UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The role of SHIP in natural killer cell licensing Rytova, Valeria 2011

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
ubc_2012_spring_rytova_valeria.pdf [ 1.51MB ]
[if-you-see-this-DO-NOT-CLICK]
Metadata
JSON: 1.0072430.json
JSON-LD: 1.0072430+ld.json
RDF/XML (Pretty): 1.0072430.xml
RDF/JSON: 1.0072430+rdf.json
Turtle: 1.0072430+rdf-turtle.txt
N-Triples: 1.0072430+rdf-ntriples.txt
Original Record: 1.0072430 +original-record.json
Full Text
1.0072430.txt
Citation
1.0072430.ris

Full Text

THE ROLE OF SHIP IN NATURAL KILLER CELL LICENSING  by Valeria Rytova  B.A. & Sc., McGill University, 2009  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Interdisciplinary Oncology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  December 2011  © Valeria Rytova, 2011  Abstract  Natural Killer (NK) cells comprise a unique subset of lymphocytes with innate ability to detect and kill abnormal cells. Inhibitory Ly49 receptors expressed on NK cells recognize major histocompatibility complex class I (MHC I) molecules and inhibit NK cell killing of normal cells that express high amounts of MHC I. In addition to maintaining self-tolerance of NK cells, the Ly49:MHC I interaction is required for the functional maturation of NK cells by a process termed “NK cell licensing.” NK cells from MHC I-deficient β2 microglobulin (β2m)-KO mice are not cytotoxic as they are not licensed. Our goal was to determine the mechanism through which NK cells of MHC-I deficient mice are kept hyporesponsive to NK-sensitive targets. We compared unlicensed NK cells from β2m-KO mice with licensed wild type (WT) NK cells in each step of NK cell cytotoxicity. We found that LFA-1 mediated adhesion to target and polarization of actin and talin are functional in these cells, yet unlicensed NK cells fail to polarize cytotoxic granules when bound to the prototypic NK target YAC-1, or beads coated with combinations of ligands for NK stimulatory receptors, namely the LFA-1 ligand ICAM-1, NKG2D ligand H60, and 2B4 ligand CD48. Thus, NKG2D and 2B4 mediated signalling seemed impaired in unlicensed NK cells. Ly49 receptors, upon tyrosine phosphorylation, are thought to recruit both Src homology 2-containing phosphatase 1 (SHP1) and Src homology 2 domain-containing inositol-5′-phosphatase (SHIP), whereas NK cell licensing is known to be SHP1-independent. Therefore, we tested whether SHIP is involved in NK cell licensing. In both WT and β2m-KO NK cells, antibody mediated cross-linking of inhibitory Ly49 receptors induced recruitment of SHIP rather than SHP1. When NK cells bound to MHC I-deficient YAC-1, SHIP was enriched at the contact site of unlicensed, but not in licensed, NK cells. These ii  results suggest that during the process of NK cell licensing, Ly49C/I recruits SHIP and prevents SHIP‟s association with activating NK cell receptors allowing stimulatory signalling and cytotoxicity to occur. These findings provide insight into the mechanism of NK cell licensing and signalling generated by the Ly49: MHC I interaction.  iii  Preface  Mice were housed in the BC Cancer Research Centre Animal Research Centre. All animal use was approved by the animal care committee of the University of British Columbia (Animal Care Protocol # A09-0994), and animals were maintained and euthanized under humane conditions in accordance with the guidelines of the Canadian Council on Animal Care.  iv  Table of Contents  Abstract ................................................................................................................................... ii Preface .................................................................................................................................... iv Table of Contents .....................................................................................................................v List of Tables ........................................................................................................................ viii List of Figures ........................................................................................................................ ix List of Abbreviations ............................................................................................................. xi Acknowledgements .............................................................................................................. xiv Chapter 1: Introduction .........................................................................................................1 1.1 Natural Killer cells ........................................................................................................1 1.2 Stimulatory receptors ....................................................................................................3 1.2.1 NKG2D ..................................................................................................................4 1.2.2 2B4 .........................................................................................................................5 1.2.3 NKp46....................................................................................................................7 1.2.4 Other stimulatory receptors ...................................................................................7 1.3 Inhibitory receptors .......................................................................................................9 1.3.1 Ly49 .......................................................................................................................9 1.3.2 NKG2A ................................................................................................................11 1.3.3 Other inhibitory receptors ....................................................................................11 1.4 Intracellular signals .....................................................................................................12 1.4.1 Stimulatory ..........................................................................................................12 1.4.2 Inhibitory .............................................................................................................14 1.5 NK cell licensing ........................................................................................................16 v  1.6 Thesis objectives and hypothesis ................................................................................19 Chapter 2: Materials and Methods .....................................................................................20 2.1 Tissue culture ..............................................................................................................20 2.1.1 Mice .....................................................................................................................20 2.1.2 Murine splenocyte extraction ..............................................................................20 2.1.3 Generation of poly I:C primed ex-vivo NK cells ................................................20 2.1.4 YAC-1 culture .....................................................................................................21 2.2 Antibodies and commercial reagents ..........................................................................21 2.2.1 Primary antibodies ...............................................................................................21 2.2.2  Secondary antibodies ...........................................................................................22  2.2.3  Reagents ...............................................................................................................22  2.3 CD48 and Fc-H60 fusion proteins ..............................................................................23 2.4 ICAM-1 adhesion assay..............................................................................................23 2.5 Confocal microscopy ..................................................................................................24 2.5.1 Binding of NK cells to beads ...............................................................................24 2.5.2 Binding of NK cells to YAC-1 ............................................................................25 2.5.3 Staining for confocal microscopy ........................................................................26 2.5.4 Acquisition and analysis of confocal images.......................................................26 2.6 Ly49 cross-linking experiments .................................................................................27 2.6.1 Induction of Ly49 capping...................................................................................27 2.6.2 Confocal analysis of SHIP or SHP-1 localization with cross-linked Ly49C/I ....27 2.7 Cytotoxicity assays .....................................................................................................28 2.8 Flow cytometry ...........................................................................................................28 Chapter 3: Results ................................................................................................................30 vi  3.1 Unlicensed β2m-KO NK cells do not kill the prototypic target YAC-1 .....................30 3.2 Unlicensed NK cells from poly I:C primed β2m-KO mice contain similar amounts of Granzyme B as WT NK cells .....................................................................................31 3.3 LFA-1 mediated adhesion is intact in unlicensed NK cells of β2m-KO mice ...........32 3.4 The LFA-1/ICAM-1 interaction induces efficient polarization of talin and actin in β2mKO NK cells ................................................................................................................34 3.5 Polarization of lytic granules is defective in unlicensed NK cells bound to YAC-1 .36 3.6 Unlicensed NK cells fail to polarize granzymes towards beads coated with ICAM-1, and the NKG2D ligand H60 ...............................................................................................38 3.7 Unlicensed NK cells fail to polarize granzymes towards beads coated with ICAM-1, NKG2D ligand H60, and additional stimulatory ligand CD48 ...................................40 3.8 Ab mediated cross-linking of inhibitory Ly49C/I receptors induces recruitment of SHIP rather than SHP-1 phosphatase in both licensed and unlicensed NK cells..................41 3.9 SHIP localizes to the contact site of unlicensed NK cells bound to YAC-1 targets ...45 3.10 NK cells from SHIP-KO mice contain a greater subset of immature cells than WT .48 Chapter 4: Discussion ............................................................................................................50 References ...............................................................................................................................56  vii  List of Tables  2.2.1 Primary antibodies .......................................................................................................21 2.2.2 Secondary antibodies ...................................................................................................22  viii  List of Figures  Figure 3.1 β2m-KO NK cells do not kill the prototypic NK target YAC-1 ............................... 30 Figure 3.2 β2m-KO NK cells from poly-IC primed mice contain granzyme B amounts comparable with WT NK cells ................................................................................................... 31 Figure 3.3 β2m-KO NK cells from poly-IC primed mice adhere to purified and immobilized ICAM-1 at similar levels as WT NK cells ................................................................................. 33 Figure 3.4 WT and β2m-KO NK cells efficiently polarize their actin and talin cytoskeleton once bound to polystyrene beads coated with LFA-1 ligand ICAM-1 ............................................... 35 Figure 3.5 Actin polarizes but lytic granules do not polarize in β2m-KO NK cells bound to YAC-1 target .............................................................................................................................. 37 Figure 3.6 Actin polarizes but lytic granules do not polarize in β2m-KO NK cells bound to beads coated with ICAM-1 and NKG2D ligand H60................................................................. 39  Figure 3.7 In the presence of additional stimulation from CD48, ligand for 2B4 stimulatory receptor on NK cells, β2m-KO NK cells are deficient in granule polarization .......................... 41 Figure 3.8 In B6 and β2m-KO NK cells from poly I:C primed mice, Ab mediated cross-linking of inhibitory Ly49C/I receptors induces recruitment of SHIP rather than SHP-1 phosphatase . 42 Figure 3.9 Uncapped Ly49C/I colocalizes with SHIP in WT, but not in β2m-KO NK cells .... 44  Figure 3.10 SHIP localizes away from the contact site in WT cells, but is present at the contact site of unlicensed NK cells bound to YAC-1 targets.................................................................. 46  ix  Figure 3.11 SHIP-KO NK cells differ phenotypically from WT, as they contain a significantly larger subset of immature NK cells ............................................................................................ 49 Figure 4.1 Model for SHIP‟s role in NK cell licensing .............................................................. 