Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Immunosuppressive myeloid cells under normal and neoplastic conditions Hamilton, Melisa June 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2012_spring_hamilton_melisa.pdf [ 3.71MB ]
Metadata
JSON: 24-1.0072452.json
JSON-LD: 24-1.0072452-ld.json
RDF/XML (Pretty): 24-1.0072452-rdf.xml
RDF/JSON: 24-1.0072452-rdf.json
Turtle: 24-1.0072452-turtle.txt
N-Triples: 24-1.0072452-rdf-ntriples.txt
Original Record: 24-1.0072452-source.json
Full Text
24-1.0072452-fulltext.txt
Citation
24-1.0072452.ris

Full Text

IMMUNOSUPPRESSIVE MYELOID CELLS  UNDER NORMAL AND NEOPLASTIC CONDITIONS    by    MELISA JUNE HAMILTON  B.Sc., The University of British Columbia, 2005      A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF  THE REQUIREMENTS FOR THE DEGREE OF    DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE STUDIES  (Experimental Medicine)      THE UNIVERSITY OF BRITISH COLUMBIA  (Vancouver)  December 2011        © Melisa June Hamilton, 2011   ABSTRACT    Although  the  importance  of  immunomodulatory  myeloid  cells  in  both  normal  physiology  and  carcinogenesis  is  well  established,  many  questions  remain  regarding  the  specific  roles  and  regulation  of  these  cells.  In  this  thesis,  we  explore  the  immunosuppressive  features  of  macrophages  (Mφs)  and  elucidate  the  mechanisms  by  which  they  suppress  T  cell  proliferation/activation,  the  factors  that  regulate  their  suppressive  properties,  the  relative  potency  of  Mφ  suppression  compared  to  other  myeloid  cells,  such  as  myeloid‐derived  suppressor  cells  (MDSCs),  and  the  role  these  cells play in promoting tumor growth and metastasis.     We demonstrate herein that in response to interferon (IFN)‐γ, which is secreted  by  activated  T  cells,  resident  Mφs  from  non‐tumor‐bearing  mice  acquire  immunosuppressive  properties  that  are  mediated  by  nitric  oxide  (NO).  Moreover,  our  data  reveal  a  novel  role  for  Toll‐like  receptor  (TLR)‐induced  IFN‐β  in  regulating  the  immunosuppressive properties of Mφs.     We also demonstrate for the first time that in vitro culture conditions profoundly  affect  the  immunosuppressive  functions  of  MDSCs.  Specifically,  we  show  that  serum  antagonizes the suppressive abilities of MDSCs from 4T1 tumor‐bearing mice and that  the  major  serum  protein  albumin  mediates  these  effects,  in  part  by  reducing  reactive  oxygen  species  (ROS)  production  from  MDSCs.  These  findings  have  important  implications, since the accurate detection and quantification of immunosuppression is  critical for both the identification and functional analysis of tumor‐induced MDSCs.     We also explore the phenotypic and functional heterogeneity of tumor‐induced  myeloid  cells  and  compare  the  immunosuppressive  functions  of  different  populations  isolated  from  normal  and  tumor‐bearing  mice.    We  show  that  tumors  that  induce  the  accumulation of myeloid cells also enhance the suppressive functions of these cells. In  addition,  we  demonstrate  that,  in  vitro,  tumor‐induced  Mφs  are  significantly  more   ii  potent  immune  suppressors  than  tumor‐induced  MDSCs  on  a  per  cell  basis,  and  suppress  T  cell  responses  via  distinct  mechanisms.  Finally,  we  present  data  showing  that  treating  metastatic  mammary  tumor‐bearing  mice  with  all‐trans‐retinoic  acid  (ATRA) decreases MDSCs, increases Mφs, and enhances metastatic growth.     Taken  together,  these  findings  advance  our  understanding  of  the  factors  that  regulate  myeloid  cell  functions  in  normal  and  neoplastic  tissues  and  may  lead  to  improved immunotherapies to treat human disease.    iii  PREFACE    All  experiments  were  conducted  by  Melisa  J.  Hamilton,  with  the  exception  of  those  described  below.  I  designed  the  studies  presented  in  this  dissertation,  analyzed  and interpreted all the data, and composed and edited the thesis.    A version of Chapter 3 was previously published. Hamilton MJ, Antignano F, von  Rossum  A,  Boucher  JL,  Bennewith  KL,  Krystal  G.  “TLR  agonists  that  induce  IFN‐β  abrogate  resident  macrophage  suppression  of  T  cells”.  The  Journal  of  Immunology,  185(8):4545‐4553, 2010. Copyright 2010. The American Association of Immunologists,  Inc.  Several  of  the  experiments  in  Chapter  3  were  conducted  with  the  technical  assistance  of  co‐operative  education  students  Anna  von  Rossum  (Terry  Fox  Laboratory),  who  worked  under  my  supervision,  and  Kim  Snyder  (Terry  Fox  Laboratory), who worked under the supervision of Vivian Lam (Terry Fox Laboratory).  In addition, Dr. Frann Antignano (Terry Fox Laboratory) developed the IFN‐β ELISA in  collaboration  with  Victor  Ho  (Terry  Fox  Laboratory),  and  participated  in  helpful  discussions  that  led  to  hypothesis  generation  and  experimental  ideas.  Dr.  Scott  Patterson (CFRI) assisted with the development of the Foxp3 staining protocol.    A  version  of  Chapter  4  is  currently  in  press.  Hamilton  MJ,  Banáth  JP,  Lam  V,  Lepard NE, Krystal G, Bennewith KL. “Serum inhibits the immunosuppressive function  of  myeloid‐derived  suppressor  cells  isolated  from  4T1  tumor‐bearing  mice.”  Cancer  Immunology Immunotherapy. Studies in Chapters 4 and 5 involving tumor models were  performed  in  collaboration  with  Dr.  Kevin  Bennewith’s  laboratory,  with  the  technical  assistance of Dr. Judit Banáth, Nancy LePard, Momir Bosiljcic, Denise McDougal, Jessica  Jia, and Dr. Kevin Bennewith, (Department of Integrative Oncology, BC Cancer Research  Centre).  Specifically,  lab  members  assisted  with  tumor  injections,  tissue  processing,  immunofluorescence  analyses,  clonogenic  assays,  and  some  flow  cytometry  analyses.  Victor Ho also assisted with tissue collection, though did not contribute directly to any  specific figure. In addition, co‐operative education students Kim Snyder and Ann Hsu‐  iv  An Lin (Terry Fox Laboratory), under the supervision of me, Vivian Lam, and/or Victor  Ho,  assisted  with  Western  blot  analyses.  In  Chapter  4,  the  microscopy  in  Fig.  4.3  was  performed by Dr. Judit Banáth and Dr. Kevin Bennewith, and Vivian Lam prepared the  fetal calf serum that was used in Fig. 4.5 and Fig. 4.7. In Chapter 5, members of Dr. Kevin  Bennewith’s laboratory collected the raw data presented in Fig. 5.1, Fig. 5.2, Fig. 5.3, Fig.  5.28, and Fig. 5.30A.        Mice  were  housed  in  the  Animal  Resource  Centre  (ARC)  with  the  assistance  of   ARC staff. Mouse studies were performed under UBC Animal Care protocols A07‐0221  (Dr. Gerald Krystal) and A09‐0251 (Dr. Kevin Bennewith).    Drs.  Gerald  Krystal  and  Kevin  Bennewith  contributed  to  experimental  design,  data interpretation, and editing of the dissertation.     v  TABLE OF CONTENTS  ABSTRACT ......................................................................................................................................... ii  PREFACE ............................................................................................................................................ iv  TABLE OF CONTENTS ................................................................................................................... vi  LIST OF TABLES ................................................................................................................................ x  LIST OF FIGURES .............................................................................................................................xi  LIST OF ABBREVIATIONS .......................................................................................................... xiv  ACKNOWLEDGEMENTS .............................................................................................................. xix  DEDICATION .................................................................................................................................... xx  CHAPTER 1 : INTRODUCTION ...................................................................................................... 1   1.1   History of tumor immunology .................................................................................................................... 1   1.2   Cancer immunoediting versus tumor‐induced immune suppression ....................................... 2   1.3   Brief overview of the immune system .................................................................................................... 3   1.4   Tolerance versus autoimmunity ................................................................................................................ 5   1.5   TLR signaling ..................................................................................................................................................... 6   1.6   Immune escape ............................................................................................................................................... 11   1.7   Pro‐ and anti‐tumor effects of the immune system ......................................................................... 12  1.7.1  Mφs ....................................................................................................................................................... 16  1.7.1.1  Mφ activation ................................................................................................................. 19  1.7.1.2  TAMs ................................................................................................................................. 23  1.7.2  Myeloid‐derived suppressor cells ........................................................................................... 26   1.8   Tumor metastasis and the pre‐metastatic niche .............................................................................. 29   1.9   4T1 and 67NR murine mammary tumor models ............................................................................. 31   1.10   Aims of study ................................................................................................................................................... 33   CHAPTER 2 : MATERIALS AND METHODS ............................................................................ 35   2.1   Mice ..................................................................................................................................................................... 35   2.2   Media ................................................................................................................................................................... 35   2.3   Reagents and cytokines ............................................................................................................................... 36   2.4   Isolation of myeloid cells ............................................................................................................................ 37  2.4.1  Peritoneal macrophages ............................................................................................................. 37  2.4.2  Splenic, pulmonary, or tumor‐associated Mφs and MDSCs .......................................... 37   2.5   Flow cytometry ............................................................................................................................................... 38   2.6   T cell proliferation assay and cytokine assays ................................................................................... 40  vi  2.7   In vitro Mφ skewing ....................................................................................................................................... 41   2.8   SDS‐PAGE and Western blot analysis .................................................................................................... 41   2.9   Viability and morphology assays ............................................................................................................. 42   2.10   Nitric oxide assay ........................................................................................................................................... 43   2.11   In vitro Mφ pre‐treatment and stimulation ......................................................................................... 43   2.12   IFN‐β ELISA ...................................................................................................................................................... 44   2.13   Tumor models ................................................................................................................................................. 44   2.14   Serum treatment for MDSC assay studies............................................................................................ 45   2.15   ROS Detection .................................................................................................................................................. 45   2.16   Clonogenic assays .......................................................................................................................................... 46   2.17   Immunofluorescence .................................................................................................................................... 46   2.18   Statistical analysis ......................................................................................................................................... 47   CHAPTER 3 : TOLL­LIKE RECEPTOR AGONISTS THAT INDUCE IFN­β ABROGATE  RESIDENT MACROPHAGE SUPPRESSION OF T CELLS ....................................................... 48   3.1   Introduction ..................................................................................................................................................... 48   3.2   Results ................................................................................................................................................................ 49  3.2.1  Characterization of the immunosuppressive properties of PC cells ......................... 49  3.2.2  Resident PMφs exhibit a naïve phenotype ........................................................................... 50  3.2.3  Resident Mφs suppress T cell proliferation and cytokine production ..................... 51  3.2.4  Mφs suppress T cell proliferation via a contact‐dependent mechanism ................. 54  3.2.5  Mφs suppress T cell proliferation via IFN‐γ‐induced NO production ....................... 57  3.2.6  Pre‐treatment  with  LPS  and  dsRNA,  but  not  CpG  or  PGN,  decreases  the  ability of Mφs to produce NO and suppress T cells .......................................................... 59  3.2.7  IFN‐β  contributes  to  the  reduced  suppressive  abilities  of  LPS  and  dsRNA  pre‐treated Mφs .............................................................................................................................. 62  3.2.8  Inhibition of Arg1 reduces the effect of LPS and dsRNA pre‐treatment of Mφs ... 65   3.3   Discussion ......................................................................................................................................................... 66   CHAPTER  4  :  SERUM  INHIBITS  THE  IMMUNOSUPPRESSIVE  FUNCTION  OF  MYELOID­DERIVED  SUPPRESSOR  CELLS  ISOLATED  FROM  4T1  TUMOR­ BEARING MICE ............................................................................................................................... 71   4.1   Introduction ..................................................................................................................................................... 71   4.2   Results ................................................................................................................................................................ 72  4.2.1  Validation of in vitro T cell proliferation assay systems ................................................ 72   vii  4.2.2  4T1‐induced  MDSCs  only  suppress  T  cell  proliferation  under  serum‐free  conditions .......................................................................................................................................... 73  4.2.3  Serum does not increase the viability of 4T1‐induced MDSCs .................................... 75  4.2.4  Serum directly inhibits 4T1‐induced MDSC immunosuppression ............................ 76  4.2.5  FCS inhibits MDSC immunosuppression in a dose‐dependent manner .................. 76  4.2.6  Effect of different serum treatments on MDSC immune suppression ...................... 78  4.2.7  BSA blunts 4T1‐induced MDSC immunosuppression ..................................................... 80  4.2.8  BSA antagonizes 4T1‐induced MDSC immunosuppression by inhibiting ROS  production ......................................................................................................................................... 82  4.3   Discussion ......................................................................................................................................................... 84   CHAPTER  5  :  MACROPHAGES  ARE  MORE  POTENT  IMMUNE  SUPPRESSORS  THAN  MYELOID­DERIVED  SUPPRESSOR  CELLS  IN  MURINE  METASTATIC  MAMMARY CARCINOMA ............................................................................................................. 89   5.1   Introduction ..................................................................................................................................................... 89   5.2   Results ................................................................................................................................................................ 91  5.2.1  Characterization of primary tumor growth and metastasis in 4T1 and 67NR  tumor models ................................................................................................................................... 91  5.2.2  4T1 but not 67NR tumors induce MDSCs and Mφs .......................................................... 93  5.2.3  Phenotypic  characterization  of  myeloid  cells  from  control  versus  tumor‐ bearing mice ..................................................................................................................................... 95  5.2.3.1  TAMs ................................................................................................................................. 95  5.2.3.2  PMφs .................................................................................................................................. 97  5.2.3.3  Splenic Mφs ..................................................................................................................... 97  5.2.3.4  Splenic Gr1+ cells ....................................................................................................... 100  5.2.4  Summary of the effect of 4T1 tumors on the phenotypes of myeloid cells ......... 100  5.2.5  Comparison  of  immunosuppressive  abilities  of  myeloid  cells  from  control  versus tumor‐bearing mice ..................................................................................................... 102  5.2.5.1  PMφs ............................................................................................................................... 102  5.2.5.2  TAMs .............................................................................................................................. 103  5.2.5.3  SpMφs ............................................................................................................................. 103  5.2.5.4  Splenic Gr1+ cells ....................................................................................................... 107  5.2.5.5  Gr1+ cells from different tissues ......................................................................... 109  5.2.6  Summary  of  the  relative  immunosuppressive  abilities  of  different  myeloid  cell populations from 4T1 tumor‐bearing mice ............................................................. 111  viii  5.2.7  4T1‐induced MDSCs and TAMs, but not PMφs, decrease T cell viability ............. 119  5.2.8  4T1‐induced MDSCs suppress T cells via a contact‐independent mechanism .. 121  5.2.9  PMφs  from  control  and  67NR  tumor‐bearing  mice  suppress  via  a  NO‐ dependent mechanism .............................................................................................................. 123  5.2.10  The immunosuppressive properties of 4T1 PMφs are not abrogated by TLR  stimulation ..................................................................................................................................... 125  5.2.11  4T1 PMφ suppression of T cells is reversed by N‐acetyl‐cysteine .......................... 126  5.2.12  The immunosuppressive properties of 4T1 pulmonary MDSCs are inhibited  by catalase ...................................................................................................................................... 128  5.2.13  Mφs  and  MDSCs  suppress  T  cell  responses  via  different  ROS‐mediated  mechanisms ................................................................................................................................... 130  5.2.14  ATRA increases lung metastasis in 4T1 tumor‐bearing mice ................................... 133  5.2.15  ATRA  increases  the  proportion  of  Mφs,  which  are  much  more  immunosuppressive than MDSCs in the lungs of 4T1 tumor‐bearing mice ....... 135  5.3   Discussion ...................................................................................................................................................... 139   CHAPTER 6 : SUMMARY AND FUTURE DIRECTIONS ...................................................... 149  REFERENCES ................................................................................................................................ 160   ix  LIST OF TABLES    CHAPTER 1  Table 1.1   Summary of the properties of known TLRs .......................................................................... 8   Table 1.2   Diversity of Mφs in different tissues ....................................................................................... 19     CHAPTER 2  Table 2.1   List of antibodies used in this thesis ...................................................................................... 39      x  LIST OF FIGURES    CHAPTER 1  Figure 1.1   Immune  cells  contribute  to  both  the  promotion  and  inhibition  of  tumor  growth ................................................................................................................................................ 13   Figure 1.2   Development and functions of the mononuclear phagocytic lineage ...................... 17   Figure 1.3   Polarization of Mφ phenotypes ................................................................................................. 21   Figure 1.4   TAMs promote tumorigenesis via multiple mechanisms .............................................. 25     CHAPTER 3  Figure 3.1   Resident PMφs possess immunosuppressive properties .............................................. 50   Figure 3.2   Resident PMφs exhibit a naïve phenotype and can be skewed to either M1 or  M2 with appropriate stimulation ............................................................................................ 51   Figure 3.3   Mφs  suppress  T  cell  proliferation  and  cytokine  production  in  a  dose‐ dependent manner ........................................................................................................................ 53   Figure 3.4   Mφs do not increase the proportion of dead T cells ......................................................... 54   Figure 3.5   Mφs suppress T cell proliferation via a contact‐dependent mechanism ................. 56   Figure 3.6   Mφs suppress T cell proliferation through NO production ........................................... 58   Figure 3.7   IFN‐γ is required for Mφ NO production ............................................................................... 59   Figure 3.8   Pre‐treatment with TLR agonists that signal through TRIF desensitizes Mφs  to subsequent IFN‐γ stimulation, decreasing the ability of Mφs to produce NO  and suppress T cells ...................................................................................................................... 61   Figure 3.9   Pre‐treatment with LPS, but not CpG, reduces Mφ sensitivity to subsequent  stimulation ........................................................................................................................................ 62   Figure 3.10   LPS stimulation induces production of a secondary factor that inhibits IFN‐γ‐ induced NO production by Mφs ................................................................................................ 63   Figure 3.11   IFN‐β  contributes  to  the  reduced  suppressive  abilities  of  LPS  and  dsRNA  pre‐treated Mφs .............................................................................................................................. 64   Figure 3.12   The Arg1 inhibitor BEC reduces the effects of LPS and dsRNA pre‐treatment .... 65   Figure 3.13   The  ability  of  resident  Mφs  to  suppress  T  cell  proliferation  is  abrogated  when Mφs are pre‐treated with LPS or dsRNA, but not CpG or PGN ........................ 67      xi  CHAPTER 4  Figure 4.1   Polyclonal‐ and Ag‐specific‐stimulated T cells proliferate in both serum‐free  and serum‐containing conditions ........................................................................................... 73   Figure 4.2   MDSCs  from  4T1  tumor‐bearing  mice  only  suppress  T  cell  proliferation  under serum‐free conditions .................................................................................................... 74   Figure 4.3   Serum does not alter the proportion of different MDSC subtypes ............................ 75   Figure 4.4   Serum directly inhibits the immunosuppressive abilities of MDSCs ........................ 77   Figure 4.5   The  inhibitory  effects  of  serum  on  4T1‐induced  MDSC  immunosuppression  are dose‐dependent ...................................................................................................................... 78   Figure 4.6   The effects of serum on 4T1‐induced MDSCs cannot be reversed by filtration,  dialyzation, or heat inactivation of the serum ................................................................... 79   Figure 4.7   BSA reduces the immunosuppressive abilities of 4T1‐induced MDSCs .................. 81   Figure 4.8   Serum albumin restricts ROS production by 4T1‐induced MDSCs ........................... 83     CHAPTER 5  Figure 5.1   Characterization of 4T1 and 67NR tumor growth ........................................................... 92   Figure 5.2   Visualization  of  hypoxia  and  myeloid  cell  infiltration  in  4T1  and  67NR  tumors................................................................................................................................................. 93   Figure 5.3   Induction of myeloid cells by 4T1 and 67NR tumors ...................................................... 94   Figure 5.4   Phenotypic characterization of TAMs ................................................................................... 96   Figure 5.5   Phenotypic characterization of PMφs .................................................................................... 98   Figure 5.6   Phenotypic characterization of SpMφs .................................................................................. 99   Figure 5.7   Phenotypic characterization of splenic Gr1+ cells ......................................................... 101   Figure 5.8   Analysis of protein expression in different myeloid cell populations ................... 102   Figure 5.9   Tumors augment the immunosuppressive abilities of PMφs ................................... 104   Figure 5.10   67NR TAMs are more immunosuppressive than 4T1 TAMs .................................... 105   Figure 5.11   SpMφs are only immunosuppressive at high concentrations ................................... 106   Figure 5.12   4T1 tumors enhance the immunosuppressive abilities of splenic Gr1+ cells .... 108   Figure 5.13   4T1   Gr1+   cells   isolated   from   different   tissues   are   equally   immunosuppressive .................................................................................................................. 110  Figure 5.14   4T1  PMφs  are  more  potent  suppressors  of  T  cell  proliferation  than  4T1  MDSCs on a per cell basis ......................................................................................................... 112   xii  Figure 5.15   4T1  PMφs  are  more  potent  suppressors  of  T  cell  cytokine  production  than  4T1 MDSCs on a per cell basis ............................................................................................... 113   Figure 5.16   Visualization  of  the  immunosuppressive  effects  of  different  myeloid  cell  populations .................................................................................................................................... 115   Figure 5.17   Summary of the ability of different myeloid cell populations to inhibit T cell  division as determined by flow cytometric analysis of CFSE intensity ................ 117   Figure 5.18   Comparison of the ability of different myeloid cell populations to reduce the  proportion of T cells ................................................................................................................... 118   Figure 5.19   Effect of different myeloid cell types on cell viability .................................................. 120   Figure 5.20   At high concentrations, both MDSCs and PMφs suppress T cells via contact‐ independent mechanisms ........................................................................................................ 122   Figure 5.21   Control  PMφs,  but  no  other  cell  types  tested,  suppress  T  cell  responses  via  NO production .............................................................................................................................. 124   Figure 5.22   The  immunosuppressive  properties  of  4T1  PMφs  are  not  reversed  by  pre‐ treatment with TLR ligands .................................................................................................... 125   Figure 5.23   NAC reduces the immunosuppressive abilities of 4T1 PMφs ................................... 127   Figure 5.24   The immunosuppressive properties of 4T1 MDSCs are not reversed by pre‐ treatment with TLR ligands .................................................................................................... 128   Figure 5.25   Catalase reduces the suppressive abilities of 4T1 MDSCs ......................................... 129   Figure 5.26   4T1 Mφs and MDSCs suppress T cell proliferation via different ROS‐mediated  mechanisms ................................................................................................................................... 131   Figure 5.27   Myeloid  cells  suppress  T  cell  proliferation  via  different  mechanisms  and  to  different degrees ......................................................................................................................... 132   Figure 5.28   ATRA  treatment  does  not  alter  primary  tumor  growth  but  increases  lung  metastasis ....................................................................................................................................... 134   Figure 5.29   ATRA does not change the immunosuppressive properties of MDSCs or Mφs . 136   Figure 5.30   ATRA  increases  the  number  of  Mφs  and  reduces  the  number  of  MDSCs  in  4T1 mice ......................................................................................................................................... 137   Figure 5.31   ATRA  induces  the  differentiation  of  MDSCs  into  more  immunosuppressive  Mφs and promotes lung metastasis in the 4T1 and 4TO7 tumor models ............ 138      xiii  LIST OF ABBREVIATIONS    Ab      antibody   Ag      antigen   AP‐1     activator protein 1   APC   antigen presenting cell      APCy     allophycocyanin   AML     acute myeloid leukemia   APL   acute promyelocytic leukemia      Arg1     arginase 1   ATRA     all‐trans retinoic acid   β‐ME     beta‐mercaptoethanol   Bcl      B cell lymphoma   BEC      [S]‐[2‐boronoethyl]‐L‐cysteine‐HCl   BM      bone marrow   BSA      bovine serum albumin   C/EBP    CCAAT/enhancer binding protein   CCL      CC chemokine ligand   CCR      CC chemokine receptor   CD      cluster of differentiation   CFSE     carboxyfluorescein succinimidyl ester   CMP     common myeloid progenitor   COX     cyclooxygenase   CpG      CpG‐dinucleotides   cpm     counts per minute   CSF‐1     colony‐stimulating factor 1   CTL   cytotoxic T lymphocyte      CTLA‐4   cytotoxic T‐lymphocyte antigen 4 (or CD152)   CXCL     CXC chemokine ligand   Cy   cyanine      xiv  DAMP     damage‐associated molecular pattern molecule   DAPI     4',6‐diamidino‐2‐phenylindole   DC   dendritic cell      dsRNA    double stranded ribonucleic acid   ECM     extracellular matrix   EDTA     ethylenediaminetetraacetic acid   ELISA     enzyme‐linked immunosorbent assay   FA      fatty acid   FCS      fetal calf serum   FITC     fluorescein isothiocyanate   Flt3L     Flt3 ligand   G‐MDSC   granulocytic‐myeloid‐derived suppressor cell   GAPDH   glyceraldehyde 3‐phosphate dehydrogenase   GM‐CFU   granulocyte macrophage colony‐forming unit   GM‐CSF   granulocyte macrophage colony‐stimulating factor   h   hour      H2O2     hydrogen peroxide   HBSS     Hank’s balanced salt solution   HEPES    4‐(2‐hydroxyethyl)‐1‐piperazineethanesulfonic acid   HFN     Hank’s balanced salt solution containing 2% FCS and 0.05% azide   HIF‐1α   hypoxia‐inducible factor‐1 alpha   HMGB1   high‐mobility group protein B1   HPC     hematopoietic progenitor cell   HPLC     high‐performance liquid chromatography   IDO      indoleamine 2,3‐dioxygenase   IFN      interferon   Ig      immunoglobulin   IκKi     inducible IκB kinase   IL      interleukin   IMC      immature myeloid cell   xv  IMDM     Iscove’s modified Dulbecco’s medium   iNOS     inducible nitric oxide synthase   IP   intraperitoneal      IRAK1    interleukin‐1 receptor‐associated kinase 1   IV      intravenous   JAK      Janus kinase   kDa      kilodalton   L‐Arg     L‐arginine   LFA‐1     lymphocyte function‐associated antigen 1   L‐NMMA   NG‐monomethyl‐L‐arginine   LAP   latency associated peptide      LPS      lipopolysaccharide   LRR     leucine‐rich repeat   Mφ   macrophage      M1 Mφ    classically activated macrophage   M2 Mφ    alternatively activated macrophage   mAb     monoclonal antibody   M‐CFU    macrophage colony‐forming unit   M‐CSF    macrophage colony‐stimulating factor   M‐CSFR   macrophage colony‐stimulating factor receptor   M‐MDSC   monocytic‐myeloid‐derived suppressor cell   MAL     MyD88 adaptor‐like   MCP‐1    monocyte chemotactic protein‐1   mDC     myeloid dendritic cell   MDSC     myeloid‐derived suppressor cell   MFI   mean fluorescence intensity      MHC     major histocompatibility complex   MHCII    major histocompatibility complex class II   min   minute      MMP     matrix metalloproteinase   xvi  MPS     mononuclear phagocyte system   MSF     migration stimulating factor   MTG     monothioglycerate   MyD88   myeloid differentiation factor 88   NAC     N‐acetyl cysteine   NF‐κB    nuclear factor kappa-light-chain-enhancer of activated B cells   NK   natural killer cell      NKT     natural killer T cell   NO   nitric oxide      NO2‐     nitrite   O2‐   superoxide      O/N     overnight   OCT     optimal cutting temperature   ONOO‐    peroxynitrite   OVA     ovalbumin   PAGE     polyacrylamide gel electrophoresis   PAMP     pathogen‐associated molecular pattern   PBS      phosphate buffered saline   PC      peritoneal cavity   PD‐L1     programmed death ligand 1   pDC     plasmacytoid dendritic cell   PE      phycoerythrin   PFA      paraformaldehyde   PG      prostaglandin   PGN     peptidoglycan   PI   propidium iodide      PMφ     peritoneal macrophage   PMN     polymorphonuclear neutrophil   Poly I:C   polyinosinic:polycytidylic   PRR     pattern recognition receptor   xvii  PTIO     carboxy‐2‐phenyl‐4,4,5,5‐tetramethylimidazoline‐1‐oxyl‐3‐oxide   RC      responder control   ROS      reactive oxygen species   rm      recombinant mouse   RNS     reactive nitrogen species   RPMI     Roswell Park Memorial Institute   SCCVII    squamous cell carcinoma VII   SDS   sodium dodecyl sulfate      SEM     standard error of the mean   SOD     superoxide dismutase   SpMφ     splenic macrophage   STAT     signal transducer and activator of transcription   TAA     tumor‐associated antigen   TAM     tumor‐associated macrophage   TBK1     TANK‐binding kinase 1   TCR      T cell receptor   TF      transcription factor   TGF‐β     transforming growth factor beta   Th      T helper cell   thy      thymidine   TIL      tumor‐infiltrating lymphocyte   TIR      Toll‐interleukin‐1 receptor   TIRAP    TIR‐domain containing adaptor protein   TLR   Toll‐like receptor      TNF     tumor necrosis factor   TRAM     TRIF‐related adaptor molecule   TRIF     TIR‐domain‐containing adapter‐inducing interferon‐β   Treg     regulatory T cell   VEGF     vascular endothelial growth factor      xviii  ACKNOWLEDGEMENTS    I am extremely appreciative of the many people in my life that supported me in  each  step  of  this  journey.  I  thank  my  family  for  their  constant  love,  support,  and  encouragement. I also thank my husband for his never‐ending support, understanding,  advice, and (sometimes tough) love. Thank you, Evan, for being my partner, in this and  all aspects of life.    I  sincerely  thank  my  supervisor,  Dr.  Gerald  Krystal,  for  the  opportunity  to  join  his laboratory and conduct these studies under his guidance. Thank you, Gerry, for your  support and encouragement these past six years. I appreciate your kind spirit, scientific  curiosity, creativity, and passion for clinically‐relevant research. I am also grateful to Dr.  