UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Contributions to the ultrastructural diversity and molecular phylogeny of phagotrophic euglenids and… Breglia, Susana Alicia 2012

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2012_spring_breglia_susana.pdf [ 12.88MB ]
Metadata
JSON: 24-1.0072730.json
JSON-LD: 24-1.0072730-ld.json
RDF/XML (Pretty): 24-1.0072730-rdf.xml
RDF/JSON: 24-1.0072730-rdf.json
Turtle: 24-1.0072730-turtle.txt
N-Triples: 24-1.0072730-rdf-ntriples.txt
Original Record: 24-1.0072730-source.json
Full Text
24-1.0072730-fulltext.txt
Citation
24-1.0072730.ris

Full Text

CONTRIBUTIONS TO THE ULTRASTRUCTURAL DIVERSITY AND MOLECULAR PHYLOGENY OF PHAGOTROPHIC EUGLENIDS AND THEIR EPISYMBIONTS by Susana Alicia Breglia A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Zoology) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) April 2012  © Susana Alicia Breglia, 2012  Abstract The Euglenida is a diverse group of single celled eukaryotes with modes of nutrition that include phagotrophy, osmotrophy, and phototrophy. Phototrophic members of the group have attracted the most attention from previous researchers, and some species (e.g., Euglena gracilis) have become models in cell biology research. Phagotrophic euglenids, by contrast, are difficult to cultivate and manipulate so are severely underrepresented in culture collections, comparative ultrastructural studies, and molecular phylogenetic studies. Species discovery and the comparative ultrastructure of phagotrophic euglenids within a phylogenetic context were the main aims of this thesis. These data are essential for a comprehensive knowledge of the overall diversity and evolutionary history of euglenids as a whole, as well as for a better understanding of the relationships with their closest euglenozoan relatives, the Kinetoplastida and the Diplonemida. I generated DNA sequences of heat shock protein 90 and small subunit (SSU) rRNA genes from several different species of phagotrophic euglenids in order to evaluate some of the deepest branches in the phylogeny of euglenozoans, especially the phylogenetic position of Petalomonas cantuscygni. This species has a set of morphological features that are intermediate between kinetoplastids and euglenids (e.g., pellicle strips and kinetoplast-like mitochondrial inclusions). I also characterized the ultrastructure, feeding behaviour, and phylogenetic position of Heteronema scaphurum, a phagotrophic euglenid that feeds on green algal prey and is equipped with a distinctive “cytoproct” or cell anus. My explorations in low oxygen marine sediments led me to discover and characterize a novel lineage of euglenozoans, the “Symbiontida”. Members of this group formed intimate symbiotic relationships with at least two distinct types of epibiotic bacteria: rod-shaped ε-proteobacteria and spherical-shaped verrucomicrobia. I was able to show, using electron microscopy, that the verrucomicrobial symbionts were capable of evasive sporulation using a conspicuous extrusive apparatus that consisted of a thread tightly wound around a central core of DNA. The highly similar episymbionts reported previously on a group of ciliates led to questions 	
    ii	
    about host transfer and the convergent evolution of extrusive organelles across the tree of eukaryotes.  	
    iii	
    Preface I have generated the images included in this study, unless otherwise specified.  A version of Chapter 2 has been published, and is based on my work with the samples of P. cantuscygni and Entosiphon sulcatum that I collected: Breglia, S.A., Slamovits, C.H., and Leander, B.S. (2007). Phylogeny of phagotrophic euglenids (Euglenozoa) as inferred from hsp90 gene sequences. J. Eukaryot. Microbiol. 52: 86-94. I did the field work and cell isolation, generated the micrographs, and performed the molecular work (Hsp 90 cloning and sequencing). I performed the majority of the phylogenetic analysis, interpretation and discussion, and wrote the paper. Dr. Slamovits assisted with the AU tests and intron description. Dr. Leander funded and supervised the collection and interpretation of data, and contributed to writing the paper.  A version of Chapter 3 has been submitted and accepted for publication, and is based on my work on Heteronema scaphurum. Breglia, S.A., Yubuki, and Leander, B.S. Accepted pending minor revisions. Ultrastructure and molecular phylogenetic position of Heteronema scaphurum: A eukaryovorous euglenid with a cytoproct. I collected and maintained the culture of H. scaphurum cells; generated the LM, SEM, TEM, and SSU rDNA sequence data; and wrote the manuscript. Dr. Yubuki generated the thin sections for TEM, and contributed to the interpretation of TEM data. Dr. Leander funded and supervised the collection and interpretation of data,  	
    iv	
    and contributed to writing the paper. Mr. Dan Holloway provided the water samples in which H. scaphurum was found.  A version of Chapter 4 has been published: Breglia, S.A., Yubuki, N., Hoppenrath, M. and Leander, B.S. (2010). Ultrastructure and molecular phylogentic position of a novel euglenozoan with extrusive episymbiotic bacteria: Bihospites bacati n. gen. et sp. (Symbiontida). BMC Microbiol 10:145. I carried out the field work, the single-cell isolation, generated the light and scanning electron micrographs; analysed the TEM data, for which I produced the figures included in the paper; and performed the molecular work (SSU rDNA sequence data, sequence editing and phylogenetic analysis); and wrote the manuscript. Dr. Yubuki generated the TEM data and helped with the phylogenetic analyses and interpretation of the TEM data. Dr. Hoppenrath carried out the sampling, identification, and LM work of the German material and helped with the identification of the Canadian material. Dr. Leander funded and supervised the collection and interpretation of data, and contributed to writing the paper.  Chapter 5 is based on my study on the bacterial episymbionts of Bihospites bacati. I collected the sediment samples from Boundary Bay; generated the light and scanning electron micrographs; analysed the TEM data, for which I produced the figures included in the paper; generated the bacterial 16S rDNA sequence data; and wrote the manuscript. Dr. Yubuki generated the TEM data and helped with their interpretation. Dr. Leander funded and supervised the interpretation of data, and contributed to writing the paper.  	
    v	
    As part of my work in Dr. Leander’s laboratory at UBC, and in collaboration with the Woods Hole Oceanographic Institution, the following paper was generated: Edgcomb, V.P., Breglia, S., Yubuki, N., Beaudoin, Patterson, D. J., D., Leander, B.S., and Bernhard, J. (2011). Identity of epibiotic bacteria on symbiontid euglenozoans in O2-depleted marine environments: evidence for symbiont and host co-evolution. The ISME Journal. 5: 231-243. I was responsible for the collection and single-cell isolation of the samples containing cells of Bihospites bacati from Boundary Bay; I also generated the light and scanning electron micrographs corresponding to Bihospites bacati and its episymbiont; analysed the TEM data, for which I produced the figures included in the paper; and generated the bacterial 16S rDNA sequence data corresponding to Bihospites bacati’s ε-proteobacterial episymbiont.  Part of the work described in this thesis was also included in the following review paper, along with other work conducted in Dr. Leander’s laboratory at UBC: Leander, B.S., Esson, H.J., and Breglia, S.A. 2007. Macroevolution of complex cytoskeletal systems in euglenids. BioEssays. 29:987-1000. I contributed in the review with the writing of the section ‘Evolutionary morphology of the euglenid feeding apparatus’, from which Figure 6 is included in the Introduction of this thesis, as Figure 1.7.  	
    vi	
    Table of Contents Abstract ................................................................................................................ ii Preface ................................................................................................................. iv Table of contents ............................................................................................... vii List of tables....................................................................................................... xii List of figures .................................................................................................... xiii Glossary……………………………………………………………………………….xvii Acknowledgements .......................................................................................... xix Dedication.......................................................................................................... xxi 1 Introduction 1.1 The diversity of microbial eukaryotes.......................................................1 1.2 Euglenids: what are they?........................................................................2 1.2.1 The euglenid pellicle .......................................................................5 1.2.2 Phagotrophic euglenids...................................................................8 1.3 Phylogeny of Euglenozoa as background to understanding feeding structures, and origin of photosynthesis in euglenids...............................9 1.3.1 Problems with SSU rDNA and taxon sampling .............................14 1.4 The euglenid feeding apparatus ............................................................14 1.5 Euglenids in low oxygen environments..................................................19 2 Phylogeny of phagotrophic euglenids (Euglenozoa) as inferred from hsp90 gene sequences 2.1 Synopsis ................................................................................................22 2.2 Materials and methods...........................................................................26 2.2.1 Collection of organisms.................................................................26  	
    vii	
    2.2.2 DNA isolation, amplification, and sequencing ...............................27 2.2.3 Alignments ....................................................................................28 2.2.4 Molecular phylogenetic analyses ..................................................30 2.3 Results ...................................................................................................31 2.4 Discussion..............................................................................................35 2.4.1 Non-conventional introns in hsp90 of phagotrophic euglenids .....35 2.4.2 Phylogeny and character evolution ...............................................37 3 Ultrastructure and molecular phylogenetic position of Heteronema scaphurum: a eukaryovorous euglenid with a cytoproct 3.1 Synopsis…………………………………………………………………….. 40 3.2 Materials and methods...........................................................................41 3.2.1 Cell isolation and cultivation..........................................................41 3.2.2 Light microscopy and video analysis.............................................41 3.2.3 Electron microscopy......................................................................42 3.2.4 DNA extraction and PCR amplification .........................................42 3.2.5 Multiple sequence alignment and molecular phylogenetic analyses ......................................................................................................43 3.3 Results ...................................................................................................44 3.3.1 General morphology......................................................................44 3.3.2 Feeding behaviour ........................................................................46 3.3.3 Cell surface ...................................................................................47 3.3.4 Cytoplasmic organelles .................................................................48 3.3.5 Feeding apparatus ........................................................................50 3.3.6 Flagellar apparatus .......................................................................53  	
    viii	
    3.3.7 Molecular phylogenetic position ....................................................56 3.4 Discussion..............................................................................................58 3.4.1 Pellicle...........................................................................................59 3.4.2 Feeding apparatus ........................................................................60 3.4.3 Faecal pellets in single-celled eukaryotes.....................................61 3.4.4 Heteronema scaphurum: ultrastructural identity and phylogenetic position..........................................................................................62 3.5 Taxonomic summary..............................................................................62 3.5.1 Description ....................................................................................62 4 Ultrastructure and molecular phylogenetic position of a novel euglenozoan with extrusive episymbiotic bacteria: Bihospites bacati n. gen. et sp. (Symbiontida) 4.1 Synopsis ................................................................................................64 4.2 Materials and methods...........................................................................66 4.2.1 Collection of organisms.................................................................66 4.2.2 Light and electron microscopy ......................................................67 4.2.3 DNA extraction, PCR amplification, alignment and phylogenetic analysis ..........................................................................................67 4.3 Results ...................................................................................................69 4.3.1 General morphology......................................................................69 4.3.2 Cell surface ...................................................................................71 4.3.3 Nucleus, C-shaped rod apparatus, cytostomal funnel, and vestibulum .....................................................................................76 4.3.4 Flagellar root system.....................................................................84 4.3.5 Molecular phylogenetic position ....................................................88 4.4 Discussion..............................................................................................90 	
    ix	
    4.4.1 Remnants of pellicle strips ............................................................90 4.4.2 A novel feeding apparatus consisting of rods ...............................91 4.4.3 Extrusomes ...................................................................................93 4.4.4 Episymbiotic bacteria ....................................................................93 4.4.5 Identity and composition of the Symbiontida ................................95 4.5 Formal taxonomic descriptions ..............................................................97 4.5.1 Bihospites n. gen...........................................................................97 4.5.2 Bihospites bacati n. sp, .................................................................98 4.5.3 Registration of new genus and species name in ZooBank .........100 5 Evasive sporulation in episymbiotic verrucomicrobial bacteria 5.1 Synopsis ..............................................................................................101 5.2 Materials and methods.........................................................................102 5.2.1 Collection of organisms...............................................................102 5.2.2 Light and electron microscopy ....................................................102 5.2.3 DNA extraction, PCR amplification, alignment, and phylogenetic analysis .......................................................................................103 5.3 Results .................................................................................................104 5.3.1 Ultrastructural features................................................................104 5.3.2 Molecular phylogenetic analyses ................................................109 5.4 Discussion............................................................................................112 5.4.1 Possible origins of eviscerating symbiotic bacteria .....................113 5.4.2 Eviscerating symbiotic bacteria and eukaryotic extrusive organelles ....................................................................................................113 6 Conclusions  	
    x	
    6.1 Euglenids .............................................................................................117 6.2 Phagotrophic euglenids .......................................................................118 6.2.1 The phylogeny of phagotrophic euglenids ..................................119 6.2.2 Inclusions in the mitochondrion of Petalomonas.........................122 6.2.3 The ultrastructure of phagotrophic euglenids..............................123 6.3 Relationships with episymbiotic bacteria .............................................125 6.4 Summary and outlook ..........................................................................127 Bibliography .....................................................................................................131  	
    xi	
    List of Tables  Table 2.1 Accession numbers (NCBI nucleotide and protein databases) for the sequences employed in this study ......................................................29 Table 2.2 p values for approximately unbiased likelihood tests of five alternative positions of Petalomonas cantuscygni................................................35  	
    xii	
    List of Figures  Figure 1.1. Morphological diversity of microbial eukaryotes from my environmental samples, using scanning electron microscopy ...........2 Figure 1.2. Morphological diversity of euglenids using scanning electron microscopy .........................................................................................3 Figure 1.3. Transmission electron micrograph (TEM) of a cross section of the euglenid pellicle, and SEM showing euglenoid movement ................5 Figure 1.4. Scanning electron micrographs showing the euglenid pellicle ...........6 Figure 1.5. Scanning electron micrographs of a euglenid cell during cytokinesis.7 Figure 1.6. Scanning electron micrographs of phagotrophic euglenids ................8 Figure 1.7. Illustration of euglenozoan relationships………………………………11 Figure 1.8. Comparative morphology of the euglenid feeding apparatus ...........16 Figure 1.9. Light and scanning electron micrographs of the bacterivorous euglenids Ploeotia costata and Entosiphon sulcatum........................17 Figure 1.10. SEMs of the bacterivorous euglenid Entosiphon sulcatum showing the feeding apparatus (siphon) in motion .........................................18 Figure 1.11. LM and SEM of the eukaryovorous euglenid Dinema sp................19  Figure 2.1. Hypothetical frameworks for inferring character evolution within the Euglenozoa, considering two different phylogenetic positions for 	
    xiii	
    Petalomonas cantuscygni ................................................................25  Figure 2.2. LMs of wild isolates of two phagotrophic euglenids from which heat shock protein 90 genes were sequenced.........................................27  Figure 2.3. Euglenozoan phylogeny as inferred from the heat-shock protein 90 gene .................................................................................................32 Figure 2.4. Topologies used in approximately unbiased (AU) likelihood tests....34  Figure 3.1. LMs showing fixed cells of Heteronema scaphurum ........................44 Figure 3.2. SEMs of Heteronema scaphurum.....................................................45 Figure 3.3. Time series of video microscope images of Heteronema scaphurum feeding on the green alga Chlamydomonas.....................................47 Figure 3.4. TEMs of Heteronema scaphurum.....................................................49 Figure 3.5. TEMs showing the feeding apparatus in Heteronema scaphurum ...51 Figure 3.6. TEMs showing the feeding apparatus in Heteronema scaphurum ...53 Figure 3.7. TEMs of the flagellar apparatus of Heteronema scaphurum ............55 Figure 3.8. Maximum likelihood tree, inferred from 39 small subunit (SSU) rDNA sequences ........................................................................................57  	
    xiv	
    Figure 4.1. LMs of living cells of Bihospites bacati n. gen. et sp. .......................70 Figure 4.2. SEMs of Bihospites bacati n. gen. et sp. ..........................................72 Figure 4.3. TEMs of the cell surface of Bihospites bacati n. gen. et sp. .............74 Figure 4.4. TEMs of Bihospites bacati n. gen. et sp. showing intracellular bacteria and extrusomes ..................................................................75 Figure 4.5. TEMs of non-consecutive serial sections of Bihospites bacati n. gen. et sp. through the vestibular region of the cell..................................77 Figure 4.6. TEMs of non-consecutive serial sections through the flagellar apparatus and feeding pockets of Bihospites bacati n. gen. et sp. ..79 Figure 4.7. TEMs of non-consecutive serial sections through the anterior part of the nucleus of Bihospites bacati n. gen. et sp. .................................81 Figure 4.8. TEMs of non-consecutive serial sections through the posterior part of the nucleus of Bihospites bacati n. gen. et sp. .................................82 Figure 4.9. Diagrams showing a reconstruction of the ultrastructure of Bihospites bacati n. gen. et sp. ..........................................................................83 Figure 4.10. TEMs showing sections of basal bodies, flagellar roots and associated structures, of Bihospites bacati n. gen. et sp................86 Figure 4.11. TEMs of Bihospites bacati n. gen. et sp. showing the emergence and organization of the flagella.......................................................87 Figure 4.12. Phylogenetic position of Bihospites bacati n. gen. et sp. within the Euglenozoa as inferred from small subunit (SSU) rDNA sequences ........................................................................................................89  	
    xv	
    Figure 5.1. Light micrographs (LM) showing eviscerating verrucomicrobial episymbionts on Bihospites bacati (Euglenozoa, Symbiontida) .....105 Figure 5.2. TEMs and SEMs showing details of the eviscerating verrucomicrobial symbionts on Bihospites bacati (Euglenozoa, Symbiontida)..........107 Figure 5.3. Illustration showing the life cycle of the eviscerating symbiotic bacteria on Bihospites bacati .........................................................109 Figure 5.4. Maximum likelihood tree inferred from 16S rDNA sequences from …62 eubacterial taxa showing the phylogenetic position of the eviscerating symbionts on Bihospites (Euglenozoa) ......................111 Figure 5.5. Illustration showing the phylogenetic distribution of eviscerating symbiotic bacteria across the tree of eukaryotes ...........................112  Figure 6.1. Diversity of phagotrophic euglenids................................................118 Figure 6.2. Present state of euglenid phylogeny based on SSU rDNA sequences, and hypothetical phylogeny derived from cladistic analysis of morphological characters ...............................................................121 Figure 6.3. SEMs of wild isolates of two phagotrophic euglenids from which heat shock protein 90 genes were sequenced.......................................122  	
    xvi	
    Glossary Apical: Anteriorly located. Cytoproct: Cell anus. In this case it refers to a dimple in the pellicle, at the posterior end of the cell body, through which waste matter is released. Epibiotic = episymbiotic bacteria: Bacteria that live on the surface of another organism (e. g., the host), in this case in a symbiotic relationship. Extrusomes: Membrane-bounded extrusible body, usually located beneath the pellicle, and that are ejected under chemical or mechanical stimulation. In euglenids, extrusomes are tubular. Heterotrophic euglenids: Those species of euglenids whose nutrition is obtained by digesting organic substances. They can be devided in either osmotrophs, or phagotrophs. Kinetoplast: the network of compacted, circular DNA (called kDNA) inside the mitochondrion of Kinetoplastids, which contains the mitochondrial genome. There are several structures of kDNA, (i.e., pan-kDNA; pro-kDNA; polykDNA; mega-kDNA; kDNA network), that reflect the evolutionary relationships between species of Kinetoplastids. Mastigonemes: Flagellar hairs. Fine filamentous appendages associated with the flagella in many flagellates. They are usually arranged in one or more rows of thin, delicate, and non-tubular units. Tubular hairs, on the other hand, consist of two distinct regions, one being thick and tubular. In the case of euglenids, mastigonemes are non-tubular. Metaboly: In many euglenid species, the strips in the pellicle can slide along one another, enabling the cell to distort and twist its shape in a peristaltic manner, also known as “euglenoid movement”. Osmotrophs: Organisms whose nutrition is based in the absorption or uptake of dissolved organic molecules by osmosis. Pellicle: The cytoskeletal complex of euglenids consisting of the plasma membrane, proteinaceous strips, microtubules, and tubular cisternae of endoplasmic reticulum.  	
    xvii	
    Phagotrophs: Organisms whose nutrition is obtained by actively capturing and digesting organic preys. In euglenids, phagotrophic species can be roughly divided in “bacterivores” (those that ingest bacteria-sized particles) or “eukaryovores” (those that ingest larger particles that might include other microeukaryotes). Rods: In phagotrophic euglenids, cluster of microtubules and amorphous proteinaceous material oriented longitudinally within the cell. They form the feeding structures along with the vanes, giving structural support to the cytostome when engulfing prey cells. Strips: A repeating proteinaceous structure that lies directly below the plasma membrane and consists primarily of a frame that is often sigmoidal in transverse section. Vanes: In phagotrophic euglenids, a set of membranous folds that surround the cytostome. The vanes originate from the rods, and as the prey is engulfed, the vanes rotate open in a pinwheel-like fashion, creating a space within the feeding apparatus. Whorl of strip reduction: In some phototrophic and primary osmotrophic euglenid species, pellicle strips terminate before reaching the posterior end of the cell, forming a circular, or ‘‘whorled’’ pattern on the cell surface. Yhe total number of pellicle strips around the cell periphery is thus reduced at the point of strip termination.  	
    xviii	
    Acknowledgements First and foremost, I would like to express my sincere gratitude to my supervisor, Dr. Brian Leander, for giving me the opportunity to realize my dream of obtaining a PhD degree. For his support and patience throughout this research work, and for believing in me. Always encouraging and ready to answer to my questions, in my moments of doubt he gave me the space that I needed. I am also very thankful for the time and effort he took in revising and correcting my drafts. His enthusiasm for the spectacular world of the microbes is contagious. I would also like to thank my committee members, Dr. Naomi Fast, Dr. James Berger, Dr. Martin Adamson, and Dr. Mary Berbee for their showed interest, comments, and helpful insights. A special thank to everyone in Dr. Brian Leander’s lab, especially to Dr. Sonja Rueckert, Dr. Heather Esson, Dr. Naoji Yubuki, Dr. Mona Hoppenrath, Dr. Chitchai Chantangsi and Sarah Sparmann, for creating such an enjoyable working atmosphere, where help and encouragement turned into life-lasting friendship. In a truly learning community where we all collaborated with each other, I acquired knowledge and skills essential for my training. I would like to thank Garnet Martens and Derrick Horne for their invaluable help and training with the electron microscopes, especially in those times when the latter wouldn’t do what I wanted them to do. I keep good memories of the time spent at the Bioimaging Facility. I offer sincere thanks to Alice Liou, Zoology Graduate Program Secretary, for her prompt help with every problem that I encountered, especially since my moving to another province. I need to express my eternal gratitude to the whole Leander lab, Keeling lab, and Fast lab, as well as to all my friends in Acadia Park, at UBC, for their constant  	
    xix	
    support throughout my illness, and for their amazing gift. I’d like to especially thank Dr. Celeste Leander for organizing this. It was incredibly helpful; I’ll never forget it. Many thanks to Dr. Slamovits, at Dalhousie University, for giving me the space to continue with my research and writing after my moving from British Columbia to Nova Scotia. Also, to everyone in the Slamovits’ lab, especially Dr. Gillian Gile and Dr. Banoo Malik, as well as Dr. Eleni Gentekaki of the Roger’s lab, for their warm welcome, and for giving me a much needed sense of scientific community. Finally, I need to express my huge thanks to my family: to my parents, who have tirelessly supported and encouraged me throughout my life, and who taught me the importance of knowledge, and of pursuing one’s dreams; to my sisters, who are proud of me, even though they have no idea of what I do; to my incredible husband, Claudio, who has been more than a life companion, he is also my inspiration and my mentor; to my wonderful daughters, for putting up so many times with ‘mommy is working’, and for giving me the joy and pride necessary to feel, in every sense, fulfilled.  	
    xx	
    To my loving parents and sisters, For their constant support and confidence in me,  To my wonderful husband, To whom I owe more than I can express,  To my beautiful daughters, The reason of my life.  	
