Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Tyrosyl-DNA phosphodiesterase 1 (Tdp1) : a rhabdomyosarcoma therapy target and mitochondrial DNA repair… Chowdhury, Md. Miraj Kobad 2012

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2012_spring_chowdhury_miraj.pdf [ 16.82MB ]
Metadata
JSON: 24-1.0072543.json
JSON-LD: 24-1.0072543-ld.json
RDF/XML (Pretty): 24-1.0072543-rdf.xml
RDF/JSON: 24-1.0072543-rdf.json
Turtle: 24-1.0072543-turtle.txt
N-Triples: 24-1.0072543-rdf-ntriples.txt
Original Record: 24-1.0072543-source.json
Full Text
24-1.0072543-fulltext.txt
Citation
24-1.0072543.ris

Full Text

TYROSYL-DNA PHOSPHODIESTERASE 1 (TDP1): A RHABDOMYOSARCOMA THERAPY TARGET AND MITOCHONDRIAL DNA REPAIR ENZYME  by Md. Miraj Kobad Chowdhury  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Medical Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  January 2012  © Md. Miraj Kobad Chowdhury, 2012  Abstract Tyrosyl-DNA phosphodiesterase 1 (TDP1) repairs blocked 3´ DNA termini to enable DNA repair. The H493R mutation in TDP1, which disrupts the active site of the enzyme and leads to formation of long-lived TDP1-DNA adducts, causes the progressive neurodegenerative disease spinocerebellar ataxia with axonal neuropathy 1 (SCAN1). Loss of function of TDP1 results in increased sensitivity towards several genotoxic agents including camptothecin analogues, bleomycin and ionizing radiation in vitro and in vivo. In this study, the rationale for using TDP1 as a therapeutic anticancer target and the role of functional loss of TDP1 in neurodegeneration were investigated. Using immunohistochemical  staining,  immunofluorescence  microscopy,  sub-cellular  fractionation, immunoblotting, TUNEL assays, and PCR, TDP1 expression and the consequences of its loss were studied in different human tissues, tumor tissues, rhabdomyosarcoma cell lines and murine retina. Twenty-four out of twenty six different human tumors were TDP1 positive. Rhabdomyosarcoma cell lines expressing TDP1 in the mitochondria showed higher resistance to camptothecin compared to those not expressing TDP1 in the mitochondria. Loss of TDP1 reduced growth and increased camptothecin sensitivity in all rhabdomyosarcoma cell lines. To better understand the role of TDP1 in the mitochondria, I identified a tissue in mouse in which murine TDP1 is exclusively expressed in the mitochondria, photoreceptors, and found that Tdp1-/- mice had degenerating rod and cone cells from postnatal day 11 associated with an increased level of oxidative mitochondrial DNA damage and apoptosis. These observations indicated that murine TDP1 plays an important role in mitochondria by repairing mitochondrial DNA and that murine TDP1 in mitochondria protects photoreceptors from degeneration. They also suggest that mitochondrial TDP1 renders cancer cells resistant to some chemotherapy and radiotherapy regimes, and that mitochondrial TDP1 is a potential anticancer target.  ii  Preface Dr. Cornelius F Boerkoel initially identified and designed the research work presented in this thesis. Kunho Choi did all the knockdown experiments, several of the immunoblots, the cell culture and some of the subcellular fractionation. Dr. Gulisa Turashvili stained all the tumor tissue microarrays. Cheryl Walton and I analyzed the tumor tissue microarray results. Cheryl Walton and I did the immunoblotting and immunofluorescence analysis of the tumor cell lines. Cheryl Walton and I did the immunostaining and analysis of the human autopsy tissues. Dr. Cornelius F Boerkoel previously developed Tdp1-/- mice and generated the anti-Tdp1 antibodies. Dr. Hiroshi Takashima identified the eye phenotype in the Tdp1-/- mice. All the other experimental results, all the photomicrographs and data analysis presented in this thesis were performed by me and I wrote this thesis. The Institutional Review Board of the University of British Columbia provided the ethical approval for using human tissues and samples. Protocol number is H0903301. Also, the Animal Care Committee of the University of British Columbia provided the approval of using mice in this study. Protocol number is A10-0296. Kunho Choi and I maintained the mouse lines with the assistance from technicians of the Transgenic Facility at the Center for Molecular Medicine and Therapeutics. I also did the ear notching, plug checking and weaning of these mice. The following manuscripts are under preparation for publishing the data presented in this thesis and I participated in the preparation of the manuscripts:  iii  1. Spinocerebellar ataxia with axonal neuropathy (SCAN1): a disorder of nuclear and mitochondrial DNA repair. Hok Khim Fam, Miraj K Chowdhury*, Cornelius F Boerkoel. (Chapters 1 and 5). 2. TDP1 and PARP: synthetic lethal targets for rhabdomyosarcoma. Hok khim Fam, Miraj K Chowdhury*, Sheetal Bajaj, Nichola Osborne, Kunho Choi, Cheryl Walton, Goubin Sun, Gulisa Turashvili, Samuel Aparicio, Mason Bond, Timothy J Triche, Catherine J Pallen, Cornelius F Boerkoel. (Chapter 3). 3. Expression profile of TDP1 in human tissues. Miraj K Chowdhury*, Cheryl Walton, Kunho Choi, Hok Khim Fam, Cornelius F Boerkoel, Glenda Hendson. (Chapter 4). 4. TDP1 repairs mitochondrial DNA. Miraj K Chowdhury*, Kunho Choi, Hok Khim Fam, Cornelius F Boerkoel. (Chapter 4).  The following abstracts were presented based on the work performed in this thesis: 1. Tdp1 is a mitochondrial DNA repair enzyme. Miraj K Chowdhury*, Andrew Fam, Kunho Choi, Glenda Hendsons, Cornelius F Boerkoel. (2011). United Mitochondrial Disease Foundation. (Chapter 4). 2. Tdp1: a rationale anticancer target. Miraj K Chowdhury*, Andrew Fam, Nichola Osborne, Cheryl Walton, Kunho Choi, Mason Bond, Catherine J Pallen, Cornelius F Boerkoel. (2010). Annual Genomics Forum of Genome British Columbia. (Chapter 3).  iv  Table of Contents Abstract ……………………………………………………………………………  ii  Preface……………………………………………………………………………...  iii  Table of Contents…………………………………………………………………..  v  List of Tables……………………………………………………………………….  viii  List of Figures……………………………………………………………………...  ix  List of Abbreviations and Symbols……………………………………………….  xi  Acknowledgements………………………………………………………………...  xiii  Chapter 1. Introduction…………………………………………………………...  1  1.1 Mechanism of DNA repair………………………………………………….  1  1.2 DNA repair diseases………………………………………………………...  4  1.3 Spinocerebellar ataxia with axonal neuropathy type 1 (SCAN1)…...……… 4 1.4 Discovery of tyrosyl-DNA phosphodiesterase 1 (TDP1)..………………….  7  1.5 Functional definition of TDP1……………………………………………… 7 1.6 Rationalization of TDP1 as an anti-cancer target…………………………...  11  1.7 Remaining questions………………………………………………………... 13 1.8 Hypothesis and specific aims……………………………………………….. 13 Chapter 2. Materials and methods…………………………………………...…..  20  2.1 Human and animal subjects…………………………………………………  20  2.2 Production of rabbit-antiTDP1 and guinea pig-antiTdp1 serum……………  20  2.3 Tumor tissue-microarray (TMA)...………………………………………….  20  2.4 Cell culture……………………………………………………….................. 21 2.5 Immunofluorescence microscopy…………………………………………...  22  v  2.6 Western blotting……………………………………………………….......... 23 2.7 Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)....  24  2.8 Immunohistochemistry……………………………………………………...  24  2.9 Purification of mitochondria………………………………………………... 25 2.10 Purification of nuclei………………………………………………………  26  2.11 siRNA knockdown……………………………………………………….... 27 2.12 shRNA knockdown………………………………………………………... 28 2.13 Camptothecin (CPT) sensitivity…….……………………………………..  28  2.14 Hematoxylin and eosin (H&E) staining…………………………………… 29 2.15 Terminal deoxynucleotidyl transferase deoxyuridine triphosphate nick end labeling (TUNEL) assay………………………………................  29  2.16 Polymerase chain reaction (PCR)…………..……………...........................  30  Chapter 3. TDP1 as a potential anti-cancer target………………………………  35  3.1 TDP1 expression in tumor tissue microarray (TMA)………………………. 35 3.1.1 Pediatric tumor TMA…………………………………………………. 35 3.1.2 Adult tumor TMA…………………………………………………….. 36 3.2 TDP1 expression in rhabdomyosarcoma (RMS) cell lines…………………. 37 3.2.1 TDP1 expression in normal human skeletal muscle………………….. 37 3.2.2 TDP1 expression in aRMS and eRMS cells…………………………..  37  3.2.3 Mitochondrial localization of TDP1 in RMS cells……………………  38  3.3 TDP1 inhibition and CPT sensitivity in RMS cell lines……………………. 39 3.3.1 CPT sensitivity of RMS cell lines…………………………………….  39  3.3.2 Effect of siRNA knockdown of TDP1………………………………..  40  vi  3.3.3 Effect of shRNA knockdown of TDP1……………………………….. 40 Chapter 4. Tdp1 as a mitochondrial DNA repair enzyme………………………  56  4.1 TDP1 expression in human tissue…………………………………………..  56  4.2 Murine retina as a model for TDP1 mitochondrial function…………..……  57  4.2.1 TDP1 expression in human retina…………………………………….. 57 4.2.2 TDP1 expression in murine retina…………………………………….  57  4.3 Retinal pathology associated with Tdp1 deficiency………………………...  58  4.3.1 Retinal morphology of Tdp1+/+ and Tdp1-/- mice……………………..  58  4.3.2 Molecular analysis of retinal degeneration in Tdp1-/- mice…………...  59  4.4 Retinal mitochondrial function with Tdp1 deficiency……………………… 60 4.4.1 Level of 8-oxoguanine in retina……………………………………...  60  4.4.2 Mitochondrial DNA damage in retina………………………………...  62  Chapter 5. Discussion………………………………………………………...........  76  5.1 TDP1 in cancer and neurodegeneration………………………………….…  76  5.2 Anticancer potential of TDP1 inhibition………………………..…………..  78  5.3 Tdp1-/- retina as a model for neurodegeneration in SCAN1…………...……  82  5.4 Possible side-effects of TDP1 inhibitors………………………………..…..  88  5.5 Future directions………………………………………..…………...............  89  References……………………………………………………….............................. 94 Appendix A: Analysis of mtDNA deletion in mouse…………………………...... 104 Appendix B: Full list of TDP1 expression in different human tissues………….  105  Appendix C: Representative photographs of TDP1 expression in different human systems…………………………………………………...………………...  109  vii  List of Tables Table 1.1  Examples of DNA repair diseases in human…………………………… 15  Table 2.1  List of primary antibodies used in experiments………………………...  Table 2.2  List of secondary antibodies used in experiments……………………… 33  Table 2.3  List of oligonucleotide sequences used in experiments………………...  Table 4.1  Expression of TDP1 in different human tissues as observed by immunohistochemical staining on autopsy samples……………………  32  34  63  viii  List of Figures Figure 1.1  Overview of DNA repair……………..………………………………... 16  Figure 1.2  Substrates of TDP1…………………………………………………….  Figure 1.3  Mechanism of TDP1 catalytic activity………….…………………....... 18  Figure 1.4  TDP1-dependent and TDP1-independent pathways to remove Topo I-  17  DNA covalent complex………………………………………………... 19 Figure 3.1  TDP1 expression in different pediatric tumors………………………...  42  Figure 3.2  TDP1 expression in rhabdomyosarcoma tumors…..…………………..  43  Figure 3.3  Expression of TDP1 in adult tumors…………………………………... 44  Figure 3.4  Expression of TDP1 in normal human skeletal muscle………………..  45  Figure 3.5  Expression of TDP1 in RMS cells……………………………………..  46  Figure 3.6  Mitochondrial localization of TDP1 in RMS cells…………………….  47  Figure 3.7  Camptothecin (CPT) sensitivity of RMS cell lines……………………. 48  Figure 3.8  siRNA knockdown of TDP1 in human fibroblast cells………………..  49  Figure 3.9  siRNA knockdown of TDP1 in aRMS cell lines……………………....  50  Figure 3.10 siRNA knockdown of TDP1 in eRMS cell lines……………………....  51  Figure 3.11 shRNA knockdown of TDP1 in human fibroblast cells……………….  52  Figure 3.12 shRNA knockdown of TDP1 in aRMS cell lines……………………...  53  Figure 3.13 shRNA knockdown of TDP1 in eRMS cell lines……………………...  54  Figure 3.14 CPT sensitivity of RMS cell lines with TDP1-shRNA knockdown.......  55  Figure 4.1  Representative figure of TDP1 expression in different human tissues... 65  Figure 4.2  Co-localization of TDP1 with mitochondria during oxidative stress…  66  Figure 4.3  TDP1 expression in human retina……………………………………..  67  ix  Figure 4.4  Tdp1 expression in wild type 129/SvEv murine retina………………... 68  Figure 4.5  Tdp1 expression pattern in wild type 129/SvEv murine retina after 24 hours experience in dark…………………...…………………………..  69  Figure 4.6  Retinal degeneration in Tdp1-/- mouse………………………………...  70  Figure 4.7  Degeneration of both rod cells and cone cells in Tdp1-/- mouse retina…………………………………………………………………… 71  Figure 4.8  Apoptosis in Tdp1-/- mouse retina……………………………………...  72  Figure 4.9  Increased oxidative DNA damage in Tdp1-/- mouse…………………...  73  Figure 4.10 Internal oxidative stress might be sufficient to cause retinal degeneration in Tdp1-/- mice…………………………………………...  74  Figure 4.11 Mitochondrial DNA damage in Tdp1-/- mouse retina………………….  75  Figure 5.1  TDP1 inhibitor as an anticancer therapeutic..……………………….....  92  Figure 5.2  A model illustrating possible molecular mechanism of SCAN1 development…………………………………………………………....  93  x  List of Abbreviations and Symbols 8-oxo-G  = 8-oxo-7,8-dihydroguanine  APE  = Apurinic/apyrimidinic endonuclease  aRMS  = Alveolar rhabdomyosarcoma  ATM  = Ataxia telangiectasia mutated  ATR  = Ataxia telangiectasia and Rad3 related  BER  = Base excision repair  BRCA1  = Breast cancer type 1 susceptibility protein  CIVS1  = Complex IV subunit 1  CNS  = Central nervous system  COG  = Children’s oncology group  CPT  = Camptothecin  CSA  = Cockayne syndrome group A protein  CSB  = Cockayne syndrome group B protein  CytC  = Cytochrome C  DNA-PK  = DNA-dependent protein kinase  DSB  = Double-strand break  ERCC1  = Excision-repair, complementing defective, in Chinese hamster, 1  eRMS  = Embryonal rhabdomyosarcoma  ETC  = Electron transport chain  GAPDH  = Glyceraldehyde-3-phosphate dehydrogenase  GCL  = Ganglion cell layer  HF  = Human dermal fibroblast  HKD  = Histidine-lysine-arginine motif  HR  = Homologous recombination  H&E  = Hematoxylin and eosin  INL  = Inner nuclear layer  LRC  = Layer of rods and cones  MEF  = Mouse embryonic fibroblast  MGMT  = Methylguanine methyl transferase  MMEJ  = Microhomology-mediated end joining  xi  MMR  = Mismatch repair  MRI  = Magnetic resonance imaging  MSBS  = Menadione sodium bisulphate  mtDNA  = Mitochondrial DNA  mtTopo I  = Mitochondrial topoisomerase 1  NER  = Nucleotide excision repair  NHEJ  = Non-homologous end joining  NCS/EMG  = Nerve conduction studies/electromyogram  NSCLC  = Non-small cell lung carcinoma  OGG1  = 8-oxoguanine glycosylase 1  ONL  = Outer nuclear layer  ORF  = Open reading frame  PARP  = Poly(ADP-ribose) polymerase  PGs  = 3´-Phosphoglycolates  PLD  = Phospholipase D  PNKP  = Polynucleotide kinase 3´-phosphatase  qRT-PCR  = Quantitative reverse transcriptase polymerase chain reaction  RACE  = Rapid amplification of cDNA ends.  RFLP  = Restriction-fragment length polymorphism  RMS  = Rhabdomyosarcoma  ROS  = Reactive oxygen species  SCAN1  = Spinocerebellar ataxia with axonal neuropathy type 1  SSB  = Single-strand break  TCR  = Transcription-coupled nucleotide excision repair  TDP1  = Tyrosyl-DNA phosphodiesterase 1  TMA  = Tissue microarray  Topo I  = Topoisomerase I  TUNEL  = Terminal deoxynucleotidyl transferase dUTP nick end labeling  XPF  = Xeroderma pigmentosum group F-complementing protein  XRCC1  = X-ray cross-complementing group 1  xii  Acknowledgements All praises are for the Almighty, most gracious, for His mercy and blessings, enabling me to perform this study. My heartfelt honor and gratitude to my respected mentor, Dr. Cornelius F Boerkoel, for his consistent encouragement, instruction, support, suggestions, advice and guidance over my years as a graduate student. He has been an excellent teacher in many aspects, who had extended his full co-operation by offering scholastic supervision, constructive criticism and constant inspiration. I am grateful to have had the opportunity to work with him. Also, my sincere thanks to my committee members, Drs. Catherine J Pallen, Michel Roberge and Daniel Goldowitz, whose advice, insight, and support have been invaluable over the years. My special thanks to Dr. Catherine J Pallen for the pediatric tumor microarray and staining it for TDP1 expression, Dr. Glenda Hendson for the autopsy samples, Dr. Robert S Molday for human retinal sections, and Dr. Gulisa Turashvili for staining the COG tumor microarray for TDP1 expression. Many thanks are required for my laboratory mates, Kunho Choi, Alireza Baradaran-Heravi, Keith McLarren, Marie Morimoto, Andrew Fam, Cheryl Walton, Jenny Huang and Cristina Dias. My heartfelt thanks to Kunho Choi for playing a key role in the work with siRNA and shRNA knockdown and CPT sensitivity assays and also for his suggestions on the work with the murine retina. Many thanks to Alireza for his lessons and helpful hands and guidance during my experiments and writing. In addition, thanks to Keith for all his support, suggestions and discussion during the experiments. I would like to thank Cheryl Walton, who stained most of the autopsy samples and also helped with my initial training on these projects. Many thanks to Marie Morimoto for her inspiration and training. Also, many thanks to Andrew Fam, who also helped with the siRNA knockdown experiments; it was a pleasure to work with him. I would like to thank Jenny and Cristina for their support and brilliant discussions. Also, my heartfelt thanks go to the Michael Cuccione Foundation for supporting me with the Michael Cuccione Fellowship. The experiments in this thesis were made possible with the funding support from the United Mitochondrial Disease Foundation, the Michael Cuccione Foundation and the Pediatric Oncology Cluster at CFRI. Finally, I would very much like to thank my family and my friends for their continued support.  