Kevin Bennewith for his collaboration and mentorship. Kevin, thank you for all the time  and  effort  you  invested  in  these  studies  and  your  continual  guidance  and  advice.  I  would  also  like  to  recognize  the  members  of  my  supervisory  committee,  Drs.  Fumio  Takei, Megan Levings, and Kevin Bennewith, for their input, suggestions, and direction  throughout  my  PhD  studies.  I  thank  all  of  my  lab  mates,  past  and  present,  especially  Victor  Ho,  Vivian  Lam,  Frann  Antignano,  and  Christina  Thomas,  for  their  help  and  friendship.  I  would  also  like  to  thank  the  members  of  the  Terry  Fox  Laboratory  for  helpful  discussions  and  collaborations,  and  express  my  gratitude  to  Drs.  Vincent  Duronio  and  Connie  Eaves  for  their  support  of  funding  applications;  the  research  described in this thesis was supported by personal fellowships awarded to me from the  Canadian Institutes of Health Research, Michael Smith Foundation for Health Research,  and Canadian Federation of University Women.     xix  DEDICATION    I dedicate this dissertation to my family.   xx  CHAPTER 1 : INTRODUCTION    1.1 History of tumor immunology    The relationship between the immune system and cancer has been the subject of  much  debate  throughout  the  past  century  and  remains  one  of  the  most  challenging  issues  in  the  field  of  immunology.  The  concept  that  the  immune  system  provides  protection from cancer was first suggested by Paul Ehrlich in the early 1900s (Ehrlich,  1909),  but  it  was  not  until  after  major  advances  in  immune  cell  identification  and  function that experiments could be performed to test this hypothesis. Related to this, in  the  mid  1950s,  Burnet  and  Thomas  proposed  the  idea  of  cancer  immunosurveillance,  i.e.,  that  the  immune  system  can  recognize  and  destroy  emerging  transformed  cells  (Burnet,  1957).  However,  initial  studies  produced  mixed  results  and  this  idea  was  largely  abandoned  (Prehn  and  Main,  1957;  Schreiber  et  al.,  2011;  Stutman,  1974;  Stutman,  1975).  Nevertheless,  interest  in  cancer  immunology  was  revived  in  1982  when  van  Pel  and  Boon  made  the  seminal  discovery  that  vaccinating  mice  with  mutagenized tumor cells provided protection from spontaneous tumors, indicating that  spontaneous  tumors  possessed  tumor  antigens  (Ags)  (Van  Pel  and  Boon,  1982).  Advances  in  technology,  including  the  development  of  improved  mouse  models,  combined  with  a  better  understanding  of  the  immune  system  has  allowed  major  advances  to  be  made  in  tumor  immunology  in  the  past  two  decades  (Schreiber  et  al.,  2011).  Immune  surveillance  has  now  been  clearly  demonstrated,  since  mice  with  genetic  immune  deficiencies  are  more  susceptible  to  chemically‐induced,  as  well  as  spontaneous,  tumors  (Laoui  et  al.,  2011;  Shankaran  et  al.,  2001),  and  there  is  now  a  large body of evidence supporting the general hypothesis that the immune system can  act to restrict cancer development and progression (Vesely et al., 2011). However, these  advances  have  also  revealed  that  the  relationship  between  the  immune  system  and  cancer is extremely complex. In fact, we now appreciate that the immune system plays a  dual  role  in  cancer;  on  the  one  hand,  it  can  inhibit  tumor  growth  by  recognizing  and  destroying  cancer  cells,  but  on  the  other,  it  can  encourage  tumor  progression  by   1  selecting  for  less  immunogenic  tumors  and  by  providing  resources  to  the  tumor  that  support its growth and metastasis (Schreiber et al., 2011).     1.2 Cancer immunoediting versus tumor­induced immune suppression    In  2001,  experimental  evidence  from  Schreiber  and  colleagues  not  only  demonstrated the existence of immune surveillance, but also showed that the immune  system can influence tumor immunogenicity (Dunn et al., 2002; Shankaran et al., 2001).  Based on their findings, they proposed what they called cancer immunoediting (Dunn et  al., 2002), which suggests three sequential steps: elimination, equilibrium, and escape  (Schreiber et al., 2011). During the elimination phase, the immune system detects and  destroys developing tumor cells (Dunn et al., 2002). Although the mechanisms by which  the  immune  system  becomes  aware  of  these  nascent  tumor  cells  are  not  fully  understood,  there  is  evidence  that  a  combination  of  danger  signals  may  be  involved,  such  as  Type  I  interferons  (IFNs),  which  are  induced  in  the  early  stages  of  tumor  development  (Matzinger,  1994),  damage‐associated  molecular  pattern  molecules  (DAMPs) (e.g. high mobility group box 1; HMGB1), which are released from dying tumor  cells or injured tissues (Sims et al., 2010), or stress ligands (i.e. RAE‐1 or H60 in mice  and MICA/B in humans), which are often expressed on tumor cells (Guerra et al., 2008).  This  elimination  phase  appears  to  require  players  from  both  the  innate  and  adaptive  immune  system,  and  if  it  is  fully  successful,  elimination  is  a  possible  endpoint  of  the  cancer  immunoediting  process  (Schreiber  et  al.,  2011).  However,  if  tumor  variants  survive,  the  equilibrium  phase  begins,  whereby  the  adaptive  immune  system  holds  tumors  in  check  by  preventing  the  outgrowth  of  tumor  cells,  and  tumor  growth  and  immune  surveillance  enter  a  dynamic  balance  (Schreiber  et  al.,  2011).  Since  the  immune  system  is  best  able  to  recognize  and  control  the  most  immunogenic  tumor  variants, it exerts a constant selective pressure on genetically unstable tumor cells and  promotes the outgrowth of tumor variants that have acquired the most immunoevasive  mutations (Schreiber et al., 2011). The final stage described by the immune surveillance  hypothesis  is  escape,  during  which  tumor  cells  that  have  evaded  immune  detection  emerge and flourish to form clinically‐relevant tumors (Schreiber et al., 2011).   2    Although the reciprocal relationship between the immune system and tumors is  widely  accepted,  there  are  some  investigators  who  do  not  subscribe  to  the  immunoediting  hypothesis.  Instead,  these  scientists  propose  that  the  most  important  determinants of successful tumorigenesis are the immunosuppressive mechanisms that  are  acquired  by  tumors  to  block  anti‐tumor  immune  responses  and  induce  a  state  of  tumor‐specific tolerance. Although these two models have been proposed as conflicting  hypotheses,  they  are  likely  not  mutually  exclusive  (Whiteside,  2010).  Rather,  there  is  evidence  to  support  both  models,  suggesting  both  the  selection  of  less  immunogenic  tumors  as  well  as  tumor‐induced  immune  suppression  contribute  to  carcinogenesis  (Whiteside, 2010). In this thesis, the pro‐ and anti‐tumor effects of the immune system  on  tumorigenesis,  as  well  as  the  mechanisms  by  which  tumors  suppress  immune  responses will be discussed.     1.3 Brief overview of the immune system    The  immune  system  is  typically  divided  into  two  arms,  innate  and  adaptive.  Innate  immune  responses,  which  are  carried  out  by  monocytes,  macrophages  (Mφs),  dendritic  cells  (DCs),  polymorphonuclear  leukocytes  (PMNs,  a.k.a.  granulocytes),  natural  killer  (NK)  cells,  platelets,  mast  cells,  epithelial,  and  endothelial  cells,  provide  rapid host protection against pathogens (Parkin and Cohen, 2001). Innate immune cells  recognize  foreign  organisms,  including  nascent  tumor  cells,  via  sets  of  germ‐line  encoded  pattern  recognition  receptors  (PRRs),  such  as  Toll‐like  receptors  (TLRs)  (Moresco et al., 2011). Due to the finite nature of receptor structure and expression, the  innate  immune  response  is  limited  in  its  breadth  and  is  only  activated  by  certain  evolutionarily conserved pathogen‐associated molecular patterns (PAMPs) (Moresco et  al., 2011). Receptor activation induces the maturation and activation of innate immune  cells,  which  in  turn  triggers  cytokine  production,  recruitment  of  immune  cells,  complement  activation,  and  induction  of  the  adaptive  immune  response  via  Ag  presentation  (Parkin  and  Cohen,  2001).  Myeloid  cell  populations,  including  PMNs,   3  monocytes, Mφs, and DCs are critical mediators of immune responses (Mantovani et al.,  2011;  Soehnlein  and  Lindbom,  2010).  Mφs  and  PMNs  both  eliminate  pathogens  and  damaged  cells  via  phagocytosis  but  also  have  distinct  roles  (Ueha  et  al.,  2011);  PMNs  amplify inflammation by releasing cytotoxic granules, while Mφs resolve inflammation  and restore tissue integrity after removal of inflammatory stimuli (Kennedy and DeLeo,  2009).     The key players of the more recently evolved adaptive immune response are T  and B lymphocytes. Unlike innate immune cells, T and B cells express a large repertoire  of  Ag  receptors  that  are  produced  by  site‐specific  somatic  recombination  (Parkin  and  Cohen,  2001).  This  mechanism  of  receptor  generation  allows  for  a  specific  yet  wide‐ ranging  response,  allowing  the  adaptive  immune  system  to  distinguish  between  vast  numbers of different Ags (Parkin and Cohen, 2001). Although the adaptive response is  not  as  fast‐acting  as  the  innate  immune  system,  it  imparts  long‐lasting  specific  protection to the host (Parkin and Cohen, 2001). There are two main types of effector T  cells,  cluster  of  differentiation  (CD)4+  T  helper  (Th)  cells  and  CD8+  cytotoxic  T  lymphocytes  (CTLs)  (Parkin  and  Cohen,  2001).  Upon  Ag  recognition  Th  cells  mature  into Th1 or Th2 cells, which produce cytokines that activate players involved in the cell‐ mediated  (i.e.  Mφs,  NK  cells,  CTLs)  or  antibody  (Ab)‐mediated  (i.e.  B  cell)  response,  respectively (Parkin and Cohen, 2001). CTLs, on the other hand, are directly cytotoxic to  their  target  cells  and  thus  have  important  functions  in  anti‐viral  and  anti‐tumor  immunity (Parkin and Cohen, 2001). Natural killer T (NKT) cells are lymphocytes that  share characteristics of both NK and T cells (Godfrey et al., 2010). NKT cells recognize  glycolipid Ags in the context of CD1d, and express a semi‐invariant T cell receptor (TCR)  and  NK  cell  markers  including  NK1.1  (a.k.a.  CD161)  (Godfrey  et  al.,  2010).  NKT  cells  produce  high  levels  of  Th1  and  Th2  cytokines  and  can  therefore  activate  or  suppress  immune  responses  by  modulating  the  functions  of  other  immune  cells  (Godfrey  et  al.,  2010).  The  final  members  of  the  adaptive  immune  system  are  B  cells,  which  produce  Abs upon activation. They also act as Ag‐presenting cells (APCs), presenting Abs in the  context  of  major  histocompatibility  complex  (MHC)  to  activate  Th  cells  that  help   4  amplify the response (Parkin and Cohen, 2001). Abs function via a number of different  mechanisms  to  improve  the  effectiveness  of  both  innate  and  adaptive‐mediated  responses (Parkin and Cohen, 2001).    There is overlap between the two arms of the immune system since innate APCs  (i.e.  Mφs  and  DCs)  are  critical  modulators  of  the  adaptive  response.  They  reside  in  tissues  where  they  continually  survey  the  environment,  taking  up  Ags  and  displaying  them on their surface in the context of MHC molecules (Martinez et al., 2008). Immature  APCs,  which  have  not  encountered  a  pathogen  or  harmful  foreign  entity,  express  low  levels  of  MHC  class  II  (MHCII)  and  lack  expression  of  co‐stimulatory  molecules  (e.g.  CD80/86, which bind to CD28 on T cells) (Martinez et al., 2008). However, in response  to PRR activation or inflammatory cytokine production, Mφs and DC mature, increasing  their expression of MHCII and co‐stimulatory molecules (Martinez et al., 2008). These  APCs  then  migrate  to  specialized  peripheral  lymphoid  organs,  including  the  lymph  nodes  and  spleen,  where  they  interact  with  lymphocytes  (Martinez  et  al.,  2008).  Depending  on  their  activation  state,  APCs  can  either  tolerize  or  activate  naïve  lymphocytes  (Parkin  and  Cohen,  2001).  When  a  naïve  T  cell  recognizes  a  peptide  displayed on an immature APC the T cell becomes anergic, and this is a mechanism of  peripheral tolerance (Parkin and Cohen, 2001). On the other hand, binding of a naïve T  cell to an Ag presented by a mature APC induces T cell activation and clonal expansion  (Parkin and Cohen, 2001).     1.4 Tolerance versus autoimmunity    Because of the process of somatic hypermutation by which they are generated, T  and B cell receptors have the potential to recognize an almost unlimited number of Ags,  including  self‐Ags  (Munn  and  Mellor,  2003).  If  left  unchecked,  these  self‐reactive  lymphocytes could cause tremendous damage to host tissues and lead to autoimmune  diseases. Many self‐reactive T cells are deleted during development in the thymus via  central tolerance (Munn and Mellor, 2003). However, since some self‐reactive cells are   5  able  to  mature  and  enter  the  periphery,  peripheral  tolerance  strategies  are  also  necessary  to  prevent  autoimmunity  (Munn  and  Mellor,  2003).  These  mechanisms  include  immune  ignorance,  such  as  in immune  privileged  sites,  induction  of anergy  in  lymphocytes that encounter their Ag in the absence of co‐stimulatory or in the presence  of  co‐inhibitory  signals,  and  immune  suppression  by  cells  that  actively  suppress  lymphocyte activation and proliferation (Nurieva et al., 2011). Although these tolerance  mechanisms evolved to prevent autoimmune reactions, tumors have co‐opted them to  hide  from  or  disable  the  immune  system.  Therefore,  maintaining  the  proper  balance  between immune tolerance and response is of the utmost importance; if the equilibrium  shifts  too  strongly  in  favour  of  immune  tolerance  the  organism  forgoes  its  protection  against  harmful  pathogens  or  tumors,  yet  if  tolerance  is  diminished  too  much  the  organism is no longer protected from autoimmunity (Munn and Mellor, 2003).     1.5 TLR signaling    One important factor that regulates the balance between immune tolerance and  response  is  the  ability  of  the  immune  system  to  distinguish  self  from  non‐self.  Innate  immune  cells  possess  PRRs  that  directly  recognize  pathogens  and  initiate  an  inflammatory response (Parkin and Cohen, 2001). These receptors are located either on  the cell surface or within internal cell compartments of Mφs, PMNs, DCs, epithelial, and  endothelial  cells  (Fitzner  et  al.,  2008;  Parkin and  Cohen,  2001).  These  innate  immune  receptors  are  not  clonally  distributed  like  adaptive  immune  receptors;  all  cells  of  a  particular  subtype  express  the  same  set  of  PRRs  (Parkin  and  Cohen,  2001).  The  TLR  family is a class of PRRs that plays a key role in the innate immune response. To date,  thirteen  TLRs,  named  TLR1‐13,  have  been  identified;  10  in  humans  and  12  in  mice  (Moresco  et  al.,  2011).  All  family  members  share  a  common  intracellular  Toll‐ interleukin‐1  receptor  (TIR)  domain  and  have  multiple  extracellular  leucine‐rich  repeats  (LRRs)  (Moresco  et  al.,  2011).  TLRs,  named  for their  homology  to  the protein  coded  by  the  Toll  gene  in  Drosophila,  are  single  membrane‐spanning  non‐catalytic  receptors that function as homo‐ or hetero‐dimers (Moresco et al., 2011). Each receptor   6  or  receptor  dimer  is  able  to  recognize  a  distinct  set  of  PAMPs,  which  are  molecular  patterns  that  are  broadly  shared  by  a  class  of  pathogens  but  are  also  distinguishable  from normal host molecules (Moresco et al., 2011). Since TLRs are germ‐line encoded  and  their  specificity  cannot  be  easily  altered  by  evolution,  these  receptors  recognize  molecules  that  are  consistently  and  specifically  associated  with  threats,  including  pathogens or cellular stress (Moresco et al., 2011).     Stimulation  of  TLRs  activates  signaling  cascades  that  lead  to  the  induction  of  genes  essential  for  immune  responses,  including  those  that  encode  chemokines,  cytokines,  and  co‐stimulatory  molecules  (Akira  and  Takeda,  2004).  Since  different  classes  of  microorganisms  possess  different  components,  and  are  thus  recognized  by  different  TLRs,  the  innate  immune  system  is  able  to  not  only  identify  a  pathogen  as  foreign, but also initiate an appropriately targeted response. For example, extracellular  bacterial  PAMPs  induce  increased  phagocytosis,  Ag  processing  and  presentation,  and  secretion  of  pro‐inflammatory  cytokines,  which  stimulate  a  Th2‐skewed  adaptive  immune  response  (Akira  and  Takeda,  2004).  Viral  PAMPs,  on  the  other  hand,  trigger  decreased  protein  synthesis,  induction  of  apoptosis,  and  type  1  interferon  (IFN)  production  (Akira  and  Takeda,  2004).  After  ligand  binding,  TLRs  dimerize,  undergo  conformational changes, and recruit different TIR‐domain‐containing adaptor proteins  including  myeloid  differentiation  factor  88  (MyD88),  TIR‐domain  containing  adaptor  protein  (TIRAP,  a.k.a.  MyD88  adaptor‐like,  or  MAL),  TIR‐domain‐containing  adaptor‐ inducing interferon‐β  (TRIF),  and  TRIF‐related  adaptor molecule  (TRAM)  (Moresco  et  al.,  2011).  These  adaptors,  in  turn,  activate  other  molecules  within  the  cell,  including  specific protein kinases (i.e. interleukin‐1 receptor‐associated kinase 1 (IRAK1), TANK‐ binding  kinase  1  (TBK1),  and  inducible  IκB  kinase  (IKKi))  that  amplify  the  signal  and  lead  to  the  induction  or  inhibition  of  genes  that  regulate  the  inflammatory  response  (Moresco et al., 2011; Waltenbaugh et al., 2008). In general, TLR signaling pathways can  be  classified  as  MyD88‐dependent  or  MyD88‐independent,  each  of  which  activates  distinct  signaling  pathways  and  ultimate  end‐points  (Akira  and  Takeda,  2004).  Signaling  through  MyD88  activates  nuclear  factor  kappa‐light‐chain‐enhancer  of   7  activated  B  cells  (NF‐κB)  and  activator  protein  1  (AP‐1)  transcription  factors  (TFs),  resulting in the induction of pro‐inflammatory genes (Akira and Takeda, 2004). On the  other hand, in addition to activating NF‐κB, signaling through the MyD88‐independent  pathway  also  triggers  the  production  of  Type  I  IFNs  (IFN‐α  and  IFN‐β),  which  have  potent  anti‐viral  effects  via  their  subsequent  activation  of  IFN‐inducible  genes  (Akira  and Takeda, 2004; Schroder et al., 2004).  A summary of known mammalian TLRs, their  PAMP ligands, signaling molecules, and expression patterns can be found in Table 1.1.     Table 1.1   Summary of the properties of known TLRs.   TLRs  recognize,  bind,  and  become  activated  by  different  ligands,  which  are  derived  from  different  microbes  including  viruses,  fungi,  bacteria,  and  protozoa  or  from  damaged host cells. TLRs signal through different adaptor proteins that directly bind to  activated  TLRs  and  recruit  different  downstream  signaling  components.  While  most  receptors are displayed on the cell surface, TLRs that recognize nucleic acids (TLR3, 7,  8, 9) are located in intracellular endosomes. TLR10 is only present in humans and TLRs  11‐13 are only present in mice. Adapted from Moresco et al., 2011; Fitzner et al., 2008;  and Waltenbaugh et al., 2008.    Receptor   Ligand(s)   Adaptor(s)   Ligand  Location  Bacteria  MyD88/MAL  TLR1   Triacyl  lipopeptides   TLR2   Glycolipids,  lipopeptides,  lipoproteins,  lipoteichoic  acid   Bacteria  MyD88/MAL  HSP70  Zymosan  Double‐ stranded RNA  (dsRNA), poly  I:C   Host cells Fungi Viruses  TRIF  TLR3   Cell Types   Location   Monocytes,  Mφs,   DC subsets,  B cells,  endothelial  cells  Monocytes,  Mφs,  myeloid  (m)DCs ,  mast cells,   endothelial  cells   Cell surface  DCs,  B cells,   endothelial  cells   Cell  compartment   Cell surface  8    Receptor   Ligand(s)   TLR4   Lipopolysacch‐ aride (LPS)     TLR5   Heat shock  proteins  Fibrinogen,  heparin sulfate  fragments,  hyaluronic acid  fragments  Flagellin  Diacyl  lipopeptides   TLR6   Ligand  Location  Gram‐ negative  bacteria   Bacteria and  host cells  Host Cells  Bacteria Mycoplasma  Adaptor(s)  MyD88/MAL/ TRIF/TRAM   MyD88   MyD88/MAL  TLR7   Single‐ Synthetic  stranded RNA  compounds  and synthetic  analogs  (imidazoguino‐ line, loxoribine,  bropirimine)   MyD88  TLR8   Single‐ stranded RNA,  small synthetic  compounds   Synthetic  compounds   MyD88  TLR9   Unmethylated  CpG DNA   Bacteria  MyD88  Cell Types   Location   Monocytes,  Cell surface Mφs,  mDCs,  mast cells,  intestinal  epithelium,   endothelial  cells    Monocytes,  Cell surface  Mφs,  DC subsets,  intestinal  epithelium,   endothelial  cells  Monocytes,  Cell surface Mφs,  mast cells,  B cells,   endothelial  cells  Monocytes,  Cell  compartment  Mφs,  plasma‐ cytoid  (p)DCs,  B cells,   endothelial  cells  Monocytes,  Cell  compartment  Mφs, DC  subsets,  B cells,   endothelial  cells  Monocytes,  Cell  Mφs, pDCs,  compartment  B cells,   endothelial  cells   9    Receptor   Ligand(s)   Ligand  Location  Unknown  Adaptor(s)   TLR10   Unknown   Unknown  TLR11   Profilin   Toxoplasma  gondii   MyD88  TLR12  TLR13   Unknown  Unknown   Unknown Virus  Unknown MyD88, TAK‐1  Cell Types  Monocytes,  Mφs,  B cells,   endothelial  cells  Monocytes,  Mφs,  liver cells,  kidney  cells,  bladder  epithelium  Neurons  Unknown   Location  Cell surface  Cell  compartment   Unknown Unknown       10  1.6 Immune escape    The  fact  that  tumors  are  frequently  able  to  develop  and  thrive  in  immune  competent  hosts  suggests  that  the  immune  system  is  often  unable  to  prevent  cancer.  There  are  a  number  of  factors  that  contribute  to  this  failure  of  anti‐tumor  immunity  including low immunogenicity of tumor cells, tolerance, and immune evasion (Dunn et  al., 2002). In order to be successful, tumors must evolve mechanisms to escape from or  suppress  host  immune  responses,  and  this  immune  evasion  is  increasingly  being  recognized  as  an  important  component  of  cancer  development  (Hanahan  and  Weinberg,  2011).  Immune  evasion  is  mediated  by  several  distinct  molecular  mechanisms that can be divided into two general categories; those that allow tumors to  hide  from  the  immune  system  and  those  that  enable  tumors  to  disable  the  immune  system.    Transformed  cells  can  hide  from  the  immune  system  by  down‐regulating  Ag  presentation  (either  by  decreasing  Ag  or  co‐stimulatory  molecule  expression),  by  antigenic  drift,  or  by  acquiring  defects  in  Ag  processing  or  presentation  machinery  (Whiteside,  2006).  Another  way  tumor  cells  hide  is  by  decreasing  T  cell  recruitment  into tumor sites via reducing chemokine and adhesion molecule expression (Whiteside,  2006).  Tumor  cells  can  also  surmount  anti‐tumor  immunity  by  increasing  their  resistance  to  immune  effector  mechanisms.  For  example,  tumor  cells  can  acquire  mutations that make them less sensitive to apoptosis, including over‐expression of anti‐ apoptotic  molecules  (e.g.  B  cell  lymphoma  (Bcl)‐2,  Bcl‐XL,  survivin),  up‐regulation  of  molecules  that  interfere  with  the  perforin/granzyme  pathway  (e.g.  serine  protease  inhibitors),  expression  of  soluble  death  receptors  that  act  as  decoys,  and  shedding  surface molecules that activate NK cells (Whiteside, 2006).    Alternatively, tumor cells can escape from anti‐tumor immunity by disabling the  immune  system.  One  of  the  key  mechanisms  tumors  use  to  do  this  is  production  of  immunosuppressive  factors  that  either  disable  the  immune  system  directly  or  that  promote  recruitment  and  differentiation  of  immunosuppressive  cells  (Whiteside,  11  2006). Tumors secrete a plethora of molecules that induce an immunosuppressive state  either  locally,  i.e.,  within  the  tumor  microenvironment,  or  systemically.  These  can  include  immunosuppressive  small  molecules  (i.e.  prostaglandin  (PG)E2,  histamine,  reactive  oxygen  species  (ROS)  and  reactive  nitrogen  species  (RNS)),  cytokines  (i.e.  vascular endothelial growth factor (VEGF), granulocyte macrophage colony‐stimulating  factor  (GM‐CSF),  interleukin  (IL)‐4,  IL‐10,  transforming  growth  factor  beta  (TGF‐β)),  and  enzymes  (i.e.  indoleamine  2,3  dioxygenase  (IDO),  arginase  1(Arg1))  (Whiteside,  2010).    Furthermore,  tumors  secrete  growth  factors  and  pro‐inflammatory  cytokines  that promote the recruitment and activation of regulatory cells (i.e.  regulatory T cells  (Tregs),  tolerogenic  DCs,  mast  cells,  tumor‐associated  macrophages  (TAMs),  and  myeloid‐derived suppressor cells (MDSCs)) (Whiteside, 2006), whose functions will be  discussed in detail in Section 1.7.     1.7 Pro­ and anti­tumor effects of the immune system    It is well established that the immune system plays a role in both the promotion  and  inhibition  of  tumor  growth  and  metastasis  (Schreiber  et  al.,  2011)  (Fig.  1.1).  In  terms of anti‐tumor immunity, members from both the innate and adaptive arms of the  immune  system,  including  CD8+  CTLs,  CD4+  Th  cells,  NK  cells,  DCs,  Mφs,  and  B  cells,  work together to identify and kill foreign tumor cells using the same mechanisms used  to eradicate microorganisms (Bhardwaj, 2007). As mentioned earlier, while there was  initially some doubt about whether the immune system could successfully distinguish  transformed cells from normal cells, there is now convincing evidence that cancer cells  express  specific  Ags,  termed  tumor‐associated  Ags  (TAAs)  that  distinguish  them  from  their non‐transformed counterparts (Whiteside, 2010). These Ags are distinctive due to  a combination of mutagenic and epigenetic alterations (Laoui et al., 2011) and include  products  of  viral,  aberrantly  expressed,  or  mutated  genes  (Whiteside,  2010).  Tumor‐ specific  T  cells,  i.e.,  T  cells  with  TCRs  that  recognize  TAAs,  are  theoretically  able  to  eradicate  even  metastatic  tumors  (Vesely  et  al.,  2011).  CTLs  are  critical  mediators  of  tumor  cell  killing  and  exert  their  effects  via  a  number  of  different  mechanisms,   12    Figure 1.1  Immune cells contribute to both the promotion and inhibition of tumor  growth.   Both innate and adaptive immune cells mediate anti‐tumor immunity, including CD8+ CTLs,  CD4+  Th  cells,  NK  cells,  M1  Mφs,  DCs,  and  B  cells.  Together  these  cell  types  can  detect  and  induce  apoptosis  in  tumor  cells,  which  results  in  decreased  tumor  growth  and  metastasis.  However,  successful  tumors  develop  strategies  to  evade  immune  detection,  including  the  production  of  cytokines,  growth  factors,  and  chemokines  that  induce  the  development  of  immunosuppressive cells, including Tregs, mast cells, MDSCs, tolerogenic DCs, and M2 Mφs.  These  suppressive  immune  cells  actively  inhibit  anti‐tumor  immunity  and  produce  factors  that  promote  angiogenesis,  as  well  as  tumor  cell  growth  and  invasion,  and  thereby  contribute  to  the  progression  of  both  primary  and  metastatic  tumors.  Adapted  from  references in section 1.7.       13  including  indirect  killing  through  release  of  IFN‐γ,  tumor  necrosis  factor  (TNF)‐α  and  soluble Fas ligand, and direct killing by engagement of membrane‐bound Fas ligand to  Fas on tumor cells or by secretion of perforin and granzymes into the target cell (Vesely  et al., 2011).    In addition, the immune system is able to indirectly protect the host from tumors  by  both  eliminating  pathogens  and  limiting  inflammation.  Specifically,  since  the  immune system evolved in part to protect the host from viral infection it is quite adept  at  preventing  virus‐induced  tumors  (Schreiber  et  al.,  2011).  Similarly,  by  efficiently  resolving  infections,  the  immune  system  reduces  the  duration  and  extent  of  inflammation (Schreiber et al., 2011). Inflammation is a multifaceted process that acts  to  protect  the  host  and  maintain  tissue  homeostasis.  Inflammation  is  initiated  in  response to stresses such as infection, physical injury, or local immune responses and  functions to eliminate the threat to the organism and then trigger the healing process  (Ostrand‐Rosenberg  and  Sinha,  2009).    It  involves  the  local  accumulation  of  fluid,  plasma proteins, and immune cells and is generally classified as either acute or chronic;  acute inflammation is the initial response of the organism to a threat and is normally a  short‐lived  process,  while  chronic  inflammation  occurs  when  inflammation  is  prolonged (e.g. autoimmune disease, persistent foreign body, or cancer) (Sansone and  Bromberg, 2011). Whereas acute inflammation is a necessary aspect of the anti‐tumor  response,  chronic  inflammation  has  been  shown  to  contribute  to  all  stages  of  tumorigenesis,  including  cancer  development,  progression,  and  metastasis  (Sansone  and  Bromberg,  2011).  In  fact,  Mantovani  and  colleagues  have  recently  suggested  that  inflammation should  be considered the seventh hallmark of cancer (Mantovani, 2009;  Mantovani  and  Sica,  2010)  and  in  their  recent  review  Hanahan  and  Weinberg  highlighted  tumor‐promoting  inflammation  as  an  enabling  characteristic  of  cancer  (Hanahan and Weinberg, 2011). Inflammation and cancer are linked in two major ways;  on one hand, oncogene activation drives the expression of inflammatory mediators and  leads  to  a  pro‐inflammatory  microenvironment  and,  on  the  other  hand,  inflammatory  conditions  promote  cancer  development  (Mantovani  and  Sica,  2010).  Therefore,   14  prompt  resolution  of  inflammation  by  immune  cells  is  critical  to  reducing  cancer  incidence and development.    Although these protective mechanisms are effective in some cases, the fact that  tumors are often able to develop and thrive in immune competent hosts indicates that  the anti‐tumor functions of the immune system are frequently inadequate to protect the  host  from  developing  cancer.  Related  to  this,  there  are  numerous  lines  of  evidence  suggesting  both  early  and  late  involvement  of  the  immune  system  in  promoting  tumorigenesis  (Whiteside,  2010).  Early  tumors  and  even  premalignant  foci  are  frequently  infiltrated  with  hematopoietic  cells,  including  lymphocytes,  Mφs,  and  occasionally PMNs (Kornstein et al., 1983; von Kleist et al., 1987). Although the number  of  tumor‐infiltrating  lymphocytes  (TILs),  especially  CD8+  CTLs,  has  been  associated  with  improved  patient  survival  in  some  studies,  they  are  largely  unsuccessful  in  inhibiting tumor growth (Whiteside, 2010). Moreover, TILs isolated from advanced or  metastatic tumors are often more functionally impaired than those isolated from early  lesions  (Whiteside,  2010).  This  is  in  large  part  due  to  bone  marrow  (BM)  derived  immunosuppressive  cells  that  develop  and  are  recruited  to  the  tumor  site  by  tumor‐ produced  factors  (Whiteside,  2008)  including  Tregs  (Bettini  and  Vignali,  2009),  alternatively  activated  (M2)  Mφs  (Gordon  and  Martinez,  2010),  tolerogenic  DCs  (Whiteside, 2010), mast cells (Maltby et al., 2009), and MDSCs (Ostrand‐Rosenberg and  Sinha,  2009;  Youn  and  Gabrilovich,  2010).  These  immunosuppressive  cells,  which  function  physiologically  to  prevent  auto‐immunity  and  resolve  inflammation,  directly  oppose  the  anti‐tumor  functions  of  the  immune  system  by  actively  suppressing  cytotoxic T cells and are critical mediators of tumor development and progression via  production of factors that foster tumor growth and metastasis (Hanahan and Weinberg,  2011;  Whiteside,  2006).  Mφs  and  MDSCs  are  two  of  the  most  integral  pro‐tumor  immune  cells  and  are  the  focus  of  this  thesis.  The  roles  MDSCs  and  Mφs  play  in  suppressing anti‐tumor immunity and fostering tumorigenesis will now be discussed in  greater detail.     15  1.7.1  Mφs     Mφs  are  terminally  differentiated  cells  of  the  mononuclear  phagocyte  system  (MPS),  which  is  comprised  of  mononuclear  cells  that  possess  phagocytic  abilities,  including lineage committed BM precursors, MDSCs, monocytes, DCs, and Mφs (Pollard,  2009). Terminally‐differentiated cells of the MPS arise as part of normal myelopoiesis  from  pluripotent  hematopoietic  progenitor  cells  (HPCs)  that  give  rise  to  a  series  of  lineage‐restricted  progenitor  cells,  or  immature  myeloid  cells  (IMCs)  (Fig.  1.2).  These  IMCs,  which  lack  immunosuppressive  properties  in  healthy  individuals  (Delano  et  al.,  2007),  generate  pro‐monocytes and  monocytes that  circulate  in  the  bloodstream  (Fig.  1.2)  (Pollard,  2009).  Murine  monocytes  express  both  CD11b  and  CD115  and  can  be  further  classified  into  functional  subpopulations  of  resident  (Gr1‐Ly6C‐)  and  inflammatory (Gr1+Ly6C+) monocytes (Geissmann et al., 2008; Geissmann et al., 2010).  In  response  to  inflammatory  cytokines,  chemokines,  and  other  factors,  monocytes  migrate into tissues and undergo terminal differentiation into resident DCs or Mφs (Fig.  1.2) (Siveen and Kuttan, 2009).  Recruitment of monocytes to these inflammatory sites  is  mediated  to  a  large  extent  by  CC  chemokine  ligand  2  (CCL2,  a.k.a.  monocyte  chemotactic  protein‐1,  MCP‐1),  which  binds  to  CC  chemokine  receptor  2  (CCR2)  on  monocytes (Laoui et al., 2011). Overall, cells of the MPS are critical for a wide variety of  physiological processes, including tissue development, homeostasis, and regulating the  balance  between  pro‐  and  anti‐inflammatory  responses,  and  accordingly,  exhibit  enormous heterogeneity and versatility (Qian and Pollard, 2010).   16    Figure 1.2  Development and functions of the mononuclear phagocytic lineage.  Mononuclear phagocyte development begins in the BM where pluripotent HPCs give rise to a  series  of  progenitor  cells,  i.e.,  common  myeloid  progenitors  (CMPs),  granulocyte/macrophage  colony‐forming  units  (GM‐CFUs),  macrophage  colony‐forming  units  (M‐CFUs),  monoblasts,  and  pro‐monocytes.  Terminally  differentiated  osteoclasts  and  Mφs  arise  in  the  BM,  while  all  other  mature  cell  types  arise  in  the  tissues  from  blood  monocytes.  M‐CSF  plays  an  important  role  in  promoting  the  development  of  mononuclear  phagocytes at multiple stages. The presence of other factors in the tissues, including GM‐CSF,  IL‐4, IL‐13, IFN‐γ, TNF‐α, promote the differentiation and determine the specific phenotype  and  physiological  roles  of  mature  DCs  and  Mφs.  *’s  indicate  IMCs,  which  lack  immunosuppressive properties in healthy individuals. However, in response to a variety of  inflammatory factors, or disease states, these cells can acquire immunosuppressive functions  and are termed MDSCs. Adapted from Pollard, 2009 and other references in section 1.7.1.       17  Mature Mφs are found in almost every tissue where they perform a wide variety  of critical functions (Table 1.2). Under steady‐state conditions, terminally differentiated  Mφs  are  very  stable  and  can  exist  in  tissues  for  months,  or  even  years  (Cuenca  et  al.,  2011). Mφs are defined by specific phenotypic characteristics and by the expression of  certain cell surface markers, none of which are specifically limited to Mφs (Gordon and  Taylor, 2005). With the exception of alveolar Mφs, which express CD11c but not CD11b  due to their unique lung environment (Guth et al., 2009), murine Mφs express CD11b,  F4/80,  and  macrophage  colony‐stimulating  factor  receptor  (M‐CSFR;  CD115) and  lack  expression  of  Gr1  (Qian  and  Pollard,  2010).  In  combination,  these  characteristics  distinguish Mφs from other members of the myeloid lineage such as PMNs, monocytes,  and  MDSCs  (Joyce  and  Pollard,  2009).  The  development  of  Mφs  is  regulated  by  a  number of different growth factors, the most important of which is macrophage colony‐ stimulating factor (M‐CSF, a.k.a. colony‐stimulating factor‐1 or CSF‐1), as it is required  at multiple stages of the differentiation process (Fig. 1.2) (Pollard, 2009). In fact, M‐CSF  is  not  only  essential  for  Mφ  development,  it  is  also  necessary  for  their  survival  and  proliferation in vitro (Chitu and Stanley, 2006). Mφs exhibit a variety of phenotypes and  perform  many  diverse  functions  including  phagocytosis  of  apoptotic  cells,  debris  removal, destruction of pathogens, coordination of wound healing, tissue development  and  remodeling,  Ag  presentation,  regulation  of  immune  responses,  and  induction  of  both innate and adaptive immunity (Fig. 1.2) (Cesta, 2006; Gordon and Martinez, 2010;  Martinez  et  al.,  2008;  Munn  and  Mellor,  2003;  Pollard,  2009).  These  roles  of  Mφs  in  normal  tissues  can  be  exploited  by  the  developing  tumor  and,  as  a  result,  Mφs  can  contribute to all phases of the cancer process (Laoui et al., 2011).      18  Table 1.2   Diversity of Mφs in different tissues.   Mφs  are  found  in  almost  every  tissue  in  mammals  and  perform  a  wide  variety  of  immunogenic  and  non‐immunogenic  roles.  Adapted  from  Pollard,  2009;  Guth  et  al.,  2009; and Cesta, 2006.    