UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Role of Y-box binding protein-1 (YB-1) in breast cancer Astanehe, Arezoo 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2012_spring_astanehe_arezoo.pdf [ 6.7MB ]
Metadata
JSON: 24-1.0072041.json
JSON-LD: 24-1.0072041-ld.json
RDF/XML (Pretty): 24-1.0072041-rdf.xml
RDF/JSON: 24-1.0072041-rdf.json
Turtle: 24-1.0072041-turtle.txt
N-Triples: 24-1.0072041-rdf-ntriples.txt
Original Record: 24-1.0072041-source.json
Full Text
24-1.0072041-fulltext.txt
Citation
24-1.0072041.ris

Full Text

ROLE OF Y-BOX BINDING PROTEIN-1 (YB-1) IN BREAST CANCER by Arezoo Astanehe B.Sc., The University of British Columbia, 2002 M.Sc., The University of British Columbia, 2005  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF COMBINED DOCTOR OF MEDICINE AND DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Experimental Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  June 2011  © Arezoo Astanehe, 2011  ABSTRACT The Y-box binding protein-1 (YB-1) is a multifunctional protein with roles in transcription, translation, DNA repair, and a recently identified function as an extracellular mitogen. YB-1 is over-expressed in various malignancies including breast carcinoma. Previous work from our laboratory has shown that YB-1 is expressed in approximately 40% of invasive breast carcinomas, and its expression correlates with relapse and poor survival. Further, the oncogenic potential of YB-1 has been demonstrated in breast cancer. In the studies presented in this thesis, we sought to understand the contribution of YB-1 as an oncogenic transcription factor to breast cancer. We focused our studies on the basal-like breast carcinoma (BLBC) and the human epidermal growth factor receptor 2 (HER2) over-expressing breast cancers, as patients with these subtypes suffer the worst prognosis. Using BLBC cell lines, we demonstrated that YB-1 induces expression of MET and PIK3CA to promote anchorage-independent growth and invasion respectively. These studies further identified YB-1 as a potential therapeutic target in BLBC. We then directed our focus to the HER2 over-expressing breast cancers. Although the development of trastuzumab (Herceptin®), a targeted therapy against HER2, has provided a substantial advance in the care of affected patients, resistance remains a prevailing challenge. We identified a novel mechanism by which signalling proteins, mitogen activated protein kinase interacting kinase (MNK) and p90 ribosomal S6 kinase (RSK), interact to increase phosphorylation of YB-1. In turn, phosphorylation of YB-1 promotes its nuclear translocation where it regulates transcription of genes involved in trastuzumab resistance. These results further suggest YB-1 as a therapeutic target to improve outcome for women with trastuzumab refractory disease. As a whole, the studies outlined in this thesis have contributed to our understanding of breast cancer pathogenesis and have identified novel aspects of YB-1 function in BLBC and in HER2 over-expressing breast carcinomas.  ii  PREFACE Chapter 2: Profiling YB-1 target genes uncovers a new mechanism for MET receptor regulation in normal and malignant human mammary cells The studies were conceived and designed jointly by Melanie Finkbeiner and Arezoo Astanehe. Melanie Finkbeiner and Arezoo Astanehe performed and analyzed approximately 65% (equal contributions) of the work described. The first version of the manuscript was written and prepared by Melanie Finkbeiner. Arezoo Astanehe assisted in editing and with revisions of the manuscript. Contribution of co-authors: • Karen To performed the quantitative real-time PCR experiments (Figure 2.2 c-d) using isolated primary normal mammary progenitors that were obtained by Peter Eirew, Afshin Raouf, and Connie J Eaves. Karen To also performed experiments involving the small molecule compound OSU-03012 (Figure 2.4f). • Abbas Fotovati performed the immunofluorescence experiments (Figure 2.2b). • Alastair Davies performed the ingenuity pathway analysis (Figure 2.1). • Yang Zhao performed preliminary experiments looking at MET subsequent to YB-1 knockdown. • Helen Jiang carried out the ChIP-on-chip experiment. • Anna Stratford provided the YB-1 S102D mutant construct. • Ashleen Shadeo performed the aCGH studies (Supplementary Figure S2.2) under the supervision of Wan Lam. • Carla Boccaccio and Paolo Comoglio provided the MET luciferase construct. • Peter R Mertens provided the shYB-1 construct. • Sandra Dunn supervised the project and assisted with editing of the manuscript. A version of this chapter has been published. Melanie R. Finkbeiner*, Arezoo Astanehe*, Karen To, Abbas Fotovati, Alastair H. Davies, Yang Zhao, Helen Jiang, Anna L. Stratford, Ashleen Shadeo, Carla Boccaccio, Paolo Comoglio, Peter R. Mertens, Peter Eirew, Afshin Raouf, Connie J. Eaves, and Sandra E. Dunn (2009). Profiling YB-1 target genes uncovers a new mechanism for MET receptor regulation in normal and malignant human mammary cells. Oncogene 28, 1421-1431. * These authors contributed equally. iii  Chapter 3: The transcriptional induction of PIK3CA in tumour cells is dependent upon the oncoprotein Y-box binding protein-1 (YB-1) Arezoo Astanehe conceived the project and designed the studies described. More than 90% of the work was performed and analyzed by Arezoo Astanehe. Further, the manuscript was written and prepared by Arezoo Astanehe. Contribution of co-authors: • Melanie R. Finkbeiner provided some technical assistance. • Peyman Hojabrpour, under the supervision of Vincent Duronio, performed the PI3K assays (Figure 3.5a). Samples for the assay were prepared by Arezoo Astanehe. • Karen To generated the lenti-shYB-1 SUM149 cell line. • Abbas Fotovati performed immunofluorescence staining of the SUM149 xenografts (Figure 3.4b). • Ashleen Shadeo performed the aCGH studies (Figure 3.3c and 3.3e) under the supervision of Wan Lam. • Anna Stratford provided the YB-1 S102D mutant construct. • Isabelle Berquin provided the HTRY cell line. • Sandra Dunn supervised the project and assisted with editing of the manuscript. A version of this chapter has been published. Arezoo Astanehe, Melanie R. Finkbeiner, Peyman Hojabrpour, Karen To, Abbas Fotovati, Ashleen Shadeo, Anna L. Stratford, Wan L Lam, Isabelle M Berquin, Vincent Duronio, and Sandra E. Dunn (2009). The transcriptional induction of PIK3CA in tumour cells is dependent on the oncoprotein Y-box binding protein-1. Oncogene 28, 2406-2418.  iv  Chapter 4: The MNK1/RSK1/YB-1 Signalling Network Mediates Resistance to Trastuzumab Therapy Arezoo Astanehe conceived the project and designed the studies described. More than 90% of the work was performed and analyzed by Arezoo Astanehe. Further, the manuscript was written and prepared by Arezoo Astanehe. Contribution of co-authors: • Melanie R. Finkbeiner provided technical assistance with preliminary experiments. • Martin Krzywinski, under the supervision of Marco A. Marra, performed bioinformatics analyses of the ChIP-sequencing data and generated the Venn diagram in Figure 4.5b. • Mollianne J. McGahren Murray optimized and stained the RPPA under the supervision of Ana M. Gonzalez-Angulo, Ana Lluch, Bryan T. Hennessy, and Gordon B. Mills. Further, Arezoo Astanehe performed statistical analysis and interpretation of the RPPA data (Figure 4.6a). • Abbas Fotovati performed the immunofluorescence staining of mouse mammary glands (Figure 4.2g) that were provided by Isabelle M. Berquin. • Jaspreet Dhillon generated the BT474 stable cell lines expressing wt, S102D, and S102A YB-1. • Sandra Dunn supervised the project and assisted with editing of the manuscript. A version of this chapter has been submitted for publication. Arezoo Astanehe, Melanie R. Finkbeiner, Martin Krzywinski, Mollianne J. McGahren Murray, Abbas Fotovati, Jaspreet Dhillon, Isabelle M. Berquin, Ana M. Gonzalez-Angulo, Ana Lluch, Bryan T. Hennessy, Gordon B. Mills, Marco A. Marra, and Sandra E. Dunn. The MNK1/RSK1/YB-1 signalling network mediates resistance to trastuzumab therapy. 	
   	
   	
   	
   	
    v  TABLE OF CONTENTS ABSTRACT .................................................................................................................................. ii PREFACE .................................................................................................................................... iii LIST OF TABLES........................................................................................................................ x LIST OF FIGURES..................................................................................................................... xi LIST OF ABBREVIATIONS ................................................................................................... xiii ACKNOWLEDGEMENTS ...................................................................................................... xvi DEDICATION .......................................................................................................................... xvii CHAPTER 1: INTRODUCTION ............................................................................................... 1 1.1 CANCER ................................................................................................................................. 2 1.2 CELL SIGNALLING............................................................................................................. 2 1.2.1 The ERBB family of receptor tyrosine kinases............................................................. 5 ERBB receptor structure and signalling ................................................................................. 5 ERBB2/HER2 in development ............................................................................................... 7 ERBB2/HER2 in cancer ......................................................................................................... 8 1.2.2 MET receptor tyrosine kinase ...................................................................................... 10 MET structure and signalling ............................................................................................... 10 MET in development ............................................................................................................ 11 MET in cancer ...................................................................................................................... 12 1.2.3 Phosphatidylinositol-3-kinase (PI3K) .......................................................................... 16 Class I PI3K subunits ........................................................................................................... 16 Class I PI3K signalling ......................................................................................................... 18 Class I PI3K catalytic subunits in development ................................................................... 19 Class I PI3K catalytic subunits in cancer ............................................................................. 20 1.2.4 MAPK interacting kinase (MNK) ................................................................................ 23 MNKs structure and signalling............................................................................................. 24 MNKs in development.......................................................................................................... 27 MNKs in cancer.................................................................................................................... 27 1.2.5 Y-box binding protein-1 (YB-1) ................................................................................... 29 YB-1 structure and localization ............................................................................................ 29 YB-1 functions ..................................................................................................................... 30 YB-1 in development............................................................................................................ 35 YB-1 in cancer...................................................................................................................... 35 1.3 BREAST CANCER .............................................................................................................. 39 1.3.1 Pathological classification of breast carcinoma .......................................................... 39 1.3.2 Molecular classification of breast carcinoma.............................................................. 40 Luminal subtype ................................................................................................................... 41 HER2 over-expressing subtype ............................................................................................ 41 Basal-like breast carcinoma (BLBC) subtype ...................................................................... 42 1.3.3 Breast cancer treatment ................................................................................................ 43 1.3.4 Trastuzumab .................................................................................................................. 46 Mechanisms of action of trastuzumab .................................................................................. 48 vi  Resistance to trastuzumab and strategies to overcome it...................................................... 50 Potential new therapies to overcome trastuzumab resistance............................................... 53 1.4 HYPOTHESIS AND OBJECTIVES .................................................................................. 55 1.5 REFERENCES ..................................................................................................................... 57 CHAPTER 2: PROFILING YB-1 TARGET GENES UNCOVERS A NEW MECHANISM FOR MET RECEPTOR REGULATION IN NORMAL AND MALIGNANT HUMAN MAMMARY CELLS ................................................................................................................. 99 2.1 OVERVIEW........................................................................................................................ 100 2.2 INTRODUCTION .............................................................................................................. 100 2.3 RESULTS ............................................................................................................................ 102 2.3.1 COC suggests YB-1 regulates MET ........................................................................... 102 2.3.2 P-YB-1S102 and MET are coordinately expressed in BLBC cell lines ..................... 102 2.3.3 Total YB-1 and MET are co-expressed in normal human mammary progenitor cells ......................................................................................................................................... 103 2.3.4 Verification that YB-1 binds to the promoter of MET............................................. 104 2.3.5 Silencing YB-1 or MET with siRNA inhibits HGF-stimulated signalling and anchorage-independent growth........................................................................................... 105 2.4 DISCUSSION...................................................................................................................... 107 2.5 MATERIALS AND METHODS ....................................................................................... 109 2.6 ACKNOWLEDGEMENTS ............................................................................................... 115 2.7 TABLES .............................................................................................................................. 117 2.8 FIGURES ............................................................................................................................ 118 2.9 SUPPLEMENTARY DATA .............................................................................................. 126 2.9.1 Supplementary materials and methods ..................................................................... 126 2.9.2 Supplementary figures ................................................................................................ 130 2.10 REFERENCES ................................................................................................................. 132 CHAPTER 3: THE TRANSCRIPTIONAL INDUCTION OF PIK3CA IN TUMOUR CELLS IS DEPENDENT UPON THE ONCOPROTEIN Y-BOX BINDING PROTEIN-1 (YB-1)......................................................................................................................................... 135 3.1 OVERVIEW........................................................................................................................ 136 3.2 INTRODUCTION .............................................................................................................. 136 3.3 RESULTS AND DISCUSSION ......................................................................................... 139 3.3.1 YB-1 binds to the PIK3CA promoter at three validated sites.................................. 139 3.3.2 YB-1 binds to the PIK3CA promoter and induces its transcription independent of copy number gains or mutational status ............................................................................ 140 3.3.3 YB-1 induces PIK3CA transcription in a manner dependent on S102 phosphorylation .................................................................................................................... 142 3.3.4 Loss of YB-1 results in a decrease in PI3K activity and the downstream signalling ................................................................................................................................................ 143 vii  3.3.5 The YB-1/p110α/uPA network induces BLBC cell invasion ................................... 146 3.4 MATERIALS AND METHODS ....................................................................................... 148 3.5 ACKNOWLEDGEMENTS ............................................................................................... 152 3.6 FIGURES ............................................................................................................................ 153 3.7 SUPPLEMENTARY DATA .............................................................................................. 161 3.7.1 Supplementary materials and methods ..................................................................... 161 3.7.2 Supplementary tables .................................................................................................. 164 3.7.3 Supplementary figures ................................................................................................ 167 3.8 REFERENCES ................................................................................................................... 170 CHAPTER 4: THE MNK1/RSK1/YB-1 SIGNALLING NETWORK MEDIATES RESISTANCE TO TRASTUZUMAB THERAPY ............................................................... 174 4.1 OVERVIEW........................................................................................................................ 175 4.2 INTRODUCTION .............................................................................................................. 175 4.3 RESULTS ............................................................................................................................ 177 4.3.1 MNK1 mediates trastuzumab resistance, while its loss re-sensitizes cells to the drug ................................................................................................................................................ 177 4.3.2 P-YB-1S102 induces MNK1 expression via direct promoter occupancy .................. 180 4.3.3 Inhibition of RSK blocks MNK1-mediated trastuzumab resistance ...................... 181 4.3.4 Coordinate MNK1 and RSK1 activity increases phosphorylation of YB-1 ........... 182 4.3.5 Chromatin-immunoprecipitation sequencing identified unique YB-1 transcriptional target genes in trastuzumab resistant cells......................................................................... 184 4.3.6 A trastuzumab resistant gene signature from patients includes YB-1 target genes ................................................................................................................................................ 185 4.4 DISCUSSION...................................................................................................................... 186 4.5 MATERIALS AND METHODS ....................................................................................... 189 4.6 ACKNOWLEDGMENTS.................................................................................................. 193 4.7 TABLES .............................................................................................................................. 194 4.8 FIGURES ............................................................................................................................ 195 4.9 SUPPLEMENTARY DATA .............................................................................................. 204 4.9.1 Supplementary materials and methods ..................................................................... 204 4.9.2 Supplementary tables .................................................................................................. 207 4.9.3 Supplementary figures ................................................................................................ 209 4.10 REFERENCES ................................................................................................................. 213 CHAPTER 5: DISCUSSION ................................................................................................... 218 5.1 SUMMARY OF CONTRIBUTIONS ............................................................................... 219 5.2 IMPLICATIONS AND FUTURE DIRECTIONS........................................................... 221 5.2.1 Induction of MET by YB-1 in BLBC promotes anchorage independent growth (Chapter 2) ............................................................................................................................ 221 viii  5.2.2 Induction of PIK3CA by YB-1 in BLBC promotes invasion (Chapter 3)............... 222 5.2.3 Induction of MKNK1 by YB-1 in HER2 overxpressing subtype promotes trastuzumab resistance (Chapter 4).................................................................................... 227 5.3 CONCLUDING REMARKS: YB-1 AS A THERAPEUTIC TARGET IN BLBC AND HER2 OVER-EXPRESSING TUMOURS............................................................................. 233 5.4 REFERENCES ................................................................................................................... 237 APPENDIX A: (relates to Chapter 4) List of YB-1 target genes, identified by ChIPsequencing, that associate with YB-1 in the trastuzumab resistant HR5 and HR6 Cells, but not the trastuzumab sensitive BT474 cells. ............................................................................ 244  ix  LIST OF TABLES Table 2.1: Select putative YB-1 target genes identified in the COC screen that are common to one another in that they are each associated with a stem cell signature. ................ 117	
   Table S3.1: siRNA Target Sequences. .................................................................................... 164	
   Table S3.2: Sequence of ChIP oligonucleotides designed to encompass potential YB-1 binding sites on the PIK3CA promoter. .......................................................................... 165	
   Table S3.3: EMSA oligonucleotide sequences to putative YB-1 binding sites on the PIK3CA promoter. ........................................................................................................................... 166	
   Table 4.1: KinexTM antibody microarray with 800 antibodies, identified proteins differentially expressed/phosphorylated in both resistant cell lines compared to the BT474 cells after 72 hours of trastuzumab (20µg/ml) treatment................................. 194	
   Table S4.1: YB-1 targets with altered protein expression (based on KinexTM antibody microarray) in the trastuzumab resistant cell lines (HR5 and HR6) compared to the sensitive BT474 cells after 72 hours of trastuzumab (20µg/ml) treatment. ................ 207	
   Table S4.2: Sequence of ChIP oligonucleotides designed to encompass potential YB-1 binding sites on the MKNK1 promoter. .......................................................................... 208	
    x  LIST OF FIGURES Figure 1.1: Schematic representation of a cancer cell summarizing the findings outlined in the main body of this thesis.................................................................................................. 4	
   Figure 2.1: Categorization of YB-1 COC data into functional groups and schematic presentation of the possible interactions among the select genes that are linked to primitive cells and tumour initiation. ............................................................................. 118	
   Figure 2.2: YB-1 and MET receptor expression levels are positively correlated in basal-like breast cancer cell lines and primary normal mammary progenitor cells. .................. 119	
   Figure 2.3: Traditional ChIP and EMSA localize YB-1 binding to the -1018 YRE.......... 121	
   Figure 2.4: MET mRNA and protein levels and reporter activity can be modulated via YB1. ......................................................................................................................................... 123	
   Figure 2.5: Inhibition of YB-1 disrupts HGF/MET receptor signalling and anchorageindependent growth. ......................................................................................................... 125	
   Figure S2.1: Stable Lentiviral down-regulation of YB-1 (Lenti-shYB-1) in SUM149 and its effect on MET expression................................................................................................. 130	
   Figure S2.2: CGH analysis using SMRT high resolution tiling arrays on primary BLBC. ............................................................................................................................................ 131	
   Figure 3.1: Mapping YB-1 binding sites on the PIK3CA promoter. .................................... 153	
   Figure 3.2: YB-1 induces the PIK3CA promoter. .................................................................. 155	
   Figure 3.3: Expression of PIK3CA, whether wild type, mutant, or amplified, is dependent on YB-1. ............................................................................................................................. 156	
   Figure 3.4: YB-1 induces PIK3CA transcription in a manner dependent on S102 phosphorylation. ............................................................................................................... 157	
   Figure 3.5: Silencing YB-1 decreases PI3K activity. ............................................................. 158	
   Figure 3.6: PI3K rescues the inhibition of invasion by siYB-1............................................. 159	
   Figure 3.7: Proposed pathway of invasiveness in BLBC. ..................................................... 160	
   Figure S3.1: Silencing YB-1 decreases p110α levels. ............................................................ 167	
   Figure S3.2: YB-1 induces PIK3CA in a phospho-S102 dependent manner. ...................... 168	
   Figure S3.3: YB-1 and uPA levels correlate........................................................................... 169	
    xi  Figure 4.1: Trastuzumab resistant cell lines have increased levels of MNK1 and depend on it for survival. .................................................................................................................... 195	
   Figure 4.2: MNK1 levels are regulated via transcriptional induction by YB-1.................. 196	
   Figure 4.3: RSK1 phosphorylation of MNK1 is required for its ability to mediate resistance. .......................................................................................................................... 198	
   Figure 4.4: MNK1-induced resistance is P-YB-1S102 dependent. ......................................... 199	
   Figure 4.5: ChIP-sequencing identifies genome-wide YB-1 targets..................................... 201	
   Figure 4.6: YB-1 regulates expression of a number of predictive markers of resistance in patient samples.................................................................................................................. 202	
   Figure 4.7: Schematic mechanistic model of trastuzumab resistance. ................................ 203	
   Figure S4.1: Silencing MNK1 but not MNK2 induces apoptosis. ........................................ 209	
   Figure S4.2: YB-1 induction increases MNK1 in non-tumourigenic cells........................... 210	
   Figure S4.3: Silencing RSK in combination with trastuzumab induces apoptosis............. 211	
   Figure S4.4: MET levels are higher in trastuzumab resistant cells. .................................... 212	
    xii  LIST OF ABBREVIATIONS 5’-UTR α β δ γ ABC ADCC aCGH ATM BCS BH BLBC BRSK2 CDK ChIP ChIP-on-chip ChIP-seq CIS CK1 COC cPLA2 CREB CRS CSD DbpB DCIS DKO DNA-PK ECD EGF EGFR eIF4E eIF4G EMSA ER ERK FDR FGF FISH GAB1 GnRH GPCR  5’-untranslated region alpha beta delta gamma ATP-binding cassette antibody-dependent cellular cytotoxicity array comparative genomic hybridization ataxia telangiectasia mutated breast conserving surgery breakpoint cluster region homology domain basal-like breast carcinoma brain selective kinase 2 cyclin-dependent kinase chromatin immunoprecipitation chromatin immunoprecipitation on chip chromatin immunoprecipitation sequencing carcinoma in situ casein kinase 1 chromatin immunoprecipitation on chip cytoplasmic phospholipase A2 cyclic AMP response element binding-protein cytoplasmic retention site cold shock domain DNA binding protein B ductal carcinoma in situ double knockout DNA-dependent protein kinase extracellular domain epidermal growth factor epidermal growth factor receptor eukaryotic initiation factor 4E eukaryotic initiation factor 4G electrophoretic mobility shift assay estrogen receptor extracellular signal-regulated kinase false discovery rate fibroblast growth factor fluorescence in situ hybridization GRB2-associated binder 1 gonadotropin releasing hormone G-protein coupled receptor xiii  GRB2 HB-EGF HER HGF HGFR HIF1 hnRNPA1 HSP90 IGF1 IGF-1R IGF-BP3 ILK IRES iSH2 JNK LCIS MAPK MAPKAPK/MK MBS MDR1 MEFs MET MHC MKK1 MMP MMR MMTV MNK MRP1 MSH2 MSK mTOR MUC4 MVP NEIL2 NES NK NLS PAK PCNA PDCD4 PDK1 P-ERK PH  growth-factor-receptor-bound protein 2 heparin-binding epidermal growth factor-like factor human epidermal growth factor receptor hepatocyte growth factor hepatocyte growth factor receptor hypoxia-inducible factor heterogeneous nuclear ribonucleoprotein A1 heat shock protein 90 kDa insulin-like growth factor 1 insulin-like growth factor 1 receptor insulin-like growth factor binding protein 3 integrin linked kinase internal ribosome entry site inter-SRC homology 2 domain c-JUN N-terminal kinase lobular carcinoma in situ mitogen activated protein kinase MAPK associated protein kinase MET-binding site multi-drug resistance-1 mouse embryonic fibroblasts mesenchymal-epithelial transition receptor major histocompatibility complex MAPK kinase 1 matrix metalloproteinase mismatch repair mouse mammary tumour virus MAPK interacting kinase multi-drug resistance related protein-1 MutS homologue 2 mitogen and stress activated protein kinase mammalian target of rapamycin mucin 4 major vault protein Nei-like-2 protein nuclear export signal natural killer cells nuclear localization signal p21-activated kinase proliferating cell nuclear antigen programmed cell death protein 4 PI3K-dependent kinase-1 phosphorylated extracellular signal-regulated kinase pleckstrin homology domain xiv  PI3K PKB PKC PR PRAK PSF PTB PtdIns RBD RPPA RSK RSV RTK S6RP SERM SF SGK3 shRNA siRNA SMRT STAT3 SH2 SH3 SPRY2 TBP TEB TGFα TNBC TNM TPR uPA US-FDA VEGF v-erbB WRN wt YB-1 YRE  phosphatidylinositol-3-kinase protein kinase B protein kinase C progesterone receptor p38-regulated/activated protein kinase polypyrimidine-tract binding protein-associated splicing factor phospho-tyrosine binding domain phosphatidylinositols RAS binding domain reverse phase protein lysate microarray p90 ribosomal S6 kinase Rous sarcoma virus receptor tyrosine kinase S6 ribosomal protein selective estrogen receptor modulator scatter factor serum/glucocorticoid regulated kinase 3 short hairpin RNA small interfering RNA submegabase resolution tiling signal transducer and activator of transcription 3 SRC homology 2 domain SRC homology 3 domain sprouty 2 TATA-box binding protein terminal end bud transforming growth factor alpha triple negative breast cancer tumour node metastasis translocated promoter region urokinase plasminogen activator United States Food and Drug Administration vascular endothelial growth factor erythroblastic leukaemia viral oncogene B Werner syndrome protein wild type Y-box binding protein-1 YB-1 response element  xv  ACKNOWLEDGEMENTS I would like to start by thanking my supervisor Dr. Sandra Dunn for her patience and unwavering support throughout my graduate degree. You are an outstanding role model, and I have learned so much from you during the past seven years. Sandi, you have made a great impact on my life, and I would not be where I am today without you. Thank you for encouraging me to pursue the clinician-scientist career path; I will always be grateful to you. You believed in my potential, and in the process instilled confidence in me. You have been a great mentor, and more importantly a true friend. I will always remember your enthusiasm and your incredible ability to look at the brighter side of everything. To members of my thesis committee Dr. Vincent Duronio, Dr. Michael Kobor, and Dr. Torsten Nielsen, I thank you deeply for your valued input, guidance, and advice the past several years. My sincere gratitude goes to Dr. Steven Pelech and Dr. Gordon Mills for spending the time to help me. I have always appreciated your kindness. Thank you Dr. Lynn Raymond for your continued support through out this journey, and Ms. Jane Lee for taking care of everything with a smile on your face. Thanks Dr. Nelly Auersperg for being another great role model in my life. You introduced me to research and taught me the fundamentals of how to be a good scientist. Moreover, I would like to acknowledge the Canadian Institute of Health Research MD/PhD studentship program, and the Michael Smith Foundation for Health Research for supporting me through out my degree. Thanks to the members of the Dunn lab for making my experience a great one. The Dunn lab is the best! Thanks Anna for never forgetting a birthday brownie. Thanks Jennifer for not laughing at me, but with me. Thanks Jessie and Cathy for always being there to listen. Thanks Karen for being a great alcove-mate. Thanks Abbas, Alastair, Amar, Goli, James, Kaiji, Kristen, Mary, Michelle, and Peter and for your friendship. I will miss you all so much. You have become a part of my family, and it will be sad to not see you every day. Thank you Melanie for always being there for me no matter what. You are the best friend I could ever ask for. Thank you mom and dad for your unconditional love and support. I appreciate all the sacrifices you made to give me better opportunities in life. I am forever indebted to you. Thank you Nazanin for being the most supportive sister. Thanks Kourosh for brightening my life. I will try my best to invent that potion for you one day. Thanks Kiana for your beautiful drawings and paintings that decorated my desk and made me smile every day. Thanks Babayi for being a great role model and instilling in me the value of continued education. Thank you Mamani, for inspiring me to choose the path that I have taken. I love you all! Last but certainly not least to Saman, thank you for everything. I appreciate having such a great man in my life. Thanks for taking care of me, always being there for me, and for your lasting support through out everything. You are the best!  xvi  DEDICATION  To My Family  xvii  CHAPTER 1: INTRODUCTION  1  1.1 CANCER The origin of the word cancer can be traced back to the ancient Greek physician, Hippocrates (460-377 B.C) (Ekmektzoglou et al., 2009). He used the term “karkinos”, which in Greek refers to crab, to describe the tumours. He later added the suffix “oma” which means swelling thereby giving the name “karkinoma” (carcinoma). The Roman physician, Celsus (25 B.C.-50 A.D.) later translated the Greek term to the Latin word for crab “cancer”. In the year 2009, there were almost 171,000 new cases of cancer diagnoses and 75,300 cancer deaths accounting for about 26% of all deaths in Canada (CCSSC 2009). There has been a decrease in cancer mortality in the past decade, however the problem remains. An improved understanding of how cancer cells function can lead to the development of targeted therapeutics to improve outcome for patients. In 2000, Hanahan and Weinberg described the six “hallmarks of cancer”, which all cells acquire in their pursuit to become malignant. These are: 1) selfsufficiency in growth signals, 2) insensitivity to anti-growth signals, 3) tissue invasion and metastasis, 4) limitless replicative potential, 5) sustained angiogenesis, and 6) evading apoptosis (Hanahan and Weinberg, 2000). Cells function through a complex network of signalling mediators. In cancer, various alterations of these signalling pathways have been observed that promote the “hallmarks of cancer”. The focus in this review will be on the major pathways that are related to the work presented in the main body of the thesis. Furthermore, breast cancer will be discussed in terms of molecular subtypes and current treatment strategies used in patients.  1.2 CELL SIGNALLING Cells sense their environment using surface receptors. Extracellular ligands bind to surface receptors to initiate signalling cascades. Receptor tyrosine kinases (RTK) are one type of cell surface receptors that initiate multitude of effects on cells including growth, differentiation, and survival. RTK are classified into different classes based on their structure, the ligands they 2  recognize, and the biological responses they induce (Schlessinger, 2000). Here we will discuss the class I ERBB RTKs with an emphasis on the ERBB2 family member, and the class VI MET RTK. Once RTKs are activated, they relay signals to intracellular proteins through two main signalling pathways: the phosphatidylinositol-3-kinase (PI3K) and the mitogen activated protein kinase (MAPK) cascades. The focus in this review will be on the PI3K pathway, although some aspects of the MAPK signalling (ie. MAPK interacting kinase [MNK]) are also discussed. Activation of these pathways leads to phosphorylation of downstream effectors including translation and transcription factors that will in turn affect expression of numerous proteins depending on the identity of the initial signal. The main interest in our laboratory has been the Ybox binding protein-1 (YB-1), which is an oncogenic transcription/translation factor. These key cell signalling proteins will be described in more detail below with a particular attention to their involvement in cancer. Figure 1.1 illustrates a schematic representation of a cancer cell and summarizes the findings outlined in chapters 2, 3, and 4 of this thesis.  3  Figure 1.1: Schematic representation of a cancer cell summarizing the findings outlined in the main body of this thesis. RTKs sense extracellular signals. This leads to autophosphorylation of their tyrosine residues, which act to recruit SRC homology 2 (SH2) containing proteins to the membrane. As a result, PI3K and MAPK pathways can be activated. AKT and p90 ribosomal S6 kinase (RSK), downstream mediators of PI3K and MAPK activation respectively, phosphorylate YB-1 on its S102 residue, thereby promoting its nuclear translocation. Once in the nucleus YB-1 can bind to promoter sequences to induce transcription of a number of genes including MET (Chapter 2), PIK3CA (Chapter 3), and MKNK1 (Chapter 4) to promote growth, invasion, and trastuzumab (Herceptin®) resistance respectively. These YB-1 targets, in turn, act in a positive feedback loop to maintain YB-1 phosphorylation. For example upregulation of MET will increase signalling through both PI3K and MAPK pathways, upregulation of p110α leads to increased PI3K activity (Chapter 3), and upregulation of MNK1 leads to enhanced activity of RSK towards YB-1 (Chapter 4).  4  1.2.1 THE ERBB FAMILY OF RECEPTOR TYROSINE KINASES The fundamental principles of modern molecular cancer biology were established through studies of oncogenic retroviruses. The discovery of avian Rous sarcoma virus (RSV) by Peyton Rous in early 1900s (Rous, 1910; Rous, 1911; Rous and Murphy, 1914), led to eventual identification of viral oncogene src and its cellular homologue proto-oncogene (Martin, 2004). As additional viral oncogenes were discovered, each was shown to have a cellular homologue (Bishop, 1983). One such proto-oncogene is cellular ERBB (c-ERBB) that is similar to the erythroblastic leukaemia viral oncogene B (v-erbB). We now know that the ERBB family of RTKs consist of four members: ERBB1, ERBB2, ERBB3, and ERBB4. Downward et al. (1984) first demonstrated that c-ERBB was homologous to the epidermal growth factor receptor (EGFR). At around the same time, it was shown that the Neu oncogene that was originally identified from ethylnitrosurea induced rat neuroglioblastomas (Shih et al., 1981) was also related to c-ERBB and induced synthesis of a p185 protein that was homologous to EGFR (Schechter et al., 1984). Subsequently, Weinberg and colleagues demonstrated that Neu and EGFR were distinct and coded by genes on human chromosomes 17 and 7 respectively (Schechter et al., 1985). Coussens et al. (1985) identified a novel RTK they termed human epidermal growth factor receptor 2 (HER2) that showed sequence similarity to v-erbB and mapped to the same chromosomal location as Neu. Therefore, Neu and HER2 were shown to be identical and are also referred to as ERBB2, while EGFR is also referred to as ERBB1. Several years later additional members of the ERBB proto-oncogene family, ERBB3 (HER3) and ERBB4 (HER4), were isolated (Kraus et al., 1989; Plowman et al., 1993). The ERBB receptors with a particular focus on the role of ERBB2 (HER2) in cancer are discussed below.  ERBB RECEPTOR STRUCTURE AND SIGNALLING The ERBB family receptors consist of an extracellular domain (ECD), a transmembrane 5  domain, and an intracellular domain. There are a number of extracellular ligands that bind to the ECD of ERBB receptors. Most of these ligands are synthesized as transmembrane precursors and then cleaved, releasing the soluble active N-terminal portion (Massague and Pandiella, 1993; Singh and Harris, 2005). Some, however, can be secreted or can act in a juxtacrine manner. Epidermal growth factor (EGF), transforming growth factor alpha (TGF-α), heparin-binding epidermal growth factor-like factor (HB-EGF), amphiregulin, epiregulin, epigen, and betacellulin bind to the EGFR (Fuller et al., 2008). The HB-EGF, epiregulin, and betacellulin bind to HER4, while a family of ligands referred to as the neuregulins can bind to both HER3 and HER4 (Falls, 2003; Fuller et al., 2008). HER2 does not have a known ligand, and is therefore not a true receptor. Interestingly, the conformation of the ECD of HER2 is similar to that of EGFR when bound to EGF (Cho et al., 2003). However, HER2 becomes catalytically active only when heterodimerized with other receptors (Cho et al., 2003; Garrett et al., 2003). Crystal structures have demonstrated that compared to other ERBB family members the dimerization arm of HER2 is more exposed, making it more accessible to other receptors (Cho et al., 2003). Indeed, HER2 is the preferred dimerization partner of all other ERBB receptors (Karunagaran et al., 1996). It has been demonstrated that signalling from HER2 heterodimers lasts longer than other ERBB combinations. Binding to HER2 has been shown to increase affinity of ligands to the partners (Karunagaran et al., 1996). Moreover, increase in duration of the signal may be due to higher stability of HER2, as heterodimers containing HER2 are endocytosed and degraded at a lower rate compared to other combinations (Haslekas et al., 2005; Hommelgaard et al., 2004; Lenferink et al., 1998; Offterdinger and Bastiaens, 2008; Wang et al., 1999). The intracellular domains of ERBB receptors contain multiple tyrosine residues. Upon ligand binding, receptors dimerize. In the case of EGFR, HER2, and HER4, dimerization leads to autophosphorylation on these tyrosine residues. HER3 has a characteristic difference with 6  other members. Although it binds to ligands, it lacks tyrosine kinase activity (Guy et al., 1994). However, upon heterodimerization, its intracellular domain tyrosine residues can be transphosphorylated by its ERBB family partner (Soltoff et al., 1994). The phospho-tyrosine residues then act as binding sites for proteins containing SH2 or phospho-tyrosine binding (PTB) motifs ultimately resulting in activation of MAPK and PI3K signalling pathways (Schlessinger and Lemmon, 2003). Thus, ERBBs can promote intracellular signalling, and aberrations in expression or function of these RTKs can contribute to malignancy. HER2 will be discussed in more detail below, as it is the ERBB family member that pertains to studies outlined in the body of this thesis (Chapter 4).  ERBB2/HER2 IN DEVELOPMENT HER2 knockout mice were shown to be embryonic lethal as a result of dysfunction associated with the lack of cardiac trabeculae (Lee et al., 1995). These embryos also displayed compromised development of sensory and motor nerves (Lee et al., 1995). In subsequent experiments the cardiac defect was genetically rescued through tissue specific expression of HER2 (Morris et al., 1999; Woldeyesus et al., 1999). These mice died shortly after birth due to lack of innervations to the diaphragm, however, they had grossly normal mammary glands suggesting that HER2 is not required for prenatal mammary gland development. Jackson-Fisher et al. (2004) transplanted mammary buds from HER2 null mice into cleared mammary fat pads of wild type mice. These mice showed delayed ductal penetration and decreased terminal end buds (TEBs). However, after pregnancy there were no differences between the HER2 negative and control mammary fat pads, and both animals were able to support lactation (Jackson-Fisher et al., 2004). Similarly, the mammary-specific ablation of HER2 through Cre-mediated recombination led to a striking defect in ductal elongation, reduced branching, and decreased number of TEBs (Andrechek et al., 2005). Therefore, HER2 plays a critical role for early stages 7  of ductal growth but is dispensable for subsequent functional differentiation of the gland.  ERBB2/HER2 IN CANCER Amplification of HER2 was first noted by King et al. (1985) in a human breast carcinoma cell line. In 1987, Slamon et al. demonstrated that approximately 28% of breast cancer tumours from patients harboured amplification of HER2. Further the increase in HER2 gene copy number correlated with poor overall and shortened recurrence-free survival (Slamon et al., 1987). HER2 amplification is directly linked to its over-expression in breast cancer (Slamon et al., 1989). Moreover, HER2 is also highly expressed in a significant proportion of gastric, ovarian, and prostate carcinomas (Slamon et al., 1989; Tai et al., 2010). In vitro studies provided evidence for involvement of HER2 in cell transformation. HER2 was shown to be a potent oncogene when expressed in NIH3T3 cells at high levels as seen in cancers with HER2 over-expression or amplification (Di Fiore et al., 1987; Hudziak et al., 1987). Muller et al. (1988) provided the first in vivo evidence for role of HER2 in tumour development. Transgenic mice carrying an activated Neu (Neu-T) oncogene, driven by a mouse mammary tumour virus (MMTV) promoter, developed adenocarcinomas involving the entire epithelium in each mammary gland. These carcinomas arose synchronously and were polyclonal in origin suggesting that activated Neu was sufficient to induce tumours in a single step (Muller et al., 1988). However, in a study by Bouchard et al. (1989) activated Neu transgenic mice developed multiple mammary tumours that arose asynchronously. This study suggested that mammary epithelial cells require other genetic events, in addition to Neu-T over-expression, to undergo transformation. The difference in findings between these two studies has not been addressed. However, further work by the Muller laboratory confirmed that Neu-T is sufficient to transform mammary epithelial cells (Guy et al., 1996). This activated oncogenic Neu (Neu-T) carries a valine to glutamic acid mutation in the transmembrane domain and is found in rat 8  glioblastomas (Bargmann et al., 1986). However, there is no evidence for this activating mutation in human breast tumours, where HER2 is primarily over-expressed through gene amplification (Lemoine et al., 1990; Slamon et al., 1987). Mammary gland-specific expression of unactivated Neu resulted in development of focal mammary tumours after long latency (Guy et al., 1992). Interestingly, when these tumours were examined, most harboured mutations in sequences coding for the NEU extracellular domain (Guy et al., 1992). These mutations were later shown to activate the receptor through constitutive dimerization (Siegel et al., 1994; Siegel and Muller, 1996). These results suggest that in transgenic mice, there is selective pressure for mutational activation of Neu. Despite this, such mutations are not observed in human tumours. However, expression of an alternatively spliced HER2 isoform with deletion of juxtamembrane domain that closely resembles the Neu transgene-derived somatic mutations has been reported in human tumours (Kwong and Hung, 1998; Siegel et al., 1999). This isoform is also constitutively active and shows stronger transformation activity than wild type HER2 (Kwong and Hung, 1998; Siegel et al., 1999). Indeed, Muller and colleagues have suggested that since Neu cDNA cannot undergo splicing in transgenic mice, there is selective pressure for somatic mutations that functionally parallel alteration of HER2 seen in patient tumours (Ursini-Siegel et al., 2007). The vast evidence supporting the role of HER2 as an oncogene in breast cancer prompted development of novel therapeutic agents. This led to generation of trastuzumab (Herceptin®), a monoclonal antibody that binds to the ECD of HER2. In pre-clinical studies trastuzumab inhibited the growth of HER2 over-expressing tumours (Baselga et al., 1998; Carter et al., 1992; Harwerth et al., 1993; Hudziak et al., 1989; Katsumata et al., 1995). Further, clinical trials demonstrated the safety and efficacy of trastuzumab in patients, which led to its eventual approval as standard therapy (Baselga et al., 1996; Cobleigh et al., 1999; Pegram et al., 1998). Trastuzumab will be discussed further in section 1.3.4.  9  1.2.2 MET RECEPTOR TYROSINE KINASE Another RTK involved in normal cellular function and dysregulated in cancer is the cellular mesenchymal-epithelial transition receptor (c-MET). MET is also known as the hepatocyte growth factor receptor (HGFR) and its gene is mapped to chromosome 7q21.31 (Cooper et al., 1984; Dean et al., 1985). It was first isolated from a chemically transformed human osteosarcoma derived cell line (Cooper et al., 1984), and was found to have homology to the RTK gene family (Dean et al., 1985). Scatter factor (SF) (Stoker et al., 1987) and hepatocyte growth factor (HGF) (Miyazawa et al., 1989; Nakamura et al., 1989; Zarnegar and Michalopoulos, 1989) were characterized independently and later shown to be identical proteins (Gherardi and Stoker, 1990; Weidner et al., 1991). Subsequent experiments established HGF/SF as the MET ligand (Bottaro et al., 1991).  MET STRUCTURE AND SIGNALLING MET is synthesized as a single-chain precursor, but undergoes intracellular cleavage to yield α and β chain subunits, linked together by a disulphide bond. The α chain is shorter and is extracellular, while the β chain encompasses an extracellular domain, a transmembrane domain and a C-terminal cytoplasmic portion. The α chain and the first 212 residues of the β chain are sufficient for HGF/SF binding (Gherardi et al., 2003). HGF binding induces MET receptor homodimerization and phosphorylation of two tyrosine residues (Y1234 and Y1235) within the kinase domain (Longati et al., 1994). This leads to activation of the tyrosine kinase and thereby phosphorylation of the bidentate docking site (Y1349 and Y1356) within the C-terminal cytoplasmic portion of MET (Ponzetto et al., 1993; Ponzetto et al., 1994). As like other RTKs the tyrosine residues are phosphorylated thereby allowing interaction with SH2-containing signal transducers such as growth-factor-receptor-bound protein 2 (GRB2) to mediate downstream  10  signalling (Ponzetto et al., 1994). GRB2-associated binder 1 (GAB1) is an adapter protein that plays an essential role in MET signalling (Maroun et al., 1999; Sachs et al., 2000). GAB1 can interact with MET indirectly through GRB2. However, GAB1 can also be recruited to MET directly via a MET-binding site (MBS) that does not resemble classical SH2 or PTB domains found on adaptor proteins that interact with tyrosine kinases (Lock et al., 2000; Schaeper et al., 2000). This interaction results in prolonged GAB1 phosphorylation in response to HGF/SF (Maroun et al., 1999). Phosphorylated GAB1 then relays the signal by interacting with SH2 containing proteins to activate PI3K and MAPK pathways (Gu and Neel, 2003; Schaeper et al., 2000). Activation of MET promotes proliferation, cell survival, motility, changes in cellular morphology and cytoskeletal reorganization under both normal physiological conditions as required during embryonic development or tissue repair, and in pathological conditions such as cancer (Boccaccio and Comoglio, 2006; Comoglio and Boccaccio, 2001; Huh et al., 2004). MET induces growth and motility through the RAS/MAPK pathway, and survival through the PI3K/AKT pathway (Derksen et al., 2003; Fan et al., 2001). In addition, there is crosstalk between MAPK and PI3K pathways downstream of MET activation that promotes survival (Xiao et al., 2001; Zeng et al., 2002). Further, MET also activates the RAS/RAC1/p21-activated kinase (PAK) signalling cascade, inducing cell spreading and actin reorganization (Ridley et al., 1995; Royal et al., 2000). Finally, cell motility can be regulated via activation of Crk and Rap1 downstream of MET (Lamorte et al., 2000; Sakkab et al., 2000).  