xiii  Chapter 1. Introduction  1.1  Mechanism of DNA repair The DNA of a living cell stores all the genetic information required for its  survival1; therefore, maintenance of the integrity and the stability of the DNA molecule is essential for life. The genome of a cell is under constant insult from DNA damaging agents1,2. These agents can be exogenous like radiation, drugs and chemicals3,4 or endogenous like reactive oxygen species or defective cellular processes associated with DNA replication and transcription5,6. To repair DNA damage, every cell has its own machinery and a defect in this repair machinery will increase DNA damage and impair cell survival. Although our understanding of DNA repair processes is still incomplete, we understand that the DNA repair process in a cell involves three basic steps as illustrated in Figure 1.1: 1) identifying the damage, 2) recruiting the repair machinery and 3) repairing the damage7. Recognition of DNA damage. In brief, proteins that participate in DNA replication, transcription or repair first recognize the DNA damage and then trigger specific signaling pathways. This recognition is mediated by the alteration of the local structure of DNA or by modification of DNA-binding proteins such as phosphorylation of histone H2A (γH2AX) to mark double-stranded breaks in DNA8,9. Recruitment of the DNA repair machinery. After recognition, a specific signaling pathway is activated that recruits appropriate proteins to the damage site to start the repair8,9. These include DNA-dependent protein kinase (DNA-PK), the radiation protein 1 (RAD1)-radiation protein 9 (RAD9) complex, ataxia telangiectasia mutated  1  protein (ATM), and ataxia telangiectasia and Rad3-related protein (ATR). The DNAPK mediated pathway is activated by double-stranded breaks10, RAD1-RAD9 signaling by base damage11 and the ATM-ATR pathways by single-stranded breaks12. DNA repair mechanisms. Depending on the type of damage, one of four processes mediates the repair. The simplest form of DNA repair is the direct reversal of the damage. Such a process does not create a break in the phosphodiester backbone of the DNA but repairs the damaged bases. Two well-studied processes are demethylation of methyl-guanosine by methylguanine methyl transferase (MGMT)13 and direct removal of pyrimidine dimers or (6-4)-photoproducts by photolyases14. Another process repairs single-strand breaks (SSBs) in the phosphodiester backbone of DNA. Such SSBs arise from either helix distorting damage like apurinic/apyrimidinic (AP) sites in DNA or are generated by proteins that nick the DNA and/or produce an intermediate DNA-enzyme complex either at the 3´-or 5´-end of the nick. Three distinct types of such repair include base-excision repair (BER), nucleotide excision repair (NER) and mismatch repair (MMR)15. In BER, the damaged or altered bases are first removed by specific glycosylases to produce an AP site16. As an aside, AP sites are also generated by spontaneous loss of bases from the DNA. At least 11 different glycosylases have been reported in human cells16-18. Subsequently, apurinic/apyrimidinic endonuclease (APE) generates a nick on the phosphodiester backbone to create a single-strand break19, and this nick is either directly ligated by DNA ligases (short-patch BER) or processed by a mechanism called nick-translation and then ligated to remove the single-strand break (long-patch BER)17. In NER, bulky or helix-distorting damage such as pyrimidine dimers are removed by making two nicks  2  in the same strand of DNA20. This results in removal of the lesion flanked by undamaged bases on both sides, and thus, it is called dual-incision reaction21. NER is also categorized into two different sub-pathways called global genomic NER and transcription-coupled NER (TCR) based on their speed of repair and location of the damage21,22. The global genomic NER process is slower than TCR and participates in NER throughout the genome, whereas TCR is faster and participates in repair of damage in transcriptionally active regions of the genome22. MMR is involved in the repair of DNA replication errors, incorporated tautomers of bases or mismatch of bases after recombination23. Double-strand breaks (DSBs) in the DNA are usually severe as they can lead to genomic rearrangements and such breaks are fixed by three different pathways: 1) nonhomologous end joining (NHEJ), 2) microhomology-mediated end joining (MMEJ) and 3) homologous recombination (HR)24. HR is restricted to the late S to G2/M phase of the cell cycle when a sister chromatid is available, whereas NHEJ operates throughout the cell cycle and can repair DSBs in non-replicating cells. NHEJ repairs DSBs at short- or non-homologous sequences25. In contrast, MMEJ uses a microhomology sequence of 5-25 base-pairs to align the broken strands before joining during G1/S phase of cell cycle26. MMEJ also differs from NHEJ by 1) MMEJ repair is independent of DNA ligase IV and 2) requires end resection or unwinding to reveal homologous sequences24,26. HR is different from NHEJ and MMEJ in terms of using relatively longer homologous sequence and requires identical or nearly identical sequence to be used as a template. Theses differences make the HR repairing process the least errorprone from the other DSB-repairing processes27.  3  DNA repair processes in mitochondria utilize proteins from the nuclear DNA repair pathways. Interestingly, mitochondrial DNA (mtDNA) damage is repaired by all of the above mechanisms except for NER28. Evidence suggests that some proteins of the NER component (i.e. Cockayne syndrome group A protein (CSA) and Cockayne syndrome group B protein (CSB)) are present in mitochondria, and these proteins participate in BER of mitochondrial DNA (mtDNA) damage29. Although the DNA repair pathways are common in the nucleus and the mitochondria, the proteins involved in a specific pathway and the details of particular pathways can differ29-31.  1.2  DNA repair diseases Impaired function of DNA repair processes can lead to medical conditions  called DNA repair diseases32. Though defects in DNA repair can result in a wide variety of clinical presentations, there is typically a constellation of common traits like cancer, neurodegeneration or premature aging. In fact, impaired DNA repair leads to the accumulation of damage and mutations that facilitate senescence, apoptosis or uncontrolled cell division33. Defective DNA damage response, SSB or DSB repair pathways have been reported to cause a number of disorders33,34. These diseases are mostly autosomal recessive in human. Examples of human DNA repair diseases are listed in Table 1.134-36.  1.3  Spinocerebellar ataxia with axonal neuropathy type 1 (SCAN1) Spinocerebellar ataxia with axonal neuropathy type 1 (SCAN1) is a debilitating  neurodegenerative disorder characterized by late-childhood onset, slowly progressive  4  cerebellar ataxia (lack of order in movement due to injury or damage to the cerebellum), followed by areflexia (absence of reflexive actions) and signs of peripheral neuropathy (damage to the peripheral nerves or peripheral neurons)37,38. Following onset of gait ataxia (loss of order in limb movement), gaze nystagmus (involuntary rapid movement of the eyeball while looking to the right or to the left) and cerebellar dysarthria (weakness or paralysis of the muscle used for speaking, due to damage or injury to the cerebellum) usually develop. Impaired pain and touch sensations in hands and legs subsequently develop, as does loss of vibration sensing in hands and distal legs. Eventually the patients become wheelchair dependent37,38. SCAN1 is suspected in an individual based on clinical findings, family history and nerve conduction studies/electromyography (NCS/EMG). Clinical deduction of SCAN1 in a patient is based on presence of late-childhood (age 13-15 years) slowly progressing cerebellar ataxia with peripheral neuropathy and absence of oculomotor apraxia (difficulty in eye movement) or the extraneurologic features commonly found in ataxia-telangiectasia which include telangiectasia (dilated blood vessels near the surface of skin or mucous membranes), immunodeficiency or cancer. Affected individuals with SCAN1 have normal intelligence and mild dysarthria. Magnetic resonance imaging (MRI) studies of patient brains show cerebellar atrophy (shrinking of cerebellum) especially of the cerebellar vermis (the narrow, worm-like structure of the cerebellum)39. Nerve conduction studies show axonal neuropathy in all patients with SCAN1. Increased serum cholesterol and decreased serum albumin levels also support a diagnosis of SCAN138.  5  SCAN1 is an autosomal recessive neurological disorder. The homozygous A>G missense mutation in coding region of the tyrosyl-DNA phosphodiesterase 1 (TDP1) gene (c.1478A>G) resulting in TDP1 protein with Arg493 instead of His493 (p.His493Arg) is the only known genetic defect in SCAN1 patients and produces a variant of TDP1 with a defective active site. The only reported SCAN1 patients are from a large Saudi Arabian family having nine affected individuals. All the affected individuals were tested for the homozygous c.1478A>G mutation in TDP1 and confirmed for the disease38. The protein TDP1 participates in the SSB repair pathway by removing stalled topoisomerase I (Topo I) from the 3´-end of DNA. Interestingly, these patients are neither predisposed to neoplasia nor to dysfunction in rapidly replicating tissues, though their cells have a defective SSB repair pathway due to mutation in TDP1. Only large, terminally differentiated, post-mitotic neurons like Purkinje cells, dentate nuclei cells, anterior horn cells and dorsal root ganglia cells are thought to be affected in SCAN138. Molecular diagnosis of SCAN1 is only research based and can be tested by sequence analysis of TDP1 or restriction fragment length polymorphism (RFLP) with BsaA1 endonuclease digestion of PCR amplification product as the mutation generates a BsaA1 restriction endonuclease recognition site37,38. Currently, there is no treatment for SCAN1. Depending on the disability, prostheses, walking aids and wheelchairs are helpful for the mobility of the patient. Some physical therapies are also advisable for maintaining a relatively active lifestyle. Patients should avoid genotoxic anti-cancer  6  drugs such as camptothecin, irinotecan, topotecan or bleomycin as exposure to these drugs and to radiation is likely to be extremely harmful and possibly fatal37.  1.4  Discovery of tyrosyl-DNA phosphodiesterase 1 (TDP1) Tyrosyl-DNA phosphodiesterase 1 (TDP1) was first discovered in yeast  Saccharomyces cerevisiae by Pouliot et al. in 199940. The authors were exploring how the cell repairs camptothecin-induced Topo I-DNA covalent intermediates in yeast. Earlier findings suggested that if a long-lived topoisomerase I-DNA covalent intermediate formed, the Topo I was partially digested by a protease but a peptide remained trapped on the DNA as a tyrosyl-DNA adduct. The authors observed that wild-type yeast extracts could remove the Topo I peptide from DNA and by screening chemically mutagenized yeast strains, they identified one lacking tyrosyl-DNA phosphodiesterase activity and highly sensitive to camptothecin. This enzymatic activity was subsequently attributed to a protein with tyrosyl-DNA phosphodiesterase activity and conserved among many species40-43.  1.5  Functional definition of TDP1 TDP1 cleaves tyrosine-DNA phosphodiester bonds at the 3´ end of DNA and is  hence named tyrosyl-DNA phosphodiesterase 140. The products of the enzymatic reaction are tyrosyl moieties and 3´-phospho-DNA44. In fact, TDP1 functions in removing stalled Topo I from the 3´ end of the DNA39. Topo I is an essential enzyme which functions to unwind supercoiled DNA, thereby relieving the torsional stress generated during transcription and replication. To do this, Topo I acts on the 3´ end of  7  one strand to generate a nick and trap itself on the 3´-phosphate with tyrosine723 on its active site to generate an enzyme-DNA covalent intermediate45. After unwinding the DNA, Topo I ligates the DNA break by itself and thus can release itself from the DNA. Camptothecin binds to the covalent intermediate, generates an enzyme-drug-DNA ternary complex and thus stabilizes Topo I on the DNA resulting in a single-strand break46. Also, bulky helix distorting lesions of DNA can cause a misalignment of the 5´-hydroxyl end of the DNA and prevent it from acting as a nucleophile to release Topo I from the DNA. When these SSBs are encountered by replication machinery or by transcription machinery via the NER complex47, DSBs occur. As long as the enzymeDNA covalent intermediate remains stable, both the SSBs and the DSBs are unrepairable46,48,49. To clear the covalent intermediate, Topo I is cleaved by a protease to generate a partially degraded Topo I bound to the 3´ end of DNA by a phosphodiesterase bond between the 3´-phosphate of DNA and Tyr723 of Topo I. TDP1 acts on the phosphodiesterase bond and removes the partially degraded Topo I, clearing the 3´ end49,50. Cells lacking TDP1 are camptothecin (CPT) sensitive as CPT stabilizes the Topo I-DNA covalent intermediate39. Although the Topo I-DNA covalent intermediate is the most studied substrate for TDP1, a broad spectrum of TDP1 substrates have been studied46,51. These substrates are bound at the 3´ end of the DNA via a phosphodiester bond and include physiological substrates like phosphoglycolates generated during oxidative damage of deoxyribose sugar in DNA, denatured Topo I, mononucleoside and tetrahydrofuran and non-physiological substrates like 4-methylphenol, 4nitrophenol and 4-methylumbelliferone (Figure 1.2). However, TDP1 is unable to  8  remove full-length Topo I from the DNA. Also, the activity of TDP1 depends on the structure of DNA segments bound to Topo I. TDP1 activity is decreased if Topo I is bound to the nicked-duplex DNA52,53. TDP1 is a 608 amino acid protein coded by TDP1 located on the long arm (q arm) of human chromosome 14 at position 32.11 (base pair 90,422,245 from p-terminal to base pair 90,511,107 from p-terminal) and the mRNA contains 15 exons. Sequence analysis has shown that TDP1 contains a bipartite nuclear localization sequence and two conserved HxKx4Dx6G (G/S) motif, also known as HKD (histidine-lysinearginine) signature motifs38,40. Proteins of the phospholipase D (PLD) superfamily contain one HKD motif. However, the hydrolytic reaction catalyzed by TDP1 follows phosphoryl transfer chemistry that is common to all members of the PLD superfamily, thereby TDP1 is considered as a member of this superfamily44. The HKD motifs are very important for the catalytic function of TDP1. The His493Arg mutation in SCAN1 is located in the second HKD motif. Thereby, this mutation affects the catalytic site of the protein and reduces the catalytic activity by 25 fold38. TDP1 mediated removal of Topo I-DNA intermediate involves two steps. In first step, TDP1 removes the Topo I from the DNA by an SN2 nucleophilic attack on the phosphodiesterase bond between Topo I and DNA, and produces a TDP1-DNA phosphodiesterase covalent intermediate with His263 in the first HKD motif of TDP1. In the second step, TDP1 removes itself from the DNA using the His493 in the second HKD motif to finish the substitution process. Thus defective TDP1 in SCAN1 generates a TDP1-DNA covalent intermediate with His263, which can be removed by  9  wild-type TDP139,54 (Figure 1.3). This finding suggested that SCAN1 might arise, at least in part, from accumulation of the TDP1-DNA covalent intermediate39,54. To investigate the molecular basis of SCAN1 more clearly, the neuron-specific function of TDP1 has been studied in the Drosophila melanogaster orthologue (glaikit), mouse orthologue (Tdp1) and human TDP1 (TDP1). In flies, glaikit is expressed predominantly in the cytoplasm and plays an essential role in epithelial polarity and in central nervous system (CNS) development during embryogenesis. Loss of glaikit in the fly is embryonic lethal and results in failure to localize proteins at the apical lateral membrane of epithelial cells and also results in severe disruption of CNS architecture55,56. No other function of glaikit has been defined56. In mice, murine TDP1 (Tdp1) is expressed in the cytoplasm and nucleus of the cells affected in SCAN1. Tdp1 participates in the DNA repair process to remove stalled Topo I. Mice, mouse neuroblasts or mouse embryonic fibroblasts (MEFs) lacking Tdp1 are sensitive to camptothecin (CPT). But Tdp1-/- mice do not show an ataxic phenotype like SCAN1 patients. No other role has been described for Tdp1 in mice39,57,58. In the human, TDP1 is predominantly expressed in the cytoplasm of the affected neurons in SCAN1, but is expressed both in the cytoplasm and nucleus of the unaffected cells39. However, detailed studies of human TDP1 expression have not yet been done. TDP1 is phosphorylated at Ser81 for the optimal repair of Topo I-associated replication- and transcription-mediated DNA damage. Such phosphorylation stabilizes TDP1 and is mediated by ATM and DNA-PK59. When phosphorylated, TDP1 can form a complex with X-ray cross-complementing group 1 (XRCC1) protein to participate in DNA repair. Besides stabilizing TDP1, the phosphorylation of Ser81 also promotes  10  interaction with DNA ligase III-alpha following DNA damage60. A recent finding suggested that TDP1 is present in the mitochondria of MCF-7 breast cancer cells and Tdp1 is present in the mitochondria of MEFs61. The authors demonstrated that TDP1 is important for base-excision repair in the mitochondria and loss of Tdp1 results in increased damage to mitochondrial DNA when MEFs are treated with hydrogen peroxide61. These findings suggest that SCAN1 might arise from loss of mitochondrial DNA repair. Besides these, no other functions, like participating in a signaling pathway or having a phospholipase activity, have been reported for TDP1.  1.6  Rationalization of TDP1 as an anti-cancer target The role of TDP1 in removing stalled Topo I is physiologically very important  as failure to clear stalled Topo I can result in DSBs and cell death during replication62 or sometimes during transcription through formation of a RNA-DNA hybrid, also known as R-loop47. The anticancer drug camptothecin forms a stable drug-Topo I-DNA ternary complex. Accumulation of such ternary complexes can increase DNA damage and lead to cell death by the above mechanism63. On this basis, camptothecin or its analogs like topotecan or irinotecan have been used as anticancer drugs. However, these drugs are still not effective enough for cancer treatment and cause severe side effects like diarrhea, anemia, low white blood cell counts, weakness, nausea and vomiting63. There are two different pathways involved in clearing Topo I-mediated DNA damage46. One of them is BER that involves the activity of TDP1 as described above. The alternative pathway is XPF-ERCC1 dependent NER. In this pathway, the heterodimeric endonuclease complex composed of xeroderma pigmentosum group F-  11  complementing protein (XPF) and excision-repair, complementing defective, in Chinese hamster, 1 (ERCC1) catalyzes the 5´ incision in the process of excising the DNA lesion49. This alternative, TDP1 independent pathway is checkpoint dependent and often inactivated in cancer. That leaves only the TDP1 dependent pathway to repair the damage46 (Figure 1.4). Thereby, inhibition of TDP1 may increase camptothecin sensitivity in such cancers (i.e. BRCA1/2-associated breast cancer). Recent findings showed that expression of TDP1 and XPF is increased in non-small cell lung carcinoma (NSCLC). The authors also showed that the activity of TDP1 is increased in NSCLC64. As both TDP1 and XPF participate in removing Topo 1-DNA covalent complexes, an increased expression of these proteins may result in resistance to radiotherapy and chemotherapy, especially camptothecin and camptothecin-derivatives that stabilize Topo I-DNA covalent intermediates. Studies of Tdp1-/- mice and SCAN1 lymphoblasts suggested that functional loss of TDP1 sensitizes Tdp1-/- mice or cells to camptothecin and bleomycin and also increases DNA damage and apoptosis after camptothecin treatment39,57,58. Previous studies showed that TDP1 expression is increased in cells after camptothecin treatment or oxidative stress59,61. Also, TDP1 decreases sensitivity to anticancer agents like camptothecin, irinotecan, bleomycin and radiotherapy60,65. Interestingly, a recent trial of irinotecan (CPT-11) for the treatment of rhabdomyosarcoma (RMS) failed to show efficacy in tumor reduction, cure, or longevity66. One possible reason for such failure could be overexpression of TDP1. Recently TDP1 expression has been reported in mitochondria of Leishmania donivani, the MCF-7 breast cancer cell line and mouse embryonic fibroblasts42,61. Mitochondrial TDP1 has been reported to perform BER in  12  mitochondria to clear mtDNA bound Topo I (mtTopo I). There is also another apurinic/apyrimidinic endonuclease 1 (APE1)-dependent BER pathway in the mitochondria, which is not efficient enough to remove 3´-phosphoglycolyates from mtDNA19. Polymorphism in APE1 is correlated with increased risk in lung cancer67. Alongside this APE1-dependent BER pathway, TDP1 has been reported as the most efficient enzyme to remove 3´-phosphoglycolyates from mitochondrial DNA as NER is absent in mitochondria61. As mitochondria play roles in cancer, neurodegeneration and aging68, inhibiting TDP1 activity may differentially sensitize cancer cells to chemotherapeutics or may push cancer cells towards death due to lack of proper mtDNA repair activity. Based on these observations, TDP1 has been identified as a potential anti-cancer target.  1.7  Remaining questions Based on the above information, two important questions can be asked about  the roles of TDP1 in health and disease, and I will pursue answers to these questions in my research: 1. Does TDP1 expression grant resistance to current anticancer agents? 2. Is TDP1 expression in mitochondria important in vivo?	
