UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Expansion of antigen specific regulatory T cells in an IDO expressing fibroblast co-culture Curran, Terryann 2012

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2012_fall_curran_terryann.pdf [ 1.36MB ]
Metadata
JSON: 24-1.0072807.json
JSON-LD: 24-1.0072807-ld.json
RDF/XML (Pretty): 24-1.0072807-rdf.xml
RDF/JSON: 24-1.0072807-rdf.json
Turtle: 24-1.0072807-turtle.txt
N-Triples: 24-1.0072807-rdf-ntriples.txt
Original Record: 24-1.0072807-source.json
Full Text
24-1.0072807-fulltext.txt
Citation
24-1.0072807.ris

Full Text

i  EXPANSION OF ANTIGEN SPECIFIC REGULATORY T CELLS IN AN IDO EXPRESSING FIBROBLAST CO-CULTURE  by  TERRYANN CURRAN M.B. Bc.H B.A.O, Trinity College Dublin, 2007  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENT FOR THE DEGREE OF MASTER OF SCIENCE   in  THE FACULTY OF GRADUATE STUDIES (Experimental Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)    May 2012  ©Terryann Curran, 2012  ii  Abstract  Cadaver skin grafts are commonly utilised as dermal replacement treatments for large burn injuries when an autologous donor tissue shortage exists. The limitation of this therapy is immune rejection. The adverse side effects of immune suppressive drugs make them unsuitable for this subset of individuals with large surface area burns, who are often clinically unstable. Thus, a gap in treatment exists to prolong survival of these skin grafts. The goal of this Masters research was to address this gap and induce tolerance to specific skin antigens in vitro. We hypothesized that we could expand a specific population of Treg in an allogeneic indoleamine 2,3-dioxygenase (IDO) fibroblast co-culture, on the basis of specific MHC class II expression by the fibroblasts and that the IDO generated micro-environment afford selective survival of regulatory T cells (Treg) over effector T cells.  Three specific aims were accomplished in this study. (1)We first showed that Treg could be expanded in an allogeneic IDO expressing fibroblast co-culture. (2) As a side project to this, we showed that naïve CD4 T cells could be converted to Treg in the same co-culture conditions. (3) In the next phase, the suppressive potential of the expanded and converted Treg populations were confirmed in a CD8 T cell suppression assay. We found that the Treg isolated from the allogeneic IDO expressing fibroblast co-culture, specifically suppressed CD8 proliferation to the allogeneic fibroblast antigens but not third party antigens. In contrast, the Treg from the control group did not suppress CD8 proliferation.  The findings presented in this thesis collectively prove expansion of an antigen specific Treg population and conversion of naïve CD4 T cells to antigen specific Treg, in an allogeneic IDO expressing fibroblast co-culture, in vitro.     iii  Preface This thesis was compiled under the guidance of Dr. Aziz Ghahary who devised the original concept for the research. Chapters 2 and 3 are based on work conducted in the BCPFF Burn and Wound Firefighters Laboratory by Dr. Terry-Ann Curran, Dr. R. Jalili, and Dr. A. Ghahary. Terry-Ann was responsible for isolating the cells used in the co-culture experiments, staining the cells for flow cytometry analysis, isolating the RNA for q-PCR processing and analyzing the data with the assistance of Dr. Jalili. A version of Chapter 2, Dermal Fibroblasts Expressing IDO Can Expand a Suppressive Antigen Specific Treg Population, has been submitted for publication. Terry-Ann conducted and analysed most of the data and wrote the manuscript, with contributions from Dr. R. Jalili. This was critically reviewed by both Dr. R. Jalili and Dr. A. Ghahary. The co-authors on this manuscript are Dr. R. Jalili and Dr. A Ghahary.  A version of Chapter 3, IDO Expression by Dermal Fibroblasts Convert Naïve CD4+CD25- T cells to Antigen Specific Regulatory T cells has been submitted for publication. Terry-Ann designed the experiments with Dr. R Jalili and conducted and analysed the results. Terry-Ann was responsible for the writing of the manuscript which was critically reviewed by Dr. R. Jalili and Dr. A. Ghahary. The co-authors on this manuscript are Dr. R. Jalili and Dr. A Ghahary.  Check the first pages of these chapters to see footnotes for similar information.  The work described in this thesis has been conducted with the approval of the University of British Columbia Biohazards Committee under the certificate number B09-0298. All animal iv  studies have been conducted under the close supervision of the University of British Columbia Animal Care Committee and under the protocol number A10-0147  v  Table of Contents Abstract ............................................................................................................................................ii Preface ........................................................................................................................................... iii Table of Contents ............................................................................................................................. v List of Figures .............................................................................................................................. viii List of Abbreviations ....................................................................................................................... x Acknowledgements........................................................................................................................xii Dedication ..................................................................................................................................... xiv  CHAPTER 1 Introduction, Specific Aims and Research Plan ........................................................ 1 Overview ...................................................................................................................................... 1 Immunology of Graft Rejection and the Role of Regulatory T cells ........................................... 2 The Structure and Role of IDO in Treg expansion ...................................................................... 7 The Proposed Mechanisms of Naïve CD4+CD25- T cell Conversion to Treg by IDO .............. 9 The Expansion of Antigen Specific Treg by IDO Expressing Dermal Fibroblasts ................... 11 Hypothesis, Objectives and Specific Aims ................................................................................ 12 Hypothesis .............................................................................................................................. 12 Objectives ............................................................................................................................... 12 Specific aims .......................................................................................................................... 12 Experimental Research Plan ...................................................................................................... 13  CHAPTER 2 Dermal Fibroblasts Expressing IDO Can Expand a Suppressive Antigen Specific Treg Population ............................................................................................................................. 15 Introduction ................................................................................................................................ 15 Materials and Methods ............................................................................................................... 17 Mice ........................................................................................................................................ 17 Isolation of splenocytes .......................................................................................................... 18 Culture of fibroblasts and co-culture with splenocytes .......................................................... 18 IDO expression induction in B6 mouse fibroblasts and IFN-γ or inhibition with 1-methyl tryptophan............................................................................................................................... 19 Flow cytometry for Regulatory T cell population .................................................................. 19 Quantitative (q)-PCR of mRNA of co-culture cell suspension .............................................. 20 vi  Magnetic Assisted Cell Sorting (MACS) of Regulatory T cells and CD8+ T cells .............. 20 Antigen specific suppression assay ........................................................................................ 21 Statistical analysis .................................................................................................................. 21 Results ........................................................................................................................................ 22 IDO expression and MHC II was confirmed in the co-cultured fibroblasts .......................... 22 The number of Treg cells increased in an IDO expressing fibroblast environment .............. 24 More live CD25+ cells were found in the IDO expressing fibroblast group ......................... 27 CD4 cell proliferation was greatest in the IDO expressing fibroblast co-culture .................. 30 CD4 T cells isolated from the IDO expressing fibroblast environment express more CTLA-4 and m-RNA for IL10 and TGF-β ........................................................................................... 33 Treg cells cultured in the IDO expressing allogeneic fibroblast group show antigen specificity in a mixed lymphocyte reaction assay .................................................................. 37 Discussion .................................................................................................................................. 39  CHAPTER 3 IDO Expression by Dermal Fibroblasts Convert Naïve CD4+CD25- T cells to Antigen Specific Regulatory T cells .............................................................................................. 42 Introduction ................................................................................................................................ 42 Materials and Methods ............................................................................................................... 44 Mice ........................................................................................................................................ 44 Isolation of splenocytes .......................................................................................................... 44 Magnetic Assisted Cell Sorting (MACS) ............................................................................... 45 Fibroblast preparation ............................................................................................................ 45 Cell co-cultures ...................................................................................................................... 46 Proliferation assay .................................................................................................................. 46 Flow cytometry ...................................................................................................................... 46 Live/ dead staining ................................................................................................................. 47 Mixed lymphocyte reaction .................................................................................................... 47 Enzyme Linked Immunosorbent Assay (ELISA) for detection of TGF-β and IL-10 ............ 48 Statistical analysis of data ...................................................................................................... 48 Results ........................................................................................................................................ 49 IDO expressing dermal fibroblasts convert naïve CD4+CD25- T cells into Treg cells ........ 49 Converted Cd4+CD25- cells survive better in the IDO fibroblast co-culture environment  ................................................................................................................................................ 52 vii  CD4+CD25- cells proliferate more in the IDO/ fibroblast co-culture environment .............. 55 A greater number of CTLA-4 positive cells are present in the control co-culture ................. 57 CD4+CD25- T cells co-cultured with IDO expressing fibroblasts produce more TGF-β and IL-10 ....................................................................................................................................... 57 Converted CD4+CD25- cells from the IDO expressing fibroblast co-cultures are suppressive and antigen specific ................................................................................................................ 61 Discussion .................................................................................................................................. 63  CHAPTER 4 Conclusion and Suggestions for Future Work......................................................... 66 General Discussion and Conclusion .......................................................................................... 66 Suggestions for Future Work ..................................................................................................... 68  BIBLIOGRAPHY ......................................................................................................................... 70 viii  List of Figures Figure 1.1. Direct and indirect antigen presentation ....................................................................... 3 Figure 1.2. Important receptors in T-cell activation ....................................................................... 4 Figure 1.3. Kynurenine pathway of L-tryptophan catabolism ........................................................ 8 Figure 1.4. Experimental research plan ........................................................................................ 14 Figure 2.1. Confirmation of C57BL/6 mouse fibroblasts and induction and activity of IDO enzyme ........................................................................................................................................... 23 Figure 2.2. Expansion of CD4CD25Foxp3+ T cells in the IDO co-culture group ....................... 25 Figure 2.3. More dead cells were detected in the IDO group, although more live CD25+ cells were also evident ........................................................................................................................... 28 Figure 2.4. More proliferating cells were seen in the IDO group ................................................. 31 Figure 2.5 A greater number of CTLA-4 positive cells were detected in the IDO group ............ 34 Figure 2.6. The CD4+ cells isolated from the co-culture expressed more TGF-β and IL-10 at the gene level than in the monoculture conditions .............................................................................. 36 Figure 2.7. Treg cells isolated from the IDO group co-culture display antigen specific suppression of CD8 proliferation in a mixed lymphocyte reaction  .............................................. 