Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The role of islet amyloid and CHOP in islet graft dysfunction and failure Potter, Kathryn Jane 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2011_spring_potter_kathryn.pdf [ 3.85MB ]
Metadata
JSON: 24-1.0072016.json
JSON-LD: 24-1.0072016-ld.json
RDF/XML (Pretty): 24-1.0072016-rdf.xml
RDF/JSON: 24-1.0072016-rdf.json
Turtle: 24-1.0072016-turtle.txt
N-Triples: 24-1.0072016-rdf-ntriples.txt
Original Record: 24-1.0072016-source.json
Full Text
24-1.0072016-fulltext.txt
Citation
24-1.0072016.ris

Full Text

THE ROLE OF ISLET AMYLOID AND CHOP IN ISLET GRAFT DYSFUNCTION AND FAILURE     by  KATHRYN JANE POTTER B.Sc. Hons., The University of British Columbia, 2005    A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF      DOCTOR OF PHILOSOPHY  in   THE FACULTY OF GRADUATE STUDIES (Pathology and Laboratory Medicine)     THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)         August 2011 © Kathryn Jane Potter, 2011  ii  ABSTRACT Islet transplantation has great promise as a treatment for patients with insulin-dependent diabetes but its long-term success is limited by progressive graft dysfunction.  Many measures of  cell dysfunction in transplantation are similar to those observed in the type 2 diabetic  cell. We focused upon two particular genes underlying pathology of the latter, namely islet amyloid polypeptide (IAPP) and C/EBP homologous protein (CHOP). We hypothesized that CHOP and islet amyloid composed of IAPP played distinct roles in progressive dysfunction and loss of the transplanted  cell.  Human islets and murine islets expressing the IAPP transgene developed islet amyloid following transplantation. Amyloid deposition correlated with loss of glycemic control and was exacerbated by transplantation of a marginal islet mass. Further, pre-existing amyloid in human islets prior to transplantation correlated with graft dysfunction at one year following islet transplantation into human allograft recipients. We tested several strategies to protect against islet amyloid toxicity in a pre-clinical model of human islet culture. Human IAPP deposition and toxicity was abrogated by siRNA against IAPP and by peptide inhibitors of IAPP aggregation. As an alternate strategy, transplantation of porcine islets expressing minimally amyloidogenic forms of IAPP yields excellent long-term outcomes.  Islet amyloid deposition and toxicity is particularly rapid in the transplanted islet. This phenomenon may relate to factors in the transplant environment. We demonstrated that heparin, used in clinical islet transplantation, potentiates amyloid deposition in human islets. In addition, it exacerbates IAPP toxicity to cultured cells and accelerates graft failure in marginal mass human islet grafts.  CHOP is activated by prolonged endoplasmic reticulum or oxidative stress. We demonstrated that CHOP immunostaining is increased in marginal mass islet grafts. Transplantation of islets in which CHOP has been deleted or silenced by RNA significantly improves glycemic normalization in marginal mass grafts and reduces apoptosis. These data suggest that CHOP plays a detrimental role in islet graft dysfunction.  iii  These studies demonstrate a role for two independent non-immune factors in mediating islet graft dysfunction and for which therapeutic modulation may improve  cell function and survival in both islet transplantation and type 2 diabetes.                                             iv  PREFACE  Ethics approval was obtained for the use of human samples from the University of British Columbia / Children’s and Women’s Health Centre of British Columbia Research Ethics Board (Ethics Certificates #H06-03112, #H0370453). Animal studies were reviewed and approved by the University of British Columbia Committee on Animal Care (Protocols # A10-0294, #A05- 1003-A006).  In Chapter 3, K. Potter monitored mice, performed i.p. glucose tolerance tests, retrieved and fixed grafts for histological processing, and performed graft histology and analysis for all murine islet grafts. Technical assistance in islet isolation and transplantation was provided by D. Dai and G. Soukhatcheva. A. Klimek performed proinsulin and insulin ELISAs and determined the proinsulin:insulin ratios; these data and thioflavin S analysis of human islets grafted into NOD.scid mice performed by K. Potter are also presented in A. Klimek’s Ph.D. thesis (1). For human islet grafts, A. Klimek and S. Butterworth contributed human islet graft samples and corresponding blood glucose data. Islet allograft donor pancreas histological sections and clinical data were provided by Dr. G. Korbutt (University of Alberta). Islet autograft donor pancreas histological sections and clinical data were provided by Dr. H. Rilo (University of Cincinnati). K. Potter performed all histological staining and analysis for human autograft and allograft donor pancreas and islets. Lipid nano-particles containing one of the short-interfering RNAs (siRNA) for human IAPP (si-hIAPP4) were generated by Dr. C. Tam in the laboratory of Dr. P. Cullis (University of British Columbia). All cultured studies using these liposomes and subsequent data analysis was performed by K.Potter. Hexa-peptides used for studies presented in Figure 14 were synthesized by Dr. P. Fraser (University of Toronto). Islet culture studies in Figures 14 and 15A were performed by Dr. L. Marzban; all immunostaining and histological analysis presented in this these figures was performed by K. Potter. Figures appearing in Figure 14 and 15A have been published in Potter et al. Biochim Biophys Acta 1790(6):566-74, 2009 (2) and Marzban et al. Diabetes. 57(11):3045-55, 2008) (3), respectively.  Islet culture studies for Figure 15 B-D were performed by K. Potter.  In Chapter 4, all studies except data presented in Figure 17 were performed by K. Potter. Transmission electron microscopy in Figure 17 was performed by Y. Chen in the laboratory of Dr. P. Fraser (University of Toronto). J. Cheng aided in amyloid quantification of cultured human islets and in the development of the insoluble fraction IAPP assay. Dr. Fraser suggested the idea for the insoluble fraction IAPP assay. Technical assistance with islet transplantation was provided by Derek Dai.  A version of Chapter 5 contributed to a manuscript published in the Proceedings of the National Academy of Sciences (USA) (Potter et al. Proc Natl Acad Sci 107:4305-10, 2010). Islet lysis, western blot, porcine IAPP sequencing, thioflavin T kinetics studies, cell culture studies, immunohistochemistry and related analysis were performed by K. Potter. Dr. R. Baker aided in the design of constructs to sequence porcine IAPP. Circular dichroism and electron microscopy presented in this thesis were performed by Drs. A. Abedini and P. Marek in the laboratory of Dr. D. Raleigh (Stony Brook University, NY). Neonatal porcine islets, histological sections from neonatal porcine islet grafts, and blood glucose data from the recipients of these grafts were provided by Dr. G. Korbutt. Histological sections from adult porcine islet grafts, and blood v  glucose from the recipients of these grafts were provided by Dr. S. Bertera and Dr. M. Trucco (University of Pittsburgh).  In Chapter 6, K. Potter performed all studies. C. Zhang aided in studies of glucose-stimulated insulin secretion from isolated islets and several histological analyses. Lipid nano-particles were synthesized by Dr. C. Tam in the laboratory of Dr. P. Cullis. Technical assistance with islet isolation and transplantation was provided by D. Dai, G. Soukhatcheva, and M. Obach.                                    vi  TABLE OF CONTENTS  ABSTRACT ..........................................................................................................................................ii PREFACE ............................................................................................................................................ iv TABLE OF CONTENTS .................................................................................................................... vi LIST OF TABLES............................................................................................................................... xi LIST OF FIGURES ............................................................................................................................xii ABBREVIATIONS ...........................................................................................................................xiv ACKNOWLEDGEMENTS ............................................................................................................ xvii DEDICATION ................................................................................................................................ xviii Chapter 1. Introduction......................................................................................................................... 1 1.1 Amyloid ....................................................................................................................................... 1 1.1.1 Current definition of amyloid ............................................................................................. 1 1.1.2 Amyloid formation .............................................................................................................. 2 1.1.3 Functional amyloid .............................................................................................................. 2 1.1.4 Pathological amyloid ........................................................................................................... 3 1.1.5 Amyloid toxicity .................................................................................................................. 3 1.1.6 Public health burden of amyloid diseases .......................................................................... 4 1.2. Diabetes mellitus ....................................................................................................................... 5 1.2.1 Type 1 diabetes .................................................................................................................... 6 1.2.2 Type 2 diabetes .................................................................................................................... 7 1.2.3 Other causes of diabetes mellitus ....................................................................................... 9 1.2.4 Complications of diabetes ................................................................................................. 10 1.2.5 Treatment of diabetes mellitus .......................................................................................... 10 1.3.  cell replacement .................................................................................................................... 11 1.3.1 Stem cell therapy ............................................................................................................... 11 1.3.2 Pancreas and islet transplantation ..................................................................................... 12 1.3.2.1 Pancreas transplantation ................................................................................................. 12 1.3.2.2 Islet transplantation ........................................................................................................ 13 1.4 Graft dysfunction in islet transplantation ................................................................................ 15 1.4.1 Immune-mediated graft destruction.................................................................................. 15 1.4.1.1 Alloimmunity .................................................................................................................. 15 1.4.1.2 Autoimmunity ................................................................................................................. 17 1.4.1.3 Innate immunity .............................................................................................................. 18 vii  1.4.2 Non-immune causes of graft failure ................................................................................. 19 1.4.2.1 Causes related to early graft dysfunction ...................................................................... 20 1.4.2.1.1 Pre-existing conditions within donor tissue ............................................................... 20 1.4.2.1.2 Isolation procedure and islet culture .......................................................................... 21 1.4.2.1.3 Site of transplantation.................................................................................................. 22 1.4.2.1.4 Hypoxia following transplantation ............................................................................. 24 1.4.2.1.5 Hyperglycemia ............................................................................................................. 24 1.4.2.1.6 Transplanted islet mass ............................................................................................... 26 1.4.2.1.7 Instant blood mediated inflammatory reaction .......................................................... 27 1.4.2.1.8 Inflammation ................................................................................................................ 28 1.4.2.1.9 Immunosuppressive drug toxicity .............................................................................. 29 1.4.2.2 Intrinsic features of the  cell that may promote graft failure ..................................... 30 1.4.2.2.1 Metabolic stress on the graft ....................................................................................... 30 1.4.2.2.1.1 Endoplasmic reticulum stress responses in  cell physiology ............................... 30 1.4.2.2.1.2  Pathological ER stress and apoptosis in  cells..................................................... 32 1.4.2.2.1.3 Oxidative stress ........................................................................................................ 32 1.4.2.2.1.4 Oxidative and ER stress pro-apoptotic signaling ................................................... 33 1.4.2.2.1.5 Impaired prohormone processing in islet transplants............................................. 34 1.4.2.2.1.6 Islet amyloid ............................................................................................................. 34 1.5 Summary ................................................................................................................................... 38 1.6 Thesis hypothesis and objectives ............................................................................................. 39 Chapter 2. Methods and materials ..................................................................................................... 41 2.1 Materials .................................................................................................................................... 41 2.2 Preparation of peptide stock..................................................................................................... 41 2.3 Fluorometry............................................................................................................................... 41 2.4 Circular dichroism .................................................................................................................... 42 2.5 Transmission electron microscopy .......................................................................................... 42 2.6 Cell culture ................................................................................................................................ 42 2.7 Animals ..................................................................................................................................... 43 2.8 Islet isolation ............................................................................................................................. 44 2.8.1 Human islet isolation ................................................................................................... 44 2.8.2  Murine islet isolation ................................................................................................... 44 2.9 Islet culture ................................................................................................................................ 45 2.9.1 Human islet culture ...................................................................................................... 45 viii  2.9.2 Murine islet culture ...................................................................................................... 45 2.10 In vitro glucose-stimulated insulin secretion ........................................................................ 45 2.11 Islet transplantation ................................................................................................................ 45 2.12 Intraperitoneal glucose tolerance tests .................................................................................. 46 2.13 Immunohistochemistry and other histological staining ....................................................... 46 2.14 Porcine IAPP sequencing ....................................................................................................... 47 2.15 Insoluble IAPP/protein assay ................................................................................................. 48 2.16 IAPP western blotting ............................................................................................................ 48 2.17 CHOP western blotting .......................................................................................................... 48 2.18 Data and statistical analysis ................................................................................................... 49 Chapter 3. Role of islet amyloid in islet transplant dysfunction ...................................................... 50 3.1. Introduction .............................................................................................................................. 50 3.2 Methods ..................................................................................................................................... 53 3.2.1 Islet transplantation............................................................................................................ 53 3.2.2 Islet allograft cohort........................................................................................................... 53 3.2.3 Islet autograft cohort .......................................................................................................... 54 3.2.4 Quantification of islet amyloid load and prevalence in donor islets .............................. 54 3.3 Results ....................................................................................................................................... 54 3.3.1 Expression of human IAPP in transplanted islets promotes  cell dysfunction ............ 54 3.3.2 Deposition of amyloid within transplanted marginal mass grafts of hIAPP Tg/0  islets is associated with graft failure........................................................................................................ 58 3.3.3. Amyloid formation is associated with human islet graft failure .................................... 61 3.3.4. Increased amyloid area within human islet grafts is associated with a lower islet transplant mass ............................................................................................................................ 63 3.3.5. Islet amyloid in human islet allograft donors ................................................................. 65 3.3.5.1. Analysis of amyloid severity and prevalence in the islet allograft cohort ................. 65 3.3.5.2 Correlation of amyloid load and prevalence with available clinical data ................... 65 3.3.6. Islet amyloid in human islet autograft donors................................................................. 70 3.3.6.1. Amyloid load characterization for the islet autograft cohort ...................................... 70 3.3.6.2. Lack of correlation of amyloid load and prevalence in donor islets with HbA1C ..... 71 3.3.7. Hexapeptide IAPP derivatives inhibit amyloid formation and protect against amyloid- induced apoptosis ........................................................................................................................ 76 3.3.8. RNA silencing of human IAPP protects against amyloid deposition and toxicity in cultured human islets .................................................................................................................. 77 3.4. Discussion ................................................................................................................................ 79 ix  Chapter 4. Effect of heparin on amyloidogenesis and toxicity of human IAPP ............................. 90 4.1 Background ............................................................................................................................... 90 4.2 Methods ..................................................................................................................................... 91 4.2.1 Time course of IAPP toxicity ............................................................................................... 91 4.3 Results ....................................................................................................................................... 92 4.3.1 Heparin accelerates the formation and the final yield of IAPP amyloid fibrils ....... 92 4.3.2 Heparin accelerates the extent and onset of IAPP toxicity ....................................... 95 4.3.3 Heparin promotes islet amyloid deposition in cultured human islets ..................... 101 4.3.4. Effect of heparin on apoptosis in cultured human islets .............................................. 105 4.3.5 Functional evaluation of the effects of heparin pre-treatment on human islets in a transplantation model ................................................................................................................ 107 4.4 Discussion ............................................................................................................................... 113 Chapter 5. Porcine IAPP is minimally fibrillogenic and porcine islet transplants have excellent long-term outcomes .......................................................................................................................... 121 5.1 Introduction ............................................................................................................................. 121 5.2. Results .................................................................................................................................... 122 5.2.1. Detection of porcine IAPP in neonatal porcine islets ...................................................... 122 5.2.2. Determination of the sequence of porcine (1-37) IAPP ................................................... 123 5.2.3. Porcine IAPP is minimally fibrillogenic ........................................................................... 124 5.2.4. Differences in primary sequence of porcine and human IAPP explain species differences in IAPP cytotoxicity ..................................................................................................................... 127 5.2.5. Porcine islet grafts do not develop amyloid deposits ....................................................... 128 5.3. Discussion .............................................................................................................................. 130 Chapter 6. Role of CHOP in islet graft dysfunction ....................................................................... 135 6.1. Introduction ............................................................................................................................ 135 6.2 Results ..................................................................................................................................... 136 6.2.1. CHOP levels are increased in marginal mass grafts ........................................................ 136 6.2.2. CHOP knockout islets are protected against thapsigargin-induced ER stress ................ 136 6.2.3. CHOP knockout islets have improved insulin response to glucose ................................ 138 6.2.4. CHOP -/-  islets restore and maintain normoglycemia following syngeneic transplantation  ........................................................................................................................................................ 138 6.2.5. Marginal mass CHOP -/- islet grafts restore glycemic control more rapidly .................... 139 6.2.6. Liposomal delivery of siRNA against CHOP is effective in improving marginal mass islet graft function ......................................................................................................................... 143 6.3. Discussion .............................................................................................................................. 146 Chapter 7. Conclusions..................................................................................................................... 151 x  References ......................................................................................................................................... 155                                           xi  LIST OF TABLES Table 1. List of primary antibodies. .................................................................................................. 47 Table 2. Blood glucose in murine recipients of adult porcine islet transplants. ........................... 129 Table 3. Blood glucose in murine recipients of neonatal porcine islet transplants. ..................... 130                                          xii  LIST OF FIGURES Figure 1. Optimal mass grafts of islets expressing human IAPP restore glycemic control but have impairments in glucose tolerance and proinsulin processing. ......................................................... 56 Figure 2. Optimal mass grafts of islets expressing human IAPP develop islet amyloid................ 57 Figure 3. Recipients of marginal mass grafts of islets expressing human IAPP have impaired glucose tolerance. ............................................................................................................................... 59 Figure 4. Recipients of marginal mass grafts of islets expressing human IAPP develop amyloid associated with graft failure. .............................................................................................................. 60 Figure 5. Amyloid formation is associated with human islet graft failure...................................... 62 Figure 6. Increased amyloid area is associated with lower transplanted graft mass. ..................... 64 Figure 7. Amyloid severity and prevalence in islet allograft donors. ............................................. 67 Figure 8. Lack of correlation between acute insulin response to glucose and islet amyloid in islet allografts. ............................................................................................................................................. 68 Figure 9. Amyloid prevalence in islets prior to transplantation is predictive of loss of insulin independence....................................................................................................................................... 69 Figure 10. Amyloid severity in islet autograft donors...................................................................... 72 Figure 11. Amyloid prevalence in islet autograft donors. ................................................................ 73 Figure 12. Correlation between amyloid load and prevalence in islet autograft donors. ............... 74 Figure 13. Lack of correlation between HbA1c in islet graft recipients and amyloid in transplanted islets................................................................................................................................ 75 Figure 14. A hexapeptide fragment of IAPP inhibits amyloid formation and apoptosis in cultured human islets......................................................................................................................................... 76 Figure 15. siRNA-mediated inhibition of hIAPP protects cultured human islets from amyloid deposition and toxicity. ...................................................................................................................... 78 Figure 16. Heparin decreases the lag time of fibril formation and increases load of fibril formation as assessed by thioflavin T fluorescence kinetic assay. .................................................. 93 Figure 17. Heparin increases fibril load as assessed by transmission electron microscopy. ......... 94 Figure 18. Heparin enhances toxicity of synthetic human IAPP. .................................................... 96 Figure 19. Experimental design to assess the onset of heparin-potentiated IAPP toxicity relative to fibril formation. .............................................................................................................................. 98 Figure 20. Heparin accelerates the onset and disappearance of IAPP toxicity. ............................ 100 Figure 21. Heparin enhances amyloid deposition in cultured human islets.................................. 102 Figure 22.Heparin enhances amyloid deposition in cultured human islets as assessed by an ELISA-based assay. .......................................................................................................................... 104 Figure 23. Heparin abrogates IAPP toxicity in cultured human islets as assessed by TUNEL and cleaved caspase-3 immunohistochemistry. ..................................................................................... 106 Figure 24. Heparin protects against apoptosis in INS-1  cells..................................................... 107 Figure 25. Experimental design for islet transplantation experiments following pre-transplant culture with heparin. ......................................................................................................................... 109 Figure 26. Histology of human islets after 1 week in culture in the presence of heparin. ........... 110 Figure 27. Pre-transplant culture of human islets in heparin promotes graft failure. ................... 111 Figure 28. Graft histology following transplantation of human islets pre-cultured with heparin. ............................................................................................................................................................ 112 Figure 29. Removal of heparin following 1 week of culture does not affect amyloid formation but does increase islet cell apoptosis. .............................................................................................. 113 xiii  Figure 30. Proislet amyloid polypeptide and mature islet amyloid polypeptide are detectable in lysates of neonatal porcine islets. .................................................................................................... 123 Figure 31. Primary sequence of human and porcine islet amyloid polypeptide. .......................... 124 Figure 32. Porcine islet amyloid polypeptide is less fibrillogenic than human islet amyloid polypeptide. ....................................................................................................................................... 126 Figure 33. Porcine islet amyloid polypeptide is less cytotoxic than human islet amyloid polypeptide. ....................................................................................................................................... 127 Figure 34. Lack of amyloid in native or transplanted porcine islets. ............................................ 129 Figure 35. CHOP immunoreactivity is elevated in marginal mass mouse islet grafts. ................ 136 Figure 36. CHOP -/-  islet cells are protected against apoptosis thapsigargin-induced apoptosis .. 137 Figure 37. In vitro functional comparison of wild-type and CHOP-/- islets.................................. 138 Figure 38. Optimal mass syngeneic transplantation of wild-type and CHOP -/-  islets. ................. 139 Figure 39. CHOP -/-  islets restore glycemic control more rapidly than wild-type islets in marginal mass islet transplants. ....................................................................................................................... 141 Figure 40. Histological analysis of replicating and apoptotic cells in marginal mass wild-type and CHOP -/-  islet transplants. .................................................................................................................. 142 Figure 41. Lipofectamine-mediated delivery of CHOP siRNA suppresses CHOP expression and thapsigargin-induced activation of caspase 3. ................................................................................ 143 Figure 42.Uptake of liposomes containing Cy3-labelled siRNA into mouse islets. .................... 144 Figure 43. Lipid nano-particle delivery of CHOP siRNA suppresses thapsigargin-induced CHOP expression. ......................................................................................................................................... 144 Figure 44. CHOP siRNA enhances islet transplant function. ........................................................ 145 Figure 45. Strategies to prevent  cell dysfunction and loss in islet transplantation . ................. 152                           xiv  ABBREVIATIONS  4-PBA  4-phenyl butyric acid AA  Amyloid A AFU  Arbitrary fluorescence units AL  Amyloid light chain AMP  Adenosine monophosphate ANOVA Analysis of variance APC  Antigen presenting cell ATF  Activating transcription factor ATP  Adenosine triphosphate ATTR  Transthyretin BB  Biobreeding BCA  Bicinchoninic acid protein assay BiP  Binding immunoglobulin protein Bl/6  C57BL/6 mice BMDMS Bone marrow-derived mesenchymal stem cells BMI  Body mass index bZIP  Basic leucine zipper domain CCAC  Canadian Council on Animal Care CCL  Chemokine (C-C motif) ligand CD  Cluster of differentiation; Circular dichroism (Chapter 5 only) C/EBP  CCAAT/enhancer-binding protein CFRI  Child and Family Research Institute CHOP  C/EBP homologous protein (same as DDIT3) CHOP -/-  B6.129S-Ddit3 tm1Dron /J mice ClC3  Cleaved caspase-3 CPE  Carboxypeptidase E CXCL1 Chemokine (C-X-C motif) ligand 1 DCCT  Diabetes control and complications trial DDit3  DNA damage-inducible transcript 3 (same as CHOP) DMSO  Dimethyl sulfoxide DPP-IV Dipeptidyl peptidase 4 EDTA  Ethylenediaminetetraacetic acid EGFR  Epidermal growth factor receptor ELISA  Enzyme-linked immunosorbent assay eIF  Eukaryotic initiation factor EST  Expressed sequence tag ER  Endoplasmic reticulum ERAD  ER-associated degradation ESRD  End-stage renal disease FBS  Fetal bovine serum FKBP  FK506 binding protein FTIR  Fourier transform infrared spectroscopy FVIIa  activated factor VII GAD65 Glutamate decarboxylase 65 xv  GAG  Glycosaminoglycan GK  Goto-Kakizaki rat GLP-1  Glucagon-like peptide-1 GLUT  Glucose transporter GSIS  Glucose-stimulated insulin secretion IGF-1  Insulin-like growth factor 1 IRE1   Inositol-requiring kinase 1 HbA1c  Glycated hemoglobin Hb-EGF Heparin-binding epidermal growth factor hESC  Human embryonic stem cell HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid hIAPP 0/0   Wild-type (FVB/NJ) mice hIAPP Tg/0   Hemizygous human IAPP (FVB/N-Tg(Ins2-IAPP)RHFSoel/J) mice HIP  Human IAPP transgenic rat HNF1 Hepatocyte nuclear factor 1 homeobox A HNF1 Hepatocyte nuclear factor 1 homeobox B HNF4 Hepatocyte nuclear factor 4 homeobox A HFIP  1,1,1,3,3,3-Hexafluoro-2-propanol IA-2  Islet autoantigen-2 IAPP  Islet amyloid polypeptide IBMIR  Instant blood mediated inflammatory reaction IE  Islet equivalent IFN Interferon IL  Interleukin IL-1R  Interleukin-1 receptor INS  Insulin INS-1  Rat insulinoma transformed  cell line IP  Intraperitoneal IP3R  Inositol-3-phosphate receptor IPF-1  Insulin promoter factor 1 iPS  Induced pluripotent stem cell IU  International units JNK  c-Jun N-terminal kinase KRB  Krebs-Ringer bicarbonate buffer LDH  Lactate dehydrogenase MCP-1 Monocyte chemoattractant protein-1 MHC  Major histocompatibility complex MIP-1 Macrophage inflammatory protein-1 MMP  Matrix metalloproteinase MODY Maturity-onset diabetes of the young mTOR  Mammalian target of rapamycin Ngn1  Neurogenin 1 NO  Nitric oxide NOD  Non-obese diabetic mouse NOD.scid Non-obese diabetic/severe combined immunodeficiency mouse (NOD.CB17- Prkdc scid /J) xvi  NP-40  Nonyl phenoxypolyethoxylethanol, or Igepal CA-630 PAM  Peptidyl-glycine -amidating monooxygenase PBS  Phosphate-buffered saline PC1/3  Prohormone convertase 1/3 PC2  Prohormone convertase 2 Pdx-1  Pancreatic and duodenal homeobox 1 PDI  Protein disulfide isomerase PERK  Protein kinase RNA-like endoplasmic reticulum kinase PERV  Porcine endogenous retrovirus PI  Proinsulin PI/PI+I Proinsulin:insulin ratio Pme-1  Protein phosphatase methylesterase-1 PMSF  Phenylmethanesulfonylfluoride PNDM  Permanent neonatal diabetes proIAPP pro-islet amyloid polypeptide PTDM  Post-transplantation diabetes mellitus PVDF  Polyvinylidene fluoride qPCR  Quantitative PCR RAMP  Receptor modifying protein RNS  Reactive nitrogen species ROS  Reactive oxygen species RPMI  Roswell Park Memorial Institute medium RyR  Ryanodine receptor si-hIAPP Small interfering RNA targeted against the human IAPP gene siRNA  Small interfering RNA SNP  Single nucleotide polymorphism SRP  Signal recognition particle STZ  Streptozotocin TBS-T  Tris-buffered saline with tween TEM  Transmission electron microscopy TF  Tissue factor Tg  Thapsigargin Tg-hIAPP Human IAPP transgene Th  T-helper cell TLR  Toll-like receptor TNDM Transient neonatal diabetes TNF Tumor necrosis factor TUDCA Tauroursodeoxycholic acid TUNEL Transferase-mediated dUTP nick-end labeling UKPDS United Kingdom prospective diabetes study UPR  Unfolded protein response VEGF  Vascular endothelial growth factor WT  Wild-type mouse ZnT8  Zinc transporter 8   xvii  ACKNOWLEDGEMENTS  I have much gratitude to all of the wonderful family, friends, and mentors that I’ve been blessed to have in my life.  I would like to thank the many mentors over the years for wisdom, encouragement, and inspiration. To my supervisor, Dr. Bruce Verchere, many thanks for the many opportunities and guidance you have provided me with over the years and the leap you took deciding to take on an MD/PhD student! From the day you allowed me to join your lab as an undergraduate, you have allowed me the freedom to be creative and the capacity to work on fascinating projects. You are an incredibly brilliant and kind individual and you inspire me with your knowledge, wisdom, sense of humour, and unfailingly positive attitude. I also owe many thanks to the many other mentors over the years who have nurtured my love of science, provided amazing opportunities, and shared their experiences and wisdom: Jeff Reading, Dr. Douw Steyn, Dr. David Cramb, Dr. Pieter Tieleman, Dr. Anne English, Dr. Urs Ruegg, in particular, Dr. Casey van Breemen and Dr. Damon Poburko. Finally, I am very grateful for the mentorship of Dr. Torsten Nielsen, Dr. Lynn Raymond, Dr. Bruce Tiberiis, and Dr. Karen Pinder during my years MD/PhD years. Thank you to all of my mentors - I would not have gotten here without your support and belief in me.  I would also like to thank all of the Verchere Lab members over the years, with special thanks to Derek Dai, Dr Paul Orban, Dr. Galina Soukatcheva, Clara Westwell-Roper, Dr. Agnieszka Klimek, Dr. Meredith Hutton, Dr. Mike Kennedy, Dr. Merce Obach, and Dr. Joel Montane. In particular, Derek Dai, Galina Soukhatcheva, and Merce Obach, thank you for the countless hours of islet isolation and surgery. To Dr. Paul Orban, I have greatly appreciated all of your insight, teaching, and humour. To my students Charlie Zhang and Jordan Cheng, you inspired me with your enthusiasm and pushed me to carry projects much further. I would also like to thank lab collaborators with whom I have had the opportunity to work on exciting projects, particularly Dr. Paul Fraser, Dr. Chris Tam, Dr Pieter Cullis, and Dr. Daniel Raleigh. In addition, Dr Greg Korbutt, Dr. Massimo Trucco, Dr. Suzanne Bertera, Dr. David D’Alessio, and Dr Horatio Rilo provided materials critical to studies presented in my thesis. I would like to thank members of my committee, Dr. Garth Warnock, Dr. Bruce McManus, Dr. Alice Mui, and Dr. Catherine Pallen for guidance and support. Finally, I would like to thank the MD PhD program secretary, Jane Lee, for all of her help over the years.  Finally, I would like to thank my family and friends. You have all provided me with love and support, been there in both the wonderful and the hard times, and taught me that there’s also life outside of science! To my mom, Judith Potter, you are my inspiration, unfailingly supportive, and a close friend and I cannot express how much that means to me. To my dad, Dean Potter, you’ve supported the Potter women through 16 total years of PhDs! Your quiet wisdom, practicality, and support have been invaluable. To all of my wonderful friends, thank you for the fantastic memories from these crazy PhD years. In particular I’d like to thank Ella, Sophie, Theresa, Rebecca, MaryAnn, Elmine, and Karen for support and encouragement.  I would also like to recognize Rx&D Pharma, CIHR, the Michael Smith Foundation, the Canadian Diabetes Association, and the Child and Family Research Institute for financial support during my PhD. xviii  DEDICATION              To my parents, Dean and Judith Potter 1  Chapter 1. Introduction  1.1 Amyloid Amyloid was first identified by Rudolph Virchow in 1854 in his studies of macroscopic pathology in diseased cerebral cortex (4). He discovered that areas of pathology stained blue when treated with iodine. He coined the term “amyloid” to describe these and similar deposits also found in liver and spleen, based upon his assumption that iodine bound to starch. Although these deposits were shown to be proteinaceous in nature in1859 (4), the term amyloid held fast.  1.1.1 Current definition of amyloid Today, amyloid refers to deposits of insoluble protein with characteristic -sheet quaternary structure (5). It should be noted that the  sheets characteristic of amyloid differ biochemically from  sheets found within globular proteins, as determined by differing Fourier transform infrared (FTIR) spectroscopy peaks and differing antibody-binding epitopes (5). Many proteins may adopt this conformation and can be subdivided into two classes. Prions and the mammalian protein Huntingtin have primary sequences rich in glutamine, which stabilizes intramolecular hydrogen bonding (6). The second class of pro-amyloidogenic proteins have regions containing a high proportion of hydrophobic amino acid residues and sequence containing alternating polar and non-polar residues (7). Amyloid fibrils are unbranched and 5 to 25 nm in diameter. They are long polymers of constituent monomers assembled through intermolecular hydrogen bonding between cross-  sheets that are oriented perpendicular to the long axis of the amyloid fibril (5).  In biophysical studies of amyloid, fibrils are identified by several methods. Amyloid fibrils may be visualized by transmission electron microscopy and atomic force microscopy (5).  sheet confirmation is confirmed by circular dichroism (5). Additional biophysical techniques used to study amyloid fibrils include infrared spectroscopy, X-ray diffraction, and electron diffraction (5). In histological sections, several dyes, such as thioflavin S, thioflavin T, and Congo red, are known to bind to amyloid fibrils (8). Thioflavin dye fluorescence is dramatically enhanced upon binding to amyloid fibrils (9).  Thioflavin T interaction with amyloid fibrils is used to monitor amyloid fibril formation in vitro by fluorescence spectroscopy. In histological sections, the binding of Congo red and thioflavin S is used to identify amyloid deposits. Congo red emits a 2  weakly fluorescent signal in the red spectrum upon amyloid binding and is strongly birefringent under polarized light when bound to amyloid. Thioflavin S strongly fluoresces in the blue spectrum upon binding to amyloid.  1.1.2 Amyloid formation Amyloid fibrils are insoluble polymers that form by hydrogen bonding between -sheets of misfolded peptides. These polymers are highly resistant to degradation, although synthetic fibrils may be solubilized in formic acid (10) and enzymes such as neprilysin (11) may degrade fibrils in vivo (11). Amyloid fibril formation is classically monitored by thioflavin T fluorescence (9). The kinetics of amyloid fibril formation comprise three phases: 1) a lag phase; 2) a phase of rapid fibril growth; and 3) a steady-state plateau (12). Rapid fibril growth begins following formation of a nucleus which seeds fibril growth. Seeding of monomers with pre-formed fibrils greatly accelerates progression to the second phase (13). In the third phase, visualization of amyloid fibrils by transmission electron microscopy reveals a dense meshwork of long, unbranched fibrils (5) and circular dichroism indicates complete conversion to sheet structure. Thioflavin T kinetics do not characterize prefibrillar assembly well. Thioflavin dyes bind to the cross -sheet structure of amyloid fibrils (9), but may also bind to prefibrillar species which have distinct -sheet conformation (12, 14-19) and exist in multimeric assemblies, ranging from dimers to small oligomers to large multimeric assemblies (12). Prefibrillar species form during the lag phase of thioflavin-monitored kinetics.  1.1.3 Functional amyloid Although typically known as a pathology, many proteins form amyloid to fulfill physiological functions. Bacterial biofilms, essential for adherence to surfaces, are composed of proteins that have adopted amyloid-like structure. For example, the TasA protein (14) secreted by Bacillus subtilis and the Curli protein (15) secreted by Escherichia coli form amyloid fibrils which are principal components of biofilm. The malarial coat protein adopts an amyloid conformation to protect Plasmodium falciparum (16). The major silk protein, spidroin, adopts an amyloid conformation (17). Amyloid formation by yeast prions promotes replication, phenotypic diversity, and growth in nitrogen-poor environments (15, 18). In mammals, the melanosome protein Pme17 forms functional amyloid that serves as a template for melanin polymerization 3  (15). Prohormones adopt amyloid-like conformations within secretory granules of mammalian peptide-hormone producing cells (15). The concept of functional amyloid has been well characterized amongst bacterial and simple eukaryotes, but is novel in the vertebrate world. It is highly likely that additional roles for functional amyloid will be identified in vertebrates in the years to come.  1.1.4 Pathological amyloid Over 40 amyloid-forming proteins have been implicated in disease pathology (4, 19, 20). Although the traditional definition of amyloid encompassed proteins forming -sheet structure due to hydrophobic residues in their primary structure, this definition has recently been expanded to include cross-  sheet structure formed by glutamine rich proteins, such as huntingtin (21-23), and proteins localized to pathological inclusions with cross-  sheet properties, such as - synuclein (22, 24-26). Amyloid diseases may be divided into two classes, namely systemic and localized amyloidoses. In systemic amyloidosis, such as amyloid light chain (AL), amyloid A (AA), transthyretin (ATTR), and -2 microglobulin amyloidosis, amyloid deposits may be found throughout multiple tissues (27). Other amyloidoses are localized to a particular tissue, such as amyloid  in the cerebral cortex in Alzheimer’s disease and islet amyloid in the pancreatic islet.  1.1.5 Amyloid toxicity In recent literature, it has become apparent that amyloid fibrils are less cytotoxic than pre- fibrillar forms, which are the predominant cytotoxic species (12, 28). The toxicity of aged fibrils is minimal and several amyloids have been characterized to have early toxicity that diminishes over time. Protein engineering of amyloid  to stabilize an oligomeric state and prevent formation of mature amyloid fibrils yielded highly toxic species (29). The term “pre-fibrillar species” refers to a heterogenous ensemble of entities with  sheet structure that are on-pathway to amyloid formation. Another vague term, oligomer, is commonly used to describe -sheet containing, non-fibrillar toxic species which may be on- or off-pathway to fibril formation (12). Prefibrillar species have been proposed to exert toxicity through many mechanisms for both intra- and extracellular toxicity. Intracellular mechanisms of toxicity include endoplasmic reticulum (ER) stress-mediated apoptosis following aggregation of misfolded protein in the ER (30), perforation of organelle membranes and subsequent calcium toxicity (28), oxidative stress 4  (31, 32), perturbation of mitochondrial function (33, 34), and disruption of autophagy and lysosomal degradation (35). Extracellular mechanisms include membrane perforation or channel formation leading to cytosolic calcium overload (28, 36) and death receptor activation (37). Apoptosis is potentiated by activation of CHOP (30), caspase-3 (38), and calpain signaling (39). Although amyloid fibrils are considered minimally toxic, their presence within tissues likely limits metabolite clearance and nutrient delivery and disrupts organ architecture. The characteristic  sheet structure of amyloid species may also stimulate pattern recognition receptors in the innate immune system (40), leading to local inflammation, cytokine production (40), and release of reactive oxygen and nitrogen species.  1.1.6 Public health burden of amyloid diseases Amyloid underlies several notable diseases for which there is no cure, and for many of which treatments are minimally effective. Many neurodegenerative diseases have underlying amyloid pathology, such as Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, and spongiform encephalopathy. Alzheimer’s disease may be moderately improved in the early stages by anti-cholinesterases. Its course, however, is unrelenting, leading to severe dementia. Patients may persist for years with dementia. The global economic burden of Alzheimer’s disease is staggering. Between 10 and 15% of adults over the age of 65 may have dementia (41). In the Canadian Outcomes Study in Dementia, 83% of enrolled dementia patients had Alzheimer’s disease (42). Canadian studies place the yearly economic burden of mild dementia at approximately $13,000 per patient and at $40,000 per patient for severe dementia (43).  Parkinson’s disease may be treated early in its course with pharmaceuticals that enhance the lifetime of dopamine in the substantia nigra or with deep brain stimulation. Similar to Alzheimer’s disease, therapeutics do not alter the course of the disease, which ultimately leads to severe impairment of mobility, fine motor function, speech, and swallowing; a subset of Parkinson’s patient also develop dementia. Parkinson’s disease had a prevalence of 12% in the Canadian Study on Health and Aging (44).  