiratory epithelia on Pseudomonas aeruginosa gene expression. Microb. Pathog. 42:29-35.  35.  Ciofu, O., L. F. Mandsberg, T. Bjarnsholt, T. Wassermann, and N. Høiby. 2010. Genetic adaptation of Pseudomonas aeruginosa during chronic lung infection of patients with cystic fibrosis: strong and weak mutators with heterogeneous genetic backgrounds emerge in mucA and/or lasR mutants. Microbiology. 156:1108-1119.  36.  Comolli, J. C., and T. J. Donohue. 2002. Pseudomonas aeruginosa RoxR, a response regulator related to Rhodobacter sphaeroides PrrA, activates expression of the cyanideinsensitive terminal oxidase. Mol. Microbiol. 45:755-768.  37.  Cormack, B. P., R. H. Valdivia, and S. Falkow. 1996. FACS-optimized mutants of the green fluorescent protein (GFP). Gene. 173:33-38.  38.  Cosseau, C., D. A. Devine, E. Dullaghan, J. L. Gardy, A. Chikatamarla, S. Gellatly, L. L. Yu, J. Pistolic, R. Falsafi, J. Tagg, and R. E. Hancock. 2008. The commensal Streptococcus salivarius K12 downregulates the innate immune responses of human epithelial cells and promotes host-microbe homeostasis. Infect. Immun. 76:4163-4175.  39.  Craig, L., M. E. Pique, and J. A. Tainer. 2004. Type IV pilus structure and bacterial pathogenicity. Nat. Rev. Microbiol. 2:363-378.  40.  Dacheux, D., I. Attree, and B. Toussaint. 2001. Expression of ExsA in trans confers type III secretion system-dependent cytotoxicity on noncytotoxic Pseudomonas aeruginosa cystic fibrosis isolates. Infect. Immun. 69:538-542.  41.  D'Argenio, D. A., M. W. Calfee, P. B. Rainey, and E. C. Pesci. 2002. Autolysis and autoaggregation in Pseudomonas aeruginosa colony morphology mutants. J. Bacteriol. 184:6481-6489.  42.  Darveau, R. P., and R. E. W. Hancock. 1983. Procedure for Isolation of bacterial lipopolysaccharides from both smooth and rough Pseudomonas aeruginosa and Salmonella typhimurium strains. J. Bacteriol. 155:831-838.  43.  Dasgupta, N., M. C. Wolfgang, A. L. Goodman, S. K. Arora, J. Jyot, S. Lory, and R. Ramphal. 2003. A four-tiered transcriptional regulatory circuit controls flagellar biogenesis in Pseudomonas aeruginosa. Mol. Microbiol. 50:809-824.  44.  Davies, J. C. 2002. Pseudomonas aeruginosa in cystic fibrosis: pathogenesis and persistence. Paediatr. Respir. Rev. 3:128-134. 123  45.  de Kievit, T. R., and B. H. Iglewski. 2000. Bacterial quorum sensing in pathogenic relationships. Infect. Immun. 68:4839-4849.  46.  Deep, A., U. Chaudhary, and V. Gupta. 2011. Quorum sensing and bacterial pathogenicity: from molecules to disease. J. Lab. Physicians. 3:4-11.  47.  Denning, G. M., L. A. Wollenweber, M. A. Railsback, C. D. Cox, L. L. Stoll, and B. E. Britigan. 1998. Pseudomonas pyocyanin increases interleukin-8 expression by human airway epithelial cells. Infect. Immun. 66:5777-5784.  48.  Devine, D. A., and R. E. W. Hancock (eds.), 2004. Mammalian host defense peptides. Cambridge University Press, Cambridge, United Kingdom.  49.  Devine, D. A. 2003. Antimicrobial peptides in defence of the oral and respiratory tracts. Mol. Immunol. 40:431-443.  50.  Di, A., M. E. Brown, L. V. Deriy, C. Li, F. L. Szeto, Y. Chen, P. Huang, J. Tong, A. P. Naren, V. Bindokas, H. C. Palfrey, and D. J. Nelson. 2006. CFTR regulates phagosome acidification in macrophages and alters bactericidal activity. Nat. Cell Biol. 8:933-944.  51.  Doring, G., C. Meisner, and M. Stern. 2007. A double-blind randomized placebocontrolled phase III study of a Pseudomonas aeruginosa flagella vaccine in cystic fibrosis patients. Proc. Natl. Acad. Sci. U. S. A. 104:11020-11025.  52.  Downey, D. G., S. C. Bell, and J. S. Elborn. 2009. Neutrophils in cystic fibrosis. Thorax. 64:81-88.  53.  Du, X., R. J. Youle, D. J. FitzGerald, and I. Pastan. 2010. Pseudomonas exotoxin Amediated apoptosis is Bak dependent and preceded by the degradation of Mcl-1. Mol. Cell. Biol. 30:3444-3452.  54.  Engel, L. S., J. M. Hill, J. M. Moreau, L. C. Green, J. A. Hobden, and R. J. O'Callaghan. 1998. Pseudomonas aeruginosa protease IV produces corneal damage and contributes to bacterial virulence. Invest. Ophthalmol. Vis. Sci. 39:662-665.  55.  Ernst, R. K., E. C. Yi, L. Guo, Lim Kheng B., J. L. Burns, M. Hackett, and S. I. Millar. 1999. Specific lipopolysaccharide found in cystic fibrosis airway Pseudomonas aeruginosa . Science. 286:1561-1565.  56.  Ernst, R. K., K. N. Adams, S. M. Moskowitz, G. M. Kraig, K. Kawasaki, C. M. Stead, M. S. Trent, and S. I. Miller. 2006. The Pseudomonas aeruginosa lipid A deacylase: Selection for expression and loss within the cystic fibrosis airway. J. Bacteriol. 188:191-201. 124  57.  Ernst, R. K., S. M. Moskowitz, J. C. Emerson, G. M. Kraig, K. N. Adams, M. D. Harvey, B. Ramsey, D. P. Speert, J. L. Burns, and S. I. Miller. 2007. Unique lipid A modifications in Pseudomonas aeruginosa isolated from the airways of patients with cystic fibrosis. J. Infect. Dis. 196:1088-1092.  58.  Feldman, M., R. Bryan, S. Rajan, L. Scheffler, S. Brunnert, H. Tang, and A. Prince. 1998. Role of flagella in pathogenesis of Pseudomonas aeruginosa pulmonary infection. Infect. Immun. 66:43-51.  59.  Fernandez, L., W. J. Gooderham, M. Bains, J. B. McPhee, I. Wiegand, and R. E. Hancock. 2010. Adaptive resistance to the "last hope" antibiotics polymyxin B and colistin in Pseudomonas aeruginosa is mediated by the novel two-component regulatory system ParR-ParS. Antimicrob. Agents Chemother. 54:3372-3382.  60.  Fernandez-Pinar, R., J. Luis Ramos, J. Juan Rodriguez-Herva, and M. EspinosaUrgel. 2008. A two-component regulatory system Integrates redox state and population density sensing in Pseudomonas putida. J. Bacteriol. 190:7666-7674.  61.  Ferrer, M., R. Menendez, R. Amaro, and A. Torres. 2011. The impact of guidelines on the outcomes of community-acquired and ventilator-associated pneumonia. Clin. Chest Med. 32:491-505.  62.  Flato, S., K. Hemminki, E. Thunberg, and A. Georgellis. 1996. DNA adduct formation in the human nasal mucosa as a biomarker of exposure to environmental mutagens and carcinogens. Environ. Health Perspect. 104 (Suppl 3):471-473.  63.  Fleiszig, S. M., and D. J. Evans. 2002. The pathogenesis of bacterial keratitis: studies with Pseudomonas aeruginosa. Clin. Exp. Optom. 85:271-278.  64.  Fomsgaard, A., M. A. Freudenberg, and C. Galanos. 1990. Modification of the silver staining technique to detect lipopolysaccharide in polyacrylamide gels. J. Clin. Microbiol. 