UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Defining the role of autographa californica multiple nucleopolyhedrovirus immediate early-0 and immediate.. Sokal, Nadia 2012

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata


ubc_2012_fall_sokal_nadia.pdf [ 2.02MB ]
JSON: 1.0072995.json
JSON-LD: 1.0072995+ld.json
RDF/XML (Pretty): 1.0072995.xml
RDF/JSON: 1.0072995+rdf.json
Turtle: 1.0072995+rdf-turtle.txt
N-Triples: 1.0072995+rdf-ntriples.txt
Original Record: 1.0072995 +original-record.json
Full Text

Full Text

DEFINING THE ROLE OF AUTOGRAPHA CALIFORNICA MULTIPLE NUCLEOPOLYHEDROVIRUS IMMEDIATE EARLY-0 AND IMMEDIATE EARLY-1 PROTEINS IN VIRAL GENOME REPLICATION AND EARLY GENE TRANSACTIVATION by Nadia Sokal B. Sc., University of Waterloo, 2003 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in The College of Graduate Studies (Biology) THE UNIVERSITY OF BRITISH COLUMBIA (Okanagan) August 2012  © Nadia Sokal, 2012  Abstract The immediate early-0 (IE0) and IE1 proteins of the baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) are key transregulators in the viral replication cycle. If both proteins are absent, the virus is inactive. Either protein can support viral replication but both are required to achieve wildtype infection. Both IE0 and IE1 are involved in viral DNA replication and transcriptional transactivation of early genes. In this study, to analyze IE0 and IE1’s function, ie0, ie0MtoA or ie1 were placed under the control of identical promoters (ie1 or gp64) to achieve comparable levels of protein expression. The ie1 promoter produced higher levels of IE0, IE0MtoA and IE1 compared to the gp64 promoter. Time course assays of infected Spodoptera frugiperda 9 (Sf9) cells allowed examination of viral DNA replication and budded virus (BV) production. The results showed that when IE0 and IE1 protein levels were high, either IE0, IE1 or IE0 and IE1 together maintained DNA replication and BV production similar to wildtype levels. However, when IE0 and IE1 protein levels were low, only when IE0 and IE1 were present together was DNA replication and BV production similar to wildtype. These results suggest that during the virus replication cycle when cellular levels of IE0 or IE1 are low, for example at the beginning of infection, the presence of both proteins results in more efficient DNA replication. Transient transactivation studies were also performed to examine IE0 and IE1’s ability to activate nineteen viral early gene promoters. At low levels of IE0 and IE1 expression, a group of viral early gene promoters were found to be differentially transactivated by IE0 alone or when both IE0 and small amounts of IE1 were together. These results suggest that during early times post-infection, when ii  cellular levels of viral proteins are low, IE0 in the presence of a small amount of IE1 results in rapid onset of viral DNA replication and efficient transactivation of a specific set of viral early gene promoters. In context of virus infection, rapid viral replication by IE0 and IE1and transactivation of early genes by IE0 may counter the insect’s defense mechanisms like sloughing and apoptosis.  iii  Table Of Contents Abstract........................................................................................................................... ii Table of Contents.......................................................................................................... iv List of Tables................................................................................................................viii List of Figures................................................................................................................ ix List of Abbreviations..................................................................................................... xi Acknowledgements...................................................................................................... xv 1. Introduction.................................................................................................................1 1.1. General description of baculoviruses................................................................... 2 1.2. Baculovirus taxonomy.......................................................................................... 3 1.3. Alphabaculovirus life cycle................................................................................... 3 1.3.1. Primary infection and entrance into the midgut cells................................... 3 1.3.2. Import of nucleocapsids into the nucleus.................................................... 4 1.3.3. Gene transcription....................................................................................... 5 1.3.4. Viral DNA replication, nucleocapsid egress and secondary infection..........7 1.4. Baculovirus DNA replication................................................................................ 8 1.5. The ie0-ie1 gene complex....................................................................................9 1.6. IE1 structure.......................................................................................................10 1.7. IE0 structure.......................................................................................................12 1.8. IE0 and IE1 expression profiles......................................................................... 12 iv  1.9. IE0 and IE1 function in viral replication.............................................................. 13 1.10. IE0 and IE1 are able to form dimers................................................................ 14 1.11. IE0 and IE1 function in early gene expression.................................................14 1.12. IE0 and IE1 function in DNA replication........................................................... 15 1.13. Summary and significance of proposed study................................................. 17 1.14. Research objectives.........................................................................................18 1.15. Experimental outline........................................................................................ 18 2. Materials and Methods............................................................................................. 19 2.1. Cells and viruses................................................................................................ 19 2.2. Production of AcMNPV ac146-ie1 gene knockout bacmid (AcBacac146-ie1KO) ........................................................................................................................... 19 2.3. Construction of transfer plasmid backbone: pFAcT-GFP including ac146 or ac146HA............................................................................................................ 22 2.4. Construction of intermediate plasmids expressing ie0, ie0MtoA or ie1 under control of the ie1 or gp64 promoters.................................................................. 23 2.5. Construction of transfer plasmids with ie0, ie0MtoA or ie1 under control of the ie1 or gp64 promoters and ac146 or ac146HA.................................................. 24 2.6. Construction of repaired bacmids: Repair of AcBacac146-ie1KO with transfer plasmids............................................................................................................. 25 2.7. Transfection of Sf9 cells with repaired bacmid constructs................................. 25 2.8. BV stock production and BV titration by TCID50.................................................26 2.9. Time course infections assays........................................................................... 27 2.10. Time course of viral DNA replication................................................................28 2.11. Time course of BV production..........................................................................29 2.12. Transient transactivation co-transfection assays............................................. 30 v  2.13. Chloramphenicol acetyl-transferase (CAT) diffusion assay with 3 H-acetyl-CoA ................................................................................................. 32 2.14. Protein analysis by Western blot..................................................................... 32 3. Results..................................................................................................................... 34 3.1. Construction of an ie0 and ie1 knockout bacmid............................................... 34 3.2. Construction of repair viruses............................................................................ 35 3.3. Fluorescence microscopy of bacmid transfected Sf9 cells to detect BV production.......................................................................................................... 36 3.4. Western blot analysis of bacmid transfected Sf9 cells....................................... 37 3.5. Viral titre analysis............................................................................................... 38 3.6. Virus time course assays................................................................................... 38 3.6.1. IE0, IE0MtoA and IE1 analysis by Western blot........................................... 39 3.6.2. DNA replication analysis by qPCR............................................................ 40 3.6.3. Temporal analysis of budded virus production.......................................... 42 3.7. Transactivation analysis of early gene promoters by IE0 and IE1..................... 43 3.7.1. Analysis of level of transactivation by IE0, IE0MtoA and IE1....................... 44 3.7.2. IE0, IE0MtoA and IE1 analysis by Western blot........................................... 45 4. Discussion............................................................................................................... 49 4.1. Comparison of IE0, IE0MtoA and IE1 in time course assays............................... 49 4.2. Comparison of IE0, IE0MtoA and IE1 in transactivation of viral early gene promoters........................................................................................................... 51 4.3. Significance of findings in context of virus infection........................................... 55 4.4. Conclusions........................................................................................................60 4.5. Future studies.................................................................................................... 61 vi  References...............................................................................................................  89  Appendices................................................................................................................. 102 Appendix A: Replicated randomized block ANOVA with Tukey HSD.......................102  vii  List of Tables Table 1: Manufactured kits used.....................................................................................64 Table 2: Complete list of primer sequences and features.............................................. 65 Table 3: Statistical p values comparing transactivation by IE0, IE0 MtoA, IE1 and reporter under control of the gp64 promoter..................................................... 67 Table 4: Statistical p values comparing transactivation by IE0, IE0MtoA, IE1 and reporter under control of the ie1 promoter........................................................ 68  viii  List of Figures Figure 1: Organization of the AcMNPV genome.............................................................69 Figure 2: Alphabaculovirus life cycle.............................................................................. 70 Figure 3: ie0-ie1 gene complex and IE0/IE1 functional domains....................................71 Figure 4: Construction of the ac146-ie1 knock-out (KO) virus........................................ 72 Figure 5: Confirmation of recombination events between wildtype bacmid and zeocin cassette at the ac146-ie1 locus............................................................ 73 Figure 6: Construction of AcMNPV bacmid expressing ie1, ie0, or ie0MtoA under control of the ie1 or gp64 promoters................................................................ 74 Figure 7: Schematic diagrams of plasmids used in transient transactivation co-transfection assays..................................................................................... 75 Figure 8: Fluorescence microscopy analysis of transfected Sf9 cells (bacmids under control of ie1 promoter)..........................................................................76 Figure 9: Fluorescence microscopy analysis of transfected Sf9 cells (bacmids under control of gp64 promoter)...................................................................... 78 Figure 10: Western blot of IE0, IE1 and AC146HA expression in bacmid transfected Sf9 cells...................................................................................... 80 Figure 11: Western blot of IE0 and IE1 in virus infected Sf9 cells at early times post infection..................................................................................................81 Figure 12: Western blot of IE0 and IE1 in virus infected Sf9 cells at representative times post infection....................................................................................... 82 Figure 13: Time course analysis of viral DNA replication in infected Sf9 cells............... 83 Figure 14: Viral BV production during time course assays............................................. 84 Figure 15: Transactivation analysis of AcMNPV early gene promoters by IE0 and IE1 under control of the ie1 promoter.........................................................  85 ix  Figure 16: Transactivation analysis of AcMNPV early gene promoters by IE0 and IE1 under control of the gp64 promoter......................................................... 86 Figure 17: Western blot of IE0, IE0MtoA and IE1 in transient co-transfected Sf9 cells.... 87 Figure 18: Preliminary analysis of amount of transactivator plasmid transfected and rate of transactivation............................................................................. 88  x  List of Abbreviations aa  amino acid  A  alanine  AAD  acidic activation domain  AcMNPV  Autographa californica multiple nucleopolyhedrovirus  AD  acidic domain  ANOVA  analysis of variance  BDI  basic domain I  BDII  basic domain II  bp  base pair  BV  budded virus  ⁰C  degrees Celsius  CAT/cat  chloramphenicol acetyltransferase protein/gene  C-terminus  carboxy-terminus  Ci  Curie  DAR  downstream activation region  DBP  DNA binding protein  DE  delayed early  DNA  deoxyribonucleic acid  dpt  days post transfection  E.coli  Escherichia coli  EDTA  Ethylenediaminetetraacetic acid  FBS  fetal bovine serum  Fig.  Figure  g  grams in the context of mass; gravitational force in the context of centrifugation xi  genr  gentamicin resistance gene  GFP/gfp  green fluorescent protein/gene  3  tritiated acetyl coenzymeA  HA  hemagglutinin  HCl  hydrochloric acid  hpi  hours post infection  hpt  hours post transfection  hr  homologous regions  IE  immediate early  IE0/ie0  immediate early 0 protein/gene  IE0MtoA/ie0MtoA  immediate early 0 with methionine changed to alanine protein/gene  IE1/ie1  immediate early 1 protein/gene  IPTG  isopropyl-β-D-thiogalactopyranisode  kb  kilobase  kbp  kilobase pair  kDa  kilodalton  KO  knockout  L  late  l  litre  LB  Luria broth  LEF  late expression factor  µ  micro  m  milli in context of volume metre in context of length  M  methionine in the context of protein sequence; molar in the context of concentration  MCS  multiple cloning site  H-acetyl-CoA  xii  min  minute  MOI  multiplicity of infection  mRNA  messenger ribonucleic acid  n  nano  nt  nucleotides  N-terminus  amino-terminus  OB  occlusion body  ODV  occlusion derived virus  OpMNPV  Orgyia psuedotsugata multiple nucleopolyhedrosis virus  ORF  open reading frame  ori  origin of replication  PAGE  polyacrylamide gel electrophoresis  pBS+  pBluescribe+ plasmid  PBS  phosphate buffered saline  PCR  polymerase chain reaction  PIF  per os infectivity factor  polh  polyhedrin gene  polyA  polyadenylation sequence  PVDF  polyvinylidene fluoride  qPCR  quantitative polymerase chain reaction  RNA  ribonucleic acid  RNaseA  ribonuclease A  rpm  revolutions per minute  SDS  sodium dodecyl sulfate  sec  seconds  Sf9  Spodoptera frugiperda clone 9 xiii  TCID50  50% tissue culture infective dose  TNM-FH  Trichoplusia ni media – Fred Hink  Tris  Tris-hydroxymethylaminomethane  UTR  untranslated region  v  virus  V  volts  VL  very late  WASP  Wiskott-Aldrich syndrome protein  WT  wildtype  Xgal  5-bromo-4-chloro-indolyl-β-D-galactopyranoside  xiv  Acknowledgements I give my sincere thanks to my supervisor Dr. David Theilmann for the opportunity to work with him as well as his guidance during my studies. I would like to thank my supervisor Dr. Mark Rheault for his guidance and helpful contributions during my Master’s degree. I would also like to thank my committee members Dr. Deanna Gibson and Dr. Soheil Mahmoud for their interest in my project and their support during my studies. I would like to acknowledge and thank Dr. Jason Loeppky for his assistance and advice on statistical analyses. I would like to especially thank Les Willis for all of his technical expertise and knowledge. I am sure my experiments would have taken twice as long without his guidance. I aspire to be as proficient in the lab, as patient with students and as knowledgeable as he is. Also, I’d like to thank past and present members of the Theilmann lab, especially Yingchao Nie, Jessie Buzikievich and Virginia Dickison for their technical advice and friendship. I would like to acknowledge the BC Ministry of Advanced Education for their financial support through the Pacific Century Graduate Scholarship. I thank everyone at PARC for their friendship and support. Finally, I thank my family for their patience.  xv  1  Introduction  Baculoviruses are not pathogenic to humans, yet have a profound impact on our lives. Baculovirus specifically target arthropods, and their effects were first observed over 5000 years ago, negatively impacting the production of silk in China (reviewed in Rohrmann, 2011). Researchers began to use baculoviruses in the 1950’s to control insect populations that were harmful to agricultural crops and forests (Miller, 1997). As basic research regarding baculoviruses and its genes progressed, it was found that baculovirus genomes could be manipulated to express foreign proteins at high levels under control of the strong polyhedrin promoter. This led to the development of baculovirus expression vector systems in the 1980s (Smith et al., 1983) for high level production of proteins for research purposes and pharmaceuticals, including vaccine development. Further, recent innovations exploiting baculoviruses involve their use for gene therapy vectors as the virus can enter mammalian cells but not cause disease (Kost and Condreay, 2002). Baculoviruses have therefore proven to be a useful tool in a variety of different applications; increased knowledge regarding these viruses will allow further innovations in health care and agriculture. Baculoviruses are also an excellent model system for studying eukaryotic DNA virus replication. Clear understanding of baculovirus replication is key to further improve baculovirus applications as well as provide fundamental knowledge in important processes in eukaryotic cell biology. This study focuses on the type Alphabaculovirus, Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and the roles of the two main transregulatory proteins, 1  IE0 and IE1 in viral DNA replication and early gene expression. IE0 and IE1 are generated from the only known baculovirus spliced gene complex that produces multiple protein products (Chisholm and Henner, 1988). Many studies have shown that the ie0-ie1 gene complex is essential and is intricately involved in the Alphabaculovirus life cycle (Choi and Guarino, 1995b; Dai et al., 2004b; Huijskens et al., 2004; Nagamine et al., 2006; Okano et al., 1999; Olson et al., 2001; Olson et al., 2002; Olson et al., 2003; Pathakamuri and Theilmann, 2002; Stewart et al., 2005; Taggart and Friesen, 2009; Taggart et al., 2012). 1.1  General description of baculoviruses  Baculoviridae are diverse, varying in host range, genome size, and quantity of gene products. Baculoviruses have large, double stranded, circular DNA genomes and are only known to replicate in arthropods. Genome size ranges from 82 kbp to 179 kbp. To date, there are 31 genes, known as core genes, which have homologs in every completely sequenced genome (reviewed in Rohrmann, 2011). AcMNPV, which is the subject of this study, has a 134 kbp genome and codes for 154 methionine initiated, predicted open reading frames (ORF) of 150 nt or larger (Fig. 1) (Ayres et al., 1994). The viral genome is packaged in large rod-shaped nucleocapsids which are 200-300 nm in length and approximately 30 nm in diameter. The nucleocapsid acquires an envelope either from the host’s nuclear or cellular membrane (reviewed in Rohrmann, 2011).  2  1.2  Baculovirus taxonomy  The current baculovirus classification system separates the family Baculoviridae into four genera; Alphabaculovirus, Betabaculovirus, Deltabaculovirus and Gammabaculovirus (Jehle et al., 2006). Alphabaculovirus infect lepidoptera, and produce single (S) or multiple (M) occlusion derived virus (ODV) as well as budded virus (BV) (Jehle et al., 2006). Alphabaculoviruses are further separated into 2 categories, Group I and Group II, based on phylogenetic relationships, although these designations are not recognized taxonomically (Zanotto et al., 1993). Betabaculovirus are lepidopteran-specific and include viruses formerly known as granuloviruses. Gammabaculoviruses include hymenoptera-specific baculoviruses and Deltabaculoviruses include diptera-specific baculoviruses (Jehle et al., 2006). 