Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Cloning and expression of organic cation transporters (ORCT and ORCT2) from the fruit fly Drosophila.. Matier, Brieanne Joelle 2011

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
[if-you-see-this-DO-NOT-CLICK]
ubc_2012_spring_matier_brieanne.pdf [ 9.46MB ]
Metadata
JSON: 1.0072474.json
JSON-LD: 1.0072474+ld.json
RDF/XML (Pretty): 1.0072474.xml
RDF/JSON: 1.0072474+rdf.json
Turtle: 1.0072474+rdf-turtle.txt
N-Triples: 1.0072474+rdf-ntriples.txt
Original Record: 1.0072474 +original-record.json
Full Text
1.0072474.txt
Citation
1.0072474.ris

Full Text

CLONING AND EXPRESSION OF ORGANIC CATION TRANSPORTERS (ORCT AND ORCT2)  FROM THE FRUIT FLY DROSOPHILA MELANOGASTER MEIGEN        by       Brieanne Joelle Matier          B.Sc., The University of British Columbia, 2009        A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF   THE REQUIREMENTS FOR THE DEGREE OF       MASTER OF SCIENCE      in       The College of Graduate Studies     (Biology)         THE UNIVERSITY OF BRITISH COLUMBIA    (Okanagan)         December 2011            © Brieanne Joelle Matier, 2011       ii  Abstract    Organic cations include endogenous metabolites, and xenobiotics (drugs, pesticides,  environmental toxins), that must be effectively eliminated in order for organisms to survive.  The midgut and Malpighian tubules of insects have been shown to play a role in the active  transport of organic cations. Two putative organic cation transporters (OCTs) were cloned  from adult Drosophila melanogaster. Phylogenetic analysis indicated that these OCTs exist in  an insect specific clade separate and equally divergent from identified vertebrate OCT  isoforms. Gene expression patterns for these D. melanogaster transporters were determined  using quantitative real time polymerase chain reaction (qPCR).  D. melanogaster genes were  found to be differentially distributed across the Malpighian tubules and the midgut.  The  isolated ORCT protein was transiently expressed in Sf9 insect cell lines.  Preliminary  experiments indicated successful expression of ORCT, visualized through Western blotting.   A complete understanding of the molecular structure, tissue expression, and physiological  characterization of these organic cation transporters may hold promise for the formulation  of more effective and environmentally benign insecticides, and may provide insights into the  evolutionary origin of OCTs themselves.                    iii  Preface     As required by the UBC Animal Care Committee, I had successfully completed the  Canadian Council on Animal Care (CCAC) National Institutional Animal User Training prior  to beginning my research.  All research presented in Chapter 2 was conduced solely by the author, under the  supervision of Dr. Mark Rheault at the University of British Columbia – Okanagan.  Research presented in Chapter 3 was conducted with collaboration from the Insect  Pathology laboratory at Pacific Agri‐Research Center (PARC), Summerland, B.C. with Mrs.  Nadia Sokal, and under the direction of Dr. David Theilmann and Dr. Mark Rheault.  I was  responsible for the creation of all orct constructs and for the creation and isolation of  positive orct‐p2ZOPe2 constructs for transient cell line expression.  All transfections,  infections and Western blotting were performed together at PARC.  Figures 1.1 (Maddrell, 1981), 1.2 (Ianowski and O’Donnell, 2004), and 1.3 (Dow,  2009) were reproduced in this thesis with permission from the Journal of Experimental  Biology.  Figure 1.4 (Wright and Dantzler, 2004) did not require permission and was  reproduced from The American Physiological Society through Copywright Clearance Center  Inc.                   iv  Table of Contents    Abstract............................................................................................................................................ ii  Preface ............................................................................................................................................ iii  Table of Contents......................................................................................................................... iv  List of Tables ................................................................................................................................. vi  List of Figures............................................................................................................................... vii  List of Abbreviations .................................................................................................................. ix  Acknowledgements...................................................................................................................xiii   Dedication..................................................................................................................................... xv   Chapter 1  General Introduction .................................................................................... 1  1.1 Organization of the Insect Excretory System....................................................1  1.2 Fluid and Ion Secretion by Malpighian Tubules...............................................2  1.3 Models of Inorganic Ion Secretion by Insect Malpighian Tubules ...........3  1.4 Secretion of Organic Cations.....................................................................................5  1.5 Overview of Organic Cation Transport by Vertebrate Renal Tubules....6  1.6 Molecular Identification of Vertebrate Organic Cation Transporters ....9  1.7 Transport of Organic Cations in Insects ........................................................... 10  1.8 Heterologous Protein Expression as a Tool to Study Organic Cation   Transport Pathways .................................................................................................. 13   1.9 Research Purpose....................................................................................................... 17    Chapter 2  Cloning and mRNA Expression of orct and orct2 ............................... 25    2.1  Synopsis.......................................................................................................................... 25   2.2  Materials and Methods............................................................................................. 26     2.2.1     Insect Rearing............................................................................................... 26    2.2.2     RNA Extraction and Reverse Transcription .................................... 26     2.2.3     Primer Design............................................................................................... 28     2.2.4     Primer Optimization.................................................................................. 30  2.2.5  Cloning of Full Length cDNA Encoding orct and orct2.................32    2.2.6     orct and orct2 Sequence Analysis ........................................................ 34    2.2.7     Phylogeny of Organic Cation Transporters ..................................... 35    2.2.8     Quantitative Real‐Time Polymerase Chain Reaction................... 36    2.2.9     Data Analysis................................................................................................. 37   2.3  Results ............................................................................................................................. 39    2.3.1     Sequence and Structural Features....................................................... 39  2.3.2     Alignments and Phylogenetic Relationships................................... 42   v  2.3.3     Gene Expression Analysis of orct and orct2 Using      Quantitative Real‐Time Polymerase Chain Reaction................... 43  2.4  Summary ........................................................................................................................ 45    Chapter 3  Expression of the ORCT Protein in Insect Cell Lines ........................75  3.1  Synopsis.......................................................................................................................... 75  3.2  Materials and Methods............................................................................................. 77  3.2.1     Insect Rearing............................................................................................... 77  3.2.2     RNA Extraction and Reverse Transcription .................................... 77  3.2.3     Primer Design............................................................................................... 77  3.2.4     Amplification and Preparation of Amplicons ................................. 78   3.2.5     Cloning into p2ZOPe2 ............................................................................... 79  3.2.6     Cloning into pAcBac ................................................................................... 81   3.2.7     Transfection and Collection of Budded Virus ................................. 84  3.2.8     Infection .......................................................................................................... 85   3.2.9     Protein Preparation and Sodium Dodecyl Sulfate     Polyacrylamide Gel Electrophoresis .................................................. 86   3.2.10  Coomassie Staining and Western Blotting........................................ 87  3.2.11  Selection for Stable Expressing Polyclonal Cell Line.................... 88   3.3  Results ............................................................................................................................. 88  3.3.1     Proof of Method ........................................................................................... 88  3.3.2     Transfection Results .................................................................................. 89  3.3.3     Infection Results.......................................................................................... 90  3.4  Summary ........................................................................................................................ 91    Chapter 4  Discussion.................................................................................................... 100   4.1  General Discussion.................................................................................................. 100  4.2  Molecular Identification of Organic Cation Transporters in     D. melanogaster ........................................................................................................... 101  4.3 Heterologous Protein Expression in Insect Sf9 Cells ............................... 105  4.4 Relative mRNA Expression of orct and orct2................................................ 108   4.5 Future Studies........................................................................................................... 110  References ................................................................................................................................. 113  Appendix 1: qPCR Normalization Using Multiple Reference Genes ....................... 129           vi  List of Tables    Table 1.1  Tissue localization of vertebrate organic cation transporters ..................... 19  Table 2.1  Cloning primers ................................................................................................................ 47   Table 2.2  Quantitative real‐time PCR primers......................................................................... 48  Table 2.3  Sequencing primers ........................................................................................................ 49   Table 2.4  Protein sequences for alignments............................................................................. 50  Table 2.5   Sequence analysis for orct showing nucleotide substitutions...................... 51   Table 2.6  Sequence analysis for orct2 showing nucleotide substitutions ................... 52  Table 2.7    Sequence identity shared between organic cation transporter‐like    representative proteins................................................................................................. 53  Table 3.1  Expression primers ......................................................................................................... 93                              vii  List of Figures   Figure 1.1  Structure of the insect alimentary and excretory systems ............................ 20   Figure 1.2  Physiology of inorganic cation secretion in D. melanogaster ........................21   Figure 1.3    Physiology of the secrection of inorganic anions in D. melanogaster........ 22  Figure 1.4    Schematic representation of organic cation transport in renal cells       of vertebrates..................................................................................................................... 23  Figure 1.5    Schematic of the proposed transport mechanism for organic cations       in D. melanogaster...............................................................................................................24   Figure 2.1    Representative RNA gel................................................................................................. 54   Figure 2.2    Sample MELT curve analysis for orct ........................................................................55  Figure 2.3    Sample plate schematic for temperature and primer concentration    optimization using quantitative real‐time PCR................................................... 56  Figure 2.4    Optimal annealing temperatures for quantitative real‐time       PCR primers........................................................................................................................ 57   Figure 2.5    Sample plate schematic for determination of primer set efficiency .......... 58  Figure 2.6    Efficiency curves............................................................................................................... 59  Figure 2.7    Sample schematic for a quantitative real‐time PCR experimental plate.. 60  Figure 2.8    Annotated protein sequence of ORCT ..................................................................... 61  Figure 2.9    Schematic representation of the predicted secondary structure of ORCT62  Figure 2.10  Annotated protein sequence of ORCT2 .................................................................. 63  Figure 2.11  Schematic representation of the predicted secondary structure of     ORCT2 ................................................................................................................................... 64  Figure 2.12  Alignment of representative vertebrate organic cation transporters     and organic cation transporter orthologs with sequences from    viii    D.  melanogaster ...................................................................................................................65  Figure 2.13  Hydrophobicity plots of ORCT and ORCT2 with representative     vertebrate oganic cation transporter orthologs ................................................. 66  Figure 2.14  Alignment of representative insect organic cation transporter‐like     orthologs .............................................................................................................................. 67  Figure 2.15  Hydrophobicity plots of ORCT and ORCT2 with representative insect     organic cation transporter‐like orthologs............................................................. 68  Figure 2.16  Phylogenetic analysis of representative organic cation transporter‐like  orthologs from the major facilitator superfamily.............................................. 69   Figure 2.17  Reference gene stability analysis .............................................................................. 70    Figure 2.18  Tissue distribution profiles of orct and orct2........................................................71  Figure 2.19  Comparative expression of orct and orct2 within D. melanogaster     tissues.................................................................................................................................... 72   Figure 2.20  Relative expression of orct mRNA following exposure to     tetraethylammonium after 1 and 15 generations.............................................. 73   Figure 2.21  Relative expression of orct2 mRNA following exposure to  tetraethylammonium after 1 and 15 generations ............................................. 74   Figure 3.1  Schematic diagram showing constructs and cloning into p2ZOPe2 .......... 94  Figure 3.2  Schematic diagram showing constructs and cloning into pAcBac.............. 95  Figure 3.3  Images of Sf9 cells following transfection with pE28‐GFP............................. 96  Figure 3.4  Results of transfection with p2ZOPe2 constructs.............................................. 97  Figure 3.5  Results of transfection with pAcBac constructs.................................................. 98  Figure 3.6  Results of infection with budded virus constructs ............................................ 99     ix  List of Abbreviations   aa  amino acid   AcMNPV  Autographa californica multicapsid nuclear polyhedrosis virus   actin 42A  actin 42A gene, D. melanogaster, reference gene   ANOVA  analysis of variance, statistical test   apical  the cell membrane bordering the lumen  bacmid  a shuttle vector that can be propagated in both E. coli and insect cells  basolateral  the cell membrane bordering the haemolymph or blood  bmon14272  Autographa californica Multicapsid Nucleopolyhedro virus bacmid   BLAST  Basic Local Alignment Search Tool  BV   budded virus   cDNA   complimentary DNA  ColE1   replication origin  Cq   quantification cycle   Ct  threshold cycle  ctl   control, undigested circular plasmid  Da   Dalton, atomic mass unit  DDAB  dimethyldioctadecyl‐ammonium bromide  DEPC  diethylpyrocarbonate  DH10β  E. coli cell strain  DOPE  L‐alpha‐ phosphatidylethanolamine dioleoyl  E  efficiency  EM7  bacterial promoter  FBS   fetal bovine serum   x  FLIPT  fly‐like putative transporter   gapdh­1  glyceraldehyde 3‐phosphate dehydrogenase, D. melanogaster,  reference gene  GFP  green fluorescent protein   goi  gene of interest   HA‐tag  human influenza hemagglutinin amino acid sequence (YPY DVP DYA)  heterologous  from a different species, transplant between species   hpi   hours post infection    hpt   hours post transfection   ie2  immediate early promoter from Orgyia pseudotsugata  JM109  E. coli cell strain  JMAX   maximum flux  Kc1   a cell line from the dipteran Drosophila melanogaster  Km  concentration of substrate that will give half‐maximal velocity of  transport capability   LB   Luria‐Bertani media/agar   MATE   multi drug and toxin extrusion transporter   MDR    multi‐drug resistant protein   MFS    major facilitator superfamily   mRNA  messenger RNA  MT   Malpighian tubule   NAPS  Nucleic Acid Protein Service Unit  NCBI  National Center for Biotechnology Information  NHE   sodium/proton exchanger    xi  NMN   N‐methylnicotinamide   NRQ  normalized relative quantity  NRT   no reverse transcription control  NTC   no template control   OAT   organic anion transporter   OB   occlusion body   OC   organic cation   OCT   organic cation transporter   OCTN   organic cation/carnitine transporter   ODV   occlusion derived virus   OpMNPV  Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus  orct  organic cation transporter‐like, D. melanogaster, gene of interest  orct2  organic cation transporter‐like 2, D. melanogaster, gene of interest  ORF    open reading frame   p2ZOPe2  a plasmid  pAcBac  recombinant plasmid   pE38‐GFP  a plasmid with a green fluorescent protein construct  pFastBac‐1™  a plasmid   pGEM®‐T Easy  a plasmid  pmon7124   transfer plasmid  PBS  phosphate buffered saline    PCR    polymerase chain reaction   PKA  cAMP dependant protein kinase  PKC   protein kinase C    xii  qPCR    quantitative real time polymerase chain reaction   ref  reference gene   rp49  ribosomal protein 49, D. melanogaster, reference gene   SDS‐PAGE  sodium dodecyl sulfate polyacrylamide gel electrophoresis  SEM  standard error of the mean   Sf9   a cell line from the lepidopteran Spodoptera frugiperda  SL2   a cell line from the dipteran Drosophila melanogaster  SLC22A   solute carrier superfamily 22A  SMART  Simple Modular Architecture Research Tool  SNP   single nucleotide polymorphism  TEA   tetraethylammonium  TEMED  tetramethylethylenediamine , N,N,N',N'‐tetramethyl‐ ethane‐1,2‐ diamine  Tm   annealing temperature   TMD   transmembrane domain  Tn7   transposition site  V‐ATPase   vacuolar type H+‐ATPase                 xiii  Acknowledgements    It is with the deepest appreciation I would like to extend my thanks to the faculty, staff  and students at the Okanagan campus of UBC for making my many years here an  unforgettable and rewarding experience.  It is the atmosphere of the campus and the  ongoing support of everyone that I have had the pleasure of working that have made these  years so memorable.      I find it hard to put into words my unending gratitude to my supervisor Dr. Mark  Rheault for granting me the opportunity to learn from him.  Through his guidance I have  learned more about myself and what I am capable of over anything I would have expected.   His unwavering confidence in my ability and his respect pushed me to exceed all of my own  expectations and has raised my confidence and abilities to new heights.      Thank you to all members of my committee; Dr. Scott Reid, Dr. Michael Russello and  Dr. Andis Klegeris for your feedback, support and respect.  It has been a pleasure working  with you and learning from you.   Thank you to my collaborators for help with this and other projects, Mrs. Nadia Sokal  and Dr. David Theilmann (PARC); Miss Sarah Chahine (McMaster University, Hamilton, ON);  and Miss Jesmila Marusalin and Dr. Andrew Donini (York University, Toronto, ON).  Special thanks should be given to Lukman (Rony) Sarker and Zerihun Demissie for  their friendship, support, positive thinking and knowledge – I could not have made it  through without you. Thank you Kevin Duncan and Patrick Bobyn for your patience and  help developing techniques for our lab and for always inspiring great music on long  dissection days.  Thank you also to my current lab mate Matt Glover for your understanding  during my writing months.    xiv    Thank you to the Natural Sciences and Engineering Research Council of Canada  (NSERC), the Canadian Foundation for Innovation (CFI), the Canadian Society of Zoologists  (CSZ) and the Association of Professional Biologists of British Columbia (APB) for granting  the funding to complete and share this research.     Finally to my family – you are my drive, my inspiration, my strength, my support, my  world, and even though I’m sure you can only wonder at what I have been doing for the last  two years, I am so grateful everyday that we could go through it together.  Mom, Dad, Matt,  you are my best friends and I love you.                          xv      To Joy and family                                   1  Chapter 1  General Introduction    1.1 Organization of the Insect Excretory System  The excretory system in the majority of insects consists of the Malpighian tubules (MTs)  and the hindgut, working in concert with other areas of the alimentary system (i.e. midgut)  and respiratory system (i.e. anal papillae) to maintain osmotic balance. Malpighian tubules,  which are analogous to vertebrate renal tissue, are present in all known insects except  Springtails (order Collembola), Bristle‐tails (order Diplura), Coneheads (order Protura),  and Stylops (order Strepsiptera) (Phillips, 1981).  The number of MTs found between  species is variable and ranges from 2 in coccids to more than 250 in locusts (Phillips, 1981).   Malpighian tubules are variable in length and can range from 2 – 70 mm (Phillips, 1981).   Although MTs of insects show variability in number and length, their overall morphology is  relatively well conserved.  Malpighian tubules are blind‐ended and in the majority of insects  open to the alimentary system at the junction of the midgut and hindgut (Figure 1.1).   Malpighian tubules are composed of a single layer of squamous epithelial cells.  Two to five  cells make up a tubule in cross‐section (Phillips, 1981).  Insects such as Rhodnius prolixus or  Locusta migratoria have tubules are composed of a single cell type, while other insects such  as the dipterans D. melanogaster and Aedes aegypti have tubules composed of both principal  cells and a different , secondary, cell type, called stellate cells (Dow, 2009).  Ultrastructural  studies have revealed that tubules have membrane structures consistent with transporting  epithelia.  Electron micrographs of tubules show that the apical and basal membranes are  highly folded.  The total surface area of a tubule is ~20 times greater than that of the  vertebrate glomeruli per unit body weight (Phillips, 1981).  In R. prolixus, it has been  calculated that the apical side of the cell is increased 150‐fold due to the presence of  microvilli and that the surface area of the basal side of the cell is increased by a factor of 40   2  due to the extensive infolding of the membrane (O’Donnell and Maddrell, 1983).  The  increases in surface area as a result of this folding are presumed to be necessary for the  incorporation of membrane‐bound proteins that are utilized for transport of inorganic and  organic ions in MTs.  Based on cell dimensions, the width of the intercellular spaces and the  extensive membrane infolding the ratio of the area of the membrane to the intercellular  cleft has been calculated to be 120 000:1 (Phillips, 1981).  Given the high value of this ratio  it has been suggested that the dominant route for fluid and ion transport in R. prolixus MTs  is transcellular rather than paracellular (O’Donnell and Maddrell, 1983).     