    xxi	
    1 INTRODUCTION  1.1 The diversity of microbial eukaryotes The number of protistan species, and the variety of structures, sizes, and shapes they present, are proving to be far greater than ever suspected (Adl et al., 2007; Corliss, 2002) (Fig. 1.1). Advances in microscopy and molecular biology over the last decade have sparked more awareness of the tremendous diversity that exists at a microbial scale and of the critical roles that these microeukaryotes play in our biosphere. Microbial eukaryotes are ubiquitous, thriving in every possible environment including extreme habitats, like deep-sea sulfidic sediments (Buck and Bernhard, 2002), hydrothermal vents (Edgcomb et al., 2002), oxygendepleted sediments (Bernhard et al., 2000) or anoxic deep waters (Behnke et al., 2006; Buck and Bernhard, 2002; Dawson and Pace, 2002; Fenchel et al., 1995; Stoeck et al., 2003; Takishita et al., 2007; Zuendorf et al., 2006). They survive extreme ranges in temperature (Camacho, 2007; Fell et al., 2006), pH levels (Pedersen and Hansen, 2003), salinity, atmospheric pressure (Roberts, 1999), etc. After more than a century of research, we have only described a small fraction of the microeukaryotic diversity and have characterized even fewer in detail.  1  Figure 1.1. Morphological diversity of microbial eukaryotes from my environmental samples, using scanning electron microscopy (SEM). A. Euglyphid (Cercozoan). B. Cercozoan. C-D Choanoflagellates (Opisthokonts). E. Dinoflagellate (Alveolate). F. Haptophyte (Stramenopile). G. Dinoflagellate (Alveolate). H. Haptophyte (Stramenopile). I. Dinoflagellate (Alveolate). J. Diatom (Stramenopile). K. Cercozoan. L. Cercomonad (Cercozoan). M. Haptophyte (Stramenopile). N. Choanoflagellate (Opisthokont). O. Haptophyte (Stramenopile). P. Euglyphid (Cercozoan). Scale bars = 5 µm. © Susana Breglia.  1.2 Euglenids: what are they? Among the unicellular eukaryotes, the Euglenida comprise a group of predominantly free-living, biflagellated organisms adapted to different aquatic environments, such as inter-tidal and estuarine habitats, freshwater lakes, and  2  anoxic sediments (Fig. 1.2). Euglenids are very diverse in size and shape, as well as in modes of nutrition, that include specific kinds of heterotrophy such as osmotrophy (acquisition of nutrients by absorption of organic molecules from the environment), bacterivory (the ability to feed on bacteria), eukaryovory (the ability to feed on other eukaryotes) and phototrophy.  Figure 1.2. Morphological diversity of euglenids using scanning electron microscopy (SEM). A. Bacterivorous species (Entosiphon sulcatum). B-E. Eukaryovorous species. (B = Peranema tricophorum. C = Heteronema spirale. D = Unknown species. E = Urceolous sp.). F. Osmotroph (Rhabdomonas sp). G. Phototroph, unknown species. (Scale bars = 5 µm). © Susana Breglia.  Euglenids are relatives of kinetoplastids, a group that includes obligate vertebrate parasites that are the etiological agents of serious diseases, such as Sleeping Sickness and Chagas’ disease; and of diplonemids, a much smaller group of free-living phagotrophs. These three lineages form the monophyletic taxon Euglenozoa, a group included within the supergroup Excavata. However, the  3  sister group relationships between the Euglenozoa and other excavates is still unclear. Furthermore, the entire supergroup Excavata is still contentious, as it is not very well supported by molecular phylogenies. (Baldauf, 2003; CavalierSmith, 2003; Simpson and Patterson, 2008).  The combination of plant-like and animal-like nutritional modes in euglenids has attracted both botanists and zoologists for decades, and certain euglenid species, such as Euglena gracilis, have been model organisms in cell biological research (see for example Greenblatt and Schiff, 1959; Price and Vallee, 1962; Wolken, 1977; Macor et al., 1996; Einicker-Lamas et al., 2002). The study of euglenids in general, and of phagotrophic species in particular, is important for a variety of reasons. From an ecological perspective, euglenids are of significance in the food web as bacteria consumers, thus helping to control bacterial production; they play a role in recycling nutrients and as food source for other protists and organisms of higher trophic levels; they also serve as indicators of the health of aquatic ecosystems (some euglenids thrive in polluted waters, favouring those environments that are richer in organic matter). Some species are producers of neurotoxins that are occasionally responsible for large-scale fish kills in freshwater environments (Zimba et al., 2010). Several characters distinguish euglenids from other eukaryotes, such as the presence of membrane-bound granules of a crystallized β 1,3-glucan storage product called ‘paramylon’ (Gottlieb, 1850), chromosomes that are permanently condensed throughout the cell cycle (see Leedale, 1958; 1967; Triemer, 1985) and, most distinctively, a cytoskeleton called the ‘pellicle’ (see Roth, 1959; Hofmann and Bouck, 1976; Leedale, 1964).  4  1.2.1 The euglenid pellicle As mentioned above, the most distinctive ultrastructural feature of euglenids is a pellicle, formed by four main components: the plasma membrane, a pattern of repeating and interlocking S-shaped strips of articulin proteins, microtubules subtending the strips, and tubular cisternae of endoplasmic reticulum (a reservoir for Ca++) (Fig. 1.3A) (Leander and Farmer, 2000b; Leander and Farmer, 2001b; Triemer and Farmer, 1991b). The strips run lengthwise over the cell, articulating with one another along their lateral margins (Fig. 1.3A-B) (Leander and Farmer, 2001b). Some euglenids have rigid cells, whereas others are very plastic, being able to squirm and twist. The ability to distort their shape is called ‘euglenoid movement’ or metaboly (Fig. 1.3 B-C).  Figure 1.3. A. Transmission electron micrograph of a cross section of the euglenid pellicle, showing interlocking S-shaped strips (S), zones of articulation between strips (arrowhead), microtubules (mt), plasma membrane (PM) and cisterna of endoplasmic reticulum (ER) Scale bar = 500 nm. B-C. Scanning electron micrographs showing the euglenoid movement in Peranema trichophorum. B. Cell in a relaxed position. C. Same cell as in B, in a contracted and twisted position. Scale bars = 5 µm. © Susana Breglia.  5  Cell plasticity depends largely on the number and disposition of pellicle strips on the cell surface. Cells with few strips (i.e. less than twelve) usually have little or no plasticity, and the strips appear longitudinally arranged on the cell surface (Fig. 1.4A). Conversely, cells that perform metaboly have more than twenty strips, and these are helically arranged (Fig. 1.4B) (Leander and Farmer, 2001b; Leander et al., 2007; Suzaki and Williamson, 1986a).  Figure 1.4. Scanning electron micrographs showing the euglenid pellicle. A. Euglenid with few, longitudinally arranged strips and a rigid cell. Scale bar = 1 µm. B. Euglenid with more than 20 helically arranged strips, and the ability of performing metaboly. (Scale bar = 5 µm). © Susana Breglia.  The variation in strip numbers is thought to reflect events of incomplete cytokinesis during euglenid evolution. Prior to cytokinesis, euglenids double the number of strips in the pellicle (Fig. 1.5A). After division, each daughter cell normally has the same number of strips as the mother cell (Fig. 1.5B) (Esson and Leander, 2006; Mignot et al., 1987).  6  Figure 1.5. Scanning electron micrographs of a euglenid cell during cytokinesis. A. Cell prior to division. The flagella, normally two in this species, have doubled their number to four. The pellicle strips have also duplicated (arrowheads). The newest strips are thinner than the original ones. Scale bar = 10 µm. B. Cell dividing along an anterior-posterior axis. The daughter cells have the same number of strips of the mother cell. © Susana Breglia.  Leander and Farmer proposed that a failure to start or complete the process of strip duplication in preparation for cell division caused variation in the total number of strips in different species (Leander and Farmer, 2001b). For instance, a cell that duplicated its strips but failed to divide would end up with twice as many strips as before; a cell that divided before duplicating its strips would result in daughter cells with half as many strips as before. Leander and Farmer also showed that the diversity of pellicle surface patterns provided information useful for discriminating among different euglenid lineages (Esson and Leander, 2006; Leander and Farmer, 2001a; Leander and Farmer, 2001b; Leander et al., 2001b). For example, bacterivores, as well as derived lineages of phototrophic euglenids, have few, longitudinally arranged strips (Fig. 1.6A), whereas many eukaryovores, primary osmotrophs and phototrophic euglenids possess pellicles with numerous, helically arranged strips (Fig. 1.6B). In many species of euglenids, pellicle strips terminate before reaching the anterior and/or the posterior end of the cell, producing patterns of strip reduction. In order to understand the origin and development of these patterns, Esson, working in the Leander lab, analyzed species of Euglena and Phacus at different  7  dividing stages, using scanning electron microscopy (SEM). Esson and Leander proposed a model for the morphogenesis of strip reduction patterns that invokes a differential growth in the strips duplicating previous to cell division. In other words, when the cell divides, the newly developed strips had not fully grown, resulting in a whorl of strip reduction (Esson and Leander, 2006). These patterns are useful indicators of phylogenetic relationships among phototrophic euglenids (Leander and Farmer, 2000b; Leander et al., 2001b; Leander et al., 2007).  Figure 1.6. Scanning electron micrographs of phagotrophic euglenids. A. Bacterivorous euglenid with few longitudinally arranged strips. Arrow shows longitudinally arranged strips. Scale bar = 2 µm. B. Eukaryovorous euglenid with numerous helically arranged strips. Arrow shows helically arranged strips. Scale bar = 5 µm. © Susana Breglia.  1.2.2 Phagotrophic euglenids Phagotrophic euglenids are either bacterivorous or eukaryovorous. Early classifications, based on morphological characters observed with light microscope, divided phagotrophic euglenids into two subgroups or ‘suborders’: the Heteronematales (= Heteronematina) and Sphenomonadales (= Sphenomonadina) (Busse et al., 2003; Larsen and Patterson, 1991; Triemer and Farmer, 1991a). This division was based on whether a feeding apparatus was ‘present’ (Heteronematales) or ‘absent’ (Sphenomonadales) in the cell. However,  8  this classification is no longer acceptable, as feeding structures previously undetected with LM are now more readily observed with transmission electron microscopy (TEM). Moreover, “Heteronematales” and “Sphenomonadales” are not monophyletic groups, and thus have, in my opinion, no validity within a modern classification scheme based on phylogenetic history.  1.3. Phylogeny of Euglenozoa as background to understanding feeding structures, and origin of photosynthesis in euglenids As mentioned above, both morphological and molecular studies indicate that the Euglenida constitutes a monophyletic group within the Euglenozoa (Adl et al., 2005; Cavalier-Smith, 1981; Cavalier-Smith, 1998; Simpson, 1997). Morphologically, euglenozoans have a similar organization of the cytoskeleton, share a distinctive flagellar apparatus in which the flagella insert within an apical or subapical pocket and have basal bodies associated with three unequal microtubular roots. This tripartite root system gives rise to the peripheral microtubules supporting the flagellar pocket, the feeding apparatus, and the pellicle. Kinetoplastids and euglenids also share mitochondria with discoidshaped cristae (Kivic and Walne, 1984; Simpson, 1997; Willey et al., 1988), as well as flagella that usually have mastigonemes (i.e. ‘hairs’), and that are reinforced by paraxial rods (proteinaceous scaffolding adjacent to the usual 9+2 axoneme) (Simpson, 1997; Willey et al., 1988). Conversely, diplonemids lack paraxial rods (Roy et al., 2007a; Montegut-Felkner and Triemer, 1994), and have most likely a single mitochondrion with a few flat, lamellar cristae (Roy et al., 2007a,b; Schnepf, 1994). Presently, the consensus among researchers establishes diplonemids and kinetoplastids as sister groups, but the branching order of the three groups within  9  the Euglenozoa has been contentious. Some studies had placed diplonemids and euglenids as sister groups to the exclusion of kinetoplastids (Busse and Preisfeld, 2003b; Moreira et al., 2001). Some studies were inconclusive (Busse and Preisfeld, 2002a; Marin et al., 2003; Maslov et al., 1999; Moreira et al., 2004; von der Heyden et al., 2004; Yubuki et al., 2009). Of the more conclusive studies, most have shown diplonemids to be the sister clade of kinetoplastids, to the exclusion of euglenids (Busse and Preisfeld, 2002b; Busse et al., 2003; Leander, 2004; Marande et al., 2005; Simpson et al., 2002; Simpson and Roger, 2004a; Simpson et al., 2006b). An alternative view proposed that kinetoplastids and euglenids had a phototrophic common ancestor (‘early chloroplast hypothesis) (Hannaert et al., 2003; Martin and Borst, 2003). Based in the inferred homology of several genes (e.g., Calvin cycle enzymes) the authors concluded that a common ancestor of kinetoplastids and euglenids acquired a plastid through a secondary endosymbiotic event, which was subsequently lost in kinetoplastids and retained in euglenids (Hannaert et al., 2003; Martin and Borst, 2003). However, this disagrees with morphological and phylogenetic evidence showing that the clade of phototrophic euglenids is derived and nested within lineages of phagotrophic euglenids (Leander, 2004). The ‘early chloroplast’ hypothesis thus implies numerous independent losses of photosynthesis (and plastids) in several lineages throughout the Euglenida. With the current evidence, I argue that this scenario is less likely than that of a single, late acquisition of plastids within euglenids. Among euglenids, bacterivorous lineages, such as Petalomonas cantuscygni and Notosolenus mediocanellata, form the earliest diverging phylogenetic branches (Fig. 1.7) (see Busse and Preisfeld, 2002b; Busse and Preisfeld, 2003a; Leander et al., 2001a; Leander, 2004; Marin et al., 2003; Mullner et al., 2001; Preisfeld et al., 2000; Talke and Preisfeld, 2002; Yubuki et al., 2009).  10  Figure 1.7. Illustration of euglenozoan relationships. Synthetic hypothesis derived form comparative morphology and available molecular phylogenetic data. Polytomies indicate regions of phylogenetic uncertainty. Colored triangles indicate putative radiations of organisms with distinct nutritional modes: blue, bacterivory; red, eukaryovory; yellow, primary osmotrophy; light green, phototrophic euglenids with plastic pellicles; dark green, phototrophic euglenids with rigid pellicles, orange, phototrophic euglenids encased in a lorica. Taken from Leander, Esson & Breglia (2007). BioEssays, 29:987-1000.  This view is in agreement with the ultrastructural observations that show these taxa having features considered plesiomorphic in the group, namely a simple feeding apparatus and a low number of strips. Moreover, Petalomonas  11  possesses mitochondrial inclusions that, according to Leander et al., could be kDNA-like structures (Leander et al., 2001a). Mitochondrial inclusions, called ‘kinetoplast DNA’ or kDNA, are arrangements of mitochondrial DNA forming conspicuous bodies within the mitochondria, and represent an apomorphic character of kinetoplastids (Lukes et al., 2002). The most studied and best-known kDNA structure is that of trypanosomatid kinetoplastids, that forms a network of mini- and maxi-circles of DNA. However, the general configuration of kDNA among kinetoplastids is variable, ranging from pro-kDNA, poly-kDNA, pan-kDNA and mega-kDNA (see reviews by Lukes et al., 2002 and Marande et al., 2005). The presence of such an inclusion in the mitochondria of Petalomonas also suggests a basal position for this genus, as this character represents a bridge between euglenids and kinetoplastids. There is both morphological and molecular phylogenetic evidence that support the hypothesis that early diverging bacterivorous euglenids, possessing a rigid cell with few pellicle strips, gave rise to the eukaryovorous members of the group (Fig. 1.7) (see Triemer and Farmer, 1991b; Montegut-Felkner and Triemer, 1997; Linton et al., 1999; Preisfeld et al., 2000; Leander et al., 2001a; 2001b; Mülner et al., 2001; Busse et al., 2003Leander, 2004;). It also has been hypothesized that, at some point during the evolutionary history of euglenids, a set of morphological transformations took place that allowed phagotrophic (eukaryovorous) euglenids to more readily engulf microeukaryote-sized prey cells (Willey et al., 1988; Leaner, 2004). When characters associated to the feeding apparatus are mapped on a euglenid phylogenetic tree, it is clear that the feeding structures in heterotrophic species follow a trend towards becoming more elaborate and diverse, going from relatively simple cytoplasmic pockets reinforced by microtubules (e.g. in the bacterivore Petalomonas), to complex structures consisting mainly of proteinaceous rods and vanes (e.g., in Ploeotia and Entosiphon). Also, a duplication in the number of pellicular strips is postulated to have occurred at some point in the euglenid lineage (e.g. an increase from 10 to 20 strips) (Leander et al., 2001b; Leander, 2004). This strip duplication event,  12  when mapped in euglenid phylogenies, can be seen co-occuring with the appearance of helically arranged strips, a pattern that enables a better arrangement on the cell surface. Permanent increases in the number of pellicle strips might also be linked to the ability of some euglenids to distort their shape (Leedale, 1964; Mignot et al., 1987; Suzaki and Williamson, 1985; Suzaki and Williamson, 1986a; Suzaki and Williamson, 1986b; Triemer et al., 2006). During cell duplication, strips become more loosely attached. This might have allowed them to slide along each other more freely, in a novel way called ‘euglenoid movement’ or ‘metaboly’(Suzaki and Williamson, 1985; Suzaki and Williamson, 1986a; Triemer et al., 2006). Cells thus equipped with both an elaborate feeding apparatus and a plastic pellicle became specialized in feeding on relatively large prey cells that could be more readily accommodated (e.g. other microeukaryotes). Leander et al. hypothesize that this condition allowed for the capture and ingestion of microalgae that might have led, in a secondary endosymbiotic event, to the acquisition of a chloroplast in the most recent ancestor of all phototrophic euglenids (Leander et al., 2001a). In my opinion, this hypothesis supports the argument that phototrophic euglenids are descended from eukaryovorous forms. Morphological evidence of this evolutionary history is found in the vestigial feeding structures retained in phototrophic euglenids (Shin et al., 2001; Shin et al., 2002; Triemer and Lewandowski, 1994). The monophyletic conditions of phototrophic euglenids and of primary osmotrophs are very well supported (Busse and Preisfeld, 2002b; Busse and Preisfeld, 2003a; Leander et al., 2001a). Current molecular phylogenetic and morphological evidence indicates that both subclades descended independently from a paraphyletic stem group of eukaryovores (Fig. 1.7).  13  1.3.1 Problems with SSU rRNA and taxon sampling Molecular phylogenies of euglenids are mostly based on small subunit (SSU) rRNA genes that do not satisfactorily resolve the branching order among the deepest nodes. Problems with the marker itself, such as great sequence diversity and unequal rates of evolution within euglenids may result in insufficient resolving power to determine deep-branching nodes (Busse and Preisfeld, 2003b; Philippe, 2000). Moreover, representation of taxa belonging to the different nutritional modes is severely unbalanced in the phylogenies. Indeed, the SSU rRNA has been sequenced in a large number of phototrophic and osmotrophic species, but it has only been sampled in a small handful of phagotrophic species. Only two taxa (Petalomonas cantuscygni and Peranema trichophorum) are usually included in the studies as representatives of phagotrophs. Consequences of unbalanced taxon sampling on phylogenetic analysis are well known. Missing lineages often lead to lack of resolution or to misleading results (Philippe, 2000). In the case of euglenids, this pronounced unbalance seems to occur because phototrophic and osmotrophic species are broadly represented in culture collections, whereas phagotrophic species are difficult to grow and maintain in culture for long periods of time. In Chapter 2 of this thesis I produced a euglenid phylogeny based on new Hsp 90 gene sequences, with the intent to assess the value of protein sequences in resolving the branching order of the deepest branches.  1.4 The euglenid feeding apparatus Phagotrophic euglenids possess a distinctive feeding apparatus for the capture and ingestion of prey that is positioned on the ventral-anterior side of the cell. Previous authors proposed that different feeding systems constitute a transformation series, ranging from a relatively simple and ancestral ‘‘type I’’  14  apparatus, to a more complex and derived ‘‘type IV’’ apparatus (Triemer and Farmer, 1991a; Triemer and Farmer, 1991b). According to this scheme, “type I” feeding systems—or ‘‘microtubule reinforced (MTR) pockets’’—are present in small bacterivores, such as Petalomonas and Calycimonas (plus in some kinetoplastids), and consist of a ventral invagination of the cell membrane that is reinforced by microtubules (Fig. 1.8) (Kivic and Walne, 1984; Triemer and Farmer, 1991a; Triemer and Farmer, 1991b; Willey et al., 1988). The feeding systems in most phagotrophic euglenids, however, comprise an integrated system of proteinaceous ‘‘rods’’ and ‘‘vanes’’. For instance, the feeding apparatus “type II”, found in the bacterivore Ploeotia (Figs. 1.8, 1.9 A-B), consists of robust rods that extend the entire length of the cell and are reinforced by a superficial layer of microtubules and an internal amorphous matrix (Belhadri et al., 1992; Farmer and Triemer, 1988; Linton and Triemer, 1999; Triemer and Farmer, 1991a). The feeding rods found in the bacterivore Entosiphon sulcatum (“type IV”) are the most intricate of all known euglenids. The rods in these predators lack an amorphous matrix and, instead, are completely made up of an elaborate array of microtubules. In addition, one of the supporting rods also bifurcates near the posterior end, giving rise to three rods that extend for almost the whole length of the cell (Figs. 1.8, 1.9 C-D) (Belhadri et al., 1992; Belhadri and Brugerolle, 1992; Brugerolle, 1992; Triemer and Fritz, 1987; Triemer and Farmer, 1991a).  15  Figure 1.8. Comparative morphology of the euglenid feeding apparatus. Labeled diagrams showing the general organization and known diversity of the euglenid feeding apparatus. For illustrative purposes, the anterior end of each cell is shown in transverse section. (I) = Feeding apparatus ‘type I’, found in the bacterivores Petalomonas and Calycimonas; (II) = Feeding apparatus ‘type II’, present only in the bacterivore Ploeotia; (III) = Feeding apparatus ‘type III’, present in the eukaryovores Dinema and Peranema; (IV) = Feeding apparatus ‘type IV’, found only in the bacterivore Entosiphon. Red, microtubules; yellow, amorphous matrix; blue, flagellar axonemes. Modified from Leander et al. 2007.  16  Figure 1.9. A-B: Bacterivorous euglenid Ploeotia costata. A. Light micrograph showing the two microtubular rods that form the feeding apparatus. B. Scanning electron micrograph of the feeding apparatus extruding from groove in the pellicle. Scale bar = 10 µm. C-D: Bacterivorous euglenid Entosiphon sulcatum. C. Light micrograph showing the microtubular rods. D. Scanning electron micrograph of the feeding apparatus extruding from an internal pocket. Scale bars = 5 µm. © Susana Breglia.  The feeding apparatus in Entosiphon is usually in motion, extruding from the cytostome during feeding. This so-called ‘‘siphon’’ is covered by an ‘‘anterior cap’’ that only opens when the siphon is fully extended in order to allow prey cells to be drawn into the cell (Fig. 1.10) (Belhadri et al., 1992; Triemer and Fritz, 1987; Triemer and Farmer, 1991a). Extension of the siphon also simultaneously closes off the opening to the flagellar pocket (Fig. 1.10B).  17  Figure 1.10. Scanning electron micrographs of the bacterivorous euglenid Entosiphon sulcatum showing the feeding apparatus (siphon) in motion. A. Anterior view of a cell with the siphon starting the eversion. B. Siphon fully everted, with anterior cap closed. C. Anterior cap is opening, in preparation for engulfment. (Bars = 2 µm). © Susana Breglia.  The feeding apparatus in eukaryovorous species (“type III”) consists of a cytostome surrounded by four vanes and two rods that are reinforced by microtubules embedded in an amorphous matrix (e.g. Peranema) (Fig. 1.8) (Hall and Powell, 1928; Nisbet, 1974; Roth, 1959; Triemer and Farmer, 1991a; Triemer, 1997). The relative density of microtubules and the amorphous matrix surrounding them appears to vary considerably in the rods of different species. As in bacterivorous euglenids, the rods in some eukaryovores extend the entire length of the cell, and this configuration is present in eukaryovorous euglenids with approximately 20 pellicle strips that are only slightly helically arranged, such as Dinema (Fig. 1.11). This set of character states is thought to reflect the transition from a predominantly bacterivorous mode of nutrition to one that allows eukaryovory (Leander et al., 2001a). Eukaryovorous euglenids with approximately 40–50 strips that are strongly helically arranged (and highly plastic) contain feeding rods that are limited to the anterior third of the cell (e.g. Peranema). Additionally, many phototrophic euglenids have microtubule-reinforced cytoplasmic pockets (Shin et al., 2002), a remnant of the feeding apparatus in their phagotrophic ancestors.  18  I have re-described, in Chapter 3 of this thesis, the eukaryovorous species Heteronema scaphurum, for which only light microscopy existed. I produced SEM and TEM data that showed a plastic pellicle with an intermediate number of strips (28) and a feeding apparatus that conforms to Triemer and Farmer’s “type III”. The obtained molecular phylogeny places it close to Peranema, in agreement with these morphological characteristics.  Figure 1.11. Eukaryovorous euglenid Dinema sp. A. Light micrograph showing dorsal flagellum (DF) and ventral flagellum (VF). The arrowhead shows the feeding apparatus. B. Scanning electron micrograph showing a slightly helically arranged pellicle, with approximately 20 strips. Scale bars = 10 µm. © Susana Breglia.  1.5 Euglenids in low oxygen environments Poorly understood but highly diverse microbial communities exist within anoxic and microaerophilic environments, in extreme habitats, at different depths in marine sediments and even in freshwater settings (Behnke et al., 2006; Dawson and Pace, 2002; Edgcomb et al., 2002; Fenchel et al., 1995; Stoeck et al., 2003; Takishita et al., 2007; Zuendorf et al., 2006). These communities often harbour single-celled eukaryotes that form symbiotic associations with different kinds of bacteria, and often involve beneficial exchanges of metabolites (Bernhard et al., 2000; Buck et al., 2000; Buck and Bernhard, 2002; Dubilier et al., 2008; Edgcomb  19  et al., 2011; Fenchel et al., 1977; Leander and Farmer, 2000a; Leander and Keeling, 2004a; Noda et al., 2003; Ohkuma, 2008; Radek, 2010; Rosati, 2002). Some of these associations are also known to confer other benefits to the eukaryotic hosts such as bacteria-propelled motility systems (Tamm, 1982) or bacteria-based defense mechanisms (Gast et al., 2009; Rosati, 2006; Vannini et al., 2003). The episymbiotic bacteria may also serve as a food-source for the host (Fenchel and Finlay, 1989). Among euglenozoans, several species have been described as carrying episymbiotic bacteria. Two of them live in well-oxygenated, freshwater environments (e.g. the euglenid phototroph Euglena helicoideus (Leander and Farmer, 2000a), and the phagotroph Dylakosoma pelophilum (Wołowski, 1995)). However, most of the described euglenozoans with episymbiotic bacteria are phagotrophs that live in oxygen-depleted or anoxic marine environments. These include Calkinsia aureus (Bernhard et al., 2000; Yubuki et al., 2009), Postgaardi mariagerensis (Simpson et al., 1996; Simpson, 1997) as well as some unidentified species (Bernhard et al., 2000; Buck et al., 2000; Buck and Bernhard, 2002), all covered with rod-shaped episymbiotic bacteria (Bernhard et al., 2000; Simpson, 1997; Yubuki et al., 2009). Many of these species have mitochondrion-derived organelles with reduced or absent cristae that lie beneath the plasma membrane, and are in close association with the rod-shaped bacteria that cover the cell surface (Yubuki et al., 2009). Although the presence of these characters does not imply a phylogenetic relationship, Yubuki and Leander were able to establish a novel clade of anoxic euglenozoans on the basis of molecular phylogenetic analyses that included C. aureus and several environmental sequences. This new subclade of euglenozoans is referred to as the “Symbiontida” (Yubuki et al., 2009). Symbiontids have been morphologically defined as cells covered with rod-shaped bacteria (i.e., ε-proteobacteria) that are in close association with mitochondrion-  20  derived organelles with reduced or absent cristae. These organelles lie beneath the surface of the cell (Edgcomb et al., 2011; Yubuki et al., 2009). Yubuki et al. proposed that rod-shaped episymbionts are present in most (if not all) members of the group (Yubuki et al., 2009). The presence of episymbiotic bacteria and the superficial distribution of mitochondria with reduced cristae in C. aureus indicate a mutualistic relationship that enabled both groups of organisms to diversify within low-oxygen environments. The episymbionts most likely play a role in detoxifying the immediate surrounding environment for the hosts, while the eukaryotic host transports and positions the episymbionts into suitable locations within the oxic/anoxic interface (Edgcomb et al., 2011). I described, in Chapter 4 of this thesis, the morphological characteristics and phylogenetic position of a new member of the Symbiontida. Also, in Chapter 5, I morphologically characterized and placed in a phylogenetic context its bacterial episymbionts.  My aims in the present work are: i) to expand knowledge on ultrastructure for the feeding structures in phagotrophic euglenids, in order to elucidate the trends in the evolution of the feeding apparatus and to further evaluate involvement of the apparatus in the origin of phototrophic euglenids. ii) to acquire molecular and morphological data from new phagotrophic euglenids in order to strengthen the phylogenetic hypothesis for the group; iii) to expand the current knowledge on ultrastructural and molecular diversity of euglenids, and on their bacterial symbionts, in marine low oxygen environments.  