UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Identification of membrane-interacting proteins and membrane protein interactomes using Nanodiscs and… Zhang, Xiao Xiao 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2012_spring_zhang_xiaoxiao.pdf [ 12.85MB ]
Metadata
JSON: 24-1.0072417.json
JSON-LD: 24-1.0072417-ld.json
RDF/XML (Pretty): 24-1.0072417-rdf.xml
RDF/JSON: 24-1.0072417-rdf.json
Turtle: 24-1.0072417-turtle.txt
N-Triples: 24-1.0072417-rdf-ntriples.txt
Original Record: 24-1.0072417-source.json
Full Text
24-1.0072417-fulltext.txt
Citation
24-1.0072417.ris

Full Text

Identification of membrane-interacting proteins and membrane protein interactomes using Nanodiscs and proteomics  by Xiao Xiao Zhang  B.Sc., Queen’s University, 2008  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Biochemistry and Molecular Biology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  November 2011  © Xiao Xiao Zhang, 2011  Abstract The insoluble nature of membrane proteins has complicated the identification of their interactomes. The Nanodisc has allowed the membrane and membrane proteins to exist in a soluble state. In this thesis, we combined Nanodisc and proteomics and applied the technique to discover the interactome of membrane proteins. Using the SecYEG and MalFGK membrane complex incorporated into Nanodisc, we identified, Syd, SecA, and MalE. These interactions were identified with high specificity and confidence from total soluble protein extracts. The protein YidC was also tested but no interactors were detected. Overall, these results showed that the technique can identify periplasmic and cytosolic interacting partners with high degree of specificity. In a second approach, the method was applied to detect proteins with high affinity for lipid using S. cerevisiae as a model organism. Using Nanodiscs containing different types of phospholipids, many known lipid interactors were identified, including: Ypt1, Sec4, Vps21, Osh6, and Faa1. Interestingly, Caj1 was identified as a PA specific interactor and this interaction was found to be pH dependent. Liposome sedimentation assay showed that Caj1 has affinity for acidic phospholipids. In vivo analysis confirmed the plasma membrane localization of N’-GFP-Caj1 and specifically to the yeast buds. However, pH dependent localization was not observed. Together, with the in vivo and in vitro results suggests that Caj1 is an acidic phospholipid interacting protein.  ii  Preface The proteomic aspect of this thesis was done in collaboration with the laboratory of Dr. Leonard Foster. The trypsin digestion and STAGE-tip purification were performed by me. The injection of the peptides onto the mass spectrometer was performed by technicians (Yuan Fang, Isabelle Kelly, Amy Tam, and Jenny Moon) in the Foster lab. Yeast genetic and microscopy work in Chapter 3 were performed with John Shin in the laboratory of Dr. Christopher Loewen, where he showed me the basic principles of yeast genetics and the operation of the microscope. The work presented in Chapter 2 was conducted with Dr. Catherine Chan, Huan Bao and Yuan Fang. I performed 90 % of the experiments. Dr. Chan was responsible for the initial experimental ideas and performed the SILAC experiments with Nanodisc SecYEG made with phosphatidylglycerol. Nanodisc MalFGK was provided by Huan Bao. All of the SecYEG used were purified by Jean-François Montariol. Yuan Fang helped with the injection of the peptides onto the mass spectrometer. Manuscript of this work is accepted for publication in the jounal of proteomics reserach where I am co-authors with Dr. Catherine Chan, Huan Bao and Yuan Fang.  iii  Table of contents Abstract.................................................................................................................................... ii Preface..................................................................................................................................... iii Table of contents .................................................................................................................... iv List of tables.......................................................................................................................... viii List of figures.......................................................................................................................... ix List of abbreviations .............................................................................................................. xi Acknowledgements .............................................................................................................. xiii Dedication ............................................................................................................................. xiv Chapter 1: Introduction ........................................................................................................ 1 1.1  Nanodisc ................................................................................................................... 1  1.2  Mass spectrometry based proteomics ....................................................................... 3  1.2.1  Tandem mass spectrometry, LTQ-Orbitrap .......................................................... 3  1.2.2  SILAC (stable-isotope labelling with amino acids in cell culture)....................... 3  1.3  Overview of the technique ........................................................................................ 4  Chapter 2: Membrane protein interactome in Escherichia coli ........................................ 6 2.1  Introduction............................................................................................................... 6  2.1.1  The Sec translocon and its interacting partners .................................................... 6  2.1.2  The membrane protein insertase ........................................................................... 8  2.1.3  The maltose transporter......................................................................................... 8  2.1.4  Aims...................................................................................................................... 9  2.2 2.2.1  Materials and methods .............................................................................................. 9 Materials ............................................................................................................... 9  iv  2.2.2  Cloning................................................................................................................ 10  2.2.2.1  Polymerase chain reaction conditions......................................................... 10  2.2.2.2  Site-directed mutagenesis ........................................................................... 10  2.2.3  Syd expression .................................................................................................... 11  2.2.4  YidC expression.................................................................................................. 12  2.2.5  Membrane protein purification ........................................................................... 12  2.2.6  Nanodisc reconstitution ...................................................................................... 13  2.2.7  Stable isotope labelling with amino acids in cell culture (SILAC) .................... 14  2.2.8  Nickel affinity pulldown ..................................................................................... 15  2.2.9  In solution proteolytic digestion ......................................................................... 15  2.2.10  Stage-tip (Stop-and-go-extraction-tips) purification....................................... 15  2.2.11  Analysis of mass spectrometry data................................................................ 16  2.3  Results..................................................................................................................... 17  2.3.1  YidC purification ................................................................................................ 17  2.3.2  Nanodisc reconstitutions ..................................................................................... 19  2.3.3  SILAC cultures ................................................................................................... 20  2.3.4  Nickel affinity pulldown with SILAC protein extract ........................................ 20  2.3.5  The SecYEG interactome ................................................................................... 21  2.3.6  MalFGK interactome .......................................................................................... 24  2.3.7  YidC interactome ................................................................................................ 27  2.3.8  Summary ............................................................................................................. 28  Chapter 3: Identification of the peripherally-bound membrane proteins in Saccharomyces cerevisiae...................................................................................................... 29  v  3.1  Introduction............................................................................................................. 29  3.1.1  Membrane phospholipids in S. cerevisiae .......................................................... 29  3.1.2  Lipid interacting proteins in yeast....................................................................... 30  3.1.3  Phosphatidic acid ................................................................................................ 32  3.2  Materials and methods ............................................................................................ 34  3.2.1  Materials ............................................................................................................. 34  3.2.2  Empty Nanodisc reconstitution........................................................................... 34  3.2.3  Yeast growth conditions (SILAC) ...................................................................... 35  3.2.4  Caj1 cloning ........................................................................................................ 35  3.2.5  Caj1 expression................................................................................................... 36  3.2.6  Caj1 purification ................................................................................................. 36  3.2.6.1  Caj1-His6 purification ................................................................................. 36  3.2.6.2  Non-tagged Caj1 purification ..................................................................... 37  3.2.7  Nickel affinity pulldown ..................................................................................... 37  3.2.8  Liposome preparation ......................................................................................... 38  3.2.9  Liposome sedimentation assay ........................................................................... 38  3.2.10  N- and C- terminal GFP-tagged Caj1 ............................................................. 38  3.2.10.1  Yeast transformation ............................................................................... 40  3.2.10.2  Gene crossing.......................................................................................... 40  3.2.11 3.3  Confocal fluorescence microscopy ................................................................. 40  Results..................................................................................................................... 41  3.3.1  Nickel affinity pulldown ..................................................................................... 41  3.3.2  Lipid binding proteins identified ........................................................................ 41  vi  3.3.3  Purification of Caj1............................................................................................. 46  3.3.4  Verification of Caj1-PA interaction using Nanodiscs and liposomes ................ 48  3.3.4.1 3.3.5  Effect of pH on the binding of Caj1 to PA ................................................ 50  Measure of the Caj1-PA interaction in intact cells ............................................. 52  Chapter 4: Discussion .......................................................................................................... 58 4.1  The membrane protein interactome in E. coli......................................................... 58  4.2  The membrane interactome in S. cerevisiae ........................................................... 59  Chapter 5: Conclusion......................................................................................................... 64 5.1  Address the aims of project..................................................................................... 64  5.2  Future Directions .................................................................................................... 64  References .............................................................................................................................. 66 Appendices............................................................................................................................. 71 Appendix A Primers ........................................................................................................... 71 Appendix B E. coli mass spectrometry results summary ................................................... 72 Appendix C S. cerevisiae mass spectrometry results summary.......................................... 84  vii  List of tables Table 2.1 Polymerase chain reaction program........................................................................ 10 Table 2.2 Summary of the top ten proteins identified with Nd-SecYEG ............................... 22 Table 2.3 Summary of the top ten proteins identified with Nd-MalFGK............................... 25 Table 2.4 Summary of the top ten proteins identified with Nd-YidC .................................... 27 Table 3.1 Phospholipid composition of S. cerevisiae ............................................................. 29 Table 3.2 Yeast strains used in this study ............................................................................... 34 Table 3.3 Plasmids used in this study ..................................................................................... 34 Table 3.4 Top ten non-ribosomal proteins identified with empty Nanodiscs ......................... 43 Table A.1 Primers used in this study ...................................................................................... 71 Table B.1 Complete list of proteins identified with Nd-YEG containing E. coli total lipid extract...................................................................................................................................... 72 Table B.2 Complete list of proteins identified with Nd-YEG containing PG lipids .............. 74 Table B.3 Complete list of proteins identified with Nd-MalFGK using glucose cultured SILAC extract ......................................................................................................................... 76 Table B.4 Complete list of proteins identified with Nd-MalFGK using maltose cultured SILAC extract ......................................................................................................................... 79 Table B.5 Complete list of proteins identified with Nd-YidC................................................ 82 Table C.1 Complete list of proteins identified with Nd-Ec .................................................... 84 Table C.2 Complete list of proteins identified with Nd-PE.................................................... 87 Table C.3 Complete list of proteins identified with Nd-PEPA (50:50).................................. 89  viii  List of figures Figure 1.1 Schematic of Nanodiscs .......................................................................................... 2 Figure 1.2 General experimental scheme involved in MS-based proteomics .......................... 5 Figure 2.1 SecYEG and its interacting partners........................................................................ 7 Figure 2.2 YidC purification................................................................................................... 18 Figure 2.3 Nanodisc reconstitutions ....................................................................................... 19 Figure 2.4 Nanodisc pulldown with Syd................................................................................. 20 Figure 2.5 Summary of SILAC ratios for proteins identified to interact with Nanodiscs SecYEG................................................................................................................................... 23 Figure 2.6 Summary of SILAC ratios for proteins identified to interact with Nanodisc MalFGK .................................................................................................................................. 26 Figure 2.7 Summary of SILAC ratios for proteins identified to interact with Nanodisc YidC ................................................................................................................................................. 28 Figure 3.1 Different types of interaction between peripheral membrane proteins and the membrane................................................................................................................................ 31 Figure 3.2 Simple representation of the electrostatic/hydrogen bond switch model. ............. 33 Figure 3.3 Strategy for GFP-tagged Caj1 construction. ......................................................... 39 Figure 3.4 Summary of SILAC ratios for proteins identified to interact with Nanodisc Ec, PE and PEPA. ............................................................................................................................... 44 Figure 3.5 The acidic and basic map of the Caj1 protein ....................................................... 45 Figure 3.6 Purifiaction of His6-tagged and non-tagged Caj1.................................................. 47 Figure 3.7 Binding of Caj1 to acidic phospholipids with Nanodsics and liposomes. ............ 49 Figure 3.8 pH-dependent binding of Caj1 to PA in Nanodiscs and liposomes ...................... 51  ix  Figure 3.9 Localization of C- and N- terminal GFP-tagged Caj1 in yeast cells ..................... 52 Figure 3.10 Effect of pH on Caj1 localization ........................................................................ 54 Figure 3.11 Overexpression of Dgk1 and Pah1 and effect on the localization of Caj1 .......... 56 Figure 3.12 Interaction of Caj1 with acidic phospholipids..................................................... 