Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Toll-like recepetors play a major role in the myocardial pro-inflammatory and anti-inflammatory responses Mathur, Sumeet 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2012_spring_mathur_sumeet.pdf [ 136.33MB ]
Metadata
JSON: 24-1.0072427.json
JSON-LD: 24-1.0072427-ld.json
RDF/XML (Pretty): 24-1.0072427-rdf.xml
RDF/JSON: 24-1.0072427-rdf.json
Turtle: 24-1.0072427-turtle.txt
N-Triples: 24-1.0072427-rdf-ntriples.txt
Original Record: 24-1.0072427-source.json
Full Text
24-1.0072427-fulltext.txt
Citation
24-1.0072427.ris

Full Text

TOLL-LIKE RECEPTORS PLAY A MAJOR ROLE IN THE MYOCARDIAL PROINFLAMMATORY AND ANTI-INFLAMMATORY RESPONSES by SUMEET MATHUR B.Sc., The University of Waterloo, 2007  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in  THE FACULTY OF GRADUTE STUDIES (Experimental Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  December 2011 © Sumeet Mathur, 2011  Abstract Acute cardiac dysfunction due to myocardial infarction and septic shock may contribute to hypotension, low cardiac output, or death. A common outcome of these disease states is the induction of inflammation, a major contributor to acute cardiac dysfunction. Acute inflammatory reactions often involve the Toll-Like receptor/NFκB pathway. Toll-Like receptors (TLRs) are members of the innate immune system and are responsible for recognizing foreign Pathogen Associated Molecular Patterns (PAMPs) expressed by infecting organisms. Ligation of cardiomyocyte TLRs by PAMPs initiates an inflammatory response and can reduce cardiomyocyte contractility. Recently, endogenous molecules known as Damage Associated Molecular Patterns (DAMPs) which are released during myocardial infarctions have proven to initiate an inflammatory response similar to PAMPs in inflammatory cells. We hypothesize that DAMPs ligate to TLRs causing a pro-inflammatory response by cardiomyocytes whilst reducing cardiac contractility. Additionally, this pro-inflammatory response can be attenuated by using TLR9 ligand, CpG, in a pre-treatment model. Our first objective was to assay a variety of DAMPs for an effect on the inflammatory and functional responses of cardiomyocytes, and determine which TLRs are involved. We found that the DAMP, HSP70, induces an inflammatory response via TLR2 and the NFκB signalling pathway. Our second objective was to determine if a TLR ligand was capable of activating NFκB signalling inducing a tolerant state without affecting cardiac contractility. We found that pretreatment with TLR9 ligand (CpG) induced tolerance and down-regulated NFκB signalling and expression of inflammatory markers. In accord with these observations, we found CpG pretreatment attenuated decreases in cardiomyocyte contractility in an LPS model and coronary  ii  artery ligation model of ischemia reperfusion. Microarray analysis identified a group of NFκB pathway inhibitors induced by CpG that may be responsible for the diminished inflammatory response. TNFAIP3 (A20) was identified as a highly regulated suppressor of NFκB in cardiomyocytes. In conclusion, a discrete set of TLRs play a major role in myocardial pro-inflammatory responses caused by DAMPs, PAMPs and ischemic injury that lead to decreased contractility and inflammation. However, using TLR9 ligand CpG pre-emptively has shown to reduce the inflammatory response while maintaining proper cardiac function.  iii  Preface Chapter 3  Chapter 3 is an altered version of a manuscript published in Circulation Journal. [Sumeet Mathur], Keith R. Walley, Yingjin Wang, Toonchai Indrambarya, John H. Boyd. (2011) “Extracellular heat shock protein 70 induces cardiomyocyte inflammation and contractile dysfunction via TLR2”. This project was conceptualized by John Boyd, Keith Walley and I. Yingjin Wang and Toonchai Indrambarya conducted all animal work regarding surgeries and harvesting of organs. I was responsible for conducting all lab work and data analysis as well as writing of the manuscript. John Boyd and Keith Walley assisted in writing and editing of the manuscript.  Chapter 4  Chapter 4 is an altered version of a manuscript published in SHOCK. [Sumeet Mathur], Keith R. Walley, John H. Boyd (2011) “The TLR9 ligand CpG-C attenuates acute inflammatory cardiac dysfunction”. The manuscript was conceptualized by Keith Walley, John Boyd and I. Animal surgeries and organ harvesting were conducted by Yingjin Wang. John Boyd conducted all echocardiography readings. I was responsible for all lab work and data analysis in addition to writing the manuscript. John Boyd and Keith Walley assisted in writing and editing of the manuscript.  iv  All animal experiments were sanctioned by the UBC Animal Care Committee. All experiments fell under the following ethics certificates: A05-1871-A003 Toll-like receptors and A06-0304 Toll-like receptor protection against ischemia.  Several images in this thesis have been taken from other copyrighted publications. All copyrighted material has been given permission to be used in this thesis.  v  Table of Contents Abstract ........................................................................................................................... ii Preface............................................................................................................................ iv Table of Contents........................................................................................................... vi List Of Tables ................................................................................................................ ix List Of Figures ................................................................................................................ x List Of Abbreviations ................................................................................................... xii Acknowledgements...................................................................................................... xiv Dedication ..................................................................................................................... xv Chapter 1  Introduction......................................................................................................1  1.1 Inflammation........................................................................................................... 1 1.2 Acute Cardiac Dysfunction..................................................................................... 2 1.2.1  Ischemia Reperfusion..................................................................................... 2  1.2.2  Septic Shock................................................................................................... 3  1.3 Toll-Like Receptors ................................................................................................ 4 1.3.1  Toll-Like Receptors On Cardiomyocytes ...................................................... 6  1.4 Endogenous Ligands............................................................................................... 8 1.4.1  Heat Shock Protein 70 ................................................................................. 10  1.5 NFκB Pathway ...................................................................................................... 11 1.5.1  NFκB............................................................................................................ 13  1.5.2  Negative Regulators Of The NFκB Pathway............................................... 14  1.5.3  A20 And TNIP1........................................................................................... 18  1.5.4  A20 And TNIP1’s Physiological Effects..................................................... 21  vi  1.6 Tolerance............................................................................................................... 22 1.6.1  TLR Tolerance ............................................................................................. 22  1.6.2  Ischemia Reperfusion Tolerance.................................................................. 23  1.7 CPG ....................................................................................................................... 25 Chapter 2  Hypothesis......................................................................................................28  2.1 Specific Aims........................................................................................................ 28 Chapter 3  Extracellular Heat Shock Protein 70 Induces Cardiomyocyte Inflammation  And Contractile Dysfunction Via TLR2............................................................................30 3.1 Introduction........................................................................................................... 30 3.2 Materials and Methods.......................................................................................... 31 3.3 Results................................................................................................................... 35 3.4 Discussion ............................................................................................................. 42 Chapter 4  The TLR9 Ligand CpG C Attenuates Acute Inflammatory Cardiac  Dysfunction ........................................................................................................................47 4.1 Introduction........................................................................................................... 47 4.2 Materials and Methods.......................................................................................... 48 4.3 Results................................................................................................................... 55 4.4 Discussion ............................................................................................................. 64 Chapter 5  A20 And TNIP1 are key modulators of NFκB activated inflammation ........70  5.1 Introduction........................................................................................................... 70 5.2 Methods................................................................................................................. 71 5.3 Results................................................................................................................... 73 5.4 Discussion ............................................................................................................. 76  vii  Chapter 6  Conclusions....................................................................................................79  Chapter 7  Limitations And Future Directions ................................................................83  References ........................................................................................................................86 Appendix 1 Assay Methodology .......................................................................................93  viii  List Of Tables Table 1. CpG ODN Sequences ..................................................................................................... 26 Table 2. Gene expression of NFκB pathway inhibitors induced by CpG C. ................................ 57  ix  List Of Figures Figure 1. TLR ligation via a discrete set of TLRs causes cardiac dysfunction. ............................ 7 Figure 2. DAMP release in circulation during an ischemic episode.............................................. 9 Figure 3. The MyD88-dependent and independent pathways in TLR4 signalling...................... 12 Figure 4. Negative regulators of the NFκB pathway. .................................................................. 17 Figure 5. A20 protein domain structure....................................................................................... 19 Figure 6. A20’s methods of NFκB pathway inhibition................................................................ 20 Figure 7. Ischemic tolerance reduces inflammation. ................................................................... 24 Figure 8. DAMPS activate the NFκB pathway............................................................................ 36 Figure 9. HSP70 reduces fractional shortening without disrupting calcium flux........................ 37 Figure 10. HSP70 induces expression of inflammatory markers. ............................................... 38 Figure 11. HSP70 activates inflammation in a TLR2 dependent manner. .................................. 39 Figure 12. HSP70 requires TLR2 to decrease contractility. ........................................................ 41 Figure 13. HSP70 induces cell death in cardiomyocytes through TLR2..................................... 42 Figure 14. CpG ODNs do not affect cardiac ejection fraction. ................................................... 55 Figure 15. CpG C preserves cardiac function in an LPS model. ................................................. 56 Figure 16. CpG C activates NFκB in a dose response manner. ................................................... 57 Figure 17. CpG C pre-treatment prevents cardiac dysfunction in an LAD model. ..................... 58 Figure 18. CpG C concurrent treatment preserves cardiac function during LAD ligation.......... 59 Figure 19. Inflammatory marker expression is reduced in CpG C pre-treated left ventricular tissue. ............................................................................................................................................ 60 Figure 20. S100A8 and S100A9 expression is abolished in CpG C pre-treated left ventricular tissue. ............................................................................................................................................ 61  x  Figure 21. CpG C is able to reduce NFκB activity induced by LPS and HSP70. ....................... 62 Figure 22. CpG C nearly abolishes ICAM-1 expression induced by LPS and HSP70. .............. 63 Figure 23. Troponin I following IR of the LAD is reduced by CpG C. ...................................... 64 Figure 24. Induction of A20 and TNIP1 24 hours after CpG C stimulation. .............................. 74 Figure 25. Western Blot confirmation of over-expression vector transfection. .......................... 75 Figure 26. A20 & TNIP1 over-expression attenuate ICAM-1 and MIP-2 expression when stimulated with LPS...................................................................................................................... 75 Figure 27. CpG C triggers NFκB pathway regulators to attenuate further inflammation. ........... 81  xi  List Of Abbreviations BCL-3 CAD CD40 CD91 CD94 cDNA CYLD DAMPs DNA ELISA FL HMGB1 HSPs IκBα IκBβ IκBε IκBγ ICAM-1 IFN IKKα IKKβ IKKγ IL-1 IL-1β IL-1R IL-6 IL-8 IL-12 i.p. IR IRAK 1 IRAK 4 JAK KC LAD LOX1 LPS Lys MCP-1  B-cell lymphoma 3-encoded protein Coronary Artery Disease cluster of differentiation 40 cluster of differentiation 91 cluster of differentiation 94 Complementary DNA cylindromatosis Danger Associated Molecular Patterns Deoxyribonucleic Acid Enzyme Linked Immunosorbant Assay Flagellin High-mobility group protein B1 Heat Shock Proteins nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, gamma Inter-Cellular Adhesion Molecule 1 Interferon inhibitor of kappa B kinase alpha inhibitor of kappa B kinase beta inhibitor of kappa B kinase gamma Interleukin 1 Interleukin 1 beta Interleukin 1 Receptor Interleukin 6 Interleukin 8 Interleukin 12 Inter-peritoneal Ischemia Reperfusion Interleukin-1 receptor-associated kinase 1 Interleukin-1 receptor-associated kinase 4 Janus kinase keratinocyte derived chemokine Left Anterior Descending Artery Lectin-like oxidized low density lipoprotein receptor-1 Lipopolysaccharide Lysine Monocyte Chemotactic Protein-1  xii  MIP-2 mRNA MyD88 NFκB NIK NK cell NOD ODN OTU domain PAMPs PDTC PGN qRT-PCR RAGE RIP RNA ROS SARM SH2 siRNA SNP SOCS1 STAT TAB1 TAB2 TAK1 TAX1BP1 TIR TLR TMB TNFα TNFAIP3/A20 TNF-R TNIP1 TRAF TRIF TRIM30α VCAM-1  Macrophage Inflammatory Protein 2 Messenger RNA Myeloid differentiation primary response gene 88 Nuclear Factor Kappa light polypeptide gene enhancer in B-cells Nuclear Factor kappa B-inducing kinase Natural Killer cell Nucleotide-binding Oligomerization Domain Oligonucleotide Ovarian Tumor Domain Pathogen Associated Molecular Patterns pyrrolidine dithiocarbamate Peptidoglycan Quantitative Real Time Polymerase Chain Reaction Receptor for Advanced Glycation End Products Ral-interacting protein 1 Ribonucleic Acid Reactive Oxygen Species sterile alpha and TIR motif containing 1 Src Homology 2 domain silencing RNA Single Nucleotide Polymorphism Suppressor of cytokine signalling 1 Signal Transducer and Activator of Transcription TGF-beta activated kinase 1/MAP3K7 binding protein 1 TGF-beta activated kinase 2/MAP3K7 binding protein 2 TGF-beta activated kinase 1 Tax1-binding protein 1 Toll/Interleukin-1 Receptor Toll-like Receptor tetramethylbenzidine Tumor Necrosis Factor alpha Tumor Necrosis Factor Alpha Induced Protein 3 Tumor Necrosis Factor Receptor TNFAIP3 Interacting Protein I Tumor Necrosis Factor receptor associated factor TIR-domain-containing adapter-inducing interferon-β tripartite motif-containing 30A Vascular Cell Adhesion Molecule 1  xiii  Acknowledgements Supervisor: Dr. Keith Walley Committee Members: Dr. Keith Walley, Dr. John Boyd, Dr. David Granville Funding: Project funding was provided by the Canadian Institutes of Health Research (CIHR) and the National Sanitorium Association.  Thank you to my supervisory committee, members of the Walley lab and the Heart and Lung Institute at St.Paul’s Hospital for helping me and giving advice throughout my experience. A special thank you to my supervisors Keith Walley and John Boyd who took a chance on an undergrad as a co-op student and then again as a graduate student. You have taught me more than you know and have supported me throughout this process.  xiv  Dedication I dedicate this thesis to my family. You have given me unwavering support throughout my journey in life and through graduate school. Thank you. I would also like to acknowledge my Vancouver family who always made me feel at home with love and warm home cooked meals. I couldn’t have gotten through this without your comfort and help.  xv  Chapter 1  1.1  Introduction  Inflammation Cardiovascular inflammation has shown to contribute to several cardiovascular  diseases [1]. Inflammation may be triggered by an assortment of stimuli including pathogens, damaged endothelium, atherosclerotic plaque rupture and ischemiareperfusion. During injury, exposed intracellular proteins such as fibrin, HMBG1, heat shock proteins, and collagen are extruded locally [2].  Both pathogen associated  molecular patterns (PAMPS) and these damage associated proteins bind to receptors such as Toll-like receptors (TLRs) on neighbouring cells causing activation of Nuclear Factor kappa B (NFκB), a central transcription factor regulating the cellular inflammatory process. NFκB activation causes the release of inflammatory cytokines such as IL-1 and TNFα, and expression of cell adhesion molecules such as ICAM-1, VCAM-1 and selectins [1]. Expression of these proteins represents the first or early response. Cytokines including IL-6, KC and MIP-2 act as messengers responsible for recruiting and activating leukocytic cells such as macrophages, neutrophils and dendritic cells [3]. Upon arrival to the site of injury, leukocytes bind to cell adhesion molecules expressed on the cellular surface of the damaged area and release a second wave of cytokines. This inflammatory process may have negative effects on cardiovascular function. Irregular repair mechanisms often lead to fibrosis or occlusion of arteries and can lead to ischemic injury. Furthermore, recruitment of leukocytic cells such as neutrophils mediates cardiomyocyte death via the release of reactive oxygen species (ROS) and vascular  1  plugging [1, 3]. Expression of cell adhesion molecules such as ICAM-1 mediate decreased cardiac contractility independently of neutrophil adhesion directly to cardiomyocytes [4, 5]. As a result of these processes cardiac function may decrease.  1.2  Acute Cardiac Dysfunction Acute cardiac dysfunction is characterized by reduced ventricular systolic  function. Cardiac dysfunction may be caused by ischemia-reperfusion injury; bacterial or viral infection; medications; rare dietary deficiencies or unknown causes of cardiomyopathies [1, 6-8]. Systole, the ventricular contraction stage, is greatly affected in acute cardiac dysfunction due to reduced fractional shortening of ventricular myocytes. Without time to dilate the ventricle (increasing end-diastolic volume), the acute reduction in end-systolic volume grossly reduces stroke volume, resulting in blood pressure decline and hypotension. Hypotensive patients commonly possess a decrease in organ perfusion, which may lead to further complications including organ failure, stroke or death. Two common causes of acute cardiac dysfunction in hospitalized patients are cardiac ischemia and septic shock [9].  