1.2 Fluid and Ion Secretion by Malpighian Tubules  Malpighian tubules, which are analogous to the proximal segments of the vertebrate  renal tubule, are responsible for the secretion of primary urine, waste products and toxins,  while the hindgut is responsible for downstream reabsorption of water from the primary  urine and can be considered functionally analogous to the collecting duct of the vertebrate  renal tubule (Phillips et al., 1981).  Malpighian tubules and the hindgut acting in concert  comprise the insect functional kidney.  In contrast to the vertebrate kidney where urine is  formed through hydrostatic filtration of the plasma at the glomerulus, production of  primary urine in insects occurs by a secretory process driven by the active transport of ions  into the tubule lumen, and a consequent flow of osmotically obliged water (O’Donnell and  Maddrell, 1983; Dow et al., 1994).  Secreted fluid is nearly iso‐osmotic or slightly hyper‐ osmotic to the haemolymph of the insect. The rates of fluid secretion by tubules can be  extremely high.  Fully stimulated MTs of R. prolixus or D. melanogaster can secrete a volume  of near iso‐osmotic fluid equivalent to each cells own intracellular volume every 10‐15  seconds (Maddrell, 1991; Dow et al., 1994).    3  1.3  Models of Inorganic Ion Secretion by Insect Malpighian Tubules  The physiology of inorganic ion transport by the MTs has been investigated in a number  of insect species. Current models propose that cations are transported through a  transcellular pathway (O’Donnell and Maddrell, 1983), but differing pathways for inorganic  anion transport have been described in tubules from different insect species. Inorganic  anion transport may involve paracellular pathways or transcellular pathways, through the  same cell type as cations or through a different cell type (Beyenbach, 2003; O’Donnell et al.,  2003; O’Donnell et al., 1998).    Figure 1.2 shows the current models of inorganic ion transport for the MTs of D.  melanogaster. Early models of fluid secretion by insect MTs suggested that an apical alkali  cation pump was responsible for energizing ion transport (Wieczorek et al., 1986; Harvey et  al., 1983).  It is now widely accepted that the apical cation pump is in fact comprised of two  separate transporters, a ouabain insensitive vacuolar‐type H+‐ATPase (V‐ATPase)  (Schweikl et al., 1989) that can be inhibited by bafilomycin A1 (Bertram et al., 1991;  Bowman et al., 1988), coupled to an amiloride sensitive alkali cation/H+ exchanger  (Wieczorek et al., 1991). The V‐ATPase maintains an electrochemical proton derived  gradient, which makes the lumen side of the membrane positive relative to the intracellular  side of the apical membrane. This electrochemical gradient provides the driving force for  the secondary facilitated transport of alkali cations from the cell to lumen through the alkali  cation/H+ antiporter (Wieczorek et al., 1991).  Recent studies by Rheault et al. (2007) have  provided molecular evidence that the previously proposed Weiczoreck alkali cation/H+  antiporter is in fact a member of the cation/proton antiporter family of transport proteins  designated NHE (sodium/proton exchanger).    4  Mechanisms of inorganic cation movement across the apical membrane in different  insect species have been extensively studied and the mechanisms have been found to be  similar across insect species.  However, there has been much debate as to the transporters  responsible for the entry of inorganic cations across the basolateral membrane between  different insect species. Early models have proposed separate entry pathways for K+ and  Na+ in phytophagous insects such as D. melanogaster. The first of these early models  suggested that K+ transport across the basolateral membrane of the principal cells occurs  through K+ channels (Dow et al., 1994; O’Donnell et al., 1996). A recent study by Evans et al.  (2005) has provided evidence that a low‐affinity class of inward rectifying K+ channels may  play a minor role in fluid secretion by unstimulated MTs but a more significant role in MTs  in which fluid secretion has been stimulated by diuretic factors. A second model proposed  by Linton and O’Donnell (1999) suggests that K+ crosses the basolateral membrane through  both the Na+/K+‐ATPase and a K+:Cl‐ co‐transporter.  More recently a study by Ianowski and  O’Donnell (2004), in which basolateral electrochemical potentials were calculated, has  ruled out both of these suggested routes of K+ basolateral entry for unstimulated tubules.  Instead a bumetanide sensitive Na+:K+:2Cl‐ co‐transporter was shown to be responsible for  inorganic cation entry, with most of the Na+ that enters the cells being recycled back to the  haemolymph via a basolateral Na+/K+‐ATPase. The routes of transepithelial Cl‐ transport  are shown in Figure 1.2 and Figure 1.3.  Studies by O’Donnell et al. (1996, 1998) have  indicated that transepithelial Cl‐ transport in D. melanogaster is mediated by passive  movement down a favorable electrochemical gradient for Cl‐ through stellate cells, possibly  mediated by chloride channels. However, Ianowski and O’Donnell (2004) have shown that  Cl‐ enters across the basolateral membrane of the principal cells of D. melanogaster MTs via  the Na+:K+:2Cl‐ co‐transporter. While a small portion of this Cl‐ is recycled back across the   5  basolateral membrane the majority must exit across the apical membrane by a yet  undefined or characterized apical pathway. Alternatively, in another dipteran, the yellow  fever mosquito, A. aegypti, there is evidence to suggest that transepithelial Cl‐ transport is  mediated via a paracellular pathway (Pannabecker et al., 1993).      1.4 Secretion of Organic Cations     Renal secretion of organic ions plays a critical role in limiting an organism’s  susceptibility to the effects of toxic compounds of both exogenous and endogenous origin.  Secretion of organic cations (OCs) has been demonstrated in the renal tissues of a number  of mammalian and non‐mammalian vertebrates (Miller and Holohan, 1987; Burg and  Weller, 1969; Hawk and Dantzler, 1984, Dantzler, 1989; Rennick, 1981), and in several  invertebrate species (Miller and Holliday, 1987; Maddrell and Gardiner, 1976).  Insects  have evolved a number of defensive mechanisms to cope with the accumulation of toxic  substances in their haemolymph and tissues including detoxification by metabolic enzymes  (Li et al., 2002, 2007) and through elimination across insect MTs and gut (O’Donnell et al.,  2003).  Organic cations include xenobiotics such as environmental pollutants, plant  defensins, animal toxins and pharmacological drugs (Dresser et al., 1999). In addition, both  endogenous and exogenous compounds have the potential of being metabolized into OCs.   All OCs share a common hydrophobic carbon backbone (Meijer et al., 1990) giving each  molecule a certain level of hydrophobicity.  As well, all OCs posses a positively charged  amine group at physiological pH 7 (Meijer et al., 1990) implicating carrier mediated  transport in the excretion of these compounds.   Type I OCs such as tetraethylammonium  (TEA), and N‐methylnicotinamide (NMN) are typically monovalent and have a molecular  weight <400 g mol‐1.  Type II OCs such as vinblastin and vecuronium are typically   6  polyvalent with a molecular weight >500 g mol‐1 (Meijer et al., 1990).  It is generally  accepted that the principal function of transport processes associated with the movement  of OCs is clearing the body of xenobiotic compounds (Pritchard and Miller, 1993; Wright  and Dantzler, 2004).    Much of what is known about OC renal secretion and the mechanisms involved has  been derived from experimental work on vertebrate renal tissue over the past 30 years.  Thus, it is appropriate to begin our discussion of the mechanisms potentially involved in MT  OC transport by discussing models of vertebrate renal transport.      1.5 Overview of Organic Cation Transport by Vertebrate Renal Tubules    Renal excretion of OCs was first demonstrated in vertebrate tissue almost 65 years  ago (Sperber, 1947; Rennick et al., 1947).  Since then, further studies have shown that  excretion of a wide range of OCs is a common characteristic of vertebrate and invertebrate  renal tissues (Miller and Holliday, 1987; Boom et al., 1992; Hawk and Dantzler, 1984;  McKinney et al., 1981; Wright et al., 2004).  In 1993 Pritchard and Miller reviewed the  physiological evidence for the “classical” OC transport pathway in vertebrates. This  pathway involved carrier‐mediated potential‐driven uptake of OCs through a single  pathway at the basolateral membrane, intracellular sequestration of the OCs, and luminal  exit through an OC/ H+ exchanger or by a multi‐drug resistance transport protein (MDR).   Incorporation of more recent physiological and molecular evidence suggested that this  classical model is an oversimplification of the OC transport pathways.  More extensive  reviews by Wright and Dantzler (2004) and Wright (2005) incorporating available evidence  indicated that there are multiple OC transporters with differential expression and affinities   7  for a broad range of type I and type II OCs at both the basolateral and apical membranes of  renal cells.     Figure 1.4 shows the complement of transporters proposed by Wright and Dantzler  in 2004 for the transepithelial transport of OCs in the vertebrate renal proximal tubule.  Basolateral entry of Type I OCs involves one or more electrogenic facilitated diffusion  mechanisms driven by the inside‐negative basolateral membrane potential (Smith et al.,  1988; Busch et al., 1996).  The transporters responsible have been cloned and characterized  in vertebrates and labeled as organic cation transporters (OCT1, OCT2, OCT3).  Evidence for  potential‐driven facilitated diffusion at the basolateral membrane of an intact epithelium  comes from the study of proximal tubules of two species of marine teleost fish, namely the  southern flounder and the killifish (Smith et al., 1988).  Smith et al. (1988) found that  treatments that depolarize the basolateral membrane (high K+, Ba+2) inhibit OC uptake,  while treatments that hyperpolarize the basolateral membrane (low K+) stimulate uptake.  Smith et al. (1988) also found that the addition of OCs such as TEA or darstine  (mepiperphenidol) to the bathing medium reversibly depolarizes the basolateral  membrane potential.  Two‐electrode voltage clamp studies of Xenopus laevis oocytes in  which an organic cation transporter 1 (OCT1) from the rat is expressed demonstrated  inwardly directed currents upon exposure to TEA (Busch et al., 1996). Furthermore, uptake  of radiolabeled TEA by oocytes expressing rat OCT1 is inhibited by depolarization of the  membrane potential (Grüdemann et al., 1994).  Thus data from both intact renal tissue and  from isolated protein expression studies with oocytes provide support for an electrogenic  facilitated diffusion transporter, which is dependent on membrane potential for the uptake  of OCs across the basolateral membrane.   8  Type II OCs cross the basolateral membrane due to their larger size and degree of  hydrophobicity through simple diffusion, providing an additional, potential driven pathway  for basolateral OC entry.   Some OCs may be sequestered into organelles, however the loading capacity and  trafficking of OCs by organelles is unknown (Sweet and Pritchard, 1999).    Transport across the apical membrane is driven by proton exchange maintained by a  proposed NHE (Wright and Dantzler, 2004).  Studies using isolated apical membrane  vesicles show evidence that acidification of vesicles can stimulate OC uptake (Dantzler et al.,  1991; McKinney and Kunnemann,, 1985; Ott et al., 1991). Furthermore luminal perfusion of  intact proximal tubules with an acidifying solution also supports the concept of an apical  electrogenic OC/ H+ exchanger (Dantzler et al., 1989; McKinney, 1984).  The first molecular  candidate for the apical transport protein was an organic cation/carnitine transporter  (OCTN) (Tamai et al., 1997).  However, due to the low kidney expression and low affinity of  OCTN for TEA, new candidate proteins for the apical transporter have been proposed: multi  drug and toxin extrusion (MATE) transporter 1 (Otsuka et al., 2005) and MATE2 (Masuda et  al., 2006).  These transporters exchange TEA and other OCs at the apical membrane for a  proton, and have expression profiles consistent with other renal transporters (Zhang et al.,  2007).  MDR or p‐glycoprotein transporters may transport larger or more hydrophobic  type I OCs, however their contribution to OC transport has not been quantified (Buss and  Callaghan, 2007).   An ATP‐dependent MDR mediates exit of type II OCs across the luminal membrane.  Expression of MDR in the apical membrane of the vertebrate renal proximal tubule cells  suggests that these transporters likely play a role in the secretion of at least some OCs.  Studies by Miller (1995) have shown that teleost renal proximal tubules actively secrete the   9  fluorescent anthracycline daunomycin into their lumen, and this transport could be reduced  by known p‐glycoprotein substrates such as cyclosporin A, and the known p‐glycoprotein  inhibitors verapamil and vanadate. In addition, there is evidence that the teleost renal  proximal tubules can actively secrete the fluorescent analogues of cyclosporin (Schramm et  al., 1995) and rapamycin (Miller et al., 1997).    1.6 Molecular Identification of Vertebrate Organic Cation Transporters   Organic cation transporters belong to the solute carrier superfamily 22A (SLC22A),  which also includes OCTNs and organic anion transporters (OATs) (Wright and Dantzler,  2004).  Three isoforms of OCTs have been identified in humans, rats and mice, and  orthologs of these isoforms have been identified in other species.  The first OCT to be cloned  in vertebrates (OCT1) was from a rat kidney cDNA library (Grundemann et al.,1994).  The  cDNA transcript encodes a 556‐amino acid (aa) sequence with 12 predicted trans  membrane domains (TMDs).  The predicted topology is that both the amino and carboxyl  termini of the peptide chain are located intracellularly and when inserted into the  membrane, the peptide forms a large extracellular loop between TMD1 and TMD2 and a  large intracellular loop between TMD6 and TMD7.   Since the discovery of OCT1 in rat, two  other transporters have been cloned and characterized that share identity with OCT1,  named OCT2 (Okuda et al., 1996; Gorboulev et al., 1997) and OCT3 (Kekuda et al., 1998).   Physiological studies in X. laevis oocytes with isolated OCT transporters show a large  inward current associated with high concentrations of TEA in the bath (Dresser et al.,2001).   Thus it is believed that these transporters are localized to the basolateral membrane.      Table 1.1 summarizes the tissue localization of vertebrate OCTs and OCTNs. All of  the known vertebrate OCT isoforms and orthologs exist in the kidneys and most are present   10  in the liver.  Expression of these transporters is consistent with the expression of proteins  responsible for the elimination of toxic compounds. All of the OCTs are present at the  basolateral membrane (Wright and Dantzler, 2004; Dresser et al., 2001).     1.7 Transport of Organic Cations in Insects   Although mechanisms of inorganic cation transport in insect MTs and their  regulatory control have been extensively studied and reviewed (Dow and Davies, 2001;  O’Donnell and Spring, 2000), it has not been until very recently that physiological evidence  has emerged elucidating the mechanisms underlying the transport of OCs by the MTs of  insects (Rheault and O’Donnell, 2004; Rheault et al., 2005; 2006; Bijelic and O’Donnell,  2005; Bijelic et al., 2005).  Nijhout (1975) provided the first evidence for the transport of  OCs across insect MTs from Manduca sexta.  In this study the MTs transported the cationic  dyes methyl green and methylene blue.  Subsequently MTs of R. prolixus were shown to  secrete the basic, cationic dyes methyl green and methylene blue as well (Maddrell and  Gardiner, 1976).  Tubules of the larvae of Chironomous have been shown to rapidly  concentrate the dye neutral red (Salkind, 1930), while the tubules of Blatta orientalis,  Forficula auricularia, and Carasius morosus cannot (Lison, 1938).  All historical observations  of basic dye transport by MTs were purely qualitative.  Attempts were not made in these  studies to quantify the transport of these dyes by the MTs. However, it is of interest that all  of these basic dyes contain a positively charged amine nitrogen at physiological pH and are  thus candidate substrates for the OC transport pathway.       It has been observed that, in addition to the transport of basic dyes, insect MTs also  actively secrete the plant alkaloid nicotine (Maddrell and Gardiner, 1976) and the p‐ glycoprotein substrate vinblastine (Gaertner et al., 1998).  The possibility that nicotine   11  transport in insect MTs is mediated by a p‐glycoprotein‐like mechanism has been suggested  by the observations that verapamil, a known p‐glycoprotein inhibitor, blocks the transport  of nicotine, while nicotine interferes with the transport of vinblastine by the isolated MTs  from larval M. sexta (Gaertner et al., 1998).  A recent study by Leader and O’Donnell (2005)  has shown that p‐glycoprotein may play a role in the secretion of daunorubicin by insect  MTs due to the fact that verapamil also inhibits transepithelial transport of daunorubicin. In  polarized mammalian epithelia, OCs cross the basolateral membrane through passive  diffusion or by facilitated diffusion (Wright and Dantzler, 2004).  P‐glycoprotein is  expressed only at the apical membrane where it is proposed to actively transport OCs out of  the cell (Wright and Dantzler, 2004).  Thus, p‐glycoprotein is a potential candidate for an  apical but not basolateral route of OC transport in insect MTs. Further evidence, which  suggests that p‐glycoprotein is not involved in basolateral OC uptake by insect MTs, comes  from studies using the fluorescent p‐glycoprotein substrate daunomycin on the MTs of  larval M. sexta (Gaertner and Morris, 1999).  In this study, although the MTs quickly took up  daunomycin, uptake could not be blocked by verapamil or nicotine, indicating that uptake  at the basolateral membrane does not involve a p‐glycoprotein‐like mechanism.     A number of recent studies have provided physiological evidence for the transport of  the prototypical type I OC, TEA, by insect MTs and extrarenal tissues.  Rheault and  O’Donnell (2004) used newly developed TEA ion selective microelectrodes to show that  TEA was transported from bathing medium across the MT epithelia into the lumen along  the length of the main, lower and ureter segments of the MTs.  The posterior midgut  displayed TEA secretion rates similar to the MT main segment.  The analysis of secreted  fluids showed a nearly 12‐fold increase in TEA concentration in the secreted fluid when  compared to bathing medium.  This observation combined with measurements of a positive   12  potential in lumen of MTs provides support for an active transporter mechanism (Rheault  and O’Donnell, 2004).        Tetraethylammonium is a positively charged OC at physiological pH.  Thus its  movement from the haemolymph across the basolateral membrane is opposed by the  hydrophobic lipid bilayer of the cell and as such necessitates some form of facilitated  transport.  Rheault et al. (2005) provided the first evidence for an electrogenic, carrier‐ mediated basolateral transport mechanism for OCs in insect MTs. Briefly they showed that  TEA transport was metabolically dependent, was dependent on membrane potential and  could be inhibited by the addition of a number of type I OCs (Rheault et al., 2005).   Transport of TEA across isolated MTs was saturable indicating a transcellular carrier  mediated pathway.        Pharmacological studies on D. melanogaster MTs with type I and type II OCs affected  TEA transport in different ways.  Verapamil, a type II OC, had no effect on transport of TEA,  where as cimetidine, a type I OC, significantly decreased TEA influx.  These findings led  researchers to conclude that there may be different transport pathways for type I and type  II OCs.  Transport for type I OCs thus may be carrier mediated, shown through competition  between cimetidine and TEA for transport (Rheault and O’Donnell, 2004).        In a comparative study of different insects, it was found that secretion of type I and  type II OCs may occur through separate transporter‐mediated pathways (Rheault et al.,  2006).  Of interest in this study was that blood‐feeding insects such as R. prolixus and A.  aegypti do not exhibit active transport of TEA across cells of the MTs.  The current  hypothesis is that these insects either secrete OCs in other parts of the body (i.e. the gut) or  that a life history in which plant alkaloids and pesticides were not routinely ingested did  not allow the development of OC transport proteins.  In this study the transport of the p‐  13  glycoprotein substrate, nicotine, was inhibited by verapamil, a p‐glycoprotein inhibitor in  insects such as M. sexta.  However, in previous studies, verapamil had no effects on TEA  transport.  Currently, research suggests different modes of transport for type I OCs and  other OC, plant alkaloids such as nicotine (Rheault et al., 2006).  Based on evidence  gathered surrounding the transport of OC in insects, a model for OC transport across the  MTs of D. melanogaster has been proposed and is shown in figure 1.5.      Historically, studies on the transport of OCs across insect tissues have focused on  whole body or whole tissue transport.  Researchers have yet to study insect putative OCT  genes in isolation to determine the contributions of individual proteins to overall tissue  transport of OCs.  Therefore, there exists a need for the development of an expression  system that would be suitable for the expression of isolated insect proteins for functional  studies.        1.8 Heterologous Protein Expression as a Tool to Study Organic Cation Transport  Pathways     Heterologous protein expression systems are useful tools to produce high levels of  foreign protein that can be used for both structural and functional analysis.  More  commonly used expression systems include Escherichia coli, yeast, baculovirus/insect cells,  oocytes and mammalian cells (Brondyk, 2009).  Choosing an appropriate system to express  a foreign protein depends on the proteins characteristics, the characteristics of the  expression system and the planned use of the protein for various physiological assays  (Brondyk, 2009).  Prokaryotic systems such as E. coli and yeast are generally simple and  inexpensive, which explains their wide use and appeal (Midgett and Madden, 2007).   Differences in protein glycosylation, membrane lipid composition and processing  machinery needed to fold, assemble and stabilize eukaryotic proteins make these systems   14  less than ideal for eukaryotic protein expression (Midgett and Madden, 2007, Hegedus et al.,  1999).  The use of a baculovirus is advantageous because protein production occurs in a  eukaryotic system.  Transfection of a baculovirus vector containing a foreign gene, into an  insect cell line allows large amounts of protein production and correct post translational  modifications of the protein, resulting in proper formation of the foreign proteins (Miller,  1988).  It is known that three glycosylation pathways exist in insect cells that are dissimilar  to comparable pathways in higher eukaryotes such as mammalian cells (Miller, 1997),  making insect cell lines in combination with a baculovirus vector ideal for expression of an  insect protein.  Sf9 embryonic cell lines from the Fall armyworm (Spodoptera frugiperda)  have been recently exploited to characterize a number of human and other vertebrate  proteins using a baculovirus vector (Sarkade et al., 1992, Hegedus et al., 1999, Bakos et al.,  2000, Ozvegy et al., 2001).      Baculoviruses have long been used as insect pest control agents to protect  economically important crops due to the specific nature of baculovirus to infect only insect  cells (Miller, 1997).  More recently, it has been found that baculovirus genomes could be  manipulated to express heterologous proteins at high levels, leading to the development of  baculovirus expression vector systems (Smith et al., 1983).  A widely used baculovirus for  expression research has been the alphabaculovirus Autographa californica multiple  nucleopolyhedrovirus (AcMNPV), which undergoes successful replication in Sf9, cells (Jehle  et al., 2006).  AcMNPV has a large double‐stranded circular genome with 154 open reading  frame (ORF) coding regions (Rormann, 2008).  Alphabaculoviruses, including AcMNPV, all  produce budded virus (BV) and occlusion derived virus (ODV) over the course of their  replication cycle (Jehle et al., 2006).  Occlusion derived viruses are produced embedded in a  polyhedrin protein matrix that allows the virus to survive outside of the host as occlusion   15  bodies (OB) (Rohrmann, 2008).  The virus is spread between hosts via ingestion of OB from  a contaminated food source.  The polyhedrin matrix is broken down within the midgut of  the new host, releasing the viron to infect midgut cells (Rohrmann, 2008).  Production of BV  in the latter stages of infection allows the spread of systemic infection throughout the host  (Rohrmann, 2008).  In order to use a baculovirus expression vector, the foreign gene is first  inserted into the virus and applied to an insect cell culture.  Budded virus is produced  following transfection of the cells and can be collected and subsequently used to infect  insect cells for protein production (Miller, 1997).      