52  x  List of Abbreviations  Ab  antibody  ADCC  antibody-dependent cell-mediated cytotoxicity  BM  bone marrow  BSA  bovine serum albumin  CD2AP  CD2 associated protein  CFDA-SE  carboxyfluorescein diacetate, succinimidyl ester  CTL  cytotoxic T lymphocyte  DAP10  DNAX-activating protein of 10 kDa  DAP12  DNAX-activating protein of 12 kDa  DMEM  Dulbecco's modified eagle's medium  DMSO  dimethyl sulfoxide  DNAM-1  DNAX accessory molecule-1  EBV  Epstein Barr virus  EDTA  ethylenediamine tetraacetic acid  ERK  extracellular signal-related kinase  FACS  fluorescence activated cell sorting  FasL  Fas ligand  FCS  fetal calf serum  Grb2  growth factor receptor-bound protein 2  HBSS  Hank's balanced salt solution  ICAM-1  intercellular adhesion molecule-1  IL  interleukin  xi  IS  immunological synapse  ITAM  immunoreceptor tyrosine-based activation motif  ITIM  immunoreceptor tyrosine-based inhibitory motif  ITSM  immunoreceptor tyrosine-based switch motif  KIR  killer immunoglobulin-like receptors  KO  Knockout  LFA-1  leukocyte function associated antigen-1  mAb  monoclonal antibody  MAPK  MAP kinase kinase  MHC  major histocompatibility complex  MCMV  mouse cytomegalovirus  MTOC  microtubule organizing centre  MULT-1  mouse ULBP like transcript-1  NKG2D  natural killer group 2D  NK  natural killer  PBS  phosphate buffered saline  PH  pleckstrin homology  PI  propidium iodide  PI3K  phosphoinositide 3-kinase  PIP2  phosphatidylinositol (4,5) bisphosphate  PIP3  phosphatidylinositol (3,4,5) trisphosphate  PLCγ  phospholipase C γ  PLL  poly L lysine  PMA  phorbol 12-myristate 13-acetate  poly I:C  polyinosinic-polycytidylic acid xii  PTEN  phosphatase and tensin homologue  RAE-1  retinoic acid early inducible-1  RT-PCR  reverse transcriptase polymerase chain reaction  SAP  slam-associated protein  SDS-PAGE  sodium dodecyl sulphate polyacrylamide gel electrophoresis  SH3  Src homology 3  SHIP  Src homology 2 domain-containing inositol-5′-phosphatase  SHP  Src homology 2 domain-containing phosphatase  dsRNA  double stranded ribonucleic acid  sIC-1  soluble ICAM-1  SLAM  signaling lymphocyte activation molecule  TCR  T cell receptor  TNF  tumour necrosis factor  TRAIL  tumour necrosis factor apoptosis inducing ligand  ULBP1  UL-16 binding protein-1  WT  wild-type  ZAP70  δ-associated protein of 70-kDA  xiii  Acknowledgements  Thank you Fumio, for giving me the opportunity to learn and gain essential experience in such a great place, surrounded by wonderful people, fresh minds and innovative ideas. Thank you for being honest, fair, supportive, and motivating. Without your wisdom, I would have been very lost.  Thank you Rob and Andy, for guiding me through my research, as well as preparation of this thesis. Things would have been impossible without your contribution. Thanks to Laura Sly – you are an amazing examiner and scientist!  I am more than thankful to Victor Ling, for taking me into this excellent program. For your outstanding presence, wonderful sense of humor, and motivational spirit, that transgresses to everyone and everything around you.  Special thanks to my parents, Svetlana and Mario, for always being there for me, regardless of the situation. I am nothing without your guidance, encouragement, and advice.  Thanks to my beautiful friends, who have listened and helped me hold up during the past two and a half years.  xiv  Chapter 1: Introduction  1.1  Natural Killer cells  Natural Killer (NK) cells comprise a unique subset of lymphocytes with the innate ability to detect and kill virally-infected and tumorigenic cells. Following development in the bone marrow, mature NK cells circulate in peripheral blood, lymphatics, and tissues, constantly scanning cell-surface molecules to identify abnormal cells. NK cells belong to the innate arm of the immune system as they express germ line encoded, non antigen-specific receptors, and can mediate cytotoxicity without prior sensitization. They are also an important link between innate and adaptive immunity as they secrete chemokines and cytokines, such as IFN-γ, GMCSF, and TNF-α, that regulate antigen-specific responses from B and T cells. Tumor and virally-infected cells often avoid killing by cytotoxic T lymphocytes (CTLs), the other major cytotoxic lymphocytes, by down-regulating major histocompatibility complex class I (MHC I) molecules. This, however, makes them susceptible to NK cell killing. In addition, abnormal cells express a multitude of ligands recognized by NK cell stimulatory receptors, making them the perfect targets 1. There are two major pathways by which NK cells mediate apoptosis of their target: (1) the granule exocytosis pathway and (2) the death receptor pathway, which involves engagement of Fas ligand (FasL) or TNF on the NK cell with Fas (CD95), or TNFR-related apoptosis inducing lingand (TRAIL) on the target cell, resulting in caspase-dependent apoptosis 2. The most common pathway is granule exocytosis. The apoptosis-inducing granules are specialized secretory lysosomes, and their major cytotoxic components are granzymes, a type of serine protease, and perforin. Although human NK cells contain pre-formed granules and 1  thus have some level of basal activation, naïve murine NK cells are not cytotoxic as they lack granzyme B and perforin until primed or activated by a foreign agent 3. Upon target recognition, secretory lysosomes are exocytosed by the NK cell and their cytotoxic contents are released. Perforin assists in the entry of granzymes into the cytosol of target cells, where they cleave various targets (e.g. caspases) resulting in apoptosis 4, 5. The most common granzymes are granzymes A and B. Granzyme A causes slower, caspase-independent apoptosis, whereas granzyme B causes rapid, caspase-dependent cell death 6. Each NK cell kills on average four target cells, terminating its cytotoxic activity due to diminished perforin and granzyme B levels 7. NK cell-mediated cytotoxicity is highly regulated by the balance of stimulatory and inhibitory receptors on the NK cell surface, which structurally belong to either the C-type lectin-like family or the immunoglobulin (Ig) superfamily of receptors. As mentioned earlier, abnormal cells express multiple stimulatory ligands that activate NK cells, and very few inhibitory MHC I ligands. This is why they are efficiently killed by NK cells. Normal cells are spared because they express little to no stimulatory ligands and numerous inhibitory MHC I molecules 8, 9. MHC I molecules are the classical ligand for NK cell inhibitory receptors. Once their count becomes scarce, NK cell cytotoxicity can proceed unconstrained and trigger cell lysis, a phenomenon referred to as “missing-self recognition” 10. The actual killing of target cells by NK cells is a rapid, multi-step process that can take place within twenty minutes. The first step is the binding of NK cells to targets, mediated by the interaction of LFA-1 integrins on NK cell surface with ICAM-1 molecules on target cells. This induces polarization of the actin cytoskeleton (step 2). In our laboratory, we have previously shown that step 2 occurs in a talin1-dependent manner, and talin is also polarized 2  towards the target cell 11. This is followed by translocation of the lytic granules, containing perforin and granzymes, to the interface between the NK cell and its target (step 3). And finally, the fusion of granules with the cell membrane and the release of perforin and granzymes towards the bound target cause apoptosis of target cells (step 4, Fig.1.1) 12. The complex formed between an NK cell and a sensitive target is often termed the “lytic immune synapse”. LFA-1, actin, and talin form a ring that provides stability to the immune synapse and acts as the scaffold for the assembly of stimulatory and inhibitory signaling complexes. It also provides a route for delivery of lytic granules to the target 13.  Figure 1.1 Sequential steps to NK cell cytotoxicity. The killing of target cells by NK cells is a multi-step process involving: 1) adhesion to target cells mediated by LFA-1 molecules, 2) polarization of the actin cytoskeleton mediated by talin and actin polymerization machinery, 3) redistribution of lytic granules and 4) release of their contents towards target cells triggered by ligation of the stimulatory receptors. Image adapted and modified from Nature Reviews Immunology 14.  1.2  Stimulatory receptors  As opposed to B and T cells, NK cells do not rely on a single dominant stimulatory receptor to initiate effector functions. Instead, they cooperatively use an array of stimulatory receptors that act in additive or synergistic manners to elicit a response. Hence, they are often referred 3  to as „costimulatory‟ or „coactivating‟ 15. Following conjugate formation via the LFA-1: ICAM-1 interaction between an NK cell and its target, NK cell activating receptors bind their ligands on target cells. In contrast with inhibitory receptors, the majority of stimulatory receptors on NK cells lack intrinsic signalling domains and, instead, rely on transmembrane adapter proteins to transmit their signals. While some adapters (e.g. FcεRIγ, CD3δ and DNAX adapter protein (DAP)-12) contain an immunoreceptor tyrosine-based activating motif (ITAM) with the YxxL/Ix[6–8]YxxL/I sequence, others do not (e.g. DAP10) 16.  1.2.1. NKGD2 NKG2D is an activating receptor and member of the C-type lectin-like family of receptors. It is expressed on NK cells, activated CD8+ T cells, and macrophages. It recognizes cell surface ligands distantly related to MHC I molecules. These comprise MULT1, H60 and Rae1 in mice, and MHC I heavy chain-related proteins and UL-16-binding proteins (ULBPs) in humans 17, 18. DNA damage response can also induce expression of NKG2D ligands to alert NK cells of potentially damaged cells 19. Murine NKG2D exists in two splice variants: the „long‟ (NKG2D-L) isoform that associates only with the DAP10 adaptor protein, and a „short‟ (NKG2D-S) isoform that is detected only after NK cell activation and can associate with either DAP10 or DAP12 20, 21. Although NKG2D has been presented as a primary activating receptor on NK cells, some studies suggest that it may co-stimulate rather than directly activate effector functions. For instance, NKG2D ligation alone was shown to be insufficient for degranulation of NK cells 22. Also, stimulation of mouse lymphokineactivated NK cells (LAKs) by anti-NKG2D mAb alone does not induce cytokine release, but  4  co-stimulation via CD16, NK1.1, or Ly-49D in addition to NKG2D enables cytokine production 23.  1.2.2. 2B4 Another major stimulatory NK cell receptor is 2B4, also referred to as CD244. It belongs to the SLAM family of receptors that includes CRACC, SLAM, CD84 and Ly-9 in mice 24. 2B4 is expressed on all immature and mature mouse and human NK cells, γδ T cells and on a large subset of CD8+ T cells. The ligand for 2B4 is its relative CD48, a glycosyl-phosphatidyl inositol (GPI)-anchored cell surface glycoprotein. CD48 also interacts with the CD2 receptor, however the affinity of 2B4 for CD48 is 5 to 10 times higher than that of CD2, making the 2B4-CD48 interaction the predominant one in NK cells 25. Originally, 2B4 was identified as a stimulatory cell surface receptor on murine NK cells. Antibody (Ab)-cross linking of 2B4 triggered cell-mediated cytotoxicity and cytokine secretion by NK cells 26. Transfecting mouse cell lines with human CD48 enhanced their susceptibility to lysis by human NK cells, while adding blocking Ab for 2B4 or CD48 diminished the killing of CD48-expressing targets 27. 2B4, SLAM, and others of the CD2 sub-family contain multiple cytoplasmic tyrosine-based motifs (TxYxxI/V) called immunoreceptor tyrosine-based switch motifs (ITSMs). These motifs have the unique capacity to „switch‟ between activating and inhibitory signal transduction. Upon 2B4 receptor activation, its four ITSMs are phosphorylated. This recruits SLAM-associated protein (SAP), which interacts with all four ITSMs through its SH2 domain 28. The third phosphorylated ITSM can also bind inhibitory phosphatases SHP-1, SHP-2, and SHIP 29. However, SAP prevents the binding of these negative regulators to 2B4, 5  by interacting with them itself. SAP also recruits the SH3 containing Src family kinase Fyn, which mediates 2B4 signal transduction leading to PLCγ activation, calcium mobilization, and cytotoxicity 30, 31. Loss of function mutation of the SAP gene causes inherited X-linked lymphoproliferative disease (XLP), which manifests itself by the inability to control B-cell proliferation following Epstein-Barr virus (EBV) infection 32. It was shown that XLP patients exhibit severe SLAM signalling defects, as well as impaired 2B4 receptor-mediated cytolysis of EBV-infected B cells 33. One possible mechanism for this is: in the absence of SAP, inhibitory phosphatases SHP-1, SHP-2, and SHIP bind 2B4 and abrogate its activating signals 29. Similar to NKG2D, recent studies with human NK cells suggest that 2B4 may act as a coactivating receptor rather than a primary stimulatory receptor. NKp46 co-expression with 2B4 was shown to exert synergistic effects on target killing 34. NKG2D was likewise proposed as a coactivating receptor to 2B4 31. Despite this, there is affirmation that 2B4 can act as an inhibitory receptor in both humans and mice 35. NK cells from 2B4-KO mice kill CD48-transfected target cells more efficiently than WT NK cells, suggesting that 2B4 might act as an inhibitory receptor 36. The question of whether 2B4 stimulates or inhibits NK cells is perplexed by the expression of multiple SLAM family receptors on NK cells, as well as multiple members of the SAP family of signalling proteins that associate with SLAM family receptors 24. It has been proposed that its first ITSM is sufficient to mediate stimulatory signalling, and its third, phosphatase-binding, ITSM mediates inhibitory functions 29.  6  1.2.3. NKp46 NKp46 (NCR1) is a member of the natural cytotoxicity receptor (NCR) group on NK cells, alongside NKp44 and NKp30. While all three are expressed in humans, only NKp46 is expressed in mice 37. NCRs associate with non-MHC I ligands on abnormal cells, and transduce their signals with the help of ITAM-containing adapter proteins. NKp46 was first identified by the Morretta group and shown to be expressed on all human NK cells, regardless of activation state 38. Ab cross-linking induces NK cell cytotoxicity, calcium ion release, and cytokine production by resting and cultured NK cells 38. NKp46 is described as a major activating receptor and a highly specific marker of NK cells. It belongs to the Igsuperfamily of surface receptors, and presumably interacts with the ITAM-containing CD3δ adapter protein to mediate signalling. Although NKp46 can trigger cytolysis of different tumorigenic cells, the actual tumor ligand(s) for it have not been identified 39. Among viral ligands, NKp46 has been found to associate with haemagglutinin of influenza virus and haemagglutinin–neuraminidase of parainfluenza virus 40. However, the mechanism of interaction between NKp46 and its viral ligands remains to be deciphered.  