Tissue   Bone      Specific Name  Osteoclast    Bone Marrow Mφ   Brain  Epidermis  Eye  Intestine  Kidney  Liver   Microglial cell Langerhans cell N/A  Crypt Mφ  N/A  Kupffer cell   Lung   Alveolar Mφ   Mammary gland  Ovary  Pancreas  Peritoneal Cavity  Spleen  Testis  Uterus   N/A  N/A  N/A  Peritoneal Mφ  Splenic Mφ  N/A  Uterine Mφ   Function  Bone remodelling; provide stem cell niches Erythropoiesis (identify and degrade ejected  nuclei)  Neuronal survival and connectivity; repair Immune surveillance Vascular remodelling Immune surveillance Ductal development Clearance of debris from blood; tissue  regeneration  Regulation of immune responses to inhaled  pathogens and allergens  Branching morphogenesis; ductal development Steroid hormone production; ovulation  Islet development Immune surveillance Clearance of debris and damaged erythrocytes Steroid hormone production  Cervical ripening  N/A, not applicable    1.7.1.1  Mφ activation     One  of  the  hallmark  characteristics  of  Mφs  is  their  functional  plasticity  (Mantovani and Sica, 2010). Mφs exhibit a wide range of phenotypes and perform many  different functions depending on the environmental stimuli to which they are exposed   (Martinez et al., 2008) (Fig. 1.3). This diversity of Mφs has led to a number of proposed  classification  systems  based  on  activating  stimuli  (Gordon,  2003)  or  different  homeostatic activities (i.e. host defense, wound healing, or immune regulation) (Mosser  and  Edwards,  2008).  The  M1/M2  classification  scheme  described  below  is  the  most  widely  used  model  and  has  been  elaborated  upon  to  include  a  number  of  different  subclasses  (i.e.  M2a,  M2b,  M2c)  (Mantovani  et  al.,  2004).  However,  it  is  important  to  bear  in  mind  that  Mφ  activation  is  likely  a  cyclic  process  that  balances  classical  and  19  alternative  activation  to  achieve  proper  immunologic  function  (McGrath  and  Kodelja,  1999).  Thus,  polarization  of  Mφs  is  a  useful,  simplified  conceptual  framework  for  describing  what  is  most  likely  a  continuum  of  diverse  functional  states  (Mantovani  et  al., 2004).     Classically  activated,  or  M1  Mφs,  are  induced  in  response  to  type  I,  or  pro‐ inflammatory  cytokines,  such  as  IFN‐γ  and  TNF‐α  (Martinez  et  al.,  2006).  In  turn,  M1  Mφs  produce  high  levels  of  pro‐inflammatory  cytokines  (i.e.  IL‐1β,  IL‐6,  IL‐12,  IL‐23,  TNF‐α) and low levels of anti‐inflammatory cytokines (i.e. IL‐10) (Martinez et al., 2006).   Upon  activation  by  Th1  or  NK  cell  produced  IFN‐γ,  M1  Mφs  secrete  ROS  and  RNS  and  thereby become potent killers of intracellular microorganisms and tumor cells (Parkin  and Cohen, 2001). These cytotoxic functions, combined with the ability of these Mφs to  process  and  present  Ags,  makes  them  important  inducers  and  effectors  of  Th1  cell‐ mediated immune responses (Gordon and Martinez, 2010; Munn and Mellor, 2003).     Alternatively  activated,  or  M2  Mφs,  on  the  other  hand,  have  been  reported  to  suppress  both  specific  and  non‐specific  T  cell  activation.  In  general,  they  arise  in  response to stimulation by type II cytokines, such as IL‐4, IL‐10, IL‐13, TGF‐β, and PGE2  and  produce  anti‐inflammatory  cytokines  (i.e.  IL‐10)  (Martinez  et  al.,  2008).  Interestingly, M2 activation appears to be regulated in part by the p50 subunit of NF‐ κB,  which  inhibits  NF‐κB  induced  M1‐polarizing  IFN‐β  production  and  consequently  promotes  M2  activation  (Porta  et  al.,  2009).  M2  Mφs  play  important  roles  in  killing  extracellular  microorganisms  and  parasites  and  in  promoting  wound  healing  by  initiating  tissue  remodeling  and  angiogenesis  (Martinez  et  al.,  2008).  A  number  of  murine  M2  Mφ  markers  have  been  described  including  scavenger,  mannose,  and  galactose‐type receptors (Gordon, 2003; Stein et al., 1992), FIZZ1 and the mammalian  chitinase Ym1 (Ho and Sly, 2009; Holcomb et al., 2000; Raes et al., 2002), and recently,  migration‐stimulating factor (MSF) (Solinas et al., 2010). M2 Mφs have been reported to  suppress T cell activation/proliferation via a variety of mechanisms including secretion   20    Figure 1.3  Polarization of Mφ phenotypes.   Mφ  activation  is  a  cyclical  process  that  balances  classical  (M1)  and  alternative  (M2)  activation  to  eradicate  invading  pathogens  and  promote  subsequent  healing.  Blood  monocytes  that  differentiate  in  the  presence  of  LPS/IFN‐γ  mature  into  M1  or  “classically  activated”  Mφs.  These  M1  Mφs  are  effective  APCs  and  thus  promote  immune  responses.  In  addition,  they  produce  high  levels  of  pro‐inflammatory  cytokines,  ROS,  and  RNS,  which  enable  them  to  kill  pathogens  and  transformed  cells.  On  the  other  hand,  monocytes  that  differentiate  in  the  presence  of  IL‐4,  IL‐10,  IL‐13,  or  corticosteroids  mature  into  M2  or  “alternatively  activated”  Mφs,  which  secrete  IL‐10,  TGF‐β,  IL‐1ra,  and  the  IL‐1R  decoy  protein.  M2  Mφs  scavenge  dead  cells  and  debris,  remodel  and  repair  damaged  tissues,  and  promote angiogenesis. They also function to suppress M1 Mφ‐mediated immune responses  as part of their role in resolving inflammation. Another key difference between M1 and M2  Mφs is how they metabolize the amino acid L‐Arg; M1 Mφs express iNOS and convert L‐Arg  into  NO  while  M2  Mφs  express  the  enzyme  Arg1,  which  converts  L‐Arg  into  L‐ornithine,  which  is  then  converted  into  polyamines  (i.e.  putrescine,  spermidine,  spermine)  that  promote  cell  division  and  L‐proline,  which  supports  collagen  synthesis.  Adapted  from  references in section 1.7.1.1.    21  of  immunosuppressive  cytokines  (i.e.  TGF‐β,  IL‐10)  (Munn  and  Mellor,  2003),  Treg  induction (Brem‐Exner et al., 2008; Hoves et al., 2006), production of PGs, ROS, and RNS  (Albina et al., 1991; Allison, 1978; Metzger et al., 1980; Strickland et al., 1996), and by  depletion of amino acids such as tryptophan (Munn et al., 1999) and arginine (Kung et  al., 1977; Rodriguez et al., 2003) via expression of IDO and Arg1, respectively.     Based  on  in  depth  studies  exploring  Mφ  polarization,  Mantovani  et  al.  have  proposed that M2 Mφs can be further subdivided based on the factors that induce their  activation (Mantovani et al., 2004). Specifically, M2a are activated by IL‐4 or IL‐13, M2b  by immune complexes in combination with IL‐1β or lipopolysaccharide (LPS), and M2c  by IL‐10, TGF‐β, or glucocortocoids (Mantovani et al., 2004; Martinez et al., 2008). The  phenotype  and  function  of  each  subtype,  including  chemokine,  cytokine,  effector  molecule, and receptor expression, has been thoroughly elucidated by genetic profiling,  as well as functional assays (Mantovani et al., 2004; Martinez et al., 2006). Among their  many intriguing findings, Martinez et al. report that M‐CSF driven human monocyte to  Mφ differentiation leads to expression of M2 transcripts, suggesting that M2 activation  is  the  default  pathway  under  steady‐state  conditions  (Martinez  et  al.,  2006).  Furthermore, they found that treatment with M‐CSF upregulated a number of cell cycle‐ associated  genes,  revealing  the  previously  unappreciated  proliferation  potential  of  monocytes (Martinez et al., 2006). These important findings regarding the phenotypic  profiles  of  M1  versus  M2  Mφs  have  been  recently  and  comprehensively  reviewed  (Gordon and Martinez, 2010).     Contributing  to  the  distinct  responses  of  M1  and  M2  Mφs  is  the  way  they  metabolize  the  amino  acid  L‐arginine  (L‐Arg).  M1  Mφs  rapidly  upregulate  inducible  nitric oxide synthase (iNOS, or NOS2) in response to danger signals (Rauh et al., 2005;  Sinha et al., 2005a) to convert L‐Arg into nitric oxide (NO) to kill bacteria, viruses, and  tumor cells (Gordon, 2003; Mantovani et al., 2002). M2 Mφs, on the other hand, which  typically  function  in  wound  healing  after  an  infectious  agent  has  been  destroyed,  possess  constitutively  high  levels  of  Arg1,  which  sequesters  L‐Arg  away  from  iNOS  to   22  generate  ornithine.  Ornithine,  in  turn,  stimulates  host  cell  proliferation  (via  ornithine  decarboxylase‐mediated  conversion  into  polyamines)  and  collagen  synthesis  (via  ornithine‐derived proline) (Gordon and Martinez, 2010).     1.7.1.2  TAMs     It is well established that Mφs play a critical role in tumor biology. Solid tumors,  including  both  primary  tumors  and  metastatic  lesions,  are  infiltrated  by  significant  numbers of TAMs (Siveen and Kuttan, 2009). In fact, there have been reports that TAMs  can  comprise  up  to  80%  of  the  cell  mass  in  breast  tumors  (Bingle  et  al.,  2002).  The  presence of extensive TAM infiltration correlates with poor prognosis and metastasis in  a  variety  of  human  cancers,  including  breast,  cervix,  and  bladder  (Leek  et  al.,  1996;  Siveen  and  Kuttan,  2009),  a  finding  that  underscores  the  vital  role  TAMs  play  in  promoting carcinogenesis. Monocytes are recruited to the tumor site by tumor‐derived  chemokines such as CCL2 and they mature and become activated in response to tumor‐ derived cytokines, growth factors (i.e. M‐CSF, VEGF, IL‐4, IL‐10, TGF‐β), and PGs (Siveen  and  Kuttan,  2009).  Once  at  the  tumor  site,  Mφs  tend  to  cluster  at  the  leading  edge  of  tumors,  i.e.,  at  the  tumor‐host  tissue  interface  (Siveen  and  Kuttan,  2009).    In  general,  TAMs are thought to display a molecular and functional phenotype similar to M2 Mφs  (Mantovani et al., 2002). However, there are reports that some TAMs can express both  iNOS  and  Arg1  and  thus  possess  a  combination  of  M1‐  and  M2‐like  features  (Gordon  and  Martinez,  2010).  Interestingly,  although  these  M1/M2  TAMs  produce  pro‐ inflammatory  cytokines  and  ROS,  they  do  not  seem  to  be  cytotoxic  to  tumor  cells  (Gordon  and  Martinez,  2010).  A  recent  study  by  Movahedi  et  al.  highlighted  the  heterogeneity  of  TAMs,  demonstrating  the  presence  of  multiple  phenotypically  and  functionally  distinct  TAM  subsets,  which  could  be  characterized  as  either  M1‐  or  M2‐ like (Movahedi et al., 2010).     Consistent  with  the  role  Mφs  play  in  normal  wound  healing,  TAMs  promote  tumor  growth  and  metastasis  via  promotion  of  angiogenesis  and  vascularization,   23  stroma  formation  and  remodeling,  enhancement  of  tumor  cell  growth  and  invasion,  recruitment  of  additional  inflammatory  cells,  and  suppression  of  anti‐tumor  immune  responses  (Mantovani  et  al.,  2002;  Siveen  and  Kuttan,  2009)  (Fig.  1.4).  In  fact,  it  has  been suggested that TAMs play a critical role in facilitating tumor cell migration out of  the primary tumor, entry into blood or lymph vessels, and seeding in distant sites (Qian  et al., 2009). TAMs carry out these functions by producing a plethora of growth factors,  proteolytic enzymes, cytokines, and inflammatory mediators (Bingle et al., 2002; Siveen  and Kuttan, 2009) and the specific mechanisms involved have been detailed in several  reviews (Bingle et al., 2002; Condeelis and Pollard, 2006; Laoui et al., 2011; Martinez et  al., 2008; Qian and Pollard, 2010).   24    Figure 1.4  TAMs promote tumorigenesis via multiple mechanisms.   TAMs  resemble  M2  Mφs  and  play  a  critical  role  in  tumor  growth  and  metastasis.  TAMs  produce  a  plethora  of  cytokines,  growth  factors,  chemokines,  and  other  molecules  that  support  tumor  growth,  metastasis,  matrix  remodeling,  inflammation,  angiogenesis,  and  immune suppression. Adapted from references in section 1.7.1.2.         25  1.7.2  Myeloid­derived suppressor cells      MDSCs are a heterogeneous population of relatively immature cells at different  stages  of  differentiation  including  early  myeloid  progenitors  and  immature  Mφs,   monocytes, PMNs, and DCs (Pastula and Marcinkiewicz, 2011). Murine MDSCs express  both the αM integrin CD11b and the myeloid lineage differentiation Ag Gr1 (Ly6G and  Ly6C).  Two  subsets  of  murine  MDSCs  have  been  identified;  CD11b+Ly6G‐Ly6Chigh  mononuclear  cells,  which  are  termed  monocytic  MDSCs  (M‐MDSCs)  and  CD11b+Ly6G+Ly6Clow cells, which have multi‐lobed nuclei and are termed granulocytic‐ MDSCs  (G‐MDSCs)  (Movahedi  et  al.,  2008;  Youn  et  al.,  2008).  Human  MDSCs  are  generally defined as cells that express CD11b and the common myeloid marker CD33,  but lack expression of mature myeloid and lymphoid markers and the MHCII molecule  HLA‐DR (Almand et al., 2001; Diaz‐Montero et al., 2009; Nagaraj and Gabrilovich, 2010;  Zea  et  al.,  2005).  MDSCs  are  greatly  expanded  in  practically  all  tested  mouse  tumor  models (Gallina et al., 2006; Habibi et al., 2009; Rodriguez et al., 2005; Youn et al., 2008)  and in cancer patients (Almand et al., 2001; Diaz‐Montero et al., 2009; Kusmartsev et al.,  2008;  Mandruzzato  et  al.,  2009;  Ochoa  et  al.,  2007;  Valenti  et  al.,  2006;  Young  and  Lathers,  1999;  Zea  et  al.,  2005)  and  are  considered  one  of  the  main  contributors  to  immune suppression in cancer (Nagaraj and Gabrilovich, 2010). In response to tumor‐ derived  factors  that  promote  myeloid  cell  recruitment  and  activation  (i.e.  M‐CSF,  GM‐ CSF, VEGF, IL‐1β, IL‐3, IL‐6, IL‐10, Flt3 ligand (Flt3L)) MDSCs are recruited from the BM  to  the  tumor  site  and  secondary  lymphoid  organs  (i.e.  spleen,  lymph  nodes)  via  the  bloodstream  (Youn  and  Gabrilovich,  2010).  In  addition  there  is  evidence  that  MDSCs  can  also  home  to  and  accumulate  in  the  liver  (Ilkovitch  and  Lopez,  2009),  as  well  as  other  sites  including  the  kidneys,  bones,  and  lungs  (Pulaski  and  Ostrand‐Rosenberg,  2001).  A  number  of  different  combinations  of  markers  have  been  suggested  to  more  specifically identify murine and human MDSCs, but the heterogeneity of MDSCs makes  this difficult (Gallina et al., 2006; Greenwald et al., 2005; Huang et al., 2006; Kryczek et  al.,  2006;  Nagaraj  and Gabrilovich,  2010).  Moreover,  although  immature  myeloid  cells  from  tumor‐free  mice  lack  the  immunosuppressive  activity  of  MDSCs  they  express   26  similar levels of these proposed markers (Youn et al., 2008). Consequently, both murine  and human MDSCs must be identified functionally, which requires assays to accurately  assess MDSC immunosuppression ex vivo.     MDSCs  are  distinguished  by  their  myeloid  origin,  immature  state,  and,  most  notably,  by  their  ability  to  suppress  T  cell‐mediated  immune  responses  (Youn  and  Gabrilovich,  2010).  They  have  been  reported  to  exert  their  suppressive  effects  by  a  number  of  different  mechanisms,  which  are  indicative  of  their  heterogeneity.  MDSCs  can express both iNOS (induced by IFN‐γ) and Arg1 (induced by IL‐4, IL‐13, and PGE2),  which  contribute  to  MDSC‐mediated  suppression  both  individually  and  synergistically  (Bronte et al., 2003; Laoui et al., 2011). As mentioned previously, iNOS converts L‐Arg  into  NO,  which  inhibits  IL‐2R  signaling  and  T  cell  activation  while  Arg1  expression  depletes L‐Arg from the microenvironment, which prevents re‐expression of the TCRζ  chain and T cell signaling (Bronte et al., 2003). However, when both iNOS and Arg1 are  expressed in the same cell these two enzymes work together in a synergistic fashion to  produce  ROS.  In  the  absence  of  L‐Arg  (due  to  Arg1  expression),  iNOS  can  catalyze  superoxide  (O2‐)  formation  via  its  reductase  domain,  which  combines  with  water  to  generate  hydrogen  peroxide  (H2O2)  or  with  NO  to  form  peroxynitrite  (ONOO‐),  a  powerful oxidant that potently induces T cell dysfunction and apoptosis (Bronte et al.,  2003; Xia et al., 1998). Consequently, MDSCs have been reported to produce high levels  of  ROS  such  as  H2O2  and  ONOO‐  (Youn  and  Gabrilovich,  2010).  MDSCs  have also  been  reported to suppress T cells via the production of immunosuppressive factors including  TGF‐β,  IL‐10,  and  PGE2  (Ostrand‐Rosenberg  and  Sinha,  2009),  by  sequestering  the  amino acid L‐cysteine, which is required for T cell activation (Srivastava et al., 2010), by  down‐regulating  T  cell  expression  of  L‐selectin,  which  prevents  T  cell  trafficking  (Hanson et al., 2009), and by inducing the development of functional Tregs (Huang et  al., 2006; Serafini et al., 2008).     There  are  reports  that  M‐MDSCs  and  G‐MDSCs  suppress  T  cell  responses  via  different  mechanisms  (Movahedi  et  al.,  2008;  Youn  and  Gabrilovich,  2010).  G‐MDSCs   27  suppress  T  cells  via  ROS  production,  which  requires  contact  between  G‐MDSCs  and  T  cells for effective suppression.  (Movahedi et al., 2008; Youn and Gabrilovich, 2010). M‐ MDSCs,  on  the  other  hand,  have  been  reported  to  suppress  T  cells  via  a  number  of  contact  independent  mechanisms  including  upregulation  of  iNOS  and  consequent  NO  production,  upregulation  of  Arg1  and  subsequent  L‐Arg  depletion,  and  production  of  immunosuppressive cytokines (Youn and Gabrilovich, 2010). In addition, some groups  have  reported  that  M‐MDSCs  are  more  potent  than  G‐MDSCs  on  a  per  cell  basis;  however,  in  most  tumor  models  the  vast  majority  of  MDSCs  are  comprised  of  the  G‐ MDSC subtype (Youn and Gabrilovich, 2010).     In  addition  to  suppressing  T  cell  responses,  MDSCs  can  also  impact  anti‐tumor  immunity  via  interactions  with  Mφs,  DCs,  B  cells,  NK  cells,  and  NKT  cells  (Ostrand‐ Rosenberg, 2010). Briefly, MDSCs can inhibit Mφ production of IL‐12 and polarize Mφs  towards an M2, tumor‐promoting phenotype (Sinha et al., 2005b). In addition, MDSCs  increase  Mφ  expression  of  programmed  death  ligand  1  (PD‐L1),  a  negative  T  cell  co‐ stimulatory  molecule  (Ilkovitch  and  Lopez,  2009).  Moreover,  studies  have  suggested  that  factors  that  induce  MDSC  activation  (i.e.  LPS  and  IFN‐γ  stimulation)  inhibit  the  development of DCs (Greifenberg et al., 2009) and there is some evidence that MDSCs  can also restrict B cell development (Ostrand‐Rosenberg, 2010). However, the effect of  MDSCs on NK and NKT cells is less clear; there are conflicting reports in the literature  regarding  whether  MDSCs  suppress  or  activate  these  cell  types  (Elkabets  et  al.,  2010;  Nausch et al., 2008; Ostrand‐Rosenberg, 2010; Pastula and Marcinkiewicz, 2011). It is  possible that different MDSC subsets have distinct effects on NK and/or NKT cells and  this may provide a rationale for the apparently dissimilar results. MDSCs have also been  implicated  in  fostering  cancer  progression  via  promotion  of  angiogenesis,  tumor  cell  invasion,  and  metastasis  (Priceman  et  al.,  2010;  Sinha  et  al.,  2005b;  Yang  et  al.,  2004;  Yang et al., 2008; Youn and Gabrilovich, 2010). MDSCs are considered one of the main  factors  responsible  for  the  failure  of  immunotherapy,  both  in  cancer  patients  and  tumor‐bearing mice, and are an attractive therapeutic target (Kusmartsev et al., 2008;  Ostrand‐Rosenberg, 2010; Vieweg et al., 2007). Consequently, a better understanding of   28  MDSC  immunosuppression  in  cancer  will  be  vital  to  developing  effective  immune‐ mediated cancer therapies.    It is worth noting that although MDSCs have been most commonly studied in the  context  of  cancer,  they  are  induced  in  a  number  of  chronic  and  acute  inflammatory  conditions,  including  autoimmune  disease,  trauma,  burns,  parasitic  infections,  and  sepsis  (Cuenca  et  al.,  2011;  Van  Ginderachter  et  al.,  2010).  Indeed,  the  factors  that  generate  a  normal  immune  response  and  mobilization  of  mature  Mφs,  PMNs,  and  immature  populations  from  the  BM  and  blood  to  inflammatory  sites,  also  induce  accelerated  myelopoiesis  and  expansion  of  MDSCs  (Ueda  et  al.,  2009).  Related  to  this,  the expansion, accumulation (i.e. inhibition of terminal differentiation), and function of  MDSCs are driven by pro‐inflammatory factors produced by the tumor, tumor stroma,  and  infiltrating  T  cells.  These  include  cytokines  (i.e.  IL‐1β,  IL‐6)  (Bunt  et  al.,  2007;  Elkabets et al., 2010), chemokines, PGE2 (Eruslanov et al., 2010; Serafini, 2010), and the  S100A8/A9  proteins  (Ostrand‐Rosenberg  and  Sinha,  2009).  In  addition,  NF‐κB  signaling appears to be required for the complete activation of these cells (Delano et al.,  2007). Exposure of MDSCs to these factors increases the pro‐inflammatory functions of  MDSCs,  including  increased  ROS,  cytokine  (i.e.  IFN‐γ,  IL‐10,  TNF‐α),  and  chemokine  production  (i.e.  CCL3,  CCL4,  CCL5,  CXC  chemokine  ligand  12;  CXCL12)  (Delano  et  al.,  2007). The mechanisms regulating these processes have been elucidated by a number  of  groups  (Corzo  et  al.,  2009;  Nagaraj  et  al.,  2007)  and  have  been  recently  reviewed  (Cuenca et al., 2011).    1.8 Tumor metastasis and the pre­metastatic niche    Historically,  the  major  focus  of  cancer  research  has  been  primary  tumor  development and progression. However, since the vast majority of cancer patients die  from metastasis there has been a recent shift in focus towards investigating the factors  that  control  tumor  metastasis  and  this  has  led  to  the  emergence  of  several  novel  hypotheses  and  models  that  shed  light  on  this  intricate  process  (Coghlin  and  Murray,   29  2010). In the past, metastasis was considered to be a stepwise accumulation of genetic  events driven by clonal evolution (Fidler, 2003). However, new evidence from genetic  studies suggests that the vast majority of tumor cells inherently possess the ability to  metastasize  (Singh  et  al.,  2002;  van  't  Veer  et  al.,  2002)  and  that  tumor  cells  may  separate from the primary tumor much earlier than previously appreciated (Husemann  et al., 2008; Schmidt‐Kittler et al., 2003). Furthermore, the critical role that host‐derived  factors play in driving tumor metastasis is now becoming clear.     Our understanding of metastasis has been greatly influenced by the idea that the  behaviour of individual tumor metastases is highly dependent on interactions between  tumor  cells  (the  ‘seeds’)  and  the  host  microenvironment  (the  ‘soil’)  (Coghlin  and  Murray,  2010).  This  idea  was  first  proposed  by  Stephen  Paget  in  1889  based  on  his  analysis  of  metastatic  spread  in  cancer  patient  autopsies  (Paget,  1889).  Today  we  acknowledge  that  multiple  layers  of  cross‐talk  occur  between  malignant  cells  and  normal  physiological  cells,  including  stromal,  endothelial,  inflammatory,  and/or  BM‐ derived  cells,  which  together  comprise  the  metastatic  microenvironment  (Laoui  et  al.,  2011;  Psaila  et  al.,  2006).  There  is  evidence  that  although  tumor  cells  may  be  continually  released  from  a  primary  site,  relatively  few  of  them  are  able  to  efficiently  form macrometastases (Luzzi et al., 1998). In fact, the most probable outcome for these  cells is death, with extravasation and establishment of micrometastases serving as rate‐ limiting  steps  in  this  process  (Joyce  and  Pollard,  2009).  Perhaps  one  of  the  most  important concepts that has transformed the way we conceptualize metastasis is that of  the  ‘pre‐metastatic  niche’  (Coghlin  and  Murray,  2010;  Kaplan  et  al.,  2006),  based  on  landmark findings by Kaplan et al. (Kaplan et al., 2005). These studies demonstrate that  recruitment  of  VEGFR‐1  expressing  HPCs  represents  an  essential  cellular  event  in  the  process of metastasis (Kaplan et al., 2005). Prior to the arrival of metastatic tumor cells,  HPCs  home  to  specific  sites  and  form  clusters,  comprising  the  ‘pre‐metastatic  niche’,  that  identify  sites  of  future  metastases  (Kaplan  et  al.,  2005).  Their  results  suggest  a  functional  role  for  VEGFR‐1,  since  anti‐VEGFR‐1  blocking  Abs  specifically  prevented  tumor  metastases  in  their  model  (Kaplan  et  al.,  2005).  Furthermore,  they  report  that  soluble factors produced by primary tumor cells can induce VEGFR‐1 progenitor cells to  30  migrate  from  the  BM  to  specific  metastatic  sites,  where  they  direct  the  seeding  and  proliferation of metastatic lesions in a specific manner (Kaplan et al., 2005). However,  there are conflicting reports regarding the cell types that comprise the niche as well as  the manner in which the niche functions (Qian and Pollard, 2010). For example, some  groups  have  challenged  whether  VEGFR‐1  is  required  for  metastasis  (Dawson  et  al.,  2009),  while  others  have  proposed  that  the  niche  provides  sites  for  tumor  cells  to  adhere  and  grow  (Psaila  and  Lyden,  2009)  or  acts  as  a  reservoir  of  monocytes  that  differentiate into Mφs upon tumor cell arrival (Qian et al., 2009). There is also evidence  that  hypoxia  mediates  metastatic  niche  development.  Specifically,  hypoxia‐induced  lysyl oxidase (LOX) has been reported to accumulate at pre‐metastatic sites, where it is  required  for  the  recruitment  of  CD11b+  myeloid  cells,  which  in  turn  promote  the  invasion  and  recruitment  of  other  BM‐derived  cells,  as  well  as  metastatic  tumor  cells  (Erler et al., 2009).     Although it is now evident that BM‐derived progenitors and inflammatory cells  contribute  to  metastasis  (Psaila  et  al.,  2006),  the  specific  cell  types  and  mechanisms  involved  are  still  being  explored.  Substantial  evidence  suggests  both  MDSCs  and  Mφs  play roles in metastasis through production of soluble factors (including growth factors,  proteolytic  enzymes,  cytokines,  chemokines,  and  inflammatory  mediators),  modification of the extracellular matrix (ECM), and interactions with tumor cells (Qian  and  Pollard,  2010;  Siveen  and  Kuttan,  2009;  Youn  and  Gabrilovich,  2010).  Consequently,  MDSCs  and  Mφs  function  to  promote  metastasis  through  several  mechanisms  including  encouragement  of  tumor  cell  survival  and  proliferation,  promotion  of  angiogenesis,  and  enhancement  of  tumor  cell  migration  and  invasion  (Condeelis and Pollard, 2006; Youn and Gabrilovich, 2010).      1.9 4T1 and 67NR murine mammary tumor models    As mentioned above, metastatic disease is responsible for the majority of deaths  in breast cancer patients (Psaila et al., 2006) and a number of animal models have been   31  developed over the years to investigate key aspects of the metastatic process (Heppner  et  al.,  2000).    One  of  the  most  useful  is  the  4T1  murine  mammary  carcinoma  model  because  it  closely  resembles  the  natural  history  and  histopathology  of  human  breast  cancer and because it is one of a series of sister models that represent the spectrum of  metastatic  disease  (Heppner  et  al.,  2000).  Specifically,  a  comparison  of  the  metastatic  4T1 to its non‐metastatic sister 67NR facilitates studies aimed at elucidating the factors  responsible for primary tumor growth versus metastasis. Both 4T1 and 67NR cell lines  were derived from a single, spontaneous mouse mammary tumor (Aslakson and Miller,  1992; Miller et al., 1983).  The thioguanine‐resistant 4T1 subline was derived from this  parental  population  while  the  geneticin‐resistant  67NR  subline  was  obtained  by  transfection  of  line  67  (Aslakson  and  Miller,  1992).  While  both  lines  are  highly  tumorigenic  and  form  primary  tumors  in  the  mammary  fat  pad,  the  4T1  cell  line  is  highly  metastatic  while  67NR  cells  are  non‐metastatic  (Aslakson  and  Miller,  1992).  Another  key  difference  between  these  two  cell  lines  is  the  vascularization  of  the  primary tumor; primary 4T1 tumors are hypoxic while 67NR primary tumors are well  vascularized and normoxic (Aslakson and Miller, 1992).    A  number  of  studies  have  used  the  4T1  tumor  model  to  investigate  the  role  of  myeloid  cells  in  metastasis.  When  these  cells  are  injected  orthotopically  into  the  mammary  fat  pad  of  syngeneic  BALB/c  mice,  they  share  several  important  characteristics  with  human  breast  carcinomas  (Heppner  et  al.,  2000;  Pulaski  and  Ostrand‐Rosenberg, 2001). In particular, 4T1 tumor cells spontaneously metastasize to  the  lung,  liver,  bone,  and  brain  via  the  bloodstream  (Aslakson  and  Miller,  1992;  Heppner  et  al.,  2000),  consistent  with  late‐stage  human  breast  cancer.  As  well,  mice  bearing  4T1  tumors  exhibit  significant  expansion  and  accumulation  of  MDSCs  in  the  lungs, spleen, blood, and primary tumor (Ostrand‐Rosenberg, 2010; Youn et al., 2008).  These  4T1‐induced  MDSCs  have  been  shown  to  accumulate  in  response  to  pro‐ inflammatory mediators (i.e. IL‐1β, IL‐6, PGE2, S100A8/A9) (Ostrand‐Rosenberg, 2010),  contribute  to  decreased  immune  surveillance  (Sinha  et  al.,  2005c),  and  block  both  innate  and  adaptive  anti‐tumor  immunity  (Sinha  et  al.,  2005b).  They  have  been   32  reported  to  exert  their  immunosuppressive  effects  by  a  number  of  mechanisms  including upregulation of Arg1 expression and the resulting depletion of L‐Arg, cysteine  sequestration,  and  down‐regulation  of  L‐selectin  expression  on  T  cells  (Ostrand‐ Rosenberg, 2010).     Less is known about the role Mφs play in the 4T1 tumor model. However, it has  been shown that 4T1 tumor cells skew the differentiation of naïve Mφs into M2 Mφs in  an IL‐6‐dependent manner (Wang et al., 2010). Furthermore, 4T1‐induced MDSCs and  Mφs  have  been  reported  to  work  together  to  suppress  immune  surveillance  against  metastasis; specifically, contact‐dependent cross‐talk between MDSCs and Mφs leads to  increased IL‐10 production by MDSCs and decreased IL‐12 production by Mφs (Sinha et  al.,  2007a; Sinha  et  al.,  2005b).  On  the  other  hand,  relatively  little is  known  about  the  role  of  Mφs  or  MDSCs  in  the  67NR  tumor  model.  Additional  studies  will  likely  reveal  whether  myeloid  cells  are  involved  in  tumor  growth  in  this  non‐metastatic  model  of  mammary carcinoma.    1.10 Aims of study    Although it is well established that immune suppression contributes to all stages  of  cancer,  there  are  many  aspects  that  remain  unclear.  First,  multiple  myeloid  and  lymphoid  cell  populations  have  been  proposed  to  possess  immunosuppressive  properties. However, little is known about the specific roles each of these cell types play  in different situations. For example, do the same cell types that contribute to peripheral  tolerance  under  physiological  circumstances  also  promote  tumor  growth?  Moreover,  the  signaling  pathways  that  regulate  the  immunosuppressive  properties  of  different  cells are not yet well defined. Given the dual roles these cells play in both the promotion  and  inhibition  of  immune  responses,  understanding  the  specific  factors  that  regulate  their function is of particular importance.  Furthermore, very few studies have directly  compared  the  immunosuppressive  potencies  of  different  cell  types,  or  the  different  mechanisms they use to exert their suppressive effects. Finally, it is poorly understood   33  how  the  strength  of  immune  suppression  relates  to  the  importance  of  these  cells  in  tumor  growth  or  metastasis.  A  better  understanding  of  factors  that  control  the  development and function of immunosuppressive myeloid cells is critical for the design  of therapies that could be used to treat diseases such as cancer and autoimmunity via  the modulation of immune suppression.     The work presented in this thesis addresses a number of these issues, especially  the  different  roles  immunosuppressive  cells  play  in  normal  physiology  and  in  cancer.  We  chose  to  focus  on  elucidating  the  immunosuppressive  features  of  mononuclear  phagocytes, and Mφs in particular, since the role of regulatory lymphoid cells (i.e. Tregs)  was  being  carried  out  with  a  collaborator  (Dr.  Megan  Levings,  CFRI)  and  the  suppressive  properties  of  different  DC  subsets  was  being  investigated  by  another  graduate  student  in  our  laboratory  (Antignano  et  al.,  2011).  Moreover,  the  regulatory  functions of Mφs is a topic that has received very little attention to date (Brem‐Exner et  al.,  2008;  Munn  and  Mellor,  2003).  Our  overall  goal  was  to  explore  the  immunosuppressive  functions  of  Mφs  and  elucidate  the  factors  that  regulate  their  suppressive  properties,  the  mechanisms  by  which  Mφs  suppress  T  cell  responses,  the  relative  potency  of  Mφ  suppression  compared  to  other  myeloid  cell  types  such  as  MDSCs, and their roles in promoting tumor development, growth, and metastasis.    34  CHAPTER 2 :  MATERIALS AND METHODS    2.1 Mice    BALB/c (Taconic; Germantown, NY) and C57BL/6 and OTII transgenic mice (The  Jackson Laboratory; Bar Harbor, ME) were bred in house. BALB/c DO11.10 transgenic  mice,  which  express  a  TCR  specific  for  chicken  ovalbumin  (OVA)  peptide  (323‐339)  restricted to I‐Ad   (Murphy et al., 1990), were purchased from The Jackson Laboratory  and spleens from OTI transgenic mice were kindly provided by Dr. Hung‐Sia Teh (The  University of British Columbia, Vancouver, BC, Canada).  Female mice, 6 to 12 weeks of  age,  were  used  for  all  experiments.  Mice  were  maintained  in  the  Animal  Resource  Centre  at  the  BC Cancer  Research  Centre  under  specific‐pathogen free  conditions.   All  animal  experiments  were  performed  in  accordance  with  institutional  and  Canadian  Council on Animal Care guidelines.    2.2 Media    For the studies presented in Chapter 3, cells were cultured in Iscove’s modified  Dulbecco’s medium (IMDM) + 10% fetal calf serum (FCS) medium (i.e. L‐Arg‐free IMDM  (HyClone, Logan, UT) + 10% FCS, 150 µM monothioglycerate (MTG), 50 U/ml penicillin,  50 µg/ml streptomycin, and 100 µM L‐Arg). For the studies presented in Chapter 4, cells  were  cultured  in  HL1  medium  (i.e.  HL‐1  serum‐free  medium  (BioWhittaker;  Basel,  Switzerland)  +  1%  penicillin,  1%  streptomycin,  1%  Glutamax,  5  x  10‐5  M  beta‐ mercaptoethanol (β‐ME)), or Roswell Park Memorial Institute (RPMI) 1640 + 10% FCS  medium  (i.e.  RPMI  1640  (StemCell  Technologies;  Vancouver,  BC,  Canada)  +  10%  FCS,  150 µM MTG, 50 U/ml penicillin and 50 µg/ml streptomycin). For the studies presented  in Chapter 5, cells were cultured in HL1 medium.    For the MDSC serum studies, we tested four different sources of FCS purchased  from  HyClone,  StemCell  Technologies,  Invitrogen  (Burlington,  ON,  Canada),  and  PAA   35  Laboratories (Pasching, Austria) and two sources of bovine serum albumin (BSA) from  Sigma‐Aldrich  (St.  Louis,  MO)  and  Roche  Diagnostics  (Laval,  QC,  Canada).  BALB/c  mouse serum was purchased from Innovative Research (Novi, Michigan) or harvested  by cardiac puncture from BALB/c mice.    2.3 Reagents and cytokines    Neutralizing Abs to cytokines were purchased as follows: IL‐4 (eBioscience; San  Diego,  CA);  IL‐10  and  cytotoxic  T‐lymphocyte  antigen  4  (CTLA‐4)  (BD  Biosciences;  Mississauga,  ON,  Canada);  IL‐13,  IFN‐γ,  and  TGF‐β  (R&D  Systems;  Minneapolis,  MN);  and IFN‐β (Pestka Biomedical Laboratories; Piscataway, NJ). Reagents were purchased  as  follows:  recombinant  human  latency‐associated  peptide  (LAP)  (R&D  Systems);  N6‐ (1‐iminoethyl)‐L‐lysine  (L‐NIL),  a  specific  inhibitor  of  iNOS  (Calbiochem;  San  Diego,  CA);  carboxy‐2‐phenyl‐4,4,5,5‐tetramethylimidazoline‐1‐oxyl‐3‐oxide  (PTIO),  an  NO  scavenger  (Cayman  Chemicals;  Ann  Arbor,  MI);  soluble  anti‐CD3  and  anti‐CD28  (eBioscience);  OVA  peptides  (257‐264  and  323‐339)  (GenScript;  Piscataway,  NJ);  and  Celebrex,  a  cyclooxygenase  (COX)‐2  inhibitor  (Pfizer;  St.  Louis,  MO).  [(S)‐(2‐ Boronoethyl)‐L‐cysteine]  (BEC),  a  competitive  inhibitor  of  Arg1  and  2  that  does  not  inhibit iNOS, was from Dr. Jean‐Luc Boucher (Université Paris Descartes, Paris, France).  TIB‐218,  a  rat  IgG2aκ  Ab  selective  for  the  β  subunit  of  mouse  lymphocyte  function‐ associated  antigen  1  (LFA‐1)  and  CD11b  (CD18),  was  purified  from  hybridoma  supernatants  in  house.  E.coli  LPS  serotype  O127:B8  and  the  double  stranded  ribonucleic  acid  (dsRNA)  analog  polyinosinic:polycytidylic  (Poly  I:C)  acid  were  from  Sigma‐Aldrich.  The  high‐performance  liquid  chromatography  (HPLC)‐purified  phosphorothioate‐modified CpG‐dinuclotide (CpG), 5'‐tccatgacgttcctgacgtt‐3' was from  Invitrogen  and  peptidoglycan  (PGN)  from  Staphylococcus  aureus  was  from  Fluka  (Buchs,  Switzerland).  Recombinant  mouse  (rm)  IFN‐γ  and  IL‐2  were  from  StemCell  Technologies  and  IFN‐β  was  from  Sigma‐Aldrich.  Unless  otherwise  stated,  all  tissue  culture  reagents  were  from  StemCell  Technologies  and  all  other  reagents  were  from  Sigma‐Aldrich.   36  2.4 Isolation of myeloid cells    2.4.1  Peritoneal macrophages     The peritoneal cavities (PCs) of mice were lavaged with 3 x 5 ml IMDM + 10%  FCS medium or HL1 medium containing 1 mM ethylenediaminetetraacetic acid (EDTA)  (USB Corporation, Cleveland, OH). The number of peritoneal macrophages (PMφs) was  visually  enumerated  using  a  hemocytometer  and  cells  were  resuspended  in  fresh  medium without EDTA. Cells were plated and allowed to adhere for at least 3 hours (h)  before the non‐adherent cells were washed away. When required, adherent cells were  harvested  using  cell  dissociation  buffer  (Invitrogen/Gibco)  and  gentle  scraping.  Analysis  of  the  adherent  cells  revealed  that  >95%  co‐expressed  F4/80  and  CD11b.  In  experiments  where  the  ratio  of  Mφs  to  splenocytes  was  varied,  the  number  of  Mφs  plated per well was adjusted to give the desired ratio, while the number of splenocytes  remained  constant  (2  x  105  cells/well  [96‐well  plate]  or  1  x  106  cells/well  [48‐well  plate]).    2.4.2  Splenic, pulmonary, or tumor­associated Mφs and MDSCs     To  isolate  Mφs  or  MDSCs,  single‐cell  suspensions  were  prepared  from  the  spleens, kidneys, livers, lungs, and/or tumors of naïve or tumor‐bearing female BALB/c  mice.  