57  x  List of abbreviations ABC ATP CL DDM DNA Ec EDTA ER ESI GDI GDP GFP GTP IPTG LB LTQ m/z mPA MS MS/MS MSP Nd-Ec Nd-MalFGK Nd-PE Nd-PEPA Nd-PG Nd-SecYEG Nd-YidC OD ORD OSBP PA PAGE PC PCR PDB PE PG PH pHi PI PI4P PIP PMSF  ATP binding cassette adenosine triphosphate cardiolipin n-Dodecyl β-D-maltopyranoside deoxyribonucleic acid E. coli total lipid extract ethylenediaminetetraacetic acid endoplasmic reticulum electrospray ionization Rab GDP dissociation inhibitor guanosine diphosphate green fluorescence protein guanosine triphosphate isopropyl-β-D-thiogalactopyranosid luria broth linear trapping quadrupole mass-to-charge ratio methyl phosphotidic acid (1,2-Dioleoyl-sn-Glycero-3-phosphomethanol) mass spectrometry tandem mass spectrometry membrane scaffold protein Nanodisc E. coli total lipid extract Nanodisc MalFGK Nanodisc phosphatidylethonalamine Nanodisc phosphatidylethonalamine and phosphatidic acid Nanodisc phosphatidylglycerol Nanodisc SecYEG Nanodisc YidC optical density OSBP related domain oxysterol binding protein phosphatidic acid polyacylamine gel electrophoresis phosphatidylcholine polymerase chain reaction protein data bank phosphatidylethonalamine phosphatidylglycerol pleckstrin homology intracellular cytosolic pH phosphatidylinosotol phosphatidylinositol-4-phosphate phosphoinositides phenylmethanesulfonyl fluoride xi  PS PX domain SDS SILAC TMS  phosphatidylserine phosphoinositide binding domain sodium dodecyl sulfate stable labelling with amino acids in cell culture transmembrane segments  xii  Acknowledgements There are many people to thank, without them this thesis would not be possible. First and foremost I would like to thank my supervisor Dr. Franck Duong for the opportunity to complete my Master’s training in your lab. You have provided me with such excellent lab environment and project. Your generous guidance had thought me to think deeper and more critical. I also like to thank my committee members, Dr. George Mackie and Dr. Leonard Foster, and my external examiner, Dr. Christopher Loewen, for their valuable advice on my project. I received training of proteomic techniques with funding from British Columbia Proteomics Network. My fellow lab members had made the everyday work more enjoyable. Especially, Dr. Catherine Chan, Dr. Hai-Tuong Le and Jean-François Montariol, who had not only helped me on different aspects of my project but also, had become good friends. Fellow students Kush Dalal, Huan Bao, Allan Mills, John Shin, Spencer MacDonald and Sung-hoon Choi, had given me many helpful suggestions. I thank my grandparents for inspiring to become a scientist. Finally, I would like to thank my parents for bringing me to this country. They had left behind many things to come to Canada and it has been challenging for them to adapt to the new country, but they had done it for my future. I thank them for their unconditional love.  xiii  Dedication  To my family  xiv  Chapter 1: Introduction About 30 % of the coding region of the human genome encodes membrane proteins (1). This class of proteins plays important roles in many biological processes, such as signal transduction, protein trafficking, and energy production (2). Various diseases and conditions are related to changes or mutations in membrane proteins, such as Alzheimer’s, cystic fibrosis, and multi-drug resistance; therefore, it is essential to study and understand membrane proteins and their interacting partners. However, membrane proteins are difficult to work with due to their membrane-bound location and their insoluble nature in aqueous solution. Many of the technologies available today to study protein interactions, such as coimmunoprecipitation and the yeast two-hybrid system, are not suitable for membrane proteins (3). These problems are partially overcome by the use of detergent micelles and artificial liposomes but these systems are not ideal to study membrane proteins. Detergent can denature proteins and destabilize their interactions, whereas liposomes are heterogeneous in size and often promote non-specific protein associations. These limitations hinder any efforts in understanding the membrane proteome network and limit the application of high throughput technology aimed at identifying binding partners of membrane and membrane proteins. Novel and more adapted methods are required to effectively examine the membrane interactome.  1.1 Nanodisc The phospholipid bilayer Nanodisc is a soluble particle, about 10 nanometers in diameter, consisting of two amphipathic membrane scaffold proteins (MSP), wrapped around a patch of phospholipid bilayer with or without a membrane protein in the middle (4) (Fig. 1.1). The Nanodisc allows a membrane protein to exist in solution without the presence of  1  detergent. This allows the study of membrane proteins in an environment similar to native membranes. Nanodisc technology has been successfully employed for studying bacteriorhodopsin (5), cytochromes P450 (6), and the beta2-adrenergic receptor (7). In our lab, the reconstitution of the SecYEG complex into Nanodiscs has been optimized and applied to investigate the interaction of SecYEG with SecA and Syd. These earlier successes had led me to propose that Nanodisc can provide a novel method to identify and characterize the membrane protein interactome.  Figure 1.1 Schematic of Nanodiscs Green belts represent MSPs which wraps around a patch of lipid bilayer with (left) or without (right) membrane protein in the middle.  2  1.2 Mass spectrometry based proteomics In recent years, mass spectrometry has become a method of choice for analyzing complex protein samples, especially in the study of protein-protein interactions via affinity based isolations. A mass spectrometer consists of three main components: an ion source, a mass analyzer which measures the mass-to-charge ration (m/z) of charged particles, and a detector. Methods of mass spectrometry have quickly evolved with the development for different ionization techniques. Newer instruments are developed to improve the sensitivity, resolution, and mass accuracy of each experiment. 1.2.1 Tandem mass spectrometry, LTQ-Orbitrap One of the advantage of using tandem mass spectrometry (MS/MS) is the ability to generate information-rich ion mass spectra from peptide fragments. MS/MS refers to the use of two different mass spectrometers which produces two sequential mass spectra. The instrument employed in this study is a linear trapping quadrupole (LTQ)-Orbitrap. The tryptic digested peptides are separated by liquid chromatography connected to an electrospray ionization (ESI) source. This process allows the peptides to appear at the outlet at different times thus reduces the effective complexity of the sample. The peptides are ionized into the gas phase and passed through a quadruple followed by orbitrap mass analyzer. The LTQ-Orbitrap provides high accuracy (1-2ppm), resolution and dynamic range (8) which reduces overlapping peaks and produces information-rich mass spectra. 1.2.2 SILAC (stable-isotope labelling with amino acids in cell culture) The field of proteomics had developed from largely qualitative to quantitative which allows the comparison of relative protein abundance between two proteomes. SILAC is a simple and powerful approach to quantitative proteomics. In this method, stable isotope  3  labels, such as  13  C-labelled arginine, are introduced in the growth media of living cells,  which results in the whole proteome to become stable isotope-labelled. The protein profiles of the labelled and the non-labelled are virtually identical with mass differences that can only be detected via a mass spectrometer. The ratio of signal intensities of the analyte pairs indicates their relative abundance. It allows a control and a test sample to be handled and processed in the same manner and even in the same reaction tubes, which reduces an y variation that could be introduced during sample processing. While various labels, such as 15  N-labelling, can be used in the labeling process, arginine and lysine are used in this study.  One of the advantages of using these two amino acids is, with trypsin digest every peptide excluding the carboxyl-terminal peptides of the protein will contain at least one label. To achieve complete SILAC labelling, auxotrophic strains such as Arg-/Lys- double auxotrophic yeast (9), is usually required.  1.3 Overview of the technique The technique employed in this study combines Nanodisc with SILAC proteomics. Total soluble protein extracts obtained from SILAC cultures were used as preys and Nanodisc were used as baits. After reisolation of the discs, the elutes were combined and proteolysed by trypsin then injected onto a liquid chromatography with an electrospray outlet, followed by mass spectrometry analysis. The isolated co-proteins were identified via data base search of the peptide fragment and quantified via their SILAC labels. An overview of the experimental procedure is presented in Figure 1.2. By combining Nanodisc, SILAC and tandem mass spectrometry, the method is predicted to be sensitive enough to detect specific interactions even with those less abundant proteins.  4  Figure 1.2 General experimental scheme involved in MS-based proteomics Soluble protein extract obtained from SILAC cultures were used in Nickel affinity pulldown with appropriate Nanodiscs as baits. The elute samples were combined and digested with trypsin. Digested peptides were subjected to MS analysis.  5  Chapter 2: Membrane protein interactome in Escherichia coli 2.1 Introduction 2.1.1  The Sec translocon and its interacting partners The SecY complex/channel/translocon is the universal protein translocation channel  which catalyzes protein transport across membranes (10). In bacteria, it is composed of three subunits, SecY, SecE and SecG, where SecYE form the core of the protein conducting channel and SecG serves as a stimulatory subunit associated with the core channel (11). SecY is the largest subunit of the protein-conducting channel with a molecular weight of 48 kDa. The SecY subunit consists of 10 transmembrane segments (TMSs) with the N- and Cterminal ends in the cytosol (12). SecE is a smaller integral membrane protein with a mass of 14 kDa and consists of 3 TMSs (13). SecG has a mass of 12 kDa with 2 TMSs (14). This subunit is non-essential and functions to stimulate SecYE-mediated protein translocation and SecA ATPase (11). The crystal structure of the SecY complex (Fig. 2.1) reveals a region of loops and helices that extends into the cytosol (15) where the SecY channel establishes transient interactions with its cytosolic partners. In Figure 2.1, three interactions are highlighted. First, the translating ribosome docks at this region of the SecY complex and feeds the newly synthesized peptide through the channel (16). Second, the SecA ATPase has high affinity for the SecY complex and acidic phospholipids. In E. coli, SecA is a large 102 kDa protein that provides energy via ATPase hydrolysis which drives the translocation of protein across the inner membrane (17). Third, Syd, a small 22 kDa protein, also interacts with the SecY complex at this region to control its assembly (18).  6  Figure 2.1 SecYEG and its interacting partners Structure of the protein conduction channel (A) with its cytoplasmic interacting region highlighted. Structures of three of the SecYEG interacting partners are shown: the ribosome (B), Syd (C) and SecA (D). PDB IDs for SecY channel, ribosome, Syd, and SecA are 1RHZ, 3J01, 3FFV, and 2FSF respectively. Structures are not to scale.  7  2.1.2  The membrane protein insertase In bacteria, another important component of protein transport is the insertase YidC. It  is an essential membrane protein which facilitates insertion and assembly of many inner membrane proteins (19). Studies have shown that YidC interacts with transmembrane helices of membrane proteins after their release from the SecYEG translocon (20). It is not known how YidC releases membrane proteins and whether it associates with other proteins during the insertion reaction. In E. coil, YidC has a molecular mass of ~ 62 kDa with predicted 6 TMSs. The topology map of YidC reveals a large, 35 kDa, periplasmic loop (P1) at the Nterminus of the protein (21). The crystal structure of the P1 domain suggests that YidC may interact with periplasmic chaperones that aid in protein folding and secretion following insertion into the membrane (22). However, these interacting partners have yet to be identified. 2.1.3 The maltose transporter The MalFGK complex is an ATP binding cassette (ABC) transporter involved in the transport of maltose to accommodate the dynamic lifestyle of E. coli. The complex comprises of two integral membrane subunits, MalFG, and two MalK ATPase subunits attached from the cytoplasmic side. In the absence of glucose but presence of maltose, the operons controlling expression of genes involved in maltose transport are turned on by their transcription activator MalT (23). Together with the periplasmic maltose-binding protein MalE, MalFGK coordinates the transport of maltose from the periplasm into the cytoplasm (24). Other known proteins that associate with MalFGK include MalT and EIIA. Previous studies show that MalT binds free MalK in vitro and it is believed that the majority of MalT binds to only the inactive MalFGK complex in vivo (25-26). EIIA is part of the  8  phosphoenolpyruvate-sugar phosphotransferase system serves to inhibit maltose transport in the presence of glucose (28). This interaction has not been observed directly but has been implicated through peptide arrays (27-28). 2.1.4 Aims The interactome of three membrane proteins will be examined using the techniques described in Chapter 1. The SecYEG and MalFGK complexes will serve as models for the development and optimization of the method followed by the application of the technique to YidC. Since the interactors of YidC are unknown, novel interacting partners of this protein could potentially be identified.  2.2 Materials and methods 2.2.1 Materials All salts and solvents were obtained from Fisher Scientific (Hampton, NH). All enzymes used in molecular cloning procedures were purchased from New England Biolabs, Inc (Ipswitch, MA). The following materials were obtained as indicated: Primer oligos – Life Technologies (Carlsbad, CA); phospholipids – Avanti Polar Lipids Inc. (Alabaster, AL); natural amino acids, dithiothreitol and iodoacetamide – Sigma-Aldrich (Oakville, ON); isotopically labelled lysine and arginine – Cambridge Isotope Laboratories (Andover, MA); sequencing grade trypsin – Roche (Laval, QC, Canada); Bio-Beads® SM2 Adsorbent – BioRad (Hercules, CA); n-Dodecyl-β-D-Maltopyranoside (DDM) – Affymetrix (Santa Clara, CA); All purification columns and beads – GE Healthcare (Pittsbourgh, PA); ampicillin, arabinose and phenylmethanesulfonyl fluoride (PMSF) – Fisher Scientific.  9  2.2.2 Cloning The construct pET23a-Syd-Myc-His6 was already available in the laboratory. A stop codon was placed just before the hexa-histidine tag to remove the His-tag using site-directed mutagenesis. The primers are listed in appendix A. 2.2.2.1 Polymerase chain reaction conditions  For each polymerase chain reaction (PCR) approximately 0.5 µg of template, 10 pmol  of primers, 2-5 mM magnesium chloride, 0.2 mM dNTPs and 1 U of Phusion™ DNA polymerase were mixed together in the recommended buffer (to a final volume of 50 µl). The reaction was performed in 0.2 ml thin wall PCR tubes (Axygen) with an Eppendorf Mastercycler 5332 thermomulticycler under the conditions listed below.  Table 2.1 Polymerase chain reaction program Step Temperature Time 1 95 ºC 4 min 2 95 ºC 1 min 3 Tanneal = (Tm – 7 ºC) 0.5 min 4 72 ºC Amplification time depends on the length of the product (~1 kb/min) 5 Go to step 2 Repeat 25 – 30 times 6 72 ºC 5 min 7 16 ºC Hold 2.2.2.2 Site-directed mutagenesis  The volume of the PCR reaction for site-directed mutagenesis was 25 µl. A small  amount (5 µl) of the amplified PCR product was analyzed on a 1.0 % agarose gel in TBE buffer (89 mM Tris, 89 mM Borate and 2 mM EDTA) to ensure there were amplified products. Then 5 µl of the PCR reaction were incubated with 10 units of Dpn1 in 1X NEBuffer 4 (20 mM Tris-acetate, 50 mM potassium acetate, 10 mM Magnesium Acetate,  10  1 mM Dithiothreitol pH 7.9) for 2 hours at 37 ºC to remove parental DNA strands which do not contain the mutation. The digested material was separated on a 1 % agrose gel. The desired product was excised under low intensity UV lamp and purified using an EconoSpin™ silica membrane spin column for DNA (Epoch Life Science). The digested PCR product was then transformed into competent DH5α cells and cells were plated on selective ampicilin LB agar (29). The insertion of the stop codon disrupted a XhoI restriction enzyme digestion site. To test this, the plasmids were digested with 6 units of XhoI in 1 X NEBuffer 4 for 30 min at 37 ºC. The correct plasmid was verified by sequencing through Eurofin MWG Operon. 2.2.3 Syd expression Construct pET23a-Syd-myc was transformed into E. coli strain BL21 (DE3) for protein expression. Cells were grown overnight at 37 ºC in 30 mL of luria broth (LB) medium with 80 µg/L of ampicillin. The next day culture was diluted into 3 L of fresh medium. The cells were incubated at 37 ºC with agitation until the O.D. 600 reached 0.5. The cultures were induced with 0.5 mM IPTG and grown for two more hours before harvesting. Cells were centrifuged for 10 min at 5,000 g (Beckman JLA 10.5 rotor). Pellets were suspended in buffer A (50 mM Tris pH 7.9, 100 mM sodium chloride, and 10 % v/v glycerol) and protease inhibitor was added before lysis. The cells were passed through a 30 ml French ® pressure cell press at 12,000 psi three times to ensure complete cell lysis. The lysate was centrifuged at low speed, 10 min at 7,000 g (Beckman JA 25.5 rotor), to remove cell debris, unbroken cells and large inclusion bodies. Then the supernatant was ultracentrifuged for 45 min at 200,000 g (Beckman Type 60 Ti rotor) at 4 ºC. The supernatant containing the soluble protein fraction was stored at -80 ºC for future analysis.  11  2.2.4 YidC expression Plasmid pBad22 encoding N-terminal His6 tagged YidC gene was available in the lab. E. coli strain BL21 (DE3) containing pBad22 YidC was grown overnight at 37 ºC in 20 ml of LB medium with 80 µg/L of ampicillin. Next day, the culture was diluted into 2 L of fresh LB medium with ampicillin and shaken at 37 ºC. Cells were induced at O.D.600 of 0.4 with 0.2 % v/v arabinose. After three hours of induction, cells were harvested and lysed as described in section 2.2.3. The membrane pellet obtained from the high speed ultracentrifugation was resuspended in buffer A to a final total protein concentration of 10 mg/ml. A final concentration of 1 % v/v DDM was included to solubilize the membrane fraction. The sample was gently rocked overnight at 4 ºC. The material was centrifuged at 200,000 g for 45 min (Beckman Type 60 Ti rotor) at 4 ºC to remove insoluble material and protein aggregates. The supernatant was collected for purification. 2.2.5 Membrane protein purification His6-tagged SecYEG was overexpressed from plasmid pBAD22 and purified as described (30). MalFGK bearing a C-terminal His6-tag on MalK was expressed from pBAD22 and purified as for YidC. A 5 ml column, containing Ni2+ sepharose high performance beads was washed with 50 ml of filtered distilled water at a flow rate of 1 ml/min. The column was then equilibrated with ten column volumes of buffer B (50 mM Tris pH 7.9, 100 mM sodium chloride, 10 % v/v glycerol and 0.03 % DDM). The solubilized membrane fraction containing YidC was passed through a 0.45 micron filter to remove large particles then loaded onto the column. The column was washed in buffer B with 30 mM imidazole. YidC was eluted with buffer B plus 500 mM imidazole. The flow through, wash  12  and eluate were analyzed by SDS-PAGE. The eluted fractions containing pure YidC were pooled. YidC was further purified using size exclusion chromatography. The pooled fractions were injected onto a Superose™ 6 HR10/100 column equilibrated with buffer B at a flow rate of 0.5 ml/min. The elution profile was monitored at 280 nm. Fractions were collected and analyzed by a 4-12 % native gel. The soluble YidC fractions were pooled and concentrated using a 15 ml Amico Ultra Centrifugal Filter (Millipore) with molecular weight cut off of 30,000 Da. The purified protein was stored at -80 ºC. 2.2.6 Nanodisc reconstitution Chloroform-dissolved phospholipids were dried under a stream of nitrogen and placed in a vacuum overnight. Prior to reconstitution, the lipids were resuspended by sonication in TS buffer (50 mM Tris pH 7.9, 50 mM sodium chloride). A final concentration of 0.5 % DDM was added to further solubilize the lipids. To make Nanodiscs, membrane scaffold protein (MSP), purified membrane protein and lipids were mixed together in a certain molecular ratio in buffer A with 0.5 % w/v DDM. This ratio differs for each membrane protein. For Nanodisc SecYEG (Nd-SecYEG), the ratio was 1 nmol of SecYEG to 4 nmol of MSP to 40 nmol of lipids. No lipids were added during the reconstitution of Nanodisc YidC (Nd-YidC) and Nanodisc MalFGK (Nd-MalFGK) and the ratio of protein to MSP was 1:4. One quarter of the total volume of BioBeads® was added and the mixture was gently rocked at 4 ºC overnight to slowly remove the detergent. The beads were removed by passing the mixture through an empty spin column with a cotton filter base. To remove aggregates, liposomes and excess MSP, the sample was injected onto a Superdex™ 200 HR10/200 column equilibrated with buffer A. Peak fractions corresponding  13  to the soluble form of the discs were analyzed by electrophoresis on a 4-2 % blue- or clearnative gel then pooled, concentrated and stored at -80 ºC. 2.2.7 Stable isotope labelling with amino acids in cell culture (SILAC) A lysine auxotroph E. coli strain JW2806 [Δ(araD-araB)567 ΔlacZ4787(::rrnB-3) lambda- ΔlysA763::kan rph-1 Δ(rhaD-rhaB)568 hsdR514], with the LysA knock out, was used to achieve maximal uptake of the isotopic amino acid by the cells. Cells were grown overnight in LB medium at 37 ºC. Next day, the cells were washed three times with fresh M9 minimal medium and added at 1/100 dilution (relative to the original culture volume) into M9 minimal medium supplemented with 2 mM magnesium sulphate, 10 µM calcium chloride, 4 µg/ml vitamin B1, 0.4 % w/v glucose, and 0.2 mg/ml amino acids. Cultures were grown simultaneously each with different labels. The ‘light’ culture contains all 20 naturally abundant amino acids. In the ‘heavy’ culture, the arginine and lysine were replaced with 0.174 mg/ml 13C6, 15N4-arginine (Arg10) and 0.3 mg/ml 13C6 15N2-lysine (Lys8). The cultures were grown for six generations at 37 ºC to ensure the complete incorporation of the labelled amino acids. SILAC labelled E. coli cells were harvested by centrifugation at 5,000 g and the pellets were resuspended in buffer A containing 10 mM protease inhibitor. The cells were passed through a 4 ml French® pressure cell press at 14,000 psi three times for complete cell lysis. Lysates were centrifuged for 10 min at 7,000 g (Bechman JLA 25.5 rotor), then for 45 min at 200,000 g (Beckman TLA 110 rotor). The supernatants (soluble protein fractions) were divided into 100 µl aliquots with final concentration at 20-24 mg/ml and stored at -80 ºC.  14  2.2.8 Nickel affinity pulldown Affinity pulldown of the Nanodiscs was performed using Ni2+-NTA beads. The beads were washed with water and equilibrated with buffer A. About 20 µl of beads as a slush were mixed with 10 µg of Nanodisc or MSP in 500 µl of buffer A and gently rocked for 10 min at room temperature. The mixtures were gently centrifuged at 600 g (Eppendorf centrifuge 5415D) to pellet the beads. Then 1 mg of SILAC labelled soluble protein extract was incubated with the beads in 1 ml of buffer A. The mixture was rocked for 10 min then the samples of ‘light’ and ‘heavy’ were mixed together and washed three times each with 1ml of buffer A containing 50 mM imidazole. The proteins were eluted with 100 µl of buffer A containing 600 mM imidazole. Each eluted sample was analyzed by SDS-PAGE and silver stained and stored at -80 ºC for further analysis. 