1.2.4. Other stimulatory receptors A number of other activating receptors have been identified in human and mouse NK cells. A group of them specifically bind to MHC I or MHC I-like molecules on target cells; these include NKG2C, NKG2E, human KIR2DS and KIR3DS, as well as mouse Ly49D, Ly49H, Ly49P and Ly49W. While KIR2DS is involved in attenuating viral spreading and AIDS progression in HIV positive individuals, donor KIR2DS expression reduces relapse after haplo-identical transplantation for acute leukemia 41. NK cells from C57BL/6 mice express  7  activating Ly49D receptors that recognize H-2Dd molecules, and are important for rejecting bone marrow cell (BMC) allografts in vivo and lysing allogeneic lymphoblasts in vitro 42. The ligand for the Ly49H receptor has been identified to be the murine cytomegalovirusencoded MHC I-like protein m157 (MCMV) and it mediates resistance to the virus 43. As mentioned earlier, human NK cells express natural cytotoxicity receptors (NCRs) NKp30, NKp44 and NKp46. NKp44 mediates signalling through the DAP-12 adapter protein, while NKp30 and NKp46 act in complex with CD3δ and/or FcRγ adapters 16. In vitro assays with human NK cells revealed that both NKp46 and NKp44 bind the haemagglutinins of Influenza virus 40, 44. And recently, a murine homologue of NKp46 has been described; however the ligand for this receptor remains to be identified 45. While the NK1.1 alloantigen has extensively been used as NK and NKT cell marker in C57BL/6 mice, further analysis of NK cells from diverse mouse strains confirmed that the NK1.1 epitope is shared by two alternative splicing products of the NKR-P1gene 46. NKR-P1 (CD161) is a member of the family of type II transmembrane C-type lectin-like receptors in NK cells, giving rise to two receptors with entirely opposing functions. NKR-P1B is the inhibitory form of this receptor and NKR-P1C is the triggering form. NKR-P1C ligation induces cytotoxicity, cytokine production, increased calcium ion flux, and enhanced kinase activity 46. Recent studies show that signalling through NKR-P1C requires association with FcRγ adapter protein, as NK cells from FcRγ-deficient mice are not cytotoxicic nor do they produce IFN-γ upon NKR-P1 cross-linking 47. Nonetheless, elaborate molecular mechanisms of NKR-P1signalling have not been determined yet.  8  NK cells also participate in Ab-dependent cell-mediated cytotoxicity (ADCC) via the CD16 activating receptor, which is a multi-subunit immune recognition complex, also referred to as FcγRIIIA. CD16 is a low affinity receptor for IgG that, in humans, associates with hetero- or homodimers of CD3δ and FcRγ adapter molecules, and with homodimers of FcRγ in mice 16, 48  .  1.3. Inhibitory receptors Polymorphic MHC I molecules are the classical ligands for NK cell inhibitory receptors, such as the human killer Ig-like receptors (KIRs), the analogous murine Ly49 receptors, CD94/NKG2A receptors in both humans and mice, and the leukocyte Ig-like receptor B1 (LILRB1) 9. Structurally, LILRB1s and KIRs are monomeric type I glycoproteins of the immunoglobulin superfamily, while CD94-NKG2A and Ly49 receptors are type II glycoproteins with a C-type lectin-like domain. Despite the disparate extracellular domains, these receptors share a common signalling motif in their cytoplasmic domain. It is the immunoreceptor tyrosine-based inhibitory motif (ITIM) of the (I/L/V/S)XYXX(L/V) sequence, where X designates any amino acid, and slashes separate distinct amino acids that may occupy a given position 1. The interaction between NK inhibitory receptors and MHC I generates a dominant signal that abrogates NK cell effector functions.  1.3.1. Ly49 In humans, killer-cell immunoglobulin-like receptors (KIRs) are a major family of NK cell receptors recognizing MHC I molecules. In mice, the analogous function is exhibited by the Ly49 receptor family, which includes both inhibitory and activating receptors that signal  9  through either ITIMs or kinase-activated adapter proteins, respectively 49. Structurally, these are homodimeric disulfide-linked type II transmembrane glycoproteins, with each chain composed of a C-type lectin-like domain (CTLD) connected to the cell membrane by an αhelix stem 50. The mouse Ly49 family of NK cell receptors includes at least 23 members, from Ly49A through W. Although not all have been characterized, it is known that distinct Ly49 members can discriminate between different MHC I molecules (e.g. H-2D, H-2K, H-2L). MHC I is highly polymorphic, and a particular Ly49 receptor only recognizes a limited repertoire of MHC I molecules 51. For instance, Ly49A specifically binds H-2Dd and H-2Dk 46 whereas Ly49C binds H-2Kb and H-2Db 52, 53. A target that does not display the specific MHC I molecule recognized by the available Ly49 receptors on a given subset of NK cells will endure lysis. The same fate awaits if the target additionally over-expresses specific ligands for NK cell activating receptors. The expression of Ly49 receptors is stochastic and each receptor can be expressed by a distinct but overlapping subset of NK cells. Thus, each NK cell usually co-expresses two or more different Ly49 receptors 54, 55. In vivo, NK cells attack allogeneic and MHC I-deficient cells (e.g. tumour cells), but not self-cells. When the latter down-modulate their MHC I as a result of mutation, infection, or transformation, they become sensitive to autologous NK cells. This is the principal idea behind the „missing self‟ hypothesis 10. Signalling through inhibitory Ly49 receptors involves ITIM phosphorylation. In contrast to human KIRs each containing two cytoplasmic ITIMs, inhibitory Ly49s have a single cytoplasmic ITIM 56. This is probably why Ly49 homodimerization is essential for performing their inhibitory function.  10  An elaborate description of signalling through the ITIM follows in the next section of this thesis.  1.3.2. NKG2A The CD94/NKG2A receptor is expressed in both humans and mice, and is a disulfide-linked heterodimer consisting of two subunits encoded by the CD94 and NKG2A genes. It is expressed on approximately fifty percent of adult mouse NK cells and nearly all fetal and neonatal mouse NK cells, as well as on some CD8+ T cells 57. The CD94 subunit of this receptor has a short cytoplasmic domain with no signalling function, while the NKG2A subunit contains two ITIMs. Upon ligand binding, these ITIMs become phosphorylated and recruit SHP-1 or SHP-2 phosphatases 58. Ultimately, inhibitory signaling through the CD94/NKG2A receptor prevents actin-dependent recruitment of stimulatory receptors to the contact site between an NK cell and its target, evading its lysis 59. In humans, the MHC I ligand recognized by the CD94/NKG2A receptor complex is HLA-E, and in mice it is the homologous Qa1b molecule. The peptide binding sites of HLA-E and Qa1b are occupied by peptides derived from MHC I molecules. Without these peptides, HLA-E and Qa1b are not expressed on cell surface, but are degraded in the cytoplasm of host cells 60. This serves as a surveillance mechanism for NK cells expressing CD94/NKG2A, enabling them to monitor global MHC I expression levels on target cells 58.  1.3.3. Other inhibitory receptors Some NK cells express inhibitory receptors that bind ligands other than MHC I. Examples include the lectin-like receptor KLRG1 which, in humans and mice, binds cadherins and  11  assesses the loss of tissue integrity 61, 62. NKR-P1, also a lectin-like receptor, binds to LLT1 in humans and Clrb/Ocil in mice 63-65. LAIR-1 interacts with collagen and plays a role in control activation in the extracellular matrix 66. Siglec-7 (CD328) and Siglec-9 (CD329), bind sialic acid residues on target cells. NK cells also have orphan inhibitory receptors, such as IRp60 (CD300a), for which the ligands remain unidentified 67, 68.  1.4. Intracellular signals 1.4.1. Stimulatory In order for NK cells to mount a response, engagement of primary or, most often, of a combination of coactivating receptors must produce a stimulatory threshold strong enough to counteract the input from inhibitory receptors. Attaining this threshold induces assembly of multi-subunit receptor complexes, with specialized adapter proteins that transduce signals into the cell via distinct signaling pathways. Three major activating pathways have been identified in both mouse and human NK cells: signalling through immunoreceptor tyrosinebased activation motif (ITAM)-bearing NK receptor complexes, DAP10-associated NKG2D receptor complexes, and the 2B4 (CD244) receptor system 1. DNAX-activating protein of 12 kDa (DAP12) is an example of a specialized adapter that signals through the ITAM in its cytoplasmic domain. In mice, DAP12 associates with stimulatory NK receptors CD16, NKG2-S, Ly49D and Ly49H 20. This association activates Src family protein tyrosine kinases (PTKs), which phosphorylate the ITAM on tandem tyrosine residues, thereby recruiting additional tandem SH2 PTKs of the Syk family, Syk and ZAP-70 69. In turn, various transmembrane and cytosolic adapters come into play and activate a number of signalling cascades involving molecules like phosphoinositide 3-kinase  12  (PI3K), phospholipase C- (PLC), Vav1, Rho, Ras, and extracellular signal-related kinase (ERK). Moreover, ITAM-receptor signalling also increases intracellular calcium ion levels, induces actin polarization, release of lytic granules, and transcription of cytokine genes 1. Other examples of ITAM-containing adapters include FcεRIγ and CD3δ, which bind NKp46, CD16 & NK1.1, respectively 47, 70. A different adapter protein implicated in NK cell stimulatory signalling is DAP10. The DAP10 stimulatory pathway is independent of Syk-family protein kinases and mediates signals distinct from DAP12. In place of an ITAM, it contains a YINM sequence in its cytoplasmic domain. This sequence can bind either the p85 subunit of PI3K, or the growth factor receptor bound protein 2 (Grb2). Depending on the binding partner, DAP10 downstream signalling can take different routes. DAP10 binding of p85 activates PI3K and induces production of phosphatidylinositol-3,4,5-triphosphate (PIP3) at the immune synapse. Recruitment of Grb2 results in phosphorylation of SLP-76, PLC2, and Vav1 – the RacCdc42 family exchange factor. Grb2 can also indirectly interact with DAP10 at the synapse via increased PIP3 levels, in complex with Sos1 and Vav1. Interestingly, it was found that intact binding sites for both p85 and Grb2 are required for full calcium release and cytotoxicity to occur 71. Activation signals passing through DAP10 seem sufficient to induce cytotoxicity, but not cytokine secretion, against specific tumor cell lines 20, whereas ITAM dependent signalling through DAP12 can trigger both cytotoxicity and cytokine secretion in NK cells 72. Despite their differences, signaling through either DAP10 or DAP12 eventually leads to a common cytotoxicity pathway involving Rac activation, subsequent activation of mitogen-activated protein kinase (MAPK) and ERK by means of p21-activated kinase (PAK) and mitogen-activated or extracellular signal-regulated protein kinase kinase (MEK), leading 13  to polarization and release of cytotoxic granules 69, 73. To some extent, DAP10 and DAP12 complement one another during NK cell activation. Studies with resting NK cells from DAP10-deficient (Hcst–/–) mice reveal under-expression of NKG2D receptors, until in vitro or in vivo stimulation. This suggests compensation by DAP12 dependent expression of NKG2D-S 74. Still, NKG2D-dependent killing of tumorigenic targets is impaired in these mice, and so is their ability to reject mismatched BM grafts 74, 75. NK cells from DAP12deficient mice also show diminished killing of tumor cells, as well as a diminished and nonfunctional repertoire of Ly49 activating receptors 76, 77. It was also recently shown that both adapters are necessary for optimal killing of mouse cytomegalovirus (MCMV) by NK cells, as this is a Ly49H-dependent process, a stimulatory receptor from which signalling employs both DAP10 and DAP12. Double deletion of DAP10 and DAP12 annihilates expression of Ly49H and resistance to MCMV infection 78.  1.4.2. Inhibitory As oppose to stimulatory signalling in NK cells, inhibitory signals occur through one major pathway involving immunoreceptor tyrosine-based inhibition motifs (ITIMs) contained within the cytoplasmic tails of NK inhibitory receptors. Upon receptor engagement, its ITIM tyrosine residue(s) is (are) phosphorylated, most likely by a Src family kinase. This results in recruitment of the Src homology 2 containing phosphatase-1 (SHP-1), SHP-2, or the Src homology2-containing inositol phosphatase-1 (SHIP-1). Inhibitory receptors recruit these phosphatases to the contact site between an NK cell and its target, where they dephosphorylate substrates of tyrosine kinases involved in NK cell activation, thereby blocking it at an early stage 1. For instance, a direct substrate of the SHP-1 phosphatase is  14  Vav1 – a major regulator of actin organization 79. SHP-1 dephosphorylates Vav1 and prevents polarization of the actin cytoskeleton, opposing NK cell activation 59, 80. It is important to note that these inhibition events are transient and do not prevent the same NK cell from becoming activated upon encounter with an abnormal target 1. The ITIM was initially discovered in the cytoplasmic tail of FcγRIIb receptor, which mediates B cell inhibitory signalling. Phosphorylated ITIM of FcγRIIb can bind both SHP-1 and SHIP phosphatase, but only SHIP is necessary for B-cell inhibition 81. Studies with human and mouse NK cells expressing KIR/FcγRIIb chimeric receptors and dominant negative mutants of SHIP and SHP-1 revealed that SHP-1 is indispensible for KIR-mediated inhibition, while SHIP is required for inhibition through FcγRIIb 82. In NK cells, Ly49 and NKG2A are thought to predominantly associate with SHP-1 or SHP-2, while KLRG1 associates with SHIP-1 58, 83. The reasons for this differential association are undetermined. While SHP-1 and SHP-2 carry out their inhibitory role by removing tyrosine phosphates, SHIP-1 converts phosphatidylinositol 3,4,5-trisphosphate (PI(3,4,5)P3) to PI(3,4)P2 by removing the 5′ phosphate 84, 85. This blocks activation of serine/threonine kinase Akt. Engagement of ADCC-mediating receptor CD16 on NK cells also recruits SHIP, which interacts with the CD3δ adapter protein and acts as a negative regulator of NK function 86. Wang et al. found that SHIP in mouse NK cells associates with Ly49A and Ly49C inhibitory receptors, and homozygous SHIP-KO mice present an alternate Ly49 repertoire with excessive amounts of Ly49A and Ly49C/I receptor 87. Both of these have been proposed to play a role in NK cell licensing, a topic discussed in the next section of the thesis. In addition, SHIP-KO mice are not able to reject MHC I mismatched bone marrow (BM) grafts, nor kill tumorigenic or virally infected targets 87. 