UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Identification of membrane-interacting proteins and membrane protein interactomes using Nanodiscs and… Zhang, Xiao Xiao 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2012_spring_zhang_xiaoxiao.pdf [ 12.85MB ]
Metadata
JSON: 24-1.0072417.json
JSON-LD: 24-1.0072417-ld.json
RDF/XML (Pretty): 24-1.0072417-rdf.xml
RDF/JSON: 24-1.0072417-rdf.json
Turtle: 24-1.0072417-turtle.txt
N-Triples: 24-1.0072417-rdf-ntriples.txt
Original Record: 24-1.0072417-source.json
Full Text
24-1.0072417-fulltext.txt
Citation
24-1.0072417.ris

Full Text

Identification of membrane-interacting proteins and membrane protein interactomes using Nanodiscs and proteomics by Xiao Xiao Zhang B.Sc., Queen’s University, 2008 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Biochemistry and Molecular Biology) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) November 2011 © Xiao Xiao Zhang, 2011 ii Abstract The insoluble nature of membrane proteins has complicated the identification of their interactomes. The Nanodisc has allowed the membrane and membrane proteins to exist in a soluble state. In this thesis, we combined Nanodisc and proteomics and applied the technique to discover the interactome of membrane proteins. Using the SecYEG and MalFGK membrane complex incorporated into Nanodisc, we identified, Syd, SecA, and MalE. These interactions were identified with high specificity and confidence from total soluble protein extracts. The protein YidC was also tested but no interactors were detected. Overall, these results showed that the technique can identify periplasmic and cytosolic interacting partners with high degree of specificity. In a second approach, the method was applied to detect proteins with high affinity for lipid using S. cerevisiae as a model organism. Using Nanodiscs containing different types of phospholipids, many known lipid interactors were identified, including: Ypt1, Sec4, Vps21, Osh6, and Faa1. Interestingly, Caj1 was identified as a PA specific interactor and this interaction was found to be pH dependent. Liposome sedimentation assay showed that Caj1 has affinity for acidic phospholipids. In vivo analysis confirmed the plasma membrane localization of N’-GFP-Caj1 and specifically to the yeast buds. However, pH dependent localization was not observed. Together, with the in vivo and in vitro results suggests that Caj1 is an acidic phospholipid interacting protein. iii Preface The proteomic aspect of this thesis was done in collaboration with the laboratory of Dr. Leonard Foster. The trypsin digestion and STAGE-tip purification were performed by me. The injection of the peptides onto the mass spectrometer was performed by technicians (Yuan Fang, Isabelle Kelly, Amy Tam, and Jenny Moon) in the Foster lab. Yeast genetic and microscopy work in Chapter 3 were performed with John Shin in the laboratory of Dr. Christopher Loewen, where he showed me the basic principles of yeast genetics and the operation of the microscope. The work presented in Chapter 2 was conducted with Dr. Catherine Chan, Huan Bao and Yuan Fang. I performed 90 % of the experiments. Dr. Chan was responsible for the initial experimental ideas and performed the SILAC experiments with Nanodisc SecYEG made with phosphatidylglycerol. Nanodisc MalFGK was provided by Huan Bao. All of the SecYEG used were purified by Jean-François Montariol. Yuan Fang helped with the injection of the peptides onto the mass spectrometer. Manuscript of this work is accepted for publication in the jounal of proteomics reserach where I am co-authors with Dr. Catherine Chan, Huan Bao and Yuan Fang. iv Table of contents Abstract.................................................................................................................................... ii Preface..................................................................................................................................... iii Table of contents .................................................................................................................... iv List of tables.......................................................................................................................... viii List of figures.......................................................................................................................... ix List of abbreviations .............................................................................................................. xi Acknowledgements .............................................................................................................. xiii Dedication ............................................................................................................................. xiv Chapter  1: Introduction ........................................................................................................ 1 1.1 Nanodisc ................................................................................................................... 1 1.2 Mass spectrometry based proteomics ....................................................................... 3 1.2.1 Tandem mass spectrometry, LTQ-Orbitrap .......................................................... 3 1.2.2 SILAC (stable-isotope labelling with amino acids in cell culture) ....................... 3 1.3 Overview of the technique ........................................................................................ 4 Chapter  2: Membrane protein interactome in Escherichia coli ........................................ 6 2.1 Introduction............................................................................................................... 6 2.1.1 The Sec translocon and its interacting partners .................................................... 6 2.1.2 The membrane protein insertase ........................................................................... 8 2.1.3 The maltose transporter......................................................................................... 8 2.1.4 Aims...................................................................................................................... 9 2.2 Materials and methods .............................................................................................. 9 2.2.1 Materials ............................................................................................................... 9 v2.2.2 Cloning................................................................................................................ 10 2.2.2.1 Polymerase chain reaction conditions......................................................... 10 2.2.2.2 Site-directed mutagenesis ........................................................................... 10 2.2.3 Syd expression .................................................................................................... 11 2.2.4 YidC expression.................................................................................................. 12 2.2.5 Membrane protein purification ........................................................................... 12 2.2.6 Nanodisc reconstitution ...................................................................................... 13 2.2.7 Stable isotope labelling with amino acids in cell culture (SILAC) .................... 14 2.2.8 Nickel affinity pulldown ..................................................................................... 15 2.2.9 In solution proteolytic digestion ......................................................................... 15 2.2.10 Stage-tip (Stop-and-go-extraction-tips) purification....................................... 15 2.2.11 Analysis of mass spectrometry data................................................................ 16 2.3 Results..................................................................................................................... 17 2.3.1 YidC purification ................................................................................................ 17 2.3.2 Nanodisc reconstitutions ..................................................................................... 19 2.3.3 SILAC cultures ................................................................................................... 20 2.3.4 Nickel affinity pulldown with SILAC protein extract ........................................ 20 2.3.5 The SecYEG interactome ................................................................................... 21 2.3.6 MalFGK interactome .......................................................................................... 24 2.3.7 YidC interactome ................................................................................................ 27 2.3.8 Summary............................................................................................................. 28 Chapter  3: Identification of the peripherally-bound membrane proteins in Saccharomyces cerevisiae ...................................................................................................... 29 vi 3.1 Introduction............................................................................................................. 29 3.1.1 Membrane phospholipids in S. cerevisiae .......................................................... 29 3.1.2 Lipid interacting proteins in yeast....................................................................... 30 3.1.3 Phosphatidic acid ................................................................................................ 32 3.2 Materials and methods ............................................................................................ 34 3.2.1 Materials ............................................................................................................. 34 3.2.2 Empty Nanodisc reconstitution........................................................................... 34 3.2.3 Yeast growth conditions (SILAC) ...................................................................... 35 3.2.4 Caj1 cloning ........................................................................................................ 35 3.2.5 Caj1 expression................................................................................................... 36 3.2.6 Caj1 purification ................................................................................................. 36 3.2.6.1 Caj1-His6 purification ................................................................................. 36 3.2.6.2 Non-tagged Caj1 purification ..................................................................... 37 3.2.7 Nickel affinity pulldown ..................................................................................... 37 3.2.8 Liposome preparation ......................................................................................... 38 3.2.9 Liposome sedimentation assay ........................................................................... 38 3.2.10 N- and C- terminal GFP-tagged Caj1 ............................................................. 38 3.2.10.1 Yeast transformation............................................................................... 40 3.2.10.2 Gene crossing.......................................................................................... 40 3.2.11 Confocal fluorescence microscopy ................................................................. 40 3.3 Results..................................................................................................................... 41 3.3.1 Nickel affinity pulldown ..................................................................................... 41 3.3.2 Lipid binding proteins identified ........................................................................ 41 vii 3.3.3 Purification of Caj1............................................................................................. 46 3.3.4 Verification of Caj1-PA interaction using Nanodiscs and liposomes ................ 48 3.3.4.1 Effect of pH on the binding of Caj1 to PA ................................................ 50 3.3.5 Measure of the Caj1-PA interaction in intact cells ............................................. 52 Chapter  4: Discussion .......................................................................................................... 58 4.1 The membrane protein interactome in E. coli......................................................... 58 4.2 The membrane interactome in S. cerevisiae ........................................................... 59 Chapter  5: Conclusion......................................................................................................... 64 5.1 Address the aims of project..................................................................................... 64 5.2 Future Directions .................................................................................................... 64 References .............................................................................................................................. 66 Appendices............................................................................................................................. 71 Appendix A Primers ........................................................................................................... 71 Appendix B E. coli mass spectrometry results summary ................................................... 72 Appendix C S. cerevisiae mass spectrometry results summary.......................................... 84 viii List of tables Table 2.1 Polymerase chain reaction program........................................................................ 10 Table 2.2 Summary of the top ten proteins identified with Nd-SecYEG ............................... 22 Table 2.3 Summary of the top ten proteins identified with Nd-MalFGK............................... 25 Table 2.4 Summary of the top ten proteins identified with Nd-YidC .................................... 27 Table 3.1 Phospholipid composition of S. cerevisiae ............................................................. 29 Table 3.2 Yeast strains used in this study ............................................................................... 34 Table 3.3 Plasmids used in this study ..................................................................................... 34 Table 3.4 Top ten non-ribosomal proteins identified with empty Nanodiscs ......................... 43 Table A.1 Primers used in this study ...................................................................................... 71 Table B.1 Complete list of proteins identified with Nd-YEG containing E. coli total lipid extract...................................................................................................................................... 72 Table B.2 Complete list of proteins identified with Nd-YEG containing PG lipids .............. 74 Table B.3 Complete list of proteins identified with Nd-MalFGK using glucose cultured SILAC extract ......................................................................................................................... 76 Table B.4 Complete list of proteins identified with Nd-MalFGK using maltose cultured SILAC extract ......................................................................................................................... 79 Table B.5 Complete list of proteins identified with Nd-YidC................................................ 82 Table C.1 Complete list of proteins identified with Nd-Ec .................................................... 84 Table C.2 Complete list of proteins identified with Nd-PE.................................................... 87 Table C.3 Complete list of proteins identified with Nd-PEPA (50:50).................................. 89 ix List of figures Figure 1.1 Schematic of Nanodiscs .......................................................................................... 2 Figure 1.2 General experimental scheme involved in MS-based proteomics .......................... 5 Figure 2.1 SecYEG and its interacting partners........................................................................ 7 Figure 2.2 YidC purification................................................................................................... 18 Figure 2.3 Nanodisc reconstitutions ....................................................................................... 19 Figure 2.4 Nanodisc pulldown with Syd................................................................................. 20 Figure 2.5 Summary of SILAC ratios for proteins identified to interact with Nanodiscs SecYEG................................................................................................................................... 23 Figure 2.6 Summary of SILAC ratios for proteins identified to interact with Nanodisc MalFGK .................................................................................................................................. 26 Figure 2.7 Summary of SILAC ratios for proteins identified to interact with Nanodisc YidC ................................................................................................................................................. 28 Figure 3.1 Different types of interaction between peripheral membrane proteins and the membrane................................................................................................................................ 31 Figure 3.2 Simple representation of the electrostatic/hydrogen bond switch model. ............. 33 Figure 3.3 Strategy for GFP-tagged Caj1 construction. ......................................................... 39 Figure 3.4 Summary of SILAC ratios for proteins identified to interact with Nanodisc Ec, PE and PEPA. ............................................................................................................................... 44 Figure 3.5 The acidic and basic map of the Caj1 protein ....................................................... 45 Figure 3.6 Purifiaction of His6-tagged and non-tagged Caj1.................................................. 47 Figure 3.7 Binding of Caj1 to acidic phospholipids with Nanodsics and liposomes. ............ 49 Figure 3.8 pH-dependent binding of Caj1 to PA in Nanodiscs and liposomes ...................... 51 xFigure 3.9 Localization of C- and N- terminal GFP-tagged Caj1 in yeast cells ..................... 52 Figure 3.10 Effect of pH on Caj1 localization ........................................................................ 54 Figure 3.11 Overexpression of Dgk1 and Pah1 and effect on the localization of Caj1.......... 56 Figure 3.12 Interaction of Caj1 with acidic phospholipids ..................................................... 