2.2.9 In solution proteolytic digestion The eluted proteins were mixed with 1 % w/v sodium deoxycholate and 50 mM ammonium bicarbonate and heated for 10 min at 99 ºC. All subsequent incubations were done at 37 ºC. To ensure complete digest, the samples were reduced with 0.5 µg dithiothreitol for 30 min and alkylated with 2.5 µg iodoacetamide for 20 min before 0.5 µg of trypsin was added and incubated for 18 to 20 hours. 2.2.10 Stage-tip (Stop-and-go-extraction-tips) purification To stop the digestion and remove sodium deoxycholate, the pH of the sample was brought down below 2.5 with 1 % trifluoric acid. The mixture was centrifuged for 10 min at 1,000 g (Eppendorf 5415R centrifuge). The supernatant was passed through a C18 column equilibrated with 20 µl methanol then buffer C (3 % v/v acetonitrile, 1 % v/v trifluoric acid, and 0.5 % v/v acetic acid). The column was washed once with buffer C. Peptides were eluted  15  and separated by liquid chromatography on an Agilent 1100 Series HPLC coupled on-line to a LTQ-Orbitrap (Thermo Fisher Scientific, Bremen, Germany) for tandem mass spectrometry analysis. 2.2.11 Analysis of mass spectrometry data The peptide lists generated from the tandem mass spectrometer were searched against a 2007 version of E. coli K12 protein sequence database using Mascot v2.3.01 (Matrix Science, www.matrixscience.com). In a mascot database search, the mass values obtained from the MS/MS analysis are compared with calculated peptide mass obtained by applying cleavage rules to the entries in a comprehensive primary sequence database. Using an appropriate scoring algorithm, the closest match or matches are identified. The search is set up with specific parameters. First, a database is chosen to compare the experimental mass values to the calculated peptide mass (2007 E. coli K12). Second, a cleavage rule is set up. In this case, trypsin was used for peptide digestion; hence, trypsin/proline cleavage with up to one missed cleavage was used, since the digestions are never perfect. Next, the appropriate modifications are specified. There are two types of modifications supported by Mascot, fixed and variable modifications. Fixed modification indicates the modification is applied universally to the residues specified. For example, the cystine carbamidomethyl fixed modification means a mass of 161 Da will be applied to all cystine residues during the calculation. Variable modifications are those may or may not be present. The Mascot program will calculate all the possible combination of the modification to find the best match. For example, the isotopically labelled amino acids are variable modifications that are not present in every peptide. Therefore Mascot will test for a match with the experimental data for that peptide with and without the label. Next, the peptide and MS/MS tolerances are  16  selected where the error windows are set on experimental peptide mass values and MS/MS fragment ion mass values respectively. Finally, the instrument is selected. In this case it was the ESI-TRAP. In this study, the parameters used for Mascot search are: carbamidomethylation (Cys) as fixed modification, oxidation (Met), acetyl (protein) and appropriate SILAC modifications as variable modification. Mass accuracy and ion mass accuracy were set to be 10 ppm and 0.8 Da respectively. Proteins with more than 2 peptides and scores above 25 are considered and quantified by the software MSQuant v1.4.0a17 for their ‘light’ to ‘heavy’ ratio.  2.3 Results 2.3.1 YidC purification The protein YidC was overproduced and purified as described in the methods, Section 2.2.4 and 2.2.5. The fractions collected following Ni-NTA chromatography were analyzed on SDS-PAGE (Fig. 2.2A). The predominant protein species was YidC. However, when analyzed on a blue-native gel, the proteins appeared smeary (data not shown). To exclude the possibility of aggregation, the protein was injected on to a size exclusion column which demonstrates that YidC elutes as a single protein peak (Fig 2.2B) Fractions were analyzed on blue-native-PAGE where YidC appeared as a single band (Fig 2.2C). The final yield is about 1.5 mg/L of culture.  17  Figure 2.2 YidC purification. A. SDS-PAGE analysis of starting material, flow through (FT) and elution fractions of nickel affinity purification of YidC. Purification as performed as in Section 2.2.5. The soluble protein fraction was loaded onto a Ni-NTA column equilibrated in buffer B. The column was washed in buffer B containing 30 mM imidazole and the protein was eluted in 600 mM imidazole. Ten 1 ml fractions were collected from the start of the elution. B. Size exclusion chromatogram of YidC. A Superose™ 6 HR10/100 column equilibrated with buffer B was used. Twelve 400 µl fractions were collected starting at around 4 ml. C. Clear-native-PAGE analysis of peak fractions collected from size exclusion chromatography.  18  2.3.2 Nanodisc reconstitutions Nanodiscs containing MalFGK and YidC were reconstituted without lipids but Nanodisc-SecYEG were prepared with different lipids, one with E. coli total lipid extract (Ec) and one with phosphatidylglycerol (PG). Nanodiscs were reconstituted as in Section 2.2.6. Different lipids were used in the reconstitution because SecYEG requires specific lipid environments for interaction with its partners. Although the reconstitution ratios were optimized to reduce the amount of free MSP and aggregates, it was necessary to purify the disc preparation by size exclusion chromatography as any aggregates or empty discs will interfere with the SILAC experiment. The corresponding native- and SDS-PAGE of the discs are shown in Fig. 2.3.  Figure 2.3 Nanodisc reconstitutions Reconstitutions performed as in Section 2.2.6. A. Three Nanodiscs were purified using size exclusion chromatography and analyzed on 4-2 % Blue-native PAGE. B. Same samples analyzed on 12 % SDS-PAGE. The molecular weights of the protein markers are as indicated.  19  2.3.3 SILAC cultures Initially, the SILAC labelling was done with E. coli strain BL21 (DE3). However, it was found that only arginine was sufficiently labelled. Since trypsin digests polypeptide chains after arginine and lysine residues, problems were created during data analysis as peptides ending with lysine were not quantified. Small proteins which generate few peptides may not be quantified with confidence. Therefore a lysine auxotroph strain was needed. After obtaining the LysA strain from the E. coli Keio knockout collection (31), the labelling efficiency was tested again. The SILAC culture conditions were optimized for minimal usage of the labelled amino acids and maximal protein labelling. Ratios of 1/200, 1/500, and 1/1000 (v/v) of labelled amino acids to culture volume were tested. The ratio 1/500 was chosen, as it is the lowest ratio that still gave sufficient signal for MS detection (data not shown). 2.3.4 Nickel affinity pulldown with SILAC protein extract Syd was used as a control to test the efficiency of the pulldown experiments. Nonpurified Myc-tagged Syd was mixed with soluble protein extract (1/50 v/v) to ensure Syd was a minor species in the mixture. Pulldowns were performed using Nd-SecYEG, empty Nansdisc reconstituted with Ec (Nd-Ec), and beads only as baits. The western blot of the eluted samples indicates that pulldown of Nd-SecYEG was able to isolate Syd out of a cytosolic protein extract (Fig. 2.4).  Figure 2.4 Nanodisc pulldown with Syd Elutions of pulldowns using beads, Nd-Ec, Nd-SecYEG, and the starting material were analyzed by western blot with anti-Myc antibody to detect Syd.  20  During the SILAC pulldown, as described in Section 2.2.8, Nanodisc SecYEG, MalFGK and YidC were used as baits to capture specific prey from the SILAC ‘heavy’ labelled protein extract and MSP was used as control to capture the proteins in the ‘light’ extract. Two to three biological replicas of each pulldown were performed and analyzed. All trypsin digested peptides identified by LC MS/MS were quantified by MSQuant by ‘light’ to ‘heavy’ ratio. SILAC ratios for proteins were generated by taking an average of the peptide ratios corresponding to each protein. Refer to Section 2.2.9, 2.2.10. and 2.2.11 for detailed mass spectrometry procedures 2.3.5 The SecYEG interactome The SecYEG complex was chosen as a model membrane system to validate the technique. Nd-SecYEG with Ec lipids were used as baits in the pulldown. The first ten proteins identified are listed in Table 2.2. Out of a total of 48 proteins identified, 25 proteins had a ratio above one (Appendix B Table B.1 for full list of proteins). Syd was the protein with the highest SILAC ratio of ~27, considerably above the ratio of any other protein identified in this experiment. Since the interaction between Syd and SecYEG has been characterized (18) and Syd is small and not highly expressed in E. coli, the results suggest that the method is working and is highly sensitive. The other five proteins identified below Syd had ratios less than 5 and had no obvious connection to SecYEG. The known SecYEG interacting protein, the ATPase motor SecA, was identified with a SILAC ratio of 1.5 ranking 18 on the list (Table B.1). This was not surprising as previous studies showed that SecA and Syd exhibit competitive binding at a similar surface on SecY, where Syd was shown to out-compete SecA-bound SecYEG in Nanodiscs (18).  21  Since it has previously been shown that acidic phospholipids promote high affinity interactions with SecA and stimulate its ATPase activity (32-33), pulldowns using NdSecYEG reconstituted in the presence of PG lipids were repeated. A total of 97 proteins were identified. The first protein on the list was SecA with a ratio of 35, whereas Syd was found with a ratio of 4.7 at fourth position (Table 2.2). These results support previous observations that acidic phospholipids enhance the affinity of SecA towards SecYEG (18). Furthermore, these results indicate that the technique is able to identify specific known interactors of the SecYEG membrane complex and is sensitive enough to differentiate interactions based on lipid type. Table 2.2 Summary of the top ten proteins identified with Nd-SecYEG Name Description/function Ratioa b SecYEG(Ec) Syd SecY-interacting protein 27 FolE GTP cyclohydrolase I 4.2 GlyA serine hydroxymethyltransferase 3.9 HisB histidine biosynthesis bifunctional protein 3.4 PflB formate acetyltransferase 3.2 FucR L-fucose operon activator 2.8 YqjL uncharacterized protein 2.8 XerC chromosome segregation recombinase 2.7 Crp cAMP receptor protein 1.5 HinT purine nucleoside phosphoramidase 1.2 c SecYEG(PG) SecA preprotein translocase ATPase 35 XerC chromosome segregation recombinase 9.0 DnaJ chaperone/heat shock protein 6.3 Syd SecY-interacting protein 4.7 HinT purine nucleoside phosphoramidase 3.7 FliC flagellin 3.2 LpxA UDP N-Acetylglucosamine Acyltransferase 3.2 Fur ferric uptake regulator 3.0 Crp cAMP receptor protein 2.7 SpeG spermidine acetyltransferase 2.6 a Average of heavy to light ratios for each protein from one to three replicates. b Nanodisc SecYEG made in with E. coli total lipid extract (Ec). c Nanodisc SecYEG made with phosphatidylglycerol (PG).  22  Figure 2.5 Summary of SILAC ratios for proteins identified to interact with Nanodiscs SecYEG Nd-YEG is reconstituted in the presence of E. coli total lipids (Ec) or phosphatidylglycerol (PG), Positions of SecA and Syd are highlighted. Proteins limited to the top 30 for simplicity with complete lists provided in Appendix B Tables B.1 and B.2.  23  2.3.6 MalFGK interactome Ten mal genes, including MalE and MalFGK, are under the positive control of MalT and maltose (34). To examine the MalFGK interactome, SILAC cultures were grown in the presence of maltose and the pulldowns were performed with Nd-MalFGK. A glucose-grown SILAC protein extract was also used as a control. With the glucose-grown extract, 92 proteins were identified. MalE, a known periplasmic interactor of MalFGK, was at the top of list with a SILAC ratio of 4.4. Since the mal genes are turned off in the presence of glucose, little MalE is present in the protein extract. However, the interaction was still detected by mass spectrometry suggesting that the method is very sensitive. Using the maltose-grown SILAC extract, 102 proteins were identified. MalE was the first protein identified with a SILAC ratio of 26. In the presence of maltose, MalE is highly expressed; therefore, the interaction is more easily picked up by mass spectrometry. The fact that MalE was ranked first under both growth conditions regardless of the ratios, indicates that the interaction was not due to the overexpression of the protein. Moreover, the expression of other proteins in the mal gene such as MalQ and MalM was also turned on, but their ratios are not above one. Thus, the growth conditions are important for the identification of interactome for certain membrane proteins. Combined with the SecYEG results, the method can not only detect cytosolic but also periplasmic interactors.  24  Table 2.3 Summary of the top ten proteins identified with Nd-MalFGK Name Description/Function Ratioa MalFGK(glucose)b MalE periplasmic maltose binding protein 4.4 SeqA DNA replication regulation modulator of oriC 3.4 RpsB 30S ribosomal protein S2 2.4 YaeH function unknown, UPF0325 family protein 2.2 PbpG D-alanyl-D-alanine endopeptidase 2.1 Rob right origin-binding protein 1.8 Crp cAMP receptor protein 1.8 NusG transcription antitermination protein 1.5 RlmG 23S rRNA methyltransferase 1.5 XerD chromosome segregation recombinase 1.5 MalFGK(maltose)c MalE periplasmic maltose binding protein 26 YaeH function unknown, UPF0325 family protein 2.4 MinD septum site determination protein 1.6 RpmG 50S ribosomal protein L33 1.2 RpmA 50S ribosomal protein L27 1.1 RpsO 30S ribosomal protein S15 1.1 RpmB 50S ribosomal protein L28 1.0 RpmF 50S ribosomal protein L32 1.0 AmiA N-acetylmuramyl-L-alanine amidase 1.0 Hfq host-factor I protein 0.9 a Average of heave to light peptide ratios for each protein from two replicates. b SILAC cultures grown in the presence of glucose c SILAC cultures grown in the presence of maltose.  25  Figure 2.6 Summary of SILAC ratios for proteins identified to interact with Nanodisc MalFGK Nd-MalFGK pulldowns were performed with prey grown in two different carbon sources, maltose or glucose. Proteins limited to the top 15 identified are shown for simplicity. Complete lists of proteins identified are provided in Appendix B Tables B.3 and B.4. Scales for MalFGK glucose and maltose are identical. Positions of MalE are highlighted.  26  2.3.7 YidC interactome There were 64 proteins identified using Nd-YidC as bait. The top two were XerC and FucR with ratios 5.2 and 5.1 respectively (Table 2.4, Fig. 2.6 and Appendix B Table B.5). XerC belongs to the tyrosine family of site-specific recombinases and functions to convert dimers of E. coli chromosomes into monomers (35). FucR is a positive regulator protein of the L-fucose operon. There are no obvious connections between these two proteins to YidC and they have been identified in the experiments with SecYEG and MalFGK. Since both proteins interact with negatively charged DNA, it is possible that they interact nonspecifically with negatively charged region of the protein. The putative interacting proteins following FucR are mostly involved in metabolic pathways. A recent study analyzed proteins that were cross-linked to YidC in vivo had identified 12 cytosolic proteins, the majority of which are ribosomal proteins, and a few of which are involved in metabolism whose relationship with YidC was not obvious (36) similar to the results of this experiment. Therefore, the results suggest that there were no specific high-affinity interacting partners identified with YidC under the growth conditions of the SILAC cultures.  Table 2.4 Summary of the top ten proteins identified with Nd-YidC Name Description/Function Ratioa XerC chromosome segregation recombinase 5.2 FucR L-fucose operon activator 5.1 GrcA autonomous glycyl radical cofactor 3.9 PflB formate acetyltransferase 3.3 GlyA serine hydroxymethyltransferase 3.2 HinT purine nucleoside phosphoramidase 3.2 FolE GTP cyclohydrolase I 3.0 HisB histidine biosynthesis bifunctional protein 2.7 Rob right origin-binding protein 1.9 PyrI aspartate carbamoyltransferase 1.8 a Average of heavy to light peptide ratios for each protein from three replicates.  27  Figure 2.7 Summary of SILAC ratios for proteins identified to interact with Nanodisc YidC Nd-YidC is used in the pulldown with SILAC extracts. Top 30 proteins identified are shown for simplicity; a complete list is provided in Appendix B Table B.5.  2.3.8  Summary Syd and SecA were identified as specific interactors for Nd-YEG. Using Nd-  MalFGK, MalE was identified. These results indicate that the method, combining Nanodisc and SILAC, is successful in identifying membrane protein interactomes. This method is also sensitive enough to detect different interactors with different lipid environment and growth conditions. No specific interactor was detected for Nd-YidC, which agrees with previous findings (36). The success in the method development allowed the further exploration of the membrane interactome in S. cerevisiae.  28  Chapter 3: Identification of the peripherally-bound membrane proteins in Saccharomyces cerevisiae 3.1 Introduction 3.1.1 Membrane phospholipids in S. cerevisiae Unlike bacteria, yeast cells consist of many specialized cellular compartments which are enclosed by membranes. The plasma membrane separates the cell component from the external media. The mitochondrial membranes serve to produce energy. The endoplasmic reticulum (ER) and Golgi apparatus are involved in protein and lipid synthesis and sorting. The nuclear membrane encloses and protects the DNA. The vacuolar and peroxisomal membranes compartmentalize special metabolic and digestive functions (37). With different functions, the membrane compositions of each compartments are different as well. A study done in 1991 using 2D thin layer chromatography provided detailed characterization of the phospholipid composition in each subcellular compartment in yeast (38). As seen in Table 3.1, phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinosotol (PI), and phosphatidylserine (PS) are the major phospholipids found in yeast, while cardiolipin (CL) and phosphatidic acid (PA) are present in smaller amounts. Table 3.1 Phospholipid composition of S. cerevisiae % compositiona Subcellular compartment PC PE PI PS CL Plasma membrane 16.8 20.3 17.7 33.6 0.2 Secretory vesicles 35 22.3 19.1 12.9 0.7 Vacuoles 46.5 19.4 18.3 4.4 1.6 Nucleus 44.6 26.9 15.1 5.9 <1.0 Peroxisomes 48.2 22.9 15.8 4.5 7.0 ER/Golgi 51.3 33.4 7.5 6.6 0.4 Mitochondria 40.2 26.5 14.6 3.0 13.3 a Data obtained from Zinser et al. 1991 (38).  