1.3  Alphabaculovirus life cycle  1.3.1 Primary infection and entrance into the midgut cells Alphabaculoviruses, of which AcMNPV is a member, produce two different virion phenotypes, BV and ODV (Fig. 2). ODV can exist outside of a host as they are occluded within a stable proteinaceous occlusion body (OB). Once the OB is ingested by the host, the OB matrix composed primarily of the viral protein polyhedrin is dissolved by the alkaline environment of the midgut lumen, releasing the ODV (reviewed in Rohrmann, 2011). To access the host cells, the virion must first pass through the peritrophic membrane of the midgut. The mechanism facilitating virion passage is unclear, although a combination of proteinases and enhancins play roles in host cell 3  entry in some baculovirus species (Hashimoto et al., 1991; Lepore et al., 1996; Wang et al., 1994). Once through the peritrophic membrane, ODV attach to the microvilli of the columnar epithelial cells that line the midgut. A combination of mechanisms allow ODV entry, including binding of the virion to the cell, interaction with a cell receptor, interaction with envelope enzymes that facilitate entry to the midgut cell and/or membrane fusion. To date, seven viral gene products termed per os infectivity factors (pif) have been found to be essential for ODV midgut infection; p74, pif1, pif2, pif3, pif4, pif5 and pif6. All pifs are core genes and all encode structural components of ODV (Fang et al., 2009; Fang et al., 2006; Faulkner et al., 1997; Kikhno et al., 2002; Li et al., 2007; Nie et al., 2012; Peng et al., 2012; Piljman et al., 2003; Sparks et al., 2011). 1.3.2 Import of nucleocapsids into the nucleus ODV nucleocapsids are transported to the nucleus via the actin cytoskeleton. Actin polymerization drives nucleocapsid intracellular motility. The capsid protein p78/83 stimulates actin nucleation with the host Arp2/3 complex. The Arp2/3 complex regulates cytoplasmic actin assembly and nucleates branched actin filaments (Goley et al., 2006). Capsid protein p78/83 contains a Wiskott-Aldrich syndrome protein (WASP) domain. The WASP domain within p78/83 binds to actin as well as the host actin-nucleating Arp2/3 complex, allowing p78/83 to act as a nucleation-promoting factor for the Arp2/3 complex (Goley et al., 2006) Actin-based motility occurs in two phases. During transit to the nucleus, actin-based motility is employed (Ohkawa et al., 2010). The viral nucleocapsids interact with the 4  cytoplasmic filaments within the nuclear pore complex, which act as a docking site when the capsid is midway through the nuclear pore complex (Au and Pante, 2012). This complex undergoes rearrangement to accommodate translocation of the capsid (Au and Pante, 2012). Once in the nucleus the viral genome is uncoated and transcription is initiated by host RNA polymerase (Huh and Weaver, 1990). For AcMNPV some of the nucleocapsids entering the cell have also been shown to move directly to the cell periphery bypassing the nucleus by actin-based motility (Ohkawa et al., 2010). 1.3.3 Gene transcription Gene transcription occurs in an ordered cascade of immediate early (IE), delayed early (DE), late (L) and very late (VL) transcription events. In general there are five functional categories for baculovirus genes which include; RNA transcription, DNA replication, structural proteins, auxiliary proteins and proteins with unknown function to date. Early gene products include proteins essential for viral replication as well as proteins that stimulate late gene expression. For example, viral RNA polymerase is an early gene which recognizes late viral promoters that regulate transcription of essential structural genes (Yang et al., 1991). IE and DE genes are transcribed by the host RNA polymerase II, before viral DNA replication initiates. The transcripts are 5’ capped and 3’ polyadenylated (Jun-Chuan and Weaver, 1982). Early viral gene promoters resemble host gene promoters and can consist of a TATA element 25-31 bp upstream of the transcriptional start site. The deletion or replacement of the TATA element results in a large decrease of promoter activity of IE genes, indicating that it is an important 5  regulatory element (Blissard and Rohrmann, 1991b; Dickson and Friesen, 1991; Theilmann and Stewart, 1991). The TATA elements direct transcription initiation at the correct start site, and are involved with the transcription initiation rate. A promoter initiator motif ATCA(G/T)T(C/T) contributes to the activity of TATA promoters but is not an essential element (Miller, 1997). There are also elements downstream of the transcriptional start site that regulate expression, and have loosely been termed downstream activation regions (DAR) (Pullen and Friesen, 1995b). The 5’ untranslated regions (UTR) of immediate early genes ie1 and gp64 have DAR which are thought to contribute to transcription by stabilizing protein interactions within the promoter region (Miller, 1997). Late and very late gene transcription occurs after initiation of viral DNA replication. The viral RNA polymerase transcribes late and very late genes during late stages of infection (Fuchs et al., 1983; Huh and Weaver, 1990). Late genes in AcMNPV are generally transcribed between 6 to 24 hours post infection (hpi) and very late genes are transcribed between 18 to 72 hpi (Miller, 1997). Initiation of late and very late gene transcription occurs at an essential (A/T/G)TAAG motif (Morris and Miller, 1994; Ooi et al., 1989). Very late promoters are hyperexpressed, resulting in high levels of gene products being produced. The UTR of the very late gene polyhedrin is also required for very high expression levels (Ooi et al., 1989; Rankin et al., 1988). Late expression factors (LEFs) regulate late and very late gene expression. To date, 21 genes have been identified as LEFs and are generally viral IE or DE genes that optimize viral DNA replication or are directly involved in late gene transcription (Hang et al., 1995; 6  Huijskens et al., 2004; Passarelli and Miller, 1993a; Passarelli and Miller, 1993b; Passarelli and Miller, 1993c; Rapp et al., 1998; Yamagishi et al., 2007). 1.3.4 Viral DNA replication, nucleocapsid egress and secondary infection Viral DNA replication and subsequent nucleocapsid assembly occur in a virogenic stroma formed in the nucleus. Some newly formed nucleocapsids transit from the nucleus to the cytoplasm and bud through the cellular membrane producing BV. BV are required for the systemic infection of the host. In midgut cells BV travel to the basal membrane and proceed to infect tracheal cells, hemocytes, fat bodies and muscle (Fig. 2).The remaining nucleocapsids eventually form ODV within the nucleus and either single or multiple nucleocapsids are enveloped per virion and are embedded within the OB polyhedrin matrix (reviewed in Rohrmann, 2011). Permissive cells become filled with OBs which are released upon cell lysis. The viral proteins chitinase and cathepsin have been shown to aid in insect cell lysis and degrade the insect cuticle (Hawtin et al., 1997). Upon primary infection some nucleocapsids are transported directly to the basal membrane of midgut cells bypassing the nucleus and viral replication. At the basal membrane the nucleocapsids bud through the cell membrane forming BV, allowing rapid development of secondary infection. It is thought that this mechanism counteracts the insect host’s defence mechanism of sloughing midgut cells (Washburn et al., 2002).  7  1.4  Baculovirus DNA replication  The exact mechanism of baculovirus genome replication is unknown. Evidence suggests rolling circle replication, (Oppenheimer and Volkman, 1997) though is it thought that a more complex system occurs incorporating the theta mechanism at early times and recombination at late times (Leisy and Rohrmann, 1993). Multiple origins of replication (ori’s) are identified in baculoviruses including homologous regions (hr) that are found at multiple locations around the viral genome (Ayres et al., 1994; Pearson et al., 1992), a non-hr ori which resembles a classic eukaryotic ori (Kool et al., 1994b) and early gene promoters (Wu and Carstens, 1996). As well as these defined ori, it has been proposed that any unwound site of the viral genome could potentially allow the binding of the replication enzyme complex, serving as an ori (Okano et al., 2006). The hr typically contain several copies of the same element. In the AcMNPV genome there are eight hr’s which act as ori’s and also act as transcription enhancers (Mikhailov, 2003). Replication of the baculovirus genome requires the viral proteins, DNA polymerase, helicase, late expression factor-1 (LEF1), LEF2, LEF3, LEF7, LEF11, immediate-early 1 (IE1), and IE0. Three replication factors, P35, IE2 and PE38 augment DNA replication, but are not essential. Some factors exhibit contradictory evidence for being essential or solely stimulatory (Kool et al., 1994a; Kool et al., 1994c; Lu and Miller, 1995).  8  1.5  The ie0-ie1 gene complex  The focus of this thesis is on the IE0 and IE1 transregulatory proteins and their involvement in viral DNA replication and early gene transactivation. The IE0 and IE1 proteins are translated from ie0 and ie1 mRNA transcripts which arise from the ie0-ie1 gene complex (Fig. 3). The ie0-ie1 gene complex is unique within the baculovirus genome as it is the only known spliced gene that is processed into multiple protein products (Chisholm and Henner, 1988). The ie0-ie1 gene complex is composed of exon1 and exon2. The ie1 transcript is the shorter of the two transcripts at 1.9 kb, and is composed of only exon2 (Chisholm and Henner, 1988). The ie0 transcript is composed of exon2 as well as exon1, which is located 4.2 kb upstream of exon 2. The ie0 transcript contains the complete ie1 transcript with an additional 189 bp on its 5’ end, resulting in a 2.1 kb mRNA. The ie0 and ie1 transcripts are under control of separate promoters. Both ie0 and ie1 promoters contain the consensus immediate early gene TATA-CAGT motif, upstream as well as downstream regulatory sequences (Chisholm and Henner, 1988; Pullen and Friesen, 1995a; Pullen and Friesen, 1995b). Ie0 and ie1 transcripts are expressed throughout the virus life cycle but at different levels. The steady state levels of the ie0 transcript peaks at 2-4 hpi and decreases thereafter (Chisholm and Henner, 1988; Huijskens et al., 2004). The ie1 transcript continually increases in steady levels throughout infection (Chisholm and Henner, 1988; Huijskens et al., 2004). The ie0 and ie1 transcript levels reflect protein expression levels indicating that IE0 is the  9  dominant protein early in infection prior to replication whereas IE1 is dominant during the rest of the infection cycle. Translation of the ie0 transcript produces both IE0 and IE1 from the ie1 internal start codon (Theilmann et al., 2001). It is unknown if internal translation initiation is due to a leaky scanning mechanism or by an internal ribosomal entry site (Theilmann et al., 2001). Prior to this discovery, studies examining IE0 function (Kovacs et al., 1991; Pearson and Rohrmann, 1997) were unaware that the observed trans-regulatory functions were due to the presence of IE0 as well as IE1 (Theilmann et al., 2001). 1.6  IE1 structure  The ie1 mRNA transcript contains an ORF that encodes a 582 amino acid (aa), 66.9 kDa protein (Fig. 3) (Chisholm and Henner, 1988). The N-terminus contains a combination of three domains, a classic transcriptional acidic activation domain (AAD), an AC16 binding domain, a basic domain (BDI) followed by an acidic domain (AD), which is rich in acidic amino acids (Nie et al., 2009; Olson et al., 2003; Pathakamuri and Theilmann, 2002; Slack and Blissard, 1997). The AAD has very little sequence conservation relative to other baculovirus homologs, but is rich in acidic residues, as well as contains hydrophobic and aromatic residues which are essential for transactivation (Regier et al., 1993; reviewed in Triezenberg, 1995). The first 65 amino acids of the IE1 AAD of the Alphabaculovirus Orgyia psuedotsugata multiple nucleopolyhedrosis virus (OpMNPV) were found to be essential for origin-specific DNA replication (Pathakamuri and Theilmann, 2002). Recently, similar results defined the 10  replication domain of the AcMNPV IE1 AAD as amino acids 2 to 23 (Taggart et al., 2012). Within these 23 residues, a motif was identified that resembled a cyclindependent phosphorylation site (TPXR/H) and amino acid substitution in this region caused loss of DNA replication activity (Taggart et al., 2012). The IE1 AAD also contains a transactivation domain which has been shown to be separable from the essential replication domain (Pathakamuri and Theilmann, 2002). A previous study of OpMNPV IE1 showed that if the AAD was deleted, resulting in loss of transactivation it could be replaced with the archetype herpes simplex virus VP16 AAD, restoring transactivation function (Forsythe et al., 1998). The AD domain (Fig. 3) has conserved sequence and in a heterologous bacterial system it activates gene expression (Slack and Blissard, 1997). However in the absence of the AAD, in the context of IE1, no activation is observed (Slack and Blissard, 1997). BDI located between the AAD and AD inhibits the function of the AD domain (Slack and Blissard, 1997). IE0 and IE1 are both able to bind to AC16, and the AC16 binding domain is located within the acidic transcriptional activation domain (Nie et al., 2009). The relative levels of IE0 and IE1 are potentially regulated by AC16 as seen in an ac16 knockout study (Nie et al., 2009). BDI is required for enhancer-dependent transactivation and viral DNA replication (Nagamine et al., 2005; Olson et al., 2003; Taggart and Friesen, 2009). Basic domain II (BDII) and a helix-loop-helix structure are located at the IE1 C-terminus (Okano et al., 1999; Olson et al., 2002; Olson et al., 2003; Pathakamuri and Theilmann, 2002; Rodems et al., 1997; Theilmann et al., 2001). The helix-loop-helix domain mediates oligomerization and mutation within this region results in the loss of enhancer-dependent and independent 11  transient transactivation (Olson et al., 2001; Rodems et al., 1997), indicating that oligomers are required for transactivation of viral early promoters. Oligomerization occurs prior to nuclear entry and the BDII domain acts as the nuclear localization signal (Kaffman and O'Shea, 1999; Olson et al., 2001; Olson et al., 2002). 1.7  IE0 structure  IE0 includes the entire IE1 protein with an additional 54 amino acids fused to the Nterminus, resulting in a 636 amino acid, 72.6 kDa protein (Chisholm and Henner, 1988)(Fig. 3). The additional amino acids are derived from 38 amino acids from exon 1, and 16 amino acids encoded by the ie1 5’ UTR. No specific domains or structures are predicted from the additional amino acid sequence (Nie, 2010). As previously mentioned, translation of the ie0 transcript results in both IE0 and IE1 being produced due to an internal translation initiation site at the ie1 start codon (Theilmann et al., 2001). 1.8  IE0 and IE1 expression profiles  Although IE0 and IE1 are similar in structure and have similar properties, some functional differences are suggested (Huijskens et al., 2004; Lu et al., 2003; Pearson and Rohrmann, 1997; Theilmann et al., 2001). Expression profiles of both IE0 and IE1 are dissimilar. Steady state levels of IE0 peaks at 2-4 hpi, before the onset of viral DNA replication, levels decrease thereafter but remain detectable up to late times postinfection (Huijskens et al., 2004). IE1 is also detected immediately upon infection and continues to increase in steady state levels until very late times post infection (Huijskens 12  et al., 2004). Analysis of relative densities of IE0 and IE1 post infection show that before initiation of replication, IE0 is present at higher or equal levels compared to IE1 (Huijskens et al., 2004). IE1 becomes the dominant protein after the onset of replication and is 12-fold more abundant than IE0 by 48 hpi (Huijskens et al., 2004). This suggests IE0’s role during viral infection is predominant during very early times, and IE1’s role during viral infection is primarily during later times. 1.9  IE0 and IE1 function in viral replication  An AcMNPV ie0-ie1 double-knockout virus shows that the ie0-ie1 gene locus is essential for virus replication (Stewart et al., 2005). No viral growth and no viral DNA replication are detected in the absence of both gene products (Stewart et al., 2005). Repair of the AcMNPV double-knockout virus with either ie0, ie0MtoA or ie1, under control of their native ie0 and ie1 promoters, produces viruses expressing IE0 and IE1, IE0 or IE1 respectively. The ie0MtoA sequence contains a mutation changing the internal ATG methionine start codon of the ie1 ORF to an alanine (GCG), resulting in only IE0 being translated (Stewart et al., 2005). Studies with these viruses show that either IE0 or IE1 are able to support viral replication in cell culture (Stewart et al., 2005). Note that the presence of IE0 without IE1, or vice versa, is an artificial situation that does not occur in wildtype infected cells. Although viral replication is occurring in viruses expressing IE0 or IE1, it is not equivalent to wildtype virus replication levels (Stewart et al., 2005), showing that either IE0 or IE1 can support viral replication but both are required to obtain a wildtype infection. BV levels produced by viruses expressing IE0 are significantly lower than wildtype and viruses expressing only IE1 (Stewart et al., 13  2005). Viruses expressing only IE0 display delayed onset of viral DNA replication, although viral DNA replication levels surpass wildtype levels at late times (Stewart et al., 2005). The repaired ie0-ie1 knockout viruses also shows that IE0 enhances the expression of IE1, and IE1 depresses the expression level of IE0, suggesting that IE0 and IE1 are mutually antagonistic (Huijskens et al., 2004; Stewart et al., 2005). 1.10 IE0 and IE1 are able to form dimers IE0 and IE1 form homodimers and heterodimers (Kremer and Knebel-Morsdorf, 1998; Lu et al., 2003). The three different variations of dimers may affect activation levels of viral gene transcription and levels of viral DNA replication (Stewart et al., 2005). As previously discussed, IE0 is present in greater amounts relative to IE1 at early times post infection, leading to possibly larger amounts of the IE0-IE0 homodimer (Stewart et al., 2005). Once the levels of IE1 increase, IE1-IE0 heterodimers are predicted to be formed. At late times, when the levels of IE1 supersede the levels of IE0, the IE1-IE1 dimer may become the predominant species. It is possible that the presence of these different dimers may have an impact on processes in the virus replication cycle. 1.11 IE0 and IE1 function in early gene expression Both IE0 and IE1 are transcriptional transactivators of early and late genes (Choi and Guarino, 1995a; Choi and Guarino, 1995b; Choi and Guarino, 1995c; Guarino and Summers, 1986a; Huijskens et al., 2004; Kovacs et al., 1991; Kremer and KnebelMorsdorf, 1998; Passarelli and Miller, 1993c). To date, the only DNA element that IE0 and IE1 have been shown to bind to are hr elements (Choi and Guarino, 1995a; Olson 14  et al., 2003), which act as enhancers of transcription (Guarino and Summers, 1986b) as well as origins of replication (Leisy and Rohrmann, 1993; Pearson et al., 1992). IE0 or IE1 can activate genes in an enhancer-dependent and independent manner (Nissen and Friesen, 1989; Rodems and Friesen, 1993; Theilmann and Stewart, 1991). IE1 also negatively regulates transcription of immediate early genes ie2, ie0 and pe38 (Carson et al., 1991; Kovacs et al., 1991; Leisy et al., 1997; Theilmann and Stewart, 1993). Although IE0 and IE1 transactivate many early genes in transient assays, there is no evidence of a specific IE0 or IE1 responsive element within the early gene promoters. This suggests that in the absence of enhancers IE0 or IE1 may activate transcription by an indirect mechanism and not bind to the promoter directly. Microarray analysis identified 58 genes that may be specifically regulated by IE0 and IE1 (Nie, 2010). However, it is still unknown whether IE0 and IE1 activate genes to the same level, as all previous analyses of IE0 and IE1 compare the two proteins under control of their native promoters, resulting in different expression levels. Even though data indicate that there is no specific target for IE0 and IE1, one protein may be a more efficient transactivator than the other. 