UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Patterns of domestication in the Compositae and beyond Dempewolf, Hannes 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2012_spring_dempewolf_hannes.pdf [ 3.59MB ]
Metadata
JSON: 24-1.0072532.json
JSON-LD: 24-1.0072532-ld.json
RDF/XML (Pretty): 24-1.0072532-rdf.xml
RDF/JSON: 24-1.0072532-rdf.json
Turtle: 24-1.0072532-turtle.txt
N-Triples: 24-1.0072532-rdf-ntriples.txt
Original Record: 24-1.0072532-source.json
Full Text
24-1.0072532-fulltext.txt
Citation
24-1.0072532.ris

Full Text

Patterns of domestication in the Compositae and beyond  by  Hannes Dempewolf   B.Sc. (Hons), The University of Edinburgh, 2006    A DISSERTATION SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF      DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE STUDIES  (Botany)  THE UNIVERSITY OF BRITISH COLUMBIA  (Vancouver)        December 2011  © Hannes Dempewolf, 2011   ii Abstract Domestication is the process of evolutionary change that results in the phenotypic and genetic differences between a crop species and its ‘wild’ progenitor. Domesticated species vary widely in their phylogenetic diversity, diversity of uses, and degree of domestication. Here, we attempt to better understand the traits and processes that govern this diversity of domesticated species by taking a comparative view of domestication. First, we compare patterns of domestication in the Compositae family (chapter 2) and propose that the prevalence of secondary defense compounds, the lack of carbohydrates that can be digested by the human gut, and the predominantly mechanical or wind-dependent seed dispersal syndrome of the family are key reasons for the apparent paucity of crops in the Compositae family. We then report on the establishment of genomic tools and resources in the form of a library of expressed sequence tags, a set of microsatellite loci, and the full sequence of the chloroplast genome for one particular domesticated species in the Compositae, the oil-seed crop Noug (Guizotia abyssinica) (chapter 3). A combination of genotypic, phenotypic and eco-geographic analyses is then used to test whether high levels of crop-wild gene flow and/or unfavorable phenotypic correlations are the reason why noug appears to be only semi-domesticated (chapter 4). Even though we did not find evidence for either of these hypotheses, our data revealed evidence of local adaptation of noug cultivars to different precipitation regimes, as well as high levels of phenotypic plasticity, which may permit reasonable yields under diverse environmental conditions. We then suggest that domestication may also have been slowed by noug’s outcrossing mating system. The idea that transitions in mating systems and other reproductive barriers between crops and their wild progenitors play a role in domestication is then further explored in a systematic comparison of several crops of major economic importance within and beyond the Compositae family (chapter 5). The majority of such crops appear to indeed be isolated from their progenitors by one or more   iii r   eproductive barriers, even in the absence of geographical isolation during domestication.    iv  Preface A version of chapter 2 has been published as: Dempewolf, H., Rieseberg, L.H. & Cronk, Q.C.B. (2008) Crop domestication in the Compositae: a family-wide trait assessment. Genetic Resources and Crop Evolution, 55, 1141-1157. I helped conceive the idea, conducted the literature survey and wrote the manuscript. LHR and QCB helped conceive the study and edited the manuscript. A version of chapter 3 has been published as: Dempewolf, H., Kane, N.C., Ostevik, K.L., Geleta, M., Barker, M.S., Lai, Z., Stewart, M.L., Bekele, E., Engels, J.M.M., Cronk, Q.C.B. & Rieseberg, L.H. (2010a) Establishing genomic tools and resources for Guizotia abyssinica (L.f.) Cass. - the development of a library of expressed sequence tags, microsatellite loci, and the sequencing of its chloroplast genome. Molecular Ecology Resources, 10, 1048-1058. I helped conceive the study, conducted a large part of the analyses and wrote the entire manuscript. KLO and I developed and tested the microsatellite primers. MLS and I extracted the chloroplast DNA. NCK and MSB helped with the bioinformatics analysis and contributed by editing the manuscript. ZL constructed the expressed sequence tag library. JMME, EB and QCBC helped conceive the idea and edited the manuscript. LHR helped conceive the idea, edited the manuscript and provided technical advice. A version of chapter 4 has been prepared for publication and is soon to be submitted as: Dempewolf, H., Tesfaye, M., Teshome, A., Bekele, E., Engels, J.M.M., Cronk, Q.C.B. & Rieseberg, L.H. Patterns of domestication in the Ethiopian oil-seed crop Noug (Guizotia abyssinica). I helped conceive the study, collected most of the data, conducted all of the analyses and wrote the entire manuscript. MT collected phenotypic data, AT and EB supported the germplasm collection efforts and JMM, QCBC and LHR helped conceive the study, gave advice on experimental design and helped edit the manuscript.   v A version of chapter 5 has been prepared for publication and is soon to be submitted as: Dempewolf, H., Hodgins, K., Rummel, S., Ellstrand N. & Rieseberg, L.H. Is reproductive isolation a domestication trait? LHR, KH and I conceived the study. SR and I collected the data from the literature. I conducted the analyses and wrote most of the manuscript. KH and LHR ontributed to the writing of the manuscript and NE edited the manuscript. c   Similar information is listed in the footnotes on the first page of each of these chapters.   vi   Table of Contents Abstract ......................................................................................................................................... ii Preface .......................................................................................................................................... iv Table of Contents ......................................................................................................................... vi List of Tables ................................................................................................................................ ix List of Figures ............................................................................................................................... x Acknowledgements ...................................................................................................................... xi 1 Introduction ............................................................................................................................... 1 1.1 The process and ‘degree’ of domestication ...................................................................... 2 1.2. Overview of research chapters and research goals ........................................................ 3 1.2.1 Chapter 2: Crop diversity and domestication in the Compositae .................................. 3 1.2.2 Chapters 3 & 4: Focus on Noug (Guizotia abyssinica) ................................................. 4 1.2.3 Chapter 5: Domestication and reproductive isolation ................................................... 6 2 Crop Domestication in the Compositae: a Family-wide Trait Assessment .......................... 8 2.1 Introduction ........................................................................................................................ 8 2.2 The process of domestication ............................................................................................. 9 2.3 Level of domestication of food crops in the Compositae ............................................... 10 2.4 The potential of Compositae for domestication ............................................................. 11 2.5 Other economically important members of the Compositae ........................................ 13 2.6 Why so few domesticated food plants? ........................................................................... 15 2.6.1 Secondary compounds ................................................................................................. 15 2.6.2 Allergenicity of Compositae ........................................................................................ 17   vii 2.6.3 Nutritional considerations ............................................................................................ 18 2.6.4 Adaptive traits .............................................................................................................. 19 2.6.5 Genetic considerations ................................................................................................. 20 2.6.6 Cultural considerations ................................................................................................ 21 2.7 Conclusions ........................................................................................................................ 22 3 Establishing Genomic Tools and Resources for Guizotia abyssinica (L.f.) Cass. - The Development of a Library of Expressed Sequence Tags, Microsatellite Loci, and the Sequencing of its Chloroplast Genome ..................................................................................... 29 3.1 Introduction ...................................................................................................................... 29 3.2 Methods ............................................................................................................................. 31 3.2.1 EST library development and analyses........................................................................ 31 3.2.2 Microsatellite marker development ............................................................................. 33 3.2.3 Chloroplast DNA sequencing and analyses ................................................................. 35 3.3 Results and discussion ...................................................................................................... 37 3.3.2 Analyses of EST library .............................................................................................. 37 3.3.3 Microsatellite analyses................................................................................................. 38 3.3.4 Chloroplast genome analysis ....................................................................................... 39 4 Patterns of Domestication in the Ethiopian Oil-seed Crop Noug (Guizotia abyssinica) .... 51 4.1 Introduction ...................................................................................................................... 51 4.1.1 Crop-wild gene flow .................................................................................................... 53 4.1.2 Unfavorable phenotypic correlations ........................................................................... 53 4.2 Methods ............................................................................................................................. 54 4.3 Results ................................................................................................................................ 57 4.4 Discussion .......................................................................................................................... 58   viii 4.5 Conclusions ........................................................................................................................ 61 5 Is Reproductive Isolation a Domestication Trait? ................................................................ 69 5.1 Introduction ...................................................................................................................... 69 5.2 Methods ............................................................................................................................. 72 5.2.1 Literature survey .......................................................................................................... 72 5.2.2 Characterization of reproductive barriers .................................................................... 73 5.3 Results ................................................................................................................................ 74 5.4 Discussion .......................................................................................................................... 76 5.4.1 Reproductive barrier strength in domesticated species ............................................... 76 5.4.2 The taxonomy of crop plants in relation to reproductive barrier strength ................... 79 5.4.3 Uniparental reproduction and domestication ............................................................... 80 5.5 Conclusions ........................................................................................................................ 82 6 Conclusion ................................................................................................................................ 86 6.1 A ‘comparative view’ of domestication ........................................................................... 86 6.2 Context of current research findings, possible applications and future directions .... 87 Bibliography ................................................................................................................................ 91 Appendices ................................................................................................................................ 111 A.1 List of uses of some species in the Compositae and a few major crops of other families  .................................................................................................................................. 111 A.2 GOSlim category comparison between noug and a sample of Compositae ............. 115 A.3 Unigene origins of microsatellites ................................................................................. 117 A.4 Non-coding sequences and short protein-coding sequences ...................................... 119 A.5 Literature survey results ............................................................................................... 123    ix   List of Tables Table 2.1 Five indicators of the level of domestication................................................................ 23 Table 2.2 Degree of domestication for some species in the Compositae that are suitable for human consumption .............................................................................................................. 24 Table 3.1 GOSlim annotations for the noug EST database and a pooled sample of other Compositae EST databases (Barker et al. 2008; Laitinen et al. 2005) ................................. 42 Table 3.2 Characteristics of microsatellites .................................................................................. 44 Table 3.3 Protein coding genes and important non-coding sequences ......................................... 47 Table 4.1 Phenotypic trait correlations of a selected number of traits related to plant architecture  .............................................................................................................................................. 63 Table 4.2 Phenotypic differences among noug accessions from different precipitation regimes 64    x  List of Figures Figure 2.1 Taxonomic diversity and number of strongly domesticated crops in a selection of Angiosperm families. ............................................................................................................ 26 Figure 2.2 Simplified phylogeny of the Compositae after Funket al. (2005), showing tribal relationships and the placement of the economically most important food crops. ............... 27 Figure 2.3 Diagrammatic representation of the different plant parts that show signs of strong artificial selection in Compositae species. ............................................................................ 28 Figure 3.1 Histogram of noug gene duplication ages and fitted mixture model analyses. ........... 48 Figure 3.2 Assembled Guizotia chloroplast genome. ................................................................... 49 Figure 3.3 Dotplot comparison showing conserved regions found in both Guioztia (x axis) and Helianthus (y axis) chloroplast genomes. ............................................................................. 50 Figure 4.1 A map of Ethiopia showing the location for each collection (in red). ........................ 65 Figure 4.2 NMDS analysis of phenotypic data of both sites (red = Holetta site 1 and blue = Ginchi site 2) showing correlations with environmental variables. ..................................... 66 Figure 4.3 Estimates of Delta K, which can be used as an indicator for the optimal number of clusters, K, as described by Evanno et al (2005). ................................................................. 67 Figure 4.5 Assignment of individuals to two clusters (k=2) by the program STRUCTURE. ...... 67 Figure 4.6 Assignment of noug genotypes to 2, 3, 4 and 10 different clusters by the program STRUCTURE. ...................................................................................................................... 68 Figure 5.1 Level of taxonomic differentiation for the 29 species included in the analysis. ......... 84 Figure 5.2 Hybrid fitness of crop/progenitor crosses for the species included in the analysis..... 84 Figure 5.3 Transition in mating system during domestication. .................................................... 85 Figure 5.4 Breakdown of self-incompatibility during domestication. .......................................... 85   xi Acknowledgements I am very grateful to my wife, Anne, for all the emotional support as well as scientific, statistical and editorial advice she has given me throughout the duration of my PhD. I couldn’t have done it without her. I would probably never have dared to embark upon this thesis without the unwavering support of my family, who have always encouraged me to follow my dreams – even to the most distant shores. I am also greatly indebted to the many Ethiopian farmers who we met during  our collecting trips and who have always generously shared with us their knowledge, experiences, and seeds. A big thank-you also goes to my Ethiopian collaborators at the Ethiopian Institute of Agricultural Research and Addis Ababa University. Without their logistical and scientific support, this work would not have been possible. Furthermore, I would like to thank both of my PhD advisers, Loren Rieseberg and Quentin Cronk, as well as my external adviser, Jan Engels - all three of whom have supported (almost) all of my ideas with great encouragement and enthusiasm, even when faced with the most unusual travel reimbursement requests. A big thank-you also goes to Jeannette Whitton, Catherine D’Andrea and Sally Otto, with whom I was lucky to be able to consult with at various stages of my PhD. I would also like to acknowledge the financial support I received for the research presented here, which came in the form of several research grants from the Canadian International Development Agency (CIDA), the Canadian National Science and Engineering Research Council (NSERC), and the US National Science Foundation (NSF). Last but not least, a huge thank-you goes to all past and present members of the Rieseberg lab, who have been equally generous with their helpful advice as well as (off-colour) jokes and helped to make my PhD journey seem more like fun than work.   1 1 Introduction Charles Darwin cited domesticated plants and animals as inspiration for his newly developed theory of evolution by natural selection (Darwin 1859; Darwin 1868). Since then, the study of crop domestication has helped to build many of the key ideas of evolutionary biology, and crop diversity has been a treasure-trove of empirical evidence for evolutionary processes. Domestication is the process of evolutionary change that results in phenotypic and genetic differences between a crop species and its ‘wild’ progenitor. It is also an important example of the evolutionary impact humans can have on natural populations. Darwin (1868) rightly called domestication ‘an experiment on a gigantic scale’ and it is an experiment from which we can learn important lessons for future interactions between humans and natural systems on our planet. As in the case of domestication, other human-induced selection pressures, such as climate change, are thought to be of a magnitude great enough to result in large organismal changes over a short period of time (Gepts 2004). The nature of selection during domestication has been the focus of numerous studies; scientists continue to debate whether ‘conscious’ selection pressures exerted by humans to select for certain traits are more important during domestication than ‘unconscious’ selection pressures that result in the adaptation of species to cultivation in agronomic environments (Gepts and Papa 2002; Harlan et al. 1973; Zohary et al. 1998; Purugannan and Fuller 2009). Biologists have long been interested in the type, strength and duration of selection pressures during domestication, but more recent research in this area has aimed at better understanding why certain species have been domesticated rather than other species, and why domestication has had such vastly different effects on different species (Diamond 1997a,b and 2002). These are also important considerations in the context of global climate change. Do species with particular traits differ in their response to strong selection pressures, such as rapidly changing climatic conditions? The main goal of this thesis work is to   2 obtain a better understanding of how the process of domestication has affected species in the Compositae family as a whole and which factors influence the domestication process of one crop in this family in particular, the Ethiopian oil-seed crop Noug (Guizotia abyssinica). The final chapter explores domestication beyond the limits of the Compositae family, where we focus on understanding how barriers to reproduction between crops and their progenitors have influenced the domestication process of many of the world’s major crops.  1.1 The process and ‘degree’ of domestication Domestication is not a singular event that occurs at a certain point in time, but rather should be viewed as a gradual process (Zeder et al. 2006). Furthermore, many researchers distinguish the process of crop domestication from the process of crop diversification, which commonly starts well after the domestication process has begun and can result in a great diversity of different crop varieties (Purugannan and Fuller, 2009). Some crops seem to have moved further along the process of domestication than others. For example maize (Zea mays) exhibits a clear set of phenotypic differences when compared with its wild progenitor teosinte, such as increased kernel size, loss of ear shattering, and apical dominance (Doebley et al. 1997; Doebley 2004). However, crops such as the Ethiopian grain t’ef  (Eragrostis tef), which has been under cultivation in the Horn of Africa for several thousand years, still has very small seeds, shatters in the field and has multiple branches (D’Andrea 2008). Why does domesticated Te’f differ so significantly from domesticated maize? One possibility is that Te’f has simply not moved along the process of domestication as far as maize and therefore at present remains only ‘semi-domesticated’. There are other researchers, however, who argue that it is incorrect to consider such plants “primitive” domesticates that never underwent intensive selection by humans, but rather that they should be viewed as a different kind of domesticated species, which   3 have mainly been cultivated and selected for traits that enable them to produce reasonable yields even under challenging environmental conditions (D’Andrea 2008). Scientists have applied many different labels to such minor crops, such as ‘semi- domesticated crops’, ‘minor crops’, ‘orphan crops’ or ‘neglected and underutilized species’. What most of these crops have in common is a severe lack of attention by the scientific community – not only in terms of applied agricultural research, but also with respect to more basic research into their genomics and evolution. What are the evolutionary forces that have lead to what appears to be ‘weaker’ or rather ‘different’ domestication syndromes in these minor crops compared to many other closely related but major crops? Are there factors that hinder such species from becoming domesticated in the same way? Are environmental conditions, genetic factors, or consciously guided selection pressures by humans key to this observation? In the fourth chapter of this thesis, we explore why one such crop, the Ethiopian oil-seed crop noug (Guizotia abyssinica) appears to remain semi-domesticated despite millennia of cultivation.    1.2. Overview of research chapters and research goals 1.2.1 Chapter 2: Crop diversity and domestication in the Compositae A large part of this thesis focuses on the Compositae plant family, which is the world’s largest plant family in terms of currently recognized species (23,000 species ± 1000; Anderberg et al. 2007). This family is a particularly intriguing taxonomic group for studies of the domestication process, since despite its large size it contains relatively few major crops. However, several different species have been domesticated for a broad range of uses and hence in different taxa, different parts of the plant show signs of artificial selection. Sunflower (Helianthus annuus) has been domesticated for its seed, lettuce (Lactuca sativa) for its edible leaves and Jerusalem artichoke (Helianthus tuberosus) for its edible tuber, to name just a few.   4 Diversity exists not only in the uses of these different crops but also in the degree to which the different crop species appear to have been domesticated. To better understand this diversity of crops and the reasons for the relative paucity of domesticated species in this family, we set out on a ‘family-wide trait assessment’, in the second chapter of this thesis. The work on this chapter allowed us to develop an appreciation of the large diversity of useful species and domesticated crops in a single plant family and how this diversity can be described according to different ‘levels of domestication’.  1.2.2 Chapters 3 & 4: Focus on Noug (Guizotia abyssinica) The oil-seed crop noug (Guizotia abyssinica) has been grown in Ethiopia since at least the 2nd millennium BC and probably much earlier (Boardman 1999; Boardman 2000). It is a member of the Compositae family and one of the most valuable oil-seed crops in Ethiopia (Getinet and Sharma 1996). Noug grows in water-logged soils where other oil-seed crops fail, and its cultivation is beneficial for soil conservation and rehabilitation. Despite its importance to developing countries in East Africa and South Asia, we know essentially nothing about its domestication history and only little about the extent of wild germplasm that might be critical for crop improvement. Noug is an interesting example of a ‘neglected and underutilized species’ in the Compositae. It is widely cultivated in Ethiopia today but has received only limited attention from agricultural scientists and modern breeding techniques have yet to be applied to its improvement. As a consequence, noug remains semi-domesticated; the crop is self-incompatible, highly branched, and flowering heads and seeds are less than one-tenth the size of sunflower. Hence, unlike sunflower, noug does not exhibit strong signs of artificial selection. It superficially looks somewhat like wild sunflowers (Helianthus annuus) and indeed bears a much greater resemblance to its wild relatives than cultivated sunflower does.   5 The comparison with sunflower, which is noug’s most closely related crop relative, is one of the main reasons why this crop is such an intriguing example of a semi-domesticated crop. Sunflower, despite its close phylogenetic position, has responded to human selection pressure quite differently; cultivated sunflowers, unlike their wild progenitors, are single stemmed, often single headed, do not shatter and have much larger seeds (Burke et al. 2002). Why then, when both noug and sunflower have been domesticated as oil-seed crops, do they differ so dramatically in their respective sets of domestication traits? In order to better understand the process of domestication and the diversity of noug populations, it was first necessary to establish genomic resources for the crop. The third chapter of this thesis is dedicated to this effort; we developed a library of expressed sequence tags, 43 microsatellite loci, and sequenced its chloroplast genome. These genomics resources are of considerable importance for the future breeding and improvement of noug. The application of modern breeding efforts to existing crop diversity is one of the most promising and sustainable solutions to improve the yield and quality of neglected and underutilized species, such as noug, so they can contribute to the food security and income of subsistence farmers in the future. Global climate change and degradation of once-productive croplands have further heightened demand for such crops, since they perform well in harsh and/or changing environments (Dempewolf et al. 2010b). We used 16 of the newly developed microsatellite loci to genotype 639 individuals of 29 noug accessions and 4 accessions of the putative progenitor species (chapter 4). This genotyping effort allowed us to explore the hypothesis that rampant introgression has reduced the effectiveness of artificial selection and prevented the evolution of a strong domestication syndrome. The use of microsatellite markers for the study of domestication is particularly useful if their linkage position in relation to domestication genes is known – however for noug information on the identity of domestication genes does not exist and the microsatellite markers   6 were assumed to evolve neutrally. We also conducted a phenotypic trait correlation analysis (also chapter 4) in order to test a second hypothesis that selection for highly branched plants with more flower heads and therefore more seeds precludes the selection of larger seeds due to phenotypic correlations. We conclude the fourth chapter by suggesting that domestication may have been slowed by noug’s outcrossing mating system, since this may facilitate gene-flow between different noug populations and impede the ability of farmers to select easily on different traits, since a plant with an outcrossing mating system is much less likely to ‘breed true to type’ through self-fertilization.  1.2.3 Chapter 5: Domestication and reproductive isolation The idea that mating systems can play a major role in the domestication process has been explored by previous authors (e.g. Rick 1988) – and also emerged in the fourth chapter on the domestication of noug. If indeed the domestication process is hindered by an outcrossing mating system, then one might predict that a transition from outcrossing to selfing during the domestication process is likely to be a common feature of major crops. A transition to selfing is expected to reduce gene flow between the crop and the progenitor, which may in turn facilitate the response of the crop to further artificial selection. Many crops are at least partially reproductively isolated from their progenitors and wild relatives, but a systematic comparison of barrier strength between crops and their progenitors has, to our knowledge, never been undertaken. Norman C. Ellstrand (2003) states: “It is not clear whether gene flow from cultivated plants to wild plants has reinforced the isolation barriers between them. [...] the whole question of the evolution of isolating barriers between crops and their wild relatives appears to be poorly studied.” This observation lead us to explore the question of the importance of mating systems and,   7 more generally, the role of reproductive isolation between crops and their progenitors in the context of domestication. In the fifth chapter we therefore investigate the hypothesis that reproductive isolation facilitates the process of domestication and we pose the question of whether reproductive isolation should be viewed as a long-overlooked domestication trait. The findings of this final chapter are not only of interest from an evolutionary biology perspective but are also of relevance to practical applications, such as the use of wild germplasm in crop improvement efforts (Tanksley and McCouch 1997) and better understanding the process of ‘gene escape’ of engineered genes from cultivation through crop-wild hybridization (Ellstrand 2001; Snow et al. 2003).     8                                                          2 Crop Domestication in the Compositae: a Family-wide Trait Assessment1  2.1 Introduction Approximately 10% of flowering plant species belong to the Compositae (Funk et al. 2005), making it the largest angiosperm family in terms of named species (Stevens 2007; Anderberg et al. 2007). Despite its great diversity, there are only two major food crops known from the Compositae, sunflower and lettuce, a handful of minor, domesticated crops and several useful species that show little or no signs of domestication (Sauer 1993; Jeffrey 2001). Whereas other large families such as Poaceae, Fabaceae, Solanaceae and Rosaceae have furnished most of our food crops, the main rival to the Compositae in species diversity, the Orchidaceae, has produced only one major food crop, vanilla (Vanilla sp.) (Mansfeld Database 2001; Sauer 1993) (Figure 2.1). Indeed, a cursory survey of major food crops reveals that most derive from a few families, and that there are several genera that have produced multiple domesticated species, such as peppers (genus Capsicum) and beans (genus Phaseolus) (Gepts 2004; Heiser 1969; Ladizinsky 1998). Even within the Compositae, phylogenetic clustering of major, domesticated food crops is apparent; all major, domesticated crop species belong to one of the three main clades (Figure 2.2). These observations imply that the taxonomic affiliation of food crops is an important factor in the study of domestication, whereas the taxonomic diversity of such groups is less important. If species diversity is not the key, then what other factors pre-dispose a group to   1 A version of chapter 2 has been published as: Dempewolf, H., Rieseberg, L.H. & Cronk, Q.C.B. (2008) Crop domestication in the Compositae: a family-wide trait assessment. Genetic Resources and Crop Evolution, 55, 1141-1157.   