There is no available treatment for Huntington’s disease or spongiform encephalopathy. The cost of care for affected individuals is extensive (45). Spongiform encephalopathy, also known as Creutzfeldt-Jakob disease, is unique among the amyloidoses in that it is infectious. Disease 5  control to minimize exposure to the underlying infectious prions must be exercised at hospitals treating affected human patients, at farms in which infected animals are identified, and at meat processing facilities which may have processed an infected carcass. Millions of dollars are lost sterilizing hospital equipment and destroying entire herds of animals in which a single case of Creutzfeldt-Jakob disease is encountered (46-48). Amyloidoses affecting the central nervous system are a considerable economic burden.  Amyloidoses affecting organ systems other than the central nervous system also engender significant cost. Amyloid deposition in the renal glomeruli precipitates renal dysfunction requiring dialysis.  The estimated cost of dialysis for a single patient is $60,000 per annum, according to the Canadian Institute for Health Information.  Type 2 diabetes is gaining growing recognition as an amyloid disease in which islet amyloid accelerates the course of the disease and may contribute to diabetic renovascular pathology (49). The annual cost to treat an individual with diabetes mellitus in Canada exceeds $3000 (50), not including the cost of care of complications such as dialysis, blindness, and limb amputation. Though this cost is not extreme on an individual level, it will become considerable as type 2 diabetes prevalence is expected to double by 2030.  There is essentially no treatment available to target amyloid pathogenesis for any of the 20 or more known amyloid diseases. Even in the face of cardiac, renal, and hepatic transplantation, amyloid disease recurrence has been documented (51-58) and graft survival and function may be limited in recipients previously diagnosed with amyloid diseases (55, 56, 59). Indeed, de novo amyloid deposition has also been documented in transplant recipients not diagnosed with amyloidosis prior to transplantation (60). The development of anti-amyloid strategies is critical to reduce worldwide disease burden of several of the most prominent incurable diseases of the 21 st  century.  1.2. Diabetes mellitus Diabetes mellitus encompasses an ensemble of metabolic disorders with the common features of hyperglycemia and serum insulin levels insufficient for the metabolic needs of the peripheral tissues. This results in the classic diagnostic triad of polyuria, polydipsia, and polyphagia. A clinical diagnosis of diabetes mellitus may be established upon evidence of persistent 6  hyperglycemia, including fasting plasma glucose > 7.0 mM, plasma glucose > 11.0 mM two hours following a 75 g oral glucose challenge, or glycated hemoglobin above 6.5%. An individual is considered “pre-diabetic” if their fasting glucose exceeds 6.1 mM or their plasma glucose exceeds 7.8 mM at 2 hours post-glucose challenge. According to the World Health Organization, the worldwide diabetes prevalence is 171 million individuals (2010). Type 1 diabetes affects approximately 10% of these individuals, while type 2 diabetes accounts for the majority of cases. Increasing prevalence of type 2 diabetes is predicted to increase diabetes prevalence to 366 million worldwide by 2030 (61).  1.2.1 Type 1 diabetes Type 1 diabetes results from insufficient insulin secretion due to autoimmune destruction of pancreatic  cells.  cells are selectively destroyed by autoreactive CD8 + T cells that recognize cell antigens (62, 63). CD4 + T cells and macrophages also infiltrate the pancreatic islets (64). CD4 + -T-cells are critical to disease pathogenesis and promote the activation and maturation of CD8 + T cells (64). Much of our understanding of type 1 diabetes is based upon the development of diabetes in the NOD mouse and the BB rat. In these rodents, the disease process is preceded by inflammatory infiltration of the islet (63). Disease susceptibility in the NOD mouse lies in the Idd5 (65) and Idd9 (66) loci that govern T cell stimulation and survival, in MHC II genes, such as the Idd1 locus (67-69), and in additional susceptibility loci, such as Idd3 (68), Idd12 (69), and Idd18 (69). Upon defective thymic negative selection, islet antigen specific T cells are activated in pancreatic lymph nodes followed by subsequent infiltration of the islet.  cells are destroyed by CD8 + T cells;  cell mass, however, may not be immediately depleted. A honeymoon period has been described in some patients who may become experience remission and insulin independence for up to a year following a diabetes diagnosis and initial insulin therapy (70). Type 1 diabetes tends to be diagnosed in children above 4 years of age, with a bimodal distribution of onset peaking at 5 and 11 years of age (71). The pathological process, however, begins much earlier as evidenced by the appearance of autoantibodies against known  cell antigens, including preproinsulin, glutamate decarboxylase 65 (GAD65), islet autoantigen 2 (IA- 2), and zinc transporter 8 (ZnT8) (72) in human patients prior to metabolic dysfunction.  The onset of overt type 1 diabetes is thought to occur upon loss of >80-95% of pancreatic  cell mass (73, 74), although recent studies suggest that diabetes may occur upon loss of as little as 40% of pancreatic  cell mass (75) or upon loss of insulin-positive immunostaining in 70% of islets (74). 7   Type 1 diabetes results from a combination of genetic susceptibility and environmental triggers. Genetic susceptibility is illustrated by the 27-54% (70, 76) concordance rates of type 1 diabetes in monozygotic twin studies (70) and the development of impaired glucose tolerance in non- symptomatic first-degree relatives of type 1 diabetic patients (77). Strong genetic susceptibility is associated with DR3 (DRB1*0301 DQA1*0501–DQB1*0201) and DR4 (*0401,0402, 0404 and 0405) haplotypes of human leukocyte antigen class II (76). Additional genes that confer risk include the insulin (INS) gene, the CTLA4 gene, and possibly PTPN22 genes (76). Environmental causes, such as Group B Coxsackie viral infection (78), are thought to play a role in the development of type 1 diabetes in genetically susceptible individuals. Viral infection of cells may lead to the presentation of  cell antigens to autoreactive T-cells, resulting in autoimmune attack (79).  1.2.2 Type 2 diabetes Type 2 diabetes results from a combination of inadequate insulin secretion and insufficient insulin sensitivity. Inadequate insulin secretion by the pancreatic  cell results from deficits in both  cell function and mass. The type 2 diabetic  cell is characterized by multiple defects in insulin secretion and gradual cell loss by apoptosis. Defective first-phase glucose-stimulated insulin secretion (GSIS) is detectable in patients with impaired fasting glucose or impaired glucose tolerance (80). Islets from individuals with type 2 diabetes have absent first phase GSIS, reduced second-phase GSIS, and reduced insulin secretion in response to non-glucose secretagogues (81-83). Peripheral serum insulin concentration normally oscillates due to pulsatile insulin release, caused by coordinated bursts of insulin granule release (84). In type 2 diabetic patients, both diurnal and ultradian oscillations are decreased early in the disease process due to impaired rapid pulsatile insulin release (85). Processing of the insulin precursor, proinsulin, is also impaired in type 2 diabetes. Basal and stimulated proinsulin levels and proinsulin:insulin ratios are significantly elevated in type 2 diabetic patients in whom rates of clearance of proinsulin and insulin do not differ from healthy controls (86, 87).  Type 2 diabetic  cells also show evidence of de-differentiation (88, 89) and exhibit markers of oxidative (90) and ER stress (91).  8  Progressive loss of  cell mass is critical to disease pathogenesis. In autopsy studies, type 2 diabetic patients have greatly reduced  cell mass as compared to controls matched for the degree of obesity (73). Prior to diabetes onset, fractional cell volume is reduced by approximately half in individuals with impaired fasting glucose (73). Loss of  cell mass in type 2 diabetes is due to apoptosis (92) thought to result in part from prolonged glucotoxicity (93). Prolonged ER or oxidative stress, for which there is evidence in human type 2 diabetic  cells (90, 91), may also lead to apoptosis. Islet amyloid and inflammation may also contribute to apoptotic loss of  cells. Islet amyloid is a characteristic pathology of the type 2 diabetic islet (94): amyloid fibrils (95) and prefibrillar (96) intermediates are preferentially toxic to  cells and likely contribute to the progressive loss of  cell mass (97, 98). Type 2 diabetic islets have elevated numbers of macrophages (99) and increased production of pro-inflammatory cytokines, such as IL-1  (100). A local pro-inflammatory milieu may promote  cell dysfunction and loss. Thus, loss of  cell mass in diabetes is progressive and exacerbated by  cell dysfunction, islet amyloid deposition, and inflammation, all of which will be described in more detail in later sections.  The progressive decline in  cell mass and function in type 2 diabetes is exacerbated by peripheral insulin resistance. In adipose, skeletal and hepatic tissue, glucose uptake into cells is dependent upon insulin-receptor-mediated translocation of GLUT4 to the plasma membrane. In an insulin resistant cell, the concentration of insulin required to sufficiently activate the insulin receptor is much greater than in a normal individual. This results from a combination of fewer insulin receptors and reduced capacity of the insulin receptor to activate cytosolic tyrosine kinases (101). In the face of insulin resistance, the  cell must compensate by increasing insulin secretion.  cell dysfunction worsens under chronically elevated secretory demand. Insulin resistance may be increased in the  cell itself, thus decreasing first-phase glucose-stimulated insulin secretion and impairing glucose tolerance (102). A primary  cell defect becomes evident as first-phase insulin secretion in response to glucose declines. Weir et al developed a five-stage model of progression of  cells from compensation to decompensation (103). Early in the disease, the  cell is able to compensate for insulin resistance. In the early stages of  cell exhaustion, corresponding to impaired glucose tolerance in an individual, first phase insulin secretion diminishes and there is evidence of  cell de-differentiation. This will progress to frank 9  diabetes, in which glycemic control is lost and  cell de-differentiation is more severe, and  cell mass is profoundly reduced. While a  cell defect is intrinsic to the progression of diabetes, this defect is exacerbated by insulin resistance.  1.2.3 Other causes of diabetes mellitus A subset of diabetes diagnoses (1-3% of diagnoses in children) (104) is directly attributable to single gene mutations that affect transcription factors critical to  cell development, cause severe  cell dysfunction, or are critical to mature  cell function. Diabetes may present as permanent neonatal diabetes (PNDM), transient neonatal diabetes (TNDM), or maturity-onset diabetes of the young (MODY). PNDM and TNDM are diagnosed within the first 3 months of life and have a prevalence of 1/400,000 births (104). Diabetes does not resolve in PNDM, whereas in TNDM, hyperglycemia resolves but 50% of individuals later relapse. TNDM is most commonly associated with paternal isodisomy of chromosome 6 (105). Gene mutations underlying PNDM are commonly found in the insulin gene; in glucokinase, which serves as the  cell glucose sensor; in FOXP3; in EIF2AK3 and in genes for subunits of the  cell KATP channel, ABCC8 or KCNJ11 (105). MODY, in which diabetes develops prior to 25 years of age, has a prevalence of 2% of diabetes diagnoses (106). In MODY2, mutations in glucokinase dampen responsiveness of insulin secretion in response to elevation in plasma glucose (107). Other causes of MODY involve mutations in genes critical to insulin gene transcription, IPF-1 (MODY4) and Ngn1 (MODY6), or other transcription factors critical to  cell mass and function, HNF4  (MODY1), HNF1  (MODY3), and HNF1  (MODY5) (107).  Gestational diabetes occurs in 2-5% of pregnancies and resolves following pregnancy. Development of gestational diabetes is a strong risk factor for type 2 diabetes. Placental hormones and pregnancy-induced increases in cortisol, leptin, and TNF  increase insulin resistance in pregnant women (108). Diabetes may also be caused by medications, endocrinopathies, and defects of the exocrine pancreas. Drugs known to cause diabetes include glucocorticoids and immunosuppressive agents such as tacrolimus. Endocrinopathies in which diabetes may develop include Cushing syndrome, acromegaly, hyperthyroidism, and pheochromocytoma. Diabetes may result from damage to the pancreas such as in chronic 10  pancreatitis, cystic fibrosis, pancreatic neoplasm, and hemochromatosis, or following pancreatectomy.  1.2.4 Complications of diabetes The long-term complications of diabetes mellitus are common between disease subtypes. Chronic hyperglycemia leads to both macro- and micro-vascular complications. The macrovascular complications of diabetes are cardiovascular, cerebrovascular, and peripheral vascular (109, 110). Diabetes is one of the strongest predictive risk factors for stroke and myocardial infarction (109). Chronic hyperglycemia and inflammation associated with diabetes increases the risk of atherosclerotic plaque formation, hypercoagulability, and platelet adhesion, and decreases fibrinolysis (111). Microvascular complications of diabetes include retinopathy, nephropathy, and neuropathy (109); these may lead to blindness, renal failure, and progressive limb amputation, respectively. The most likely mechanisms underlying microvascular complications are oxidative damage, advanced glycosylation end-products, and intracellular polyol accumulation leading to osmotic stress (112). Rigid glycemic control has been shown to slow the progression of complications in type 1 diabetes in the Diabetes Control and Complications Trial (DCCT) (113) and to minimize the development of complications in type 2 diabetes in the United Kingdom Prospective Diabetes Study (UKPDS) study (114). As detailed in a subsequent section, islet transplantation may be superior to rigid glycemic control in slowing, at least temporarily, the progression of complications in type 1 diabetes (115).  1.2.5 Treatment of diabetes mellitus Type 1 diabetes is treated with insulin replacement therapy, frequent glycemic monitoring, and dietary management. Insulin replacement therapy may be given by multiple daily insulin injections or by insulin pump.  cell replacement, by pancreas or islet transplantation, may be considered to slow the progression of diabetes. Treatment of type 2 diabetes depends upon the stage of the disease. Initial modifications in diet and lifestyle dramatically slow diabetes pathology. In the early years of the disease, while there is adequate remaining  cell mass and function, cell function may be potentiated to promote adequate insulin secretion. Sulfonylureas close the ATP-dependent potassium channel of the  cell, thus promoting insulin secretion by cell depolarization. Incretin analogues such as exendin-4 potentiate insulin release by receptor- 11  mediated increases in cytosolic AMP. An alternate strategy to potentiate the effects of endogenous incretins is to administer dipeptidyl peptidase (DPP-IV) inhibitors. Insulin resistance may also be reduced using thiazolidinediones or biguanides to reduce secretory pressure on the cell. Once an individual has progressed to overt  cell failure, treatment more closely resembles that of type 1 diabetes, by insulin injection and rigid glycemic monitoring.  1.3.  cell replacement  cell replacement remains a “holy grail” of diabetes research, with the potential to dramatically improve quality of life and minimize complications of diabetes. Insulin therapy only estimates insulin requirements and cannot tune plasma insulin concentration to transient fluxes in plasma glucose. Transplantation of  cells with a glucose sensor is thus theoretically superior to the best medical therapy in minimizing glycemic fluxes. Many strategies have been proposed to replace cells, from stem cells to whole organ transplantation.  1.3.1 Stem cell therapy An effective  stem cell therapy would require generation of a cell able to produce and store large quantities of insulin and to effectively secrete sufficient insulin in response to a stimulus such as glucose. Strategies to generate glucose-responsive, insulin-producing cells have been attempted with both embryonic and adult stem cells. Established protocols transform human embryonic stem cells (hESC) into cell colonies capable of synthesizing multiple islet hormones (116). By current protocols, 2-8% of cells are C-peptide positive and have similar insulin content per cell as an adult human  cell (117). Insufficient glucose-stimulated insulin secretion in vitro remains a considerable challenge of the hESC approach, although these cells achieve improved GSIS several months following transplantation. To circumvent ethical issues of hESC origin, induced pluripotent stem (iPS) cells may be derived from adult human somatic cells or umbilical vein cord blood. While the iPS stategy is promising, it has not yet been possible to differentiate sufficient numbers of functional, mature  cells in vitro (118). Bone marrow-derived mesenchymal stromal cells may promote formation of insulin-positive cells or may differentiate into insulin-producing cells. Although evidence remains preliminary, transplantation of bone marrow-derived mesenchymal stem cells (BMDMS) promotes insulin secretion and glycemic 12  control in diabetic rodents (119). While stem cell-derived  cell replacement therapies show promise, all strategies remain pre-clinical.  1.3.2 Pancreas and islet transplantation Whole pancreas and islet transplantation are clinically available therapies for  cell replacement. In whole pancreas transplantation, the pancreas is grafted such that the arterial and venous circulation of the recipient are connected to the iliac artery and vein, respectively, and the pancreatic duct is connected to the recipient duodenum. Pancreas transplantation is currently restricted to type 1 diabetic individuals with end-stage renal disease (ESRD), typically in conjunction with or following renal transplantation. Islet transplantation offers a less-invasive alternative to pancreas transplantation with fewer potential complications for patients not undergoing renal transplantation. Islet transplantation involves separation of islets from pancreatic acinar tissue by collagenase digestion and purification; a suspension of isolated islets is infused into the portal vein of the recipient.  Success in pancreas and islet transplantation was attained only after decades of research. Early unsuccessful attempts at transplantation of pancreatic tissue included subcutaneous xenotransplantation of sheep pancreatic tissue in 1893 (120) and autologous pancreatic tissue grafts in canines (121).  In 1924, Pybus et al described the transplantation of cadaveric human pancreas to ameliorate glycemic control (121); the graft was lost due to lack of immunosuppression. In 1966, pancreas transplantation performed using azathioprine immunosuppression achieved long-standing insulin independence in an adult type 1 diabetic recipient (122). Subsequent success rates remained as low as 10%. Advances in surgical technique and immunosuppression over the last three decades greatly improved outcomes and reduced technical surgical complications from 25% (1980) to 8% (123). To date, 30,000 pancreas transplants have been performed worldwide (124).  1.3.2.1 Pancreas transplantation Pancreas transplantation is recommended by the American Diabetes Association as an acceptable therapeutic alternative in diabetic patients with end-stage renal disease. Current estimates of pancreas graft survival are 95% and 90% at 1 and 3 years’ post-transplantation, respectively 13  (124). Long-term metabolic control is maintained in pancreas transplantation. Recipients have robust insulin secretory responses to glucose and arginine (125), although basal and stimulated insulin levels are 2-3 fold greater than in normal adults. Kendall et al reported maintenance of glycemic control in 21 patients for >5 years and in 3 patients for > 10 years (122). Multiple centres have reported glycemic control for 5 years, while some have reports of 10-20 years of glycemic control in individuals (126). Hypoglycemic events and hypoglycemic unawareness are uncommon and vascular complications of diabetes improve or stabilize (124). Despite considerable success in graft survival and metabolic control, pancreas transplantation presents many potential complications. Peri-transplant and early post-surgical complications include graft thrombosis, deep wound infections, leakage, hemorrhage, graft pancreatitis, and graft non- function or delayed function (123). Other common complications are cardiovascular and cerebrovascular (124).  1.3.2.2 Islet transplantation Islet isolation was first attempted by Paul Lacy in 1967 and Moskalewski in 1969 (121). The technique was optimized and automated in 1988 (121). Lacy reversed diabetes in rats made diabetic by treatment with the  cell toxin streptozotocin (STZ) by syngeneic islet grafting in 1972 (120). He achieved similar results in diabetic primates (124). Human islet autografts were first attempted in 1980 in patients undergoing pancreatectomy to treat pain associated with chronic pancreatitis; insulin independence was achieved in 3 of 10 patients for 3-38 months (120). The first successful allogeneic islet transplantation was performed in 1980 and insulin independence was maintained for 9 months (120). The first successful trials of human islet allo- transplantation were performed at the University of Pittsburgh in 1990 (127) and at the University of Alberta in 1992 (128). Overall success, however, remained low, with insulin independence rates at 1 year post-transplantation not exceeding 10% (120, 124). The Edmonton Protocol, introduced in 2000, revolutionized islet transplantation by eliminating xenoproteins from islet media, eliminating overnight islet culture, transplanting an excess of 11,000 islet equivalents/kg, and eliminating glucocorticoids (121). In the International Trial of the Edmonton Protocol for Islet Transplantation (129), 44% of graft recipients achieved insulin independence at 1 year post-transplantation and 28% achieved partial graft function. At two years post- transplantation, 31% were insulin-independent. 14  Islet transplantation offers a less-invasive alternative to pancreas transplantation with fewer potential complications. Nevertheless, islet graft survival is limited. Successful transplantation appears limited to centres with extensive experience. A rate of 90% insulin-independence was achieved in three well-established transplant centres (120), while success rates at other sites hovered around 23%. Long-term success of islet transplantation is also limited. In the International Trial of the Edmonton Protocol, 75% of recipients required exogenous insulin at two years following achievement of insulin independence. Similar findings were reported by the University of Miami and the Collaborative Islet Transplant Registry (121). To restore insulin independence, graft recipients require additional islet infusions (130), with some receiving as many as four total infusions (124). Even multiple infusions do not preserve long-term normoglycemia (124). Despite lack of long-term insulin independence in recipients, islet transplantation is successful in slowing the progression of vascular complications (115) and reducing hypoglycemic events (121) in patients that maintain detectable levels of C-peptide. Glycemic control was improved in patients back on insulin but who remained C-peptide positive as compared to C-peptide negative (120). When graft success is evaluated in terms of C-peptide secretion, 83% of patients demonstrate islet function at 5 years following transplantation (131). Reported complications of islet transplantation are primarily complications of immunosuppressive treatment or immunosuppressive drug toxicity (121). Risks of immunosuppression include impaired renal function, hypertension, and hypercholesterolemia, among others (124). Additional complications include elevated liver function tests, procedural hemorrhage, and abdominal pain (130). Pancreas and islet transplantation are strategies for  cell replacement that have undergone clinical trials in humans and that are currently available.  Pancreas transplantation is a clinically established procedure accepted for the treatment of patients with type 1 diabetes and ERSD or diabetes not adequately controlled by insulin therapy (132). Over 30,000 cadaveric pancreas transplants have been performed worldwide with one-year graft success rates of between 76-95% (124, 133-135), 3 year survival of ~60-90% (124, 133), and 5 year survival of 40-70% (135- 137). The majority of these procedures are performed in tandem with (72%) or following (17%) a kidney transplant, and only 7% of recipients receive a pancreas alone (124). By several reports, pancreas transplantation maintains long-term normoglycemia over years (122, 124, 126), decreases the occurrence of hypoglycemic events (124), and slows progression of diabetic vascular complications (124).  Reported rates of insulin independence range from 80-98% (137- 15  141) at 1 year following transplantation, 65% (135) after 2 years, 24-41% (136) after 5 years, and 28% after 10 years (142). Comparisons of islet function in transplanted pancreas and isolated transplanted islets are limited, although  cells in transplanted pancreas secrete greater amounts of C-peptide than those of transplanted islets (143). When procedures were performed at the same institution, three-fold more pancreas transplant recipients were insulin independent 1 year following the procedure (141), although a comparison of the functional outcomes of the procedures is biased in favour of pancreas transplantation as it receives higher quality organs from younger and healthier donors (144-147). Pancreas transplantation is limited by surgical complications and morbidity (123, 124, 141), particularly in type 1 diabetic recipients with long- standing disease and complications of diabetes. Islet transplantation is an experimental therapy (132) offers a non-surgical approach with proven benefit in improving glycemic control and slowing progression of microvascular complications in long-standing diabetic patients for whom invasive surgery has high risks of peri- and post-operative morbidity. Nevertheless, improvements in long-term graft function and survival would increase support for islet transplantation.  1.4 Graft dysfunction in islet transplantation At 2 years following islet transplantation, 75% of initially successful islet grafts can no longer maintain insulin independence (129), such that graft recipients require partial supplementation or full medical therapy with exogenous insulin. Both immune and non-immune mechanisms may contribute to islet graft loss and dysfunction.  1.4.1 Immune-mediated graft destruction 1.4.1.1 Alloimmunity Graft tissue is at risk of rejection in allotransplantation. Rejection may be hyperacute (immediately following transplantation), acute (in the first week following transplantation), or chronic (occurring months to years following transplantation). Hyperacute rejection occurs within minutes to hours of engraftment. It may be mediated by both inflammatory and humoral mechanisms. Most commonly, tissue factor (TF) and macrophage chemoattractant protein (MCP-1) exposed on the surface of isolated islets promotes destruction of up to 70% of transplanted islets by the instant blood mediated inflammatory reaction (IBMIR) (148, 149). 16  IBMIR is characterized by activation of the coagulation and complement systems, rapid activation and consumption of platelets (150, 151), and subsequent inflammation and leukocyte infiltration (152). Heparin is administered peri-operatively and up to 7 days post-operatively to inhibit the clotting cascade (152, 153) to promote graft survival. Alternate strategies to reduce TF production, block exposed tissue factor, or interfere with the complement and clotting cascades show promise in minimizing IBMIR (148, 149, 152, 154-156).  Acute and chronic rejection are primarily lymphocyte mediated. Rejection is initiated by presentation of donor antigens to T cells in regional lymph nodes. Donor antigens are presented on major histocompatibility complexes (MHC II) on the surface of antigen presenting cells (APCs). APCs may be derived from the donor or recipient. Presentation by donor or recipient APCs is termed direct or indirect presentation, respectively. Direct presentation is of particular importance in acute rejection, while chronic rejection is mediated by indirect presentation (157). CD4 +  lymphocytes are activated if a second signal is generated by binding interaction of the APC cell surface co-stimulatory molecular B7 (CD80, 86) with the  T-cell CD28 receptor (158). Activated CD4 +  lymphocytes undergo IL-2 driven proliferation and release cytokines and other ligands to activate CD8 + T-cells, macrophages, natural killer cells and B cells. CD8 +  T cells kill graft cells by granulysin and perforin-induced cell lysis, by granzyme activation of caspases, and by activation of Fas receptors on target cells (157). CD4 + -mediated immunity has a critical role in mediating islet allograft rejection (159-161). Recent studies have also established a role for CD8 +  T cells in allograft rejection (162-164). CD8 +  cytotoxic T cells may be activated independently of CD4 +  lymphocytes (165), by Th1 cytokines such as IFN  The humoral, or antibody-mediated response, may contribute to acute and chronic rejection. It typically plays a role in acute rejection if a patient has been previously sensitized, by means of previous transplants (166), blood transfusions (167), and pregnancy (168). In chronic rejection, alloantibodies develop to the graft over time (169). Antibody binding to graft antigens activates the complement cascade or phagocytosis of graft cells via Fc or C3 receptors.  Immunosuppression in islet transplantation was revolutionized by the Edmonton Protocol. Introduction of the Edmonton protocol dramatically improved 1-year islet transplant outcomes, most significantly by omission of glucocorticoids (129, 170).  Prior to the Edmonton Protocol, 17  the insulin independence rate at l year post-transplantation was less than 10% (152). In this steroid-free protocol, immunosuppression was achieved using daclizumab for induction and low- dose sirolimus, tacrolimus, and mycophenylate mofetil for maintenance therapy (129). Each of these therapies interferes with lymphocyte activation and proliferation. Daclizumab, sirolimus, and tacrolimus inhibit IL-2 driven proliferation of activated T cells (158, 171). Daclizumab is a humanized monoclonal antibody that binds to the T-cell IL-2 receptor to inhibit binding of interleukin-2 (158). Sirolimus forms a complex with FKBP12, which binds to mTORC1 and inhibits mTOR signaling (158, 172). Tacrolimus inhibits calcineurin signaling and subsequent IL-2 transcription by binding to FKBP12-FK506 (158). Mycophenylate inhibits purine synthesis, which is critical to T cell proliferation (158). Rituximab has been proposed as an adjuvant therapy to inhibit humoral responses (173). Rituximab is a monoclonal antibody that binds CD20 on B cells (158). Immunosuppression protocols continue to be refined using combinations of these available immunosuppressive agents.  1.4.1.2 Autoimmunity Autoimmune destruction of pancreatic  cells is intrinsic to the pathophysiology of type 1 diabetes. In type 1 diabetes, up to 90% of  cells are destroyed by T-cell mediated processes, although cells and residual insulin production are still detectable years after the onset of overt disease (174). Differentiation of T cells involved in initial  cell destruction into memory cells allows the persistence of a population of T cells that are activated by  cell antigens. Presentation of such antigens following islet transplantation may reactivate these cells, leading to destruction of transplanted  cells. Activation of memory CD8 + T-cells has been associated with rapid destruction of  cells in twin-to-twin pancreas transplantation (175), although CD4 +  memory T cells have also been implicated in recurrent autoimmunity (176). In some cases of islet transplantation, rapid graft loss has been associated with the re-appearance of GAD-65 and IA-2 autoantigens (152). Depletion using a CD8-specific monoclonal antibody (177) or with anti-CD4 antibody (178) has proven effective in protecting islet grafts in BB rats and NOD mice, respectively, from recurrent autoimmune destruction of cells.  18  1.4.1.3 Innate immunity The innate immune system recognizes pathogens in a pattern-specific manner. While traditional immunosuppressive therapies target the adaptive immune response, blockade of innate immunity also promotes islet allograft and xenograft survival. Many factors in the pre- and peri-transplant periods can activate the innate immune system. Islet isolation leads to cytokine and chemokine production by human islets (179). In the peri-transplant period, multiple factors promote activation of the innate immune system in the recipient. Surgical procedures and anesthesia promote systemic cytokine production (180). The infusion of isolated islets triggers IBMIR (149), which activates the coagulation and complement cascades, promotes cytokines and free radical production, and recruits neutrophils and macrophages to the graft. Further inflammation may result upon reperfusion of islets that were ischemic during pre-transplantation islet culture (181).  Activation of the innate immune system in transplanted islets promotes pro-inflammatory signaling and recruitment of natural killer cells, macrophages, neutrophils, and dendritic cells (182). These cell types are recruited by cytokines and complement activation (182). Elevated levels of cytokines are expressed in transplanted islets and contribute to graft dysfunction and loss. Syngeneic murine islet grafts express high levels of cytokines and chemokines (183). Within the graft, pro-inflammatory mediators are released by intra-islet macrophages (184) and damaged -cells (185). When islets are transplanted into the portal vein, hepatic Kupffer cells also secrete pro-inflammatory cytokines (186). Secreted cytokines include IL-1 , TNF- , IFN- , IL-2 and IL-6 (187-191) and known chemokines include IL-8, MCP-1, and macrophage inflammatory protein-1  (MIP-1 ) (184, 185). Cytokines may induce  cell apoptosis. Release of IL-1 , TNF- , and IFN-  within the islet contributes significantly to early -cell loss (187- 191). The direct and indirect detrimental effects of released cytokines on transplanted islets are demonstrated by cytokine blockade and macrophage depletion. Cytokine blockade with neutralizing antibodies preserves  cell mass and decreases the number of islets required to achieve normoglycemia in mice (192). Systemic depletion of macrophages prolongs allograft survival (182). Toll-like receptor (TLR) signaling is an additional means by which the innate immune system may be activated in islet transplantation. TLR activation may play a role in the early function of both allografts and xenografts (193-197). TLR signaling is also important in mediating inflammation in islets. While TLR signalling in donor islets is not essential to long- 19  term rejection of allografts or xenografts (198, 199), TLRs on immune cells of the graft recipient are involved in the innate immune response to syngeneic islet transplantation (200) and may inhibit T regulatory cell generation (201). Innate immunity may be activated by multiple mechanisms in islet transplantation and its activation may be detrimental to graft survival and function. Additionally, innate activation of dendritic cells may also promote adaptive immune responses (182) which mediate allorejection.  1.4.2 Non-immune causes of graft failure Much focus on islet loss in transplantation has centered around immune-mediated mechanisms. Accumulating evidence from animal studies and clinical data suggests that non-immune factors also contribute to early and long-term graft failure.  Early graft failure encompasses both primary non-function of engrafted tissue and rapid loss of graft function and survival in the early post-transplantation period. Up to 60% of graft mass is lost in the first 7 days following transplantation in a syngeneic rodent model not subject to auto- or alloimmunity (202).  Long-term graft failure refers to declining graft function following an extended period of graft function. Islet grafts fail slowly and progressively over time, despite aggressive immuosuppressive therapy. Whereas T-cell mediated destruction of target cells is rapid even in chronic rejection, human islet transplant recipients maintain C-peptide secretion despite loss of insulin independence (129, 203, 204). Failing grafts in humans and primates commonly demonstrate little evidence of rejection. In three autopsies performed on allogeneic islet transplant recipients with marginally functioning grafts, islet mass was reduced to 10-15% of the infused islet mass yet there was no evidence of inflammation or infiltration (205). Toso et al failed to detect significant peri-islet inflammation in biopsies from 16 human islet allograft recipients (206). In those biopsies in which a minimal immune cell infiltrate surrounded some islets, there was no correlation with graft function even for 2 patients with worsening glycemic control (206). Slowly progressive loss of islet function is observed in cynomolgus monkey islet isografts and allografts despite adequate immunosuppression and no evidence of rejection (207). Further, human and other large mammal islet autografts demonstrate a slowly progressive loss of insulin independence despite absence of allo- and auto-immunity (205, 208, 209). Biopsies in 20  beagle autotransplants prior to graft failure showed that 84% of islets contained well-granulated cells, while this decreased to 5% following graft failure (209). Of human patients achieving insulin independence following autotransplantation, 20% return to requiring insulin between 1- 1.5 years following transplantation and of patients with partial graft function, 50% returned to requiring insulin several months post-transplant (210). Webb et al reported that only 26% of islet autotransplant patients experienced periods of insulin independence, with 11% remaining stably independent, and the median time of insulin independence being 16.5 months (211). Insulin dose increased with each year following islet auto transplantation (211, 212). Loss of cell mass and a gradual progressive  cell dysfunction in islet autografts suggest that non-immune factors are important contributors to loss of insulin independence in graft recipients.  1.4.2.1 Causes related to early graft dysfunction 1.4.2.1.1 Pre-existing conditions within donor tissue Characteristics of donor tissue may impact islet engraftment and function following transplantation. Donor organs are scarce (213), with the highest quality organs being utilized for pancreas transplantation (144, 145). Ideally, an organ used for islet transplantation should fall within selection criteria for solid organ transplants, with a donor age range between 18 and 45 years, a body weight between 40 and 100 kg, and without a history of diabetes mellitus or pancreatitis (214).  Organs allocated to islet transplantation are more likely to come from aged donors with higher body mass index (BMI) (146, 147) and tend to have longer cold ischemic time (144). A higher BMI is preferential in islet isolation as the digestion procedure is more efficient (214-217) and the islet yield is greater (218). Donors for islet transplantation have been as old as 70 years (219). Islets from younger donors have improved function in vitro and in vivo (214, 220). Once donor age exceeds 45 years, there is increased risk of poor glycemic control and early graft dysfunction in whole pancreas transplant (221). Some studies have shown lower insulin content and responsiveness in islets of older donors (218, 222). High-BMI donor pancreata tend to be fatty (216), more susceptible to reperfusion injury (216), and have significantly lower survival and long-term maintenance of insulin independence following pancreas transplantation (217). Although type 2 diabetic pancreata are not used in islet transplantation, high BMI donors have a 21  high probability of being pre-diabetic. It is not known whether  cell dysfunction is reversible in islets from pre-diabetic donors. There is, however, evidence that islets of type 2 diabetic donors function poorly in transplantation. Hyperglycemia in a donor has been shown to have poor outcomes following pancreas transplantation (145, 223). Islet yields from human type 2 diabetic pancreata are reduced (205). Islets from type 2 diabetic humans are smaller, have an increased :  ratio, have abnormal GSIS and do not reverse hyperglycemia in transplanted mice (205). In spite of correlations of elevated donor age and BMI with reduced islet quality, each of these characteristics improve islet yield following isolation in all but one report (214, 216, 224-227). Such donors continue to be used for islet transplantation due to the high islet yield and the allocation of better quality pancreata for whole pancreas transplantation.  1.4.2.1.2 Isolation procedure and islet culture Islets may sustain considerable damage during the isolation procedure. Many factors influence final islet yield and quality. Islets are subject to warm ischemic damage during collagenase digestion of the pancreas (228). Furthermore, islet isolation damages islets by osmotic, chemical, ischemic, enzymatic and mechanical insults (229-231). Isolation-induced damage to islet ultrastructure includes plasma membrane breakage (232), loss of peripheral cells (232), and disrupted islet capillary integrity and islet extracellular matrix. Disruption of the islet matrix during isolation leads to reduced islet viability and subsequent anoikis (233) or apoptosis (234). Cold ischemic time following collagenase digestion also affects islet yield and quality (218, 224). Minimization of cold ischemic time improves outcomes (228). Warm and cold ischemia subject  cells, which express particularly low levels of anti-oxidants (235), to ischemic damage. Following islet isolation, pro-apoptotic factors are elevated in isolated islets (229, 236). Islet isolation decreases insulin mRNA by 40% and upregulates stress genes (237). Islet isolation also leads to induction of proinflammatory cytokines and chemokines (179, 230, 238-240). An additional important consideration in islet isolation is the purity of the islet preparation. One might predict that impure preparations would be less effective. Surprisingly, islet preparations containing more ductal epithelial cells, thought to be islet progenitor cells, are more likely to maintain long-term metabolic success (222).  The necessity of islet culture prior to transplantation is debatable. Although the Edmonton Protocol recommended transplantation of islets within 2 hours of isolation, the majority of islet 22  transplant centres culture islets between 48-72 hours to give the transplant team and recipient more flexibility (241). Pre-transplant culture also allows quality assessment of islets and may improve islet metabolic activity as compared to islet function immediately following the stress of isolation (242). Islet culture may reduce immunogenicity and the culture medium CMRL reduces MCP-1 and TF expression (179, 243). Deng et al reported that improved outcomes in islet transplantation may have resulted from a shift to pretransplant culture (205). Islets are cultured at 22 o C pre-transplant to promote apoptotic loss of remaining acinar tissue, decrease  cell metabolism, and slow production of pro-apoptotic molecules prior to transplantation (244). Reports on the effects of islet culture on viability and function are variable (243, 245-247). Islet morphology and function have been reported to be maintained between 1 and 2 weeks (241, 243, 248). Kin et al reported that islet mass is reduced in culture despite improvements in morphology (249). Established negative consequences of islet culture may result from microbial contamination (250) and hypoxia (235). Culture may promote  cell de-differentiation and replication (229, 250) as well as islet amyloid deposition (2, 3). Finally, large islets tend to undergo central necrosis and have reduced secretion and survival (244, 251). While overnight pre-transplantation has both practical and some functional advantages, additional strategies employed in pre-transplant culture might improve outcomes following transplantation. Additionally, overnight culture of islets allows a window for ex-vivo treatment with compounds to promote islet survival following transplantation.  1.4.2.1.3 Site of transplantation In clinical islet transplantation, islets are infused into the portal vein following percutaneous catheter insertion under radiological guidance (252). The portal vein has been the site used in the majority of human islet transplants. Complications of portal vein infusion are rare but do include thrombosis (253), areas of local focal necrosis following islet infusion (254), modest increases in portal venous pressure with each subsequent islet infusion (253), hemorrhage, portal vein thrombosis, hemothorax, pneumothorax, hemobilia, and puncture of adjacent organs (252). The liver as a transplant site has both advantages and disadvantages. A critical advantage in humans is that this site may be accessed non-surgically under alternating ultrasound and fluoroscopic guidance (255). This is of particular value for type 1 diabetic patients for whom invasive surgery poses increased risk of morbidity, infection and complications relative to the general population (256). Transplantation into the portal vein leads to insulin independence given a sufficient islet 23  mass (129) and islets achieve pulsatile insulin secretion in response to hyperglycemia (257, 258). Over the long-term, however, this site is not ideal for islet function and survival. Insulin content, glucose-stimulated insulin release, insulin biosynthesis, glucose oxidation rate, and glucagon responsiveness to hypoglycemia were markedly decreased in islets transplanted to the liver relative to native islets (259-261). Islets transplanted into the portal vein showed downregulation of critical  cell proteins including Pdx-1, GLUT-2, glucokinase, mitochondrial glycerol- phosphate dehydrogenase, and pyruvate carboxylase (261, 262). Islet survival is limited in the portal vein. Survival rates of rat islets transplanted into the portal vein declined from 89% at day 1 to 43% at day 7 (202). There are many reasons the portal vein may not be the optimal transplantation site. Oxygen tension within the portal vein may be inadequate to support the high metabolic demand of pancreatic islets (263). Further, vascular density within portal vein transplanted islets is much lower than in native islets (264). Local insulin release by intrahepatic islets stimulated triglyceride accumulation and upregulation of lipogenic enzymes in adjacent hepatocytes, which may promote  cell dysfunction and death by lipotoxicity (265), evidenced by a reduction in islet  cell area. The local hepatic milieu may generate a proinflammatory milieu for islets, as its reticuloendothelial system has a large population of macrophages which may produce ROS, NO and cytokines detrimental to islet function (263). Finally, the portal vein has elevated concentrations of glucose and metabolites. Immunosuppressive drug concentrations in the portal vein are 2-3 fold higher than in the peripheral circulation (171, 172, 266, 267). Although the portal vein is easily accessible for transplantation, it is not an ideal heterologous transplantation site for islets.  Other sites have been considered for islet transplantation. Different organs may have different paracrine activity, local metabolite levels, oxygen tensions, inflammatory responses, and revascularization capacity (268). Other sites in which islet transplantation has achieved glycemic control in animal models include the spleen (269-271), omentum (262, 271, 272), renal subcapsular space (272, 273), gastrointestinal wall (273), pancreas (273, 274),  thymus (275), bone marrow (273, 276), celiac artery (277), skeletal muscle (262, 273), and subcutaneous space (278, 279). Due to practical reasons and associated risks, the renal subcapsular space, spleen, and pancreas are limited in their suitability for clinical application (273, 280). These and other proposed sites remain experimental and further research is required to validate their utility in clinical islet transplantation. 24   1.4.2.1.4 Hypoxia following transplantation Islets have a high oxygen tension in the native pancreas and their metabolic activity is highly dependent upon sufficient oxygen availability. Islets have substantially reduced oxygen tension in culture. Furthermore, islet endothelial cells die rapidly in culture (229) and islets are avascular following transplantation (281).  Islets are not revascularized until 7-14 days post-transplantation (152, 282). Final graft vascular density is half that of native islets and oxygen tension is reduced five-fold regardless of site of implantation (281-283). In the portal site, capillaries may fail to penetrate islets (244). Islets may be lost by apoptosis due to hypoxia (284). Numerous areas of local focal necrosis are found in the liver following islet infusion and up to 2 weeks post- transplantation (254, 285). Reperfusion injury may also occur following re-establishment of the vasculature, in which re-introduction of oxygen may lead to production of reactive oxygen species;  cells have very limited antioxidant defense and are highly susceptible to ROS injury (244). An avascular period in early transplantation, altered vascular phenotype and lower islet oxygen tension may partly account for differences in long-term function between transplanted isolated islets and islets transplanted as part of a whole pancreas.  