28:2627-2631.  65.  Franchi, L., A. Amer, M. Body-Malapel, T. D. Kanneganti, N. Ozoren, R. Jagirdar, N. Inohara, P. Vandenabeele, J. Bertin, A. Coyle, E. P. Grant, and G. Nunez. 2006. Cytosolic flagellin requires Ipaf for activation of caspase-1 and interleukin 1beta in Salmonella-infected macrophages. Nat. Immunol. 7:576-582.  66.  Frank, D. W., G. Nair, and H. P. Schweizer. 1994. Construction and characterization of chromosomal insertional mutations of the Pseudomonas aeruginosa exoenzyme S transregulatory locus. Infect. Immun. 62:554-563.  125  67.  Fujimoto, J., J. Wiener-Kronish, S. Hashimoto, and T. Sawa. 2002. Effects of Cl2MDP-encapsulating liposomes in a murine model of Pseudomonas aeruginosainduced sepsis. J. Liposome Res. 12:239-257.  68.  Fujita, K., T. Akino, and H. Yoshioka. 1988. Characteristics of heat-stable extracellular hemolysin from Pseudomonas aeruginosa. Infect. Immun. 56:1385-1387.  69.  Furutani, T., R. Su, H. Ooshima, and J. Kato. 1995. Simple screening method for lipase for transesterification in organic solvent. Enzyme Microb. Technol. 17:1067-1072.  70.  Galperin, M. Y. 2006. Structural classification of bacterial response regulators: diversity of output domains and domain combinations. J. Bacteriol. 188:4169-4182.  71.  Garcia-Medina, R., W. M. Dunne, P. K. Singh, and S. L. Brody. 2005. Pseudomonas aeruginosa acquires biofilm-like properties within airway epithelial cells. Infect. Immun. 73:8298-8305.  72.  Gibson, R. L., J. L. Burns, and B. W. Ramsey. 2003. Pathophysiology and management of pulmonary infections in cystic fibrosis. Am. J. Respir. Crit. Care Med. 168:918-951.  73.  Giraud, C., C. S. Bernard, V. Calderon, L. Yang, A. Filloux, S. Molin, G. Fichant, C. Bordi, and S. de Bentzmann. 2011. The PprA-PprB two-component system activates CupE, the first non-archetypal Pseudomonas aeruginosa chaperone-usher pathway system assembling fimbriae. Environ. Microbiol. 13:666-683.  74.  Gooderham, W. J., and R. E. W. Hancock. 2009. Regulation of virulence and antibiotic resistance by two-component regulatory systems in Pseudomonas aeruginosa. FEMS Microbiol Rev. 33:279-294.  75.  Gooderham, W. J., S. L. Gellatly, F. Sanschagrin, J. B. McPhee, M. Bains, C. Cosseau, R. C. Levesque, and R. E. Hancock. 2009. The sensor kinase PhoQ mediates virulence in Pseudomonas aeruginosa. Microbiology. 155:699-711.  76.  Goodman, A. L., B. Kulasekara, A. Rietsch, D. Boyd, R. S. Smith, and S. Lory. 2004. A signaling network reciprocally regulates genes associated with acute infection and chronic persistence in Pseudomonas aeruginosa. Dev. Cell. 7:745-754.  77.  Grabenstein, J. P., M. Marceau, C. Pujol, M. Simonet, and J. B. Bliska. 2004. The response regulator PhoP of Yersinia pseudotuberculosis is important for replication in macrophages and for virulence. Infect. Immun. 72:4973-4984.  126  78.  Grassme, H., S. Kirschnek, J. Riethmueller, A. Riehle, G. von Kurthy, F. Lang, M. Weller, and E. Gulbins. 2000. CD95/CD95 ligand interactions on epithelial cells in host defense to Pseudomonas aeruginosa. Science. 290:527-530.  79.  Greene, C. M., T. P. Carroll, S. G. Smith, C. C. Taggart, J. Devaney, S. Griffin, S. J. O'neill, and N. G. McElvaney. 2005. TLR-induced inflammation in cystic fibrosis and non-cystic fibrosis airway epithelial cells. J. Immunol. 174:1638-1646.  80.  Groisman, E. A. 2001. The pleiotropic two-component regulatory system PhoP-PhoQ. J. Bacteriol. 183:1835-1842.  81.  Gruenert, D. C., C. B. Basbaum, M. J. Welsh, M. Li, W. E. Finkbeiner, and J. A. Nadel. 1988. Characterization of human tracheal epithelial cells transformed by an origin-defective simian virus 40. Proc. Natl. Acad. Sci. U. S. A. 85:5951-5955.  82.  Gudmundsson, G., T. Gislason, E. Lindberg, R. Hallin, C. S. Ulrik, E. Brondum, M. M. Nieminen, T. Aine, P. Bakke, and C. Janson. 2006. Mortality in COPD patients discharged from hospital: the role of treatment and co-morbidity. Respir. Res. 7:109.  83.  Gunn, J. S., R. K. Ernst, A. J. McCoy, and S. I. Miller. 2000. Constitutive mutations of the Salmonella enterica serovar Typhimurium transcriptional virulence regulator phoP. Infect. Immun. 68:3758-3762.  84.  Gunn, J. S., K. B. Lim, J. Krueger, K. Kim, L. Guo, M. Hackett, and S. I. Miller. 1998. PmrA-PmrB-regulated genes necessary for 4-aminoarabinose lipid A modification and polymyxin resistance. Mol. Microbiol. 27:1171-1182.  85.  Guzzo, J., J. M. Pages, F. Duong, A. Lazdunski, and M. Murgier. 1991. Pseudomonas aeruginosa alkaline protease: evidence for secretion genes and study of secretion mechanism. J. Bacteriol. 173:5290-5297.  86.  Halbert, R. J., J. L. Natoli, A. Gano, E. Badamgarav, A. S. Buist, and D. M. Mannino. 2006. Global burden of COPD: systematic review and meta-analysis. Eur. Respir. J. 28:523-532.  87.  Hall-Stoodley, L., and P. Stoodley. 2009. Evolving concepts in biofilm infections. Cell. Microbiol. 11:1034-1043.  88.  Hancock, R. E. W., and F. S. L. Brinkman. 2002. Function of Pseudomonas porins in uptake and efflux. Annu. Rev. Microbiol. 56:17-38.  89.  Hancock, R. E. 1998. Resistance mechanisms in Pseudomonas aeruginosa and other nonfermentative gram-negative bacteria. Clin. Infect. Dis. 27 Suppl 1:S93-9. 127  90.  Hancock, R. E., L. M. Mutharia, L. Chan, R. P. Darveau, D. P. Speert, and G. B. Pier. 1983. Pseudomonas aeruginosa isolates from patients with cystic fibrosis: a class of serum-sensitive, nontypable strains deficient in lipopolysaccharide O side chains. Infect. Immun. 42:170-177.  91.  Hankins, J. V., and M. S. Trent. 2009. Secondary acylation of Vibrio cholerae lipopolysaccharide requires phosphorylation of Kdo. J. Biol. Chem. 284:25804-25812.  92.  Harmsen, M., L. Yang, S. J. Pamp, and T. Tolker-Nielsen. 2010. An update on Pseudomonas aeruginosa biofilm formation, tolerance, and dispersal. FEMS Immunol. Med. Microbiol. 59:253-268.  93.  Hatano, K., J. B. Goldberg, and G. B. Pier. 1995. Biologic activities of antibodies to the neutral-polysaccharide component of the Pseudomonas aeruginosa lipopolysaccharide are blocked by O side chains and mucoid exopolysaccharide (alginate). Infect. Immun. 63:21-26.  94.  Hatchette, T. F., R. Gupta, and T. J. Marrie. 2000. Pseudomonas aeruginosa community-acquired pneumonia in previously healthy adults: case report and review of the literature. Clin. Infect. Dis. 31:1349-1356.  95.  