9 domestication? That is, why are the members of some taxonomic groups more likely to become domesticated than members of others? By examining the suitability of taxa in the Compositae for domestication, we hope to understand why so few Compositae have been domesticated. The family clearly has the potential to produce some crops of major economic importance, as exemplified by sunflower (Helianthus annuus) and lettuce (Lactuca sativa). Several other crops of less economic significance, but with interesting properties nevertheless, also exist (Jeffrey 2001). Remarkably, different species in the Compositae have been domesticated for a wide variety of uses and hence in different taxa, different parts of the plant show signs of artificial selection (Figure 2.3). Sunflower has been domesticated for its seed, lettuce for its edible leaves and Jerusalem artichoke for its edible tuber, to name just a few. No other family shows such a diversity of crop uses - Poaceae and Fabaceae are mainly used for their edible seeds, Rosaceae for their fruits and Solanaceae for their fruits and tubers. This makes the Compositae a particularly intriguing family for the study of domestication.  2.2 The process of domestication Domestication is best viewed as a process rather than an event (Zeder et al. 2006). Viewed in this way, different species, used by humans for different purposes, often exhibit different levels of domestication. The domestication syndrome, which represents the suite of traits that have been affected by artificial selection, varies among taxa. Artificial selection pressures can vary widely and depend both on the life history traits of the emerging crop, such as breeding system and pollination mechanisms, and also on the differential effects of conscious and unconscious selection (Zohary 2004). In an attempt to reach a working classification of useful species in the Compositae according to the level of domestication they exhibit, we allocated an extensive range of species to one of three categories of a ‘domestication index’. Although assessing levels of domestication   10 is challenging, we attempted to do so by employing a range of different factors that we believe are good indicators (Tables 2.1 and 2.2). We are not trying to deliver quantifiable degrees of domestication with this simplified scheme, but rather try to give an indication of how crops could be categorised according to some basic indicators, which include the following: (A) The level of phenotypic differentiation between the domesticated taxon and its wild progenitor (if known); (B) The extent of cultivation in terms of both intensiveness and geographical area; (C) Whether there is evidence of a long history of domestication indicating a long period of mass selection; (D) Whether the useful species’ domestication history is known to include interspecific hybridization or major genetic shifts such as polyploidy; (E) Whether the useful species is known to have been the subject of recent targeted improvement efforts through breeding. Useful species in the Compositae were assigned a ‘+’ or a ‘-’ indicator for the presence or absence, respectively, of each of these indicators. The number of ‘+’ indicators was then summarized across all indicators and used to categorize species according to level of domestication, with none or one ‘+’ sign indicative of weak or no domestication; two or three ‘+’ signs indicative of semi-domestication; and four or five ‘+’ signs indicative of strong domestication. For example, under this system sunflower receives a score of four ‘+’ indicators, and would be assigned the status of ‘‘strongly’’ domesticated––it differs greatly from its progenitor, is cultivated on a large scale, has been cultivated in North America for several thousand years and has been subject to intensive recent breeding efforts. At the other extreme, a useful species such as Stevia (Stevia rebaudiana) receives no ‘+’ sign, indicative of weak or no domestication.    11 2.3 Level of domestication of food crops in the Compositae Our analysis of food crops in the Compositae classified five species as strongly domesticated: safflower (Carthamus tinctorius), endive (Cichorium endivia), chicory (Cichorium intybus), sunflower (Helianthus annuus), and lettuce (Lactuca sativa). An additional five taxa were categorized as semi-domesticated: cardoon (Cynara cardunculus var. altilis), globe artichoke (Cynara cardunculus var. scolymus), noug (Guizotia abyssinica), Jerusalem artichoke (Helianthus tuberosus), and yacon (Smallanthus sonchifolius). Other species in the Compositae that are used for food exhibit either no or only weak signs of domestication (Table 2.2). The number of domesticated taxa is remarkably small, particularly when compared to the great number of useful species in the Compositae; Jeffrey (2001) has recognized 260 species as useful for agriculture and/or horticulture. While this chapter focuses on species that are used for food, we briefly discuss species in the Compositae that have been selected for other purposes, including medicinal, horticultural or industrial uses (Appendix A.1). Most species that show strong signs of domestication are food crops or ornamentals. Signs of domestication are weak or absent in Compositae species of medicinal or industrial value. None of the latter have been heavily cultivated for a long time, benefited from modern breeding efforts or been grown in environments that are intensively controlled by humans - the cause of unconscious selection (Zohary 2004; Heiser 1988). It should be noted that a great variety of Compositae have been domesticated as ornamentals (Jeffrey 2001). However, the factors involved in the domestication of ornamentals are usually quite different from those involved in food crop domestication. As a consequence, and despite the importance of ornamental crops in the Compositae, our focus is mainly on the domestication of food crops.     12 2.4 The potential of Compositae for domestication Here we explore the potential of the Compositae family for domestication and review characters that would suggest that many of its species are suitable for human use. Not only do Compositae exhibit an extremely high taxonomic diversity, but they also inhabit a great diversity of ecological niches and can be found in almost every habitat (Kesseli and Michelmore 1997; Bohm and Stuessy 2001; Anderberg et al. 2007). Geographically they are not restricted to any one land mass and can be found all over the world, except the Antarctic continent (Funk et al. 2005). Furthermore, many of them prefer open habitats, such as grasslands or roadsides. Hence we can be almost certain that when agriculture originated and the first crop plants - mostly cereals and pulses (Kislev and Baryosef 1988; Bellwood 2005) - were domesticated, Compositae were present in those areas. The Compositae are mainly delimited by the clustering of single flowers into a compound inflorescence, called a capitulum (Judd 2002; Anderberg et al. 2007). This arrangement is beneficial for domestication of seed crops, since through the capitulum, many seeds are clustered together on a single stalk, which allows for effective harvesting. Another trait of Compositae species that facilitates domestication is excellent seed storage behaviour (Thormann et al. 2004). Compositae seeds can survive considerable desiccation and show great longevity. All extant seed crops in the Compositae (e.g. sunflower, Helianthus annuus; safflower, Carthamus tinctorius, and noug, Guizotia abyssinica) are grown for their oils, which are low in saturated and rich in mono- and poly-unsaturated fatty acids. Seed oils that contain high levels of mono-unsaturated fatty acids are valued as they appear to contribute to the removal of cholesterol and hence to a reduction of the risk of coronary heart disease (Simpson and Ogorzaly 2001). While none of the crops in the Compositae that are grown today have been domesticated   13 as a source of protein, there is archaeological evidence that sumpweed (Iva annua), which contains high levels of protein, was cultivated by native Americans (Smith 1992). However, the domesticated form was lost after the introduction of new food plants from Europe, which replaced many of the native crops (Diamond 1997a). Other food crops in the Compositae are grown for their edible foliage or for their tubers and roots (Figure 2.3). However, we were unable to identify family-wide traits in the Compositae that would facilitate domestication of leaf or tuber crops.  2.5 Other economically important members of the Compositae Although there are few domesticated species in the Compositae, as previously noted, many species in the family have a wide range of uses other than as food. Examples include medicinal purposes, pesticides or even latex production (Jeffrey 2001; Judd 2002). Here, we generated a list of economically important plants in the Compositae, which have a well- established use (Table 2.2 and Appendix A.1). This list is not comprehensive and other useful or potentially useful species may be retrieved from standard references, such as Mansfeld’s Encyclopedia of Agricultural and Horticultural Crops (Jeffrey 2001) or online databases (Survey of Economic Plants for Arid and Semi-Arid Lands (SEPASAL) database 1999; Mansfeld Database 2001; USDA National Genetic Resources Program 2007). Some of the most potent anti-malarial drugs known to humankind are based on artemisin or derivatives thereof, which was discovered in Artemisia annua (Antimalarial Coordinating Research Group Quinghaosu 1979; Taylor and Berridge 2006). A species in the same genus, Artemisia absinthium, provides flavoring components of the bitter alcoholic beverage, absinthe, including small amounts of a toxin, the monoterpene thujone. Absinthe has been prohibited in several countries because of thujone, but it is experiencing a recent revival because the thujone content in most absinthes is too low to have a harmful effect (Lachenmeier et al. 2006). Likewise,   14 β-sitosterol and stigmasterol extracted from roots of Pluchea indica have been found to neutralize viper and cobra venom (Gomes et al. 2007). All of these uses can be attributed to the great range of secondary compounds that are prevalent in the Compositae - one of the distinguishing features of this family (Heywood et al. 1977; Anderberg et al. 2007). In particular sesquiterpene lactones, alkaloids and terpenoids are abundant (Judd 2002; Anderberg et al. 2007), many of which have probably evolved as a response to herbivory (Heywood et al. 1977; Anderberg et al. 2007). In addition to the beneficial uses of Compositae species, the family is well known for its weeds, which have considerable negative economic effects (Anderberg et al. 2007). While the perception that most members of the family are ‘weedy’ has been questioned recently due to the restricted geographic distribution of most species (Funk et al. 2005), many economically detrimental agricultural weeds are indeed members of the Compositae. For instance, in the United States 116 species within the Compositae, the most of any plant family, are listed as noxious weeds in at least one U.S. State (USDA National Genetic Resources Program 2007). Furthermore, it has been shown that the evolutionary transition to weediness (i.e. adaptation to agricultural habitats) has occurred numerous times within the genus Helianthus and many times within the common sunflower (Helianthus annuus) alone (Kane and Rieseberg 2008). These data imply that the family is pre-disposed to the evolution of weediness. Presumably, the preference of the family for open and disturbed habitats facilitates weed formation (Sauer 1993). ‘Weediness traits’ such as high reproductive rates, fast growth and ease of germination are characteristics of many members of the Compositae family. Such traits are typical of weeds as well as crops, which is further indication that such attributes are of relevance in crop domestication. A weedy habit would also bring Compositae species to the attention of early farmers, as Compositae likely invaded early cultivated fields, much as they do now. This might lead to   15 domestication, such as in the case of domesticated rye (Secale cereale subsp. cereale), whose wild progenitor is a common weed of wheat fields in South-west Asia (Ladizinsky 1998). Examples of species with a weedy habit in the Compositae that have become domesticated include common sunflower, Jerusalem artichoke, lettuce, and chicory. One should note, however, that most Near Eastern grain crops do not have weedy wild relatives (Abbo et al. 2005) and the relevance of ‘weediness’ for crop origins remains controversial.  2.6 Why so few domesticated food plants? Given that availability to early farmers, seed-oil quality, storability and diversity should have favoured domestication of Compositae species, why were so few domesticated? Are there other attributes of the Compositae that might reduce the likelihood of domestication? We speculate that a combination of traits may account for this observation, including the high proportion of secondary defence compounds, the presence of inulin rather than starch as a storage carbohydrate and the predominant wind and mechanical dispersal syndromes of the family.  2.6.1 Secondary compounds The great diversity and abundance of secondary compounds such as sequiterpene lactones, alkaloids and terpenoids in Compositae species may be a barrier to the domestication of food crops (Heywood et al. 1977; Judd 2002). As mentioned above, many of these secondary compounds were likely part of an evolutionary response to deter herbivores. For example, ragwort (Jacobaea vulgaris), which is common in pastures, contains pyrrolizidine alkaloids that may be lethal to grazing mammals (Naumann et al. 2002; Heywood et al. 1977). Interestingly,   16 caterpillars of the Cinnabar moth (Tyria jacobaeae) avoid predation by eating the leaves of ragwort, thereby accumulating alkaloids that are toxic to their predators (Naumann et al. 2002). The presence of pyrrolizidine alkaloids might be one reason why the largest tribe in the Compositae, the Senecioneae, has produced no food crops that have been domesticated to even a nominal degree. One might view the ‘human animal’ as just another herbivore that has been deterred by the secondary chemistry of the Compositae. However, of the few crops in the Compositae, three are mainly used for their edible leaves: lettuce (Lactuca sativa), endive (Cichorium endivia) and chicory (Cichorium intybus). Artificial selection can clearly enhance palatability in some instances through secondary compound reduction. Interestingly, lettuce may have been domesticated in Egypt initially as an oil-seed crop rather than for edible leaves (Keimer 1924; de Vries 1997). If so, we speculate that protection from herbivory by early farmers might have reduced natural selection for secondary compound production, eventually rendering the leaves more palatable to humans. Once farmers had discovered the edibility of lettuce leaves, they might have actively selected for less bitter tasting leaves. This might explain why some lettuce varieties grown for their oil-seeds in Egypt today have bitter tasting leaves (Harlan 1986). Even modern varieties of lettuce can still induce diuretic effects if they are consumed in large quantities. Due to higher levels of sesquiterpene lactones, chicory and endive are more bitter and less widely cultivated than lettuce (de Kraker et al. 1998; Seto et al. 1988). Of course it should be noted that the Solanaceae also contains a great richness of secondary defence compounds, but have produced many major food crops. Most Solanaceae display a diverse array of alkaloids, such as nicotine or other steroid or tropane alkaloids (Judd 2002). Hence the rich secondary chemistry of the Compositae cannot alone explain the low number of Compositae crops in comparison to the Solanaceae. However, the Compositae lack   17 the nutritious fruit that was the target of selection for several Solanaceae, perhaps accounting at least in part for the differences in the number of food crops between these families (see section on ‘Adaptive traits’).  2.6.2 Allergenicity of Compositae Secondary compounds also play a major role as allergens. Ragweed (Ambrosia artemisiifolia and Ambrosia trifida), and mugwort (Artemisia vulgaris) pollen grains are particularly well-known allergens (Wopfner et al. 2005). Indeed, pollen of ragweed growing in southern Hungary can be transported with wind-currents as far as central Italy and cause allergenic responses in such regions, where ragweed is not known to occur (Lorenzo et al. 2006). Other studies suggest that cosmetics and herbal remedies containing arnica (Arnica montana) and German chamomile (Matricaria recutita) may cause contact sensitization (Paulsen 2002). Among scientists working with Compositae, the potential allergenic effects are well known. There are frequent reports of students with no signs of allergenicity at the start of their graduate studies becoming allergic to their Compositae target species after a few years. Hence, precautions such as wearing gloves and face masks during pollination studies are often taken (Whitton, personal communication). Diamond (1997a) suggests that the potential of sumpweed pollen to cause allergies may have contributed to the extinction of the domesticated form. It is easy to imagine why a farmer might refrain from tending an allergenic crop. Interestingly, although many species in the Poaceae, in particular the grasses, are well known to have pollen that causes allergenic reactions in many people, this family is home to some of our most important food crops such as rice and wheat. Therefore the potential allergenicity of the Compositae cannot fully explain the small number of domesticated food plants.    18 2.6.3 Nutritional considerations Oils from Compositae seeds have nutritional value because of the high proportion of unsaturated fatty acids (Simpson and Ogorzaly 2001). However, such oils go rancid faster and are less storable than oils with greater amounts of saturated fatty acids (Rossell 1994). Early farmers presumably did not recognize the potential health benefits of oils with unsaturated fatty acids (Simpson and Ogorzaly 2001), but they probably did have a preference for oils that could be stored for longer periods. Many of the crops that dominate agriculture today are grown as a source of carbohydrates, mainly starch, such as rice, wheat and potato. The dominance of high-carbohydrate crops is not surprising given the caloric intake gained by digesting these major starch staples. The lack of a major high-starch crop in the Compositae has a simple explanation: the family produces inulin rather than starch as its storage carbohydrate (Heywood et al. 1977; Anderberg et al. 2007), which also holds true for the tuberous crops Jerusalem artichoke and yacon. Inulin is indigestible by the human gut because we lack the enzyme to break it down into monosaccharides that could then be further utilized by the human metabolism (Roberfroid 2005). It passes through the digestive tract until it is partially metabolized by bacteria in the colon leading to the production of methane (Roberfroid 2005). There has been some recent interest in inulin among nutritional scientists for its potential in ‘functional foods’: inulin acts as a dietary fibre, is thought to stimulate the gut microflora, is not harmful to diabetics, and may have other beneficial effects on human health (Roberfroid 2002; Nugent 2005). Inulin is composed of a heterogeneous mixture of fructose polymers (Niness 1999) and it can be broken into its fructose components through heat treatment (Yamazaki and Matsumoto 1993). Some aboriginal communities of the Interior of the Pacific Northwest are known to collect Balsamroot (Balsamorhiza sagittata) and slowly pit- cook it for many hours, which converts most of the inulin into its fructose components resulting in a sweet tasting foodstuff (Peacock 1998). However, humans have a limited ability to   19 metabolize fructose and if over-consumed it can potentially have detrimental effects on human health (Fields 1998; Elliott et al. 2002; Basciano et al. 2005). As a consequence, unlike other large angiosperm families such as Poaceae or Solanaceae, no Compositae crop has been domesticated as a source of starchy carbohydrates. The lack of this key category of food plants maybe the single most important reason for the paucity of domesticated species in the Compositae.  2.6.4 Adaptive traits Many crop relatives from the Solanaceae and Rosaceae are dispersed by animals; seeds or fruits are eaten, and seeds are dispersed following passage through the animal’s digestive tract. Seed dispersal in many Fabaceae is through a ballistic mechanism following dehiscence (Judd 2002; Harlan 1995). Most taxa in the Compositae, however, are adapted to wind dispersal or to dispersal by adhesion to animal fur (Judd 2002; Venable and Levin 1983). Such a dispersal strategy might put a limit on seed and fruit size, as seeds that are too big would not be carried very far by wind or stick to the fur of animals for very long. The same holds true for the Orchidaceae, which produces tiny dust-like seeds, often <1 mm in size, that are also wind dispersed (Judd 2002). Plants that rely on animals to eat their fruit for dispersal might put more resources into fruit production and maintain low levels of toxic compounds in the fruits to make them more attractive, nutritious and harmless to the animal disperser. Such coevolutionary dynamics can be viewed as the disperser having ‘pre-domesticated’ the fruits of many crop progenitors before human intervention (Smartt 1997). This pattern holds true in particular for many crops in the Solanaceae and Rosaceae, where the crop is formed from fruits. Hence Compositae might not have been a major component of foods collected by ancient hunter-gatherers. This pattern, of course, applies to seed and fruit crops only and cannot explain the paucity and low economic   20 value of tuberous crops in the Compositae, such as Jerusalem artichoke (Helianthus tuberosus). Also, the Poaceae have produced many important domesticates, yet have a dispersal strategy similar to that of the Compositae, so this cannot be a complete explanation.  2.6.5 Genetic considerations There might also be a genetic basis to the paucity of Compositae crops. Genetic analysis of domestication is still in its infancy and has focused mainly on a few important crops, such as maize, rice, wheat and tomato (Hancock 2004; Doebley et al. 2006; Zeder et al. 2006). In most cases, major quantitative trait loci (QTLs) have been found to underlie one or more key domestication traits. This contrasts with domesticated sunflower, in which important domestication traits are mostly controlled by minor QTLs (Burke et al. 2002). However, it is not clear why such a difference in genetic architecture would affect the ease of domestication, at least not in the expected direction. While the presence of major QTLs might speed up the selection response (Gepts 2004), major domestication alleles are likely to be deleterious and found at very low frequencies in wild populations, which might hinder domestication. In contrast, numerous wild alleles with cultivar-like effects are present in wild sunflower populations, implying that sunflower domestication may have occurred readily (Burke et al. 2002). The ease of domestication may also be affected by mating system. In particular, selfing is considered beneficial for domestication because the response to artificial selection is not diluted by genes from other populations (Zohary and Hopf 2000). This might partly account for the many successful domestications of cereals (Zohary 1999; Hancock 2004). Most Compositae, however, are self- incompatible outcrossers (Judd 2002), which might reduce the probability of domestication. However, self-incompatibility is easily lost and domestication has occurred frequently in some outcrossing groups such as tomato and peppers (Gepts 2004; Rick 1988).    21 2.6.6 Cultural considerations A large number of Compositae have defences against herbivory, which include the above mentioned armoury of chemical defence compounds, and physical deterrents such as spines and thorns, well exemplified by the thistle tribe, Cynareae. These characteristics might have hindered the development of Compositae crops when early farmers were faced with a decision regarding which crops to tend. In addition to the avoidance of thorns, early farmers probably focused on crops such as pulses and cereals that provided them with a reliable source of carbohydrate or protein that could be easily stored (Kislev and Baryosef 1988; Diamond 1997a; Hancock 2004). Plants mainly utilized for oil, salad or medicinal purposes were probably not needed in large quantities. Indeed, food crops in the Compositae can be viewed as adjunct crops rather than ‘founder’ crops on which a society depends, such as the world’s largest staples, wheat, rice and corn (Harlan 1992; Diamond 1997a; Simpson and Ogorzaly 2001). Because most major crops are believed to have been initially domesticated by prehistoric farmers (Diamond 1997a,b; Hancock 2004; de Wet 1992), the lack of crops in the Compositae might largely be a consequence of these early domestication decisions. This idea is consistent with Diamond’s argument of cultural contingency and the view that the early availability and use of resources can help to explain many of today’s cultural and societal patterns (Diamond 1997a,b). He also argued that so few domesticated species arose in general not because of the people who domesticated them, but rather due to the particular characteristics of the species themselves (Diamond 2002). This chapter supports this view by showing that many features of Compositae species reduced their suitability for domestication.      22 2.7 Conclusions Although few crops in the Compositae play a key role in modern-day agriculture, their potential future importance should not be under-estimated. Compositae species are an important source of oils for human consumption and industrial applications and due to their tremendous array of secondary compounds they have great potential in the development of drugs and other bioproducts. The fact that literally hundreds of taxa in the Compositae are known to be useful to human societies (Jeffrey 2001), underscores their largely unexploited potential. Domestication research has focused on explaining the properties of individual crops and how they arose. Although successful in explaining the origins of many modern crops, this approach fails to account for the unequal distribution of crops amongst the families of flowering plants. The apparent link between taxonomic affiliation and likelihood of domestication seems to be a consequence of the distinctive suite of morphological, anatomical and physiological traits that characterize plant families and that affect their suitability for domestication. For the Compositae, we propose that the relative paucity of food crops can be explained by a combination of traits, including the plethora of secondary defence compounds, the presence of inulin instead of starch as a storage product, and adaptation to wind and mechanical seed dispersal. Beyond interpreting why plant families have or have not produced crop plants, trait assessments such as those performed here can be used to understand patterns of domestication amongst crops, and to predict and explore the domestication potential of various floras and faunas.    23  Table 2.1 Five indicators of the level of domestication  Domestication index + - A Phenotypic differentiation Strong phenotypic differentiation between domesticate and wild progenitor (if known), illustrated by non-overlapping ranges of reproductive or vegetative characters Phenotypic differentiation between domesticate and wild progenitor slight or absent, or wild progenitor not known B Extent of cultivation Cultivated in sufficient quantity to be widely traded, and known to cover extensive geographical areas often outside its natural range Not cultivated in sufficient quantity to be widely traded, and not known to cover extensive geographical areas often outside its natural range C History of cultivation Strong evidence of cultivation at least since prehistoric times suggesting a long history of mass selection Evidence of cultivation relatively recent or obscure D Major genetic alterations Domestication known to have involved ancient interspecific hybridization or other major genetic shifts (e.g. polyploidy) Domestication not known to have involved ancient interspecific hybridization or other major genetic shifts E Improvement through breeding Modern domesticates have resulted from extensive and targeted breeding programs Breeding programs casual or absent  These indicators are used in Table 2. Summed domestication indicators of 0–1 are indicative of weak or no domestication; 2–3 are indicative of semi-domestication; and 4–5 are indicative of marked domestication Table 2.2 Degree of domestication for some species in the Compositae that are suitable for human consumption Common name (Scientific name) Family Indicators ( A )  P h e n o t y p i c  d i f f e r e n t i a t i o n  ( B )  E x t e n t  o f  c u l t i v a t i o n  ( C )  H i s t o r y  o f  c u l t i v a t i o n  ( D )  M a j o r  g e n e t i c  a l t e r a t i o n s  ( E )  I m p r o v e m e n t  t h r o u g h  b r e e d i n g  N u m b e r  o f  i n d i c a t o r s  D o m e s t i c a t i o n  c a t e g o r y  Para-cress (Acmella oleracea (L.) R. K. Jansen) Compositae - - - - - none weak/no Absinthium (Artemisia absinthium L.) Compositae - + - - - + weak/no Sweet wormwood (Artemisia annua L.) Compositae - - - - - none weak/no Yin-chen wormwood (Artemisia scoparia Waldst. Kit.) Compositae - - - - - none weak/no Balsamroot (Balsamorhiza sagittata (Pursh) Nutt.) Compositae - - - - - none weak/no Safflower (Carthamnus tinctorius L.) Compositae + + + - + ++++ strong Endive (Cichorium endivia L.)  Compositae + + + - + ++++ strong Chicory (Cichorium intybus L.) Compositae + + + - + ++++ strong Cardoon (Cynara cardunculus L. var. altilis DC.) Compositae + - + - + +++ semi Globe artichoke (Cynara cardunculus L. var scolymus (L.) Fiori) Compositae + - + - + +++ semi Sow thistle (Sonchus oleraceus L.) Compositae - - - - - - weak/no Chop-Suey greens (Glebionis coronaria (L.) Cass. ex Spach) Compositae - - - - - - weak/no Corn chrysanthemum (Glebionis segetum (L.) Fourr.) Compositae - - - - - - weak/no Noug (Guizotia abyssinica L.) Compositae - + + - - ++ semi Sunflower (Helianthus annuus L.) Compositae + + + - + ++++ strong Jerusalem artichoke (Helianthus tuberosus L.) Compositae + - + - - ++ semi Sumpweed (Iva annua L.) Compositae - - + - - + weak/no Lettuce (Lactuca sativa L.) Compositae + + + - + ++++ strong   24   25   Common name (Scientific name) Family Indicators ( A )  P h e n o t y p i c  d i f f e r e n t i a t i o n  ( B )  E x t e n t  o f  c u l t i v a t i o n  ( C )  H i s t o r y  o f  c u l t i v a t i o n  ( D )  M a j o r  g e n e t i c  a l t e r a t i o n s  ( E )  I m p r o v e m e n t  t h r o u g h  b r e e d i n g  N u m b e r  o f  i n d i c a t o r s  D o m e s t i c a t i o n  c a t e g o r y  Yam daisy (Microseris scapigera (Sol. ex A. Cunn.) Sch. Bip.) Compositae - - - - - - weak/no Guayule (Parthenium argentatum L.) Compositae - - - - - - weak/no French scorzonera  (Reichardia picroides Roth) Compositae - - - - - - weak/no Spanish salsify (Scolymus hispanicus L.) Compositae - - - - - - weak/no Scorzonera (Scorzonera hispanica L.) Compositae - - - - - - weak/no Yacon (Smallanthus sonchifolius (Poepp. et Endl.) H. Rob.) Compositae - - + + - ++ semi Stevia (Stevia rebaudiana (Bertoni) Bertoni) Compositae - - - - - - weak/no Huacatay (Tagetes minuta L.) Compositae - - - - - - weak/no Rubber dandelion (Taraxacum kok-saghyz L. E. Rodin) Compositae - - - - - - weak/no Dandelion (Taraxacum sect Ruderalia) Compositae - - - - - - weak/no Salsify (Tragopogon porrifolius L.) Compositae - - - - - - weak/no Beans (Phaseolus spp.) Fabaceae + + + - + ++++ strong Vanilla (Vanilla spp.) Orchidaceae - + - - - + weak/no Rye (Secale cereale L. subsp. Cereale) Poaceae + + + - + ++++ strong Bread wheat (Triticum aestivum L. subsp. aestivum) Poaceae + + + + + +++++ strong Maize (Zea mays L. subsp. mays) Poaceae + + + - + ++++ strong Peppers (Capsicum spp.) Solanaceae + + + - + ++++ strong   Only taxa for which agricultural uses are well established are shown. A few major crops of other families, some of which have been mentioned in this chapter, are also included. The number of indicators (see Table 2.1) is used to divide useful plants into the following categories: no domestication or very weak domestication (no/weak = 0–1), semi-domestication (semi = 2–3) and marked domestication (strong = 4–5)    Figure 2.1 Taxonomic diversity and number of strongly domesticated crops in a selection of Angiosperm families. Relationship between the numbers of species in the eight most speciose families (according to APG II) and the number of major crops in each family defined as those treated in Smartt and Simmonds (1995) is shown. All families currently recognized as containing more than 5000 species are listed as well as two families with fewer species but many major crop species.   