1.2.1 Ischemia Reperfusion Ischemia reperfusion (IR) induced injury is the most frequent source of hospitalizations in Canada [10]. Ischemia refers to an occlusion in the vasculature that obstructs blood flow, commonly observed in myocardial infarctions and strokes. The obstruction of blood flow prevents cells and organs from being perfused with oxygen and essential molecules to maintain function and survive; without resumption of blood flow  2  cells die via apoptosis and necrosis [11]. The duration of ischemia is positively correlated to the amount of cell death [12], therefore it is essential that resumption of blood flow commences immediately. Reperfusion involves the restoration of blood flow following reprieve from occlusion. Reperfusion itself is not without harmful effects as it is the major cause of post IR injury, often leading to cell death via apoptosis [11, 13]. One aspect of IR injury is the acceleration of apoptosis and necrosis of cardiomyocytes leading to arrhythmias and contractile dysfunction [14]. Cell death and reduced cardiomyocyte contractility are two important outcomes of IR injury. Several intracellular pathways become activated following reperfusion, leading to signalling cascades affecting cellular function, cell survival and inflammation. Reactive oxygen species (ROS) are released in IR leading to inflammation and increased expression of pro-inflammatory cytokines [11]. Apoptotic pathways involving mitochondria become activated triggering apoptosis [11, 15-18]. Calcium ion release from storage compartments into the cytosol of cardiomyocytes causes calcium overloading leading to cardiomyocyte stunning [19-22]. Stunning is defined as the inability of a cardiomyocyte to contract while maintaining other cellular activities [23]. Finally, TLRs are activated upon reperfusion triggering a pro-inflammatory signalling cascade regulated by NFκB [11]. Together, these intracellular pathways are often the cause or a participant in reducing cardiomyocyte contractility.  1.2.2 Septic Shock Sepsis is defined as an infection leading to a severe inflammatory response. Sepsis may progresses to severe sepsis, which is defined as sepsis plus organ dysfunction;  3  a common occurrence in critically ill patients [24-26]. These systemic problems commonly arise from bacterial or viral infections leading to release of inflammatory mediators into the blood stream. The innate immune system is the primary responder to pathogens and mounts an enormous early inflammatory response via TNFα and IL-1β, leading to expression of additional pro-inflammatory cytokines and chemokines. Due to the vigorous pro-inflammatory cytokine response, inflammatory cells are recruited and activated to secrete their own robust cytokine response. Septic shock encompasses severe sepsis with the inclusion of cardiovascular dysfunction [27-30]. This dysfunction manifests in both the cardiac and vascular systems. In septic shock blood pressure is low due to vasodilation and reduced ventricular filling in the heart which may contribute to cardiac depression [24]. Cardiac depression arises from a variety of deregulated process such as calcium trafficking and cytokine signalling [9, 24, 31, 32]. Cardiomyocyte contraction is a calcium-dependent process that requires synchronized trafficking. Sepsis is a considerably complicated illness that is able to manifest cardiac dysfunction via a myriad of pathways.  1.3  Toll-Like Receptors TLRs are components of the innate immune system and have a central role in  inflammation [33]. Initially discovered in drosophila [1, 34], TLRs have since been found on mammalian cells [34, 35]. Classified as trans-membrane proteins, TLRs interact with the extracellular environment in addition to affecting intracellular signalling. As trans-membrane receptors, TLRs are not solely expressed on the cell surface, but rather some are embedded in endosomal vesicles [36]. However, location and expression  4  of TLRs varies amongst different cell types [33]. There are currently 10 TLRs characterized in humans, with each binding one or more ligands [1, 37, 38]. TLRs are highly conserved throughout evolution and bind highly conserved pathogen associated molecular patterns (PAMPs) [33]. These molecular patterns are composed of bacteria or viral motifs, such as: cell wall components, flagellin, DNA, and RNA [33, 37]. Due to the variety of PAMP classes, each TLR has been found to bind specific molecular patterns. TLR2 commonly binds gram positive bacteria cell wall lipoprotein components such as peptidoglycan (PGN). TLR2 is able to differentiate between a variety of cell wall components by forming heterodimers with either TLR1 or TLR6 [33]. TLR2-TLR1 heterodimer recognizes triacylated lipoproteins, where as TLR2-TLR6 heterodimers recognize diacylated lipoproteins [36]. TLR3, commonly expressed internally on endosomes, is known to bind viral double stranded RNA (dsRNA) [39]. TLR4 binds gram negative cell wall component lipopolysaccharide (LPS) [33]. TLR4 is a highly characterized receptor that has been found to participate in the pathogenesis of several different inflammatory diseases, including cardiac dysfunction. In addition to binding LPS, TLR4 has been shown to bind a wide variety of endogenous ligands, such as: heat shock proteins, fibrinogen, and heparan sulphate [1]. Unlike all other TLRs, with the exception of TLR3, TLR4 is able to not only activate the MyD88-dependent pathway but the MyD88-independent pathway (TRIF pathway) as well [33]. Activation of both pathways gives TLR4 its versatile nature. TLR5 binds flagellin (FL), a protein monomer that is a component of flagella, the projection used in bacterial movement [33]. TLR 7/8 bind viral single stranded RNA (ssRNA) and are highly involved in initiating an interferon response to viral infection [36]. TLR9 binds bacterial DNA which is  5  characterized by unmethylated CG repeats, known as CpG. TLRs 7, 8, and 9 are generally considered endosomal TLRs, requiring lysosomal degradation of products to bind to these receptors. By virtue of the complete set of TLRs, a bacterial or viral infection rarely goes undetected.  1.3.1 Toll-Like Receptors On Cardiomyocytes  TLRs were initially thought to be expressed on leukocytes such as macrophages and dendritic cells; however, research in the last decade has shown that TLRs are in fact expressed on virtually every cell in the body [40]. Cardiomyocytes, the individual contracting cells of the heart express an array of these TLRs as well [40, 41]. TLRs expressed on cardiomyocytes are involved in mounting an inflammatory process and regulating cardiomyocyte contractility. Interestingly, ligation of a discrete set of TLRs (TLR 2, 4, 5) causes a decrease in cardiomyocyte contractility [41]. Conversely, ligation of TLR 3, 7, 8 or 9 does not reduce contractility, but does initiate an inflammatory response via NFκB [41].  6  Figure 1. TLR ligation via a discrete set of TLRs causes cardiac dysfunction. Toll-Like receptor stimulation impairs ventricular myocyte contraction. Primary murine ventricular myocytes were paced at 60 Hz following 24 hours incubation with TLR2 ligand S. aureus peptidoglycan (10 µg/ml), TLR4 ligand E. coli LPS (1 µg/ml) and TLR5 ligand, S. typhimurium flagellin (1 µg/ml). (A) Representative tracings of myocyte length vs. time paced at 1 bps. (B) Group mean fractional shortening of ventricular myocytes. Compared to CL treated cells, PG , LPS and Flagellin resulted in significantly decreased contractility. *p<0.05 vs. Control. Cardiovascular research by BRITISH MEDICAL ASSOCIATIO . Reproduced with permission of ELSEVIER BV in the format Journal via Copyright Clearance Center. [41]  Interestingly, TLRs play a substantial role in IR injury. TLR2 and TLR4 are major culprits in initiating the process of inflammation following IR. TLR4 expression is drastically increased on cellular surfaces following reperfusion injury [42], a common result seen in cells exposed to TLR4 ligand LPS. Surprisingly, TLR4 knockout mice that underwent IR had strikingly reduced size of infarct in addition to reduced cytokine expression compared to control [42]; indicating TLR4 plays a substantial role in the progression of IR injury. TLR2 plays a similar role in IR induced inflammation as TLR4. Sakata et al. were able to show in an ex-vivo IR model that TLR2 knockout mice had  7  greater recovery compared to wildtype [43]. Additionally, TLR2 knockout mice had greater preservation of left ventricular function, and less remodelling after a myocardial infarction compared to wildtype. However, despite preservation in function a similar infarct size and degree of neutrophil infiltration were present in both groups [44]. There is substantial evidence that TLR2 and TLR4 play a vital role in the progression of IR injury. However, the mode of TLR activation during ischemia reperfusion remains to be discovered.  1.4  Endogenous Ligands PAMPs are not the only ligands capable of binding to TLRs. Endogenous  molecules characterized as Danger Associated Molecular Patterns (DAMPs) have shown to have pro-inflammatory attributes. Interestingly, DAMPs possess dual functions intracellularly as well as extra-cellularly. Commonly, these DAMPS are released by necrotic cells, but studies have shown DAMP release by cells undergoing apoptosis and even cells under stress [45]. A wide variety of endogenous compounds have been characterized as DAMPs, including: High Mobility Group Box 1 (HMGB1) [36, 46]; heat shock proteins (HSP) which are chaperone proteins involved in protein folding; and degraded or cleaved components of the extra cellular matrix such as fibronectin [47], hyaluronic acid [48, 49] and versican [36, 49]. TLR ligation of DAMPs has shown to increase expression of inflammatory markers in a variety of cell types such as neutrophils, dendritic cells and macrophages, but cardiomyocytes have yet to be characterized. Due to the hydrophobic protein and lipid like structures of DAMPs, a fair quantity bind to TLR2 and/or TLR4 [50].  8  Figure 2. DAMP release in circulation during an ischemic episode. Molecules derived from injured tissue, blood vessels, and necrotic cells activate Toll-like receptors and induce inflammation. Following tissue and cell injury, endogenous ligands of Toll-like receptors (TLRs) are generated and/or released. Fragments of extracellular matrices (hyaluronic acid, fibronectin, heparan sulfate), fibrin and fibrinogen, and heat shock proteins (HSP) released from damaged tissue, blood vessels, and necrotic cells, respectively, activate TLR4, the LPS receptor. R A and chromatin-associated D A released from necrotic cells activate TLR3 and TLR9, respectively. When endogenous ligands activate TLRs the resulting immune response is similar to that induced by microbial products. Reproduced with permission of AMERICA SOCIETY FOR MICROBIOLOGY, in the format Journal via Copyright Clearance Center. [2]  The release of DAMPs into circulation has been observed in many inflammatory diseases such as: arthritis, multiple sclerosis, cancer tumor progression and cardiovascular events [51]. DAMPs have therefore become potential biomarkers for such events, but they may also be assisting in disease progression. Several cardiac diseases have shown dramatic increases in DAMP concentration in circulation. Positive correlations have been made between increased heat shock protein 70 (HSP70) levels and severity of hypertensive heart disease [51], cardiomyopathies [52], myocardial infarctions [53], heart failure [54], and septic shock [55]. Several heat shock proteins have shown to activate macrophages and dendritic cells via TLR2, TLR4 and TLR2TLR4 heterodimers [36], however effects on cardiomyocytes have yet to be established.  9  1.4.1 Heat Shock Protein 70 Heat shock proteins (HSPs) are intra-cellular chaperone proteins primarily involved in managing proper protein folding of newly translated, denatured or degraded proteins [56]. Additionally, HSPs are involved in repressing gene expression, modulating cell cycle progression and possess anti-apoptotic functions [45]. However, when released into the extracellular environment, HSPs act in a conflicting fashion. Stimulation of pro-inflammatory molecules, initiation of chemokine synthesis, and upregulation of co-stimulatory molecules are a few of the events that are triggered when HSPs are bound to cell surface receptors in the extracellular environment [45]. Although, HSPs may bind to multiple cell surface receptors (CD91, CD94, CD40, and LOX-1) ligation to TLRs have shown to have the greatest inflammatory consequences [56]. The ligation of extracellular DAMPs may be as pro-inflammatory as PAMP ligation to TLRs. Heat shock protein 70 (HSP70), the most widely studied of all HSPs, is able to activate NFκB similar to TLR4 ligand LPS in macrophages [57]. As a result, ligation of HSP70 to TLRs induces significant release of TNFα, IL-1b, and IL-6; all proinflammatory molecules that are known to trigger a robust inflammatory response in other cell types [45]. Due to its pro-inflammatory properties, there should be no surprise that elevated levels of HSP70 have been identified in many disease models such as: renal disease, sickle cell diseases, hypertension, and atherosclerosis [45, 58]. While conducting a clinical study on chronic heart failure, Genth-Zotz et al, discovered that serum levels of HSP70 were significantly elevated in heart failure patients compared to control patients [54]. Although no significant increase was detected, patients that had higher levels of serum HSP70 had increased mortality as well [54]. Heat shock proteins  10  are essential for proper cell function when intra-cellular, however when extra-cellular they may have pro-inflammatory effects.  1.5  NFκB Pathway The Nuclear Factor kappa B (NFκB) pathway is composed of several proteins  acting in a signalling cascade that trigger the transcription factor NFκB to promote transcription of several genes. The NFκB pathway may be triggered by several different cell surface receptors, such as TNF-R, IL-1R, CD40 and TLRs. TLRs are likely the most highly connected set of receptors to the NFκB pathway [59]. All TLRs with the exception of TLR3 activate NFκB and do so via the MyD88-dependent pathway [1]. The MyD88-dependent pathway is named so due to the heavy reliance of MyD88 as the main adaptor protein linking the intracellular binding domain of TLRs with the internal signalling cascade of the NFκB pathway. MyD88 binds to the TIR domain present on the cytosolic domain of the TLR. Once bound to the receptor MyD88 recruits the IRAK family of kinases. IRAK4 phosphorylates IRAK1 which then binds to the TRAF family of proteins in the next step of the pathway [1, 39]. IRAK1 phosphorylates TRAF6 activating it in the process; TRAF6 recruits TAB1 and TAB2 and modifies the ubiquitination of these proteins causing them to be activated. TAB1 and TAB2 in turn activate the IKK complex, which is composed of several IKK family proteins such as IKKα, IKKβ, and IKKγ (NEMO). This complex is vital for executing the final stage of the NFκB pathway. The IKK complex is responsible for phosphorylating and ubiquitinating IκBα [1, 39]. IκBα is the direct inhibitor of NFκB, preventing it from  11  entering the nucleus where NFκB promotes transcription of inflammatory genes. IκBα binds to NFκB directly covering its nuclear localization signal (NLS) thus preventing entrance into the nucleus [60]. Upon IκBα phosphorylation, the structure of the IκBα is modified allowing NFκB to be released and free for gene activation. IκBα ubiquitination directs it for degradation via the ubiquitin proteasome [39].  Figure 3. The MyD88-dependent and independent pathways in TLR4 signalling. (a) Schematic representation and (b) biological outcome of TLR4 signalling pathway. TLR4 can activate the MyD88-dependent pathway (blue arrows), which can also be stimulated by IL-1 and IL18 and ligands for other TLR family members. TLR4 also activates MyD88-independent pathways (orange arrows). For example, FκB activation can be induced, with delayed kinetics, in the absence of MyD88 and leads to induction of co-stimulatory molecules. Phosphorylation and nuclear translocation of IRF3 can occur in a MyD88-independent manner and is involved in IF -inducible gene expression. ature immunology by ATURE PUBLISHI G GROUP. Reproduced with permission of ATURE PUBLISHI G GROUP in the format Journal via Copyright Clearance Center. [33]  12  1.5.1 NFκB NFκB is a key transcription factor regulating pro-apoptotic, anti-apoptotic and most importantly inflammatory/immune response genes [12, 61-67]. Inhibition of NFκB via a direct chemical inhibitor (PDTC) can effectively abolish the expression of several inflammatory cytokines upon TLR stimulation [41]; identifying NFκB as a major regulator of cellular inflammation. The activation of NFκB triggers a relatively long process of gene transcription that starts immediately upon activation and can last for 48 hours [12, 68]. NFκB triggers gene expression in a multi-phasic manner, triggering proinflammatory genes such as TNFα, IL-1 and IL-6 early, followed by anti-inflammatory gene transcription in a delayed manner. Differential NFκB dimer formation is responsible for the multi-phasic activity [68]. Proper NFκB function is a fine balance of pro-inflammatory activation versus anti-inflammatory activation. Unfortunately, inflammatory diseases often have the balance heavily shifted to a pro-inflammatory state, with little to no resolution by anti-inflammatory measures. The active NFκB transcription factor is composed of a dimer of the Rel family of nuclear proteins [12]. The Rel family of proteins include: RelA (p65), RelB, cRel, p100 (NFκB1), p105 (NFκB2) [12, 69, 70]. These five proteins are separated into two classes based upon their requirement for activation [60]. The first class of proteins include RelA, c-Rel and RelB. These three proteins when activated are immediately ready to affect gene transcription. The second class, which includes p100 and p105, must be proteolytically cleaved to p52 and p50, respectively, in order to affect gene transcription [60]. Interestingly, all members of the Rel family are able to identify a NFκB consensus sequence, with only minor base pair substitutions accounting for specificity. Due to the  13  vast amount of stimuli that are able to trigger the NFκB pathway, the system has devised an intricate dimerization system that is able to manufacture an appropriate response. RelA and c-Rel are vital in the production of an IL-12 response in macrophages [60]. Leukocytic cells show pro-inflammatory expression in the presence of cRel-p50 dimers, but alternatively have p50-p50 homodimers in anti-inflammatory measures [68]. A sophisticated mechanism in which appropriate stimuli activate an appropriate response exists, and this is governed in part by the unique dimerization capabilities of the NFκB class of proteins. Additionally, a second measure of control is managed by the Inhibitor kappa B (IκB) family of proteins. There are five known IκBs: IκBα, IκBβ, IκBε, IκBγ and bcl-3 [60]. The IκBs prevent localization of NFκB by directly blocking the nuclear localization signal (NLS) and dimer binding site. In order for NFκB activation to occur, the IkB presently bound to NFκB must be degraded [60]. Depending on the IκB present, this can occur in a variety of ways. Inhibitor of kappa B kinase (IKK) complex of proteins are a part of the canonical pathway of activation, where as Nuclear factor kappa B-inducing kinase (NIK) is a part of the non-canonical pathway. Depending on the stimulus, one of these pathways govern which IkB is targeted for degradation, and thus which NFκB dimers will be released for the appropriate response.  1.5.2 Negative Regulators Of The NFκB Pathway The inflammatory response is essential for responding to and eliminating infections in addition to regulating repair. Control over the inflammatory response is crucial to maintaining a homeostatic environment within the body. Several inflammatory  14  disorders arise when this balance is altered to a pro-inflammatory state. Rheumatoid arthritis, asthma and sepsis are prime examples of a unbalanced inflammatory response [71]. Governed by the NFκB pathway, the inflammatory response must be managed in order to not exacerbate any problems currently existing. In order to prevent the positive feedback loop of cytokines triggering further inflammation such as TNFα stimulating IL6 and ICAM-1 expression, there must be a counter-regulatory measure put in place as a negative feedback loop. NFκB pathway regulators are proteins that oversee this duty. The array of pathway regulators is vast and diverse, encompassing: decoy receptors, splice variants, ubiquitinases, de-ubiquitinases, transcriptional regulators, micro RNAs and direct binding inhibitors [36]. The three most frequently used methods of pathway regulation: degradation, direct competition, and deubiquitination [72]. Although not all pathway regulators fall under the three categories, a vast majority do. The degradative family of inhibitors are active in the upstream portion of the NFκB pathway. Triad3A targets specific TLRs for degradation via ubiquitination using the E3 ubiquitin-protein ligase domain [72]. Interestingly, Triad3A is able to mark TLR3, 4, 5 and 9 for degradation but is unable to target TLR2 [72]. Similar to Triad3A, TRIM30α is able to target TAB2 and TAB3 for degradation. Contrary to Triad3A, TRIM30α works in a ubiquitin-independent manner, which has yet to characterized [72]. SOCS1 has been characterized in studies involving JAK-STAT signalling, but is also a NFκB pathway regulator. SOCS1 recognizes phosphorylated TLR adaptor molecules via a SH2 domain and polyubiquitinates them for proteosomal degradation. Interestingly, all three members of the degradative class of inhibitors function in unique ways to target proteins in the signalling cascade for degradation.  