21  2 Phylogeny of phagotrophic euglenids (Euglenozoa) as inferred from hsp90 gene sequences  2.1 Synopsis The Euglenozoa constitute a group of flagellates that includes three major clades: euglenids, kinetoplastids and diplonemids. Although the monophyly of this group has been confirmed by studies using small subunit (SSU) ribosomal RNA (rRNA) and protein sequences, the order of relationship between the three major groups varies according to the methods and the markers employed (Simpson and Roger, 2004a). For example, some morphological (Kivic and Walne, 1984) and molecular analyses using SSU rRNA phylogenetic analyses using multipleprotein data indicate that diplonemids and kinetoplastids are more closely related to each other than to euglenids (Maslov et al., 1999; Moreira et al., 2004; Simpson et al., 2002; Simpson et al., 2004; Simpson and Roger, 2004a; Simpson et al., 2006b). This topology shows strong boostrap support, while alternative topologies (e.g., were generally rejected by ‘approximately unbiased’ (AU) tests (Simpson and Roger, 2004a). Kinetoplastids include both trypanosomatids (parasites) and bodonids (either free-living or parasites) and are apomorphically defined by a novel arrangement of mitochondrial DNA (mtDNA) forming conspicuous inclusions called ‘kinetoplasts’ (Lukes et al., 2002). In the majority of kinetoplastids, the kinetoplast DNA (kDNA) is arranged in two kinds of circular molecules known as ‘maxicircles’ and ‘minicircles’. Maxicircles are present in a few dozen copies, and encode both mitochondrial protein genes and some ‘guide rRNA’ (gRNA) genes. Minicircles are present in thousands of copies and encode gRNAs (Morris et al., 2001). Transcripts of some protein-coding genes undergo editing in which the addition or removal of uridine residues produce the final mRNA molecules (Lukes et al.,  22  2005). Nonetheless, the general configuration of kDNA is variable, and the main states described so far include pro-kDNA, poly-kDNA, pan-kDNA and megakDNA (see reviews by (Lukes et al., 2002; Marande et al., 2005). Diplonemids comprise a small group of mostly free-living phagotrophs (Kivic and Walne, 1984; Marande et al., 2005), and some facultative parasites (Kent et al., 1987). There is no evidence of a kDNA-like mitochondrial inclusion in diplonemids, but the structure of its single mitochondrion has been shown to be unusual (e.g. highly branched, with few flattened cristae). The mtDNA is arranged in circular chromosomes of two slightly different sizes and distributed in a pankDNA-like fashion (Marande et al., 2005; Maslov et al., 1999). Euglenids form a very diverse group of free-living flagellates that inhabit a variety of aquatic environments. Members of this group have very different modes of nutrition, such as osmotrophy, phagotrophy and phototrophy. The most distinctive structural character of euglenids is a pellicle composed of proteinaceous strips that run lengthwise over the cell (Leander and Farmer, 2001b). Some euglenids are completely rigid, whereas others are highly plastic. Cell plasticity depends on the number of pellicle strips in the cell, and how they articulate with each other along the lateral margins. Longitudinally arranged strips are usually associated with cells that cannot change their shape, whereas helically arranged strips are associated with a type of peristaltic movement called ‘euglenoid movement’ (Leander and Farmer, 2001a; Leander et al., 2001b; Suzaki and Williamson, 1985; Suzaki and Williamson, 1986a; Suzaki and Williamson, 1986b). The diversity of pellicle surface patterns provides a significant amount of information useful for discriminating among the euglenid lineages (Brosnan et al., 2003; Esson and Leander, 2006; Leander and Farmer, 2001b; Leander et al., 2001b; Leander, 2004). Both morphology-based and molecular-based phylogenetic analyses suggest that rigid phagotrophs form the earliest diverging branches within euglenids (Leander et al., 2001a; Leander, 2004). As such, a key taxon in reconstructing early events  23  in the evolutionary history of euglenozoans is the phagotrophic euglenid Petalomonas cantuscygni (Busse and Preisfeld, 2003a; Leander et al., 2001a). P. cantuscygni is usually considered the earliest branching euglenid, because it possesses an unusual combination of ultrastructural characters, including a simple feeding apparatus, pellicle strips (synapomorphic for euglenids), and a kDNA-like inclusion within each mitochondrion (see Leander et al., 2001a). Unfortunately, the SSU rRNA sequence from P. cantuscygni is highly divergent, which precludes resolution of its phylogenetic position within the Euglenozoa (Busse et al., 2003; Busse and Preisfeld, 2003b; Leander and Farmer, 2000b; Leander and Farmer, 2001a; Leander et al., 2001a; Leander et al., 2001b; Linton et al., 2000; Marin et al., 2003; von der Heyden et al., 2004). This uncertainty about its phylogenetic position coupled with the unusual suite of characters found in P. cantuscygni led us to consider two main hypothetical scenarios for understanding character evolution within the Euglenozoa (Fig. 2.1). If P. cantuscygni is the earliest branching euglenid, then the presence of a kDNAlike inclusion might not be a synapomorphy for the kinetoplastid clade but a plesiomorphic condition present in the ancestor of all euglenozoans (Figs. 2.1AB). This scenario requires that kDNA-like inclusions were secondarily lost in the last common ancestor of most euglenids, as well as in diplonemids (Fig. 2.1A). Alternatively, kDNA-like inclusions might have been independently acquired by kinetoplastids and P. cantuscygni (Fig. 2.1B). If P. cantuscygni is more closely allied with kinetoplastids, then the most parsimonious inference would be that kDNA-like inclusions arose once in the last common ancestor of these two lineages (Figs. 2.1C-D). This scenario would also suggest the feature inferred to be synapomorphic for euglenids, namely pellicle strips, is actually an ancestral state for all euglenozoans, which were subsequently and independently lost in kinetoplastids and diplonemids (Fig. 2.1C). Alternatively, pellicle strips might have evolved convergently in euglenids and P. cantuscygni (Fig. 2.1D). It should be noted that two other hypothetical scenarios are formally possible: (1) P. cantuscygni is the sister lineage to a clade consisting of euglenids, diplonemids  24  and kinetoplastids and (2) P. cantuscygni is the sister lineage to a clade consisting of diplonemids and kinetoplastids.  Figure 2.1. Hypothetical frameworks for inferring character evolution within the Euglenozoa, considering two different phylogenetic positions for Petalomonas cantuscygni: scenarios A-B, P. cantuscygni is the sister lineage to all other euglenids; scenarios C-D, P. cantuscygni is the sister lineage to kinetoplastids. The putative synapomorphies for the Kinetoplastida and the Euglenida are “kinetoplasts” and “pellicle strips”, respectively. For each possible topology, two alternative scenarios for the evolutionary origin and losses of pellicle strips and (kinetoplast-like) mitochondrial inclusions are phylogenetically mapped. In scenarios A, C, and D, the reaorganization of mitochondrial DNA (mtDNA) is inferred to predate or occur concurrently with the presence of the inclusion (as indicated by the black oval). Scenario A invokes the independent loss of a kinetoplast-like inclusion, but not the reorganized mtDNA, in euglenids and diplonemids. Scenario B specifically postulates a reorganization of the mtDNA in all euglenozoans before to the independent acquisition of inclusions in Petalomonas and kinetoplastids. Scenario C invokes the independent loss of pellicle strips in kinetoplastids and diplonemids. Scenario D invokes convergent evolution of pellicle strips in Petalomonas and euglenids.  Resolving the branching order of P. cantuscygni and other phagotrophic euglenids is necessary to evaluate the hypotheses outlined above. However, phagotrophic euglenids represent several distinctive and divergent lineages that  25  cannot be satisfactorily resolved with SSU rRNA data (Busse and Preisfeld, 2002b; Busse et al., 2003; Busse and Preisfeld, 2003b; Simpson and Roger, 2004a). Comparison of nucleus encoded protein sequences, such as the heatshock protein 90 (hsp90) gene, provides an alternative (Leander and Keeling, 2004b; Shalchian-Tabrizi et al., 2006; Simpson et al., 2002; Simpson and Roger, 2004a; Simpson et al., 2006a; Stechmann and Cavalier-Smith, 2003). Among euglenids, hsp90 sequences are known only from the phototroph Euglena gracilis. With the aim of increasing the dataset of available hsp90 sequences from euglenids and addressing our phylogenetic hypotheses (Fig. 2.1), we sequenced the cytosolic hsp90 gene from three taxa, namely the phagotrophs Peranema trichophorum, Entosiphon sulcatum and P. cantuscygni.  2.2 Materials and methods 2.2.1 Collection of organisms. E. sulcatum was isolated from sediment samples collected from a pond at the Queen Elizabeth Park, Vancouver, British Columbia in May, 2004 (Figs. 2.2A-B). Cells were manually isolated using drawn out glass Pasteur micropipettes and temporarily grown at 16 °C in an 802 Sonnerborn’s Paramecium medium (rye grass Cerophyll of 250 mg/l with Klebsiella sp. as food source). P. trichophorum was manually isolated from a duck pond at Granville Island, Vancouver, British Columbia in June, 2005 and grown at room temperature in a fresh-water KNOP medium with egg yolk as food source (Saito et al., 2003) (Fig. 2.2C). Differential interference contrast light micrographs were captured with a Zeiss Axioplan 2 imaging microscope connected to a Leica DC500 digital color camera. Genomic DNA from P. cantuscygni (CCAP 1259/1) was a gift from S. Jardeleza and M. Farmer (University of Georgia, Athens, USA).  26  Figure 2.2. Light micrographs of wild isolates of two phagotrophic euglenids from which heat shock protein 90 genes were sequenced. A. Entosiphon sulcatum (bacterivore) showing the longitudinal arranged pellicle strips. B. A deeper focal plane of E. sulcatum showing the rods of feeding apparatus (arrow). The two heterodynamic flagella are also visible (Bar = 10 µm). C. A gliding Peranema trichophorum (eukaryovore) showing the extended anterior flagellum (arrowhead) and the absence of a conspicuous recurrent flagellum, which is pressed against the cell within a flagellar strip (Bar = 20µm).  2.2.2 DNA isolation, amplification and sequencing Genomic DNA was extracted from cultures of E. sulcatum and P. trichophorum using a standard trimethylhexadecylammonium bromide (CTAB) extraction protocol: pelleted material was suspended in 400 µl CTAB extraction buffer (1.12 g Tris, 8.18 g NaCl, 0.74 g EDTA, 2 g CTAB, 2 g Polyvinylpyrolidone, 0.2 ml 2mercaptoethanol in 100 ml water), homogenized in a glass tissue grinder, incubated at 65 °C for 30 min. and separated with chloroform:isoamyl alcohol (24:1). The aqueous phase was then precipitated in 70% ethanol. Sequences of the cytosolic hsp90 gene were amplified using PCR primers designed from different alignments of euglenozoan hsp90 sequences. P. cantuscygni and E. sulcatum genes were amplified with the primer pairs F4-R3 for the 5’ portion of the gene and F2eug-970R for the 3’ half. Primer sequences were: F4, 5’-  27  GGAGCCTGATHATHAAYACNTTYTA-3’; R3, 5’-GATGACYTTNARDATYTTRTT3’; F2eug, 5’-GTNTTCATYATGGACAACTGYGAGGA-3’; and 970R, 5’TCGAGGGAGAGRCCNARCTTRATCAT-3’. Attempts to amplify the hsp90 gene from P. trichophorum using these primers were unsuccessful, so we designed new primers using the nucleotide sequences obtained from E. sulcatum and P. cantuscygni. The new primer sequences were: 3Forw, 5’CTTGGAACGATTGCCAGA-3’; 627Rev, 5’-CCAATTGTCCTTCAACAGA-3’; 598Forw, 5’-CGATTGGGAGGACCACTT-3’; and Eug2106R, 5’GAKAGACCAAGYTTRTCAT-3’. PCR amplifications consisted of an initial denaturing period (95 °C for 3min), 35 cycles of denaturing (93 °C for 45s), annealing (55 °C for 45s), extension (72 °C for 2min) and a final extension period (72 °C for 5min). PCR products of the expected size were gel-isolated and cloned into the vector pCR2.1 using the TOPO TA cloning kit (Invitrogen). Two to four clones from each product were sequenced with the ABI Big-Dye reaction mix using the vector primers oriented in both directions. New sequences were identified by BLAST and phylogenetic analysis and deposited in GenBank: P. cantuscygni (DQ683346), P. trichophorum (DQ683345) and E. sulcatum (DQ683347).  2.2.3 Alignments Nucleotide sequences and conceptual amino acids translations were combined with published euglenozoan sequences into two datasets (Table 2.1). The three new sequences were aligned with 18 representative sequences from kinetoplastids (both trypanosomatids and bodonids), diplonemids, a previous published euglenid (E. gracilis), the heterolobosean Naegleria gruberi, two plants (Ipomoea nil and Oryza sativa), and a jakobid (Reclinomonas americana). The resultant nucleotide and amino acid datasets were aligned with ClustalX (Thompson et al., 1997) and manually adjusted with McClade. Ambiguously aligned positions, gaps, and the 3rd codon position in the nucleotide dataset were  28  excluded. Final nucleotide and amino acid datasets contained 1069 and 540 positions for the alignments containing plants and N. gruberi and 925 and 469 when the outgroup was R. americana. Taxon  DNA  Protein  Ipomoea nil  M99431  AAA33748  Oryza sativa  XM_483191  XP_483191  Reclinomonas americana  DQ295221  ABC54646  Naegleria gruberi  AY122634  AAM93756  Ichthyobodo necator  AY651251  AAV66335  Rhynchobodo sp.  AY651252  AAV66336  Leishmania amazonensis  M92926  AAA29250  Leishmania infantum  X87770  CAD30506  Trypanosoma brucei  X14176  CAA32377  Trypanosoma cruzi  M15346  AAA30202  Rhynchopus sp.  AY122622  AAM93744  Diplonema papillatum  AY122623  AAM93745  Dimastigella trypaniformis  AY122624  AAM93746  Rhynchomonas nasuta  AY122625  AAM93747  Neobodo saliens  AY122626  AAM93748  Trypanoplasma borreli  AY122628  AAM93750  Cryptobia salmositica  AY122629  AAM93751  Cryptobia helicis  AY122631  AAM93753  Bodo saltans  AY122632  AAM93754  Bodo cf. uncinatus  AY122633  AAM93755  Euglena gracilis  AY288510  AAQ24861  Petalomonas cantuscygni  DQ683346  ABG77329  Peranema trichophorum  DQ683345  ABG77328  Entosiphon sulcatum  DQ683347  ABG77330  Table 2.1. Accession numbers (NCBI nucleotide and protein databases) for the sequences employed in this study. New sequences are highlighted in bold letters.  29  2.2.4 Molecular phylogenetic analyses Phylogenetic relationships were inferred using maximum likelihood (ML), distance and Bayesian methods with the programs PHYML (Guindon and Gascuel, 2003), Weighbor (Bruno et al., 2000) and MrBayes (Huelsenbeck and Ronquist, 2001), respectively. For ML, the alignments of amino acid sequences were analyzed under a WAG model of substitution considering corrections for site-to-site rate variation (gamma) with eight categories of rate variation and proportion of invariable sites. Nucleotide dataset was analysed using a GTR model plus gamma correction with eight categories and proportion of invariable sites. For both datasets, 500 bootstrap replicates were performed with the same parameters described above. Distances were calculated with TREE-PUZZLE 5.0 (Strimmer and von Haeseler, 1996) using the HKY and WAG substitution models for the nucleotide and amino acid datasets, respectively, and among-site rate variation was modeled with a gamma distribution. One thousand bootstrap datasets were generated with SEQBOOT (Felsenstein, 1993). Respective distances were calculated with the shell script ‘puzzleboot’ (M. Holder and A. Roger, http://www.tree-puzzle.de) using the parameters estimated from the original datasets (e.g. alpha shape parameter and nucleotide transition/transversion ratio) and analyzed with Weighbor. For Bayesian analyses, the program MrBayes was set to operate with GTR for nucleotides, with WAG for amino acids, a gamma distribution and four MonteCarlo-Markov chains (MCMC) (default temperature=0.2). In each case, a total of 2,000,000 generations were calculated with trees sampled every 100 generations and with a prior burn-in of 200,000 generations (2,000 sampled trees were discarded). A majority rule consensus tree was constructed from 18,000 postburn-in trees with PAUP* 4.0. Posterior probabilities correspond to the frequency at which a given node is found in the post-burn-in trees.  30  Five alternative topologies differing in the relative position of P. cantuscygni were generated with McClade. Approximately unbiased (AU) tests were performed with CONSEL (Shimodira and Hasegawa, 2001) using the likelihoods calculated with PUZZLE 5.2 (Strimmer and von Haeseler, 1996) with the same models and parameters indicated above.  2.3 Results We sequenced the cytosolic hsp90 gene of the phagotrophic euglenids P. trichophorum, E. sulcatum and P. cantuscygni. The nucleotide sequence recovered from the PCR product isolated from genomic DNA of P. trichophorum contained several frame shifts and was longer than anticipated, suggesting that the hsp90 coding sequence may be interrupted by spliceosomal introns. Through close examination of the sequence using BLASTX we were able to detect three short intervening sequences whose removal resulted in a continuous ORF and maximized the similarity at the amino acid level of this sequence with other euglenozoan hsp90 genes. The nucleotide sequences of these introns, from 5’ to 3’ are GTATGTTCACTTTCCTTTTTCTCTTAG (27 bp), GGCAACACTACTAAGATTGTGATGCCTGG (29 bp) and GGAAATTTTATGAATTAGTAATTTTTCCATG (31 bp). The 27 bp intron had canonical GT/AG borders, whereas both the 29 bp and 31pb introns had noncanonical borders. For our phylogenetic analyses, the level of statistical support throughout the encountered tree topology was generally consistent between both nucleotide (excluding the third position) and amino acid datasets (Fig. 2.3).  31  Figure. 2.3. Euglenozoan phylogeny as inferred from the heat-shock protein 90 gene. A. The topology shown is derived from a Γ+8+I (γ correction with eight categories of rate variation and proportion of invariable sites) maximum likelihood analysis using a GTR model of nucleotide substitutions on 21 unambiguously aligned sequences with the third codon position excluded (925 nucleotide positions). Support values for each node are indicated as bootstrap percentages or Bayesian posterior probabilities as indicated in the upper left-hand table. Numbers above the branches correspond to the nucleotide dataset (third codon position excluded), and numbers below the branches correspond to the amino acid dataset (469 positions). New sequences are indicated with black boxes. B. Schematic topology showing the position of  32  Petalomonas cantuscygni when the heterolobosean and plant sequences are included as outgroups with the nucleotide dataset (third codon position excluded). This pattern was obtained using maximum likelihood, distance, and Bayesian methods. C. Detail of the branching order among euglenids in trees constructed with the amino acids dataset. Numbers at the nodes represent bootstrap percentages using maximum likelihood (above) and Bayesian analysis (below). The bootstrap support of the node indicated (*) drops to 45 when no outgroup is present.	
  	
    Our analyses recovered a highly supported sister relationship between the kinetoplastid clade and the diplonemid clade to the exclusion of euglenids. Within the kinetoplastid clade, four species of trypanosomatids formed a strongly supported monophyletic group, and the nodes grouping bodonid lineages showed varying levels of support. Within the euglenid clade, the phagotroph P. trichophorum and the phototroph E. gracilis branched together to the exclusion of E. sulcatum. The position of P. cantuscygni was less clear. Our analyses using plants (I. nil and O. sativa) and a heterolobosean (N. gruberi) sequences as outgroups placed P. cantuscygni as the sister lineage to the kinetoplastiddiplonemid clade (Fig. 2.3B). Support for this relationship was robust in all analyses using the nucleotide dataset, excluding the third codon position (ML bootstrap = 88, Bayesian posterior probability = 0.98, Weighbor bootstrap = 92). Moreover, this relationship was recovered in ML and distance trees using the complete amino acid dataset, but was only weakly supported with bootstrap analyses (data not shown). However, the Bayesian tree derived from the amino acid dataset placed P. cantuscygni as the sister lineage to the euglenid clade. In order to address these inconsistencies, we repeated the analyses using different outgroup schemes by excluding the distant taxa I. nil and O. sativa and replacing a divergent relative (N. gruberi) by the jakobid R. americana. However, because the published hsp90 sequence from this species is shorter, our alignment was reduced, accordingly. Without having significant effects on the overall topology, outgroup changes had drastic effects on the position of P. cantuscygni. With the new scheme of outgroups, P. cantuscygni branched as the most basal lineage within the euglenids with high bootstrap support (Fig. 2.3A). A similar effect occurred with the protein dataset, but in this case the branching order between P.  33  cantuscygni and E. sulcatum was not clearly resolved (Fig. 2.3C). Nonetheless, the support for the inclusion of P. cantuscygni within the euglenid clade was robust after N. gruberi was replaced by R. americana as the outgroup (Fig. 2.3A). In order to gain additional insight into how well the data supported the phylogenetic position of P. cantuscygni, we performed AU tests for comparing the likelihoods of five alternative topologies differing in the relative position of this taxon (Fig. 2.4).  	
    Figure 2.4. Topologies used to evaluate five alternative positions of Petalomonas cantuscygni by performing approximately unbiased (AU) likelihood tests with both the nucleotide (third codon position excluded) and the amino acid datasets, with Reclinomonas americana as outgroup (see Table 2.2). Labels at the termini are as follows: Eug, euglenids; Pet, P. cantuscygni (bold); Kin, kinetoplastids; and Dip, diplonemids. The topology most favored by the hsp90 phylogenetic analyses and AU likelihood tests is highlighted with a box.  The topologies assayed were similar to the tree shown in Fig. 2.3A, except for the position of P. cantuscygni, which was alternatively placed as a sister branch to the euglenids (topology A in Fig. 2.4), to the kinetoplastid–diplonemid group (B, 34  Fig. 2.4), to the kinetoplastids (C, Fig. 2.4), to the diplonemids (D, Fig. 2.4), and at the base of Euglenozoa (D, Fig. 2.4). The tests were performed on both the nucleotide (excluding the third position) and amino acid datasets. The topologies placing P. cantuscygni specifically with either diplonemids or kinetoplastids (C, D, Fig. 2.4) were rejected by the AU test at a 5% level, using the nucleotide and amino acids datasets (Table 2.2). The topology with P. cantuscygni placed as a sister lineage of all other euglenozoas (E, Fig. 2.4) had a considerably lower likelihood than the topologies placing P. cantuscygni as sister to either euglenids (A, Fig. 2.4) or the kinetoplastid-diplonemid group (B, Fig. 2.4) (i.e. the AU value was very close to the 5% threshold; Table 2.2). However, the topology B (Fig. 2.4) was not rejected at a 5% level, attesting to the difficulties in resolving this part of the tree.  A  B  C  D  E  DNA (excluding 3rd position)  0.829  0.309  0.002  0.019  0.082  Amino acids  0.902  0.191  0.003  0.008  0.058  Topology  Table 2.2. p values for approximately unbiased likelihood tests of five alternative positions of Petalomonas cantuscygni (Topologies shown in Fig. 4).  2.4 Discussion 2.4.1 Non-conventional introns in hsp90 of phagotrophic euglenids. We found that the hsp90 gene of P. trichophorum contained at least three putative spliceosomal introns. Although genomic data on euglenids are scarce, some examples of introns in nuclear genes have been reported from E. gracilis, and both conventional and non-conventional representatives were found  35  (Breckenridge et al., 1999; Canaday et al., 2001; Henze et al., 1995; Muchhal and Schwartzbach, 1994; Russell et al., 2005; Tessier et al., 1995). Introns have not been reported from any hsp90 genes that have been amplified from euglenozoans (Simpson et al., 2002). Nonetheless, like most spliceosomal introns, intron 1 of P. trichophorum had typical GT–AG borders and a characteristic pyrimidine-rich tract adjacent to the 30-border. Introns 2 and 3 had the non-canonical borders GG–GG and GG–TG, respectively. In euglenids, introns with non-canonical borders were found mainly in nuclear genes encoding chloroplast-targeted proteins and, thus, were considered to be of prokaryotic origin (Henze et al., 1995; Muchhal and Schwartzbach, 1994; Tessier et al., 1995). However, it was later found that genes encoding for non-plastidic proteins in E. gracilis contain both classes of introns (Canaday et al., 2001; Russell et al., 2005). Non-conventional introns are characterized by non-canonical and variable dinucleotides at the borders and by the presence of two inverted repeats that are adjacent to each border of the intron. These repeats have the capacity for base pairing and for bringing together both splice sites in order to constitute a distinct, and probably spliceosome-free mechanism for splicing (Canaday et al., 2001; Russell et al., 2005). In addition to the non-canonical borders GG–GG and GG– TG, introns 2 and 3 from P. trichophorum have two 10 bp inverted repeats arranged in the same fashion as those described in the phototroph E. gracilis, showing that non-conventional introns also occur in phagotrophic euglenids. This finding suggests that an endosymbiotic origin of non-conventional introns in E. gracilis is unlikely, as molecular phylogenies indicate that eukaryovorous euglenids such as P. trichophorum diverged before the hypothetical endosymbiotic event that gave rise to photosynthesis in euglenids (Leander, 2004). Nonetheless, the three introns found in P. trichophorum (27, 29, and 31 bp) are smaller than any other intron known from euglenids and are among the smallest introns ever described in eukaryotes (Gilson, 2001; Zagulski et al., 2004). Interestingly, the known intron size range in euglenids goes from 27 bp (this study) to 9.2 kbp (Canaday et al., 2001). This wide size variation might  36  explain the difficulties often encountered when amplifying protein-coding genes from genomic DNA in certain species of euglenids.  2.4.2 Phylogeny and character evolution We have made an attempt to exploit protein-coding genes to explore the phylogenetic relationships among phagotrophic euglenids. Although still very limited in the number of euglenid taxa, our data suggest that the hsp90 gene constitutes a useful tool for inferring euglenid phylogeny and overcoming some of the limitations exhibited by SSU rRNA sequences. At the same time, our results highlight the importance of appropriate outgroup-selection when analyzing euglenozoan phylogeny. Analyses of the nucleotide and amino acid alignments recovered the expected relationships among the three main groups of Euglenozoa (kinetoplastids, diplonemids, and euglenids; (Maslov et al., 1999; Moreira et al., 2004; Simpson et al., 2002; Simpson et al., 2004; Simpson and Roger, 2004a; Simpson et al., 2006a). The relationships among the phototroph E. gracilis and the phagotrophs P. trichophorum (with features appropriate for consuming eukaryotic-sized food), and E. sulcatum (with features suitable for consuming bacterial-sized food) were similar to those of previous rRNA phylogenies (Busse et al., 2003) and hypothetical scenarios inferred from morphological data (Leander et al., 2001a). Resolving the position of P. cantuscygni, however, was more problematic and it was shown to be strongly dependent on outgroup choice. Use of distant taxa (like plants) or a very divergent relative (like N. gruberi) apparently distorted the placement of the more divergent taxa in the ingroup, as is the case of P. cantuscygni. As the closest relatives to Euglenozoa (Baldauf et al., 2000), a heterolobosean seems to be a proper choice to root the euglenozoan tree, but the only available hsp90 sequence is from N. gruberi, an amoeba whose hsp90 sequence is highly divergent and thus potentially problematic. Because jakobids have been shown to branch as sisters to Euglenozoa (Simpson 2003; Simpson et al., 2006a), we  37  decided to include R. americana as an outgroup. The addition of R. americana (along with N. gruberi) increased the support of P. cantuscygni branching with the euglenids, and the support for this relationship was significantly higher when we eliminated N. gruberi from the dataset. A possible explanation for the different outcome between both datasets is that the highly conserved hsp90 gene lacks sufficient phylogenetic signal at the amino acid level, but contains enough ‘‘hidden’’ variation at the nucleotide level (excluding the ‘‘noise’’ created by the third codon position) to robustly resolve the deep phylogenetic position of P. cantuscygni. However, whether or not the strong support for the sister relationship between P. cantuscygni and the euglenid clade is a consequence of long-branch attraction artifact cannot be definitively ruled out at this stage. Nonetheless, the sister relationship between P. cantuscygni and the euglenid clade is concordant with previous phylogenetic hypotheses based on ultrastructural data and brings to light some interesting considerations. On one hand, it confirms the synapomorphic character of the pellicle as an exclusive euglenid feature. As per the relationships among euglenids, our results broadly agree with SSU rRNA trees (Busse et al., 2003) and the proposed sequence of events leading to the potential for acquiring eukaryotic endosymbionts, which resulted in the origin and diversification of phototrophic euglenids (Leander et al., 2001a; Leander, 2004). On the other hand, P. cantuscygni has kDNA-like inclusions within its mitochondria (Leander et al., 2001a). This highly compacted structure strongly resembles the poly-kDNA configuration sensu Lukes et al. (Lukes et al., 2002), and has not been observed in other euglenids or diplonemids. Because our most robust phylogenetic hypothesis places P. cantuscygni at the base of the euglenid side of the tree, convergent evolution of mitochondrial inclusions might explain their presence in both kinetoplastids and P. cantuscygni (Fig. 2.1B). However, the functional integration of kDNA inclusions at the molecular level suggests that independent acquisition of this sophisticated character is highly unlikely, especially in the absence of data to the contrary. Notwithstanding, it is possible to envision that independent compaction processes starting from an unpacked state gave rise to the pan-kDNA of  38  bodonids and the uncharacterized structure of P. cantuscygni. This scenario mirrors a hypothesis on kDNA evolution made by Lukes et al. (Lukes et al., 2002), where a plesiomorphic pan-kDNA configuration independently gave rise to (1) the megakDNA present in the bodonid Trypanoplasma, and (2) the kDNA network of trypanosomatids. We favor a hypothetical scenario in which the ancestral euglenozoan underwent a novel reorganization of its mitochondrial genome. The mitochondrial genome independently underwent different kinds of rearrangements, some of which acquired further complexity and compaction leading to the inclusions observed in kinetoplastids and P. cantuscygni (Fig. 2.1B). Assessing the plausibility of this scenario requires a significantly improved understanding of the structure and organization of mitochondrial genomes in euglenids and diplonemids, which is still very limited. However, there is evidence showing that the diplonemid Diplonema papillatum has a fragmented and reorganized mitochondrial genome (Marande et al., 2005) and E. gracilis seems to have an unusual mitochondrial genome as well (Gray et al., 2004; Yasuhira and Simpson, 1997). We should be able to address these inferences more concretely once we know more about the molecular organization of the mitochondrial inclusions in P. cantuscygni and several of its close relatives (e.g. Notosolenus and Calycimonas), and the structure of mitochondrial DNA in other euglenids.  39  3 Ultrastructure and molecular phylogenetic position of Heteronema scaphurum: a eukaryovorous euglenid with a cytoproct  3.1 Synopsis The Euglenida comprises a diverse group of unicellular flagellates unified by both ultrastructural and molecular features. Most notably, euglenids share a distinctive pellicle that is formed by the plasma membrane, interlocking proteinaceous strips, subtending microtubules, and cisternae of endoplasmic reticulum (Esson and Leander, 2006; Leander and Farmer, 2000b; Leander et al., 2007). The different modes of nutrition in the group, namely phagotrophy, osmotrophy and phototrophy, roughly correlate with the number of strips and the degree of plasticity in the pellicle (Leander and Farmer, 2000b; Leander and Farmer, 2001a; Leander et al., 2001a). Bacterivores have rigid cells with less than 20 longitudinally arranged strips, whereas eukaryovores have between 20 and 56 strips that form a helically arranged pattern on the cell surface; eukaryovorous euglenids are able to distort their cell shape in a manner that is characteristic of euglenids, called ‘euglenoid movement’ or ‘metaboly’ (Leander et al., 2001b; Triemer and Farmer, 1991a; Triemer et al., 2006). This ability, coupled with the presence of a well-developed feeding apparatus consisting of microtubule-based rods and vanes, allows eukaryovorous euglenids (e.g., Peranema, Dinema, and Urceolus) to capture and engulf large prey cells, such as other microeukaryotes. A secondary endosymbiotic event involving eukaryovorous euglenids and engulfed green algal prey cells might have given rise to a distinct clade of phototrophic euglenids (Leander, 2004; Rogers et al., 2007). Here we characterize the eukaryovorous euglenid Heteronema scaphurum using light microscopy, video analysis, scanning and transmission electron microscopy,  40  and molecular phylogenetic analysis of SSU rRNA sequences. Our study demonstrated that this species has a distinct and novel feeding behaviour involving hook-like flagella and a mucilaginous web that captures (green algal) prey before engulfing them. H. scaphurum also eliminates remnant prey material as faecal pellets through a cytoproct. The discovery of these novel features in this species expands our knowledge of euglenid diversity, especially in regard to phagotrophic euglenids, and provides improved context for understanding the eukaryovorous origins of phototrophic euglenids.  3.2 Materials and methods 3.2.1 Cell isolation and cultivation A sample of freshwater sediments from a pond in Illinois, USA, was collected during the spring of 2007, and a culture was established at room temperature in a 0.01% Knop medium (Saito et al., 2003) using Chlamydomonas as prey cells.  3.2.2 Light microscopy and video analysis Differential interference contrast (DIC) light micrographs (LMs) were taken using a Zeiss Axioplan 2 imaging microscope and a Leica DC500 digital chilled CCD camera. Cells were fixed with 1% (v/v) glutaraldehyde for high magnification observations. Digital videos were taken with a PixeLink Megapixel color digital camera connected to a Zeiss Axiovert 200 inverted microscope.  