57 xi List of abbreviations ABC ATP binding cassette ATP adenosine triphosphate CL cardiolipin DDM n-Dodecyl β-D-maltopyranoside DNA deoxyribonucleic acid Ec E. coli total lipid extract EDTA ethylenediaminetetraacetic acid ER endoplasmic reticulum ESI electrospray ionization GDI Rab GDP dissociation inhibitor GDP guanosine diphosphate GFP green fluorescence protein GTP guanosine triphosphate IPTG isopropyl-β-D-thiogalactopyranosid LB luria broth LTQ linear trapping quadrupole m/z mass-to-charge ratio mPA methyl phosphotidic acid (1,2-Dioleoyl-sn-Glycero-3-phosphomethanol) MS mass spectrometry MS/MS tandem mass spectrometry MSP membrane scaffold protein Nd-Ec Nanodisc E. coli total lipid extract Nd-MalFGK Nanodisc MalFGK Nd-PE Nanodisc phosphatidylethonalamine Nd-PEPA Nanodisc phosphatidylethonalamine and phosphatidic acid Nd-PG Nanodisc phosphatidylglycerol Nd-SecYEG Nanodisc SecYEG Nd-YidC Nanodisc YidC OD optical density ORD OSBP related domain OSBP oxysterol binding protein PA phosphatidic acid PAGE polyacylamine gel electrophoresis PC phosphatidylcholine PCR polymerase chain reaction PDB protein data bank PE phosphatidylethonalamine PG phosphatidylglycerol PH pleckstrin homology pHi intracellular cytosolic pH PI phosphatidylinosotol PI4P phosphatidylinositol-4-phosphate PIP phosphoinositides PMSF phenylmethanesulfonyl fluoride xii PS phosphatidylserine PX domain phosphoinositide binding domain SDS sodium dodecyl sulfate SILAC stable labelling with amino acids in cell culture TMS transmembrane segments xiii Acknowledgements There are many people to thank, without them this thesis would not be possible. First and foremost I would like to thank my supervisor Dr. Franck Duong for the opportunity to complete my Master’s training in your lab. You have provided me with such excellent lab environment and project. Your generous guidance had thought me to think deeper and more critical. I also like to thank my committee members, Dr. George Mackie and Dr. Leonard Foster, and my external examiner, Dr. Christopher Loewen, for their valuable advice on my project. I received training of proteomic techniques with funding from British Columbia Proteomics Network. My fellow lab members had made the everyday work more enjoyable. Especially, Dr. Catherine Chan, Dr. Hai-Tuong Le and Jean-François Montariol, who had not only helped me on different aspects of my project but also, had become good friends. Fellow students Kush Dalal, Huan Bao, Allan Mills, John Shin, Spencer MacDonald and Sung-hoon Choi, had given me many helpful suggestions. I thank my grandparents for inspiring to become a scientist. Finally, I would like to thank my parents for bringing me to this country. They had left behind many things to come to Canada and it has been challenging for them to adapt to the new country, but they had done it for my future. I thank them for their unconditional love. xiv Dedication To my family 1Chapter  1: Introduction About 30 % of the coding region of the human genome encodes membrane proteins (1). This class of proteins plays important roles in many biological processes, such as signal transduction, protein trafficking, and energy production (2). Various diseases and conditions are related to changes or mutations in membrane proteins, such as Alzheimer’s, cystic fibrosis, and multi-drug resistance; therefore, it is essential to study and understand membrane proteins and their interacting partners. However, membrane proteins are difficult to work with due to their membrane-bound location and their insoluble nature in aqueous solution. Many of the technologies available today to study protein interactions, such as co- immunoprecipitation and the yeast two-hybrid system, are not suitable for membrane proteins (3). These problems are partially overcome by the use of detergent micelles and artificial liposomes but these systems are not ideal to study membrane proteins. Detergent can denature proteins and destabilize their interactions, whereas liposomes are heterogeneous in size and often promote non-specific protein associations. These limitations hinder any efforts in understanding the membrane proteome network and limit the application of high throughput technology aimed at identifying binding partners of membrane and membrane proteins. Novel and more adapted methods are required to effectively examine the membrane interactome. 1.1 Nanodisc The phospholipid bilayer Nanodisc is a soluble particle, about 10 nanometers in diameter, consisting of two amphipathic membrane scaffold proteins (MSP), wrapped around a patch of phospholipid bilayer with or without a membrane protein in the middle (4) (Fig. 1.1). The Nanodisc allows a membrane protein to exist in solution without the presence of 2detergent. This allows the study of membrane proteins in an environment similar to native membranes. Nanodisc technology has been successfully employed for studying bacteriorhodopsin (5), cytochromes P450 (6), and the beta2-adrenergic receptor (7). In our lab, the reconstitution of the SecYEG complex into Nanodiscs has been optimized and applied to investigate the interaction of SecYEG with SecA and Syd. These earlier successes had led me to propose that Nanodisc can provide a novel method to identify and characterize the membrane protein interactome. Figure 1.1 Schematic of Nanodiscs Green belts represent MSPs which wraps around a patch of lipid bilayer with (left) or without (right) membrane protein in the middle. 31.2 Mass spectrometry based proteomics In recent years, mass spectrometry has become a method of choice for analyzing complex protein samples, especially in the study of protein-protein interactions via affinity based isolations. A mass spectrometer consists of three main components: an ion source, a mass analyzer which measures the mass-to-charge ration (m/z) of charged particles, and a detector. Methods of mass spectrometry have quickly evolved with the development for different ionization techniques. Newer instruments are developed to improve the sensitivity, resolution, and mass accuracy of each experiment. 1.2.1 Tandem mass spectrometry, LTQ-Orbitrap One of the advantage of using tandem mass spectrometry (MS/MS) is the ability to generate information-rich ion mass spectra from peptide fragments. MS/MS refers to the use of two different mass spectrometers which produces two sequential mass spectra. The instrument employed in this study is a linear trapping quadrupole (LTQ)-Orbitrap. The tryptic digested peptides are separated by liquid chromatography connected to an electrospray ionization (ESI) source. This process allows the peptides to appear at the outlet at different times thus reduces the effective complexity of the sample. The peptides are ionized into the gas phase and passed through a quadruple followed by orbitrap mass analyzer. The LTQ-Orbitrap provides high accuracy (1-2ppm), resolution and dynamic range (8) which reduces overlapping peaks and produces information-rich mass spectra. 1.2.2 SILAC (stable-isotope labelling with amino acids in cell culture) The field of proteomics had developed from largely qualitative to quantitative which allows the comparison of relative protein abundance between two proteomes. SILAC is a simple and powerful approach to quantitative proteomics. In this method, stable isotope 4labels, such as 13C-labelled arginine, are introduced in the growth media of living cells, which results in the whole proteome to become stable isotope-labelled. The protein profiles of the labelled and the non-labelled are virtually identical with mass differences that can only be detected via a mass spectrometer. The ratio of signal intensities of the analyte pairs indicates their relative abundance. It allows a control and a test sample to be handled and processed in the same manner and even in the same reaction tubes, which reduces any variation that could be introduced during sample processing. While various labels, such as 15N-labelling, can be used in the labeling process, arginine and lysine are used in this study. One of the advantages of using these two amino acids is, with trypsin digest every peptide excluding the carboxyl-terminal peptides of the protein will contain at least one label. To achieve complete SILAC labelling, auxotrophic strains such as Arg-/Lys- double auxotrophic yeast (9), is usually required. 1.3 Overview of the technique The technique employed in this study combines Nanodisc with SILAC proteomics. Total soluble protein extracts obtained from SILAC cultures were used as preys and Nanodisc were used as baits. After reisolation of the discs, the elutes were combined and proteolysed by trypsin then injected onto a liquid chromatography with an electrospray outlet, followed by mass spectrometry analysis. The isolated co-proteins were identified via data base search of the peptide fragment and quantified via their SILAC labels. An overview of the experimental procedure is presented in Figure 1.2. By combining Nanodisc, SILAC and tandem mass spectrometry, the method is predicted to be sensitive enough to detect specific interactions even with those less abundant proteins. 5Figure 1.2 General experimental scheme involved in MS-based proteomics Soluble protein extract obtained from SILAC cultures were used in Nickel affinity pulldown with appropriate Nanodiscs as baits. The elute samples were combined and digested with trypsin. Digested peptides were subjected to MS analysis. 6Chapter  2: Membrane protein interactome in Escherichia coli 2.1 Introduction 2.1.1 The Sec translocon and its interacting partners The SecY complex/channel/translocon is the universal protein translocation channel which catalyzes protein transport across membranes (10). In bacteria, it is composed of three subunits, SecY, SecE and SecG, where SecYE form the core of the protein conducting channel and SecG serves as a stimulatory subunit associated with the core channel (11). SecY is the largest subunit of the protein-conducting channel with a molecular weight of 48 kDa. The SecY subunit consists of 10 transmembrane segments (TMSs) with the N- and C- terminal ends in the cytosol (12). SecE is a smaller integral membrane protein with a mass of 14 kDa and consists of 3 TMSs (13). SecG has a mass of 12 kDa with 2 TMSs (14). This subunit is non-essential and functions to stimulate SecYE-mediated protein translocation and SecA ATPase (11). The crystal structure of the SecY complex (Fig. 2.1) reveals a region of loops and helices that extends into the cytosol (15) where the SecY channel establishes transient interactions with its cytosolic partners. In Figure 2.1, three interactions are highlighted. First, the translating ribosome docks at this region of the SecY complex and feeds the newly synthesized peptide through the channel (16). Second, the SecA ATPase has high affinity for the SecY complex and acidic phospholipids. In E. coli, SecA is a large 102 kDa protein that provides energy via ATPase hydrolysis which drives the translocation of protein across the inner membrane (17). Third, Syd, a small 22 kDa protein, also interacts with the SecY complex at this region to control its assembly (18). 7Figure 2.1 SecYEG and its interacting partners Structure of the protein conduction channel (A) with its cytoplasmic interacting region highlighted. Structures of three of the SecYEG interacting partners are shown: the ribosome (B), Syd (C) and SecA (D). PDB IDs for SecY channel, ribosome, Syd, and SecA are 1RHZ, 3J01, 3FFV, and 2FSF respectively. Structures are not to scale. 82.1.2 The membrane protein insertase In bacteria, another important component of protein transport is the insertase YidC. It is an essential membrane protein which facilitates insertion and assembly of many inner membrane proteins (19). Studies have shown that YidC interacts with transmembrane helices of membrane proteins after their release from the SecYEG translocon (20). It is not known how YidC releases membrane proteins and whether it associates with other proteins during the insertion reaction. In E. coil, YidC has a molecular mass of ~ 62 kDa with predicted 6 TMSs. The topology map of YidC reveals a large, 35 kDa, periplasmic loop (P1) at the N- terminus of the protein (21). The crystal structure of the P1 domain suggests that YidC may interact with periplasmic chaperones that aid in protein folding and secretion following insertion into the membrane (22). However, these interacting partners have yet to be identified. 2.1.3 The maltose transporter The MalFGK complex is an ATP binding cassette (ABC) transporter involved in the transport of maltose to accommodate the dynamic lifestyle of E. coli. The complex comprises of two integral membrane subunits, MalFG, and two MalK ATPase subunits attached from the cytoplasmic side. In the absence of glucose but presence of maltose, the operons controlling expression of genes involved in maltose transport are turned on by their transcription activator MalT (23). Together with the periplasmic maltose-binding protein MalE, MalFGK coordinates the transport of maltose from the periplasm into the cytoplasm (24). Other known proteins that associate with MalFGK include MalT and EIIA. Previous studies show that MalT binds free MalK in vitro and it is believed that the majority of MalT binds to only the inactive MalFGK complex in vivo (25-26). EIIA is part of the 9phosphoenolpyruvate-sugar phosphotransferase system serves to inhibit maltose transport in the presence of glucose (28). This interaction has not been observed directly but has been implicated through peptide arrays (27-28). 2.1.4 Aims The interactome of three membrane proteins will be examined using the techniques described in Chapter 1. The SecYEG and MalFGK complexes will serve as models for the development and optimization of the method followed by the application of the technique to YidC. Since the interactors of YidC are unknown, novel interacting partners of this protein could potentially be identified. 2.2 Materials and methods 2.2.1 Materials All salts and solvents were obtained from Fisher Scientific (Hampton, NH). All enzymes used in molecular cloning procedures were purchased from New England Biolabs, Inc (Ipswitch, MA). The following materials were obtained as indicated: Primer oligos – Life Technologies (Carlsbad, CA); phospholipids – Avanti Polar Lipids Inc. (Alabaster, AL); natural amino acids, dithiothreitol and iodoacetamide – Sigma-Aldrich (Oakville, ON); isotopically labelled lysine and arginine – Cambridge Isotope Laboratories (Andover, MA); sequencing grade trypsin – Roche (Laval, QC, Canada); Bio-Beads® SM2 Adsorbent – Bio- Rad (Hercules, CA); n-Dodecyl-β-D-Maltopyranoside (DDM) – Affymetrix (Santa Clara, CA); All purification columns and beads – GE Healthcare (Pittsbourgh, PA); ampicillin, arabinose and phenylmethanesulfonyl fluoride (PMSF) – Fisher Scientific. 10 2.2.2 Cloning The construct pET23a-Syd-Myc-His6 was already available in the laboratory. A stop codon was placed just before the hexa-histidine tag to remove the His-tag using site-directed mutagenesis. The primers are listed in appendix A.2.2.2.1 Polymerase chain reaction conditions For each polymerase chain reaction (PCR) approximately 0.5 µg of template, 10 pmol of primers, 2-5 mM magnesium chloride, 0.2 mM dNTPs and 1 U of Phusion™ DNA polymerase were mixed together in the recommended buffer (to a final volume of 50 µl). The reaction was performed in 0.2 ml thin wall PCR tubes (Axygen) with an Eppendorf Mastercycler 5332 thermomulticycler under the conditions listed below. Table 2.1 Polymerase chain reaction program Step Temperature Time 1 95 ºC 4 min 2 95 ºC 1 min 3 Tanneal= (Tm – 7 ºC) 0.5 min 4 72 ºC Amplification time depends on the length of the product (~1 kb/min) 5 Go to step 2 Repeat 25 – 30 times 6 72 ºC 5 min 7 16 ºC Hold 2.2.2.2 Site-directed mutagenesis The volume of the PCR reaction for site-directed mutagenesis was 25 µl. A small amount (5 µl) of the amplified PCR product was analyzed on a 1.0 % agarose gel in TBE buffer (89 mM Tris, 89 mM Borate and 2 mM EDTA) to ensure there were amplified products. Then 5 µl of the PCR reaction were incubated with 10 units of Dpn1 in 1X NEBuffer 4 (20 mM Tris-acetate, 50 mM potassium acetate, 10 mM Magnesium Acetate, 11 1 mM Dithiothreitol pH 7.9) for 2 hours at 37 ºC to remove parental DNA strands which do not contain the mutation. The digested material was separated on a 1 % agrose gel. The desired product was excised under low intensity UV lamp and purified using an EconoSpin™ silica membrane spin column for DNA (Epoch Life Science). The digested PCR product was then transformed into competent DH5α cells and cells were plated on selective ampicilin LB agar (29). The insertion of the stop codon disrupted a XhoI restriction enzyme digestion site. To test this, the plasmids were digested with 6 units of XhoI in 1 X NEBuffer 4 for 30 min at 37 ºC. The correct plasmid was verified by sequencing through Eurofin MWG Operon. 2.2.3 Syd expression Construct pET23a-Syd-myc was transformed into E. coli strain BL21 (DE3) for protein expression. Cells were grown overnight at 37 ºC in 30 mL of luria broth (LB) medium with 80 µg/L of ampicillin. The next day culture was diluted into 3 L of fresh medium. The cells were incubated at 37 ºC with agitation until the O.D.600 reached 0.5. The cultures were induced with 0.5 mM IPTG and grown for two more hours before harvesting. Cells were centrifuged for 10 min at 5,000 g (Beckman JLA 10.5 rotor). Pellets were suspended in buffer A (50 mM Tris pH 7.9, 100 mM sodium chloride, and 10 % v/v glycerol) and protease inhibitor was added before lysis. The cells were passed through a 30 ml French ® pressure cell press at 12,000 psi three times to ensure complete cell lysis. The lysate was centrifuged at low speed, 10 min at 7,000 g (Beckman JA 25.5 rotor), to remove cell debris, unbroken cells and large inclusion bodies. Then the supernatant was ultracentrifuged for 45 min at 200,000 g (Beckman Type 60 Ti rotor) at 4 ºC. The supernatant containing the soluble protein fraction was stored at -80 ºC for future analysis. 12 2.2.4 YidC expression Plasmid pBad22 encoding N-terminal His6 tagged YidC gene was available in the lab. E. coli strain BL21 (DE3) containing pBad22 YidC was grown overnight at 37 ºC in 20 ml of LB medium with 80 µg/L of ampicillin. Next day, the culture was diluted into 2 L of fresh LB medium with ampicillin and shaken at 37 ºC. Cells were induced at O.D.600 of 0.4 with 0.2 % v/v arabinose. After three hours of induction, cells were harvested and lysed as described in section 2.2.3. The membrane pellet obtained from the high speed ultracentrifugation was resuspended in buffer A to a final total protein concentration of 10 mg/ml. A final concentration of 1 % v/v DDM was included to solubilize the membrane fraction. The sample was gently rocked overnight at 4 ºC. The material was centrifuged at 200,000 g for 45 min (Beckman Type 60 Ti rotor) at 4 ºC to remove insoluble material and protein aggregates. The supernatant was collected for purification. 2.2.5 Membrane protein purification His6-tagged SecYEG was overexpressed from plasmid pBAD22 and purified as described (30). MalFGK bearing a C-terminal His6-tag on MalK was expressed from pBAD22 and purified as for YidC. A 5 ml column, containing Ni2+ sepharose high performance beads was washed with 50 ml of filtered distilled water at a flow rate of 1 ml/min. The column was then equilibrated with ten column volumes of buffer B (50 mM Tris pH 7.9, 100 mM sodium chloride, 10 % v/v glycerol and 0.03 % DDM). The solubilized membrane fraction containing YidC was passed through a 0.45 micron filter to remove large particles then loaded onto the column. The column was washed in buffer B with 30 mM imidazole. YidC was eluted with buffer B plus 500 mM imidazole. The flow through, wash 13 and eluate were analyzed by SDS-PAGE. The eluted fractions containing pure YidC were pooled. YidC was further purified using size exclusion chromatography. The pooled fractions were injected onto a Superose™ 6 HR10/100 column equilibrated with buffer B at a flow rate of 0.5 ml/min. The elution profile was monitored at 280 nm. Fractions were collected and analyzed by a 4-12 % native gel. The soluble YidC fractions were pooled and concentrated using a 15 ml Amico Ultra Centrifugal Filter (Millipore) with molecular weight cut off of 30,000 Da. The purified protein was stored at -80 ºC. 2.2.6 Nanodisc reconstitution Chloroform-dissolved phospholipids were dried under a stream of nitrogen and placed in a vacuum overnight. Prior to reconstitution, the lipids were resuspended by sonication in TS buffer (50 mM Tris pH 7.9, 50 mM sodium chloride). A final concentration of 0.5 % DDM was added to further solubilize the lipids. To make Nanodiscs, membrane scaffold protein (MSP), purified membrane protein and lipids were mixed together in a certain molecular ratio in buffer A with 0.5 % w/v DDM. This ratio differs for each membrane protein. For Nanodisc SecYEG (Nd-SecYEG), the ratio was 1 nmol of SecYEG to 4 nmol of MSP to 40 nmol of lipids. No lipids were added during the reconstitution of Nanodisc YidC (Nd-YidC) and Nanodisc MalFGK (Nd-MalFGK) and the ratio of protein to MSP was 1:4. One quarter of the total volume of BioBeads® was added and the mixture was gently rocked at 4 ºC overnight to slowly remove the detergent. The beads were removed by passing the mixture through an empty spin column with a cotton filter base. To remove aggregates, liposomes and excess MSP, the sample was injected onto a Superdex™ 200 HR10/200 column equilibrated with buffer A. Peak fractions corresponding 14 to the soluble form of the discs were analyzed by electrophoresis on a 4-2 % blue- or clear- native gel then pooled, concentrated and stored at -80 ºC. 2.2.7 Stable isotope labelling with amino acids in cell culture (SILAC) A lysine auxotroph E. coli strain JW2806 [Δ(araD-araB)567 ΔlacZ4787(::rrnB-3) lambda- ΔlysA763::kan rph-1 Δ(rhaD-rhaB)568 hsdR514], with the LysA knock out, was used to achieve maximal uptake of the isotopic amino acid by the cells. Cells were grown overnight in LB medium at 37 ºC. Next day, the cells were washed three times with fresh M9 minimal medium and added at 1/100 dilution (relative to the original culture volume) into M9 minimal medium supplemented with 2 mM magnesium sulphate, 10 µM calcium chloride, 4 µg/ml vitamin B1, 0.4 % w/v glucose, and 0.2 mg/ml amino acids. Cultures were grown simultaneously each with different labels. The ‘light’ culture contains all 20 naturally abundant amino acids. In the ‘heavy’ culture, the arginine and lysine were replaced with 0.174 mg/ml 13C6, 15N4-arginine (Arg10) and 0.3 mg/ml 13C6 15N2-lysine (Lys8). The cultures were grown for six generations at 37 ºC to ensure the complete incorporation of the labelled amino acids. SILAC labelled E. coli cells were harvested by centrifugation at 5,000 g and the pellets were resuspended in buffer A containing 10 mM protease inhibitor. The cells were passed through a 4 ml French® pressure cell press at 14,000 psi three times for complete cell lysis. Lysates were centrifuged for 10 min at 7,000 g (Bechman JLA 25.5 rotor), then for 45 min at 200,000 g (Beckman TLA 110 rotor). The supernatants (soluble protein fractions) were divided into 100 µl aliquots with final concentration at 20-24 mg/ml and stored at -80 ºC. 15 2.2.8 Nickel affinity pulldown Affinity pulldown of the Nanodiscs was performed using Ni2+-NTA beads. The beads were washed with water and equilibrated with buffer A. About 20 µl of beads as a slush were mixed with 10 µg of Nanodisc or MSP in 500 µl of buffer A and gently rocked for 10 min at room temperature. The mixtures were gently centrifuged at 600 g (Eppendorf centrifuge 5415D) to pellet the beads. Then 1 mg of SILAC labelled soluble protein extract was incubated with the beads in 1 ml of buffer A. The mixture was rocked for 10 min then the samples of ‘light’ and ‘heavy’ were mixed together and washed three times each with 1ml of buffer A containing 50 mM imidazole. The proteins were eluted with 100 µl of buffer A containing 600 mM imidazole. Each eluted sample was analyzed by SDS-PAGE and silver stained and stored at -80 ºC for further analysis. 