    1.8  Hypothesis and specific aims I hypothesize that TDP1 protects cancer cells from specific genotoxic agents  and mitochondrial TDP1 protects the mitochondrial DNA from oxidative DNA damage. My specific aims are: 13  Specific Aim 1: To determine if TDP1 is a rational anticancer target. Specific Aim 2: To determine the importance of Tdp1 expression in the mitochondria of normal tissue. In my research, I used rhabdomyosarcoma (RMS) as a model to investigate TDP1 as a potential anticancer target and murine retina as a model to understand the importance of mitochondrial Tdp1 in normal tissue maintenance. Using the methods described in Chapter 2, I examined the RMS tissues and cell lines for TDP1 expression and the role of TDP1 in camptothecin (CPT) sensitivity of these cells. These results are presented in Chapter 3. I also examined the role of Tdp1 in the retina of wild type and Tdp1-/- mice to show that mitochondrial expression of Tdp1 plays an important role in the normal physiology of vision, and these findings are presented in Chapter 4.  14  Table 1.1: Examples of DNA repair diseases in humans34-36. Disorder Xeroderma pigmentosum Cockayne Syndrome Trichothoidystrophy  Main Symptoms  DNA repair defect  Sensitivity to sunlight, slow  NER (7 variants), pol  neurodegeneration, skin cancer.  η.  Sensitive to sunlight, growth retardation,  Defective NER and  neurological impairment, progeria.  TCR.  Sensitivity to sunlight, dystrophy, short  Defective NER.  brittle hair with low sulfur content, neurological and psychomotoric defects. Hereditary nonpolyposis  Predisposition to colon cancer.  Defect in MMR.  Spinocerebellar ataxia  Progressive degeneration of postmitotic  Mutation in TDP1,  with axonal neuropathy 1  neuron.  required for BER.  Ataxia with oculomotor  Slowly progressive cerebellar ataxia,  Mutation in APTX,  apraxia type 1  followed by oculomotor apraxia and  defective BER.  colon cancer  severe peripheral axonal motor neuropathy. Amyotrophic lateral  Progressive degeneration of motor  Defective BER,  sclerosis  neurons, muscle weakness and atrophy,  defect in SOD1.  fatal Ataxia with oculomotor  Cerebellar atrophy, axonal sensorimotor  Mutation in SETX,  apraxia type 2  neuropathy, oculomotor apraxia, and  defective DSB.  elevated serum concentration of alphafetoprotein. Ataxia-telangiectasia  Ataxia-telangiectasia like  Progressive ataxia, defective muscle  Defective DSB repair  coordination, dilation of blood vessel in  and damage response  skin and eyes, immune deficiency,  and detection,  predisposition to cancer.  mutated ATM.  Slowly progressive cerebellar ataxia,  Defective DSB repair  genomic instability and, hypersensitivity  and damage response  to ionizing radiation and genomic  and detection.  instability. Infantile-onset  Severe, progressive neurodegenerative  Defect in repairing  spinocerebellar ataxia  disorder, ataxia, muscle hypotonia, loss of  mitochondrial DNA.  deep-tendon reflexes and athetosis.  Mutated C10orf2.  15  Figure 1.1: Overview of DNA repair. Once the DNA is damaged by endogenous or exogenous damaging agents and is recognized, specific DNA repair pathways are activated based on the type of damage (see text for details).  16  Figure 1.2: Substrates of TDP1. TDP1 can remove both physiologic substrates and non-physiologic substrates from the 3´-end of the DNA. The above substrates were tested and previously published for TDP1 activity in vitro, as described in the text. R = Substrates.  17  Figure 1.3: Mechanism of TDP1 catalytic activity. (A) Wild type TDP1 removes denatured Topo I, but is trapped on DNA. Later, His493 of the second HKD motif in TDP1 removes TDP1 from DNA through a nucleophilic substitution. (B) In SCAN1, the mutated TDP1 (p.His493Arg) removes denatured Topo I but remains trapped on DNA and thereby accumulates.  18  Figure 1.4: TDP1-dependent and TDP1-independent pathways to remove Topo IDNA covalent complex. After the Topo I becomes trapped on DNA, a proteolytic degradation of Topo I produces denatured Topo I bound to the DNA. This complex can be removed by either the BER (TDP1-dependent pathway) or the NER (TDP1independent pathway). As NER is absent from mitochondria and as BRCA1 and other checkpoints are inactivated in different cancers, this leaves only TDP1 to repair the complex. Thus, TDP1 plays a major role in repairing Topo I-mediated DNA damage.  19  Chapter 2. Materials and methods  2.1  Human and animal subjects Human tissue and material used for this study was approved by the Institutional  Review Board of the University of British Columbia (H09-03301). Tdp1-/- mice were generated previously with gene trap embryonic stem (ES) cell line on 129/SvEv background39. Inbred Tdp1-/- and the wild type 129/SvEv (Tdp1+/+) mice (coat color: agouti) were used for the experiments. Primer sequences for genotyping and PCR conditions were previously described39. These mice were housed, bred and euthanized according to the guidelines and with approval of the University of British Columbia Animal Care Committee (Protocol number A10-0296). At least three mice of each genotype were tested for each case during an experiment.  2.2  Production of rabbit anti-TDP1 and guinea pig anti-Tdp1 serum An anti-TDP1 serum was generated in rabbit against human TDP1 amino acids  1-152 as previously described39. An anti-Tdp1 serum was generated in guinea pig against full-length murine TDP1 protein (amino acids 1-608) as previously described39.  2.3  Tumor tissue-microarray (TMA) Microarrays of adult tumor tissues were purchased from Imgenex Corp. (CA)  and the pediatric tumor TMA was a kind gift from Dr. Catherine J Pallen, Department of Pediatrics, University of British Columbia, Vancouver, Canada. The adult tumor TMAs were three different slides of common cancers (common cancer A, B and C).  20  Details of these common cancer samples are available at www.imgenex.com. Also, another set of alveolar rhabdomyosarcoma (aRMS) and embryonal rhabdomyosarcoma (eRMS) TMA were obtained from Children’s Oncology Group (COG) to stain for TDP1 expression. For the Pallen Lab pediatric TMA, 155 tumor samples from cases referred to British Columbia Children’s Hospital (BC Children’s Hospital) were arranged into four tissue microarray (TMA) blocks. The tumors included rhabdomyosarcoma (n=36), ganglioneuroma (n=14), neuroblastoma (n=30), Ewing’s sarcoma (n=22), medulloblastoma (n=14), and Wilm’s tumor (n=24), fibromatosis (n=10) and fibrosarcoma (n=5). Of the rhabdomyosarcoma tumors, 21 were aRMS and 25 were eRMS. TMAs were immunostained on a Ventana Discovery XT staining system (Ventana Medical Systems) using both commercial (ab4166, Abcam) and our previously published anti-TDP1 antibody with 1:100 dilution39. A tumor was considered as TDP1 positive if TDP1 was detected and as TDP1 negative if the staining was undetectable. TDP1 expression in the microarray was scored independently three times. Later images were acquired using a Zeiss Axiovert 200 microscope, a Zeiss AxiocamHR camera, and the Zeiss Axiovision imaging system.  2.4  Cell culture Rh30 (aRMS, PAX3-FKHR) and CW9019 (aRMS, PAX7-FKHR) cells were  cultured in Dulbecco’s modified eagle medium (DMEM) (Gibco) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Hyclone) and 1% antibioticantimycotic (Gibco). RD (eRMS) cells were grown on DMEM supplemented with 10% heat inactivated FBS, 1% antibiotic antimycotic, 4 ml/L L-glutamine, 4.5 g/L glucose  21  and 1.5 g/L NaHCO3. Human fibroblast cells (HF) were cultured using DMEM with 15% FBS and 1% antibiotic-antimycotic. A204 (eRMS), Birch (eRMS) and Rh18 (aRMS) cells were grown in RPMI-1640 media (Gibco) supplemented with 10% heat inactivated FBS and 1% antibiotic-antimycotic. All the cell lines were maintained in a cell culture incubator at 37º C with 5% CO2 and humidified environment.  2.5  Immunofluorescence microscopy Immunofluorescence microscopy was performed as described before39. Briefly,  approximately 5 X 105 cells were grown on a cover slip in appropriate media based on cell lines, washed with phosphate-buffered saline (PBS) and then fixed with 4% paraformaldehyde (PFA) in phosphate buffer (PB) for 15 minutes. The cells were then permeabilized with 0.5% Triton X-100 for 15 minutes and blocked overnight at 4º C or for an hour at room temperature with blocking buffer (20% horse serum, 1% casein in PBS). Primary antibodies were diluted in blocking buffer and incubated overnight at 4º C. After washing with PBS, secondary antibodies diluted in blocking buffer was added and incubated for 45 minutes at room temperature in dark. Later the cover slips were washed again with PBS in dark, mounted with DAPI and sealed with nail polish. Then images were acquired using a Zeiss Axiovert 200 microscope, a Zeiss AxiocamMR camera, and the Zeiss Axiovision imaging system. When MitoTrackerTM (Invitrogen) was used to stain the mitochondria in cell lines, it was diluted with media without FBS at a concentration of 300 nM and was applied to the cover slips for 30 minutes before fixing with 4% PFA in PB. For cryosections, slides were air-dried, then fixed with cold acetone at -20º C for 15 minutes and air-dried again. Then the slides were washed with  22  PBS and permeabilized. Then slides were blocked, stained with primary and secondary antibodies and image was acquired as described above. Mouse-on-mouse kit (MOMTM kit, BMK-2202, Vector Lab) was used according to the manufacturer’s instructions where a primary antibody was generated in mouse and applied on mouse tissue. Cryosections of human retina were a kind gift from Dr. Robert S Molday, Department of Biochemistry and Molecular Biology, University of British Columbia, Vancouver, Canada. All primary and secondary antibodies used for western blot are listed in Table 2.1 and Table 2.2.  2.6  Western blotting Western blotting was performed as described before39. Briefly, cell lysates in  SDS-sample buffer (63 mM Tris HCl, 10% glycerol, 2% SDS, 0.0025% bromophenol blue, pH 6.8) were denatured by boiling for 5 minutes. Then the proteins were separated in a 10% or 15% polyacrylamide gel by electrophoresis, transferred to a polyvinylidene fluoride (PVDF) membrane, blocked overnight at 4º C or for an hour at room temperature with Western Star buffer (0.2% iBlockTM (Applied Biosystems) in PBS with 0.1% Tween 20). Primary antibodies were diluted in Western Star buffer and incubated overnight at 4º C. The membrane was washed with Western Star buffer and secondary antibody was applied for an hour at room temperature and washed again. Then the membrane was developed with CDP-StarTM chemiluminescent system and then was exposed to the film. All primary and secondary antibodies used for western blot are listed in Table 2.1 and Table 2.2.  23  2.7  Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) RNA was isolated from cell-line or tissue using Qiagen RNeasy mini kit  (Qiagen) and 3 µg of RNA was reverse transcribed with qScript cDNA Supermix (Quanta Biosciences). Quantitative PCR was then performed using PerfeCTa SYBR Green FastMix (Quanta Biosciences) and the Applied Biosystems 7500 Fast Real-time System qPCR machine using manufacturer’s protocol. Data was analyzed using 7500 software (v2.0.1). Reaction condition for qRT-PCR was initial denaturation at 95º C for 10 minutes, then 40 cycles for denaturation at 95º C for 15 second and amplification at 60º C for 30 seconds. Data was collected during amplification at 60º C. The sequences of the primers used for qRT-PCR are listed in Table 2.3.  2.8  Immunohistochemistry Autopsy samples of formalin-fixed paraffin-embedded sections were a kind gift  from Dr. Glenda Hendson, Department of Anatomic Pathology, University of British Columbia, Canada. TDP1 expression in tissues was performed following standard immunohistochemistry protocol39. Briefly, sections were deparaffinized in xylene, sequentially rehydrated in 100%, 95%, 80% and 70% ethanol and later with phosphatebuffered saline (PBS). Antigen was retrieved by heat-induced epitope retrieval with sodium citrate buffer (10mM sodium citrate, 0.05% Tween 20, pH 6.0) in a pressure cooker for 5 minutes. Then endogenous peroxidases in the section were inactivated with 0.3% peroxide solution and blocked with blocking solution (5% normal goat serum, 5 mg/ml bovine serum albumin and 1% casein in PBS) overnight at 4º C or for an hour at room temperature. Rabbit anti-TDP1 (1:100) antiserum or pre-immune  24  serum (1:100 for negative control) were diluted in blocking solution and incubated overnight at 4º C. The slides were then developed using the Dako EnVision HRP Rabbit Kit (K4011) following the manufacturer’s protocol. The sections were incubated with 3,3´-diaminobenzidine (DAB) solution for 2 minutes. Then the slides were counterstained with Mayer’s hematoxylin for a minute and serially dehydrated with ethanol gradient (70% to 100%), then with xylene and then were mounted with xylenebased mounting media (Cytoseal-60, Thermo Scientific). Later images were acquired using a Zeiss Axiovert 200 microscope, a Zeiss AxiocamHR camera, and the Zeiss Axiovision imaging system.  2.9  Purification of mitochondria Mitochondria were isolated from cell lines, human skeletal muscle (a kind gift  from Dr. Glenda Hendson, Department of Anatomic Pathology, University of British Columbia, Canada) and mouse retina using the method described previously69,70. Briefly, for cell line, the media was discarded and the cells were trypsinized. Then the cells were washed with PBS and 107 cells were dissolved in 1 ml mitochondria isolation buffer (0.25 M sucrose, 1 mM EDTA, 20 mM HEPES-NaOH, pH 7.4) and were mixed well. For human skeletal muscle, the human muscle sample was snap frozen and the muscle was minced coarsely on ice with fine scissors and treated with 100 µg/ml Nagarase in ionic medium (100 mM sucrose, 10 mM EDTA, 100 mM TrisHCl, 46 mM KCl pH7.4) for 5 minutes on ice to obtain a muscle lysate. For mouse, one-month old Tdp1+/+ mice were euthanized by cervical dislocation and the eyeballs were collected immediately. Three mice were used for each round of mitochondria  25  isolation. Each eyeball was placed in cold PBS and retina was collected and stored temporarily in homogenization buffer (0.32 M sucrose, 1 mM EDTA, 10 mM Tris, pH 7.4). Then the retina was minced coarsely in homogenization buffer. The lysate were collected using cell strainer (40 µm). Once the lysate was prepared, it was immediately homogenized further using loose-fitting (for tissue) or tight-fitting (for cells) Dounce-homogenizer with 20 strokes on ice and then centrifuged at 1,000 x g to remove nuclei. The supernatant was further centrifuged at 14,000 x g to obtain the crude mitochondrial pellet. Mitochondria were purified from this crude pellet as described previously70. Briefly, the pellet was resuspended in 40% w/v OptiprepTM (AXIS-SHIELD, Norway) and was used as bottom layer of the step gradient. The step gradient was prepared using 1.175 g/ml (30% w/v OptiprepTM) and 1.079 g/ml (10% w/v OptiprepTM) and whole preparations were ultracentrifuged at 80,000 x g for 4 hours. Mitochondria were collected between the interface of 1.079 g/ml and 1.175 g/ml layers and diluted 1:5 with mitochondria isolation buffer and centrifuged at 14,000 x g for 10 minutes. Protein sample was prepared from the pellete and 30 µg of protein was loaded per lane for immunoblotting. All the centrifugation steps were done at 4º C and all solutions and buffers contained protease inhibitor cocktail (Roche). All primary and secondary antibodies used for immunoblotting are listed in Table 2.1 and Table 2.2.  2.10  Purification of nuclei Nuclei were purified from normal human skeletal muscle using iodixanol with  minor modifications as described71. Briefly, snap-frozen samples of muscle were  26  chopped well in homogenization medium (0.25 M sucrose, 25 mM KCl, 5 mM MgCl2, 20 mM Tricine-KOH, pH 7.8) and homogenized using loose-fitting Douncehomogenizer with 20 strokes on ice. The homogenate was centrifuged at 1000 x g for 10 minutes to prepare a crude nuclear pellet. The pellet was suspended in homogenization buffer and was mixed with equal volumes of 50% iodixanol in diluent medium (150 mM KCl, 30 mM MgCl2, 120 mM Tricine-KOH, pH 7.8). Then the sample was underlayered with 30% and 35% iodixanol (prepared by diluting 50% iodixanol in diluent medium with homogenization buffer) and was centrifuged as 12,000 x g for 2 hours with SW 41 Ti swinging-bucket rotor at 4º C. The purified nuclei were collected from the 30%-35% iodixanol interface and washed once with homogenization buffer. Protein sample was prepared from the nuclei and 30 µg of protein sample per lane was used for immunoblotting as described above. All the centrifugation steps were done at 4º C and all solutions and buffers contained protease inhibitor cocktail (Roche). All primary and secondary antibodies used for immunoblotting are listed in Table 2.1 and Table 2.2.  2.11  siRNA knockdown TDP1 was knocked down transiently by transfecting 8 x 104 cells with 100 nM  of pooled siRNAs (Dharmacon) in a 24-well plate using Lipofectamine 2000 (Invitrogen). Pooling was done using four different siRNA constructs and also a pool of non-targeting siRNAs was used as negative control for this experiment. Knockdown was confirmed by both immunoblotting and qRT-PCR. The sequences of the siRNAs and primers are listed in Table 2.3.  27  2.12  shRNA knockdown For stable knockdown of TDP1, 1-2 x104 cells were plated in each well of a 96-  well plate and cultured overnight (37º C, 5% CO2). The culture medium was replaced for 4 to 18 hours with serum-free culture medium, 3 µg/ml polybrene and lentivirus carrying the SMARTvector 2.0 shRNA (Dharmacon). The infection was carried out at three multiplicities of infection (the ratio of infectious agent) of 0.3, 1, 2 or 5. Stably infected cells were selected with 0.5 µg/ml puromycin, and ultimately the multiplicity of infection that gave the best knockdown was used for each cell line. A non-targeting control shRNA was also used as a negative control for this experiment. Knockdown of TDP1 was verified by immunoblotting and qRT-PCR. The sequences of the shRNAs and primers are listed in Table 2.3.  2.13  Camptothecin (CPT) sensitivity 5 x 103 cells were plated in each well of a 96-well plate and then incubated with  different concentrations of CPT (1 µM, 10 µM and 15 µM) in phenol red-free media with serum for 48 hours. Then the media was discarded and fresh phenol red-free media with  serum  containing  20%  of  5  mg/ml  3-(4,5-dimethylthiazol-2-yl)-2,5-  diphenyltetrazolium bromide (MTT) diluted in PBS was added to each well. MTT is a yellow tetrazole dye, which is reduced to purple formazan in living cells, allowing the measurement of viable cell number. After 3 hours incubation, the MTT solution was completely removed from each well and 100 µl of dimethyl sulfoxide (DMSO) were added to each well and then incubated for 30 minutes. All the incubations were done in an incubator at 37º C with 5% CO2 and humidified environment. Then the plate was  28  shaken gently for 5 minutes and the absorbance of each well was measured at 570 nm using VICTOR3V 1420 Multilabel counter. Means, standard deviations and p-values were calculated using Microsoft Excel.  2.14  Hematoxylin and eosin (H&E) staining The 10 µm cryosections of retina samples were air-dried, then fixed with cold  acetone at -20º C for 15 minutes and then, air-dried again. After that, the sections were rinsed with PBS and stained with Harris hematoxylin solution for 5 minutes. After washing with running water for 2 minutes, the sections were differentiated with 1% acid-alcohol (5 ml HCl (37%) in 495 ml 70% ethanol) for 30 seconds and again washed with tap water for 1 minute. Then the sections were blued with 0.2% ammonia water for 30 seconds and again washed with tap water for 1 minute. After a rinse with 95% ethanol they were counter-stained with eosin-phloxine B solution for 1 minute and then were dehydrated with ethanol gradient (95% to 100%), then with xylene and then were mounted with xylene-based mounting media (Cytoseal-60, Thermo Scientific). Later images were acquired using a Zeiss Axiovert 200 microscope, a Zeiss AxiocamHR camera, and the Zeiss Axiovision imaging system.  