Spleens  and  livers  were  passed  through  a  70  µm  filter  to  create  a  single‐cell  suspension. Lungs, kidneys, and tumors were finely minced with crossed scalpels prior  to agitation for 40 minutes (min) at 37°C with an enzyme suspension containing 0.5%  trypsin (BD Biosciences) and 0.08% collagenase (Sigma‐Aldrich) in phosphate buffered  saline  (PBS)  (lungs  and  kidneys)  or  30  min  at  37°C  with  125  μg  Liberase  (Roche  Diagnostics)  in  IMDM  (tumors).    After  incubation,  0.06%  DNase  (Sigma‐Aldrich)  was  added, and the cell suspension was gently vortexed and filtered through 30 µm nylon  mesh  to  remove  clumps.  Samples  for  flow  cytometry  were  treated  with  ammonium  chloride  solution  (0.8%  with  0.1  mM  EDTA;  7  min  on  ice)  for  erythrocyte  lysis  and   37  either fixed in 70% EtOH and stored at ‐20°C for subsequent flow cytometry analysis or  analyzed immediately.    Samples  for  magnetic  separation  were  washed  by  centrifugation  (1200  rpm,  5  min) and resuspended in PBS + 2% FCS + 1mM EDTA. Mφs were isolated using F4/80‐ PE positive selection (EasySep; StemCell Technologies) and MDSCs were isolated using  Gr1‐PE  positive  selection  (EasySep;  StemCell  Technologies),  according  to  the  manufacturer’s  instructions  (Table  2.1).  Cell  numbers  were  quantified  using  a  hemocytometer and purity was determined to be >90% by flow cytometry.     2.5 Flow cytometry    All flow cytometry samples were prepared in 96‐well V‐bottom plates. To label  cells  with  surface  marker  Abs,  cells  were  suspended  in  Hank’s  balanced  salt  solution  (HBSS)  +  2%  FCS  +  0.05%  NaN3  (HFN)  and  incubated  with  anti‐mouse  CD16/CD32  (2.4G2)  (BD  Pharmigen,  Mississauga,  ON,  Canada)  for  10  min  at  4°C  to  block  Fc  receptors before labeling. Flurochrome conjugated Abs (Table 2.1) were added at pre‐ determined  optimal  concentrations  for  30  min  at  4°C.    Cells  were  then  washed  twice  and  resuspended  in  HFN  for  analysis.  Data  were  acquired  using  a  FACSCalibur  flow  cytometer  (BD  Biosciences)  and  analyzed  using  FlowJo  software  (Tree  Star,  Inc.,  Ashland,  OR).  Where  reported,  absolute  numbers  of  cells  were  calculated  by  multiplying  the  total  number  of  cells  (enumerated  using  a  hemocytometer)  by  the  proportion of that specific cell type, as determined by flow cytometry.     To stain cells for intracellular Foxp3 expression, cells were resuspended in 50 μl  HFN + 2.4G2 Ab and 100 μl Fixation/Permeabilization working solution (eBioscience)  was added to each sample. Following incubation for 30 min at 4°C, cells were washed  twice with 100 μl 1x Permeabilization Buffer (eBioscience) and resuspended in 50 μl 1x  Permeabilization  Buffer  containing  2%  rat  serum  (Stem  Cell  Technologies).  Abs  were   38  added  as indicated  in Table  2.1  for  30  min at  4°C.   Cells  were then  washed  twice  and  resuspended in HFN and analyzed by flow cytometry.      Table 2.1   List of antibodies used in this thesis.     FC – Flow Cytometry, WB – Western Blotting, IF – Immunofluorescence,   PS – Positive Selection  Ms – mouse, Rb – rabbit, c – cells or cell equivalents  pAb – polyclonal Ab, mAb – monoclonal Ab, Ig – immunoglobulin   APCy – allophycocyanin, Cy – cyanine, FITC ‐ fluorescein isothiocyanate,   PE ‐ phycoerythrin    Antibody (Ab)  Annexin V‐PE  Arg 1  B220‐PE  CD3‐APCy  CD4‐APCy  CD8‐PE  CD8‐FITC  CD11b  CD11b‐APCy  CD11b‐PE  CD11b‐PE  CD11c‐APCy  CD40‐FITC  CD86‐FITC  FcεR1α‐FITC  F4/80  F4/80‐PE  F4/80‐PE  GAPDH  (glyceraldehyde 3‐ phosphate  dehydrogenase)  Gr1  Gr1‐PE   Type  n/a  mAb (Ms)  Rat IgG2a  Armenian  Hamster  IgG1  Rat IgG2b  Rat IgG2a  Rat IgG2a  Rat IgG2b  Rat IgG2b  Rat IgG2b  Rat IgG2b  Armenian  Hamster  IgG  Rat IgG2a  Rat IgG2a  Armenian  Hamster  IgG1  Rat IgG2a  Rat IgG2a  Rat IgG2a  mAb (Ms)   Rat IgG2b  Rat IgG2b   Concentration/  Dilution used  5 μl/106 c  1:2000 0.2 μg/106 c  0.2 μg/106 c   Procedure   Source   FC WB FC FC  BD Pharmingen  BD Bioscience  BD Pharmingen  BD Pharmingen   0.125 μg/106 c  1 μg/106 c  0.5 μg/106 c  1:100 0.125 μg/106 c  1 μg/106 c  1 μg/ml  0.125 μg/106 c   FC FC FC IF FC FC PS FC  eBioscience  StemCell Technologies eBioscience  eBioscience  eBioscience  StemCell Technologies StemCell Technologies eBioscience   1 μg/106 c  1 μg/106 c  0.125 μg/106 c   FC FC FC  BD Pharmingen  BD Pharmingen  eBioscience   1:100 0.1 μg/106 c  1 μg/ml  1:40,000  IF FC PS WB  eBioscience  Invitrogen  Invitrogen  Research Diagnostics  Inc. (Flanders, NJ)   1:100 1 μg/106 c   IF FC  eBioscience  eBioscience   39  Antibody (Ab)   Type   Procedure   Source   PS FC WB  eBioscience  eBioscience  Santa Cruz  Biotechnology, (Santa  Cruz, CA)  BD Pharmingen  Hydroxyprobe, Inc.  (Burlington, MA)  Cell Signalling (Beverly,  MA)  StemCell Technologies Invitrogen   Gr1‐PE  Foxp3‐PE‐Cy7  iNOS   Rat IgG2b  Rat IgG2a  pAb (Rb)   Concentration/  Dilution used  1 μg/106 c  0.25 μg/106 c  1:750  MHCII‐FITC  Pimonidazole‐FITC   Rat IgG2a  Mouse IgG   1 μg/106 c  1:100  FC IF  pSTAT1 Y701   pAb (Rb)   1:1000  WB  Ym1  Goat anti‐rat   Alexa 488  Goat anti‐rat   Alexa 594   pAb (Rb)  pAb (Goat)  1:2000 1:100  WB IF  pAb (Goat)  1:100  IF  Invitrogen     2.6 T cell proliferation assay and cytokine assays    Erythrocyte‐depleted  splenocytes  were  cultured  in  IMDM  medium  or  RPMI  medium + 10% FCS, or HL1 medium ± 10% FCS at 2 x 105  cells/well ± irradiated (2000  rads) test cells in a total volume of 150 μl in 96‐well, flat‐bottom tissue culture plates.  These splenocytes were stimulated as follows: C57BL/6 or BALB/c splenocytes with 1  μg/ml anti‐CD3 + 5 μg/ml anti‐CD28 (polyclonal), OTII or DO11.10 splenocytes with 10  μg/ml OVA peptide (323‐339); and OTI splenocytes with 10 μg/ml OVA peptide (257‐ 264). Inhibitors were added as indicated. Cells were incubated at 37°C, 5% CO2 for 72 h,  with 1 μCi/well  3H‐thymidine (thy) (2 Ci/mM; PerkinElmer, Woodbridge, ON, Canada)  added  for  the  last  18  h.  For  cell  contact  studies,  test  cells  were  added  to  the  lower  chamber  of  Transwell  plates  (0.4  μm  pores,  polycarbonate  membrane;  Corning  Life  Sciences,  Corning,  NY)  and  splenocytes  were  added  to  the  upper  chamber.  Cells  were  harvested  onto  glass  fiber  filter  mats  using  a  96‐well  harvester  (Molecular  Devices,  Sunnyvale, CA). Filter mats were sealed in plastic bags with 10 ml of scintillation fluid  and  3H‐thy  incorporation  measured  using  a  Betaplate  liquid  scintillation  counter  (Wallac, Waltham, MA). Data are expressed as counts per minute (cpm) (mean ± SEM)  of triplicate cultures. Responder control (RC) indicates stimulated splenocytes alone.    40  The relative percentage of splenocyte proliferation was calculated as:  (Proliferation of stimulated splenocytes with test cells) x 100%                (Proliferation of stimulated splenocytes (RC) alone)    To  measure  cytokine  production,  the  above  assay  was  performed  with  the  following  changes:  5  x  105  splenocytes/well  were  added  to  48‐well  plates,  the  assay  was  performed  in  a  total  volume  of  375  μl,  and  no  3H‐thy  was  added.  Cell‐free  supernatants  were  collected  after  72  h  and  IL‐2,  IL‐4,  IL‐10,  and  IFN‐γ  production  assayed  using  cytokine  enzyme‐linked  immunosorbent  assay  (ELISA)  kits  (BD  Biosciences), according to the manufacturer’s instructions.     To assay cell proliferation by flow cytometry, erythrocyte‐depleted splenocytes  were resuspended in 37°C PBS and 5 μM carboxyfluorescein succinimidyl ester (CFSE)  (Sigma‐Aldrich) was added to each sample. Cells were incubated for 10 min at 37°C and  then washed twice in 4°C PBS prior to stimulation and co‐culture with test cells. After  72 h, non‐adherent cells were harvested, stained with fluorescent Abs against CD3, CD4,  and/or CD8, and analyzed by flow cytometry. Histogram peaks represent the number of  T cell divisions and the proportion of divided cells is indicated.      2.7 In vitro Mφ skewing    Mφs were plated at 1.25 x 105 cells/well in 500 μl IMDM + 10% FCS and treated  with this medium alone, with 100 ng/ml IFN‐γ + 100 ng/ml LPS, or with 10 ng/ml IL‐4  + 10 ng/ml IL‐13. After 72 h, Mφs were subjected to Western blot analysis.    2.8 SDS­PAGE and Western blot analysis    Cells were washed with PBS and cell pellets lysed with 1x sodium dodecyl sulfate  (SDS)  sample  buffer  (i.e.  8.5%  (v/v)  glycerol,  0.5%  (w/v)  SDS  and  0.71  M  β‐ME).  Samples were then boiled for 2 min, allowed to cool, and DNA sheared with a 26 gauge  needle.  Equal  numbers  of  cells  (total  cell  lysates)  were  then  loaded  onto  10%  41  polyacrylamide  gels  and  subjected  to  SDS‐polyacrylamide  gel  electrophoresis  (PAGE)  and Western blot analysis as described previously (Damen et al., 1995).  Abs used for  Western blotting are indicated in Table 2.1.     2.9 Viability and morphology assays    Following 72 h co‐culture of stimulated splenocytes with myeloid test cells, non‐ adherent cells were harvested and analyzed by flow cytometry for expression of CD3,  CD4, CD8, Annexin V‐PE, and/or propidium iodide (PI) (Table 2.1). Annexin V staining  was  performed  by  washing  cells  (that  had  been  previously  stained  with  cell  surface  Abs) twice with cold PBS and then resuspending cells in 100μl 1x Binding Buffer (100  mM  4‐(2‐hydroxyethyl)‐1‐piperazineethanesulfonic  acid  (HEPES),  pH  7.4;  140  mM  NaCl; 2.5 mM CaCl2). 5 μl Annexin V‐PE and 100 ng PI were added to each sample, cells  were gently mixed, and incubated for 15 min at 23°C in the dark. Cells were then diluted  with  50  μl  1x  Binding Buffer  and  analyzed  by  flow  cytometry.  Cells  were  classified  as  viable (Annexin V‐PE and PI negative), undergoing apoptosis (Annexin V‐PE positive, PI  negative),  or  dead  (Annexin  V‐PE  and  PI  positive).  For  some  experiments  cells  were  stained for CD3, CD4, and/or CD8, and PI prior to flow cytometric analysis to determine  bulk  (total  cells),  total  T  cell  (CD4+  or  CD8+),  or  CD4+  or  CD8+  T  cell  viability.  The  increase in T cell viability was calculated as:     (Percent viability of stimulated splenocytes with test cells)   x 100%            (Percent viability of stimulated splenocytes (RC) alone)    Cell  viability  was  also  determined  via  trypan  blue  exclusion.  Trypan  blue  was  added to either adherent or non‐adherent cells and the proportion of cells that excluded  trypan blue (viable cells) was determined using a hemocytometer.    To  assess  MDSC  morphology,  MDSCs  were  plated  at  1  x  106  cells/ml  in  HL1  medium with or without 10% FCS and incubated overnight (O/N) at 37°C. The next day,  cells  were  harvested  and  cytospin  preparations  were  stained  with  Giemsa‐Eosin.  The   42  morphology  of  cells  was  assessed  by  light  microscopy  using  an  Axiovert  S100  microscope (Carl Zeiss Canada Ltd., Toronto, ON, Canada) and images captured with a  Retiga EXi camera (QImaging, Surrey, BC, Canada).     2.10 Nitric oxide assay    NO production was determined indirectly by measuring the accumulation of the  stable  end  product,  nitrite  (NO2‐),  in  cell‐free  culture  supernatants  using  the  Griess  assay (Kleinbongard et al., 2002). Briefly, 50 μl of supernatant was aliquoted into wells  of  a  96‐well  plate  at  23°C.  Then  50  μl  of  solution  A  (1%  sulfanilamide  in  2.5%  phosphoric  acid)  was  added  to  each  sample,  followed  by  the  addition  of  50  μl  of  solution B (0.1% phenylnapthylenediamine dihydrochloride in 2.5% phosphoric acid).  After  5  min,  the  absorbance  of  samples  at  570  nm  was  determined  and  NO2‐  concentration calculated by comparison to a standard curve.    2.11 In vitro Mφ pre­treatment and stimulation    Mφs were plated at 1.25 x 105 cells/well in 500 μl IMDM medium + 10% FCS or  HL1 medium in 48‐well plates or 2.5 x 104 cells/well in 100  μl in  96‐well plates. Mφs  were pre‐treated directly ± 100 ng/ml LPS, 0.3 μM CpG, 5 μg/ml dsRNA, 5 μg/ml PGN,  or  IFN‐β  (concentrations  as  indicated),  ±  anti‐IFN‐β  (500  or  1000  U/ml)  or  BEC  (200  μM),  or  indirectly  with  polymyxin  B‐treated  (50  mg/ml)  supernatants  from  Mφs  stimulated for 24 h ± 100 ng/ml LPS. After 24 h, supernatants were collected and IFN‐β  measured by ELISA. Mφs were then washed with fresh IMDM medium + 10% FCS and  co‐cultured with activated splenocytes or stimulated with 100 ng/ml IFN‐γ + 100 ng/ml  LPS for an additional 72 h. After 72 h, proliferation was measured, supernatants were  collected for analysis of NO production, and/or cell lysates were prepared for Western  blot analysis.      43  2.12 IFN­β ELISA    To  assay  IFN‐β  production  we  used  an  ELISA  we  adapted  from  two  previous  publications  (Punturieri  et  al.,  2004;  Weinstein  et  al.,  2000)  and  have  since  published  (Sly  et  al.,  2009).  Briefly,  Maxisorp  ELISA  96‐well  plates  (Nalgene  Nunc  International,  Rochester,  NY)  were  coated  O/N  with  0.1  μg  IFN‐β  capture  Ab  (rat  anti‐mouse  IFN‐β  mAb 7F‐D3; Seikagaku America, Falmouth, MA, USA) in 100 μl PBS. The next day, wells  were washed five times with wash buffer (PBS + 0.05% Tween‐20), blocked for 2 h at  23°C  with  200  μl  assay  diluent  (PBS  +  10%  heat‐inactivated  FCS),  and  then  washed  three times with wash buffer. 100 μl of each sample or standard (rmIFN‐β) was added  to each well and incubated O/N at 4°C. The wells were washed 7x with wash buffer and  then  100  μl  of  detection  Ab  (25  U/ml  rabbit  anti‐mouse  IFN‐β  polyclonal  Ab  in  assay  diluent; R&D Systems, Minneapolis, MN) was added to each well and incubated for 2 hrs  at  23°C.  The  wells  were  washed  7x  with  wash  buffer  with  1  min  soaks  between  each  wash. ELISA substrate (100 μl) (BD OptEIA TMB Substrate Reagent Set; BD Biosciences,  Mississauga, ON, Canada) was added to each well and the plate incubated for 20‐30 min  at 23°C in the dark.  The reaction was stopped with 50 μl 2N H2SO4, the absorbance of  the samples at 450 nm determined, and the concentration of IFN‐β calculated from the  standard curve.    2.13 Tumor models    4T1,  4TO7,  and  67NR  murine  mammary  carcinoma  cells  were  a  kind  gift  from  Dr. Fred Miller (Karmanos Cancer Institutes, Detroit, MI).  These cell lines were derived  from  a  spontaneous  mammary  tumor  in  a  BALB/cfC3H  mouse  (Dexter  et  al.,  1978;  Miller  et  al.,  1983)  and  represent  different  levels  of  metastatic  propensity  (Aslakson  and Miller, 1992).  4T1 tumor cells metastasize to the lung, liver, bone, and brain; 4TO7  cells metastasize to the lungs, but fail to grow into macroscopic metastases; 67NR cells  do not metastasize.  BALB/c mice were anesthetized with 2% isoflurane in O2 and were  orthotopically inoculated with 105 4T1 cells, 106 4TO7 cells, or 2 x 105 67NR cells in 50   44  μl  PBS  in  the  fourth  mammary  fat  pad.  We  have  found  that  these  cell  concentrations  produce  consistent  tumor  growth  rates  with  tumor  volumes  that  approach  ethical  restrictions four weeks after implantation.  Where indicated, mice were subcutaneously  implanted  with  5  mg  or  10  mg  slow‐release  all‐trans  retinoic  acid  (ATRA)  pellets  (Innovative Research of America, Sarasota, FL) at the base of neck. Mice were sacrificed  at  various  time  points  and  weights  of  spleens  and  primary  tumors  were  measured.  Unless  otherwise  indicated,  mice  were  sacrificed  three  weeks  post‐tumor  implant  or  three weeks post‐ATRA pellet implant.    2.14 Serum treatment for MDSC assay studies    FCS  was  untreated,  filtered  (0.22  µm),  dialyzed  (3.5  kDa  (kilodalton)  MW  cut  off), or heat inactivated (55°C, 45 min) and then added to HL1 medium to a final serum  concentration of 10%. Albumin was removed from FCS using Affi‐Gel Blue Gel (Bio‐Rad;  Mississauga,  ON,  Canada)  affinity  chromatography  according  to  the  manufacturer’s  instructions.    2.15 ROS Detection    Pulmonary  and  splenic  MDSCs  were  plated  O/N  in  6‐well  plates  at  1  x  106  cells/ml  in  HL1  medium  ±  10%  FCS  or  3%  BSA.  The  next  day,  cells  were  harvested  using 1 ml/well of cell dissociation buffer (Invitrogen/Gibco) and gentle scraping. Cells  were  washed  twice  with  PBS,  and  stained  with  20  µM  DCFDA  dye  (Invitrogen/Molecular  Probes)  in  PBS  for  45  min  at  37°C,  with  the  cells  gently  mixed  every 10 min during this incubation. MDSCs were then washed twice with 4°C PBS and  then plated in 96‐well plates for cell surface staining, as previously described in section  2.5.  MDSCs  were  stained  for  CD11b,  Gr1,  and  PI,  and  then  suspended  for  analysis  by  flow cytometry. The fluorescent intensity of DCFDA (measured in the FL‐1 channel) of  live  MDSCs  (CD11b+Gr1+PI‐)  was  determined  and  mean  fluorescence  intensity  (MFI)  recorded.    45  2.16 Clonogenic assays    Monodispersed lung cells were washed by centrifugation prior to treatment with  ammonium chloride.  Cells were washed in PBS, resuspended in medium, and aliquots  of  3x103  to  106  cells  were  plated  in  clonogenic  assays  containing  60µM  or  30µM  6‐ thioguanine (for 4T1 and 4TO7 respectively) or 250µg/ml geneticin (for 67NR).  Cells  were incubated for 9‐12 days (37°C, 5% CO2) and then colonies stained with malachite  green  and  manually  counted.  The  total  number  of  tumor  cells  in  the  lungs  was  calculated as follows:    (Proportion of colony forming tumor cells x Total number of lung cells)    2.17 Immunofluorescence    Pimonidazole  (100  mg/kg;  Hydroxyprobe,  Inc.;  Burlington,  MA)  was  injected  intraperitoneally  (IP)  90  min  prior  to  tumor  excision  and  Hoecsht  33342  (500  μg/mouse;  Sigma‐Aldrich)  was  injected  intravenously  (IV)  20  min  prior  to  tumor  excision.  Tumors  were  rinsed  in  4°C  PBS  prior  to  freezing  in  Optimal  Cutting  Temperature (OCT) medium (Sakura Finetek; Torrance, CA). Lungs were inflated with  300  μl  50:50  OCT:PBS  mixture  and  rinsed  in  4°C  PBS  prior  to  freezing  in  OCT.  Serial  sections  (8‐10  μm)  were  cut  with  a  cryostat  and  stained  with  the  appropriate  Abs  (Table  2.1)  in  PBS  containing  4%  calf  serum  with  or  without  0.1%  Triton  X,  for  anti‐ pimonidazole or surface marker Abs, respectively. Where indicated, samples were fixed  with methanol and stained with 4',6‐diamidino‐2‐phenylindole (DAPI).   46  2.18 Statistical analysis    Data  are  represented  as  the  mean  ±  standard  error  of  the  mean  (SEM)  and  all  experiments  were  performed  a  minimum  of  three  times.  Two‐tailed  Student  t  tests  were  performed  using  Microsoft  Office  Excel  2007.  Values  of  p≥0.05  were  considered  not significant (NS) *,p<0.05; **,p<0.01; ***,p<0.001   47  CHAPTER 3 : TOLL­LIKE RECEPTOR AGONISTS THAT INDUCE IFN­β  ABROGATE RESIDENT MACROPHAGE SUPPRESSION OF T CELLS    3.1 Introduction    Immune  cells  that  function  to  suppress  T  cell  responses  are  critical  for  the  maintenance  of  immune  homeostasis  and  the  prevention  of  auto‐immune  disease.  Negative regulation of T cells occurs, not only during development in the thymus, but  also  in  peripheral  tissues  (Bettini  and  Vignali,  2009),  such  as  the  lung  and  PC.  Tregs,  myeloid DCs, and Mφs have all been shown to play a role in peripheral tolerance (Bettini  and Vignali, 2009; Munn and Mellor, 2003); however, the role of Mφs as regulatory cells  has received little attention (Brem‐Exner et al., 2008; Munn and Mellor, 2003).    Although  it  is  well  established  that  Mφs  can  perform  both  immunogenic  and  immunosuppressive  functions,  the  mechanisms  that  determine  whether  Mφs  promote  or  inhibit  a  particular  immune  response  are  not  well  understood.  Resting,  or  non‐ activated, tissue Mφs continually survey the microenvironment, ingesting large amounts  of extracellular fluid, apoptotic cells, and cellular debris, which they display as Ags on  their  surface  for  recognition  by  T  cells  (Gordon  and  Martinez,  2010).  Since  these  Ags  can be derived from either host cells (i.e. self‐Ags) or pathogens, Mφs must be able to  distinguish  whether  a  particular  Ag  should  provoke  an  immune  response  or  be  tolerated. Therefore, we investigated the factors that regulate the effect of Mφs on T cell  activation; we determined the mechanism by which resident PMφs suppress in vitro T  cell proliferation in the absence of pathogens, and then explored the effects of different  pathogen‐derived  molecules  on  Mφ  immunosuppression.  In  this  chapter  we  demonstrate  that  in  response  to  IFN‐γ,  which  is  secreted  by  TCR‐activated  T  cells,  resident  PMφs  acquire  immunosuppressive  properties  that  are  mediated  by  NO.  Furthermore, we show that pre‐treatment with TLR agonists that activate TRIF (i.e. LPS  and  dsRNA),  but  not  those  that  exclusively  signal  through  MyD88  (i.e.  CpG  and  PGN),  eliminates the suppressive properties of Mφs, in part via the induction of IFN‐β. These  48  data further our understanding of how Mφs contribute to T cell tolerance and suggest a  novel role for TLR signaling and IFN‐β in regulating the immunosuppressive functions  of  Mφs.  This  thesis  chapter  is  based  on  previously  published  work  (Hamilton  et  al.,  2010)  and  is  reprinted  with  the  permission  of  The  American  Association  of  Immunologists, Inc.    3.2 Results    3.2.1  Characterization of the immunosuppressive properties of PC cells     Since it has been reported that negative regulation of T cells occurs in peripheral  tissues (Bettini and Vignali, 2009) and T cells are known to reside in the PC (Shiku et al.,  1975), we hypothesized that the PC may contain cells that possess immunosuppressive  properties. To test this, we isolated the PC cells from mice and analyzed the cell types  present  and  their  relative  proportions  by  flow  cytometry.    As  shown  in  Fig.  3.1A,  the  most abundant cells were B cells and CD11b+ cells, followed by DCs, T cells, and mast  cells.  To  see  if  any  of  these  cells  could  suppress  T  cell  proliferation,  we  separated  PC  cells  based  on  their  adherent  properties  and  found  that  adherent  cells  significantly  suppressed  T  cell  proliferation  while  non‐adherent  cells  activated  T  cell  proliferation  (Fig.  3.1B).  Analysis  of  the  adherent  PC  cells  revealed  they  were  exclusively  Mφs,  co‐ expressing  F4/80  and  CD11b  (Fig.  3.1C,  left)  while  lacking  Gr1  (Fig.  3.1C,  right)  and  other non‐Mφ lineage markers (data not shown). To verify that these PMφs were indeed  responsible  for  T  cell  suppression,  we  isolated  F4/80+  or  CD11b+  cells  by  positive  selection and found that both cell populations effectively suppressed T cell proliferation  to an equal extent (Fig. 3.1D).   49    Figure 3.1  Resident PMφs possess immunosuppressive properties.   A, Bulk PC cells were stained with fluorescent Abs and analyzed by flow cytometry to assess  the  relative  proportions  of  cells  expressing  the  lineage  markers  B220  (B  cells),  CD11b  (myeloid cells), CD11c (DCs), CD3 (T cells), and FcεR (mast  cells). B, Polyclonal‐stimulated  splenocytes  were  cultured  with  (black  bars)  or  without  (white  bar)  adherent  or  non‐ adherent PC cells (1 PC cell: 8 splenocytes) and T cell proliferation measured. C, Adherent PC  cells were stained with fluorescent Abs to CD11b and F4/80 (left) or CD11b and Gr1 (right)  and analyzed by flow cytometry. The proportions of CD11b+F4/80+ and CD11b+Gr1‐ cells are  indicated. D, Polyclonal‐stimulated splenocytes were cultured with (black  bars) or without  (white  bar)  F4/80+  or  CD11b+  PC  cells  (1  PC  cell:  2  splenocytes)  and  T  cell  proliferation  measured.  Assays were performed in duplicate (A, C) or triplicate (B, D). Data are the mean  ±  SEM  of  two  independent  experiments  (A)  or  representative  of  three  independent  experiments  (B,  C,  D).  *,p<  0.05;  **,p<0.01;  ***,p<0.001  relative  to  responder  control  (RC;  stimulated splenocytes alone). Reprinted from Hamilton et al., 2010 with permission of The  American Association of Immunologists, Inc.     3.2.2  Resident PMφs exhibit a naïve phenotype     Mφs can exhibit a variety of phenotypes depending on their activation state, from  classically  activated,  M1,  to  alternatively  activated  M2a,  b,  or  c  Mφ  phenotypes  (Martinez  et  al.,  2008).  We  performed  Western  blot  analysis  on  lysates  from  PMφs  to  determine  their  activation  state  and  found  that  these  resident  Mφs  lacked  features  of  either M1, such as iNOS expression, or M2 activation, such as Arg1 or Ym1 expression   50  (Fig.  3.2,  left).  However,  these  Mφs  could  become  either  M1  or  M2  polarized  with  appropriate  stimulation  (IFN‐γ  +  LPS  or  IL‐4  +  IL‐13,  respectively)  (Fig.  3.2,  right),  confirming the naïve (non‐activated) state of resident PMφs.        Figure 3.2  Resident  PMφs  exhibit  a  naïve  phenotype  and  can  be  skewed  to  either  M1 or M2 with appropriate stimulation.   PMφs isolated directly ex vivo (left) or treated with medium alone (‐), IFNγ+LPS, or IL‐4+IL‐ 13 for 72 h (right) were subjected to Western blot analysis. Data are representative of three  independent  experiments.  Reprinted  from  Hamilton  et  al.,  2010  with  permission  of  The  American Association of Immunologists, Inc.        3.2.3  Resident Mφs suppress T cell proliferation and cytokine production     To  further  evaluate  the  immunosuppressive  properties  of  Mφs,  we  co‐cultured  resident  PMφs  from  C57/Bl6  mice  with  stimulated  splenocytes  and  found  that  Mφs  potently suppressed T cell proliferation in response to either polyclonal or Ag‐specific  stimulation  of  CD4+  or  CD8+  T  cells  in  a  dose‐dependent  manner  (Fig.  3.3A).  We  also  conducted these studies using Mφs from BALB/c mice and obtained similar results (Fig.  3.3B).  Next,  we  tested  whether  Mφs  could  suppress  T  cell  cytokine  production.  In  the  presence of Mφs, activated T cells produced significantly less IFN‐γ and IL‐10 (Fig. 3.3C,  left and middle), suggesting that Mφs can inhibit both Th1 and Th2 cytokine production.   51  We also assayed IL‐4 levels, but the concentration of IL‐4 was below the detection limit  in cultures with and without Mφs. However, co‐culture  with Mφs increased T cell IL‐2  levels  (Fig.  3.3C,  right),  suggesting  that  the  presence  of  Mφs  does  not  prevent  IL‐2  production,  and  may  restrict  IL‐2  uptake  by  T  cells.  This  is  consistent  with  previous  studies  suggesting  that  in  the  presence  of  Mφs,  T  cells  secrete  IL‐2,  but  are  unable  to  utilize it and remain locked in the Go/G1 phase of the cell cycle (Bingisser et al., 1998;  Strickland et al., 1996).     To  determine  whether  Mφs  were  inducing  T  cell  death,  we  assayed  the  proportion of dead or apoptotic T cells following co‐culture of Mφs with polyclonal or  Ag‐stimulated T cells. We found that Mφs did not increase T cell death. On the contrary,  they reduced the proportion of dead CD4+ and CD8+ T cells (Fig. 3.4, left). This may be  due,  in  part,  to  phagocytosis  of  dead  cells  by  Mφs.  Interestingly,  analysis  of  the  proportion of apoptotic T cells revealed that co‐culture with Mφs promoted apoptosis of  CD8+, but not CD4+, T cells (Fig. 3.4, right).   52    Figure 3.3  Mφs  suppress  T  cell  proliferation  and  cytokine  production  in  a  dose­ dependent manner.   A,  anti‐CD3/anti‐CD28‐stimulated  C57BL/6  (Polyclonal)  or  OVA‐peptide‐stimulated  OTII  (CD4+  T  cell  Ag‐specific)  or  OTI  (CD8+  T  cell  Ag‐specific)  splenocytes  were  cultured  with  (black bars) or without (white bars) Mφs at different ratios (Mφs:splenocytes; 1:2, 1:8, 1:32)  and T cell proliferation measured.  Significance is compared to RC. B, Responder splenocytes  (polyclonal‐stimulated  BALB/c  (Polyclonal)  or  OVA‐peptide‐stimulated  DO11.10  (CD4+  Ag‐ specific))  were  cultured  with  (black  bars)  or  without  (white  bars)  Mφs  at  different  ratios  (Mφs:splenocytes; 1:2, 1:8, 1:32) and T cell proliferation measured. Significance is compared  to  RC.  C,  Polyclonal‐stimulated  splenocytes  were  cultured  with  (black  bars)  or  without  (white  bars)  Mφs  (1  Mφ:  2  splenocytes).    Supernatants  were  collected  after  72  h  and  concentrations of IFN‐γ (left), IL‐10 (middle), and IL‐2 (right) measured. Data are the mean ±  SEM  of  2  independent  experiments  assayed  in  triplicate  (A,  B)  or  duplicate  (C).  *,p<  0.05;  **,p<0.01;  ***,p<0.001.  Reprinted  from  Hamilton  et  al.,  2010  with  permission  of  The  American Association of Immunologists, Inc.   53    Figure 3.4  Mφs do not increase the proportion of dead T cells.   Polyclonal‐  (Poly)  or  Ag‐specific‐  (OTI  or  OTII)  stimulated  splenocytes  were  cultured  with  (black bars) or without (white bars) Mφs (1 Mφ: 8 splenocytes) and after 72 h the proportion  of  dead  (PI+)  (left)  or  apoptotic  (Annexin  V+  PI‐)  (right)  CD4+  and  CD8+  T  cells  assessed  by  flow cytometry. Data shown are the mean ± SEM of 2 independent experiments assayed in  duplicate. *,p< 0.05; **,p<0.01; ***,p<0.001; NS, not significant. Reprinted from Hamilton et  al., 2010 with permission of The American Association of Immunologists, Inc.        3.2.4  Mφs suppress T cell proliferation via a contact­dependent mechanism      To  elucidate  the  mechanism(s)  by  which  Mφs  were  suppressing  T  cells  we  utilized  a  panel  of  blocking  Abs,  inhibitors,  and  exogenous  cytokines.  Each  of  the  reagents  tested  were  shown  to  be  biologically  active  in  our  hands  in  several  different  systems (Alcon et al., 2009; Hamilton et al., 2010; Kuroda et al., 2009; Mace et al., 2009;  Rauh  et  al.,  2005;  Sly  et  al.,  2009;  Sly  et  al.,  2008,  and  unpublished  results).  We  first  determined whether cytokines that have been reported to alter Mφ phenotype (i.e. IL‐4,  IL‐13) (Rodriguez et al., 2003) or restrict T cell proliferation (i.e. IL‐10, TGF‐β) (Levings  and  Roncarolo,  2000)  were  involved.  Adding  neutralizing  Abs  to  IL‐4,  IL‐10,  IL‐13,  or  TGF‐β  did  not  reverse  Mφ  suppression  of  T  cell  proliferation,  indicating  that  these  cytokines  were  not  involved  (Fig.  3.5A).  To  determine  whether  Mφs  were  acting  as  a  sink for IL‐2 (von Bergwelt‐Baildon et al., 2006) and thus restricting the availability of  IL‐2 for T cell proliferation, we added exogenous IL‐2 to  the cultures, but this did not  reverse  suppression  (Fig.  3.5A),  which  was  consistent  with  our  finding  that  the  presence  of  Mφs  increased  IL‐2  levels  (Fig.  3.3C,  right).  Since  PGs  such  as  PGE2  have  54  been  implicated  in  Mφ  suppression  of  T  cells  (Allison,  1978;  Metzger  et  al.,  1980),  we  tested  the  effect  of  blocking  PGE2  synthesis.  However,  adding  the  COX‐2  inhibitor  Celebrex to co‐cultures did not alter suppression (Fig. 3.5A), which suggested PGE2 was  not involved. Next, we tested whether Mφs were suppressing T cell proliferation by an  arginine dependent mechanism. The amino acid L‐Arg is necessary for T cell functions  and  arginine  depletion  inhibits  T  cell  proliferation  through  a  number  of  different  mechanisms,  including  preventing  re‐expression  of  the  CD3ζ‐chain  (Rodriguez  et  al.,  2002;  Rodriguez  et  al.,  2003).  However,  adding  exogenous  L‐Arg  did  not  abrogate  Mφ  suppression  of  T  cells  (Fig.  3.5A).  Consistent  with  this  result,  inhibiting  Arg1,  which  converts  L‐Arg  to  urea  and  L‐ornithine,  with  the  inhibitor  BEC  did  not  reverse  suppression;  in  fact,  BEC  increased  the  suppressive  effects  of  Mφs  (Fig.  3.5A).  In  addition, we tested whether Mφs were suppressing T cell responses indirectly via Treg  induction. However, Mφ co‐culture with activated T cells did not significantly increase  the proportion of Tregs (Fig. 3.5B).    Since  none  of  the  soluble‐mediated  mechanisms  we  tested  appeared  to  be  involved in Mφ‐mediated immunosuppression, we asked whether the mechanism might  be contact‐dependent.  To test this, we assessed proliferation of activated splenocytes  using a Transwell system. As shown in Fig. 3.5C, when Mφs and responder splenocytes  were  separated  by  a  semi‐permeable  membrane,  T  cell  suppression  was  abrogated,  suggesting that Mφs suppress T cell proliferation via a contact‐dependent mechanism.     55    Figure 3.5  Mφs suppress T cell proliferation via a contact­dependent mechanism.   A, Mφs were co‐cultured with polyclonal‐stimulated splenocytes (1 Mφ: 8 splenocytes) ± 10  μg/ml  rat  IgG,  10  μg/ml  anti‐IL‐4,  2  μg/ml  anti‐IL‐10,  10  μg/ml  anti‐IL‐13,  10  μg/ml  anti‐ TGF‐β, 100 U/well mIL‐2, 20 μM Celebrex, 2 mM L‐arg, or 200 μM BEC. T cell proliferation  was measured and percent of RC proliferation calculated. Significance is compared to control  (‐) co‐cultures, where no inhibitors were added. B, Polyclonal‐stimulated splenocytes were  cultured with (black bar) or without (white bar) Mφs (1 Mφ: 8 splenocytes). After 72 h, the  proportion  of  Tregs  (CD4+Foxp3+  cells)  was  analyzed  by  flow  cytometry.  C,  Mφs  were  co‐ cultured  with  polyclonal‐stimulated  splenocytes  (1  Mφ:  2  splenocytes)  in  control  (Mφs  and  splenocytes  in contact) or Transwell  (Mφs and splenocytes separated by a semi‐permeable  membrane) 96‐well plates. T cell proliferation was measured and percent of RC proliferation  calculated. Data is representative of three independent experiments performed in triplicate  (A, C) or the mean ± SEM of two independent experiments performed in duplicate. *,p< 0.05;  ***,p<0.001; NS, not significant. Reprinted from Hamilton et al., 2010 with permission of The  American Association of Immunologists, Inc.             56  3.2.5  Mφs suppress T cell proliferation via IFN­γ­induced NO production     Since  direct  contact  between  Mφs  and  T  cells  was  required  for  effective  suppression, we tested whether Mφs suppressed T cells either by activating CTLA‐4, a  negative  co‐stimulatory  molecule  found  on  T  cells,  by  producing  membrane‐bound  TGF‐β,  or  via  integrin‐mediated  cell‐cell  interactions.  However,  suppression  was  not  reversed by adding a neutralizing Ab to CTLA‐4, LAP, to bind and neutralize bioactive  TGF‐β  at  the  cell  membrane  (Gandhi  et  al.,  2007),  or  TIB218,  to  block  CD11b/LFA‐1  (Fig. 3.6A, left). Next, we investigated whether ROS or RNS were involved. Although ROS  and RNS are soluble mediators, they are extremely short‐lived and require cells to be in  close  proximity  for  their  effects  to  be  transmitted.  Addition  of  the  ROS  inhibitors  catalase,  N‐acetyl‐L‐cysteine  (NAC),  and  superoxide  dismutase  (SOD)  did  not  reverse  suppression;  in  fact,  catalase  and  NAC  increased  the  suppressive  effects  of  Mφs  (Fig.  3.6A,  right).  To  elucidate  whether  RNS  were  playing  a  role,  we  first  assayed  for  production of NO, a free radical gas that has cytostatic/cytotoxic effects (Bogdan, 2001).  We  found  that  Mφs  produced  NO  in  a  dose‐dependent  manner  in  the  presence  of  activated  T  cells  (Fig.  3.6B  and  C).  The  addition  of  iNOS  inhibitors  NG‐monomethyl‐L‐ arginine  (L‐NMMA)  and  L‐NIL,  or  the  NO  scavenger  PTIO,  to  co‐cultures  effectively  reduced  Mφ  NO  production  (Fig.  3.6D,  left)  and  completely  abrogated  the  inhibitory  effect of Mφs on T cells (Fig. 3.6D, right), indicating that Mφs suppress T cell activation  in large part via NO production.                     57    Figure 3.6  Mφs suppress T cell proliferation through NO production.   A, Mφs were co‐cultured with polyclonal‐stimulated splenocytes (1 Mφ: 8 splenocytes) ± 10  μg/ml anti‐CTLA4, 250 ng/ml LAP, or 5 μg/ml TIB218 (left), or ± 1 mg/ml catalase, 10 mM  NAC,  or  200  U/ml  SOD  (right).  T  cell  proliferation  was  measured  and  percent  of  RC  proliferation  calculated.  Significance  is  compared  to  control  (‐)  co‐cultures,  where  no  inhibitors  were  added.  B,  Mφs  were  cultured  alone  or  with  polyclonal‐stimulated  splenocytes at different ratios (Mφs:splenocytes; 1:4, 1:8, 1:16) for 72 h and NO production  measured.  C,  Responder  splenocytes  (polyclonal‐stimulated  C57BL/6  or  OVA‐peptide‐ stimulated  OTI  or  OTII)  were  cultured  with  (black  bars)  or  without  (white  bars)  Mφs  at  different  ratios  (Mφs:splenocytes;  1:4,  1:8,  1:16,  1:32).  After  72  h,  NO  production  was  measured.  D,  Mφs  were  co‐cultured  with  polyclonal‐stimulated  splenocytes  (1  Mφ:  8  splenocytes) ± 0.5 mM L‐NMMA, 1 mM L‐NIL, or 25 μg/ml PTIO. NO production (left) and T  cell  proliferation  were  measured  and  percent  of  RC  proliferation  calculated  (right).  Significance is compared to control (‐) co‐cultures, where no inhibitors were added. Data are  representative  of  three  to  five  independent  experiments  performed  in  triplicate.  *,p<  0.05;  **,p<0.01;  ***,p<0.001;  NS,  not  significant.  Reprinted  from  Hamilton  et  al.,  2010  with  permission of The American Association of Immunologists, Inc.       58  Since  Mφs  did  not  express  iNOS  (Fig.  3.2)  or  produce  NO  (Fig.  3.6B)  in  the  absence of activated T cells, we hypothesized that a factor produced by activated T cells  was required to induce Mφ NO production. Since IFN‐γ is known to induce iNOS in Mφ  via Janus kinase (JAK)/signal transducer and activator of transcription (STAT) signaling  (Schroder  et  al.,  2004),  we  added  an  IFN‐γ‐neutralizing  Ab  during  Mφ  co‐culture  with  stimulated  T  cells  and  found  this  eliminated  Mφ  NO  production  (Fig.  3.7,  left)  and  restored T cell proliferative ability (Fig. 3.7, right). Taken together, these data indicate  that IFN‐γ, produced by activated T cells, induces naïve, resident Mφs to express iNOS  and produce NO, which negatively regulates T cell responses.     Figure 3.7  IFN­γ is required for Mφ NO production.   Mφs  were  co‐cultured  with  polyclonal‐stimulated  splenocytes  (1  Mφ:  8  splenocytes)  ±  10  μg/ml anti‐IFN‐γ and NO production (left) and T cell proliferation measured and percent of  RC  proliferation  calculated  (right).  