41  3.2.3 Electron microscopy Cells were fixed for scanning electron microscopy (SEM) using a 4% osmium tetroxide vapour protocol described previously (Leander and Farmer, 2000b). The cells were then transferred onto a 10µm polycarbonate membrane filter, dehydrated with a graded ethanol series, and critical point dried with CO2 using a Tousimis Critical Point Dryer. The filter was then mounted on an aluminum stub, sputter coated with gold/palladium using a Cressington 208HR High Resolution Sputter Coater, and observed with a Hitachi S-4700 field emission scanning electron microscope. Cells were fixed for transmission electron microscopy (TEM) using 2% glutaraldehyde in 0.1 M sodium cacodylate buffer (SCB). The pre-fixed cells were washed in 0.1M SCB three times, and post-fixed in 1% (w/v) osmium tetroxide in 0.2 M SCB, in ice, for one hour. The cells were then dehydrated through a graded series of ethanol and 100% acetone, and infiltrated with a graded series of acetone-Epon 812 resin mixtures and 100% Epon 812 resin. Ultra-thin sections were collected on copper Formvar-coated slot grids, stained with 2% (w/v) uranyl acetate and lead citrate, and observed using a Hitachi H7600 electron microscope.  3.2.4 DNA extraction and PCR amplification Total genomic DNA was extracted using the MasterPure Complete DNA and RNA purification Kit (Epicentre, WI, USA) from ~ 30 cells, following the procedures provided by the manufacturer. Polymerase chain reactions (PCR) of 18S rRNA were performed using PuRe Taq Ready-To-Go PCR beads kit (GE Healthcare, Buckinghamshire, UK), and the following primers: 5’TGCGCTACCTGGTTGATCC-3’ and 5’-AACGGAATYAACCAGACARAT-3’. Amplified DNA fragments were purified from agarose gels using UltraClean 15  42  DNA Purification Kit (MO Bio, CA, USA), and subsequently cloned into the TOPO TA Cloning Kit (Invitrogen, CA, USA). Three clones were sequenced with the ABI Big-Dye reaction mix using the vector primers and three internal primers: Dinema18s1R (5’- GGACTACGACGGTATCTGATCAT-3’), 475EugF (5’AAGTCTGGTGCCAGCAGCYGC-3’) and DinemaSSU620F (5’GCAAGACAGCTGTGCGATAGCAA-3’). The new sequence was screened with BLAST, identified by molecular phylogenetic analyses, and submitted to the GenBank database (JN566139).  3.2.5 Multiple sequence alignment and molecular phylogenetic analyses The new 18S rRNA sequence was analyzed within the context of a 39-taxon alignment consisting of taxa representing the Euglenozoa (636 unambiguously aligned sites). Ambiguously aligned positions and gaps were excluded. Molecular phylogenetic relationships were inferred using maximum likelihood (ML) and Bayesian inference (BI) methods with PhyML (Guindon and Gascuel, 2003) and MrBayes (Ronquist and Huelsenbeck, 2003), respectively, with the graphical interface TOPALi v2.5 (Milne et al., 2009). The models used for ML and BI to generate phylogenetic trees were chosen using Model selection in TOPALi v2.5 (Milne et al., 2009). For ML, the nucleotide dataset was analysed using a general-time-reversible (GTR) model of base substitutions, plus a gamma correction with eight substitution rate categories and the proportion of invariable sites (GTR + I + G). ML bootstrap analysis of 100 replicates was performed with the same parameters described above. For the BI, the program MrBayes was set to operate with a gamma correction with eight categories and proportion of invariable sites, and four Monte-Carlo-Markov chains (MCMC) (default temperature = 0.2). A total of 1,000,000 generations was calculated with trees sampled every 50 generations and with a prior burn-in of 100,000 generations (i.e., 2,000 sampled trees were discarded).  43  3.3 Results 3.3.1 General morphology The cells were spindle-shaped with a tapering posterior end, 45-70 µm long and approximately 30 µm wide (n = 250). A vestibular opening was located at the anterior end of the cell, which led to the flagellar pocket and feeding pocket (Figs. 3.1A-B). The posterior end of the cell contained a distinct concavity, or ‘cytoproct’, through which material was periodically released (Figs. 3.1C-F, 3.2A, E-G).  Figure 3.1. Light micrographs (LM) showing fixed cells of Heteronema scaphurum. A. Side view showing dorsal and ventral flagella (DF and VF, respectively), flagellar pocket (FP) and feeding apparatus (arrowhead). Scale bar = 10 µm. B. High magnification view showing feeding apparatus (arrowhead). Scale bar = 5 µm. C. Side view showing the nucleus with endosomes (arrow) and cytoproct (arrowhead). D. Cell in dorsal view showing engulfed prey Chlamydomonas (arrows), and cytoproct (arrowhead). E. Dorsalposterior view showing the DF and VF, and the feeding apparatus (arrowhead). Scale bars 3-5 = 10 µm. F. Detail of figure 5 showing the cytoproct, and material being excreted (arrowhead). Scale bar = 5 µm.  44  Figure 3.2. Scanning electron micrographs (SEM) of Heteronema scaphurum. A. Posterior view of a cell showing the cytoproct (arrow). Scale bar = 10 µm. B. Lateral view of the cell showing the dorsal and ventral flagella with mastigonemes (DF and VF, respectively). Scale bar = 5 µm. C. Ventral view of the anterior tip of a cell showing two prey cells (Chlamydomonas, arrowhead) that have been captured by both flagella of the euglenid. Scale bar = 10 µm. D. Anterior view of a cell showing a mucus web (arrow) surrounding the prey cells. Scale bar = 10 µm. E. Posterior tip of a cell showing pellicle strips extending into the cytoproct (arrowhead). Scale bar = 1 µm. F. Posterior tip of a cell showing material being secreted from the cytoproct. Scale bar = 5 µm. G. Posterior view of a cell showing a faecal pellet (arrow) being secreted through the cytoproct. Scale bar = 10 µm. H. Posterior view of a cell dividing along its anteroposterior axis. The arrow shows the thinner nascent pellicle strips. Scale bar = 10 µm.  Two heterodynamic flagella emerged from the vestibular opening (Figs. 3.1A-E, 3.2B). The dorsal (anterior) flagellum (DF) was approximately 60 µm long,  45  whereas the ventral (posterior) flagellum (VF) was slightly shorter. Both flagella were adorned with mastigonemes (Figs. 3.2B-D). The cells were capable of ‘euglenoid movement’ and moved by a smooth gliding, with the anterior flagellum extended in front of the cell and probing the substrate, and the ventral flagellum bent backward, and trailing freely beneath the cell. The cell divided from anterior to posterior along the longitudinal axis (Fig. 3.2H).  3.3.2 Feeding behaviour H. scaphurum devoured Chlamydomonas. During this process, the dorsal flagellum formed an arc, hooked several prey cells, and pushed them toward the vestibular opening (Figs. 3.3A-F). The ventral flagellum participated in the capture and manipulation of the prey cells by trapping the cells within the arc formed by the dorsal flagellum. The cell also secreted a sticky substance that functioned to envelope the prey within a web of mucus (Figs. 3.2C-D). Once the prey cells were moved against the vestibular opening, the anterior end of the cell expanded as the flagella continued to push the prey cells inward (Figs. 3.3B-F). The rods then moved the flagella to one side, preventing the passage of food into the flagellar pocket as the prey cells were ingested whole. During this process, H. scaphurum also distorted its shape, presumably to generate forces required to facilitate the engulfment of the prey (Figs. 3.3E-F). The entire process of feeding, from prey capture to engulfment, took approximately one minute to complete.  46  Figure 3.3. Time series of video microscope images of Heteronema scaphurum feeding on the green alga Chlamydomonas. The dorsal flagellum (arrow) captures and guides the prey (arrowhead) toward the vestibular opening. Once in contact with the prey the vestibular opening of the cell expands, the flagella thrust the prey cells inward, and the whole prey cells are engulfed.  We also observed material that was released through the posterior ‘cytoproct’ during the feeding process (Figs. 3.1F, 3.2F-G). The cells were able to discharge either mucilaginous material (Fig. 3.2F) or solid faecal pellets around 3µm in diameter (Fig. 3.2G). The faecal pellets accumulated, and were easily observed in the culture dishes.  3.3.3 Cell surface H. scaphurum had 28 pellicle strips (n~100) that ran along the antero-posterior axis of the cell and formed a helically arranged pattern on the cell surface (Fig. 3.2). All of the strips were approximately the same width; there was no ventral groove or ‘flagellar strip’ containing the ventral flagellum. All of the strips extended into the anterior vestibulum and the posterior ‘cytoproct’; there were no  47  indications of strip reduction on either end of the cell (Figs. 3.2A, C-H). The number of strips doubled prior to cytokinesis, whereby new thinner strips emerged between the parental thicker strips (Fig. 3.2H). The transverse ultrastructure of the pellicle consisted of the plasma membrane, relatively thick Sshaped proteinaceous strips, a discontinuous row of microtubules beneath the heel of each strip, and cisternae of endoplasmic reticulum (ER) (Fig. 3.4A). The number of microtubules underlining the strips was typically 10, but varied from three to more than 18 (not shown). The plateau-shaped strips had an uneven thickness, becoming thinner towards the zone of articulation with the next strip. The arch terminated with a conspicuous overhang that connected to the hook of the adjacent strip by three bridges in the articulation zone (see Leander and Farmer, 2001b for definitions of terminology).  3.3.4 Cytoplasmic organelles LMs and TEMs demonstrated a single nucleus with permanently condensed chromosomes and several conspicuous, centrally located, endosomes (Figs. 3.1C, 3.4B). The mitochondria had discoidal cristae (Fig.3.4C), and robust Golgi bodies were formed of numerous concentric cisternae (Fig. 3.4D). Tubular extrusomes were positioned immediately beneath the articulation zones between S-shaped pellicle strips and throughout the cytoplasm, sometimes forming batteries of parallel units (Fig. 3.4E). The resting tubular extrusomes were approximately 2.7 µm long and 0.2 µm wide (Figs. 3.4E-G). The extrusomes were circular in cross-section, with a darkly stained outer region surrounding a granular core (Fig. 3.4H), and had helically arranged surface striations (Fig. 3.4G). The core contained electron dense regions and translucent regions along its length (Figs. 3.4E-G); an anterior (clear) ‘cup’ with operculum was followed by a granular dark band approximately 200 nm long, and a lighter (apparently hollow) core (Fig. 3.4F).  48  Figure 3.4. Transmission electron micrographs (TEM) of Heteronema scaphurum. A. Cross-section through the pellicle showing the plasma membrane (m), thick proteinaceous strips (S), microtubules (mt), and cisternae of endoplasmic reticulum (ER). Scale bar = 100 nm. B. TEM showing the nucleus containing several conspicuous endosomes (En) and permanently condensed chromosomes. Scale bar = 2 µm. C. Mitochondria with discoidal cristae (arrow). Scale bar = 500 nm. D. Golgi bodies. Scale bar = 500 nm. E. Longitudinal and cross-section views of tubular extrusomes (E). Scale bar = 2 µm. F. Longitudinal section of an extrusome showing an anterior clear ‘cup’ (arrowhead) with operculum (arrow). The region next to the cup, of approximately 200 nm in length, appears granular and darker than the rest of the tube. Scale bar = 500 nm. G. Detail of extrusome in longitudinal view, showing a striated outer region (arrow) and a clear, hollow core (arrowhead). Scale bar = 100 nm. H. Cross section of extrusomes at different levels showing a dark and helically striated outer region (arrow), and a granular core. Scale bar = 100 nm.  49  3.3.5 Feeding apparatus The feeding apparatus was located at the ventral side of the flagellar pocket and consisted of four structures: a dorsal rod (DR), a ventral rod (VR), an accessory rod (AR) that interacted with the VR and the wall of the feeding pocket (Fe) and four ‘vanes’ (i.e., a single row of microtubules affixed to a membrane). The dorsal wall of the vestibulum (V) was lined by dense fibrous material (Fig. 3.5A). A group of microtubules lined the dorsal side of the feeding pocket and supported a cluster of hairs (‘tomentum’) that extended into the feeding pocket (Figs. 3.5AB, E). The three rods were positioned between the Fe and the anterior region of the FP to separate the pockets (Figs. 3.5E-F). The rods were formed of interlinked microtubules embedded in an amorphous matrix (Fig. 3.6A-C). At the posterior end, these were entirely formed of microtubules embedded in a thin homogeneous matrix (Fig. 3.6A); at the anterior end, the rods contained microtubules within a heterogeneous matrix that formed a conspicuous peripheral ring in transverse sections (Figs. 3.5A-C, 3.6C).  50  Figure 3.5. Transmission electron micrographs showing the feeding apparatus in Heteronema scaphurum at different levels along the longitudinal axis of the cell. A. Cross-section through the anterior end of the cell showing part of the feeding pocket (Fe), the dorsal rod (DR) and the accessory rod (AR). The AR has a lamellar expansion that connects with a microtubule-lined ventral lamella (VL) extending from the wall of the feeding pocket. Microtubules line the dorsal side of the feeding pocket (arrows). A cluster of hairs or “tomentum” (arrowhead) extends from the dorsal microtubules and into the Fe. FM: fibrous material lining the anterior pocket of the cell; SF: striated fibre. Scale bar = 1 µm. B. Transversal section showing the enlarged vestibulum (V) formed by the merging of the flagellar pocket and the feeding pocket. A cluster of hairs (arrowhead) still demarcates the deeper separation of the flagellar pocket and the Fe. DF = dorsal flagellum. Scale bar = 1 µm. C. Cross-section at the anterior end of the cell. The region of the vestibulum that is continuous with the flagellar pocket is reinforced by FM and SF.  51  Both DR and VRare visible as well as the vanes of the feeding apparatus (arrows). VF = ventral flagellum. Scale bar = 1 µm. D. Oblique section showing the position of DR and VR relative to Fe and the flagellar pocket (FP). DL = dorsal lamella Scale bar = 2 µm. E. Semi-longitudinal section of the FP and Fe. The VL arches over the Fe and connects to the DL. Scale bar = 2 µm. F. Separation of the Fe from the FP. Scale bars = 1 µm.  The AR was composed of only a few microtubules embedded in a dense amorphous matrix (Figs. 3.6D-E). It also had a lamellar projection that extended toward the anterior end of the cell (Fig. 3.6E). At the most anterior level of the feeding apparatus, the lamellar projection of the accessory rod connected to a microtubule-lined ventral lamella (VL) that extended inward from the wall of the vestibulum (Figs. 3.5A-B, E). The VL arched over the Fe, side of the V and joined to DL (Fig. 3.5E). Near the anterior end of the cell, both DR and VR were connected to one another. Near the posterior end of the cell, the rods were also connected, forming one microtubular bundle that was compartmentalized by the four vanes (Fig. 3.6A). A series of more anterior sections through the rods demonstrate the detachment of the vanes from the rods (Figs. 3.6B-C).  52  Figure 3.6. Transmission electron micrographs showing the feeding apparatus in Heteronema scaphurum. A-C. Non-consecutive serial cross-sections through the rods. Scale bars = 500 nm. A. A posterior section through the rods showing that they are connected, forming a single structure entirely formed by microtubules embedded in a homogeneous matrix. Deep grooves in the microtubular bundle are lined by four vanes (arrows). B. A more anterior section through the rods showing separate bundles of microtubules embedded in a more heterogeneous matrix. There are still grooves in the microtubular bundles associated with the four vanes. C. An anterior section through the rods showing the detachment of the vanes from the rods. D. Cross-section showing the relationship of the flagellar pocket (FP) and the feeding apparatus. The rods are separated from the FP and the vanes. Arrowhead = striated fibre; AR = accessory rod; DF = dorsal flagellum; DR = dorsal rod; VF = ventral flagellum; VR = ventral rod. E. Detail of the connection (arrow) between the ventral rod (VR) and the accessory rod (AR). The arrowhead shows a striated fibre extending toward the pellicle. Scale bars in D-E = 1 µm.  3.3.6 Flagellar apparatus The flagellar pocket merged with the Fe near the anterior end of the cell, forming the vestibulum (Fig. 3.5B). Two heterodynamic flagella emerged from the base of the flagellar pocket, which was reinforced by electron-dense material near the vestibular opening (Fig. 3.7D). Each flagellum had axonemes with the typical 9+2 arrangement of microtubules (Fig. 3.7C) and near the transition zone, which  53  appeared swollen, the two central microtubules were absent, showing a 9+0 arrangement (Fig. 3.7A). Both flagella also contained paraxial rods (PR) (Figs. 3.7A-C) and conspicuous flagellar hairs (mastigonemes) (Fig. 3.7C). The PR in the DF had a whorled disposition in transverse section; the PR in the VF had a lattice of parallel fibres in transverse section (Figs. 3.7B-C). The two flagella were sometimes linked to each other near the vestibular opening by a striated system of hairs (Fig. 3.7C). Like in other euglenids, the flagellar apparatus consisted of two basal bodies and three microtubular roots. The flagellar apparatus is shown in Figs. 3.7E-G from a posterior to anterior view. The dorsal root (dr) originated from the dorsal basal body, and the ventral root (vr) and intermediate root (ir) originated form the ventral basal body (Figs. 3.7E-G). The dr consisted of microtubules that extended toward the anterior end of the cell and initially supported the dorsal side of the flagellar pocket (Figs. 3.7E-F). The number of microtubules increased as they extended anteriorly along the flagellar pocket and ultimately became the microtubules that subtend the pellicle strips (Figs. 3.7D, F-G). The ir, initially formed by four microtubules, was located between the dr and the vr, and supported the left side of the flagellar pocket (Figs. 3.7E-G). The number of microtubules in this root increased towards the anterior end of the flagellar pocket, joining the dorsal root in a single microtubular band (dr+ir) that lined the dorsal-left side of the flagellar pocket (Fig. 3.7G). The vr originated from the ventral basal body and initially consisted of four microtubules (Figs. 3.7E-F). Toward the anterior of the cell, the number of these microtubules increased, and eventually reinforced the ventral side of the flagellar pocket and the feeding apparatus (Fig. 3.7G).  54  Figure 3.7. Transmission electron micrographs of the flagellar apparatus of Heteronema scaphurum. A. Cross-section through the swollen flagellar transition zone, showing a 9+0 arrangement of microtubules (arrow). PR = paraxial rod. Scale bar = 100 nm. B. Oblique section through the dorsal and ventral flagella (DF and VF, respectively) showing the paraxial rods (arrows) and mastigonemes (arrowheads). Scale bar = 500 nm. C. Cross-section of DF and VF showing the 9+2 arrangement of axonemal microtubules and the paraxial rods (arrows). The paraxial rod in the DF has a whorled disposition, and the paraxial rod in the VF is composed of a lattice-like pattern of fibres. A striated fibril (arrowhead) connects both flagella near the posterior end of the flagellar pocket. Scale bar = 100 nm. D. Cross-section through the flagellar pocket at the anterior level showing DF and VF and pellicle strips (arrows) extending into the flagellar pocket, which  55  is lined by fibrous material (FM). Scale bar = 500 nm. E. Cross-section through the flagellar pocket at the level of the flagellar transition zones showing the three microtubular roots: the dorsal flagellar root (dr) is associated with the dorsal basal body; the ventral and intermediate roots (vr and ir, respectively) are associated with the ventral basal bodyDR = dorsal rod; VR = ventral rod. Scale bar = 500 nm. F. Crosssection through the middle part of the flagellar pocket. The dr is formed by microtubules that extend along the dorsal side of the flagellar pocket. The ir is positioned between the dr and the vr, supporting the left side of the flagellar pocket. The vr initially consists of four microtubules, supporting the ventral side of the pocket. A striated fibre (SF) reinforces the dorsal side of the pocket. Rows of microtubules lie on both sides of SF: four microtubules on the left (arrowhead) and sixteen linked microtubules (LMt) on the right side of SF. An electron-dense plate that passes under the SF connects both rows of microtubules. Scale bar = 1 µm. G. Cross-section through the anterior area of the flagellar pocket, showing the fusion of the dorsal and intermediate roots (dr+ir). Scale bar = 2µm.  A striated fibre (SF) lined the dorsal-right side of the feeding pocket. On either side of the fibre there was a row of microtubules: to the right, the row was formed by four microtubules. To the left of the fibre the microtubules were linked, and their number increased from approximately eight, to more than eighteen. An electron dense plate that passed under the SF connected both rows of microtubules (Fig. 3.7F).  3.3.7 Molecular phylogenetic position The 18S rRNA sequence (2,860 bp) of H. scaphurum contained a number of insertions not present in the sequences of the other phagotrophs. Two of them were of considerable length: the first one (at position 142 of the sequence) was 567 bp long, and the second (at position 2122 of the sequence) had 253 bp. ML and Bayesian analyses of the 39-taxon alignment resulted in identical tree topologies that showed the new isolate clustering within a clade of euglenids consisting of eukaryovorous, primary osmotrophic and phototrophic species (Fig. 3.8).  56  Figure 3.8. Maximum likelihood tree, inferred from 39 small subunit (SSU) rRNA sequences, showing the molecular phylogenetic position of Heteronema scaphurum within the Euglenids using Diplonemids and Kinetoplastids as outgroups. Bayesian posterior probabilities over 0.95 are shown. Thick branches correspond ML bootstraps greater then 50%.  57  The phototrophic and primary osmotrophic euglenids formed two well-supported subclades (ML boostrap value = 83% and Bayesian posterior probability = 1.00 for primary osmotrophs, and ML boostrap value = 99% and Bayesian posterior probability = 1.00 for phototrophic species). The eukaryovorous euglenids Peranema, Anisonema, Dinema, and H. scaphurum, however, did not form a distinct clade and instead formed a paraphyletic stem group from which the phototrophic and primary osmotrophic subclades branched independently from one another.  3.4 Discussion Heteronema scaphurum had all the ultrastructural characteristics distinctive of euglenozoans: a tripartite flagellar root system, flagella with heteromorphic paraxial rods, tubular extrusomes, and mitochondria with discoidal (paddleshaped) cristae (Simpson, 1997; Willey et al., 1988). H. scaphurum also had a pellicle with proteinaceous strips, the best synapomorphy for euglenids, and a complex feeding apparatus consisting of rods and vanes, typically found in many heterotrophic members of the group (e.g., Peranema and Dinema) (Triemer and Farmer, 1991a). In agreement with these morphological attributes, our phylogenetic analyses of 18S rRNA sequences placed H. scaphurum as a member of the Euglenida and, more specifically, as a branch within a clade formed by all eukaryovorous, primary osmotrophic, and phototrophic euglenids. H. scaphurum was originally described by Skuja in 1934, and later reported in Australian freshwater sites (Schroeckh et al., 2003). These descriptions, however, were solely based on light micrographs. Skuja reported cells with a size range of 78–85 µm, and a diameter of 40–46 µm for H. scaphurum, whereas the cells in Australia were shorter (62–75 µm long), more within the range of our isolate (45-70 µm in length and 30 µm in diameter). Both Skuja and Schroeckh et al. described “a characteristic dimple at the posterior end of the cell” (Schroeckh 58  et al., 2003), which we consider to be the posterior cytoproct in our isolate. No other data (e.g. scanning and transmission electron microscopy, or molecular markers) are available, making a more detailed comparison with our isolate impossible. The features observed in our light micrographs, on the other hand, seem to be in accordance with the previous descriptions of this species, persuading us to name our isolate H. scaphurum. However, Heteronema has unclear generic limits, largely due to a continuum of morphological variation between this genus and other genera, such as Metanema and Dinema (Larsen and Patterson, 1991), coupled with descriptions based solely on LM (Al-Qassab et al., 2002; Lee et al., 2005; Schroeckh et al., 2003). The re-description of this species, with the addition of SEM, TEM and molecular data, contributes to demarcate the ultrastructural features of Heteronema species. Moreover, we provide the first molecular data (SSU rRNA sequence) for this genus, contributing to a better resolution of euglenid phylogeny.  3.4.1 Pellicle The eukaryovorous euglenids described so far are capable of euglenoid movement and have helically arranged, delicate pellicle strips that range in total number between 20-56 (Leander et al., 2007). Euglenids with less than about twenty strips tend to be rigid and are either bacterivorous, osmotrophic or phototrophic. H. scaphurum had a plastic pellicle formed by 28 helically arranged strips without posterior strip reduction, which is consistent with the range of features present in other eukaryovores. In contrast to other eukaryovores (Peranema, Dinema, and Urceolus), the pellicle strips of H. scaphurum were robust in transverse section (100 nm thick) and had distinct overhangs in the articulation zones (Leander and Farmer, 2000b; Leander et al., 2001b). Unlike Peranema trichophorum and Dinema sulcatum, H. scaphurum did not possess a distinctly shaped ‘flagellar strip’ that holds the posterior (recurrent) flagellum on the ventral side of the cell during gliding motility (Leander et al., 2001a).  59  3.4.2 Feeding apparatus Triemer and Farmer (1991a) described four types of feeding apparatuses in euglenids (Type I-IV). Some bacterivores have relatively simple feeding structures consisting of a pocket lined by a row of microtubules (e.g., Type I apparatus in Petalomonas), whereas others have a robust and well-developed feeding apparatuses consisting of robust rods and vanes (e.g., Type II and IV in Ploeotia and Entosiphon, respectively) (Linton and Triemer, 1999; Triemer and Fritz, 1987; Triemer and Farmer, 1991a). Eukaryovorous euglenids also have a complex feeding system consisting of a cytostome, four vanes, and two rods with varying amounts of supporting microtubules and amorphous matrix (e.g., Type III apparatus in Dinema and Peranema) (Triemer and Farmer, 1991a). The feeding apparatus in H. scaphurum conforms to Type III in this scheme and is most similar to the apparatus found in Peranema trichophorum (Nisbet, 1974); the main difference is that the base of the flagellar pocket is more expanded in H. scaphurum Moreover, the rods in P. trichophorum are capable of projecting out from the cell in order to pierce the prey cell during myxocytosis (Triemer, 1997). This behavior was not observed in H. scaphurum. Both H. scaphurum and P. trichophorum use their two flagella like ‘arms’ to manipulate prey and initiate phagocytosis (Triemer, 1997); however, H. scaphurum also secretes a mucilaginous web through the vestibular opening, another novel feature, to capture and secure the prey cells (usually several at a time). The rods move the flagella to one side, preventing the passage of food into the flagellat pocket. In P. trichophorum the rods are pushed forward into the flagellar pocket, also displacing the flagella. However, according to Nisbet (Nisbet, 1974), the contraction of longitudinal lamellae attached to the rods moves them forward, something that is not observed in H. scaphurum The enlargement of the vestibular opening during phagocytosis in H. scaphurum is generally similar to the modes of feeding in other kinds of eukaryotes, such as  60  raptorial ciliates. Dileptus lamella, for instance, enlarges its cytostome to a diameter even wider than that of the prey; Didinium nasutum has a fibrous ring that encircles the base of its proboscis and stretches the cell body to accommodate the prey (Verni and Gualtieri, 1997). In H. scaphurum, the thickenings and the striated fibre around the flagellar pocket might be playing a similar role. The accessory rod in H. scaphurum probably also plays a role in the expansion of the vestibular opening by pulling the ventral lamella away from the center of the flagellar pocket.  3.4.3 Faecal pellets in single-celled eukaryotes After feeding, H. scaphurum secretes waste material through the cytoproct, often in the form of faecal pellets. Faecal pellets are found in both marine and freshwater environments and can vary in size and shape, ranging from minipellets (measuring between 3 µm and 50 µm in diameter) to larger pellets of more than 50 µm (Gowing and Silver, 1985). The presence of faecal pellets in sediment samples is usually attributed to meiofaunal metazoans (i.e., benthic organisms with sized ranging 0.5 - 1 mm). Although phagotrophic protists must produce some sort of waste product, the generation of faecal pellets is only rarely reported, for example in dinoflagellates (Buck et al., 1990; Buck and Newton, 1995), ciliates (Stoecker, 1984), and radiolarians (Gowing and Silver, 1985). This is the first report of any member of the Euglenozoa discharging faecal pellets through a distinct cytoproct.  3.4.4 Heteronema scaphurum: ultrastructural identity and phylogenetic position The SSU rRNA sequence of H. scaphurum had an unresolved position among the eukayrovorous species of euglenids. Its ultrastructural characters are  61  consistent with a predator lifestyle (e.g., a derived feeding apparatus, with short rods located in the anterior end of the cell, similar to that of P. trichophorum). Shorter rods presumably allow for more flexibility in the posterior two thirds of the cell which, coupled with a growing number of pellicle strips, would give eukaryovorous euglenids the elasticity to ingest bundles of large prey cells. However, H. scaphurum has fewer pellicle strips than P. trichophorum (28 vs 56), as well as less cell plasticity. The set of morphological characters in H. scaphurum is somewhat transitional between bacterivores (with fewer pellicle strips but longer rods) and eukaryovores (with more pellicle strips and short rods). Also, H. scaphurum shows novel characteristics such as a cytoproct from which small pellets are expelled, and a feeding behaviour similar to the hypothezised mechanism by which eukaryovorous ancestors might have sequestered green algae, thus giving rise to the clade of phototrophic euglenids.  3.5 Taxonomic summary Eukaryota; Excavata; Euglenozoa; Euglenida; Heteronema Dujardin 1841 Heteronema scaphurum Skuja 1934 3.5.1 Description Fresh-water, spindle-shaped cells, 45-70 µm long and approximately 30 µm across at its broadest. Free-living, colorless, capable of metaboly and eukaryovory. Two heterodynamic flagella bearing prominent hairs; anterior flagellum about the same length as cell body and extending straight forward while gliding; posterior flagellum slightly shorter and about 0.7 times of the cell length and trailing freely beneath the ventral surface of the cell. Both flagella participate in prey capture; the anterior flagellum forms an arc used to hook prey cells and guide them toward the vestibular opening. Feeding apparatus extends beyond  62  the flagellar pocket for approximately one third of the cell length, and consists of two main rods, one accessory rod, and four vanes. Conspicuous posterior cytoproct. Tubular extrusomes. Pellicle consists of 28 helically arranged strips without posterior reduction. Pellicle strips relatively thick in transverse section (100 nm). The nucleus contains several conspicuous endosomes.  Material Block of resin-embedded cells for TEM and cells on gold sputter-coated SEM stubs (hapantotype) deposited in the Beaty Biodiversity Research Centre (Marine Invertebrate Collection) at the University of British Columbia, Vancouver, Canada (MI-PR112).  Locality Artificial freshwater pond at Herrin, Illinois, U.S.A. (N 37°47’223”N, 089°01’310”W).  