15  As mentioned earlier, the third cytoplasmic ITSM of the 2B4 receptor attracts negative regulators SHP-1, SHP-2 and SHIP-1, likely enabling it to transduce inhibitory signals 29. In compliance with studies identifying 2B4 as an inhibitory receptor on NK cells, it was shown that lack of response of SHIP-KO NK cells to various targets is due to predominant inhibition through 2B4 88. Removing 2B4 restores cytolytic capacity to SHIP-KO NK cells, as seen with double (2B4 and SHIP) knock-out animals 89. As it turns out, in the absence of SHIP, 2B4 expression is up-regulated and recruitment of SHP-1 to this inhibitory receptor increases 10 to 16 fold, as opposed to WT NK cells where inhibition is mostly mediated by SHIP. Blocking SHP-1 function with sodium orthovanadate alleviates its inhibitory effects and re-establishes killing capacity to SHIP-KO NK cells 90.  1.5. NK cell licensing The interaction between inhibitory Ly49 receptors and MHC I is important for the functional maturation of NK cells by a process termed NK cell “licensing” 91. Given the stochastic expression of inhibitory ligands specific for MHC I, it is evident that some NK cells do not go through licensing, and are thus functionally impaired as they are unable to induce cytotoxicity. In fact, NK cells from MHC I-deficient mutant mice are not cytotoxic because they are not licensed. Mice homozygous for the deleted β2m gene, (β2m-KO) are deficient for MHC class Ia and Ib expression. Although abundant in number, NK cells from β2m-KO mice show low capacity to reject allogenic bone marrow transplants, and low cytotoxicity against tumor cells 92. Since the functional impairment is apparent but not absolute, β2m-KO NK cells are deemed “hyporesponsive”. Moreover, studies have revealed that β2m-KO NK cells express the same cell surface markers as WT NK cells. For instance, they express  16  CD11b, DX5, Ly49C/I, and other Ly49 receptors 93. This implies that the functional impairment arising from the lack of Ly49C/I-MHC I interaction alters intracellular pathways that, in-turn, prevent cytotoxicity. The NK cell licensing model was initially described by the Yokoyama group, who noticed the differential killing capacity and IFNγ production between WT and β2m-KO upon NK1.1 cross-linking 91. Focusing on Ly49A and Ly49C, due to readily available Ab‟s and extended research, they found that in order for NK cells to develop functionally (i.e. be able to lyse targets and produce interferon), these must interact with specific host MHC I molecules via their inhibitory Ly49 receptors. Furthermore, they found that licensing is mediated through the Ly49 ITIM. Gene transfer experiments revealed intact Ly49A, but not cytoplasmicdomain deleted Ly49A, renders NK cells functional upon ligand binding. However, this is different from ITIM-mediated inhibitory signalling, because licensing is observed in SHP-1 deficient NK cells 91. If ITIM-mediated NK cell licensing does not require SHP-1, it potentially involves other phosphatases (e.g. SHIP). The Yokoyama group chose the term „licensing‟ as opposed to „education‟ in order to avoid confusion with events occurring during T-cell development. Another group led by D. Raulet has described a subset of NK cells that do not express MHC I-specific receptors 93. These represent about 10 to 13 percent of NK cells in normal B6 mice, and lack expression of Ly49A, Ly49C, or NKG2A receptors altogether. Similar to NK cells from β2m-KO mice, this newly described subset exhibits diminished levels of cytotoxicity toward prototypic targets (e.g. YAC-1), and reduced IFN-γ production in response to crosslinking of stimulatory receptors 93. This reinforces the idea that MHC I-Ly49 interaction is necessary for NK functional maturation and acquisition of effector functions. 17  The next question addressed by both the Yokoyama and Raulet groups inquired whether licensing is a reversible process and whether responsiveness of an NK cell be altered according to its environment. Alternatively, they asked whether licensing is set once during development and remains unchanged throughout NK adult-hood, irrespective of surroundings. To test this, peripheral NK cells from MHC I deficient mice were transferred into WT MHC I competent hosts. A gain of function was observed as they began to produce IFNγ and degranulate at similar levels as WT NK cells in response to the standard NK cell target YAC-1. Plus, affirmative of the licensing hypothesis, only the cells expressing Ly49C could gain function after being transferred into hosts expressing specific MHC I ligand for Ly49C, while Ly49C negative cells remained unlicensed 94. Hence, licensing is not solely restricted to NK cell development in the BM. Similar results were observed by the Raulet group, who additionally reported that hyporesponsive cells did not divide post transfer, indicative of their initial mature state 95. In a similar manner, when WT NK cells were introduced into MHC I deficient hosts, they lost their capacity to produce IFNγ in response to NKG2D and NK1.1 stimulation, and were not able to reject mismatched grafts 95. It is important to note that licensing does not apply to cultured NK cells, as stimulation with potent cytokines (e.g. interleukin-2) over time reverses their hyposensitive state and renders them cytotoxic 93, 96. Moreover, contrary to aforementioned studies describing the functional impairment of NK cells from MHC I deficient mice, a group led by L. Lanier showed that “unlicensed” NK cells from β2m-KO mice are the primary fighters against MCMV infection in vivo 78. Their depletion makes mice susceptible to MCMV, whereas transfer of unlicensed NK cells into WT hosts is more protective than transfer of licensed NK cells into β2m-KO hosts 78. Nonetheless, MCMV studies might be looking at a completely distinct phenomenon,  18  as cytotoxicity against this virus is mediated by Ly49H, which is present in β2m-KO mice 97. Lanier‟s study also showed that SHP-1 signalling limited proliferation of licensed, but not unlicensed NK cells during infection 78, confirming the idea that ITIM-mediated NK cell licensing relies on a different phosphatase. The precise mechanism by which the interaction between MHC I and inhibitory Ly49 mediates licensing of NK cells remains a major question to be resolved in the field of NK cell biology.  1.6  Thesis objectives and hypothesis  The goal of my MSc project was to determine the mechanism through which NK cells of MHC I deficient mice are kept hyporesponsive to otherwise NK-sensitive targets. The objective of this thesis was to elucidate the major molecules involved in inhibiting NKG2D mediated cytotoxicity in β2m-KO NK cells. I hypothesized that in licensed NK cells, the binding of MHC I to inhibitory Ly49C/I receptor causes phosphorylation of its ITIM and recruitment of SHIP. This prevents SHIP from localizing to the NKG2D-mediated stimulatory synapse, allowing cytotoxicity. In unlicensed NK cells, Ly49 ITIM does not associate with SHIP and SHIP localizes to the NKG2D-mediated stimulatory synapse, where it inhibits cytotoxicity. I tested this hypothesis in Chapter 3 by comparing unlicensed NK cells from β2m-KO mice with wild type (WT) B6 mouse NK cells.  19  Chapter 2: Materials and Methods  2.1  Tissue culture  2.1.1. Mice C57BL/6 (B6) mice and 2microglobulin (2m)-deficient B6.129P2-B2mtm1Unc/J mice (2m-KO mice hereafter) were obtained from Jackson Laboratories (Bar Harbor, ME) and bred in the Animal Resource Centre (ARC) of the BC Cancer Research Centre (BCCRC). WT and SHIP-deficient BALB/c mice were generously donated by Gerry Krystal‟s laboratory (Vancouver, Canada) 98.  2.1.2. Murine splenocyte preparation Splenocytes were isolated from two to six month old mice. Single cell suspensions were generated by grinding spleens with the blunt end of a 3ml syringe and passing them through a 70 µm strainer onto a 10 cm Petri dish (BD Falcon). Cells were washed with RPMI 1640 media supplemented with 10% fetal calf serum (FCS), penicillin, streptomycin, 5 x 10-5 M βmercaptoethanol (StemCell Technologies), resuspended in 0.8% ammonium chloride (StemCell Technologies) to lyse red blood cells, washed again and resuspended in media. Red blood cells were not lysed for NK cell enrichment.  2.1.3. Generation of poly I:C primed ex-vivo NK cells One to three B6 and/or β2m-KO mice were subcutaneously injected with 200 µl of 1 mg/ml Polyinosinic-polycytodylic acid (poly I:C) (Sigma-Aldrich, St.Louis, MO). 24 hours post-  20  injection, splenocytes were extracted as described in 2.1.2., and NK cells isolated using EasySep® NK cell negative selection kit (StemCell Technologies).  2.1.4. YAC-1 culture Murine lymphoid cell line YAC-1, originally from American Type Culture Collection (ATCC, Rockland, MD) was cultured in RPMI 1640 media supplemented with 10% FCS, penicillin, streptomycin, 5 x 10-5 M β-mercaptoethanol (StemCell Technologies).  2.2. Antibodies and commercial reagents 2.2.1. Primary antibodies Table 2.2.1. Antibody/ Probe β tubulin CD3  Primary antibodies Clone  Species  Monoclona Conjugate l/Polyclonal monoclonal purified monoclonal PE  Company/ cat # CH 3408 BD 553063  Use/ Dilution C 1:50 F 0.1 µg/ml  monoclonal  PE  BD 558754  F 0.1 µg/ml  polyclonal monoclonal monoclonal monoclonal  purified FITC FITC hyb sup  Granzyme B Granzyme B IgG2a FcR  KMX-1 Ms 145ar hm 2C11 LG.3A ar hm 10 Rb 16G6 Rat R19-15 Rat 2.4G2 Rat  Ly49C/I  5E6  monoclonal  FITC  AB 4059 B 11-8822-80 BD 553390 ATCC HB197 BD 553276  Ly49C/I LFA-1 Mac1 (CD11b) NK1.1 NKp46 Phalloidin Phalloidin SHIP  5E6 TIB213 TIB128  monoclonal monoclonal monoclonal  purified purified FITC  PM 01621D ATCC ATCC  C 1:50 F 0.1 µg/ml F 0.1 µg/ml F 100 µl per 4 x 106 cells C, F 0.1 µg/ml C 0.2 µg/ml C 1: 50 F 0.1 µg/ml  monoclonal monoclonal ----------monoclonal  PerCP APC Alexa 647 rhodamine purified  BD BL 137608 MP A-22287 MP R415 SC-8425  F 0.1 µg/ml F 0.1 µg/ml C 1:50 C 1:100 C 1:30  CD27  Ms 29A1.4 ----------P1C1  ----------Ms  21  Antibody/ Probe SHP-1 Talin 7AAD  Clone  Species Rb  Monoclona Conjugate l/Polyclonal polyclonal purified  Company/ cat # AB 51171  Use/ Dilution C 1:100  Phosph oY536 8D4 -  Ms -  monoclonal -  S 3287 S 9400  C 1:100 F 1:1000  purified fluorescent DNA dye  Legend: SG Stressgen; SC Santa Cruz; AB Abcam; CH Chemicon; UP Upstate; S Sigma; B eBioscience; ML Millipore; BD BD Bioscience; MP Invitrogen Molecular Probes; ATCC American Tissue Culture Collection; BL BioLegend; ms mouse; gt goat; rb rabbit; ar hm Armenian hamster. C confocal; W western blotting; F FACS; cytotoxicity assay; Ad adhesion assay; FITC fluorescein isothiocyanate; PE phycoerythrin; APC allophycocyanin  2.2.2. Secondary antibodies Table 2.2.2.  Secondary antibodies  Antibody mouse IgG mouse IgG goat IgG goat IgG goat IgG rabbit IgG rabbit IgG rabbit IgG mouse IgG mouse IgG  Animal donkey goat donkey rabbit donkey goat donkey donkey donkey  Conjugate Alexa Fluor 488 Alexa Fluor 568 Alexa Fluor 488 Alexa Fluor 488 Alexa Fluor 568 Alexa Flour 488 Alexa Fluor 488 Alexa Fluor 647 Streptavidin 488 Alexa Fluor 647  company/cat# MP A21202 MP A11031 MP A11055 MP A11078 MP A11057 MP A11008 MP A21206 MP A31573 MP S-32354 MP A31571  use/dil’n C 10 µg/ml C 10 µg/ml C 10 µg/ml C 10 µg/ml C 10 µg/ml C 10 µg/ml C 10 µg/ml C 10 µg/ml C 10 µg/ml C 10 µg/ml  Legend: MP Invitrogen Molecular Probes; C confocal.  2.2.3. Reagents Murine soluble recombinant ICAM-1 (sICAM-1) 99 was from StemCell Technologies (Vancouver BC, Canada). Calcein-AM and carboxy-fluorescein diacetate succinimidyl ester (CF-DA SE) were from Invitrogen Molecular Probes (Eugene, OR). Polybead® polystyrene 10 micron microspheres were from Polysciences (Warrington, PA). Bovine serum albumin  22  (BSA), saponin, polyinosinic-polycytodylic acid (poly I:C), and poly-L-lysine (PLL) were from Sigma-Aldrich (St.Louis, MO). BD Cytofix/Cytoperm™ Fixation/Permeabilization Solution Kit with BD GolgiPlug™ was from BD Biosciences.  2.3. CD48 and H60-Fc fusion proteins CD48-Fc fusion protein was prepared by Boxiang Jiang of our laboratory. CD48 cDNA was cloned by RT-PCR from YAC-1 cells using forward primer 5‟ACGAATTCAGTATTATGTGCTTCATAAAACAGGGATG 3‟ and reverse primer 5‟ACGGATCCACTTACCTGTAGATCTGGCTAGATCACAAGGTAGAG 3‟, subcloned into pBluescript and sequenced. The cDNA encoding the extracellular domain of CD48 was PCR-amplified, sequenced and subcloned into pIG vector  10  . The CD48-Fc/pIG construct  was then transfected into 293T cell line and the fusion protein secreted into the media was purified by protein A affinity chromatography. The purified protein was analyzed and quantified by Western Blot and Coomassie Blue staining. H60 cDNA was cloned by Ryan Russell by RT-PCR from BALB/c mouse splenocytes, subcloned into pBluescript and sequenced. The cDNA encoding the extracellular domain of H60 was PCR-amplified, sequenced and subcloned into the pIG vector. H60-Fc fusion protein was produced and purified as described for CD48-Fc fusion protein.  2.4. ICAM-1 adhesion assay Splenocytes were isolated from poly I:C injected B6 and β2m-KO mice, and NK cells generated using EasySep® NK cell negative selection kit (StemCell Technologies). Cells were resuspended in Hank‟s balanced salt solution (HBSS) at a concentration of 106/ml and  23  labelled with 1 µg/ml Calcein-AM for 30 minutes at 37°. Cells were washed twice with HBSS 2% FCS, resuspended at 106/ml in 500 µl volumes, and aliquoted into 3 Eppendorf tubes. For specificity control, NK cells in one of the tubes were incubated with 1.5 µg/ml of anti-LFA1 antibody (TIB213) for 10 minutes at 37°. Meanwhile, a flat-bottomed 96 well immunoassay plate (NUNC Maxisorp) was coated with soluble sICAM-1 (10 µg/ml in 0.1 M sodium bicarbonate buffer pH 8.0) for 60 minutes at room temperature. An extra set of control wells was left uncoated with sICAM-1. The plate was washed three times with phosphate buffered saline (PBS) and blocked with 0.5 mg/ml heat inactivated bovine serum albumin (BSA) for 30 minutes at room temperature. Following blocking, the plate was washed 3 times with PBS and cells were distributed onto the plate at a concentration of 105/100 µl per well. The initial fluorescence intensity was read by CytoFluor 2300 (Millipore, Bedford, MA). Plates were washed five times with 100 µl pre-warmed HBSS 2% FCS to remove non-adherent cells, and fluorescence intensity was read again to assess percent adhesion of NK cells bound to sICAM-1 coated wells, and that of specificity controls, cells plated on wells coated with 0.5 mg/ml BSA, or cells pre-incubated with antiLFA-1. The percent adhesion was calculated as the ratio of the post-wash to pre-wash fluorescence values, minus background fluorescence values.  