26    Figure 2.2 Simplified phylogeny of the Compositae after Funket al. (2005), showing tribal relationships and the placement of the economically most important food crops.    27   Figure 2.3 Diagrammatic representation of the different plant parts that show signs of strong artificial selection in Compositae species. Selected representative taxa of economic importance in the Compositae are listed accordingly.    28   29 Our aim was to develo                                                          3 Establishing Genomic Tools and Resources for Guizotia abyssinica (L.f.) Cass. - The Development of a Library of Expressed Sequence Tags, Microsatellite Loci, and the Sequencing of its Chloroplast Genome1  3.1 Introduction Noug (Guizotia abyssinica) is a species in the Compositae that is used traditionally as an oilseed crop in Ethiopia, Eritrea, and less extensively in India and several other countries in Africa and South Asia (Getinet and Sharma 1996). It has been recognized as a semi- domesticated crop (Dempewolf et al. 2008) and shares many characteristics with its wild relatives. Noug has been categorized as a ‘neglected and underutilized species’ (Getinet and Sharma 1996) and has received little attention from the scientific community. Consequently, it suffers from a lack of improvement through modern breeding efforts and an absence of basic genomic resources. In North America, it is popular as bird-feed and is sold under various names such as thistle or niger seed. Phylogenetic analyses aimed at fully resolving the origin of the domesticated lineage have remained so far unsuccessful, although it appears that Guizotia scabra (Vis.) Chiov. ssp. schimperi (Sch. Bip. in Walp.) J. Baagøe is noug’s most closely related taxon and putative progenitor (Geleta et al. 2010). p genomic tools and resources for population genetic studies,   1 A version of chapter 3 has been published as: Dempewolf, H., Kane, N.C., Ostevik, K.L., Geleta, M., Barker, M.S., Lai, Z., Stewart, M.L., Bekele, E., Engels, J.M.M., Cronk, Q.C.B. & Rieseberg, L.H. (2010a) Establishing genomic tools and resources for Guizotia abyssinica (L.f.) Cass. - the development of a library of expressed sequence tags, microsatellite loci, and the sequencing of its chloroplast genome. Molecular Ecology Resources, 10, 1048-1058.   30 phylogeographic and evolutionary analyses, research on mating systems, studies of gene flow between the crop and its wild relatives, as well as to aid modern breeding efforts. The generation of a library of expressed sequence tags (ESTs) is often the first step in developing genomic resources for non-model organisms. EST databases can be used for many different purposes, including genome-wide studies of gene expression and selection, the study of gene family evolution or simply for providing sequence data for molecular marker development (Bouck and Vision 2007). We generated an EST database for noug, assembled unigenes, assessed functional categories for those noug unigenes that we were able to annotate, screened the database for the evidence of past genome duplications, and developed simple sequence repeat (SSR) markers, also known as microsatellites, from several unigenes. The development of SSRs from ESTs has become the method of choice for many researchers, as it is a more time- and cost- efficient alternative to more traditional approaches, such as library construction, enrichment, and screening. Previous efforts to characterize the genetic diversity of noug populations using anonymous genetic markers revealed the presence of high levels of intra- and inter-population diversity (Geleta et al. 2007, 2008), but could not fully resolve the origin of domesticated lineages. We aim to utilize the EST-derived microsatellite markers to more closely study the level and partitioning of genetic diversity in noug and arrive at a better understanding of phylogeographic patterns. We also sequenced the chloroplast genome of noug using Illumina’s sequencing technology. The importance of the plastid genome for phylogenetics, DNA barcoding, studies of photosynthesis and, more recently, transplastomics (Bungard 2004; Grevich and Daniell 2005; Jansen et al. 2005, 2007) has led to the sequencing of an increasingly large number of whole chloroplast genomes, using both traditional and next-generation sequencing methods (Jansen et al. 2005; Cronn et al. 2008). The small size and low repeat content of chloroplast genomes make them particularly amenable to sequencing with short-read next-generation platforms such as the   31 Illumina Genome Analyzer (IGA). Noug’s closest crop relative, sunflower (Helianthus annuus L.), has a wealth of genomic resources available owing to its global importance as an oilseed crop and its status as model species for research on speciation. This is also true for lettuce (Lactuca sativa L.), which is a more distantly related crop in the Compositae. The sunflower and lettuce chloroplast genomes have both been sequenced and compared (Timme et al. 2007). By sequencing the chloroplast genome of noug and comparing it with the plastid genomes of sunflower and lettuce, we were able to assess the level of Compositae chloroplast genome divergence at a finer scale than previous analyses and to increase our understanding of Compositae plastid genome evolution. Furthermore, the chloroplast is an important source of markers for phylogenetic and phylogeographic analyses. Making the full chloroplast genome sequence of noug available empowers researchers to assess the usefulness of a wide range of chloroplast DNA markers for such studies in noug, the Heliantheae (the tribe that includes noug and sunflower), and the Compositae as a whole.  3.2 Methods 3.2.1 EST library development and analyses Seeds for noug were obtained from the USDA’s Western Regional Plant Introduction Station, Pullman, WA, and were germinated and grown in the University of British Columbia’s greenhouses. USDA-ARS accession PI 508077 from Ethiopia was chosen for sequencing, as it is an Ethiopian accession that is readily available through the USDA’s National Genetic Resources Program. Noug RNA was extracted from leaf and root material of 4-week-old seedlings using the Spectrum Plant Total RNA kit from SIGMA. RNase-free DNase I on-column digestion (Qiagen) was performed to further purify the RNA. Total RNA was quantified using a Nanodrop,   32 and its quality was verified using a Bioanalyzer. To obtain full-length, low-redundancy cDNA libraries, it was necessary to employ a normalization strategy to remove high-abundance cDNA transcripts. The following protocol was developed from the manuals of the Clontech Creator SMART cDNA Library Construction Kit (catalogue number 634903) and the Evrogen TRIMMER-DIRECT cDNA normalization kit (catalogue number NK002). Approximately 1-1.5 μg of total RNA were reverse transcribed to first-strand cDNA. Following the first-strand cDNA synthesis, cDNA amplification was performed with a hot start of 95 °C for 1 min followed by 15 cycles of 95°C for 7 s, 66°C for 20 s, and 72°C for 5 min. The QIAquick PCR Purification Kit (Qiagen) was used to purify ds-cDNA, which was eluted with 20 μL to a final concentration of around 100–200 ng ⁄ μL. Approximately 800–1200 ng purified ds-cDNA was used as starting material for normalization. The best normalization result was achieved using 0.5 μL of double- strand nuclease (DSN) enzyme; therefore, a 0.5 μL DSN normalization tube was used for normalized cDNA for the first and second amplification. After the second normalized cDNA amplification, 50 μL of amplified normalized cDNA was used for proteinase K digestion following the Clontech Creator SMART cDNA Library Construction Kit manual. After transformation, twenty clones were randomly selected for checking insert size. STs were sequenced by the Compositae Genome Project (http://compgenomics.ucdavis.edu/) using ABI 3730 machines at the Joint Genome Institute, Walnut Creek, CA. Phred basecalling, masking and trimming were conducted using the CGPdb bioinformatic pipelines (http://cgpdb.ucdavis.edu/cgpdb2/). The 25 711 noug transcriptome reads were then submitted to NCBI GenBank (GE551264.1 GI:211701855 to GE576974.1 GI:211733899). Prior to assembly of noug transcriptome reads, vector and low-quality sequences were removed using Seqclean (http://compbio.dfci.harvard.edu/tgi/software/) with the UniVec database (http://www.ncbi. nlm.nih.gov/VecScreen/UniVec.html). To reduce the impact of repetitive elements on assembly quality, repeats were masked with the library-less repeat masker RBR (Malde et al. 2006) using   33 the default settings. Contigs were assembled for the EST collection using the program TGICL with default settings (http://compbio.dfci.harvard.edu/tgi/software/) (Quackenbush et al. 2000), and a unigene file containing 17 538 assembled contigs and singletons was created. Gene ontology (GO) annotations for the unigenes were obtained through discontiguous MegaBlast searches against Arabidopsis thaliana transcripts from the Arabidopsis Information Resource TAIR (TAIR 7 released 25 April 2007) (Rhee et al. 2003) for the best hit with at least 100 bp and an e value of 1 x 10-10. Using a Pearson Chi-squared test with a simulated P-value computed from 100 000 Monte Carlo simulations in R (R Development Core Team 2009), we tested for significant differences between the number of genes in each set of GOSlim categories between noug and a set of previously analysed, pooled EST databases from 18 other Compositae species (Barker et al. 2008) (Appendix A.2). To search for evidence for paleopolyploidy events in the EST library, the general methods of Barker et al. (2008) were followed. Briefly, duplicate gene pairs were identified, reading frames assigned, the rate of substitutions per synonymous site (Ks) calculated, and phylogenies for each gene family constructed. To identify significant features in the age distribution of duplicated genes, a boot-strapped K-S goodness of fit test (Cui et al. 2006) was applied to assess if the distribution deviated from a simulated null. A maximum likelihood mixture model (McLachlan et al. 1999) was used to fit a range of 1–5 normal distributions to the data because peaks produced by paleopolyploidy events are expected to approximately follow a Gaussian distribution (Barker et al. 2008). The mixture model with the lowest Bayesian information criterion (BIC) was selected as the best fit.  3.2.2 Microsatellite marker development One thousand four hundred and thirty-three simple sequence repeats (SSRs) were initially identified from unigenes in the EST library using the online software tool SSRIT   34 (Temnykh et al. 2001), as well as a custom Perl script (N. Kane, unpublished). Tetra- and Tri- nucleotides were preferentially selected, as their alleles are commonly easier to distinguish and therefore scoring is facilitated. Primers were designed using PRIMER3 v 0.4.0 (Rozen and Skaletsky 1999). PCR was performed in 15 μL reaction volumes containing 1 x HF PCR buffer (Finnzymes), 1.5 mM MgCl2, 200 μM of each dNTP, 0.05 μM forward primer, 0.5 μM reverse primer, 0.5 μM of dye-labelled universal primer, 0.15 U Phusion DNA polymerase, and 5–10 ng genomic DNA. Fragments were amplified using one of two PCR touch-down programs: 1 TD-50: An initial denaturation step at 95 °C for 2 min was followed by 9 cycles of 94 °C for 30 s, 60 °C for 30 s (temp decreased by 1 °C for every cycle), and 72 °C for 45 s, followed by 29 cycles of 94 °C for 30 s, 50 °C for 30 s, 72 °C for 45 s, and finally followed by a final extension at 72 °C for 20 min. 2 TD-55: An initial denaturation step at 95 °C for 2 min was followed by 9 cycles of 94 °C for 30 s, 65 °C for 30 s (temp decreased by 1 °C for every cycle) and 72 °C for 45 s, followed by 29 cycles of 94 °C for 30 s, 55 °C for 30 s, 72 °C for 45 s, and finally followed by a final extension at 72 °C for 20 min.  The repeat motif and primer sequences of 43 selected microsatellites are shown in Table 3.2. A test set of 20 individuals from a population that was collected in the Ethiopian highlands in 2007 was genotyped using these SSR markers. Basic characteristics such as the number of alleles, size range of alleles, and observed and expected heterozygosity were calculated using Arlequin 3.11 (Excoffier et al. 2005) (Table 3.2). All loci were tested for Hardy-Weinberg equilibrium (HWE) using the Guo and Thompson (1992) approach, as implemented by Arlequin 3.11 (1 000 000 steps in Markov Chain; 100 000 dememorization steps; 0.05 significance level) (Excoffier et al. 2005). Linkage disequilibrium was assessed between all pairs of loci using the   35 Slatkin and Excoffier (1996) approach, as implemented by Arlequin 3.11 (5000 permutations; 5 initial conditions; 0.05 significance level) (Excoffier et al. 2005) (Table 3.2). Information on the unigene origin is included in Appendix A.3.  3.2.3 Chloroplast DNA sequencing and analyses In preparation for sequencing the chloroplast genome, ten noug plants (USDA-ARS accession PI 508077 from Ethiopia) were grown under controlled environmental conditions in a growth chamber (Conviron E15, Winnipeg, MB, Canada) with a daily regime of 20 °C and 16 h light. Chloroplast isolations followed the general protocol of SIGMA’s Chloroplast Isolation Kit (CP-ISO). Plants were kept in the dark for 24 h before harvesting 20 g of leaf tissue. Midrib veins were removed, and the leaf tissue was cut into small pieces and placed in the chloroplast isolation buffer (CIB; 0.33 M Sorbitol, 50 mM Tricine-OH pH 7.9, 2 mM EDTA, 1 mM MgCl2, 1 mM DTT, and 0.1% BSA) at a ratio of 4 mL ⁄ g of tissue. Tissue was macerated using a small blender (Philips, Amsterdam, The Netherlands). The macerate was filtered through two layers of Miracloth (Calbiochem, San Diego, CA, USA). The filtrate was collected and evenly divided among eight centrifuge tubes. All steps were carried out at 4 °C and low light conditions. To remove unwanted cell debris, the tubes were centrifuged (2100R; Thermo electron corporation, Waltham, MA, USA) at 200 g for 3 min. The supernatant was transferred to a clean tube and centrifuged again at 1000 g for 7 min to pellet the chloroplasts. The supernatant was discarded and the pellet was re-suspended in 1 mL of CIB. Chloroplasts were purified by centrifugation at 3200 g for 15 min through a 40 ⁄ 80% Percoll (Sigma-Aldrich, St. Louis, MO, USA) and CIB gradient. Purified intact chloroplasts were harvested from the interface between 40% and 80%. The band was re-suspended in three volumes of CIB (without BSA) and centrifuged at 1700 g for 1 min. The pellet was re-suspended in 0.5 mL of CIB (without BSA) and stored in the dark on ice. Chloroplast DNA was extracted by adding 400 μL of Lysis Buffer (10 mM Tris-HCl pH   36 8.0, 1 mM EDTA pH 8.0, 0.1% SDS, 0.1 M NaCl) to 200 μL of isolated purified chloroplasts and vortexed briefly. The mixture was incubated for 10 min at 65 °C. To the lysate, 130 μL of protein precipitation buffer (3 M potassium ⁄ 5 M acetate) was added and incubated on ice for 5 min. The lysate mixture was then centrifuged (Eppendorf 5414D, Westbury, NY, USA) at 20000 g for 5 min. The supernatant was transferred to a fresh tube, and 1.5 volumes of binding buffer (1 M Guanidine hydrochloride) were added and mixed. This mixture was loaded onto a silica column (Epochbiolabs, Sugarland, TX, USA) and centrifuged for 1 min at 6000 g. The membrane was washed twice with 500 μL of 70% ethanol (20000 g, 2 min). The membrane was then incubated for 5 min with 100 μL of elution buffer (TE Buffer) and centrifuged at 6000 g for 1 min. Library construction and Illumina sequencing were performed at the Genome Sciences Centre (GSC) at the British Columbia Cancer Agency in Vancouver, Canada, using an Illumina Genome Analyser GA-II. A single lane of one flow cell was used for sequencing. Reads of 36 bp were generated and 8.2 million reads passed the default quality filtering. The initial Illumina assembly was used together with the sunflower cp genome to design 26 primer pairs, 19- to 30- bp long for gap filling and sequence confirmation by standard Sanger sequencing. We assembled the 36-bp sequences using both VCAKE with the commands: -k 36 –n 19 –m 15 –v 10 –t 5 -e 22 (Jeck et al. 2007) and VELVET (Zerbino and Birney 2008). Initial assemblies using VELVET used a hash length of 19, minimum contig length of 100 bp, and minimum average coverage of 6x. These contigs were combined and extended using CAP3 (Huang 1996), and were subsequently aligned against the sunflower chloroplast genome (NC_007977) using BLAST. Contigs with at least 10-bp identical overlap were joined. Remaining gaps and regions of low complexity were sequenced using Sanger sequencing. The full-length chloroplast sequence was annotated using DOGMA (Dual Organellar GenoMe Annotator) (Wyman et al. 2004), with additional information about splice sites and open reading   37 frames provided from comparisons with the well-annotated Helianthus chloroplast genome (Timme et al. 2007). The resulting annotation was illustrated using OGDraw (Lohse et al. 2007). Genome rearrangements, insertions and deletions were illustrated using zPicture (Ovcharenko et al. 2004).  3.3 Results and discussion 3.3.2 Analyses of EST library The 25 711 noug transcriptome reads were assembled into 17 538 contigs and singletons (unigene file available from http://msbarker.com/). Of this set of unigenes, we were able to functionally annotate 4781 unigenes using the Gene Ontology database at TAIR (Rhee et al. 2003). The percentage of genes that were included in each GO-Slim category for the noug EST database is displayed in Table 3.1. To facilitate comparisons, Table 3.1 also shows the percentage of genes for each GOSlim category for a pooled set of EST databases from 18 other members of the Compositae (Barker et al. 2008; Laitinen et al. 2005). Those EST libraries had been prepared using the same normalization procedures as described previously. A Chi-squared test revealed that the order of GOSlim categories is significantly different (v2 = 2317.652; P = 0.0001) when ordered according to the number of annotated genes in each category. Overall, the proportional differences are relatively small and probably reflect variation among species in the tissues and developmental stages employed for sequencing rather than differences in gene content (Tables 3.1 and Appendix A.2). Our analyses of the age distribution of duplicated genes in the noug EST library revealed two major peaks that likely result from paleopolyploidization (Figure 3.1). The youngest peak is centred at Ks ~ 0.4–0.5, whereas the older peak’s median is located at Ks ~ 0.8. The young peak was previously found in all six species of the sunflower genus, Helianthus, and Barker et al.   38 (2008) suggested that it resulted from a paleopolyploidzation at the base of the Heliantheae tribe, to which Guizotia abyssinica also belongs. The presence of the peak in Guizotia supports this hypothesis. The older peak is shared by all members of the Compositae that have so far been analysed (Barker et al. 2008), indicating its position near the base of the phylogeny or before the divergence of extant Compositae.  3.3.3 Microsatellite analyses From the total set of 1433 microsatellites identified in the noug ESTs library, 206 were screened and 43 were selected on the basis of consistent amplification and evidence of polymorphism in our test population. The one exception was GA082 which only showed evidence of polymorphism when tested on a different population (data unpublished). All 43 loci should be suitable for a range of applications in molecular ecology and breeding, especially in phylogeographic and population genetic studies of noug and its wild relatives. Excluding GA082, the number of microsatellite alleles varied between 2 and 10 (average 4.67) and the average observed and expected heterozygosities were 0.49 and 0.54, respectively (Table 3.2). In five cases (GA029, GA037, GA182, GA217, and GA228), the amplicon contains more than one simple sequence repeat structure, which should to be taken into consideration during analysis, as a stepwise mutation model cannot be applied. The tests for Hardy-Weinberg equilibrium (HWE) showed that all but seven loci are at HWE (Table 3.2). Pairwise tests for linkage disequilibrium revealed linked loci for all but one locus (GA013) (Table 3.2). It should be noted that the test for linkage disequilibrium assumes HWE, so caution should be advised when interpreting significant values for LD involving loci not in HWE.      39  3.3.4 Chloroplast genome analysis Using Illumina’s sequencing technology, we obtained 8 890 094 raw reads of 36 bp in length, of which 8 228 087 sequences were high-quality reads with no ambiguous base calls. These high-quality sequences were successfully assembled with VCAKE into 8920 contigs ranging from 100 to 2507 bp in length. The alternative VELVET assembly yielded 1042 contigs, 100 - 3982 bp in length. Most contigs were nearly identical when the two assemblies were compared. All contigs were further assembled into 5689 longer CAP3 contigs, 100 - 4369 bp in length. These de novo contigs were aligned against the H. annuus chloroplast sequence using BLAST, and contigs with at least 10bp of identical overlap were combined, yielding a draft noug chloroplast genome with nine gaps. Additional Sanger sequencing was able to bridge these gaps, yielding a full chloroplast genome. After annotation, this was submitted to Genbank as GenBank id EU549769 ⁄ Refseq NC 010601. All 80 annotated coding sequences in the H. annuus chloroplast were identified in the G. abyssinica chloroplast genome, as well as all 34 tRNAs and 4 rRNA sequences (Figure 3.2). There were no substantial rearrangements found between H. annuus and G. abyssinica, which were entirely collinear other than numerous small insertions and deletions (Figure 3.3). Aligned sequences of the two chloroplasts showed over 96% identity, with 1.8% of the remaining sites showing different nucleotide sequences and 1.4% of sites having gaps because of small insertions and deletions. The sequence divergence and length differences between the two species are listed in Table 3.3 for a representative set of coding genes and intergenic regions. Similar information for shorter coding sequences as well as non- coding regions such as tRNA, rRNA, introns, and intergenic regions is provided in Appendix A.4. Of particular note are rbcL, atpB, rpoC1, rpoB, matK, and trnH-psbA, which have been used for phylogenetic analyses (APG II 2003; Shaw et al. 2005) and DNA barcoding (Lahaye et al. 2008) in the past. Of these sequences, trnH-psbA shows the highest divergence (15%), an   40 order of magnitude faster than most other loci, indicating its potential utility in these and other taxa in the Helianthae, which with 2500 species comprises approximately 1% of all flowering plants. Additionally, the rapidly evolving intergenic regions identified by Timme et al. 2007 (Timme et al. 2007) show promise. Although they evolve slightly slower than trnH-psbA, they are substantially longer, thus providing more characters. They are flanked by conserved regions, enabling a single set of primers to be useful in even widely divergent taxa (Timme et al. 2007). Whole chloroplast sequencing using short reads is simplified when a high-quality scaffold for a closely related species may be leveraged, as in the present case. The low level of rearrangements in Compositae chloroplast genomes further simplified the scaffolded assembly. Unfortunately, some taxa show relatively high levels of chloroplast genome rearrangements (e.g. Campanulaceae; Cosner et al. 1997) that make the use of existing scaffolds problematic. However, the de novo assembly of fairly large contigs (100 - 4000 bp) in our study indicates that useful sequence information can be recovered with this approach even without a scaffold. The use of paired-end reads with variable insert sizes would probably enable the assembly of larger de novo contigs and provide improved assemblies. Comparisons between Guizotia and Helianthus and Lactuca confirm previous research showing a lack of major rearrangements in the Compositae. One interesting difference is that the 456-bp deletion in ycf2 identified in Helianthus by Timme et al. (2007) is not found in Guizotia, which is more similar to Lactuca in this respect, indicating that this deletion is probably limited to a smaller portion of the Heliantheae. In most other major respects, the noug chloroplast is much more similar to Helianthus, as expected. For instance, although there are several small insertions and deletions when accD is compared between the two taxa, neither contains the 25-aa insertion found in Lactuca (Timme et al. 2007). In most coding regions, however, all three taxa are nearly identical. Chloroplast sequence variation has been shown to work well for phylogeographic studies in many plant species. The prospect of using whole chloroplast   41 genomes instead of single sequence fragments will allow for much more comprehensive assessments of phylogeographic patterns and hence enable researchers to take these studies to the next level.   42   Table 3.1 GOSlim annotations for the noug EST database and a pooled sample of other Compositae EST databases (Barker et al. 2008; Laitinen et al. 2005)    GOSlim categories Noug Gene Count (%) Pooled Compositae Gene Count (%) G O  C el lu la r C om po ne nt  other intracellular components 16.70 17.61 other cytoplasmic components  14.21 10.66 chloroplast  12.04 10.05 other membranes  10.01 14.75 plastid  6.22 3.61 plasma membrane  8.22 2.07 nucleus  6.49 9.38 unknown cellular components  7.39 17.99 cytosol  3.89 1.94 ribosome  2.55 2.39 mitochondria  3.68 4.68 other cellular components  2.71 0.66 cell wall  2.04 0.87 extracellular  1.48 0.36 ER  1.19 1.48 Golgi apparatus  1.19 1.49 G O  M ol le cu la r Fu nc tio n other enzyme activity  14.46 12.58 transferase activity  9.93 11.15 other binding  10.59 7.93 hydrolase activity  8.70 13.00 kinase activity  4.98 6.29 nucleotide binding  9.15 5.87 protein binding  8.87 7.06 unknown molecular functions  9.33 9.25 transporter activity  5.02 6.32 DNA or RNA binding  5.63 6.79 structural molecule activity  3.93 2.81 other molecular functions  3.43 2.94 nucleic acid binding  3.07 2.18 transcription factor activity  2.74 5.44 receptor binding or activity  0.17 0.39 G O  B io lo gi ca l Pr oc es s other cellular processes  25.04 22.99 other metabolic processes  22.72 24.24 protein metabolism  9.26 9.79 response to abiotic or biotic 5.29 3.39 unknown biological processes  7.65 10.77 transport  5.23 5.24 response to stress  4.85 3.00 developmental processes  4.32 3.63   43      GOSlim categories Noug Gene Count (%) Pooled Compositae Gene Count (%) G O  B io lo gi ca l Pr oc es s other biological processes  4.94 2.79 cell organization and biogenesis 4.04 5.09 signal transduction  2.08 2.20 transcription  2.12 3.80 electron transport or energy 1.85 1.80 DNA or RNA metabolism  0.61 1.27      44  Table 3.2 Characteristics of microsatellites Locus Repeat motif Forward Primer sequence Reverse primer sequence Num. of alleles Allele size ranges Observed Heterozy. Expected Heterozyg. HWE Linked loci PCR cond. GA003 gat CGCCCTAAAGCTACTTTCTTCC CACACTCGCACTAGGAACTTCT C 2 399 – 402 0.05 0.05 Yes GA127, GA238 TD-55 GA012 gat CAGTAAGCTCGGTATCTCCAAGTT AGAAGATCTCGTCAGCAGAAA CAG 2 263 – 275 0.2 0.18 Yes GA107, GA138 TD-55 GA013 ctt GGTAATGGTAATGGAGGTTCTGG CCTCATCAGAGTTCTTCGGGTT AT 9 424 – 455 0.9 0.86 Yes none TD-55 GA018 agc GTTCCAGCCCATGAGTCATAAT CTATCTCTATCTCGTGGGGTTT TG 2 353 – 358 0.3 0.43 Yes GA183, GA186, GA205 TD-50 GA029 atc & tc CCATCATCAATGGCGTTACTC GTCTCGTTCTAGAAGCTTCATC CT 3 270 - 276 0.35 0.47 Yes GA108, GA143, GA186, GA214, GA217 TD-55 GA035 tga GATTTCTCAGGTGAAGGAGAAGAG GCCCTCCCTACAACATACTTGA TA 3 301 - 307 0.35 0.30 Yes GA107, GA144, GA217 TD-55 GA037 ta & gaa GGTGTTTTTGTGTAGTGGTCTGTC GACTAGCCAGAAACCGAAGAA TC 2 347 - 350 0.55 0.51 Yes GA081 TD-55 GA054 ta AACGGTTTAGGAGACCTTGG TCACCTGGCTCAGACTTGTTT 3 247 - 265 0.25 0.31 Yes GA182, GA210, GA204, GA205 TD-55 GA055 ct CCTGAAACAAACCCCAACAA CAGTACATCGCGGAGAGAGG 3 194 - 200 0.25 0.41 No GA191, GA205 TD-55 GA077 tc TCAGCCAAACATTCCAAAGC AAACAACGCGCTAAAAACGA 2 487 - 490 0.05 0.14 Yes GA108, GA139, GA150, GA229, GA205, GA238, GA246 TD-55 GA081 tc AATCTCGATTGGCTGAGTGG AGGAAGTTGGGGCTTCGTAA 3 437 - 441 0.5 0.48 Yes GA037, GA242 TD-55 GA082 tc TGTCCGTATGAAACCCATTGA CAATGATCATGGGGACTGCT 1 197 - 197 0 N/A N/A N/A TD-55 GA107 cct ATCACCCTCTCTCCAAAACCAT GAAGATCTAAATCCAGCTCCTG TG 4 220 - 232 0.2 0.35 No GA012, GA035, GA108, GA183 TD-55 GA108 cca ATGGCCTCCACCTTCCTCT GAGTGATAATCCGGTGCTAAGACT 4 194 - 209 0.15 0.58 No GA029, GA107, GA077, GA188, GA214, GA220 TD-55 GA117 cac CCCTTCATCCAATTCTAACGAC AGGTCTAATCCCAGCCTCTCTA AT 2 336 - 339 0.25 0.22 Yes GA210, GA127, GA214, GA242 TD-55 GA127 cct CAATCTGCAACTACTGCCAATACC CCAGTCAGAACCCTTGATCACT A 2 213 - 216 0.05 0.05 Yes GA003, GA117 TD-55           Locus Repeat motif Forward Primer sequence Reverse primer sequence Num. of alleles Allele size ranges Observed Heterozy. Expected Heterozyg. HWE Linked loci PCR cond. GA138 aag ATCAACTTCCCCATATACCTCTGG CTTCCTCTGTCACTTCTTTTGGA C 5 363 - 378 0.65 0.57 Yes GA012, GA035, GA108, GA183 TD-55 GA139 gaa GTACATCCCAACTTTACCATCCAC CTCTACAACCAACACCACTTTC C 7 223 - 241 0.75 0.69 Yes GA077, GA238 TD-55 GA143 tga GGATGGTGTACTTCTTTCTGACCT TAGCGACGGTAACATACGAGT CT 7 296 - 312 0.75 0.79 Yes GA029, GA182, GA165, GA172, GA190 TD-55 GA144 agtt GGTCCCACAAACCAATATGATG CTAGGGCTTGTACCACACCTTA AA 5 331 - 347 0.35 0.39 Yes GA035 TD-50 GA150 acc GTAATGACTTGTGAGGAACACGAC GGGTTTGGAGGTACAGTGTAA GAT 8 279 - 298 0.6 0.81 No GA162, GA182, GA077, GA204 TD-55 GA156 aag CCAGTTTGTGAGAATTCACCGTGT GAGCTCCAGGTCTCTAGGGTTA TC 3 158 - 173 0.7 0.54 Yes GA220 TD-55 GA162 cca AGCCACTCTCTTGTTTGTTACC CAAGTTCTGGTGGGTGGTATG 3 134 - 140 0.3 0.27 Yes GA150, GA210 TD-55 GA165 gat GGGTACCTACGTACTGGAAACAAG TCCTTTGGAAAATCCCTTCC 4 280 - 289 0.7 0.67 Yes GA143, GA205 TD-50 GA172 tca AAGAACAAGGGAGAGTGGAT AGGAGTTGTGAGGACAAATG 10 233 - 354 0.75 0.80 Yes GA143, GA214 TD-50 GA182 aaagt & ctaag GAAAGACAACGACTGGAAT G TGTTTCTCCTAAAGGCTACC 7 363 - 393 0.65 0.79 Yes GA054, GA150, GA143, GA204, GA205, GA220 TD-50 GA183 atg ATAGGGTTAGGGTTCCATGT CCTCTTCTTCATCATCATCG 9 280 - 317 0.6 0.82 No GA107, GA018, GA186, GA192 TD-50 GA186 atg CTCCCAAGAGAATCAAACAG GTCATTCCTGCCAATAACTC 7 414 - 438 0.7 0.64 Yes GA029, GA018, GA183 TD-50 GA188 cac GTGCTTCCCCTACTCATTTA GGCACTTTCATCCATGTACT 5 339 - 351 0.85 0.72 Yes GA108 TD-50 GA190 cca CACCTCACTTGTCACCTTCT GAGAGTGGCTGAATGGATTA 8 364 - 396 0.85 0.75 Yes GA143, GA204 TD-55 GA191 tca CCCACCAACCCTATATCTTC GTCGGAAACAGAACTCCAT 5 265 - 277 0.65 0.76 Yes GA055 TD-55 GA192 cac AACACCAAGATCAGTGGCT CACCTATACTCCATTCTGCC 5 247 - 262 0.55 0.67 Yes GA183, GA204 TD-50 GA204 tga GGAAGAAGAAGAGGATTGGT CAACATTTACCAGCGTTCTC 5 212 - 224 0.6 0.65 Yes GA054, GA150, GA182, GA190, GA192 TD-55                     45   46 Locus Repeat motif Forward Primer sequence Reverse primer sequence Num. of alleles Allele size ranges Observed Heterozy. Expected Heterozyg. HWE Linked loci PCR cond. GA205 cat CCTGGCCTTTCTCTATTCTT GGTGATGATGGTGATGATG 6 378 - 408 0.5 0.75 No GA054, GA182, GA055, GA018, GA077, GA165, GA220 TD-55 GA210 atc ACAACACCACAACTACTCCC GGTGGACTGATTTGAAGAGA 6 340 - 366 0.6 0.58 Yes GA054, GA117, GA162 TD-55 GA214 cca ATATCGTTAGAGTTCGTGGG CGGTTCTTGCTTTGTACTTC 6 394 - 412 0.5 0.50 Yes GA029, GA108, GA117, GA172 TD-55 GA217 acc & cca CACCACCACCTACCTACCT A GATTGTGAGGGAGAACAAGA 6 290 - 305 0.7 0.79 Yes GA029, GA035 TD-55 GA220 acc CATAGCATCCTCTCCACCT CCTTTACATCCTTTCTTCCC 4 409 - 421 0.65 0.63 Yes GA108, GA156, GA182, GA205, GA228 TD-55 GA228 cct & ata & tg GTTTCCCTCACCTCTTTGAT CATGGATCTGAAGACAAACC 7 165 - 474 0.6 0.77 No GA220 TD-55 GA229 gaa GTAACATGAGCATCCCACAT GTGAAAGATCAGCAGTCCAT 5 284 - 299 0.7 0.68 Yes GA077, GA238 TD-55 GA238 aga ATCACAGTAGCACCAAATCC CATAATTCTCCCCACATGAC 3 237 - 243 0.75 0.56 Yes GA003, GA139, GA229, GA077, GA246 TD-50 GA242 cac CAGATTCCTCTCCACAAAAG GAGTGTCTATGAGCTTTGCC 3 479 - 485 0.35 0.30 Yes GA081, GA117 TD-55 GA246 tct CAATACTCGTCTCCTTCTGC GGTAAACATTATCGGTGAGC 5 298 - 310 0.5 0.63 Yes GA077, GA238 TD-55 Average 4.67  0.49 0.54   47 Table 3.3 Protein coding genes and important non-coding sequences  Name Dn Ds Dn/Ds % identity indels length (noug) length (sun- flower) Type of sequence rpoA 0.007 0.014 0.471 0.991 0 1008 1008 Coding psbA 0.001 0.059 0.020 0.987 0 1062 1062 Coding psbD 0.003 0.009 0.287 0.996 0 1062 1062 Coding ndhA 0.005 0.043 0.113 0.987 0 1092 1092 Coding ndhH 0.001 0.052 0.021 0.989 0 1182 1182 Coding psbC 0.002 0.045 0.044 0.987 0 1422 1422 Coding accD 0.008 0.057 0.148 0.985 1 1452 1443 Coding rbcL 0.005 0.076 0.071 0.982 0 1458 1458 Coding atpB 0.004 0.023 0.164 0.992 0 1497 1497 Coding ndhD 0.013 0.049 0.255 0.980 0 1503 1503 Coding matK 0.047 0.069 0.674 0.980 0 1515 1503 Coding atpA 0.004 0.020 0.218 0.992 0 1527 1527 Coding psbB 0.005 0.039 0.117 0.988 0 1527 1527 Coding ndhB 0.002 0.006 0.270 0.996 0 1533 1533 Coding rpoC1 0.004 0.038 0.113 0.989 0 2091 2091 Coding psaB 0.005 0.028 0.184 0.991 0 2205 2205 Coding ndhF 0.013 0.073 0.178 0.974 1 2226 2232 Coding psaA 0.002 0.028 0.086 0.992 0 2253 2253 Coding rpoB 0.003 0.031 0.094 0.991 0 3183 3183 Coding rpoC2 0.007 0.046 0.154 0.985 0 4089 4089 Coding ycf1 0.015 0.007 2.028 0.960 7 5040 5118 Coding ycf2 0.004 0.007 0.589 0.996 10 6831 6396 Coding psbA- trnH - - - 0.842 7 390 387 Non-coding ndhC- trnV - - - 0.922 7 1024 883 Non-coding trnL- rpl32 - - - 0.858 9 733 781 Non-coding trnY- rpoB - - - 0.935 6 1150 1167 Non-coding  Comparison of all long (> 1,000 bp) protein sequences in Guizotia and Helianthus chloroplast genomes. Dn and Ds were calculated using PAML, and the Arabidopsis best hit was identified using BLAST.    48         Figure 3.1 Histogram of noug gene duplication ages and fitted mixture model analyses. The yellow peak represents the putative Heliantheae paleopolyploidization and the green peak represents the putative basal Compositae paleopolyploidization. 	 