The baculovirus system works by exploiting the polyhedrin gene, which is under the  control of a strong late promoter, which results in high levels of polyhedrin protein  production late in the viral replication cycle (Rohrmann, 1986).  Therefore replacing the  polyhedrin ORF with a foreign gene, would result in high levels of foreign gene expression  with minimal effect on the production of BV (Smith et al., 1983, Vialard et al., 1990, Zuidema  et al., 1990).  Due to the lack of polyhedrin production following foreign gene insertion, ODV  are not produced, resulting in an inability of the virus to transmit to other insects; and  because ODV are not formed, infected cells can be identified visually under a light  microscope by the absence of OB (Smith et al., 1983).      One method for the creation of recombinant AcMNPV baculovirus is site‐specific  transposition in bacterial culture, described by Luckow et al. (1993).  Transposition  involves 1) a shuttle vector including the virus genome 2) a transfer plasmid including the  foreign gene and 3) a helper plasmid encoding a transposase enzyme to allow transposition  of the foreign gene into the virus genome.  The shuttle vector, or bacmid, includes the  AcMNPV genome with 4 modifications within the polyhedrin locus.  First a mini‐F region  was added which allowed viral replication in bacterial cells to simplify recombinant virus   16  construction.  Second, two Tn7 bacterial transposition sites were added to allow insertion  of the foreign gene from the transfer plasmid into the bacmid.  Third, a kanamycin  resistance gene was incorporated necessary for bacmid selection in bacteria on  supplemented media.  Fourth, the lacZ gene was added between the transposition target  sites, which allowed blue white screening (Sambrook and Russell, 2001) due to insertional  gene interruption.  The transfer plasmid contains a gentamicin resistance gene for selection  and a strong late polyhedrin promoter between the Tn7 transposition sites (Luckow et al.,  1993).  The combination of the bacmid, transfer plasmid and helper plasmid in bacterial E.  coli cells, allows site specific transposition of the foreign gene.  The resulting recombinant  bacmid, containing the foreign gene, was identified by kanamycin resistance, gentamicin  resistance and the white color of the colony.  The success of the baculovirus polyhedrin  promoter at expressing heterologous proteins in Sf9 cells led to the development of  numerous plasmid vectors that could be used for both transient and stable expression of a  protein in insect cell lines (Pfeifer et al., 1999; Pfeifer et al., 2001; Dai et al., 2005).  One  plasmid, p2ZOPe2, uses and immediate‐early promoter (ie2) from the Orgyia pseudotsugata  multicapsid nuclear polyhedrosis virus (OpMNPV) to transcribe heterologous cDNA  sequences in insect cells.  The plasmid is either degraded or integrated into the Sf9 genomic  DNA by intracellular processes as soon as 48 hours post transfection (hpt)(Dai et al., 2005).   This expression system thus reduces toxicity in Sf9 cells resulting from prolonged protein  accumulation.  Integration of the plasmid into the genomic DNA of the cells allows for the  selection of stably expressing cell lines through the use of an antibiotic (Dai et al., 2005).   The zeocin selectable marker under the control of an EM7 bacterial promoter and the ColE1  origin allows for selection and rapid amplification of the plasmid in E. coli.  A multiple  cloning site containing a number of restriction sites just downstream of the ie2 promoter   17  allows insertion and transcription of the foreign cDNA for expression (Hededus et al., 1998;  Hegedus et al., 1999; Theilmann and Stewart, 1992; Invitrogen InsectSelect™ System  Manual, 2010).     1.9 Research Purpose    Mechanisms of inorganic cation transport across the MTs of insects, and the  regulatory control governing the movements of these ions have been extensively studied  and reviewed (Dow and Davies, 2001; O’Donnell and Spring, 2000); however it has not been  until recently that physiological evidence has emerged describing the mechanism  underlying the transport of OCs by insect MTs (Rheault and O’Donnell, 2004; Rheault et al.,  2005, 2006; Bijelic and O’Donnell, 2005).  These studies have provided the first evidence for  the transport of the prototypical type I OC, TEA by D. melanogaster tissues. Rheault and  O’Donnell (2004), demonstrated TEA transport across the posterior midgut, as well as  across the main and lower segments of the MTs using ion‐selective microelectrodes.  In  2005, Rheault et al. provided the first evidence for an electrogenic carrier‐mediated  basolateral organic cation transport mechanism in D. melanogaster MTs.    In 1997, a sequence transcript in the genomic DNA of D. melanogaster was  discovered which showed a high degree of similarity to vertebrate OCT coding regions  (Taylor et al., 1997). The gene giving rise to this transcript has been named organic cation  transporter‐like (orct).   Further annotations of the D. melanogaster genome (Hoskins et al.,  2007) have revealed a second candidate gene orct2, which also showed high similarity to  vertebrate OCTs.   This thesis describes the cloning of the candidate OCT‐like genes orct and orct2 from  D. melanogaster for the first time.  Using phylogenetic analysis I determined the sequence   18  identities to vertebrate OCT orthologs and predicted OCT‐like orthologs from other insect  species.  Additionally this thesis describes the topology of the amino acid peptide chains of  the ORCT and ORCT2 proteins.  Furthermore, this thesis describes the mRNA expression  profiles of orct and orct2 across a number of D. melanogaster tissues and describes the  changes in expression following exposure to TEA.       Synthesis of the proteins would be needed for functional assays in order to verify the  hypothesis that these gene transcripts play a role in OC transport across D. melanogaster  tissues.  I evaluated the ability of both a baculovirus vector and a plasmid vector to express  ORCT in insect Sf9 cell lines for the purpose of future functional assays.  In addition, a  plasmid vector was used to create a polyclonal, stably expressing Sf9 cell line to be used in  future work.  Expression was assessed through western blotting following transfection with  both vector systems and following infection with collected budded virus over a series of  time points.  Results of this study will lay the groundwork for researchers to choose an  optimal expression vector for future physiological studies of ORCT and ORCT2.                         19                        Table 1.1 Tissue localization of vertebrate organic cation transporters.  Information gathered from Wright  and Dantzler (2004)1 and Dresser et al., (2001)2.  Localization profiles summarized here are not exhaustive of  the literature, and shows only the most common and highest expressing sites for a number of vertebrate  species.  Acronyms are defined as: BLM, basolateral membrane  Localization   Type   Kidney  Liver  Nervous  Gut  Muscle  Heart  Fetal   Genital  Apical  BLM  OCT1  ✓1,2  ✓1,2  ✓2  ✓1,2  ✓2    ✓2      ✓1  OCT2  ✓1,2    ✓1,2  ✓2      ✓2    ✓1  ✓1  OCT3  ✓1  ✓1  ✓1  ✓1  ✓1      ✓1    ✓1  OCTN1  ✓1          ✓1  ✓1  ✓1  ✓1    OCTN2  ✓1  ✓1  ✓1    ✓1  ✓1  ✓1                         20          Figure  1.1  Structure  of  the  insect  alimentary  and  excretory  system,  showing  branching  of  the Malpighian  tubules  from  the  junction  between  the  midgut  and  hindgut.    Reproduced  from  Maddrell  (1981)  with  permission from the Journal of Experimental Biology.             21                                                                  Figure 1.2 Physiology of inorganic cation secretion from a principle cell of the MTs of D. melanogaster.  Secretion of cations is coupled to the concentration gradient created through the action of an H+ ATPase on the  apical brush border membrane.  Reproduced from Ianowski and O’Donnell (2004) with permission from the  Journal of Experimental Biology.            Apical membrane  Basolateral membrane   22            Figure 1.3 Physiology of the secretion of inorganic anions from the stellate cells (green) of the MTs of D.  melanogaster.  Reproduced from Dow (2009) with permission from the Journal of Experimental Biology.   Schematic shows a segment of a whole MT (above) and the placement of the stellate cells and principle cells  (yellow) within the complete MT.   Abreviations on the figure are defined as follows: cGMP, cyclic guanosine  monophosphate; cAMP, cyclic adenoside monophosphate; LK, leucokinin; CRF, corticotropin‐releasing factor;  CAPA, cardioacceleratory peptide; NOS, nitric oxide synthase; NO, nitric oxide; sGC, soluble guanylate cyclase.              23              Figure 1.4 Schematic representation of organic cation transport in renal cells of vertebrates.  Reproduced  from Wright and Dantzler (2004).  The 3 OCT isoforms are shown on the blood side of the cell.  OCTN  transporters are shown on the lumen side of the cell.  Other transporters must be present in order to maintain  electrochemical gradients necessary for driving OC transport.  A Na+/K+ ATPase at the basolateral membrane  moves Na+ out of the cell creating a driving force for the exchange of Na+ for OCs through OCTNs at the apical  membrane.  An NHE (Na+/H+ exchanger) at the apical membrane establishes a proton gradient that is used to  drive the exchange of OCs for H+ through apical transporters. Reproduced with permission from Copyright  Clearance Inc.              24                Figure 1.5 Schematic of the proposed transport mechanism for organic cations in D. melanogaster.  Transport  of type I OCs from the haemolymph across the cell membrane is mediated through a carrier protein.  Type I  OCs are transported across the cell membrane to the lumen through a, OC/ H+ exchanger; where the proton  gradient is maintained by a separate NHE (not shown).  Transport of type II OCs from the haemolymph across  the membrane is through simple diffusion.  Transport of type II OC across the membrane into the lumen is  mediated through an MDR or p‐glycoprotein transporter.                         25  Chapter 2  Cloning and mRNA Expression of orct and orct2    2.1 Synopsis     Organic cations are a common group of molecules that include endogenous  metabolites and xenobiotics that must be effectively detoxified or eliminated in order for  organisms to survive.  The midgut and MTs of insects have been shown to play a role in the  excretion of OCs (Rheault and O’Donnell, 2004; Rheault et al., 2005; Rheault et al., 2006).   This chapter describes the cloning of two putative organic cation‐like transporters, orct and  orct2, from the fruit fly D. melanogaster.  Sequence analysis of these clones supports the  grouping of these genes into the major facilitator superfamily (MFS) and into the 2.A.1.19  group of electrochemical potential driven OCTs (Saier, 2000).  Phylogenetic analysis of  ORCT and ORCT2 sequences with insect and vertebrate orthologs indicated that two  distinct insect clades exist that are equally divergent from vertebrate OC‐like transporters.   Relative mRNA expression of orct and orct2 following exposure to a prototypical type I OC,  TEA, was assessed in a number of D. melanogaster tissues.  Transcripts of orct and orct2  were detected in all tissues tested, with orct having high constitutive expression in MTs.   Expression increased following exposure to TEA over 15 generations in all tissues tested for  orct and in the midgut for orct2.  The expression of orct and orct2 in the MTs and midgut,  the main excretory organs of D. melanogaster and tissues previously shown to transport  TEA (Rheault et al., 2005), indicated that these transporters may play a role in the epithelial  transport and elimination of OCs from adult D. melanogaster.                    26  2.2 Materials and Methods      2.2.1 Insect Rearing    Oregon R strain D. melanogaster Meigen were raised on standard artificial fly media  and maintained at 20‐23°C in polystyrene shell culture vials (25x95 mm; Fisher Scientific,  Nepean, ON, Canada).  The artificial media was prepared as described by Chahine and  O’Donnell (2009).  Briefly two solutions were prepared separately.  Solution A contained 50  g sucrose, 9 g agar, 4 g KNaC4H4O6H2O, 0.5 g KH2PO4, 0.25 g NaCl, 0.25 g MgCl26H2O, and  0.25 g Fe2(SO4)3 in 400 mL of Milli‐Q® filtered reverse osmosis water (Millipore, Billerica,  MA, USA).  Solution B consisted of 25 g of dry active yeast in 100 mL of Milli‐Q® water  (Millipore).  The two solutions were autoclaved separately for 45 minutes, and then  combined and stirred.  After cooling to 50°C, 5 mL of an acid mixture (11 parts Milli‐Q®  water, 10 parts propionic acid and 1 part o‐phosphoric acid) and 3.73 mL of a 10% (w/v)  mixture of Tegosept (methyl‐4‐hydroxybenzoate) in ethanol were added to the mixture.   For experiments where larval D. melanogaster were exposed to TEA in the rearing media,  TEA was added following the addition of the acid mixture to final concentrations of 80  mmol L‐1 or 150 mmol L‐1.  The final solution is poured into D. melanogaster shell vials and  agitated by hand until set.  Concentrations for TEA‐enriched media exposure were  determined from larval LC50 data for TEA collected by Bijelic et al. (2005).  Media was  stored at 4°C for up to 30 days.  Animals 4‐7 days post emergence were used in all  experiments.     2.2.2 RNA Extraction and Reverse Transcription   Tissues for 80 midgut, 200 Malpighian tubules, 50 ovary and 8 whole flies were  harvested and pooled three separate times from adult D. melanogaster to make three   27  biological replicates.  Tissues harvested were collected from flies raised on standard  artificial media, 80 mmol L‐1 TEA enriched media or 150 mmol L‐1 TEA enriched media over  1 and 15 generations.  The number of individuals to make each pooled sample as well as  appropriate generation time for exposure experiments was determined previously by  Chahine and O’Donnell (2009, 2010).  RNA was extracted as described by Nawata and  Wood (2008) and Chahine and O’Donnell (2009).   Tissues were collected under nuclease‐ free D. melanogaster saline in a nuclease free work area and immediately transferred into  TRIzol® Reagent (Invitrogen, Burlington, ON) for total RNA extraction. To prepare D.  melanogaster nuclease‐free saline for tissue collection, 500mL of Milli‐Q® water was treated  with 0.1% DEPC (diethylpyrocarbonate) for 2 hours at 37°C.  The water was then  autoclaved at 121°C for 30 minutes to remove the DEPC and saline components were added  after cooling.  The saline contained: 118 mmol L‐1 NaCl, 20 mmol L‐1 KCl, 10.2 mmol L‐1  NaHCO3, 8.5 mmol L‐1 MgCl26H2O, 2.0 mmol L‐1 CaCl22H2O, 7.87 mmol L‐1 HEPES sodium  salt and 3.78 mmol L‐1 NaH2PO42H2O.  RNA was isolated by adding 200 μL of chloroform,  vortexing to mix, incubating for 2 minutes at room temperature and extracted by  centrifugation at 12 000xg for 15 minutes at 4°C.  The aqueous layer was treated with 500  μL of isopropanol and 1 μL of glycogen (20 mg mL‐1) to precipitate the RNA with  centrifugation at 12 000xg for 15 minutes at 4°C.  A single wash was performed with 70%  ethanol and the dried RNA pellet was resuspended in 10μL of water from Milli‐Q® water  treated with 0.1% DEPC.  RNA was treated with Ambion® Turbo DNA‐freeTM (Invitrogen)  according to the manufacturers protocols to remove any genomic DNA contamination.  RNA  purity and quantity was assessed using a BioPhotometer Plus with a Hellma® TrayCell  (Eppendorf, Hamburg, Germany).  Typical RNA yields ranged from 227.3 ng μL‐1 from  Malpighian tubules to 3914.2 ng μL‐1 from ovary with an A260/280 purity measurement   28  from 1.8‐2.2 for all samples.  Each RNA sample was then electrophoresed on 1% agarose gel  stained with SYBR® Safe (Invitrogen) immediately following extraction to check RNA  quality.  Only RNA samples with a clear 18s ribosomal subunit RNA band, and lacking  visible signs of genomic contamination were used for subsequent cDNA constructions.   Invertebrate 28s ribosomal subunit RNA contains a cryptic nick that results in cleavage of  this 28s subunit   and thus this band may be absent when visualized through agarose gel  electrophoresis.  A sample RNA non‐denaturing agarose gel is shown in Figure 2.1.  cDNA  was immediately synthesized from 1 μg of RNA using the Improm II™ Reverse  Transcription System (Promega, Madison, WI)  with oligo(dT) primers.  cDNA construction  was tested through polymerase chain reaction (PCR) with GoTaq® Green Master Mix  (Promega) according to manufacturers instructions with primers for ribosomal protein 49  (rp49).  cDNA samples were stored at ‐20°C.     2.2.3 Primer Design     Previously predicted organic cation transporter‐like gene sequences from D.  melanogaster  (Taylor et al., 1997; Hoskins et al., 2007) were located in the National Center  for Biotechnology Information (NCBI) GenBank database (www.ncbi.nlm.nih.gov).   Cloning  primers (Table 2.1) were designed at the 5’ and 3’ ends of the predicted sequences so that  the predicted amplicons would contain the complete ORFs of orct (GenBank ascession  number: NM_079755) and orct2 (GenBank ascession number: NM_142981).  Primers were  designed for a rp49 (GenBank ascession number: Y13939.1) as a positive control gene to  test cDNA construction and amplification (5’‐ AGCATACAGGCCCAAGATCGTGAA/AATCTCCTTGCGCTTCTTGGAGGA‐5’).  Primers were designed and  analyzed using Integrated DNA Technologies [IDT (www.idtdna.com)] PrimerQuest©   29  Software (2002), which incorporates the Primer3© Software (Rozen and Skaletsky, 1998).   Specificity of primers was accessed using Basic Local Alignment Search Tool (BLAST)  (www.ncbi.nlm.nih.gov/BLAST; Altschul et al., 1990).  In addition, all PCR amplicons  were  sequenced by the Nucleic Acid Protein Service (NAPS) Unit, Michael Smith Laboratories at  the University of British Columbia (Vancouver, Canada) to ensure primer specificity and  correct target amplification.  Primers for quantitative real‐time PCR (qPCR) were designed  to span intron/exon junctions where possible using NCBI Primer‐BLAST  (www.ncbi.nml.nih.gov/tools/primer‐blast), which employs Primer3© Software (Rozen and  Skaletsky, 2000) and BLAST (www.ncbi.nlm.nih.gov/BLAST; Altschul et al., 1990).  Primers  were designed for two genes of interest (orct and orct2) and for three reference genes;  rp49,  actin (actin 42A), a structural protein, and glyceraldehyde‐3 dehydrogenase (gapdh­ 1), a glycolytic enzyme (Table 2).  Primers were selected in order to minimized secondary  structure using Oligo Analyzer 3.1®  (www.idtdna.com/Scitools/Applications/Oligoanalyzer), which includes secondary  structure analysis by UNAFold (Zuker, 2003).  Primers were designed to have a length  between 18‐24 base pairs with an annealing temperature (Tm) from 52 ‐ 60°C.  Primer pair  Tm mismatch between forward and reverse primers had to be <2°C.  A GC% content of 40‐ 70% was accepted and primers with a GC clamp in the last 3 bases of the primer were  preferred but not required.  Primer self‐dimers and primer pair hetero‐dimers were  required to have a Gibbs free energy (ΔG) of association ≤‐6.0 kcal. mole‐1.  All primer sets  were designed to amplify a product of 70 – 250 base pairs.  The Tm of any secondary  structure predicted by UNAFold (Zuker, 2003) for primers or amplicons, had to be >10°C  lower than that primer sets predicted Tm to be used during amplification for the primers to  be accepted.     30  2.2.4 Primer Optimization  Primers sets were tested to confirm amplicon size using a heterogeneous mixed  whole body cDNA template from flies reared on non‐enriched, control media using  standard PCR.  Cycling was performed on a C1000 Thermal Cycler (Bio‐Rad, Hercules CA,  USA) with the following PCR cycling parameters; an initial denaturing step of 95°C for 2  minutes, followed by 35 cycles of denaturing at 95°C for 30 s, an annealing step across a  temperature gradient at 55°C ‐ 63°C for 30 s, and an elongation step at 72°C for 60 s;  followed by a final elongation at 72°C for 5 minutes.  Each PCR reaction contained 12.5μL of  GoTaq® Green Master Mix, 2 μL of cDNA, 1 μL each of 100 μmol L‐1 forward and 100 μmol L‐ 1 reverse primer and nuclease free water in a 25 μL reaction volume.  Amplified products  were verified for size by visualizing products on a 1.5% non‐denaturing agarose gel stained  with SYBR® Safe.  All qPCR primer sets were optimized for primer concentration and annealing  temperature using SsoFastTM EvaGreen® Supermix (Bio‐Rad).  Whole body cDNA from flies  raised on control media was used as a template at a relative concentration of 10‐0.5.  Whole  body cDNA was used to represent a heterogeneous cDNA sample, which would include all  tissues of interest.  qPCR was performed on a CFX‐96™ Real‐Time PCR Detection System  (Bio‐Rad).  The cycling protocol consisted of an initial denaturing step at 95°C for 30 s  followed by 39 cycles of denaturing at 95°C for 5 s; and an annealing step over a  temperature gradient of 50°C to 70°C for 5 s; for a total of 40 cycles.   Following 40 cycles of  amplification, a MELT curve analysis was done by incrementally increasing the block  temperature from 65‐95°C in steps of 0.5°C for 5 s. A sample MELT curve for orct primer  optimization is shown in Figure 2.2.  A single peak at 83.5°C indicated a single amplicon for  orct, with all other peaks indicating primer dimer or non specific amplification falling below   31  detection threshold.  Eight different temperatures (50°C, 51.3°C, 53.9°C, 57.8°C, 62.6°C,  66.6°C, 68.8°C, 70°C) were tested for each primer set.  Optimal primer concentrations for  each primer set over each of the 8 temperatures were evaluated using a primer mix so that  each individual primer was used at a final concentration of 400 nmol L‐1, 500 nmol L‐1 or  600 nmol L‐1 in the reaction.  Two technical replicates were performed for each  concentration (Figure 2.3).  No template controls (NTCs) were used to confirm that reaction  components are free of contaminating DNA or fluorescent products, and to ensure that the  observed Cq (quantification cycle) values are not the result of primer dimerization.   Subsequently, sample wells for each primer and the NTCs were run on a 1.5% non‐ denaturing agarose gel stained with SYBR® Safe to check amplicon size and for significant  primer dimer.  A single annealing temperature was chosen to use in all subsequent  reactions.  The annealing temperature that was chosen resulted in a Cq of 20‐35 for sample  wells, Cq for the NTCs > 37, and a MELT curve indicating amplification of a single product  for each primer set (Figure 2.4).  Primer efficiencies were evaluated over a range of either  5‐fold or 10‐fold serial dilutions of a heterogeneous mixed whole body cDNA template  collected from adults raised on control media.  The dilution series is created such that it  covers a wide dynamic range covering at least 3 orders of magnitude.  This allows proper  calculation of the linear phase of the calibration curve to establish efficiency of the primers.   Primer efficiency is calculated as:   Efficiency = 10‐1/slope ‐1     Eq. 2.1  Where the slope is calculated as the Cq divided by the logarithm of the  concentration.  Hence the theoretical ideal efficiency where the amount of product doubles  with each additional cycle would be 1.00 or 100% (Bustin et al., 2009).  Three technical  replicates were used for each template concentration in order to allow us to assess for   32  experimental pipetting errors (Figure 2.5).  The reaction was cycled using the following  parameters: a denaturing step of 95°C for 5 s and a combined annealing and elongation step  of 58°C for 5 s.  This protocol was repeated for 39 cycles for a total of 40 complete cycles  followed by a standard MELT curve as described in the preceding paragraph.  Cycling  parameters were identical for each primer set evaluated.  qPCR reactions were performed  at a constant volume of 20 μL. Each reaction contained: 2 μL of cDNA template, 0.2 μL of  primer mix (50 μmol L‐1), 10.0 μL of SsoFastTM EvaGreen® Supermix and 7.8 μL of nuclease  free water.  NTCs were performed for reasons explained above; in addition, no reverse  transcription (NRT) controls were used to test for genomic DNA contamination of the  samples.  NRT controls are prepared at the same time as the cDNA samples and were stored  at ‐20°C; these reactions contain RNA samples that have not undergone reverse  transcription.  NRTs were considered acceptable if the observed Cq value was >5 cycles  higher than the Cq values observed in experimental samples.  Statistical analysis of  efficiency curves was performed after quality analysis and manual well exclusion using CFX  Manager™ Software (Bio‐Rad).  Primer pairs with efficiencies between 90% and 110%, a  slope ≈ ‐3.3 ±0.2, and an R‐squared value ≥ 0.98 were accepted and used in subsequent  analysis (Bustin et al., 2009) (Figure 2.6).      2.2.5 Cloning of Full Length cDNA Encoding orct and orct2    Amplification on whole body cDNA using Easy‐A™ High‐Fidelity PCR Cloning Enzyme  & Master Mix (Agilent; Santa Clara, CA, USA) was performed with terminal primers for orct   (5’‐ATGGGCTACGACGACGTCATC /TTAGCCGGACTGTCCGTTCAGCATTC‐5’) and orct2 (5’‐ ATGGGCTACGATGAGGCCATCATCCATCTG/ TTACTTGTGGCCATTGGCTATGGTTGATCC‐5’) to obtain the full  length amplicons containing the complete ORFs.   PCR was performed on a C1000™ Thermal   33  Cycler with the following parameters: an initial denaturing at 95°C for 2 min, followed by  30 cycles of denaturing at 95°C for 40 s, annealing at 60°C (orct) or 65°C (orct2) for 30 s and  elongation at 72°C for 2 minutes, and ending with a final elongation of 72°C for 7 minutes  for a total of 31 cycles.  