2.5. Confocal microscopy 2.5.1. Binding of NK cells to beads Polystyrene beads (Polybead® polystyrene 10 micron microspheres, Polysciences Inc., Warrington, PA) were mixed at 1:1 ratio with 20 µg/ml of recombinant sICAM-1, H60-Fc, CD48-Fc, or 0.005% poly-L-lysine (PLL), diluted in Adhesion Buffer (20 mM Tris-HCl, 150  24  mM NaCl, pH 8.2). The mixture was incubated for 1 hr at room temperature, with occasional agitation to prevent settling. Beads were washed 3 times with 100 µl RPMI 10% FCS media and resuspended in 150 µl media. Coverslips were soaked in PLL (Sigma-Aldrich, St.Louis, MO) over-night on a 10 cm Petri dish, washed three times with PBS and left to dry against the side of the dish. Poly I:C primed ex-vivo NK cells were generated (2.1.3.) and resuspended in the same media as beads at 1.25 × 106/ml. Cells (2.5 × 105 in 200 µl) were gently mixed with 25 µl (105) beads in an Eppendorf tube and incubated at 37º for 5 minutes. Dry PLL coated coverslips were placed into a 12 well plate. Cell-bead conjugates were gently resuspended by flicking the tubes, carefully pipetted onto the coverslips, and incubated at 37º for 15 minutes. Coverslips were fixed with 4% formaldehyde, and samples were permeabilized with Hank‟s Saponin solution (HBSS containing 2% FBS, 5 mM Ethylenediaminetetraacetate (EDTA), 0.5% Saponin).  2.5.2. Binding of NK cells to YAC-1 YAC-1 were cultured in RPMI 1640 media supplemented with 10% FCS, 5 × 10-5 M mercaptoethanol and penicillin/streptomycin, at 37° for at least five days prior to use. Cells were washed with the same media and resuspended at 107/ml. Coverslips were soaked in PLL (Sigma-Aldrich, St.Louis, MO) over-night on a 10 cm Petri dish, washed three times with PBS and left to dry against the side of the dish. Poly I:C primed ex-vivo NK cells were generated (2.1.3.) and resuspended in RPMI 1640 10% FCS at 107/ml. NK cells (106 in 100 µl) were gently mixed with YAC-1 (106 in 100 µl) in an Eppendorf tube and incubated at 37º for 5 minutes. Dry PLL coated coverslips were placed into a 12 well plate. NK-YAC-1 conjugates were gently resuspended by flicking the tubes, carefully pipetted onto the  25  coverslips, and incubated at 37º for an additional 15 minutes. Cells on coverslips were fixed with 4% formaldehyde, and samples were permeabilized with Hank‟s saponin solution (HBSS, 2% FCS, 5 mM EDTA 0.5% saponin).  2.5.3. Staining for confocal microscopy Actin, Talin, Granzyme B, β-tubulin, SHIP, and SHP1 were stained by incubating cover slips with the appropriate dilution of primary antibody in 300 µl HBSS-Saponin buffer on a slow shake for 1 h, at room temperature. Coverslips were washed 3 times with the same buffer, and incubated with the corresponding Alexa Fluor conjugated secondary antibody at 10 μg/ml for 1 h at room temperature. Finally, the slips were washed twice with HBSS and mounted on slides using Vectashield Hard Set Antifade Mounting Medium (Vector Laboratories, Inc., Burlingame, CA).  2.5.4. Acquisition and analysis of confocal images Cells, cell-bead, or NK-YAC-1 conjugates were analyzed using a Nikon C1-si confocal microscope with a 100× objective lens, zoom 4 (BC Cancer Agency, Vancouver). To avoid bleed-through, images were collected using sequential scanning. Alexa Fluor 488 was excited at 488 nm and the emission filter was HQ 515/30. Alexa Fluor 568 and rhodamine were excited at 568 nm and the emission filter was HQ 600/50. Z-stacks were collected using 0.30 μm Z steps and reconstructed into 3D images using Volocity software (Improvision, Lexington, MA). For quantification of fluorescence intensity at the site of binding, the sum intensity in the channel of interest was determined using Volocity software for the area of contact between a cell and a target bead or YAC-1, and compared to the sum fluorescent  26  intensity of the whole same cell. For quantification of co-localization between Ly49C/I and SHIP or SHP-1, the overlap coefficient (R) values out of 1.00 were computed by Volocity software. All values were exported to Microsoft Excel or GraphPad software for statistic analysis. Averages, standard deviation and T-test values were calculated.  2.6. Ly-49 cross-linking experiments 2.6.1. Induction of Ly49 capping Splenocytes were harvested from B6 and β2m-KO mice previously injected with poly I:C, and NK cells were isolated using EasySep® NK cell negative selection kit (StemCell Technologies). Cells were resuspended in cold HBSS with 2% FCS and aliquoted in equal amounts into three 5 ml polystyrene tubes. After spinning and discarding the supernatant, cells remained in 100 µl volume and were incubated with 20 µg/ml of anti-Ly49C/I Ab (5E6) at 4°C for 30 minutes. NK cells were then transferred to the cold room and washed twice with cold PBS 2% FCS. To induce capping, cells were incubated with AlexaFluor-568 conjugated antimouse IgG at 37°C for 30 minutes, whilst un-capped controls were kept at 4°C. Cells underwent two final washes with PBS 2% FCS.  2.6.2. Confocal analysis of SHIP or SHP-1 localization with cross-linked Ly49C/I Once cross-linked with anti-Ly49C/I antibody (2.6.1.), NK cells were transferred onto PLLcoated coverslips (2.5.1.) and incubated at 37ºC for 5 minutes to allow binding. Cells were fixed with 4% formaldehyde for 15 minutes on ice, washed twice in PBS 2% FCS and permeabilized with HBSS saponin solution for 5 minutes at room temperature. Biotinylated  27  anti-SHIP antibody was added at a 1:30 dilution or anti-SHP-1 was added at a 1:100 dilution with slow shaking for one hour at room temperature. Following washing, Alexa Fluor-488 conjugated donkey anti-mouse or anti-rabbit antibody was added for detection of SHIP and SHP-1, respectively. Cells were further analyzed by confocal microscopy and Volocity software, as described in 2.5.4.  2.7. Cytotoxicity assays YAC-1 cells were harvested, resuspended at 2 × 106/ml in PBS containing 1 µM carboxyfluorescein diacetate succinimidyl ester (CFSE) (Invitrogen Molecular Probes), and incubated for 15 minutes at 37°C. Cells were washed thrice with RPMI 1640 media supplemented with 15% FCS, and resuspended at 105/ml cells in regular RPMI 1640 media (10% FCS). Poly I:C activated ex-vivo NK cells were isolated as described in 2.1.3. and resuspended in the same media as targets. CFSE labelled YAC-1 (104) cells were mixed at varying ratios with NK cells in a 96 well round-bottomed tissue culture plate. After 4 h, cells were washed and resuspended in 300 µl of 1 mg/ml 7-amino-actinomycin D (7AAD), and analyzed by flow cytometry. The level of cytotoxicity was determined as the percentage of CFSE+ 7AAD+ cells out of all CFSE+ cells, minus the percent spontaneous release (CFSE+ 7AAD+ target cells incubated without effectors).  2.8. Flow cytometry Single cell suspension of splenocytes were prepared (2.1.2.), counted, and Fc receptors were blocked for 10 minutes on ice with 100 µl 2.4G2 hybridoma supernatant per 4 × 106 cells. Cells were washed once and resuspended in 50-100 µl of PBS 2% FCS. Antibody was added  28  at appropriate concentrations and cells were incubated for 30 minutes at 4°. Cells were washed twice with PBS 2% FCS and, where required, secondary antibody was added and cells were incubated for another 30 minutes at 4°. Following two PBS 2% FCS washes, cells were resuspended in PBS 2% FCS containing 5 µg/ml propidium iodide and analyzed by flow cytometry using FACSCalibur (BD). Results were further interpreted on CellQuest Pro and FlowJo software. For intracellular staining with granzyme B and granzyme B isotype control antibody, cells were first fixed and permeabilized using Cytofix/CytopermTM Plus kit (BD Biosciences). Antibodies were added to cells and incubated for 30 minutes at 4°C. Cells were washed twice and resuspended in PBS, 2% FCS prior to flow cytometric analysis.  29  Chapter 3: Results  3.1.  Unlicensed β2m-KO NK cells do not kill the prototypic target YAC-1  The first essential experiment to be performed was to assess whether unlicensed NK cells of β2m-KO mice are indeed non-cytotoxic. Thus, we carried out a series of cytotoxicity assays with varying effector to target ratios, using the standard NK cell target YAC-1. NK cells isolated from un-primed WT and β2m-KO mice did not kill YAC-1 cells (data not shown). Therefore, the mice were injected with poly I:C prior to NK cell isolation and cytotoxicity assays. As expected, while WT NK cells efficiently killed YAC-1 in a proportional effector to target manner, β2m-KO NK cells had very low cytotoxicity against YAC-1. The minimal level of cytotoxicity observed for unlicensed NK cells (triangles) in Figure 3.1. may be due to the fact that β2m-KO mice express a low level of MHC I, which might have allowed for the licensing (and hence, cytotoxicity) of a small portion of NK cells.  Figure 3.1 β2m-KO NK cells do not kill the prototypic NK target YAC-1. Cytotoxicity against YAC-1 target cells was analyzed by FACS. YAC-1 targets were labeled with CFDASE and incubated for 4 hours with WT (square) or β2m-KO (triangle) NK cells. Following incubation, cells were washed and analyzed by flow cytometry as described in Materials and Methods. Results are representative of at least 3 independent experiments, each done in triplicate. Error bars indicate ± SD.  30  3.2.  Unlicensed NK cells from poly I:C primed β2m-KO mice contain similar amounts of Granzyme B as WT NK cells  In order to verify that unlicensed NK cells actually do have killing potential, we decided to confirm the presence of cytotoxic granules – essential components of NK cell cytotoxicity 22. Hence, we performed intracellular staining for granzyme B, which is contained in cytotoxic granules, in NK cells isolated from poly I:C primed β2m-KO mice, and compared it to the Granzyme B content in WT NK cells. An isotype control antibody was used as negative control in both cases. It was found that unlicensed NK cells contain comparable amounts of Granzyme B to licensed NK cells (Fig.3.2). This finding implies that they have potential for  control  NK1.1-PerCP  Granzyme B isotype  Fluorescence Intensity  cytotoxicity.  Granzyme B-FITC  0.0%  Granzyme B-FITC  31  NK1.1-PerCP  B6  Fluorescence Intensity  37% ± 4%  NK1.1-PerCP  β2m-KO  GranzymeB-FITC  Fluorescence Intensity  GranzymeB-FITC  Granzyme B-FITC  39% ± 2%  Granzyme B-FITC  Figure 3.2 β2m-KO NK cells from poly I:C primed mice contain granzyme B amounts comparable with WT NK cells. Freshly isolated WT and β2m-KO NK cells were analyzed by FACS for the presence of granzyme B. Compared to isotype control, each histogram represents mean percentage (± SD) of NK cells positive for granzyme B from three independent experiments.  3.3.  LFA-1 mediated adhesion is intact in unlicensed NK cells of β2m-KO mice  Having confirmed the lack of cytotoxicity in β2m-KO NK cells, we proceeded with a stepby-step comparison between unlicensed and licensed NK cells to deduce the step defective in unlicensed NK cells of β2m-KO mice. The first step in NK cell cytotoxicity is adhesion to 32  target cells. This is thought to be primarily mediated by the integrin LFA-1 on NK cells and ICAM-1 on target cells 11, 13. Therefore, β2m-KO and WT NK cells were tested for their ability to adhere to purified immobilized sICAM-1 (2.4). Both WT and β2m-KO NK cells bound to ICAM-1 coated flat plastic surface to comparable levels, and neither bound to surfaces not coated with ICAM-1 (Fig.3.3). Further, binding of WT and β2m-KO NK cells to ICAM-1 coated wells was reduced if LFA-1 was blocked with anti-LFA-1 antibody (Fig.3.3). These results suggest that the LFA-1:ICAM-1 interaction is intact in unlicensed NK cells, and would therefore allow for efficient adhesion to targets.  IC-1  BSA β2m-KO  Anti-LFA1  IC-1  BSA  Anti-LFA1  B6  Figure 3.3 β2m-KO NK cells from poly-IC primed mice adhere to purified and immobilized ICAM-1 at similar levels as WT NK cells. NK cells purified from poly I:C injected mice were stained with Calcein-AM, and allowed to bind to 96 well plates coated with recombinant ICAM-1 or BSA control. In some wells, anti-LFA1 blocking antibody was added. Initial fluorescence was read by cytofluor, then the plate was washed to remove nonadherent cells. Remaining fluorescence was read and cell adhesion calculated as a ratio of remaining to initial fluorescence. The results depict one of three experiments performed in triplicate and show the mean values ± SD. 33  3.4.  The LFA-1/ICAM-1 interaction induces efficient polarization of talin and actin in β2m-KO NK cells  The second step of NK cell cytotoxicity involves polarization of talin and actin cytoskeleton towards the contact site between an NK cell and its target. Previous studies in our laboratory have shown that ICAM-1 binding to LFA-1 induces talin-dependent intracellular signalling events that lead to actin polymerization at the site of LFA-1 ligation 11. For this study, I used a model system devised in our laboratory, in which cell-size (10 µm diameter) polystyrene beads coated with ligand(s) of choice were used in place of target cells. This allowed for visualization of signalling events generated by individual receptor-ligand interactions. I incubated poly I:C-primed WT and β2m-KO NK cells with plastic beads coated with ICAM1 and examined the distribution of F-actin and talin in NK cells by confocal microscopy. Twenty images per condition were collected from one experiment, using the same instrument settings. In all of the collected WT and β2m-KO NK cells, actin and talin accumulated at the site of contact between the cell and ICAM-1-coated bead (Fig.3.4A.) Quantitative analysis of 5 WT and 8 β2m-KO confocal images confirmed that binding of LFA-1 to ICAM-1 resulted in significant localization of actin and talin in WT as well as in β2m-KO NK cells (Fig 3.4B.) These results indicate that the LFA-1:ICAM-1 interaction induces the polarization of actin and talin to the contact site in both WT and β2m-KO NK cells to the same level.  