2.2.9 In solution proteolytic digestion The eluted proteins were mixed with 1 % w/v sodium deoxycholate and 50 mM ammonium bicarbonate and heated for 10 min at 99 ºC. All subsequent incubations were done at 37 ºC. To ensure complete digest, the samples were reduced with 0.5 µg dithiothreitol for 30 min and alkylated with 2.5 µg iodoacetamide for 20 min before 0.5 µg of trypsin was added and incubated for 18 to 20 hours. 2.2.10 Stage-tip (Stop-and-go-extraction-tips) purification To stop the digestion and remove sodium deoxycholate, the pH of the sample was brought down below 2.5 with 1 % trifluoric acid. The mixture was centrifuged for 10 min at 1,000 g (Eppendorf 5415R centrifuge). The supernatant was passed through a C18 column equilibrated with 20 µl methanol then buffer C (3 % v/v acetonitrile, 1 % v/v trifluoric acid, and 0.5 % v/v acetic acid). The column was washed once with buffer C. Peptides were eluted 16 and separated by liquid chromatography on an Agilent 1100 Series HPLC coupled on-line to a LTQ-Orbitrap (Thermo Fisher Scientific, Bremen, Germany) for tandem mass spectrometry analysis. 2.2.11 Analysis of mass spectrometry data The peptide lists generated from the tandem mass spectrometer were searched against a 2007 version of E. coli K12 protein sequence database using Mascot v2.3.01 (Matrix Science, www.matrixscience.com). In a mascot database search, the mass values obtained from the MS/MS analysis are compared with calculated peptide mass obtained by applying cleavage rules to the entries in a comprehensive primary sequence database. Using an appropriate scoring algorithm, the closest match or matches are identified. The search is set up with specific parameters. First, a database is chosen to compare the experimental mass values to the calculated peptide mass (2007 E. coli K12). Second, a cleavage rule is set up. In this case, trypsin was used for peptide digestion; hence, trypsin/proline cleavage with up to one missed cleavage was used, since the digestions are never perfect. Next, the appropriate modifications are specified. There are two types of modifications supported by Mascot, fixed and variable modifications. Fixed modification indicates the modification is applied universally to the residues specified. For example, the cystine carbamidomethyl fixed modification means a mass of 161 Da will be applied to all cystine residues during the calculation. Variable modifications are those may or may not be present. The Mascot program will calculate all the possible combination of the modification to find the best match. For example, the isotopically labelled amino acids are variable modifications that are not present in every peptide. Therefore Mascot will test for a match with the experimental data for that peptide with and without the label. Next, the peptide and MS/MS tolerances are 17 selected where the error windows are set on experimental peptide mass values and MS/MS fragment ion mass values respectively. Finally, the instrument is selected. In this case it was the ESI-TRAP. In this study, the parameters used for Mascot search are: carbamidomethylation (Cys) as fixed modification, oxidation (Met), acetyl (protein) and appropriate SILAC modifications as variable modification. Mass accuracy and ion mass accuracy were set to be 10 ppm and 0.8 Da respectively. Proteins with more than 2 peptides and scores above 25 are considered and quantified by the software MSQuant v1.4.0a17 for their ‘light’ to ‘heavy’ ratio. 2.3 Results 2.3.1 YidC purification The protein YidC was overproduced and purified as described in the methods, Section 2.2.4 and 2.2.5. The fractions collected following Ni-NTA chromatography were analyzed on SDS-PAGE (Fig. 2.2A). The predominant protein species was YidC. However, when analyzed on a blue-native gel, the proteins appeared smeary (data not shown). To exclude the possibility of aggregation, the protein was injected on to a size exclusion column which demonstrates that YidC elutes as a single protein peak (Fig 2.2B) Fractions were analyzed on blue-native-PAGE where YidC appeared as a single band (Fig 2.2C). The final yield is about 1.5 mg/L of culture. 18 Figure 2.2 YidC purification. A. SDS-PAGE analysis of starting material, flow through (FT) and elution fractions of nickel affinity purification of YidC. Purification as performed as in Section 2.2.5. The soluble protein fraction was loaded onto a Ni-NTA column equilibrated in buffer B. The column was washed in buffer B containing 30 mM imidazole and the protein was eluted in 600 mM imidazole. Ten 1 ml fractions were collected from the start of the elution. B. Size exclusion chromatogram of YidC. A Superose™ 6 HR10/100 column equilibrated with buffer B was used. Twelve 400 µl fractions were collected starting at around 4 ml. C. Clear-native-PAGE analysis of peak fractions collected from size exclusion chromatography. 19 2.3.2 Nanodisc reconstitutions Nanodiscs containing MalFGK and YidC were reconstituted without lipids but Nanodisc-SecYEG were prepared with different lipids, one with E. coli total lipid extract (Ec) and one with phosphatidylglycerol (PG). Nanodiscs were reconstituted as in Section 2.2.6. Different lipids were used in the reconstitution because SecYEG requires specific lipid environments for interaction with its partners. Although the reconstitution ratios were optimized to reduce the amount of free MSP and aggregates, it was necessary to purify the disc preparation by size exclusion chromatography as any aggregates or empty discs will interfere with the SILAC experiment. The corresponding native- and SDS-PAGE of the discs are shown in Fig. 2.3. Figure 2.3 Nanodisc reconstitutions Reconstitutions performed as in Section 2.2.6. A. Three Nanodiscs were purified using size exclusion chromatography and analyzed on 4-2 % Blue-native PAGE. B. Same samples analyzed on 12 % SDS-PAGE. The molecular weights of the protein markers are as indicated. 20 2.3.3 SILAC cultures Initially, the SILAC labelling was done with E. coli strain BL21 (DE3). However, it was found that only arginine was sufficiently labelled. Since trypsin digests polypeptide chains after arginine and lysine residues, problems were created during data analysis as peptides ending with lysine were not quantified. Small proteins which generate few peptides may not be quantified with confidence. Therefore a lysine auxotroph strain was needed. After obtaining the LysA strain from the E. coli Keio knockout collection (31), the labelling efficiency was tested again. The SILAC culture conditions were optimized for minimal usage of the labelled amino acids and maximal protein labelling. Ratios of 1/200, 1/500, and 1/1000 (v/v) of labelled amino acids to culture volume were tested. The ratio 1/500 was chosen, as it is the lowest ratio that still gave sufficient signal for MS detection (data not shown). 2.3.4 Nickel affinity pulldown with SILAC protein extract Syd was used as a control to test the efficiency of the pulldown experiments. Non- purified Myc-tagged Syd was mixed with soluble protein extract (1/50 v/v) to ensure Syd was a minor species in the mixture. Pulldowns were performed using Nd-SecYEG, empty Nansdisc reconstituted with Ec (Nd-Ec), and beads only as baits. The western blot of the eluted samples indicates that pulldown of Nd-SecYEG was able to isolate Syd out of a cytosolic protein extract (Fig. 2.4). Figure 2.4 Nanodisc pulldown with Syd Elutions of pulldowns using beads, Nd-Ec, Nd-SecYEG, and the starting material were analyzed by western blot with anti-Myc antibody to detect Syd. 21 During the SILAC pulldown, as described in Section 2.2.8, Nanodisc SecYEG, MalFGK and YidC were used as baits to capture specific prey from the SILAC ‘heavy’ labelled protein extract and MSP was used as control to capture the proteins in the ‘light’ extract. Two to three biological replicas of each pulldown were performed and analyzed. All trypsin digested peptides identified by LC MS/MS were quantified by MSQuant by ‘light’ to ‘heavy’ ratio. SILAC ratios for proteins were generated by taking an average of the peptide ratios corresponding to each protein. Refer to Section 2.2.9, 2.2.10. and 2.2.11 for detailed mass spectrometry procedures 2.3.5 The SecYEG interactome The SecYEG complex was chosen as a model membrane system to validate the technique. Nd-SecYEG with Ec lipids were used as baits in the pulldown. The first ten proteins identified are listed in Table 2.2. Out of a total of 48 proteins identified, 25 proteins had a ratio above one (Appendix B Table B.1 for full list of proteins). Syd was the protein with the highest SILAC ratio of ~27, considerably above the ratio of any other protein identified in this experiment. Since the interaction between Syd and SecYEG has been characterized (18) and Syd is small and not highly expressed in E. coli, the results suggest that the method is working and is highly sensitive. The other five proteins identified below Syd had ratios less than 5 and had no obvious connection to SecYEG. The known SecYEG interacting protein, the ATPase motor SecA, was identified with a SILAC ratio of 1.5 ranking 18 on the list (Table B.1). This was not surprising as previous studies showed that SecA and Syd exhibit competitive binding at a similar surface on SecY, where Syd was shown to out-compete SecA-bound SecYEG in Nanodiscs (18). 22 Since it has previously been shown that acidic phospholipids promote high affinity interactions with SecA and stimulate its ATPase activity (32-33), pulldowns using Nd- SecYEG reconstituted in the presence of PG lipids were repeated. A total of 97 proteins were identified. The first protein on the list was SecA with a ratio of 35, whereas Syd was found with a ratio of 4.7 at fourth position (Table 2.2). These results support previous observations that acidic phospholipids enhance the affinity of SecA towards SecYEG (18). Furthermore, these results indicate that the technique is able to identify specific known interactors of the SecYEG membrane complex and is sensitive enough to differentiate interactions based on lipid type. Table 2.2 Summary of the top ten proteins identified with Nd-SecYEG Name Description/function Ratioa SecYEG(Ec)b Syd SecY-interacting protein 27 FolE GTP cyclohydrolase I 4.2 GlyA serine hydroxymethyltransferase 3.9 HisB histidine biosynthesis bifunctional protein 3.4 PflB formate acetyltransferase 3.2 FucR L-fucose operon activator 2.8 YqjL uncharacterized protein 2.8 XerC chromosome segregation recombinase 2.7 Crp cAMP receptor protein 1.5 HinT purine nucleoside phosphoramidase 1.2 SecYEG(PG)c SecA preprotein translocase ATPase 35 XerC chromosome segregation recombinase 9.0 DnaJ chaperone/heat shock protein 6.3 Syd SecY-interacting protein 4.7 HinT purine nucleoside phosphoramidase 3.7 FliC flagellin 3.2 LpxA UDP N-Acetylglucosamine Acyltransferase 3.2 Fur ferric uptake regulator 3.0 Crp cAMP receptor protein 2.7 SpeG spermidine acetyltransferase 2.6 a Average of heavy to light ratios for each protein from one to three replicates. b Nanodisc SecYEG made in with E. coli total lipid extract (Ec). c Nanodisc SecYEG made with phosphatidylglycerol (PG). 23 Figure 2.5 Summary of SILAC ratios for proteins identified to interact with Nanodiscs SecYEG Nd-YEG is reconstituted in the presence of E. coli total lipids (Ec) or phosphatidylglycerol (PG), Positions of SecA and Syd are highlighted. Proteins limited to the top 30 for simplicity with complete lists provided in Appendix B Tables B.1 and B.2. 24 2.3.6 MalFGK interactome Ten mal genes, including MalE and MalFGK, are under the positive control of MalT and maltose (34). To examine the MalFGK interactome, SILAC cultures were grown in the presence of maltose and the pulldowns were performed with Nd-MalFGK. A glucose-grown SILAC protein extract was also used as a control. With the glucose-grown extract, 92 proteins were identified. MalE, a known periplasmic interactor of MalFGK, was at the top of list with a SILAC ratio of 4.4. Since the mal genes are turned off in the presence of glucose, little MalE is present in the protein extract. However, the interaction was still detected by mass spectrometry suggesting that the method is very sensitive. Using the maltose-grown SILAC extract, 102 proteins were identified. MalE was the first protein identified with a SILAC ratio of 26. In the presence of maltose, MalE is highly expressed; therefore, the interaction is more easily picked up by mass spectrometry. The fact that MalE was ranked first under both growth conditions regardless of the ratios, indicates that the interaction was not due to the overexpression of the protein. Moreover, the expression of other proteins in the mal gene such as MalQ and MalM was also turned on, but their ratios are not above one. Thus, the growth conditions are important for the identification of interactome for certain membrane proteins. Combined with the SecYEG results, the method can not only detect cytosolic but also periplasmic interactors. 25 Table 2.3 Summary of the top ten proteins identified with Nd-MalFGK Name Description/Function Ratioa MalFGK(glucose)b MalE periplasmic maltose binding protein 4.4 SeqA DNA replication regulation modulator of oriC 3.4 RpsB 30S ribosomal protein S2 2.4 YaeH function unknown, UPF0325 family protein 2.2 PbpG D-alanyl-D-alanine endopeptidase 2.1 Rob right origin-binding protein 1.8 Crp cAMP receptor protein 1.8 NusG transcription antitermination protein 1.5 RlmG 23S rRNA methyltransferase 1.5 XerD chromosome segregation recombinase 1.5 MalFGK(maltose)c MalE periplasmic maltose binding protein 26 YaeH function unknown, UPF0325 family protein 2.4 MinD septum site determination protein 1.6 RpmG 50S ribosomal protein L33 1.2 RpmA 50S ribosomal protein L27 1.1 RpsO 30S ribosomal protein S15 1.1 RpmB 50S ribosomal protein L28 1.0 RpmF 50S ribosomal protein L32 1.0 AmiA N-acetylmuramyl-L-alanine amidase 1.0 Hfq host-factor I protein 0.9 a Average of heave to light peptide ratios for each protein from two replicates. b SILAC cultures grown in the presence of glucose c SILAC cultures grown in the presence of maltose. 26 Figure 2.6 Summary of SILAC ratios for proteins identified to interact with Nanodisc MalFGK Nd-MalFGK pulldowns were performed with prey grown in two different carbon sources, maltose or glucose. Proteins limited to the top 15 identified are shown for simplicity. Complete lists of proteins identified are provided in Appendix B Tables B.3 and B.4. Scales for MalFGK glucose and maltose are identical. Positions of MalE are highlighted. 27 2.3.7 YidC interactome There were 64 proteins identified using Nd-YidC as bait. The top two were XerC and FucR with ratios 5.2 and 5.1 respectively (Table 2.4, Fig. 2.6 and Appendix B Table B.5). XerC belongs to the tyrosine family of site-specific recombinases and functions to convert dimers of E. coli chromosomes into monomers (35). FucR is a positive regulator protein of the L-fucose operon. There are no obvious connections between these two proteins to YidC and they have been identified in the experiments with SecYEG and MalFGK. Since both proteins interact with negatively charged DNA, it is possible that they interact non- specifically with negatively charged region of the protein. The putative interacting proteins following FucR are mostly involved in metabolic pathways. A recent study analyzed proteins that were cross-linked to YidC in vivo had identified 12 cytosolic proteins, the majority of which are ribosomal proteins, and a few of which are involved in metabolism whose relationship with YidC was not obvious (36) similar to the results of this experiment. Therefore, the results suggest that there were no specific high-affinity interacting partners identified with YidC under the growth conditions of the SILAC cultures. Table 2.4 Summary of the top ten proteins identified with Nd-YidC Name Description/Function Ratioa XerC chromosome segregation recombinase 5.2 FucR L-fucose operon activator 5.1 GrcA autonomous glycyl radical cofactor 3.9 PflB formate acetyltransferase 3.3 GlyA serine hydroxymethyltransferase 3.2 HinT purine nucleoside phosphoramidase 3.2 FolE GTP cyclohydrolase I 3.0 HisB histidine biosynthesis bifunctional protein 2.7 Rob right origin-binding protein 1.9 PyrI aspartate carbamoyltransferase 1.8 aAverage of heavy to light peptide ratios for each protein from three replicates. 28 Figure 2.7 Summary of SILAC ratios for proteins identified to interact with Nanodisc YidC Nd-YidC is used in the pulldown with SILAC extracts. Top 30 proteins identified are shown for simplicity; a complete list is provided in Appendix B Table B.5. 2.3.8 Summary Syd and SecA were identified as specific interactors for Nd-YEG. Using Nd- MalFGK, MalE was identified. These results indicate that the method, combining Nanodisc and SILAC, is successful in identifying membrane protein interactomes. This method is also sensitive enough to detect different interactors with different lipid environment and growth conditions. No specific interactor was detected for Nd-YidC, which agrees with previous findings (36). The success in the method development allowed the further exploration of the membrane interactome in S. cerevisiae. 29 Chapter  3: Identification of the peripherally-bound membrane proteins in Saccharomyces cerevisiae 3.1 Introduction 3.1.1 Membrane phospholipids in S. cerevisiae Unlike bacteria, yeast cells consist of many specialized cellular compartments which are enclosed by membranes. The plasma membrane separates the cell component from the external media. The mitochondrial membranes serve to produce energy. The endoplasmic reticulum (ER) and Golgi apparatus are involved in protein and lipid synthesis and sorting. The nuclear membrane encloses and protects the DNA. The vacuolar and peroxisomal membranes compartmentalize special metabolic and digestive functions (37). With different functions, the membrane compositions of each compartments are different as well. A study done in 1991 using 2D thin layer chromatography provided detailed characterization of the phospholipid composition in each subcellular compartment in yeast (38). As seen in Table 3.1, phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinosotol (PI), and phosphatidylserine (PS) are the major phospholipids found in yeast, while cardiolipin (CL) and phosphatidic acid (PA) are present in smaller amounts. Table 3.1 Phospholipid composition of S. cerevisiae Subcellular compartment % compositiona PC PE PI PS CL PA Others Plasma membrane 16.8 20.3 17.7 33.6 0.2 3.9 6.9 Secretory vesicles 35 22.3 19.1 12.9 0.7 1.2 8.8 Vacuoles 46.5 19.4 18.3 4.4 1.6 2.1 7.7 Nucleus 44.6 26.9 15.1 5.9 <1.0 2.2 4.3 Peroxisomes 48.2 22.9 15.8 4.5 7.0 1.6 ER/Golgi 51.3 33.4 7.5 6.6 0.4 0.2 0.5 Mitochondria 40.2 26.5 14.6 3.0 13.3 2.4 a Data obtained from Zinser et al. 1991 (38). 