Each PCR reaction contained reagents according to manufacture  instructions in a 50 μL volume with 2 μmol L‐1 each of forward and reverse primers and 100  ng of template.  Products were purified on a 1% agarose gel stained with SYBR® Safe.   Products of interest were excised from the gel and purified using Wizard® SV Gel and PCR  Cleanup system (Promega).  Purified products were ligated using T4 DNA ligase (Promega)  into pGEM®‐T Easy Vector System (Promega) using a 3:1 insert to vector ratio corrected for  genomic size.  Resulting constructs were transformed into chemically competent JM109 E.  coli cells (Promega) according to manufactures protocols.  Transformed cells were spread  on Luria‐Bertani  (LB) agar plates supplemented with 100μg mL‐1 ampicillin, and previously  spread with 40 μL 5‐bromo‐4‐chloro‐3‐indolyl‐beta‐D‐galactopyranoside (X‐gal; 40 mg mL‐ 1) and 100 μL isopropyl β‐D‐1‐thiogalactopyranoside (IPTG; 0.2 M).  Plates were incubated  at 37°C overnight in an inverted position.  LB agar was prepared according to Sambrook  and Russell (2001).  Briefly, 10 g molecular grade tryptone, 5 g yeast extract and 10 g NaCl  were added to 1000 mL Milli‐Q® water and the pH was brought to 7.0 using HCl and NaOH.   For liquid LB media, the solution was then autoclaved for 20 minutes. To create solid media  7 g of agar was added prior to the autoclaving step.  Once cooled to 50°C, antibiotics were  added for selection and plates were poured to set.  Four single white colonies for each  construct were selected by blue white screening and used to inoculate 5 mL of liquid LB  media supplemented with 100 μg mL‐1 ampicillin. Cultures were incubated at 37°C with  shaking (170 rpm) until an optical density (OD600) of 2.0‐4.0 was achieved; determined  using a BioPhotometer Plus with a Hellma® TrayCell.  Plasmids were purified from single   34  isolate cultures using the PureYieldTM Plasmid Mini Prep System (Promega) and quantified.   Typical yields ranged from 427.1 ng μL‐1 to 876.2 ng μL‐1 with an A260/A280 purity  measurement of 1.85‐1.89.   Plasmids were digested with EcoR1 (New England Biolabs Ltd.,  Pickering ON) according to manufacturers instructions for a 10 μL reaction volume, and  were visualized on a 1% agarose gel to confirm correct insert size (data not shown).   Plasmids containing ligated products were sent for sequencing using a combination of T7,  SP6 and gene specific nested primers (Table 2.3). All amplified products were sequenced  for 5 times coverage at NAPS (Vancouver, BC, Canada).      2.2.6 orct and orct2 Sequence Analysis      Sequencing results for orct and orct2 were compiled using Geneious™ Pro (v5.0.4)  (Drummond et al., 2011) to produce a single contiguous consensus sequence from the 5  replicate sequencing reads using a 75% similarity threshold.  Translation of the nucleotide  sequences was done using Geneious™ Pro (Drummond et al., 2011) and the presence of  each genes complete open reading frame was confirmed through Geneious™ Pro  (Drummond et al., 2011) pairwise nucleotide global alignment with free end gaps to the  predicted sequences of orct (Taylor et al., 1997) and orct2 (Hoskins et al., 2007), using a  65% similarity (5.0/‐4.0) cost matrix with a gap opening penalty of 12 and gap extension  penalty of 3.  Percent shared identity between representative OCT orthologs, from  vertebrate and invertebrate species and orct and orct2, and identity between predicted and  cloned sequences of orct and orct2, were determined using pairwise Geneious™ Pro  (Drummond et al., 2011) alignments of amino acid sequences with a Blosum62 cost matrix  with a gap opening penalty of 12 and gap extension penalty of 3 in Geneious™ Pro  (Drummond et al., 2011).     35  The predicted molecular mass of ORCT and ORCT2 was calculated using the  Compute pI/Mw Tool (Gasteiger et al., 2005).  Secondary structures were predicted using  hydrophobicity analysis with TmPred (Hofmann and Stoffel, 1993) with final graphical  output by Microsoft® PowerPoint® 2008 for Mac (v12.2.9).  Alignments of TMDs using  results from each genes hydrophobicity analysis with TmPred (Hofmann and Stoffel, 1993)  were created using Microsoft® Excel® 2007 for Mac (v12.3) and were compared to multiple  amino acid alignments containing OCT orthologs created in Geneious™ Pro (Drummond et  al., 2011).  Potential protein family domains were predicted using the Simple Modular  Architecture Research Tool [SMART (Schultz et al., 1998)] and BLAST (Altschul et al., 1990).   Phosphorylation and glycosylation sites were predicted using PROSITE (Sigrist et al., 2010)  and N‐myristolation sites were predicted with NMT‐The MYR Predictor (Bohr‐Gasse, 2007).    2.2.7 Phylogeny of Organic Cation Transporters     Representative amino acid sequences from the major facilitator superfamily (OCTs,  OCTNs, insect OCT‐like transporters) were retrieved from GenBank database using BLAST  (Altschul et al., 1990) with orct and orct2 as query sequences (Table 2.4).  Sequences with a  similarity threshold (e‐value) of  < 0.001 were included in the alignment.  The initial  alignment was created using Geneious™ Pro (Drummond et al., 2011) with parameters for a  Geneious™ Pro (Drummond et al., 2011) alignment as described in the previous section.  An  unrooted, neighbor‐joining tree was generated with the Geneious™ Tree Builder  (Drummond et al., 2011) using a Jukes‐Cantor distance model.  Threshold was set to 75%  and the alignment was bootstrapped over 10 000 iterations.  Final graphical output was  generated using Geneious™ Pro (Drummond et al., 2011) and edited in Microsoft®  PowerPoint® 2008 for Mac (v12.2.9).   36  2.2.8 Quantitative Real­Time Polymerase Chain Reaction     qPCR was performed on cDNA collected from whole body, midgut, MTs and ovary  tissues collected from 4‐7 day old adult D. melanogaster.  Flies were raised on control media  or media enriched with either 80 mmol L‐1 or 150 mmol L‐1 of TEA.  Tissues were collected  following 1 and 15 generations of exposure.  Reactions were performed in 96 well low  profile plates using the CFX96TM Real‐Time PCR Detection System with the following cycling  conditions: 30 s activation at 95°C, followed by 40 cycles of 5 s denaturation at 95°C and 5 s  annealing/extension at 58°C followed by a standard MELT curve analysis (described in  2.2.4).  Each experimental 20 μL reaction contained 10 μL of SsofastTM EvaGreen®  Supermix, 2 μL of 10x dilution of cDNA and 500 nmol L‐1 of forward and reverse primer in  nuclease‐free water.  Sample wells were visualized on a 1% agarose gel stained with SYBR®  Safe to ensure that only a single amplified product was present with no significant primer  dimer.  Each qPCR experiment was conducted on 3 biological replicates of D. melanogaster  and performed with 2 technical replicates.  In addition to experimental samples, a single  NTC for each gene was run on each plate and a single NRT for each sample was tested once  with each primer set to test for primer dimerization and genomic contamination  respectively.  Observed Cq values for NRT and NTC controls were held to quality quidelines  outlined previously (Section 2.2.4) and in the Bio‐Rad CFX™ Manager Software Handbook  (Bio‐Rad).   Inter run calibration with a heterogeneous whole body sample was performed on  each plate (Vermeulen et al., 2009) for each primer set (Hellemans et al., 2007) to  normalize for variation between different plates.  Plates were designed to follow sample  maximization analysis (Hellemans et al., 2007), which allowed for statistically relevant   37  analysis of the expression of a single gene across sample types and experimental conditions  (Figure 2.8).    Expression of three reference genes was tested and the stability of each of these  genes across tissues and experimental conditions was analyzed using GeNormPLUS  (Biogazelle, Ghent University, Belgium).  Reference genes were first ranked according to  their stability, expressed as GeNorm M‐values, and then a GeNorm V analysis was  conducted to determine the optimal number of reference genes to be used in subsequent  analysis (Hellemans et al., 2007).  M‐values of >0.5 and <1.0 were accepted for reference  genes across heterogeneous samples.  GeNorm V output was generated by a comparison of  M‐values between reference gene (n) and gene (n+1) beginning with the most stable  reference gene and ending with the least stable.  As convention, the benefit of using  additional reference targets (n+1) is limited when Vn/n+1 < 0.15 (Hellemans et al., 2007);  this yields the optimal number of reference targets to use.    qPCR analysis was conducted using multiple reference genes (gapdh­1 and rp49) for  normalization, determined by the GeNorm analysis output (see Appendix 1 for additional  information on normalization using multiple reference genes). Analysis of qPCR data was  done using CFX™ Manager Software which employs the Hellemans et al. (2007) method of  data normalization and allows proper error propagation through inter run calibration.     2.2.9 Data Analysis      To determine if differences in relative mRNA expression were significantly different  two successive criteria had to be met.  First, relative fold differences between mean  expression values had to be > than 2‐fold (Bubner, Gase and Baldwin, 2004).  Second, fold  differences in expression had to be determined to be mathematically significant by an   38  applied statistical test.  Final statistical analysis was performed using Graphpad PrismTM  (v5) (www.graphpad.com) by one‐way analysis of variance (ANOVA) followed by Dunnett’s  multiple comparison post‐hoc test to analyze tissue distribution relative to whole body   An  Unpaired Student’s t­test was used to compare mRNA expression of control tissues at 1 and  15 generations.  Two‐way ANOVA with a Bonferroni post‐hoc test was used to assess the  effect of TEA exposure and generation time in individual tissues and one‐way ANOVA with a  Dunnett’s multiple comparison test was conducted to assess effect of TEA exposure within  each generation.  Data was expressed as mean ± standard error of the mean (SEM) with a  p<0.05 considered significant.  For direct comparison of the relative expression of each  gene of interest within a certain tissue, data was normalized to the gene with the lowest  expression value.  Means were divided to yield the normalized mean.  Error was normalized  by taking the square root of the sum of squares of the fractional SEM.   Ex. Calculate total error (dX) when normalized value (X) = A/B  dX/X = sqrt((dA/A)2 + (dB/B)2)      Eq. 2.5                       39  2.3 Results  2.3.1 Sequence and Structural Features  The cloned orct cDNA consisted of 1647 nucleotides and contained an open reading  frame encoding a 548‐amino acid (aa) residue protein that was 99.7% similar to the  predicted protein (GenBank accession number: NM_079755).  A comparison of the cloned  orct cDNA to the predicted sequence showed 2 single nucleotide transitions at 438 and  1636 from AC that corresponded to amino acid substitutions (Table 2.5).  The  substitution at 146 fell within TMD2 where as the substitution at 546 (KQ) was within  the intracellular carboxyl end.  A fully annotated sequence for cloned orct cDNA is shown in  Figure 2.9.  Analysis via SMART (Schultz et al., 1998) and BLAST (Altschul et al., 1990),  indicated that domains in the orct amino acid sequence were consistent with members of  the MFS.  The predicted molecular mass of the protein was 61 kDa (Compute pI/Mw Tool;  Gasteiger et al., 2005).  Hydrophobicity analysis using TmPred (Hoffman and Stoffel, 1993)  indicated the protein possessed 12 putative TMDs each with 21‐25 aa residues (Figure 2.9).   The secondary structure of ORCT was modeled to human OCT orthologs to give a predicted  cytoplasmic amino terminus (19aa) and carboxyl terminus (45aa).  The model predicted a  large extracellular loop (84aa) between TMD1 and TMD2 consistent with human OCT  orthologs (Dresser et al., 2001; Wright and Dantzler, 2004), which contained 4 putative N‐ linked glycosylation sites (Nx(T/S)x) at positions 55, 67, 89 and 97.  The predicted protein  also contained a large intracellular loop (72aa) between TMD6 and TMD7, and a putative  protein kinase C‐dependent (PKC) phosphorylation site (SAR‐267) and a cAMP dependent  protein kinase (PKA) phosphorylation site (RRKT‐333).  Additional PKC phosphorylation  sites were predicted at 152 (SDK), 213 (SYR), as well as an additional PKA phosphorylation  site at 157 (RKPT).    40    The cloned cDNA of orct2 consisted of 1701 nucleotides encoding a 567 aa residue  protein, which was 99.6% similar to its predicted sequence (GenBank accession number:  NM_142981).  Multiple single nucleotide polymorphisms were found between the predicted  orct2 sequences and the cloned cDNA (Table 2.6).  Of these substitutions, only 2 caused  amino acid transitions at residue 58 (SI), which lies within a predicted N‐linked  glycosylation site, and at residue 60 (DE).  Full annotation of the cloned orct2 cDNA is  shown in Figure 2.10.  Similar to orct, SMART (Schultz et al., 1998) and BLAST (Altschul et  al., 1990) analysis of orct2 showed that domains of the sequence are consistent with other  members of the MFS transporters.  The predicted molecular mass was 63.2 kDa (Compute  pI/Mw Tool; Gasteiger et al., 2005).  Hydrophobicity analysis with TmPred (Hoffman and  Stoffel, 1993) indicated that the protein possessed the characteristic 12 TMDs with an N‐ amino terminus (18aa) and carboxyl terminus (58aa) on the cytoplasmic side of the  membrane (Figure 2.11).  The model predicted a characteristic extracellular loop (84aa)  between TMD1 and TMD2 as well as a large intracellular loop (81aa) between TMD6 and  TMD7.  ORCT2 has 5 total predicted N‐linked glycosylation sites (Nx(T/S)x), 4 in the  extracellular loop between TMD1 and TMD2 (sites 55, 67, 89 and 97) and an additional site  at 364 between TMD7 and TMD8.  PKC phosphorylation sites were predicted at 152 (SDK)  and 267 (SAR) as well as a PKA phosphorylation site at 341 (RRKT).      Figure 2.12 shows an alignment of ORCT and ORCT2, and candidate vertebrate OCT  orthologs, with a number of conserved domains highlighted.  TMDs were conserved  between ORCT, ORCT2 and vertebrate orthologs, with an additional TMD predicted for  human FLIPT1 (Figure 2.13).  The first conserved 13 residue region was found in ORCT and  ORCT2 between TMD2 and TMD3 with the sequence GQ‐(ML)‐SDK‐(LY)‐GRKP‐(TI)‐(FL)  and is comparable to the sequence found in vertebrates in the form G‐(RKPATY)‐L‐(GAS)‐  41  (DN)‐(RK)‐(FY)‐G‐G‐(RK)‐(RKP)‐(LIVGST)‐(LIM) (Wright and Dantzler, 2004).  An 8‐ residue domain was found just upstream of TMD2 with the sequence VTEWNLVC.  This  sequence is identifiable in 9 orthologs of OCT‐like vertebrate transporters with the  sequence STIVTEW‐(DN)‐LVC (Schomig et al., 1998).  Variations in the sequence included a  tryptophan (W) in OCTNs rather than a phenylalanine (F) in OCTs at residue 7 and a serine  (D) at residue 2 in OCT1 and OCT2 rather than the threonine (T) present in other OCT and  OCTN orthologs.  Sequences of EQFPT following TMD10 and M‐(PL)‐ETI after TMD12 were  found to be similar to signature sequences for vertebrate orthologs identified by Schomig et  al., (1998).    Figure 2.14 displays an alignment with a number of insect OCT‐like orthologs, which  shared conserved domains with vertebrate OCT sequences and to each other. All insect  species used in this study had peptide sequences with 10‐12 predicted TMDs in conserved  areas, with the same characteristic intracellular and extracellular loops as the vertebrate  OCTs (Figure 2.15).  Insect peptide chains ranged in length from 512‐aa (Tribolium  castaneum) to 570‐aa (Anopheles gambiae).  In addition to conserved signature sequences  between insect and vertebrate species, there were a number of domains seemingly  conserved in only insect species (excluding A. gambiae MFS).  These domains included: a  12‐aa sequence within TMD4, (AS)(TS)‐TSG‐(VL)(FY)‐L‐(VA)‐AYV; a 6‐aa sequence within  TMD6,  (ILV)‐A‐(ILV)‐T‐(ILV)‐P; a 8‐aa sequence just following TMD6, IPES‐(APVS)‐RWL; a  6‐aa long sequence within TMD7, Y‐(VY)‐GLS‐(WY); a 5‐aa sequence within TMD10, IT‐ (AS)‐SY; a 9‐aa sequence between TMD10 and TMD11, EQFPTV‐(VI)‐RN; and a 7‐aa  sequence within TMD12, SL‐(LV)‐LPET.  These proposed insect orthologs signature  domains, taken with the conserved domains between insect and vertebrate species   42  indicates a higher degree of similarity between insect sequences as compared to vertebrate  OCT orthologs.     2.3.2 Alignments and Phylogenetic Relationships   ORCT has the highest pairwise identity (72.4%) with the other D. melanogaster  (Order: Diptera) sequence ORCT2 (Table 2.7).  Similar high identity was shared between  another dipteran, Culex quinquefasciatus (southern house mosquito) and ORCT (63.3%) and  ORCT2 (60.7%).  Insect sequences from the coleopteran T. castaneum (red flour beetle) had  57.6% identity with ORCT and 53.6% identity with ORCT2, and the hymenopteran Apis  mellifera (western honey bee) had 56.5% identity to ORCT and 51.8% identity to ORCT2.  A.  gambiae (African malaria mosquito), another dipteran, and close Culex relative (Family:  Culicidae) had the lowest shared identity with predicted insect proteins (35.9% to ORCT,  33.1% to ORCT2, 29.1% A. mellifera MFS).  Similarity between ORCT and vertebrate  orthologs ranged from 35.6% (human FLIPT1) to 39.4% (human OCT3); with similarity for  ORCT2 and vertebrate orthologs ranging from 30.4% (human FLIPT1) to 33.6% (human  OCT3).  In summary, ORCT and ORCT2 had higher similarity with other insect transporters  with the exception of A. gambiae.  A. gambiae does not show high similarity to other insect  or vertebrate species, indicating this predicted sequence might represent a distinct  transporter type unrelated to ORCT, ORCT2 or vertebrate OCT orthologs.    In a phylogenetic analysis, ORCT and ORCT2 were compared to putative MFS  transporters from insects and candidate OCT‐like transporters from vertebrates (Figure  2.16).  36 sequences were aligned including 9 sequences from insects.  The analysis  revealed that insect sequences fell into two distinct clades with A. gambiae and the  hymenoptera Camponotus floridanus (Florida carpenter ant) separate from the other insect   43  MFS putative transporters.  ORCT and ORCT2 are equally divergent from OCT1, OCT2, OCT3  and OCTN transporters (branch length 0.5) and are more distantly related to the human  FLIPT (branch length 0.56 and 0.62) and A. gambiae MFS (branch length 0.65) transporters.   A distinct clade  of insect OCT‐like transporters separate from vertebrate orthologs might  suggest  a early branching of this transporter family during its evolution.      2.3.3 Gene Expression Analysis of orct and orct2 Using Quantitative Real­Time  Polymerase Chain Reaction       The stability of the reference genes gapdh­1, rp49, and actin 42A were assessed using  GeNormPLUS (Biogazelle) analysis software.  The results of this analysis indicated that M‐ values for stability of the reference genes were higher than the theoretical optimal value for  heterogeneous samples (M < 1) (Hellemans et al., 2007), with actin 42A being the least  stable reference gene with a value of 1.76 (Figure 2.17.A).   Based on the GeNorm V analysis,  the variability between subsequently tested reference targets (based on the n and n+1 least  variable reference targets) was high (GeNorm V >0.15).  GeNorm V analysis thus indicated  that the ideal number of reference genes to use for this experiment was two (Figure 2.17.B).   Therefore all subsequent qPCR data analysis and normalization was done using gapdh­1  and rp49 as the reference targets.    Figure 2.18 shows tissue distribution analysis of mRNA of orct and orct2 in whole  body, midgut, MTs and ovary from flies raised on control media.  The relative amount of  mRNA in each tissue is shown normalized to each genes whole body mRNA expression.  Detectable amounts of mRNA were present in each of the tissues tested for each gene.   mRNA expression for orct was significantly higher in the MTs (Figure 2.18.A), suggesting  high constitutive expression of orct in the insect renal tissue.  In contrast, mRNA expression   44  of orct2 was significantly lower in the MTs and ovary compared to whole body expression  (Figure 2.18.B).   Relative amounts of expression between orct and orct2 in each of the tissues tested  under control conditions were compared (Figure 2.19).  mRNA levels for orct2 were greater  than 4‐fold higher than orct in whole body (Figure 2.19.A), 8‐fold higher in ovary (Figure  2.19.B), and 3‐fold higher in midgut (Figure 2.19.D); whereas expression of orct was over 8‐ fold higher than orct2 in the MTs (Figure 2.19.C).  Expression values for each gene were  normalized to the gene with the lowest expression within a certain tissue.  Results of this  analysis showed orct2 to have higher basal expression across a wider range of tissues were  orct is more highly and locally expressed in the MTs.      Expression of orct and orct2 was measured in midgut, MTs and ovary following one  and 15 generations of exposure to 80 mmol L‐1 and 150 mmol L‐1  TEA and expressed  relative to the control tissue level of expression measured at 1 and 15 generations.   Unpaired Student’s t‐tests between expression values in control tissues collected at 1 and  15 generations confirmed that mean Cq values were not significantly different, therefore  values were pooled to give one control value for the final analysis.  Following 1 generation  of either 80 mmol L‐1 or 150 mmol L‐1 TEA exposure, there was an almost 5‐fold increase in  expression of orct in the midgut, independent of the concentration of TEA exposure, which  increased to almost 10‐fold over 15 generations of exposure (Figure 2.20.A).  Expression  levels of orct increased over 3‐fold at the 80 mmol L‐1 TEA exposure in the MTs (Figure  2.20.B) following 15 generations of exposure only.   Ovary expression increased over 4‐fold  at each concentration of exposure after 15 generations (Figure 2.20.C).  Expression in these  tissues after 1 generation was not significantly different from control.     45    The expression profile of the midgut for orct2, showed a greater than 5‐fold increase  in expression following exposure to TEA after 1 generation (Figure 2.21.A), and an almost  10‐fold increase in expression after 15 generations.  All increases in expression were  independent of the concentration of TEA exposure.  There were no significant changes in  orct2 expression after exposure to TEA in the MTs (Figure 2.21.B) and the ovary (Figure  2.21.C).    2.4 Summary     This chapter described the cloning of two putative OCTs from D. melanogaster.   Sequencing of orct and orct2 showed the two sequences to have divergences from the  predicted sequences, resulting in substitutions at the protein level.  Pairwise alignments  between the genes indicated high similarity (72.4%), which was nearly double the percent  similarity shared between of any of the vertebrate OCT isoforms (32.2% between human  OCT1 and human OCT3), with the exception of the high degree of similarity between human  OCT1 and human OCT2 (69.8%).  Each of the cloned genes possessed 12 conserved TMDs  with intracellular and extracellular loops characteristic of this transporter superfamily.  A  number of conserved domains first identified in vertebrates were conserved in insect  orthologs, as well with additional conserved domains found between insect sequences.   Sequence analysis supports the grouping of ORCT and ORCT2 into the MFS 2.A.1.19 (2,  electrochemical potential driven porters; A, uniporter/symporter/antiporter; 1, MFS; 19,  OCTs) according to Saier (2000).  Phylogenetic analysis showed the ORCT and ORCT2  peptide sequences to fall into an insect specific clade that is equally divergent from OCT3  and OCTN orthologs, and OCT1 and OCT2 orthologs.  Results of sequence analysis and  phylogenetic analysis indicated a high degree of similarity between insect orthologs and   46  could indicate an ancestral relationship of ORCT and ORCT2 to vertebrate OCT‐like  sequences.  Gene expression results indicated that orct had constitutive high expression in  the MTs, whereas orct2 was not highly expressed under control conditions in any tissue  tested compared to whole body.  Expression of orct2 was higher relative to orct in whole  body, ovary and midgut tissue.  Following exposure to TEA, there was a significant increase  in midgut expression for both orct and orct2 as well as an increase in orct expression  following 15 generations of exposure in the MTs and ovary tissues.  This supports the  physiological evidence describing TEA transport across midgut and MTs.  An alternative  explanation would be that transcript regulation of orct and orct2 is mediated through a  generalized stress response to toxicity.  Transport across the MTs is most likely mediated  by ORCT, whereas transport across the midgut could be regulated by exposure to TEA and  is mediated by ORCT and ORCT2 based on mRNA tissue distribution profiles.                                    47                                       Table 2.1 Cloning primers.                          48                Table 2.2 Quantitative real‐time PCR primers.                 49                                  Table 2.3 Sequencing primers.                                     50                          Table 2.4 Protein sequences for alignments.    *Accession number for available predicted sequence from GenBank database (NCBI).  Cloned sequences  were used for generation of the multiple alignment and subsequent phylogenetic tree.                         51                                    Table 2.5 Sequence analysis for orct showing nucleotide substitutions between the cloned and predicted  sequence (NP_524479) of orct.                                               52                          Table 2.6 Sequence analysis for orct2 showing nucleotide substitutions between the cloned and predicted  sequence (NM_142981) of orct2.                         