1.12 IE0 and IE1 function in DNA replication As indicated above AcMNPV DNA replication requires IE0 or IE1 and LEF-1, LEF-2, LEF-3, LEF-7, LEF-11, viral DNA polymerase and helicase and can be augmented by P35, IE2 and PE38 (Kool et al., 1994a; Kool et al., 1995; Kool et al., 1994c). When IE1 binds to hr elements it co-localizes in nuclear structures thought to be viral replication 15  factories, with LEF-3 , helicase and viral DNA binding protein (DBP) which may form a scaffold for the virogenic stroma (Kawasaki et al., 2004; Nagamine et al., 2006; Okano et al., 1999). Therefore, IE0 and IE1 may be acting as origin binding proteins allowing the replisome complex to form due to binding to hr elements (Blissard and Rohrmann, 1991a; Choi and Guarino, 1995a; Lu and Carstens, 1993; Mikhailov, 2003; Rodems et al., 1997). As previously mentioned, the N-terminal AAD of both AcMNPV IE1 and OpMNPV IE1 contains a domain essential for replication (Pathakamuri and Theilmann, 2002; Taggart et al., 2012). However, DNA replication is not maintained when the OpMNPV AAD is replaced with the heterologous AcMNPV AAD, indicating that this region contributes to the specificity of the virus DNA replication complex (Pathakamuri and Theilmann, 2002). In addition, some replication domain mutants are inactive for DNA replication, but remain functional for transcriptional transactivation (Pathakamuri and Theilmann, 2002; Taggart et al., 2012). This indicates that transcriptional transactivation functions and viral DNA replication functions of IE1 are independent (Pathakamuri and Theilmann, 2002; Taggart et al., 2012). The literature suggests that IE0 and IE1 may play different roles in viral DNA replication even though they both support replication (Stewart et al., 2005). Recombinant viruses expressing only IE0 show a delay in onset of DNA replication compared to wildtype, but viral DNA actually accumulates to higher levels at later times post-infection (Stewart et al., 2005). Whereas viruses expressing only IE1 initiate DNA replication and attain levels similar to wildtype virus (Stewart et al., 2005). These experiments express IE0 16  and IE1 under control of their native promoters, therefore the expression levels of each protein are dissimilar (Stewart et al., 2005). The impact observed on viral DNA replication could either be indirect due to transactivation of other viral genes or directly due to differences in the viral replisome. A recent study showed in transient assays, IE0MtoA was able to support replication of a plasmid containing a viral origin of replication (Luria et al., 2012). However, no comparison was made of the ability of IE0MtoA to transiently replicate DNA compared to IE0 or IE1. 1.13 Summary and significance of proposed study IE0 and IE1 are the key trans-regulatory proteins of the Alphabaculovirus replication cycle. IE0 and IE1 are required for all aspects of the viral life cycle (Huijskens et al., 2004; Prikhod'ko and Miller, 1999; Stewart et al., 2005). However the functional differences of these two critical viral proteins are still unknown. Their roles appear to be intricately intertwined and further research is needed to fully understand the function of the only known baculovirus spliced gene. Determining the relative roles of IE0 and IE1 in AcMNPV DNA replication and early gene expression will provide significant insight to the biochemical basis of baculovirus virulence, eukaryotic viral gene expression and viral replication. Knowing how these proteins function will also contribute to the development of baculovirus biocontrol agents, protein expression systems and other pharmaceutical applications.  17  1.14 Research objectives The goal of this project was to determine the separate functions of IE0 and IE1 in AcMNPV DNA replication and early gene expression. Based on the prior research results, it is hypothesized that; 1. AcMNPV IE0 is inefficient in its ability to support viral DNA replication compared to IE1 and 2. AcMNPV IE0 is equal to IE1 in its ability to transcriptionally transactivate viral early genes. 1.15 Experimental outline 1. Production of recombinant viruses that express only IE0 or IE1 under control of identical promoters 2. Quantitative and temporal analysis of viruses expressing only IE0 or IE1 under control of identical promoters by examination of : a. Protein expression b. Viral DNA replication c. Budded virus production 3. Quantitative comparison of the ability of IE0 or IE1 expressed under control of identical promoters to transactivate viral early gene promoters  18  2  Materials and Methods  Routine molecular biology techniques including polymerase chain reaction (PCR), restriction digestion, ligation, gel electrophoresis, Western blots, and bacterial cell preparation were performed using standard procedures (Sambrook, 2001). All PCR purification, gel extraction, plasmid and bacmid DNA preparations were performed using Qiagen or VWR kit-based systems following manufacturer’s directions (see Table 1). 2.1  Cells and viruses  All cell culture experiments used Spodoptera frugiperda clone 9 (Sf9) cells maintained at 27⁰C in TNM-FH media prepared from Grace’s insect media (Gibco Life Technologies) supplemented with Yeastolate, Lactalbumin hydrolysate and 10% fetal bovine serum (FBS). The AcMNPV bacmid bMON14272 derived from AcMNPV stain E2 (Invitrogen Life Technologies) was used to construct all AcMNPV recombinant bacmids in Escherichia coli (E. coli) as described previously (Datsenko and Wanner, 2000; Luckow et al., 1993). The AcMNPV recombinant bacmids were infectious and were used to transfect Sf9 cells to produce recombinant viruses. 2.2  Production of AcMNPV ac146-ie1 gene knockout bacmid (AcBacac146-ie1KO)  The ie0 and ie1 genes were removed from the wildtype bacmid by constructing an ie1 knockout bacmid as previously described (Stewart et al., 2005). The ie1 open reading frame (ORF) was knocked out which results in the deletion of both ie0 and ie1 genes, eliminating the production of both IE0 and IE1. As well as ie0 and ie1, ac146 was also deleted from the wildtype bacmid (Fig. 4). Recent investigation found that ac146 is an 19  essential gene and is regulated by two late promoter motifs (ATAAG), 342 and 399 bp upstream of the ac146 translational start site and reside within the ie1 ORF (Fig. 4) (Dickison, 2010). Therefore, deletion of the complete ie1 ORF also eliminates AC146 production due to the absence of the two late ac146 promoters. Therefore the complete ac146 gene was deleted, and subsequently reintroduced in all repaired bacmids to maintain the late promoter elements. Both the ac146 and ie1 ORFs were knocked out from the AcMNPV bacmid bMON14272, resulting in a bacmid that did not express ac146, ie0 and ie1. This knockout bacmid then served as a backbone for producing recombinant bacmids expressing ie0, ie0MtoA and ie1 under control of identical promoters (Fig. 4). Recombination events were used to replace the ac146-ie1 locus with a PCR amplified EM7 promoter-zeocin resistance cassette that encoded the gene that confers zeocin drug resistance. The EM7 promoter-zeocin resistance cassette also contained 5’ and 3’ homologous flanking regions of the ac146-ie1 locus which allowed recombination to occur in the presence of a recombinase. The plasmid p2Zop2E (Pfeifer et al., 1997) containing the EM7 promoter-zeocin resistance gene was used as template and 657 bp was PCR amplified with primers 1551 and 1918 (Fig. 5). Primer 1551 incorporated the flanking homologous region of the 3’ end of ac145, a polyA signal for ac145, and the homologous region 5’ to the EM7 promoter-zeocin resistance cassette. Primer 1918 incorporated the 3’ flanking region of ie1 and a polyA signal for odv-e56 and the 3’ region homologous to the EM7 promoter-zeocin resistance cassette. The PCR product  20  that contained the zeocin resistance cassette and AcMNPV flanking sequences was gel purified. Recombination between the PCR product and the bacmid genome was performed using the  Red recombinase method (Datsenko and Wanner, 2000). Briefly, E. coli BW25113/pKD46 cells containing AcMNPV E2 bacmid (bMON14272) and recombinase helper plasmid (pKD46) were electroporated with 100 ng of gel purified PCR product. Transformed cells were recovered in low salt media at 37C for 2.5 hours. The AcMNPV E2 bacmid (bMON14272) contains the gene that confers kanamycin resistance (Luckow et al., 1993) and the ac146-ie1 knockout bacmid also contains the gene that confers zeocin resistance. Therefore, LB agar plates supplemented with kanamycin (50g/ml) and zeocin (30 g/ml) were used to select colonies containing the ac146-ie1 knockout bacmid. Bacmid DNA was isolated and PCR was used to confirm the deletion of ac146ie1 and correct recombination at the 5’ and 3’ ends of the ac146-ie1 locus (Fig. 5). Primers 1574 and 520 were used to confirm the recombination event at the 5’ end of the zeocin resistance cassette. Primers 1919 and 1920 were used to confirm the recombination event at the 3’ end of the zeocin resistance cassette. The entire zeocin resistance cassette was confirmed by PCR using primers 1574 and 1920. One recombinant bacmid confirmed by PCR was selected and named AcBacac146-ie1KO. AcBacac146-ie1KO was transformed into E. coli DH10B cells including transposase helper plasmid (pMON7124) and the cells were made electrocompetent (Sharma and Schimke, 1996).  21  2.3  Construction of transfer plasmid backbone: pFAcT-GFP including ac146 or ac146HA  Using the pFAcT-GFP plasmid, transfer vectors were constructed that contained AC146. One vector contained the native ac146 ORF. The second vector contained the ac146 ORF with additional sequence coding for a hemagglutinin (HA)-epitope tag on the 3’ end of the ac146 ORF. The second ac146HA-tagged vector was constructed to allow confirmation that the knockout bacmid was correctly repaired with ac146. This was done by using an HA antibody to detect the HA epitope in Western blot analysis of bacmid transfected cells. PCR was used to amplify ac146 using AcMNPV virus strain E2 as template and primers 1936 and 1935. Primer 1936 contained a PstI restriction site and the heterologous OpMNPV op146 late promoter. Primer 1935 contained an XhoI restriction site and the OpMNPV ie2 polyA signal. Primers 1936 and 1940 were used to amplify ac146 to include a 3’ HA tag. Primer 1940 contained an XhoI restriction site, the OpMNPV ie2 polyA signal and sequence coding for the HA-epitope. The PCR products were digested using XhoI and PstI, gel purified, ligated into pFAcTGFP and transformed into E. coli DH5 cells. Successful transformants were identified by selection on LB with ampicillin (50g/ml) and were confirmed by restriction digestion. The resulting clones were named pF and pFHA. The clones were digested with XbaI and PstI for insertion of ie0 ,ie0MtoA or ie1 under control of ie1 or gp64 promoters.  22  2.4  Construction of intermediate plasmids expressing ie0, ie0MtoA or ie1 under control of the ie1 or gp64 promoters  Plasmids expressing ie0, ie0MtoA or ie1 under control of identical promoters were constructed in two stages. First, plasmids containing either the ie1 promoter or the gp64 promoter were made as backbones. Subsequent insertion of ie0, ie0MtoA or ie1 into the backbone plasmids containing the ie1 promoter or gp64 promoter produced six intermediate plasmids. The ie1 promoter and gp64 promoter were produced by PCR amplification using pAcIE1-DT1 (Theilmann and Stewart, 1991) and AcMNPV virus strain E2 as template respectively. Primers 1932 and 1931 were used to amplify 598 bp of the ie1 promoter. Primer 1932 contained an EcoRI and XbaI restriction sites, whereas primer 1931 contained a BamHI restriction site. Primers 1933 and 1934 were used to amplify 348 bp of the gp64 promoter. Primer 1933 contained an EcoRI and XbaI restriction sites, and primer 1934 contained a BamHI restriction site. The ie1 promoter and gp64 promoter PCR products were gel purified, BamHI and EcoRI digested, ligated into pBluescribe (pBS+) and transformed into E. coli DH5 cells. Successful transformants were identified by restriction digestion and positive clones were chosen and named pie1p and pgp64p. The vectors pie1p and pgp64p were linearized with BamHI and PstI and PCR amplified ie0, ie0MtoA or ie1 ORFs were inserted. Each ORF was amplified with a common 3’ primer 1937, which contained a PstI restriction site and the OpMNPV ie2 polyA signal. 23  To amplify both ie0MtoA and ie0 the 5’ primer 1939 was used which contained a BamHI restriction site. The ie1 gene was amplified using the 5’ primer 1938, which contained a BamHI restriction site. The templates used to amplify ie0, ie0MtoA and ie1 were previously constructed clones pAc-IE01, pAc-IE0 (Huijskens et al., 2004) and pAcIE1DT1 (Theilmann and Stewart, 1991) respectively. All PCR products were gel purified and digested with BamHI and PstI. The digested products were ligated into pie1p and pgp64p which generated six clones, pie1p-IE0, pie1p-IE0MtoA, pie1p-IE1, pgp64p-IE0, pgp64p-IE0MtoA and pgp64p-IE1. A positive transformant for each clone was chosen and the target cassette was sequenced. 2.5  Construction of transfer plasmids with ie0, ie0MtoA or ie1 under control of ie1 or gp64 promoters and ac146 or ac146HA  Transfer plasmids were constructed to contain cassettes with ac146 or ac146HA and ie0, ie0MtoA or ie1 under control of the ie1 promoter or gp64 promoter. The vectors, pie1p-IE0, pie1p-IE0MtoA, pie1p-IE1, pgp64p-IE0, pgp64p-IE0MtoA and pgp64p-IE1 were digested with XbaI and PstI, and gel purified to isolate the cassettes. Each digested cassette was individually ligated to linearized pF and pFHA, which were previously generated from the pFAcT-GFP transfer plasmid backbone. This generated twelve transfer plasmids; pFie1p-IE0, pFie1p-IE0MtoA, pFie1p-IE1, pFHAie1p-IE0, pFHAie1pIE0MtoA, pF HAie1p-IE1, pFgp64p-IE0, pFgp64p-IE0MtoA, pFgp64p-IE1, pFHAgp64p-IE0, pFHAgp64p-IE0MtoA, and pFHAgp64p-IE1. The “HA” denotes the virus with AC146 tagged with the HA epitope. 24  Construction of repaired bacmids: Repair of AcBacac146-ie1KO with transfer  2.6  plasmids The twelve transfer plasmids were used to repair AcBacac146-ie1KO with cassettes containing ac146 or ac146HA and ie0, ie0MtoA or ie1 under control of ie1 or gp64 promoters. AcBacac146-ie1KO was also repaired with the unaltered pFAcT-GFP transfer vector to transpose the additional transfer vector genes (genr, polh, and gfp) as well as the MCS, to act as a control. Each transfer plasmid was individually transformed into electrocompetent E. coli DH10B cells which contained AcBacac146-ie1KO and the transposase helper plasmid (pMON 7124). The transfer plasmid cassettes were inserted into the polyhedrin locus by Tn7-mediated transposition events (Luckow et al., 1993). Positive transformants indicating a successful transposition event were identified by selection on LB with kanamycin (50 g/ml), zeocin (30 g/ml), tetracycline (10 g/ml), gentamicin (7 g/ml) as well as Xgal and IPTG allowing blue and white selection. Three colonies were selected for each construct and are re-streaked onto LB supplemented with the previously mentioned selection criteria but omitting tetracycline to cure the cells of the tetracycline resistant transposase helper plasmid (pMON7124). Twelve positive clones were screened, and large-scale bacmid DNA purification was performed. 2.7  Transfection of Sf9 cells with repaired bacmid constructs  Sf9 cells were transfected with each repair bacmid, wildtype bacmid and AcBacac146ie1KO  . The twelve repaired bacmids and wildtype bacmid were transfected to produce 25  recombinant budded virus stocks, as well as to confirm IE0 and IE1 protein expression. AcBacac146-ie1KO was transfected to confirm absence of production of infectious virus and absence of IE0 and IE1 protein expression. Transfection assays were performed in duplicate using Sf9 cells cultured in TNM-FH media. Sf9 cells were dispensed into 6well plates at 1 X 106 cells per well. Lipofectin was used to transfect 1.0 g of each bacmid as previously described (Campbell, 1995). The cells were overlaid with the lipofectin-bacmid mixture and incubated at 27C for 4 hours. After incubation, the lipofectin-bacmid mixture was removed and cells were washed with 1 ml of Grace’s media. Cells were overlaid with TNM-FH media and incubated at 27C. The transfected cells were observed under bright field and fluorescence microscopy. Cells and BV supernatant were harvested at various times post transfection. Virus stocks were named vie1p-IE1, vie1p-IE0, vie1p-IE0MtoA, vgp64p-IE1, vgp64p-IE0, vgp64p-IE0MtoA, vHAie1p-IE1, vHAie1p-IE0, vHAie1p-IE0MtoA, vHAgp64p-IE1, vHAgp64p-IE0, and vHAgp64pIE0MtoA (Fig. 6). The “HA” denotes the virus with AC146 tagged with the HA epitope. 2.8  BV stock production and BV titration by TCID50  Sf9 cells transfected with wildtype bacmid as well as repaired bacmids produced budded virus to be used in infectious time course assays. BV supernatants from bacmid transfected cells were collected at 9 dpt and were used to infect 25 x 106 cells at an estimated multiplicity of infection (MOI) of 0.6. After 5 days at 27C, cells and BV supernatants were collected. Cells were collected by centrifugation at 3500 rpm for 5 minutes and BV supernatants were dispensed into 5 ml aliquots and kept at 4C. 26  The BV stocks were titred for use in infectious time course assays. TCID50 end point dilution was performed in duplicate to estimate viral titre by infecting Sf9 cells in 96-well microtitre plates (Lo and Chao, 2004; Reed and Muench, 1938). Each well contained 2 x 105 Sf9 cells and each row of wells was infected with a 10-fold dilution of budded virus (Reed and Muench, 1938). Infected cells were kept at 27C for 5 days and were analyzed under fluorescence microscopy for plaque formation by presence of GFP. Viral titres were calculated using Chiptitre software (Lynn, 1992). 2.9  Time course infection assays  Time course infection assays were performed to analyze the effect of IE0 and IE1 under control of identical promoters on viral replication. Four time course infection assays were performed with slight alterations as noted. In the first pair of time course infections Sf9 cells (3 x 106 cell/50 ml tube) were infected with vie1p-IE1, vie1p-IE0, vie1p-IE0MtoA, vgp64p-IE1, vgp64p-IE0, vgp64p-IE0MtoA and WT (wildtype) virus, each at an MOI of 5 at 27⁰C. The BV supernatants used to infect the Sf9 cells were previously titred by TCID50. After 1 hour of infection, cells were washed with Grace’s insect media and gently resuspended in TNM-FH media for a final concentration of 3 x 105 cells/ml. Infected cells were kept at 27C with agitation and 1 ml samples were collected at 3, 6, 9, 12, 20, 24, 36 and 48 hpi. Each 1 ml sample at each time point were centrifuged at 5000 g for 5 min, BV supernatants were removed and kept at 4⁰C for further use. Cell pellets were washed with 1 x phosphate buffered saline (PBS), and were split for further use; 1 x 105 cells for Western analysis, and 1.5 x 105 cells for DNA replication analysis. The remainder of the cells were kept as stock at -80C. 27  In the second pair of time course infections, alterations in methods were as follows. Sf9 cells (3 x 106 cells/50 ml tube) were infected with vie1p-IE1, vie1p-IE0, vie1p-IE0MtoA, vgp64p-IE1, vgp64p-IE0, vgp64p-IE0MtoA and WT virus each at an MOI of 5 at 27⁰C. The BV supernatants used were previously titred by qPCR. After 1 hour of infection, cells were washed with Grace’s insect media and gently resuspended in TNM-FH media. Cells were immediately dispensed into 17 microtubes at 1.5 x 105 cells/0.5ml for each time point. One microtube corresponding to each virus was removed at time points 3, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 24, 36, and 48 hpi. Samples were centrifuged at 5000 g for 5 min, BV supernatant was removed and kept at 4⁰C. Cell pellets were immediately resuspended in lysis buffer (10 mM TrisCl pH 8.0, 100 mM EDTA, 0.5% SDS) and kept at -80C for later use. 2.10 Time course of viral DNA replication DNA replication was analyzed at all the time points for recombinant viruses with ie0, ie0MtoA and ie1 under control of identical promoters. Cells were collected, DNA extracted and absolute quantity of viral genome was determined by qPCR for all time points in all four time course assays. Frozen cell pellets (1.5 x 105 cells) from the first pair of time course infection assays were resuspended with a 0.4M sodium hydroxide, 125 mM EDTA solution to dissolve occlusion bodies, and were incubated at 100C for 10 minutes. Cells were neutralized with 0.4M HCl and 5 x 104 cells were removed for analysis. Cells were treated with lysis buffer (10 mM TrisCl pH 8.0, 100 mM EDTA, 0.5% SDS), incubated at 37C with 28  RNaseA (20 g/ml) for 30 min, and incubated at 55C with proteinase K (80 g/ml) overnight. For the second pair of infectious time course assays previously treated with lysis buffer, 1.25 x 105 cells were removed for DNA replication analysis. The cells were incubated at 37C with RNaseA (20 g/ml) for 30 min, and incubated at 55C with proteinase K (80 g/ml) overnight. Serial dilutions of previously quantified wildtype bacmid DNA ranging from 101 to 107 genome copies were used as template for qPCR to construct a standard curve. Duplicate dilutions were prepared and were used as template for qPCR to construct a standard curve. DNA was extracted with phenolchloroform-isoamyl alcohol (25:24:1), followed by chloroform. The aqueous phase was removed and diluted 1 in 10 prior to qPCR analysis. In a 20 l reaction volume, 2 l of the diluted DNA extract was used as template, with primers 850 and 851 (0.5 M of each) and 2 x DyNAmo HS mastermix (DyNAmo HS SYBR Green qPCR kit, New England Biolabs). A previously developed qPCR thermal profile was used; 1 cycle of 95C for 15 min; 40 cycles of 95C for 30 sec, 52C for 24 sec, 72C for 30 sec; 1 cycles of 95C for 1 min: 41 cycles of 55C for 30 sec (McCarthy and Theilmann, 2008; Vanarsdall et al., 2007). Results were analyzed using MX4000 software (Stratagene). Technical replicates were performed for each qPCR reaction. 2.11 Time course of BV production Budded virus production was analyzed at all the time points for recombinant viruses with ie0, ie0MtoA and ie1 under control of identical promoters. Supernatant containing BV  29  were collected, DNA extracted and absolute quantity of viral genome was determined by qPCR for all time points in all four time course assays. Serial dilutions of previously titred wildtype AcMNPV budded virus were made to contain 2.5 x 101 to 2.5 x 107 AcMNPV genome copies and were used as template for qPCR to construct a standard curve. For all budded virus wildtype AcMNPV dilutions and budded virus supernatants collected over the four time course assays, 100l of budded virus supernatant was combined with 100 l of lysis buffer (10 mM TrisCl pH 8.0, 100 mM EDTA, 0.5% SDS), incubated at 37C with RNaseA (20 g/ml) for 30 min, and incubated at 55C with proteinase K (80 g/ml) overnight. DNA was extracted with phenol-chloroform-isoamyl alcohol (25:24:1) as well as chloroform and qPCR was performed as in the section “2.10 Time course of DNA replication”. Results were analyzed using MX4000 software (Stratagene). Technical replicates were performed for each qPCR reaction. 