38 Figure 3.1. CD4+CD25- cells are converted to CD4+CD25+ cells after 7 days of co-culture with allogeneic IDO expressing fibroblasts ........................................................................................... 50 Figure 3.2. Survival of the cell population is greater in the IDO group compared to control due to conversion of CD4+CD25- cells to CD25+ cells ...................................................................... 53 Figure 3.3. Cells proliferate more in the IDO culture compared to that of the control culture .... 56 ix  Figure 3.4. The number of cells expressing CTLA-4 was greater in the control group although the concentration of TGF-β and IL-10 was greater in the IDO group  .......................................... 59 Figure 3.5. Naïve CD4+CD25- cells converted in an IDO expressing fibroblast environment are suppressive and antigen specific .................................................................................................... 62 x  List of Abbreviations  1-MT  1-Methyl-DL-Tryptophan ANOVA Analysis of Variance AP-1   Activator Protein-1 APC  Allophycocyanin APC  Antigen Presenting Cell B6  C57BL/6 mice CD40L  CD40 Ligand c-DNA Complementary DNA CESS  Cultured Engineered Skin Substitute CFSE  Carboxyfluorescein Diacetate Succinimnidyl Ester CIITA  Class II Transactivator Transcription Genes CLIP   Class II Invariant Chain Peptide CTA  Composite Tissue Allografts CTLA-4 Cytotoxic T- Lymphocyte Specific Antigen 4 DAG   Diacylglycerol ddH2O De-ionised Distilled Water DMEM Dulbecco’s Modified Eagle Medium DNA  Deoxyribonucleic Acid EIF2α  Eukaryotic Initiation Factor 2-Alpha ELISA Enzyme-Linked Immunosorbent Assay ERK   Extra-Cellular Signal Regulated Kinase FACS  Fluorescence Activated Cell Sorting FBS  Fetal Bovine Serum Fib  Fibroblasts FITC  Fluorescein Isothiocyanate Foxp3  Forkhead Box P3 FVB  Friend Leukaemia Virus B mice GAPDH Glycerol-3-Phosphate Dehydrogenase GCN-2 General Control Non-derepressible 2 GITR  Glucocorticoid-Inducible Tumour Necrosis Factor Receptor-Related Protein GITRL Glucocorticoid-Inducible Tumour Necrosis Factor Receptor-Related Protein Ligand ICOS   Inducible Co-Stimulatory Molecule IDO  Indoleamine 2,3-Dioxygenase IFN-γ  Interferon-Gamma IL  Interleukin IP3   Inositol Tri-Phosphate ITAMS Immunoreceptor Tyrosine-Based Activation Motif JNK   Jun NH2-Terminal Kinase Li  Invariant Chain MACS Magnetic Assisted Cell Sorting xi  mDC   Myeloid Dendritic Cell MHC  Major Histocompatibility Complex MLR  Mixed Lymphocyte Reaction m-RNA Messenger Ribonucleic Acid NFAT  Nuclear Factor of Activated T Cells NFκB   Nuclear Factor- Kappa B PBS  Phosphate Buffered Saline pDC   Plasmacytoid Dendritic Cell PE  Phycoerythrin PI  Propidium Iodide PIP2   Phosphatidylinositol 4,5-Bisphosphate PKC   Protein kinase C q-PCR Quantitative- Polymerase Chain Reaction RBC  Red Blood Cell RNA  Ribonucleic Acid RPMI  Roswell Park Memorial Institute medium SD  Standard Deviation SPSS  Statistical Package for the Social Sciences TBSA  Total Burn Surface Area TCR  T- Cell Receptor TGF-β Transforming Growth Factor-Beta TLR   Toll-Like Receptors Treg  CD4+CD25+ Regulatory T cell tRNA   Transfer Ribonucleic Acid TTEST Student T-test UV  Ultra-Violet  xii  Acknowledgements   First and foremost, I must express my unending love and admiration for my husband Stephen, who left a good job in Ireland to allow me to pursue my ambitions and advancement in my career. I look forward to the years we will spend together and as a family on the birth of our first child in June.  Next, I would like to express my heartfelt gratitude to my supervisor Dr. Aziz Ghahary for inviting me to work with him in his wonderful laboratory and always being on-hand for advice and guidance. I am eternally grateful of the opportunity to work with you. You and your beautiful wife, Ruhi have welcomed me to Vancouver and into your family. I will never forget your kindness.  I am also deeply appreciative of the members of my Masters advisory committee at the University of British Columbia; Dr Nicholas Carr and Dr. Erin Brown for your good humour and willingness to take time out of your busy schedules to provide fresh ideas and inspiration. I am also indebted to my colleague Dr. Reza Jalili who has been my confidant and sounding board throughout my research. Your unending confidence in my abilities has given me the courage to complete my studies.  My thanks also to my wonderful laboratory colleagues who made it a pleasure to come into work and were always on hand to offer expertise and encouragement; Dr. Ruhangiz Kilani, Dr. Claudia Chavez-Munoz, Dr. Yunyuan Li, Dr. Azadeh Taba, Dr. Layla Nabai, Mr. Ryan Hartwell, Dr. Yun Zhang, Mr. Matthew Carr, Ms. Malihe Meibod and Ms. Sanam Salili.  My friends and colleagues in Ireland who have kept me up to date on all the developments at home, I have missed you. To all the new friendships I have forged in Canada, you have made the transition to life here easy. I hope that you will visit me when I return to Ireland. xiii   I am very grateful to the CIHR Transplant Training Program and WorkSafe BC for recognising the importance of my research and the potential benefits of this research for burn victims in Canada and across the globe. Thank you for your financial assistance.  Finally, I would like to mention my parents and sisters who are my grounding force. Thank you for your love and support.  xiv  Dedication This work is dedicated to: The victims of burn injuries, this research was inspired by you, To my husband, for your support and patience, To my parents and extended family 1  CHAPTER 1 Introduction, Specific Aims and Research Plans   Overview  Burn injuries are the fourth most common trauma experienced world-wide . According to the American Burn Association 450,000 burn injuries required medical care in 2011 and of these 45,000 were admitted to US hospitals 1 . The gold standard of treatment of deep burns is excision and autologous grafting. Excision of the devitalised tissue reduces bacteraemia, endotoxin production and the release of inflammatory mediators, as well as prepares the site for reconstruction with a skin graft 2 . Application of a graft minimises fluid loss, reduces the metabolic demand, and protects the wound from colonisation 3 . When the skin graft requirements of a large burn injury exceed the donor site availability, a widely used treatment alternative is cadaver grafts.  Skin is considered one of the most antigeneic tissues in nature as a result of the abundance of dendritic cells that reside in the dermis and epidermis 4,5 . For this reason, cadaveric skin grafts are rejected and thus only provide temporary wound coverage 6 . Immune suppression, while prescribed to inhibit rejection of Composite Tissue Allografts (CTA) 5,7 , is inappropriate for use in patients with large burn wound injuries. The anti-rejection side effects including organ toxicity and immune system depression make them unsuitable for these individuals due to the large open wounds, heavy bacterial colonization and high incidence of other infections such as ventilator-associated pneumonia and central line infections that are often associated with the large burn injury 8 . As such, a safe, alternative method of inducing immune tolerance to allogeneic cadaver grafts would be highly beneficial. 2   Cultured Engineered Skin Substitutes (CESS) are another form of dermal replacement. Of interest are those CESS populated with cells that express Indoleamine 2,3-Dioxygenase (IDO). These have been shown to suppress the CD3 positive cell infiltration at the site of the CESS engraftment, by 2.5 fold in comparison to skin substitutes without IDO expressing fibroblasts 9 . This is because IDO creates an immune privileged environment where regulatory T cells (Treg) selectively survive over effector cells 10 .  However, viral transduction of the cells to express IDO makes them unsuitable for introduction into clinical practice at this time. As an alternative approach to achieving tolerance to allogenic skin grafts, we developed a Treg cell therapy whereby these cells would suppress specific effector response to dermal fibroblast allo- antigens.   Immunology of Graft Rejection and the Role of Regulatory T cells  On engraftment of allogeneic tissue, Antigen Presenting Cells (APC) from the graft migrate to the local recipient’s lymph nodes and present their MHC via the direct APC pathway, to alloreactive T cells. Additionally, MHC can be shed from the surface of the donor cells. These proteins are engulfed by recipient APC, cleaved into peptides in lysosomes and presented on MHC to the T cells via the indirect pathway (figure 1.1). The recipient T cells are primed by recognition of specific antigen and activation of co-stimulatory molecules on the T-cell, results in clonal expansion. Activated leukocytes activate cytotoxic killer lymphocytes which migrate to the allograft resulting in a cascade of cytotoxicity, phagocytosis, cytokine release and antibody- mediated rejection 11 . Although different immune cells play a role in graft rejection, T 3  lymphocytes are the predominant population mediating acute rejection 12 . For this reason, suppression of effector T cells proliferation is paramount for controlling acute rejection.    Figure 1.1. Direct and indirect antigen presentation. (Adapted from Immunobiology: The immune system in health and disease. Janeway CA, Travers P, Walport M, et al)  CD4 cells are activated by two signals transmitted by the antigen presenting cell. Signal 1 is the recognition of specific antigens presented on MHC II receptors, by the TCR polymorphic binding site 13 . The CD4 receptor on the T cell also binds to the non-polymorphic α-2 chain on the MHC. On induction of the second signal, which involves the interaction of the co-stimulatory molecules, CD28 receptor on the lymphocyte with B7 molecules on the APC, the Immunoreceptor Tyrosine-Based Activation Motifs (ITAMS) on the CD3 and ζ chains on the TCR are phosphorylated by Lck and Fyn. Zap 70 is then able to bind to the phosphorylated sites on the ζ chain (figure 1.2). Phosphatidylinositol 4,5-Bisphosphate (PIP2) in the cell membrane is 4  hydrolysed to Diacylglycerol (DAG) and Inositol Tri-Phosphate (IP3) which results in an increase in cytoplasmic calcium and the formation of calcium-calmodulin complexes. These activate a number of kinases and phosphatases including protein phosphatase IIB or calcineurin. Calcineurin dephosphorylates cytoplasmic Nuclear Factor of Activated T Cells (NFAT), allowing it to translocate to the nucleus where it binds the IL-2 promoter leading to the synthesis of the cytokine IL-2. DAG also activates Protein Kinase C (PKC) which activates Nuclear Factor-Kappa B (NFκB) and phosphorylation of adaptor proteins LAT and SKP-76 leads to downstream activation of activator protein-1 (AP-1) through the RAS-MAP pathway. The second signal activation is essential to avoid an apoptotic or anergic response and activation of the T cell can proceed through signal 2 without a combined signal 1 response. This is one of the methods used to activate T cells in vitro     Figure 1.2. Important receptors in T-cell activation. (Adapted from Immunobiology: The immune system in health and disease. Janeway CA, Travers P, Walport M, et al)  Co-stimulatory molecules are up-regulated on APC through several mechanisms including the binding of antigens through pathogen-associated molecular patterns (PAMP) and 5  Toll-LikeRreceptors, (TLR), interaction of their CD40 receptors with CD40 Ligand (CD40L) on activated T cells and in the presence of cytokines, including IL-12 and IFN-γ. Activation and differentiation of CD4 T cells is also driven by the presence of cytokines released from the endothelial cells, macrophages and activated T cells. For Th1 cell differentiation, IFN-γ and IL-12 are important for induction of T-bet, while IL-4 is important for Th-2 differentiation. Treg cells require the presence of TGF-β, IL-10 and IL-2 in the environment for activation. The α and β chains of the MHC class II are assembled in the endoplasmic reticulum of the cells and associate with the invariant chain (Li) which rests in the cleft to prevent premature binding of peptide to the MHC 13 . The Li is later digested in the MHC II complex by enzymes including cathepsin S. The remaining Class II Invariant Chain Peptide (CLIP) is removed by HLA-DM which facilitates the exchange for a specific protein fragment of exogenous antigen, processed in the endocytic pathway. This complex is then expressed on the surface of the APC for presentation to CD4 T cells. MHC class II are primarily expressed by professional APC including dendritic cells, macrophages and B-cells. Non-professional APC, including fibroblasts are denoted thus as they do not constitutively express MHC. However their expression will be upregulated in the presence of IFN-γ through activation of the Class II Transactivator Transcription Genes (CIITA). The expression of co-stimulatory molecules, while again not expressed on resting fibroblasts, has been shown to be up-regulated in the lamina propria on stimulation with IFN-γ, particularly CD80 14 .  Treg are important in maintaining immune tolerance through the suppression of effector T cells. Low numbers or defective Treg are associated with allergy, auto-immune conditions and 6  graft rejection 15-17 . There are several sub-populations of Treg but the classic population express CD4+CD25+ receptors and Foxp3 nuclear transcription factor. They are either released from the thymus as natural Treg or differentiate from naive CD4 T cells in the periphery 18,19 . The CD4+CD25+ Treg sub-set constitutes only 5-10% of all CD4 cells 16,20 . Isolation of large numbers ex vivo is poor, and thus expansion is required. This has been most frequently achieved through combined T Cell Receptor (TCR) stimulation with anti-CD3/ anti- CD28 beads and IL-2 or by transduction of the Foxp3 gene into naive CD4 memory T cells 21-23 . Tryptophan starvation in the culture environment is yet another method utilised for Treg expansion 24 . The mechanisms of Treg suppression are not fully understood but there is evidence that it can result from cell-cell contact through the Cytotoxic T Lymphocyte Specific Antigen 4 (CTLA-4) or through the release of the suppressive cytokines, IL-10 and TGF-β 25. CTLA-4 inhibits antigen-induced T cell proliferation 26 .This receptor is coded by genes on chromosome 2 and like CD28, with which it shares 20% sequence homology, it binds to B7 molecules. It however, has higher binding affinity than CD28 for B7 molecules. Signalling through the CTLA-4 receptor induces association with the TCR ζ chain complex and utilizes the tyrosine phosphatase SHP-2 to dephosphorylate CD3ζ chain. Thus CTLA-4 activation results in inhibition of IL-2 production, IL-2 receptor expression and cell cycle arrest. This involves interference with the TCR activation of extra-cellular signal regulated kinase (ERK) and Jun NH2-terminal kinase (JNK). Attenuation of AP-1, NFAT and NFκB nuclear transcription activity in activated CD4 T cells results and inhibits the DNA binding of AP-1 and NFAT complexes in the nucleus. IL-10 and TGF-β decrease expression of Major Histocompatibility Complex (MHC) and co-stimulatory molecules, inhibit APC function and decrease the release of inflammatory cytokines 27 . IL-10 elicits tolerance in T cells by selective inhibition of the CD28 co-stimulatory 7  pathway. It does this by inhibiting the phosphorylation of CD28 and consequently the binding of phosphatidylinositol 3-kinase p85 to the CD28 receptor. It thus controls whether a T cell will respond to an immune response or become anergic 28 . The three TGF-β isoforms identified in humans are TGF-β 1, 2 and 3. They share the same receptor and isoform 1 is released from Treg. TGF-β1 has both pro and anti-inflammatory properties; at low levels, the cytokine establishes a chemotactic gradient for monocytes to areas of inflammation and increases adhesion molecule expression in T helper cells. As monocytes and lymphocytes differentiate and change their TGF- β receptor, they become de-activated or suppressed by TGF-β1. Il-35, a recently discovered and not well characterised cytokine, is also release by Treg cells. It induces Treg proliferation and inhibits activity of Th1 and T17 cells 29 .   