MET IN DEVELOPMENT MET homozygote null transgenic mice are embryonic lethal (Bladt et al., 1995). These embryos show abnormalities in limb muscle and diaphragm development due to loss of migration of myogenic precursor cells (Bladt et al., 1995). Marked reduction in liver size, 11  damage to the parenchyma, as well as placental abnormalities were also observed (Bladt et al., 1995). These defects were also present in mice lacking HGF/SF (Bladt et al., 1995; Schmidt et al., 1995; Uehara et al., 1995), and in GAB1 null mice (Sachs et al., 2000). These studies suggest the essential role of HGF/SF and GAB1 in MET signalling. The role of MET in prenatal mammary development, ductal growth, and functional differentiation has not been addressed.  MET IN CANCER MET signalling is dysregulated in many human malignancies (Birchmeier et al., 2003; Di Renzo et al., 1994; Garcia et al., 2007b; Wong et al., 2001). In normal cells, MET is activated through paracrine secretion of HGF/SF by stromal cells. However, in many malignancies such as glioma (Koochekpour et al., 1997), osteosarcoma (Ferracini et al., 1995), rhabdomyosarcoma (Ferracini et al., 1996), as well as prostate, breast, and lung carcinoma, autocrine activation of MET has been detected (Danilkovitch-Miagkova and Zbar, 2002; Tuck et al., 1996). In normal breast epithelial cells, HGF expression is suppressed (Elliott et al., 2002), while in invasive breast carcinomas, high levels of HGF and MET are frequently co-expressed suggesting an autocrine effect (Elliott et al., 2002; Tuck et al., 1996). In breast carcinoma cell lines, SRC phosphorylates signal transducer and activator of transcription 3 (STAT3), which binds to the HGF promoter to increase its transcription (Hung and Elliott, 2001; Wojcik et al., 2006). Transcriptional induction of the HGF promoter has also been observed in ovarian and cervical cancer cell lines, but via a SRC/STAT3 independent mechanism (Sam et al., 2007). Autocrine production of HGF plays an important role in malignancy. Co-expression of MET and HGF/SF transforms NIH3T3 cells leading to formation of invasive tumours in mice (Rong et al., 1994). On the other hand, their ablation decreases growth, blocks angiogenesis, and promotes apoptosis (Abounader et al., 2002). In addition to autocrine production of HGF/SF, signalling can be dysregulated through 12  crosstalk of MET with other cell surface receptors including: α3β1 integrin (Liu et al., 2009), α6β4 integrin (Merdek et al., 2007; Trusolino et al., 2001), CD44 (Damm et al., 2010; OrianRousseau et al., 2002; Orian-Rousseau et al., 2007; Singleton et al., 2007; van der Voort et al., 1999; Wielenga et al., 2000), EGFR (Guo et al., 2008; Ishibe et al., 2009; Jo et al., 2000), HER3 (Engelman et al., 2007), PLEXIN B1 (Conrotto et al., 2004; Conrotto et al., 2005; Giordano et al., 2002), and RON (Follenzi et al., 2000). These interactions allow for enhanced phosphorylation and activation of MET and thereby modulation of downstream signalling through PI3K, MAPK, and other downstream mediators. Over-expression of MET is another means by which cancer cells can increase downstream signalling. In several malignancies including lung, breast, ovarian and colorectal carcinomas, MET over-expression is associated with more advanced disease and impaired patient outcome (Garcia et al., 2007a; Garcia et al., 2007b; Garcia et al., 2007c; Ichimura et al., 1996; Sawada et al., 2007; Takanami et al., 1996; Takeuchi et al., 2003; Tolgay Ocal et al., 2003; Zeng et al., 2008). MET amplifications have been identified in both primary and metastatic lesions of various malignancies including gastric carcinoma (Houldsworth et al., 1990), esophageal carcinoma (Houldsworth et al., 1990), colorectal carcinoma (Umeki et al., 1999; Zeng et al., 2008), lung adenocarcinoma (Bean et al., 2007), medulloblastoma (Tong et al., 2004), and glioma (Beroukhim et al., 2007). In breast cancer, although MET can be overexpressed (Garcia et al., 2007a; Garcia et al., 2007c), its amplification is uncommon (Carracedo et al., 2009; Finkbeiner et al., 2009). This suggests that other mechanisms, such as transcriptional upregulation, can drive expression of this oncogene. The promoter region of MET has been characterized (Seol and Zarnegar, 1998; Seol et al., 1999). Multiple nuclear factors including AP1, ETS1, PAX3, p53, SMAD, SP1, SMYD3, and YB-1 induce, while DAXX represses transcription of MET via direct promoter occupancy (Epstein et al., 1996; Finkbeiner et al., 2009; Gambarotta et al., 1996; Morozov et al., 2008; Seol et al., 1999; Zhang et al., 2005; 13  Zou et al., 2009). Moreover, hypoxia promotes hypoxia-inducible factor (HIF-1) mediated MET transcription (Pennacchietti et al., 2003). HGF stimulation and RAS signalling also induce transcription of MET (Boccaccio et al., 1994; Ivan et al., 1997). In addition to transcriptional regulation, recent findings have demonstrated that non-coding RNA, miRNA-34, posttranscriptionally downregulates MET levels (Corney et al., 2010). Loss of miRNA-34 is observed in epithelial ovarian carcinomas and leads to elevated MET expression (Corney et al., 2010). Besides over-expression, oncogenic mutations of MET have also been identified in a subset of tumours. In fact, when MET was first isolated from a chemically transformed osteosarcoma cell line (Cooper et al., 1984), it was involved in a rearrangement that placed the translocated promoter region locus (TPR) on chromosome 1 upstream of the MET gene (Dean et al., 1985; Park et al., 1986). The TPR-MET chimeric gene encodes a cytoplasmic protein that is constitutively active as a result of TPR leucine zipper interactions, which allow for MET kinase dimerization, transphosphorylation, and activation (Rodrigues and Park, 1993). The TPR-MET rearrangement has been detected in human gastric cancers (Soman et al., 1991). Other activating mutations of MET have been discovered in both sporadic and inherited forms of human renal papillary carcinomas (Olivero et al., 1999; Schmidt et al., 1997; Schmidt et al., 1998; Schmidt et al., 1999), head and neck squamous carcinomas (Di Renzo et al., 2000; Seiwert et al., 2009), ovarian carcinoma (Tanyi et al., 1999), hepatocellular carcinoma (Lee et al., 2000; Park et al., 1999), small cell and non-small cell lung carcinoma (Kong-Beltran et al., 2006; Ma et al., 2003; Ma et al., 2005), gastric carcinoma (Asaoka et al., 2010; Lee et al., 2000), malignant pleural mesothelioma (Jagadeeswaran et al., 2006), and melanoma (Puri et al., 2007). These mutations are found predominantly in the kinase domain and the juxtamembrane region of MET, and lead to its elevated activity. The juxtamembrane region of MET contains a docking site for CBL, an E3 ubiquitin ligase, which mediates endocytosis and degradation of MET thereby attenuating 14  signalling (Jeffers et al., 1997; Peschard et al., 2001). The mutations in the juxtamembrane region can result in loss of Cbl binding leading to sustained MET signalling (Kong-Beltran et al., 2006). Further, in a colon carcinoma cell line, MET was identified to be expressed as a constitutively phosphorylated single chain molecule due to defective post-translational processing, which led to constitutive MET activation and tumourigenesis (Mondino et al., 1991). Regardless of the mode of alteration, the studies above indicate that MET signalling is dysregulated in various malignancies. In breast cancer, MET is over-expressed in approximately 20% of cases and is a prognostic factor for poor outcome (Camp et al., 1999; Ghoussoub et al., 1998; Lengyel et al., 2005; Tolgay Ocal et al., 2003). Mammary specific over-expression of wild type MET under control of the MMTV promoter did not alter mammary development (Welm et al., 2005). In contrast, retroviral delivery of wild type MET into primary mammary epithelial cells, followed by transplantation into mammary fat pads resulted in development of multiple microscopic neoplasms (Welm et al., 2005). However, these neoplasms did not progress to malignancy even after more than 8 months of follow up (Welm et al., 2005), suggesting that MET over-expression is not sufficient for mammary tumourigenesis. However, the lesions progressed to mammary adenocarcinoma when MYC was over-expressed, indicating that MET and MYC can cooperate in mammary tumourigenesis (Welm et al., 2005). Furthermore, although mutations of MET have not yet been observed in breast cancer, several studies have demonstrated the ability of mutant MET to promote mammary tumour development. Transgenic mice expressing TPR-MET developed mammary tumours in conjunction with other malignancies (Liang et al., 1996). Similarly, transgenic mice expressing constitutively activated MET, harbouring mutations observed in hereditary papillary renal carcinomas developed mammary tumours (Jeffers et al., 1998). More recently, two independent studies (Graveel et al., 2009; Ponzo et al., 2009) generated transgenic mice with mammary specific targeting of MET harbouring mutations in the kinase domain that allowed for its constitutive activation. These 15  mice developed mammary tumours that shared histopathological features and basal protein markers consistent with human basal-like breast carcinoma (BLBC) tumours (Graveel et al., 2009; Ponzo et al., 2009). BLBC tumours, as will be discussed in section 1.3.2, are especially difficult to treat. Therefore, targeting the MET pathway may be a useful strategy for patients harbouring BLBC tumours. A number of MET RTK inhibitors, as well as monoclonal antibodies directed towards MET or HGF are currently in clinical trials for use in patients with various malignancies (Eder et al., 2009). Our results demonstrating that YB-1 regulates transcription of MET suggest ablation of YB-1 as a novel approach to diminishing MET levels in BLBC (Chapter 2).  1.2.3 PHOSPHATIDYLINOSITOL-3-KINASE (PI3K) As indicated in Figure 1.1, once activated, RTKs including HER2 and MET can transmit signals via the PI3K pathway. PI3K is a dual specificity protein; it has protein kinase activity, but in addition it has the unique ability to phosphorylate membrane phosphatidylinositols (PtdIns) on the 3-hydroxyl group of the inositol head group (Luo et al., 2003; Whitman et al., 1988). The PI3Ks are placed into three different classes based on their structural characteristics and their lipid substrate preferences. The class I PI3K is most extensively studied, and will be focus of review here, as it pertains to the main body of the thesis.  CLASS I PI3K SUBUNITS The class I PI3K family is further subdivided into class IA and IB. Both class IA and IB PI3Ks are heterodimers consisting of catalytic and regulatory subunits. There are multiple isoforms of catalytic and regulatory subunits that are encoded by different genes. The class IA catalytic subunits are p110α (PIK3CA), p110β (PIK3CB), and p110δ (PIK3CD), while the  16  regulatory subunits are p85α (PIK3R1), p85β (PIK3R2), p55γ (PIK3R3), p55α (PIK3R1), and p50α (PIK3R1). Each p110 isoform is capable of interacting with each regulatory subunit. The p110 catalytic subunits contain a p85-binding domain, a RAS-binding domain (RBD), a C2 domain, a helical domain, and a catalytic domain. The C2 domain of PI3K binds phospholipids and may be involved in recruiting PI3K to membranes, while function of the helical domain is not yet known (Wymann and Pirola, 1998). The p110 subunit interacts directly with RAS through its RBD. This interaction increases PI3K activity, as a dominant negative RAS prevents growth factor induced PtdIns(3,4,5)P3 generation (Rodriguez-Viciana et al., 1994). Moreover, RAS-induced tumourigenesis is dependent on interaction of p110α with RAS (Gupta et al., 2007). The p85α and the p85β regulatory subunits contain one SRC-homology 3 (SH3) domain, a breakpoint cluster region homology (BH) domain, two SH2 domains, and an inter-SH2 (iSH2) domain (Escobedo et al., 1991; Fu et al., 2004; Musacchio et al., 1996; Otsu et al., 1991). In terms of structural homology the p55α, p50α, and p55γ regulatory subunits are similar to p85 subunits, but lack the C-terminal SH3 and BH domains. The iSH2 domain mediates interaction of p85 with the p85-binding domain of p110α. This interaction is required for maximal enzymatic activity of p110α (Fu et al., 2004). However, the p110α catalytic subunit is constitutively active, and Klippel et al. (1996) have shown that targeting of p110α subunit to the membrane either by N-terminal myristoylation, or by C-terminal prenylation is sufficient to allow for catalytic activity. Upon RTK activation, the regulatory subunits via their SH2 domains bring p110 in close proximity to the membrane where the PI3K lipid substrates reside (Escobedo et al., 1991; Otsu et al., 1991). There is only one class IB catalytic subunit, p110γ (PIK3CG), which binds one of two non-p85 regulatory subunits p101 (PIK3R5) and p84 (PIK3R6) (Stephens et al., 1997; Suire et 17  al., 2005). There is no homology between class IB and the class IA regulatory subunits, and they do not possess any of the same domains. Moreover, p110γ is not activated by RTK signalling, but upon G-protein coupled receptor (GPCR) stimulation (Stephens et al., 1997; Suire et al., 2005). Interestingly, it was recently demonstrated that p110β can also be activated by GPCR agonists (Guillermet-Guibert et al., 2008).  CLASS I PI3K SIGNALLING PI3K lipid kinase activity converts PtdIns(4,5)P2 to PtdIns(3,4,5)P3, which acts to recruit the PI3K downstream targets including intracellular kinases, adaptor proteins, and regulators of small GTPases to the membrane via their pleckstrin homology (PH) domains (Vanhaesebroeck et al., 2010). The most studied downstream target of PI3K is AKT, also known as protein kinase B (PKB). AKT is a serine-threonine kinase family that consists of three highly homologous members, AKT1 (PKBα), AKT2 (PKBβ) and AKT3 (PKBγ). In 1995 two independent groups identified AKT as a target for PI3K activation (Burgering and Coffer, 1995; Franke et al., 1995). Further, it was shown that activation of AKT was dependent on its PH domain (Franke et al., 1995). Translocation of AKT to the inner surface of the plasma membrane is induced through binding of its PH domain to PtdIns(3,4,5)P3 (Franke et al., 1997; Klippel et al., 1997). Upon membrane localization due to PI3K activity, AKT is phosphorylated on two residues, T308 and S473 (Alessi et al., 1996; Stokoe et al., 1997). The PI3K-dependent kinase-1 (PDK1) phosphorylates AKT on T308 (Alessi et al., 1997). PDK1 possesses a PH domain and is recruited to the membrane as a result of PtdIns phosphorylation by PI3K (Alessi et al., 1997). In order to be fully activated, AKT also needs to be phosphorylated on S473 by a kinase referred to as “PDK2”, whose identity has been debated. A number of kinases have been suggested to represent the long sought after “PDK2” including mTOR within the context of the mTOR-rictor complex (Sarbassov et al., 2005), integrin-linked kinase (ILK), DNA-dependent protein kinase 18  (DNA-PK), ataxia telangiectasia mutated (ATM), protein kinase C (PKC)bII, and AKT itself (Delcommenne et al., 1998; Feng et al., 2004; Kawakami et al., 2004; Lynch et al., 1999; Toker and Newton, 2000; Viniegra et al., 2005). Upon activation, AKT moves to the cytoplasm and nucleus, where it phosphorylates a plethora of downstream targets to affect many cellular functions including proliferation, differentiation, senescence, cytoskeletal organization, motility, angiogenesis, and cell survival (Toker and Cantley, 1997; Vanhaesebroeck et al., 1997a; Wymann and Pirola, 1998). The protein kinase activity of PI3K is vastly understudied and has mostly been demonstrated in vitro. It has been shown that p110 can phosphorylate p85 in vitro resulting in downregulation of its lipid kinase activity (Carpenter et al., 1993; Dhand et al., 1994). Further, the p110δ catalytic subunit can autophosphorylate itself on S1039, which also decreases its lipid kinase activity (Vanhaesebroeck et al., 1999). In addition, p110 can phosphorylate the insulin receptor substrate (IRS1) (Lam et al., 1994). Moreover, Bondeva et al. (1998) studied its protein kinase activity by generating p110γ mutants without lipid substrate binding sites. This approach revealed that while lipid kinase activity leads to AKT activation, the protein kinase activity of p110γ leads to MAPK activation (Bondeva et al., 1998). More studies are required to define PI3K protein kinase substrates and functional effects of PI3K protein kinase activity on cells.  CLASS I PI3K CATALYTIC SUBUNITS IN DEVELOPMENT The p110α and p110β isoforms are expressed in all adult tissues, while p110δ and p110γ are highly enriched in leukocytes (Chantry et al., 1997; Vanhaesebroeck et al., 1997b). The specific role of PIK3CA in mammary development has not been addressed. However, the p110α subunit is essential for development, as PIK3CA knock out mice are early embryonic lethal (Bi et al., 1999). PIK3CB knockout mice are also embryonic lethal, therefore the function of p110β 19  is essential and non-redundant during development (Bi et al., 2002). Interestingly, it has recently been demonstrated that p110β has both kinase-dependent and kinase-independent functions (Ciraolo et al., 2008; Jia et al., 2008). The kinase-independent functions of p110β appear to be sufficient for embryonic development, as mouse mutants expressing a catalytically inactive p110β were viable to adulthood (Jia et al., 2008). On the other hand, PIK3CD knockout mice develop normally, indicating that p110δ is not essential for embryonic development. However, these mice have defects in B cell receptor signalling and chemotaxis (Jou et al., 2002; Reif et al., 2004). Similarly, the p110γ isoform is not essential during embryonic development as PIK3CG knockout mice develop normally. However, these mice have defective immune response secondary to lack of T cell development and activation, as well as inability of granulocytes and macrophages to migrate (Hirsch et al., 2000; Puri et al., 2005; Reif et al., 2004).  CLASS I PI3K CATALYTIC SUBUNITS IN CANCER Since the seminal report in 1999 implicating the importance of PIK3CA in cancer (Shayesteh et al., 1999), this class IA PI3K catalytic subunit has received significant attention. In contrast, the other class I PI3K isoforms are only recently gaining interest in the field of cancer research. The PIK3CA gene is located on chromosome 3q26.32 and codes for the p110α catalytic subunit of PI3K. Alterations of PIK3CA have been identified in various malignancies. The first report highlighting PIK3CA as an oncogene demonstrated it to be amplified in approximately 40% of epithelial ovarian carcinomas (Shayesteh et al., 1999). Several studies followed indicating PIK3CA amplifications in a number of other malignancies including cervical cancer (Ma et al., 2000), non-small cell lung cancer (Massion et al., 2002), squamous cell carcinoma (Woenckhaus et al., 2002), esophageal adenocarcinoma (Miller et al., 2003), gastric carcinoma (Byun et al., 2003), and thyroid carcinoma (Wu et al., 2005). Increased PIK3CA gene  20  copy number is associated with elevated p110α transcript and protein levels and subsequent PI3K activity in these studies. However, the frequency of p110α increases at the RNA and protein levels exceeds those at the DNA level, suggesting that copy number-independent mechanisms also regulate PI3K levels. There is relatively little known about what regulates transcription of PIK3CA. We recently demonstrated that PIK3CA gives rise to two alternate transcripts with two distinct first exons (exon 1a or exon 1b) positioned 50kb upstream of the translational start site (Astanehe et al., 2008). The significance of alternate PIK3CA transcripts remains to be unravelled. We further characterized the PIK3CA promoter and were first to report its transcriptional regulation (Astanehe et al., 2008). We showed that the tumour suppressor protein p53 binds directly to the PIK3CA promoter to suppress its transcription. Further we demonstrated that loss of p53, as is often seen in cancer, induces transcription of PIK3CA and in turn the PI3K activity in ovarian surface epithelial cells as well as epithelial ovarian carcinoma cell lines (Astanehe et al., 2008). This finding was subsequently confirmed by others. Hirota et al. (2010) demonstrated that uterine tissue from mice with conditional deletion of TP53 had increased levels of p110α and PI3K activity as assessed by phosphorylation of its downstream target AKT. Furthermore, Grinkevich et al. (2009) demonstrated that p53 reactivation by the small-molecule RITA (reactivation of p53 and induction of tumour cell apoptosis) triggered ablation of crucial oncogenes including PIK3CA in colon and breast carcinoma cells in a p53-dependent manner. Following our characterization of the PIK3CA promoter, it was demonstrated that both NFkB and FOXO3a can bind to the PIK3CA promoter to induce its transcription (Hui et al., 2008; Yang et al., 2008). Furthermore, we showed that the oncogenic transcription factor YB-1 induces PIK3CA transcription in breast cancer cell lines (Astanehe et al., 2009) (Chapter 3). In addition to over-expression of p110α, activating mutations of PIK3CA have also been identified. Samuels et al. (2004) first identified somatic activating mutations of PIK3CA in 21  cancer. It was later shown that although PIK3CA amplifications are uncommon in breast cancer, approximately 25% harbour mutations (Bachman et al., 2004; Levine et al., 2005; Saal et al., 2005; Samuels and Velculescu, 2004; Samuels et al., 2004). More than 75% of mutations in the PIK3CA gene are in exon 9 (E542K) and exon 20 (H1047R), which code for the helical and kinase domains of p110α respectively (Samuels and Velculescu, 2004). These mutations are transforming, and increased expression of mutant PIK3CA induces PI3K activity (Bader et al., 2006; Horn et al., 2008; Isakoff et al., 2005; Kang et al., 2005; Samuels et al., 2004; Zhang et al., 2008; Zhao et al., 2006). Recently the mechanism by which these alterations promote a gain of function was addressed. Zhao et al. (2008) demonstrated that H1047R mutant can induce an allosteric change of p110α that mimics RAS binding (Zhao and Vogt, 2008). Therefore, these mutants can transform cells independent of RAS. However, they require binding to the p85 regulatory subunit. On the other hand, the E542K mutant functions independent of p85, but requires interaction with RAS (Zhao and Vogt, 2008). This mutation further disrupts an inhibitory interaction of p110 with p85 (Miled et al., 2007). Despite elevated p110α levels in cancer, the involvement of PIK3CA in tumour initiation is not well understood. There has only been one study to date looking at the consequence of PIK3CA over-expression in vivo. Transgenic mice with targeted expression of PIK3CA in the Mullerian epithelium of the female reproductive tract demonstrated hyperplasia but not tumour formation. These results indicate that p110α is not sufficient to initiate tumour formation, but may require cooperation with other oncogenic events (Liang et al., 2009). Similarly, although PIK3CA mutations have been shown to be transforming in vitro, there has only been one study to date addressing their involvement in tumour formation. Bader et al. (2006) demonstrated that the H1047R and E542K mutants could induce tumours in the chorioallantoic membrane of the chicken embryo and cause hemangiosarcomas in the animal.  22  PIK3CA has been the isoform of interest in cancer due to identification of amplification and activating mutations as noted above. Several recent studies have also suggested involvement of PIK3CB in cancer. Increases in PIK3CB (3q22.3) gene copy numbers have been observed in primary ovarian tumours (Zhang et al., 2007) and thyroid cancer (Liu et al., 2008), while p110β expression is elevated in prostate cancer and in neuroblastoma without gene copy number increases (Boller et al., 2008; Zhu et al., 2008). PIK3CB is the predominant PI3K isoform in prostate cancer (Hill et al., 2010; Jia et al., 2008; Jiang et al., 2010; Zhu et al., 2008). Further, it has been shown that PTEN-deficient tumours are dependent on p110β signalling (Wee et al., 2008). The p110δ subunit is highly expressed in acute myeloid leukaemia cells (Billottet et al., 2006; Sujobert et al., 2005), and has also been detected in cancers of non-hematopoietic origin including melanoma, neuroblastoma, glioblastoma, as well as breast, lung, and colorectal carcinoma without corresponding PIK3CD (1p36.22) copy number increases (Boller et al., 2008; Knobbe and Reifenberger, 2003; Sawyer et al., 2003). Amplification of PIK3CG (7q22.3) has been detected in approximately 20% of epithelial ovarian carcinomas (Zhang et al., 2007). The significance of p110δ and p110γ in cancers particularly of non-hematopoietic origin has yet to be clearly delineated.  1.2.4 MAPK INTERACTING KINASE (MNK) The MAPK pathway is also activated downstream of RTK signalling (Figure 1.1). In 1997, two independent groups discovered the MNK family of protein kinases using screens to identify binding partners of extracellular signal-regulated kinase (ERK) (Fukunaga and Hunter, 1997; Waskiewicz et al., 1997). They demonstrated that there are two related kinases, MNK1 and MNK2, which are phosphorylated by ERK and also by p38 MAPK α and β, but not by the related c-Jun N-terminal kinase (JNK) (Fukunaga and Hunter, 1997; Waskiewicz et al., 1997).  23  MNKs are members of MAPK-regulated kinase family, which also includes RSK, mitogen and stress activated protein kinase (MSK), MAPK associated protein kinase 2 (MAPKAPK2/MK2), MAPKAPK3/MK3, p38-regulated/activated protein kinase (PRAK or MAPKAPK5/MK5) proteins (Roux and Blenis, 2004).  MNKs STRUCTURE AND SIGNALLING MNK1 and MNK2 are encoded by MKNK1 (1p33) and MKNK2 (19p13.3) respectively. In the human, each of these genes gives rise to splice variants referred to as MNK1a, MNK1b, MNK2a, and MNK2b (O’Loghlen et al., 2004; Scheper et al., 2003; Slentz-Kesler et al., 2000). Structurally, MNKs contain a catalytic domain flanked by N-terminal and C-terminal regions. The catalytic domains of various MNK isoforms share approximately 70% sequence homology. There are two threonine residues within the activation or T-loop of MNK catalytic domain, which are phosphorylated by ERK and p38 MAPKs (Waskiewicz et al., 1997). This phosphorylation leads to activation of MNKs, which can then phosphorylate their downstream targets. The C-terminal regions of MNK1a and MNK2a are highly similar and contain binding sites for MAPKs. There are, however, slight differences between these binding sequences, which may be responsible for why MNK1a binds well to both ERK and p38 MAPKs (α/β), whereas MNK2a binds better to ERK and only weakly to p38 MAPKs α/β (Parra et al., 2005; Waskiewicz et al., 1997). Interestingly, MNK1a has low basal activity that increases upon stimulation of the MAPK pathway (Goto et al., 2009; Wang et al., 1998; Waskiewicz et al., 1997; Waskiewicz et al., 1999). In contrast, MNK2a has high basal activity that is only slightly enhanced upon stimulation (Scheper et al., 2001). Further, while inhibitors of MAPK signalling decrease MNK1a activity, MNK2a is only slightly affected. This variation in activity is attributed to the fact that phosphorylated ERK (P-ERK) cannot bind to MNK1a stably, but 24  interacts with MNK2a much more strongly (Parra et al., 2005). The interaction with MNK2a protects P-ERK from dephosphorylation and inactivation; therefore, P-ERK can phosphorylate MNK2a even in the absence of serum stimulation (Parra et al., 2005). The difference in binding of MNK1a and MNK2a to P-ERK is partly due to the differences in their MAPK binding motif (Parra et al., 2005). However, other differences in the amino acid sequence of the C-terminal domains and the catalytic domains of MNK1a and MNK2a also contribute to this disparity (Parra et al., 2005). The C-terminal MAPK binding motif is absent in the shorter variants MNK1b and MNK2b (O’Loghlen et al., 2004; Parra et al., 2005; Scheper et al., 2003). Consistent with this finding, MNK1b and MNK2b do not stably bind to ERK (O’Loghlen et al., 2004; Parra et al., 2005; Scheper et al., 2003). In fact, MNK2b displays very little basal or stimulated activity (Scheper et al., 2003), while MNK1b has significant basal activity (Goto et al., 2009; O’Loghlen et al., 2004; O’Loghlen et al., 2007). This is consistent with the observation that MNK1b is not phosphorylated by MAPKs (Goto et al., 2009; O’Loghlen et al., 2004; O’Loghlen et al., 2007). It has been suggested that MNK1b is constitutively active, and that unlike other MNK isoforms the activation of MNK1b is independent of its phosphorylation status (O’Loghlen et al., 2007). On the other hand, it has been demonstrated that MNK2b is still phosphorylated and activated by ERK although less readily compared to MNK1a and MNK2a (Scheper et al., 2003). More studies are required to determine what accounts for phosphorylation and basal activity of MNK1b. Further, the functional roles of individual MNK isoforms in cells remain unclear. N-terminal to the catalytic domain, all four isoforms contain a polybasic sequence that is involved in binding to the nuclear transport protein, importin-α (Parra-Palau et al., 2003). All MNKs have binding sequence for importin-α, however, only MNK1b and MNK2b have been found in the nucleus (O’Loghlen et al., 2004; Scheper et al., 2003). In contrast, MNK1a is cytoplasmic as it contains a nuclear export signal (NES) in its C-terminal region (Parra-Palau et 25  al., 2003; Scheper et al., 2003). MNK2a lacks the NES, but is also cytoplasmic because of its long C-terminus that is thought to impede binding of importin-α. The role of MNK1b and MNK2b in the nucleus is not yet known. The polybasic sequence in the N-terminal region also binds to the translation factor scaffold protein, eukaryotic initiation factor 4G (eIF4G) (Pyronnet et al., 1999). The MNK/eIF4G interaction is required for efficient phosphorylation of eukaryotic initiation factor 4E (eIF4E), the most well known substrate of MNKs (Pyronnet et al., 1999; Waskiewicz et al., 1999). The eIF4E is a translation initiation factor that binds the 5’-cap structure found in all eukaryotic cytosolic mRNAs (Waskiewicz et al., 1997). This is the first identified and most studied substrate of MNKs. MNK1 and MNK2 are the only two kinases demonstrated to phosphorylate eIF4E on its S209 residue in vivo (Ueda et al., 2004). Therefore, MNKs have functionally been linked to translational regulation (Mahalingam and Cooper, 2001). Despite numerous studies in the past two decades, data on the significance of eIF4E phosphorylation on translational initiation is conflicting. Phosphorylation of eIF4E alters its affinity for capped mRNA (Minich et al., 1994; Scheper et al., 2002; Shibata et al., 1998), but the role of phosphorylated eIF4E in translation is unclear. Other substrates of MNKs include the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1), sprouty (SPRY2), cytoplasmic phospholipase A2 (cPLA2), and polypyrimidine-tract binding protein-associated splicing factor (PSF) (Buxade et al., 2005; Buxade et al., 2008; DaSilva et al., 2006; Guil et al., 2006; Hefner et al., 2000). Most of these substrates have been implicated in inflammatory-response enhancing production of pro-inflammatory cytokines such as tumour necrosis factor α (TNFα) or eicosanoids (Buxade et al., 2005; Hefner et al., 2000). More work is required to identify other downstream targets of MNKs and to define the biological functions of individual MNKs in cells.  26  MNKs IN DEVELOPMENT In mouse models it has been shown that MNKs are not necessary for normal growth and development. Double knockout (MNK1/2) transgenic mice were born normally, were fertile, and did not show developmental abnormalities or morbidity for at least 8 months of follow-up after birth (Ueda et al., 2004). Moreover, these mice did not express MNK or phosphorylated eIF4E, but presented no apparent abnormality or defect in translation (Ueda et al., 2004).  MNKs IN CANCER There is limited knowledge about the role of MNKs in cancer. However, eIF4E has been studied in a number of malignancies, and its activation correlates with tumour aggressiveness (De Benedetti and Graff, 2004; Graff et al., 2009). The eIF4E-mediated transformation is dependent on phosphorylation of its S209 site by MNKs (Lazaris-Karatzas et al., 1990; Smith et al., 1990; Wendel et al., 2007). Therefore, it is plausible to consider a role for MNKs in malignancy. Wendel et al. (2007) demonstrated that mice reconstituted with hematopoietic stem cells expressing an activated MNK1 displayed accelerated lymphomagenesis indicating that MNK1 is tumourigenic. However, the involvement of MNKs in tumour initiation and progression, particularly in epithelial tumours, remains largely unexplored. Expression of MNKs in quiescent NIH3T3 fibroblasts has not been performed to assess their transformation ability. Further, transgenic mouse models over-expressing MNKs have not been generated, but will be useful in testing for the contribution of MNKs to tumourigenesis. Recent work indicates function of MNKs in proliferation and cell survival. Bianchini et al. (2008) established that in prostate cancer cells, inhibition of MNKs leads to decreased proliferation due to translational repression of mRNAs involved in the cell cycle. Furthermore, Chrestensen et al. (2007) demonstrated that HER2 over-expressing breast cancer cell lines have elevated phosphorylated MNK1 and MNK2 levels compared to both luminal subtype and non27  tumourigenic cell lines. They also showed that inhibition of MNKs with a small molecule inhibitor (CGP57380) blocked anchorage-independent growth (Chrestensen et al., 2007). However, the specificity of this inhibitor is not fully established, as recent data indicate that this compound can also inhibit other protein kinases including the brain selective kinase 2 (BRSK2), casein kinase 1 (CK1), and the MAPK kinase (MKK1) with the same potency (Bain et al., 2007). Therefore, reliance on CGP57380 as the sole indicator of the importance of MNKs on survival may be misleading. In chapter 4, we demonstrated that MNK1 expression is elevated in HER2 over-expressing breast cancer cells that are resistant to trastuzumab therapy and its ablation using small interfering RNA (siRNA) decreased proliferation and increased sensitivity to trastuzumab (Chapter 4). Furthermore, MNK1 over-expression in sensitive cells decreased response to trastuzumab (Chapter 4). Similarly, in epithelial ovarian carcinoma, MKNK1 was identified as part of a gene expression signature for prediction of response to conventional chemotherapy (Spentzos et al., 2005). The inclusion of MKNK1 as part of a chemotherapy resistance gene expression signature suggests that it may have a broader role in drug resistance. To this date, there have been no studies correlating MNK levels with patient outcome. The only assessment of MNK levels in patient samples has been in acute myeloid leukaemia (AML) bone marrow biopsies that showed high expression in 25% (25/99) of cases (Worch et al., 2004). This study demonstrated that in AML, a fusion transcription factor (PML-RAR) induced MNK1, albeit at a post-transcriptional level. They further showed that upregulation of MNK1 inhibited myeloid differentiation and increased proliferation (Worch et al., 2004). In chapter 4, we demonstrated that the oncogenic transcription factor YB-1 binds to the MKNK1 promoter to induce its transcription. As we learn more about biological functions of MNKs and their aberrations in cancer, the question of what regulates MNK levels will be of more relevance. The differences in cytoplasmic/nuclear localization, their regulation, and their activities suggest that various MNK isoforms may have biochemically divergent roles in cells, which are 28  yet to be determined. As an example, MNK2b was initially found as a binding partner for estrogen receptor β (ERβ) (Slentz-Kesler et al., 2000). The importance of this interaction has not been followed up, but may prove to be interesting, as it is reminiscent of the interaction of RSK with ERα. RSK phosphorylates ERα, thereby increasing its ability to activate transcription in breast cancer cells (Joel et al., 1998). MNK2b may potentially have a similar role in breast cancer. The abovementioned studies implicate a role for MNKs in cancer progression and suggest the importance of understanding MNKs contribution to malignancy. Furthermore, the crystal structures of the various MNK catalytic domains have been reported (Jauch et al., 2005; Jauch et al., 2006). Knowledge of these structures will likely aid in development of specific MNK inhibitors that have the potential to be of benefit in the treatment of cancer.  1.2.5 Y-BOX BINDING PROTEIN-1 (YB-1) As illustrated in Figure 1.1, activation of PI3K and MAPK pathways leads to phosphorylation and nuclear localization of YB-1. YB-1 was first isolated as a protein bound to the major histocompatibility complex (MHC) class II promoter (Didier et al., 1988). Since its discovery, YB-1 is a multi-functional protein with roles in transcription, translation, DNA repair, and most recently as an extracellular mitogen.  YB-1 STRUCTURE AND LOCALIZATION YB-1 contains a highly conserved cold-shock domain (CSD) that is flanked by an alanine/proline rich N-terminal domain and a C-terminal domain comprised of four alternating clusters of basic and acidic amino acids (Wolffe, 1994). The CSD is thought to have evolved from cold-shock proteins in prokaryotes. In eukaryotes, the CSD has not been shown to be involved in cold-shock response, but instead is involved in binding nucleic acids including RNA, 29  as well single and double stranded DNA (Bouvet et al., 1995; Kloks et al., 2002; Kloks et al., 2004; Nambiar et al., 1998a). The N-terminal domain contributes to mRNA localization (Ruzanov et al., 1999). The C-terminal region of YB-1 mediates protein–protein interactions and also binds to RNA and DNA (Nambiar et al., 1998b; Swamynathan et al., 1998). In cells, YB-1 is present in both the cytoplasm and the nucleus. Deletion mutants have been generated to define sites responsible for its cytoplasmic/nuclear localization. The isolated CSD is predominantly cytoplasmic (Jurchott et al., 2003). The C-terminal domain of YB-1 contains a non-canonical nuclear localization signal (NLS), as well as a cytoplasmic retention site (CRS) (Bader and Vogt, 2005; Jurchott et al., 2003). The CRS is necessary for cytoplasmic localization of YB-1 and prevails over the NLS, as deletion of CRS results in localization to the nucleus (Bader and Vogt, 2005). More recently it was demonstrated that the N-terminal domain is responsible for cytoplasmic localization of YB-1 (Khandelwal et al., 2009). Additional studies are required to examine the interaction and cooperation between the different YB-1 domains for its localization within the cell. A study by our group demonstrated that phosphorylation of YB-1 on the S102 residue, within the CSD, promotes its nuclear translocation (Sutherland et al., 2005). We further demonstrated that RSK and to a lesser extent AKT are responsible for phosphorylation of YB-1 on S102 (Stratford et al., 2008; Sutherland et al., 2005). To date S102 is the only identified YB-1 phosphorylation site. Although there are other putative phosphorylation sites on YB-1 (Wu et al., 2007), studies are required to identify these sites, their effect on YB-1 function, and the kinases responsible for their phosphorylation.  YB-1 FUNCTIONS YB-1 IN TRANSCRIPTION Within the nucleus, YB-1 binds to inverted CCAAT boxes known as YB-1 responsive elements (YRE’s) to activate or repress transcription (Didier et al., 1988). However, it has also 30  been demonstrated that YB-1 can bind to DNA without the consensus inverted CCAAT box (Higashi et al., 2003a; Lasham et al., 2003; Mertens et al., 1997). YB-1 was first identified as a transcription factor regulating the promoter of the class II MHC gene (Didier et al., 1988). In the same year, DNA binding protein B (DbpB), later demonstrated to be the same as YB-1, was shown to interact with the EGFR enhancer and the HER2 promoter (Sakura et al., 1988). Subsequently, YB-1 was shown to increase transcription of cyclin A (Jurchott et al., 2003), cyclin B (Jurchott et al., 2003), topoisomerase II alpha (Shibao et al., 1999), DNA polymerase α (En-Nia et al., 2005), matrix metalloproteinase (MMP)-2 (Mertens et al., 1997), MMP12 (Samuel et al., 2005), the phosphatase PTP1B (Fukada and Tonks, 2003), and collagen type I α1 (Norman et al., 2001) via transcriptional induction. YB-1 also induces transcription of drug resistance genes including: the multi-drug resistance-1 (MDR1) (Bargou et al., 1997; Goldsmith et al., 1993; Stein et al., 2001), multi-drug resistance related protein-1 (MRP1) (Stein et al., 2001), and the major vault protein (MVP) (Stein et al., 2005). On the other hand, YB-1 has been shown to decrease levels of p53 (Lasham et al., 2003), class II MHC (Didier et al., 1988; Ting et al., 1994), apoptosis-associated protein FAS (Lasham et al., 2000), collagen type I α2 (Higashi et al., 2003a), and MMP13 (Samuel et al., 2007) through transcriptional repression. Additionally, work from our laboratory indicates that YB-1 directly induces transcription of EGFR and HER2 in a S102 dependent manner (Wu et al., 2006). In chapter 2, using chromatin immunoprecipitation on chip (ChIP-on-chip) we identified YB-1 target genes in SUM149 basallike breast carcinoma cell line (Finkbeiner et al., 2009). This strategy identified approximately 6000 promoter sequences bound by YB-1. We further validated YB-1 binding to MET (Finkbeiner et al., 2009), PIK3CA (Astanehe et al., 2009), CD44 and CD49f (To et al., 2010). Transcriptional control by YB-1 can occur via three mechanisms (Kohno et al., 2003). Firstly, YB-1 can bind directly to DNA to induce or repress transcription. For example YB-1 interacts directly with the promoters of MET, PIK3CA, and EGFR to increase transcription 31  (Astanehe et al., 2009; Finkbeiner et al., 2009; Wu et al., 2006), and with the TP53 promoter to decrease transcription (Lasham et al., 2003). Secondly, YB-1 can interact with other transcription factors that bind to DNA and thereby acts as a co-activator or a co-repressor independent of Y-boxes. For example, SMAD3 binds to the COL1A2 promoter to induce transcription of collagen type I α2 (Zhang et al., 2000). In addition, p300 acts as a coactivator for SMAD3 to induce COL1A2 transcription (Ghosh et al., 2000). YB-1 interacts with SMAD3 and interferes with SMAD3-p300 interaction, thereby repressing transcription of collagen type I α2 (Higashi et al., 2003b). Also, YB-1 has been shown to interact with p53. This interaction enhances binding of p53 to its consensus binding sites, while it impedes binding of YB-1 to its consensus binding sites (Okamoto et al., 2000). Finally, YB-1 can bind to single-stranded DNA to enhance or inhibit binding of other transcription factors to DNA. As an example, it was demonstrated that YB-1 binds directly to the COL1A2 promoter preventing binding of transactivators thereby repressing transcription of collagen type I α2 (Higashi et al., 2003a).  YB -1 IN TRANSLATION Most of the work on YB-1 to date has focused on its role as a transcription factor. However, YB-1 also regulates translation. Unfortunately, data in this field is somewhat conflicting and does not completely fit with the role of YB-1 as an oncogene. More studies are required to uncover the role of YB-1 in translational regulation, and in particular its subsequent impact on cancer. In both cancer cell lines and tissues, YB-1 is predominantly cytoplasmic and is found in complexes with translationally inactive mRNAs (Evdokimova and Ovchinnikov, 1999). This has led to the notion that YB-1 is involved in translational repression. Indeed, it is suggested that YB-1 binds to the 5’ mRNA cap, and displaces the eukaryotic initiation factors (eIF4E and eIF4G) thereby inhibiting translational initiation (Bader and Vogt, 2005; Evdokimova et al., 2001; Evdokimova et al., 2006; Nekrasov et al., 2003). On the other hand, 32  YB-1 was reported to induce internal ribosome entry site (IRES)-dependent translation of mRNAs including multiple embryonic transcription factors such as SNAIL1 and TWIST in carcinoma cells (Cobbold et al., 2008; Evdokimova et al., 2009). It has been demonstrated that AKT-mediated phosphorylation reduces YB-1’s ability to inhibit cap-dependent translation (Bader and Vogt, 2008; Evdokimova et al., 2006). Evdokimova et al. (2006) compared mRNAs bound to YB-1 between non-transformed and K-RAS transformed NIH3T3 cells. YB-1 was associated with more growth-promoting mRNAs in nontransformed cells than in K-RAS transformed cells (Evdokimova et al., 2006). Therefore, it is possible that growth-promoting mRNAs are repressed by YB-1 in non-transformed cells, but released and translationally activated in response to mitogenic stimulation that leads to YB-1 phosphorylation and nuclear translocation. In addition to translational regulation, YB-1 has also been shown to prevent degradation and to stabilize mRNA through binding to the 5’ cap (Chen et al., 2000; Evdokimova et al., 2001). Moreover, YB-1 is also involved in recognizing alternative splice sites and stimulating pre-mRNA splicing (Chansky et al., 2001; Raffetseder et al., 2003; Stickeler et al., 2001).  YB-1 IN DNA REPAIR YB-1 possesses several characteristics implicating its involvement in DNA repair. First of all, YB-1 is able to bind to single stranded DNA, depurinated DNA, cisplatin-modified DNA, as well as mismatched DNA pairs (Gaudreault et al., 2004; Hasegawa et al., 1991; Ise et al., 1999; Spitkovsky et al., 1992). Upon UV irradiation, YB-1 translocates from the cytoplasm to the nucleus and is known to bind to modified nucleic acids (Hayakawa et al., 2002; Koike et al., 1997). Secondly, YB-1 has been shown to associate with proteins involved in DNA repair including: proliferating cell nuclear antigen (PCNA), the MutS homologue 2 (MSH2), DNA polymerase 8, the Ku80 antigen, and the Werner syndrome (WRN) protein (Gaudreault et al., 33  2004; Ise et al., 1999). UV irradiation induces formation of an YB-1/p53/WRN complex on DNA lesions (Guay et al., 2006). Similarly, treatment of cells with UV light induces the interaction of YB-1 with Nei-like-2 (NEIL2), an oxidized base-specific DNA glycosylase with weak base excision activity. This interaction markedly stimulates the base excision activity of NEIL2 to repair DNA (Das et al., 2007). Finally, YB-1 acts as both a 3' to 5’ exonuclease and an endonuclease that may excise damaged DNA (Gaudreault et al., 2004; Izumi et al., 2001). Therefore, although YB-1’s role in DNA repair has not been extensively looked at, it is likely that YB-1 plays a role in repairing DNA after insult. More recently it was demonstrated that YB1 has mismatch repair (MMR) activity in the mitochondria (de Souza-Pinto et al., 2009). Maintenance of the mitochondrial genome is essential for proper cellular function, while the accumulation of damage and mutations in mitochondrial DNA leads to several diseases including cancer. YB-1 was identified as the first mitochondrial MMR protein. It was further shown that depletion of YB-1 in cells increases mitochondrial DNA mutagenesis (de SouzaPinto et al., 2009). Although the studies mentioned suggest the involvement of YB-1 in DNA repair, future studies are required to unveil the precise mechanisms.  YB-1 AS AN EXTRACELLULAR PROTEIN YB-1 has recently been shown to be a secreted protein with extracellular functions (Frye et al., 2009). This was specifically demonstrated in inflammatory glomerular diseases, where mesangial and monocytic cells secreted YB-1 after inflammatory challenge. Further, extracellular YB-1 has mitogenic as well as pro-migratory effects on cells (Frye et al., 2009). In a follow-up study, it was shown that YB-1 can associate with the ECD of NOTCH3 receptor. This interaction induces translocation of the intracellular portion of NOTCH3 into the nucleus where it can upregulate expression of downstream target genes (Rauen et al., 2009). The fact that YB-1 can be secreted and act as an extracellular mitogen in inflammatory glomerular disease 34  suggests that it may also have the same function in cancer. Future studies are warranted to determine whether YB-1 is secreted in cancer. If so, this opens up exciting opportunities to use YB-1 as a potential biomarker for early disease detection or for monitoring progression in patient serum.  YB-1 IN DEVELOPMENT YB-1 is a pleiotropic protein that has a non-redundant role in early embryonic development, as knockout mice are embryonic lethal and exhibit neurological abnormalities, hemorrhage, and respiratory failure (Lu et al., 2005; Uchiumi et al., 2006). The particular role of YB-1 in mammary development has not been examined due to this lethality; further transgenic mice with mammary specific knockout of YB-1 have not been generated.  YB-1 IN CANCER YB-1 is highly expressed in various malignancies including breast carcinoma (Bargou et al., 1997; Gluz et al., 2009; Habibi et al., 2008; Huang et al., 2005; Janz et al., 2002; Wu et al., 2006), colorectal carcinomas (Shibao et al., 1999), ovarian serous adenocarcinoma (Kamura et al., 1999; Yahata et al., 2002), prostate adenocarcinoma (Gimenez-Bonafe et al., 2004), lung carcinoma (Gu et al., 2001; Kashihara et al., 2009; Shibahara et al., 2001), large B-cell lymphoma (Xu et al., 2009), multiple myeloma (Chatterjee et al., 2008), osteosarcoma (Oda et al., 1998), synovial sarcoma (Oda et al., 2003), embryonal rhabdomyosarcoma (Oda et al., 2008), glioblastoma multiforme (Faury et al., 2007), and melanoma (Hipfel et al., 2000; Schittek et al., 2007). In all these studies, YB-1 expression correlated with poor patient prognosis. A recent study from our laboratory involving 4000 breast cancer cases demonstrated that across all subtypes, patients with tumours expressing high YB-1 had significantly decreased disease-free  35  and recurrence-free survival (Habibi et al., 2008). However, YB-1 is not only a prognostic factor, but it is also a predictive factor for response to therapy. For the first time in a randomized prospective cancer therapy trial, YB-1 was identified as a predictive factor for selection of adjuvant chemotherapy (Gluz et al., 2009). Gluz et al. (2009) demonstrated that high YB-1 expression strongly predicted benefit from rapidly cycled tandem high-dose chemotherapy compared with conventional dose-dense chemotherapy. Since YB-1 is highly expressed in various malignancies, it has been the aim of several studies to address the mechanism causing its elevated levels. Over-expression of YB-1 in cancer is not likely due to gene amplification. The short arm of chromosome 1 is a common site for amplifications in colon, lung, and breast cancers (Henderson et al., 2005). However, it was demonstrated that although 1p34.2, 1p34.3, and 1p34.4 are commonly amplified in lung cancer, 1p34.1 where YBX1 resides is not (Henderson et al., 2005). Moreover, previous work from our laboratory using array comparative genomic hybridization (aCGH) has demonstrated that the YB-1 locus is not amplified in breast tumours from patients or cell lines that highly express it (Shadeo and Lam, 2006; Stratford et al., 2007). An alternate mechanism for YB-1 overexpression in cancer may be via transcriptional upregulation. There are multiple E-boxes and GF-boxes in the YBX1 promoter (Uramoto et al., 2002). Uramoto et al. (2002) demonstrated that p73 stimulates transcription of YB-1 by enhancing recruitment of MYC-MAX dimers to the Ebox on the promoter. YB-1 transcription is also shown to be regulated by MATH2, a brainspecific transcription factor, which binds to an E-box in the 5’-untranslated region (5'-UTR) of the YBX1 gene (Ohashi et al., 2009). Also, the E-box-binding transcription factor TWIST increases transcription of YB-1 via promoter binding (Shiota et al., 2008). Moreover, this induction by TWIST is regulated by other proteins including programmed cell death protein 4 (PDCD4), p53, and p300/CBP (Shiota et al., 2008; Shiota et al., 2009; Shiota et al., 2010). PDCD4 interacts directly with the DNA binding domain of TWIST1 to inhibit its ability to 36  induce YB-1 transcription (Shiota et al., 2009). Also, p53 interacts with the N-terminal domain of TWIST to repress TWIST-dependent YBX1 promoter activity (Shiota et al., 2008). Conversly, p300/CBP interacts with TWIST to induce transcription of YB-1 (Shiota et al., 2010). The levels of both TWIST and MYC are elevated in cancer, while p53 function is commonly lost (Crawford et al., 1984; Rodriguez-Pinilla et al., 2007; Yang et al., 2004). Thus, upregulation of YB-1 transcription by these factors may account for its high level expression in cancer. Over-expression of YB-1 in the mouse mammary gland has been shown to provoke remarkably diverse breast carcinomas with 100% penetrance through the induction of genetic instability, as close examination of the tumours revealed a high content of binucleate cells most of which were tetraploid (Bergmann et al., 2005). This study certainly demonstrated that YB-1 acts as an oncogene in breast cancer. However, while high YB-1 expression is observed in numerous malignancies, there have not been any studies undertaken to prove it as a causative role in other cancers than the breast. Nonetheless, YB-1 has been shown to induce cell growth in monolayer culture and in soft agar (Finkbeiner et al., 2009; Sutherland et al., 2005; To et al., 2010), and to promote invasion in a S102-dependent manner (Astanehe et al., 2009). YB-1 inhibition with siRNA impedes cell growth and invasion (Astanehe et al., 2009; Finkbeiner et al., 2009; Lee et al., 2008; Sutherland et al., 2005; Wu et al., 2006). Moreover, HER2 overexpressing and BLBC breast cancer cells are YB-1 dependent and undergo apoptosis after silencing its expression (Lee et al., 2008). A recent study demonstrated that not only does YB-1 play an important role in the growth of tumour cells but also in tumour-associated endothelial cells (Takahashi et al., 2010). Conversely, no or low YB-1 expression was observed in angiogenesis associated with inflammation or normal physiological processes (Takahashi et al., 2010). Further, silencing of YB-1 with siRNA induced G1 cell cycle arrest and inhibited growth of the tumour-associated endothelial cells (Takahashi et al., 2010). In addition, YB-1 over-expression is thought to play a role in drug resistance, mostly 37  through its transcriptional induction of MDR1 (Bargou et al., 1997). MDR1, a P-glycoprotein, is a member of the ATP-binding cassette (ABC) transporters that efflux compounds out of the cell. Concomitant increase in nuclear YB-1 and MDR1 is observed in patient tumour samples of various malignancies including breast carcinoma (Bargou et al., 1997; Saji et al., 2003), prostate carcinoma (Gimenez-Bonafe et al., 2004), epithelial ovarian carcinoma (Kamura et al., 1999), and osteosarcoma (Oda et al., 2003). Analyses of patient tumour samples before and after paclitaxel administration revealed a subset of tumours with nuclear localization of YB-1 and MDR1 over-expression following treatment (Fujita et al., 2005). Moreover, cisplatin resistant patient tumours demonstrate high nuclear YB-1 expression (Janz et al., 2002). YB-1 translocates into the nucleus upon cisplatin treatment and preferentially binds to cisplatin-modified DNA (Gaudreault et al., 2004; Ise et al., 1999; Yahata et al., 2002). Although YB-1 may be involved in transcription or DNA repair within the nucleus, strand separation and nuclease activities of YB-1 are dispensable for cisplatin resistance (Guay et al., 2008). Based on this, it is likely that nuclear YB-1 mediates resistance to cisplatin via transcriptional regulation. In fact, recent work from our laboratory showed that YB-1 promotes cell growth and paclitaxel resistance through upregulation of the cancer stem cell genes CD44 and CD49f (To et al., 2010). On the other hand, inhibition of YB-1 decreases growth and sensitizes CD44-high population of cells to paclitaxel (To et al., 2010). Inhibition of YB-1 may also be a novel approach to improve treatment of glioblastoma multiforme, as its loss decreased cancer cell growth and invasion and enhanced sensitivity to temozolomide, the current first line treatment for glioblastoma multiforme (Gao et al., 2009). Interestingly, normal adult tissues do not express YB-1. For example, while YB-1 is highly expressed in malignant melanoma, and in colorectal, prostate and breast carcinomas, it is not detectable in normal skin, benign nevi, gastrointestinal mucosa, or in prostate and mammary epithelium (Bargou et al., 1997; Gimenez-Bonafe et al., 2004; Schittek et al., 2007; Shibao et 38  al., 1999). The lack of YB-1 expression in adult tissue makes it a potentially attractive therapeutic target in cancer.  