2.12 Transient transactivation co-transfection assays Four independent transient transactivation assays were performed to examine IE0 and IE1’s ability to transactivate viral early gene promoters. Co-transfection of plasmids containing viral early gene promoters controlling the cat reporter gene (Fig. 7) and transactivator plasmids expressing IE0, IE0MtoA and IE1 using the ie1 promoter (pie1pIE0, pie1p-IE0MtoA, and pie1p-IE1), and gp64 promoter (pgp64p-IE0, pgp64p-IE0MtoA and pgp64p-IE1) and subsequent CAT assays were performed as follows.  30  Sf9 cells in TNM-FH media were dispensed in six-well plates at 1 x 106 cells/well and were incubated at 27C overnight. Lipofectin was used to co-transfect 0.5 µg of a viral early gene promoter-cat plasmid and 0.5 µg of pBS+ control plasmid, GFP transfection control plasmid or 0.5 µg of transactivator plasmid; pie1p-IE0, pie1p-IE0MtoA, pie1p-IE1, pgp64p-IE0, pgp64p-IE0MtoA or pgp64p-IE1 (Campbell, 1995; Nie, 2010). The amount of transactivator plasmid used in the transfection was determined by titration to ensure a linear response in the CAT assay. Additional preliminary titrations were performed by co-transfection of 0.5 µg of the cat-reporter plasmid containing the early gene promoter for 39K and varying amount of pgp64p-IE0, pgp64p-IE0MtoA or pgp64p-IE1 to relate amount of transfected transactivator plasmid to rate of CAT activity. The cells were overlaid with lipofectin-plasmid mixture and were incubated at 27C for 4 hours. After incubation, the lipofectin-plasmid mixture was removed and cells were washed with 1 ml of Grace’s media. Cells were overlaid with 1.5 ml of TNM-FH media and incubated at 27C. Transfection efficiency was monitored by fluorescence microscopy indicated by the presence of GFP and cells were harvested at 48 hpt. The transfected cells were washed with 1X PBS, scraped from the six-well plates with rubber policemen and pelleted by centrifugation at 3000 rpm for 5 min. Cell pellets were resuspended in 100 l of 0.25M TrisCl (pH 7.8), and lysed by three cycles of freezethaw (-80C to 37C). The lysed cells were centrifuged at 10 000 rpm for 2 min and heated at 65C for 15 min to inactivate any cellular deacetylases. Cell lysates were stored at -80C until used for diffusion CAT-assay with 3H-acetyl-CoA. 31  2.13 Chloramphenicol acetyl-transferase (CAT) diffusion assay with 3H-acetylCoA CAT assays performed were based on a previously described method (Neumann et al., 1987). Reaction buffer containing 5mM chloramphenicol, 210mM TrisCl (pH 7.8), 125 M acetyl coenzyme A and 0.014 Ci 3H-acetyl-CoA was added to 25l of cell lysate in a scintillation vial. The amount of cell lysate used in the reaction was titrated to determine the amount to use for a linear response in the assay. Each scintillation vial containing reaction buffer and cell lysate was overlaid with 2.5 ml of toluene-based scintillation liquid (Instafluor Plus, Perkin Elmer) and the enzymatic reaction was measured using a scintillation counter (Beckman, LS-6500). To support results, replicated randomized block analysis of variance (ANOVA) followed by a TukeyHSD post hoc test were performed as advised by an experimental design statistician (Table 3 and 4) (Loeppky, 2012). Statistical significance is defined as p<0.05. 2.14 Protein analysis by Western blot Western blot analysis was performed to detect protein levels in bacmid transfections, virus infections and transient transactivation co-transfections. Cell pellets were passed through a 25 gauge syringe to shear genomic DNA and boiled to denature the protein samples. For bacmid transfection and transient transactivation samples co-transfected with ie1 promoter driven constructs, 5 x 104 cells were loaded onto each lane of 10% gels for sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE). For transient transactivation samples co-transfected with gp64 promoter driven constructs, 1 x 106 cells were loaded onto each lane of 10% SDS-PAGE gels. For the first pair of time 32  course infections and 5 x 104 cells were loaded and for the second pair of time course infections and 5.4 x 103 cells were loaded onto each lane of 10% SDS-PAGE gels. SDS-PAGE gels (Laemmli, 1970) were run using the Mini Protean II system (Bio-Rad) and protein was transferred by electroblotting at 100V overnight to PVDF membranes (Millipore). All blots were probed with mouse monoclonal anti-IE1 antibody (IE1-4B7) at 1:10000 dilution (Ross and Gaurino, 1997). A second set of bacmid transfection blots was probed with a primary mouse monoclonal anti-HA epitope antibody at 1:1000 dilution. Bound antibodies were detected using a secondary peroxidase conjugated goat anti-mouse antibody at 1:10000 dilution. Blots were exposed and visualized with Western-Lightening Plus ECL Enhanced Chemiluminescence System (Perkin-Elmer).  33  3 3.1  Results Construction of an ie0 and ie1 knockout bacmid  To enable the investigation of the function of IE0 and IE1, initially an ie0-ie1 knockout virus was constructed. The ie0-ie1 knockout virus would serve as a backbone for the construction of viruses expressing ie0, ie0MtoA or ie1 under control of the gp64 or ie1 promoters. In order to construct viruses that expressed only ie0, ie0MtoA or ie1 under control of identical ie1 or gp64 promoter, a knockout bacmid was made from the AcMNPV bMON14272 bacmid. The knockout bacmid AcBacac146-ie1KO deleted ac146 and ie1 by replacement of ac146-ie1 with an EM7-promoter-zeocin cassette by homologous recombination (Fig. 4). The knockout virus was designed to completely delete the entire ie1 ORF, which also results in the deletion of ie0. However, the deletion of ie1 also impacts the gene ac146 which is immediately upstream of the ie1 ORF due to the deletion of exon2. The promoter for ac146 is contained within the ie1 ORF therefore deletion of the ie1 ORF also deletes the ac146 promoter. To account for this overlap, the complete ORFs of both ac146 and ie1 were deleted (Fig. 4) and the ac146 ORF was reinserted into all repair viruses. This was required as a previous study demonstrated that AC146 is essential for production of infectious BV(Dickison et al., 2012). To ensure the adjacent ORFs, ac145 and pif5, were not affected, polyA signals were included in primers 1551 and 1918 to ensure expression of these genes. PCR was used to confirm the recombination event to show both the correct insertion of the zeocin resistance cassette and the absence of ac146-ie1 (Fig. 5). Primers 1574 and 34  1580 were used to confirm the absence of ac146. The 5’ and 3’ recombination events were examined using two primers pairs, 1574 with 520 and 1919 with 1920 which confirmed the junction of the zeocin resistance cassette with ac145 (5’ end) and pif5 (3’ end). The entire zeocin resistance cassette was confirmed by amplification of a 657 bp fragment using primers 1574 and 1920 (Fig 5). 3.2  Construction of repair viruses  To compare the function of IE0 and IE1, the ie0-ie1 knockout bacmid, AcBacac146-ie1KO, was repaired with ie0, ie0MtoA and ie1 under control of the ie1 promoter or gp64 promoter (Fig. 6). The promoters were chosen because they are constitutively active in insect cells (Blissard and Rohrmann, 1991b; Chisholm and Henner, 1988; Guarino and Summers, 1988). The ie1 promoter is native to the ie0-ie1 gene locus, and there have been conflicting reports on whether the ie1 promoter is autoregulated by IE1 (Kovacs et al., 1991; Nie, 2010; Theilmann and Stewart, 1991). The most recent report showed no activation by IE0 or IE1 of the ie1 promoter (Nie, 2010), however the gp64 promoter was also chosen to construct a second set of viruses as an alternative, in case IE1 autoregulation was observed. The gp64 promoter has not been shown to be affected by IE0 or IE1 (Nie, 2010). The repair constructs also included ac146, as ac146 was also removed from AcBacac146-ie1KO as indicated above. To ensure correct reinsertion of ac146, two sets of repairs were constructed, one set repaired with ac146 and a second set repaired with ac146 including a C-terminal HA tag, (ac146HA). The repair constructs with ac146HA were able to be detected by Western blot with an anti-HA antibody to confirm AC146HA protein production. Both ac146 and ac146HA were placed under 35  control of the OpMNPV pif5 late promoter, and also contained the OpMNPV ie2 polyA sequence. It has recently been confirmed that the transfer vector pFAcT-GFP including AC146HA under control of the op146 promoter and ie2 polyA successfully repairs AC146 knockout virus, restoring budded virus production (Dickison et al., 2012). The repair constructs containing the ie0, ie0MtoA or ie1 ORFs and ac146 or ac146HA ORFs, were inserted into the pFAcT-GFP transfer vector to facilitate repair of AcBacac146-ie1KO (Dai et al., 2004a). The transfer vector pFAcT-GFP contains the polyhedrin (polh) gene, the green fluorescence protein (gfp) gene and the gentamicin resistance (genr) gene which are inserted into the bacmid AcBacac146-ie1KO upon transposition (Fig. 6). AcBacac146-ie1KO constructed from AcMNPV E2 bacmid strain bMON14272 is polyhedrin negative. Therefore successful transposition with the transfer vector yielded bacmid clones that were gentamicin resistant in bacteria and viruses expressed GFP and polyhedrin protein in insect cells (Dai et al., 2004a). 3.3  Fluorescence microscopy of bacmid transfected Sf9 cells to detect BV production  The infection generated by the constructed bacmids was initially compared by transfection and spread of virus was monitored by fluorescence microscopy. The spread of GFP signal indicated the production of infectious BV showing that IE0, IE0MtoA or IE1 and AC146 or AC146HA were being expressed and could support virus replication. AcBacac146-ie1KO was examined at 24 hpt and showed single infected cells and no spread of infection was seen at 48 hpt (Fig. 8 and 9). This confirms that ie0 or ie1 are required 36  for BV production as previously shown (Stewart et al., 2005). Examination of the repaired bacmids showed spread of GFP expression indicating that all repaired bacmids produced infectious budded virus and that IE0, IE0MtoA or IE1 and AC146 or AC146HA were expressed. Differences in spread of virus infection may suggest different levels of BV were produced. The viruses produced by bacmids were named to denote the genes expressed; vie1p-IE0, vie1p-IE0MtoA, vie1p-IE1, vHAie1p-IE0, vHAie1p-IE0MtoA, vHAie1pIE1, vgp64p-IE0, vgp64p-IE0MtoA, vgp64p-IE1, vHAgp64p-IE0, vHAgp64p-IE0MtoA, and vHAgp64p-IE1. The “HA” denotes the virus with AC146 tagged with the HA epitope. 3.4  Western blot analysis of bacmid transfected Sf9 cells  Observation of virus spread under fluorescence microscopy suggested that all repaired bacmids generated replicating viruses that produced BV. To analyze IE0, IE0MtoA or IE1 and AC146HA expression Western blot analysis was performed. Cells were analyzed at 48 hpt and as expected, wildtype virus produced both IE0 and IE1 indicated at 72.6 and 66.9 kDa respectively (Fig. 10). Cells transfected with AcBacac146-ie1KO showed no expression of IE0 and IE1, confirming the deletion of ie1 (Fig. 10). AC146 was not expected to be detected in wildtype virus as it is not HA-tagged in its native form. As shown in Fig. 10 all viruses produced the expected protein products. The viruses expressing ie0 under control of the ie1 promoter or gp64 promoter produced both IE0 and IE1. Whereas the viruses expressing ie0MtoA only produced IE0 and the viruses expressing ie1 only produced IE1.  37  Western blot analysis of AC146HA in viruses repaired with ac146HA all showed the presence of a 23 kDa protein, the predicted size of AC146 (Dickison et al., 2012). This showed that AcBacac146-ie1KO was repaired with ac146HA under control of a heterologous promoter and polyA signal. The non-HA tagged ac146 viruses were repaired in the same manner and all viruses produced IE0 and IE1, IE0 or IE1 as well as BV, indicating that ac146 was successfully repaired. 3.5  Viral titre analysis  BV stocks were generated from bacmid transfected cells harvested at 9 dpt. Virus titres were determined and no difference was seen between the HA tagged ac146 viruses and untagged viruses. Therefore, for the purpose of examining viruses expressing IE0, IE0MtoA and IE1 under control of identical promoters, the wildtype virus and the six recombinant viruses expressing native, untagged AC146; vie1p-IE0, vie1p-IE0MtoA, vie1p-IE1, vgp64p-IE0, vgp64p-IE0MtoA, vgp64p-IE1 were used for further experiments. 3.6  Virus time course assays  Time course assays with vie1p-IE0, vie1p-IE0MtoA, vie1p-IE1, vgp64p-IE0, vgp64pIE0MtoA, and vgp64p-IE1 were performed to compare DNA replication and BV production of viruses expressing ie0, ie0MtoA or ie1 under control of identical promoters. Sf9 cells were infected at an MOI of 5 and cell pellets and supernatants were collected at various time points for analysis.  38  3.6.1 IE0, IE0MtoA and IE1 analysis by Western blot The use of identical promoters to drive expression of ie0, ie0MtoA or ie1 was an attempt to obtain similar temporal expression and similar levels of expression of IE0, IE0MtoA and IE1. It was therefore important to examine the level of IE0 and IE1 expression around the time of initiation of viral DNA replication (6-8 hpi), to ensure that any differences observed in viral DNA replication level were due to protein function rather than the level of protein expression. Infected cell pellets harvested at 6, 7, 9, and 11 hpi were analyzed by Western blot (Fig. 11). IE0, IE0MtoA and IE1 expression was detected using a monoclonal antibody that recognizes an epitope in the AAD present in IE0, IE0MtoA and IE1. At 6 hpi all viruses produced nearly undetectable levels of protein but analysis of subsequent time points (7, 9 and 11 hpi), indicated that protein levels increased to detectable levels. At all time points examined viruses using the ie1 promoter, (vie1p-IE0, vie1p-IE0MtoA, and vie1pIE1) all expressed greater amounts of protein produced compared to viruses using the gp64 promoter, (vgp64p-IE0, vgp64p-IE0MtoA, and vgp64p-IE1) (Fig. 11). For each promoter, at each time point, the level of protein for IE0, IE0MtoA and IE1 was comparable (Fig. 11). This allowed comparison of the function of IE0, IE0MtoA and IE1 in viral DNA replication between the viruses containing the ie1 or gp64 promoter because the levels of protein expression were similar for each virus set. The level of IE0, IE0MtoA and IE1 expression was also analyzed throughout the virus replication cycle to examine temporal expression of IE0, IE0MtoA and IE1 under control 39  of the ie1 promoter or gp64 promoter (Fig. 12). Infected cell pellets harvested at 6, 9, 12, 20, 24, 36 and 48 hpi were analyzed by Western blot. The expression of ie0MtoA or ie1 under control of the gp64 promoter exhibited the same general temporal expression. That is, a steady increase of IE0MtoA or IE1 expression up to 24 hpi followed by a large increase at 36 hpi and maintained to 48 hpi. For virus expressing ie0 which produces mainly IE0 with a smaller amount of IE1, the large increase in steady state expression levels was detected between 12 and 20 hpi. Under control of the ie1 promoter, ie0MtoA and ie1 exhibit the same profile with a continuous increase in expression to 48 hpi without large increases between 24 and 36 hpi, as seen when driven by the gp64 promoter. However ie0 driven by the ie1 promoter shows the same temporal pattern as gp64 driven ie1 with a large increase in expression levels between 12 and 20 hpi. 3.6.2 DNA replication analysis by qPCR Analysis of DNA replication was performed to compare viral replication of vie1p-IE0, vie1p-IE0MtoA, vie1p-IE1, vgp64p-IE0, vgp64p-IE0MtoA, vgp64p-IE1 and WT. The amount of DNA replication for each virus at each time point was determined using qPCR to detect the number of genomes present in the harvested cell pellet. In WT infected cells, viral DNA replication initiates at approximately 6-8 hpi. Therefore time course data for each virus was normalized to 3 hpi, to reflect the increase in the number of genomes present due to DNA replication and viruses containing identical promoters driving ie0, ie0MtoA and ie1 expression were compared to each other (Fig. 11).  40  Viruses utilizing the ie1 promoter to express IE0, IE0MtoA and IE1 achieved similar DNA replication levels as wildtype virus. However differences were observed in the initiation of DNA replication. The viruses vie1p-IE0MtoA, and vie1p-IE1 initiated DNA replication at similar times between 6-8 hpi. However, vie1p-IE0 showed a 1-2 hour delay in initiation of DNA replication (Fig. 13A). This suggested expression of IE0 with small amounts of IE1 delays initiation of viral DNA replication when under control of the ie1 promoter, compared to viruses that express IE0MtoA or IE1. Even though DNA replication initiation times were dissimilar, all viruses showed an increase of viral DNA levels of over a thousand fold by 48 hpi which was similar to wildtype virus (Fig. 13A). Viruses utilizing the gp64 promoter express IE0, IE0MtoA and IE1 at lower levels than the viruses utilizing the ie1 promoter. When under control of the gp64 promoter, expression of IE0 resulted in a virus that was most similar to wildtype virus with no delay in initiation of DNA replication and reached similar levels of DNA replication by 48 hpi (Fig. 13B). Whereas IE0MtoA and IE1 both had delayed initiation of DNA replication (Fig. 13B) and the amount of DNA replication was lower and did not reach WT levels by 48 hpi. By 48 hpi, the expression of IE0 resulted in over a thousand fold increase in level of viral DNA, which differed from IE0MtoA and IE1 which reached only a five hundred fold increase in level of viral DNA. The results show that when expression levels are lower due to the weaker gp64 promoter, IE0 initiated DNA replication earlier and reached higher levels of viral DNA replication than either IE0MtoA or IE1.  41  3.6.3 Temporal analysis of budded virus production BV production was also examined in cells infected with IE0, IE0 MtoA and IE1 under control of the ie1 and gp64 promoters. Budded virus production was analyzed using qPCR for quantification of the number of genomes present in supernatants harvested at each time point for each virus. All data was normalized to the first time point at 3 hpi. As with the DNA replication analysis, viruses expressing IE0, IE0MtoA and IE1 utilizing identical promoters were compared to each other. Viruses utilizing the ie1 promoter to express IE0, IE0MtoA and IE1 all initiated BV production at 18 hpi and BV levels increased to about one thousand-fold by 48 hpi (Fig. 14A). These viruses, all expressing similar levels of IE0, IE0MtoA or IE1, acted similarly to wildtype virus, except that wildtype virus reached slightly higher levels of BV production by 48 hpi. Viruses utilizing the gp64 promoter to express IE0, IE0MtoA and IE1 showed a different BV production profile compared to wildtype. Expression of IE0 resulted in initiation of BV production at 18 hpi, like wildtype, and levels increased over one thousand-fold by 48 hpi, although levels were lower than wildtype (Fig. 14B). Expression of IE0MtoA and IE1 show a very different BV profile as BV production was delayed, initiating between 20-24 hpi and BV levels increased only one hundred fold by 48 hpi (Fig. 14B). This result shows that at low levels of IE0 expression, which also produces small amounts of IE1, BV production initiates at least 6 hours before viruses expressing low levels of only  42  IE0MtoA or IE1 (Fig. 14B). No difference was observed between IE0MtoA and IE1 when expression levels were low. 3.7  Transactivation analysis of early gene promoters by IE0 and IE1  IE0 and IE1 have shown to be transactivators of viral early gene promoters (Guarino and Summers, 1986a) and an acidic activation domain has been identified (Pathakamuri and Theilmann, 2002; Taggart et al., 2012). Part of IE0 and IE1`s essential role in viral replication may be due to their ability to transactivate viral genes required for viral replication. Results of a previous study has shown that IE0 and IE1 activate the same viral early gene promoters, that is, no viral promoters were identified to be specifically transactivated by IE0 or IE1 (Nie, 2010). Differences were only observed in the levels of reporter gene transactivation and these differences could be simply due to variable levels of IE0 or IE1 which were expressed using different promoters. Therefore it was hypothesized that IE0 and IE1 are equal in ability to transcriptionally transactivate viral early gene promoters. To test this hypothesis, the ability of IE0, IE0MtoA and IE1 to transiently transactivate viral early gene promoters when they were expressed utilizing the same promoter was examined. Nineteen early gene promoter-CAT reporter gene constructs were analyzed (Fig. 7). The reporter plasmid constructs were transfected by themselves or with plasmids expressing IE0, IE0MtoA or IE1 under control of the ie1 promoter or gp64 promoter (Fig 7). CAT assays were performed to determine the level of transactivation of each viral early gene promoter by IE0, IE0MtoA and IE1 at similar levels of expression. The data is presented  43  normalized to IE1 transactivation (Fig. 15A and 16A) or as counts per minute (Fig. 15B and 16B). Statistical analysis is summarized in Table 3 and 4. 