1.4.2.1.5 Hyperglycemia Islets are transplanted into diabetic individuals, who by definition are subject to chronic hyperglycemia. In the early post-transplantation period, individuals may remain hyperglycemic until islets are revascularized and islet stress due to isolation and transplantation has subsided. Surgical procedures promote insulin resistance and temporary impairment of glucose-stimulated insulin secretion (286). Elevated portal vein glucose levels likely contribute to islet loss prior to engraftment and in the first few weeks following transplantation. To illustrate the effect of recipient hyperglycemia on islet function, primary non-function was observed in transplants into severely diabetic recipients (287). Recipient hyperglycemia at time of transplant greatly affected graft survival (288, 289).  Hyperglycemia in the immediate post-transplantation period may stimulate  cell oxygen consumption and promotes apoptosis (290). Furthermore, hyperglycemia aggravates monocyte chemokine and cytokine expression, activation and adhesion to endothelium (291). Chronic exposure to high levels of extracellular glucose negatively affects cell function. Prolonged exposure of islets to high glucose concentrations impaired glucose- 25  stimulated insulin secretion and induced apoptosis in  cells (85, 292-297) and decreased insulin content (294). Hyperglycemia in transplanted murine islets led to degranulation and swelling of ER and mitochondria (298). In rat islet transplant recipients that remained hyperglycemic for extended periods of time, glucose-stimulated insulin secretion was reduced or absent and grafts had 10% lower insulin content (295). Grafts which subsequently normalized after 2 weeks retained defects in glucose-stimulated insulin secretion (295).   cells adapt to hyperglycemia by expansion of  cell mass and by metabolic changes. Glucose is a critical determinant of  cell mass (299) and hyperglycemia promotes neogenesis and  cell replication in a transplantation model by activation of Akt/mTOR signaling (289, 300). This effect was reported by Donath et al following acute glucose stimulation while chronic exposure to glucose impairs proliferation (293). Metabolic adaptation includes downregulation of glucose sensing and secretion mechanisms, increased glycolysis, and switching to futile cycles and production of uncoupling proteins (301); these effects are reversible in the short-term (299) but may not be in the long-term.  cell de-differentiation, apparent by increased LDH expression and reduced levels of transcription factors and genes critical to  cell function, may occur in transplanted islets and partially pancreatectomized animals due to prolonged hyperglycemia (237, 302-304). Additional changes noted in cells following exposure to hyperglycemia include intracellular glycogen deposition (305, 306) and hypertrophy (303). Prolonged hyperglycemia promotes  cell exhaustion and glucotoxicity.  cell exhaustion occurs when insulin production cannot keep up with demand for secretion (301) and is likely linked to prolonged ER stress. Glucotoxicity negatively impacts insulin gene transcription, content, and secretion and insulin receptor expression and signaling in the  cell and promotes  cell apoptosis (294, 300, 307). Glucotoxicity may also impair  cell function by altering metabolic pathways, increasing intracellular calcium concentration, promoting ER stress from increased demand for insulin production, oxidative stress (246) and mitochondrial dysfunction, and stimulation of IL-1  production (300, 308). IL-1  suppresses  cell function and promotes Fas- mediated apoptosis (293).  Reducing demand on  cells slows  cell metabolism and reduces insulin secretion and ER and oxidative stress (309). Insulin and KATP channel activators have induced  cell rest in animal models and clinical studies (301). Short-term insulin therapy in new-onset diabetic patients with 26  severe hyperglycemia is highly effective in achieving adequate glycemic control and improving insulin secretion after 6 months as compared to oral hypoglycemic agents (299, 310). Peri- transplant insulin treatment promotes superior graft outcomes (311). Treatment of partially functioning autografts with insulin for the first 3 months post-transplantation allowed 50% of grafts to achieve periods of insulin independence (211). Insulin treatment for 14 days promoted function in marginal autografts (312). Supplemental insulin treatment preserved and promoted the function of second allograft islet infusions in human recipients with marginally functioning grafts despite infusion of low numbers of islet equivalents (313). Restoration of euglycemia using insulin promotes  cell regeneration from islet precursors (314). In marginal mass transplants, insulin treatment beginning 7 days prior to transplantation promoted graft function after ceasing insulin therapy (289). Islets treated with insulin during the peri-transplant period restored normoglycemia while the same mass of islets without insulin treatment did not (315). Marginal mass grafts initially treated with insulin had a greater  cell mass, increased  cell replication, and a lower rate of apoptotic  cells at 1 month post-transplantation than mice that remained hyperglycemic (289).  1.4.2.1.6 Transplanted islet mass In humans, an adequate graft mass in islet allotransplantation is considered to be above 10,000 islet equivalents (IE)/kg (316). Insulin independence in islet autotransplantation was more likely to be achieved if greater than 2,000 (317) or 6,000 IE/kg (210, 317, 318) were transplanted. Beyond a critical threshold of islets, canine autografts maintained normoglycemia (209). Patients receiving fewer islets are less likely to become insulin-independent and allograft recipients with single donor islet infusions have poorer long-term outcomes (319). This is particularly surprising given that >90% of pancreas mass must be removed in rodents or 50-60% in humans to induce glucose intolerance or hyperglycemia (87, 303, 320, 321). These findings suggest that a strong majority of transplanted isolated islets fail to engraft; thus, infusion of an optimal number of islets does not guarantee an optimal mass graft.  cell replication in transplanted human islets is particularly low (322), as has also been demonstrated in islet culture (323, 324). Substantial apoptosis occurs in the first days following transplantation in human and murine islets (236, 325- 328) and the rate of apoptosis is particularly high in human islets following isolation (329). Furthermore, a continuous decline in  cell mass was observed over weeks in marginal mass murine grafts (330). Marginal mass grafts also exhibit metabolic dysfunction (326, 331), 27  increased apoptosis (331), and lower resistance to secretory stress (287) and insulin resistance (332) in animal models.  1.4.2.1.7 Instant blood mediated inflammatory reaction The instant blood-mediated inflammatory reaction (IBMIR) is stimulated by TF (149) exposed on the islet surface following islet isolation. Human islets exposed to blood are rapidly destroyed (333). In the peri-transplant period, IBMIR activates the coagulation and complement cascades (150, 151). The extent of IBMIR in an islet graft recipient may depend upon the quality of an islet preparation (150) and may be monitored indirectly by thrombin-antithrombin (TAT) levels (149). The signaling cascades activated by IBMIR lead to consumption of platelets, generation of cytokines and free radicals at the site of islet engraftment, and recruitment of leukocytes and macrophages (152). Each of these processes contribute to islet destruction by the innate immune system. In rats, it is estimated that only one third to half of the transplanted islet mass engrafts (202); IBMIR likely plays a role. Numerous areas of local focal necrosis, which likely correspond to sites at which IBMIR has been initiated, are found in the liver following islet infusion (254) or 2 days later (285), but not at 4 weeks following transplantation (285). Islet cells adjacent to these focal necrotic regions of hepatic tissue demonstrate markers of apoptosis (254). Multiple solutions have been proposed to protect islets against IBMIR. One approach is to minimize the exposure of TF on the islet surface by reducing its production with nicotinamide (152) or pre- and perioperative treatment of recipients with an anti-TF antibody (148). The latter solution was effective in a primate marginal islet allograft model (148). Alternative solutions have attempted to minimize the activity of the complement cascade with soluble complement receptor and the coagulation cascade with activated protein C, the thrombin inhibitor Melagtran, TF inhibitor active site-inactivated FVIIa, heparin, dextran sulfate, or thrombomodulin (149, 152-156, 334). In clinical islet transplantation, heparin is administered peri-operatively and for up to 7 days post-operatively to inhibit the clotting cascade (152, 153) and promote graft survival. The efficacy of soluble heparin, however, is questionable (149). Islet surface heparinization has been demonstrated to be more effective at protecting islets of multiple species against IBMIR (149).  28  1.4.2.1.8 Inflammation Inflammation affects islets immediately following engraftment (192) and long-term following transplantation. Islet isolation and culture promote the production of inflammatory mediators. Islet isolation induces hypoxic and mechanical injury leading to activation of stress signalling pathways (335), including c-Jun N-terminal kinase (JNK) and p38 (336). Islet culture promotes cytokine and chemokine secretion in human or murine islets and the static environment promotes prolonged exposure of islets. Cytokines and chemokines, such as MCP-1, CCL2, CCL25 and CCL28 are produced by human and mouse islets in culture (230, 239, 337). Markers of inflammation are elevated in islets following transplantation. IL-1  and iNOS are substantially upregulated in the first week following syngeneic islet transplantation and localized to CD68- positive macrophages (191). Cytokine expression within the graft indicates the presence of inflammation. Il-1 , IFN-  and TNF-  are elevated in islets following portal vein islet transplantation (186). In a study of the effects of adenoviral expression on post-transplant islet inflammation, control non-transduced grafts were not infiltrated but expressed comparable levels of IFN- , IL-4 and CCR7 and greater levels of CCR5 than did adenovirally transduced syngeneic grafts (338); this demonstrates that grafted islets express cytokines and chemokines. Pro- inflammatory cytokines have a detrimental effect on  cell survival and function (339-343). Local chemokine and cytokine release attracts host macrophages to the graft, which further propagate local inflammation.  Many established causes of inflammation in the type 2 diabetic islet may similarly promote inflammation in transplanted  cells. Long-term allograft survival may be impaired by inflammation associated with metabolic stress, including chronic hyperglycemia and dyslipidemia (289, 344). Hyperglycemia promotes  cell production of IL-1  and subsequent induction of the Fas receptor (293). One month duration of hyperglycemia in the Cohen rat promoted macrophage appearance in the islets (345). Anakinra, an IL-1 receptor antagonist, has been shown to improve  cell secretory function in type 2 diabetic patients (346) and to reduce hyperglycemia in the GK rat (345). Overexpression of IL-1R antagonist in murine islets improves syngeneic transplantation outcomes (347). Long chain fatty acids may also promote islet production of Il-1 , IL-6, IL-8 and CXCL1, potentially via stimulation of TLRs (293).  29  1.4.2.1.9 Immunosuppressive drug toxicity Although progressive graft failure occurs in islet autograft recipients, it occurs at a faster rate in islet allograft recipients in many (129, 210, 312, 317, 348, 349), though not all (210, 211, 317), human clinical studies. The disparity between success of islet allografts and autografts may result in part from the absence of toxic immunosuppressive agents in autotransplantation. Immunosuppressive agents currently employed to prevent islet allograft rejection, including tacrolimus, sirolimus, and mycophenylate, have all been shown to have direct adverse effects on  cells. Tacrolimus is the most diabetogenic agent employed in the immunosuppressive cocktail. In whole organ transplant recipients, tacrolimus causes post-transplant diabetes mellitus (PTDM) in up to one third of patients (238, 350-353). Decreased PTDM correlates with reduced doses of tacrolimus (354). Tacrolimus directly affects the  cell, causing a reversible insulin secretion defect (152, 355-360), decreased insulin mRNA transcription (266, 357), loss of normoglycemia in murine (266, 361) and canine (362) islet graft recipients, and decreased  cell survival (356). Portal vein levels of tacrolimus exceed those of the peripheral circulation by three-fold, further potentiating its dose-dependent toxicity (266).  Reports are conflicting as to whether sirolimus negatively impacts  cell survival and function. Although sirolimus is not to be diabetogenic (238, 363), by some reports it may promote PTDM (353). In many animal transplant models, sirolimus had no adverse effects on cell function (171, 364-367), while other studies in normal or transplanted animals have shown sirolimus- induced hyperglycemia, impaired islet graft function and  cell apoptosis (171, 364, 368, 369). In transformed  cell lines, sirolimus promoted a concentration- and time-dependent reduction in viability, Pdx1 and GLUT expression, and GSIS and increased apoptosis (171, 172, 360, 370).  Diabetogenic effects of sirolimus on the  cell may only be evident at supra-therapeutic doses (171, 172), although human islets transplanted into the portal vein are exposed to 2-3 fold higher concentrations of sirolimus than in the peripheral circulation (171, 172, 266). Additional deleterious effects of sirolimus are anti-proliferative and anti-angiogenic. Sirolimus inhibits the proliferation-promoting effects of IGF-1 on  cells (172, 371). It also suppresses the expansion of human ductal cells at therapeutic concentrations and in pregnant mice (171). In a transgenic model of conditional  cell destruction, treatment with a combination of sirolimus and tacrolimus 30  prevented  cell regeneration (372). Sirolimus inhibits angiogenesis and VEGF-mediated revascularization (373, 374), which is critical to graft revascularization.  Mycophenylate, by most reports (358, 366, 375), has no deleterious effects on the  cell (358, 366). Mycophenylate did suppress insulin secretion in transformed cell lines and rat islets (360) and promote apoptosis in human islets (369) but had no effect upon maintenance of normoglycemia in transplanted human islets (361). As it is necessary to continue use of immunosuppressive agents in islet allograft recipients, further development of immunosuppressants with less  cell toxicity is required.  1.4.2.2 Intrinsic features of the  cell that may promote graft failure 1.4.2.2.1 Metabolic stress on the graft The transplanted  cell is typically under a high degree of metabolic stress. As described previously, a limited  cell mass engrafts, estimated to be ~30% of the  cell mass in a native pancreas. Secretory demand per  cell is high and exacerbated by factors such as recipient hyperglycemia and elevated insulin resistance in transplant recipients (376). Many factors in the transplantation environment, such as in immunosuppressive drugs, inflammation, hypoxia, and elevated free fatty acid concentration the vicinity of transplanted islets, have a detrimental effect on  cell viability and secretory function. Transplanted islets may be derived from obese donors likely to have metabolic syndrome.  The  cell’s capacity to adapt to chronic secretory stress is finite. In order to successfully adapt, the  cell must maintain homeostatic regulation of physiological endoplasmic reticulum (ER) and oxidative stress responses and its pro-hormone processing capacity. In contrast,  cell dysfunction is apparent by impaired GSIS, impaired processing of proinsulin, and amyloid deposition.  1.4.2.2.1.1 Endoplasmic reticulum stress responses in  cell physiology  cells, as professional secretory cells, have a highly developed ER (236, 377). The ER is fundamentally important in many cellular processes. It is involved in phosholipid synthesis (378), free fatty acid esterification (379), and steroid production and storage (378). The ER is an important calcium buffer and modulates cellular calcium signaling via inositol-3-phosphate and 31  ryanodine receptors (IP3R and RyR, respectively) (380). The ER is also critical for trafficking, folding and post-translational modification of proteins destined for secretion or plasma membrane insertion (381). Peptides with a signal recognition particle (SRP) are translocated into the ER as ribosomal translation occurs. Upon termination of translation, chaperone proteins including BiP (GRP78), GRP94, calnexin, and calreticulin, facilitate peptide folding (380). The  cell ER lumen has a protein concentration exceeding 100 mg/ml and processes approximately 1 million proinsulin polypeptides per minute (382). In addition to chaperone-mediated folding of insulin, the ER also promotes oxidation of its three disulfide bridges by protein disulfide isomerase (PDI) (381). Only properly folded proteins may transition along the secretory pathway. The ER routinely disposes of soluble misfolded proteins, up to 30% of newly synthesized polypeptides, by ER-associated degradation (ERAD), in which they are retro- translocated into the cytosol, ubiquitinated, and degraded by the proteasome (380, 381); insoluble aggregates of protein are disposed of by autophagy (382, 383). The  cell ER must handle continual fluctuations in protein load whilst maintaining quality control.  Demand for insulin increases in accordance with the extracellular glucose concentration. Acute exposure to high concentrations of glucose can promote a twenty-fold increase in insulin biosynthesis (384). Proinsulin represents 30-50% of the total protein in the  cell, thus such increases produce dramatic changes in ER protein content (382). At elevated glucose concentrations, the ER must rapidly increase its capacity to fold and oxidize proinsulin. A lack of equilibrium between ER protein load and folding capacity is referred to as “ER stress”, which triggers signaling pathways critical to cellular adaptation to stress (377). Transient activation of ER stress responses protects the cell from an ER protein overload by attenuating translation of most peptides including insulin, promoting ER chaperone translation, and promoting ERAD. Such transient activation may be referred to as the unfolded protein response (UPR). The ER stress response has 3 distinct pathways, each initiated by an ER transmembrane protein (PERK, IRE1, and ATF6) (380). Activation of the UPR promotes general translation attenuation, increased production of ER chaperone proteins, and ERAD (380). The UPR is a protective temporary means restoring of ER homeostasis (385) that is critical in response to constant fluxes in insulin production in the  cell.  32  1.4.2.2.1.2  Pathological ER stress and apoptosis in  cells Sustained activation of ER stress responses is not conducive to cell viability.  cells are particularly sensitive to translational attenuation (381). Prolonged activation of ER stress responses in the cell may occur due to a combination of elevated demand for insulin production and an elevated load of misfolded protein in the ER. Protein over-expression in cells of transgenic mice (30, 386, 387) triggers ER stress-induced apoptosis due to high biosynthetic load. Sustained ER protein overload of misfolded protein leads to cell dysfunction and progressive loss of  cell mass, as illustrated in MUNICH and AKITA mice (377, 380, 382, 388, 389). Metabolically stressed human  cells demonstrate markers of ER stress (91, 390) and activation of associated apoptotic signaling (30, 380, 391). Superimposing additional internal or external stressors on the  cell may exceed the capacity of the UPR to restore ER homeostasis and preserve  cell function. Internal stressors in addition to protein overload and misfolding include changes in [Ca 2+ ]ER, required to sustain chaperone function (392), and oxidative stress, such as that produced in the ER upon extensive oxidation of disulfide bridges or in the absence of sufficient reducing equivalents or antioxidants (393). ER stress-mediated apoptosis is exacerbated in rodent  cells expressing amyloidogenic isoforms of islet amyloid polypeptide (IAPP) (394, 395) and leads to reduction of  cell mass in the HIP rat (97). External stressors that promote ER stress include elevated extracellular glucose (91, 396-398), elevated free fatty acids, cytokines (399-402), nitric oxide (403), and reactive oxygen species (236, 398, 404, 405). Many of these stresses are exacerbated in the islet transplantation environment. Prolonged activation of ER stress signaling leads to activation of pro-apoptotic pathways. Prolonged ER stress responses promote CCAAT/enhancer-binding homologous protein (CHOP) (229), caspase-12 (380), and JNK activation (406, 407) in  cells.  1.4.2.2.1.3 Oxidative stress As a highly metabolically active cell, the  cell produces high levels of reactive oxygen (ROS) and nitrogen (RNS) species. ROS are primarily generated by complexes I and II of the mitochondrial respiratory chain and by NADPH oxidases (408). ROS are generated upon catalysis of the three disulfide bonds per proinsulin molecule and one disulfide bond per proIAPP molecule in the ER (409). The  cell expresses low levels of antioxidants compared to other cell types and is highly susceptible to oxidative stress (244). Oxidative stress results when a 33  cell’s antioxidant capacity is insufficient to buffer ROS. Increasing metabolic demand increases ROS generation by increased mitochondrial respiration and by increased prohormone disulfide bond catalysis. As an example of  cells under constant secretory demand, human type 2 diabetic  cells show markers of oxidative stress (90, 410, 411). Islet isolation (412) and reperfusion injury (413) upon islet revascularization introduce additional oxidative stress in islet transplantation. Oxidative stress in islet transplantation and type 2 diabetes may be alleviated by antioxidant (181, 414) or ROS scavenging (415) therapies. Prolonged oxidative stress promotes  cell apoptosis primarily mediated by CHOP and JNK signaling (416).  1.4.2.2.1.4 Oxidative and ER stress pro-apoptotic signaling ER and oxidative stress are intricately linked. Elevated production of proinsulin generates not only ER but also oxidative stress. Elevated mitochondrial metabolism generates oxidative stress by ROS production but also modulates ER stress through calcium signaling interaction with the ER. As such, the CHOP and JNK pro-apoptotic signaling pathways activated by ER stress are also activated by oxidative stress. CHOP promotes Ca 2+ -dependent apoptosis by transcriptional activation of proapoptotic genes (DR5, TRB3, BIM, Doc1, CA-VI, Doc4, Doc6), induction of ROS, repression of the anti-apoptotic factor Bcl-2, translocation of Bax to mitochondria, and depletion of glutathione (381, 382). Islets from mice lacking functional CHOP (CHOP -/- ) have decreased apoptosis and increased expression of UPR genes and CHOP deletion delays the onset and severity of the diabetic phenotype (417, 418). Additional mechanisms of apoptotic induction, both mitochondrial-dependent and ER-specific, have been attributed to particular branches of the ER stress pathway. ATF4 may also promote apoptosis by suppression of Bcl-2 (384). IRE1 recruits TRAF2 and ASK1 to promote MAPK/JNK signaling (384, 419). IRE1 also promote the clustering and activation of caspase-12 (419). Procaspase-12 is localized to ER membranes and undergoes cleavage during ER stress in murine cells (420). Active caspase-12 is thought to promote the caspase cascade by cleaving caspase-3 in mice, although its role in promoting apoptosis is controversial and the human orthologue is a pseudogene (391, 421). Pharmacologically-induced ER stress has given additional insight into mechanisms by which ER stress may promote apoptosis (420). Such agents cause mitochondrial cytochrome c release and loss of mitochondrial transmembrane potential and implicate the BH3 proteins Bax and Bak in ER stress-induced apoptosis. Finally, perturbed ER Ca 2+ homeostasis may contribute to apoptosis following induction of ER stress. ER Ca 2+ stores can both sensitize mitochondria to pro-apoptotic 34  stimuli and activate cytoplasmic cascades (420). Islets lacking the ER-stress responsive ER Ca 2+  channel Wsf1 are particularly susceptible to ER-stress-induced apoptosis (422).  1.4.2.2.1.5 Impaired prohormone processing in islet transplants Proinsulin and proIAPP are synthesized as inactive precursors that undergo proteolytic processing to generate their mature forms. Both proinsulin and proIAPP are synthesized by ribosomes on the rough ER (RER) and translocated into the ER as synthesis occurs. These proteins are then trafficked through the regulated secretory pathway. Prohormone processing occurs in the secretory granules by the prohormone convertases PC1/3 and PC2 which cleave adjacent to pairs of dibasic residues. Proinsulin is cleaved in immature secretory granules by PC1/3 between residues 32 and 33 (423). It is later cleaved in mature secretory granules by PC2 between residues 65 and 66 (424). Subsequent removal of dibasic pairs at each cleavage site by carboxypeptidase E (CPE) yields mature insulin and C-peptide (425). ProIAPP cleavage also begins in immature secretory granules by C-terminal PC1/3 cleavage (426). PC2 then cleaves the resulting N-terminally extended form at the N-terminal cleavage site and acts in mature secretory granules (427). Mature IAPP is yielded following CPE removal of dibasic residues and N- terminal amidation by peptidylglycine -amidating monooxygenase (PAM).  Prohormone processing is inefficient in the type 2 diabetic  cell (86). This impairment may result from an intrinsic  cell defect or decreased processing time when immature granules are secreted under high metabolic demand. Defects in prohormone processing are illustrated by hyperproinsulinemia and elevated ratios of secreted proinsulin:insulin and proinsulin:C-peptide in both type 2 diabetic human patients (86) and in human islet transplant recipients (316, 376).  1.4.2.2.1.6 Islet amyloid Islet amyloid refers to a localized amyloidosis specific to the pancreatic islets. Classically, islet amyloid deposits have been identified in insulinomas (428, 429) and in islets of type 2 diabetic patients (97, 430, 431). Islet amyloid is identified in histological sections by fluorescence upon thioflavin S staining or by apple green bifrefringence upon Congo red staining. Islet amyloid is composed primarily of aggregated IAPP. Additional minor components include N-terminally 35  unprocessed IAPP (432), heparan sulfate proteoglycans (433), apolipoprotein E (433), and serum amyloid P (433).  IAPP is a 37 amino acid peptide secreted from  cells in response to glucose or other secretagogues along with insulin, in a molar ratio (IAPP:insulin) of ~1:100 (433). Under normal physiological conditions, IAPP is secreted as a soluble hormone and circulates in serum at concentrations in the low picomolar range (433). IAPP has central and peripheral effects that protect against obesity and diabetes. IAPP has anorexigenic effects by stimulation of noradrenergic neurons (434) in the area postrema of the hindbrain (435) and by potentiating the anorexigenic effects of leptin in the hypothalamus (436, 437). The peripheral effect of IAPP on energy balance is to slow gastric emptying (433, 437) and thereby reduce post-prandial glucose excursions (438). A non-amyloidogenic analogue of IAPP, pramlintide, is used clinically as an adjunct therapy to improve glycemic control and promote weight loss (439). IAPP also inhibits bone resorption (440-442). IAPP may also inhibit glucagon secretion (443) and act as a vasodilator (436), although the physiological relevance of these studies is questionable due to the high concentration of IAPP used. The physiological effects of IAPP are thought to be mediated by the calcitonin receptor in combination with receptor modifying proteins (RAMP) RAMP1, RAMP2 or RAMP3 (444). In normal individuals, IAPP is a secreted peptide and does not aggregate into islet amyloid deposits (445).  Islet amyloid forms in conditions under which the  cell is under metabolic stress. Such conditions include elevated insulin resistance (446, 447), exposure to a high fat diet (448), obesity (449) , insulinoma (428, 429), and type 2 diabetes (97, 430, 431). Islet amyloid has been reported in 20-99% (97, 430, 431) of islets of type 2 diabetic patients but in only 3-11% of islets in non-diabetic controls (431). The importance of islet amyloid to type 2 diabetes is underscored by observations that the degree of islet amyloid deposition may correlate with severity of the disease in humans, with reduced  cell mass in humans and non-human primates, and with the development of hyperglycemia in transgenic rodents (98, 448, 450-452). Extensive amyloid deposition in primate islets around the time of diabetes onset provides additional support for the role of amyloid in progression of disease (453-455). A missense mutation (S20G) in human IAPP that enhances amyloidogenicity and cytotoxicity (456, 457) is associated with severe, early 36  onset type 2 diabetes (458, 459). The appearance of amyloid pathology in the islet correlates strongly with  cell dysfunction and loss.  A role for islet amyloid in  cell dysfunction is further supported by the lack of disease pathology in species expressing non-amyloidogenic forms of IAPP. Feline, primate, and human IAPP are amyloidogenic by virtue of a -sheet prone region located between amino acids 20-29 (460, 461), although other regions of the peptide potentiate amyloidogenesis (460-463). In rodents, three proline substitutions in the 20-29 region act as  sheet breakers (460, 461, 464, 465); consequently, synthetic rodent IAPP does not form fibrils in vitro, and is not toxic to cells. Porcine IAPP is also minimally fibrillogenic, which is consistent with the lack of diabetes incidence in sus scrofa (466). The conditions that predispose IAPP aggregation into islet amyloid are not fully understood. Elevated expression and secretion of IAPP are not sufficient to promote amyloid formation. As an example, mice expressing the amyloidogenic human IAPP transgene failed to develop amyloid or diabetes despite a five-fold elevation in IAPP content and IAPP serum levels above those in wild-type mice (446). Nevertheless, amyloid-prone forms of IAPP contribute to islet pathology under conditions of metabolic stress.  Islet amyloid has toxic effects on the islet. Amyloid formation in cultured human islets (2, 3, 467) and murine islets expressing the human IAPP transgene (468) correlates with selective apoptotic loss of  cells. Synthetic human IAPP induces apoptosis in transformed  cell lines (469-475). Adenovirally expressed human IAPP may induce apoptosis in transformed cell lines, depending on the level of expression (3, 476). IAPP has additionally been shown to be preferentially cytotoxic to cultured  cells relative to  cells (38). As discussed in a previous section, pre-fibrillar species of misfolded IAPP are the principal mediators of toxicity (96). These pre-fibrillar entities do not necessarily correlate with “oligomeric species” of IAPP purportedly detected by the A-11 antibody, with which we have considerable concerns (12). It should be noted that the polyclonal A-11 antibody was raised to colloidal-gold linked oligomers of a different pro-amyloidogenic protein, amyloid , and not to IAPP.  IAPP toxicity has been proposed to occur by either intracellular or extracellular mechanisms. In an intracellular model of toxicity, prefibrillar species may alter the permeability of organelle membranes to disrupt cellular calcium homeostasis and to cause mitochondrial dysfunction 37  (477). An intracellular mechanism of cytoxicity would most likely occur due to membrane permeabilization by IAPP species upon formation in the secretory granules rather than proIAPP earlier in the secretory pathway. Although lipid membranes may induce fibrillization of proIAPP (478), proIAPP species do not alter membrane permeability (479). In contrast, IAPP pre-fibrillar species induce membrane permeabilization (480, 481). An alternate mechanism of intracellular toxicity is ER stress pro-apoptotic signaling activated upon aggregation of misfolded proIAPP species in the ER (482). Islets from type 2 diabetic humans show an accumulation of polyubiquitinated proteins (483), consistent with elevated levels of proIAPP in the ERAD pathway, as well as increased CHOP immunostaining (30), consistent with ER stress-associated apoptotic signaling. Islets from the HIP rat, which expresses the human IAPP transgene in its cells, show the same phenomena (97, 483). It is possible that ER stress signaling in this model is unrelated to IAPP toxicity, as amyloid deposition in cultured human islets is not associated with ER stress (468).  Extracellular mechanisms of IAPP toxicity include IAPP-induced membrane permeabilization (480, 481), altered cation channel activity (484), or death receptor-mediated apoptosis (37). Downstream events are mediated by caspase (38, 485) and JNK activation (485) and mitochondrial dysfunction (486). Seeding of IAPP amyloid formation by membrane heparan sulfate interaction with N-terminally extended proIAPP (487) likely potentiates extracellular formation of prefibrillar IAPP species and associated toxicity. Extracellular toxicity is reproduced upon incubation of synthetic IAPP (469-475) with transformed cell lines. A strong argument may be made for extracellular toxicity, as administration of extracellular peptide inhibitors (2) of IAPP amyloid formation reduce amyloid load and promote  cell survival cultured human islets. IAPP may also promote toxicity indirectly by induction of pro- inflammatory signaling. Human IAPP potentiates  cell production and secretion of IL1- by activation of the NLRP3 inflammasome (40). IL1- signaling potentiates  cell dysfunction under conditions of metabolic stress (293, 345).  Recent evidence suggests that islet amyloid deposition contributes to pathology in transplanted islets. Amyloid deposits have been shown to develop rapidly in transplanted human islets (290, 488). A recent case report points to extensive amyloid deposition within islets in a patient with a marginally-functioning graft (489). Islet amyloid deposition correlates with loss of glycemic 38  control in transplanted murine islets expressing the human IAPP transgene (490). Islet amyloid may contribute to graft dysfunction by promotion of apoptosis, inducing  cell dysfunction independent of amyloid deposition (491), inhibition of local diffusion of nutrients and metabolites, and potentiation of inflammation. Transplanted islets, particularly under conditions of hyperglycemia, secrete disproportionate amounts of IAPP (492). Enhanced production and secretion of IAPP, however, is unlikely in itself to be sufficient to increase amyloid deposition and toxicity (446).  Factors within the transplantation environment likely act synergistically to potentiate amyloid formation and toxicity. IAPP may increase peripheral insulin resistance (493-502), shown to be elevated in islet transplant recipients (376), and its secretion may thus exacerbate  cell dysfunction. Conditions related to islet isolation and transplantation may promote islet amyloid deposition and toxicity. Collagenase digestion of islets disrupts islet vasculature and may expose basement membrane and proteoglycans, which may promote the deposition of islet amyloid. Advanced glycosylation end-product-modification of IAPP potentiates its amyloidogenicity and cytotoxicity, suggesting that prolonged hyperglycemia in type 2 diabetes or following islet transplantation may potentiate the detrimental effects of IAPP on  cell function and mass (503, 504). Inflammation triggered by islet transplantation may elevate levels of the acute phase protein serum amyloid P (505), a known component of islet amyloid, and thus promote islet amyloid deposition. Rapid amyloid deposition and associated toxicity in islet transplantation makes islet amyloid a viable therapeutic target to improve graft function and sustain graft mass in islet transplantation.  1.5 Summary  cell replacement by islet transplantation offers a potential cure for type 1 diabetes that can slow the progression of the devastating micro- and macrovascular complications of diabetes beyond that of best medical therapy. This procedure, however, is still far from ideal. Improvements in graft function and survival are essential to improve long-term transplant outcomes. Much focus on islet loss has centered around immune-mediated mechanisms of graft destruction, but accumulating evidence from animal studies and clinical islet transplantation suggests that a number of non-immune factors also likely play an important role in graft failure, for example ER stress, islet amyloid, and ischemia. Some of these stressors – notably ER stress and islet amyloid 39  – are also thought to play a role in  cell loss in type 2 diabetes. Interestingly,  cell dysfunction in transplanted islets resembles that of the type 2 diabetic islet, including impairments in first phase glucose-stimulated insulin secretion, defective proinsulin processing, and gradual decline of  function and mass. Dysfunction and death of transplanted  cells resembles closely that of type 2 diabetes, and the striking similarities between the type 2 diabetic islet and the transplanted islet may have implications for therapy for islet transplant recipients and for tracking graft function.  1.6 Thesis hypothesis and objectives There are many similarities between  cell dysfunction in type 2 diabetes and in islet transplantation, particularly in terms of islet amyloid pathology and metabolic dysfunction. In light of this, the overall hypothesis of this thesis is that islet amyloid and CHOP, a pro-apoptotic pathway activated by ER and oxidative stress in  cell dysfunction, are important non-immune modulators of graft dysfunction and therapeutic targets in islet transplantation. To address this hypothesis, the following objectives were pursued.  Objective 1: To determine the role of human islet amyloid polypeptide in islet graft failure.  Aim 1: To determine whether islet amyloid is a significant contributor to graft failure. Specific Aim 1.1.1: To determine whether transplantation of a marginal islet mass promotes amyloid formation; Specific Aim 1.1.2: To determine whether amyloid load is elevated in human islet transplants that have failed as compared to those which have maintained normoglycemia; Specific Aim 1.1.3: To determine whether the presence of islet amyloid in donor islets can predict graft outcome.  Aim 2: To determine whether compounds present during and following islet transplantation promote amyloid aggregation and contribute to graft failure. Specific Aim 1.2.1: To determine whether heparin can accelerate graft failure by promoting amyloid deposition. 40   Aim 3: To determine whether knockdown of IAPP by RNAi and/or inhibition of amyloid formation by small molecule inhibitors protects against graft failure. Specific Aim 1.3.1: To determine whether knockdown of IAPP by RNA silencing protects against amyloid formation and improves graft function and survival; Specific Aim 1.3.2: To determine whether peptide fragments derived from human IAPP and shown to inhibit IAPP aggregation in vitro reduce amyloid formation and associated toxicity.  Objective 2: To determine whether xenotransplantation of islets expressing non- fibrillogenic forms of IAPP improves transplantation outcomes. Specific Aim 2.1: To determine whether pig IAPP is fibrillogenic and cytotoxic; Specific Aim 2.2: To determine whether pig islets form islet amyloid following transplantation.  Objective 3: To determine whether CHOP negatively impacts graft function and survival, and whether suppression of CHOP expression improves islet transplant outcomes. Specific Aim 3.1: To determine whether CHOP immunoreactivity is elevated in marginal mass grafts; Specific Aim 3.2: To determine whether CHOP -/-  islets have improved function and survival in marginal mass islet transplantation; Specific Aim 3.3: To determine whether suppression of CHOP expression in islets by RNAi improves islet transplant outcomes.           41  Chapter 2. Methods and materials  2.1 Materials Clinical grade heparin (10,000 IU/ml) was obtained from the Ike Barber Human Islet Transplant Laboratory or the British Columbia Children’s Hospital Pharmacy. INS-1 (832/13) cells, a transformed rat ß-cell line,  were a gift of Dr. C. Newgard (Duke University  Medical Center, Durham, NC). SiRNA-containing liposomes were prepared by our collaborators, Drs. C. Tam and P. Cullis (University of British Columbia). Histological sections from human pancreas and islets for allograft and autograft donors were received from Dr. G. Korbutt (University of Alberta) and Dr. H. Rilo (University of Cincinnati), respectively.  Histological sections from neonatal porcine islet transplants were obtained from Dr. G. Korbutt (University of Alberta). Histological sections of native adult porcine pancreas and of engrafted porcine islets were obtained from Dr. M. Trucco (University of Pittsburgh).  2.2 Preparation of peptide stock Rat and human IAPP were obtained from Bachem (Torrance, CA). Porcine IAPP and additional human IAPP were also synthesized in the laboratory of Dr. D. Raleigh (State University of New York, Stony Brook, NY). Prior to use, IAPP was solubilized in 1,1,1,3,3,3-Hexafluoro-2- propanol (HFIP) and incubated for one hour at room temperature. Solubilized IAPP (1 mg/ml) was divided into 0.1 ml aliquots, which were frozen for 1 hour at -20 o C and subsequently kept at -80 o C overnight. Aliquots were lyophilized for 2.5 hours. Following lyophilization, aliquots were kept in a desiccator at -20 o C.  2.3 Fluorometry The kinetics of IAPP aggregation into amyloid fibrils were measured by thioflavin T fluorescence using the assay described by Park and Verchere (487) and adapted from Naiki et al (506) and Kudva et al (507). Lyophilized peptide was added to wells containing 10 μM thioflavin T (Sigma-Aldrich, Oakville, ON) in cell media (described in the following section) or 10 mM Tris-HCl, pH 7.4, 100 mM NaCl, and 0.1% Triton X-100. The plate was sealed with Parafilm® and fluorescence measured at 37 °C using a Fluoroskan (Labsystems, Vista, CA) fluorometer with filters set at 444 (excitation) and 485 (emission) nm and bandwidth slits of 12 and 14 nm, respectively. Upon binding to amyloid fibrils, thioflavin T fluoresces with excitation 42  and emission maxima of 450 and 482 nm. Measurements were taken every minute in the first 2 hours and every 1-10 minutes thereafter. Duplicate measurements were taken for each condition. Each experiment was repeated on a minimum of 3 occasions.  2.4 Circular dichroism Circular dichroism studies presented in this thesis were performed in the laboratory of Dr. D. Raleigh according to published techniques (466).  2.5 Transmission electron microscopy Transmission Electron Microscopy studies were performed in the laboratories of Dr. D. Raleigh (466) and Dr. P. Fraser (508) according to their published techniques. Aliquots (4 µl) were removed from solutions containing aggregating peptide, placed on a carbon-coated 200-mesh copper grid or pioloform and carbon coated grid and incubated at room temperature.  Excess solution was removed by blotting with filter paper. Grids were negatively stained with saturated uranyl acetate.  2.6 Cell culture INS-1 cells were grown in Roswell Park Memorial (RPMI) 1640 (Gibco-BRL, Burlington, ON) supplemented with 10% fetal bovine serum (FBS), 11 mM glucose, 10 mM Hepes, 2 mM L- glutamine, 1 mM sodium pyruvate, 50 M -mercaptoethanol, 100 U/ml penicillin (Gibco- BRL), and 100 U/ml streptomycin (Gibco-BRL). Cells were maintained at 37 o C in a humidified environment supplemented with 5% CO2. Cells were grown for two passages prior to use and used in assays between passages 59 and 65.  For toxicity experiments, cells were seeded at a density of 60,000 cells per well in 96-well plates and cultured for 24 hours prior to addition of peptide. Lyophilized rodent, porcine and human IAPP were solubilized in RPMI culture media and added directly to cells. After 24 hours, alamarBlue® (Biosource International, CA) was diluted ten-fold in culture media and cells were incubated for 3 hours at 37 o C. Fluorescence (excitation 530; emission 590 nm) was measured by a  Fluoroskan Ascent plate reader (Thermo Labsystems, Helsinki,  Finland).  43  For transferase-mediated dUTP nick-end labeling (TUNEL assays), INS-1 cells were seeded at a density of 100,000 cells per well in 8-well chamber slides and cultured for 48 hours prior to addition of peptide. Porcine and human IAPP were solubilized in RPMI culture media and added directly to cells. After 14 hours, cells were fixed in 4% paraformaldehyde  (20 min), permeabilized with 0.5% Triton X-100 in PBS, and incubated  with TUNEL reaction  mixture (Roche Diagnostics, Laval, QC, Canada) for 1 hour at 37 °C. Cells were co-stained with Hoechst-33342 for 10 minutes. Images were taken using an Olympus BX-61 fluorescent microscope. Image quantification was performed using Image Pro 6.2 (Media Cybernetics, Bethesda, MD). IAPP was tested at concentrations between 20 and 200 M. Experiments were performed in triplicate.  For western blot analysis, INS-1 cells were plated at 350,000 cells/well in 12-well plates and grown until 50% confluency. Cells were incubated with fresh media containing dimethyl sulfoxide (DMSO) or thapsigargin (Sigma-Aldrich, Oakville, ON) stock in DMSO for 12 or 24 hours. Maximum DMSO concentration was 0.1% vol. Cells were lifted from 12-well plates using 0.25% trypsin. Cells were centrifuged for 2 min at 1200 rpm and washed twice with phosphate- buffered saline. Lysis solution of 25 µL PMSF (Sigma-Aldrich), 25 µL aprotinin (Sigma- Aldrich), 3.3 µL pepstatin (Sigma-Aldrich), 100 µL leupeptin (Sigma-Aldrich), and 846.7 µL NP40 (Roche, Mississauga, ON) was added in a volume double that of the cell pellet. Cells were kept on ice and vortexed for 10 sec every 5 min for 25 min. Cells were spun at 12,000 rpm at 4°C for 5 min and supernatant was collected. Cell lysate protein concentration was determined using BCA protein assay (Thermo Scientific, Nepean, ON). Ten millitres of lysate diluted in H2O was incubated at 37°C with 200 L assay buffer for 30 min. Absorbance (560 nm) was measured using a Multiskan plate reader (Thermo Labsystems, Nepean ON).  2.7 Animals Animals used in these studies included FVB/N-Tg(Ins2-IAPP)RHFSoel/J (hereafter called hIAPP Tg/0  mice), FVB/NJ (hereafter called hIAPP 0/0  mice), B6.129S-Ddit3 tm1Dron /J (hereafter called CHOP -/-  mice), NOD.CB17-Prkdc scid /J (hereafter called NOD.scid mice), and wild-type C57BL/6 mice (hereafter called Bl/6 mice), each of which were originally obtained from the Jackson Laboratories (Bar Harbour, Maine) and bred in-house in the Child and Family Research Institute (CFRI) Animal Care Facility. All animal experiments were approved by the Animal 44  Care Committee of the University of British Columbia in compliance with Canadian Council on Animal Care (CCAC) guidelines and were performed at CFRI.  Genotyping of hIAPP Tg/0  mice was performed using genomic DNA obtained by an ear punch sample taken from weaned mice (4-6 weeks of age). Ear punches were digested with Proteinase K (20 mg/ml; Gibco, Invitrogen Canada, Burlington, ON) in SET buffer (20 mM Tris, 5 mM EDTA, 1% SDS) at 37 o C while shaking at 1300 rpm. DNA was precipitated using 4.9 M NaCl/245 mM KCL and ice cold 95% ethanol, followed by resuspension in sterile ddH2O. Polymerase chain reaction (PCR) primer sequences and thermocycler programs for hIAPP Tg/0  mice were obtained from the Jackson Laboratory. Gene targets were amplified by PCR at 94 o C for 3 minutes, 35 cycles at 94 o C for 30 seconds, primer annealing temperature for 1 minute and 72 o C for 1 minute, followed by 72 o C for 2 minutes. PCR products were separated by gel electrophoresis on a 1.5% agarose gel (Ultrapure, Gibco) with ethidium bromide (0.5 g/ml, Sigma-Aldrich, St Louis MO).  2.8 Islet isolation 2.8.1 Human islet isolation Human islets were isolated at the Ike Barber Human Islet Transplant Laboratory at Vancouver General Hospital (509) or the University of Illinois Chicago (UIC) Medical Centre. Upon receipt, islets were filtered to remove large tissue fragments. Filtered islets were further purified by hand-picking under a light microscope. An additional light source was used to enhance the pink tint of islets to aid with purification. Islets were maintained in CMRL (Mediatech, Manassas, VA) supplemented with penicillin (50 U/ml), streptomycin (50 U/ml), gentamycin (50 g/ml), Glutamax® (2 mM), and additional glucose as required by experimental design. Islets were cultured at 37 o C for up to three weeks in a humid atmosphere of 95% air 5% CO2. Islets that were not to be used immediately were maintained in culture at 22 o C until required for transplantation.  2.8.2  Murine islet isolation Mice were anesthetized by intraperitoneal injection of Avertin (0.02 ml/g body weight). Pancreata were harvested and retrogradely perfused via the pancreatic duct using collagenase (1000 units/ml, type IX, Sigma) dissolved in Hank’s Balanced Salt Solution (HBSS; Cat. 14185, 45  Gibco). Pancreata were digested with collagenase for up to 14 minutes at 37 o C followed by 1 minute of vigorous hand-shaking at room temperature. Islets were purified by filtration using 70 m nylon cell strainers (BD Biosciences, Mississauga ON). Following filtration, islets were maintained overnight in Ham’s F-10 medium (Gibco) at 37oC in a 5% CO2 incubator.  2.9 Islet culture 2.9.1 Human islet culture Human islets were cultured at 37 o C for up to 3 weeks in CMRL supplemented with penicillin (100 U/ml), streptomycin (100 U/ml), gentamycin (50 μg/ml), Glutamax® (2 mM), and additional glucose as required by experimental design. Islet media was replaced every 2-3 days. Following culture, islets were washed and frozen at -80 o C for later protein studies or fixed in formalin, preserved in agar, and processed in paraffin for immunohistochemistry.  2.9.2 Murine islet culture Murine islets were cultured at 37 o C for up to 1 week in RPMI media supplemented with penicillin (100 U/ml), streptomycin (100 U/ml), Glutamax® (2 mM), and additional glucose as required by experimental design. Following culture, islets were washed and frozen at -80 o C for later protein studies or fixed as for human islets.  2.10 In vitro glucose-stimulated insulin secretion Isolated murine islets (minimum of 20 per well) were plated in sets of 6 wells per condition in a 96 well plate. Three wells per condition were allocated to low (1.67 mM) glucose incubation and three to high (16.7 mM) glucose stimulation. All wells were pre-incubated in Krebs-Ringer bicarbonate buffer (KRB) supplemented with 10 mM HEPES (pH 7.4), 0.25% BSA and 1.67 mM glucose for two hours at 37 o C. Subsequently, wells were incubated in fresh 1.67 or 16.7 mM glucose KRB for 1 hour at 37 o C. Media and islets were collected from each well to measure secreted insulin and islet insulin content, respectively.  