53            Table 2.7 Sequence identity shared between organic cation transporter‐like representative proteins.  Column and row headings indicate assigned protein name:  Tc, Tribolium castaneum protein; Ag, Anopheles gambiae protein; h, human proteins.       54                    Figure 2.1 Representative RNA gel for qPCR tissue samples from control and TEA exposed individuals after 1  generation.  Ribosomal mRNA 18s and 28s bands were labeled.  Invertebrate RNA contains nicks that can  cause 28s bands to be faint or absent, even in intact RNA.  Lanes contain the following:  1) 1kb DNA Ladder  (New England Biolabs Ltd.)  2) whole body control, 3) midgut control, 4) ovary control, 5) 150 mmol L‐1 TEA  whole body, 6) 150 mmol L‐1 TEA midgut, 7) 150 mmol L‐1 TEA ovary, 8) 80 mmol L‐1 TEA whole body, 9) 80  mmol L‐1 TEA midgut, 10) 80 mmol L‐1 TEA ovary.               55                              Figure 2.2 Sample MELT curve analysis for orct.  MELT curve was generated by plotting the change in the  inverse of the measured fluorescence value over time (vertical axis) by the temperature of the block  (horizontal axis).  Double‐stranded DNA products created through amplification denature at unique  temperatures and cause fluorescence to decrease.  This method allows determination of the number of unique  amplicons present (having the same peak position) across a qPCR plate.  Trace colors: orct amplification,  green; NRT, blue; NTC, black.  Horizonal green bar indicates fluorescence threshold value.                        56                                  Figure 2.3 Sample plate schematic for temperature and primer concentration optimization using quantitative  real‐time PCR. Identical unknown numbers represent technical replication.  NTCs were run at various  temperatures to assess primer dimer effects at low and high temperatures.  Plate was designed using CFX  Manager™ Software.                         57                          Figure 2.4 Optimal temperature ranges for quantitative real‐time PCR primer sets (orct, orct2, actin 42A,  rp49, gapdh­1) indicated by dark gray bars.  Light gray regions indicated the full range of temperatures tested.                             58                          Figure 2.5 Sample plate schematic for determination of primer set efficiency using 6 serial 5 or 10‐ fold  dilutions of template.  Plate was designed using CFX Manager™ Software. NTCs and NRT controls were  performed to test for primer dimer and genomic DNA contamination.                       59      Figure 2.6 Efficiency curves for orct (A), orct2 (B), actin 42A (C), gapdh­1 (D) and rp49 (E).  The legend on  each graph displays: primer efficiency (E), R2 value, y‐intercept and slope. Quantification cycle (Cq) is present  on the vertical axis while the horizontal axis displays the logarithmic value of the starting template quantity.         60                                Figure 2.7 Sample schematic for a quantitative real‐time PCR experimental plate designed according to the  sample maximization method (Hellemans et al., 2007).  The same unknown value represents technical  replication of the same biological sample. Unknowns 37‐41 were performed on every experimental plate with  the same whole body sample to act as inter run calibrators.  NTCs were run on every plate.  NRTs for each  sample were tested one time for each gene on separate plates with inter‐run calibrators.                         61        Figure 2.8 Annotated protein sequence of ORCT.  Colored bars indicate the following: blue, intracellular domain; red, TMD; yellow, extracellular domain; purple,  N‐glycosylation site; green, PKC phosphorylation site; light blue, PKA phosphorylation site; black, single nucleotide polymorphism (SNP) from predicted  sequence.   62    Figure 2.9 Schematic representation of the predicted secondary structure of ORCT.  Hydrophobicity analysis with TmPred (Hoffman and Stoffel, 1993) predicts  12 TMDs with intracellular amino and carboxyl ends.  Image was generated using Microsoft® PowerPoint® 2008 for Mac.  Non‐polar amino acids are shown in  white, positively charged amino acids are blue, and negatively charged amino acids are red.  63        Figure 2.10 Annotated Protein sequence of ORCT2.  Colored bars indicate the following: blue, intracellular domain; red, TMD; yellow, extracellular domain;  purple, N‐glycosylation site; green, PKC phosphorylation site; light blue, PKA phosphorylation site; black, single nucleotide polymorphism (SNP) from predicted  sequence.     64    Figure 2.11 Schematic representation of the predicted secondary structure of ORCT2.  Hydrophobicity analysis with TmPred (Hoffman and Stoffel, 1993)  predicts 12 TMDs with intracellular amino and carboxyl ends.  Image was generated using Microsoft® PowerPoint® 2008 for Mac.  Non‐polar amino acids are  shown in white, positively charged amino acids are blue, and negatively charged amino acids are red.  65        Figure 2.12 Alignment of representative vertebrate organic cation transporters and organic cation  transporter orthologs with sequences from D. melanogaster.  Human OCT isoforms were used as well as OCTN  and FLIPT transporters. Sequences found using NCBI BLAST (Altschul et al., 1990) with ORCT as the input  query sequence.  Alignment constructed using Geneious™ Pro software (Drummond et al., 2011). Red bars  indicate TMDs for ORCT, red boxes indicate conserved regions between all sequences.  Dark shaded regions  indicate low similarity, where as light shaded regions indicate similar amino acids.  Unshaded regions indicate  identical sites. h indicates human protein.   66                    Figure 2.13 Hydrophobicity plots of ORCT and ORCT2 with representative vertebrate organic cation  transporter orthologs using TMpred  (Hoffman and Stoffel, 1993) with a given TMD range of 17‐33 aa.   Sequences were aligned relative to amino acid position from a multiple alignment (Figure 2.13) (horizontal  scale).  Transmembrane spanning regions predicted for all sequences were indicated by the vertical bars.  All sequences shared 12 conserved trans membrane domains, with human FLIPT protein having an  additional predicted TMD between positions 50 – 100.  Upper threshold for predicting TMD is indicated by  the grey horizontal bar at 1.0 and the lower threshold at 0.6. Vertical axis indicates a hydrophobicity value  predicted by TMpred, which uses the Kyte‐Doolittle scale for amino acid hydrophobicity.  A value between  0.6 to 1.0 indicates a TMD.              67    Figure 2.14 Alignment of representative insect organic cation transporter‐like orthologs.  Sequences  found using NCBI BLAST (Altschul et al., 1990) with ORCT as the input query sequence.  Alignment  constructed using Geneious™ Pro software (Drummond et al., 2011). Red bars indicate TMDs for ORCT, red  boxes indicate conserved regions between all sequences.  Dark shaded regions indicate low similarity,  where as light shaded regions indicate similar amino acids.  Unshaded regions indicate identical sites.  Legend indicates the protein: Ag, Anopheles gambiae protein; Am, Apis mellifera protein; Ap, Acyrthosiphon  pisum protein; Cq, Culex quinquefasciatus protein; Nv, Nasonia vitripennis protein; Tc, Tribolium castaneum  protein.       68                    Figure 2.15 Hydrophobicity plots of ORCT and ORCT2 with representative insect organic cation transporter‐ like orthologs using TMpred  (Hoffman and Stoffel, 1993) with a given TMD range of 17‐33 amino acids.   Sequences were aligned relative to amino acid position from a multiple alignment (Figure 2.14) (horizontal  scale).  Transmembrane spanning regions predicted for all sequences were indicated by the vertical bars. The  majority of sequences shared 12 conserved trans membrane domain, with the exception of T. castaneum  which had 10 predicted domains.  Upper threshold for predicting TMD is indicated by the horizontal bar at 1.0  and the lower threshold at 0.6. Vertical axis indicates a hydrophobicity value predicted by TMpred, which uses  the Kyte‐Doolittle scale for amino acid hydrophobicity.  A value between 0.6 to 1.0 indicates a TMD.  Legend  indicates the protein: Ag, Anopheles gambiae protein; Am, Apis mellifera protein; Ap, Acyrthosiphon pisum  protein; Cq, Culex quinquefasciatus protein; Nv, Nasonia vitripennis protein; Tc, Tribolium castaneum protein.               69              Figure 2.16 Phylogenetic analysis of representative organic cation transporter‐like orthologs from the major  facilitator superfamily.  The tree was constructed in Geneious™ Pro (Drummond et al., 2011) using the Jukes‐ Cantor method for a Neighbor Joining tree and is displayed as an unrooted tree.  Likelihood values are shown  at branch nodes.  The scale bar represents the number of amino acid substitutions per site.  ORCT is  highlighted in blue, ORCT2 highlighted in red.  Background shading: OCT1, orange; OCT2, purple; OCT3, pink;  Bird OCT1‐2, yellow; OCTN, blue; Insect MSF, green.     70                      Figure 2.17 Reference gene stability analysis. A) GeNorm M analysis (BioGazelle) showed ranked stability of  tested reference genes.  M‐values for a heterogeneous sample should be less than <1.  B) GeNorm V analysis  (BioGazelle) determined the ideal number of reference genes to be n‐1.   A GeNorm V value for n‐1 reference  genes was above threshold for a heterogeneous sample (0.16). actin 42A was the least stable gene, therefore  gapdh­1 and rp49 were used in all final analyses.       71                          Figure 2.18 Tissue distribution profiles of orct (A) and orct2 (B).   Relative mRNA fold expression of each gene  was measured in whole body, midgut, Malpighian tubule, and ovary tissues and results are expressed  calibrated to the whole body expression of each gene.  Statistical significance from whole body expression (*)  was assessed using a one‐way ANOVA with a Dunnett’s multiple comparisons post‐test. Statistical tests and  final graphical output was done using Graphpad Prism™ (v5) with a p‐value <0.05 considered significant.                           R el at ive  m R N A ex pr es sio n Whole Body  Midgu t Malpighian  Tubul e Ovary  0 2 4 6 8 * R el at ive  m R N A ex pr es sio n Whole Body  Midgu t Malpighian  Tubul e Ovary  0.0 0.5 1.0 1.5 * * A) orct B) orct2  72          Figure 2.19 Comparative expression of orct and orct2 within D. melanogaster tissues.  A) whole body, B)  ovary, C) Malpighian tubule, D) midgut.  Expression values were normalized to the gene with the lowest  expression value in each tissue tested.  Unpaired Student’s t‐tests were used to compare mRNA expression  values. Statistical tests and final graphical output was done using Graphpad Prism™ (v5) with a p‐value <0.05  considered significant.  R el at ive  m R N A ex pr es sio n orc t orct 2 0 2 4 6 * R el at ive  m R N A ex pr es sio n orc t orct 2 0 2 4 6 8 10 * R el at ive  m R N A ex pr es sio n orc t orct 2 0 2 4 6 8 10 * R el at ive  m R N A ex pr es sio n orc t orct 2 0 1 2 3 4 * A) whole body B) ovary C) Malpighian tubule D) midgut  73    Figure 2.20 Relative expression of orct mRNA following exposure to tetraethylammonium after 1 (white) and  15 (blue) generations.  A) midgut, B) Malpighian tubules, C) ovary.  Expression values were normalized to  control conditions within each generation.  Significant differences in expression due to exposure are indicated  by *; significant differences between generations subjected to the same exposure of TEA are indicated by +.   Two‐way ANOVA with a Bonferroni post‐hoc test was used to assess the affect of treatment and generation  time.   One‐way ANOVA with a Dunnett’s post‐hoc test was used to determine statistical changes in exposure  within a generation. Statistical tests and final graphical output was done using Graphpad Prism™ (v5) with a  p‐value <0.05 considered significant.  R el at ive  m R N A ex pr es sio n control  80mM  TE A 150mM  TE A 0 5 10 15 Generation 1 Generation 15 * * * * + + R el at ive  m R N A ex pr es sio n control  80mM  TE A 150mM  TE A 0 1 2 3 4 5 Generation 1 Generation 15* + + R el at ive  m R N A ex pr es sio n control  80mM  TE A 150mM  TE A 0 2 4 6 8 Generation 1 Generation 15* *  74    Figure 2.21 Relative expression of orct2 mRNA following exposure to tetraethylammonium after 1 (white)  and 15 (red) generations.  A) midgut, B) Malpighian tubules, C) ovary.  Expression values were normalized to  control conditions within each generation. Significant differences in expression due to exposure are indicated  by *; significant differences between generations subjected to the same exposure of TEA are indicated by +.   Two‐way ANOVA with a Bonferroni post‐hoc test was used to assess the affect of treatment and generation  time.   One‐way ANOVA with a Dunnett’s post‐hoc test was used to determine statistical changes in exposure  within a generation. Statistical tests and final graphical output was done using Graphpad Prism™ (v5) with a  p‐value <0.05 considered significant.  R el at ive  m R N A ex pr es sio n control  80mM  TE A 150mM  TE A 0 5 10 15 Generation 1 Generation 15 * * * * + + R el at ive  m R N A ex pr es sio n control  80mM  TE A 150mM  TE A 0 1 2 3 4 Generation 1 Generation 15 R el at ive  m R N A ex pr es sio n control  80mM  TE A 150mM  TE A 0.0 0.5 1.0 1.5 2.0 2.5 Generation 1 Generation 15*  75  Chapter 3  Expression of the ORCT Protein in Insect Cell Lines    3.1 Synopsis     In order to conduct functional assays of the isolated ORCT and ORCT2 proteins, an  appropriate heterologous expression system had to be tested.  In contrast to the option of  expressing the protein in a heterologous expression system, a homologous expression  system derived from D. melanogaster is commercially available.  However, Kc1 and SL2 cell  lines from D. melanogaster were not used in this research for a number of reasons.  First,  previous studies have shown Kc1 and SL2 cells to be ineffective at correctly transporting  and inserting foreign proteins into the cell membranes (Hegedus et al., 1999).  Second,  there may exist native constitutive expression of the genes of interest in D. melanogaster  cell lines, which would obscure results obtained from functional studies.  Finally, Sf9 cells  were made readily available to use from collaborators at Pacific Agri‐Foods Research  Center, Summerland, B.C.  A series of expression constructs for ORCT were prepared that  allowed expression of the ORCT protein in Sf9 cell lines derived from the fall army worm,  Spodoptera frugiperda (Lepidoptera).  Prokaryotic heterologous protein expression systems  such as Escherichia coli (E. coli) and yeast, despite their wide use and appeal, lack the  necessary intracellular processing for correct assembly of a eukaryotic protein (Hegedus et  al., 1999).  Expression of ORCT in a eukaryotic, insect expression system allowed protein  processing to occur in a cellular environment that more closely mimics the natural  environment for this protein.  Over the last 30 years, manipulation of baculovirus genomes  lead to the development of a number of expression vectors for transfection of insect cell  lines (Pfeifer et al., 1999; Smith et al., 1983).  Sf9 cells using a baculovirus expression vector  have been recently used to express and characterize a number of vertebrate membrane   76  transport proteins (Sarkade et al., 1992; Hegedus et al., 1999; Bakos et al., 2000; Ozvegy et  al., 2001).        Transient and constitutive expression of ORCT was mediated by a plasmid vector,  p2ZOPe2, which exploits the immediate‐early 2 (ie2) promoter from the Orgyia  pseudotsugata multicapsid nuclepolyhedrosis virus (OpMNPV) (Hegedus et al., 1998).   ORCT was expressed transiently using the baculovirus vector pAcBac mediated by the  polyhedrin promoter from Autographica californica multicapsid nucleopolyhedrosis virus  (AcMNPV) (Luckow and Summers, 1988; Miller, 1988).  Budded virus constructs were  collected following transfection with pAcBac for subsequent infection of Sf9 cells.  Protein  expression was assessed through Coomassie staining for total protein and through Western  blotting.  Site‐specific detection of ORCT is possible through the addition of an HA‐tag  sequence (YPY DVP DYA) from human influenza hemagglutinin.  ORCT‐HA constructs were  detected as soon as 24 hpt with the plasmid vector p2ZOPe2 and increased in intensity at  48 hpt.  Protein from transfections with pAcBac was detectable only at 48 hpt; however  protein from subsequent infections with budded virus was detectable 24 hours post  infection (hpi) and increased in intensity up to 96 hpi.  Results of the Western blots did not  correspond to the predicted 60 kDa size of ORCT in all cases, however post‐translational  modification of the protein may have affected protein migration.  Functional assays are  needed to confirm correct assembly of the ORCT protein, and to characterize ORCT as an  organic cation transporter.             77  3.2 Materials and Methods   3.2.1 Insect Rearing     Oregon R strain D. melanogaster Meigen were raised on standard artificial fly media  and maintained in laboratory culture. Artificial media was prepared as described by  Chahine and O’Donnell  (2009).  Full protocol for media preparation was outlined in  Chapter 2.  Media was stored at 4°C for up to 30 days.  Insects 4‐7 days post emergence  were used in all experiments.    3.2.2 RNA Extraction and Reverse Transcription   Adult 4‐7 day post emergence D. melanogaster were harvested for total RNA  extraction.  Eight whole flies were transferred into 1mL TRIzol® reagent and RNA was  extracted as described by Chahine and O’Donnell (2009) and Nawata and Wood (2008).  A  complete protocol for RNA extraction is outlined in Chapter 2.  Typical RNA yields ranged  from 528.0 ng/μL to 1171.7 ng/μL with A260/280 of 2.1.  RNA was stored at ‐80°C for 6  months with no loss of yield.  RNA was treated with Ambion® Turbo DNA‐free™ to remove  any contaminating genomic DNA prior to cDNA construction.  cDNA was synthesized from  1μg of RNA in the Improm II™ Reverse Transcription System with oligo(dT) primers.   Temperature cycling for reverse transcription was performed using a C1000™ Thermal  Cycler according to manufacturer directions.  cDNA was stored at ‐20°C.     3.2.3 Primer Design   A predicted OCT‐like gene (orct) was previously cloned and sequenced (Chapter 2).   A full length amplicon of the orct gene was obtained using terminal primers that enclose the  ORF with 5’ modifications.  A Kozac sequence (5’‐GCCACC) was added to the 5’ forward   78  primers for ribosomal recognition. Appropriate restriction sites (HindIII and BamHI)  corresponding to each expression vector (p2ZOPe2, pFastBac™1 (Invitrogen)) were  included in the primer.  Additionally, one forward and one reverse primer for each vector  construct was created with a 27bp long HA‐tag sequence (5’‐ TACCCCTACGACGTGCCCGACTACGCC) from human influenza hemagglutinin (GenBank accession  number: AEG65813.1) corresponding to the amino acid sequence YPY DVP DYA, for which  there is a commercially available antibody for site specific detection.  Table 3.1 lists primers  for the amplification of orct for each vector with modifications outlined.  Primers were  designed and analyzed using Integrated DNA technologies [IDT; (www.idtdna.com)] which  employs IDTs PrimerQuest® Software (2002).  Specificity of primers was accessed using  BLAST (Altschul et al., 1990).    3.2.4 Amplification and Preparation of Amplicons   For each expression vector (p2ZOPe2, pFastBac™1) 3 amplicons were designed. The  first had an HA‐tag on the forward strand designated 5’HA‐orct, the second had an HA‐tag  on the reverse strand designated orct‐HA3’ and final amplicon lacked the HA‐tag sequence  designated orctN (Figure 3.1; Figure 3.2).  The HA‐tag sequence was added to the forward  and reverse strands so that the resulting proteins could be detected from either the amino  or carboxyl terminus.  The untagged construct was created for use as a control as well as for  use in future functional assays.  Amplification on whole body cDNA using Easy‐A™ High‐ Fidelity PCR Cloning Enzyme and Master Mix was performed to obtain full length amplicons  of orct.  Each PCR reaction contained 2.0 μL cDNA template and 1.0 μL of forward (100 μmol  L‐1) and 1.0 μL of reverse (100 μmol L‐1) primer in a total reaction volume of 50 μL  according to manufacturer’s protocol.  Cycling was performed on C1000™ Thermal Cycler   79  with the following parameters: initial denaturing at 95°C for 2 minutes, followed by 30  cycles of 40 s denaturing at 95°C, 30 s annealing at 69°C and 2 minutes elongation at 72°C,  with a final elongation step at 72°C for 5 minutes.  PCR reactions were purified using either QIAquick® PCR Purification Kit (Qiagen,  Toronto, ON) or E.Z.N.A.® Gel Extraction and PCR Cleanup Kit (Omega Bio‐Tek, Norcross,  GA) according to manufacturer.  Amplicons and vectors were digested using HindIII and  BamHI restriction enzymes (New England Biolabs Ltd.) using 1‐4 μg DNA in NEB2 buffer  according to manufacturer’s directions.  All digestion reactions were incubated at 37°C for 1  hour.  Restriction digest reactions were purified on a 0.7% agarose gel stained with SYBR®  Safe.  Bands of interest were excised and recovered using either QIAquick® Gel Extraction  Kit (Qiagen) or E.Z.N.A.® Gel Extraction Kit (Omega Bio‐Tek).  Ligation of orct amplicons  into the baculovirus system (pFastBac™1; pAcBac) was done at Pacific Agri‐Foods Research  Center, Summerland, B.C. by Nadia Sokal.  Ligations of orct amplicons into the transient  p2ZOPe2 vector were performed at the University of British Columbia, Kelowna, B.C. by the  author.  Purified DNA was assessed for quantity and quality using a BioPhotometer Plus  with Hellma® Tray Cell.  Concentrations of purified DNA ranged from 7.5‐20.5 ng μL‐1 and  had A260/A280 purity ratios of 1.7–2.2.    3.2.5 Cloning into p2ZOPe2   Amplicons of orct were ligated into p2ZOPe2 using T4 DNA ligase (Promega) with an  insert to vector ratio of 3:1, for 2 hours at room temperature before transformation into  high efficiency JM109 E.coli cells (Promega) according to manufacturer’s protocols.   Resultant orct‐p2ZOPe2 constructs were designated: pZOP5’HA‐orct, pZOPorct‐HA3’, and  pZOPorctN to reflect the presence of the HA‐tag sequence (Figure 3.1). Cells were plated onto   80  LB agar plates supplemented with 30 μg mL‐1 zeocin and incubated 37°C overnight.  No  insert control plasmids (pZOPctl) were transformed and plated as a negative control.   Colonies were screened for positive inserts using PCR on a C1000™ Thermal Cycler with the  following cycling conditions: an initial denaturing for 10 minutes at 95°C, followed by 35  cycles of denaturing at 95°C for 30 s, annealing at 69°C for 30 s and elongation at 72°C for 2  minutes.  Each PCR reaction contained 12.5 μL GoTaq® Hot Start Green Master Mix, 0.13 μL  Triton‐X and 1 μL each of forward and reverse primer (100 μmol L‐1) in a total reaction  volume of 25 μL.  The tip of a pipette was used to select a colony that was transferred to the  inside of a 0.2mL PCR tube to supply template for the reaction.  The tip was subsequently  used to streak an LB agar plate that was grown overnight at 37°C.  Products from the PCR  were visualized on a 1% agrose gel stained with SYBR® Safe.  Based on the results of the  PCR, 5 positive colonies were randomly chosen for each construct for long‐term storage in a  10% (v/v) glycerol solution, and of these stored colonies, 1 clone for each construct was  selected to inoculate 5 mL of LB media.  The colony was incubated for 16 hours at 37°C with  shaking (170 rpm) and zeocin selection (30 μg mL‐1).  After this first incubation and  selection a 50 mL volume of LB media with 30 μg mL‐1 zeocin was subsequently inoculated  and incubated for 24 hours at 37°C. The OD600 of the 50 mL inoculum was assessed  repeatedly using a Biophotometer plus with a Hellma® TrayCell until an optical density of  2‐4 was reached.    Plasmids were purified using E.Z.N.A.® Midi Prep Kit (Omega Bio‐Tek)  according to manufacturer protocols, with resulting plasmid yields from 71.5 ng μL‐1 –  299.8 ng μL‐1 with A260/A280 between 1.7‐ 1.88.  Plasmids for each construct were  digested in a 10μL volume with BamHI and HindIII using NEB2 Buffer according to  manufacturer’s instructions and visualized on a 1% agarose gel stained with SYBR® Safe to  confirm the correct insert size (data not shown).   81  3.2.6 Cloning into pAcBAC   In order to produce a final bacmid containing orct, the orct‐HA constructs were first  inserted into the transfer vector pFastBac™1.  A single bacterial colony containing the  pFastBac™1 plasmid was isolated from an LB‐agar plate and used to inoculate a 3 mL  culture of LB media supplemented with 100 μg mL‐1  of ampicillin and 7 μg mL‐1  of  gentamycin.  Plasmids were isolated using EZ‐10 Spin Column Plasmid DNA Minipreps Kit  (Bio Basic Inc., Markham, ON).  pFastBac™1 contains two Tn7 transposition sites  encompassing the multiple cloning site of the vector as well as conferring ampicillin and  gentamycin resistance to the transfected bacteria (Figure 3.2). pFastBac™1 was linearized  with HindIII according to manufacturer’s protocols for 2 hours at 37°C in a 50 μL reaction  volume.  After 2 hours the buffer was adjusted with 50 mmol L‐1 NaCl to optimize for  BamHI.  BamHI was added bringing the reaction volume to 55 μL, and the reaction was  incubated an additional hour at 37°C.  Digests were purified on a 0.7% agarose gel stained  with ethidium bromide.  The linear plasmid was excised and purified using QIAquick® Gel  Extraction Kit (Quiagen).  Previously prepared amplicons (5’HA‐orct, orct‐HA3’, orctN) were  ligated using a 3:1 insert to vector ration with T4 DNA ligase into pFastBac™1 in a 20 μL  reaction volume at 16°C for 4 hours.  