15  The direct competitor family of proteins are frequently found binding to the cytosolic region of TLRs. Binding to the TIR domain of TLRs prevents essential adaptor molecules such as MyD88 from continuing the pro-inflammatory signalling cascade. MyD88s is a splice variant of the MyD88 adaptor protein that does not possess an essential intermediate domain. Therefore, MyD88s has the ability to bind to the TIR domain on TLRs but is not able to phosphorylate the IRAK1-IRAK4 complex, rendering it inactive and unable to continue down the signalling cascade [72, 73]. Alternatively, MyD88s is able to bind to MyD88 and form a dimer, preventing any further signal transduction [72, 73]. SARM, similar to MyD88s is a decoy adaptor molecule, however it regulates the MyD88-independent pathway or TRIF pathway [72]. SARM is able to bind to the TIR domain thus effectively blocking TRIF binding to the TIR domain [72]. The alternative to decoy adaptor molecules preventing signalling is TLRs that are unable to initiate a signalling cascade; such is the case for soluble TLRs. Soluble TLRs (sTLRs) may arise as splice variants or proteolytically cleaved receptors free in the extracellular space. Overexpression studies of sTLR4 have led to decreased NFκB activation in endotoxic models [72]. Splice variants of genes have been established for many years, but intentional splice variant expression to regulate signalling pathways may be a unique feature of the NFκB pathway. The deubiquitination family of inhibitors are proteins able to de-ubiquitinate proteins that are activated via ubiquitination. Although many signalling cascades are comprised of phosphorylation based signal transduction, the NFκB pathway has a dual regulated signalling pathway comprised of phosphorylation regulated proteins as well as ubiquitin regulated proteins. Pathway members such as the TRAF family and RIP family  16  proteins are regulated/activated through polyubiquitination of lysine residues [74, 75]. DUBA, is a de-ubiquitinizing enzyme that interacts with TRAF3, inhibiting type I IFN production [72]. TRAF3 is part of a viral defence pathway regulated by TLR3, TLR7 and TLR9. CYLD has many de-ubiquitin targets as it has been shown to regulate TRAF, NEMO, bcl-3, TAK1, RIP1 as well as other proteins [72]. CYLD has significant affects on TLR2 generated signalling [72]. The final de-ubiquitinating enzyme is TNFAIP3, also known as, A20. A20 is the most prominent of the de-ubiquitinating proteins as it was the first one discovered. A20 binds to the TRAF family of proteins, specifically TRAF1, TRAF2 and TRAF6 [71, 76], RIP1 [77], as well as NEMO in the IKK complex [71].  Figure 4. egative regulators of the FκB pathway. The negative regulators of TLR signaling pathways. The negative regulators were marked using the brown color around their target proteins. Reprinted from Microbes Infection, Vol 11 / edition 3, Wang, J., et al., egative regulation of Toll-like receptor signalling pathway. pages 321-7, Copyright (2009), with permission from Elsevier [72]  17  There are a wide variety of methods of regulating NFκB pathway activity. Unfortunately, such an intensive system of regulation is not present in all cell types as certain regulators or inhibitors are cell type specific. As a result, deficiency in any one of these regulators leads to severe consequences regularly leading to a diseased state. Regrettably, these negative regulators are unable to compensate for deficiencies in each other [72].  1.5.3 A20 And TNIP1 A20 is a member of the NFκB regulatory system as it de-ubiquitinates several essential proteins in the inflammatory pathway and targets them for degradation. Initially discovered as an inhibitor of TNF induced apoptosis, A20 has shown to play an essential role in regulating the NFκB driven inflammatory response [71, 78]. Interestingly, A20 expression is mediated in a NFκB-dependent fashion [79]. This demonstrates a NFκB dependent feedback mechanism that is able to regulate itself. A20 is a unique molecule due to its dual opposing functional processes as a ubiquitinizing and de-ubiquitinizing protein [36]. A20 is classified as a zinc finger protein containing seven zinc finger domains and an OTU domain. The OTU domain mediates the binding and de-ubiquitination of Lys63 on TRAF6, RIP1, RIP2 and NEMO [80, 81]. Following the de-ubiquitination, these same proteins are polyubiquitinated on Lys48 by the seven zinc fingered domain of A20, effectively targeting them for degradation [72]. Interestingly, A20 activity can be increased substantially following phosphorylation of Ser381 by IKKβ, thus inhibiting NFκB activity at a greater rate. A20 does require assistance to  18  complete its duties. The zinc fingered region dimerizes with TNIP1 and TAX1BP1, two proteins that assist A20 in binding to their respective targets [80].  Figure 5. A20 protein domain structure. Schematic representation of the structural domains of human A20 involved in its ubiquitin-editing function and interaction with regulatory proteins. The -terminal OTU domain mediates the deubiquitinating activity of A20 on RIP1, RIP2, TRAF6, and EMO, whereas the C-terminal zinc finger domain mediates its ubiquitin ligase activity on RIP1. Regions involved in specific proteinprotein interactions or post-translational modifications of A20 are also indicated. This research was originally published in Journal of Biological Chemistry. Coornaert, B., I. Carpentier, and R. Beyaert, A20: central gatekeeper in inflammation and immunity. J Biol Chem, 2009. 284(13): p. 8217-21. © The American Society for Biochemistry and Molecular Biology. [80]  TNFAIP3 interacting protein 1 (TNIP1) is an essential component of the A20 inhibiting process as it mediates proper binding to its targets. The primary setting of the A20-TNIP1 interaction occurs near the IKK complex. The target of choice is the IKKγ/NEMO regulatory subunit of the IKK complex. TNIP1 is able to bind to A20 and NEMO/IKKγ directly via the ubiquitin binding domain (UBD) [82]. This dual binding ability facilitates the A20 de-ubiquitination of Lys63 on NEMO, preventing NFκB activation. Interestingly, deletion of either binding region on TNIP1 still allows for the inhibitory process to continue [83]. However, deletion of both binding regions renders the inhibitory process ineffective. Over-expression of TNIP1 is able to increasingly  19  inhibit NFκB activation by TNF, IL-1β and LPS stimulation. However, this effect is abolished in A20 knockout models [82]. Therefore, even as an adaptor TNIP1 is capable of altering NFκB inhibition. Although characterized as an adaptor protein, TNIP1 has shown to have anti-apoptotic function independent of A20 [82]. The anti-apoptotic function is the result of TNIP1 inhibiting caspase-8 activation in response to TNF [82]. Although. TNIP1 assists A20 in its task it is able to affect cellular processes independently.  Figure 6. A20’s methods of FκB pathway inhibition. Model for the role of A20 phosphorylation at Ser381 in the inhibition of FκB responses. Recognition of pathogens or proinflammatory cytokines by cells of the innate immune system leads to activation of IKKβ. Active IKKβ leads to the transcription of FκB target genes, including A20. If IKKβ activity remains high following A20 translation, IKKβ phosphorylates this newly translated A20 at serine 381. This phosphorylation increases the activity of A20, allowing it to more forcefully downregulate the FκB pathway. Molecular Cell Biology, 2007, 27, pg. 7451, reproduced/amended with permission from American Society for Microbiology [77]  20  1.5.4 A20 And TNIP1’s Physiological Effects Not surprisingly, deregulation of the NFκB response translates to pathological conditions such as arthritis, atherosclerosis, and Crohn’s disease [71, 80]. The use of NFκB regulators has revealed promising results and potential targets for therapy in the future. Mitigating the inflammation induced by NFκB activation is the primary goal of these regulators. The effects of A20 and TNIP1’s inhibitory functions are most clearly observed in quenching NFκB driven inflammatory processes. A20 over-expression experiments have yielded very promising results in reducing the NFκB governed inflammatory responses. NFκB governed molecules such as IL-6, IL-8, E-selectin, ICAM-1, VCAM-1 and even reactive oxygen species (ROS) were all down-regulated in the presence of over-expressed A20 [71, 79]. Indicating that activated A20 is able to substantially reduce NFκB driven inflammation. When discussing regulating NFκB activity, consideration of signalling pathways and their affects on cardiomyocyte function must be examined. Since many inflammatory diseases stem from uncontrolled inflammation, the use of NFκB regulators has become a new target for potential therapies for various diseases. Recent studies have shown A20 over-expression in mice can be protective in an atherosclerosis model [80]. In a myocardial infarction model measuring inflammatory output, A20 over-expression had a surplus of positive activity. A20 over-expression led to reduced neutrophil and macrophage infiltration into the myocardium; reduced TNFα, IL-1b, IL-6, MCP-1 expression; reduced cytochrome c release from mitochondria, and reduced IκBα phosphorylation and degradation [84]. Of greater value was that A20 over expression led to reduced infarct size as well as improved cardiac function after a myocardial infarction  21  [84]. In contrast, single nucleotide polymorphisms (SNPs) in A20 are associated with an assortment of diseases. Rheumatoid arthritis, Crohn’s disease, systemic lupus erythomatosus, and coronary artery disease (CAD) in type II diabetic patients are diseases associated with a mutation in the A20 gene [80]. Interestingly, transgenic mice that have A20 deleted from their genome die shortly after birth due to severe inflammation and multi-organ failure [36]. Unmistakably, A20 is an essential protein in both development and in regulating inflammation as evidenced by the multitude of diseases and disruptions that arise from mutated forms.  1.6  Tolerance  1.6.1 TLR Tolerance Cellular tolerance involves activation of a network of molecules that limit the extent of an inflammatory response to further re-stimulation. TLRs are able to participate in cellular tolerance due to activation of a common pathway, the MyD88-NFκB pathway. Several studies have proven that priming of a TLR prior to a second stimulus will lead to an overall diminished pro-inflammatory response [85-89]. Interestingly, due to common signalling pathways between different TLRs, stimulation of one TLR can affect the response of a different TLR’s stimulation. This method of inducing tolerance is characterized as “cross tolerance”. In this method, the response may promote further inflammation or dampen further inflammation; the affects of which are governed by a variety of factors including, cell type, TLRs involved, and time span between first and second stimulation [86]. Dalpke et al, analyzed cross tolerance capabilities of  22  macrophages both in vitro and in vivo. Surprisingly, in vitro and in vivo data had discrepancies. Although TLR9 stimulation with CpG was able to induce cross-tolerance to TLR2 and TLR4 in vitro in RAW264.7 macrophages, it was unable to do so in vivo [86]. Therefore, choice of experimental model has a profound effect on the outcome of cross-tolerance.  1.6.2 Ischemia Reperfusion Tolerance TLR activation of the NFκB pathway contributes to the progression of IR injury, affecting inflammation, infarct size and cell death [14]. Several decades of research have shown short episodes of ischemia reperfusion can significantly attenuate the severity of cardiac dysfunction and infarct size [43, 90]. Priming via short bouts of ischemia trigger NFκB and its regulatory networks in preparation for a subsequent stimulus. Knowledge of the mechanistic details regarding ischemic pre-conditioning follows similar mechanisms involving TLR tolerance. Given that activation of the TLR through NFκB pathway is common to inflammation and IR injury, inflammatory tolerance may be induced to prevent ischemic injury. Cross tolerance using TLR ligands in place of short ischemia may prove efficacious in reducing cardiac injury.  23  Figure 7. Ischemic tolerance reduces inflammation. A model for delayed ischemic tolerance. Preconditioning stimuli as well as severe ischemic insults induce inflammation followed by suppression of the innate immune system. The induced immune responses, both inflammation and immune suppression, are proportional to the intensity of the initial insult or treatment. Consequently, immune responses initiated by preconditioning are limited in time and extent. By contrast, a severe ischemic insult induces excessive inflammation, followed by robust immune suppression. Inflammation is mediated primarily by the action of cytokines such as T F, IL-1, and IL-6. The immune suppression is mediated by feedback inhibitors of inflammation, which include decoy receptors and inhibitors of TLRs and cytokine signalling cascades. Because the initial preconditioning stimulus and the subsequent inflammation both contribute to induction of the feedback inhibitors, inflammation wanes gradually and immune suppression increases. Excessive immune responses are detrimental because severe inflammation promotes coagulation and aggravates ischemia, while massive immune suppression permits infection to spread unchecked. During ischemic tolerance, a severe ischemic insult occurs during an immune suppressed state, both the inflammation and subsequent immune suppression are diminished. The predicted extent of inflammation and immune suppression caused by ischemia without preconditioning is indicated by the red and green dashed lines, respectively. Because severe inflammation and immune suppression exacerbates ischemic damage, limiting these reactions is protective and provides ischemic tolerance. Molecular and cellular biology by AMERICA SOCIETY FOR MICROBIOLOGY. Reproduced with permission of AMERICA SOCIETY FOR MICROBIOLOGY, in the format Journal via Copyright Clearance Center. [2]  Cross tolerance via TLR ligand priming has proven successful in a broad range of ischemic models. LPS pre-stimulation has proven to mitigate myocardial IR induced injury [91, 92]. Lipoteichoic acid, a ligand for TLR2 has shown similar outcomes when used as a pre-conditioning agent for myocardial IR injury [93]. Liver IR models have shown similar results with CpG as the pre-conditioning agent [89]. Additionally, CpG has been shown to prevent neuronal death when used as a pre-conditioning agent in an 24  ischemic brain injury model [94]. The use of TLR ligands successfully can mitigate the negative effects of NFκB driven inflammation in an IR model.  1.7  CPG TLR9 recognizes short sequences of bacterial DNA that are referred to as CpG  oligonucleotides [33, 36]. Unlike mammalian DNA, bacterial DNA is unmethylated on cytosine nucleotides. This distinction is one method in which the body is able to discriminate from self-DNA to produce an inflammatory response. As means of experimenting with TLR9 ligands, synthetic versions of bacterial DNA have been created and are commonly referred to as CpG oligonucleotides (ODNs). CpG ODNs have shown to have identical effects as bacterial DNA on the NFκB driven inflammatory response [95]. CpG ODNs directly activate dendritic cells, macrophages, B cells and cause an aggressive Th1 response [33, 36, 37, 96]. Interestingly, the DNA sequence and backbone composition affect the type of inflammatory response produced [96]. As a result, three different classes of CpG have been created, CpG A, CpG B, and CpG C. Each class contains a sterile counterpart (NCpG) that should not induce a response. NCpGs are similar to CpG except CG repeats are replaced with random nucleotide pairs. CpG A is composed of a dual phosphorothioate-phosphodiester backbone, in addition to containing a poly G tail and a palindromic CpG motif [96]. CpG A triggers the secretion of type I IFN by dendritic cells [95, 96]. CpG B contains multiple CpG motifs as well as a complete phosphorothioate backbone [36]. The phosphorothioate backbone prevents the ODN from being cleaved by nucleases due to a non-existent di-ester bond. CpG B elicits B cell and NK cell activation and the release of cytokines from dendritic cells [95, 96]. CpG C is considered a hybrid of both CpG A and CpG B as its sequence characteristics  25  are similar to CpG A, but it contains a phosphorothioate backbone like CpG B. Sharing characteristics, CpG C is able to produce an IFN response similar to CpG A and still stimulate B cells very strongly [96]. Interestingly, CpG C stimulation down-regulated expression of TLR4 associated protein CD14 and increased expression of T cell costimulatory molecule CD80 on monocytes [96]. This may indicate CpG is able to down regulate the innate immune response and focus on activating the adaptive immune system. Table 1. CpG OD Sequences  Compound  ODN Type  Sequence  CpG A  2336  GGG*G*A*C*G*A*C*G*T*C*G*T*G*GGGGGG  NCpG A  2243  GGG*G*G*A*G*C*A*T*G*C*T*G*GGGGGG  CpG B  1826  TCCATGACGTTCCTGACGTT  NCpG B  2138  TCCATGAGCTTCCTGAGCTT  CpG C  2395  TCGTCGTTTTCGGCGCGCGCCG  NCpG C  2137  TGCTGCTTTTGTGCTTTTGTGCTT  * denotes a phosphodiester backbone, remainder are phosphorothioate backbone.  In a study by Klaschik et al, CpG is regarded as a key activator of the antiinflammatory response [95]. The study involved monitoring the gene expression profile via microarray of spleenocytes stimulated with CpG from 30 minutes through to 72 hours. A key result of this study was that NFκB responds in a multi-phasic pattern. A pro-inflammatory response is first observed from 0 to 3 hours. However, following this three hour time point a strong anti-inflammatory response is activated. Several NFκB pathway regulators are activated such as: NFΚBIA (IκBα), SOCS1, and SOCS3. The  26  pro-inflammatory response is effectively quenched by these pathway regulators within a 24 hour span. CpG not only is able to produce a mild pro-inflammatory response, but more importantly is able to trigger a sustained anti-inflammatory response.  27  Chapter 2  Hypothesis  Acute cardiac dysfunction is a disease process that is regulated by the activation of a variety of pathways including the TLR-NFκB pathway. TLR ligation appears to induce cardiac dysfunction whether in an infectious state or in an IR state. In addition to inflammatory mediators affecting cardiomyocyte function a discrete set of TLRs on cardiomyocytes are able to affect cardiomyocyte functions as well [41]. Endogenous ligands have shown to have TLR activating capabilities in immune cells but have yet to be characterized in cardiomyocytes. With the high expression of endogenous ligands in serum during cardiac events, it is highly likely that these endogenous molecules trigger adverse inflammatory reactions. TLR tolerance has proven to be an effective strategy attenuating the inflammatory response to subsequent stimuli in cardiomyocytes; however many of these TLR ligands can produce adverse reactions that lead to fever, sepsis, and even death. Therefore, identifying a TLR ligand capable of activating NFκB but without the negative proinflammatory and reduced contractility effects of endotoxin would be extremely beneficial in potentially reducing acute cardiac dysfunction and inflammation. Therefore, I hypothesize that endogenous mediators do cause cardiac dysfunction and that this cardiac dysfunction can be circumvented by use of CpG as preventative therapy.  2.1  Specific Aims  1) To establish if endogenous molecules are able to trigger NFκB activation and contractile dysfunction in cardiomyocytes.  28  2) Determine if TLR9 ligand CpG is a suitable candidate to induce tolerance without causing detrimental inflammatory effects.  3) Determine if cross tolerance is achievable in cardiomyocytes via pre-stimulation with CpG followed by stimulation with LPS in an endotoxin model. a. Can CpG counteract the effects of endogenous mediators in a similar fashion to natural TLR ligands.  4) Determine if CpG- mediated pre-conditioning affects cardiac IR using an IR injury model.  5) Determine the mechanism by which CpG preserves cardiac function and limits inflammation.  