3.7.1 Analysis of level of transactivation by IE0, IE0MtoA and IE1 Of the nineteen viral early gene promoters examined, there was a wide range of response to the transactivators IE0, IE0MtoA and IE1. Similar to what was previously reported, any early gene promoter that was transactivated by IE0 MtoA was also transactivated by IE1. Nine promoters appeared to be differentially expressed depending on which transactivator, or whether the transactivator was expressed at high (ie1 promoter) or low (gp64 promoter) levels. At low expression levels eight promoters, p35, orf18, lef4, 39K, lef3, lef6, orf79 and orf111 were transactivated to higher levels by IE0 and IE0MtoA compared to IE1 (Fig. 16A). At high levels however, no difference was observed in the expression with p35, orf18, lef4, lef3, lef6. These promoters therefore appear to be more sensitive to IE0 when cellular levels are low. Expression of high levels of IE0, IE0MtoA and IE1 revealed three viral early gene promoters, orf111, ie1 and 39K that were transactivated to a higher levels by IE1 compared to IE0 and IE0 MtoA (Fig. 15A). These data show that there appears to be specificity in promoter activation by IE0 and IE1 and it appears to be dependent on cellular levels of IE0, IE0MtoA or IE1. Statistical analysis support these results (Table 3 and 4).Three viral early gene promoters ie0, me53, and gp64 had relatively high levels of expression in the absence of transactivator and showed no increase or decrease when co-transfected with plasmids expressing IE0, IE0MtoA, or IE1. These results show that these promoters were not transactivated by any transactivator but were actively expressed by cellular 44  transcription factors (Fig. 15B and 16B). The reporter constructs containing the promoters of orf33, orf91, orf52 and orf76 resulted in CAT expression levels that were barely above background and only minor or no increase was observed when transactivated by IE0, IE0Mto A, or IE1. These viral promoters are therefore not activated by cellular proteins and the increase in CAT expression that is observed would be consistent with the ability of IE0 or IE1 to non-specifically activate basal promoters at low levels (Choi and Guarino, 1995c) (Fig. 15B and 16B). Down regulation of the pe38 promoter was detected when IE1 was expressed from the gp64 promoter though decrease of expression was minimal. IE0MtoA when expressed from either the ie1or gp64 promoters had a similar impact on the pe38 promoter but no impact, positive or negative, was seen on the ie2 promoter (Fig. 16 A and B). The p78 promoter appears to be insensitive to low level expression (gp64 promoter) of either IE0 or IE1 but showed activation at higher levels (ie1 promoter) (Fig. 15 and 16). For the p78 promoter therefore, there appears to be a threshold level of transactivator required but no differences were observed between IE0 or IE1. 3.7.2 IE0, IE0MtoA and IE1 analysis by Western blot Western blots were performed to compare the levels of expression of IE0 and IE1 in the transient expression assays. In general, IE0, IE0MtoA and IE1 under control of the gp64 promoter resulted in lower expression levels than when under control of the ie1 promoter (Fig. 17). The levels of IE0MtoA and IE1 produced under control of the gp64 promoter were relatively low but similar. The expression of IE0 produced a slightly greater amount of IE0/IE1 from internal translation initiation (Fig. 17). Under control of 45  the ie1 promoter, the level of IE0 and IE0MtoA were similar but IE1 showed greater levels. This would suggest that IE1 autoregulates the ie1 promoter which agrees with the CAT assay results (Fig. 15A) that showed that IE1 transactivated the ie1 promoter to higher levels than IE0 or IE0MtoA. The interpretation of the CAT assay results using the ie1 promoter to drive expression of IE0, IE0MtoA and IE1 has to take into account the higher expression of IE1. The differences in the transactivation of early gene promoters by IE0MtoA or IE1 were therefore more readily apparent at the low equal levels that is observed using the gp64 promoter. However using the ie1 promoter, the transactivation levels of IE0, IE0MtoA and IE1 were all higher and very few differences in transactivation were observed, even though IE1 was expressed at higher levels. This would suggest that transactivation of the early gene promoter-cat reporters were being maximized by high levels of IE0, IE0MtoA and IE1 expression, masking any functional differences between IE0 MtoA and IE1. Exceptions were observed, the 39K and orf111 promoters were transactivated to greater levels by IE0 and IE0MtoA when at low levels of protein expression (gp64 promoter, Fig. 16A) but transactivated to higher levels by IE1 when at high levels of protein expression (ie1 promoter, Fig. 15A). The CAT assay results would suggest that promoters are differentially sensitive to transactivation by IE0, IE0MtoA and IE1 depending on the intracellular levels. This is theoretically described in Fig. 18A which shows that at low levels of expression certain promoters are more sensitive to IE0 and IE0MtoA than IE1 and are activated at low cellular levels. As the levels of transactivator increase the promoters become more 46  responsive to IE1 as they reach maximum expression levels. Once maximum levels are reached, the differences between IE0, IE0MtoA and IE1 are no longer observed. To test this model of the functional differences between IE0, IE0MtoA and IE1, preliminary experiments with increasing amounts of transactivator and monitoring the level of transactivation were initiated (Fig. 18B). It was expected that as the amounts of IE0MtoA and IE1 increased, rate of transactivation would also increase, until a maximum rate was achieved. It was also expected that the rate of transactivation observed by IE0 MtoA would be higher than IE1, when amounts of transactivator were low (gp64 promoter, Fig. 18A). However, when amounts of transactivators increased to higher levels (ie1 promoter, Fig. 18A), it was expected that the rate of transactivation by IE1 would surpass rates achieved by IE0 and IE0MtoA, until all transactivators achieved the maximum transactivation rate. The preliminary experiment analyzed the level of transactivation of the 39K-cat reporter plasmid using a range of 0.5 to 2.5 µg of transfected plasmid expressing IE0, IE0 MtoA or IE1 under control of the gp64 promoter (Fig. 18B). As the amount of transfected IE0 or IE0MtoA expressing plasmid increased, the level of transactivation increased, though the levels of transactivation achieved with IE0 were higher than IE0 MtoA (Fig. 18B). However, as the amount of transfected plasmid expressing IE1 increased, no increase in the levels of transactivation was observed (Fig. 18B). These results would agree with the theoretical results in Fig. 18A but further assays with higher levels of transactivator are required. However, this result confirms that the 39K promoter is more sensitive to  47  IE0 and IE0MtoA transactivation than IE1 transactivation showing that viral promoters are differentially transactivated by IE0 and IE1.  48  4  Discussion  The goal of this study was to compare the function of AcMNPV IE0 and IE1 in DNA replication and early gene transactivation when IE0, IE0MtoA and IE1 were produced at similar cellular levels. Previous examination of the function of IE0MtoA and IE1 was conducted under control of their native ie0 and ie1 promoters (Nie, 2010; Stewart et al., 2005). When IE0, IE0MtoA or IE1 were placed under control of their native promoters, different amounts of IE0, IE0MtoA or IE1 were obtained, and any functional difference observed may have been due to differences in level of expression (Nie, 2010). In this study therefore, a new approach was used and identical promoters were used to control ie0, ie0MtoA or ie1 to produce IE0 and IE1, IE0 or IE1 respectively. The results indicate that IE0MtoA and IE1 are approximately equivalent in their ability to initiate and support viral DNA replication but show synergistic affects when expressed together. The two proteins however do appear to be functionally different in their ability to transactivate viral gene expression. 4.1  Comparison of IE0, IE0MtoA and IE1 in time course assays  The initial hypothesis of this study was that IE1 was more efficient in DNA replication compared to IE0MtoA which was based on previous research that showed virus producing only IE1 followed DNA replication profiles similar to wildtype virus (Stewart et al., 2005). In this study, time course assays revealed differences in initiation and level of DNA replication and budded virus production for viruses expressing IE0, IE0MtoA or IE1. Expression of IE0MtoA and IE1at high or low levels (Fig. 13) showed that these two proteins supported virus replication and that initiation and final levels were 49  approximately equal. However, if IE0MtoA or IE1 were expressed at sustained lower levels (gp64 promoter) and compared to cells infected with WT virus, initiation of viral DNA replication was delayed and final levels were lower. When expressed at higher levels (ie1 promoter) IE0MtoA or IE1 were very similar to WT. The surprising result was that low level expression of IE0 (Fig. 13B) resulted in viral DNA replication initiation and final levels nearly identical to WT. Expression of ie0 results in both IE0 and IE1 being produced (Fig. 12) so this clearly shows that there is a synergistic interaction between these two proteins that results in enhanced viral DNA replication compared to either protein by itself. However, expression of ie0 at higher cellular levels (Fig. 13A) results in an antagonistic interaction and viral DNA initiation is delayed but levels eventually reach WT levels. Antagonistic effects between IE0 and IE1 have been shown in regards to viral late gene expression (Huijskens et al., 2004). From the perspective of the virus infection, these results strongly suggest that there is a distinct advantage for expressing both IE0 and IE1 as it results in more potent stimulation of viral DNA replication compared to each protein separately. This result would provide an explanation of why the spliced ie0 is translated as both proteins early in infection when levels are low (Theilmann et al., 2001) and why expression decreases late in infection. DNA replication can have a major impact on the timing and level of BV production (Milks et al., 2003), the effect of IE0, IE0MtoA and IE1 on BV production was examined. At relatively higher levels, (ie1 promoter), no difference was seen between IE0, IE0MtoA and IE1; all were similar in timing and level of BV production. At relatively lower levels, (gp64 50  promoter), IE0MtoA and IE1 were equivalent in timing and level of BV production. The level of BV production of IE0MtoA and IE1 increased by only a hundred fold and a BV initiation was delayed. However, IE0 initiated BV production at the same time as wildtype virus (18 hpi) and BV levels increased to approximately one thousand fold, which was slightly less than wildtype. 4.2  Comparision of IE0, IE0MtoA and IE1 in transactivation of viral early gene promoters  Part of the initial hypothesis of this study was that IE0 and IE1 were equal in their ability to transactivate viral early gene promoters. This was based on a previous study that showed that all promoters that were transactivated by IE0 were also transactivated by IE1 (Nie, 2010) which indicated that there are no specific IE0 or IE1 activated promoters. However, it was possible that a promoter may be more sensitive to activation by IE0 or IE1. To address this question in this study, IE0 and IE1 were expressed using identical promoters to produce approximately equal levels of expression to determine if the levels of transactivation by IE0 and IE1 were the same or different. Nineteen viral early gene promoters were used for this analysis. One set of viral early gene promoters were chosen because they have been reported as being transactivated by IE1 in the literature; 39K (Guarino and Summers, 1986a), p35 (Schultz et al., 2009), gp64 (Blissard and Rohrmann, 1991b), ie0 (Kovacs et al., 1991), ie1 (Kovacs et al., 1991; Pullen and Friesen, 1995b), pe38 (Leisy et al., 1997) and ie2 (Leisy et al., 1997). 51  Whereas other viral early gene promoters that were used were recently identified to be potentially differentially regulated by IE0 and IE1 by microarray analysis; orf18, lef4, lef3, lef6, orf79, orf111, orf91, orf52 and orf76 (Nie, 2010). Four viral early gene promoters, orf33, orf91, orf52 and orf76 that had previously been suggested to have differential activation by IE0, IE0MtoA or IE1 by microarray studies (Nie, 2010), showed no activation in this study. This would therefore suggest that additional viral factors are required for transactivation of these promoters. Down regulation of the pe38 promoter was seen when IE1 was expressed from the gp64 promoter. The ie2 and pe38 promoters have been previously reported to be down regulated by IE1 (Leisy et al., 1997). IE0, IE0MtoA and IE1 produced at low levels (gp64 promoter) and high levels (ie1 promoter) were analyzed for their ability to transactivate each of the nineteen viral early gene promoters. When IE0, IE0MtoA and IE1 were at low levels, differences in transactivator function were readily observed. Both IE0 and IE0MtoA transactivated eight viral early gene promoters (lef4, lef6, orf79, p35, orf18, lef3, orf111, and 39K) to a higher level than IE1 (Fig. 16A). Statistical analysis generally support these results (p<0.05, Table 3). One statistical exception is lef4 where IE1 compared to IE0MtoA p=0.13, however IE1 compared to IE0 p=0.002. A subset of four promoters, lef4, lef6, orf79 and 39K, were transactivated to a higher level by IE0 compared to IE0 MtoA. Statistical analysis support these results (p<0.05, Table 3), with two exceptions. The p values for IE0 compared to IE0MtoA for lef4 was 0.08 and orf79 was 0.25. This shows that IE0 and IE0MtoA are more potent transactivators of specific promoters than IE1 52  when present at low levels. This result would provide an explanation of why IE0 is present in higher amounts relative to IE1 at early times in infection (Huijskens et al., 2004). A recent study has also compared the function of IE0MtoA and IE1 examining both transcriptional activation and DNA replication (Luria et al., 2012). Transcriptional transactivation was analyzed using a luciferase reporter gene under control of the p39K promoter that was linked to an hr enhancer. IE0MtoA and IE1 were expressed under control of the Drosophila melanogaster hsp70 promoter (Luria et al., 2012). Under these hr dependent conditions transactivation by IE0MtoA was 90-fold greater than IE1 (Luria et al., 2012). This result would agree with the results of this study showing IE0 MtoA was a stronger activator of p39K promoter however, transactivation by IE0 was not explored (which produces small amounts of IE1) or hr-independent transactivation. Hr-dependent transactivation depends on direct binding of IE0 or IE1 to the hr element (Guarino and Dong, 1991; Kovacs et al., 1992; Rodems and Friesen, 1993) whereas in this study, hrindependent transactivation without direct binding was examined. In addition, evidence showing that that similar IE0MtoA and IE1 protein expression levels were achieved was not provided. When expressed at higher levels (ie1 promoter) the differences between IE0, IE0MtoA and IE1 became less apparent. IE1 transactivated three viral early gene promoters, orf111, 39K and ie1, to a higher level than IE0 and IE0MtoA (Fig. 15B, Table 4 for statistical analysis) but this could be due to high levels of expression observed. The six promoters (lef4, lef6, orf79, p35, orf18 and lef3) that were more strongly activated by 53  IE0 and IE0MtoA at low levels showed approximately equal transactivation with IE1 when expression levels were higher. This data suggests that maximum levels of transactivation and reporter gene expression may be occurring when each of the transactivators are produced at high levels (ie1 promoter). Since transactivation may be at its maximum, this could prevent the detection of functional differences between IE0MtoA and IE1. Taken together, the results indicate that functional differences between IE0 and IE1 are dependent on cellular concentration. This is graphically described in Figure 18A which illustrates a theoretical example of how transactivators may behave according to the observations seen in this study when present at high and low levels. Specific promoters appear to be more sensitive to IE0 and IE0MtoA so that at low levels of expression the level of transactivation is greater than IE1. In addition, levels of transactivation achieved with IE0 are higher than levels of transactivation achieved with IE0MtoA. When IE1 reaches high enough levels the ability to transactivate starts to equal that of IE0 and IE0MtoA. Once a promoter reaches maximal level of expression no differences will be observed between IE0, IE0MtoA or IE1. The results in general appear to support this model. Viral early gene promoters that show equivalent transactivation by all transactivators at high levels (lef4, lef6, orf79, p35, orf18, and lef3) could represent the situation where rate of transactivation is maximized, when transactivator amounts are high (top right of graph). However, these same viral early gene promoters show increased transactivation by IE0 and IE0MtoA compared to IE1 when the transactivators are at low levels (lower left of graph). The promoters orf111 and 39K fit the model as 54  well; when the transactivators were present at low levels, there was increased activation by IE0 and IE0MtoA compared to IE1 (lower left of graph) but at high levels there was increased activation by IE1 compared to IE0 and IE0MtoA (upper right of graph). The ie1 promoter appears to be an exception as it showed no transactivation by any of the transactivators at low levels but activation by only IE1 was observed at high levels. This suggests the ie1 promoter is specifically activated by IE1 but unlike the other promoters requires higher levels of expression for transactivation. The Western blot of transient transfection also supports this observation as pie1-IE1 expressed higher levels of transactivator than either pie1- IE0 or pie1-IE0MtoA indicating autoregulation by IE1 (Fig. 17). The remaining promoters that showed no activation compared to the reporter plasmid alone therefore are not responsive to IE0, IE0MtoA or IE1. However, it is possible that in the context of other viral factors during viral infection IE0, IE0 MtoA or IE1 may play a role in their expression. 4.3  Significance of findings in context of virus infection  IE0 and IE1 are key transregulatory proteins, either IE0 or IE1 are needed to support viral replication but both are required for wildtype replication (Stewart et al., 2005), suggesting that each protein has a specific role in the viral replication cycle. Of the four genera of Baculoviruses, Alphabaculoviruses are the most recent evolutionary group (Krell, 2008) and are the only genera that utilize gene splicing which only produces ie0 (Chisholm and Henner, 1988). For Alphabaculoviruses to employ this relatively complex mechanism to produce IE0 and IE1, it is likely that these proteins have a distinct advantage for the virus. 55  During the first few hours of infection of an insect, cellular levels of all viral proteins including the immediate early proteins like IE0 and IE1 are low. There is evidence that IE1 is packaged in ODV indicating thatIE0 and IE1 may be present in the cell at low levels during initial nucleocapsid entry (Braunagel et al., 2003). The study by Braunagel et al. (2003) identified IE1 in AcMNPV ODV although this conflicted with published results in OpMNPV which showed IE1 only associating with BV rather than ODV (Theilmann and Stewart, 1993). This difference may have been due to differences in protein preparation and suggested that IE1 may be easily susceptible to degradation (Braunagel et al., 2003). Therefore, if in AcMNPV ODV low levels of IE1 are present and low abundance IE0 may be present, but may not have been detected in their analysis. Sustained low levels expression of IE0, IE0MtoA and IE1 using the gp64 promoter highlights the early events that may be occurring in WT infected cells. Regardless of whether IE0 and IE1 are packaged within ODV, the number of initial nucleocapsids that enter the midgut cells may be small. Therefore, at these early times in infection within the midgut cells, production of immediate early proteins like IE0 and IE1 may be relatively low. The results obtained from viruses using the gp64 promoter, when low levels of IE0 and IE1 are produced, may be used to speculate how IE0 and IE1 function at these early times in infection. After the entry into the midgut cell and production of viral proteins accumulates, levels of immediate early proteins are increased (Huijskens et al., 2004). These later times, when higher levels of IE0 and IE1 are present, may be represented in this study by the viruses using the ie1 promoter, which expressed higher levels of IE0 and IE1. 