1.3 BREAST CANCER Up to this point, I have introduced several signalling proteins that are pivotal to diverse cellular processes, and have discussed how their dysregulation can lead to cancer initiation and/or progression. I will now focus on breast cancer as the main subject of this thesis. Breast carcinoma is the most common cancer in women, accounting for approximately 28% of new cases in 2009. Amongst Canadian women, breast cancer leads incidence with 22,700 new cases each year. Moreover, breast cancer is the second leading cause of cancer mortality with 5,400 deaths in 2009 (CCSSC 2009). The breast is composed of specialized epithelium and surrounding stroma. Two cell types, myoepithelial and luminal, line the ducts and lobules. The myoepithelial cells are contractile cells that lie on the basement membrane. The luminal cells are those that face the lumen. Both the epithelium and the stroma can give rise to benign and malignant lesions. Breast cancers are typically of epithelial origin. However, breast sarcomas, although rare, do occur and account for less than 1% of all breast malignancies (McGowan et al., 2000). The focus here will be on breast cancer of epithelial origin, breast carcinoma. As will be discussed below, breast carcinomas are classified into various categories based on pathological and molecular characteristics. These classifications are significant in terms of identifying both patient prognoses and how they may respond to therapy.  1.3.1 PATHOLOGICAL CLASSIFICATION OF BREAST CARCINOMA Pathologically breast carcinomas are divided into carcinoma in situ (CIS) or invasive 39  carcinomas. CIS is distinguished by tumour cells that are confined to the ducts (ductal CISDCIS) or lobules (lobular CIS- LCIS). They do not invade the surrounding stroma and have no potential for metastasis. Invasive breast cancer is staged using the tumour node metastasis (TNM) staging classification (AJCC 2010). This is based on the size of the primary tumour (T), the presence or absence of regional lymph node involvement (N), and the presence or absence of distant metastases (M). There are four basic stages of invasive breast cancer based on the particular combination of T, N, and M. Stage I is any tumour that is less than 2cm in size and has not spread to the axillary node. Stage II is any tumour less than 2cm in size with the presence of tumour cells in the ipsilateral axillary node or any tumour more than 2cm in size without axillary node involvement. Stage III disease is extensive axillary nodal disease, supraclavicular nodal involvement, direct tumour extension to the chest wall or skin, or inflammatory breast cancer. Finally, any disease with distant metastasis is considered stage IV. Invasive breast cancer is considered early stage at TNM stage I and II, locally advanced at TNM stage III, and metastatic at TNM stage IV (AJCC 2010).  1.3.2 MOLECULAR CLASSIFICATION OF BREAST CARCINOMA Breast cancer is a heterogeneous disease, and aside from pathological classifications, tumours are also categorized based on their molecular expression. Perou et al. (2000) demonstrated that there are variations in gene expression patterns of tumours that account for their biological diversity. Furthermore, seminal gene expression studies on large cohorts of breast cancer patients resulted in its classification into several intrinsic subtypes (Perou et al., 2000; Sorlie et al., 2001; Sorlie et al., 2003). The main division is based on expression of the estrogen receptor (ER). There are two main subtypes of ER positive tumours (luminal A and luminal B), and two major subtypes with low to absent expression of ER (HER2 overexpressing, basal-like). These intrinsic subtypes differ markedly in the genes they express and in 40  their prognosis. Patients with luminal breast tumours have a relatively favourable prognosis, while those with HER2 over-expressing or basal-like breast cancers (BLBC) have the shortest disease-free survival (Carey et al., 2006; Sorlie et al., 2001; Sorlie et al., 2003). These various breast cancer subtypes are described in more detail below.  LUMINAL SUBTYPE The luminal subtype is the most common, making up about 70% of all breast cancers. The expression pattern of luminal subtype tumours bears similarity to the luminal epithelium of the breast (Sorlie et al., 2001). These are ER positive and typically express the progesterone receptor (PR) and luminal cytokeratins 8 and 18, as well as other genes associated with ER activation. Luminal A tumours, which make up about 40% of all breast cancers have the highest expression of ER and ER-related genes, and low expression of the HER2 cluster of genes (Fan et al., 2006; Sorlie et al., 2001). Luminal A tumours carry the best prognosis of all breast cancer subtypes (Carey et al., 2006; Loi et al., 2007; Sorlie et al., 2001; Sorlie et al., 2003; Sotiriou et al., 2003). The luminal B tumours have low to moderate expression of the ER cluster and have outcomes intermediate between those with luminal A and other subtypes (Loi et al., 2007; Sorlie et al., 2001; Sotiriou et al., 2003).  HER2 OVER-EXPRESSING SUBTYPE The HER2-over-expressing subtype makes up about 10% to 15% of breast cancers and is characterized by high expression of the HER2 gene and other genes located on that amplicon (17q22.24) including GRB7. Further, they have low expression of luminal cluster genes and are typically negative for ER and PR. It is important to note that this subtype comprises only about half of clinically HER2-positive breast cancers, as the other half have high expression of both the  41  HER2 and luminal gene clusters, thus they fall in a luminal subtype. Patients with HER2 overexpressing subtypes have a poor prognosis (Sorlie et al., 2001; Sorlie et al., 2003). Although trastuzumab has improved outcome for women with HER2 over-expressing tumours, development of resistance as will be discussed in section 1.3.4 is a major setback.  BASAL-LIKE BREAST CARCINOMA (BLBC) SUBTYPE The BLBC subtype make up about 15% to 20% of breast cancers. They are named basallike because they express many genes characteristic of normal breast basal epithelial cells including cytokeratins 5 and 17, laminin, and fatty acid binding protein 7 (Perou et al., 2000; Sorlie et al., 2001; Sorlie et al., 2003). This subtype is also characterized by low expression of luminal and HER2 gene clusters. BLBC tumours typically lack expression of ER, PR, and HER2 on clinical assays, and are often referred to as the triple negative breast cancers (TNBC). However, TNBC and BLBC are not synonymous (Rakha et al., 2007). Krieke et al. (2007) demonstrated that 91% of TNBC displayed association with BLBC, while 19% of non-TNBC displayed association with BLBC. It has been established that immunohistochemical analysis for the lack of ER, PR, and HER2 is not sufficient to identify BLBC, and that a panel of ER, PR, HER2, cytokeratin 5/6, EGFR can identify BLBC with 100% specificity and 76% sensitivity (Nielsen et al., 2004). Further Cheang et al. (2008) demonstrated that BLBC defined by these five biomarkers predicts survival better than the triple negative phenotype. Interestingly, there is a strong association between BLBC and hereditary breast cancers. It has been demonstrated that over 80% of tumours with hereditary breast cancer gene 1 (BRCA1) mutations are basal-like (Foulkes et al., 2003; Olopade and Grushko, 2001; Sorlie et al., 2003). However, most BLBC are sporadic, and the BRCA1 gene and protein appear intact in these tumours. Another notable association is that BLBC is more prevalent in premenopausal years and in African-American women (Carey et al., 2006; Millikan et al., 2008; Morris et al., 42  2007; Parker et al., 2009). Patients with BLBC have the worst prognosis (Carey et al., 2006; Sorlie et al., 2001; Sorlie et al., 2003). This is partially due to the lack of effective targeted therapy for the women affected, particularly as these tumours will not respond to endocrine therapy or HER2-targeted therapies. Fortunately, studies suggest that BLBC are more sensitive to modern chemotherapy as compared to luminal breast cancer (Berry et al., 2006; Carey et al., 2007; Rouzier et al., 2005). However, rates of relapse and mortality are high, so there is a great need for identification of targets that will improve outcome for the women affected.  1.3.3 BREAST CANCER TREATMENT Molecular profiling of tumours has enhanced our understanding of pathogenesis, and defined prognostic value. In addition, several studies have suggested the use of molecular profiling for prediction of response to therapy (Ayers et al., 2004; Hannemann et al., 2005; Harris et al., 2007; Iwao-Koizumi et al., 2005; Jansen et al., 2005; Rouzier et al., 2005; Thuerigen et al., 2006). However, current therapeutic strategies for breast cancer are not based on molecular profiling. Most breast cancers are diagnosed as a result of an abnormal mammogram. A biopsy is usually performed to identify the stage of disease, which governs the choice for initial treatment. The best indicator of prognosis for invasive breast cancer is lymph node status (Carter et al., 1989; Fitzgibbons et al., 2000). The presence of tumour cells within nodes is an indication that breast cancer has likely spread to other organs. Therefore, women with node-positive breast cancer are indicated to receive adjuvant systemic therapy after local treatment. Local treatment involves surgery. Breast cancer surgery has evolved in the past 20 years moving away from radical mastectomies to breast conserving surgery (BCS) where the tumour is resected without excessive amount of normal breast tissue. BCS is usually followed by local radiation to the 43  breast with the goal of eradicating subclinical residual disease and minimizing local recurrence (Clarke et al., 2005; Vinh-Hung and Verschraegen, 2004). BCS plus local radiation has been shown to have equivalent survival rates compared with mastectomy (Clarke et al., 2005). Systemic therapies include: cytotoxic chemotherapy, endocrine therapy, or HER2-targeted therapy. The choice of systemic treatment depends on expression of molecular factors including hormone receptors and HER2. Tumour expression of ER and/or PR is a predictive factor for response to endocrine therapy (Berry et al., 2006). Endocrine therapy can be accomplished by inhibiting the estrogen effect or by blocking its production. Tamoxifen is a selective estrogen receptor modulator (SERM) that blocks the effect of estrogen. To block production of estrogen, oopherectomy or temporary ovarian suppression by use of gonadotropin releasing hormone (GnRH) analogs are options in pre-menopausal women. Alternatively, aromotase inhibitors are effective in post-menopausal women, and have superior effects and fewer side effects over tamoxifen (Baum et al., 2003; Winer et al., 2005). Aside from predicting response to endocrine therapies, emerging evidence suggests that hormone receptor status is an important predictor for cytotoxic chemotherapy responsiveness. Whereas BLBC and HER2 over-expressing breast cancers benefit significantly from adjuvant cytotoxic chemotherapy, the benefit in ER positive tumours is less consistent (Berry et al., 2006; Carey et al., 2007; Rouzier et al., 2005). Moreover, amplification of HER2 is associated with clinical responsiveness to anthracyclinecontaining chemotherapy (Gennari et al., 2008; Pritchard et al., 2006). More importantly however, HER2 amplification represents an important predictive factor for response to antiHER2 targeted therapies including trastuzumab and lapatinib. Trastuzumab therapy is discussed in more detail in section 1.3.4. The treatment for in situ cancers is usually local. DCIS have the potential to progress to invasive cancer if left untreated; therefore, they are typically resected by BCS. Local radiation 44  may also be used depending on the size of lesion (Schwartz et al., 2000). LCIS on the other hand is thought to be a marker of increased risk for subsequent invasive disease in the ipsilateral, contralateral, or both breasts (Afonso and Bouwman, 2008). Therefore, these patients are managed by close observation for invasive lesions, by endocrine therapy, or by bilateral mastectomy (Afonso and Bouwman, 2008). For early stage invasive breast carcinomas (TNM stage I and II), the standard of care is BCS plus adjuvant radiation (Goldhirsch et al., 2007). However, involvement of lymph nodes is an important indicator for adjuvant systemic therapy. In general, all women with node-positive breast cancer and those with node-negative disease with tumour size exceeding 1cm receive adjuvant chemotherapy (Goldhirsch et al., 2007). For women with tumours that express ER and/or PR, adjuvant endocrine therapy in combination with cytotoxic chemotherapy is indicated (Goldhirsch et al., 2007). On the other hand, trastuzumab in combination with chemotherapy is recommended for patients with tumours that express high levels of HER2 (Garnock-Jones et al., 2010; Joensuu et al., 2006; Piccart-Gebhart et al., 2005; Romond et al., 2005; Smith et al., 2007; Spielmann et al., 2009). The addition of trastuzumab to cytotoxic chemotherapy in the adjuvant setting confers a significant benefit in disease-free survival. However, this combined treatment is associated with a significant risk of cardiac toxicity. Combination of trastuzumab with taxanebased chemotherapy without anthracyclines has been shown to provide comparable benefit with significantly decreased risk of cardiac toxicity (Costa et al., 2010). Locally advanced invasive breast carcinomas (TNM stage III) are considered inoperable due to the extent of disease. Therefore, they often require neoadjuvant therapy to reduce tumour bulk prior to surgery. Neoadjuvant cytotoxic chemotherapy is beneficial in patients with triple negative disease (Silver et al., 2010). In patients with ER and/or PR positive tumours, neoadjuvant endocrine therapy is recommended (Liu et al., 2010). Moreover, the combination of neoadjuvant trastuzumab and cytotoxic chemotherapy is suggested for women with HER245  positive locally advanced breast cancer (Gianni et al., 2010). Treatment of metastatic breast carcinoma (TNM stage IV) is often considered palliative. These patients have poor prognosis with only 5% to 10% that survive greater than five years (Greenberg et al., 1996). Standard chemotherapy is first line for therapy in the metastatic setting, however studies indicate that women with ER positive advanced disease may benefit from endocrine therapy (Beslija et al., 2009). On the other hand, patients with HER2-positive disease respond to trastuzumab treatment both as monotherapy and in combination with cytotoxic chemotherapy (Baselga et al., 1996; Beslija et al., 2009; Slamon et al., 2001). However, as will be discussed below, trastuzumab resistance is a major clinical problem that needs to be addressed in order to improve patient outcome.  1.3.4 TRASTUZUMAB Trastuzumab (Herceptin®) is a recombinant humanized monoclonal antibody that was engineered from the mouse antibody (clone 4D5) using a human IgG1 backbone (Carter et al., 1992). Initially, a panel of mouse monoclonal antibodies was raised against the ECD of HER2 (Fendly et al., 1990). Some of these antibodies were inhibitory, while others had stimulatory effects (Fendly et al., 1990; Lewis et al., 1993). Clone 4D5 showed the best inhibitory effect on a panel of HER2 over-expressing breast cancer cell lines tested (Fendly et al., 1990) and was thus subsequently humanized. HER2 over-expression, as measured by immunohistochemistry (3+), or gene amplification determined by FISH is a predictive biomarker of response to trastuzumab. The United States Food and Drug Administration (US-FDA) and Canada approved trastuzumab in 1998 for metastatic disease. Trastuzumab as a monotherapy showed clinical benefit in approximately 30% of patients with metastatic breast cancer whose tumours over-express HER2  46  (Baselga et al., 1996; Cobleigh et al., 1999; Vogel et al., 2002). Therefore, the majority of patients demonstrate intrinsic resistance to single-agent trastuzumab. Trastuzumab in combination with chemotherapy further improves survival in patients with metastatic disease (Esteva et al., 2002; Marty et al., 2005; Pegram et al., 1998; Pegram et al., 2004; Slamon et al., 2001). However, tumours that respond frequently experience acquired resistance within one year. It is therefore of clinical importance to define what mediates resistance to trastuzumab therapy. Recently, several large clinical trials involving more than 13,000 women with early stage HER2-positive breast cancers showed efficacy of adjuvant intravenous trastuzumab in combination with, or sequentially after, chemotherapy. These trials indicated that there was a significant survival benefit with approximately 40% decrease in risk of death at four years of follow-up. Moreover, adjuvant therapy with trastuzumab decreased the three-year relative risk of recurrence by 50% (Garnock-Jones et al., 2010; Joensuu et al., 2006; Piccart-Gebhart et al., 2005; Romond et al., 2005; Smith et al., 2007; Spielmann et al., 2009). Trastuzumab was subsequently approved in 2006 in both the United States and Canada for use in the adjuvant setting for early stage breast cancer patients. Phase II and III trials have also shown benefit for the use of trastuzumab as neoadjuvant therapy for locally advanced breast cancers (Iwata, 2009; Lazaridis et al., 2008; Mohsin et al., 2005; Untch et al., 2010). Although trastuzumab has been used in breast cancer, its benefit in other cancers is currently being investigated. Interestingly, in 2009 trastuzumab was approved in Europe for patients with HER2-positive metastatic gastric carcinoma (Jorgensen, 2010). To date, the mechanism of action of trastuzumab and how resistance to this drug develops are still not fully understood. Defining these mechanisms will help us get a step closer to identifying appropriate patients that would benefit from trastuzumab, and to circumvent acquisition of refractory disease.  47  MECHANISMS OF ACTION OF TRASTUZUMAB There are several proposed models of how trastuzumab functions to regress HER2positive tumours. Indeed, trastuzumab has both cytostatic and cytotoxic properties. The ability to kill tumour cells is in part due to induction of an immune response via antibody-dependent cellular cytotoxicity (ADCC) (Arnould et al., 2006; Carter et al., 1992; Clynes et al., 2000; Cooley et al., 1999; Lewis et al., 1993; Ritter et al., 2007). Immunohistochemical analyses of patient samples treated with neoadjuvant trastuzumab demonstrate an increased number of lymphoid infiltrations including tumour-associated natural killer (NK) cells (Arnould et al., 2006; Gennari et al., 2004). NK cells express the Fcγ receptor that binds to the Fc portion of trastuzumab. In vivo studies have demonstrated that mice with breast cancer cell line xenografts treated with trastuzumab showed a 96% regression of tumours. In comparison, mice lacking the Fc receptor, demonstrated approximately 30% reduction in tumour mass (Clynes et al., 2000). This indicates that, although not the sole mediator, ADCC has a major effect on trastuzumab response. Recently, Junttilla et al. (2010) demonstrated that afucosylated trastuzumab had increased binding to the Fcγ receptor and enhanced ADCC response. Besides ADCC, an additional mechanism of action for trastuzumab is thought to be through diminished receptor signalling. Since HER2 does not have a known extracellular ligand, it still remains unclear how binding of this antibody to the ECD diminishes intracellular signalling. Early on, it was suggested that binding of trastuzumab results in HER2 internalization and degradation, thereby decreasing signalling through HER2 (Cuello et al., 2001; Hudziak et al., 1989). However, conflicting data now indicates that membrane receptor levels are unchanged after trastuzumab treatment and that trastuzumab does not mediate HER2 endocytosis (Austin et al., 2004; Hommelgaard et al., 2004; Lane et al., 2000; Le et al., 2003; Nahta et al., 2004a; Nahta et al., 2004b). It was also suggested that trastuzumab mediates HER2 dephosphorylation (Lane et al., 2000; Nagata et al., 2004; Sarup et al., 1991), however this mechanism of action has 48  also recently been challenged (Junttila et al., 2009). A mechanism for diminished signalling by trastuzumab was suggested to be through blocking the PI3K pathway (Junttila et al., 2009; Nagata et al., 2004). When HER2 is over-expressed, ligand-independent interaction between HER3 and HER2 occurs (Junttila et al., 2009). Trastuzumab treatment disrupts ligandindependent HER2/HER3 interaction thereby leading to decreased PI3K signalling (Junttila et al., 2009). Alternatively, Nagata et al. (2004) demonstrated that trastuzumab disrupts interaction of HER2 with the SRC tyrosine kinase, leading to inactivation of SRC. SRC phosphorylates and inactivates PTEN, the negative regulator of PI3K (Lu et al., 2003). Therefore, trastuzumabmediated inhibition of SRC leads to increased PTEN phosphatase activity, which results in inhibition of the PI3K cell survival pathway. There are a number of other mechanisms suggested to contribute to trastuzumab response. It has been demonstrated that trastuzumab treated cells undergo arrest in the G1 phase of the cell cycle. Trastuzumab treatment results in accumulation of the cyclin-dependent kinase (CDK) inhibitor, p27kip1. Further, it reduces expression of cyclin D1 that is involved in sequestering p27kip1. Therefore, p27kip1 is free and can bind to inhibit cyclin E/CDK2 complexes thereby blocking progression through the cell cycle (Lane et al., 2000; Lane et al., 2001; Yakes et al., 2002). Moreover, trastuzumab has been shown to sensitize HER2 over-expressing cells to apoptosis by reducing levels of anti-apoptotic proteins such as MCL-1 (Henson et al., 2006). Apoptosis can also be observed secondary to inhibition of angiogenesis. In a mouse breast cancer model, treatment with trastuzumab decreased endothelial cell migration and microvessel density (Izumi et al., 2002; Klos et al., 2003; Wen et al., 2006). Further, trastuzumab treatment reduced expression of pro-angiogenic factors including vascular endothelial growth factor (VEGF), while increasing expression of anti-angiogenic factors (Izumi et al., 2002; Klos et al., 2003; Petit et al., 1997; Wen et al., 2006). Additionally, trastuzumab inhibits DNA repair, and thus has synergistic effects in combination with a variety of chemotherapeutic agents (Mayfield 49  et al., 2001; Pegram et al., 2004; Pietras et al., 1994; Pietras et al., 1999). An alternate mechanism of action of trastuzumab is through blocking cleavage of the ECD of HER2 (Molina et al., 2001). MMPs can cleave the ECD of HER2 from the cell surface, leaving an intact N-terminal truncated form referred to as p95 HER2 (Christianson et al., 1998; Codony-Servat et al., 1999). The expression of p95 HER2 in a transgenic mouse model is sufficient for tumourigenesis (Pedersen et al., 2009), and its elevated levels is associated with aggressive disease, poor prognosis, and lack of response to trastuzumab (Molina et al., 2001; Molina et al., 2002; Saez et al., 2006; Scaltriti et al., 2007). Trastuzumab decreases cleavage of the ECD, and therefore prevents formation of this potent truncated HER2 (Molina et al., 2001).  RESISTANCE TO TRASTUZUMAB AND STRATEGIES TO OVERCOME IT As mentioned above, trastuzumab resistance is a major clinical impediment. There are several proposed mechanisms of trastuzumab resistance based on in vitro and in vivo evidence. One mechanism is through the inability of trastuzumab to interact with the ECD of HER2. This may occur as a result of masking the binding epitope on the ECD of HER2 through increased levels of membrane-associated glycoproteins including mucin 4 (MUC4) (Nagy et al., 2005; Price-Schiavi et al., 2002). Indeed, silencing MUC4 has been shown to increase the response of otherwise resistant cells to trastuzumab (Nagy et al., 2005; Price-Schiavi et al., 2002). Moreover, 30% of HER2-positive tumours express p95 HER2 (Molina et al., 2001; Molina et al., 2002; Saez et al., 2006; Scaltriti et al., 2007). As the p95 HER2 lacks the ECD that binds to trastuzumab, these tumours lack response to trastuzumab, but are alternatively sensitive to the HER2 kinase inhibitor (lapatinib) (Scaltriti et al., 2007; Scaltriti et al., 2010). Moreover, the cleaved ECD have been detected in serum from breast cancer patients (Isola et al., 1994; Krainer et al., 1997; Molina et al., 1999; Mori et al., 1990), and its increased levels correlate with shortened disease free survival (Ludovini et al., 2008; Mehta et al., 1998). Interestingly, it was 50  recently demonstrated that inhibition of the heat shock protein 90 (HSP90) potently induces degradation of p95 HER2 in vivo thereby decreasing signalling through MAPK and PI3K pathways (Chandarlapaty et al., 2010). Additionally, HSP90 inhibitors have been shown to sensitize trastuzumab resistant cells expressing full length HER2 protein (Austin et al., 2004; Basso et al., 2002; Chandarlapaty et al., 2010; Modi et al., 2007; Munster et al., 2002; Raja et al., 2008; Zsebik et al., 2006). This is compatible with work showing that HSP90 binds to a region in the catalytic domain of HER2, stabilizing it, and preventing its degradation (Tikhomirov and Carpenter, 2003; Xu et al., 2001). Therefore, inhibitors of HSP90 can be beneficial in overcoming resistance to trastuzumab. Over-expression of other RTKs including insulin-like growth factor 1 receptor (IGF-1R) and MET have also been implicated in trastuzumab resistance. Pollak and colleagues have provided evidence that over-expression of IGF-1R mediates trastuzumab resistance through upregulation of SKP2, an ubiquitin ligase that degrades p27Kip1. The decline in p27Kip1 levels in turn antagonizes trastuzumab-mediated G1 cell cycle arrest (Lu et al., 2001; Lu et al., 2004). Further, an anti-IGF-1R antibody or recombinant IGF binding protein3 (IGF-BP3) enhanced response to trastuzumab in resistant cells (Camirand et al., 2002; Jerome et al., 2006). Nahta et al. (2005) demonstrated that IGF-1R and HER2 can form heterodimers, which is only observed in trastuzumab resistant cells. This leads to IGF1-stimulated HER2 phosphorylation in resistant cells. Further, treatment with an anti-IGF-1R antibody restored sensitivity in the resistant cells by disrupting IGF-1R/HER2 hetrodimerization and accumulation of p27Kip1 (Nahta et al., 2005). A recent publication demonstrated that HER2, HER3, and IGF-1R form a heterotrimer in trastuzumab resistant cells (Huang et al., 2010). Silencing HER3 or IGF-1R with short hairpin RNA (shRNA) re-sensitized cells to trastuzumab via an upregulation of p27Kip1 (Huang et al., 2010). Shattuck et al. (2008) demonstrated that MET over-expression is observed in trastuzumab resistant cell lines. Silencing MET sensitized cells to trastuzumab and similar to IGF-1R 51  inhibition increased p27Kip1. Additionally, elevated levels of the RTK, ephrin-A receptor has been shown to mediate resistance to trastuzumab, while its inhibition restores sensitivity to trastuzumab treatment in vivo (Zhuang et al., 2010). Moreover, as trastuzumab is unable to block ligand-induced EGFR/HER2 and HER2/HER3 heterodimerization, stimulation through these receptors can maintain signalling (Agus et al., 2002; Cho et al., 2003). In a model of acquired trastuzumab resistance developed in mice, Ritter et al. (2007) demonstrated that trastuzumab resistant cells have higher expression of EGFR that formed heterodimers with HER2. Inhibition of EGFR tyrosine kinase activity with selective inhibitors such as erlotinib and gefitinib decreased phosphorylation of HER2 and induced apoptosis in trastuzumab resistant cells (Ritter et al., 2007). Moreover, upregulation of anti-apoptotic proteins including MCL-1 and inhibitor of apoptosis family members cIAP1 (BIRC2) and cIAP2 (BIRC3) can promote resistance to antiHER2 targeted therapies (Foster et al., 2009; Martin et al., 2008). Inhibition of these antiapoptotic factors has been shown to increase sensitivity to trastuzumab (Foster et al., 2009; Martin et al., 2008). Enhanced intracellular signalling is also a proposed mechanism for trastuzumab resistance. Loss of PTEN or activating PIK3CA mutations have been suggested to confer trastuzumab resistance through increased PI3K signalling (Berns et al., 2007; Junttila et al., 2009; Nagata et al., 2004). Patients with PTEN deficient tumours have a worse response to trastuzumab than patients with normal PTEN levels (Berns et al., 2007; Nagata et al., 2004). Correspondingly, silencing PTEN in breast cancer cells conferred trastuzumab resistance in vitro and in vivo, while PI3K inhibitors rescued PTEN loss-induced trastuzumab resistance (Berns et al., 2007; Nagata et al., 2004). Additionally, patients with oncogenic PIK3CA mutations have poor prognosis after trastuzumab therapy (Berns et al., 2007). PIK3CA mutations are activating and can potentiate signals independent of RTKs, therefore mediating trastuzumab resistance (Berns et al., 2007; Junttila et al., 2009). Junttila et al. (2009) recently showed that activating 52  mutations of PIK3CA or loss of PTEN mediate resistance through a HER2/HER3-independent signalling that would not be affected by trastuzumab treatment. They further demonstrated that the class I PI3K inhibitor, GDC-0941, is a novel inhibitor for trastuzumab refractory cancers. Recent evidence also indicates that breast cancer stem/progenitor cells may play a role in resistance to trastuzumab (Dhillon et al., 2010; Oliveras-Ferraros et al., 2010). Recent work from our laboratory has demonstrated that YB-1 is more highly phosphorylated in trastuzumab resistant cell lines, and drives the expression of CD44, a marker of breast cancer stem/progenitor cells, to mediate resistance (Dhillon et al., 2010). In addition, silencing YB-1 sensitizes the resistant cells to trastuzumab, suggesting that its inhibition may have potential benefits in treating trastuzumab refractory disease (Dhillon et al., 2010). Interestingly, the anti-diabetic drug metformin has also been shown to have synergistic effects with trastuzumab. Although the mechanism of action of metformin-mediated sensitization to trastuzumab is not yet defined, it has been shown to eliminate progenitor cell populations in breast cancer (Hirsch et al., 2009; Vazquez-Martin et al., 2010). Clearly, as stated above, there are various alterations that a cancer cell can undergo to bypass the effects of trastuzumab. Therefore, the efficacy of novel drugs to overcome resistance may be different on a case-by-case basis. The key to solving the problem of trastuzumab resistance is to find a common denominator, which can also act as a good therapeutic target.  POTENTIAL NEW THERAPIES TO OVERCOME TRASTUZUMAB RESISTANCE There are currently several drugs that are being evaluated clinically for trastuzumab refractory disease. Lapatinib is an oral small-molecule tyrosine kinase inhibitor directed against EGFR and HER2 (Xia et al., 2002). It was approved in 2007 based on a randomized phase III clinical trial, which showed that its combination with capecitabine increased time to progression compared to capecitabine alone in patients with HER2-positive metastatic breast cancers who 53  had previously been treated with anthracyclines, taxanes, and had progressed on trastuzumab (Geyer et al., 2006). However, resistance to lapatinib also frequently occurs (Eichhorn et al., 2008; Esteva et al., 2010). Trials are currently underway to assess the benefit of lapatinib in both the adjuvant and neoadjuvant setting in patients with early stage disease. Novel therapeutics currently in clinical development to overcome resistance to trastuzumab include: neratinib, pertuzumab, trastuzumab-DM1, PI3K inhibitors, HSP90 inhibitors, and IGF-IR inhibitors. Neratinib (HKI-272) is an irreversible oral inhibitor of EGFR and HER2 kinases that has so far shown clinical benefit in patients with HER2-positive metastatic breast cancer that have progressed on trastuzumab (Burstein et al., 2010). Pertuzumab is a humanized monoclonal antibody that is directed against the extracellular heterodimerization domain of HER2 (Adams et al., 2006). In comparison to trastuzumab that binds to domain IV, pertuzumab binds to domain II and effectively blocks HER2/HER3 heterodimerization and downstream signalling (Agus et al., 2002). Pertuzumab may also inhibit HER2/EGFR binding, although data on this is conflicting (Agus et al., 2002; Cai et al., 2008). In phase II trials, pertuzumab in combination with trastuzumab has shown promise in patients with metastatic HER2-positive breast cancer who had experienced progression during prior trastuzumab therapy (Baselga et al., 2010). Trastuzumab-DM1 is an antibody conjugated with a microtubule inhibitor (DM1) (Lewis Phillips et al., 2008). Cancer cells internalize trastuzumab-DM1, where DM1 is released, resulting in cytotoxic effects (Esteva et al., 2010). Phase I clinical trials have shown clinical activity in patients with advanced disease, and phase II and III trials are currently underway (Esteva et al., 2010; Krop et al., 2010). The involvement of the PI3K pathway in trastuzumab resistance has been demonstrated by several studies (Berns et al., 2007; Junttila et al., 2009; Nagata et al., 2004). The preclinical evidence provided by Junttilla et al. (2009) demonstrated a synergistic effect of the class I selective PI3K inhibitor GDC-0941 with trastuzumab in vitro and in vivo. As a result, clinical 54  trials are currently exploring the efficacy of this drug both as monotherapy and in combination with trastuzumab-DM1 (Esteva et al., 2010). Moreover, as stated in the previous section, HSP90 has been implicated in resistance to trastuzumab (Austin et al., 2004; Basso et al., 2002; Chandarlapaty et al., 2010; Modi et al., 2007; Munster et al., 2002; Raja et al., 2008; Zsebik et al., 2006). In a phase I clinical trial, the HSP90 inhibitor tanespimycin (17-AAG) in combination with trastuzumab showed activity in patients with HER2-positive metastatic breast cancer who had progressed on trastuzumab therapy (Modi et al., 2007). Similarly, as IGF-1R is involved in trastuzumab resistance (Camirand et al., 2002; Harris et al., 2007; Jerome et al., 2006; Lu et al., 2001; Lu et al., 2004; Nahta et al., 2005), its inhibitors are being explored in the clinical setting. AMG-471 is an IGF-IR monoclonal antibody that is currently being explored in clinical trials in combination with trastuzumab in patients with advanced disease who have progressed on trastuzumab therapy. IGF-1R tyrosine kinase inhibitors have been a clinical challenge as a result of unwanted side effects due to its similarity to the insulin receptor (Esteva et al., 2010). As results of these clinical trials are released, it will become clear whether the new therapeutic approaches will benefit women with HER2-positive breast cancer. For now more research is required to better identify the key players involved in mediating resistance to trastuzumab in the hope of discovering new targets for therapy.  1.4 HYPOTHESIS AND OBJECTIVES Hypothesis: YB-1 is a target for novel therapeutic approaches against aggressive forms of breast cancer.  Although current treatment strategies have improved outcomes for women with breast cancer, there can certainly be improvements. The broader goal of our studies is to identify better targeted therapies to improve outcome for women diagnosed with the most 55  aggressive subtypes of breast cancer, notably the basal-like and the HER2 over-expressing. Patients with basal-like breast carcinoma (BLBC) and HER2 over-expressing tumours typically have the worst prognosis compared to other breast cancer subtypes (Carey et al., 2006; Sorlie et al., 2001; Sorlie et al., 2003). The poor outcome in BLBC is partly due to the lack of effective therapeutic strategies. The majority of BLBC tumours lack expression of ER, PR, and HER2, and therefore do not benefit from the current targeted treatments available including endocrine therapies or trastuzumab. Understanding the molecular pathways involved in BLBC may help unravel potential therapeutic targets. The main objective of chapters 2 and 3 is to characterize the contribution of YB-1 and its downstream targets MET and PIK3CA to the BLBC phenotype. These studies suggest YB-1 as a valid therapeutic target in BLBC. Furthermore, although trastuzumab has improved outcome for patients with HER2positive breast tumours, clinical observations indicate that only 30% have an initial response to treatment; thus intrinsic resistance is apparent (Vogel et al., 2002). Moreover, the majority of patients who achieve a response to trastuzumab acquire resistance within one year (Nahta and Esteva, 2006). Therefore, understanding the mechanisms of trastuzumab resistance has important clinical implications. In chapter 4, the objective is to unravel the signalling mechanisms by which cells acquire resistance to trastuzumab therapy. Further, we recently demonstrated that elevated P-YB-1S102 levels decreased response to trastuzumab (Dhillon et al., 2010); however, the molecular details concerning this mechanism remains elusive. Therefore, in chapter 4, we also aim to identify the downstream targets of YB-1 unique to trastuzumab refractory cell lines in order to better understand its contribution to resistant disease.  56  1.5 REFERENCES Abounader R, Lal B, Luddy C, Koe G, Davidson B, Rosen EM et al. (2002). In vivo targeting of SF/HGF and c-met expression via U1snRNA/ribozymes inhibits glioma growth and angiogenesis and promotes apoptosis. FASEB J 16: 108-110. Adams CW, Allison DE, Flagella K, Presta L, Clarke J, Dybdal N et al. (2006). Humanization of a recombinant monoclonal antibody to produce a therapeutic HER dimerization inhibitor, pertuzumab. Cancer Immunol Immunother 55: 717-727. Afonso N, Bouwman D. (2008). Lobular carcinoma in situ. Eur J Cancer Prev 17: 312-316. Agus DB, Akita RW, Fox WD, Lewis GD, Higgins B, Pisacane PI et al. (2002). Targeting ligand-activated ErbB2 signalling inhibits breast and prostate tumour growth. Cancer Cell 2: 127-137. AJCC (American Joint Committee on Cancer) Cancer Staging Manual, 7th ed, Edge, SB, Byrd, DR, Compton, CC, et al (Eds), Springer-Verlag, New York, 2010. 347-377. Alessi DR, Andjelkovic M, Caudwell B, Cron P, Morrice N, Cohen P et al. (1996). Mechanism of activation of protein kinase B by insulin and IGF-1. EMBO J 15: 6541-6551. Alessi DR, James SR, Downes CP, Holmes AB, Gaffney PR, Reese CB et al. (1997). Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase balpha. Curr Biol 7: 261-269. Andrechek ER, White D, Muller WJ. (2005). Targeted disruption of ErbB2/Neu in the mammary epithelium results in impaired ductal outgrowth. Oncogene 24: 932-937. Arnould L, Gelly M, Penault-Llorca F, Benoit L, Bonnetain F, Migeon C et al. (2006). Trastuzumab-based treatment of HER2-positive breast cancer: An antibody-dependent cellular cytotoxicity mechanism? Br J Cancer 94: 259-267. Asaoka Y, Tada M, Ikenoue T, Seto M, Imai M, Miyabayashi K et al. (2010). Gastric cancer cell line Hs746T harbours a splice site mutation of c-met causing juxtamembrane domain deletion. Biochem Biophys Res Commun 394: 1042-1046. Astanehe A, Arenillas D, Wasserman WW, Leung PC, Dunn SE, Davies BR et al. (2008). Mechanisms underlying p53 regulation of PIK3CA transcription in ovarian surface epithelium and in ovarian cancer. J Cell Sci 121: 664-674. Astanehe A, Finkbeiner MR, Hojabrpour P, To K, Fotovati A, Shadeo A et al. (2009). The transcriptional induction of PIK3CA in tumour cells is dependent on the oncoprotein Y-box binding protein-1. Oncogene 28: 2406-2418. Austin CD, De Maziere AM, Pisacane PI, van Dijk SM, Eigenbrot C, Sliwkowski MX et al. (2004). Endocytosis and sorting of ErbB2 and the site of action of cancer therapeutics trastuzumab and geldanamycin. Mol Biol Cell 15: 5268-5282. 57  Ayers M, Symmans WF, Stec J, Damokosh AI, Clark E, Hess K et al. (2004). Gene expression profiles predict complete pathologic response to neoadjuvant paclitaxel and fluorouracil, doxorubicin, and cyclophosphamide chemotherapy in breast cancer. J Clin Oncol 22: 22842293. Bachman KE, Argani P, Samuels Y, Silliman N, Ptak J, Szabo S et al. (2004). The PIK3CA gene is mutated with high frequency in human breast cancers. Cancer Biol Ther 3: 772-775. Bader AG, Kang S, Vogt PK. (2006). Cancer-specific mutations in PIK3CA are oncogenic in vivo. Proc Natl Acad Sci U S A 103: 1475-1479. Bader AG, Vogt PK. (2008). Phosphorylation by akt disables the anti-oncogenic activity of YB1. Oncogene 27: 1179-1182. Bader AG, Vogt PK. (2005). Inhibition of protein synthesis by Y box-binding protein 1 blocks oncogenic cell transformation. Mol Cell Biol 25: 2095-2106. Bain J, Plater L, Elliott M, Shpiro N, Hastie CJ, McLauchlan H et al. (2007). The selectivity of protein kinase inhibitors: A further update. Biochem J 408: 297-315. Bargmann CI, Hung MC, Weinberg RA. (1986). The neu oncogene encodes an epidermal growth factor receptor-related protein. Nature 319: 226-230. Bargou RC, Jurchott K, Wagener C, Bergmann S, Metzner S, Bommert K et al. (1997). Nuclear localization and increased levels of transcription factor YB-1 in primary human breast cancers are associated with intrinsic MDR1 gene expression. Nat Med 3: 447-450. Baselga J, Gelmon KA, Verma S, Wardley A, Conte P, Miles D et al. (2010). Phase II trial of pertuzumab and trastuzumab in patients with human epidermal growth factor receptor 2-positive metastatic breast cancer that progressed during prior trastuzumab therapy. J Clin Oncol 28: 1138-1144. Baselga J, Norton L, Albanell J, Kim YM, Mendelsohn J. (1998). Recombinant humanized antiHER2 antibody (herceptin) enhances the antitumour activity of paclitaxel and doxorubicin against HER2/neu overexpressing human breast cancer xenografts. Cancer Res 58: 2825-2831. Baselga J, Tripathy D, Mendelsohn J, Baughman S, Benz CC, Dantis L et al. (1996). Phase II study of weekly intravenous recombinant humanized anti-p185HER2 monoclonal antibody in patients with HER2/neu-overexpressing metastatic breast cancer. J Clin Oncol 14: 737-744. Basso AD, Solit DB, Munster PN, Rosen N. (2002). Ansamycin antibiotics inhibit akt activation and cyclin D expression in breast cancer cells that overexpress HER2. Oncogene 21: 1159-1166. Baum M, Buzdar A, Cuzick J, Forbes J, Houghton J, Howell A et al. (2003). Anastrozole alone or in combination with tamoxifen versus tamoxifen alone for adjuvant treatment of postmenopausal women with early-stage breast cancer: Results of the ATAC (arimidex, tamoxifen alone or in combination) trial efficacy and safety update analyses. Cancer 98: 18021810. 58  Bean J, Brennan C, Shih JY, Riely G, Viale A, Wang L et al. (2007). MET amplification occurs with or without T790M mutations in EGFR mutant lung tumours with acquired resistance to gefitinib or erlotinib. Proc Natl Acad Sci U S A 104: 20932-20937. Bergmann S, Royer-Pokora B, Fietze E, Jurchott K, Hildebrandt B, Trost D et al. (2005). YB-1 provokes breast cancer through the induction of chromosomal instability that emerges from mitotic failure and centrosome amplification. Cancer Res 65: 4078-4087. Berns K, Horlings HM, Hennessy BT, Madiredjo M, Hijmans EM, Beelen K et al. (2007). A functional genetic approach identifies the PI3K pathway as a major determinant of trastuzumab resistance in breast cancer. Cancer Cell 12: 395-402. Beroukhim R, Getz G, Nghiemphu L, Barretina J, Hsueh T, Linhart D et al. (2007). Assessing the significance of chromosomal aberrations in cancer: Methodology and application to glioma. Proc Natl Acad Sci U S A 104: 20007-20012. Berry DA, Cirrincione C, Henderson IC, Citron ML, Budman DR, Goldstein LJ et al. (2006). Estrogen-receptor status and outcomes of modern chemotherapy for patients with node-positive breast cancer. JAMA 295: 1658-1667. Beslija S, Bonneterre J, Burstein HJ, Cocquyt V, Gnant M, Heinemann V et al. (2009). Third consensus on medical treatment of metastatic breast cancer. Ann Oncol 20: 1771-1785. Bi L, Okabe I, Bernard DJ, Nussbaum RL. (2002). Early embryonic lethality in mice deficient in the p110beta catalytic subunit of PI 3-kinase. Mamm Genome 13: 169-172. Bi L, Okabe I, Bernard DJ, Wynshaw-Boris A, Nussbaum RL. (1999). Proliferative defect and embryonic lethality in mice homozygous for a deletion in the p110alpha subunit of phosphoinositide 3-kinase. J Biol Chem 274: 10963-10968. Bianchini A, Loiarro M, Bielli P, Busa R, Paronetto MP, Loreni F et al. (2008). Phosphorylation of eIF4E by MNKs supports protein synthesis, cell cycle progression and proliferation in prostate cancer cells. Carcinogenesis 29: 2279-2288. Billottet C, Grandage VL, Gale RE, Quattropani A, Rommel C, Vanhaesebroeck B et al. (2006). A selective inhibitor of the p110delta isoform of PI 3-kinase inhibits AML cell proliferation and survival and increases the cytotoxic effects of VP16. Oncogene 25: 6648-6659. Birchmeier C, Birchmeier W, Gherardi E, Vande Woude GF. (2003). Met, metastasis, motility and more. Nat Rev Mol Cell Biol 4: 915-925. Bishop JM. (1983). Cellular oncogenes and retroviruses. Annu Rev Biochem 52: 301-354. Bladt F, Riethmacher D, Isenmann S, Aguzzi A, Birchmeier C. (1995). Essential role for the cmet receptor in the migration of myogenic precursor cells into the limb bud. Nature 376: 768771.  59  Boccaccio C, Comoglio PM. (2006). Invasive growth: A MET-driven genetic programme for cancer and stem cells. Nat Rev Cancer 6: 637-645. Boccaccio C, Gaudino G, Gambarotta G, Galimi F, Comoglio PM. (1994). Hepatocyte growth factor (HGF) receptor expression is inducible and is part of the delayed-early response to HGF. J Biol Chem 269: 12846-12851. Boller D, Schramm A, Doepfner KT, Shalaby T, von Bueren AO, Eggert A et al. (2008). Targeting the phosphoinositide 3-kinase isoform p110delta impairs growth and survival in neuroblastoma cells. Clin Cancer Res 14: 1172-1181. Bondeva T, Pirola L, Bulgarelli-Leva G, Rubio I, Wetzker R, Wymann MP. (1998). Bifurcation of lipid and protein kinase signals of PI3Kgamma to the protein kinases PKB and MAPK. Science 282: 293-296. Bottaro DP, Rubin JS, Faletto DL, Chan AM, Kmiecik TE, Vande Woude GF et al. (1991). Identification of the hepatocyte growth factor receptor as the c-met proto-oncogene product. Science 251: 802-804. Bouchard L, Lamarre L, Tremblay PJ, Jolicoeur P. (1989). Stochastic appearance of mammary tumours in transgenic mice carrying the MMTV/c-neu oncogene. Cell 57: 931-936. Bouvet P, Matsumoto K, Wolffe AP. (1995). Sequence-specific RNA recognition by the xenopus Y-box proteins. an essential role for the cold shock domain. J Biol Chem 270: 2829728303. Burgering BM, Coffer PJ. (1995). Protein kinase B (c-akt) in phosphatidylinositol-3-OH kinase signal transduction. Nature 376: 599-602. Burstein HJ, Sun Y, Dirix LY, Jiang Z, Paridaens R, Tan AR et al. (2010). Neratinib, an irreversible ErbB receptor tyrosine kinase inhibitor, in patients with advanced ErbB2-positive breast cancer. J Clin Oncol 28: 1301-1307. Buxade M, Morrice N, Krebs DL, Proud CG. (2008). The PSF.p54nrb complex is a novel mnk substrate that binds the mRNA for tumour necrosis factor alpha. J Biol Chem 283: 57-65. Buxade M, Parra JL, Rousseau S, Shpiro N, Marquez R, Morrice N et al. (2005). The mnks are novel components in the control of TNF alpha biosynthesis and phosphorylate and regulate hnRNP A1. Immunity 23: 177-189. Byun DS, Cho K, Ryu BK, Lee MG, Park JI, Chae KS et al. (2003). Frequent monoallelic deletion of PTEN and its reciprocal associatioin with PIK3CA amplification in gastric carcinoma. Int J Cancer 104: 318-327. Cai Z, Zhang G, Zhou Z, Bembas K, Drebin JA, Greene MI et al. (2008). Differential binding patterns of monoclonal antibody 2C4 to the ErbB3-p185her2/neu and the EGFR-p185her2/neu complexes. Oncogene 27: 3870-3874.  60  Camirand A, Lu Y, Pollak M. (2002). Co-targeting HER2/ErbB2 and insulin-like growth factor1 receptors causes synergistic inhibition of growth in HER2-overexpressing breast cancer cells. Med Sci Monit 8: BR521-6. Camp RL, Rimm EB, Rimm DL. (1999). Met expression is associated with poor outcome in patients with axillary lymph node negative breast carcinoma. Cancer 86: 2259-2265. Carey LA, Dees EC, Sawyer L, Gatti L, Moore DT, Collichio F et al. (2007). The triple negative paradox: Primary tumour chemosensitivity of breast cancer subtypes. Clin Cancer Res 13: 23292334. Carey LA, Perou CM, Livasy CA, Dressler LG, Cowan D, Conway K et al. (2006). Race, breast cancer subtypes, and survival in the carolina breast cancer study. JAMA 295: 2492-2502. Carpenter CL, Auger KR, Duckworth BC, Hou WM, Schaffhausen B, Cantley LC. (1993). A tightly associated serine/threonine protein kinase regulates phosphoinositide 3-kinase activity. Mol Cell Biol 13: 1657-1665. Carracedo A, Egervari K, Salido M, Rojo F, Corominas JM, Arumi M et al. (2009). FISH and immunohistochemical status of the hepatocyte growth factor receptor (c-met) in 184 invasive breast tumours. Breast Cancer Res 11: 402. Carter CL, Allen C, Henson DE. (1989). Relation of tumour size, lymph node status, and survival in 24,740 breast cancer cases. Cancer 63: 181-187. Carter P, Presta L, Gorman CM, Ridgway JB, Henner D, Wong WL et al. (1992). Humanization of an anti-p185HER2 antibody for human cancer therapy. Proc Natl Acad Sci U S A 89: 42854289. CCSSC (Canadian Cancer Society’s Steering Committee): Canadian Cancer Statistics 2009. Toronto: Canadian Cancer Society, 2009.” April 2009, ISSN 0835-2976 Chandarlapaty S, Scaltriti M, Angelini P, Ye Q, Guzman M, Hudis CA et al. (2010). Inhibitors of HSP90 block p95-HER2 signalling in trastuzumab-resistant tumours and suppress their growth. Oncogene 29: 325-334. Chansky HA, Hu M, Hickstein DD, Yang L. (2001). Oncogenic TLS/ERG and EWS/Fli-1 fusion proteins inhibit RNA splicing mediated by YB-1 protein. Cancer Res 61: 3586-3590. Chantry D, Vojtek A, Kashishian A, Holtzman DA, Wood C, Gray PW et al. (1997). P110delta, a novel phosphatidylinositol 3-kinase catalytic subunit that associates with P85 and is expressed predominantly in leukocytes. J Biol Chem 272: 19236-19241. Chatterjee M, Rancso C, Stuhmer T, Eckstein N, Andrulis M, Gerecke C et al. (2008). The Ybox binding protein YB-1 is associated with progressive disease and mediates survival and drug resistance in multiple myeloma. Blood 111: 3714-3722. Cheang MC, Voduc D, Bajdik C, Leung S, McKinney S, Chia SK et al. (2008). Basal-like breast cancer defined by five biomarkers has superior prognostic value than triple-negative phenotype. 61  Clin Cancer Res 14: 1368-1376. Chen CY, Gherzi R, Andersen JS, Gaietta G, Jurchott K, Royer HD et al. (2000). Nucleolin and YB-1 are required for JNK-mediated interleukin-2 mRNA stabilization during T-cell activation. Genes Dev 14: 1236-1248. Cho HS, Mason K, Ramyar KX, Stanley AM, Gabelli SB, Denney DW,Jr et al. (2003). Structure of the extracellular region of HER2 alone and in complex with the herceptin fab. Nature 421: 756-760. Chrestensen CA, Shuman JK, Eschenroeder A, Worthington M, Gram H, Sturgill TW. (2007). MNK1 and MNK2 regulation in HER2-overexpressing breast cancer lines. J Biol Chem 282: 4243-4252. Christianson TA, Doherty JK, Lin YJ, Ramsey EE, Holmes R, Keenan EJ et al. (1998). NH2terminally truncated HER2/neu protein: Relationship with shedding of the extracellular domain and with prognostic factors in breast cancer. Cancer Res 58: 5123-5129. Ciraolo E, Iezzi M, Marone R, Marengo S, Curcio C, Costa C et al. (2008). Phosphoinositide 3kinase p110beta activity: Key role in metabolism and mammary gland cancer but not development. Sci Signal 1: ra3. Clarke M, Collins R, Darby S, Davies C, Elphinstone P, Evans E et al. (2005). Effects of radiotherapy and of differences in the extent of surgery for early breast cancer on local recurrence and 15-year survival: An overview of the randomised trials. Lancet 366: 2087-2106. Clynes RA, Towers TL, Presta LG, Ravetch JV. (2000). Inhibitory fc receptors modulate in vivo cytoxicity against tumour targets. Nat Med 6: 443-446. Cobbold LC, Spriggs KA, Haines SJ, Dobbyn HC, Hayes C, de Moor CH et al. (2008). Identification of internal ribosome entry segment (IRES)-trans-acting factors for the myc family of IRESs. Mol Cell Biol 28: 40-49. Cobleigh MA, Vogel CL, Tripathy D, Robert NJ, Scholl S, Fehrenbacher L et al. (1999). Multinational study of the efficacy and safety of humanized anti-HER2 monoclonal antibody in women who have HER2-overexpressing metastatic breast cancer that has progressed after chemotherapy for metastatic disease. J Clin Oncol 17: 2639-2648. Codony-Servat J, Albanell J, Lopez-Talavera JC, Arribas J, Baselga J. (1999). Cleavage of the HER2 ectodomain is a pervanadate-activable process that is inhibited by the tissue inhibitor of metalloproteases-1 in breast cancer cells. Cancer Res 59: 1196-1201. Comoglio PM, Boccaccio C. (2001). Scatter factors and invasive growth. Semin Cancer Biol 11: 153-165. Conrotto P, Corso S, Gamberini S, Comoglio PM, Giordano S. (2004). Interplay between scatter factor receptors and B plexins controls invasive growth. Oncogene 23: 5131-5137.  