DNA sequence The SSU rRNA sequence from Heteronema scaphurum has the GenBank. Accession Number JN566139  63  4 Ultrastructure and molecular phylogenetic position of a novel euglenozoan with extrusive episymbiotic bacteria: Bihospites bacati n. gen. et sp. (Symbiontida)  4.1 Synopsis The Euglenozoa is a diverse group of single-celled eukaryotes consisting of three main subgroups: euglenids, kinetoplastids and diplonemids. Euglenids are united by the presence of a distinctive pellicle, a superficial system formed by four major components: the plasma membrane, a pattern of repeating proteinaceous strips that run along the length of the cell, subtending microtubules and tubular cisternae of endoplasmic reticulum (Leander and Farmer, 2000b). The group is widely known for its phototrophic members (e.g. Euglena and Phacus), but the majority of the species are heterotrophic (osmotrophs or phagotrophs). Phototrophic euglenids evolved from phagotrophic ancestors with a complex feeding apparatus and a large number of pellicle strips that facilitate a characteristic peristaltic cell movement called “euglenoid movement”. This combination of characters allows phagotrophic euglenids to engulf large prey cells, such as eukaryotic algae, which eventually led to the acquisition of chloroplasts via secondary endosymbiosis (Leander et al., 2001a; Triemer and Farmer, 1991a). Euglenids are closely related to kinetoplastids and diplonemids. Kinetoplastids (a group that includes free-living bodonids and parasitic species such as Trypanosoma and Leishmania) are united by the presence of a mitochondrial inclusion of distinctively arranged DNA molecules, called a kinetoplast or kDNA (Simpson et al., 2002). Kinetoplastids and euglenids share several morphological features, such as flagella with hairs and heteromorphic  64  paraxial rods (e.g. a proteinaceous scaffolding adjacent to the usual 9+2 axoneme) and mitochondria with paddle-shaped (discoidal) cristae (Kivic and Walne, 1984; Simpson, 1997; Willey et al., 1988). Diplonemids, on the other hand, possess a large mitochondrion with flattened cristae and apparently lack flagellar hairs (Marande et al., 2005). The monophyly of the Euglenozoa has been established on the basis of both molecular phylogenetic analyses and the following morphological synapomorphies: a tripartite flagellar root system, presence of heteromorphic paraxial rods and tubular extrusomes. Environmental sequencing of oxygen-depleted sediments around the world has shown that these habitats harbour a vast and unknown diversity of microbial lineages (Behnke et al., 2006; Dawson and Pace, 2002; Edgcomb et al., 2002; Stoeck et al., 2003; Takishita et al., 2007; Zuendorf et al., 2006). Phylogenetic analyses of these data have helped demonstrate the existence of several novel lineages associated with many different eukaryotic supergroups. Although these types of analyses are very effective in revealing the actual diversity of microbes living in a particular environment, these approaches also generate vast amounts of “orphan” data that cannot be linked directly to organisms known from comparative morphology. Nonetheless, some of the environmental sequences recovered from oxygen depleted environments cluster with euglenozoans in phylogenetic analyses but with no clear position within the group (Behnke et al., 2006; Stoeck et al., 2003; Zuendorf et al., 2006). Other studies have explored and characterized the microbial diversity in oxygendepleted environments using microscopical approaches (Bernhard et al., 2000; Buck et al., 2000; Fenchel et al., 1995; Leander and Keeling, 2004a; Simpson et al., 1996; Yubuki et al., 2009). This research has shown that a reoccurring feature of euglenozoans living in low oxygen environments is the presence of episymbiotic bacteria on the cell surface. Here, we report on a highly unusual (uncultivated) euglenozoan isolated from oxygen depleted marine sediments that is covered with two very different morphotypes of episymbionts. We  65  characterized this new euglenozoan with light microscopy, SEM, comprehensive TEM, and molecular phylogenetic analyses of SSU rRNA sequences. Our data demonstrate that this organism is the earliest diverging member of the Symbiontida, a new subclade of euglenozoans composed of anaerobic and microaerophilic flagellates with a superficial layer of mitochondrion-derived organelles that associates closely with a uniform layer of episymbiotic bacteria (Yubuki et al., 2009). Moreover, the comparative ultrastructural data from this novel lineage sheds considerable light onto the phylogenetic position of the Symbiontida, as a whole, within the Euglenozoa.  4.2 Materials and methods 4.2.1 Collection of organisms Sediment samples were collected at low tide from the shoreline of Centennial Beach (Boundary Bay) in South-western British Columbia, Canada (49° 00’ 4797’’N, 123° 02’ 1812’’W), during the spring and summer of 2007 and 2008. The samples were taken at a depth of 1-3 cm below the sediment surface, from a conspicuous layer of black sand. The sediment samples were stored in flat containers at room temperature before individually isolated cells were prepared for light microscopy, electron microscopy, and DNA extraction. Cells were extracted from the sand samples through a 48-µm mesh using the Uhlig melted seawater-ice method (Uhlig, 1964). Attempts to culture the organism were made using two different media: ATCC 1728 (for growing Isonema) and CCAP 1259/1 (for growing Petalomonas cantuscygni). Both media were diluted in sterile seawater and kept under low oxygen conditions (oxygen content below 1%) using the ANAEROGENTM COMPACT Kit system for anaerobic incubation; however, the cells did not reproduce and disappeared within 24 hours.  66  4.2.2 Light and electron microscopy Differential interference contrast (DIC) light micrographs were taken using a Zeiss Axioplan 2 imaging microscope and a Leica DC500 digital chilled CCD camera. Cells isolated from the British Columbia locality were fixed for scanning electron microscopy (SEM) using the 4% osmium tetroxide vapour protocol described previously (Leander and Farmer, 2000b). The cells were then transferred onto a 10-µm polycarbonate membrane filter, dehydrated with a graded ethanol series, and critical point dried with CO2 using a Tousimis Critical Point Dryer. The filter was then mounted on an aluminium stub, sputter coated with gold/palladium using a Cressington 208HR High Resolution Sputter Coater, and observed with a Hitachi S-4700 field emission scanning electron microscope. Cells isolated from the surrounding sediment were pre-fixed for transmission electron microscopy (TEM) using 4% (v/v) glutaraldehyde in 0.2 M sodium cacodylate buffer (SCB) (pH 7.2) with the addition of 0.3 M sorbitol. The pre-fixed cells were washed in 0.2 M SCB (pH 7.2) three times and embedded in 2% of low melting temperature agarose and post-fixed in 1% (w/v) osmium tetroxide in 0.2 M SCB (pH 7.2) at room temperature for 1 hr, before being dehydrated through a graded series of ethanol and 100% acetone. The dehydrated cells were then infiltrated with acetone-Epon 812 resin mixtures and 100% Epon 812 resin. Ultrathin serial sections were collected on copper Formvar-coated slot grids, stained with 2% (w/v) uranyl acetate and lead citrate, and observed using a Hitachi H7600 electron microscope.  4.2.3 DNA extraction, PCR amplification, alignment and phylogenetic analysis Genomic DNA was extracted using the MasterPure Complete DNA and RNA purification Kit (Epicentre, WI, USA) from 30 cells that were individually isolated  67  and washed three times in sterile seawater (i.e., “isolate 1”). This procedure was repeated three months later on a different sample of 30 individually isolated cells (i.e., “isolate 2”). Polymerase chain reactions (PCR) were performed using PuRe Taq Ready-To-Go PCR beads kit (GE Healthcare, Buckinghamshire, UK). Nearly the entire eukaryotic SSU rRNA gene was amplified from each isolate using the eukaryotic universal primers 5’- TGATCCTTCTGCAGGTTCACCTAC-3’ (Rosati et al., 1999) and 5’-GCGCTACCTGGTTGATCCTGCCAGT-3’ (Keeling, 2002). PCR amplifications consisted of an initial denaturing period (95 °C for 3 min), 35 cycles of denaturing (93 °C for 45s), annealing (5 cycles at 45°C and 30 cycles at 55 °C, for 45 s), extension (72 °C for 2 min), and a final extension period (72 °C for 5min). The amplified DNA fragments were purified from agarose gels using UltraClean 15 DNA Purification Kit (MO Bio, CA, USA), and subsequently cloned into the TOPO TA Cloning Kit (Invitrogen, CA, USA). Two clones of the eukaryotic SSU rRNA gene, from each of the two isolates (i.e., four clones in total), were sequenced with the ABI Big-Dye reaction mix using the vector primers and internal primers oriented in both directions. The new sequences were screened with BLAST, identified by molecular phylogenetic analysis, and deposited into GenBank: HM004353, HM004354. The SSU rRNA sequences from B. bacati were analyzed within the context of two alignments: (1) a 40-taxon alignment consisting of taxa representing all of the major groups of eukaryotes (988 unambiguously aligned sites) and (2) a 37-taxon alignment consisting of taxa representing all of the major lineages of euglenozoans (760 unambiguously aligned sites). Ambiguously aligned positions and gaps were excluded from both analyses. Phylogenetic relationships were inferred using maximum likelihood (ML) and Bayesian methods with the programs PhyML (Guindon and Gascuel, 2003) and MrBayes (Huelsenbeck and Ronquist, 2001), respectively. For ML, the nucleotide datasets were analysed using a general-time-reversible (GTR) model of base substitutions, plus a gamma correction with eight substitution rate categories and the proportion of invariable sites (GTR + I + G). ML bootstrap analysis of 500 replicates was performed with  68  the same parameters described above. For Bayesian analyses, the program MrBayes was set to operate with a gamma correction with eight categories and proportion of invariable sites, and four Monte-Carlo-Markov chains (MCMC) (default temperature = 0.2). A total of 2,000,000 generations was calculated with trees sampled every 100 generations and with a prior burn-in of 200,000 generations (i.e., 2,000 sampled trees were discarded). A majority rule consensus tree was constructed from 18,000 post-burn-in trees with PAUP* 4.0. Posterior probabilities correspond to the frequency at which a given node is found in the post-burn-in trees.  4.3 Results 4.3.1 General morphology The cells of Bihospites bacati n. gen. et sp. were elongated with a somewhat rounded posterior end and were 40-120 µm long and 15-30 µm wide (n = 200). The cells contained a brownish (or greenish) body near the posterior end of the cell and a variable number of distinctive black bodies at the anterior half of the cell (Fig. 4.1A, B). The cells of B. bacati had two heterodynamic flagella that were inserted subapically within a depression. The longer anterior (dorsal) flagellum extended forward and continuously probed the substrate during 'gliding' movements (Fig. 4.1B); periodically, the tip of the anterior flagellum would adhere to the substrate and abruptly drag the cell forward. The recurrent (posterior) flagellum was slightly longer than the cell body and trailed freely beneath the cell.  69  Figure 4.1. Light micrographs (LM) of living cells of Bihospites bacati n. gen. et sp. A. LM showing distinctive black bodies (white arrow) and the prominent nucleus (N) positioned near the anterior end of the cell. B. LM showing the extended dorsal flagellum (Df) that is inserted subapically. C. LM showing the dorsal flagellum (Df) and a contracted cell with raised helically arranged striations (S) on the surface. D. LM showing a cell dividing along the anteroposterior axis. E. LM showing rows of spherical-shaped bacterial episymbionts on the cell surface (arrowheads). F. LM showing the nucleus with a distinct thickening (arrow), providing evidence for the shape and orientation of the C-shaped rod apparatus.  70  The cells of B. bacati were plastic and capable of rhythmic deformations ranging from contracted to relaxed states that were reminiscent of “euglenoid movement” (Fig. 4.1C). The cells divided from anterior to posterior along the longitudinal axis (Fig. 4.1D). Cyst formation or sexual reproduction was not observed. Cells of B. bacati were found all year round, although the abundance of this species decreased significantly during the winter months.  4.3.2 Cell surface The cell surface of B. bacati was covered with two different morphotypes of episymbiotic bacteria: (1) more abundant rod shaped episymbionts and (2) spherical-shaped episymbionts (Figs. 4.1E, 4.2). The rod-shaped episymbionts were 3-5 µm long and were arranged in bands, about 7 µm wide, along the longitudinal axis of the host cell (Fig. 4.2A). These bands peeled off when the host cell deteriorated. The longitudinal bands of rod-shaped episymbionts were separated and defined by single or double rows of spherical episymbionts, each about 0.6 µm in diameter (Figs. 4.2A-E). These longitudinal rows usually extended nearly the entire length of the host cell and were helically organized when the host cells were in a contracted state (Figs. 4.1C, 4.2A).  71  Figure 4.2. Scanning electron micrographs (SEM) of Bihospites bacati n. gen. et sp. A. Ventral view of B. bacati showing a cell covered with rod-shaped and spherical-shaped episymbiotic bacteria (white arrowheads and black arrowheads, respectively), the vestibulum (vt), dorsal flagellum (Df) and ventral flagellum (Vf) (bar = 15 µm). B. High magnification of the vestibular opening (vt), showing the open cytostome (white arrowhead), and the dorsal (Df) and ventral flagella (Vf) without flagellar hairs. C. High magnification SEM showing the posterior end of B. bacati, in ventral view, and the external appearance of the raised articulation zones between S-shaped folds in the host cell surface (black arrowheads). The white arrows show pores on the cell surface. D. High magnification SEM showing the rod-shaped (white arrowheads) and spherical-shaped episymbionts. E. High magnification SEM of the spherical-shaped episymbionts showing discharged threads (black arrows) through an apical pore (bar = 0.5 µm). The white arrow shows the initial stages of the ejection process. (B-D bar = 1 µm).  72  The rod-shaped episymbionts were connected to the plasma membrane of the host by a glycocalyx-like material (Figs. 4.3A-E). The spherical-shaped episymbionts were attached to the host within a concavity in the host plasma membrane (Fig. 4.3E). The spherical-shaped episymbionts were highly organized and possessed an extrusive apparatus consisting of an apical “operculum” and a tightly coiled internal thread around a densely stained core (Figs. 4.3D-F). The coiled thread was capable of rapid discharge through an apical pore when disturbed during chemical fixation for electron microscopy (Figs. 4.2A, D-E); the densely stained core was discharged first, and the coiled thread followed (Fig. 4.3F). The ultrastructure of the host cell surface, beneath the episymbionts, consisted of a plasma membrane that was organized into a repeated series of S-shaped folds (i.e., “strips”) (Figs. 4.1C, 4.3A), a thin layer of glycoprotein, and a corset of microtubules (Fig. 4.3C). The longitudinal rows of spherical-shaped episymbionts were associated with the troughs of the S-shaped folds (Fig. 4.3A). The raised articulation zones between the S-shaped folds were visible in (i) light micrographs of contracted cells (Fig. 4.1C), (ii) scanning electron micrographs near the posterior end of the host cell (Fig. 4.2C), and (iii) transmission electron micrographs (Fig. 4.3A). The corset of microtubules beneath the folds formed a continuous row and was linked together by short “arms” (Fig. 4.3C). Tubular cisternae of endoplasmic reticulum and a layer of double-membrane bound mitochondrion-derived organelles (MtD) were positioned immediately below the superficial corset of microtubules (Figs. 4.3A-C, E-F). The mitochondrion-derived organelles contained a granular matrix and none or very few cristae per TEM profile (Fig. 4.3B). There was no evidence of kinetoplast-like inclusions or any other kind of packed DNA within the matrix of the mitochondrion-derived organelles. DAPI (4',6-diamidino-2-phenylindole) staining did not reveal kinetoplast-like structures in the mitochondrion. However, the observation of intracellular structures was obscured by the presence of abundant bacteria covering the cell surface (not shown).  73  Figure 4.3. Transmission electron micrographs (TEM) of the cell surface of Bihospites bacati n. gen. et sp. A. Cross-section of cell showing a series of S-shaped folds in the cell surface. Elongated extrusomes (E) positioned beneath the raised articulation zones between the S-shaped folds (S). Cell surface covered with rod-shaped bacteria (black arrowheads), in cross section, and spherical-shaped bacteria (white arrowheads). Mitochondrion-derived organelles (MtD) underlie the cell surface. (bar = 1 µm). B. TEM showing mitochondrion-derived organelles (MtD) with zero to two cristae (arrow). Arrowheads show transverse profiles of rod-shaped episymbionts on cell surface. C. High magnification TEM of the host cell surface showing glycocalyx (GL) connecting episymbionts to plasma membrane. Plasma membrane subtended by a thick layer of glycoprotein (double arrowhead) and a continuous row of microtubules linked  74  by short ‘arms’ (arrowhead). Mitochondrion-derived organelles (MtD) positioned between the row of microtubules and the endoplasmic reticulum (ER). D. Oblique TEM section of spherical-shaped episymbiont showing electron-dense apical operculum (black arrow) and the extrusive thread coiled around a densely stained core region (white arrow). E. High magnification TEM of cell surface showing mitochondrion-derived organelles (MtD), rod-shaped episymbionts (arrowheads), and spherical-shaped episymbiont (black arrow) sitting within a concavity in the host cell. Core region of the spherical-shaped episymbiont (white arrow) in longitudinal section. F. TEM of spherical-shaped episymbiont showing discharged extrusive thread (arrow). Electron-dense material corresponding to the core is positioned at the tip of the discharged thread (arrow). Arrowheads indicate rod-shaped bacteria on cell surface (B-F bar = 500 nm).  The cytoplasm of the host cell was highly vacuolated and contained clusters of intracellular bacteria within vacuoles (Fig. 4.4A). Batteries of tubular extrusomes, ranging from only a few to several dozen, were also present within the host cytoplasm (Fig. 4.4B).  Figure 4.4. Transmission electron micrographs (TEM) of Bihospites bacati n. gen. et sp. showing intracellular bacteria and extrusomes. A. TEM showing a cell containing numerous intracellular bacteria (arrowheads) within vacuoles. B. Transverse TEM showing a battery of extrusomes (arrows) (A, B, bar = 500 nm). C. High magnification TEM of extrusomes showing a dense outer region (arrowhead) and a granular core containing a lighter cruciform structure (white arrow). Black arrow denotes the plasma membrane of the host (bar = 100 nm). D. TEM showing a longitudinal section of an extrusome; the proximal end is indicated with a black arrow. Arrowheads denote rod-shaped bacteria on the cell surface (bar = 500 nm).  75  The extrusomes were circular in cross-section and had a densely stained outer region that surrounded a lighter, granular core; a cruciform element was observed in cross-section of some extrusomes (Fig. 4.4C). The extrusomes were approximately 4 µm long, and many of them were positioned immediately beneath the raised articulation zones between the S-shaped surface folds (Figs. 4.3A, 4.4D).  4.3.3 Nucleus, C-shaped rod apparatus, cytostomal funnel, and vestibulum The nucleus of B. bacati was positioned in the anterior half of the cell and had permanently condensed chromosomes (Figs.4.1A, 4.5A). The nucleus was also closely linked to a robust rod apparatus (Fig. 4.1F). Serial sections through the entire nucleus demonstrated that a C-shaped system of rods formed a nearly complete ring around an indented nucleus (Figs. 4.5A, 4.6-4.9). The C-shaped system of rods consisted of two main elements: (1) a main rod that was nestled against the indented nucleus (Figs. 4.7-4.9) and (2) a folded accessory rod that was pressed tightly against the outer side of the main rod for most of its length. We refer to this two-parted arrangement as the “C-shaped rod apparatus” (Figs. 4.5A, 4.6-4.9).  76  Figure 4.5. Transmission electron micrographs (TEM) of non-consecutive serial sections of Bihospites bacati n. gen. et sp. through the vestibular region of the cell. A. TEM showing the nucleus (N) with condensed chromatin, the dorsal side of the C-shaped rod apparatus consisting of the main rod (r) and the accessory rod (ar), and the vestibulum (vt). Several rod-shaped bacteria (black arrows) and spherical-shaped bacteria line inner surface of the vestibulum (vt) (bar = 10 µm). B. High magnification view of the Cshaped rod apparatus in Figure A showing the single row of microtubules (arrowheads) positioned at the junction between the tightly connected rod and accessory rod. Granular bodies (arrows) are present between the parallel lamellae that form the main rod (bar = 500 nm). C, D. Transverse TEMs showing the  77  cytostomal funnel (cyt) and two separate lobes of the feeding pocket (arrowheads). Bacterial profiles can be seen inside the feeding pocket (arrows). Figure D uses color to distinguish between the feeding pocket (red), the vestibulum (blue), and the two branches of the flagellar pocket (green). E, F. Transverse TEMs at a more posterior level than in Figure C-D showing the posterior end of the main C-shaped rod (arrow) emerging within the posterior end of the feeding pocket. The cytostomal funnel (arrowheads) opens and fuses with the feeding pocket. Figure F uses color to distinguish between the feeding pocket (red), the vestibulum (blue), and the two branches of the flagellar pocket (green). (C-F bar = 2 µm).  The main rod was composed of a dense cluster of parallel lamellae that often appeared corrugated, while the accessory rod was composed of striated fibres (SF) (Figs. 4.5A-B, 4.6-4.8). Granular bodies of approximately 35 nm in diameter were observed in the spaces between the parallel lamellae of the main rod (Fig. 4.5B). The ventral side of the main rod was embedded in an amorphous matrix that became thinner toward the posterior end of the cell, until it disappeared altogether (Figs. 4.6A-D). A single row of longitudinal microtubules lined the external side of the main rod, which delimited the boundary between the main rod and the accessory rod for most of their length (Figs. 4.5A-B). The anterior ends of both C-shaped rods terminated near the antero-ventral region of the nucleus (Fig. 4.9). The posterior end of the main rod was positioned within the posterior region of a feeding pocket (Figs. 4.5C-F, 4.9). This feeding pocket merged together with the flagellar pocket and formed a common subapical concavity in the cell or a “vestibulum” (Figs. 4.2B, 4.5, 4.9A). A “cytostomal funnel” was positioned at the junction, and therefore demarcated the boundary, between the feeding pocket and the flagellar pocket (Figs. 4.5, 4.6, 4.9A). The cytostomal funnel was an anterior extension of the posterior end of the accessory rod that eventually opened within the subapical vestibulum (Figs. 4.2B, 4.5, 4.6, 4.9A). Some microtubules associated with the posterior end of the accessory rod also extended toward the ventral side of the cell and appeared to become continuous with the (ventral flagellar root) microtubules that reinforced the flagellar pocket (not shown).  78  Figure 4.6. Transmission electron micrographs (TEM) of non-consecutive serial sections through the flagellar apparatus and feeding pockets of Bihospites bacati n. gen. et sp. TEMs taken at levels posterior to those shown in Figure 5 and presented from anterior (A) to posterior (D). A. TEM showing the posterior  79  end of the main C-shaped rod (r) embedded in an amorphous matrix (double arrowhead) and surrounded by a thick membrane with fuzzy material (arrowhead). At this level, the rod is associated with ‘congregated globular structure’ (CGS), and the striated fibres that form the accessory rod (ar) appear near the cytostomal funnel (cyt) at the junction between the feeding pocket and the flagellar pocket. Inset: TEM showing the accessory rod (ar) in a subsequent posterior section, as it starts to open up. Vf = ventral flagellum; Df = dorsal lagellum. B. TEM showing the separation (arrowhead) of the feeding pocket (asterisks) from the flagellar pocket (FP) near cytostomal funnel (cyt) and the expanding accessory rod (ar). C. TEM showing the diminishing feeding pocket (asterisks), the cytostomal funnel (cyt), and the separate flagellar pocket (FP). D. TEM showing the accessory rod (ar) with its characteristically folded shape becoming more tightly linked to the main rod (r). Lobes of the feeding pocket (asterisk) and the flagellar pocket (FP) are also still visible. MtD = mitochondrion-derived organelle; double arrowheads = spherical-shaped episymbionts. (Scale bars = 2 µm).  The posterior region of the feeding pocket contained a “congregated globular structure” (CGS) that was associated with the posterior end of the main rod (Figs. 4.6A-B). The posterior end of the folded accessory rod became more robust as the serial sections moved from the posterior end of the feeding pocket toward the posterior end of the cell (Figs. 4.6, 4.9). The posterior end of the folded accessory rod was initially positioned between the feeding apparatus and the flagellar apparatus; the accessory rod then gradually became more robust and more tightly associated with the main rod as both of the rods migrated around the posterior side of the nucleus and toward the dorsal side of the nucleus (Figs. 4.6A-D, 4.9). Moreover, as the sections continued posteriorly, the feeding pocket and the CGS that surrounded the main rod diminished, and ultimately only the main rod and the accessory rod remained (Figs. 4.6C-D). Serial sections through the anterior region of the nucleus, moving from anterior to posterior, demonstrated the C-shaped curvature of the rod apparatus (Figs. 4.7, 4.9). These sections also demonstrated how the anterior ends of both the main rod and the accessory rod terminate on the ventral side of the indented nucleus near the vestibulum (Fig. 4.7F). Similarly, serial sections through the posterior region of the nucleus, moving from anterior to posterior, demonstrated the Cshaped curvature of the rod apparatus and its relationship to the indented nucleus (Figs. 4.8, 4.9).  80  Figure 4.7. Transmission electron micrographs (TEM) of non-consecutive serial sections through the anterior part of the nucleus of Bihospites bacati n. gen. et sp. Figures 7A-F are presented from anterior to posterior. A. TEM showing the nucleus (N) and the accessory rod (ar) surrounded by electron-dense material (Images are viewed from the anterior side of the cell: D, dorsal; L, left side of the cell; R, right side of the cell; V, ventral). B-C. TEMs showing the main rod (r) near the striated fibres (SF) of the accessory rod (arrow). D. TEM showing the left side of the nucleus (N) appearing behind the rod (r) and accessory rod (ar). The white arrow shows the presence of bacteria near the rod. E. TEMs showing the main rod (r) and the accessory rod (arrowheads) on the dorsal and ventral sides of the nucleus. F. Transverse TEM at the level of the vestibulum showing the disappearance of the ventral side of the main rod (r) and the drastic reduction of the accessory rod (arrowhead). Note the indentations in the nucleus for accommodating the main rod and accessory rod (A bar = 500 nm; B-F bar = 2 µm).  81  Figure 4.8. Transmission electron micrographs (TEM) of non-consecutive serial sections through the posterior part of the nucleus of Bihospites bacati n. gen. et sp. Figures 4.8A-D are presented from anterior to posterior. A-C. TEMs showing the rod (r) and the folded accessory rod (ar) nestled within indentations in the dorsal and ventral sides of the nucleus. The ventral part of the accessory rod runs close to the main rod for most of its length and extends toward the flagella on the ventral side of the cell. N = nucleus; D, dorsal; L, left side of the cell; R, right side of the cell; V, ventral; Images are viewed from the anterior side of the cell. D. TEMs showing the main rod (r) and the accessory rod (ar) reaching the posterior end of the nucleus (N). The main rod consists of parallel-arranged lamellae. Most of the nucleus and the main rod have disappeared from the section. The accessory rod (ar) consists of striated fibres that wrap around the main rod and the nucleus (bars = 2 µm).  82  Figure 4.9. Diagrams showing a reconstruction of the ultrastructure of Bihospites bacati n. gen. et sp. Relationships between C-shaped rod apparatus, nucleus, cytostomal funnel, feeding pocket, flagellar pocket and vestibulum, as inferred from serial transmission electron microscopy (TEM), scanning electron microscopy (SEM), and light microscopy (LM). A. Cell viewed from the right side showing the positions of the nucleus (N), the C-shaped main rod (r), the accessory rod (ar), and the cytostomal funnel (cyt) in relation to the feeding pocket (FeP), the flagellar pocket (FP) and the vestibulum (vt); Vf = ventral flagellum; Df = dorsal flagellum; Db = dorsal basal body; Vb = ventral basal body. B. Diagram emphasizing the relationship between nucleus (N), main rod (r), and folded accessory rod (ar). The diagram is divided into three sections; and the nucleus removed from the top section for clarity. Posterior end of the main rod positioned at the level of the vestibulum on the ventral side of the nucleus. This rod extends posteriorly and then encircles the posterior, dorsal and anterior ends of the nucleus before terminating on the ventral side of the nucleus just above the vestibulum; therefore, this rod is C-shaped. The folded accessory rod runs along the C-shaped main rod for most of its length, terminating at the same point just above the vestibulum; however, on the ventral side of the nucleus, the posterior end of the accessory rod extends both anteriorly, defining the cytostomal funnel (cyt), and ventrally toward the ventral basal body.  83  4.3.4 Flagellar root system Two flagella emerged from the base of the flagellar pocket (Figs. 4.2A-B, 4.10AF, 4.11A-E). Each flagellum had a paraxial rod (PR) in addition to the 9+2 arrangement of microtubules forming the axoneme (Figs. 4.10G-H, 4.11F). The PR in the dorsal flagellum (Df) had a whorled disposition, whereas the PR of the ventral flagellum (Vf) had a lattice-like arrangement of parallel fibres (Fig. 4.11F). No mastigonemes were observed on either flagellum (Figs. 4.2A-B). The dorsal basal body contained a long opaque core (Fig. 4.11B). Both basal bodies were approximately 1.7 µm long and were linked by a connecting fibre (CF) (Figs. 4.10A-B). A cartwheel structure was present at the proximal end of both basal bodies (Figs. 4.10A-B). Two accessory basal bodies (Db’ and Vb’) were observed on the ventral side of the Db and the dorsal side of the Vb (Fig. 4.10B). The flagellar root system is described here from the proximal to the distal end of the basal bodies as viewed from the anterior end of the cell. The basal bodies were associated with three asymmetrically arranged flagellar roots. A dorsal root (DR) originated from the dorsal-right side of the Db (Figs. 4.10B, 4.11B-C) and was formed of approximately six microtubules (Fig. 4.10E). A ventral root (VR) connected to the dorsal-right side of the ventral basal body (Figs. 4.11A, D-E) and was comprised initially of four microtubules (Fig. 4.10D). An intermediate root (IR), originally formed of about eight microtubules (Fig. 4.10F), emerged from the left side of the Vb (Figs. 4.10C-D). The ventral root and the intermediate roots ultimately fused, forming a continuous VR-IR row of microtubules around the flagellar pocket (Figs. 4.10G-H). A band of dorsal microtubules (DMt), not directly associated to the basal bodies, lined the dorsal side of the flagellar pocket (Figs. 4.10C, F; 4.11A-E). Toward the anterior end of the cell, the number of microtubules increased one by one, until the band reached the dorsal root (DR). The DMt and the DR eventually fused and formed a single band of microtubules around the flagellar pocket (Figs. 4.10G-H).  84  The DR and VR were associated with two electron dense bodies that elongated to form a dorsal lamina (DL) and a ventral lamina (VL), respectively (Figs. 4.10CH). Both laminae extended anteriorly and ended up reinforcing the walls of the flagellar pocket (Figs. 4.10G-H). The DR, together with the DL, supported the dorsal-left side of the pocket, and the DMt supported the dorsal-right side. The VR – reinforced by the VL – lined the ventral side of the pocket and was in contact with the IR that lined the ventral-left side of the flagellar pocket. The microtubules of the DMt and the VR became part of the elements forming the cytostomal funnel and accessory rod (i.e., the C-shape rod apparatus in general), and both the DR and the IR became part of the sheet of microtubules underlining the plasma membrane of the entire cell.  85  Figure 4.10. TEM micrographs showing sections of basal bodies, flagellar roots and associated structures, of Bihospites bacati n. gen. et sp. A-H from proximal to distal end of flagellar pocket. A-C. Non-consecutive serial sections showing origin and organization of flagellar pocket. A. High magnification TEM of proximal region of basal bodies showing dorsal and ventral basal bodies (Db and Vb) linked by a connecting fibre (CF). Basal bodies with cartwheel structures associated to electron-dense fibres (arrowheads). B. TEM showing accessory dorsal and ventral basal bodies (Db’ and Vb’) on the left of the two main basal bodies. Dorsal root (DR) connects to electron-dense body (dorsal lamella=DL), on right side of Db. C. TEM showing intermediate root (IR) associated with right side of Vb. Ventral root (VR) associated with electron-dense material that becomes ventral lamella (VL). Row of dorsal microtubules (DMt), not associated with basal bodies. D. Detail of ventral side of Figure C showing Vb, VR formed by four microtubules, VL and intermediate root (arrowhead), initially composed of eight microtubules. E. Detail of dorsal side of Figure C showing DR, with six microtubules (white arrowheads), and DL. F. TEM showing three flagellar roots and DMt around flagellar pocket. Df = dorsal flagellum; Vf = ventral flagellum. G-H. Non-consecutive serial TEM sections of flagellar pocket showing Df and Vf with paraxial rods (PR), flagellar roots, DMt of microtubules lining flagellar pocket, and DL and VL. (A-B and D-E bars = 200 nm; C and F bars = 500 nm; G-H bars = 2 µm)  86  . Figure 4.11. Transmission electron micrographs (TEM) of Bihospites bacati n. gen. et sp. showing the emergence and organization of the flagella. A. Longitudinal TEM through the electron-dense region near the origin of the basal bodies. The ventral root (VR) originates from the ventral basal body (Vb). A row of microtubules (DMt) lines the dorsal side of the incipient flagellar pocket. B. Longitudinal TEM through the dorsal flagellum showing the dorsal basal body (Db) associated with the dorsal flagellar root (DR), the ventral basal body (Vb), and the dorsal microtubules (DMt). C-D. TEM sections showing the dorsal flagellum (Df) and the intermediate root (IR) associated with the ventral basal body (Vb). E. TEM showing oblique sections through both flagella and the positions of the VR, IR and DMt in the flagellar pocket. The electron-dense material from which the flagellar apparatus originated in Figure A elongates to form the dorsal lamella (DL). The double arrowheads show the paraxial rod in the ventral flagellum (Vf). F. Transverse TEM of the Df and Vf showing the 9+2 arrangement of microtubules in the axoneme and the heteromorphic paraxial rods (PR). (A-E bars = 500 nm; F bar = 200 nm).  