Hauser, A. R. 2009. The type III secretion system of Pseudomonas aeruginosa: infection by injection. Nat. Rev. Microbiol. 7:654-665.  96.  Hauser, A. R., E. Cobb, M. Bodi, D. Mariscal, J. Valles, J. N. Engel, and J. Rello. 2002. Type III protein secretion is associated with poor clinical outcomes in patients with ventilator-associated pneumonia caused by Pseudomonas aeruginosa. Crit. Care Med. 30:521-528.  97.  Hayes, E., K. Pohl, N. G. McElvaney, and E. P. Reeves. 2011. The cystic fibrosis neutrophil: a specialized yet potentially defective cell. Arch. Immunol. Ther. Exp. (Warsz). 59:97-112.  98.  He, J., R. L. Baldini, E. Déziel, M. Saucier, Q. Zhang, N. T. Liberati, D. Lee, J. Urbach, H. M. Goodman, and L. G. Rahme. 2004. The broad host range pathogen Pseudomonas aeruginosa strain PA14 carries two pathogenicity islands harboring plant and animal virulence genes. Proc. Natl. Acad. Sci. U. S. A. 101:2530.  99.  Heeb, S., M. P. Fletcher, S. R. Chhabra, S. P. Diggle, P. Williams, and M. Camara. 2011. Quinolones: from antibiotics to autoinducers. FEMS Microbiol. Rev. 35:247-274.  100.  Hidron, A. I., J. R. Edwards, J. Patel, T. C. Horan, D. M. Sievert, D. A. Pollock, S. K. Fridkin, National Healthcare Safety Network Team, and Participating National 128  Healthcare Safety Network Facilities. 2008. NHSN annual update: antimicrobialresistant pathogens associated with healthcare-associated infections: annual summary of data reported to the National Healthcare Safety Network at the Centers for Disease Control and Prevention, 2006-2007. Infect. Control Hosp. Epidemiol. 29:996-1011. 101.  Hitchcock, P. J., and T. M. Brown. 1983. Morphological heterogeneity among Salmonella lipopolysaccharide chemotypes in silver-stained polyacrylamide gels. J. Bacteriol. 154:269-277.  102.  Hite, R. D. 2002. Surfactant deficiency in adults. Clin. Pulm. Med. 9:39-45.  103.  Hobden, J. A. 2002. Pseudomonas aeruginosa proteases and corneal virulence. DNA Cell Biol. 21:391-396.  104.  Hogardt, M., and J. Heesemann. 2010. Adaptation of Pseudomonas aeruginosa during persistence in the cystic fibrosis lung. Int. J. Med. Microbiol. 300:557-562.  105.  Hoiby, N., O. Ciofu, H. K. Johansen, Z. J. Song, C. Moser, P. O. Jensen, S. Molin, M. Givskov, T. Tolker-Nielsen, and T. Bjarnsholt. 2011. The clinical impact of bacterial biofilms. Int. J. Oral Sci. 3:55-65.  106.  Holloway, B. W. 1955. Genetic recombination in Pseudomonas aeruginosa. J. Gen. Microbiol. 13:572-581.  107.  Holm, B. A., L. Keicher, M. Y. Liu, J. Sokolowski, and G. Enhorning. 1991. Inhibition of pulmonary surfactant function by phospholipases. J. Appl. Physiol. 71:317321.  108.  Holt, P. G., D. H. Strickland, M. E. Wikstrom, and F. L. Jahnsen. 2008. Regulation of immunological homeostasis in the respiratory tract. Nat. Rev. Immunol. 8:142-152.  109.  Hurd, S. 2000. The impact of COPD on lung health worldwide: epidemiology and incidence. Chest. 117:1S-4S.  110.  Hurley, B. P., A. L. Goodman, K. L. Mumy, P. Murphy, S. Lory, and B. A. McCormick. 2010. The two-component sensor response regulator RoxS/RoxR plays a role in Pseudomonas aeruginosa interactions with airway epithelial cells. Microb. Infect. 12:190-198.  111.  Iwamura, C., and T. Nakayama. 2008. Toll-like receptors in the respiratory system: their roles in inflammation. Curr. Allergy Asthma Rep. 8:7-13.  112.  Jacobs, M. A., A. Alwood, I. Thaipisuttikul, D. Spencer, E. Haugen, S. Ernst, O. Will, R. Kaul, C. Raymond, R. Levy, C. R. Liu, D. Guenthner, D. Bovee, M. V. 129  Olson, and C. Manoil. 2003. Comprehensive transposon mutant library of Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. U. S. A. 100:14339-14344. 113.  Jacoby, G. A. 2009. AmpC beta-lactamases. Clin. Microbiol. Rev. 22:161-82, Table of Contents.  114.  Janausch, I. G., E. Zientz, Q. H. Tran, A. Kroger, and G. Unden. 2002. C4dicarboxylate carriers and sensors in bacteria. Biochim. Biophys. Acta. 1553:39-56.  115.  Jenal, U., and J. Malone. 2006. Mechanisms of cyclic-di-GMP signaling in bacteria. Annu. Rev. Genet. 40:385-407.  116.  Jiang, J., B. H. Gu, L. M. Albright, and B. T. Nixon. 1989. Conservation between coding and regulatory elements of Rhizobium meliloti and Rhizobium leguminosarum dct genes. J. Bacteriol. 171:5244-5253.  117.  Johansen, H. K., S. M. Moskowitz, O. Ciofu, T. Pressler, and N. Hoiby. 2008. Spread of colistin resistant non-mucoid Pseudomonas aeruginosa among chronically infected Danish cystic fibrosis patients. J. Cyst. Fibros. 7:391-397.  118.  John, G., A. O. Yildirim, B. K. Rubin, D. C. Gruenert, and M. O. Henke. 2010. TLR4-mediated innate immunity is reduced in cystic fibrosis airway cells. Am. J. Respir. Cell Mol. Biol. 42:424-431.  119.  Joseph P, M. 2002. Molecular mechanisms of neutrophil recruitment elicited by bacteria in the lungs. Semin. Immunol. 14:123-132.  120.  Jung, K., L. Fried, S. Behr, and R. Heermann. 2011. Histidine kinases and response regulators in networks. Curr. Opin. Microbiol. 15:1-7.  121.  Kaplan, J. B. 2010. Biofilm dispersal: mechanisms, clinical implications, and potential therapeutic uses. J. Dent. Res. 89:205-218.  122.  Kato, A., and E. A. Groisman. 2008. The PhoQ/PhoP regulatory network of Salmonella enterica . Adv. Exp. Med. Biol. 631:7-21.  123.  King, J. D., D. Kocincova, E. L. Westman, and J. S. Lam. 2009. Lipopolysaccharide biosynthesis in Pseudomonas aeruginosa. Innate Immun. 15:261-312.  124.  Kingma, P. S., and J. A. Whitsett. 2006. In defense of the lung: surfactant protein A and surfactant protein D. Curr. Opin. Pharmacol. 6:277-283.  125.  Kipnis, E., T. Sawa, and J. Wiener-Kronish. 2006. Targeting mechanisms of Pseudomonas aeruginosa pathogenesis. Med. Mal. Infect. 36:78-91. 130  126.  Knight, D. A., and S. T. Holgate. 2003. The airway epithelium: structural and functional properties in health and disease. Respirology. 8:432-446.  127.  Knirel, Y. A., O. V. Bystrova, N. A. Kocharova, U. Zahringer, and G. B. Pier. 2006. Conserved and variable structural features in the lipopolysaccharide of Pseudomonas aeruginosa. J. Endotoxin Res. 12:324-336.  128.  Knowles, M. R., and R. C. Boucher. 2002. Mucus clearance as a primary innate defense mechanism for mammalian airways. J. Clin. Invest. 109:571-577.  129.  Kohler, T., L. K. Curty, F. Barja, C. van Delden, and J. Pechere. 2000. Swarming of Pseudomonas aeruginosa is dependent on cell-to-cell signaling and requires flagella and pili. J. Bacteriol. 