2.15  Terminal deoxynucleotidyl transferase deoxyuridine triphosphate (dUTP) nick end labeling (TUNEL) assay Terminal deoxynucleotidyl transferase deoxyuridine triphosphate (dUTP) nick  end labeling (TUNEL) assay was performed to detect apoptotic cells in murine retina using ApopTag Plus Peroxidase In Situ Apoptosis Detection kit (Millipore, S7101) with  29  manufacturer’s protocol. Briefly, 10 µm cryosections of murine retina were fixed with pre-cooled ethanol:acetic acid (2:1) solution at -20º C for 5 minutes and then treated with 0.5% Triton X-100 for 15 minutes to expose the DNA. Then endogenous peroxidases in the sections were inactivated with 3.0% peroxide solution and then the slides were treated with terminal deoxynucleotidyl transferase (TdT) enzyme with digoxigenin-conjugated nucleotides for 1 hour at 37º C in a humidified chamber to label DNA fragments. Then the sections were incubated with polyclonal ship antidigoxigenin antibody conjugated with peroxidase for 30 minutes at room temperature and then were incubated with 3,3´-diaminobenzidine (DAB) solution for 5 minutes. After counterstaining the nuclei, the slides were rehydrated serially with n-butanol and xylene and finally were mounted with xylene-based mounting media (Cytoseal-60, Thermo Scientific). Later images were acquired using a Zeiss Axiovert 200 microscope, a Zeiss AxiocamHR camera, and the Zeiss Axiovision imaging system.  2.16  Polymerase chain reaction (PCR) Total DNA from each retina was prepared using Gentra Puregene cell DNA  isolation kit (Qiagen). Mitochondrial DNA was amplified from 50 ng of total retinal DNA using REPLI-g Mitochondrial DNA kit (Qiagen) with manufacturer’s protocol and mouse mtCytB primers. Common deletion of mitochondrial DNA (mtDNA) was analyzed from the REPLI-g amplified samples using previously described method29,72. Briefly, deletion of 3,821 bp from mtDNA was previously reported to occur during oxidative stress or accumulated during the aging process29,72. This deletion region is flanked by a repetitive sequence. PCR was done to preferentially amplify this region  30  from the deleted mtDNA with HotStarTaq DNA polymerase and the condition was 1 cycle for denaturation at 95º C for 15 minutes, then 40 cycles of amplification (denaturation at 95º C for 30 seconds, annealing at 50º C for 30 seconds and amplification at 72º C for 1 minute) and finally 1 cycle for final amplification at 72º C for 10 minutes. Then the PCR products were loaded on 0.8% agarose gel, electrophoresed and visualized with ethidium bromide staining under ultra-violet light. A control PCR was also performed as an internal control by amplifying 354 bp of mtDNA, which resides from 645 bp to 999 bp of mtDNA72. This region is not flanked by a repetitive sequence and is commonly used as a control for quantitative purpose29. The primers are listed in Table 2.3. Location of the primers to analyzed mtDNA deletion and a model of mtDNA deletion are described in Appendix A. Finally the PCR products were digested with EcoRV restriction endonuclease (New England Biolabs) and also were sequenced for validity.  31  Table 2.1: List of primary antibodies used in experiments. Antibody (Source, Part number) Anti-TDP1  Host Rabbit  Clonality (Clone ID) Polyclonal  (Abcam, ab4166)  Application (Ratio) Immunofluorescence (1:100) Western blotting (1:1000) Immunohistochemistry (1:100)  Anti-TDP1  Rabbit  Polyclonal  (Lab generated)  Immunofluorescence (1:100) Western blotting (1:1000) Immunohistochemistry (1:100)  Anti-Tdp1  Guinea  (Lab generated)  pig  Anti-Tubulin (Sigma, T9026) Anti-GAPDH (Abcam, ab8245) Anti-Complex IV Subunit I (MitoSciences, MS404) Anti-Histone H2B (Millipore, 07-371) Anti-Tubulin (Developmental Studies Hybridoma Bank) Anti-Cytochrome C (BD Biosciences, 556432) Anti-S-opsin (Abcam, ab81017) Anti-Rhodopsin (Abcam, ab3267) Anti-8oxoG (Abcam, ab48508) Anti-Complex IV (Abcam, ab16056) Anti-PARP (Cell Signaling, 9542) Anti-Caspase-3 (Cell Signaling, 9662) Anti-β-actin (EMD, CP01-1EA)  Mouse Mouse Mouse Rabbit Mouse Mouse Rabbit Mouse Mouse  Polyclonal  Immunofluorescence (1:100) Western blotting (1:1000)  Monoclonal (DM1A) Monoclonal (6C5) Monoclonal (1D6E1A8) Polyclonal Monoclonal (E7) Monoclonal (6H2.B4) Polyclonal Monoclonal (RET-P1) Monoclonal (N45.1)  Immunofluorescence (1:400) Western blotting (1:5000) Western blotting (1:1000) Western blotting (1:1000) Western blotting (1:1000) Immunofluorescence (1:250) Immunofluorescence (1:20) Immunofluorescence (1:100) Immunofluorescence (1:20)  Rabbit  Polyclonal  Immunofluorescence (1:300)  Rabbit  Polyclonal  Western blotting (1:1000)  Rabbit  Polyclonal  Western blotting (1:1000)  Mouse  Monoclonal (JLA20)  Western blotting (1:5000)  32  Table 2.2: List of secondary antibodies used in experiments. Antibody (Source, Part number) Anti-rabbit IgG (SIGMA, A9919) Anti-mouse IgG (SIGMA, A9688) Anti-guinea pig IgG (SIGMA, A5062) Anti-mouse IgM (SIGMA, A9688) Anti-rabbit IgG (Molecular Probes, A-21429) Anti-rabbit IgG (Molecular Probes, A-11034) Anti-mouse IgG (Molecular Probes, A-21424) Anti-mouse IgG (Molecular Probes, A-11029) Anti-guinea pig IgG (Molecular Probes, A-11073)  Host Goat Goat Goat Goat  Conjugation  Application (Ratio)  Alkaline  Western blotting  phosphatase  (1:10000)  Alkaline  Western blotting  phosphatase  (1:10000)  Alkaline  Western blotting  phosphatase  (1:10000)  Alkaline  Western blotting  phosphatase  (1:10000)  Goat  Alexa 555  Goat  Alexa 488  Goat  Alexa 555  Goat  Alexa 488  Goat  Alexa 488  Immunofluorescence (1:500) Immunofluorescence (1:500) Immunofluorescence (1:500) Immunofluorescence (1:500) Immunofluorescence (1:500)  33  Table 2.3: List of oligonucleotide sequences used in experiments. qRT-PCR primers Name  Sequence (5´ to 3´)  TDP1-Forward  AGGCTAAGGCTCACCTCCAT  TDP1-Reverse  TTCCTGGAGTCTTGCTTTCC  GAPDH-Forward  TTAGCACCCCTGGCCAAGG  GAPDH-Reverse  CTTACTCCTTGGAGGCCATG  siRNA sequences Name  Sequence (5´ to 3´)  siRNA 1  GGAGUUAAGCCAAAGUAUA  siRNA 2  UCAGUUACUUGAUGGCUUA  siRNA 3  GACCAUAUCUAGUAGUGAU  siRNA 4  CUAGACAGUUUCAAAGUGA  Control siRNA pool  UGGUUUACAUGUCGACUAA, UGGUUUACAUGUUGUGUGA, UGGUUUACAUGUUUUCUGA, UGGUUUACAUGUUUUCCUA  shRNA sequences Name  Sequence (5´ to 3´)  shRNA 1  GTATGGAAGTAAAGATCGG  shRNA 2  TCAAAGCACCGGATACGCA  shRNA 3  TTGGAACACACCACACGAA  Control  GTGTGAACCATGAGAAGTA  Primers for mouse genotyping Name  Sequence (5´ to 3´)  Tdp1-General-Forward  AAGGTCCAAGGTGTGTTTGG  Tdp1-WT-Reverse  AGGTCTCACAGAGGGGATGA  Tdp1-Mutant-Reverse  CCACAACGGGTTCTTCTGTT  Primers for mtDNA analysis Name  Sequence (5´ to 3´)  mtDNA-del-Forward  TAAGTCGTAACAAGGTAAGC  mtDNA-del-Reverse  GATGGTGGTAGGAGTCAAAA  mtDNA-control-Forward  TGCTTACCTTGTTACGACTTA  mtDNA-control-Reverse  CGCTCTACCTCACCATCTCTT  Mouse-mtCytB-Forward  ACAGCATTTATAGGCTACGTCCTTCC  Mouse-mtCytB-Reverse  TAGGTCAATGAATGAGTGGTTAATA  34  Chapter 3. TDP1 as a potential anti-cancer target  3.1  TDP1 expression in tumor tissue microarray (TMA) 3.1.1 Pediatric tumor TMA Increased expression of TDP1 has been reported in non-small cell lung  carcinoma64. However, this has not been investigated in other neoplasms, including pediatric cancers. Thus, to determine if TDP1 is highly expressed in pediatric solid tumors, immunohistochemical screening of a pediatric tumor tissue microarray (TMA) was performed with both commercial anti-TDP1 antibody and lab-generated previously published anti-TDP1 antibody. The later antibody is highly specific for TDP1 and can be blocked by TDP1 peptide. The pediatric TMA was assembled with samples from British Columbia Children’s hospital and consists of 24 embryonal rhabdomyosarcoma (eRMS),  18  alveolar  rhabdomyosarcoma  (aRMS),  12  ganglioneuroma,  23  neuroblastoma, 10 Ewing’s sarcoma, 9 medulloblastoma, 8 fibromatosis and 24 Wilm’s tumor readable tissue cores. Three independent scores for TDP1 expression on this TMA showed that 47% of eRMS, 15.48% of aRMS, 10.7% of ganglioneuroma, 10.23% of Ewing’s sarcoma, 5.83% of neuroblastoma and 5% of fibromatosis tumors were TDP1 positive. Interestingly, cytoplasmic expression of TDP1 was observed in all TDP1 positive rhabdomyosarcomas, ganglioneuromas and neuroblastomas, along with the nuclear expression of TDP1. Cytoplasmic staining of TDP1 was punctate in all cases. However, all the Wilm’s tumor and medulloblastoma tumors of the TMA were TDP1 negative (Figure 3.1). In general, TDP1 expression was highest in rhabdomyosarcomas (RMSs). To confirm this expression in RMS tumors, another  35  rhabdomyosarcoma (RMS) TMA from the Children’s Oncology Group consisting of 34 eRMS and 39 aRMS tumors was also stained by immunohistochemical techniques and scored. It was observed that TDP1 was expressed in 97% and 100% of the tumors, respectively (Figure 3.2). Though most of these tumors expressed TDP1 in the cytoplasm, however TDP1 was expressed predominantly in the nucleus of some cells of aRMS and eRMS.  3.1.2 Adult tumor TMA Besides the pediatric tumors, TDP1 expression was also analyzed in adult cancers by immunohistochemical staining of a tumor tissue microarray. Three different sets of common tumor TMAs were purchased from Imgenex Corp. and stained for TDP1 expression. Later the slides were scored for TDP1 expression by three independent viewers. These TMAs consisted of 10 readable cores for ovarian, uterine, liver, breast, thyroid, pancreatic, stomach, lung, larynx, colon, esophageal, cervical, gall bladder and urinary bladder cancer and also malignant lymphoma. The TMAs also included 9 readable cores for malignant melanoma, prostate and renal cancer. TDP1 was expressed in all types of tumors in the TMAs and 50-100% cores of each tumor type was TDP1 positive. TDP1 was expressed both in the nucleus and in the cytoplasm, with punctate staining in the cytoplasm. All ovarian, uterine and malignant melanoma tumors in the TMAs were TDP1 positive, whereas 90% of malignant lymphoma, hepatic, breast and thyroid cancer and about 89% of the prostate cancer cores were TDP1 positive (Figure 3.3). A representative photograph of a stained sample of each type of cancer is given in Figure 3.3.  36  3.2  TDP1 expression in rhabdomyosarcoma (RMS) cell lines 3.2.1 TDP1 expression in normal human skeletal muscle TDP1 expression was also analyzed in normal human skeletal muscle. As RMSs  are malignant tumors of muscles attached to bone73, normal human skeletal muscle was used as a positive control. Immunohistochemical staining of TDP1 in this tissue suggested that TDP1 was exclusively expressed in the cytoplasm of skeletal muscle cells and absent from the nucleus. Interestingly, a closer look at the cytoplasmic TDP1 in skeletal muscle showed that the cytoplasmic TDP1 was located along the Z-line of muscle fibers (Figure 3.4) where mitochondria are located74. To understand the subcellular localization of TDP1 in this tissue, immunofluorescence microscopy was performed. Similar to the immunohistochemical findings, immunofluorescence staining also showed that TDP1 was, in fact, absent in the nuclei of normal skeletal muscle cells but was expressed in the cytoplasm. Furthermore, the cytoplasmic TDP1 co-localized with mitochondria. To confirm this, mitochondrial and nuclear sub-cellular fractions were purified from normal skeletal muscle by density-gradient ultracentrifugation, and immunoblotted for TDP1. Complex IV subunit I, tubulin and histone H2B were used as a markers for the mitochondria, cytosol and nucleus respectively. Immunoblotting suggested the fractions were pure and that TDP1 was expressed in mitochondria but not in the nucleus (Figure 3.4).  3.2.2 TDP1 expression in aRMS and eRMS cells To further validate TDP1 expression in RMS further, TDP1 expression was analyzed in different RMS cell lines. There are two distinct clinical presentations of  37  RMS, alveolar RMS (aRMS) and the embryonal RMS (eRMS)75. Therefore, both aRMS and eRMS cell lines were analyzed. aRMS is often associated with characteristic chromosomal translocation resulting in fusion proteins76-78. Two common types of such fusion proteins are PAX3-FKHR and PAX7-FKHR. In this study, three aRMS cell lines (Rh30 [PAX3-FKHR]77, CW9019 [PAX7-FKHR]78 and Rh18) as well as three eRMS cell lines (A204, Birch and RD) were used. Immunofluorescence microscopy suggested that all of these cell lines predominantly express TDP1 in the nucleus, with much less TDP1 detected in the cytoplasm. This was especially pronounced in the Rh30 and Rh18 cell lines those expressed even less cytoplasmic TDP1 than the other cell lines (Figure 3.5). Later, TDP1 expression was quantitatively analyzed in these cell lines by qRTPCR and immunoblotting. When compared with normal skeletal muscle, these cell lines showed 25-200 fold increased expression of TDP1 with Rh30 cells expressing the most, followed by CW9019, Rh18, Birch, A204 and RD cells (Figure 3.5). Thus, aRMS cell lines expressed higher levels of TDP1 than eRMS cell lines. This result was consistent with the immunoblot results and immunofluorescence microscopy (Figure 3.5).  3.2.3 Mitochondrial localization of TDP1 in RMS cells The above observations suggested that all the RMS cell lines express TDP1, more or less, in the cytoplasm. To investigate the role of cytoplasmic TDP1, immunofluorescence microscopy was performed. Mitochondria were stained with MitoTrackerTM. Immunofluorescence microscopy showed that TDP1 co-localized with mitochondria in all eRMS cell lines but not in aRMS cell lines (Figure 3.6). To further  38  validate these results, mitochondria were purified by sub-cellular fractionation from these cell lines. When immunoblotting was performed with the purified mitochondrial fractions of these cell lines, it showed that all the eRMS cell lines expressed TDP1 in the mitochondria (Figure 3.6). The A204 cell line had relatively higher mitochondrial TDP1 followed by the Birch and RD cell lines. None of the aRMS cell lines showed expression of mitochondrial TDP1 (Figure 3.6).  3.3  TDP1 inhibition and camptothecin (CPT) sensitivity in RMS cell lines 3.3.1 CPT sensitivity of RMS cell lines Camptothecin (CPT) forms a stable Topo I-CPT-DNA covalent complex and  thus traps Topo I on the DNA79, and TDP1 functions to remove trapped Topo I from the DNA80. Thereby, increased expression of TDP1 in tumors might reduce the efficacy of the drug to stabilize Topo I with DNA, possibly granting resistance to CPT. To validate this, the RMS cell lines were treated with different concentrations (0, 1, 10 and 15 µM) of CPT for 48 hours and their sensitivity to CPT was assessed by measuring cell viability using MTT assay. Interestingly, it was observed that the cells that expressed higher amounts of TDP1 were more sensitive to CPT. The most sensitive cell lines were CW9019, Rh30 and Rh18, whereas the least sensitive cells were A204, Birch and RD. Thus, the eRMS cell lines showed relative resistance to CPT compared to the aRMS cell lines (Figure 3.7). Since all the eRMS cell lines expressed TDP1 in the mitochondria, I postulated that mitochondrial expression of TDP1 conveys resistance to CPT since CPT sensitivity of the RMS cell lines inversely correlated with the level of TDP1 in the mitochondria. Consistent with this, A204 and Birch cells,  39  those expressed TDP1 in mitochondria at relatively higher levels than the other cell lines and were most resistant to CPT among the cell lines, followed by the RD cell line. All the aRMS cell lines showed almost the same sensitivity to CPT.  3.3.2 Effect of siRNA knockdown of TDP1 Though the expression of TDP1 was higher in all the RMS cell lines, it was important to study whether this elevated expression of TDP1 is necessary for the survival of these cell lines or not. In order to answer this question, the siRNA-mediated transient knockdown of TDP1 was carried out in normal human dermal fibroblasts, two aRMS cell lines (Rh30 and CW9019) and two eRMS cell lines (A204 and Birch). The human dermal fibroblast cell line was used as a normal control cell line. When TDP1 was knocked-down in fibroblasts, there was neither an effect on their growth nor was there increased apoptosis (Figure 3.8). However, when TDP1 was knocked down in aRMS (Figure 3.9) and eRMS (Figure 3.10) cell lines, there was a significant reduction in cell proliferation, as measured by MTT assay, compared to the non-targeting control siRNA knockdown cells for each cell lines. However, no increased apoptosis was detected as a consequence of TDP1 knockdown as measured by immunoblotting for cleaved PARP (Figure 3.9 and Figure 3.10). These observations suggested that loss of TDP1 might result in reduced cell proliferation in all of the RMS cell lines.  3.3.3 Effect of shRNA knockdown of TDP1 To investigate whether TDP1 inhibitor could be used in combination with CPT, TDP1 was stably knocked-down in the RMS cell lines by shRNA and their CPT-  40  sensitivity was compared with the non-targeting control shRNA knock down cells for each cell lines. The human dermal fibroblast cell line was used as a normal cell line for this experiment. When TDP1 was stably knocked-down in these fibroblasts, there was no significant reduction in cell proliferation (Figure 3.11). Immunoblotting with nonspecific control knockdown and TDP1 knockdown cell extracts also showed no increased apoptosis (Figure 3.11). Also, none of the aRMS (Figure 3.12) and eRMS (except Birch) (Figure 3.13) cell lines showed significant differences in cell proliferation and apoptosis between non-targeting control knockdown and TDP1 knockdown. Interestingly, during the generation of these TDP1 shRNA knockdown RMS cell lines but not the human fibroblast cell lines, very few cells survived to form viable colonies. This observation suggested that the confirmed constitutive knockdown of TDP1 might have a synthetic lethal effect on some cells even though the surviving cells had growth and viability rates comparable to the parent cell lines. There was no significant difference in CPT sensitivity between these control and TDP1 knockdown cells (Figure 3.14). These observations suggested that constitutive knockdown of TDP1 probably resulted in selective proliferation of cells that do not require TDP1 for their growth and survival or perhaps accumulated mutations enabling bypass of the effect(s) of TDP1 shRNA knockdown.  41  Figure 3.1: TDP1 expression in different pediatric tumors. Immunohistochemical staining of TDP1 in pediatric TMA consisting of samples from BC Children’s hospital showed prominent expression of TDP1 in alveolar (A) and embryonal (B) rhabdomyosarcoma. However, some ganglioneuroma (C), Ewing’s sarcoma (D), neuroblastoma (E) and fibromatosis (F) samples were also TDP1 positive. No expression was detected in medulloblastoma (G) and Wilm’s tumor samples (H). (I) Frequency of TDP1 positive pediatric tumors. The solid arrows show nuclear location and the open arrows show cytoplasmic location of TDP1. Scale bar = 20 µm.  42  Figure 3.2: TDP1 expression in rhabdomyosarcoma tumors. Immunohistochemical staining of TDP1 expression in alveolar (A) and embryonal (B) rhabdomyosarcoma tumor tissue microarrays obtained from Children’s Oncology Group (COG). Almost all the samples in these TMAs were TDP1 positive (C). Note that TDP1 was enriched in the nuclei of these samples. Scale bar = 20 µm.  43  Figure 3.3: Expression of TDP1 in adult tumors. Immunohistochemical staining of TDP1 expression in breast (A), ovarian (B), prostate (C), colon (D), hepatic (E), lung (F), malignant lymphoma (G), malignant melanoma (H), pancreatic (I), uterine (J), esophageal (K), gall bladder (L), renal (M), laryngeal (N), stomach (O), thyroid (P), urinary bladder (Q) and in cervical (R) cancers. (S) Frequency of TDP1 positive tumors in the adult TMA. Note the cytoplasmic and nuclear expression of TDP1 in different adult tumors. TDP1 was enriched in nucleus of these samples. Arrow shows nuclear location and open arrow shows cytoplasmic location of TDP1. Scale bar = 20 µm.  44  Figure  3.4:  Expression  of  TDP1  in  normal  human  skeletal  muscle.  