	                      	     49 Figure 3.2 Assembled Guizotia abyssinica chloroplast genome.    Figure 3.3 Dotplot comparison showing conserved regions found in both Guioztia abyssinica (x axis) and Helianthus annuus (y axis) chloroplast genomes.    50   51                                                          4 Patterns of Domestication in the Ethiopian Oil-seed Crop Noug (Guizotia abyssinica)1  4.1 Introduction Domestication is most accurately described as a process rather than an event (Zeder et al. 2006), and cultivated plants differ widely in their level of domestication. Some strongly domesticated crops, such as rice, wheat, corn, tomato and sunflower, are substantially different from their wild ancestors. They often differ in traits that contribute to the ease of harvesting, such as reduced shattering, a more determinate growth habit (or increased apical dominance), larger inflorescences, larger seeds or fruits, loss of seed dormancy, reduction in non-palatable substances in edible parts, changes in photoperiod sensitivity, and synchronized flowering time (Harlan et al. 1973; Koinange et al. 1996; Doebley et al. 2006; Purugannan and Fuller 2009). Other crops, however, including the Ethiopian cereal t’ef (Eragrostis tef), known as the world’s smallest grain, and the Andean tuber crop yacon (Smallanthus sonchifolius), as well as many other locally important crops, show much weaker signs of domestication (Gepts 2004; D’Andrea 2008; Dempewolf et al. 2008). Possible explanations include variation in the type and strength of artificial selection pressures during domestication, interactions between natural and artificial selection, the length and duration of the domestication period, variation in the genetic architecture of the crop and its progenitor, variation in mating system, and gene flow with wild progenitors (Hillman and Davies 1990; Gepts 2004; Burger et al. 2008; Dempewolf et al. 2008). Here we ask why noug (Guizotia abyssinica), a Compositae oilseed crop from Ethiopia, appears   1 A version of chapter 4 has been prepared for publication and is soon to be submitted as: Dempewolf, H., Tesfaye, M., Teshome, A., Bekele, E., Engels, J.M.M., Cronk, Q.C.B. & Rieseberg, L.H. Patterns of domestication in the Ethiopian oil-seed crop noug (Guizotia abyssinica).   52 to be considerably less domesticated than sunflower (Helianthus annuus), a closely related seed crop also in the Compositae. It is unclear when noug was first cultivated, although there is some archaeobotanical evidence that suggests it was present in the Aksumite period (800 B.C.-A.D. 700) and was therefore likely first domesticated in pre-Aksumite times (Boardman 1999; Boardman 2000). At present, noug is grown primarily in Ethiopia, Eritrea, and India. The crop is popular with small- scale farmers in Ethiopia as it grows well in adverse conditions such as water-logged soils and produces reasonable yields under low-input conditions. It is well embedded into the traditional planting cycle and produces an edible oil that is highly sought after on the domestic market (Getinet and Sharma 1996). Despite its importance to developing countries in East Africa, we know essentially nothing about the domestication history of this species. Noug has been described as semi- domesticated (Dempewolf et al. 2008); the crop is self-incompatible, highly branched, and flowering heads and seeds are less than one-tenth the size of sunflower, its closest oil-seed crop relative (Funk et al. 2009). Hence, unlike sunflower, noug does not exhibit strong signs of artificial selection and bears much greater resemblance to its wild relatives than does sunflower to its wild relative. Despite their phylogenetic proximity within the Compositae, sunflower has responded to human selection pressure quite differently than noug; cultivated sunflowers, unlike their wild progenitors, are single stemmed and often single headed, do not shatter, and have much larger seeds (Burke et al. 2002). Because both noug and sunflower are cultivated for their oil, one might expect similar artificial selection pressures in the two species, but this does not appear to be the case. Because sunflower and noug are so closely related, comparisons between the two species can inform our understanding of general domestication patterns and processes.   53 In this study, we investigate two core hypotheses that might account for why noug remains semi-domesticated despite thousands of years of cultivation: (1) crop-wild gene flow, and (2) unfavorable phenotypic correlations.  4.1.1 Crop-wild gene flow Noug is not known to occur in the wild and noug’s closest relative and putative progenitor, Guizotia scabra subsp. schimperii, is a common and widespread species in many parts of Ethiopia, providing ample opportunity for gene flow between the two species (Geleta et al. 2010). Because G. scabra subsp. schimperii can produce fertile hybrids with noug (Dagne 1994), widespread introgression between the two species may have prevented full domestication of the latter. We test this hypothesis by using a set of simple-sequence repeat (SSR) markers, also known as microsatellites, to estimate population structure and levels of admixture.  4.1.2 Unfavorable phenotypic correlations In seed crops, yield may be enhanced by selection for increased seed size, increased seed number, or both.  However, seed size often is negatively correlated with seed number, so selection on one trait may lead to reductions in the other.  This may be due to genetic factors such as the pleiotropic effects of the same genetic locus or linkage disequilibrium among underlying loci, or to natural or conscious selection against unfit trait combinations.  In sunflower, for example, because of negative genetic correlations between seed size and branching (Tang et al. 2006), sunflowers with large seeds have fewer flowering heads (and fewer seeds) than plants with small seeds.  Thus, a possible explanation for the atypical domestication syndrome in noug is that early farmers selected mainly for an increase in number of seeds or flowering heads, which inhibited the evolution of larger heads and larger seeds due to negative   54 phenotypic correlations.  We test this hypothesis by analyzing phenotypic correlations among key traits in common garden experiments at two sites in Ethiopia. Lastly, we investigate the level and partitioning of genetic diversity between different noug accessions and determine whether there are any signs of local adaptation across noug’s range in Ethiopia. This information allows us to examine the importance of adaptation to local environmental conditions during noug’s history of domestication.  4.2 Methods Collections of noug and noug’s putative progenitor, Guizotia scabra subsp. schimperii, were made across an altitudinal gradient of approximately 2300 metres, ranging from semi-arid climate conditions at 896 metres above sea level to sub-alpine conditions at 3199 metres above sea level. From each field of noug (or population of Guizotia scabra subsp. schimperii) approximately 50 individuals were sampled at random and the seeds from each individual plant were kept separate. Five administrative regions (Amhara, Oromia, Tigray, Southern Nation Nationalities & Peoples and Beni-Shangul Gumuz) were covered during the harvest season. A GPS device was used to record the precise geographical location of each collection (Figure 4.1). The noug diversity collected in the field was characterized in two common garden experiments to evaluate phenotypic trait variation. These common gardens were located at the Holetta and Ginchi experimental stations operated by the Ethiopian Institute of Agricultural Research (EIAR). Although the two sites are only 38 km apart, Ginchi is at a lower altitude, receives less rainfall (250 mm less rainfall on average each year) and has soils with higher clay content than Holetta. Seeds collected from the ~50 individuals from each field were pooled before sowing. Four blocks containing 29 accessions each were sown with 0.3 m distance between two rows of the same accessions and 0.6m distance between plots of different accessions. Stand count at establishment varied between one and 222 individuals at the Ginchi   55 site (51 individuals on average), and between 5 and 490 individuals at the Holetta site (222 individuals on average), depending on survival success during the establishment phase. If fewer than ten individuals from a population survived to maturity the accession was excluded from the analysis. The accessions at Holetta were planted on the 15th of July 2009 and in Ginchi on the 17th of July 2009. The following traits were phenotyped on ten mature plants which were selected at random from each accession: leaf width, leaf length, stem diameter, number of heads, number of primary branches, number of secondary branches, number of nodes, number of stem leaves, height, and head diameter. The number of seeds per plant, number of seeds per head, and the mass of 1000 seeds were measured after harvest. In addition, flowering time was assessed for each accession as the number of days until 10% of plants per plot flowered and the number of days until 50% of plants per plot flowered. We obtained environmental data for all collecting locations using the publicly available Worldclim/Bioclim dataset (http://www.worldclim.org/bioclim), which contains a set of 19 environmental variables, including precipitation and temperature data. In addition, we compiled altitudinal and latitudinal data for each collection point. Statistical analyses of the phenotypic data were carried out in R v. 2.10.0 (R Development Core Team 2011). Where necessary, data were transformed using square (height and 10% flowering time), square root (leaf width, number of secondary branches and seeds per head) or logarithmic (stem diameter, number of heads, number of primary branches, head size and seeds per plant) transformations to meet the assumptions of normality.  Correlations between traits were investigated with a regression analysis in R v. 2.10.0  (R Development Core Team 2011) using the cor function and the pairwise.complete.obs parameter, which calculates the correlation between each pair of variables using all complete pairs of observations. We then conducted a non-metric multidimensional scaling (NMDS) analysis of the phenotypic data from both common garden sites using metamds in the R package “vegan” (v. 1.7-8) (Oksanen et al. 2010). The envfit function was employed to   56 provide an indirect measure of correlation between environmental variables and the phenotypic traits used in the ordination. We conducted analyses of variance (ANOVAs) using the aov function in R v. 2.10.0 to determine whether there were significant differences in trait values of populations from different precipitation regimes while taking into account the effect of ‘common garden site’ (R Development Core Team 2011). We grouped populations according to three levels of the ‘Precipitation of Wettest Quarter’ variable, which was the variable most strongly correlated with the variation in the phenotypic traits used in the ordination: (1) 700 mm and below, (2) 700 to 900 mm, and (3) 900 mm and above. To account for multiple comparisons, significance levels were adjusted by employing a Bonferroni correction. A subset of 29 noug accessions as well as four populations of G. scabra ssp. schimperi were genotyped with a set of 16 microsatellite markers that had previously been developed for noug: GA003, GA012, GA029, GA035, GA081, GA082, GA107, GA108, GA117, GA138, GA139, GA150, GA156, GA162, GA182 and GA210 (Dempewolf et al. 2010a).  Genotyping was performed following the protocol described in Dempewolf et al. (2010a), using between 14 and 23 individuals per population (average 19.27 individuals per population). We then employed a model-based clustering method using the software program STRUCTURE v. 2.3.2.1 (Pritchard et al. 2000; Falush et al. 2003; Hubisz et al. 2009) to assign individuals to a pre-defined number of groups, as well as to infer levels of admixture.  The burn-in period was set to 500,000 generations and the number of MCMC generations was set to 4,000,000. Twenty independent runs were performed and a range of one to 20 clusters (Ks) was explored in each run. We determined the optimal number of clusters using the ‘Evanno’ method, as implemented in Structure Harvester  v. 0.6.5 (http://users.soe.ucsc.edu/~dearl/software/struct_harvest/), which estimates the optimal number of clusters (K) by inferring Delta K, which is the second order increase in likelihood for each K (Evanno et al. 2005).    57 4.3 Results The regression analysis used to measure phenotypic correlations among traits of interest (Table 4.1), revealed weakly positive correlations between 1000 seed mass (used as a proxy for seed size) and the number of flowering heads, the number of seeds per head, the number of seeds per plant, and head size. Not surprisingly, most strongly correlated were traits such as number of primary/secondary branches and number of heads or the number of primary branches and number of secondary branches. The number of seeds per plant was also strongly positively correlated with the number of primary and secondary branches. The NMDS analysis shows that noug accessions cluster according to common-garden site along the axis of most variation (NMDS1) (Figure 4.2).  The spread of noug accessions along the second axis (NMDS2) correlates most strongly with the precipitation variables ‘precipitation of wettest quarter’, ‘precipitation of wettest month’, ‘precipitation of coldest quarter’ and ‘annual precipitation’. The results of the ANOVAs testing for differences among populations from different precipitation regimes were significant for several traits, including leaf width, leaf length, stem diameter, number of heads, number of primary branches, number of secondary branches, height and days to 50% flowering (Table 4.2). The ‘Evanno’ method (Evanno et al. 2005) estimated the optimal number of clusters (K) to be two for the dataset that included all 29 noug accessions and 4 populations of the wild relative, G. scabra ssp schimperii (Figure 4.3). The STRUCTURE graph at K=2 clearly assigns all populations of G. scabra ssp schimperii (Figure 4.4) to one cluster, and all but one of the noug accessions to a second cluster. Only one noug accession appears to contain admixed individuals, indicating that overall levels of introgression between noug and its wild relative are low. When populations of the wild relative were excluded from the analysis, there appeared to be no clear assignment of whole populations or other groups of individuals to distinct clusters.   58 This was true for a range of K values that were tested (Figure 4.5), since the estimate of Delta K through the Evanno method was inconclusive, and no dramatic shift in Delta K from one value of K to another was apparent.   4.4 Discussion We tested the hypothesis that unfavorable phenotypic correlations have hindered noug domestication. Specifically, we asked whether plants with more flower heads and more seeds tend to have smaller flower heads and smaller seeds. Such negative phenotypic correlations are frequently evident in seed crops, including annual sunflowers, in which this phenotypic correlation is at least partially genetically based (Tang et al. 2006). In noug, however, a weak positive correlation was observed between seed mass and the number of seeds per head, the number of seeds per plant, and head size.  Thus, we found no evidence that unfavorable phenotypic correlations have constrained the evolution of seed size in noug. A possible caveat is that we have analyzed phenotypic rather than genetic correlations and that some of the variation underlying these phenotypes has a common genetic basis that could limit responses to selection. We also tested whether introgression between noug and its putative wild progenitor is the cause for the observed similarity in phenotype between the two species. If this hypothesis were true, we would expect to see evidence of repeated introgression from the wild species into the domesticated species in our microsatellite analysis. The results of this analysis, however, indicate that there is little introgression between noug and its closest wild relative and putative progenitor, Guizotia scabra subsp. schimperii (Figure 4.3 and Figure 4.4). Indeed, only one noug accession shows clear evidence of introgression from the wild, leading us to reject this second hypothesis as well. The apparent lack of population genetic structure within and among noug accessions once the wild relative is excluded suggests that there is significant gene exchange among   59 cultivated noug fields, even across large geographic distances. These data further imply that local selection has not led to significant genetic divergence among noug accessions. Many noug farmers attempt to save their own seed for sowing in the next year whenever possible, but they often run out of stored seed and will buy market seed instead – especially in years when noug production is low and saved seed is needed for personal consumption (Dempewolf, personal observation). Farmers also frequently exchange noug seeds with neighbouring farmers, resulting in additional seed flow between farms, even across large geographic distances. When asked about the level of diversity, farmers usually did not distinguish between different noug types, nor were they usually aware of noug diversity elsewhere (Dempewolf, personal observation). The apparent lack of awareness of diversity within noug stands in stark contrast to diversity recognized by farmers in many other crops (Jarvis et al. 2008). Rampant genetic exchange between different noug accessions is facilitated by the fact that the crop has a self-incompatibility system and is obligately outcrossing (Geleta and Bryngelsson 2010). Crops with self-incompatibility systems are known to be more challenging to improve through breeding, since it is difficult to keep lines of interest ‘true to type.’  If an interesting phenotype is discovered in a certain accession, there is a high risk that the phenotype of interest will no longer be present in the next generation, since maintenance of the genetic identity of the line through selfing is not possible. This may also present a barrier to farmer-led improvement efforts and may be the reason why none of the farmers we encountered claimed to actively improve or select for certain agronomic characteristics in noug. A lack of farmer-led improvement would also explain why most farmers were not aware of much noug diversity in terms of landraces or varieties. A lack of intensive improvement efforts by farmers during earlier phases of noug domestication might have also been a major cause for the crop’s apparently ‘weak’ domestication syndrome.   60 The wild progenitor of sunflower is also self-incompatible, so why does the case of sunflower domestication differ in this respect from noug? One possibility is that self- compatibility evolves more easily in sunflower, as self-compatible genotypes are frequently found in wild sunflower populations (Burke et al. 2002).  However, no comparisons have been made with noug to determine the ease with which self-compatibility evolves in the two crops. Even though there are no signs of substantial artificial selection among different noug accessions, there does appear to be some adaptation to different environmental conditions across noug’s range. In the NMDS analysis (Figure 4.2), accessions clearly cluster according to the common garden site at which they were grown. None of the environmental variables considered here are correlated with the spread of data along the x-axis. This indicates that phenotypic plasticity plays an important role in explaining phenotypic differences between the two common garden sites and, by extension, much of the phenotypic diversity observed in farmer’s fields across Ethiopia. The spread of the data along the y-axis, which explains the second largest proportion of variation in this NMDS analysis, is most strongly correlated with four precipitation variables (Figure 4.2). The results of the ANOVA (Table 4.2) show that leaf width, leaf length, number of heads, number of primary branches, number of secondary branches, height, and days to 50% flowering are all traits that significantly differ between accessions that originated from different precipitation zones, even when grown in common gardens.  This suggests that the level of precipitation during the growing season of noug may be a key environmental factor driving noug phenotypic diversity. The results of the NMDS and ANOVA analyses therefore provide some evidence for local adaptation to different precipitation regimes. This observation does not present a contradiction to our finding of a lack of population structure as detected by molecular markers, since the selective pressures that lead to this local adaptation likely have not been strong enough to influence variation at presumably neutral microsatellite loci.   61 Episodic drought events and variable climatic conditions have been characteristic in the region for several thousand years (reviewed in Harrower et al. 2010). Therefore, an alternative hypothesis which could help explain noug’s phenotype is that farmers didn’t prioritize selection for seed size or other domestication traits as seen in sunflower, but rather (consciously or unconsciously) selected for a resilient crop that performs well under diverse conditions. This hypothesis has been suggested in the context of the domestication history of the Ethiopian cereal t’ef (Eragrostis tef), which is commonly recognized as the world’s smallest grain and has a high level of branching and uncompacted panicles (D’Andrea 2008). The results of our common garden experiments do suggest that phenotypic plasticity plays a major role in explaining trait variation in noug. However, in order to determine whether increases in phenotypic plasticity have accompanied noug domestication we must first compare noug productivity with that of its putative progenitor in a series of common garden experiments across diverse environments.  4.5 Conclusions Neither introgression between noug and its progenitor nor unfavorable phenotypic correlations were found to be substantial barriers to noug domestication. The crop’s self- incompatibility system and extensive gene flow among farmer’s fields likely contributes to noug’s status as a semi-domesticated crop and to its apparent lack of selection and diversification attempts by farmers. Phenotypic plasticity appears to be an important factor in explaining trait variation observed in noug in farmer’s fields, and plasticity may permit the crop to produce reasonable yields even in diverse conditions. Despite the apparent lack of genetic structure as detected by neutral microsatellites, there is evidence of adaptation to different precipitation regimes. We propose a series of common garden experiments to investigate the alternative   62 hypothesis that domestication in noug has focused more on resilience to diverse environmental conditions rather than a sunflower-like domestication syndrome.  Table 4.1 Phenotypic trait correlations of a selected number of traits related to plant architecture   No. of heads No. of prim. br. No. of sec. br. Height Head size Seeds per plant Seeds per head 1000 seed mass No. of heads  <0.0001 <0.0001 0.0034 0.041 < 0.001 0.17 0.062 No. of prim. br. 0.43  <0.0001 0.58 0.0099 < 0.001 0.0074 < 0.001 No. of sec. br. 0.50 0.55  0.016 0.0017 <0.0001 < 0.001 < 0.001 Height 0.051 0.0019 (-) 0.035  0.38 0.00102 < 0.001 0.7849431 Head size 0.025 0.039 0.058 0.0046  0.089 0.634 0.00027 Seeds per plant 0.19 0.30 0.45 (-) 0.063 0.017  <0.0001 0.0018 Seeds per head 0.011 0.042 0.18 (-) 0.12 0.0014 0.51  0.17 1000 seed mass 0.021 0.13 0.089 < (-) 0.001 0.077 0.057 0.011  R2 values are shaded in light grey, p-values in white. Correlations that are significant at the p < 0.01 level are shown in bold. Negative correlations are indicated by (-).   63   64  Table 4.2 Phenotypic differences among noug accessions from different precipitation regimes Trait Low precipitation Medium precipitation High precipitation F value Pr (>F) Leaf width (cm) 2.52 ± 0.09 2.89 ± 0.08 3.06 ± 0.08 14.28 < 0.0001 *** Leaf length (cm) 10.90 ± 0.29 11.83 ± 0.15 12.05 ± 0.15 8.5825 0.0003 ** Stem diameter (mm) 5.13 ± 0.20 5.52 ± 0.18 5.94 ± 0.17 5.6827 0.0041 No. of heads  37.07 ± 3.30 45.18 ± 3.41 45.39 ± 2.58 6.8224 0.0014 * No. of primary branches 5.92 ± 0.26 7.38 ± 0.31 7.98 ± 0.33 21.765 < 0.0001 *** No. of secondary braches 13.03 ± 1.16 15.45 ± 1.25 16.27 ± 1.37 8.0395 0.0005 ** No. of nodes 7.44 ± 0.19 7.88 ± 0.15 8.14 ± 0.12 4.9033 0.0086 Height (cm) 85.89 ± 2.61 95.28 ± 1.59 101.84 ± 1.19 19.697 < 0.0001 *** Head size (mm) 5.84 ± 0.14 6.01 ± 0.12 6.24 ± 0.16 2.1486 0.12 No. of seeds per plant 235.28 ± 27.91 299.06 ± 31.73 228.11 ± 25.38 4.3192 0.015 No. of seeds per head 13.27 ± 1.04 13.32 ± 1.07 10.88 ± 0.82 2.1904 0.115 Days to 50% flowering 89.73 ± 1.47 96.62 ± 1.45 101.85 ± 0.84 19.8559 < 0.0001 *** 1000 Seed mass (g) 3.09 ± 0.11 3.07 ± 0.09 3.17 ± 0.08 0.3559 0.7011   This table shows the means, ± 1 SE, as well as the F and P-values for the ANOVAs that were conducted to test for phenotypic differences among noug accessions that experience different precipitation regimes. Three levels of the ‘Precipitation of Wettest Quarter’ variable were distinguished: Low: 700mm and below, Medium: 700 to 900mm, and High: 900mm and above.  After correction for multiple comparisons, using the Bonferroni method: *** indicates highly significant results, ** very significant results and * results that are significant.      Figure 4.1 A map of Ethiopia showing the location for each collection (in red). The map also shows precipitation gradients across the country. Dark blue areas indicate areas with high precipitation during the wettest quarter, green areas indicate intermediate rainfall during the wettest quarter and areas shown in yellow and red indicate low rainfall during this period.   65   -0.05 0.00 0.05 0.10 -0 .0 5 0. 00 0. 05 0. 10 NMDS1 N M D S 2 1.9 1.10 1.111.12 1.13 1.141.151.16 1.17 1.18 1.191.20 1.21 1.22 1.23 1.24 1.25 1. 6 1.27 1.28 1.29 1.30 1.31 1.32 1.341.35 1.36 1.39 1.40 1.41 1. 2 1.43 1.44 1.45 1.46 1.47 1.48 1.49 .5 1.51 1.521.53 1.54 1.55 1.56 1.571.58 1.59 1.60 1.62 1.63 1.64 1.65 1.66 1.67 1.68 1.701.71 1.72 1.73 1.741.75 1.77 1.81 1.82 1.83 1.84 1.85 1.86 1.87 1.90 1.91 1.92 1.93 1.94 .95 1.96 1.97 1.100 1.105 1 0 2.9 2.10 2.11 2.12 2.132.14 2.152.16. 7 2.18 2.19 2.202.21 2.222.23 2.24 2.25 2.26 2.27 2.28 2.29 2.302.31 2.32 2.34 2.35 2.36 2.39 2.40 2.41 2.42.43 2.44 2.45 2.46 2.47 2.48 2.492.50 2.51 2.52 2.53 2.54 2.55 2.56 2.57 2.58 2.59 2.60 2.62 2.63 2.64 2.65 2.66 2.67 2.68 2.70 2.71 2.722.73 2.74 2.75 2.77 2.81 2.822.83 2.84 2.852.86 2.90 2.91 2.92 2.93 2.94 2.95 2.96 2.972.100 2.105 Annual_Precipitation Precipitation_of_Wettest_Month Precipitation_of_Wettest_Quarter Precipitation_of_Coldest_Quarter   66 Pr cip.(we*est(quarter( Annual(precip..( Precip.(coldest(quart.( Precip.(we*est(month(  Figure 4.2 NMDS analysis of phenotypic data of both sites (red = Holetta site 1 and blue = Ginchi site 2) showing correlations with environmental variables. The four precipitation variables: (1) precipitation of wettest quarter, (2) precipitation of wettest month, (3) precipitation of coldest quarter, and (4) annual precipitation, are highly correlated with each other, which is why their vectors point in a similar direction.      Figure 4.3 Estimates of Delta K for the dataset that included all 29 noug accessions and 4 populations of he wild relative, G. scabra ssp schimperii. Delta K is a measure which can be used as an indicator for the ptimal number of clusters, K, as described by Evanno et al. (2005). t o       Figure 4.5 Assignment of individuals to two clusters (k=2) by the program STRUCTURE. Accessions of oug are underlined in blue, whereas populations of noug’s putative progenitor are underlined in yellow. he accession marked by a black bar is likely of hybrid origin. n T     67   k = 2 k = 3 k = 4 k = 10   Figure 4.6 Assignment of noug genotypes to 2, 3, 4 and 10 different clusters by the program STRUCTURE. The noug accession marked with the black bar is of putative hybrid origin.   68   69                                                          5 Is Reproductive Isolation a Domestication Trait?1  5.1 Introduction The process of domestication was an ‘inspiration’ to Darwin when he developed the theory of evolution by natural selection (Darwin 1859; Darwin 1868). Since then, studies of crop evolution have enhanced our understanding of evolutionary processes and speciation (Gepts 2004; Ross-Ibarra et al. 2007). However, there have been surprisingly few efforts to employ speciation theory to increase our understanding of the process of domestication. While it has long been recognized that reproductive barriers between domesticated species and their wild relatives may sometimes arise during the process of domestication, as far as we are aware there have been no systematic surveys of reproductive barrier strength between crops and their progenitors or discussions of how reproductive isolation might facilitate domestication. Here we conduct such a survey of 29 of the economically most important crops on a global scale. We show that the development of barriers to gene flow has accompanied the domestication of many of these crops and suggest that reproductive isolation may be an important but previously overlooked domestication trait.  While evolutionary biologists may disagree about species concepts, there is widespread agreement that barriers to gene flow facilitate the accumulation of genetic differences between populations (Haldane 1930; Bulmer 1971; Felsenstein 1976; Slatkin 1985; Lenormand 2002; Hendry and Taylor 2004). In general, strong barriers enable populations to diverge through either selection or drift, whereas weaker barriers typically permit divergence through selection only, since even fairly low levels of gene flow (Nem ≥ 1) will homogenize   1 A version of chapter 5 has been prepared for publication and is soon to be submitted as: Dempewolf, H., Hodgins, K., Rummel, S., Ellstrand N & Rieseberg, L.H. Is reproductive isolation a domestication trait?   