62  Conrotto P, Valdembri D, Corso S, Serini G, Tamagnone L, Comoglio PM et al. (2005). Sema4D induces angiogenesis through met recruitment by plexin B1. Blood 105: 4321-4329. Cooley S, Burns LJ, Repka T, Miller JS. (1999). Natural killer cell cytotoxicity of breast cancer targets is enhanced by two distinct mechanisms of antibody-dependent cellular cytotoxicity against LFA-3 and HER2/neu. Exp Hematol 27: 1533-1541. Cooper CS, Park M, Blair DG, Tainsky MA, Huebner K, Croce CM et al. (1984). Molecular cloning of a new transforming gene from a chemically transformed human cell line. Nature 311: 29-33. Corney DC, Hwang CI, Matoso A, Vogt M, Flesken-Nikitin A, Godwin AK et al. (2010). Frequent downregulation of miR-34 family in human ovarian cancers. Clin Cancer Res 16: 1119-1128. Costa RB, Kurra G, Greenberg L, Geyer CE. (2010). Efficacy and cardiac safety of adjuvant trastuzumab-based chemotherapy regimens for HER2-positive early breast cancer. Ann Oncol. Epub ahead of print. Coussens L, Yang-Feng TL, Liao YC, Chen E, Gray A, McGrath J et al. (1985). Tyrosine kinase receptor with extensive homology to EGF receptor shares chromosomal location with neu oncogene. Science 230: 1132-1139. Crawford LV, Pim DC, Lamb P. (1984). The cellular protein p53 in human tumours. Mol Biol Med 2: 261-272. Cuello M, Ettenberg SA, Clark AS, Keane MM, Posner RH, Nau MM et al. (2001). Downregulation of the erbB-2 receptor by trastuzumab (herceptin) enhances tumour necrosis factorrelated apoptosis-inducing ligand-mediated apoptosis in breast and ovarian cancer cell lines that overexpress erbB-2. Cancer Res 61: 4892-4900. Damm S, Koefinger P, Stefan M, Wels C, Mehes G, Richtig E et al. (2010). HGF-promoted motility in primary human melanocytes depends on CD44v6 regulated via NF-kappa B, egr-1, and C/EBP-beta. J Invest Dermatol 130: 1893-1903. Danilkovitch-Miagkova A, Zbar B. (2002). Dysregulation of met receptor tyrosine kinase activity in invasive tumours. J Clin Invest 109: 863-867. Das S, Chattopadhyay R, Bhakat KK, Boldogh I, Kohno K, Prasad R et al. (2007). Stimulation of NEIL2-mediated oxidized base excision repair via YB-1 interaction during oxidative stress. J Biol Chem 282: 28474-28484. DaSilva J, Xu L, Kim HJ, Miller WT, Bar-Sagi D. (2006). Regulation of sprouty stability by Mnk1-dependent phosphorylation. Mol Cell Biol 26: 1898-1907. De Benedetti A, Graff JR. (2004). eIF-4E expression and its role in malignancies and metastases. Oncogene 23: 3189-3199.  63  de Souza-Pinto NC, Mason PA, Hashiguchi K, Weissman L, Tian J, Guay D et al. (2009). Novel DNA mismatch-repair activity involving YB-1 in human mitochondria. DNA Repair (Amst) 8: 704-719. Dean M, Park M, Le Beau MM, Robins TS, Diaz MO, Rowley JD et al. (1985). The human met oncogene is related to the tyrosine kinase oncogenes. Nature 318: 385-388. Delcommenne M, Tan C, Gray V, Rue L, Woodgett J, Dedhar S. (1998). Phosphoinositide-3-OH kinase-dependent regulation of glycogen synthase kinase 3 and protein kinase B/AKT by the integrin-linked kinase. Proc Natl Acad Sci U S A 95: 11211-11216. Derksen PW, de Gorter DJ, Meijer HP, Bende RJ, van Dijk M, Lokhorst HM et al. (2003). The hepatocyte growth factor/Met pathway controls proliferation and apoptosis in multiple myeloma. Leukaemia 17: 764-774. Dhand R, Hiles I, Panayotou G, Roche S, Fry MJ, Gout I et al. (1994). PI 3-kinase is a dual specificity enzyme: Autoregulation by an intrinsic protein-serine kinase activity. EMBO J 13: 522-533. Dhillon J, Astanehe A, Lee C, Fotovati A, Hu K, Dunn SE. (2010). The expression of activated Y-box binding protein-1 serine 102 mediates trastuzumab resistance in breast cancer cells by increasing CD44+ cells. Oncogene (in press). Di Fiore PP, Pierce JH, Kraus MH, Segatto O, King CR, Aaronson SA. (1987). erbB-2 is a potent oncogene when overexpressed in NIH/3T3 cells. Science 237: 178-182. Di Renzo MF, Olivero M, Katsaros D, Crepaldi T, Gaglia P, Zola P et al. (1994). Overexpression of the Met/HGF receptor in ovarian cancer. Int J Cancer 58: 658-662. Di Renzo MF, Olivero M, Martone T, Maffe A, Maggiora P, Stefani AD et al. (2000). Somatic mutations of the MET oncogene are selected during metastatic spread of human HNSC carcinomas. Oncogene 19: 1547-1555. Didier DK, Schiffenbauer J, Woulfe SL, Zacheis M, Schwartz BD. (1988). Characterization of the cDNA encoding a protein binding to the major histocompatibility complex class II Y box. Proc Natl Acad Sci U S A 85: 7322-7326. Downward J, Yarden Y, Mayes E, Scrace G, Totty N, Stockwell P et al. (1984). Close similarity of epidermal growth factor receptor and v-erb-B oncogene protein sequences. Nature 307: 521527. Eder JP, Vande Woude GF, Boerner SA, LoRusso PM. (2009). Novel therapeutic inhibitors of the c-met signalling pathway in cancer. Clin Cancer Res 15: 2207-2214. Eichhorn PJ, Gili M, Scaltriti M, Serra V, Guzman M, Nijkamp W et al. (2008). Phosphatidylinositol 3-kinase hyperactivation results in lapatinib resistance that is reversed by the mTOR/phosphatidylinositol 3-kinase inhibitor NVP-BEZ235. Cancer Res 68: 9221-9230.  64  Ekmektzoglou KA, Xanthos T, German V, Zografos GC. (2009). Breast cancer: From the earliest times through to the end of the 20th century. Eur J Obstet Gynecol Reprod Biol 145: 3-8. Elliott BE, Hung WL, Boag AH, Tuck AB. (2002). The role of hepatocyte growth factor (scatter factor) in epithelial-mesenchymal transition and breast cancer. Can J Physiol Pharmacol 80: 91102. Engelman JA, Zejnullahu K, Mitsudomi T, Song Y, Hyland C, Park JO et al. (2007). MET amplification leads to gefitinib resistance in lung cancer by activating ERBB3 signalling. Science 316: 1039-1043. En-Nia A, Yilmaz E, Klinge U, Lovett DH, Stefanidis I, Mertens PR. (2005). Transcription factor YB-1 mediates DNA polymerase alpha gene expression. J Biol Chem 280: 7702-7711. Epstein JA, Shapiro DN, Cheng J, Lam PY, Maas RL. (1996). Pax3 modulates expression of the c-met receptor during limb muscle development. Proc Natl Acad Sci U S A 93: 4213-4218. Escobedo JA, Navankasattusas S, Kavanaugh WM, Milfay D, Fried VA, Williams LT. (1991). cDNA cloning of a novel 85 kd protein that has SH2 domains and regulates binding of PI3kinase to the PDGF beta-receptor. Cell 65: 75-82. Esteva FJ, Valero V, Booser D, Guerra LT, Murray JL, Pusztai L et al. (2002). Phase II study of weekly docetaxel and trastuzumab for patients with HER2-overexpressing metastatic breast cancer. J Clin Oncol 20: 1800-1808. Esteva FJ, Yu D, Hung MC, Hortobagyi GN. (2010). Molecular predictors of response to trastuzumab and lapatinib in breast cancer. Nat Rev Clin Oncol 7: 98-107. Evdokimova V, Ruzanov P, Anglesio MS, Sorokin AV, Ovchinnikov LP, Buckley J et al. (2006). Akt-mediated YB-1 phosphorylation activates translation of silent mRNA species. Mol Cell Biol 26: 277-292. Evdokimova V, Ruzanov P, Imataka H, Raught B, Svitkin Y, Ovchinnikov LP et al. (2001). The major mRNA-associated protein YB-1 is a potent 5' cap-dependent mRNA stabilizer. EMBO J 20: 5491-5502. Evdokimova V, Tognon C, Ng T, Ruzanov P, Melnyk N, Fink D et al. (2009). Translational activation of snail1 and other developmentally regulated transcription factors by YB-1 promotes an epithelial-mesenchymal transition. Cancer Cell 15: 402-415. Evdokimova VM, Ovchinnikov LP. (1999). Translational regulation by Y-box transcription factor: Involvement of the major mRNA-associated protein, p50. Int J Biochem Cell Biol 31: 139-149. Falls DL. (2003). Neuregulins: Functions, forms, and signalling strategies. Exp Cell Res 284: 1430.  65  Fan C, Oh DS, Wessels L, Weigelt B, Nuyten DS, Nobel AB et al. (2006). Concordance among gene-expression-based predictors for breast cancer. N Engl J Med 355: 560-569. Fan S, Ma YX, Gao M, Yuan RQ, Meng Q, Goldberg ID et al. (2001). The multisubstrate adapter Gab1 regulates hepatocyte growth factor (scatter factor)-c-met signalling for cell survival and DNA repair. Mol Cell Biol 21: 4968-4984. Faury D, Nantel A, Dunn SE, Guiot MC, Haque T, Hauser P et al. (2007). Molecular profiling identifies prognostic subgroups of pediatric glioblastoma and shows increased YB-1 expression in tumours. J Clin Oncol 25: 1196-1208. Fendly BM, Winget M, Hudziak RM, Lipari MT, Napier MA, Ullrich A. (1990). Characterization of murine monoclonal antibodies reactive to either the human epidermal growth factor receptor or HER2/neu gene product. Cancer Res 50: 1550-1558. Feng J, Park J, Cron P, Hess D, Hemmings BA. (2004). Identification of a PKB/Akt hydrophobic motif ser-473 kinase as DNA-dependent protein kinase. J Biol Chem 279: 4118941196. Ferracini R, Di Renzo MF, Scotlandi K, Baldini N, Olivero M, Lollini P et al. (1995). The Met/HGF receptor is over-expressed in human osteosarcomas and is activated by either a paracrine or an autocrine circuit. Oncogene 10: 739-749. Ferracini R, Olivero M, Di Renzo MF, Martano M, De Giovanni C, Nanni P et al. (1996). Retrogenic expression of the MET proto-oncogene correlates with the invasive phenotype of human rhabdomyosarcomas. Oncogene 12: 1697-1705. Finkbeiner MR, Astanehe A, To K, Fotovati A, Davies AH, Zhao Y et al. (2009). Profiling YB-1 target genes uncovers a new mechanism for MET receptor regulation in normal and malignant human mammary cells. Oncogene 28: 1421-1431. Fitzgibbons PL, Page DL, Weaver D, Thor AD, Allred DC, Clark GM et al. (2000). Prognostic factors in breast cancer. college of american pathologists consensus statement 1999. Arch Pathol Lab Med 124: 966-978. Follenzi A, Bakovic S, Gual P, Stella MC, Longati P, Comoglio PM. (2000). Cross-talk between the proto-oncogenes met and ron. Oncogene 19: 3041-3049. Foster FM, Owens TW, Tanianis-Hughes J, Clarke RB, Brennan K, Bundred NJ et al. (2009). Targeting inhibitor of apoptosis proteins in combination with ErbB antagonists in breast cancer. Breast Cancer Res 11: R41. Foulkes WD, Stefansson IM, Chappuis PO, Begin LR, Goffin JR, Wong N et al. (2003). Germline BRCA1 mutations and a basal epithelial phenotype in breast cancer. J Natl Cancer Inst 95: 1482-1485. Franke TF, Kaplan DR, Cantley LC, Toker A. (1997). Direct regulation of the akt protooncogene product by phosphatidylinositol-3,4-bisphosphate. Science 275: 665-668. 66  Franke TF, Yang SI, Chan TO, Datta K, Kazlauskas A, Morrison DK et al. (1995). The protein kinase encoded by the akt proto-oncogene is a target of the PDGF-activated phosphatidylinositol 3-kinase. Cell 81: 727-736. Frye BC, Halfter S, Djudjaj S, Muehlenberg P, Weber S, Raffetseder U et al. (2009). Y-box protein-1 is actively secreted through a non-classical pathway and acts as an extracellular mitogen. EMBO Rep 10: 783-789. Fu Z, Aronoff-Spencer E, Wu H, Gerfen GJ, Backer JM. (2004). The iSH2 domain of PI 3kinase is a rigid tether for p110 and not a conformational switch. Arch Biochem Biophys 432: 244-251. Fujita T, Ito K, Izumi H, Kimura M, Sano M, Nakagomi H et al. (2005). Increased nuclear localization of transcription factor Y-box binding protein 1 accompanied by up-regulation of Pglycoprotein in breast cancer pretreated with paclitaxel. Clin Cancer Res 11: 8837-8844. Fukada T, Tonks NK. (2003). Identification of YB-1 as a regulator of PTP1B expression: Implications for regulation of insulin and cytokine signalling. EMBO J 22: 479-493. Fukunaga R, Hunter T. (1997). MNK1, a new MAP kinase-activated protein kinase, isolated by a novel expression screening method for identifying protein kinase substrates. EMBO J 16: 1921-1933. Fuller SJ, Sivarajah K, Sugden PH. (2008). ErbB receptors, their ligands, and the consequences of their activation and inhibition in the myocardium. J Mol Cell Cardiol 44: 831-854. Gambarotta G, Boccaccio C, Giordano S, Ando M, Stella MC, Comoglio PM. (1996). Ets upregulates MET transcription. Oncogene 13: 1911-1917. Gao Y, Fotovati A, Lee C, Wang M, Cote G, Guns E et al. (2009). Inhibition of Y-box binding protein-1 slows the growth of glioblastoma multiforme and sensitizes to temozolomide independent O6-methylguanine-DNA methyltransferase. Mol Cancer Ther 8: 3276-3284. Garcia S, Dales JP, Charafe-Jauffret E, Carpentier-Meunier S, Andrac-Meyer L, Jacquemier J et al. (2007a). Overexpression of c-met and of the transducers PI3K, FAK and JAK in breast carcinomas correlates with shorter survival and neoangiogenesis. Int J Oncol 31: 49-58. Garcia S, Dales JP, Charafe-Jauffret E, Carpentier-Meunier S, Andrac-Meyer L, Jacquemier J et al. (2007b). Poor prognosis in breast carcinomas correlates with increased expression of targetable CD146 and c-met and with proteomic basal-like phenotype. Hum Pathol 38: 830-841. Garcia S, Dales JP, Jacquemier J, Charafe-Jauffret E, Birnbaum D, Andrac-Meyer L et al. (2007c). c-met overexpression in inflammatory breast carcinomas: Automated quantification on tissue microarrays. Br J Cancer 96: 329-335. Garnock-Jones KP, Keating GM, Scott LJ. (2010). Trastuzumab: A review of its use as adjuvant treatment in human epidermal growth factor receptor 2 (HER2)-positive early breast cancer. Drugs 70: 215-239. 67  Garrett TP, McKern NM, Lou M, Elleman TC, Adams TE, Lovrecz GO et al. (2003). The crystal structure of a truncated ErbB2 ectodomain reveals an active conformation, poised to interact with other ErbB receptors. Mol Cell 11: 495-505. Gaudreault I, Guay D, Lebel M. (2004). YB-1 promotes strand separation in vitro of duplex DNA containing either mispaired bases or cisplatin modifications, exhibits endonucleolytic activities and binds several DNA repair proteins. Nucleic Acids Res 32: 316-327. Gennari R, Menard S, Fagnoni F, Ponchio L, Scelsi M, Tagliabue E et al. (2004). Pilot study of the mechanism of action of preoperative trastuzumab in patients with primary operable breast tumours overexpressing HER2. Clin Cancer Res 10: 5650-5655. Gennari A, Sormani MP, Pronzato P, Puntoni M, Colozza M, Pfeffer U et al. (2008). HER2 status and efficacy of adjuvant anthracyclines in early breast cancer: A pooled analysis of randomized trials. J Natl Cancer Inst 100: 14-20. Geyer CE, Forster J, Lindquist D, Chan S, Romieu CG, Pienkowski T et al. (2006). Lapatinib plus capecitabine for HER2-positive advanced breast cancer. N Engl J Med 355: 2733-2743. Gherardi E, Stoker M. (1990). Hepatocytes and scatter factor. Nature 346: 228. Gherardi E, Youles ME, Miguel RN, Blundell TL, Iamele L, Gough J et al. (2003). Functional map and domain structure of MET, the product of the c-met protooncogene and receptor for hepatocyte growth factor/scatter factor. Proc Natl Acad Sci U S A 100: 12039-12044. Ghosh AK, Yuan W, Mori Y, Varga J. (2000). Smad-dependent stimulation of type I collagen gene expression in human skin fibroblasts by TGF-beta involves functional cooperation with p300/CBP transcriptional coactivators. Oncogene 19: 3546-3555. Ghoussoub RA, Dillon DA, D'Aquila T, Rimm EB, Fearon ER, Rimm DL. (1998). Expression of c-met is a strong independent prognostic factor in breast carcinoma. Cancer 82: 1513-1520. Gianni L, Eiermann W, Semiglazov V, Manikhas A, Lluch A, Tjulandin S et al. (2010). Neoadjuvant chemotherapy with trastuzumab followed by adjuvant trastuzumab versus neoadjuvant chemotherapy alone, in patients with HER2-positive locally advanced breast cancer (the NOAH trial): A randomised controlled superiority trial with a parallel HER2-negative cohort. Lancet 375: 377-384. Gimenez-Bonafe P, Fedoruk MN, Whitmore TG, Akbari M, Ralph JL, Ettinger S et al. (2004). YB-1 is upregulated during prostate cancer tumour progression and increases P-glycoprotein activity. Prostate 59: 337-349. Giordano S, Corso S, Conrotto P, Artigiani S, Gilestro G, Barberis D et al. (2002). The semaphorin 4D receptor controls invasive growth by coupling with met. Nat Cell Biol 4: 720724. Gluz O, Mengele K, Schmitt M, Kates R, Diallo-Danebrock R, Neff F et al. (2009). Y-boxbinding protein YB-1 identifies high-risk patients with primary breast cancer benefiting from 68  rapidly cycled tandem high-dose adjuvant chemotherapy. J Clin Oncol 27: 6144-6151. Goldhirsch A, Wood WC, Gelber RD, Coates AS, Thurlimann B, Senn HJ et al. (2007). Progress and promise: Highlights of the international expert consensus on the primary therapy of early breast cancer 2007. Ann Oncol 18: 1133-1144. Goldsmith ME, Madden MJ, Morrow CS, Cowan KH. (1993). A Y-box consensus sequence is required for basal expression of the human multidrug resistance (mdr1) gene. J Biol Chem 268: 5856-5860. Goto S, Yao Z, Proud CG. (2009). The C-terminal domain of Mnk1a plays a dual role in tightly regulating its activity. Biochem J 423: 279-290. Graff JR, Konicek BW, Lynch RL, Dumstorf CA, Dowless MS, McNulty AM et al. (2009). eIF4E activation is commonly elevated in advanced human prostate cancers and significantly related to reduced patient survival. Cancer Res 69: 3866-3873. Graveel CR, DeGroot JD, Su Y, Koeman J, Dykema K, Leung S et al. (2009). Met induces diverse mammary carcinomas in mice and is associated with human basal breast cancer. Proc Natl Acad Sci U S A 106: 12909-12914. Greenberg PA, Hortobagyi GN, Smith TL, Ziegler LD, Frye DK, Buzdar AU. (1996). Long-term follow-up of patients with complete remission following combination chemotherapy for metastatic breast cancer. J Clin Oncol 14: 2197-2205. Grinkevich VV, Nikulenkov F, Shi Y, Enge M, Bao W, Maljukova A et al. (2009). Ablation of key oncogenic pathways by RITA-reactivated p53 is required for efficient apoptosis. Cancer Cell 15: 441-453. Gu C, Oyama T, Osaki T, Kohno K, Yasumoto K. (2001). Expression of Y box-binding protein1 correlates with DNA topoisomerase IIalpha and proliferating cell nuclear antigen expression in lung cancer. Anticancer Res 21: 2357-2362. Gu H, Neel BG. (2003). The "gab" in signal transduction. Trends Cell Biol 13: 122-130. Guay D, Evoy AA, Paquet E, Garand C, Bachvarova M, Bachvarov D et al. (2008). The strand separation and nuclease activities associated with YB-1 are dispensable for cisplatin resistance but overexpression of YB-1 in MCF7 and MDA-MB-231 breast tumour cells generates several chemoresistance signatures. Int J Biochem Cell Biol 40: 2492-2507. Guay D, Gaudreault I, Massip L, Lebel M. (2006). Formation of a nuclear complex containing the p53 tumour suppressor, YB-1, and the werner syndrome gene product in cells treated with UV light. Int J Biochem Cell Biol 38: 1300-1313. Guil S, Long JC, Caceres JF. (2006). hnRNP A1 relocalization to the stress granules reflects a role in the stress response. Mol Cell Biol 26: 5744-5758. Guillermet-Guibert J, Bjorklof K, Salpekar A, Gonella C, Ramadani F, Bilancio A et al. (2008). The p110beta isoform of phosphoinositide 3-kinase signals downstream of G protein-coupled 69  receptors and is functionally redundant with p110gamma. Proc Natl Acad Sci U S A 105: 82928297. Guo A, Villen J, Kornhauser J, Lee KA, Stokes MP, Rikova K et al. (2008). Signalling networks assembled by oncogenic EGFR and c-met. Proc Natl Acad Sci U S A 105: 692-697. Gupta S, Ramjaun AR, Haiko P, Wang Y, Warne PH, Nicke B et al. (2007). Binding of ras to phosphoinositide 3-kinase p110alpha is required for ras-driven tumourigenesis in mice. Cell 129: 957-968. Guy CT, Cardiff RD, Muller WJ. (1996). Activated neu induces rapid tumour progression. J Biol Chem 271: 7673-7678. Guy CT, Webster MA, Schaller M, Parsons TJ, Cardiff RD, Muller WJ. (1992). Expression of the neu protooncogene in the mammary epithelium of transgenic mice induces metastatic disease. Proc Natl Acad Sci U S A 89: 10578-10582. Guy PM, Platko JV, Cantley LC, Cerione RA, Carraway KL,3rd. (1994). Insect cell-expressed p180erbB3 possesses an impaired tyrosine kinase activity. Proc Natl Acad Sci U S A 91: 81328136. Habibi G, Leung S, Law JH, Gelmon K, Masoudi H, Turbin D et al. (2008). Re-defining prognostic factors for breast cancer: YB-1 is a stronger predictor of relapse and disease specific survival than estrogen receptor or HER2 across all tumour subtypes. Breast Cancer Res 10: R86. Hanahan D, Weinberg RA. (2000). The hallmarks of cancer. Cell 100: 57-70. Hannemann J, Oosterkamp HM, Bosch CA, Velds A, Wessels LF, Loo C et al. (2005). Changes in gene expression associated with response to neoadjuvant chemotherapy in breast cancer. J Clin Oncol 23: 3331-3342. Harris LN, You F, Schnitt SJ, Witkiewicz A, Lu X, Sgroi D et al. (2007). Predictors of resistance to preoperative trastuzumab and vinorelbine for HER2-positive early breast cancer. Clin Cancer Res 13: 1198-1207. Harwerth IM, Wels W, Schlegel J, Muller M, Hynes NE. (1993). Monoclonal antibodies directed to the erbB-2 receptor inhibit in vivo tumour cell growth. Br J Cancer 68: 1140-1145. Hasegawa SL, Doetsch PW, Hamilton KK, Martin AM, Okenquist SA, Lenz J et al. (1991). DNA binding properties of YB-1 and dbpA: Binding to double-stranded, single-stranded, and abasic site containing DNAs. Nucleic Acids Res 19: 4915-4920. Haslekas C, Breen K, Pedersen KW, Johannessen LE, Stang E, Madshus IH. (2005). The inhibitory effect of ErbB2 on epidermal growth factor-induced formation of clathrin-coated pits correlates with retention of epidermal growth factor receptor-ErbB2 oligomeric complexes at the plasma membrane. Mol Biol Cell 16: 5832-5842. Hayakawa H, Uchiumi T, Fukuda T, Ashizuka M, Kohno K, Kuwano M et al. (2002). Binding capacity of human YB-1 protein for RNA containing 8-oxoguanine. Biochemistry 41: 1273970  12744. Hefner Y, Borsch-Haubold AG, Murakami M, Wilde JI, Pasquet S, Schieltz D et al. (2000). Serine 727 phosphorylation and activation of cytosolic phospholipase A2 by MNK1-related protein kinases. J Biol Chem 275: 37542-37551. Henderson LJ, Coe BP, Lee EH, Girard L, Gazdar AF, Minna JD et al. (2005). Genomic and gene expression profiling of minute alterations of chromosome arm 1p in small-cell lung carcinoma cells. Br J Cancer 92: 1553-1560. Henson ES, Hu X, Gibson SB. (2006). Herceptin sensitizes ErbB2-overexpressing cells to apoptosis by reducing antiapoptotic mcl-1 expression. Clin Cancer Res 12: 845-853. Higashi K, Inagaki Y, Suzuki N, Mitsui S, Mauviel A, Kaneko H et al. (2003a). Y-box-binding protein YB-1 mediates transcriptional repression of human alpha 2(I) collagen gene expression by interferon-gamma. J Biol Chem 278: 5156-5162. Higashi K, Inagaki Y, Fujimori K, Nakao A, Kaneko H, Nakatsuka I. (2003b). Interferon-gamma interferes with transforming growth factor-beta signalling through direct interaction of YB-1 with Smad3. J Biol Chem 278: 43470-43479. Hill KM, Kalifa S, Das JR, Bhatti T, Gay M, Williams D et al. (2010). The role of PI 3-kinase p110beta in AKT signally, cell survival, and proliferation in human prostate cancer cells. Prostate 70: 755-764. Hipfel R, Schittek B, Bodingbauer Y, Garbe C. (2000). Specifically regulated genes in malignant melanoma tissues identified by subtractive hybridization. Br J Cancer 82: 1149-1157. Hirota Y, Daikoku T, Tranguch S, Xie H, Bradshaw HB, Dey SK. (2010). Uterine-specific p53 deficiency confers premature uterine senescence and promotes preterm birth in mice. J Clin Invest 120: 803-815. Hirsch E, Wymann MP, Patrucco E, Tolosano E, Bulgarelli-Leva G, Marengo S et al. (2000). Analysis of the murine phosphoinositide 3-kinase gamma gene. Gene 256: 69-81. Hirsch HA, Iliopoulos D, Tsichlis PN, Struhl K. (2009). Metformin selectively targets cancer stem cells, and acts together with chemotherapy to block tumour growth and prolong remission. Cancer Res 69: 7507-7511. Hommelgaard AM, Lerdrup M, van Deurs B. (2004). Association with membrane protrusions makes ErbB2 an internalization-resistant receptor. Mol Biol Cell 15: 1557-1567. Horn S, Bergholz U, Jucker M, McCubrey JA, Trumper L, Stocking C et al. (2008). Mutations in the catalytic subunit of class IA PI3K confer leukemogenic potential to hematopoietic cells. Oncogene 27: 4096-4106. Houldsworth J, Cordon-Cardo C, Ladanyi M, Kelsen DP, Chaganti RS. (1990). Gene amplification in gastric and esophageal adenocarcinomas. Cancer Res 50: 6417-6422. 71  Huang J, Tan PH, Li KB, Matsumoto K, Tsujimoto M, Bay BH. (2005). Y-box binding protein, YB-1, as a marker of tumour aggressiveness and response to adjuvant chemotherapy in breast cancer. Int J Oncol 26: 607-613. Huang X, Gao L, Wang S, McManaman JL, Thor AD, Yang X et al. (2010). Heterotrimerization of the growth factor receptors erbB2, erbB3, and insulin-like growth factor-i receptor in breast cancer cells resistant to herceptin. Cancer Res 70: 1204-1214. Hudziak RM, Lewis GD, Winget M, Fendly BM, Shepard HM, Ullrich A. (1989). p185HER2 monoclonal antibody has antiproliferative effects in vitro and sensitizes human breast tumour cells to tumour necrosis factor. Mol Cell Biol 9: 1165-1172. Hudziak RM, Schlessinger J, Ullrich A. (1987). Increased expression of the putative growth factor receptor p185HER2 causes transformation and tumourigenesis of NIH 3T3 cells. Proc Natl Acad Sci U S A 84: 7159-7163. Huh CG, Factor VM, Sanchez A, Uchida K, Conner EA, Thorgeirsson SS. (2004). Hepatocyte growth factor/c-met signalling pathway is required for efficient liver regeneration and repair. Proc Natl Acad Sci U S A 101: 4477-4482. Hui RC, Gomes AR, Constantinidou D, Costa JR, Karadedou CT, Fernandez de Mattos S et al. (2008). The forkhead transcription factor FOXO3a increases phosphoinositide-3 kinase/Akt activity in drug-resistant leukemic cells through induction of PIK3CA expression. Mol Cell Biol 28: 5886-5898. Hung W, Elliott B. (2001). Co-operative effect of c-src tyrosine kinase and Stat3 in activation of hepatocyte growth factor expression in mammary carcinoma cells. J Biol Chem 276: 1239512403. Ichimura E, Maeshima A, Nakajima T, Nakamura T. (1996). Expression of c-met/HGF receptor in human non-small cell lung carcinomas in vitro and in vivo and its prognostic significance. Jpn J Cancer Res 87: 1063-1069. Isakoff SJ, Engelman JA, Irie HY, Luo J, Brachmann SM, Pearline RV et al. (2005). Breast cancer-associated PIK3CA mutations are oncogenic in mammary epithelial cells. Cancer Res 65: 10992-11000. Ise T, Nagatani G, Imamura T, Kato K, Takano H, Nomoto M et al. (1999). Transcription factor Y-box binding protein 1 binds preferentially to cisplatin-modified DNA and interacts with proliferating cell nuclear antigen. Cancer Res 59: 342-346. Ishibe S, Karihaloo A, Ma H, Zhang J, Marlier A, Mitobe M et al. (2009). Met and the epidermal growth factor receptor act cooperatively to regulate final nephron number and maintain collecting duct morphology. Development 136: 337-345. Isola JJ, Holli K, Oksa H, Teramoto Y, Kallioniemi OP. (1994). Elevated erbB-2 oncoprotein levels in preoperative and follow-up serum samples define an aggressive disease course in patients with breast cancer. Cancer 73: 652-658. 72  Ivan M, Bond JA, Prat M, Comoglio PM, Wynford-Thomas D. (1997). Activated ras and ret oncogenes induce over-expression of c-met (hepatocyte growth factor receptor) in human thyroid epithelial cells. Oncogene 14: 2417-2423. Iwao-Koizumi K, Matoba R, Ueno N, Kim SJ, Ando A, Miyoshi Y et al. (2005). Prediction of docetaxel response in human breast cancer by gene expression profiling. J Clin Oncol 23: 422431. Iwata H. (2009). Neo(adjuvant) trastuzumab treatment: Current perspectives. Breast Cancer 16: 288-294. Izumi H, Imamura T, Nagatani G, Ise T, Murakami T, Uramoto H et al. (2001). Y box-binding protein-1 binds preferentially to single-stranded nucleic acids and exhibits 3'-->5' exonuclease activity. Nucleic Acids Res 29: 1200-1207. Izumi Y, Xu L, di Tomaso E, Fukumura D, Jain RK. (2002). Tumour biology: Herceptin acts as an anti-angiogenic cocktail. Nature 416: 279-280. Jackson-Fisher AJ, Bellinger G, Ramabhadran R, Morris JK, Lee KF, Stern DF. (2004). ErbB2 is required for ductal morphogenesis of the mammary gland. Proc Natl Acad Sci U S A 101: 17138-17143. Jagadeeswaran R, Ma PC, Seiwert TY, Jagadeeswaran S, Zumba O, Nallasura V et al. (2006). Functional analysis of c-Met/hepatocyte growth factor pathway in malignant pleural mesothelioma. Cancer Res 66: 352-361. Jansen MP, Foekens JA, van Staveren IL, Dirkzwager-Kiel MM, Ritstier K, Look MP et al. (2005). Molecular classification of tamoxifen-resistant breast carcinomas by gene expression profiling. J Clin Oncol 23: 732-740. Janz M, Harbeck N, Dettmar P, Berger U, Schmidt A, Jurchott K et al. (2002). Y-box factor YB1 predicts drug resistance and patient outcome in breast cancer independent of clinically relevant tumour biologic factors HER2, uPA and PAI-1. Int J Cancer 97: 278-282. Jauch R, Cho MK, Jakel S, Netter C, Schreiter K, Aicher B et al. (2006). Mitogen-activated protein kinases interacting kinases are autoinhibited by a reprogrammed activation segment. EMBO J 25: 4020-4032. Jauch R, Jakel S, Netter C, Schreiter K, Aicher B, Jackle H et al. (2005). Crystal structures of the Mnk2 kinase domain reveal an inhibitory conformation and a zinc binding site. Structure 13: 1559-1568. Jeffers M, Fiscella M, Webb CP, Anver M, Koochekpour S, Vande Woude GF. (1998). The mutationally activated met receptor mediates motility and metastasis. Proc Natl Acad Sci U S A 95: 14417-14422. Jeffers M, Taylor GA, Weidner KM, Omura S, Vande Woude GF. (1997). Degradation of the met tyrosine kinase receptor by the ubiquitin-proteasome pathway. Mol Cell Biol 17: 799-808. 73  Jerome L, Alami N, Belanger S, Page V, Yu Q, Paterson J et al. (2006). Recombinant human insulin-like growth factor binding protein 3 inhibits growth of human epidermal growth factor receptor-2-overexpressing breast tumours and potentiates herceptin activity in vivo. Cancer Res 66: 7245-7252. Jia S, Liu Z, Zhang S, Liu P, Zhang L, Lee SH et al. (2008). Essential roles of PI(3)K-p110beta in cell growth, metabolism and tumourigenesis. Nature 454: 776-779. Jiang X, Chen S, Asara JM, Balk SP. (2010). Phosphoinositide 3-kinase pathway activation in phosphate and tensin homolog (PTEN)-deficient prostate cancer cells is independent of receptor tyrosine kinases and mediated by the p110beta and p110delta catalytic subunits. J Biol Chem 285: 14980-14989. Jo M, Stolz DB, Esplen JE, Dorko K, Michalopoulos GK, Strom SC. (2000). Cross-talk between epidermal growth factor receptor and c-met signal pathways in transformed cells. J Biol Chem 275: 8806-8811. Joel PB, Smith J, Sturgill TW, Fisher TL, Blenis J, Lannigan DA. (1998). pp90rsk1 regulates estrogen receptor-mediated transcription through phosphorylation of ser-167. Mol Cell Biol 18: 1978-1984. Joensuu H, Kellokumpu-Lehtinen PL, Bono P, Alanko T, Kataja V, Asola R et al. (2006). Adjuvant docetaxel or vinorelbine with or without trastuzumab for breast cancer. N Engl J Med 354: 809-820. Jorgensen JT. (2010). Targeted HER2 treatment in advanced gastric cancer. Oncology 78: 26-33. Jou ST, Carpino N, Takahashi Y, Piekorz R, Chao JR, Carpino N et al. (2002). Essential, nonredundant role for the phosphoinositide 3-kinase p110delta in signalling by the B-cell receptor complex. Mol Cell Biol 22: 8580-8591. Junttila TT, Akita RW, Parsons K, Fields C, Lewis Phillips GD, Friedman LS et al. (2009). Ligand-independent HER2/HER3/PI3K complex is disrupted by trastuzumab and is effectively inhibited by the PI3K inhibitor GDC-0941. Cancer Cell 15: 429-440. Jurchott K, Bergmann S, Stein U, Walther W, Janz M, Manni I et al. (2003). YB-1 as a cell cycle-regulated transcription factor facilitating cyclin A and cyclin B1 gene expression. J Biol Chem 278: 27988-27996. Kamura T, Yahata H, Amada S, Ogawa S, Sonoda T, Kobayashi H et al. (1999). Is nuclear expression of Y box-binding protein-1 a new prognostic factor in ovarian serous adenocarcinoma? Cancer 85: 2450-2454. Kang S, Bader AG, Zhao L, Vogt PK. (2005). Mutated PI 3-kinases: Cancer targets on a silver platter. Cell Cycle 4: 578-581. Karunagaran D, Tzahar E, Beerli RR, Chen X, Graus-Porta D, Ratzkin BJ et al. (1996). ErbB-2 is a common auxiliary subunit of NDF and EGF receptors: Implications for breast cancer. EMBO 74  J 15: 254-264. Kashihara M, Azuma K, Kawahara A, Basaki Y, Hattori S, Yanagawa T et al. (2009). Nuclear Y-box binding protein-1, a predictive marker of prognosis, is correlated with expression of HER2/ErbB2 and HER3/ErbB3 in non-small cell lung cancer. J Thorac Oncol 4: 1066-1074. Katsumata M, Okudaira T, Samanta A, Clark DP, Drebin JA, Jolicoeur P et al. (1995). Prevention of breast tumour development in vivo by downregulation of the p185neu receptor. Nat Med 1: 644-648. Kawakami Y, Nishimoto H, Kitaura J, Maeda-Yamamoto M, Kato RM, Littman DR et al. (2004). Protein kinase C betaII regulates akt phosphorylation on ser-473 in a cell type- and stimulus-specific fashion. J Biol Chem 279: 47720-47725. Khandelwal P, Padala MK, Cox J, Guntaka RV. (2009). The N-terminal domain of y-box binding protein-1 induces cell cycle arrest in g2/m phase by binding to cyclin d1. Int J Cell Biol 2009: 243532. King CR, Kraus MH, Aaronson SA. (1985). Amplification of a novel v-erbB-related gene in a human mammary carcinoma. Science 229: 974-976. Klippel A, Kavanaugh WM, Pot D, Williams LT. (1997). A specific product of phosphatidylinositol 3-kinase directly activates the protein kinase akt through its pleckstrin homology domain. Mol Cell Biol 17: 338-344. Klippel A, Reinhard C, Kavanaugh WM, Apell G, Escobedo MA, Williams LT. (1996). Membrane localization of phosphatidylinositol 3-kinase is sufficient to activate multiple signaltransducing kinase pathways. Mol Cell Biol 16: 4117-4127. Kloks CP, Spronk CA, Lasonder E, Hoffmann A, Vuister GW, Grzesiek S et al. (2002). The solution structure and DNA-binding properties of the cold-shock domain of the human Y-box protein YB-1. J Mol Biol 316: 317-326. Kloks CP, Tessari M, Vuister GW, Hilbers CW. (2004). Cold shock domain of the human Y-box protein YB-1. backbone dynamics and equilibrium between the native state and a partially unfolded state. Biochemistry 43: 10237-10246. Klos KS, Zhou X, Lee S, Zhang L, Yang W, Nagata Y et al. (2003). Combined trastuzumab and paclitaxel treatment better inhibits ErbB-2-mediated angiogenesis in breast carcinoma through a more effective inhibition of akt than either treatment alone. Cancer 98: 1377-1385. Knobbe CB, Reifenberger G. (2003). Genetic alterations and aberrant expression of genes related to the phosphatidyl-inositol-3'-kinase/protein kinase B (akt) signal transduction pathway in glioblastomas. Brain Pathol 13: 507-518. Kohno K, Izumi H, Uchiumi T, Ashizuka M, Kuwano M. (2003). The pleiotropic functions of the Y-box-binding protein, YB-1. Bioessays 25: 691-698.  75  Koike K, Uchiumi T, Ohga T, Toh S, Wada M, Kohno K et al. (1997). Nuclear translocation of the Y-box binding protein by ultraviolet irradiation. FEBS Lett 417: 390-394. Kong-Beltran M, Seshagiri S, Zha J, Zhu W, Bhawe K, Mendoza N et al. (2006). Somatic mutations lead to an oncogenic deletion of met in lung cancer. Cancer Res 66: 283-289. Koochekpour S, Jeffers M, Rulong S, Taylor G, Klineberg E, Hudson EA et al. (1997). Met and hepatocyte growth factor/scatter factor expression in human gliomas. Cancer Res 57: 53915398. Krainer M, Brodowicz T, Zeillinger R, Wiltschke C, Scholten C, Seifert M et al. (1997). Tissue expression and serum levels of HER2/neu in patients with breast cancer. Oncology 54: 475-481. Kraus MH, Issing W, Miki T, Popescu NC, Aaronson SA. (1989). Isolation and characterization of ERBB3, a third member of the ERBB/epidermal growth factor receptor family: Evidence for overexpression in a subset of human mammary tumours. Proc Natl Acad Sci U S A 86: 91939197. Kreike B, van Kouwenhove M, Horlings H, Weigelt B, Peterse H, Bartelink H et al. (2007). Gene expression profiling and histopathological characterization of triple-negative/basal-like breast carcinomas. Breast Cancer Res 9: R65. Krop IE, Beeram M, Modi S, Jones SF, Holden SN, Yu W et al. (2010). Phase I study of trastuzumab-DM1, an HER2 antibody-drug conjugate, given every 3 weeks to patients with HER2-positive metastatic breast cancer. J Clin Oncol 28: 2698-2704. Kwong KY, Hung MC. (1998). A novel splice variant of HER2 with increased transformation activity. Mol Carcinog 23: 62-68. Lam K, Carpenter CL, Ruderman NB, Friel JC, Kelly KL. (1994). The phosphatidylinositol 3kinase serine kinase phosphorylates IRS-1. stimulation by insulin and inhibition by wortmannin. J Biol Chem 269: 20648-20652. Lamorte L, Kamikura DM, Park M. (2000). A switch from p130Cas/Crk to Gab1/Crk signalling correlates with anchorage independent growth and JNK activation in cells transformed by the met receptor oncoprotein. Oncogene 19: 5973-5981. Lane HA, Beuvink I, Motoyama AB, Daly JM, Neve RM, Hynes NE. (2000). ErbB2 potentiates breast tumour proliferation through modulation of p27(Kip1)-Cdk2 complex formation: Receptor overexpression does not determine growth dependency. Mol Cell Biol 20: 3210-3223. Lane HA, Motoyama AB, Beuvink I, Hynes NE. (2001). Modulation of p27/Cdk2 complex formation through 4D5-mediated inhibition of HER2 receptor signalling. Ann Oncol 12 Suppl 1: S21-2. Lasham A, Lindridge E, Rudert F, Onrust R, Watson J. (2000). Regulation of the human fas promoter by YB-1, puralpha and AP-1 transcription factors. Gene 252: 1-13.  76  Lasham A, Moloney S, Hale T, Homer C, Zhang YF, Murison JG et al. (2003). The Y-boxbinding protein, YB1, is a potential negative regulator of the p53 tumour suppressor. J Biol Chem 278: 35516-35523. Lazaridis G, Pentheroudakis G, Pavlidis N. (2008). Integrating trastuzumab in the neoadjuvant treatment of primary breast cancer: Accumulating evidence of efficacy, synergy and safety. Crit Rev Oncol Hematol 66: 31-41. Lazaris-Karatzas A, Montine KS, Sonenberg N. (1990). Malignant transformation by a eukaryotic initiation factor subunit that binds to mRNA 5' cap. Nature 345: 544-547. Le XF, Claret FX, Lammayot A, Tian L, Deshpande D, LaPushin R et al. (2003). The role of cyclin-dependent kinase inhibitor p27Kip1 in anti-HER2 antibody-induced G1 cell cycle arrest and tumour growth inhibition. J Biol Chem 278: 23441-23450. Lee C, Dhillon J, Wang MY, Gao Y, Hu K, Park E et al. (2008). Targeting YB-1 in HER2 overexpressing breast cancer cells induces apoptosis via the mTOR/STAT3 pathway and suppresses tumour growth in mice. Cancer Res 68: 8661-8666. Lee JH, Han SU, Cho H, Jennings B, Gerrard B, Dean M et al. (2000). A novel germ line juxtamembrane met mutation in human gastric cancer. Oncogene 19: 4947-4953. Lee KF, Simon H, Chen H, Bates B, Hung MC, Hauser C. (1995). Requirement for neuregulin receptor erbB2 in neural and cardiac development. Nature 378: 394-398. Lemoine NR, Staddon S, Dickson C, Barnes DM, Gullick WJ. (1990). Absence of activating transmembrane mutations in the c-erbB-2 proto-oncogene in human breast cancer. Oncogene 5: 237-239. Lenferink AE, Pinkas-Kramarski R, van de Poll ML, van Vugt MJ, Klapper LN, Tzahar E et al. (1998). Differential endocytic routing of homo- and hetero-dimeric ErbB tyrosine kinases confers signalling superiority to receptor heterodimers. EMBO J 17: 3385-3397. Lengyel E, Prechtel D, Resau JH, Gauger K, Welk A, Lindemann K et al. (2005). C-met overexpression in node-positive breast cancer identifies patients with poor clinical outcome independent of Her2/neu. Int J Cancer 113: 678-682. Levine DA, Bogomolniy F, Yee CJ, Lash A, Barakat RR, Borgen PI et al. (2005). Frequent mutation of the PIK3CA gene in ovarian and breast cancers. Clin Cancer Res 11: 2875-2878. Lewis Phillips GD, Li G, Dugger DL, Crocker LM, Parsons KL, Mai E et al. (2008). Targeting HER2-positive breast cancer with trastuzumab-DM1, an antibody-cytotoxic drug conjugate. Cancer Res 68: 9280-9290. Lewis GD, Figari I, Fendly B, Wong WL, Carter P, Gorman C et al. (1993). Differential responses of human tumour cell lines to anti-p185HER2 monoclonal antibodies. Cancer Immunol Immunother 37: 255-263.  77  Liang S, Yang N, Pan Y, Deng S, Lin X, Yang X et al. (2009). Expression of activated PIK3CA in ovarian surface epithelium results in hyperplasia but not tumour formation. PLoS One 4: e4295. Liang TJ, Reid AE, Xavier R, Cardiff RD, Wang TC. (1996). Transgenic expression of tpr-met oncogene leads to development of mammary hyperplasia and tumours. J Clin Invest 97: 28722877. Liu SV, Melstrom L, Yao K, Russell CA, Sener SF. (2010). Neoadjuvant therapy for breast cancer. J Surg Oncol 101: 283-291. Liu Y, Chattopadhyay N, Qin S, Szekeres C, Vasylyeva T, Mahoney ZX et al. (2009). Coordinate integrin and c-met signalling regulate wnt gene expression during epithelial morphogenesis. Development 136: 843-853. Liu Z, Hou P, Ji M, Guan H, Studeman K, Jensen K et al. (2008). Highly prevalent genetic alterations in receptor tyrosine kinases and phosphatidylinositol 3-kinase/akt and mitogenactivated protein kinase pathways in anaplastic and follicular thyroid cancers. J Clin Endocrinol Metab 93: 3106-3116. Lock LS, Royal I, Naujokas MA, Park M. (2000). Identification of an atypical Grb2 carboxylterminal SH3 domain binding site in gab docking proteins reveals Grb2-dependent and independent recruitment of Gab1 to receptor tyrosine kinases. J Biol Chem 275: 31536-31545. Loi S, Haibe-Kains B, Desmedt C, Lallemand F, Tutt AM, Gillet C et al. (2007). Definition of clinically distinct molecular subtypes in estrogen receptor-positive breast carcinomas through genomic grade. J Clin Oncol 25: 1239-1246. Longati P, Bardelli A, Ponzetto C, Naldini L, Comoglio PM. (1994). Tyrosines1234-1235 are critical for activation of the tyrosine kinase encoded by the MET proto-oncogene (HGF receptor). Oncogene 9: 49-57. Lu Y, Yu Q, Liu JH, Zhang J, Wang H, Koul D et al. (2003). Src family protein-tyrosine kinases alter the function of PTEN to regulate phosphatidylinositol 3-kinase/AKT cascades. J Biol Chem 278: 40057-40066. Lu Y, Zi X, Pollak M. (2004). Molecular mechanisms underlying IGF-I-induced attenuation of the growth-inhibitory activity of trastuzumab (herceptin) on SKBR3 breast cancer cells. Int J Cancer 108: 334-341. Lu Y, Zi X, Zhao Y, Mascarenhas D, Pollak M. (2001). Insulin-like growth factor-I receptor signalling and resistance to trastuzumab (herceptin). J Natl Cancer Inst 93: 1852-1857. Lu ZH, Books JT, Ley TJ. (2005). YB-1 is important for late-stage embryonic development, optimal cellular stress responses, and the prevention of premature senescence. Mol Cell Biol 25: 4625-4637. Ludovini V, Gori S, Colozza M, Pistola L, Rulli E, Floriani I et al. (2008). Evaluation of serum HER2 extracellular domain in early breast cancer patients: Correlation with clinicopathological 78  parameters and survival. Ann Oncol 19: 883-890. Luo J, Manning BD, Cantley LC. (2003). Targeting the PI3K-akt pathway in human cancer: Rationale and promise. Cancer Cell 4: 257-262. Lynch DK, Ellis CA, Edwards PA, Hiles ID. (1999). Integrin-linked kinase regulates phosphorylation of serine 473 of protein kinase B by an indirect mechanism. Oncogene 18: 8024-8032. Ma PC, Jagadeeswaran R, Jagadeesh S, Tretiakova MS, Nallasura V, Fox EA et al. (2005). Functional expression and mutations of c-met and its therapeutic inhibition with SU11274 and small interfering RNA in non-small cell lung cancer. Cancer Res 65: 1479-1488. Ma PC, Kijima T, Maulik G, Fox EA, Sattler M, Griffin JD et al. (2003). c-MET mutational analysis in small cell lung cancer: Novel juxtamembrane domain mutations regulating cytoskeletal functions. Cancer Res 63: 6272-6281. Ma YY, Wei SJ, Lin YC, Lung JC, Chang TC, Whang-Peng J et al. (2000). PIK3CA as an oncogene in cervical cancer. Oncogene 19: 2739-2744. Mahalingam M, Cooper JA. (2001). Phosphorylation of mammalian eIF4E by Mnk1 and Mnk2: Tantalizing prospects for a role in translation. Prog Mol Subcell Biol 27: 132-142. Maroun CR, Holgado-Madruga M, Royal I, Naujokas MA, Fournier TM, Wong AJ et al. (1999). The Gab1 PH domain is required for localization of Gab1 at sites of cell-cell contact and epithelial morphogenesis downstream from the met receptor tyrosine kinase. Mol Cell Biol 19: 1784-1799. Martin AP, Miller A, Emad L, Rahmani M, Walker T, Mitchell C et al. (2008). Lapatinib resistance in HCT116 cells is mediated by elevated MCL-1 expression and decreased BAK activation and not by ERBB receptor kinase mutation. Mol Pharmacol 74: 807-822. Martin GS. (2004). The road to src. Oncogene 23: 7910-7917. Marty M, Cognetti F, Maraninchi D, Snyder R, Mauriac L, Tubiana-Hulin M et al. (2005). Randomized phase II trial of the efficacy and safety of trastuzumab combined with docetaxel in patients with human epidermal growth factor receptor 2-positive metastatic breast cancer administered as first-line treatment: The M77001 study group. J Clin Oncol 23: 4265-4274. Massague J, Pandiella A. (1993). Membrane-anchored growth factors. Annu Rev Biochem 62: 515-541. Massion PP, Kuo WL, Stokoe D, Olshen AB, Treseler PA, Chin K et al. (2002). Genomic copy number analysis of non-small cell lung cancer using array comparative genomic hybridization: Implications of the phosphatidylinositol 3-kinase pathway. Cancer Res 62: 3636-3640. Mayfield S, Vaughn JP, Kute TE. (2001). DNA strand breaks and cell cycle perturbation in herceptin treated breast cancer cell lines. Breast Cancer Res Treat 70: 123-129. 79  McGowan TS, Cummings BJ, O'Sullivan B, Catton CN, Miller N, Panzarella T. (2000). An analysis of 78 breast sarcoma patients without distant metastases at presentation. Int J Radiat Oncol Biol Phys 46: 383-390. Mehta RR, McDermott JH, Hieken TJ, Marler KC, Patel MK, Wild LD et al. (1998). Plasma cerbB-2 levels in breast cancer patients: Prognostic significance in predicting response to chemotherapy. J Clin Oncol 16: 2409-2416. Merdek KD, Yang X, Taglienti CA, Shaw LM, Mercurio AM. (2007). Intrinsic signalling functions of the beta4 integrin intracellular domain. J Biol Chem 282: 30322-30330. Mertens PR, Harendza S, Pollock AS, Lovett DH. (1997). Glomerular mesangial cell-specific transactivation of matrix metalloproteinase 2 transcription is mediated by YB-1. J Biol Chem 272: 22905-22912. Miled N, Yan Y, Hon WC, Perisic O, Zvelebil M, Inbar Y et al. (2007). Mechanism of two classes of cancer mutations in the phosphoinositide 3-kinase catalytic subunit. Science 317: 239242. Miller CT, Moy JR, Lin L, Schipper M, Normolle D, Brenner DE et al. (2003). Gene amplification in esophageal adenocarcinomas and barrett's with high-grade dysplasia. Clin Cancer Res 9: 4819-4825. Millikan RC, Newman B, Tse CK, Moorman PG, Conway K, Dressler LG et al. (2008). Epidemiology of basal-like breast cancer. Breast Cancer Res Treat 109: 123-139. Minich WB, Balasta ML, Goss DJ, Rhoads RE. (1994). Chromatographic resolution of in vivo phosphorylated and nonphosphorylated eukaryotic translation initiation factor eIF-4E: Increased cap affinity of the phosphorylated form. Proc Natl Acad Sci U S A 91: 7668-7672. Miyazawa K, Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N et al. (1989). Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. Biochem Biophys Res Commun 163: 967-973. Modi S, Stopeck AT, Gordon MS, Mendelson D, Solit DB, Bagatell R et al. (2007a). Combination of trastuzumab and tanespimycin (17-AAG, KOS-953) is safe and active in trastuzumab-refractory HER2 overexpressing breast cancer: A phase I dose-escalation study. J Clin Oncol 25: 5410-5417. Mohsin SK, Weiss HL, Gutierrez MC, Chamness GC, Schiff R, Digiovanna MP et al. (2005). Neoadjuvant trastuzumab induces apoptosis in primary breast cancers. J Clin Oncol 23: 24602468. Molina MA, Codony-Servat J, Albanell J, Rojo F, Arribas J, Baselga J. (2001). Trastuzumab (herceptin), a humanized anti-Her2 receptor monoclonal antibody, inhibits basal and activated Her2 ectodomain cleavage in breast cancer cells. Cancer Res 61: 4744-4749. Molina MA, Saez R, Ramsey EE, Garcia-Barchino MJ, Rojo F, Evans AJ et al. (2002). NH(2)terminal truncated HER2 protein but not full-length receptor is associated with nodal metastasis 80  in human breast cancer. Clin Cancer Res 8: 347-353. Molina R, Jo J, Filella X, Zanon G, Farrus B, Munoz M et al. (1999). C-erbB-2, CEA and CA 15.3 serum levels in the early diagnosis of recurrence of breast cancer patients. Anticancer Res 19: 2551-2555. Mondino A, Giordano S, Comoglio PM. (1991). Defective posttranslational processing activates the tyrosine kinase encoded by the MET proto-oncogene (hepatocyte growth factor receptor). Mol Cell Biol 11: 6084-6092. Mori S, Mori Y, Mukaiyama T, Yamada Y, Sonobe Y, Matsushita H et al. (1990). In vitro and in vivo release of soluble erbB-2 protein from human carcinoma cells. Jpn J Cancer Res 81: 489494. Morozov VM, Massoll NA, Vladimirova OV, Maul GG, Ishov AM. (2008). Regulation of c-met expression by transcription repressor daxx. Oncogene 27: 2177-2186. Morris GJ, Naidu S, Topham AK, Guiles F, Xu Y, McCue P et al. (2007). Differences in breast carcinoma characteristics in newly diagnosed african-american and caucasian patients: A singleinstitution compilation compared with the national cancer institute's surveillance, epidemiology, and end results database. Cancer 110: 876-884. Morris JK, Lin W, Hauser C, Marchuk Y, Getman D, Lee KF. (1999). Rescue of the cardiac defect in ErbB2 mutant mice reveals essential roles of ErbB2 in peripheral nervous system development. Neuron 23: 273-283. Muller WJ, Sinn E, Pattengale PK, Wallace R, Leder P. (1988). Single-step induction of mammary adenocarcinoma in transgenic mice bearing the activated c-neu oncogene. Cell 54: 105-115. Munster PN, Marchion DC, Basso AD, Rosen N. (2002). Degradation of HER2 by ansamycins induces growth arrest and apoptosis in cells with HER2 overexpression via a HER3, phosphatidylinositol 3'-kinase-AKT-dependent pathway. Cancer Res 62: 3132-3137. Musacchio A, Cantley LC, Harrison SC. (1996). Crystal structure of the breakpoint cluster region-homology domain from phosphoinositide 3-kinase p85 alpha subunit. Proc Natl Acad Sci U S A 93: 14373-14378. Nagata Y, Lan KH, Zhou X, Tan M, Esteva FJ, Sahin AA et al. (2004). PTEN activation contributes to tumour inhibition by trastuzumab, and loss of PTEN predicts trastuzumab resistance in patients. Cancer Cell 6: 117-127. Nagy P, Friedlander E, Tanner M, Kapanen AI, Carraway KL, Isola J et al. (2005). Decreased accessibility and lack of activation of ErbB2 in JIMT-1, a herceptin-resistant, MUC4-expressing breast cancer cell line. Cancer Res 65: 473-482. Nahta R, Hung MC, Esteva FJ. (2004a). The HER2-targeting antibodies trastuzumab and pertuzumab synergistically inhibit the survival of breast cancer cells. Cancer Res 64: 2343-2346. 81  Nahta R, Takahashi T, Ueno NT, Hung MC, Esteva FJ. (2004b). P27(kip1) down-regulation is associated with trastuzumab resistance in breast cancer cells. Cancer Res 64: 3981-3986. Nahta R, Yuan LX, Zhang B, Kobayashi R, Esteva FJ. (2005). Insulin-like growth factor-I receptor/human epidermal growth factor receptor 2 heterodimerization contributes to trastuzumab resistance of breast cancer cells. Cancer Res 65: 11118-11128. Nahta R, Esteva FJ. (2006). HER2 therapy: Molecular mechanisms of trastuzumab resistance. Breast Cancer Res 8: 215. Nakamura T, Nishizawa T, Hagiya M, Seki T, Shimonishi M, Sugimura A et al. (1989). Molecular cloning and expression of human hepatocyte growth factor. Nature 342: 440-443. Nambiar A, Kandala JC, Svoboda J, Guntaka RV. (1998a). Cloning of a novel Y-box homology protein (chkYB-1HP) cDNA lacking the cold-shock domain. Biochim Biophys Acta 1395: 1-6. Nambiar A, Swamynathan SK, Kandala JC, Guntaka RV. (1998b). Characterization of the DNAbinding domain of the avian Y-box protein, chkYB-2, and mutational analysis of its singlestrand binding motif in the rous sarcoma virus enhancer. J Virol 72: 900-909. Nekrasov MP, Ivshina MP, Chernov KG, Kovrigina EA, Evdokimova VM, Thomas AA et al. (2003). The mRNA-binding protein YB-1 (p50) prevents association of the eukaryotic initiation factor eIF4G with mRNA and inhibits protein synthesis at the initiation stage. J Biol Chem 278: 13936-13943. Nielsen TO, Hsu FD, Jensen K, Cheang M, Karaca G, Hu Z et al. (2004). Immunohistochemical and clinical characterization of the basal-like subtype of invasive breast carcinoma. Clin Cancer Res 10: 5367-5374. Norman JT, Lindahl GE, Shakib K, En-Nia A, Yilmaz E, Mertens PR. (2001). The Y-box binding protein YB-1 suppresses collagen alpha 1(I) gene transcription via an evolutionarily conserved regulatory element in the proximal promoter. J Biol Chem 276: 29880-29890. Oda Y, Kohashi K, Yamamoto H, Tamiya S, Kohno K, Kuwano M et al. (2008). Different expression profiles of Y-box-binding protein-1 and multidrug resistance-associated proteins between alveolar and embryonal rhabdomyosarcoma. Cancer Sci 99: 726-732. Oda Y, Ohishi Y, Saito T, Hinoshita E, Uchiumi T, Kinukawa N et al. (2003). Nuclear expression of Y-box-binding protein-1 correlates with P-glycoprotein and topoisomerase II alpha expression, and with poor prognosis in synovial sarcoma. J Pathol 199: 251-258. Oda Y, Sakamoto A, Shinohara N, Ohga T, Uchiumi T, Kohno K et al. (1998). Nuclear expression of YB-1 protein correlates with P-glycoprotein expression in human osteosarcoma. Clin Cancer Res 4: 2273-2277. Offterdinger M, Bastiaens PI. (2008). Prolonged EGFR signalling by ERBB2-mediated sequestration at the plasma membrane. Traffic 9: 147-155.  82  Ohashi S, Fukumura R, Higuchi T, Kobayashi S. (2009). YB-1 transcription in the postnatal brain is regulated by a bHLH transcription factor Math2 through an E-box sequence in the 5'UTR of the gene. Mol Cell Biochem 327: 267-275. Okamoto T, Izumi H, Imamura T, Takano H, Ise T, Uchiumi T et al. (2000). Direct interaction of p53 with the Y-box binding protein, YB-1: A mechanism for regulation of human gene expression. Oncogene 19: 6194-6202. Oliveras-Ferraros C, Vazquez-Martin A, Martin-Castillo B, Cufi S, Barco SD, Lopez-Bonet E et al. (2010). Dynamic emergence of the mesenchymal CD44(pos)CD24(neg/low) phenotype in HER2-gene amplified breast cancer cells with de novo resistance to trastuzumab (herceptin). Biochem Biophys Res Commun 397: 27-33. Olivero M, Valente G, Bardelli A, Longati P, Ferrero N, Cracco C et al. (1999). Novel mutation in the ATP-binding site of the MET oncogene tyrosine kinase in a HPRCC family. Int J Cancer 82: 640-643. O’Loghlen A, Gonzalez VM, Jurado T, Salinas M, Martin ME. (2007). Characterization of the activity of human MAP kinase-interacting kinase Mnk1b. Biochim Biophys Acta 1773: 14161427. O’Loghlen A, Gonzalez VM, Pineiro D, Perez-Morgado MI, Salinas M, Martin ME. (2004). Identification and molecular characterization of Mnk1b, a splice variant of human MAP kinaseinteracting kinase Mnk1. Exp Cell Res 299: 343-355. Olopade OI, Grushko T. (2001). Gene-expression profiles in hereditary breast cancer. N Engl J Med 344: 2028-2029. Orian-Rousseau V, Chen L, Sleeman JP, Herrlich P, Ponta H. (2002). CD44 is required for two consecutive steps in HGF/c-met signalling. Genes Dev 16: 3074-3086. Orian-Rousseau V, Morrison H, Matzke A, Kastilan T, Pace G, Herrlich P et al. (2007). Hepatocyte growth factor-induced ras activation requires ERM proteins linked to both CD44v6 and F-actin. Mol Biol Cell 18: 76-83. Otsu M, Hiles I, Gout I, Fry MJ, Ruiz-Larrea F, Panayotou G et al. (1991). Characterization of two 85 kd proteins that associate with receptor tyrosine kinases, middle-T/pp60c-src complexes, and PI3-kinase. Cell 65: 91-104. Park M, Dean M, Cooper CS, Schmidt M, O'Brien SJ, Blair DG et al. (1986). Mechanism of met oncogene activation. Cell 45: 895-904. Park WS, Dong SM, Kim SY, Na EY, Shin MS, Pi JH et al. (1999). Somatic mutations in the kinase domain of the Met/hepatocyte growth factor receptor gene in childhood hepatocellular carcinomas. Cancer Res 59: 307-310. Parker JS, Mullins M, Cheang MC, Leung S, Voduc D, Vickery T et al. (2009). Supervised risk predictor of breast cancer based on intrinsic subtypes. J Clin Oncol 27: 1160-1167. 