29  Chapter 3 Extracellular Heat Shock Protein 70 Induces Cardiomyocyte Inflammation And Contractile Dysfunction Via TLR2  3.1  Introduction Cardiomyocytes express innate immune Toll-like receptors [41]. Activation of a  discrete set of these TLRs (TLR 2, 4, 5) on cardiomyocytes using exogenous PathogenAssociated Molecular Patterns (PAMPs) such as peptidoglycan for TLR2, lipopolysaccharide for TLR4, and flagellin for TLR5, leads to a NFκB-mediated cardiomyocyte inflammatory response and a concordant decrease in contractility [41, 97]. Cardiomyocytes, unlike immune cells, are not routinely exposed to pathogens or PAMPs, but diverse stimuli [98-103] leading to endogenous Damage-Associated Molecular Patterns (DAMPs) may be important mediators of acute cardiac dysfunction. DAMPs, like PAMPs, activate TLRs. DAMPs are rapidly up-regulated by the host at the site of injury, have distinct intracellular and extracellular roles, and activate innate immune signalling [104-106]. A variety of molecules have been classified as DAMPs including fibronectin [47], elastase [107], chromosomal DNA [108], HMGB1[14], and heat shock proteins[109]. TLRs have been implicated in cardiac dysfunction following nonpathogen related injury, such as IR, suggesting activation of TLR signalling by endogenous DAMPs [110-112]. However, identification and understanding of endogenous DAMPs which induce TLR signalling with functional consequences in cardiomyocytes is incomplete.  30  TLR-mediated cardiac dysfunction induced by PAMPs requires NFκB signalling [41, 97]. Accordingly, in transgenic mice with a NFκB-luciferase reporter gene expressed in cardiomyocytes, we measured responses to the DAMPs: HSP60, HSP70, and HMGB1. Among these DAMPs we found HSP70 to be the strongest inducer of NFκB activity; HSP70’s plateau effect was substantially greater than that of the “positive control” PAMP; E coli lipopolysaccharide (LPS). Therefore, we tested for a direct effect of HSP70 on cardiomyocyte inflammatory and contractile function. In immune cells [109, 113] and endothelial cells [56, 114] HSP70 is a ligand for TLRs. In the heart TLR2 and TLR4 are most prominently involved following IR insults [56, 109, 112]. Therefore, we focused on these TLRs in order to identify and understand the signalling pathways leading to the effect of HSP70 on cardiomyocytes.  3.2  Materials and Methods  All animal studies were approved by the University of British Columbia Animal Care Committee and conformed to NIH guidelines.  Cell line: HL-1 cells are an immortalized cell line with adult cardiac morphological, biochemical, and electrophysiological properties, including contraction and biochemical response to cognate ligands. The cell line was kindly provided by Dr William Claycomb (Tulane University, New Orleans, Louisiana). Cells are grown in complete supplemented Claycomb media (JRH Biosciences, Lenexa, Kansas). Stimulations are performed with 90-100% confluent cells.  31  Primary murine cardiomyocytes: Murine ventricular myocytes were isolated from 10to 14-week-old male mice. Strains were obtained from Jackson laboratory (Bar Harbor, Maine) and included background strain (C57BL/6), NFκB-luciferase knock-in mice (B10.Cg-H2k Tg(NFκB/Fos-luc)26Rinc/J), TLR2 knock-out (B6.129-Tlr2tm1Kir), TLR4 knock-out (B6.B10ScN-TlR4), and MyD88 knock-out mice (courtesy of Dr Salman Qureshi and Dr S. Akira). Cardiomyocyte isolation and cell culture was performed as previously described [41].  Rat primary cardiomyocyte isolation for contractility measurement: Murine cardiomyocyte contractility is substantially less than that of rat cardiomyocytes [97]. Therefore, to optimize sensitivity of contractility measurements we used rat cardiomyocytes. Isolation of adult rat cardiomyocytes was performed as previously described [97]. The cells were incubated for 90 minutes in 95% O2, 5% CO2. The medium was then changed to fresh M199 with 5% BSA and the cardiomyocytes were incubated for 24 h to allow them to become relatively quiescent. After 24 h cells were considered viable if they demonstrated a characteristic rod shape without membrane blebbing.  Measurement of cardiomyocyte FκB activity: Twenty-four hours after isolation, primary cardiomyocytes from NFκB-luciferase1 knock-in mice were incubated with endotoxin free HMGB1 (0.06-6 µg/mL), HSP60 (0.1-10 µg/mL, low endotoxin), HSP70 (0.1-10 µg/mL, low endotoxin) (all from StressGen, Victoria, BC), and the positive  1  NFκB-luciferase methodology can be found in Appendix 1  32  control PAMP, E Coli derived LPS (0.1-10 µg/mL) (Invivogen, San Diego, CA). After 24 h of incubation cell lysates were collected and 60 µL of each were added to duplicate wells in a luminometry plate and read using the Dual-Luciferase Reporter Assay (Promega #1910) using a Fluostar Optima Luminometer (BMG Labtech, Durham NC). Relative Light Units (RLU) were obtained for Firefly-Luciferase and all results were normalized to µg protein lysate.  Calcium flux assay: HL-1 cells grown to confluence on 4-well LabTek cover slips chambers (Sigma, Oakville, ON) are incubated for 30 minutes with 2.5 µM Fura-2 calcium-gated fluorescent dye (Molecular probes). Fluorescence is captured using a photomultiplier detector (Ionoptix corp, Milton, MA) and analyzed using an Ionoptix Softedge detection package that directly yields dynamic cardiomyocyte calcium flux (Ionoptix corp, Milton, MA). Calcium flux is calculated as peak to baseline difference in the ratio of emissions from excitation wavelengths 340/380 nm.  Cardiomyocyte inflammatory marker mR A expression: ICAM-1, IL-6 and KC are NFκB regulated molecules which define a myocardial inflammatory response [41, 115]. ICAM-1 is most relevant to inflammatory cardiac contractile dysfunction as ligation of cardiomyocyte ICAM-1 decreases cardiac contractility via interaction with the structural cytoskeleton [4, 5, 41, 116, 117]. Additionally, although their cardiac function is unknown, IL-6 and KC expression have shown to be significantly up regulated in myocardial inflammatory states [41]. Thus, we assessed the cardiomyocyte inflammatory response by measuring ICAM-1, IL-6, and KC mRNA expression. HL-1 cells were  33  incubated with HSP70 (10 µg/mL) for 6 h and harvested in 1 mL Trizol (Invitrogen, Carlsbad, CA). RNA was extracted as per the manufacturer's instructions, and DNase treated using AMBION TURBO DNA-free DNase (Austin, TX) to remove genomic contamination. ICAM-1, IL-6 and KC mRNA was quantified using SuperScript III Platinum SYBR-GREEN One-Step qRT-PCR2 Kit with ROX (Invitrogen, Carlsbad, CA). PCR conditions were 40 cycles at 95oC for 15 seconds, 56oC for 30 seconds and 72oC for 30 seconds. Primers were as follows: ICAM-1 Forward 5’–gcaagtccaattcacactgaatg-3’, ICAM-1 Reverse 5’–cagagcggcagagcaaaag-3’. IL-6 Forward 5’–ggccttccctacttcacaag-3’, IL-6 Reverse 5’–atttccacgatttcccagag-3’. KC Forward 5’–tgttgtgcgaaaagaagtgc-3’, KC Reverse 5’–acacgtgcgtgttgaccata-3’.  Measurement of cardiomyocyte fractional shortening: Isolated rat cardiomyocytes were cultured as above for 24 h. Cells were then incubated with 10 µg/mL of HSP70 (StressGen, Victoria, BC) or vehicle control for 6 h. Following this incubation, cardiomyocytes were stimulated at 140V using a Grass S48 stimulator (Grass-Telefactor, Warwick, RI). Images were captured using a Myocam video camera (Ionoptix Corp, Milton, MA) and analyzed using Ionoptix SoftEdge detection package (Ionoptix Corp, Milton, MA). Fractional shortening was calculated as the difference between diastolic and systolic length, divided by diastolic length.  Effect of Blocking TLR binding: Isolated rat cardiomyocytes were cultured in a Matrigel (BD Biosciences) coated 96 well plate for 24 h in M199 media + 5% BSA.  2  qRT-PCR methodology can be found in Appendix 1  34  Cells were incubated overnight with 25 µg/mL of blocking antibodies to TLR2, TLR4 or isotype control antibodies (eBioscience, San Diego, CA). Cells were then incubated with HSP70 (10 µg/mL) for 4 h followed by measurement of fractional shortening, as above. Cell viability after treatment was determined by counting the number of rod shaped cells per high power field (HPF, 100x magnification).  Statistical analysis: All values are expressed as means ± SD. For each experimental condition and time point, three independent replicate analyses were performed, unless otherwise noted. ANOVA and a post-hoc Bonferroni correction was used to identify significant differences between groups. The analyses were performed using SigmaPlot (San Jose, CA) and statistical significance was set at p<0.05.  3.3  Results  DAMPS, and HSP70 in particular, induce FκB signalling. TLR-mediated cardiac dysfunction requires NFκB signalling [41]. Therefore we used primary cardiomyocytes isolated from a mouse strain containing an NFκB-Luciferase reporter gene to compare the effect of the DAMPs: HSP60, HSP70 and HMGB1 to a potent positive control PAMP (LPS) on NFκB transcriptional activity in the heart. Previous published data and preliminary dose-response experiments over a 100-fold concentration range determined plateau doses to be 10 µg/mL for HSP60 [118], 10 µg/mL for HSP70 [57, 119], 6 µg/mL HMGB1 [120] and 10 µg/mL LPS [97]. The DAMPs HSP60, HSP70, and HMGB1 increased NFκB transcriptional activity compared to controls. HSP70 stood out (4.1 ±  35  0.6 fold increase in NFκB activity vs. control, p=0.007) compared to the other DAMPs and even LPS (p=0.01) in inducing NFκB transcriptional activity (Figure 8). Subsequent experiments focused on HSP70.  Figure 8. DAMPS activate the FκB pathway. The DAMPS HSP60, HSP70 and HMGB1 strongly induce FκB in cardiomyocytes. Isolated cardiomyocytes derived from FκB-luciferase mice are incubated for 24 h in either standard culture media or media containing plateau dose LPS (10 µg/ml), HSP60 (10 µg/ml); HSP70 (10 µg/ml), or HMGB1 (6 µg/ml). All treatments demonstrate increased FκB transcriptional activity vs. CL (*), whereas HSP60 and HSP70 activity is significantly greater than LPS (**), p<0.05.  HSP70 reduces fractional shortening of isolated rat cardiomyocytes without altering calcium flux. Following 6 h of exposure to 10 µg/mL HSP70, contractility of isolated rat cardiomyocytes was significantly decreased compared to saline control treated cells (p<0.001). HSP70 treated cardiomyocytes shortened only 58 ± 2.4 % of control stimulated cells (Figure 9A and B). Generally, inhibition of cardiomyocyte contractility relates either to a reduction in calcium flux or to an uncoupling of excitation-contraction. Using real-time Fura-2 based fluorescence as a surrogate of calcium flux in spontaneously beating HL-1 cardiomyocytes exposed to HSP70 we found no significant  36  decline in calcium flux due to HSP70 versus controls (mean flux 2.3 ± 0.3 in each case) (Figure 9C).  Figure 9. HSP70 reduces fractional shortening without disrupting calcium flux. 9A and B: Isolated cardiomyocytes derived from rats were plated for 24 h, then exposed to 10µg/ml HSP70 or vehicle control for six hours then paced for assessment of their contractility estimated by fractional shortening. Compared to control cardiomyocytes, those exposed to HSP70 had a large and statistically significant reduction in fractional shortening. 9C: Spontaneously beating HL-1 cardiomyocytes were incubated with 10µg/ml HSP70 or vehicle control. Calcium flux as measured by Fura-2 fluorescence is taken after 24 h and representative traces shown. Group mean data ( =75) demonstrated no significant difference in calcium flux. * p < 0.001 vs. control.  HSP70 induces a cardiomyocyte inflammatory response. HL-1 cultured cardiomyocytes were stimulated with HSP70 (10 µg/mL) for 6 h. A qRT-PCR analysis of mRNA expression revealed an increase in several inflammatory markers. The cell adhesion molecule, ICAM-1, had increased expression by 1.6 ± 0.2 fold that was significantly  37  elevated compared to control (p = 0.03). KC expression was increased by 6.9 ± 0.3 fold compared to control (p < 0.001). IL-6 expression was increased by 2.3 ± 0.3 fold compared to control (p = 0.003). (Figure 10)  Figure 10. HSP70 induces expression of inflammatory markers. HSP70 stimulation of HL-1 cardiomyocyte cell line for 6 h is able to significantly increase expression of several inflammatory markers compared to controls (CL). ICAM-1 expression (1.6 fold ± 0.2, p = 0.006), KC expression (6.9 fold ± 0.3, p < 0.001) and IL-6 expression (2.3 ± 0.3, p = 0.003) were all significantly increased compared to controls. * p < 0.05 vs. control.  HSP70 acts via TLR2 to induce a cardiomyocyte inflammatory response. TLR2 and TLR4 signalling have been implicated in the TLR response to HSP70 in immune cells  38  [109]. Therefore, we measured the cardiomyocyte inflammatory molecule known to functionally reduce contractility [97, 121], ICAM-1, in response to HSP70 in cardiomyocytes isolated from mice deficient in TLR2, TLR4 or the downstream adaptor molecule MyD88. As illustrated in Figure 11, HSP70 increased ICAM-1 mRNA expression in cardiomyocytes from the background murine strain by 2.1 ± 0.2 fold (p<0.001). Cardiomyocytes derived from TLR4 deficient mice similarly increased ICAM-1 mRNA expression following exposure to HSP70 by 2.0 ± 0.15 fold (p = NS vs. wildtype cardiomyocytes). In contrast, HSP70 exposure in TLR2 knock-out and MyD88 cardiomyocytes did not increase ICAM-1 mRNA expression (p<0.001 compared to the wildtype response). These results implicate TLR2 and its downstream adaptor molecule, MyD88, in the HSP70-induced cardiomyocyte inflammatory response.  Figure 11. HSP70 activates inflammation in a TLR2 dependent manner. HSP70 induces ICAM-1 expression in cardiomyocytes through TLR2 and MyD88. Primary cardiomyocytes derived from background strain mice (C57BL/6), TLR2 knockout, TLR4 knockout and MyD88 knockout mice were incubated for 6 h with 10 µg/ml HSP70. ICAM-1 is highly induced in wildtype and TLR4 knockout mice, while mice deficient in TLR2 or MyD88 do not up-regulate ICAM-1 in response to HSP70. ( =3 for each group)  39  HSP70-induced reduction in fractional shortening is also dependent upon TLR2. To confirm that like the inflammatory response, the cardiomyocyte functional response is similarly dependent on the TLR2 signalling pathway we repeated measurements of fractional shortening following overnight incubation with blocking antibodies to TLR2, TLR4 or isotype control. Following the overnight incubation, cardiomyocyte fractional shortening in controls was less than observed in controls in Figure 9a, likely related to interrupted incubation with blocking or isotype control antibodies (control fractional shortening 12 ± 0.8 %). Nevertheless, incubation with 10 µg/mL HSP70 resulted in a similar 25 ± 2.6% decrease in fractional shortening from the control value in isotype control antibody incubated cells (Figure 12). TLR4 blocking antibody had no effect on the HSP70 induced reduction in fractional shortening. Importantly, pre-treatment with TLR2 blocking antibody prevented the reduction in fractional shortening following exposure to HSP70.  40  Figure 12. HSP70 requires TLR2 to decrease contractility. Isolated cardiomyocytes derived from rats were incubated overnight with blocking antibodies to TLR2, TLR4 or isotype control. They were then exposed to 10 µg/mL HSP70 or vehicle control for four hours then paced with contractility estimated by fractional shortening. Compared to cells treated with vehicle control, fractional shortening was significantly reduced by HSP70. TLR2 blocking antibody reversed this effect while TLR4 blocking antibody as well as isotype control antibody had no effect.  HSP70 interaction with TLR2 results in cardiomyocyte cell death. While intracellular HSP70 is known to prevent cell death [122], its extracellular effects are not known. During preliminary contractility experiments we noted a profound effect of HSP70 on cardiomyocyte survival, with a clear decline in survival in those cells exposed to HSP70. Following isolation, equal numbers of cells were plated in each well. Sixteen hours prior to the addition of 10µg/ml HSP70 or saline, cells were incubated with a blocking antibody to TLR2. Four hours following HSP70 stimulation, cells were considered viable if they demonstrated a characteristic rod shape without membrane blebbing.  41  HSP70 resulted in rapid cell death (10.0 ± 4.1 cells per HPF) of cardiomyocytes compared to control (16.9 ± 4.2 cells per HPF). Pre-treatment with TLR2 blocking antibody attenuated this effect (18.0 ± 3.3 cells per HPF) (Figure 13).  Figure 13. HSP70 induces cell death in cardiomyocytes through TLR2. Rat primary cardiomyocytes were isolated and incubated overnight with TLR2 blocking antibody or saline (SL). Four hour stimulation with 10 µg/mL HSP70 led to significant cell death, while cells treated with TLR2 blocking antibody had no significant increase in cell death. * p= 0.005 vs. control.  3.4  Discussion The major new findings of this study are that extracellular DAMPs (HSP70 in  particular) induce NFκB transcriptional activity in cardiomyocytes at levels exceeding that of the “positive control” PAMP (LPS). HSP70 signals through TLR2 and its adaptor molecule, MyD88, and induces NFκB expression which leads to a cardiomyocyte inflammatory response as measured by ICAM-1, IL-6 and KC mRNA expression.  42  Furthermore, this is associated with a reduction in cardiomyocyte contractility and an increase in cell death. Heat shock proteins and other DAMPs are induced by oxidative stress and other acute injury and, intracellularly, serve to protect the cell against these insults [56, 104106]. Overexpressed intracellular HSP70 has shown to reduce infarct size and preserve cardiac contractility in several animal myocardial infarction models [123-125]. However, DAMPs are also released extracellularly and appear to have very different effects; many of these effects mediated through innate immune receptors [104-106]. For instance, HMGB1 is implicated in the exacerbation of acute cardiac dysfunction in a model of septic shock [126]. PAMPS induce cardiac NFκB transcriptional activity and cause a TLR-induced NFκB-dependent decline in contractility, with LPS being the most potent PAMP in the heart [41]. Accordingly, we surveyed three major DAMPs (HSP60, HSP70 and HMGB1) and found that all three induced NFκB transcriptional activity in cardiomyocytes. HSP70 in particular exhibited very strong induction of cardiomyocyte NFκB transcriptional activity, over three-fold greater than LPS. Intracellularly, HSP70 is a chaperone protein involved with protein folding, modulating cell cycle progression, repressing gene expression and having anti-apoptotic functions [45]. Increased intracellular levels of HSP70 reduce damage caused by ischemic injury [123, 124] and deletion of its inducible isoform induces cardiac hypertrophy and impaired contractility [127]. These beneficial effects are thought to be through its intra-cellular roles. However, HSP70 is also released extracellularly via necrotic cell death [128] and other reports have shown HSP70 to be actively released by cells under stress [129]. Extracellularly, HSP70 stimulates pro-inflammatory cytokine  43  production, augments chemokine synthesis, and increases expression of co-stimulatory molecules in a variety of non-cardiomyocyte cell lines [45]. Serum HSP70 levels are measureable and are associated with adverse prognosis of several diseases including renal disease, hypertension, atherosclerosis, aging, and sickle cell disease [45]. High HSP70 serum levels are linked with a variety of cardiovascular diseases [53, 54, 56]. Dybdahl et al. found elevated serum levels of HSP70 in acute myocardial infarction patients. Additionally, HSP70 serum levels negatively correlated with left ventricular ejection fraction [53]. Similarly, Satoh et al. found a positive correlation between HSP70 levels and cardiac release of troponin and creatine kinase as well as increased infarct size in acute myocardial infarction patients [130]. One report using global ischemia-reperfusion in an isolated heart model suggested that heat shock cognate protein 70 (90% homologous to HSP70) is acutely induced by ischemia in cardiomyocytes and is secreted and rapidly detected in coronary effluent [131]. Inhibitory antibody to heat shock cognate protein 70 was able to attenuate ischemia-induced cardiac dysfunction [131]. Our results add to these observations by demonstrating that extracellular HSP70 directly decreased cardiomyocyte contractility and increased cell death; an effect that depended on the signalling pathway defined by TLR2, MyD88, and NFκB. Although HSP70 has shown to co-localize with multiple receptors [56], among TLRs, TLR2 and TLR4 are the most likely functional candidates [56, 109, 112]. Increased expression of ICAM-1 in response to inflammatory stimuli has been shown to reduce cardiac contractility [4, 5, 132]; therefore we used ICAM-1 as an important measure of inflammation to assess whether mice deficient in TLR2 or TLR4 could mount a response to HSP70. TLR4 knockout cardiomyocytes increased ICAM-1 expression  44  following exposure to HSP70 to the same extent as wild-type cardiomyocytes suggesting that HSP70 does not appreciably signal via TLR4. In contrast, we found that cardiomyocytes derived from TLR2 knockout mice had no significant increase in ICAM1 expression in response to HSP70. TLR2 signals almost exclusively via MyD88 [33, 36, 133], whereas TLR4 has alternative pathways available (TRIF). MyD88 knockout cardiomyocytes did not significantly increase ICAM-1 levels in response to HSP70. In accord with these results, blocking antibodies to TLR2 prevented the HSP70-induced decrease in cardiomyocyte contractility. These results indicate that extracellular HSP70 signals via TLR2 and its downstream adaptor, MyD88, to induce NFκB signalling which leads to a cardiomyocyte inflammatory response and ultimately decreased cardiomyocyte contractility. We went on to confirm that HSP70 signalling via TLR2 not only induces inflammation in cardiomyocytes but results in cell death. The results of this study are similar to those reported by Kim et al. [125] who showed that HSP60 is able to induce apoptosis, activate NFκB and in turn induce an inflammatory response. Unlike HSP70’s effects we describe in this manuscript, HSP60 acted uniquely via TLR4, although it did not act through known TLR4 binding sites. A major limitation to this study is our use of isolated cardiomyocytes rather than a whole animal model. This limits our ability to infer whether the mechanisms we discuss above occur in human health and disease. If chosen to be done in vivo, we would have been unable to distinguish whether HSP70’s cardiac effects were due to direct signalling within the heart compared with interaction with the endothelium, immune cells or other cells.  