182:5990-5996.  130.  Kooguchi, K., S. Hashimoto, A. Kobayashi, Y. Kitamura, I. Kudoh, J. WienerKronish, and T. Sawa. 1998. Role of alveolar macrophages in initiation and regulation of inflammation in Pseudomonas aeruginosa pneumonia. Infect. Immun. 66:3164-3169.  131.  Kuang, Z., Y. Hao, B. E. Walling, J. L. Jeffries, D. E. Ohman, and G. W. Lau. 2011. Pseudomonas aeruginosa elastase provides an escape from phagocytosis by degrading the pulmonary surfactant protein-A. PLoS One. 6:e27091.  132.  Kulasakara, H., V. Lee, A. Brencic, N. Liberati, J. Urbach, S. Miyata, D. G. Lee, A. N. Neely, M. Hyodo, Y. Hayakawa, F. M. Ausubel, and S. Lory. 2006. Analysis of Pseudomonas aeruginosa diguanylate cyclases and phosphodiesterases reveals a role for bis-(3'-5')-cyclic-GMP in virulence. Proc. Natl. Acad. Sci. U. S. A. 103:2839-2844.  133.  Kulasekara, H. D., I. Ventre, B. R. Kulasekara, A. Lazdunski, A. Filloux, and S. Lory. 2005. A novel two-component system controls the expression of Pseudomonas aeruginosa fimbrial cup genes. Mol. Microbiol. 55:368-380.  134.  Kung, V. L., E. A. Ozer, and A. R. Hauser. 2010. The accessory genome of Pseudomonas aeruginosa. Microbiol. Mol. Biol. Rev. 74:621-641.  135.  Kunzelmann, K., T. Koslowsky, T. Hug, D. C. Gruenert, and R. Greger. 1994. cAMP-dependent activation of ion conductances in bronchial epithelial cells. Pflugers Arch. 428:590-596.  136.  Laarman, A. J., B. W. Bardoel, M. Ruyken, J. Fernie, F. J. Milder, J. A. van Strijp, and S. H. Rooijakkers. 2012. Pseudomonas aeruginosa alkaline protease blocks complement activation via the classical and lectin pathways. J. Immunol. 188:386-393.  131  137.  Lam, J. S., V. L. Taylor, S. T. Islam, Y. Hao, and D. Kocincova. 2011. Genetic and functional diversity of Pseudomonas aeruginosa lipopolysaccharide. Front. Microbiol. 2:1-25.  138.  Lamont, I. L., A. F. Konings, and D. W. Reid. 2009. Iron acquisition by Pseudomonas aeruginosa in the lungs of patients with cystic fibrosis. Biometals. 22:53-60.  139.  Lau, G. W., D. J. Hassett, H. Ran, and F. Kong. 2004. The role of pyocyanin in Pseudomonas aeruginosa infection. Trends Mol. Med. 10:599-606.  140.  Laub, M. T., and M. Goulian. 2007. Specificity in two-component signal transduction pathways. Annu. Rev. Genet. 41:121-145.  141.  Laube, D. M., S. Yim, L. K. Ryan, K. O. Kisich, and G. Diamond. 2006. Antimicrobial peptides in the airway. Curr. Top. Microbiol. Immunol. 306:153-182.  142.  Lee, D. G., J. M. Urbach, G. Wu, N. T. Liberati, R. L. Feinbaum, S. Miyata, L. T. Diggins, J. He, M. Saucier, E. Déziel, L. Friedman, L. Li, G. Grills, K. Montgomery, R. Kucherlapati, L. G. Rahme, and F. M. Ausubel. 2006. Genomic analysis reveals that Pseudomonas aeruginosa virulence is combinatorial. Genome Biol. 7:1-14.  143.  Lee, V. T., R. S. Smith, B. Tummler, and S. Lory. 2005. Activities of Pseudomonas aeruginosa effectors secreted by the Type III secretion system in vitro and during infection. Infect. Immun. 73:1695-1705.  144.  Lesley, J. A., and C. D. Waldburger. 2001. Comparison of the Pseudomonas aeruginosa and Escherichia coli PhoQ sensor domains: evidence for distinct mechanisms of signal detection. J. Biol. Chem. 276:30827-30833.  145.  Lewenza, S., R. K. Falsafi, G. Winsor, W. J. Gooderham, J. B. McPhee, F. S. L. Brinkman, and R. E. W. Hancock. 2005. Construction of a mini-Tn5-luxCDABE mutant library in Pseudomonas aeruginosa PAO1: A tool for identifying differentially regulated genes. Genome Res. 15:583-589.  146.  Li, J., R. V. Swanson, M. I. Simon, and R. M. Weis. 1995. Response regulators CheB and CheY exhibit competitive binding to the kinase CheA. Biochemistry. 34:1462614636.  147.  Li, W., and C. D. Lu. 2007. Regulation of carbon and nitrogen utilization by CbrAB and NtrBC two-component systems in Pseudomonas aeruginosa. J. Bacteriol. 189:54135420.  148.  Liberati, N. T., J. M. Urbach, S. Miyata, D. G. Lee, E. Drenkard, G. Wu, J. Villanueva, T. Wei, and F. M. Ausubel. 2006. An ordered, nonredundant library of 132  Pseudomonas aeruginosa strain PA14 transposon insertion mutants. Proc. Natl. Acad. Sci. U. S. A. 103:2833-2838. 149.  Lieleg, O., M. Caldara, R. Baumgartel, and K. Ribbeck. 2011. Mechanical robustness of Pseudomonas aeruginosa biofilms. Soft Matter. 7:3307-3314.  150.  Livermore, D. M. 2002. Multiple mechanisms of antimicrobial resistance in Pseudomonas aeruginosa: our worst nightmare? Clin. Infect. Dis. 34:634-640.  151.  Lizewski, S. E., D. S. Lundberg, and M. J. Schurr. 2002. The transcriptional regulator AlgR is essential for Pseudomonas aeruginosa pathogenesis. Infect. Immun. 70:60836093.  152.  Llama-Palacios, A., E. Lopez-Solanilla, and P. Rodriguez-Palenzuela. 2005. Role of the PhoP-PhoQ system in the virulence of Erwinia chrysanthemi strain 3937: involvement in sensitivity to plant antimicrobial peptides, survival at acid pH, and regulation of pectolytic enzymes. J. Bacteriol. 187:2157-2162.  153.  Lo, A. 2008. Early interaction between Pseudomonas aeruginosa and polarized human bronchial epithelial cells. M.Sc. University of British Columbia, Vancouver, BC.  154.  Lopez, D., H. Vlamakis, and R. Kolter. 2010. Biofilms. Cold Spring Harb Perspect. Biol. 2:a000398.  155.  Lyczak, J. B., C. L. Cannon, and G. B. Pier. 2000. Establishment of Pseudomonas aeruginosa infection: lessons from a versatile opportunist. Microb. Infect. 2:1051-1060.  156.  Macfarlane, E. L. A., A. Kwasnicka, M. M. Ochs, and R. E. W. Hancock. 1999. PhoP-PhoQ homologues in Pseudomonas aeruginosa regulate expression of the outermembrane protein OprH and polymyxin B resistance. Mol. Microbiol. 34:305-316.  157.  Macfarlane, E. L., A. Kwasnicka, and R. E. Hancock. 2000. Role of Pseudomonas aeruginosa PhoP-PhoQ in resistance to antimicrobial cationic peptides and aminoglycosides. Microbiology. 146 ( Pt 10):2543-2554.  158.  Mackenzie, C., J. M. Eraso, M. Choudhary, J. H. Roh, X. Zeng, P. Bruscella, Á. Puskás, and S. Kaplan. 2007. Postgenomic Adventures with Rhodobacter sphaeroides. Annu. Rev. Microbiol. 61:283-307.  159.  Mah, T. C., and G. A. O'Toole. 2001. Mechanisms of biofilm resistance to antimicrobial agents. Trends Microbiol. 9:34-39.  133  160.  Mahenthiralingam, E., M. E. Campbell, and D. P. Speert. 1994. Nonmotility and phagocytic resistance of Pseudomonas aeruginosa isolates from chronically colonized patients with cystic fibrosis. Infect. Immun. 