87  4.3.5 Molecular phylogenetic position In order to infer the phylogenetic position of B. bacati, we PCR-amplified and sequenced the nearly complete SSU rRNA gene (2057 bp) from two independent isolates. The SSU rRNA sequences contained expansions as found in other euglenids (Busse and Preisfeld, 2002b). First, we carried out a 40-taxon Maximum likelihood (ML) analysis that included sequences representing all of the major groups of eukaryotes; the resulting phylogeny showed B. bacati grouped strongly within the Euglenozoa (not shown). A second analysis included 37 taxa representing all of the major lineages of euglenozoans. The phylogenetic analyses showed that the euglenozoan sequences clustered in five main subgroups (Fig. 4.12): (i) a kinetoplastid clade, (ii) a diplonemid clade, (iii) a bacterivorous euglenid clade, (iv) a eukaryovorous + phototrophic euglenid clade and (v) the Symbiontida, a newly named clade that includes Calkinsia aureus and several environmental sequences. Bihospites bacati clustered with the Symbiontida with extremely high statistical support (ML bootstrap value = 100% and Bayesian posterior probability > 0.95), as the sister lineage to the rest of this group. Calkinsia aureus branched next within the Symbiontida and formed the sister lineage to several environmental sequences (Fig. 4.12). However, the relationship of the Symbiontida to the other main subgroups within the Euglenozoa was unclear.  88  Figure 4.12. Phylogenetic position of Bihospites bacati n. gen. et sp. within the Euglenozoa as inferred from small subunit (SSU) rRNA sequences. Maximum likelihood (ML) analysis of 35 euglenozoan taxa, rooted with two jakobids (Andalucia incarcerata and A. godoyi). Only ML boostraps greater then 50% are shown. Thick branches correspond to Bayesian posterior probabilities over 0.95. Ba, bacterivorous taxa; Eu, eukaryovorous taxa; Ph, phototrophic taxa.  89  4.4 Discussion Bihospites bacati n. gen et sp. possesses all three synapomorphies that unify the Euglenozoa: a tripartite flagellar root system, heteromorphic paraxial rods and tubular extrusomes. Concordantly, our analyses of SSU rRNA sequences clearly places B. bacati within the Euglenozoa, specifically within the Symbiontida. Several studies based on environmental sequences indicated the existence of a novel rRNA clade of euglenozoans (Behnke et al., 2006; Stoeck et al., 2003; Zuendorf et al., 2006). The Symbiontida was proposed after the ultrastructural description and molecular phylogeny of C. aureus strongly grouped this species with these environmental sequences, as a distinct subgroup within the Euglenozoa (Yubuki et al., 2009). Nonetheless, it was not clear in that study whether the Symbiontida was a new clade of euglenozoans or a subclade within one of the three previously recognized members of the Euglenozoa (i.e., kinetoplastids, diplonemids and euglenids).  4.4.1 Remnants of pellicle strips Bihospites bacati possesses a cell surface consisting of S-shaped folds, microtubules and endoplasmic reticulum that is similar to the pellicle of S-shaped strips found in euglenids. In most phototrophic euglenids, the pellicle strips usually consist of a robust proteinaceous frame that supports and maintains the shape of the cell, even during euglenoid movement (Leander and Farmer, 2001b; Leander et al., 2001b; Suzaki and Williamson, 1986a). However, like in most phagotrophic euglenids, there is no robust proteinaceous frame in B. bacati. Articulation zones between strips in the euglenid pellicle function as ‘slipping points’ around which the pellicle can change shape rather freely; moreover, the relative number of strips in each euglenid species reflects phylogenetic relationships and the degree of cell plasticity (Leander, 2004). Due to the extreme flexibility of the cell surface in B. bacati, it was not possible to determine  90  an exact number of S-shaped folds in the cell surface. Nonetheless, the microtubular corset in most euglenids is regularly interrupted, thus forming groups of a few microtubules associated with each pellicle strip, the number of which varies between species (Leander and Farmer, 2001b; Leander et al., 2001b; Suzaki and Williamson, 1986a). By contrast, the microtubules beneath the plasma membrane in B. bacati form a continuous corset over the entire cell, much like that found in several phagotrophic euglenids (e.g., Dinema (Leander and Farmer, 2001b)) and in symbiontids (C. aureus (Yubuki et al., 2009) and Postgaardi mariagerensis (Simpson et al., 1996)).  4.4.2 A novel feeding apparatus consisting of rods Bihospites bacati possesses a well-developed C-shaped rod apparatus consisting of a main rod and an associated accessory rod. Several heterotrophic euglenids (Linton and Triemer, 1999; Nisbet, 1974; Roth, 1959; Triemer and Fritz, 1987; Triemer and Farmer, 1991a; Triemer and Farmer, 1991b), and some species of diplonemids (Montegut-Felkner and Triemer, 1996; Porter, 1973; Roy et al., 2007a; Schnepf, 1994; Schuster et al., 1968; Triemer and Ott, 1990), have been described with feeding apparatuses consisting of two main rods; some species also have corresponding accessory rods (e.g. Peranema trichophorum has two main rods and two folded accessory rods) or have a branched rod that gives the appearance of three main rods (e.g., Entosiphon). Nonetheless, there are several differences between these rods and those described here for B. bacati. Firstly, B. bacati only has one main rod and one folded accessory rod; this configuration has never been described so far. Secondly, the vast majority of this apparatus tightly encircles the nucleus in a C-shaped fashion, the functional significance of which is totally unclear. The straight rods in euglenids support and line a conspicuous feeding pocket, whereas the feeding pocket in B. bacati only associates with the posterior end(s) of the C-shaped rod apparatus. Thirdly, the main C-shaped rod in B. bacati is formed by a highly novel arrangement of tightly  91  packed lamellae, and only a single row of microtubules originating from the VR separates the main C-shaped rod from the folded accessory rod. This row of microtubules demarcates the end of each lamella in the main rod. In all of the previously described euglenozoan species, different rods are formed by different proportions of amorphous material (not parallel lamellae) and microtubules originating from the ventral root of the ventral basal body. Fourthly, the posterior terminus of the accessory rod in B. bacati participates in the formation of a novel cytostomal funnel that extends anteriorly and merges with the subapical vestibulum. The cytostomal funnel presumably closes the connection between the flagellar pocket and the vestibulum during feeding. Although the cytostomal funnel in B. bacati is likely homologous to the “vanes” described in several different phagotrophic euglenids, the unusual ultrastructural features of B. bacati made this inference somewhat tenuous. Nonetheless, the additional “congregated globular structure” (CGS) at the posterior end of the main rod in B. bacati is also present in Calkinsia aureus (Yubuki et al., 2009). However, the feeding apparatus in C. aureus lacks conspicuous rods (or vanes) and consists mainly of a feeding pocket reinforced by microtubules from the VR, similar to the MTR pockets of other euglenozoans (e.g., Petalomonas). Overall, the C-shaped rod apparatus in B. bacati appears to contain some homologous subcomponents with phagotrophic euglenozoans (e.g., a main rod and a folded accessory rod), but, as highlighted above, this apparatus is novel in most respects. The presence of a highly plastic cell surface, an elaborate feeding apparatus, and brownish bodies, reminiscent of food vacuoles, suggests that B. bacati is capable of engulfing large prey cells such as other eukaryotes (Leander and Farmer, 2000b; Leander et al., 2001a; Leander, 2004; Leander et al., 2007; Roth, 1959; Triemer and Fritz, 1987); however, this species was never directly observed preying on (relatively large) microeukaryotic cells present in the environment. Nonetheless, the presence of intracellular bacteria surrounded by vacuoles near the feeding pocket indicates that B. bacati actively feeds on bacteria. It is also  92  possible that B. bacati feeds on the rod shaped episymbiotic bacteria that grow over the host surface and into the subapical vestibulum.  4.4.3 Extrusomes Tubular extrusomes are present in several members of the Euglenozoa (Montegut-Felkner and Triemer, 1996; Simpson et al., 1996; Yubuki et al., 2009) and constitute a synapomorphy for the group. Among the Symbiontida, C. aureus has tubular extrusomes clustered in a single large battery that is longitudinally arranged and anchored to a novel “extrusomal pocket” (Yubuki et al., 2009). Although Bihospites bacati also possesses tubular extrusomes, these organelles are not organized as a single battery. The extrusomes in B. bacati are arranged in several smaller clusters that are distributed in different places throughout the superficial cytoplasm; solitary extrusomes are organized consecutively beneath the articulation zones of the S-shaped pellicular folds or “strips”. A similar arrangement of tubular extrusomes has also been observed in P. mariagerensis (Simpson et al., 1996).  4.4.4 Episymbiotic bacteria Several distantly related species of euglenozoans have been described with episymbiotic bacteria. These euglenozoans are usually phagotrophs that live in oxygen-depleted to anoxic marine environments, such as that in which B. bacati thrives (Bernhard et al., 2000; Buck et al., 2000; Buck and Bernhard, 2002; Lackey, 1960; Simpson et al., 1996; Yubuki et al., 2009). However, two species of euglenids living in well-oxygenated, freshwater environments have also been described as having episymbiotic bacteria: the phototroph Euglena helicoideus (Leander and Farmer, 2000a), and the phagotroph Dylakosoma pelophilum (Wołowski, 1995). The episymbionts so far encountered in euglenozoans are  93  either rod-shaped (in Euglena helicoideus (Leander and Farmer, 2000a), Postgaardi mariagerensis (Simpson et al., 1996), Calkinsia aureus (Lackey, 1960; Yubuki et al., 2009)) or spherical-shaped (D. pelophilum (Wołowski, 1995)). Bihospites bacati, however, is the first euglenozoan described having both morphotypes of episymbionts. Hypotheses about the role of rod-shaped bacteria in symbiotic relationships with eukaryotic hosts usually emphasize commensalism, where the bacteria benefit from metabolic byproducts secreted by the host (Bernhard et al., 2000; Leander and Keeling, 2004a; Simpson et al., 1996). It has also been proposed that the rod-shaped bacteria are chemoautotrophic sulphur or methanogenic-oxydizers and form a mutualistic relationship with the host (Buck et al., 2000), whereby the host provides anchorage for the bacteria, and the bacteria detoxify the immediate environment for the host (Buck and Bernhard, 2002; Fenchel and Ramsing, 1992). The episymbiotic bacteria may also serve as a food-source for the host, as has been observed in one ciliate (Rosati, 2002). A discussion on the phylogenetic affiliation of the rod-shaped episymbionts in B. bacati has been incorporated into another paper upcoming paper (Edgcomb, Breglia et al., 2011) Spherical episymbiotic bacteria have been reported in one other euglenozoan: the freshwater euglenid D. pelophilum (Wołowski, 1995). However, this species has so far been described based only on light microscopy, and morphological characteristics of the bacteria are very difficult to evaluate; it was reported that the bacteria on the surface of D. pelophilum are 2 µm in diameter, twice the size of those in B. bacati. Spherical episymbiotic bacteria that are ultrastructurally nearly identical to those we describe here on B. bacati have been described on one species of hypotrich ciliate isolated from tidal pools (Petroni et al., 2000; Rosati et al., 1999; Rosati, 2002; Verni and Rosati, 1990). Molecular phylogenetic evidence showed that the ciliate’s episymbionts, called “epixenosomes”, are a novel lineage of verrucomicrobial bacteria, and experiments indicate that the extrusive nature of the spherical episymbionts function in defense against  94  predators (Petroni et al., 2000; Rosati et al., 1999; Rosati, 2002). The thorough study of these episymbionts and how they function add information to the comparative context for understanding the origin(s) and evolution of different types of extrusive organelles in different lineages of eukaryotes (e.g., ejectosomes in cryptophytes and nematocysts in cnidarians and dinoflagellates). A more comprehensive examination and discussion of the biology and origins of the epixenosomes in B. bacati have been incorporated into a companion paper currently in preparation for publication (Breglia, Yubuki and Leander, unpubl. data).  4.4.5 Identity and composition of the Symbiontida Molecular phylogenetic analyses using SSU sequences place B. bacati as the earliest diverging branch within the Symbiontida. The Symbiontida are anaerobic and microaerophilic euglenozoans covered with rod-shaped bacteria that are in close association with a superficial layer of mitochondrion-derived organelles with reduced or absent cristae; accordingly, it was predicted that rod-shaped episymbionts are present in most (if not all) members of the group (Yubuki et al., 2009). The morphology of B. bacati is concordant with this description, reinforcing the interpretation that the presence of episymbiotic bacteria is a shared derived character of the most recent ancestor of the Symbiontida. This hypothesis makes more sense when we consider that B. bacati and C. aureus, both with episymbiotic bacteria, are not sister taxa. In other words, episymbiotic bacteria are no longer a character known only in a single lineage within this group. Given this context, current ultrastructural data indicate that P. mariagerensis might also be a member of the Symbiontida (e.g., B. bacati, C. aureus and P. mariagerensis all lack flagellar hairs and possess rod-shaped episymbionts, a continuous corset of cortical microtubules, and a superficial layer of mitochondrion-derived organelles) (Simpson et al., 1996; Yubuki et al., 2009). This inference, however, needs to be examined more carefully with an ultrastructural characterization of  95  the flagellar apparatus and feeding apparatus in P. mariagerensis and with molecular phylogenetic data from the host and the episymbionts. The presence of episymbiotic bacteria and the superficial distribution of mitochondria with reduced cristae in B. bacati, C. aureus and P. mariagerensis indicate a mutualistic relationship that enabled both lineages to thrive in lowoxygen environments. Determining whether the episymbionts on B. bacati, C. aureus and other symbiontids are closely related will more robustly establish the identity and composition of the clade and potentially reveal co-evolutionary patterns between the symbionts and the hosts. The geographic distribution of C. aureus and B. bacati (i.e. seafloor sediments of Santa Barbara Basin, California and coastal sediments of British Columbia, Canada) suggests that the Symbiontida is more widespread and diverse than currently known. This view is supported by the existence of related environmental sequences originating from Venezuela, Denmark, and Norway (Behnke et al., 2006; Edgcomb et al., 2002; Zuendorf et al., 2006). Moreover, an organism with striking morphological resemblance to B. bacati has been previously observed in the Wadden Sea, Germany (Hoppenrath, 2000). More comprehensive sampling of anoxic and lowoxygen sediments around the world will shed considerable light on the abundances and ecological significance of this enigmatic group of euglenozoans. We described and characterized a novel flagellate from micro-aerobic marine sand: Bihospites bacati n. gen. et sp. Both comparative ultrastructure and molecular phylogenetic analyses strongly support the placement of B. bacati with the Euglenozoa and, more specifically, as a new member of the Symbiontida. An early diverging position of B. bacati within the Symbiontida is consistent with the presence of morphological features that are transitional between those found in C. aureus and phagotrophic euglenids: (1) a cell surface with strip-like S-shaped folds but lacking the proteinaceous frames of the euglenid pellicle, (2) a compact but robust rod-based feeding apparatus, and (3) a dense community of rodshaped episymbiotic bacteria on the cell surface but without the elaborate  96  extracellular matrix of C. aureus. Therefore, the molecular phylogenetic position and suite of intermediate ultrastructural features in B. bacati suggest that the most recent ancestor of the Symbiontida descended from phagotrophic euglenids. Although the close association of rod-shaped episymbiotic bacteria with the underlying mitochondria is a shared feature of symbiontids, the presence of extrusive verrucomicrobial episymbionts in B. bacati is highly unusual. These rapid-firing episymbionts could provide critical context for understanding the origin(s) of several different types of extrusive organelles in eukaryotes, and their discovery on this novel euglenozoan lineage underscores how little we know about the diverse symbiotic communities present in marine benthic environments.  4.5 Formal taxonomic descriptions Euglenozoa, Cavalier-Smith, 1981 (Cavalier-Smith, 1981) Symbiontida, Yubuki, Edgcomb, Bernhard & Leander, 2009 (Yubuki et al., 2009)  4.5.1 Bihospites n. gen. Breglia, Yubuki, Hoppenrath and Leander 2010  Description Uninucleate biflagellates; two heterodynamic flagella inserted subapically, with paraxial rods and no mastigonemes; flagella of approximately the cell length; elongated cells with a rounded posterior end; nucleus at anterior end of cell; cell covered with epibiotic bacteria of two different types: rod-shaped and sphericalshaped; cell surface with S-shaped folds; tubular extrusomes with cruciform core;  97  presence of black bodies mainly at the anterior end of cell; rhythmic cell deformations and gliding motility.  Type species Bihospites bacati.  Etymology Latin Bihospites, with two guests. The generic name reflects the presence of two different episymbiont morphotypes: rod-shaped, and spherical-shaped episymbionts.  4.5.2 Bihospites bacati n. sp. Breglia, Yubuki, Hoppenrath and Leander 2010  Description Cell elongated with rounded ends; cell size 40-120 µm in length and 15-30 µm in width; two heterodynamic flagella inserted subapically; anterior nucleus; cell covered with epibiotic bacteria of two different types: rod-shaped and sphericalshaped; cell surface with S-shaped folds; mitochondrion-derived organelles with reduced or absent cristae; feeding apparatus with conspicuous C-shaped rod and accessory rod that encircles the indented nucleus; the rod is formed by tightly packed, parallel-arranged lamellae; presence of black bodies, mainly at the anterior end of the cell; rhythmic cell deformations and gliding motility. Small subunit rRNA gene sequences [GenBank: HM004353, HM004354].  98  Hapantotype Both resin-embedded cells used for TEM and cells on gold sputter-coated SEM stubs have been deposited in the Beaty Biodiversity Research Centre (Marine Invertebrate Collection) at the University of British Columbia, Vancouver, Canada.  Iconotypes Figs 1A, 2A and 9A.  Type locality Tidal sand-flat at Centennial Beach, Vancouver, British Columbia, Canada (49°00’ 4797’’N, 123°02’1812’’W).  Habitat Marine sand, black layer 2-3 cm deep.  Etymology Specific epithet, Latin bacati, ornamented with pearls. The etymology for the specific epithet reflects the presence of distinct longitudinal rows of sphericalshaped episymbionts, reminiscent of pearl necklaces.  99  4.5.3 Registration of new genus and species name in ZooBank LSID for article: urn:lsid:zoobank.org:pub:40211D82-B95C-494A-B8D07E061E80DD18 LSID for the genus Bihospites: urn:lsid:zoobank.org:act:794D6C7B-BFB1-45C78DDA-32D44F3B0E50 LSID for the species B. bacati: urn:lsid:zoobank.org:act:E1549565-5434-4F85B936-7D0C485596B8  100  5 Evasive sporulation in episymbiotic verrucomicrobial bacteria  5.1 Synopsis Symbioses between microeukaryotes and bacteria are widespread, but the significance of these interactions is not fully understood. Eukaryote-bacteria symbioses are particularly common in low-oxygen environments and often involve beneficial exchanges of metabolites (Bernhard et al., 2000; Buck et al., 2000; Buck and Bernhard, 2002; Dubilier et al., 2008; Edgcomb et al., 2011; Fenchel et al., 1977; Gast et al., 2009; Noda et al., 2003; Ohkuma, 2008; Radek, 2010; Rosati, 2002; Rosati, 2006). These associations are also known to confer other benefits to the eukaryotic hosts such as bacteria-propelled motility systems (Tamm, 1982) or bacteria-based defense mechanisms (Gast et al., 2009; Rosati, 2006). “Epixenosomes”, for example, are epibiotic bacteria that contain a tightly wound thread that discharges rapidly when disturbed, providing the ciliate host with weapon-like resistance against predators (Rosati et al., 1999; Rosati, 2002; Rosati, 2006; Vannini et al., 2003). Spherical bodies reminiscent of epixenosomes have also been reported on a symbiontid flagellate (Bihospites bacati, Euglenozoa) that lives in low-oxygen intertidal sands (Breglia et al., 2010). In both cases, the process of thread discharge completely and irreversibly eviscerates the spherical bodies, sometimes leaving only an empty “shell” behind. In order to determine the identity and lifecycle of these peculiar bodies, we studied them using fluorescence microscopy, electron microscopy and molecular phylogenetic analyses. Comparative ultrastructure and 16S rRNA demonstrated that the spherical bodies are symbiotic verrucomicrobial bacteria that potentially extend their lifecycle through evasive evisceration. The features of these symbiotic bacteria provide context for hypothesizing lateral symbiont transfer from one eukaryotic host to another and/or convergent evolution over 101  vast phylogenetic distances (i.e., across domains) (Leander, 2008a; Leander, 2008b).  5.2 Materials and methods 5.2.1 Collection of organisms Sediment samples were collected at low tide from oxygen-depleted layers of black sand, at a depth of 1-3 cm, on the shoreline of Centennial Beach (Boundary Bay) in South-western British Columbia, Canada (49° 00’ 4797’’N, 123° 02’ 1812’’W), during the spring and summer of 2007 and 2008. The sediment samples were stored in flat containers at room temperature before individually isolated cells of Bihospites bacati and its episymbionts were prepared for light microscopy, electron microscopy, and DNA extraction. Individual cells of uncultured Bihospites bacati were extracted from the sand samples through a 48µm mesh using the Uhlig melted seawater-ice method (Uhlig, 1964).  5.2.2 Light and electron microscopy Differential interference contrast (DIC) and fluorescent light micrographs were taken using a Zeiss Axioplan 2 imaging microscope and a Leica DC500 digital chilled CCD camera. Some cells were stained with DAPI diluted in phosphate buffer (0.5 µg/ml) and visualized with UV fluorescence microscopy. Individual cells of B. bacati were manually isolated from heterogenous sand samples and fixed for scanning electron microscopy (SEM) using a 4% osmium tetroxide vapour protocol described previously (Leander and Farmer, 2000b). The cells were then transferred onto a 10-µm polycarbonate membrane filter, dehydrated with a graded ethanol series, and critical point dried with CO2 using a Tousimis Critical Point Dryer. The filter was then mounted on an aluminum stub, sputter  102  coated with gold/palladium using a Cressington 208HR High Resolution Sputter Coater, and observed with a Hitachi S-4700 field emission scanning electron microscope. Individual cells of uncultured B. bacati were manually isolated from heterogeneous sand samples and fixed for transmission electron microscopy (TEM) using a protocol described previously (Breglia et al., 2010). Serial ultra-thin sections were collected on copper Formvar-coated slot grids, stained with 2% (w/v) uranyl acetate and lead citrate, and observed using a Hitachi H7600 electron microscope.  5.2.3 DNA extraction, PCR amplification, alignment, and phylogenetic analysis Total genomic DNA was extracted using the MasterPure Complete DNA and RNA purification Kit (Epicentre, WI, USA) from 31 uncultured cells of B. bacati that were individually isolated from heterogeneous sand samples and washed three times in sterile seawater. Polymerase chain reactions (PCR) of 16S rRNA genes were performed using PuRe Taq Ready-To-Go PCR beads kit (GE Healthcare, Buckinghamshire, UK), and the following primers: 5’GTGCCAGCAGCMGCGGTAATAC-3’ and 5’TACGGYTACCTTGTTACGACTTC-3’. Amplified DNA fragments were purified from agarose gels using UltraClean 15 DNA Purification Kit (MO Bio, CA, USA), and subsequently cloned into the TOPO TA Cloning Kit (Invitrogen, CA, USA). Clones were sequenced with the ABI Big-Dye reaction mix using the vector primers. The new verrucomicrobial sequence was screened with BLAST, identified by molecular phylogenetic analyses, and submitted to the GenBank database. The new 16S rRNA sequence was analyzed within the context of a 62-taxon alignment consisting of taxa representing all of the major groups of bacteria (1127 unambiguously aligned sites). Ambiguously aligned positions and gaps  103  were excluded. Phylogenetic relationships were inferred using maximum likelihood (ML) and Bayesian methods with the programs PhyML (Guindon and Gascuel, 2003) and MrBayes (Huelsenbeck and Ronquist, 2001), respectively. For ML, the nucleotide datasets were analysed using a general-time-reversible (GTR) model of base substitutions, plus a gamma correction with eight substitution rate categories and the proportion of invariable sites (GTR + I + G). ML bootstrap analysis of 500 replicates was performed with the same parameters described above. For Bayesian analyses, the program MrBayes was set to operate with a gamma correction with eight categories and proportion of invariable sites, and four Monte-Carlo-Markov chains (MCMC) (default temperature = 0.2). A total of 2,000,000 generations was calculated with trees sampled every 100 generations and with a prior burn-in of 200,000 generations (i.e., 2,000 sampled trees were discarded).  5.3 Results 5.3.1 Ultrastructural features Spherical bodies on the surface of the symbiontid B. bacati (Euglenozoa) formed single or double rows that extended along the longitudinal axis of the host cell (Figs. 5.1A-B, 5.2A-B). The spherical bodies stained strongly with DAPI, providing a positive signal for the presence of DNA (Fig. 5.1B).  104  Figure 5.1. Light micrographs (LM) showing eviscerating verrucomicrobial episymbionts on Bihospites bacati (Euglenozoa, Symbiontida). A. Differential interference contrast micrograph showing the general appearance of the eukaryotic host, B. bacati. (Scale bar = 15 µm). B. Fluorescence light micrograph showing DAPI staining of the nucleus of B. bacati (N) and the verrucomicrobial episymbionts (arrow). (Scale bar = 15 µm). C. Phase contrast micrograph of a disturbed cell of B. bacati showing a shield of ejected or eviscerated verrucomicrobial episymbionts (arrows). (Scale bars = 15 µm).  Scanning- and transmission electron microscopy (SEM and TEM, respectively) showed that there were two main forms of spherical bodies: a smaller form approximately 0.4 µm in diameter (form I, Figs. 5.2B-C), and a larger form approximately 0.7 µm in diameter and usually bearing a thread (form II, Figs. 5.2B, D-H). SEM and TEM also demonstrated that form I spherical bodies reproduced by binary fission and had the typical ultrastructure of bacteria (Figs. 5.2B-C). The larger form II bodies had a thin “operculum” and a highly organized ultrastructure consisting mainly of a tightly coiled internal thread surrounding a darkly stained core that was similar in appearance to the chromosomes of eukaryotes when viewed with TEM (Figs. 5.2D-F). The operculum contained a central pore about 100 nm in diameter that was covered by a thinner membrane (Fig. 5.2F). The outside diameter of the coiled thread was approximately 0.5 µm, and the diameter of the chromosomal core was approximately 130 nm (Figs. 5.2D-F); both were capable of rapid discharge through the central pore of the operculum when disturbed (Figs. 5.1C, 5.2B, G).  105  The spherical bodies on Bihospites were very similar in overall morphology to the “epixenosomes” described from a species of Euplotidium (Figs. 5.2I-K) (Rosati et al., 1993b; Rosati et al., 1996; Rosati et al., 1998). Like epixenosomes, the spherical bodies on Bihospites were extracellular and attached to the host within a corresponding concavity in the host plasma membrane (Figs. 5.2F-G). The spherical bodies on Bihospites, however, were less than half the size of the epixenosomes on Euplotidium (the diameter of form I and form II bodies on Euplotidium was 1 µm and 1.5-2.5 µm, respectively) (Petroni et al., 2000). Despite the differences in size, a tightly wound thread surrounding a chromosomal core was present within the form II bodies on both host species (Figs. 5.2D-H, J-K). The thin operculum observed in the spherical bodies on Bihospites (Figs. 5.2E-F), however, was not present in the epixenosomes on Euplotidium; this region was instead occupied by an “electron-dense zone”, about 0.9 µm thick, containing DNA (Petroni et al., 2000) (Figs. 5.2I-K).  106  Figure 5.2. Micrographs showing details of the eviscerating verrucomicrobial symbionts on Bihospites bacati (Euglenozoa, Symbiontida) (A-H) and Euplotidium arenarium (Alveolata, Ciliata) (I-K). A. Scanning electron micrograph (SEM) of B. bacati showing rows of verrucomicrobial symbionts along its longitudinal axis (arrow). (scale bar = 5 µm). B. SEM of the surface of B. bacati showing smaller form I verrucomicrobial symbionts undergoing binary fission (black arrows) and larger form II verrucomicrobial symbionts (white arrowheads) with discharged threads (black arrowhead) (scale bar = 1 µm). C. Transmission electron micrograph (TEM) showing smaller form I verrucomicrobial symbionts undergoing binary fission (black arrowhead) on the surface of Bihospites (scale bar = 0.5 µm). D. TEM through a longitudinal row of form II verrucomicrobial symbionts on the surface of Bihospites (scale bar = 0.5 µm). E. Tangential TEM through a form II verrucomicrobial symbiont on the surface of Bihospites showing a tightly wound thread around a chromosomal core (scale bar = 0.1 µm). F. Longitudinal TEM through a  107  form II verrucomicrobial symbiont on the surface of Bihospites showing the thin operculum (arrow) with an apical pore covered by a thinner membrane (arrowhead) (scale bar = 0.1 µm). G. Longitudinal TEM through a form II verrucomicrobial symbiont on the surface of Bihospites showing evisceration in progress. The core (arrowhead) is discharged first and is followed by the unwinding thread (scale bar = 0.5 µm). H. TEM through a longitudinal row of form II verrucomicrobial symbionts on the surface of Bihospites showing the empty “shell” of an eviscerated symbiont (asterisk) (scale bar = 0.15 µm). I. TEM showing the smaller form I verrucomicrobial symbionts on the surface of Euplotidium undergoing binary fission (scale bar = 0.3 µm) (Modified, with permission, from Verni and Rosati, 1990). J-K. Tangential TEMs through form II verrucomicrobial symbionts on the surface of Euplotidium showing a tightly wound thread, a “dense zone” containing DNA (arrow) beneath the apical end of the symbiont, and clusters of fibrils (arrowheads) (scale bar = 0.2 µm) (Modified, with permission, from Petroni et al., 2000).  