The Structure and Role of IDO in Treg Expansion Tryptophan is an essential amino acid used for protein amalgamation and synthesis of serotonin, an important neurotransmitter and kynurenine, an intermediate metabolite in its catabolism along the kynurenine pathway. 95% of tryptophan in the body is depleted along this kynurenine pathway 30 (figure 1.3). IDO catalyses the initial step in this pathway, oxidizing L- tryptophan to N-formyl-kynurenine 24,31 . IDO, first discovered in rabbit intestine in 1967, is a 42k DA monomeric protein 32 . Aside from tryptophan, IDO also cleaves the indole ring in 5- hydroxytryptophan, serotonin and melatonin 33 . It is ubiquitiously expressed in a number of cells including trophoblast cells, monocytes, macrophages and dendritic cells 34-36  . 8   Figure 1.3. Kynurenine pathway of L-tryptophan catabolism. In 1998, Munn and Mellor proposed that IDO plays an important role in natural immune- regulation during pregnancy. They demonstrated that inhibition of the enzyme by the tryptophan analogue 1-methyl- DL- tryptophan, resulted in spontaneous abortion in a pregnant animal model 34 . In the IDO micro-environment, the level of tRNA that is uncharged with amino acids increases in cells as a consequence of tryptophan loss and this subsequently activates GCN2. The induction of this pathway alters the translation of various mRNAs in T cells 10 . GCN2 binds the uncharged tRNA and reacts by phosphorylating the serine residue at position 51 of the α-subunit of Eukaryotic Initiation Factor 2-Alpha (EIF2α). Phosphorylation of EIF2α represses protein synthesis by halting the initiation of translation. GCN-2 activation thus drives the  T cells to transition to an anergic state or to apoptose 37 . In contrast, the same conditions lead to activation of suppressive function in Treg, the mechanisms of which will be discussed further in the chapter 37 .Thus, IDO creates an immune-privileged environment where Treg thrive but effector T cells become anergic or die. 9  Incidentally, IDO is also expressed by skin cells, fibroblasts and keratinocytes, when stimulated with the cytokine Interferon- Gamma (IFN-γ) 38. When up-regulated by IFN-γ, IDO contributes to the barrier defence property of skin, against the external environment. The IDO mediated depletion of tryptophan in the immediate environment, leads to potent inhibition of proliferation in gram positive bacteria; staphlococcus aureus, streptococcus suis, group B streptococci and gram negatives; enterococci, Chlamydia and Rickettsia 39-44 . Tryptophan metabolites are also important Ultra-Violet (UV) filters in the eye, with the potential of a similar role in the skin 45 . As a another component of barrier defence, fibroblasts and keratinocytes are also non- professional antigen presenting cells, expressing MHC class II 38,46 . This allows fibroblasts to present antigens to CD4 T cells to initiate an immune response.  Treg cells can thus be activated and induced to proliferate by fibroblasts. As mentioned previously, CD4 T cells are activated by interaction with specific antigens, therefore allogeneic fibroblasts expressing MHC II may activate a specific population of Treg. These Treg may then be isolated to confer immune tolerance to the fibroblast cells. Co-culturing of fibroblasts and T cells in an IDO micro- environment may further encourage the selective activation and expansion of Treg instead of CD4CD25- T cells.   The Proposed Mechanisms of Naïve CD4+CD25- T cell Conversion to Treg by IDO  IDO has a role in the peripheral generation of regulatory T cells, under physiological and pathological conditions 47 .Naïve CD4+CD25- T cells can undergo induction of the Foxp3 gene and thus can be converted to the CD25+ Treg phenotype by activation of the GCN2 kinase 10  pathway in the presence of TGF-β and in a low-tryptophan- high kynurenine micro-environment. In this conversion a gradual decrease in IL-2 production and upregulation of IL-10 and TGF-β is evident 48 .Initiation of this starvation response program is protective to the cell for self- structures. Another mechanism that has been implicated in conversion of naïve CD4+CD25- T cells to Treg is the inhibition of the mammalian target of Rapamycin (mTOR) pathway. The inhibition induces de novo expression of Foxp3 in synergism with TGF-β 49. Recently, a mechanism has been identified that links maturing Plasmacytoid Dendritic Cells (pDC) to the generation of IL-10 producing regulatory T cells, through activation independent up-regulation of inducible costimulator (ICOS) ligand (ICOS-L). The addition of ICOS-L stimulation alone generates T cells producing high levels of IL-10 but not IL-4, whereas the addition of CD28 co-stimulation generates T cells producing substantial levels of IL-4 but not IL-10 50 . Immature Myeloid Dendritic Cells (mDC) have also been shown to have the ability to prime naïve T cells to differentiate into IL-10 producing Treg through a TLR-independent mechanism mediated by CD40 signalling. This results in activation of NF-κB to induce IDO expression under environmental conditions. In pDC, reverse signalling through Glucocorticoid- Inducible Tumour Necrosis Factor Receptor-Related Protein (GITR) Ligand (GITRL) also activates non-canonical NF-κB signalling and IDO expression 51. The mechanism of IDO induced survival of Treg in the micro-environment may be as a result of activation of the Pim kinase pathway. Pim directly phosphorylates and inactivates the pro-apoptotic Bcl-2 protein Bad. Additionally, phosphorylation of Cot, results in the proteasomal degradation of IκB, the activation of NF-κB, and the transcription of an array of antiapoptotic genes. Pim can also maintain cell survival through the phosphorylation of GSK3B, a regulator of cellular glucose metabolism 52 . 11  The Expansion of Antigen Specific Treg by IDO expressing Dermal Fibroblasts   As described in the previous sections, fibroblasts can activate and expand Treg 46 . It is possible that like dendritic cells, allogeneic fibroblasts may also have the potential to expand a specific population of Treg 53 . These Treg can then be used to induce tolerance to an allograft. Our research group has already shown that fibroblasts expressing IDO through gene transduction, offer immune protection in a skin substitute model 9 . We also demonstrated that this immune protection could be extended to protect islet allografts encased in a fibroblast populated matrix 54 .  However, both of these models utilize viral transduction of fibroblasts to express IDO. Given the potential of dendritic cells to expand a population of antigen specific Treg through MHC II expression in the presence of IDO, we hypothesized that IDO expressing fibroblasts could be used to develop a Treg cell therapy to prevent the rejection of allogenic skin grafts. No virally transduced cells would be used for induction of IDO, instead IFN-γ, a natural inflammatory cytokine, would be employed. At present, the adverse side effects of immunosuppressive drugs in transplantation pose a major concern for transplant recipients, physicians and care providers. Taking skin transplantation as a model and evolving from the research already completed in our laboratory on the property of IDO in prevention of allograft rejection, we present this thesis on a potential alternative to the use of virally engineered cells and the use of dendritic cells for antigen specific Treg expansion.    12   Hypothesis, Objective and Specific Aims  Hypothesis  Allogeneic fibroblasts induced to express Indoleamine 2,3-Dioxygenase, through stimulation with IFN-γ, will expand an antigen specific population of regulatory T cells, which will prevent rejection of an allogeneic skin graft.  Objective  Expansion of an antigen specific Treg population in an allogeneic IDO expressing fibroblast co-culture that would specifically suppress CD8 proliferation to the fibroblast antigens and conversion of naïve CD4 T cells to antigen specific Treg in the same co-culture conditions. These objectives will be addressed through following specific aims.  Specific aims  Specific aim 1: To expand an allogeneic Treg population in an IDO expressing fibroblast co-culture in vitro.  Specific aim 2: To convert naïve CD4 T cells to Treg in an IDO expressing fibroblast environment in vitro. 13   Specific aim 3: To evaluate suppressive functioning and antigen specificity of the expanded and the naïve CD4 converted Treg populations in vitro.  Experimental Research Plan  A detailed description of animals, materials and methods used in this study is provided in the Materials and Methods sections of the following chapters. A brief overview is presented here (Fig 1.4).  Fibroblasts were isolated from C57BL/6 mouse skin and passages 3-7 used in this study. Spleens were extracted from BALB/c mice and the splenocytes isolated. To address Specific Aim 1, in vitro expansion of Treg and conversion of CD4CD25- cells to Treg was evaluated by co-culture of the fibroblasts with T cells or naïve CD4 T cells, as described in chapters 2 and 3.  Suppressive functioning of the expanded Treg population was evaluated through determination of the concentration of Treg suppressive cytokines, TGF-β and IL-10 and through detection of the CTLA-4 surface receptor, all of which have been shown to be important in Treg mediated suppression. To address the Specific Aim 3, antigen specificity was confirmed using a CD8 proliferation assay, as described in detail in chapters 2 and 3. 14   Figure 1.4. Experimental research plan. C57BL/6 mouse fibroblasts (Fib.) and BALB/c mouse splenocytes were isolated and co-cultured. The splenocytes were removed after 72 hours and expansion of regulatory T cells (Treg) determined (Specific aim 1). Naïve CD4 T cells were isolated from BALB/c mice and co-cultured with IDO expressing C57BL/6 fibroblasts (Fib). Transdifferentiation of the naïve CD4 cells to Treg was assessed (Specific aim 2). The Treg were isolated from the population and an antigen specific suppression assay performed with C57BL/6 and FVB stimulator cells to determine antigen specificity of the Treg (Specific aim 3). 15  CHAPTER 2 Dermal Fibroblasts Expressing IDO Can Expand A Suppressive Antigen Specific Treg Population 1  Introduction The National Institute of Health estimates that 5-8% of Americans are affected by autoimmune diseases (niaid.nih.gov 2011). Deficiency in or defective regulatory T cells (Treg) are a known contributing factor to development of autoimmune conditions, allergy and in allograft rejection 15,16,55  . Treg are the immune system’s tolerance cells. They have been shown to have enhanced suppressive function in Indoleamine 2,3-Dioxygenase (IDO) generated micro- environments 56 . IDO, a 42 kDA monomeric protein, is expressed intra-cellularly in dendritic cells, monocytes and macrophages 53 . IDO has a high affinity for L-tryptophan (Km ~ 0.02 mM) and rapidly metabolizes tryptophan into kynurenine metabolites 10,31 , resulting in a local tissue microenvironment deficient in this essential amino acid 57 . The depletion of this essential amino acid leads to potent inhibition of proliferation in parasites and bacteria 39,41,43,58 , in addition to the previously noted inhibition of T cells. IDO is also expressed by fibroblasts during wound healing, particularly during the early stages in the inflammatory phase. Once at the wound site, immune cells are stimulated to release inflammatory cytokines into the wound healing mileau, including Interferon-Gamma (IFN-γ). This in turn stimulates the synthesis of IDO in both the immune cells and fibroblasts 59 . In 1998 Munn and Mellor showed that IDO is also important in immune regulation and generation of immune privilege in pregnancy 34 . Inhibition of IDO expression in trophoblast cells  _________________________________________ 1 A version of this chapter has been submitted for publication.  16  of the placenta using 1-methyl tryptophan, resulted in spontaneous abortion in a murine model. Following this initial discovery, it has become clear that tryptophan deficiency induces T cells to transition to anergy, apoptosis or to transdifferentiate into regulatory T cells (Treg) 53,56,60 . The mechanism for this appears to be through activation of the general control non-derepressible 2 stress-pathway (GCN-2) 10 . Activation of this pathway in Treg, on the other hand, enhances suppressive functioning of these cells. Treg suppress effector responses to specific antigens. There are several different sub-populations of regulatory T cells but the classic Treg express the receptors CD4 CD25 on their surface and Foxp3 intra-cellularly. They are a subset of CD4 or helper T cells and constitute 5-10% of all CD4+ T cells in humans 16,20 . Antigen presenting cells express specific antigen on Major Histocompatability Complex class II (MHC II) to activate CD4+ cells to proliferate. Activation and expansion of Treg is currently an active area of investigation as a potential suppressive therapy in allo-transplantation 61,62 . Their use would abrogate the need for immunosuppressive drugs which are organotoxic in the long term and generalised depressants of the immune system. The specific nature of Treg to specific antigens avoids generalised immune suppression. It is also possible that on adoptive transfer, the antigen specific Treg will concentrate locally at the site of the allo-graft 46,63 . Success in expansion has been achieved through combined T Cell Receptor (TCR) stimulation with anti-CD3/anti-CD28 beads and high dose IL-2 or through transduction of the Foxp3 gene 21-23 . These methods however do not result in a specific Treg population. An alternative to polyclonal expansion is to use dendritic cells expressing IDO to expand a Treg population that are specific to the dendritic cell antigens 53,64 . The disadvantage is that dendritic cells are cumbersome to isolate and difficult to maintain in culture. 