2.11 Islet transplantation Recipients of islet transplants were rendered diabetic with a single intraperitoneal injection of streptozotocin (STZ; Sigma-Aldrich) four days prior to transplantation surgery. STZ dose varied according to murine strain from 200 to 250 mg/kg. Blood glucose was checked between 9 am 46  and noon on the 2 days prior to surgery. Mice were used as recipients if they had 2 consecutive glucose readings greater than 20 mM. On the day of transplantation, mice were anesthetized using isoflurane. Human or murine islet grafts were transplanted into the subcapsular space of the left kidney. Following transplantation, glycemia was monitored daily for the first week, following which it was monitored 1-2 times per week. Random blood glucose measurements were taken from the tail vein between 10 am and 12 pm using a OneTouch® Ultra Glucometer (LifeScan).  2.12 Intraperitoneal glucose tolerance tests Mice were fasted for four hours prior to intraperitoneal glucose tolerance test (IPGTT). A 50% solution of dextrose was delivered by intraperitoneal (ip) injection (1.5 mg/g of body weight). Blood glucose was taken from the tail vein at 0, 15, 30, 60 and 120 min post-injection. Blood was also collected from the saphenous vein at 0 hours in EDTA-coated microvette tubes (Sarstedt Inc, Montreal QC). Plasma was extracted by centrifugation. Insulin was measured using a mouse insulin ELISA (Mercodia, Burlington, ON) according to the manufacturer’s instructions. Incubation consisted of 2 hours at 600 rpm and fluorescence measured at 450 nm using a Multiskan plate-reader.  2.13 Immunohistochemistry and other histological staining Specimens for immunohistochemistry were fixed in formalin and processed for histology. Paraffin-embedded sections (5 m) were mounted on glass slides and de-paraffinized by consecutive incubation in xylene, 95% ethanol, 70% ethanol, and distilled water. Sections were blocked in phosphate-buffered saline (PBS) containing 2% normal goat serum (Vector Laboratories). Primary antibodies were prepared in PBS containing 1% BSA. Primary antibodies, dilutions, and incubation conditions are listed in Table 1. Various secondary Alexa- 488 and Alexa-594 fluorescently-labeled antibodies (Invitrogen) were used at a dilution of 1:100. Secondary antibodies were incubated for 1 hour at room temperature. Appropriate negative controls were performed and antibody specificity confirmed by the manufacturers.  TUNEL staining was performed using In Situ Cell Death Detection kit, TMR red (Roche 12156792910). Sections for TUNEL staining were treated for antigen retrieval by microwaving for 5 minutes at 40% power in 0.1 M citrate buffer. Sections were incubated for 60 min at 37º C 47  with a 1:10 solution of TUNEL enzyme:substrate. Thioflavin S staining was used to stain for amyloid. TissueTrol® amyloid sections (Sigma) were included as a positive control for thioflavin S staining. For thioflavin S staining, following secondary antibody incubation, slides were immersed in 0.5% thioflavin S solution for 2 minutes, rinsed in 70% ethanol and water, and wet-mounted using Vectashield mounting media (Vector Laboratories). Images were captured using an Olympus Bx61 fluorescent microscope and analyzed using Image Pro 6.2 software (Media Cybernetics Inc).  Table 1. List of primary antibodies. Primary or Secondary Antibody Target Manufacturer Antibody Characteristics Dilution Antigen retrieval Incubation Primary  Insulin Dako (A0564) Polyclonal guinea pig-derived antibody 1:100 None 1 hour at 22 o C Primary Glucagon Dako (A0565) Polyclonal rabbit- derived antibody 1:75 None 1 hour at 22 o C Primary Ki-67 Vector (VP-K451) Polyclonal rabbit- derived antibody 1:100 10 mM citrate Overnight at 4 o C Primary Cleaved caspase-3 Cell Signalling (9661) Polyclonal rabbit- derived antibody 1:40 10 mM citrate Overnight at 4 o C Primary CHOP Santa Cruz (Sc-7351) Monoclonal mouse-derived antibody 1:100 10 mM citrate 1 hour at 22 o C  2.14 Porcine IAPP sequencing Primers (Invitrogen, Burlington, ON) were designed according to EST sequence (Q29119) from porcine hypothalamus homologous to the predicted sequence for mature (1-37) porcine IAPP. The primer sequences used were: Forward, CTGAATTTCCAAAGGATTGTACTGGGAA, ACCAAAACACTGGGTTACTGATAGGAAGA; Reverse, GTGCGTTGACCTCTAAAGGGGTAAGTA, CTGGCAGCAAACATGGGACACA. RNA was isolated from neonatal porcine islets. Reverse transcription was performed using SuperScript First-Strand (Invitrogen). PCR was performed using Accuprime TaqDNA Polymerase High Fidelity (Invitrogen).  48  2.15 Insoluble IAPP/protein assay Cultured human islets were lysed with 100 l NP40 lysis buffer containing the previously mentioned protease inhibitors. Cells were kept on ice and vortexed for 10 sec every 5 min for 25 min. The lysate was ultracentrifuged at 60,000 rpm at 4 o C for 1 hour using a Beckman ultracentrifuge with a Beckman TLA-100·3 rotor (Beckman Instruments, Gagny, France). The soluble fraction was separated from the insoluble fraction and stored at -80 o C. The pellet was solubilized in 0.1 ml 70% formic acid, sonicated until the solution was clear, and vortexed for 1 minute. The fraction was neutralized using 1.9 ml of 1M Tris and diluted 1:3 in filtered distilled water. Total protein (soluble plus insoluble fractions) was determined using the BCA assay (described above). IAPP content in the insoluble fraction was determined using the Total Amylin ELISA (Millipore, Billerica, MA).  2.16 IAPP western blotting Lysates were electrophoresed on a polyacrylamide gel using Tris-tricine buffer for separation of small proteins and transferred to 0.45-μm polyvinylidene fluoride (PVDF) membranes (15 V, 20 min) using a Bio-Rad semidry electrophoretic transfer cell (Trans-Blot SD). The membranes were blocked with 5% skim milk for 1 hour at room temperature and washed and incubated for 1 hour with a 1:1000 dilution of primary anti-IAPP (7323 or 4145) at 1:1,000 room temperature, followed by 1 hour incubation with horseradish peroxidase-conjugated anti-rabbit IgG (Amersham) diluted 1:5,000 at room temperature. Immunodetection was performed using an enhanced chemiluminescence detection kit (Amersham).  2.17 CHOP western blotting Gels were made using 1.0 mm spaced plates with 10 wells/gel. Forty micrograms of protein were loaded into each well and run at 70 V for 15 min and 110 V for 60-120 min depending on the position of the leading band. Proteins were wet transferred onto PVDF membrane using 110 V for 60 min. Membranes were blocked using 2.5% skim milk in tris-buffered saline containing 0.1% Tween-20. CHOP antibody (Santa Cruz 7351), cleaved caspase-3 (Cell signaling D-175), and β-actin (Sigma 9E10) antibodies were diluted 1:200, 1:1000 and 1:1000, respectively. Secondary antibodies containing horseradish peroxidase were diluted 1:1000 for all. Immunodetection was performed using an Amersham ECL Plus™ Western Blotting Detection Reagents enhanced chemiluminescence detection kit (GE Healthcare). 49   2.18 Data and statistical analysis Data are presented as mean ± standard error of the mean (SEM). Statistical significance was determined using Student’s t-test or analysis of variance (ANOVA) and Neuman-Keuls post-hoc test, where appropriate. P < 0.05 was considered statistically significant. Data analysis was performed using Prism v 4.0 (GraphPad Software Inc, La Jolla CA).                                         50  Chapter 3. Role of islet amyloid in islet transplant dysfunction  3.1. Introduction The long-term success of human islet transplantation is limited. Seventy-five percent of patients who initially achieve insulin independence require insulin within 2 years post-transplant (129). Although allo- (159, 163, 175, 193, 348, 510-515) and auto-immune (175, 512, 513, 516-518) mediated destruction of  cells is a major contributor to  cell loss in islet transplants, evidence from clinical data suggests that non-immune factors also contribute to long-term graft failure. Two key observations lead us to this hypothesis. First, long-term graft failure occurs in human islet autograft recipients. An autograft is one in which one’s own islets are re-implanted following pancreatectomy and islet isolation. Autograft recipients do not require immunosuppression, as the graft is not subject to alloimmune rejection. This patient population, primarily composed of patients with chronic pancreatitis (519) and patients undergoing pancreas resection for tumour removal (520), does not typically include individuals with type 1 diabetes (519) nor do patients have serum autoantibodies against  cell epitopes (521, 522). Human and primate autografts display progressive graft dysfunction (205, 207, 208, 210-212, 348), albeit at a slower rate than human allografts, in the absence of allo- or auto-immune mediated graft destruction. The second critical observation is that the rate of decline in serum C-peptide levels was a fraction of the rate of loss of insulin independence in the International Trial of the Edmonton Protocol (129). It seems unlikely that the slow rate of decline in C-peptide would reflect rapid immune-mediated clearance of  cells. In human islet transplant recipients, rapid elevation in serum numbers of cytotoxic T lymphocyte precursors by 12 weeks following transplantation was associated with extremely low levels of C-peptide 14 weeks later (511). In islet allograft recipients with auto-antibodies present prior to transplant, C-peptide levels were significantly reduced in the first 6 weeks following transplantation (176). Rather, the gradual loss of the ability of the transplanted  cell to maintain glycemic control suggests a progressive impairment in insulin production, reminiscent of that seen in type 2 diabetes.  The available evidence is not persuasive for a critical role of immune-mediated destruction in progressive graft dysfunction. Autoimmunity is an unlikely cause. Development of islet auto- antibodies following transplantation is associated with detrimental graft outcomes (176). In the International Trial of the Edmonton Protocol, 82% of islet transplant recipients were auto- antibody negative at 1 year post-transplantation, at which point 40% of recipients had lost insulin 51  independence (129). It is conceivable that autoimmune attack in chronic islet rejection is a T-cell mediated process and thus does not correlate with serum levels of auto-antibodies (511, 523). This possibility, however, is inconsistent with observations from human and islet recipient autopsy data. In autopsies of 3 failing human islet grafts (205), there was an absence of inflammatory markers and a lack of immune cell infiltration in transplanted islets. A similar finding was reported for slowly progressive dysfunction of cynomolgus macaque islet allografts that were adequately immunosuppressed (207); these grafts did not demonstrate islet invasive lymphocytic infiltration characteristic of islet allograft rejection. Moreover, optimally immunosuppressed allografts failed at a similar rate to autografts performed in the same study (207). Taken together, these findings make a strong case for the involvement of non-immune factors in long-term graft dysfunction.  It is now well-recognized that defects in  cell function and mass are critical contributors to the pathogenesis of type 2 diabetes. The  cell in type 2 diabetes is characterized by multiple defects in insulin secretion and gradual cell loss by apoptosis. Defective first-phase glucose-stimulated insulin secretion is detectable in patients with impaired fasting glucose or impaired glucose tolerance (80) and is nearly absent at onset of type 2 diabetes (524, 525).  cell function progressively declines, illustrated by a gradual loss in glucose-stimulated insulin secretion and reduced insulin secretion in response to non-glucose secretagogues such as arginine (81, 87). Insulin secretory patterns are also abnormal (526, 527). In type 2 diabetic patients, both diurnal and ultradian oscillations in serum insulin concentration are decreased early in the disease process due to impaired pulsatile insulin release (84, 85, 528). Finally, proinsulin processing is also known to be impaired in type 2 diabetes. Basal and stimulated proinsulin levels and the proinsulin:insulin ratio are significantly elevated in type 2 diabetic patients (86).  In addition to progressive loss of  cell function,  cell mass is also lost over the course of the disease.  In autopsy studies, type 2 diabetic patients have greatly reduced  cell mass compared to controls matched for the degree of obesity (73, 529). Prior to the onset of diabetes, fractional cell volume is reduced by approximately half in individuals with impaired fasting glucose (529). Loss of  cell mass in type 2 diabetes is associated with increased  cell apoptosis, rather than decreased replication or neogenesis (529). Causes of  cell death in type 2 diabetes include 52  glucolipotoxicity (300, 526, 530-533), ER stress (390, 534, 535), oxidative stress (90, 536-538), local islet inflammation (293, 345), and islet amyloid species (433, 477).  Many features of the transplanted cell are reminiscent of those seen in type 2 diabetes. Like type 2 diabetic patients, islet transplant recipients demonstrate impaired first phase glucose- stimulated insulin secretion (357, 539) and reduced maximal secretory capacity (539, 540). Furthermore, these impairments are progressive in nature (540).  Similar findings have been reported in syngeneic murine islet transplants (541, 542). Impaired proinsulin processing in islet transplant recipients (316, 376, 543), demonstrated by an elevated proinsulin:C-peptide ratio, provides further evidence of  cell dysfunction in transplantation. This ratio is a surrogate measure of the proinsulin:insulin ratio used for type 2 diabetes. In islet transplant recipients, C- peptide is used as the denominator so that the ratio is not influenced by exogenous insulin, which many patients require. Impaired proinsulin processing in islet transplants may be associated with decreased graft PC2 immunostaining (543), suggestive of an intrinsic  cell processing defect.  Reduced  cell mass relative to normal individuals is another common feature between type 2 diabetes and islet transplants. In humans, an adequate graft mass in islet allotransplantation is considered to be above 10,000 IE/kg (316), although islet recovery from a single pancreas donor is commonly insufficient to provide recipients with this amount of islets. Patients who receive less than 10,000 IE/kg have greater impairment in  cell function than those that receive greater than 10,000 IE/kg (316). Transplantation of a marginal mass of islets in animals models predisposes recipients to defective glucose-stimulated insulin secretion and poor glycemic control (326, 331, 544). MRI imaging of autologous islet transplantation into baboon liver (545) and human islets into the liver of immunodeficient mice (546) shows a progressive decrease in transplanted islet mass over several weeks following transplantation. Consistent with this decrease in mass, apoptotic cells but no replicating cells were detected in marginal mass human islet grafts in immune-deficient, diabetic mice (543).  Thus, islet transplant recipients tend to receive an inadequate islet mass that continues to decline following transplantation.  Islet amyloid is a pathology common between transplanted and type 2 diabetic islets, which causes significant  cell dysfunction, apoptosis, and loss of islet mass. Indeed, in the marginal mass graft studies described in the previous paragraph, the authors also detected intra- and 53  extracellular amyloid associated with “pre-apoptotic”  cells within the graft (543). Westermark and colleagues first described amyloid deposition in human islets within 2 weeks after transplantation into diabetic, immune-deficient mice (290, 488). This same group followed up this observation with a case report in which they identified extensive amyloid deposition within transplanted human islets of a patient with a marginally-functioning graft (489). Transplantation of murine islets with  cell expression of a human IAPP transgene (Tg-hIAPP) provides additional support for the detrimental effect of islet amyloid on graft function. Transplanted Tg- hIAPP islets initially restore glycemic control following transplantation but develop modest hyperglycemia by two weeks post-transplantation, while wild-type grafts maintain normoglycemia (490). Islets expressing non-amyloidogenic forms of IAPP do not develop amyloid deposits following transplantation and consistently maintain long-term glycemic control (208, 466). Islet amyloid deposition and its associated toxicity is common to both type 2 diabetes and islet transplantation, although deposition and toxicity are accelerated in transplantation. In this Chapter, we investigated factors underlying amyloid formation and toxicity in transplanted human and Tg-hIAPP murine islets. Furthermore, we evaluated several strategies to prevent amyloid formation, with the ultimate goal of a translatable therapeutic strategy.  Finally, we evaluated whether islet amyloid load or prevalence within histological sections of donor pancreas or isolated islets might have predictive value in human autograft and allograft function.  3.2 Methods 3.2.1 Islet transplantation Please refer to Chapter 2 for a description of human and murine islet transplantation into streptozotocin (STZ)-diabetic, immune deficient mice.  3.2.2 Islet allograft cohort In collaboration with Dr. G. Korbutt (University of Alberta), we obtained histological sections of pancreas fixed prior to islet isolation for subsequent islet allotransplantation. We received histological sections from a total of 19 islet allograft donors that were used for islet transplantation into 11 recipients. It should be noted that all of the 11 allograft islet recipients received at least 2 and as many as 4 islet infusions. We did not obtain any information pertaining to donor characteristics, such as age, BMI, or gender. Recipient graft function was assessed by the area under the insulin response curve in response to an intravenous glucose challenge 54  (AIRglu). We received the most recently available AIRglu data for 91% (10 out of 11) allograft recipients. Additionally, we were informed as to whether patients had maintained graft function since the last islet infusion or if their grafts were dysfunctional such that they once again required insulin therapy.  3.2.3 Islet autograft cohort In collaboration with Dr. H. Rilo, formerly of the University of Cincinnati, we obtained histological sections of pancreas and isolated islets from a cohort of patients on which islet autografts were performed following total pancreatectomy. We received materials from 21 separate islet autograft procedures, all of which were retrieved at the time of islet isolation. For 52% of the cohort, we received both pancreas and isolated islets. For the remainder of the cohort, we received isolated islets for 33% of the donors and pancreas specimens only for the remaining 14%. In terms of clinical information, we did not obtain any information pertaining to donor characteristics, such as age and gender, underlying health conditions, or reason for undergoing islet auto-transplantation. In terms of measurements of graft function, we were only provided HbA1c at 1 year following transplantation. In spite of these limitations, we characterized analysis of islet amyloid load and prevalence in this cohort and attempted to correlate the limited clinical data with our findings.  3.2.4 Quantification of islet amyloid load and prevalence in donor islets Donor islets and pancreatic sections were stained for amyloid by thioflavin S as described in Chapter 2. We quantified amyloid load and prevalence as defined by Hull et al (547). Islet amyloid severity is defined as the proportion of total islet area occupied by thioflavin S-positive staining. Islet amyloid prevalence is defined as the proportion of islets that had detectable amyloid.  3.3 Results 3.3.1 Expression of human IAPP in transplanted islets promotes  cell dysfunction To determine the effect of human IAPP expression on function of an optimal mass islet transplant, we transplanted 250 islets from mice with  cell-specific expression of the human IAPP transgene (hIAPP Tg/0 ) or their wild-type littermate controls into STZ-diabetic immune- deficient (NOD.scid) recipients. Blood glucose was monitored weekly (Figure 1A). There was 55  no significant difference in blood glucose between hIAPP Tg/0  and wild-type mice as determined by repeated measures two-way ANOVA (p = ns). We compared glucose tolerance and proinsulin processing between the genotypes to determine whether human IAPP expression had an effect upon  cell function. To assess glucose homeostasis, we performed i.p. glucose tolerance tests on graft recipients at 1 and 3 months post-transplantation. At 1 month post-transplantation, hIAPP Tg/0  graft recipients had blood glucose values significantly greater than recipients of wild- type grafts at 60 and 120 minutes following i.p. glucose injection (p < 0.05; Figure 1B). The area under the curve was significantly elevated in hIAPP Tg/0 graft recipients (1854 ± 168 versus 2398 ± 188 mM/min, p < 0.05). At 3 months post-transplantation, transgenic grafts had significantly elevated glucose at 60 minutes following i.p. glucose injection (p < 0.05, Figure 1C). The area under the curve remained significantly elevated between the genotypes (1108 ± 52 versus 1714 ± 287, p < 0.05) but was not increased for either group as compared to 1 month post-transplant.  Proinsulin processing efficiency, assessed by the proinsulin to insulin ratio (PI/PI+I), may be used as a marker of cell function (86, 316). To assess PI/PI+I, fasting serum was collected from wild-type (n=7) and hIAPP Tg/0  (n=9) graft recipients at 6 weeks following transplantation. Recipients of hIAPP Tg/0  islets tended to have less insulin (91.8 ± 7.9 versus 141.1 ± 26.3 pM, p = 0.07; Figure 1D) but similar amounts of proinsulin (4.0 ± 0.3 versus 4.2 ± 0.8 pM, p = ns; Figure 1E). The PI/PI+I was significantly higher in hIAPP Tg/0  graft recipients (4.3 ± 0.4 versus 2.8 ± 0.3%, p < 0.05; Figure 1F). Taken together, these data demonstrate that glucose tolerance and proinsulin processing are impaired in recipients of hIAPP Tg/0  grafts.  We performed histological analysis of amyloid load in optimal mass islet grafts by thioflavin S staining. Representative images are shown in Figure 2. As expected, no amyloid was detected in grafts of wild-type islets. Grafts from hIAPP Tg/0  donors had variable amyloid histology, with 69% (9 of 13) of recipients having detectable amyloid. Thirty eight percent of grafts had greater than 0.1% of graft area occupied by amyloid, while a single graft had greater than 1% of graft area occupied by amyloid. The mean proportion of the graft occupied by amyloid was 0.22 ± 0.12% (Figure 2E). 56   Figure 1. Optimal mass grafts of islets expressing human IAPP restore glycemic control but have impairments in glucose tolerance and proinsulin processing. STZ-diabetic NOD.scid mice were transplanted with 250 wild-type (n=13) or hIAPP Tg/0 (n=14) islets. Non-fasted blood glucose (A) was measured daily for the first week, three times in the second week, and weekly thereafter for three months following transplantation. Recipients of hIAPP Tg/0  (n= 12) grafts have significantly impaired glucose tolerance compared to recipients of wild-type grafts (n=10) at 1 month following transplantation (B). A similar trend was observed (hIAPP Tg/0 , n= 4; wild-type, n = 8) at 3 months following transplantation (C).  Plasma was collected at 6 weeks post-transplantation for analysis of insulin (D), proinsulin (E), and the proinsulin/insulin ratio (F). Data are expressed as mean ± SEM. Differences between groups were assessed by repeated measures two-way ANOVA for (A) and Student’s t-test for all other results. p < 0.05  (*) was considered significant.  ip, intraperitoneal; STZ, streptozotocin; TX, transplantation. 57     Figure 2. Optimal mass grafts of islets expressing human IAPP develop islet amyloid. Histological analysis was performed on optimal mass wild-type (n = 11) and hIAPP Tg/0 (n = 12) grafts removed by survival nephrectomy at 3 months following transplantation. Representative images following insulin (red) and thioflavin S (ThioS; blue) staining are shown for wild-type (A, C) and hIAPP Tg/0  grafts in (B, D). Amyloid was only detected in hIAPP Tg/0  grafts (E). Differences between groups were assessed by Student’s t-test. p < 0.05  (*) was considered significant. Size bar = 100 m.          58  3.3.2 Deposition of amyloid within transplanted marginal mass grafts of hIAPP Tg/0  islets is associated with graft failure To determine the effect of human IAPP expression on function of an islet graft mass under greater metabolic demand, we transplanted 150 (rather than 250) islets from transgenic hIAPP Tg/0  mice or their wild-type littermate controls into STZ-diabetic NOD.scid recipients. Maintenance of glycemic control varied amongst graft recipients (Figure 3A). Three of thirteen hIAPP Tg/0  grafts (23%) failed between days 6 and 12 following achievement of glycemic control. All remaining hIAPP Tg/0 grafts and all wild-type grafts maintained glycemic control, although three of the hIAPP Tg/0 grafts tended to have glycemic values at the upper limits of normal. Blood glucose in marginal wild-type and hIAPP Tg/0  grafts was 7.8 ± 0.5 mM and 9.4 ± 0.7 mM, respectively (p < 0.05), at two weeks following transplantation. Kaplan-Meier analysis (Figure 3B) revealed a significant difference (p < 0.05) between marginal wild-type and hIAPP Tg/0  grafts to maintain glycemic control following transplantation. Intraperitoneal glucose tolerance tests were performed at 4 weeks following transplantation in a subset of normalized marginal mass recipients (Figure 3C). Random fasting blood glucose was significantly elevated in hIAPP Tg/0  grafts recipients above that of wild-type recipients in this subset (12.5 ± 0.8 mM versus 7.3 ± 0.3 mM, p < 0.05); there was no significant difference in blood glucose between recipients of the same genotype of islets for which IPGTT was or was not performed (wild-type recipients, 7.3 ± 0.3 mM versus 8.0 ± 0.6 mM, p = ns; hIAPP Tg/0  recipients, 12.5 ± 0.8 mM versus 11.5 ± 2.3 mM, p = ns). In the intraperitoneal glucose tolerance test, blood glucose was significantly elevated in hIAPP Tg/0 graft recipients at 1 hour following i.p. glucose injection. Area under the glucose curve was also significantly greater for recipients of hIAPP Tg/0 grafts.  We next analyzed graft amyloid load (Figure 4E). Of marginal mass grafts, 62% of transgenic grafts developed amyloid. In these grafts, amyloid occupied a mean 1.2 ± 0.9% of graft area. Amyloid tended to be greater in marginal mass than in optimal mass grafts, although this was not significant. Amyloid deposition was highly variable amongst graft recipients, with 54% having amyloid area of greater than 0.1% of graft area and 23% having area greater than 1% of graft area. Amyloid in hIAPP Tg/0  grafts positively correlated (r 2  = 0.66, p < 0.001) with random plasma glucose at day 10 following transplantation (Figure 4F). In this Figure, we confirmed that this relationship between amyloid-positive graft area and blood glucose remained significant upon exclusion of a point lying well upward and to the right of all other points (r 2  = 0.83, p < 0.0001). 59   Figure 3. Recipients of marginal mass grafts of islets expressing human IAPP have impaired glucose tolerance. STZ-diabetic NOD.scid mice were transplanted with 150 wild-type  (n=19) or hIAPP Tg/0 (n=13) islets. Non-fasted blood glucose was measured daily for the first week, twice in the second week, and weekly thereafter for one month following transplantation. Blood glucose is shown in (A). Kaplan-Meier analysis is shown in (B). All grafts normalized in the first week following transplantation. Three of 13 hIAPP Tg/0 grafts failed within the first 2 weeks following achievement of glycemic control. Recipients of hIAPP Tg/0  grafts (n = 3) graft recipients have significantly impaired glucose tolerance compared to recipients of wild-type islets (n=4) at 1 month following transplantation (C). Data are expressed as mean ± SEM. Differences between groups were assessed by Student’s t-test. *, p <0.05; **, p<0.01.        60    Figure 4. Recipients of marginal mass grafts of islets expressing human IAPP develop amyloid associated with graft failure. Histological analysis was performed on optimal mass wild-type (n = 19) and hIAPP Tg/0 (n = 13) grafts removed for histology at 1 month following transplantation. Representative images following insulin (red) and thioflavin S (ThioS; blue) staining are shown for wild-type (A, C) and hIAPP Tg/0  grafts in (B, D). Quantification of amyloid load is shown in (E). There was a significant (p < 0.05) correlation between amyloid load and blood glucose (F).  Data are expressed as mean ± SEM. Differences between groups were assessed by Student’s t-test. p < 0.05  (*) was considered significant. Size bar = 100 m.  61  3.3.3. Amyloid formation is associated with human islet graft failure  To determine whether amyloid correlates with graft dysfunction, as it does for hIAPP Tg/0  islets, NOD.scid mice transplanted with human islets were assessed for the presence of amyloid by thioflavin S staining (Figure 5). Upon graft harvest, mice whose grafts had maintained normoglycemia throughout the duration of the experiment had a significant elevation in the proportion of graft area occupied by amyloid (0.70 ± 0.3% versus 6.1 ± 3.5 %, p<0.05). Grafts which had maintained normoglycemia also tended to have a greater proportion of the graft occupied by  cells than those mice that failed to maintain normoglycemia (24.8 ± 3.8% versus 16.5 ± 4.3%, p = ns). These results demonstrate that amyloid deposition is greater in failed human islet grafts in this model and is associated with a loss of graft insulin immune-positive area.                  62   Figure 5. Amyloid formation is associated with human islet graft failure. Human islets were transplanted into streptozotocin-diabetic NOD.scid recipients. Grafts were retrieved following graft failure or at approximately 2 months following transplantation. Thioflavin S (ThioS) positive area (A) was significantly increased and insulin-immunopositive cell area (B) tended to be reduced in recipients of grafts with blood glucose values >15 mM at the time of graft harvest. Data are expressed as mean ± SEM. Differences between groups were assessed by Student’s t-test. P < 0.05 (*) was considered significant.                63  3.3.4. Increased amyloid area within human islet grafts is associated with a lower islet transplant mass  To determine whether increased amyloid formation is associated with a lower transplanted mass of human islets, as it is for hIAPP Tg/0  islets, we compared insulin-positive  cell area and thioflavin S (amyloid) positive area within grafts of normoglycemic recipients of 300 or 500 human islets (Figure 6). Recipients of 300 islets had a significantly elevated proportion of the graft occupied by amyloid (0.44 ± 0.12% versus 0.11 ± 0.03%, p <0.05). The proportion of graft area comprised of insulin-positive  cells was not significantly different between groups (20.4 ± 2.8% versus 26.6 ± 2.8%, p = ns), although there was a trend towards a lower proportion of cell area in recipients of fewer islets. Recipients of fewer islets also tended to have a greater impairment in proinsulin processing (1). This finding suggests that increased secretory stress on a smaller graft mass promotes cell dysfunction and amyloid deposition even when glycemic normalization is achieved.             64   Figure 6. Increased amyloid area is associated with lower transplanted graft mass. Grafts from mice transplanted with 300 (n=16) or 500 (n=16) human islets were stained for amyloid (ThioS; thioflavin S, A) and insulin (B) and analyzed for positivity as a percentage of total graft area. Representative images for 300 (C) and 500 (D) islet grafts are shown. Arrows indicate amyloid as assessed by thioflavin S staining. Insulin immunostaining is shown in red and amyloid is shown in cyan. Data area expressed as mean ± SEM. Differences between groups were assessed by the Mann-Whitney test. p < 0.05  (*) was considered significant. Scale bar = 100 m.     65  3.3.5. Islet amyloid in human islet allograft donors  3.3.5.1. Analysis of amyloid severity and prevalence in the islet allograft cohort The islet allograft cohort studied is described in the Methods section of this chapter. We analyzed amyloid severity and prevalence in islets from donors whose islets were used in clinical allograft recipients. Amyloid severity for individual donors is shown in Figure 7A. The mean amyloid load was 0.64 ± 0.19% of islet area. Ninety-five percent of donors had thioflavin S- positive staining within islets. Twenty-six percent of donors had greater than 1% of mean islet area occupied by amyloid. The least, median, and greatest amyloid loads within islets containing amyloid were 0.01%, 0.38%, and 3.20%, respectively.  Islet allograft donors in this cohort had a three-fold increase in amyloid load relative to the islet autograft cohort. Amyloid prevalence is shown in Figure 7B. The mean amyloid prevalence was 29.5 ± 5.9%, approximately two-fold greater than for the islet autograft cohort. The least, median, and greatest amyloid prevalences were 0%, 26.2%, and 78.0%.  Amyloid prevalence correlated positively and non-linearly with amyloid severity in islets from allograft donors (Figure 7C; R 2  = 0.768), as has been previously shown in islets of mice expressing the human IAPP transgene (548). After log transformation, the equation between these two parameters was [loge(severity) = 0.674 x loge(prevalence) + 3.747 ] (R 2  = 0.678; p < 0.0001).  3.3.5.2 Correlation of amyloid load and prevalence with available clinical data Limited clinical data were available for this cohort. Recent AIRglu data was available for 7 recipients for whom we had characterized amyloid load and prevalence in islets prior to isolation for the most recent islet infusion. There was a lack of correlation between AIRglu and either amyloid severity (Figure 8A; r 2  = 0.0002, p = 0.97) or prevalence (Figure 8B; r 2  = 0.02, p = 0.79).  We also compared amyloid severity and prevalence between recipients with optimal graft function and those requiring insulin supplementation. These data were only available for the most recent islet infusion. Data was available for 7 patients for whom we also had donor pancreas histological sections for the most recent islet infusion. Four of these patients had optimal graft function, while 3 required insulin supplementation. Patients requiring insulin supplementation tended to have increased donor islet amyloid load at time of transplantation, although this difference was not significant (Figure 9A; 0.24 ± 0.20% versus 0.91 ± 0.26%, 66  p=0.10). Amyloid prevalence was significantly increased in islet recipients requiring adjunctive insulin therapy (Figure 9B, 10.8 ± 8.8% versus 56.4 ± 5.7%, p<0.05). Taken together, these data suggest that that the greater the amyloid load and prevalence in donor islets prior to transplantation, the greater the likelihood of graft dysfunction.           67   Figure 7. Amyloid severity and prevalence in islet allograft donors. Amyloid load (A) and prevalence (B) were determined in the islet allograft cohort. Amyloid severity was determined by quantification of mean thioflavin S (ThioS) positive area within islets. Islets were immunostained for insulin to illustrate islet boundaries. Amyloid prevalence was determined as the proportion of islets staining positively for thioflavin S. Image analysis was performed using islets in histological sections of donor pancreas fixed prior to islet isolation. Amyloid prevalence correlated positively and non-linearly with amyloid severity in islets from allograft donors (C; R 2  = 0.768). After log transformation, the equation between these two parameters was [loge(severity) = 0.674 x loge(prevalence) + 3.747 ] (R 2  = 0.678; p < 0.0001). 68    Figure 8. Lack of correlation between acute insulin response to glucose and islet amyloid in islet allografts. Linear regression analysis of the relationship between AIRglu and amyloid severity (A) and prevalence (B). No correlation was observed. AIRglu, incremental area under the glucose curve above the baseline in an intravenous glucose tolerance test.      69   Figure 9. Amyloid prevalence in islets prior to transplantation is predictive of loss of insulin independence. Amyloid severity (A) and prevalence (B) from the last islet infusion received by a given patient were stratified according to whether a patient required adjunctive insulin supplementation at one year following islet transplantation. **, p < 0.01.       70  3.3.6. Islet amyloid in human islet autograft donors  3.3.6.1. Amyloid load characterization for the islet autograft cohort The islet autograft cohort is also described in the Methods section of this chapter. As for allografts, we analyzed amyloid severity and prevalence in the islet autograft cohort. We determined amyloid severity for both islets in the native pancreas and isolated islets (Figure 10). In native pancreas specimens, the mean amyloid load was 0.23 ± 0.17% Figure 10A). Of these donors, 50% had detectable amyloid. Amongst donor islets containing amyloid, the mean amyloid severity was 0.46 ± 0.32%, with lowest, median and greatest amyloid severities of 0.001%, 0.03% and 2.3%, respectively. The mean amyloid severity in isolated islets was 0.17 ± 0.08% (Figure 10B), which was not significantly different from the severity in native islets. Of these specimens, 50% had any detectable amyloid. Amongst isolated islets containing amyloid, the mean amyloid severity was 0.35% ± 0.15%, with least, median and greatest amyloid severities of 0.003%, 0.11% and 1.4%, respectively. A comparison of amyloid severity in isolated islets and native islets (Figure 10C) was uninformative due to an amyloid severity of 0 in both isolated and native islets in 5 of 9 donors for whom both isolated and native islets were available.  Amyloid prevalence for the autograft cohort is shown in Figure 11. In native pancreas specimens, the mean amyloid prevalence was 17.0 ± 7.6% (Figure 11A). Of these donors, 50% had islets containing amyloid; the mean prevalence amongst donors with detectable amyloid was 34.1 ± 13.1%. The least, median, and greatest amyloid prevalence within native pancreatic islets were 1.0%, 4.0%, and 17.0%.  The mean amyloid prevalence amongst isolated islets (Figure 11B) was 17.7 ± 6.3% and amongst donors with detectable amyloid, prevalence was 35.4 ± 9.6%. The least, median, and greatest amyloid prevalence within the isolated islets were 3.2%, 31%, and 91.2%. Linear regression revealed a positive correlation between amyloid prevalence between islets in native pancreas and isolated islets for donors in which we had both (Figure 11C, n = 11, r 2  = 0.75 , p < 0.0005). Amyloid severity and prevalence were compared within the autograft cohort (Figure 12). We combined results from analysis of native pancreatic and isolated islets and found that there was a positive and non-linear correlation between amyloid severity and prevalence (R 2  = 0.523). After log transformation, the equation between these two parameters was [loge(severity) = 0.391 x loge(prevalence) + 4.041] (R 2  = 0.662; p < 0.0001).  71   3.3.6.2. Lack of correlation of amyloid load and prevalence in donor islets with HbA1C Metabolic data (HbA1c) was available at 1 year following transplantation for only 6 patients. The mean HbA1c was 6.7 ± 0.4% for these patients. Correlation of these data with amyloid load and prevalence is shown in Figures 13A and 13B, respectively. No significant correlation was found for either amyloid load (r 2  = 0.31, p = 0.25) or amyloid prevalence (r 2  = 0.51, p = 0.11). Of donors with corresponding metabolic data, 83% had little to no amyloid. Based upon these data, we cannot draw meaningful conclusions regarding the influence of pre-existing donor amyloid load and prevalence upon metabolic outcomes in islet autotransplantation.                        72   Figure 10. Amyloid severity in islet autograft donors. Amyloid load was determined by quantification of mean thioflavin S (ThioS) positive area within islets. Islets were immunostained for insulin to illustrate islet boundaries. Amyloid severity was determined using (A) native pancreas specimens and (B) islets isolated prior to transplantation.  Lack of significant correlation between amyloid severity in matched donors 73  between islets in native pancreas and isolated islets is shown in (C). It should be noted that 5 data points are clustered at the intersection of the X and Y axes in (C).  Figure 11. Amyloid prevalence in islet autograft donors. Amyloid prevalence was determined by the proportion of islets from a given donor that stained positively for thioflavin S (ThioS). Amyloid prevalence was determined using (A) native pancreas specimens and (B) islets isolated prior to transplantation. Amyloid prevalence correlated positively between native pancreatic islets and isolated islets (C; p = 0.0005). 74   Figure 12. Correlation between amyloid load and prevalence in islet autograft donors. Amyloid prevalence correlated positively and non-linearly with amyloid severity in islets from autograft donors (R 2  = 0.523). After log transformation, the equation between these two parameters was [loge(severity) = 0.391 x loge(prevalence) + 4.041] (R 2  = 0.662; p < 0.0001). 75   Figure 13. Lack of correlation between HbA1c in islet graft recipients and amyloid in transplanted islets. Amyloid load and prevalence failed to correlate with HbA1c for islet autograft recipients. HbA1c, glycated hemoglobin.           76  3.3.7. Hexapeptide IAPP derivatives inhibit amyloid formation and protect against amyloid-induced apoptosis A library of hexa-peptide derivatives corresponding to regions of the mature IAPP (1-37) sequence were synthesized and tested for their ability to inhibit aggregation of synthetic human IAPP in vitro by electron microscopy in the laboratory of Dr. P. Fraser (University of Toronto). We tested the most promising inhibitor, L-ANFLVH, for its effects on amyloid formation and apoptosis in cultured human islets (Figure 14). L-ANFLVH significantly reduced amyloid deposition in cultured human islets (control, 0.65 ± 0.10% versus L-ANFLVH treated, 0.22 ± 0.06%, p < 0.01). Apoptosis in islets was assessed by two independent histological methods, TUNEL and cleaved caspase-3 staining. L-ANFLVH significantly reduced apoptosis as assessed by TUNEL (control, 24.6 ± 1.2% versus L-ANFLVH treated, 14.4 ± 2.3%; p<0.05) and by cleaved caspase-3 (control, 2.26 ± 0.25% versus L-ANFLVH treated, 1.28 ± 0.24%; p<0.05). Negative control peptides that did not inhibit synthetic human IAPP amyloid formation in vitro did not protect against the deposition of amyloid or against apoptosis in cultured human islets.   Figure 14. A hexapeptide fragment of IAPP inhibits amyloid formation and apoptosis in cultured human islets. The proportion of islet area occupied by thioflavin S (ThioS) positive amyloid is shown in (A). Apoptosis was assessed as percentage of TUNEL-positive islet cell nuclei (B) and the proportion of islet area occupied by cleaved caspase-3 positive staining (C). Culture experiments were performed using islets from 4 human donors. Data are expressed as mean ± SEM. Differences between groups were assessed by Student’s t-test. p < 0.05  (*) was considered significant. ClC3, cleaved caspase-3.   77  3.3.8. RNA silencing of human IAPP protects against amyloid deposition and toxicity in cultured human islets Human IAPP siRNAs were previously characterized in transformed  cell lines and the sequence which achieved the greatest knockdown of IAPP was cloned into an adenovirus (Ad-hIAPP- siRNA) (3). Human islets were cultured for 2 weeks in the presence of this adenovirus (Figure 15A). In treated islets, amyloid deposition was significantly reduced as compared to islets not treated with adenovirus (control, 0.43 ± 0.05% versus Ad-hIAPP-siRNA-treated, 0.16 ± 0.04%, p < 0.01). Apoptosis was also significantly reduced in human IAPP siRNA-treated islets (3).  Clinical translation of adenoviral vectors is limited, particularly due to immunogenicity, lack of high specificity for  cells in vivo, and potential toxicity. Lipid nano-particle delivery systems for siRNA have been shown to be highly effective, minimally toxic, and translatable (549). We have shown these particles to be efficient in delivering fluorescently-labelled siRNA homogenously throughout islets in a concentration-dependent manner (see Chapter 6). The use of this technology to deliver siRNA against human IAPP would be a novel strategy for therapeutic modulation of IAPP and amyloid deposition within islets and may have great potential for clinical translation. In collaboration with Drs. P. Cullis and C. Tam (University of British Columbia), we characterized five siRNA against human IAPP in cell lines (data not shown) and selected the two most effective. One of the two effective siRNAs (sihIAPP3) was the same sequence as used in the adenoviral construct in Figure 15A (549). The other was a novel sequence (sih4; AACCATCTGAAAGCTACACCCATTG). Human islets from 4 donors were treated with lipid nano-particles containing sihIAPP3, sihIAPP4 or scrambled siRNA. These islets were treated in 16.7 mM glucose rather than 11.1 mM glucose to enhance amyloid deposition, as shown by (32) and our own data (Figure 15A). Although there was no significant reduction in amyloid load or apoptosis (Figure 15B), there was a strong trend towards decreased amyloid deposition in islets treated with both si-hIAPP. Si-hIAPP4 also tended to protect against apoptosis (Figure 15C,D).     78   Figure 15. siRNA-mediated inhibition of hIAPP protects cultured human islets from amyloid deposition and toxicity. Human islets (n=3) treated with an adenoviral vector expressing siRNA against human IAPP were cultured for 2 weeks in 11.1 mM glucose-containing medium (A).  Human islets (n=4) in (B-D) were treated with lipid nano-particles (10 mg/ml) in 16.7 mM glucose. Quantification of amyloid load is shown in (A) and (B). Quantification of TUNEL-positive nuclei expressed as a proportion of islet cell nuclei (C) and cleaved caspase-3 positive area (D) is shown for nano- particle treated islets.  Data are expressed as mean ± SEM. Differences between groups were assessed by Student’s t-test or one-way ANOVA. **, p<0.01. si-scramble, scrambled siRNA; si- hIAPP3, and si-hIAPP4, human IAPP siRNA 3 and 4; ThioS, thioflavin S; ClC3, cleaved caspase-3.           79  3.4. Discussion Human IAPP aggregation has a detrimental effect upon transplanted islets. Using hIAPP Tg/0 islets, we showed that expression of this peptide promotes mild elevations in blood glucose and glucose intolerance even when an optimal mass of islets is transplanted. Notably, impaired blood glucose homeostasis was present in recipients of hIAPP Tg/0 islets even when amyloid was not detectable, and moreover the presence of islet amyloid did not worsen blood glucose in recipients of 250 hIAPP Tg/0 islets. This finding is consistent with the development of diabetes in another strain of hIAPP Tg/0 mouse that does not develop detectable islet amyloid (491). The potentially deleterious effects of islet amyloid formation are more notable in a marginal mass islet graft. Marginal mass grafts of hIAPP Tg/0 islets had a significantly increased probability of hyperglycemia and graft failure, both of which correlated with the degree of amyloid deposition in the graft. Our data elaborated upon a recent study in which it was demonstrated that the presence of islet amyloid deposition correlated with the development of hyperglycemia (490). hIAPP Tg/0 islets over-express amyloidogenic IAPP, which may lead to supra-physiological concentrations of human IAPP in the circulation. Human islet studies thereby have greater physiological and clinical relevance. Using transplanted human islets, we determined that in human islet grafts which failed to maintain glycemic control, there was increased amyloid deposition and a trend towards reduced  cell mass. Further, we determined that transplantation of fewer islets promotes amyloid deposition within human islet grafts. Amyloid load is highly variable amongst human islet donors. Consistent with the detrimental effect of islet amyloid in transplantation, we determined that a greater amyloid load prior to transplantation correlated with graft dysfunction in recipients. Moreover, we noted that islets used in a cohort of clinical islet allografts had an elevated incidence of amyloid prior to transplantation, unlike the islet autograft cohort. Finally, we demonstrated that two promising therapeutic strategies protect against amyloid deposition and amyloid-associated toxicity in cultured human islets. Although these strategies need to be further validated in vivo, they show great promise for clinical translation in the development of anti-amyloid therapeutics.  The success of clinical islet transplantation is limited by progressive loss of graft function. Despite its considerable success in slowing the progression of diabetes-related complications, its broader implementation is dependent upon improvement in long-term graft viability and function. Though patient satisfaction is high and quality of life improved upon successful islet 80  transplantation, both deteriorate rapidly upon a return to insulin therapy (550, 551). A slow decline in production of C-peptide and graft failure in non-immunosuppressed autograft recipients are highly suggestive that non-immune mechanisms contribute to long-term graft failure. Amyloid deposition has been previously described in transplanted human islets (543, 552) but never correlated with pathology. In this chapter, we show that human islet amyloid polypeptide contributes substantially and rapidly to  cell dysfunction in transplantation in human islets. This finding is consistent with a case report of extensive amyloid deposition in a failing human islet graft (489). Furthermore, it validates a previous study in which amyloid deposition within transplanted human IAPP-overexpressing transgenic mouse islets was associated with recurrence of hyperglycemia within weeks of transplantation (490). Rapid human IAPP-associated pathology in transplanted human islets demonstrates that islet amyloid is a significant contributor to graft dysfunction at physiological levels of IAPP expressed in human islets rather than simply attributable to transgenic over-expression at supraphysiological levels.  