83  Parra JL, Buxade M, Proud CG. (2005). Features of the catalytic domains and C termini of the MAPK signal-integrating kinases Mnk1 and Mnk2 determine their differing activities and regulatory properties. J Biol Chem 280: 37623-37633. Parra-Palau JL, Scheper GC, Wilson ML, Proud CG. (2003). Features in the N and C termini of the MAPK-interacting kinase Mnk1 mediate its nucleocytoplasmic shuttling. J Biol Chem 278: 44197-44204. Pedersen K, Angelini PD, Laos S, Bach-Faig A, Cunningham MP, Ferrer-Ramon C et al. (2009). A naturally occurring HER2 carboxy-terminal fragment promotes mammary tumour growth and metastasis. Mol Cell Biol 29: 3319-3331. Pegram MD, Konecny GE, O'Callaghan C, Beryt M, Pietras R, Slamon DJ. (2004). Rational combinations of trastuzumab with chemotherapeutic drugs used in the treatment of breast cancer. J Natl Cancer Inst 96: 739-749. Pegram MD, Lipton A, Hayes DF, Weber BL, Baselga JM, Tripathy D et al. (1998). Phase II study of receptor-enhanced chemosensitivity using recombinant humanized anti-p185HER2/neu monoclonal antibody plus cisplatin in patients with HER2/neu-overexpressing metastatic breast cancer refractory to chemotherapy treatment. J Clin Oncol 16: 2659-2671. Pennacchietti S, Michieli P, Galluzzo M, Mazzone M, Giordano S, Comoglio PM. (2003). Hypoxia promotes invasive growth by transcriptional activation of the met protooncogene. Cancer Cell 3: 347-361. Perou CM, Sorlie T, Eisen MB, van de Rijn M, Jeffrey SS, Rees CA et al. (2000). Molecular portraits of human breast tumours. Nature 406: 747-752. Peschard P, Fournier TM, Lamorte L, Naujokas MA, Band H, Langdon WY et al. (2001). Mutation of the c-cbl TKB domain binding site on the met receptor tyrosine kinase converts it into a transforming protein. Mol Cell 8: 995-1004. Petit AM, Rak J, Hung MC, Rockwell P, Goldstein N, Fendly B et al. (1997). Neutralizing antibodies against epidermal growth factor and ErbB-2/neu receptor tyrosine kinases downregulate vascular endothelial growth factor production by tumour cells in vitro and in vivo: Angiogenic implications for signal transduction therapy of solid tumours. Am J Pathol 151: 1523-1530. Piccart-Gebhart MJ, Procter M, Leyland-Jones B, Goldhirsch A, Untch M, Smith I et al. (2005). Trastuzumab after adjuvant chemotherapy in HER2-positive breast cancer. N Engl J Med 353: 1659-1672. Pietras RJ, Fendly BM, Chazin VR, Pegram MD, Howell SB, Slamon DJ. (1994). Antibody to HER2/neu receptor blocks DNA repair after cisplatin in human breast and ovarian cancer cells. Oncogene 9: 1829-1838. Pietras RJ, Poen JC, Gallardo D, Wongvipat PN, Lee HJ, Slamon DJ. (1999). Monoclonal antibody to HER2/neureceptor modulates repair of radiation-induced DNA damage and enhances radiosensitivity of human breast cancer cells overexpressing this oncogene. Cancer Res 84  59: 1347-1355. Plowman GD, Culouscou JM, Whitney GS, Green JM, Carlton GW, Foy L et al. (1993). Ligandspecific activation of HER4/p180erbB4, a fourth member of the epidermal growth factor receptor family. Proc Natl Acad Sci U S A 90: 1746-1750. Ponzetto C, Bardelli A, Maina F, Longati P, Panayotou G, Dhand R et al. (1993). A novel recognition motif for phosphatidylinositol 3-kinase binding mediates its association with the hepatocyte growth factor/scatter factor receptor. Mol Cell Biol 13: 4600-4608. Ponzetto C, Bardelli A, Zhen Z, Maina F, dalla Zonca P, Giordano S et al. (1994). A multifunctional docking site mediates signalling and transformation by the hepatocyte growth factor/scatter factor receptor family. Cell 77: 261-271. Ponzo MG, Lesurf R, Petkiewicz S, O'Malley FP, Pinnaduwage D, Andrulis IL et al. (2009). Met induces mammary tumours with diverse histologies and is associated with poor outcome and human basal breast cancer. Proc Natl Acad Sci U S A 106: 12903-12908. Price-Schiavi SA, Jepson S, Li P, Arango M, Rudland PS, Yee L et al. (2002). Rat Muc4 (sialomucin complex) reduces binding of anti-ErbB2 antibodies to tumour cell surfaces, a potential mechanism for herceptin resistance. Int J Cancer 99: 783-791. Pritchard KI, Shepherd LE, O'Malley FP, Andrulis IL, Tu D, Bramwell VH et al. (2006). HER2 and responsiveness of breast cancer to adjuvant chemotherapy. N Engl J Med 354: 2103-2111. Puri KD, Doggett TA, Huang CY, Douangpanya J, Hayflick JS, Turner M et al. (2005). The role of endothelial PI3Kgamma activity in neutrophil trafficking. Blood 106: 150-157. Puri N, Ahmed S, Janamanchi V, Tretiakova M, Zumba O, Krausz T et al. (2007). c-met is a potentially new therapeutic target for treatment of human melanoma. Clin Cancer Res 13: 22462253. Pyronnet S, Imataka H, Gingras AC, Fukunaga R, Hunter T, Sonenberg N. (1999). Human eukaryotic translation initiation factor 4G (eIF4G) recruits mnk1 to phosphorylate eIF4E. EMBO J 18: 270-279. Raffetseder U, Frye B, Rauen T, Jurchott K, Royer HD, Jansen PL et al. (2003). Splicing factor SRp30c interaction with Y-box protein-1 confers nuclear YB-1 shuttling and alternative splice site selection. J Biol Chem 278: 18241-18248. Raja SM, Clubb RJ, Bhattacharyya M, Dimri M, Cheng H, Pan W et al. (2008). A combination of trastuzumab and 17-AAG induces enhanced ubiquitinylation and lysosomal pathwaydependent ErbB2 degradation and cytotoxicity in ErbB2-overexpressing breast cancer cells. Cancer Biol Ther 7: 1630-1640. Rakha EA, Tan DS, Foulkes WD, Ellis IO, Tutt A, Nielsen TO et al. (2007). Are triple-negative tumours and basal-like breast cancer synonymous? Breast Cancer Res 9: 404; author reply 405.  85  Rauen T, Raffetseder U, Frye BC, Djudjaj S, Muhlenberg PJ, Eitner F et al. (2009). YB-1 acts as a ligand for notch-3 receptors and modulates receptor activation. J Biol Chem 284: 2692826940. Reif K, Okkenhaug K, Sasaki T, Penninger JM, Vanhaesebroeck B, Cyster JG. (2004). Cutting edge: Differential roles for phosphoinositide 3-kinases, p110gamma and p110delta, in lymphocyte chemotaxis and homing. J Immunol 173: 2236-2240. Ridley AJ, Comoglio PM, Hall A. (1995). Regulation of scatter factor/hepatocyte growth factor responses by ras, rac, and rho in MDCK cells. Mol Cell Biol 15: 1110-1122. Ritter CA, Perez-Torres M, Rinehart C, Guix M, Dugger T, Engelman JA et al. (2007). Human breast cancer cells selected for resistance to trastuzumab in vivo overexpress epidermal growth factor receptor and ErbB ligands and remain dependent on the ErbB receptor network. Clin Cancer Res 13: 4909-4919. Rodrigues GA, Park M. (1993). Dimerization mediated through a leucine zipper activates the oncogenic potential of the met receptor tyrosine kinase. Mol Cell Biol 13: 6711-6722. Rodriguez-Pinilla SM, Jones RL, Lambros MB, Arriola E, Savage K, James M et al. (2007). MYC amplification in breast cancer: A chromogenic in situ hybridisation study. J Clin Pathol 60: 1017-1023. Rodriguez-Viciana P, Warne PH, Dhand R, Vanhaesebroeck B, Gout I, Fry MJ et al. (1994). Phosphatidylinositol-3-OH kinase as a direct target of ras. Nature 370: 527-532. Romond EH, Perez EA, Bryant J, Suman VJ, Geyer CE,Jr, Davidson NE et al. (2005). Trastuzumab plus adjuvant chemotherapy for operable HER2-positive breast cancer. N Engl J Med 353: 1673-1684. Rong S, Segal S, Anver M, Resau JH, Vande Woude GF. (1994). Invasiveness and metastasis of NIH 3T3 cells induced by met-hepatocyte growth factor/scatter factor autocrine stimulation. Proc Natl Acad Sci U S A 91: 4731-4735. Rous P. (1911). A sarcoma of the fowl transmissible by an agent separable from the tumour cells. J Exp Med 13: 397-411. Rous P. (1910). A transmissible avian neoplasm. (sarcoma of the common fowl.). J Exp Med 12: 696-705. Rous P, Murphy JB. (1914). On the causation by filterable agents of three distinct chicken tumours. J Exp Med 19: 52-68. Roux PP, Blenis J. (2004). ERK and p38 MAPK-activated protein kinases: A family of protein kinases with diverse biological functions. Microbiol Mol Biol Rev 68: 320-344. Rouzier R, Perou CM, Symmans WF, Ibrahim N, Cristofanilli M, Anderson K et al. (2005). Breast cancer molecular subtypes respond differently to preoperative chemotherapy. Clin Cancer 86  Res 11: 5678-5685. Royal I, Lamarche-Vane N, Lamorte L, Kaibuchi K, Park M. (2000). Activation of cdc42, rac, PAK, and rho-kinase in response to hepatocyte growth factor differentially regulates epithelial cell colony spreading and dissociation. Mol Biol Cell 11: 1709-1725. Ruzanov PV, Evdokimova VM, Korneeva NL, Hershey JW, Ovchinnikov LP. (1999). Interaction of the universal mRNA-binding protein, p50, with actin: A possible link between mRNA and microfilaments. J Cell Sci 112 ( Pt 20): 3487-3496. Saal LH, Holm K, Maurer M, Memeo L, Su T, Wang X et al. (2005). PIK3CA mutations correlate with hormone receptors, node metastasis, and ERBB2, and are mutually exclusive with PTEN loss in human breast carcinoma. Cancer Res 65: 2554-2559. Sachs M, Brohmann H, Zechner D, Muller T, Hulsken J, Walther I et al. (2000). Essential role of Gab1 for signalling by the c-met receptor in vivo. J Cell Biol 150: 1375-1384. Saez R, Molina MA, Ramsey EE, Rojo F, Keenan EJ, Albanell J et al. (2006). p95HER2 predicts worse outcome in patients with HER2-positive breast cancer. Clin Cancer Res 12: 424431. Saji H, Toi M, Saji S, Koike M, Kohno K, Kuwano M. (2003). Nuclear expression of YB-1 protein correlates with P-glycoprotein expression in human breast carcinoma. Cancer Lett 190: 191-197. Sakkab D, Lewitzky M, Posern G, Schaeper U, Sachs M, Birchmeier W et al. (2000). Signalling of hepatocyte growth factor/scatter factor (HGF) to the small GTPase Rap1 via the large docking protein Gab1 and the adapter protein CRKL. J Biol Chem 275: 10772-10778. Sakura H, Maekawa T, Imamoto F, Yasuda K, Ishii S. (1988). Two human genes isolated by a novel method encode DNA-binding proteins containing a common region of homology. Gene 73: 499-507. Sam MR, Elliott BE, Mueller CR. (2007). A novel activating role of SRC and STAT3 on HGF transcription in human breast cancer cells. Mol Cancer 6: 69. Samuel S, Beifuss KK, Bernstein LR. (2007). YB-1 binds to the MMP-13 promoter sequence and represses MMP-13 transactivation via the AP-1 site. Biochim Biophys Acta 1769: 525-531. Samuel S, Twizere JC, Bernstein LR. (2005). YB-1 represses AP1-dependent gene transactivation and interacts with an AP-1 DNA sequence. Biochem J 388: 921-928. Samuels Y, Velculescu VE. (2004). Oncogenic mutations of PIK3CA in human cancers. Cell Cycle 3: 1221-1224. Samuels Y, Wang Z, Bardelli A, Silliman N, Ptak J, Szabo S et al. (2004). High frequency of mutations of the PIK3CA gene in human cancers. Science 304: 554.  87  Sarbassov DD, Guertin DA, Ali SM, Sabatini DM. (2005). Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science 307: 1098-1101. Sarup JC, Johnson RM, King KL, Fendly BM, Lipari MT, Napier MA et al. (1991). Characterization of an anti-p185HER2 monoclonal antibody that stimulates receptor function and inhibits tumour cell growth. Growth Regul 1: 72-82. Sawada K, Radjabi AR, Shinomiya N, Kistner E, Kenny H, Becker AR et al. (2007). c-met overexpression is a prognostic factor in ovarian cancer and an effective target for inhibition of peritoneal dissemination and invasion. Cancer Res 67: 1670-1679. Sawyer C, Sturge J, Bennett DC, O'Hare MJ, Allen WE, Bain J et al. (2003). Regulation of breast cancer cell chemotaxis by the phosphoinositide 3-kinase p110delta. Cancer Res 63: 16671675. Scaltriti M, Chandarlapaty S, Prudkin L, Aura C, Jimenez J, Angelini PD et al. (2010). Clinical benefit of lapatinib-based therapy in patients with human epidermal growth factor receptor 2positive breast tumours coexpressing the truncated p95HER2 receptor. Clin Cancer Res 16: 2688-2695. Scaltriti M, Rojo F, Ocana A, Anido J, Guzman M, Cortes J et al. (2007). Expression of p95HER2, a truncated form of the HER2 receptor, and response to anti-HER2 therapies in breast cancer. J Natl Cancer Inst 99: 628-638. Schaeper U, Gehring NH, Fuchs KP, Sachs M, Kempkes B, Birchmeier W. (2000). Coupling of Gab1 to c-met, Grb2, and Shp2 mediates biological responses. J Cell Biol 149: 1419-1432. Schechter AL, Hung MC, Vaidyanathan L, Weinberg RA, Yang-Feng TL, Francke U et al. (1985). The neu gene: An erbB-homologous gene distinct from and unlinked to the gene encoding the EGF receptor. Science 229: 976-978. Schechter AL, Stern DF, Vaidyanathan L, Decker SJ, Drebin JA, Greene MI et al. (1984). The neu oncogene: An erb-B-related gene encoding a 185,000-mr tumour antigen. Nature 312: 513516. Scheper GC, Morrice NA, Kleijn M, Proud CG. (2001). The mitogen-activated protein kinase signal-integrating kinase Mnk2 is a eukaryotic initiation factor 4E kinase with high levels of basal activity in mammalian cells. Mol Cell Biol 21: 743-754. Scheper GC, Parra JL, Wilson M, Van Kollenburg B, Vertegaal AC, Han ZG et al. (2003). The N and C termini of the splice variants of the human mitogen-activated protein kinase-interacting kinase Mnk2 determine activity and localization. Mol Cell Biol 23: 5692-5705. Scheper GC, van Kollenburg B, Hu J, Luo Y, Goss DJ, Proud CG. (2002). Phosphorylation of eukaryotic initiation factor 4E markedly reduces its affinity for capped mRNA. J Biol Chem 277: 3303-3309. Schittek B, Psenner K, Sauer B, Meier F, Iftner T, Garbe C. (2007). The increased expression of Y box-binding protein 1 in melanoma stimulates proliferation and tumour invasion, antagonizes 88  apoptosis and enhances chemoresistance. Int J Cancer 120: 2110-2118. Schlessinger J. (2000). Cell signalling by receptor tyrosine kinases. Cell 103: 211-225. Schlessinger J, Lemmon MA. (2003). SH2 and PTB domains in tyrosine kinase signalling. Sci STKE 2003: RE12. Schmidt C, Bladt F, Goedecke S, Brinkmann V, Zschiesche W, Sharpe M et al. (1995). Scatter factor/hepatocyte growth factor is essential for liver development. Nature 373: 699-702. Schmidt L, Duh FM, Chen F, Kishida T, Glenn G, Choyke P et al. (1997). Germline and somatic mutations in the tyrosine kinase domain of the MET proto-oncogene in papillary renal carcinomas. Nat Genet 16: 68-73. Schmidt L, Junker K, Nakaigawa N, Kinjerski T, Weirich G, Miller M et al. (1999). Novel mutations of the MET proto-oncogene in papillary renal carcinomas. Oncogene 18: 2343-2350. Schmidt L, Junker K, Weirich G, Glenn G, Choyke P, Lubensky I et al. (1998). Two north american families with hereditary papillary renal carcinoma and identical novel mutations in the MET proto-oncogene. Cancer Res 58: 1719-1722. Schwartz GF, Solin LJ, Olivotto IA, Ernster VL, Pressman PI. (2000). Consensus conference on the treatment of in situ ductal carcinoma of the breast, april 22-25, 1999. Cancer 88: 946-954. Seiwert TY, Jagadeeswaran R, Faoro L, Janamanchi V, Nallasura V, El Dinali M et al. (2009). The MET receptor tyrosine kinase is a potential novel therapeutic target for head and neck squamous cell carcinoma. Cancer Res 69: 3021-3031. Seol DW, Chen Q, Smith ML, Zarnegar R. (1999). Regulation of the c-met proto-oncogene promoter by p53. J Biol Chem 274: 3565-3572. Seol DW, Zarnegar R. (1998). Structural and functional characterization of the mouse c-met proto-oncogene (hepatocyte growth factor receptor) promoter. Biochim Biophys Acta 1395: 252258. Shadeo A, Lam WL. (2006). Comprehensive copy number profiles of breast cancer cell model genomes. Breast Cancer Res 8: R9. Shattuck DL, Miller JK, Carraway KL,3rd, Sweeney C. (2008). Met receptor contributes to trastuzumab resistance of Her2-overexpressing breast cancer cells. Cancer Res 68: 1471-1477. Shayesteh L, Lu Y, Kuo WL, Baldocchi R, Godfrey T, Collins C et al. (1999). PIK3CA is implicated as an oncogene in ovarian cancer. Nat Genet 21: 99-102. Shibahara K, Sugio K, Osaki T, Uchiumi T, Maehara Y, Kohno K et al. (2001). Nuclear expression of the Y-box binding protein, YB-1, as a novel marker of disease progression in nonsmall cell lung cancer. Clin Cancer Res 7: 3151-3155.  89  Shibao K, Takano H, Nakayama Y, Okazaki K, Nagata N, Izumi H et al. (1999). Enhanced coexpression of YB-1 and DNA topoisomerase II alpha genes in human colorectal carcinomas. Int J Cancer 83: 732-737. Shibata S, Morino S, Tomoo K, In Y, Ishida T. (1998). Effect of mRNA cap structure on eIF-4E phosphorylation and cap binding analyses using Ser209-mutated eIF-4Es. Biochem Biophys Res Commun 247: 213-216. Shih C, Padhy LC, Murray M, Weinberg RA. (1981). Transforming genes of carcinomas and neuroblastomas introduced into mouse fibroblasts. Nature 290: 261-264. Shiota M, Izumi H, Onitsuka T, Miyamoto N, Kashiwagi E, Kidani A et al. (2008). Twist promotes tumour cell growth through YB-1 expression. Cancer Res 68: 98-105. Shiota M, Izumi H, Tanimoto A, Takahashi M, Miyamoto N, Kashiwagi E et al. (2009). Programmed cell death protein 4 down-regulates Y-box binding protein-1 expression via a direct interaction with Twist1 to suppress cancer cell growth. Cancer Res 69: 3148-3156. Shiota M, Yokomizo A, Tada Y, Uchiumi T, Inokuchi J, Tatsugami K et al. (2010). P300/CBPassociated factor regulates Y-box binding protein-1 expression and promotes cancer cell growth, cancer invasion and drug resistance. Cancer Sci 101: 1797-1806. Siegel PM, Dankort DL, Hardy WR, Muller WJ. (1994). Novel activating mutations in the neu proto-oncogene involved in induction of mammary tumours. Mol Cell Biol 14: 7068-7077. Siegel PM, Muller WJ. (1996). Mutations affecting conserved cysteine residues within the extracellular domain of neu promote receptor dimerization and activation. Proc Natl Acad Sci U S A 93: 8878-8883. Siegel PM, Ryan ED, Cardiff RD, Muller WJ. (1999). Elevated expression of activated forms of Neu/ErbB-2 and ErbB-3 are involved in the induction of mammary tumours in transgenic mice: Implications for human breast cancer. EMBO J 18: 2149-2164. Silver DP, Richardson AL, Eklund AC, Wang ZC, Szallasi Z, Li Q et al. (2010). Efficacy of neoadjuvant cisplatin in triple-negative breast cancer. J Clin Oncol 28: 1145-1153. Singh AB, Harris RC. (2005). Autocrine, paracrine and juxtacrine signalling by EGFR ligands. Cell Signal 17: 1183-1193. Singleton PA, Salgia R, Moreno-Vinasco L, Moitra J, Sammani S, Mirzapoiazova T et al. (2007). CD44 regulates hepatocyte growth factor-mediated vascular integrity. role of c-met, Tiam1/Rac1, dynamin 2, and cortactin. J Biol Chem 282: 30643-30657. Slamon DJ, Clark GM, Wong SG, Levin WJ, Ullrich A, McGuire WL. (1987). Human breast cancer: Correlation of relapse and survival with amplification of the HER2/neu oncogene. Science 235: 177-182.  90  Slamon DJ, Godolphin W, Jones LA, Holt JA, Wong SG, Keith DE et al. (1989). Studies of the HER2/neu proto-oncogene in human breast and ovarian cancer. Science 244: 707-712. Slamon DJ, Leyland-Jones B, Shak S, Fuchs H, Paton V, Bajamonde A et al. (2001). Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. N Engl J Med 344: 783-792. Slentz-Kesler K, Moore JT, Lombard M, Zhang J, Hollingsworth R, Weiner MP. (2000). Identification of the human Mnk2 gene (MKNK2) through protein interaction with estrogen receptor beta. Genomics 69: 63-71. Smith I, Procter M, Gelber RD, Guillaume S, Feyereislova A, Dowsett M et al. (2007). 2-year follow-up of trastuzumab after adjuvant chemotherapy in HER2-positive breast cancer: A randomised controlled trial. Lancet 369: 29-36. Smith MR, Jaramillo M, Liu YL, Dever TE, Merrick WC, Kung HF et al. (1990). Translation initiation factors induce DNA synthesis and transform NIH 3T3 cells. New Biol 2: 648-654. Soltoff SP, Carraway KL,3rd, Prigent SA, Gullick WG, Cantley LC. (1994). ErbB3 is involved in activation of phosphatidylinositol 3-kinase by epidermal growth factor. Mol Cell Biol 14: 3550-3558. Soman NR, Correa P, Ruiz BA, Wogan GN. (1991). The TPR-MET oncogenic rearrangement is present and expressed in human gastric carcinoma and precursor lesions. Proc Natl Acad Sci U S A 88: 4892-4896. Sorlie T, Perou CM, Tibshirani R, Aas T, Geisler S, Johnsen H et al. (2001). Gene expression patterns of breast carcinomas distinguish tumour subclasses with clinical implications. Proc Natl Acad Sci U S A 98: 10869-10874. Sorlie T, Tibshirani R, Parker J, Hastie T, Marron JS, Nobel A et al. (2003). Repeated observation of breast tumour subtypes in independent gene expression data sets. Proc Natl Acad Sci U S A 100: 8418-8423. Sotiriou C, Neo SY, McShane LM, Korn EL, Long PM, Jazaeri A et al. (2003). Breast cancer classification and prognosis based on gene expression profiles from a population-based study. Proc Natl Acad Sci U S A 100: 10393-10398. Spentzos D, Levine DA, Kolia S, Otu H, Boyd J, Libermann TA et al. (2005). Unique gene expression profile based on pathologic response in epithelial ovarian cancer. J Clin Oncol 23: 7911-7918. Spielmann M, Roche H, Delozier T, Canon JL, Romieu G, Bourgeois H et al. (2009). Trastuzumab for patients with axillary-node-positive breast cancer: Results of the FNCLCCPACS 04 trial. J Clin Oncol 27: 6129-6134. Spitkovsky DD, Royer-Pokora B, Delius H, Kisseljov F, Jenkins NA, Gilbert DJ et al. (1992). Tissue restricted expression and chromosomal localization of the YB-1 gene encoding a 42 kD 91  nuclear CCAAT binding protein. Nucleic Acids Res 20: 797-803. Stein U, Bergmann S, Scheffer GL, Scheper RJ, Royer HD, Schlag PM et al. (2005). YB-1 facilitates basal and 5-fluorouracil-inducible expression of the human major vault protein (MVP) gene. Oncogene 24: 3606-3618. Stein U, Jurchott K, Walther W, Bergmann S, Schlag PM, Royer HD. (2001). Hyperthermiainduced nuclear translocation of transcription factor YB-1 leads to enhanced expression of multidrug resistance-related ABC transporters. J Biol Chem 276: 28562-28569. Stephens LR, Eguinoa A, Erdjument-Bromage H, Lui M, Cooke F, Coadwell J et al. (1997). The G beta gamma sensitivity of a PI3K is dependent upon a tightly associated adaptor, p101. Cell 89: 105-114. Stickeler E, Fraser SD, Honig A, Chen AL, Berget SM, Cooper TA. (2001). The RNA binding protein YB-1 binds A/C-rich exon enhancers and stimulates splicing of the CD44 alternative exon v4. EMBO J 20: 3821-3830. Stoker M, Gherardi E, Perryman M, Gray J. (1987). Scatter factor is a fibroblast-derived modulator of epithelial cell mobility. Nature 327: 239-242. Stokoe D, Stephens LR, Copeland T, Gaffney PR, Reese CB, Painter GF et al. (1997). Dual role of phosphatidylinositol-3,4,5-trisphosphate in the activation of protein kinase B. Science 277: 567-570. Stratford AL, Fry CJ, Desilets C, Davies AH, Cho YY, Li Y et al. (2008). Y-box binding protein-1 (YB-1) serine 102 is a downstream target of p90 ribosomal S6 kinase (RSK) in basallike breast cancer cells. Breast Cancer Res 10: R99. Stratford AL, Habibi G, Astanehe A, Jiang H, Hu K, Park E et al. (2007). Epidermal growth factor receptor (EGFR) is transcriptionally induced by the Y-box binding protein-1 (YB-1) and can be inhibited with iressa in basal-like breast cancer, providing a potential target for therapy. Breast Cancer Res 9: R61. Suire S, Coadwell J, Ferguson GJ, Davidson K, Hawkins P, Stephens L. (2005). p84, a new gbetagamma-activated regulatory subunit of the type IB phosphoinositide 3-kinase p110gamma. Curr Biol 15: 566-570. Sujobert P, Bardet V, Cornillet-Lefebvre P, Hayflick JS, Prie N, Verdier F et al. (2005). Essential role for the p110delta isoform in phosphoinositide 3-kinase activation and cell proliferation in acute myeloid leukaemia. Blood 106: 1063-1066. Sutherland BW, Kucab J, Wu J, Lee C, Cheang MC, Yorida E et al. (2005). Akt phosphorylates the Y-box binding protein 1 at Ser102 located in the cold shock domain and affects the anchorage-independent growth of breast cancer cells. Oncogene 24: 4281-4292. Swamynathan SK, Nambiar A, Guntaka RV. (1998). Role of single-stranded DNA regions and Y-box proteins in transcriptional regulation of viral and cellular genes. FASEB J 12: 515-522. 92  Tai W, Mahato R, Cheng K. (2010). The role of HER2 in cancer therapy and targeted drug delivery. J Control Release . Takahashi M, Shimajiri S, Izumi H, Hirano G, Kashiwagi E, Yasuniwa Y et al. (2010). Y-box binding protein-1 is a novel molecular target for tumour vessels. Cancer Sci 101: 1367-1373. Takanami I, Tanana F, Hashizume T, Kikuchi K, Yamamoto Y, Yamamoto T et al. (1996). Hepatocyte growth factor and c-Met/hepatocyte growth factor receptor in pulmonary adenocarcinomas: An evaluation of their expression as prognostic markers. Oncology 53: 392397. Takeuchi H, Bilchik A, Saha S, Turner R, Wiese D, Tanaka M et al. (2003). c-MET expression level in primary colon cancer: A predictor of tumour invasion and lymph node metastases. Clin Cancer Res 9: 1480-1488. Tanyi J, Tory K, Rigo J,Jr, Nagy B, Papp Z. (1999). Evaluation of the tyrosine kinase domain of the met proto-oncogene in sporadic ovarian carcinomas*. Pathol Oncol Res 5: 187-191. Thuerigen O, Schneeweiss A, Toedt G, Warnat P, Hahn M, Kramer H et al. (2006). Gene expression signature predicting pathologic complete response with gemcitabine, epirubicin, and docetaxel in primary breast cancer. J Clin Oncol 24: 1839-1845. Tikhomirov O, Carpenter G. (2003). Identification of ErbB-2 kinase domain motifs required for geldanamycin-induced degradation. Cancer Res 63: 39-43. Ting JP, Painter A, Zeleznik-Le NJ, MacDonald G, Moore TM, Brown A et al. (1994). YB-1 DNA-binding protein represses interferon gamma activation of class II major histocompatibility complex genes. J Exp Med 179: 1605-1611. To K, Fotovati A, Reipas KM, Law JH, Hu K, Wang J et al. (2010). Y-box binding protein-1 induces the expression of CD44 and CD49f leading to enhanced self-renewal, mammosphere growth, and drug resistance. Cancer Res 70: 2840-2851. Toker A, Cantley LC. (1997). Signalling through the lipid products of phosphoinositide-3-OH kinase. Nature 387: 673-676. Toker A, Newton AC. (2000). Akt/protein kinase B is regulated by autophosphorylation at the hypothetical PDK-2 site. J Biol Chem 275: 8271-8274. Tolgay Ocal I, Dolled-Filhart M, D'Aquila TG, Camp RL, Rimm DL. (2003). Tissue microarraybased studies of patients with lymph node negative breast carcinoma show that met expression is associated with worse outcome but is not correlated with epidermal growth factor family receptors. Cancer 97: 1841-1848. Tong CY, Hui AB, Yin XL, Pang JC, Zhu XL, Poon WS et al. (2004). Detection of oncogene amplifications in medulloblastomas by comparative genomic hybridization and array-based comparative genomic hybridization. J Neurosurg 100: 187-193.  93  Trusolino L, Bertotti A, Comoglio PM. (2001). A signalling adapter function for alpha6beta4 integrin in the control of HGF-dependent invasive growth. Cell 107: 643-654. Tuck AB, Park M, Sterns EE, Boag A, Elliott BE. (1996). Coexpression of hepatocyte growth factor and receptor (met) in human breast carcinoma. Am J Pathol 148: 225-232. Uchiumi T, Fotovati A, Sasaguri T, Shibahara K, Shimada T, Fukuda T et al. (2006). YB-1 is important for an early stage embryonic development: Neural tube formation and cell proliferation. J Biol Chem 281: 40440-40449. Ueda T, Watanabe-Fukunaga R, Fukuyama H, Nagata S, Fukunaga R. (2004). Mnk2 and Mnk1 are essential for constitutive and inducible phosphorylation of eukaryotic initiation factor 4E but not for cell growth or development. Mol Cell Biol 24: 6539-6549. Uehara Y, Minowa O, Mori C, Shiota K, Kuno J, Noda T et al. (1995). Placental defect and embryonic lethality in mice lacking hepatocyte growth factor/scatter factor. Nature 373: 702705. Umeki K, Shiota G, Kawasaki H. (1999). Clinical significance of c-met oncogene alterations in human colorectal cancer. Oncology 56: 314-321. Untch M, Rezai M, Loibl S, Fasching PA, Huober J, Tesch H et al. (2010). Neoadjuvant treatment with trastuzumab in HER2-positive breast cancer: Results from the GeparQuattro study. J Clin Oncol 28: 2024-2031. Uramoto H, Izumi H, Ise T, Tada M, Uchiumi T, Kuwano M et al. (2002). p73 interacts with cmyc to regulate Y-box-binding protein-1 expression. J Biol Chem 277: 31694-31702. Ursini-Siegel J, Schade B, Cardiff RD, Muller WJ. (2007). Insights from transgenic mouse models of ERBB2-induced breast cancer. Nat Rev Cancer 7: 389-397. van der Voort R, Taher TE, Wielenga VJ, Spaargaren M, Prevo R, Smit L et al. (1999). Heparan sulfate-modified CD44 promotes hepatocyte growth factor/scatter factor-induced signal transduction through the receptor tyrosine kinase c-met. J Biol Chem 274: 6499-6506. Vanhaesebroeck B, Guillermet-Guibert J, Graupera M, Bilanges B. (2010). The emerging mechanisms of isoform-specific PI3K signalling. Nat Rev Mol Cell Biol 11: 329-341. Vanhaesebroeck B, Higashi K, Raven C, Welham M, Anderson S, Brennan P et al. (1999). Autophosphorylation of p110delta phosphoinositide 3-kinase: A new paradigm for the regulation of lipid kinases in vitro and in vivo. EMBO J 18: 1292-1302. Vanhaesebroeck B, Leevers SJ, Panayotou G, Waterfield MD. (1997a). Phosphoinositide 3kinases: A conserved family of signal transducers. Trends Biochem Sci 22: 267-272. Vanhaesebroeck B, Welham MJ, Kotani K, Stein R, Warne PH, Zvelebil MJ et al. (1997b). P110delta, a novel phosphoinositide 3-kinase in leukocytes. Proc Natl Acad Sci U S A 94: 43304335. 94  Vazquez-Martin A, Oliveras-Ferraros C, Barco SD, Martin-Castillo B, Menendez JA. (2010). The anti-diabetic drug metformin suppresses self-renewal and proliferation of trastuzumabresistant tumour-initiating breast cancer stem cells. Breast Cancer Res Treat . Vinh-Hung V, Verschraegen C. (2004). Breast-conserving surgery with or without radiotherapy: Pooled-analysis for risks of ipsilateral breast tumour recurrence and mortality. J Natl Cancer Inst 96: 115-121. Viniegra JG, Martinez N, Modirassari P, Losa JH, Parada Cobo C, Lobo VJ et al. (2005). Full activation of PKB/Akt in response to insulin or ionizing radiation is mediated through ATM. J Biol Chem 280: 4029-4036. Vogel CL, Cobleigh MA, Tripathy D, Gutheil JC, Harris LN, Fehrenbacher L et al. (2002). Efficacy and safety of trastuzumab as a single agent in first-line treatment of HER2overexpressing metastatic breast cancer. J Clin Oncol 20: 719-726. Wang X, Flynn A, Waskiewicz AJ, Webb BL, Vries RG, Baines IA et al. (1998). The phosphorylation of eukaryotic initiation factor eIF4E in response to phorbol esters, cell stresses, and cytokines is mediated by distinct MAP kinase pathways. J Biol Chem 273: 9373-9377. Wang Z, Zhang L, Yeung TK, Chen X. (1999). Endocytosis deficiency of epidermal growth factor (EGF) receptor-ErbB2 heterodimers in response to EGF stimulation. Mol Biol Cell 10: 1621-1636. Waskiewicz AJ, Flynn A, Proud CG, Cooper JA. (1997). Mitogen-activated protein kinases activate the serine/threonine kinases Mnk1 and Mnk2. EMBO J 16: 1909-1920. Waskiewicz AJ, Johnson JC, Penn B, Mahalingam M, Kimball SR, Cooper JA. (1999). Phosphorylation of the cap-binding protein eukaryotic translation initiation factor 4E by protein kinase Mnk1 in vivo. Mol Cell Biol 19: 1871-1880. Wee S, Wiederschain D, Maira SM, Loo A, Miller C, deBeaumont R et al. (2008). PTENdeficient cancers depend on PIK3CB. Proc Natl Acad Sci U S A 105: 13057-13062. Weidner KM, Arakaki N, Hartmann G, Vandekerckhove J, Weingart S, Rieder H et al. (1991). Evidence for the identity of human scatter factor and human hepatocyte growth factor. Proc Natl Acad Sci U S A 88: 7001-7005. Welm AL, Kim S, Welm BE, Bishop JM. (2005). MET and MYC cooperate in mammary tumourigenesis. Proc Natl Acad Sci U S A 102: 4324-4329. Wen XF, Yang G, Mao W, Thornton A, Liu J, Bast RC,Jr et al. (2006). HER2 signalling modulates the equilibrium between pro- and antiangiogenic factors via distinct pathways: Implications for HER2-targeted antibody therapy. Oncogene 25: 6986-6996. Wendel HG, Silva RL, Malina A, Mills JR, Zhu H, Ueda T et al. (2007). Dissecting eIF4E action in tumourigenesis. Genes Dev 21: 3232-3237.  95  Whitman M, Downes CP, Keeler M, Keller T, Cantley L. (1988). Type I phosphatidylinositol kinase makes a novel inositol phospholipid, phosphatidylinositol-3-phosphate. Nature 332: 644646. Wielenga VJ, van der Voort R, Taher TE, Smit L, Beuling EA, van Krimpen C et al. (2000). Expression of c-met and heparan-sulfate proteoglycan forms of CD44 in colorectal cancer. Am J Pathol 157: 1563-1573. Winer EP, Hudis C, Burstein HJ, Wolff AC, Pritchard KI, Ingle JN et al. (2005). American society of clinical oncology technology assessment on the use of aromatase inhibitors as adjuvant therapy for postmenopausal women with hormone receptor-positive breast cancer: Status report 2004. J Clin Oncol 23: 619-629. Woenckhaus J, Steger K, Werner E, Fenic I, Gamerdinger U, Dreyer T et al. (2002). Genomic gain of PIK3CA and increased expression of p110alpha are associated with progression of dysplasia into invasive squamous cell carcinoma. J Pathol 198: 335-342. Wojcik EJ, Sharifpoor S, Miller NA, Wright TG, Watering R, Tremblay EA et al. (2006). A novel activating function of c-src and Stat3 on HGF transcription in mammary carcinoma cells. Oncogene 25: 2773-2784. Woldeyesus MT, Britsch S, Riethmacher D, Xu L, Sonnenberg-Riethmacher E, Abou-Rebyeh F et al. (1999). Peripheral nervous system defects in erbB2 mutants following genetic rescue of heart development. Genes Dev 13: 2538-2548. Wolffe AP. (1994). Structural and functional properties of the evolutionarily ancient Y-box family of nucleic acid binding proteins. Bioessays 16: 245-251. Wong AS, Pelech SL, Woo MM, Yim G, Rosen B, Ehlen T et al. (2001). Coexpression of hepatocyte growth factor-met: An early step in ovarian carcinogenesis? Oncogene 20: 13181328. Worch J, Tickenbrock L, Schwable J, Steffen B, Cauvet T, Mlody B et al. (2004). The serinethreonine kinase MNK1 is post-translationally stabilized by PML-RARalpha and regulates differentiation of hematopoietic cells. Oncogene 23: 9162-9172. Wu J, Stratford AL, Astanehe A, Dunn SE. (2007). YB-1 is a Transcription/Translation factor that orchestrates the oncogenome by hardwiring signal transduction to gene expression. Translational Oncogenomics 2: 49-65. Wu G, Mambo E, Guo Z, Hu S, Huang X, Gollin SM et al. (2005). Uncommon mutation, but common amplifications, of the PIK3CA gene in thyroid tumours. J Clin Endocrinol Metab 90: 4688-4693. Wu J, Lee C, Yokom D, Jiang H, Cheang MC, Yorida E et al. (2006). Disruption of the Y-box binding protein-1 results in suppression of the epidermal growth factor receptor and HER2. Cancer Res 66: 4872-4879.  96  Wymann MP, Pirola L. (1998). Structure and function of phosphoinositide 3-kinases. Biochim Biophys Acta 1436: 127-150. Xia W, Mullin RJ, Keith BR, Liu LH, Ma H, Rusnak DW et al. (2002). Anti-tumour activity of GW572016: A dual tyrosine kinase inhibitor blocks EGF activation of EGFR/erbB2 and downstream Erk1/2 and AKT pathways. Oncogene 21: 6255-6263. Xiao GH, Jeffers M, Bellacosa A, Mitsuuchi Y, Vande Woude GF, Testa JR. (2001). Antiapoptotic signalling by hepatocyte growth factor/Met via the phosphatidylinositol 3-kinase/Akt and mitogen-activated protein kinase pathways. Proc Natl Acad Sci U S A 98: 247-252. Xu W, Mimnaugh E, Rosser MF, Nicchitta C, Marcu M, Yarden Y et al. (2001). Sensitivity of mature Erbb2 to geldanamycin is conferred by its kinase domain and is mediated by the chaperone protein Hsp90. J Biol Chem 276: 3702-3708. Xu W, Zhou L, Qin R, Tang H, Shen H. (2009). Nuclear expression of YB-1 in diffuse large Bcell lymphoma: Correlation with disease activity and patient outcome. Eur J Haematol 83: 313319. Yahata H, Kobayashi H, Kamura T, Amada S, Hirakawa T, Kohno K et al. (2002). Increased nuclear localization of transcription factor YB-1 in acquired cisplatin-resistant ovarian cancer. J Cancer Res Clin Oncol 128: 621-626. Yakes FM, Chinratanalab W, Ritter CA, King W, Seelig S, Arteaga CL. (2002). Herceptininduced inhibition of phosphatidylinositol-3 kinase and akt is required for antibody-mediated effects on p27, cyclin D1, and antitumour action. Cancer Res 62: 4132-4141. Yang J, Mani SA, Donaher JL, Ramaswamy S, Itzykson RA, Come C et al. (2004). Twist, a master regulator of morphogenesis, plays an essential role in tumour metastasis. Cell 117: 927939. Yang N, Huang J, Greshock J, Liang S, Barchetti A, Hasegawa K et al. (2008). Transcriptional regulation of PIK3CA oncogene by NF-kappaB in ovarian cancer microenvironment. PLoS One 3: e1758. Zarnegar R, Michalopoulos G. (1989). Purification and biological characterization of human hepatopoietin A, a polypeptide growth factor for hepatocytes. Cancer Res 49: 3314-3320. Zeng Q, Chen S, You Z, Yang F, Carey TE, Saims D et al. (2002). Hepatocyte growth factor inhibits anoikis in head and neck squamous cell carcinoma cells by activation of ERK and akt signalling independent of NFkappa B. J Biol Chem 277: 25203-25208. Zeng ZS, Weiser MR, Kuntz E, Chen CT, Khan SA, Forslund A et al. (2008). c-met gene amplification is associated with advanced stage colorectal cancer and liver metastases. Cancer Lett 265: 258-269. Zhang H, Liu G, Dziubinski M, Yang Z, Ethier SP, Wu G. (2008). Comprehensive analysis of oncogenic effects of PIK3CA mutations in human mammary epithelial cells. Breast Cancer Res 97  Treat 112: 217-227. Zhang L, Huang J, Yang N, Greshock J, Liang S, Hasegawa K et al. (2007). Integrative genomic analysis of phosphatidylinositol 3'-kinase family identifies PIK3R3 as a potential therapeutic target in epithelial ovarian cancer. Clin Cancer Res 13: 5314-5321. Zhang W, Ou J, Inagaki Y, Greenwel P, Ramirez F. (2000). Synergistic cooperation between Sp1 and Smad3/Smad4 mediates transforming growth factor beta1 stimulation of alpha 2(I)collagen (COL1A2) transcription. J Biol Chem 275: 39237-39245. Zhang X, Yang J, Li Y, Liu Y. (2005). Both Sp1 and smad participate in mediating TGF-beta1induced HGF receptor expression in renal epithelial cells. Am J Physiol Renal Physiol 288: F1626. Zhao JJ, Cheng H, Jia S, Wang L, Gjoerup OV, Mikami A et al. (2006). The p110alpha isoform of PI3K is essential for proper growth factor signalling and oncogenic transformation. Proc Natl Acad Sci U S A 103: 16296-16300. Zhao L, Vogt PK. (2008). Helical domain and kinase domain mutations in p110alpha of phosphatidylinositol 3-kinase induce gain of function by different mechanisms. Proc Natl Acad Sci U S A 105: 2652-2657. Zhu Q, Youn H, Tang J, Tawfik O, Dennis K, Terranova PF et al. (2008). Phosphoinositide 3OH kinase p85alpha and p110beta are essential for androgen receptor transactivation and tumour progression in prostate cancers. Oncogene 27: 4569-4579. Zhuang G, Brantley-Sieders DM, Vaught D, Yu J, Xie L, Wells S et al. (2010). Elevation of receptor tyrosine kinase EphA2 mediates resistance to trastuzumab therapy. Cancer Res 70: 299308. Zou JN, Wang SZ, Yang JS, Luo XG, Xie JH, Xi T. (2009). Knockdown of SMYD3 by RNA interference down-regulates c-met expression and inhibits cells migration and invasion induced by HGF. Cancer Lett 280: 78-85. Zsebik B, Citri A, Isola J, Yarden Y, Szollosi J, Vereb G. (2006). Hsp90 inhibitor 17-AAG reduces ErbB2 levels and inhibits proliferation of the trastuzumab resistant breast tumour cell line JIMT-1. Immunol Lett 104: 146-155.  98  CHAPTER 2: PROFILING YB-1 TARGET GENES UNCOVERS A NEW MECHANISM FOR MET RECEPTOR REGULATION IN NORMAL AND MALIGNANT HUMAN MAMMARY CELLS1  1  A version of this chapter has been published. Melanie R. Finkbeiner*, Arezoo Astanehe*, Karen To, Abbas Fotovati, Alastair H. Davies, Yang Zhao, Helen Jiang, Anna L. Stratford, Ashleen Shadeo, Carla Boccaccio, Paolo Comoglio, Peter R. Mertens, Peter Eirew, Afshin Raouf, Connie J. Eaves, and Sandra E. Dunn (2009). Profiling YB-1 target genes uncovers a new mechanism for MET receptor regulation in normal and malignant human mammary cells. Oncogene 28, 1421-1431. * These authors contributed equally.  99  2.1 OVERVIEW Basal-like breast cancers (BLBCs) are aggressive tumours with high relapse rates and poor survival. We recently reported that >70% of primary BLBCs express the oncogenic transcription/translation factor Y-box binding protein-1 (YB-1) and silencing it with small interfering RNAs (siRNAs) attenuates the growth of BLBC cell lines. To understand the basis of these earlier findings, we profiled YB-1:DNA complexes by chromatin immunoprecipitation (ChIP)-on-chip. Several tumour growth-promoting genes such as MET, CD44, CD49f, WNT and NOTCH family members were identified. In addition, YB-1 and MET are coordinately expressed in BLBC cell lines, as well as in normal human mammary progenitor cells. MET was confirmed to be an YB-1 target through traditional ChIP and gel-shift assays. More specifically, YB-1 binds to -1018 bp on the MET promoter. Silencing YB-1 with siRNA decreased MET promoter activity, transcripts, as well as protein levels and signalling. Conversely, expressing wild type YB-1 or a constitutively active mutant YB-1 (D102) increased MET expression. Finally, silencing YB-1 or MET attenuated anchorage-independent growth of BLBC cell lines. Together, these findings implicate MET as a target of YB-1 that work in concert to promote BLBC growth.  2.2 INTRODUCTION Basal-like breast cancers (BLBCs) remain one of the greatest challenges in oncology given that the probability of survival beyond 2 years is only 30% (Sorlie et al., 2001). Because BLBCs do not express estrogen receptors (ERs), progesterone receptors (PRs) or HER2, they are unresponsive to anti-estrogens (Dunn and Ford, 2007) or Herceptin that target these gene products (Colozza et al., 2007). Therefore, much effort is now focused on identifying new molecular targets in BLBCs. One target of current interest is the transcription/translation factor Y-box binding protein-1 (YB-1) because of its documented high expression in approximately 70% of BLBCs (Stratford et al., 2007) and its association with poor survival (Habibi et al., 100  2008). YB-1 is consistently associated with high rates of relapse in virtually all breast cancer subtypes including BLBC (Habibi et al., 2008). Complimenting the strength of YB-1 as a biomarker of aggressive cancer we reported that inhibiting it with siRNAs attenuates the growth of BLBC cell lines (Lee et al., 2008). YB-1 is known to stimulate cell growth by binding to inverse CAAT boxes of many genes, thereby inducing their expression. Examples include EGFR (epidermal growth factor receptor), HER2, and TOPOII (topoisomerase 2) (Okamoto et al., 2000; Wu et al., 2006). It has been suggested that such YB-1-mediated activation of EGFR transcription also promotes the growth of BLBCs (Wu et al., 2006). The induction of EGFR expression is dependent on phosphorylation of YB-1 at S102 (Stratford et al., 2007; Wu et al., 2006) which is achieved by serine/threonine kinases AKT (Sutherland et al., 2005) or RSK (Stratford et al., 2008) leading to nuclear translocation. Importantly, nuclear YB-1 has been reported in many instances to be a universal biomarker for drug resistance thus understanding how it regulates gene expression is essential (Kuwano et al., 2004). Given this, it is of particular interest to identify target genes responsible for the growth dysregulation of YB-1 overexpressing BLBC cells. Another gene associated with poor outcomes and a greater risk of metastasis in BLBCs is MET (Welm et al., 2005). The MET gene encodes a cell surface tyrosine kinase receptor for hepatoctye growth factor (HGF, also known as scatter factor). HGF is a pleiotropic cytokine with pro-migratory, anti-apoptotic, and mitogenic activities (Birchmeier et al., 2003; Leo et al., 2007; Trusolino and Comoglio, 2002). Once activated, MET can promote cancer cells to proliferate and migrate and it has thus become another potential therapeutic target (Yoshida et al., 2004). To understand how YB-1 regulates growth of BLBC at the transcriptional level, we performed genome-wide chromatin immunoprecipitation (ChIP) on chip (COC) analyses using promoter arrays. These revealed a subset of YB-1 target genes associated with the basal-like signature including MET and other genes expressed by normal progenitor and malignant 101  mammary cells such as CD44, CD49f and several members of the NOTCH and WNT families. Further studies were then undertaken to investigate how YB-1 regulates MET expression.  2.3 RESULTS 2.3.1 COC SUGGESTS YB-1 REGULATES MET COC was undertaken to systematically identify a full list of potential targets of YB-1 in SUM149 BLBC cells. The results revealed that YB-1 potentially interacts with >6000 candidate promoters. A high proportion of these encode enzymes, kinases, transporters and known or potential growth factor receptors (Figure 2.1a). Notable amongst the latter was MET (Table 2.1). CD44 (Orian-Rousseau et al., 2002) and CD49f (Trusolino et al., 2001) were also found to be potential YB-1 target genes and notably both are previously reported to bind to and enhance MET activation (Boccaccio and Comoglio, 2006). Several members of the NOTCH and WNT pathways were also identified (Table 2.1). Their potential functional relationships to one another in terms of signal transduction activation are illustrated using Ingenuity Pathway Analysis software (Figure 2.1b). We highlight that two major signalling nodes are created using this approach; one that involves the MET/CD44/CD49f signalling complex and the other that includes WNT/NOTCH interactions. While it is beyond the scope of this work to validate all YB-1 target genes associated with these signalling networks, this preliminary analysis does suggest that there are common features of YB-1 responsive genes that could have an important bearing on cell growth control.  2.3.2 P-YB-1S102 AND MET ARE COORDINATELY EXPRESSED IN BLBC CELL LINES To investigate if there is a relationship between levels of MET and YB-1 protein, a panel of breast cancer cell lines was screened. Levels of total YB-1 protein were consistent across all 102  cell lines, but P-YB-1S102 levels were higher in BLBC cells (Figure 2.2a). Strikingly, MET was expressed exclusively in BLBC cell lines (Figure 2.2a). Like many transcription factors, YB-1’s access to the genome is governed by phosphorylation (Sutherland et al., 2005). Herein we show that P-YB-1S102 was intensely expressed in the nucleus of SUM149 and MDA-MB-231 cells. MET was also expressed at considerable levels in both SUM149 and MDA-MB-231 based on immunofluorescence (Figure 2.2b). This was further confirmed by immunoblotting (data not shown).  2.3.3 TOTAL YB-1 AND MET ARE CO-EXPRESSED IN NORMAL HUMAN MAMMARY PROGENITOR CELLS We asked whether YB-1 transcripts are present in populations of the most primitive normal human mammary progenitors that can be reproducibly isolated at high purities (30-50% (Raouf et al., 2008); i.e., bipotential progenitors that produce mixed colonies containing both mature luminal and myoepithelial cell progeny. Suspension cultures containing bipotent progenitors were isolated from freshly thawed aliquots of reduction mammoplasty cells taken from three different individuals. The mRNA from these samples was amplified for YB-1 and MET by qRT-PCR. In addition, we evaluated the expression of YB-1 and MET in mammoplasty cells that were isolated and subsequently cultured for three days in media that specifically enriches for progenitors where the proportion of progenitors increased from ~5% in the freshly thawed isolates to 30-50% in the selective media. YB-1 and MET mRNA were expressed in the bipotential progenitor populations regardless of the culturing method (Figure 2.2c). However, the levels of YB-1 transcripts in these cells were up to 2000 times lower than in the cancer cell lines and the levels of MET mRNA were as much as 300 times lower (data not shown). Nevertheless, there was a strong correlation (r2=0.8785) between the levels of YB-1 and MET mRNA in the normal progenitor-enriched samples (Figure 2.2d). This indicates for the first time that YB-1 and 103  MET transcripts are both detectable in a very primitive normal mammary subpopulation albeit at very low levels compared to cancer cell lines.  2.3.4 VERIFICATION THAT YB-1 BINDS TO THE PROMOTER OF MET To obtain more direct evidence that YB-1 binds to the MET promoter in BLBC cells, traditional ChIP experiments were carried out on extracts of three BLBC (SUM149, MDA-MB213 and MDA-MB-468) cell lines, as well as, from a primary tumour that developed from SUM149 cells injected into a NOD/SCID mouse. PCR amplifications were performed using 3 primer sets designed to flank potential YB-1 binding sites on the MET promoter referred to as MET 1, MET 2 and MET 3 (Figure 2.3a, top). YB-1:MET promoter binding was validated using MET 1 primers and this was evident in each of the BLBC cell lines and the xenograft cells (Figure 2.3a, bottom left). Yet the putative YB-1-responsive elements (YREs) that would have been amplified by MET 2 and MET 3 primers were not authentic binding sites based on a lack of amplification (Figure 2.3a, bottom right). Using this strategy, we localized YB-1 binding sites to the MET 1 region that contains six potential binding sites. To determine which of the potential YB-1 binding sites was most important, five oligonucleotides (oligo 2 contained two YREs in close proximity to one another) were designed to the putative binding sites in the MET 1 region and EMSA was then performed (data not shown). The results of these assays revealed that oligo 1 (-1151 to -1180) and 4 (-1006 to -1035) elicited the strongest shifts in the presence of a nuclear extract from SUM149 cells (Figure 2.3b). This was confirmed with MDA-MB-231 nuclear extracts (data not shown). Both oligos showed a strong supershift with the addition of YB-1 antibody but not a cyclic AMP response element binding-protein (CREB) antibody, indicating specificity of YB-1 binding. Furthering this observation, mutation of the YRE in oligo 4 resulted in loss of binding, whereas this was not the case with oligo1 (Figure 2.3c). Therefore, it can be  104  concluded that a bona fide YRE on the MET promoter resides -1018 bp upstream of the translational start site while YB-1 binding to the oligo 1 region must be indirect. To investigate this apparent association further, the introduction of either Flag:YB-1 or constitutively active Flag:YB-1(D102) increased MET protein levels in SUM149 and HCC1937 cells compared to the empty vector yet the inactive A102 mutant did not (Figure 2.4a). The introduction of siRNA designed to silence YB-1 reduced MET protein and mRNA expression by 40-60% in SUM149 and MDA-MB-231 cells (Figure 2.4b-c). Similarly, stable inhibition of YB1 using a shYB-1 approach suppressed expression of MET protein and mRNA (Figure 2.4b-c). The same effect was observed when cells were infected with a lentiviral vector expressing shYB1 (Supplementary Figure S2.1). In all of these studies, MET mRNA decreased by ~50%. Consistent with this finding, treatment of cells with siYB-1 #2 caused a 54% reduction in MET promoter activity (Figure 2.4d). In contrast, wild type YB-1 and Flag:YB-1(D102) increased MET promoter activity, whereas Flag:YB-1(A102) did not (Figure 2.4e). Likewise, treating SUM149 cells with the PDK-1 inhibitor OSU-03012 for 6 hrs decreased P-AKTS473, P-YB-1S102 and attenuated MET protein (Figure 2.4f, left) and mRNA (Figure 2.4f, right). Thus, inhibiting a major signal transduction pathway known to activate YB-1 also perturbs MET protein expression (To et al., 2007). These data provide evidence that YB-1 phosphorylation is important for its control of MET expression.  2.3.5 SILENCING YB-1 OR MET WITH siRNA INHIBITS HGF-STIMULATED SIGNALLING AND ANCHORAGE-INDEPENDENT GROWTH Because HGF is the major ligand for MET receptor, we expected that inhibiting YB-1 would interfere with this important signalling pathway. In support of this idea, silencing YB-1 for 96 hrs inhibited HGF-mediated signalling through MET given that GAB1 phosphorylation was suppressed (Figure 2.5a). Silencing YB-1 with siYB-1#3 remarkably suppressed the expression 105  of the MET receptor and therefore HGF-induced signalling through GAB1. We also silenced MET itself as a positive control to show that HGF must use this receptor to elicit signalling through GAB1 (Figure 2.5a). Of note, partial suppression of MET with siYB-1#2 was not enough to fully block HGF-induced signalling. This is likely because there was enough residual MET receptor present to transmit the signal. Taken together, these results indicate that expression and activity of MET in BLBC cells is at least partly dependent on YB-1. To study the effect of YB-1 and MET knockdown on proliferative activity of BLBC cell lines, the clonogenic ability of siRNA-treated SUM149 and MDA-MB-231 cells in soft agar assays was analyzed in cultures enriched with HGF. Both cell lines showed greater sensitivity to the loss of YB-1 than MET interference, with up to a 90% reduction in colony-forming ability by siYB-1 #2-treated SUM149 cells (Figure 2.5b). However, a reduction of up to 57% in clonogenic ability of these cells was seen when MET was directly targeted. MDA-MB-231 cells were slightly less sensitive to either of these treatments (72% reduction with siYB-1 #2 and 34% with siMET, Figure 2.5c). These data indicate that disruption of YB-1 leads to a remarkable suppression of anchorageindependent growth, some of which is attributable to loss of MET expression. Our data collectively supports the idea that MET is transcriptionally up-regulated by YB1 in BLBC. One could argue that high levels of MET may be due to gene amplification. To begin to address this, we performed comparative genomic hybridization on MDA-MB-231 and reported that amplifications were not found at 7q31.1 where the MET gene resides (Shadeo and Lam, 2006). Similarly, MET is not commonly amplified in primary BLBC based on analysis of ten tumours (Supplementary Figure S3.2). These findings do not support a role of gene amplification causing increased MET expression that is characteristic of these cells and reinforce the potential importance of other mechanisms such as YB-1-mediated up-regulation.  