17  Fibroblasts play an important role in immune protection, particularly as first line defence in the skin to the external environment. Dermal fibroblasts are easily isolated from a skin biopsy and survive well in culture over several passages. Moreover, they are non-professional Antigen Presenting Cells (APC) that express MHC II 46 . Thus, fibroblasts can activate and induce proliferation in a population of specific complimentary CD4+ T cells 46 . IDO expressing fibroblasts will allow selective survival of Treg over effector cells in a co-culture system 38,65 . The survival of fibroblasts is not affected in this environment 66 . It has not been demonstrated whether fibroblasts, emulating dendritic cells, can expand a specific suppressive Treg population. Thus, we hypothesized that a population of functionally suppressive, antigen specific Treg could be expanded through activation by allogeneic fibroblasts in an IDO micro- environment. In this study we show that allogeneic fibroblasts pre-treated with IFN- γ to induce IDO and MHC class II expression expand a Treg population that are functionally suppressive and antigen specific.  Materials and Methods Mice Male BALB/c mice, Friend Leukaemia Virus B (FVB) mice and C57BL/6 mice were purchased from Charles River Laboratories (Wilmington, MA). Mice were housed in ventilated cages in sets of 4 with enrichment, as per ethical recommendations of the province and institution. All experiments were carried out according to standard operating procedures approved by the UBC animal ethics committee and by recipients holding full animal husbandry certification.  18  Isolation of splenocytes One Spleen per each 6-well plate was harvested from male BALB/c mice under sterile conditions. The spleen was gently pressed through a 40µl nylon cell strainer (VWR International, LCC, BD Falcon) with a 3ml syringe plunger (BD bioscience, BD syringe) and rinsed through with 30ml of medium RPMI (Thermo Scientific) enriched with 10% fetal bovine serum (FBS) and 1% anti-mycotic antibiotic (100µg/ml penicillin, 100µg/ml streptomycin, and 0.25µg/ml amphotericin B) (GIBCO). The cells were centrifuged at 1800g for 5 minutes and the supernatant removed. The pellet was resuspended in 5ml per spleen of RBC lysis buffer (ebioscience) for 5minutes. PBS was then added to the suspension and it was centrifuged for 1800g for 5minutes. The cells were resuspended in RMPI enriched medium and sieved again through a 40µl nylon sieve. Each spleen typically yielded 30 to 50 million splenocytes. Splenocytes from B6 and Friend Leukemia Virus B (FVB) mice were also isolated and stored in the N2-tank for use as APC in the mixed lymphocyte reaction.  Culture of fibroblasts and co-culture with splenocytes Skin, from the dorsum of B6 mice, was harvested under sterile conditions. It was washed six times in PBS and 1% anti-mycotic antibiotic before dissection into smaller pieces. The tissue was placed in a 15ml conical plate and a drop of 100% FBS was added to each segment for 3 mins and placed the incubator at 3  C. 1 ml of high glucose DMEM (thermo Scientific) medium enriched with 10% FBS and 1% anti-mycotic antibiotic was then added. The cells were allowed to grow to confluence in the plate before removal of the skin fragments and passaging. Passages 3 to 7 were used for this study. The fibroblasts were grown to confluence in 6-well plates in DMEM. During co-culture the medium used was a 50:50 mix of enriched RMPI and DMEM. 6 million splenocytes were added to each well.  19  IDO expression induction in B6 mouse fibroblasts with IFN- γ or inhibition with 1-methyl- tryptophan On determination of confluence of the B6 fibroblasts in the 6-well plates 1000units/ ml of IFN- γ was added to the DMEM medium in the IFN-γ treatment group. Control cells were not exposed to an IFN- γ. The cells were incubated for 18 hours after which time the medium was removed and the wells in both groups washed twice with warmed PBS before co-culture. 1- Methyl-DL-Tryptophan 97% (1-MT) (Sigma-Aldrich) was added at a concentration of 800 µl/ ml from a 20mM stock solution to wells that had been incubated with IFN-γ for 18 hours. Expression of IDO in fibroblasts was confirmed by PCR of cDNA product and by measuring the concentration of the tryptophan metabolite, kynurenine in the conditioned media against a standard curve with a defined kynurenine concentration (0-50µg/ml) as described in previous publications 54 .  Flow Cytometry for Regulatory T cell population The suspension of BALB/c splenocytes was collected 72 hours after co-culture. The cells were centrifuged at 1200g for 5 minutes and washed once in warmed PBS before re-suspension at a concentration of 2 x 10 7 /ml of cells in flow cytometry buffer (ebioscience). The Mouse regulatory T cell staining kit from ebioscience was used to stain for Treg. The following monoclonal antibodies were used; isotype control, CD4-FITC, CD25-APC and FOXP3-PE FJK16 as per manufacturer’s instructions. We additionally purchased CTLA-4-APC and Propidium Iodide (PI) from ebioscience. Briefly, in a 2   l cell suspension of flow buffer, 1 l 1   l of CD -FITC and CD25-APC or CTLA- -APC or PI were incubated at   C for 1 hour and subsequently washed twice with FACS buffer. The cells were then permeabilised with 1:3 permeabilisation buffer: ddH2O for an hour and after washing twice were incubated with 2µl/100µl of Foxp3-PE at room temp for 1 hour. After washing twice, the cells were 20  resuspended in 200µl of FACS buffer. Flow cytometry was performed on a FACScalibur and analyse of data was conducted with FSC Express V3. All or up to 50,000 events were recorded in each sample.  Quantitative (q)-PCR of mRNA of co-culture cell suspension The BALB/c splenocyte suspension was collected after 72 hours of co-culture and the cells sorted into a CD4+ population using Negative selection Mouse CD4+ T cell pre-enrichment kit (Stemcell Technologies). The B6 fibroblasts from the co-culture were washed with warm PBS and trypsinized from the 6-well plates. Total RNA was isolated from the CD4+ cells and fibroblasts using RNeasy Mini Kit (Qiagen, Mississauga, ON) according to manufacturer’s instructions.  An equivalent amount of total RNA from each sample was synthesized into cDNA using Superscript first-strand cDNA synthesis kit (Invitrogen) as per Invitrogen instructions. q- PCR was used to detect mRNA for IL-10 and TGF-β in the CD  cells; IL-10 sense: GGTTGCCAAGCCTTATCGGA, anti-sense: ACCTGCTCCACTGCCTTGCT and  mTGF- sense: GCACGGGACACAGCAATGGGGG, anti-sense: GCGTGCTAATGGTGGACCGCA. q-PCR was used to calculate the mRNA present for IDO and the MHC-class II surface receptor H-2Kb primers in the fibroblasts after 72 hours of co-culture; mIDO sense: AAGGGCTTCTTCCTCGTCTC , anti-sense: AAAAACGTGTCTGGGTCCAC and mH-2Kb sense: CCACGCAGCCCGCAGAACT, anti-sense: TAGTGTGAGAGCCGCCCTTGC. All primers were purchased from Invitrogen. Sense and antisense primers for GAPDH were used as housekeeping genes for internal controls.  Magnetic Assisted Cell Sorting (MACS) of Regulatory T cells and CD8+ T cells The BALB/c splenocyte suspension was collected after 72 hours of co-culture and Tregs isolated from the population using CD4+ CD25+ Easysep Mouse Regulatory T cells selection kit 21  (STEMCELL Technologies) as per manufacturer’s instructions. CD8+ T cells were isolated from unstimulated and non-co-cultured BALB/c splenocyte populations using Easysep CD8 positive selection kit as per manufacturer’s instructions.  Antigen specific suppression assay CD8+ T cells were isolated from BALB/c mouse spleens using MACS separation as above. They were then resuspended in PBS and 5% FBS at a concentration of 1 x 10 6  cells/ ml and added to a 15ml clean falcon tube which was placed horizontally. 1.1µl / 1ml of cell suspension of a 5mM stock solution of Carboxyfluorescein Diacetate Succinimnidyl Ester (CFSE) (Invitrogen, Eugene, OR) was activated in 110 µl of PBS (per ml of cell suspension) and mixed immediately with the cells. The tube was covered in foil and the CFSE-cell mix incubated in the dark for 5 minutes. 10ml of PBS and 5% FBS was added to stop the reaction and the mix centrifuged at 1800g for 5 minutes. Cells were washed twice in PBS and 5% FBS and then re- suspended in enriched RPMI and  . 5% β-mercapto-ethanol (Fisher). The sorted BALB/c Treg cells from each sample were counted and suspended in enriched RPMI and  . 5% β-mercaptoethanol before plating in a 96-well plate. BALB/c CD8+ T cells and either B6 or FVB mouse APCs were added to each sample at a ratio Treg: CD8+: APC of 1:2:2 in RPMI medium  . 5% β-mercapto-ethanol. Flow cytometry was used to detect the concentration of CFSE in the CD8+ cells.  Statistical analysis All data are reported as mean ± SD of three or more independent observations. Statistical significance was calculated using SPSS 20.0 and ANOVA for more than 2 independent variables or TTEST when only 2 variables were present. P values less than 0.05 were considered to be significant. 22   Results IDO expression and MHC II was confirmed in the co-cultured fibroblasts BALB/c cells express MHC complex H-2Kd whereas B6 express H-2Kb complex, thus an allogeneic co-culture was created. BALB/c splenocytes were co-cultured with B6 fibroblasts that had either been stimulated with IFN- γ or nothing (control group). The fibroblasts were trypsinized from the co-culture plates after the 3 days of culture or 4 days after IFN-γ treatment, and the RNA isolated. The B6 fibroblasts were confirmed by detection of the mRNA H-2Kb, which was greater in the IDO group compared to the control 4 days after stimulation (12.36 ± 2.40 fold increase vs 1.79 ± 1.58 fold increase in the control, p < 0.05, figure 2.1A, the baseline used was c-DNA isolated from confluent B6 fibroblast monocultures for 3 days in 50:50, RMPI:DMEM). Previous experiments have shown that stimulation of fibroblasts with IFN- γ upregulates expression of the MHC class II complex 38 . IDO expression at the gene level was determined compared to a 3 day monoculture of B6 fibroblasts and as expected the fold increase was greater in the IDO group, 37.47 ± 0.94 fold increase compared to 15.49 ± 1.32 fold increase in the control (p < 0.005, figure 2.1B, baseline used was B6 fibroblast monoculture). A higher concentration of kynurenine was present in the culture medium collected from the IDO group 1 .35 ± 1. 5 μg ml compared to the control culture medium,  .25 ±  .1 5 μg ml confirming activity of the IDO gene (p value< 0.001, figure 2.1C). 23     Figure 2.1. Confirmation of C57BL/6 mouse fibroblasts and induction and activity of IDO enzyme.  A. The fold increase for the MHC II, H-2kB in the B6 fibroblasts was compared in the control and IDO group fibroblasts trypsinzied from the co-culture plates after day 3. A monoculture of B6 fibroblasts was used as a baseline comparison (n = 3). B. The fold increase for the expression of the IDO gene depicted in a bar chart. c-DNA isolated from a B6 fibroblast monoculture was used as baseline comparison (n=3). C. The concentration of kynurenine in the conditioned medium on day 3 of the co-culture. Conditioned medium from the B6 fibroblast monoculture was used as control. (n= 5, * = p< 0.05, ** = p< 0.01, *** = p< 0.001, C57BL/6 fibroblasts and BALB/c splenocytes).  24  The number of Treg cells increased in an IDO expressing fibroblast environment After 3 days of co-culture in either the IFN-γ, IFN-γ-1-MT (IDO inhibitor) or control environments the splenocytes were isolated and stained with anti-CD4, anti-CD25 and anti- Foxp3, to determine expansion of the Treg population. Gating on CD4+ cells showed that there was a higher percentage of CD4 positive cells, 30.91% ± 1.93 in the control group, with 24.03% ± 1.85 in the IDO group, 23.83% ± 1.56 in the 1-MT culture and 17.14% ± 4.33 in the splenocyte monoculture (monoculture and control p< 0.01, the other results were not significant, figure 2.2A). On inspection of the count in each group however, it was evident that there was significantly more CD4+ cells in the control and IDO groups, 105238 ± 9770 and 95439 ± 9879 respectively compared to the monoculture, 481 ± 172 and 1-MT cultures, 21202 ± 1417 (all p< 0.05 except control and IDO, p> 0.05, figure 2.2B). A ratio of 6.56% ± 0.66 CD4 Foxp3+ cells was detected in the IDO group vs 4.89% ± 0.33 in the control group, 2.99% ± 0.34 in the 1-MT group and 3.98% ± 0.94 in the splenocyte monoculture (all p< 0.05 except monoculture and control and monoculture and 1-MT, figure 2.2C). Again, on determination of the count of cells we found that 35482 ± 2729 cells expressed both CD4 and Foxp3 in the IDO group compared to 21318 ± 1498 in the control group, 5185 ± 606 in the 1-MT group and 251 ± 59 in the splenocyte monoculture (p< 0.05, gated on CD4+ cells, figure 2.2D). 25   26  Figure 2.2. Expansion of CD4CD25Foxp3+ T cells in the IDO co-culture group. Flow cytometry was used to detect CD4+CD25+ cells. A. A histogram showing the ratio of CD4 positive cells in the BALB/s splenocyte monoculture, control, IDO and 1-MT groups after 3 days in the co-culture or monoculture environment (gated on CD4+ cells). B A count of the CD4 positive cells in each group (n= 3, p< 0.05). C A dot plot showing double staining of the BALB/c splenocytes with anti-Foxp3-PE and anti-CD4-FITC. The cells were gated on CD4+ cells. D. A bar chart representing the total number of CD4+Foxp3+ cells in each culture (n=3, *** = p< 0.001, C57BL/6 fibroblasts and BALB/c splenocytes).                      27  More live CD25+ cells were found in the IDO expressing fibroblast group Previous studies have shown that the IDO microenvironment results in apoptosis in effector cells 67 . To assess for dead cells in the splenocyte population after co-culture we stained the cells for propidium iodide (PI). After 3 days of co-culture 84.76% ± 1.87 cells were dead in the IDO group compared to 30.5% ± 0.41 in the control group and 21.56% ± 0.79 in the 1-MT treated culture (p< 0.001, Figure 2.3A and B). Interestingly, gating on CD4+ cells we found that there were a greater number of live CD25+ cells in the IDO group, 44371 ± 2108 compared to 30189 ± 3672 in the control group and 9483 ± 908 in the 1-MT culture (p< 0.01, figure 2.3C and D). 28    29  Figure 2.3. More dead cells were detected in the IDO group, although more live CD25+ cells were also evident. Live/ dead staining with propidium iodide (PI) and analysis using flow cytometry. A. The ratio is dead cells in each population is expressed as a histogram (PI positive cells, cells not gated). B. A bar chart depicting the percentage of dead cells in each environment (n=3, p< 0.05). C. A dot plot showing double staining for anti-CD25-APC and PI for each group (gated on CD4 positive cells). D. A total count of the numbers of the numbers of live CD25+ cells from each culture, represented in a bar chart. (n=3, ** = p< 0.01, *** = p< 0.001, C57BL/6 fibroblasts and BALB/c splenocytes). 30  CD4 cell proliferation was greatest in the IDO expressing fibroblast co-culture To determine the proliferation of the CD4+ cell population the splenocytes were sorted into CD4+ cells and stained with CFSE before co-culturing. The cell suspension was collected after 72 hours and stained for CD25 before flow cytometry analysis. A greater percentage of the CD4 positive cells were found to proliferate in the co-culture systems with slightly more proliferation in the control group, 69.08% ± 7.14 than in the IDO group 61.08% ± 5.8 compared to the CD 4 T cell monoculture 36.02% ± 6.02 (gated on viable cells, monoculture p< 0.01, control and IDO not significant, figure 2.4A and B). Upon gating on CD25+ cells we found a significant proliferation of the CD25 cells in the IDO group, 24.68% ± 1.02 compared to 8.10% ± 0.34 in the control group and 2.9% ± 0.35 in the splenocyte monoculture (p< 0.001, figure 2.4C and D). 