30 3.1.2 Lipid interacting proteins in yeast The tight regulation of lipid composition in each subcellular compartment suggests that lipids play important role in the function of membrane associated proteins. Many important signaling and trafficking cascades originate at the membrane and are carried out by proteins that can dissociate from the membrane. These class of proteins are known as peripheral membrane proteins. They are amphitropic, often found in the soluble fractions and contain a hydrophobic motif that can associate with the membrane. Several different mechanisms are employed for membrane association by this class of proteins. They may contain exposed hydrophobic surfaces, covalently bound lipid anchors, and/or charged residues which interact with the oppositely charged lipid headgroups (Fig. 3.1). For example, Rab proteins are post-translationally modified with two geranylgeranyl lipid anchors for membrane association where they function as GTPases to regulate membrane trafficking (39). Oxysterol binding proteins, which regulate lipid metabolism and vesicular transport, contain lipid binding domains such as pleckstrin homology (PH) domains for membrane association (40). In addition, lipid specificity is also important to the function of peripheral membrane proteins. Protein kinase C requires PS as cofactor for activation to function in various signal transduction pathways (41). Phosphoinositides (PIPs) recruit various proteins to the membrane through conserved motifs (42) which perform diverse functions, such as lipid signaling, membrane trafficking, and cell signaling. The importance of PIPs are reviewed in Strahl and Thorner, 2008 (43). 31 Figure 3.1 Different types of interaction between peripheral membrane proteins and the membrane Exposed hydrophobic surfaces such as alpha-helices or loops, lipid modifications and charged residues are the main mechanism used by peripheral membrane protein to reversibly attach to the cell membrane. 32 3.1.3 Phosphatidic acid Phosphatidic acid (PA) is one of the most important glycerophospholipids found in biomembranes. In eukaryotic cells, PA is not only a precursor for the synthesis of many glycerophospholipids and triglycerides, but also a major signaling lipid. For example, in S. cerevisiae, PA generated from the turnover of PC via the phospholipase D-mediated pathway serves to suppress growth (44) and mediate vesicle fusion during sporulation (45). PA is also found to be a pH biosensor which regulates the activity of Opi1, a phospholipid synthesis regulatory protein (46). Compared to known lipid binding domains (such as PH, PX, C2 domains), PA binding domains are diverse and share no apparent sequence homology (47). However, one common characteristic for PA binding proteins is that they all contain a stretch of basic amino acids which are essential for PA interaction (48). The phosphomonoester headgroup of PA has two pKa’s (pKa1 3.2 and pKa2 7.02) with the second one in the physiological pH range. The negatively charged headgroup allows the formation of electrostatic interactions with basic regions of proteins. By changing the pH at around 7, the charge on the headgroup will be affected and thus alters the electrostatic interaction with proteins. In addition, unique hydrogen bonding contributes to interactions between PA and proteins. The combination of electrostatic interactions and hydrogen bond formation creates an electrostatic/hydrogen bond switch model which allows for PA-specific interactions (49). In this switch model, PA forms an intramolecular hydrogen-bond between the deprotonated and protonated hydroxyl of its phosphomonoester headgroup. This intramolecular hydrogen bond stabilizes the second proton of the phosphomonoester. In the presence of a primary amine group (such as the headgroup of PE or the side chains of arginine and lysine), the positively charged amine interacts with the negatively charged phosphate on PA which 33 brings the two headgroups in close proximity to allow hydrogen bond formation. The intermolecular hydrogen bond destabilizes the intramolecular hydrogen bond and thus lowers the pKa2 and increases the negative charge. A simple schematic of this process is shown in Figure 3.2. The challenge for identifying PA binding proteins is that there is no predicted specific sequence motif. Therefore potential PA binding proteins could not be predicted based on sequence alone. Using the method developed in Chapter 2, this Chapter will examine the peripherally-bound membrane proteins in S. cerevisiae. Figure 3.2 Simple representation of the electrostatic/hydrogen bond switch model. Modified based on Kooijman et al., 2007 (49). 34 3.2 Materials and methods 3.2.1 Materials Isopropyl β-D-1-thiogalactopyranoside (IPTG) was obtained from BioShop® (Burlington, ON). Yeast nitrogen base was purchased from Becton, Dickinson and Company (Sparks, MD). Complete supplement mixture minus arginine and lysine was obtained from Sunrise Science Products, Inc. (San Diego, CA). All yeast strains and plasmids used in this section were kindly given by Dr. Christopher Loewen. Ebselen was obtained from Sigma. Table 3.2 Yeast strains used in this study Name Mating Type Genotype BY4741 MATa his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 ygl007wΔ MATa BY4741, ygl007w::kanMX4 BY4742 MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 arg4Δ MATα BY4742, arg4::kanMX4 Y7043 MATα his3Δ1 leu2Δ0 met15Δ0 ura3 Δ0 can1::STE2pr-LEU2 lyp1 cyh2 Table 3.3 Plasmids used in this study Name Discription pKT128 Used for C-terminally GFP-tagging CAJ1 pHPG Used for N-terminal GFP-tagging CAJ1 Gal-dgk1 Used for overexpression of Dgk1 Gal-pah1 Used for overexpression of Pah1 3.2.2 Empty Nanodisc reconstitution Empty Nanodiscs, containing only lipids, were made as in section 2.3.6 by varying the MSP to lipid ratio for each phospholipid. For Nanodisc phosphatidylcholine (Nd-PC) and Nanodisc total E. coli lipid extract (Nd-Ec), the molar ratio of MSP to lipid was 1:30. For Nanodisc phosphatidylethanolamine (Nd-PE), the ratio was 1:20. The cone shape of phosphatidic acid causes PA to adopt a non-bilayer structure in solution. Thus a 100% PA 35 Nanodisc could not the reconstituted. However, up to fifty percent of PA could be inserted into a PC or PE Nanodisc. 3.2.3 Yeast growth conditions (SILAC) A lysine and arginine auxotrophic strain, BY4742 Δarg4, was used. The cells were first grown for 7 hours in YPD media at 25 ºC, washed three times with sterile water and diluted to a final O.D.600 of 0.007 in yeast nitrogen base minimal medium. The medium contained 0.69 mg/ml complete supplement mixture minus arginine and lysine and 36 µg/ml and 30 µg/ml of normal or labelled arginine and lysine respectively. The cultures were grown for 14 hours at 25 ºC. The cultures were harvested by centrifugation and lysed by glass beads (1.5 ml of beads per 1 ml of culture) in the presence of 10 mM protease inhibitor. The mixture was vortexed vigorously for 3 min at 4 ºC. The beads were separated from the broken cells by centrifugation. The soluble protein extracts were collected by ultracentrifugation the same way as described in section 2.3.7. 3.2.4 Caj1 cloning Caj1 was cloned into pET23a vector for expression in E. coli. Two constructs were generated i) a C-terminal His6 tagged Caj1, ii) a non-tagged Caj1. Primers are listed in Appendix A. For constructing the His6 tagged Caj1, the amplified PCR product was purified using EconoSpin™ DNA column. The purified PCR product and pET23a vector were subjected to restriction enzyme digestion with NdeI and XhoI for 2 hours at 37 ºC. The digested products were analyzed on a 0.6 % agarose gel and the desired products were excised from the gel and re-isolated using a DNA spin column. The digested PCR product and vector (pET23a) were ligated using T4 DNA Ligase at a vector to insert ratio of 1:3-5. The vector concentration is 36 always kept at around 100 ng. The ligation was completed overnight at room temperature then was transformed into competent E. coli strain DH5α. Cells were plated onto LB agar plates containing 80 µg/ml ampicillin, incubated overnight at 37 ºC. Plasma DNA was isolated by miniprep then verified by sequencing. Site-directed mutagenesis of a single nucleotide were employed to generate the non- tagged Caj1. The last codon (GAG) which encodes a glutamic acid residue was changed into a stop codon (TAG) just before the His6 tag. This change also disrupts a XhoI restriction enzyme site which allows for easy screening of the product. For a detailed procedure refer to section 2.2.2.2. 3.2.5 Caj1 expression Plasmid pET23a Caj1-His6 and pET23a Caj1 were transformed to E. coli strain C41 (DE3) for protein expression. The cells were grown overnight at 37 ºC in 20 ml of LB media with 80 µg/L of ampicillin. Next day, the culture was diluted into 2 L of fresh LB media with ampicillin. Cells were induced at O.D.600 of 0.4 with 0.2 mM IPTG. After three hours of induction, cells were harvested and disrupted as described in section 2.2.3. Caj1 is a soluble protein therefore the supernatant from the high spin was kept for purification. 3.2.6 Caj1 purification3.2.6.1 Caj1-His6 purification The soluble protein fraction containing Caj1-His6 was injected into a 5 ml column containing Ni2+-NTA high performance beads, equilibrated with buffer A. The column was washed in buffer A with 10 mM imidazole followed by elution using 600 mM imidazole. The flow through, wash and eluate were analyzed by SDS-PAGE. Caj1 eluted at around 300 mM imidazole. The eluted fractions containing pure Caj1 were pooled and further purified using 37 size exclusion chromatography. The eluted proteins were injected onto a Superdex™ 200 HR10/300 column equilibrated with buffer A at a flow rate of 0.5 ml/min. The elution profile was monitored at 280 nm. Fractions were collected and analyzed by clear-native-PAGE. The soluble Caj1 fractions were pooled and concentrated and stored at -80 ºC.3.2.6.2 Non-tagged Caj1 purification A total soluble protein fraction containing Caj1 was injected onto a prepacked 1ml HiTrap™ SP FF (GE Healthcare) equilibrated with buffer D (50 mM Tris pH 6.8, 50 mM sodium chloride, and 10 % v/v glycerol) at a flow rate of 1 ml/min. A linear gradient from 50 to 500 mM sodium chloride was applied and Caj1 eluted at around 200 mM salt. The factions were analyzed on a SDS-PAGE and the ones that contain Caj1 were pooled and further purified by size exclusion chromatography. A Superdex™ 200 HR 10/300 column equilibrated with buffer A was used at a flow rate of 0.3 ml/min. Fractions were analyzed on a clear-native-PAGE and the soluble Caj1 fractions were pooled and concentrate as described above. 3.2.7 Nickel affinity pulldown Nickel affinity pulldown similar to Section 2.2.8 was performed with few variations. To verify Caj1 binding to PA, empty Nanodiscs PE, EC, PEPG [50:50], and PEPA [50:50] were used. Purified non-tagged Caj1 (10 µg) was added to a final volume of 0.5 ml. The samples were washed three times with 1 ml of buffer A containing 50 mM imidazole and eluted in 50 µl of 600 mM imidazole. To test the effect of pH in the Caj1-PA interaction, Nanodiscs PCPEPA [40:35:25] and PCmPA [50:50] were used. All lipid ratios were calculated in moles. To vary the pH, buffer E (25 mM HEPES pH 6.8 to 8, 100 mM sodium chloride, and 5 % glycerol) was used. Samples were washed three times with 1 ml of buffer 38 E containing 50 mM imidazole and eluted in 50 µl of 600 mM imidazole. Eluted samples were analyzed on 12 % SDS-PAGE. 3.2.8 Liposome preparation Phospholipids were dissolved in chloroform and mixed together in the desired ratios. The lipid mixtures were then dried under a stream of nitrogen and overnight in a vacuum. Next day, the lipids were resuspended in buffer A using a freeze-thaw method (flash frozen in liquid nitrogen, then rapidly thawed at 37 ºC and vortexed). The steps were repeated five times to ensure uniformed size liposomes. Liposomes used in this study include: PC (100), PCPE (50:50), PCPEPA (90-50:0-40:10), PCPEmPA (50:40:10). All lipid ratios were calculated by moles. 3.2.9 Liposome sedimentation assay In 150 µl buffer A, 150 nmol of liposomes and 11.5 µg of Caj1-His6 were suspended. The mixture was incubated for 20 min on ice followed by ultracentrifugation at 174,000 g (Beckman TLA 100.2 rotor) for 30 min at 4 ºC. The supernatant and pellet were analyzed by SDS-PAGE. The affect of pH on the binding of Caj1 to PCPEPA liposomes were tested using buffer E. 3.2.10 N- and C- terminal GFP-tagged Caj1 A HIS3-GFP cassette was integrated into either 1 kb up or down stream of the Caj1 open reading frame through homologous recombination. Primers are listed in Appendix A. A basic schematic of the strategy for creating GFP tagged Caj1 is show in Figure 3.3. 39 Figure 3.3 Strategy for GFP-tagged Caj1 construction. Left, PCR product containing the GFP tag and His3 selective marker are transformed into the C-terminus of Caj1 open reading frame through homologous recombination to yield a C-terminal GFP tagged Caj1. Right, PCR product containing the promoter, GFP tag and His3 selective marker are inserted into the N-terminus of Caj1 open reading frame through homologous recombination to generate a N-terminal GFP tagged Caj1. 40 3.2.10.1 Yeast transformation Transformations were done following closely to a previously published protocol (50). Briefly, strain Y7043 was cultured in 2 mL YPD media overnight at 30 ºC. The cells were diluted to an O.D.600 of 0.2 in 20 ml fresh YPD media and allowed to grow to O.D.600 ~1. Cells were collected by centrifugation at 3,000 g (Beckman JA25.5 rotor) for 5 min. The pellet was washed once with 5 ml of sterile water then 100 mM lithium acetate (LiAc). Cells were resuspended in 200 µL of 100 mM LiAc and 50 µL were transferred into a new microfuge tube and spun down. A transformation mix containing 240 µL PEG (50 % w/v), 36 µL 1 M LiAc, 25 µL single-stranded carrier DNA (2 mg/ml) and 50 µL of concentrated PCR product (2-10 µg) was added and vigorously vortexed for 1 min. The mixtures were incubated for 30 min at 30 ºC and heat-shocked at 42 ºC for 20 min. The samples were centrifuged for 15 sec and the transformation mix was removed. The cells were resuspended in sterile water and plated on selective plates without histidine.3.2.10.2 Gene crossing To test the effect of pH on Caj1 localization, MATα Y7043 N’GFP-Caj1 strain was crossed with MATa BY4741 ygl007wΔ to generate the N’GFP-Caj1 in a pma1-007 mutant background. The diploids were selected with markers of -His and kanMX. The resulting diploids were transferred to sporulation media and incubated at 25 ºC for 5 days. The sporulating cells were treated with 50 µg of zymolase for 10 min at 30 ºC to break down the cell wall. About 25 µl of digested spores were spread on YPD plates for tetrad dissection. 3.2.11 Confocal fluorescence microscopy To examine Caj1 localization, cells containing GPF-tagged Caj1 were grown to early log phase (O.D.600 ~ 0.5) at 30 ºC in synthetic minimal media without histidine. Cells 41 containing the pma1-007 mutation were grown in different pH medium (3 to 6) to test for the effect of pH on Caj1 localization. To further decrease the pH, pma1-007 mutant cells were treated with 0.1 mM ebselen for 10 min prior to imaging. To test the affect of overexpression of Dgk1 and Pah1 on the localization of Caj1, yeast cells containing either Dgk1 or Pah1 plasmid were grown in the presence of 2 % galactose to induce expression of these proteins. For microscopy analysis, 1 µL of cells was mixed with 1 µl of media on a glass plate with a cover slid on top. The cells were viewed on a Pascal Laser Scanning Confocal Microscope (Zeiss) with excitation at 488 nm and emission at 500-530 nm. All images were taken with identical microscope setting to enable direct comparison between images and samples. 3.3 Results 3.3.1 Nickel affinity pulldown For the identification of the PA lipid interactome, three kinds of empty Nanodisc were used. Nd-Ec, Nd-PE, and Nd-PEPA [50:50] were used as baits in the pulldown experiments to capture specific preys from the ‘heavy’ labelled protein extract. MSP was used as a control. Pulldowns were performed as in Section 2.2.8. The pulldown samples were first analyzed by silver staining prior to digestion and mass spectrometry. 3.3.2 Lipid binding proteins identified To identify the membrane interactome in yeast, pulldown samples of Nd-Ec, Nd-PE and Nd-PEPA [50:50] were analyzed by mass spectrometry. Various known lipid interacting proteins were identified including, Ypt1, Vps21, Sec4, Faa1 and Osh6 (Table 3.4, Fig. 3.4, and Appendix C). The three Ras family GTPases (Ypt1, Vps21 and Sec4) attach to the membrane via a double prenylation anchor (39). A fraction of the lipid-modified GTPase 42 exists in the cytosol in complex with Rab GDP dissociation inhibitors (GDIs). GDIs serve to deliver these GTPases to their specific membrane bound compartments and aid in the lipid insertion (51). It is possible that this soluble fraction of GTPase was present in the soluble yeast protein extracts and inserted into the Nanodisc through their lipid anchor. Faa1 is a long chain fatty acyl-CoA synthetase. A previous study had identified Faa1 as one of the proteins found in major lipid particles by mass spectrometry (52). These particles function to store nonpolar lipids with structures similar to lipoproteins in mammals (53). As a protein heavily involved in lipid metabolism, it is logical that Faa1 was found to associate with lipid storage particles and as a general lipid binding protein. Osh6, an oxysterol-binding protein (OSBP), interacts with phosphoinositides (PIPs) and PA via its N-terminal conserved OSBP-related domain (54). Osh6 was solely identified with Nd-Ec and could be related to the composition of Ec which is 75% PE, 15% PG and 10 % cardiolipin. The mixture of acidic and neutral lipids could provide a unique environment for Osh6 to interact. Caj1 was identified using Nd-PEPA with a SILAC ratio of ~16. Caj1 is a type II DnaJ heat shock protein belonging to the E. coli DnaJ family (55). Since it is an Hsp40 it should interact with an Hsp70 partner and stimulate its ATPase activity. Even though the total protein has a slightly acidic pI of 5.79, there are two regions from residues 230 to 270 and residues 317 to 370 that have a pI of 10.52 and 9.84 respectively (Fig. 3.5). It is possible that Caj1 interacts with PA through one of these basic regions. As shown below, the interaction of Caj1 to PA is verified in vitro. 43 Table 3.4 Top ten non-ribosomal proteins identified with empty Nanodisc Namea Description Ratiob Nd-Ec OSH6 Member of an oxysterol-binding protein family 11.5 YPT1 Ras-like small GTPase, involved in the ER-to-Golgi step of the secretory pathway 10.3 FAA1 Long chain fatty acyl-CoA synthetase with a preference for C12:0- C16:0 fatty acids 9.8 VPS21 GTPase required for transport during endocytosis and for correct sorting of vacuolar hydrolases 3.4 CDC19 Pyruvate kinase 1.8 DED1 ATP-dependent DEAD (Asp-Glu-Ala-Asp)-box RNA helicase 1.8 PDC1 Major of three pyruvate decarboxylase isozymes 1.7 SAH1 S-adenosyl-L-homocysteine hydrolase 1.6 TDH2 Glyceraldehyde-3-phosphate dehydrogenase 1.6 ADH1 Alcohol dehydrogenase 1.4 Nd-PE YPT1 Ras-like small GTPase, involved in the ER-to-Golgi step of the secretory pathway 16.8 VPS21 GTPase required for transport during endocytosis and for correct sorting of vacuolar hydrolases 10.1 SEC4 Secretory vesicle-associated Rab GTPase essential for exocytosis 8.0 TIF1 Translation initiation factor eIF4A 2.5 ENO2 Enolase II 2.3 FAA1 Long chain fatty acyl-CoA synthetase with a preference for C12:0- C16:0 fatty acids 2.2 PGK1 3-phosphoglycerate kinase 2.1 HSC82 Cytoplasmic chaperone of the Hsp90 family 1.8 IMD3 Inosine monophosphate dehydrogenase 1.6 ACT1 Actin, structural protein involved in cell polarization 1.5 Nd-PEPA CAJ1 Nuclear type II J heat shock protein of the E. coli dnaJ family 16.3 FAA1 Long chain fatty acyl-CoA synthetase with a preference for C12:0- C16:0 fatty acids 6.6 YPT1 Ras-like small GTPase, involved in the ER-to-Golgi step of the secretory pathway 5.9 VPS21 GTPase required for transport during endocytosis and for correct sorting of vacuolar hydrolases 4.9 YFL002W-A Retrotransposon TYA Gag and TYB Pol genes 2.9 LSP1 Primary component of eisosomes 1.8 MHP1 Microtubule-associated protein involved in assembly and stabilization of microtubules 1.8 TDH2 Glyceraldehyde-3-phosphate dehydrogenase, isozyme 2, involved in glycolysis and gluconeogenesis 1.8 HRK1 Protein kinase implicated in activation of the plasma membrane H(+)-ATPase Pma1p in response to glucose metabolism 1.5 YDL025C Putative protein kinase, potentially phosphorylated by Cdc28p 1.5 a Ribosomal proteins are removed from this list. For complete lists of proteins refer to Appendix C. bRatios are an average of three biological replicates. 