70 variation at neutral loci (Hartl and Clark, 1997). In plants, the barriers that operate to reduce gene flow can be divided into several categories (Rieseberg and Willis 2007). These include (1) pre-pollination barriers - geographic, habitat, mechanical and temporal isolation; (2) post-pollination, prezygotic barriers - conspecific pollen precedence or gametic incompatibilities; (3) instrinsic postzygotic barriers - hybrid sterility, inviability, or breakdown; and (4) extrinsic postzygotic barriers - reductions in hybrid fitness due to the external environment. It is thought that prezygotic barriers make a greater overall contribution to speciation than postzygotic barriers, as they are often stronger in recently formed species and act before postzygotic barriers (Ramsey et al 2003; Coyne and Orr 2004; Lowry et al. 2008). Given that domesticated plants have arisen very recently, barriers between crops and their progenitors are expected to be mainly prezygotic, but as far as we are aware, this prediction has not previously been tested. Domestication involving polyploidy is one exception to this prediction, as whole genome duplication results in substantial post-zygotic isolation (Rieseberg and Willis 2007), but may not necessarily impact prezygotic barriers.  Geographical isolation is reproductive isolation that arises because of limited contact among taxa due to geological processes that fragment populations, long-distance dispersal of founding populations, and/or to the ecological range limits (ecogeographic isolation) of those taxa (Schemske 2000; Lowry et al 2008). Geographic isolation is widely recognized as providing the most effective barrier to gene flow and the vast majority of speciation events are believed to involve complete (allopatry) or partial (parapatry) geographic isolation (Coyne and Orr 2004). Presumably, geographic isolation would facilitate domestication as well, but whether domestication generally occurs at the center, periphery, or well outside the geographic range of its progenitor has, to our knowledge, never been quantified. It is important to keep in mind that most discussions of reproductive isolation in natural populations focus on the means by which sexual, outcrossing species arise. The reproductive   71 barriers discussed above reflect this bias. Additional barriers to gene flow found in natural populations, and potentially exploited by early farmers, include self-fertilization (autogamy), as well as various forms of asexual reproduction. Like other kinds of reproductive barriers, autogamy and asexual reproduction offer a means for preserving adaptive gene combinations. However, they differ from other barriers in that descendent lineages are as strongly isolated from each other as they are from their ancestors. Thus, some authors have questioned whether autogamy and asexual reproduction should be viewed as reproductive barriers at all (e.g., Coyne and Orr 2004). However, both mechanisms offer a straightforward means for preserving desired genotypes and thus may have played an important role in the domestication of some crops. Here, we explore the hypothesis that reproductive isolation facilitates the process of domestication. We ask the following specific questions: (1) Is reproductive isolation frequently associated with plant domestication? (2) Does domestication, like speciation, typically occur in parapatry or allopatry with progenitor populations? (3) Are intrinsic postzygotic barriers rare relative to geographic isolation or other prezygotic barriers? (4) Are shifts in ploidy more frequent during domestication than might be predicted based on polyploid speciation rates in natural populations of plants? and (5) Does a transition in mating systems towards higher rates of selfing occur during domestication, or does mating system influence the propensity for a species to be domesticated (see also Rick 1988)? The results from our survey not only increase our understanding of the role of reproductive isolation in plant domestication, but they also are of practical relevance for the use of wild germplasm in crop improvement (Tanksely and McCouch 1997) and for predicting the likelihood that engineered genes may ‘escape’ from cultivated fields through crop-wild hybridization (Ellstrand 2001; Snow et al 2003).     72 5.2 Methods 5.2.1 Literature survey We focused this study on 29 of the 30 most economically important crops, as measured in terms of area under cultivation and recorded in the FAOStat database of the Food and Agricultural Organization of the United Nations (2008).  This sample was chosen because a cursory review of a wider set of literature revealed that for most of the ‘economically less important’ crops, insufficient information exists on the progenitor. Furthermore, the focus of this study is on the more strongly domesticated crops, which we feel are represented well in this list. Only the major species that contribute to a crop’s total acreage are listed, so for example in the case of ‘plantain and banana’ only Musa acuminata Colla (AAA Group) cv. 'Dwarf Cavendish' is listed. This set of crops is diverse with respect to phylogeny and life-history, and most have sufficient information available in terms of the history of domestication and the identity of the progenitor for inclusion in our survey. However, potato, for which there is much uncertainty regarding the identity of the progenitor, was removed from our list because of insufficient information - thereby reducing the number of crop species considered here from 30 to 29. For banana, there is uncertainty concerning the precise identity of the progenitor and it is thought that several subspecies of Musa acuminata have been involved in the domestication of this crop (Perrier et al. 2011). We therefore included a reference to ‘several subspecies of Musa acuminata’ as the progenitor of banana in our analysis, but treated it as a single crop/progenitor comparison. For coffee, both major types -  Arabica (Coffea arabica) and Robusta (Coffea canephora) - were included. In the case of rapeseed, the two putative progenitors that are thought to have contributed to the origin of the crop, Brassica rapa and Brassica oleracea were both considered. Where there is strong evidence of hybridization in the domestication history of the crop, such as common wheat, information on all proposed progenitors is listed. Therefore,   73 although we have included information on the 29 economically most important crops (excluding potato), we are considering here a total of 34 crop/progenitor pair comparisons. The taxonomy of each crop and its proposed progenitor was verified using The Plant List (2010). We recognize that some crop evolutionists and taxonomists might disagree with the taxonomy provided by these references.  5.2.2 Characterization of reproductive barriers Several different approaches can be taken to assess reproductive barrier strength.  A popular method is to identify and quantity the individual barriers that exist between a given pair of taxa and then combine them to estimate total isolation strength (Ramsey et al. 2003; Lowry et al. 2008). However, the necessary information for such an approach does not exist for most species pairs considered here. A second approach is to use molecular markers to examine ongoing gene flow or to indirectly estimate gene flow from overall genetic divergence (e.g., Klinger et al. 1992; Arias and Rieseberg 1994; Morjan and Rieseberg 2004).  However, this approach suffers because it is difficult to estimate range-wide realized gene flow from experimental studies, and demographic effects likely invalidate indirect estimates of gene flow between crops and their wild relatives. Given these difficulties, we have not attempted to assess the identity and strength of the entire suite of reproductive barriers for each crop. Instead, we focused our efforts on what we suspected were the important reproductive barriers, especially those for which information could be found in the literature. These include (1) geographical isolation; (2) mating system isolation, especially transitions from outcrossing to selfing; (3) isolation through asexual propagation; (4) ploidy changes, because whole genome duplications typically generate substantial reproductive isolation (Coyne and Orr 2004; Linder and Rieseberg 2004; Mallet 2007); and (5) the fitness of hybrids between the crop and its proposed progenitor. We classified hybrid fitness according to   74 the following four categories: (1) generally no reduction in hybrid fertility; (2) reduced fertility in post-F1 generations (wherever such data were available); (3) reduction of fitness in some F1s; (4) no or few fertile hybrids formed. Furthermore, we also recorded information on the predominant mode of propagation for each crop. In cases where hybridization between two or more species is thought to have played a key role during domestication, we considered each case separately for the purpose of our assessment of taxonomic differences and hybrid fitness. However, in our comparisons of transition in mating systems, the assessment of breakdown of self-incompatibility systems and of differences in ploidy level, data on all progenitors were treated as a single case for each crop in order to avoid pseudo-replication. This was the case for common wheat and rapeseed in our data set.  5.3 Results In 16 cases, no taxonomic differences are recognized between the crop and progenitor species according to currently recognized taxonomic nomenclature (Figure 5.1; Appendix A.5). However 14 crop/wild relative pairs are recognized as different species, three pairs as different subspecies and an additional two crop/wild relatives pairs are distinguished at the varietal level (Figure 5.1). In some instances, the presumed geographic location of domestication is partly deduced from the current origin of the progenitor (e.g., Upland cotton in Yucatan (Brubaker and Wendel 1994), rather than exclusively from archaeological records or the centre of crop diversity. With this caveat in mind, almost all examples of domestication are thought to have occurred in sympatry with the wild progenitor species (Appendix A.5). The only exception in our data appears to be sunflower domestication, which occurred on the periphery of the range of the common sunflower, so it is best classified as parapatric (Asch, 1993).   75 Twenty-one crop/wild relative pairs out of the 34 pairs displayed little or no reduction in hybrid fertility (category 1, 61%; Figure 5.2); one pair, barley, exhibited reduced fertility in later generation hybrids (category 2, 3%); nine pairs showed evidence of reduced F1 fitness (category 3, 26%); and three pairs have been shown to produce few or no fertile hybrids (category 4, 9%). Data on mating system transitions were used to place each of the crop/wild relative pairs into one of five categories; however the case of sesame was excluded because of insufficient information on the mating system of the progenitor. In 11 out of 31 cases (35%), the crop and progenitor are predominantly selfing (category 1); coconut as well as cotton and its wild progenitor have mixed mating systems (category 2, 6%); both the crop and its progenitor are predominantly outcrossing in 11 additional cases (category 3, 35%); seven pairs show higher rates of selfing in the crop (category 4, 23%); whereas there are no pairs that show higher rates of outcrossing in the crop (category 5) (Figure 5.3). In addition to information on the mating system we also examined the presence or absence of a self-incompatibility system. In 24 cases, which is the vast majority, neither the progenitor nor the crop have a self incompatibility system (Figure 5.4). Of these 24 cases, wine grapes deserve special attention; while grapes lack a self-incompatibility system, a transition from dioecy to monoecy during domestication has occurred. Of the remaining eight cases, three species pairs show a complete loss of self-incompatibility, while self-compatible genotypes are found in three more cases. Finally, in only two pairs do both the crop and the progenitor maintain a self-incompatibility system (Figure 5.4). In four cases there are ploidy differences between the crop and the wild progenitor: rapeseed; sweet potato; banana; and common wheat (see Appendix A.5). The case of sugar cane is unclear, since lineages with a wide range of chromosome numbers exist in both the putative progenitor and the crop.    76  5.4 Discussion 5.4.1 Reproductive barrier strength in domesticated species Our literature survey revealed that three-fourths of the world’s most important crops are isolated from their wild progenitors by a minimum of one reproductive barrier, at least if these barriers are defined broadly to include autogamy and asexual reproduction. If we restrict our consideration to traditional barriers such as ploidy differences and reduced hybrid fitness then more than a third of the cases considered here (38%) show evidence of reproductive isolation. However, these estimates are conservative because some reproductive barriers were not included (e.g., flowering time, phenology, conspecific pollen precedence and gametic incompatibilities). In addition, components of isolation that operate mainly in agricultural environments rather than the greenhouse are likely to have been missed. Thus, we conclude that reproductive isolation frequently exists between crops and their progenitors, with nearly complete barriers to gene flow in ~10% of cases. This is particularly remarkable given the short-time span of domestication (<12,000 years (Hancock 2004)). It is of course also possible that certain isolating barriers between crops and their proposed progenitors arose in wild populations well after the beginning of the domestication process, once the crop is common and the wild relative has become rare. Under such a scenario certain crop alleles may become detrimental in wild populations and the selection pressure for reproductive isolation in the wild may increase (Ladizinsky 1985). Furthermore, the association between domestication and reproductive isolation does not necessarily mean that reproductive isolation was a cause of domestication or even that the ease with which reproductive isolation arose affected the domestication process. Some of the reproductive barriers observed likely were favoured for reasons other than their effects on gene flow with wild relatives. For example,   77 selfing and asexual reproduction may have been unconsciously selected by early farmers because of reproductive assurance and the ability to preserve key phenotypic traits within domesticated varieties from recombination with other varieties (Rick 1988; Allard 1999; Gepts 2004). Likewise, changes in ploidy might have been favoured because of effects on development or on fruit and seed size (Villar et al 1998; von Well and Fossey 1998; Otto and Whitton 2000). There are a number of crops for which some researchers have suggested that certain domestication traits might have evolved after the incipient crop was transferred to areas where the wild relatives were absent (e.g., Africa to Asia). One example is finger millet, which has been suggested to initially have been domesticated in the East African Highlands, yet the earliest known remains date to 2000 BC in India, and it only shows up later in the paleo-record of East Africa (Fuller 2006). Similar patterns have also been suggested for pearl millet and sorghum domestication (Fuller 2007; Haaland 1995; Haaland 1999), though this remains controversial. However, there are too few such crops in our list to allow quantification of this potential “allopatry effect”. We did find differences in how reproductive isolation has evolved in domesticated plants versus wild species. For example, unlike wild plant species geographical isolation was not associated with the origin of most (97%) of the domesticated plants studied here (Stebbins 1950; Rieseberg and Willis 2007).  Thus, it appears that sympatry was not a major impediment to domestication. This could be because (1) other barriers to gene flow arose quickly, such as polyploidy, thereby mitigating the effects of sympatry (Rieseberg and Willis 2007); (2) microgeographic variation in habitat provided local geographic isolation; or (3) both conscious and unconscious selection were strong enough to overcome the homogenizing effects of gene flow between the incipient crop and its wild progenitor (Papa and Gepts 2003; Papa et al. 2005; Papa et al. 2007). However, the high level of sympatry compared to speciation in the wild suggests that reproductive barriers other than geographical isolation are likely of more   78 importance during domestication. Another surprise was the high frequency of intrinsic postzygotic isolation (38% of cases assayed) given the fairly short time scale of domestication (typically < 12,000 years (Hancock 2004)) and lack of geographic isolation. Only 50 (13%) of 397 wild plant species surveyed by Rieseberg et al. (2006) showed evidence of intraspecific variation for intrinsic postzygotic reproductive barriers. This is a conservative estimate because the wild population crosses typically were assayed for a smaller number of reproductive barriers than the crop wild hybrids. Also, the crop-wild complexes are enriched for selfers, which tend to exhibit higher levels of intraspecific RI than outcrossers (e.g., Grundt et al. 2006). Nonetheless, it does look like highly domesticated crops are more strongly isolated from their progenitors than is expected for a typical intraspecific cross in plants. We are not sure why postzygotic barriers have arisen so quickly in crops, although note that some unknown fraction of these likely result from the sorting of hybrid incompatibilities that already existed in progenitor populations. A recent review of the attributes of genes underlying reproductive isolation in plants, many of which were characterized in crop plants, revealed strong roles for diversifying selection and genetic drift in the evolution of intrinsic hybrid incompatibilities (Rieseberg and Blackman 2010). Both forces are likely to be strong in crop evolution, perhaps contributing to the patterns observed here. Also, all six cases where the history of domestication includes polyploidy also show varying degrees of post-zygotic isolation, which is not surprising given that interploidy hybrids often exhibit difficulties in chromosome pairing during meiosis, which pose a significant challenge to successful reproduction (Rieseberg and Willis 2007). The frequency of ploidy changes in our data (13%) is similar to the estimates of polyploid speciation in angiosperms (~15%) (Wood et al. 2009) and in all cases it is associated with uni-parental reproduction in the crop (selfing or asexual reproduction), a feature that could aid in overcoming the minority cytotype disadvantage experienced by neopolyploids   79 (Otto and Whitton 2000).  5.4.2 The taxonomy of crop plants in relation to reproductive barrier strength Although opinions differ on the taxonomic placement of several species under consideration here, the recently published ‘Plant List’ (2010) allows us to assess the level of taxonomic differentiation between the crops and their wild relatives, as agreed by many of the world’s pre-eminent authorities of plant taxonomy. Simmonds (1976) describes a trend that over time taxonomists tend to bring crops and their progenitors together into a single species. In our dataset, 14 crop/progenitor pairs are differentiated at the species level, three pairs are differentiated at the subspecies level, two at the variety level and only 16 pairs were recognized as the same taxon (Figure 5.1). Taxonomists base their descriptions mainly on the level of phenotypic and phylogenetic differentiation and rarely use direct evidence of reproductive isolation as the basis of their taxonomic assessment (Rieseberg et al. 2006). Most of the cases in which taxonomists consider the crop and the progenitor to belong to the same taxon are fully inter-fertile, with the exception of banana. Banana is not known to form fertile hybrids with its progenitor species due to parthenocarpy in the domesticated taxon, which allows the crop to produce fruit without fertilization. There are seven cases - oats, chickpeas, pearl millet, sorghum, durum wheat, sugar cane and cowpea - in which taxonomists recognize the crop and the progenitor as different taxa, even though it appears from the literature that there are no postzygotic barriers to reproduction between the crop and the progenitor taxa. However, oats, chickpeas, durum wheat and cowpea are all selfing, as are their proposed progenitors, which is of interest because selfing acts as a premating barrier. Over-differentiation by taxonomists has been found for wild plant species (Rieseberg et al. 2006), and the same appears to be true for the designation of several of the taxa formed during domestication - however for most crop/wild taxon pairs, taxonomic status is an   80 accurate predictor of crossability.  5.4.3 Uniparental reproduction and domestication The evolution of uniparental reproduction is one factor that can contribute to reproductive isolation, as it allows individuals to produce fertile offspring without the incorporation of genes from a different lineage. Selfing as well as asexual reproduction can be particularly advantageous in crops; it enables farmers to select more easily on combinations of traits, because a selfing plant will ‘breed true to type’ (Rick, 1988; Zohary and Hopf 2000; Gepts 2004; Glémin and Bataillon 2009). In addition to its potential role in preserving desirable combinations of traits and genes (Baker 1959; Dickinson and Antonovics 1973; Epinat and Lenormand 2009), uniparental reproduction may facilitate domestication through reproductive assurance (Darwin 1876; Baker 1955; Kalisz et al 2004), allowing populations to survive demographic bottlenecks (mate limitation) and pollinator limitation (reviewed in Holsinger 1996). Avoidance of pollinator limitation might have been especially critical to domestication because it would allow farmers to successfully grow the species in a greater number of environments. Consequently, the advantages of these breeding systems suggests that they should evolve frequently during domestication. On the other hand, selfing can be associated with significant short-term fitness costs through inbreeding depression (Darwin 1876; Charlesworth and Charlesworth 1987), and both selfing and asexual breeding systems can slow adaptation (in the long term) and inhibit the purging of deleterious recessive alleles (Williams 1975; Kondrashov 1984; Schoen and Brown 1991; Schultz and Lynch 1997; Glemin et al. 2006; Agrawal 2006; Moran et al. 2009). Given the brief time scale of domestication, as well as reduced competition within agricultural fields, which could ameliorate some of the short term costs of selfing (e.g. Armbruster and Reed 2005),   81 it might be that the benefits these breeding systems offer to crop plants outweigh their long-term liabilities, particularly when combined with occasional episodes of outcrossing. Of the crop/progenitor pairs analyzed for transitions in mating systems during domestication, almost a quarter (Figure 5.3) show higher rates of selfing in the crop, but none show higher rates of selfing in the progenitor. Empirical studies have shown that transitions in mating systems from selfing to outcrossing rarely, if ever, occur in nature, whereas transitions from outcrossing to selfing are more frequent (Stebbins 1957; Rick 1988; Takebayashi and Morrell 2001, Goldberg 2010), a pattern also repeated in our data. However, the majority of crop/progenitor pairs do not appear to show a transition in mating systems. It is worth noting that the majority of outcrossing pairs, with the exception of maize, rye and pearl millet, are either perennial crops, such as oil palm, rubber tree, olive, sugar cane, banana and robusta coffee, and/or are propagated predominantly asexually through vegetative means, such as sweet potato, olive, cassava, banana and rubber tree. The lack of mating system transitions in the latter is not surprising, given that the sexual mode of reproduction is much less relevant for such species in cultivated environments. One could argue that these species have undergone a transition to asexuality via cultural co-evolution with humans rather than through intrinsic mechanisms. Likewise, perennial species are thought to become domesticated at a much slower pace (and to exhibit domestication syndromes to a much lower degree) than annuals because of longer generation times. The transition from outcrossing to selfing can be facilitated by the breakdown of sexual systems that enforce outcrossing, such as self-incompatibility systems or dioecy (Igic and Kohn 2006). A transition from separate sexes to combined sexes appears to be rare and is evident in our dataset only in grapes. Most progenitors and crops (75%), do not exhibit a self- incompatibility system, and only in two cases - rye and robusta coffee - are the crops and the progenitors both self-incompatible. In three cases - rapeseed, sugar cane and sunflower - there is   82 a complete loss of the self-incompatibility system during domestication and a partial break-down of the self-incompatibility systems in some cultivars seems to have occurred in three more cases (cacao, olives, and sweet potato). Estimates place the percentage of self-fertilizing angiosperms at ~20%, while the percentage of obligate outcrossers (i.e., dioecious or self-incompatibility systems) is ~50% (Igic and Kohn 2006; Vogler and Kalisz 2001). Therefore, the higher frequency of selfing progenitors (35% of all cases considered here) and the lower frequency of obligate outcrossers (35% of all cases considered here) could indicate that the ability to self-fertilize represents a pre-adaptation to domestication. However, as Barrett et al. (1996 and 1998) and Morgan and Schoen (1997) show, annual species have considerably higher rates of selfing than woody perennials, which are predominantly outcrossing. Interestingly, annuals tend to have high reproductive output (Primack 1979; Wilson and Thompson 1989; Karlsson and Mendez 2005), an attractive feature for a farmer, and a short generation time, which would speed domestication. This is not a benefit of selfing per se, but it could partially explain the high incidence of selfers that are domesticated. In order to investigate whether selfing species are pre-adapted to become domesticated, larger samples sizes than included here will be required to disentangle information on mating systems from other correlated factors, such as an annual habit.  5.5 Conclusions In summary, our review of 29 of the most economically important crops and their progenitors has shown that domestication is frequently associated with the existence or evolution of prezygotic and/or postzygotic reproductive barriers despite the fact that the most important reproductive barrier in natural systems, geographical isolation, was absent at least in the initial stages of domestication for most species. Strong barriers to reproduction between crops and wild   83 relatives could increase the rate of domestication and/or facilitate the maintenance of gene combinations favored by early human farmers. However, our hypothesis that reproductive isolation may have facilitated domestication will require additional evidence.  This could for example include a comparison of levels of reproductive isolation between crop/wild relative pairs of semi-domesticated and strongly domesticated crops, quantification of the “allopatry effect,” if it exists, as well as selection studies that attempt to re-domesticate crops under varying levels of gene flow. Whether selfing species are pre-adapted to becoming domesticated remains an open question, but there is strong evidence that higher rates of selfing are frequently associated with domestication and that a breakdown of the self-incompatibility system is common.      F o   igure 5.1 Level of taxonomic differentiation for the 29 species included in the analysis. The percentage f all cases considered is shown.       84 F p   igure 5.2 Hybrid fitness of crop/progenitor crosses for the species included in the analysis. The ercentage of all cases considered is shown.      Figure 5.3 Transition in mating system during domestication. The percentage of all cases considered is shown.     85 Figure 5.4 Breakdown of self-incompatibility during domestication. The percentage of all cases considered is shown.   86  6 Conclusion 6.1 A ‘comparative view’ of domestication The findings of this thesis clearly demonstrate the value of taking a comparative view of domestication. In the second chapter, we compared the number of crops in the Compositae family with the number of crops in other large plant families and explored why relatively few Compositae species have been domesticated. We propose that the prevalence of secondary defense compounds, the lack of carbohydrates that can be digested by the human gut and the predominantly mechanical or wind-dependent seed dispersal syndrome are some of the key reasons for this apparent paucity of crops in the Compositae family. However, we recognize that these potential reasons vary in their explanatory value.  For example, the lack of digestible carbohybrates is likely more important than the presence of secondary compounds or allergens.  . Other researchers, such as Smartt (1976) in his paper “Comparative evolution of pulse crops”, Chapman (1992) in his book “Grass evolution and domestication” and Glemin and Bataillon (2009) in their paper “A comparative view of the evolution of grasses under domestication,” have also been taking a comparative approach to the study of domestication. One can only hope that similar studies on other families will soon follow. In the third chapter of this thesis, we developed genomic resources for the oil-seed crop noug (Guizotia abyssinica), which included the sequencing of noug’s chloroplast genome. When compared with noug’s most closely related oil-seed relative, sunflower (Helianthus annuus), the chloroplast genomes of sunflower and noug appeared remarkably similar. The comparison between noug and sunflower also inspired the fourth chapter of this thesis, in which we investigated the possible reasons that noug is only semi-domesticated in comparison with sunflower. Sunflower differs much more markedly from its wild progenitor than noug, even though both crops were domesticated for the same purpose. We tested the two   87 hypotheses that (1) rampant gene-flow between the crop and its progenitor hinder domestication, and (2) unfavorable phenotypic correlations have inhibited the evolution of a more typical domestication syndrome. However, we could not find evidence in support of either of these hypotheses. Our data did reveal evidence of local adaptation of noug cultivars to different precipitation regimes, as well as high levels of phenotypic plasticity, which may be important for the crop to produce reasonable yields under diverse environmental conditions. Although we could not conclusively resolve why early farmers failed to fully domesticate noug, we suggest that perhaps farmers consciously or unconsciously prioritized selection for resilience to episodic drought or untended environments rather than typical domestication traits such as larger seeds. In the fifth chapter, we compared the mating system and reproductive barrier strength of the domesticated and wild-progenitor forms of several major crops. This comparison reaches well beyond the limits of the Compositae family and allowed us to explore the question of whether reproductive isolation should be considered a domestication trait. Our study showed that at least one reproductive barrier exists between a particular crop and its progenitor for most cases that we surveyed. This is true even though geographical isolation, which is one of the most important reproductive barriers in natural populations, was absent at least during the initial phase of domestication for most species. We therefore suggest that barriers to reproduction between crops and their wild relatives might have played an important role in facilitating domestication.  6.2 Context of current research findings, possible applications and future directions Our observations presented here clearly indicate that species have responded to artificial selection to varying degrees and with a wide diversity of alterations in phenotypic traits. The reasons for these differences need to be assessed on a case-by-case basis. These results are of   88 significance to evolutionary biologists because they highlight the importance of considering diversity in life-history traits when investigating the response of species to strong selection pressures. This is of particular relevance to conservation biologists, who aim to predict the future responses of species to strong, human-induced selective pressures such as climate change. Our findings are also of interest to breeders as well as to those researchers concerned with the optimal conservation strategy for crop diversity in agricultural gene-banks or in the field. In the case of noug, the development and use of self-compatible lines in breeding programs should be a top priority and would likely lead to major advances in the improvement of this crop. The results of our study on noug also showed that there appears to be some degree of local adaptation to different precipitation regimes – an important aspect to consider in future collection missions that aim to capture the maximum diversity of the crop for conservation purposes. The genomic tools and resources we developed are of great interest to breeders and genetic resource managers because they make it possible to assess and better understand the genetic diversity of noug accessions in ex-situ collections and in the field. With the continuously decreasing cost of sequencing, it has now become financially feasible to develop further genomic resources for noug that provide an even better level of coverage of the genome, such as genotyping chips that are based on a high number of single nucleotide polymorphisms (SNPs) rather than the microsatellite markers that were developed as part of this thesis. A SNP chip could be employed to develop a genetic map for noug and to apply marker-assisted selection approaches to advance noug improvement efforts. Furthermore, the library of expressed sequence tags, which was developed as part of this thesis, provides an important basis for a sequencing effort of the whole genome, which may be feasible within a few years time. Once a whole-genome sequence and a genetic map for noug is available, it will be possible to investigate the parallels and differences of the impact of the domestication process on noug and sunflower on the genomic level. This approach also bears great promise when extended to other   89 crops in the Compositae family. As our results have shown, despite their relatively close phylogenetic relationships, many crops in the Compositae have been domesticated for different purposes, which makes this family ideally suited to exploring key questions in comparative domestication genomics. Once more sequence data for a wider diversity of crops in the Compositae are available, it will be possible to explore questions such as (1) are similar (or identical) genes under selection in crops that have been domesticated for the same purpose? (2) what are the differences in the genomic signatures of selection in the genomes of crops that have been domesticated for different purposes? and (3) are there differences in genome architecture that explain why some crops have moved further along the process of domestication than others? The idea, as proposed by D’Andrea (2008), that artificial selection pressures during domestication are perhaps much less uniform than commonly thought, is also a particularly intriguing one that remains to be tested. In the case of noug, it would be relatively easy to explore this question with a set of common garden experiments in extreme environments, in order to measure noug productivity under diverse conditions. If in fact farmers have selected noug for its ability to produce reasonable yields under diverse environmental conditions, such experiments should be able to reveal this. Furthermore, it would be interesting to conduct an in- depth analysis of domestication traits of noug in common garden environments to assess the heritability of several phenotypic traits, which is a limitation of our present study. Such an analysis would not only be informative for determining the relative importance of different traits for the process of noug domestication, but would also allow breeders to better understand which traits are likely the most suitable targets for improvement efforts. The findings of the last chapter highlight the importance of considering barriers to reproduction between crops and their wild relatives when exploring patterns of domestication. Further studies that also include ‘semi-domesticated’ crops are now necessary to examine the relationship between the strength of the domestication syndrome and reproductive barrier   90 strength between crops and their wild relatives. Such an investigation would help us better understand whether strong barriers to reproduction actually increase the rate at which species become domesticated – a question that could not be fully answered by the study presented here.   91  Bibliography APG II. (2003) An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG II. Botanical Journal of the Linnean Society, 141, 399- 436. Abbo, S., Gopher, A., Rubin, B. & Lev-Yadun, S. (2005) On the origin of Near Eastern founder crops and the “Dump-heap Hypothesis.” Genetic Resources and Crop Evolution, 52, 491- 495. Agrawal, A.F. (2006) Evolution of sex: Why do organisms shuffle their genotypes? Current Biology, 16, R696-R704. Ahmad, Q.N., Brritten, E.J. & Byth, D.E. (1979) Inversion heterozygosity in the hybrid soybean x Glycine soja: Evidence from a pachytene loop configuration and other meiotic irregularities. Journal of Heredity, 70, 358-364. Albertini, E., Torricelli, R., Bitocchi, E., Raggi, L., Marconi, G., Pollastri, L., Minco, G. Di, Battistini, A., Papa, R. & Veronesi, F. (2011) Structure of genetic diversity in Olea europaea L. cultivars from central Italy. Molecular Breeding, 27, 533-547. Allard, R.W. (1999) History of plant population genetics. Annual review of genetics, 33, 1–27. Anderberg, A., Baldwin, B., Bayer, R., Breitwieser, J., Jeffrey, C., Dillon, M.O., Eldenas, P., Funk, V., Garcia-Jacas, N., Hind, D.J.N., Karis, P.O., Lack, H.W., Nesom, G., Nordenstam, B., Oberprieler, C., Panero, J.L., Puttock, C., Robinson, H., Stuessy, T.F., Susanna, A., Urtubey, E., Vogt, R., Ward, J. & Watson, L.E. (2007) Compositae. Kubitzki, K. (ed.) The families and genera of vascular plants. VIII. Flowering plants, eudicots, asterales. (eds J.W. Kadereit & C. Jeffrey), pp. 61-588. Springer, Berlin-Heidelberg-New York. Anderson, M.S. & Vicente, M.C.D. (2010) Gene flow between crops and their wild relatives. The John Hopkins University Press, Baltimore. Annapurna, M., Kumar, K. & Hiremath, S. (2010) Cytological analysis of interspecific hybrid between Sesamum indicum LX S. Orientale L. var. malabaricum. Karnataka Journal of Agricultural Sciences, 21, 498-502. Anthony, F., Bertrand, B., Quiros, O., Wilches, A., Lashermes, P., Berthaud, J. & Charrier, A. (2001) Genetic diversity of wild coffee (Coffea arabica L.) using molecular markers. Euphytica, 118, 53–65. Antimalarial Coordinating Research Group Quinghaosu (1979) Antimalarial studies on Qinghaosu. Chinese Medical Journal, 92, 57–58.   92 Arias, D.M. & Rieseberg, L.H. (1994) Gene flow between cultivated and wild sunflowers. Theoretical and Applied Genetics, 89, 655-660. Armbruster, P. & Reed, D.H. (2005) Inbreeding depression in benign and stressful environments. Heredity, 95, 235-242. Asch, D. (1993) Common sunflower (Helianthus annuus L.): the pathway toward domestication. Proceedings of the 58th annual meeting of the Society of American Archaeology. St Louis. Asfaw, Z. & Bothmer, R. von. (2008) Hybridization between landrace varieties of Ethiopian barley (Hordeum vulgare ssp. vulgare) and the progenitor of barley (H. vulgare ssp. spontaneum). Hereditas, 112, 57-64. Ashburner, G. (1994) Characterisation, collection and conservation of Cocos nucifera L. in the South Pacific. PhD thesis, University of Melbourne, Melbourne. Ashri, A. (1998) Sesame breeding. Plant Breeding Reviews, Volume 16. (ed J. Janick), pp. 179– 228. John Wiley & Sons, Inc., Oxford. Baker, H. (1959) Reproductive methods as factors in speciation in flowering plants. Cold Spring Harbor Symposia on Quantitative Biology. p. 177. Cold Spring Harbor Laboratory Press. Baker, H.G. (1955) Self-compatibility and establishment after ‘long-distance’ dispersal. Evolution, 9, 347–349. Baranyi, M. & Greilhuber, J. (1996) Flow cytometric and Feulgen densitometric analysis of genome size variation in Pisum. Theoretical and Applied Genetics, 92, 297-307. Barker, M.S., Kane, N.C., Matvienko, M., Kozik, A., Michelmore, R.W., Knapp, S.J. & Rieseberg, L.H. (2008) Multiple paleopolyploidizations during the evolution of the Compositae reveal parallel patterns of duplicate gene retention after millions of years. Molecular Biology and Evolution, 25, 2445-2455. Barrett, S.C.H. (1998) The evolution of mating strategies in flowering plants. Science, 3, 335- 341. Barrett, S.C.H. & Harder, L.D. (1996) Ecology and evolution of plant mating. Trends in Ecology & Evolution, 11, 73–79. Bartley, B.G.D. (2005) The genetic diversity of cacao and its utilization. CABI Publishing, Wallingford. Basciano, H., Federico, L. & Adeli, K. (2005) Fructose, insulin resistance, and metabolic dyslipidemia. Nutrition & Metabolism, 2, 5. Baudouin, L., Baril, C., Clément-Demange, A., Leroy, T. & Paulin, D. (1997) Recurrent selection of tropical tree crops. Euphytica, 96, 101–114.   93 Becker, H.C., Damgaard, C. & Karlsson, B. (1992) Environmental variation for outcrossing rate in rapeseed (Brassica napus). Theoretical and Applied Genetics, 84, 303-306. Bedigian, D. (2003) Evolution of sesame revisited: domestication, diversity and prospects. Genetic Resources and Crop Evolution, 50, 779-787. Bekele, E., Geleta, M., Dagne, K., Jones, A.L., Barnes, I., Bradman, N. & Thomas, M.G. (2007) Molecular phylogeny of genus Guizotia (Asteraceae) using DNA sequences derived from ITS. Genetic Resources and Crop Evolution, 54, 1419–1427. Bellwood, P.S. (2005) The first farmers: the origins of agricultural societies. Wiley-Blackwell,  Malden. Ben Ze’ev, N. & Zohary, D. (1973) Species relationships in the genus Pisum. Israel Journal of Botany, 22, 73-91. Boardman, S.J. (2000) Archaeobotany. Archaeology at Aksum, Ethiopia, 1993-7. (ed D.W. Phillipson), p. 363-368. The British Institute in Eastern Africa and the Society of Antiquaries, London. Boardman, S.J. (1999) The agricultural foundation of the Aksumite empire, Ethiopia. Plants and People in Africa: Recent Archaeobotanical Evidence. (ed M. van der Veen), pp. 137-147. Plenum Publishing Corp, New York. Bohm, B.A. & Stuessy, T.F. (2001) Flavonoids of the sunflower family (Asteraceae). Springer Verlag, Vienna. Bonnett, G.D., Nowak, E., Olivares-Villegas, J.J., Berding, N., Morgan, T. & Aitken, K.S. (2008) Identifying the risks of transgene escape from sugarcane crops to related species, with particular reference to Saccharum spontaneum in Australia. Tropical Plant Biology, 1, 58-71. Bouck, A. & Vision, T. (2007) The molecular ecologist’s guide to expressed sequence tags. Molecular Ecology, 16, 907–924. Breton, C., Tersac, M. & Bervillé, A. (2006) Genetic diversity and gene flow between the wild olive (oleaster, Olea europaea L.) and the olive: several Plio-Pleistocene refuge zones in the Mediterranean basin suggested by simple sequence repeats analysis. Journal of Biogeography, 33, 1916-1928. Brink, M. & Belay, G. (2006) Plant Resources of Tropical Africa: Cereals and Pulses. PROTA Programme, Wageningen. Brown, A., Zohary, D. & Nevo, E. (1978) Outcrossing rates and heterozygosity in natural populations of Hordeum spontaneum Koch in Israel. Heredity, 41, 49–62. Brubaker, C.L. & Wendel, J.F. (1994) Reevaluating the origin of domesticated cotton (Gossypium hirsutum; Malvaceae) using nuclear restriction fragment length polymorphisms (RFLPs). American Journal of Botany, 81, 1309–1326.   94 Bulmer, M. (1971) The effect of selection on genetic variability. American Naturalist, 105, 201– 211. Bungard, R.A. (2004) Photosynthetic evolution in parasitic plants: insight from the chloroplast genome. Bioessays, 26, 235–247. Burger, J.C., Chapman, M. a & Burke, J.M. (2008) Molecular insights into the evolution of crop plants. American Journal of Botany, 95, 113-122. Burke, J.M., Tang, S., Knapp, S.J. & Rieseberg, L.H. (2002) Genetic analysis of sunflower domestication. Genetics, 161, 1257-67. Carvalho, A. (1988) Principles and practice of coffee plant breeding for productivity and quality factors: Coffea arabica. Coffee: agronomy, vol. 4. (eds F.P. Fewerda & F. Wit), pp. 129- 165. Elsevier Applied Science, London. Chapman, G.P. (1992) Grass evolution and domestication. Cambridge University Press, Cambridge. Charlesworth, D. & Charlesworth, B. (1987) Inbreeding depression and its evolutionary consequences. Annual Review of Ecology and Systematics, 18, 237–268. Corley, R.H.V., Hardon, J.J. & Wood, B.J. (Eds.) (1976) Oil Palm research. Elsevier Scientific Publishing Company, Amsterdam. Cosner, M.E., Jansen, R.K., Palmer, J.D. & Downie, S.R. (1997) The highly rearranged chloroplast genome of Trachelium caeruleum (Campanulaceae): multiple inversions, inverted repeat expansion and contraction, transposition, insertions/deletions, and several repeat families. Current Genetics, 31, 419–429. Coyne, JA; Orr, H.A. (2004) Speciation. Sinauer Associates, Inc., Sunderland. Cronn, R., Liston, A., Parks, M., Gernandt, D.S., Shen, R. & Mockler, T. (2008) Multiplex sequencing of plant chloroplast genomes using Solexa sequencing-by-synthesis technology. Nucleic Acids Research, 36, e122. Cui, L., Wall, P.K., Leebens-Mack, J.H., Lindsay, B.G., Soltis, D.E., Doyle, J.J., Soltis, P.S., Carlson, J.E., Arumuganathan, K., Barakat, A. & others. (2006) Widespread genome duplications throughout the history of flowering plants. Genome Research, 16, 738-749. D’Andrea, A.C. (2008) T’ef (Eragrostis tef) in ancient agricultural systems of highland Ethiopia. Economic Botany, 62, 547–566. Dagne, K. (1994) Meiosis in interspecific hybrids and genomic interrelationships in Guizotia Cass. (Compositae). Hereditas, 121, 119–129. Darwin, C. (1859) On the origin of species by means of natural selection. J. Murray, London.   95 Darwin, C. (1876) The effects of cross and self fertilization in the vegetable kingdom. J. Murray, London. Darwin, C. (1868) The variation of plants and animals under domestication. J. Murray, London. De Wet, J.M.J. (1992) The three phases of cereal domestication. Grass evolution and domestication. (ed G. Chapman), pp. 176–198. Cambridge Univ Press, Cambridge. De Wet, J.M.J. & Huckabay, J.P. (1967) The origin of Sorghum bicolor. II. Distribution and domestication. Evolution, 21, 787-802. Dempewolf, H., Kane, N.C., Ostevik, K.L., Geleta, M., Barker, M.S., Lai, Z., Stewart, M.L., Bekele, E., Engels, J.M.M., Cronk, Q.C.B. & Rieseberg, L.H. (2010a) Establishing genomic tools and resources for Guizotia abyssinica (L.f.) Cass. – the development of a library of expressed sequence tags, microsatellite loci, and the sequencing of its chloroplast genome. Molecular Ecology Resources, 10, 1048-1058. Dempewolf, H., Bordoni, P., Rieseberg, L.H. & Engels, J.M.M. (2010b) Letter to Science: Food security: crop species diversity. Science, 328, 169-170. Dempewolf, H., Rieseberg, L.H. & Cronk, Q.C. (2008) Crop domestication in the Compositae: a family-wide trait assessment. Genetic Resources and Crop Evolution, 55, 1141-1157. Diamond, J. (2002) Evolution, consequences and future of plant and animal domestication. Nature, 418, 700-707. Diamond, J.M. (1997a) Guns, germs, and steel: the fates of human societies. W.W. Norton & Co, New York. Diamond, J. (1997b) Location, location, location: the first farmers. Science, 278, 1243-1244. Dickinson, H. & Antonovics, J. (1973) Theoretical considerations of sympatric divergence. The American Naturalist, 107, 256–274. Doebley, J., Stec, A & Hubbard, L. (1997) The evolution of apical dominance in maize. Nature, 386, 485-488. Doebley, J. (2004) The genetics of maize evolution. Annual review of genetics, 38, 37-59. Doebley, J.F., Gaut, B.S. & Smith, B.D. (2006) The molecular genetics of crop domestication. Cell, 127, 1309–1322. Doggett, H. (1988) Sorghum. Longman Scientific & Technical, Harlow, UK. Elliott, S.S., Keim, N.L., Stern, J.S., Teff, K. & Havel, P.J. (2002) Fructose, weight gain, and the insulin resistance syndrome. The American Journal of Clinical Nutrition, 76, 911-922. Ellstrand, N.C. (2003) Dangerous liaisons? When cultivated plants mate with their wild relatives. The John Hopkins University Press, Baltimore.   96 Ellstrand, N.C. (2001) When transgenes wander, should we worry? Plant physiology, 125, 1543- 1545. Elzebroek, A.T.G. & Wind, K. (2008) Guide to cultivated plants. CABI Publishing, Singapore. Epinat, G. & Lenormand, T. (2009) The evolution of assortative mating and selfing with in- and outbreeding depression. Evolution, 63, 2047-2060. Evanno, G. & Regnaut, S. (2005) Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Molecular Ecology, 14, 2611-2620. Evans, M. (2001) Teosinte crossing barrier1, a locus governing hybridization of teosinte with maize. TAG Theoretical and Applied Genetics, 103, 259-265. Excoffier, L., Laval, G. & Schneider, S. (2005) Arlequin (version 3.0): an integrated software package for population genetics data analysis. Evolutionary Bioinformatics, 1, 47-50. Food and Agriculture Organization of the United Nations. (2008) FAO Statistical Database (FAOSTAT). Available form: http://faostat.fao.org/ (last accessed August 2011) Falush, D., Stephens, M. & Pritchard, J.K. (2003) Inference of population structure using multilocus genotype data: linked loci and correlated allele frequencies. Genetics, 164, 1567- 1587. Felsenstein, J. (1976) The theoretical population genetics of variable selection and migration. Annual Review of Genetics, 10, 253–280. Fields, M. (1998) Nutritional factors adversely influencing the glucose/insulin system. Journal of the American College of Nutrition, 17, 317-321. Fujita, R., Ohara, M., Okazaki, K. & Shimamoto, Y. (1997) The extent of natural cross- pollination in wild soybean (Glycine soja). Journal of Heredity, 88, 124-128. Fuller, D.Q. (2006) Agricultural origins and frontiers in South Asia: a working synthesis. Journal of World Prehistory, 20, 1-86. Fuller, D.Q. (2007) Contrasting patterns in crop domestication and domestication rates: recent archaeobotanical insights from the Old World. Annals of Botany, 100, 903-924. Fuller, D., Qin, L., Zheng, Y., Zhao, Z., Chen, X., Hosoya, L.A. & Sun, G.P. (2009) The domestication process and domestication rate in rice: Spikelet bases from the Lower Yangtze. Science, 323, 1607-1610. Funk, V.A., Bayer, R.J., Sterling, K., Chan, R., Watson, L., Gemeinholzer, B., Schilling, E., Panero, J.L., Baldwin, B.G., Garcia-Jacas, N., Susanna, A. & Jansen, R.K. (2005) Everywhere but Antarctica: Using a supertree to understand the diversity and distribution of the Compositae. Plant diversity and complexity patterns: local, regional, and global dimensions: proceedings of an international symposium held at the Royal Danish Academy   97 of Sciences and Letters in Copenhagen, Denmark, 25-28 May, 2003. pp. 343-374. Kgl. Danske Videnskabernes Selskab, Copenhagen. Funk, V.A., Susanna, A., Stuessy, T.F. & R.J., B. (Eds.). (2009) Systematics, evolution, and biogeography of Compositae. International Association for Plant Taxonomy, University of Vienna, Vienna. Ganeshaiah, K.N. & Uma Shaanker, R. (1982) Evolution of reproductive behaviour in the genus Eleusine. Euphytica, 31, 397-404. García-Díaz, A., Oya, R., Sanchez, A. & Luque, F. (2003) Effect of prolonged vegetative reproduction of olive tree cultivars (Olea europaea L.) in mitochondrial homoplasmy and heteroplasmy. Genome, 46, 377-381. Geleta, M. & Bryngelsson, T. (2010) Population genetics of self-incompatibility and developing self-compatible genotypes in niger (Guizotia abyssinica). Euphytica, 176, 417-430. Geleta, M., Bekele, E. & Dagne, K. (2010) Phylogenetics and taxonomic delimitation of the genus Guizotia (Asteraceae) based on sequences derived from various chloroplast DNA regions. Plant Systematics and Evolution, 289, 77-89. Geleta, M., Bryngelsson, T., Bekele, E. & Dagne, K. (2008) Assessment of genetic diversity of Guizotia abyssinica (Lf) Cass. (Asteraceae) from Ethiopia using amplified fragment length polymorphism. Plant Genet. Resour. Characterization Utilization, 6, 41–51. Geleta, M., Bryngelsson, T., Bekele, E. & Dagne, K. (2007) Genetic diversity of Guizotia abyssinica (L. f.) Cass. (Asteraceae) from Ethiopia as revealed by random amplified polymorphic DNA (RAPD). Genetic Resources and Crop Evolution, 54, 601–614. Gepts, P. (2004) Crop domestication as a long-term selection experiment. Plant Breeding Reviews, 24, 1–44. Gepts, P. & Papa, R. (2002) Evolution during domestication. Encyclopedia of Life Sciences. Macmillan Publishers Ltd, Nature Publishing Group. Getinet, A. & Sharma, S. (1996) Niger, Guizotia abyssinica (L. f.) Cass. Promoting the conservation and use of underutilized and neglected crops. p. 59. International Plant Genetic Resources Institute Rome, Rome. Glémin, S. & Bataillon, T. (2009) A comparative view of the evolution of grasses under domestication. The New Phytologist, 183, 273-290. Glémin, S., Bazin, E. & Charlesworth, D. (2006) Impact of mating systems on patterns of sequence polymorphism in flowering plants. Proceedings of the Royal Society B: Biological Sciences, 273, 3011-3019. Goldberg, E.E., Kohn, J.R., Lande, R., Robertson, K. A., Smith, S. A. & Igic, B. (2010) Species selection maintains self-incompatibility. Science, 330, 493-495.   98 Gomes, A., Saha, A. & Chatterjee, I. (2007) Viper and cobra venom neutralization by β- sitosterol and stigmasterol isolated from the root extract of Pluchea indica Less. (Asteraceae). Phytomedicine, 14, 637–643. Grassl, C.O. (1964) Problems relating to the origin of wild and cultivated Saccharum. Indian Journal of Sugar Cane Research and Development, 8, 106-116. Grevich, J. & Daniell, H. (2005) Chloroplast genetic engineering: recent advances and future perspectives. Critical Reviews in Plant Sciences, 24, 83–107. Grivet, L., Daniels, C., Glaszmann, J.C. & D’Hont, A. (2004) A review of recent molecular genetics evidence for sugarcane evolution and domestication. Ethnobotany Reseach and Applications, 2, 9-17. Grundt, H.H., Kjølner, S., Borgen, L., Rieseberg, L.H. & Brochmann, C. (2006) High biological species diversity in the arctic flora. Proceedings of the National Academy of Sciences of the United States of America, 103, 972-975. Guen, V. Le, Doaré, F., Weber, C. & Seguin, M. (2009) Genetic structure of Amazonian populations of Hevea brasiliensis is shaped by hydrographical network and isolation by distance. Tree Genetics & Genomes, 5, 673-683. Guo, S.W. & Thompson, E.A. (1992) Performing the exact test of Hardy-Weinberg proportion for multiple alleles. Biometrics, 48, 361–372. Haaland, R. (1995) Sedentism, cultivation, and plant domestication in the Holocene Middle Nile Region. Journal of Field Archaeology, 22, 157–174. Haaland, R. (1999) The puzzle of the late emergence of domesticated sorghum in the Nile valley. The Prehistory of Food - Appetites for change. (eds C. Gosden & J. Hather), pp. 397-418. Routledge, London & New York. Haldane, J. (1930) A mathematical theory of natural and artificial selection. Part IV, Isolation. Transactions of the Cambridge Philosophical Society, 26, 220-230. Hamblin, M.T., Salas Fernandez, M.G., Casa, A.M., Mitchell, S.E., Paterson, A.H. & Kresovich, S. (2005) Equilibrium processes cannot explain high levels of short- and medium-range linkage disequilibrium in the domesticated grass Sorghum bicolor. Genetics, 171, 1247-56. Hancock, J.F. (2004) Plant evolution and the origin of crop species. CABI Publishing, Wallingford. Harlan, J.R. (1986) Lettuce and the sycamore – sex and romance in Ancient-Egypt. Economic Botany, 40, 4-15. Harlan, J.R. (1992) Origins and processes of domestication. Grass evolution and domestication. (ed. G. Chapman), pp. 159–175. Cambridge University Press, Cambridge. Harlan, J.R. (1995) The living fields. Cambridge University Press, New York.   99 Harlan, J.R., de Wet, J. & Price, E.G. (1973) Comparative evolution of cereals. Evolution, 27, 311–325. Harrower, M.J., McCorriston, J. & D’Andrea, A. (2010) General/specific, local/global: Comparing the beginnings of agriculture in the Horn of Africa (Ethiopia/Eritrea) and Southwest Arabia (Yemen). American Antiquity, 75, 452–472. Harst, M., Bornhoff, B., Töpfer, R., Peterlunger, E., Gaspero, G. & Cipriani, G. (2009) Investigations of pollen dispersal and out-crossing events using transgenic grapevines: A pilot study. Acta Horticulturae (ISHS), 827, 505–510. Hartl, D.L. & Clark, A.G. (1997) Principles of population genetics. Sinauer Associates, Inc. Publishers, Sunderland. Heiser, C.B. (1988) Aspects of unconscious selection and the evolution of domesticated plants. Euphytica, 37, 77–81. Heiser, C.B. (1969) Systematics and the origin of cultivated plants. Taxon, 18, 36–45. Hendry, A.P., Day, T. & Taylor, E.B. (2001) Population mixing and the adaptive divergence of quantitative traits in discrete populations: a theoretical framework for empirical tests. Evolution, 55, 459–466. Heywood, V.H., Harborne, J.B. & Turner, B.L. (1977) The biology and chemistry of the Compositae. Academic Press, New York. Hillman, G.C. & Davies, M.S. (1990) Domestication rates in wild-type wheats and barley under primitive cultivation. Biological Journal of the Linnean Society, 39, 39–78. Hinata, K. & Nishio, T. (1978) S-allele specificity of stigma proteins in Brassica oleracea and B. campestris. Heredity, 41, 93-100. Holsinger, K.E. (1996) Pollination biology and the evolution of mating systems in flowering plants. Evolutionary Biology, 29, 107-149. Huang, X. (1996) An improved sequence assembly program. Genomics, 33, 21–31. Huang, L., Brooks, S., Li, W., Fellers, J., Nelson, J.C. & Gill, B. (2009) Evolution of new disease specificity at a simple resistance locus in a crop-weed complex: reconstitution of the Lr21 gene in wheat. Genetics, 182, 595-602. Hubisz, M.J., Falush, D., Stephens, M. & Pritchard, J.K. (2009) Inferring weak population structure with the assistance of sample group information. Molecular Ecology Resources, 9, 1322-1332. Hufford, M.B., Gepts, P. & Ross-Ibarra, J. (2011) Influence of cryptic population structure on observed mating patterns in the wild progenitor of maize (Zea mays ssp. parviglumis). Molecular Ecology, 20, 46-55.   100 Husband, B.C. & Schemske, D.W. (2000) Ecological mechanisms of reproductive isolation between diploid and tetraploid Chamerion angustifolium. Journal of Ecology, 88, 689–701. Igic, B. & Kohn, J.R. (2006) The distribution of plant mating systems: study bias against obligately outcrossing species. Evolution, 60, 1098–1103. Imle, E.P. (1978) Hevea rubber - past and future. Economic Botany, 32, 264–277. Itino, T., Kato, M. & Hotta, M. (1991) Pollination ecology of the two wild bananas, Musa acuminata subsp. halabanensis and M. salaccensis: chiropterophily and ornithophily. Biotropica, 23, 151–158. Jansen, R.K., Cai, Z., Raubeson, L.A., Daniell, H., Depamphilis, C.W., Leebens-Mack, J., Müller, K.F., Guisinger-Bellian, M., Haberle, R.C., Hansen, A.K. & others. (2007) Analysis of 81 genes from 64 plastid genomes resolves relationships in angiosperms and identifies genome-scale evolutionary patterns. Proceedings of the National Academy of Sciences, 104, 19369-19374. Jansen, R.K., Raubeson, L.A., Boore, J.L., Depamphilis, C.W., Chumley, T.W., Haberle, R.C., Wyman, S.K., Alverson, A.J., Peery, R., Herman, S.J., Fourcade, H.M., Kuehl, J.V., McNeal, J.R., Leebens-Mack, J. & Cui, L. (2005) Methods for obtaining and analyzing whole chloroplast genome sequences. Methods in Enzymology, 395, 348–384. Jarvis, D.I., Brown, A.H.D., Cuong, P.H., Collado-Panduro, L., Latournerie-Moreno, L., Gyawali, S., Tanto, T., Sawadogo, M., Mar, I., Sadiki, M., Hue, N.T.