31    32  Figure 2.4. More proliferating CD25+ cells were seen in the IDO group. BALB/c cells were sorted to CD4+ cells and stained with CFSE before co-culture to assess proliferation in the splenocyte population. After 3 days in co-culture, the splenocytes were isolated and stained with anti-CD25-APC. A. A histogram depicting the ratio of proliferated and non-proliferated CD4+ cells in the population. Non-proliferating cells are marked on the left in each chart with proliferating cells marked on the right (gated on viable cells). B. A bar chart showing the percentage of proliferated CD4 cells (gated on viable cells, n= 3, p< 0.05) C. A histogram showing the ratio of CD25+ cells proliferating in each group (cells gated on CD25+ cells). D. The percentage of CD25+ proliferating cells in each group represented in a bar chart. (n=3, ** = p< 0.01, *** = p< 0.001, C57BL/6 fibroblasts and BALB/c splenocytes). 33  CD4 T cells isolated from the IDO expressing fibroblast environment express more CTLA- 4 and m-RNA for IL-10 and TGF-β The exact mechanism of Treg suppression is not fully understood but there is evidence it is mediated through cell-cell contact of the Cytotoxic T lymphocyte Specific Antigen-4 (CTLA- 4) receptor with the CD80 or CD86 receptor on APC or the secretion of the cytokines IL-10 and TGF-β 25,26.  The cell suspension was collected from the co-culture after 72 hours, sorted into CD4+ cells and stained for CD4 and CTLA-4 expression. Upon gating on CD4+ cells we found that more CTLA-4+ cells were present in the IDO group, 27.93% ± 1.88 compared to the control culture, 4.15% ± 0.55 (p< 0.005, figure 2.5A). A count of cells expressing both CD4 and CTLA- 4 receptors confirmed that there were a greater number of CD4 cells expressing CTLA-4 receptors in the IDO group, 1445 ± 168 compared to the control group, 137 ± 29 (p < 0.01, figure 2.5B and C). To determine the gene expression of TGF-β and IL-10 as a result of the fibroblast co- culture, the cell suspension was collected and sorted into CD4+ cells. The RNA was then isolated, c-DNA synthesized and q-PCR performed for the cytokine primers. Results were standardised to the BALB/C CD4+ cells isolated from the splenocyte monoculture. A fold increase of 796.39 ± 86.65 was seen for mRNA synthesis of TGF-β in the co-culture environment compared to monoculture (p< 0.001) and a significant fold increase of 20.51 ± 3.79 was seen for IL-10 (p< 0.001, figure 2.6 A and B respectively). Control and IDO group comparison was not significantly different (not shown) and therefore the effect of the co-culture of the CD4+ cells and the fibroblasts was compared with the monoculture. 34     35  Figure 2.5. A greater number of CTLA-4 positive cells were detected in the IDO group. BALB/c splenocytes were isolated from the co-culture groups on day 3, sorted into CD4+ cells and stained with anti-CTLA-4-APC and anti-CD4-FITC and analysed using flow cytometry. A. A histogram showing the ratio of CTLA-4 positive cells (gated on CD4+ cells). B. A dot plot showing double staining for CTLA-4 and CD4 positive cells (gated on CD4+ cells).  C A bar chart showing the total number of CTLA-4/ CD4 positive cells in each group. (n=3, ** = p< 0.01, C57BL/6 fibroblasts and BALB/c splenocytes).      36    Figure 2.6. The CD4+ cells isolated from the co-culture conditions expressed more TGF-β and IL-10 at the gene level than in the monoculture conditions. The BALB/s splenocyte population was isolated from the co-culture and sorted into CD4+ cells before extraction of RNA and c- DNA synthesis. A. The fold increase of TGF-β expression in the co-culture conditions is charted using the monoculture results as a baseline (n= 3, p< 0.05). B. The fold increase in IL-10 gene expression in co-cultured CD4+ cells after 72 hours represented in a bar chart, with CD4+ monoculture as a baseline. (n=3, *** = p< 0.001, C57BL/6 fibroblasts and BALB/c splenocytes)  37  Treg cells cultured in the IDO expressing allogeneic fibroblast group show antigen specificity in a mixed lymphocyte reaction assay To evaluate whether the Treg population were functionally suppressive and antigen specific after the allogeneic co-culture a mixed lymphocyte reaction was performed. The BALB/c cell suspension was collected from the samples and the cells sorted into CD4+CD25+ cells. A 1:2:2 ratio of BALB/c CD4+CD25+ cells: BALB/c CD8+-CFSE cells: B6 (H-2Kb) or FVB (H-2q) APC was used as stimulator cells. In all analysis, the cells were gated on CFSE positive CD8 cells. 32.42%, ± 3.73 of CD8+ cells were suppressed in the IDO/ B6 APC culture compared to 14.04% ± 1.36 of CD8+ cells in the control/ B6 APC culture (p< 0.001).  In contrast, only 5.61% ± 0.82 CD8+ cells were suppressed in the IDO/ FVB APC culture (p< 0.001) (figure 2.7A and B). 8.28% ± 1.79 CD8+ cells were suppressed in the control/ FVB APC culture but this was not significant when compared to the control/ B6 APC culture (p= 0.11). These results confirm generation of an antigen specific population of Treg after allogeneic IDO expressing fibroblast co-culture. 38    Figure 2.7. Treg cells isolated from the IDO group co-culture display antigen specific suppression of CD8 proliferation in a mixed lymphocyte reaction. The splenocyte population was isolated from the co-culture conditions after 3 days and isolated into CD4CD25+ T cells. The count was determined and these cells were then plated for a mixed lymphocyte reaction with CFSE stained CD8 cells and stimulator cells from B6 mice or third party, FVB mice in a ratio of 1:2:2. A. A histogram representing the percentage of non-proliferating BALB/c CD8 cells in each stimulator group. B. A bar chart representing the percentage of non-proliferating CD8 cells in each group showing significant suppression with the Treg isolated from the IDO group in the B6 group only. (n=3, *** = p< 0.001 co-culture conditions- C57BL/6 (B6) fibroblasts and BALB/c splenocytes. Mixed Lymphocyte Reaction (MLR)- BALB/c Treg isolated from the fibroblast co-cultures, naive BALB/c CD8 cell and either C57BL/6 (B6) Antigen Presenting Cells (APC) or FVB APC). 39  Discussion The results presented demonstrate a novel role of IDO- expressing fibroblasts in expanding an antigen specific Treg population. Antigen specific Treg have been expanded previously using IDO expressing dendritic cells 53 . An advantage of using fibroblasts as opposed to dendritic cells is that they can be easily isolated from a skin biopsy and will reliably survive in culture over several passages. IDO expression in fibroblasts has been induced using viral vectors or stimulation with IFN-γ 9,65. IFN-γ is a natural cytokine, expressed at sites of inflammation. It induces the expression of more than 200 genes but of particular relevance in this thesis, it upregulates the expression of IDO and MHC II. Although IDO gene transduction has evolved in our research group from primarily adenoviral transduction to the more stable and robust lentiviral transduction, the potential risk of oncogeneic activation poses an obstacle for translation of our methods into the clinical sphere. IFN-γ induced IDO expression avoids any concerns about using viruses and offers a clear pathway for translation into clinical practice. A notable short-coming is that IDO expression is relatively short lived, peaking at 36-48 hours, but as our co-culture period is 72 hours we do not view this as a disadvantage. The confirmation of gene expression for the H-2Kb MHC II receptor substantiates that the fibroblasts were from a B6 donor and the co-culture with BALB/c splenocytes was allogeneic. IDO gene expression and the kynurenine concentration were greater in the IDO group affirming induction and activity of the IDO enzyme in this group. Expansion of the Treg population was seen in the IDO group with minimal expansion also evidenced in the control group. Minimal expansion was observed when the IDO enzyme was inhibited with 1-MT, confirming that IDO is important in the expansion of the Treg population. We acknowledge that IL-2 is essential for activation and proliferation of Treg which otherwise are hypo-responsive. In the splenocyte co-culture we assume that IL-2 is expressed by cells within the population in 40  response to the allogeneic fibroblast antigen stimulus. The presence of this cytokine however was not confirmed. Another drawback in this study is that we did not distinguish between natural and induced Tregs, but it has been shown that CD4+CD25- cells can be converted to CD25+ cells in the IDO environment through activation of the GCN 2 pathway 68 . Although not directly investigated in this study, other research groups have described the IDO induced activation of  the GCN 2 stress pathway in non-Treg populations and subsequent anergy and apoptosis evident in these population 10 . Therefore, we chose to determine the percentage of dead cells observed in the splenocytes after 72 hours of co-culture. As anticipated, CD4- cells did not survive well in the IDO group although there was greater survival of CD25+ cells in this group when compared to the control and 1-MT cultures. This was as a result of CD25+ cell expansion and proliferation. We acknowledge that CD25 is an activation marker and that there will be greater allogeneic stimulation encountered in the IDO group with respect to the increased MHC II expression. In determining the surface expression of the CTLA-4 receptor we first sorted the cells into CD4 cells before co-culture as the CTLA-4 receptor may also be detected in activated CD8+ cells 69 . The importance of the CTLA-4 receptor and the IL-10 and TGF-β cytokines in suppression in this model could have further been assessed through inhibition but the mechanism of suppression was not the objective of this study, although it offers an avenue for future studies. Suppressive functioning can however be seen by antigen specific suppression of the CD8+ cells in the IFN-γ  B6 APC MLR. In conclusion, the findings of the present study confirm the utility of IDO expressing dermal fibroblasts for expansion of an antigen specific Treg population. This is a novel finding and confirms the feasibility of fibroblasts for expansion of Treg as an alternative to dendritic cells. The Treg could be further isolated into an autologous Treg cell therapy. The generation of an antigen specific Treg cell therapy could be used to induce immune tolerance in allogeneic 41  organ transplantation or the treatment of autoimmune conditions, without the need for immunosuppressive medications. 42  CHAPTER 3 IDO Expression by Dermal Fibroblasts Can Convert Naive CD4+CD25- T Cells to Antigen Specific Regulatory T Cells 2  Introduction Burn injuries are the fourth commonest trauma world-wide 70 . According to the American Burn Association 45,000 individuals were admitted for medical treatment to hospitals across the US, following a burn in 2011 1 . The gold standard of medical treatment for a deep burn is tangential excision of the devitalised tissue and an autologous skin graft. In large burns, autologous skin harvest may not be sufficient for the reconstruction of the areas requiring skin grafting. Allogeneic or cadaver skin grafts are an alternate treatment in these cases. Unfortunately, they offer only temporary wound coverage due to the eventual rejection of this allogenic transplant. Skin is particularly antigeneic tissue as a result of the abundance of dendritic cells that reside in the dermis and epidermis 4,5,71 . Thus skin is considered one of the most antigeneic tissues in nature. Upon allogeneic skin grafting, the Antigen Presenting Cells (APC) present in the donor skin migrate to the resident lymph nodes, and activate the recipient T cell pathways.  Rejection of the graft ultimately ensues 12 . Clinical tolerance or reduced alloreactivity to allogeneic skin grafts has not been achieved. Immune suppression can be used to delay or inhibit rejection and is commonly used for composite tissue allograft tolerance 5,7,72,73 . However, generalised immune suppression is not appropriate for victims of large surface area burns. Therefore, the allogenic skin grafts will eventually require replacement with autologous skin grafts.  _________________________________________ 2 A version of this chapter has been submitted for publication.  43  Regulatory T cells (Treg) or CD4+CD25+Foxp3+ are immune tolerance cells and are a potential avenue for immune suppressive therapeutics 61,62 . Several Treg cell subpopulations have been characterised. In this paper we focus on the classic CD4+CD25+Foxp3+ population. Tregs can be released from the thymus as natural Tregs or induced from CD4+CD25- naive cells in the periphery 74 . They play a key role in controlling immunity and  preventing autoimmune conditions and allergy 15,16,55,75 . They have also been used to prevent graft rejection 17,76 . Proliferation and expansion of CD4+ cell subpopulations is achieved through the interaction of specific antigens presented on Major Histocompatibility Complex class II (MHC II)  receptors with the T Cell Receptor (TCR) 77 . Tregs have enhanced suppressive function in a low tryptophan environment 37 . This environment can be generated through the action of the intra- cellular enzyme, Indoleamine 2,3-Dioxygenase (IDO).  This enzyme catalyses the initial rate limiting step of tryptophan metabolism in the kynurenine pathway 78 . In contrast to Tregs, the deficiency in tryptophan and the associated metabolites, such as kynurenine derivatives, as well as O2-free radicals induce effector cell anergy and initiate apoptosis along the general control non-derepressible 2 pathway (GCN-2) 10 . Through activation of the same pathway, CD4+CD25- cell can be induced to transition to Tregs 48 . IFN-γ is a potent stimulating factor for induction of IDO in fibroblasts 79.  A previously identified property of IDO in the skin is the inhibition of proliferation in bacteria and parasites 59 . IFN-γ released during inflammation, induces the skin cells to synthesize IDO. The tryptophan metabolites have additionally been shown to act as important UV filters in the eye 45 . Complimentary to their role in defence, fibroblasts are also non-professional antigen presenting cells and express MHC class II 38,46 . In this way, expression of MHC class II by fibroblasts could be utilised to activate a specific population of CD4+ cells. In an IDO enriched environment Treg could be selectively expanded. Expansion of a Treg population that can specifically suppress 44  effector responses to an allogeneic graft would prolong survival of the donor tissue and abrogate the need for replacement of the allograft after rejection with autologous tissue. In the present study we demonstrated for the first time to our knowledge that facultative expression of IDO in allogeneic dermal fibroblasts, convert naive CD25- T cells to Treg cells, that are suppressive and antigen specific to the fibroblast antigens.     