44 Figure 3.4 Summary of SILAC ratios for proteins identified to interact with Nanodisc Ec, PE and PEPA. Proteins 1 to 50 are shown for simplicity reason (Refer to Appendix C for complete lists). Gray bars represents ribosomal proteins. Known lipid interactors and Caj1 are highlighted. 45 Figure 3.5 The acidic and basic map of the Caj1 protein Caj1 contains 391 amino acid residues. The first 80 residues correspond to the J-domain. The theoretical pI of the whole protein is 5.79. The acidic regions are shown in the top part (A) and the basic in the bottom part (B). Black bars represent the acidic or basic residues. Residues 230 to 270 and 317 to 370 (red areas) have a calculated pI of 10.52 and 9.84 respectively. Map is generated from N-terminus to C-terminus, left to right, using DNAStrider program. 46 3.3.3 Purification of Caj1 Caj1-His6 was purified as described in the methods Section 3.2.6.1. Most of the Caj1- His6 was eluted in the first three fractions of the Ni2+-NAT chromatography. Caj1-His6 migrated at around 47kDa with two additional bands at around 34 kDa and 15 kDa (Fig. 3.6A). The bands were identified by mass spectrometry to contain peptides derived from Caj1 as well. Therefore these two bands represent cleaved products of Caj1. The Caj1-His6 was further purified by size exclusion chromatography. Fractions were analyzed on a clear- native PAGE where Caj1 runs as a single band. Peak fractions were pooled, concentrated, and stored at -80 ºC. Non-tagged Caj1 was created through site-directed mutagenesis of the Caj-His6 and expressed in C43 as described in Section 3.2.4 and 3.2.5. Since the theoretical pI of Caj1 is slightly acidic, 5.97, initial purification was performed with an anion exchange column. However, there was no purification of Caj1 (data not shown). The basic patches on the protein could have resulted in Caj1 behaving as a basic protein. Thus, Caj1 is purified with a strong cation exchange column. The protein was eluted using a gradient of high salt (Fig. 3.6B) and fractions analyzed by SDS-PAGE (Fig. 3.6C). On SDS-PAGE, the non-tagged Caj1 behaves similar to the His6-tagged Caj1. The protein was purified by size exclusion columatography (Fig. 3.6D). The elution profile of Caj1 is one single peak which suggests that the clipped products seen on SDS-PAGE behave as a full length protein in solution. The fractions were analysed by clear-native PAGE (Fig. 3.6E). The clear-native PAGE profiles were the same for tagged and non-tagged Caj1 indicats that the tag does not interfere with the folding of the protein. Caj1 was a single band on native-PAGE further suggests that the clipped products forms a complex and behave as the full length protein in solution. 47 Figure 3.6 Purifiaction of His6-tagged and non-tagged Caj1A. SDS-PAGE analysis of flow through (FT), wash (W), and elution fractions of Ni-NTA column purification, The soluble protein was loaded onto a Ni2+ resin column equilibrated in buffer A. The column was washed in buffer A with 10 mM imidazole and the protein was eluted in 600 mM imidazole (as in section 3.2.6.1). Twelve 1 ml fractions were collected from the start of the elution. B. Ion exchange chromatogram of non-tagged Caj1. Soluble fraction containing Caj1 was injected onto a strong cation column equilibrated with buffer D. A linear gradient from 50 to 500 mM sodium chloride was applied for elution of Caj1(as in section 3.2.6.2). Fractions (1 ml) were collected after the gradient started. C. SDS-PAGE analysis of the ion exchange fractions. D. Size exclusion chromatogram of Caj1. A Superdex™ 200 HR10/300 column equilibrated with buffer A was used. Fractions (400 µl) were collected starting at around 11 ml. E. Clear-native PAGE analysis of peak fractions collected from size exclusion chromatography. 48 3.3.4 Verification of Caj1-PA interaction using Nanodiscs and liposomes To verify the interaction of Caj1 with PA, a nickel affinity pulldown experiment was performed with purified non-tagged Caj1. Caj1 was incubated with Nanodisc-PE, EC, PEPG (50:50) and PEPA (50:50). The elutions were analyzed on SDS-PAGE. Caj1 was seen with Nanodisc containing PA but not with any other tested phospholipids (Fig. 3.7A). The interaction was further examined using liposomes, as described in Section 3.2.9. It is possible that the presence of PE can increase the positive charge on PA (49) which enhances the binding of PA interacting proteins. To test this, liposomes containing different amount of PE were used in the sedimentation assay. The pellets were analyzed on SDS-PAGE (Fig. 3.7B). The results show that the presence of PE in the liposome facilitates the binding of Caj1. The control liposomes (100% PC and PCPE [60:40]) showed no binding of Caj1. Another way to show the interaction between Caj1 and PA was through clear-native- PAGE analysis. Since there were no detergents in the gel or the running buffer, the protein complexes were not disrupted and could be observed as higher molecular weight species. Caj1 and Nd-PEPA or Nd-PE were mixed together and analyzed on clear-native PAGE (Fig. 3.7C). When Caj1 were mixed together with Nd-PEPA, a higher molecular weight product band was formed indicating complex formation. In contrast, Caj1 does not form a stable complex with Nd-PE. These results indicate that interaction between Caj1 and PA is PE dependent in vitro. 49 Figure 3.7 Binding of Caj1 to acidic phospholipids with Nanodsics and liposomes. A. Affinity pull-down of Caj1 with Nanodisc. Nanodiscs-PE, Ec, PEPG, and PEPA were immobilized onto Ni2+ beads equilibrated in buffer A. Non-tagged Caj1 was added to the mixture(as in Section 3.2.7). Elutions were analysed on 12 % SDS-PAGE. B. Liposome sedimentation assay. Liposomes made with different percentages of PE were tested for Caj1 binding. 150 nmol of liposomes were incubated with 11.5 µg of Caj1-His6 in buffer A. Mixture were ultracentrifuged (refer to Section 3.2.9). Pellets were analysed on 12 % SDS- PAGE. C. 4 % to 12 % clear-native PAGE analysis of Caj1-PA interaction using Nanodisc. Indicated amount of Caj1 was incubated with 1.5 µg of Nanodisc containing either PEPA [50:50] or PE in buffer A then separated on clear-native-PAGE. 50 3.3.4.1 Effect of pH on the binding of Caj1 to PA As mentioned in Section 3.1.3, the phosphomonoester head group of PA has a second pKa at physiological pH. Varying the pH slightly would affect the charge on the PA head group and potentially affect the electrostatic interactions between PA and its interacting partners. Other studies have shown that PA binding protein, Opi1, binds to PA in a pH- dependent manner (46, 56). To test the effect of pH on Caj1-PA interaction, liposome sedimentation and Nanodisc nickel affinity pulldown assays were performed with Caj1 at different pH as in Sections 3.2.7 and 3.2.9. The results showed that the binding of Caj1 to PA in Nanodisc and liposomes increased as the pH increased from 6.4 to 8 (Fig. 3.8B, C). To ensure the changes in pH were not affecting Caj1, the lipid methyl-PA was used as a control. The head group of methyl-PA contains a methyl group which eliminates the second pKa (Fig. 3.8A). With methyl-PA reconstituted into Nanodisc and liposomes, the overall binding of Caj1 was weaker and pH-independent (Fig. 3.8B, C). Together, these results indicate that the affinity between Caj1 and PA is affected by pH. 51 Figure 3.8 pH-dependent binding of Caj1 to PA in Nanodiscs and liposomes A. Structure of PA and methyl-PA. B. The liposome sedimentation assay was performed as in Section 3.2.9. Two different liposomes were tested: PCPEPA [50:40:10] versus PCPEmPA [50:40:10]. Liposome pellets were analyzed on 12 % SDS-PAGE. C. Nanodisc pulldown assay (Section 3.2.7). Two kinds of Nanodiscs were tested: PCPEPA [40:35:25] and PCmPA [50:50]. Elutions were analyzed on 12 % SDS-PAGE. 52 3.3.5 Measure of the Caj1-PA interaction in intact cells To assess the Caj1-PA interaction in vivo, GFP-tagged Caj1 was constructed. Both N- and C- terminal GFP-tagged Caj1 were created using homologous recombination. Using confocal microscopy, C’GFP-tagged Caj1 was localized to the cytosol and the N’GFP-tagged Caj1 was localized to the bud plasma membrane as well as to the cytosol (Fig. 3.9). The difference in localization obtained with the two constructs could be due to the bulky GFP tag on the C-terminal blocking the binding interface on Caj1. Figure 3.9 Localization of C- and N- terminal GFP-tagged Caj1 in yeast cells N- and C- terminal GFP-tag were inserted into Caj1 via homologous recombination as in section 2.3.10. Cells were grown to log phase and fluorescence microscopy was performed as in section 3.2.11. The microscope settings are the same for all conditions. Scale bar represents 1 µm. Arrows highlight the membrane localization. 53 To test whether the membrane localization of Caj1 to the cell bud was pH-dependent, the pH inside the cell was varied around the physiologic pH. The second pKa of the phosphomonoester head group of PA is around pH 7. If the localization is pH dependent then it is likely to be PA dependent as well. N’GFP-Caj1 was crossed with a S. cerevisiae strain containing the pma1-007 mutation to generate N’GFP-Caj1-pma1-007. The pma1 gene encodes an essential plasma membrane H+-ATPase that regulates the intracellular cytosolic pH, pHi (57). The pma1-007 mutation disrupts half of the ATPase activity, allowing the pHi to be modified. The cells were cultured at different pH (3, 4, 5, and 6) and examined under the microscope. From pH 3 to 6, the intracellular pHi was determined to be from 6.8 to 7 (46). There were no obvious differences in the localization of N’GFP-Caj1 under these pH conditions (Fig. 3.10). It could be that the pHi was not low enough to delocalize Caj1 from the plasma membrane. To lower the pHi further, cells were treated with ebselen, a drug that inhibits Pma1 in vitro (58). The cells were incubated with 100 µM of ebselen for 10 min and observed under the microscope. According to Young et al., 2011 (46), the pHi dropped to around 6.1 in these conditions. In that case, Caj1 was found localized exclusively to the cytosol (Fig. 3.10). 54 Figure 3.10 Effect of pH on Caj1 localization N’GFP-Caj1-pma1-007 cells were grown in different pH media and visualized using confocal microscopy (as in section 3.2.11). Localization of N-GFP-Caj1-pma-007 at pH 6,5,4,and 3 and 10 min after ebselen treatment. Same microscope settings for all conditions tested. The scale bar represents 1 µm. Arrows highlight the membrane localization. 55 As another way to test the PA-dependence of Caj1 membrane localization, the expression of enzymes in the PA production pathway were modified. Dgk1 and Pah1 are two enzymes that are important for regulating PA levels in the cell. Dgk1 is a diacylglycerol kinase that catalyzes the formation of PA from diacylglycerol (59) and Pah1 catalyzes the dephosphorylation of PA into diacylglycerol (60). Plasmids overexpressing these two enzymes were transformed into yeast cells containing N’GFP-Caj1-pma1-007. The experiments were done with the pma1-007 background because the localization of Caj1 to the plasma membrane was more obvious than the wildtype. Therefore, any change would be easier to detect. The plasmid-encoded enzymes were under the gal promoter hence induced by galactose. If the membrane localization of Caj1 was dependent on PA, then overexpression of Dgk1 would result in an increase in membrane localization whereas the overexpression of Pah1 would cause a decrease. The results shows that when Dgk1 is overexpressed, the expression of N’-GFP-Caj1 was also high but the localization to the bud plasma membrane was still present (Fig. 3.11 left). Overall, no changes in the localization of N’-GFP-Caj1 were observed upon overexpression of Dgk1 or Pah1. Together, the in vivo localization data suggest that it is possible the localization of Caj1 to the bud plasma membrane may be due to interactions with other acidic phospholipids. 56 Figure 3.11 Overexpression of Dgk1 and Pah1 and effect on the localization of Caj1 N’GFP-Caj1-pma1-007 yeast strain containing Dgk1 or Pah1 was grown in the presence of dextrose or galactose to log phase and confocal microscopy was performed as in section 3.2.11. Same microscope setting for all conditions tested. Scale bar represent 1 µm. Arrows highlight the membrane localization. 57 The localization experiments above confirmed the membrane association of Caj1. However, it did not show PA dependence. Therefore, the liposome sedimentation assay was performed again to examine the Caj1 interaction to other acidic phospholipids. As shown in Figure 3.12, Caj1 interacted with phosphatidylserine (PS), phosphoinositol (PI), and phosphoinositol-4-phosphate (PI4P) with stronger interactions to PS and PI4P. Previous results showed that PA liposomes made in the presence of PC had less capacity to bind Caj1 than those made in the presence of PE (Fig. 3.7). Therefore, PA binding was weak here. Together, the in vitro and the in vivo results suggest Caj1 is an acidic lipid binding protein. Figure 3.12 Interaction of Caj1 with acidic phospholipids Liposomes made with different acidic lipids compositions were tested for Caj1 binding. Detailed procedures are in Section 3.2.9. PS was reconstituted into liposome along with PC at two percentages: 25 % and 50 %. Other acidic phospholipids (PI, PI4P and PA) were reconstituted with 50 % PC. Pellets were analyzed on 12 % SDS-PAGE. 58 Chapter  4: Discussion 4.1 The membrane protein interactome in E. coli Three E. coli membrane proteins complexes (SecYEG, MalFGK, and YidC) interactors were used to develop and validate the technique. With Nd-SecYEG reconstituted in different lipids, Syd and SecA were identified. The identification of these known interactors of SecYEG suggests that the technique works and also is sensitive enough to distinguish between interactions that depend on different lipid types. With Nd-MalFGK, MalE was identified as a specific interacting partner. In this case, two growth conditions, glucose and maltose, were compared. The SILAC ratio of MalE from the glucose condition was ~6 fold lower than the ratio from the maltose condition. The lower ratio was expected since MalE expression is strongly reduced in the presence of glucose. SILAC extract from maltose cultures contained high level of proteins controlled by the mal operon (such as MalP, MalM and MalQ). However these proteins had SILAC ratios below one. Thus, the identification of MalE is not simply due to the increase in abundance of the protein in the presence of maltose. Growth conditions are important when applying this technique to certain membrane proteins. Since MalE is a periplasmic protein, the technique can identify both cytosolic and periplasmic interacting partners. No proteins interacting with YidC were isolated. The crystal structure of the large periplasmic P1 domain of YidC reveals a fold resembling that of a carbohydrate-binding protein and a cleft motif that could serve as a peptide-binding site (21-22). Previous proteomic analysis using an in vivo photo-crosslinker approach identified 12 different cytosolic proteins, most of them ribosomal or involved in cell metabolism with no apparent functional relationships to YidC (36). Here, the proteins identified with YidC showed no 59 specificity, with low SILAC ratios. These proteins were also present in experiments with SecYEG and MalFGK. YidC does not interact with any specific cytosolic or periplasmic proteins in the conditions tested. 4.2 The membrane interactome in S. cerevisiae Several known lipid interacting proteins were identified with Nanodisc made with PE, Ec, and PEPA. These are Ypt1, Vps21, Sec4, Faa1, and Osh6 (Table 3.4, Fig. 3.4 and Appendix C). Out of these, three are Rab family GTPase (Ypt1, Vps21 and Sec4). Ypt1 is involved in the secretory pathway for vesicle docking and targeting from ER to Golgi (61). Vps21 is required for endocytic transport and sorting of vacuolar proteins (62). Sec4 functions in the exocytic secretion and autophagy pathways (63). These Rab family GTPases require geranylgeranylation for membrane insertion. The lipid-modified GTPases exist in the cytosol in complex with Rab GDP dissociation inhibitor (GDI) which functions to bring the Rab GTPases to their appropriate membrane location and facilitate membrane insertion (64). The membrane targeting of these Rab GTPases has been shown previously using a sedimentation assay (65-66). These studies used membranes isolated from yeast cells and mixed with a soluble protein extract containing prenylated Rab-GDI complex. In the sedimented pellet, Rab proteins were detected by immunoblotting (65). Therefore, it is possible that the soluble form of these Rab family GTPases were present in the SILAC extracts and were inserted into the Nanodisc during the pulldown. Faa1 is one of the four long chain acyl-CoA synthetases required for fatty acid uptake and protein myristoylation. In yeast, nonpolar lipids, such as triacylglycerols and steryl esters, are stored in subcellular compartment known as lipid particles. Faa1 is heavily involved in lipid fatty acid metabolism and regulation. Hence it was not surprising that Faa1 60 was earlier identified to be associated with lipid particles via mass spectrometry (52). In this earlier study, the isolated lipid particles were delipidated and proteins were analyzed on a SDS-PAGE. Protein bands were excised and identified by mass spectrometry. Many proteins involved in lipid metabolism, including Faa1, were identified. This is consistent with the identification of Faa1 as a general lipid interacting protein. Osh proteins play critical roles in sterol homeostasis. In total there are seven Osh proteins in yeast. Most of them interact with oxysterols through their C-terminus oxysterol binding protein related domain (ORD) and with phosphoinositides (PIPs) via their pleckstrin homology (PH) domain. Although Osh6 lacks a PH domain at its N-terminus, it is still able to bind acidic PIPs and PA with different affinity (54). However, in this study, Osh6 was identified with Ec lipids. E. coli total lipid extract contains 57 % PE, 15 % PG, 10 % CL, and 18 % other lipids. Even though the acidic phosphatidylglycerol is not abundant in yeast, the fact that Osh6 is able to interact with acidic phospholipids could have led to this artificial interaction. Moreover, the unique mixture of lipids found in E. coli total lipid extract could have artificially enhanced the binding. However, to prove this hypothesis, more experiments are required. For example, a pulldown assay with different empty Nanodisc could be employed to test the affinity of Osh6 for different lipids. Alternatively, a sedimentation assay using liposomes with different lipid composition could be utilized. Using Nanodisc containing PA, the two known interacting proteins, Spo20 and Opi1, were not identified. Spo20 is a SNARE protein which is required for the formation of spores. Spo20 belongs to the SNAP-25 family which lacks a transmembrane domain (67-68). Studies using liposome sedimentation assays and in vivo localizations have demonstrated PA interaction and dependent localization (69). However, due to their strong affinity for 61 membranes they are not likely to be present in the soluble protein fractions, since our protein extraction conditions were mild (100 mM NaCl). Opi1 has been shown to bind PA through in vitro liposome sedimentation assays and in vivo GFP localization assays (46). Opi1 was not detected here could be due to interaction between Opi and PA was not established using the pulldown method or Opi1 was tightly bound to the membrane and not released into the total soluble protein extract. The test this, a sample of the total SILAC protein extract could be analyzed by mass spectrometry to detect if Opi1 and Spo20 are present. Pulldown assays with purified Opi1 could also be performed with Nd-PEPA to verify binding to Nanodisc. A previously uncharacterized lipid interactor, Caj1, was identified using Nanodisc containing PA. Caj1 belongs to the E. coli DnaJ protein family. This family of proteins all contain a conserved J-domain similar to the DnaJ protein found in E. coli. Caj1 was first identified and characterized in yeast in 1994 (55). Since then, only a few studies have involved Caj1. It has been characterized to be a type II J-protein consists of a J-domain at the N-terminus followed by a glycine rich domain. The exact function of this protein is unknown. However, since it contains a J-domain, Caj1 is an Hsp40 which interacts with an Hsp70 and stimulates its ATPase activity. Global analysis of protein localization in budding yeast has shown that Caj1 is possibly localized to the nucleus (70). This led to the prediction that Caj1 interacts with Ssa1/2 in the nucleus to assist its function (71). However, a more recent study has indicated that Caj1 together with Kap123 play an essential role in normal microtubule function (72). PA associated proteins contain a stretch of basic amino acid residues essential for PA interaction. Caj1 contains two basic regions near the C-terminus (Fig. 3.5) that could potentially serve as PA binding site. The interaction between Caj1 and PA was characterized 62 in vitro. Technique such as nickel affinity pulldown, liposome sedimentation assay and native-PAGE gel were employed and Caj1 binding to PA and other acidic phospholipids were confirmed. In addition, consistent with the properties of Opi1 (46, 56), the Caj1-PA interaction was found to be PE and pH dependent (Fig. 3.7B and 3.8). In vivo, N-terminal GFP-tagged Caj1 localized to the plasma membrane of yeast buds and the cytoplasm while C-terminal GFP-tagged Caj1 localized to the cytoplasm. The inconsistency in the localization could be due to the position of the GFP-tag. Since the potential basic PA interaction regions on Caj1 are found close to the C-terminus (Fig. 3.5), placing the bulky GFP-tag at the C-terminus could have blocked the interaction site. It is unlikely that the overexpression of N’GFP-Caj1 would have caused Caj1 to localize to the plasma membrane since the fluorescence intensities are similar for the N’ and C’GFP-Caj1 (Fig. 3.9). The specificity of binding of Caj1 to PA was tested in vivo. A GFP-Caj1-pma1-007 strain was created for manipulation of the cytosolic pH. According to Young et al., 2010, when grown in medias of pH 3-5, the cytosolic pH of the pma-007 strain is around 6.8-7 (46). However, the localization of N’GFP-Caj1 was not pH-dependent but the addition of ebselen, which decreased the pHi to ~6 (46), caused Caj1 to detach from the plasma membrane (Fig. 3.10). The delocalization may also have been caused by other effects of the drug (such as induced stress) and not directly due to the change in pHi. Moreover, Caj1 localization was not affected when two enzymes in the PA metabolism pathway were overexpressed (Fig. 3.11). These results suggest the association of Caj1 to the membrane is not PA-specific and that Caj1 is possibly interacting with other phospholipids in vivo. This hypothesis was tested via liposome sedimentation assay with different acidic lipid liposomes. 63 The result shows that Caj1 is a general acidic phospholipid binding protein (Fig. 3.12). However, the pulldown assay using Nd-Ec and Nd-PEPG showed no association of Caj1 (Fig. 3.7A). Binding of Caj1 to PG liposomes needs to be tested as the interaction might be observed with only one of these methods. 64 Chapter  5: Conclusion 5.1 Address the aims of project This technique which combines Nanodisc and SILAC proteomics has been applied to E. coli membrane proteins, SecYEG, MalFGK, and YidC and successfully identified previously known interactors, SecA, Syd, and MalE. However, consistent with previous studies, no interacting proteins were found with YidC. In yeast, the technique was applied to examine the membrane interactome. Several known lipid interacting proteins were identified along with a novel acidic phospholipid binding protein, Caj1. The interaction between Caj1 and PA as well as other acidic lipids was verified. The work in E. coli and S. cerevisiae together demonstrate the success in the development of a robust method for the identification of the membrane interactome. This technique could potentially be applied to any membrane or membrane protein of interest. 5.2 Future Directions The interaction between Caj1 and acidic phospholipids requires further characterization. First, the phospholipid that leads to the membrane localization of Caj1 needs to be identified. Since PS is present in the yeast bud plasma membrane in relative high concentration, this lipid is most likely to be responsible for Caj1 localization. To test this, a yeast Cho1 deletion strain will be employed since deletion of Cho1 will directly decrease the amount of PS present in the plasma membrane. Second, it is still possible that Caj1 is interacting with PA during the sporulation stage of the cell cycle. Previously, Spo20 was been shown to play a role during sporulation via its PA association (69). It is possible that Caj1 functions during sporulation as well. Therefore, localization of N’GFP-Caj1 during sporulation should be verified. Third, the predicted lipid binding sites on Caj1 need to be 65 verified. Point mutations could be introduced in the predicted binding region to replace the basic residues with neutral amino acids or truncation mutants could be created to remove the entire predicted binding site on Caj1. These mutants would be used in binding assays to map out the lipid interaction site of Caj1. 66 References 1. Ahram, M., Litou, Z. I., Fang, R., and Al-Tawallbeh, G. (2006) Estimation of membrane proteins in the human proteome, In Silico Biol 6, 379-386. 2. Cho, W., and Stahelin, R. V. (2005) Membrane-protein interactions in cell signaling and membrane trafficking, Annu Rev Biophys Biomol Struct 34, 119-151. 3. Hooker, B. S., Bigelow, D. J., and Lin, C. T. (2007) Methods for mapping of interaction networks involving membrane proteins, Biochem Biophys Res Commun 363, 457-461. 4. Bayburt, T. H., and Sligar, S. G. (2003) Self-assembly of single integral membrane proteins into soluble nanoscale phospholipid bilayers, Protein Sci 12, 2476-2481. 5. Bayburt, T. H., Grinkova, Y. V., and Sligar, S. G. (2006) Assembly of single bacteriorhodopsin trimers in bilayer nanodiscs, Arch Biochem Biophys 450, 215-222. 6. Denisov, I. G., and Sligar, S. G. (2011) Cytochromes P450 in nanodiscs, Biochim Biophys Acta 1814, 223-229. 7. Leitz, A. J., Bayburt, T. H., Barnakov, A. N., Springer, B. A., and Sligar, S. G. (2006) Functional reconstitution of Beta2-adrenergic receptors utilizing self-assembling Nanodisc technology, Biotechniques 40, 601-602, 604, 606, passim. 8. Makarov, A., Denisov, E., Kholomeev, A., Balschun, W., Lange, O., Strupat, K., and Horning, S. (2006) Performance evaluation of a hybrid linear ion trap/orbitrap mass spectrometer, Anal Chem 78, 2113-2120. 9. Gruhler, A., Olsen, J. V., Mohammed, S., Mortensen, P., Faergeman, N. J., Mann, M., and Jensen, O. N. (2005) Quantitative phosphoproteomics applied to the yeast pheromone signaling pathway, Mol Cell Proteomics 4, 310-327. 10. Veenendaal, A. K., van der Does, C., and Driessen, A. J. (2004) The protein- conducting channel SecYEG, Biochim Biophys Acta 1694, 81-95. 11. Nishiyama, K., Hanada, M., and Tokuda, H. (1994) Disruption of the gene encoding p12 (SecG) reveals the direct involvement and important function of SecG in the protein translocation of Escherichia coli at low temperature, EMBO J 13, 3272-3277. 12. Akiyama, Y., and Ito, K. (1987) Topology analysis of the SecY protein, an integral membrane protein involved in protein export in Escherichia coli, EMBO J 6, 3465- 3470. 13. Schatz, P. J., Riggs, P. D., Jacq, A., Fath, M. J., and Beckwith, J. (1989) The secE gene encodes an integral membrane protein required for protein export in Escherichia coli, Genes Dev 3, 1035-1044. 14. Nishiyama, K., Mizushima, S., and Tokuda, H. (1993) A novel membrane protein involved in protein translocation across the cytoplasmic membrane of Escherichia coli, EMBO J 12, 3409-3415. 15. Collinson, I. (2005) The structure of the bacterial protein translocation complex SecYEG, Biochem Soc Trans 33, 1225-1230. 16. Frauenfeld, J., Gumbart, J., Sluis, E. O., Funes, S., Gartmann, M., Beatrix, B., Mielke, T., Berninghausen, O., Becker, T., Schulten, K., and Beckmann, R. (2011) Cryo-EM structure of the ribosome-SecYE complex in the membrane environment, Nat Struct Mol Biol 18, 614-621. 17. Alami, M., Dalal, K., Lelj-Garolla, B., Sligar, S. G., and Duong, F. (2007) Nanodiscs unravel the interaction between the SecYEG channel and its cytosolic partner SecA, EMBO J 26, 1995-2004. 67 18. Dalal, K., Nguyen, N., Alami, M., Tan, J., Moraes, T. F., Lee, W. C., Maurus, R., Sligar, S. S., Brayer, G. D., and Duong, F. (2009) Structure, binding, and activity of Syd, a SecY-interacting protein, J Biol Chem 284, 7897-7902. 19. Wagner, S., Pop, O. I., Haan, G. J., Baars, L., Koningstein, G., Klepsch, M. M., Genevaux, P., Luirink, J., and de Gier, J. W. (2008) Biogenesis of MalF and the MalFGK(2) maltose transport complex in Escherichia coli requires YidC, J Biol Chem 283, 17881-17890. 20. Luirink, J., Samuelsson, T., and de Gier, J. W. (2001) YidC/Oxa1p/Alb3: evolutionarily conserved mediators of membrane protein assembly, FEBS Lett 501, 1- 5. 21. Oliver, D. C., and Paetzel, M. (2008) Crystal structure of the major periplasmic domain of the bacterial membrane protein assembly facilitator YidC, J Biol Chem 283, 5208-5216. 22. Ravaud, S., Stjepanovic, G., Wild, K., and Sinning, I. (2008) The crystal structure of the periplasmic domain of the Escherichia coli membrane protein insertase YidC contains a substrate binding cleft, J Biol Chem 283, 9350-9358. 23. Notley, L., and Ferenci, T. (1995) Differential expression of mal genes under cAMP and endogenous inducer control in nutrient-stressed Escherichia coli, Mol Microbiol 16, 121-129. 24. Shilton, B. H. (2008) The dynamics of the MBP-MalFGK(2) interaction: a prototype for binding protein dependent ABC-transporter systems, Biochim Biophys Acta 1778, 1772-1780. 25. Panagiotidis, C. H., Boos, W., and Shuman, H. A. (1998) The ATP-binding cassette subunit of the maltose transporter MalK antagonizes MalT, the activator of the Escherichia coli mal regulon, Mol Microbiol 30, 535-546. 26. Boos, W., and Bohm, A. (2000) Learning new tricks from an old dog: MalT of the Escherichia coli maltose system is part of a complex regulatory network, Trends Genet 16, 404-409. 27. Bluschke, B., Volkmer-Engert, R., and Schneider, E. (2006) Topography of the surface of the signal-transducing protein EIIA(Glc) that interacts with the MalK subunits of the maltose ATP-binding cassette transporter (MalFGK2) of Salmonella typhimurium, J Biol Chem 281, 12833-12840. 28. Dean, D. A., Reizer, J., Nikaido, H., and Saier, M. H., Jr. (1990) Regulation of the maltose transport system of Escherichia coli by the glucose-specific enzyme III of the phosphoenolpyruvate-sugar phosphotransferase system. Characterization of inducer exclusion-resistant mutants and reconstitution of inducer exclusion in proteoliposomes, J Biol Chem 265, 21005-21010. 29. Hanahan, D., Jessee, J., and Bloom, F. R. (1991) Plasmid transformation of Escherichia coli and other bacteria, Methods Enzymol 204, 63-113. 30. Dalal, K., and Duong, F. (2010) Reconstitution of the SecY translocon in nanodiscs, Methods Mol Biol 619, 145-156. 31. Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., Datsenko, K. A., Tomita, M., Wanner, B. L., and Mori, H. (2006) Construction of Escherichia coli K- 12 in-frame, single-gene knockout mutants: the Keio collection, Mol Syst Biol 2, 2006 0008. 68 32. Gold, V. A., Robson, A., Bao, H., Romantsov, T., Duong, F., and Collinson, I. (2010) The action of cardiolipin on the bacterial translocon, Proc Natl Acad Sci U S A 107, 10044-10049. 33. Lill, R., Dowhan, W., and Wickner, W. (1990) The ATPase activity of SecA is regulated by acidic phospholipids, SecY, and the leader and mature domains of precursor proteins, Cell 60, 271-280. 34. Raibaud, O., and Richet, E. (1987) Maltotriose is the inducer of the maltose regulon of Escherichia coli, J Bacteriol 169, 3059-3061. 35. Sherratt, D. J., Arciszewska, L. K., Blakely, G., Colloms, S., Grant, K., Leslie, N., and McCulloch, R. (1995) Site-specific recombination and circular chromosome segregation, Philos Trans R Soc Lond B Biol Sci 347, 37-42. 36. van Bloois, E., Dekker, H. L., Froderberg, L., Houben, E. N., Urbanus, M. L., de Koster, C. G., de Gier, J. W., and Luirink, J. (2008) Detection of cross-links between FtsH, YidC, HflK/C suggests a linked role for these proteins in quality control upon insertion of bacterial inner membrane proteins, FEBS Lett 582, 1419-1424. 37. van der Rest, M. E., Kamminga, A. H., Nakano, A., Anraku, Y., Poolman, B., and Konings, W. N. (1995) The plasma membrane of Saccharomyces cerevisiae: structure, function, and biogenesis, Microbiol Rev 59, 304-322. 38. Zinser, E., Sperka-Gottlieb, C. D., Fasch, E. V., Kohlwein, S. D., Paltauf, F., and Daum, G. (1991) Phospholipid synthesis and lipid composition of subcellular membranes in the unicellular eukaryote Saccharomyces cerevisiae, J Bacteriol 173, 2026-2034. 39. Calero, M., Chen, C. Z., Zhu, W., Winand, N., Havas, K. A., Gilbert, P. M., Burd, C. G., and Collins, R. N. (2003) Dual prenylation is required for Rab protein localization and function, Mol Biol Cell 14, 1852-1867. 40. Yan, D., and Olkkonen, V. M. (2008) Characteristics of oxysterol binding proteins, Int Rev Cytol 265, 253-285. 41. Nishizuka, Y. (1986) Studies and perspectives of protein kinase C, Science 233, 305- 312. 42. Bottomley, M. J., Salim, K., and Panayotou, G. (1998) Phospholipid-binding protein domains, Biochim Biophys Acta 1436, 165-183. 43. Strahl, T., and Thorner, J. (2007) Synthesis and function of membrane phosphoinositides in budding yeast, Saccharomyces cerevisiae, Biochim Biophys Acta 1771, 353-404. 44. Sreenivas, A., Patton-Vogt, J. L., Bruno, V., Griac, P., and Henry, S. A. (1998) A role for phospholipase D (Pld1p) in growth, secretion, and regulation of membrane lipid synthesis in yeast, J Biol Chem 273, 16635-16638. 45. Rudge, S. A., Sciorra, V. A., Iwamoto, M., Zhou, C., Strahl, T., Morris, A. J., Thorner, J., and Engebrecht, J. (2004) Roles of phosphoinositides and of Spo14p (phospholipase D)-generated phosphatidic acid during yeast sporulation, Mol Biol Cell 15, 207-218. 46. Young, B. P., Shin, J. J., Orij, R., Chao, J. T., Li, S. C., Guan, X. L., Khong, A., Jan, E., Wenk, M. R., Prinz, W. A., Smits, G. J., and Loewen, C. J. (2010) Phosphatidic acid is a pH biosensor that links membrane biogenesis to metabolism, Science 329, 1085-1088. 69 47. Andresen, B. T., Rizzo, M. A., Shome, K., and Romero, G. (2002) The role of phosphatidic acid in the regulation of the Ras/MEK/Erk signaling cascade, FEBS Lett 531, 65-68. 48. Testerink, C., and Munnik, T. (2005) Phosphatidic acid: a multifunctional stress signaling lipid in plants, Trends Plant Sci 10, 368-375. 49. Kooijman, E. E., Tieleman, D. P., Testerink, C., Munnik, T., Rijkers, D. T., Burger, K. N., and de Kruijff, B. (2007) An electrostatic/hydrogen bond switch as the basis for the specific interaction of phosphatidic acid with proteins, J Biol Chem 282, 11356-11364. 50. Gietz, R. D., and Schiestl, R. H. (2007) High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method, Nat Protoc 2, 31-34. 51. Pfeffer, S. R., Dirac-Svejstrup, A. B., and Soldati, T. (1995) Rab GDP dissociation inhibitor: putting rab GTPases in the right place, J Biol Chem 270, 17057-17059. 52. Athenstaedt, K., Zweytick, D., Jandrositz, A., Kohlwein, S. D., and Daum, G. (1999) Identification and characterization of major lipid particle proteins of the yeast Saccharomyces cerevisiae, J Bacteriol 181, 6441-6448. 53. Aitchison, J. D., Nuttley, W. M., Szilard, R. K., Brade, A. M., Glover, J. R., and Rachubinski, R. A. (1992) Peroxisome biogenesis in yeast, Mol Microbiol 6, 3455- 3460. 54. Wang, P., Duan, W., Munn, A. L., and Yang, H. (2005) Molecular characterization of Osh6p, an oxysterol binding protein homolog in the yeast Saccharomyces cerevisiae, FEBS J 272, 4703-4715. 55. Mukai, H., Shuntoh, H., Chang, C. D., Asami, M., Ueno, M., Suzuki, K., and Kuno, T. (1994) Isolation and characterization of CAJ1, a novel yeast homolog of dnaJ, Gene 145, 125-127. 56. Loewen, C. J., Gaspar, M. L., Jesch, S. A., Delon, C., Ktistakis, N. T., Henry, S. A., and Levine, T. P. (2004) Phospholipid metabolism regulated by a transcription factor sensing phosphatidic acid, Science 304, 1644-1647. 57. Ambesi, A., Miranda, M., Petrov, V. V., and Slayman, C. W. (2000) Biogenesis and function of the yeast plasma-membrane H(+)-ATPase, J Exp Biol 203, 155-160. 58. Chan, G., Hardej, D., Santoro, M., Lau-Cam, C., and Billack, B. (2007) Evaluation of the antimicrobial activity of ebselen: role of the yeast plasma membrane H+-ATPase, J Biochem Mol Toxicol 21, 252-264. 59. Han, G. S., O'Hara, L., Siniossoglou, S., and Carman, G. M. (2008) Characterization of the yeast DGK1-encoded CTP-dependent diacylglycerol kinase, J Biol Chem 283, 20443-20453. 60. Han, G. S., Wu, W. I., and Carman, G. M. (2006) The Saccharomyces cerevisiae Lipin homolog is a Mg2+-dependent phosphatidate phosphatase enzyme, J Biol Chem 281, 9210-9218. 61. Jedd, G., Richardson, C., Litt, R., and Segev, N. (1995) The Ypt1 GTPase is essential for the first two steps of the yeast secretory pathway, J Cell Biol 131, 583-590. 62. Horazdovsky, B. F., Busch, G. R., and Emr, S. D. (1994) VPS21 encodes a rab5-like GTP binding protein that is required for the sorting of yeast vacuolar proteins, EMBO J 13, 1297-1309. 70 63. Kabcenell, A. K., Goud, B., Northup, J. K., and Novick, P. J. (1990) Binding and hydrolysis of guanine nucleotides by Sec4p, a yeast protein involved in the regulation of vesicular traffic, J Biol Chem 265, 9366-9372. 64. Pfeffer, S. R., Soldati, T., Geissler, H., Rancano, C., and Dirac-Svejstrup, B. (1995) Selective membrane recruitment of Rab GTPases, Cold Spring Harb Symp Quant Biol 60, 221-227. 65. Soldati, T., Shapiro, A. D., Svejstrup, A. B., and Pfeffer, S. R. (1994) Membrane targeting of the small GTPase Rab9 is accompanied by nucleotide exchange, Nature 369, 76-78. 66. Ballew, N., Liu, Y., and Barlowe, C. (2005) A Rab requirement is not bypassed in SLY1-20 suppression, Mol Biol Cell 16, 1839-1849. 67. Hess, D. T., Slater, T. M., Wilson, M. C., and Skene, J. H. (1992) The 25 kDa synaptosomal-associated protein SNAP-25 is the major methionine-rich polypeptide in rapid axonal transport and a major substrate for palmitoylation in adult CNS, J Neurosci 12, 4634-4641. 68. Weimbs, T., Low, S. H., Chapin, S. J., Mostov, K. E., Bucher, P., and Hofmann, K. (1997) A conserved domain is present in different families of vesicular fusion proteins: a new superfamily, Proc Natl Acad Sci U S A 94, 3046-3051. 69. Nakanishi, H., de los Santos, P., and Neiman, A. M. (2004) Positive and negative regulation of a SNARE protein by control of intracellular localization, Mol Biol Cell 15, 1802-1815. 70. Huh, W. K., Falvo, J. V., Gerke, L. C., Carroll, A. S., Howson, R. W., Weissman, J. S., and O'Shea, E. K. (2003) Global analysis of protein localization in budding yeast, Nature 425, 686-691. 71. Walsh, P., Bursac, D., Law, Y. C., Cyr, D., and Lithgow, T. (2004) The J-protein family: modulating protein assembly, disassembly and translocation, EMBO Rep 5, 567-571. 72. Ptak, C., Anderson, A. M., Scott, R. J., Van de Vosse, D., Rogers, R. S., Sydorskyy, Y., Aitchison, J. D., and Wozniak, R. W. (2009) A role for the karyopherin Kap123p in microtubule stability, Traffic 10, 1619-1634. 