106  2.4 DISCUSSION In this study, we present results of the first global COC analysis of genes potentially regulated by YB-1 in BLBC cells. This analysis revealed approximately 6000 candidate targets including many genes encoding growth factor receptors and their signalling intermediates. One of these was MET, which encodes the tyrosine kinase cell surface receptor for HGF and has been previously implicated in primary human BLBCs (Charafe-Jauffret et al., 2006). In addition, forced over-expression of MET together with MYC in murine mammary cells has been found to produce BLBC in mice (Welm et al., 2005). While many aspects of MET activity have been well studied (Comoglio et al., 2008), surprisingly little has been uncovered about its transcriptional regulation with the exception of evidence for a role of ETS (Gambarotta et al., 1996), hypoxia inducible factor-1 a (Pennacchietti et al., 2003) and β-catenin (Boon et al., 2002). In the studies described herein, using traditional ChIP and EMSA, we now demonstrate that MET expression is transcriptionally up-regulated in BLBC cells by direct binding of YB-1 to the MET promoter at – 1018 bp from the transcriptional start site. In addition, we showed that inhibition of YB-1 in these cells decreased MET mRNA and protein levels, and attenuated HGF-induced signalling. Interestingly, examination of MET expression in different breast cancer cell lines showed MET to be up-regulated in four BLBC cell lines, but not in the three representative luminal and HER2 expressing cell lines tested. Further, our data suggest that MET signalling is important to the growth of BLBC cells, based on the level of suppression of BLBC colony formation obtained from siRNA-treated cells. These results provide strong support for an important role of MET as a downstream effecter of YB-1-mediated transformation of BLBC cells. Our present finding indicates that primary samples of this subgroup of breast cancer do not show amplification of the MET gene, in spite of their up-regulated expression of MET expression (Charafe-Jauffret et al., 2006; Welm et al., 2005). This observation underscores the likelihood that this is a downstream  107  consequence of the enhanced expression and trans-regulatory activity of YB-1 on the MET promoter. It should be noted that inhibiting YB-1 consistently had a greater effect on attenuating MET protein than it did on modulating MET mRNA levels. For example, when YB-1 expression was stably inhibited with shRNA, the levels of MET protein became virtually undetectable, yet MET mRNA was reduced by only ~40-50%. This observation was confirmed using two different MET receptor antibodies. Consistent with these results, silencing YB-1 with a lentiviral shRNA vector yielded identical findings; the levels of MET protein were inhibited to a greater extent than could be explained by changes in mRNA. While we demonstrate herein that the MET promoter is a direct target of YB-1, it may also influence its translation. Thus, additional regulatory avenues need to be explored to more fully understand the relationship between YB-1 and MET. As predicted by such a model, inhibiting YB-1 also markedly suppressed the growth of the BLBC cells under anchorage-independent conditions. Indeed, the inhibition obtained was even greater than that achieved by inhibiting MET alone, consistent with the COC findings indicating likely effects of YB-1 on other genes important for the growth of BLBC cells. These data suggest that targeting MET, as well as, YB-1 could be useful therapeutic strategies for improving the treatment of BLBC in patients. In this regard, it is interesting to note that inhibitors of MET are already available and in clinical trials for other types of cancer (Comoglio et al., 2008). Our group is actively developing inhibitors to YB-1. Some of the other genes that YB-1 bound reportedly have stem/progenitor associations; e.g., CD44, CD49f, c-KIT, BMI-1, and both NOTCH and WNT pathway elements (Mani et al., 2008; Raouf et al., 2008; Shipitsin et al., 2007; Stingl et al., 2006). It is interesting to note that high expression of many of these genes has also been associated with human breast cancer cells that have an ability to initiate tumour formation in immunodeficient mice (Al-Hajj et al., 2003; 108  Dontu et al., 2004; Farnie et al., 2007). It might be speculated, therefore, that heightened expression of YB-1 is a key mechanism used by normal mammary stem cells to maintain their primitive status and one that is used and/or high jacked by breast cancer stem cells. Further validation of the genes that YB-1 regulates in normal and malignant breast cells should therefore be of interest to understand why YB-1 expression correlates so strongly with breast cancer recurrence.  2.5 MATERIALS AND METHODS Cell lines SUM149 cells were obtained from Asterand (Ann Arbor, MI) and grown according to the supplier's recommendations. HCC1937 cells were obtained from Dr. W.D. Foulkes (McGill University, Montreal, Quebec, Canada) and were cultured in RPMI-1640 (Invitrogen, Burlington, ON, Canada) supplemented with 10 mM HEPES pH 7.6, 4.5 g/L glucose (Sigma, Oakville, ON, Canada), 1 mM sodium pyruvate (Sigma) and 10% FBS. BT474-M1 cells were obtained from Dr. Mien-Chie Hung (University of Texas, M.D. Anderson Cancer Center, Houston, TX, USA). All other breast cancer cell lines were purchased from the American Tissue culture collection (Rockwood MD) and cultured as recommended.  ChIP-on-chip (COC) SUM149 cells were grown to 80% confluency on 15-cm diameter plates (8 x 106 cells). ChIP was performed on the pooled lysates from 12 plates of cells. YB-1:DNA complexes were isolated as previously described (Wu et al., 2006) using an anti-chicken antibody (Dr. Isabella Berquin, Wake Forest University, North Carolina, USA). Following elution of the DNA from the beads, the DNA was amplified using the protocol provided by NimbleGen (additional details can 109  be found in the supplemental Materials and Methods). From the ChIP-on-chip hybridization, a list of accession numbers of genes with promoters to which YB-1 potentially binds was generated.  Using  the  National  Center  for  Biotechnology  Information  website  (http://www.ncbi.nlm.nih.gov/), the accession numbers were decoded and all genes with a greater than log 2-fold change were identified. Data was analyzed using Ingenuity Pathway Analysis software (Redwood City, CA, USA).  Immunoblotting Breast cancer cell lines were harvested and immunoblotting performed as described previously (Wu et al., 2006) by probing blots with antibodies against MET (Santa Cruz Biotechnology clone C-12, Santa Cruz, CA, USA), P-YB-1S102 (Cell Signalling Technologies (CST), Danvers, MA, USA) and total YB-1 (Abcam, Cambridge, MA, USA). Transient transfections were performed with 2 µg of empty vector, Flag:YB-1(WT), Flag:YB-1(D102) or Flag:YB-1(A102) into SUM149 or HCC1937 cells as previously described (Sutherland et al., 2005) and 72 hours later MET receptor levels were evaluated by immunoblotting. Flag YB-1 was detected with an anti-Flag antibody (Sigma) and total YB-1 levels were determined. Actin (CST) was used as a loading control. YB-1 knockdowns were performed as described below, proteins harvested after 96 hours, immunoblotted, and MET and YB-1 levels determined using Vinculin (Sigma clone Vin 11-5, V4505 antibody) or actin as loading controls. Intensity of the signals was quantified using ImageJ 1.38X image analyzing software.  Immunocytochemistry for P-YB-1S102 SUM149 and MDA-MB-231 cells (1.0x105) were seeded on glass coverslips, washed with phosphate-buffered saline (PBS), fixed with 2% formaldehyde for 20 min, rinsed twice with  110  PBS, and then incubated with PBS containing 0.1% Triton X-100 (Sigma) for 30 min. Next, the coverslips were washed with PBS, incubated with rabbit anti-MET (Santa Cruz Biotechnology clone C-12, Santa Cruz, CA, USA) or anti-P-YB-1S102 (CST) antibodies dissolved in buffer containing 10% BSA and 2% goat serum for 1 hour at room temperature in a humidified container. After washing three times with PBS, glass slides were incubated with Alexa 488 antirabbit antibody for 1 hour, washed three times and then mounted using Vectashield mounting medium (Vector Laboratories, CA, USA). DAPI was used for nuclear staining.  Isolation of primary progenitor cells. Bipotent progenitor-enriched fractions were isolated from freshly thawed vials of three reduction mammoplasty samples, as previously described (Eirew et al., 2008) (see supplemental materials and methods for more detail). We also isolated bipotent progenitor-enriched fractions from 3 different reduction mammoplasty samples, as previously described (Raouf et al., 2008). To assess transcript levels of YB-1 and MET, 40 to 60 ng of RNA from each sample were reverse transcribed into cDNA as described (Zhao et al., 2007). For comparison, RNA was isolated from MDA-MB-231, MDA-MB-468, HCC1937, and SUM149 cells grown in log phase using the Qiagen RNeasy Mini Kit (Qiagen, Mississauga, ON, Canada) and its prescribed protocol. 1 µg of extracted RNA was reverse-transcribed using Superscript III Reverse Transcriptase and its prescribed protocol (Invitrogen). QRT-PCR (7000 Sequence Detection System, Applied Biosystems, Streetsvile, ON, Canada) was performed using TaqMan Gene Expression Assays designed  against  human  YB-1  (Custom  TAMRA  probe,  sequence:  6FAM-  AAGCCCGGCACTACGGGCAGC-TAMRA, Applied Biosystems), human MET (Assay ID: Hs00179845_m1, Applied Biosystems), and human TATA-box binding protein (TBP) as an endogenous control (Part No. 4326322E, Applied Biosystems). Relative expression of YB-1 and MET transcript levels was determined by normalizing to TBP. 111  Traditional Chromatin Immunoprecipitation (ChIP) SUM149 and HCC1937 cells were grown until 90% confluent in a 15-cm dish (1 x 107 cells) and ChIP was performed as previously described (Wu et al., 2006) to isolate the YB-1promoter complexes. Fifteen potential YB-1 binding sites were identified on the first 2 kb of the MET promoter. Therefore we designed three sets of primers to narrow down where YB-1 binds to the MET promoter using ChIP. PCR was carried out using 6 µl of purified DNA. Primer sequences were as follows: MET1: TTGACCTTCACACACCCAGAT (forward) TTCTGAGTTTGAGTGCCATGA (reverse) MET2: TCATGGCACTCAAACTCAGAA (forward) CCAGTCAGGTGTCCTTCACA (reverse) MET3: GCAAAATGGTTCAATGCAAG (forward) GGGCCTCGGTGAACTCTATT (reverse) PCR conditions were optimized for the primer sets as follows: 94°C for 3 minutes, 40 cycles of 94°C for 30 seconds, 58°C for 30 seconds and 70°C for 30 seconds, followed by 70°C for 10 minutes. PCR products were visualized by agarose gel electrophoresis (2% gel) and DNA stained with ethidium bromide (Invitrogen, Burlington, ON, Canada). The YB-1:MET promoter complex was also chromatin immunoprecipitated from a SUM149 xenograft. Briefly, NOD/SCID mice were injected with 5x105 cells into the mammary fat pad and the tumours were allowed to develop over a 14-week period. Endogenous YB-1 was subjected to ChIP from the SUM149 xenografts as previously described by us (To et al., 2007) and the DNA was amplified for MET promoter binding using the primers indicated above.  112  Electrophoretic mobility shift assay (EMSA) Nuclear proteins were isolated from SUM149 and MDA-MB-231 cells using NE-PER extraction kit (Pierce Biotechnology, Rockford, Illinois, USA) according to the manufacturer’s protocol. The Lightshift Chemiluminescent EMSA kit (Pierce Biotechnology) was used to perform EMSAs using oligonucleotides corresponding to potential YB-1 binding sites according to our previously published methods (Stratford et al., 2007). Briefly, binding reactions contained 1x binding buffer, 50 ng/µl poly dIdC, 20 fmol biotin-labelled double stranded DNA and 6 µg nuclear extract. Unlabelled oligonucleotide (16 pmol) was used as competition. Chicken antiYB-1 antibody (1 µg) was used to determine YB-1 involvement and CREB antibody (1 µg) acted as a negative control. Oligo1: TAACCCATGACTTTCAATAACGAAGATATC Oligo 1 mutant: TAACCCATGACTTTCCCCAACGAAGATATC Oligo 4: ACTCTTGTAGGTGCCAATTTTTATAGCGAA Oligo 4 mutant: ACTCTTGTAGGTGCCCCCTTTTATAGCGAA  Inhibition of YB-1 and MET using siRNA or OSU-03012 The siRNAs targeting YB-1 or MET were diluted in 500 µl serum-free OPTI-MEM (Invitrogen) to achieve a final concentration of 20 nM and 6 µl Lipofectamine RNAiMAX (Invitrogen) was then added. The mixtures were incubated at room temperature for 20 minutes in wells of a 6-well plate to each of which 4 x 105 cells were then added in 2 ml of media. After 96 hours, cells were harvested. Small inhibitory RNAs targeting YB-1, referred to as siYB-1#2, and siYB-1#3, were obtained from Dharmacon (Lafayette, CO, USA) as previously described (Stratford et al., 2007), and Qiagen (Catalog number SI03019191) respectively. The siMET oligonucleotide was obtained from Qiagen (Catalog number SI00604821). Stable knockdowns 113  were performed using shYB-1 previously described (van Roeyen et al., 2005) in the SUM149 cells. SUM149 cells were seeded at 85% confluence into 6-well plates 24-hours before OSU03012 treatment. OSU-03012 was added into the media to achieve final concentrations of 10 µM. Equal volumes of DMSO were added as vehicle control treatments. SUM149 cells were harvested at 6 hours of OSU-03012 treatment. Western blotting and RT-PCR analyses were performed as previously described (To et al. 2007). At later time points, OSU-03012 killed the cells; therefore we were not able to collect the cells after longer exposure times.  Luciferase assays To determine the effect of YB-1 expression on MET promoter activity –3.1kB portion of the receptor was cloned into a pGL2 reporter (Gambarotta et al., 1996). Forty-eight hours (MDA-MB-231 cells) or 72 hours (SUM149 cells) after siRNA treatment, cells were transfected with this MET promoter construct, a renilla expression vector, pRL-TK (Promega, Madison, Wisconsin, USA), or an empty vector. After an additional 48 hours (MDA-MB-231 cells) or 24 hours (SUM149 cells), cells were harvested in 1x Passive Lysis buffer (Promega) and luciferase activity was measured using the Dual Luciferase kit (Promega). Additional cells were lysed in ELB buffer with protease inhibitor cocktail to check for evidence of YB-1 knockdown. Experiments were performed in triplicate on two separate occasions and results were averaged.  YB-1 over-expression and site-directed mutagenesis Over-expression of wild type and mutated YB-1A102 was performed as previously described (Sutherland et al., 2005). The YB-1 S102D was generated by site-directed mutagenesis (Stratagene, Windsor, ON, USA) of the WT-YB-1 construct using the following 114  primer: 5’-ccaggaagtaccttcgcgatgtaggagatggagagactgtgg-3’. These three constructs have the 3x FLAG tag. The plasmid transfections were performed with 2 µg of DNA and Lipofectamine 2000 (Invitrogen), and maintained for 72-96 hours.  Effect of siYB-1 on MET receptor signalling and tumour cell growth in soft agar In order to understand the impact of silencing YB-1 expression on HGF-dependent stimulation of MET receptor signalling, MDA-MB-231 cells were exposed to siYB-1#2 or siYB1#3 for 96 hours. Cells were then serum starved over night and then stimulated for 15 minutes with HGF (20 ng/ml). Proteins were isolated and evaluated for changes in the MET receptor adaptor protein P-GAB1(Y307) (Sachs et al., 2000) (CST, cat number 3234). Total GAB1 was used as a loading control (CST, Cat 3232). To study anchorage independent growth, cells were plated at a density of 1 x 104 cells/well (SUM149 cells) and 2.5 x 103 cells/well (MDA-MB-231 cells) in a 24-well plate in 0.6% agar plus 40 ng/ml HGF (R&D Systems, Minneapolis, MN) on top of a 1.2% cell-free agar. After 28 days, colonies were counted. Experiments were performed in replicates of four on two separate occasions and results averaged.  2.6 ACKNOWLEDGEMENTS This project was funded by the Canadian Breast Cancer Research Alliance (awarded to SED) and the National Institute of Health (RO1 awarded to SED). A Astanehe, K To and A Davies are recipients of Michael Smith Foundation for Health Research Graduate Studentships. A Astanehe and K To are recipients of Canadian Institute for Health Graduate Studentships. A Stratford holds a Canadian Breast Cancer Foundation Postdoctoral Fellowship. P Eirew is the recipient of the US Department of Defense Breast Cancer Research Program Studentship, the Terry Fox Foundation Research Studentship from the National Cancer Institute of Canada, the  115  Canadian Imperial Bank of Commerce Inter- disciplinary Award and the Canadian Stem Cell Network Studentship.  116  2.7 TABLES Gene Name BMI-1 CD44  CD49f (ITGA6) C-KIT MET NOTCH2 NOTCH3 NOTCH4 P21/CDKN1A/CIP1 WNT1 WNT2B WNT4 WNT3A WNT5B WNT10A WNT11 WNT16  Accession Number NM_005180 NM_000610, NM_001001389, NM_001001390, NM_001001391, NM_001001392 NM_000210 NM_000222 NM_000245 NM_024408 NM_000435 NM_004557 NM_000389, NM_078467 NM_005430 NM_024494 NM_030761 NM_033131 NM_032642 NM_025216 NM_004626 NM_057168  Fold Change 3.5 2.6  5.3 3.8 6.6 2.4 8.3 11.9 7.1 4.7 9.4 6.9 4.9 5.5 7.2 4.3 6.4  Table 2.1: Select putative YB-1 target genes identified in the COC screen that are common to one another in that they are each associated with a stem cell signature. From this list of genes, the MET receptor was selected for validation because it forms a network with other proteins in this list such as CD44 and CD49f.  117  YB-1 induces MET in BLBC MR Finkbeiner et al  2.8 FIGURES  3 Functional groups Ligand Dependent Nuclear Receptor Translation Regulator Cytokine Growth Factor Phosphatase Ion Channel Transmembrance Receptor G-Protein Coupled Receptor Peptidase Transporter Kinase Transcription Regulator Enzyme Other  Functional Group Number of Genes Ligand Dependent Nuclear Receptor Translation Regulator Growth Factor Cytokine  19 24 65 68  Phosphatase Transmembrane Receptor Ion Channel  101 144  Peptidase  189  G-Protein Coupled Receptor Kinase Transporter  225 267 391  Transcription Regulator Enzyme Other  530 892 3551  Total Genes  6552  WNT11  WNT3A WNT2B WNT16 WNT4  WNT5B WNT10A WNT1 NOTCH3 NOTCH2  KIT  CD49f MET CD44  86  CDKN 1A  BMI 1  Figure 1 Categorization of YB-1 COC data into functional groups and schematic presentation of the possible interactions among the select genes that are linked to primitive cells and tumor initiation. (a) Genes were grouped into 15 functional categories. The largest known group was represented by genes that encode enzymes using Ingenuity Pathway Analyses. Enumeration of the genes in each category is found the list. (b) From the B6000 potential YB-1 targets by COC, a group of genes involved in self-renewal Figure 2.1:in Categorization of YB-1 COC dataidentified into functional groups and schematic and tumor initiation were identified. The way in which the protein products of these genes interact with one another and thereby presentation the possible interactions among the select genes that signaling are linked influence cell signalingof is depicted. From this analysis, it is clear that there are several members of two common nodes thatto are potentially regulated YB-1.tumour These nodes involve MET/CD44/CD49f and the WNT/NOTCH networks. Solid arrows indicate direct primitive cellsbyand initiation. interactions, whereas broken arrows represent indirect relationships. COC, ChIP-on-chip.  (a) Genes were grouped into 15 functional categories. The largest known group was represented by genes that encode enzymes using Ingenuity Pathway Analyses. Enumeration of the genes in YB-1-responsive elements that would have been amplibut not a cyclic AMP response-element binding (CREB) each category is found in the list. (b) From the ~6000 potential YB-1 targetstheidentified fied by the MET 2 and MET 3 primers were not protein antibody, indicating specificitybyofCOC, the YB-1 a group of sites genes involved in ofself-renewal tumour initiation identified. The way of in the authentic binding based on lack amplificationand binding. Furtheringwere this observation, mutation (Figurewhich 3a, bottom, right). Using of this strategy, YB-1-responsive element oligo 4 influence resulted incell loss of the protein products these genes we interact with one another andinthereby localized YB-1 binding sites to From the MET region thatit is binding, whereas not members the case with oligo 1 signalling is depicted. this1 analysis, clear that there this are was several of two contains six potential binding sites. To determine which (Figure 3c). Therefore, it can be concluded that a bona signalling potentiallyfideregulated by YB-1. These nodes involve of the common potential YB-1 binding nodes sites wasthat mostare important, YB-1-responsive element on the MET promoter MET/CD44/CD49f and the WNT/NOTCH networks. Solid arrows indicate direct interactions five oligonucleotides (oligo 2 contained two YB-1resides À1018 bp upstream of the translational start responsive elements in close proximity to indirect one another) site while YB-1 binding to the oligo 1 region must be whereas broken arrows represent relationships. were designed to the putative binding sites in the MET 1 region and electrophoretic mobility shift assay (EMSA) was then performed (data not shown). The results of these assays revealed that oligo 1 (À1151 to À1180) and 4 (À1006 to À1035) elicited the strongest shifts in the presence of a nuclear extract from SUM149 cells (Figure 3b). This was confirmed with MDA-MB-231 nuclear extracts (data not shown). Both oligos showed a strong supershift with the addition of the YB-1 antibody  indirect. To investigate this apparent association further, the introduction of either Flag:YB-1 or constitutively active Flag:YB-1(D102) increased MET protein levels in SUM149 and HCC1937 cells compared with the empty vector, yet the inactive A102 mutant did not (Figure 4a). The introduction of siRNA designed 118 to silence YB-1 reduced MET protein and mRNA expression by 40–60% in SUM149 and MDA-MB-231 cells  YB-1 induces MET in BLBC MR Finkbeiner et al  5 8 3 1 46 45 23 1 BBB- 937 9 M 4 -M 1 -M -M C1 74 F-7 A A A M 4 D C D D M M SU BT M HC M  MET P-YB-1S102 T-YB-1 SUM149  MDA-MB-231  Relative transcript levels normalized to endogenous TBP transcript levels  p-YB-1  YB-1  Pre-cultured  10  p-YB-1  c-MET  MET  Fresh Thaw  10  1  1  0.1  0.1  0.01  0.01  0.001  0.001  0.0001  0.0001 1  2  3  1  Patient Bipotent Progenitor Sample  Relative MET transcript levels normalized to endogenous TBP transcript levels  c-MET  2  3  Patient Bipotent Progenitor Sample  10 Bipotent progenitors isolated from fresh thaw, n=3  1  Bipotent progenitors isolated from pre-culturing, n=3  y = 938.56x1.3012 0.1 0.0001  R2 = 0.8785 0.001  0.01  0.1  Relative YB-1 transcript levels normalized to endogenous TBP transcript levels  Figure 2 YB-1 and MET receptor expression levels are positively correlated in basal-like breast cancer (BLBC) cell lines and primary normal mammary progenitor Investigation of MET and YB-1 protein levels are in a positively panel of breast cancer cellin lines Figure 2.2: cells. YB-1(a)and MET receptor expression levels correlated basalcorresponding to BLBC, HER-2 overexpressing and luminal subtypes. This comparison included four BLBC cell lines (SUM149, breast cell lines and normal mammaryother progenitor cells. MDA-MB-231, like HCC1937 and cancer MDA-MB-468), as well as primary three additional lines representing breast cancer subtypes; that is, MDA-MB-453 (a model for the HER-2 over-expressing subtype), BT474-M1 (a model of the luminal B subtype) and (a model (a) Investigation of MET and YB-1 protein levels in a panel of breastMCF-7 cancer cell lines of the luminal A subtype). MET expression was restricted to the BLBC cells lines, subtypes where P-YB-1(S102) levels were also higher. (S102) corresponding to BLBC, HER2 over-expressing, and luminal subtypes. This comparison was localized to the nucleus of the SUM149 and MDA-MB-231 cells. Levels of Met receptor protein were also (b) P-YB-1 visualized in theincluded cell lines byfour immunofluorescence. 4,6-diamidino-2-phenylindole was used for HCC1937 nuclear staining. and d) YB-1 and BLBC cell lines (SUM149, MDA-MB-231, and(c MDA-MB-468), as MET receptor transcript levels in normal mammary progenitor cells were isolated from three different reduction mammoplasties. Cells well as three additional lines representing other breast cancer subtypes; i.e., MDA-MB-453 (a were either isolated from freshly thawed tissues or from cells cultured in media that enriched for mammary progenitors. Samples were model assays for the over-expressing model luminal subtype), analysed by qRT–PCR forHER2 YB-1 and MET mRNA andsubtype), normalized BT474-M1 to endogenous (a TBP. YB-1 of andthe MET mRNA B tightly correlated across these samples (R2 ¼ 0.8785). qRT–PCR, quantitative reverse transcriptase–PCR; TBP, TATA-box binding protein.  119  ChIP and EMSA, we now show that MET expression is transcriptionally upregulated in BLBC cells by direct  from the transcriptional start site. In addition, we showed that inhibition of YB-1 in these cells decreased  and MCF-7 (a model of the luminal A subtype). MET expression was restricted to the BLBC cells lines, subtypes where P-YB-1S102 levels were also higher. (b) P-YB-1S102 was localized to the nucleus of SUM149 and MDA-MB-231 cells. Levels of MET receptor protein were also visualized in cell lines by immunofluorescence. DAPI was used for nuclear staining. (c-d) YB-1 and MET receptor transcript levels in normal mammary progenitor cells isolated from three different reduction mammoplasties. Cells were either isolated from freshly thawed tissues or from cells cultured in media that enriches for mammary progenitors. Samples were analyzed by qRT-PCR assays for YB-1 and MET mRNA and normalized to endogenous TBP. YB-1 and MET mRNA tightly correlated across these samples (R2=0.8785).  120  YB-1 induces MET in BLBC MR Finkbeiner et al  Oligo 4  Oligo 1 -2kb -2152 -2063 -1934 -1837  MET 3  -1163  -1123  MET 2  -1018  YB-1 antibody  +  + + +  CREB antibody  MET 3  wt labeled oligo wt unlabeled oligo  +  mut labeled oligo +  YB-1  -ve  IgY  - + + + +  + +  MET 2  SUM149 xenograft +  +  MET 1  MDA-MB-468  +  Input  IgY  ChIP  MDA-MB-231  Competition  ATTG CAAT  MDA-MB-468  SUM149  nuclear extract - + +  -983  MET 1  Input YB-1  IgY  YB-1  ChIP  -1672  -1kb  -1075  -1132  IgY  -1965  -1602  YB-1  -2083  -1704  mut unlabeled oligo  +  + +  +  + +  + +  +  supershift shift shift  1 2 3 4 5 6 7 8 9 10 Oligo 1  Oligo 4  1 2 3 4 Oligo 1  5 6 7 8 Oligo 4  Figure 3 Traditional ChIP and EMSA localize YB-1 binding to the À1018 YRE. (a) Analysis of the MET promoter indicated 15 0 Figure 2.3:sites Traditional ChIP and EMSA localize YB-1 binding theindicates -1018 YRE. sequences and white to boxes 50 -CAAT-30 sites. Primers putative YB-1 binding where the black boxes indicate 50 -ATTG-3 were designed to amplify portions of the MET receptor that captured several nonoverlapping YRE’s referred to as MET MET 2 and (a) Analysis of the MET promoter indicated 15 putative YB-1 binding sites where the1,black MET 3. Solid and open boxes refer to ATTG and CAAT binding regions, respectively. In addition, the location of confirmatory boxesused indicate 5’-ATTG-3’ andbelow white boxes indicates 5’-CAAT-3’ sites.Traditional Primers ChIP oligonucleotides for subsequent gel-shift sequences assays described referred to as oligo 1 and 4 is also illustrated. analysis showed binding YB-1 in the MET 1non-overlapping region in both SUM149 and MDA-MB-468 extracts. In referred addition, ChIP were strong designed thatofcaptured several YRE’s on the MET promoter to asfrom a SUM149 xenograft showed YB-1 binding in vivo at this site. Binding was not observed using primers to the MET2 or MET3 regions, for MET 1, MET 2, and MET 3. Solid and open boxes refer to ATTG and CAAT binding regions, example in MDA-MB-468 cells. (b) EMSA analysis with MET oligos 1 and 4. The regions corresponding to these oligos were from À1151 respectively. In À1006 addition, the location oligonucleotides subsequent gel In to À1180 for oligo 1 and from to À1035 for oligo 4.of In confirmatory the absence of nuclear protein (lanes 1used and 6)for no binding was observed. shift assays described below to as inoligo1 4 could is also illustrated. Traditional ChIP(lanes 3 contrast, the addition of nuclear extracts (lanes referred 2 and 7) resulted binding,and which be competed with cold oligonucleotide and 8) or by incubating the nuclear extracts with YB-1 antibody (lanesMET 4 and19).region Addition YB-1SUM149 antibody causes a supershift (lanes 4 analysis showed strong binding of YB-1 in the in ofboth and MDA-MBand 9), whereas addition of a CREB antibody did not (lanes 5 and 10) indicating site specificity. (c) Mutant oligonucleotides were next extracts. InÀ1151 addition, ChIPand from a SUM149 xenograft in vivotoat50this -CCCC-30 . introduced468 to oligos 1 (from to À1180) 4 (from À1006 to À1035) whereshowed the YB-1 YB-1 bindingbinding site was changed Binding was notelement observed primers to binding the MET2 MET3 regions, example in cyclic Loss of thesite. putative YB-1 response causes using a reduction in YB-1 in oligoor 4 (lane 7) but not oligofor 1 (lane 3). CREB, AMP response-element binding-protein; YB-1-responsive elements, EMSA, 1electrophoretic assay MDA-MB-468 cells. (b) YRE, EMSA analysis with MET oligos and 4. The mobility regionsshift corresponding to  these oligos were -1151 to -1180 for oligo1 and -1006 to -1035 for oligo 4. In the absence of Figure 4 MET mRNA and protein levels and can be modulated through YB-1. (a) SUM149 and HCC1937 cells were nuclear protein (lane 1&6) no reporter bindingactivity was observed. In contrast, the addition of nuclear extracts transiently (lane transfected for 72 h with empty vector, Flag:YB-1(WT), Flag:YB-1(D102) or Flag:YB-1(A102). MET levels 2&7) resulted in binding which could be competed with cold oligonucleotide (lane 3&8) increased or following the expression of Flag:YB-1(WT) and more so with Flag:YB-1(D102), whereas Flag:YB-1(A102) was unable to cause the by incubating the nuclear extracts with YB-1 antibody (lane 4&9). Addition of YB-1 antibody same effect. (b) YB-1 knockdown with either siYB-1 #2 or siYB-1 #3 reduced MET protein expression in the SUM149 and MDA-MB231 cell lines. Vinculin was used as a loading control. Similarly, shYB-1 expression lead to decreased MET receptor protein in SUM149 cells. (c) QRT–PCR revealed that transcript levels of MET were also reduced in YB-1 knockdown samples compared with cells 121treated with control siRNA for all cell lines. (d) SUM149 and MDA-MB-231 cells treated with siYB-1 #2 or siYB-1 #3 decreased MET reporter activity by 45 and 54%, respectively. Inhibition of YB-1 had no effect on the activity of empty vector, pGL2 basic, as expected. (e) In contrast, overexpression of wild-type YB-1 increased MET promoter activity which again was more so with Flag:YB-1(D102). Similar  causes a supershift (lane 4&9), while addition of a CREB antibody did not (lane 5&10) indicating site specificity. (c) Mutant oligonucleotides were next introduced to oligos 1 (-1151 to -1180) and 4 (-1006 to -1035) where the YB-1 binding site was changed to 5’-CCCC-3’. Loss of the putative YB-1 response element causes a reduction in YB-1 binding in oligo 4 (lane 7) but not oligo 1 (lane 3).  122  but not in the three representative luminal and HER-2expressing cell lines tested. Further, our data suggest that MET signaling is important to the growth of BLBC cells, based on the level of suppression of BLBC colony formation obtained from siRNA-treated cells. These  indicates that primary samples of this subgroup of breast cancer do not show amplification of the MET gene, in spite of their upregulated expression of MET expression (Welm et al., 2005; Charafe-Jauffret et al., 2006). This observation underscores the likelihood that  C on tr w ol tY B YB -1 -1 YB S1 -1 0 2 S1 D 02 C A on t w rol tY B YB -1 -1 YB S1 -1 02D S1 02 A  1 B2 #3 hY # s l l o ble o -1 -1 ntr ntr B B co sta co siY siY MET  MET 100 118 181  90  100  100 40 60  100 110 180 130  8  100 66  100 16  YB-1  0  100  0.8  control siYB-1 #2 siYB-1 #3 shYB-1  0.6 0.4 0.2 0  YB-1 MET SUM149 cells  1 0.8  ctrl siRNA siYB-1 #2  0.6 0.4 0.2 0  pGL2  pMET  0  0  1 0.8  control siYB-1 #2 siYB-1 #3  0.6 0.4 0.2 0 YB-1 MET MDA-MB-231  1.2 1 0.8  ctrl siRNA siYB-1 #2  0.6 0.4 0.2 0 pGL2 basic pMET MDA-MB-231  SUM149  12 030  200 150  P-AktSer473  100  P-YB-1Ser102  50  MET  0  Actin EV  wt  1  D  YB  YB  -  1S  2 10  YB  -1  A 02 S1  MDA-MB-231  1.2  SUM149  250  SUM149 Stable shYB-1  SO UDM OS  100  44  100  37  100  72  SUM149  relative MET transcript levels  1  fold change in transcript levels  SUM149  HCC1937  relative promoter activity  fold change in transcript levels relative promoter activity  SUM149  relative MET promoter activity (%)  100  18  Vinculin  Actin  1.2  10  YB-1  Flag  1.2  #2 #3 ol -1 -1 ntr iYB iYB o c s s  1.5  SUM149  1  0.5  0  S O 012 DM U-03 S O  Figure 2.4: MET mRNA and protein levels and reporter activity can be modulated via YB-1. (a) SUM149 and HCC1937 cells were transiently transfected for 72 hrs with empty vector, Flag:YB-1(WT), Flag:YB-1(D102) or Flag:YB-1(A102). MET levels increased following the expression of Flag:YB-1(WT) and more so with Flag:YB-1(D102), while Flag:YB-1(A102) was unable to cause the same effect. (b) YB-1 knockdown with either siYB-1#2 or siYB-1#3 reduced MET protein expression in the SUM149 and MDA-MB-231 cell lines. Vinculin was 123  Oncogene  used as a loading control. Similarly, shYB-1 expression lead to decreased MET receptor protein in SUM149 cells. (c) QRT-PCR revealed that transcript levels of MET were also reduced in YB1 knockdown samples compared to cells treated with control siRNA for all cell lines. (d) SUM149 and MDA-MB-231 cells treated with siYB-1#2 or siYB-1#3 decreased MET reporter activity by 45% and 54%, respectively. Inhibition of YB-1 had no effect on the activity of empty vector, pGL2 basic, as expected. (e) In contrast, over-expression of wild type YB-1 increased MET promoter activity which again was more so with Flag:YB-1(D102). Similar to transcription level, Flag:YB-1(A102) was unable to increase the promoter activity (f) OSU03012 attenuated AKT activation resulting in reduced P-YB-1S102 and eventually reduction of MET protein expression in SUM149 cells. Inhibition of PDK-1 signalling via OSU-03012 treatment also significantly inhibited MET mRNA levels based on qRT-PCR. SUM149 cells were treated with DMSO (black) or OSU-03012 (white) for 6 hours. MET transcripts were significantly reduced by OSU-03012 compared to the DMSO treated cells (p < 0.05).  124  YB-1 induces MET in BLBC MR Finkbeiner et al  co nt r si ol YB si -1 YB # si -1 2 M # ET 3  co nt si rol YB si -1 YB # 2 si -1 M # ET 3  8  MET P-GAB1 T-GAB1 YB-1 Actin serum-starved  HGF  % of colonies relative to control  MDA-MB-231 140 120 100 80 60 40 20 0 ctrl  siYB-1 #2  siYB-1#3  siMET  % of colonies relative to control  SUM149 140 120 100 80 60 40 20 0 ctrl  siYB-1 #2  siYB-1#3  siMET  MDA-MB-231 Figure 5 Inhibition of YB-1 disrupts HGF/MET receptor  hairpin RNA, the levels of MET protein became virtually undetectable, yet MET mRNA was reduced by only B40–50%. This observation was confirmed using two different MET receptor antibodies. Consistent with these results, silencing YB-1 with a lentiviral short hairpin RNA vector yielded identical findings; the levels of MET protein were inhibited to a greater extent than could be explained by changes in mRNA. Although we show that the MET promoter is a direct target of YB-1, it may also influence its translation. Thus, additional regulatory avenues need to be explored to more fully understand the relationship between YB-1 and MET. As predicted by such a model, inhibiting YB-1 also markedly suppressed the growth of the BLBC cells under anchorage-independent conditions. Indeed, the inhibition obtained was even greater than that achieved by inhibiting MET alone, consistent with the COC findings indicating likely effects of YB-1 on other genes important to the growth of BLBC cells. These data suggest that targeting MET, as well as YB-1 could be useful therapeutic strategies for improving the treatment of BLBC in patients. In this regard, it is interesting to note that inhibitors of MET are already available and in clinical trials in other types of cancers (Comoglio et al., 2008). Our group is actively developing inhibitors to YB-1. Some of the other genes that YB-1 bound reportedly have stem/progenitor associations; for example, CD44, CD49f, c-KIT, BMI-1, and both NOTCH and WNT pathway elements (Stingl et al., 2006; Shipitsin et al., 2007; Mani et al., 2008; Raouf et al., 2008). It is interesting to note that high expression of many of these genes has also been associated with human breast cancer cells that have an ability to initiate tumor formation in immunodeficient mice (Al-Hajj et al., 2003; Dontu et al., 2004; Farnie et al., 2007). It might be speculated, therefore, that heightened expression of YB-1 is a key mechanism used by normal mammary stem cells to maintain their primitive status and one that is used and/ or highjacked by breast cancer stem cells. Further validation of the genes that YB-1 regulates in normal and malignant breast cells should therefore be of interest to understand why YB-1 expression correlates so strongly with breast cancer recurrence.  signaling and anchorage-independent growth (a) MDA-MB-231 Figure 2.5: Inhibition of YB-1 disrupts HGF/MET receptor signalling and anchoragecells were transfected with siYB-1 for 96 h then stimulated with HGF for 15growth. min. The impact on signal transduction was evaluated independent levels. (b and c) Soft agar assays through decreased P-Gab-1 (a) MDA-MB-231 cells transfected withresults siYB-1 96 hours stimulated with HGF for with YB-1 knockdown showwere that the loss of either protein in forMaterials andthen methods a marked The reduction in anchorage-independent growth in was both evaluated via decreased P-GAB1Y307 levels. 15 minutes. impact on signal transduction SUM149 and MDA-MB-231 cells by 80–90%. Decreased MET (b-c) receptor Soft agar assays withsuppressed YB-1 knockdown show thatCell thelines loss of either protein results in a expression by siRNA anchorage-independent SUM149 cells were obtained from Asterand (Ann Arbor, MI, growth of both cell lines by approximately 50%. HGF, hepatocyte marked reduction in anchorage-independent growth in both MDA-MB-231 cellsrecommendaUSA)SUM149 and grown and according to the supplier’s growth factor. tions. suppressed HCC1937 cells were obtained from Dr WD Foulkes by 80-90%. Decreased MET receptor expression by siRNA anchorage-independent (McGill University, Montreal, QC, Canada) and were cultured growth of both cell lines by approximately 50%. in RPMI-1640 (Invitrogen, Burlington, ON, Canada) suppleY307  this is a downstream consequence of the enhanced expression and transregulatory activity of YB-1 on the MET promoter. It should be noted that inhibiting YB-1 consistently had a greater effect on attenuating MET protein than it did on modulating MET mRNA levels. For example, when YB-1 expression was stably inhibited with short  mented with 10 mM HEPES pH 7.6, 4.5 g/l glucose (Sigma, Oakville, ON, Canada), 1 mM sodium pyruvate (Sigma) and 10% fetal bovine serum. BT474-M1 cells were obtained from Dr Mien-Chie Hung (University of Texas, MD Anderson Cancer Center, Houston, TX, USA). All other breast cancer cell lines were purchased from the American Tissue culture collection (Rockwood MD, ATCC, Manassas, VA, USA) and cultured as recommended.  Oncogene  125  2.9 SUPPLEMENTARY DATA 2.9.1 SUPPLEMENTARY MATERIALS AND METHODS Lentiviral down-regulation of YB-1 A pSuper plasmid harbouring an established sh-YB-1 sequence (van Roeyen et al.,2005), a gift from Dr. Peter Mertens, Aachen, Germany, was digested with EcoRI and HindIII to eject and isolate the approximately 200 bp H1 RNA promoter and YB-1-specific RNAi sequence. The 200 bp fragment was cloned into a pSuper shuttle vector, and further digested with BamHI and NheI. The RNAi sequence and corresponding promoter was finally inserted at position 2376 into the KA391 lentivector (Raouf et al., 2005) with a modified yellow fluorescence protein (YFP). A Lenti-EV plasmid was also constructed by inserting the H1 promoter with no sh-RNA sequence into the KA391 lentivector at the same location. Lenti-EV and Lenti-shYB-1 viruses were produced, purified, and titred as previously described (Raouf et al., 2005). SUM149 cells were grown in log-phase in their described medium and infected with either the purified LentiEV or Lenti-sh-YB-1 virus as previously described (Raouf et al., 2005). Successful transfectants were selected based on fluorescence analysis by the BD FACSVantage flow cytometry system, and the top 20% of YFP+ cells were isolated and propagated in culture. The pSuper shuttle vector, KA391 lentivector with modified YFP, virus production reagents, virus purification reagents, and selection of successfully infected SUM149 cells materials were gifts from Dr. Connie Eaves, Vancouver, Canada. Western blotting and quantitative PCR for MET and YB-1 were performed as described in Materials and Methods.  Array CGH analysis Ten primary tumours were characterized as being basal-like by immunohistochemistry (negative for ER, PR and HER2 while positive for EGFR) and then DNA was extracted from the  126  tumours and analyzed for gain or loss of copy number by using a submegabase resolution tiling set (SMRT) tiling arrays as previously described (Stratford et al., 2007).  Detailed description of primary progenitor isolations Bipotent progenitor-enriched fractions were isolated from freshly thawed vials of three reduction mammoplasty samples, as previously described (Eirew et al., 2008). In this case, an aliquot of the initially obtained single cell suspension were fractionated immediately by FACS after staining with antibodies against human EpCAM, CD49f, CD31 and CD45. The basal fraction (CD49f+EpCAM-/lowCD31-CD45-) isolated by this method comprises mainly mature myoepithelial cells, and also bipotent and myoepithelial-restricted progenitors. The luminal fraction (CD49f+EpCAM+CD31-CD45-) comprises mainly mature luminal epithelial cells, and also luminal-restricted progenitors. An average of 5% of cells in fractions isolated using this methodology are progenitors (Eirew et al., 2008). We also isolated bipotent progenitor-enriched fractions from 3 different reduction mammoplasty samples, as previously described (Raouf et al., 2008). In this case, the culture condition enrich for the expansion of progenitors. Briefly, cryopreserved organoid-enriched human mammary cells were defrosted, enzymatically dissociated to generate a single cell suspension and cultured for 3 days in EGF-containing medium. An Epithelial Cell Adhesion Molecule (EpCAM)+ fraction was isolated immunomagnetically, and the cells were further fractionated by fluorescence activated cell sorting (FACS) after staining with antibodies against human CD49f, CD10, Thy1, Mucin 1 (MUC1) and AC133. This method yields progenitor purities of 30-50% in the EpCAM+CD49f+(CD10/Thy1)+ (bipotent progenitor enriched) isolates (Raouf et al., 2008). To assess the transcript levels of YB-1 and MET, 40 to 60 ng of RNA from each sample were reverse transcribed into cDNA as described (Zhao et al., 2007). For comparison, RNA was isolated from MDA-MB-231, MDA-MB-468, HCC1937, and SUM149 cells grown in log phase 127  using the Qiagen RNeasy Mini Kit (Qiagen) and its prescribed protocol. 1 µg of extracted RNA was reverse-transcribed using Superscript III Reverse Transcriptase and its prescribed protocol (Invitrogen). QRT-PCR (7000 Sequence Detection System, Applied Biosystems) was performed using TaqMan Gene Expression Assays designed against human YB-1 (Custom TAMRA probe, sequence: 6FAM-AAGCCCGGCACTACGGGCAGC-TAMRA, Applied Biosystems), human MET (Assay ID: Hs00179845_m1, Applied Biosystems), and human TATA-box binding protein (TBP) as an endogenous control (Part No. 4326322E, Applied Biosystems). Relative expression of YB-1 and MET transcript levels was determined by normalizing to TBP.  ChIP-on-chip (COC) SUM149 cells were grown to 80% confluency on 15-cm diameter plates (8 x 106 cells). Chromatin immunoprecipitation (ChIP) was performed on the pooled lysates from 12 plates of cells. YB-1:DNA complexes were isolated as previously described (Wu et al., 2006) using a anti-chicken antibody (Dr. Isabella Berquin, Wake Forest University, North Carolina). Following elution of DNA from the beads, DNA was amplified using the protocol provided by NimbleGen. Briefly, DNA end blunting was performed by T4 DNA polymerase (NEB, #203L) for 20 minutes at 12°C on eluates and input controls. 3 M NaOAc, 20 mg/ml glycogen and phenol/chloroform was added and samples were vortexed for one minute. Aqueous supernatants were removed, DNA precipitated in ethanol and the pellet suspended in 25 µl water. T4 DNA ligase (NEB, #202L) was used to ligate blunted DNA to 15 µmol/L of annealed linkers oJW102 (5’ GCGGTGACCCGGGAGATCTGAATTC) and oJW103 (5’  GAATTCAGATC). The  samples were incubated at 16°C overnight and precipitated in ethanol. The oJW102 primer was used to perform ligation-mediated PCR (LM-PCR). PCR conditions were 55°C for 2 minutes, 72°C for 5 minutes, and 95°C for 2 minutes, then 22 cycles of 95°C for 1 minute, 60°C for 1  128  minute and 72°C for 5 minutes. QIAQuick PCR Purification Kit (#28104) was used to purify the samples and NanoDrop® ND-1000 Spectrophotometer was used to quantify the DNA. From the ChIP-on-chip hybridization, a list of accession numbers of genes with promoters to which YB-1 potentially binds was generated. Using the National Center for Biotechnology Information (NCBI) website (http://www.ncbi.nlm.nih.gov), the accession numbers were decoded and all genes with a greater than log 2-fold change were identified. Data was analyzed using Ingenuity Pathway Analysis software (Redwood City, CA).  129  2.9.2 SUPPLEMENTARY FIGURES  Figure S2.1: Stable Lentiviral down-regulation of YB-1 (Lenti-shYB-1) in SUM149 and its effect on MET expression. Lentiviral down-regulation of YB-1 reduced both (a) transcript and (b) protein levels of MET.  130  Figure S2.2: CGH analysis using SMRT high resolution tiling arrays on primary BLBC. Array CGH analysis shows that MET is not commonly amplified in primary BLBC. Gain or loss of copy number was considered significant if the levels were – or + 0.5 from the norm. A small segmental gain was observed only in sample J.  131  2.10 REFERENCES Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF (2003). Prospective identification of tumourigenic breast cancer cells. Proc Nat Acad Sci, USA 100, no 7: 39833988. Birchmeier C, Birchmeier W, Gherardi E, Vande Woude GF (2003). MET, metastasis, motility and more. Nat Rev Mol Cell Biol 4: 915-25. Boccaccio C, Comoglio PM (2006). Invasive growth: a MET-driven genetic programme for cancer and stem cells. Nat Rev Cancer 6: 637-45. Boon EMJ, van der Neut R, van de Wetering M, Clevers H, Pals ST (2002). Wnt signalling regulates the receptor tyrosine kinase MET in colorectal cancer. Cancer Res 62: 5126-5128. Charafe-Jauffret E, Ginestier C, Monville F, Finetti P, Adelaide J, Cervera N et al. (2006). Gene expression profiling of breast cell lines identifies potential new basal markers. Oncogene 25: 2273-84. Colozza M, de Azambuja E, Personeni N, Lebrun F, Piccart MJ, Cardoso F (2007). Achievements in systemic therapies in the pregenomic era in metastatic breast cancer. Oncologist 12: 253-70. Comoglio PM, Giordano S, Trusolino L (2008). Drug development of MET inhibitors: targeting oncogene addiction and expedience. Nat Rev Drug Discov 7: 504-16. Dontu G, Jackson KW, McNicholas E, Kawamura MJ, Abdallah WM, Wicha MS (2004). Role of Notch signalling in cell-fate determination of human mammary stem/progenitor cells. Breast Cancer Res 6: R605-15. Dunn BK, Ford LG (2007). Hormonal interventions to prevent hormonal cancers: breast and prostate cancers. Eur J Cancer Prev 16: 232-42. Eirew P, Stingl J, Raouf A, Turashvili G, Aparicio S, Emerman JT et al. (2008). A method for quantifying normal human mammary epithelial stem cells with in vivo regenerative ability. Nature Medicine 12: 1384-9. Farnie G, Clarke RB, Spence K, Pinnock N, Brennan K, Anderson NG et al. (2007). Novel cell culture technique for primary ductal carcinoma in situ: role of Notch and epidermal growth factor receptor signalling pathways. J Natl Cancer Inst 99: 616-27. Gambarotta G, Boccaccio C, Giordano S, Ando M, Stella MC, Comoglio PM (1996). Ets upregulates MET transcription. Oncogene 13: 1911-7. Habibi G, Leung S, Law JH, Gelmon K, Masoudi H, Turbin D et al. (2008). Redefining prognostic factors for breast cancer: YB-1 is a stronger predictor of relapse and disease-specific survival than estrogen receptor or HER2 across all tumour subtypes. Breast Cancer Res 10: R86.  132  Kuwano M, Oda Y, Izumi H, Yang S, Uchiumi T, Iwamoto Y et al. (2004). The role of nuclear Y-box binding protein-1 as a global marker of drug resistance. Mol Cancer Ther 3(11): 14851492. Lee C, Dhillon J, Wang MY, Gao Y, Hu K, Park E et al. (2008). Targeting YB-1 in HER2 overexpressing breast cancer cells induces apoptosis via the mTOR/STAT3 pathway and suppresses tumour growth in mice. Cancer Res 68: 8661-6. Leo C, Horn LC, Einenkel J, Hentschel B, Hockel M (2007). Tumour hypoxia and expression of c-met in cervical cancer. Gynecol Oncol 104: 181-5. Mani SA, Guo W, Liao M, Eaton E, Ayyanan A, Ahaou AY et al. (2008). The epithelialmesenchymal transition generates cells with properties of stem cells. Cell 133: 704-715. Okamoto T, Izumi H, Imamura T, Takano H, Ise T, Uchiumi T et al. (2000). Direct interaction of p53 with the Y-box binding protein, YB-1: a mechanism for regulation of human gene expression. Oncogene 19: 6194-202. Orian-Rousseau V, Chen L, Sleeman JP, Herrlich P, Ponta H (2002). CD44 is required for two consecutive steps in HGF/c-MET signalling. Genes Dev 16: 3074-86. Pennacchietti S, Michieli P, Galluzzo M, Mazzone M, Giordano S, Comoglio PM (2003). Hypoxia promotes invasive growth by transcriptional activation of the met protooncogene. Cancer Cell 3: 347-61. Raouf A, Zhao Y, To K, Stingl J, Delaney A, Barbara M et al. (2008). Transcriptome analysis of the normal human mammary cell commitment and differentiation process. Cell Stem Cell 3: 109-18. Raouf A, Brown L, Vrcelj N, To K, Kwok W, Huntsman D et al (2005). Genomic instability of human mammary epithelial cells over-expressing a truncated form of EMSY. J Natl Cancer Inst 97: 1302-6. Sachs M, Brohmann H, Zechner D, Muller T, Hulsken J, Walther I et al. (2000). Essential role of Gab1 for signalling by the c-met receptor in vivo. J Cell Bio 150, 6: 1375-1384. Shadeo A, Lam WL (2006). Comprehensive copy number profiles of breast cancer cell model genomes. Breast Cancer Res 8: R9. Shipitsin M, Campbell LL, Argani P, Weremosicz S, Bloushtain-Qimorn N, Yao J et al. (2007). Molecular definition of breast tumour heterogeneity. Cancer Cell 11, 3: 259-273. Sorlie T, Perou CM, Tibshirani R, Aas T, Geisler S, Johnsen H et al. (2001). Gene expression patterns of breast carcinomas distinguish tumour subclasses with clinical implications. Proc Natl Acad Sci U S A 98: 10869-74. Stingl J, Eirew P, Ricketson I, Shackleton M, Vaillant F, Choi D et al. (2006). Purification and unique properties of mammary epithelial stem cells. Nature 439 993-997. 133  Stratford AL, Fry CJ, Desilets C, Davies AH, Cho YY, Li Y et al. (2008). Y-box binding protein-1 (YB-1) serine 102 is a downstream target of p90 ribosomal S6 kinase (RSK) in basallike breast cancer cells. Breast Cancer Res 10(6):R99. Stratford AL, Habibi G, Astanehe A, Jiang H, Hu K, Park E et al. (2007). Epidermal growth factor receptor (EGFR) is transcriptionally induced by the Y-box binding protein-1 (YB-1) and can be inhibited with Iressa in basal-like breast cancer, providing a potential target for therapy. Breast Cancer Res 9: R61. Sutherland BW, Kucab JE, Wu J, Lee C, Cheang MCU, Yorida E et al. (2005). AKT phosphorylates the Y-box binding protein-1 at Ser102 located in the cold shock domain and affects the anchorage-independent growth of breast cancer cells. Oncogene 24: 4281-4292. To K, Zhao Y, Jiang H, Hu K, Wang M, Wu J et al. (2007). The phosphoinositide-dependent kinase-1 inhibitor 2-amino-n-[4-[5-(2-phenanthrenyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl] phenyl]-acetamide (OSU-03012) prevents Y-box binding protein from inducing epidermal growth factor receptor. Mol Pharm 72: 641-652. Trusolino L, Bertotti A, Comoglio PM (2001). A signalling adapter function for alpha6beta4 integrin in the control of HGF-dependent invasive growth. Cell 107: 643-54. Trusolino L, Comoglio PM (2002). Scatter-factor and semaphorin receptors: cell signalling for invasive growth. Nat Rev Cancer 2: 289-300. van Roeyen CR, Eitner F, Martinkus S, Thieltges SR, Ostendorf T, Bokemeyer D et al. (2005). Y-box protein mediates PDGF-B effects on mesangioproliferative glomerular disease. J Am Soc Nephrol 16(10): 2985-2996. Welm AL, Kim S, Welm BE, Bishop JM (2005). MET and MYC cooperate in mammary tumourigenesis. Proc Natl Acad Sci U S A 102: 4324-9. Wu J, Lee C, Yokom D, Jiang H, Cheang MC, Yorida E et al. (2006). Disruption of the Y-box binding protein-1 results in suppression of the epidermal growth factor receptor and HER2. Cancer Res 66: 4872-9. Yoshida S, Harada T, Mitsunari M, Iwabe T, Sakamoto Y, Tsukihara S et al. (2004). Hepatocyte growth factor/MET system promotes endometrial and endometriotic stromal cell invasion via autocrine and paracrine pathways. J Clin Endocrinol Metab 89: 823-32. Zhao Y, Raouf A, Kent D, Khattra J, Delaney A, Schenerch A et al. (2007). A modified polymerase chain reaction-long serial analysis of gene expression protocol identifies novel therapeutics in human CD34+ bone marrow cells. Stem Cells 25(7): 1681-1689.  134  CHAPTER 3: THE TRANSCRIPTIONAL INDUCTION OF PIK3CA IN TUMOUR CELLS IS DEPENDENT UPON THE ONCOPROTEIN Y-BOX BINDING PROTEIN-1 (YB-1)2  2  A version of this chapter has been published. Arezoo Astanehe, Melanie R. Finkbeiner, Peyman Hojabrpour, Karen To, Abbas Fotovati, Ashleen Shadeo, Anna L. Stratford, Wan L Lam, Isabelle M Berquin, Vincent Duronio, and Sandra E. Dunn (2009). The transcriptional induction of PIK3CA in tumour cells is dependent on the oncoprotein Y-box binding protein-1. Oncogene 28, 2406-2418.  135  3.1 OVERVIEW PIK3CA, which codes for the p110α catalytic subunit of phosphatidylinositol-3-kinase (PI3K), is implicated as an oncogene. Despite importance of PIK3CA in cancer, little is known about what drives up its expression in tumour cells. We recently characterized the PIK3CA promoter and reported that it is transcriptionally silenced by the tumour suppressor protein p53. In the present study, we demonstrate that PIK3CA can be induced by the oncogenic transcription factor Y-box binding protein-1 (YB-1). Three YB-1-responsive elements were identified on the PIK3CA promoter using chromatin immunoprecipitation and electrophoretic mobility shift assays. Interestingly, silencing YB-1 with siRNA in models of basal-like breast cancer decreased p110α protein levels regardless of whether PIK3CA was wild type, amplified or mutated. This decrease in p110α led to a reduction in PI3K activity and downstream signalling primarily through p90 ribosomal S6 kinase and S6 ribosomal protein. Disruption in PIK3CA-dependent signalling suppressed cellular invasion correlative with loss of urokinase plasminogen activator (uPA). Similarly, silencing YB-1 suppressed invasion and uPA production however this was reversible through the introduction of constitutively active PIK3CA. In conclusion, YB-1 is the first reported oncogene to induce the expression of PIK3CA through transcriptional control of its promoter.  