Materials and Methods Mice Male BALB/c mice, Friend Leukaemia Virus (FVB) mice and C57BL/6 mice were purchased from Charles River Laboratories (Wilmington, MA). Mice were housed in ventilated cages in sets of 4 with enrichment, as per ethical recommendations. All experiments were carried out according to standard operating procedures approved by the UBC animal ethics committee and by recipients holding full animal husbandry certification.  Isolation of splenocytes Spleens were harvested from under sterile conditions and gently pressed through a 40µl nylon cell strainer (VWR International, LCC, BD Falcon) with a 3ml syringe plunger (BD bioscience, BD syringe). The cells were rinsed through with 30ml of RPMI medium (Thermo Scientific) enriched with 10% fetal bovine serum (FBS) (GIBCO) and 1% anti-mycotic antibiotic (100µg/ml penicillin, 100µg/ml streptomycin, and 0.25µg/ml amphotericin B) (GIBCO). Cells were centrifuged at 1800g for 5 minutes. The pellet was then re-suspended in 45  5ml per spleen of RBC lysis buffer (ebioscience, San Diego, CA) for 5minutes. PBS was added to the suspension and it was centrifuged for 1800g for 5minutes. The pellet was re-suspended in RMPI enriched medium and sieved again through a 40µl nylon sieve.  Magnetic Assisted Cell Sorting (MACS) After isolation, BALB/c splenocytes were sorted into CD4+CD25+cells using the CD4+CD25+ Easysep Mouse Regulatory T cells positive selection kit (Stemcell Technologies, Vancouver, Canada) according to the manufacturer’s instructions. The residue from the CD25+ isolation of CD25- was retained (flow cytometry confirmed purity of 96.57% data not shown). CD8+ T cells were isolated from naive BALB/c splenocyte populations using Easysep CD8 positive selection kit (Stemcell technologies, Vancouver, Canada) as per manufacturer’s instructions.   Fibroblast preparation C57BL/6 dermal fibroblasts were isolated from skin pieces harvested from a C57BL/6 mouse and washed in sterile PBS supplemented with 1% anti-mycotic antibiotic six times. The tissue was divided into smaller pieces and sited in a 10ml conical plate before saturation in one drop of FB . The plate was then placed in the incubator at 3  C for 3 mins before addition of high glucose DMEM medium (Thermo Fisher Scientific,Ontario, Canada) enriched with 1% anti-mycotic antibiotic and 10% FBS. Passages 3-7 of C57BL/6 fibroblasts were grown to confluence in 6-well plates for this study. Treated cells were stimulated with 1000U IFN- γ (Sigma- Aldrich). Control cells were not stimulated. The medium was removed after 18hours and the cells washed with warm PBS before addition of 1ml of fresh enriched DMEM medium to eliminate traces of IFN-γ. 46   Cell co-cultures 6 million CD4+CD25- T cells were added to each well in 1ml of enriched RPMI medium (Thermo Fisher Scientific) giving a final medium mix of 50:50 RMPI :DMEM. Cells were cultured with fibroblasts for 7 days with a medium change on the 4 th  day. BALB/c monoculture was used as a negative control.  Proliferation assay Before co-culture, CD4+CD25- T cells were suspended at a concentration of 1 x 10 6  cells/ ml in pre-warmed PBS enriched with 5% FBS and added to a 15ml falcon tube. 1.1 ul of 5mM per ml of CFSE (Invitrogen, Eugene, OR) stock solution was then activated in 110ml of PBS and mixed immediately with the cells. They cells were incubated in the dark at room temperature for 5 minutes after which 1 ml of PB  and 5% FB  solution were added and the cells centrifuged at 18  g for 5 minutes at 2  C. Cells were washed twice in PB  and 5% FB before cells resuspension in enriched RPMI and co-culturing. The plate was wrapped in foil and placed in the incubator at 3  C for 3 days after which time the suspension cells were removed, washed in PBS and resuspended in 200µl of flow cytometry buffer (ebioscience, San Diego, CA). A FACSCalibur flow cytometer was used for counting and the data analysed using FSC Express V3.   Flow cytometry After 7 days co-culture naive CD25- cells were stained with the following flow cytometry monoclonal antibodies; isotype control, CD4-FITC, CD25-APC and FOXP3-PE FJK16 (Mouse regulatory T cell staining kit from ebiosciences, San Diego, CA). The cell 47  suspensions from the co-cultures or naive cell monoculture were pelletted and resuspended at a concentration of 2 x 10 7  / ml in flow cytometry buffer (ebiosicences, San Diego, CA). The CD4 and CD25 antibodies were mixed at a concentration of 1  l 1    l of flow cytometry buffer and added to each cell sample. The cells were incubated in the dark at   C for 1 hour. After this time the cells were washed twice in flow buffer and centrifuged at 1800g for 5 minutes. Cell were then resuspended in 100µl of permeabilisation buffer and incubated at room temperature in the dark for 1 hour before addition of 2 µl/ 100 µl of Foxp3 antibody. The cells were incubated for an hour at room temperature in the dark before washing twice in flow buffer and resuspension in 200 µl of flow buffer. A FACSCalibur flow cytometer and FSC Express V3 used to analyse data.  Live/ dead staining The cell suspension was collected from co-cultures after 3 days and washed in PBS before resuspension at a concentration of 2 x 10 7  / ml of flow cytometer buffer. Propidium iodide (PI) and CD25- APC monoclonal antibody (eBioscience) were mixed to concentrations of 1 µl/ 100 µl and 1 µl/ 100 µl respectively in flow buffer and added to each sample. The cells were incubated in the dark at   C for 1 hour. The samples were read with a FAC Calibur and F C Express V3 was used to analyse data.  Mixed lymphocyte reaction The cell suspension was isolated from the fibroblast co-cultures after 7 days and counted. Half of the cells were then added to either a well containing C57BL/6 APC or a third party mouse strain, FVB APC in a 96-well round bottom plate (Costar, Corning, NY). Naive sorted CD8+ BALB/c T cells were stained with CFSE (invitrogen, Eugene, OR) before also being added to the plate. The cell population consisted of a ratio of 1 1 1 T cells from the co-culture APC  naive BALB c CD8 cells. The medium used was enriched RPMI and  . 5% β- 48  mercaptoethanol. The plate was incubated in the dark at 3  C for four days before the cell population were extracted, washed in PBS and resuspended in 200 µl of flow buffer. The concentration of CFSE was measured using a FACSCalibur flow cytometry machine and the data analysed using FSC Express V3.  Enzyme-Linked Immunosorbent Assay (ELISA) for detection of TGF-β1 and IL-10 The concentration of TGF-β1 and IL-10 was detected in the conditioned medium using Human/ Mouse TGF beta 1 ELISA Ready-SET-Go and Mouse IL-10 ELISA Ready-SET-Go from eBioscience (San Diego, CA) according to the manufacturer’s instructions. Conditioned medium was collected from the co-cultures on day 3. Before processing for TGF-β1 analysis the conditioned medium was acidified and neutralised to remove latency associated peptide. Fresh culture medium, 50:50 RMPI: DMEM was also processed to determine a baseline TGF-β1 and IL-10 concentration. Plates were read using a 96-well plate reader at 450nm and 570nm and subtracted to determine the concentration against a standard curve for TGF-β1 concentration or at the 570nm wavelength alone for the IL-10 concentration.  Statistical analysis of data All data are reported as Mean ± SD of three or more independent observations. Statistical significance was calculated using SPSS 20.0 and ANOVA for more than 2 independent variables or TTEST when only 2 variables were present. P values less than 0.05 were considered to be significant.     49  Results IDO expressing dermal fibroblasts convert naive CD4+CD25- T cells into Treg cells To determine whether CD4+CD25- cells could be converted  to CD4+CD25+ cells in an IDO expressing fibroblast environment, we co-cultured IDO expressing fibroblasts from a C57BL/6 mouse with CD4+CD25- BALB/c mouse cells and compared them to a control fibroblast co-culture and BALB/c CD4+CD25- monoculture. Confirmation of IDO expression was determined through detection of the tryptophan metabolite, kynurenine as in previous publications 9 . The cell suspension was collected from the cultures after 7 days. A greater number of Foxp3+ cells were found in the IDO group (20.80% or 18,717± 1561.58 cells) compared to the control group (6.85% or 6165 ± 999.12 cells), and the monoculture (6.38% or 5742 ± 675.24 , p< 0.001, figure 3.1 A, 1 B). More CD25+ cells were present in the IDO/ fibroblast group, 19.29% ± 2.14 compared to 7.03% ± 1.62 in the control co-culture (p< 0.001) and 7.78 ± 1.03 in the CD4+CD25- monoculture (p< 0.001, figure 3.1 C, 3.1 D). This suggests that an IDO expressing fibroblast environment can convert CD4+CD25- cells to both CD25+ cells, possibly Th1 and Tr3 regulatory T cells, and Foxp3+ cells Treg. 50    51  Figure 3.1. CD4+CD25- cells are converted to CD4+CD25+ cells after 7days of co-culture with allogeneic IDO expressing fibroblasts. After 7 days the naive BALB/c CD4 T cells were isolated from the C57BL/6 fibroblast co-culture and stained with anti-CD4-FITC, anti-CD25-APC and anti-Foxp3-PE after permeabilisation. A. A histogram of the ratio of Foxp3+ cells in the populations (gated on Foxp3+ cells). B. A total count of the final number of Foxp3+ cells after 7 days of co-culture represented as a bar chart. C. A histogram of the percentage of CD25+ cells (gated on CD25+ cells). D. The total numbers of CD25+ cells is plotted in a bar chart. (p< 0.0001, n= 3). (Fibroblasts from C57BL/6 mice and CD4+CD25- cells from BALB/c mice) 52  Converted CD4+CD25- cells survive better in the IDO/ fibroblast co-culture environment The IDO generated micro-environment induces transition of activated CD4+CD25- cells to an anergic state and apoptosis 10 . Thus, to investigate the survival of the naive CD4+CD25- cells in the IDO/ fibroblast environment, we collected the cell suspension from the co-culture environments after 3 days and stained the cells with propidium iodide (PI) and anti-CD 25 antibody. More PI negative or live cells were present in the IDO group, 46.61%, ± 3.51 compared to 72.02, ± 2.11 in the control group (p< 0.005, figure 3.2 A, 3.2 B). This result was unexpected, but on co-staining the population for the CD 25 surface receptor and PI we found that there was significantly more live CD25+ cells in the IDO group, 9.27% ± 0.91 compared to 0.08% ± 0.11 in the control group (p< 0.01, figure 3.2 C). This was confirmed by determination of the total count of CD25+ cells; 6935 ± 678.92 in the IDO group compared to 72.5 ± 11.46 cells in the control group (p< 0.01, figure 3.2D). 53   54  Figure 3.2. Survival of the cell population is greater in the IDO group compared to control due to conversion of CD4+CD25- cells to CD25+ cells.  To stain the dead cells, propidium iodide (PI) was added to the isolated BALB/c naive cells for 1 hour.  After washing, the cells were further stained with anti-CD25-APC for 1 hour and analysed using flow cytometry. A and B. A histogram and bar chart of the ratio of PI positive cells in the population (cell debris gated out). C. A dot plot for PI and CD25 cells. D. A total count of live CD25+ cells (c and d- gated on CD25+ cells) (p< 0.0001, n=3) (Fibroblasts from C57BL/6 mice and CD4+CD25- cells from BALB/c mice). 55  CD4+CD25- cells proliferate more in the IDO/ fibroblast co-culture environment A Carboxyfluoresccein Diacetate Succinimidyl Ester (CFSE) assay was performed to determine the percentage of dividing naive CD25- T cells in each fibroblast co-culture system. Before co-culturing, the naive CD25- T cells were stained with CFSE. The T cell sub-population was then collected from the co-culture systems on day 3 and the concentration of CFSE detected with flow cytometry. A greater percentage of proliferating CD4+CD25- cells was seen in the IDO group (49.70%, ± 3.68) compared to the control group (26.17, ± 2.49, p< 0.001, figure 3.3A and B). This population of proliferating cells provides an explanation why a greater percentage of live cells are seen in the IDO group. 56   Figure 3.3. Cells proliferate more in the IDO culture compared to that of the control culture. Before co-culturing, the naive CD25- cells were stained with CFSE. On day 3, the cells were removed and the concentration of CFSE detected using flow cytometry. A and B. A histogram and bar chart, showing the ratio of proliferated cells. The marker depicts the percentage of proliferated cells (gated on CFSE+ cells). (p< 0.001, n=3) (Fibroblasts from C57BL/6 mice and CD4+CD25- cells from BALB/c mice). 57  A greater number of CTLA-4 positive cells are present in the control co-culture Cytotoxic T Lymphocyte Specific Antigen-4 (CTLA-4) is required for Treg mediated cell-to-cell contact suppression. It has been shown that mice who lack this receptor succumb to autoimmune diseases 80 . Interestingly however, recent studies have shown that CTLA-4 is also correlated with Treg cell TCR hypo-signalling 81 . To determine the presence of this receptor in the naive CD4+CD25- population after co-culturing we stained the cells for CTLA-4. We found a greater percentage and count of CTLA-4 positive cells in the control group (80.78% or 2390 ± 531) compared to the IDO group, (58.15% or 922 ± 43, p< 0.05, figure 3.4A and B). Although it is widely accepted that CTLA-4 ligation of B7-1/ B7-2 molecules induces IDO synthesis and blockade of the CTLA-4 receptor inhibits IDO synthesis in dendritic cells, there is little evidence currently detailing the relationship between low tryptophan in the environment and CTLA-4 expression 82,83 .  CD4+CD25- T cells co-cultured with IDO expressing fibroblasts produce more TGF-β1 and IL-10 In the periphery, naive CD4+CD25- cells have the capacity to convert to Tregs and can be further sub-classified into either T regulatory 1 (TR1 cells) or T Helper 3 (TH3 cells) which secret IL-10 and TGF-β respectively 25. These immunosuppressive cytokines are important in Treg suppressive capacity 84,85 . Enzyme-Linked Immunosorbant Assay (ELISA) was used to determine the concentration of these cytokines in the culture medium. The culture medium was collected from the co-cultures on day 3 and processed. The concentration of TGF-β1 was significantly higher in the IDO group compared to the control groups at 602.51pg/ml, ±70.99 for the 199.01 pg/ml, ± 91.43 respectively (p< 0.005, figure 3.4 C). As shown in figure 3.4 D, a significantly higher concentration of IL-10 was also detected in the IDO group (1356.5 pg/ml, ± 116.18) compared to control (447.0 pg/ml, ± 132.944, p< 0.0005). The detection of TGF-β1 and 58  IL-10 in the co-cultures suggests that the converted CD4+CD25- cells are secreting these suppressive cytokines, more so in the IDO group. Notably, IFN-γ stimulation does not induce TGF-β secretion in fibroblasts therefore we assume that TGF-β1 is predominantly released by the T cells in this co-culture. 59    60  Figure 3.4. The number of cells expressing CTLA-4 was greater in the control group although the concentration of TGF-β1 and IL-10was greater in the IDO group.  The cell suspension was collected after 3 days and stained for anti-CTLA-4-APC. A and B. A histogram and count of the ratio of CTLA-4+ cells in the population (gated on CTLA-4+ cells, n = 3, p< 0.05). ELISA was used to determine the concentration of cytokines in the culture medium after 3 days. C. A bar chart showing the concentration of TGF-β1 in the culture medium (p<  .  