Constructs for pFastBac™1  (pFastBac5’HA‐orct,  pFastBacorct‐HA3’, pFastBacorctN and pFastBacctl) were transformed into electrocompetent  DH10β cells (Sharma and Shimke, 1996), and cells were spread onto LB‐agar plates  supplemented with 50 μg mL‐1  ampicillin and 7 μg mL‐1  gentamycin and incubated  overnight at 37°C.  Two colonies for each construct were isolated and used to inoculate 3mL  cultures of LB media supplemented with ampicillin (50 μg mL‐1) and gentamycin (7 μg mL‐ 1).  The cultures were incubated with shaking (170 rpm) overnight at 37°C and plasmids  were isolated using EZ‐10 Spin Column Plasmid DNA Kit (Bio Basic Inc.).  Products were   82  visualized on a 0.7% agarose gel stained with ethidium bromide to determine plasmid  quality and quantified using a Biophotometer (Eppendorf).  Plasmids were digested with  HindIII and BamHI (described above) and resolved on a 0.7% agarose gel with ethidium  bromide to confirm the presence of the orct insert (data not shown).  Competent cells containing the the AcMNPV bacmid, bmon14272 (pAcBac) and  pmon7124 helper plasmid were provided by Dr. G. Blisserd’s Lab (Cornell University,  Ithaca, NY) in 2005 and have been stored by Dr. D. Theilmann’s Lab (PARC, Summerland,  BC).  Competent cells were prepared by inoculating a 3 mL culture of LB media  supplemented with 50 μg mL‐1  kanamycin and 10 μg mL‐1  tetramycin and incubating the  culture overnight at 37°C with shaking at 170 rpm.  The 3 mL culture was used to inoculate  100 mL YENB media (3.75 g Bacto© Yeast Extract, 4 g Difco© Nutrient Broth in 500 mL  distilled water adjusted to pH7.5 with NaOH and autoclaved to sterilize) supplemented with  50 μg mL‐1  kanamycin and 10 μg mL‐1  tetramycin and was incubated at 37°C with shaking  (170 rpm) until an OD600 of >0.7.    Cells were chilled in a 4°C fridge for 5 minutes  and collected by centrifugation at 4  000xg for 10 minutes at 4°C.  Duplicate washes were performed by resuspending cells in 50  mL of cold distilled water and collecting cells by centrifugation at 4 000xg for 10 minutes at  4°C.  Cells were resuspended in 20 mL of cold 10% (v/v) glycerol solution, collected by  centrifugation at 4 000xg for 10 minutes at 4°C and resuspended once more in 1 mL 10%  (v/v) glycerol.  Transformation capability of competent cells was tested by electroporating with a  pGEM®‐T vector (Promega).    83  Constructs of orct‐pFastBac™1 were transformed by combining 100 ng of plasmid  with 20 μL of competent cells containing pAcBac and the helper plasmid pmon7124 and  electroporating the cells (Sharma and Shimke, 1996).  Cells were incubated in 750 μL LB  media overnight at 37°C with shaking (170 rpm) to allow site‐specific transposition of orct  from pFastBac™1 to pAcBac.  Cells were plated onto LB agar supplemented with kanamycin  (50 μg mL‐1), tetramycin (10 μg mL‐1), gentamycin (7 μg mL‐1), 10 μL of 0.5 mol L‐1  isopropyl β‐D‐1‐thiogalacropyranoside and 40 μL of 20 mg mL‐1 5‐bromo‐4‐chloro‐3‐ indolyl‐β‐D‐galacropyranoside.  Successful transformants designated pAcBac5’HA‐orct,  pAcBacorct‐HA3’, pAcBacorctN and pAcBacctl, were white in color and were restreaked on LB  agar supplemented with gentamycin (7 μg mL‐1) and kanamycin (50 μg mL‐1) for selection  and incubated overnight at 37°C.  For each construct, a single colony was used to inoculate a  3 mL culture of LB media with gentamycin (7 μg mL‐1) and kanamycin (50 μg mL‐1)  selection.  Each bacmid was isolated using a modified plasmid mini kit for bacmid DNA.  1.5  mL of a 3 mL overnight culture of LB media was used to pellet cells at 10 000xg for 1  minutes.  Cells were resuspended in 0.25 mL of Solution 1 (15 mM Tris pH 8, 10 mM EDTA  with 100 μg mL‐1 RNase A).  Cells were lysed by adding 0.25 mL of Solution 2 (0.2 N NaOH,  1% sodium dodecyl sulfate) and the mixture was incubated at room temperature until the  lysate cleared.  Cell debris were precipitated by adding 0.25 mL cold Solution 3 (3 mol L‐1  potassium acetate adjusted with glacial acetic acid to pH 5.5) and mixing by inversion.   Tubes were incubated for 10 minutes on ice and centrifuged for 10 minutes at 4°C at 10  000xg.  The supernatant was removed by pipetting and DNA was pelleted by adding 0.8 mL  isopropanol and spinning at 13 000xg for 15 minutes.  The pellet was washed with 0.7 mL  of 70% ethanol.  The dry pellet was resuspended in 40 μL of Tris‐EDTA buffer with 0.2 μL  RNase A.  DNA was incubated for 20 minutes at 37°C to allow the RNase A to work.  The   84  RNase was degraded by heating to 65°C for 10 minutes and allowing the DNA to cool.  DNA  was stored at ‐80°C.    3.2.7 Transfection and Collection of Budded Virus   Transfections with orct‐HA constructs ligated into p2ZOPe2 (pZOP5’HA‐orct, pZOPorct‐ HA3’, pZOPorctN and pZOPctl) or pAcBac (pAcBac5’HA‐orct, pAcBacorct‐HA3’, pAcBacorctN and  pAcBacctl) were performed using Sf9 cells cultured in TC100 media supplemented with 10%  fetal bovine serum (FBS) and 0.1% gentamycin (50 mg mL‐1 stock).  Transfections were  performed in 6 well plates in duplicate on 1x106 cells. Liposomes were previously prepared  by combining DDAB (dimethyldioctadecyl‐ammonium  bromide) and DOPE (L‐alpha‐  phosphatidylethanolamine dioleoyl) in a 1:2 molar ratio.  Transfection cocktail for each well  contained 15 μL lipofectin, 85 μL Grace’s Insect Media (Sigma‐Aldrich, Oakville, ON) and 1  μg DNA adjusted for genome size.  Grace’s Insect Media was added to bring the mixture to a  volume to give 1 mL/well of transfection cocktail following a 15 minute incubation of the  components at room temperature.  Transfections with uncut plasmids (pZOPctl and AcBacctl)  acted as negative controls.  A parallel transfection with a plasmid containing a green  fluorescent protein (GFP) construct, 501 pE38‐GFP, was used as a positive control.  Mock  transfections, which underwent the same washes but lacked the addition of DNA, were used  to compare the health of the cells following transfection.  Cells were prepared by duplicate  washes with 1.5 mL of Grace’s Insect Media prior to the addition of 1 mL of the transfection  cocktail, containing 1 μg DNA to each well.  Plates were incubated for 4 hours at 27°C in a  humid container.  Following incubation, the transfection cocktail was aspirated off and cells  were washed once with 1.5 mL Grace’s Insect Media and left to incubate overlaid with 1.5  mL TC100 Media (400 mL Grace’s Insect Media, 50 mL FBS, 50 mL lactalbumin/TC‐  85  Yeastolate, 500 μL gentamycin (50 mg mL‐1)) for 24 and 48 hours from the addition of the  transfection cocktail at 27°C.    Cells were collected into 1.5 mL tubes at 24 and 48 hpt following two washes of 1x  phosphate buffered saline (PBS; 137 mmol L‐1 NaCl, 2.7 mmol L‐1  KCl, 8.1 mmol L‐1  Na2HPO4H2O, 1.76 mmol L‐1  KH2PO4 with pH 7.4) by scraping the wells with a rubber  policeman.  Cells were pelleted by centrifugation at 1000xg for 5 minutes and the  supernatent removed.  Cells were stored at ‐80°C until further analysis.     Budded virus (v5’HA‐orct, vorct‐HA3’, vorctN) was collected 5 days post transfection  by collecting the overlaid TC100 media through pipetting.  Collected media was centrifuged  at 1000xg for 5 minutes to remove cellular debris and the supernatant containing the BV  was transferred to a new tube.  Budded virus was stored at 4°C until future use.  Images were captured at 24 and 48 hpt using a Nikon Diaphot microscope outfitted  with a Nikon D700 camera using Nikon Camera Control Pro Software (Nikon Instruments  Inc., Melville, NY).  Bright field shutter speed was 1/125 seconds and shutter speed for GFP  images was 0.5 s using a DM501 Nikon Filter and a Nikon Super Hi Pressure Mercury Lamp  (Nikon Instruments Inc.).       3.2.8 Infection   Previously collected BV (v5’HA‐orct, vorct‐HA3’, vorctN) was used to infect Sf9 cell  lines.  Infections were performed in 6 well plates in duplicate for each construct on 1x106  cells.  Cells were plated and left to adhere to the wells for 1 hour at 27°C in a humid  incubator.  Budded virus was applied at a multiplicity of infection of 5, assuming a virus  titre of 1x108 plaque forming units/mL (D. Theilmann, personal communication).  Plates  were incubated for 1 hour at 27°C with manual agitation every 10 minutes.  Following   86  incubation the virus was removed and the cells underwent triplicate washes with 1.5 mL  Grace’s Insect Media.  Cells were overlaid with 1.5 mL of TC100 media and left to incubate  at 27°C.  Cells were collected at 24, 48, 72 and 96 hpi using the collection method described  in the previous section.  Mock infections served as negative controls and were collected at  24, 72 and 96 hpi.    3.2.9 Protein Preparation and Sodium Dodecyl Sulfate Polyacrylamide Gel    Electrophoresis   To prepare protein for gel loading, 1x106 cells were resuspended in a solution of 50  μL 2x SDS PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) loading buffer  (100 mmol L‐1 Tris‐HCl pH 6.8, 4% SDS, 0.2% bromophenol blue, 20% glycerol, 200 mmol L‐ 1 β‐mercaptoethanol), 1 μL 100x protease inhibitor (P8340‐5mL, Sigma‐Aldrich), 1 μL β‐ mercaptoethanol, 48 μL 1x PBS.  Genomic DNA was sheared by passing cells through a 25  gauge syringe needle 3 times with subsequent heat denaturing for 10 minutes at 100°C.   The SDS PAGE matrix was prepared according to Sambrook and Russell (2001) for a 4%  stacking and 10% resolving gel using the Mini PROTEAN® II Electrophoresis Cell (Bio‐Rad).   Briefly, the 4% Stacking gel consisted of: 1.85 mL Distilled water, 750 μL 0.5 mol L‐1 Tris‐ HCl pH 6.8, 15 μL 20% SDS, 0.35 μL 30% acrylamide/bis‐acrylamide, 15 μL 10%  ammonium persulfate and 6 μL TEMED (N,N,N’,N’‐tetramethylethylenediamine), and the  10% resolving gel consisted of a solution of:  4.07 mL distilled water, 2.5 mL 1.5 mmol L‐1  Tris‐HCl pH 8.8, 50 μL 20% SDS, 3.33 mL 30% acrylamide/bis‐acrylamide, 50 μL 10%  ammonium persulfate, 5 μL TEMED.  One lane was loaded with 10 μL COLORPLUS™  Prestained Protein Ladder (New England Biolabs Ltd.) and 5.5 μL of sample was loaded to   87  represent protein from 50 000 cells.  Gels were prepared in duplicate and run at 70 mV  through the stacking gel and then at 125 mV through the resolving gel.      3.2.10 Coomassie Staining and Western Blotting   To visualize total protein, 1 SDS‐PAGE gel was stained with Coomassie® Brilliant  Blue R250 (Invitrogen) overnight at room temperature with shaking.  Stain is prepared by  dissolving 1 g Coomassie® Brilliant Blue R250 in 400 mL 95% ethanol, 100 mL glacial acetic  acid and 500 mL distilled water.  Gels were destained the following day with a solution of  400 mL 95% ethanol, 100 mL glacial acetic acid and 500 mL distilled water at room  temperature with shaking until protein bands were visible.   Western blotting was used for site‐specific detection of the HA‐tagged ORCT protein.   Protein was transferred from an SDS‐PAGE gel by electroblotting to a 6 cm X 8.5 cm piece of  polyvinylidene fluoride membrane (Immobilon‐P, Millipore) previously soaked in methanol  to wet.  Transfer buffer consisted of 6.06 g Tris base, 28.82 g glycine, 400 mL methanol and  1600 mL water.  The Mini Trans‐Blot® Cell (Bio‐Rad) was assembled according to  manufacturer’s directions and left overnight at 4°C at 50 V for transfer.    Membranes were blocked in excess blocking solution (20% (w/v) skim milk powder,  0.5% Tween‐20 in 1xPBS) for one hour at room temperature with shaking.  Blots were  probed using a mouse monoclonal anti‐HA antibody (Covance, Princeton NJ) applied at a  1:10 000 dilution in 10 mL of blocking solution and left to shake for 1 hour.  The secondary  peroxidase‐conjugated goat anti‐mouse IgG antibody  (Medicorp Inc., Montreal, QC) was  applied at 1:10 000 dilution in 10 mL of blocking solution and left for 1 hour.  Membranes  were washed 3 times for 15 minutes with a solution of 1xPBS and 0.5% Tween‐20.  Blots  were exposed with Western Lighting® Plus ECL Enhanced Chemiluminescence System   88  (PerkinElmer, Ma, USA) and developed using autoradiographic film (GE Healthcare Ltd.,  Mississauga ON) following standard darkroom procedures, with 1 s exposure, 2 minute  development, 30 s stop and a 2 minute fixation.  Ladders were visualized by exposing film  overnight, developing the film, and manually overlaying the images.     3.2.11 Selection for Stable Expressing Polyclonal Cell Line   Transient transfections with p2ZOPe2 containing orct inserts were performed in  T25 flasks seeded with 1x106 cells using the lipofectin protocol described in the previous  sections.  The transfection cocktail was removed following a 4 hour incubation at 27°C and  replaced with 2.0 mL fresh TC100 media supplemented with 10% FBS and 0.1%  gentamycin.  At 72 hpt, cells expressing ORCT were selected for with supplemented TC100  media containing 250 ug mL‐1 zeocin for 2 weeks to generate polyclonal stably transformed  cell lines.  These cells were collected and stored at ‐80°C      3.3 Results   3.3.1 Proof of Method     Figure 3.3 showed the successful transfection of the pE38‐GFP control plasmid 24  and 48 hpt.  Images were taken of Sf9 cells under UV conditions to visualize the GFP.   Fluorescent signals from the GFP were detectable 24 hpt and expression appeared to  increase over the next 24 hours (Figure 3.3.A; C).   Images of mock transfected Sf9 cells 48  hpt showed no detectable background fluorescence indicating that any fluorescent signal  seen was due to successful transfection of the control plasmid.  Images taken of cells using a  light microscope confirmed that cell morphology remained unchanged between the mock  and transfected cells over 48 hours.    89  3.3.2 Transfection Results     Sf9 cells were collected at 24 and 48 hours following transfection with constructs of  pAcBac (pAcBac5’HA‐orct, pAcBacorct‐HA3’, pAcBacorctN) and p2ZOPe2 (pZOP5’HA‐orct, pZOPorct‐HA3’,  pZOPorctN) and protein expression was analyzed through Western blotting and Coomassie  staining.     Figure 3.4 showed transfection results from p2ZOPe2.  Western blotting with an HA  antibody revealed distinct bands for both constructs containing the HA‐tag sequence at  both 24 and 48 hpt.  At 24 hpt, a clear band was visible at 60 kDa and a strong band was  visible at 40 kDa (Figure 3.4.A).  These bands were also visible at 48 hpt, with an additional  strong band at 80 kDa (Figure 3.4.B).  Mock cells and cells transfected with the p2ZOPe2  circular plasmid and the pZOPorctN construct had no visible bands following Western  development.  This indicated the specificity of the HA antibody for the HA‐tag sequence.      Coomassie stained gels representing total protein from transfected cells collected 24  hpt (Figure 3.4.C) and 48 hpt (figure 3.4.D) showed no distinct bands corresponding to  bands detected through Western blotting.     Figure 3.5 showed the Western blot and Coomassie staining results from cells  collected 24 and 48 hpt with the baculovirus vector pAcBac.  Western blotting of cells  collected 24 hpt (data not shown) did not reveal any detectable HA‐tagged ORCT protein.   However, the blot using cells collected 48 hpt showed distinct bands >80 kDa and between  40 kDa and 60 kDa (Figure 3.5.A).  Lanes containing mock transfected cells and cells  transfected with pAcBacorctN, and the pAcBac bacmid had no detection of the HA‐tag  sequence.  Distinct bands corresponding to results of the Western blot were not detected  with Coomassie staining (Figure 3.5.B; C).     90  3.3.3 Infection Results     Sf9 cells were infected with collected budded virus from transfections conducted  previously.  Cells were collected 24, 48, 72, 96 hpi and ORCT protein expression was  analyzed by Western blot and Coomassie stains.     Figure 3.6 showed the Western blot results of infection with v5’HA‐orct and vorct‐ HA3’ over four collection time points.  Bands were visible at all time points following  infection with each of the 2 viruses with the HA‐tag sequence.     Infection with v5’HA‐orct  (Figure 3.6.A) showed a single faint band at 60 kDa at 24  hpi that became distinct at 48 hpi.  The band at 60 kDa was observable at 72 and 96 hpi,  however, the signal is nearly undetectable due to the high amount of HA detection of  indiscriminate sizes from the top of the membrane to approximately 40 kDa.  Starting at 72  hpi a band was detected at 30 kDa and was also present at 96 hpi.       Figure 3.6.B showed results of the Western blot following infection with vorct‐HA3’.   At 24 hpi a single, distinct band at 60 kDa was detected.  The band at 60 kDa was also  observed at 48, 72, and 96 hpi, however, the signal was obscured at these time points by  high amounts of signal from the top of the blot to 40 kDa of indeterminable sizes.  The 60  kDa band is clearly represented on the original autoradiography film, but digital  reproduction is less clear.  At 48 hpi  a double band just below 40 kDa, a band just below 30  kDa and 2 bands between 20 kDa and 25 kDa were also detected.  The same band pattern is  observed at 72 and 96 hpi, with intensities increasing over time.  Lanes with protein from  mock wells showed no signal, indicating the specificity of the HA antibody for the HA‐tag  sequence (data not shown).    A Coomassie stained gel representing total protein from infected cells with the virus  v5’HA‐orct (Figure 3.6.C) showed no distinct bands corresponding to bands detected   91  through Western blotting.  Figure 3.6.D showed results of Coomassie staining protein  collected from cells infected with vorct‐HA3’.  Cells collected 24 – 72 hpi showed no distinct  bands corresponding to the bands detected by Western blotting.  At 96 hpi dark protein  bands were observed between 50‐60 kDa, a doublet was seen between 40‐50 kDa as well as  a band slightly larger than 30 kDa and slightly less than 30 kDa.  These signals correspond  with signals observed on the vorct‐HA3’ Western blot (Figure 3.6.B, Lanes 7‐8).    3.4 Summary    ORCT was expressed successfully in insect Sf9 cell lines using both transfections  with a transient and baculovirus vector, and infection with collected BV.  Proof of method  was confirmed through the parallel transfections with a plasmid containing a GFP  construct.  GFP production was observed through fluorescent imaging as soon as 24 hpt and  appeared to increase in intensity over the next 24 hours.  Following transfection with  p2ZOPe2 constructs, the HA‐tag was detected at all time points tested, although protein was  not detected through Coomassie staining.  Bands detected through Western blotting near  60 kDa (Figure 3.4.A; Figure 3.6.B) correspond to the predicted molecular weight of the  ORCT protein (Chapter 2).  Bands less than 60kDa are most likely the result of protein  turnover and degradation within the cells.  Bands larger than 60 kDa could be the result of  post‐translational modifications of the protein.  Alternatively, multiple banding patterns  could be due to non‐specific binding of the secondary antibody.  Transfection with pAcBac  was detected through Western blotting at 48 hpt, but not at 24 hpt.  The blots included  bands > 80kDa and between 40 – 60 kDa.  No protein was detected for pAcBac transfection  through Coomassie staining.  Following infection with BV, the HA‐tag was detected at all  time points tested, and bands increased in intensity from 24 hpi to 96 hpi.  Protein bands   92  were detected by Coomassie staining following infection with vorct‐HA3’ only at 96 hpi.   These bands correspond to bands detected through Western blotting.   The specificity of the  HA antibody for the HA‐tag sequence indicated successful expression of the ORCT protein.   Protein was detected through both transfections and infections with various expression  vectors.  Functional studies using transfected Sf9 cells expressing the ORCT protein are  needed to confirm that the protein is functional and expressed to a level high enough to be  physiologically relevant.  Results of this chapter indicated that Sf9 cells could be a potential  expression system for the study of ORCT and ORCT2 function.                                                              93                              Table 3.1 Expression primers for cloning into pFastBac™1 (FB) and p2ZOPe2 (OP).  Primer color coding:  black, 5’ end tag; red, restriction site; blue, Kozac sequence; tan, HA‐tag sequence; green, gene of interest with  bolded start and stop codons. Primer naming code: FB, pFastBac™1; OP, p2ZOPe2; f, forward; r, reverse; 1 or  2, pair number; HA, HA‐tag; NHA, no HA‐tag; bam, BamHI; hind, HindIII.                             94      Figure 3.1 Schematic diagram showing constructs and cloning into p2ZOPe2.  The vector is under the control  of 2 ie2 promoters.  One controls transcription of the foreign gene, the other controls transcription of zeocin  resistance in Sf9 cells.  The ColE1 promoter controls replication of the plasmid in bacterial cells, while a  bacterial promoter (EM7) controls transcription of a zeocin resistant gene in bacterial cells.  Each construct  was flanked by HindIII and BamHI restriction sites for insertion into the plasmid, and has a Kozac sequence for  ribosomal recognition at the 5’ end.  Additionally, an HA‐tag sequence was added to one construct at the N‐ terminus and one construct at the C‐terminus.     95    Figure 3.2 Schematic diagram showing constructs and cloning into pAcBac.  Insertion of the Tn7 transposition  sites from the shuttle vector pFastBac™‐1 containing the foreign gene are shown.  Transcriptional regulation  of the foreign gene is under the control of a polyhedrin promoter.   The vector contains an Sv40 poly‐A tail  that is added to the foreign gene transcript.  A gentamicin resistance gene confers selection to both pAcBac  and to the shuttle vector pFastBac™‐1. Each construct was flanked by HindIII and BamHI restriction sites for  insertion into the plasmid, and had a Kozac sequence for ribosomal recognition at the 5’ end.  Additionally, an  HA‐tag sequence was added to one construct at the N‐terminus and one construct at the C‐terminus.       96                  Figure 3.3 Images of Sf9 cells following transfection with pE28‐GFP.  GFP images 24 hpt (A) and 48 hpt (C)  showed positive transfections.  Bright field images 24 hpt (B) and 48 hpt (D) showed the health of the Sf9 cells  following transfections.  Mock transfections showed no background fluorescence (E) and were used to  compare cell morphology to Sf9 cells that had undergone transfection (F).  Images were taken at 40x total  magnification.   97          Figure 3.4 Results of transfection with p2ZOPe2 constructs.  Western blots of ORCT constructs at A) 24 hpt  and B) 48 hpt were probed with a primary mouse anti‐HA antibody and a secondary peroxidase‐conjugated  goat anti‐mouse IgG antibody.  Lanes were loaded with two technical replicates for the following proteins: 1‐2,  pZOP5’HA‐orct; 3‐4, pZOPorct‐HA3’; 5‐6, pZOPorctN; 7, pZOPctl; 8, mock.  Coomassie stained SDS‐PAGE gels loaded  with protein from cells collected from C) 24 hpt and D) 48 hpt show no distinct bands associated with the  Western blot.  Lanes were loaded with two technical replicates for the following protein: 1‐2, pZOP5’HA‐orct; 3‐4,  pZOPorct‐HA3’; 5‐6, pZOPorctN; 7, pZOPctl; 8, mock; 9, COLORPLUS™ Prestained Protein Ladder; 10, protein ladder.      98          Figure 3.5 Results of transfection with pAcBac constructs.  Western blots of ORCT constructs at A) 48 hpt  were probed with a primary mouse anti‐HA antibody and a secondary peroxidase‐conjugated goat anti‐mouse  IgG antibody.  Lanes were loaded with the following protein: 1‐2, pAcBac5’HA‐orct; 3‐4, pAcBacorct‐HA3’; 5‐6,  pAcBacorctN; 7, pAcBacctl; 8, mock.  Coomassie stained SDS‐PAGE gels loaded with protein from cells collected  from B) 24 hpt and C) 48 hpt show no distinct bands associated with the Western blot.  Lanes were loaded  with the following: 1‐2, pAcBac5’HA‐orct; 3‐4, pAcBacorct‐HA3’; 5‐6, pAcBacorctN; 7, pAcBacctl; 8, mock.  ; 9,  COLORPLUS™ Prestained Protein Ladder (NEB); 10, protein ladder.         99        Figure 3.6 Results of infection with budded virus constructs.  Western blots of A) v5’HA‐orct and B) vorct‐ HA3’ probed with a primary mouse anti‐HA antibody and a secondary peroxidase‐conjugated goat anti‐mouse  IgG antibody.  Lanes were loaded with the following: 1‐2, 24 hpi; 3‐4, 48 hpi; 5‐6, 72 hpi; 7‐8, 96 hpi.  Mock  wells and controls were probed but are not shown as they were identical to previous controls (Figure 3.4;  Figure 3.5).  Coomassie‐stained SDS‐PAGE gels loaded with protein from cells collected from C) v5’HA‐orct  and D) vorct‐HA3’.  Lanes were loaded with the following: 1‐2, 24 hpi; 3‐4, 48 hpi; 5‐6, 72 hpi; 7‐8, 96 hpi. 9,  COLORPLUS™ Prestained Protein ladder (D)‐Mock); 10 mock infection (D) ‐ COLORPLUS™ Prestained Protein  Ladder.    ‘     100  Chapter 4   Discussion   4.1 General Discussion     Previous chapters of this thesis described the molecular identification and  heterologous expression of two putative organic cation transporter genes, orct and orct2,  from the fruit fly Drosophila melanogaster.  Cloning of these transporters has provided new  insights into the molecular basis of organic cation transport across D. melanogaster tissues  by classifying the cloned sequences and elucidating the mRNA expression profiles.  Previous  studies had shown the ability of D. melanogaster MTs and midgut to transport OCs (Rheault  and O’Donnell, 2004; Rheault et al., 2005).  However, the transporter(s) governing the  transcellular movement of these compounds in insects had yet to be determined.   Expression of these transport proteins in insect Sf9 cell lines marks the first step at  determining the function of a predicted OCT from an insect.  Successful production of the  ORCT and ORCT2 proteins in Sf9 cells could lead to the development of new physiological  assays for the study of insect OCT proteins.  