34  A DIC  Talin  Actin  Merge  B6  β2m-KO  Fraction of total fluorescence at the contact site  B  n=5  n=6  n=9  n=6  n=6  n=6  n=8  n=6  Figure 3.4 WT and β2m-KO NK cells efficiently polarize their actin and talin n=8 n=8 n=8 beads coated cytoskeleton once bound to polystyrene withn=8LFA-1 ligand ICAM-1. To n=7 n=7 incubated n=7 with 10 m polystyrene allow binding, poly I:C primed ex-vivo n=7 NK cells were beads previously coated with recombinant soluble ICAM-1, at 37C for 20 minutes. The formed conjugates were fixed, permeabilized, stained for actin and talin, and analyzed by confocal microscopy. The above images depict mid sections of cell-bead complexes. Confocal images from (A) were further quantified for the distribution of actin and talin (B) using Volocity software (Improvision). The ratio of the contact intensity over non-contact  35  site intensity was calculated for n=5 to n=9 cells per condition and results represented as means ± SD.  3.5.  Polarization of lytic granules is defective in unlicensed NK cells bound to YAC-1  To assess the subsequent step in NK cell cytotoxicity, namely polarization of lytic granules towards the contact site between an NK cell and its target, we decided to use the prototypic NK target YAC-1. Freshly isolated NK cells from poly I:C injected WT and β2m-KO mice were incubated with YAC-1 to allow binding. Following incubation, the formed conjugates were analyzed by confocal microscopy for localization of F-actin and granzyme B. WT NK cells bound to YAC-1 and polarized both actin and granzyme B towards the target (Fig.3.5), whereas unlicensed NK cells could only polarize actin but not granzyme B (Fig.3.5). This experiment was conducted three times with consistent results. Analysis of 18 B6 and 20 β2m-KO images using Volocity software further confirmed our observations. These results suggest that the polarization of lytic granules, an essential step for NK cell mediated cytotoxicity, is defective in unlicensed NK cells of β2m-KO mice.  36  A Actin  GranzymeB  DIC  B6  β2m-KO  Actin  B  37  C  Granzyme B  *  Figure 3.5 Actin polarizes but lytic granules do not polarize in β2m-KO NK cells bound to YAC-1 targets. To allow binding, poly I:C activated ex-vivo NK cells were incubated with YAC-1 at 37C for 20 minutes. The formed conjugates were fixed, permeabilized, stained for actin and granzyme B, and analyzed by confocal microscopy. The images in (A) depict mid sections of NK-YAC-1 complexes, which were further quantified for the distribution of actin (B) and granzyme B (C) using Volocity software (Improvision). The ratio of the contact intensity over non-contact site intensity was calculated for n=18 to n=20 cells per condition and results represent exact values for each n. * indicates p= 3.37x10-6  3.6.  Unlicensed NK cells fail to polarize granzymes towards beads coated with ICAM-1, and the NKG2D ligand H60  To confirm the results obtained in the previous experiment, we made use of the bead-target system once again. Ex-vivo NK cells from poly I:C injected B6 and β2m-KO mice were allowed to bind beads coated with ICAM-1 + H60. Beads coated with PLL, which efficiently bound to cells but did not ligate specific receptors, were used as negative control. Confocal analysis revealed that WT NK cells efficiently polarize their actin cytoskeleton and lytic granules to the contact site between cells and beads coated with ICAM-1 + H60 (Fig.3.6A). β2m-KO NK cells fail to polarize lytic granules, although they efficiently re-  38  distribute their actin cytoskeleton towards the bead (Fig. 3.6A). Neither WT nor KO NK cells redistributed actin or granzyme B, when bound to control beads coated with PLL (Fig. 3.6A). To quantify the level of protein accumulation observed with confocal microscopy, we measured the fluorescence density at the point of contact between the cell and the bead, and compared it to the fluorescence density of the rest of the cell. We analyzed 16 to 20 cells per condition from one experiment, using the same instrument settings (Fig. 3.6B). These results confirmed our previous finding that unlicensed NK cells fail to polarize lytic granules towards their targets.  A  Granzyme B  Actin  DIC  B6  β2m-KO  PLL Control (B6)  39  B  B6 test  β2m-KO test  B6 control  β2m-KO control  Figure 3.6 Actin polarizes but lytic granules do not polarize in β2m-KO NK cells bound to beads coated with ICAM-1 and NKG2D ligand H60. To allow binding, poly I:C primed ex-vivo NK cells were incubated with 10 m polystyrene beads previously coated with ICAM-1 and H60, or with poly-L-lysine for 20 minutes at 37C. The formed conjugates were fixed, permeabilized, stained for GranzymeB, and analyzed by confocal microscopy. The images in (A) depict mid sections of cell-bead complexes, which were further quantified for the distribution of granzyme B (B) using Volocity software. The ratio of the contact intensity over non-contact site intensity was calculated for n=20 cells per condition and results represent exact values for each n. * indicates p= 1.17 x 10-5  3.7  Unlicensed NK cells fail to polarize granzymes towards beads coated with ICAM-1, NKG2D ligand H60, and additional stimulatory ligand CD48  Findings from the previous experiment (3.6.) indicate that NKG2D ligation, combined with LFA-1 ligation, induces lytic granule polarization in licensed, but not in unlicensed NK cells. However, this does not entirely explain why unlicensed NK cells do not kill YAC-1, as we have shown in 3.5. It is known that NKG2D has moderate effect on its own to fully activate NK cytotoxicity 22, and co-stimulation by additional signals is likely required for YAC-1 killing. The most probable receptor that may cooperate with NKG2D is 2B4, which interacts with CD48 ligands 23. Therefore, we carried out the same confocal experiment as in 3.6, 40  using ICAM-1, H60, and CD48 coated beads as targets. Quantification of confocal microscopy (Fig.3.7.) revealed that unlicensed NK cells are still impaired in polarizing lytic granules in the presence of NKG2D and additional 2B4 co-stimulatory signaling. *  Figure 3.7 In the presence of additional stimulation from CD48, ligand for 2B4 stimulatory receptor on NK cells, unlicensed NK cells are still deficient in granule polarization. The experiment described in Figure 3.6 was repeated with target beads coated with ICAM-1, H60, and additional stimulatory CD48 ligands. The above graph shows quantification of granzyme B distribution, analyzed by Volocity. The ratio of the fluorescence intensity at the contact site over that at non-contact site was calculated (16 to 20 cells per condition) and results represent exact values for each n. * indicates p= 1.8 x 10-3  3.8.  Ab mediated cross-linking of inhibitory Ly49C/I receptors induces recruitment of SHIP rather than SHP-1 phosphatase in both licensed and unlicensed NK cells  The above results show that NKG2D signalling and NKG2D, together with 2B4 activation, signals leading to lytic granule polarization are impaired in unlicensed NK cells. SHIP and SHP-1 are two well characterized negative regulators of cell signaling known to interact with the ITIMs of Ly49 inhibitory receptors on NK cells 1. We decided to test if either SHP-1 or 41  SHIP were involved in inhibiting NK cell mediated cytotoxicity. First, we set out to decipher where these phosphatases localize once Ly49C/I interacts with its ligand, mimicking the Ly49C/I-MHC-I interaction key to NK cell licensing. Hence, we performed a co-capping experiment. Poly I:C primed NK cells were isolated from B6 and β2m-KO mice, and capping of Ly49C/I inhibitory receptors was induced by cross-linking them with anti-Ly49C/I mAb (5E6), followed by incubation with secondary AlexaFluor conjugated antibody at 37ºC. Uncapped controls were incubated with secondary antibody at 4ºC. The cells were fixed, permeabilized, stained for SHP-1 and SHIP, and analyzed by confocal microscopy. Antibody cross-linking induced strong colocalization between Ly49C/I and SHIP in both licensed and unlicensed NK cells (Fig. 3.8A). Not much colocalization was seen with SHP-1 and Ly49C/I in either cell type (Fig.3.8B). These observations were consistent throughout three trials of this experiment. Twenty cells were collected from one trial and analyzed using the same instrument settings. To quantify the level of colocalization between proteins, we used the overlap coefficient function of Volocity software, which produces an overlap value out of 1.00 (Fig.3.8C). Results suggest that SHIP, rather than SHP-1 phosphatase, colocalizes with Ab cross-linked Ly49C/I receptors of both licensed and unlicensed NK cells. A  42  B  C  Figure 3.8 In B6 and β2m-KO NK cells from poly I:C primed mice, Ab mediated crosslinking of inhibitory Ly49C/I receptors induces recruitment of SHIP rather than SHP-1 phosphatase. Poly I:C primed ex-vivo NK cells were incubated at 37ºC with anti-Ly49C/I to induce capping. Cells were further fixed, permeabilized, stained for SHIP (A) or SHP-1 (B), and analyzed by confocal microscopy. Fluorescence was quantified using Volocity and overlap coefficients (i.e. colocalization) were deduced for Ly49C/I and SHIP or SHP-1, respectively (C). Results are representative of mean coefficient overlap values ± SD, for 20 cells per condition.  43  To determine the localization of SHIP in WT and β2m-KO NK cells without Ly49C/I crosslinking, Ly49C/I capping was prevented by incubating cells at 4ºC with secondary AlexaFluor568 conjugated anti-mouse IgG, as oppose to incubating at 37ºC. In WT NK cells, SHIP still colocalized with Ly49C/I (Fig.3.9A). However, in β2m-KO NK cells there was no sign of such colocalization (Fig.3.9A). Quantification of confocal microscopy further confirmed this observation (Fig.3.9B). The results suggest that the interaction between Ly49C/I and SHIP preexists prior to Ly49C/I cross-linking in WT NK cells, whereas in unlicensed NK cells of β2mKO mice this interaction is only induced post Ly49C/I capping presumably because it mimics ligation of Ly49C/I by MHC I.  A  DIC  Ly49C/I  SHIP  Merge  B6  B6  β2m- KO  44  B  *  Figure 3.9 Uncapped Ly49C/I colocalizes with SHIP in WT, but not in β2m-KO NK cells. Poly I:C primed ex-vivo NK cells were incubated at 4ºC with anti-Ly49C/I and at 4ºC with secondary AlexaFluor-568 conjugated anti-mouse IgG to prevent capping, as controls. Cells were fixed, permeabilized, stained for SHIP, and analyzed by confocal microscopy (A). Fluorescence was quantified using Volocity, and overlap coefficients (i.e. colocalization) between Ly49C/I and SHIP were deduced for capped and uncapped specimens (B). Results represent overlap coefficient for each cell (n) ranging from n=18 to n=20 per condition. * indicates p= 1.46 x 10-7  3.9.  SHIP localizes to the contact site of unlicensed NK cells bound to YAC-1 targets  In order to visualize the distribution of Ly49C/I and SHIP in a real NK cell-target scenario, we incubated NK cells from poly I:C injected WT or β2m-KO mice with YAC-1 cells. Following incubation, the formed conjugates were fixed, permeabilized, stained, and analyzed by confocal microscopy for the localization of SHIP and Ly49C/I. We observed that in WT NK cells adhered to YAC-1 targets, SHIP localized away from the contact area between the NK cell and YAC-1 (Fig.3.10A).  45  In contrast, in β2m-KO NK cells, SHIP accumulated directly at the immunological synapse (Fig.3.10A). To quantify the level of protein accumulation detected by confocal microscopy, we calculated the ratio of SHIP fluorescence density at the contact site as compared to the fluorescence density in the remainder of the cell. This ratio was calculated for 30 licensed and 40 unlicensed NK cells (Fig.3.10B), and quantitative results emphasize the fact that SHIP is more abundant at the contact site of unlicensed NK cells, but not of licensed NK cells bound to YAC-1 targets. We further analyzed confocal images and quantified colocalization between Ly49C/I and SHIP in licensed versus unlicensed NK cells bound to YAC-1 targets. Overlap coefficients (R), as computed by Volocity software, revealed similar levels of overlap between Ly49C/I and SHIP in WT and β2m-KO NK cells (Fig.3.10C).  A Ly49C/I  SHIP  Merge  B6  β2m-KO  46  *  B  C  B6  β2m-KO  47  Figure 3.10 SHIP localizes away from the contact site in WT cells, but is abundant at the contact site of β2m-KO NK cells bound to YAC-1 targets. To allow binding, poly I:C activated ex-vivo NK cells were incubated with YAC-1 for 20 minutes at 37C. The formed conjugates were fixed, permeabilized, stained for L49C/I and SHIP, and analyzed by confocal microscopy. The above images (A) depict mid sections of NK-YAC-1 complexes. Images were further analyzed for the distribution of SHIP and Ly49C/I usingVolocity. (B) The ratio of SHIP fluorescence density at the contact site versus rest of the cell for every cell at unlicensed (n=40) and WT (n=30) NK cells. * indicates p= 6.6 x 10-3. (C) The overlap coefficient (i.e. colocalization) of Ly49C/I and SHIP in WT (n=25) and β2m-KO (n=22) NK cells.  3.10. NK cells from SHIP-KO mice contain a greater subset of immature cells than WT The above results suggest that SHIP localization to the target contact site may inhibit NK cell cytotoxicity and thus mediate hypo-responsiveness of unlicensed NK cells. It implies that SHIP-deficient NK cells would be hyper-responsive. However, SHIP-KO NK cells have been reported to have lower expression of Ly49 and are hypo-responsive 80, 82. To solve this apparent contradiction, we analyzed NK cells from SHIP-KO mice and WT BALB/c mice. NK cells (NKp46+) can be divided into subsets based on the expression of CD27 and Mac-1, namely the most immature Mac-1loCD27- subset, the less immature Mac-1loCD27+ subset (which produces cytokines but is not very cytotoxic), mature cytotoxic Mac-1hiCD27+ subset, and the terminally differentiated Mac-1hiCD27- subset 100. Our analysis showed that most SHIP-KO mouse NK cells are Mac1loCD27+, whereas the majority of NK cells from WT mice are Mac1hiCD27+ and Mac1hiCD27- (Fig. 3.11 ). These results suggest that NK cells in SHIP-KO mice are unable to fully mature and hence are less cytotoxic than WT NK cells.  