71 Appendices Appendix A Primers Table A.1 Primers used in this study Primer Name Sequence 5’ to 3’ Vector Product Syd-myc-stop sens GTTGATCTCCGAGGAGGACCTCTAGCACCACCACCACCACCACTG pET23a T7: Syd-MycSyd-myc-stop anti CAGTGGTGGTGGTGGTGGTGCTAGAGGTCCTCCTCGGAGATCAAC 5’-Nde-Caj1 atatcatATGGTAAAGGAGACGGAGTATTATGATATTTTGGGC pET23a T7: Caj1-His63’-Caj1-Xho1 tatactcgagTCTGGCCCACAGTATGTTTTTTGTGTTCCTC Caj1-stop sens CATACTGTGGGCCAGACTCTAGCACCACCACCACCACCAC pET23a T7: Caj1Caj1-stop anti GTGGTGGTGGTGGTGGTGCTAGAGTCTGGCCACAGTATG Caj1-GFP forward GGTGAGCAGGAGAAGGAACACAAAAAACATACTGTGGCCAGAG GTGACGGTGCTGGTTTA Yeast genome Caj1-GFPCaj1-GFP reverse ATATATGAAAAATATACATGAGGCGTTATTAACTTGCTGAGCTCGAT GAATTCGAGCTCG GFP-Caj1 forward AATTAAGACGTATTAACTCAAAGGAAAAGAAAAGAGGGAATCATAC GATTTAGGTGACAC Yeast genome GFP-Caj1GFP-Caj1 reverse TGATGCCCAAAATATCATAATACTCCGTCTCCTTTACCATAGATCTC AAGTCCTCTTCAG 72 Appendix B E. colimass spectrometry results summary Table B.1 Complete list of proteins identified with Nd-YEG containing E. coli total lipid extract # Name Description Ratio Swiss Prot accession 1 Syd SecY-interacting protein 26.955 P0A8U0 2 FolE GTP cyclohydrolase I 4.195 P0A6T5 3 GlyA Serine hydroxymethyltransferase 3.876 P0A825 4 HisB Histidine biosynthesis bifunctional protein 3.375 P06987 5 PflB Formate acetyltransferase 3.182 P09373 6 FucR Positive regulatory protein for fuc regulon 2.799 P0ACK8 7 YqjL Uncharacterized protein 2.758 P64588 8 XerC Site-specific tyrosine recombinase 2.704 P0A8P6 9 Crp cAMP receptor protein 2.421 P0ACJ8 10 HinT Purine nucleoside phosphoramidase 2.190 P0ACE7 11 MalQ Amylomaltase 1.957 P15977 12 MutY A/G-specific adenine glycosylase 1.780 P17802 13 XerD Site-specific tyrosine recombinase 1.718 P0A8P8 14 RpsC 30S ribosomal subunit protein S3 1.692 P0A7V3 15 YeeX function unknown 1.640 P0A8M6 16 Rob Right origin-binding protein 1.629 P0ACI0 17 Tus DNA replication terminus site-binding protein 1.586 P16525 18 SecA Preprotein translocase ATPase secretion component 1.498 P10408 19 TrmH tRNA guanosine-2'-O-methyltransferase 1.346 P0AGJ2 20 KdsD Arabinose 5-phosphate isomerase 1.239 P45395 21 YbiB Uncharacterized protein 1.233 P30177 22 SlyD FKBP-type peptidyl-prolyl cis-trans isomerase 1.121 P0A9K9 23 RpsB 30S ribosomal subunit protein S2 1.101 P0A7V0 24 LpxA Udp N-Acetylglucosamine Acyltransferase 1.068 P0A722 25 Hfq Host factor-I protein 1.012 P0A6X3 26 RpsO 30S ribosomal subunit protein S15 0.958 P0ADZ4 27 DapB Dihydrodipicolinate reductase 0.897 P04036 28 SeqA Negative regulator of replication initiation 0.890 P0AFY8 29 YhbJ nucleotide-binding protein 0.878 P0A894 30 GutQ Arabinose 5-phosphate isomerase 0.854 P17115 31 Rsd Regulator of sigma D 0.814 P0AFX4 32 NikR Nickel-responsive regulator of the nik operon 0.805 P0A6Z6 33 Dcm DNA-cytosine methyltransferase 0.789 P0AED9 34 RlmG 23S rRNA m(2)G1835 methyltransferase 0.647 P42596 35 RsuA Ribosomal small subunit pseudouridine synthase A 0.584 P0AA43 36 TufB Translation elongation factor EF-Tu.B 0.496 P0CE48 37 RpmF 50S ribosomal subunit protein L32 0.492 P0A7N4 38 NusG Transcription antitermination factor 0.471 P0AFG0 39 AtdA Spermidine acetyltransferase 0.440 P0A951 40 Spy Spheroplast protein y 0.421 P77754 73 # Name Description Ratio Swiss Prot accession 41 HemY Member of uro (hemC) operon 0.137 P0ACB7 42 YidC Inner membrane protein 0.120 P25714 43 OmfP Outer membrane porin 0.074 P02931 44 Lpp Major outer membrane lipoprotein 0.042 P69776 45 SecG preprotein translocase 0.039 P0AG99 46 PyrC dihydroorotase 0.036 P05020 47 OmpV Outer membrane protein 0.023 P06111 48 SecY preprotein translocase 0.011 P0AGA2 74 Table B.2 Complete list of proteins identified with Nd-YEG containing PG lipids # Name Description Ratio Swiss Prot accession 1 SecA Preprotein translocase ATPase secretion component 34.956 P10408 2 XerC Site-specific tyrosine recombinase 8.961 P0A8P6 3 DnaJ Heat shock protein 6.267 P08622 4 Syd SecY-interacting protein 4.653 P0A8U0 5 HinT Purine nucleoside phosphoramidase 3.708 P0ACE7 6 FliC Flagellin 3.193 P04949 7 LpxA Udp N-Acetylglucosamine Acyltransferase 3.150 P0A722 8 Fur Ferric uptake regulator 3.034 P0A9A9 9 Crp cAMP receptor protein 2.738 P0ACJ8 10 AtdA Spermidine acetyltransferase 2.633 P0A951 11 SeqA Negative regulator of replication initiation 2.359 P0AFY8 12 RpmF 50S ribosomal subunit protein L32 2.222 P0A7N4 13 XerD Site-specific tyrosine recombinase 2.043 P0A8P8 14 RlmG 23S rRNA m(2)G1835 methyltransferase 2.030 P42596 15 YejD Uncharacterized protein 1.731 P46144 16 MutY A/G-specific adenine glycosylase 1.646 P17802 17 RpsB 30S ribosomal subunit protein S2 1.589 P0A7V0 18 NusG Transcription antitermination factor 1.588 P0AFG0 19 YqjL Uncharacterized protein 1.567 P64588 20 DnaA Chromosomal replication initiator protein 1.540 P03004 21 RpmA 50S ribosomal subunit protein L27 1.527 P0A7L8 22 DapB Dihydrodipicolinate reductase 1.519 P04036 23 KdsD Arabinose 5-phosphate isomerase 1.392 P45395 24 SelB Selenocysteine-specific elongation factor 1.342 P14081 25 PriA Primosome factor Y, protein N' 1.244 P17888 26 GuaB Inosine-5'-monophosphate dehydrogenase 1.231 P0ADG7 27 NikR Nickel-responsive regulator of the nik operon 1.194 P0A6Z6 28 RfaF ADP-heptose--LPS heptosyltransferase 2 1.185 P37692 29 YhbJ Nucleotide-binding protein 1.174 P0A894 30 GutQ Arabinose 5-phosphate isomerase 1.137 P17115 31 TrmH tRNA guanosine-2'-O-methyltransferase 1.109 P0AGJ2 32 DnaK heat shock chaperone 1.034 P0A6Y8 33 MinD Septum site-determining protein 1.021 P0AEZ3 34 RpsO 30S ribosomal subunit protein S15 1.021 P0ADZ4 35 PyrB Aspartate carbamoyltransferase, catalytic subunit 0.959 P0A786 36 RpsL 30S ribosomal subunit protein S12 0.944 P0A7S3 37 Rob Right origin-binding protein 0.878 P0ACI0 38 RplC 50S ribosomal subunit protein L3 0.861 P60438 39 FtsZ Cell division protein 0.860 P0A9A6 40 Upp Uracil phosphoribosyltransferase 0.786 P0A8F0 41 RpsC 30S ribosomal protein S3 0.772 P0A7V3 42 SlyD FKBP-type peptidyl-prolyl cis-trans isomerase 0.740 P0A9K9 43 GlyA Serine hydroxymethyltransferase 0.740 P0A825 75 # Name Description Ratio Swiss Prot accession 44 HemY Member of uro (hemC) operon 0.545 P0ACB7 45 TufB Translation elongation factor EF-Tu.B 0.509 P0CE48 46 GldA glycerol dehydrogenase 0.491 P0A9S5 47 RpsK 30S ribosomal protein S11 0.487 P0A7R9 48 AdhE Aldehyde-alcohol dehydrogenase 0.485 P0A9Q7 49 Pal Peptidoglycan-associated lipoprotein 0.457 P0A912 50 FucR L-fucose operon activator 0.422 P0ACK8 51 PflB Formate acetyltransferase 0.326 P09373 52 Ivy Inhibitor of vertebrate lysozyme 0.319 P0AD59 53 WzzE Lipopolysaccharide biosynthesis protein 0.297 P0AG00 54 GrcA Autonomous glycyl radical cofactor 0.262 P68066 55 RecA General recombination and DNA repair 0.262 P0A7G6 56 CyoA cytochrome o ubiquinol oxidase subunit II 0.237 Q8XE63 57 AtpB ATP synthase subunit beta 0.232 P0ABB4 58 SecF preprotein translocase chain F 0.226 P0AG93 59 DacA Alanyl-D-alanine carboxypeptidase 0.231 P0AEB2 60 YgiB Uncharacterized protein 0.166 P0ADT2 61 OmpT outer membrane protein, protease 7 0.161 P09169 62 Ndh NADH dehydrogenase 0.106 P00393 63 CptA Phosphoethanolamine transferase 0.100 P0CB39 64 OmpA outer membrane protein A 0.065 P0A910 65 SecG preprotein translocase G subunit 0.059 P0AG99 66 AcrB Acriflavine resistance protein B 0.061 P31224 67 MetQ D-methionine-binding lipoprotein 0.055 P28635 68 Lpp Major outer membrane lipoprotein 0.055 P69776 69 RodZ Cytoskeleton protein 0.056 P27434 70 PpiD Peptidyl-prolyl cis-trans isomerase D 0.050 P0ADY1 71 PyrC dihydroorotase 0.051 P05020 72 YfgM Uncharacterized protein 0.041 P76576 73 YidC Inner membrane protein 0.033 P25714 74 CydA Cytochrome d ubiquinol oxidase subunit 1 0.031 P0ABJ9 75 YajC preprotein translocase subunit 0.030 P0ADZ7 76 ZinT Metal binding protein 0.013 P76344 77 OmpF outer membrane porin F subunit 0.012 P02931 78 SecD preprotein translocase D subunit 0.006 P0AG90 79 YibN uncharacterized protein 0.011 P0AG27 76 Table B.3 Complete list of proteins identified with Nd-MalFGK using glucose cultured SILAC extract # Name Description Ratio Swiss Prot accession 1 MalE Maltose-binding protein, periplasmic 4.432 P0AEX9 2 SeqA Negative regulator of replication initiation 3.396 P0AFY8 3 RpsB 30S ribosomal subunit protein S2 2.392 P0A7V0 4 YaeH Uncharacterized protein 2.213 P62768 5 PbpG Murein D-alanyl-D-alanine endopeptidase 2.146 P0AFI5 6 Rob Right origin-binding protein 1.795 P0ACI0 7 Crp cAMP receptor protein 1.768 P0ACJ8 8 NusG Transcription antitermination factor 1.486 P0AFG0 9 RlmG 23S rRNA m(2)G1835 methyltransferase 1.466 P42596 10 XerD Site-specific tyrosine recombinase 1.457 P0A8P8 11 XerC Site-specific tyrosine recombinase 1.400 P0A8P6 12 UspG Stress protein, induced in stationary phase 1.390 P39177 13 RplC 50S ribosomal subunit protein L3 1.377 P60438 14 RpmF 50S ribosomal subunit protein L32 1.361 P0A7N4 15 RsuA 16S rRNA U516 pseudouridine synthase 1.350 P0AA43 16 GutQ D-arabinose 5-phosphate isomerase 1.339 P17115 17 MalP Maltodextrin phosphorylase 1.337 P00490 18 RpsP 30S ribosomal subunit protein S16 1.298 P0A7T3 19 PriA Primosome factor Y, protein N' 1.289 P17888 20 TrmI tRNA m(7)G46 methyltransferase, 1.259 P0AGJ7 21 GldA Glycerol dehydrogenase 1.249 P0A9S5 22 LpxA Udp N-Acetylglucosamine Acyltransferase 1.180 P0A722 23 SpeG Spermidine acetyltransferase 1.148 P0A951 24 RpmA 50S ribosomal subunit protein L27 1.134 P0A7L8 25 PdxH Pyridoxine/pyridoxamine phosphate oxidase 1.101 P0AFI7 26 SmpB tmRNA RNA-binding protein 1.087 P0A832 27 RplR 50S ribosomal subunit protein L18 1.087 P0C018 28 KdsD D-arabinose 5-phosphate isomerase 1.079 P45395 29 RpsJ 30S ribosomal subunit protein S10 1.075 P0A7R5 30 RpsO 30S ribosomal subunit protein S15 1.059 P0ADZ4 31 YqjI Uncharacterized protein 1.041 P64588 32 RlmI 23S rRNA m(5)C1962 methyltransferase 1.037 P75864 33 PtsI Phosphotransferase system enzyme I 1.036 P08839 34 TrmH tRNA mG18-2'-O-methyltransferase 1.017 P0AGJ2 35 PyrI Aspartate carbamoyltransferase, regulatory subunit 1.014 P0A7F3 36 ZinT Periplasmic zinc and cadmium binding protein 0.983 P76344 37 RplQ 50S ribosomal subunit protein L17 0.975 P0AG44 38 NikR Nickel-responsive regulator of the nik operon 0.972 P0A6Z6 39 RplX 50S ribosomal subunit protein L24 0.949 P60624 40 Dcm DNA cytosine methyltransferase 0.929 P0AED9 41 RplI 50S ribosomal subunit protein L9 0.887 P0A7R1 42 PriB Primosomal protein N 0.854 P07013 77 # Name Description Ratio Swiss Prot accession 43 HelD ATP-dependent DNA Helicase IV 0.846 P15038 44 IntS Integrase, CPS-53/KpLE1 prophage 0.798 P37326 45 RplM 50S ribosomal subunit protein L13 0.749 P0AA10 46 PflB Pyruvate formate lyase I 0.731 P09373 47 AdhE Alcohol dehydrogenase, largely anaerobic 0.731 P0A9Q7 48 Upp Uracil phosphoribosyltransferase 0.714 P0A8F0 49 RpsF 30S ribosomal subunit protein S6 0.705 P02358 50 Tig Trigger factor, protein folding chaperone 0.697 P0A850 51 RplN 50S ribosomal subunit protein L14 0.689 P0ADY3 52 RplB 50S ribosomal subunit protein L2 0.646 P60422 53 GroL Chaperonin Cpn60 0.625 P0A6F5 54 RpmB 50S ribosomal subunit protein L28 0.622 P0A7M2 55 YfiD Autonomous glycine radical cofactor 0.602 P68066 56 LipA Lipoyl synthase, iron-sulfur protein 0.573 P60716 57 AsnA Asparagine synthase A 0.544 P00963 58 YbjS Uncharacterized protein 0.538 P75821 59 Rne RNase E 0.524 P21513 60 GlyA Serine hydroxymethyltransferase 0.522 P0A825 61 RpsK 30S ribosomal subunit protein S11 0.511 P0A7R9 62 BolA Transcriptional repressor for mreB 0.489 P0ABE2 63 CheY Protein phosphatase 0.458 P0A9H9 64 EIIA phosphocarrier for glucose PTS transport 0.449 P69783 65 FliC Flagellin, structural gene, H-antigen 0.443 P04949 66 GrpE Nucleotide exchange factor for the DnaKJ chaperone 0.436 P09372 67 FusA Elongation Factor EF-G 0.425 P0A6M8 68 FtsZ Cell division protein 0.402 P0A9A6 69 GlnQ Glutamine high-affinity transport system 0.391 P10346 70 RpsA 30S ribosomal subunit protein S1 0.388 P0AG67 71 SlyD FKBP-type peptidyl-prolyl cis-trans isomerase 0.380 P0A9K9 72 RplA 50S ribosomal subunit protein L1 0.372 P0A7L0 73 TufA EF-Tu, Elongation Factor-Translation 0.362 P0CE47 74 Tsf EF-Ts, Elongation Factor-Translation, stable 0.346 P0A6P1 75 PurC Phosphoribosyl-aminoimidazole-succinocarboxamidesynthase 0.346 P0A7D7 76 Rho Transcription termination factor 0.326 P0AG30 77 HinT Purine nucleoside phosphoramidase 0.268 P0ACE7 78 FolE GTP cyclohydrolase I 0.232 P0A6T5 79 CyoA Cytochrome o oxidase subunit II, lipoprotein 0.208 Q8XE63 80 AtpD ATP synthase subunit beta 0.093 P0ABA4 81 PlsB Glycerol-3-phosphate acyltransferase 0.090 P0A7A7 82 OmpA Outer membrane protein A 0.080 P0A910 83 OmpC Outer membrane porin C 0.064 P06996 84 MalK Maltose transport complex, ATP-binding subunit 0.050 P68187 85 YbhC Acyl-CoA thioesterase, verified lipoprotein 0.040 P46130 78 # Name Description Raio Swiss port asscession 86 MalG Maltose transport complex 0.035 P68183 87 MalF Maltose transport complex 0.033 P02916 88 MetQ Periplasmic methionine binding lipoprotein 0.031 P28635 89 DacA D-alanine D-alanine carboxypeptidase PBP5 0.027 P0AEB2 90 HemY Member of uro (hemC) operon 0.024 P0ACB7 91 AcrB AcrAB-TolC multidrug efflux pump 0.016 P31224 92 Ndh Respiratory NADH dehydrogenase II 0.015 P00393 79 Table B.4 Complete list of proteins identified with Nd-MalFGK using maltose cultured SILAC extract # Name Description Ratio Swiss Prot accession 1 MalE Maltose-binding protein, periplasmic 26.386 P0AEX9 2 YaeH Uncharacterized protein 2.434 P62768 3 MinD Inhibition of FtsZ ring polymerization 1.555 P0AEZ3 4 RpmG 50S ribosomal subunit protein L33 1.226 P0A7N9 5 RpmA 50S ribosomal subunit protein L27 1.132 P0A7L8 6 RpsO 30S ribosomal subunit protein S15 1.108 P0ADZ4 7 RpmB 50S ribosomal subunit protein L28 0.969 P0A7M2 8 RpmF 50S ribosomal subunit protein L32 0.963 P0A7N4 9 AmiA N-acetylmuramyl-L-alanine amidase, periplasmic 0.959 P36548 10 Hfq Global regulator of sRNA function 0.930 P0A6X3 11 ZinT Periplasmic zinc and cadmium binding protein 0.922 P76344 12 Rob Right origin-binding protein 0.880 P0ACI0 13 YfgM Uncharacterized protein 0.869 P76576 14 MalQ Amylomaltase 0.855 P15977 15 RlmG 23S rRNA m(2)G1835 methyltransferase 0.848 P42596 16 RplB 50S ribosomal subunit protein L2 0.843 P60422 17 RplC 50S ribosomal subunit protein L3 0.834 P60438 18 PyrB Aspartate carbamoyltransferase, catalytic subunit 0.826 P0A786 19 YqjI Uncharacterized protein 0.797 P64588 20 PbpG Murein D-alanyl-D-alanine endopeptidase 0.785 P0AFI5 21 PriB Primosomal protein n 0.764 P07013 22 RlmI 23S rRNA m(5)C1962 methyltransferase 0.758 P75864 23 XerD Site-specific tyrosine recombinase 0.754 P0A8P8 24 NikR Nickel-responsive regulator of the nik operon 0.740 P0A6Z6 25 RplX 50S ribosomal subunit protein L24 0.732 P60624 26 Dcm DNA cytosine methyltransferase 0.731 P0AED9 27 RpsP 30S ribosomal subunit protein S16 0.725 P0A7T3 28 RsuA 16S rRNA U516 pseudouridine synthase 0.716 P0AA43 29 PyrI Aspartate carbamoyltransferase, regulatory subunit 0.704 P0A7F3 30 FucR L-fucose operon activator 0.679 P0ACK8 31 GutQ D-arabinose 5-phosphate isomerase 0.674 P17115 32 GldA Glycerol dehydrogenase, NAD+ dependent 0.673 P0A9S5 33 KdsD D-arabinose 5-phosphate isomerase 0.658 P45395 34 MalP Maltodextrin phosphorylase 0.654 P00490 35 LpxA Udp N-Acetylglucosamine Acyltransferase 0.648 P0A722 36 Spy Spheroplast protein y 0.645 P77754 37 PriA Primosome factor Y, protein n' 0.615 P17888 38 RplM 50S ribosomal subunit protein L13 0.610 P0AA10 39 TrmI tRNA m(7)G46 methyltransferase 0.609 P0AGJ7 40 TrmH tRNA mG18-2'-O-methyltransferase 0.593 P0AGJ2 41 SpeG Spermidine acetyltransferase 0.587 P0A951 42 ZraP Zn-binding periplasmic protein 0.577 P0AAA9 80 # Name Description Ratio Swiss Prot accession 43 RpsS 30S ribosomal subunit protein S19 0.559 P0A7U3 44 HinT Purine nucleoside phosphoramidase 0.555 P0ACE7 45 RpsB 30S ribosomal subunit protein S2 0.555 P0A7V0 46 RplR 50S ribosomal subunit protein L18 0.539 P0C018 47 XerC Site-specific tyrosine recombinase 0.529 P0A8P6 48 RpmD 50S ribosomal subunit protein L30 0.520 P0AG51 49 YfiD Autonomous glycine radical cofactor 0.515 P68066 50 Crp cAMP receptor protein 0.512 P0ACJ8 51 RpsF 30S ribosomal subunit protein S6 0.481 P02358 52 PyrC Dihydroorotase 0.480 P05020 53 DnaK Hsp70 molecular chaperone, heat-inducible 0.461 P0A6Y8 54 PflB Pyruvate formate lyase I 0.449 P09373 55 RpsL 30S ribosomal subunit protein S12 0.444 P0A7S3 56 CheY Chemotaxis protein 0.435 P0AE67 57 FliC Flagellin, structural gene, H-antigen 0.429 P04949 58 RpsK 30S ribosomal subunit protein S11 0.406 P0A7R9 59 FrdB Fumarate reductase iron-sulfur protein subunit 0.402 P0AC47 60 SlyD FKBP-type peptidyl-prolyl cis-trans isomerase 0.368 P0A9K9 61 KdsA 2-dehydro-3-deoxyphosphooctonate aldolase 0.338 P0A715 62 RplN 50S ribosomal subunit protein L14 0.324 P0ADY3 63 RpsC 30S ribosomal subunit protein S3 0.323 P0A7V3 64 CyoA Cytochrome o oxidase subunit II, lipoprotein 0.322 Q8XE63 65 CheZ CheY-P phosphatase 0.315 P0A9H9 66 RplK 50S ribosomal subunit protein L11 0.292 P0A7J7 67 Tsf EF-Ts, Elongation Factor-Translation, stable 0.283 P0A6P1 68 FusA Elongation Factor EF-G 0.280 P0A6M8 69 Tsr Serine chemoreceptor, methyl-accepting 0.276 P02942 70 NusG Transcription antitermination factor 0.259 P0AFG0 71 GatY D-Tagatose-1,6-bisphosphate aldolase, class II 0.247 P0C8J6 72 TolC Outer membrane protein 0.234 P02930 73 RplJ 50S ribosomal subunit protein L10 0.221 P0A7J3 74 MreB Rod shape-determining protein 0.211 P0A9X4 75 AdhE Alcohol dehydrogenase, largely anaerobic 0.193 P0A9Q7 76 PlsB Glycerol-3-phosphate acyltransferase 0.190 P0A7A7 77 OmpF Outer membrane porin F 0.185 P02931 78 AtpD ATP synthase subunit delta 0.173 P0ABA4 79 TufA EF-Tu, Elongation Factor-Translation, unstable 0.135 P0CE47 80 FolE GTP cyclohydrolase I 0.119 P0A6T5 81 Rne RNase E 0.098 P21513 82 FtsZ Cell division protein 0.076 P0A9A6 83 Lpd Lipoamide dehydrogenase, NADH-dependent 0.075 P0A9P0 84 HemL Glutamate-1-semialdehyde aminomutase 0.072 P23893 85 AceE Pyruvate dehydrogenase E1 component 0.042 P0AFG8 86 MalM Periplasmic protein in malK operon 0.041 P03841 81 # Name Description Ratio Swiss prot accession 87 RecA General recombination and DNA repair 0.033 P0A7G6 88 Ndh Respiratory NADH dehydrogenase II 0.032 P00393 89 AcrB AcrAB-TolC multidrug efflux pump 0.032 P31224 90 YgiB Uncharacterized protein 0.027 P0ADT2 91 YcgR Flagellar brake protein 0.026 P76010 92 Pal Lipoprotein associated with peptidoglycan 0.023 P0A912 93 MalF Maltose transport complex 0.023 P02916 94 DacA D-alanine D-alanine carboxypeptidase PBP5 0.021 P0AEB2 95 NhaB Na+/H+ antiporter 2, weakly pH-dependent 0.018 P0AFA7 96 SdaC Serine:H+ symport permease, threonine-insensitive 0.018 P0AAD6 97 MetQ Periplasmic methionine binding lipoprotein 0.016 P28635 98 OmpA Outer membrane protein A 0.015 P0A910 99 MalK Maltose transport complex, ATP-binding subunit 0.015 P68187 100 OmpC Outer membrane porin C 0.015 P06996 101 LamB Maltoporin, maltose high-affinity uptake system 0.011 P02943 82 Table B.5 Complete list of proteins identified with Nd-YidC # Name Description Ratio Swiss Prot accession 1 XerC Site-specific tyrosine recombinase 5.172 P0A8P6 2 FucR L-fucose operon activator 5.110 P0ACK8 3 GrcA autonomous glycyl radical cofactor 3.933 P68066 4 PflB formate C-acetyltransferase 3.313 P09373 5 GylA Serine hydroxymethyltransferase 3.238 P0A825 6 HinT purine nucleoside phosphoramidase 3.232 P0ACE7 7 FolE GTP cyclohydrolase I 2.981 P0A6T5 8 HisB Histidine biosynthesis bifunctional protein hisB 2.719 P06987 9 Rob Right origin-binding protein 1.871 P0ACI0 10 PyrL aspartate carbamoyltransferase regulatory chain 1.777 P0A7F3 11 YcfP orf, hypothetical protein; putative hydrolase 1.752 P0A8E1 12 Tus DNA replication terminus site-binding protein 1.642 P16525 13 Fur Ferric uptake regulation protein 1.585 P0A9A9 14 XerD Site-specific tyrosine recombinase 1.554 P0A8P8 15 YqjL Uncharacterized protein 1.498 P64588 16 TrmB tRNA (guanine-N(7)-)-methyltransferase 1.395 P17802 17 RpsC 30S ribosomal protein S3 1.338 P0A7V3 18 TrmH tRNA guanosine-2'-O-methyltransferase 1.296 P0AGJ2 19 LpxA Udp N-Acetylglucosamine Acyltransferase 1.295 P0A722 20 KdsD Arabinose 5-phosphate isomerase 1.276 P45395 21 Crp Catabolite gene activator 1.275 P0ACJ8 22 RsuA Ribosomal small subunit pseudouridine synthase A 1.206 P0AA43 23 SpeG Spermidine N(1)-acetyltransferase 1.205 P0A951 24 RpsB 30S ribosomal protein S2 1.183 P0A7V0 25 SeqA Negative regulator of replication initiation 1.173 P0AFY8 26 AcpS Holo-[acyl-carrier-protein] synthase 1.164 P24224 27 GldA Glycerol dehydrogenase 1.153 P0A9S5 28 PriA Primosomal protein N' 1.128 P17888 29 RlmG Ribosomal RNA large subunit methyltransferase G 1.081 P42596 30 SlyD FKBP-type peptidyl-prolyl cis-trans isomerase 1.046 P0A9K9 31 