Immunohistochemical staining of TDP1 expression in the cytoplasm of normal human skeletal muscle (A). Cytoplasmic TDP1 seemed to be aligned with Z-line of muscle fibers, where mitochondria are located (B). Immunofluorescence microscopy on frozen muscle section showed that cytoplasmic TDP1 co-localized with mitochondria (C) and absence of nuclear expression (D). Cytochrome C was used as mitochondrial marker (C and D). Inset image shows magnified view of the box and circle with arrow indicates the location of cut view of Z-stack, as shown in the right panel (C). Arrows indicate nuclear locations (D). Immunoblotting of purified mitochondrial and nuclear fractions confirmed that TDP1 was expressed in the mitochondria but not in the nuclei (E). Tubulin, complex IV subunit I and histone H2B were used as markers for cytoplasm, mitochondria and nucleus respectively (E). Whole tissue lysate was used as positive control. Scale bar = 10 µm.  45  Figure 3.5: Expression of TDP1 in RMS cells. Immunofluorescence microscopy showed both cytoplasmic and nuclear expression of TDP1 in eRMS (A204, Birch and RD) and aRMS (Rh30, Rh18 and CW9019) cell lines. Tubulin was used as a cytoplasmic marker (A). eRMS cell lines showed relatively more cytoplasmic TDP1 than aRMS cell lines. qRT-PCR showed increased expression of TDP1 in all of these cell lines compared to normal skeletal muscle (B), with Rh30 expressing 250 fold higher than normal muscle. Immunoblotting with whole cell lysate was consistent with the qRT-PCR and immunofluorescence data (C). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an endogenous control (B) or loading control (C). Scale bar = 10 µm.  46  Figure 3.6: Mitochondrial localization of TDP1 in RMS cells. Immunofluorescence microscopy showed that cytoplasmic TDP1 co-localized with the mitochondria of eRMS cell lines (A204, Birch and RD) only. Though all the aRMS cell lines (Rh30, Rh18 and CW9019) expressed cytoplasmic TDP1, the cytoplasmic TDP1 was not colocalized with mitochondria. MitotrackerTM was used to track mitochondria. Circle with arrow indicates the location of cut view of Z-stack, as shown in the right panel. Scale bar = 10 µm (A). Immunoblotting with the purified mitochondrial fraction confirmed TDP1 localization in the eRMS cell lines with A204 cells expression highest amount of mitochondrial TDP1 followed by Birch and RD (B). Tubulin, complex IV subunit I and histone H2B were used as markers for cytoplasm, mitochondria and nucleus respectively. Whole cell lysate was used as positive control. 47  Figure 3.7: Camptothecin (CPT) sensitivity of RMS cell lines. CPT was applied in different concentrations as mentioned for 48 hours and the growth of each cell line was measured by MTT assay. eRMS cell lines (A204, Birch and RD) were more resistant to CPT compared to aRMS cell lines (Rh30, Rh48 and CW9019). Cell lines having higher expression of TDP1 in the mitochondria (A204 and Birch) were the most resistant. Overall, CPT sensitivity of these cell lines was inversely correlated with total amount of TDP1 but proportional to the amount of mitochondrial TDP1.  48  Figure 3.8: siRNA knockdown of TDP1 in human fibroblast cells. TDP1 mRNA was transiently knocked down by siRNA in human dermal fibroblasts. The knockdown efficiency was 65%-80% over 96 hours as verified by qRT-PCR, relative to 24 hours control (non-targeting) knockdown (a). No significant change in cell viability, as measured by MTT assay, was observed between control (non-targeting) knockdown and TDP1 knockdown in this cell line (b). Immunoblotting of whole cell extracts from different time points showed consistent knockdown of TDP1 and there was no increased apoptosis in TDP1 knockdown cells (c). RQ = relative quantitation. GAPDH was used as an endogenous control. PARP was used as a marker for apoptosis. β-actin was used as loading control. All the experiments were done three times independently.  49  Figure 3.9: siRNA knockdown of TDP1 in aRMS cell lines. TDP1 mRNA was transiently knocked down by siRNA in Rh30 (a-c) and CW9019 (d-f) cell lines. The knockdown efficiency was about 50%-90% at 96 hours in these cells as verified by qRT-PCR, relative to 24 hours control (non-targeting) knockdown (a and d). There was a significant reduction in cell viability, as measured by MTT assay, between the control (non-targeting) knockdown and TDP1 knockdown in these cell lines (b and e). Immunoblotting of whole cell extracts from different time points showed consistent knockdown of TDP1 and there was no increased apoptosis in TDP1 knockdown cells (c and f). RQ = relative quantitation. GAPDH was used as an endogenous control. PARP was used as a marker for apoptosis. β-actin was used as a loading control. All the experiments were done three times independently. * p-value < 0.05; ** p-value < 0.01.  50  Figure 3.10: siRNA knockdown of TDP1 in eRMS cell lines. TDP1 mRNA was transiently knocked down by siRNA in A204 (a-c) and Birch (d-f) cell lines. The knockdown efficiency was about 70%-87% after 96 hours in these cell lines as verified by qRT-PCR, relative to 24 hours control (non-targeting) knockdown (a and d). There was a significant reduction in cell viability, as measured by MTT assay, between the control (non-targeting) knockdown and TDP1 knockdown in these cell lines (b and e). Immunoblotting of whole cell extracts from different time points showed consistent knockdown of TDP1 and there was no increased apoptosis in TDP1 knockdown cells (c and f). RQ = relative quantitation. GAPDH was used as an endogenous control. PARP was used as a marker for apoptosis. β-actin was used as loading control. All the experiments were done three times independently. * p-value < 0.05; ** p-value < 0.01.  51  Figure 3.11: shRNA knockdown of TDP1 in human fibroblast cells. TDP1 mRNA was stably knocked down by shRNA in human fibroblast cell lines. The knockdown efficiency was about 85% in these cell lines as verified by immunoblot and qRT-PCR (a and b), relative to control (non-targeting) knockdown. Immunoblotting of whole cell extracts from these cell lines showed similar rate of apoptosis. PARP and Caspase-3 were used as markers for apoptosis. GAPDH was used as loading control (a) or endogenous control (b). Growth of both control knockdown and TDP1 knockdown cells were similar, as measured by MTT assay (c). All the experiments were done three times independently. RQ = relative quantitation.  52  Figure 3.12: shRNA knockdown of TDP1 in aRMS cell lines. TDP1 mRNA was stably knocked down by shRNA in Rh30 (a-c) and CW9019 (d-f) cell lines. The knockdown efficiency was about 75%-90% in these cell lines as verified by immunoblot (a and d) and qRT-PCR (b and e), relative to control (non-targeting) knockdown. Growth of both control knockdown and TDP1 knockdown cells was similar (c and f) for both of the cell lines, as measured by MTT assay. Immunoblotting of whole cell extracts from these cell lines showed similar rate of apoptosis (a and d). PARP and Caspase-3 were used as markers for apoptosis. GAPDH was used as loading control (a and d) or endogenous control (b and e). All the experiments were done three times independently. * p-value < 0.05. RQ = relative quantitation.  53  Figure 3.13: shRNA knockdown of TDP1 in eRMS cell lines. TDP1 mRNA was stably knocked down by shRNA in A204 (a-c) and Birch (d-f) cell lines. The knockdown efficiency was about 55%-90% in these cell lines as verified by immunoblot (a and d) and qRT-PCR (b and e), relative to control (non-targeting) knockdown. Growth of both control knockdown and TDP1 knockdown cells were similar for A204 cell line (c) but was reduced in Birch cell lines (f), as measured by MTT assay. Immunoblotting of whole cell extracts from these cell lines showed similar rate of apoptosis (a and d). PARP and Caspase-3 were used as markers for apoptosis. GAPDH was used as loading control (a and d) or endogenous control (b and e). All the experiments were done three times independently. * p-value < 0.05; ** p-value < 0.01. RQ = relative quantitation.  54  Figure 3.14: CPT sensitivity of RMS cell lines with TDP1-shRNA knockdown. Both the control-shRNA knockdown and TDP1-shRNA knockdown of human fibroblast (a), Rh30 (b), CW9019 (c), A204 (d) and Birch (e) cell lines were analyzed for CPT sensitivity at different lower doses, as measured by MTT assay. Stable knockdown of TDP1 did not improve the CPT sensitivity compared to control knockdown for each cell lines. All the experiments were done three times independently. These results indicated that these stable knockdown cell lines might be bypassing the loss of TDP1 by gaining function in CPT-mediated DNA damage repair.  55  Chapter 4. TDP1 as a mitochondrial DNA repair enzyme  4.1  TDP1 expression in human tissues TDP1 expression in various human tissues was analyzed in autopsy samples by  immunohistochemistry. Expression of TDP1 was observed both in the nucleus and in the cytoplasm of most tissues. Interestingly and consistent with previous publications39, TDP1 was exclusively expressed in the cytoplasm but not in the nucleus of the neurons hypothesized to be affected in SCAN1. These neurons include Purkinje cells in the cerebellum, dentate nucleus and dorsal horn cells39. Also, TDP1 was expressed mostly in the cytoplasm of the tissues where oxidative stress is relatively higher81, as for example in skeletal muscle, neurons, Purkinje fibers, adrenal gland, mucosa of small and large intestine, liver, oocytes, spleen, kidney and adipose tissues. Overall, TDP1 is ubiquitously expressed except for the epicardium of the heart and endothelium or intima of blood vessels. Figure 4.1 shows representative photograph of TDP1 expression in different tissues. Also, TDP1 expression in different tissues is listed in Table 4.1. A full list of TDP1 expression in different human tissues is shown in Appendix B. Representative figures of TDP1 expression in different human systems are given in Appendix C. To understand why TDP1 is enriched in the cytoplasm of those tissues where oxidative stress is higher, human fibroblast cells were treated with two different oxidants (200nM H2O2 and 12 µM menadione sodium bisulfite) for 24 hours and TDP1 expression and sub-cellular localization was compared with that in untreated cells. Interestingly, such oxidative stresses had little effect on overall TDP1 expression but  56  TDP1 shifted to the mitochondria during stress (Figure 4.2). Overall TDP1 was enriched in the cytoplasm as observed by immunofluorescence microscopy and moved to mitochondria during oxidative stress.  4.2  Murine retina as a model for TDP1 mitochondrial function 4.2.1 TDP1 expression in human retina As TDP1 was mostly expressed in the cytoplasm of the tissues where oxidative  stress is higher, the retina was selected as a model. The reasons for using retina were: 1) oxidative stress is high due to exposure to light and 2) oxidative stress can be controlled by reducing or increasing light exposure. Thereby, the retina could be a model to study the function of TDP1 in mitochondria. To investigate the expression and sub-cellular localization of TDP1 in human retina, frozen sections were stained for TDP1 by immunofluorescence method (Figure 4.3). In human retina, expression of TDP1 was observed mostly in the nucleus and very little TDP1 was detected in the cytoplasm. However, TDP1 co-localized with mitochondria in layers of rods and cones. Preimmune serum was used for non-specific staining. Overall, TDP1 expression is not predominantly in the cytoplasm of retina, and SCAN1 patients do not develop retinal degeneration or visual problems. Thus, exclusive expression of TDP1 in the cytoplasm of neurons affected in SCAN1 might be the basis of the disease.  4.2.2 TDP1 expression in murine retina To investigate the mitochondrial function of TDP1 in animal model, TDP1 expression in murine retinal sections was studied by immunofluorescence microscopy.  57  Interestingly in mice, murine TDP1 (Tdp1) was expressed predominantly in the cytoplasm of the outer nuclear layer or in the layer of rods and cones (Figure 4.4). Cytoplasmic Tdp1 was co-localized with the mitochondria in the layer of rods, but Tdp1 was expressed both in the mitochondria and in the nucleus of the inner nuclear layer and in the ganglion cell layer. Thus the rod and cone neurons in mouse retina mimicked the degenerative neurons in SCAN1 in terms of Tdp1 expression. To understand whether Tdp1 expression in the mitochondria correlated or not with oxidative stress, wild type mice were kept in dark for 24 hours and Tdp1 localization was examined in the retina (Figure 4.5). It was observed that Tdp1 still remained in the mitochondria of layers of rods and cones even when light-induced oxidative stress is minimized. Thereby, it was hypothesized that oxidative stress from cellular metabolism might be sufficient for Tdp1 localization to the mitochondria of rods and cones.  4.3  Retinal pathology associated with Tdp1 deficiency 4.3.1 Retinal morphology of Tdp1+/+ and Tdp1-/- mice Previously, three different groups knocked-out Tdp1 in mouse and observed  neither an ataxic phenotype typical of SCAN1 nor neuronal degeneration39,57,58. It was previously observed that Tdp1 expression is different between human and mouse, at least for those neurons affected in SCAN139. For those neurons, TDP1 expression is exclusive to the cytoplasm in human but is present in both nucleus and cytoplasm in mouse for an unknown reason39. Such difference in sub-cellular localization of TDP1 might be a reason for the absence of an ataxic phenotype in mouse. To understand the mitochondrial function of Tdp1 in vivo requires a tissue in mouse where Tdp1  58  expression is exclusive to cytoplasm. Thus, observing exclusive cytoplasmic or mitochondrial expression of Tdp1 in retinal layer of rods and cones, these neurons could be used as a model to mimic those human neurons to study the mitochondrial basis of SCAN1. To investigate the importance of mitochondrial expression of TDP1, retina of Tdp1+/+ and Tdp1-/- mice were observed at different stages for a degenerative phenotype (Figure 4.6). At postnatal day 1 (P1) and at postnatal day 8 (P8), there was no difference in retinal morphology between Tdp1+/+ and Tdp1-/- mice. But at postnatal day 11 (P11), retinal degeneration was observed in Tdp1-/- mice. The retinal outer nuclear layer of Tdp1-/- mice, containing the nuclei of rod and cone neurons, was almost absent compared to Tdp1+/+ mice at postnatal day 14 (P14). At postnatal day 30 (P30), the retinal outer nuclear layer in the Tdp1-/- mice was completely absent. Overall, a clear, early onset of severe degeneration in the photoreceptor layer of the retina was observed in Tdp1-/- mice after postnatal day 8.  4.3.2 Molecular analysis of retinal degeneration in Tdp1-/- mice To understand the molecular basis of the retinal degeneration in Tdp1-/- mice, frozen sections of retina from both Tdp1+/+ and Tdp1-/- mice at different ages were analyzed by immunofluorescence microscopy and immunohistochemical methods. To answer whether the degeneration is cell specific or not, retina were stained for rhodopsin and s-opsin to detect rod and cone cells, respectively (Figure 4.7). Rhodopsin is a commonly used marker for rod cells and enables vision in dim light82. There are three different cone cells in retina and all work for vision in bright light82. These cells are S, M and L cones expressing different opsins, s-opsin, m-opsin and l-opsin,  59  respectively82. S cones are randomly placed in retina and usually less in number compared to M cones and L cones82. However, s-opsin or short wavelength sensitive opsin is a specific and commonly used marker for cones82. When the retina of Tdp1+/+ and Tdp1-/- mice were stained for these markers, it was observed that both rod and cone cells were present in P8, P11 and P14 stages of both genotypes. Thus, both rods and cones developed in Tdp1-/- retina, indicating that the retinal pathology was not a developmental disorder but more likely a degenerative disorder. To understand the basis of cell death in the photoreceptor layers, terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay was performed on both Tdp1+/+ and Tdp1-/- retinal sections to detect apoptotic cells. The TUNEL assay is a widely used method to detect fragmented DNA of late-apoptotic and necrotic cells83. TUNEL+ cells were clearly observed in the retinal outer nuclear layer of Tdp1-/mice at P11 and P14 (Figure 4.8). No TUNEL+ cells were detected in P8 stage of Tdp1/-  mice and P8, P11 and P14 stages of Tdp1+/+ mice. This observation suggested that the  pathology in the outer nuclear layer was cell death. Overall, the results suggested that both rod and cone neurons were affected in Tdp1-/- mice. However, it was still not clear why cell death took place.  4.4  Retinal mitochondrial function with Tdp1 deficiency 4.4.1 Level of 8-oxoguanine in retina Previously, it was reported that Tdp1 is expressed in the mitochondria of murine  embryonic fibroblast (MEF) cells and loss of Tdp1 resulted in mtDNA damage during oxidative stress61. As retina is very prone to light induced oxidative stress, it was next  60  investigated whether there was an increase in oxidative stress in Tdp1-/- retina. This could provide a basis for apoptosis as observed in Tdp1-/- retina. One commonly used method to detect oxidative stress is to analyze the level of 8-oxo-7,8-dihydroguanine (8-oxo-G or 8-oxoguanine), as during oxidative stress, guanine in the DNA is oxidized to 8-oxoguanine84. Thus, this assay would help to detect the DNA damage during oxidative stress in the retina. Thereby, the level of 8-oxoguanine was determined in retinal samples of Tdp1+/+ and Tdp1-/- mice by immunofluorescence microscopy. Interestingly, there was an increased level of 8-oxoguanine in the mitochondria but not in the nucleus of Tdp1-/- mice at P11 and P14 when compared to Tdp1+/+ mice (Figure 4.9). However, no 8-oxoguanine was detected at P8 in both Tdp1+/+ and Tdp1-/- retina. This observation indicated increased mtDNA damage of retinal mitochondria in the absence of Tdp1. To understand whether light-induced oxidative stress was a factor for such phenotype, both Tdp1+/+ and Tdp1-/- mice were raised in the dark and retinal samples were analyzed (Figure 4.10). It was observed that retinal degeneration, cell death in the outer nuclear layer and an increased level of 8-oxoguanine were still present in Tdp1-/- mice compared to wild type mice, even though they were raised in the dark. These observations indicated that internal oxidative stress from metabolism might be sufficient to provoke mtDNA damage in retina when Tdp1 was absent. Thus, increased mtDNA damage in the outer nuclear layer of Tdp1-/- mice retina at postnatal day 11 could induce cell death. Interestingly, it has been reported that mitotic cell division in the outer nuclear layer of the retina slows down after postnatal day 8 in wild type mice85. Thus, induced cell death in the outer nuclear layer might result in retinal degeneration after postnatal day 8. Overall, the loss of Tdp1 resulted in increased  61  mtDNA damage that could ultimately kill the cell by apoptosis and hence retinal degeneration was observed. However, increased level of 8-oxoguanine could occur from either failure to remove 8-oxoguanine or due to increased oxidative stress or a combination of both.  4.4.2  Mitochondrial DNA damage in retina Mitochondrial DNA undergoes a common deletion of 3821 bp (1114-4934 in  mtDNA) in ageing mice72. This deletion, also known as D-17 deletion, in mtDNA results from a recombination during oxidative stress between two repeat sequences of 10 bp flanking the deletion region (1094-1113 and 4915-4934 in mtDNA, Appendix A). Thereby, retinal DNA samples from Tdp1+/+ and Tdp1-/- mice were analyzed for this deletion. Interestingly, no D-17 deletion was observed at postnatal day 8 or postnatal day 11 for both Tdp1+/+ and Tdp1-/- mice. However, the deletion was detected and verified in retinal DNA samples of postnatal day 14 from Tdp1-/- mice but not from Tdp1+/+ mice (Figure 4.11). This observation indicated that the deletion did not occur during the beginning of the retinal degeneration (at postnatal day 11). As the level of 8oxoguanine was detected from P11 in Tdp1-/- mice, it might take three more days for sufficient recombination so that the deletion is enriched in the mitochondria. However, these observations, along with the observations as described in 4.4.1, suggested a higher oxidative damage in retinal mtDNA of Tdp1-/- mice leading to mitochondrial DNA deletion.  