62:596-605.  161.  Malloy, J. L., R. A. Veldhuizen, B. A. Thibodeaux, R. J. O'Callaghan, and J. R. Wright. 2005. Pseudomonas aeruginosa protease IV degrades surfactant proteins and inhibits surfactant host defense and biophysical functions. Am. J. Physiol. Lung Cell. Mol. Physiol. 288:L409-18.  162.  Mariencheck, W. I., J. F. Alcorn, S. M. Palmer, and J. R. Wright. 2003. Pseudomonas aeruginosa elastase degrades surfactant proteins A and D. Am. J. Respir. Cell Mol. Biol. 28:528-537.  163.  Martinez-Solano, L., M. D. Macia, A. Fajardo, A. Oliver, and J. L. Martinez. 2008. Chronic Pseudomonas aeruginosa infection in chronic obstructive pulmonary disease. Clin. Infect. Dis. 47:1526-1533.  164.  Massaro, G. D., G. Singh, R. Mason, C. G. Plopper, A. M. Malkinson, and D. B. Gail. 1994. Biology of the Clara cell. Am. J. Physiol. 266:L101-6.  165.  Mathee, K., G. Narasimhan, C. Valdes, X. Qiu, J. M. Matewish, M. Koehrsen, A. Rokas, C. N. Yandava, R. Engels, E. Zeng, R. Olavarietta, M. Doud, R. S. Smith, P. Montgomery, J. R. White, P. A. Godfrey, C. Kodira, B. Birren, J. E. Galagan, and S. Lory. 2008. Dynamics of Pseudomonas aeruginosa genome evolution. Proc. Natl. Acad. Sci. U. S. A. 105:3100-3105.  166.  Matsumoto, K. 2004. Role of bacterial proteases in pseudomonal and serratial keratitis. Biol. Chem. 385:1007-1016.  167.  Matsumoto, T., K. Tateda, N. Furuya, S. Miyazaki, A. Ohno, Y. Ishii, Y. Hirakata, and K. Yamaguchi. 1998. Efficacies of alkaline protease, elastase and exotoxin A toxoid vaccines against gut-derived Pseudomonas aeruginosa sepsis in mice. J. Med. Microbiol. 47:303-308.  168.  Matsuo, Y., S. Eda, N. Gotoh, E. Yoshihara, and T. Nakae. 2004. MexZ-mediated regulation of mexXY multidrug efflux pump expression in Pseudomonas aeruginosa by binding on the mexZ-mexX intergenic DNA. FEMS Microbiol. Lett. 238:23-28.  169.  Mattick, J. S. 2002. Type IV pili and twitching motility. Annu. Rev. Microbiol. 56:289314.  170.  Mavrodi, D. V., R. F. Bonsall, S. M. Delaney, M. J. Soule, G. Phillips, and L. S. Thomashow. 2001. Functional analysis of genes for biosynthesis of pyocyanin and 134  phenazine-1-carboxamide from Pseudomonas aeruginosa PAO1. J. Bacteriol. 183:64546465. 171.  McCleary, W. R., and J. B. Stock. 1994. Acetyl phosphate and the activation of twocomponent response regulators. J. Biol. Chem. 269:31567-31572.  172.  McPhee, J. B., M. Bains, G. Winsor, S. Lewenza, A. Kwasnicka, M. D. Brazas, F. S. Brinkman, and R. E. Hancock. 2006. Contribution of the PhoP-PhoQ and PmrA-PmrB two-component regulatory systems to Mg2+-induced gene regulation in Pseudomonas aeruginosa. J. Bacteriol. 188:3995-4006.  173.  McPhee, J. B., S. Tamber, M. Bains, E. Maier, S. Gellatly, A. Lo, R. Benz, and R. E. Hancock. 2009. The major outer membrane protein OprG of Pseudomonas aeruginosa contributes to cytotoxicity and forms an anaerobically regulated, cation-selective channel. FEMS Microbiol. Lett. 296:241-247.  174.  McPhee, J. B., S. Lewenza, and R. E. W. Hancock. 2003. Cationic antimicrobial peptides activate a two-component regulatory system, PmrA-PmrB, that regulates resistance to polymyxin B and cationic antimicrobial peptides in Pseudomonas aeruginosa. Mol. Microbiol. 50:205-217.  175.  Mena, A., E. E. Smith, J. L. Burns, D. P. Speert, S. M. Moskowitz, J. L. Perez, and A. Oliver. 2008. Genetic adaptation of Pseudomonas aeruginosa to the airways of cystic fibrosis patients is catalyzed by hypermutation. J. Bacteriol. 190:7910-7917.  176.  Mescher, A. L. 2010. Junqueira's Basic Histology. Twelfth Edition. McGraw-Hill Companies, United States of America.  177.  Meyer, M., F. Huaux, X. Gavilanes, S. van den Brule, P. Lebecque, S. Lo Re, D. Lison, B. Scholte, P. Wallemacq, and T. Leal. 2009. Azithromycin reduces exaggerated cytokine production by M1 alveolar macrophages in cystic fibrosis. Am. J. Respir. Cell Mol. Biol. 41:590-602.  178.  Miao, E. A., E. Andersen-Nissen, S. E. Warren, and A. Aderem. 2007. TLR5 and Ipaf: dual sensors of bacterial flagellin in the innate immune system. Semin. Immunopathol. 29:275-288.  179.  Mikkelsen, H., M. Sivaneson, and A. Filloux. 2011. Key two-component regulatory systems that control biofilm formation in Pseudomonas aeruginosa. Environ. Microbiol. 13:1666-1681.  135  180.  Mikkelsen, H., R. McMullan , and A. Filloux . 2011. The Pseudomonas aeruginosa reference strain PA14 displays increased virulence due to a mutation in ladS. PLoS ONE. 6:e29113.  181.  Miller, A. K., M. K. Brannon, L. Stevens, H. K. Johansen, S. E. Selgrade, S. I. Miller, N. Hoiby, and S. M. Moskowitz. 2011. PhoQ mutations promote lipid A modification and polymyxin resistance of Pseudomonas aeruginosa found in colistintreated cystic fibrosis patients. Antimicrob. Agents Chemother. 55:5761-5769.  182.  Miller, S. I., A. M. Kukral, and J. J. Mekalanos. 1989. A two-component regulatory system (phoP phoQ) controls Salmonella typhimurium virulence. Proc. Natl. Acad. Sci. U. S. A. 86:5054-5058.  183.  Mirleau, P., S. Delorme, L. Philippot, J. Meyer, S. Mazurier, and P. Lemanceau. 2000. Fitness in soil and rhizosphere of Pseudomonas fluorescens C7R12 compared with a C7R12 mutant affected in pyoverdine synthesis and uptake. FEMS Microbiol. Ecol. 34:35-44.  184.  Miyazaki, S., T. Matsumoto, K. Tateda, A. Ohno, and K. Yamaguchi. 1995. Role of exotoxin A in inducing severe Pseudomonas aeruginosa infections in mice. J. Med. Microbiol. 43:169-175.  185.  Mookherjee, N., K. L. Brown, D. M. E. Bowdish, S. Doria, R. Falsafi, K. Hokamp, F. M. Roche, R. X. Mu, G. H. Doho, J. Pistolic, J. P. Powers, J. Bryan, F. S. L. Brinkman, and R. E. W. Hancock. 2006. Modulation of the TLR-mediated inflammatory response by the endogenous human host defense peptide LL-37. J. Immunol. 176:2455-2464.  186.  Moore, N. M., and M. L. Flaws. 2011. Antimicrobial resistance mechanisms in Pseudomonas aeruginosa. Clin. Lab. Sci. 24:47-51.  187.  Morissette, C., C. Francoeur, C. Darmond-Zwaig, and F. Gervais. 1996. Lung phagocyte bactericidal function in strains of mice resistant and susceptible to Pseudomonas aeruginosa. Infect. Immun. 64:4984-4992.  188.  Moscoso, J. A., H. Mikkelsen, S. Heeb, P. Williams, and A. Filloux. 2011. The Pseudomonas aeruginosa sensor RetS switches type III and type VI secretion via c-diGMP signalling. Environ. Microbiol. 13:3128-3138.  189.  