Data  are  representative  of  three  to  five  independent  experiments performed in triplicate. ***,p<0.001. Reprinted from Hamilton et al., 2010 with  permission of The American Association of Immunologists, Inc.         3.2.6  Pre­treatment with LPS and dsRNA, but not CpG or PGN, decreases the  ability of Mφs to produce NO and suppress T cells     Our  results  suggested  that  in  the  absence  of  a  pathogen  signal,  resident  Mφs  become  potent  suppressors  of  T  cell  proliferation  upon  stimulation  by  T  cell‐derived  IFN‐γ. Consequently, we wanted to determine whether Mφs matured with TLR ligands   59  would exhibit the same suppressive phenotype. Related to this, we found that although  LPS,  CpG,  dsRNA,  and  PGN  were  equally  potent  at  stimulating  the  maturation  of  Mφs,  i.e., increasing Mφ expression of MHCII, CD40, and CD86 to a similar extent (Fig. 3.8A;  LPS  and  CpG,  and  data  not  shown),  they  had  different  effects  on  Mφ  immunosuppression.  Pre‐treatment  with  LPS  or  dsRNA,  which  signal  through  the  adaptor  TRIF  (Akira  and  Takeda,  2004),  reduced  the  ability  of  Mφs  co‐cultured  with  activated T  cells  to  upregulate iNOS  expression  (Fig.  3.8B),  produce  NO  (Fig.  3.8C),  or  suppress T cell proliferation (Fig. 3.8D).  In contrast, Mφs pre‐treated with CpG or PGN,  which  signal  through  the  adaptor  MyD88  (Akira  and  Takeda,  2004),  behaved  like  control  Mφs,  expressing  iNOS  (Fig.  3.8B),  producing  NO  (Fig.  3.8C),  and  significantly  inhibiting  T  cell  proliferation  (Fig.  3.8D).  It  is  worth  noting  that  although  LPS  and  dsRNA pre‐treatment reduced Mφ iNOS expression upon exposure to activated T cells,  the level of STAT1 phosphorylation did not change (Fig. 3.8B), indicating that JAK/STAT  signaling was not reduced.     Since  previous  reports  suggested  that  pre‐treatment  of  Mφs  with  sub‐lethal  doses of LPS can cause a transient state of hypo‐responsiveness to subsequent exposure  to  LPS  or  other  pro‐inflammatory  mediators  (Lorsbach  and  Russell,  1992),  we  hypothesized  that  pre‐treatment  with  LPS  might  render  Mφs  less  responsive  to  subsequent IFN‐γ stimulation. To test this, we pre‐treated Mφs with or without LPS or  CpG  and  then  stimulated  the  cells  with  or  without  IFN‐γ  +  LPS.    As  shown  in  Fig.  3.9,  Mφs  that  had  been  pre‐treated  with  LPS  produced  significantly  less  NO  than  CpG  or  non‐pre‐treated Mφs, indicating that pre‐treatment with LPS, but not CpG, reduces the  ability of Mφs to respond to IFN‐γ.              60    Figure 3.8  Pre­treatment  with  TLR  agonists  that  signal  through  TRIF  desensitizes  Mφs to subsequent IFN­γ stimulation, decreasing the ability of Mφs to produce NO and  suppress T cells.   A, Mφs were treated with medium alone (grey fill), LPS (black line), or CpG (grey line). After  24 h, cells were harvested and analyzed by flow cytometry for surface expression of MHC  class II, CD40, and CD86. Polyclonal‐stimulated splenocytes were cultured with (black bars)  or without (white bars) Mφs that had been pre‐treated ± LPS, CpG, dsRNA, or PGN for 24 h  and washed prior to co‐culture (1 Mφ: 8 splenocytes). After 72 h, Mφs were subjected to B,  Western blot analysis, and C, NO production and D, T cell proliferation measured. Data  shown are representative of 4 independent experiments, performed in duplicate (A) or the  mean ± SEM of 3 independent experiments, performed in duplicate (B, C, D). *,p< 0.05;  **,p<0.01; ***,p<0.001; NS, not significant. Reprinted from Hamilton et al., 2010 with  permission of The American Association of Immunologists, Inc.      61    Figure 3.9  Pre­treatment  with  LPS,  but  not  CpG,  reduces  Mφ  sensitivity  to  subsequent stimulation.   Mφs were pre‐treated ± LPS or CpG for 24 h, washed, and then stimulated ± IFN‐γ+LPS. After  72 h, NO production was measured. Data are the mean ± SEM of 3 independent experiments,  performed in duplicate. ***,p<0.001; NS, not significant. Reprinted from Hamilton et al., 2010  with permission of The American Association of Immunologists, Inc.        3.2.7  IFN­β contributes to the reduced suppressive abilities of LPS and dsRNA  pre­treated Mφs     To gain insight into how LPS or dsRNA pre‐treatment reduced the ability of Mφs  to respond to IFN‐γ and suppress T cell responses, we tested whether the effect of LPS  was  dependent  on  a  secondary,  secreted  factor.  To  perform  these  studies  we  utilized  polymyxin  B,  a  compound  that  binds  to  and  inactivates  LPS  (Morrison  and  Jacobs,  1976)  and  effectively  blocks  the  effect  of  LPS  on  Mφ  NO  production  (Fig.  3.10A).  We  treated  Mφs  with  or  without  LPS  for  24  h,  and  then  added  polymyxin  B  to  the  supernatants before transferring them onto unstimulated Mφs. After 24 h, the Mφs were  washed and co‐cultured with activated T cells. As shown in Fig. 3.10B, Mφs exposed to  supernatants  from  LPS‐treated  cells  had  decreased  NO  production  when  compared  to  Mφs  treated  with  unstimulated  supernatants.  These  data  suggest  that  LPS  stimulation  induces  Mφs  to  secrete  a  secondary  factor  that  acts in  an  autocrine manner  to reduce  Mφ NO production in response to IFN‐γ from activated T cells.  62       Figure 3.10  LPS  stimulation  induces  production  of  a  secondary  factor  that  inhibits  IFN­γ­induced NO production by Mφs.   A,  Mφs  were  pre‐treated  with  medium  alone  (‐),  LPS,  or  LPS  +  polymyxin  B  (PB)  for  24  h,  washed, and co‐cultured with polyclonal‐stimulated splenocytes (1 Mφ: 8 splenocytes). After  72 h, NO production was measured. Significance is compared to non‐pre‐treated Mφs (‐). B,  Mφs  were  stimulated  ±  LPS  for  24  h  and  the  supernatants  were  supplemented  with  polymyxin B (PB), and then  added to unstimulated Mφs. After 24 h, Mφs  were washed and  co‐cultured  with  polyclonal‐stimulated  splenocytes  (1  Mφ:  8  splenocytes)  for  72  h  and  NO  production measured. Data are representative of three independent experiments. *,p< 0.05;  NS,  not  significant.  Reprinted  from  Hamilton  et  al.,  2010  with  permission  of  The  American  Association of Immunologists, Inc.        We  then  asked  if  this  secondary  factor  could  be  IFN‐β  since  activation  of  the  TRIF  pathway  has  been  shown  to  produce  this  cytokine  (Akira  and  Takeda,  2004).  Indeed,  we  found  that  stimulation  with  LPS  and  dsRNA,  but  not  CpG  or  PGN,  induced  Mφs to produce IFN‐β (Fig. 3.11A). Therefore, we tested whether IFN‐β was involved in  the  abrogation  of  T  cell  suppression  by  LPS  and  dsRNA  and  found  that  IFN‐β  pre‐ treatment  of  Mφs  dose‐dependently  reduced  iNOS  expression  (Fig.  3.11B,  left),  NO  production (Fig. 3.11B, middle) and Mφ immunosuppression (Fig. 3.11B, right). Adding  a  neutralizing  Ab  to  IFN‐β  significantly  increased  NO  production  (Fig.  3.11C,  left)  and  suppression  of  T  cell  proliferation  (Fig.  3.11C,  right)  by  LPS‐  and  dsRNA‐treated  Mφs.  Moreover,  neutralizing  IFN‐β  also  increased  iNOS  expression  in  Mφs  exposed  to  supernatants  from  LPS‐stimulated  Mφs  treated  with  polymyxin  B  (Fig.  3.11D).  Taken   63  together,  these  results  suggest  that  the  induction  of  autocrine‐acting  IFN‐β  plays  an  important role in abrogating the immunosuppressive abilities of Mφs.   Figure 3.11  IFN­β  contributes  to  the  reduced  suppressive  abilities  of  LPS  and  dsRNA  pre­treated Mφs.   A, Mφs were stimulated ± LPS, CpG, dsRNA, or PGN for 24 h. Supernatants were collected and  IFN‐β  levels  measured.  Significance  is  compared  to  non‐pre‐treated  Mφs  (‐).  B,  Polyclonal‐ stimulated splenocytes were cultured with (black bars) or without (white bars) Mφs that had  been  pre‐treated  with  IFN‐β  (0,  100,  1000,  5000  U/ml),  LPS,  or  dsRNA  for  24  h  and  washed  prior  to  co‐culture  (1  Mφ:  8  splenocytes).  After  72  h,  Mφs  were  subjected  to  Western  blot  analysis  (left),  and  NO  production  (middle)  and  T  cell  proliferation  (right)  measured.  Significance  is  compared  to  untreated  Mφs.  C,  Mφs  were  pre‐treated  with  medium  alone  (‐),  LPS, or dsRNA in the presence (black bars) or absence (white bars) of neutralizing anti‐IFN‐β  (1000 U/ml) for 24 h, washed, and co‐cultured with polyclonal‐stimulated splenocytes (1 Mφ:  8 splenocytes). After 72 h, NO production (left) and T cell proliferation (right) were measured.  D, Mφs were stimulated with medium alone (‐), LPS, or LPS + anti‐IFNβ (500 U/ml) for 24 h.  Supernatants were collected, treated with polymyxin B, and then added to unstimulated Mφs.  After 24 h, Mφs were washed and co‐cultured with polyclonal‐stimulated splenocytes (1 Mφ: 8  splenocytes) for 72 h and then subjected to Western blot analysis. Data are representative of  three to five experiments performed in duplicate (A, D) or triplicate (B, C). *,p< 0.05; **,p<0.01;  ***,p<0.001; NS, not significant. Reprinted from Hamilton et al., 2010 with permission of The  American Association of Immunologists, Inc.    64  3.2.8  Inhibition of Arg1 reduces the effect of LPS and dsRNA pre­treatment of  Mφs     We  observed  that,  in  addition  to  inhibiting  iNOS  expression  (Fig.  3.11B),  LPS  and, to a lesser extent, dsRNA increased the expression of Arg1 in Mφs (Fig. 3.11D and  data  not  shown).  Thus,  we  investigated  whether  Arg1  was  playing  a  role  in  LPS‐  and  dsRNA‐induced abrogation of Mφ immunosuppression. As shown in Fig. 3.12, inhibiting  Arg1  with  the  Arg‐specific  inhibitor  BEC  increased  NO  production  (left)  and  suppression of T cells (right) by LPS‐ and dsRNA‐treated Mφs, but, as expected, did not  alter  iNOS  expression  (data  not  shown).  This  is  consistent  with  the  observation  that  increasing Arg1 expression or activity can decrease NO production, given that iNOS and  Arg1  compete  for  the  common  substrate,  L‐Arg  (Gordon,  2003).  Therefore,  LPS  and  dsRNA decrease the ability of Mφs to produce NO in response to T cell‐derived IFN‐γ by  both decreasing iNOS and increasing Arg1 expression.     Figure 3.12  The  Arg1  inhibitor  BEC  reduces  the  effects  of  LPS  and  dsRNA  pre­ treatment.   Mφs were pre‐treated with medium alone (‐), LPS, or dsRNA in the presence (black bars) or  absence  (white  bars)  of  200  μM  BEC  for  24  h,  washed,  and  co‐cultured  with  polyclonal‐ stimulated  splenocytes  (1  Mφ:  8  splenocytes).  After  72  h,  NO  production  (left)  and  T  cell  proliferation (right) were measured. Data are representative of 3 independent experiments  performed  in  triplicate.  *,p<  0.05;  NS,  not  significant.  Reprinted  from  Hamilton et  al.,  2010  with permission of The American Association of Immunologists, Inc.         65  3.3 Discussion    One  of  the  most  important  features  of  the  immune  system  is  its  ability  to  discriminate  between  Ags  that  should  provoke  an  immune  response  and  those  that  should  be  tolerated.  It  is  well  known  that  APCs,  such  as  Mφs  and  DCs,  regulate  the  ability  of  the  adaptive  immune  system  to  respond  to  Ags.  However,  the  specific  mechanisms  by  which  this  occurs  have  not  been  fully  elucidated  (Munn  and  Mellor,  2003). In this chapter, we investigated the process by which resident PMφs suppress T  cell  proliferation  and  determined  how  the  presence  of  pathogen‐derived  molecules  influences Mφ immunosuppression. Our results more clearly elucidate the mechanisms  by  which  Mφs  exert  their  immunosuppressive  effects  and  suggest  a  key  role  for  TLR  signaling and IFN‐β in regulating Mφ phenotype.    Resident  PMφs,  but  not  other  cells  within  the  PC,  potently  suppress  T  cell  proliferation via an IFN‐γ and NO‐dependent mechanism. As shown in the model in Fig.  3.13,  IFN‐γ  produced  by  TCR‐activated  T  cells  induces  naïve  resident  Mφs  to  express  iNOS and produce NO, which subsequently suppresses T cell activation.  However, this  negative  feedback  loop  is  eliminated  by  TLR  agonists  that  signal  through  the  TRIF  cascade (i.e. LPS or dsRNA), but not by those that signal exclusively through MyD88 (i.e.  CpG or PGN). Mφs stimulated with LPS or dsRNA exhibit low responsiveness to T cell‐ produced  IFN‐γ  and,  consequently,  do  not  upregulate  iNOS,  produce  NO,  or  exhibit  immunosuppressive properties. The reduced ability of LPS or dsRNA pre‐treated Mφs to  respond  to  IFN‐γ  is  due,  at  least  in  part,  to  the  production  of  autocrine‐acting  IFN‐β,  which  occurs  following  TRIF  recruitment  and  IRF‐3  activation  (Akira  and  Takeda,  2004). This, together with induction of Arg1, reduces NO production by Mφs, allowing T  cells  to  proliferate  and  mount  an  immune  response.  Although  the  inhibitory effects  of  LPS  and  dsRNA  on  IFN‐γ  responsiveness  and  iNOS  expression  are  mediated  by  IFN‐β,  the  ability  of  LPS  and  dsRNA  to  induce  Arg1  does  not  appear  to  be  IFN‐β‐dependent,  since blocking IFN‐β did not reduce Arg1 expression (Fig. 3.11D). Related to this, there  is  some  evidence  that  Arg1  may  be  induced  via  the  NF‐κB  pathway  (Hagemann  et  al.,  66  2008), which is activated by all TLR signaling pathways, although more rapidly via the  MyD88‐dependent pathway (Akira and Takeda, 2004). However, our data suggest that  increasing  Arg1  alone  is  not  sufficient  to  reduce  NO  production  and  Mφ  immunosuppression, but that increased Arg1 expression is only capable of decreasing  NO production in combination with decreased iNOS expression.       Figure 3.13  The ability of resident Mφs to suppress T cell proliferation is abrogated  when Mφs are pre­treated with LPS or dsRNA, but not CpG or PGN.   Resident peritoneal Mφs, or Mφs pre‐treated with CpG or PGN, suppress T cell proliferation  via IFN‐γ‐induced NO production. IFN‐γ produced by T cells following TCR stimulation binds  to its receptor on resident Mφs and recruits two JAKs (JAK‐1 and JAK‐2), which trigger the  recruitment,  phosphorylation,  and  activation  of  the  transcription  factor  STAT1.  The  phosphorylated  STAT1  homodimer  translocates  into  the  nucleus  and  binds  to  IFN‐γ‐ activation sites (GAS) on the iNOS promoter, inducing iNOS expression and NO production,  which  in  turn  suppresses  T  cell  activation.    However,  Mφs  treated  with  LPS  or  dsRNA  lack  immunosuppressive  properties.  Exposure  of  resident  peritoneal  Mφs  to  LPS  or  dsRNA  triggers TRIF recruitment, IRF‐3 activation, and induction of IFN‐β, and later, IFN‐inducible  genes.  When these pre‐treated Mφs subsequently detect IFN‐γ produced by activated T cells  they fail to upregulate iNOS or produce NO, and consequently exhibit significantly reduced  immunosuppressive  abilities  as  compared  to  naïve,  or  CpG  or  PGN  pre‐treated,  Mφs.  This  failure  of  LPS  or  dsRNA  pre‐treated  Mφs  to  respond  to  IFN‐γ  is,  at  least  in  part,  due  to  autocrine‐acting IFN‐β. This, together with induction of Arg1, reduces NO production by Mφs  and  eliminates  Mφ  immunosuppression.  Reprinted  from  Hamilton  et  al.,  2010  with  permission of The American Association of Immunologists, Inc.          67  There is some controversy in the literature regarding the effect of IFN‐β on IFN‐γ  signaling (Gough et al., 2010; Inaba et al., 1986; Ling et al., 1985; Schroder et al., 2004;  Yoshida et al., 1988). The IFN‐γ and IFN‐α/β signal pathways are partially overlapping,  which allows for cross‐talk at multiple levels (Schroder et al., 2004). IFN‐γ binds to its  receptor,  which  triggers  receptor  clustering  and  activates  a  JAK‐STAT  signaling  pathway  that  culminates  in  the  binding  of  a  phosphorylated  STAT1  homodimer  to  promoter  elements.  This,  in  turn,  activates  or  suppresses  transcription  of  IFN‐γ‐ regulated  genes  (Schroder  et  al.,  2004).  There  is  evidence  that  type  I  IFNs  can  prime  cells and increase responsiveness to IFN‐γ by inducing IFN‐γ signaling molecules, such  as STAT1 (Gough et al., 2010; Schroder et al., 2004). On the other hand, our finding that  IFN‐β antagonizes the response of Mφs to subsequent treatment with IFN‐γ is consistent  with several reports (Inaba et al., 1986; Ling et al., 1985; Yoshida et al., 1988) including  a  recent  study  suggesting  the  mechanism  may  be  down‐regulation  of  the  IFN‐γR  in  response to IFN‐ α/β (Rayamajhi et al., 2010). However, since we did not see a decrease  in  STAT1  phosphorylation  following  IFN‐β  treatment  (data  not  shown),  down‐ regulation of the IFN‐γR may not be consistent with our findings.     IFN‐γ is a critical regulator of Mφ phenotype and function. It is well known that    IFN‐γ  stimulation  triggers  Mφs  to  acquire  anti‐microbial  and  pro‐inflammatory  properties, including the ability to promote T cell proliferation (Schroder et al., 2004).  However,  as  our  data  demonstrate,  IFN‐γ  can  also  trigger  Mφs  to  become  immunosuppressive. Thus, IFN‐γ‐induced Mφs have the potential to both stimulate and  suppress T cell responses and the dominating effect likely depends on the ratio of Mφs  to  T  cells  and  the  resulting  local  concentration  of  NO.  When  Mφs  are  present  in  low  numbers, little NO is produced and the immunostimulatory effects of Mφs predominate  (Fig.  3.3A,  left).  However,  when  the  ratio  of  Mφs  to  T  cells  is  high,  IFN‐γ‐induced  Mφs  exhibit  anti‐inflammatory  properties,  since  the  resulting  NO  is  sufficient  to  suppress  local T cell proliferation. This situation is physiologically relevant both in sites of acute  infection (e.g. wounds) and in non‐infected tissues, where Mφs are more abundant than  lymphocytes  (Gordon,  2003;  Martin  and  Muir,  1990).    This  is  supported  by  a  recent  68  report (Composto et al., 2011) demonstrating that although resident PC T cells exhibit a  phenotype  indicative  of  activation,  they  are  suppressed  by  resident  PMφs,  which  outnumber T cells and suppress via an IFN‐γ and iNOS‐dependent mechanism.     The co‐existence of Mφs and activated T cells in tissues such as the PC (Composto  et al., 2011) suggests Mφs play an important role in maintaining immune homeostasis.   Our  results,  which  indicate  that  TLR  signaling  can  regulate  the  immunosuppressive  properties of Mφs, add to our understanding of how this homeostasis is maintained and  are consistent with the role of TLRs in pathogen detection. In the absence of PAMPs, it is  likely  that  Mφs  that  detect  T  cell‐produced  IFN‐γ  sense  the  response  as  inappropriate  and  exert  immunosuppressive  effects.  On  the  other  hand,  if  a  pathogen  is  present,  predisposition  of  Mφs  to  allow  T  cells  to  mount  an  immune  response  would  be  advantageous.  However,  our  data  suggest  that  not  all  PAMPs  negate  Mφ  suppressive  abilities.  Specifically,  while  TLR4  (LPS)  and  TLR3  (dsRNA)  agonists  abrogated  Mφ  immunosuppression, TLR9 (CpG) and TLR2 (PGN) agonists did not (Fig. 3.8). Although  the  physiological  rationale  for  these  differences  is  not  immediately  apparent,  we  hypothesize  that  the  abrogation  of  Mφ  immunosuppression  may  be  specific  to  viral  stimuli, given that only PAMPs that trigger the induction of IFN‐β (Fig. 3.11A), a critical  mediator  of  the  anti‐viral  immune  response  (Schroder  et  al.,  2004),  eliminated  Mφ  immunosuppression (Fig. 3.8). Bacterial stimuli, on the other hand, did not reduce NO  production  by  Mφs,  which  may  be  advantageous  given  the  ability  of  NO  to  kill  extracellular  pathogens,  such  as  certain  classes  of  bacteria  (Bogdan,  2001).    As  well,  there  is  indirect  in  vitro  (Taylor‐Robinson  et  al.,  1994)  and  in  vivo  (Wei  et  al.,  1995)  evidence that Th1 cells, which target intracellular pathogens (i.e. viruses) may be more  susceptible  to  the  inhibitory  effects  of  NO  than  Th2  cells,  which  promote  attacks  on  extracellular  pathogens  (e.g.  extracellular  bacteria),  and  this  may  suggest  a  potential  rationale  for  our  findings.  Further  studies  to  address  the  physiological  effects  of  different pathogens will provide additional insights into the regulation of Mφ phenotype  by TLR agonists.    69  The  central  role  that  Mφs  play  in  regulating  T  cell  activation  makes  them  attractive  therapeutic  targets.  Strategies  that  promote  Mφ  immune  suppression  could  reduce  autoimmune  disease  and  enhance  transplantation  tolerance.  Alternatively,  therapies  that  reduce  the  suppressive  effects  of  Mφs,  such  as  treatment  with  iNOS  inhibitors,  IFN‐β,  LPS,  or  dsRNA  could  boost  immune  responses  and  lead  to  more  effective  treatments  for  infection  and  cancer.  Furthermore,  given  the  current  debate  concerning  the  most  effective  vaccine  adjuvants  (McKee  et  al.,  2007)  and  the  contrasting  effects  of  different  TLR  agonists  on  the  immunosuppressive  functions  of  Mφs,  and  potentially  DCs,  agonists  that  induce  IFN‐β,  such  as  LPS  or  dsRNA,  may  be  more  effective  than  CpG  at  stimulating  immune  responses.  In  summary,  the  ability  of  Mφs to contribute to both immune response and tolerance highlights their considerable  therapeutic potential, as well as the importance of increasing our understanding of the  factors that regulate Mφ function.       70  CHAPTER 4 : SERUM INHIBITS THE IMMUNOSUPPRESSIVE FUNCTION  OF MYELOID­DERIVED SUPPRESSOR CELLS ISOLATED FROM 4T1  TUMOR­BEARING MICE    4.1 Introduction    After  investigating  the  role  that  Mφs  play  in  regulating  peripheral  tolerance  under physiological conditions, we next wanted to compare the roles of Mφs and other  myeloid  cell  types,  especially  MDSCs,  under  neoplastic  conditions.  MDSCs  are  a  heterogeneous  population  of  myeloid  cells  that  expand  and  become  activated  in  response  to  tumor‐derived  factors  in  both  cancer  patients  and  tumor‐bearing  mice  (Nagaraj  and  Gabrilovich,  2010).  MDSCs  can  contribute  to  cancer  progression  by  a  number  of  different  mechanisms  including  suppression  of  T  cell‐mediated  immune  responses (Priceman et al., 2010; Sinha et al., 2005b; Yang et al., 2004; Yang et al., 2008;  Youn  and  Gabrilovich,  2010).  The  cell  surface  phenotype  of  MDSCs  is  not  clearly  elucidated  and  the  heterogeneity  of  MDSCs  has  made  both  their  identification  and  isolation  difficult  (Nagaraj  and  Gabrilovich,  2010).    Consequently,  both  human  and  murine  MDSCs  must  be  identified  functionally,  which  requires  assays  to  accurately  assess MDSC immunosuppression ex vivo.     A  number  of  different  culture  systems  have  been  used  to  investigate  the  properties  of  cancer‐induced  MDSCs.  However,  the  influence  of  different  culture  conditions  on  the  ability  of  MDSCs  to  suppress  T  cell  responses  ex  vivo  remains  unknown.  Given  that  MDSCs  are  functionally  defined,  accurate  assessment  of  MDSC  immunosuppression  is  extremely  important  for  studying  the  role  of  MDSCs  in  tumor  progression.  One  murine  cancer  model  often  employed  to  study  MDSC‐induced  suppression  involves  orthotopic  injection  of  4T1  mammary  carcinoma  cells  that  metastasize  to  the  lungs  and  other  tissues  (Aslakson  and  Miller,  1992;  Heppner  et  al.,  2000). One of the primary differences in the culture conditions used by different groups  studying 4T1‐induced MDSCs is the presence (Ko et al., 2010) or absence (Srivastava et  71  al.,  2010)  of  serum  in  ex  vivo  immunosuppression  assays.  In  this  chapter  we  demonstrate  that  MDSCs  from  4T1  tumor‐bearing  mice  effectively  suppress  T  cell  proliferation  under  serum‐free  conditions,  but  fail  to  do  so  in  the  presence  of  FCS.  Furthermore, we show that the major serum protein albumin mediates the effect of FCS  on 4T1‐induced MDSCs by inhibiting their ability to produce ROS. Our data indicate that  different culture conditions can profoundly alter MDSC phenotype. These findings have  important  implications  for  investigating  the  role  of  MDSCs  in  cancer,  since  accurate  assessment of MDSC immunosuppression is essential for identifying tumor‐induced MDSCs  and for studying the functional roles of MDSCs in  primary and metastatic tumor growth.   This  thesis  chapter  is  based  on  work  presented  in  a  manuscript  currently  in  press  (Hamilton et al., 2011).    4.2 Results    4.2.1  Validation of in vitro T cell proliferation assay systems     In  order  to  test  our  hypothesis  that  the  immunosuppressive  abilities  of  MDSCs  are influenced by different culture conditions, we designed assay systems to assess the  ability of MDSCs to suppress polyclonal‐ and Ag‐specific‐stimulated T cell proliferation.  As expected, splenic T cells isolated from BALB/c mice proliferated only in response to  polyclonal‐stimulation, while splenic T cells from BALB/c DO11.10 mice proliferated in  response  to  both  polyclonal‐  and  Ag‐specific‐stimulation  (Fig.  4.1A).  In  the  latter  system, polyclonal‐stimulation induces the proliferation of all T cells and is therefore a  more  potent  stimulus  than  Ag‐driven‐stimulation,  which  specifically  activates  CD4+  T  cells. Initial tests also revealed that polyclonal‐stimulated T cells could proliferate to an  equal extent whether or not 10% FCS was present, while Ag‐specific‐stimulated T cells  proliferated more in the presence of 10% FCS (Fig. 4.1B).    72    Figure 4.1  Polyclonal­ and Ag­specific­stimulated T cells proliferate in both serum­ free and serum­containing conditions.   A,  BALB/c  (left)  or  DO11.10  (right)  splenocytes  were  stimulated  with  anti‐CD3/anti‐CD28  (polyclonal) or OVA peptide (Ag‐specific) in serum‐free HL1 medium and T cell proliferation  measured. No stim = unstimulated splenocytes. B, Splenocytes were polyclonal‐ (left) or Ag‐ specific‐  (right)  stimulated  in  HL1  medium  ±  10%  FCS  and  T  cell  proliferation  measured.  Data are the mean ± SEM of three (a) or five (b) independent experiments. ***,p<0.001, NS,  not significant        4.2.2  4T1­induced  MDSCs  only  suppress  T  cell  proliferation  under  serum­ free conditions     We isolated MDSCs from the spleens of 4T1 mice based on Gr1 positive selection  and  established  that  the  recovered  cells  were  >95%  CD11b+Gr1+  and  contained  few  F4/80+  Mφs  (Fig.  4.2A).  We  then  investigated  the  ability  of  4T1‐induced  MDSCs  to  suppress  T  cell  proliferation  and  found  that  MDSCs  significantly  suppressed  both  73  polyclonal‐  and  Ag‐specific‐stimulated  T  cell  proliferation  in  serum‐free  medium,  but  were no longer immunosuppressive when 10% FCS was present (Fig. 4.2B). To ensure  that  these  results  were  not  due  to  a  specific  source  of  FCS  we  tested  four  different  sources of FCS and found that they all completely prevented MDSC‐induced suppression  of T cells, and did so to an equal extent (data not shown). We also tested the effect of  mouse serum in our assay, but found that polyclonal‐stimulated T cells were unable to  proliferate in medium containing 10% mouse serum (data not shown).       Figure 4.2  MDSCs from 4T1 tumor­bearing mice only suppress T cell proliferation  under serum­free conditions.   A,  MDSCs  were  isolated  from  the  spleens  of  4T1  tumor‐bearing  mice  by  Gr1  positive  selection and surface expression of  Gr1, CD11b, and F4/80  assayed. B, Polyclonal‐ (left) or  Ag‐specific‐  (right)  stimulated  splenocytes  were  cultured  with  (black  bars)  or  without  (white bars) 4T1‐induced MDSCs (1 MDSC: 1 splenocyte) in HL1 medium ± 10% FCS and T  cell  proliferation  measured.  Data  are  representative  of  five  independent  experiments.  ***,p<0.001      74  4.2.3  Serum does not increase the viability of 4T1­induced MDSCs     We  next  addressed  whether  the  inability  of  MDSCs  to  suppress  T  cell  proliferation in the presence of serum was due to an effect of serum on the MDSCs or on  the T cells. First, we pre‐incubated MDSCs O/N with or without 10% FCS, washed the  cells, and performed morphological analysis to determine the proportion of M‐ versus  G‐MDSC  subsets  (Movahedi  et  al.,  2008).  We  found  that  although  M‐MDSCs  were  present in both serum‐free and serum‐containing conditions, the majority of cells were  G‐MDSCs  under  both  conditions,  and  that  the  presence  or  absence  of  serum  did  not  alter this ratio (Fig. 4.3A). We also assayed cell viability and found that culturing MDSCs  in  medium  containing  10%  FCS  slightly  reduced  cell  viability  and  increased  the  proportion of non‐adherent cells (Fig. 4.3B).     Figure 4.3  Serum does not alter the proportion of different MDSC subtypes.   MDSCs  were  cultured  overnight  (O/N)  in  HL1  medium  ±  10%  FCS  and  A,  cell  morphology  (20x  magnification),  and  B,  viability  and  adherence  were  determined.  Data  are  representative of three independent experiments.     75  4.2.4  Serum directly inhibits 4T1­induced MDSC immunosuppression     Next,  we  tested  the  ability  of  these  pre‐incubated  MDSCs  to  suppress  T  cell  proliferation  under  serum‐free  conditions.  MDSCs  pre‐incubated  with  10%  FCS  displayed significantly reduced immunosuppressive abilities under both polyclonal and  Ag‐specific conditions (Fig. 4.4A). Importantly, serum did not compromise the ability of  T cells to be suppressed since TAMs (Fig. 4.4B) and PMφs (Fig. 4.4C) from 4T1 tumor‐ bearing mice potently suppressed T cell proliferation both in the presence and absence  of  serum.  Taken  together,  these  results  indicate  that  FCS  directly  ameliorates  the  immunosuppressive properties of 4T1‐induced MDSCs.    4.2.5  FCS inhibits MDSC immunosuppression in a dose­dependent manner     To  understand  how  serum  influences  the  immunosuppressive  phenotype  of  MDSCs,  we  first  assayed  the  ability  of  4T1‐induced  MDSCs  to  suppress  T  cell  proliferation  in  the  presence  of  different  concentrations  of  FCS.  As  shown  in  Fig.  4.5,  serum  inhibited  MDSC  immunosuppression  in  a  dose‐dependent  manner.  While  pulmonary and splenic 4T1‐induced MDSCs strongly suppressed T cell proliferation in  serum‐free  or  1%  FCS‐containing  medium,  they  lost  all  immunosuppressive  function  when assayed in 3% or 10% FCS‐containing medium (Fig. 4.5).    76    Figure 4.4  Serum directly inhibits the immunosuppressive abilities of MDSCs.   A,  Splenic  MDSCs  were  cultured  O/N  in  serum‐free  (white  bars)  or  10%  FCS‐containing  (black bars) HL1 medium, washed, and co‐cultured at different ratios with polyclonal‐ (left)  or Ag‐specific‐ (right) stimulated splenocytes and T cell proliferation measured. B, TAMs or  C, PMφs were co‐cultured (1 Mφ: 2 splenocytes) with polyclonal‐ (left) or Ag‐specific‐ (right)  stimulated  splenocytes  in  HL1  medium  ±  10%  FCS  and  T  cell  proliferation  measured.  Data  are representative of three independent experiments. *,p<0.05; **,p<0.01; ***,p<0.001       77    Figure 4.5  The  inhibitory  effects  of  serum  on  4T1­induced  MDSC  immunosuppression are dose­dependent.   Polyclonal‐stimulated  splenocytes  were  co‐cultured  with  (black  bars)  or  without  (white  bars) pulmonary (left) or splenic (right) MDSCs (1 MDSC: 1 splenocyte) in HL1 medium ± 1,  3,  or  10%  FCS  and  T  cell  proliferation  measured.  Data  are  the  mean  ±  SEM  of  two  independent experiments. ***,p<0.001; NS, not significant        4.2.6  Effect of different serum treatments on MDSC immune suppression     Next, we tested the ability of MDSCs to suppress T cells in the presence of FCS  that  had  been  filtered  to  remove  components  >0.22  µm  or  dialyzed  to  remove  components  <3.5  kDa.  Neither  treatment  restored  the  immunosuppressive  abilities  of  pulmonary  or  splenic  4T1‐induced  MDSCs,  although  dialysis  may  have  slightly  increased  the  ability  of  pulmonary  MDSCs  to  suppress  T  cell  proliferation  (Fig.  4.6A).  Similarly,  heat‐inactivating  the  serum  to  destroy  complement  activity  did  not  restore  MDSC  immunosuppression  (Fig.  4.6B).  Our  experiments  were  performed  using  HL1  medium  and  clearly  demonstrate  the  inhibitory  effect  of  serum  on  MDSC  immune  suppression. There are some reports in the literature that splenic 4T1‐induced MDSCs  are immunosuppressive when assayed in RPMI 1640 medium containing 10% FCS (Ko  et al., 2010; Kodumudi et al., 2010; Le et al., 2009). However, in our hands, both splenic  and  pulmonary  MDSCs  were  unable  to  suppress  T  cell  proliferation  in  RPMI  1640  medium containing 10% FCS and, in fact, pulmonary 4T1‐induced MDSCs appeared to  activate  T  cell  proliferation  under  these  conditions  (Fig.  4.6C).  Similarly,  4T1‐induced   78  MDSCs  failed  to  suppress  T  cell  proliferation  when  cultured  in  IMDM  medium  containing 10% FCS (data not shown).     Figure 4.6  The  effects  of  serum  on  4T1­induced  MDSCs  cannot  be  reversed  by  filtration, dialyzation, or heat inactivation of the serum.  Polyclonal‐stimulated  splenocytes  were  co‐cultured  with  (black  bars)  or  without  (white  bars) pulmonary (left) or splenic (right) MDSCs (1 MDSC: 1 splenocyte) in A, HL1 medium ±  10% untreated, filtered, or dialyzed FCS, or B, HL1 medium ± 10% heat‐inactivated FCS, or C,  RPMI  1640  medium  ±  10%  untreated  FCS,  and  T  cell  proliferation  measured.  Data  are  the  mean ± SEM of two independent experiments. *,p<0.05; ***,p<0.001; NS, not significant      79  4.2.7  BSA blunts 4T1­induced MDSC immunosuppression     Since the antagonism by serum of MDSC‐induced immune suppression could not  be ameliorated by filtration, dialysis, or heat‐inactivation of the serum, we considered  whether any of the key protein components of serum could be playing a role. BSA is the  most  abundant  protein  in  FCS  (Seifert  and  Resman‐Targoff,  2006)  and  is  commonly  added to serum‐deprived cultures to support cell growth (Monette and Sigounas, 1990).  We tested the effect of BSA on 4T1‐induced MDSC immunosuppression and found that  BSA  decreased  the  ability  of  both  pulmonary  and  splenic  MDSCs  to  suppress  T  cell  proliferation in a dose‐dependent manner (Fig. 4.7A). In the absence of BSA, pulmonary  and  splenic  MDSCs  suppressed  96.9%  and  98.3%  of  T  cell  proliferation,  respectively.  This  suppression  was  reduced  to  51.4%  and  43.6%  with  1%  BSA,  and  to  29.8%  and  21.6% when 3% BSA was added to the assay. Soluble BSA is 400 x 1400 nm in size with  a molecular mass of 66.4 kDa and, therefore, would not  have been removed by either  filtration (>0.22 µm) or dialysis (<3.5 kDa) of FCS, which is consistent with our results  (Fig.4.6A). We also tested the effect of human albumin and a second source of BSA and  found that both significantly reduced the suppressive functions of 4T1‐induced MDSCs  (data not shown). To verify that the effect of serum on MDSC immunosuppression was  due to BSA, we removed BSA from FCS using Affi‐Gel Blue bead affinity chromatography  and  compared  the  ability  of  MDSCs  to  suppress  T  cell  proliferation  in  serum  with  or  without BSA. At all concentrations of serum tested, removing BSA restored the ability of  4T1‐induced  MDSCs  to  suppress  T  cells  (Fig.  4.7B),  indicating  that  BSA  inhibits  MDSC  immunosuppression.  Since  BSA  contains  both  high  and  low  affinity  binding  sites  for  fatty acids (FAs), and thus is an efficient source of lipids (Fasano et al., 2005; Roche et  al.,  2008),  we  tested  whether  BSA‐associated  FAs  were  affecting  MDSC  immunosuppression.  Interestingly,  we  found  that  MDSC  suppression  was  restored  when  the  assay  was  performed  in  medium  containing  FA‐free  BSA  (Fig.  4.7C),  suggesting  that  BSA‐associated  FAs  may  be  involved  in  inhibiting  MDSC  immune  suppression.   80  Figure 4.7  BSA reduces the immunosuppressive abilities of 4T1­induced MDSCs.   A,  Polyclonal‐stimulated  splenocytes  were  co‐cultured  with  (black  bars)  or  without  (white  bars)  pulmonary  (left)  or  splenic  (right)  MDSCs  (1  MDSC:  1  splenocyte)  in  HL1  medium  ±  0.3,  1,  or  3%  BSA  and  T  cell  proliferation  measured.  B,  Polyclonal‐stimulated  splenocytes  were  co‐cultured  with  (black  bars)  or  without  (white  bars)  pulmonary  (left)  or  splenic  (right) MDSCs (1 MDSC:1 splenocyte) in HL1 medium ± 1, 3, or 10% FCS that was untreated  or that had been depleted of BSA and T cell proliferation measured. C, Polyclonal‐stimulated  splenocytes were co‐cultured with (black bars) or without (white bars) pulmonary (left) or  splenic  (right)  MDSCs  (1  MDSC:1  splenocyte)  in  HL1  medium  containing  3%  BSA  ±  fatty‐ acids (FAs) and T cell proliferation measured.  Data are the mean ± SEM of two independent  experiments. *,p<0.05; **,p<0.01; ***,p<0.001; NS, not significant         81  4.2.8  BSA  antagonizes  4T1­induced  MDSC  immunosuppression  by  inhibiting  ROS production        Next,  we  embarked  on  a  series  of  studies  to  investigate  the  mechanism(s)  by   which BSA inhibits MDSC‐induced immune suppression. MDSCs have been reported to  suppress T cell proliferation via a number of different mechanisms including expression  of  iNOS  and/or  Arg1,  production  of  inhibitory  cytokines  (i.e.  TGF‐β,  IL‐10),  and  generation  of  ROS  species  (Youn  and  Gabrilovich,  2010).  