The form II bodies on Euplotidium also contained distinct clusters of fibrils that have been interpreted to be tubules of tubulin (Rosati et al., 1993a; Rosati et al., 1993b; Rosati et al., 1996; Rosati et al., 1998) (Figs. 5.2I-K). Corresponding fibrils were not evident in the form II spherical bodies on Bihospites (Figs. 5.2DH). Some of the form I bodies on Bihospites (and in Euplotidium) underwent a maturation process through which the extrusive apparatus was formed from a few layers of granular material (Fig. 5.3). During the first stages of ultrastructural transformation, the form I bodies were still able to undergo binary fission. Additional layers of granular material were added in succession to produce the thread in form II bodies. The evisceration of the core and thread was irreversible and was followed by the detachment of the form II body from the host surface. Remnants of eviscerated spherical bodies (Fig. 5.2H) were replaced by new rows of form II bodies derived from a persistent background of dividing form I bodies (Fig. 5.2B).  108  Figure 5.3. Illustration showing the life cycle of the eviscerating symbiotic bacteria on Bihospites bacati. Form I cells divide by binary fission, and some transform into larger form II cells consisting of an operculum (o) and a tightly wound thread (t) around a chromosomal core (c). When disturbed, the form II cells are capable of complete evisceration via the rapid discharge of the chromosomal core and thread. This behaviour, presumably (?), provides an evasive spore-like propagation mechanism that allows form II cells to jump-ship from one host substrate to another. However, the evisceration of form II cells will also lead to the termination of the life cycle (x) for every eviscerated form II cell that fails to find another suitable substrate.  5.3.2 Molecular phylogenetic analyses Two different 16S rRNA sequences were consistently amplified from DNA extractions of manually isolated cells of uncultured Bihospites: an εproteobacteria sequence derived from the rod-shaped epibiotic bacteria (Edgcomb et al., 2011) and a sequence affiliated with the Verrucomicrobia, which  109  is a recently discovered group of eubacteria frequently involved in symbiotic relationships with eukaryotes (Scheuermayer et al., 2006; Schlesner et al., 2006; Vandekerckhove et al., 2000). In order to determine the phylogenetic position of the latter sequence, we performed phylogenetic analyses on an alignment consisting of 62 sequences representing all of the major groups of eubacteria (Fig. 5.4). These analyses demonstrated that the 16S rRNA sequence obtained from the episymbionts in Bihospites clustered within the Verrucomicrobia and was the strongly supported sister lineage to the sequence derived from the epixenosomes on Euplotidium (Fig. 5.4).  110  Figure 5.4. Maximum likelihood tree inferred from 16S rRNA sequences from 62 eubacterial taxa showing the phylogenetic position of the eviscerating symbionts on Bihospites (Euglenozoa) (highlighted with a black box). This sequence was the strongly supported sister lineage to the sequence derived from similar eviscerating symbionts on Euplotidium (Ciliata) (highlighted in a grey box). Maximum likelihood bootstraps greater than 50% are shown above the branches, and Bayesian posterior probabilities are shown below the branches.  111  5.4 Discussion The highly distinctive ultrastructure shared between the epixenosomes on Euplotidium and the spherical bodies on Bihospites, coupled with the very similar 16S rRNA sequences derived from both lineages, suggests that closely related eviscerating bacteria established symbiotic associations with two very distantly related species of eukaryotic hosts, namely ciliates (Euplotidium) and symbiontid euglenozoans (Bihospites) (Fig. 5.5). The specific path(s) that led to the establishment of these symbioses in evolutionary time is, however, less clear.  Figure 5.5. Illustration showing the phylogenetic distribution of eviscerating symbiotic bacteria across the tree of eukaryotes. These symbionts have only been found on Bihospites within the Symbiontida and Euplotidium within the Ciliata (black boxes). (Modified from Simpson and Roger, 2004b).  112  5.4.1 Possible origins of eviscerating symbiotic bacteria The phylogenetic topologies for the eukaryotic hosts and the eviscerating bacteria are incongruent. The hosts are about as distantly related as any two lineages of eukaryotes could possibly be, while the eviscerating symbiotic bacteria are very closely related. The ultrastructural integration of the eviscerating symbiotic bacteria and their hosts suggests a long-standing relationship through evolutionary time (Rosati et al., 1998). On the other hand, the high level of ultrastructural similarity and low degree of 16S rRNA sequence divergence between the two episymbionts suggest that the establishment of at least one of these symbioses is much more recent than previously thought. Two possible scenarios can explain the incongruent phylogenetic patterns of the hosts and symbionts: (a) two symbiotic relationships were independently established, relatively recently, between two unrelated hosts and a free-living member of the Verrucomicrobia that was already equipped with the evisceration apparatus or (b) one of the symbiotic relationships was established a long time ago and the symbionts were subsequently transferred (laterally) from one host to a distantly related host. The second scenario is supported by the fact that the evisceration apparatus has so far only been found (twice) in symbiotic verrucomicrobial bacteria and is unknown in free-living members of the group. If the evisceration apparatus in verrocumicrobial bacteria evolved within the context of a symbiotic condition rather than in a free-living condition, then it is worth considering the functional advantages of such a complex ultrastructural system for both the symbiont and the host.  5.4.2 Eviscerating symbiotic bacteria and eukaryotic extrusive organelles The DNA of the verrucomicrobial symbionts is completely discharged together with the thread during evisceration (Verni and Rosati, 1990) (Fig. 5.2G-H).  113  Although the rapid release of bacterial cell contents by means of a tightly wound thread is highly unusual, the formation of spores is known to occur in several lineages of bacteria (de Maagd et al., 2003). Therefore, the main function of the elaborate evisceration apparatus described here is presumably to provide an evasive propagation mechanism. This “jumping” behavior would provide a way for the verrucomicrobial symbionts to “abandon a sinking ship” under stressful conditions in an attempt to find a new substrate, such as another eukaryotic host cell in the immediate environment. This evasive survival strategy also helps explain the sporadic distribution of eviscerating verrucomicrobial symbionts across the tree of eukaryotes, namely the lateral transfer of symbionts from a ciliate host to a symbiontid euglenozoan host or vice versa (Fig. 5.5). Some α-proteobacterial endosymbionts of the ciliate Paramecium, namely Caedibacter known as “R bodies”, also contain tightly wound ribbons that unwind under stressful circumstances (Beale et al., 1969; Beier et al., 2002). The R bodies release toxins and may equip the infected ciliates with a “killer trait” that confers them a competitive advantage over uninfected Paramecium cells when exposed to predators (Kusch et al., 2002; Kusch and Görtz, 2006). Rosati and others exposed cultures of Euplotidium with and without verrucomicrobial symbionts to a larger predatory species (Rosati et al., 1997; Rosati et al., 1999). These experiments indicated that the Euplotidium cultures with verrucomicrobial symbionts survived longer than Euplotidium cultures without verrucomicrobial symbionts, which suggests that the eukaryotic host benefits from the shield of threads created by the evisceration of symbionts. The rapid discharge of a DNA containing thread and/or other cellular contents through an apical pore as a means of propagation is known in a few distantly related groups of parasitic microeukaryotes. For instance, cysts of the endoparasitic oomycete Haptoglossa form a “gun cell” that injects its cytoplasmic contents into a new host cell (Kugrens et al., 1994). Similarly, the spores of microsporidian fungi have an extrusive apparatus consisting of a long, hollow  114  (polar) filament through which the cell contents of the parasite are injected into the cytoplasm of a new host cell (Cali and Takvorian, 1999; Delbac and Polonais, 2008; Vavra and Larsson, 1999). These eukaryotic examples provide evidence for convergent evolution over vast phylogenetic distances both within eukaryotes and across domains (Leander, 2008a; Leander, 2008b). Moreover, extrusive organelles that function in both protection and feeding are known in several different lineages of eukaryotes (Hausmann, 1978), but perhaps the best-known examples are the cnidae, or nematocysts, of cnidarians (Hwang et al., 2008). Nematocysts are organelles that consist of a tightly wound thread within a capsule that is capped with a hinged operculum. The hollow thread may be equipped with barbs and toxins and is everted rapidly through an apical pore when disturbed by different kinds of stimuli (e.g., changes in pressure or water chemistry) (Ozbek et al., 2009). The nematocysts of cnidarians are also capable of being laterally transferred in an undischarged state to soft-bodied predators of cnidarians, such as nudibranchs. This process, called “kleptocnidae”, allows the new host animal to reposition the stolen organelles into its own tissues for its own protection (e.g., the cnidsacs of aeolids) (Greenwood, 2009). Lateral transfers of nematocysts may extend beyond animals, because strikingly similar nematocysts have also been described in polykrikoid and warnowiid dinoflagellates (Hoppenrath and Leander, 2007; Hoppenrath et al., 2009; Hoppenrath et al., 2010; Hwang et al., 2008). The capacity to be laterally transferred to distantly related lineages gives nematocysts a degree of autonomy that is reminiscent of the two major classes of eukaryotic organelles acquired through bacterial endosymbioses: mitochondria and plastids (e.g., chloroplasts). The evolutionary origin of nematocysts is unclear, although it is known that some novel components of nematocysts (e.g., minicollagens) are assembled through the Golgi apparatus and have diversified within cnidarians (David et al., 2008). By contrast, other components appear to have a bacterial origin. For instance, the thread of the nematocyst stains strongly with DAPI, which suggests the presence  115  of DNA but has been interpreted to signal the presence of poly-γ-glutamate (Szczepanek et al., 2002). Poly-γ-glutamate is a natural polymer of the amino acid glutamic acid that stains with DAPI. A biosynthetic route for poly-γ-glutamate is generally restricted to bacteria, and its presence in nematocysts has been interpreted to be the result of horizontal gene transfer from bacteria to cnidarians (Candela and Fouet, 2006; Denker et al., 2008; Szczepanek et al., 2002; Weber, 1990). Expression of bacterial genes in cnidarian nematocysts (Denker et al., 2008), and the overall similarities in the organization and behaviour of these organelles with the verrucomicrobial symbionts described here fuels speculation that the nematocysts could be exogenously derived from bacterial ancestors. If so, then some extrusive organelles in eukaryotes may represent a third major class of organelles acquired through bacterial endosymbioses. If not, then the similarities between nematocysts and verrucomicrobial symbionts represent an example of convergent evolution across domains. Comprehensive genomic/transcriptomic data from symbiotic bacteria capable of evasive evisceration and nematocyst-containing eukaryotes (e.g., cnidarians, warnowiids and polkrikoids) are expected to shed significant light onto these intriguing possibilities (Hwang et al., 2008). In the meantime, it should be emphasized that continued exploration and characterization of marine microbial diversity will provide the discoveries that would eventually support or refute hypotheses like these.  116  6 Conclusions  6.1 Euglenids The Euglenozoa is one of the main lineages of eukaryotes and consists of at least three main subgroups: the Kinetoplastida, Diplonemida and Euglenida. Euglenids have been known since 1830 when the genus Euglena was erected after E. viridis, a phototrophic flagellate that is common in freshwater habitats (Shin and Triemer, 2004). Since then, thousands of “green” euglenids have been described and studied thoroughly, and some species, such as E. gracilis became experimental models that have been routinely used to explore a variety of questions. But in addition to the huge diversity of phototrophic forms, there are a vast number of non-phototrophic (heterotrophic, colourless) members in the group (Fig. 6.1). Perhaps for historical and practical reasons (i.e., harder to find and difficult to cultivate and maintain), heterotrophic euglenids remained at the shadow of their green counterparts, and this bias resulted in the impression that heterotrophic forms may be less diverse. However, when properly considered, the available evidence tells us that this is not so, and more critically, that a detailed exploration of heterotrophic euglenids is paramount for understanding the evolution of the entire group. This was the main motivation to undertake this research.  117  Figure 6.1. Diversity of phagotrophic euglenids. A-C. Eukaryovorous species. A. Bihospites bacati. B. Urceolus sp. C. Peranema trichophorum. D-E. Bacterivorous species. D. Notosolenus sp. E. Heteronema spirale. N = nucleus. F = anterior flagellum. © Susana Breglia.  6.2 Phagotrophic euglenids Inferences about the succession of evolutionary events that explain the distribution of characters among euglenids depend on a strongly supported and relatively comprehensive phylogenetic framework. To this end, it is important that the branching patterns between the lineages characterized by the main types of nutrition found in euglenids (i.e. bacteriovory, eukaryovory, osmotrophy, phototrophy) are clearly established. The nucleotide sequence of the SSU rRNA 118  gene is the most widely used marker for molecular phylogenetic studies, and as such, it is available from a large number of euglenids. Unfortunately, the vast majority of SSU rRNA sequences are from phototrophic species; therefore, comprehensive phylogenetic analyses suffer from an extremely unbalanced taxon sampling, with phagotrophic species severely underrepresented. Trees constructed with such datasets show good support for the monophyly of phototrophic euglenids, but the branching order of heterotrophic forms is much less clear. While the bias in taxon sampling is probably an important factor, nucleotide sequences have limited power to resolve phylogenetic relationships when large evolutionary distances are involved. The SSU molecule contains regions of different degrees of conservation, a feature that makes it suitable as a genetic marker for a wide taxonomic range. However, at deeper evolutionary divergences, variable regions become saturated with multiple substitutions per site whereas highly conserved regions vary little, resulting in insufficient phylogenetic signal and poorly resolved trees. Suitability of SSU rRNA genes for euglenozoan phylogeny has been extensively analysed (Busse and Preisfeld, 2003b; Busse et al., 2003; Busse and Preisfeld, 2002b; Linton et al., 1999) and showed to have limited power to resolve deep relationships, especially those involving heterotrophic lineages. This situation highlights the need to generate sequence data from several different protein-coding genes.  6.2.1 The phylogeny of phagotrophic euglenids Phylogenetic inferences based on morphological and molecular data suggest that bacterivores like Petalomonas cantuscygni have retained many features allegedly present in the most recent ancestor of all euglenids. This species possesses a combination of ultrastructural characters that can be considered intermediate between kinetoplastids and euglenids: a simple feeding apparatus consisting of a cytoplasmic pocket reinforced by microtubules, and homologous to the MTRpocket feeding apparatus of bodonid kinetoplastids; few pellicle strips; and an  119  inclusion within each mitochondrion that morphologically resembles the compact mitochondrial DNA found at different levels of complexity in kinetoplastids. As mentioned above, the relationship between P. cantuscygni and other euglenozoans remained unresolved in molecular phylogenetic analyses of SSU rRNA sequences (Fig 6.2A). I set out to address this limitation by isolating and sequencing the gene encoding Hsp90 from P. cantuscygni and conducting a phylogenetic analysis with the amino acid sequence of Hsp90, a marker that has been used with some success to resolve deep branching relationships within other groups of microbial eukaryotes (Simpson and Roger, 2004a; Stechmann and Cavalier-Smith, 2003). This study, in which I also generated Hsp90 sequences from two other phagotrophic euglenids, the bacterivore Entosiphon sulcatum and the eukaryovore Peranema trichophorum (Fig. 6.3), established a sister relationship between the kinetoplastid and diplonemid clades. However, the position of P. cantuscygni was less clear, and strongly depended on the outgroup used in the analysis. When plants (I. nil and O. sativa) and a heterolobosean (N. gruberi) were used as outgroups, P. cantuscygni branched as the sister lineage to the kinetoplastid-diplonemid clade; when the jakobid R. americana was used as an outgroup, P. cantuscygni branched as the most basal lineage within the euglenids with high bootstrap support (see chapter 2). The sensitivity of polarization of the euglenozoan phylogeny to outgroup choice likely reflects the vast genetic distances between the ingroup and available outgroup taxa. Very few HSP 90 sequences were available at the time of my analysis. In the future, better sampling of HSP 90 and other slowly evolving genes both among the euglenids and the outgroups may improve resolution of polarity. Ideally, more excavates, especially jakobids (e.g., Andalucia, Jakoba, etc.) would be particularly apropriate. It is also important to mention that the approach followed to evaluate the phylogenetic position of P. cantuscygni (i.e., using PCR with degenerate primers to amplify, clone and sequence the hsp90 gene) would probably be different if started today, as new sequencing technologies (e.g., RNA-seq) and analytical  120  improvements (e.g., user-friendly nucleotide alignment based on protein information) are now available.  Figure 6.2. A. Present state of euglenid phylogeny based on SSU rRNA sequences. B. Hypothetical phylogeny derived from cladistic analysis of morphological characters. (a) Strip duplication event. (b) Origin of plastids.  121  Figure 6.3. Scanning electron micrographs of wild isolates of two phagotrophic euglenids from which heat shock protein 90 genes were sequenced. A. Entosiphon sulcatum (bacterivore). B. Peranema trichophorum (eukaryovore). Scale bars = 5 µm. © Susana Breglia.  6.2.2 Inclusions in the mitochondrion of Petalomonas The kDNA-like inclusions in the mitochondria of P. cantuscygni morphologically resemble the poly-kDNA configuration in some kinetoplastids (Lukes et al., 2002). This structure has not been observed in other euglenids or diplonemids. However, E. gracilis has an unusual mitochondrial genome (Flegontov et al., 2011; Spencer and Gray, 2011; Gray et al., 2004; Yasuhira and Simpson, 1997), and the diplonemid Diplonema papillatum has a fragmented and reorganized mitochondrial genome as well (Flegontov et al., 2011; Marande and Burger, 2007; Roy et al., 2007b; Marande et al., 2005). Within the current phylogenetic context, in which P. cantuscygni branches with euglenids, it is possible that the ancestral euglenozoan experienced a novel reorganization of its mitochondrial  122  genome, which later underwent independent rearrangements leading in some cases to further complexity and compaction. This process has been observed on kDNA evolution (Lukes et al., 2002), where a plesiomorphic pan-kDNA configuration independently gave rise to (1) the mega-kDNA present in the bodonid Trypanoplasma and (2) the kDNA network of trypanosomatids. It must be noted that, since the publication of the data presented in Chapter 2 (Breglia et al., 2007), a new study by Roy et al. (2007b) concluded that the inclusions described in P. cantuscygni as possibly kDNA (Leander et al. 2001a, and pg. 16 of this thesis) do not correspond to packed mitochondrial DNA. They base their argument in the lack of fluorescence in the region of the flagellar pocket of Petalomonas cells. However, in my opinion, this does not disprove that the inclusions observed by Leander et al. (2001a) are indeed some type of DNAcontaining structure.  6.2.3 The ultrastructure of phagotrophic euglenids Although the diversity of feeding systems among euglenids is not fully known, it is clear that some species have relatively simple feeding structures and others have exceedingly complex ones. In order to outline a hypothesis for trends in the evolution of the euglenid feeding apparatus it is necessary to increase the meager sample of phagotrophic species that have been investigated so far. Presently, the evidence reflects a transition from a predominantly bacterivorous mode of nutrition to a eukaryovorous one (Leander et al., 2001a). Bacterivorous species are positioned basally in the euglenid phylogenetic tree. They tend to have a rigid pellicle and some have a feeding apparatus consisting of a simple cytostome; other bacterivores have robust rods that extend the full length of the cell. Conversely, eukaryovorous species have a plastic pellicle and feeding rods that are limited to the anterior third of the cell. Among phagotrophic euglenids, the  123  eukaryovores are more closely related to the lineage that gave rise to the phototrophic species. The ultrastructural characterization of the eukaryovore Heteronema scaphurum described in this thesis corroborates the molecular phylogenetic reconstruction of phagotrophic euglenids. H. scaphurum has a basal position among the eukayrovorous species and exhibits characters that are transitional between bacterivores and eukaryovores: a feeding apparatus similar to that of P. trichophorum, but with fewer pellicle strips (28, vs 56 in P. trichophorum ) and a lesser degree of plasticity. On the other hand, H. scaphurum shows unique characteristics such as a cytoproct from which small pellets are expelled, and a feeding behaviour that suggests the possible mechanism by which eukaryovorous ancestors sequestered green algae and gave rise to the phototrophic lineage This set of character states is a derived condition associated with a greater capacity for acquiring and consuming eukaryotic prey cells (Leander et al., 2001b; Leander, 2004; Triemer, 1997). For instance, a reduction of the rod length eliminates structural constraints in the posterior two thirds of the cell, which presumably gives these euglenids the flexibility to simultaneously accommodate the ingestion of several large prey cells. Vestiges of a feeding apparatus are present in phototrophic euglenids as well, which reflects the phagotrophic ancestry of this lineage (Owens et al., 1988; Shin et al., 2001; Shin et al., 2002; Surek and Melkonian, 1986; Triemer and Lewandowski, 1994; Willey and Wibel, 1985; Willey et al., 1988). Nonetheless, the overall evolutionary history of the euglenid feeding apparatus is far from complete, and major areas of uncertainty include the origin and early evolution of the rods and vanes from MTR pockets and the extent of the subsequent diversification.  124  6.3 Relationships with episymbiotic bacteria I isolated a novel microeukaryote with the intent of learning more about the diversity of the euglenid feeding apparatus and ended up discovering a fascinating lineage whose characterization contributed to fill a major gap in euglenid phylogeny. Bihospites bacati thrives in low-oxygen intertidal sands, an environment that is rich in symbiotic associations between eukaryotic hosts and sulfur oxidizing bacteria. More research demonstrated that B. bacati forms episymbioses with two unrelated bacteria, namely with members of epsilonproteobacteria and with member of the Verrucomicrobia. The lab also demonstrated that Calkinsia aureus, another biflagellate that forms symbiosis with epsilon-proteobacteria in low oxygen environments, was closely related to B. bacati, forming the Symbiontida. This new group also included several environmental sequences recovered from different low oxygen environments (Yubuki et al., 2009). The ultrastructural characterization of B. bacati demonstrated several intermediate traits between C. aureus and eukaryovorous euglenids, indicating that the Symbiontida descended from phagotrophic euglenids.  The episymbiotic association of B. bacati with two types of bacteria is novel. On the one hand, the rod-shaped bacteria covering the surface of B. bacati and C. aureus are sulfur or sulfide oxidizing members of the epsilon-proteobacteria (Edgcomb et al., 2011). These episymbionts are thought to play a role in detoxifying the immediate surrounding environment for the two hosts that, in turn, might serve the epibionts as anchorage that position them into suitable locations within the oxic/anoxic interface. Congruent tree topologies inferred from the hosts’ 18S rRNA and the bacterial 16S rRNA provided strong evidence for a coevolutionary history between the two sets of partners (Edgcomb et al., 2011).  125  Although microeukaryotes in anoxic or low oxygen environments are often enveloped with symbiotic bacteria, the extrusive verrucomicrobial episymbionts I discovered on B. bacati are highly unusual. These episymbiotic bacteria are ultrastructurally very similar, and phylogenetically closely related to the “epixenosomes” described from a species of the ciliate Euplotidium (Rosati et al., 1993b; Rosati et al., 1998; Rosati, 1996). The presence of closely related bacteria that have evolved a similar, very specialized, and seemingly intimate relationship with two distantly related protists leads one to wonder how these symbioses originated. I envision two possible scenarios: in (a), two unrelated hosts independently established symbiotic relationships with a free-living member of the Verrucomicrobia that was already equipped with the evisceration apparatus, whereas in (b), a symbiotic relationship was established and the symbionts were subsequently transferred horizontally between unrelated hosts. The second scenario is supported by the fact that the evisceration apparatus found in the episymbionts of Bihospites and Euplotidium is unknown in free-living Verrucomicrobia (not particularly strong evidence considering that we probably know a very small fraction of the actual diversity of the Verrucomicrobia). Answering this question requires extensive surveys of microbial diversity in various habitats aimed to identify Verrucomicrobia related to the epixenosomes of Bihospites and Euplotidium. This can be done by carrying out environmental PCRs surveys targeting 16S rRNA genes and by using microscopy to look for protists carrying verrucomicrobial episymbiont-like structures similar to the ones described in this thesis. The structure and mechanism of the extrusive episymbionts described here are reminiscent of other extrusive structures found in a wide range of protists, from the “gun cell” of the endoparasitic oomycete Haptoglossa (Kugrens et al., 1994) to the spores of microsporidian fungi (Cali and Takvorian, 1999; Delbac and Polonais, 2008; Vavra and Larsson, 1999), and even in animals, where the nematocysts of cnidarians are perhaps the best-known example of extrusive structures. (Hwang et al., 2008). Unlike others, nematocysts can “jump” from the  126  cnidarian individual to a predator in an undischarged state. This allows the new host animal to reposition the acquired organelles into its own tissues for its own protection (Greenwood, 2009). Moreover, potential cases of this type of lateral transfers of nematocysts have been described in certain dinoflagellates (Hoppenrath and Leander, 2007; Hoppenrath et al., 2009; Hoppenrath et al., 2010; Hwang et al., 2008). The capacity to be laterally transferred to distantly related lineages has two profound implications. First, it argues for the plausibility of the verrucomicrobial episymbionts being horizontally transferred between unrelated hosts (scenario 2 above), and second, it brings up the possibility that some extrusive cellular structures in eukaryotes had originated from bacterial symbionts, in the same way as mitochondria and plastids. The striking similarities between nematocysts and the verrucomicrobial symbionts described here, along with some evidence suggesting that some components of the nematocysts appear to have a bacterial origin, are compelling reasons to speculate that the nematocysts may have derived from ancestors like, or related to, the verrucomicrobial epixenosomes. Even if this speculation turns out to be incorrect, the similarities between nematocysts and epixenosomes would then constitute a striking example of convergent evolution across domains. These intriguing possibilities can be explored by generating comprehensive genomic and transcriptomic data from extrusive symbiotic bacteria and from eukaryotes with nematocysts.  6.4 Summary and outlook This work has augmented our current knowledge of the morphological and molecular phylogenetic diversity of heterotrophic euglenids. The sequencing of the gene encoding for Hsp 90 in three new phagotrophic euglenids, and the phylogenetic analysis using the amino acid sequences, better resolved the basal nodes of the euglenid phylogeny. However, this phylogeny is still very limited in the number of taxa represented. To improve the resolution and support of 127  protein-based phylogenies it is essential to increase the available data by incorporating other protein genes (multigene protein phylogenies), as well as by enlarging the taxon sampling.  The discovery and characterization of two new members of the Euglenida added new information on the feeding structures and feeding behaviour in phagotrophic euglenids. It improved our understanding of the ultrastructural and molecular diversity of phagotrophic euglenids, and increased the taxonomic representations of these species in molecular phylogenetic analyses. The addition of Heteronema scaphurum and, especially, Bihospites bacati contributed to the construction of a more robust phylogenetic hypothesis for euglenids. The phylogenetic position, coupled with the feeding behaviour of P. egressus strengthened the hypothesis of a eukaryovorous ancestor engulfing an alga and giving rise to phototrophic members of the group. The characterization of B. bacati supported the recently created Symbiontida, a new subgroup within euglenids with distinctive synapomorphies. Moreover, the symbiotic associations with two different bacteria provided excellent examples of co-evolution (in the case of the epsilonproteobacteria) and of lateral symbiont transmission in the case of the extrusive verrucomicrobia.  The results detailed in this thesis further support the idea that the Euglenozoa harbours a vast amount of undiscovered diversity. In particular, environmental sequence data showed a number of sequences that branch with B. bacati and C. aureus, suggesting that the Symbiontida is a much more diverse clade that currently appreciated. This fact underscores the importance of the type of work described in this thesis (identifying and describing the organisms from which environmental sequences come from) for our better understanding of microbial biodiversity. Because both C. aureus and B. bacati were collected from oxygen-  128  depleted environments, it is possible that more symbiontids will be found in future surveys in different types of low oxygen environments. An “environmental metagenomic” approach is a rapid way to identify symbiontids, as it screens large numbers of samples. This involves DNA extraction from samples such as planktonic filtrates or sediments and further massive parallel sequencing of PCR products of genes such as 18S SSU rRNA. Samples that contain sequences associated to known symbiontids can be further explored using microscopy to isolate potential candidates. Molecular techniques like fluorescent in situ hybridization with specific probes (FISH) or PCR and sequencing on single cells can be used to associate univocally particular environmental sequences with an actual organism.  One of the most fascinating aspects of my work was the discovery of B. bacati, a euglenid with verrucomicrobial episymbionts that appear to be homologous to those found originally in ciliates. This question certainly deserves to be pursued further in order to determine if other protists also contain these symbionts and if so, if they are restricted to particular environments. Future work in this area will hopefully help characterize the nature and origin of this fascinating type of symbiosis. An intriguing possibility is that extrusive organelles such as the nematocysts in cnidarians may have originated from an endosymbiotic association with a similar type of bacteria. The fact that nematocysts can be transmitted horizontally between distantly related hosts (e.g., cnidarian to nudibranch and potentially cnidarian to dinoflagellate or vice versa) adds credence to this possibility.  The exploration and characterization of microbial eukaryotes, and their symbionts, through high-resolution microscopy and molecular phylogenetics have demonstrated that the number of organisms remaining to be discovered is vast.  129  We are still just starting to appreciate how important such diversity is to the integrity and stability of global ecosystems. Continuing to achieve a better understanding of microbial eukaryotes is therefore imperative to understand the biosphere and ultimately preserve it (including us) to our best ability.  