Amyloid deposition in the type 2 diabetic islet begins prior to the onset of overt disease and is associated with progressive apoptotic loss of islet  cell mass. In autopsy studies of human pancreas, islet amyloid load and prevalence are substantially increased in both lean and obese type 2 diabetic individuals, consistent with a 70% reduction in islet  cell volume (529). Pre- diabetic individuals with impaired fasting glucose had a 50% reduction in islet  cell volume compared to non-diabetic individuals but had similar islet amyloid load and prevalence to non- diabetic controls (529). Autopsy studies present a limited snapshot of disease pathology and do not follow the progressive pathology in individuals. The contribution of islet amyloid deposition to progression of type 2 diabetes is better illustrated in the baboon, a primate with pro- amyloidogenic IAPP (454) that spontaneously develops human-like type 2 diabetes and associated islet amyloid pathology (453, 553). In a non-diabetic, normoglycemic baboon, up to 17% of islet area may be occupied by islet amyloid (454). Islet amyloid severity increases as baboons age (454). Between 36 and 51% of islet volume is occupied by amyloid upon onset of hyperglycemia. Amyloid load within the islet continues to increase as hyperglycemia worsens, suggesting that amyloid formation continues to contribute to islet pathology. When amyloid load exceeds 51% of baboon islet volume,  cell volume within the islet drops dramatically (454); this recapitulates the decrease in  cell volume associated with progression from impaired fasting glucose to diabetes and with increased amyloid deposition in the aforementioned human autopsy 81  study (529). These findings are also reproduced in the HIP rat, a transgenic rat which overexpresses IAPP in the  cell under control of the rat insulin promoter (97). The hemizygous HIP rat is a hIAPP-expressing transgenic model that closely approximates human type 2 diabetes (554) and develops a phenotype in the absence of a high fat diet or pharmacological stimulation. In this model, a tripling of islet amyloid load between 2 and 5 months of age precedes the onset of hyperglycemia and rapid decline in islet  cell volume that begin at 5 months of age (98). A significant increase in  cell apoptosis is noted at 3 months of age, correlating with a rapid increase in islet amyloid deposition. Taken together, these data illustrate that islet amyloid deposition precipitates cell dysfunction and loss in type 2 diabetes and continues to contribute to disease pathology as diabetes progresses.  The transplanted  cell recapitulates several features of the type 2 diabetic  cell. In addition to amyloid pathology within the graft (543, 552), these features include a blunted first phase of secretagogue-stimulated insulin secretion (357, 539), a progressive decline in insulin and C- peptide secretion (129), impaired prohormone processing leading to hyper-proinsulinemia (316, 376, 543), and decreased PC2 immunostaining (543). Additional similarities are the progressive loss of transplanted islet mass following successful engraftment (545, 546) and the improvement of transplanted islet function with therapeutic agents used in the treatment of type 2 diabetes (211, 246, 298, 311, 312, 555-559). The progressive decline in the function of transplanted cells is accelerated relative to type 2 diabetes. In type 2 diabetes, progression from a state of impaired fasting glucose to overt diabetes tends to occur over 3 to 4 years (560). Amyloid aggregation in aforementioned animal models of type diabetes occurs over months. The time course of its deposition is likely longer in humans, considering the low amyloid load in humans with impaired fasting glucose (529) and that progression to overt disease occurs over several years. In islet transplantation, the decline in islet function is rapid, such that graft failure occurs within 1-2 years of transplantation (129). Correspondingly, islet amyloid fibrils have been observed in transplanted human islets as early as two weeks following transplantation (552). Furthermore, in our optimal mass islet transplantation model, human-IAPP expressing islets demonstrated a slight but significant increase in blood glucose values within the second week following transplantation. This correlated with impaired glucose tolerance upon an intraperitoneal glucose challenge. Islet amyloid species contribute markedly to  cell pathology in both transplanted and type 2 diabetic islets. The accelerated onset of amyloid pathology and 82  deposition in islet transplantation suggest that islet amyloid and associated pre-fibrillar IAPP aggregates are important non-immune factors that contribute to long-term islet graft failure.  The causes of accelerated amyloid pathology in islet transplantation remain unclear. Islet injury associated with islet isolation or the peri-transplantation environment may enhance islet amyloid deposition. Pancreatic digestion by collagenase may damage the integrity of islet basement membrane and capillary beds. Moreover, islet endothelium dies rapidly during overnight islet culture prior to transplantation. Together, these factors lead to exposure of endogenous heparan sulfate proteoglycans (487, 561) that may seed islet amyloid formation. Islet isolation (236) and peri-transplant inflammation stimulate  cell apoptosis. Localized release of contents of apoptotic cells may elevate intra-islet extracellular IAPP concentrations and also promote its aggregation. Many factors in or associated with the transplantation environment may contribute to and potentiate  cell dysfunction. Transplanted cells are subject to metabolic stress, particularly when engrafted islet mass is low (202) and in the presence of recipient hyperglycemia. Many factors in the transplant environment may exacerbate  cell dysfunction (202, 262, 263, 265, 355, 360, 562-565), leading to impaired prohormone processing and elevated release of N-terminally extended proIAPP, which may bind to heparan sulfate proteoglycans to seed amyloid formation by IAPP (487). Alternately, rapid amyloid formation within grafts may stem from decreased IAPP clearance upon loss of islet vasculature in islet isolation. Furthermore, it has not been established whether vasculature formed from endothelial cells at a heterologous site of transplantation maintain the characteristic fenestrations of islet endothelium and thus normal rates of IAPP clearance upon re-establishment of islet vasculature. Finally, as insulin may inhibit amyloid formation, an increased ratio of secreted proinsulin:insulin in the face of impaired insulin processing may destabilize IAPP and promote its misfolding. Although there are many potential mechanisms underlying increased amyloid deposition in transplantation, the actual mechanism remains to be elucidated.  Amyloid prevalence in donor islets prior to transplantation is predictive of long-term graft function. Although not statistically significant, there was also a strong tendency for amyloid severity to predict outcomes that was likely limited by the small sample size. Taken together, these preliminary data suggest that a larger multi-centre study evaluating whether stratification of recipients according to amyloid in donor islets is predictive of long-term graft function is 83  warranted. Amyloid severity correlates with disease severity (566) or glycemic control (567) in type 2 diabetes in human autopsy studies (568). Thus, findings in type 2 diabetes support our predictive findings in transplanted human islets. Amyloid imaging in vivo has been performed in humans and animal models of Alzheimer’s disease by positron emission tomography (PET) using a radiolabelled isotype of the Pittsburgh compound (PiB) (569). As this technology becomes more widely available, monitoring the rate of amyloid deposition in transplanted islets will likely be an even stronger predictor of long-term graft outcome.  Thioflavin S-positive area in donor islets provides an estimate of amyloid plaque load but not pre-fibrillar, thioflavin S-negative IAPP species. The predictive value of amyloid plaques on disease severity is not fully supported in Alzheimer’s disease. Some autopsy studies in humans have shown association between amyloid plaque load and degree of cognitive impairment (570, 571), while others have failed (572) or detected amyloid in normal individuals without cognitive impairment (573). A lack of association was found over time as detected by PET-PiB imaging over time despite Alzheimer’s disease progression in a case report of single individual (569). Severity of Alzheimer’s disease is earlier (574) and better predicted by the presence of prefibrillar “oligomeric” species (572, 575-577) as detected by an oligomer-specific antibody rather than for fibrillar amyloid. In our hands, impaired glucose tolerance was present even in recipients of hIAPP Tg/0  islets whose grafts failed to develop amyloid deposits, supporting the idea that undetectable, pre-fibrillar IAPP aggregates contribute to disease and graft failure.  Several studies support the notion that a pre-fibrillar species is the predominant toxic species formed by human IAPP (96, 578). Zhao et al claimed to have identified IAPP oligomeric species in type 2 diabetic human islets (579) using the previously described A-11 antibody, although concerns have been raised regarding the specificity of this A-11 antibody (12) and whether this it has been adequately characterized for IAPP (476, 580). Furthermore, this antibody is well known not to work in paraffin-embedded tissues (579) and in our own studies we have been unable to replicate the findings of Zhao et al. (data not shown). The A-11 antibody has only been used in a single study in Alzheimer’s disease (577), while other antibodies are more commonly used (572, 575, 576). The development of an antibody that truly binds the toxic IAPP oligomeric species would be of great value to the field. In the meantime, we have shown that fibril load and prevalence do have predictive power in islet graft success in transplantation.  84  Although the amyloid fibril end-product may not be the predominant toxic species affecting cells, its presence demonstrates the prior aggregation of pre-fibrillar species. Moreover, as IAPP aggregates up to a hundred-fold faster than amyloid , the time course from the appearance of prefibrillar species to mature fibrils is much more rapid in IAPP pathology than in other amyloid diseases. Nevertheless, alternate methods of characterization of islet amyloid might increase the predictive power of graft success and allow a measure of IAPP aggregates species that correlate better with toxicity. Several currently available methodologies could potentially provide such evidence. Serum amyloid P (SAP) is a known component of amyloid plaques. It may detected by immuno-histochemical staining and while it localizes well with thioflavin-staining (581, 582), it may bind to areas that do not stain positively by thioflavin dyes (583). Moreover, it may be monitored in vivo. In patients with systemic amyloidosis, serum SAP levels decrease significantly (584) and SAP localization within tissues may be determined by scintigraphy (584- 587). Detection of fibril load will likely become possible using the previously described method of PET imaging in conjunction with PiB (588). Future developments in the ability to detect amyloid oligomers and amyloid in vivo imaging techniques will refine our ability to monitor IAPP amyloid pathology in both islet transplantation and type 2 diabetes.  Islet amyloid prevalence and load tend to be greater in conditions in which  cell dysfunction is observed (431, 567, 568, 589, 590). For example, islet amyloid is found in 92% of insulinomas (589). Between 20 and 99% of type 2 diabetic patients (431, 567, 568, 590) have islet amyloid in human autopsy studies; islet amyloid severity is approximately 12 to 35% (567, 590). Moreover, islet amyloid deposition is increased with severity of diabetes (568). In this study, we noted dramatic differences in amyloid load and prevalence between autograft and allograft donors. The islet autograft cohort analyzed in this study was highly representative of a non-diabetic population based upon these citations, with a mean islet amyloid severity of less than 0.2% of islet area and islet amyloid prevalence within a given pancreas of approximately 17%. The islet allograft population had a mean amyloid severity of 0.6% and a mean prevalence of approximately 30%. While the severity of amyloid present in islets used in clinical allografts was less than that of type 2 diabetes, it appears to be markedly elevated relative to islets used in our autograft population. Furthermore, following transplantation, amyloid deposition within human islets may become extensive (489). Although we were not provided with islet donor 85  characteristics for either population, these data suggests that the donor populations are very different between the two cohorts.  Islet auto-transplantation is most commonly performed following pancreatectomy to alleviate pain in chronic pancreatitis. Chronic pancreatitis is a malabsorption syndrome, leading to thin body habitus and wasting. The mean age of onset of chronic pancreatitis is 40, suggesting that this population is middle-aged. While diabetes mellitus may occur as a consequence of long- standing pancreatitis, chronic pancreatitis patients tend to lack features of the metabolic syndrome associated with type 2 diabetes, in which islets typically develop amyloid pathology. In contrast, islet allograft donors tend to be older and obese (144, 146, 147). Thus, it is perhaps not surprising that islets used in auto-transplants have less amyloid than those used in allo- transplants.  In islet allo-transplantation, cadaveric donor organs are scarce (213), with the highest quality organs being allocated to pancreas transplantation (144). Only 10% of cadaveric multiorgan donors are eligible for pancreas transplantation, while 48% of donors were suitable for islet transplantation (145). Donors for islet transplantation may be as old as 70 years (219) and BMI often exceeds 30 (146, 147). Islet isolation efficacy and yield also favors the use of older, larger donors. Islet isolation is more difficult with the pancreas of a low BMI donor (214, 215, 217) and digestion time is reduced with a pancreas from a larger BMI donor (216). Furthermore, pancreata from high BMI pancreata yield more islets (218). Reports on the function of islets from obese donors are conflicting (216, 217), although it is known that pancreata from obese donors tend to be fatty and thus poorly perfused and more susceptible to ischemia/reperfusion injury (216). Islets from obese donors may be more susceptible to metabolic exhaustion and long-term dysfunction upon transplantation. Donors are excluded if there is a known history of diabetes (214) but many obese donors are likely “pre-diabetic” with undiagnosed metabolic syndrome. Hyperglycemia in a donor has been shown to have poor outcomes following pancreas transplantation (145, 223). Islets from type 2 diabetic humans have abnormal glucose-stimulated insulin secretion and do not reverse hyperglycemia in transplanted mice (205). Donor age also influences glycemic outcomes in transplantation. Once donor age exceeds 45 years, there is increased risk of poor glycemic control and early graft dysfunction in whole pancreas transplant (221). Islet transplantation may be biased against by the use of lower quality organs than pancreas transplantation, which may thus lower likelihood of success of the procedure. Islets 86  used in allo-transplantation may be preferentially obtained from donors older and more obese donors that may be predisposed to amyloid formation, dysfunction and graft failure. As islet amyloid contributes significantly to graft pathology, therapeutic manipulation of IAPP expression or islet amyloid deposition should improve long-term graft survival and function. Currently, there are no amyloid inhibitors in clinical trials or clinically approved for treatment of any local or systemic amyloidoses. The most promising anti-amyloid therapy to date has been anti-amyloid vaccination in mouse models of Alzheimer’s disease (591) and in early human clinical trials (592), demonstrated to promote amyloid plaque clearance and improve cognitive function. Amyloid immunotherapy has not yet passed clinical trials due to significant pathology in recipients (592). Many relevant pre-clinical strategies have been proposed to protect against amyloid. Direct inhibitors of IAPP aggregation have been characterized to varying extents. These include Congo red (38), [(N-Me)G24, (N-Me)I26]-human IAPP-GI (593), acid fuschin (594), epigallocatechin-3- O-gallate (595), phenolsulfonphthalein (596), curcumin (597), and IAPP fragments and their derivatives (598, 599). Interestingly, a non-amyloidogenic derivative of full length human IAPP (pramlintide) is clinically available but has not been tested for its inhibitory properties against IAPP aggregation. The non-amyloidogenic rat IAPP has also been shown to inhibit IAPP fibrolligenesis in vitro (464). Given that IAPP may cause toxicity by intracellular mechanisms, use of molecular chaperones has been proposed to improve proper folding efficiency of proIAPP (394) in the ER. This might be accomplished by gene therapy or by the use of chemical chaperones (397, 406, 600). As IAPP has been proposed to promote toxicity by means of inflammation (40), inhibition of IAPP-stimulated inflammatory processes may also improve graft outcomes. Additional means of protecting  cells from amyloid toxicity include suppression of  cell pro-apoptotic signaling (37, 38). While many strategies have been proposed, further testing is required for all of the above mechanisms in pre-clinical models. In this chapter, we demonstrated human islet protection from amyloid deposition and associated toxicity by the use of a hexapeptide inhibitor of IAPP aggregation and by silencing IAPP mRNA expression.  One promising strategy for islet graft protection against islet amyloid toxicity that we propose is the use of amyloid inhibitors. While many molecules have been proposed to inhibit IAPP fibrillogenesis and cytotoxicity in biochemical and cell culture models (38, 464, 593-599), we are the first to show that this strategy is effective in human tissue. We screened promising hexa- 87  peptide sequences derived from the primary amino acid sequence of IAPP that were effective in suppressing IAPP amyloid formation in biochemical assays. The hexa-peptide ANFLVH is the most promising candidate for further in vivo testing. Within the sequence of full length, mature IAPP, the ANFLVH sequence falls between amino acid residues 13-17. It does not lie adjacent to or within the primary pro-amyloidogenic GAILSS region (residues 24-28). To prevent the formation of pre-fibrillar species by human IAPP, ANFLVH may stabilize full-length IAPP in its native, soluble random coil conformation, as has been shown for other effective IAPP hexapeptide fragments (508). Interestingly, a similar hexapeptide derivative (LANFLV) promotes  sheet formation with IAPP (1-37) and seeds amyloid formation (463). Therefore, a histidine residue (residue 18 in mature IAPP) in the effective inhibitory hexapeptide may play a critical role in preventing IAPP aggregation. This histidine residue promotes -sheet structure and fibril formation in solution when it is deprotonated at physiological pH (462); its pro- fibrillogenic effects are lost when the residue is charged at low pH. The histidine residue within the hexapeptide may competitively inhibit interaction between histidine at residue 18 within the mature peptide for interaction with other IAPP (1-37) residues critical to formation of  sheet structure.  Therapeutic formulation of a hexapeptide for drug delivery is much simpler than for a larger peptide derivative, such as the proposed IAPP amyloid inhibitor IAPP-GI (593). However, peptides are not ideal for in vivo use due to rapid proteolytic degradation. Preliminary studies of the half-life of ANFLVH in serum suggested a half-life of less than two minutes. Many peptidomimetic strategies have been proposed to increase peptide stability in vivo. These include N-terminal modification and the use of D-enantiomers. We showed that the D-enantiomer of the L-ANLFVH sequence has remarkably similar properties to L-ANFLVH in its ability to inhibit IAPP fibril formation and toxicity. Furthermore, the half-life of this compound in serum was increased to several hours in preliminary studies. By development of a highly stable and highly effective inhibitor of islet amyloid formation, we have developed a strong candidate drug for in vivo protection of  cells in type 2 diabetes and islet transplantation.  A second strategy that we proposed to protect islets against islet amyloid toxicity in transplantation is the silencing of IAPP expression. RNA silencing of gene expression has entered the realm of clinical application. The first clinical trial using siRNA began in 2004, in a 88  patient population affected by blinding choroidal neovascularization (601). SiRNA was administered by direct intraocular injection. The most recent report in the treatment of this particular disease demonstrates that siRNA therapy is well tolerated and results in disease stabilization or improvement (602). The first effective systemic delivery of siRNA to humans resulting in specific RNA and protein level knock-down of M2 subunit of ribonucleotide reductase (RRM2) in solid tumours was achieved by lipid nano-particle delivery (601) and published less than a year ago. Positive results in clinical trials, achieved without systemic toxicity, open the gateway for RNA targeting for an endless possibility of gene targets.  Our initial studies on human IAPP knockdown in human islets were performed using an adenoviral vector. We effectively knocked down IAPP and correspondingly limited islet amyloid deposition and protected against its toxicity in cultured human islets. The possibility of clinical translation into humans using adenoviral vectors is limited, however, by their immunogenicity and potential toxicity (603-605). Adenoviral vectors are currently in human clinical trials for gene therapy (606), for which mild influenza-like symptoms were associated with delivery. Lipid nano-particle delivery may be achieved with an absence of systemic toxicity. In this chapter, we show that use of this technology (549) to deliver highly stable siRNA to cultured human islets also reduces islet amyloid deposition and toxicity when the target is human IAPP. Given IAPP toxicity in transplanted human islets, this represents a novel and highly translatable approach to protect  cells against the toxic effects of human IAPP.  A particular novelty of islet cell transplantation, as compared with other organ transplants, is that overnight culture of islets prior to transplantation is typically performed, allowing sufficient time for ex-vivo treatment. The current limitation of this system is the lack of  cell specificity of lipid nano-particle delivery. Systemic delivery would thereby also reduce IAPP expression in other cell types. Lack of IAPP expression in a transgenic mouse has minimal metabolic effects, with mild improvement in glucose tolerance (607), and therefore systemic knockdown of IAPP production is unlikely to have significant physiological effects. Additional reported effects include increased susceptibility to chemically-induced diabetes (608) and reduced nociception (609).  cell-specific lipid nano-particle delivery systems would eliminate risks of IAPP knockdown in other organ systems and decrease the dose required to achieve effective silencing in the  cell. IAPP replacement therapy is possible using the clinically available non- 89  amyloidogenic analogue of human IAPP, pramlintide. Increased  cell specificity of lipid nano- particle delivery is currently in development by means of ligand associated nano-particles. We conclude that our results in human islets using both adenoviral and lipid nano-particle delivery systems show great promise for in vivo modulation of amyloidogenic protein expression.  In summary, in this Chapter, we show that islet amyloid deposition is detrimental to graft function and exacerbated under conditions of metabolic stress. Pre-existing amyloid in an allograft donor cohort may have value for prediction of long-term graft outcome. We demonstrate several therapeutic strategies with clinical applicability to protect human islets against the toxic effects of human islet amyloid polypeptide.                                  90  Chapter 4. Effect of heparin on amyloidogenesis and toxicity of human IAPP  4.1 Background Heparin is used in clinical islet transplantation to prevent loss of islets by the instant blood- mediated inflammatory reaction (IBMIR) upon infusion, thus preserving  cell mass (149, 334). Islets are exposed to heparin (149, 610) prior to infusion and again in serum up to 7 days following transplantation (153, 311). Islet surface heparinization protects islets against IBMIR (149) and is in clinical trials for islet transplantation.  Heparin directly promotes the fibrillogenesis of many amyloidogenic species, including proIAPP (561), IAPP (611, 612), acylphosphatase (613), serum amyloid A (614), -2 microglobulin (615), gelsolin (616), A  1-28 (617), the prion fragment PrP 185-208 (617), and -synuclein (618). IAPP amyloid formation in the presence of heparin results in increased fibril density and fibril compaction (619). Further evidence of a role for heparin in amyloid formation is the inhibition of heparin binding to IAPP by the amyloid inhibitor Congo red (611) and removal of heparin-IAPP complexes from solution by centrifugation (611). Heparin is thought to act as a scaffold for amyloid formation (613). Heparin increases the nucleation rate of amyloid fibrils at low concentrations and the elongation rate of fibrils at higher concentrations (620). Heparin may also stabilize fibrils such that it prevents de-polymerization, as has been shown for -2 microglobulin (621). Thus, heparin exposure to islets likely promotes aggregation of IAPP.  Heparin may promote IAPP aggregation in islets by multiple mechanisms. First, it may promote fibrillization of mature IAPP by direct interaction, as suggested by interaction with its positively charged arginine residue at residue 11 (622). Heparin may also seed amyloid formation by its interaction with a processing intermediate of proIAPP.  Islet amyloid is comprised primarily of islet amyloid polypeptide (IAPP) (623) but N-terminally extended (C-terminally processed) pro- IAPP is also detected in islet amyloid plaques (432). N-terminally unprocessed proIAPP has a putative heparin-binding domain that mediates proIAPP binding to heparin and heparan sulfate (487), comprising 3 basic amino acids at its N-terminal cleavage site. Binding of heparin to this domain promotes amyloid formation by proIAPP species (561), which may subsequently seed IAPP aggregation into amyloid fibrils (624). Glycosaminoglycan binding domains exist in other mature amyloidogenic proteins (561, 625, 626) and have been shown to promote amyloid 91  deposition (625). Sulfated glycosaminoglycans such as heparan sulfate are recognized components of amyloid deposits (487). Given the known cytotoxic effects of aggregating human IAPP, the potent effects of heparin on its aggregation likely impact its toxicity to  cells. In this study, we investigated the effects of heparin on amyloid aggregation and toxicity in cell culture, human islet culture, and in vivo transplantation studies.  4.2 Methods 4.2.1 Time course of IAPP toxicity A time course of IAPP toxicity was performed according to the method of Bucciantini et al (627) and Rigacci et al (628). IAPP was rapidly solubilized in 90% of a final volume of cell culture media to obtain a concentration of 48.9 M. It was subsequently aliquoted into tubes containing media alone or media and heparin, such that tubes contained 40 M hIAPP, 40 M hIAPP plus 41 IU/ml heparin, or 40 M hIAPP plus 410 IU/ml heparin. These aliquots were kept at 37 o C in a water bath throughout the experiment. One hundred microlitres of each aliquot was transferred in duplicate to a 96 well plate so as to monitor IAPP fibrillization by thioflavin T kinetics at 37 o C throughout the experiment. Concentrated thioflavin T stock was added to each well  to make a final concentration of 10 M. INS-1 cells were plated in 96 well plates such that for every time point, fresh INS-1 cells were at 70-80% confluence. Immediately after preparing hIAPP- containing solutions, INS-1 media was removed from 8 wells and media in 2 wells per condition was replaced with fresh media or an aliquot of the three solutions described above. At 0.5, 1, 2, 3, 6, and 12 hours after IAPP solubilization, an aliquot of each solution was added to fresh wells containing INS-1 cells. Each of these solutions were left on cells for 9 hours to allow toxic species within the aliquot to impact the viability of INS-1 cells. After 9 hours, images were taken of all wells. At this time, media in wells was replaced with fresh media containing 10% alamarBlue ®. Cells were incubated with alamarBlue® for 4 hours, after which time fluorescence was read as described in Chapter 2.      92  4.3 Results  4.3.1 Heparin accelerates the formation and the final yield of IAPP amyloid fibrils We assessed the effect of heparin on amyloid fibril formation using a thioflavin T kinetics assay as previously described (487) (Figure 16). IAPP (40 M) was incubated alone or in the presence of increasing concentrations of heparin (41 IU/ml, 410 IU/ml). The lowest concentration, 41 IU/ml, was chosen to mimic concentrations of heparin used clinically prior to islet infusion. Islets are exposed to between 3,000 and 5,000 IU/ml of heparin (149, 610) in a volume of 120 ml (610). A ten-fold greater concentration was also used to determine whether the effects of heparin on IAPP occurred in a concentration-dependent manner. Each condition was performed in duplicate and repeated on five separate occasions. Data was corrected for the fluorescence of buffer containing thioflavin T alone, or in the case of heparin addition, for the fluorescence of buffer containing thioflavin T and the appropriate concentration of heparin alone. Even the highest concentration of heparin used did not alter fluorescence of solution in the absence of IAPP as compared to buffer with thioflavin T alone (0.042 ± 0.001 versus 0.042 ± 0.001, p = ns).  When IAPP (40 M) was incubated alone (Figure 16), the lag phase lasted 0.55 ± 0.10 hours. The slope of the upstroke of fibril growth was 0.52 ± 0.17 AFU/hour. Maximal fluorescence was achieved by 0.93 ± 0.12 hours, at which point fluorescence above the corrected baseline was 0.16 ± 0.04 AFU. In the presence of either 41 or 410 IU/ml heparin, the initial thioflavin- corrected fluorescence was slightly but significantly increased, reflective of previous observations that thioflavin T fluorescence is slightly increased upon binding prefibrillar aggregates with -sheet structure (629-631). The lag phase was significantly reduced in the presence of both concentrations of heparin. Heparin (410 IU/ml) reduced the lag phase by six- fold to 0.09 ± 0.03 hours. At the time of onset of the rapid fibril growth phase, corrected fluorescence was increased two-fold in the prescence of 410 IU/ml heparin. The slope of fibril- induced fluorescence was also significantly greater in the 41 IU/ml heparin-treated group compared to hIAPP alone, and was 4- and 2.5-fold increased in the presence of 41 and 410 IU/ml heparin, respectively. Peak fluorescence was significantly increased between 2- and 3-fold in the presence of both concentrations of heparin. IAPP in the presence of heparin tended to have higher fluorescence at two hours following initiation of aggregation, although this was not statistically significant.  93   Figure 16. Heparin decreases the lag time of fibril formation and increases load of fibril formation as assessed by thioflavin T fluorescence kinetic assay. Thioflavin T fluoresces upon binding to amyloid fibrils. Synthetic human IAPP (40 M) was incubated alone (black) or in the presence of heparin (purple: 41 IU/ml; blue: 410 IU/ml. Heparin alone did not alter thioflavin T fluorescence (not shown).  Assay conditions are described in Chapter 2 (Methods).  Electron microscopy was performed to provide representative images of amyloid fibrils in the absence or presence of heparin at different time points (Figure 17). No fibrillar structures were noted immediately following IAPP solubilization and addition of heparin. By 4 hours, IAPP fibrils formed in the presence of both concentrations of heparin Figures 17E and H) but not in buffer containing 40 M IAPP alone (Figure 17B). By 24 hours post-solubilization, denser fibril meshworks were observed at both concentrations of heparin (Figures 17F and G) while no fibrils were noted in buffer containing 40 M IAPP alone (Figure 17C). By Thioflavin T data, we confirmed that 40 M IAPP formed fibrils in the absence of heparin, although this was not observed in TEM images shown in Figure 17. TEM images do, however, confirm that heparin (41 and 410 IU/ml) enhances IAPP fibril formation.        94   Figure 17. Heparin increases fibril load as assessed by transmission electron microscopy. Synthetic human IAPP (40 M) was solubilized with or without heparin (41 or 410 IU/ml). Aliquots were removed immediately after solubilization and at 4 or 24 hours following solubilization, and then incubated on grids for electron micoscopy. Grids were dried, negatively stained with uranyl acetate, and imaged. Scale bar represents 200 m. Fibrils are demonstrated by black arrows.        95  4.3.2 Heparin accelerates the extent and onset of IAPP toxicity To determine the effect of heparin on IAPP toxicity, we incubated INS-1 rat insulinoma cells with synthetic human IAPP at increasing concentrations of heparin (Figure 18). Viability was assessed by alamarBlue® reduction assay (Figure 18A) and apoptosis was assessed by TUNEL (Figure 18B).  Human IAPP significantly reduced INS-1 viability as assessed by alamarBlue® incubation with 20 or 40 M hIAPP for 24 hours (control viability, 100.0%; 20 M hIAPP, 72.4 ± 5.3% of control viabilty; 40 M hIAPP, 58.8 ± 9.1%; p<0.01 and p<0.001, respectively) . Heparin had no effect on INS-1 cell viability even at the highest concentration of heparin used (control, 100%; 410 IU/ml heparin, 99.5 ± 2.7%; p = ns). A concentration-dependent effect of heparin in reducing cell viability in the presence of hIAPP was observed in cells treated with 20 and 40 M hIAPP. At 40 M hIAPP, heparin significantly increased the toxicity of IAPP at a concentrations of 410 IU/ml (40 M hIAPP, 58.8 ± 9.1%; 40 M hIAPP + 410 IU/ml heparin, 23.7 ± 6.2%; p < 0.05) as compared to cells treated with heparin alone.  Human IAPP did not significantly increase apoptosis in INS-1 cells as assessed by TUNEL staining after incubation with 10 or 20 M hIAPP for 16 hours, although a trend towards increase apoptosis was observed in the latter (control, 2.3 ± 0.9% TUNEL positive cells; 10 M hIAPP, 3.0 ± 0.2%; 20 M hIAPP, 7.0 ± 4.5%). Any effects of heparin alone on INS-1 cells were not significant even at the highest concentration of heparin used (control, 2.3 ± 0.9% TUNEL-positive nuclei; 410 IU/ml heparin, 0.21 ± 0.16%; p = ns). Heparin did not increase IAPP toxicity at 10 M hIAPP (Figure 18). At 20 M hIAPP, however, heparin significantly increased the toxicity of IAPP at concentrations of 41 IU/ml (34.3 ± 11.8%, p < 0.05) and 410 IU/ml (36.5 ± 8.2%, p < 0.01) as compared to cells treated with heparin alone.        96   Figure 18. Heparin enhances toxicity of synthetic human IAPP. INS-1 cells treated with IAPP with or without heparin were assessed for viability by Alamar blue reduction assay (A) and apoptosis by TUNEL (B). For Alamar blue, cells were treated with human IAPP without (white) or with heparin (green, 4.1 IU/ml; purple, 41 IU/ml; blue, 410 IU/ml heparin) for 24 hours. For TUNEL, cells were treated with identical conditions but incubated for 16 hours.  Cells were incubated with synthetic human IAPP at 10, 20, or 40 M. Statistical analysis was performed by two-way ANOVA. * p < 0.05; ** p < 0.01.      97  To better delineate the effects of heparin on IAPP-induced toxicity in INS-1 cells, we performed a time course of toxicity according to the method of Bucciantini et al (627) and Rigacci et al (628). The experimental setup is illustrated in Figure 19 and described in the Methods section of this chapter. Essentially, IAPP was solubilized in cell media and at various time points following solubilization, aliquots were removed and assessed for amyloid load by thioflavin T fluorescence or added to INS-1 cells to determine the effect on cellular viability 9 hours following addition of a given aliquot. It should be noted that in this experiment, in contrast to section 4.3.1, kinetics of IAPP aggregation were assessed in cell media as opposed to Tris buffer. Cell viability was assessed at each time point by alamarBlue® fluorescence.   98   Figure 19. Experimental design to assess the onset of heparin-potentiated IAPP toxicity relative to fibril formation. The experimental design allowed comparison of the aggregation state of IAPP, as indicated by thioflavin fluorescence, with toxicity at a given time point. Aliquots were added to wells containing INS-1 cells at ~75% confluence. Heparin concentrations were 41 and 410 IU/ml.     99  The effects of heparin on IAPP fibrillization in cell media (Figure 20A) are similar to the effects in Tris buffer until the plateau phase (Figure 16). The two concentrations of heparin (41 IU/ml, 410 IU/ml) had nearly identical effects on IAPP fibrillization. Heparin (410 IU/ml) significantly decreased the lag phase relative to 40 M hIAPP alone (control, 2.23 ± 0.07 hours; heparin 0.48 ± 0.08 hours; p < 0.0001). There was no significant difference in slope, although heparin tended to make the slope steeper (control, 0.25 ± 0.11; heparin 41 IU/ml 0.66 ± 0.22; heparin 410 IU/ml 0.72 ± 0.16, p = 0.18). Curves reached a smooth plateau that, unlike fibrillization in Tris buffer, did not reach maximal fluorescence immediately and from which fluorescence did not decline over time. A final maximal fluorescence was observed by 6 hours following solubilization, at which time fluorescence yield in the presence of heparin tended to be greater than with IAPP alone, although this was not significant (control: 0.69 ± 0.08; 41 IU/ml heparin: 1.61 ± 0.42; 410 IU/ml heparin: 1.60 ± 0.24, p = ns).  The effects of heparin on cell toxicity were immediate (Figure 20B), prior to fibril formation as assessed by thioflavin T fluorescence (Figure 20A). In wells treated immediately following IAPP solubilization, heparin significantly increased toxicity at both concentrations (control, 83.6 ± 7.5% control viability; 41 IU/ml heparin, 45.4 ± 1.4%; 410 IU/ml heparin, 43.4 ± 0.8%; p<0.01). The same trend persisted even as heparin promoted the rapid upstroke of fibril formation over the first hour. By 2 hours following IAPP solubilization, there was no significant difference between any of the groups consistent with the heparin-IAPP thioflavin curves reaching a steady- state plateau (p = 0.30). By 6 hours post-solubilization, heparin-treated IAPP was significantly less toxic than IAPP alone (control, 85.1 ± 5.4%; 41 IU/ml heparin, 109.4 ± 1.2%, p< 0.01 compared to control; 410 IU/ml heparin, 101.4 ± 1.4%, p < 0.05 compared to control).         100   Figure 20. Heparin accelerates the onset and disappearance of IAPP toxicity. The effect of heparin on human IAPP fibril formation and associated toxicity was investigated as described in the experimental design shown in Figure 19. Fibril formation was monitored by thioflavin T fluorescence (A). Aliquots were removed immediately following solubilization of IAPP in cell media and addition of heparin. Aliquots were incubated with 10 mM thioflavin T at 37 o C to monitor fibril formation. Toxicity to INS-1 cells was monitored by alamarBlue® reduction assay (B). Cell media was replaced with fresh media containing 10% alamarBlue® at 9 hours following incubation with IAPP and alamarBlue® fluorescence measured 4 hours later. IAPP (40 M) was incubated without (black) or with heparin (purple: 41 IU/ml; blue: 410 IU/ml). 101  4.3.3 Heparin promotes islet amyloid deposition in cultured human islets To determine the effects of heparin on IAPP deposition in human islets, we cultured human islets in 11.1 mM glucose with or without heparin (41 IU/ml and 410 IU/ml; Figure 21). After two weeks, islets were fixed and prepared for histology. The proportion of islet area staining for amyloid was significantly increased in heparin-pretreated islets (control, 0.17 ± 0.03%, heparin 410 IU/ml, 0.52 ± 0.11%; p <0.05). The proportion of islets containing amyloid, or amyloid prevalence, was significantly increased by both concentrations of heparin (control, 45.6 ± 4.6%; heparin 41 IU/ml, 65.0 ± 4.4%, p<0.05; heparin 410 IU/ml, 70.1 ± 4.5%=;, p<0.01).       102   Figure 21. Heparin enhances amyloid deposition in cultured human islets. Representative islets are shown in (A). Islets were immunostained for insulin (red) and stained for amyloid with thioflavin S (cyan). Islet amyloid load, or the proportion of an individual islet staining positive for amyloid, without (white) or with heparin (purple: 41 IU/ml; blue: 410 IU/ml) is shown in (B). Amyloid prevalence , or the proportion of total islets staining positively for amyloid, is shown in (C). Data represent the mean of 15 islet culture experiments. *p<0.05; ** p< 0.01. Space bar = 100 m.      103  To confirm heparin-induced amyloid deposition in cultured islets by a non-histological method, we sought to adapt an assay developed for the detection of amyloid  deposits in insoluble deposits in the brains of Alzheimer’s disease (632). The underlying principle of the assay is that amyloid fibrils are insoluble but may be solubilized in formic acid. We treated human islets in parallel with islet culture experiments performed for histology (Figure 22) under identical conditions. After 2 weeks of culture, islets were washed and subjected to a NP40 lysis procedure. Islets were ultracentrifuged to separate soluble and insoluble (containing amyloid and IAPP aggregates) fractions. Following ultracentrifugation, the insoluble pellet was solubilized in formic acid and sonicated; it was subsequently neutralized and diluted. We determined levels of IAPP in the insoluble fraction by ELISA. Levels of IAPP were normalized to total protein in both the soluble and insoluble fractions. Amyloid load determined from this assay significantly correlated with that evaluated by thioflavin S (p < 0.01; Figure 22B), validating this assay. As shown in Figure 22C, heparin did not significantly increase IAPP deposition into the insoluble fraction (p = ns); however, a trend towards heparin-promoting amyloid deposition into the insoluble fraction was observed.                  104   Figure 22.Heparin enhances amyloid deposition in cultured human islets as assessed by an ELISA-based assay. The assay is outlined in (A).  We validated this assay by comparison to matched histological (thioflavin S) analysis. Islets from 10 human donors were cultured in quadruplicate. Following 2 weeks of culture, islets were fixed for histology (duplicate per condition) or processed according to the assay outlined in (A) (duplicate per condition) and linear regression performed. IAPP content (fmol IAPP/ g total protein) is shown for human islets (n=12 donors) cultured in 11.1 mM glucose alone or with heparin (41 IU/ml, purple; 410 IU/ml, blue) for 2 weeks (C). No statistical significance was determined amongst groups, although there tended to be a difference between untreated and heparin (410 IU/ml)-treated islets. 105   4.3.4. Effect of heparin on apoptosis in cultured human islets To determine the effect of heparin on apoptosis in cultured islets, we quantified apoptosis by histological analysis using two markers, TUNEL and cleaved caspase-3 (Figure 23). Surprisingly, despite increasing islet amyloid formation, heparin protected against islet cell apoptosis in a concentration-dependent manner, as assessed by both markers. Heparin (410 IU/ml) significantly decreased apoptosis compared to control islets as assessed by both TUNEL (control, 14.5  ± 1.5% versus heparin 410 IU/ml, 8.1 ± 2.0% TUNEL positive nuclei, p<0.05) and cleaved caspase-3 (control, 10.2  ± 1.6% versus heparin 410 IU/ml, 6.6 ± 1.2% cleaved caspase-positive islet area, p<0.05). To further investigate the anti-apoptotic effects of heparin, we assessed its protective effects in INS-1 cells exposed to various pro-apoptotic stimuli (Figure 24). Heparin (410 IU/ml) significantly protected against thapsigargin- (p < 0.05) and brefeldin A-induced apoptosis (p = 0.001), but had no effect on staurosporine- or etoposide-induced apoptosis. Heparin (41 IU/ml) protected against brefeldin-induced apoptosis (p < 0.05).                    106   Figure 23. Heparin abrogates IAPP toxicity in cultured human islets as assessed by TUNEL and cleaved caspase-3 immunohistochemistry. Representative islets stained for DAPI (blue) and TUNEL (red) are shown for (A) untreated and heparin-treated (B: 41 IU/ml; C: 410 IU/ml) conditions. * p<0.05 as determined by one-way ANOVA followed by Neuman-Keuls post-hoc test. Clc3, cleaved caspase-3.  Scale bar = 100 m.  107   Figure 24. Heparin protects against apoptosis in INS-1  cells. Cells were treated for 18 hours without heparin or with heparin (41 IU/ml, blue; 410 IU/ml heparin, purple) in the presence of pro-apoptotic stimuli: thapsigargin (0.1 M, A), etoposide (0.5 mM, B), brefeldin A (10 M, C) and staurosporine (1 M, D). Each condition was performed in triplicate. Viability was assessed by Alamar Blue fluorescence assay. *, p<0.05, ** p < 0.01.  4.3.5 Functional evaluation of the effects of heparin pre-treatment on human islets in a transplantation model To evaluate the function of human islets after culture with or without heparin, we transplanted islets into STZ-diabetic, immunodeficient (NOD.scid) mice (633-636). In vivo dosing with heparin for an extended period of time was not feasible due to the heightened risk of bleeding and likelihood of morbidity in mice. Therefore, we pre-cultured human islets in 11.1 mM glucose for 1 week prior to transplantation. The experimental model is illustrated in Figure 25. Islets were treated with or without heparin (410 IU/ml). Due to limited human islet availability and the limited number of transplantations that could be performed on a given day, we chose to 108  use a single concentration of heparin. We chose the higher concentration of heparin employed in our previous studies for maximal effect of heparin on amyloid formation. Islets treated in parallel were fixed after 1 week of transplantation to evaluate the effects of heparin on amyloid formation and apoptosis prior to transplantation. We transplanted a suboptimal number of islets per diabetic recipient (200 islets) so as to exacerbate metabolic stress on islets. Following transplantation, blood glucose was monitored daily in recipient mice for the first 2 weeks and every 2 days thereafter. Body weight was checked weekly. Graft normalization of blood glucose was defined as three consecutive blood glucose values <15 mM. Mice were sacrificed after 4 consecutive glucoses > 20 mM in the first 4 days, or after 2 consecutive blood glucoses > 20 mM thereafter. Experiment duration was thirty days so as to minimize the chance of recovery of endogenous cell mass following STZ treatment in diabetic recipients. Survival nephrectomy, in which the graft-containing kidney is removed, was performed on mice remaining normoglycemic after 30 days to confirm that this had not occurred. All mice became diabetic after survival nephrectomy, demonstrating that endogenous pancreatic  cells had not regenerated following STZ treatment.    109   Figure 25. Experimental design for islet transplantation experiments following pre- transplant culture with heparin. Human islets (n=4 human islet donors) were cultured for 7 days without heparin or with heparin (410 IU/ml) in 11.1 mM glucose. At the end of the islet culture period, islets were either fixed and processed for histology or transplanted into STZ-diabetic NOD.scid mice. Transplanted mice were sacrificed following 2 consecutive blood glucose values > 20 mM. If a recipient remained normoglycemic at 28 days following transplantation, the graft was removed by survival nephrectomy. Following survival nephrectomy, mice were sacrificed following 2 consecutive blood glucose values > 20 mM.  We performed pre-transplant analysis of islets fixed at the time of transplantation (Figure 26A). At this time, heparin tended to increase thioflavin S-positive area and amyloid prevalence but this was not statistically significant. Apoptosis at time of transplantation was assessed by TUNEL and cleaved caspase-3 staining. There was no significant change in apoptosis induced by heparin treatment when assessed by TUNEL or cleaved caspase-3 (Figures 26B and C).   110   Figure 26. Histology of human islets after 1 week in culture in the presence of heparin. Islets from 4 human donors were cultured for 1 week without or with heparin (410 IU/ml) in 11.1 mM glucose and then transplanted or fixed for histological assessment of amyloid and apoptosis. Amyloid was quantified with thioflavin S (ThioS) staining (A); apoptosis was assessed by TUNEL (B) and cleaved caspase-3 staining (C). No significant differences were found , although amyloid area tended to be higher and apoptosis tended to be lower in heparin-treated islets. ClC3, cleaved- caspase-3.                 111  Following transplantation, the proportion of recipients of heparin pre-treated islets in which blood glucose was normalized was significantly lower than recipients of untreated islets (untreated, 18.8 ± 12.0% versus heparin pre-treated, 64.5 ± 14.6%, p<0.05; Figure 27).   Figure 27. Pre-transplant culture of human islets in heparin promotes graft failure. Two hundred human islets per well were cultured for 1 week prior to transplantation without heparin or with heparin (410 IU/ml). After 1 week in culture, islets were transplanted into STZ- diabetic NOD.scid mice. The proportion of grafts which failed to normalize was significantly different between untreated (white) and heparin-pretreated (grey) human islets. Normal blood glucose was defined as three consecutive values <15 mM. Human islets were obtained from 4 human donors. This experiment was repeated with islets from 4 donors. *, p<0.05.           112  We retrieved grafts after 4 consecutive days of blood glucose > 20 mM immediately following transplantation, or thereafter following 2 consecutive days of glycemia > 20 mM, or at 30 days post-transplantation at the time of nephrectomy. Amyloid load within the graft tended to be increased in heparin pre-treated islets (control, 0.30 ± 0.13%; heparin pretreated, 0.64 ± 0.23%; p= ns; Figure 28A), although this was not statistically significant. We quantified cell apoptosis within the graft area by TUNEL and cleaved caspase-3 staining. There was no significant difference in the proportion of TUNEL-positive cells (Figure 4-28B) or in cleaved caspase-3 area within the grafts (Figure 28C) between the untreated and heparin-treated groups.   