The study of insect proteins within an insect  expression system allows production and modification of the protein within a relatively  native intracellular environment that would help to remove speculation surrounding  conclusions drawn with respect to protein function when proteins are expressed in a more  distantly related system (i.e. yeast, mammalian cells).  Relative mRNA expression of the two  gene transcripts was studied according to the newest and most stringent guidelines for  qPCR analysis.  The qPCR assay developed for this thesis will serve to train future students  and researchers in correct experimental qPCR design.  Chapter 2 describes the sequence  analysis and molecular identification of the two gene transcripts as well as examination of  the mRNA expression of these two genes following exposure to the prototypical type I OC,  TEA.  Chapter 3 is the first study to express an isolated insect OCT in a heterologous   101  expression system.  Thus the results of this thesis provide the first molecular candidates to  support previous physiological evidence for TEA transport across the tissues of D.  melanogaster.     4.2 Molecular Identification of Organic Cation Transporters in D. melanogaster    Two putative OCT genes had been previously identified in D. melanogaster and  named orct (Taylor et al., 1997) and orct2 (Hoskins et al., 2007).  I have cloned and  conclusively sequenced these putative genes for the first time.  Using sequence analysis  tools, these genes have been molecularly classified based on peptide sequence and  phylogenetics.  Alignments between the cloned nucleotide sequences and the predicted  sequence for orct and orct2 showed a number of silent nucleotide substitutions, as well as  substitutions which resulted in amino acid transitions (Table 2.5; Table 2.6, Chapter 2).  The  contiguous sequence for each gene that was created from 5 times sequencing coverage of 4  isolated clones, yielded identifiable nucleotide sequences for orct and orct2 that were more  robust than predicted sequences gathered from shotgun genome sequencing.  I identified  amino acid differences from the predicted genome sequence in the putative ORCT protein,  which fell within TMD2 and within the intracellular carboxyl end, whereas amino acid  differences in ORCT2 fell within the large extracellular loop between TMD1 and TMD2.   Predicted post‐translational modification sites were unaffected by any amino acid  substitution. One substitution in the ORCT2 peptide sequence fell within a predicted N‐ linked glycosylation site.  Mutation of the N‐glycosylation sites of the rabbit OCT2 protein  expressed in Chinese hamster ovary cells has been shown to have functional effects on the  OCT2 protein (Pelis et al., 2006). In that study individual mutation of the three  glycoslylation sites resulted in decreased plasma membrane expression and increased   102  protein turnover. As a result, the transport of TEA was reduced accordingly in these  mutants (Pelis et al., 2006). Mutation at all three N‐glycosylation sites resulted in OCT2  being sequestered to an unidentified intracellular compartment (Pelis et al., 2006). In this  study the mutation of a predicted N‐glycoslylation site might suggest an effect on protein  function. Further studies using mutation analysis and Western blotting to determine levels  of N‐glycoslylation as well as expression of mutant and wild‐type ORCT and ORCT2 may  provide interesting functional information with regard to insect OCT.     Additionally, a number of conserved sequence motifs indicative of vertebrate  members of the major facilitator superfamily were identified in these D. melanogaster   transporters.  This supports the grouping of ORCT and ORCT2, based on sequence, into the  MFS 2.A.1.19 category (2, electrochemical potential driven porters; A,  uniporter/symporter/antiporter; 1, MFS; 19, organic cation transporters) (Saier, 2000).   Insect orthologs of ORCT and ORCT2 shared domains with representative vertebrate  orthologs, along with sharing a number of conserved sequences among themselves.  This  thesis proposed a number of identifiable conserved domains in insect OCT‐like orthologs.   This indicated a higher degree of similarity between insect orthologs compared to  vertebrate orthologs.  Shared identity could allow inference of function between insect  orthologs following characterization of ORCT and ORCT2.  Not included in this analysis was  the insect orthologs from A. aegypti.  The sequence from A. aegypti was observed to be  highly dissimilar to both vertebrate and insect orthologs within noted conserved domains.    Topology analysis yielded predicted secondary structures for ORCT and ORCT2 that  contained 12 TMDs and intracellular amino and carboxyl ends.  Each peptide sequence was  predicted to have a large extracellular loop between TMD1 and TMD2 and a large  intracellular loop between TMD6 and TMD7; both are characteristic of vertebrate orthologs   103  (Wright and Dantzler, 2004).  A similar number of post‐translational N‐linked glycosylation  sites were predicted between TMD1 and TMD2 in ORCT and ORCT2 as vertebrate  transporters.  Thus ORCT and ORCT2 based on sequence topology and conserved domains,  appeared to be closely related to vertebrate OCT orthologs.  Given these similarities,  pairwise alignments and phylogenetic analysis were performed with the goal of further  classifying and categorizing the ORCT and ORCT2 proteins.     When orthologous peptide sequences were compared, ORCT and ORCT2 had higher  similarity to each other than any other ortholog pairs tested (Table 2.7, Chapter2).   Similarity was high between insect orthologs with the exception of the A. aegypti ortholog.   Rheault et al. (2006) found that TEA was not transported by the MTs of A. aegypti.  The  proposed rational was that A. aegypti, being hematophagous, possess a life history that did  not require excretion of plant defensins and pesticides and had therefore not allowed the  evolution of an organic cation transporter.   Similarity in the D. melanogaster peptide  sequences to individual OCT isoforms from humans was low, averaging ~30%.  As well,  similarity between D. melanogaster sequences to the predicted orthologs in A. aegypti was  equally low (35% to ORCT), as was similarity between A. aegypti and human orthologs  (Table 2.7, Chapter 2).     Similarity from pairwise alignments was reflected in the phylogenetic analysis of 37  ortholog sequences, representing OCT isoforms as well as OCTN isoforms and predicted  insect orthologs.  Also represented in the phylogram are sequences identified by Eraly and  Nigam (2002, 2004), named fly‐like putative transporters, or FLIPT1 and FLIPT2.  These  gene sequences have been included in analysis of vertebrate organic cation transporters  and thus have been included in this phylogram.  Preliminary studies of these proteins have  shown them to be importers of an anticancer agent doxorubicin in human tumor cells   104  (Okabe et al., 2005), although functional characterization of these proteins is incomplete.   Results of the phylogram indicated that ORCT and ORCT2 exist within an insect specific  clade, equally divergent from OCT1 and OCT2, and OCT3 and OCTN isoforms (Figure 2.17,  Chapter 2).  Also reflected in the phylogram was the divergence of the A. aegypti predicted  sequence from other transporters.  Evidence described in this thesis expands upon previous  research (Rheault et al., 2006) to suggest that A. aegypti may not possess a specific organic  cation transporter and thus elimination of these compounds may occur through either a  paracellular or p‐glycoprotein mediated transport pathway.     Phylogenetic analysis was originally undertaken in the attempt to answer the  question: can function of ORCT and ORCT2 be inferred by sequence similarity to a single  isoform of OCT?  The answer, based on the presented phylogram, is no.   Although sequence  domains support the grouping of OCRT and ORCT2 into the family of OCT‐like transporters,  equal divergence from functionally characterized transporters from vertebrates does not  allow further grouping of these transporters into an identified isoform group.  This could  indicate that the D. melanogaster proteins share functional kinetic properties and substrate  specificities from all isoforms found in vertebrates, or more likely, the D. melanogaster  proteins have their own unique functional profiles.  Therefore previous studies elucidating  the function and substrate associations of OCT1, OCT2, and OCT3, can be used as guidelines  only as to the assays that should be performed on ORCT and ORCT2, but should not be used  as a predictive model as to how these transporters will function.  The next step in  classifying the ORCT and ORCT2 proteins then, is to functionally characterize the isolated  proteins in a heterologous expression system.        105  4.3 Heterologous Protein Expression in Insect Sf9 Cells     This thesis described the preliminary steps of evaluating a protein expression  system using a number of delivery systems with the future goal of ascertaining function of  the D. melanogaster proteins.  This is the first time any insect OCT protein would be  expressed in a heterologous system for study.  Insect Sf9 cells were chosen as an expression  system, because as insect derived cells, previously proven to express heterologous  membrane proteins (Hegedus et al., 1999), these cells would most closely mimic the native  environments of the D. melanogaster proteins to allow correct post translational  modification and membrane lipid composition.  A BLAST search of the Sf9 cell line genome  did not reveal an ortholog sequence to ORCT or ORCT2.  It is possible that Sf9 cells, because  of their derivation from pupal ovary, lack an OCT, which would mean that background  levels of TEA transport for physiological assays should be low.  Transfection of Sf9 cells  with a plasmid vector as well as transfection and subsequent, parallel infection with a  baculovirus were used to deliver the foreign protein.  A detectable amount of HA‐tagged  protein was observed with all delivery methods tested through Western blotting.  Detection  with the HA antibody was specific to the HA tag sequence, confirmed through the use of  multiple controls at each stage of the transfection/infection (Figure 3.4; Figure 3.5, Chapter  3).  Intensity of detection increased over time following infection, indicating a higher  amount of heterologous protein expression (Figure 3.6, Chapter 3).  Banding patterns  observed on the blots did not always coincide with the predicted 60 kDa molecular weight  of the ORCT protein.  Bands observed higher than 60 kDa could be the result of post‐ translational protein modification which could add roughly 12 kDa of weight from each N‐ linked glycosylation alone (Taylor and Drickamer, 2011).  This could be confirmed through  purification of the protein and digestion with N‐glycanase.  The protein can then be   106  visualized using SDS‐PAGE and the protein motility observed (Lu et al., 1997).  Bands  observed lower than the predicted 60 kDa are most likely the result of protein degradation  and protein turnover.  Alternatively, multiple bands could indicate non‐specific binding, or  cross reactivity, of the secondary antibody.  To test this alternate possibility a number of  controls could be employed: 1) probe blots with an alternative secondary HA‐ antibody, 2)  probe blots with the secondary antibody in the absence of the primary antibody, 3)  optimize the amount of each antibody to apply with a dilution series.  In the case of BV  infection multiple banding could be the results of over production of the protein  overwhelming intracellular protein processing systems, resulting in fragmented and  unfinished protein (O’Reilly et al., 1994).  Thus a more narrow time course with collection  every 4‐6 hpi would have to be conducted in order to determine an appropriate time post‐ infection to conduct functional assays so that expression levels are optimal.     Although, protein was detected with all delivery systems, protein was not detected  at all time points tested post transfection.  It has been suggested that the transfection  process does not exactly match the infection process (Nie and Theilmann, 2010; Stewart et  al., 2005).  As a matter of methodology, time post transfection and time post infection is  measured when either the transfection cocktail or BV respectively, is applied to the cells.   However, this does not necessarily accurately represent the time when the bacmid or  plasmid is incorporated into the cells.  During an infection time course, uptake of the BV  into the cells occurs almost immediately upon application, thus beginning the virus life  cycle, whereas during a transfection time course, there may be a delay between application  of the DNA and uptake into the cells and the beginning of transcription.  Therefore  differences observed through Western blotting between transfections with pAcBac and BV   107  infections, specifically the absence of detection at 24 hpt (Figure 3.5, Chapter 3), could be  due to definitions of time and not actual events in the virus life cycle.    In this study, results of protein production detected by Western blotting were not, in  all cases, mimicked in the Coomassie stained gels.  It can be expected that staining a  Coomassie gel for 24 hours allows detection of 0.1μg of protein in a visible band (Sambrook  and Russell, 2001).   A lack of visible bold bands observed through Coomassie staining,  indicated a low amount of protein produced above background total protein levels from Sf9  cells.  Infection with BV, 72 and 96 hpi yielded dark, visible bands on the Coomassie stained  gel that corresponded to bands detected through Western blotting, indicating higher levels  of protein production (Figure 3.6, Chapter3).  However, the amount of non‐specific banding  in the Western due to previously discussed protein over production make these time points  less than ideal for functional assays.     The research shown here laid the preliminary groundwork for expression of D.  melanogaster OCT‐like proteins in insect Sf9 cell lines.  Stably expressing polyclonal Sf9  cells were produced with the p2ZOPe2 delivery vector through maintained antibiotic  selection.  Expression in these cells has yet to be confirmed through Western blotting,  however, their creation gives future researchers the first step towards designing functional  assays to characterize the ORCT protein.  Functional assays are the next step in confirming  Sf9 cells as an appropriate heterologous expression system for the study of these  transporters.  Simple uptake studies with C14TEA or fluorescent labeled TEA would confirm  a number of hypotheses: 1) That ORCT is able to transport TEA, 2) That the amount of  ORCT protein produced in Sf9 cells is enough to allow detectable amounts of C14TEA  uptake, 3) The ORCT protein is functional and correctly inserted into the cell membrane, 4)   108  Sf9 cells have no background transport of TEA, or that background uptake of TEA is  minimal in non transfected cells when compared to transfected cells.     4.4 Relative mRNA Expression of orct and orct2    Using a TEA ion‐selective microelectrode, Rheault and O’Donnell (2004),  demonstrated for the first time the transport of TEA across the epithelial cells of the main  and lower segments of the MTs, the ureter and midgut of D. melanogaster.  Calculation of  the transport capacity of TEA in these tissues indicated that uptake was a carrier mediated,  active process.  The transport protein responsible for the movement of organic cations  across these tissues has yet to be conclusively identified.  Relative mRNA expression of the  two putative OCTs, orct and orct2, was assessed across a number of D. melanogaster tissues  using qPCR.  Results indicated that orct was constitutively, highly expressed in the MTs  relative to whole body under control conditions.  This localization profile supports the  previously mentioned physiological findings by Rheault and O’Donnell (2004).  Although  expression of orct2 was constitutively low in the tissues tested relative to its own whole  body expression, when compared to orct, whole body expression of orct2 was nearly 5 fold  higher.  This indicates that although orct2 expression in tested tissues was low, its  expression profile could be stronger in other tissues (i.e. fat body, salivary glands).      When exposed to TEA concentrations reflecting larval LC50 and larval 1/2LC50 for  TEA (Bijelic et al., 2005) for 1 and 15 generations, midgut expression increased for both  orct and orct2.  Rheault and O’Donnell (2004) calculated JMAX for transport of TEA across the  posterior midgut to be 3.7 pmol cm‐2 s‐1.  A value much lower than that calculated for  transport kinetics of TEA across the lower MT  (JMAX = 17.8 pmol cm‐2 s‐1).  However, given  the roughly 8‐fold difference in surface area between the MT and midgut (Maddrell, 2009), I   109  propose that overall transport capacity of the midgut for TEA is higher than that of the  paired MTs.  Therefore any increase in gene expression of orct and orct2 could, given no  transcriptional regulation, play a significant part in the elimination of excess TEA from the  insect across the midgut.      Rheault and O’Donnell (2004) calculated Km values for TEA across the MTs and the  midgut to be 0.13 and 0.22 respectively.  Km values could be thought of as a measure of  tissue affinity for a substrate.  Different Km values in the MTs and midgut indicated that  either different transporters were responsible for TEA uptake in these tissues, or that a  number of transporters were differentially distributed between these tissues.  The research  presented in this thesis supported differential expression of orct and orct2 across the  Malpighian tubules and the midgut, with orct displaying higher expression in the MTs and  orct2 displaying higher expression in the midgut (Figure 2.19).    Increases in expression of orct in the MTs and ovary following 15 generations of  exposure could indicate adaptation to environmental conditions.  The possibility exists that  changes in expression of orct and orct2 could be due to a stress response, brought on by  increased toxicity in the fly, due to the high amount of TEA in the media.  This could be  tested by studying the regulation of other stress induced genes (i.e. heat shock proteins) or  by studying the expression of orct and orct2 while the flies are exposed to other conditions  of stress (i.e. prolonged high ambient temperature, anoxic conditions).    There was a trend observed in all tissues tested for expression to increase following  15 generations of exposure that appears to be independent of exposure concentration.   Chahine and O’Donnell (2010), showed that D. melanogaster exposed to methotrexate, a  prototypical organic anion, took over 10 generations of chronic exposure to register any  observable change in gene expression.  In contrast, more recent studies using A. aegypti,   110  another dipteran, have shown that increases in the expression of metal transporting,  membrane bound proteins can be measured following only 24 hours of exposure (Bobyn, P.  and Matier, B.J., University of British Columbia – Okanagan, unpublished data).     Expression of vertebrate OCT orthologs studied through Northern blots showed that  all OCT isoforms are present in the kidney (Table 1.1, Chapter1), and most are present in  the liver.  This localization pattern is consistent with transporters responsible for the  elimination of toxins.  Presence of the orct and orct2 transcripts in tissues of the insect  alimentary and excretory system support the hypothesis that these transporters play at  least a partial role in the elimination of organic cations from the insect.     4.5 Future Studies     Although several questions and future lines of study have been identified through  this discussion, there are additional questions regarding the mechanism governing the  elimination of OCs by the excretory system of D. melanogaster and specifically, the further  characterization of ORCT and ORCT2:     1) Do the ORCT and ORCT2 proteins transport prototypical OCs such as TEA?    Characterization of the transport kinetics and substrate profiles of the ORCT and ORCT2  proteins is essential to understanding the mechanism of OC transport in D. melanogaster  and other insects.  A number of expression systems can be evaluated for the study of  protein function and used to assess different qualities of the protein.  Rheault and O’Donnell  (2004) varied bathing concentration of TEA and observed uptake of a TEA over a series of  time points to calculate Km and JMAX for flux across D. melanogaster tissues.  Sf9 cell lines  could be used for simple uptake assays that test time dependent and concentration   111  dependent uptake kinetics of C14TEA.  Cell lines can be used for competition studies using  other type I and type II OCs to inhibit C14TEA uptake.  Expression of ORCT and ORCT2 in X.  laevis oocytes could provide a useful model system to study the dependence on membrane  voltage and the electrogenicity of the transport protein through voltage clamp studies.   Rheault et al. (2005), varied saline concentrations of cations to mimic membrane  depolarization and hyperpolarization of cells of MTs from D. melanogaster.  Oocytes could  be used in the same way, for uptake studies and inhibition studies by varying the amount of  cations in the bathing saline and measuring C14TEA uptake.  A more recent technique that  would allow similar functional assays comes from research that synthesized brush border  membrane vesicles (Harvey et al., 2010).  This technique has the benefit of using the  insect’s own membrane, containing its own native membrane proteins from chosen tissues  to create small vesicles that can be exposed to substrates for uptake studies.  The benefits of  this technique are that brush border membrane vesicles do not rely on correct assembly of  the protein of interest in a heterologous system and the technique allows researchers to  assess transport capacity of certain tissues in isolation.  The limitation is that researchers  lose the ability to differentiate the contributions of individual transporters to net flux of a  substrate.  Instead, all transporters present on the native brush border membrane are  represented in the vesicle.         2) Does protein expression mimic trends of mRNA expression and to what membrane  are ORCT and ORCT2 localized?   This thesis examined mRNA expression in a few D. melanogaster tissues using qPCR,  however, whole body localization studies using in situ hybridization or reverse  transcription PCR would be useful in determining other tissues where the orct and orct2   112  transcripts are expressed.  mRNA could be extracted from additional D. melanogaster  tissues thought to be important in the elimination or sequestration of toxic compounds (i.e.  hindgut, fat body, salivary gland) and analyzed for the presence of orct and/or orct2  transcripts through reverse transcription PCR.  If transcripts are found in certain tissues,  qPCR could be used to quantify the expression within identified tissues.  As a matter of  practicality, as not all tissues are easily extracted in a large enough quantity for RNA  extraction, whole mount in situ hybridization could be used as an alternative to probe for  orct and orct2 transcripts.       The ORCT and ORCT2 proteins could be localized to either the basolateral or apical  membrane of the MTs through immunohistochemistry.  mRNA expression supports the  presence of these transporters in excretory tissues and based on previous studies, these  transporters have been hypothesized as the basolateral membrane proteins responsible for  the movement of type I OCs into epithelial cells of the MTs and midgut (Figure 1.5,  Chapter1) (Rheault and O’Donnell, 2004; Rheault et al., 2005).   It is possible therefore that  one (or both) of these transporters is basolateral and that the other (or both) could act as  an apical transporter.  Immunohistochemistry would also allow researchers to correlate  mRNA expression patters to protein expression patterns observed.  It is possible that  although mRNA expression increased with exposure to OCs, that this increase is not  adaptive, and does not correlate to an increase in protein expression.               113  References    Altschul, S.F., Gish, W., Miller, W., Myers, E.W. and Lipman, D.J. (1990). Basic local  alignment search tool.  J. Mol. Biol. 215, 403‐410.     Bakos, E., Evers R., Sinko, E., Varadi, A., Borst, P. and Sarkadi, B. (2000). Interactions of  the human multidrug resistance proteins MRP1 and MRP2 with organic anions.  Mol.  Pharmacol. 57, 760‐768.    Bertram, G., Schleithoff, L., Zimmermann, P. and Wessing, A. (1991). Bafilomycin A1 is a  potent inhibitor of urine formation by Malpighian tubules of Drosophila hydei: Is a  vacuolar‐type ATPase involved in fluid secretion? J. Insect Physiol. 37, 201‐209.    Beyenbach, K.W. (2003). Transport mechanisms of diuresis in Malpighian tubules of  insects. J. Exp. Biol. 206, 3845‐3856.     Bijelic, G., Kim, N.R. and O’Donnell, M.J. (2005). Effects of dietary or injected organic  cations on larval Drosophila melanogaster: Mortality and elimination or  tetraethylammonium from the hemolymph. Arch. Insect Biochem. Physiol. 59, DOI:  10.1002/arch.20085.    Bijelic, G. and O’Donnell, M.J. (2005). Diuretic factors and second messengers stimulate  secretion of the organic cation TEA by the Malpighian tubules of Drosophila  melanogaster. J. Insect Physiol. 51, 267‐275.    Bohr­Gasse, (2007). “The Predictor”. NMT‐ The MYR predictor.  http://mendel.imp.ac.at/myristate/SUPLpredictor.htm (13 July, 2011).    