45  In conclusion, HSP70 acts via TLR2 and MyD88 to activate NFκB. This induces expression of pro-inflammatory molecules such as ICAM-1, IL-6 and KC and decreases cardiomyocyte contractility and results in cell death. A reduction in contractility in response to DAMPs may represent an adaptive response to preserve viable myocardium in the face of injury, while intense inflammatory activity might adversely result in impaired cardiac function.  46  Chapter 4 The TLR9 Ligand CpG C Attenuates Acute Inflammatory Cardiac Dysfunction  4.1  Introduction TLR2, TLR4 and TLR5 [41, 134, 135] contribute substantially to the myocardial  inflammatory response and cardiac dysfunction that occurs following IR or other inflammatory stimuli such as lipopolysaccharide (LPS). In the early phase these receptors signal predominantly through the ubiquitous transcription factor NFκB [41, 134-136]. TLR initiated NFκB signalling induces the expression of genes which reduce myocardial performance both directly and indirectly. These effectors of cardiac dysfunction include pro-inflammatory cytokines [41] and the calcium-regulated molecules S100A8 and S100A9 [135]. It follows that modulation of TLR signalling after an inflammatory stimulus may alter the subsequent cardiac dysfunction. Stimulation of TLR9 with a pharmaceutical analogue of its natural ligand (CpG) is the most potent method to attenuate the pro-inflammatory response to all other TLR ligands [95, 137]. Accordingly, in this manuscript we investigate whether CpG is able to improve acute TLR-mediated cardiac dysfunction. We screened the three classes of CpG for cardio-protective activity using an in vivo model of TLR4 ligation with its cognate ligand LPS to induce acute inflammatory cardiac pump failure. We discovered that of class A, B and C, only class C is able to reverse TLR4 induced cardiac dysfunction. We went on to investigate whether CpG C was able to attenuate the acute cardiac pump dysfunction in a mouse model of acute anterior myocardial IR. To establish proof of principle with maximum efficacy we treated one group of mice with CpG C prior to 47  injury. In separate mice we modeled clinical practice more closely by beginning a continuous infusion midway through a one hour occlusion of the left anterior descending (LAD) artery. We went on to assess whether CpG C might exert its cardio-protective action through the local attenuation of cardiac biomarkers; pro-inflammatory cytokines; and S100A8/A9 protein expression, and used gene expression microarray to identify four inhibitors of the NFκB pathway which were up-regulated by CpG C.  4.2  Materials and Methods  Animal Models Male C57BL/6 mice were obtained from Jackson Laboratory, body weight 25-30 grams, 10-14 weeks old were housed in a secure animal facility on site. All animal studies were approved by the University of British Columbia Animal Care Committee and conformed to NIH and Guide for the Care and Use of Laboratory Animals guidelines.  TLR9 ligands tested:  CpG oligonucleotide (ODN)-2336 Class A was  GGG*G*A*C*G*A*C*G*T*C*G*T*G*GGGGGG; CpG ODN-1826 Class B was TCCATGACGTTCCTGACGTT; CpG ODN-2395 Class C was TCGTCGTTTTCGGCGCGCGCCG. Non-CpG-Control ODN-2243 Class A was GGG*G*G*A*G*C*A*T*G*C*T*G*GGGGGG; Non-CpG-Control ODN-2138 Class B was TCCATGAGCTTCCTGAGCTT; Non-CpG-Control ODN-2137 Class C was TGCTGCTTTTGTGCTTTTGTGCTT (Coley Pharmaceutical Group, Ottawa, ON). * denotes phosphodiester bonds in sequence, remainder are phosphorothioate bonds (PS).  48  Luciferase assays: HL-1 cells were transfected using either pNFκB -Luc vector (BD Biosciences, Franklin Lakes, NJ) or Renilla pGL4.74 [hRluc/TK] vector (Promega, Madison, WI). 60 µL of cell lysate was added to duplicate wells in a luminometry plate, and read using the Dual- Luciferase Reporter Assay (Promega #1910) using a Fluostar Optima Luminometer (BMG Labtech, Durham NC). Relative Light Units (RLU) were obtained for both Renilla and the Firefly-Luciferase, all results were normalized to Renilla RLU in HL-1 cell line lysates.  In vivo TLR4 stimulation: C57BL/6 mice were injected intra-peritoneally with 100µg of CpG Class A, B or C, their scrambled control non-CpG (NCpG), or saline 24 h prior to 40mg/kg of Lipopolysaccharide (LPS). Six hours post LPS stimulation echocardiograms were performed as described below. To determine the effects of CpG on health, separate mice were injected with 100µg CpG, and left ventricular ejection fraction (LVEF) was assessed at 6 and 24 h.  Ischemia-reperfusion via LAD ligation: An open-chest model of cardiac IR using ligation and reperfusion of the left anterior descending artery (LAD) was modified from Michael and colleagues [138] . Mice were anaesthetized with Isofluorane 1-3% by inhalation throughout the operative procedure. An animal technician was present throughout the procedure and general anaesthesia is confirmed by lack of physical response to painful peripheral stimuli. Under anaesthesia, an endotracheal intubation was performed using a 22 Gauge catheter. Ventilation was controlled using Mouse Ventilator (Model 687, Harvard Instruments, Holiston, MA, USA) with a tidal volume of 0.5 mL  49  and a respiratory rate of 120 breaths/minute. After a left thoracotomy was performed at the level of the second or third intercostal space, the LAD was identified and a 6-0 polypropylene suture was placed around the LAD. Occlusion of the LAD was accomplished by pulling the suture ends through a small piece of PE-50 tubing and occlusion was confirmed by discoloration of the anterior left ventricle wall. Following one hour of ischemia the ligature was released to allow reperfusion, which was visualized. Following the thoracotomy wound closure, intra-operatively, 1 mL of normal saline was injected subcutaneously for volume resuscitation and subcutaneous buprenorphrine (0.1mg/kg) for pain control were given. After recovery and resumption of spontaneous ventilation, mice were extubated. Any mice euthanized were done so via CO2.  CpG effect on Ejection Fraction Pre-treatment: The effective therapeutic dose for CpG has been established at 100 µg per 25-30 gram mouse [86, 96, 139-141]. Mice were injected intra-peritoneally with 100µg CpG ODN-2395 Class C –TCGTCGTTTTCGGCGCGCGCCG, (Coley Pharmaceutical Group, Ottawa, ON) or saline 24 h prior to LAD ligation. Ejection fraction was measured at one and seven days post reperfusion using echocardiography. Concurrent Treatment: Mice underwent LAD ligation as stated above, however 30 minutes into the ligation period a 72 h osmotic pump (ALZET, Cupertino, CA) with an infusion rate of 1µL/hr was implanted intra-peritoneally. Pumps contained 100µg CpG ODN-2395 Class C or saline. We have previously shown excellent delivery of medication including vasopressors and inotropes using this protocol [142]. Ejection  50  fraction was measured at one and seven days post reperfusion using echocardiography. Serum was collected from mice 24 h after ligation and stored at -80oC.  Echocardiographic assessment of mice Mice were lightly anaesthetized with 1-3% inhaled isofluorane and placed on a warming blanket. M-mode echocardiograms (ECHO) were targeted from 2D echos obtained using the Vevo 770 ECHO (Visualsonics, Toronto ON) operating at a 120 Hz frame rate. Left parasternal 2D left ventricular cross-sectional echocardiographic images were obtained. The position and angle of the echo transducer is maintained by directing the beam just off the tip of the anterior leaflet of the mitral valve and by maintaining internal anatomic landmarks constant. All measurements are taken from M-mode traces at end-expiration. Left ventricular internal dimensions were measured at end-diastole (defined as the onset of the QRS complex in lead II of the simultaneously obtained electrocardiogram) and at end-systole (defined as minimum internal ventricular dimension).  Measurement of left ventricular intracellular cytokine, S100A8, and S100A9 protein levels. Murine left ventricular tissue from the mid-ventricle was snap frozen in liquid nitrogen 24 h following IR. Tissue was homogenized in 1mL cell lysis buffer containing protease inhibitors aprotinin 10 µg/mL and leupeptin 10 µg/mL and the phosphatase inhibitor sodium orthovanadate 10 mM. Interleukin-6 (IL-6) and KC levels were measured using immunoassays from R&D Systems (R&D Systems, Minneapolis MN).  51  The MAP fluorokine IL-6 assay, and KC ELISA were used to measure IL-6 and KC respectively. All values were normalized to µg total protein in tissue lysate. Expression of S100A8 and S100A9 was measured by western blot analyses. 40 µg of cell lysate were separated onto a 4-20% gradient SDS-PAGE gel (BIO-RAD, Hercules, CA) and transferred onto nitrocellulose membranes. Membranes were blocked with 5% skim milk followed by overnight incubation with anti-S100A8 or anti-S100A9 (R&D Systems, Minneapolis MN) antibodies. Primary incubation was followed by 1 h incubation with donkey anti-goat IgG HRP (Santa Cruz Biotechnology Inc, Santa Cruz, CA) secondary antibody and visualized using FEMTO (Thermo, Rockford, IL).  HSP70 Cell Culture Treatments HL-1 cells were grown to 90-100 % confluence and stimulated with 10µM CpG C 24 h prior to secondary stimulation with 10µg/mL HSP70 or 10µg/mL LPS. Upon secondary stimulation cells were incubated for 6 h and then harvested with 1 mL of Trizol (Invitrogen, Carlsbad, CA) and extracted as per the manufacturer's instructions. RNA was DNase treated using AMBION TURBO DNA-free DNase (Austin, TX) to remove genomic contamination. Samples were run on SYBR-GREEN qRT-PCR platform using SuperScript III Platinum SYBR-GREEN One-Step qRT-PCR Kit with ROX (Invitrogen, Carlsbad, CA). PCR was 40 cycles at 95 °C for 15 seconds, 56 °C for 30 seconds and 72 °C for 30 seconds. Primers were as follows ICAM-1 Forward 5’gcaagtccaattcacactgaatg-3’, ICAM-1 Reverse 5’-cagagcggcagagcaaaag-3’.  52  Serum Troponin measurement Cardiac Troponin I (cTnI) is an established marker of cardiac dysfunction. Assessment of cTnI expression in serum was measured via ELISA (LifeDiagnostics Inc., West Chester, PA). C57BL/6 mice that had undergone 24 h pre-treatment with CpG C or saline were used to assess cTnI levels. Blood was drawn 24 h post reperfusion and left to clot on ice. Blood was then spun down at 6,500 rpm for 10 minutes; serum was extracted and frozen at -80oC.  Expression Microarrays for TLR4 and TLR9 ligands. Adult male C57BL/6 mice (10- to 14-week-old) were injected intra-peritoneally with TLR9 ligand CpG C (100 µg) or equivalent volume of sterile normal saline. The effective therapeutic dose for CpG has been established at 100 µg per 25-30 gram mouse [86, 96, 139-141]. Murine ventricular cardiomyocytes were then isolated as previously described [41] at 2 or 4 h post injection. Cardiomyocytes were harvested in 1 mL Trizol (Invitrogen, Carlsbad, CA) and total cellular RNA was extracted as per manufacturer's instructions. RNA was DNase treated using TURBO DNA-free (Ambion, Austin, TX) to remove genomic contamination. Total cellular RNA was reverse transcribed and gene expression was measured using the Illumina3 mouse Ref 8 DNA microarray (Genome Quebec, Montreal, PQ). A list (Fold change > 2 and corrected p value < 0.05) of differentially regulated genes (saline vs. CpG class C) was generated using the Flexarray 4/Illumina-lumi bioanalyzer software (Genome Quebec, Montreal, PQ). This list was  3  Illumina methodology may be found in Appendix I  53  analyzed for biological and pathway significance using Ingenuity Pathway Analysis (Ingenuity Systems, Redwood City CA).  Statistical Analysis: All values are expressed as mean ± SE. For each experimental condition and time point, three independent replicate analyses were performed, unless otherwise noted. Group test were analyzed using ANOVA and the post hoc Bonferroni test to identify specific differences between groups. The analyses were performed using Sigmastat (SPSS, Chicago, IL) and statistical significance was set at p<0.05.  54  4.3  Results  The Toll-Like receptor 9 ligand CpG C mitigates TLR4-induced cardiac dysfunction. When administered alone to healthy mice (N=6 per group), neither 100µg CpG Class A, B nor C had an effect on left ventricular ejection fraction (LVEF) at 6 h (LVEF = 71 ± 4.0%; 67 ± 4.0%; 72 ± 2.2%; 70 ± 4.0%: Saline; CpG A; CpG B and CpG C respectively) or 24 h (LVEF = 66 ± 4.0%; 64 ± 2.5%; 72 ± 2.5%; 64 ± 4.0%: Saline; CpG A; CpG B and CpG C respectively) (Figure 14). The TLR4 ligand LPS at a dose of 40 mg/kg reduced left ventricular ejection fraction from 65 ± 1.4% to 26 ± 1.4% at 6 h (Figure 15). Pre-treatment with CpG C greatly attenuated the LPS-induced decrease in left ventricular ejection fraction (51 ± 5.8% compared to 25 ± 1.6% scrambled NCpG C) (Figure 15). Neither, CpG A, B, nor their scrambled NCpG sequences had cardioprotective activity compared to saline.  Figure 14. CpG OD s do not affect cardiac ejection fraction. Various classes of CpG OD s (100µ µg) were administered to C57BL6 mice via i.p. injection. Left Ventricular Cardiac Ejection Fraction (LVEF) was measured 6 and 24 h post injection via echocardiography. o CpG OD s caused any decrease in LVEF over a 24 h period.  55  Figure 15. CpG C preserves cardiac function in an LPS model. C57BL/6 mice had LVEF measured by transthoracic ECHO at baseline and were then injected with Lipopolysaccharide (LPS) at a dose of 40mg/kg with ECHO performed again at 6 h. TLR4 ligation dramatically reduces cardiac ejection fraction at 6 h in saline (SL) treated mice from 65 ± 1.4% to 26 ± 1.4%. Pre-treatment 24 h prior to LPS with 100 µg CpGs A and B, along with scrambled oligonucleotides ( CpG) for CpGs A, B and C had no effect on TLR4-induced cardiac dysfunction, while CpG C greatly attenuated the cardiac dysfunction (51 ± 5.8% compared to 25 ± 1.6% scrambled CpG C). * p < 0.05 vs. Baseline, ** p < 0.05 vs. CpG-Class C  The TLR9 ligand CpG C activates FκB in a dose dependent manner. While cytoplasmic TLR signalling is extremely complex, transcriptional events are overwhelmingly mediated by the transcription factor NFκB. To determine which classes of CpG were active in the heart a dose response was carried out measuring NFκB activity via luciferase intensity. Figure 16 demonstrates the dose dependent increase in transcriptional NFκB transcriptional activity in cardiomyocytes exposed to CpG C. CpG A and B had minimal biologic effects, whereas CpG C enhances NFκB activity 2.6 ± 0.9 fold at 10µM.  56  Figure 16. CpG C activates FκB in a dose response manner. HL-1 cardiomyocytes were transfected with a plasmid containing FκB-luciferase construct, as well as a renilla plasmid to control for transfection efficiency. The cells were then exposed to CpG A, B or C at a concentration of 0.1-10 µM for 24 h. (mean± SD, *p<0.05)  FκB pathway inhibitors are induced in cardiomyocytes by CpG C Microarray hybridization of RNA extracted from isolated cardiomyocytes stimulated in vivo with TLR9 ligand CpG C revealed statistically significant up-regulation of the NFκB pathway inhibitors A20, NFKBIA,TRIM30 and TNIP1 (Table 2). The early expression of these genes indicates a rapid activation of inflammatory suppressors within ventricular myocytes exposed to CpG C.  Table 2. Gene expression of FκB pathway inhibitors induced by CpG C.  Gene A20 NFKBIA TNIP1 TRIM30  Fold change 2 hours 4 hours 11.0 2.6 9.7 2.2 3.0 0.0 0.0 3.8  57  Pre-treatment with CpG type C reverses decreased LVEF induced by ischemiareperfusion of the LAD. In saline treated mice our model of IR of the left anterior descending artery (LAD) reliably induced a decrease in LVEF from 66 ± 5.2% at baseline to 46 ± 4.7% at Day 1, and 46 ± 4.0% at Day 7 (Figure 17). Mice pre-treated with 100µg CpG C had no significant reduction in LVEF over a period of seven days (Figure 17).  Figure 17. CpG C pre-treatment prevents cardiac dysfunction in an LAD model. C57BL/6 mice had LVEF measured by transthoracic ECHO at baseline and were injected i.p with 100µ µg CpG C or saline. The following day mice underwent reversible clamping of the left anterior descending (LAD) artery for one h. ECHO was performed at days 1 and 7 following IR. In saline pre-treated mice the LVEF decreased compared to baseline throughout the seven day period (66 ± 5.2% at baseline to 46 ± 4.7% at Day 1, and 46 ± 4.0% at Day 7). Mice pre-treated with 100µ µg CpG C had no significant decline in LVEF throughout the 7 day period. * p < 0.05 vs. Baseline.  72 hour infusion of CpG type C mitigates decreased LVEF induced by ischemiareperfusion of the LAD. Midway through the ischemic period an intra-peritoneal pump containing saline or 100 µg CpG C was implanted. Compared to a baseline LVEF of 65 ± 1.4%, LVEF measured one day post ischemia declined to 51 ± 5.2% in saline treated mice, where as CpG C treated mice had an LVEF of 69 ± 3.0% (Figure 18). LVEF  58  measured on Day 7 post ischemia was 44 ± 5.3% in the saline treated group while CpG C treated mice enjoyed a significant advantage with a measured LVEF of 64 ± 3.8%.  Figure 18. CpG C concurrent treatment preserves cardiac function during LAD ligation. C57BL/6 mice had LVEF measured by transthoracic ECHO at baseline (65 ± 1.4%). The following day mice underwent reversible clamping of the LAD artery for one h. Intra-operatively, 30 minutes following the onset of ischemia, 72 h i.p pump containing saline or 100 µg CpG C was implanted. Day 1, LVEF was reduced in saline treated (51 ± 5.2%) mice compared to CpG C treated (69 ± 3.0%) mice. LVEF Day 7 was again significantly lower in the saline treated (44 ± 5.3%) group compared to those treated with CpG C (64 ± 3.8%). * p < 0.05 vs. Baseline  CpG C attenuates ischemia-reperfusion induced production of pro-inflammatory cytokines and S100A8/S100A9. We have previously shown that pro-inflammatory cytokines (IL-6 and KC) are produced in detectable quantities at the protein level in mouse cardiomyocytes [41]. Compared to sham operated mice, KC (19 ± 2.0 pg/µg tissue protein vs. 5.8 ± 0.7 pg/µg tissue protein) and IL-6 (36 ± 3.0 pg/µg tissue protein vs. 29 ± 0.8 pg/µg tissue protein) are increased in the left ventricle 24 h following IR injury  59  (Figure 19). Pre-treatment with 100 µg of CpG C greatly reduced this inflammatory response such that there was no significant increase compared to sham operated mice (Figure 19). S100A8 and S100A9 are EF Hand proteins which are up-regulated in cardiomyocytes exposed to LPS [135]. They are more than inflammatory molecules, actually reducing cardiac contractility via the RAGE receptor [135]. In response to ischemia reperfusion, S100A8 and S100A9 protein expression is highly up-regulated (Figure 20). Pre-treatment with CpG C 24 h prior to IR was able to significantly diminish expression of both S100A8 and S100A9 (Figure 20).  Figure 19. Inflammatory marker expression is reduced in CpG C pre-treated left ventricular tissue. Pro-inflammatory cytokine protein levels in left ventricular tissue extracted 24 h following reperfusion were measured. Mouse groups are either sham operated mice (SHAM) or those who had one hour IR of the proximal LAD artery. 24 h prior to IR of the LAD, mice were injected with either 100 µg CpG C or an equal volume of normal saline. KC and IL-6 are markedly elevated in saline treated LAD mice compared to SHAM, whereas CpG C pre-treatment returns their levels to SHAM levels.  60  Figure 20. S100A8 and S100A9 expression is abolished in CpG C pre-treated left ventricular tissue. Western blot for S100A8 and S100A9 in left ventricular tissue extracted 24 h following reperfusion. Mouse groups are either sham operated mice (SHAM) or those who had one hour IR of the proximal LAD artery. 