PA 3.9 1.2 2.1 2.2 1.6 0.2 2.4  Others 6.9 8.8 7.7 4.3 0.5  29  3.1.2 Lipid interacting proteins in yeast The tight regulation of lipid composition in each subcellular compartment suggests that lipids play important role in the function of membrane associated proteins. Many important signaling and trafficking cascades originate at the membrane and are carried out by proteins that can dissociate from the membrane. These class of proteins are known as peripheral membrane proteins. They are amphitropic, often found in the soluble fractions and contain a hydrophobic motif that can associate with the membrane. Several different mechanisms are employed for membrane association by this class of proteins. They may contain exposed hydrophobic surfaces, covalently bound lipid anchors, and/or charged residues which interact with the oppositely charged lipid headgroups (Fig. 3.1). For example, Rab proteins are post-translationally modified with two geranylgeranyl lipid anchors for membrane association where they function as GTPases to regulate membrane trafficking (39). Oxysterol binding proteins, which regulate lipid metabolism and vesicular transport, contain lipid binding domains such as pleckstrin homology (PH) domains for membrane association (40). In addition, lipid specificity is also important to the function of peripheral membrane proteins. Protein kinase C requires PS as cofactor for activation to function in various signal transduction pathways (41). Phosphoinositides (PIPs) recruit various proteins to the membrane through conserved motifs (42) which perform diverse functions, such as lipid signaling, membrane trafficking, and cell signaling. The importance of PIPs are reviewed in Strahl and Thorner, 2008 (43).  30  Figure 3.1 Different types of interaction between peripheral membrane proteins and the membrane Exposed hydrophobic surfaces such as alpha-helices or loops, lipid modifications and charged residues are the main mechanism used by peripheral membrane protein to reversibly attach to the cell membrane.  31  3.1.3 Phosphatidic acid Phosphatidic acid (PA) is one of the most important glycerophospholipids found in biomembranes. In eukaryotic cells, PA is not only a precursor for the synthesis of many glycerophospholipids and triglycerides, but also a major signaling lipid. For example, in S. cerevisiae, PA generated from the turnover of PC via the phospholipase D-mediated pathway serves to suppress growth (44) and mediate vesicle fusion during sporulation (45). PA is also found to be a pH biosensor which regulates the activity of Opi1, a phospholipid synthesis regulatory protein (46). Compared to known lipid binding domains (such as PH, PX, C2 domains), PA binding domains are diverse and share no apparent sequence homology (47). However, one common characteristic for PA binding proteins is that they all contain a stretch of basic amino acids which are essential for PA interaction (48). The phosphomonoester headgroup of PA has two pKa’s (pKa1 3.2 and pKa2 7.02) with the second one in the physiological pH range. The negatively charged headgroup allows the formation of electrostatic interactions with basic regions of proteins. By changing the pH at around 7, the charge on the headgroup will be affected and thus alters the electrostatic interaction with proteins. In addition, unique hydrogen bonding contributes to interactions between PA and proteins. The combination of electrostatic interactions and hydrogen bond formation creates an electrostatic/hydrogen bond switch model which allows for PA-specific interactions (49). In this switch model, PA forms an intramolecular hydrogen-bond between the deprotonated and protonated hydroxyl of its phosphomonoester headgroup. This intramolecular hydrogen bond stabilizes the second proton of the phosphomonoester. In the presence of a primary amine group (such as the headgroup of PE or the side chains of arginine and lysine), the positively charged amine interacts with the negatively charged phosphate on PA which  32  brings the two headgroups in close proximity to allow hydrogen bond formation. The intermolecular hydrogen bond destabilizes the intramolecular hydrogen bond and thus lowers the pKa2 and increases the negative charge. A simple schematic of this process is shown in Figure 3.2. The challenge for identifying PA binding proteins is that there is no predicted specific sequence motif. Therefore potential PA binding proteins could not be predicted based on sequence alone. Using the method developed in Chapter 2, this Chapter will examine the peripherally-bound membrane proteins in S. cerevisiae.  Figure 3.2 Simple representation of the electrostatic/hydrogen bond switch model. Modified based on Kooijman et al., 2007 (49).  33  3.2 Materials and methods 3.2.1 Materials Isopropyl β-D-1-thiogalactopyranoside (IPTG) was obtained from BioShop® (Burlington, ON). Yeast nitrogen base was purchased from Becton, Dickinson and Company (Sparks, MD). Complete supplement mixture minus arginine and lysine was obtained from Sunrise Science Products, Inc. (San Diego, CA). All yeast strains and plasmids used in this section were kindly given by Dr. Christopher Loewen. Ebselen was obtained from Sigma. Table 3.2 Yeast strains used in this study Name Mating Type BY4741 MATa ygl007wΔ MATa BY4742 MATα arg4Δ MATα Y7043 MATα  Genotype his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 BY4741, ygl007w::kanMX4 his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 BY4742, arg4::kanMX4 his3Δ1 leu2Δ0 met15Δ0 ura3 Δ0 can1::STE2pr-LEU2 lyp1 cyh2  Table 3.3 Plasmids used in this study Name pKT128 pHPG Gal-dgk1 Gal-pah1  Discription Used for C-terminally GFP-tagging CAJ1 Used for N-terminal GFP-tagging CAJ1 Used for overexpression of Dgk1 Used for overexpression of Pah1  3.2.2 Empty Nanodisc reconstitution Empty Nanodiscs, containing only lipids, were made as in section 2.3.6 by varying the MSP to lipid ratio for each phospholipid. For Nanodisc phosphatidylcholine (Nd-PC) and Nanodisc total E. coli lipid extract (Nd-Ec), the molar ratio of MSP to lipid was 1:30. For Nanodisc phosphatidylethanolamine (Nd-PE), the ratio was 1:20. The cone shape of phosphatidic acid causes PA to adopt a non-bilayer structure in solution. Thus a 100% PA  34  Nanodisc could not the reconstituted. However, up to fifty percent of PA could be inserted into a PC or PE Nanodisc. 3.2.3 Yeast growth conditions (SILAC) A lysine and arginine auxotrophic strain, BY4742 Δarg4, was used. The cells were first grown for 7 hours in YPD media at 25 ºC, washed three times with sterile water and diluted to a final O.D.600 of 0.007 in yeast nitrogen base minimal medium. The medium contained 0.69 mg/ml complete supplement mixture minus arginine and lysine and 36 µg/ml and 30 µg/ml of normal or labelled arginine and lysine respectively. The cultures were grown for 14 hours at 25 ºC. The cultures were harvested by centrifugation and lysed by glass beads (1.5 ml of beads per 1 ml of culture) in the presence of 10 mM protease inhibitor. The mixture was vortexed vigorously for 3 min at 4 ºC. The beads were separated from the broken cells by centrifugation. The soluble protein extracts were collected by ultracentrifugation the same way as described in section 2.3.7. 3.2.4 Caj1 cloning Caj1 was cloned into pET23a vector for expression in E. coli. Two constructs were generated i) a C-terminal His6 tagged Caj1, ii) a non-tagged Caj1. Primers are listed in Appendix A. For constructing the His6 tagged Caj1, the amplified PCR product was purified using EconoSpin™ DNA column. The purified PCR product and pET23a vector were subjected to restriction enzyme digestion with NdeI and XhoI for 2 hours at 37 ºC. The digested products were analyzed on a 0.6 % agarose gel and the desired products were excised from the gel and re-isolated using a DNA spin column. The digested PCR product and vector (pET23a) were ligated using T4 DNA Ligase at a vector to insert ratio of 1:3-5. The vector concentration is  35  always kept at around 100 ng. The ligation was completed overnight at room temperature then was transformed into competent E. coli strain DH5α. Cells were plated onto LB agar plates containing 80 µg/ml ampicillin, incubated overnight at 37 ºC. Plasma DNA was isolated by miniprep then verified by sequencing. Site-directed mutagenesis of a single nucleotide were employed to generate the nontagged Caj1. The last codon (GAG) which encodes a glutamic acid residue was changed into a stop codon (TAG) just before the His6 tag. This change also disrupts a XhoI restriction enzyme site which allows for easy screening of the product. For a detailed procedure refer to section 2.2.2.2. 3.2.5 Caj1 expression Plasmid pET23a Caj1-His6 and pET23a Caj1 were transformed to E. coli strain C41 (DE3) for protein expression. The cells were grown overnight at 37 ºC in 20 ml of LB media with 80 µg/L of ampicillin. Next day, the culture was diluted into 2 L of fresh LB media with ampicillin. Cells were induced at O.D.600 of 0.4 with 0.2 mM IPTG. After three hours of induction, cells were harvested and disrupted as described in section 2.2.3. Caj1 is a soluble protein therefore the supernatant from the high spin was kept for purification. 3.2.6 Caj1 purification 3.2.6.1 Caj1-His6 purification  The soluble protein fraction containing Caj1-His6 was injected into a 5 ml column  containing Ni2+-NTA high performance beads, equilibrated with buffer A. The column was washed in buffer A with 10 mM imidazole followed by elution using 600 mM imidazole. The flow through, wash and eluate were analyzed by SDS-PAGE. Caj1 eluted at around 300 mM imidazole. The eluted fractions containing pure Caj1 were pooled and further purified using  36  size exclusion chromatography. The eluted proteins were injected onto a Superdex™ 200 HR10/300 column equilibrated with buffer A at a flow rate of 0.5 ml/min. The elution profile was monitored at 280 nm. Fractions were collected and analyzed by clear-native-PAGE. The soluble Caj1 fractions were pooled and concentrated and stored at -80 ºC. 3.2.6.2 Non-tagged Caj1 purification  A total soluble protein fraction containing Caj1 was injected onto a prepacked 1ml  HiTrap™ SP FF (GE Healthcare) equilibrated with buffer D (50 mM Tris pH 6.8, 50 mM sodium chloride, and 10 % v/v glycerol) at a flow rate of 1 ml/min. A linear gradient from 50 to 500 mM sodium chloride was applied and Caj1 eluted at around 200 mM salt. The factions were analyzed on a SDS-PAGE and the ones that contain Caj1 were pooled and further purified by size exclusion chromatography. A Superdex™ 200 HR 10/300 column equilibrated with buffer A was used at a flow rate of 0.3 ml/min. Fractions were analyzed on a clear-native-PAGE and the soluble Caj1 fractions were pooled and concentrate as described above. 3.2.7 Nickel affinity pulldown Nickel affinity pulldown similar to Section 2.2.8 was performed with few variations. To verify Caj1 binding to PA, empty Nanodiscs PE, EC, PEPG [50:50], and PEPA [50:50] were used. Purified non-tagged Caj1 (10 µg) was added to a final volume of 0.5 ml. The samples were washed three times with 1 ml of buffer A containing 50 mM imidazole and eluted in 50 µl of 600 mM imidazole. To test the effect of pH in the Caj1-PA interaction, Nanodiscs PCPEPA [40:35:25] and PCmPA [50:50] were used. All lipid ratios were calculated in moles. To vary the pH, buffer E (25 mM HEPES pH 6.8 to 8, 100 mM sodium chloride, and 5 % glycerol) was used. Samples were washed three times with 1 ml of buffer  37  E containing 50 mM imidazole and eluted in 50 µl of 600 mM imidazole. Eluted samples were analyzed on 12 % SDS-PAGE. 3.2.8 Liposome preparation Phospholipids were dissolved in chloroform and mixed together in the desired ratios. The lipid mixtures were then dried under a stream of nitrogen and overnight in a vacuum. Next day, the lipids were resuspended in buffer A using a freeze-thaw method (flash frozen in liquid nitrogen, then rapidly thawed at 37 ºC and vortexed). The steps were repeated five times to ensure uniformed size liposomes. Liposomes used in this study include: PC (100), PCPE (50:50), PCPEPA (90-50:0-40:10), PCPEmPA (50:40:10). All lipid ratios were calculated by moles. 3.2.9 Liposome sedimentation assay In 150 µl buffer A, 150 nmol of liposomes and 11.5 µg of Caj1-His6 were suspended. The mixture was incubated for 20 min on ice followed by ultracentrifugation at 174,000 g (Beckman TLA 100.2 rotor) for 30 min at 4 ºC. The supernatant and pellet were analyzed by SDS-PAGE. The affect of pH on the binding of Caj1 to PCPEPA liposomes were tested using buffer E. 3.2.10 N- and C- terminal GFP-tagged Caj1 A HIS3-GFP cassette was integrated into either 1 kb up or down stream of the Caj1 open reading frame through homologous recombination. Primers are listed in Appendix A. A basic schematic of the strategy for creating GFP tagged Caj1 is show in Figure 3.3.  38  Figure 3.3 Strategy for GFP-tagged Caj1 construction. Left, PCR product containing the GFP tag and His3 selective marker are transformed into the C-terminus of Caj1 open reading frame through homologous recombination to yield a C-terminal GFP tagged Caj1. Right, PCR product containing the promoter, GFP tag and His3 selective marker are inserted into the N-terminus of Caj1 open reading frame through homologous recombination to generate a N-terminal GFP tagged Caj1.  39  3.2.10.1 Yeast transformation  Transformations were done following closely to a previously published protocol (50).  Briefly, strain Y7043 was cultured in 2 mL YPD media overnight at 30 ºC. The cells were diluted to an O.D.600 of 0.2 in 20 ml fresh YPD media and allowed to grow to O.D.600 ~1. Cells were collected by centrifugation at 3,000 g (Beckman JA25.5 rotor) for 5 min. The pellet was washed once with 5 ml of sterile water then 100 mM lithium acetate (LiAc). Cells were resuspended in 200 µL of 100 mM LiAc and 50 µL were transferred into a new microfuge tube and spun down. A transformation mix containing 240 µL PEG (50 % w/v), 36 µL 1 M LiAc, 25 µL single-stranded carrier DNA (2 mg/ml) and 50 µL of concentrated PCR product (2-10 µg) was added and vigorously vortexed for 1 min. The mixtures were incubated for 30 min at 30 ºC and heat-shocked at 42 ºC for 20 min. The samples were centrifuged for 15 sec and the transformation mix was removed. The cells were resuspended in sterile water and plated on selective plates without histidine. 3.2.10.2 Gene crossing  To test the effect of pH on Caj1 localization, MATα Y7043 N’GFP-Caj1 strain was  crossed with MATa BY4741 ygl007wΔ to generate the N’GFP-Caj1 in a pma1-007 mutant background. The diploids were selected with markers of -His and kanMX. The resulting diploids were transferred to sporulation media and incubated at 25 ºC for 5 days. The sporulating cells were treated with 50 µg of zymolase for 10 min at 30 ºC to break down the cell wall. About 25 µl of digested spores were spread on YPD plates for tetrad dissection. 3.2.11 Confocal fluorescence microscopy To examine Caj1 localization, cells containing GPF-tagged Caj1 were grown to early log phase (O.D.600 ~ 0.5) at 30 ºC in synthetic minimal media without histidine. Cells  40  containing the pma1-007 mutation were grown in different pH medium (3 to 6) to test for the effect of pH on Caj1 localization. To further decrease the pH, pma1-007 mutant cells were treated with 0.1 mM ebselen for 10 min prior to imaging. To test the affect of overexpression of Dgk1 and Pah1 on the localization of Caj1, yeast cells containing either Dgk1 or Pah1 plasmid were grown in the presence of 2 % galactose to induce expression of these proteins. For microscopy analysis, 1 µL of cells was mixed with 1 µl of media on a glass plate with a cover slid on top. The cells were viewed on a Pascal Laser Scanning Confocal Microscope (Zeiss) with excitation at 488 nm and emission at 500-530 nm. All images were taken with identical microscope setting to enable direct comparison between images and samples.  3.3 Results 3.3.1 Nickel affinity pulldown For the identification of the PA lipid interactome, three kinds of empty Nanodisc were used. Nd-Ec, Nd-PE, and Nd-PEPA [50:50] were used as baits in the pulldown experiments to capture specific preys from the ‘heavy’ labelled protein extract. MSP was used as a control. Pulldowns were performed as in Section 2.2.8. The pulldown samples were first analyzed by silver staining prior to digestion and mass spectrometry. 3.3.2 Lipid binding proteins identified To identify the membrane interactome in yeast, pulldown samples of Nd-Ec, Nd-PE and Nd-PEPA [50:50] were analyzed by mass spectrometry. Various known lipid interacting proteins were identified including, Ypt1, Vps21, Sec4, Faa1 and Osh6 (Table 3.4, Fig. 3.4, and Appendix C). The three Ras family GTPases (Ypt1, Vps21 and Sec4) attach to the membrane via a double prenylation anchor (39). A fraction of the lipid-modified GTPase  41  exists in the cytosol in complex with Rab GDP dissociation inhibitors (GDIs). GDIs serve to deliver these GTPases to their specific membrane bound compartments and aid in the lipid insertion (51). It is possible that this soluble fraction of GTPase was present in the soluble yeast protein extracts and inserted into the Nanodisc through their lipid anchor. Faa1 is a long chain fatty acyl-CoA synthetase. A previous study had identified Faa1 as one of the proteins found in major lipid particles by mass spectrometry (52). These particles function to store nonpolar lipids with structures similar to lipoproteins in mammals (53). As a protein heavily involved in lipid metabolism, it is logical that Faa1 was found to associate with lipid storage particles and as a general lipid binding protein. Osh6, an oxysterol-binding protein (OSBP), interacts with phosphoinositides (PIPs) and PA via its N-terminal conserved OSBP-related domain (54). Osh6 was solely identified with Nd-Ec and could be related to the composition of Ec which is 75% PE, 15% PG and 10 % cardiolipin. The mixture of acidic and neutral lipids could provide a unique environment for Osh6 to interact. Caj1 was identified using Nd-PEPA with a SILAC ratio of ~16. Caj1 is a type II DnaJ heat shock protein belonging to the E. coli DnaJ family (55). Since it is an Hsp40 it should interact with an Hsp70 partner and stimulate its ATPase activity. Even though the total protein has a slightly acidic pI of 5.79, there are two regions from residues 230 to 270 and residues 317 to 370 that have a pI of 10.52 and 9.84 respectively (Fig. 3.5). It is possible that Caj1 interacts with PA through one of these basic regions. As shown below, the interaction of Caj1 to PA is verified in vitro.  42  Table 3.4 Top ten non-ribosomal proteins identified with empty Nanodisc Namea Nd-Ec OSH6 YPT1 FAA1 VPS21 CDC19 DED1 PDC1 SAH1 TDH2 ADH1 Nd-PE YPT1 VPS21 SEC4 TIF1 ENO2 FAA1 PGK1 HSC82 IMD3 ACT1 Nd-PEPA CAJ1 FAA1 YPT1 VPS21 YFL002W-A LSP1 MHP1 TDH2 HRK1 a  YDL025C  Description  Ratiob  Member of an oxysterol-binding protein family Ras-like small GTPase, involved in the ER-to-Golgi step of the secretory pathway Long chain fatty acyl-CoA synthetase with a preference for C12:0C16:0 fatty acids GTPase required for transport during endocytosis and for correct sorting of vacuolar hydrolases Pyruvate kinase ATP-dependent DEAD (Asp-Glu-Ala-Asp)-box RNA helicase Major of three pyruvate decarboxylase isozymes S-adenosyl-L-homocysteine hydrolase Glyceraldehyde-3-phosphate dehydrogenase Alcohol dehydrogenase  11.5  Ras-like small GTPase, involved in the ER-to-Golgi step of the secretory pathway GTPase required for transport during endocytosis and for correct sorting of vacuolar hydrolases Secretory vesicle-associated Rab GTPase essential for exocytosis Translation initiation factor eIF4A Enolase II Long chain fatty acyl-CoA synthetase with a preference for C12:0C16:0 fatty acids 3-phosphoglycerate kinase Cytoplasmic chaperone of the Hsp90 family Inosine monophosphate dehydrogenase Actin, structural protein involved in cell polarization  16.8  Nuclear type II J heat shock protein of the E. coli dnaJ family Long chain fatty acyl-CoA synthetase with a preference for C12:0C16:0 fatty acids Ras-like small GTPase, involved in the ER-to-Golgi step of the secretory pathway GTPase required for transport during endocytosis and for correct sorting of vacuolar hydrolases Retrotransposon TYA Gag and TYB Pol genes Primary component of eisosomes Microtubule-associated protein involved in assembly and stabilization of microtubules Glyceraldehyde-3-phosphate dehydrogenase, isozyme 2, involved in glycolysis and gluconeogenesis Protein kinase implicated in activation of the plasma membrane H(+)-ATPase Pma1p in response to glucose metabolism Putative protein kinase, potentially phosphorylated by Cdc28p  16.3 6.6  10.3 9.8 3.4 1.8 1.8 1.7 1.6 1.6 1.4  10.1 8.0 2.5 2.3 2.2 2.1 1.8 1.6 1.5  5.9 4.9 2.9 1.8 1.8 1.8 1.5 1.5  Ribosomal proteins are removed from this list. For complete lists of proteins refer to Appendix C. b Ratios are an average of three biological replicates. 