62  Table 4.1: Expression of TDP1 in different human tissues as observed by immunohistochemical staining on autopsy samples. +++: Highly expressed; ++: Moderately expressed; +: Weakly expressed; -: Not expressed. System and Tissue  Expression Level Cytoplasmic  Nuclear  Both  Cerebellum  ++  +  ++  Spinal cord  ++  ++  ++  Midbrain neurons  +++  -  -  Pons neurons  +++  -  -  Frontal lobe  +  +++  ++  +++  +  -  +  -  -  Thyroid  +++  +  +  Parathyroid  ++  +  ++  Pancreatic islets  +  ++  ++  Adrenal cortex  ++  ++  ++  Adrenal medulla  +++  ++  +++  Trachea & bronchia  ++  ++  ++  Alveoli  ++  +  +  Esophagus  ++  ++  ++  Stomach  ++  ++  ++  Small intestine  ++  ++  ++  Large intestine  +++  ++  ++  Liver  ++  +  ++  Gall bladder  ++  ++  ++  Brain and CNS  Cardiovascular Heart Blood vessels Endocrine (not gonads)  Pulmonary  Gastrointestinal  63  System and Tissue  Expression Level Cytoplasmic  Nuclear  Both  +  ++  ++  Testes  ++  ++  ++  Prostate  +  ++  +  Ovary  +++  +  +++  Kidney  ++  +  ++  Bladder  ++  +  +  Spleen  +++  +  +++  Thymus  ++  +  ++  Lymph node  ++  +  ++  Peyer’s patch  ++  +  ++  Bone marrow  -  +  -  Endochondral bone  ++  ++  ++  Hyaline cartilage  +++  +++  +++  Tendon/connective  ++  ++  ++  ++  -  -  ++  ++  ++  Exocrine pancreas Genitourinary  Blood & Immune  Musculoskeletal  tissue Skeletal muscle Adipose tissue  64  Figure 4.1: Representative figure of TDP1 expression in different human tissues. TDP1  expression  was  observed  in  different  human  autopsy  samples  by  immunohistochemical staining (A). Specific staining with the anti-TDP1 primary antibody was verified by staining with pre-immune serum from the same antibodyproducing rabbit (B). Scale bar = 20 µm. Name of the tissue or cell type is given on top of each picture. 65  Figure 4.2: Co-localization of TDP1 with mitochondria during oxidative stress. Fibroblast cells were treated with two different oxidants (menadione sodium bisulfite (MSBS) and hydrogen peroxide) at the indicated concentrations for 24 hours. The expression of TDP1 was analyzed by immunofluorescence microscopy (A), qRT-PCR (B) and immunoblotting (C). During oxidative stress, TDP1 was co-localized with the mitochondria. Cytochrome C was used as a marker for mitochondria. Circle with arrow shows the location of cut view of Z-stack, as shown in the right panel (A). However, such oxidative stress resulted a reduction of TDP1 transcript by about 50% relative to untreated cells (B), but immunoblotting of whole cell extract showed similar expression of TDP1 between untreated and treated samples (C). GAPDH was used as endogenous control (B) or loading control (C). All the experiments were done three times independently. Scale bar = 10 µm. RQ = relative quantitation.  66  Figure 4.3: TDP1 expression in human retina. Immunofluorescence microscopy on frozen section of human retina showed that TDP1 is expressed both in the nucleus and in the cytoplasm of human retina (A). Cytoplasmic TDP1 showed co-localization with mitochondria in the layer or rods and cones (LRC). Specificity of the anti-TDP1 antibody was determined by pre-immune serum (TDP1 pi) from the same rabbit (B). Scale bar = 20 µm. LRC: layer of rods and cones; ONL: outer nuclear layer; INL: inner nuclear layer; GCL: ganglion cell layer; pi: pre-immune serum. Cytochrome C (CytC) was used as marker for mitochondria.  67  Figure  4.4:  Tdp1  expression  in  wild  type  129/SvEv  murine  retina.  Immunofluorescence microscopy on frozen section of one-month-old wild type murine retina showed that Tdp1 is exclusively expressed in the cytoplasm of the layers of rods and cones (LRC). Tdp1 was co-localized with retinal mitochondria (A). Scale bar = 20 µm. LRC: layer of rods and cones; ONL: outer nuclear layer; INL: inner nuclear layer; GCL: ganglion cell layer. Cytochrome C (CytC) was used as a mitochondrial marker. Immunoblotting on ultra-purified mitochondrial fraction from one-month-old wild type murine retina showed Tdp1 expression in mitochondria (B). Tubulin, complex IV subunit I and histone H2B were used as markers for cytoplasm, mitochondria and nucleus respectively.  68  Figure 4.5: Tdp1 expression pattern in wild type 129/SvEv murine retina after 24 hours experience in dark. Immunofluorescence microscopy on frozen sections of onemonth-old wild type murine retina showed that after 24 hours of dark experience, Tdp1 was observed to remain in the mitochondria of layer of rods and cones (LRC), indicating that Tdp1 localization to mitochondria in murine retina either might be developmentally programmed or do not depend solely on light or both. Scale bar = 20 µm. LRC: layer of rods and cones; ONL: outer nuclear layer; INL: inner nuclear layer; GCL: ganglion cell layer. Cytochrome C (CytC) was used as a mitochondrial marker.  69  Figure 4.6: Retinal degeneration in Tdp1-/- mouse. Hematoxylin and eosin staining of retinal cryosections showed retinal morphology in Tdp1+/+ and Tdp1-/- mice. Retinal morphology of Tdp1+/+ and Tdp1-/- mice were comparable to each other at postnatal day 1 and day 8 respectively (A and B). Retinal degeneration was observed in Tdp1-/mice from postnatal day 11 (C) and clearer on postnatal day 14 (D). One-month-old Tdp1-/- mice showed much severe retinal degeneration in the outer nuclear layer (E). Scale bar = 40 µm. LRC: layer of rods and cones; ONL: outer nuclear layer; INL: inner nuclear layer; GCL: ganglion cell layer.  70  Figure 4.7: Degeneration of both rod cells and cone cells in Tdp1-/- mouse retina. At postnatal day 8, both Tdp1+/+ and Tdp1-/- mice showed comparable levels of s-opsin and rhodopsin as observed by immunofluorescence microscopy. Levels of s-opsin and rhodopsin were reduced in Tdp1-/- mice at postnatal day 11 and day 14 compared to Tdp1+/+ mice. These observations indicated that both rod cells and cone cells were degenerated in Tdp1-/- mice. Scale bar = 20 µm. LRC: layer of rods and cones; ONL: outer nuclear layer. S-opsin and rhodopsin were used as markers for cone cells and rod cells, respectively.  71  Figure 4.8: Apoptosis in Tdp1-/- mouse retina. Apoptosis was detected by TUNEL assay. No apoptotic cell was detected in the outer nuclear layer of retina of Tdp1+/+ and Tdp1-/- at postnatal day 8 (A). There were clearly a number of apoptotic cells (arrow) in the outer nuclear layer of Tdp1-/- mouse retina at postnatal day 11 compared to Tdp1+/+ retina (B). At P14, apoptosis was still detectable in Tdp1-/- mouse retina (C). Scale bar = 40 µm. LRC: layer of rods and cones; ONL: outer nuclear layer; INL: inner nuclear layer. Sections were counter stained for nucleus with methyl green.  72  Figure 4.9: Increased oxidative DNA damage in Tdp1-/- mice retina. Immunofluorescence microscopy showed an increased level of 8-oxoguanine in Tdp1-/mice retina compared to Tdp1+/+ retina. At postnatal day 8, level of 8-oxoguanine in Tdp1+/+ and Tdp1-/- were comparable. There was a marked increase of 8-oxoguanine staining in Tdp1-/- mice at postnatal day 11 and day 14. Interestingly, 8-oxoguanine staining co-localized with the mitochondria indicating increased oxidative stress in mitochondrial DNA. Scale bar = 20 µm. LRC: layer of rods and cones; ONL: outer nuclear layer; INL: inner nuclear layer. Complex IV was used as a marker for mitochondria.  73  Figure 4.10: Internal oxidative stress might be sufficient to cause retinal degeneration in Tdp1-/- mice. Tdp1+/+ and Tdp1-/- mice were raised in dark and retina was analyzed at postnatal day 30. Hematoxylin and eosin staining showed retinal degeneration in Tdp1-/- mice (A). Apoptosis was detected in the outer nuclear layer (arrow) of Tdp1-/- mice retina (B). Also, 8-oxoguanine was detectable in the mitochondria of Tdp1-/- mice retina (C). Scale bar = 20 µm. LRC: layer of rods and cones; ONL: outer nuclear layer; INL: inner nuclear layer; GCL: ganglion cell layer. Complex IV antibody was used as a mitochondrial marker.  74  Figure 4.11: Mitochondrial DNA damage in Tdp1-/- mouse retina. D-17 deletion in mitochondrial DNA was detectable at postnatal day 14 in retinal mitochondrial DNA of Tdp1-/- mice.  75  Chapter 5. Discussion  5.1  TDP1 in cancer and neurodegeneration Defects in DNA repair processes have been reported as a major culprit for  cancer predisposition and development, neurodegeneration and ageing in humans21,32. Repairing the damaged DNA is crucial for cell viability and a failure to do so may result in cell death. DNA repair processes are conserved among all living organisms and also, there exist alternative DNA repair pathways competing and collaborating with each other to repair the damage86. This has allowed researchers to target a specific DNA repair pathway to combat cancer. Beside defects in DNA repair, mitochondrial dysfunction has been hypothesized to be a prime cause of cancer, which is known as the Warburg effect or Warburg hypothesis87,88. As mitochondria play a vital role in programmed cell death or apoptosis, shutting down mitochondria prevents apoptosis in cancer cells. As persistent SSBs in mitochondrial DNA can lead to apoptosis89, it is thus important for cancer cells to repair such SSBs in mtDNA. Mitochondria also play a major role in the development of neurodegenerative disorders90. As mitochondria produce energy through oxidative phosphorylation, a disturbance or defect in the electron transport chain (ETC) can generate reactive oxygen species (ROS) which can damage DNA by oxidizing DNA bases91. Beside energy production, mitochondria also have other vital cellular functions including regulating apoptosis, cholesterol synthesis and amino acid metabolism92. Thus, a disturbance in mitochondrial trafficking, in interorganellar communication, and in mitochondrial quality control can also lead to mitochondrial dysfunction leading to disruption of normal cellular homeostasis92.  76  Neurons with long axons are particularly affected, as the energy demands of these neurons are very high due to their function in transferring action potentials from the dendrite to the synapse93. TDP1 is a member of the DNA single-strand-break repair complex that also includes XRCC1, Ligase III, PARP1, and PNKP94. Within this complex, TDP1 participates in the resolution of stalled Topo I and in the processing of blocked 3´termini like 3´-phosphoglycolates that form in response to oxidative stress, ionizing radiation, and chemotherapeutic agents51. Increased expression and increased activity of TDP1 have been reported in non-small cell lung carcinoma64. Also, cells lacking TDP1 show increased sensitivity towards the anticancer drug CPT and its derivatives39. A mutation in TDP1 has been reported to cause SCAN138. As none of the Tdp1 knockout mouse models show an ataxic phenotype as observed in SCAN139,57,58, it was hypothesized that the SCAN1-specific mutation producing TDP1H493R might be responsible for this neurodegenerative disorder95. In SCAN1, neurons with long axons are particularly affected resulting in an ataxic phenotype38. Research on the molecular basis of SCAN1 showed that TDP1 was exclusively expressed in the cytoplasm instead of the nucleus of these neurons39. Observing the absence of cytoplasmic Tdp1 in these neurons of wild type mouse, Hirano et al. proposed that TDP1 might have a humanspecific function in these neurons or have a cytoplasmic function39. However, these studies introduced the concept that SCAN1 might not arise solely from a defect in nuclear DNA repair39. Although recently TDP1 has been discovered in the mitochondria, where this protein also repairs mtDNA61, there is still no evidence that loss of TDP1 can result in mitochondrial dysfunction in model organisms.  77  5.2  Anticancer potential of TDP1 inhibition Loss of TDP1 function can result in increased radio-sensitivity and CPT  sensitivity in model organisms and cell lines. TDP1 expression and activity has been reported to increase in cancer. So, I hypothesized that TDP1 could be a potential anticancer target and TDP1 inhibitor alone or in combination with CPT, CPTderivatives or radio-therapy can cure cancers, especially those cancers resistant to CPT or radiotherapy. To test my hypothesis, I first determined which cancers express TDP1, through tissue microarrays of both adult and pediatric tumors. Interestingly, all types of adult tumors examined were TDP1 positive, especially ovarian, breast, prostate, pancreatic, thyroid and hepatic cancers. These cancers often show multi-drug resistance and are difficult to treat when metastasized96,97. In the pediatric TMA, most of the rhabdomyosarcoma tumors were TDP1 positive, followed by ganglioneuroma and Ewing’s  sarcoma.  This  observation  was  further  confirmed  by  staining  rhabdomyosarcoma TMAs from the Children’s Oncology Group (COG), prepared from frozen paraffin sections so that antigens remain preserved. There are two distinct clinical presentations of rhabdomyosarcomas (RMSs), alveolar rhabdomyosarcoma (aRMS) or rhabdomyosarcoma in older children and embryonal rhabdomyosarcoma (eRMS) or rhabdomyosarcoma of younger children75. These two types also differ in morphology, aggressiveness and location. aRMS, usually found in muscle of extremities and the trunk, is more aggressive than eRMS and has alveoli-like morphology. aRMSs are often associated with PAX3-FKHR (t(2;13)(q35;q14)) or PAX7-FKHR (t(1;13)(p36;q14)) translocation76. eRMS are usually found in the genitourinary tract and head and neck regions and have small round nuclei as the cancer  78  cells resemble primitive developing skeletal muscle cells of the embryo75. RMSs are relatively rare but approximately 250 children in the United States have been diagnosed with this disease, and two thirds of these patients are under 10 years old73. Although the overall survival has increased from 25 to 70% between the 1970’s and the 1990’s, the 5-year failure-free survival rate is only 65% for children with non-metastatic aRMS or eRMS at unfavorable sites and is even less for about 15% of children with metastatic RMS98. Moreover, a recent randomized phase II trial of irinotecan (camptothecin derivative) for treatment of RMS was not successful66. As irinotecan stabilizes the 3´Topo I-DNA covalent intermediate and TDP1 functions in rescuing this complex, and also loss of TDP1 function grants sensitivity to irinotecan in cells and mouse, my studies were designed to investigate whether TDP1 is an anticancer target for RMS or not. Immunohistochemical staining of RMS tissues and normal skeletal muscle showed that TDP1 was distinctly expressed in the RMS tissues compared to normal muscle. In skeletal muscle, TDP1 was exclusively expressed in the cytoplasm indicating that TDP1 might be present in the mitochondria. Immunofluorescence microscopy and sub-cellular fractionation confirmed TDP1 expression in mitochondria of normal human skeletal muscle. This suggest that, TDP1 might be involved in repairing mtDNA in human skeletal muscle. Also, some muscle cells showed higher expression of TDP1 in the cytoplasm compared to adjacent cells. This indicated that expression of TDP1 might be higher in type I muscle fibres which are rich in mitochondria and where oxidative stress is higher99. The distinct nuclear expression of TDP1 in RMS suggested that TDP1 might be used as a diagnostic marker for RMS.  79  Based on the above observations, my studies on TDP1 as an anticancer target was focused on RMS cell lines. Interestingly, TDP1 expression was higher in Rh30 and CW9019 cell lines, cells with PAX3-FKHR and PAX7-FKHR fusion products respectively. These cell lines were also most sensitive to CPT compared to other cell lines. This observation suggested that these cell lines might have a higher degree of genomic instability compared to other cell lines. Interestingly, none of the aRMS cell lines but all of the eRMS cell lines expressed TDP1 in the mitochondria. As mitochondrial TDP1 has the same molecular weight as of TDP1 in the whole cell lysate, this indicated that probably TDP1 is exported to the mitochondria through a cleavage-independent, phosphorylation-mediated, HSP-70 dependent mitochondrial targeting like other proteins, i.e. glutathione S-transferase isoform A4 (GSTA4-4)100 and BRCA1101, or might enter into the mitochondria like many other proteins i.e. p53102, APE1103, FEN1104 and NF-κB105, despite their lack of a canonical mitochondrial localization sequence106. However, the existence of a still unknown mechanism for intracellular protein trafficking can also be considered for TDP1 translocation to the mitochondria61. As TDP1 was expressed in the mitochondria of normal skeletal muscle, this observation also indicated that there likely exists a defect in transportation of TDP1 to the mitochondria of these aRMS cell lines or a mutation in TDP1. Also, as cell lines expressing TDP1 in the mitochondria showed less sensitive to CPT, CPT could also be causing damage to the mtDNA and TDP1 was protecting the mitochondrial DNA from CPT-induced damage. As mitochondria also have a topoisomerase known as mtTopo I, CPT could potentially stabilize a mtTopo I-mtDNA covalent complex107. Thereby,  80  TDP1 inhibitor alone or in combination with CPT could be used as mitochondrial genotoxic agent to treat cancer. To understand whether the loss of TDP1 function could induce apoptosis in these RMS cell lines or could increase CPT sensitivity, TDP1 was transiently knockeddown in these cell lines by siRNA. Compared to the non-targeting control knockdown cells, all of these cell lines showed reduced cell proliferation when TDP1 was knocked down. No increased rate of apoptosis was detected in these TDP1-depleted cells. This suggested that loss of TDP1 might be inducing more DNA damage that resulted in delayed cell division. However, stably knocked down cells neither showed loss of proliferation nor increased apoptosis. These observations suggested that: 1) either these stable knockdown cells gained further mutation to overcome the loss of TDP1, which had been selected to proliferate during the knockdown process, or 2) there was a gain of function to bypass the TDP1 mediated DNA repair pathway, i.e. XPF-ERCC1 mediated pathway, or 3) I missed the apoptosis time point. Interestingly, few cells survived to form colonies during the knockdown procedure, which suggested that there was an initial event of cell death and selection due to loss of TDP1. Overall, the findings in RMS cell lines suggested that loss of TDP1 function could significantly decrease cell proliferation and mitochondrial TDP1 could protect the cells from mitochondrial genotoxic agents. Thus, TDP1 inhibitor alone or in combination with CPT or CPT-derivatives can potentially be used to treat cancers with high TDP1 expression. In other words, TDP1 is a rational and potential anticancer target. Based on these findings, a model is illustrated in Figure 5.1 to show how TDP1 inhibitors could be used to treat cancer. A number of TDP1 inhibitors have been  81  reported like sodium vanadate, neomycin B, paromomycin I, 4-Pregnen-21-ol-3,20dione-21-(4-bromobenzenesulfonate), lividomycin and furamidine108. However, these compounds are not selective enough to be used as TDP1 inhibitors. A potent and selective TDP1 inhibitor is yet to be discovered.  