Therefore,  we  investigated  whether BSA was interfering with any of these processes. We cultured MDSCs O/N in  serum‐free  or  10%  FCS  or  3%  BSA  containing  medium  (as  our  previous  studies  had  demonstrated  this  was  sufficient  to  reduce  the  suppressive  function  of  MDSCs  (Fig.  4.4A)). Western blot analysis of cell lysates revealed that both pulmonary and splenic  4T1‐induced  MDSCs  failed  to  express  either  iNOS  or  Arg1  under  any  of  these  culture  conditions (data not shown). Furthermore, the presence of FCS or BSA did not influence  the production of TGF‐β, which was below the detection limit in all samples, or IL‐10,  which was produced at low, but similar, levels in all samples (data not shown). Next, we  tested the effect of FCS or BSA on the ability of 4T1‐induced MDSCs to generate ROS and  found  that  culturing  MDSCs  O/N  in  FCS  or  BSA  reduced  ROS  production  to  a  large  extent (Figure 4.8). Specifically, pulmonary MDSCs cultured in medium containing FCS  or BSA produced 3.6 fold and 6.5 fold less ROS, respectively. Similarly, splenic MDSCs  produced  5.2  and  6.5  fold  less  ROS  when  cultured  in  the  presence  of  FCS  or  BSA,  respectively.  Taken  together,  our  results  indicate  that  the  immunosuppressive  properties of MDSCs are greatly influenced by different culture conditions and that BSA  contained  in  FCS  blunts  the  immunosuppressive  properties  of  4T1  tumor‐derived  MDSCs, at least in part, by restricting ROS production. These findings are vital for the  appropriate  design  and  interpretation  of  immunosuppression  assays  and  may  shed  light on the physiological roles of MDSCs in tumor biology.   82    Figure 4.8  Serum albumin restricts ROS production by 4T1­induced MDSCs.   A, Pulmonary (left) or splenic (right) MDSCs were cultured O/N in HL1 medium containing  no  serum  (grey  fill),  10%  FCS  (black  line)  or  3%  BSA  (grey  line)  and  ROS  production  measured using DCFDA dye. B, Mean fluorescent intensity (MFI) of MDSCs cultured O/N in  HL1 medium containing no serum (grey fill), 10% FCS (black line) or 3% BSA (grey line) and  labeled  with  DCFDA  dye.  Data  are  (A)  representative  or  (B)  the  mean  ±  SEM  of  two  independent experiments.       83  4.3 Discussion    Although MDSCs are defined by their immunosuppressive properties, our work  demonstrates that the ability of MDSCs to suppress T cell responses can be influenced  by different culture conditions, such as the presence or absence of serum. Specifically,  while  4T1‐induced  MDSCs  potently  suppressed  T  cell  proliferation  under  serum‐free  conditions,  they  were  not  suppressive  when  10%  FCS  was  included  in  the  assay.  Our  data  identify  BSA  as  the  principal  factor  responsible  for  the  effect  of  serum  on  4T1‐ induced MDSCs and are consistent with a model in which serum albumin acts directly  on  MDSCs  to  decrease  their  immunosuppressive  properties  by  decreasing  ROS  production. Moreover, we have some evidence that BSA‐associated FAs may play a role  in  regulating  MDSC  suppression.  These  findings  have  important  implications  for  researchers  investigating  the  role  of  MDSCs  in  cancer,  as  the  accurate  detection  and  quantification  of  immunosuppression  is  critical  for  both  the  identification  and  functional analysis of MDSCs.    Since  our  studies  revealed  that  serum  interferes  with  the  immunosuppressive  functions of 4T1‐induced MDSCs, we performed a series of experiments to elucidate the  mechanism(s)  by  which  this  occurs.  Although  an  understanding  of  the  individual  components  of  serum  would  be  most  helpful  to  address  this,  serum  represents  a  complex  mixture  of  proteins  and  other  factors  that  are  not  well  defined  (Barnes  and  Sato,  1980;  Dainiak,  1985).  Nevertheless,  our  data  indicate  that  albumin,  a  soluble  protein  that  comprises  approximately  50  to  60%  of  total  protein  in  blood  plasma  (Seifert  and  Resman‐Targoff,  2006),  strongly  inhibits  MDSC  immunosuppression  (Fig.  4.7).  Albumin,  which  is  synthesized  in  the  liver,  plays  a  number  of  important  roles  in  vivo: it controls oncotic pressure in the plasma, transports amino acids synthesized in  the  liver  to  other  tissues,  and  acts  as  a  carrier  protein  for  ligands  that  are  relatively  insoluble  in  plasma,  such  as  fatty  acids,  metals,  cholesterol,  bile  pigments,  hormones,  and drugs (Fasano et al., 2005; Seifert and Resman‐Targoff, 2006). In addition, albumin  serves as an important antioxidant, both directly via its thiol group and indirectly via its  ligand‐binding  capabilities  (Fasano  et  al.,  2005;  Roche  et  al.,  2008).  Albumin  likely  84  carries out similar functions in vitro. In addition to serving as a carrier for factors that  support cell growth, including FAs, trace minerals, hormones, and growth factors, there  are also reports that albumin can protect cells from mechanical shear damage and act  as  a  detoxifying  agent  for  H2O2  (Monette  and  Sigounas,  1990;  Roche  et  al.,  2008).  Interestingly,  we  found  that  albumin  stripped  of  FAs  blocked  MDSC‐induced  immunosuppression to a lesser extent than control albumin (Fig. 4.7c), suggesting that  FAs bound to albumin may play a role in inhibiting MDSC‐induced immunosuppression.   In  addition,  it  is  possible  that  albumin  may  act  as  a  carrier  for  other  molecules  that  restrict the immunosuppressive function of MDSCs.    Our  data  indicate  that  albumin  restricts  the  suppressive  function  of  MDSCs,  at  least  in  part,  by  decreasing  the  formation  of  ROS.  MDSCs  isolated  from  a  variety  of  murine  and  human  tumors  have  been  reported  to  suppress  T  cell  responses  via  production  of  ROS,  including  H2O2,  O2‐,  and  peroxynitrites  (Nagaraj  and  Gabrilovich,  2010;  Youn  and  Gabrilovich,  2010).  Although  our  data  clearly  demonstrate  that  exposing 4T1‐induced MDSCs to serum or albumin decreases ROS production (Fig. 4.8),  the flow cytometric approach we used to assay ROS detects generalized oxidative stress  rather than any specific ROS (Eruslanov and Kusmartsev, 2010); therefore, the specific  ROS  involved  remain  unknown  and  their  identification  will  be  the  subject  of  future  studies.     Although we have demonstrated that serum albumin inhibits the production of  ROS, it is possible that other components of serum and/or other mechanisms could also  be involved. Related to this, a recent report has suggested that 4T1‐induced MDSCs can  suppress  Ag‐stimulated  T  cell  proliferation  by  restricting  the  availability  of  cysteine,  which  is  an  essential  amino  acid  for  T  cell  proliferation  (Srivastava  et  al.,  2010).  It  is  therefore  possible  that  serum  contains  additional  cysteine/cystine  and  thus  prevents  4T1‐induced  MDSCs  from  suppressing  T  cell  proliferation.    However,  this  does  not  appear to be the case since we found that MDSCs were unable to  potently suppress T  cell  proliferation  in  the  presence  of  dialyzed  serum  (Fig.  4.6A),  which  lacks  molecules  smaller  than  3.5  kDa,  including  amino  acids  such  as  cysteine  (121.15  Da).  Previous  85  studies  have  also  suggested  that  4T1‐induced  MDSCs  suppress  T  cells  via  an  Arg1‐ dependent mechanism  (Sinha  et  al.,  2005c).  Conceivably,  proteins contained  in  serum  may  inhibit  MDSC  immunosuppression  by  interfering  with  Arg1  expression  or  L‐Arg  metabolism,  although  our  finding  that  neither  pulmonary  nor  splenic  4T1‐induced  MDSCs express Arg1 directly ex vivo (data not shown) does not support this hypothesis.  Related to this, it is intriguing that serum inhibits the ability of MDSCs from 4T1 tumor‐ bearing mice to potently suppress T cell proliferation, but does not affect TAM‐ or PMφ‐ mediated  immunosuppression  (Fig.  4.4).  This  could  be  due  to  differences  in  the  immunosuppressive mechanism(s) used by these cells or to differences in susceptibility  to serum factors.     While  there  are  some  reports  of  4T1‐induced  MDSCs  suppressing  T  cell  responses under serum‐containing culture conditions, i.e., in RPMI 1640 supplemented  with 10% FCS (Ko et al., 2010; Kodumudi et al., 2010; Le et al., 2009), the magnitude of  suppression is difficult to determine since the ratios of MDSCs to splenocytes have not  always been reported. However, in our hands, 4T1‐induced MDSCs could not suppress  T cell proliferation in RPMI 1640 or IMDM media containing 10% FCS, even at very high  ratios (1 MDSC: 1 splenocyte). In fact, in the presence of FCS, MDSCs stimulated T cell  proliferation  in  most  experiments  (Fig.  4.6C).  It  is  possible  that  the  type  of  T  cell  stimulation may affect MDSC immunosuppression in the presence of serum, given that  one  group  reported  4T1‐induced  MDSC  suppression  of  T  cells  stimulated  by  a  combination  of  bryostatin,  ionomycin,  IL‐2,  and  cultured  in  the  presence  of  IL‐5,  IL‐7,  and 10% FCS (Le et al., 2009). In light of these studies, we propose that MDSCs may be  capable of suppressing T cell responses in serum‐containing RPMI 1640 medium under  certain conditions, but the use of serum in immunosuppression assays can mask the full  suppressive effect of MDSCs.     Taken together, our results demonstrate that different culture conditions have a  considerable  influence  on  the  properties  of  MDSCs  isolated  from  4T1  tumor‐bearing  mice.  Since  MDSCs  are  defined  functionally  via  in  vitro  assays,  these  findings  are  of   86  critical importance to accurately assess the role of MDSC in promoting primary tumor  growth  and  tumor  metastasis.  The  presence  of  serum,  and  specifically  albumin,  conceals  the  immunosuppressive  properties  of  MDSCs,  which  can  lead  to  erroneous  conclusions  regarding  the  importance  of  4T1‐induced  MDSCs  in  immunosuppression.  Furthermore, these findings may provide insight into the in vivo functions of MDSCs. It  is  possible  that  high  levels  of  albumin  in  the  peripheral  blood  may  restrict  the  immunosuppressive  abilities  of MDSCs  until  they  reach  the  tissues.  This  hypothesis  is  supported by a study by Sinha et al., in which they demonstrate that, at higher ratios,  blood MDSCs were less suppressive than MDSCs isolated from the spleen, BM, and lung  of 4T1 tumor‐bearing mice (Sinha et al., 2008). Related to this, we found that stimulated  T  cells  were  unable  to  proliferate  in  medium  containing  10%  mouse  serum  (data  not  shown).  Although  the  basis  for  this  is  unclear,  it  is  possible  that  mouse  serum  lacks  some  of  the  factors  required  to  support  T  cell  survival  and/or  proliferation  or  that  it  contains  inhibitory  factors  that  induce  T  cell  anergy  or  death.  This  effect  may  have  physiological  importance,  since  proliferation  of  T  cells  in  the  peripheral  circulation  could  have  deleterious  effects.  In  fact,  this  may  be  an  example  of  a  more  general  phenomenon,  whereby  serum  constrains  the activation  of  certain  cell  types,  including  MDSCs and T cells, and thereby maintains appropriate immune cell function. A recent  report  by  Haverkamp  et  al.  also  indicates  that  MDSCs  from  different  tissues  possess  different capacities to regulate T cell responses (Haverkamp et al., 2011). Using the RM‐ 1 prostate tumor model, they found that while MDSCs in peripheral tissues (i.e. spleen  and liver) could acquire immunosuppressive abilities upon exposure to T cell‐produced  IFN‐γ in vitro, only MDSCs isolated from the tumor site revealed immediate suppressive  abilities  (Haverkamp  et  al.,  2011).  Our  findings,  which  are  consistent  with  those  of  Haverkamp  et  al.  and  others  (Nausch  et  al.,  2008),  support  the  idea  that  MDSCs  may  exhibit diverse properties in different contexts or in response to certain treatments (i.e.  docetaxel)  (Kodumudi  et  al.,  2010),  a  feature  that  could  be  exploited  therapeutically.  Overall,  our  data  clearly  highlight  the  importance  of  testing  different  in  vitro  culture  conditions on MDSC phenotype to ensure that the presence of serum is not masking the  full immunosuppressive properties of MDSCs. These results will enable more accurate   87  identification  of  MDSCs  based  on  their  immunosuppressive  function  and  will  consequently advance our understanding of the roles that MDSCs perform in promoting  primary and metastatic tumor growth.   88  CHAPTER 5 : MACROPHAGES ARE MORE POTENT IMMUNE  SUPPRESSORS THAN MYELOID­DERIVED SUPPRESSOR CELLS IN  MURINE METASTATIC MAMMARY CARCINOMA    5.1 Introduction    Having  established  appropriate  culture  conditions  to  accurately  assay  the  immunosuppressive abilities of myeloid cells, we embarked on a series of experiments  to investigate the roles of different myeloid cells in tumorigenesis. Immunosuppressive  myeloid cells, including MDSCs and mature Mφs, play pivotal roles in the promotion of  primary  tumor  growth  and  are  emerging  as  possible  players  in  metastasis  (Qian  and  Pollard, 2010; Youn and Gabrilovich, 2010). However, little is known about the relative  immunosuppressive potencies of different myeloid cell types, the different mechanisms  by  which  they  exert  their  suppressive  effects,  or  how  the  strength  of  immune  suppression relates to the functions of these cells in tumor growth or metastasis.     Characterization  of  the  specific  phenotypes  of  different  myeloid  cell  types  and  the roles each play in vivo is difficult because of the extreme heterogeneity exhibited by  tumor‐induced myeloid cells. Different subtypes of MDSCs and Mφs have been classified  based on characteristics such as morphology (i.e. M‐MDSCs versus G‐MDSCs), activation  state  (i.e.  M1  versus  M2a,  M2b,  or  M2c  Mφs),  or  tissue‐specificity  (Corzo  et  al.,  2010;  Haverkamp et al., 2011). However, these classifications only begin to describe the true  heterogeneity  of  myeloid  cells,  since  the  phenotype  of  an  individual  cell  can  be  influenced  by  a  number  of  key  factors  including  cell  lineage  and  molecules  present  in  the  microenvironment  both  during  and  subsequent  to  differentiation  (Laoui  et  al.,  2011). Related to this, different populations of MDSCs and Mφs are thought to be able to  exert  their  suppressive  effects  via  different  mechanisms,  including,  but  not  limited  to,  production  of  inhibitory  cytokines,  expression  of  inhibitory  receptors,  and  expression  of Arg1 and iNOS, which lead to L‐Arg depletion and formation of ROS and RNS (Cuenca  et al., 2011).  89    Although there is evidence that MDSCs and TAMs contribute to metastasis, many  questions still remain. For example, it is not well established if Mφ subtypes other than  TAMs play a role in metastasis. Specifically, the contribution of Mφs from extra‐tumoral  (i.e. peripheral tissue) sites in tumor‐bearing hosts remains unclear (Torroella‐Kouri et  al., 2009). Also, given that MDSCs and TAMs have been reported to promote metastasis  via similar mechanisms (Siveen and Kuttan, 2009; Youn and Gabrilovich, 2010) it is not  known  whether  MDSCs  and  Mφs  play  distinct  roles.  Finally,  little  is  known  about  the  relationship  between  immune  suppression  and  metastasis.  The  concept  of  the  pre‐ metastatic  niche  proposes  that  BM‐derived  cells  migrate  to  future  sites  of  metastasis  ahead  of  tumor  cells  and  promote  the  homing  and  growth  of  metastatic  tumor  cells  (Kaplan  et  al.,  2005).  However,  whether  these  BM‐derived  cells  possess  immunosuppressive properties or whether immune suppression contributes to tumor  metastasis is not well established.     To investigate some of these questions, including whether MDSCs and Mφs play  distinct  roles  in  vivo,  we  implanted  4T1  tumor‐bearing  mice  with  ATRA  pellets  to  promote the differentiation of MDSCs to Mφs and DCs. ATRA, a member of the retinoid  family  and  structurally  related  to  vitamin  A,  exerts  strong  effects  on  myeloid  cell  proliferation,  differentiation,  and  apoptosis  in  both  normal  and  cancer  cells  (Bastien  and Rochette‐Egly, 2004). ATRA induces immature cells to terminally differentiate and  is used clinically to treat acute promyelocytic leukemia (APL) (a form of acute myeloid  leukemia (AML)), in combination with chemotherapy (Sanz and Lo‐Coco, 2011). Based  on its ability to reduce MDSC levels and abrogate MDSC‐mediated immune suppression,  the  use  of  ATRA  as  a  possible  cancer  therapy  has  been  proposed  in  the  literature  (Kusmartsev et al., 2003; Kusmartsev et al., 2008; Mirza et al., 2006). In this chapter we  report that, as expected, mice treated with ATRA had decreased MDSCs and increased  Mφs in their lungs. However, mice treated with ATRA displayed significantly more lung  metastases  than  untreated  or  placebo‐treated  mice.  Furthermore,  these  data  are  consistent with  our  in  vitro  experiments,  which  reveal  that  lung  Mφs  are  more  potent   90  immune suppressors than lung MDSCs on a per cell basis. These findings contribute to  our  understanding  of  the  processes  and  cell  types  involved  in  metastasis,  which  may  lead to novel and more effective treatment strategies for cancer patients.     5.2 Results    5.2.1  Characterization  of  primary  tumor  growth  and  metastasis  in  4T1  and  67NR tumor models     To address the roles of Mφs and MDSCs in tumor growth and metastasis we used  two  murine  mammary  carcinoma  models.  After  three  weeks,  mice  orthotopically  implanted  with  metastatic  4T1  tumor  cells  (i.e.  4T1  mice)  exhibited  large  primary  tumors  (Fig.  5.1A),  considerable  splenomegaly  (Fig.  5.1B)  due  to  extramedullary  myelopoiesis  (Ueha  et  al.,  2011),  and  high  numbers  of  metastatic  tumor  cells  in  their  lungs  (Fig.  5.1C).  In  contrast,  although  non‐metastatic  67NR  primary  tumors  reached  the same size as 4T1 tumors, mice bearing 67NR tumors (i.e. 67NR mice) did not exhibit  splenomegaly  (Fig.  5.1D),  and,  as  expected,  did  not  exhibit  any  lung  metastases  (data  not shown).      Next,  we  performed  immunofluorescence  on  4T1  and  67NR  primary  tumor  sections to examine differences in perfusion and myeloid cell infiltration.  4T1 tumors  were poorly vascularised and contained a high proportion of hypoxic tumor cells while  67NR tumors were well vascularised and hypoxic cells were not detectable (Fig. 5.2A).  Moreover,  the  number  of  CD11b+  cells  was  much  higher  in  4T1  tumors  (Fig.  5.2A),  indicating greater myeloid cell infiltration. We also examined the lungs of 4T1 mice and  found that the metastatic tumor nodules and the lung tissue were highly infiltrated with  myeloid  cells  (Fig.  5.2B).  Interestingly,  we  saw  a  marked  difference  in  the  location  of  different myeloid cell types; Gr1+ cells were located around the periphery of the tumor  nodules  (Fig.  5.2B,  left),  while  F4/80+  cells  had  invaded  deep  into  the  tumor  interior  (Fig. 5.2B, right).    91    Figure 5.1  Characterization of 4T1 and 67NR tumor growth.   Mice were implanted with 4T1 tumor cells and A, primary tumor weight, B, spleen weight,  and  C,  number  of  metastatic  tumor  cells  in  the  lungs  were  measured  over  time.  Data  are  mean ± SEM with at least 15 mice per point. D, Mice were implanted with 4T1 (•) or 67NR  (□) tumor cells, harvested at different times, and primary tumor weights and spleen weights  measured. Each point represents an individual mouse.       92    Figure 5.2  Visualization  of  hypoxia  and  myeloid  cell  infiltration  in  4T1  and  67NR  tumors.   A,  4T1  (left)  or  67NR  (right)  primary  tumor  sections  analyzed  for  anti‐CD11b  (red),  pimonidazole (hypoxia; green), and Hoechst 33342 (perfusion; blue). B, Lung sections from  4T1 mice analyzed for DAPI (nuclei; blue) and anti‐Gr1 (red; left) or anti‐F4/80 (red; right).  Areas  in  dotted  lines  are  metastatic  tumor  nodules.  All  images are  10x  magnification.  Data  are representative of at least two experiments performed in duplicate.         5.2.2  4T1 but not 67NR tumors induce MDSCs and Mφs     To  further  characterize  the  involvement  of  myeloid  cells  in  the  4T1  and  67NR  tumor  models,  we  investigated  the  ability  of  each  tumor  type  to  induce  the  accumulation  of  MDSCs  (CD11b+Gr1+  cells)  and  Mφs  (F4/80+CD11b+  cells)  using  flow  cytometry.  Mice  bearing  4T1,  but  not  67NR  tumors,  exhibited  significantly  higher  proportions of MDSCs and Mφs in both their lungs and spleens, compared to control (i.e.  93  non‐tumor‐bearing)  mice  (Fig.  5.3A).  Similarly,  the  absolute  number  of  both  myeloid  cell  types  was  considerably  higher  in  4T1,  but  not  67NR,  mice,  compared  to  control  mice (Fig. 5.3B). These contrasting effects were underscored by our observation that, in  some  cases,  67NR  mice  possessed  significantly  lower  proportions  and  numbers  of  myeloid  cells  than  control  animals,  while  4T1  mice  displayed  up  to  230  or  600  fold  more  Mφs  or  MDSCs,  respectively  (Fig.  5.3A,B).  These  data  are  consistent  with  our  ex  vivo  imaging  results  (Fig.  5.2)  and  reveal  clear  and  intriguing  differences  in  the  induction of myeloid cells by 4T1 and 67NR tumors.      Figure 5.3  Induction of myeloid cells by 4T1 and 67NR tumors.   A, Proportion and  B, total number of MDSCs (CD11b+Gr1+) and Mφs (F4/80+CD11b+) in the  lungs and spleens of control (i.e. non‐tumor bearing) (white bars), 4T1 (black bars), or 67NR  (grey  bars)  mice  three  weeks  post‐implant.  Data  are  the  mean  ±  SEM  of  at  least  two  independent experiments performed in duplicate. *,p< 0.05; **,p<0.01; ***,p<0.001; NS, not  significant relative to control mice; nd, not determined      94  5.2.3  Phenotypic  characterization  of  myeloid  cells  from  control  versus  tumor­bearing mice     5.2.3.1  TAMs     Since  our  data  suggested  that  4T1,  but  not  67NR,  tumors  induce  the  development of myeloid cells, we commenced a series of studies to investigate the roles  of different myeloid cell subtypes in promoting tumor growth and metastasis. We began  by  comparing  the  cell  surface  phenotype  and  protein  expression  of  4T1  and  67NR  TAMs.  Flow  cytometric  analysis  revealed  that  TAMs  from  both  tumor  models  represented a heterogeneous population. Although almost all cells lacked expression of  Gr1, subsets of TAMs exhibited different degrees of F4/80 and CD11b expression (Fig.  5.4A). In general, a larger proportion of 4T1 TAMs expressed high levels of both F4/80  and  CD11b  compared  to  67NR  TAMs  (Fig.  5.4A).  We  also  analyzed  cell  lysates  to  determine if TAMs were M1 or M2 skewed. As Figure 5.4B shows, 4T1 TAMs expressed  Arg1 and 67NR TAMs expressed iNOS, indicating that 4T1 TAMs are M2 skewed while  67NR TAMs exhibit features of M1 activation.    95    Figure 5.4  Phenotypic characterization of TAMs.   TAMs were isolated from 4T1 or 67NR mice and A, surface expression of F4/80, CD11b, and  Gr1  was  analyzed  by  flow  cytometry  and  B,  expression  of  Ym1,  Arg1,  and  GAPDH  was  analyzed by Western blot. Data are representative of at least three experiments performed  in duplicate.       96  5.2.3.2  PMφs     Next,  we  investigated  the  phenotype  of  PMφs  from  control  and  tumor‐bearing  mice. PMφs from both control and 4T1 mice expressed CD11b and F4/80, but not Gr1  (Fig.  5.5A).  Interestingly,  control  PMφs  were  a  single,  relatively  uniform  population,  while  4T1  PMφs  appeared  to  be  composed  of  two  distinct  populations,  one  that  expressed moderate levels of both CD11b and F4/80 and one that expressed high levels  of  these  two  markers  (Fig.  5.5A). Next,  we  investigated  whether  these  cells  expressed  features  of  M1  or  M2  activation.  Western  blot  analysis  revealed  that  4T1  PMφs  expressed high levels of both Arg1 and Ym1, 67NR PMφs expressed very low Arg1 and  no Ym1, and control PMφs lacked expression of both proteins (Fig. 5.5B). Furthermore,  none of the cells expressed iNOS (data not shown). Overall, these data suggest that 4T1  PMφs are M2 skewed, while 67NR and control PMφs exhibit a naïve phenotype.    5.2.3.3  Splenic Mφs     Analysis  of  the  surface  phenotype  of  splenic  Mφs  (SpMφs)  revealed  that  although, as expected, a large proportion expressed F4/80, few expressed CD11b (Fig.  5.6A). Moreover, SpMφ samples isolated from 4T1 mice appeared to contain some Gr1+  cells  (Fig.  5.6B).  This  is  perhaps  not  surprising  given  the  large  proportion  of  CD11b+/Gr1+  MDSCs  present  in  4T1  spleens  (Fig.  5.3A).  However,  since  there  are  reports  that  some  MDSCs  express  F4/80,  CD11b,  and  Gr1  (Ueha  et  al.,  2011),  it  is  difficult  to  determine  whether  these  cells  should  be  classified  as  SpMφs,  MDSCs,  or  a  mixed population. Interestingly very few F4/80+ cells from the spleens of control (Fig.  5.6A) or 67NR (Fig. 5.6C) mice co‐expressed Gr1+ .    97    Figure 5.5  Phenotypic characterization of PMφs.   PMφs  were  isolated  from  control,  4T1,  or  67NR  mice  and  A,  surface  expression  of  F4/80,  CD11b, and Gr1 was analyzed by flow cytometry and B, expression of Ym1, Arg1, and GAPDH  was  analyzed  by  Western  blot.  Data  are  representative  of  at  least  three  experiments  performed in duplicate.         98    Figure 5.6  Phenotypic characterization of SpMφs.   SpMφs  were  isolated  from  A,  control,  B,  4T1,  or  C,  67NR  mice  and  surface  expression  of   F4/80, CD11b, and Gr1 was analyzed by flow cytometry. Data are representative of at least  three experiments performed in duplicate.       99  5.2.3.4  Splenic Gr1+ cells     Lastly, we considered the phenotypic properties of Gr1+ cells isolated from the  spleens of control, 4T1, or 67NR mice. Intriguingly, the cell surface phenotypes of these  three populations varied significantly. Control and 67NR splenic Gr1+ cells appeared to  be  comprised  of  three  distinct  populations  that  differentially  expressed  Gr1:  Gr1loCD11b‐,  Gr1midCD11b+,  and  Gr1brightCD11b+  (Fig.  5.7).  In  contrast,  cells  from  4T1  mice  were  a  uniform  Gr1highCD11b+  population  (Fig.  5.7),  consistent  with  the  general  phenotype  of  MDSCs.  In  addition,  we  found  that  none  of  the  Gr1+  cell  populations  isolated from any group of mice expressed F4/80 (Fig. 5.7).     5.2.4  Summary of the effect of 4T1 tumors on the phenotypes of myeloid cells     Taken together, our data demonstrate that, unlike non‐metastatic 67NR tumors,  metastatic 4T1 tumors  have a  profound  effect  on  the  phenotypes  of  different  myeloid  cell  populations.  Whereas  the  phenotype  of  cells  isolated  from  67NR  mice  closely  resembled  that  of  cells  from  control  mice,  4T1  tumors  modified  both  cell  surface  and  intracellular  protein  expression.  In  general,  4T1  tumors  increased  expression  of  proteins  associated  with  M2  activation  (i.e.  inducing Arg1,  but  not  iNOS)  in  PMφs  and  TAMs  (Fig.  5.8A).  Furthermore,  it  is  noteworthy  that  neither  Gr1+  nor  F4/80+  splenic  myeloid  cells  from  control  or  4T1  mice  exhibited  Arg1  expression,  but  Gr1+  cells  isolated from the tumors of 4T1 mice did express both Arg1 and Ym1 (Fig. 5.8B).   100    Phenotypic characterization of splenic Gr1+ cells.    Figure 5.7  Gr1+  cells  were  isolated  from  the  spleens  of  control,  4T1,  or  67NR  mice  and  surface  expression  of  Gr1,  F4/80,  and  CD11b  was  analyzed  by  flow  cytometry.  Data  are  representative of at least three experiments performed in duplicate.         101    Figure 5.8  Analysis of protein expression in different myeloid cell populations.   A,  PMφs,  splenic  Gr1+  cells,  SpMφs,  or  TAMs  were  isolated  from  control  or  4T1  mice  and  expression of iNOS, Arg1, and GAPDH analyzed by Western blot. B, Gr1+ cells were isolated  from the tumors of 4T1 mice and expression of Ym1, Arg1, and GAPDH analyzed by Western  blot. Data are representative of at least three experiments performed in duplicate.         5.2.5  Comparison  of  immunosuppressive  abilities  of  myeloid  cells  from  control versus tumor­bearing mice     5.2.5.1  PMφs     Next, we investigated the effect of tumors on the immunosuppressive properties  of  different  myeloid  cell  populations.  Our  previous  results  revealed  that  control  PMφs  could suppress T cell responses and we were interested to discover whether PMφs from  tumor‐bearing  mice  also  possessed  immunosuppressive  properties.  We  found  that  PMφs from control, 4T1, and 67NR mice all potently suppressed T cell proliferation (Fig.  5.9A).  However,  consistent  with  our  phenotypic  data,  different  tumor  models  had  distinct  effects  on  immunosuppressive  function.  Specifically,  4T1  PMφs,  but  not  67NR  PMφs were significantly more immunosuppressive on a per cell basis than control PMφs  (Fig. 5.9A) and this trend held true over multiple PMφ:splenocyte ratios (Fig. 5.9B). We  102  also  performed  these  studies  using  C3H/HeN  mice  bearing  metastatic  squamous  cell  carcinoma (SCCVII) tumors (Suit et al., 1985) and found that PMφs from tumor‐bearing  mice  were  significantly  more  suppressive  than  control  PMφs  at  higher  concentrations  (i.e.  lower  ratios)  (Fig.  5.9C).  Taken  together,  these  data  suggest  that  certain  tumors,  such  as  the  metastatic  4T1  and  SCCVII  cell  lines,  enhance  the  immunosuppressive  functions of PMφs.    5.2.5.2  TAMs     We  isolated  TAMs  from  4T1  or  67NR  mice  and  compared  their  abilities  to  suppress T cell proliferation in vitro. At each ratio tested, 67NR TAMs were more potent  immune  suppressors,  on  a  per  cell  basis  (Fig.  5.10).  This  was  somewhat  surprising,  since  4T1  TAMs,  but  not  67NR  TAMs,  expressed  Arg1  (Fig.  5.4B),  which  is  often  associated  with  immune  suppression.  However,  this  finding  could  contribute  to  our  understanding  of  the  roles  of  TAMs  in  normoxic  (i.e.  67NR)  versus  hypoxic  (i.e.  4T1)  primary tumors.     5.2.5.3  SpMφs     Studies  quantifying  the  immunosuppressive  properties  of  SpMφs  revealed  that  they were only able to suppress T cell proliferation at high concentrations (Fig. 5.11).  As  the  ratio  of  SpMφs:  splenocytes  was  decreased,  SpMφs  were  no  longer  immunosuppressive (Fig. 5.11A). Interestingly, SpMφs isolated from 4T1 mice exhibited  very similar suppressive properties to control SpMφs (Fig. 5.11A). In fact, neither 4T1  or  67NR  tumors  altered  the  immunosuppressive  abilities  of  SpMφs  in  a  consistent  manner (Fig. 5.11B).   103    Figure 5.9  Tumors augment the immunosuppressive abilities of PMφs.   A,  PMφs  were  isolated  from  control,  4T1,  or  67NR  mice  and  co‐cultured  with  polyclonal‐ stimulated  splenocytes  (1  PMφ:  8  splenocyte)  and  T  cell  proliferation  measured.  Data  are  representative  of  three  experiments  performed  in  triplicate.  B,  PMφs  were  isolated  from  control  (o),  4T1  (■),  or  67NR  (∆)  mice  and  co‐cultured  with  polyclonal‐stimulated  splenocytes at different ratios (PMφs: splenocytes; 1:2, 1:4, 1:8, 1:16, 1:32). Proliferation was  measured  and  percent  of  RC  proliferation  calculated.    Data  are  the  mean  ±  SEM  of  two  independent experiments performed in triplicate. C, Polyclonal‐stimulated splenocytes were  cultured alone (white bar) or with control (grey bar) or SCCVII (black bar) PMφs at different  ratios  (PMφs:  splenocytes;  1:4,  1:8,  1:16,  1:32)  and  proliferation  measured.  Data  are  representative  of  two  experiments  performed  in  triplicate.  *,p<  0.05;  **,p<0.01;  NS,  not  significant relative to control PMφs       104    Figure 5.10  67NR TAMs are more immunosuppressive than 4T1 TAMs.   TAMs  were  isolated  from  4T1  (open  square)  or  67NR  (closed  square)  mice  using  F4/80+  selection and co‐cultured with polyclonal‐stimulated splenocytes at different concentrations  (TAMs: splenocytes; 1:1, 1:2, 1:4, 1:8). T cell proliferation was measured and percent of RC  proliferation  calculated.  Data  are  representative  of  three  experiments  performed  in  duplicate.       105    Figure 5.11  SpMφs are only immunosuppressive at high concentrations.   A,  SpMφs  were  isolated  from  control  (ο)  or  4T1  mice  (■)  and  co‐cultured  with  polyclonal‐ stimulated  splenocytes  at  different  concentrations  (SpMφs:  splenocytes;  2:1,  1:1,  1:2,  1:4,  1:8,  1:16,  1:32,  1:64).  T  cell  proliferation  was  measured  and  percent  of  RC  proliferation  calculated. Data are the mean ± SEM of three experiments performed in duplicate. B, SpMφs  were isolated from control (white bars), 4T1 (black bars), or 67NR (grey bars) mice and co‐ cultured  with  polyclonal‐stimulated  splenocytes  at  different  concentrations  (SPMφs:  splenocytes;  1:1,  1:2).  T  cell  proliferation  was  measured  and  percent  of  RC  proliferation  calculated. Data are representative of three experiments performed in triplicate.       106  5.2.5.4  Splenic Gr1+ cells     Next,  we  investigated  the  immunosuppressive  properties  of  splenic  Gr1+  cells.  Although  our  phenotypic  data  revealed  that  most  of  these  cells,  particularly  those  isolated from 4T1 mice, express both CD11b and Gr1 (Fig. 5.7), before we could define  these  cells  as  MDSCs  we  first  had  to  determine  their  immunosuppressive  abilities.   Interestingly, we observed an immense difference in the ability of splenic Gr1+  cells to  suppress T cell responses depending on whether they were isolated from control, 4T1,  or 67NR mice. As shown in Fig. 5.12A, while 4T1 Gr1+ cells potently suppressed T cell  proliferation, control or 67NR cells were much less suppressive at all cell ratios tested.  We also assayed the effect of splenic Gr1+ cells on T cell cytokine production. Consistent  with the proliferation data, 4T1 Gr1+ cells but not control or 67NR Gr1+ cells, inhibited  T cell‐produced IFN‐γ  and increased levels of IL‐2 in the culture  medium (Fig.  5.12B),  which is consistent with a model in which T cells produce IL‐2 but are unable to utilize  it  for  cell  division  (Strickland  et  al.,  1996).  We  also  found  that  all  three  types  of  Gr1+  cells  suppressed  T  cell  IL‐10  production  to  an  equal,  albeit  minor,  extent  (Fig.  5.12B).  Finally,  we  assessed  the  levels  of  NO  and  found  that  none  of  the  splenic  Gr1+  subsets  produced  considerable  levels  of  NO  upon  co‐culture  with  activated  splenocytes  (Fig.  5.12B).  Taken  together,  these  data  suggest  that  4T1  splenic  Gr1+  cells  can  be  characterized  as  MDSCs,  since  they  are  capable  of  potently  suppressing  T  cell  responses,  whereas  Gr1+  cells  from  67NR  or  control  mice  lack  immunosuppressive  properties  and  are  therefore  not  MDSCs.  These  findings  are  consistent  with  the  idea  that many tumors induce both the differentiation and immunosuppressive function of  MDSCs,  yet  also  suggest  that  not  all  tumors  induce  splenic  Gr1+  cells  to  acquire  immunosuppressive abilities.   107    Figure 5.12  4T1  tumors  enhance  the  immunosuppressive  abilities  of  splenic  Gr1+  cells.   A,  Splenic  Gr1+  cells  were  isolated  from  control  (o),  4T1  (■),  or  67NR  (∆)  mice  and  co‐ cultured  with  polyclonal‐stimulated  splenocytes  at  different  ratios  (Gr1+  cells:  splenocytes;  2:1,1:1,  1:2,  1:4,  1:8,  1:16,  1:32).  T  cell  proliferation  was  measured  and  percent  of  RC  proliferation  calculated.  Data  are  representative  of  three  experiments,  performed  in  triplicate.  B,  Splenic  Gr1+  cells  were  isolated  from  control,  4T1,  or  67NR  mice  and  co‐ cultured  with  polyclonal‐stimulated  splenocytes  (1  Gr1+  cell:  2  splenocytes).  Supernatants  were collected and concentrations of IFN‐γ, IL‐10, IL‐2, or NO were determined. Data are the  mean ± SEM of two independent experiments, performed in duplicate.      108  5.2.5.5  Gr1+ cells from different tissues     Since MDSCs are known to accumulate in multiple organs and tissues (Ilkovitch  and Lopez, 2009; Youn and Gabrilovich, 2010), we investigated the immunosuppressive  abilities of Gr1+ cells isolated from various sites. Gr1+ cells isolated from the spleens or  lungs  of  4T1  mice  suppressed  T  cell  proliferation  significantly  more  than  their  counterparts  from  control  mice,  and  did  so  to  an  equal  extent  (Fig.  5.13A).  Similarly,  splenic  and  pulmonary  4T1  Gr1+  cells  both  suppressed  T  cell  IFN‐γ  and  IL‐10  production  and  did  so  to  a  similar  degree  (Fig.  5.13B).  Finally,  we  compared  the  immunosuppressive  abilities  of  Gr1+  cells  harvested  from  the  spleens,  lungs,  tumors,  kidneys,  and  livers  of  4T1  mice  and  found  that  they  all  potently  suppressed  T  cell  proliferation to the same degree (Fig. 5.13C). Consequently, from this point forward we  will refer to Gr1+ cells from 4T1 mice as MDSCs.   109    Gr1+   Figure 5.13  4T1  cells  isolated  from  different  tissues  are  equally  immunosuppressive.   A, Polyclonal‐stimulated splenocytes were co‐cultured with or without (white bar) Gr1+ cells  isolated  from  the  spleens  or  lungs  of  control  (grey  bars)  or  4T1  mice  (black  bars)  (1  Gr1+  cell:  2  splenocytes)  and  T  cell  proliferation  measured.  Data  are  representative  of  three  independent  experiments  performed  in  triplicate.  B,  Gr1+  cells  were  isolated  from  the  spleens or lungs of 4T1 mice and co‐cultured with polyclonal‐stimulated splenocytes (1 Gr1+  cell: 2 splenocytes). Supernatants were collected, and IFN‐γ and IL‐10 were measured. Data  are  representative  of  three  independent  experiments  performed  in  duplicate.  C,  Gr1+  cells  were isolated from the spleens, lungs, tumors, kidneys, or livers of 4T1 mice and co‐cultured  with  polyclonal‐stimulated  splenocytes  (1  Gr1+  cell:  2  splenocytes)  and  proliferation  measured.  Data  are  representative  of  two  experiments,  performed  in  triplicate.  **,p<0.01;  ***,p< 0.001 relative to control Gr1+ cells.      