130  Bibliography  Adl SM, Simpson AGB, Farmer MA, Andersen RA, Anderson OR, Barta JR et al. (2005). The new higher level classification of eukaryotes with emphasis on the taxonomy of protists. J Eukaryot Microbiol 52: 399-451. Adl SM, Leander BS, Simpson AGB, Archibald JM, Anderson OR, Bass D, et al. (2007). Diversity, nomenclature, and taxonomy of protists. Syst Biol 56:684-689. Al-Qassab S, Lee WJ, Murray S, Simpson AGB, Patterson DJ (2002). Flagellates from stromatolites and surrounding sediments in Shark Bay, Western Australia. Acta Protozool 41: 91-144. Baldauf SL, Roger AJ, Wenk-Siefert I, Doolittle WF (2000). A kingdom-level phylogeny of eukaryotes based on combined protein data. Science 290: 972977. Baldauf SL (2003). The deep roots of eukaryotes. Science 300: 1703-1706. Beale GN, Jurand A, Preer JR (1969). The classes of endosymbiont of Paramecium aurelia. J Cell Sci 5: 65-91. Behnke A, Bunge J, Barger K, Breiner HW, Alla V, Stoeck T (2006). Microeukaryote community patterns along an O-2/H2S gradient in a supersulfidic anoxic Fjord (Framvaren, Norway). Appl Environ Microb 72: 3626-3636. Beier CL, Horn M, Michel R, Schweikert M, Gortz HD, Wagner M (2002). The genus Caedibacter comprises endosymbionts of Paramecium spp. related to the Rickettsiales (Alphaproteobacteria) and to Francisella tularensis (Gammaproteobacteria). Appl Environ Microbiol 68: 6043-6050.  131  Belhadri A, Bayle D, Brugerolle G (1992). Biochemical and immunological characterization of intermicrotubular cement in the feeding apparatus of phagotrophic euglenoids - Entosiphon, Peranema, and Ploeotia. Protoplasma 168: 113-124. Belhadri A, Brugerolle G (1992). Morphogenesis of the feeding apparatus of Entosiphon sulcatum - an immunofluorescence and ultrastructural study. Protoplasma 168: 125-135. Bernhard JM, Buck KR, Farmer MA, Bowser SS (2000). The Santa Barbara Basin is a symbiosis oasis. Nature 403: 77-80. Breckenridge DG, Watanabe Y, Greenwood SJ, Gray MW, Schnare MN (1999). U1 small nuclear RNA and spliceosomal introns in Euglena gracilis. Proc Natl Acad Sci USA 96: 852-856. Breglia SA, Yubuki N, Hoppenrath M, Leander BS (2010). Ultrastructure and molecular phylogenetic position of a novel euglenozoan with extrusive episymbiotic bacteria: Bihospites bacati n. gen. et sp (Symbiontida). BMC Microbiol 10: 145. Brosnan S, Shin W, Kjer KM, Triemer RE (2003). Phylogeny of the photosynthetic euglenophytes inferred from the nuclear SSU and partial LSU rDNA. Int J Syst Evol Micr 53: 1175-1186. Brugerolle G (1992). Flagellar apparatus duplication and partition, flagellar transformation during division in Entosiphon sulcatum. Biosystems 28: 203209. Bruno WJ, Socci ND, Halpern AL (2000). Weighted neighbor joining: A likelihood-based approach to distance-based phylogeny reconstruction. Mol Biol Evol 17: 189-197.  132  Buck KR, Bolt PA, Garrison DL (1990). Phagotrophy and fecal pellet production by an athecate dinoflagellate in Antarctic sea ice. Mar Ecol Prog Ser 60: 7584. Buck KR, Newton J (1995). Fecal pellet flux in Dabob Bay during a diatom bloom: contribution of microzooplankton. Limnol Oceanogr 40: 306-315. Buck KR, Barry JP, Simpson AGB (2000). Monterey Bay cold seep biota: Euglenozoa with chemoautotrophic bacterial epibionts. Eur J Protistol 36: 117-126. Buck KR, Bernhard JM (2002). Protistan-prokaryotic symbioses in deep-sea sulfidic sediments. In: Seckbach J (ed). Symbiosis: Mechanisms and Model Systems. Springer Netherlands: Dordrecht, The Netherlands. pp 509-517. Busse I, Preisfeld A (2002a). Phylogenetic position of Rhynchopus sp and Diplonema ambulator as indicated by analyses of euglenozoan small subunit ribosomal DNA. Gene 284: 83-91. Busse I, Preisfeld A (2002b). Unusually expanded SSU ribosomal DNA of primary osmotrophic euglenids: Molecular evolution and phylogenetic inference. J Mol Evol 55: 757-767. Busse I, Patterson DJ, Preisfeld A (2003). Phylogeny of phagotrophic euglenids (Euglenozoa): A molecular approach based on culture material and environmental samples. J Phycol 39: 828-836. Busse I, Preisfeld A (2003a). Systematics of primary osmotrophic euglenids: a molecular approach to the phylogeny of Distigma and Astasia (Euglenozoa). Int J Syst Evol Microbiol 53: 617-624.  133  Busse I, Preisfeld A (2003b). Application of spectral analysis to examine phylogenetic signal among euglenid SSU rDNA data sets (Euglenozoa). Org Divers Evol 3: 1-12. Cali A, Takvorian PM (1999). Developmental morphology and life cycles of the Microsporidia. In: Wittner M (ed). The Microsporidia and Microsporidiosis. American Society for Microbiology: Washington, D. C. pp 85-128. Camacho A (2007). Planktonic microbial assemblages and the potential effects of metazooplankton predation on the food web of lakes from maritime Antarctica and sub-Antarctic islands. In: Amils R, Ellis-Evans C, HinghoferSzalkay HG (eds). Life in extreme environments. Springer. pp 167-185. Canaday J, Tessier LH, Imbault P, Paulus F (2001). Analysis of Euglena gracilis alpha-, beta- and gamma-tubulin genes: introns and pre-mRNA maturation. Mol Genet Genomics 265: 153-160. Candela T, Fouet A (2006). Poly-gamma-glutamate in bacteria. Mol Microbiol 60: 1091-1098. Cavalier-Smith T (1981). Eukaryote kingdoms: seven or nine? Biosystems 14: 461-481. Cavalier-Smith T (1998). A revised six-kingdom system of life. Biol Rev 73: 203266. Cavalier-Smith T (2003). Flagellate megaevolution: the basis for eukaryote diversification. In: Leadbeater BSC, Green JC (eds). The flagellates. Unity, diversity and evolution. Taylor and Francis: London-New York. pp 361-390. Corliss JO (2002). Biodiversity and biocomplexity of the protists and an overview of their significant roles in maintenance of our biosphere. Acta Protozool 41: 199-219.  134  David CN, Ozbek S, Adamczyk P, Meier S, Pauly B, Chapman J et al. (2008). Evolution of complex structures: minicollagens shape the cnidarian nematocyst. Trends Genet 24: 431-438. Dawson SC, Pace NR (2002). Novel kingdom-level eukaryotic diversity in anoxic environments. Proc Natl Acad Sci USA 99: 8324-8329. de Maagd RA, Bravo A, Berry C, Crickmore N, Schnepf HE (2003). Structure, diversity, and evolution of protein toxins from spore-forming entomopathogenic bacteria. Annu Rev Genet 37: 409-433. Delbac F, Polonais V (2008). The microsporidian polar tube and its role in invasion. In: Burleigh BA, Soldati-Favre D (eds). Molecular Mechanisms of Parasite Invasion. Landes Bioscience and Springer Science+Business Media. pp 208-220. Denker E, Bapteste E, Le Guyader H, Manuel M, Rabet N (2008). Horizontal gene transfer and the evolution of cnidarian stinging cells. Curr Biol 18: R858859. Dubilier N, Bergin C, Lott C (2008). Symbiotic diversity in marine animals: the art of harnessing chemosynthesis. Nat Rev Microbiol 6: 725-740. Edgcomb VP, Kysela DT, Teske A, Gomez AD, Sogin ML (2002). Benthic eukaryotic diversity in the Guaymas Basin hydrothermal vent environment. Proc Natl Acad Sci USA 99: 7658-7662. Edgcomb VP, Breglia SA, Yubuki N, Beaudoin D, Patterson DJ, Leander BS et al. (2011). Identity of epibiotic bacteria on symbiontid euglenozoans in O-2depleted marine sediments: evidence for symbiont and host co-evolution. ISME J 5: 231-243.  135  Einicker-Lamas M, Mezian GA, Fernandez TB, Silva FL, Guerra F, Miranda K et al. (2002). Euglena gracilis as a model for the stydy of Cu2+ and Zn2+ toxicity and accumulation in eukaryotic cells. Environ Pollut 120: 779-786. Esson HJ, Leander BS (2006). A model for the morphogenesis of strip reduction patterns in phototrophic euglenids: evidence for heterochrony in pellicle evolution. Evol Dev 8: 378-388. Farmer MA, Triemer RE (1988). A redescription of the genus Ploeotia Duj. (Euglenophyceae). Taxon 37: 319-325. Fell JW, Scorzetti G, Connell L, Craig S (2006). Biodiversity of microeukaryotes in Antarctic Dry Valley soils with < 5% soil moisture. Soil Biol Biochem 38: 3107-3119. Felsenstein J (1993). PHYLIP (Phylogeny Inference Package). University of Washington: Seattle. Fenchel T, Perry T, Thane A (1977). Anaerobiosis and symbiosis with bacteria in free-living ciliates. J Protozool 24: 154-163. Fenchel T, Finlay BJ (1989). Kentrophoros - a mouthless ciliate with a symbiotic kitchen garden. Ophelia 30: 75-93. Fenchel T, Ramsing NB (1992). Identification of sulphate-reducing ectosymbiotic bacteria from anaerobic ciliates using 16S rRNA binding ologonucleotide probes. Arch Microbiol 158. Fenchel T, Bernard C, Esteban G, Finlay BJ, Hansen PJ, Iversen N (1995). Microbial diversity and activity in a danish fjord with anoxic deep water. Ophelia 43: 45-100. Flegontov P, Gray MW, Burger G, Lukes J (2011). Gene fragmentation: a key to mitochondrial genome evolution in Euglenozoa?. Curr Genet 57: 225-32.  136  Gast RJ, Sanders RW, Caron DA (2009). Ecological strategies of protists and their symbiotic relationships with prokaryotic microbes. Trends Microbiol 17: 563-569. Gilson PR (2001). Nucleomorph genomes: much ado about practically nothing. Genome Biol 2. Gottlieb J (1850). Ueber eine neue, mit Stärkmehl isomere Substanz. Ann Chem Pharm 75: 51-61. Gowing MM, Silver MW (1985). Minipellets: A new and abundant size class of marine fecal pellets. J Mar Res 43: 395-418. Gray MW, Lang BF, Burger G (2004). Mitochondria of protists. Ann Rev Genet 38: 477-524. Greenblatt CL, Schiff JA (1959). A pheophytin-like pigment in dark-adapted Euglena gracilis. J Eukaryot Microbiol 6: 23-28. Greenwood PG (2009). Acquisition and use of nematocysts by cnidarian predators. Toxicon 54: 1065-1070. Guindon S, Gascuel O (2003). A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol 52: 696-704. Hall RP, Powell WN (1928). Morphology and binary fission of Peranema trichophorum (Ehrbg.) Stein. Biol Bull 54: 36-65. Hannaert V, Saavedra E, Duffieux F, Szikora JP, Rigden DJ, Michels PAM et al. (2003). Plant-like traits associated with metabolism of Trypanosoma parasites. Proc Natl Acad Sci USA 100: 1067-1071. Hausmann K (1978). Microtubules and endocytosis. Cytobiologie 18: 186-186.  137  Henze K, Badr A, Wettern M, Cerff R, Martin W (1995). A nuclear gene of eubacterial origin in Euglena gracilis reflects cryptic endosymbioses during protist evolution. Proc Natl Acad Sci USA 92: 9122-9126. Hofmann C, Bouck B (1976). Immunological and structural evidence for patterned intussusceptive surface growth in a unicellular organism. J Cell Biol 69: 693-715. Hoppenrath M (2000). Taxonomical and ecological investigations of flagellates from marine sands, University of Hamburg, Hamburg, Germany. Hoppenrath M, Leander BS (2007). Character evolution in polykrikoid dinoflagellates. J Phycol 43: 366-377. Hoppenrath M, Bachvaroff TR, Handy SM, Delwiche CF, Leander BS (2009). Molecular phylogeny of ocelloid-bearing dinoflagellates (Warnowiaceae) as inferred from SSU and LSU rDNA sequences. BMC Evol Biol 9: 116. Hoppenrath M, Yubuki N, Bachvaroff S, Leander BS (2010). Re-classification of Pheopolykrikos hartmannii as Polykrikos (Dinophyceae) based partly on the ultrastructure of complex extrusomes. Europ J Protistol 46: 29-37. Huelsenbeck JP, Ronquist F (2001). MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17: 754-755. Hwang JS, Nagai S, Hayakawa S, Takaku Y, Gojobori T (2008). The search for the origin of cnidarian nematocysts in dinoflagellates. In: Evolutionary Biology from Concept to Application. Springer, Berlin/Heidelberg. Keeling PJ (2002). Molecular phylogenetic position of Trichomitopsis termopsidis (Parabasalia) and evidence for the Trichomitopsiinae. Europ J Protistol 38: 279-286.  138  Kent ML, Elston RA, Nerad TA, Sawyer TK (1987). An Isonema-like flagellate (Protozoa, Mastigophora) infection in larval Geoduck clams, Panope abrupta. J Invertebr Pathol 50: 221-229. Kivic PA, Walne PL (1984). An evaluation of the possible phylogenetic relationship between euglenophyta and kinetoplastida. Orig Life 13: 269-288. Kugrens P, Lee RE, Corliss JO (1994). Ultrastructure, biogenesis, and functions of extrusive organelles in selected non-ciliate protists. Protoplasma 181: 164190. Kusch J, Czubatinski L, Wegmann S, Hubner M, Alter M, Albrecht P (2002). Competitive advantages of Caedibacter-infected paramecia. Protist 153: 4758. Kusch J, Görtz H-D (2006). Towards an understanding of the killer trait: Caedibacter endocytobionts in Paramecium. In: Overmann J (ed). Molecular Basis of Symbiosis. Springer-Verlag: Berlin Heidelberg. pp 61-76. Lackey JB (1960). Calkinsia aureus gen. et sp. nov., a new marine euglenid. Trans Am Microsc Soc 79: 105-107. Larsen J, Patterson DJ (1991). The diversity of heterotrophic euglenids. In: Patterson DJ, Larsen J (eds). The biology of free-living heterotrophic flagellates. Systematics Association Special Volume. Claredon Press: Oxford. pp 205-217. Leander BS, Farmer MA (2000a). Epibiotic bacteria and a novel pattern of strip reduction on the pellicle of Euglena helicoideus (Bernard) Lemmermann. Europ J Protistol 36: 405-413. Leander BS, Farmer MA (2000b). Comparative morphology of the euglenid pellicle. I. Patterns of strips and pores. J Eukaryot Microbiol 47: 469-479.  139  Leander BS, Farmer MA (2001a). Evolution of Phacus (Euglenophyceae) as inferred from pellicle morphology and SSU rDNA. J Phycol 37: 143-159. Leander BS, Farmer MA (2001b). Comparative morphology of the euglenid pellicle. II. Diversity of strip substructure. J Eukaryot Microbiol 48: 202-217. Leander BS, Triemer RE, Farmer MA (2001a). Character evolution in heterotrophic euglenids. Eur J Protistol 37: 337-356. Leander BS, Witek RP, Farmer MA (2001b). Trends in the evolution of the euglenid pellicle. Evolution 55: 2215-2235. Leander BS (2004). Did trypanosomatid parasites have photosynthetic ancestors? Trends Microbiol 12: 251-258. Leander BS, Keeling PJ (2004a). Symbiotic innovation in the oxymonad Streblomastix strix. J Eukaryot Microbiol 51: 291-300. Leander BS, Keeling PJ (2004b). Early evolutionary history of dinoflagellates and apicomplexans (Alveolata) as inferred from hsp90 and actin phylogenies. J Phycol 40: 341-350. Leander BS, Esson HJ, Breglia SA (2007). Macroevolution of complex cytoskeletal systems in euglenids. Bioessays 29: 987-1000. Leander BS (2008a). A hierarchical view of convergent evolution in microbial eukaryotes. J Eukaryot Microbiol 55: 59-68. Leander BS (2008b). Different modes of convergent evolution reflect phylogenetic distances: a reply to Arendt and Reznick. Trends Ecol Evol 23: 481-482  140  Lee WJ, Simpson AGB, Patterson DJ (2005). Free-living heterotrophic flagellates from freshwater sites in Tasmania (Australia), a field survey. Acta Protozool 44: 321-350. Leedale GF (1958). Nuclear structure and mitosis in the euglenineae. Arch Microbiol, 32: 32-64. Leedale GF (1964). Pellicle structure in Euglena. Brit Phycol Bull 2: 291-306. Leedale GF (1967). Euglenida/Euglenophyta. Ann Rev Microbiol 21: 31-48 Linton EW, Triemer RE (1999). Reconstruction of the feeding apparatus in Ploeotia costata (Euglenophyta) and its relationship to other euglenoid feeding apparatuses. J Phycol 35: 313-324. Linton EW, Hittner D, Lewandowski C, Auld T, Triemer RE (1999). A molecular study of euglenoid phylogeny using Small Subunit rDNA. J Euk Microbiol 46: 217-223. Linton EW, Nudelman MA, Conforti V, Triemer RE (2000). A molecular analysis of the euglenophytes using SSU rDNA. J Phycol 36: 740-746. Lukes J, Guilbride DL, Votypka J, Zíkova A, Benne R, Englund PT (2002). Kinetoplast DNA network: evolution of an improbable structure. Eukaryot Cell 1: 495–502. Lukes J, Hashimi H, Zikova A (2005). Unexplained complexity of the mitochondrial genome and transcriptome in kinetoplastid flagellates. Curr Genet 48: 277-299. Macor M, Beno J, Grones J, Sieckel P, Novotny J. (1996). Euglena gracilis as a supplementary test organism for detecting biologically active compounds. Folia Microbiol 41: 48-52.  141  Marande W, Lukes J, Burger G (2005). Unique mitochondrial genome structure in diplonemids, the sister group of kinetoplastids. Eukaryot Cell 4: 1137-1146. Marande W, Burger G (2007). Mitochondrial DNA as a genomic jigsaw puzzle. Science 318: 415. Marin B, Palm A, Klingberg M, Melkonian M (2003). Phylogeny and taxonomic revision of plastid-containing euglenophytes based on SSU rDNA sequence comparisons and synapomorphic signatures in the SSU rRNA secondary structure. Protist 154: 99-145. Martin W, Borst P (2003). Secondary loss of chloroplasts in trypanosomes. Proc Natl Acad Sci USA 100: 765-767. Maslov DA, Yasuhira S, Simpson L (1999). Phylogenetic affinities of Diplonema within the Euglenozoa as inferred from the SSU rRNA gene and partial COI protein sequences. Protist 150: 33-42. Mignot JP, Brugerolle G, Bricheux G (1987). Intercalary strip development and dividing cell morphogenesis in the euglenid Cyclidiopsis acus. Protoplasma 139: 51-65. Milne I, Lindner D, Bayer M, Husmeier D, McGuire G, Marshall DF et al. (2009). TOPALi v2: a rich graphical interface for evolutionary analyses of multiple alignments on HPC clusters and multi-core desktops. Bioinformatics 25: 126-127. Montegut-Felkner AE, Triemer RE (1994). Phylogeny of Diplonema ambulator (Larsen and Patterson). 1. Homologies of the Flagellar Apparatus. Europ J Protistol 30: 227-237.  142  Montegut-Felkner AE, Triemer RE (1996). Phylogeny of Diplonema ambulator (Larsen and Patterson). 2. Homologies of the Feeding Apparatus. Europ J Protistol 32: 64-76. Montegut-Felkner AE, Triemer RE (1997). Phylogenetic relationships of selected euglenoid genera based on morphological and molecular data. J Phycol 33: 512-519. Moreira D, Lopez-Garcia P, Rodriguez-Valera F (2001). New insights into the phylogenetic position of diplonemids: G+C content bias, differences of evolutionary rate and a new environmental sequence. Int J Syst Evol Micr 51: 2211-2219. Moreira D, Lopez-Garcia P, Vickerman K (2004). An updated view of kinetoplastid phylogeny using environmental sequences and a closer outgroup: proposal for a new classification of the class Kinetoplastea. Int J Syst Evol Microbiol 54: 1861-1875. Morris JC, Drew ME, Klingbeil MM, Motyka SA, Saxowsky TT, Wang ZF et al. (2001). Replication of kinetoplast DNA: an update for the new millennium. Int J Parasitol 31: 453-458. Muchhal US, Schwartzbach SD (1994). Characterization of the unique intronexon junctions of Euglena gene(s) encoding the polyprotein precursor to the light-harvesting chlorophyll a/b binding protein of photosystem II. Nucl Acids Res 22: 5737-5744. Mullner AN, Angeler DG, Samuel R, Linton EW, Triemer RE (2001). Phylogenetic analysis of phagotrophic, phototrophic and osmotrophic euglenoids by using the nuclear 18S rDNA sequence. Int J Syst Evol Micr 51: 783-791.  143  Nisbet B (1974). An ultrastructural study of the feeding apparatus of Peranema trichophorum. J Protozool 21: 39-48. Noda S, Ohkuma M, Yamada A, Hongoh Y, Kudo T (2003). Phylogenetic position and in situ identification of ectosymbiotic spirochetes on protists in the termite gut. Appl Environ Microb 69: 625-633. Ohkuma M (2008). Symbioses of flagellates and prokaryotes in the gut of lower termites. Trends Microbiol 16: 345-352. Owens KJ, Farmer MA, Triemer RE (1988). The flagellar apparatus and reservoir/canal cytoskeleton of Cryptoglena pigra (Euglenophyceae). J Phycol 24: 520–528. Ozbek S, Balasubramanian PG, Holstein TW (2009). Cnidocyst structure and the biomechanics of discharge. Toxicon 54: 1038-1045. Pedersen MF, Hansen PJ (2003). Effects of high pH on the growth and survival of six marine heterotrophic protists. Mar Ecol-Prog Ser 260: 33-41. Petroni G, Spring S, Schleifer KH, Verni F, Rosati G (2000). Defensive extrusive ectosymbionts of Euplotidium (Ciliophora) that contain microtubulelike structures are bacteria related to Verrucomicrobia. Proc Natl Acad Sci USA 97: 1813-1817. Philippe H (2000). Opinion: long branch attraction and protist phylogeny. Protist 151: 307-316. Philippe H, Laurent J (1998). How good are deep phylogenetic trees? Curr Opin Genet Dev 8:616-623. Porter D (1973). Isonema papillatum sp. n., a new colorless marine flagellate: a light and electronmicroscopic study. J Protozool 20: 351-356.  144  Preisfeld A, Berger S, Busse I, Liller S, Ruppel HG (2000). Phylogenetic analyses of various euglenoid taxa (Euglenozoa) based on 18S rDNA sequence data. J Phycol 36: 220-226. Price CA, Vallee BL (1962). Euglena gracilis, a test organism for study of zinc. Plant Physiol 37: 428-433. Radek R (2010). Adhesion of bacteria to protists. In: Konig H, Claus H, A. V (eds). Prokaryotic Cell Wall Compounds. Springer-Verlag: Berlin. pp 429-456. Roberts DML (1999). Eukaryotic cells under extreme conditions. In: Seckbach J (ed). Enigmatic microorganisms and life in extreme environments. Kluwer Academic Publishers: Dordretcht, Netherlands. pp 163-174. Rogers MB, Gilson PR, Su V, McFadden GI, Keeling PJ (2007). The complete chloroplast genome of the chlorarachniophyte Bigelowiella natans: Evidence for independent origins of chlorarachniophyte and euglenid secondary endosymbionts. Mol Biol Evol 24: 54-62. Ronquist F, Huelsenbeck JP (2003). MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572-1574. Rosati G, Lenzi P, Verni F (1993a). Epixenosomes: peculiar epibionts of the protozoan ciliate Euplotidium itoi. Do their cytoplasmic tubules consist of tubulin? Micron 24: 465-471. Rosati G, Verni F, Lenzi P (1993b). Epixenosomes: peculiar epibionts of the ciliate Euplotidium itoi. The formation of the extrusive apparatus and the ejecting mechanism. Eur J Protistol 29: 238-245. Rosati G, Giambelluca MA, Grossi M, Morelli A (1997). Epixenosomes, peculiar epibionts of the ciliate Euplotidium itoi: involvement of membrane  145  receptors and the adenylate cyclase-cyclic AMP system in the ejecting process. Protoplasma 197: 57-63. Rosati G, Verni F, Lenzi P, Giambelluca MA, Sironi M, Bandi C (1998). Epixenosomes, peculiar epibionts of the ciliated protozoon Euplotidium itoi: what kind of organisms are they? Protoplasma 201: 38-44. Rosati G, Petroni G, Quochi S, Modeo L, Verni F (1999). Epixenosomes: Peculiar epibionts of the hypotrich ciliate Euplotidium itoi defend their host against predators. J Eukaryot Microbiol 46: 278-282. Rosati G (2002). Ectosymbiosis in ciliated protozoa. In: Seckbach J (ed). Symbiosis. Springer Netherlands: Netherlands. pp 477-488. Rosati G (2006). Extrusive bacterial ectosymbiosis of ciliates. In: Overmann J (ed). Molecular Basis of Symbiosis. Springer-Verlag Berlin: Heidelberg. pp 97-115. Rosati G, Giambelluca E, Taiti E (1996). Epixenosomes: peculiar epibionts of the ciliate Euplotidium itoi: morphological and functional cell compartimentalization. Tissue & Cell 28: 313-320. Roth LE (1959). An electron-microscope study of the cytology of the protozoan Peranema trichophorum. J Protozool 6: 107-116. Roy J, Faktorová D, Benada O, Lukeš J, Burger G (2007a). Description of Rynchopus euleeides n. sp. (Diplonemea), a free-living marine euglenozoan. J Eukaryot Microbiol 54: 137-145. Roy J, Faktorová D, Lukeš J, Burger G (2007b). Unusual mitochondrial genome structures throughout the Euglenozoa. Protist 158: 385-396. Russell AG, Watanabe Y, Charette JM, Gray MW (2005). Unusual features of fibrillarin cDNA and gene structure in Euglena gracilis: evolutionary  146  conservation of core proteins and structural predictions for methylation-guide box C/D snoRNPs throughout the domain Eucarya. Nucleic Acids Res 33: 2781-2791. Saito A, Suetomo Y, Arikawa M, Omura G, Khan SMMK, Kakuta S et al. (2003). Gliding movement in Peranema trichophorum is powered by flagellar surface motility. Cell Motil Cytoskel 55: 244-253. Scheuermayer M, Gulder TAM, Bringmann G, Hentschel U (2006). Rubritalea marina gen. nov., sp. nov., a marine representative of the phylum 'Verrucomicrobia', isolated from a sponge (Porifera). Int J Syst Evol Micr 56: 2723-2723. Schlesner H, Jenkins C, Stanley JT (2006). The Phylum Verrucomicrobia: a phylogenetically heterogeneous bacterial group. The Prokaryotes. Springer: New York. pp 881-896. Schnepf E (1994). Light and electron microscopical observations in Rynchopus coscinodiscivorus spec. nov., a colorless, phagotrophic euglenozoon with concealed flagella. Arch Protistenkd 144: 63-74. Schroeckh S, Lee WJ, Patterson DJ (2003). Free-living heterotrophic euglenids from freshwater sites in mainland Australia. Hydrobiologia 493: 131-166. Schuster FL, Goldstein S, Herchenoz B (1968). Ultrastructure of a flagellate, Isonema nigricans nov. gen. nov. sp., from a polluted marine habitat. Protistologica IV: 141-149 Shalchian-Tabrizi K, Minge MA, Cavalier-Smith T, Nedreklepp JM, Klaveness D, Jakobsen KS (2006). Combined heat shock protein 90 and ribosomal RNA sequence phylogeny supports multiple replacements of dinoflagellate plastids. J Eukaryot Microbiol 53: 217-224.  147  Shimodira H, Hasegawa M (2001). CONSEL: for assessing the confidence of phylogenetic tree selection. Bioinformatics 17: 1246–1247. Shin W, Boo SM, Triemer RE (2001). Ultrastructure of the basal body complex and putative vestigial feeding apparatus in Phacus pleuronectes (Euglenophyceae). J Phycol 37: 913-921. Shin W, Triemer RE (2004). Phylogenetic analysis of the genus Euglena (Euglenophyceae) with particular reference to the type species Euglena viridis. J Phycol 40: 226-235. Shin WG, Brosnan S, Triemer RE (2002). Are cytoplasmic pockets (MTR/pocket) present in all photosynthetic euglenoid genera? J Phycol 38: 790-799. Simpson AGB, van den Hoff J, Bernard C, Burton HR, Patterson DJ (1996). The ultrastructure and systematic position of the euglenozoon Postgaardi mariagerensis, Fenchel et al. Arch Protistenkd 147: 213-335. Simpson AGB (1997). The identity and composition of the Euglenozoa. Arch Protistenkd 148: 318-327. Simpson AGB, Lukes J, Roger AJ (2002). The evolutionary history of kinetoplastids and their kinetoplasts. Mol Biol Evol 19: 2071-2083. Simpson AGB (2003). Cytoskeletal organization, phylogenetic affinities and systematics in the contentious taxon Excavata (Eukaryota). IJSEM 53: 17591777. Simpson AGB, Gill EE, Callahan HA, Litaker RW, Roger AJ (2004). Early evolution within kinetoplastids (Euglenozoa), and the late emergence of trypanosomatids. Protist 155: 407-422.  148  Simpson AGB, Roger AJ (2004a). Protein phylogenies robustly resolve the deep-level relationships within Euglenozoa. Mol Phylogenet Evol 30: 201212. Simpson AGB, Roger AJ (2004b). The real 'kingdoms' of eukaryoyes. Curr Biol 14: R694. Simpson AGB, Inagaki Y, Roger AJ (2006a). Comprehensive multigene phylogenies of excavate protists reveal the evolutionary positions of "primitive" eukaryotes. Mol Biol Evol 23: 615-625. Simpson AGB, Stevens JR, Lukes J (2006b). The evolution and diversity of kinetoplastid flagellates. Trends Parasitol 22: 168-174. Simpson AGB, Patterson DJ (2008). Current perspectives on high-level groupings of protists. In: Katz LA, Bhattacharya D (eds). Genomics and evolution of microbial eukaryotes. Oxford University Press: New York. pp 730. Spencer DF, Gray MW (2011). Ribosomal RNA genes in Euglena gracilis mitochondrial DNA: fragmented genes in a seemingly fragmented genome. Mol Genet Genomics 285: 19-31. Stechmann A, Cavalier-Smith T (2003). Phylogenetic analysis of eukaryotes using heat-shock protein Hsp90. J Mol Evol 57: 408-419. Stoeck T, Taylor GT, Epstein SS (2003). Novel eukaryotes from the permanently anoxic Cariaco Basin (Caribbean sea). Appl Environ Microb 69: 5656-5663. Stoecker DK (1984). Particle production by planktonic ciliates. Limnol Oceanogr 29: 930-940  149  Strimmer K, von Haeseler A (1996). Quartet puzzling: a quartet maximumlikelihood method for reconstructing tree topologies. Mol Biol Evol 13: 964969. Surek B, Melkonian M (1986). A cryptic cytostome is present in Euglena. Protoplasma 133: 39–49. Suzaki T, Williamson RE (1985). Euglenoid movement in Euglena fusca: evidence for sliding between pellicullar strips. Protoplasma 124: 137-146. Suzaki T, Williamson RE (1986a). Ultrastructure and sliding of pellicular structures during euglenoid movement in Astasia longa Pringsheim (Sarcomastigophora, Euglenida). J Protozool 33: 179-184. Suzaki T, Williamson RE (1986b). Pellicular ultrastructure and euglenoid movement in Euglena ehrenbergii Klebs and Euglena oxyuris Schmarda. J Protozool 33: 165-171. Szczepanek S, Cikala M, David CN (2002). Poly-gamma-glutamate synthesis during formation of nematocyst capsules in Hydra. J Cell Science 115: 745751. Takishita K, Tsuchiya M, Kawato M, Oguri K, Kitazato H, Maruyama T (2007). Genetic diversity of microbial eukaryotes in anoxic sediment of the saline meromictic lake Namako-ike (Japan): On the detection of anaerobic or anoxic-tolerant lineages of eukaryotes. Protist 158: 51-64. Talke S, Preisfeld A (2002). Molecular evolution of euglenozoan paraxonemal rod genes par1 and par2 coincides with phylogenetic reconstruction based on small subunit rDNA data. J Phycol 38: 995-1003. Tamm SL (1982). Flagellated ectosymbiotic bacteria propel a eucaryotic cell. J Cell Biol 94: 697-709.  150  Tessier LH, Paulus F, Keller M, Vial C, Imbault P (1995). Structure and expression of Euglena gracilis nuclear Rbcs genes encoding the small subunits of the Ribulose 1,5-Bisphosphate Carboxylase Oxygenase - a novel splicing process for unusual intervening sequences. J Mol Biol 245: 22-33. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgons DG (1997). The ClustalX Windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucl Acids Res 24: 4876-4882. Triemer RE, Fritz L (1987). Structure and operation of the feeding apparatus in a colorless euglenoid, Entosiphon sulcatum. J Protozool 34: 39-47. Triemer RE, Ott DW (1990). Ultrastructure of Diplonema ambulator Larsen & Patterson (Euglenozoa) and its relationship to Isonema. Europ J Protistol 25: 316-320. Triemer RE, Farmer MA (1991a). The ultrastructural organization of the heterotrophic euglenids and its evolutionary implications. In: Patterson DJ, Larsen J (eds). The biology of free-living heterotrophic flagellates. The Systematics Association. Oxford. pp 185-204. Triemer RE, Farmer MA (1991b). An ultrastructural comparison of the mitotic apparatus, feeding apparatus, flagellar apparatus and cytoskeleton in euglenoids and kinetoplastids. Protoplasma 164: 91-104. Triemer RE, Lewandowski CL (1994). Ultrastructure of the basal apparatus and putative vestigial feeding apparatuses in a quadriflagellate euglenoid (Euglenophyta). J Phycol 30: 28-38. Triemer RE (1997). Feeding in Peranema trichophorum revisited (Euglenophyta). J Phycol 33: 649-654.  151  Triemer RE, Linton E, Shin W, Nudelman A, Monfils A, Bennett M, Brosnan S (2006). Phylogeny of the Euglenales based upon combined SSU and LSU rDNA sequnce comparisons and description of Discoplastis gen. nov. (Euglenophyta). J Phycol 42: 731-740. Uhlig G (1964). Eine einfach Methode zur Extraktion der vagilen, mesopsammalen Mikrofauna. Helgol Wiss Meeresunters 11: 178-185. Vandekerckhove TT, Willems A, Gillis M, Coomans A (2000). Occurrence of novel verrucomicrobial species, endosymbiotic and associated with parthenogenesis in Xiphinema americanum-group species (Nematoda, Longidoridae). Int J Syst Evol Microbiol 50: 2197-2205. Vannini C, Petroni G, Schena A, Verni F, Rosati G (2003). Well-established mutualistic associations between ciliates and prokaryotes might be more widespread and diversified than so far supposed. Eur J Protistol 39: 481-485. Vavra J, Larsson JIR (1999). Structure of the Microsporidia. In: Wittner M (ed). The Microsporidia and Microsporidiosis. American Society for Microbiology: Washington, D.C. pp 7-84. Verni F, Rosati G (1990). Peculiar epibionts in Euplotidium itoi (Ciliata, Hypotrichida). J Protozool 37: 337-343. Verni F, Gualtieri P (1997). Feeding behaviour in ciliated protists. Micron 28: 487-504. von der Heyden S, Chao EE, Vickerman K, Cavalier-Smith T (2004). Ribosomal RNA phylogeny of bodonid and diplonemid flagellates and the evolution of euglenozoa. J Eukaryot Microbiol 51: 402-416. Weber J (1990). Poly(y-glutamic acid)s are the major constituents of nematocysts in Hydra (Hydroxoa, Cnidaria). J Biol Chem 265: 9664-9669.  152  Willey RL, Wibel RG (1985). A cytostome/cytopharynx in green euglenoid flagellates (Euglenales) and its phylogenetic implications. BioSystems 18: 369–376. Willey RL, Walne PL, Kivic PA (1988). Phagotrophy and the origins of the euglenoid flagellates. CRC Crit Rev Plant Sci 7: 303-340. Wolken JJ (1977). Euglena: the photoreceptor system for phototaxis. J Eukaryot Microbiol 24: 518-522. Wołowski K (1995). Dylakosoma pelophilum Skuja, a rare colourless euglenophyte found in Poland. Algological Studies 76: 75-78. Yasuhira S, Simpson L (1997). Phylogenetic affinity of mitochondria of Euglena gracilis and kinetoplastids using cytochrome oxidase I and hsp60. J Mol Evol 44: 341-347. Yubuki N, Edgcomb VP, Bernhard JM, Leander BS (2009). Ultrastructure and molecular phylogeny of Calkinsia aureus: cellular identity of a novel clade of deep-sea euglenozoans with epibiotic bacteria. BMC Microbiol 9: 16. Zagulski M, Nowak JK, Le Mouel A, Nowacki M, Migdalski A, Gromadka R et al. (2004). High coding density on the largest Paramecium tetraurelia somatic chromosome. Curr Biol 14: 1397-1404. Zimba PV, Moeller PD, Beauchesne K, Lane HE, Triemer RE (2010). Identification of euglenophycin, a toxin found in certain euglenoids. Toxicon 55: 100-104. Zuendorf A, Bunge J, Behnke A, Barger KJA, Stoeck T (2006). Diversity estimates of microeukaryotes below the chemocline of the anoxic Mariager Fjord, Denmark. Fems Microbiol Ecol 58: 476-491.  153  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0072730/manifest

Comment

Related Items