43  Figure 3.4 Summary of SILAC ratios for proteins identified to interact with Nanodisc Ec, PE and PEPA. Proteins 1 to 50 are shown for simplicity reason (Refer to Appendix C for complete lists). Gray bars represents ribosomal proteins. Known lipid interactors and Caj1 are highlighted.  44  Figure 3.5 The acidic and basic map of the Caj1 protein Caj1 contains 391 amino acid residues. The first 80 residues correspond to the J-domain. The theoretical pI of the whole protein is 5.79. The acidic regions are shown in the top part (A) and the basic in the bottom part (B). Black bars represent the acidic or basic residues. Residues 230 to 270 and 317 to 370 (red areas) have a calculated pI of 10.52 and 9.84 respectively. Map is generated from N-terminus to C-terminus, left to right, using DNAStrider program.  45  3.3.3 Purification of Caj1 Caj1-His6 was purified as described in the methods Section 3.2.6.1. Most of the Caj1His6 was eluted in the first three fractions of the Ni 2+-NAT chromatography. Caj1-His6 migrated at around 47kDa with two additional bands at around 34 kDa and 15 kDa (Fig. 3.6A). The bands were identified by mass spectrometry to contain peptides derived from Caj1 as well. Therefore these two bands represent cleaved products of Caj1. The Caj1-His6 was further purified by size exclusion chromatography. Fractions were analyzed on a clearnative PAGE where Caj1 runs as a single band. Peak fractions were pooled, concentrated, and stored at -80 ºC. Non-tagged Caj1 was created through site-directed mutagenesis of the Caj-His6 and expressed in C43 as described in Section 3.2.4 and 3.2.5. Since the theoretical pI of Caj1 is slightly acidic, 5.97, initial purification was performed with an anion exchange column. However, there was no purification of Caj1 (data not shown). The basic patches on the protein could have resulted in Caj1 behaving as a basic protein. Thus, Caj1 is purified with a strong cation exchange column. The protein was eluted using a gradient of high salt (Fig. 3.6B) and fractions analyzed by SDS-PAGE (Fig. 3.6C). On SDS-PAGE, the non-tagged Caj1 behaves similar to the His 6-tagged Caj1. The protein was purified by size exclusion columatography (Fig. 3.6D). The elution profile of Caj1 is one single peak which suggests that the clipped products seen on SDS-PAGE behave as a full length protein in solution. The fractions were analysed by clear-native PAGE (Fig. 3.6E). The clear-native PAGE profiles were the same for tagged and non-tagged Caj1 indicats that the tag does not interfere with the folding of the protein. Caj1 was a single band on native-PAGE further suggests that the clipped products forms a complex and behave as the full length protein in solution.  46  Figure 3.6 Purifiaction of His6-tagged and non-tagged Caj1 A. SDS-PAGE analysis of flow through (FT), wash (W), and elution fractions of Ni-NTA column purification, The soluble protein was loaded onto a Ni 2+ resin column equilibrated in buffer A. The column was washed in buffer A with 10 mM imidazole and the protein was eluted in 600 mM imidazole (as in section 3.2.6.1). Twelve 1 ml fractions were collected from the start of the elution. B. Ion exchange chromatogram of non-tagged Caj1. Soluble fraction containing Caj1 was injected onto a strong cation column equilibrated with buffer D. A linear gradient from 50 to 500 mM sodium chloride was applied for elution of Caj1(as in section 3.2.6.2). Fractions (1 ml) were collected after the gradient started. C. SDS-PAGE analysis of the ion exchange fractions. D. Size exclusion chromatogram of Caj1. A Superdex™ 200 HR10/300 column equilibrated with buffer A was used. Fractions (400 µl) were collected starting at around 11 ml. E. Clear-native PAGE analysis of peak fractions collected from size exclusion chromatography.  47  3.3.4 Verification of Caj1-PA interaction using Nanodiscs and liposomes To verify the interaction of Caj1 with PA, a nickel affinity pulldown experiment was performed with purified non-tagged Caj1. Caj1 was incubated with Nanodisc-PE, EC, PEPG (50:50) and PEPA (50:50). The elutions were analyzed on SDS-PAGE. Caj1 was seen with Nanodisc containing PA but not with any other tested phospholipids (Fig. 3.7A). The interaction was further examined using liposomes, as described in Section 3.2.9. It is possible that the presence of PE can increase the positive charge on PA (49) which enhances the binding of PA interacting proteins. To test this, liposomes containing different amount of PE were used in the sedimentation assay. The pellets were analyzed on SDS-PAGE (Fig. 3.7B). The results show that the presence of PE in the liposome facilitates the binding of Caj1. The control liposomes (100% PC and PCPE [60:40]) showed no binding of Caj1. Another way to show the interaction between Caj1 and PA was through clear-nativePAGE analysis. Since there were no detergents in the gel or the running buffer, the protein complexes were not disrupted and could be observed as higher molecular weight species. Caj1 and Nd-PEPA or Nd-PE were mixed together and analyzed on clear-native PAGE (Fig. 3.7C). When Caj1 were mixed together with Nd-PEPA, a higher molecular weight product band was formed indicating complex formation. In contrast, Caj1 does not form a stable complex with Nd-PE. These results indicate that interaction between Caj1 and PA is PE dependent in vitro.  48  Figure 3.7 Binding of Caj1 to acidic phospholipids with Nanodsics and liposomes. A. Affinity pull-down of Caj1 with Nanodisc. Nanodiscs-PE, Ec, PEPG, and PEPA were immobilized onto Ni2+ beads equilibrated in buffer A. Non-tagged Caj1 was added to the mixture(as in Section 3.2.7). Elutions were analysed on 12 % SDS-PAGE. B. Liposome sedimentation assay. Liposomes made with different percentages of PE were tested for Caj1 binding. 150 nmol of liposomes were incubated with 11.5 µg of Caj1-His6 in buffer A. Mixture were ultracentrifuged (refer to Section 3.2.9). Pellets were analysed on 12 % SDSPAGE. C. 4 % to 12 % clear-native PAGE analysis of Caj1-PA interaction using Nanodisc. Indicated amount of Caj1 was incubated with 1.5 µg of Nanodisc containing either PEPA [50:50] or PE in buffer A then separated on clear-native-PAGE.  49  3.3.4.1 Effect of pH on the binding of Caj1 to PA  As mentioned in Section 3.1.3, the phosphomonoester head group of PA has a second  pKa at physiological pH. Varying the pH slightly would affect the charge on the PA head group and potentially affect the electrostatic interactions between PA and its interacting partners. Other studies have shown that PA binding protein, Opi1, binds to PA in a pHdependent manner (46, 56). To test the effect of pH on Caj1-PA interaction, liposome sedimentation and Nanodisc nickel affinity pulldown assays were performed with Caj1 at different pH as in Sections 3.2.7 and 3.2.9. The results showed that the binding of Caj1 to PA in Nanodisc and liposomes increased as the pH increased from 6.4 to 8 (Fig. 3.8B, C). To ensure the changes in pH were not affecting Caj1, the lipid methyl-PA was used as a control. The head group of methyl-PA contains a methyl group which eliminates the second pKa (Fig. 3.8A). With methyl-PA reconstituted into Nanodisc and liposomes, the overall binding of Caj1 was weaker and pH-independent (Fig. 3.8B, C). Together, these results indicate that the affinity between Caj1 and PA is affected by pH.  50  Figure 3.8 pH-dependent binding of Caj1 to PA in Nanodiscs and liposomes A. Structure of PA and methyl-PA. B. The liposome sedimentation assay was performed as in Section 3.2.9. Two different liposomes were tested: PCPEPA [50:40:10] versus PCPEmPA [50:40:10]. Liposome pellets were analyzed on 12 % SDS-PAGE. C. Nanodisc pulldown assay (Section 3.2.7). Two kinds of Nanodiscs were tested: PCPEPA [40:35:25] and PCmPA [50:50]. Elutions were analyzed on 12 % SDS-PAGE.  51  3.3.5 Measure of the Caj1-PA interaction in intact cells To assess the Caj1-PA interaction in vivo, GFP-tagged Caj1 was constructed. Both Nand C- terminal GFP-tagged Caj1 were created using homologous recombination. Using confocal microscopy, C’GFP-tagged Caj1 was localized to the cytosol and the N’GFP-tagged Caj1 was localized to the bud plasma membrane as well as to the cytosol (Fig. 3.9). The difference in localization obtained with the two constructs could be due to the bulky GFP tag on the C-terminal blocking the binding interface on Caj1.  Figure 3.9 Localization of C- and N- terminal GFP-tagged Caj1 in yeast cells N- and C- terminal GFP-tag were inserted into Caj1 via homologous recombination as in section 2.3.10. Cells were grown to log phase and fluorescence microscopy was performed as in section 3.2.11. The microscope settings are the same for all conditions. Scale bar represents 1 µm. Arrows highlight the membrane localization.  52  To test whether the membrane localization of Caj1 to the cell bud was pH-dependent, the pH inside the cell was varied around the physiologic pH. The second pKa of the phosphomonoester head group of PA is around pH 7. If the localization is pH dependent then it is likely to be PA dependent as well. N’GFP-Caj1 was crossed with a S. cerevisiae strain containing the pma1-007 mutation to generate N’GFP-Caj1-pma1-007. The pma1 gene encodes an essential plasma membrane H+-ATPase that regulates the intracellular cytosolic pH, pHi (57). The pma1-007 mutation disrupts half of the ATPase activity, allowing the pHi to be modified. The cells were cultured at different pH (3, 4, 5, and 6) and examined under the microscope. From pH 3 to 6, the intracellular pHi was determined to be from 6.8 to 7 (46). There were no obvious differences in the localization of N’GFP-Caj1 under these pH conditions (Fig. 3.10). It could be that the pHi was not low enough to delocalize Caj1 from the plasma membrane. To lower the pHi further, cells were treated with ebselen, a drug that inhibits Pma1 in vitro (58). The cells were incubated with 100 µM of ebselen for 10 min and observed under the microscope. According to Young et al., 2011 (46), the pHi dropped to around 6.1 in these conditions. In that case, Caj1 was found localized exclusively to the cytosol (Fig. 3.10).  53  Figure 3.10 Effect of pH on Caj1 localization N’GFP-Caj1-pma1-007 cells were grown in different pH media and visualized using confocal microscopy (as in section 3.2.11). Localization of N-GFP-Caj1-pma-007 at pH 6,5,4,and 3 and 10 min after ebselen treatment. Same microscope settings for all conditions tested. The scale bar represents 1 µm. Arrows highlight the membrane localization.  54  As another way to test the PA-dependence of Caj1 membrane localization, the expression of enzymes in the PA production pathway were modified. Dgk1 and Pah1 are two enzymes that are important for regulating PA levels in the cell. Dgk1 is a diacylglycerol kinase that catalyzes the formation of PA from diacylglycerol (59) and Pah1 catalyzes the dephosphorylation of PA into diacylglycerol (60). Plasmids overexpressing these two enzymes were transformed into yeast cells containing N’GFP-Caj1-pma1-007. The experiments were done with the pma1-007 background because the localization of Caj1 to the plasma membrane was more obvious than the wildtype. Therefore, any change would be easier to detect. The plasmid-encoded enzymes were under the gal promoter hence induced by galactose. If the membrane localization of Caj1 was dependent on PA, then overexpression of Dgk1 would result in an increase in membrane localization whereas the overexpression of Pah1 would cause a decrease. The results shows that when Dgk1 is overexpressed, the expression of N’-GFP-Caj1 was also high but the localization to the bud plasma membrane was still present (Fig. 3.11 left). Overall, no changes in the localization of N’-GFP-Caj1 were observed upon overexpression of Dgk1 or Pah1. Together, the in vivo localization data suggest that it is possible the localization of Caj1 to the bud plasma membrane may be due to interactions with other acidic phospholipids.  55  Figure 3.11 Overexpression of Dgk1 and Pah1 and effect on the localization of Caj1 N’GFP-Caj1-pma1-007 yeast strain containing Dgk1 or Pah1 was grown in the presence of dextrose or galactose to log phase and confocal microscopy was performed as in section 3.2.11. Same microscope setting for all conditions tested. Scale bar represent 1 µm. Arrows highlight the membrane localization.  56  The localization experiments above confirmed the membrane association of Caj1. However, it did not show PA dependence. Therefore, the liposome sedimentation assay was performed again to examine the Caj1 interaction to other acidic phospholipids. As shown in Figure 3.12, Caj1 interacted with phosphatidylserine (PS), phosphoinositol (PI), and phosphoinositol-4-phosphate (PI4P) with stronger interactions to PS and PI4P. Previous results showed that PA liposomes made in the presence of PC had less capacity to bind Caj1 than those made in the presence of PE (Fig. 3.7). Therefore, PA binding was weak here. Together, the in vitro and the in vivo results suggest Caj1 is an acidic lipid binding protein.  Figure 3.12 Interaction of Caj1 with acidic phospholipids Liposomes made with different acidic lipids compositions were tested for Caj1 binding. Detailed procedures are in Section 3.2.9. PS was reconstituted into liposome along with PC at two percentages: 25 % and 50 %. Other acidic phospholipids (PI, PI 4P and PA) were reconstituted with 50 % PC. Pellets were analyzed on 12 % SDS-PAGE.  57  Chapter 4: Discussion 4.1 The membrane protein interactome in E. coli Three E. coli membrane proteins complexes (SecYEG, MalFGK, and YidC) interactors were used to develop and validate the technique. With Nd-SecYEG reconstituted in different lipids, Syd and SecA were identified. The identification of these known interactors of SecYEG suggests that the technique works and also is sensitive enough to distinguish between interactions that depend on different lipid types. With Nd-MalFGK, MalE was identified as a specific interacting partner. In this case, two growth conditions, glucose and maltose, were compared. The SILAC ratio of MalE from the glucose condition was ~6 fold lower than the ratio from the maltose condition. The lower ratio was expected since MalE expression is strongly reduced in the presence of glucose. SILAC extract from maltose cultures contained high level of proteins controlled by the mal operon (such as MalP, MalM and MalQ). However these proteins had SILAC ratios below one. Thus, the identification of MalE is not simply due to the increase in abundance of the protein in the presence of maltose. Growth conditions are important when applying this technique to certain membrane proteins. Since MalE is a periplasmic protein, the technique can identify both cytosolic and periplasmic interacting partners. No proteins interacting with YidC were isolated. The crystal structure of the large periplasmic P1 domain of YidC reveals a fold resembling that of a carbohydrate-binding protein and a cleft motif that could serve as a peptide-binding site (21-22). Previous proteomic analysis using an in vivo photo-crosslinker approach identified 12 different cytosolic proteins, most of them ribosomal or involved in cell metabolism with no apparent functional relationships to YidC (36). Here, the proteins identified with YidC showed no  58  specificity, with low SILAC ratios. These proteins were also present in experiments with SecYEG and MalFGK. YidC does not interact with any specific cytosolic or periplasmic proteins in the conditions tested. 4.2 The membrane interactome in S. cerevisiae Several known lipid interacting proteins were identified with Nanodisc made with PE, Ec, and PEPA. These are Ypt1, Vps21, Sec4, Faa1, and Osh6 (Table 3.4, Fig. 3.4 and Appendix C). Out of these, three are Rab family GTPase (Ypt1, Vps21 and Sec4). Ypt1 is involved in the secretory pathway for vesicle docking and targeting from ER to Golgi (61). Vps21 is required for endocytic transport and sorting of vacuolar proteins (62). Sec4 functions in the exocytic secretion and autophagy pathways (63). These Rab family GTPases require geranylgeranylation for membrane insertion. The lipid-modified GTPases exist in the cytosol in complex with Rab GDP dissociation inhibitor (GDI) which functions to bring the Rab GTPases to their appropriate membrane location and facilitate membrane insertion (64). The membrane targeting of these Rab GTPases has been shown previously using a sedimentation assay (65-66). These studies used membranes isolated from yeast cells and mixed with a soluble protein extract containing prenylated Rab-GDI complex. In the sedimented pellet, Rab proteins were detected by immunoblotting (65). Therefore, it is possible that the soluble form of these Rab family GTPases were present in the SILAC extracts and were inserted into the Nanodisc during the pulldown. Faa1 is one of the four long chain acyl-CoA synthetases required for fatty acid uptake and protein myristoylation. In yeast, nonpolar lipids, such as triacylglycerols and steryl esters, are stored in subcellular compartment known as lipid particles. Faa1 is heavily involved in lipid fatty acid metabolism and regulation. Hence it was not surprising that Faa1  59  was earlier identified to be associated with lipid particles via mass spectrometry (52). In this earlier study, the isolated lipid particles were delipidated and proteins were analyzed on a SDS-PAGE. Protein bands were excised and identified by mass spectrometry. Many proteins involved in lipid metabolism, including Faa1, were identified. This is consistent with the identification of Faa1 as a general lipid interacting protein. Osh proteins play critical roles in sterol homeostasis. In total there are seven Osh proteins in yeast. Most of them interact with oxysterols through their C-terminus oxysterol binding protein related domain (ORD) and with phosphoinositides (PIPs) via their pleckstrin homology (PH) domain. Although Osh6 lacks a PH domain at its N-terminus, it is still able to bind acidic PIPs and PA with different affinity (54). However, in this study, Osh6 was identified with Ec lipids. E. coli total lipid extract contains 57 % PE, 15 % PG, 10 % CL, and 18 % other lipids. Even though the acidic phosphatidylglycerol is not abundant in yeast, the fact that Osh6 is able to interact with acidic phospholipids could have led to this artificial interaction. Moreover, the unique mixture of lipids found in E. coli total lipid extract could have artificially enhanced the binding. However, to prove this hypothesis, more experiments are required. For example, a pulldown assay with different empty Nanodisc could be employed to test the affinity of Osh6 for different lipids. Alternatively, a sedimentation assay using liposomes with different lipid composition could be utilized. Using Nanodisc containing PA, the two known interacting proteins, Spo20 and Opi1, were not identified. Spo20 is a SNARE protein which is required for the formation of spores. Spo20 belongs to the SNAP-25 family which lacks a transmembrane domain (67-68). Studies using liposome sedimentation assays and in vivo localizations have demonstrated PA interaction and dependent localization (69). However, due to their strong affinity for  60  membranes they are not likely to be present