110  5.2.6  Summary  of  the  relative  immunosuppressive  abilities  of  different  myeloid cell populations from 4T1 tumor­bearing mice     As  previously  mentioned,  few  studies  have  directly  compared  the  immunosuppressive potencies of different myeloid cell types. To address this we plated  equal numbers of splenic MDSCs and PMφs from control or 4T1 mice and analyzed their  abilities  to  suppress  polyclonal  and  Ag‐specific  stimulated  T  cell  proliferation.  Our  results  clearly  demonstrated  that  PMφs  were  much  more  immunosuppressive  than  splenic  MDSCs,  on  a  per  cell  basis  (Fig.  5.14A).  Specifically,  these  data  suggest  the  following:  1)  control  PMφs,  but  not  control  Gr1+  cells  possess  immunosuppressive  properties, 2) control PMφs are more immunosuppressive than 4T1 MDSCs, and 3) the  presence  of  4T1  tumors  increases  the  immunosuppressive  abilities  of  both  Gr1+  cells  and  PMφs  (Fig.  5.14A).  As  Figure  5.14B  illustrates,  PMφs  were  more  than  32‐fold  (polyclonal)  or  10‐fold  (Ag‐specific)  more  immunosuppressive  than  MDSCs  isolated  from  the  same  4T1  mouse.  We  also  performed  a  direct  comparison  of  all  the  myeloid  cell  types  we  isolated  and  found  the  following  immunosuppressive  hierarchy  (listed  from most suppressive to least suppressive): 4T1 PMφs > 4T1 TAMs ≈ control PMφs >  4T1 SpMφs > control SpMφs > 4T1 Gr1+ cells > control Gr1+ cells, and these trends were  comparable whether splenocytes were activated in a polyclonal or Ag‐specific manner  (Fig. 5.14C).     111    Figure 5.14  4T1 PMφs are more potent suppressors of T cell proliferation than 4T1  MDSCs on a per cell basis.   A, Splenic Gr1+ cells and PMφs were isolated from control or 4T1 mice and co‐cultured with  polyclonal‐  (left)  or  Ag‐specific‐  (right)  stimulated  splenocytes  (1  myeloid  cell:  2  splenocytes). T cell proliferation was measured and percent of RC proliferation calculated. B,  Splenic  Gr1+  cells  (black  bars)  or  PMφs  (white  bars)  were  isolated  from  4T1  mice  and  co‐ cultured  with  polyclonal‐  or  Ag‐specific‐  stimulated  splenocytes  (1  myeloid  cell:  2  splenocytes).  T  cell  proliferation  was  measured  and  percent  of  RC  proliferation  calculated.   C, Splenic Gr1+ cells, PMφs, TAMs, or SpMφs were isolated from control or 4T1 mice and co‐ cultured  with  polyclonal‐  (left)  or  Ag‐specific‐  (right)  splenocytes.  T  cell  proliferation  was  measured  and  percent  of  RC  proliferation  calculated.  Data  are  representative  of  three  independent experiments performed in triplicate. **,p<0.01; ***,p< 0.001      112  These  results  are  also  consistent  with  data  comparing  the  abilities  of  different  myeloid  cell  types  from  4T1  mice  to  suppress  T  cell  cytokine  production.  As  Figure  5.15A  shows,  PMφs  and  TAMs  inhibited  T  cell‐produced  IFN‐γ  and  IL‐10  to  a  greater  extent  than  MDSCs  or  SpMφs.  Interestingly,  we  also  measured  levels  of  NO  in  culture  supernatants  and  found  that  only  control  PMφs,  which  we  had  previously  determined  suppress via a NO‐mediated mechanism (Hamilton et al., 2010), produced NO upon co‐ culture with activated splenocytes (Fig. 5.15B). These data suggest that none of the 4T1  myeloid  cells  we  tested  exerted  their  suppressive  effects  via  NO  production  and  are  consistent  with  a  previous  report  that  PMφs  from  mammary  tumor‐bearing  mice  produce less NO upon LPS stimulation than control PMφs (Di Napoli et al., 2005).     Figure 5.15  4T1  PMφs  are  more  potent  suppressors  of  T  cell  cytokine  production  than 4T1 MDSCs on a per cell basis.   A, PMφs, splenic Gr1+ cells, TAMs, and SpMφs were isolated from 4T1 mice and co‐cultured  with polyclonal‐stimulated splenocytes (1 myeloid cell: 2 splenocytes) and IFN‐γ and IL‐10  were  measured  in  the  culture  supernatants.  B,  PMφs  were  isolated  from  control  mice  and  PMφs, splenic Gr1+ cells, TAMs, and SpMφs were isolated from 4T1 mice. Myeloid cells were  co‐cultured  with  polyclonal‐stimulated  splenocytes  (1  myeloid  cell:  2  splenocytes).  Supernatants  were  collected  and  NO  measured.  Data  are  the  mean  ±  SEM  of  two  independent experiments, performed in duplicate.      113  Finally,  we  corroborated  these  data  using  a  flow  cytometric  approach.  We  labelled  responder  splenocytes  with  CFSE,  a  fluorescent  dye  that  becomes  stably  trapped  in  the  cytoplasm  of  individual  cells.  Using  this  method,  we  were  able  to  visualize T cell proliferation, since each time a cell divides its fluorescence intensity is  halved, resulting in a series of peaks that each represent one cell division (Lyons, 2000).  We  co‐cultured  different  myeloid  cell  types  with  stimulated  CFSE‐labeled  splenocytes  and after 72 h analyzed the proportion of CD4+ and CD8+ T cells that had undergone cell  division, as well as the number of divisions (Fig. 5.16). However, due to the absence of  viable cells we were unable to obtain data for CD8+ T cells co‐cultured with 4T1 Gr1+  cells, and this is discussed further in Section 5.3. In general, the results were consistent  with our  3H‐thy incorporation data; 4T1 PMφs, 4T1 Gr1+ cells, and 4T1 TAMs exhibited  strong  immunosuppressive  effects,  reducing  the  maximal  number  of  T  cell  divisions  (Fig. 5.16) and proportion of divided T cells (Fig. 5.17), while control Gr1+ cells, control  SpMφs, and 4T1 SpMφs did not. In both proliferation assays, 4T1 PMφs were the most  immunosuppressive,  completely  preventing all  T  cell  division  (Fig.  5.14 and  Fig  5.17).  Finally, we compared the ability of different myeloid cell types to suppress CD4+ versus  CD8+ T cell proliferation and found they did so to a similar extent (Fig. 5.18).   114  Figure 5.16  Visualization of the immunosuppressive effects of different myeloid cell  populations.   Responder  splenocytes  were  labelled  with  fluorescent  CFSE  dye  and  cultured  with  or  without  PMφs,  splenic  Gr1+  cells,  TAMs,  and  SpMφs  isolated  from  control  or  4T1  mice  ±  polyclonal stimulation. After 72 h cells were harvested and analyzed by flow cytometry for  expression of CD4, CD8, and CFSE. The proportion of CD4+ and CD8+ T cells is shown, as well  as the proportion of each that had undergone cell division. Data are representative of three  experiments performed in duplicate. N/A; assay could not be performed due to insufficient  live cells.            115        116    Figure 5.17  Summary of the ability of different myeloid cell populations to inhibit T  cell division as determined by flow cytometric analysis of CFSE intensity.   Proportion of CFSE‐labelled polyclonal‐stimulated CD4+ (black bars) and CD8+ (white bars)  T cells that divided at least once during 72 h co‐culture with or without different myeloid cell  populations. Data are representative of three experiments performed in duplicate. n/a; assay  could not be performed due to insufficient live cells.      117    Figure 5.18  Comparison  of  the  ability  of  different  myeloid  cell  populations  to  reduce the proportion of T cells.   Polyclonal‐stimulated  splenocytes  were  cultured  with  (black  bars)  or  without  (white  bars)  different  populations  of  myeloid  cells  and  the  proportion  of  viable  CD4+  (upper)  or  CD8+  (lower) T cells after 72 h was determined by flow cytometry. Data are the mean ± SEM of two  independent experiments performed in duplicate. **,p<0.01; ***,p< 0.001; NS, not significant  relative to RC       118  5.2.7  4T1­induced MDSCs and TAMs, but not PMφs, decrease T cell viability     We  subsequently  performed  a  series  of  experiments  to  elucidate  the  mechanisms  of  immunosuppression  utilized  by  different  myeloid  cell  types.  We  first  investigated the effect of different myeloid cells isolated from control or 4T1 mice on T  cell viability. We found that co‐culture with 4T1 MDSCs or TAMs significantly decreased  the proportion of viable splenocytes, but co‐culture with control or 4T1 PMφs, or with  control  splenic  Gr1+  cells  did  not  (Fig.  5.19A).  However,  when  we  specifically  assayed  the effect of myeloid cells on T cell viability, the results were less clear. The data suggest  that  control  or  4T1  PMφs  greatly  increased  the  proportion  of  viable  CD4+  and  CD8+  T  cells,  while  control  or  4T1  splenic  Gr1+  cells  both  decreased  T  cell  viability,  and  4T1  TAMs  decreased  CD4+  and  increased  CD8+  T  cell  viability  (Fig.  5.19B).  These  results  indicate  that  PMφs  and  splenic  Gr1+  have  contrasting  effects  on  T  cell  survival  and  suggest that PMφs, MDSCs, and TAMs suppress T cells via different mechanisms.    119    Figure 5.19  Effect of different myeloid cell types on cell viability.   Polyclonal‐stimulated  splenocytes  were  co‐cultured  for  72  h  with  or  without  different  myeloid  cell  populations  and  A,  Bulk  cell  viability  (total  splenocytes)  and  B,  CD4+  (black  bars)  and  CD8+  (white  bars)  T  cell  viability  was  determined  by  exclusion  of  PI  by  flow  cytometry.  For  B,  data  are  reported  as  the  fold  increase  in  T  cell  viability  compared  to  stimulated  splenocytes  alone  (responder  control).  Data  are  the  mean  ±  SEM  of  two  independent experiments performed in duplicate. ***,p< 0.001 relative to RC            120  5.2.8  4T1­induced  MDSCs  suppress  T  cells  via  a  contact­independent  mechanism     To  further  explore  the  different  suppressive  mechanisms  used  by  Mφs  and  MDSCs we used a Transwell assay system to determine whether direct cell‐cell contact  was  required.  We  found  that  MDSCs  isolated  from  either  the  spleen  or  lungs  of  4T1  mice  could  suppress  T  cell  proliferation  whether  or  not  they  were  separated  from  T  cells by a semi‐permeable membrane (Fig. 5.20A), suggesting contact is not required for  MDSC immunosuppression. In contrast, 4T1 PMφs were only immunosuppressive when  in  direct  contact  with  T  cells  and  promoted  T  cell  proliferation  when  contact  was  removed (Fig. 5.20A). However, when we tested the ability of 4T1 PMφs to suppress T  cell  proliferation  at  different  ratios,  we  found  that  at  high  concentrations  PMφs  could  inhibit T cell proliferation even when contact with T cells was prevented, but this was  not true at lower concentrations of PMφs (Fig. 5.20B). One hypothesis that is consistent  with  these  data  is  that  4T1  PMφs  produce  one  or  more  secreted  factors  that  function  along a concentration gradient, and as the number of PMφs increases, so does the level  of  the  factor(s),  which  enables  PMφs  to  suppress  T  cells  from  a  greater  distance.  However, when the concentration of PMφs, and thus the secreted factor, are low, PMφs  must  be  in  close  contact  with  T  cells  to  inhibit  their  activation.  Finally,  we  tested  whether there were differences in contact requirement for control, 4T1, and 67NR PMφ  immunosuppression and found that even at high concentrations, control PMφs required  contact  to  effectively  suppress  T  cell  proliferation,  while  4T1  and  67NR  PMφs  could  suppress in both control and Transwell systems (Fig. 5.20C). However, all myeloid cell  types  we  tested  suppressed  T  cell  responses  to  a  greater  degree  when  contact  was  allowed between myeloid cells and test cells (Fig. 5.20).    121    Figure 5.20  At  high  concentrations,  both  MDSCs  and  PMφs  suppress  T  cells  via  contact­independent mechanisms.   A, MDSCs (splenic and pulmonary) and PMφs were harvested from 4T1 mice and co‐cultured  with polyclonal‐stimulated splenocytes (1 MDSC: 2 splenocytes or 1 PMφ: 8 splenocytes) in  control (black bars) or Transwell (white bars) wells. T cell proliferation was measured and  percent  of  RC  proliferation  calculated.  B,  4T1  PMφs  were  co‐cultured  with  polyclonal‐ stimulated  splenocytes  at  different  concentrations  (PMφ:  splenocytes;  1:2,  1:8)  in  control  (black bars) or Transwell (white bars) wells. T cell proliferation was measured and percent  of RC proliferation calculated. C, PMφs were isolated from control, 4T1, or 67NR mice and co‐ cultured  with  polyclonal‐stimulated  splenocytes  (1  PMφ:  2  splenocytes)  in  control  (black  bars) or Transwell (white bars) wells. T cell proliferation was measured and percent of RC  proliferation  calculated.  Data  are  representative  of  three  independent  experiments  performed in triplicate.      122  5.2.9  PMφs  from  control  and  67NR  tumor­bearing  mice  suppress  via  a  NO­ dependent mechanism      Since our previous work, presented in Chapter 3, had revealed that PMφs from  control  mice  suppressed  T  cells  via  NO  production  (Hamilton  et  al.,  2010),  we  tested  whether  any  other  myeloid  cell  types  suppressed  by  this  mechanism.  We  found  that  control and 67NR, but not 4T1 PMφs produced NO in response to co‐culture with T cells  (Fig.  5.21A).  Consistent  with  this,  inhibiting  NO  production  via  iNOS  inhibitors  (i.e.  L‐ NMMA,  L‐NIL)  or  iNOS  induction  by  IFN‐γ  (i.e.  anti‐IFN‐γ)  reversed  the  suppressive  effects  of  control  but  not  4T1  PMφs  (Fig.  5.21B).  Conversely,  although  67NR  PMφs  produced moderate amounts of NO upon co‐culture with T cells, these inhibitors did not  eradicate T cell suppression by 67NR PMφs (Fig. 5.21B), which may suggest that 67NR  PMφs may suppress via different or additional mechanisms.   123    Figure 5.21  Control PMφs, but no other cell types tested, suppress T cell responses  via NO production.   A, PMφs were isolated from control mice; PMφs, splenic Gr1+ cells, TAMs, and SpMφs were  isolated from 4T1 mice; and PMφs and TAMs were isolated from 67NR mice. Each cell type  was  cultured  with  polyclonal‐stimulated  splenocytes  (1  myeloid  cell:  2  splenocytes)  and  supernatant  NO  production  measured.  B,  PMφs  were  cultured  with  polyclonal‐stimulated  splenocytes  (1  PMφ:  8  splenocytes)  ±  L‐NMMA,  L‐NIL,  or  αIFN‐γ.  T  cell  proliferation  was  measured and percent of RC proliferation calculated.           124  5.2.10 The  immunosuppressive  properties  of 4T1  PMφs  are  not  abrogated  by  TLR stimulation    Since  we  had  previously  elucidated  the  mechanism  by  which  control  PMφs  suppress  T  cell  responses,  we  were  particularly  interested  in  investigating  the  suppressive mechanism(s) used by 4T1 PMφs, to gain insight into the effect of tumors  on  the  suppressive  phenotypes  of  Mφs.    Furthermore,  our  results  had  revealed  4T1  PMφs to be the most potent immunosuppressive cells of those we tested, which made  them  particularly  intriguing.  Since  we  had  found  that  the  suppressive  properties  of  control  PMφs  could  be  reversed  by  pre‐treatment  with  LPS  or  dsRNA  we  first  determined the effect of TLR agonists on 4T1 PMφ immunosuppression. Unlike control  PMφs, pre‐treating 4T1 PMφs did not inhibit their immunosuppressive abilities; in fact,  pre‐treatment  with  LPS  and  dsRNA  increased  the  4T1  PMφ‐induced  suppression  of  T  cells (Fig. 5.22).       Figure 5.22  The  immunosuppressive  properties  of  4T1  PMφs  are  not  reversed  by  pre­treatment with TLR ligands.   Polyclonal‐stimulated  splenocytes  were  cultured  with  (black  bars)  or  without  (white  bars)  4T1 PMφs (1 PMφ: 8 splenocytes) that had been pre‐treated ± LPS, CpG, dsRNA, or PGN for  24  h  and  washed,  and  T  cell  proliferation  measured.  Data  are  representative  of  three  independent experiments performed in triplicate. *,p< 0.05; ***,p<0.001; NS, not significant  relative to untreated PMφs       125  5.2.11 4T1 PMφ suppression of T cells is reversed by N­acetyl­cysteine    Next, we utilized the same panel of inhibitors described in Chapter 3 to elucidate  the mechanism of 4T1 PMφ‐induced immune suppression. Consistent with our previous  results  (Fig.  5.21B),  inhibitors  of  the  NO  pathway  did  not  reverse  suppression  (Fig.  5.23A). Similarly, blocking Abs to immunosuppressive cytokines also did not abrogate  suppression (Fig. 5.23B), suggesting that 4T1 PMφs do not suppress T cell proliferation  by production of IL‐4, IL‐10, IL‐13, or TGF‐β. Next we tested the effect of IL‐2 or L‐Arg  supplementation,  inhibiting  Arg1,  or  blocking  the  membrane‐bound  inhibitory  molecules  CTLA4  or  TGF‐β,  but  none  of  these  treatments  restored  T  cell  proliferation  (Fig.  5.23C).  Finally,  we  tested  the  effects  of  different  ROS  inhibitors  on  4T1  PMφ  immunosuppression. Catalase catalyzes the conversion of H2O2 to H2O and O2, and SOD  catalyzes  the  dismutation  of  O2‐  into  O2 and H2O2,  while  NAC, a  derivative  of  cysteine,  has  both  indirect  and  direct  antioxidant  functions;  NAC  acts  as  a  scavenger  of  free  radicals and also serves as a precursor in the formation of the antioxidant glutathione  (GSH)  (Zhang  et  al.,  2011).  While  catalase  and  SOD  had  no  effect  in  our  assay,  the  presence  of  NAC  completely  eliminated  4T1  PMφ  immunosuppression  (Fig.  5.23).  In  fact,  4T1  PMφs  stimulated  T  cell  proliferation  in  the  presence  of  NAC.  Since  NAC  can  also act as a source of cysteine we supplemented cultures with different concentrations  of  L‐cysteine  to  see  if  this  mimicked  the  effect  of  NAC,  but  L‐cysteine  did  not  reverse  4T1  PMφ‐induced  immune  suppression  (data  not  shown).  Taken  together  these  data  suggest that 4T1 PMφs suppress T cell responses by production of ROS other than H2O2  or O2‐.   126    Figure 5.23  NAC reduces the immunosuppressive abilities of 4T1 PMφs.   Polyclonal‐stimulated  splenocytes  were  cultured  with  (black  bars)  or  without  (white  bars)  4T1 PMφs (1 PMφ: 8 splenocytes) ± A, 0.5 mM L‐NMMA, 1 mM L‐NIL, or 10 μg/ml anti‐IFN‐γ;  B, 10 μg/ml rat IgG, 10 μg/ml anti‐IL‐4, 2 μg/ml anti‐IL‐10, 10 μg/ml anti‐IL‐13, or 10 μg/ml  anti‐TGF‐β; C, 100 U/well mIL‐2, 2 mM L‐Arg, 200 μM BEC, ± 10 μg/ml anti‐CTLA4, or 250  ng/ml LAP;  or D, 1  mg/ml catalase, 200 U/ml SOD, or 10 mM NAC and  T cell proliferation  measured. Data are representative of five independent experiments performed in triplicate.      127  5.2.12 The  immunosuppressive  properties  of  4T1  pulmonary  MDSCs  are  inhibited by catalase    Next, we performed a similar series of experiments to investigate the mechanism  by  which  MDSCs  isolated  from  the  lungs  of  4T1  mice  suppress  T  cell  responses.  We  tested the effect of pre‐treating MDSCs with different TLR ligands but none decreased  MDSC‐induced immunosuppression (Fig. 5.24). We then used our panel of inhibitors to  try to elucidate the mechanism of suppression. The only inhibitor that had an effect on  4T1  MDSC‐induced  suppression  was  catalase  (Fig.  5.25).  Although  treatment  with  catalase  did  not  completely  eliminate  4T1  MDSC  suppressive  function,  it  significantly  reduced suppression and increased T cell proliferation (Fig. 5.25C), indicating that 4T1  pulmonary  MDSCs  exert  their  immunosuppressive  effects,  at  least  in  part,  by  H2O2  production.        Figure 5.24  The  immunosuppressive  properties  of  4T1  MDSCs  are  not  reversed  by  pre­treatment with TLR ligands.   Polyclonal‐stimulated  splenocytes  were  cultured  with  (black  bars)  or  without  (white  bars)  4T1 splenic MDSCs (i.e. Gr1+ cells) (1 MDSC: 2 splenocytes) that had been pre‐treated ± LPS,  CpG,  dsRNA,  or  PGN  for  24  h  and  washed,  and  T  cell  proliferation  measured.  Data  are  representative of three independent experiments performed in triplicate.          128    Figure 5.25  Catalase reduces the suppressive abilities of 4T1 MDSCs.   Polyclonal‐stimulated  splenocytes  were  cultured  with  (black  bars)  or  without  (white  bars)  4T1 pulmonary MDSCs (1 PMφ: 2 splenocytes) ± A, 10 μg/ml rat IgG, 10 μg/ml anti‐IL‐4, 100  U/well mIL‐2, 10 μg/ml anti‐CTLA4, or 250 ng/ml LAP + 10 μg/ml anti‐TGF‐β; B, 0.5 mM L‐ NMMA,  1  mM  L‐NIL,  10  μg/ml  anti‐IFN‐γ,  2  mM  L‐Arg,  or  200  μM  BEC;  or  C,  1  mg/ml  catalase,  ,  10  mM  NAC,  or  200  U/ml  SOD  and  T  cell  proliferation  measured.  Data  are  representative  of  three  independent  experiments  performed  in  triplicate.  ***,p<  0.001  relative to untreated 4T1 MDSCs       129  5.2.13 Mφs  and  MDSCs  suppress  T  cell  responses  via  different  ROS­mediated  mechanisms    To  follow  up  on  these  experiments,  we  determined  whether  our  results  regarding  the  different  suppressive  mechanisms  of  4T1‐induced  myeloid  cells  were  valid for Mφs and MDSCs from different tissues.  Given that the lung is a key metastatic  target  organ  for  4T1  tumors  we  were  particular  interested  in  pulmonary  Mφs.  Importantly, the lungs of 4T1 mice contain both CD11b‐CD11c+F4/80+ resident alveolar  Mφs and CD11b+CD11c‐F4/80+ infiltrating Mφs. Although both of these populations are  isolated  by  F4/80  positive  selection,  the  majority  of  lung  Mφs  in  4T1  mice  are  likely  induced  by  tumor  cells,  given  the  high  levels  of  splenomegaly  (Fig.  5.1B)  and  myelopoiesis  (Fig.  5.3)  we  observed  in  these  mice.  We  first  tested whether  4T1  PMφs  and  lung  Mφs  suppressed  T  cell  proliferation  by  the  same  mechanism.  We  found  that,  like PMφs, the suppressive properties of lung Mφs were significantly decreased by NAC,  but not catalase (Fig. 5.26A). However, it is interesting that NAC completely eliminated  PMφ  suppression,  but  only  partially  reduced  the  suppressive  properties  of  lung  Mφs  (Fig.  5.26A).  Importantly,  neither  NAC,  nor  any  of  the  other  inhibitors  we  tested  significantly  lessened  the  suppressive  effects  of  4T1  TAMs  (data  not  shown),  which  suggests that TAMs inhibit T cells by a different mechanism than PMφs and lung Mφs.  These data may suggest that Mφs at the tumor site function differently than Mφs in the  periphery.  We  also  tested  whether  MDSCs  from  different  tissues  utilized  the  same  suppressive mechanism and found that catalase, but not NAC, significantly lessened the  suppressive effects of both splenic and pulmonary 4T1 MDSCs, and did so to an equal  extent (Fig. 5.26B). All together, our results are consistent with a model in which 4T1  Mφs  exert extremely  potent  immunosuppressive  functions  via  contact‐dependent  ROS  production,  control  Mφs  strongly  inhibit  T  cell  proliferation  via  IFN‐γ‐induced  NO  production, and 4T1 MDSCs suppress T cells via contact‐independent ROS production,  albeit to a lesser extent than Mφs (Fig. 5.27).   130    Figure 5.26  4T1  Mφs  and  MDSCs  suppress  T  cell  proliferation  via  different  ROS­ mediated mechanisms.   A,  Lung  Mφs  or  PMφs  were  isolated  from  4T1  mice  and  co‐cultured  with  polyclonal‐ stimulated splenocytes (1 Mφ: 8 splenocytes) ± 10 mM NAC (black bars) or 1 mg/ml catalase  (grey bars). T cell proliferation was measured and percent of RC proliferation calculated. B,  Splenic  or  pulmonary  Gr1+  MDSCs  were  isolated  from  4T1  mice  and  co‐cultured  with  polyclonal‐stimulated splenocytes (1 MDSC: 2 splenocytes) ± 10 mM NAC (black bars), or 1  mg/ml  (light  grey  bars)  or  2  mg/ml  (dark  grey  bars)  catalase.  T  cell  proliferation  was  measured  and  percent  of  RC  proliferation  calculated.  Data  are  representative  of  two  independent experiments performed in triplicate. *,p<0.05;  **,p<0.01;  ***,p< 0.001 relative  to untreated cells       131    Figure 5.27  Myeloid cells suppress T cell proliferation via different mechanisms and  to different degrees.   4T1  Mφs  suppress  T  cell  proliferation  via  contact‐dependent  ROS  production  that  is  inhibited  by  treatment  with  NAC.  Mφs  from  control  mice  exert  their  immunosuppressive  effects  via  contact‐dependent  NO  production,  which  is  prevented  by  treatment  with  L‐ NMMA,  L‐NIL,  and/or  α‐IFNγ.  Unlike  Mφs,  4T1  MDSCs  suppress  T  cell  responses  via  a  contact‐independent  mechanism  that  is  inhibited  by  treatment  with  catalase,  indicating  a  role for H2O2. These cells also differ in their relative suppressive strengths; 4T1 Mφs exhibit  the most potent immunosuppressive abilities, followed by control Mφs, and then 4T1 MDSCs.         132  5.2.14 ATRA increases lung metastasis in 4T1 tumor­bearing mice    After   thoroughly   characterizing   the   phenotype   of   tumor‐induced   immunosuppressive myeloid cells, we next examined the functions of these cells in vivo.  Specifically, we investigated the distinct roles of Mφs and MDSCs in promoting primary  tumor  growth  and  metastasis.  We  conducted  a  series  of  experiments  using  the  drug  ATRA, which induces the differentiation of MDSCs into Mφs and DCs (Kusmartsev et al.,  2003;  Nefedova  et  al.,  2007).  We  treated  4T1  mice  with  or  without  placebo  or  slow‐ release ATRA pellets over a three week timeframe. We found that ATRA treatment did  not have an effect on the growth rate of primary tumors, which was very similar in all  groups (Fig. 5.28A). Since the lungs are a principal site of metastasis in the 4T1 model,  we  assayed  the  number  of  metastatic  tumor  cells  in  the  lungs  and  found  that  ATRA  treatment,  especially  the  higher  10  mg  dose,  greatly  increased  lung  metastases  (Fig.  5.28B).  Furthermore,  we  performed  these  same  studies  using  the  4TO7  tumor  model,  which is a much less aggressive metastatic cell line compared to 4T1 cells (i.e. although  4TO7  cells  can  be  recovered  from  the  blood  and  lungs,  visible  metastases  never  develop)  (Aslakson  and  Miller,  1992;  Heppner  et  al.,  2000),  and  found  that  ATRA  treatment increased metastatic lung cells to an even greater extent (Fig. 5.28C). These  data suggest that although ATRA treatment does not impact primary tumor growth, it  enhances metastasis in both the 4T1 and 4TO7 models.   133    Figure 5.28  ATRA  treatment  does  not  alter  primary  tumor  growth  but  increases  lung metastasis.  4T1  mice  were  treated  ±  ATRA  (5  mg  or  10  mg)  or  placebo  pellets  and  A,  primary  tumor  growth  and  B,  number  of  tumor  cells  in  the  lungs  were  measured  over  time.  C,  4T07  mice  were treated ± ATRA (5 mg or 10 mg) or placebo pellets and the number of tumor cells in the  lungs were measured over time. Data are the mean ± SEM of two independent experiments,  n>5 mice per group.       134  5.2.15 ATRA  increases  the  proportion  of  Mφs,  which  are  much  more  immunosuppressive  than  MDSCs  in  the  lungs  of  4T1  tumor­bearing  mice    We  next  performed  a  number  of  tests  to  elucidate  the  mechanisms  by  which  ATRA treatment  increased  lung metastasis. First,  we  considered whether  ATRA  might  influence the immunosuppressive properties of myeloid cells. We assayed the abilities  of pulmonary and splenic MDSCs isolated from 4T1 mice treated with or without ATRA  to suppress T cell proliferation and found that ATRA treatment did not drastically alter  the immunosuppressive function of pulmonary or splenic MDSCs (Fig. 5.29A). Similarly,  ATRA treatment did not have an effect on the immunosuppressive abilities of lung Mφs  (Fig.  5.29B).  However,  in  performing  these  experiments  we  observed  that,  consistent  with our previous results, lung Mφs from mice in all treatment groups were much more  potent  suppressors  of  T  cell  responses  than  lung  MDSCs  isolated  from  the  same  mice  (Fig. 5.29C). In fact, when assayed at the same ratio, pulmonary Mφs were up to 50‐fold  more suppressive than pulmonary MDSCs (Fig. 5.29C).   135    Figure 5.29  ATRA does not change the immunosuppressive properties of MDSCs or  Mφs.   A,  Pulmonary  or  splenic  MDSCs  were  isolated  from  4T1  mice  treated  ±  ATRA  (5  mg)  or  placebo  pellets  and  co‐cultured  with  polyclonal‐stimulated  splenocytes  (1  MDSC:  1  splenocyte).  T  cell  proliferation  was  measured  and  percent  of  RC  proliferation  calculated.  Significance is relative to untreated cells. B, Lung Mφs were isolated from 4T1 mice treated ±  ATRA  (5  mg)  or  placebo  pellets  and  co‐cultured  with  polyclonal‐stimulated  splenocytes  at  different ratios (Mφ: splenocytes; 1:1 or 1:2). T cell proliferation was measured and percent  of  RC  proliferation  calculated.  Significance  is  relative  to  untreated  cells.  C,  MDSCs  or  Mφs  were isolated from the lungs of 4T1 mice treated ± ATRA (5 mg or 10 mg) or placebo pellets  and co‐cultured with polyclonal‐stimulated splenocytes (1 myeloid cell: 1 splenocyte). T cell  proliferation was measured and percent of RC proliferation calculated. Data are the mean ±  SEM  of  three  independent  experiments  performed  in  triplicate.  *,p<0.05;  ***,p<0.001;  NS,  not significant       136  Because ATRA induces MDSC differentiation, and thus alters the proportions of  different myeloid cells, we examined the impact of ATRA treatment on myelopoiesis. As  expected,  control  and placebo‐treated  4T1  mice  exhibited  extreme splenomegaly  (Fig.  5.30A). However, mice treated with ATRA exhibited much smaller spleens than control  mice  with  the  same  size  primary  tumors  (Fig.  5.30A),  indicating  that  ATRA  treatment  decreased tumor‐induced myelopoiesis. Furthermore, we found that the ratio of MDSCs  to  Mφs  in  the  lungs  was  significantly  reduced  by  ATRA  treatment  (Fig.  5.30B),  consistent  with  reports  that  ATRA  treatment  induces  MDSC  differentiation,  and  consequently  reduces  the  number  of  MDSCs  and  increases  the  number  of  Mφs  (Kusmartsev et al., 2003; Nefedova et al., 2007). Taken together, our data are consistent  with  a  model  in  which  ATRA  enhances  metastasis  by  promoting  the  differentiation  of  MDSCs  to  Mφs,  which  are  much  more  potent  suppressors  of  immune  responses  (Fig.  5.31).      Figure 5.30  ATRA increases the number of Mφs and reduces the number of MDSCs in  4T1 mice.   A,  4T1  mice  were  treated  ±  ATRA  (5  mg  or  10  mg)  or  placebo  pellets  and  primary  tumor  weight and spleen weight were measured over time. B, 4T1 mice were treated ± ATRA (5 mg  or 10 mg) or placebo pellets, and lung MDSCs and Mφs were harvested and quantified.  Data  are  the  mean  ±  SEM  of  two  independent  experiments  performed  in  duplicate.  *,p<0.05;  **,p<0.01; NS, not significant relative to untreated mice       137    Figure 5.31  ATRA  induces  the  differentiation  of  MDSCs  into  more  immunosuppressive  Mφs  and  promotes  lung  metastasis  in  the  4T1  and  4TO7  tumor  models.          138  5.3 Discussion    In this chapter, we characterized the phenotypes of immunosuppressive myeloid  cells  from  normal  and  neoplastic  tissues,  elucidated  the  mechanisms  by  which  they  inhibit  immune  responses,  and  investigated  the  roles  they  play  in  tumorigenesis.  Our  results reveal that both Mφs and MDSCs possess immunosuppressive abilities. However,  we also found these myeloid cells differ with regard to the potency and mechanisms by  which they exert their suppressive effects, as well as the functions they perform in vivo.  Our  data  suggest  that  these  characteristics  are  governed  by  a  number  of  contextual  factors  including  exposure  to  different  tumor‐derived  factors,  location  in  different  tissues, and activation state. In general, the studies performed in this chapter reveal a  number of key findings regarding the different roles Mφs and MDSCs play both ex vivo  and in vivo and highlight the importance of Mφs in immune suppression and metastasis.    One  important  trend  that  we  saw  throughout  our  studies  was  the  contrasting  effects  of  different  tumor  models,  specifically  metastatic  4T1  tumors  versus  non‐ metastatic 67NR tumors, on the phenotype and function of Mφs and MDSCs.  We found  that  4T1  tumors  induce  immense  expansion  of  myeloid  cells,  including  both  Mφs  and  MDSCs  (Fig.  5.3),  and  skew  their  phenotype  towards  M2  activation  (Fig.  5.8).  Furthermore,  4T1  tumors  enhanced  the  suppressive  function  of  all  cell  types  we  investigated (Fig. 5.14). In contrast, 67NR tumors did not induce myelopoiesis (Fig. 5.3)  or  alter  the  phenotype  of  myeloid  cells.  The  only  exception  to  this  trend  was  with  regard to TAMs, which we found were more immunosuppressive from 67NR mice than  4T1 mice (Fig. 5.10). Taken together, these data support two ideas: 1) Different tumors  have  contrasting  effects  on  myeloid  cell  induction  and  immune  suppression  and  2)  there may be important differences between the effect of tumors on cells located within  the tumor microenvironment versus the periphery.     Although we report significant differences in the effect of 4T1 and 67NR tumors  on immunosuppressive myeloid cells, the underlying principles remain unclear. It has   139  been reported that MDSCs are induced by almost all types of human and murine tumors  (Youn  et  al.,  2008);  however,  we  found  that  67NR  tumors  did  not  induce  either  the  accumulation  or  activation  of  myeloid  cells  (Fig.  5.3,  5.12).  Myelopoiesis  is  part  of  a  normal  immune  response  and  is  induced  by  any  number  of  chronic  and  acute  inflammatory  conditions,  including  autoimmune  disease,  trauma,  burns,  and  sepsis  (Cuenca et al., 2011). Indeed, pro‐inflammatory factors produced by the tumor, tumor  stroma,  and  infiltrating  T  cells,  including  cytokines,  chemokines,  and  S100  proteins,  induce accelerated myelopoiesis and drive the mobilization of mature Mφs, PMNs, and  immature populations from the BM and blood to inflammatory sites (Ueda et al., 2009).  Interestingly, it has also been shown that these same factors not only drive myeloid cell  expansion  and  activation,  but  also  prevent  the  differentiation  of  immature  myeloid  cells, thus promoting MDSC accumulation. Related to this, studies by Kusmartsev et al.  have  revealed  that  MDSCs  from  tumor‐bearing  mice  injected  into  healthy  animals  quickly lose their immunosuppressive phenotype and terminally differentiate into Mφs  and DCs (Kusmartsev et al., 2003), indicating that MDSCs have the potential to mature,  but are trapped by their environment in an immature state. Therefore, our finding that  67NR  tumors  do  not  promote  myelopoiesis  has  a  number  of  interesting  implications.  First, it suggests that, unlike the vast majority of tumors, 67NR tumors do not induce an  inflammation  response.  Further,  it  suggests  that  67NR  tumor  cells  do  not  produce  factors that promote myeloid cell expansion or activation. It seems unusual that 67NR  tumors  can  grow  and  thrive  in  the  mammary  fat  pad,  yet  not  induce  a  systemic  inflammatory  response.  One  possible  explanation  could  be  related  to  the  non‐ metastatic  nature  of  67NR  tumors;  perhaps  the  same  factors  that  promote  metastasis  also induce myelopoiesis or perhaps disseminated tumor cells are required to initiate  an  inflammatory  response.  Alternatively,  the  inability  of  67NR  tumors  to  induce  myeloid  cells  or  modify  their  phenotypes  may  be  related  to  the  high  degree  of  vascularization in 67NR tumors(Fig. 5.2). Perhaps the lack of myeloid cell induction and  infiltration  in  67NR  tumors  is  due  to  the  lack  of  hypoxic  cells  in  67NR  tumors,  which  have  been  shown  to  induce  the  production  of  factors  that  stimulate  angiogenesis  and  myeloid cell infiltration (Corzo et al., 2010; Doedens et al., 2010; Laoui et al., 2011; Qian   140  and  Pollard,  2010).  Additional  studies  using  a  panel  of  tumor  cell  lines,  including  metastatic and non‐metastatic tumors, as well as tumors that exhibit different degrees  of vascularization and hypoxia will be integral to gaining a better understanding of the  factors that regulate myeloid cell infiltration and function.     As mentioned earlier, there appear to be substantial tissue‐specific differences in  the  phenotype  of  Mφs  and  MDSCs.  Most  notably,  the  phenotype  of  TAMs  and  tumor  MDSCs  differs  from  their  peripheral  tissue  counterparts.  For  example,  we  found  that  MDSCs  in  peripheral  lymphoid  organs  did  not  express  iNOS  or  Arg1,  while  tumor  MDSCs  expressed  both  Arg1  and  Ym1  (Fig.  5.8B).  We  also  discovered  that  Mφs  in  the  periphery  (i.e.  PMφs  and  lung  Mφs)  suppressed  T  cell  responses  via  a  different  mechanism  than  TAMs.  Intriguingly,  most  studies  investigating  MDSCs  are  performed  using cells isolated from peripheral lymphoid organs (i.e. spleen), while much of what  we  know  about  the  role  of  Mφs  in  cancer  has  been  based  on  studies  with  TAMs.  Consequently, the role of tumor‐associated MDSCs and peripheral Mφs, as well as how  they  compare  to  their  differently‐located  counterparts,  remains  largely  unknown  (Corzo  et  al.,  2010;  Torroella‐Kouri  et  al.,  2009).  In  the  past  few  years,  a  number  of  groups  have  investigated  the  phenotypes  of  immunosuppressive  myeloid  cells  in  the  peripheral  lymphoid  organs  versus  the  tumor  site  and  published  results  that  are  consistent with our own data (Haverkamp et al., 2011), including a recent report from  Corzo et al. that presented a number of important findings. Using an EL‐4 ascites model,  they  noted  major  differences  in  the  immunosuppressive  function  between  tumor  and  splenic MDSCs. Specifically, they found splenic MDSCs could only suppress Ag‐specific  CD8+  T  cell  function,  while  tumor  MDSCs  could  suppress  both  Ag‐specific  and  non‐ specific  T  cell  responses,  and  that  these  differences  were  principally  regulated  by  hypoxia and induction of hypoxia‐inducible factor (HIF)‐1α (Corzo et al., 2010).  They  also found that HIF‐1α expression induced the expression of iNOS and Arg1 in MDSCs,  decreased  ROS  production,  and  promoted  the  differentiation  of  MDSCs  into  TAMs  (Corzo et al., 2010). These data shed light on a number of issues relevant to our work  and  may  help  explain  the  relatively  low  potency  of  MDSC  immunosuppression  we   141  observed.  