56  At early stages of viral infection the insect employs defence mechanisms to rid itself of the virus that result in midgut cell death (reviewed in Hakim et al., 2010). The virus must compete with the cell’s defence mechanisms in order to replicate and produce a systemic infection. One insect defence mechanism is sloughing, where the infected midgut cell shed and it swells and bursts followed by new midgut cell proliferation (reviewed in Hakim et al., 2010). Sloughing is a defence mechanism used for baculovirus infection resulting in prevention or delay in virus infection (Hoover et al., 2000; reviewed in Clem, 2005). Therefore it is important that the virus rapidly produces BV for systemic infection or else the virus infected cell is sloughed and the virus can no longer replicate. At these early stages of infection when viral cellular proteins are at low levels, the virus must find a mechanism to rapidly move out of the midgut and into other cell types. One strategy may be the stimulation of rapid viral DNA replication by both IE0 and IE1 together, resulting in BV production and subsequent systemic infection. Therefore co-production of both IE0 and IE1 proteins, ensured by internal translation (Theilmann et al., 2001) is advantageous to evade the hosts defence strategy of sloughing to ensure successful infection. Another insect defence strategy is programmed cell death, known as apoptosis which is conserved among most animals (reviewed in Rohrmann, 2011). In insects, apoptosis is an antiviral defence mechanism, and serves many other purposes including preventing unwanted cell division, removal of extraneous tissue during organism development as well as damaged cells (reviewed in Clarke and Clem, 2003). Infected cells are triggered into apoptosis by either viral DNA replication or expression of a viral gene at the same 57  time as viral DNA replication (Schultz and Friesen, 2009). It is important for the virus to have viable host cells and accompanying cellular machinery in order for the virus to replicate. Therefore viruses have evolved to include mechanisms to regulate or inhibit apoptosis, to counteract the host’s defence mechanism of apoptosis. AcMNPV produces the protein P35, which prevents apoptosis in infected cells (Clem et al., 1991; Clem and Miller, 1993; Lee et al., 1998; reviewed in Clem, 2005). Part of the apoptosis process is the use of initiator and effector caspases to disassemble the cell (reviewed in Clem, 2005). Initiator caspases activate other caspases and effector caspases cleave cellular components. P35 binds to effector caspases, which results in cleavage of P35, but also causes a conformation change in the effector caspase that permanently binds the proteins together, preventing apoptotic cell death (reviewed in Clarke and Clem, 2003). The p35 viral early gene promoter was one of the promoters identified as transactivated to a higher level by IE0 or IE0MtoA compared to IE1. Again, if low levels represent early times in virus infection, when evasion of the host’s defence system is critical, increased cellular P35 would be advantageous for apoptosis prevention, and may promote subsequent viral replication. Currently, it has not been shown that apoptosis occurs in insect midgut cells. However, apoptosis occurs in other cells types that are affected by systemic infection (Clarke and Clem, 2003). In these cell types, presence of IE0 may produce increased levels of P35, providing a mechanism against apoptosis resulting in successful infection.  58  Another viral early gene promoter identified as activated to a higher level by IE0 or IE0MtoA compared to IE1 was lef3. LEF3 has been widely studied and has been found to be critical for viral DNA replication (Nie et al., 2012), as well as required for transient DNA replication (Kool et al., 1994a; Lu and Miller, 1995). LEF3 is a single stranded binding protein (Hang et al., 1995), which stabilizes the unwound DNA at the replication fork during DNA replication (Kool et al., 1995). An increase in DNA replication factors, including LEF3 is advantageous for increased DNA replication, especially at early times in virus infection. Other DNA replication factors, HELICASE, DNA POL, LEF1 and LEF2 were not analyzed for transactivation by IE0, IE0MtoA or IE1, as they were not previously identified by microarray or other analyses. It has been shown that DNA replication affects BV production (Milks et al., 2003) and an increase in BV may increase the opportunity for systemic infection. However, it should be noted that even though at low transactivator levels (gp64 promoter), IE0MtoA showed higher transactivation of the lef3 promoter compared to IE1, the virus time course assays showed no difference in initiation or levels of DNA replication with viruses expressing IE0MtoA and IE1 at low levels (gp64 promoter). Therefore, increased transactivation by IE0MtoA compared to IE1 of any of the viral early gene promoters studied does not result in an increase in viral DNA replication. It is the combination of IE0 and IE1 that results in early initiation of viral DNA replication and higher viral DNA levels. It is possible that increased transactivation by IE0MtoA combined with a more efficient replication complex containing IE0 and IE1 allows rapid viral DNA replication and successful systemic infection.  59  It is tempting to associate all viral early gene promoters that were differentially regulated by IE0 or IE0MtoA with processes important to rapid viral replication like apoptosis prevention. Unfortunately, the remaining viral early gene promoters produce proteins that function in a wide variety of viral processes, and most are not thoroughly characterized. Functions for both ORF18 and ORF111 are currently unknown (reviewed in Rohrmann, 2011). LEF6 and 39K are involved in late gene expression (Todd et al., 1995). However 39K has also been shown to bind DNA (Guarino et al., 2002) as well as be transactivated by IE1 (Guarino and Summers, 1986a). ORF79 has been suggested to be involved in DNA repair (reviewed in Rohrmann, 2011). LEF4 has been found to be an RNA 5’ capping enzyme (Gross and Shuman, 1998; Jin et al., 1998), which serves to protect from degradation and interact with translation initiation factors. These proteins are involved in processes that are important to the virus and further studies are needed to fully understand their roles and interactions with IE0 and IE1. 4.4  Conclusions  This study’s aim was to determine the functional differences of IE0 and IE1 in DNA replication and transactivation of viral early gene promoters. Differences between these transregulatory proteins was more readily seen when they were expressed at low levels. This study shows that both IE0 and small amounts of IE1 are required for efficient DNA replication. However IE0 appears to have enhanced ability to transactivate a set of viral early gene promoters compared to IE1.  60  Considering that Alphabaculoviruses are the only genera to contain ie0, the only known baculovirus spliced gene that produces multiple protein products, an attractive idea is that IE0 and IE1 play a role in viral replication that make this group of viruses robust. Efficient DNA replication by the presence of both IE0 and IE1 and enhanced transactivation of some viral early gene promoters by IE0 may benefit the virus when viral protein levels are low. This supports IE0 and IE1’s role as proteins that confer a distinct advantage to the virus. 4.5  Future studies  The results of this study lead to more questions regarding IE0 and IE1’s roles in AcMNPV replication. Additional studies involving DNA replication and early gene transactivation are needed to support the results from this study. The finding that IE0 and IE0MtoA preferentially transactivate some viral early gene promoters may be refined with a more thorough analysis. It was discussed that viral early gene promoters that are preferentially upregulated by IE0 and IE0 MtoA may accelerate events important to evade the insect’s defence mechanisms and promote rapid virus replication and systemic infection. It is hypothesized that viral promoters associated with these events may also be upregulated, for example promoters for the essential DNA replication factors, lef1, lef2, DNApol and helicase. It is hypothesized that the genes for the remaining essential factors may be upregulated to contribute to rapid viral DNA replication, as shown in this study with essential viral replication factor LEF3. However, it would be expected that promoters not associated with rapid virus replication 61  or systemic infection would not be upregulated, for example per os infectivity factors that are required for infection of midgut cells (reviewed in Rohrmann, 2011). To confirm the viral time course finding that IE0 and IE1 are required together for efficient viral DNA replication, further studies examining transient DNA replication are needed. Transient studies use only the viral replication factors, without any other viral factors present. Therefore these studies would truly show if IE0 and small amounts of IE1 were causing an increase in DNA replication, or if other viral factors are involved. Transient DNA replication studies use plasmids encoding all essential viral replication factors, a plasmid expressing IE0, IE0MtoA or IE1 and a target plasmid including a viral origin of replication. The target plasmid containing the origin of replication is quantified, reflecting the abilities of IE0, IE0MtoA or IE1 in DNA replication. It is expected that the level of target DNA replication achieved by transiently expressed IE0 when at low levels (gp64 promoter) will be greater than IE0MtoA and IE1 when present at low levels (gp64 promoter). It is also expected that at high levels of IE0, IE0MtoA or IE1 (ie1 promoter), no difference in target DNA replication will be seen. This would confirm the findings in this study that at low levels, IE0 and IE1 are required together for rapid and efficient viral DNA replication. To examine these findings in the context of insect infection, in vivo studies may be used. ODV expressing IE0, IE0MtoA and IE1 under control of the ie1 promoter and gp64 promoter were collected when budded virus was produced during this study. The number of ODV could be quantified and fed to insects. It would be expected that the insects that were fed low amounts of viruses expressing IE0 at sustained low levels 62  (gp64 promoter) would have a lower lethal dose (LD50) than viruses expressing low levels of IE1 or IE0MtoA.  63  Table 1: Manufactured kits used Kit Name Qiaprep Spin Miniprep Kit QIAfilterTM Plasmid Midi Kit Qiaquick Gel Extraction Kit EZ-10 Spin Column Plasmid DNA Miniprep Kit EZ-10 Spin Column DNA Gel Extraction EZNA Fastfilter® Plasmid Midi Kit  Use Plasmid purification – small scale Plasmid purification – medium scale Gel extraction Plasmid purification – small scale Gel extraction  Distributor Qiagen  Plasmid purification – medium scale  VWR  Qiagen Qiagen VWR VWR  64  Table 2: Complete list of primer sequences and features All primers were originally designed by N. Sokal unless otherwise indicated. Primer number  Primer sequence 5’ to 3’  1551  acggctcgcatgtatagaaactt gttactatgaaataaaggatctct gcagcacgtgtt  Description of use and unique features -  1918  aaaaataatataaaatatatgtat aattaattaaattcaaaataaag gcggtgttggtcggcgtcgg  -  1574  cgccagctgcaagcctatc  -  520  ccggaacggcactggtcaactt  -  used to construct the zeocin cassette for homologous recombination into wildtype bacmid, to knockout ac146 and ie1 loci flanking 5’ region of ac145, a polyA signal (italics) used for ac145 and a region homologous to the EM7 promoter-zeocin cassette (underlined) previously designed (Dickison et al., 2012) used to construct the zeocin cassette for homologous recombination into wildtype bacmid, to knockout ac146 and ie1 loci flanking 3’ region of ie1 and pif5, a polyA signal used for pif5 (italics) a region homologous to the EM7 promoterzeocin cassette (underlined) used to confirm recombination 5’ end of zeocin cassette previously designed (Dickison et al., 2012) used to confirm recombination 5’ end of zeocin cassette previously designed (Fang et al., 2007)  1919  gtccacgaacttccgggacgc  -  used to confirm recombination 3’ end of zeocin cassette  1920  ctatgcaaaaccccacaccaa  -  used to confirm recombination 3’ end of zeocin cassette  1936  aacctgcagttgtttcatattaagc cacaacgccgcccaacatgaa cgtcaatttatactg  -  used to amplify ac146 from AcMNPV strain E2 contains a PstI restriction site (underlined) contains the OpMNPV op146 promoter (italics)  -  65  Primer number  Primer sequence 5’ to 3’  1935  ttactcgagttttataaaatttatta aaactatgaagagcgggtttcca  Description of use and unique features -  1940  1932  ttactcgagttttataaaatttatta aaactatgaggcgtagtcggg cacgtcgtaggggtaagagcg ggtttcca  -  tccgaattctctagagagtcgatg tctttgtgatgc  -  -  1931  agtggatcccacttggttgttcac gatc  -  1933  ccggaattctctagaaactgccg ttgctaagaaa  -  1934  catggatcccttgcttgtgtgttcct tat  -  used to amplify ac146 from AcMNPV strain E2 contains a XhoI restriction site (underlined) and the OpMNPV ie2 polyA signal (italics) used to amplify ac146 from AcMNPV strain E2 and insert HA tag contains a XhoI restriction site (underlined), the OpMNPV ie2 polyA signal (italics) and sequence coding for the HA-epitope tag (bold) used to amplify 550bp of IE1 promoter at 5’ end contains EcoRI (underlined) and XbaI (italics) restriction sites used to amplify 550bp of IE1 promoter at 3’ end contains BamHI (underlined) restriction sites used to amplify 350 p of the GP64 promoter at 5’ end contains EcoRI (underlined) and XbaI (italics) restriction sites used to amplify 350 bp of the GP64 promoter at 3’ end contains BamHI (underlined) restriction site  1937  taactgcagttttataaaatttatta aaattaattaaattcgaattttttat at  -  used to amplify ie1, ie0 and ie0MtoA at 3’ end containing a PstI restriction site (underlined) and the OpMNPV ie2 polyA signal (italics)  1938  aacggatccactatgacgcaaa ttaattttaa  -  used to amplify ie1 at 5’ end contains BamHI restriction site (underlined)  1939  aacggatccaacataagaacc agcagtc  -  used to amplify ie0 and ie0MtoA at 5’ end contains BamHI restriction site (underlined)  66  Table 3: Statistical p values comparing transactivation by IE0, IE0MtoA, IE1 and reporter under control of the gp64 promoter lef4 MtoA  lef6  orf79  p35  orf18  lef3  orf111  39K  IE1-IE0  0.1289758  0.0056196  0.0000991  0.0056848  0.1254680  0.0068448  0.0001710  0.0000311  IE1-IE0  0.0015394  0.0000667  0.0000096  0.0018176  0.0006965  0.0037661  0.0010138  0.0000001  0.0824460  0.0433816  0.2493269  0.8865655  0.3050333  0.9817456  0.6026845  0.0001076  0.0060070  0.0000310  0.0000121  0.0004428  0.0000863  0.0014462  0.0009919  0.0000000  reporter - IE0  0.0459157  0.0020559  0.0001293  0.0012721  0.0010983  0.0025612  0.0001677  0.0000018  reporter-IE1  0.9189258  0.9187394  0.9967098  0.7764441  0.4506629  0.9252972  0.9999988  0.7998730  MtoA  IE0-IE0  reporter-IE0 MtoA  ie1 MtoA  ie2  pe38  me53  ie0  gp64  p78  orf33  IE1-IE0  0.9856646  0.3401793  0.9735156  0.0373980  0.9896275  0.9821896  0.9708943  0.9989782  IE1-IE0  0.1664496  0.6181200  0.9832343  0.2240093  0.9994087  0.2261122  0.0375722  0.1555688  IE0-IE0  0.2741175  0.0509057  0.9999072  0.6852870  0.9737809  0.3734600  0.0774226  0.1252253  reporter-IE0  0.1872693  0.0440368  0.0704402  0.9346135  0.9762722  0.9790252  0.0045680  0.0596298  reporter - IE0  0.9327010  0.9997480  0.0635663  0.9485345  0.9999988  0.5809769  0.3635831  0.9667070  reporter-IE1  0.9998199  0.3028811  0.1258321  0.0905602  0.9910040  0.3837544  0.5962397  0.9309352  MtoA  MtoA  orf91 MtoA  orf52  orf76  IE1-IE0  0.7069298  0.7037707  0.0101844  IE1-IE0  0.7114728  0.0875193  0.0051693  0.9999998  0.0143386  0.9747319  0.8838165  0.0023111  0.1493108  reporter - IE0  0.8870553  0.6803535  0.2755635  reporter-IE1  0.3226023  0.1784549  0.2299548  MtoA  IE0-IE0  reporter-IE0 MtoA  67  Table 4: Statistical p values comparing transactivation by IE0, IE0MtoA, IE1 and reporter under control of the ie1 promoter lef4  lef6  orf79  p35  orf18  lef3  orf111  39K  IE1-IE0  0.6044951  0.4748934  0.6433514  0.9606486  0.3316023  0.4312003  0.0004994  0.0000222  IE1-IE0  0.9925657  0.9998019  0.0799047  0.5685961  0.7146940  0.0307033  0.0006420  0.0006270  0.4525415  0.5190647  0.7673590  0.8361563  0.8898289  0.3553500  0.9979909  0.0996424  0.0000000  0.0000024  0.0349171  0.0001624  0.0000173  0.0000333  0.0037799  0.0000000  reporter - IE0  0.0000000  0.0000007  0.0068813  0.0000559  0.0000396  0.0000050  0.0050005  0.0000000  reporter-IE1  0.0000000  0.0000026  0.0004731  0.0000312  0.0000055  0.0000011  0.0000028  0.0000000  ie1  ie2  pe38  me53  ie0  gp64  p78  orf33  IE1-IE0  0.0102131  0.6619064  0.9899266  0.2421945  0.9817166  0.9207470  0.9995084  0.9911960  IE1-IE0  0.0066550  0.6300625  0.2407727  0.9973103  0.9446632  0.7363538  0.2582296  0.7909265  IE0-IE0  0.6826013  0.9999361  0.1535032  0.3164208  0.7946923  0.9770718  0.2208427  0.8550573  reporter-IE0  0.6089236  0.9190729  0.0031622  0.0177456  0.7094098  0.6820329  0.0002017  0.0258803  reporter - IE0  0.9992110  0.9365342  0.1407981  0.3182812  0.9985272  0.8851998  0.0000159  0.0069169  reporter-IE1  0.0082786  0.9352706  0.0870535  0.0128756  0.9504921  0.9996593  0.0000180  0.0055782  orf91  orf52  orf76  IE1-IE0  0.7995118  0.9973397  0.9961612  IE1-IE0  0.7963185  0.3698671  0.9750980  0.9999999  0.4666797  0.9201508  0.2043950  0.0003899  0.0144515  reporter - IE0  0.2062922  0.0000541  0.0051358  reporter-IE1  0.6343720  0.0000428  0.0073090  MtoA  MtoA  IE0-IE0  reporter-IE0 MtoA  MtoA  MtoA  MtoA  MtoA  MtoA  IE0-IE0  reporter-IE0 MtoA  68  Figure 1. Organization of the AcMNPV genome. Baculoviruses have circular double stranded DNA genomes. The AcMNPV genome is 133.9 kbp and codes for 154 methionine initiated predicted open reading frames of 50 amino acids or larger. This study focuses on the ie0-ie1 gene locus located within the inset noted in red. Reprinted from Encyclopedia of Virology 3rd edition, Theilmann D.A. and Blissard G.W., Baculoviruses: Molecular Biology of Nucleopolyhedroviruses, Pages No. 259 , Copyright (2008), with permission from Elsevier. 69  A.  B. Virogenic stroma Envelopment & occlusion  Nuclear envelope Nuclear pore Plasma membrane Insect cell  Occlusion bodies are released upon cell lysis  Uncoating  Fusion to midgut cell Primary Infection  Adsorptive endocytosis Secondary infection  Budding  Budded Virus (BV)  Oral ingestion and release of ODV in alkali environment  Occlusion Derived Virus (ODV)  Figure 2: Alphabaculovirus life cycle. (A) ODV enter midgut epithelium cell and travel to the nucleus for viral replication or proceed to bud, resulting in secondary infection of tracheal cells, hemocytes, fatbody and muscle tissue. Adapted from Slack and Arif (2006). Reprinted from Encyclopedia of Virology rd 3 edition, Theilmann D.A. and Blissard G.W., Baculoviruses: Molecular Biology of Nucleopolyhedroviruses, Pages No. 258 , Copyright (2008), with permission from Elsevier. (B) During primary infection ODV bind and fuse to the midgut cell, releasing nucleocapsids into the cytoplasm. The nucleocapsids are imported to the nucleus and uncoat their genome. In the nucleus, gene expression is initiated and viral DNA replication follows within the virogenic stroma. Nucleocapsid assembly occurs. Some nucleocapsids transit from the nucleus to the cytoplasm and bud through the cellular membrane producing BV, allowing secondary infection. Some nucleocapsids are enveloped and embedded within the polyhedrin matrix forming OB. OB are released upon cell lysis and remain in the environment until ingested by a host.  70  A.  B.  Figure 3: ie0-ie1 gene complex and IE0/IE1 functional domains. (A) Schematic representation showing the mRNA transcripts of ie0 and ie1. The ie0 mRNA transcript is expressed under control of the ie0 promoter and initiates 4.2 kb upstream at the “A” nucleotide of the CAGT ie1 start site. The ie0 mRNA transcript is composed of exon 1 and 2. The ie1 mRNA transcript is expressed under control of the ie1 promoter and is composed of only exon 2. (B) Functional domains of IE0 and IE1. Translation of the ie1 mRNA transcript results in a protein containing the following domains: replication domain (R), acidic activation domain (AAD), AC16 binding domain, basic domain I (BDI), DNA binding domain (DBD), basic domain II (BDII) and helix- loop-helix motif (HLH). IE0 contains an additional 54 amino acids (aa), 38 aa coded by exon 1 and 16 aa coded by exon 2, coinciding with the 5’ untranslated region (UTR) of the ie1 mRNA transcript.  71  Wildtype ie0-ie1 gene locus  ie0  ac141  ac142  ac140  ac144 ac143  ac146  pif5  ie1  ac145  ac146-ie1 KO ie0-ie1 gene locus ac141  ac140  ac142  pif5  ac144  ac143  ac145 EM7-Zeo  Figure 4: Construction of the ac146-ie1 knock-out (KO) virus. The schematic diagram representing the AcMNPV wildtype ie0-ie1 locus and the region replaced with a zeocin resistance cassette (EM7-Zeo) ac146-ie1KO in the ac146-ie1KO virus (AcBac ). The ie0 ORF is composed exon1 and exon2 (orange arrow) separated by an intron (red dotted line), and the ie1 ORF is only composed of exon2 (orange box). The ac146 ORF (blue arrow) is upstream of the ie1 ORF and the late promoter for ac146 (indicated by the arrow pointing to the left) resides within the ie1 ORF. The ORFs of ac140, ac141, ac142, ac143, ac144, ac145 and odv-e56 are also located adjacent to the ie1 ORF and within the sequence spliced from the ie0 mRNA transcript. Replacement of the ac146-ie1 locus by recombination with EM7 promoter-zeocin resistance gene (red arrow) deletes ac146, ie1 and ie0.  72  A.  