-N., Arias-Reyes, L., Balma, D., Bajracharya, J., Castillo, F., Rijal, D., Belqadi, L., Rana, R., Saidi, S., Ouedraogo, J., Zangre, R., Rhrib, K., Chavez, J.L., Schoen, D., Sthapit, B., Santis, P. De, Fadda, C. & Hodgkin, T. (2008) A global perspective of the richness and evenness of traditional crop-variety diversity maintained by farming communities. Proceedings of the National Academy of Sciences, 105, 5326-5331. Jeck, W.R., Reinhardt, J.A., Baltrus, D.A., Hickenbotham, M.T., Magrini, V., Mardis, E.R., Dangl, J.L. & Jones, C.D. (2007) Extending assembly of short DNA sequences to handle error. Bioinformatics, 23, 2942-2944. Jeffrey, C. (2001) Compositae. Mansfeld ́s encyclopedia of agricultural and horticultural crops. Vol. 4. (eds Hanelt, P. & Institute of Plant Genetics and Crop Plant Research), pp. 2035– 2145. Springer, Berlin-Heidelberg-New York. Jensen, N.F. (1961) Genetics and inheritance in oats: Inheritance of morphological and other characters. Oats and Oats Improvement. (ed F. Coffman), pp. 125-136. American Society of Agronomy, Madison. Judd, W.S. (2002) Plant systematics: a phylogenetic approach. Sinauer Associates, Inc., London. Kadereit, J.W.; & Jeffrey, C. (Eds.). (2007) Compositae. The families and genera of vascular plants. VIII. Flowering plants, eudicots, asterales. pp. 61-588. Springer, Berlin-Heidelberg- New York.   101 Kalisz, S., Vogler, D.W. & Hanley, K.M. (2004) Context-dependent autonomous self- fertilization yields reproductive assurance and mixed mating. Nature, 430, 884-887. Kane, N.C. & Rieseberg, L.H. (2008) Genetics and evolution of weedy Helianthus annuus populations: adaptation of an agricultural weed. Molecular Ecology, 17, 384–394. Karlsson, P.S. & Méndez, M. (2005) The resource economy of plant reproduction. Reproductive Allocation in Plants. (eds Reekie E. G. & Bazzaz F. A.), pp. 1–49. Elsevier Academic Press, Burlington. Keimer, L. (1924) Die Gartenpflanzen im alten Aegypten. Hoffmann und Campe, Hamburg. Kesseli, R.V. & Michelmore, R.W. (1997) The Compositae: systematically fascinating but specifically neglected. Genome Mapping in Plants. (ed P. AH), pp. 179–191. RG Landes, Georgetown. Khoshbakht, K. & Hammer, K. (2008) How many plant species are cultivated? Genetic Resources and Crop Evolution, 55, 925-928. Khush, G.S. (1963) Cytogenetic and Evolutionary Studies in Secale III. Cytogenetics of Weedy Ryes and Origin of Cultivated Rye. Economic Botany, 17, 60–71. Kim, S.C. & Rieseberg, L.H. (1999) Genetic architecture of species differences in annual sunflowers: implications for adaptive trait introgression. Genetics, 153, 965-77. Kislev, M. & Baryosef, O. (1988) The legumes - the earliest domesticated plants in the Near East. Current Anthropology, 29, 175-179. Kiviharju, E. & Puolimatka, M. (1997) Regeneration of anther-derived plants of Avena sterilis. Plant cell, tissue and organ culture, 48, 147-152. Klinger, T., Arriola, P.E. & Ellstrand, N.C. (1992) Crop-weed hybridization in radish (Raphanus sativus): effects of distance and population size. American Journal of Botany, 79, 1431– 1435. Koinange, E.M.K., Singh, S.P. & Gepts, P. (1996) Genetic control of the domestication syndrome in common bean. Crop Science, 36, 1037–1044. Kondrashov, A.S. (1984) Deleterious mutations as an evolutionary factor. I. The advantage of recombination. Genetics Research, 44, 199–217. Kowyama, Y., Tsuchiya, T. & Kakeda, K. (2000) Sporophytic self-incompatibility in Ipomoea trifida, a close relative of sweet potato. Annals of Botany, 85, 191-196. Kraker, J.W., Franssen, M.C.R., Groot, A., Konig, W.A. & Bouwmeester, H.J. (1998) (+)- Germacrene A biosynthesis: the committed step in the biosynthesis of bitter sesquiterpene lactones in chicory. Plant Physiology, 117, 1381-1392.   102 Lachenmeier, D.W., Walch, S.G. & Padosch, S.A. (2006) Absinthe – a review. Critical Reviews in Food Science, 46, 365–377. Ladizinsky, G. (1989) Biological species and wild genetic resources in Avena. European Cooperative Programme for the Conservation and Exchange of Crop Genetic Resources. Meeting. p. 19-32. Radzikow. Ladizinsky, G. (1985) Founder effect in crop-plant evolution. Economic Botany, 39, 191–199. Ladizinsky, G. (1998) Plant evolution under domestication. Kluwer Academic Publishers, London. Lahaye, R., Der Bank, M. Van, Bogarin, D., Warner, J., Pupulin, F., Gigot, G., Maurin, O., Duthoit, S., Barraclough, T.G. & Savolainen, V. (2008) DNA barcoding the floras of biodiversity hotspots. Proceedings of the National Academy of Sciences, 105, 2923-2928. Laitinen, R.A.E., Immanen, J., Auvinen, P., Rudd, S., Alatalo, E., Paulin, L., Ainasoja, M., Kotilainen, M., Koskela, S., Teeri, T.H. & others. (2005) Analysis of the floral transcriptome uncovers new regulators of organ determination and gene families related to flower organ differentiation in Gerbera hybrida (Asteraceae). Genome Research, 15, 475- 486. Lashermes, P., Combes, M.C., Prakash, N.S., Trouslot, P., Lorieux, M. & Charrier, A. (2001) Genetic linkage map of Coffea canephora: effect of segregation distortion and analysis of recombination rate in male and female meioses. Genome, 44, 589-595. Lashermes, P., Combes, M.C., Robert, J., Trouslot, P., D’Hont, A., Anthony, F. & Charrier, A. (1999) Molecular characterisation and origin of the Coffea arabica L. genome. Molecular & General Genetics: MGG, 261, 259-266. Lenormand, T. (2002) Gene flow and the limits to natural selection. Trends in Ecology & Evolution, 17, 183–189. Linder, C.R. & Rieseberg, L.H. (2004) Reconstructing patterns of reticulate evolution in plants. American Journal of Botany, 91, 1700-1708. Lohse, M., Drechsel, O. & Bock, R. (2007) OrganellarGenomeDRAW (OGDRAW): a tool for the easy generation of high-quality custom graphical maps of plastid and mitochondrial genomes. Current Genetics, 52, 267–274. Lorenzo, C., Marco, M., Paola, D.M., Alfonso, C., Marzia, O. & Simone, O. (2006) Long distance transport of ragweed pollen as a potential cause of allergy in central Italy. Annals of Allergy, Asthma & Immunology, 96, 86–91. Lowry, D.B., Modliszewski, J.L., Wright, K.M., Wu, C. A. & Willis, J.H. (2008) Review. The strength and genetic basis of reproductive isolating barriers in flowering plants. Philosophical Transactions of the Royal Society of London. Series B, Biological sciences, 363, 3009-2021.   103 Maiti, R. & Wesche-Ebeling, P. (2001) Advances in chickpea science. Science Publishers, Inc., Enfield. Malde, K., Schneeberger, K., Coward, E. & Jonassen, I. (2006) RBR: library-less repeat detection for ESTs. Bioinformatics, 22, 2232-2236. Mallet, J. (2007) Hybrid speciation accompanied by genomic reorganization in wild sunflowers. Nature, 446, 279-283. Manning, K., Pelling, R., Higham, T., Schwenniger, J.-L. & Fuller, D.Q. (2011) 4500-Year old domesticated pearl millet (Pennisetum glaucum) from the Tilemsi Valley, Mali: new insights into an alternative cereal domestication pathway. Journal of Archaeological Science, 38, 312-322. Mansfeld Database (2001) Mansfeld’s encyclopedia of agricultural and horticultural crops (eds Hanelt P. & Institute of Plant Genetics and Crop Plant Research). Available from: http://mansfeld.ipk-gatersleben.de (last accessed May 2007) Marchais, L. (1994) Wild pearl millet population (Pennisetum glaucum, Poaceae) integrity in agricultural Sahelian areas. An example from Keita (Niger). Plant Systematics and Evolution, 189, 233-245. Maurin, O., Davis, A.P., Chester, M., Mvungi, E.F., Jaufeerally-Fakim, Y. & Fay, M.F. (2007) Towards a phylogeny for Coffea (Rubiaceae): identifying well-supported lineages based on nuclear and plastid DNA sequences. Annals of Botany, 100, 1565-1583. McIntyre, C. & Jackson, P. (2001) Low level of selfing found in a sample of crosses in Australian sugarcane breeding programs. Euphytica, 117, 245–249. McLachlan, G.J., Peel, D., Basford, K.E. & Adams, P. (1999) The EMMIX software for the fitting of mixtures of normal and t-components. Journal of Statistical Software, 4, 1–14. Meyer, F.G. (1965) Notes on wild Coffea arabica from Southwestern Ethiopia, with some historical considerations. Economic Botany, 19, 136–151. Moore, P.H., Ming, R. & Delmer, D.P. (2008) Genomics of tropical crop plants. Springer Science + Business Media, New York. Morgan, M. & Schoen, D. (1997) The evolution of selffertilization in perennials. The American Naturalist, 150, 618-638. Morishima, H. & Barbier, P. (1990) Mating system and genetic structure of natural populations in wild rice Oryza rufipogon. Plant Species Biology, 5, 31–39. Morjan, C.L. & Rieseberg, L.H. (2004) How species evolve collectively: implications of gene flow and selection for the spread of advantageous alleles. Molecular Ecology, 13, 1341- 1356.   104 Morran, L.T., Parmenter, M.D. & Phillips, P.C. (2009) Mutation load and rapid adaptation favour outcrossing over self-fertilization. Nature, 462, 350–352. Muraya, M.M., Geiger, H.H., Sagnard, F., Toure, L., Traore, P.C.S., Togola, S., Villiers, S. & Parzies, H.K. (2011) Adaptive values of wild × cultivated sorghum (Sorghum bicolor (L.) Moench) hybrids in generations F1, F2, and F3. Genetic Resources and Crop Evolution, (published online 10 March 2011). Simmonds, N.W. & Smartt, J. (1999) Principles of crop improvement. Blackwell Science, Oxford. Nasrallah, J.B. & Nasrallah, M.E. (1989) The molecular genetics of self-incompatibility in Brassica. Annual Review of Genetics, 23, 121-139. Naumann, C., Hartmann, T. & Ober, D. (2002) Evolutionary recruitment of a flavin-dependent monooxygenase for the detoxification of host plant-acquired pyrrolizidine alkaloids in the alkaloid-defended arctiid moth. Proceedings of the National Academy of Sciences, 99, 6085–6090. Nevo, E., Korol, A.B., Beiles, A. & Fah. (2002) Evolution of wild emmer and wheat improvement: population genetics, genetic resources, and genome organization of wheat’s projenitor, Triticum dicoccoides. Springer, Berlin-Heidelberg-New York. Newbigin, E., Anderson, M.A. & Clarke, A.E. (1993) Gametophytic self-incompatibility systems. The Plant Cell, 5, 1315-1324. Ng, N.Q. & Ng, S.Y.C. (2002) Genetic resources and conservation. Cassava Biology, Production, and Utilization. (eds R.J. Hillocks, J.M. Thresh & A.C. Bellotti), pp. 167–177. CABI Publishing, Wallingford. Nugent, A. (2005) Health properties of resistant starch. Nutrition Bulletin, 30, 27-54. Oksanen, J., Blanchet, F.G., Kindt, R., Legendre, P., O’Hara, R.B., Simpson, G.L., Solymos, P., Stevens, M.H.H. & Wagner, H. (2010) vegan: Community Ecology Package. R package version 1.17-3. Olsen, K.M. & Schaal, B.A. (2001) Microsatellite variation in cassava (Manihot esculenta, Euphorbiaceae) and its wild relatives: further evidence for a southern Amazonian origin of domestication. Am. J. Botany, 88, 131-142. Otto, S.P. & Whitton, J. (2000) Polyploid incidence and evolution. Annual Review of Genetics, 34, 401–437. Ovcharenko, I., Loots, G.G., Hardison, R.C., Miller, W. & Stubbs, L. (2004) zPicture: dynamic alignment and visualization tool for analyzing conservation profiles. Genome Research, 14, 472-477.   105 Papa, R., Bellucci, E., Rossi, M., Leonardi, S., Rau, D., Gepts, P., Nanni, L. & Attene, G. (2007) Tagging the signatures of domestication in common bean (Phaseolus vulgaris) by means of pooled DNA samples. Annals of Botany, 100, 1039-1051. Papa, R., Acosta, J., Delgado-Salinas, A. & Gepts, P. (2005) A genome-wide analysis of differentiation between wild and domesticated Phaseolus vulgaris from Mesoamerica. TAG Theoretical and Applied Genetics, 111, 1147-1158. Papa, R. & Gepts, P. (2003) Asymmetry of gene flow and differential geographical structure of molecular diversity in wild and domesticated common bean (Phaseolus vulgaris L.) from Mesoamerica. Theoretical and applied genetics, 106, 239-250. Pasquet, R.S. (1996) Wild cowpea. Advances in Legume Systematics 8: Legumes of Economic Importance. (eds B. Pickersgill & J.M. Lock), pp. 95-100. Royal Botanic Gardens, Kew, London. Paulsen, E. (2002) Contact sensitization from Compositaecontaining herbal remedies and cosmetics. Contact Dermatitis, 47, 189-198. Peacock, S.L. (1998) Putting down roots: the emergence of wild plant food production on the Canadian Plateau. PhD thesis, University of Victoria, Victoria. Price, S. (1957) Cytological studies in Saccharum and allied genera. III. Chromosome numbers in interspecific hybrids. Botanical Gazette, 118, 146-159. Primack, R.B. (1979) Reproductive effort in annual and perennial species of Plantago (Plantaginaceae). American Naturalist, 114, 51–62. Pritchard, J.K., Stephens, M. & Donnelly, P. (2000) Inference of population structure using multilocus genotype data. Genetics, 155, 945-959. Priyadarshan, P.M., Goncalves, P.S. & Omokhafe, K.O. (2009) Breeding Hevea rubber. Breeding Plantation Tree Crops: Tropical Species. (eds S.M. Jain & P.M. Priyadarshan), p. 469-522, Springer Science + Business Media, New York. Purugganan, M.D. & Fuller, D.Q. (2009) The nature of selection during plant domestication. Nature, 457, 843-848. Qi, X., Marshall, D. & Ford-Lloyd, B. (1995) A study of the genetic parameters in a wild Brassica oleracea L. population. Acta Horticulturae (ISHS), 402, 158–167. Quackenbush, J., Liang, F., Holt, I., Pertea, G. & Upton, J. (2000) The TIGR gene indices: reconstruction and representation of expressed gene sequences. Nucleic Acids Research, 28, 141-145. Ramsey, J., Bradshaw, H.D. & Schemske, D.W. (2003) Components of reproductive isolation between the monkeyflowers Mimulus lewisii and M. cardinalis (Phrymaceae). Evolution, 57, 1520-1534.   106 Reger, B.J. (1989) Stigma suface secretions of Pennisetum americanum. American Journal of Botany, 76, 1–5. Rhee, S.Y., Beavis, W., Berardini, T.Z., Chen, G., Dixon, D., Doyle, A., Garcia-Hernandez, M., Huala, E., Lander, G., Montoya, M. & others. (2003) The Arabidopsis Information Resource (TAIR): a model organism database providing a centralized, curated gateway to Arabidopsis biology, research materials and community. Nucleic Acids Research, 31, 224- 228. Rick, C. (1988) Evolution of mating systems in cultivated plants. Plant Evolutionary Biology. (eds L. Gottlieb & S. Jain), pp. 133-147. Chapman and Hall, London. Rieseberg, L.H. & Blackman, B.K. (2010) Speciation genes in plants. Annals of Botany, 106, 439-455. Rieseberg, L.H. & Willis, J.H. (2007) Plant speciation. Science, 317, 910-914. Rieseberg, L.H., Wood, T.E. & Baack, E.J. (2006) The nature of plant species. Nature, 440, 15- 18. Roberfroid, M.B. (2002) Functional foods: concepts and application to inulin and oligofructose. British Journal of Nutrition, 87, 139–144. Roberfroid, M.B. (2005) Introducing inulin-type fructans. British Journal of Nutrition, 93, 13– 26. Ross-Ibarra, J., Morrell, P.L. & Gaut, B.S. (2007) Plant domestication, a unique opportunity to identify the genetic basis of adaptation. Proceedings of the National Academy of Sciences, 104 Suppl, 8641-8648. Rossell, J.B. (1994) Measurement of rancidity. Rancidity in foods. (eds J.C. Allen & R.J. Hamilton), pp. 22-53. Aspen Publishers, New York. Rozen, S. & Skaletsky, H. (1999) Primer3 on the WWW for general users and for biologist programmers. Bioinformatics Methods and Protocols, 132, 365–386. Sastri, D. & Shivanna, K. (1976) Attempts to overcome interspecific incompatibility in Sesamum by using recognition pollen. Annals of Botany, 40, 891-893. Sauer, J.D. (1993) Historical geography of crop plants. CRC Press, Boca Raton. Schemske, D.W. (2000) Understanding the origin of species. Evolution, 54, 1069–1073. Schoen, D.J. & Brown, A. (1991) Intraspecific variation in population gene diversity and effective population size correlates with the mating system in plants. Proceedings of the National Academy of Sciences, 88, 4494.   107 Schultz, S.T. & Lynch, M. (1997) Mutation and extinction: the role of variable mutational effects, synergistic epistasis, beneficial mutations, and degree of outcrossing. Evolution, 51, 1363–1371. Seto, M., Miyase, T., Umehara, K., Ueno, A., Hirano, Y. & Otani, N. (1988) Sesquiterpene lactones from Cichorium endivia L. and C. intybus L. and cytotoxic activity. Chemical and Pharmaceutical Bulletin, 36, 2423–2429. Shaw, J., Lickey, E.B., Beck, J.T., Farmer, S.B., Liu, W., Miller, J., Siripun, K.C., Winder, C.T., Schilling, E.E. & Small, R.L. (2005) The tortoise and the hare II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. American Journal of Botany, 92, 142-166. Simmonds, N.W. (1976) Evolution of crop plants. Longman, London & New York. Slatkin, M. (1985) Gene Flow in Natural Populations. Annual Review of Ecology and Systematics, 16, 393–430. Slatkin, M. & Excoffier, L. (1996) Testing for linkage disequilibrium in genotypic data using the Expectation-Maximization algorithm. Heredity, 76, 377–383. Smartt, J.N.W. (1997) The domestication syndrome and the development of new crop plants. Domestication, production and utilization of new crops. (eds J.N.W. Smartt & N. Haq), pp. 134–146. International Centre for Underutilised Crops (ICUC), Southampton. Smartt, J. & Simmonds, N.W. (1995) Evolution of crop plants. Longman Scientific & Technical, Singapore. Smartt, J. (1976) Comparative evolution of pulse crops. Euphytica, 25, 139-143. Smith, B.D. (1992) The economic potential of Iva annua in Eastern North America. Rivers of change: essays on early agriculture in Eastern North America. pp. 185–200. Smithsonian Institution Press, Washington. Snow, A., Moran-Palma, P., Rieseberg, L., Wszelaki, A. & Seiler, G. (1998) Fecundity, phenology, and seed dormancy of F1 wild-crop hybrids in Sunflower (Helianthus annuus, Asteraceae). American Journal of Botany, 85, 794-801. Snow, A.A., Pilson, D., Rieseberg, L.H., Paulsen, M.J., Pleskac, N., Reagon, M.R., Wolf, D.E. & Selbo, S.M. (2003) A Bt transgene reduces herbivory and enhances fecundity in wild sunflowers. Ecological Applications, 13, 279-286. Song, Z.P., Lu, B.-R., Wang, B. & Chen, J.K. (2004) Fitness estimation through performance comparison of F1 hybrids with their parental species Oryza rufipogon and O. sativa. Annals of Botany, 93, 311-6. Sreenivasan, T.V. & Jalaja, N.C. (1981) Desynapsis in Saccharum robustum. Genetica, 55, 133- 135.   108 Stebbins, G.L. (1957) Self fertilization and population variability in higher plants. The American Naturalist, 91, 337–354. Stebbins, G.L. (1950) Variation and evolution in plants. Columbia University Press, New York. Stevens, P.F. (2007) Angiosperm phylogeny website, Version 7, May 2006. Missouri Botanical Garden, St Louis, Missouri. Available from: http://www.mobot.org/MOBOT/ research/APweb/welcome.html (last accessed March 2007) Survey of Economic Plants for Arid and Semi-Arid Lands (SEPASAL) database (1999) Royal Botanic Gardens Kew, London, United Kingdom. Available from: http://www.kew.org/ceb/sepasal/ (last accessed March 2007) Sweeney, M. & McCouch, S. (2007) The complex history of the domestication of rice. Annals of Botany, 100, 951-957. Takebayashi, N. & Morrell, P.L. (2001) Is self-fertilization an evolutionary dead end? Revisiting an old hypothesis with genetic theories and a macroevolutionary approach. American Journal of Botany, 88, 1143-1150. Tang, S., Leon, A., Bridges, W.C. & Knapp, S.J. (2006) Quantitative Trait Loci for genetically correlated seed traits are tightly linked to branching and pericarp pigment loci in sunflower. Crop Science, 46, 721-734. Tanksley, S.D. & McCouch, S.R. (1997) Seed banks and molecular maps: unlocking genetic potential from the wild. Science, 277, 1063-1066. Taylor, S. & Berridge, V. (2006) Medicinal plants and malaria: an historical case study of research at the London School of Hygiene and Tropical Medicine in the twentieth century. Transactions of the Royal Society of Tropical Medicine and Hygiene, 100, 707–714. R Development Core Team (2009) R: A Language and Environment for Statistical Computing. Vienna, Austria. R Development Core Team (2011) R: A Language and Environment for Statistical Computing. Vienna, Austria. Temnykh, S., DeClerck, G., Lukashova, A., Lipovich, L., Cartinhour, S. & McCouch, S. (2001) Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): frequency, length variation, transposon associations, and genetic marker potential. Genome Research, 11, 1441-1452. The Plant List (2010) Version 1. Published on the Internet; http://www.theplantlist.org/ (last accessed: 15th August 2011). This, P., Lacombe, T. & Thomas, M.R. (2006) Historical origins and genetic diversity of wine grapes. TRENDS in Genetics, 22, 511–519.   109 Thormann, I., Metz, T. & Engels, J. (2004) The species compendium, Release 1.0, December 2004. Bioversity International, Rome, Italy. Available from: http://www.bioversityinternational.org/Information_Sources/Species_Databases/Spec ies_Compendium (last accessed March 2007) Timme, R.E.E., Kuehl, J.V.V., Boore, J.L.L. & Jansen, R.K.K. (2007) A comparative analysis of the Lactuca and Helianthus (Asteraceae) plastid genomes: identification of divergent regions and categorization of shared repeats. American Journal of Botany, 94, 302-312. Tsegaye, S. (1996) Estimation of outcrossing rate in landraces of tetraploid wheat (Triticum turgidum L.). Plant Breeding, 115, 195-197. USDA National Genetic Resources Program. (2007) Germplasm resources information network - (GRIN). National Germplasm Resources Laboratory, Beltsville, Maryland. Available from: http://www.ars-grin.gov/ (last accessed: March 2007) Vecchi-Staraz, M. Di, Laucou, V., Bruno, G., Lacombe, T., Gerber, S., Bourse, T., Boselli, M. & This, P. (2009) Low level of pollen-mediated gene flow from cultivated to wild grapevine: consequences for the evolution of the endangered subspecies Vitis vinifera L. subsp. silvestris. The Journal of Heredity, 100, 66-75. Venable, D.L. & Levin, D.A. (1983) Morphological dispersal structures in relation to growth habit in the Compositae. Plant Systematics and Evolution, 143, 1–16. Villar, R. & Veneklaas, E. (1998) Relative growth rate and biomass allocation in 20 Aegilops (Poaceae) species. New Phytologist, 140, 425-437. Vogler, D.W. & Kalisz, S. (2001) Sex among the flowers: the distribution of plant mating systems. Evolution, 55, 202-204. Vries, I.M.D. (1997) Origin and domestication of Lactuca sativa L. Genetic Resources and Crop Evolution, 44, 165-174. Well, E.V. & Fossey, A. (1998) A comparative investigation of seed germination, metabolism and seedling growth between two polyploid Triticum species. Euphytica, 101, 83-89. Williams, G.C. (1975) Sex and evolution. Princeton University Press, Princeton, NJ. Wilson A. M. & Thompson, K. (1989) A comparative study of reproductive allocation in 40 British grasses. Functional Ecology, 3, 297-302. Wood, T.E., Takebayashi, N., Barker, M.S., Mayrose, I., Greenspoon, P.B. & Rieseberg, L.H. (2009) The frequency of polyploid speciation in vascular plants. Proceedings of the National Academy of Sciences, 106, 13875-13879. Wopfner, N., Gadermaier, G., Egger, M., Asero, R., Ebner, C., Jahn-Schmid, B. & Ferreira, F. (2005) The spectrum of allergens in ragweed and mugwort pollen. International Archives of Allergy and Immunology, 138, 337–346.   110 Wyman, S.K., Jansen, R.K. & Boore, J.L. (2004) Automatic annotation of organellar genomes with DOGMA. Bioinformatics, 20, 3252-3255. Yamazaki, H. & Matsumoto, K. (1993) Inulin and inulin-bearing crops. Production of fructo- oligosaccharide-rich fructose syrup. (ed A. Fuchs), pp. 355-358. Elsevier, Amsterdam. Zeder, M.A., Emshwiller, E., Smith, B.D. & Bradley, D.G. (2006) Documenting domestication: the intersection of genetics and archaeology. Trends in Genetics, 22, 139–155. Zerbino, D.R. & Birney, E. (2008) Velvet: algorithms for de novo short read assembly using de Bruijn graphs. Genome Research, 18, 821-829. Zohary, D. (1999) Monophyletic vs. polyphyletic origin of the crops on which agriculture was founded in the Near East. Genetic Resources and Crop Evolution, 46, 133-142. Zohary, D. (1996) The mode of domestication of the founder crops of Southwest Asian agriculture. The origins and spread of agriculture and pastoralism in Eurasia. (ed D.R. Harris), pp. 142-158. UCL Press, London. Zohary, D. (1994) The wild genetic resoures of the cultivated olive. Acta Horticulturae (ISHS), 356, 62-65. Zohary, D. (2004) Unconscious selection and the evolution of domesticated plants. Economic Botany, 58, 5-10. Zohary, D. & Hopf, M. (1973) Domestication of Pulses in the Old World: Legumes were companions of wheat and barley when agriculture began in the Near East. Science, 182, 887-894. Zohary, D. & Hopf, M. (2000) Domestication of plants in the Old World: the origin and spread of cultivated plants in West Asia, Europe, and the Nile Valley. Oxford University Press, New York.   111  Appendices A.1 List of uses of some species in the Compositae and a few major crops of other families. English name Scientific name Familiy Use type Detailed use Yarrow Achillea millefolium L. Asteraceae food additives flavoring environmental erosion control; ornamental medicines folklore vertebrate poison mammals Para-cress Acmella oleracea             (L.) R. K. Jansen Asteraceae food vegetable medicines folklore pesticide potential for disease vector control Arnica Arnica montana L. Asteraceae environmental ornamental medicines folklore poison mammals Absinthium Artemisia absinthium L. Asteraceae additive flavoring materials essential oils medicines folklore poison mammals Sweet wormwood Artemisia annua L. Asteraceae environmental ornamental medicines folklore Yin-chen wormwood Artemisia scoparia Waldst. & Kit. Asteraceae food vegetable medicines folklore environmental ornamental Balsamroot Balsamorhiza sagittata   (Pursh) Nutt. Asteraceae food starch Pot marigold Calendula officinalis L. Asteraceae food vegetable medicines folklore environmental ornamental materials dyestuff additive coloring; flavoring Safflower  Carthamnus tinctorius L.  Asteraceae food oil/fat medicines folklore environmental ornamental materials Lipids; dyestuff additive coloring animal food fodder honey honey Endive Cichorium endivia L.  Asteraceae food vegetable       112       English name Scientific name Familiy Use type Detailed use Chicory  Cichorium intybus L.  Asteraceae food beverage base; vegetable; potential as starch medicines folklore poison mammals Globe Artichoke Cynara cardunculus L. var. scolymus (L.); Cynara cardunculus L.var. altilis DC Asteraceae food vegetable medicines folklore; source of cynarin environmental ornamental Sow thistle Emilia sonchifolia (L.) DC. Asteraceae food vegetable environmental ornamental Gerbera Gerbera hybrida (Gerbera jamesonii Bolus ex Hook. f. x Gerbera viridifolia Sch. Bip.) Asteraceae environmental ornamental Chop-Suey Greens Glebionis coronaria (L.) Cass. ex Spach Asteraceae food vegetable environmental ornamental Corn chrysanthemum Glebionis segetum (L.) Fourr. Asteraceae food vegetable environmental ornamental Nigerseed Guizotia abyssinica L.  Asteraceae food oil/fat materials lipids animal food bird feed; fodder Sunflower  Helianthus annuus L.  Asteraceae food oil/fat; pseudosereal medicines folklore environmental ornamental materials fiber animal food fodder honey honey poison mammals Jerusalem Artichoke  Helianthus tuberosus L. Asteraceae food starch; vegetable medicines folklore animal food fodder poison mammals Sumpweed Iva annua L. Asteraceae food potential as oil/fat Lettuce  Lactuca sativa L.  Asteraceae food vegetable German chamomile Matricaria recutita L. Asteraceae food beverage base medicines folklore materials essential oils additive flavoring social stimulant Yam Daisy Microseris scapigera (Sol. ex A. Cunn.) Sch. Bip. Asteraceae food starch; vegetable   113       English name Scientific name Familiy Use type Detailed use Guayule Parthenium argentatum L.  