in the soluble protein fractions, since our protein extraction conditions were mild (100 mM NaCl). Opi1 has been shown to bind PA through in vitro liposome sedimentation assays and in vivo GFP localization assays (46). Opi1 was not detected here could be due to interaction between Opi and PA was not established using the pulldown method or Opi1 was tightly bound to the membrane and not released into the total soluble protein extract. The test this, a sample of the total SILAC protein extract could be analyzed by mass spectrometry to detect if Opi1 and Spo20 are present. Pulldown assays with purified Opi1 could also be performed with Nd-PEPA to verify binding to Nanodisc. A previously uncharacterized lipid interactor, Caj1, was identified using Nanodisc containing PA. Caj1 belongs to the E. coli DnaJ protein family. This family of proteins all contain a conserved J-domain similar to the DnaJ protein found in E. coli. Caj1 was first identified and characterized in yeast in 1994 (55). Since then, only a few studies have involved Caj1. It has been characterized to be a type II J-protein consists of a J-domain at the N-terminus followed by a glycine rich domain. The exact function of this protein is unknown. However, since it contains a J-domain, Caj1 is an Hsp40 which interacts with an Hsp70 and stimulates its ATPase activity. Global analysis of protein localization in budding yeast has shown that Caj1 is possibly localized to the nucleus (70). This led to the prediction that Caj1 interacts with Ssa1/2 in the nucleus to assist its function (71). However, a more recent study has indicated that Caj1 together with Kap123 play an essential role in normal microtubule function (72). PA associated proteins contain a stretch of basic amino acid residues essential for PA interaction. Caj1 contains two basic regions near the C-terminus (Fig. 3.5) that could potentially serve as PA binding site. The interaction between Caj1 and PA was characterized  61  in vitro. Technique such as nickel affinity pulldown, liposome sedimentation assay and native-PAGE gel were employed and Caj1 binding to PA and other acidic phospholipids were confirmed. In addition, consistent with the properties of Opi1 (46, 56), the Caj1-PA interaction was found to be PE and pH dependent (Fig. 3.7B and 3.8). In vivo, N-terminal GFP-tagged Caj1 localized to the plasma membrane of yeast buds and the cytoplasm while C-terminal GFP-tagged Caj1 localized to the cytoplasm. The inconsistency in the localization could be due to the position of the GFP-tag. Since the potential basic PA interaction regions on Caj1 are found close to the C-terminus (Fig. 3.5), placing the bulky GFP-tag at the C-terminus could have blocked the interaction site. It is unlikely that the overexpression of N’GFP-Caj1 would have caused Caj1 to localize to the plasma membrane since the fluorescence intensities are similar for the N’ and C’GFP-Caj1 (Fig. 3.9). The specificity of binding of Caj1 to PA was tested in vivo. A GFP-Caj1-pma1-007 strain was created for manipulation of the cytosolic pH. According to Young et al., 2010, when grown in medias of pH 3-5, the cytosolic pH of the pma-007 strain is around 6.8-7 (46). However, the localization of N’GFP-Caj1 was not pH-dependent but the addition of ebselen, which decreased the pHi to ~6 (46), caused Caj1 to detach from the plasma membrane (Fig. 3.10). The delocalization may also have been caused by other effects of the drug (such as induced stress) and not directly due to the change in pHi. Moreover, Caj1 localization was not affected when two enzymes in the PA metabolism pathway were overexpressed (Fig. 3.11). These results suggest the association of Caj1 to the membrane is not PA-specific and that Caj1 is possibly interacting with other phospholipids in vivo. This hypothesis was tested via liposome sedimentation assay with different acidic lipid liposomes.  62  The result shows that Caj1 is a general acidic phospholipid binding protein (Fig. 3.12). However, the pulldown assay using Nd-Ec and Nd-PEPG showed no association of Caj1 (Fig. 3.7A). Binding of Caj1 to PG liposomes needs to be tested as the interaction might be observed with only one of these methods.  63  Chapter 5: Conclusion 5.1 Address the aims of project This technique which combines Nanodisc and SILAC proteomics has been applied to E. coli membrane proteins, SecYEG, MalFGK, and YidC and successfully identified previously known interactors, SecA, Syd, and MalE. However, consistent with previous studies, no interacting proteins were found with YidC. In yeast, the technique was applied to examine the membrane interactome. Several known lipid interacting proteins were identified along with a novel acidic phospholipid binding protein, Caj1. The interaction between Caj1 and PA as well as other acidic lipids was verified. The work in E. coli and S. cerevisiae together demonstrate the success in the development of a robust method for the identification of the membrane interactome. This technique could potentially be applied to any membrane or membrane protein of interest. 5.2 Future Directions The  interaction  between  Caj1  and  acidic  phospholipids  requires  further  characterization. First, the phospholipid that leads to the membrane localization of Caj1 needs to be identified. Since PS is present in the yeast bud plasma membrane in relative high concentration, this lipid is most likely to be responsible for Caj1 localization. To test this, a yeast Cho1 deletion strain will be employed since deletion of Cho1 will directly decrease the amount of PS present in the plasma membrane. Second, it is still possible that Caj1 is interacting with PA during the sporulation stage of the cell cycle. Previously, Spo20 was been shown to play a role during sporulation via its PA association (69). It is possible that Caj1 functions during sporulation as well. Therefore, localization of N’GFP-Caj1 during sporulation should be verified. Third, the predicted lipid binding sites on Caj1 need to be  64  verified. Point mutations could be introduced in the predicted binding region to replace the basic residues with neutral amino acids or truncation mutants could be created to remove the entire predicted binding site on Caj1. These mutants would be used in binding assays to map out the lipid interaction site of Caj1.  65  References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16.  17.  Ahram, M., Litou, Z. I., Fang, R., and Al-Tawallbeh, G. (2006) Estimation of membrane proteins in the human proteome, In Silico Biol 6, 379-386. Cho, W., and Stahelin, R. V. (2005) Membrane-protein interactions in cell signaling and membrane trafficking, Annu Rev Biophys Biomol Struct 34, 119-151. Hooker, B. S., Bigelow, D. J., and Lin, C. T. (2007) Methods for mapping of interaction networks involving membrane proteins, Biochem Biophys Res Commun 363, 457-461. Bayburt, T. H., and Sligar, S. G. (2003) Self-assembly of single integral membrane proteins into soluble nanoscale phospholipid bilayers, Protein Sci 12, 2476-2481. Bayburt, T. H., Grinkova, Y. V., and Sligar, S. G. (2006) Assembly of single bacteriorhodopsin trimers in bilayer nanodiscs, Arch Biochem Biophys 450, 215-222. Denisov, I. G., and Sligar, S. G. (2011) Cytochromes P450 in nanodiscs, Biochim Biophys Acta 1814, 223-229. Leitz, A. J., Bayburt, T. H., Barnakov, A. N., Springer, B. A., and Sligar, S. G. (2006) Functional reconstitution of Beta2-adrenergic receptors utilizing self-assembling Nanodisc technology, Biotechniques 40, 601-602, 604, 606, passim. Makarov, A., Denisov, E., Kholomeev, A., Balschun, W., Lange, O., Strupat, K., and Horning, S. (2006) Performance evaluation of a hybrid linear ion trap/orbitrap mass spectrometer, Anal Chem 78, 2113-2120. Gruhler, A., Olsen, J. V., Mohammed, S., Mortensen, P., Faergeman, N. J., Mann, M., and Jensen, O. N. (2005) Quantitative phosphoproteomics applied to the yeast pheromone signaling pathway, Mol Cell Proteomics 4, 310-327. Veenendaal, A. K., van der Does, C., and Driessen, A. J. (2004) The proteinconducting channel SecYEG, Biochim Biophys Acta 1694, 81-95. Nishiyama, K., Hanada, M., and Tokuda, H. (1994) Disruption of the gene encoding p12 (SecG) reveals the direct involvement and important function of SecG in the protein translocation of Escherichia coli at low temperature, EMBO J 13, 3272-3277. Akiyama, Y., and Ito, K. (1987) Topology analysis of the SecY protein, an integral membrane protein involved in protein export in Escherichia coli, EMBO J 6, 34653470. Schatz, P. J., Riggs, P. D., Jacq, A., Fath, M. J., and Beckwith, J. (1989) The secE gene encodes an integral membrane protein required for protein export in Escherichia coli, Genes Dev 3, 1035-1044. Nishiyama, K., Mizushima, S., and Tokuda, H. (1993) A novel membrane protein involved in protein translocation across the cytoplasmic membrane of Escherichia coli, EMBO J 12, 3409-3415. Collinson, I. (2005) The structure of the bacterial protein translocation complex SecYEG, Biochem Soc Trans 33, 1225-1230. Frauenfeld, J., Gumbart, J., Sluis, E. O., Funes, S., Gartmann, M., Beatrix, B., Mielke, T., Berninghausen, O., Becker, T., Schulten, K., and Beckmann, R. (2011) Cryo-EM structure of the ribosome-SecYE complex in the membrane environment, Nat Struct Mol Biol 18, 614-621. Alami, M., Dalal, K., Lelj-Garolla, B., Sligar, S. G., and Duong, F. (2007) Nanodiscs unravel the interaction between the SecYEG channel and its cytosolic partner SecA, EMBO J 26, 1995-2004. 66  18. 19.  20. 21. 22. 23. 24. 25. 26. 27.  28.  29. 30. 31.  Dalal, K., Nguyen, N., Alami, M., Tan, J., Moraes, T. F., Lee, W. C., Maurus, R., Sligar, S. S., Brayer, G. D., and Duong, F. (2009) Structure, binding, and activity of Syd, a SecY-interacting protein, J Biol Chem 284, 7897-7902. Wagner, S., Pop, O. I., Haan, G. J., Baars, L., Koningstein, G., Klepsch, M. M., Genevaux, P., Luirink, J., and de Gier, J. W. (2008) Biogenesis of MalF and the MalFGK(2) maltose transport complex in Escherichia coli requires YidC, J Biol Chem 283, 17881-17890. Luirink, J., Samuelsson, T., and de Gier, J. W. (2001) YidC/Oxa1p/Alb3: evolutionarily conserved mediators of membrane protein assembly, FEBS Lett 501, 15. Oliver, D. C., and Paetzel, M. (2008) Crystal structure of the major periplasmic domain of the bacterial membrane protein assembly facilitator YidC, J Biol Chem 283, 5208-5216. Ravaud, S., Stjepanovic, G., Wild, K., and Sinning, I. (2008) The crystal structure of the periplasmic domain of the Escherichia coli membrane protein insertase YidC contains a substrate binding cleft, J Biol Chem 283, 9350-9358. Notley, L., and Ferenci, T. (1995) Differential expression of mal genes under cAMP and endogenous inducer control in nutrient-stressed Escherichia coli, Mol Microbiol 16, 121-129. Shilton, B. H. (2008) The dynamics of the MBP-MalFGK(2) interaction: a prototype for binding protein dependent ABC-transporter systems, Biochim Biophys Acta 1778, 1772-1780. Panagiotidis, C. H., Boos, W., and Shuman, H. A. (1998) The ATP-binding cassette subunit of the maltose transporter MalK antagonizes MalT, the activator of the Escherichia coli mal regulon, Mol Microbiol 30, 535-546. Boos, W., and Bohm, A. (2000) Learning new tricks from an old dog: MalT of the Escherichia coli maltose system is part of a complex regulatory network, Trends Genet 16, 404-409. Bluschke, B., Volkmer-Engert, R., and Schneider, E. (2006) Topography of the surface of the signal-transducing protein EIIA(Glc) that interacts with the MalK subunits of the maltose ATP-binding cassette transporter (MalFGK2) of Salmonella typhimurium, J Biol Chem 281, 12833-12840. Dean, D. A., Reizer, J., Nikaido, H., and Saier, M. H., Jr. (1990) Regulation of the maltose transport system of Escherichia coli by the glucose-specific enzyme III of the phosphoenolpyruvate-sugar phosphotransferase system. Characterization of inducer exclusion-resistant mutants and reconstitution of inducer exclusion in proteoliposomes, J Biol Chem 265, 21005-21010. Hanahan, D., Jessee, J., and Bloom, F. R. (1991) Plasmid transformation of Escherichia coli and other bacteria, Methods Enzymol 204, 63-113. Dalal, K., and Duong, F. (2010) Reconstitution of the SecY translocon in nanodiscs, Methods Mol Biol 619, 145-156. Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., Datsenko, K. A., Tomita, M., Wanner, B. L., and Mori, H. (2006) Construction of Escherichia coli K12 in-frame, single-gene knockout mutants: the Keio collection, Mol Syst Biol 2, 2006 0008.  67  32. 33. 34. 35. 36.  37. 38.  39. 40. 41. 42. 43. 44. 45.  46.  Gold, V. A., Robson, A., Bao, H., Romantsov, T., Duong, F., and Collinson, I. (2010) The action of cardiolipin on the bacterial translocon, Proc Natl Acad Sci U S A 107, 10044-10049. Lill, R., Dowhan, W., and Wickner, W. (1990) The ATPase activity of SecA is regulated by acidic phospholipids, SecY, and the leader and mature domains of precursor proteins, Cell 60, 271-280. Raibaud, O., and Richet, E. (1987) Maltotriose is the inducer of the maltose regulon of Escherichia coli, J Bacteriol 169, 3059-3061. Sherratt, D. J., Arciszewska, L. K., Blakely, G., Colloms, S., Grant, K., Leslie, N., and McCulloch, R. (1995) Site-specific recombination and circular chromosome segregation, Philos Trans R Soc Lond B Biol Sci 347, 37-42. van Bloois, E., Dekker, H. L., Froderberg, L., Houben, E. N., Urbanus, M. L., de Koster, C. G., de Gier, J. W., and Luirink, J. (2008) Detection of cross-links between FtsH, YidC, HflK/C suggests a linked role for these proteins in quality control upon insertion of bacterial inner membrane proteins, FEBS Lett 582, 1419-1424. van der Rest, M. E., Kamminga, A. H., Nakano, A., Anraku, Y., Poolman, B., and Konings, W. N. (1995) The plasma membrane of Saccharomyces cerevisiae: structure, function, and biogenesis, Microbiol Rev 59, 304-322. Zinser, E., Sperka-Gottlieb, C. D., Fasch, E. V., Kohlwein, S. D., Paltauf, F., and Daum, G. (1991) Phospholipid synthesis and lipid composition of subcellular membranes in the unicellular eukaryote Saccharomyces cerevisiae, J Bacteriol 173, 2026-2034. Calero, M., Chen, C. Z., Zhu, W., Winand, N., Havas, K. A., Gilbert, P. M., Burd, C. G., and Collins, R. N. (2003) Dual prenylation is required for Rab protein localization and function, Mol Biol Cell 14, 1852-1867. Yan, D., and Olkkonen, V. M. (2008) Characteristics of oxysterol binding proteins, Int Rev Cytol 265, 253-285. Nishizuka, Y. (1986) Studies and perspectives of protein kinase C, Science 233, 305312. Bottomley, M. J., Salim, K., and Panayotou, G. (1998) Phospholipid-binding protein domains, Biochim Biophys Acta 1436, 165-183. Strahl, T., and Thorner, J. (2007) Synthesis and function of membrane phosphoinositides in budding yeast, Saccharomyces cerevisiae, Biochim Biophys Acta 1771, 353-404. Sreenivas, A., Patton-Vogt, J. L., Bruno, V., Griac, P., and Henry, S. A. (1998) A role for phospholipase D (Pld1p) in growth, secretion, and regulation of membrane lipid synthesis in yeast, J Biol Chem 273, 16635-16638. Rudge, S. A., Sciorra, V. A., Iwamoto, M., Zhou, C., Strahl, T., Morris, A. J., Thorner, J., and Engebrecht, J. (2004) Roles of phosphoinositides and of Spo14p (phospholipase D)-generated phosphatidic acid during yeast sporulation, Mol Biol Cell 15, 207-218. Young, B. P., Shin, J. J., Orij, R., Chao, J. T., Li, S. C., Guan, X. L., Khong, A., Jan, E., Wenk, M. R., Prinz, W. A., Smits, G. J., and Loewen, C. J. (2010) Phosphatidic acid is a pH biosensor that links membrane biogenesis to metabolism, Science 329, 1085-1088.  68  47. 48. 49.  50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62.  Andresen, B. T., Rizzo, M. A., Shome, K., and Romero, G. (2002) The role of phosphatidic acid in the regulation of the Ras/MEK/Erk signaling cascade, FEBS Lett 531, 65-68. Testerink, C., and Munnik, T. (2005) Phosphatidic acid: a multifunctional stress signaling lipid in plants, Trends Plant Sci 10, 368-375. Kooijman, E. E., Tieleman, D. P., Testerink, C., Munnik, T., Rijkers, D. T., Burger, K. N., and de Kruijff, B. (2007) An electrostatic/hydrogen bond switch as the basis for the specific interaction of phosphatidic acid with proteins, J Biol Chem 282, 11356-11364. Gietz, R. D., and Schiestl, R. H. (2007) High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method, Nat Protoc 2, 31-34. Pfeffer, S. R., Dirac-Svejstrup, A. B., and Soldati, T. (1995) Rab GDP dissociation inhibitor: putting rab GTPases in the right place, J Biol Chem 270, 17057-17059. Athenstaedt, K., Zweytick, D., Jandrositz, A., Kohlwein, S. D., and Daum, G. (1999) Identification and characterization of major lipid particle proteins of the yeast Saccharomyces cerevisiae, J Bacteriol 181, 6441-6448. Aitchison, J. D., Nuttley, W. M., Szilard, R. K., Brade, A. M., Glover, J. R., and Rachubinski, R. A. (1992) Peroxisome biogenesis in yeast, Mol Microbiol 6, 34553460. Wang, P., Duan, W., Munn, A. L., and Yang, H. (2005) Molecular characterization of Osh6p, an oxysterol binding protein homolog in the yeast Saccharomyces cerevisiae, FEBS J 272, 4703-4715. Mukai, H., Shuntoh, H., Chang, C. D., Asami, M., Ueno, M., Suzuki, K., and Kuno, T. (1994) Isolation and characterization of CAJ1, a novel yeast homolog of dnaJ, Gene 145, 125-127. Loewen, C. J., Gaspar, M. L., Jesch, S. A., Delon, C., Ktistakis, N. T., Henry, S. A., and Levine, T. P. (2004) Phospholipid metabolism regulated by a transcription factor sensing phosphatidic acid, Science 304, 1644-1647. Ambesi, A., Miranda, M., Petrov, V. V., and Slayman, C. W. (2000) Biogenesis and function of the yeast plasma-membrane H(+)-ATPase, J Exp Biol 203, 155-160. Chan, G., Hardej, D., Santoro, M., Lau-Cam, C., and Billack, B. (2007) Evaluation of the antimicrobial activity of ebselen: role of the yeast plasma membrane H+-ATPase, J Biochem Mol Toxicol 21, 252-264. Han, G. S., O'Hara, L., Siniossoglou, S., and Carman, G. M. (2008) Characterization of the yeast DGK1-encoded CTP-dependent diacylglycerol kinase, J Biol Chem 283, 20443-20453. Han, G. S., Wu, W. I., and Carman, G. M. (2006) The Saccharomyces cerevisiae Lipin homolog is a Mg2+-dependent phosphatidate phosphatase enzyme, J Biol Chem 281, 9210-9218. Jedd, G., Richardson, C., Litt, R., and Segev, N. (1995) The Ypt1 GTPase is essential for the first two steps of the yeast secretory pathway, J Cell Biol 131, 583-590. Horazdovsky, B. F., Busch, G. R., and Emr, S. D. (1994) VPS21 encodes a rab5-like GTP binding protein that is required for the sorting of yeast vacuolar proteins, EMBO J 13, 1297-1309.  69  63. 64. 65. 66. 67.  68. 69. 70. 71. 72.  Kabcenell, A. K., Goud, B., Northup, J. K., and Novick, P. J. (1990) Binding and hydrolysis of guanine nucleotides by Sec4p, a yeast protein involved in the regulation of vesicular traffic, J Biol Chem 265, 9366-9372. Pfeffer, S. R., Soldati, T., Geissler, H., Rancano, C., and Dirac-Svejstrup, B. (1995) Selective membrane recruitment of Rab GTPases, Cold Spring Harb Symp Quant Biol 60, 221-227. Soldati, T., Shapiro, A. D., Svejstrup, A. B., and Pfeffer, S. R. (1994) Membrane targeting of the small GTPase Rab9 is accompanied by nucleotide exchange, Nature 369, 76-78. Ballew, N., Liu, Y., and Barlowe, C. (2005) A Rab requirement is not bypassed in SLY1-20 suppression, Mol Biol Cell 16, 1839-1849. Hess, D. T., Slater, T. M., Wilson, M. C., and Skene, J. H. (1992) The 25 kDa synaptosomal-associated protein SNAP-25 is the major methionine-rich polypeptide in rapid axonal transport and a major substrate for palmitoylation in adult CNS, J Neurosci 12, 4634-4641. Weimbs, T., Low, S. H., Chapin, S. J., Mostov, K. E., Bucher, P., and Hofmann, K. (1997) A conserved domain is present in different families of vesicular fusion proteins: a new superfamily, Proc Natl Acad Sci U S A 94, 3046-3051. Nakanishi, H., de los Santos, P., and Neiman, A. M. (2004) Positive and negative regulation of a SNARE protein by control of intracellular localization, Mol Biol Cell 15, 1802-1815. Huh, W. K., Falvo, J. V., Gerke, L. C., Carroll, A. S., Howson, R. W., Weissman, J. S., and O'Shea, E. K. (2003) Global analysis of protein localization in budding yeast, Nature 425, 686-691. Walsh, P., Bursac, D., Law, Y. C., Cyr, D., and Lithgow, T. (2004) The J-protein family: modulating protein assembly, disassembly and translocation, EMBO Rep 5, 567-571. Ptak, C., Anderson, A. M., Scott, R. J., Van de Vosse, D., Rogers, R. S., Sydorskyy, Y., Aitchison, J. D., and Wozniak, R. W. (2009) A role for the karyopherin Kap123p in microtubule stability, Traffic 10, 1619-1634.  