5, n=5). D. A bar chart showing the concentration IL-10 in the culture medium. (p< 0.0005, n=5) (Fibroblasts from C57BL/6 mice and CD4+CD25- cells from BALB/c mice). 61  Converted CD4+CD25- cells from the IDO expressing fibroblast co-culture system are suppressive and antigen specific After 7 days of co-culture, the suspension cells were collected from the cultures without sorting. A naive BALB/c spleen was harvested for sorting into CD8+ cells which were stained with CFSE. An antigen suppression assay was performed using either C57BL/6 mouse or a third party (FVB) mouse Antigen Presenting Cells (APC) as stimulator cells in a ratio of 1:1:1 of co- cultured BALB/c T cells: naive BALB/c CD8+ cells: APC. Suppression was evident in the C57BL/6 stimulator and T cells isolated from the IDO co-culture groups with 66.37% ± 3.55 of CD8+ cells not proliferating compared to the FVB APC and IDO co-culture T cells where only 19.51% ± 1.64 CD8+ cells did not proliferate (p< 0.001, figure 3.5 A, 3.5 B). No significant suppression of CD8+ cells was seen using the cells isolated from the control group in either the C57BL/6 or FVB APC cultures (12.05%, ± 1.47 and 14.16%, ± 2.98, p< 0.001, figure 3.5 A, 3.5 B). These findings suggest that the CD4+CD25- cells isolated from the IDO co-culture are able to suppress CD8 T cell proliferation in response to the C57BL/6 mouse MHC antigens. Additionally, we show that the suppressor T cells isolated from the IDO co-culture are able to specifically suppress in response to the C57BL/6 antigens but not the third party, FVB antigens suggesting antigen specificity. 62   Figure 3.5. Naive CD4+CD25- cells converted in an IDO expressing fibroblast environment are suppressive and antigen specific. The BALB/c cells were collected from the C57BL/6 fibroblast co-culture on day 7. BALB/c CD8 T cells were stained with CFSE. Frozen splenocytes from a C57BL/6 and FVB mice were thawed and used as stimulator cells, in a ratio of 1:1:1. A and B. A histogram showing the ratio of non-proliferating CD8 cells in the C57BL/6 and FVB groups.  C. A bar chart of the ratio of non-proliferating CD8 T cells (p< 0.0001, n= 4) (APC from C57BL/6 mice or third part FVB mice, suppressor cells from BALB/c mice CD4+CD25- co-cultures and CD8+ cells from naive BALB/c mice). 63  Discussion Cadaveric skin grafts are commonly used as wound coverage in large surface area burns (>50% TBSA). The draw-back to their use lies in the susceptibility of the graft to immune rejection 6 .  Immune suppression can be prescribed but organo-toxicity and generalised immune depression are side effects that are not suitable for this sub-set of individuals. Naturally occurring immunosuppressive processes are the basis of foetal survival during pregnancy 34 . An enzyme, IDO is expressed by the trophoblast cells of the placenta in response to IFN-γ. IDO generates an immune-privileged environment where Tregs thrive but effector T cells transition to anergy or apoptose 86 . In this environment, CD4+CD25- cells are induced to differentiate into Tregs through downstream activation of the GCN 2 pathway 48 .  CD4+ cells are activated through interaction of specific antigens on MHC class II with the TCR. Fibroblasts express MHC II and can be induced to express IDO once stimulated with IFN-γ. An additional benefit of IFN-γ stimulation in fibroblasts is that it up-regulates the MHC class II expression allowing a greater chance of CD4+ cell activation in this environment 87 . However, it was not clear whether a population of Tregs expanded in response to fibroblast antigens in an IDO generated micro- environment could specifically suppress activation and proliferation of effector CD8+ T cells. We isolated CD4+CD25- cells from the spleen to distinguish this population from natural Tregs which also accumulate in the spleen.  Our results shows that CD4+CD25- cells convert to CD25+Foxp3+ cells in the IDO microenvironment. Control fibroblasts did not result in greater conversion compared to that of the monoculture. More live cells were detected in the IDO group compared to the control. To investigate this further we stained for the presence of the CD25 surface receptor. A population of CD25+ live cells was found in the IDO group that was not found in the control group. CFSE analysis was used to determine proliferation of the CD4+CD25- population which in tandem with the PI results was also greater in the IDO environment. We appreciate that up-regulation of the MHC in the IFN-γ treated group was likely 64  a contributing factor to this finding. Therefore, although the IDO-generated microenvironment induces anergy and apoptosis in a CD4+CD25- population, conversion of the naive CD4+ T cells to CD25+ cells and proliferation of this sub-set of cells, results in a greater percentage of live cells in this environment. The detection of Foxp3 expression distinguishes CD4+CD25+ Tregs from T cells without regulatory function that are also present in the CD4+CD25+ T cell population. Additionally the higher concentration of both IL-10 and TGF-β in the IDO group shows that the converted cells produce more of these cytokines, both of which are central to Treg suppressive function 74 . CTLA-4 is another recognised mechanism of Treg suppression mediated through cell-to-cell contact with the CD80/ CD86 receptors on immune cells. We found that after 3 days in the IDO culture fewer CTLA-4 positive cells were detected compared to control. To date, there are no documented reports on whether an IDO micro-environment induces CTLA-4 down- regulation.  Nevertheless, suppression was greatest in the T cells isolated from this group suggesting that CTLA-4 is not the predominant method of suppression. This is consistent with the finding that CTLA-4 expression is correlated with TCR hypo-signalling in Treg 81 . Mechanistic determination for this result was not within the scope of this study however it presents an area for future studies. Suppressive function was confirmed through suppression of the CD8+ population in a mixed lymphocyte reaction. Greater suppression was evident with the T cells isolated from the IDO group in the B6 stimulator group compared to all other groups. We also provide for the first time evidence of antigen specificity of T cells isolated from the IDO group to the allogeneic fibroblasts. The  conversion of CD4+CD25- cells to CD25+ cells in an allogeneic IDO expressing fibroblast environment is novel and IFN-γ stimulation avoids viral transduction or cell engineering for induction of IDO expression. Fibroblasts are also easier to isolate and maintain 65  in culture than other APCs, for instance dendritic cells. Future studies are required to confirm that antigen tolerance to an allogeneic graft in vivo can be controlled using these converted CD25- cells and importantly the survival and plasticity of the population on re-introduction to the in vivo environment. Finally, this novel finding paves the way to challenging the use of current immunosuppressive therapies prescribed with allogenic engraftment.     66  CHAPTER 4 Conclusion and Suggestions for Future Work  General Discussion and Conclusion  A gap in treatment exists for preventing the rejection of cadaver skin grafts commonly used for wound coverage in extensive surface area burns. The rejection is tolerated as immune suppressive drugs are not appropriate adjuncts to treatment in this sub-set of individuals due to the adverse side effects 88-90. Regulatory T cells (CD +CD25+, Treg) are the immune system’s natural tolerance cells and are a natural alternative to pharmaceutics 74 . Their principle role is to suppress the activation, proliferation or function of effector T cells either through cell-to-cell, CTLA-4 receptor mediated or synthesis of immune-suppressive cytokines IL-10 and TGF-β mechanisms 25,26 . Treg are activated through the interaction with specific antigens presented on MHC II 77 . Thus, Treg are appealing as a potential specific tolerance treatment in allo- transplantation 91 . This cell population survive particularly well and have enhanced suppressive functioning in the low tryptophan environment generated through the activity of the enzyme, IDO 53,64 . This enzyme is expressed by several cells including dendritic cells, macrophages, trophoblast cells and fibroblasts 34-36,92  . Over the last two decades, significant advances have been made in the field of regulatory T cells in terms of enhancing their suppressive functioning and expansion of cell numbers. However, two challenges are encountered; 1). Viral transduction methods are commonly used which pose concerns for introduction into clinical practice and result in polyclonal expansion of Treg which are non-specific and 2).dendritic cells used for expansion of antigen specific populations are complicated to isolate and do not survive well in culture. To address these challenges our research group focused on fibroblasts. These cells play a role in the maintenance of the structural integrity of connective tissue. They are found in all 67  tissues and dermal fibroblasts particularly can be easily isolated from a skin biopsy. They also survive well in culture over several passages. They are non-professional antigen presenting cells and thus express MHC II. Therefore these cells can be used to present antigens to Treg cells and could potentially expand a complimentary specific Treg population. As mentioned previously, similar to dendritic cells, they can express IDO on stimulation with IFN-γ which would further encourage survival of Treg. Thus we hypothesized that fibroblasts induced to express IDO through treatment with IFN-γ would expand a population of antigen specific Treg cells. Furthermore, we proposed that we can convert naïve CD4 T cells to antigen specific Treg in the same environment. Our research confirms that the dual expression of MHC II receptors and IDO resulted in expansion of an antigen specific population of Treg (figure 2.7, Chapter 2). As shown in Chapter 3, fibroblasts expressing IDO also possess the capacity to convert naïve CD4 T cells into Treg (figure 3.2, Chapter 3). In this chapter, we additionally presented confirmation of antigen specificity of the converted Treg to the fibroblast antigens (figure 3.6, Chapter 3). Uniquely, we found that CTLA-4 receptor expression was significantly lower in the naïve CD4 converted Treg in the IDO expressing fibroblast environment compared to the control T cell suggesting that cell- to-cell contact suppression was not the predominant mechanism in the CD8 suppression assay (figure 3.4, Chapter 3). This has not been described previously.  In conclusion, there are several important aspects that distinguish this thesis from our previous studies. First, we adopted the use of IFN-γ to induce expression of IDO in the fibroblasts instead of using virally transduced cells. This approach avoids the use of viral modification and shows evolution of our research for translation into clinical practice. In addition, we showed for the first time that IDO expression in allogeneic fibroblasts can be used to expand a population of antigen specific Treg and to convert naïve CD4 T cells into antigen 68  specific Treg. Finally, we showed that dermal fibroblasts can be considered an alternative method for expansion of antigen specific Treg to dendritic cells and are more convenient due to the ease of isolation of these cells, as well as the predicable survival of these cells in vitro over several passages.  In summary, in this research we demonstrate that 1) IDO expressing fibroblasts expand a population of antigen specific Treg and 2) IDO expressing fibroblasts convert CD4 naïve T cells to antigen specific Treg.  Suggestions for Future Work  Although this study presents promise as an alternative method for expanding antigen specific Treg and potentially may in be used to induce tolerance to allogeneic skin grafts in vivo without using immune-suppressive pharmaceutics, we acknowledge that further studies are required to translate the antigen suppression evident in vitro to the in vivo environment. As such, the following are my suggestions for improving this Treg cell therapy model. 1- In Chapter 2 we demonstrate that the CD4 cells isolated from both the control and IDO cultures expressed high levels of the cytokines TGF-β and IL-10 but it was not within the scope of this thesis to confirm that blockade of these cytokines resulted in inhibition of Treg mediated suppression. We hypothesize that these cytokines are important in the suppression evident with the Treg isolated from the IDO group and suggest that this be confirmed through suppression of these antigens in a CD8 suppression assay. 2- In Chapter 3 we established that expression of CTLA-4 was not the predominate method of suppression for the converted naïve CD4 T cells in the antigen specific suppression assay. We hypothesize that an IDO generated low tryptophan environment results in 69  CTLA-4 receptor down-regulation or inhibition of expression of this receptor on the surface of converted naïve CD4 T cells. 3- For evolution of this research into an in vivo study we suggest sorting of the Treg using flow cytometry sorting for CD25 hi  cells instead of magnetic sorting to ensure isolation and delivery of the highest purity of suppressive cells. Additionally, as it has been shown that Treg can convert to conventional cells in vivo we advise staining of the cell therapy in order to assess conversion and determine the fate of the cells. 4- Finally, we showed that dermal fibroblasts can function as non-professional antigen presenting cells and in our research were able to expand Treg cells, however Treg activation and expansion is dependent not only on recognition of specific antigens by the TCR but also on interaction with ci-stimulatory molecules e.g. B7 receptors. There is evidence that these receptors are present on fibroblasts isolated from the lamino propria and can be upregulated with IFN-γ, but this has not been confirmed in dermal fibroblasts. Thus, I suggest confirmation of the presence of these receptors on dermal fibroblasts. 70  BIBLIOGRAPHY  1. American Burn Association home page. 2011. (Accessed April 2012 at http://www.ameriburn.org/resources_factsheet.php) 2. Ong YS, Samuel M, Song C. Meta-analysis of early excision of burns. Burns 2006;32:145-150. 3. Orgill DP. Excision and Skin Grafting of Thermal Burns. New England Journal of Medicine 2009;360:893-901. 4. Lee WPA, Yaremchuk MJ, Pan Y-C, Randolph MA, Tan CM, Weiland AJ. Relative Antigenicity of Components of a Vascularized Limb Allograft. Plastic & Reconstructive Surgery 1991;87:401-411. 5. Baumeister S, Kleist C, Döhler B, Bickert B, Germann G, Opelz G. Risks of allogeneic hand transplantation. Microsurgery 2004;24:98-103. 6. Gibson T, PB. M. The fate of skin homografts in man. J Anatomy 1943;77. 7. Tobin GR, Breidenbach Iii WC, Ildstad ST, Marvin MM, Buell JF, Ravindra KV. The History of Human Composite Tissue Allotransplantation. Transplantation Proceedings 2009;41:466-471. 8. Rafla K, Tredget EE. Infection control in the burn unit. Burns 2011;37:5-15. 