Since  the  necessary  mice  are  not  available  on  the  BALB/c  background,  we  were  unable  to  assay  the  ability  of  different  myeloid  cell  types  to  inhibit  Ag‐specific  CD8+  T  cell  responses,  and  instead  only  tested  suppression  of  Ag‐specific  CD4+  and  polyclonal (non‐specific) T cell functions. Therefore, it is possible that our finding that  splenic  and  lung  MDSCs  are  less  potent  immune  suppressors  than  Mφs  may  not  be  applicable  to  tumor  MDSCs  and/or  CD8+  Ag‐specific‐stimulated  T  cell  responses.  Furthermore,  the  finding  that  hypoxia  regulates  immunosuppressive  function,  as  well  as  MDSC  differentiation,  may  explain  some  of  the  differences  we  observed  in  suppressive  ability  between  4T1‐  and  67NR‐  induced  myeloid  cells.  Importantly,  this  phenomenon  does  not  appear  to  be  restricted  to  MDSCs,  since  hypoxia  and  HIF‐1α  expression have also been implicated in regulating the suppressive functions of Mφs, as  demonstrated  by  a  recent  study  from  Johnson’s  group  (Doedens  et  al.,  2010).  Taken  together,  these  findings  may  highlight  an  integral  role  for  hypoxia  in  regulating  the  phenotype  and  functions  of  myeloid  cells,  and,  in  turn,  tumor  progression  and  metastasis.    Unlike  TAMs,  the  roles  of  peripheral  Mφs  in  tumorigenesis  are  not  yet  clearly  elucidated (Torroella‐Kouri et al., 2009). Our results demonstrate that the presence of  4T1  tumors  dramatically  alters  the  phenotype  and  enhances  the  immunosuppressive  function of Mφs in peripheral tissues, such as the PC and lung (Fig. 5.14).  Our finding  that increased numbers of lung Mφs correlate with increased metastatic growth in the  lungs  raises  questions  about  whether  Mφs  contribute  to  the  formation  of  the  pre‐ metastatic  niche.  To  date,  most  groups  have  focused  on  the  involvement  of  VEGF‐R1  expressing BM‐derived HPCs in niche development (Kaplan et al., 2005), but  our data  suggest a potential role for Mφs, and future studies will be integral to determine their  contribution  to  this  process.    In  addition,  the  role  of  PMφs  in  the  context  of  cancer  remains unclear. It is possible that PMφs function to suppress activated T cells in the PC,  and  may  contribute  to  ascites  formation  in  this  manner.  Alternatively,  the  increased  immunosuppressive  abilities  of  PMφs  may  be  representative  of  a  systemic  immunosuppressive  state.  Taken  together,  these  results  suggest  that  both  TAMs  and   142  peripheral Mφs are central players in the immunosuppressive network and their roles  should not be neglected or minimized. Rather, further studies should be performed to  clarify the roles Mφs play in different stages of carcinogenesis and validate these cells as  potential therapeutic targets.     As  we  have  discussed,  tumor‐induced  myeloid  cells  display  immense  heterogeneity.  As  Figure  5.7  shows,  we  analyzed  MDSC  expression  of  CD11b  and  Gr1  and found some degree of variation in Gr1 expression. However, these subpopulations  were most evident in control and 67NR Gr1+ cells, while 4T1 MDSCs appeared to be a  more uniform population (Fig. 5.7). Moreover, we analyzed splenic and pulmonary 4T1  MDSCs by flow cytometry and found that only a very small proportion (<5%) expressed  Ly6C and the vast majority were Ly6G+ (data not shown), which are consistent with our  morphological  analysis  presented  in  Chapter  4  (Fig.  4.3).    Consequently,  we  did  not  analyze  different  subpopulations  of  4T1  MDSCs,  but  rather  chose  to  study  them  as  a  single  ‘bulk’  population.    However,  there  are  reports  indicating  that  different  subpopulations of MDSCs vary with regard to immunosuppressive function (Movahedi  et  al.,  2008).  Related  to  this,  a  recent  study  by  Bronte’s  group  investigating  the  phenotype  of  three  splenic  MDSC  subpopulations,  isolated  by  their  differential  expression  of  Gr1,  found  that  the  CD11b+/Gr1int  subset,  which  was  comprised  of  monocytes  and  myeloid  cell  progenitors,  was  highly  suppressive,  while  the  CD11b+/Gr1high subset, made up of mostly granulocytes, was only immunosuppressive  in some tumor models and under certain conditions (Dolcetti et al., 2010). Interestingly,  they found that the development and function of more immunosuppressive subsets was  dependent  on  tumor‐produced  GM‐CSF  (Dolcetti  et  al.,  2010).  These  data,  along  with  reports from several other groups (Corzo et al., 2010; Cuenca et al., 2011; Laoui et al.,  2011;  Peranzoni  et  al.,  2010;  Youn  and  Gabrilovich,  2010),  highlight  the  extreme  heterogeneity  encompassed  by  the  MDSC  classification  and  reinforce  the  idea  that  MDSCs  cannot  be  identified  by  expression  of  particular  markers,  but  rather  by  their  immunosuppressive nature (Laoui et al., 2011).      143  Since accurate detection of immunosuppressive function was critical both for the  accurate  identification  of  MDSCs,  as  well  as  for  our  studies  comparing  the  relative  immunosuppressive potencies of myeloid cells, we used a number of assays to quantify  suppression  of  T  cell  responses.    For  the  most  part,  whether  we  assayed  T  cell  proliferation  by  3H‐thy  incorporation  or  flow  cytometry  analysis  of  CFSE,  the  results  were very consistent. However, we observed two important discrepancies in the results  of these assays that reveal important clues about immunosuppressive mechanism. The  first  is  that  while  PMφs  isolated  from  control  mice  strongly  suppressed  T  cell  proliferation  as  measured  by  3H‐thy  incorporation  (Fig.  5.9),  they  did  not  reduce  the  proportion of divided T cells (Fig. 5.17). A possible explanation for this disparity relates  to the different time frames during which proliferation is measured using each method.  Analysis by flow cytometry determines T cell division over the entire 72 h period of co‐ culture  while  3H‐thy  incorporation  only  measures  proliferation  in  the  final  18  h.  Therefore, these data may suggest that control PMφs are not immediately suppressive,  but  require  time  and/or  activation  to  acquire  suppressive  function.  This  is  consistent  with  our  finding  that  control  PMφs  are  only  able  to  produce  NO  and  exert  their  suppressive  effects  following  exposure  to  T  cell‐produced  IFN‐γ,  which  induces  iNOS  expression  in  PMφs  (Fig  3.13).  Moreover,  Figure  5.18  provides  further  evidence  that  control PMφs possess immunosuppressive properties, since control PMφs significantly  reduced the proportion of both CD4+ and CD8+ T cells present in the culture after 72 h.    The  other  noteworthy  difference  between  the  results  from  the  two  methods  is  that,  at  first  glance,  4T1  MDSCs  seem  much  more  immunosuppressive  by  CFSE‐flow  cytometric  analysis  than  by  the  3H‐thy  assay  (Fig.  5.16).  However,  these  data  indicate  that the majority of cells are dead (98.1%) following 72 h co‐culture with 4T1 MDSCs  (Fig.  5.16),  which,  in  theory,  would  suggest  MDSCs  are  exerting  non‐specific  cytotoxic  activities.  However,  these  results  are  not  consistent  with  the  high  levels  of  3H‐thy  incorporation  we  detected,  since  if  all  the  cells  were  dead  there  would  be  little  or  no  incorporation  of  3H‐thy  during  the  last  18  h  of  co‐culture.  Furthermore,  when  we  determined the proportion of viable T cells following 4T1 MDSC co‐culture using a non‐  144  CFSE  flow  cytometric  approach,  we  found  that  4T1  MDSCs  reduced  the  proportion  of  viable  CD4+  T  cells  from  37.4%  to  20.3%  and  CD8+  T  cells  from  22.3%  to  4.35%  (Fig.  5.18). These numbers are consistent with the data from the  3H‐thy assay and indicate  that  4T1  MDSCs  restrict  the  proliferation  of  both  CD4+  and  CD8+  T  cells,  but  do  not  obliterate all viable T cells. Taken together, these data suggest that CFSE may increase  the  sensitivity  of  splenocytes  to  the  cytotoxic  effects  of  4T1  MDSCs  and  support  our  finding  that  MDSCs  are  less immunosuppressive  on a  per  cell  basis than  Mφs.  Further  studies  specifically  investigating  the  effect  of  CFSE  pre‐treatment  on  the  viability  of  splenocytes co‐cultured with 4T1 MDSCs will reveal the mechanisms involved.    Related  to  this,  when  we  investigated  the  effect  of  different  Mφ  and  MDSC  populations  on  bulk  splenocyte  and  T  cell  viability  we  made  a  number  of  interesting  observations. First, we noted that although control and 4T1 PMφs potently suppressed  T  cell  proliferation,  they  increased  the  proportion  of  viable  T  cells  in  culture  (Fig.  5.19B).  In  contrast,  co‐culture  with  either  control  Gr1+  cells  (which  were  not  immunosuppressive)  or  4T1  MDSCs  significantly  promoted  T  cell  death  (Fig.  5.19B).  These  data  suggest  that  Mφs  and  MDSCs  have  opposing  effects  on  T  cell  viability  and  also provide evidence that T cell suppression and death are not always directly related.  In  general,  suppression  of  T  cell  responses  can  be  achieved  via  induction  of  anergy,  apoptosis,  or  necrosis.    However,  further  studies  will  be  required  to  accurately  distinguish  which  of  these  mechanisms  is  utilized  by  different  immunosuppressive  myeloid cells. It seems probable that the increase in T cell viability we see is due to the  removal  of  dead  or  dying  cells  from  the  culture  by  phagocytic  Mφs  but  studies  using  specific inhibitors of phagocytosis will be required to substantiate this hypothesis.    One of the key findings from these studies is the elucidation of the mechanisms  by which 4T1 Mφs and MDSCs exert their immunosuppressive functions. We found that  both Mφs and MDSCs suppress T cell proliferation by ROS production, but use different  mechanisms.  Specifically,  the  suppressive  effects  of  MDSCs  were  contact‐independent  (Fig. 5.20A) and inhibited by catalase (Fig. 5.25C), suggesting MDSCs inhibit T cells by   145  production  of  extracellular  H2O2.    Although  MDSCs  in  other  tumor  models  have  been  reported to produce ROS, this immunosuppressive mechanism has not been specifically  reported for 4T1 MDSCs.  In contrast, we found that 4T1 PMφ‐induced suppression of T  cells  was  inhibited  by  NAC  (Fig.  5.23D)  and  that  PMφs  were  much  more  potent  suppressors  when  in  contact  with  target  cells  (Fig.  5.20B).  NAC  contains  both  a  thiol  (sulfhydryl;  SH)  and  cysteine  group,  each  of  which  contributes  to  its  anti‐oxidant  properties  (Zhang  et  al.,  2011).  On  the  one  hand,  via  its  thiol  group,  NAC  serves  as  a  proton  donor,  reducing  unstable  molecules  such  as  ROS  (Zhang  et  al.,  2011).  On  the  other  hand,  via  its  cysteine  group,  NAC  functions  as  the  rate‐limiting  factor  in  GSH  synthesis,  which  is  a  potent  intracellular  antioxidant  in  cells  (Pompella  et  al.,  2003).  Therefore,  although  NAC  is  an  important  player  in  the  neutralization  of  free  radicals  and ROS both directly and indirectly (Zhang et al., 2011), we are unable to surmise from  our data the specific ROS produced by 4T1 PMφs. However, since neither catalase nor  SOD  reduced  their  suppressive  effects,  our  results  indicate  that  4T1  PMφs  suppress  T  cells via intracellular ROS other than H2O2 or O2‐.     Not  only  do  our  data  demonstrate  that  MDSCs  and  Mφs  suppress  T  cells  via  different  mechanisms,  they  also  suggest  that  MDSCs  and  Mφs  play  distinct  roles  in  tumorigenesis. To discriminate between the effects of these different cell types we used  ATRA, which induces the terminal differentiation of MDSCs into Mφs and DCs (Almand  et al., 2001; Kusmartsev et al., 2003; Mirza et al., 2006). A recent report by Nefedova et  al. investigated the mechanism by which ATRA induced MDSC differentiation and found  that  ATRA  increased  levels  of  glutathione  synthase  (GSS)  in  MDSCs,  which  in  turn  resulted  in  increased  levels  of  GSH  and  decreased  ROS  production  (Nefedova  et  al.,  2007). These findings are consistent with previous reports suggesting that in addition  to mediating the suppressive effects of MDSCs, ROS also contributed to the inability of  MDSCs  to  differentiate  into  mature  cells  (Kusmartsev  and  Gabrilovich,  2003;  Kusmartsev  et  al.,  2004).  Interestingly,  ATRA  did  not  stimulate  the  differentiation  of  MDSCs induced in a model of sepsis (Cuenca et al., 2011), which is compatible with the  idea that different stimuli induce MDSCs with different phenotypes (i.e. sepsis‐induced   146  MDSCs do not produce ROS and thus are not affected by ATRA treatment). Nevertheless,  a number of studies have demonstrated that ATRA potently eliminates MDSCs both in  vitro (Almand et al., 2001; Gabrilovich et al., 2001) and in vivo, in tumor‐bearing mice  and  cancer  patients  (Kusmartsev  et  al.,  2003;  Kusmartsev  et  al.,  2008;  Mirza  et  al.,  2006),  by  differentiating  MDSCs  into  mature  myeloid  cells.  Furthermore,  there  is  evidence  that  ATRA,  in  combination  with  cancer  vaccines  or  chemotherapy,  increases  cancer treatment efficacy (Kusmartsev et al., 2003; Mirza et al., 2006; Sanz and Lo‐Coco,  2011).  However,  little  is  known  about  the  effect  of  ATRA  on  primary  or  metastatic  growth  in  the  absence  of  other  treatments.  Our  studies  reveal  that  treating  tumor‐ bearing  mice  with  ATRA  reduces  the  number  of  MDSCs,  increases  the  number  of  Mφs  (Fig.  5.30),  and  increases  lung  metastasis,  but  does  not  affect  primary  tumor  growth  (Fig.  5.28).    These  data  argue  against  the  notion  that  inducing  MDSC  differentiation  leads to increased anti‐tumor immune responses and decreased tumorigenesis. Rather,  they  suggest  that,  at  least  in  some  tumor  models,  inducing  MDSC  differentiation  can  promote metastasis. Interestingly, we noted that while ATRA enhanced lung metastasis  in  both  4T1  and  4TO7  models,  it  increased  4TO7  metastasis  to  a  greater  extent.  This  may  be  because  1)  the  baseline  level  of  4TO7  tumor  cell  metastasis  is  much  lower,  allowing the metastasis‐enhancing effects of ATRA to be more evident, and/or 2) 4TO7  tumors  may  be  more  sensitive  to  the  both  pro‐  and  anti‐tumor  effects  of  the  immune  system,  i.e.,  in  the  absence  of  ATRA  the  anti‐tumor  immune  response  is  sufficient  to  inhibit  4TO7  metastasis,  but  the  increase  in  pro‐tumor  Mφs  mediated  by  ATRA  profoundly increases 4TO7 metastatic growth.     Given our finding that Mφs are more potent immune suppressors than MDSCs on  a per cell basis (Fig. 5.14), we propose that inducing the differentiation of MDSCs to Mφs  increases  overall immune  suppression,  which  in turn fosters  the  growth  of  metastatic  tumor  cells  in  the  lungs.  In  contrast,  altering  the  ratio  of  MDSCs  to  Mφs  with  ATRA  treatment  did  not  affect  primary  tumor  growth  (Fig.  5.28A),  which  may  indicate  that  MDSCs and Mφs play a similar role in promoting primary tumor growth than metastatic  growth. This is consistent with our preliminary data demonstrating that tumor MDSCs   147  and  TAMs  exhibit  comparable  immunosuppressive  abilities  (data  not  shown),  unlike  MDSCs  and  Mφs  isolated  from  metastatic  sites.  The  idea  that  MDSCs  and  Mφs  have  different  roles  in  metastasis  is  further  supported  by  our  finding  that  MDSCs  and  Mφs  are located in very different regions of metastatic tumor nodules, with MDSCs lining the  periphery  of    nodules  and  Mφs  invading  deep  into  the  tumor  interior  (Fig.  5.2B).  It  is  also possible that Mφs promote metastatic growth to a greater extent than MDSCs due  to  other  mechanisms  (i.e.  production  of  factors  that  support  cell  growth  or  angiogenesis).  Although  our  hypothesis  is  supported  by  the  critical  role  immune  suppression  is  known  to  play  in  all  stages  of  tumorigenesis,  including  metastasis,  the  relative contribution of the immunosuppressive functions of Mφs to metastatic growth  could be more accurately determined using a T cell‐deficient mouse model.        As  a  whole,  our  studies  underscore  the  vast  heterogeneity,  as  well  as  the   phenotypic  similarities,  of  tumor‐induced  myeloid  cells.  By  characterizing  the  differences  between  cells  from  normal  tissues  and  their  tumor‐induced  counterparts  we  have  increased  our  understanding  of  the  effects  of  different  tumors  on  the  phenotype and immunosuppressive function of myeloid cells. Importantly, our results  highlight  that  not  all  tumor  models  have  equivalent  effects  on  the  induction  and  suppressive  function  of  myeloid  cells,  demonstrate  that  while  most  myeloid  cells  possess  immunosuppressive  properties  the  potency  varies  dramatically  between  different cell types as do the mechanisms by which cells exert their suppressive effects,  and finally, reveal that Mφs may play a critical role in promoting metastasis, and may do  so  to  a  greater  extent  than  MDSCs.  Together,  these  findings  help  clarify  the  roles  of  different myeloid cells in cancer, which may contribute to the development of targeted  therapeutics.      148  CHAPTER 6 : SUMMARY AND FUTURE DIRECTIONS    The overall objective of this thesis was to investigate the factors that regulate the  immunosuppressive properties of different myeloid cells and elucidate the roles these  cells  play  in  both  normal  and  neoplastic  tissues.  Although  the  immunomodulatory  properties  of  myeloid  cells  have  long  been  recognized  (Holda  et  al.,  1985;  Strober,  1984),  when  we  embarked  on  this  work  many  questions  remained  regarding  the  specific cell types involved, the mechanisms by which they functioned, and the contexts  in  which  they  exerted  their  effects.  Our  studies  have  focused  on  clarifying  the  immunosuppressive properties of two mononuclear cell populations, Mφs and MDSCs.   Overall, the results of our work reveal a number of important insights into the functions  and  regulation  of  these  cells  in  both  physiological  and  pathological  environments,  highlight  the  considerable  phenotypic  and  functional  heterogeneity  exhibited  by  Mφs  and MDSCs, and underscore the considerable therapeutic potential of Mφs.     In  Chapter  3,  we  examined  the  immunosuppressive  abilities  of  myeloid  cells  under physiological conditions and obtained a number of interesting results (Hamilton  et al., 2010). Although CD11b+Gr1+ IMCs exist in various murine tissues, including the  BM  and  spleen,  they  do  not  possess  immunosuppressive  abilities  under  steady‐state  conditions  and  therefore  are  not  considered  MDSCs  (Delano  et  al.,  2007;  Laoui  et  al.,  2011).  We  thus  focused  on  exploring  the  immunosuppressive  functions  of  Mφs.  We  determined  that  resident  Mφs,  isolated  from  the  PC  of  non‐tumor‐bearing  mice,  potently  suppressed  T  cell  responses  via  an  IFN‐γ  and  NO‐dependent  mechanism  (Hamilton  et  al.,  2010).  These  results  are  consistent  with  previous  studies  from  the  early  1990s  that  identified  this  pathway  in  Mφs  (Albina  et  al.,  1991;  Cox  et  al.,  1992;  Deng  et  al.,  1993).  However,  these  original  studies  have  been  largely  overlooked  in  recent years and the factors that regulate this pathway, and thus determine whether or  not Mφs exert their suppressive effects, remained poorly understood. We performed a  series  of  experiments  to  address  this  question  and  discovered  that  the  suppressive  abilities of Mφs were eliminated by TLR agonists that signal through the TRIF cascade  149  (i.e. LPS or dsRNA), but not by those that signal exclusively through MyD88 (i.e. CpG or  PGN) (Hamilton et al., 2010). Moreover, we found that these effects were mediated by  the  induction  of  IFN‐β  that  occurs  following  TRIF  recruitment  and  IRF‐3  activation,  which  decreases  the  ability  of  Mφs  to  respond  to  IFN‐γ  stimulation  (Hamilton  et  al.,  2010).  These  novel  findings  reveal  a  role  for  resident  Mφs  in  the  maintenance  of  immune  homeostasis,  increase  our  understanding  of  the  mechanisms  by  which  Mφs  contribute  to  T  cell  tolerance,  and  suggest  a  key  role  for  TLR  signaling  and  IFN‐β  in  regulating the immunosuppressive functions of Mφs.       The  findings  presented  in  Chapter  3  offer  novel  insights  into  the  mechanisms   regulating  Mφ‐induced  T  cell  tolerance  on  multiple  levels.  At  the  molecular  level,  our  data provide evidence that IFN‐β can antagonize IFN‐γ signaling; however, the precise  mechanism(s)  by  which  this  occurs  remain(s)  unclear  and  will  require  further  work.  Specifically,  activation  levels  of  different  IFN‐γ  signaling  components  (e.g.  IFN‐γ  receptor,  JAK‐1,  JAK‐2,  STAT1)  in  IFN‐γ‐stimulated  Mφs  pre‐treated  with  or  without  IFN‐β  would  contribute  to  our  understanding  of  this  process.  Our  data  support  the  concept  that  NO  can  play  divergent  roles  in  immune  responses  (Prabhu  and  Guruvayoorappan,  2010)  and  demonstrate  a  previously  unappreciated  link  between  TLR signaling and regulation of immune suppression. These findings also contribute to  our  understanding  of  the  factors  that  regulate  Mφ  suppression  and  T  cell  tolerance  at  the cellular and organismal levels. Intriguingly, we show for the first time that viral‐ but  not  bacterial‐derived  PAMPs  reduce  the  immunosuppressive  properties  of  Mφs.  However, an important caveat to these findings is they are based on in vitro stimulation  of Mφs with individual PAMP ligands and this does not accurately reflect the context in  which Mφs would encounter intact pathogens in vivo. Future experiments investigating  the  effect  of  different  pathogens  on  Mφ  immunosuppression  using  in  vivo  animal  infection  models,  e.g.,  Legionella  pneumophila  (intracellular  bacteria),  Mycobacterium  tuberculosis  (extracellular  bacteria),  influenza  (virus),  Candida  albicans  (fungus),  Trichuris muris (helminth) would validate our in vitro results and provide insights into  the physiological rationale for these findings.   150    Importantly,  our  data  reveal  specific  factors  that  regulate  the  suppressive  mechanisms  of  Mφs  and  suggest  that  Mφs  may  be  attractive  therapeutic  targets.  Treatment  with  IFN‐β,  LPS,  dsRNA,  or  small  molecule  iNOS  inhibitors  may  reduce  Mφ  suppression,  which  could  be  useful  following  infection  or  as  part  of  future  cancer  therapies. Alternatively, small molecule Arg1 or IFN‐β inhibitors, via their enhancement  of  the  immunosuppressive  properties  of  Mφs,  may  be  desirable  in  patients  with  autoimmune diseases or GvHD. Future studies will be required to test the effectiveness  of  these  potential  therapies  in  vivo,  in  animal  models  of  clinical  diseases.  Overall,  the  findings presented in Chapter 3 emphasize the dual role of Mφs in the promotion and  inhibition  of  immune  responses  in  normal  tissues  and  highlight  their  considerable  therapeutic potential, as well as the importance of increasing our understanding of the  factors that regulate Mφ function.    After investigating the regulatory role of Mφs under physiological conditions, we  sought  to  determine  their  role  in  a  tumor  environment,  as  well  as  compare  the  immunosuppressive  properties  of  Mφs  and  MDSCs  in  tumor‐bearing  mice.      However,  although there are many reports in the literature of tumor‐derived MDSCs inhibiting T  cell responses in vitro, we had difficulties reproducing these findings. This prompted us  to  consider  the  effect  of  different  cell  culture  conditions  on  the  immunosuppressive  properties of MDSCs and the results of these experiments are presented in Chapter 4.  We  found  that  MDSCs  isolated  from  4T1  tumor‐bearing  mice,  unlike  PMφs  or  TAMs,  could not suppress T cell proliferation in the presence of FCS and, in fact, promoted T  cell  proliferation  in  some  experiments  (Hamilton  et  al.,  2011).  Investigation  of  the  underlying  mechanisms  revealed  that  serum  albumin  was  a  major  contributor  to  the  antagonistic  effects  of  FCS  on  MDSC‐induced  immune  suppression  and  did  so  by  restricting  ROS  production  from  MDSCs  (Hamilton  et  al.,  2011).  These  novel  findings  have  a  number  of  important  implications  regarding  the  accurate  detection  and  identification  of  MDSCs  as  well  as  the  mechanisms  that  regulate  the  immunosuppressive properties of MDSCs.    151     MDSCs represent an extremely heterogeneous population of cells. In fact, some   have  argued  that  identifying  MDSCs  by  co‐expression  of  CD11b  and  Gr1  has  led  to  ambiguity in the literature since this definition is neither specific nor inclusive (Cuenca  et al., 2011). In reality, cells of the mononuclear phagocyte lineage can be particularly  difficult to identify by cell surface markers since the phenotype of these cells depends  on  a  number  of  factors  including  inflammatory  status  (i.e.  steady‐state  versus  inflammatory  conditions),  type  and/or  duration  of  inflammation,  and  tissue  location  (Laoui  et  al.,  2011).  Therefore,  MDSCs  must  be  identified  functionally,  which  requires  assays  to  accurately  assess  MDSC  immunosuppression  ex  vivo.  Our  data,  which  demonstrate for the first time that different culture conditions have a profound effect  on  the  suppressive  functions  of  MDSCs,  are  of  critical  importance  for  researchers  regarding the appropriate design and interpretation of immunosuppression assays.     One  caveat  is  that  our  studies  were  limited  to  4T1‐induced  MDSCs  and  we  did  not test the effects of serum on MDSCs induced in any other models. Validation of these  results  in  different  models  of  MDSC  induction  (e.g.  different  tumor  models,  trauma,  parasitic  infections,  sepsis)  will  reveal  whether  this  phenomenon  is  unique  to  4T1‐ MDSCs or more generally applicable to other tumor or inflammatory models. Similarly,  we  did  not  separate  different  populations  of  MDSCs,  but  studied  the  immunosuppressive  features  of  bulk  pulmonary  or  splenic  Gr1+  cells.  Although  we  found  that  4T1‐MDSCs  were  a  relatively  uniform  population  by  flow  cytometric  and  morphological  analyses  (>95%  of  cells  were G‐MDSCs),  further studies  comparing  the  effects  of  serum  and  albumin  on  the  suppressive  functions  and  ROS  production  of  different  subpopulations  of  MDSCs  will  reveal  the  potential  applicability  and/or  limitations of our findings.       Despite the technical nature of the work presented in Chapter 4, our results may   shed light on the physiological roles of MDSCs in tumor biology. Our finding that MDSC‐ induced immunosuppression is not a fixed property, but varies in response to different  culture conditions is consistent with reports that, in certain contexts, MDSCs can exert  pro‐inflammatory  functions  (Cuenca  et  al.,  2011;  Nausch  et  al.,  2008;  Pastula  and  152  Marcinkiewicz, 2011). Briefly, there is evidence that the same properties of MDSCs that  enable  them  to  inhibit  T  cell  responses,  such  as  ROS  and  inflammatory  cytokine  production, play a role in anti‐microbial responses and increased immune surveillance  (Cuenca  et  al.,  2011).  Moreover,  there  are  some  reports  that  MDSCs,  under  some  circumstances,  can  be  immunostimulatory  (Nausch  et  al.,  2008;  Pastula  and  Marcinkiewicz,  2011),  which  is  consistent  with  results  obtained  in  some  of  our  experiments in which serum was present. In addition, our finding that albumin blunts  ROS  production  and,  as  a  result,  immune  suppression, demonstrates  for  the  first  time  that  4T1‐induced  MDSCs  can  inhibit  T  cell  responses  via  ROS  production.  Although  these experiments did not reveal the particular ROS involved, our findings from Chapter  5 suggest a possible role for H2O2, and future studies measuring production of H2O2 and  other ROS should be performed to validate this finding. As previously mentioned, these  data may suggest a physiological function for albumin in restricting the activation and  function of MDSCs. While we have not identified the specific mechanism(s) at play, we  have  some  evidence  that  albumin‐associated  FAs  may  be  involved.  It  would  be  interesting to further elucidate the involvement of FAs in regulating MDSC function and  test the effect of altering the ratio of different FAs (i.e. omega‐3 versus ‐6) as this might  be of therapeutic value. In summary, the data presented in Chapter 4 clearly highlight  the  importance  of  testing  different  in  vitro  culture  conditions  on  MDSC  function  to  ensure  that  the  presence  of  serum  is  not  masking  the  full  immunosuppressive  properties  of  MDSCs.  These  results  will  enable  more  accurate  identification  of  MDSCs  based  on  their  immunosuppressive  properties  and  consequently  advance  our  understanding  of  the  roles  that  MDSCs  perform  in  promoting  primary  and  metastatic  tumor growth.       Once we established culture conditions that allowed immune suppression to be   accurately  assayed  in  vitro,  we  embarked  on  a  series  of  studies  comparing  the  regulatory  properties  of  different  subtypes  of  myeloid  cells  from  control,  4T1,  and  67NR  tumor‐bearing  mice.  These  experiments,  communicated  in  Chapter  5,  revealed  several striking results. We demonstrated that, contrary to currently accepted notions,  not all tumors induce myelopoiesis and the development of immunosuppressive cells.  153  We  noted  a  significant  difference  in  the  vascularization  of  4T1  and  67NR  tumors,  consistent with a number of reports suggesting a link between hypoxia and induction  and/or  activation  of  immunosuppressive  myeloid  cells  (Erler  et  al.,  2009;  Laoui  et  al.,  2011).  In  general,  hypoxia  and  HIF‐1α  stabilization  promotes  the  immunosuppressive  function  of  MDSCs  (Corzo  et  al.,  2010)  and  Mφs  (Doedens  et  al.,  2010).  HIF‐1α  also  stimulates  the  pro‐angiogenic  functions  of  Mφs,  by  recruiting  Mφs  to  hypoxic  regions  (i.e.  in  the  tumor)  and  driving  Mφ  production  of  VEGF  and  matrix  metalloproteinase  (MMP)9 (Grimshaw et al., 2002; Murdoch et al., 2008). Further studies using myeloid‐ specific  HIF‐1α  mice  (i.e.  HIF‐1α  deletion  under  the  control  of  the  M‐CSFR  promoter)  would  be  helpful  in  further  elucidating  the  role  of  hypoxia  on  the  induction  and  activation  of  suppressive  myeloid  cells.  In  addition,  proteomic  studies  identifying  the  different  factors  produced  by  4T1  and  67NR  tumors  cultured  in  vitro  under  either  normoxic  or  hypoxic  conditions  will  be  critical  to  understanding  the  specific  tumor‐ derived factors, as well as the role of hypoxia, in inducing myelopoiesis and promoting  metastasis.        Although the majority of current research is focused on targeting MDSCs, when   we  compared  the  suppressive  properties  of  Mφs  and  MDSCs  isolated  from  the  same  tissues,  we  found  that  Mφs  suppressed  T  cell  proliferation  to  a  much  greater  extent.  Moreover,  we  found  that  4T1  Mφs  and  MDSCs  inhibited  T  cell  responses  via  different  mechanisms;  although  both  Mφs  and  MDSCs  produced  ROS,  Mφ  suppression  was  contact‐dependent  and  inhibited  by  NAC  while  MDSC  suppression  was  contact‐ independent  and  inhibited  by  catalase.  There  a  few  potential  caveats  that  must  be  considered related to these in vitro results: 1) due to the lack of appropriate genetically  modified mice we were unable to compare the ability of Mφs and MDSCs to specifically  suppress CD8+ T cell Ag‐specific responses, 2) due to low cell yield we were not able to  compare  the  suppressive  abilities  of  tumor‐associated  MDSCs  and  Mφs,  and  3)  rather  than  examining  precise  MDSC  and  Mφ  subsets  we  examined  total  cell  populations.  Identification of individual subpopulations of myeloid cells is difficult since these cells  are  highly  related  and  exhibit  variable  phenotypes  depending  on  the  stimuli  to  which   154  they are exposed (Laoui et al., 2011).  Related to this, we observed major differences in  both  the  strength  and  mechanism  of  suppression  of  cells  in  peripheral  versus  tumor  tissues.  For  example,  we  found  that,  unlike  peritoneal  and  pulmonary  Mφs,  TAM‐ mediated  immune  suppression  could  not  be  reversed  by  NAC,  or  any  other  inhibitors  that  we  tested  in  our  assay.  These  findings  are  consistent  with  multiple  studies  that  have reported significant functional differences between cells located in the tumor and  periphery (Corzo et al., 2010).     It  is  well  established  that  cancer  is  a  systemic  disease,  inducing  wide‐spread  immune  deficiency  in  addition  to  local  immune  suppression  (Torroella‐Kouri  et  al.,  2009).  However,  while  much  emphasis  has  been  placed  on  elucidating  the  roles  of  TAMs  in  tumor  progression,  the  role  of  peripheral  Mφs  remains  poorly  understood  (Torroella‐Kouri et al., 2009). Our data clearly show that the presence of certain tumors  changes  the  phenotype  of  peripheral  Mφs,  increasing  their  suppressive  capabilities.  Studies by the Lopez laboratory investigating the phenotype of PMφs from mice bearing  D1‐DMBA‐3  mammary  tumors  showed  that  these  cells  exhibit  decreased  APC  ability  (Watson  and  Lopez,  1995)  and  produce  lower  levels  of  IL‐1β,  IL‐6,  IL‐12,  TNF‐α,  NO,  CCL2, and M‐CSF compared to control PMφs (Dinapoli et al., 1996; Handel‐Fernandez et  al., 1997; Torroella‐Kouri et al., 2009). Recently, they published that the decreased pro‐ inflammatory functions of tumor PMφs are due, at least in part, to lower expression of  NF‐κB  and  CCAAT/enhancer  binding  protein  (C/EBP)  TFs  and  that  these  cells,  which  cannot  be  classified  as  either  M1  or  M2,  are  more  sensitive  to  apoptosis  and  express  lower  levels  of  Mφ  markers  (i.e.  F4/80,  CD11b,  CD68,  CD116).  (Torroella‐Kouri  et  al.,  2005; Torroella‐Kouri et al., 2009). These studies from the Lopez laboratory provide a  mechanistic basis for the effect of tumors on peripheral Mφs and it would be useful to  perform  these  experiments  in  4T1  tumor‐bearing  mice  to  reveal  whether  these  mechanisms  are  consistent  between  different  mammary  tumor  models,  as  well  as  to  explore the functions of these cells in vivo.       155  As  well,  in  Chapter  5  we  show  for  the  first  time  that  ATRA  treatment,  which  induces  the  differentiation  of  MDSCs  to  terminally  differentiated  Mφs  and  DCs,  enhances metastatic growth. These results are particularly intriguing given that ATRA  has been proposed as a possible cancer therapy because of its ability to decrease MDSC  levels  (Kusmartsev  et  al.,  2008).  ATRA  is  currently  used  to  treat  APL  in  combination  with chemotherapy (Sanz and Lo‐Coco, 2011); however, a key difference is that, in APL,  ATRA targets the malignant cells directly, rather than acting indirectly through MDSCs.  Our results suggest that, at least in certain tumor models, Mφs promote metastasis to a  greater  degree  than  MDSCs.  Although  this  finding  is  consistent  with  our  data  demonstrating  that,  in  vitro,  Mφs  suppress  T  cell  responses  to  a  greater  degree  than  MDSCs,  these  experiments  are  not  sufficient  to  determine  causality.    Related  to  this,  there  is  substantial  evidence  that  Mφs  can  promote  metastasis  via  non‐ immunosuppressive  functions  including  production  of  IL‐1,  TNF,  IL‐6,  VEGF,  and  proteases  that  breakdown  the  ECM  and  aid  tumor  cell  escape  and  migration  such  as  cathepsins, MMPs, and serine proteases (Laoui et al., 2011; Mantovani and Sica, 2010;  Qian  and  Pollard,  2010).  On  the  other  hand,  Mφs  have  also  been  reported  to  promote  carcinogenesis via multiple immune regulatory mechanisms, such as production of IL‐ 10, PGE2, and/or TGF‐β (Kuang et al., 2009; Torroella‐Kouri et al., 2009), upregulation  of  PD‐1L  on  monocytes  (Kuang  et  al.,  2009),  induction  of  Tregs  via CCL22  production  (Curiel  et  al.,  2004),  and  based  on  our  results,  ROS  production.  Given  the  key  role  of  immune  suppression  in  fostering  tumorigenesis,  it  is  possible  that  Mφs  promote  4T1  metastatic  growth,  at  least  in  part,  via  suppression  of  anti‐tumor  T  cell‐mediated  immunity.  Further  experiments  using  T  cell‐deficient  mice  may  be  helpful  to  test  this  hypothesis;  however,  initial  studies  comparing  the  immunosuppressive  properties  of  Mφs  isolated  from  wild‐type  and  T‐cell  deficient  mice  will  be  required  to  assess  the  validity of this approach. Another question that should be addressed is the role of DCs  in   ATRA‐treated   mice.   Studies   analyzing   the   relative   proportions   and   immunosuppressive  functions  of  Mφs  and  DCs  in  4T1  mice  treated  with  or  without  ATRA,  as  well  as  studies  specifically  targeting  Mφs  or  DCs,  should  be  performed  to  clarify the distinct roles of these cells in metastasis.    156  While we have demonstrated that Mφs enhance metastatic growth, we have not  investigated  at  which  stage  Mφs  are  involved.  Metastasis  requires  a  number  of  steps:  release  of  tumor  cells  from  the  primary  tumor,  migration  through  the  circulatory  or  lymphatic system, extravasation in distant tissues, and subsequent survival and growth  (Qian  and  Pollard,  2010).  Recently,  important  work  has  revealed  a  direct  and  critical  role  for  Mφs  i