Asteraceae materials latex/rubber poison mammals Indian fleabane Pluchea indica (L.) Less. Asteraceae medicines anti-venom French Scorzonera Reichardia picroides Roth  Asteraceae food vegetable Spanish Salsify  Scolymus hispanicus L. Asteraceae food vegetable additive adulterant Scorzonera  Scorzonera hispanica L. Asteraceae food vegetable environmental ornamental Yacon Smallanthus sonchifolius (Poepp. & Endl.) H. Rob. Asteraceae food vegetable Canada goldenrod Solidago canadensis L. Asteraceae environmental ornamental medicines folklore Stevia Stevia rebaudiana (Bertoni) Bertoni Asteraceae additive sweetener medicines folklore; source of stevioside Huacatay Tagetes minuta L. Asteraceae food vegetable medicines folklore environmental ornamental materials essential oils additive flavoring pesticide plant pest control Dalmatian chrysanthemum Tanacetum cinerariifolium (Trevir.) Sch. Bip. Asteraceae medicines folklore non-vertebrate poison plant pest control Feverfew Tanacetum parthenium (L.) Sch. Bip. Asteraceae environmental ornamental medicines folklore Rubber Dandelion Taraxacum kok-saghyz L. E. Rodin Asteraceae food vegetable materials latex/rubber Dandelion Taraxacum officinale L. Asteraceae food beverage base; vegetable medicines folklore additive flavoring honey honey Salsify Tragopogon porrifolius L. Asteraceae food vegetable environmental ornamental Vernonia Vernonia spp. Asteraceae environmental boundary/barrier/support food vegetable medicines folklore materials potential as lipids poison mammals   114         English name Scientific name Familiy Use type Detailed use Zinnia Zinnia spp. Asteraceae environmental ornamental Beans Phaseolus spp. Fabaceae food pulse; vegetable poison mammals environmental ornamental medicines folklore animal food forage Vanilla Vanilla spp. Orchidaceae additive flavoring materials essential oils medicines folklore Rye Secale cereale L. subsp. cereale Poaceae environmental erosion control, soil improver food beverage base; cereal animal food fodder, forage medicines folklore poison mammals Bread Wheat Triticum aestivum L. subsp. aestivum Poaceae food beverage base; cereal; starch animal food fodder materials alcohol; potential as fiber medicines folklore poison mammals Maize Zea mays L. subsp. mays Poaceae additive sweetener environmental ornamental food beverage base; oil/fat; starch; vegetable animal food fodder fuels petroleum substitute/alcohol materials fiber; lipids medicines folklore vertebrate poison mammals Peppers Capsicum spp. Solanaceae Additive coloring; flavoring Environmental ornamental Food vegetable Medicines folklore; source of capsaicin Poison mammals  A.2 GOSlim category comparison between noug and a sample of Compositae Keyword Category Functional Category Noug Gene count Compositae comparison Gene count Residuals GO Cellular Component other intracellular components  1139 1990 4.5106756 -3.0836741 GO Cellular Component other cytoplasmic components  969 1204 10.5248705 -7.1952128 GO Cellular Component chloroplast  821 1136 7.9181056 -5.4131264 GO Cellular Component other membranes  683 1667 -2.3936616 1.6364006 GO Cellular Component plastid  424 408 9.7675929 -6.6775082 GO Cellular Component plasma membrane  561 234 19.3424092 -13.2232269 GO Cellular Component nucleus  443 1060 -1.6322645 1.1158798 GO Cellular Component unknown cellular components  504 2032 -10.6869388 7.306009 GO Cellular Component cytosol  265 219 8.9274926 -6.1031828 GO Cellular Component ribosome  174 270 2.7400043 -1.873174 GO Cellular Component mitochondria  251 529 0.1628006 -0.1112968 GO Cellular Component other cellular components  185 75 11.2294351 -7.6768807 GO Cellular Component cell wall  139 98 7.3103657 -4.9976517 GO Cellular Component extracellular  101 41 8.293083 -5.6694757 GO Cellular Component ER  81 167 0.226241 -0.1546672 GO Cellular Component Golgi apparatus  81 168 0.1900212 -0.1299059 GO Molecular Function other enzyme activity  665 1387 0.4469987 -0.3055858 GO Molecular Function transferase activity  457 1229 -3.4522383 2.360085 GO Molecular Function other binding  487 874 2.5703057 -1.7571614 GO Molecular Function hydrolase activity  400 1433 -7.6076925 5.2009159 GO Molecular Function kinase activity  229 693 -3.7733182 2.5795878 GO Molecular Function nucleotide binding  421 647 4.3829248 -2.9963387 GO Molecular Function protein binding  408 778 1.5565653 -1.0641289 GO Molecular Function unknown molecular functions  429 1020 -1.513479 1.0346734 GO Molecular Function transporter activity  231 697 -3.7559253 2.5676973 GO Molecular Function DNA or RNA binding  259 749 -3.4631815 2.3675663 GO Molecular Function structural molecule activity  181 310 1.9682636 -1.3455819 GO Molecular Function other molecular functions  158 324 0.3616173 -0.2472157   115   116 Keyword Category Functional Category Noug Gene count Compositae comparison Gene count Residuals GO Molecular Function nucleic acid binding  141 240 1.7837424 -1.2194361 GO Molecular Function transcription factor activity  126 600 -6.92042 4.7310696 GO Molecular Function receptor binding or activity  8 43 -2.0454179 1.3983276 GO Biological Process other cellular processes  1760 3945 -1.3388554 0.9152939 GO Biological Process other metabolic processes  1597 4158 -5.5122039 3.768358 GO Biological Process protein metabolism  651 1680 -3.3557137 2.294097 GO Biological Process response to abiotic or biotic stimulus  372 581 3.9297211 -2.686511 GO Biological Process unknown biological processes  538 1848 -8.0513351 5.5042074 GO Biological Process transport  368 899 -1.7694718 1.2096801 GO Biological Process response to stress  341 514 4.1617627 -2.8451436 GO Biological Process developmental processes  304 623 0.5089797 -0.3479584 GO Biological Process other biological processes  347 478 5.196353 -3.55243 GO Biological Process cell organization and biogenesis  284 874 -4.4170402 3.0196613 GO Biological Process signal transduction  146 378 -1.6175333 1.1058089 GO Biological Process transcription  149 652 -6.644057 4.542137 GO Biological Process electron transport or energy pathways  130 309 -0.8307803 0.5679539 GO Biological Process DNA or RNA metabolism  43 218 -4.40138 3.0089554 A.3 Unigene origins of microsatellites Locus GenBank Accession number of transcriptome reads Name(s) of contig(s) contained in unigene Name of unigene GA003 GE560978.1 / GE569356.1 / GE568688.1 / GE570048.1 CCHT19019.b1_E04.ab1- / CCHT394.b1_C03.ab1- / CCHT3254.b1_L21.ab1- / CCHT4601.b1_B24.ab1-  CL588Contig1 GA012 GE569814.1 / GE553659.1 / GE571208.1 / GE571209.1 CCHT438.b1_K13.ab1+ / CCHT1220.g1_G17.ab1- / CCHT5372.b1_H24.ab1+ / CCHT5372.g1_H24.ab1- CL898Contig1 GA013 GE569910 CCHT447.b1_M15.ab1 CCHT447.b1_M15.ab1 GA018 GE565398.1 / GE552027.1 / GE570782.1 / GE572500.1 CCHT23230.b1_L23.ab1+ / CCHT10710.b1_L14.ab1+ / CCHT516.b1_H09.ab1+ / CCHT6243.b1_F01.ab1+ CL932Contig1 GA029 GE560964.1 / GE572399.1 / GE565337.1 CCHT19006.b1_L23.ab1+ / CCHT615.b1_M10.ab1+ / CCHT23174.b1_L09.ab1+ CL688Contig1 GA035 GE573045.1 CCHT677.b1_J02.ab1  CCHT677.b1_J02.ab1 GA037 GE573108.1 CCHT683.b1_F04.ab1 CCHT683.b1_F04.ab1 GA054 GE569398.1 CCHT398.b1_K03.ab1 CCHT398.b1_K03.ab1 GA055 GE560933.1 / GE562911.1 / GE569479.1 / GE572764.1 / GE566083.1 CCHT18975.b1_N15.ab1+ / CCHT20896.b1_P15.ab1+ / CCHT406.b1_K05.ab1+ / CCHT6489.b1_B16.ab1+ / CCHT23874.b1_C17.ab1+ CL519Contig1 GA077 GE572815.1 CCHT654.b1_K20.ab1 CCHT654.b1_K20.ab1 GA081 GE574218.1 CCHT755.b1_F22.ab1 CCHT755.b1_F22.ab1 GA082 GE574313.1 CCHT764.b1_H24.ab1 CCHT764.b1_H24.ab1 GA107 GE569299.1 CCHT3884.b1_G11.ab1  CCHT3884.b1_G11.ab1 GA108 GE574403.1 CCHT7728.b1_O11.ab1  CCHT7728.b1_O11.ab1 GA117 GE552626.1 / GE571511.1 CCHT1128.b1_P18.ab1+ / CCHT5654.b1_K22.ab1+ CL2845Contig1 GA127 GE568803.1 CCHT3375.b1_N04.ab1  CCHT3375.b1_N04.ab1 GA138 GE573591.1 / GE573592.1 CCHT7111.b1_M02.ab1+ / CCHT7111.g1_M02.ab1- CL3072Contig1 GA139 GE553664.1 / GE560991.1 CCHT12204.b1_H04.ab1- / CCHT19030.b1_K06.ab1- CL3306Contig1 GA143 GE562451.1 / GE572841.1 CCHT20468.b1_H05.ab1- / CCHT6565.b1_I09.ab1- CL3600Contig1 GA144 GE561080.1 / GE575505.1 CCHT19118.b1_L04.ab1+ / CCHT8599.b1_N13.ab1+ CL2571Contig1 GA150 GE563794.1 CCHT21728.b1_O08.ab1 CCHT21728.b1_O08.ab1 GA156 GE567172.1 / GE573600.1 / GE573599.1 CCHT24899.b1_F10.ab1+ / CCHT7115.g1_E04.ab1- / CCHT7115.b1_E04.ab1+ CL1188Contig1   117   118 Locus GenBank Accession number of transcriptome reads Name(s) of contig(s) contained in unigene Name of unigene GA162 GE565387.1 / GE572894.1 CCHT23220.b1_H21.ab1- / CCHT6619.b1_E23.ab1- CL4273Contig1 GA165 GE553794.1 CCHT12319.b1_M07.ab1 CCHT12319.b1_M07.ab1 GA172 GE557184.1 / GE552923.1 CCHT1533.b1_J24.ab1+ / CCHT11560.b1_O09.ab1+ CL2047Contig1 GA182 GE556264.1 CCHT14502.b1_L02.ab1 CCHT14502.b1_L02.ab1 GA183 GE558315.1 CCHT16424.b1_P02.ab1 CCHT16424.b1_P02.ab1 GA186 GE557012.1 CCHT15180.b1_G04.ab1 CCHT15180.b1_G04.ab1 GA188 GE562461.1 CCHT20477.b1_J07.ab1 CCHT20477.b1_J07.ab1 GA190 GE565419.1 CCHT2325.b1_I05.ab1 CCHT2325.b1_I05.ab1 GA191 GE565859.1 CCHT23660.b1_G12.ab1 CCHT23660.b1_G12.ab1 GA192 GE561824.1 / GE567694.1 CCHT19842.b1_C18.ab1+ / CCHT2596.b1_H02.ab1+ CL2634Contig1 GA204 GE576427.1 CCHT9485.b1_I20.ab1 CCHT9485.b1_I20.ab1 GA205 GE569873.1 / GE575844.1 / GE571430.1 CCHT4436.b1_G06.ab1+ / CCHT8927.b1_M23.ab1+ / CCHT558.b1_L19.ab1+ CL1107Contig1 GA210 GE568613.1 / GE556472.1 CCHT3174.b1_L01.ab1+ / CCHT14693.b1_J01.ab1+ CL4020Contig1 GA214 GE552159.1 CCHT10833.b1_A21.ab1 CCHT10833.b1_A21.ab1 GA217 GE552685.1 CCHT11337.b1_A04.ab1 CCHT11337.b1_A04.ab1 GA220 GE554350.1 CCHT12812.b1_H11.ab1 CCHT12812.b1_H11.ab1 GA228 GE558821.1 CCHT16903.b1_M01.ab1 CCHT16903.b1_M01.ab1 GA229 GE556655.1 CCHT14864.b1_O20.ab1 CCHT14864.b1_O20.ab1 GA238 GE570413.1 CCHT4945.b1_B14.ab1 CCHT4945.b1_B14.ab1 GA242 GE567081.1 / GE557733.1 / GE565743.1 / GE571579.1 / GE573338.1 / GE567223.1 / GE573339.1 CCHT24814.b1_K12.ab1+ / CCHT15851.b1_F03.ab1+ / CCHT23551.b1_N07.ab1+ / CCHT5718.b1_L14.ab1+ / CCHT6985.b1_A19.ab1+ / CCHT24948.b1_H22.ab1+ / CCHT6985.g1_A19.ab1- CL153Contig1 GA246 GE566769.1 / GE571561.1 / GE561790.1 / GE571226.1 CCHT24518.b1_L10.ab1+ / CCHT5701.b1_J10.ab1+ / CCHT19809.b1_A10.ab1+ / CCHT5386.b1_C03.ab1+ CL737Contig1   119 A.4 Non-coding sequences and short protein-coding sequences Gene Hitnou Ath annotation % Identity number of gaps Length (noug) Length (HA383) atpH: nou13 ATCG00140.1 99.19 0 246 246 infA nou55 x 99.57 0 234 234 petG: nou40 ATCG00600.1 99.12 0 114 114 petL: nou39 ATCG00590.1 98.96 0 96 96 petN: nou6 ATCG00210.1 100.00 0 90 90 psaC: nou75 ATCG01060.1 99.19 0 246 246 psaI: nou31 ATCG00510.1 100.00 0 111 111 psaJ: nou41 ATCG00630.1 100.00 0 129 129 psbE nou38 ATCG00580.1 99.60 0 252 252 psbF nou37 ATCG00570.1 100.00 0 120 120 psbH: nou49 ATCG00710.1 97.75 0 222 222 psbI: nou5 ATCG00080.1 100.00 0 111 111 psbJ nou35 ATCG00550.1 100.00 0 123 123 psbK: nou4 ATCG00070.1 100.00 0 180 180 psbL nou36 ATCG00560.1 99.15 0 117 117 psbM nou7 ATCG00220.1 98.10 0 105 105 psbN nou48 ATCG00700.1 98.48 0 132 132 psbT: nou47 ATCG00690.1 98.04 0 102 102 psbZ: nou18 ATCG00300.1 98.48 0 189 189 rpl23 nou63 ATCG01300.1 100.00 0 282 282 rpl32 nou78 ATCG01020.1 97.41 0 165 165 rpl33: nou42 ATCG00640.1 99.50 0 201 201 rpl36 nou54 ATCG00760.1 100.00 0 114 114 rps15: nou69 ATCG01120.1 97.13 0 279 279 rps16 nou3 ATCG00050.1 1.57 0 255 255 rps19 nou61 ATCG00820.1 99.44 0 279 279 Intron from rps16: 5339-6208 NA NA 92.87 8 869 880 Intron of rpoC1: 16510-17253 NA NA 95.70 4 743 731 Intron of atpF: 26994- 27701 NA NA 97.76 3 707 712 Intron of ycf3: 42122- 42867 NA NA 98.39 0 745 745 Intron of ycf3: 43097- 43815 NA NA 95.82 2 718 698 Intron of clpP: 69595- 70212 NA NA 92.83 3 617 620 Intron of clpP: 70503- 71313 NA NA 85.82 10 810 423 Intron of petB: 74318- 75089 NA NA 95.13 4 771 750 Intron of petD: 75731- 75929 NA NA 98.90 0 198 198     120 Gene Hitnou Ath annotation % Identity number of gaps Length (noug) Length (HA383) Intron of petD: 75937- 76648 NA NA 98.17 2 711 710 Intron of rpl2: 84113- 84778 NA NA 99.70 0 665 665 Intron of ndhB: 94455- 95125 NA NA 99.10 0 670 670 Intron of ndhA: 115501-116563 NA NA 92.63 10 1062 1045 Intron of rpl2: 150504- 151169 NA NA 99.70 0 665 665 rrn16: 99650-101139 NA NA 99.93 0 1489 1489 rrn23: 103389-106197 NA NA 99.79 1 2808 2809 rrn4.5: 106297-106399 NA NA 100.00 0 102 102 rrn5: 106645-106765 NA NA 100.00 0 120 120 trnH-GUG (reverse strand): showing revcomp of: <1-74 NA NA 100.00 0 73 73 trnK-UUU (reverse strand): showing revcomp of: <4285- 4321 NA NA 100.00 0 36 36 trnQ-UUG (reverse strand): showing revcomp of: <7212- 7283 NA NA 100.00 0 71 71 trnS-GCU (reverse strand): showing revcomp of: <8482- 8569 NA NA 100.00 0 87 87 trnC-GCA: 9319-9399 NA NA 100.00 0 80 80 trnD-GUC (reverse strand): showing revcomp of: <11449- 11522 NA NA 100.00 0 73 73 trnY-GUA (reverse strand): showing revcomp of: <11636- 11719 NA NA 100.00 0 83 83 trnR-UCU (reverse strand): showing revcomp of: <29837- 29908 NA NA 100.00 0 71 71 trnT-GGU: 31050- 31117 NA NA 98.53 0 67 67 trnS-UGA (reverse strand): showing revcomp of: <34954- 35036 NA NA 100.00 0 82 82 trnG-UCC: 35877- 35947 NA NA 100.00 0 70 70   121   Gene Hitnou Ath annotation % Identity number of gaps Length (noug) Length (HA383) trnfM-CAU (reverse strand): showing revcomp of: <36131- 36204 NA NA 100.00 0 73 73 trnS-GCU: 44839- 44924 NA NA 100.00 0 85 85 trnT-UGU (reverse strand): showing revcomp of: <46188- 46260 NA NA 100.00 0 72 72 trnL-UAA: 46850- 46886 NA NA 100.00 0 36 36 trnL-UAA: 47321- 47370 NA NA 100.00 0 49 49 trnF-GAA: 47716- 47772 NA NA 96.49 0 56 56 trnF-GAA: 47792- 47864 NA NA 98.63 0 72 72 trnV-UAC (reverse strand): showing revcomp of: <50852- 50888 NA NA 100.00 0 36 36 trnV-UAC (reverse strand): showing revcomp of: <51464- 51501 NA NA 100.00 0 37 37 trnM-CAU: 51677- 51749 NA NA 100.00 0 72 72 trnW-CCA (reverse strand): showing revcomp of: <65846- 65918 NA NA 100.00 0 72 72 trnP-UGG (reverse strand): showing revcomp of: <66082- 66155 NA NA 100.00 0 73 73 trnP-GGG (reverse strand): showing revcomp of: <66084- 66154 NA NA 100.00 0 70 70 trnI-CAU (reverse strand): showing revcomp of: <85634- 85707 NA NA 100.00 0 73 73 trnL-CAA (reverse strand): showing revcomp of: <93052- 93132 NA NA 100.00 0 80 80 trnV-GAC: 99352- 99423 NA NA 100.00 0 71 71   122   Gene Hitnou Ath annotation % Identity number of gaps Length (noug) Length (HA383) trnI-GAU: 101434- 101475 NA NA 100.00 0 41 41 trnI-GAU: 102247- 102281 NA NA 100.00 0 34 34 trnA-UGC: 102346- 102383 NA NA 100.00 0 37 37 trnA-UGC: 103204- 103238 NA NA 100.00 0 34 34 trnR-ACG: 107025- 107098 NA NA 100.00 0 73 73 trnN-GUU (reverse strand): showing revcomp of: <107565- 107636 NA NA 100.00 0 71 71 trnL-UAG (reverse strand): showing revcomp of: <122541- 122620 NA NA 100.00 0 79 79 trnH-psbA NA NA 84.20 7 390 387  A.5 Literature survey results # Common name Family Crop species Proposed progenitor 1 Banana Musaceae Musa acuminata Colla (AAA Group) cv. 'Dwarf Cavendish' Several Musa acuminata subspecies 2 Barley Poaceae Hordeum vulgare L Hordeum vulgare ssp. Spontaneum (K.Koch) Asch. & Graebn. (synonym of Hordeum spontaneum K.Koch) 3 Cassava Euphrobiacea Manihot esculenta Crantz Manihot esculenta ssp flabellifolia (Pohl) Cif. (synonym of Manihot esculenta Crantz.) 4 Chickpea Leguminosae Cicer arietinum L. Cicer reticulatum Ladiz. 5 Cocoa Malvaceae Theobroma cacao L. Theobroma cacao L. 6 Coconut Arecaceae Cocos nucifera L. Cocos nucifera L. 7 Coffee (Arabica) Rubiaceae Coffea arabica L. Coffea arabica L. 8 Coffee (Robusta) Rubiaceae Coffea canephora Pierre ex A. Froehner Coffea canephora Pierre ex A. Froehner 9 Common bean Leguminosae Phaseolus vulgaris L. Phaseolus vulgaris L. 10 Common wheat Poaceae Triticum aestivum L. Triticum turgidum L. 11 Common wheat Poaceae Triticum aestivum L. Aegilops tauschii Coss. 12 Cowpea Leguminosae Vigna unguiculata subs. unguiculata (L.) Walp. Vigna unguiculata subsp. unguiculata var. spontanea (Schweinf.) Pasquet 13 Durum wheat Poaceae Triticum turgidum L. T. turgidum ssp dicoccoides (synonym of Triticum dicoccoides (Körn. ex Asch. & Graebn.) Schweinf.) 14 Finger millet Poaceae Eleusine coracana (L.) Gaertn. Eleusine coracana ssp africana (Kenn.-O'Byrne) Hilu & de Wet (synonym to Eleusine coracana (L.) Gaertn.) 15 Grape Vitaceae Vitis vinifera L. Vitis vinifera ssp sylvestris (C.C.Gmel.) Hegi (synonym of Vitis vinifera L.) 16 Maize Poaceae Zea mays L. Zea mays ssp parviglumis (synonym of Zea mays L.) 17 Oats Poaceae Avena sativa L. Avena sterilis L. 18 Oilpalm (African) Arecaceae Elaeis guineensis Jacq. Elaeis guineensis Jacq. 19 Olive Oleaceae Olea europaea L. (also Olea europaea ssp. europaea) Olea europaea subsp. oleaster (Hoffmanns. & Link) Negodi (synonym of Olea europaea subsp. europaea) 20 Pea Leguminosae Pisum sativum L. Pisum sativum subsp. humile (Holmboe) Greuter & al. (synonym of Pisum sativum subsp. elatius (M.Bieb.) Asch. & Graebn.) 21 Peanut Leguminosae Arachis hypogaea L Arachis monticola Krapov. & Rigoni 22 Pearl millet Poaceae Pennisetum glaucum (L.) R. Br.  Pennisetum americanum ssp. monodii (Maire) Brunken (synonym of Pennisetum violaceum (Lam.) Rich.) 23 Rapeseed Brassicaceae Brassica napus L. Brassica rapa L. 24 Rapeseed Brassicaceae Brassica napus L. Brassica oleracea L. 25 Rice Poaceae Oryza sativa L. Oryza rufipogon Griff. 26 Rubber tree Euphorbiaceae Hevea brasiliensis (Willd. ex A. Juss.) Mull. Arg. Hevea brasiliensis (Willd. ex A. Juss.) Mull. Arg. 27 Rye Poaceae Secale cereale L. Secale cereale L. 28 Sesame Pedaliaceae Sesamum indicum L. Sesamum indicum var. malabaricum (Burm.) Christenh. 29 Sorghum Poaceae Sorghum bicolor (L.) Moench Sorghum bicolor ssp. verticilliflorum (Steud.) de Wet ex Wiersema & J.Dahlb. (synonym of Sorghum arundinaceum (Desv.) Stapf) 30 Soybean Leguminosae Glycine max (L.) Merr. Glycine soja Siebold & Zucc. (synonym of Glycine max subsp. soja (Siebold & Zucc.) H.Ohashi) 31 Sugar cane Poaceae Saccharum officinarum L. Saccharum robustum E.W.Brandes & Jeswiet ex Grassl 32 Sunflower Asteraceae Helianthus annuus L. Helianthus annuus L. 33 Sweet potato Convolvulaceae Ipomoea batatas (L.) Poir. Ipomoea trifida (Kunth) G. Don 34 Upland cotton Malvaceae Gossypium hirsutum L. Gossypium hirsutum L.       123     # Level of taxonomic differentiation Reference Hybrid fitness Reference 1 different subspecies The Plant List (2010) 4 - no or few fertile hybrids Anderson and Vicente 2010 2 different species The Plant List (2010) 2 - reduduced fertility post-F1 Asfaw et al. 2008 3 same taxa The Plant List (2010) 1 - generally no reduction in hybrid fertility Anderson and Vicente 2010 4 different species The Plant List (2010) 1 - generally no reduction in hybrid fertility Anderson and Vicente 2010 5 same taxa The Plant List (2010) 1 - generally no reduction in hybrid fertility Bartley 2005 6 same taxa The Plant List (2010) 1 - generally no reduction in hybrid fertility Smartt and Simmonds 1995 7 same taxa The Plant List (2010) 1 - generally no reduction in hybrid fertility Carvalho 1988 8 same taxa The Plant List (2010) 1 - generally no reduction in hybrid fertility Smartt and Simmonds 1995 9 same taxa The Plant List (2010) 1 - generally no reduction in hybrid fertility Anderson and Vicente 2010 10 different species The Plant List (2010) 3 - reduced fitness of F1 Anderson and Vicente 2010 11 different species The Plant List (2010) 4 - no or few fertile hybrids Anderson and Vicente 2010 12 different variety The Plant List (2010) 1 - generally no reduction in hybrid fertility Anderson and Vicente 2010 13 different species The Plant List (2010) 1 - generally no reduction in hybrid fertility Nevo et al. 2002 14 same taxa The Plant List (2010) 1 - generally no reduction in hybrid fertility Anderson and Vicente 2010 15 same taxa The Plant List (2010) 1 - generally no reduction in hybrid fertility Zohary and Hopf 2000 16 same taxa The Plant List (2010) 1 - generally no reduction in hybrid fertility Anderson and Vicente 2010 17 different species The Plant List (2010) 1 - generally no reduction in hybrid fertility Ladizinsky 1989 18 same taxa The Plant List (2010) 1 - no info available, but is same taxon NA 19 same taxa The Plant List (2010) 1 - generally no reduction in hybrid fertility Zohary 1994 20 different subspecies The Plant List (2010) 3 - reduced fitness of F1 Ben Ze'ev and Zohary 1973 21 different species The Plant List (2010) 3 - reduced fitness of F1 Anderson and Vicente 2010 22 different species The Plant List (2010) 1 - generally no reduction in hybrid fertility Anderson and Vicente 2010 23 different species The Plant List (2010) 3 - reduced fitness of F1 Anderson and Vicente 2010 24 different species The Plant List (2010) 4 - no or few fertile hybrids Anderson and Vicente 2010 25 different species The Plant List (2010) 3 - reduced fitness of F1 Song et al. 2004 26 same taxa The Plant List (2010) 1 - no info available, but is same taxon NA 27 same taxa The Plant List (2010) 1 - generally no reduction in hybrid fertility Khush 1963 28 different variety The Plant List (2010) 3 - reduced fitness of F1 Annapurna et al. 2008 29 different species The Plant List (2010) 1 - generally no reduction in hybrid fertility Muraya et al. 2011 30 different subspecies The Plant List (2010) 3 - reduced fitness of F1 Ahmad et al. 1979 31 different species The Plant List (2010) 1 - generally no reduction in hybrid fertility Price 1957 32 same taxa The Plant List (2010) 3 - reduced fitness of F1 Snow et al. 1998 33 different species The Plant List (2010) 3 - reduced fitness of F1 Anderson and Vicente 2010 34 same taxa The Plant List (2010) 1 - generally no reduction in hybrid fertility Anderson and Vicente 2010    124    # Transition in mating system during domestication Reference 1 No change - crop and progenitor are both outcrossing Anderson and Vicente 2010 2 No change - crop and progenitor are both selfing crop: Anderson and Vicente 2010; progenitor: Brown et al. 1978 3 No change - crop and progenitor are both outcrossing crop: Anderson and Vicente 2010; progenitor: Ng and Ng 2002 4 No change - crop and progenitor are both selfing Maiti and Wesch-Ebeling 2001 5 There is evidence for higher rates of selfing in crop Smartt and Simmonds 1995 6 No change - crop and progenitor are both mixed maters Ashburner 1994 7 No change - crop and progenitor are both selfing Anthony et al. 2001 8 No change - crop and progenitor are both outcrossing Lashermes 2001 9 No change - crop and progenitor are both selfing Anderson and Vicente 2010 10 No change - crop and progenitor are both selfing crop: Anderson and Vicente 2010; progenitor: Tsegaye 1996 11 No change - crop and progenitor are both selfing crop: Anderson and Vicente 2010; progenitor: Huang et al. 2009 12 No change - crop and progenitor are both selfing crop: Anderson and Vicente 2010; progenitor: Pasquet 1996 13 No change - crop and progenitor are both selfing crop: Tsegaye 1996; progenitor: Goldenberg 1987 14 There is evidence for higher rates of selfing in crop Ganeshaiah and Uma Shaanker 1982 15 There is evidence for higher rates of selfing in crop crop: Harst et al. 2009; progenitor: Di Vecchi Staraz et al. 2010 16 No change - crop and progenitor are both outcrossing Anderson and Vicente, 2010 17 No change - crop and progenitor are both selfing crop: Jensen 1961; progenitor: Kiviharju and Puolimatka, 1997 18 No change - crop and progenitor are both outcrossing Corley et al. 1976 19 No change - crop and progenitor are both outcrossing Breton et al. 2006 20 No change - crop and progenitor are both selfing crop: Elzebroek and Wind, 2008; progenitor: Zohary, 1997 21 No change - crop and progenitor are both selfing Anderson and Vicente, 2010 22 No change - crop and progenitor are both outcrossing crop: Anderson and Vicente, 2010; progenitor: Marchais 1994 23 There is evidence for higher rates of selfing in crop crop: Becker et al. 1991; progenitor: Nasrallah and Nasrallah 1989 24 There is evidence for higher rates of selfing in crop crop: Becker et al. 1991; progenitor: Qui et al. 1995 25 There is evidence for higher rates of selfing in crop Sweeney and McCouch 2007 26 No change - crop and progenitor are both outcrossing Le Guen et al. 2009 27 No change - crop and progenitor are both outcrossing crop: Elzebroek and Wind 2008; progenitor: Zohary and Hopf 2000 28 NA NA 29 There is evidence for higher rates of selfing in crop crop: Anderson and Vicente 2010; progenitor: Doggett 1988 30 No change - crop and progenitor are both selfing crop: Anderson and Vicente 2010; progenitor: Fujita et al. 1996 31 No change - crop and progenitor are both outcrossing crop: McIntyre and Jackson 2001; progenitor: Grassl 1964 32 There is evidence for higher rates of selfing in crop Burke et al. 2002 33 No change - crop and progenitor are both outcrossing crop: Anderson and Vicente 2010; progenitor: Kowyama et al. 2000 34 No change - crop and progenitor are both mixed maters Anderson and Vicente 2010     125  # Breakdown of self-incompatibility  Reference 1 crop and progenitor do not have a self incompatibility system Itino et al. 1991 2 crop and progenitor do not have a self incompatibility system NA - both mainly selfing 3 crop and progenitor do not have a self incompatibility system Olsen and Schall 2001 4 crop and progenitor do not have a self incompatibility system NA - both selfing 5 there is a loss of the self incompatibility system in some cultivars of the crop Smartt and Simmonds 1995 6 crop and progenitor do not have a self incompatibility system Smartt and Simmonds 1995 7 crop and progenitor do not have a self incompatibility system Anthony et al. 2001 8 crop and progenitor are self incompatible Maurin et al. 2007 9 crop and progenitor do not have a self incompatibility system NA - both selfing 10 crop and progenitor do not have a self incompatibility system NA - both selfing 11 crop and progenitor do not have a self incompatibility system NA - both selfing 12 crop and progenitor do not have a self incompatibility system NA - both mainly selfing 13 crop and progenitor do not have a self incompatibility system NA - both selfing 14 crop and progenitor do not have a self incompatibility system Brink and Belay 2006 15 crop and progenitor do not have a self incompatibility system, but there is a change from dioecy to monecy Vecchi Staraz et al. 2009 16 crop and progenitor do not have a self incompatibility system crop: Anderson and Vicente 2010; progenitor: Hufford et al. 2011 17 crop and progenitor do not have a self incompatibility system NA - both selfing 18 crop and progenitor do not have a self incompatibility system Baudouin et al. 1997 19 there is a loss of the self incompatibility system in some cultivars of the crop crop: Albertini et al. 2011; progenitor: Zohary and Hopf 2000 20 crop and progenitor do not have a self incompatibility system NA - both selfing 21 crop and progenitor do not have a self incompatibility system NA - both selfing 22 crop and progenitor do not have a self incompatibility system Reger 1989 23 complete loss of self-incompatibility in the crop crop: Anderson and Vicente 2010: progenitor: Hinata and Nishio 1978 24 complete loss of self-incompatibility in the crop crop: Anderson and Vicente 2010: progenitor: Hinata and Nishio 1978 25 crop and progenitor do not have a self incompatibility system Morishima and Barbier 2005 26 crop and progenitor do not have a self incompatibility system Priyadarshan et al. 2009 27 crop and progenitor are self incompatible crop: Newbigin et al. 1993; progenitor: Zohary and Hopf 2000 28 crop and progenitor do not have a self incompatibility system Sastra and Shivanna 1976 29 crop and progenitor do not have a self incompatibility system Muraya et al. 2011 30 crop and progenitor do not have a self incompatibility system NA - both mainly selfing 31 complete loss of self-incompatibility in the crop crop: McIntyre and Jackson 2001; progenitor: Grassl 1964 32 complete loss of self-incompatibility in the crop Burke et al. 2002 33 there is a loss of the self incompatibility system in some cultivars of the crop crop: Anderson and Vicente, 2010; progenitor: Kowyama et al. 2000 34 crop and progenitor do not have a self incompatibility system Anderson and Vicente, 2010      126  # Geography of domestication Reference Ploidy differences Reference 1 sympatric Perrier et al. 2011 Yes, progenitor diploid, cultivar triploid Perrier et al. 2011 2 sympatric Anderson and Vicente 2010 No, both diploid Anderson and Vicente 2010 3 sympatric Anderson and Vicente 2010 No, both diploid Anderson and Vicente 2010 4 sympatric Maiti and Wesch-Ebeling 2001 No, both diploid Maiti and Wesch-Ebeling 2001 5 sympatric Smartt and Simmonds 1995 No, both diploid Smartt and Simmonds 1995 6 sympatric Smartt and Simmonds 1995 No, both diploid Smartt and Simmonds 1995 7 sympatric Meyer 1965 No, both tetraploid Lashermes 1999 8 sympatry  Smartt and Simmonds 1995 No, both diploid Lashermes 2001 9 sympatric Anderson and Vicente 2010 No, both diploid Anderson and Vicente 2010 10 sympatric Smartt and Simmonds 1995 Yes, progenitor tetraploid, crop hexaploid  Anderson and Vicente 2010 11 sympatric Smartt and Simmonds 1995 Yes, progenitor diploid, crop hexaploid  Anderson and Vicente 2010 12 sympatric Smartt and Simmonds 1995 No, both diploid Smartt and Simmonds 1995 13 sympatric Anderson and Vicente 2010 No, both tetraploid Anderson and Vicente 2010 14 sympatric Smartt and Simmonds 1995 No, both tetraploid Anderson and Vicente 2010 15 sympatric Smartt and Simmonds 1995 No, both diploid Smartt and Simmonds 1995 16 sympatric Doebley 2004 No, both diploid Anderson and Vicente 2010 17 sympatric Anderson and Vicente 2010 No, both hexaploid Anderson and Vicente 2010 18 sympartic Elzebroek and Wind 2008 No, both diploid Smartt and Simmonds 1995 19 sympatric Smartt and Simmonds 1995 No, both diploid Zohary 1994 20 sympartic  Zohary and Hopf 1973 No, both diploid Baranyi and Greilhuber 1996 21 sympatric Anderson and Vicente 2010 No, both tetraploid Anderson and Vicente 2010 22 sympatric Manning et al. 2011 No, both diploid Anderson and Vicente 2010 23 uncertain, but likely relatively recently in Europe Smartt and Simmonds 1995 Yes, progenitor diploid, crop tetraploid Anderson and Vicente 2010 24 uncertain, but likely relatively recently in Europe  Smartt and Simmonds 1995 Yes, crop 4n, wild 2n Anderson and Vicente 2010 25 sympatric Fuller et al 2009 No, both diploid Anderson and Vicente 2010 26 sympartic Elzebroek and Wind 2008 No, both diploid Smartt and Simmonds 1995 27 sympatric Smartt and Simmonds 1995 No, both diploid Zohary and Hopf 2000 28 sympatric Bedigian 2003 No, both diploid Bedigian 2003 29 sympatric DeWet 1967 No, both diploid Anderson and Vicente 2010 30 sympartic Anderson and Vicente 2010 No, both tetraploid Anderson and Vicente, 2010 31 sympatric Grivet et al. 2004 complex, both are polyploid (likely no change in chromosome number during initial domestication; though later on chromosome number increased) Smartt and Simmonds 1995 32 parapatric Asch 1993 No, both diploid Burke et al. 2002 33 sympatric Anderson and Vicente 2010 Yes, progenitor dilploid, crop hexaploid Anderson and Vicente 2010 34 sympatric Brubaker and Wendel 1994 No, both tetraploid Brubaker and Wendel 1994     127   128  # Mode of propagation of crop Reference 1 vegetative Anderson and Vicente 2010 2 sexual Ellstrand 2003 3 asexual Ellstrand 2003 4 sexual Ellstrand 2003 5 sexual and vegetative (through predominantly sexual) Bartley 2005 6 sexual Ellstrand 2003 7 sexual Ellstrand 2003 8 sexual Ellstrand 2003 9 sexual Ellstrand 2003 10 sexual Ellstrand 2003 11 sexual Ellstrand 2003 12 sexual Ellstrand 2003 13 sexual Ellstrand 2003 14 sexual Ellstrand 2003 15 sexual and vegetative (though predominantly vegetative today) This et al 2006 16 sexual Ellstrand 2003 17 sexual Ellstrand 2003 18 sexual Ellstrand 2003 19 sexual and vegetative (though predominantly vegetative today) García-Díaz et al. 2003 20 sexual Smartt and Simmonds 1995 21 sexual Ellstrand 2003 22 sexual Ellstrand 2003 23 sexual Ellstrand 2003 24 sexual Ellstrand 2003 25 sexual Ellstrand 2003 26 sexual and vegetative (though predominantly vegetative today) Imle 1978 27 sexual Ellstrand 2003 28 sexual Smartt and Simmonds 1995 29 sexual Ellstrand 2003 30 sexual Ellstrand 2003 31 vegetative Ellstrand 2003 32 sexual Ellstrand 2003 33 vegetative Ellstrand 2003 34 sexual Ellstrand 2003

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0072532/manifest

Comment

Related Items