70  Appendices Appendix A Primers Table A.1 Primers used in this study Primer Name Syd-myc-stop sens Syd-myc-stop anti 5’-Nde-Caj1 3’-Caj1-Xho1 Caj1-stop sens Caj1-stop anti Caj1-GFP forward Caj1-GFP reverse GFP-Caj1 forward GFP-Caj1 reverse  Sequence 5’ to 3’ Vector GTTGATCTCCGAGGAGGACCTCTAGCACCACCACCACCACCACTG pET23a CAGTGGTGGTGGTGGTGGTGCTAGAGGTCCTCCTCGGAGATCAAC atatcatATGGTAAAGGAGACGGAGTATTATGATATTTTGGGC pET23a tatactcgagTCTGGCCCACAGTATGTTTTTTGTGTTCCTC CATACTGTGGGCCAGACTCTAGCACCACCACCACCACCAC pET23a GTGGTGGTGGTGGTGGTGCTAGAGTCTGGCCACAGTATG GGTGAGCAGGAGAAGGAACACAAAAAACATACTGTGGCCAGAG GTGACGGTGCTGGTTTA Yeast ATATATGAAAAATATACATGAGGCGTTATTAACTTGCTGAGCTCGAT genome GAATTCGAGCTCG AATTAAGACGTATTAACTCAAAGGAAAAGAAAAGAGGGAATCATAC GATTTAGGTGACAC Yeast genome TGATGCCCAAAATATCATAATACTCCGTCTCCTTTACCATAGATCTC AAGTCCTCTTCAG  Product T7: Syd-Myc T7: Caj1-His6 T7: Caj1 Caj1-GFP  GFP-Caj1  71  Appendix B E. coli mass spectrometry results summary Table B.1 Complete list of proteins identified with Nd-YEG containing E. coli total lipid extract # 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40  Name Syd FolE GlyA HisB PflB FucR YqjL XerC Crp HinT MalQ MutY XerD RpsC YeeX Rob Tus SecA TrmH KdsD YbiB SlyD RpsB LpxA Hfq RpsO DapB SeqA YhbJ GutQ Rsd NikR Dcm RlmG RsuA TufB RpmF NusG AtdA Spy  Description SecY-interacting protein GTP cyclohydrolase I Serine hydroxymethyltransferase Histidine biosynthesis bifunctional protein Formate acetyltransferase Positive regulatory protein for fuc regulon Uncharacterized protein Site-specific tyrosine recombinase cAMP receptor protein Purine nucleoside phosphoramidase Amylomaltase A/G-specific adenine glycosylase Site-specific tyrosine recombinase 30S ribosomal subunit protein S3 function unknown Right origin-binding protein DNA replication terminus site-binding protein Preprotein translocase ATPase secretion component tRNA guanosine-2'-O-methyltransferase Arabinose 5-phosphate isomerase Uncharacterized protein FKBP-type peptidyl-prolyl cis-trans isomerase 30S ribosomal subunit protein S2 Udp N-Acetylglucosamine Acyltransferase Host factor-I protein 30S ribosomal subunit protein S15 Dihydrodipicolinate reductase Negative regulator of replication initiation nucleotide-binding protein Arabinose 5-phosphate isomerase Regulator of sigma D Nickel-responsive regulator of the nik operon DNA-cytosine methyltransferase 23S rRNA m(2)G1835 methyltransferase Ribosomal small subunit pseudouridine synthase A Translation elongation factor EF-Tu.B 50S ribosomal subunit protein L32 Transcription antitermination factor Spermidine acetyltransferase Spheroplast protein y  Swiss Prot Ratio accession 26.955 P0A8U0 4.195 P0A6T5 3.876 P0A825 3.375 P06987 3.182 P09373 2.799 P0ACK8 2.758 P64588 2.704 P0A8P6 2.421 P0ACJ8 2.190 P0ACE7 1.957 P15977 1.780 P17802 1.718 P0A8P8 1.692 P0A7V3 1.640 P0A8M6 1.629 P0ACI0 1.586 P16525 1.498 P10408 1.346 P0AGJ2 1.239 P45395 1.233 P30177 1.121 P0A9K9 1.101 P0A7V0 1.068 P0A722 1.012 P0A6X3 0.958 P0ADZ4 0.897 P04036 0.890 P0AFY8 0.878 P0A894 0.854 P17115 0.814 P0AFX4 0.805 P0A6Z6 0.789 P0AED9 0.647 P42596 0.584 P0AA43 0.496 P0CE48 0.492 P0A7N4 0.471 P0AFG0 0.440 P0A951 0.421 P77754 72  # 41 42 43 44 45 46 47 48  Name HemY YidC OmfP Lpp SecG PyrC OmpV SecY  Description Member of uro (hemC) operon Inner membrane protein Outer membrane porin Major outer membrane lipoprotein preprotein translocase dihydroorotase Outer membrane protein preprotein translocase  Ratio 0.137 0.120 0.074 0.042 0.039 0.036 0.023 0.011  Swiss Prot accession P0ACB7 P25714 P02931 P69776 P0AG99 P05020 P06111 P0AGA2  73  Table B.2 Complete list of proteins identified with Nd-YEG containing PG lipids # 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43  Name SecA XerC DnaJ Syd HinT FliC LpxA Fur Crp AtdA SeqA RpmF XerD RlmG YejD MutY RpsB NusG YqjL DnaA RpmA DapB KdsD SelB PriA GuaB NikR RfaF YhbJ GutQ TrmH DnaK MinD RpsO PyrB RpsL Rob RplC FtsZ Upp RpsC SlyD GlyA  Description Preprotein translocase ATPase secretion component Site-specific tyrosine recombinase Heat shock protein SecY-interacting protein Purine nucleoside phosphoramidase Flagellin Udp N-Acetylglucosamine Acyltransferase Ferric uptake regulator cAMP receptor protein Spermidine acetyltransferase Negative regulator of replication initiation 50S ribosomal subunit protein L32 Site-specific tyrosine recombinase 23S rRNA m(2)G1835 methyltransferase Uncharacterized protein A/G-specific adenine glycosylase 30S ribosomal subunit protein S2 Transcription antitermination factor Uncharacterized protein Chromosomal replication initiator protein 50S ribosomal subunit protein L27 Dihydrodipicolinate reductase Arabinose 5-phosphate isomerase Selenocysteine-specific elongation factor Primosome factor Y, protein N' Inosine-5'-monophosphate dehydrogenase Nickel-responsive regulator of the nik operon ADP-heptose--LPS heptosyltransferase 2 Nucleotide-binding protein Arabinose 5-phosphate isomerase tRNA guanosine-2'-O-methyltransferase heat shock chaperone Septum site-determining protein 30S ribosomal subunit protein S15 Aspartate carbamoyltransferase, catalytic subunit 30S ribosomal subunit protein S12 Right origin-binding protein 50S ribosomal subunit protein L3 Cell division protein Uracil phosphoribosyltransferase 30S ribosomal protein S3 FKBP-type peptidyl-prolyl cis-trans isomerase Serine hydroxymethyltransferase  Swiss Prot Ratio accession 34.956 P10408 8.961 P0A8P6 6.267 P08622 4.653 P0A8U0 3.708 P0ACE7 3.193 P04949 3.150 P0A722 3.034 P0A9A9 2.738 P0ACJ8 2.633 P0A951 2.359 P0AFY8 2.222 P0A7N4 2.043 P0A8P8 2.030 P42596 1.731 P46144 1.646 P17802 1.589 P0A7V0 1.588 P0AFG0 1.567 P64588 1.540 P03004 1.527 P0A7L8 1.519 P04036 1.392 P45395 1.342 P14081 1.244 P17888 1.231 P0ADG7 1.194 P0A6Z6 1.185 P37692 1.174 P0A894 1.137 P17115 1.109 P0AGJ2 1.034 P0A6Y8 1.021 P0AEZ3 1.021 P0ADZ4 0.959 P0A786 0.944 P0A7S3 0.878 P0ACI0 0.861 P60438 0.860 P0A9A6 0.786 P0A8F0 0.772 P0A7V3 0.740 P0A9K9 0.740 P0A825 74  # 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79  Name HemY TufB GldA RpsK AdhE Pal FucR PflB Ivy WzzE GrcA RecA CyoA AtpB SecF DacA YgiB OmpT Ndh CptA OmpA SecG AcrB MetQ Lpp RodZ PpiD PyrC YfgM YidC CydA YajC ZinT OmpF SecD YibN  Description Member of uro (hemC) operon Translation elongation factor EF-Tu.B glycerol dehydrogenase 30S ribosomal protein S11 Aldehyde-alcohol dehydrogenase Peptidoglycan-associated lipoprotein L-fucose operon activator Formate acetyltransferase Inhibitor of vertebrate lysozyme Lipopolysaccharide biosynthesis protein Autonomous glycyl radical cofactor General recombination and DNA repair cytochrome o ubiquinol oxidase subunit II ATP synthase subunit beta preprotein translocase chain F Alanyl-D-alanine carboxypeptidase Uncharacterized protein outer membrane protein, protease 7 NADH dehydrogenase Phosphoethanolamine transferase outer membrane protein A preprotein translocase G subunit Acriflavine resistance protein B D-methionine-binding lipoprotein Major outer membrane lipoprotein Cytoskeleton protein Peptidyl-prolyl cis-trans isomerase D dihydroorotase Uncharacterized protein Inner membrane protein Cytochrome d ubiquinol oxidase subunit 1 preprotein translocase subunit Metal binding protein outer membrane porin F subunit preprotein translocase D subunit uncharacterized protein  Ratio 0.545 0.509 0.491 0.487 0.485 0.457 0.422 0.326 0.319 0.297 0.262 0.262 0.237 0.232 0.226 0.231 0.166 0.161 0.106 0.100 0.065 0.059 0.061 0.055 0.055 0.056 0.050 0.051 0.041 0.033 0.031 0.030 0.013 0.012 0.006 0.011  Swiss Prot accession P0ACB7 P0CE48 P0A9S5 P0A7R9 P0A9Q7 P0A912 P0ACK8 P09373 P0AD59 P0AG00 P68066 P0A7G6 Q8XE63 P0ABB4 P0AG93 P0AEB2 P0ADT2 P09169 P00393 P0CB39 P0A910 P0AG99 P31224 P28635 P69776 P27434 P0ADY1 P05020 P76576 P25714 P0ABJ9 P0ADZ7 P76344 P02931 P0AG90 P0AG27  75  Table B.3 Complete list of proteins identified with Nd-MalFGK using glucose cultured SILAC extract # 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42  Name MalE SeqA RpsB YaeH PbpG Rob Crp NusG RlmG XerD XerC UspG RplC RpmF RsuA GutQ MalP RpsP PriA TrmI GldA LpxA SpeG RpmA PdxH SmpB RplR KdsD RpsJ RpsO YqjI RlmI PtsI TrmH PyrI ZinT RplQ NikR RplX Dcm RplI PriB  Description Maltose-binding protein, periplasmic Negative regulator of replication initiation 30S ribosomal subunit protein S2 Uncharacterized protein Murein D-alanyl-D-alanine endopeptidase Right origin-binding protein cAMP receptor protein Transcription antitermination factor 23S rRNA m(2)G1835 methyltransferase Site-specific tyrosine recombinase Site-specific tyrosine recombinase Stress protein, induced in stationary phase 50S ribosomal subunit protein L3 50S ribosomal subunit protein L32 16S rRNA U516 pseudouridine synthase D-arabinose 5-phosphate isomerase Maltodextrin phosphorylase 30S ribosomal subunit protein S16 Primosome factor Y, protein N' tRNA m(7)G46 methyltransferase, Glycerol dehydrogenase Udp N-Acetylglucosamine Acyltransferase Spermidine acetyltransferase 50S ribosomal subunit protein L27 Pyridoxine/pyridoxamine phosphate oxidase tmRNA RNA-binding protein 50S ribosomal subunit protein L18 D-arabinose 5-phosphate isomerase 30S ribosomal subunit protein S10 30S ribosomal subunit protein S15 Uncharacterized protein 23S rRNA m(5)C1962 methyltransferase Phosphotransferase system enzyme I tRNA mG18-2'-O-methyltransferase Aspartate carbamoyltransferase, regulatory subunit Periplasmic zinc and cadmium binding protein 50S ribosomal subunit protein L17 Nickel-responsive regulator of the nik operon 50S ribosomal subunit protein L24 DNA cytosine methyltransferase 50S ribosomal subunit protein L9 Primosomal protein N  Ratio 4.432 3.396 2.392 2.213 2.146 1.795 1.768 1.486 1.466 1.457 1.400 1.390 1.377 1.361 1.350 1.339 1.337 1.298 1.289 1.259 1.249 1.180 1.148 1.134 1.101 1.087 1.087 1.079 1.075 1.059 1.041 1.037 1.036 1.017 1.014 0.983 0.975 0.972 0.949 0.929 0.887 0.854  Swiss Prot accession P0AEX9 P0AFY8 P0A7V0 P62768 P0AFI5 P0ACI0 P0ACJ8 P0AFG0 P42596 P0A8P8 P0A8P6 P39177 P60438 P0A7N4 P0AA43 P17115 P00490 P0A7T3 P17888 P0AGJ7 P0A9S5 P0A722 P0A951 P0A7L8 P0AFI7 P0A832 P0C018 P45395 P0A7R5 P0ADZ4 P64588 P75864 P08839 P0AGJ2 P0A7F3 P76344 P0AG44 P0A6Z6 P60624 P0AED9 P0A7R1 P07013 76  # 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74  Name HelD IntS RplM PflB AdhE Upp RpsF Tig RplN RplB GroL RpmB YfiD LipA AsnA YbjS Rne GlyA RpsK BolA CheY EIIA FliC GrpE FusA FtsZ GlnQ RpsA SlyD RplA TufA Tsf  75  PurC  76 77 78 79 80 81 82 83 84 85  Rho HinT FolE CyoA AtpD PlsB OmpA OmpC MalK YbhC  Description ATP-dependent DNA Helicase IV Integrase, CPS-53/KpLE1 prophage 50S ribosomal subunit protein L13 Pyruvate formate lyase I Alcohol dehydrogenase, largely anaerobic Uracil phosphoribosyltransferase 30S ribosomal subunit protein S6 Trigger factor, protein folding chaperone 50S ribosomal subunit protein L14 50S ribosomal subunit protein L2 Chaperonin Cpn60 50S ribosomal subunit protein L28 Autonomous glycine radical cofactor Lipoyl synthase, iron-sulfur protein Asparagine synthase A Uncharacterized protein RNase E Serine hydroxymethyltransferase 30S ribosomal subunit protein S11 Transcriptional repressor for mreB Protein phosphatase phosphocarrier for glucose PTS transport Flagellin, structural gene, H-antigen Nucleotide exchange factor for the DnaKJ chaperone Elongation Factor EF-G Cell division protein Glutamine high-affinity transport system 30S ribosomal subunit protein S1 FKBP-type peptidyl-prolyl cis-trans isomerase 50S ribosomal subunit protein L1 EF-Tu, Elongation Factor-Translation EF-Ts, Elongation Factor-Translation, stable Phosphoribosyl-aminoimidazole-succinocarboxamide synthase Transcription termination factor Purine nucleoside phosphoramidase GTP cyclohydrolase I Cytochrome o oxidase subunit II, lipoprotein ATP synthase subunit beta Glycerol-3-phosphate acyltransferase Outer membrane protein A Outer membrane porin C Maltose transport complex, ATP-binding subunit Acyl-CoA thioesterase, verified lipoprotein  Ratio 0.846 0.798 0.749 0.731 0.731 0.714 0.705 0.697 0.689 0.646 0.625 0.622 0.602 0.573 0.544 0.538 0.524 0.522 0.511 0.489 0.458 0.449 0.443 0.436 0.425 0.402 0.391 0.388 0.380 0.372 0.362 0.346  Swiss Prot accession P15038 P37326 P0AA10 P09373 P0A9Q7 P0A8F0 P02358 P0A850 P0ADY3 P60422 P0A6F5 P0A7M2 P68066 P60716 P00963 P75821 P21513 P0A825 P0A7R9 P0ABE2 P0A9H9 P69783 P04949 P09372 P0A6M8 P0A9A6 P10346 P0AG67 P0A9K9 P0A7L0 P0CE47 P0A6P1  0.346  P0A7D7  0.326 0.268 0.232 0.208 0.093 0.090 0.080 0.064 0.050 0.040  P0AG30 P0ACE7 P0A6T5 Q8XE63 P0ABA4 P0A7A7 P0A910 P06996 P68187 P46130 77  # 86 87 88 89 90 91 92  Name MalG MalF MetQ DacA HemY AcrB Ndh  Description Maltose transport complex Maltose transport complex Periplasmic methionine binding lipoprotein D-alanine D-alanine carboxypeptidase PBP5 Member of uro (hemC) operon AcrAB-TolC multidrug efflux pump Respiratory NADH dehydrogenase II  Raio 0.035 0.033 0.031 0.027 0.024 0.016 0.015  Swiss port asscession P68183 P02916 P28635 P0AEB2 P0ACB7 P31224 P00393  78  Table B.4 Complete list of proteins identified with Nd-MalFGK using maltose cultured SILAC extract # 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42  Name MalE YaeH MinD RpmG RpmA RpsO RpmB RpmF AmiA Hfq ZinT Rob YfgM MalQ RlmG RplB RplC PyrB YqjI PbpG PriB RlmI XerD NikR RplX Dcm RpsP RsuA PyrI FucR GutQ GldA KdsD MalP LpxA Spy PriA RplM TrmI TrmH SpeG ZraP  Description Maltose-binding protein, periplasmic Uncharacterized protein Inhibition of FtsZ ring polymerization 50S ribosomal subunit protein L33 50S ribosomal subunit protein L27 30S ribosomal subunit protein S15 50S ribosomal subunit protein L28 50S ribosomal subunit protein L32 N-acetylmuramyl-L-alanine amidase, periplasmic Global regulator of sRNA function Periplasmic zinc and cadmium binding protein Right origin-binding protein Uncharacterized protein Amylomaltase 23S rRNA m(2)G1835 methyltransferase 50S ribosomal subunit protein L2 50S ribosomal subunit protein L3 Aspartate carbamoyltransferase, catalytic subunit Uncharacterized protein Murein D-alanyl-D-alanine endopeptidase Primosomal protein n 23S rRNA m(5)C1962 methyltransferase Site-specific tyrosine recombinase Nickel-responsive regulator of the nik operon 50S ribosomal subunit protein L24 DNA cytosine methyltransferase 30S ribosomal subunit protein S16 16S rRNA U516 pseudouridine synthase Aspartate carbamoyltransferase, regulatory subunit L-fucose operon activator D-arabinose 5-phosphate isomerase Glycerol dehydrogenase, NAD+ dependent D-arabinose 5-phosphate isomerase Maltodextrin phosphorylase Udp N-Acetylglucosamine Acyltransferase Spheroplast protein y Primosome factor Y, protein n' 50S ribosomal subunit protein L13 tRNA m(7)G46 methyltransferase tRNA mG18-2'-O-methyltransferase Spermidine acetyltransferase Zn-binding periplasmic protein  Ratio 26.386 2.434 1.555 1.226 1.132 1.108 0.969 0.963 0.959 0.930 0.922 0.880 0.869 0.855 0.848 0.843 0.834 0.826 0.797 0.785 0.764 0.758 0.754 0.740 0.732 0.731 0.725 0.716 0.704 0.679 0.674 0.673 0.658 0.654 0.648 0.645 0.615 0.610 0.609 0.593 0.587 0.577  Swiss Prot accession P0AEX9 P62768 P0AEZ3 P0A7N9 P0A7L8 P0ADZ4 P0A7M2 P0A7N4 P36548 P0A6X3 P76344 P0ACI0 P76576 P15977 P42596 P60422 P60438 P0A786 P64588 P0AFI5 P07013 P75864 P0A8P8 P0A6Z6 P60624 P0AED9 P0A7T3 P0AA43 P0A7F3 P0ACK8 P17115 P0A9S5 P45395 P00490 P0A722 P77754 P17888 P0AA10 P0AGJ7 P0AGJ2 P0A951 P0AAA9 79  #  43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86  Name RpsS HinT RpsB RplR XerC RpmD YfiD Crp RpsF PyrC DnaK PflB RpsL CheY FliC RpsK FrdB SlyD KdsA RplN RpsC CyoA CheZ RplK Tsf FusA Tsr NusG GatY TolC RplJ MreB AdhE PlsB OmpF AtpD TufA FolE Rne FtsZ Lpd HemL AceE MalM  Description 30S ribosomal subunit protein S19 Purine nucleoside phosphoramidase 30S ribosomal subunit protein S2 50S ribosomal subunit protein L18 Site-specific tyrosine recombinase 50S ribosomal subunit protein L30 Autonomous glycine radical cofactor cAMP receptor protein 30S ribosomal subunit protein S6 Dihydroorotase Hsp70 molecular chaperone, heat-inducible Pyruvate formate lyase I 30S ribosomal subunit protein S12 Chemotaxis protein Flagellin, structural gene, H-antigen 30S ribosomal subunit protein S11 Fumarate reductase iron-sulfur protein subunit FKBP-type peptidyl-prolyl cis-trans isomerase 2-dehydro-3-deoxyphosphooctonate aldolase 50S ribosomal subunit protein L14 30S ribosomal subunit protein S3 Cytochrome o oxidase subunit II, lipoprotein CheY-P phosphatase 50S ribosomal subunit protein L11 EF-Ts, Elongation Factor-Translation, stable Elongation Factor EF-G Serine chemoreceptor, methyl-accepting Transcription antitermination factor D-Tagatose-1,6-bisphosphate aldolase, class II Outer membrane protein 50S ribosomal subunit protein L10 Rod shape-determining protein Alcohol dehydrogenase, largely anaerobic Glycerol-3-phosphate acyltransferase Outer membrane porin F ATP synthase subunit delta EF-Tu, Elongation Factor-Translation, unstable GTP cyclohydrolase I RNase E Cell division protein Lipoamide dehydrogenase, NADH-dependent Glutamate-1-semialdehyde aminomutase Pyruvate dehydrogenase E1 component Periplasmic protein in malK operon  Ratio 0.559 0.555 0.555 0.539 0.529 0.520 0.515 0.512 0.481 0.480 0.461 0.449 0.444 0.435 0.429 0.406 0.402 0.368 0.338 0.324 0.323 0.322 0.315 0.292 0.283 0.280 0.276 0.259 0.247 0.234 0.221 0.211 0.193 0.190 0.185 0.173 0.135 0.119 0.098 0.076 0.075 0.072 0.042 0.041  Swiss Prot accession P0A7U3 P0ACE7 P0A7V0 P0C018 P0A8P6 P0AG51 P68066 P0ACJ8 P02358 P05020 P0A6Y8 P09373 P0A7S3 P0AE67 P04949 P0A7R9 P0AC47 P0A9K9 P0A715 P0ADY3 P0A7V3 Q8XE63 P0A9H9 P0A7J7 P0A6P1 P0A6M8 P02942 P0AFG0 P0C8J6 P02930 P0A7J3 P0A9X4 P0A9Q7 P0A7A7 P02931 P0ABA4 P0CE47 P0A6T5 P21513 P0A9A6 P0A9P0 P23893 P0AFG8 P03841 80  # 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101  Name RecA Ndh AcrB YgiB YcgR Pal MalF DacA NhaB SdaC MetQ OmpA MalK OmpC LamB  Description General recombination and DNA repair Respiratory NADH dehydrogenase II AcrAB-TolC multidrug efflux pump Uncharacterized protein Flagellar brake protein Lipoprotein associated with peptidoglycan Maltose transport complex D-alanine D-alanine carboxypeptidase PBP5 Na+/H+ antiporter 2, weakly pH-dependent Serine:H+ symport permease, threonine-insensitive Periplasmic methionine binding lipoprotein Outer membrane protein A Maltose transport complex, ATP-binding subunit Outer membrane porin C Maltoporin, maltose high-affinity uptake system  Ratio 0.033 0.032 0.032 0.027 0.026 0.023 0.023 0.021 0.018 0.018 0.016 0.015 0.015 0.015 0.011  Swiss prot accession P0A7G6 P00393 P31224 P0ADT2 P76010 P0A912 P02916 P0AEB2 P0AFA7 P0AAD6 P28635 P0A910 P68187 P06996 P02943  81  Table B.5 Complete list of proteins identified with Nd-YidC # 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43  Name XerC FucR GrcA PflB GylA HinT FolE HisB Rob PyrL YcfP Tus Fur XerD YqjL TrmB RpsC TrmH LpxA KdsD Crp RsuA SpeG RpsB SeqA AcpS GldA PriA RlmG SlyD NikR PurU RpsK RpmF ZraP Rsd Hfq YhbJ RpsO DnaJ NusG Syd RpmB  Description Site-specific tyrosine recombinase L-fucose operon activator autonomous glycyl radical cofactor formate C-acetyltransferase Serine hydroxymethyltransferase purine nucleoside phosphoramidase GTP cyclohydrolase I Histidine biosynthesis bifunctional protein hisB Right origin-binding protein aspartate carbamoyltransferase regulatory chain orf, hypothetical protein; putative hydrolase DNA replication terminus site-binding protein Ferric uptake regulation protein Site-specific tyrosine recombinase Uncharacterized protein tRNA (guanine-N(7)-)-methyltransferase 30S ribosomal protein S3 tRNA guanosine-2'-O-methyltransferase Udp N-Acetylglucosamine Acyltransferase Arabinose 5-phosphate isomerase Catabolite gene activator Ribosomal small subunit pseudouridine synthase A Spermidine N(1)-acetyltransferase 30S ribosomal protein S2 Negative regulator of replication initiation Holo-[acyl-carrier-protein] synthase Glycerol dehydrogenase Primosomal protein N' Ribosomal RNA large subunit methyltransferase G FKBP-type peptidyl-prolyl cis-trans isomerase Nickel responsive regulator Formyltetrahydrofolate deformylase 30S ribosomal protein S11 50S ribosomal protein L32 Zinc resistance-associated protein Regulator of sigma D Hfq protein (Host factor-I protein) (HF-I) (HF-1) Nucleotide-binding protein 30S ribosomal protein S15 Heat shock protein Transcription antitermination factor Interacts with the secY protein in vivo 50S ribosomal protein L28  Ratio 5.172 5.110 3.933 3.313 3.238 3.232 2.981 2.719 1.871 1.777 1.752 1.642 1.585 1.554 1.498 