Moskowitz, S. M., and R. K. Ernst. 2010. The role of Pseudomonas lipopolysaccharide in cystic fibrosis airway infection. Subcell. Biochem. 53:241-253.  136  190.  Moskowitz, S. M., R. K. Ernst, and S. I. Miller. 2004. PmrAB, a two-component regulatory system of Pseudomonas aeruginosa that modulates resistance to cationic antimicrobial peptides and addition of aminoarabinose to lipid A. J. Bacteriol. 186:575579.  191.  Moskowitz, S. M., E. Garber, Y. Chen, S. A. Clock, S. Tabibi, A. K. Miller, M. Doctor, and L. Saiman. 2010. Colistin susceptibility testing: evaluation of reliability for cystic fibrosis isolates of Pseudomonas aeruginosa and Stenotrophomonas maltophilia. J. Antimicrob. Chemother. 65:1416-1423.  192.  Muir, A., G. Soong, S. Sokol, B. Reddy, M. I. Gomez, A. Van Heeckeren, and A. Prince. 2004. Toll-like receptors in normal and cystic fibrosis airway epithelial cells. Am. J. Respir. Cell Mol. Biol. 30:777-783.  193.  Murphy, T. F., A. L. Brauer, K. Eschberger, P. Lobbins, L. Grove, X. Cai, and S. Sethi. 2008. Pseudomonas aeruginosa in chronic obstructive pulmonary disease. Am. J. Respir. Crit. Care Med. 177:853-860.  194.  National Clinical Guideline Centre (UK). 2010. .  195.  Nishijyo, T., D. Haas, and Y. Itoh. 2001. The CbrA–CbrB two-component regulatory system controls the utilization of multiple carbon and nitrogen sources in Pseudomonas aeruginosa. Mol Microbiol. 40:917-931.  196.  Nunn, D., S. Bergman, and S. Lory. 1990. Products of three accessory genes, pilB, pilC, and pilD, are required for biogenesis of Pseudomonas aeruginosa pili. J. Bacteriol. 172:2911-2919.  197.  Ojielo, C. I., K. Cooke, P. Mancuso, T. J. Standiford, K. M. Olkiewicz, S. Clouthier, L. Corrion, M. N. Ballinger, G. B. Toews, R. Paine 3rd, and B. B. Moore. 2003. Defective phagocytosis and clearance of Pseudomonas aeruginosa in the lung following bone marrow transplantation. J. Immunol. 171:4416-4424.  198.  O'May, C. Y., D. W. Reid, and S. M. Kirov. 2006. Anaerobic culture conditions favor biofilm-like phenotypes in Pseudomonas aeruginosa isolates from patients with cystic fibrosis. FEMS Immunol. Med. Microbiol. 48:373-380.  199.  Osborn, M. J. 1963. Studies on Gram-negative cell wall 1. Evidence for role of 2-keto-3 deoxyoctonate in lipopolysaccharide of Salmonella typhimurium. Proc. Natl. Acad. Sci. U. S. A. 50:499-506.  137  200.  Ostroff, R. M., A. I. Vasil, and M. L. Vasil. 1990. Molecular comparison of a nonhemolytic and a hemolytic phospholipase C from Pseudomonas aeruginosa. J. Bacteriol. 172:5915-5923.  201.  Ostroff, R. M., B. Wretlind, and M. L. Vasil. 1989. Mutations in the hemolyticphospholipase C operon result in decreased virulence of Pseudomonas aeruginosa PAO1 grown under phosphate-limiting conditions. Infect. Immun. 57:1369-1373.  202.  O'Toole, G. A., and R. Kolter. 1998. Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds through multiple convergent signalling pathways: a genetic analysis. Mol. Microbiol. 28:449-461.  203.  O'Toole, G. A., and R. Kolter. 1998. Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol. Microbiol. 30:295-304.  204.  Otter, J. A., S. Yezli, and G. L. French. 2011. The role played by contaminated surfaces in the transmission of nosocomial pathogens. Infect. Control Hosp. Epidemiol. 32:687-699.  205.  Overhage, J., S. Lewenza, A. K. Marr, and R. E. W. Hancock. 2007. Identification of genes involved in swarming motility using a Pseudomonas aeruginosa PAO1 mini-Tn5lux mutant library. J Bact. 189:2164-2169.  206.  Oyston, P. C. F., N. Dorrell, K. Williams, S. Li, M. Green, R. W. Titball, and B. W. Wren. 2000. The response regulator PhoP is important for survival under conditions of macrophage-induced stress and virulence in Yersinia pestis. Infect. Immun. 68:34193425.  207.  Palmer, K. L., L. M. Aye, and M. Whiteley. 2007. Nutritional cues control Pseudomonas aeruginosa multicellular behavior in cystic fibrosis sputum. J. Bacteriol. 189:8079-8087.  208.  Patriquin, G. M., E. Banin, C. Gilmour, R. Tuchman, E. P. Greenberg, and K. Poole. 2008. Influence of quorum sensing and iron on twitching motility and biofilm formation in Pseudomonas aeruginosa. J. Bacteriol. 190:662-671.  209.  Pearson, J. P., M. Feldman, B. H. Iglewski, and A. Prince. 2000. Pseudomonas aeruginosa cell-to-cell signaling is required for virulence in a model of acute pulmonary infection. Infect. Immun. 68:4331-4334.  210.  Peng, X., C. Xu, H. Ren, X. Lin, L. Wu, and S. Wang. 2005. Proteomic analysis of the sarcosine-insoluble outer membrane fraction of Pseudomonas aeruginosa responding to ampicilin, kanamycin, and tetracycline resistance. J. Proteome Res. 4:2257-2265. 138  211.  Perez-Gil, J., and T. E. Weaver. 2010. Pulmonary surfactant pathophysiology: current models and open questions. Physiology. 25:132-141.  212.  Potter, C. A., E. Jeong, M. P. Williamson, P. J. F. Henderson, and M. K. PhillipsJones. 2006. Redox-responsive in vitro modulation of the signalling state of the isolated PrrB sensor kinase of Rhodobacter sphaeroides. FEBS Lett. 580:3206-3210.  213.  Prost, L. R., M. E. Daley, M. W. Bader, R. E. Klevit, and S. I. Miller. 2008. The PhoQ histidine kinases of Salmonella and Pseudomonas spp. are structurally and functionally different: evidence that pH and antimicrobial peptide sensing contribute to mammalian pathogenesis. Mol. Microbiol. 69:503-519.  214.  Prost, L. R., M. E. Daley, V. Le Sage, M. W. Bader, H. Le Moual, R. E. Klevit, and S. I. Miller. 2007. Activation of the bacterial sensor kinase PhoQ by acidic pH. Mol. Cell. 26:165-174.  215.  Prost, L. R., and S. I. Miller. 2008. The Salmonellae PhoQ sensor: mechanisms of detection of phagosome signals. Cell. Microbiol. 10:576-582.  216.  Provinciali, M., M. Cardelli, and F. Marchegiani. 2011. Inflammation, chronic obstructive pulmonary disease and aging. Curr. Opin. Pulm. Med. 17 Suppl 1:S3-10.  217.  Qi, F., M. Carbone, H. Yang, and G. Gaudino. 2011. Simian virus 40 transformation, malignant mesothelioma and brain tumors. Expert Rev. Respir. Med. 5:683-697.  218.  Rajan, S., G. Cacalano, R. Bryan, A. J. Ratner, C. U. Sontich, A. van Heerckeren, P. Davis, and A. Prince. 2000. Pseudomonas aeruginosa induction of apoptosis in respiratory epithelial cells - Analysis of the effects of cystic fibrosis transmembrane conductance regulator dysfunction and bacterial virulence factors. Am. J. Respir. Cell Mol. Biol. 23:304-312.  