Figure 28. Graft histology following transplantation of human islets pre-cultured with heparin. Grafts were removed 4 weeks following transplantation  by survival nephrectomy or following two subsequent days on which random plasma glucose measured > 20  mM. Grafts were analyzed for amyloid load (A) and apoptosis by TUNEL (B) and cleaved caspase-3 (C). ThioS, thioflavin S; ClC3, cleaved caspase-3.  To replicate in an islet culture model what occurs within grafts following the removal of heparin we cultured human islets for 3 weeks in media alone, media containing heparin (410 IU/ml), or media containing heparin (410 IU/ml) for 1 week followed by 2 weeks in media alone (Figure 29). Apoptosis, as assessed by TUNEL, was significantly reduced in islets treated for 3 weeks with heparin as compared to control islets (control, 15.3 ± 2.6% versus 3 week heparin, 4.3 ± 0.8%; p=0.01). There was no difference between control islets and islets cultured for only 1 week in heparin, suggesting that short-term treatment of islets with heparin has an anti-apoptotic effect only while heparin is present and that this effect is not sustained following removal of heparin. 113    Figure 29. Removal of heparin following 1 week of culture does not affect amyloid formation but does increase islet cell apoptosis. To attempt to mimic preculture of islets in heparin and subsequent transplantation, human islets were cultured for 3 weeks without heparin, with heparin (410 IU/ml) for the first week only, or with heparin (410 IU/ml) for 3 weeks. Islets were fixed for histology. Analysis of (A)amyloid load (thioflavin S staining) and (B) TUNEL is shown. These experiments were repeated in 3 sets of human islets.  4.4 Discussion In this chapter, we examined the effects of heparin on islet amyloid fibrillogenicity and toxicity in several models. We showed that heparin promotes amyloid formation by synthetic human IAPP. Correspondingly, heparin also exacerbated IAPP toxicity to cultured cells. Furthermore, heparin accelerated both the onset and disappearance of toxicity. Heparin promoted amyloid deposition in cultured human islets and exposure to heparin promoted graft failure following transplantation.  Inhibition of IBMIR is critical to successful islet engraftment. IBMIR is thought to be an important cause of islet loss during the early post-transplantation period (149), during which time up to 75% of transplanted islets are lost (254). Strategies proposed to prevent IBMIR include transplantation of freshly isolated islets (245), islet surface modification (637), depletion of platelets prior to transplantation, and treatment with Resolvin E1 (638), thrombomodulin (156), melgatran (149), active-site inactivated FVIIa (149), nicotinamide (639), activated protein C (640), tyroban (640), or anti-TF antibodies (148). Heparin is the currently employed 114  pharmaceutical agent to minimize IBMIR. It has been shown to be protective in animal models (641). Indeed, heparin may have direct anti-apoptotic (642, 643) and anti-inflammatory (644) effects on cells in addition to its anti-coagulant properties. Heparin (153, 311) or its low molecular weight analogue, enoxaparin (252, 311), has been administered up to 7 days following islet transplantation to minimize the risk of portal vein thrombosis, which may lead to areas of focal ischemia (285) and necrosis in the liver (254). In human islet transplant recipients, the infusion of heparin and insulin during the peri-transplant period promotes insulin independence (311), although the authors did not consider the effects of heparin and insulin separately and the protective effect may thus have been mediated by insulin treatment. Furthermore, while the combined heparin-insulin infusion promoted islet function and prevented islet loss following transplantation, 80% of these grafts still failed by 2 years following islet transplantation. These grafts failed more slowly than untreated grafts, but this seems likely due to the substantially lower graft mass and rate of engraftment in untreated islets. A lower starting graft mass ultimately predisposes grafts to earlier dysfunction in the face of metabolic stress.  Heparin seeds amyloid formation of multiple pro-amyloidogenic proteins (613-618), including both proIAPP (561) and IAPP (611, 612, 619). We demonstrated that heparin decreases the lag phase of thioflavin T amyloid kinetic formation, which is likely due to acceleration of formation of prefibrillar structures. In buffer, the highest concentration of heparin promoted a slight but significant increase in thioflavin fluorescence during the lag phase, consistent with previous observations that thioflavin T fluorescence is slightly increased upon binding prefibrillar aggregates with -sheet structure (629-631). In support of this hypothesis, heparin promotes dimerization of amyloid precursor protein (645), the precursor to amyloid- , and has been proposed to promote formation of multimeric oligomers by light chain immunoglobulins (646). Heparin increased the slope of the rapid growth phase (12) of fibril formation. Heparin acts as a scaffold for amyloid formation (621, 646-648), by way of stabilizing -sheet structure (647, 649). The highly negatively charged sulphate groups of heparin promote  sheet formation within IAPP by interaction with the positively charged arginine at residue 11, as heparin promotes fibrillization of IAPP (11-37) but has no effect upon fibril formation of IAPP (12-37) (622).  115  In TEM images of IAPP incubated in the presence of heparin, heparin increased the final amyloid fibril load. Amyloid load tended to be increased in the presence of heparin as assessed by thioflavin T fluorescence when IAPP was dissolved in cell media, although significance was not reached. These findings are consistent with previously reported findings that heparin increased IAPP fibril density and fibril compaction (619). IAPP aggregation kinetics in Tris buffer do not support this conclusion due to a declining thioflavin fluorescence of IAPP in the presence of heparin following a maximal. When IAPP was dissolved in Tris buffer, heparin significantly increased the intensity of thioflavin fluorescence above that of hIAPP alone; however, after 2 hours, fluorescence did not differ between the groups. Interestingly, the same trend was observed for thioflavin kinetics of proIAPP in the presence of another glycosaminoglycan, dermatan sulphate (650). This phenomenon was not observed when thioflavin kinetics were performed in cell media. Furthermore, TEM data show an increase in fibril load that becomes increasingly dense over 24 hours. TEM has been demonstrated to be more reliable than thioflavin probes for assessing the fibrillar states of amyloidogenic proteins (580, 651). One possible explanation is that as fibril compaction occurs in the presence of heparin (619), thioflavin T is excluded from binding to  sheets of internally compacted fibrils. Given that this phenomenon was only observed in Tris buffer, fibril structure or density may differ somewhat in cell media. The increased final fibril load in the presence of heparin observed in TEM images and the trend towards increased thioflavin fluorescence in cell media are consistent with an effect of heparin to stimulate amyloid formation in islet culture. We demonstrated that heparin increases amyloid severity and prevalence in cultured human islets. As heparin enhances IAPP amyloid formation in human islets, it is important to consider the effects of heparin and enhanced amyloid deposition on transplanted islets.  Heparin has been reported to have no effect (617) or a protective effect (617, 652-656) on the toxicity of other amyloidogenic proteins. Enoxaparin, a low molecular weight heparin derivative, reduces plaques and  amyloid accumulation in a mouse model of Alzheimer’s disease (657). As described above, heparin also promotes fibrillogensis of these proteins. Since toxic pre-fibrillar species may mediate amyloid toxicity (96, 627, 658) rather than mature amyloid fibrils, rapid formation of amyloid in the presence of heparin may deplete cytotoxic prefibrillar species which otherwise would have mediated toxicity. Methylene blue (659) and ellagic acid (660) promote fibrillization of amyloid  and protect against amyloid-associated toxicity (660, 661). Methylene 116  blue also inhibits oligomer accumulation (659), consistent with depleting pre-fibrillar species by driving amyloid formation. We found that heparin strongly promoted IAPP toxicity in a cultured  cell line, in contrast to the effects of heparin on other amyloidogenic proteins.  Heparin dramatically promoted toxicity immediately following IAPP solubilization, in contrast to IAPP alone. The effects of heparin on toxicity occurred prior to fibrillization of IAPP, as monitored by thioflavin t kinetics, suggesting that heparin promotes IAPP toxicity by promoting the formation and stability of pre-fibrillar aggregates. Heparin-IAPP-mediated toxicity disappeared soon after thioflavin kinetics reached the steady state plateau at which point mature fibril meshworks are observed by electron microscopy. Consistent with the effects of ellagic acid on amyloid  (660), mature fibrils appeared not to promote amyloid-mediated toxicity. The rapid kinetics of IAPP cytotoxicity observed in the presence of heparin may be explained by the time course of IAPP aggregation, which is up to a hundred-fold faster than other amyloidogenic proteins. Rapid stabilization of prefibrillar species may allow these species to reach a threshold concentration for cytotoxicity, which is not reached upon slower aggregation. Alternately, heparin exacerbation of IAPP toxicity may be due to a particular structural interaction unique to these molecules.  The contrasting effect on IAPP cytotoxicity in the presence of heparin relative to other amyloidogenic species may be related to protein-specific interactions with heparin. Glycosaminoglycan (GAG)-interactions with amyloidogenic species depend on the spacing of negatively charged residues or the charge density of a specific GAG. For example, heparin and heparan sulphate interact with IAPP while the highly sulphated GAG chondroitin sulphate does not (487). Chondroitin does not promote amyloid formation by IAPP, does not exacerbate its toxicity, and is not found in amyloid plaques. Cells are protected against amyloid-  toxicity in the presence of heparin but amyloid-  toxicity is promoted in the presence of dextran sulphate, a GAG with a greater number of sulphate moieties per disaccharide (654). Interactions also depend upon primary sequence of the pro-amyloidogenic protein or peptide. We speculate the effects of heparin on IAPP toxicity are specific to its interactions with IAPP. IAPP species have also been proposed to exert their toxicity via death receptors (37). Cell surface levels of death receptors may vary between cell types or a subtype of receptor may be highly expressed in  cells relative to other cells. The structure of IAPP pre-fibrillar species may also be specific to interaction with 117  certain receptors such that the  sheet structure of other pro-amyloidogenic proteins would not stimulate receptor activity.  Surprisingly, we noted that heparin had a strong anti-apoptotic effect in human islet culture. This effect was noted after 2 weeks in culture but not following one week of culture. It is possible that heparin promotes an early wave of amyloid toxicity soon after its incubation with islets, as we measured apoptosis after 2 weeks in culture. In early islet culture, islets are more viable and likely secreting much more insulin and IAPP. Prolonged human islet culture induces pro- apoptotic signaling in islets and by two weeks,  cell replication is decreased and apoptosis increased (229). Furthermore, maintenance of human-derived  cell lines in culture leads to rapid de-differentiation and decreased insulin secretion (229). If IAPP secretion is greatly decreased by several weeks in culture, other direct (non-amyloid)-related effects of heparin may decrease islet cell apoptosis, masking any deleterious effects of IAPP.  A more likely explanation for the anti-apoptotic effects of heparin in human islets despite increased amyloid deposition is that the simultaneous activation of anti-apoptotic signaling counteracts the toxic effects of islet amyloid. This phenomenon has been demonstrated using exendin-4 in hIAPP Tg/0 islets; exendin-4 promoted extracellular amyloid deposition by increasing hIAPP release but protected against its toxicity by activating of anti-apoptotic AKT signaling (662). Stimulation of IAPP secretion by an alternate mechanism without anti-apoptotic properties leads to increased amyloid deposition and increased apoptosis within the islet (662). There are many reports of heparin’s anti-apoptotic (642, 643) and anti-inflammatory (311) properties in addition to its primary role as an anticoagulant. Indeed, we demonstrated a protective effect of heparin against several pro-apoptotic stimuli. One plausible mechanism underlying heparin anti- apoptotic signaling in cultured human islets is by activation of the epidermal growth factor (EGF) receptor (EGFR). EGRF signaling is critical to normal cell function (663-666). Heparin- binding EGF (HB-EGF), over-expressed in damaged or diseased epithelial tissues (423) and produced by the islet (664, 667, 668), can activate the EGFR in the presence of heparin (669) to promote anti-apoptotic signaling.  We used an in vivo transplantation model to evaluate the function of islets following culture with heparin. We did not treat graft recipients with heparin due to the risk of morbidity at doses of 118  heparin required to promote sufficient amyloid deposition to detect by thioflavin S fluorescence. This model was not designed to replicate perfectly conditions in human islet transplantation, but rather to determine the effects of heparin-induced amyloid formation on subsequent islet function. Short-term incubation of islets with heparin does, however, mimic peri-transplant exposure to heparin and heparin dosing up to 7 days following transplantation in human islet transplantation. We were limited by human islet availability, which restricted the number of transplant experiments that could be performed. Based upon these limitations, we opted to use the highest dose of heparin as it induced the greatest amount of amyloid deposition. Thioflavin S is relatively insensitive to amyloid formation relative to electron microscopy, but the latter cannot be reliably quantified over large areas. Amyloid formation was significantly greater in the presence of heparin by the end of two weeks culture, but was not significant by 1 week. This finding may be due to the relative insensitivity of thioflavin S and illustrates the limitations of performing amyloid quantification in tissue. Thioflavin S is a less sensitive means of detecting amyloid fibrils in tissue as compared to TEM, but whole islet amyloid quantification is not feasible by TEM. After 2 weeks in culture, heparin-treated islets have a significant increase in thioflavin S-positive amyloid; one week of culture likely does not promote sufficient amyloid deposition to achieve a significant difference using an insensitive probe. In the amyloid-beta field, many antibodies exist for the detection of various monomeric, prefibrillar, and fibrillar states of amyloid-beta; this is not the case for the IAPP, which is limited to thioflavin or Congo red dyes for histological amyloid quantification (12).  Following transplantation, islets pre-treated with heparin failed significantly faster than control islets. Prior to transplantation, heparin-treated islets had a four-fold increase in amyloid load as compared to untreated islets, although this trend was not statistically significant. Amyloid load in grafts also tended to be increased, although not significantly. As amyloid is toxic to  cells, the majority of amyloid-laden islets may have degenerated due to extensive  cell apoptosis following transplantation. As amyloid fibrils may stimulate innate immune reactions (40) and IAPP amyloid fibrils may be internalized by macrophages (670, 671), some amyloid may have been cleared by infiltrating macrophages following transplantation. Amyloid plaques may also have dis-aggregated following the removal of heparin (672). There was no significant difference in apoptosis within the graft between the untreated and heparin-treated groups. Because the rapid clearance of apoptotic cells are rapidly cleared by macrophages in vivo, the number of apoptotic 119  cells that can be counted in transplanted islets at any one time is very low, making it difficult to observed differences in islet cell apoptosis between groups.  Our islet transplantation studies suggest that heparin likely has an amyloid-related detrimental function on human islets in vivo. This finding is in agreement with our cell toxicity data that showed that heparin enhanced IAPP-mediated aggregation and toxicity, but not with our finding that the proportion of apoptotic cells was not different in heparin-treated islets following 2 weeks culture. Cell toxicity data using synthetic IAPP and beta cell lines should be interpreted cautiously, as supraphysiological concentrations of IAPP are likely used, beta cell lines are imperfect models of primary beta cells, and other in vivo components of amyloid plaques are not present. Toxicity may occur at lower IAPP concentrations and may involved different mechanisms in a physiological setting. The lack of apoptosis after 2 weeks in heparin-treated cultured islets may be unrelated to amyloid; it is conceivable that we missed an early wave of heparin-induced toxicity earlier in the islet culture period.  If heparin truly decreased toxicity while promoting amyloid deposition in cultured human islets, as seen with ellagic acid and amyloid  (660) or with exendin-4 and IAPP (662), several mechanisms may account for the progressive loss of graft function observed in transplanted islets following achievement of normoglycemia. First, heparin may deplete toxic oligomeric species, as it stimulates amyloid fibril formation. Removal of heparin would thus allow the formation of more toxic prefibrillar species in transplanted islets. Second, heparin may compete with native GAGs, namely heparan sulphate, for proIAPP or IAPP binding. Heparan sulphate is thought to interact with proIAPP to seed amyloid formation and toxicity of prefibrillar species in the vicinity of beta cells. The presence of heparin might competitively inhibit GAG binding to IAPP species or sequester IAPP into amyloid fibrils to decrease IAPP-mediated toxicity. Removal of heparin would remove this competitive inhibition. By either of these mechanisms, it could be argued that islet apoptosis would merely return to similar levels in the control islets. However, preincubation with heparin increases islet amyloid load. Heparin inhibits amyloid de- polymerization (672); the removal of heparin likely destabilizes plaques (672) to promote greater localized concentrations of toxic prefibrillar IAPP species in heparin-pretreated islets than in untreated islets. Finally, it is also conceivable that graft failure following heparin pre-treatment 120  may be related to loss of islet secretory function rather than beta cell apoptosis or alternatively due to the removal of the strong anti-apoptotic effect of heparin.  We conclude that due to its pro-amyloidogenic effects on IAPP, caution should be taken in the use of heparin in islet transplantation. While the results of this work certainly do not provide sufficient evidence to preclude its use, they provide evidence that pre-transplant exposure of human islets to heparin may seed amyloid formation, which may in turn have a detrimental effect on beta cell function and survival following transplantation. Alternate heparin-related compounds, such as dextran sulphate (334), are also effective in preventing IBMIR. Dextran, in particular, should be investigated for its pro-amyloidogenic effects on IAPP prior to use, as it promotes fibrillogenesis and toxicity of other pro-amyloidogenic proteins (654). Islet surface heparinization (149), currently in clinical trials for human islet transplantation, should also be subject to further studies prior to clinical implementation; the authors of this study showed viability and post-transplantation functional and survival data for heparin-treated rodent, but not human, islets. The authors also demonstrated that islet surfaces that became heparinised included the extensive fenestrated capillary network throughout the islet and mentioned that heparinization of arterial vessels led to subendothelial deposition of heparin (149), which might seed amyloid formation by IAPP. Acute suppression of IAPP amyloid formation (2, 594) or silencing of IAPP expression (3) may be effective strategies to minimize the effects of heparin employed according to current clinical protocols on IAPP fibrillogenesis and toxicity should models mimicking exact clinical conditions substantiate our findings. Should xenotransplantation become a clinical reality, transplantation of islets from species expressing non-amyloidogenic IAPP (466) might obviate this problem, as discussed in Chapter 5.              121  Chapter 5. Porcine IAPP is minimally fibrillogenic and porcine islet transplants have excellent long-term outcomes  5.1 Introduction Organ transplantation, on the whole, is highly successful. It improves quality of life, and, for many whole organ transplant recipients, prolongs survival when medical therapy has reached its limits. Islet transplantation has been shown in many studies to improve metabolic control (509, 673-675) and quality of life (550, 551, 673, 674, 676-679) in patients with long-standing or brittle type 1 diabetes. Islet transplantation decreases the frequency of hypoglycemic events (673, 678), which cause significant reduction in quality of life. It also slows the progression of the severe complications of diabetes, including retinopathy and renal disease (115, 680). Despite limited long-term maintenance of insulin independence (129), islet transplantation dramatically reduces insulin dose (128, 681) and slows the progression of microvascular complications (680). An economic analysis of islet transplantation showed it to be cost effective relative to standard medical therapy due to its effects on slowing complications (682).  A limiting factor in islet transplantation remains organ supply and quality. Organ supply is highly limited for most transplantation procedures (213). Supply is particularly limited for islet transplantation as organs are preferentially allocated to pancreas transplantation (145, 147, 683). Furthermore, to maintain long-term insulin independence, a single islet transplant recipient requires islets from multiple donors (684-686). Higher quality organs are allocated for whole pancreas transplants (145-147, 683, 687). A higher quality, more widely available source of islets would greatly increase islet transplantation availability and reduce the supply burden.  Xenotransplantation of pancreatic islets, using pigs or other animals as islet donors, has received increasing interest in recent years, given the limited number of human islets available for clinical transplantation. Pigs are ideal donors, as they may be easily replenished and have similar sized islets to humans. They also lack the degree of ethical constraints as animals kept as pets or of similar speciation to humans. Many properties of porcine islet support the use of pigs as donors in islet xenotransplantation. Neonatal porcine islets show particular promise, as they are easily isolated, are highly resistant to hypoxia and hyperglycemia (688, 689), and have shown remarkable ability to expand their cell mass following transplantation (690). Notably, porcine islets have been shown to maintain long-term function following intraportal transplantation into 122  non-human primates with production of detectable porcine C-peptide and restoration of normoglycemia (691-695). In a limited number of case reports, xenotransplantation of porcine islets into diabetic humans has improved glycemic control (696).  Given that expression of the pro-amyloidogenic human IAPP is detrimental to graft function and survival (466, 490), it is critical to consider the amyloidogenic potential of porcine IAPP prior to clinical trials for porcine islet transplantation. There is wide variation amongst species in the fibrillogenicity of IAPP (453, 697-704). The region of human IAPP containing residues 20 through 29 is a key determinant of its ability to form amyloid (705). Human (699) and primate IAPP (701, 703) form amyloid fibrils, are cytotoxic, and form islet amyloid deposits in type 2 diabetes pathogenesis (699).The various forms of rodent IAPP (mouse (704), rat (699), and hamster (698)), unlike human IAPP, do not form amyloid fibrils (698) or pre-fibrillar aggregates (706, 707), and are not cytotoxic (33, 469, 708, 709). The critical difference between human and rodent IAPP is the presence of three proline substitutions at residues 25, 28, and 29 within the mature peptide. Proline is well known to disrupt β-structure and is not compatible with the cross β-structure of amyloid. Cat IAPP incorporates the GAILS sequence although it has a single proline substitution within the 20-29 region; cat IAPP forms amyloid deposits consistent with the development of type 2 diabetes in cats (699). Dog IAPP also contains the GAILS sequence but only forms amyloid fibrils associated with the rare occurrence of canine insulinomas (700). Additional variations amongst species in amino acids 8-20 and 30-37 likely also affect the amyloidogenicity of different species’ forms of IAPP (460, 462, 463, 710). The full sequence of porcine IAPP has not been determined. In this study, we characterized the sequence of mature porcine IAPP (1-37) and examined its fibrillogenicity, cytotoxicity, and whether it formed amyloid in transplanted islets.  5.2. Results 5.2.1. Detection of porcine IAPP in neonatal porcine islets IAPP immunoreactivity has been reported in fetal and adult porcine  cells (711). To confirm the presence of mature IAPP in porcine islets, we performed western blots with neonatal porcine islet lysates (Figure 30). INS-1 cell lysate was used as a positive control. Porcine IAPP had relatively weak affinity for the primary antibody to IAPP (#7323) used for detection. 123  Nevertheless, we detected both proIAPP and mature (1-37) IAPP in neonatal porcine islet lysates. This result confirmed that mature porcine IAPP was present in porcine islets.  Figure 30. Proislet amyloid polypeptide and mature islet amyloid polypeptide are detectable in lysates of neonatal porcine islets. IAPP immunoreactivity in lysates from control INS-1 cells and neonatal porcine islets was detected by western blot on a tris-tricine gel. ProIAPP (8.2 kDa), intermediate proIAPP (6.0 kDa) and mature IAPP (3.7 kDa) were detectable in control INS-1 cells. ProIAPP and mature IAPP were also detectable in neonatal porcine islet lysate.  5.2.2. Determination of the sequence of porcine (1-37) IAPP To determine whether differences in the primary structure of the porcine polypeptide might explain the lack of amyloid formation in transplanted pig islets, we cloned and sequenced a porcine IAPP cDNA reverse transcribed using primers based on an EST sequence (BF712755) for porcine hypothalamus and RNA extracted from neonatal porcine islets. The sequence of mature porcine IAPP predicts a 37 amino-acid peptide (Figure 31) that is well-conserved in the N- and C-terminal regions of the molecule, but has unique amino acid differences in the mid- portion. The predicted sequence matches partial sequences (3-34) that are deposited in SwissProt (Q29119) and GenBank (AAB05919.1). Comparison of the porcine and human sequences reveal amino acid differences in ten positions, five of which reside within the 20-29 region thought to be critical for amyloid formation. Noteworthy differences include the substitution of a positively charged arginine at position 20 and a proline at position 29. Overall, porcine IAPP contains six residues that are potentially charged at neutral pH while human IAPP contains only three. These sequence differences are predicted to reduce the ability of the peptide to form amyloid as they 124  increase the net charge and reduce the net hydrophobicity (712), raising the question as to whether porcine IAPP is capable of forming amyloid.   Figure 31. Primary sequence of human and porcine islet amyloid polypeptide. Human IAPP (hIAPP) sequence (A). Porcine IAPP (pIAPP) sequence (B). All peptides have an amidated C-terminus and free N-terminus with a Cys-2 to Cys-7 disulfide-bridge.  Residues are numbered according to their position in mature IAPP. Residues differing from the human sequence are indicated in bold.  5.2.3. Porcine IAPP is minimally fibrillogenic We investigated the ability of porcine IAPP to aggregate relative to human and rat IAPP. Thioflavin T binds amyloid fibrils formed by aggregation of IAPP and is a useful probe to assess the time course of IAPP aggregation (12). The experimental curve observed for human IAPP aggregation displayed the characteristic features expected for kinetics of amyloid formation (Figure 32A). Following solubilization, human IAPP exhibited a short lag phase in which no significant change in thioflavin T fluorescence was detected, followed by a rapid rise in fluorescence leading to a plateau phase, as previously described in Chapter 4. No change above baseline fluorescence was observed for rat IAPP or porcine IAPP (both 20 M) over 14 hours. By this method, we concluded that porcine IAPP did not form amyloid fibrils, even at the supraphysiological concentrations tested.  Amyloid fibrils are rich in -sheet structure and therefore UV circular dichroism (CD) offers another convenient probe of amyloid formation. CD spectra taken of aliquots removed at the end of thioflavin T kinetic studies confirm that human and porcine IAPP have very different tendencies to form -sheet structure (Figures 32B and C, respectively). The CD spectrum of human IAPP exhibits a strong minimum at 218 nm, a band associated with -structure that is typical of the CD spectrum of IAPP-derived amyloid. In contrast, the CD spectrum of porcine IAPP displays a wide band ranging from 208 to 222 nm, indicative of a mixture of helical, 125  random and -sheet structures. CD spectra were recorded on independently prepared samples of porcine IAPP on different days and similar results obtained.  Neither CD nor thioflavin T fluorescence provides direct information about the morphology of any aggregates formed. Consequently, transmission electron microscopy (TEM) was used to image the reaction products. TEM micrographs of human IAPP revealed dense clusters of rod- like fibrils with classic amyloid morphology (Figure 32B). These images are typical of those previously reported for human IAPP under similar conditions (460). A few long fibril-like structures were observed after incubation of 32 µM porcine IAPP for 24 h, but these fibrils were much fewer in number and appeared dispersed among a mat of smaller amorphous aggregates. Three independently prepared samples of porcine IAPP were imaged and similar TEMs obtained each time. The images displayed in Figure 32C confirm that porcine IAPP is significantly less amyloidogenic than its human counterpart.                126   Figure 32. Porcine islet amyloid polypeptide is less fibrillogenic than human islet amyloid polypeptide. Thioflavin T kinetics at 37 o C are shown for human, rat and porcine IAPP (all 20 M) (A). Data are the mean of three replicates. Transmission electron micrographs are shown for human IAPP (B) and porcine IAPP (C). After 24 hours of incubation, human IAPP samples appear as dense mattes of intertwined amyloid fibrils with the classic linear and unbranched morphology. Porcine IAPP samples incubated for the same length of time show the presence of a few fibrillar strands among a bed of amorphous aggregates. TEM samples were incubated at pH 7.4 in 2% HFIP and 25 o C and peptide concentration was 32 µM. Scale bars represent 100 nm.  Far UV CD spectra of human and porcine IAPP is shown in (D).  Conformational analysis of human (black circles) and porcine (white circles) IAPP after 12 hour incubation indicates that porcine IAPP has significantly less -sheet propensity than the human peptide. Human IAPP adopts a classic - sheet conformation signified by a signal minima at 218 nm and positive ellipticity below 200 nm while porcine IAPP shows a wide band ranging from 208 to 222 nm, indicative of a mixture of helical and -sheet structures. All reactions were monitored at pH 7.4 in 2% HFIP and 25 o C. Peptide concentration was 32 µM. Spectra are the mean of 3 repeats. 127  5.2.4. Differences in primary sequence of porcine and human IAPP explain species differences in IAPP cytotoxicity Given that synthetic porcine IAPP is much less amyloidogenic than human IAPP, we predicted that it would also be less toxic. The effect of porcine IAPP on  cell toxicity was next assessed in transformed (INS-1)  cells by Alamar blue reduction (Figure 33B). As expected, addition of human IAPP (40 M) substantially reduced INS-1 cell viability after 24 hours (12 ± 5% viability) and further increases in IAPP concentration virtually eliminated any viable cells. In contrast, at the same concentration of porcine IAPP, INS-1 cell viability was significantly greater (93 ± 2%, p < 0.001). To confirm the reduced toxicity of porcine compared to human IAPP, we assessed the induction of apoptosis in INS-1 cells by TUNEL staining after 16 hours of incubation of cells with either peptide (Figure 33A). In the presence of 40 M human IAPP, the proportion of apoptotic  cells was 44 ± 10% compared to only 6 ± 1% (p < 0.001) following incubation in the presence of porcine IAPP. Even in the presence of a higher concentration of IAPP (100 M), the proportion of TUNEL-positive  cells was still much higher when cells were exposed to human (90 ± 5%) compared to porcine IAPP (14 ± 3%; p< .001). We confirmed these results with porcine IAPP synthesized by two independent sources. Thus, porcine IAPP is much less fibrillogenic and cytotoxic than its human counterpart.   Figure 33. Porcine islet amyloid polypeptide is less cytotoxic than human islet amyloid polypeptide. TUNEL staining following 16 hours incubation of INS-1 cells in presence of human or porcine IAPP (A). *Denotes statistically significant difference from porcine IAPP-treated cells (p<0.05). Alamar blue viability assay following 24 hours incubation of INS-1  cells in presence of human 128  or porcine IAPP (B). The EC50 for human IAPP was 27 µM compared to 172 µM for porcine IAPP (p<0.05). Solid line: human IAPP; dashed line: porcine IAPP.  5.2.5. Porcine islet grafts do not develop amyloid deposits Islet amyloid forms rapidly in human islets transplanted into immune-deficient, diabetic murine recipients (14). In a previous chapter, we characterized an association between amyloid deposition and graft failure. We sought to confirm the minimal fibrillogenicity of porcine IAPP and the lack of cytotoxicity with lack of graft failure upon transplantation into diabetic, immune- deficient mice. Adult porcine grafts maintained normoglycemia for up to 195 days post- transplantation, with the exception of one recipient out of six studied (Table 2). This recipient was borderline diabetic at 34 days post-transplantation and never achieved normoglycemia. Neonatal porcine islet grafts were unable to correct diabetes immediately after transplantation but eventually established and maintained euglycemia as transplanted  cells were supplemented by the generation of new  cells within the graft (690) (Table 3). Upon restoration of normoglycemia, neonatal porcine islet grafts consistently maintained glycemic control until time of sacrifice between 4 weeks and 3 months post-transplantation. Transplanted neonatal (n = 10) and adult (n = 6) porcine islets failed to stain positively for the presence of detectable amyloid by thioflavin S even after 12 weeks post-transplantation (Figures 34C and D). Islet amyloid was also not detected in adult porcine pancreas (Figure 34E). Native and transplanted human islets containing thioflavin S-positive amyloid deposits are shown for comparison in Figures 34A and B, respectively.           129   Figure 34. Lack of amyloid in native or transplanted porcine islets. Human islet (A). Human islet graft (B). Adult porcine islet (C).  Neonatal porcine islet graft (D). Adult porcine islet graft (E). Amyloid is detectable by thioflavin S (blue) stain in human but not adult porcine islets. Amyloid develops rapidly in transplanted human islets but is not found in transplanted neonatal or adult porcine islets. (Red immunostaining: insulin; scale bar = 50 µm).  Table 2. Blood glucose in murine recipients of adult porcine islet transplants. Experiment ID Following streptozotocin 2 weeks Post- transplantation 4 weeks Post- transplantation Final Mouse 1 25.6 13.7 14.2 12.2 (34 days) Mouse 2 22.7 9.8 7.2 5.3 (37 days) Mouse 3 19.4 5.7 5.6 4.8 (87 days) Mouse 4 21.5 6.6 4.5 7.7 (195 days) Mouse 5 21.4 6.2 3.7 4.0 (113 days) Mouse 6 24.0 4.2 4.2 4.2 (25 days)    130  Table 3. Blood glucose in murine recipients of neonatal porcine islet transplants. Experiment ID Following streptozotocin 2 weeks Post- transplantation 4 weeks Post- transplantation 8 weeks Post- transplantation 10 weeks Post- transplantation Mouse 1 28.6 25.1 17.1 5.8 5.6 Mouse 2 29.2 26.2 14.2 5.2 5.2 Mouse 3 27.4 24.1 13.1 5.8 5.6 Mouse 4 29.8 26.1 12.0 6.2 6.2 Mouse 5 26.1 25.1 11.1 5.7 6.1 Mouse 6 27.8 24.2 12.6 6.2 5.9 Mouse 7 26.1 22.1 9.9 6.0 5.6 Mouse 8 29.8 19.9 10.1 5.5 5.7 Mouse 9 29.2 23.1 9.8 6.1 5.8 Mouse 10 27.6 24.2 11.1 6.3 5.6  5.3. Discussion IAPP-derived amyloid deposits are hallmarks of islet pathology in type 2 diabetes. Whereas in type 2 diabetes islet amyloid formation takes months or years to develop, islet amyloid has been observed to form rapidly in cultured human islets (3), in human islets transplanted into diabetic murine recipients (552), and in islets from transgenic mice with  cell expression of human IAPP (490, 713). In addition, a recent case report described the presence of extensive amyloid formation in transplanted islets, engrafted into the liver obtained at autopsy of a diabetic subject (489). Taken together, these data support the hypothesis that amyloid deposition can play a significant role in reducing the viability of human islet grafts. Transplanted porcine islets, in contrast, formed no detectable amyloid following transplantation. Moreover, the sequence of porcine IAPP predicts a 37 amino acid peptide with substantial differences from human IAPP. Indeed, we found synthetic porcine IAPP to be much less fibrillogenic and less toxic to  cells than its human counterpart. These data are supported by a recent study with porcine IAPP fragments (714). We propose that the lower amyloidogenic potential and toxicity of porcine IAPP is likely to be a significant factor contributing to the better long-term survival and function of transplanted porcine islets in animal models, compared to human islets.  IAPP is found in the pancreatic  cells of most mammals; however, only those species in which an amyloidogenic sequence in the mid-portion of the IAPP molecule is conserved have a propensity to form toxic IAPP aggregates (715). Sequencing of the mature form of pig IAPP revealed that human and pig IAPP differ by 10 residues. Notably, porcine IAPP has a serine-for- proline substitution at residue 29, although feline IAPP, which is also amyloidogenic, also has a proline residue at position at 29. A notable difference between feline and porcine IAPP is that the 131  critical GAILS sequence is conserved in feline IAPP (699) while two substitutions in porcine IAPP alter this sequence to GTIFS. The A-to-T mutation replaces a hydrophobic amino acid with a polar amino acid. Amyloidogenic peptide sequences have a high proportion of hydrophobic residues (7). A 33% reduction in the hydrophobic resides thereby decreases the amyloidogenic potential of the sequence. The L-to-F substitution does not change the hydrophobicity of this residue but replaces a small side chain with the large aromatic side chain of tryptophan, and likely alters the amyloidogenic capacity of the sequence by steric effects. Other amino acid substitutions within porcine IAPP, including V17D, S20R and N31K, all of which involve the substitution of a neutral residue by a charged residue, are also likely to be important.  To consider evolutionary selection forces on the amyloidogenicity of IAPP, mammals that produce non-amyloidogenic forms of IAPP do not naturally develop type 2 diabetes (716). Although no papers specifically characterize the incidence of type 2 diabetes in rodents, transgenic over-expression, intensive pharmacological modulation, or selective inbreeding is required to generate models of type 2 diabetes; even so, these models may poorly mimic the extremes of the human disease phenotype. In the case of IAPP, development of transgenic models is especially difficult as rodent IAPP may inhibit amyloid formation by human IAPP (450, 464). A similar phenomenon has been observed for amyloid-  in rodent models, as rodents do not express a pro-amyloidogenic form amyloid- . The optimized mouse model for Alzheimer’s disease is a triple transgenic mouse (717), expressing human isoforms of 2 additional genes in addition to human amyloid . Humans, cats and primates all have pro- amyloidogenic IAPP sequences and develop type 2 diabetes (453, 699). The S20G mutation, which renders human IAPP more amyloidogenic and more toxic, is associated with earlier onset and increased severity of human type 2 diabetes (458, 459, 718). It is conceivable the underlying evolutionary driving force towards amyloidogenic IAPP in cats, humans and primates was adaptation towards improved stabilization of prohormones and increased processing efficiency in  cell secretory granules. This would be consistent with the presence of “functional” amyloid, formed by other endocrine hormones in the secretory pathway of their respective cells and possibly involved in prohormone trafficking (719). Nevertheless, the anti-amyloidogenic substitutions in porcine IAPP protect against its toxicity and may be associated with the lack of type 2 diabetes amongst pigs.  132  The lack of amyloidogenicity and toxicity of porcine IAPP support the use of pigs as islet xenograft donors. Given that the number of available islet donors is far exceeded by the number of type 1 diabetic patients who could benefit from islet transplantation (720), new sources of transplantable  cells are sorely needed. An ideal source of xeno-organs would have organs of similar size to humans, lack xenozoonosis, have low incidence of disease, and be easily bred. Moral acceptance by human organ transplant recipients is more easily obtained if this donor is not typically kept as a pet and is not phylogentically similar to humans, such as the non-human primate. The pig is a mid-size animal, breeds before 1 year of age, and has a typical lifespan of 15 years. Pigs are rarely kept as pets. They are most commonly bred as a meat source and widely consumed, thus large-scale breeding and housing protocols are established and it seems likely that the public would be more accepting of their use as organ donors. Pigs are currently used as a source of heart valves for human cardiac valve replacement surgery and there is minimal public concern in this regard.  Porcine islets are particularly appealing for islet transplantation as they may have superior functional characteristics to human islets. Neonatal porcine islets show particular promise for organ donation, as they are easily isolated, are highly resistant to hypoxia and hyperglycemia (688, 689), and have shown remarkable ability to expand their  cell mass following transplantation (690). Porcine islets are resistant to human autoimmunity against  cells (721). Furthermore, with the advent of transgenic pigs, donors may be bred to optimize  cell resistance to diabetes and metabolic stress (721). Pig islets function well in xenotransplantation models. Neonatal porcine islets have been shown to maintain normoglycemia in immune-deficient murine recipients for more than 100 days, with no spontaneous failure (722), and similarly adult pig islet autografts were recently found to function for up to two years (208). Recent studies confirm long-term glycemic normalization of neonatal porcine islets transplanted into swine (723) and primate models (724). Our findings are in keeping with two previous reports that also did not observe evidence of fibrils or islet amyloid in adult porcine pancreas or transplanted pig islets (208, 711). The current literature supports pigs as a model for islet transplantation.  Despite its promise of widespread organ availability and a source of islets resistant to hypoxia and other sources of injury, caution should be taken in the implementation of xenotransplantation into humans. Alarmingly, 75% of current xenotransplantation treatments in humans are 133  performed in countries which do not regulate xenotransplantation (725). Early promising studies in the transplantation of porcine islets were performed in children in Mexico (726, 727) without the approval and regulation by a clinical ethics panel (728, 729). Such work in humans, particularly in vulnerable populations such as children, defies rigorous scientific ethics established in the Nuremburg trials (730) to prevent recurrence of highly unethical studies by Mengele (731-733) in Nazi Germany. There are considerable risks involved with xenotransplantation of organs into humans. Xeno-organs stimulate a stronger immune response than human allogeneic transplants (734, 735). Human recipients may require stronger immunosuppression and might develop autoantibodies preventing re-transplantation. Hyperacute rejection of porcine tissues in humans is attributed to α-1,3-galactosyl epitopes on the surface of porcine cells; as humans lack α-1,3-galactosyltransferase, such epitopes trigger a humoral response (736). Hyperacute rejection of organs from α-1,3-galactosyl knock-out pigs is considerably reduced. Interestingly, these animals also have improved glucose tolerance (737), suggesting that islet transplant recipients would be less prone to hyperglycemic episodes and that these islets would be more resilient in the face of hyperglycemia and insulin resistance. Furthermore, modified immunosuppressive regimens have been proposed to reduce episodes of hyperacute rejection (738, 739). Novel devices for immunoprotection (740-742) may also be considered for xenotransplantation. The advantages of such approaches include immune- mediated destruction of tissues if the capsule breaks.  Xenozoonosis is another important concern in the xenotransplantion of organs into humans (743- 746). Rigorous screening protocols (747-751) and the production of clean pig facilities (749, 752) would allow prevention of the majority of known pig xenozoonoses. Porcine endogenous retrovirus (PERV) remains a challenge to overcome (721). Transmission of PERV to human cells would allow PERV integration into the human genome, potentially knocking out expression of critical genes or inactivating tumor suppressors. Several strategies (753-756), including selective breeding and the creation of PERV knockout pigs, have been proposed to eliminate the risk of PERV. A further limitation that remains, however, is that we may not have characterized all existing xenozoonoses and would need strategies to deal with unforeseen xenozoonosis in human recipients. One further concern is public opinion, although in several studies xenotransplantation was found to be ethically acceptable to most persons (757, 758). It should be noted that cardiac valves from bovine and porcine sources are routinely transplanted without significant public concern. Strategies have been proposed to the major challenges facing porcine 134  xenotransplantation but clinical trials should be undertaken with caution and careful consideration of the risks to recipients.                              135  Chapter 6. Role of CHOP in islet graft dysfunction  6.1. Introduction The success of islet transplantation depends upon the engrafted  cell mass. The Edmonton Protocol established that 10,000 islet equivalents per kilogram of body weight are required to attain insulin independence in a recipient (675). Islet isolation efficiency is limited, with a transplantable yield obtained in less than 50% of isolations (759). Engrafted islet mass is further reduced following transplantation. Up to 60% of islet mass is lost in the first week following transplantation (202), due to IBMIR (149), hypoxia prior to re-establishment of the islet vasculature (760, 761), immunosuppressant toxicity (172, 266, 360, 762-766), islet amyloid (490), and failure to engraft in a heterologous site of transplantation (761). Insulin resistance is elevated in human islet transplant recipients (376), which may be caused by immunosuppressive drugs (368). Excessive metabolic demand on remaining  cells enhances  cell susceptibility to oxidative and endoplasmic reticulum (ER) stress.  The  cell ER is highly developed and processes up to one million insulin molecules per minute. Transient activation of ER stress signaling upon accumulation of misfolded protein is tightly coupled to extracellular glucose concentration to modulate ER protein folding capacity in accordance with secretory demand (767, 768). Prolonged ER stress signaling due to increased metabolic demand is detrimental to  cell function. Prolonged activation of the unfolded protein response (UPR) leads to decreased insulin production and glucose-stimulated insulin secretion and activates apoptotic cascades (769, 770). Elevated production of insulin also increases cellular oxidative stress due to oxidation of its three disulfide bonds in the ER and increased demand for mitochondrial energy production for ER-dependent processes (771). The  cell is particularly susceptible to oxidative stress due to its low levels of antioxidants. CCAAT/enhancer binding homologous protein (CHOP) is a primary mediator of ER- and oxidative stress-induced apoptosis (381, 771-773) and is activated upon prolonged ER stress signaling. CHOP signalling may be additionally activated by cytokines, produced by local inflammation in the islet transplantation environment or by the  cell itself under conditions of metabolic stress (774). Deletion of CHOP enhances  cell function and mass in several models of  cell stress and type 2 diabetes (417). CHOP is elevated in transplanted islets in a syngeneic model in the first week following transplantation (775) and in models of whole organ transplantation (776). CHOP is an attractive 136  therapeutic target as it has no known critical physiological role in  cell function, unlike other upstream mediators.  