5.3  Tdp1-/- retina as a model for neurodegeneration in SCAN1 As mutation in TDP1 results in SCAN1, TDP1 had been a focus of investigation  in studying the cause of neurodegenerative diseases. This is reflected by three different research groups generating three independent mouse models for SCAN139,57,58. However, it is not still clear how mutation in TDP1 can lead to neurodegeneration. Although TDP1 is expressed throughout the brain and central nervous system, and also highly expressed in testes and thymus, clinical studies with SCAN1 suggested that Purkinje cells of cerebellum, dentate nuclei cells, anterior horn cells and dorsal root cells are affected by the pathogenic mutation in TDP138. Later, exclusive cytoplasmic expression of TDP1 was observed in these cells39. In my studies, I also aimed to understand the physiologic importance of such an expression pattern of TDP1. For this, TDP1 expression in different human tissues from all organ systems was studied by immunohistochemical staining. Interestingly, TDP1 was expressed mainly in the cytoplasm of the cells where oxidative stress is higher due to requirement of high energy. These include neurons, skeletal muscle, cardiac muscle, spleen, adrenal medulla and thyroid. Among these, TDP1 was exclusively expressed in the cytoplasm but was completely absent in the nucleus of neurons, skeletal muscle and smooth muscle of blood vessels. Thereby, neurons were the only non-replicating cells that  82  exclusively express TDP1 in the cytoplasm but not in the nucleus. These studies suggested that in SCAN1, loss of TDP1 might exclusively affect neurons with large axons, as demonstrated previously, but not other cells or tissues39. But why TDP1 is exclusively expressed in the cytoplasm of these neurons and how such expression correlates with the disease are not still clear. To understand the role of cytoplasmic or mitochondrial TDP1, human fibroblasts were challenged with two different oxidants. I choose: 1) menadione sodium bisulfite, which produces large quantities of intracellular superoxide anion and usually used to boost up internal oxidative stress109, and 2) hydrogen peroxide, which is produced by the mitochondria during oxidative phosphorylation and usually used as an exogenous source of oxidative stress110. It was observed that TDP1 was enriched in the cytoplasm compared to untreated cells for both types of stress and cytoplasmic TDP1 co-localized with the mitochondria. Interestingly, exposure to these oxidants reduced the amount of TDP1 transcript but not the TDP1 protein compared to untreated cells, indicating that TDP1 might be stabilized due to DNA damage as previously reported59. Thereby, cytoplasmic TDP1 in the neurons affected in SCAN1 was probably in the mitochondria due to higher oxidative burden, reflected by the punctate staining pattern in the cytoplasm. As mitochondrial TDP1 can process both 3´-Topo I-DNA covalent intermediate and 3´-phosphoglycolates61, shifting TDP1 from cytoplasm to the mitochondria might be essential to repair the lesions generated in the mitochondrial DNA of these neurons during oxidative stress. Light is a well-known oxidant and generates oxidative stress in neurons of the eye, especially in rod and cone neurons111,112. Thereby, I choose retina as a model to  83  understand the role of TDP1 in the mitochondria during oxidative stress in situ, as exposure to light could be controlled externally. In normal human retina, TDP1 was enriched in the nucleus and also in the mitochondria of layers of rods and cones (Figure 4.3). But in mouse retina, murine TDP1 (Tdp1) was exclusively expressed in the mitochondria of layers of rods and cones but not in the outer nuclear layer composed of nuclei of rods and cones (Figure 4.4). Thereby, the neurons of the outer nuclear layer, or rod and cone cells mimicked the neurons affected in SCAN1 in terms of Tdp1 expression. However, after 24 hours of dark experience, Tdp1 was still in the mitochondria of layers of rods and cones, indicating either Tdp1 is developmentally programmed to localize in the mitochondria or internal oxidative stress is sufficient to move Tdp1 to the mitochondria, at least in these neurons. To investigate whether functional loss of Tdp1 could induce neurodegeneration in the outer nuclear layer of murine retina that express exclusive cytoplasmic Tdp1, Tdp1+/+ and Tdp1-/- mice were studied for retinal morphology at different ages. There was no difference in the morphology of retina between Tdp1+/+ and Tdp1-/- mice up to postnatal day 8, when their eyes were still closed. Interestingly, SCAN1 develops in patients during late childhood. Similar to SCAN1, Tdp1-/- mice developed a clear neurodegeneration at postnatal day 11, in other words, their late childhood. At postnatal day 14, the neurodegeneration was more severe and was the most severe at postnatal day 30. Such degenerative phenotype was observed in all tested Tdp1-/- mice retina. These observations indicated that exclusive cytoplasmic expression of Tdp1 is physiologically very important and loss of Tdp1 results in degenerative phenotype in the outer nuclear layer of mice. Immunofluorescence microscopic studies with these  84  retinal samples showed that both rod and cone neurons were degenerating in Tdp1-/mice retina starting from postnatal day 11. There was progressive loss of rod and cone neurons in Tdp1-/- mice retina, but how these cells were dying remained unclear. After TUNEL staining, a number of apoptotic cells were clearly observed in the rods and cones of all tested Tdp1-/- mice retina at postnatal day 11, whereas no apoptosis was detected for the same cells of Tdp1+/+ mice retina at the same age. These findings indicated that loss of function of Tdp1 results in cell death in rods and cones of Tdp1-/mice retina. To investigate the basis of apoptosis, retinal samples were stained for 8oxoguanine. 8-oxoguanine is a well-established marker for oxidative DNA damage resulting from oxidation of guanine bases in the DNA113. As Tdp1 had been reported to protect mitochondrial DNA from oxidative damage61, possibly the loss of Tdp1 might result in increased oxidative damage to the DNA bases. Indeed, it was observed that 8oxoguanine was markedly increased in the mitochondria but not in the nuclei of rods and cones of all tested Tdp1-/- mice retina, starting from postnatal day 11. 8-oxoguanine was also detected in the mitochondrial layer between the inner and the outer nuclear layer (known as the outer plexiform layer) that comprises the neuronal synapse in the retina. Overall, loss of Tdp1 resulted in increased mtDNA damage in the mouse retina, which can potentially lead to apoptosis of the outer nuclear cells. One possible mechanism for induction of apoptosis is persistence of SSB in the mtDNA89. To answer whether light plays a significant role in development of retinal degeneration in Tdp1-/- mice or if this phenotype was primarily due a genetic defect, both Tdp1+/+ and Tdp1-/- mice were raised in dark. These mice were exposed to light for  85  about 10 minutes every day for husbandry purposes during the course of experiment. However, all of these Tdp1-/- mice, which were raised in the dark, also showed a similar pattern of degenerative retinal morphology, increased apoptosis in the outer nuclear layer and increased level of 8-oxoguanine in the mitochondria. These observations indicated that internal reactive oxygen species generated during normal physiologic function was sufficient to damage mtDNA and lead to apoptosis and retinal degeneration in the Tdp1-/- mice. Thereby, the retinal degeneration in the Tdp1-/- mice was mostly due to loss of function of Tdp1 arising from genetic defect. If loss of Tdp1 can increase the level of oxidative stress in mtDNA, as reflected by an elevated level of 8-oxouanine, then there might be some oxidative damage to the mtDNA. Indeed, mtDNA deletion was detected at postnatal day 14 in Tdp1-/- mice retina. Interestingly, this deletion was not detected in Tdp1-/- mice at postnatal day 11. One possible reason for such an observation might be that it takes at least a few days for the recombination event resulting in the deletion to take place. Nonetheless, this does not exclude the existence of other mtDNA deletions at postnatal day 11 in Tdp1-/retina. As loss of Tdp1 resulted in mtDNA damage, and mitochondrial extracts containing Tdp1 had been reported to clear Topo I from Topo I-DNA covalent intermediate and also 3´-phosphoglycolates in vitro61, it could be concluded that Tdp1 is involved in maintenance and repair of mtDNA. Thus, in cells where Tdp1 is exclusively expressed in the cytoplasm, demand for such mtDNA repair by Tdp1 is possibly too high due to oxidative burden and loss of Tdp1 function could result in mitochondrial dysfunction leading cell death. In other words, Tdp1 function is very important for cells, especially for those cells expressing Tdp1 in the mitochondria  86  exclusively and apoptosis could be induced in those cells due to the loss of Tdp1 function as a result of mitochondrial dysfunction. Interestingly, Topo I has the ability to cleave the 3´ end of the 8-oxoguanine generated spontaneously inside the mitochondria114,115. Then 8-oxoguanine is trapped by the Topo I, resulting in a Topo I-DNA covalent intermediate. Thereby, activity of Tdp1 should be essential to release Topo I from the 3´-end of the DNA and helping 8oxoguanine glycosylase (OGG1) to repair 8-oxoguanine. Also, accumulation of 3´phosphoglycolates in mtDNA may occur in the absence of Tdp1, as APE1 cannot efficiently repair it19,61. Thereby, loss of Tdp1 would result in excessive SSBs in mtDNA, which can trigger apoptosis89. As neurons are post-mitotic cells with higher oxidative stress, loss of Tdp1 could induce apoptosis in those neurons where Tdp1 is expressed exclusively in the cytoplasm, at least in the retinal layers of rods and cones in Tdp1-/- mice. This could result in permanent loss of those neurons, as they do not divide. Also, as the rod and cone neurons of Tdp1-/- mice retina mimic the degenerative neurons in SCAN1 in terms of sub-cellular localization of Tdp1, Tdp1-/- mouse retina could be used as a model for SCAN1 to understand the importance of TDP1 for those neurons affected in SCAN1. This also explains why Tdp1-/- mice did not develop an ataxic phenotype, as Tdp1 is expressed both in the nucleus and in the cytoplasm of the neurons affected in SCAN1. This also explains why SCAN1 patients do not develop retinal degeneration as TDP1 is localized both in the nucleus and cytoplasm of rods and cones. Based on this, a possible molecular mechanism of SCAN1 development is illustrated in Figure 5.2.  87  5.4  Possible side-effects of TDP1 inhibitors As TDP1 plays an important role in mitochondrial DNA repair, and loss of  TDP1 function results in neurodegeneration, there might be side effects if TDP1 inhibitors are used as anticancer drugs. Fortunately, current reports suggest that SCAN1 patients do not develop cancer and that loss of TDP1 function does not result in any other disease37,38. Based on the study of TDP1 expression in human tissues, those tissues that could be affected by TDP1 inhibitors are neurons, muscle tissues, adipose tissues, thyroid and adrenal glands. However, SCAN1 patients do not show any clinical symptoms  for  the  dysfunction  of  these  tissues  excepting  neurons,  and  neurodegeneration in SCAN1 patients occurs in the late childhood38. Thereby, longterm high dose application of TDP1 inhibitor might be harmful for those neurons known to be affected in SCAN1. Thus, it is important that the inhibitor be potent enough to inhibit TDP1 at a low concentration, with optimum biological half-life and suitable for short-term application to prevent or minimize its neurodegeneration-related side effects. As functional loss of TDP1 results in increased CPT sensitivity39, TDP1 inhibitors could be used in combination with low dose CPT. One possible strategy might be to initially start the treatment with low dose CPT, CPT derivatives or ionizing radiation in combination with low dose TDP1 inhibitor, and then continuing the treatment only with a low dose of TDP1 inhibitor for some days. Such a strategy would result in decreased side effects as TDP1 will not be inhibited completely. During clinical trial, patients should be monitored for any symptoms that might arise due to the temporary loss of TDP1 function, especially monitoring of the level of serum thyroid  88  hormone concentration, blood leucocyte counts, occurrence of hypoalbuminemia or hypercholesterolemia and lack of energy. In the mouse, loss of Tdp1 resulted in retinal degeneration. Although SCAN1 patients have not been reported to develop retinal degeneration38, patients treated with TDP1 inhibitor should be monitored for disturbance in vision to eliminate any possibility of retinal damage. Moreover, patients already having some degree of vision loss should be carefully monitored or may be excluded from treatment with this inhibitor. Also, occurrence of retinal degeneration in mice after application of TDP1 inhibitor at a high dose might be considered as a readout for determination of the maximum allowed dose of TDP1 inhibitor for mice during preclinical trial. Based on studies with SCAN1 patients and literature review, TDP1 inhibitors might be predicted to be safe for normal cells. However, to minimize oxidative stress in different tissues and cells, it could be recommended to take antioxidants along with maintaining a healthy diet during the course of cancer treatment with TDP1 inhibitor. Potential antioxidants might be vitamins like vitamin E, vitamin C, vitamin A and vitamin B or a combination of all of these. Beta-carotene, polyphenolic antioxidants or N-acetyl cysteine could also be used as antioxidants116.  5.5  Future directions This study focused on investigating TDP1 as a potential anticancer target for the  treatment of cancers resistant to current therapies. It also investigated the molecular basis of TDP1 function in the mitochondria. Although the aim of this study was limited to RMS, a number of cancers showed expression of TDP1 both in the cytoplasm and in  89  the nucleus. The effect of TDP1 inhibition on these cancers is still unknown. As TDP1 inhibition holds promise for RMS, cancers that highly express TDP1 could be the next targets i.e. non-small cell lung carcinoma and breast cancer. Hence, development of a TDP1 inhibitor for therapeutic purpose is in demand. Although some inhibitors have been discovered, a potent and selective inhibitor has not yet been developed. Also, a detailed study of different proteins that interact with TDP1 during the DNA repair process is necessary to understand more clearly how TDP1 participates in DNA repair processes and how the TDP1-dependent DNA repair pathway competes and collaborates with other DNA repair pathways. This study could unveil synthetic lethal partners for TDP1, which also could be a prospective anticancer target in future. Although TDP1 is expressed in the mitochondria to repair mitochondrial DNA, it is still unclear how TDP1 moves inside the mitochondria. Some possible mechanisms could be that TDP1 has an unidentified unknown mitochondrial localization signal, or that other proteins aid the transportation of TDP1 to the mitochondria upon increased mtDNA damage. Beside TDP1 transportation into the mitochondria, TDP1 interacting proteins in mtDNA repair are still unknown and need to be studied. Up to now, the only known function of TDP1 is to repair DNA. Besides this, TDP1 might have other functions, such as an intracellular phospholipase activity, as TDP1 is a member of the phospholipase D superfamily. More studies are necessary to understand TDP1 function and activity. Finally, it should be remembered that this recognition of TDP1 as a potential anti-cancer target in a broad range of cancers originated from the study of a rare genetic disease, SCAN1. Our understanding of SCAN1, in effect, created a bridge between  90  basic research in drug development using a yeast model system and the more translationally-minded studies of the role the TDP1 in a broader range of human diseases, including cancer.  This is a prime example of the power and utility of  understanding rare genetic disease to treat more common, described diseases, and as such, rare genetic diseases deserve more attention from the biomedical community.  91  Figure 5.1: TDP1 inhibitor as an anticancer therapeutic. In normal cells, Topo IDNA covalent intermediates can be repaired by both TDP1-dependent pathway and a TDP1-independent or XPF-ERCC1 mediated pathway (A). In cancer cells, the TDP1independent pathway is downregulated due to mutation of BRCA1 and this pathway does not exist in mitochondria to the repair mtTopo I-mtDNA covalent complex. Thus, for those cancers, the TDP1 dependent pathway is the only pathway remaining to repair the damage. Application of TDP1 inhibitor could shut down the TDP1 mediated pathway leading to un-repaired Topo I-DNA covalent intermediate. Thereby, more DNA damage is accumulated and apoptosis could take place in cancer cells but not in normal cells (B).  92  Figure 5.2: A model illustrating possible molecular mechanism of SCAN1 development. In normal condition, TDP1 removes trapped Topo I from mtDNA, allowing repair of 8-oxoguanine by 8-oxoguanine glycosylase (OGG1). Complete loss of TDP1 would result in accumulation of 8-oxoguanine (A). When TDP1H493R (TDP1 in black circle) traps itself to the mtDNA, then the damage becomes persistent, usually repaired slowly by homologous recombination allowing mtDNA deletion. As mtDNA deletion accumulates over time, mitochondria become dysfunctional leading to neurodegeneration in SCAN1 (B). 93  References 1.  Crick, F. The double helix: a personal view. Nature 248, 766-9 (1974).  2.  Gasser, S. & Raulet, D. The DNA damage response, immunity and cancer. Semin Cancer Biol 16, 344-7 (2006).  3.  Becker, M.M. & Wang, Z. Origin of ultraviolet damage in DNA. J Mol Biol 210, 429-38 (1989).  4.  Lawley, P.D. & Phillips, D.H. DNA adducts from chemotherapeutic agents. Mutat Res 355, 13-40 (1996).  5.  Saran, M. & Bors, W. Radical reactions in vivo--an overview. Radiat Environ Biophys 29, 249-62 (1990).  6.  Kunkel, T.A. & Bebenek, K. DNA replication fidelity. Annu Rev Biochem 69, 497-529 (2000).  7.  Eastman, A. & Barry, M.A. The origins of DNA breaks: a consequence of DNA damage, DNA repair, or apoptosis? Cancer Invest 10, 229-40 (1992).  8.  Lambert, M.W. & Lambert, W.C. DNA repair and chromatin structure in genetic diseases. Prog Nucleic Acid Res Mol Biol 63, 257-310 (1999).  9.  Batty, D.P. & Wood, R.D. Damage recognition in nucleotide excision repair of DNA. Gene 241, 193-204 (2000).  10.  Anderson, J.A., Harper, J.V., Cucinotta, F.A. & O'Neill, P. Participation of DNA-PKcs in DSB repair after exposure to high- and low-LET radiation. Radiat Res 174, 195-205 (2010).  11.  Chang, D.Y. & Lu, A.L. Interaction of checkpoint proteins Hus1/Rad1/Rad9 with DNA base excision repair enzyme MutY homolog in fission yeast, Schizosaccharomyces pombe. J Biol Chem 280, 408-17 (2005).  12.  Shiotani, B. & Zou, L. Single-stranded DNA orchestrates an ATM-to-ATR switch at DNA breaks. Mol Cell 33, 547-58 (2009).  13.  Mishina, Y., Duguid, E.M. & He, C. Direct reversal of DNA alkylation damage. Chem Rev 106, 215-32 (2006).  14.  Tuteja, N. & Tuteja, R. Unraveling DNA repair in human: molecular mechanisms and consequences of repair defect. Crit Rev Biochem Mol Biol 36, 261-90 (2001).  94  15.  Fortini, P. & Dogliotti, E. Base damage and single-strand break repair: mechanisms and functional significance of short- and long-patch repair subpathways. DNA Repair (Amst) 6, 398-409 (2007).  16.  Stivers, J.T. Extrahelical damaged base recognition by DNA glycosylase enzymes. Chemistry 14, 786-93 (2008).  17.  Fromme, J.C. & Verdine, G.L. Base excision repair. Adv Protein Chem 69, 1-41 (2004).  18.  Caradonna, S.J. & Cheng, Y.C. DNA glycosylases. Mol Cell Biochem 46, 49-63 (1982).  19.  Fritz, G. Human APE/Ref-1 protein. Int J Biochem Cell Biol 32, 925-9 (2000).  20.  Saldivar, J.S., Wu, X., Follen, M. & Gershenson, D. Nucleotide excision repair pathway review I: implications in ovarian cancer and platinum sensitivity. Gynecol Oncol 107, S56-71 (2007).  21.  O'Neil, N. & Rose, A. DNA repair. WormBook, 1-12 (2006).  22.  