9. Forouzandeh F, Jalili RB, Hartwell RV, et al. Local expression of indoleamine 2,3-dioxygenase suppresses T-cell-mediated rejection of an engineered bilayer skin substitute. Wound Repair and Regeneration 2010;18:614-623. 10. Munn DH, Sharma MD, Baban B, et al. GCN2 Kinase in T Cells Mediates Proliferative Arrest and Anergy Induction in Response to Indoleamine 2,3-Dioxygenase. Immunity 2005;22:633-642. 11. Li Y, Tredget EE, Ghaffari A, Lin X, Kilani RT, Ghahary A. Local Expression of Indoleamine 2,3-Dioxygenase Protects Engraftment of Xenogeneic Skin Substitute. J Invest Dermatol 2006;126:128- 136. 12. Bradley JA, Bolton EM, Pettigrew G. Monitoring T cell alloreactivity after organ transplantation. Clinical & Experimental Immunology 2005;142:229-232. 13. Neefjes J, Jongsma MLM, Paul P, Bakke O. Towards a systems understanding of MHC class I and MHC class II antigen presentation. Nat Rev Immunol 2011;11:823-836. 71  14. Saada JI, Pinchuk IV, Barrera CA, Adegboyega PA, Saurez G, Miffin RC, Di Mari JF, Reyes VE, Powell DW. Subepithelial myofibroblasts are novel nonprofessional APCs in the human colonic mucosa. J Immunol 2006;177:5968-5979 . 15. Buckner JH. Mechanisms of impaired regulation by CD4+CD25+FOXP3+ regulatory T cells in human autoimmune diseases. Nat Rev Immunol 2010;10:849-859. 16. Duan W,  o T, Mehta AK, Choi H, Croft M. Inducible CD +LAP+Foxp3− Regulatory T Cells Suppress Allergic Inflammation. The Journal of Immunology 2011;187:6499-6507. 17. Lombardi G, Sagoo P, Scotta C, et al. Cell therapy to promote transplantation tolerance: a winning strategy? Immunotherapy 2011;3:28-31. 18. Gupta S, Shang W, Sun Z. Mechanisms regulating the development and function of natural regulatory T cells. Archivum Immunologiae et Therapiae Experimentalis 2008;56:85-102. 19. Fehérvari Z, Sakaguchi S. CD4+ Tregs and immune control. The Journal of Clinical Investigation 2004;114:1209-1217. 20. Thebault P, Condamine T, Heslan M, et al. Role of IFNγ in Allograft Tolerance Mediated by CD4+CD25+ Regulatory T Cells by Induction of IDO in Endothelial Cells. American Journal of Transplantation 2007;7:2472-2482. 21. Godfrey WR, Ge YG, Spoden DJ, et al. In vitro–expanded human CD4+CD25+ T-regulatory cells can markedly inhibit allogeneic dendritic cell–stimulated MLR cultures. Blood 2004;104:453-461. 22. Nishikawa H, Sakaguchi S. Regulatory T cells in tumor immunity. International Journal of Cancer 2010;127:759-767. 23. Allan SE, Alstad AN, Merindol N, et al. Generation of Potent and Stable Human CD4+ T Regulatory Cells by Activation-independent Expression of FOXP3. Mol Ther 2007;16:194-202. 24. Moffett JR, Namboodiri MAA. Tryptophan and the immune response. Immunol Cell Biol 2003;81:247-265. 25. Mills KHG. Regulatory T cells: friend or foe in immunity to infection? Nat Rev Immunol 2004;4:841-855. 72  26. M KD, Le Gros G. The role of CTLA-4 in the regulation of T cell immune responses. Immunol Cell Biol 1999;77:1-10. 27. Gorelik L, Constant  , Flavell RA. Mechanism of Transforming Growth Factor β–induced Inhibition of T Helper Type 1 Differentiation. The Journal of Experimental Medicine 2002;195:1499- 1505. 28. Akdis CA, Blaser K. Mechanisms of interleukin-10-mediated immune suppression. Immunology 2001;103:131-136. 29. Collison LW, Workman CJ, Kuo TT, et al. The inhibitory cytokine IL-35 contributes to regulatory T-cell function. Nature 2007;450:566-569. 30. Osamu T. Biochemical and medical aspects of the indoleamine 2,3-dioxygenase-initiated l- tryptophan metabolism. Biochemical and Biophysical Research Communications 2005;338:12-19. 31. Sugimoto H, Oda S-i, Otsuki T, Hino T, Yoshida T, Shiro Y. Crystal structure of human indoleamine 2,3-dioxygenase: Catalytic mechanism of O2 incorporation by a heme-containing dioxygenase. Proceedings of the National Academy of Sciences of the United States of America 2006;103:2611-2616. 32. Yamamoto S, Hayaishi O. Tryptophan Pyrrolase of Rabbit Intestine. Journal of Biological Chemistry 1967;242:5260-5266. 33. Hirata F, Hayaishi O, Tokuyama T, Senoh S. In Vitro and in Vivo Formation of Two New Metabolites of Melatonin. Journal of Biological Chemistry 1974;249:1311-1313. 34. Munn DH, Zhou M, Attwood JT, et al. Prevention of Allogeneic Fetal Rejection by Tryptophan Catabolism. Science 1998;281:1191-1193. 35. Munn DH, Shafizadeh E, Attwood JT, Bondarev I, Pashine A, Mellor AL. Inhibition of  T Cell Proliferation by Macrophage Tryptophan Catabolism. The Journal of Experimental Medicine 1999;189:1363-1372. 36. Hwu P, Du MX, Lapointe R, Do M, Taylor MW, Young HA. Indoleamine 2,3-Dioxygenase Production by Human Dendritic Cells Results in the Inhibition of T Cell Proliferation. The Journal of Immunology 2000;164:3596-3599. 73  37. Mellor AL, Munn DH. Creating immune privilege: active local suppression that benefits friends, but protects foes. Nat Rev Immunol 2008;8:74-80. 38. Pfefferkorn ER, Rebhun S, M E. Characterisation of an indolamine 2,3-dioxygenase induced by gamma-interferon in cultured human fibroblasts. Journal of Interferon Research 1986;6:267-279. 39. Schroten H, Spors B, Hucke C, et al. Potential Role of Human Brain Microvascular Endothelial Cells in the Pathogenesis of Brain Abscess: Inhibition of Staphylococcus aureus by Activation of Indoleamine 2,3-Dioxygenase. Neuropediatrics 2001;32:206,10. 40. Adam RA, Tenenbaum T, Valentin-Weigand P, et al. Porcine Choroid Plexus Epithelial Cells Induce Streptococcus suis Bacteriostasis In Vitro. Infection and Immunity 2004;72:3084-3087. 41. Mackenzie CR, Hucke C, MÜller D, Seidel K, Takikawa O, DÄubener W. Growth inhibition of multiresistant enterococci by interferon-γ-activated human uro-epithelial cells. Journal of Medical Microbiology 1999;48:935-941. 42. Byrne GI, Lehmann LK, Landry GJ. Induction of tryptophan catabolism is the mechanism for gamma-interferon-mediated inhibition of intracellular Chlamydia psittaci replication in T24 cells. Infection and Immunity 1986;53:347-351. 43. MacKenzie CR, Hadding U, Däubener W. Interferon-γ-Induced Activation of Indoleamine 2,3- Dioxygenase in Cord Blood Monocyte-Derived Macrophages Inhibits the Growth of Group B Streptococci. Journal of Infectious Diseases 1998;178:875-878. 44. Woods M.E., J.P. O. Host defenses to Rickettsia rickettsii infection contribute to increased microvascular permeability in human cerebral endothelial cells. J Clin Immunol 2008;28:174-185. 45. Takikawa O, Littlejohn TK, Truscott RJW. Indoleamine 2,3-dioxygenase in the Human Lens, the First Enzyme in the Synthesis of UV Filters. Experimental Eye Research 2001;72:271-277. 46. Saada JI, Pinchuk IV, Barrera CA, et al. Subepithelial Myofibroblasts are Novel Nonprofessional APCs in the Human Colonic Mucosa. The Journal of Immunology 2006;177:5968-5979. 47. Puccetti P, Grohmann U. IDO and regulatory T cells: a role for reverse signalling and non- canonical NF-[kappa]B activation. Nat Rev Immunol 2007;7:817-823. 74  48. Fallarino F, Grohmann U, You S, et al. The Combined Effects of Tryptophan Starvation and Tryptophan Catabolites Down-Regulate T Cell Receptor ζ-Chain and Induce a Regulatory Phenotype in Naive T Cells. The Journal of Immunology 2006;176:6752-6761. 49. Delgoffe GM, Kole TP, Zheng Y, et al. The mTOR Kinase Differentially Regulates Effector and Regulatory T Cell Lineage Commitment. Immunity 2009;30:832-844. 50. Ito T, Yang M, Wang Y-H, et al. Plasmacytoid dendritic cells prime IL-10–producing T regulatory cells by inducible costimulator ligand. The Journal of Experimental Medicine 2007;204:105- 115. 51. Cobbold S, Adams E, Nolan K, F R, Waldmann H. Connecting the mechanisms of T-cell regulation. dendritic cells as the missing link. Immunology Reviews 2003;236:203-218. 52. Amaravadi R., Thompson CB. The survival kinases Akt and Pimn as potential pharmacological targets. J Clin Invest 2005;115:2618-2624. 53. Jürgens B, Hainz U, Fuchs D, Felzmann T, Heitger A. Interferon-γ–triggered indoleamine 2,3- dioxygenase competence in human monocyte-derived dendritic cells induces regulatory activity in allogeneic T cells. Blood 2009;114:3235-3243. 54. Jalili RB, Forouzandeh F, Rezakhanlou AM, et al. Local Expression of Indoleamine 2,3 Dioxygenase in Syngeneic Fibroblasts Significantly Prolongs Survival of an Engineered Three- Dimensional Islet Allograft. Diabetes 2010;59:2219-2227. 55. Itoh M, Takahashi T, Sakaguchi N, et al. Thymus and Autoimmunity: Production of CD25+CD4+ Naturally Anergic and Suppressive T Cells as a Key Function of the Thymus in Maintaining Immunologic Self-Tolerance. The Journal of Immunology 1999;162:5317-5326. 56. Chung DJ, Rossi M, Romano E, et al. Indoleamine 2,3-dioxygenase–expressing mature human monocyte-derived dendritic cells expand potent autologous regulatory T cells. Blood 2009;114:555-563. 57. King NJC, Thomas SR. Molecules in focus: Indoleamine 2,3-dioxygenase. The International Journal of Biochemistry &amp; Cell Biology 2007;39:2167-2172. 75  58. Pfefferkorn ER. Interferon gamma blocks the growth of Toxoplasma gondii in human fibroblasts by inducing the host cells to degrade tryptophan. Proceedings of the National Academy of Sciences 1984;81:908-912. 59. Daubener W., Schmidt S.K., Heseler K., Spekker K., C.R. M. Antimicrobial and immunoregulatory effector mechanisms in human endothelial cells. Thrombosis and Haemostasis 2009;102:1110-1116. 60. Katz JB, Muller AJ, Prendergast GC. Indoleamine 2,3-dioxygenase in T-cell tolerance and tumoral immune escape. Immunological Reviews 2008;222:206-221. 61. Joffre O, Santolaria T, Calise D, et al. Prevention of acute and chronic allograft rejection with CD4+CD25+Foxp3+ regulatory T lymphocytes. Nat Med 2008;14:88-92. 62. Yuen-Shan Tsang J, Tanriver Y, Jiang S, et al. Indefinite mouse heart allograft survival in recipient treated with CD4+CD25+ regulatory T cells with indirect allospecificity and short term immunosuppression. Transplant Immunology 2009;21:203-209. 63. Dijke IE, Weimar W, Baan CC. Regulatory T cells after organ transplantation: Where does their action take place? Human Immunology 2008;69:389-398. 64. Pallotta MT, Orabona C, Volpi C, et al. Indoleamine 2,3-dioxygenase is a signaling protein in long-term tolerance by dendritic cells. Nat Immunol 2011;12:870-878. 65. Dai W, Gupta SL. Regulation of indoleamine 2,3-dioxygenase gene expression in human fibroblasts by interferon-gamma. Upstream control region discriminates between interferon-gamma and interferon-alpha. Journal of Biological Chemistry 1990;265:19871-19877. 66. Forouzandeh F, Jalili RB, Germain M, Duronio V, Ghahary A. Skin cells, but not T cells, are resistant to Indoleamine 2, 3-Dioxygenase (IDO) expressed by allogeneic fibroblasts. Wound Repair and Regeneration 2008;16:379-387. 67. Forouzandeh F, Jalili R, Germain M, Duronio V, Ghahary A. Differential immunosuppressive effect of Indoleamine 2,3-Dioxygenase (IDO) on primary human CD4+ and CD8+ T cells. Molecular and Cellular Biochemistry 2008;309:1-7. 76  68. Curti A, Pandolfi S, Valzasina B, et al. Modulation of tryptophan catabolism by human leukemic cells results in the conversion of CD25– into CD25+ T regulatory cells. Blood 2007;109:2871-2877. 69. Walunas TL, Lenschow DJ, Bakker CY, et al. CTLA-4 can function as a negative regulator of T cell activation. Immunity 1994;1:405-413. 70. Medina A, A. G. Fibrocytes can be reprogrammed to promote tissue remodelling capacity of dermal fibroblasts. Molecular and Cellular Biochemistry 2010;344:11-21. 71. Chen H-D, Silvers WK. Influence of Langerhans Cells on the Survival of H-Y Incompatible Skin Grafts in Rats. J Investig Dermatol 1983;81:20-23. 72. Funeshima-Fuji N, Fujino M, Kimura H, et al. Survival of skin allografts is prolonged in mice with a dominant-negative H-Ras. Transpl Immunol 2008;18:302-306. 73. Stubenitsky BM, Brasile L, Rebellato LM, Hawinkels H, Haisch C, Kon M. Delayed skin allograft rejection following matrix membrane pretreatment. Journal of Plastic, Reconstructive &amp; Aesthetic Surgery 2009;62:520-525. 74. Tang Q, Bluestone JA. The Foxp3+ regulatory T cell: a jack of all trades, master of regulation. Nat Immunol 2008;9:239-244. 75. Hall PB, Pearce NW, Gurley KE, SE. D. Specific unresponsiveness in rats with prolonged cardiac survival after treatment with cyclosporine. iii Further characterization of the CD4+ suppressor call and its mechanisms of action. J Exp Med 1990;1:141-157. 76. Bushell A, Wood K. GITR Ligation Blocks Allograft Protection by Induced CD25+CD4+ Regulatory T Cells without Enhancing Effector T-Cell Function. American Journal of Transplantation 2007;7:759-768. 77. Pearce NW, Spinelli A, Gurley KE, Hall BM.Specific unresponsiveness in rats with prolonged cardiac allograft survival after treatment with cyclosporine: V Dependence of CD4+ cells on the presence of alloantigen and cytokines, including IL-21. Transplantation 1993;55:374-379. 78. JS Cook, CI Pogson, Smith. S. Indoleamine 2,3-dioxygenase. A new rapid, sensitive, radiometric assay and its application to the study of the enzyme in rat tissues. Biochem J 1980;189:461-466. 77  79. Boehm U, Klamp T, Groot M, Howard JC. Cellular responses to interferon-γ. Annual Review of Immunology 1997;15:749-795. 80. Jain N, Nguyen H, Chambers C, Kang J. Dual function of CTLA-4 in regulatory T cells and conventional T cells to prevent multiorgan autoimmunity. Proceedings of the National Academy of Sciences 2010;107:1524-1528. 81. Tai X, Van Laethem F, Pobezinsky L, et al. Basis of CTLA-4 function in regulatory and conventional CD4+ T cells. Blood 2012. 82. Orabona C, Pallotta MT, Volpi C, et al. SOCS3 drives proteasomal degradation of Indoleamine 2,3-Dioxygenase (IDO) and antagonizes IDO-dependent tolerogenesis. Proceedings of the National Academy of Sciences 2008;105:20828-20833. 83. Munn DH, Sharma MD, Mellor AL. Ligation of B7-1/B7-2 by Human CD4+ T Cells Triggers Indoleamine 2,3-Dioxygenase Activity in Dendritic Cells. The Journal of Immunology 2004;172:4100- 4110. 84. Moore KW, de Waal Malefyt R, Coffman RL, O'Garra A. Interleukin-10 and the interleukin-10 receptor. Annual Review of Immunology 2001;19:683-765. 85. von Boehmer H. Mechanisms of suppression by suppressor T cells. Nat Immunol 2005;6:338- 344. 86. Mellor AL, Munn DH. Tryptophan catabolism and T-cell tolerance: immunosuppression by starvation? Immunology Today 1999;20:469-473. 87. Pinchuk IV, Beswick EJ, Saada JI, et al. Human Colonic Myofibroblasts Promote Expansion of CD4+ CD25high Foxp3+ Regulatory T Cells. Gastroenterology 2011;140:2019-2030. 88. Chapman JR, Nankivell BJ. Nephrotoxicity of ciclosporin A: short-term gain, long-term pain? Nephrology Dialysis Transplantation 2006;21:2060-2063. 89. Soefje S, Karnad A, Brenner A. Common toxicities of mammalian target of rapamycin inhibitors. Targeted Oncology 2011;6:125-129. 90. Fishman JA, Issa NC. Infection in Organ Transplantation: Risk Factors and Evolving Patterns of Infection. Infectious Disease Clinics of North America 2010;24:273-283. 78  91. Nishimura E, Sakihama T, Setoguchi R, Tanaka K, Sakaguchi S. Induction of antigen-specific immunologic tolerance by in vivo and in vitro antigen-specific expansion of naturally arising Foxp3+CD25+CD4+ regulatory T cells. International Immunology 2004;16:1189-1201. 92. Boehm U, Klamp T, Groot M, Howard JC. Cellular responses to interferon-y. Annual Review of Immunology 1997;15:749-795.   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0072807/manifest

Comment

Related Items