6.2 Results 6.2.1. CHOP levels are increased in marginal mass grafts Chop mRNA is significantly elevated following islet transplantation in both normoglycemic and hyperglycemic grafts and tends to remain elevated throughout the first week post-transplantation (775). We investigated CHOP levels by immuno-histochemical staining. We determined that CHOP levels were significantly elevated in marginal grafts, despite glucose normalization at 4 weeks (Figure 35).  Figure 35. CHOP immunoreactivity is elevated in marginal mass mouse islet grafts. CHOP immuno-positive area was quantified within insulin-positive graft area in optimal (n = 3) and marginal (n = 14) syngeneic (Bl/6) mouse islet grafts. All recipients had normalized (<15 mM) blood glucose at 4 weeks following transplantation).  6.2.2. CHOP knockout islets are protected against thapsigargin-induced ER stress Mice with a disrupted CHOP gene (B6.129S-Ddit3tm1Dron/J) (772) are available from the Jackson Laboratories. We isolated islets from male CHOP -/-  mice and C57BL/6J controls, and following overnight culture incubated islets for 24 hours with the ER-stress inducer, thapsigarin  (0.01 to 1.0 M). CHOP immunoreactivity was significantly elevated in wild-type islets at all concentrations of thapsigargin (Figure 36). CHOP immunostaining was negligible in thapsigargin-treated CHOP -/-  islets, thus confirming the phenotype. CHOP gene inactivation 137  significantly protected  cells from thapsigargin-induced apoptosis as detected by TUNEL staining (Figure 36B).  Figure 36. CHOP -/-  islet cells are protected against apoptosis thapsigargin-induced apoptosis Islets were isolated from C57B/6 (white bars) or CHOP -/-  (gray bars) mice and incubated before 24 hour incubation in thapsigargin at the indicated concentrations. CHOP-positive area was normalized to insulin positive area of islets (%). TUNEL-positive nuclei within the insulin immunopositive area were quantified and normalized to insulin area of islets. * p<0.05 versus control; ** p < 0.01 versus control; # p  0.05 between groups; ## p<0.01 between groups.             138  6.2.3. CHOP knockout islets have improved insulin response to glucose We compared insulin content and glucose-stimulated insulin secretion between isolated CHOP -/- and wild-type islets (Figure 37). Islet insulin content (Figure 37A) did not differ between genotypes. In static incubation with high glucose (30 mM), CHOP -/-  islets secreted significantly more insulin (Figure 37B).  Figure 37. In vitro functional comparison of wild-type and CHOP -/-  islets. Islets were isolated from C57B/6 (white) or CHOP -/-  (grey) mice, cultured overnight and then incubated in KRB with either low (3 mM) or high (30 mM) glucose for 2 hours and then subjected to either KRB with 3 or 30 mM glucose for 1 hour. Islet insulin content in islet extracts after acetic acid lysis (n = 9) is shown in (A). Insulin content in KRB following 1 hour incubation in low or high glucose is shown in (B). Insulin was measured by ELISA. Error bars represent SEM. * p < 0.05.  6.2.4. CHOP -/-  islets restore and maintain normoglycemia following syngeneic transplantation To determine whether the CHOP -/- phenotype impacted glycemic normalization in optimal mass (150 islet) grafts, we compared the effectiveness of optimal islet mass grafts using islets from CHOP -/-  compared to C57BL/6J control donors. Islets were transplanted into syngeneic, STZ- diabetic recipients. Both types of grafts restored glycemic control following transplantation and maintained control for 4-5 weeks following transplantation (Figure 38). Similar preliminary results were obtained for 300 islet grafts (wild-type, n=1; CHOP -/- , n=2, data not shown), in which blood glucose values were restored to less than 7.0 mM at day 1 following transplantation. All recipients became diabetic following removal of the graft-bearing kidney, demonstrating that recovery of the STZ-treated pancreatic  cells did not occur. 139    Figure 38. Optimal mass syngeneic transplantation of wild-type and CHOP -/-  islets. Bl/6 recipient mice were treated with i.p. streptozotocin (230 mg/kg) to render them diabetic and 4 days later (day 0) transplanted with 150 islets. Glycemic control was restored by wild-type (black; n=14) and CHOP -/- (red; n=17) islets and maintained over 4-5 weeks post-transplantation. Non-fasted blood glucose was measured daily for the first week, three times in the second week, and weekly thereafter for three months following transplantation . All recipients became diabetic following removal of the graft-bearing kidney between 27 and 39 days post-transplantation.  6.2.5. Marginal mass CHOP -/- islet grafts restore glycemic control more rapidly To determine the effect of CHOP in the function of a marginal mass islet graft, we compared function of marginal mass islet transplants using islets from CHOP -/-  mice or C57BL/6J controls, grafted into syngeneic, STZ-diabetic recipients. Grafts of 75 islets overtly failed and grafts of 150 islets normalized rapidly, thus we chose 100 islets as a marginal mass graft. In this model, wild-type mice remained hyperglycemic for the first 1-2 weeks following transplantation and tended to normalize by three weeks post-transplantation. A comparison of mean glycemic values for wild-type and CHOP -/-  marginal mass grafts is shown in Figure 39A. Kaplan-Meier analysis of these data is shown in Figure 39B. For this analysis, we defined a recipient to no longer be diabetic after two consecutive blood glucose readings less than 15 mM. The median time to normalization for grafts containing 100 CHOP -/-  islets was 3 days, significantly less than the 12 days required for grafts using wild-type islets.  140  Islet grafts were removed by survival nephrectomy 4 weeks following transplantation, formalin- fixed, and processed for histology. So as to perform histological analysis at an earlier time point, we repeated marginal mass transplants and harvested the grafts at 10 days post-transplantation. Histological quantification of CHOP, replication (Ki-67) and apoptosis (TUNEL) in grafts at 10 and 28 days post-transplantation is shown in Figures 40A, B, and C, respectively. CHOP was elevated in wild-type grafts at 10 days relative to 28 days post-transplantation. There was no significant difference in replication between any groups, although there was a modest trend towards increased replication in both groups at 28 days’ post-transplantation. This finding is consistent with the finding that acute hyperglycemia stimulates  cell replication in vivo (777). At 10 days’ post-transplantation, apoptosis was significantly reduced in CHOP-/- islets as compared to wild-type islets (p < 0.01). There was no significant difference in apoptosis between groups at 28 days post-transplantation. Wild-type grafts, but not CHOP -/-  grafts, showed a significant elevation in apoptosis at 10 days post-transplantation relative to 28 days.                    141   Figure 39. CHOP -/-  islets restore glycemic control more rapidly than wild-type islets in marginal mass islet transplants. Recipient mice were treated with ip streptozotocin (230 mg/kg) and 4 days later,100 islets were transplanted (A). Mean glycemic values are shown for wild-type (black; n=14) and CHOP -/- (red; n =17). Removal of the graft-bearing kidneys was performed 4-5 weeks after transplantation. All recipients became diabetic following nephrectomy. *p < 0.05 by 2-way ANOVA with replication. Kaplan-Meier survival curve comparing groups (B). Diabetes was defined as blood glucose >15.0 mM. An animal was considered no longer diabetic after 2 consecutive blood glucose readings < 15.0 mM. *, p<0.05; i.p., intraperitoneal.  142   Figure 40. Histological analysis of replicating and apoptotic cells in marginal mass wild- type and CHOP -/-  islet transplants. A comparison of CHOP immunostaining at 10 days’ post-transplantation in wild-type and CHOP -/- grafts (A). Insulin immunoreactivity is shown in green, DAPI-staining of cell nuclei in blue, and CHOP immunoreactivity in red. The arrow demonstrates CHOP positive staining. Analysis of CHOP immunostaining  was performed on histological sections at 10 days (wild- type, white bars, n= 5; CHOP -/- , grey bars, n=6) and at 28 days post-transplantation (wiltdtype, n=14, CHOP -/- , n=17; B). Replicating cells were detected by Ki-67 immunostaining in (C). Apoptotic cells were quantified following TUNEL staining (D). Cells were measured within the insulin-positive area of the graft for each stain. * p<0.05; ** p<0.01. 143  6.2.6. Liposomal delivery of siRNA against CHOP is effective in improving marginal mass islet graft function We characterized several Stealth siRNA against rodent CHOP in INS-1 cells transfected using Lipofectamine RNAiMAX Transfection Reagent (Invitrogen). A representative western blot showing CHOP expression in INS-1 cells following transfection with two effective CHOP siRNAs is shown in Figure 41. ER stress was induced by thapsigargin treatment. A third siRNA (not shown) had moderate efficacy. In collaboration with Drs. P. Cullis and C. Tam, we optimized siRNA delivery into mouse islets using lipid nano-particles developed by the Cullis laboratory, as shown in Figure 42. Lipid nano-particle delivery was assessed using Cy5-labelled siRNA. Delivery was effective throughout the islet and fluorescent intensity within each islet increased relative to the lipid nano-particle concentration used. This delivery system delivered sufficient siRNA to mouse islets after 24 hour pre-incubation to protect against thapsigargin induction of CHOP (Figure 43). CHOP knockdown by lipid nano-particles was achieved in a concentration-dependent manner.  Figure 41. Lipofectamine-mediated delivery of CHOP siRNA suppresses CHOP expression and thapsigargin-induced activation of caspase 3. Thapsigargin (Tg) was used to stimulate CHOP induction. Western blot for cleaved caspase-3 demonstrates the absence of apoptotic signaling in the presence of CHOP knockdown.  144     Figure 42.Uptake of liposomes containing Cy3-labelled siRNA into mouse islets. Freshly isolated Bl/6 islets were incubated with liposomes for 24 hours. Z-stack images were taken of islets, from which a single slice is shown.   Figure 43. Lipid nano-particle delivery of CHOP siRNA suppresses thapsigargin-induced CHOP expression. Bl/6 murine islets were incubated with liposomes for 24 hours. Islets were then stimulated with 10  thapsigargin for 24 hours in the presence of liposomes containing either siRNA to CHOP (si-CHOP) or a scrambled siRNA (si-scramble).  To test this system in a transplantation model, we pre-incubated wild-type islets with lipid nano- particles (10 g/ml) containing siRNA against CHOP or a scramble siRNA control. Marginal mass islet transplants were performed into syngeneic, STZ-diabetic recipients. Islets treated with siRNA against CHOP restored normoglycemia (2 consecutive glucoses less than 15 mM) 145  significantly faster than did islets treated with scramble siRNA as assessed by Kaplan-Meier analysis (Figure 44). It should be noted that 3 mice in the scramble group remained persistently diabetic (> 25 mM), had to be sacrificed upon 5% loss of body weight or other signs of ill health in accordance with animal ethics, and were excluded from Kaplan-Meier analysis.. One mouse in the siCHOP group became persistently diabetic (> 20 mM for at least 2 consecutive readings) late in the experiment, also had to be sacrificed, and was excluded from Kaplan-Meier analysis. Based upon these data, ex-vivo lipid nano-particle delivery is effective in murine islets. Furthermore, we were able to replicate the phenotype of rapid glycemic normalization in CHOP - /-  marginal mass islet grafts by transfection of siRNA against CHOP into islets pre- transplantation.  Figure 44. CHOP siRNA enhances islet transplant function. Bl/6 islets were treated in culture with liposomes (10 g/ml) containing siRNA against CHOP (n=15) or a scrambled siRNA (n=10) for 12 hours prior to transplantation. Mice were sacrificed if their blood glucose remained >25 mM for 4 consecutive days in the first 4 days following transplantation, if blood glucose was >20 mM on two consecutive days afterward, or if they lost greater than 5% of their body weight. Prior to survival nephrectomy, 3 mice in the si-scramble group and one in the si-CHOP group were sacrificed for one of these reasons; these 4 mice were excluded from the Kaplan-Meier analysis. A mouse was considered non-diabetic following two consecutive blood glucose readings <15.0 mM.  146  6.3. Discussion In this chapter, we showed that CHOP levels are elevated in marginal mass syngeneic grafts, particularly in the early post-transplantation period prior to glycemic normalization. We confirmed that CHOP primarily mediates ER stress-signaled apoptosis in primary islets and showed that the absence of CHOP improves glucose-stimulated insulin secretion in isolated islets. We showed that islets lacking functional CHOP had more rapid glycemic normalization and reduced apoptosis in a syngeneic, marginal mass islet transplantation model. Furthermore, using a novel delivery system for efficient siRNA delivery, we reproduced these results in wild- type marginal mass grafts pre-treated ex-vivo with siRNA against CHOP.  Syngeneic marginal mass grafts are under considerable metabolic stress, demonstrated by elevated markers of oxidative stress and apoptosis, including CHOP (775). The islet is particularly vulnerable within the first two weeks of transplantation, as it recovers from the isolation procedure (236, 778) and islet culture (229), re-establishes its vascular supply (282), and is exposed to hyperglycemic (396, 775), hyperlipidemic (265), and pro-inflammatory (192, 638) environments. An additional stress in human allografts is exposure to diabetogenic immunosuppressive agents (355, 360) at elevated concentrations in the portal vein (267) prior to re-establishment of islet arterial blood supply. In human islets, IAPP may further promote oxidative (32) and ER stress (394, 484, 779). Each of these influences (91, 236, 361, 377, 396, 397, 401, 403) may exacerbate ER and oxidative stress in the metabolically stressed  cell, shifting the balance from homeostatic regulation to pro-apoptotic signaling.  An ideal target to modulate ER stress responses would be activated under pathological circumstances and not critical to physiological cellular function.  Furthermore, it should be downstream of both ER and oxidative stress pro-apoptotic signaling. Modulation of upstream UPR pathways interferes with signaling pathways critical to  cell function. For example, ablation of PERK signaling impairs insulin gene expression and protein secretion, in addition to impairing  cell proliferation, altering ER redox state (383, 391, 780), dysregulating synthesis of critical ER chaperones (660), and making cells particularly vulnerable to protein overload (383, 391, 780). Defective PERK signaling in human disease (Wolcott-Rallison disease) and mouse models (PERK -/- , eIF2 S51A ) leads to early-onset diabetes and reduced  cell mass (396, 419) 147  secondary to  cell apoptosis (396, 781).  cells in these models have dilated ER and a low density of secretory granules (419).  In contrast, excessive PERK activity attenuates global protein synthesis and also promotes  cell apoptosis (782). Sustained IRE1  signaling is detrimental to insulin production and glucose- stimulated insulin secretion (769), while IRE1  and xBP-1 knockout mice have embryonic lethal phenotypes (382). Modulation of the upstream UPR pathways may interfere with transient signaling that is critical to maintenance of  cell function, while prolonged activation will promote pro-apoptotic signaling.  An alternative therapeutic strategy to protect the metabolically-stressed  cell is to enhance its ability to withstand ER and oxidative stress. Anti-oxidant (181) treatment and over-expression of anti-oxidant enzymes (235, 783, 784) promotes graft function in islet transplantation. Such treatment by itself, however, is insufficient to protect against ER stress responses. A more feasible strategy to promote homeostasis in the midst of metabolic stress may be to increase the ER protein folding capacity independently of UPR signaling, for example using “chemical chaperones” such as 4-PBA and TUDCA. Each of these chaperones has been shown to have protective effects on  cell secretory function in the midst of ER stressors (397, 600). Simultaneous redox modulation and chaperone treatment could dampen both ER and oxidative stress. We found, however, that both chemical chaperones were highly toxic to islets (data not shown) at neutral pH and at reported concentrations (397, 600). We proposed that CHOP, as a pro-apoptotic downstream of ER and oxidative stress without a critical role in maintaining normal cell function, would thereby be an attractive therapeutic target for  cells under metabolic stress.  CHOP, otherwise known as DNA damage inducible transcript 3 (DDIT3), is a transcription factor belonging to the CCAAT/enhancer-binding protein (C/EBP) family (785). Each member of this family contains a bZIP involved in DNA recognition and a leucine zipper that is critical to homo- or heterodimerization. CHOP acts as a dominant negative inhibitor of C/EBP and LAP and inhibits their binding to their specific DNA enhancer elements (785). In addition to ER and oxidative stress, CHOP is activated by growth arrest in proliferating cells (785), amino acid deprivation, cytokine stimulation, and human IAPP (30, 394). CHOP is strongly pro-apoptotic 148  and may induce apoptosis by multiple mechanisms. CHOP promotes Ca 2+ -dependent apoptosis by transcriptional activation of proapoptotic genes (DR5, TRB3, BIM, Doc1, CA-VI; Doc4, Doc6) induction of reactive oxygen species, repression of the anti-apoptotic factor Bcl-2, translocation of Bax to mitochondria, by depleting cellular glutathione, and by decreasing intracellular pH (380, 382, 397, 419, 420).  As we confirmed, cells lacking active CHOP are protected against ER and oxidative stress- mediated apoptosis (381). We also discovered that CHOP may act as a negative regulator of insulin secretion under physiological conditions. We observed that in the absence of CHOP signaling, glucose-stimulated insulin secretion was enhanced. Additional evidence supports a negative regulatory role for CHOP. By interaction with C/EBP- , CHOP regulates expression of mitochondrial stress genes (786). The CHOP gene has a mitochondrial stress response element (787). CHOP interacts with a co-activator of insulin gene transcription, p300 (788), and may thus have effects on insulin gene transcription, although CHOP -/-  mouse islets did not show differences in insulin content. We suggested that an ideal therapeutic target would be pro- apoptotic, downstream of ER and oxidative stress signaling pathways, and would not be active under physiological conditions. While CHOP is typically only described as a pro-apoptotic signaling mediator, we have identified a potential minor physiological regulatory role in insulin secretion under in vitro conditions that warrants further mechanistic investigation. Nevertheless, inhibition of CHOP signaling did not appear to have a detrimental effect in an in vivo islet transplantation model.  CHOP is implicated in the development of diabetes and  cell dysfunction. In several mouse models of diabetes, CHOP deletion promotes  cell function and delays the onset and severity of the diabetic phenotype (417). A single nucleotide polymorphism (SNP) in the 5’UTR region upstream of CHOP predisposed an Italian cohort to the early development of diabetes (787, 789); this SNP prevents the binding of HOXA7, which may protect against the induction of apoptosis (790, 791), to the CHOP promoter. CHOP expression is elevated in human and murine models of type 2 diabetes (787). CHOP expression is also increased in the  cells of mice transgenic for human IAPP (30, 394), demonstrating an intracellular mechanism by which hIAPP may be cytotoxic. ER accumulation of an elevated load of misfolded proIAPP may promote  cell apoptosis by CHOP induction. It was, however, demonstrated that CHOP expression was not 149  induced in a different strain of transgenic hIAPP-expressing islets or in cultured human islets that developed amyloid deposits (468); thus CHOP induction in some hIAPP transgenic models may be a phenomenon simply associated with over-expression of a transgene in  cells. Over- expression of proteins in  cells, such as rodent IAPP (30), human IAPP (30), hIGRP (386), and MHCII (387), has been shown to trigger ER stress because of a high biosynthetic load. Nevertheless, intracellular deposits of IAPP fibrils have been visualized by TEM in human cells (624). IAPP species may perforate cell, and therefore organelle, membranes. ProIAPP species in the ER and IAPP fibrillar species in lysosomes could perforate these organelles to promote cytosol IAPP amyloid deposition. Implication of CHOP in human diabetes and evidence of protection against diabetes upon CHOP inactivation suggest that CHOP is a viable therapeutic target in diabetes as well as transplanted islets.  CHOP activity is stimulated when the  cell can no longer compensate to maintain homeostasis under elevated metabolic demand. CHOP is minimally active under non-stress conditions. Consistent with this, lack of CHOP activity is observed following an optimal mass transplant of human islets into diabetic murine recipients (792). In contrast, prolonged islet culture is detrimental to islet viability and promotes ER stress in human islets (229). CHOP is highly relevant in islet transplantation, a procedure in which considerable islet stress is induced. Isolation and transplantation procedures induce islet injury and apoptosis.  cell mass is significantly reduced by islet isolation yield, loss in islet culture, and loss following transplantation due to failure to engraft, hypoxia, or inflammatory or immune-mediated destruction. The  cell mass that does engraft is immediately exposed to a hyperglycemic environment. Immunosuppressive agents are diabetogenic and toxic to  cells; they may also increase metabolic demand on  cells by increasing peripheral insulin resistance. Adaptation to a non-ideal heterogenous site of transplantation and many detrimental factors in the local environment further promote  cell stress.  Modulation of CHOP could be introduced even prior to islet isolation to promote islet viability during warm and cold ischemic times. Inhibition of CHOP signaling in the immediate post- transplantation period should ideally preserve cell mass and thereby promote engraftment of a greater initial mass. The benefit of long-term inhibition of CHOP signaling is demonstrated by the remarkable improvement in  cell function and the expansion in mass under conditions of 150  cell stress (417). It is possible that long-term inhibition of CHOP signaling would increase  cell mass in transplantation, and this possibility warrants further investigation. The effects of CHOP inhibition on  cell survival could be synergistically enhanced by simultaneous inhibition of other pro-apoptotic signaling pathways activated by stress signaling. ER and oxidative stress signaling activate additional pro-apoptotic signaling pathways, including JNK (381, 384, 391, 419) and cleaved caspase-12 (419, 420, 768). JNK inhibition is relevant to human islet transplantation, as the human ortholog of murine cleaved caspase-12 is a pseudogene (381). JNK inhibition and dominant negative (DN-JNK) have been shown to protect  cells from apoptosis and improve graft function (382, 416). Synergistic inhibition of CHOP and JNK may further increase glycemic normalization, promote graft function, and inhibit apoptosis in transplantation.  A particular novelty of this work is the demonstration of efficient siRNA delivery throughout islets by incubation with lipid nano-particles (549). Alternate delivery systems include viral gene transfer and chitosan-based (793) particle delivery of siRNA. Viral vectors typically used to infect  cells include adenoviruses (3), adeno-associated viruses (794), and lentiviruses (795). Due to their immunogenicity and potential toxicity, viral vectors are limited in their translation to clinical medicine (603-605). The lipid nano-particle system used has been shown to have minimal toxicity at therapeutic doses and to deliver efficient knock-down of targets in vivo (549). Ligand-associated lipid nanoparticles targeting beta cell membrane proteins might have increased beta-cell specific delivery and further enhance the effectiveness of this system to modulate the beta cell in disease states.  In summary, we have demonstrated that CHOP signaling is detrimental to glycemic normalization in marginal mass islet transplantation. We have demonstrated a therapeutic approach to modulate CHOP signaling in the  cell. Targeting of CHOP and other pro-apoptotic signaling pathways activated by ER and oxidative stress may preserve  cell mass and function in the early post-transplantation period of islet transplantation, particularly under conditions of elevated metabolic stress.       151  Chapter 7. Conclusions  Progressive graft dysfunction is a daunting hurdle in islet transplantation. Much focus on islet loss has centered around immune-mediated mechanisms of graft destruction, many non-immune factors which promote metabolic stress in the transplanted  cell also likely play an important role in graft failure. In this thesis, CHOP and islet amyloid were shown to be detrimental to islet graft survival and function. Modulation of CHOP in the early post-transplant period improved glycemic control and reduced apoptosis, particularly in marginal mass grafts. The effects of islet amyloid are important over the long-term in islet transplantation. From both human and transgenic human IAPP-expressing mouse transplant models, we conclude that islet amyloid deposition is detrimental to graft function, that it inversely correlates with islet graft maintenance of glycemic control, and that its effects are exacerbated under increased secretory demand. Islet amyloid deposition in donor islets prior to transplantation predicts graft outcomes. Islet amyloid deposition is exacerbated by factors related to the transplantation procedure, such as heparin. Strategies investigated to mitigate the detrimental effects of islet amyloid in islet transplantation, such as peptide inhibitors of IAPP aggregation, siRNA-based silencing of IAPP, and xenotransplantation of islets expressing non-fibrillogenic IAPP, are promising in terms of their potential for clinical translation.  A summary depicting these strategies is shown in Figure 45.                152   Figure 45. Strategies to prevent  cell dysfunction and loss in islet transplantation .        153  There are many future directions for these studies. In terms of CHOP, it is important to investigate which upstream mechanisms in islet transplantation, such as ER stress, oxidative stress, and inflammation, are critical to its induction in marginal mass islet grafts. The role of CHOP has been investigated in the early post-transplant period, but much work remains to elucidate its role over the long-term, such as whether CHOP activity increases in proportion to graft dysfunction. As CHOP has only been investigated in rodent models of islet transplantation, its role in human islet graft dysfunction is of particular relevance, particularly whether its activity is related to the presence of islet amyloid and islet amyloid-related inflammation. Finally, the ability to silence CHOP in vivo is of great relevance to both islet transplantation and type 2 diabetes. The development of beta-cell specific ligand-associated nano-particles would allow silencing of CHOP only in the beta cell and would provide an important model for the use of this technology to silence other relevant genes in the dysfunctional beta cell.  In terms of islet amyloid, there are also numerous directions remaining to be explored. Islet allograft donors were found to be at increased risk for the development of islet amyloid, which is detrimental to graft function. This analysis, however, was performed on a small cohort. Expansion of this cohort and analysis of additional clinical parameters of the donor, recipient, and graft function over time will expand the relevance and importance of this study. Replication of this study in human islets transplanted into mouse models will provide additional support. The therapeutic strategies to modulate IAPP expression or islet amyloid deposition are promising but have only been examined in cultured human islets. The expansion of these studies to in vivo models is critical to provide evidence that these strategies are valid therapeutic approaches for the clinic. Given this evidence, these strategies will not only be applicable to islet transplantation, but also to type 2 diabetes. Finally, many factors in islet transplantation may exacerbate islet amyloid deposition. Further work remains to elucidate the role of immunosuppressive agents in islet amyloid deposition. In terms of heparin, it remains to be determined as to what the effect of islet surface heparinization, currently in clinical trials, is on islet amyloid deposition in human islets and whether alternate means of controlling IBMIR have the same detrimental effect upon seeding islet amyloid. Finally, much work remains to expand our current understanding of why islet amyloid deposits rapidly in human islets and what factors other than IAPP are critical to islet amyloid deposition and toxicity.  154  In conclusion, the main finding of this thesis is that CHOP and islet amyloid are important contributing factors to islet graft dysfunction and novel therapeutic targets by which to preserve islet graft mass and function. These factors, among others, point to important similarities between the dysfunctional beta cell in both islet transplantation and type 2 diabetes and provide therapeutic relevance not only to improving the success and availability of islet transplantation but also to treating type 2 diabetes in the face of a North American epidemic.                                      155  References  1. Klimek AM 2010 Prohormone processing in pancreatic islet transplantation. In: Pathology. Vancouver: University of British Columbia 2. Potter KJ, Scrocchi LA, Warnock GL, Ao Z, Younker MA, Rosenberg L, Lipsett M, Verchere CB, Fraser PE 2009 Amyloid inhibitors enhance survival of cultured human islets. Biochim Biophys Acta 1790:566-574 3. Marzban L, Tomas A, Becker TC, Rosenberg L, Oberholzer J, Fraser PE, Halban PA, Verchere CB 2008 Small interfering RNA-mediated suppression of proislet amyloid polypeptide expression inhibits islet amyloid formation and enhances survival of human islets in culture. Diabetes 57:3045-3055 4. Sipe JD, Cohen AS 2000 Review: history of the amyloid fibril. J Struct Biol 130:88-98 5. Fandrich M 2007 On the structural definition of amyloid fibrils and other polypeptide aggregates. Cell Mol Life Sci 64:2066-2078 6. Naiki H, Nagai Y 2009 Molecular pathogenesis of protein misfolding diseases: pathological molecular environments versus quality control systems against misfolded proteins. J Biochem 146:751-756 7. Monsellier E, Chiti F 2007 Prevention of amyloid-like aggregation as a driving force of protein evolution. EMBO Rep 8:737-742 8. Elghetany MT, Saleem A 1988 Methods for staining amyloid in tissues: a review. Stain Technol 63:201-212 9. Biancalana M, Koide S Molecular mechanism of Thioflavin-T binding to amyloid fibrils. Biochim Biophys Acta 1804:1405-1412 10. Selkoe DJ, Abraham CR, Podlisny MB, Duffy LK 1986 Isolation of low-molecular-weight proteins from amyloid plaque fibers in Alzheimer's disease. J Neurochem 46:1820-1834 11. Zraika S, Hull RL, Udayasankar J, Clark A, Utzschneider KM, Tong J, Gerchman F, Kahn SE 2007 Identification of the amyloid-degrading enzyme neprilysin in mouse islets and potential role in islet amyloidogenesis. Diabetes 56:304-310 12. Zraika S, Hull RL, Verchere CB, Clark A, Potter KJ, Fraser PE, Raleigh DP, Kahn SE Toxic oligomers and islet beta cell death: guilty by association or convicted by circumstantial evidence? Diabetologia 13. O'Nuallain B, Williams AD, Westermark P, Wetzel R 2004 Seeding specificity in amyloid growth induced by heterologous fibrils. J Biol Chem 279:17490-17499 14. Romero D, Aguilar C, Losick R, Kolter R Amyloid fibers provide structural integrity to Bacillus subtilis biofilms. Proc Natl Acad Sci U S A 107:2230-2234 15. Badtke MP, Hammer ND, Chapman MR 2009 Functional amyloids signal their arrival. Sci Signal 2:pe43 16. Chandrashekaran IR, Adda CG, MacRaild CA, Anders RF, Norton RS Inhibition by flavonoids of amyloid-like fibril formation by Plasmodium falciparum merozoite surface protein 2. Biochemistry 49:5899-5908 17. Kenney JM, Knight D, Wise MJ, Vollrath F 2002 Amyloidogenic nature of spider silk. Eur J Biochem 269:4159-4163 18. Fowler DM, Koulov AV, Balch WE, Kelly JW 2007 Functional amyloid--from bacteria to humans. Trends Biochem Sci 32:217-224 19. Westermark P, Benson MD, Buxbaum JN, Cohen AS, Frangione B, Ikeda S, Masters CL, Merlini G, Saraiva MJ, Sipe JD 2007 A primer of amyloid nomenclature. Amyloid 14:179-183 20. Sipe JD, Benson MD, Buxbaum JN, Ikeda S, Merlini G, Saraiva MJ, Westermark P Amyloid fibril protein nomenclature: 2010 recommendations from the nomenclature committee of the International Society of Amyloidosis. Amyloid 17:101-104 21. Scherzinger E, Sittler A, Schweiger K, Heiser V, Lurz R, Hasenbank R, Bates GP, Lehrach H, Wanker EE 1999 Self-assembly of polyglutamine-containing huntingtin fragments into amyloid-like fibrils: implications for Huntington's disease pathology. Proc Natl Acad Sci U S A 96:4604-4609 156  22. Nagai Y, Popiel HA 2008 Conformational changes and aggregation of expanded polyglutamine proteins as therapeutic targets of the polyglutamine diseases: exposed beta-sheet hypothesis. Curr Pharm Des 14:3267-3279 23. Chen S, Berthelier V, Hamilton JB, O'Nuallain B, Wetzel R 2002 Amyloid-like features of polyglutamine aggregates and their assembly kinetics. Biochemistry 41:7391-7399 24. Meredith GE, Halliday GM, Totterdell S 2004 A critical review of the development and importance of proteinaceous aggregates in animal models of Parkinson's disease: new insights into Lewy body formation. Parkinsonism Relat Disord 10:191-202 25. El-Agnaf OM, Irvine GB 2000 Review: formation and properties of amyloid-like fibrils derived from alpha-synuclein and related proteins. J Struct Biol 130:300-309 26. Forman MS, Trojanowski JQ, Lee VM 2004 Neurodegenerative diseases: a decade of discoveries paves the way for therapeutic breakthroughs. Nat Med 10:1055-1063 27. Perfetto F, Moggi-Pignone A, Livi R, Tempestini A, Bergesio F, Matucci-Cerinic M Systemic amyloidosis: a challenge for the rheumatologist. Nat Rev Rheumatol 6:417-429 28. Janson J, Ashley RH, Harrison D, McIntyre S, Butler PC 1999 The mechanism of islet amyloid polypeptide toxicity is membrane disruption by intermediate-sized toxic amyloid particles. Diabetes 48:491-498 29. Sandberg A, Luheshi LM, Sollvander S, Pereira de Barros T, Macao B, Knowles TP, Biverstal H, Lendel C, Ekholm-Petterson F, Dubnovitsky A, Lannfelt L, Dobson CM, Hard T Stabilization of neurotoxic Alzheimer amyloid-beta oligomers by protein engineering. Proc Natl Acad Sci U S A 107:15595-15600 30. Huang CJ, Lin CY, Haataja L, Gurlo T, Butler AE, Rizza RA, Butler PC 2007 High expression rates of human islet amyloid polypeptide induce endoplasmic reticulum stress mediated beta-cell apoptosis, a characteristic of humans with type 2 but not type 1 diabetes. Diabetes 56:2016-2027 31. Schubert D, Behl C, Lesley R, Brack A, Dargusch R, Sagara Y, Kimura H 1995 Amyloid peptides are toxic via a common oxidative mechanism. Proc Natl Acad Sci U S A 92:1989-1993 32. Zraika S, Hull RL, Udayasankar J, Aston-Mourney K, Subramanian SL, Kisilevsky R, Szarek WA, Kahn SE 2009 Oxidative stress is induced by islet amyloid formation and time- dependently mediates amyloid-induced beta cell apoptosis. Diabetologia 52:626-635 33. Lim YA, Rhein V, Baysang G, Meier F, Poljak A, Raftery MJ, Guilhaus M, Ittner LM, Eckert A, Gotz J Abeta and human amylin share a common toxicity pathway via mitochondrial dysfunction. Proteomics 10:1621-1633 34. Wang X, Su B, Perry G, Smith MA, Zhu X 2007 Insights into amyloid-beta-induced mitochondrial dysfunction in Alzheimer disease. Free Radic Biol Med 43:1569-1573 35. Rivera JF, Gurlo T, Daval M, Huang CJ, Matveyenko AV, Butler PC, Costes S Human- IAPP disrupts the autophagy/lysosomal pathway in pancreatic beta-cells: protective role of p62- positive cytoplasmic inclusions. Cell Death Differ 18:415-426 36. Engel MF 2009 Membrane permeabilization by Islet Amyloid Polypeptide. Chem Phys Lipids 160:1-10 37. Zhang S, Liu H, Yu H, Cooper GJ 2008 Fas-associated death receptor signaling evoked by human amylin in islet beta-cells. Diabetes 57:348-356 38. Law E, Lu S, Kieffer TJ, Warnock GL, Ao Z, Woo M, Marzban L Differences between amyloid toxicity in alpha and beta cells in human and mouse islets and the role of caspase-3. Diabetologia 53:1415-1427 39. Huang CJ, Gurlo T, Haataja L, Costes S, Daval M, Ryazantsev S, Wu X, Butler AE, Butler PC Calcium-activated calpain-2 is a mediator of beta cell dysfunction and apoptosis in type 2 diabetes. J Biol Chem 285:339-348 40. Masters SL, Dunne A, Subramanian SL, Hull RL, Tannahill GM, Sharp FA, Becker C, Franchi L, Yoshihara E, Chen Z, Mullooly N, Mielke LA, Harris J, Coll RC, Mills KH, Mok KH, Newsholme P, Nunez G, Yodoi J, Kahn SE, Lavelle EC, O'Neill LA Activation of the NLRP3 inflammasome by islet amyloid polypeptide provides a mechanism for enhanced IL- 1beta in type 2 diabetes. Nat Immunol 11:897-904 157  41. Rockwood K, Stadnyk K 1994 The prevalence of dementia in the elderly: a review. Can J Psychiatry 39:253-257 42. Sambrook R, Herrmann N, Hebert R, McCracken P, Robillard A, Luong D, Yu A 2004 Canadian Outcomes Study in Dementia: study methods and patient characteristics. Can J Psychiatry 49:417-427 43. Oremus M, Aguilar SC A systematic review to assess the policy-making relevance of dementia cost-of-illness studies in the US and Canada. Pharmacoeconomics 29:141-156 44. Mitchell SL, Rockwood K 2001 Defining parkinsonism in the Canadian Study of Health and Aging. Int Psychogeriatr 13 Supp 1:107-113 45. Myles S, Douglas MJ, Ward HJ, Campbell H, Will RG 2002 Variant Creutzfeldt-Jakob disease: costs borne by families. Health Soc Care Community 10:91-98 46. Belay ED, Schonberger LB 2005 The public health impact of prion diseases. Annu Rev Public Health 26:191-212 47. Kuchenmuller T, Hird S, Stein C, Kramarz P, Nanda A, Havelaar AH 2009 Estimating the global burden of foodborne diseases--a collaborative effort. Euro Surveill 14 48. Dyer O 2001 Hospitals to spend 200m pounds sterling to prevent spread of vCJD. BMJ 322:68 49. Gong W, Liu ZH, Zeng CH, Peng A, Chen HP, Zhou H, Li LS 2007 Amylin deposition in the kidney of patients with diabetic nephropathy. Kidney Int 72:213-218 50. Pohar SL, Majumdar SR, Johnson JA 2007 Health care costs and mortality for Canadian urban and rural patients with diabetes: population-based trends from 1993-2001. Clin Ther 29 Spec No:1316-1324 51. Sethi S, Fervenza FC, Miller D, Norby S, Leung N Recurrence of amyloidosis in a kidney transplant. Am J Kidney Dis 56:394-398 52. Luk A, Ahn E, Lee A, Ross HJ, Butany J Recurrent cardiac amyloidosis following previous heart transplantation. Cardiovasc Pathol 19:e129-133 53. Keven K, Sengul S, Kutlay S, Ekmekci Y, Anadol E, Nergizoglu G, Ates K, Erturk S, Erbay B 2004 Long-term outcome of renal transplantation in patients with familial Mediterranean fever amyloidosis: a single-center experience. Transplant Proc 36:2632-2634 54. Jha V, Sakhuja V, Vaiphei K, Sud K, Kohli HS, Gupta KL 2004 An unusual case of recurrence of AA amyloidosis in the renal allograft. Ren Fail 26:89-92 55. Dubrey SW, Burke MM, Khaghani A, Hawkins PN, Yacoub MH, Banner NR 2001 Long term results of heart transplantation in patients with amyloid heart disease. Heart 85:202-207 56. Dubrey SW, Burke MM, Hawkins PN, Banner NR 2004 Cardiac transplantation for amyloid heart disease: the United Kingdom experience. J Heart Lung Transplant 23:1142-1153 57. Valantine HA, Billingham ME 1989 Recurrence of amyloid in a cardiac allograft four months after transplantation. J Heart Transplant 8:337-341 58. Conner R, Hosenpud JD, Norman DJ, Pantely GA, Cobanoglu A, Starr A 1988 Heart transplantation for cardiac amyloidosis: successful one-year outcome despite recurrence of the disease. J Heart Transplant 7:165-167 59. Luo JM, Chou NK, Chi NH, Chen YS, Yu HY, Wang CH, Ko WJ, Tsao CI, Sun CD, Wang SS Heart transplantation in patients with amyloidosis. Transplant Proc 42:927-929 60. Harrison KL, Alpers CE, Davis CL 1993 De novo amyloidosis in a renal allograft: a case report and review of the literature. Am J Kidney Dis 22:468-476 61. Wild S, Roglic G, Green A, Sicree R, King H 2004 Global prevalence of diabetes: estimates for the year 2000 and projections for 2030. Diabetes Care 27:1047-1053 62. Faustman DL, Davis M 2009 The primacy of CD8 T lymphocytes in type 1 diabetes and implications for therapies. J Mol Med 87:1173-1178 63. Yang Y, Santamaria P 2006 Lessons on autoimmune diabetes from animal models. Clin Sci (Lond) 110:627-639 64. Gillespie KM 2006 Type 1 diabetes: pathogenesis and prevention. CMAJ 175:165-170 65. Hamilton-Williams EE, Martinez X, Lyman M, Hunter K, Wicker LS, Sherman LA 2007 The use of idd congenic mice to identify checkpoints of peripheral tolerance to islet antigen. Ann N Y Acad Sci 1103:118-127 158  66. Chen YG, Scheuplein F, Osborne MA, Tsaih SW, Chapman HD, Serreze DV 2008 Idd9/11 genetic locus regulates diabetogenic activity of CD4 T-cells in nonobese diabetic (NOD) mice. Diabetes 57:3273-3280 67. Hiromine Y, Fujisawa T, Noso S, Babaya N, Kawabata Y, Ikegami H 2008 Congenic mapping of the MHC-linked susceptibility to type 1 diabetes in the NOD mouse: at least two genes contribute to the Idd16 effect. Ann N Y Acad Sci 1150:90-92 68. Ikegami H, Fujisawa T, Sakamoto T, Makino S, Ogihara T 2004 Idd1 and Idd3 are necessary but not sufficient for development of type 1 diabetes in NOD mouse. Diabetes Res Clin Pract 66 Suppl 1:S85-90 69. Sundstrom M, Lejon K The prolonged and enhanced immune response in the non-obese diabetic mouse is dependent on genes in the Idd1/24, Idd12 and Idd18 regions. J Autoimmun 35:375-382 70. Narendran P, Estella E, Fourlanos S 2005 Immunology of type 1 diabetes. QJM 98:547-556 71. Bloom A, Hayes TM, Gamble DR 1975 Register of newly diagnosed diabetic children. Br Med J 3:580-583 72. Todd JA Etiology of type 1 diabetes. Immunity 32:457-467 73. Matveyenko AV, Butler PC 2008 Relationship between beta-cell mass and diabetes onset. Diabetes Obes Metab 10 Suppl 4:23-31 74. Atkinson MA, Gianani R 2009 The pancreas in human type 1 diabetes: providing new answers to age-old questions. Curr Opin Endocrinol Diabetes Obes 16:279-285 75. Klinke DJ, 2nd 2008 Extent of beta cell destruction is important but insufficient to predict the onset of type 1 diabetes mellitus. PLoS One 3:e1374 76. Borchers AT, Uibo R, Gershwin ME The geoepidemiology of type 1 diabetes. Autoimmun Rev 9:A355-365 77. Robert JJ, Deschamps I, Chevenne D, Roger M, Mogenet A, Boitard C 1991 Relationship between first-phase insulin secretion and age, HLA, islet cell antibody status, and development of type I diabetes in 220 juvenile first-degree relatives of diabetic patients. Diabetes Care 14:718- 723 78. Tracy S, Drescher KM 2007 Coxsackievirus infections and NOD mice: relevant models of protection from, and induction of, type 1 diabetes. Ann N Y Acad Sci 1103:143-151 79. Filippi CM, von Herrath MG 2008 Viral trigger for type 1 diabetes: pros and cons. Diabetes 57:2863-2871 80. Cali AM, Bonadonna RC, Trombetta M, Weiss R, Caprio S 2008 Metabolic abnormalities underlying the different prediabetic phenotypes in obese adolescents. J Clin Endocrinol Metab 93:1767-1773 81. Lupi R, Del Guerra S, Mancarella R, Novelli M, Valgimigli L, Pedulli GF, Paolini M, Soleti A, Filipponi F, Mosca F, Boggi U, Del Prato S, Masiello P, Marchetti P 2007 Insulin secretion defects of human type 2 diabetic islets are corrected in vitro by a new reactive oxygen species scavenger. Diabetes Metab 33:340-345 82. Kahn SE 2001 Clinical review 135: The importance of beta-cell failure in the development and progression of type 2 diabetes. J Clin Endocrinol Metab 86:4047-4058 83. Rorsman P, Renstrom E 2003 Insulin granule dynamics in pancreatic beta cells. Diabetologia 46:1029-1045 84. Porksen N, Hollingdal M, Juhl C, Butler P, Veldhuis JD, Schmitz O 2002 Pulsatile insulin secretion: detection, regulation, and role in diabetes. Diabetes 51 Suppl 1:S245-254 85. Guillausseau PJ, Meas T, Virally M, Laloi-Michelin M, Medeau V, Kevorkian JP 2008 Abnormalities in insulin secretion in type 2 diabetes mellitus. Diabetes Metab 34 Suppl 2:S43-48 86. Kahn SE, Halban PA 1997 Release of incompletely processed proinsulin is the cause of the disproportionate proinsulinemia of NIDDM. Diabetes 46:1725-1732 87. Kahn SE, Zraika S, Utzschneider KM, Hull RL 2009 The beta cell lesion in type 2 diabetes: there has to be a primary functional abnormality. Diabetologia 52:1003-1012 159  88. Portha B, Lacraz G, Chavey A, Figeac F, Fradet M, Tourrel-Cuzin C, Homo-Delarche F, Giroix MH, Bailbe D, Gangnerau MN, Movassat J Islet structure and function in the GK rat. Adv Exp Med Biol 654:479-500 89. Busch AK, Cordery D, Denyer GS, Biden TJ 2002 Expression profiling of palmitate- and oleate-regulated genes provides novel insights into the effects of chronic lipid exposure on pancreatic beta-cell function. Diabetes 51:977-987 90. Marselli L, Thorne J, Dahiya S, Sgroi DC, Sharma A, Bonner-Weir S, Marchetti P, Weir GC Gene expression profiles of Beta-cell enriched tissue obtained by laser capture microdissection from subjects with type 2 diabetes. PLoS One 5:e11499 91. Marchetti P, Bugliani M, Lupi R, Marselli L, Masini M, Boggi U, Filipponi F, Weir GC, Eizirik DL, Cnop M 2007 The endoplasmic reticulum in pancreatic beta cells of type 2 diabetes patients. Diabetologia 50:2486-2494 92. Rhodes CJ 2005 Type 2 diabetes-a matter of beta-cell life and death? Science 307:380-384 93. Leibowitz G, Yuli M, Donath MY, Nesher R, Melloul D, Cerasi E, Gross DJ, Kaiser N 2001 beta-cell glucotoxicity in the Psammomys obesus model of type 2 diabetes. Diabetes 50 Suppl 1:S113-117 94. Clark A, Holman RR, Matthews DR, Hockaday TD, Turner RC 1984 Non-uniform distribution of islet amyloid in the pancreas of 'maturity-onset' diabetic patients. Diabetologia 27:527-528 95. Lorenzo A, Razzaboni B, Weir GC, Yankner BA 1994 Pancreatic islet cell toxicity of amylin associated with type-2 diabetes mellitus. Nature 368:756-760 96. Rigacci S, Guidotti V, Bucciantini M, Parri M, Nediani C, Cerbai E, Stefani M, Berti A 2009 Oleuropein aglycon prevents cytotoxic amyloid aggregation of human amylin. J Nutr Biochem 97. Matveyenko AV, Butler PC 2006 Beta-cell deficit due to increased apoptosis in the human islet amyloid polypeptide transgenic (HIP) rat recapitulates the metabolic defects present in type 2 diabetes. Diabetes 55:2106-2114 98. Butler AE, Jang J, Gurlo T, Carty MD, Soeller WC, Butler PC 2004 Diabetes due to a progressive defect in beta-cell mass in rats transgenic for human islet amyloid polypeptide (HIP Rat): a new model for type 2 diabetes. Diabetes 53:1509-1516 99. Ehses JA, Perren A, Eppler E, Ribaux P, Pospisilik JA, Maor-Cahn R, Gueripel X, Ellingsgaard H, Schneider MK, Biollaz G, Fontana A, Reinecke M, Homo-Delarche F, Donath MY 2007 Increased number of islet-associated macrophages in type 2 diabetes. Diabetes 56:2356-2370 100. Ehses JA, Boni-Schnetzler M, Faulenbach M, Donath MY 2008 Macrophages, cytokines and beta-cell death in Type 2 diabetes. Biochem Soc Trans 36:340-342 101. Cornier MA, Dabelea D, Hernandez TL, Lindstrom RC, Steig AJ, Stob NR, Van Pelt RE, Wang H, Eckel RH 2008 The metabolic syndrome. Endocr Rev 29:777-822 102. Kulkarni RN, Bruning JC, Winnay JN, Postic C, Magnuson MA, Kahn CR 1999 Tissue- specific knockout of the insulin receptor in pancreatic beta cells creates an insulin secretory defect similar to that in type 2 diabetes. Cell 96:329-339 103. Weir GC, Bonner-Weir S 2004 Five stages of evolving beta-cell dysfunction during progression to diabetes. Diabetes 53 Suppl 3:S16-21 104. Craig ME, Hattersley A, Donaghue KC 2009 Definition, epidemiology and classification of diabetes in children and adolescents. Pediatr Diabetes 10 Suppl 12:3-12 105. Polak M, Cave H 2007 Neonatal diabetes mellitus: a disease linked to multiple mechanisms. Orphanet J Rare Dis 2:12 106. Owen KR, Skupien J, Malecki MT 2009 The clinical application of non-genetic biomarkers for differential diagnosis of monogenic diabetes. Diabetes Res Clin Pract 86 Suppl 1:S15-21 107. Colom C, Corcoy R Maturity onset diabetes of the young and pregnancy. Best Pract Res Clin Endocrinol Metab 24:605-615 160  108. Kirwan JP, Hauguel-De Mouzon S, Lepercq J, Challier JC, Huston-Presley L, Friedman JE, Kalhan SC, Catalano PM 2002 TNF-alpha is a predictor of insulin resistance in human pregnancy. Diabetes 51:2207-2213 109. Fowler GC, Vasudevan DA Type 2 diabetes mellitus: managing hemoglobin A(1c) and beyond. South Med J 103:911-916 110. Melendez-Ramirez LY, Richards RJ, Cefalu WT Complications of type 1 diabetes. Endocrinol Metab Clin North Am 39:625-640 111. D'Souza A, Hussain M, Howarth FC, Woods NM, Bidasee K, Singh J 2009 Pathogenesis and pathophysiology of accelerated atherosclerosis in the diabetic heart. Mol Cell Biochem 331:89- 116 112. Chan L, Terashima T, Fujimiya M, Kojima H 2006 Chronic diabetic complications: the body's adaptive response to hyperglycemia gone awry? Trans Am Clin Climatol Assoc 117:341-351; discussion 351-342 113. Keen H 1994 The Diabetes Control and Complications Trial (DCCT). Health Trends 26:41-43 114. 