Boom, S.A.P., Gribnau, F.W.J and Russel, F.G.M. (1992). Organic cation transport and  cationic drug interactions in freshly isolated proximal tubular cells of the rat. J.  Pharmacol. Exp. Ther. 263, 445‐450.      114  Bowman, E.J., Siebers, A. and Altendorf, K. (1988). Bafilomycins: A class of inhibitors of  membrane ATPases from microorganisms, animal cells, and plant cells. Proc. Natl. Acad.  Sci. USA. 85, 7972‐7976.    Brondyk, W. H. (2009). Selecting an appropriate method for expressing a recombinant  protein. Method. Enzymol. 463, 131‐147.    Bubner, B., Gase, K. and Baldwin, I.T. (2004). Two‐fold differences are the detection limit  for determining transgene copy numbers in plants by real‐time PCR. BCM biotechnol.  13, 4‐14.     Burg, M.B. and Weller, P.F. (1969). Iodopyracet transport by isolated perfused flounder  renal proximal tubules. Am. J. Physiol. 217, 1053‐1056.    Busch, A.E., Quester, S., Ulzheimer, J.C., Waldegger, S., Gorboulev, V., Arndt, P., Lang, F.  and Koepsell, H. (1996). Electrogenic properties and substrate specificity of the  polyspecific rat cation transporter rOCT1. J. Biol. Chem. 271, 32599‐32604.    Buss, D.S. and Callaghan, A. (2008).  Interaction of pesticides with p‐glycoprotein and  other ABC proteins: a survey of the possible importance to insecticide, herbicide and  fungicide resistance.  Pestic. Biochem. Phys. 90, 141‐153.    Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R.,  Nolan, T., Pfaffl, M.W., Shipley, G.L., Vandesompele, J. Wittwer, C. (2009). The MIQE  guidelines – minimum information for publication of quantitative real‐time PCR  experiments. Clin. Chem. 55, 611‐622.    Chahine, S. and O’Donnell, M.J. (2009). Physiological and molecular characterization of  methotrexate transport by Malpighian tubules of adult Drosophila melanogaster. J.  Insect Physiol. 55, 927‐935.     115  Chahine, S. and O’Donnell, M.J. (2010). Effects of acute or chronic exposure to dietary  organic anions on secretion of methotrexate and salicylate by Malpighian tubules of  Drosophila melanogaster larvae. Archiv. Insect Biochem. Physiol. 73, 128‐147.    Dai, X., Willis, L.G., Palli, S.R. and Theilmann, D.A. (2005). Tight transcriptional  regulation of foreign genes in insect cells using an ecdysone receptor based inducible  system. Protein Expres. Pruif. 42, 236‐245.     Dantzler, W.H. (1989). Organic acid (or anion) and organic base (or cation) transport by  renal tubules of nonmammalian vertebrates. J. Exp. Zool. 249, 247‐257.    Dantzler, W.H., Wright, S.H. and Brokl, O. (1991). Tetraethylammonium transport by  snake renal brush‐border membrane vesicles. Pflügers Arch. 418, 325‐332.    Dow, J.A.T. (2009). Insights into the Malpighian tubule from functional genomics. J. Exp.  Biol. 212, 435‐445.    Dow, J.A.T. and Davies, S.A. (2001). The Drosophila melanogaster Malpighian tubule, a  genetic model for insect epithelia. Adv. Insect Physiol. 28, 1‐83.    Dow, J.A., Maddrell, S.H.P., Gortz, A., Skaer, N.J.V., Brogan, S. and Kaiser, K. (1994). The  Malpighian tubules of Drosophila melanogaster: a novel phenotype for studies of fluid  secretion and its control. J. Exp. Biol. 197, 421‐428.    Dresser, M.J., Leabman, M. and Giacomini, K.M. (2001). Transporters involved in the  elimination of drugs in the kidney: Organic anion transporters and organic cation  transporters. J. Pharm. Sci. 90, 397‐421.    Dresser, M., Zhang, L. and Giacomini, K. (1999). Molecular and functional characteristics  of cloned human organic cation transporters, in Amidon and Sadee. eds., Membrane  Transporters as Drug Targets, Kluwer Academic/Plenum Publishers, New York.  441‐ 469.   116  Drummond, A.J., Ashton, B., Buxton, S., Cheung, M., Cooper, A., Duran, C., Field, M.,  Heled, J., Kearse, M., Markowitz, S., Moir, R., Stones­Havas, S., Sturrock, S.,  Thierer,T. and Wilson, A. (2010) Geneious v5.3, Available from  http://www.geneious.com/    Eraly, S.A., Monte, J.C. and Nigam, S.K. (2004). Novel slc22 transporter homologs in fly,  worm, and human clarify the phylogeny of organic anion and cation transporters.  Physiol. Genomics. 18, 12‐24.     Eraly, S.A. and Nigam, S.K. (2002). Novel human cDNAs homologous to Drosophila Orct  and mammalian carnitine transporters. Biochem. Biophys. Res, Commun. 297, 1159‐ 1166.     Evans, J. M., Allan, A. K., Davies, S. A. and Dow, J. A. T. (2005). Sulphonylurea sensitivity  and enriched expression implicate inward rectifier K+ channels in Drosophila  melanogaster renal function. J. Exp. Biol. 208, 3771‐3783.    Gaertner, L.S. and Morris, C.E. (1999). Accumulation of daunomycin and fluorescent dyes  by drug transporting Malpighian tubule cells of the tobacco hornworm, Manduca sexta.  Tissue & Cell. 31, 185‐194.    Gaertner, L.S., Murray, C.L., and Morris, C.E. (1998). Transepithelial transport of nicotine  and vinblastine in isolated Malpighian tubules of the tobacco hornworm (Manduca  sexta) suggests a p‐glycoprotein‐like mechanism. J. Exp. Biol. 201, 2637‐2645.    Gasteiger E., Gattiker A., Hoogland C., Ivanyi I., Appel R.D., Bairoch A. (2003).  ExPASy:  the proteomics server for in‐depth protein knowledge and analysis. Nucleic Acids Res.  31, 3784‐3788.    GraphPad Prism. (2011). GraphPad Software, La Joll, CA. USA. V. 5.04 for Windows.  www.graphpad.com     117  Gründemann, D., Valentin, G., Gambaryan, S., Veyhl, M. and Koepsell, H. (1994). Drug  excretion mediated by a new prototype of polyspecific transporter. Nature, 372,  549‐552.    Harvey, W.R., Cioffi, M. and Wolfersberger, M.G. (1983). Chemiosmotic potassium ion  pump of insect epithelia. Am. J. Physiol. 244, R163‐R175.    Harvey, W.R., Okech, B.A., Linser, P.J., Becnel, J.J., Ahearn, G.A. Sterling, K.M. (2010). H+  V‐ATPase‐Energized transporters in brush border membrane vesicles from whole  larvae of Aedes aegypti. J. Insect Physiol. 56, 1377‐1389.     Hawk, C.T. and Dantzler, W.H. (1984). Tetraethylammonium transport by isolated  perfused snake renal tubules. Am. J. Physiol. 246, F476‐F487.    Hegedus, D. D., Pfeifer, T. A., Hendry, J., Theilmann, D. A. and Grigliatti, T. A. (1998).  A  series of broad host range shuttle vectors for constitutive and inducible expression of  heterologous proteins in insect cell lines. Gene. 207, 241‐249.    Hegedus, D. D., Pfeifer, T. A., Theilmann, D. A., Kennard, M. L., Gabathuler, R., Jefferies,  W. A. and Grigliatt, T. A. (1999).  Differences in the expression and localization of  human melanotransferrin in lepidopteran and dipteran insect cell lines. Protein Expres.  Purifi. 15, 296‐307.    Hellemans, J., Mortier, G., De Paepe, A., Speleman, F. and Vandesompele, J. (2007).  qBase relative quantification framework and software for management and automated  analysis of real‐time quantitative PCR data. Genome Biol. 8, R19.     Hofmann, K. and Stoffel, W. (1993). TMbase‐ a database of membrane spanning proteins  segments. Biol. Chem. 347, 166.      Hoskins, R.A., Carlson, J.W., Kennedy, C., Acevedo, D., Evans­Holm, M., Frise, E., Wan,  K.H., Park, S., Mendez­Lago, M., Rossi, F., Villasante, A., Dimitri, P., Karpen, G.H.   118  and Celniker, S.E. (2007). Sequence finishing and mapping of Drosophila melanogaster  heterochromatin. Science. 316, 1625‐1628.    Ianowski, J.P. and O’Donnell, M.J. (2004). Basolateral ion transport mechanisms during  fluid secretion by Drosophila Malpighian tubules: Na+:K+:2Cl‐ cotransport  and Cl‐  conductance.  J.Exp.Biol. 207, 2599‐2609.    Integrated DNA Technologies Inc. (2011). www.idtdna.com     Invitrogen. (2010). InsectSelect™ System: For the stable expression of heterologous  proteins in lepidopteran insect cell lines using pIZ/V5‐His. Version H.     Jehle, J. A., Blissard, G. W., Bonning, B. C., Cory, J. S., Herniou, E. A., Rohrmann, G. F.,  Theilmann, D. A., Thiem, S. M. and Vlak, J. M. (2006). On the classification and  nomenclature of baculoviruses: A proposal for revision. Arch. Virol. 151, 1257‐1266.    Kekuda, R., Prasad, P., Wu, X., Wang, H., Fei, Y., Leibach, F. and Ganapathy, V. (1998).   Cloning and functional characterization of a potential‐sensitive polyspecific organic  cation transporter (OCT3) most abundantly expressed in placenta.  J. Biol. Chem. 273,  1571‐1579.    Leader, J.P. and O’Donnell, M.J. (2005).Transepithelial transport of fluorescent  p‐glycoprotein and MRP2 substrates by insect Malpighian tubules: Confocal  microscopic analysis of secreted fluid droplets. J. Exp. Biol. 208, 4363‐4376.    Li, X., Schuler, M.A. and Berembaum, M.R. (2002). Jasmonate and salicylate induce  expression of herbivore cytochrome P450 genes. Nature. 419, 712–715.    Li, X., Schuler, M.A. and Berenbaum, M.R. (2007). Molecular mechanism of metabolic  resistance to synthetic and natural xenobiotics. Annu. Rev. Entomol. 52, 231–253.     119  Linton, S.M. and O’Donnell, M.J. (1999). Contributions of K+:Cl‐ cotransport and Na+/K+‐ ATPase to basolateral ion transport in Malpighian tubules of Drosophila melanogaster.  J.Exp.Biol.. 202, 1561‐1570.     Livak, K.J. and Schmittgen, T.D. (2001). Analysis of relative gene expression data using  real‐time quantitative PCR and the 2(‐Delta Delta C(T)) method. Methods. 25, 402‐408.     Lison, L. (1938). Études histophysiologiques sur les tubes de Malpighi des Insects. III.  L’élimination des colorants basiques chez les Orthoptères. Z. Zellforsch. Mikrosk. Anat.  28,179‐209.    Lu, D., Xie, R.L., Rydzewski, A. Long G.L. (1997). The effect of N‐linked glycosylation on  molecular weight, thrombin cleavage, and functional activity of human protein S.  Thromn. Haemost. 77, 1156‐1163.     Luckow, V. A., Lee, S. C., Barry, G. F. and Olins, P. O. (1993). Efficient generation of  infectious recombinant baculoviruses by site‐specific transposon‐mediated insertion of  foreign genes into a baculovirus genome propagated in Escherichia coli. J. Virol. 67,  4566‐4579.    Luckow, V.A. and Summers, M.D. (1988). Signals important for high‐level expression of  foreign genes in Autographica californica nuclear polyhedrosis virus expression  vectors. Virology. 167, 56‐71.     Maddrell, S.H.P. (1981). The functional design of the insect excretory system. J. Exp. Biol.  90, 1‐15.     Maddrell, S.H.P. (1991).  The fastest fluid‐secreting cell known‐ the upper Malpighian  tubule cell of Rhodnius. Bioessays. 13, 357‐362.     Maddrell, S.H.P. (2009). Insect homeostasis: past and future. J. Exp. Biol. 212, 446‐451.      120  Maddrell, S.H.P. and Gardiner, B.O.C. (1976). Excretion of alkaloids by Malpighian tubules  of insects.  J. Exp. Biol. 64, 267‐281.    Marusalin, J., Matier, B., Rheault, M.R. and Donini, A. (2011).  Aquaporin homologs in the  gut, Malpighian tubules and anal papillae of the larval mosquito, Aedes aegypti. J. Comp.  Physiol. B. Submitted.     Maseuda, S., Terada, T., Yonezawa, A., Tanihara, Y., Kishimoto, K., Katsura, T., Ogawa,  O. and Inui, K. (2006). Identification and functional characterization of a new human  kidney‐specific H+/organic cation antiporter, kidney‐specific multidrug and toxin  extrusion 2. J. Am. Soc. Nephrol. 17, 2127‐2135.    McKinney, T.D. (1984). Further studies of organic base secretion by rabbit proximal  tubules. Am. J. Physiol. 246, F282‐F289.    McKinney, T.D. and Kunnemann, M.E. (1985). Procainamide transport in rabbit renal  cortical brush border membrane vesicles. Am. J. Physiol. 249, F532‐F541.    McKinney, T.D., Myers, P. and Speeg, K.V. (1981). Cimetidine secretion by rabbit renal  tubules in vitro. Am. J. Physiol. 241, F69‐F76.     Meijer, D.K.F., Mol, W.E., Müller, M. and Kurz G. (1990). Carrier‐mediated transport in  the hepatic distribution and elimination of drugs, with special reference to the category  of organic cations. J. Pharmacokinetic Biopharm. 18, 35‐70.    Midgett, C. R. and Madden, D. R. (2007). Breaking the bottleneck: eukaryotic membrane  protein expression for high‐resolution structural studies. J. Struct. Biol. 160, 265‐274.    Miller, D.S. (1995). Daunomycin secretion by killifish renal proximal tubules. Am. J. Physiol.  269, R370‐R379.    Miller, D.S., Ficker, G. and Drewe, J. (1997). P‐glycoprotein‐mediated transport of a   121  fluorescent rapamycin derivative in renal proximal tubule. J. Pharmacol. Exp. Ther. 282,  440‐444.    Miller, D.S. and Holliday, C.W. (1987). Organic cation secretion by Cancer borealis urinary  bladder. Am. J. Physiol. Regulatory Integrative and Comp. Physiol. 252, R153‐R159.    Miller, D.S. and Holohan, P.D. (1987). Organic cation secretion in flounder renal tissue.  Am. J. Physiol. 253, R861‐R867.    Miller, L. K. (1988). Baculoviruses as Gene Expression Vectors. Annu. Rev. Microbiol. 42,  177‐199.    Miller, L. K., Ed. (1997). The Baculoviruses. The Viruses. Edited by H. F.‐C. a. R. R. Wagner.  New York: Plenum Press.    Nawata, C.M. and Wood, C.M. (2008). The effects of CO2 and external buffering on  ammonia excretion and Rhesus glycoprotein mRNA expression in rainbow trout.  J. Exp.  Biol. 211, 3226‐3236.     Nie, Y. and Theilmann, D.A. (2010). Deletion of AcMNPV AC16 and AC17 results in delayed  viral gene expression in budded virus infected cells but not transfected cells. Virology.  404, 168‐179.     Nijhout, H.F. (1975). Excretory role of the midgut in larvae of the tobacco hornworm,  Manduca sexta (L.). J. Exp. Biol. 62, 221‐230.    O’Donnell, M.J., Dow, J.A.T., Huesmann, G.R., Tublitz, N.J. and Maddrell S.P.H. (1996).  Separate control of anion and cation transport in Malpighian tubules of Drosophila  melanogaster. J. Exp. Biol. 199, 1163‐1175.      122  O’Donnell, M.J., Ianowski, J.P., Linton, S.M. and Rheault, M.R. (2003). Inorganic and  organic anion transport by insect renal epithelia. Biochim. Biophys. Acta. 1618, 194‐ 206.    O’Donnell, M.J. and Maddrell, S.H.P. (1983).  Paracellular and transcellular routes for  water and solute movements across insect epithelia. J. Exp. Biol. 106, 231‐253.    O’Donnell, M.J., Rheault, M.R., Davies, S., Rosay, P., Harvey, B., Maddrell, S.H.P., Kaiser,  K. and  Dow, J. A. T. (1998). Hormonally controlled chloride movement across  Drosophila tubules is via ion channels in stellate cells. Am. J. Physiol. Regul. Integr. Comp.  Physiol. 274, 1039‐1049.     O’Donnell, M.J. and Spring, J.H. (2000). Modes of control of insect Malpighian tubules:  synergism, antagonism, cooperation and autonomous regulation. J. Insect Physiol. 46,  107‐117.    Okabe, M., Unno, M., Harigae, H., Kaku, M., Okitsu, Y., Sasaki, T., Mizoi, T., Shiliba, K.,  Takanaga, H., Terasaki, T., Matsuno, S., Sasaki, I., Ito, S. and Abe, T. (2005).   Characterization of the organic cation transporter SLC22A16: a doxorubicin importer.  Biochem. Biophys. Res. Commun. 333, 754‐762.     Okuda, M., Saito, H., Urakami, Y., Takano, M. and Inui, K. (1996). cDNA cloning and  functional expression of a novel rat kidney organic cation transporter, OCT2. Biochem.  Bioph. Res. Co.  224, 500‐507.    O’Reilly, D.R., Miller, L.K. and Luckow, V.A. (1994). Post‐translational modification.  Baculovirus Expression Vectors: A Laboratory Manual. Oxford University Press Inc.  Oxford. 216‐236.    Otsuka, M., Matsumoto, T., Morimoto, R., Arioka, S., Omote, H. and Moriyama, Y.  (2005). A human transporter protein that mediates the final excretion step for toxic  organic cations. Proc. Natl. Acad. Sci. USA. 13, 17923‐17928.   123  Ott, R.J., Hui, A.C., Hsyu, P.H. and Giacomini, K.M. (1991). Organic cation transport in  human renal brush‐border membrane vesicles. Am. J. Physiol. 261, F443‐F451.    Ozvegy, C., Litman, T., Szakacs, G., Nagy, Z., Bates, S., Varadi, A. and Sarkadi, B. (2001).  Functional characterization of the human multidrug transporter, ABCG2, expressed in  insect cells. Biochem. Bioph. Res. Co. 258, 111‐117.     Pannabecker, T.L., Hayes, T.K. and Beyenbach, K.W. (1993). Regulation of epithelial  shunt conductance by the peptide leucokinin. J. Memb. Biol. 132, 63‐76.    Pelis, R.M., Suhre, W.M. and Wright, S.H. (2006). Functional influence of N‐glycosylation  in OCT2‐mediated tetraethylammonium transport. Am. J. Physiol. Renal Physiol. 290,  F1118‐F1126.    Pfaffl, M.W. (2001). A new mathematical model for relative quantification in real‐time RT‐ PCR. Nucleic Acidc Res. 29, e45.     Pritchard, J.B. and Miller, D.S. (1993). Mechanisms mediating renal secretion of organic  anions and cations. Physiol. Rev. 73, 765‐796.    Pfeifer, T. A., Guarna, M. M., Kwan, E. M., Lesnicki, G., Theilmann, D. A., Grigliatti, T. A.  and Kilburn, D. G. (2001). Expression analysis of a modified factor X in stably  transformed insect cell lines. Protein Expres. Purifi. 23, 233‐241.    Pfeifer, T., Hegedus, D., Wang, Y.­J., Zhao, Y., Meredith, J., Brock, H.W., Phillips, J.E.,  Grigliatti, T.A. and Theilmann, D.A. (1999). Analysis of an insect neuropeptide (ITP),  expressed in insect cell systems. Arch. Insect Biochem. 42, 245‐252.     Phillips, J. (1981). Comparative physiology of insect renal function. Am. J. Physiol. Regul.  Integr. Comp. Physiol. 241, R241‐257.    Rennick, B.R. (1981). Renal tubule transport of organic cations. Am. J. Physiol. Renal Fluid   124  Electrolyte Physiol. 240, F83‐F89.    Rennick, B.R., Moe, G.K., Lyone, R.H., Hoobler, S.W. and Neligh, R. (1947). Absorption  and renal excretion of the tetraethylammonium ion.  J. Pharmacol. Exp. Ther. 91, 210‐ 217.     Rheault, M.R., Debicki, D.M.D. and O’Donnell, M.J. (2005). Characterization of    tetraethylammonium uptake across the basolateral membrane of the Drosophila  Malpighian (renal) tubule. Am. J. Physiol. Regul. Integr. Comp. Physiol. 289, R495‐R504.    Rheault, M.R. and O’Donnell, M.J. (2004). Organic cation transport by Malpighian tubules  of Drosophila melanogaster: application of two novel electrophysiological methods.  J.Exp.Biol. 207, 2173‐2184.    Rheault, M.R., Plaumann, J.S. and O’Donnell, M.J. (2006). Tetraethylammonium and  nicotine transport by the Malpighian tubules of insects. J. Insect Physiol. 52, 487‐498.     Rohrmann, G. F. (1986). Polyhderin Structure. J. Gen. Virol. 67, 1499‐1513.    Rohrmann, G. F. (2008). Baculovirus Molecular Biology. NCBI bookshelf.    Rozen, S. and Skaletsky, H.J. (2000). Primer3 on the WWW for general users and for  biologist programmers. In: Krawetz, S. and Misener, S. (eds.) Bioinformatics Methods  and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ. 365‐386.     Saier, M.H. (2000). A functional‐phylogenetic classification system for transmembrane  solute transporters. Microbiol. Mol. Biol. Rev. 64, 354‐411.     Salkind, S.J. (1930). Farbstoffansscheidung iin den Malpigischen Gefässen der  Insedtenlarven. Z. Zellforsch mikrosk Anat. 10, 53‐72.     125  Sambrook, J. and Russell, D. (2001). Molecular Cloning: A Laboratory Manual. Cold Spring  Harbor Laboratory Press. Cold Spring Harbor, New York. 3rd Ed.      Sarkadi, B., Price, E., Boucher, R., Germann, U. and Scarborough, G. (1992). Expression  of the human multidrug resistance cDNA in insect cells generates a high activity drug‐ stimulated membrane ATPase. J. Biol. Chem. 267, 4854‐4858.    Schomig, E., Spitzenberger, F., Engelhardt, M., Martel, F., Orging, N. Grundemann, D.  (1998). Molecular cloning and characterization of two novel transport proteins from rat  kidney. FEBS Lett. 425, 79‐86.     Schramm, U., Fricker, G., Wenger, R. and Miller, D.S. (1995). P‐glycoprotein‐mediated  secretion of a fluorescent cyclosporine analogue by teleost renal proximal tubules. Am.  J. Physiol. 268, F46‐F52.    Schultz, J., Milpetz, F., Bork, P. and Ponting, C.P. (1999). SMART, a simple modular  architecture research tool: Identification of signaling domains. Proc. Natl. Acad. Sci. 95,  5857‐5864.    Schweikl, H., Klein, U., Schindlbeck, M. and Wieczorek, H. (1989). A vacuolar‐type  ATPase, partially purified from potassium transporting plasma membranes of tobacco  hornworm midgut. J. Biol. Chem. 264, 11136‐11142.    Sharma, R. C. and Schimke, R. T. (1996). Preparation of electro‐competent E. Coli using  saltfree growth medium. Biotechniques. 20, 44‐46.    Sigrist, C.J.S., Cerutti, L., de Castro, E., Langendijk­Genevaux, P.S., Bulliard, V., Bairoch,  A. and Hulo, N. (2010). PROSITE, a protein domain database for functional  characterization and annotation.  Nucleic Acids Res. 38, 161‐166.     Smith, G. E., Fraser, M. J. and Summers, M. D. (1983). Molecular engineering of the  Autographica californica nuclear polyhedrosis virus genome: deletion mutations within   126  the polyhedrin gene. J. Virol. 46, 584‐593.    Smith, P.M., Pritchard, J.B. and Miller, D.S. (1988). Membrane potential drives organic  cation transport into teleost renal proximal tubules. Am. J. Physiol. 255, R492‐R499.    Sperber, I. (1947). The mechanism of renal excretion of some detoxification products in the  chicken. Proc. Int. Congr. Physiol. 17th, Oxford. 217‐218.     Stewart, T.M., Huijskens, I., Willis, L.G. and Theilmann, D.A. (2005). The Autographa  californica multiple nucleopolyhedrovirus ie0­ie1 gene complex is essential for wild‐ type virus replication, but either IE0 or IE1 can support virus growth. J. Virol. 79, 4619‐ 4629.     Sweet, D.H. and Pritchard, J.B. (1999). The molecular biology of renal organic anion and  organic cation transporters. Cell Biochem. Biophys. 31, 89‐118.    Tamai, I., Yabuuchi, H., Nexu, J., Sai, Y., Oku, A., Shimane, M. and Tsuji, A. (1997).   Cloning and characterization of a novel human pH‐dependant organic cation  transporter, OCTN1. FEBS Lett. 419, 107‐111.     Taylor, M.E. and Drickamer, K. (2011). Introduction to Glycobiology. Oxford University  Press. Oxford. 3rd Ed.     Taylor, C., Stanley, K. and Shirras, A. (1997). The orct gene of Drosophila melanogaster  codes for a putative organic cation transporter with six or 12 transmembrane domains.  Gene. 201, 69‐74.    Theilmann, D.A. and Stewart, S. (1992). Molecular analysis of the trans‐activating IE‐2  gene of Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus. Virology. 187, 84‐ 96.    Vermeulen, J., Pattyn, F., De Preter, K., Vercruysse, L., Derveaux, S., Mestdagh, P.,   127  Lefever, S., Hellemans, J., Speleman, F. and Vandesompele, J. (2009). External  oligonucleotide standards enable cross laboratory comparison and exchange of real‐ time quantitative PCR data. Nucleic Acids Res. 37, e138.     Vialard, J., Lalumiere, M., Vernet, T., Briedis, D., Alkhatib, G., Henning, D., Levin, D. and  Richardson, C. (1990). Synthesis of the membrane fusion and hemagglutinin proteins  of measles virus, Using a novel baculovirus vector containing the β‐galactosidase gene.  J. Virol. 64, 37‐50.    Wieczorek, H., Putzenlechner, M., Zeiske, W. and Klein, U. (1991). A vacuolar‐type  proton pump energizes K+/H+ antiport in an animal plasma‐membrane. J. Biol. Chem.  266, 15340‐15347.    Wieczorek, H., Wolfersberger, M.G., Cioffi, M. and Harvey, W.R. (1986).  Cation‐stimulated ATPase activity in purified plasma membranes from tobacco  hornworm midgut. Biochim Biophys Acta. 857, 271‐281.    Wright, S.H. (2005). Role of organic cation transporters in the renal handling of therapeutic  agents and xenobiotics. Toxicol. Appl. Pharmacol. 204, 309‐319.    Wright, S.H. and Dantzler, W.H. (2004). Molecular and cellular physiology of renal organic  cation and anion transport.  Physiol. Rev. 84, 987‐1049.    Wright, S.H., Evans, K.K., Zhang, Z., Cherrington, N.J., Sitar, D.S. and Dantzler, W.H.  (2004). Functional map of TEA transport activity in isolated rabbit renal proximal  tubules. Am. J. Physiol. 287, F442‐F451.    Zhang, X., Cherrington, N.J. and Wright, S.H. (2007). Molecular identification and  functional characterization of rabbit MATE1 and MATE2‐K. Am. J. Physiol. Renal Physiol.  293, F360‐F370.    Zuker, M. (2003). Mfold web server for nucleic acid folding and hybridization prediction.   128  Nucleic Acids Res. 31, 3406‐3415.     Zuidema, D., Schouten, A., Usmany, M., Maule, A. J., Belsham, G. J., Roosien, J., Klinge­ Roode, E. C., van Lent, J. W. M. and Vlak, J. (1990). Expression of cauliflower mosaic  virus gene I in insect cells using a novel polyhedrin‐based baculovirus expression  vector. J. Gen. Virol. 71, 2201‐2209.                                                                                 129  Appendix 1: qPCR Normalization Using Multiple Reference Genes    Livak and Schmittgen (2001) were the first to demonstrate a conversion of Cq values  (then Ct values) to normalized relative quantities (NRQs).  Their model assumes 100%  reaction efficiency and uses only a single reference gene.           NRQ = 2 ΔΔCq         Eq. 2.2  It is now known that not all primers work at 100% efficiency to exponentially double  the reaction following each cycle (n2).  Pfaffl (2001) improved upon the original model by  adjusting for individual primer efficiencies; however the model still relies on only one  reference gene for normalization.                 Eq. 2.3  Here the difference in cycle threshold value (Ct) of the gene of interest (goi) is  modified to consider the efficiency (E) of the goi.  This is then compared to the same  normalized Ct value for the reference gene (ref).  For improved normalization, it is now  possible to use the geometric mean of multiple reference genes as a baseline for changes in  expression of a gene of interest.  The Pfaffl model was adjusted by Hellemans et al. (2007)  to normalize to multiple reference genes.               Eq. 2.4   130  The expression of the goi is now compared to the root of the number of total  reference genes (f) to the geometric mean of the number of reference genes, while still  adjusting for varying efficiencies of the different primer pairs.     

Cite

Citation Scheme:

    

Usage Statistics

Country Views Downloads
Canada 26 2
United States 17 0
Japan 5 0
Singapore 3 0
China 3 12
Thailand 2 0
Germany 1 1
India 1 0
United Kingdom 1 0
Poland 1 0
City Views Downloads
Kelowna 11 1
Unknown 10 2
Ashburn 5 0
Mountain View 4 0
Gambier 4 0
Penticton 4 0
Tokyo 4 0
Singapore 3 0
Hamilton 3 0
Beijing 3 0
Salt Lake City 2 0
Vancouver 2 0
Dallas 1 0

{[{ mDataHeader[type] }]} {[{ month[type] }]} {[{ tData[type] }]}
Download Stats

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0072474/manifest

Comment

Related Items