3.2 INTRODUCTION PIK3CA, which codes for the p110α catalytic subunit of class IA Phosphatidylinositol-3kinase (PI3K), is implicated as an oncogene (Shayesteh et al., 1999). The importance of the role of PI3K signalling in cancer is unquestionable, as increased PI3K activity has been observed in many different cancer types and believed to be one of the driving forces behind tumourigenesis (Manning and Cantley, 2007). Previous studies of knockout mice have demonstrated that an  136  imbalance in levels of the p110 catalytic and p85 regulatory subunits suffices to significantly affect PI3K activity (Ueki et al., 2002). Similarly, elevated p110α levels correlate with increased PI3K activity (Shayesteh et al., 1999). Therefore, it is of significance to delineate mechanisms that increase p110α levels and thereby PI3K activity in cancer. In addition, gene deletion studies in mice have shown that p110α is essential for growth factor signalling as well as for oncogenic transformation (Zhao et al., 2006), while direct interaction of RAS with p110α is required for oncogenic RAS induced tumourigenesis (Gupta et al., 2007). Moreover, activating PIK3CA mutations, observed in many different cancers, are also shown to be transforming (Bader et al., 2006; Horn et al., 2008; Zhang et al., 2008) and increased expression of mutant PIK3CA further enhances PI3K activity (Samuels et al., 2004). All these studies indicate the importance of p110α in cancer and the significance of understanding the mechanisms that lead to its expression. Unfortunately, despite the importance of PIK3CA in cancer, there is relatively little known about what regulates its transcription. We recently characterized the 5’-untranslated region (5’-UTR) of PIK3CA and published the first report on transcriptional regulation of this important oncogene (Astanehe et al., 2008). We demonstrated that PIK3CA transcription is repressed by the tumour suppressor protein p53 in ovarian surface epithelial cells, and provided evidence to show that loss of p53 in ovarian cancer is one mechanism that leads to elevated p110α levels (Astanehe et al., 2008). In addition, it has recently been demonstrated that the forkhead transcription factor, FOXO3a, induces PIK3CA by directly binding to its promoter rendering chronic myelogenous leukaemia cells resistant to doxorubicin (Hui et al., 2008). However, induction of PIK3CA by FOXO3a is paradoxical as it is a known tumour suppressor with its activation mediating apoptosis in cancers including those of the breast (Sunters et al., 2003). Indisputably, more studies are required to identify transcriptional mediators of PIK3CA.  137  In the present study, we set out to demonstrate transcriptional regulation of PIK3CA using a breast cancer model. Breast cancer is a heterogeneous disease consisting of various subtypes (Sorlie et al., 2001). One of the most aggressive is the basal-like breast carcinoma (BLBC) often referred to as “triple negative” breast cancers since they do not express estrogen or progesterone receptors and they do not over-express HER2 (Yehiely et al., 2006). BLBC accounts for 15-25% of all breast cancers, and women diagnosed with it have short survival time and increased rates of relapse (Sorlie et al., 2001). We recently reported that the expression of Y-Box Binding Protein-1 (YB1), an oncogenic transcription/translation factor implicated in many malignancies (Wu et al., 2007), is associated with relapse and poor overall survival for all breast cancer subtypes (Habibi et al., 2008). This followed a smaller study indicating that 73% of BLBC primary tumours overexpress YB-1 (Stratford et al., 2007). Both serine/threonine kinases AKT (Sutherland et al., 2005) and RSK (Stratford et al., 2008) phosphorylate YB-1 on its S102 residue, thereby altering its nuclear trafficking. Within the nucleus, YB-1 binds to the inverted CCAAT elements known as YB-1 responsive elements (YRE’s) to affect transcription (Didier et al., 1988). Given the importance of YB-1 in breast cancer we sought to understand how it globally regulates gene expression and therefore a genome-wide promoter screen was performed using the NimbleGen Chromatin Immunoprecipitation (ChIP)-on-chip (COC) platform (Finkbeiner et al., 2009). The COC, which provided the basis for the present study, demonstrated a 17.05 fold enrichment of PIK3CA promoter hybridization to the microarray as compared to the input control, suggesting that YB-1 may control expression of PIK3CA by direct promoter occupancy. In the present study, we report on the transcriptional induction of PIK3CA by an oncoprotein, namely YB-1. We show that YB-1 interacts directly with the PIK3CA promoter to induce its transcription, thereby leading to elevated p110α levels and PI3K activity. In addition, we demonstrate that YB1 has a major impact in regulating invasion of BLBC cells through its ability to directly induce 138  PIK3CA, increasing PI3K activity and thereby urokinase plasminogen activator (uPA) production.  3.3 RESULTS AND DISCUSSION 3.3.1 YB-1 BINDS TO THE PIK3CA PROMOTER AT THREE VALIDATED SITES The PIK3CA promoter region was characterized by us for the very first time (Astanehe et al., 2008), enabling the study of PIK3CA transcriptional regulation. The 5’-UTR of PIK3CA is more than 50 000 bp upstream of the translational start site that lies within exon 2 (Figure 3.1a). This 5’-UTR consists of two alternate first exons (1a and 1b) that splice differentially with exon 2. Thereby, there are two alternate promoter regions 1a and 1b (Astanehe et al., 2008). Evaluation of the PIK3CA promoter for YB-1 binding identified six putative sites (Figure 3.1a). It is important to note that although our study is focused on the PIK3CA promoter approximately 1kb upstream of the transcriptional start site, there may be additional YB-1 binding sites outside of this region. Three BLBC cell lines (SUM149, HCC1937, and MDA-MB-231) were used with four different sets of Chromatin Immunoprecipitation (ChIP) primers designed to encompass the potential YB-1 binding sites (Figure 3.1a). Amplification of ChIP DNA obtained from SUM149 and HCC1937 cells determined binding to ChIP regions 1, 2, and 3 within promoter 1a, while binding was not evident to ChIP region 4 within promoter 1b (Figure 3.1a). In MDA-MB-231 cells, YB-1 only occupied ChIP regions 2 and 3 (Figure 3.1a). Nevertheless, the ChIP analyses in the three different cell lines validated that YB-1 binds to several sites along the PIK3CA promoter, specifically promoter 1a. Therefore, Electrophoretic Mobility Shift Assays (EMSA) were used to further verify YB-1 binding to these sites. Nuclear extracts of SUM149 (Figure 3.1b), HCC1937 (data not shown), or MDA-MB-231 (data not shown) cells were incubated with biotin-labelled oligonucleotides 1 to 5 corresponding to the putative YB-1 binding sites. With all of the nuclear extracts, this produced intense binding that could be competitively inhibited with 139  unlabelled probe. Furthermore, co-incubation of the nuclear extracts with an YB-1 antibody caused a supershift identifying the oligonucleotide-bound nuclear protein as YB-1. In addition, mutation of the YB-1 responsive element (YRE) from CAAT to CCCC decreased binding of nuclear YB-1 to oligonucleotides 1, 3, and 4 (Figure 3.1c), but not to oligonucleotides 2 and 5 (data not shown). The culmination of these studies indicate that YB-1 can bind to three YREs located at sites 1 (position -51 300 bp), 3 (position -50 785 bp), and 4 (position -50 745 bp) on the PIK3CA promoter (Figure 3.1c).  3.3.2 YB-1 BINDS TO THE PIK3CA PROMOTER AND INDUCES ITS TRANSCRIPTION INDEPENDENT OF COPY NUMBER GAINS OR MUTATIONAL STATUS We next addressed whether binding of YB-1 to the PIK3CA promoter leads to its transactivation. Silencing YB-1 with two different small interfering RNAs (siRNA) (siYB-1#1 and siYB-1#2) in SUM149, HCC1937, and MDA-MB-231 cells attenuated PIK3CA promoter activity measured by a luciferase assay (Figure 3.2a). Similarly, silencing YB-1 decreased the PIK3CA transcript (Figure 3.2b) and the p110α protein (Figure 3.2c) levels in all three cell lines. Consistent with these findings the stable knockdown of YB-1 in SUM149 cells, with a short hairpin RNA (shRNA) targeting a different site than the siRNA, decreased PIK3CA transcript and p110α protein levels (Supplementary Figure S3.1a). The same effect was observed when SUM149 cells were infected with a lentiviral vector expressing shYB-1 (Supplementary Figure S3.1b) and in SUM149 cells with a conditional tetracycline-off shYB-1 (Supplementary Figure S3.1c). Furthermore, induction of YB-1 with doxycycline (1µg/ml) in immortalized mammary epithelial cells with a tetracycline inducible YB-1 expression vector (HTRY#5), increased PIK3CA promoter activity, transcript, and p110α protein levels (Figure 3.2d). Thus, using  140  multiple strategies of YB-1 interference we consistently show that PIK3CA and its protein product p110α are dependent upon this transcription factor. It is interesting to note that neither of SUM149, HCC1937, nor MDA-MB-231 cell lines have known PIK3CA mutations (Hollestelle et al., 2007). Activating mutations of PIK3CA are the most common (26%) genetic aberration found in breast cancer (Bachman et al., 2004; Isakoff et al., 2005; Saal et al., 2005; Samuels and Velculescu, 2004). Moreover, expression of the mutant PIK3CA increases PI3K activity (Samuels et al., 2004) and have been shown to be transforming (Bader et al., 2006; Horn et al., 2008; Zhang et al., 2008). Therefore, it is important to elucidate mechanisms that lead to expression of these activating mutants. The SUM102 cell line which is of the BLBC subtype carries the common genetic alteration in the PIK3CA kinase domain (exon 20; H1047R), while MCF-7 a luminal subtype cell line carries a mutation in the PIK3CA helical domain (exon 9; E542K) (Hollestelle et al., 2007). Interestingly, silencing YB-1 in both SUM102 and MCF-7 cell lines decreased the PIK3CA transcript (Figure 3.3a) and p110α protein (Figure 3.3b) levels, indicating that the expression of mutant PIK3CA is also dependent on YB-1. Aside from the occurrence of activating mutations in PIK3CA, this oncogene can also be amplified in cancer. Wu et al. (2005) reported that 9% (8 of 92) of primary breast cancers have PIK3CA amplifications; we therefore sought to examine our BLBC cell lines for PIK3CA copy number changes. Array comparative genomic hybridization (aCGH) indicated a large segmental amplification encompassing the PIK3CA locus (3q26.32) in HCC1937 and MDA-MB-231, but not in SUM149 cells (Figure 3.3c). In addition, real-time quantitative PCR of breast cancer cell lines determined HCC1937 and MDA-MB-231 cells to have the highest PIK3CA copy number with 5.6 and 3.7 copies respectively (Figure 3.3d). The presence of PIK3CA amplification in the HCC1937 and MDA-MB-231 cell lines indicates that YB-1 can also regulate the expression of amplified PIK3CA. Similarly, we have previously shown that YB-1 can regulate transcription of 141  another amplified gene, HER2 (Wu et al., 2006). Combination of the data generated from various cell lines carrying different PIK3CA alterations suggest that regardless of whether PIK3CA is wild type, amplified, or mutated its expression is induced by YB-1. Moreover, since two out of five of the BLBC cell lines demonstrated PIK3CA copy number gains (Figure 3.3d), it suggested that amplifications of PIK3CA may be a more common occurrence in the BLBC subtype. The report by Wu et al. (2005) demonstrating amplification in 9% (8 of 92) of breast cancers included a mixed cohort of tumours that were not classified based on subtype. Therefore, we investigated PIK3CA genomic copy number changes in ten archival BLBC specimens using aCGH. Specimens E, I and J (30%) showed large segmental gains at the PIK3CA locus (3q26.32), however, copy number changes were not observed in 3q for seven of the ten cases (A-D and F-H) (Figure 3.3e). Although based on a limited sample size, these results suggest that BLBC may have higher amplification frequencies, on toward 30%, compared to other breast cancer subtypes.  3.3.3 YB-1 INDUCES PIK3CA TRANSCRIPTION IN A MANNER DEPENDENT ON S102 PHOSPHORYLATION We screened a panel of breast cancer cell lines (including BLBC, HER2, and Luminal subtypes) for the levels of total YB-1 (T-YB-1), phosphorylated YB-1 (P-YB-1S102), and p110α (Figure 3.4a). Strikingly, BLBC cell lines, including the SUM149s, expressed the highest levels of P-YB-1S102 and p110α. The T-YB-1 levels, however, were similar amongst the different cancer cell lines, although higher relative to the non-tumourigenic line (184htert) (Figure 3.4a). Consistent with these findings, silencing YB-1 in a SUM149 xenograft model resulted in loss of P-YB-1S102 and decreased p110α protein levels (Figure 3.4b). Given the significance of the S102 site to the transcriptional activity of YB-1, we addressed whether it is required for PIK3CA trans-  142  activation. PIK3CA promoter activity increased with over-expression of wild type YB-1 (wt-YB1) in SUM149, HCC1937, and MDA-MB-231 cells (Figure 3.4c). In addition, expression of an activated phospho-mimic mutant of YB-1 (YB-1 S102D) further augmented the PIK3CA promoter activity, while no induction was observed with transfection of an inactive mutant of YB-1 (YB-1 S102A) (Figure 3.4c). Similarly, PIK3CA transcript (Figure 3.4d) and p110α protein (Figure 3.4e) levels increased with over-expression of wt-YB-1 and even more with YB1 S102D. Expression of YB-1 S102A did not induce the transcript (Figure 3.4d) or the protein (Figure 3.4e) levels in SUM149 and HCC1937 cells, although it acted as a dominant negative and decreased both in MDA-MB-231 cells. In addition, PIK3CA transcript and p110α protein levels increased in MCF-7 cells stably transfected with wt-YB-1, while decreased in those with stable YB-1 S102A (Supplementary Figure S3.2). These data suggest a positive correlation between p110α and P-YB-1S102 and further demonstrate the importance of the S102 site for induction of PIK3CA.  3.3.4 LOSS OF YB-1 RESULTS IN A DECREASE IN PI3K ACTIVITY AND THE DOWNSTREAM SIGNALLING Similar to the decrease in transcript and protein levels, silencing YB-1 or PIK3CA decreased PI3K activity as indicated by an in vitro kinase assay (Figure 3.5a). Furthermore, this reduction in PI3K activity translated to a decrease in downstream signalling in SUM149 (Figure 3.5b), HCC1937 (data not shown), and MDA-MB-231 (Figure 3.5b) cells. Upon serum stimulation, there was a decrease in phosphorylation of the S6 ribosomal protein (PS6RPS235/236), a downstream target of the PI3K pathway, subsequent to silencing YB-1 or PIK3CA compared to the scrambled control. The S6RP is phosphorylated by p70S6 kinase which is activated downstream of AKT (Anjum and Blenis, 2008). To our surprise, none of the three cell lines exhibited a decrease in P-AKT or P-p70S6K following YB-1 or PIK3CA 143  knockdown. Therefore, we queried if loss of p110α affected P-S6RP levels in an AKTindependent manner. Alternatively, the p90 ribosomal S6 kinase (RSK) is also known to phosphorylate S6RP on its Ser235/236 residue (Roux et al., 2007). Indeed, similar to P-S6RP, PRSKS380 levels decreased after reduction in p110α subsequent to silencing YB-1 or PIK3CA. Therefore, in all three cell lines tested (SUM149 (Figure 3.5b), HCC1937 (data not shown), and MDA-MB-231 (Figure 3.5b), loss of p110α decreased P-RSKS380 and P-S6RPS235/236 in an AKTindependent manner. Interestingly, however, in SUM102 cells with an activating mutant PIK3CA, loss of p110α post YB-1 or PIK3CA silencing, decreased P-AKTS473 in addition to PRSKS380 and P-S6RPS235/236 (Figure 3.5c). Thus, we show for the first time that interrupting YB-1 has a major inhibitory effect on p110α kinase activity. Importantly, we placed RSK and S6RP as major components of the p110α downstream signalling cascade which further elucidates the impact of disrupting YB-1. However, it remains unclear why there is a shift in signalling towards the AKT pathway when PIK3CA is mutated. Recently published data further support our findings. Interestingly, She et al used a potent inhibitor of AKT1 and AKT2 (AKTi-1/2) on various breast cancer cell lines and demonstrated that those with wild type PIK3CA, including MDA-MB-231 which were utilized in our studies, were resistant to the effect of AKTi-1/2 even at concentrations leading to complete loss of P-AKT, while cells with PIK3CA mutations or HER2 amplifications were uniformly sensitive (She et al., 2008). She et al, concluded that cells with PIK3CA mutations are dependent on AKT signalling whereas those with wild type PIK3CA are not (She et al., 2008). Our data provides further evidence demonstrating that cells with wild type PIK3CA do not signal through P-AKT while those with mutant PIK3CA may (Figures 3.5b and 3.5c). Our study introduces the importance of RSK in mediating p110α signalling. In accordance with our findings, She et al demonstrated that inhibition of AKT1/2 in HCC1806, a  144  triple negative cell line with wild type PIK3CA, did not reduce P-S6RPS235/236 despite the fact that P-AKTS473 and p70S6KT389 levels were decreased (She et al., 2008). We suspect this is because RSK remains activated. In support of this idea, RSK has been reported to phosphorylate S6RP on its S235/236 residue (Roux et al., 2007). We showed that P-RSK levels decreased with the loss of p110α following YB-1 or PIK3CA knockdown (Figures 3.5b and 3.5c), demonstrating that phosphorylation of this protein is also PI3K dependent. Although RSK has been implicated in cancer (Carriere et al., 2008), the current knowledge about its role in breast cancer is limited. Smith et al. reported that RSK activity is elevated in breast cancer (Smith et al., 2005) and subsequent studies by the same group later reported this to be common to prostate cancers as well (Clark et al., 2005). Interestingly, similar to AKT, RSK binds to substrates with RXRXXS motifs (Anjum and Blenis, 2008); thereby it is likely that they may have overlapping functions in cells. Indeed, we have recently demonstrated that RSK, similar to AKT, can phosphorylate YB-1 on its S102 residue in BLBC (Stratford et al., 2008). Our findings suggest the presence of a positive feedback loop by which P-YB-1S102 induces p110α, increasing PI3K activity, thereby leading to further increases in P-RSK. The regulation of RSK is complex and is known  to  require  phosphorylation  by  mitogen-activated  protein  kinase  (MAPK),  phosphoinositide-dependent kinase-1 (PDK1), and its own C-terminal kinase domain (Anjum and Blenis, 2008). PDK1 gets recruited to the cell membrane via binding of its pleckstrin homology domain to PtdIns(3,4,5)P3 generated upon PI3K activation (Vanhaesebroeck and Alessi, 2000). Interestingly, silencing YB-1 or PIK3CA in SUM149 (Figure 3.5d) and HCC1937 (data not shown) cells decreased localization of phosphorylated PDK1S241 to the cell membrane compared to the scrambled control, thereby suggesting reduced PI3K activity. This decrease in PDK1 membrane localization could provide an explanation for the parallel decrease in P-RSK levels post YB-1 or PIK3CA knockdown. However, it has been suggested that the  145  phosphorylation of RSK by PDK1 can in some cell types be PI3K-independent (Anjum and Blenis, 2008). In regard to breast cancer, we ascertain that p110α utilizes the RSK pathway.  3.3.5 THE YB-1/p110α/uPA NETWORK INDUCES BLBC CELL INVASION Invasion is a fundamental cellular event and a defining feature of cancer that separates lesions that are benign from those that are malignant. Silencing YB-1 or PIK3CA decreased the number of SUM149 and HCC1937 cells invading through Matrigel (Figure 3.6a). Interestingly, transfection of the YB-1 knockdown cells with a constitutively active p110α construct (p110αCAAX) reversed this phenotype (Figure 3.6a). This suggests that regulation of invasion by YB-1 may be dependent on PI3K activity. To understand why this may be the case, we turned to the invasion protease urokinase plasminogen activator (uPA), as we previously reported that it is important for motility of breast cancer cells in a PI3K-dependent manner (Dunn et al., 2001). We confirmed that silencing uPA (siuPA) decreased invasion of SUM149 and HCC1937 cells through Matrigel (Supplementary Figure S3.3a). Furthermore, silencing YB-1 decreased uPA transcript (Figure 3.6b) and protein (Supplementary Figure S3.3b) levels in SUM149 and HCC1937 cells, and this effect was mirrored by knocking down PIK3CA (Figures 3.6b and S3.3b). These results were corroborated in MDA-MB-231 and MDA-MB-468 cells (data not shown). In addition, SUM149 cells expressing stable shYB-1 expressed 70% less uPA transcript and protein compared to control (data not shown). Interestingly, expression of p110α-CAAX in siYB-1 treated cells rescued both the uPA transcript (Figure 3.6b) and protein (Supplementary Figure S3.3b) levels, suggesting that regulation of uPA by YB-1 may be dependent on PI3K activity. Furthermore, the uPA transcript (Figure 3.6c) and protein (Supplementary Figure S3.3c) levels increased with over-expression of wt-YB-1, and were further enhanced with expression of YB-1 S102D, while no change was observed with expression of YB-1 S102A. Combination of these findings suggests that uPA is induced by P-YB-1S102 in a PI3K-dependent manner. 146  It has previously been shown that the PI3K signalling pathway regulates expression of uPA through activation of NFκB (Sliva et al., 2002). NFκB is a dimer protein that is retained in the cytoplasm as an inactive form by binding to IκB. Phosphorylation of IκB leads to its degradation, and the release and entry of NFκB into the nucleus where it can interact with promoter sequences (Rayet and Gelinas, 1999). RSK has been shown to phosphorylate IκBα on its S32/36 residue (Ghoda et al., 1997). Silencing YB-1 or PIK3CA decreased P-RSKS380 as well as its downstream target P-IκBαS32/36 (Figure 3.6d). In addition, transfection of p110α-CAAX rescued both P-RSKS380 and P-IκBαS32/36 levels (Figure 3.6d). Therefore, decreased phosphorylation of RSK and thus IκBαS32/36 may be one mechanism by which loss of p110α following YB-1 or direct PIK3CA knockdown reduces uPA levels and thereby decreases invasion. Taken together, we report a novel regulation of PIK3CA by YB-1 and elucidate a pathway that leads to cellular invasion (Figure 3.7). Here we show that expression of PIK3CA, whether wild type, mutant, or amplified, is dependent on YB-1. Once p110α is induced, its kinase activity is up-regulated leading to the activation of signalling through either AKT or RSK, depending on whether PIK3CA is mutated or not. Activated AKT (Sutherland et al., 2005) or RSK (Stratford et al., 2008) phosphorylate YB-1 on its S102 site thereby allowing it to shuttle into the nucleus where it binds to the PIK3CA promoter to induce more p110α. This feed forward loop also causes activation of signalling through RSK that enhances cellular invasion via phosphorylation of IκBα (Ghoda et al., 1997), allowing NFκB to enter into the nucleus where it can induce uPA production (Sliva et al., 2002). In closing, we determined for the first time that YB-1, which is a well-established oncogene for development of mammary tumours, utilizes induction of PIK3CA to bestow cellular invasion.  147  3.4 MATERIALS AND METHODS Cell Culture SUM149, HCC1937, MDA-MB-231, and SUM102 cells all express BLBC markers (Neve et al., 2006). SUM149 and SUM102 cells (Asterand, Ann Arbor, MI, USA) were cultured according to Asterand’s recommendations. MDA-MB-231 and HCC1937 cells (ATCC, Manassas, VA, USA) were grown as previously described (Stratford et al., 2007).  siRNA and Plasmid Transfections Cells were transfected with 20nM of siRNA to YB-1, PIK3CA, uPA, and scrambled control using Lipofectamine RNAiMAX (Invitrogen) for 96h. siRNA sequences are listed in Supplementary Table S3.1. The empty vector, wt-YB-1,YB-1 S102A, and YB-1 S102D have previously been described (Sutherland et al., 2005; Wu et al., 2006; Finkbeiner et al., 2009). These constructs have the 3x FLAG tag. The plasmid transfections were performed with 2µg of DNA and Lipofectamine 2000 (Invitrogen), and maintained for 72-96h. For rescue experiments, cells were transfected with p110α-CAAX 48h post-siRNA and maintained for an additional 4872h. The successful transfection of p110α-CAAX in cells was confirmed (data not shown).  Chromatin Immunoprecipitation (ChIP) YB-1 promoter complexes were isolated by ChIP as previously described (Wu et al., 2006). The oligonucleotide sequences are provided in Supplementary Table S3.2.  Electrophoretic mobility shift assay (EMSA) Nuclear and cytoplasmic proteins were fractionated using NE-PER nuclear and cytoplasmic extraction reagents (Pierce Biotechnology, Rockford, IL, USA). EMSAs were 148  carried out using the Lightshift Chemiluminescent EMSA kit (Pierce Biotechnology) as previously described (Stratford et al., 2007). Oligonucleotides used are listed in Supplementary Table S3.3.  PIK3CA Luciferase Assay PIK3CA promoter 1a subcloned into pGL3-basic vector (Promega, Madison, WI, USA) was previously described by us (Astanehe et al., 2008). For over-expression studies, cells were co-transfected with the YB-1 expression vector and both of PIK3CA 1a-pGL3 and pRL-TK. For knockdown studies, cells were transfected with DNA 48h post siRNA treatment. Cells were harvested 24h post-transfection in 1x PLB buffer (Promega) and luciferase activity measured using Dual Luciferase Reporter System (Promega) internally controlled with pRL-TK activity. Successful expression or silencing of YB-1 was confirmed by immunoblotting (data not shown).  Quantitative PCR RNA was isolated using the QIAGEN RNeasy Mini kit (QIAGEN, Mississauga, ON, Canada) and reverse-transcribed with random hexamers and SuperScript III (Invitrogen, Burlington, ON, Canada). TaqMan Universal Master Mix was used with the TaqMan Gene Expression Assay for PIK3CA, uPA, and 18S (Applied Biosystems, Streetsville, ON, Canada), as well as primers and probes for YB-1 to detect transcript levels on an ABI Prism 7000 Sequence Detector. For PIK3CA copy number analysis, genomic DNA was extracted using QIAGEN DNeasy blood and tissue kit (QIAGEN). A panel of breast cancer cell lines was screened by amplifying 10ng of DNA using the TaqMan Gene Expression Assay for PIK3CA and 18S (Applied Biosystems).  149  Immunoblots Proteins were harvested in ELB buffer (Wu et al., 2006). The primary antibodies used were: anti-total YB-1 (generous gift from Dr. Colleen Nelson, University of British Columbia), anti-Flag M2 (Sigma, Oakville, ON, Canada), anti-p110α, anti-P-YB-1S102, anti-P-AKTS473, antiP-S6RPS235/236, anti-P-RSKS380, anti-P-p70S6KT389, anti-P-IκBαS32/S36 and anti-actin (Cell Signalling Technology, Danvers, MA, USA).  Array Comparative Genomic Hybridization (aCGH) HCC1937 and SUM149 were assayed for genetic alterations using the 26,819 duplicate spotted BAC clones (53 638 elements) selected from the previously described submegabase resolution  tiling  set  to  give  optimal  genome  coverage  (available  at:  http://www.bccrc.ca/arraycgh/) (Deleeuw et al., 2007). The BLBC specimens and MDA-MB231 were assayed using a submegabase resolution tiling set (SMRT) aCGH platform as previously described (Shadeo and Lam, 2006; Stratford et al., 2007). To be classified as gain, there has to be a probability >80% (determined by Hidden Markov Model algorithm) and >0.15 log2 ratio (determined by aCGH-Smooth software). NCBI Build 36.1 was used to identify gene locus and BAC position.  Immunofluorescence of frozen xenograft sections and cells SUM149 xenograft frozen sections were fixed in 2% PFA and incubated with rabbit antip110α or rabbit- anti-P-YB-1S102 (Cell Signalling Technology) antibodies diluted in buffer containing 10% bovine serum albumin and 2% goat serum for 1 hour at 21°c in a humidified container. For PDK-1 membrane localization, cells were grown in chamber slides (Nalge Nunc International, Naperville, IL, USA), fixed in 2% PFA 96h post siRNA transfection, permeablized 150  in 0.1% Triton X-100, blocked with protein block (Dako, Mississauga, ON, Canada), and incubated overnight at 4°C with rabbit anti-P-PDK1S241 (Cell Signalling Technology). Alexa488-labelled goat anti-rabbit secondary antibody was used for 1 hour at 21°c, and slides were mounted using Vectashield mounting medium (Vector Laboratories, CA). DAPI or Hoechst dye was used for nuclear staining.  In vitro PI3K activity assay PI3K activity was assayed as previously reported (Gold et al., 1994), with some modifications (See supplementary materials and methods for details).  Invasion assay 96h post-siRNA transfection, cells were used in a Matrigel invasion assay following a protocol previously described (Woo et al., 2007). Invaded cells were stained with 0.5µg/ml of Hoescht 33258 (Sigma), mounted on glass slides, and counted at 5x magnification using a Zeiss Axiophot microscope with a digital camera and Northern Eclipse 6.0 image analyzer (Empix Imaging) (Missaussauga, ON, Canada).  Enzyme-Linked ImmunoSorbent Assay (ELISA) Conditioned media from cells 96h post siRNA or post YB-1 over-expression was diluted 1:5 and analyzed for uPA using Immunobind uPA ELISA Kit (American Diagnostica, Stamford, CT, USA) following manufacturer’s protocol.  151  Statistical Analysis All experiments were repeated at least three times. The results are reported as mean ± SD. Significance was examined using paired student t-test or ANOVA, and p-values <0.05 were considered significant.  3.5 ACKNOWLEDGEMENTS Grant Support: National Cancer Institute of Canada (SED), RO1 CA114017-01A1 (SED and IB), Canadian Institute of Health Research (VD), Canadian Breast Cancer Research Alliance IDEA (WL). AA was supported by the Canadian Institute of Health Research MD/PhD and the Michael Smith Foundation for Health Research Studentships.  152  tetracycline-off shYB-1 (Supplementary Figure S1c). Furthermore, induction of YB-1 with doxycycline (1 mg/ml) in immortalized mammary epithelial cells with a tetracycline-inducible YB-1 expression vector (HTRY#5), increased PIK3CA promoter activity, transcript and p110a levels (Figure 2d). Thus, using 3.6protein FIGURES  Oncogene  show that PIK3CA and its protein product p110a are dependent on this transcription factor. It is interesting to note that neither of SUM149, HCC1937 nor MDA-MB-231 cell lines has known PIK3CA mutations (Hollestelle et al., 2007). Activating mutations of PIK3CA are the most common (26%)  a Promoter 1a  Promoter 1b  -51 657  -50 657  1  2  ChIP 1  3 4 5  ChIP 2  ChIP 1  ChIP 2  Input ChIP  Input ChIP  +1  -50 305  1a  1b  2  6  ChIP 3  ATTG Exon  ChIP 4  ChIP 3  CAAT Intron  ChIP 4  SUM149 HCC1937  b  ChIP  Input ChIP  YB-1 IgY  YB-1 IgY  YB-1 IgY  Input  YB-1 IgY  YB-1 IgY  YB-1 IgY  IgY  YB-1 IgY  YB-1  MDA-MB-231  Supershift Shift  Oligo 1  Unlabeled Oligo  -  + -  YB-1 Antibody  -  CREB Antibody  -  Oligo 2  -  -  + -  -  + -  -  -  -  -  +  Oligo 3  -  -  + -  -  + -  -  -  -  -  +  c  Oligo 4  -  -  + -  -  + -  -  -  -  -  +  Oligo 5  -  -  + -  -  + -  -  -  + -  -  -  -  -  -  +  -  +  Promoter 1a -51 657  -51 300  -50 981  1  2  -50 785 -50 705 -50 745 -50 657  Exon 1a  *  3  *  4  *  5 ATTG CAAT  Shift  Oligo 1  Oligo 3  Oligo 4  Labeled wt Oligo +  -  +  -  +  -  Labeled mutant Oligo -  +  -  +  -  +  Figure 3.1: Mapping YB-1 binding sites on the PIK3CA promoter. (a) Schematic representation of six putative YB-1 binding sites on the PIK3CA promoter. Promoter 1a encompasses a 1kb region upstream of exon 1a, while promoter 1b is upstream of exon 1b. Putative binding sites 1 to 5 are within PIK3CA promoter 1a, and site 6 is within promoter 1b. Nucleotide positions are indicated relative to the translational start site (+1) within 153  exon 2. The location of the ChIP PCR products relative to the potential YB-1 binding sites is also indicated. ChIP of SUM149 and HCC1937 cells demonstrated binding of YB-1 to ChIP regions 1, 2 and 3 within promoter 1a. ChIP of MDA-MB-231 cells indicated binding of YB-1 to ChIP regions 2 and 3. YB-1 binding was not observed in promoter 1b region (ChIP 4). The IgY negative control samples either demonstrated none or less binding compared to the YB-1 pulldown samples. Moreover, the input DNA amplified expected product with all primer sets. (b) EMSA demonstrated a shift using SUM149 nuclear extract and oligonucleotides 1 to 5 corresponding to putative YB-1 binding sites on promoter 1a. Competition reactions were performed with 800-fold excess of unlabelled oligonucleotide. Furthermore, a supershift was demonstrated using an YB-1 antibody (1µg), identifying the oligonucleotide-bound nuclear protein as YB-1. This effect was not observed when an unrelated CREB antibody (1µg) was used as a negative control for the supershift. (c) Mutation of the YB-1 responsive element (YRE) from CAAT to CCCC decreased binding of YB-1 in the SUM149 nuclear extract to oligonucleotides 1, 3, and 4, but not to oligonucleotides 2 and 5. Therefore, sites 1 (position -51 300), 3 (position 50 785), and 4 (position -50 745) within promoter 1a verified as YB-1 binding sites. * indicates verified YB-1 binding sites.  154  The YB-1/PIK3CA/uPA network promotes invasion A Astanehe et al  2410 PIK3CA Promoter Activity (%)  a  120  120  120  100  100  100  80  80  * *  80  * *  60  60  40  40  40  20  20  20  0  0  0  60  and decreased both in the MDA-MB-231 cells. In addition, PIK3CA transcript and p110a protein levels increased in MCF-7 cells stably transfected with wt-YB-1, whereas decreased in those with stable YB-1 S102A (Supplementary Figure S2). These data suggest a positive correlation between p110a and P-YB-1(S102) and further demonstrate the importance of the S102 site for induction of PIK3CA.  * *  siYB-1#2  1ug/ml Doxycycline  siYB-1#1  Control  Scrambled  siYB-1#2  siYB-1#1  Scrambled  siYB-1#1  siYB-1#2  Transcript Levels (%)  PIK3CA Promoter Activity (%)  Scrambled  Transcript Levels (%)  Loss of YB-1 results in a decrease in PI3K activity and the downstream signaling SUM149 HCC1937 MDA-MB-231 Similar to the decrease in transcript and protein levels, Scrambled siYB-1#1 siYB-1#2 silencing YB-1 or PIK3CA decreased PI3K activity as indicated by an in vitro kinase assay (Figure 5a). 120 120 b 120 Furthermore, this reduction in PI3K activity translated to a decrease in downstream signaling in SUM149 100 100 100 (Figure 5b), HCC1937 (data not shown) and MDA-MB80 80 80 231 (Figure 5b) cells. Upon serum stimulation, there was * * * 60 60 60 * a decrease in phosphorylation of the S6 ribosomal * 7 * protein (P-S6RP(S235/236)), a downstream target of the 40 40 40 PI3K pathway, subsequent to silencing YB-1 or 20 20 20 * PIK3CA compared to the scrambled control. The * ** ** 0 0 0 S6RP is phosphorylated by p70S6 kinase which is YB-1 PIK3CA YB-1 PIK3CA YB-1 PIK3CA activated downstream of AKT (Anjum and Blenis, 2008). To our surprise, none of the three cell lines SUM149 HCC1937 MDA-MB-231 exhibited a decrease in P-AKT or P-p70S6K following siYB-1#1 Scrambled siYB-1#2 YB-1 or PIK3CA knockdown. Therefore, we queried if loss of p110a affected P-S6RP levels in an AKTc independent manner. Alternatively, RSK is also known to phosphorylate S6RP on its Ser235/236 residue (Roux et al., 2007). Indeed, similar to P-S6RP, P-RSK(S380) p110α levels decreased after reduction in p110a subsequent to silencing YB-1 or PIK3CA. Therefore, in all three YB-1 cell lines tested (SUM149, Figure 5b; HCC1937, data Actin not shown; MDA-MB-231, Figure 5b), loss of p110a decreased P-RSK(S380) and P-S6RP(S235/236) in an SUM149 HCC1937 MDA-MB-231 AKT-independent manner. Interestingly, however, in 14000 d 180 SUM102 cells with an activating mutant PIK3CA, loss * * 160 of p110a after YB-1 or PIK3CA silencing, decreased 13900 P-AKT(S473) in addition to P-RSK(S380) and P-S6RP(S235/236) 140 400 * (Figure 5c). Thus, we show for the first time that 120 300 interrupting YB-1 has a major inhibitory effect on 100 p110a kinase activity. Importantly, we placed RSK and 200 80 p110α S6RP as major components of the p110a downstream 60 100 signaling cascade that further elucidates the impact of YB-1 40 0 disrupting YB-1. However, it remains unclear why there YB-1 PIK3CA Actin 20 is a shift in signaling toward the AKT pathway when 0 HTRY#5 PIK3CA is mutated. HTRY#5 HTRY#5 Recently published data further support our findings. Control 1ug/ml Doxycycline Interestingly, She et al. (2008) used a potent inhibitor of Figure 2 Y-box binding protein-1 (YB-1) induces the PIK3CA AKT1 and AKT2 (AKTi-1/2) on various breast cancer promoter. (a) SUM149, HCC1937 and MDA-MB-231 cells were cell lines and demonstrated that those with wild-type Figure 3.2: YB-1 induces the PIK3CA promoter. transfected with a luciferase reporter construct containing PIK3CA PIK3CA, including MDA-MB-231 that were used in our promoter 1a. The PIK3CA promoter activity decreased in all three (a) SUM149, HCC1937, and MDA-MB-231 cells were transfected withto atheluciferase reportereven at studies, were resistant effect of AKTi-1/2 cell lines after silencing YB-1 with siYB-1#1 and siYB-1#2. construct containing PIK3CA promoter 1a. The PIK3CA promoter activity decreased in all (b) PIK3CA transcript levels determined by quantitative real-time concentrations leading to complete loss three of P-AKT, PCR, and (c) p110a protein levels demonstrated by immunoblots, whereas cells(b) with PIK3CAtranscript mutationslevels or HER2 celldecreased lines inafter silencing YB-1 with siYB-1#1 and siYB-1#2. PIK3CA SUM149, HCC1937 and MDA-MB-231 cells after amplifications were uniformly sensitive. They determined by (d) quantitative real-time PCR, and (c)that p110α protein levels demonstrated concluded by siYB-1 treatment. Induction of YB-1 in HTRY#5 cells with cells with PIK3CA mutations are dependent on doxycycline (1 mg/ml) increased PIK3CA promoter activity, tranimmunoblots, in SUM149, and signaling MDA-MB-231 cells with after siYB-1 AKT whereas those wild-type PIK3CA script and p110a decreased protein levels. Asterisk (*) representsHCC1937, P-value o0.05 comparing the labeled group to the scrambled control.cells with aredoxycycline not. Our data(1µg/ml) provide further evidence demonstrattreatment. (d) Induction of YB-1 in HTRY#5 increased PIK3CA ing that cells with wild-type PIK3CA do not signal  promoter activity, transcript, and p110α protein levels. * represents p-value < 0.05 comparing the labelled group to the scrambled control.  Oncogene  155  The YB-1/PIK3CA/uPA network promotes invasion A Astanehe et al  20  *  60  p110α  40 20  **  0  YB-1  **  0  Actin  YB-1 PIK3CA  YB-1 PIK3CA  Scrambled  siYB-1#1 -1  siYB-1#2 +1  -1  +1  PIK3CA Copy Number  +1  MCF-7  SUM102  MCF-7  SUM102  -1  *  siYB-1#2  * *  40  siYB-1#1  80  60  Scrambled  100  80  siYB-1#2  100  siYB-1#1  120  Scrambled  Transcript Levels (%)  2411 120  BLBC  7 6 5 4 3  HMEC LumA  LumB  Her-2  2 1 0  PIK3CA  MDA-MB-231 -1  +1  HCC1937  -1  +1  -1  SUM149 +1  -1  +1  -1  +1  -1  +1  -1  +1  -1  +1  -1  +1  -1  +1  PIK3CA  A  B  C  D  E  F  G  H  *  I  J  *  *  Figure 3 Expression of PIK3CA, whether wild type, mutant or amplified, is dependent on Y-box binding protein-1 (YB-1). (a) Knocking down YB-1 decreased PIK3CA transcript and (b) p110a protein levels in SUM102 and MCF-7 cells both of which harbor activating mutant PIK3CA. Asterisk (*) represents P-value o0.05 comparing the labeled group to the scrambled control. (c) Basal-like breast carcinoma (BLBC) cell lines SUM149, HCC1937 and MDA-MB-231 were evaluated for genomic copy number change by array comparative genomic hybridization (aCGH). Log2 scale bars ( þ /À1.0 ) are included for reference. Displacements of data points to the right and left of the center line represent gain and loss, respectively. Copy number gains were observed at the PIK3CA locus (3q26.32) in HCC1937 and MDA-MB-231. (d) Quantitative real-time PCR using genomic DNA extracted from a panel of breast cancer cells and the immortalized human mammary epithelial cells (HMEC) demonstrated PIK3CA copy number gains in the BLBC cell lines MDAMB-231 (3.7 copies) and the HCC1937 (5.6 copies). (e) Ten primary BLBC tumors were evaluated for genomic amplifications by aCGH. Log2 scale bars ( þ /À1.0) are included for reference. Copy number gains at the PIK3CA locus were observed in BLBC specimens E, I and J (*). Specimens A–D and F–H did not meet the two criteria stated in the Materials and methods section to be classified as having gains in PIK3CA.  Figure 3.3: Expression of PIK3CA, whether wild type, mutant, or amplified, is dependent on YB-1. (a) Knocking down YB-1 decreased PIK3CA transcript and (b) p110α protein levels in SUM102 and MCF-7 cells both of which harbour activating mutant PIK3CA. * represents p-value <0.05 comparing the labelled group to the scrambled control. (c) BLBC cell lines SUM149, HCC1937, and MDA-MB-231 were evaluated for genomic copy number change by aCGH. +/-1.0 Log2 scale bars are included for reference. Displacements of data points to the right and left of the through P-AKT whereas those with mutant PIK3CA findings, She et al. (2008) demonstrated that inhibition represent gain and loss, respectively. number gains were observed at the maycentre (Figuresline 5b and c). of AKT1/2Copy in HCC1806, a triple-negative cell line with Our study introduces the importance of RSK and in MDA-MB-231. wild-type PIK3CA,(d) didQuantitative not reduce P-S6RP PIK3CA locus (3q26.32) in HCC1937 real-time PCR using despite the fact that P-AKT and p70S6K levels mediating p110a signaling. In accordance with our genomic DNA extracted from a panel of breast cancer cells and immortalized human mammary Oncogene epithelial cells (HMEC) demonstrated PIK3CA copy number gains in BLBC cell lines MDAMB-231 (3.7 copies) and HCC1937 (5.6 copies). (e) Ten primary BLBC tumours were evaluated for genomic amplifications by aCGH. +/-1.0 Log2 scale bars are includes for reference. Copy number gains at the PIK3CA locus was observed in BLBC specimens E, I and J (*). Specimens A-D and F-H did not meet the two criteria stated in the materials and methods section to be classified as having gains in PIK3CA. (S235/236)  (S473)  (T389)  156  The YB-1/PIK3CA/uPA network promotes invasion A Astanehe et al  40  20  20  200 150 100 50  Ψ  * *  Control  wt YB-1  YB-1 S102D  MDA-MB-231  YB-1 S102A 275 250 225 200 175 150 125 100 75 50 25 0  HCC1937  SUM149  Control  YB-1 S102D  Ψ  *  *  *  MDA-MB-231  YB-1 S102A YB-1 S102A  *  250  wt YB-1  YB-1 S102D  300  0  HCC1937  220 200 180 160 140 120 100 80 60 40 20 0  *  Merged p110α/DAPI  p110α  60  40  wt YB-1  Ψ  350  0  80  60  Control  p110α  100  80  YB-1 S102A  Control  PIK3CA Transcript Levels (%)  Merged P-YB-1(S102) /DAPI  120  100  0  *  140  120  SUM149  400  160  *  140  YB-1 S102D  P-YB-1(S102)  *  180  160  *  wt YB-1  shYB-1  180  Ψ  200  *  Control  Control  BLBC  Ψ  200  *  YB-1 S102A  HMEC LumA LumB Her-2  Ψ  YB-1 S102D  T-YB-1  240 220 200 180 160 140 120 100 80 60 40 20 0  wt YB-1  P-YB-1(S102)  PIK3CA Promoter Activity (%)  p110α  SUM149  MDA-MB-231  HCC1937  MDA-MB-453  BT474-m1  MCF-7  184htert  2412  p110α Flag YB-1 YB-1  Merged p110α/DAPI  Actin SUM149  HCC1937  MDA-MB-231  Figure 4 Y-box binding protein-1 (YB-1) induces PIK3CA transcription in a manner dependent on S102 phosphorylation. (a) Western blot analysis of a panel of breast cancer cell lines indicated that p110a and phospho-YB-1(S102) levels correlate and are higher in the basal-like breast carcinoma (BLBC) subtype. The T-YB-1 levels were similar among the different cancer cell lines, although higher relative to the 184htert nontumorigenic line. (b) The shYB-1 SUM149 xenografts have decreased levels of P-YB-1(S102) and p110a compared to the empty vector control SUM149 xenografts. DAPI (46-diamidino-2-phenyl indole) was used for nuclear staining. The scale bars indicate 10 mm. (c) The PIK3CA promoter activity increased with overexpression of wt-YB-1, and even more with the expression of YB-1 S102D (active phospho-mimic mutant), whereas no induction was observed with expression of YB-1 S102 (inactive mutant) compared to the vector control. (d) PIK3CA transcript levels, as determined by quantitative real-time RTS102A PCR, and (e) p110a protein levels as demonstrated by immunoblots, increased in SUM149, HCC1937 and MDA-MB-231 cells after expression of wt-YB-1 and further enhanced after expression of YB-1 S102D. No induction was observed after the expression of YB-1 S102A. The Flag antibody was used to detect the YB-1 constructs that are tagged with 3  Flag. Asterisk (*) represents P-value S102 o0.05 comparing the labeled group to the scrambled control. Symbol c represents P-value o0.05 comparing the two indicated groups.  Figure 3.4: YB-1 induces PIK3CA transcription in a manner dependent on S102 phosphorylation. (a) Western blot analysis of a panel of breast cancer cell lines indicated that p110α and phosphoYB-1 levels correlate and are higher in the BLBC subtype. The T-YB-1 levels were similar amongst different cancer cell lines, although higher relative to the 184htert non-tumourigenic line. (b) The shYB-1 SUM149 xenografts have decreased levels of P-YB-1 and p110α compared to the empty vector control SUM149 xenografts. DAPI was used for nuclear staining. were decreased. We suspect this is because RSK remains cancer (Carriere et al., 2008), the current knowledge The scaleInbars indicate 10µm. ThehasPIK3CA promoter activity increased withis over-expression activated. support of this idea,(c) RSK been about its involvement in breast cancer limited. Smith reported to phosphorylate its S235/236 residue et (2005)S102D reported(active that RSK activity is elevated in of wt-YB-1, and evenS6RP moreonwith the expression of al. YB-1 phospho-mimic mutant), (Roux et al., 2007). We showed that P-RSK levels breast cancer and subsequent studies by the same group while no with induction observed withYB-1 expression of reported YB-1 S102A mutant) decreased the losswas of p110a following or later this to be(inactive common to prostate compared cancers as to PIK3CA knockdown 5b and c), demonstrating wellas (Clark et al., 2005). similar to AKT, RTthe vector control.(Figures (d) PIK3CA transcript levels, determined byInterestingly, quantitative real-time that the phosphorylation of this protein is also PI3K RSK binds to substrates with RxRXXS motifs (Anjum PCR, and Although (e) p110α levels as demonstrated by2008); immunoblots, increased SUM149, dependent. RSKprotein has been implicated in and Blenis, thereby it is likely that theyin may have HCC1937, and MDA-MB-231 cells after expression of wt-YB-1 and further enhanced after Oncogene expression of YB-1 S102D. No induction was observed after the expression of YB-1 S102A. The flag antibody was used to detect the YB-1 constructs which are tagged with 3x Flag. * represents p-value <0.05 comparing the labelled group to the scrambled control. Ψ represents pvalue <0.05 comparing the two indicated groups. 157  The YB-1/PIK3CA/uPA network promotes invasion A Astanehe et al  120  120  100  100  100 80  80  40  20  20  Scrambled  siYB-1#1  siYB-1#2  siYB-1#1  Scrambled  Serum stimulated siPIK3CA  siYB-1#2  siYB-1#1  Scrambled  Serum starved  0  HCC1937  *  MDA-MB-231  siPIK3CA  Serum starved  Serum stimulated siPIK3CA  0  SUM149  * *  siYB-1#2  0  40  Scrambled  20  60  *  siPIK3CA  *  40  *  siYB-1#1  60  siYB-1#1  *  Scrambled  60  *  siPIK3CA  *  siYB-1#2  80  siYB-1#2  PI3K Activity (%)  2413 120  P-S6RP(S235/236) P-RSK(S380) P-AKT(S473) P-p70S6K(T389) p110α YB-1 Actin MDA-MB-231  siPIK3CA  siYB-1#2  Scrambled siYB-1#1  Scrambled  SUM149 siYB-1 #1  siYB-1 #2  siPIK3CA  P-PDK1(S241)  P-S6RP(S235/236) P-RSK(S380) P-AKT(S473)  Hoechst  P-p70S6K(T389) p110α YB-1  Merged  Actin SUM102  SUM149  Figure 5 Silencing Y-box binding protein-1 (YB-1) decreases phosphatidylinositol-3-kinase (PI3K) activity. (a) Knocking down YB-1 decreased the ability of the lysates to phosphorylate phosphatidylinositols in an in vitro PI3K assay. Knocking down PIK3CA resulted in a similar decrease in PI3K activity. PI3K activity is represented as a percentage change relative to the scrambled control. (b) YB-1 or PIK3CA was silenced in SUM149 and MDA-MB-231 cells for 96 h. These cells were serum-starved for 16 h and subsequently stimulated with 10% serum for 45 min. On serum stimulation, siYB-1 or siPIK3CA cells demonstrated decreased phosphorylation of RSK(S380) and S6RP(S235/236) compared to the scrambled control, but not of AKT(S473) and p70S6K(T389). (c) In SUM102 cells harboring mutant PIK3CA, silencing YB-1 or PIK3CA decreased P-AKT(S473), P-RSK(S380) and P-S6RP(S235/236) levels. (d) Membrane localization of P-PDK1(S241) decreased in SUM149 cells after silencing YB-1 or PIK3CA compared to the scrambled control. Hoechst dye was used for nuclear staining.  Figure 3.5: Silencing YB-1 decreases PI3K activity. (a) Knocking down YB-1 decreased the ability of lysates to phosphorylate phosphatidylinositols in an in vitro PI3-kinase assay. Knocking down PIK3CA resulted in a similar decrease in PI3K activity. PI3K activity is represented as a percentage change relative to the scrambled control. (b) YB-1 or PIK3CA were silenced in SUM149 and MDA-MB-231 cells for a Oncogene total of 96h. These cells were serum starved for 16h and subsequently stimulated with 10% serum for 45min. Upon serum stimulation, siYB-1 or siPIK3CA cells demonstrated decreased phosphorylation of RSKS380 and S6RPS235/236 compared to the scrambled control, but not of AKTS473 and p70S6KT389. (c) In SUM102 cells harbouring mutant PIK3CA, silencing YB-1 or PIK3CA decreased P-AKTS473, P-RSKS380, and P-S6RPS235/236 levels. (d) Membrane localization of PPDK1S241 decreased in SUM149 cells after silencing YB-1 or PIK3CA compared to the scrambled control. Hoechst dye was used for nuclear staining. 158  The YB-1/PIK3CA/uPA network promotes invasion A Astanehe et al  Ψ  200  Ψ  Ψ  Ψ  200  150  100  SUM149  *  0  Control  SUM149 wt YB-1  0  siYB-1#2  P-RSK(S380)  50  100  siYB-1#1  * 100  Scrambled  150  300 200  + p110α-CAAX  siPIK3CA  400  *  200  siYB-1#2  *  Ψ  siYB-1#1  500  HCC1937  Scrambled  uPA Transcript Levels (%)  250  siYB-1#2  p110α-CAAX  p110α-CAAX  Ψ  siYB-1#1  *  Ψ  Scrambled  *  siPIK3CA  *  Ψ  siYB-1#2  Ψ  siYB-1#1  180 160 140 120 100 80 60 40 20 0  Scrambled  siYB-1#2  siPIK3CA  siYB-1#1  * Scrambled  * siYB-1#2  siYB-1#1  *  Scrambled  uPA Transcript Levels (%)  Ψ  HCC1937  Ψ  Ψ  siYB-1 #2  p110α-CAAX  SUM149  140 120 100 80 60 40 20 0  siYB-1 #1  *  *  Scrambled  *  siPIK3CA  0  Scrambled  siYB-1 #2  siYB-1 #1  siPIK3CA  50  siYB-1 #2  * Scrambled  * siYB-1 #2  0  siYB-1 #1  *  50  siYB-1 #1  100  p110α-CAAX  600  Ψ  150  Scrambled  Invaded Cells (%)  2415 Ψ  P-IκBα(S32/36) Actin HCC1937  YB-1 S102D  HCC1937  YB-1 S102A  Figure 6 Phosphatidylinositol-3-kinase (PI3K) rescues the inhibition of invasion by siYB-1. (a) Silencing Y-box binding protein-1 (YB-1) or PIK3CA decreased the number of cells that invade through Matrigel. Expression of p110a-CAAX construct in siYB-1treated cells rescued the invasive phenotype. Number of invaded SUM149 and HCC1937 cells is represented as a percentage change relative to the scrambled control. (b) The urokinase plasminogen activator (uPA) transcript levels determined by quantitative real-time PCR decreased after siYB-1 or siPIK3CA treatment in both SUM149 and HCC1937 cells. Furthermore, expression of p110a-CAAX in siYB-1-treated cells rescued the uPA levels. (c) The uPA transcript levels increased after expression of wt-YB-1 and even further after expression of YB-1 S102D. An increase in uPA levels was not detected after expression of YB-1 S102A. (d) Immunoblot of HCC1937 lysates indicates that the levels of P-RSK(S380) and its downstream target P-IkBa(S32/36) decreased with siYB-1 or siPIK3CA treatment. Furthermore, the expression of p110a-CAAX construct in siYB-1-treated cells rescued both the P-RSK(S380) and P-IkBa(S32/36) levels. Asterisk (*) represents P-value o0.05 comparing the labeled group to the scrambled control. Symbol c represents P-value o0.05 comparing the two indicated groups.  Figure 3.6: PI3K rescues the inhibition of invasion by siYB-1. (a) Silencing YB-1 or PIK3CA decreased the number of cells that invade through Matrigel. Expression of p110α-CAAX construct in siYB-1 treated cells rescued the invasive phenotype. Number of invaded SUM149 and HCC1937 cells is represented as a percentage change relative to the scrambled control. (b) The uPA transcript levels determined by quantitative real-time PCR decreased after siYB-1 or siPIK3CA treatment in both SUM149 and HCC1937 cells. Furthermore, expression of p110α-CAAX in siYB-1 treated cells rescued the uPA levels. (c) The with p110a-CAAX 48 h after siRNA and maintained for an Flag tag. The plasmid transfections were performed with 2 mg uPA transcript levels increased after expression ofh.wt-YB-1 and transfection even further after expression of additional 48–72 The successful of p110aof DNA and Lipofectamine 2000 (Invitrogen), and maintained CAAXwas in thenot cellsdetected was confirmed (data not shown). of YB-1 S102A. (d) for 72–96 h. For rescueS102D. experimentsAn the increase cells were transfected YB-1 in uPA levels after expression Immunoblot of HCC1937 lysates indicates that the levels of P-RSKS380 and its downstream Oncogene S32/36 target P-IκBα decreased with siYB-1 or siPIK3CA treatment. Furthermore, the expression of p110α-CAAX construct in siYB-1 treated cells rescued both the P-RSKS380 and P-IκBαS32/36 levels. * represents p-value <0.05 comparing the labelled group to the scrambled control. Ψ represents p-value <0.05 comparing the two indicated groups. 159  The YB-1/PIK3CA/uPA network promotes invasion A Astanehe et al  2416 p110α p85  cytoplasm  ? P-AKT P-RSK P-YB-1 P-S6RP P-YB-1 nucleus  PIK3CA NFκB  uPA  NFκB  P-IκBα  degradation  uPA  Invasion  Expression Assay for PIK3CA, uPA and 18S (Applied Biosystems, Streetsville, Ontario, Canada), as well as primers and probes for YB-1 to detect transcript levels on an ABI Prism 7000 Sequence Detector. For PIK3CA copy number analysis, genomic DNA was extracted using Qiagen DNeasy blood and tissue kit (Qiagen). A panel of breast cancer cell lines was screened by amplifying 10 ng of DNA using TaqMan Gene Expression Assays for PIK3CA and 18S (Applied Biosystems). Immunoblots Proteins were harvested in ELB buffer (Wu et al., 2006). The primary antibodies used were anti-total YB-1 (generous gift from Dr Colleen Nelson, University of British Columbia), anti-Flag M2 (Sigma, Oakville, Ontario, Canada), anti-p110a, anti-P-YB-1(S102), anti-P-AKT(S473), anti-P-S6RP(S235/236), anti-PRSK(S380), anti-P-p70S6K(T389), anti-P-IkBa(S32/S36) and anti-actin (Cell Signaling Technology, Danvers, MA, USA).  Figure 7 Proposed pathway of invasiveness in basal-like breast carcinoma (BLBC). Y-box binding protein-1 (YB-1) is phosphoryFigure Proposed pathway of ribosomal invasiveness Array comparative genomic hybridization lated on3.7: its S102 site by AKT and the p90 S6 kinasein BLBC. (RSK). This phosphorylation allows YB-1 to shuttle into the HCC1937 and SUM149 were assayed for genetic alterations YB-1 is phosphorylated S102promoter site by inducing AKT and RSK. This phosphorylation allows YB-1 to nucleus where it binds to on the its PIK3CA using the 26 819 duplicate spotted BAC clones (53 638 transcription. p110a levels further lead toto increased shuttle into The the elevated nucleus where it binds the PIK3CA promoter transcription. elements) selected inducing from the previously described The submegabase phosphatidylinositol-3-kinase (PI3K) activity and the eventual resolution tiling (SMRT) set to give optimal genome coverage (S380) elevated p110α levels further lead to increased PI3K activity and the eventual phosphorylation , a mechanism that is not well phosphorylation of RSK (available at: http://www.bccrc.ca/arraycgh/; Deleeuw et al., S380Activated RSK then phosphorylates S6RP(S235/236) as understood. of well RSK , a mechanism that is not well understood. RSK then phosphorylates 2007). Activated The BLBC specimens and MDA-MB-231 were assayed (S32/36) . Once IkBa is phosphorylated it dissociates from as IkBa S235/236 S32/36 using an SMRT aCGH platform as previously S6RP as (NFkB) well asandIκBα OncecanIκBα is phosphorylated it dissociates from NFκB and isdescribed nuclear factor-kB is degraded.. NFkB then enter (Shadeo and Lam, 2006; Stratford et al., 2007). To be classified the nucleus and bind to the uPA promoter thereby inducing its degraded. NFκB then uPA enter theincrease nucleus and bind astogain, the there uPAhas promoter thereby inducing its to be a probability >80% (determined by transcription. Finally can the elevated levels invasion.  