NikR Nickel responsive regulator 1.024 P0A6Z6 32 PurU Formyltetrahydrofolate deformylase 0.978 P37051 33 RpsK 30S ribosomal protein S11 0.973 P0A7R9 34 RpmF 50S ribosomal protein L32 0.913 P0A7N4 35 ZraP Zinc resistance-associated protein 0.836 P0AAA9 36 Rsd Regulator of sigma D 0.827 P0AFX4 37 Hfq Hfq protein (Host factor-I protein) (HF-I) (HF-1) 0.800 P0A6X3 38 YhbJ Nucleotide-binding protein 0.744 P0A894 39 RpsO 30S ribosomal protein S15 0.740 P0ADZ4 40 DnaJ Heat shock protein 0.660 P08622 41 NusG Transcription antitermination factor 0.632 P0AFG0 42 Syd Interacts with the secY protein in vivo 0.625 P0A8U0 43 RpmB 50S ribosomal protein L28 0.544 P0A7M2 83 # Name Description Ratio Swiss Prot accession 44 TufB Translation elongation factor EF-Tu.B 0.538 P0CE47 45 RpsD 30S ribosomal protein S4 0.455 P0A7V8 46 RplE 50S ribosomal protein L5 0.364 P62399 47 Spy Spheroplast protein y 0.344 P77754 48 DacA D-alanyl-D-alanine carboxypeptidase 0.305 P0AEB2 49 OmpA Outer membrane protein A 0.116 P0A910 50 HemY Involved in a late step of protoheme IX synthesis 0.096 P0ACB7 51 YidC Inner membrane protein 0.059 P25714 52 Lpp Major outer membrane lipoprotein 0.056 P69776 53 YcgK Uncharacterized protein 0.048 P76002 54 PyrC Dihydroorotase [Escherichia coli] 0.041 P05020 55 SecG Protein-export membrane protein 0.027 P0AG99 56 SecY Preprotein translocase subunit 0.026 P0AGA2 57 YajC Part of the secDF-yidC-yajC translocase complex 0.024 P0ADZ7 58 WaaA 3-deoxy-D-manno-octulosonic-acid transferase 0.023 P0AC75 59 OmpV Outer membrane protein 0.018 Q8X553 60 OmpF Outer membrane porin 0.018 P02931 61 YibN Uncharacterized protein 0.005 P0AG27 62 SecE preprotein translocase subunit 0.000 P0AG96 84 Appendix C S. cerevisiaemass spectrometry results summary Table C.1 Complete list of proteins identified with Nd-Ec # Name Description Ratio Accession number 1 OSH6 Member of an oxysterol-binding protein family 11.538 YKR003W 2 YPT1 Ras-like small GTPase, involved in the ER-to-Golgi step of the secretory pathway 10.300 YFL038C 3 FAA1 Long chain fatty acyl-CoA synthetase with a preference for C12:0-C16:0 fatty acids 9.832 YOR317W 4 RPS5 Ribosomal protein 4.312 YJR123W 5 VPS21 GTPase required for transport during endocytosis and for correct sorting of vacuolar hydrolases 3.448 YOR089C 6 CDC19 Pyruvate kinase 1.775 YAL038W 7 DED1 ATP-dependent DEAD (Asp-Glu-Ala-Asp)-box RNA helicase 1.761 YOR204W 8 PDC1 Major of three pyruvate decarboxylase isozymes 1.730 YLR044C 9 SAH1 S-adenosyl-L-homocysteine hydrolase 1.611 YER043C 10 TDH2 Glyceraldehyde-3-phosphate dehydrogenase 1.586 YJR009C 11 RPL20A Ribosomal protein 1.520 YMR242C 12 ADH1 Alcohol dehydrogenase 1.424 YOL086C 13 SSE1 ATPase that is a component of the heat shock protein Hsp90 chaperone complex 1.398 YPL106C 14 EFT1 Elongation factor 2 (EF-2) 1.397 YOR133W 15 SRO9 Cytoplasmic RNA-binding protein that associates with translating ribosomes 1.367 YCL037C 16 TDH3 Glyceraldehyde-3-phosphate dehydrogenase, isozyme 3 1.347 YGR192C 17 RPS7B Ribosomal protein 1.326 YNL096C 18 RPL38 Ribosomal protein 1.299 YLR325C 19 MHP1 Microtubule-associated protein involved in assembly and stabilization of microtubules 1.288 YJL042W 20 GPD2 NAD-dependent glycerol 3-phosphate dehydrogenase 1.273 YOL059W 21 RPL17B Ribosomal protein 1.248 YJL177W 22 ENO2 Enolase II, a phosphopyruvate hydratase 1.185 YHR174W 23 RPL25 Ribosomal protein 1.183 YOL127W 24 RPS22A Ribosomal protein 1.161 YJL190C 25 YCK2 Palmitoylated, plasma membrane-bound casein kinase I isoform 1.113 YNL154C 26 FBA1 Fructose 1,6-bisphosphate aldolase 1.106 YKL060C 27 RPS14A Ribosomal protein 1.095 YCR031C 85 # Name Description Ratio Accession number 28 YEF3 Translational elongation factor 3 1.088 YLR249W 29 GPM1 Tetrameric phosphoglycerate mutase 1.072 YKL152C 30 RPS13 Ribosomal protein 1.061 YDR064W 31 HRK1 Protein kinase implicated in activation of the plasma membrane H(+)-ATPase Pma1p in response to glucose metabolism 1.013 YOR267C 32 SCD6 Protein containing an Lsm domain, may bind RNA and have a role in RNA processing 0.992 YPR129W 33 RPL30 Ribosomal protein 0.977 YGL030W 34 RPL32 Ribosomal protein 0.975 YBL092W 35 PGK1 3-phosphoglycerate kinase 0.961 YCR012W 36 RPS20 Ribosomal protein 0.96 YHL015W 37 SAM1 S-adenosylmethionine synthetase 0.955 YLR180W 38 SSA1 ATPase involved in protein folding and nuclear localization signal (NLS)-directed nuclear transport 0.939 YAL005C 39 CDC33 Cytoplasmic mRNA cap binding protein 0.928 YOL139C 40 STM1 Protein that binds G4 quadruplex and purine motif triplex nucleic acid 0.928 YLR150W 41 DLD3 D-lactate dehydrogenase 0.911 YEL071W 42 YNL208W Protein of unknown function 0.904 YNL208W 43 RPS2 Ribosomal protien 0.903 YGL123W 44 CAJ1 Nuclear type II J heat shock protein of the E. coli dnaJ family 0.896 YER048C 45 YDL025C Uncharacterized ORF 0.892 YDL025C 46 HYP2 Translation initiation factor eIF-5A 0.888 YEL034W 47 RPL12A Ribosomal protein 0.885 YEL054C 48 TEF1 Translational elongation factor EF-1 alpha 0.873 YPR080W 49 RPL22A Ribosomal protein 0.865 YLR061W 50 PNC1 Nicotinamidase that converts nicotinamide to nicotinic acid as part of the NAD(+) salvage pathway 0.862 YGL037C 51 PHO8 Repressible alkaline phosphatase 0.799 YDR481C 52 RPL16A Ribosomal protein 0.787 YIL133C 53 RPS10B Ribosomal protein 0.772 YMR230W 54 HBT1 Substrate of the Hub1p ubiquitin-like protein that localizes to the shmoo tip 0.765 YDL223C 86 # Name Description Ratio Accession number 55 SHM2 Cytosolic serine hydroxymethyltransferase 0.762 YLR058C 56 RPL3 Ribosomal protein 0.753 YOR063W 57 RPL19B Ribosomal protein 0.746 YBL027W 58 RPS27B Ribosomal protein 0.74 YHR021C 59 LSP1 Primary component of eisosomes 0.736 YPL004C 60 RPL9B Ribosomal protein 0.7 YNL067W 61 RPS17A Ribosomal protein 0.698 YML024W 62 RPS26B Ribosomal protein 0.69 YER131W 63 SNF4 Activating gamma subunit of the AMP-activated Snf1p kinase complex (contains Snf1p and a Sip1p/Sip2p/Gal83p family member) 0.681 YGL115W 64 SUI1 Translation initiation factor eIF1 0.653 YNL244C 65 SNF1 AMP-activated serine/threonine protein kinase found in a complex containing Snf4p and members of the Sip1p/Sip2p/Gal83p family 0.627 YDR477W 66 TSA1 Ubiquitous housekeeping thioredoxin peroxidase 0.606 YML028W 67 MBF1 Transcriptional coactivator that bridges the DNA-binding region of Gcn4p and TATA- binding protein Spt15p 0.602 YOR298C-A 68 NMA1 Nicotinic acid mononucleotide adenylyltransferase 0.594 YLR328W 69 RPS24B Ribosomal protein 0.575 YIL069C 70 GAL83 One of three possible beta-subunits of the Snf1 kinase complex 0.557 YER027C 71 RPL35B Ribosomal protein 0.454 YDL136W 72 RPS18B Ribosomal protein 0.441 YML026C 73 RPP0 Ribosomal protein 0.393 YLR340W 74 ACT1 Actin, structural protein involved in cell polarization 0.389 YFL039C 75 RPS1B Ribosomal protein 0.365 YML063W 76 AHP1 Thiol-specific peroxiredoxin 0.229 YLR109W 77 RPS0B Ribosomal protein 0.123 YLR048W 87 Table C.2 Complete list of proteins identified with Nd-PE # Name Description Ratio Accession number 1 YPT1 Ras-like small GTPase, involved in the ER-to-Golgi step of the secretory pathway 16.803 YFL038C 2 VPS21 GTPase required for transport during endocytosis and for correct sorting of vacuolar hydrolases 10.100 YOR089C 3 SEC4 Secretory vesicle-associated Rab GTPase essential for exocytosis 8.019 YFL005W 4 RPL22A Ribosomal protein 3.145 YLR061W 5 RPS5 Ribosomal protein 2.515 YJR123W 6 TIF1 Translation initiation factor eIF4A 2.480 YKR059W 7 ENO2 Enolase II 2.260 YHR174W 8 FAA1 Long chain fatty acyl-CoA synthetase with a preference for C12:0-C16:0 fatty acids 2.180 YOR317W 9 PGK1 3-phosphoglycerate kinase 2.077 YCR012W 10 HSC82 Cytoplasmic chaperone of the Hsp90 family 1.836 YMR186W 11 RPS7B Ribosomal protein 1.657 YNL096C 12 IMD3 inosine monophosphate dehydrogenase 1.643 YLR432W 13 ACT1 Actin, structural protein involved in cell polarization 1.525 YFL039C 14 CAJ1 Nuclear type II J heat shock protein of the E. coli dnaJ family 1.523 YER048C 15 RPL12A Ribosomal protein 1.497 YEL054C 16 RPS18B Ribosomal protein 1.417 YML026C 17 RPL38 Ribosomal protein 1.326 YLR325C 18 RPL17B Ribosomal protein 1.321 YJL177W 19 RPS14A Ribosomal protein 1.298 YCR031C 20 YEF3 Translational elongation factor 3 1.294 YLR249W 21 RPL30 Ribosomal protein 1.265 YGL030W 22 RPS24B Ribosomal protein 1.241 YIL069C 23 RPS13 Ribosomal protein 1.222 YDR064W 24 RPL9A Ribosomal protein 1.184 YGL147C 25 GPD2 NAD-dependent glycerol 3-phosphate dehydrogenase, homolog of Gpd1p 1.168 YOL059W 26 RPS20 Ribosomal protein 1.130 YHL015W 27 GPM1 Tetrameric phosphoglycerate mutase 1.126 YKL152C 28 RPS22A Ribosomal protein 1.125 YJL190C 88 # Name Description Ratio Accession number 29 RPL19B Ribosomal protein 1.119 YBL027W 30 SBP1 Nucleolar single-strand nucleic acid binding protein 1.101 YHL034C 31 RPL25 Ribosomal protein 1.086 YOL127W 32 SSE1 ATPase that is a component of the heat shock protein Hsp90 chaperone complex 1.081 YPL106C 33 RPS28A Ribosomal protein 1.031 YOR167C 34 YRA1 Nuclear protein that binds to RNA and to Mex67p, 0.973 YDR381W 35 ADH1 Alcohol dehydrogenase 0.971 YOL086C 36 PDC1 Major of three pyruvate decarboxylase isozymes 0.965 YLR044C 37 IST2 Plasma membrane protein that may be involved in osmotolerance 0.962 YBR086C 38 THO1 Conserved nuclear RNA-binding protein 0.961 YER063W 39 HRK1 Protein kinase implicated in activation of the plasma membrane H(+)-ATPase Pma1p in response to glucose metabolism 0.96 YOR267C 40 DED1 ATP-dependent DEAD (Asp-Glu-Ala-Asp)-box RNA helicase 0.959 YOR204W 41 VMA10 Vacuolar H+ ATPase subunit G of the catalytic (V1) sector, involved in vacuolar acidification; 0.951 YHR039C-A 42 HSP10 Mitochondrial matrix co-chaperonin that inhibits the ATPase activity of Hsp60p, a mitochondrial chaperonin; 0.942 YOR020C 43 STM1 Protein that binds G4 quadruplex and purine motif triplex nucleic acid 0.918 YLR150W 44 CDC19 Pyruvate kinase, functions as a homotetramer in glycolysis to convert phosphoenolpyruvate to pyruvate,; 0.888 YAL038W 45 IPP1 Cytoplasmic inorganic pyrophosphatase (PPase), 0.885 YBR011C 46 RSP5 Ribosomal protein 0.885 YER125W 47 SSZ1 Hsp70 protein that interacts with Zuo1p 0.881 YHR064C 48 PAB1 Poly(A) binding protein 0.852 YER165W 49 SSA1 ATPase involved in protein folding and nuclear localization signal (NLS)-directed nuclear transport; 0.848 YAL005C 50 EGD2 Alpha subunit of the heteromeric nascent polypeptide-associated complex (NAC) involved in protein sorting and translocation, 0.844 YHR193C 51 ADH3 Mitochondrial alcohol dehydrogenase isozyme III 0.844 YMR083W 52 TEF1 Translational elongation factor EF-1 alpha 0.838 YPR080W 89 # Name Description Ratio Accession number 53 PNC1 Nicotinamidase that converts nicotinamide to nicotinic acid as part of the NAD(+) salvage pathway 0.827 YGL037C 54 EGD1 Subunit beta1 of the nascent polypeptide-associated complex (NAC) involved in protein targeting 0.816 YPL037C 55 TEF4 Translation elongation factor EF-1 gamma 0.816 YKL081W 56 TFP1 Vacuolar ATPase V1 domain subunit A containing the catalytic nucleotide binding sites 0.814 YDL185W 57 PHO8 Repressible alkaline phosphatase, a glycoprotein localized to the vacuole 0.814 YDR481C 58 YCK2 Palmitoylated, plasma membrane-bound casein kinase I isoform 0.808 YNL154C 59 DLD3 D-lactate dehydrogenase 0.805 YEL071W 60 HBT1 Substrate of the Hub1p ubiquitin-like protein that localizes to the shmoo tip (mating projection) 0.804 YDL223C 61 SUI1 Translation initiation factor eIF1 0.802 YNL244C 62 YDL025C Putative protein kinase, potentially phosphorylated by Cdc28p; 0.791 YDL025C 63 TDH3 Glyceraldehyde-3-phosphate dehydrogenase, isozyme 3, involved in glycolysis and gluconeogenesis 0.789 YGR192C 64 LSP1 Primary component of eisosomes 0.787 YPL004C 65 IDH2 Subunit of mitochondrial NAD(+)-dependent isocitrate dehydrogenase 0.770 YOR136W 66 YNL208W Protein of unknown function; may interact with ribosomes 0.768 YNL208W 67 SNF1 AMP-activated serine/threonine protein kinase found in a complex containing Snf4p and members of the Sip1p/Sip2p/Gal83p family; 0.745 YDR477W 68 SHM2 Cytosolic serine hydroxymethyltransferase, involved in one-carbon metabolism 0.739 YLR058C 69 UGP1 UDP-glucose pyrophosphorylase (UGPase) 0.730 YKL035W 70 MBF1 Transcriptional coactivator that bridges the DNA-binding region of Gcn4p and TATA- binding protein Spt15p 0.73 YOR298C-A 71 TMA7 of unknown that associates with ribosomes 0.724 YLR262C-A 72 SNF4 Activating gamma subunit of the AMP-activated Snf1p kinase complex (contains Snf1p and a Sip1p/Sip2p/Gal83p family member) 0.714 YGL115W 73 SRO9 Cytoplasmic RNA-binding protein that associates with translating ribosomes 0.693 YCL037C 74 MHP1 Microtubule-associated protein involved in assembly and stabilization of microtubules 0.688 YJL042W 75 RPL28 Ribosomal protein 0.671 YGL103W 90 # Name Description Ratio Accession number 76 GPD1 NAD-dependent glycerol-3-phosphate dehydrogenase 0.663 YDL022W 77 NMA1 Nicotinic acid mononucleotide adenylyltransferase, involved in NAD(+) salvage pathway 0.663 YLR328W 78 TUB2 Beta-tubulin 0.655 YFL037W 79 DOT6 Protein of unknown function, involved in telomeric gene silencing and filamentation 0.649 YER088C 80 FRP3 Nucleolar peptidyl-prolyl cis-trans isomerase (PPIase) 0.646 YML074C 81 SIK1 Essential evolutionarily-conserved nucleolar protein component of the box C/D snoRNP complexes that direct 2'-O-methylation of pre-rRNA during its maturation 0.572 YLR197W 82 SHE3 Protein that acts as an adaptor between Myo4p and the She2p-mRNA complex 0.558 YBR130C 83 TDH1 Glyceraldehyde-3-phosphate dehydrogenase, isozyme 1, involved in glycolysis and gluconeogenesis 0.550 YJL052W 84 TSA1 Ubiquitous housekeeping thioredoxin peroxidase 0.543 YML028W 85 ZPS1 Putative GPI-anchored protein 0.541 YOL154W 86 RPS7A Ribosomal protein 0.473 YOR096W 87 RPL20A Ribosomal protein 0.370 YMR242C 88 AHP1 Thiol-specific peroxiredoxin, reduces hydroperoxides to protect against oxidative damage; 0.249 YLR109W 89 YPT7 GTPase; GTP-binding protein of the rab family 0.004 YML001W 91 Table C.3 Complete list of proteins identified with Nd-PEPA (50:50) # Name Description Ratio Accession number 1 CAJ1 Nuclear type II J heat shock protein of the E. coli dnaJ family 16.322 YER048C 2 RPS5 Ribosomal protein 7.612 YJR123W 3 FAA1 Long chain fatty acyl-CoA synthetase with a preference for C12:0-C16:0 fatty acids 6.582 YOR317W 4 RPL11B Ribosomal protein 5.944 YGR085C 5 YPT1 Ras-like small GTPase, involved in the ER-to-Golgi step of the secretory pathway 5.864 YFL038C 6 RPS6A Ribosomal protein 5.509 YPL090C 7 VPS21 GTPase required for transport during endocytosis and for correct sorting of vacuolar hydrolases 4.866 YOR089C 8 RPS17A Ribosomal protein 4.431 YML024W 9 RPS4A Ribosomal protein 4.195 YJR145C 10 RPL35B Ribosomal protein 3.373 YDL136W 11 YFL002W-A Retrotransposon TYA Gag and TYB Pol genes 2.890 YFL002W-A 12 RPS13 Ribosomal protein 2.539 YDR064W 13 RPL19B Ribosomal protein 2.077 YBL027W 14 LSP1 Primary component of eisosomes 1.820 YPL004C 15 RPS18B Ribosomal protein 1.813 YML026C 16 MHP1 Microtubule-associated protein involved in assembly and stabilization of microtubules 1.809 YJL042W 17 TDH2 Glyceraldehyde-3-phosphate dehydrogenase, isozyme 2, involved in glycolysis and gluconeogenesis 1.750 YJR009C 18 RPS15 Ribosomal protein 1.733 YOL040C 19 RPS25A Ribosomal protein 1.729 YGR027C 20 RPS24B Ribosomal protein 1.625 YIL069C 21 RPL17B Ribosomal protein 1.569 YJL177W 22 HRK1 Protein kinase implicated in activation of the plasma membrane H(+)-ATPase Pma1p in response to glucose metabolism 1.524 YOR267C 23 YDL025C Putative protein kinase, potentially phosphorylated by Cdc28p 1.522 YDL025C 24 GPD2 NAD-dependent glycerol 3-phosphate dehydrogenase 1.456 YOL059W 25 YNL208W Protein of unknown function; may interact with ribosomes, based on co-purification experiments 1.443 YNL208W 92 # Name Description Ratio Accession number 26 SAM1 S-adenosylmethionine synthetase, catalyzes transfer of the adenosyl group of ATP to the sulfur atom of methionine 1.434 YLR180W 27 RPL5 Ribosomal protein 1.405 YPL131W 28 SSB2 Cytoplasmic ATPase that is a ribosome-associated molecular chaperone, functions with J-protein partner Zuo1p 1.376 YNL209W 29 RPL31A Ribosomal protein 1.359 YDL075W 30 SSA1 ATPase involved in protein folding and nuclear localization signal (NLS)-directed nuclear transport 1.356 YAL005C 31 RPL20A Ribosomal protein 1.349 YMR242C 32 RPS3 Ribosomal protein 1.303 YNL178W 33 TDH3 Glyceraldehyde-3-phosphate dehydrogenase, isozyme 3, involved in glycolysis and gluconeogenesis 1.257 YGR192C 34 RPS26B Ribosomal protein 1.256 YER131W 35 RPS22A Ribosomal protein 1.248 YJL190C 36 YEF3 Translational elongation factor 3 1.247 YLR249W 37 SSE1 ATPase that is a component of the heat shock protein Hsp90 chaperone complex 1.191 YPL106C 38 CDC19 Pyruvate kinase, functions as a homotetramer in glycolysis to convert phosphoenolpyruvate to pyruvate 1.153 YAL038W 39 TSA1 Ubiquitous housekeeping thioredoxin peroxidase 1.151 YML028W 40 SRO9 Cytoplasmic RNA-binding protein that associates with translating ribosomes 1.137 YCL037C 41 RPS20 Ribosomal protein 1.121 YHL015W 42 HBT1 Substrate of the Hub1p ubiquitin-like protein that localizes to the shmoo tip (mating projection) 1.102 YDL223C 43 RPL14B Ribosomal protein 1.080 YHL001W 44 RPL9B Ribosomal protien 1.074 YNL067W 45 EFT1 Elongation factor 2 (EF-2), also encoded by EFT2 1.053 YOR133W 46 RPL25 Ribosomal protein 1.037 YOL127W 47 DLD3 D-lactate dehydrogenase 1.031 YEL071W 48 RPL7A Ribosomal protein 1.024 YGL076C 49 CDC33 Cytoplasmic mRNA cap binding protein 1.020 YOL139C 93 # Name Description Ratio Accession number 50 SNF4 Activating gamma subunit of the AMP-activated Snf1p kinase complex (contains Snf1p and a Sip1p/Sip2p/Gal83p family member) 1.001 YGL115W 51 RPL38 Ribosomal protein 0.951 YLR325C 52 RPS1B Ribosomal protein 0.949 YML063W 53 TEF1 TEF1 SGDID:S000006284, Chr XVI from 700592-701968, Verified ORF,Translational elongation factor EF-1 alpha; also encoded by TEF2; functions in the binding reaction of aminoacyl-tRNA (AA-tRNA) to ribosomes 0.942 YPR080W 54 SNF1 AMP-activated serine/threonine protein kinase found in a complex containing Snf4p and members of the Sip1p/Sip2p/Gal83p family 0.933 YDR477W 55 ADH1 Alcohol dehydrogenase 0.917 YOL086C 56 PNC1 Nicotinamidase that converts nicotinamide to nicotinic acid as part of the NAD(+) salvage pathway 0.898 YGL037C 57 RPS28A Ribosomal protein 0.898 YOR167C 58 DED1 ATP-dependent DEAD (Asp-Glu-Ala-Asp)-box RNA helicase, required for translation initiation of all yeast mRNAs 0.894 YOR204W 59 YCK2 Palmitoylated, plasma membrane-bound casein kinase I isoform; 0.878 YNL154C 60 SHM2 Cytosolic serine hydroxymethyltransferase, involved in one-carbon metabolism 0.862 YLR058C 61 SCD6 Protein containing an Lsm domain, may bind RNA and have a role in RNA processing 0.859 YPR129W 62 RPL12A Ribosomal protein 0.858 YEL054C 63 PDC1 Major of three pyruvate decarboxylase isozymes 0.856 YLR044C 64 RPS7B Ribosomal protein 0.822 YNL096C 65 PHO8 Repressible alkaline phosphatase, a glycoprotein localized to the vacuole 0.818 YDR481C 66 NMA1 Nicotinic acid mononucleotide adenylyltransferase, involved in NAD(+) salvage pathway 0.799 YLR328W 67 RPS7A Ribosomal protein 0.785 YOR096W 68 GAL83 One of three possible beta-subunits of the Snf1 kinase complex, 0.767 YER027C 69 GPM1 Tetrameric phosphoglycerate mutase 0.725 YKL152C 70 PRL30 Ribosomal protein 0.723 YGL030W 71 RPP0 Ribosomal protein 0.717 YLR340W 72 ACT1 Actin, structural protein involved in cell polarization 0.692 YFL039C 94 # Name Description Ratio Accession number 73 RPS14A Ribosomal protein 0.6917 YCR031C 74 MBF1 Transcriptional coactivator that bridges the DNA-binding region of Gcn4p and TATA- binding protein Spt15p 0.672 YOR298C-A 75 STM1 Protein that binds G4 quadruplex and purine motif triplex nucleic acid; acts with Cdc13p to maintain telomere structure 0.672 YLR150W 76 RPS27B Ribosomal protein 0.662 YHR021C 77 SUI1 Translation initiation factor eIF1; component of a complex involved in recognition of the initiator codon 0.655 YNL244C 78 PGK1 3-phosphoglycerate kinase 0.653 YCR012W 79 RPL22A Ribosomal protein 0.576 YLR061W 80 AHP1 Thiol-specific peroxiredoxin, reduces hydroperoxides to protect against oxidative damage 0.567 YLR109W 81 ENO2 Enolase II 0.524 YHR174W 82 RPP2B Ribosomal protein 0.401 YDR382W 83 FBA1 Fructose 1,6-bisphosphate aldolase 0.377 YKL060C 84 RPS0B Ribosomal protein 0.1215 YLR048W

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0072417/manifest

Comment

Related Items