219.  Ritchings, B. W., E. C. Almira, S. Lory, and R. Ramphal. 1995. Cloning and phenotypic characterization of fleS and fleR, new response regulators of Pseudomonas aeruginosa which regulate motility and adhesion to mucin. Infect. Immun. 63:4868-4876.  220.  Rodrigue, A., Y. Quentin, A. Lazdunski, V. Mejean, and M. Foglino. 2000. Cell signalling by oligosaccharides. Two-component systems in Pseudomonas aeruginosa: why so many? Trends Microbiol. 8:498-504.  221.  Roy-Burman, A., R. H. Savel, S. Racine, B. L. Swanson, N. S. Revadigar, J. Fujimoto, T. Sawa, D. W. Frank, and J. P. Wiener-Kronish. 2001. Type III protein secretion is associated with death in lower respiratory and systemic Pseudomonas aeruginosa infections. J. Infect. Dis. 183:1767-1774. 139  222.  Ryder, C., M. Byrd, and D. J. Wozniak. 2007. Role of polysaccharides in Pseudomonas aeruginosa biofilm development. Curr. Opin. Microbiol. 10:644-648.  223.  Sadikot, R. T., T. S. Blackwell, J. W. Christman, and A. S. Prince. 2005. Pathogenhost interactions in Pseudomonas aeruginosa pneumonia. Am. J. Respir. Crit. Care Med. 171:1209-1223.  224.  Sato, H., and D. W. Frank. 2004. ExoU is a potent intracellular phospholipase. Mol. Microbiol. 53:1279-1290.  225.  Schaber, J. A., N. L. Carty, N. A. McDonald, E. D. Graham, R. Cheluvappa, J. A. Griswold, and A. N. Hamood. 2004. Analysis of quorum sensing-deficient clinical isolates of Pseudomonas aeruginosa. J. Med. Microbiol. 53:841-853.  226.  Schultz, M. J., P. Speelman, S. A. Zaat, C. E. Hack, S. J. van Deventer, and T. van der Poll. 2000. The effect of Pseudomonas exotoxin A on cytokine production in whole blood exposed to Pseudomonas aeruginosa. FEMS Immunol. Med. Microbiol. 29:227232.  227.  Schurek, K. N., J. L. Sampaio, C. R. Kiffer, S. Sinto, C. M. Mendes, and R. E. Hancock. 2009. Involvement of pmrAB and phoPQ in polymyxin B adaptation and inducible resistance in non-cystic fibrosis clinical isolates of Pseudomonas aeruginosa . Antimicrob. Agents Chemother. 53:4345-4351.  228.  Schwarzer, C., Z. Fu, M. Patanwala, L. Hum, M. Lopez-Guzman, B. Illek, W. Kong, S. V. Lynch, and T. E. Machen. 2012. Pseudomonas aeruginosa biofilm-associated homoserine lactone C12 rapidly activates apoptosis in airway epithelia. Cell. Microbiol. .  229.  Schweizer, H. P. 1991. Escherichia-Pseudomonas shuttle vectors derived from pUC18/19. Gene. 97:109-112.  230. Schweizer, H. P. 2003. Efflux as a mechanism of resistance to antimicrobials in Pseudomonas aeruginosa and related bacteria: unanswered questions. Genet. Mol. Res. 2:48-62. 231.  Sha, Q., A. Q. Truong-Tran, J. R. Plitt, L. A. Beck, and R. P. Schleimer. 2004. Activation of airway epithelial cells by toll-like receptor agonists. Am. J. Respir. Cell Mol. Biol. 31:358-364.  232.  Shaver, C. M., and A. R. Hauser. 2004. Relative contributions of Pseudomonas aeruginosa ExoU, ExoS, and ExoT to virulence in the lung. Infect. Immun. 72:69696977.  140  233.  Silby, M. W., C. Winstanley, S. A. Godfrey, S. B. Levy, and R. W. Jackson. 2011. Pseudomonas genomes: diverse and adaptable. FEMS Microbiol. Rev. 35:652-680.  234.  Smith, E. E., D. G. Buckley, Z. Wu, C. Saenphimmachak, L. R. Hoffman, D. A. D'Argenio, S. I. Miller, B. W. Ramsey, D. P. Speert, S. M. Moskowitz, J. L. Burns, F. Kaul, and M. V. Olson. 2006. Genetic adaptation by Pseudomonas aeruginosa to the airways of cystic fibrosis patients. Proc. Natl. Acad. Sci. U. S. A. 103:8487-8492.  235.  Son, M. S., W. J. Matthews Jr, Y. Kang, D. T. Nguyen, and T. T. Hoang. 2007. In vivo evidence of Pseudomonas aeruginosa nutrient acquisition and pathogenesis in the lungs of cystic fibrosis patients. Infect. Immun. 75:5313-5324.  236.  Sonnleitner, E., L. Abdou, and D. Haas. 2009. Small RNA as global regulator of carbon catabolite repression in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. U. S. A. 106:21866-21871.  237.  Sriramulu, D. D., M. Nimtz, and U. Romling. 2005. Proteome analysis reveals adaptation of Pseudomonas aeruginosa to the cystic fibrosis lung environment. Proteomics. 5:3712-3721.  238.  Sriramulu, D. D., H. Lünsdorf, J. S. Lam, and U. Römling. 2005. Microcolony formation: a novel biofilm model of Pseudomonas aeruginosa for the cystic fibrosis lung. J. Med. Microbio. 54:667-676.  239.  Stepinska, M., and E. A. Trafny. 2008. Diverse type III secretion phenotypes among Pseudomonas aeruginosa strains upon infection of murine macrophage-like and endothelial cell lines. Microb. Pathog. 44:448-458.  240.  Stock, A. M., V. L. Robinson, and P. N. Goudreau. 2000. Two-component signal transduction. Annu. Rev. Biochem. 69:183-215.  241.  Storey, D. G., E. E. Ujack, and H. R. Rabin. 1992. Population transcript accumulation of Pseudomonas aeruginosa exotoxin A and elastase in sputa from patients with cystic fibrosis. Infect. Immun. 60:4687-4694.  242.  Stover, C. K., X. Q. Pham, A. L. Erwin, S. D. Mizoguchi, P. Warrener, M. J. Hickey, F. S. L. Brinkman, W. O. Hufnagle, D. J. Kowalik, M. Lagrou, R. L. Garber, L. Goltry, E. Tolentino, S. Westbrock-Wadman, Y. Yuan, L. L. Brody, S. N. Coulter, F. R. Folger, A. Kas, K. Larbig, R. Lim, K. Smith, D. Spencer, G. K. -. Wong, Z. P. Wu I.T., J. Reizer, M. H. Saier, R. E. W. Hancock, S. Lory, and M. V. Olson. 2000. Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature. 406:959-964. 141  243.  Strateva, T., and D. Yordanov. 2009. Pseudomonas aeruginosa - a phenomenon of bacterial resistance. J. Med. Microbiol. 58:1133-1148.  244.  Tang, H. B., E. DiMango, R. Bryan, M. Gambello, B. H. Iglewski, J. B. Goldberg, and A. Prince. 1996. Contribution of specific Pseudomonas aeruginosa virulence factors to pathogenesis of pneumonia in a neonatal mouse model of infection. Infect. Immun. 64:37-43.  245.  Teghanemt, A., D. Zhang, E. N. Levis, J. P. Weiss, and T. L. Gioannini. 2005. Molecular basis of reduced potency of underacylated endotoxins. J. Immunol. 175:46694676.  246.  Toder, D. S., S. J. Ferrell, J. L. Nezezon, L. Rust, and B. H. Iglewski. 1994. lasA and lasB genes of Pseudomonas aeruginosa: analysis of transcription and gene product activity. Infect. Immun. 62:1320-1327.  247.  Touw, D. S., D. R. Patel, and B. van den Berg. 2010. The crystal structure of OprG from Pseudomonas aeruginosa, a potential channel for transport of hydrophobic molecules across the outer membrane. PLoS One. 5:e15016.  248.  