24 h prior to IR of the LAD, mice were injected with either 100 µg CpG C or an equal volume of normal saline. S100A8 and S100A9 are markedly elevated in saline treated LAD mice compared to SHAM, whereas CpG C pre-treatment returns their levels SHAM levels.  Preconditioning via CpG C attenuates FκB activity by HSP70. DAMPs have shown to induce NFκB activity similar to PAMPS. We show that HSP70 is able to induce NFκB activity greater than LPS stimulation at identical concentrations (214.70 RLU vs. 186.15, respectively). Interestingly, 24 h of pre-conditioning via TLR9 ligation with CpG C was able to reduce subsequent NFκB activation by HSP70 stimulation (214.70 RLU to 120.86 RLU).  61  RLU per ug protein  300  ** *  ***  200  100  H SP 70  C pG  C  C pG  +  H SP 70  C  +  LP S  LP S  C L  0  Figure 21. CpG C is able to reduce FκB activity induced by LPS and HSP70. HL-1 cardiomyocytes were transfected with a plasmid containing FκB-luciferase construct, as well as a renilla plasmid to control for transfection efficiency. 1 day after transfection cells were stimulated with saline or 10 µM CpG C. 24 h later cells were washed with PBS and treated with 10µ µg/mL LPS or HSP70 for 24 h. CpG C was able to significantly reduced FκB activity induced by LPS and HSP70 in HL-1 cells. (*p<0.05 vs. CL,**p<0.05 vs. CpG C)  Preconditioning via TLR9 attenuates ICAM-1 expression by HSP70. HSP70 similar to LPS is able to induce ICAM-1 expression via NFκB driven activity. Interestingly, pre-conditioning via TLR9 stimulation we are able to almost completely abolish HSP70 induced expression of ICAM-1. Similarly, LPS induced expression was nearly abolished with CpG C pre-treatment.  62  Figure 22. CpG C nearly abolishes ICAM-1 expression induced by LPS and HSP70. HL-1 cells were treated with 10µ µM of CpG C or saline 24 h prior to 10µ µg/mL LPS or HPS70 stimulation of 6 h. Following stimulation R A was harvested with Trizol and ICAM-1 mR A was quantified via qRT-PCR. Compared to saline pre-treatment, CpG C pre-treatment was able to almost completely inhibit ICAM-1 expression induced by 10µ µg/mL of HSP70 or 10µ µg/mL LPS.  CpG C attenuates release of Troponin I into serum. Cardiac troponin I (cTnI) is an established biomarker to detect severity of cardiac damage. We quantified serum troponin I via ELISA. Mice pre-treated with saline followed by IR of the LAD had significantly elevated levels of cTnI compared to SHAM (8.42 ± 0.62 ng/mL vs. 1.97 ± 1.2 ng/mL). CpG C pre-treatment was able to significantly reduce cTnI levels (2.38 ± 1.46 ng/mL) to reach near that of SHAM mice. (Figure 23)  63  Figure 23. Troponin I following IR of the LAD is reduced by CpG C. Mouse groups are either sham operated mice (SHAM) or those who had one hour IR of the proximal LAD artery. 24 h prior to IR of the LAD, mice were injected with either 100 µg CpG C or an equal volume of normal saline. Serum was collected 24 h post reperfusion and Cardiac Troponin I (cTnI) levels were quantified via ELISA. LAD ligation with saline pre-treatment had significantly elevated cTnI levels compared to SHAM. CpG C pre-treatment significantly reduced serum cTnI. * p < 0.05 vs. SHAM  4.4  Discussion Our major finding in this manuscript is that CpG C attenuates inflammatory  cardiac dysfunction while inducing no detectable change in cardiac physiology in healthy mice. When administered either as pre-treatment or by continuous infusion following the onset of cardiac ischemia, CpG C is able to significantly improve LVEF throughout the seven days following injury.  Cardiac injury or stress induces the cardiomyocyte to activate immune pathways [134]. In both acute and chronic heart failure, TLR expression is increased in the myocardium [134, 143, 144]. All known TLRs are expressed in the heart, with  64  stimulation of TLR2, 4 or 5 resulting in an NFκB mediated pro-inflammatory response and decreased contractility [41]. Best known for their recognition of specific components of infectious bacteria, fungi or viruses termed pathogen associated molecular patterns (PAMPs) [33, 145-148], TLRs are also activated by endogenous ligands, referred to as DAMPs [105]. DAMPs are highly regulated at the site of injury, and have an intracellular function which differs from their secreted/extracellular function [105]. They include molecules such as HSP60, HSP70, HMGB1, and chromosomal DNA [2, 53]. HSP70 and its analogue Hsc70 in particular have protective intracellular roles following ischemic cardiac injury, but are highly secreted during acute myocardial ischemia and lead to acute cardiac dysfunction through TLR mediated signalling [56, 131]. Modulating TLR induced NFκB activity and the genes it regulates during myocardial IR therefore holds great therapeutic promise [134, 149, 150], with inhibition of the pathway linking TLR stimulation and NFκB transcriptional activity demonstrating high efficacy in pre-clinical models of cardiac dysfunction following myocardial infarction [41, 67, 136, 150-152]. It has been discovered in immune cells that activation of TLR9 is the most potent method to attenuate the subsequent response to stimulation of TLR2, 4 or 5 [95, 137]. In this chapter we first tested whether any class (A, B or C) of the TLR9 ligand CpG has an effect on LVEF in healthy mice and/or is able to mitigate classic TLR4induced acute cardiac dysfunction [41, 135]. Class A CpG is named after predominant interferon-alpha effects and has a poly-G region at the 3’- and 5’-ends, but due to a nonstabilized backbone is easily hydrolyzed and has a very short half life. Class B CpG, named for its predominant B-cell-activating effects, consists of a phosphorothioated (PS)  65  backbone which greatly extends the half life. Class C CpG is named for combined activity of classes A and B, has a full PS backbone, but contain CpG A’s central palindromic region. No class of CpG altered LVEF at 6 and 24 h when given to healthy mice. This is in contrast to the findings of Knuefermann et al. [153], in which CpG B decreased the fractional shortening of isolated cardiomyocytes. There are many possible explanations for this discrepancy. The contractile behaviour and molecular expression of isolated cardiomyocytes differ enormously from the intact (in vivo) heart. Expression levels of TLR9 and its subsequent molecular and signalling effects may be substantially altered by the rigorous cardiac digestion and isolation necessary to study single cells. Using LPS to induce TLR4 mediated acute inflammatory cardiac dysfunction; we noted a dramatic decrease in LVEF by 6 h. Of the three classes of CpG, only CpG C was able to attenuate this acute cardiac dysfunction. Given the optimal balance of A's sequence and B’s highly stabilized backbone, it is not surprising that CpG C was uniquely effective. Accordingly, when observing activation of NFκB by the various classes of CpG; only CpG C was able to increase NFκB activity in a dose response manner. The NFκB pathway is able to explosively turn on a broad set of inflammatory cellular programs. Because of its powerful nature there are a number of negative feedback mechanisms in place to regulate NFκB signalling [72]. Interestingly, NFκB also regulates the expression of its own inhibitors, and it is these NFκB inhibitors which are responsible for the two related processes of acute suppression of inflammation and tolerance to subsequent stimuli [154]. Gene expression microarray of ventricular myocytes revealed significant up-regulation of three NFκB pathway inhibitors two hours following in vivo administration of CpG C. A20, its associated protein TNIP1 and  66  NFKBIA were significantly up-regulated. Four hours post stimulation an additional NFκB pathway inhibitor (TRIM30a) was up-regulated (Table 2). NFκB transcriptional activity is known to proceed in phases, with pro-inflammatory gene expression occurring within 30 minutes followed by activation of suppressor genes in less than 4 h [95]. The very early expression of NFκB pathway inhibitors strongly suggests suppression of inflammation and repression (tolerance) towards further TLR stimulation.  We went on to test whether CpG C could attenuate the acute left ventricular dysfunction associated with ischemia of the left anterior descending artery (LAD). Our model of IR resulted in significant myocardial suppression, with a significant decline in LVEF during a seven day observation period. Pre-treatment with CpG C, while not a realistic clinical model, does inform us about the potential efficacy. When administered 24 h before IR, CpG C resulted in an impressive reversal in acute cardiac dysfunction. This effect was sustained throughout the seven day period. Furthermore, serum levels of cardiac troponin I (cTnI), an established biomarker for cardiac damage, were greatly reduced in CpG C pre-treated mice when compared to saline pre-treatment. Beginning a therapy following the onset of ischemia is a more realistic clinical scenario. Using continuous infusion of CpG C with an intra-peritoneal pump 30 minutes into a one hour ischemia, we found significant cardio-protection at days 1 and 7. These results are consistent with CpG C’s reported effects in other types of injury. In diverse models of acute ischemic injury such as stroke and shock liver, pre-treatment with CpG induces a sustained anti-inflammatory effect and attenuation of organ dysfunction [94, 155, 156] .  67  In the heart, inflammatory cardiac failure is associated with NFκB driven effector cytokines [41, 134, 135], therefore we went on to assess whether treatment with CpG C decreases cardiac inflammation following ischemia. Two NFκB regulated cytokines produced at detectable levels by mouse cardiomyocytes are KC, and IL-6 [41], accordingly we used these to define the cardiac inflammatory response to IR. At twenty four hours, compared to sham operated animals IL-6 and KC were highly induced in the left ventricle of mice subjected to IR. Pre-treatment with CpG C resulted in a near total attenuation of these ischemia-induced pro-inflammatory cytokines. Acute inflammatory cardiac dysfunction is both associated with and directly mediated by increased S100A8 and S100A9 [135]. Therefore we measured their expression in left ventricular tissue 24 h following IR. In saline treated mice IR strongly induced S100A8 and S100A9, while CpG C nearly abolished this response. Increased circulation of HSP70 has been linked to increased severity of cardiac dysfunction [53, 54]. Additionally, based on the experiments conducted, HSP70 inflammatory properties have shown to act in a TLR dependent manner and cause cardiac inflammation. After assessing the positive effects of CpG C pre-treatment to LPS stimulation and IR, the question of whether HSP70’s inflammatory effects can be affected in a similar fashion was addressed. Therefore, using the same pre-treatment model with HSP70 stimulation I assessed whether HSP70’s inflammatory profile could be attenuated with CpG C pre-treatment. Using NFκB-luciferase vectors to assess NFκB activity, CpG C pre-treatment significantly reduced NFκB activity when stimulated with LPS or HSP70 compared to no pre-treatment (Figure 21). Consequently, when measuring ICAM-1 expression in CpG C pre-treated HL-1 cells ICAM-1 expression was  68  nearly completely abolished when compared to cells treated with solely HSP70 or LPS (Figure 22).  CpG C pre-treatment is therefore able to attenuate inflammation induced  by HSP70 when given as a pre-treatment. As KC, IL-6, S100A8/S100A9 and ICAM-1 are overwhelmingly regulated by NFκB [135]; CpG C appears to have strong antiinflammatory (inhibitory) activity in the NFκB pathway. The major limitation to this study is the use of mouse models of disease to approximate human pathology. Clinical trials of CpG C in ischemic heart disease would provide much stronger data as to its efficacy.  Conclusions: The TLR9 ligand CpG C is able to attenuate the acute inflammatory cardiac dysfunction induced by both LPS and IR of the LAD.  69  Chapter 5 A20 And TNIP1 are key modulators of NFκB activated inflammation  5.1  Introduction Exposure to exogenous PAMPs and endogenous DAMPs trigger complex  signalling leading to decreased contractile function of the heart [41, 135]. Cardiomyocytes recognize PAMPs and DAMPs through TLRs which initiate a core response[157]. This core response includes early (minutes to hours) induction of a largely NFκB driven response, including inflammatory molecules such as IL-6 and TNFα and key molecules in the apoptotic pathway such as caspase3 [157]. Slightly later, but potentially of greater significance, comes production of regulatory molecules directing amplification or quenching of this response [157]. Thus, if the initial danger signal subsides, counter–regulatory molecules result in tolerance to subsequent noxious stimuli and resistance to cell death. We have previously found that TLR2, TLR4 and TLR5 are expressed by cardiomyocytes [41]. Ligation of these TLRs induces expression of the NFκB regulated genes ICAM-1, S100A8 and S100A9 [41, 97, 135] which then contribute to reduced cardiomyocyte contractility [41, 97, 135]. Intriguingly, we also found that TLR9 was highly expressed in primary cardiomyocytes [41]. We previously characterized the effects of cardiac TLR9 ligation on gene expression, and found an increase in the expression of four NFκB pathway regulators. Interestingly, two of the molecules work in concert; A20 and its associated protein TNIP1. In view of these regulatory molecules we tested how manipulating their expression would affect NFκB pathway signalling. We  70  found that TLR9 ligation preconditions and counter-regulates the response to subsequent TLR4 ligation, resulting in amelioration of subsequent inflammatory mediator release and decreased ventricular function. We further confirmed central roles for A20 and TNIP1 in this preconditioning response. These results may have important consequences for understanding how innate immune responses in the heart are modulated [95, 137, 158] and suggest that pro-inflammatory and deleterious innate immune responses could be modulated using exogenous TLR9 ligands to initiate an anti-apoptotic and protective profile.  5.2  Methods  Detection of A20 and T IP1 HL-1 cells at 100% confluence were stimulated with 10µM of CpG C for 24 h. Cell lysates were then collected in 100 µL cell lysis buffer containing protease inhibitors aprotinin 10 µg/mL and leupeptin 10 µg/mL and the phosphatase inhibitor sodium orthovanadate 10 mM. Expression of A20 and TNIP1 was observed via western blot. 40 µg of cell lysate were separated onto a 4-20% gradient SDS-PAGE gel (BIO-RAD, Hercules, CA) and transferred onto nitrocellulose membranes. Membranes were blocked with 5% skim milk followed by overnight incubation with anti-A20 (Santa Cruz Biotechnology Inc, Santa Cruz, CA), anti-TNIP1 (Invitrogen, Camarillo, CA), or anti-βactin antibodies Primary incubation was followed by 1 h incubation with donkey antigoat IgG HRP (Santa Cruz Biotechnology Inc, Santa Cruz, CA) secondary antibody and visualized using FEMTO (Thermo, Rockford, IL). Relative increase in expression of  71  proteins was determined semi-quantitatively using densitometry analysis and normalized to β-actin expression using ImageJ Software.  Transfection of A20 and T IP1. HL-1 cells were transfected using either A20 cDNA vector (Origene, Rockville, MD) or TNIP1 cDNA vector (Origene, Rockville, MD). Transfections were accomplished using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) using 1.0µg DNA per 1x106 cells. Lipofectamine 2000 and DNA were incubated at room temp for 20 minutes to form Lipofectamine 2000-DNA complexes. Complexes were then incubated with cells for 4 h at 37oC in serum and antibiotic free media. After 4 h incubation, Claycomb media with 10% FBS and antibiotics was added and further incubated at 37oC for another 2 days. On day 2 of transfection, cells were stimulated with 10µg/mL of LPS or saline (control). RNA was harvested 4 h later from cells using Trizol and protein was harvested after 24 h. RNA was extracted as per the manufacturer's instructions, and DNase treated using AMBION TURBO DNA-free DNase (Austin, TX) to remove genomic contamination. ICAM-1 and MIP-2 mRNA was quantified using SuperScript III Platinum SYBR-GREEN One-Step qRT-PCR Kit with ROX (Invitrogen, Carlsbad, CA). PCR conditions were 40 cycles at 95oC for 15 seconds, 56oC for 30 seconds and 72oC for 30 seconds for ICAM-1; primers were as follows: ICAM-1 Forward 5’-gcaagtccaattcacactgaatg-3’, ICAM-1 Reverse 5’cagagcggcagagcaaaag-3’. PCR conditions were 40 cycles at 95oC for 15 seconds, 54oC for 30 seconds and 72oC for 30 seconds for MIP-2; primers were as follows: MIP-2 Forward 5’-caagaacatccagagcttgagtgt-3’, MIP-2 Reverse 5’–ttttgaccgcccttgagagt-3’.  72  Statistical Analysis: All values are expressed as mean ± SD. For each experimental condition and time point, three independent replicate analyses were performed, unless otherwise noted. Group test were analyzed using student t-test to identify specific differences between groups. The analyses were performed using Sigmastat (SPSS, Chicago, IL) and statistical significance was set at p<0.05.  5.3  Results  CpG class C induces the multisite inhibitors of FκB signalling, A20 and T IP1. Expression microarrays identified A20 as a candidate effector of the cardioprotective preconditioning response observed with TLR9 ligation with CpG C. To confirm the microarray results we further examined whether there was an increase in corresponding protein concentration. We found that A20 and TNIP1 proteins were increased in cultured cardiac myocytes 24 hours following exposure to CpG C.  73  Figure 24. Induction of A20 and T IP1 24 hours after CpG C stimulation. HL-1 cells grown to full confluence were stimulated with 10µ µM CpG C or saline (CL) for 24 h. Cell lysates were then harvested and total protein was run on a western blot to assess A20 and T IP1 protein expression. Using densitometry analysis, CpG C was able to significantly increase expression of A20 and T IP1 24 h after stimulation compared to control. *p <0.05 CL vs. CpG C  A20 and T IP1 overexpression attenuate pro-inflammatory cytokine expression. In order to assess the direct effects of A20 and TNIP1 proteins, HL-1 cells were transfected with cDNA overexpression vectors of the respective proteins. Transfected cells were stimulated with 10µg/mL LPS. LPS stimulation of control cells yielded an (2.85 ± 0.28 increase in ICAM-1 expression. A20 transfected cells showed a significant attenuation in ICAM-1 expression (2.45 ± 0.17, p <0.05) but to much lesser extent then TNIP1 (1.96 ± 0.19, p<0.05). Interestingly, when A20 and TNIP1 are co-transfected the attenuated effect is not coupled and reduces ICAM-1 expression (2.05 ± 0.05, p<0.05) to a lesser extent than TNIP1 overexpression alone. MIP-2 expression followed a similar pattern as ICAM-1 expression, except A20 and TNIP1 co-transfection (5.52 ± 0.69, p<0.05) were unable to reduce MIP-2 expression to a greater extent than A20 transfection (5.15 ± 1.29,  74  p<0.05) alone. TNIP1 overexpression was able to attenuate MIP-2 expression (4.19 ± 0.86, p<0.05) to the greatest extent when compared to LPS stimulation alone (7.17 ± 1.22).  Figure 25. Western Blot confirmation of over-expression vector transfection. HL-1 cells were transfected with a GFP vector, A20 cD A vector and/or T IP1 cD A vector. Transfected cells were grown for 2 days followed by incubation with 10µ µg/mL of LPS for 6 h. Protein was harvested in cell lysis buffer. Western blot was used to assess successful transfection of vectors. Overexpression of A20 and or T IP1 was successfully completed in respective cell treatments.  Figure 26. A20 & T IP1 over-expression attenuate ICAM-1 and MIP-2 expression when stimulated with LPS. HL-1 cells were transfected with a GFP vector, A20 cD A vector and/or T IP1 cD A vector. Transfected cells were grown for 2 days followed by incubation with 10µ µg/mL of LPS for 6 h. R A was harvested with Trizol and quantified using qRT-PCR. Overexpression of A20 and or T IP1 were able so significantly reduce A) ICAM-1 expression and B) MIP-2 expression compared to baseline LPS treatment (GFP LPS). *p <0.05 vs. GFP LPS.  75  5.4  Discussion Our key findings are that CpG C triggers expression of regulatory proteins that  counteract pro-inflammatory signalling through NFκB. CpG C/ TLR9-induced signalling pathways in cardiomyocytes results in a counter-regulatory response. This counterregulatory response has functional consequences. TLR9 ligation by CpG C reduces the pro-inflammatory and functional response to subsequent TLR4 ligation by LPS. The counter-regulatory molecules A20 and TNIP1, identified by expression microarrays and confirmed by measurement of the correspondingly upregulated proteins, appear to be important effectors of this preconditioning/counter-regulatory response. Thus, TLR9 ligation (CpG C) attenuates TLR4-induced inflammation via the NFκB inhibitor proteins A20 and its associated protein TNIP1.  