48  WT  29.2±1.5  7.1±3.3  SHIP-KO  21.5±2.2  42.1±4.7  77.3±19.4  6.6±5.0  15.7±12.8  3.8±1.7  Figure 3.11. SHIP-KO NK cells differ phenotypically from WT, as they contain a significantly larger subset of immature NK cells. WT and SHIP-KO spleen cells were stained with NKp46-APC to distinguish NK cells, and with CD27-PE and Mac1-FITC. They were further analyzed by FACS for NK maturation phenotyping as defined by CD27/Mac1 profiling. Results are representative of at least three independent experiments, with mean percentages ± SD shown in each quadrant.  49  Chapter 4: Discussion  In order to determine the mechanism that mediates NK cell licensing, we have analyzed unlicensed NK cells from MHC I deficient β2m-KO mice and compared them with licensed NK cells from WT B6 mice. While the former are much less cytotoxic against the prototypic NK target YAC-1 than the latter, our analyses have found no difference between the two NK cell populations in granzyme B expression, adhesion to ICAM-1 and polarization of actin, all of which are critical for NK cell-mediated killing of target cells. Although others have reported that NK cells from β2m-KO mice are deficient in actin polarization 101, we have found that F-actin aggregates at the contact site of both licensed and unlicensed NK cells bound to YAC-1 cells or ICAM-1-coated beads. Instead, we have found that β2m-KO NK cells fail to polarize lytic granules upon binding to YAC-1 cells, whereas clear polarization of lytic granule toward bound target is seen about 46% of WT NK cells. It should be noted that not all NK cells in WT B6 mice are licensed. Only those expressing Ly49C/I, approximately 40% of NK cells in B6 mice 52, are thought to interact with self-MHC I (H2Kb and Db) and become licensed 91. Polarization of lytic granules is crucial to NK cell cytotoxicity, and specific inhibition of granule polarization in NK cells disables target lysis 13, 102. While the process of lytic granule polarization in NK cells is not well understood, previous studies in our laboratory have shown that co-ligation of LFA-1 and the stimulatory receptor NKG2D is sufficient for the induction of lytic granule polarization in NK cells 11. NK cell killing of YAC-1 cells is thought to be mediated by NKG2D and 2B4 23, 31, 72. Therefore, it is likely that stimulatory signals generated by NKG2D and 2B4 might be impaired in β2m-KO NK cells. Indeed, 50  binding of beads coated with ligands for LFA-1 and NKG2D or those for LFA-1, NKG2D and 2B4 induces significant granule polarization toward the bound beads in WT NK cells, while β2m-KO NK cells fail to polarize lytic granules. Since LFA-1 function of 2m-KO NK cells is unaffected, as determined by adhesion to ICAM-1 and polarization of the actin cytoskeleton, these results suggest that stimulatory signals mediated by NKG2D and 2B4 are impaired in 2m-KO NK cells. In naive mouse NK cells, NKG2D signalling occurs primarily through the DAP10 adapter protein. DAP10 contains an SH2 domain which, upon receptor ligation, interacts with the p85 subunit of PI3K, thereby recruiting it to the cell membrane and activating it 103. PI3K recruitment and activation leads to downstream signaling cascade involving Rac1, PAK1, MEK, ERK, and is pivotal to NK cell cytotoxicity. Studies employing PI3K specific inhibitors show impairments in perforin and granzymeB polarization, and suppression of NK cell killing function 73. The SH2 domain of DAP10 is a potential site of interaction with the inhibitory phosphatase SHIP 104. SHIP is known to prevent PI3K recruitment to cell membranes. Signaling through DAP10 can also occur through the Grb2 adapter. In B cells, SHIP is recruited to the plasma membrane in complex with Grb2. Thus, regardless of the activation pathway taken by DAP10, SHIP has a potential inhibitory role in NKG2D/DAP10 mediated signaling. It has been shown that the ITIM of self-MHC I reactive Ly49 is crucial for NK cell licensing, yet the SHP-1 phosphatase is not 91. In addition to SHP-1, SHIP has also been reported to associate with Ly49 ITIM 87. In fact we have found that antibody-mediated cross-linking of Ly49C/I induces SHIP, and not SHP-1 colocalization with Ly49C/I, in both licensed and  51  unlicensed NK cells. Moreover, analysis of SHIP distribution in NK cells without Ly49C/I cross-linking suggests that in WT NK cells, SHIP may associate with Ly49C/I prior to Abmediated cross-linking. While in β2m-KO NK cells, this association seems to be induced by Ly49C/I cross-linking. Consistent with our results, Wang et al. found that under normal physiological conditions, in B6 mice, SHIP is associated with Ly49C/I 87. There has been no report in the literature of SHIP co-localizing with Ly49C/I in unlicensed NK cells upon Abmediated cross-linking. As mentioned earlier, DAP10 acts in complex with NKG2D to transduce stimulatory signals in naïve NK cells. Confocal analysis has shown that SHIP localizes to the contact site between a β2m-KO NK cell and a YAC-1 target. On the contrary, when a WT NK cell is bound to a YAC-1, SHIP localizes away from the contact site. This suggests that SHIP is present at the immunological synapse of unlicensed NK cells upon encounter with target cells. It is possible that SHIP exhibits its inhibitory function at the synapse formed between unlicensed NK cells and their targets, thereby disrupting NKG2D signalling. Following this study, I propose the following model for the role of SHIP in NK cell licensing  Fig. 4.1. Model for SHIP’s role in NK cell licensing. In licensed NK cells, binding of MHC I to inhibitory Ly49C/I receptor causes ITIM phosphorylation and recruits SHIP. This prevents SHIP from localizing to the NKG2D-mediated stimulatory synapse, which enables cytotoxicity. In unlicensed NK cells, Ly49C/I ITIM is not phosphorylated as it does not bind to MHC I and does not associate with SHIP. Therefore, SHIP is free to localize to NKG2Dmediated stimulatory synapse, where it inhibits DAP10-mediated stimulatory signals. 52  This model is consistent with experiments performed by Raulet et al. and Yokoyama et al., in which unlicensed mature NK cells become licensed and acquire lytic function when transplanted into a MHC-I-sufficient host 94. In reciprocity, when WT NK cells are transferred into MHC-I deficient hosts, their licensing state is reversed and the capacity to kill is perished 95. Both situations imply that licensing is flexible and is governed by the MHC-I environment. Another phenomenon which can reset the MHC-I requirement for licensing is cytokine stimulation in vitro. Kim et al. showed that culturing hyporesponsive NK cells with IL-2 restores their lytic ability 91. We observed similar effects with IL-15 stimulation (data not shown). Yokoyama et al. also reported IFNγ production by unlicensed NK cells cultured with IL-12 and IL-18 53. Recently, Orr et al. identified unlicensed NK cells a primary defense against MCMV infection 78. However, MCMV resistance is mediated through the Ly49H activating receptor, which is expressed on unlicensed NK cells. Ly49H signals through the ITAM-containing DAP12 adapter protein, while DAP10 plays no significant role in this 105. Moreover, Ly49H/DAP12 signalling seems to enhance NK cell sensitivity to IL-15 106. IL-15 is a pro-inflammatory cytokine, whose presence during MCMV infection may additionally contribute to the responsiveness of unlicensed NK cells. The PI3K activation pathway in NK cells is downstream of NKG2D-DAP10 and, as we have indicated, may be inhibited by SHIP. The ITAM-PTK activation pathway is DAP10 independent, and hence unlikely to be affected by SHIP. In fact, the ITAM-PTK activation pathway dominates during MCMV infection and cytokine activation, which may be a reason why unlicensed NK cells become responsive.  53  If NK cell licensing is mediated by the sequestering of SHIP away from the NKG2D/DAP10 complex by ITIM phosphorylated Ly49C/I, then SHIP-KO NK cells are expected to be all licensed and hyper-responsive. However, the effects of SHIP-deficiency on NK cell functions are rather complex. SHIP-KO NK cells of the B6 background have been shown to be incapable of rejecting mismatched BM grafts and killing tumourigenic or virally-infected targets suggesting that SHIP-KO NK cells are hypo-responsive 87. NK cells from SHIP-KO mice primed in vivo with poly I:C are also poor producers of IFNγ upon cross-linking of stimulatory receptors, including NKG2D 89. SHIP-KO NK cells have also been shown to express lower levels of Ly49s than WT NK cells 89. When they are expanded in culture in the presence of IL-2, they are less cytotoxic against the B6 lymphoid cell line RMA (MHC I+) transfected with the NKG2D ligand RAE-1. On the other hand, NK cells from SHIP-KO mice of the B10.D2 background (H-2d) display the same level of cytotoxicity as WT NK cells against target cells expressing H-2d while their cytotoxicity is higher than WT NK cells against RAE1-transfected RMA (H-2b) cells. It should be noted that the cytotoxicity of NK cells in these studies is analyzed following IL-2 stimulation, which is known to activate unlicensed NK cells. To clarify these contradicting results, we have analyzed NK cells from SHIP-KO and WT BALB/c mice for the expression of CD27 and Mac-1, which defines the maturation levels of NK cells 100. We have found SHIP-KO NK cells to be significantly more immature than WT NK cells, which would explain the hyporesponsiveness of SHIP-KO NK cells and lower expression of Ly49s. Altogether, my findings provide insight into the mechanism of NK cell licensing, and will hopefully initiate further studies on signalling generated by the interaction between inhibitory receptors and MHC I, which is essential for self versus non-self distinction. A natural  54  progression of this project would be to establish that the interaction between Ly49C/I and SHIP is essential to NK cell licensing. It would thus be relevant to verify the phosphorylation state of the Ly49C/I ITIM in licensed versus unlicensed NK cells, and to elucidate the mechanisms by which the Ly49C/I ITIM is phosphorylated. In addition, it is necessary to confirm the physical interaction between SHIP and components of the NKG2D activating complex, Grb2 and DAP10. Finally, it would be interesting to know whether SHIP inhibits both NKG2D and 2B4-mediated signaling, as its association with the latter has already been established 29.  55  References  1. Lanier, L. L. Up on the tightrope: natural killer cell activation and inhibition. Nat. Immunol. 9, 495-502 (2008). 2. Smyth, M. J. et al. Activation of NK cell cytotoxicity. Mol. Immunol. 42, 501-510 (2005). 3. Fehniger, T. A. et al. Acquisition of murine NK cell cytotoxicity requires the translation of a pre-existing pool of granzyme B and perforin mRNAs. Immunity 26, 798-811 (2007). 4. Topham, N. J. & Hewitt, E. W. Natural killer cell cytotoxicity: how do they pull the trigger? Immunology 128, 7-15 (2009). 5. Thiery, J. et al. Perforin pores in the endosomal membrane trigger the release of endocytosed granzyme B into the cytosol of target cells. Nat. Immunol. 12, 770-777 (2011). 6. Chavez-Galan, L., Arenas-Del Angel, M. C., Zenteno, E., Chavez, R. & Lascurain, R. Cell death mechanisms induced by cytotoxic lymphocytes. Cell. Mol. Immunol. 6, 15-25 (2009). 7. Bhat, R. & Watzl, C. Serial killing of tumor cells by human natural killer cells-enhancement by therapeutic antibodies. PLoS One 2, e326 (2007). 8. Waldhauer, I. & Steinle, A. NK cells and cancer immunosurveillance. Oncogene 27, 59325943 (2008). 9. Lanier, L. L. NK cell recognition. Annu. Rev. Immunol. 23, 225-274 (2005). 10. Ljunggren, H. G. & Karre, K. In search of the 'missing self': MHC molecules and NK cell recognition. Immunol. Today 11, 237-244 (1990). 11. Mace, E. M., Monkley, S. J., Critchley, D. R. & Takei, F. A dual role for talin in NK cell cytotoxicity: activation of LFA-1-mediated cell adhesion and polarization of NK cells. J. Immunol. 182, 948-956 (2009). 12. Graham, D. B. et al. Vav1 controls DAP10-mediated natural cytotoxicity by regulating actin and microtubule dynamics. J. Immunol. 177, 2349-2355 (2006). 13. Vyas, Y. M. et al. Spatial organization of signal transduction molecules in the NK cell immune synapses during MHC class I-regulated noncytolytic and cytolytic interactions. J. Immunol. 167, 4358-4367 (2001). 14. Orange, J. S. Formation and function of the lytic NK-cell immunological synapse. Nat. Rev. Immunol. 8, 713-725 (2008).  56  15. Bryceson, Y. T., March, M. E., Ljunggren, H. G. & Long, E. O. Activation, coactivation, and costimulation of resting human natural killer cells. Immunol. Rev. 214, 73-91 (2006). 16. Zompi, S. & Colucci, F. Anatomy of a murder--signal transduction pathways leading to activation of natural killer cells. Immunol. Lett. 97, 31-39 (2005). 17. Carayannopoulos, L. N., Naidenko, O. V., Fremont, D. H. & Yokoyama, W. M. Cutting edge: murine UL16-binding protein-like transcript 1: a newly described transcript encoding a high-affinity ligand for murine NKG2D. J. Immunol. 169, 4079-4083 (2002). 18. Diefenbach, A., Hsia, J. K., Hsiung, M. Y. & Raulet, D. H. A novel ligand for the NKG2D receptor activates NK cells and macrophages and induces tumor immunity. Eur. J. Immunol. 33, 381-391 (2003). 19. Gasser, S., Orsulic, S., Brown, E. J. & Raulet, D. H. The DNA damage pathway regulates innate immune system ligands of the NKG2D receptor. Nature 436, 1186-1190 (2005). 20. Diefenbach, A. et al. Selective associations with signaling proteins determine stimulatory versus costimulatory activity of NKG2D. Nat. Immunol. 3, 1142-1149 (2002). 21. Vahlne, G., Becker, S., Brodin, P. & Johansson, M. H. IFN-gamma production and degranulation are differentially regulated in response to stimulation in murine natural killer cells. Scand. J. Immunol. 67, 1-11 (2008). 22. Bryceson, Y. T., March, M. E., Ljunggren, H. G. & Long, E. O. Synergy among receptors on resting NK cells for the activation of natural cytotoxicity and cytokine secretion. Blood 107, 159-166 (2006). 23. Ho, E. L. et al. Costimulation of multiple NK cell activation receptors by NKG2D. J. Immunol. 169, 3667-3675 (2002). 24. Veillette, A. Immune regulation by SLAM family receptors and SAP-related adaptors. Nat. Rev. Immunol. 6, 56-66 (2006). 25. Lee, K. M. et al. Requirement of homotypic NK-cell interactions through 2B4(CD244)/CD48 in the generation of NK effector functions. Blood 107, 3181-3188 (2006). 