Shuck, S.C., Short, E.A. & Turchi, J.J. Eukaryotic nucleotide excision repair: from understanding mechanisms to influencing biology. Cell Res 18, 64-72 (2008).  23.  Modrich, P. Mismatch repair, genetic stability, and cancer. Science 266, 195960 (1994).  24.  Scott, S.P. & Pandita, T.K. The cellular control of DNA double-strand breaks. J Cell Biochem 99, 1463-75 (2006).  25.  Lieber, M.R. The mechanism of double-strand DNA break repair by the nonhomologous DNA end-joining pathway. Annu Rev Biochem 79, 181-211 (2010).  26.  McVey, M. & Lee, S.E. MMEJ repair of double-strand breaks (director's cut): deleted sequences and alternative endings. Trends Genet 24, 529-38 (2008).  27.  Li, X. & Heyer, W.D. Homologous recombination in DNA repair and DNA damage tolerance. Cell Res 18, 99-113 (2008).  28.  Croteau, D.L., Stierum, R.H. & Bohr, V.A. Mitochondrial DNA repair pathways. Mutat Res 434, 137-48 (1999).  95  29.  Kamenisch, Y. et al. Proteins of nucleotide and base excision repair pathways interact in mitochondria to protect from loss of subcutaneous fat, a hallmark of aging. J Exp Med 207, 379-90 (2010).  30.  Boesch, P. et al. DNA repair in organelles: Pathways, organization, regulation, relevance in disease and aging. Biochim Biophys Acta 1813, 186-200 (2011).  31.  Jeppesen, D.K., Bohr, V.A. & Stevnsner, T. DNA repair deficiency in neurodegeneration. Prog Neurobiol (2011).  32.  Setlow, R.B. Repair deficient human disorders and cancer. Nature 271, 713-7 (1978).  33.  Rass, U., Ahel, I. & West, S.C. Defective DNA repair and neurodegenerative disease. Cell 130, 991-1004 (2007).  34.  Subba Rao, K. Mechanisms of disease: DNA repair defects and neurological disease. Nat Clin Pract Neurol 3, 162-72 (2007).  35.  Katyal, S. & McKinnon, P.J. DNA repair deficiency and neurodegeneration. Cell Cycle 6, 2360-5 (2007).  36.  Embirucu, E.K., Martyn, M.L., Schlesinger, D. & Kok, F. Autosomal recessive ataxias: 20 types, and counting. Arq Neuropsiquiatr 67, 1143-56 (2009).  37.  Hirano, R., Salih, M.A.M., Takashima, H. & Boerkoel, C.F. Spinocerebellar Ataxia  with  Axonal  Neuropathy,  Autosomal  Recessive.  (2011).  In:  GeneReviews at GeneTests: Medical Genetics Information Resource (database online). Copyright, University of Washington, Seattle. 1997-2011. Available at http://www.genetests.org. Accessed [September 15, 2011]. 38.  Takashima, H. et al. Mutation of TDP1, encoding a topoisomerase I-dependent DNA damage repair enzyme, in spinocerebellar ataxia with axonal neuropathy. Nat Genet 32, 267-72 (2002).  39.  Hirano, R. et al. Spinocerebellar ataxia with axonal neuropathy: consequence of a Tdp1 recessive neomorphic mutation? EMBO J 26, 4732-43 (2007).  40.  Pouliot, J.J., Yao, K.C., Robertson, C.A. & Nash, H.A. Yeast gene for a TyrDNA phosphodiesterase that repairs topoisomerase I complexes. Science 286, 552-5 (1999).  96  41.  Lee, S.Y. et al. Identification of tyrosyl-DNA phosphodiesterase as a novel DNA damage repair enzyme in Arabidopsis. Plant Physiol 154, 1460-9 (2010).  42.  Banerjee, B., Roy, A., Sen, N. & Majumder, H.K. A tyrosyl DNA phosphodiesterase 1 from kinetoplastid parasite Leishmania donovani (LdTdp1) capable of removing topo I-DNA covalent complexes. Mol Microbiol 78, 11937 (2010).  43.  Macovei, A., Balestrazzi, A., Confalonieri, M. & Carbonera, D. The tyrosylDNA phosphodiesterase gene family in Medicago truncatula Gaertn.: bioinformatic investigation and expression profiles in response to copper- and PEG-mediated stress. Planta 232, 393-407 (2010).  44.  Interthal,  H.,  Pouliot,  J.J.  &  Champoux,  J.J.  The  tyrosyl-DNA  phosphodiesterase Tdp1 is a member of the phospholipase D superfamily. Proc Natl Acad Sci U S A 98, 12009-14 (2001). 45.  Gao, R. et al. Effects of modification of the active site tyrosine of human DNA topoisomerase I. Biochemistry 45, 8402-10 (2006).  46.  Dexheimer, T.S., Antony, S., Marchand, C. & Pommier, Y. Tyrosyl-DNA phosphodiesterase as a target for anticancer therapy. Anticancer Agents Med Chem 8, 381-9 (2008).  47.  Sordet, O. et al. Ataxia telangiectasia mutated activation by transcription- and topoisomerase I-induced DNA double-strand breaks. EMBO Rep 10, 887-93 (2009).  48.  Dianov, G.L. & Parsons, J.L. Co-ordination of DNA single strand break repair. DNA Repair (Amst) 6, 454-60 (2007).  49.  Liu, C., Pouliot, J.J. & Nash, H.A. Repair of topoisomerase I covalent complexes in the absence of the tyrosyl-DNA phosphodiesterase Tdp1. Proc Natl Acad Sci U S A 99, 14970-5 (2002).  50.  Debethune, L., Kohlhagen, G., Grandas, A. & Pommier, Y. Processing of nucleopeptides mimicking the topoisomerase I-DNA covalent complex by tyrosyl-DNA phosphodiesterase. Nucleic Acids Res 30, 1198-204 (2002).  97  51.  Interthal, H., Chen, H.J. & Champoux, J.J. Human Tdp1 cleaves a broad spectrum of substrates, including phosphoamide linkages. J Biol Chem 280, 36518-28 (2005).  52.  Interthal, H. & Champoux, J.J. Effects of DNA and protein size on substrate cleavage by human tyrosyl-DNA phosphodiesterase (TDP1). Biochem J (2011).  53.  Raymond, A.C., Staker, B.L. & Burgin, A.B., Jr. Substrate specificity of tyrosyl-DNA phosphodiesterase I (Tdp1). J Biol Chem 280, 22029-35 (2005).  54.  Interthal, H. et al. SCAN1 mutant Tdp1 accumulates the enzyme--DNA intermediate and causes camptothecin hypersensitivity. EMBO J 24, 2224-33 (2005).  55.  Dunlop, J., Corominas, M. & Serras, F. The novel gene glaikit, is expressed during neurogenesis in the Drosophila melanogaster embryo. Mech Dev 96, 133-6 (2000).  56.  Dunlop, J., Morin, X., Corominas, M., Serras, F. & Tear, G. glaikit is essential for the formation of epithelial polarity and neuronal development. Curr Biol 14, 2039-45 (2004).  57.  Katyal, S. et al. TDP1 facilitates chromosomal single-strand break repair in neurons and is neuroprotective in vivo. EMBO J 26, 4720-31 (2007).  58.  Hawkins, A.J. et al. In vitro complementation of Tdp1 deficiency indicates a stabilized enzyme-DNA adduct from tyrosyl but not glycolate lesions as a consequence of the SCAN1 mutation. DNA Repair (Amst) 8, 654-63 (2009).  59.  Das, B.B. et al. Optimal function of the DNA repair enzyme TDP1 requires its phosphorylation by ATM and/or DNA-PK. EMBO J 28, 3667-80 (2009).  60.  Chiang, S.C., Carroll, J. & El-Khamisy, S.F. TDP1 serine 81 promotes interaction with DNA ligase IIIalpha and facilitates cell survival following DNA damage. Cell Cycle 9, 588-595 (2010).  61.  Das, B.B., Dexheimer, T.S., Maddali, K. & Pommier, Y. Role of tyrosyl-DNA phosphodiesterase (TDP1) in mitochondria. Proc Natl Acad Sci U S A 107, 19790-5 (2010).  62.  El-Khamisy, S.F. & Caldecott, K.W. TDP1-dependent DNA single-strand break repair and neurodegeneration. Mutagenesis 21, 219-24 (2006).  98  63.  Pommier, Y. Topoisomerase I inhibitors: camptothecins and beyond. Nat Rev Cancer 6, 789-802 (2006).  64.  Liu, C. et al. Increased expression and activity of repair genes TDP1 and XPF in non-small cell lung cancer. Lung Cancer 55, 303-11 (2007).  65.  Ben Hassine, S. & Arcangioli, B. Tdp1 protects against oxidative DNA damage in non-dividing fission yeast. EMBO J 28, 632-40 (2009).  66.  Mascarenhas, L. et al. Randomized phase II window trial of two schedules of irinotecan with vincristine in patients with first relapse or progression of rhabdomyosarcoma: a report from the Children's Oncology Group. J Clin Oncol 28, 4658-63 (2010).  67.  Ji, Y.N., Zhan, P., Wang, J., Qiu, L.X. & Yu, L.K. APE1 Asp148Glu gene polymorphism and lung cancer risk: a meta-analysis. Mol Biol Rep 38, 4537-43 (2011).  68.  Druzhyna, N.M., Wilson, G.L. & LeDoux, S.P. Mitochondrial DNA repair in aging and disease. Mech Ageing Dev 129, 383-90 (2008).  69.  Rebrin, I., Kamzalov, S. & Sohal, R.S. Effects of age and caloric restriction on glutathione redox state in mice. Free Radic Biol Med 35, 626-35 (2003).  70.  Zhou, W. et al. Subcellular site of superoxide dismutase expression differentially controls AP-1 activity and injury in mouse liver following ischemia/reperfusion. Hepatology 33, 902-14 (2001).  71.  Graham, J., Ford, T. & Rickwood, D. The preparation of subcellular organelles from mouse liver in self-generated gradients of iodixanol. Anal Biochem 220, 367-73 (1994).  72.  Tanhauser, S.M. & Laipis, P.J. Multiple deletions are detectable in mitochondrial DNA of aging mice. J Biol Chem 270, 24769-75 (1995).  73.  Xia,  S.J.,  Pressey,  J.G.  &  Barr,  F.G.  Molecular  pathogenesis  of  rhabdomyosarcoma. Cancer Biol Ther 1, 97-104 (2002). 74.  Ogata, T. & Yamasaki, Y. Ultra-high-resolution scanning electron microscopy of mitochondria and sarcoplasmic reticulum arrangement in human red, white, and intermediate muscle fibers. Anat Rec 248, 214-23 (1997).  99  75.  Newton, W.A., Jr. et al. Classification of rhabdomyosarcomas and related sarcomas. Pathologic aspects and proposal for a new classification--an Intergroup Rhabdomyosarcoma Study. Cancer 76, 1073-85 (1995).  76.  Sorensen, P.H. et al. PAX3-FKHR and PAX7-FKHR gene fusions are prognostic indicators in alveolar rhabdomyosarcoma: a report from the children's oncology group. J Clin Oncol 20, 2672-9 (2002).  77.  Fredericks, W.J. et al. The PAX3-FKHR fusion protein created by the t(2;13) translocation in alveolar rhabdomyosarcomas is a more potent transcriptional activator than PAX3. Mol Cell Biol 15, 1522-35 (1995).  78.  Kelly, K.M., Womer, R.B. & Barr, F.G. PAX3-FKHR and PAX7-FKHR gene fusions in rhabdomyosarcoma. J Pediatr Hematol Oncol 20, 517-8 (1998).  79.  Pommier, Y. Camptothecins and topoisomerase I: a foot in the door. Targeting the genome beyond topoisomerase I with camptothecins and novel anticancer drugs: importance of DNA replication, repair and cell cycle checkpoints. Curr Med Chem Anticancer Agents 4, 429-34 (2004).  80.  Raymond, A.C. & Burgin, A.B., Jr. Tyrosyl-DNA phosphodiesterase (Tdp1) (3'-phosphotyrosyl DNA phosphodiesterase). Methods Enzymol 409, 511-24 (2006).  81.  Wei, Y.H., Lu, C.Y., Wei, C.Y., Ma, Y.S. & Lee, H.C. Oxidative stress in human  aging  and  mitochondrial  disease-consequences  of  defective  mitochondrial respiration and impaired antioxidant enzyme system. Chin J Physiol 44, 1-11 (2001). 82.  Shichida, Y. & Matsuyama, T. Evolution of opsins and phototransduction. Philos Trans R Soc Lond B Biol Sci 364, 2881-95 (2009).  83.  Gavrieli, Y., Sherman, Y. & Ben-Sasson, S.A. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J Cell Biol 119, 493-501 (1992).  84.  Cadet, J., Douki, T. & Ravanat, J.L. Oxidatively generated base damage to cellular DNA. Free Radic Biol Med 49, 9-21 (2010).  85.  Young, R.W. Cell proliferation during postnatal development of the retina in the mouse. Brain Res 353, 229-39 (1985).  100  86.  Kass, E.M. & Jasin, M. Collaboration and competition between DNA doublestrand break repair pathways. FEBS Lett 584, 3703-8 (2010).  87.  Warburg, O. On the origin of cancer cells. Science 123, 309-14 (1956).  88.  Schulz, T.J. et al. Induction of oxidative metabolism by mitochondrial frataxin inhibits cancer growth: Otto Warburg revisited. J Biol Chem 281, 977-81 (2006).  89.  Tann, A.W. et al. Apoptosis Induced by Persistent Single-strand Breaks in Mitochondrial Genome: Critical role of EXOG (5'-Exo/endonuclease) in their repair. J Biol Chem 286, 31975-83 (2011).  90.  Petrozzi, L., Ricci, G., Giglioli, N.J., Siciliano, G. & Mancuso, M. Mitochondria and neurodegeneration. Biosci Rep 27, 87-104 (2007).  91.  Rassool, F.V. et al. Reactive oxygen species, DNA damage, and error-prone repair: a model for genomic instability with progression in myeloid leukemia? Cancer Res 67, 8762-71 (2007).  92.  Schon, E.A. & Przedborski, S. Mitochondria: the next (neurode)generation. Neuron 70, 1033-53 (2011).  93.  Recks, M.S. et al. Axonal damage and its significance for the concept of neurodegeneration in multiple sclerosis. Fortschr Neurol Psychiatr 79, 161-70 (2011).  94.  Plo, I. et al. Association of XRCC1 and tyrosyl DNA phosphodiesterase (Tdp1) for the repair of topoisomerase I-mediated DNA lesions. DNA Repair (Amst) 2, 1087-100 (2003).  95.  El-Khamisy, S.F. To live or to die: a matter of processing damaged DNA termini in neurons. EMBO Mol Med 3, 78-88 (2011).  96.  Szakacs, G., Paterson, J.K., Ludwig, J.A., Booth-Genthe, C. & Gottesman, M.M. Targeting multidrug resistance in cancer. Nat Rev Drug Discov 5, 219-34 (2006).  97.  Klein, C.A. Cancer. The metastasis cascade. Science 321, 1785-7 (2008).  98.  Wang, C. Childhood Rhabdomyosarcoma: Recent Advances and Prospective Views. J Dent Res (2011).  101  99.  Quindry, J. et al. Muscle Fiber Type and Blood Oxidative Stress Following Eccentric Exercise. Int J Sport Nutr Exerc Metab (2011).  100.  Robin, M.A., Prabu, S.K., Raza, H., Anandatheerthavarada, H.K. & Avadhani, N.G. Phosphorylation enhances mitochondrial targeting of GSTA4-4 through increased affinity for binding to cytoplasmic Hsp70. J Biol Chem 278, 18960-70 (2003).  101.  Coene, E.D. et al. Phosphorylated BRCA1 is predominantly located in the nucleus and mitochondria. Mol Biol Cell 16, 997-1010 (2005).  102.  Marchenko, N.D., Zaika, A. & Moll, U.M. Death signal-induced localization of p53 protein to mitochondria. A potential role in apoptotic signaling. J Biol Chem 275, 16202-12 (2000).  103.  Chattopadhyay, R. et al. Identification and characterization of mitochondrial abasic (AP)-endonuclease in mammalian cells. Nucleic Acids Res 34, 2067-76 (2006).  104.  Liu, P. et al. Removal of oxidative DNA damage via FEN1-dependent longpatch base excision repair in human cell mitochondria. Mol Cell Biol 28, 497587 (2008).  105.  Cogswell, P.C. et al. NF-kappa B and I kappa B alpha are found in the mitochondria. Evidence for regulation of mitochondrial gene expression by NFkappa B. J Biol Chem 278, 2963-8 (2003).  106.  Holt, I.J. Mitochondrial DNA replication and repair: all a flap. Trends Biochem Sci 34, 358-65 (2009).  107.  Zhang, H. et al. Human mitochondrial topoisomerase I. Proc Natl Acad Sci U S A 98, 10608-13 (2001).  108.  Huang, S.Y., Pommier, Y. & Marchand, C. Tyrosyl-DNA Phosphodiesterase 1 (Tdp1) inhibitors. Expert Opin Ther Pat 21, 1285-92 (2011).  109.  Goldberg, B. & Stern, A. Production of superoxide anion during the oxidation of hemoglobin by menadione. Biochim Biophys Acta 437, 628-32 (1976).  110.  Sohal, R.S. Mitochondria generate superoxide anion radicals and hydrogen peroxide. FASEB J 11, 1269-70 (1997).  102  111.  Demontis, G.C., Longoni, B. & Marchiafava, P.L. Molecular steps involved in light-induced oxidative damage to retinal rods. Invest Ophthalmol Vis Sci 43, 2421-7 (2002).  112.  Collier, R.J. et al. Complement Deposition and Microglial Activation in the Outer Retina in Light-Induced Retinopathy: Inhibition by a 5-HT1A agonist. Invest Ophthalmol Vis Sci (2011).  113.  Cheng, K.C., Cahill, D.S., Kasai, H., Nishimura, S. & Loeb, L.A. 8Hydroxyguanine, an abundant form of oxidative DNA damage, causes G-T and A-C substitutions. J Biol Chem 267, 166-72 (1992).  114.  Lesher, D.T., Pommier, Y., Stewart, L. & Redinbo, M.R. 8-Oxoguanine rearranges the active site of human topoisomerase I. Proc Natl Acad Sci U S A 99, 12102-7 (2002).  115.  Pommier, Y. et al. Repair of topoisomerase I-mediated DNA damage. Prog Nucleic Acid Res Mol Biol 81, 179-229 (2006).  116.  Halliwell, B. Antioxidants in human health and disease. Annu Rev Nutr 16, 3350 (1996).  103  Appendix A: Analysis of mtDNA deletion in mouse A control region was previously published that was used as internal control for mtDNA deletion analysis. Arrows show the location of primers used (A). Schematic diagram showing deletion of D-17 region in mtDNA during oxidative stress. The 3821 bp deletion region is flanked by two repetitive sequences (black boxes) and when recombination takes place between these homologous sequences, the deletion occurs. The fate of the 3821 bp deletion is unknown, either it may get lost from mitochondria or may remain inside the mitochondria as an episome. Arrows show the location of primers in mtDNA for the detection of the deletion (B). Numbers indicate position in mtDNA (A and B). Ref: Tanhauser, S.M. & Laipis, P.J. Multiple deletions are detectable in mitochondrial DNA of aging mice. J Biol Chem 270, 24769-75 (1995).  104  Appendix B: Full list of TDP1 expression in different human tissues. Hints: +++ = Highly expressed; ++ = Moderately expressed; + = Weakly expressed; - = Not expressed. System and Tissue  Brain and CNS Cerebellum Pia mater Stellate cell Basket cell Purkinje cells Granular cells White matter Spinal cord Dura mater Pia mater White matter Gray matter Ventral horn Dorsal horn Gray commissure Mid brain Neuron Axon Dendrite Synapse Schwann cell Pons Neurons Transverse fiber Neurons Med. Long Fasc. Frontal Lobe Pia mater White matter Neuroglial cell Granule cell Pyramidal cell Frontal lobe layers Molecular layer External granule layer External pyramidal layer Internal granule layer Internal pyramidal layer  Expression Cytoplasmic  Nuclear  Both  ++ + + ++ + ++  + +/+  + + ++  ++ ++ +++  ++ + ++  ++ + +++  ++ ++ +++  + + +  ++ ++ +++  +++ +++ +++ +++ +  -  -  +++ +++ +++  -  -  ++  -  -  ++ ++ +++  ++ + +  ++ ++ +++  ++ ++ ++ ++ ++  + + ++ +  ++ ++ ++ ++  105  System and Tissue  Multiform layer Cardiovascular Heart Epicardium Myocardium Purkinje fiber Endocardium Blood vessels Endothelium Intima Smooth muscle Endocrine (not gonads) Thyroid Follicular cells Parafollicular cells Parathyroid Chief cells Oxyphil cells Pancreatic islets Adrenal cortex Zona glomerulosa Zona fasiculata Zona reticularis Adrenal medulla Pulmonary Trachea & bronchia Goblet cells Lamina propia Serous/mucous glands Ciliated mucosa Clara cell Alveolae Type I pneumocyte Type II pneumocyte Dust cell Stroma Gastrointestinal Esophagus Stratified sq. epithelium Columnar epithelium Lamina propria Muscularis mucosa  Expression Cytoplasmic +  Nuclear +  Both +  +++ +++ -  +/+  -  +  -  -  + -  + +  + +  +/++ +  + + ++  + ++ ++  ++ + + +++  ++ + + ++  ++ + + +++  +++ ++ ++ ++ ++  +++ ++ + + +  +++ ++ ++ ++ ++  ++ + ++ ++  + + ++ -  + + ++ -  +++ +++ +/++  +++ +++ + +  +++ +++ + ++  106  System and Tissue Glands Serosa Stomach Mucosa Muscularis Small intestine Mucosa Muscularis Large intestine Mucosa Muscularis Liver Heptocytes Kupffer cells Bile duct Gall bladder Exocrine pancreas Acinar cell Genitourinary Testes Leydig cells Sertoli cells Prostate Smooth muscle Columnar cell (parenchyma) Ovary Primary oocyte Primary follicle Oocyte Kidney Capsule Medulla Medullary rays Glomeruli Proximal tubules Macula densa Distal tubules Loops of Henle Collecting ducts Bladder Transitional epithelium Inner longitudinal Middle circular Outer longitudinal  Expression Cytoplasmic + +  Nuclear +/-  Both + -  +++ +  +++ +/-  +++ +  +++ ++  + ++  +++ ++  +++ +  + +  +++ +  + ++ +++ +++  ++ ++ +++ +++  ++ +++ +++ +++  +  ++  ++  +++ ++  +++ -  +++ -  + ++  ++  ++  +++ +++ +++  + + +/-  +++ +++ +++  + ++ + ++ +/++ ++ -  +/+ +/+ + + + -  + ++ + ++ + ++ + -  + ++ ++ ++  +/+ + +  + + + +  107  System and Tissue Blood & Immune Spleen Red pulp White pulp Thymus Cortex Medulla Corpuscle Lymph node Germinal center Medulla Cortex Peyer’s patch Bone marrow Megakaryocyte lineage RBC lineage WBC lineage Musculoskeletal Endochondral Bone Periosteum Osteoblasts Osteoclasts Growth plate Proliferative zone Hypertrophic zone Calcification zone Hyaline cartilage Fibrous perichondrium Chondrogenic perichondrium Tendon/connective tissue Skeletal muscle Myofiber Satellite cell Fascia Adipose  Expression Cytoplasmic  Nuclear  Both  +++ +++  + +  +++ +++  ++ ++ +++  +/+ +++  + ++ +++  ++ ++ ++  + + ++ +  ++ ++ ++  -  + +  -  ++ +++ +++ ++ ++ ++ ++  ++ +++ +++ + + ++ ++  ++ +++ +++ + + ++ ++  +++  +++  +++  +++ ++  +++ ++  +++ ++  + +  -  -  ++  ++  ++  108  Appendix C: Representative photographs of TDP1 expression in different human systems.  Scale bar = 20 µm.  109  Scale bar = 20 µm.  110  Scale bar = 20 µm.  111  Scale bar = 20 µm.  112  Scale bar = 20 µm.  113  Scale bar = 20 µm.  114  Scale bar = 20 µm.  115  Scale bar = 20 µm.  116  Scale bar = 20 µm.  117  Scale bar = 20 µm.  118  Scale bar = 20 µm.  119  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0072543/manifest

Comment

Related Items