In the two decades since their discovery the role of TLRs has grown significantly, having been conceived as having expression restricted to leukocytes and a physiologic repertoire limited to an exuberant pro-inflammatory response [33]. Now known to be expressed in nearly every tissue including the heart and lungs [41, 159] TLR signalling is extremely complex with an overall effect dependent upon tissue, TLR, as well as dose and frequency of TLR ligand exposure [134, 159, 160]. Although complex, the orchestration of early intense inflammatory activity via NFκB; pro or anti-apoptotic pathways; and finally the suppressive networks necessary to quench this inflammatory reaction are via a core response regardless of tissue or cell type [36, 157, 161]. Subsequent to the pro-inflammatory response following stimulation with TLR ligands, induction of suppressors of inflammation is thought to be responsible both for limiting the inflammatory reaction and for subsequent tolerance to repeated inflammatory  76  stimuli [95, 137]. Pre-treatment with small doses of cognate ligands to TLRs (TLR2, TLR4, TLR7-8, and TLR9) induces tolerance to subsequent larger doses of any of these ligands [2, 162]. While early inflammatory gene expression mainly driven through the canonical NFκB pathway peaks within 1-2 hours, these suppressive networks lag slightly behind, showing traces of expression at 1-2 hours but becoming more robust at 3 hours [95]. With no further inflammatory stimulus, these suppressors result in quenching of the inflammatory burst within 24 hours [95]. In immune cells, TLR9 ligation is the major innate immune pathway through which networks of counter-regulatory inflammatory suppressors are induced [95, 137]. We previously used expression microarray measurement following systemic administration CpG class C to identify differentially expressed genes within the core inflammatory response[157], with an emphasis on suppressors of NFκB mediated inflammation. The suppressors of NFκB activity A20 and its interacting protein TNIP1 were identified as being upregulated by CpG class C, and were subsequently verified at the protein level. A20 and TNIP1 play key roles in the termination of NFκB activity following activation of immune receptors including the TNF-R, TLRs and NOD receptors [71, 80, 82, 163, 164]. They do so by eliminating the ubiquitination many molecules in the NFκB signalling cascade require for proper physical interaction. Given this central inhibitory role we suspected that A20 and TNIP1 were the CpG C regulated molecules which were ultimately responsible for its anti-inflammatory activity in the heart. However, given the wide variety of molecules regulated by CpG C, we could not be certain of their central role without manipulating A20 and TNIP1 independently of exposure to CpG C. TNIP1 physically links the ubiquitin-editing enzyme A20 to its targets in the NFκB pathway  77  including NEMO, RIP1, and TRAF proteins [80, 163]; therefore we investigated whether overexpression of either protein would cause a significant effect. Using cDNA overexpression vectors for A20 and TNIP1, we found that although overexpression of both proteins reduces expression of ICAM-1 and MIP-2 upon LPS stimulation; TNIP1 caused a greater degree of reduction than A20. Therefore, TNIP1 may be more important in facilitating the inhibitory process than A20. Even in cells co-transfected with A20 and TNIP1 together we were unable to effectively reduce inflammatory marker expression to a greater extent than TNIP1 overexpression alone. This result gives credence to the importance of TNIP1 in facilitating the binding of A20 and its target protein. Furthermore, TNIP1 may have a direct effect on inflammatory marker expression independently of A20.  Taken together these experiments demonstrate that A20 and TNIP1 are key molecules induced by CpG C/TLR9 via NFκB, and ultimately are responsible for suppressing cardiac inflammation. Further experiments involving knockdown of A20 and TNIP1 would prove to be informative in elucidating their role in quenching the NFκB driven inflammatory response.  78  Chapter 6  Conclusions  Acute inflammatory cardiac dysfunction due to both IR and PAMP recognition is a TLR through NFκB mediated event. While characterization of PAMP activation of TLRs and NFκB has been well described, the role of DAMPs on cardiomyocyte TLR signalling has yet to be fully characterized. Here we find that DAMPs, HSP70 in particular, induce inflammation to a comparable if not greater extent than that of potent PAMPs such as LPS in cardiomyocytes. Most prominent in our models and most linked to clinical outcome in the literature is HSP70’s ligation of TLR2 and subsequent inflammatory effects. HSP70’s effect via TLR2 suggests that DAMPs released during cardiac injury may contribute to subsequent inflammation and acute cardiac dysfunction. Coupling of TLRs to their respective ligands triggers an inflammatory response via the NFκB pathway. With ongoing injury, the balance of NFκB controlled genes becomes heavily tilted towards a pro-inflammatory response. However, shifting the NFκB pathway signalling cascade to a suppressive rather than pro-inflammatory program can quench the robust inflammation seen in acute cardiac injury. Although alternative methods exist for activating the regulatory networks such as ischemic conditioning or LPS conditioning, these methods have rather severe side effects. Ischemic conditioning may damage vascular structure, while even moderate doses of LPS may induce septic conditions. The use of TLR9 ligand, CpG, can alleviate some of the concerns that are brought upon by these treatments, specifically LPS. Previous and current data declare CpG as a known trigger of NFκB activation that does not cause a decrease in cardiac  79  function [41]. These two characteristics make CpG a logical choice as a potential inducer of the NFκB regulatory mechanism. The effectiveness of CpG is highly dependent upon sequence and backbone composition. Therefore determination of which CpG class would be appropriate for inducing the regulatory network was an aim of the project. CpG C’s dual attributes of CpG A and CpG B lent it the ability to induce the NFκB suppressive network and preserve left ventricular ejection fraction in an in vivo endotoxin model. Additionally, CpG C was able to mitigate the effects of HSP70 induced acute cardiac dysfunction similar to LPS. Due to the common activated pathways between endotoxin, HSP70 and IR induced cardiac dysfunction, the translation of CpG pre-treatment therapy seemed plausible. CpG C was able to attenuate any ischemic injury when given as a pre-treatment and even as a concurrent treatment. LVEF was maintained at near baseline levels and pro-inflammatory molecule expression was greatly reduced with treatment. The effectiveness of CpG C as a pre-treatment to ischemic injury was anticipated, however, the results produced from the concurrent treatment proved shocking. The CpG-TLRNFκB signalling cascade was able to induce counter regulatory mechanisms within a 30 minute span; indicating the swiftness of CpG C’s affects in initiating a regulatory mechanism. Identifying the proteins involved was the next aim of the study.  80  Figure 27. CpG C triggers FκB pathway regulators to attenuate further inflammation. CpG C ligates to TLR9 and activates expression of FκB pathway regulators. The regulators are able to inhibit further FκB pathway signalling for an extended period of time. This results in quenching of pro-inflammatory signalling, leading to reduced inflammation and preservation of cardiac function.  81  Identification of the genes involved post CpG C stimulation via microarray led to identification of a key regulators of the NFκB pathway, A20 and TNIP1. Increased protein expression of A20 and TNIP1 following CpG C stimulation confirmed the results of the microarray. In vitro experiments involving A20 and TNIP1’s over expression demonstrated its suppressive effects on ICAM-1 and MIP-2 gene expression. Thus we were able to confirm the regulatory function of A20 and TNIP1 in cardiomyocytes (Figure 26). Overexpression of TNIP1 was surprisingly able to attenuate the proinflammatory response to a greater extent than A20. This may show that TNIP1 overexpression is able to facilitate a greater number of A20-target associations. In summary, cardiac dysfunction is a common and serious cause of mortality. Increased inflammation and reduced contractility are causes of cardiac dysfunction. The results from this study have proven DAMPs, such as HSP70 are able to induce inflammation and acute cardiac dysfunction comparable to that of the potent PAMP, LPS. However, the severity of inflammation and degree of cardiac dysfunction can be substantially reduced through treatment with the TLR9 ligand CpG C. The common signalling pathways between HSP70, endotoxin and IR injury give CpG the versatility to be able to counter act both disease states. The exquisite method by which CpG preserves cardiac function merits its application into other avenues of investigation such as cardiac bypass surgery, organ transplantation, even simple procedures as angioplasty. Although CpG’s affects are highly dependent upon organ system, cell type and time of delivery, CpGs efficacy seems to be very high in the cardiovascular system.  82  Chapter 7  Limitations And Future Directions  The experiments conducted in this thesis present an investigation in to cardiac inflammatory mechanisms and induction of regulatory networks that mitigate negative outcomes. However, there are many questions yet to be answered that merit further investigation. The investigation into HSP70’s function as a DAMP on cardiomyocytes stemmed from several clinical investigations citing elevated serum HSP70 levels in patients with various cardiac ailments. Although there has been considerable evidence showing an increase in circulating levels of HSP70, no experiment was conducted displaying HSP70’s release into serum in our IR mouse model. HSP70 may be one of many endogenous molecules that are released during IR that leads to inflammation. Therefore, isolating HSP70 and injecting it into mice may prove to be informative in labelling HSP70 as a key mediator of cardiac dysfunction. Experiments involving HSP70 infusion in vivo while observing LVEF must be conducted with the use of TLR2 or TLR4 knockout mice. Results may further prove the relationship between TLR2 and HSP70; such an experiment would unmistakably link the two. Cardiac dysfunction is comprised of several factors both intra-cellular and extracellular. Inflammatory cells such as neutrophils and macrophages are a significant part of inflammation leading to infiltration in the myocardium. Several studies have shown how cellular infiltration affects cardiac function. The use of CpG as a pre-treatment has proven beneficial in mitigating inflammation arising within the cardiomyocyte. However, detailed information regarding its effects on regulation of the immune system  83  has yet to be investigated. Theoretically, CpG should reduce pro-inflammatory cytokine expression and therefore limit the amount of cellular infiltration that occurs. Of additional interest is CpG’s pre-treatment ability in reducing infarct size in an IR model. Although the focus of this project was strictly aimed on cardiomyocyte function and inflammation further investigation into infarct size and cellular infiltration merit attention both in an endotoxin model and IR model. Pre-treatment with CpG C in an IR model proved successful in mitigating the proinflammatory effects that commonly occur. CpG C was utilized to trigger the NFκB regulatory network in all in vivo and in vitro studies. When used in the IR pre-treatment model, CpG C was given 24 h prior in a 100µg bolus dose. Conversely, in the concurrent model of CpG C treatment, a 100µg infusion pump releasing 1µg/hr was placed in the abdomen of the mouse during ischemia. Consequently, the concurrent study was not done identically to the pre-treatment study. The dosage given during the concurrent pump was 1µg per hour, while the pre-treatment gave a bolus dose of 100µg. The concurrent model was carried out in order to emulate a standard hospital treatment protocol for a patient with a myocardial infarction. As a result, an interesting case could be made to the effectiveness of dose methods. Is a bolus dose as effective inducing antiinflammatory measures as a minor continuous infusion? An aim of the project was to observe cardiomyocyte inflammation and methods of inducing regulatory networks to mitigate any negative outcomes. The use of CpG C proved to be a successful measure in limiting cardiac dysfunction in a variety of experimental models in mice. To validate the true effectiveness of CpG C as a therapeutic one would need to conduct a small clinical study observing its outcomes in  84  various cardiovascular disease situations. Currently, CpG is under clinical investigation as a vaccine adjuvant and is having very successful outcomes. Therefore CpG may be a versatile compound that may have beneficial effects in a variety of illnesses.  85  References 1. 2.  3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19.  20. 21. 22. 23.  24. 25.  Chao, W., Toll-like receptor signaling: a critical modulator of cell survival and ischemic injury in the heart. Am J Physiol Heart Circ Physiol, 2009. 296(1): p. H1-12. Kariko, K., D. Weissman, and F.A. Welsh, Inhibition of toll-like receptor and cytokine signaling--a unifying theme in ischemic tolerance. J Cereb Blood Flow Metab, 2004. 24(11): p. 1288-304. Vinten-Johansen, J., Involvement of neutrophils in the pathogenesis of lethal myocardial reperfusion injury. Cardiovasc Res, 2004. 61(3): p. 481-97. Davani, E.Y., et al., Cardiac ICAM-1 mediates leukocyte-dependent decreased ventricular contractility in endotoxemic mice. Cardiovasc Res, 2006. 72(1): p. 134-42. Davani, E.Y., et al., ovel regulatory mechanism of cardiomyocyte contractility involving ICAM-1 and the cytoskeleton. Am J Physiol Heart Circ Physiol, 2004. 287(3): p. H1013-22. Knuefermann, P., et al., Cardiac inflammation and innate immunity in septic shock: is there a role for toll-like receptors? Chest, 2002. 121(4): p. 1329-36. Takeishi, Y. and I. Kubota, Role of Toll-like receptor mediated signaling pathway in ischemic heart. Front Biosci, 2009. 14: p. 2553-8. Yndestad, A., et al., Systemic inflammation in heart failure--the whys and wherefores. Heart Fail Rev, 2006. 11(1): p. 83-92. Chockalingam, A., et al., Acute left ventricular dysfunction in the critically ill. Chest. 138(1): p. 198-207. Canada, P.H.A.o. 2009 Tracking Heart Disease and Stroke in Canada. 2009 cited 2011 July 18 2010]; Available from: http://www.phac-aspc.gc.ca/publicat/2009/cvd-avc/index-eng.php. Arslan, F., et al., Bridging innate immunity and myocardial ischemia/reperfusion injury: the search for therapeutic targets. Curr Pharm Des, 2008. 14(12): p. 1205-16. Latanich, C.A. and L.H. Toledo-Pereyra, Searching for F-kappaB-based treatments of ischemia reperfusion injury. J Invest Surg, 2009. 22(4): p. 301-15. Clarke, M., M. Bennett, and T. Littlewood, Cell death in the cardiovascular system. Heart, 2007. 93(6): p. 659-64. Arslan, F., et al., TLR2 and TLR4 in ischemia reperfusion injury. Mediators Inflamm, 2010: p. 704202. Li, L.Y., X. Luo, and X. Wang, Endonuclease G is an apoptotic D ase when released from mitochondria. ature, 2001. 412(6842): p. 95-9. Susin, S.A., et al., Molecular characterization of mitochondrial apoptosis-inducing factor. ature, 1999. 397(6718): p. 441-6. Verhagen, A.M., et al., Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins. Cell, 2000. 102(1): p. 43-53. Zou, H., et al., An APAF-1.cytochrome c multimeric complex is a functional apoptosome that activates procaspase-9. J Biol Chem, 1999. 274(17): p. 11549-56. Borutaite, V., R. Morkuniene, and G.C. Brown, Release of cytochrome c from heart mitochondria is induced by high Ca2+ and peroxynitrite and is responsible for Ca(2+)-induced inhibition of substrate oxidation. Biochim Biophys Acta, 1999. 1453(1): p. 41-8. Croall, D.E. and G. . DeMartino, Calcium-activated neutral protease (calpain) system: structure, function, and regulation. Physiol Rev, 1991. 71(3): p. 813-47. Lacks, S.A., Deoxyribonuclease I in mammalian tissues. Specificity of inhibition by actin. J Biol Chem, 1981. 256(6): p. 2644-8. Miyamae, M., et al., Attenuation of postischemic reperfusion injury is related to prevention of [Ca2+]m overload in rat hearts. Am J Physiol, 1996. 271(5 Pt 2): p. H2145-53. Vanoverschelde, J.L., et al., Mechanisms of chronic regional postischemic dysfunction in humans. ew insights from the study of noninfarcted collateral-dependent myocardium. Circulation, 1993. 87(5): p. 1513-23. Rudiger, A. and M. Singer, Mechanisms of sepsis-induced cardiac dysfunction. Crit Care Med, 2007. 35(6): p. 1599-608. Annane, D., E. Bellissant, and J.M. Cavaillon, Septic shock. Lancet, 2005. 365(9453): p. 6378.  86  26. 27. 28. 29. 30. 31. 32. 33. 34. 35.  36. 37. 38. 39. 40. 41.  42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52.  Court, O., et al., Clinical review: Myocardial depression in sepsis and septic shock. Crit Care, 2002. 6(6): p. 500-8. Hotchkiss, R.S. and I.E. Karl, The pathophysiology and treatment of sepsis. Engl J Med, 2003. 348(2): p. 138-50. Kumar, A., C. Haery, and J.E. Parrillo, Myocardial dysfunction in septic shock. Crit Care Clin, 2000. 16(2): p. 251-87. Levy, R.J. and C.S. Deutschman, Evaluating myocardial depression in sepsis. Shock, 2004. 22(1): p. 1-10. Rabuel, C. and A. Mebazaa, Septic shock: a heart story since the 1960s. Intensive Care Med, 2006. 32(6): p. 799-807. Hunter, J.D. and M. Doddi, Sepsis and the heart. Br J Anaesth. 104(1): p. 3-11. Muller-Werdan, U., H. Engelmann, and K. Werdan, Cardiodepression by tumor necrosis factor-alpha. Eur Cytokine etw, 1998. 9(4): p. 689-91. Akira, S., K. Takeda, and T. Kaisho, Toll-like receptors: critical proteins linking innate and acquired immunity. at Immunol, 2001. 2(8): p. 675-80. Lemaitre, B., et al., The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell, 1996. 86(6): p. 973-83. Medzhitov, R., P. Preston-Hurlburt, and C.A. Janeway, Jr., A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. ature, 1997. 388(6640): p. 394-7. Kawai, T. and S. Akira, The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. at Immunol, 2007. 11(5): p. 373-84. Akira, S., S. Uematsu, and O. Takeuchi, Pathogen recognition and innate immunity. Cell, 2006. 124(4): p. 783-801. Kawai, T. and S. Akira, TLR signaling. Cell Death Differ, 2006. 13(5): p. 816-25. O' eill, L.A. and A.G. Bowie, The family of five: TIR-domain-containing adaptors in Toll-like receptor signalling. at Rev Immunol, 2007. 7(5): p. 353-64. Schuster, J.M. and P.S. elson, Toll receptors: an expanding role in our understanding of human disease. J Leukoc Biol, 2000. 67(6): p. 767-73. Boyd, J.H., et al., Toll-like receptor stimulation in cardiomyoctes decreases contractility and initiates an F-kappaB dependent inflammatory response. Cardiovasc Res, 2006. 72(3): p. 384-93. Oyama, J., et al., Reduced myocardial ischemia-reperfusion injury in toll-like receptor 4deficient mice. Circulation, 2004. 109(6): p. 784-9. Sakata, Y., et al., Toll-like receptor 2 modulates left ventricular function following ischemiareperfusion injury. Am J Physiol Heart Circ Physiol, 2007. 292(1): p. H503-9. Shishido, T., et al., Toll-like receptor-2 modulates ventricular remodeling after myocardial infarction. Circulation, 2003. 108(23): p. 2905-10. Asea, A., Heat shock proteins and toll-like receptors. Handb Exp Pharmacol, 2008(183): p. 111-27. Yang, H. and K.J. Tracey, Targeting HMGB1 in inflammation. Biochim Biophys Acta. 1799(1-2): p. 149-56. Okamura, Y., et al., The extra domain A of fibronectin activates Toll-like receptor 4. J Biol Chem, 2001. 276(13): p. 10229-33. Jiang, D., et al., Regulation of lung injury and repair by Toll-like receptors and hyaluronan. at Med, 2005. 11(11): p. 1173-9. Kim, S., et al., Carcinoma-produced factors activate myeloid cells through TLR2 to stimulate metastasis. ature, 2009. 457(7225): p. 102-6. Tsan, M.F. and B. Gao, Heat shock proteins and immune system. J Leukoc Biol, 2009. 85(6): p. 905-10. Cai, W.F., et al., Intracellular or Extracellular Heat Shock Protein 70 Differentially Regulates Cardiac Remodeling in Pressure Overload Mice. Cardiovasc Res, 2010. Wei, Y.J., et al., Proteomic analysis reveals significant elevation of heat shock protein 70 in patients with chronic heart failure due to arrhythmogenic right ventricular cardiomyopathy. Mol Cell Biochem, 2009. 332(1-2): p. 103-11.  87  53. 54. 55. 56. 57. 58. 59. 60. 61. 62.  63.  64. 65. 66. 67. 68. 69. 70. 71.  72. 73. 74. 75. 76.  77. 78.  Dybdahl, B., et al., Myocardial ischaemia and the inflammatory response: release of heat shock protein 70 after myocardial infarction. Heart, 2005. 91(3): p. 299-304. Genth-Zotz, S., et al., Heat shock protein 70 in patients with chronic heart failure: relation to disease severity and survival. Int J Cardiol, 2004. 96(3): p. 397-401. Wheeler, D.S., et al., Extracellular hsp70 levels in children with septic shock. Pediatr Crit Care Med, 2005. 