1.395 1.338 1.296 1.295 1.276 1.275 1.206 1.205 1.183 1.173 1.164 1.153 1.128 1.081 1.046 1.024 0.978 0.973 0.913 0.836 0.827 0.800 0.744 0.740 0.660 0.632 0.625 0.544  Swiss Prot accession P0A8P6 P0ACK8 P68066 P09373 P0A825 P0ACE7 P0A6T5 P06987 P0ACI0 P0A7F3 P0A8E1 P16525 P0A9A9 P0A8P8 P64588 P17802 P0A7V3 P0AGJ2 P0A722 P45395 P0ACJ8 P0AA43 P0A951 P0A7V0 P0AFY8 P24224 P0A9S5 P17888 P42596 P0A9K9 P0A6Z6 P37051 P0A7R9 P0A7N4 P0AAA9 P0AFX4 P0A6X3 P0A894 P0ADZ4 P08622 P0AFG0 P0A8U0 P0A7M2 82  # 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62  Name TufB RpsD RplE Spy DacA OmpA HemY YidC Lpp YcgK PyrC SecG SecY YajC WaaA OmpV OmpF YibN SecE  Description Translation elongation factor EF-Tu.B 30S ribosomal protein S4 50S ribosomal protein L5 Spheroplast protein y D-alanyl-D-alanine carboxypeptidase Outer membrane protein A Involved in a late step of protoheme IX synthesis Inner membrane protein Major outer membrane lipoprotein Uncharacterized protein Dihydroorotase [Escherichia coli] Protein-export membrane protein Preprotein translocase subunit Part of the secDF-yidC-yajC translocase complex 3-deoxy-D-manno-octulosonic-acid transferase Outer membrane protein Outer membrane porin Uncharacterized protein preprotein translocase subunit  Ratio 0.538 0.455 0.364 0.344 0.305 0.116 0.096 0.059 0.056 0.048 0.041 0.027 0.026 0.024 0.023 0.018 0.018 0.005 0.000  Swiss Prot accession P0CE47 P0A7V8 P62399 P77754 P0AEB2 P0A910 P0ACB7 P25714 P69776 P76002 P05020 P0AG99 P0AGA2 P0ADZ7 P0AC75 Q8X553 P02931 P0AG27 P0AG96  83  Appendix C S. cerevisiae mass spectrometry results summary Table C.1 Complete list of proteins identified with Nd-Ec # 1 2 3 4 5  Name OSH6 YPT1 FAA1 RPS5 VPS21  6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27  CDC19 DED1 PDC1 SAH1 TDH2 RPL20A ADH1 SSE1 EFT1 SRO9 TDH3 RPS7B RPL38 MHP1 GPD2 RPL17B ENO2 RPL25 RPS22A YCK2 FBA1 RPS14A  Description Member of an oxysterol-binding protein family Ras-like small GTPase, involved in the ER-to-Golgi step of the secretory pathway Long chain fatty acyl-CoA synthetase with a preference for C12:0-C16:0 fatty acids Ribosomal protein GTPase required for transport during endocytosis and for correct sorting of vacuolar hydrolases Pyruvate kinase ATP-dependent DEAD (Asp-Glu-Ala-Asp)-box RNA helicase Major of three pyruvate decarboxylase isozymes S-adenosyl-L-homocysteine hydrolase Glyceraldehyde-3-phosphate dehydrogenase Ribosomal protein Alcohol dehydrogenase ATPase that is a component of the heat shock protein Hsp90 chaperone complex Elongation factor 2 (EF-2) Cytoplasmic RNA-binding protein that associates with translating ribosomes Glyceraldehyde-3-phosphate dehydrogenase, isozyme 3 Ribosomal protein Ribosomal protein Microtubule-associated protein involved in assembly and stabilization of microtubules NAD-dependent glycerol 3-phosphate dehydrogenase Ribosomal protein Enolase II, a phosphopyruvate hydratase Ribosomal protein Ribosomal protein Palmitoylated, plasma membrane-bound casein kinase I isoform Fructose 1,6-bisphosphate aldolase Ribosomal protein  Ratio 11.538 10.300 9.832 4.312 3.448  Accession number YKR003W YFL038C YOR317W YJR123W YOR089C  1.775 1.761 1.730 1.611 1.586 1.520 1.424 1.398 1.397 1.367 1.347 1.326 1.299 1.288 1.273 1.248 1.185 1.183 1.161 1.113 1.106 1.095  YAL038W YOR204W YLR044C YER043C YJR009C YMR242C YOL086C YPL106C YOR133W YCL037C YGR192C YNL096C YLR325C YJL042W YOL059W YJL177W YHR174W YOL127W YJL190C YNL154C YKL060C YCR031C  84  # 28 29 30 31  Name YEF3 GPM1 RPS13 HRK1  32 33 34 35 36 37 38  SCD6 RPL30 RPL32 PGK1 RPS20 SAM1 SSA1  39 40 41 42 43 44 45 46 47 48 49 50  CDC33 STM1 DLD3 YNL208W RPS2 CAJ1 YDL025C HYP2 RPL12A TEF1 RPL22A PNC1  51 52 53 54  PHO8 RPL16A RPS10B HBT1  Description Translational elongation factor 3 Tetrameric phosphoglycerate mutase Ribosomal protein Protein kinase implicated in activation of the plasma membrane H(+)-ATPase Pma1p in response to glucose metabolism Protein containing an Lsm domain, may bind RNA and have a role in RNA processing Ribosomal protein Ribosomal protein 3-phosphoglycerate kinase Ribosomal protein S-adenosylmethionine synthetase ATPase involved in protein folding and nuclear localization signal (NLS)-directed nuclear transport Cytoplasmic mRNA cap binding protein Protein that binds G4 quadruplex and purine motif triplex nucleic acid D-lactate dehydrogenase Protein of unknown function Ribosomal protien Nuclear type II J heat shock protein of the E. coli dnaJ family Uncharacterized ORF Translation initiation factor eIF-5A Ribosomal protein Translational elongation factor EF-1 alpha Ribosomal protein Nicotinamidase that converts nicotinamide to nicotinic acid as part of the NAD(+) salvage pathway Repressible alkaline phosphatase Ribosomal protein Ribosomal protein Substrate of the Hub1p ubiquitin-like protein that localizes to the shmoo tip  Ratio 1.088 1.072 1.061 1.013  Accession number YLR249W YKL152C YDR064W YOR267C  0.992 0.977 0.975 0.961 0.96 0.955 0.939  YPR129W YGL030W YBL092W YCR012W YHL015W YLR180W YAL005C  0.928 0.928 0.911 0.904 0.903 0.896 0.892 0.888 0.885 0.873 0.865 0.862  YOL139C YLR150W YEL071W YNL208W YGL123W YER048C YDL025C YEL034W YEL054C YPR080W YLR061W YGL037C  0.799 0.787 0.772 0.765  YDR481C YIL133C YMR230W YDL223C  85  # 55 56 57 58 59 60 61 62 63  Name SHM2 RPL3 RPL19B RPS27B LSP1 RPL9B RPS17A RPS26B SNF4  64 SUI1 65 SNF1 66 TSA1 67 MBF1 68 69 70 71 72 73 74 75 76 77  NMA1 RPS24B GAL83 RPL35B RPS18B RPP0 ACT1 RPS1B AHP1 RPS0B  Description Cytosolic serine hydroxymethyltransferase Ribosomal protein Ribosomal protein Ribosomal protein Primary component of eisosomes Ribosomal protein Ribosomal protein Ribosomal protein Activating gamma subunit of the AMP-activated Snf1p kinase complex (contains Snf1p and a Sip1p/Sip2p/Gal83p family member) Translation initiation factor eIF1 AMP-activated serine/threonine protein kinase found in a complex containing Snf4p and members of the Sip1p/Sip2p/Gal83p family Ubiquitous housekeeping thioredoxin peroxidase Transcriptional coactivator that bridges the DNA-binding region of Gcn4p and TATAbinding protein Spt15p Nicotinic acid mononucleotide adenylyltransferase Ribosomal protein One of three possible beta-subunits of the Snf1 kinase complex Ribosomal protein Ribosomal protein Ribosomal protein Actin, structural protein involved in cell polarization Ribosomal protein Thiol-specific peroxiredoxin Ribosomal protein  Ratio 0.762 0.753 0.746 0.74 0.736 0.7 0.698 0.69 0.681  Accession number YLR058C YOR063W YBL027W YHR021C YPL004C YNL067W YML024W YER131W YGL115W  0.653 0.627  YNL244C YDR477W  0.606 0.602  YML028W YOR298C-A  0.594 0.575 0.557 0.454 0.441 0.393 0.389 0.365 0.229 0.123  YLR328W YIL069C YER027C YDL136W YML026C YLR340W YFL039C YML063W YLR109W YLR048W  86  Table C.2 Complete list of proteins identified with Nd-PE # 1 2  Name YPT1 VPS21  3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28  SEC4 RPL22A RPS5 TIF1 ENO2 FAA1 PGK1 HSC82 RPS7B IMD3 ACT1 CAJ1 RPL12A RPS18B RPL38 RPL17B RPS14A YEF3 RPL30 RPS24B RPS13 RPL9A GPD2 RPS20 GPM1 RPS22A  Description Ras-like small GTPase, involved in the ER-to-Golgi step of the secretory pathway GTPase required for transport during endocytosis and for correct sorting of vacuolar hydrolases Secretory vesicle-associated Rab GTPase essential for exocytosis Ribosomal protein Ribosomal protein Translation initiation factor eIF4A Enolase II Long chain fatty acyl-CoA synthetase with a preference for C12:0-C16:0 fatty acids 3-phosphoglycerate kinase Cytoplasmic chaperone of the Hsp90 family Ribosomal protein inosine monophosphate dehydrogenase Actin, structural protein involved in cell polarization Nuclear type II J heat shock protein of the E. coli dnaJ family Ribosomal protein Ribosomal protein Ribosomal protein Ribosomal protein Ribosomal protein Translational elongation factor 3 Ribosomal protein Ribosomal protein Ribosomal protein Ribosomal protein NAD-dependent glycerol 3-phosphate dehydrogenase, homolog of Gpd1p Ribosomal protein Tetrameric phosphoglycerate mutase Ribosomal protein  Ratio 16.803 10.100  Accession number YFL038C YOR089C  8.019 3.145 2.515 2.480 2.260 2.180 2.077 1.836 1.657 1.643 1.525 1.523 1.497 1.417 1.326 1.321 1.298 1.294 1.265 1.241 1.222 1.184 1.168 1.130 1.126 1.125  YFL005W YLR061W YJR123W YKR059W YHR174W YOR317W YCR012W YMR186W YNL096C YLR432W YFL039C YER048C YEL054C YML026C YLR325C YJL177W YCR031C YLR249W YGL030W YIL069C YDR064W YGL147C YOL059W YHL015W YKL152C YJL190C  87  # 29 30 31 32 33 34 35 36 37 38 39  Name RPL19B SBP1 RPL25 SSE1 RPS28A YRA1 ADH1 PDC1 IST2 THO1 HRK1  40 DED1 41 VMA10 42 HSP10 43 STM1 44 CDC19 45 46 47 48 49  IPP1 RSP5 SSZ1 PAB1 SSA1  50 EGD2 51 ADH3 52 TEF1  Description Ribosomal protein Nucleolar single-strand nucleic acid binding protein Ribosomal protein ATPase that is a component of the heat shock protein Hsp90 chaperone complex Ribosomal protein Nuclear protein that binds to RNA and to Mex67p, Alcohol dehydrogenase Major of three pyruvate decarboxylase isozymes Plasma membrane protein that may be involved in osmotolerance Conserved nuclear RNA-binding protein Protein kinase implicated in activation of the plasma membrane H(+)-ATPase Pma1p in response to glucose metabolism ATP-dependent DEAD (Asp-Glu-Ala-Asp)-box RNA helicase Vacuolar H+ ATPase subunit G of the catalytic (V1) sector, involved in vacuolar acidification; Mitochondrial matrix co-chaperonin that inhibits the ATPase activity of Hsp60p, a mitochondrial chaperonin; Protein that binds G4 quadruplex and purine motif triplex nucleic acid Pyruvate kinase, functions as a homotetramer in glycolysis to convert phosphoenolpyruvate to pyruvate,; Cytoplasmic inorganic pyrophosphatase (PPase), Ribosomal protein Hsp70 protein that interacts with Zuo1p Poly(A) binding protein ATPase involved in protein folding and nuclear localization signal (NLS)-directed nuclear transport; Alpha subunit of the heteromeric nascent polypeptide-associated complex (NAC) involved in protein sorting and translocation, Mitochondrial alcohol dehydrogenase isozyme III Translational elongation factor EF-1 alpha  Ratio 1.119 1.101 1.086 1.081 1.031 0.973 0.971 0.965 0.962 0.961 0.96  Accession number YBL027W YHL034C YOL127W YPL106C YOR167C YDR381W YOL086C YLR044C YBR086C YER063W YOR267C  0.959 0.951  YOR204W YHR039C-A  0.942  YOR020C  0.918 0.888  YLR150W YAL038W  0.885 0.885 0.881 0.852 0.848  YBR011C YER125W YHR064C YER165W YAL005C  0.844  YHR193C  0.844 0.838  YMR083W YPR080W  88  # Name 53 PNC1 54 EGD1 55 56 57 58 59 60  TEF4 TFP1 PHO8 YCK2 DLD3 HBT1  61 SUI1 62 YDL025C 63 TDH3 64 65 66 67  LSP1 IDH2 YNL208W SNF1  68 SHM2 69 UGP1 70 MBF1 71 TMA7 72 SNF4 73 SRO9 74 MHP1 75 RPL28  Description Nicotinamidase that converts nicotinamide to nicotinic acid as part of the NAD(+) salvage pathway Subunit beta1 of the nascent polypeptide-associated complex (NAC) involved in protein targeting Translation elongation factor EF-1 gamma Vacuolar ATPase V1 domain subunit A containing the catalytic nucleotide binding sites Repressible alkaline phosphatase, a glycoprotein localized to the vacuole Palmitoylated, plasma membrane-bound casein kinase I isoform D-lactate dehydrogenase Substrate of the Hub1p ubiquitin-like protein that localizes to the shmoo tip (mating projection) Translation initiation factor eIF1 Putative protein kinase, potentially phosphorylated by Cdc28p; Glyceraldehyde-3-phosphate dehydrogenase, isozyme 3, involved in glycolysis and gluconeogenesis Primary component of eisosomes Subunit of mitochondrial NAD(+)-dependent isocitrate dehydrogenase Protein of unknown function; may interact with ribosomes AMP-activated serine/threonine protein kinase found in a complex containing Snf4p and members of the Sip1p/Sip2p/Gal83p family; Cytosolic serine hydroxymethyltransferase, involved in one-carbon metabolism UDP-glucose pyrophosphorylase (UGPase) Transcriptional coactivator that bridges the DNA-binding region of Gcn4p and TATAbinding protein Spt15p of unknown that associates with ribosomes Activating gamma subunit of the AMP-activated Snf1p kinase complex (contains Snf1p and a Sip1p/Sip2p/Gal83p family member) Cytoplasmic RNA-binding protein that associates with translating ribosomes Microtubule-associated protein involved in assembly and stabilization of microtubules Ribosomal protein  Ratio 0.827  Accession number YGL037C  0.816  YPL037C  0.816 0.814 0.814 0.808 0.805 0.804  YKL081W YDL185W YDR481C YNL154C YEL071W YDL223C  0.802 0.791 0.789  YNL244C YDL025C YGR192C  0.787 0.770 0.768 0.745  YPL004C YOR136W YNL208W YDR477W  0.739 0.730 0.73  YLR058C YKL035W YOR298C-A  0.724 0.714  YLR262C-A YGL115W  0.693 0.688 0.671  YCL037C YJL042W YGL103W  89  # 76 77 78 79 80 81  Name GPD1 NMA1 TUB2 DOT6 FRP3 SIK1  82 SHE3 83 TDH1 84 85 86 87 88  TSA1 ZPS1 RPS7A RPL20A AHP1  89 YPT7  Description NAD-dependent glycerol-3-phosphate dehydrogenase Nicotinic acid mononucleotide adenylyltransferase, involved in NAD(+) salvage pathway Beta-tubulin Protein of unknown function, involved in telomeric gene silencing and filamentation Nucleolar peptidyl-prolyl cis-trans isomerase (PPIase) Essential evolutionarily-conserved nucleolar protein component of the box C/D snoRNP complexes that direct 2'-O-methylation of pre-rRNA during its maturation Protein that acts as an adaptor between Myo4p and the She2p-mRNA complex Glyceraldehyde-3-phosphate dehydrogenase, isozyme 1, involved in glycolysis and gluconeogenesis Ubiquitous housekeeping thioredoxin peroxidase Putative GPI-anchored protein Ribosomal protein Ribosomal protein Thiol-specific peroxiredoxin, reduces hydroperoxides to protect against oxidative damage; GTPase; GTP-binding protein of the rab family  Ratio 0.663 0.663 0.655 0.649 0.646 0.572  Accession number YDL022W YLR328W YFL037W YER088C YML074C YLR197W  0.558 0.550  YBR130C YJL052W  0.543 0.541 0.473 0.370 0.249  YML028W YOL154W YOR096W YMR242C YLR109W  0.004  YML001W  90  Table C.3 Complete list of proteins identified with Nd-PEPA (50:50) # 1 2 3 4 5 6 7  Name CAJ1 RPS5 FAA1 RPL11B YPT1 RPS6A VPS21  8 9 10 11 12 13 14 15 16 17  RPS17A RPS4A RPL35B YFL002W-A RPS13 RPL19B LSP1 RPS18B MHP1 TDH2  18 19 20 21 22  RPS15 RPS25A RPS24B RPL17B HRK1  23 24 25  YDL025C GPD2 YNL208W  Description Nuclear type II J heat shock protein of the E. coli dnaJ family Ribosomal protein Long chain fatty acyl-CoA synthetase with a preference for C12:0-C16:0 fatty acids Ribosomal protein Ras-like small GTPase, involved in the ER-to-Golgi step of the secretory pathway Ribosomal protein GTPase required for transport during endocytosis and for correct sorting of vacuolar hydrolases Ribosomal protein Ribosomal protein Ribosomal protein Retrotransposon TYA Gag and TYB Pol genes Ribosomal protein Ribosomal protein Primary component of eisosomes Ribosomal protein Microtubule-associated protein involved in assembly and stabilization of microtubules Glyceraldehyde-3-phosphate dehydrogenase, isozyme 2, involved in glycolysis and gluconeogenesis Ribosomal protein Ribosomal protein Ribosomal protein Ribosomal protein Protein kinase implicated in activation of the plasma membrane H(+)-ATPase Pma1p in response to glucose metabolism Putative protein kinase, potentially phosphorylated by Cdc28p NAD-dependent glycerol 3-phosphate dehydrogenase Protein of unknown function; may interact with ribosomes, based on co-purification experiments  Ratio 16.322 7.612 6.582 5.944 5.864 5.509 4.866  Accession number YER048C YJR123W YOR317W YGR085C YFL038C YPL090C YOR089C  4.431 4.195 3.373 2.890 2.539 2.077 1.820 1.813 1.809 1.750  YML024W YJR145C YDL136W YFL002W-A YDR064W YBL027W YPL004C YML026C YJL042W YJR009C  1.733 1.729 1.625 1.569 1.524  YOL040C YGR027C YIL069C YJL177W YOR267C  1.522 1.456 1.443  YDL025C YOL059W YNL208W  91  # 26  Name SAM1  27 28  RPL5 SSB2  29 30  RPL31A SSA1  31 32 33  RPL20A RPS3 TDH3  34 35 36 37 38  RPS26B RPS22A YEF3 SSE1 CDC19  39 40 41 42  TSA1 SRO9 RPS20 HBT1  43 44 45 46 47 48 49  RPL14B RPL9B EFT1 RPL25 DLD3 RPL7A CDC33  Description S-adenosylmethionine synthetase, catalyzes transfer of the adenosyl group of ATP to the sulfur atom of methionine Ribosomal protein Cytoplasmic ATPase that is a ribosome-associated molecular chaperone, functions with J-protein partner Zuo1p Ribosomal protein ATPase involved in protein folding and nuclear localization signal (NLS)-directed nuclear transport Ribosomal protein Ribosomal protein Glyceraldehyde-3-phosphate dehydrogenase, isozyme 3, involved in glycolysis and gluconeogenesis Ribosomal protein Ribosomal protein Translational elongation factor 3 ATPase that is a component of the heat shock protein Hsp90 chaperone complex Pyruvate kinase, functions as a homotetramer in glycolysis to convert phosphoenolpyruvate to pyruvate Ubiquitous housekeeping thioredoxin peroxidase Cytoplasmic RNA-binding protein that associates with translating ribosomes Ribosomal protein Substrate of the Hub1p ubiquitin-like protein that localizes to the shmoo tip (mating projection) Ribosomal protein Ribosomal protien Elongation factor 2 (EF-2), also encoded by EFT2 Ribosomal protein D-lactate dehydrogenase Ribosomal protein Cytoplasmic mRNA cap binding protein  Ratio 1.434  Accession number YLR180W  1.405 1.376  YPL131W YNL209W  1.359 1.356  YDL075W YAL005C  1.349 1.303 1.257  YMR242C YNL178W YGR192C  1.256 1.248 1.247 1.191 1.153  YER131W YJL190C YLR249W YPL106C YAL038W  1.151 1.137 1.121 1.102  YML028W YCL037C YHL015W YDL223C  1.080 1.074 1.053 1.037 1.031 1.024 1.020  YHL001W YNL067W YOR133W YOL127W YEL071W YGL076C YOL139C  92  # 50  Name SNF4  51 52 53  RPL38 RPS1B TEF1  54  SNF1  55 56  ADH1 PNC1  57 58  RPS28A DED1  59 60 61 62 63 64 65 66  YCK2 SHM2 SCD6 RPL12A PDC1 RPS7B PHO8 NMA1  67 68 69 70 71 72  RPS7A GAL83 GPM1 PRL30 RPP0 ACT1  Description Activating gamma subunit of the AMP-activated Snf1p kinase complex (contains Snf1p and a Sip1p/Sip2p/Gal83p family member) Ribosomal protein Ribosomal protein TEF1 SGDID:S000006284, Chr XVI from 700592-701968, Verified ORF,Translational elongation factor EF-1 alpha; also encoded by TEF2; functions in the binding reaction of aminoacyl-tRNA (AA-tRNA) to ribosomes AMP-activated serine/threonine protein kinase found in a complex containing Snf4p and members of the Sip1p/Sip2p/Gal83p family Alcohol dehydrogenase Nicotinamidase that converts nicotinamide to nicotinic acid as part of the NAD(+) salvage pathway Ribosomal protein ATP-dependent DEAD (Asp-Glu-Ala-Asp)-box RNA helicase, required for translation initiation of all yeast mRNAs Palmitoylated, plasma membrane-bound casein kinase I isoform; Cytosolic serine hydroxymethyltransferase, involved in one-carbon metabolism Protein containing an Lsm domain, may bind RNA and have a role in RNA processing Ribosomal protein Major of three pyruvate decarboxylase isozymes Ribosomal protein Repressible alkaline phosphatase, a glycoprotein localized to the vacuole Nicotinic acid mononucleotide adenylyltransferase, involved in NAD(+) salvage pathway Ribosomal protein One of three possible beta-subunits of the Snf1 kinase complex, Tetrameric phosphoglycerate mutase Ribosomal protein Ribosomal protein Actin, structural protein involved in cell polarization  Ratio 1.001  Accession number YGL115W  0.951 0.949 0.942  YLR325C YML063W YPR080W  0.933  YDR477W  0.917 0.898  YOL086C YGL037C  0.898 0.894  YOR167C YOR204W  0.878 0.862 0.859 0.858 0.856 0.822 0.818 0.799  YNL154C YLR058C YPR129W YEL054C YLR044C YNL096C YDR481C YLR328W  0.785 0.767 0.725 0.723 0.717 0.692  YOR096W YER027C YKL152C YGL030W YLR340W YFL039C  93  # 73 74  Name RPS14A MBF1  75  STM1  76 77  RPS27B SUI1  78 79 80  PGK1 RPL22A AHP1  81 82 83 84  ENO2 RPP2B FBA1 RPS0B  Description Ribosomal protein Transcriptional coactivator that bridges the DNA-binding region of Gcn4p and TATAbinding protein Spt15p Protein that binds G4 quadruplex and purine motif triplex nucleic acid; acts with Cdc13p to maintain telomere structure Ribosomal protein Translation initiation factor eIF1; component of a complex involved in recognition of the initiator codon 3-phosphoglycerate kinase Ribosomal protein Thiol-specific peroxiredoxin, reduces hydroperoxides to protect against oxidative damage Enolase II Ribosomal protein Fructose 1,6-bisphosphate aldolase Ribosomal protein  Ratio 0.6917 0.672  Accession number YCR031C YOR298C-A  0.672  YLR150W  0.662 0.655  YHR021C YNL244C  0.653 0.576 0.567  YCR012W YLR061W YLR109W  0.524 0.401 0.377 0.1215  YHR174W YDR382W YKL060C YLR048W  94  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0072417/manifest

Comment

Related Items