AcMNPV ie0-ie1 gene locus 1574 ac146  ie1  pif5  ac145 1580  AcBacac146-ie1KO ie0-ie1 gene locus 1574 1551 1919 pif5 ac145 EM7-zeocin 520 1918 1920  B.  132 bp  657 bp  243 bp 197 bp  Figure 5: Confirmation of recombination events between wildtype bacmid and zeocin cassette at ac146the ac146-ie1 locus. (A) Diagram showing location of primers used to construct and confirm AcBac ie1KO . Primers 1551 and 1918 were used to amplify the EM7-zeocin cassette and included homologous flanking regions adjacent to both 5’ and 3’ ends of the ac146-ie1 locus. The λ red recombinase method was used to insert the zeocin cassette into the AcMNPV E2 bacmid (bMON14272), in E. coli BW25113/pKD46 cells. Primers 1574 with 1580, 1574 with 1539, 1919 with 1920 and 1574 with 1920 were used to confirm the absence of the ac146-ie1 and the presence of the zeocin cassette. (B) Agarose ac146-ie1KO gel analysis of PCR products from two putative AcBac clones (KO1 and KO3) and wildtype bacmid. Primers 1574 and 1580 were used to detect presence of ac146-ie1 and wildtype bacmid DNA ac146-ie1KO was used as a positive control. (C) Agarose gel analysis of AcBac clone 1 (KO1) PCR products obtained using primer pairs to confirm the recombination cassette. To detect the 5’ end of the zeocin cassette primers 1574 and 520 were used. To detect the 3’ end of the zeocin cassette primers 1919 and 1920 were used. To detect the entire zeocin cassette, primers 1574 and 1920 were used. 73  zeocin polh locus  Tn7R  BV Stock Name vie1p-IE1  genr  ie1p  gfppolh  ie1  polh  ac146  vie1p-IE0  ie1p  ie0  ac146  vie1p-IE0MtoA  ie1p  ie0MtoA  ac146  vgp64p-IE1  gp64p  ie1  ac146  vgp64p-IE0  gp64p  ie0  ac146  vgp64p-IE0MtoA  gp64p  ie0MtoA  ac146  vHAie1p-IE1  ie1p  ie1  ac146HA  vHAie1p-IE0  ie1p  ie0  ac146HA  vHAie1p-IE0MtoA  ie1p  ie0MtoA  ac146  vHAgp64p-IE1  gp64p  ie1  Tn7L  ac146HA  vHAgp64p-IE0  gp64p  ie0  ac146HA  vHAgp64p-IE0MtoA  gp64p  ie0MtoA  ac146HA  MtoA  Figure 6: Construction of AcMNPV bacmid expressing ie1, ie0, or ie0 under control of the ie1 ac146-ie1KO or gp64 promoters. The knockout bacmid AcBac was made from AcMNPV E2 bacmid (bMON14272) and repaired with pFAcT-GFP transfer vectors. pFAcT-GFP vectors contain two R transposition sites (Tn7R and Tn7L), the gentamicin resistance gene (gen ), green fluorescence protein gene (gfp) and polyhedrin gene (polh) all located in the polyhedrin locus (polh locus). The knockout ac146-ie1KO MtoA bacmid AcBac was repaired by transposition to express ie1, ie0 or ie0 under control of the ie1 promoter (white box) or under control of the gp64 promoter (grey box). Included in the repair vectors were ac146 (blue arrow) or ac146HA (blue arrow with red tip). Sf9 cells were transfected with the repaired bacmids in duplicate and budded virus stocks were harvested. The budded virus harvested for each MtoA repaired bacmid were named as follows; vie1p-IE1, vie1p-IE0, vie1p-IE0 , vgp64p-IE1, vgp64p-IE0, MtoA MtoA vgp64p-IE0 , vHAie1p-IE1, vHAie1p-IE0, vHAie1p-IE0 , vHAgp64p-IE1, vHAgp64p-IE0, and vHAgp64pMtoA IE0 . 74  Viral early gene promoters ie0 ie2 p35 orf18 le1 me53 p78 lef4 orf33 gp64 39K pe38 lef3 orf91 lef6 orf79 orf111 orf52 orf76  Viral early gene promoter-cat reporter construct  cat  viral early gene promoter  SV40 polyA  Transactivator plasmids  ie1p  ie1  ie1p  ie0  ie1p  ie0MtoA  gp64p  ie1  gp64p  ie0  gp64p  ie0MtoA  Figure 7: Schematic diagrams of plasmids used in transient transactivation co-transfection assays. The viral early gene promoter plasmids were constructed to have a viral early gene promoter MtoA controlling cat expression. The transactivator plasmids were constructed to have ie0, ie0 and ie1 under control of the ie1 or gp64 promoter. Co-transfections of a viral early gene promoter plasmid and each transactivator plasmid allowed comparison of transactivation the viral early gene promoter by IE0 and IE1 under control of identical promoters. CAT assays were performed to measure the amount of CAT produced, as a way to measure promoter transactivation. Nineteen viral early gene promoter constructs were tested. Baseline level of CAT production was assessed by co-transfection of each viral early gene promoter and pBS+ plasmid.  75  Figure 8: Fluorescence microscopy analysis of transfected Sf9 cells (bacmids under control of ie1 ac146promoter). Sf9 cells were transfected in duplicate with wildtype bacmid, knockout bacmid AcBac ie1KO MtoA , repair bacmids expressing ie0, ie0 or ie1 under control of the ie1 promoter. Cells were observed under fluorescence microscopy at 24 and 48 hpt. Increased GFP spread over time indicated viral replication and BV production in cells transfected with wildtype and all repaired bacmids. The knockout ac146-ie1KO bacmid AcBac did not show any increase in GFP expressing cells, suggesting no BV production.  76  24 hpt  48 hpt  wildtype  AcBacac146-ie1KO  vie1p-IE1  vie1p-IE0  vie1p-IE0MtoA  vHAie1p-IE1  vHAie1p-IE0  vHAie1p-IE0MtoA  77  Figure 9: Fluorescence microscopy analysis of transfected Sf9 cells (bacmids under control of gp64 promoter). Sf9 cells were transfected in duplicate with wildtype bacmid, knockout bacmid ac146-ie1KO MtoA AcBac , repair bacmids expressing ie0, ie0 or ie1 under control of the gp64 promoter. Cells were observed under fluorescence microscopy at 24 and 48 hpt. Increased GFP spread over time indicated viral replication and BV production in cells transfected with wildtype and all repaired bacmids. ac146-ie1KO The knockout bacmid AcBac did not show any increase in GFP expressing cells, suggesting no BV production.  78  24 hpt  48 hpt  wildtype  AcBacac146-ie1KO  vgp64p-IE1  vgp64p-IE0  vgp64p-IE0MtoA  vHAgp64p-IE1  vHAgp64p-IE0  vHAgp64p-IE0MtoA  79  WT  KO IE0 72.6 kDa IE1 66.9 kDa  AC146HA 23 kDa  Figure 10: Western blot of IE0, IE1 and AC146HA expression in bacmid transfected Sf9 cells. At 48 hpt IE0, IE1 and AC146HA protein expression was analyzed for Sf9 cells transfected with wildtype (WT), ac146-ie1KO MtoA AcBac (KO), repair bacmids expressing ie0 , ie0 or ie1 under control of the gp64 promoter or the ie1 promoter. Total cell protein collected at 48 hpt was separated by 10% SDS-PAGE and transferred to membranes. IE0 and IE1 were detected with an anti-IE1 mouse monoclonal primary antibody. AC146HA was detected with an anti-HA mouse monoclonal primary antibody. Bound antibody was immunodetected using Western-Lightening Plus ECL Enhanced Chemiluminescence System (PerkinElmer).  80  WT  6 hpi  IE0 IE1  7 hpi  IE0 IE1  9 hpi  IE0 IE1  11 hpi  IE0 IE1  Figure 11: Western blot of IE0 and IE1 in virus infected Sf9 cells at early times post infection. Sf9 cells were infected at an MOI of 5 with budded virus in quadruplicate with recombinant viruses expressing MtoA MtoA ie1, ie0 or ie0 under control of the ie1 promoter, recombinant virus expressing ie1, ie0 or ie0 under control of the gp64 promoter and wildtype virus (WT). Total cell protein collected at 6, 7, 9, and 11 hpi was separated by 10% SDS-PAGE and transferred to membranes. IE0 and IE1 were detected with an anti-IE1 mouse monoclonal primary antibody. Bound antibody was immunodetected using WesternLightening Plus ECL Enhanced Chemiluminescence System (Perkin-Elmer).  81  hpi 6  vgp64p-IE1  hpi 6  9 12 20 24 36 48 IE1  9  12 20 24 36 48  vie1p-IE1  IE1  vgp64p-IE0  IE1 IE0  vie1p-IE0  IE1 IE0  vgp64p-IE0MtoA  IE0  vie1p-IE0MtoA  IE0  WT  IE1 IE0  Figure 12: Western blot of IE0 and IE1 in virus infected Sf9 cells at representative times post infection. Sf9 cells were infected at an MOI of 5 with budded virus in quadruplicate with viruses MtoA expressing IE0, IE0 and IE1 under control of the gp64 promoter (A) and ie1 promoter (B). Total cell protein collected at 6, 9, 12, 20, 24, 36 and 48 hpi was separated by 10% SDS-PAGE and transferred to membranes. IE0 and IE1 were detected with an anti-IE1 mouse monoclonal primary antibody. Bound antibody was immunodetected using Western-Lightening® Plus ECL Enhanced Chemiluminescence System (Perkin-Elmer).  82  DNA Replication Levels oflevels Normalized Normalized  A.  1.0E+04 1 x 104  viep-IE1 vie1p-IE1 vIE1p-IE0 vie1p-IE0 MtoA MtoA vie1p-IE0 vIE1p-IE0MtoA WT wildtype 1.0E+03 1 x 103  1 x 102 1.0E+02  1.0E+01 1 x 101  1.0E+00 1 x 100 0  3  6  9  12  15  18  21 24 hpi  27  30  33  36  39  18  21  27  30  33  36  39  42  45  48  B. DNA Replication Levels oflevels Normalized Normalized  1 x 104 1.0E+04 vgp64p-IE1 vGP64p-IE1 vgp64p-IE0 vGP64p-IE0 MtoA MtoA vgp64p-IE0 vGP64p-IE0MtoA WT wildtype 1 x 103 1.0E+03  1 x 102 1.0E+02  1 x 101 1.0E+01  1 x 100 1.0E+00 0  3  6  9  12  15  24  42  45  48  hpi  Figure 13: Time course analysis of viral DNA replication in infected Sf9 cells. Sf9 cells were infected MtoA at an MOI of 5 with budded virus in quadruplicate with (A) vie1p-IE1, vie1p-IE0, vie1p-IE0 , and WT (B) MtoA vgp64p-IE1, vgp64p-IE0, vgp64p-IE0 and WT. Cell pellets were collected at 3 hpi, hourly time points between 6 and 18 hpi, as well as 24, 36 and 48 hpi. Viral DNA replication was assessed by qPCR and each data point represents the average of 2 to 4 assays. The level of DNA replication was normalized relative to 3 hpi for each virus and error bars represent standard error. When error bars are not visible they are smaller than the symbol used.  83  A.  Production Levels of BV Normalizednormalized levels  1.0E+04 1 x 104  vIE1p-IE1 vie1p-IE1 vIE1p-IE0 vie1p-IE0 vie1p-IE0MtoA vIE1p-IE0MtoA WT wildtype  1.0E+03 1 x 103  1.0E+02 1 x 102  1.0E+01 1 x 101  1.0E+00 1 x 100 0  1.0E+04 1 x 104  6  9  12  15  18  21 24 hpi  27  30  33  36  39  42  45  48  18  21  27  30  33  36  39  42  45  48  vGP64p-IE1 vgp64p-IE1 vGP64p-IE0 vgp64p-IE0 vgp64p-IE0MtoA vGP64p-IE0MtoA WT wildtype  Normalized Levels of BV Production normalized levels  B.  3  1.0E+03 1 x 103  1 x 102 1.0E+02  1 x 101 1.0E+01  1 x 100 1.0E+00 0  3  6  9  12  15  24  hpi  Figure 14: Viral BV production during time course assays. Sf9 cells were infected at an MOI of 5 with MtoA budded virus in quadruplicate with (A) vie1p-IE1, vie1p-IE0, vie1p-IE0 , and WT (B) vgp64p-IE1, MtoA vgp64p-IE0, vgp64p-IE0 and WT. Supernatants were collected at 3 hpi, hourly time points between 6 and 18 hpi, as well as 24, 36 and 48 hpi. BV production was assessed by qPCR and each data point represents the average of 2 to 4 assays. The level of BV production was normalized relative to 3 hpi for each virus and error bars represent standard error. When error bars are not visible they are smaller than the symbol used.  84  A. 2.50  Level of transactivation Relative Rate  2.00  1.50 IE1 ie1p-IE1 IE0 ie1p-IE0  ie1p-IE0MtoA IE0MtoA reporteralone reporter  1.00  0.50  0.00  Viral early gene promoter-cat constructs  B. 300  Rate (counts per minute)  250  200 IE1 ie1p-IE1  150  ie1p-IE0 IE0 ie1p-IE0MtoA IE0MtoA reporteralone reporter  100  50  0  Viral early gene promoter-cat constructs  Figure 15: Transactivation analysis of AcMNPV early gene promoters by IE0 and IE1 under control of the ie1 promoter. Sf9 cells were co-transfected with 0.5 µg of viral early gene promoter-cat constructs (indicated on the x axis), and 0.5 µg of transactivator plasmids with the ie1 promoter driving expression MtoA ie1 (purple), ie0 (maroon), ie0 (yellow) or reporter alone without a transactivator (blue). (A) represents the levels of transactivation normalized relative to transactivation achieved with IE1. (B) represents the actual rates measured. Co-transfections were performed in duplicate and error bars represent standard error. When error bars are not visible they are too small to be distinguishable on the y axis. 85  A. 12.00  Level of transactivation Relative Rate  10.00  8.00 IE1 gp64p-IE1 IE0 gp64p-IE0  6.00  gp64p-IE0MtoA IE0MtoA reporter reporter alone  4.00  2.00  0.00  Viral early gene promoter-cat constructs  B.  Rate (counts per minute)  200  150  IE1 gp64p-IE1 IE0 gp64p-IE0  100  gp64p-IE0MtoA IE0MtoA reporter reporter alone  50  0  Viral early gene promoter-cat constructs  Figure 16: Transactivation analysis of AcMNPV early gene promoters by IE0 and IE1 under control of the gp64 promoter. Sf9 cells were co-transfected with 0.5 µg of viral early gene promoter-cat constructs (indicated on the x axis), and 0.5 µg of transactivator plasmids with the gp64 promoter driving MtoA expression IE1 (blue), IE0 (red), IE0 (green) or reporter alone without a transactivator (purple. (A) represents the levels of transactivation normalized relative to transactivation achieved with IE1. (B) represents the actual rates measured. Co-transfections were performed in duplicate and error bars represent standard error. When error bars are not visible they are too small to be distinguishable on the y axis. 86  A. IE0 IE1  B. IE0 IE1  MtoA  Figure 17: Western blot of IE0, IE0 and IE1 in transient co-transfected Sf9 cells. Sf9 cells were co-transfected with a viral early gene promoter-cat reporter plasmid and a transactivator plasmid and assayed for CAT activity at 48 hpt. Total protein from remaining samples were separated by 10% SDSPAGE and transferred to membranes. IE0 and IE1 were detected with an anti-IE1 mouse monoclonal primary antibody. Bound antibody was immunodetected using Western-Lightening Plus ECL Enhanced Chemiluminescence System (Perkin-Elmer). The Western blots represent samples with the following MtoA plasmids transfected (A) p35 promoter-cat reporter plasmid and IE0, IE0 , or IE1 under control of the MtoA gp64 promoter (B) orf111 promoter-cat reporter plasmid and IE0, IE0 or IE1 under control of the ie1 promoter.  87  A.  A. 140  Level of transactivation  120 100 80  IE0MtoA IE0MtoA IE0 IE0  60  IE1 IE1  40 20 0 0  1 2 gp64 promoter  B.  3  4  5 ie1 promoter  6  7  Amount of transactivator  100  vGP64p-IE0 gp64p-IE0  90 of transactivation Level of transactivation Level  B.  MtoA vGP64p-IE0MtoA gp64p-IE0  80  gp64p-IE1 vGP64p-IE1  70  60 50 40 30 20 10 0 0  1 2 3 Amount of plasmid transfected (ug)  Figure 18: Preliminary analysis of amount of transactivator plasmid transfected and rate of transactivation. (A) Illustration of a model where transactivators may behave according to the observations seen when present at high and low levels. At low amounts of transactivator (gp64 MtoA MtoA promoter), level of transactivation by IE0 and IE0 increases modestly as the amount of IE0 and IE0 MtoA increases. The level of transactivation achieved with IE0 is higher than IE0 . As amounts IE0 and MtoA IE0 increase (ie1 promoter), the level of transactivation increases until the maximum level of transactivation is eventually reached. However, at low amounts of IE1 (gp64 promoter), the level of transactivation increases slowly. Over a short range of amounts of IE1 transactivator, the level of transactivation by IE1 increases sharply, and at high levels of IE1 (ie1 promoter), maximum transactivation is reached. In this example, maximum transactivation achieved when IE1 is present at MtoA levels less than IE0 and IE0 . (B) Sf9 cells were transfected with varying amounts of transactivator (x axis) and 0.5 µg of 39K promoter-cat reporter plasmid. Cells were collected at 48 hpt and level of transaction was analyzed. Co-transfections were performed in duplicate and error bars represent standard error. 88  References Au, S., Pante, N., 2012. Nuclear transport of baculovirus: revelaing the nuclear pore complex passage. Journal of Structural Biology 177, 90-98. Ayres, M.D., Howard, S.C., Kuzio, J., Lopez-Ferber, M., Possee, R.D., 1994. The complete DNA sequence of Autographa californica nuclear polyhedrovirus. Virology 202, 586-605. Blissard, G.W., Rohrmann, G.F., 1991a. Baculovirus gp64 Gene Expression: Analysis of Sequences Modulating Early Transcription and Transactivation by IE1. Journal of Virology 65(11), 8. Blissard, G.W., Rohrmann, G.F., 1991b. Baculovirus gp64 gene expression: analysis of sequences modulating early transcription and transactivation by IE1. Journal of Virology 65(11), 5820-5827. Braunagel, S.C., Russell, W.K., Rosas-Acosta, G., Russell, D.H., Summers, M.D., 2003. Determination of the protein composition of the occlusion-derived virus of Autographa californica nucleopolyhedrovirus. Proceedings of the National Academy of Sciences 100(17), 9797-9802. Campbell, M.J., 1995. Lipofectin reagents prepared by a simple ethanol injection technique. Biotechniques 18(6), 1027-1032. Carson, D.D., Summers, M.D., Guarino, L.A., 1991. Transient expression of the Autographa californica nuclear polyhedrosis virus immediate-early gene, IE-N, is regulated by three viral elements. Journal of Virology 65(2), 945-951. Chisholm, G.E., Henner, D.J., 1988. Multiple early transcripts and splicing of the Autographa californica nuclear polyhedrosis virus IE-1 gene. Journal of Virology 62(9), 3193-3200. Choi, J., Guarino, L.A., 1995a. The baculovirus transactivator IE1 binds to viral enhancer elements in the absence of insect cell factors. Journal of Virology 69(7), 45484551. Choi, J., Guarino, L.A., 1995b. Expression of the IE1 transactivator of Autographa californica nuclear polyhedrosis virus during viral infection. Virology 209, 99-107. 89  Choi, J., Guarino, L.A., 1995c. A temperature-sensitive IE1 protein of Autographa californica nuclear polyhedrosis virus has altered transactivation and DNA binding activities. Virology 209, 90-98. Clarke, T.E., Clem, R.J., 2003. In vivo induction of apoptosis correlating with reduced infectivity during baculovirus infection. Journal of Virology 77(9), 227-232. Clem, R.J., Fechhiemer, M., Miller, L.K., 1991. Prevention of apoptosis by a baculovirus gene during infection of insect cells. Science 29, 1388-1390. Clem, R.J., Miller, L.K., 1993. Apoptosis reduces both the in vitro replication and the in vivo infectivity of a baculovirus. Journal of Virology 67(7), 3730-3738. Dai, X., Stewart, T.M., J.A., P., Li, Q., Theilmann, D.A., 2004a. Autographa californica multiple nucleopolyhedrovirus exon 0 (orf141), which encodes a RING finger protein, is required for efficient production of budded virus. Journal of Virology 78(18), 9633-9644. Dai, X., Willis, L.G., Huijskens, I., Palli, S., Theilmann, D.A., 2004b. The acidic activation domains of the baculovirus transactivators IE1 and IE0 are functional for transcriptional activation in both insect and mammalian cells. Journal of General Virology 85, 573-582. Datsenko, K.A., Wanner, B.L., 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences 97, 6640-6645. Dickison, V.L., 2010. Deletion and functional analysis of AC146 of the baculovirus Autographa californica multiple nucleopolyhedrovirus, The University of British Columbia (Okanagan). Dickison, V.L., Willis, L.G., Sokal, N.R., Theilmann, D.A., 2012. Deletion of the AcMNPV ac146 eliminates the production of budded virus. Virology 431, 29-39. Dickson, J.A., Friesen, P.D., 1991. Identification of upstream promoter elements mediating early transcription from the 35,000-molecular-weight protein gene of Autographa californica nuclear polyhedrosis virus. Journal of Virology 65(8), 4006-4016.  90  Fang, M., Dai, X., Theilmann, D.A., 2007. Autographa californica multiple nucleopolyhedrovirus EXON0 (ORF141) is required for efficient egress of nucleocapsids from the nucleus. Journal of Virology 81(18), 9859-9869. Fang, M., Nie, Y., Harris, S., Erlandson, M.A., Theilmann, D.A., 2009. Autographa californica multiple nucleopolyhedrovirus core gene ac96 encodes a per os infectivity factor (pif-4). Journal of Virology 83(23), 12569-12578. Fang, M., Nie, Y., Wang, Q., Deng, F., Wang, R., Wang, H., Wang, H., Vlak, J., X., C., Hu, Z., 2006. Open reading frame 132 of Heliocoverpa armigera nucleopolyhedrovirus encodes a functional per os infectivity factor (PIF-2). Journal of General Virology 82, 2563-2569. Faulkner, P., Kuzio, J., Williams, G.V., Wilson, J.A., 1997. Analysis of p74, a PDV envelope protein of Autograha californica nucleopolyhedrovirus required for occlusion body infectivity in vivo. Journal of General Virology 78, 3091-3100. Forsythe, I.J., Shippam, C.E., Willis, L.G., Stewart, S., Grigliatt, T., Theilmann, D.A., 1998. Characterization of the acidic domain of the IE1 regulatory protein from Orgyia pseudotsugata multicapsid nucleopolyhedrovirus. Virology 252, 65-81. Fuchs, L.Y., Woods, M.S., Weaver, R.F., 1983. Viral transcription during Autographa californica nuclear polyhedrosis virus infection: a novel RNA polymerase induced in infected Spodoptera frugiperda cells. Journal of Virology 48(3), 641-646. Goley, E.D., Ohkawa, T., Mancuso, J., Woodruff, J.B., D'Alessio, J.A., Cande, W.Z., Volkman, L.E., Welch, M.D., 2006. Dynamic nuclear actin assembly by Arp2/3 complex and a baculovirus WASP-like protein. Science 314, 464-467. Gross, C.H., Shuman, S., 1998. RNA 5' triphosphatase, nucleoside triphosphatase, and guanylyltransferase activities of baculovirus LEF-4 protein. Journal of Virology 72(12), 10020-10028. Guarino, L.A., Dong, W., 1991. Expression of an enhancer-binding protein in insect cells transfected with Autographa californica nuclear polyhedrosis virus IE1 gene. Journal of Virology 65(7), 3676-3680. Guarino, L.A., Mistretta, T.A., Dong, W., 2002. DNA binding activity of the baculovirus late expression factor PP31. Virus Research 90(1-2), 187-195. 91  Guarino, L.A., Summers, M.D., 1986a. Functional mapping of a trans-activating gene required for expression of a baculovirus delayed-early gene. Journal of Virology 57(2), 563-571. Guarino, L.A., Summers, M.D., 1986b. Interspersed homologous DNA of Autographa californica nuclear polyhedrosis virus enhances delayed-early gene expression. Journal of Virology 60(1), 215-223. Guarino, L.A., Summers, M.D., 1988. Functional mapping of Autographa californica nuclear polyhedrosis virus genes required for late gene expression. Journal of Virology 62(2), 463-471. Hang, X., Dong, W., Guarino, L.A., 1995. The lef-3 gene of Autographa californica nuclear polyhedrosis virus encodes a single-stranded DNA-binding protein. Journal of Virology 69(6), 3924-3928. Hashimoto, Y., Corsaro, B.G., Granados, R.R., 1991. Location and nucleotide sequence of the gene encoding the viral enhancing factor of the Trichoplusia ni granulosis virus. Journal of General Virology 72, 2645-2651. Hawtin, R.E., Zarkowska, T., Thomas, A.K., Gooday, G.W., King, L.A., Kuzio, J.A., Possee, R.D., 1997. Liquefaction of Autographa californica nucleopolyhedrvirus infected insects is dependent on the integrity of virus-encoded chitinase and cathepsin genes. Virology 238(2), 243-253. Hoover, K., Washburn, J.O., Volkman, L.E., 2000. Midgut-based resistance of Heliothis virescens to baculovirus infection meditated by phytochemicals in cotton. Journal of Insect Physiology 46, 999-1007. Huh, N.E., Weaver, R.F., 1990. Identifying the RNA polymerases that synthesize specific transcripts of the Autographa californica nuclear polyhedrosis virus. Journal of General Virology 71, 195-201. Huijskens, I., Li, L., Willis, L.G., Theilmann, D.A., 2004. Role of AcMNPV IE0 in baculovirus very late gene expression. Virology 323, 120-130. Jehle, J.A., Blissard, G.W., Bonning, B.C., Cory, J.S., Herniou, E.A., Rohrmann, G.F., Theilmann, D.A., Thiem, S.M., Vlak, J.M., 2006. On the classification and nomenclature of baculoviruses: a proposal for revision. Archives of Virology. 