Markov transcription. Finally the elevated uPA levels increase Hidden invasion.  Model algorithm) and >0.15 log2 ratio (determined by aCGH-Smooth software). NCBI Build 36.1 was used to identify gene locus and BAC position.  Chromatin immunoprecipitation YB-1 promoter complexes were isolated by ChIP as previously described (Wu et al., 2006). The oligonucleotide sequences are provided in Supplementary Table S2. Electrophoretic mobility shift assay Nuclear and cytoplasmic proteins were fractionated using NE-PER nuclear and cytoplasmic extraction reagents (Pierce Biotechnology, Rockford, IL, USA). EMSAs were carried out using the Lightshift Chemiluminescent EMSA kit (Pierce Biotechnology) as previously described (Stratford et al., 2007). Oligonucleotides used are listed in Supplementary Table S3. PIK3CA luciferase assay PIK3CA promoter 1a subcloned into a pGL3-basic vector (Promega, Madison, WI, USA) was previously described by us (Astanehe et al., 2008). For the overexpression studies, cells were co-transfected with the YB-1 expression vector and both of PIK3CA 1a-pGL3 and pRL-TK. For knockdown studies, cells were transfected with DNA 48 h after siRNA treatment. Cells were harvested 24 h after transfection in 1  PLB buffer (Promega) and luciferase activity was measured using Dual Luciferase Reporter System (Promega) internally controlled with pRL-TK activity. Successful expression or silencing of YB-1 was confirmed by immunoblotting (data not shown). Quantitative PCR RNA was isolated using the Qiagen RNeasy Mini kit (Qiagen, Mississauga, Ontario, Canada) and reverse-transcribed with random hexamers and SuperScript III (Invitrogen). TaqMan Universal Master Mix was used with the TaqMan Gene  Immunofluorescence of xenograft sections and cells SUM149 xenograft frozen sections were fixed in 2% paraformaldehyde (PFA) and incubated with rabbit anti-p110a or rabbit-anti-P-YB-1(S102) (Cell Signaling Technology) antibodies diluted in buffer containing 10% bovine serum albumin and 2% goat serum for 1 h at 21 1C in a humidified container. For PDK-1 membrane localization, cells were grown in chamber slides (Nalge Nunc International, Naperville, IL, USA), fixed in 2% PFA 96 h after siRNA transfection, permeabilized in 0.1% Triton X-100, blocked with protein block (Dako, Mississauga, Ontario, Canada) and incubated overnight at 4 1C with rabbit anti-P-PDK1(S241) (Cell Signaling Technology). Alexa-488-labeled goat anti-rabbit secondary antibody was used for 1 h at 21 1C, and slides were mounted using Vectashield mounting medium (Vector Laboratories, Burlingame, CA, USA). DAPI (46-diamidino-2-phenyl indole) or Hoechst dye was used for nuclear staining. in vitro PI3K activity assay PI3K activity was assayed as previously reported (Gold et al., 1994), with some modifications (see Supplementary materials and methods for details). Invasion assay At 96 h after siRNA transfection, cells were used in a Matrigel invasion assay following a protocol previously described (Woo et al., 2007). Invaded cells were stained with 0.5 mg/ml of Hoechst 33258 (Sigma), mounted on glass slides and counted at  5 magnification using a Zeiss Axiophot microscope with a digital camera and Northern Eclipse 6.0 image analyzer (Empix Imaging) (Mississauga, Ontario, Canada).  Oncogene  160  3.7 SUPPLEMENTARY DATA 3.7.1 SUPPLEMENTARY MATERIALS AND METHODS Generation of stable shRNA SUM149 cells A pSuper plasmid harbouring an established shYB-1 sequence (van Roeyen et al.,2005) (a gift from Dr. Peter Mertens, Aachen, Germany) was digested with EcoRI and HindIII to eject and isolate the approximately 200 bp H1 RNA promoter and YB-1-specific RNAi sequence. The 200 bp fragment was cloned into a pSuper shuttle vector, and further digested with BamHI and NheI. The RNAi sequence and corresponding promoter was inserted at position 2376 into the KA391 lentivector (Raouf et al., 2005) with a modified yellow fluorescence protein (YFP). A Lenti-EV plasmid was also constructed by inserting the H1 promoter with no shRNA sequence into the KA391 lentivector at the same location. Lenti-EV and Lenti-shYB-1 viruses were produced, purified, and titred as previously described (Raouf et al., 2005). SUM149 cells were grown in log-phase in their described medium and infected with either the purified LentiEV or Lenti-shYB-1 virus as previously described (Raouf et al., 2005). Successful transfectants were selected based on fluorescence analysis by the BD FACSVantage flow cytometry system, and the top 20% of YFP+ cells were isolated and propagated in culture. The pSuper shuttle vector, KA391 lentivector with modified YFP, virus production reagents, virus purification reagents, and selection of successfully infected SUM149 cells materials were generous gifts from Dr. Connie Eaves, Vancouver, Canada.  Generation of conditional shRNA SUM149 cells To establish stable cells with conditional expression of shRNA directed at YB-1, the MicroRNA-30-adapted shRNAmir retroviral system (Open Biosystems, Huntsville, AL) was used in conjunction with the Tet-off system (Invitrogen). A pSM2 vector containing the YB-1-  161  specific shRNAmiR mapping to the 3’-untranslated region of YB-1 (target sequence: CTCCGGTTTAGTCATCCAACAAT) was purchased from Open Biosystems and the 110 bp insert was excised using XhoI/EcoRI. This insert was ligated into the tetracycline-regulated retroviral vector- SIN-TREmiR30-PIG (TMP) and the resulting construct sequenced for verifying accuracy. In parallel, an shRNAmiR insert designed to have no target in the human transcriptome (Non-silencing shRNA, ATCTCGCTTGGGCGAGAGTAAG) was isolated and cloned into the TMP vector. Retroviral supernatant was generated as described before (Berquin et al., 2005) and used to infect SUM149 cells previously transduced with pRevTet-Off-IN (Invitrogen, Carlsbad, CA) and selected with G418. The resulting SUM149-YBshRNA cells and SUM149-NSshRNA control cells were selected with 1µg/ml puromycin in the presence of 100µg/ml G418 and 1µg/ml doxycycline to keep the shRNA turned off. Inducibility of shRNA was verified by immunoblotting for YB-1 at various times following withdrawal of doxycycline, and maximal knockdown of YB-1 was observed by 72h of doxycycline removal.  In vitro PI3K activity assay Cells were harvested in lysis buffer containing 1% NP-40 and spun down to remove nuclei and insoluble material. Lysates were immunoprecipitated using 2µg of anti-p85 N-SH2 antibody (Upstate Biotechnology, Lake Placid, NY, USA) and protein G beads. The immunoprecipitates were washed 3x with 10mM Tris-HCl (pH 7.4), once with the kinase buffer (50µM ATP, 30mM HEPES (pH7.4), 30mM MgCl2, 200µM Adenosine), and re-suspended in 30µL of the kinase buffer. PtdIns were re-suspended in 25mM HEPES (pH 7.4) and 1mM EDTA, and sonicated on ice for 10min. Final concentration of 1µCi of γ-[32P]ATP was added. The PI3K reaction was initiated by adding 10µl of the PtdIns suspension, allowed to proceed for 20min at 30˚C, and terminated by adding 100µl of 1N HCl. Lipids in the organic phase of a  162  chloroform/methanol extraction were dried down and resolved on Silica Gel G-60 thin-layer chromatography (TLC) plates in chloroform:methanol:water:28% ammonium hydroxide (90:70:17:3; v:v:v:v). Radiolabelled PtdIns phosphate was visualized using a phosphoimager. Kinase activity was normalized to total protein in lysates. The level of knockdowns for each sample was confirmed by immunoblotting.  163  3.7.2 SUPPLEMENTARY TABLES  siRNA  siRNA Target Sequence  Manufacturer  siYB-1#1  AGAAGGTCATCGCAACGAA  Dharmacon  siYB-1#2  CCACGCAATTACCAGCAAA  Dharmacon  siPIK3CA  CTCCGTGAGGCTACATTAATA  Qiagen  siuPA  CCGCATGACTTTGACCTGGAAT  Qiagen  Scrambled  AATTCTCCGAACGTGTCACGT  Qiagen  Table S3.1: siRNA Target Sequences.  164  Name  Direction Oligonucleotide Sequence (5’-3’)  ChIP 1  Forward  AAGGTACGCAGCACCAAGAC  Reverse  GACCTTTTGCTATGCCCTCA  Forward  CCCCCGAACTAATCTCGTTT  Reverse  TGAGGGTGTTGTGTCATCCT  Forward  GAAGAGCAGCCCCAACTGTA  Reverse  GAGGGGCAGAGCCTACAATC  Forward  TGGGGAAGAGTTCGTTGTTT  Reverse  ACTTCTCGCTCCCTCTCCTC  ChIP 2 ChIP 3 ChIP 4  Table S3.2: Sequence of ChIP oligonucleotides designed to encompass potential YB-1 binding sites on the PIK3CA promoter.  165  Name  Direction Oligonucleotide Sequence (5’-3’)  Oligo 1 Forward  ATAGTTAGAATTGAATCCTACA  Reverse  TGTAGGATTCAATTCTAACTAT  Oligo 2 Forward  ACTTGCTCCCAATATTCCTTTC  Reverse Wild type  Oligo 3 Forward Reverse Oligo 4 Forward Reverse  GTAGCACATATTGTTACCCTAT ATAGGGTAACAATATGTGCTAC TCCTCGCCTCAATTTCGCTTCC GGAAGCGAAATTGAGGCGAGGA  Oligo 5 Forward  TTCCGGGGGATTGTAGGCTCTG  Reverse  CAGAGCCTACAATCCCCCGGAA  Oligo 6 Forward  AAAAGAGACCAATAAAGTTTAT  Reverse  ATAAACTTTATTGGTCTCTTTTT  Oligo 1 Forward  ATAGTTAGAGGGGAATCCTACA  Reverse  TGTAGGATTCCCCTCTAACTAT  Oligo 2 Forward  ACTTGCTCCCCCCATTCCTTTC  Reverse  Mutant  GAAAGGAATATTGGGAGCAAGT  GAAAGGAATGGGGGGAGCAAGT  Oligo 3 Forward  GTAGCACATGGGGTTACCCTAT  Reverse  ATAGGGTAACCCCATGTGCTAC  Oligo 4 Forward Reverse  TCCTCGCCTCCCCTTCGCTTCC GGAAGCGAAGGGGAGGCGAGGA  Oligo 5 Forward  TTCCGGGGGGGGGTAGGCTCTG  Reverse  CAGAGCCTACCCCCCCCCGGAA  Oligo 6 Forward  AAAAGAGACCCCCAAAGTTTAT  Reverse  ATAAACTTTGGGGGTCTCTTTT  Table S3.3: EMSA oligonucleotide sequences to putative YB-1 binding sites on the PIK3CA promoter.  166  3.7.3 SUPPLEMENTARY FIGURES  Figure S3.1: Silencing YB-1 decreases p110α levels. (a) PIK3CA transcript levels determined by quantitative real-time PCR, and p110α protein levels demonstrated by immunoblots, decreased in SUM149 cells after stable knockdown of YB-1 with shRNA. (b) PIK3CA transcript and p110α protein levels also decreased when SUM149 cells were infected with a lentiviral vector expressing shYB-1. (c) Tet-off expression of YB-1 shRNA in SUM149 cells (doxycycline removal induces shRNA) reduced the p110α protein levels. Control cells: non-silencing (NS) shRNA in the same system. * represents p-value < 0.05 comparing the labelled group to the scrambled control.  167  Figure S3.2: YB-1 induces PIK3CA in a phospho-S102 dependent manner. In MCF-7 cells stably transfected with the vector control, wt-YB-1, or YB-1 S102A, the PIK3CA transcript and p110α protein levels increased with wt-YB-1, while decreased with YB-1 S102A compared to the vector control. The flag antibody was used to detect ectopic YB-1 which were tagged with 3x Flag. * represents p-value <0.05 comparing the labelled group to the scrambled control.  168  Figure S3.3: YB-1 and uPA levels correlate. (a) uPA protein levels determined by ELISA decreased after siYB-1 or siPIK3CA treatment in both SUM149 and HCC1937 cells. Furthermore, expression of p110α-CAAX in siYB-1 treated cells rescued the uPA levels. (b) ELISA was performed to confirm successful knockdown of uPA (siuPA). Silencing uPA decreased the number of SUM149 and HCC1937 cells that invade through the Matrigel. (c) uPA protein levels in SUM149 and HCC1937 cells increased after expression of wt-YB-1 and even further after expression of YB-1 S102D (active phosphomimic). An increase in uPA levels was not detected after expression of YB-1 S102A (inactive mutant). * represents p-value < 0.05 comparing the labelled group to the scrambled control. Ψ represents p-value < 0.05 comparing the two indicated groups. 169  3.8 REFERENCES Anjum R, Blenis J. (2008). The RSK family of kinases: Emerging roles in cellular signalling. Nat. Rev. Mol. Cell Biol. 9:747-758. Astanehe A, Arenillas D, Wasserman WW, Leung PC, Dunn SE, Davies BR et al. (2008). Mechanisms underlying p53 regulation of PIK3CA transcription in ovarian surface epithelium and in ovarian cancer. J. Cell. Sci. 121:664-674. Bachman KE, Argani P, Samuels Y, Silliman N, Ptak J, Szabo S et al. (2004). The PIK3CA gene is mutated with high frequency in human breast cancers. Cancer. Biol. Ther. 3:772-775. Bader AG, Kang S, Vogt PK. (2006). Cancer-specific mutations in PIK3CA are oncogenic in vivo. Proc. Natl. Acad. Sci. U. S. A. 103:1475-1479. Berquin IM, Pang B, Dziubinski ML, Scott LM, Chen YQ, Nolan GP et al. (2005). Y-boxbinding protein 1 confers EGF independence to human mammary epithelial cells. Oncogene 24:3177-3186. Carriere A, Ray H, Blenis J, Roux PP. (2008). The RSK factors of activating the RAS/MAPK signalling cascade. Front. Biosci. 13:4258-4275. Clark DE, Errington TM, Smith JA, Frierson HF,Jr, Weber MJ, Lannigan DA. (2005). The serine/threonine protein kinase, p90 ribosomal S6 kinase, is an important regulator of prostate cancer cell proliferation. Cancer Res. 65:3108-3116. Deleeuw RJ, Zettl A, Klinker E, Haralambieva E, Trottier M, Chari R et al. (2007). Wholegenome analysis and HLA genotyping of enteropathy-type T-cell lymphoma reveals 2 distinct lymphoma subtypes. Gastroenterology 132:1902-1911. Didier DK, Schiffenbauer J, Woulfe SL, Zacheis M, Schwartz BD. (1988). Characterization of the cDNA encoding a protein binding to the major histocompatibility complex class II Y box. Proc. Natl. Acad. Sci. U. S. A. 85:7322-7326. Dunn SE, Torres JV, Oh JS, Cykert DM, Barrett JC. (2001). Up-regulation of urokinase-type plasminogen activator by insulin-like growth factor-I depends upon phosphatidylinositol-3 kinase and mitogen-activated protein kinase kinase. Cancer Res. 61:1367-1374. Finkbeiner MR, Astanehe A, To K, Fotovati A, Davies AH, Zhao Y et al. (2009). Profiling YB-1 target genes uncovers a new mechanism for MET receptor regulation in normal and malignant human mammary cells. Oncogene 28: 1421-1431. Ghoda L, Lin X, Greene WC. (1997). The 90-kDa ribosomal S6 kinase (pp90rsk) phosphorylates the N-terminal regulatory domain of IkappaBalpha and stimulates its degradation in vitro. J. Biol. Chem. 272:21281-21288. Gold MR, Duronio V, Saxena SP, Schrader JW, Aebersold R. (1994). Multiple cytokines activate phosphatidylinositol 3-kinase in hemopoietic cells. association of the enzyme with 170  various tyrosine-phosphorylated proteins. J. Biol. Chem. 269:5403-5412. Gupta S, Ramjaun AR, Haiko P, Wang Y, Warne PH, Nicke B et al. (2007). Binding of ras to phosphoinositide 3-kinase p110αlpha is required for ras-driven tumourigenesis in mice. Cell 129:957-968. Habibi G, Leung S, Law JH, Gelmon K, Masoudi H, Turbin D et al. (2008). Re-defining prognostic factors for breast cancer: YB-1 is a stronger predictor of relapse and disease specific survival than estrogen receptor or HER2 across all tumour subtypes. Breast Cancer Res. 10:R86. Hollestelle A, Elstrodt F, Nagel JH, Kallemeijn WW, Schutte M. (2007). Phosphatidylinositol-3OH kinase or RAS pathway mutations in human breast cancer cell lines. Mol. Cancer. Res. 5:195-201. Horn S, Bergholz U, Jucker M, McCubrey JA, Trumper L, Stocking C et al. (2008). Mutations in the catalytic subunit of class IA PI3K confer leukemogenic potential to hematopoietic cells. Oncogene 27:4096-4106. Hui RC, Gomes AR, Constantinidou D, Costa JR, Karadedou CT, Fernandez de Mattos S et al. (2008). The forkhead transcription factor FOXO3a increases phosphoinositide-3 kinase/AKT activity in drug-resistant leukemic cells through induction of PIK3CA expression. Mol. Cell. Biol. 28:5886-5898. Isakoff SJ, Engelman JA, Irie HY, Luo J, Brachmann SM, Pearline RV et al. (2005). Breast cancer-associated PIK3CA mutations are onc ogenic in mammary epithelial cells. Cancer Res. 65:10992-11000. Manning BD, Cantley LC. (2007). AKT/PKB signalling: Navigating downstream. Cell 129:1261-1274. Neve RM, Chin K, Fridlyand J, Yeh J, Baehner FL, Fevr T et al. (2006). A collection of breast cancer cell lines for the study of functionally distinct cancer subtypes. Cancer. Cell. 10:515-527. Raouf A, Brown L, Vrcelj N, To K, Kwok W, Huntsman D et al. (2005). Genomic instability of human mammary epithelial cells over-expressing a truncated form of EMSY. J. Natl. Cancer Inst. 97:1302-1306. Rayet B, Gelinas C. (1999). Aberrant rel/nfkb genes and activity in human cancer. Oncogene 18:6938-6947. Roux PP, Shahbazian D, Vu H, Holz MK, Cohen MS, Taunton J et al. (2007). RAS/ERK signalling promotes site-specific ribosomal protein S6 phosphorylation via RSK and stimulates cap-dependent translation. J. Biol. Chem. 282:14056-14064. Saal LH, Holm K, Maurer M, Memeo L, Su T, Wang X et al. (2005). PIK3CA mutations correlate with hormone receptors, node metastasis, and ERBB2, and are mutually exclusive with PTEN loss in human breast carcinoma. Cancer Res. 65:2554-2559.  171  Samuels Y, Velculescu VE. (2004). Oncogenic mutations of PIK3CA in human cancers. Cell. Cycle 3:1221-1224. Samuels Y, Wang Z, Bardelli A, Silliman N, Ptak J, Szabo S et al. (2004). High frequency of mutations of the PIK3CA gene in human cancers. Science 304:554. Shadeo A, Lam WL. (2006). Comprehensive copy number profiles of breast cancer cell model genomes. Breast Cancer Res. 8:R9. Shayesteh L, Lu Y, Kuo WL, Baldocchi R, Godfrey T, Collins C et al. (1999). PIK3CA is implicated as an oncogene in ovarian cancer. Nat. Genet. 21:99-102. She QB, Chandarlapaty S, Ye Q, Lobo J, Haskell KM, Leander KR et al. (2008). Breast tumour cells with PI3K mutation or HER2 amplification are selectively addicted to akt signalling. PLoS ONE 3:e3065. Sliva D, Rizzo MT, English D. (2002). Phosphatidylinositol 3-kinase and NF-kappaB regulate motility of invasive MDA-MB-231 human breast cancer cells by the secretion of urokinase-type plasminogen activator. J. Biol. Chem. 277:3150-3157. Smith JA, Poteet-Smith CE, Xu Y, Errington TM, Hecht SM, Lannigan DA. (2005). Identification of the first specific inhibitor of p90 ribosomal S6 kinase (RSK) reveals an unexpected role for RSK in cancer cell proliferation. Cancer Res. 65:1027-1034. Sorlie T, Perou CM, Tibshirani R, Aas T, Geisler S, Johnsen H et al. (2001). Gene expression patterns of breast carcinomas distinguish tumour subclasses with clinical implications. Proc. Natl. Acad. Sci. U. S. A. 98:10869-10874. Stratford AL, Fry CJ, Desilets C, Davies AH, Cho YY, Li Y et al. (2008). Y-box binding protein-1 (YB-1) serine 102 is a downstream target of p90 ribosomal S6 kinase (RSK) in basallike breast cancer cells. Breast Cancer Res. 10:R99. Stratford AL, Habibi G, Astanehe A, Jiang H, Hu K, Park E et al. (2007). Epidermal growth factor receptor (EGFR) is transcriptionally induced by the Y-box binding protein-1 (YB-1) and can be inhibited with iressa in basal-like breast cancer, providing a potential target for therapy. Breast Cancer Res. 9:R61. Sunters A, Fernandez de Mattos S, Stahl M, Brosens JJ, Zoumpoulidou G, Saunders CA et al. (2003). FoxO3a transcriptional regulation of bim controls apoptosis in paclitaxel-treated breast cancer cell lines. J. Biol. Chem. 278:49795-49805. Sutherland BW, Kucab J, Wu J, Lee C, Cheang MC, Yorida E et al. (2005). AKT phosphorylates the Y-box binding protein 1 at Ser102 located in the cold shock domain and affects the anchorage-independent growth of breast cancer cells. Oncogene 24:4281-4292. Ueki K, Fruman DA, Brachmann SM, Tseng YH, Cantley LC, Kahn CR. (2002). Molecular balance between the regulatory and catalytic subunits of phosphoinositide 3-kinase regulates cell signalling and survival. Mol. Cell. Biol. 22:965-977. 172  Vanhaesebroeck B, Alessi DR. (2000). The PI3K-PDK1 connection: More than just a road to PKB. Biochem. J. 346 Pt 3:561-576. van Roeyen CR, Eitner F, Martinkus S, Thieltges SR, Ostendorf T, Bokemeyer D et al. (2005). Y-box protein 1 mediates PDGF-B effects in mesangioproliferative glomerular disease. J. Am. Soc. Nephrol. 16:2985-2996. Woo MM, Salamanca CM, Minor A, Auersperg N. (2007). An improved assay to quantitate the invasiveness of cells in modified boyden chambers. In vitro Cell. Dev. Biol. Anim. 43:7-9. Wu J, Stratford AL, Astanehe A, Dunn SE. (2007). YB-1 is a Transcription/Translation factor that orchestrates the oncogenome by hardwiring signal transduction to gene expression. Translational Oncogenomics 2:49-65. Wu G, Xing M, Mambo E, Huang X, Liu J, Guo Z et al. (2005). Somatic mutation and gain of copy number of PIK3CA in human breast cancer. Breast Cancer Res. 7:R609-16. Wu J, Lee C, Yokom D, Jiang H, Cheang MC, Yorida E et al. (2006). Disruption of the Y-box binding protein-1 results in suppression of the epidermal growth factor receptor and HER2. Cancer Res. 66:4872-4879. Yehiely F, Moyano JV, Evans JR, Nielsen TO, Cryns VL. (2006). Deconstructing the molecular portrait of basal-like breast cancer. Trends Mol. Med. 12:537-544. Zhang H, Liu G, Dziubinski M, Yang Z, Ethier SP, Wu G. (2008). Comprehensive analysis of oncogenic effects of PIK3CA mutations in human mammary epithelial cells. Breast Cancer Res. Treat. 112:217-227. Zhao JJ, Cheng H, Jia S, Wang L, Gjoerup OV, Mikami A et al. (2006). The p110αlpha isoform of PI3K is essential for proper growth factor signalling and oncogenic transformation. Proc. Natl. Acad. Sci. U. S. A. 103:16296-16300.  173  CHAPTER 4: THE MNK1/RSK1/YB-1 SIGNALLING NETWORK MEDIATES RESISTANCE TO TRASTUZUMAB THERAPY3  3  A version of this chapter has been submitted for publication. Arezoo Astanehe, Melanie R. Finkbeiner, Martin Krzywinski, Mollianne J. McGahren Murray, Abbas Fotovati, Jaspreet Dhillon, Ana M. Gonzalez-Angulo, Gordon B. Mills, Marco A. Marra, and Sandra E. Dunn. The MNK1/RSK1/YB-1 signalling network mediates resistance to trastuzumab therapy. 174  4.1 OVERVIEW Trastuzumab resistance is a major obstacle in the treatment of patients with HER2positive breast cancers. We discovered that the MAP kinase-interacting kinase (MNK) is highly expressed in trastuzumab resistant cells using antibody microarray screens. Importantly, MNK1 over-expression was sufficient to confer resistance to trastuzumab in cells that were previously sensitive. We further identified that MNK1 through a coordinated effect with p90 ribosomal S6 kinase (RSK) increased phosphorylation of the oncogenic transcription factor Y-box-binding protein-1 (YB-1) promoting its nuclear translocation and its binding to a repertoire of drug resistance genes identified by genome-wide chromatin immunoprecipitation sequencing. Furthermore, inhibition of RSK with the small molecule BI-D1870 repressed the MNK1mediated trastuzumab resistance and can be used for overcoming recalcitrance to trastuzumab.  4.2 INTRODUCTION In approximately 25% of breast cancers, HER2 is amplified leading to abnormally high levels of the encoded protein (Slamon et al., 1987). Patients diagnosed with HER2-positive tumours have poor prognosis with significantly shortened disease-free survival (Seshadri et al., 1993; Slamon et al., 1987). Development of trastuzumab (Herceptin), a monoclonal antibody that targets the ectodomain of HER2, has been a significant advance in the care for these patients (Carter et al., 1992). Unfortunately, only 30% of patients with HER2-positive breast cancers respond to single-agent trastuzumab treatment; thus intrinsic resistance is apparent (Vogel et al., 2002). Moreover, tumours that respond frequently experience acquired resistance within one year (Nahta and Esteva, 2006). Therefore, an understanding of the mechanisms leading to intrinsic and acquired resistance to trastuzumab has the potential to lead to rational combinatorial therapies that could improve the outcome for patients with HER2-positive breast cancers. MKNK1 and MKNK2 code for the MAP kinase-interacting serine/threonine protein 175  kinases MNK1 and MNK2 respectively (Mahalingam and Cooper, 2001). MNKs are members of MAP kinase-regulated kinases with activation being dependent on phosphorylation of their T197/T202 residues (Fukunaga and Hunter, 1997; Waskiewicz et al., 1997). They are responsible for phosphorylation of eIF4E, and as such MNKs have functionally been linked to translational regulation (Mahalingam and Cooper, 2001); however, their involvement in tumour initiation and progression, particularly in epithelial tumours, remains largely unexplored. Mice reconstituted with hematopoietic stem cells expressing an activated MNK1 displayed accelerated lymphomagenesis, indicating that it can act as an oncogene (Wendel et al., 2007). Further, MNKs were shown to be more highly phosphorylated in HER2 over-expressing breast cancer compared to non-tumourigenic cells (Chrestensen et al., 2007), and their inhibition in prostate cancer cells repressed translation of mRNAs required for cell cycle progression (Bianchini et al., 2008). Additionally, MKNK1 was identified as part of a gene signature for prediction of response to conventional chemotherapy in epithelial ovarian carcinoma (Spentzos et al., 2005). These studies suggest a role for MNKs in cancer progression and emphasize the importance of understanding the contribution of these emerging kinases to malignancy. Y-box binding protein-1 (YB-1) is an oncogenic transcription/translation factor that is implicated in various malignancies including breast cancer (Wu et al., 2007). Targeted expression of YB-1 in the mammary gland of mice results in centrosomal amplification, chromosomal instability and tumour formation (Bergmann et al., 2005). We recently reported that in a cohort of more than 4400 breast cancer cases, YB-1 was expressed in approximately 40% of invasive carcinomas and its expression was associated with relapse and poor overall survival for all breast cancer subtypes (Habibi et al., 2008). The p90 ribosomal S6 kinase (RSK) (Stratford et al., 2008) and to a lesser extent AKT (Sutherland et al., 2005) can phosphorylate YB-1 on S102 promoting its nuclear translocation where it binds to inverted CCAAT boxes to affect transcription (Didier et al., 1988). Within the nucleus, YB-1 binds to promoter sequences 176  of genes including MDR1 (Bargou et al., 1997), HER2 (Wu et al., 2006), EGFR (Wu et al., 2006), PIK3CA (Astanehe et al., 2009), MET (Finkbeiner et al., 2009), and CD44 (To et al., 2010) to increase their transcription and thereby promote tumour progression. Moreover, we recently demonstrated that elevated P-YB-1S102 levels in HER2-positive breast cancer cells decreased sensitivity to trastuzumab (Dhillon et al., 2010). However the intracellular mechanisms underlying this YB-1 mediated trastuzumab resistance remains unclear. Heterodimerization of HER2 with EGFR or HER3 (Diermeier et al., 2005; Motoyama et al., 2002), hyperactivation of PI3K signalling through loss of PTEN or PIK3CA mutations (Berns et al., 2007; Junttila et al., 2009; Nagata et al., 2004), over-expression or activation of MET (Shattuck et al., 2008), or increases in IGF-1R signalling from receptor over-expression or heterodimerization with HER2 (Camirand et al., 2002; Lu et al., 2001; Nahta et al., 2005) have all been implicated in decreased sensitivity to trastuzumab. However, in order to understand the mechanisms of acquired resistance further, use of physiologically relevant models is essential. Ritter et al. (2007) established resistant cell lines from BT474 xenografts in mice that initially responded to trastuzumab but eventually recurred (HR5 and HR6 clones). This model is valuable as it recapitulates the scenario commonly seen in clinical development of trastuzumab resistance. In the present study, we used this model of acquired trastuzumab resistance to demonstrate that MNK1 and RSK1 cooperate to increase phosphorylation of YB-1, which translocates into the nucleus to regulate transcription of a set of genes involved in trastuzumab resistance.  4.3 RESULTS 4.3.1 MNK1 MEDIATES TRASTUZUMAB RESISTANCE, WHILE ITS LOSS RESENSITIZES CELLS TO THE DRUG To begin to investigate the mechanisms of trastuzumab resistance, we used the Kinexus KinexTM antibody microarray as an unbiased approach to profile changes in signal transduction 177  in the sensitive BT474, and the resistant HR5 and HR6 cells after trastuzumab treatment (20µg/ml for 72 hours). Table 4.1 lists the proteins that showed at least a 40% change (%CFC) in expression or phosphorylation in both HR5 and HR6 compared to BT474 cells. The HR5 and HR6 cells showed elevated levels of HSP27, HSP90, and P-METY1230/Y1234/Y1235, and reduced levels of P-Shc1Y239 (Table 4.1), all of which have previously been correlated to decreased sensitivity to trastuzumab in other models (Kang et al., 2008; Neve et al., 2006; Shattuck et al., 2008; Zsebik et al., 2006). Furthermore, RSK was more highly phosphorylated in HR5 and HR6 cells (Table 4.1). This is interesting as we recently demonstrated that its downstream substrate PYB-1S102 decreased sensitivity of HR5 and HR6 cells to trastuzumab (Dhillon et al., 2010). Notably, MNK2 was elevated in the resistant cell lines to the greatest degree (Table 4.1). Therefore we chose to pursue this particular kinase as a potential lead to understanding the mechanisms of trastuzumab resistance. Immunoblotting of the extracts demonstrated higher levels of MNK2 and its homologue MNK1 (not screened in the antibody microarray) in the resistant cell lines (Figure 4.1a). In response to trastuzumab treatment, MNK1, P-RSK, and PYB-1S102 levels decreased in BT474, but remained elevated in the HR5 and HR6 cells (Figure 4.1a). On the contrary, MNK2 levels did not decrease in BT474 cells after treatment (Figure 4.1a). Further, when MNK1 or MNK2 was silenced, the cells underwent apoptosis only when the former was inhibited, and the double gene knockdown did not show an additive effect (Supplementary Figure S4.1a). Similar results were obtained using a second set of siRNA to MNK1 and MNK2 (data not shown). Henceforth, we focused on the role of MNK1 in trastuzumab resistance. When MNK1 was silenced in BT474, HR5, and HR6 cells, their viability was significantly decreased (Figure 4.1b top) and the cells underwent apoptosis based on phosphorylation of γH2A.XS139 and PARP cleavage (Figure 4.1b bottom). Moreover, a combination of silencing MNK1 with trastuzumab treatment further decreased cell viability and 178  enhanced apoptosis (Figure 4.1b). Therefore, loss of MNK1 augmented the effect of trastuzumab. To further investigate the role of MNK1 in HER2 over-expressing cell lines, we knocked it down in AU565 cells, which are trastuzumab sensitive. Like the BT474 cells, AU565 cell viability was attenuated (Supplementary Figure S4.1b top) and apoptosis was induced (Supplementary Figure S4.1b bottom) with loss of MNK1. Additionally, MDA-MB-453 and JMIT-1 cells, both of which have intrinsic resistance to trastuzumab, also demonstrated growth suppressive effects of MNK1 siRNA particularly in combination with trastuzumab (Supplementary Figure S4.1b). Therefore, silencing MNK1 decreased viability of both acquired (HR5 and HR6) and intrinsic (MDA-MB-453 and JIMT-1) trastuzumab resistant cells. To further support the involvement of MNK1 in mediating resistance to trastuzumab, we over-expressed MNK1 in BT474 cells. After trastuzumab treatment there were approximately 40% more viable cells in the MNK1 over-expressing population compared to EV control cells (Figure 4.1c top). Similar results were obtained using an alternate MNK1 plasmid, while MNK2 over-expression had no effect on trastuzumab response (data not shown). In addition, immunoblots confirmed that MNK1 over-expressing BT474 cells did not undergo apoptosis as readily as EV control cells in response to drug treatment (Figure 4.1c bottom). Therefore, forced over-expression of MNK1 in BT474 cells rendered them less sensitive to trastuzumab. Consistent with this, we created a resistant variant of BT474 cells (BT474LT) through long-term culture with trastuzumab (60 days). The BT474LT cells had increased levels of both total and active P-MNK1T197/T202 (Figure 4.1d). Given this, we silenced MNK1 in BT474LT cells using siRNA and demonstrated that the cells regained sensitivity to trastuzumab (Figure 4.1e). Interestingly, similar to HR5 and HR6 cells, the BT474LT cells also had higher P-RSKS380, PRSKS221/S227, and P-YB-1S102 levels compared to BT474 cells (Figure 4.1d). Collectively, these studies indicate that MNK1 is a key player in mediating the trastuzumab resistant phenotype, and that loss of MNK1 sensitizes cells to the effect of the drug. 179  4.3.2 P-YB-1S102 INDUCES MNK1 EXPRESSION VIA DIRECT PROMOTER OCCUPANCY Next we addressed how MNK1 levels are elevated in resistant cell lines. The HR5 and HR6 cells not only had elevated MNK1 protein levels (Figure 4.1a), but also had higher MNK1 transcript levels compared to BT474 cells (Figure 4.2a). This suggests that MNK1 may be elevated in resistant cell lines via a mechanism influencing transcription. A chromatin immunoprecipitation on chip (ChIP-on-chip) analysis on the SUM149 basal-like breast cancer cell line indicated binding of YB-1 to the MKNK1 promoter (data not shown). Further, resistant cells expressed higher P-YB-1S102 levels (Figure 4.1a); as such we analyzed the first 1Kb of the MKNK1 promoter for putative YB-1 binding sites (Figure 4.2b). ChIP-PCR demonstrated YB-1 binding to the MKNK1 promoter in all three cell lines, while densitometry measurements showed that this interaction was greater in HR5 and HR6 cells (Figure 4.2b). Accordingly, silencing YB-1 reduced MNK1 transcript and protein levels (Figure 4.2c). Further, loss of YB-1 induced apoptosis in BT474, HR5, and HR6 cells based on increased phosphorylation of γH2A.XS139 and cleavage of PARP (Figure 4.2c). In addition, BT474 cells that stably express either wt-YB-1 or a phospho-mimic mutant YB-1 (YB-1 S102D) had higher MNK1 transcript and protein levels compared to EV control and inactive mutant YB-1 (YB-1 S102A) cells (Figure 4.2d). Therefore, P-YB-1S102 drives MNK1 expression. Similar to silencing YB-1, knocking down its upstream kinase RSK in BT474, HR5, and HR6 cells induced apoptosis and decreased MNK1 transcript and protein levels (Figure 4.2e). In addition, while RSK1/2 knock down reduced MNK1 levels in the BT474 EV control cells, this effect was rescued with YB-1 S102D (Figure 4.2f). Therefore, the decrease in MNK1 subsequent to RSK knockdown is YB-1 mediated. We also questioned whether YB-1 might elevate MNK1 in non-tumourigenic cells. Expressing YB-1 under a tetracycline inducible system in immortalized human mammary epithelial cells increased MNK1 transcript levels (Supplementary Figure S4.2). To determine 180  whether elevated YB-1 would have a similar effect on expression of MNK1 in primary mammary epithelial cells in vivo, we evaluated mammary glands of transgenic mice expressing YB-1 (Bergmann et al., 2005). Mammary glands from YB-1 transgenic mice had higher levels of phosphorylated MNK1 protein as compared to those from wild type animals (n=3/group) (Figures 4.2g). We were limited to assessing P-MNK1 levels, as the total MNK1 antibody was not suitable for immunofluorescence. Thus in combination, these studies indicate that P-YB-1S102 induces MNK1 via transcriptional control.  4.3.3 INHIBITION OF RSK BLOCKS MNK1-MEDIATED TRASTUZUMAB RESISTANCE Although YB-1 S102D rescued MNK1 levels after RSK1/2 knockdown, the PMNK1T197/T202 levels decreased (Figure 4.2f), suggesting that RSK might selectively regulate MNK1 phosphorylation. We showed by in vitro kinase assays that active RSK1 directly phosphorylated MNK1 (Figure 4.3a). An interaction between RSK1 and MNK1 was further demonstrated in BT474 cells expressing a GST-tagged MNK1 plasmid (Figure 4.3b). Similarly, co-immunoprecipitation studies using RSK1 or MNK1 antibodies revealed that endogenous RSK1 and MNK1 proteins form a complex (Figure 4.3c). In order to assess the intracellular role of RSK on phosphorylation of MNK1 and not the long-term effect on its total levels via YB-1, we inhibited RSK activity using a specific small molecule inhibitor (BI-D1870) (Nguyen, 2008). BT474, HR5, and HR6 cells were serum-starved overnight, pre-treated with BI-D1870 (10µM) for 1 hour and subsequently stimulated with EGF for 15 minutes. This short-term BI-D1870 treatment markedly reduced P-MNK1T197/T202 levels in all three cell lines (Figure 4.3d). Further, we established that RSK activity is required for the ability of MNK1 to mediate resistance (Figure 4.3e). MNK1 over-expression decreased the sensitivity of BT474 cells to trastuzumab; however, BI-D1870 treatment for 72 hours re-sensitized these cells to trastuzumab as demonstrated by decreased cell viability (Figure 4.3e top). Further, immunoblotting of cell 181  extracts demonstrated that although the MNK1 transgene was expressed equally in all treatment groups, its phosphorylation was inhibited by BI-D1870 treatment (Figure 4.3e bottom). This inhibition of MNK1 phosphorylation by BI-D1870 correlated with enhanced apoptosis (Figure 4.3e bottom). In addition, inhibition of RSK with BI-D1870 (Figure 4.3f) or siRNA (Figure S4.3), particularly in combination with trastuzumab, decreased viability and induced apoptosis in BT474, HR5, and HR6 cells. These results suggest that RSK inhibition may be an effective approach to overcome trastuzumab resistance.  4.3.4 COORDINATE MNK1 AND RSK1 ACTIVITY INCREASES PHOSPHORYLATION OF YB-1 In order to address the mechanism by which MNK1 mediates trastuzumab resistance, we first turned to its well-characterized downstream target, eIF4E. However, while the double knock down of MNK1 and MNK2 decreased phosphorylation of eIF4E, silencing MNK1 or MNK2 alone did not alter P-eIF4ES209 levels (data not shown). Therefore, MNK1-mediated cell death is likely independent of eIF4E phosphorylation. Interestingly, silencing MNK1 in BT474, HR5, and HR6 cells decreased P-YB-1S102 levels (Figure 4.4a). Since phosphorylation of YB-1 on S102 promotes its nuclear translocation where it can bind to its DNA targets (Sutherland et al., 2005), we assessed cytoplasmic and nuclear levels of P-YB-1S102 after silencing MNK1. In both the cytoplasmic and nuclear fractions, P-YB-1S102 levels were decreased after MNK1 knockdown, and were further reduced when siMNK1 was followed with 72 hours of trastuzumab treatment (Figure 4.4a). After MNK1 knockdown, total YB-1 levels decreased in the nuclear compartment, but were sustained in the cytoplasm (Figure 4.4a). Hence silencing MNK1 decreased phosphorylation of YB-1, which therefore cannot enter the nucleus where its function as a transcription factor is required. Correspondingly, over-expression of MNK1 in BT474 cells  182  not only increased phosphorylation of YB-1, but it also prevented the decrease in P-YB-1S102 levels seen in the EV control cells in response to trastuzumab treatment (Figure 4.4b). However, YB-1 is likely not a direct target of MNK1, as active MNK1 was unable to phosphorylate an YB-1 peptide encompassing the S102 site in an in vitro kinase assay (data not shown). Moreover, MNK1 does not serve as a kinase for RSK, as active MNK1 failed to phosphorylate RSK1 in an in vitro kinase assay, and silencing MNK1 did not decrease RSK phosphorylation at either S380 or S221/S227 residues (data not shown). Since RSK1 and MNK1 interact, we postulated that this association might enhance phosphorylation of YB-1 by RSK. Immunoprecipitation of RSK1 from scrambled control or siMNK1 BT474 cells showed that lower amounts of YB-1 and P-YB-1S102 interact with RSK1 in the absence of MNK1 (Figure 4.4c). This provides evidence that MNK1 likely coordinates the association of RSK1 with its substrate YB-1 to increase P-YB-1S102 levels. We recently showed that over-expression of active YB-1 in BT474 cells decreased their sensitivity to trastuzumab (Dhillon et al., 2010). Hence, we hypothesized that MNK1 mediates trastuzumab resistance by increasing phosphorylation of YB-1. While MNK1 over-expression decreased sensitivity to trastuzumab, silencing YB-1 re-sensitized cells to the drug as shown by decreased cell viability (Figure 4.4d top), and increased apoptosis based on P-γH2A.XS139 (Figure 4.4d bottom). Therefore, inhibition of YB1 blocked MNK1-mediated trastuzumab resistance. In corroboration, expression of YB-1 in BT474 cells rescued the decrease in cell viability observed after MNK1 knockdown (Figure 4.4e). Silencing MNK1 in BT474 EV control and YB-1 S102A cells decreased cell viability (Figure 4.4e top) and induced apoptosis (Figure 4.4e bottom). However, MNK1 knockdown in wt-YB-1 or YB-1 S102D expressing BT474 cells did not increase P-γH2A.XS139 levels or PARP cleavage, indicating that YB-1 rescued the apoptosis induced after loss of MNK1 (Figure 4.4e bottom). Collectively, these results indicate  183  that YB-1 can be phosphorylated through a coordinated effect of MNK1 and RSK1, and is required for MNK1-mediated trastuzumab resistance.  4.3.5 CHROMATIN-IMMUNOPRECIPITATION SEQUENCING IDENTIFIED UNIQUE YB-1 TRANSCRIPTIONAL TARGET GENES IN TRASTUZUMAB RESISTANT CELLS Immunoblotting indicates that in response to trastuzumab treatment, the nuclear P-YB1S102 levels decreased in BT474 cells, but remained elevated in HR5 and HR6 cells (Figure 4.5a). To determine how elevated nuclear P-YB-1S102 may mediate trastuzumab resistance, we turned to genome-wide chromatin immunoprecipitation sequencing (ChIP-seq) of YB-1 pulled-down DNA from BT474, HR5, and HR6 cells after 72 hours of trastuzumab (20µg/ml) treatment. The ChIP-seq approach not only identified candidate YB-1 targets at a genome-wide level, but the differential binding of YB-1 in trastuzumab sensitive versus resistant cell lines provided clues as to what its targets responsible for mediating resistance to the drug might be. The Venn diagram (Figure 4.5b) indicates the number of genes bound by YB-1 in each of the cell lines. A list of genes unique to the resistant cell lines identified in the YB-1 ChIP-seq experiment is provided in Appendix A. To validate the experimental design, we showed by ChIP-PCR that known target genes (MKNK1, CD44, EGFR, and MET) were preferentially associated with YB-1 in HR5 and HR6 cells following trastuzumab treatment (Figure 4.5b and Appendix A). This corresponds to higher protein levels of MNK1 (Figure 4.1a), CD44 (Dhillon et al., 2010), EGFR (Ritter et al., 2007), and MET (Supplementary Figure S4.4) in HR5 and HR6 cells compared to BT474 cells. To determine what other YB-1 targets are more highly expressed in resistant cell lines, we crossreferenced the list of ChIP-seq genes to the KinexTM antibody microarray protein expression data obtained under the same conditions (20µg/ml of trastuzumab for 72 hours). This analysis identified several YB-1 targets with altered protein expression in the resistant cell lines (Figure 4.5c and Supplementary Table S4.1). 184  To further define how YB-1 may mediate trastuzumab resistance, pathway analyses based on the YB-1 bound genes in each of the three cell lines (BT474, HR5, and HR6) were performed through the use of Ingenuity Pathways Analysis (IPA) software. These analyses identified the biological functions that were most significant to this data set. More specifically, in HR5 and HR6 cells, genes related to inhibition of apoptosis were predominant (Figure 4.5d). Products of the anti-apoptotic genes bound by YB-1 exclusively in resistant cell lines have previously been studied in the context of their roles in drug resistance. Therefore, it is likely that up-regulation of these anti-apoptotic factors may be a mechanism by which P-YB-1S102 promotes resistance to trastuzumab.  4.3.6 A TRASTUZUMAB RESISTANT GENE SIGNATURE FROM PATIENTS INCLUDES YB-1 TARGET GENES We next assessed the significance of elevated P-YB-1S102 in a clinical setting, by quantifying its levels using a reverse phase protein lysate microarray (RPPA). Kaplan-Meier analysis of 42 HER2-positive breast tumours with patient follow-up revealed shorter recurrencefree survival among patients with high P-YB-1S102 tumours (Figure 4.6a). Therefore, P-YB-1S102 is a marker of aggressiveness in HER2-positive breast cancers. Further, ChIP-seq of BT474, HR5, and HR6 cells identified a subset of YB-1 targets that correspond to established predictive markers of resistance from patient tumours (Figure 4.6b). Harris et al. (2007) explored gene expression patterns of tumours from patients with HER2 amplified breast cancers that received preoperative vinorelbine and trastuzumab treatment. The non-responding tumours were more likely to be T4 stage, and express basal markers (Basal keratins, GABRP, BOC, NAV2, TRIM, NDRG, NFI/B, TCF7L, SERPINB6), growth factors (HGF, IGF-I, PDGF, and PTN), and growth factor receptors (IGF-1R, MET, and LEPR). SFRP, TP63, and MAP2 were also expressed at a higher level in resistant tumours (Harris et al., 2007). Comparison of our list of YB-1 targets to 185  these predictive markers of resistance to trastuzumab and vinorelbine therapy (Harris et al., 2007) demonstrated that a subset of these genes is YB-1 regulated (Figure 4.6b). These results support the importance of YB-1 and similarly its upstream regulators MNK1 and RSK1 in upregulation of a milieu of biomarkers that are more highly expressed in trastuzumab resistant tumours from patients.  4.4 DISCUSSION The role of MNKs in epithelial cancer and in particular trastuzumab resistance and sensitivity has not been explored. In this study, we identified MNKs to be more highly expressed in trastuzumab resistant cell lines by using an unbiased antibody microarray approach. We further demonstrated that MNK1 through a coordinated effect with RSK1 increases YB-1 phosphorylation and conveys resistance to trastuzumab (Figure 4.7). We showed that RSK1, which is more highly phosphorylated in resistant cell lines, phosphorylates MNK1 (step 1). In turn, MNK1 increases the association of RSK1 with its substrate YB-1 (step 2) thereby leading to its phosphorylation (step 3) and nuclear localization (step 4). Within the nucleus, YB-1 binds to induce expression of MKNK1 via transcription (step 5). This elevated MNK1 will feedforward (step 6) to further increase phosphorylation of YB-1 via RSK1. Additionally, nuclear YB-1 binds to regulate expression of a number of other genes identified by genome-wide ChIPseq to sustain resistance to trastuzumab (step 7). Furthermore, we demonstrated that trastuzumab disrupts the MNK1/RSK1/YB-1 complex, resulting in decreased phosphorylation and nuclear localization of YB-1 in trastuzumab sensitive cells. However, this interaction and thereby YB-1 phosphorylation is sustained in trastuzumab resistant cell lines. Although RSK phosphorylation decreased in trastuzumab-sensitive BT474 cells in response to trastuzumab, its levels were maintained in resistant cell lines. Our ChIP-seq data identified YB-1 targets that could promote RSK phosphorylation. For example, we show that 186  YB-1 is preferentially bound to EGFR and MET promoters in resistant cell lines after trastuzumab treatment. Both EGF and HGF, ligands of EGFR and MET receptor respectively, increase phosphorylation of RSK (Nam et al., 2008). Therefore, upregulation of EGFR and MET could be a mechanism by which resistant cells maintain RSK phosphorylation. Furthermore, we showed that EphA1, β-arrestin, and the non-receptor tyrosine kinase SRC family member YES are all YB-1 targets and are more highly expressed in resistant cell lines after trastuzumab treatment. EphA has been shown to mediate trastuzumab resistance by amplifying signalling through both PI3K and MAPK pathways (Zhuang et al., 2010). β-arrestin forms a complex with YES leading to its activation (Imamura et al., 2001). Activated YES then interacts with HER2 to modulate EphA activity (Zhuang et al., 2010). The activation of YES also leads to phosphorylation of RSK (Godeny and Sayeski, 2006). Additionally, β-arrestin has been shown to mediate activation of MNK1 (DeWire et al., 2008). Therefore, YB-1 mediated upregulation of EphA1, β-arrestin, and YES may be another mechanism for resistant cells to sustain RSK phosphorylation and thereby increase MNK1 phosphorylation. Ultimately the cooperation between MNK1 and RSK1 will enhance phosphorylation of YB-1, which enters the nucleus to regulate transcription of genes involved in maintaining the feed-forward loop (Figure 4.7) and mediating trastuzumab resistance. Our comprehensive genome-wide analysis of YB-1 target genes identified signatures of clinical and biological significance. The clinical significance of our data is underlined by the fact that HER2-positive breast cancer patients with high P-YB-1S102 expression demonstrated significantly shorter recurrence-free survival. Further, ChIP-seq identified a subset of YB-1 targets that correspond to established predictive markers of resistance from patient tumours (Harris et al., 2007). From the biological standpoint, our data offer an opportunity to better understand the mechanisms through which breast cancer cells acquire resistance to trastuzumab. The biological function identified by IPA to be most significant to the ChIP-seq data set is cell 187  death. Products of many of the anti-apoptotic YB-1 target genes have previously been implicated in drug resistance. For example, inhibition of inhibitor of apoptosis family members cIAP1 (BIRC2) and cIAP2 (BIRC3) increase apoptosis in response to trastuzumab, lapatinib or gefitinib in HER2 overexpressing cells (Foster et al., 2009), while inhibition of MCL-1 sensitizes cells to both lapatinib and trastuzumab (Henson et al., 2006; Martin et al., 2008). Moreover, TNFSF18 and TCF7L1 are associated with tamoxifen and erlotinib resistance respectively (Halatsch et al., 2009; Treeck et al., 2004). Therefore, up-regulation of these anti-apoptotic factors by YB-1 likely plays a role in promoting resistance to trastuzumab. Furthermore, ChIP-seq identified MKNK1, CD44, EGFR, and MET as YB-1 targets more highly expressed in resistant cells after trastuzumab treatment. In the present study we show that elevated MNK1 decreased response to trastuzumab. Furthermore, increased expression of EGFR (Motoyama et al., 2002), MET (Shattuck et al., 2008), and more recently CD44 (Dhillon et al., 2010) have been implicated in resistance to anti-HER2 therapy. Silencing YB-1 decreases MNK1, EGFR (Wu et al., 2006), MET (Finkbeiner et al., 2009), and CD44 (To et al., 2010). Therefore, inhibiting YB-1 function will likely increase sensitivity to trastuzumab by reducing expression of MNK1, EGFR, MET, CD44, the anti-apoptotic proteins mentioned above, and likely other mediators of resistance to the drug downstream of YB-1. The data presented in this study highlight the MNK1/RSK1/YB-1 network as a novel mechanism for trastuzumab resistance and open prospects for therapeutic intervention against these targets in patients with HER2-positive breast cancers. We showed that silencing YB-1 blocked MNK1-mediated trastuzumab resistance and induced apoptosis. Furthermore, our results suggest that inhibiting YB-1 will decrease expression of a large set of proteins likely involved in trastuzumab resistance. Small molecule inhibitors of YB-1 are not currently available, although research in siRNA based cancer therapeutics is advancing (Judge et al., 2009); thus siYB-1 could be a future therapeutic strategy. In addition, we demonstrated that silencing MNK1 decreased 188  nuclear P-YB-1S102 levels and induced apoptosis of trastuzumab resistant cells; therefore one might also consider MNK1 as a therapeutic target. CGP57380 was developed to inhibit MNK1, however it was recently found to be non-specific (Bain et al., 2007). There are currently three selective inhibitors of RSK available: BI-D1870, SL0101 and fmk (Nguyen, 2008). We showed that inhibiting RSK with siRNA or BI-D1870 decreased phosphorylation of YB-1 and induced apoptosis in trastuzumab resistant cell lines. Furthermore, RSK inhibition with BI-D1870 repressed the MNK1-mediated trastuzumab resistance. Therefore, inhibition of RSK activity provides an alternate approach to block MNK1-mediated trastuzumab resistance and to inhibit phosphorylation and thereby nuclear localization of YB-1. RSK is phosphorylated downstream of receptor and non-receptor tyrosine kinases and is classically placed in the MAPK signalling pathway. In addition, we recently showed that RSK phosphorylation can be PI3K mediated (Astanehe et al., 2009). Therefore, RSK is a particularly attractive target as it acts as a hub for signals emitted through both the MAPK and PI3K networks. In conclusion, our findings suggest that interfering with the MNK1/RSK1/YB-1 network will prove to be beneficial to combat resistance in patients with HER2-positive breast cancers.  4.5 MATERIALS AND METHODS Cell Culture BT474 (ATCC, Manassas, VA), HR5, and HR6 (generously provided by Dr. Carlos L Arteaga) cells were maintained in F12/clear DMEM supplemented with 10% fetal bovine serum (Invitrogen, Burlington, ON, Canada).  Kinexus KinexTM Antibody Microarray BT474, HR5, and HR6 cells treated with 20µg/ml of trastuzumab (BC Cancer Agency Pharmacy) for 72 hours were suspended in lysis buffer provided by Kinexus Bioinformatics 189  Corporation. Subsequent fluorescent labelling, hybridization onto the KAM-1.2 microarray with 800 antibodies, as well as scanning, imaging and quantitative analysis of the enhanced chemiluminescence signal of detected proteins were performed by Kinexus (www.kinexus.ca).  siRNA/Plasmid Transfections Cells were transfected with 20nM of siRNA (Qiagen, Mississauga, ON, Canada) using Lipofectamine RNAiMAX (Invitrogen). 2µg of MNK1-pEBG6P (GST-tagged) or MNK1-pCS3MT (generously provided by Dr. Christopher G Proud) were transfected into cells using Lipofectamine 2000 (Invitrogen). For detailed treatment protocols please refer to supplemental experimental procedures. Stable BT474 cells were generated using 3x FLAG-tagged EV, wtYB-1, YB-1 S102A, and YB-1 S102D constructs described previously (Astanehe et al., 2009).  Immunoblotting Proteins were harvested in ELB supplemented with protease and phosphatase inhibitors. Cytoplasmic/Nuclear fractionations were performed using the NE-PER kit (Pierce). Immunoblotting was performed as described previously (Astanehe et al., 2009). The primary antibodies used were: anti-P-γH2A.XS139 (Abcam, Cambridge, MA), anti-P-RSKS221/S227 (Invitrogen), anti-MNK2 (SantaCruz Biotechnology, Santa Cruz, CA), anti-MNK1, anti-PMNK1T197/T202, anti-total YB-1, anti-P-YB-1S102, anti-pan-RSK, anti-P-RSKS380, anti-PARP, and anti-actin (Cell Signaling Technology, Danvers, MA).  Viability Assays 5mg/ml of MTT was diluted in growth media, added to each well for one hour at 37°C, precipitate dissolved with DMSO, and absorption values obtained at 570nm using an EnSpire 2300 multilabel plate reader (PerkinElmer, Waltham, MA). 190  Chromatin Immunoprecipitation (ChIP)-PCR, ChIP-seq, and Bioinformatics YB-1 promoter complexes were isolated as previously described (Astanehe et al., 2009). QIAquick PCR purification kit (Qiagen) was used to extract the YB-1 pulled down DNA fragments. For ChIP-seq the sequencing was performed at the BC Cancer Agency Genome Sciences Centre using the second-generation Illumina platform. For ChIP-PCR, 4 sets of oligonucleotides were designed around the putative YB-1 binding sites on MKNK1 (ChIP1, 2, 3, and 4) (Figure 4.2b). Please refer to the supplemental experimental procedures for oligonucleotide sequences, additional details on ChIP-seq, and the bioinformatics analyses.  Quantitative PCR RNA was isolated using the RNeasy Mini kit (Qiagen) and reverse-transcribed with random hexamers and SuperScript III (Invitrogen). TaqMan Universal Master Mix was used with the TaqMan Gene Expression Assay for MNK1 and 18S (Applied Biosystems, Streetsvile