26. Garni-Wagner, B. A., Purohit, A., Mathew, P. A., Bennett, M. & Kumar, V. A novel function-associated molecule related to non-MHC-restricted cytotoxicity mediated by activated natural killer cells and T cells. J. Immunol. 151, 60-70 (1993). 27. Tangye, S. G., Cherwinski, H., Lanier, L. L. & Phillips, J. H. 2B4-mediated activation of human natural killer cells. Mol. Immunol. 37, 493-501 (2000). 28. Chen, R. et al. Molecular dissection of 2B4 signaling: implications for signal transduction by SLAM-related receptors. Mol. Cell. Biol. 24, 5144-5156 (2004).  57  29. Eissmann, P. et al. Molecular basis for positive and negative signaling by the natural killer cell receptor 2B4 (CD244). Blood 105, 4722-4729 (2005). 30. Bloch-Queyrat, C. et al. Regulation of natural cytotoxicity by the adaptor SAP and the Src-related kinase Fyn. J. Exp. Med. 202, 181-192 (2005). 31. Kim, H. S., Das, A., Gross, C. C., Bryceson, Y. T. & Long, E. O. Synergistic signals for natural cytotoxicity are required to overcome inhibition by c-Cbl ubiquitin ligase. Immunity 32, 175-186 (2010). 32. Sayos, J. et al. The X-linked lymphoproliferative-disease gene product SAP regulates signals induced through the co-receptor SLAM. Nature 395, 462-469 (1998). 33. Nakajima, H. et al. Patients with X-linked lymphoproliferative disease have a defect in 2B4 receptor-mediated NK cell cytotoxicity. Eur. J. Immunol. 30, 3309-3318 (2000). 34. Sivori, S. et al. 2B4 functions as a co-receptor in human NK cell activation. Eur. J. Immunol. 30, 787-793 (2000). 35. Sivori, S. et al. Early expression of triggering receptors and regulatory role of 2B4 in human natural killer cell precursors undergoing in vitro differentiation. Proc. Natl. Acad. Sci. U. S. A. 99, 4526-4531 (2002). 36. Lee, K. M. et al. 2B4 acts as a non-major histocompatibility complex binding inhibitory receptor on mouse natural killer cells. J. Exp. Med. 199, 1245-1254 (2004). 37. Lakshmikanth, T. et al. NCRs and DNAM-1 mediate NK cell recognition and lysis of human and mouse melanoma cell lines in vitro and in vivo. J. Clin. Invest. 119, 1251-1263 (2009). 38. Sivori, S. et al. P46, a Novel Natural Killer Cell-Specific Surface Molecule that Mediates Cell Activation. J. Exp. Med. 186, 1129-1136 (1997). 39. Pessino, A. et al. Molecular cloning of NKp46: a novel member of the immunoglobulin superfamily involved in triggering of natural cytotoxicity. J. Exp. Med. 188, 953-960 (1998). 40. Mandelboim, O. et al. Recognition of haemagglutinins on virus-infected cells by NKp46 activates lysis by human NK cells. Nature 409, 1055-1060 (2001). 41. Kim, H. J. et al. The activating killer cell immunoglobulin-like receptors as important determinants of acute graft-versus host disease in hematopoietic stem cell transplantation for acute myelogenous leukemia. Transplantation 84, 1082-1091 (2007). 42. George, T. C., Ortaldo, J. R., Lemieux, S., Kumar, V. & Bennett, M. Tolerance and alloreactivity of the Ly49D subset of murine NK cells. J. Immunol. 163, 1859-1867 (1999). 43. Daniels, K. A. et al. Murine cytomegalovirus is regulated by a discrete subset of natural killer cells reactive with monoclonal antibody to Ly49H. J. Exp. Med. 194, 29-44 (2001). 58  44. Arnon, T. I. et al. The mechanisms controlling the recognition of tumor- and virusinfected cells by NKp46. Blood 103, 664-672 (2004). 45. Biassoni, R. et al. The murine homologue of the human NKp46, a triggering receptor involved in the induction of natural cytotoxicity. Eur. J. Immunol. 29, 1014-1020 (1999). 46. Ljutic, B. et al. Functional requirements for signaling through the stimulatory and inhibitory mouse NKR-P1 (CD161) NK cell receptors. J. Immunol. 174, 4789-4796 (2005). 47. Arase, N. et al. Association with FcRgamma is essential for activation signal through NKR-P1 (CD161) in natural killer (NK) cells and NK1.1+ T cells. J. Exp. Med. 186, 19571963 (1997). 48. Takai, T., Li, M., Sylvestre, D., Clynes, R. & Ravetch, J. V. FcR gamma chain deletion results in pleiotrophic effector cell defects. Cell 76, 519-529 (1994). 49. Long, E. O. Regulation of immune responses through inhibitory receptors. Annu. Rev. Immunol. 17, 875-904 (1999). 50. Dimasi, N., Moretta, L. & Biassoni, R. Structure of the Ly49 family of natural killer (NK) cell receptors and their interaction with MHC class I molecules. Immunol. Res. 30, 95104 (2004). 51. Orihuela, M., Margulies, D. H. & Yokoyama, W. M. The natural killer cell receptor Ly49A recognizes a peptide-induced conformational determinant on its major histocompatibility complex class I ligand. Proc. Natl. Acad. Sci. U. S. A. 93, 11792-11797 (1996). 52. Brennan, J., Mager, D., Jefferies, W. & Takei, F. Expression of different members of the Ly-49 gene family defines distinct natural killer cell subsets and cell adhesion properties. J. Exp. Med. 180, 2287-2295 (1994). 53. Yokoyama, W. M. & Kim, S. Licensing of natural killer cells by self-major histocompatibility complex class I. Immunol. Rev. 214, 143-154 (2006). 54. Raulet, D. H. et al. Specificity, tolerance and developmental regulation of natural killer cells defined by expression of class I-specific Ly49 receptors. Immunol. Rev. 155, 41-52 (1997). 55. Kubota, A., Kubota, S., Lohwasser, S., Mager, D. L. & Takei, F. Diversity of NK cell receptor repertoire in adult and neonatal mice. J. Immunol. 163, 212-216 (1999). 56. Takei, F., Brennan, J. & Mager, D. L. The Ly-49 family: genes, proteins and recognition of class I MHC. Immunol. Rev. 155, 67-77 (1997). 57. Takei, F. et al. Ly49 and CD94/NKG2: developmentally regulated expression and evolution. Immunol. Rev. 181, 90-103 (2001).  59  58. Ravetch, J. V. & Lanier, L. L. Immune inhibitory receptors. Science 290, 84-89 (2000). 59. Masilamani, M., Nguyen, C., Kabat, J., Borrego, F. & Coligan, J. E. CD94/NKG2A inhibits NK cell activation by disrupting the actin network at the immunological synapse. J. Immunol. 177, 3590-3596 (2006). 60. Aldrich, C. J. et al. Identification of a Tap-dependent leader peptide recognized by alloreactive T cells specific for a class Ib antigen. Cell 79, 649-658 (1994). 61. Grundemann, C. et al. Cutting edge: identification of E-cadherin as a ligand for the murine killer cell lectin-like receptor G1. J. Immunol. 176, 1311-1315 (2006). 62. Ito, M. et al. Killer cell lectin-like receptor G1 binds three members of the classical cadherin family to inhibit NK cell cytotoxicity. J. Exp. Med. 203, 289-295 (2006). 63. Iizuka, K., Naidenko, O. V., Plougastel, B. F., Fremont, D. H. & Yokoyama, W. M. Genetically linked C-type lectin-related ligands for the NKRP1 family of natural killer cell receptors. Nat. Immunol. 4, 801-807 (2003). 64. Carlyle, J. R. et al. Missing self-recognition of Ocil/Clr-b by inhibitory NKR-P1 natural killer cell receptors. Proc. Natl. Acad. Sci. U. S. A. 101, 3527-3532 (2004). 65. Aldemir, H. et al. Cutting edge: lectin-like transcript 1 is a ligand for the CD161 receptor. J. Immunol. 175, 7791-7795 (2005). 66. Lebbink, R. J. et al. Collagens are functional, high affinity ligands for the inhibitory immune receptor LAIR-1. J. Exp. Med. 203, 1419-1425 (2006). 67. Cantoni, C. et al. Molecular and functional characterization of IRp60, a member of the immunoglobulin superfamily that functions as an inhibitory receptor in human NK cells. Eur. J. Immunol. 29, 3148-3159 (1999). 68. Bryceson, Y. T. & Long, E. O. Line of attack: NK cell specificity and integration of signals. Curr. Opin. Immunol. 20, 344-352 (2008). 69. Vivier, E., Nunes, J. A. & Vely, F. Natural killer cell signaling pathways. Science 306, 1517-1519 (2004). 70. Walzer, T. et al. Identification, activation, and selective in vivo ablation of mouse NK cells via NKp46. Proc. Natl. Acad. Sci. U. S. A. 104, 3384-3389 (2007). 71. Upshaw, J. L. et al. NKG2D-mediated signaling requires a DAP10-bound Grb2-Vav1 intermediate and phosphatidylinositol-3-kinase in human natural killer cells. Nat. Immunol. 7, 524-532 (2006). 72. Zompi, S. et al. NKG2D triggers cytotoxicity in mouse NK cells lacking DAP12 or Syk family kinases. Nat. Immunol. 4, 565-572 (2003).  60  73. Jiang, K. et al. Pivotal role of phosphoinositide-3 kinase in regulation of cytotoxicity in natural killer cells. Nat. Immunol. 1, 419-425 (2000). 74. Gilfillan, S., Ho, E. L., Cella, M., Yokoyama, W. M. & Colonna, M. NKG2D recruits two distinct adapters to trigger NK cell activation and costimulation. Nat. Immunol. 3, 11501155 (2002). 75. Ogasawara, K., Benjamin, J., Takaki, R., Phillips, J. H. & Lanier, L. L. Function of NKG2D in natural killer cell-mediated rejection of mouse bone marrow grafts. Nat. Immunol. 6, 938-945 (2005). 76. Tomasello, E. et al. Combined natural killer cell and dendritic cell functional deficiency in KARAP/DAP12 loss-of-function mutant mice. Immunity 13, 355-364 (2000). 77. Bakker, A. B. et al. DAP12-deficient mice fail to develop autoimmunity due to impaired antigen priming. Immunity 13, 345-353 (2000). 78. Orr, M. T. et al. Ly49H signaling through DAP10 is essential for optimal natural killer cell responses to mouse cytomegalovirus infection. J. Exp. Med. 206, 807-817 (2009). 79. Stebbins, C. C. et al. Vav1 dephosphorylation by the tyrosine phosphatase SHP-1 as a mechanism for inhibition of cellular cytotoxicity. Mol. Cell. Biol. 23, 6291-6299 (2003). 80. Krzewski, K., Chen, X., Orange, J. S. & Strominger, J. L. Formation of a WIP-, WASp-, actin-, and myosin IIA-containing multiprotein complex in activated NK cells and its alteration by KIR inhibitory signaling. J. Cell Biol. 173, 121-132 (2006). 81. Ono, M., Bolland, S., Tempst, P. & Ravetch, J. V. Role of the inositol phosphatase SHIP in negative regulation of the immune system by the receptor Fc(gamma)RIIB. Nature 383, 263-266 (1996). 82. Gupta, N. et al. Negative signaling pathways of the killer cell inhibitory receptor and Fc gamma RIIb1 require distinct phosphatases. J. Exp. Med. 186, 473-478 (1997). 83. Tessmer, M. S. et al. KLRG1 binds cadherins and preferentially associates with SHIP-1. Int. Immunol. 19, 391-400 (2007). 84. Mason, L. H. et al. Differential tyrosine phosphorylation of inhibitory versus activating Ly-49 receptor proteins and their recruitment of SHP-1 phosphatase. J. Immunol. 159, 41874196 (1997). 85. Damen, J. E. et al. The 145-kDa protein induced to associate with Shc by multiple cytokines is an inositol tetraphosphate and phosphatidylinositol 3,4,5-triphosphate 5phosphatase. Proc. Natl. Acad. Sci. U. S. A. 93, 1689-1693 (1996). 86. Galandrini, R. et al. The adaptor protein shc is involved in the negative regulation of NK cell-mediated cytotoxicity. Eur. J. Immunol. 31, 2016-2025 (2001).  61  87. Wang, J. W. et al. Influence of SHIP on the NK repertoire and allogeneic bone marrow transplantation. Science 295, 2094-2097 (2002). 88. Wahle, J. A. et al. Cutting edge: dominance by an MHC-independent inhibitory receptor compromises NK killing of complex targets. J. Immunol. 176, 7165-7169 (2006). 89. Fortenbery, N. R. et al. SHIP influences signals from CD48 and MHC class I ligands that regulate NK cell homeostasis, effector function, and repertoire formation. J. Immunol. 184, 5065-5074 (2010). 90. Wahle, J. A. et al. Inappropriate recruitment and activity by the Src homology region 2 domain-containing phosphatase 1 (SHP1) is responsible for receptor dominance in the SHIPdeficient NK cell. J. Immunol. 179, 8009-8015 (2007). 91. Kim, S. et al. Licensing of natural killer cells by host major histocompatibility complex class I molecules. Nature 436, 709-713 (2005). 92. Liao, N. S., Bix, M., Zijlstra, M., Jaenisch, R. & Raulet, D. MHC class I deficiency: susceptibility to natural killer (NK) cells and impaired NK activity. Science 253, 199-202 (1991). 93. Fernandez, N. C. et al. A subset of natural killer cells achieves self-tolerance without expressing inhibitory receptors specific for self-MHC molecules. Blood 105, 4416-4423 (2005). 94. Elliott, J. M., Wahle, J. A. & Yokoyama, W. M. MHC class I-deficient natural killer cells acquire a licensed phenotype after transfer into an MHC class I-sufficient environment. J. Exp. Med. 207, 2073-2079 (2010). 95. Joncker, N. T., Shifrin, N., Delebecque, F. & Raulet, D. H. Mature natural killer cells reset their responsiveness when exposed to an altered MHC environment. J. Exp. Med. 207, 2065-2072 (2010). 96. Lucas, M., Schachterle, W., Oberle, K., Aichele, P. & Diefenbach, A. Dendritic cells prime natural killer cells by trans-presenting interleukin 15. Immunity 26, 503-517 (2007). 97. Smith, H. R. et al. Recognition of a virus-encoded ligand by a natural killer cell activation receptor. Proc. Natl. Acad. Sci. U. S. A. 99, 8826-8831 (2002). 98. Maxwell, M. J. et al. Genetic segregation of inflammatory lung disease and autoimmune disease severity in SHIP-1-/- mice. J. Immunol. 186, 7164-7175 (2011). 99. Welder, C. A., Lee, D. H. & Takei, F. Inhibition of cell adhesion by microspheres coated with recombinant soluble intercellular adhesion molecule-1. J. Immunol. 150, 2203-2210 (1993). 100. Chiossone, L. et al. Maturation of mouse NK cells is a 4-stage developmental program. Blood 113, 5488-5496 (2009). 62  101. Guia, S. et al. Confinement of activating receptors at the plasma membrane controls natural killer cell tolerance. Sci. Signal. 4, ra21 (2011). 102. Das, A. & Long, E. O. Lytic granule polarization, rather than degranulation, is the preferred target of inhibitory receptors in NK cells. J. Immunol. 185, 4698-4704 (2010). 103. Wu, J. et al. An activating immunoreceptor complex formed by NKG2D and DAP10. Science 285, 730-732 (1999). 104. Kerr, W. G. Inhibitor and activator: dual functions for SHIP in immunity and cancer. Ann. N. Y. Acad. Sci. 1217, 1-17 (2011). 105. Sjolin, H. et al. Pivotal role of KARAP/DAP12 adaptor molecule in the natural killer cell-mediated resistance to murine cytomegalovirus infection. J. Exp. Med. 195, 825-834 (2002). 106. French, A. R. et al. DAP12 signaling directly augments proproliferative cytokine stimulation of NK cells during viral infections. J. Immunol. 177, 4981-4990 (2006).  63  

Cite

Citation Scheme:

    

Usage Statistics

Country Views Downloads
China 19 0
United States 11 0
Japan 3 0
United Kingdom 2 0
City Views Downloads
Beijing 19 0
Unknown 4 2
Ashburn 3 0
Tokyo 3 0
Mountain View 3 0
Oxford 2 0
Santa Cruz 1 0

{[{ mDataHeader[type] }]} {[{ month[type] }]} {[{ tData[type] }]}
Download Stats

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0072430/manifest

Comment

Related Items