92  Jin, J., Dong, W., Guarino, L.A., 1998. The LEF-4 subunit of baculovirus RNA polymerase has RNA 5'-triphosphatase and ATPase activities. Journal of Virology 72(12), 10011-10019. Jun-Chuan, Q., Weaver, R.F., 1982. Capping of viral RNA in cultured Spodoptera frugiperda cells infected with Autographa californica nuclear polyhedrosis virus. Journal of Virology 43(1), 234-240. Kaffman, A., O'Shea, E.K., 1999. Regulation of nuclear localization: a key to a door. Annual Review of Cell and Developmental Biology 15, 291-339. Kawasaki, Y., Matsumoto, S., Nagamine, T., 2004. Analysis of baculovirus IE1 in living cells: dynamics and spatial relationships to viral structural proteins. Journal of General Virology 85, 3575-3583. Kikhno, I., Gutierrez, S., Croizier, L., Crozier, G., Ferber, M.L., 2002. Characterization of pif, a gene required for the per os infectivity of Spodoptera littoralis nucleopolyhedrovirus. Journal of General Virology 83, 3013-3022. Kool, M., Ahrens, C.H., Goldbach, R.W., Rohrmann, G.F., Vlak, J.M., 1994a. Identification of genes involved in DNA replication of the Autographa californica baculovirus. Proceedings of the National Academy of Sciences 91, 11212-11216. Kool, M., Ahrens, C.H., Vlak, J.M., Rohrmann, G.F., 1995. Replication of baculovirus DNA. Journal of General Virology 76, 2103-2118. Kool, M., Goldbach, R.W., Vlak, J.M., 1994b. A putative non-hr origin of DNA replication in the HindIII-K fragment of Autographa californica nuclelar polyhedrosis virus. Journal of General Virology 75, 3345-3352. Kool, M., Voeten, J.T.M., Goldbach, R.W., Vlak, L.M., 1994c. Functional mapping of regions of the Autographa californica nuclear polyhedrosis viral genome required for DNA replication. Virology 198, 680-689. Kost, T.A., Condreay, J.P., 2002. Recombinant baculovirus as mammalian cell genedelivery vectors. Trends in Biotechnology 20, 8.  93  Kovacs, G.R., Choi, J., Guarino, L.A., Summers, M.D., 1992. Functional dissection of the Autographa californica nuclear polyhedrosis virus immediate-early 1 transcriptional regulatory protein. Journal of Virology 66(12), 7429-7437. Kovacs, G.R., Guarino, L.A., Summers, M.D., 1991. Novel regulatory properties of the IE1 and IE0 transactivators encoded by the baculovirus Autographa californica multicapsid nuclear polyhedrosis virus. Journal of Virology 65(10), 5281-5288. Krell, P.J., 2008. Baculoviruses: General Features. In: Mahy, B.W.J., M.H.V., v.R. (Eds.), Encyclopedia of Virology, 3rd ed. Vol. 1. Elsevier, New York, pp. 247-254. Kremer, A., Knebel-Morsdorf, D., 1998. The early baculovirus he65 promoter: on the mechanism of transcriptional activation by IE1. Virology 249, 336-351. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227(5259), 680-685. Lee, J.-C., Chen, H.-H., Chao, Y.-C., 1998. Persistent baculovirus infection results from deletion of the apoptotic suppressor gene p35. Journal of Virology 72(11), 9157-9165. Leisy, D.J., Rasmussen, C., Owusu, E.O., Rohrmann, G.F., 1997. A mechanism for negative gene regulation in Autographa californica multinucleocapsid nuclear polyhedrosis virus. Journal of Virology 71(7), 5088-5094. Leisy, D.J., Rohrmann, G.F., 1993. Characterization of the replication of plasmids containing hr sequences in baculovirus-infected Spodoptera frugiperda cells. Virology 196, 9. Lepore, L.S., Roelvink, P.R., Granados, R.R., 1996. Enhancin, the granulosis virus protein that facilitates nucleopolyhedrovirus (NPV) infections, is a metalloprotease. Journal of Invertebrate Pathology 68, 131-140. Li, X., Song, J., Jinag, T., Liang, C., Chen, X., 2007. The N-terminal hydrophobic sequence of Autographa californica nucleopolyhedrovirus PIF-3 is essential for oral infection. Archives of Virology 125, 1851-1858. Lo, H.-R., Chao, Y.-C., 2004. Rapid titer determination of baculovirus by quantitative real-time polymerase chain reaction. Biotechnology Progress 20(1), 354-360. 94  Loeppky, J., Personal Communication: Statistical Analysis 2012. Lu, A., Carstens, E.B., 1993. Immediate early baculovirus genes transactivate the p143 gene promoter of Autographa californica nuclear polyhedrosis virus. Virology 195, 710718. Lu, A., Miller, L.K., 1995. The roles of eighteen baculovirus late expression factor genes in transcription and DNA replication. Journal of Virology 69(2), 975-982. Lu, L., Du, Q., Chejanovsky, N., 2003. Reduced expression of the immediate-early protein IE0 enables efficient replication of Autographa californica nucelopolyhedrovirus in poorly permissive Spodoptera littoralis cells. Journal of Virology 77(1), 535-545. Luckow, V.A., Lee, S.C., Barry, G.F., Olins, P.O., 1993. Efficient generation of infectious recombinant baculoviruses by site-specific transposon-mediated insertion of foreign genes into a baculovirus genome propagated in Escherichia coli. Journal of Virology 67(8), 4566-4579. Luria, N., Lu, L., Chejanovsky, N., 2012. Conserved structural motifs at the C-terminus of baculovirus protein IE0 are important for its functions in transactivation and supporting hr5-mediated DNA replication. Viruses 4, 761-776. Lynn, D.E., 1992. A BASIC computer program for analyzing endpoint assays. Biotechniques 12(6), 880-881. McCarthy, C.B., Theilmann, D.A., 2008. AcMNPV ac143 (odv-e18) is essential for mediating budded virus production and is the 30th baculovirus core gene. Virology 375, 277-291. Mikhailov, V.S., 2003. Replication of the baculovirus genome. Molecular Biology 37(2), 250-259. Milks, M.L., Washburn, J.O., Willis, L.G., Volkman, L.E., Theilmann, D.A., 2003. Deletion of pe38 attentuates AcMNPV genome replication, budded virus production and virulence in Heliothis virescens. Virology 310, 224-234. Miller, L.K., (Ed.) 1997. The baculoviruses. The Viruses. Edited by Wagner, H.F.C.a.R.R. Plenum Press, New York. 95  Morris, T.D., Miller, L.K., 1994. Mutational analysis of a baculovirus major late promoter. Gene 140, 147-153. Nagamine, T., Kawasaki, Y., Iizuka, T., Matsumoto, S., 2005. Focal distribution of baculovirus IE1 triggered by its binding to the hr DNA elements. Journal of Virology 79(1), 39-46. Nagamine, T., Kawasaki, Y., Matsumoto, S., 2006. Induction of a subnuclear structure by the simultaneous expression of baculovirus proteins IE1, LEF3 and P143 in the presence of hr. Virology 352, 400-407. Neumann, J.R., Morency, C.A., Russian, K.O., 1987. A novel rapid assay for chloramphenicol acetyltransferase gene expression. Biotechniques 5(5), 444-447. Nie, Y., 2010. Functional comparison and analysis of protein-protein interactions of Autographa californica multiple nucleopolyhedrovirus transregulatory proteins IE0 and IE1, The University of British Columbia. Nie, Y., Fang, M., Erlandson, M.A., Theilmann, D.A., 2012. Analysis of the Autographa californica multiple nucleopolyhedrovirus overlapping gene pair lef3 and ac68 reveals that AC68 is a per os infectivity factor and that LEF3 is critical, but not essential, for virus replication. Journal of Virology 86(7), 3985-3994. Nie, Y., Fang, M., Theilmann, D.A., 2009. AcMNPV AC16 (DA26, BV/ODV-E26) regulates the levels of IE0 and IE1 and binds to both proteins via a domain located within the acidic transcriptional domain. Virology 385, 484-495. Nissen, M.S., Friesen, P.D., 1989. Molecular analysis of the transcriptional regulatory region of an early baculovirus gene. Journal of Virology 63(2), 492-503. Ohkawa, T., Volkman, L.E., Welch, M.D., 2010. Actin-based motility drives baculovirus transit to the nucleus and cell surface. The Journal of Cell Biology 190(2), 187-195. Okano, K., Mikhailov, V.S., Maeda, S., 1999. Colocalization of baculovirus IE-1 and two DNA binding proteins DBP and LEF-3 to viral replication factories. Journal of Virology 73(1), 110-119. Okano, K., Vanarsdall, A.L., Mikhailov, V.S., Rohrmann, G.F., 2006. Conserved molecular systems of the baculoviridae. Virology 344, 77-87. 96  Olson, V.A., Wetter, J.A., Friesen, P.D., 2001. Oligomerization mediated by a helixloop-helix-like domain of baculovirus IE1 is required for early promoter transactivation. Journal of Virology 75(12), 6042-6051. Olson, V.A., Wetter, J.A., Friesen, P.D., 2002. Baculovirus transregulator IE1 requires a dimeric nuclear localization element for nuclear import and promoter activation. Journal of Virology 76(18), 9505-9515. Olson, V.A., Wetter, J.A., Friesen, P.D., 2003. The higly conserved basic domain I of baculovirus IE1 is required for hr enhancer DNA binding and hr-dependent transactivation Journal of Virology 77(10), 5668-5677. Ooi, B.G., Rankin, C., Miller, L.K., 1989. Downstream sequences augment transcription from the essential initiation site of a baculovirus polyhedrin gene. Journal of Molecular Biology 210, 721-736. Oppenheimer, D.I., Volkman, L.E., 1997. Evidence for rolling circle replication of Autographa californica M nucleopolyhedrovirus genomic DNA. Archives of Virology 142, 7. Passarelli, A.L., Miller, L.K., 1993a. Identification and characterization of lef-1, a baculovirus gene involved in late and very late gene expression. Journal of Virology 67(6), 3481-3488. Passarelli, A.L., Miller, L.K., 1993b. Identification of genes encoding late expression factors located between 56.0 and 65.4 map units of the Autographa californica nuclear polyhedrosis virus genome. Virology 197, 704-714. Passarelli, A.L., Miller, L.K., 1993c. Three baculovirus genes involved in late and very late gene expression: ie-1, ie-n and lef-2. Journal of Virology 67(4), 2149-2158. Pathakamuri, J.A., Theilmann, D.A., 2002. The acidic activation domain of the baculovirus transactivator IE1 contains a virus-specific domain essential for DNA replication. Journal of Virology 76(11), 5598-5604. Pearson, M., Bjornson, R., Pearson, G., Rohrmann, G.F., 1992. The Autographa californica baculovirus genome: evidence for multiple replication origins. Science 257(5075), 1382-1384.  97  Pearson, M., Rohrmann, G.F., 1997. Splicing is required for transactivation by the immediate early gene 1 of the Lymantria dispar multinucleocapsid nuclear polyhedrosis virus. Virology 235(153-165). Peng, K., van Lent, J.W.M., Fang, M., Theilmann, D.A., Erlandson, M.A., Vlak, J., van Oers, M.M., 2012. Characterization of novel components of the baculovirus per os infectivity complex. Journal of Virology 86(9), 4981-4988. Pfeifer, T.A., Hegedus, D.D., Grigliatti, T.A., Theilmann, D.A., 1997. Baculovirus immediate-early promoter-mediated expression of the ZeocinTM resistance gene for use as a dominant selectable marker in dipteran and lepidopteran insect cell lines. Gene 188, 183-190. Piljman, G.P., Pruijssers, A.J.P., Vlak, J.M., 2003. Identification of pif-2, a third conserved baculovirus gene required for per os infection of insects. Journal of General Virology 84, 2041-2049. Prikhod'ko, E.A., Miller, L.K., 1999. The baculovirus PE38 protein augments apoptosis induced by transactivator IE1. Journal of Virology 73(8), 6691-6699. Pullen, S.S., Friesen, P.D., 1995a. The CAGT motif functions as an initiator element during early transcription of the baculovirus transregulator ie-1. Journal of Virology 69(6), 9. Pullen, S.S., Friesen, P.D., 1995b. Early transcription of the ie-1 transregulator gene of Autographa californica nuclear polyhedrosis virus is regulated by DNA sequences within its 5' noncoding leader region. Journal of Virology 69(1), 10. Rankin, C., Ooi, B.G., Miller, L.K., 1988. Eight base pairs encompassing the transcriptional start point are the major determinant for baculovirus polyhedrin gene expression. Gene 70, 39-49. Rapp, J.C., Wilson, J.A., Miller, L.K., 1998. Nineteen baculovirus open reading frames including LEF-12, support late gene expression. Journal of Virology 72(12), 1019710206. Reed, L.J., Muench, H., 1938. A simple method of estimating fifty percent endpoints. The Journal of American Hygiene 27(3), 493-497.  98  Regier, J.L., Shen, F., Triezenberg, S.J., 1993. Pattern of aromatic and hydrophobic amino acids critical for one of two subdomains of the VP16 transcriptional activator. Proceedings of the National Academy of Sciences 90, 883-887. reviewed in Clarke, T.E., Clem, R.J., 2003. Insect defences against virus infection: the role of apoptosis. International Reviews of Immunology 22, 401-424. reviewed in Clem, R.J., 2005. The role of apoptosis in defense against baculovirus infection in insects. Current Topics in Microbiology and Immunology 289, 113-129. reviewed in Hakim, R.S., Baldwin, K., Smagghe, G., 2010. Regulation of midgut growth, development, and metamorphosis. Annual Review of Entomology 55, 593-608. reviewed in Rohrmann, G.F., 2011. Baculovirus molecular biology. NCBI bookshelf. reviewed in Triezenberg, S.J., 1995. Structure and function of transcriptional activation domains. Current Opinions in Genetics and Development 5(2), 190-196. Rodems, S.M., Friesen, P.D., 1993. The hr5 transcriptional enhancer stimulates early expression from the Autographa californica nuclear polyhedrosis virus genome but is not required for virus replication. Journal of Virology 67(10), 5776-5785. Rodems, S.M., Pullen, S.S., Friesen, P.D., 1997. DNA-dependent transregulation by IE1 of Autographa californica nuclear polyhedrosis virus: IE1 domains required for transactivation and DNA binding. Journal of General Virology 71(12), 9270-9277. Ross, L., Gaurino, L.A., 1997. Cyclohexamide inhibition of delayed early gene expression in baculovirus-infected cells. Virology 232, 105-113. Sambrook, J., (Ed.) 2001. Molecular cloning: a laboratory manual. 3rd Edition ed. Cold Spring Harbour Laboratory Press, Cold Spring Harbour. Schultz, K.L., Friesen, P.D., 2009. Baculovirus DNA replication-specific expression factors trigger apoptosis and shutoff of host protein synthesis during infection. Journal of Virology 83(21), 11123-11132.  99  Schultz, K.L., Wetter, J.A., Fiore, D.C., Friesen, P.D., 2009. Transactivator IE1 is required for baculovirus early replication events that trigger apoptosis in permissive and nonpermissive cells. Journal of Virology 83(1), 11. Sharma, R.C., Schimke, R.T., 1996. Preparation of electro-competent E. Coli using salt free growth medium. Biotechniques 20, 44-46. Slack, J.M., Blissard, G.W., 1997. Identification of two indepedent transcriptional activation domains in the Autographa californica multicapsid nuclear polyhedrosis virus IE1 protein. Journal of Virology 71(12), 9579-9587. Smith, G.E., Summers, M.D., Fraser, M.J., 1983. Production of human beta interferon in insect cells infected with a baculovirus expression vector. Molecular and Cellular Biology 3(12), 2156-2165. Sparks, W.O., Harrison, R.L., Bonning, B.C., 2011. Autographa californica multiple nucleopolyhedrovirus ODV-E56 is a per os infectivity factor, but is not essential for binding and fusion of occlusion-derived virus to the host midgut. Virology 409, 69-76. Stewart, T.M., Huijskens, I., Willis, L.G., Theilmann, D.A., 2005. The Autographa californica multiple nucleopolyhedrovirus ie0-ie1 gene complex is essential for wild-type virus replication, but either IE0 or IE1 can support virus growth. Journal of Virology 79(8), 4619-4629. Taggart, D.J., Friesen, P.D., 2009. AcMNPV IE1 DNA-binding and transactivation are required for a productive infection. American Society for Virology Scientific Program and Abstracts 28th Annual Meeting, 230. Taggart, D.J., Mitchell, J.K., Friesen, P.D., 2012. A conserved N-terminal domain mediates required DNA replication activities and phosphorylation of the transcriptional activator IE1 of Autographa calfornica multicapsid nucleopolyhedrovirus, Journal of Virology. Theilmann, D.A., Stewart, S., 1993. Analysis of the Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus trans-activators IE-1 and IE-2 using monoclonal antibodies. Journal of General Virology 74, 1819-1826. Theilmann, D.A., Stewart, S.S., 1991. Identification and characterization of the IE-1 gene of Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus. Virology 180, 17. 100  Theilmann, D.A., Willis, L.G., Bosch, B.J., Forsythe, I.J., Li, Q., 2001. The baculovirus transcriptional transactivator ie0 produces multiple products by internal initiation of translation. Virology 290, 211-223. Todd, J.W., Passarelli, A.L., Miller, L.K., 1995. Eighteen Baculovirus Genes, Including lef-11, p35, 39K and p47 Support Late Gene Expression. Journal of Virology 69(2), 968974. Vanarsdall, A.L., Pearson, M.N., Rohrmann, G.F., 2007. Characterization of baculovirus constructs lacking either the Ac 101, Ac 142 or the Ac 144 open reading frame. Virology 367(187-195). Wang, P., Hammer, D.A., Granados, R.R., 1994. Interaction of Trichoplusia ni granulosis virus-encoded enhancin with the midgut epithelium and peritrophic membrane of four lepidopteran insects. Journal of General Virology 75, 1961-1967. Washburn, J.O., Chan, E.Y., Volkman, L.E., Aumiller, J.J., Jarvis, D.L., 2002. Early Synthesis of Budded Virus Envelope Fusion Protein GP64 Enhances Autographa californica Multicapsid Nucleopolyhedrovirus Virulence in Orally Infected Heliothis virescens. Journal of Virology 77(1), 280-290. Wu, Y., Carstens, E.B., 1996. Initiation of baculovirus DNA replication: early promoter regions can function as infection-dependent replicating sequences in a plasmid-based replication assay. Journal of Virology 70, 6. Yamagishi, J., Burnett, E.D., Harwood, S.H., Blissard, G.W., 2007. The AcMNPV pp31 gene is not essential for productive AcMNPV replication or late gene trascription but appears to increase levels of most viral transcripts. Virology 365, 34-47. Yang, C.L., Stetler, D.A., Weaver, R.F., 1991. Structural comparison of the Autographa californica nuclear polyhedrosis virus-induced RNA polymerase and the three nuclear RNA polymerases from the host, Spodoptera frugiperda. Virus Research 20, 251-264. Zanotto, P.M., Kessing, B.D., Maruniak , J.E., 1993. Phylogenetic Interrelationships Among Baculoviruses: Evolutionary Rates and Host Associations. Journal of Invertebrate Pathology 62, 147-164.  101  Appendix A : Replicated randomized block ANOVA withTukeyHSD The following script was used in R software to analyze transactivation data. #Read in the Data yfull=read.table('filen ame.csv',header=F,sep =',') Block=as.factor(c(rep ('Day1',8),rep('Day2' ,8))) Trt=c('ie1','ieo','ie0 MtoA','reporter') Trt=as.factor(rep(Trt ,4)) y=c(3.6,3.5,12.7,13.5,25,16,53,53,19,16,47,48,2,1,5,4) #For the First Response do y=yfull[,1] Exp1=data.frame(Tr t=Trt,Block=Block,y =y) an1=aov(y~Trt+Bloc k,data=Exp1) summary(an1) TukeyHSD(an1,'Trt') #Second Response is! y=yfull[,2] Exp1=data.frame(Tr t=Trt,Block=Block,y =y) an1=aov(y~Trt+Bloc k,data=Exp1) summary(an1) TukeyHSD(an1,'Trt') y=yfull[,3] Exp1=data.frame(Tr t=Trt,Block=Block,y =y) 102  an1=aov(y~Trt+Bloc k,data=Exp1) summary(an1) TukeyHSD(an1,'Trt') y=yfull[,4] Exp1=data.frame(Tr t=Trt,Block=Block,y =y) an1=aov(y~Trt+Bloc k,data=Exp1) summary(an1) TukeyHSD(an1,'Trt') y=yfull[,5] Exp1=data.frame(Tr t=Trt,Block=Block,y =y) an1=aov(y~Trt+Bloc k,data=Exp1) summary(an1) TukeyHSD(an1,'Trt') y=yfull[,6] Exp1=data.frame(Tr t=Trt,Block=Block,y =y) an1=aov(y~Trt+Bloc k,data=Exp1) summary(an1) TukeyHSD(an1,'Trt') y=yfull[,7] Exp1=data.frame(Tr t=Trt,Block=Block,y =y) an1=aov(y~Trt+Bloc k ,data=Exp1) summary(an1) TukeyHSD(an1,'Trt')  103  y=yfull[,8] Exp1=data.frame(Tr t=Trt,Block=Block,y =y) an1=aov(y~Trt+Bloc k,data=Exp1) summary(an1) TukeyHSD(an1,'Trt') y=yfull[,9] Exp1=data.frame(Tr t=Trt,Block=Block,y =y) an1=aov(y~Trt+Bloc k,data=Exp1) summary(an1) TukeyHSD(an1,'Trt') y=yfull[,10] Exp1=data.frame(Tr t=Trt,Block=Block,y =y) an1=aov(y~Trt+Bloc k,data=Exp1) summary(an1) TukeyHSD(an1,'Trt') y=yfull[,11] Exp1=data.frame(Tr t=Trt,Block=Block,y =y) an1=aov(y~Trt+Bloc k,data=Exp1) summary(an1) TukeyHSD(an1,'Trt') y=yfull[,12] Exp1=data.frame(Tr t=Trt,Block=Block,y =y) an1=aov(y~Trt+Bloc 104  k,data=Exp1) summary(an1) TukeyHSD(an1,'Trt') y=yfull[,13] Exp1=data.frame(Tr t=Trt,Block=Block,y =y) an1=aov(y~Trt+ Block,data=Exp 1) summary(an1) TukeyHSD(an1,' Trt') y=yfull[,14] Exp1=data.frame(Tr t=Trt,Block=Block,y =y) an1=aov(y~Trt+Bloc k,data=Exp1) summary(an1) TukeyHSD(an1,'Trt') y=yfull[,15] Exp1=data.frame(Tr t=Trt,Block=Block,y =y) an1=aov(y~Trt+Bloc k,data=Exp1) summary(an1) TukeyHSD(an1,'Trt') y=yfull[,16] Exp1=data.frame(Tr t=Trt,Block=Block,y =y) an1=aov(y~Trt+Bloc k,data=Exp1) summary(an1) TukeyHSD(an1,'Trt') 105  y=yfull[,17] Exp1=data.frame(Tr t=Trt,Block=Block,y =y) an1=aov(y~Trt+Bloc k,data=Exp1) summary(an1) TukeyHSD(an1,'Trt') y=yfull[,18] Exp1=data.frame(Tr t=Trt,Block=Block,y =y) an1=aov(y~Trt+Bloc k,data=Exp1) summary(an1) TukeyHSD(an1,'Trt') y=yfull[,19] Exp1=data.frame(Tr t=Trt,Block=Block,y =y) an1=aov(y~Trt+Bloc k,data=Exp1) summary(an1) TukeyHSD(an1,'Trt')  106  


Citation Scheme:


Usage Statistics

Country Views Downloads
United States 27 0
China 21 14
Japan 10 0
Germany 3 2
Russia 2 0
Poland 1 0
France 1 0
Canada 1 0
City Views Downloads
Ashburn 20 0
Tokyo 10 0
Unknown 10 2
Beijing 9 0
Hangzhou 4 0
Shenzhen 3 14
Wilmington 2 0
Changsha 2 0
Nanjing 2 0
Fremont 1 0
Kunming 1 0
Belleville 1 0
Saint Petersburg 1 0

{[{ mDataHeader[type] }]} {[{ month[type] }]} {[{ tData[type] }]}
Download Stats



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items