6(3): p. 308-11. de Jong, P.R., et al., Hsp70 and cardiac surgery: molecular chaperone and inflammatory regulator with compartmentalized effects. Cell Stress Chaperones, 2009. 14(2): p. 117-31. Vabulas, R.M., et al., HSP70 as endogenous stimulus of the Toll/interleukin-1 receptor signal pathway. J Biol Chem, 2002. 277(17): p. 15107-12. Pockley, A.G., et al., Circulating heat shock protein and heat shock protein antibody levels in established hypertension. J Hypertens, 2002. 20(9): p. 1815-20. Hoebe, K., et al., TLR signaling pathways: opportunities for activation and blockade in pursuit of therapy. Curr Pharm Des, 2006. 12(32): p. 4123-34. Tripathi, P. and A. Aggarwal, F-kB transcription factor: a key player in the generation of immune response. Current Science, 2006. 90(4): p. 13. Bonizzi, G. and M. Karin, The two F-kappaB activation pathways and their role in innate and adaptive immunity. Trends Immunol, 2004. 25(6): p. 280-8. Belaiba, R.S., et al., Hypoxia up-regulates hypoxia-inducible factor-1alpha transcription by involving phosphatidylinositol 3-kinase and nuclear factor kappaB in pulmonary artery smooth muscle cells. Mol Biol Cell, 2007. 18(12): p. 4691-7. Cummins, E.P., et al., Prolyl hydroxylase-1 negatively regulates IkappaB kinase-beta, giving insight into hypoxia-induced FkappaB activity. Proc atl Acad Sci U S A, 2006. 103(48): p. 18154-9. Ghosh, S., M.J. May, and E.B. Kopp, F-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu Rev Immunol, 1998. 16: p. 225-60. Klune, J.R., T.R. Billiar, and A. Tsung, HMGB1 preconditioning: therapeutic application for a danger signal? J Leukoc Biol, 2008. 83(3): p. 558-63. May, M.J. and S. Ghosh, Rel/ F-kappa B and I kappa B proteins: an overview. Semin Cancer Biol, 1997. 8(2): p. 63-73. Shimamoto, A., et al., Toll-like receptor 4 mediates lung ischemia-reperfusion injury. Ann Thorac Surg, 2006. 82(6): p. 2017-23. Lawrence, T., et al., Possible new role for F-kappaB in the resolution of inflammation. at Med, 2001. 7(12): p. 1291-7. Li, Q. and I.M. Verma, F-kappaB regulation in the immune system. at Rev Immunol, 2002. 2(10): p. 725-34. Hatada, E. ., D. Krappmann, and C. Scheidereit, F-kappaB and the innate immune response. Curr Opin Immunol, 2000. 12(1): p. 52-8. Beyaert, R., K. Heyninck, and S. Van Huffel, A20 and A20-binding proteins as cellular inhibitors of nuclear factor-kappa B-dependent gene expression and apoptosis. Biochem Pharmacol, 2000. 60(8): p. 1143-51. Wang, J., et al., egative regulation of Toll-like receptor signaling pathway. Microbes Infect, 2009. 11(3): p. 321-7. Janssens, S., et al., Regulation of interleukin-1- and lipopolysaccharide-induced F-kappaB activation by alternative splicing of MyD88. Curr Biol, 2002. 12(6): p. 467-71. Chen, Z.J., Ubiquitin signalling in the F-kappaB pathway. at Cell Biol, 2005. 7(8): p. 75865. Krappmann, D. and C. Scheidereit, A pervasive role of ubiquitin conjugation in activation and termination of IkappaB kinase pathways. EMBO Rep, 2005. 6(4): p. 321-6. Arenzana-Seisdedos, F., et al., Inducible nuclear expression of newly synthesized I kappa B alpha negatively regulates D A-binding and transcriptional activities of F-kappa B. Mol Cell Biol, 1995. 15(5): p. 2689-96. Hutti, J.E., et al., IkappaB kinase beta phosphorylates the K63 deubiquitinase A20 to cause feedback inhibition of the F-kappaB pathway. Mol Cell Biol, 2007. 27(21): p. 7451-61. Opipari, A.W., Jr., et al., The A20 zinc finger protein protects cells from tumor necrosis factor cytotoxicity. J Biol Chem, 1992. 267(18): p. 12424-7.  88  79. 80. 81. 82. 83. 84.  85. 86. 87.  88.  89.  90. 91.  92.  93. 94. 95. 96. 97. 98. 99. 100. 101. 102. 103.  Cook, S.A., et al., A20 is dynamically regulated in the heart and inhibits the hypertrophic response. Circulation, 2003. 108(6): p. 664-7. Coornaert, B., I. Carpentier, and R. Beyaert, A20: central gatekeeper in inflammation and immunity. J Biol Chem, 2009. 284(13): p. 8217-21. Evans, P.C., et al., Zinc-finger protein A20, a regulator of inflammation and cell survival, has de-ubiquitinating activity. Biochem J, 2004. 378(Pt 3): p. 727-34. Verstrepen, L., et al., ABI s: A20 binding inhibitors of F-kappa B and apoptosis signaling. Biochem Pharmacol, 2009. 78(2): p. 105-14. Mauro, C., et al., ABI -1 binds to EMO/IKKgamma and co-operates with A20 in inhibiting F-kappaB. J Biol Chem, 2006. 281(27): p. 18482-8. Li, H.L., et al., Targeted cardiac overexpression of A20 improves left ventricular performance and reduces compensatory hypertrophy after myocardial infarction. Circulation, 2007. 115(14): p. 1885-94. De ardo, D., et al., Down-regulation of IRAK-4 is a component of LPS- and CpG D Ainduced tolerance in macrophages. Cell Signal, 2009. 21(2): p. 246-52. Dalpke, A.H., et al., Differential effects of CpG-D A in Toll-like receptor-2/-4/-9 tolerance and cross-tolerance. Immunology, 2005. 116(2): p. 203-12. omura, F., et al., Cutting edge: endotoxin tolerance in mouse peritoneal macrophages correlates with down-regulation of surface toll-like receptor 4 expression. J Immunol, 2000. 164(7): p. 3476-9. Medvedev, A.E., et al., Dysregulation of LPS-induced Toll-like receptor 4-MyD88 complex formation and IL-1 receptor-associated kinase 1 activation in endotoxin-tolerant cells. J Immunol, 2002. 169(9): p. 5209-16. Kim, Y.I., et al., CpG D A prevents liver injury and shock-mediated death by modulating expression of interleukin-1 receptor-associated kinases. J Biol Chem, 2008. 283(22): p. 1525870. Lochner, A., et al., Protection of the ischaemic heart: investigations into the phenomenon of ischaemic preconditioning. Cardiovasc J Afr, 2009. 20(1): p. 43-51. Ha, T., et al., Lipopolysaccharide-induced myocardial protection against ischaemia/reperfusion injury is mediated through a PI3K/Akt-dependent mechanism. Cardiovasc Res, 2008. 78(3): p. 546-53. Brown, J.M., et al., Endotoxin pretreatment increases endogenous myocardial catalase activity and decreases ischemia-reperfusion injury of isolated rat hearts. Proc atl Acad Sci U S A, 1989. 86(7): p. 2516-20. Zacharowski, K., et al., Lipoteichoic acid induces delayed protection in the rat heart: A comparison with endotoxin. Arterioscler Thromb Vasc Biol, 2000. 20(6): p. 1521-8. Stevens, S.L., et al., Toll-like receptor 9: a new target of ischemic preconditioning in the brain. J Cereb Blood Flow Metab, 2008. 28(5): p. 1040-7. Klaschik, S., D. Tross, and D.M. Klinman, Inductive and suppressive networks regulate TLR9dependent gene expression in vivo. J Leukoc Biol, 2009. 85(5): p. 788-95. Vollmer, J., et al., Characterization of three CpG oligodeoxynucleotide classes with distinct immunostimulatory activities. Eur J Immunol, 2004. 34(1): p. 251-62. Boyd, J.H., et al., Fibrinogen decreases cardiomyocyte contractility through an ICAM-1dependent mechanism. Crit Care, 2008. 12(1): p. R2. Shiono, T., et al., Suppression of myocardial inflammation using suramin, a growth factor blocker. Circ J, 2002. 66(4): p. 385-9. Yasue, H., et al., Low-grade inflammation, thrombogenicity, and atherogenic lipid profile in cigarette smokers. Circ J, 2006. 70(1): p. 8-13. Date, T., et al., Infiltration of macrophages through the atrial endocardium of inflammationinduced rats: contribution of fractalkine. Circ J, 2009. 73(5): p. 932-7. Kai, H., et al., Large blood pressure variability and hypertensive cardiac remodeling--role of cardiac inflammation. Circ J, 2009. 73(12): p. 2198-203. Hagiwara, ., Inflammation and atrial fibrillation. Circ J, 2010. 74(2): p. 246-7. akagomi, A., et al., Upregulation of monocyte tissue factor activity is significantly associated with low-grade chronic inflammation and insulin resistance in patients with metabolic syndrome. Circ J, 2010. 74(3): p. 572-7.  89  104. 105. 106. 107. 108. 109. 110. 111. 112. 113. 114. 115. 116. 117.  118. 119. 120.  121.  122. 123. 124. 125. 126.  127.  128.  Garg, A.D., et al., Immunogenic cell death, DAMPs and anticancer therapeutics: an emerging amalgamation. Biochim Biophys Acta, 2010. 1805(1): p. 53-71. Bianchi, M.E., DAMPs, PAMPs and alarmins: all we need to know about danger. J Leukoc Biol, 2007. 81(1): p. 1-5. Carta, S., et al., DAMPs and inflammatory processes: the role of redox in the different outcomes. J Leukoc Biol, 2009. 86(3): p. 549-55. Devaney, J.M., et al., eutrophil elastase up-regulates interleukin-8 via toll-like receptor 4. FEBS Lett, 2003. 544(1-3): p. 129-32. Viglianti, G.A., et al., Activation of autoreactive B cells by CpG dsD A. Immunity, 2003. 19(6): p. 837-47. Asea, A., et al., ovel signal transduction pathway utilized by extracellular HSP70: role of tolllike receptor (TLR) 2 and TLR4. J Biol Chem, 2002. 277(17): p. 15028-34. Fallach, R., et al., Cardiomyocyte Toll-like receptor 4 is involved in heart dysfunction following septic shock or myocardial ischemia. J Mol Cell Cardiol. 48(6): p. 1236-44. Mersmann, J., et al., Toll-like receptor 2 signaling triggers fatal arrhythmias upon myocardial ischemia-reperfusion. Crit Care Med. 38(10): p. 1927-32. Dybdahl, B., et al., Inflammatory response after open heart surgery: release of heat-shock protein 70 and signaling through toll-like receptor-4. Circulation, 2002. 105(6): p. 685-90. Mun, H.S., et al., Toll-like receptor 4 mediates tolerance in macrophages stimulated with Toxoplasma gondii-derived heat shock protein 70. Infect Immun, 2005. 73(8): p. 4634-42. Bulut, Y., et al., Mycobacterium tuberculosis heat shock proteins use diverse Toll-like receptor pathways to activate pro-inflammatory signals. J Biol Chem, 2005. 280(22): p. 20961-7. Kukielka, G.L., et al., Induction of interleukin-6 synthesis in the myocardium. Potential role in postreperfusion inflammatory injury. Circulation, 1995. 92(7): p. 1866-75. iessen, H.W., et al., Intercellular adhesion molecule-1 in the heart. Ann Y Acad Sci, 2002. 973: p. 573-85. Raeburn, C.D., et al., ICAM-1 and VCAM-1 mediate endotoxemic myocardial dysfunction independent of neutrophil accumulation. Am J Physiol Regul Integr Comp Physiol, 2002. 283(2): p. R477-86. Osterloh, A., et al., Hsp60-mediated T cell stimulation is independent of TLR4 and IL-12. Int Immunol, 2008. 20(3): p. 433-43. Guzhova, I., et al., In vitro studies show that Hsp70 can be released by glia and that exogenous Hsp70 can enhance neuronal stress tolerance. Brain Res, 2001. 914(1-2): p. 66-73. Grundtman, C., et al., Effects of HMGB1 on in vitro responses of isolated muscle fibers and functional aspects in skeletal muscles of idiopathic inflammatory myopathies. Faseb J. 24(2): p. 570-8. Davani, E.Y., Boyd JH, Dorscheid DR, Wang Y, Meredith A, Chao E, Singhera GK, Walley KR, Cardiac ICAM-1 mediates leukocyte-dependent decreased ventricular contractility in endotoxemic mice. Cardiovasc Res, 2006. Liu, J.C., et al., Heat shock protein 70 gene transfection protects rat myocardium cell against anoxia-reoxygeneration injury. Chin Med J (Engl), 2007. 120(7): p. 578-83. Okubo, S., et al., Gene transfer of heat-shock protein 70 reduces infarct size in vivo after ischemia/reperfusion in the rabbit heart. Circulation, 2001. 103(6): p. 877-81. Mestril, R., et al., Adenovirus-mediated gene transfer of a heat shock protein 70 (hsp 70i) protects against simulated ischemia. J Mol Cell Cardiol, 1996. 28(12): p. 2351-8. Kim, S.C., et al., Extracellular heat shock protein 60, cardiac myocytes, and apoptosis. Circ Res, 2009. 105(12): p. 1186-95. Hagiwara, S., et al., High mobility group box 1 induces a negative inotropic effect on the left ventricle in an isolated rat heart model of septic shock: a pilot study. Circ J, 2008. 72(6): p. 1012-7. Kim, Y.K., et al., Deletion of the inducible 70-kDa heat shock protein genes in mice impairs cardiac contractile function and calcium handling associated with hypertrophy. Circulation, 2006. 113(22): p. 2589-97. Basu, S., et al., ecrotic but not apoptotic cell death releases heat shock proteins, which deliver a partial maturation signal to dendritic cells and activate the F-kappa B pathway. Int Immunol, 2000. 12(11): p. 1539-46.  90  129. 130.  131.  132.  133. 134. 135. 136. 137. 138. 139. 140. 141.  142. 143. 144. 145. 146.  147. 148. 149. 150. 151. 152.  153.  Fleshner, M., et al., Cat exposure induces both intra- and extracellular Hsp72: the role of adrenal hormones. Psychoneuroendocrinology, 2004. 29(9): p. 1142-52. Satoh, M., et al., Elevated circulating levels of heat shock protein 70 are related to systemic inflammatory reaction through monocyte Toll signal in patients with heart failure after acute myocardial infarction. Eur J Heart Fail, 2006. 8(8): p. 810-5. Zou, ., et al., Critical role of extracellular heat shock cognate protein 70 in the myocardial inflammatory response and cardiac dysfunction after global ischemia-reperfusion. Am J Physiol Heart Circ Physiol, 2008. 294(6): p. H2805-13. Sato, T., et al., Tumor-necrosis-factor-alpha-gene-deficient mice have improved cardiac function through reduction of intercellular adhesion molecule-1 in myocardial infarction. Circ J, 2006. 70(12): p. 1635-42. Kaisho, T. and S. Akira, Toll-like receptor function and signaling. J Allergy Clin Immunol, 2006. 117(5): p. 979-87; quiz 988. Brown, M.A. and W.K. Jones, F-kappaB action in sepsis: the innate immune system and the heart. Front Biosci, 2004. 9: p. 1201-17. Boyd, J.H., et al., S100A8 and S100A9 mediate endotoxin-induced cardiomyocyte dysfunction via the receptor for advanced glycation end products. Circ Res, 2008. 102(10): p. 1239-46. Frantz, S., et al., Tissue-specific effects of the nuclear factor kappaB subunit p50 on myocardial ischemia-reperfusion injury. Am J Pathol, 2007. 171(2): p. 507-12. Tross, D., et al., Global changes in gene expression and synergistic interactions induced by TLR9 and TLR3. Mol Immunol, 2009. 46(13): p. 2557-64. Michael, L.H., et al., Myocardial ischemia and reperfusion: a murine model. Am J Physiol, 1995. 269(6 Pt 2): p. H2147-54. Cooper, C.L., et al., CPG 7909 adjuvant improves hepatitis B virus vaccine seroprotection in antiretroviral-treated HIV-infected adults. AIDS, 2005. 19(14): p. 1473-9. McCluskie, M.J. and A.M. Krieg, Enhancement of infectious disease vaccines through TLR9dependent recognition of CpG D A. Curr Top Microbiol Immunol, 2006. 311: p. 155-78. oll, B.O., et al., Biodistribution and metabolism of immunostimulatory oligodeoxynucleotide CPG 7909 in mouse and rat tissues following subcutaneous administration. Biochem Pharmacol, 2005. 69(6): p. 981-91. Boyd, J.H., et al., Vasopressin decreases sepsis-induced pulmonary inflammation through the V2R. Resuscitation, 2008. 79(2): p. 325-31. Frantz, S., et al., Toll4 (TLR4) expression in cardiac myocytes in normal and failing myocardium. J Clin Invest, 1999. 104(3): p. 271-80. Birks, E.J., et al., Increased toll-like receptor 4 in the myocardium of patients requiring left ventricular assist devices. J Heart Lung Transplant, 2004. 23(2): p. 228-35. Akira, S., Toll-like receptors: lessons from knockout mice. Biochem Soc Trans, 2000. 28(5): p. 551-6. Knuefermann, P., et al., Toll-like receptor 2 mediates Staphylococcus aureus-induced myocardial dysfunction and cytokine production in the heart. Circulation, 2004. 110(24): p. 3693-8. Takeda, K. and S. Akira, Toll-like receptors in innate immunity. Int Immunol, 2005. 17(1): p. 1-14. Kawai, T. and S. Akira, TLR signaling. Semin Immunol, 2007. 19(1): p. 24-32. Mehra, V.C., V.S. Ramgolam, and J.R. Bender, Cytokines and cardiovascular disease. J Leukoc Biol, 2005. Frantz, S., et al., Absence of F-kappaB subunit p50 improves heart failure after myocardial infarction. Faseb J, 2006. 20(11): p. 1918-20. Chong, A.J., et al., Toll-like receptor 4 mediates ischemia/reperfusion injury of the heart. J Thorac Cardiovasc Surg, 2004. 128(2): p. 170-9. Tillmanns, J., et al., Caught in the act: in vivo molecular imaging of the transcription factor F-kappaB after myocardial infarction. Biochem Biophys Res Commun, 2006. 342(3): p. 7734. Knuefermann, P., et al., Bacterial D A induces myocardial inflammation and reduces cardiomyocyte contractility: role of Toll-like receptor 9. Cardiovasc Res, 2008. 78(1): p. 26-35.  91  154. 155. 156. 157. 158.  159. 160. 161. 162. 163. 164. 165.  166.  Ghosh, S. and M.S. Hayden, ew regulators of F-kappaB in inflammation. at Rev Immunol, 2008. 8(11): p. 837-48. Vasileiou, I., et al., Toll-like receptors: a novel target for therapeutic intervention in intestinal and hepatic ischemia-reperfusion injury? Expert Opin Ther Targets. 14(8): p. 839-53. Marsh, B.J., et al., Inflammation and the emerging role of the toll-like receptor system in acute brain ischemia. Stroke, 2009. 40(3 Suppl): p. S34-7. Jenner, R.G. and R.A. Young, Insights into host responses against pathogens from transcriptional profiling. at Rev Microbiol, 2005. 3(4): p. 281-94. Yeo, S.J., et al., CpG D A induces self and cross-hyporesponsiveness of RAW264.7 cells in response to CpG D A and lipopolysaccharide: alterations in IL-1 receptor-associated kinase expression. J Immunol, 2003. 170(2): p. 1052-61. Basu, S. and M.J. Fenton, Toll-like receptors: function and roles in lung disease. Am J Physiol Lung Cell Mol Physiol, 2004. 286(5): p. L887-92. Cook, D. ., D.S. Pisetsky, and D.A. Schwartz, Toll-like receptors in the pathogenesis of human disease. at Immunol, 2004. 5(10): p. 975-9. Medvedev, A.E., et al., Tolerance to microbial TLR ligands: molecular mechanisms and relevance to disease. J Endotoxin Res, 2006. 12(3): p. 133-50. Fan, H. and J.A. Cook, Molecular mechanisms of endotoxin tolerance. J Endotoxin Res, 2004. 10(2): p. 71-84. Heyninck, K. and R. Beyaert, A20 inhibits F-kappaB activation by dual ubiquitin-editing functions. Trends Biochem Sci, 2005. 30(1): p. 1-4. Vereecke, L., R. Beyaert, and G. van Loo, The ubiquitin-editing enzyme A20 (T FAIP3) is a central regulator of immunopathology. Trends Immunol, 2009. 30(8): p. 383-91. Quebec, G. McGill University and Genome Quebec Innovation Centre - Gene Expression Analysis. 2010 cited 2010 April 15, 2010]; Available from: http://gqinnovationcenter.com/services/functionalGenomics/technoIlluminaExpression.aspx ?l=e. Illumina. Illumina MouseRef-8 v2.0 Expression BeadChips - For genome discovery. 2010 cited 2010 April 15, 2010]; Available from: http://www.illumina.com/products/mouseref8_expression_beadchip_kits_v2.ilmn.  92  Appendix 1  Assay Methodology  NFΚB-LUCIFERASE ASSAY The NFκB luciferase assay is a method to quantify the amount of direct NFκB activation caused by a stimulus. The luciferase assay requires the transfection of a firefly-luciferase vector that contains the promoter region of NFκB. As NFκB is activated it will bind to the promoter region on the vector and initiate the transcription and translation of the luciferase gene. Once the luciferase protein comes in contact with its substrate a fluorescent signal is produced. The intensity and duration of the signal is proportional to the amount of NFκB activity. In order to adjust for any false positive results, a second vector that encodes for the renilla-luciferase gene is also transfected. This renillaluciferase is constitutively expressed and should not be affected by any cellular stimulation. Therefore if an increase in the amount of firefly-luciferase : renillaluciferase is detected an increase in NFκB activity has occurred. qRT-PCR Activation of NFκB leads to the transcription of several inflammatory genes within several hours. Quantification of the mRNA transcribed can accurately depict the severity of the inflammatory response produced. Quantification of mRNA requires several steps that are dependent upon the use of the Polymerase Chain Reaction (PCR). Real Time Quantitative-PCR (qRT-PCR) is a method to quantify the expression of specific genes via real-time fluorescence monitoring. qRT-PCR begins with the conversion of mRNA into cDNA using a reverse transcriptase enzyme. The cDNA is then exponentially amplified via PCR. As the single stranded cDNA amplifies, it becomes double stranded while annealing to a primer probe. The use of SYBR Green based detection allows for quantification of double stranded DNA pairs via fluorescence. The intensity of fluorescence is proportional to the amount of double stranded cDNA present; therefore high fluorescence equates to a high proportion of mRNA in the original sample. Expression of target genes can be easily attained via qRT-PCR analysis.  ILLUMINA Illumina microarray is a method of determining whole cell mRNA expression rather than specific target gene expression. Illumina based arrays use Expression BeadChip technology. Each bead possesses thousands of probes on its surface that are able to bind to cDNA created from mRNA samples. Each bead contains a tag that designates it to a location on microarray chip. Analysis of the chip and BeadChip allows for quantification of gene expression [165]. Our experiments are murine based and therefore we analyzed whole cell mRNA expression using the MouseRef-8 Expression BeadChip. This chip is able to determine expression of over 25,000 different transcripts from 19,000 genes in the mouse genome [166].  93  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0072427/manifest

Comment

Related Items