Trent, M. S., A. A. Ribeiro, S. H. Lin, R. J. Cotter, and C. R. H. Raetz. 2001. An inner membrane enzyme in Salmonella and Escherichia coli that transfers 4-amino-4deoxy-L-arabinose to lipid A - Induction in polymyxin-resistant mutants and role of a novel lipid-linked donor. J. Biol. Chem. 276:43122-43131.  249.  Tsai, W. C., R. M. Strieter, B. Mehrad, M. W. Newstead, X. Zeng, and T. J. Standiford. 2000. CXC chemokine receptor CXCR2 is essential for protective innate host response in murine Pseudomonas aeruginosa pneumonia. Infect. Immun. 68:42894296.  250.  Valentini, M., N. Storelli, and K. Lapouge. 2011. Identification of C4-dicarboxylate transport systems in Pseudomonas aerguinosa PAO1. J Bacteriol. 193:4307-4316.  251.  Vallet, I., J. W. Olson, S. Lory, A. Lazdunski, and A. Filloux. 2001. The chaperone/usher pathways of Pseudomonas aeruginosa: identification of fimbrial gene clusters (cup) and their involvement in biofilm formation. Proc. Natl. Acad. Sci. U. S. A. 98:6911-6916.  252.  Vareille, M., E. Kieninger, M. R. Edwards, and N. Regamey. 2011. The airway epithelium: soldier in the fight against respiratory viruses. Clin. Microbiol. Rev. 24:210229.  142  253.  Veesenmeyer, J. L., A. R. Hauser, T. Lisboa, and J. Rello. 2009. Pseudomonas aeruginosa virulence and therapy: evolving translational strategies. Crit. Care Med. 37:1777-1786.  254.  Waite, R. D., A. Paccanaro, A. Papakonstantinopoulou, J. M. Hust, M. Saqi, E. Littler, and M. A. Curtis. 2006. Clustering of Pseudomonas aeruginosa transcriptomes from planktonic cultures, developing and mature biofilms reveals distinct expression profiles. BMC Genomics. 7:162.  255.  Walsh, A. G., M. J. Matewish, L. L. Burrows, M. A. Monteiro, M. B. Perry, and J. S. Lam. 2000. Lipopolysaccharide core phosphates are required for viability and intrinsic drug resistance in Pseudomonas aeruginosa. Mol. Microbiol. 35:718-727.  256.  Wan, H., H. L. Winton, C. Soeller, G. A. Stewart, P. J. Thompson, D. C. Gruenert, M. B. Cannell, D. R. Garrod, and C. Robinson. 2000. Tight junction properties of the immortalized human bronchial epithelial cell lines Calu-3 and 16HBE14o-. Eur. Respir. J. 15:1058-1068.  257.  Wang, Y. P., K. Birkenhead, B. Boesten, S. Manian, and F. O'Gara. 1989. Genetic analysis and regulation of the Rhizobium meliloti genes controlling C4-dicarboxylic acid transport. Gene. 85:135-144.  258.  Wei, Q., S. Tarighi, A. Dotsch, S. Haussler, M. Musken, V. J. Wright, M. Camara, P. Williams, S. Haenen, B. Boerjan, A. Bogaerts, E. Vierstraete, P. Verleyen, L. Schoofs, R. Willaert, V. N. De Groote, J. Michiels, K. Vercammen, A. Crabbe, and P. Cornelis. 2011. Phenotypic and genome-wide analysis of an antibiotic-resistant small colony variant (SCV) of Pseudomonas aeruginosa. PLoS One. 6:e29276.  259.  Whitchurch, C. B., R. A. Alm, and J. S. Mattick. 1996. The alginate regulator AlgR and an associated sensor FimS are required for twitching motility in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. U. S. A. 93:9839-9843.  260.  Whitsett, J. A. 2002. Intrinsic and innate defenses in the lung: intersection of pathways regulating lung morphogenesis, host defense, and repair. J. Clin. Invest. 109:565-569.  261.  Whooley, M. A., and A. J. McLoughlin. 1982. The regulation of pyocyanin production in Pseudomonas aeruginosa . Eur. J. Appl. Microb. Biotechnol. 15:161.  262.  Williams, B. J., J. Dehnbostel, and T. S. Blackwell. 2010. Pseudomonas aeruginosa: host defence in lung diseases. Respirology. 15:1037-1056.  263.  Wolf, P., and U. Elsässer-Beile. 2009. Pseudomonas exotoxin A: From virulence factor to anti-cancer agent. Int. J. Med. Microbiol. 299:161-176. 143  264.  Wolfgang, M. C., B. R. Kulasekara, X. Liang, D. Boyd, K. Wu, Q. Yang, C. G. Miyada, and S. Lory. 2003. Conservation of genome content and virulence determinants among clinical and environmental isolates of Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. U. S. A. 100:8484-8489.  265.  Wolfgang, M. C., J. Jyot, A. L. Goodman, R. Ramphal, and S. Lory. 2004. Pseudomonas aeruginosa regulates flagellin expression as part of a global response to airway fluid from cystic fibrosis patients. Proc. Natl. Acad. Sci. U. S. A. 101:6664-6668.  266.  World Health Organization. 2011. WHO report on the global tobacco epidemic, 2011: Warning about the dangers of tobacco.  267.  Wozniak, D. J., T. J. Wyckoff, M. Starkey, R. Keyser, P. Azadi, G. A. O'Toole, and M. R. Parsek. 2003. Alginate is not a significant component of the extracellular polysaccharide matrix of PA14 and PAO1 Pseudomonas aeruginosa biofilms. Proc. Natl. Acad. Sci. U. S. A. 100:7907-7912.  268.  Yahr, T. L., and M. C. Wolfgang. 2006. Transcriptional regulation of the Pseudomonas aeruginosa type III secretion system. Mol. Microbiol. 62:631-640.  269.  Yang, L., L. Jelsbak, and S. Molin. 2011. Microbial ecology and adaptation in cystic fibrosis airways. Environ. Microbiol. 13:1682-1689.  270.  Yarosh, O. K., T. C. Charles, and T. M. Finan. 1989. Analysis of C4-dicarboxylate transport genes in Rhizobium meliloti. Mol. Microbiol. 3:813-823.  271.  Yeung, A. T., M. Bains, and R. E. Hancock. 2011. The sensor kinase CbrA is a global regulator that modulates metabolism, virulence, and antibiotic resistance in Pseudomonas aeruginosa. J. Bacteriol. 193:918-931.  272.  Yeung, A. T., E. C. Torfs, F. Jamshidi, M. Bains, I. Wiegand, R. E. Hancock, and J. Overhage. 2009. Swarming of Pseudomonas aeruginosa is controlled by a broad spectrum of transcriptional regulators, including MetR. J. Bacteriol. 191:5592-5602.  273.  Yoon, S. S., R. F. Hennigan, G. M. Hilliard, U. A. Ochsner, K. Parvatiyar, M. C. Kamani, H. L. Allen, T. R. DeKievit, P. R. Gardner, U. Schwab, J. J. Rowe, B. H. Iglewski, T. R. McDermott, R. P. Mason, D. J. Wozniak, R. E. W. Hancock, M. R. Parsek, T. L. Noah, R. C. Boucher, and D. J. Hassett. 2002. Pseudomonas aeruginosa anaerobic respiration in biofilms: relationships to cystic fibrosis pathogenesis. Dev. Cell. 3:593-603.  144  274.  Zhou, Z., S. Lin, R. J. Cotter, and C. R. Raetz. 1999. Lipid A modifications characteristic of Salmonella typhimurium are induced by NH4VO3 in Escherichia coli K12. Detection of 4-amino-4-deoxy-L-arabinose, phosphoethanolamine and palmitate J. Biol. Chem. 274:18503-18514.  145  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0073032/manifest

Comment

Related Items