1998 Intensive blood-glucose control with sulphonylureas or insulin compared with conventional treatment and risk of complications in patients with type 2 diabetes (UKPDS 33). UK Prospective Diabetes Study (UKPDS) Group. Lancet 352:837-853 115. Warnock GL, Thompson DM, Meloche RM, Shapiro RJ, Ao Z, Keown P, Johnson JD, Verchere CB, Partovi N, Begg IS, Fung M, Kozak SE, Tong SO, Alghofaili KM, Harris C 2008 A multi-year analysis of islet transplantation compared with intensive medical therapy on progression of complications in type 1 diabetes. Transplantation 86:1762-1766 116. Aguayo-Mazzucato C, Bonner-Weir S Stem cell therapy for type 1 diabetes mellitus. Nat Rev Endocrinol 6:139-148 117. Jiang J, Au M, Lu K, Eshpeter A, Korbutt G, Fisk G, Majumdar AS 2007 Generation of insulin-producing islet-like clusters from human embryonic stem cells. Stem Cells 25:1940-1953 118. Borowiak M The new generation of beta-cells: replication, stem cell differentiation, and the role of small molecules. Rev Diabet Stud 7:93-104 119. Zhang Y, Shen W, Hua J, Lei A, Lv C, Wang H, Yang C, Gao Z, Dou Z Pancreatic islet-like clusters from bone marrow mesenchymal stem cells of human first-trimester abortus can cure streptozocin-induced mouse diabetes. Rejuvenation Res 13:695-706 120. Srinivasan P, Huang GC, Amiel SA, Heaton ND 2007 Islet cell transplantation. Postgrad Med J 83:224-229 121. Digon BJ, 3rd 2009 History of islet transplantation. Curr Diab Rep 9:312-316 122. Kendall DM, Robertson RP 1997 Pancreas and islet transplantation. Challenges for the twenty- first century. Endocrinol Metab Clin North Am 26:611-630 123. Troppmann C Complications after pancreas transplantation. Curr Opin Organ Transplant 15:112-118 124. Vardanyan M, Parkin E, Gruessner C, Rodriguez Rilo HL Pancreas vs. islet transplantation: a call on the future. Curr Opin Organ Transplant 15:124-130 125. Robertson RP, Davis C, Larsen J, Stratta R, Sutherland DE 2000 Pancreas and islet transplantation for patients with diabetes. Diabetes Care 23:112-116 126. Robertson RP, Lanz KJ, Sutherland DE, Kendall DM 2001 Prevention of diabetes for up to 13 years by autoislet transplantation after pancreatectomy for chronic pancreatitis. Diabetes 50:47-50 127. Tzakis AG, Ricordi C, Alejandro R, Zeng Y, Fung JJ, Todo S, Demetris AJ, Mintz DH, Starzl TE 1990 Pancreatic islet transplantation after upper abdominal exenteration and liver replacement. Lancet 336:402-405 128. Warnock GL, Kneteman NM, Ryan EA, Rabinovitch A, Rajotte RV 1992 Long-term follow- up after transplantation of insulin-producing pancreatic islets into patients with type 1 (insulin- dependent) diabetes mellitus. Diabetologia 35:89-95 129. Shapiro AM, Ricordi C, Hering BJ, Auchincloss H, Lindblad R, Robertson RP, Secchi A, Brendel MD, Berney T, Brennan DC, Cagliero E, Alejandro R, Ryan EA, DiMercurio B, Morel P, Polonsky KS, Reems JA, Bretzel RG, Bertuzzi F, Froud T, Kandaswamy R, 161  Sutherland DE, Eisenbarth G, Segal M, Preiksaitis J, Korbutt GS, Barton FB, Viviano L, Seyfert-Margolis V, Bluestone J, Lakey JR 2006 International trial of the Edmonton protocol for islet transplantation. N Engl J Med 355:1318-1330 130. Hirshberg B 2009 Implications of the 2008 update from the collaborative islet transplant registry. Curr Diab Rep 9:258-259 131. Srinivasan S, Ohsugi M, Liu Z, Fatrai S, Bernal-Mizrachi E, Permutt MA 2005 Endoplasmic reticulum stress-induced apoptosis is partly mediated by reduced insulin signaling through phosphatidylinositol 3-kinase/Akt and increased glycogen synthase kinase-3beta in mouse insulinoma cells. Diabetes 54:968-975 132. 2000 Pancreas transplantation for patients with type 1 diabetes: American Diabetes Association. Diabetes Care 23:117 133. Gruessner AC, Sutherland DE, Gruessner RW Pancreas transplantation in the United States: a review. Curr Opin Organ Transplant 15:93-101 134. Lam VW, Pleass HC, Hawthorne W, Allen RD Evolution of pancreas transplant surgery. ANZ J Surg 80:411-418 135. Vrochides D, Paraskevas S, Papanikolaou V 2009 Transplantation for type 1 diabetes mellitus. Whole organ or islets? Hippokratia 13:6-8 136. Gruessner RW, Sutherland DE, Kandaswamy R, Gruessner AC 2008 Over 500 solitary pancreas transplants in nonuremic patients with brittle diabetes mellitus. Transplantation 85:42- 47 137. Sutherland DE, Gruessner RW, Dunn DL, Matas AJ, Humar A, Kandaswamy R, Mauer SM, Kennedy WR, Goetz FC, Robertson RP, Gruessner AC, Najarian JS 2001 Lessons learned from more than 1,000 pancreas transplants at a single institution. Ann Surg 233:463-501 138. Orlando G, Stratta RJ, Light J Pancreas transplantation for type 2 diabetes mellitus. Curr Opin Organ Transplant 139. Alba A, Morales J, Ferrario M, Zehnder C, Aguilo J, Zavala C, Herzog C, Calabran L, Contreras L, Espinoza R, Buckel E, Fierro JA [Simultaneous kidney and pancreas transplantation (SKPT) in patients with type 1 diabetes and chronic renal failure: Experience in 12 patients in Chile.]. Rev Med Chil 139:11-18 140. White SA, Manas DW 2008 Pancreas transplantation. Ann R Coll Surg Engl 90:368-370 141. Gerber PA, Pavlicek V, Demartines N, Zuellig R, Pfammatter T, Wuthrich R, Weber M, Spinas GA, Lehmann R 2008 Simultaneous islet-kidney vs pancreas-kidney transplantation in type 1 diabetes mellitus: a 5 year single centre follow-up. Diabetologia 51:110-119 142. Dieterle CD, Arbogast H, Illner WD, Schmauss S, Landgraf R 2007 Metabolic follow-up after long-term pancreas graft survival. Eur J Endocrinol 156:603-610 143. Tufveson G 2009 An experience of pancreas and islet transplantation in patients with end stage renal failure due to diabetes type I. Curr Opin Organ Transplant 14:95-102 144. Frank A, Deng S, Huang X, Velidedeoglu E, Bae YS, Liu C, Abt P, Stephenson R, Mohiuddin M, Thambipillai T, Markmann E, Palanjian M, Sellers M, Naji A, Barker CF, Markmann JF 2004 Transplantation for type I diabetes: comparison of vascularized whole- organ pancreas with isolated pancreatic islets. Ann Surg 240:631-640; discussion 640-633 145. Ris F, Toso C, Veith FU, Majno P, Morel P, Oberholzer J 2004 Are criteria for islet and pancreas donors sufficiently different to minimize competition? Am J Transplant 4:763-766 146. Andreoni KA, Brayman KL, Guidinger MK, Sommers CM, Sung RS 2007 Kidney and pancreas transplantation in the United States, 1996-2005. Am J Transplant 7:1359-1375 147. Shapiro AM, Sutherland DE 2007 The new deceased donor pancreas allocation schema: do the recommendations go far enough? Transplantation 83:1151-1152 148. Berman DM, Cabrera O, Kenyon NM, Miller J, Tam SH, Khandekar VS, Picha KM, Soderman AR, Jordan RE, Bugelski PJ, Horninger D, Lark M, Davis JE, Alejandro R, Berggren PO, Zimmerman M, O'Neil JJ, Ricordi C, Kenyon NS 2007 Interference with tissue factor prolongs intrahepatic islet allograft survival in a nonhuman primate marginal mass model. Transplantation 84:308-315 162  149. Cabric S, Sanchez J, Lundgren T, Foss A, Felldin M, Kallen R, Salmela K, Tibell A, Tufveson G, Larsson R, Korsgren O, Nilsson B 2007 Islet surface heparinization prevents the instant blood-mediated inflammatory reaction in islet transplantation. Diabetes 56:2008-2015 150. Bertuzzi F, Marzorati S, Maffi P, Piemonti L, Melzi R, de Taddeo F, Valtolina V, D'Angelo A, di Carlo V, Bonifacio E, Secchi A 2004 Tissue factor and CCL2/monocyte chemoattractant protein-1 released by human islets affect islet engraftment in type 1 diabetic recipients. J Clin Endocrinol Metab 89:5724-5728 151. Johansson H, Lukinius A, Moberg L, Lundgren T, Berne C, Foss A, Felldin M, Kallen R, Salmela K, Tibell A, Tufveson G, Ekdahl KN, Elgue G, Korsgren O, Nilsson B 2005 Tissue factor produced by the endocrine cells of the islets of Langerhans is associated with a negative outcome of clinical islet transplantation. Diabetes 54:1755-1762 152. Reffet S, Thivolet C 2006 Immunology of pancreatic islet transplantation. Diabetes Metab 32:523-526 153. Venturini M, Angeli E, Maffi P, Fiorina P, Bertuzzi F, Salvioni M, De Cobelli F, Socci C, Aldrighetti L, Losio C, Di Carlo V, Secchi A, Del Maschio A 2005 Technique, complications, and therapeutic efficacy of percutaneous transplantation of human pancreatic islet cells in type 1 diabetes: the role of US. Radiology 234:617-624 154. Bennet W, Sundberg B, Lundgren T, Tibell A, Groth CG, Richards A, White DJ, Elgue G, Larsson R, Nilsson B, Korsgren O 2000 Damage to porcine islets of Langerhans after exposure to human blood in vitro, or after intraportal transplantation to cynomologus monkeys: protective effects of sCR1 and heparin. Transplantation 69:711-719 155. Contreras JL, Eckstein C, Smyth CA, Bilbao G, Vilatoba M, Ringland SE, Young C, Thompson JA, Fernandez JA, Griffin JH, Eckhoff DE 2004 Activated protein C preserves functional islet mass after intraportal transplantation: a novel link between endothelial cell activation, thrombosis, inflammation, and islet cell death. Diabetes 53:2804-2814 156. Cui W, Wilson JT, Wen J, Angsana J, Qu Z, Haller CA, Chaikof EL 2009 Thrombomodulin improves early outcomes after intraportal islet transplantation. Am J Transplant 9:1308-1316 157. Issa F, Schiopu A, Wood KJ Role of T cells in graft rejection and transplantation tolerance. Expert Rev Clin Immunol 6:155-169 158. Halloran PF 2004 Immunosuppressive drugs for kidney transplantation. N Engl J Med 351:2715-2729 159. Lunsford KE, Gao D, Eiring AM, Wang Y, Frankel WL, Bumgardner GL 2004 Evidence for tissue-directed immune responses: analysis of CD4- and CD8-dependent alloimmunity. Transplantation 78:1125-1133 160. Gill RG, Rosenberg AS, Lafferty KJ, Singer A 1989 Characterization of primary T cell subsets mediating rejection of pancreatic islet grafts. J Immunol 143:2176-2178 161. Beilke J, Johnson Z, Kuhl N, Gill RG 2004 A major role for host MHC class I antigen presentation for promoting islet allograft survival. Transplant Proc 36:1173-1174 162. Young HY, Zucker P, Flavell RA, Jevnikar AM, Singh B 2004 Characterization of the role of major histocompatibility complex in type 1 diabetes recurrence after islet transplantation. Transplantation 78:509-515 163. Lunsford KE, Jayanshankar K, Eiring AM, Horne PH, Koester MA, Gao D, Bumgardner GL 2008 Alloreactive (CD4-Independent) CD8+ T cells jeopardize long-term survival of intrahepatic islet allografts. Am J Transplant 8:1113-1128 164. Sleater M, Diamond AS, Gill RG 2007 Islet allograft rejection by contact-dependent CD8+ T cells: perforin and FasL play alternate but obligatory roles. Am J Transplant 7:1927-1933 165. Horne PH, Koester MA, Jayashankar K, Lunsford KE, Dziema HL, Bumgardner GL 2007 Disparate primary and secondary allospecific CD8+ T cell cytolytic effector function in the presence or absence of host CD4+ T cells. J Immunol 179:80-88 166. Papassavas AC, Iniotaki-Theodoraki A, Boletis J, Douramani P, Kostakis A, Stavropoulos- Giokas C 2000 A limited number of HLA epitopes are recognized from HLA class I-specific antibodies detected in the serum of sensitized patients. Hum Immunol 61:705-710 163  167. Qian Z, Lee CY, Murata K, Liu J, Fox-Talbot K, Wasowska BA, Baldwin WM, 3rd 2006 Antibody and complement mediated injury in transplants following sensitization by allogeneic blood transfusion. Transplantation 82:857-864 168. Gorgulu N, Caliskan Y, Yelken B, Turkmen A Outcomes of renal transplants from spousal donors: 25 years of experience at our center. Int J Artif Organs 33:40-44 169. Divella C, Rossini M, Loverre A, Schena A, Maiorano A, Gesualdo V, Zaza G, Grandaliano G, Schena FP Immunohistochemical characterization of glomerular and tubulointerstitial infiltrates in renal transplant patients with chronic allograft dysfunction. Nephrol Dial Transplant 170. Hui H, Khoury N, Zhao X, Balkir L, D'Amico E, Bullotta A, Nguyen ED, Gambotto A, Perfetti R 2005 Adenovirus-mediated XIAP gene transfer reverses the negative effects of immunosuppressive drugs on insulin secretion and cell viability of isolated human islets. Diabetes 54:424-433 171. Berney T, Secchi A 2009 Rapamycin in islet transplantation: friend or foe? Transpl Int 22:153- 161 172. Bell E, Cao X, Moibi JA, Greene SR, Young R, Trucco M, Gao Z, Matschinsky FM, Deng S, Markman JF, Naji A, Wolf BA 2003 Rapamycin has a deleterious effect on MIN-6 cells and rat and human islets. Diabetes 52:2731-2739 173. Kessler L, Parissiadis A, Bayle F, Moreau F, Pinget M, Froelich N, Cazenave JP, Berney T, Benhamou PY, Hanau D 2009 Evidence for humoral rejection of a pancreatic islet graft and rescue with rituximab and IV immunoglobulin therapy. Am J Transplant 9:1961-1966 174. Keenan HA, Sun JK, Levine J, Doria A, Aiello LP, Eisenbarth G, Bonner-Weir S, King GL Residual insulin production and pancreatic ss-cell turnover after 50 years of diabetes: Joslin Medalist Study. Diabetes 59:2846-2853 175. Azzi J, Geara AS, El-Sayegh S, Abdi R Immunological aspects of pancreatic islet cell transplantation. Expert Rev Clin Immunol 6:111-124 176. Huurman VA, Hilbrands R, Pinkse GG, Gillard P, Duinkerken G, van de Linde P, van der Meer-Prins PM, Versteeg-van der Voort Maarschalk MF, Verbeeck K, Alizadeh BZ, Mathieu C, Gorus FK, Roelen DL, Claas FH, Keymeulen B, Pipeleers DG, Roep BO 2008 Cellular islet autoimmunity associates with clinical outcome of islet cell transplantation. PLoS One 3:e2435 177. Markmann JF, Jacobson JD, Brayman KL, Kimura H, Barker CF, Naji A 1989 Prevention of recurrent diabetes in BB rats after islet transplantation by monoclonal antibody therapy. Diabetes 38 Suppl 1:165-167 178. Makhlouf L, Grey ST, Dong V, Csizmadia E, Arvelo MB, Auchincloss H, Jr., Ferran C, Sayegh MH 2004 Depleting anti-CD4 monoclonal antibody cures new-onset diabetes, prevents recurrent autoimmune diabetes, and delays allograft rejection in nonobese diabetic mice. Transplantation 77:990-997 179. Marzorati S, Antonioli B, Nano R, Maffi P, Piemonti L, Giliola C, Secchi A, Lakey JR, Bertuzzi F 2006 Culture medium modulates proinflammatory conditions of human pancreatic islets before transplantation. Am J Transplant 6:2791-2795 180. Thorvaldson L, Sandler S 2009 Factors influencing the regulation of cytokine balance during islet transplantation in mice. Transpl Immunol 20:186-194 181. Sklavos MM, Bertera S, Tse HM, Bottino R, He J, Beilke JN, Coulombe MG, Gill RG, Crapo JD, Trucco M, Piganelli JD Redox modulation protects islets from transplant-related injury. Diabetes 59:1731-1738 182. Lai Y, Chen C, Linn T 2009 Innate immunity and heat shock response in islet transplantation. Clin Exp Immunol 157:1-8 183. Cardozo AK, Proost P, Gysemans C, Chen MC, Mathieu C, Eizirik DL 2003 IL-1beta and IFN-gamma induce the expression of diverse chemokines and IL-15 in human and rat pancreatic islet cells, and in islets from pre-diabetic NOD mice. Diabetologia 46:255-266 184. Movahedi B, Van de Casteele M, Caluwe N, Stange G, Breckpot K, Thielemans K, Vreugdenhil G, Mathieu C, Pipeleers D 2004 Human pancreatic duct cells can produce tumour 164  necrosis factor-alpha that damages neighbouring beta cells and activates dendritic cells. Diabetologia 47:998-1008 185. Barbe-Tuana FM, Klein D, Ichii H, Berman DM, Coffey L, Kenyon NS, Ricordi C, Pastori RL 2006 CD40-CD40 ligand interaction activates proinflammatory pathways in pancreatic islets. Diabetes 55:2437-2445 186. Barshes NR, Wyllie S, Goss JA 2005 Inflammation-mediated dysfunction and apoptosis in pancreatic islet transplantation: implications for intrahepatic grafts. J Leukoc Biol 77:587-597 187. Bendtzen K, Mandrup-Poulsen T, Nerup J, Nielsen JH, Dinarello CA, Svenson M 1986 Cytotoxicity of human pI 7 interleukin-1 for pancreatic islets of Langerhans. Science 232:1545- 1547 188. Mandrup-Poulsen T, Bendtzen K, Dinarello CA, Nerup J 1987 Human tumor necrosis factor potentiates human interleukin 1-mediated rat pancreatic beta-cell cytotoxicity. J Immunol 139:4077-4082 189. Corbett JA, Wang JL, Sweetland MA, Lancaster JR, Jr., McDaniel ML 1992 Interleukin 1 beta induces the formation of nitric oxide by beta-cells purified from rodent islets of Langerhans. Evidence for the beta-cell as a source and site of action of nitric oxide. J Clin Invest 90:2384- 2391 190. Tran PO, Gleason CE, Robertson RP 2002 Inhibition of interleukin-1beta-induced COX-2 and EP3 gene expression by sodium salicylate enhances pancreatic islet beta-cell function. Diabetes 51:1772-1778 191. Montolio M, Biarnes M, Tellez N, Escoriza J, Soler J, Montanya E 2007 Interleukin-1beta and inducible form of nitric oxide synthase expression in early syngeneic islet transplantation. J Endocrinol 192:169-177 192. Satoh M, Yasunami Y, Matsuoka N, Nakano M, Itoh T, Nitta T, Anzai K, Ono J, Taniguchi M, Ikeda S 2007 Successful islet transplantation to two recipients from a single donor by targeting proinflammatory cytokines in mice. Transplantation 83:1085-1092 193. Kaufman DB, Platt JL, Rabe FL, Dunn DL, Bach FH, Sutherland DE 1990 Differential roles of Mac-1+ cells, and CD4+ and CD8+ T lymphocytes in primary nonfunction and classic rejection of islet allografts. J Exp Med 172:291-302 194. Kaufman DB, Gores PF, Field MJ, Farney AC, Gruber SA, Stephanian E, Sutherland DE 1994 Effect of 15-deoxyspergualin on immediate function and long-term survival of transplanted islets in murine recipients of a marginal islet mass. Diabetes 43:778-783 195. Benda B, Korsgren O 2001 Interleukin-6 in islet xenograft rejection. Transpl Int 14:63-71 196. Omer A, Keegan M, Czismadia E, De Vos P, Van Rooijen N, Bonner-Weir S, Weir GC 2003 Macrophage depletion improves survival of porcine neonatal pancreatic cell clusters contained in alginate macrocapsules transplanted into rats. Xenotransplantation 10:240-251 197. Rossi L, Migliavacca B, Pierige F, Serafini S, Sanvito F, Olivieri S, Nano R, Antonioli B, Magnani M, Bertuzzi F 2008 Prolonged islet allograft survival in diabetic mice upon macrophage depletion by clodronate-loaded erythrocytes. Transplantation 85:648-650 198. Yi S, Wang Y, Chandra AP, O'Hara JM, Wu J, Ouyang L, Burgess JS, Hawthorne W, Wu H, Chadban SJ, O'Connell PJ 2007 Requirement of MyD88 for macrophage-mediated islet xenograft rejection after adoptive transfer. Transplantation 83:615-623 199. Hutton MJ, Westwell-Roper C, Soukhatcheva G, Plesner A, Dutz JP, Verchere CB 2009 Islet allograft rejection is independent of toll-like receptor signaling in mice. Transplantation 88:1075-1080 200. Matsuoka N, Itoh T, Watarai H, Sekine-Kondo E, Nagata N, Okamoto K, Mera T, Yamamoto H, Yamada S, Maruyama I, Taniguchi M, Yasunami Y High-mobility group box 1 is involved in the initial events of early loss of transplanted islets in mice. J Clin Invest 201. Zhang N, Kruger B, Lal G, Luan Y, Yadav A, Zang W, Grimm M, Waaga-Gasser AM, Murphy B, Bromberg JS, Schroppel B Inhibition of TLR4 signaling prolongs Treg-dependent murine islet allograft survival. Immunol Lett 127:119-125 202. Pawelec K, Juszczak MT, Kumar A, Powis SH, Press M 2008 Time course of islet loss after intraportal transplantation. Ann N Y Acad Sci 1150:230-233 165  203. Smith RN, Kent SC, Nagle J, Selig M, Iafrate AJ, Najafian N, Hafler DA, Auchincloss H, Orban T, Cagliero E 2008 Pathology of an islet transplant 2 years after transplantation: evidence for a nonimmunological loss. Transplantation 86:54-62 204. Hering BJ, Kandaswamy R, Ansite JD, Eckman PM, Nakano M, Sawada T, Matsumoto I, Ihm SH, Zhang HJ, Parkey J, Hunter DW, Sutherland DE 2005 Single-donor, marginal-dose islet transplantation in patients with type 1 diabetes. JAMA 293:830-835 205. Deng S, Markmann JF, Rickels M, Yeh H, Kim JI, Lian MM, Gu Y, Markmann E, Palanjian M, Barker CF, Naji A 2009 Islet alone versus islet after kidney transplantation: metabolic outcomes and islet graft survival. Transplantation 88:820-825 206. Toso C, Isse K, Demetris AJ, Dinyari P, Koh A, Imes S, Kin T, Emamaullee J, Senior P, Shapiro AM 2009 Histologic graft assessment after clinical islet transplantation. Transplantation 88:1286-1293 207. Koulmanda M, Smith RN, Qipo A, Weir G, Auchincloss H, Strom TB 2006 Prolonged survival of allogeneic islets in cynomolgus monkeys after short-term anti-CD154-based therapy: nonimmunologic graft failure? Am J Transplant 6:687-696 208. Emamaullee JA, Merani S, Toso C, Kin T, Al-Saif F, Truong W, Pawlick R, Davis J, Edgar R, Lock J, Bonner-Weir S, Knudsen LB, Shapiro AM 2009 Porcine marginal mass islet autografts resist metabolic failure over time and are enhanced by early treatment with liraglutide. Endocrinology 150:2145-2152 209. Alejandro R, Cutfield RG, Shienvold FL, Polonsky KS, Noel J, Olson L, Dillberger J, Miller J, Mintz DH 1986 Natural history of intrahepatic canine islet cell autografts. J Clin Invest 78:1339-1348 210. Bellin MD, Carlson AM, Kobayashi T, Gruessner AC, Hering BJ, Moran A, Sutherland DE 2008 Outcome after pancreatectomy and islet autotransplantation in a pediatric population. J Pediatr Gastroenterol Nutr 47:37-44 211. Webb MA, Illouz SC, Pollard CA, Gregory R, Mayberry JF, Tordoff SG, Bone M, Cordle CJ, Berry DP, Nicholson ML, Musto PP, Dennison AR 2008 Islet auto transplantation following total pancreatectomy: a long-term assessment of graft function. Pancreas 37:282-287 212. Clayton HA, Davies JE, Pollard CA, White SA, Musto PP, Dennison AR 2003 Pancreatectomy with islet autotransplantation for the treatment of severe chronic pancreatitis: the first 40 patients at the leicester general hospital. Transplantation 76:92-98 213. Dufrane D, Gianello P 2009 Pig islets for clinical islet xenotransplantation. Curr Opin Nephrol Hypertens 18:495-500 214. Ikemoto T, Noguchi H, Shimoda M, Naziruddin B, Jackson A, Tamura Y, Fujita Y, Onaca N, Levy MF, Matsumoto S 2009 Islet cell transplantation for the treatment of type 1 diabetes in the USA. J Hepatobiliary Pancreat Surg 16:118-123 215. Brandhorst H, Brandhorst D, Hering BJ, Federlin K, Bretzel RG 1995 Body mass index of pancreatic donors: a decisive factor for human islet isolation. Exp Clin Endocrinol Diabetes 103 Suppl 2:23-26 216. Matsumoto I, Sawada T, Nakano M, Sakai T, Liu B, Ansite JD, Zhang HJ, Kandaswamy R, Sutherland DE, Hering BJ 2004 Improvement in islet yield from obese donors for human islet transplants. Transplantation 78:880-885 217. Neidlinger NA, Odorico JS, Sollinger HW, Fernandez LA 2008 Can 'extreme' pancreas donors expand the donor pool? Curr Opin Organ Transplant 13:67-71 218. O'Gorman D, Kin T, Murdoch T, Richer B, McGhee-Wilson D, Ryan EA, Shapiro JA, Lakey JR 2005 The standardization of pancreatic donors for islet isolations. Transplantation 80:801-806 219. Kenmochi T, Asano T, Maruyama M, Saigo K, Akutsu N, Iwashita C, Ohtsuki K, Ito T 2009 Clinical islet transplantation in Japan. J Hepatobiliary Pancreat Surg 16:124-130 220. Balamurugan AN, Chang Y, Bertera S, Sands A, Shankar V, Trucco M, Bottino R 2006 Suitability of human juvenile pancreatic islets for clinical use. Diabetologia 49:1845-1854 166  221. Ridgway DM, White SA, Kimber RM, Nicholson ML 2005 Current practices of donor pancreas allocation in the UK: future implications for pancreas and islet transplantation. Transpl Int 18:828-834 222. Street CN, Lakey JR, Shapiro AM, Imes S, Rajotte RV, Ryan EA, Lyon JG, Kin T, Avila J, Tsujimura T, Korbutt GS 2004 Islet graft assessment in the Edmonton Protocol: implications for predicting long-term clinical outcome. Diabetes 53:3107-3114 223. Nanji SA, Shapiro AM 2006 Advances in pancreatic islet transplantation in humans. Diabetes Obes Metab 8:15-25 224. Andrades P, Asiedu CK, Gansuvd B, Inusah S, Goodwin KJ, Deckard LA, Jargal U, Thomas JM 2008 Pancreatic islet isolation variables in non-human primates (rhesus macaques). Diabetologia 51:1236-1244 225. Hanley SC, Paraskevas S, Rosenberg L 2008 Donor and isolation variables predicting human islet isolation success. Transplantation 85:950-955 226. Nano R, Clissi B, Melzi R, Calori G, Maffi P, Antonioli B, Marzorati S, Aldrighetti L, Freschi M, Grochowiecki T, Socci C, Secchi A, Di Carlo V, Bonifacio E, Bertuzzi F 2005 Islet isolation for allotransplantation: variables associated with successful islet yield and graft function. Diabetologia 48:906-912 227. Briones RM, Miranda JM, Mellado-Gil JM, Castro MJ, Gonzalez-Molina M, Cuesta- Munoz AL, Alonso A, Frutos MA 2006 Differential analysis of donor characteristics for pancreas and islet transplantation. Transplant Proc 38:2579-2581 228. Avila JG, Wang Y, Barbaro B, Gangemi A, Qi M, Kuechle J, Doubleday N, Doubleday M, Churchill T, Salehi P, Shapiro J, Philipson LH, Benedetti E, Lakey JR, Oberholzer J  2006 Improved outcomes in islet isolation and transplantation by the use of a novel hemoglobin-based O2 carrier. Am J Transplant 6:2861-2870 229. Erbel S, Reers C, Nawroth PP, Ritzel RA Prolonged Culture of Human Islets Induces ER Stress. Exp Clin Endocrinol Diabetes 118:81-86 230. Bottino R, Balamurugan AN, Tse H, Thirunavukkarasu C, Ge X, Profozich J, Milton M, Ziegenfuss A, Trucco M, Piganelli JD 2004 Response of human islets to isolation stress and the effect of antioxidant treatment. Diabetes 53:2559-2568 231. Emamaullee JA, Shapiro AM 2006 Interventional strategies to prevent beta-cell apoptosis in islet transplantation. Diabetes 55:1907-1914 232. Morini S, Braun M, Onori P, Cicalese L, Elias G, Gaudio E, Rastellini C 2006 Morphological changes of isolated rat pancreatic islets: a structural, ultrastructural and morphometric study. J Anat 209:381-392 233. Hara Y, Fujino M, Takeuchi M, Li XK 2007 Green-tea polyphenol (-)-epigallocatechin-3- gallate provides resistance to apoptosis in isolated islets. J Hepatobiliary Pancreat Surg 14:493- 497 234. Cattan P, Berney T, Schena S, Molano RD, Pileggi A, Vizzardelli C, Ricordi C, Inverardi L 2001 Early assessment of apoptosis in isolated islets of Langerhans. Transplantation 71:857-862 235. Bertera S, Crawford ML, Alexander AM, Papworth GD, Watkins SC, Robbins PD, Trucco M 2003 Gene transfer of manganese superoxide dismutase extends islet graft function in a mouse model of autoimmune diabetes. Diabetes 52:387-393 236. Contreras JL, Smyth CA, Bilbao G, Eckstein C, Young CJ, Thompson JA, Curiel DT, Eckhoff DE 2003 Coupling endoplasmic reticulum stress to cell death program in isolated human pancreatic islets: effects of gene transfer of Bcl-2. Transpl Int 16:537-542 237. Ahn YB, Xu G, Marselli L, Toschi E, Sharma A, Bonner-Weir S, Sgroi DC, Weir GC 2007 Changes in gene expression in beta cells after islet isolation and transplantation using laser- capture microdissection. Diabetologia 50:334-342 238. Mazali FC, Lalli CA, Alves-Filho G, Mazzali M 2008 Posttransplant diabetes mellitus: incidence and risk factors. Transplant Proc 40:764-766 239. Chen MC, Proost P, Gysemans C, Mathieu C, Eizirik DL 2001 Monocyte chemoattractant protein-1 is expressed in pancreatic islets from prediabetic NOD mice and in interleukin-1 beta- exposed human and rat islet cells. Diabetologia 44:325-332 167  240. Johansson U, Olsson A, Gabrielsson S, Nilsson B, Korsgren O 2003 Inflammatory mediators expressed in human islets of Langerhans: implications for islet transplantation. Biochem Biophys Res Commun 308:474-479 241. Sabek OM, Marshall DR, Penmetsa R, Scarborough O, Gaber AO 2006 Examination of gene expression profile of functional human pancreatic islets after 2-week culture. Transplant Proc 38:3678-3679 242. Hering BJ, Kandaswamy R, Harmon JV, Ansite JD, Clemmings SM, Sakai T, Paraskevas S, Eckman PM, Sageshima J, Nakano M, Sawada T, Matsumoto I, Zhang HJ, Sutherland DE, Bluestone JA 2004 Transplantation of cultured islets from two-layer preserved pancreases in type 1 diabetes with anti-CD3 antibody. Am J Transplant 4:390-401 243. Ihm SH, Matsumoto I, Zhang HJ, Ansite JD, Hering BJ 2009 Effect of short-term culture on functional and stress-related parameters in isolated human islets. Transpl Int 22:207-216 244. Lau J, Henriksnas J, Svensson J, Carlsson PO 2009 Oxygenation of islets and its role in transplantation. Curr Opin Organ Transplant 14:688-693 245. Takahashi H, Goto M, Ogawa N, Saito Y, Fujimori K, Kurokawa Y, Doi H, Satomi S 2009 Superiority of fresh islets compared with cultured islets. Transplant Proc 41:350-351 246. King A, Lock J, Xu G, Bonner-Weir S, Weir GC 2005 Islet transplantation outcomes in mice are better with fresh islets and exendin-4 treatment. Diabetologia 48:2074-2079 247. Berney T 2008 Islet culture and counter-culture. Transpl Int 248. Mythili DM, Patra SS, Gunasekaran S 2003 Culture prior to transplantation preserves the ultrastructural integrity of monkey pancreatic islets. J Electron Microsc (Tokyo) 52:399-405 249. Kin T, Senior P, O'Gorman D, Richer B, Salam A, Shapiro AM 2008 Risk factors for islet loss during culture prior to transplantation. Transpl Int 21:1029-1035 250. Bar Y, Russ HA, Knoller S, Ouziel-Yahalom L, Efrat S 2008 HES-1 is involved in adaptation of adult human beta-cells to proliferation in vitro. Diabetes 57:2413-2420 251. Lehmann R, Zuellig RA, Kugelmeier P, Baenninger PB, Moritz W, Perren A, Clavien PA, Weber M, Spinas GA 2007 Superiority of small islets in human islet transplantation. Diabetes 56:594-603 252. Goss JA, Soltes G, Goodpastor SE, Barth M, Lam R, Brunicardi FC, Froud T, Alejandro R, Ricordi C 2003 Pancreatic islet transplantation: the radiographic approach. Transplantation 76:199-203 253. Casey JJ, Lakey JR, Ryan EA, Paty BW, Owen R, O'Kelly K, Nanji S, Rajotte RV, Korbutt GS, Bigam D, Kneteman NN, Shapiro AM 2002 Portal venous pressure changes after sequential clinical islet transplantation. Transplantation 74:913-915 254. Yin D, Ding JW, Shen J, Ma L, Hara M, Chong AS 2006 Liver ischemia contributes to early islet failure following intraportal transplantation: benefits of liver ischemic-preconditioning. Am J Transplant 6:60-68 255. Neeman Z, Hirshberg B, Harlan D, Wood BJ 2006 Radiologic aspects of islet cell transplantation. Curr Diab Rep 6:310-315 256. Meneghini LF 2009 Perioperative management of diabetes: translating evidence into practice. Cleve Clin J Med 76 Suppl 4:S53-59 257. Porksen N, Munn S, Ferguson D, O'Brien T, Veldhuis J, Butler P 1994 Coordinate pulsatile insulin secretion by chronic intraportally transplanted islets in the isolated perfused rat liver. J Clin Invest 94:219-227 258. Meier JJ, Hong-McAtee I, Galasso R, Veldhuis JD, Moran A, Hering BJ, Butler PC 2006 Intrahepatic transplanted islets in humans secrete insulin in a coordinate pulsatile manner directly into the liver. Diabetes 55:2324-2332 259. Mattsson G, Jansson L, Nordin A, Andersson A, Carlsson PO 2004 Evidence of functional impairment of syngeneically transplanted mouse pancreatic islets retrieved from the liver. Diabetes 53:948-954 260. Lau J, Jansson L, Carlsson PO 2006 Islets transplanted intraportally into the liver are stimulated to insulin and glucagon release exclusively through the hepatic artery. Am J Transplant 6:967-975 168  261. Lau J, Mattsson G, Carlsson C, Nyqvist D, Kohler M, Berggren PO, Jansson L, Carlsson PO 2007 Implantation site-dependent dysfunction of transplanted pancreatic islets. Diabetes 56:1544-1550 262. Korsgren O, Lundgren T, Felldin M, Foss A, Isaksson B, Permert J, Persson NH, Rafael E, Ryden M, Salmela K, Tibell A, Tufveson G, Nilsson B 2008 Optimising islet engraftment is critical for successful clinical islet transplantation. Diabetologia 51:227-232 263. White SA, Davies JE, Pollard C, Swift SM, Clayton HA, Sutton CD, Weymss-Holden S, Musto PP, Berry DP, Dennison AR 2001 Pancreas resection and islet autotransplantation for end-stage chronic pancreatitis. Ann Surg 233:423-431 264. Jansson L, Carlsson PO 2002 Graft vascular function after transplantation of pancreatic islets. Diabetologia 45:749-763 265. Lee Y, Ravazzola M, Park BH, Bashmakov YK, Orci L, Unger RH 2007 Metabolic mechanisms of failure of intraportally transplanted pancreatic beta-cells in rats: role of lipotoxicity and prevention by leptin. Diabetes 56:2295-2301 266. Desai NM, Goss JA, Deng S, Wolf BA, Markmann E, Palanjian M, Shock AP, Feliciano S, Brunicardi FC, Barker CF, Naji A, Markmann JF 2003 Elevated portal vein drug levels of sirolimus and tacrolimus in islet transplant recipients: local immunosuppression or islet toxicity? Transplantation 76:1623-1625 267. Shapiro AM, Gallant HL, Hao EG, Lakey JR, McCready T, Rajotte RV, Yatscoff RW, Kneteman NM 2005 The portal immunosuppressive storm: relevance to islet transplantation? Ther Drug Monit 27:35-37 268. Juszczak MT, Kooner P, Pawelec K, Jones GL, Hughes SJ, Kumar A, Powis SH, Press M 2009 Highly selective intraportal transplantation of pancreatic islets. J Surg Res 157:216-222 269. Gray BN, Caruso G, Alford F, Chisholm D 1979 Insulin and glucagon responses of transplanted intrasplenic pancreatic islets. Arch Surg 114:96-99 270. Cheng Y, Zhang JL, Liu YF, Li TM, Zhao N 2005 Islet transplantation for diabetic rats through the spleen. Hepatobiliary Pancreat Dis Int 4:203-206 271. Gustavson SM, Rajotte RV, Hunkeler D, Lakey JR, Edgerton DS, Neal DW, Snead WL, Penaloza AR, Cherrington AD 2005 Islet auto-transplantation into an omental or splenic site results in a normal beta cell but abnormal alpha cell response to mild non-insulin-induced hypoglycemia. Am J Transplant 5:2368-2377 272. Kin T, Korbutt GS, Rajotte RV 2003 Survival and metabolic function of syngeneic rat islet grafts transplanted in the omental pouch. Am J Transplant 3:281-285 273. Merani S, Toso C, Emamaullee J, Shapiro AM 2008 Optimal implantation site for pancreatic islet transplantation. Br J Surg 95:1449-1461 274. Stagner JI, Rilo HL, White KK 2007 The pancreas as an islet transplantation site. Confirmation in a syngeneic rodent and canine autotransplant model. JOP 8:628-636 275. Watt PC, Mullen Y, Nomura Y, Watanabe Y, Brunicardi FC, Anderson C, Zinner MJ, Passaro EP, Jr. 1994 Successful engraftment of autologous and allogeneic islets into the porcine thymus. J Surg Res 56:367-371 276. Salazar-Banuelos A, Wright JR, Jr., Sigalet D, Benitez-Bribiesca L 2008 Pancreatic islet transplantation into the bone marrow of the rat. Am J Surg 195:674-678; discussion 678 277. Owen RJ, Ryan EA, O'Kelly K, Lakey JR, McCarthy MC, Paty BW, Bigam DL, Kneteman NM, Korbutt GS, Rajotte RV, Shapiro AM 2003 Percutaneous transhepatic pancreatic islet cell transplantation in type 1 diabetes mellitus: radiologic aspects. Radiology 229:165-170 278. Kawakami Y, Iwata H, Gu YJ, Miyamoto M, Murakami Y, Balamurugan AN, Imamura M, Inoue K 2001 Successful subcutaneous pancreatic islet transplantation using an angiogenic growth factor-releasing device. Pancreas 23:375-381 279. Wang W, Gu Y, Hori H, Sakurai T, Hiura A, Sumi S, Tabata Y, Inoue K  2003 Subcutaneous transplantation of macroencapsulated porcine pancreatic endocrine cells normalizes hyperglycemia in diabetic mice. Transplantation 76:290-296 280. Rajab A Islet transplantation: alternative sites. Curr Diab Rep 10:332-337 169  281. Carlsson PO, Palm F, Mattsson G 2002 Low revascularization of experimentally transplanted human pancreatic islets. J Clin Endocrinol Metab 87:5418-5423 282. Brissova M, Powers AC 2008 Revascularization of transplanted islets: can it be improved? Diabetes 57:2269-2271 283. Carlsson PO, Palm F, Andersson A, Liss P 2001 Markedly decreased oxygen tension in transplanted rat pancreatic islets irrespective of the implantation site. Diabetes 50:489-495 284. Linn T, Schmitz J, Hauck-Schmalenberger I, Lai Y, Bretzel RG, Brandhorst H, Brandhorst D 2006 Ischaemia is linked to inflammation and induction of angiogenesis in pancreatic islets. Clin Exp Immunol 144:179-187 285. Sakata N, Hayes P, Tan A, Chan NK, Mace J, Peverini R, Sowers L, Pearce WJ, Chinnock R, Obenaus A, Hathout E 2009 MRI assessment of ischemic liver after intraportal islet transplantation. Transplantation 87:825-830 286. Strommer L, Wickbom M, Wang F, Herrington MK, Ostenson CG, Arnelo U, Permert J 2002 Early impairment of insulin secretion in rats after surgical trauma. Eur J Endocrinol 147:825-833 287. Makhlouf L, Duvivier-Kali VF, Bonner-Weir S, Dieperink H, Weir GC, Sayegh MH 2003 Importance of hyperglycemia on the primary function of allogeneic islet transplants. Transplantation 76:657-664 288. Melzi R, Battaglia M, Draghici E, Bonifacio E, Piemonti L 2007 Relevance of hyperglycemia on the timing of functional loss of allogeneic islet transplants: implication for mouse model. Transplantation 83:167-173 289. Biarnes M, Montolio M, Nacher V, Raurell M, Soler J, Montanya E 2002 Beta-cell death and mass in syngeneically transplanted islets exposed to short- and long-term hyperglycemia. Diabetes 51:66-72 290. Finzi G, Davalli A, Placidi C, Usellini L, La Rosa S, Folli F, Capella C 2005 Morphological and ultrastructural features of human islet grafts performed in diabetic nude mice. Ultrastruct Pathol 29:525-533 291. Shanmugam N, Reddy MA, Guha M, Natarajan R 2003 High glucose-induced expression of proinflammatory cytokine and chemokine genes in monocytic cells. Diabetes 52:1256-1264 292. de Souza CJ, Capotorto JV, Cornell-Kennon S, Wu YJ, Steil GM, Trivedi N, Weir GC 2000 Beta-cell dysfunction in 48-hour glucose-infused rats is not a consequence of elevated plasma lipid or islet triglyceride levels. Metabolism 49:755-759 293. Donath MY, Schumann DM, Faulenbach M, Ellingsgaard H, Perren A, Ehses JA 2008 Islet inflammation in type 2 diabetes: from metabolic stress to therapy. Diabetes Care 31 Suppl 2:S161-164 294. Hribal ML, Perego L, Lovari S, Andreozzi F, Menghini R, Perego C, Finzi G, Usellini L, Placidi C, Capella C, Guzzi V, Lauro D, Bertuzzi F, Davalli A, Pozza G, Pontiroli A, Federici M, Lauro R, Brunetti A, Folli F, Sesti G 2003 Chronic hyperglycemia impairs insulin secretion by affecting insulin receptor expression, splicing, and signaling in RIN beta cell line and human islets of Langerhans. FASEB J 17:1340-1342 295. Dunger A, Kauert C, Bromme HJ, Hildebrandt W, Blech W, Hahn HJ 1994 Functional response of a limited beta-cell mass to long-term hyperglycemia. Pancreas 9:186-192 296. Evgenov NV, Pratt J, Pantazopoulos P, Moore A 2008 Effects of glucose toxicity and islet purity on in vivo magnetic resonance imaging of transplanted pancreatic islets. Transplantation 85:1091-1098 297. Dubois M, Vacher P, Roger B, Huyghe D, Vandewalle B, Kerr-Conte J, Pattou F, Moustaid- Moussa N, Lang J 2007 Glucotoxicity inhibits late steps of insulin exocytosis. Endocrinology 148:1605-1614 298. Nagai T, Yasunami Y, Nagata N, Ryu S, Ono J, Ikeda S 1996 Amelioration of hyperglycemia in streptozotocin-induced diabetic rats receiving a marginal mass of islet grafts by troglitazone, an oral antidiabetic agent. Pancreas 13:381-387 170  299. Chen HS, Wu TE, Jap TS, Hsiao LC, Lee SH, Lin HD 2008 Beneficial effects of insulin on glycemic control and beta-cell function in newly diagnosed type 2 diabetes with severe hyperglycemia after short-term intensive insulin therapy. Diabetes Care 31:1927-1932 300. Chang-Chen KJ, Mullur R, Bernal-Mizrachi E 2008 Beta-cell failure as a complication of diabetes. Rev Endocr Metab Disord 9:329-343 301. Grill V, Bjorklund A 2009 Impact of metabolic abnormalities for beta cell function: clinical significance and underlying mechanisms. Mol Cell Endocrinol 297:86-92 302. Laybutt DR, Hawkins YC, Lock J, Lebet J, Sharma A, Bonner-Weir S, Weir GC 2007 Influence of diabetes on the loss of beta cell differentiation after islet transplantation in rats. Diabetologia 50:2117-2125 303. Jonas JC, Sharma A, Hasenkamp W, Ilkova H, Patane G, Laybutt R, Bonner-Weir S, Weir GC 1999 Chronic hyperglycemia triggers loss of pancreatic beta cell differentiation in an animal model of diabetes. J Biol Chem 274:14112-14121 304. Laybutt DR, Sharma A, Sgroi DC, Gaudet J, Bonner-Weir S, Weir GC 2002 Genetic regulation of metabolic pathways in beta-cells disrupted by hyperglycemia. J Biol Chem 277:10912-10921 305. Doherty M, Malaisse WJ 2001 Glycogen accumulation in rat pancreatic islets: in vitro experiments. Endocrine 14:303-309 306. Jansson L, Eizirik DL, Pipeleers DG, Borg LA, Hellerstrom C, Andersson A 1995 Impairment of glucose-induced insulin secretion in human pancreatic islets transplanted to diabetic nude mice. J Clin Invest 96:721-726 307. Harmon JS, Stein R, Robertson RP 2005 Oxidative stress-mediated, post-translational loss of MafA protein as a contributing mechanism to loss of insulin gene expression in glucotoxic beta cells. J Biol Chem 280:11107-11113 308. Venieratos PD, Drossopoulou GI, Kapodistria KD, Tsilibary EC, Kitsiou PV High glucose induces suppression of insulin signalling and apoptosis via upregulation of endogenous IL-1beta and suppressor of cytokine signalling-1 in mouse pancreatic beta cells. Cell Signal 22:791-800 309. Andrikopoulos S Obesity and type 2 diabetes: slow down!--Can metabolic deceleration protect the islet beta cell from excess nutrient-induced damage? Mol Cell Endocrinol 316:140-146 310. Weng J, Li Y, Xu W, Shi L, Zhang Q, Zhu D, Hu Y, Zhou Z, Yan X, Tian H, Ran X, Luo Z, Xian J, Yan L, Li F, Zeng L, Chen Y, Yang L, Yan S, Liu J, Li M, Fu Z, Cheng H 2008 Effect of intensive insulin therapy on beta-cell function and glycaemic control in patients with newly diagnosed type 2 diabetes: a multicentre randomised parallel-group trial. Lancet 371:1753- 1760 311. Koh A, Senior P, Salam A, Kin T, Imes S, Dinyari P, Malcolm A, Toso C, Nilsson B, Korsgren O, Shapiro AM Insulin-heparin infusions peritransplant substantially improve single- donor clinical islet transplant success. Transplantation 89:465-471 312. Oberholzer J, Triponez F, Mage R, Andereggen E, Buhler L, Cretin N, Fournier B, Goumaz C, Lou J, Philippe J, Morel P 2000 Human islet transplantation: lessons from 13 autologous and 13 allogeneic transplantations. Transplantation 69:1115-1123 313. Koh A, Imes S, Kin T, Dinyari P, Malcolm A, Toso C, Shapiro AM, Senior P Supplemental islet infusions restore insulin independence after graft dysfunction in islet transplant recipients. Transplantation 89:361-365 314. Guz Y, Torres A, Teitelman G 2002 Detrimental effect of protracted hyperglycaemia on beta- cell neogenesis in a mouse murine model of diabetes. Diabetologia 45:1689-1696 315. Nomikos I, Kalogerakos K, Athanasiou E, Plakokefalos E, Sioutopoulou D, Satra M, Vamvakopoulos NC 2008 Role of hyperglycemia in isogeneic islet transplantation: an experimental animal study. Exp Clin Endocrinol Diabetes 116:558-560 316. Klimek AM, Soukhatcheva G, Thompson DM, Warnock GL, Salehi M, Rilo H, D'Alessio D, Meneilly GS, Panagiotopoulos C, Verchere CB 2009 Impaired proinsulin processing is a characteristic of transplanted islets. Am J Transplant 9:2119-2125 171  317. Blondet JJ, Carlson AM, Kobayashi T, Jie T, Bellin M, Hering BJ, Freeman ML, Beilman GJ, Sutherland DE 2007 The role of total pancreatectomy and islet autotransplantation for chronic pancreatitis. Surg Clin North Am 87:1477-1501, x 318. Ahmad SA, Lowy AM, Wray CJ, D'Alessio D, Choe KA, James LE, Gelrud A, Matthews JB, Rilo HL 2005 Factors associated with insulin and narcotic independence after islet autotransplantation in patients with severe chronic pancreatitis. J Am Coll Surg 201:680-687 319. Markmann JF, Deng S, Huang X, Desai NM, Velidedeoglu EH, Lui C, Frank A, Markmann E, Palanjian M, Brayman K, Wolf B, Bell E, Vitamaniuk M, Doliba N, Matschinsky F, Barker CF, Naji A 2003 Insulin independence following isolated islet transplantation and single islet infusions. Ann Surg 237:741-749; discussion 749-750 320. Menge BA, Schrader H, Breuer TG, Dabrowski Y, Uhl W, Schmidt WE, Meier JJ 2009 Metabolic consequences of a 50% partial pancreatectomy in humans. Diabetologia 52:306-317 321. Jung HS, Choi SH, Kim SJ, Choi DW, Heo JS, Lee KT, Lee JK, Jang KT, Lee BW, Jee JH, Noh JH, Jeong IK, Yang TY, Oh SH, Ahn YR, Kim YS, No H, Lee MK, Kim KW 2009 Delayed improvement of insulin secretion after autologous islet transplantation in partially pancreatectomized patients. Metabolism 58:1629-1635 322. Davalli AM, Ogawa Y, Ricordi C, Scharp DW, Bonner-Weir S, Weir GC 1995 A selective decrease in the beta cell mass of human islets transplanted into diabetic nude mice. Transplantation 59:817-820 323. Parnaud G, Bosco D, Berney T, Pattou F, Kerr-Conte J, Donath MY, Bruun C, Mandrup- Poulsen T, Billestrup N, Halban PA 2008 Proliferation of sorted human and rat beta cells. Diabetologia 51:91-100 324. Fiaschi-Taesch NM, Salim F, Kleinberger J, Troxell R, Cozar-Castellano I, Selk K, Cherok E, Takane KK, Scott DK, Stewart AF Induction of human beta-cell proliferation and engraftment using a single G1/S regulatory molecule, cdk6. Diabetes 59:1926-1936 325. Emamaullee JA, Rajotte RV, Liston P, Korneluk RG, Lakey JR, Shapiro AM, Elliott JF 2005 XIAP overexpression in human islets prevents early posttransplant apoptosis and reduces the islet mass needed to treat diabetes. Diabetes 54:2541-2548 326. Grey ST, Longo C, Shukri T, Patel VI, Csizmadia E, Daniel S, Arvelo MB, Tchipashvili V, Ferran C 2003 Genetic engineering of a suboptimal islet graft with A20 preserves beta cell mass and function. J Immunol 170:6250-6256 327. Emamaullee JA, Stanton L, Schur C, Shapiro AM 2007 Caspase inhibitor therapy enhances marginal mass islet graft survival and preserves long-term function in islet transplantation. Diabetes 56:1289-1298 328. Emamaullee JA, Davis J, Pawlick R, Toso C, Merani S, Cai SX, Tseng B, Shapiro AM  2008 The caspase selective inhibitor EP1013 augments human islet graft function and longevity in marginal mass islet transplantation in mice. Diabetes 57:1556-1566 329. Paraskevas S, Maysinger D, Wang R, Duguid TP, Rosenberg L 2000 Cell loss in isolated human islets occurs by apoptosis. Pancreas 20:270-276 330. Montana E, Bonner-Weir S, Weir GC 1993 Beta cell mass and growth after syngeneic islet cell transplantation in normal and streptozocin diabetic C57BL/6 mice. J Clin Invest 91:780-787 331. Merani S, Truong W, Emamaullee JA, Toso C, Knudsen LB, Shapiro AM 2008 Liraglutide, a long-acting human glucagon-like peptide 1 analog, improves glucose homeostasis in marginal mass islet transplantation in mice. Endocrinology 149:4322-4328 332. Bell RC, Ryan EA, Finegood DT 1996 Consequences of high dietary fructose in the islet- transplanted rat with suboptimal beta-cell mass. Am J Physiol 270:E292-298 333. Bennet W, Groth CG, Larsson R, Nilsson B, Korsgren O 2000 Isolated human islets trigger an instant blood mediated inflammatory reaction: implications for intraportal islet transplantation as a treatment for patients with type 1 diabetes. Ups J Med Sci 105:125-133 334. Johansson H, Goto M, Dufrane D, Siegbahn A, Elgue G, Gianello P, Korsgren O, Nilsson B 2006 Low molecular weight dextran sulfate: a strong candidate drug to block IBMIR in clinical islet transplantation. Am J Transplant 6:305-312 172  335. Abdelli S, Ansite J, Roduit R, Borsello T, Matsumoto I, Sawada T, Allaman-Pillet N, Henry H, Beckmann JS, Hering BJ, Bonny C 2004 Intracellular stress signaling pathways activated during human islet preparation and following acute cytokine exposure. Diabetes 53:2815-2823 336. Abdelli S, Abderrahmani A, Hering BJ, Beckmann JS, Bonny C 2007 The c-Jun N-terminal kinase JNK participates in cytokine- and isolation stress-induced rat pancreatic islet apoptosis. Diabetologia 50:1660-1669 337. Schroppel B, Zhang N, Chen P, Chen D, Bromberg JS, Murphy B 2005 Role of donor- derived monocyte chemoattractant protein-1 in murine islet transplantation. J Am Soc Nephrol 16:444-451 338. Cheng J, Sun J, Sung RS 2009 Immunity to islet grafts transduced with adenovirus vectors does not inhibit long-term islet function. Transpl Immunol 21:33-42 339. Zaitseva, II, Hultcrantz M, Sharoyko V, Flodstrom-Tullberg M, Zaitsev SV, Berggren PO 2009 Suppressor of cytokine signaling-1 inhibits caspase activation and protects from cytokine- induced beta cell death. Cell Mol Life Sci 66:3787-3795 340. Wu JJ, Chen X, Cao XC, Baker MS, Kaufman DB 2001 Cytokine-induced metabolic dysfunction of MIN6 beta cells is nitric oxide independent. J Surg Res 101:190-195 341. Arafat HA, Katakam AK, Chipitsyna G, Gong Q, Vancha AR, Gabbeta J, Dafoe DC 2007 Osteopontin protects the islets and beta-cells from interleukin-1 beta-mediated cytotoxicity through negative feedback regulation of nitric oxide. Endocrinology 148:575-584 342. Oetjen E, Blume R, Cierny I, Schlag C, Kutschenko A, Kratzner R, Stein R, Knepel W 2007 Inhibition of MafA transcriptional activity and human insulin gene transcription by interleukin- 1beta and mitogen-activated protein kinase kinase kinase in pancreatic islet beta cells. Diabetologia 50:1678-1687 343. Marselli L, Dotta F, Piro S, Santangelo C, Masini M, Lupi R, Realacci M, del Guerra S, Mosca F, Boggi U, Purrello F, Navalesi R, Marchetti P 2001 Th2 cytokines have a partial, direct protective effect on the function and survival of isolated human islets exposed to combined proinflammatory and Th1 cytokines. J Clin Endocrinol Metab 86:4974-4978 344. Boni-Schnetzler M, Boller S, Debray S, Bouzakri K, Meier DT, Prazak R, Kerr-Conte J, Pattou F, Ehses JA, Schuit FC, Donath MY 2009 Free fatty acids induce a proinflammatory response in islets via the abundantly expressed interleukin-1 receptor I. Endocrinology 150:5218- 5229 345. Ehses JA, Lacraz G, Giroix MH, Schmidlin F, Coulaud J, Kassis N, Irminger JC, Kergoat M, Portha B, Homo-Delarche F, Donath MY 2009 IL-1 antagonism reduces hyperglycemia and tissue inflammation in the type 2 diabetic GK rat. Proc Natl Acad Sci U S A 106:13998- 14003 346. Larsen CM, Faulenbach M, Vaag A, Volund A, Ehses JA, Seifert B, Mandrup-Poulsen T, Donath MY 2007 Interleukin-1-receptor antagonist in type 2 diabetes mellitus. N Engl J Med 356:1517-1526 347. Tellez N, Montolio M, Estil-les E, Escoriza J, Soler J, Montanya E 2007 Adenoviral overproduction of interleukin-1 receptor antagonist increases beta cell replication and mass in syngeneically transplanted islets, and improves metabolic outcome. Diabetologia 50:602-611 348. Sutherland DE, Gruessner AC, Carlson AM, Blondet JJ, Balamurugan AN, Reigstad KF, Beilman GJ, Bellin MD, Hering BJ 2008 Islet autotransplant outcomes after total pancreatectomy: a contrast to islet allograft outcomes. Transplantation 86:1799-1802 349. Wahoff DC, Papalois BE, Najarian JS, Nelson LA, Dunn DL, Farney AC, Sutherland DE 1995 Clinical islet autotransplantation after pancreatectomy: determinants of success and implications for allotransplantation? Transplant Proc 27:3161 350. Lee YJ, Kim B, Lee JE, Kim YG, Kim DJ, Kim SJ, Joh JW, Oh HY, Huh W 2009 Randomized trial of cyclosporine and tacrolimus therapy with steroid withdrawal in living-donor renal transplantation: 5-year follow-up. Transpl Int 351. Ye F, Ying-Bin X, Yu-Guo W, Hetzer R 2009 Tacrolimus versus cyclosporine microemulsion for heart transplant recipients: a meta-analysis. J Heart Lung Transplant 28:58-66 173  352. Kamar N, Mariat C, Delahousse M, Dantal J, Al Najjar A, Cassuto E, Lefrancois N, Cointault O, Touchard G, Villemain F, Di Giambattista F, Benhamou PY 2007 Diabetes mellitus after kidney transplantation: a French multicentre observational study. Nephrol Dial Transplant 22:1986-1993 353. Fellstrom B 2001 Risk factors for and management of post-transplantation cardiovascular disease. BioDrugs 15:261-278 354. Backman LA 2004 Post-transplant diabetes mellitus: the last 10 years with tacrolimus. Nephrol Dial Transplant 19 Suppl 6:vi13-vi16 355. Mora PF 2005 Post-transplantation diabetes mellitus. Am J Med Sci 329:86-94 356. Asfari M, Berta S, Coffy S, Kergoat M, Charon C, Audet A 2005 Short-term treatment with mycophenolic acid and tacrolimus is tolerogenic for INS-1 cell clone transplantation and the deleterious effects of the drugs are limited: in vivo and in vitro studies. J Endocrinol 186:213-220 357. Luzi L, Hering BJ, Socci C, Raptis G, Battezzati A, Terruzzi I, Falqui L, Brandhorst H, Brandhorst D, Regalia E, Brambilla E, Secchi A, Perseghin G, Maffi P, Bianchi E, Mazzaferro V, Gennari L, Di Carlo V, Federlin K, Pozza G, Bretzel RG 1996 Metabolic effects of successful intraportal islet transplantation in insulin-dependent diabetes mellitus. J Clin Invest 97:2611-2618 358. Polastri L, Galbiati F, Bertuzzi F, Fiorina P, Nano R, Gregori S, Aldrighetti L, Pozza G, Secchi A, Adorini L, Davalli AM 2002 Secretory defects induced by immunosuppressive agents on human pancreatic beta-cells. Acta Diabetol 39:229-233 359. Rauch MC, San Martin A, Ojeda D, Quezada C, Salas M, Carcamo JG, Yanez AJ, Slebe JC, Claude A 2009 Tacrolimus causes a blockage of protein secretion which reinforces its immunosuppressive activity and also explains some of its toxic side-effects. Transpl Immunol 22:72-81 360. Paty BW, Harmon JS, Marsh CL, Robertson RP 2002 Inhibitory effects of immunosuppressive drugs on insulin secretion from HIT-T15 cells and Wistar rat islets. Transplantation 73:353-357 361. Johnson JD, Ao Z, Ao P, Li H, Dai LJ, He Z, Tee M, Potter KJ, Klimek AM, Meloche RM, Thompson DM, Verchere CB, Warnock GL 2009 Different effects of FK506, rapamycin, and mycophenolate mofetil on glucose-stimulated insulin release and apoptosis in human islets. Cell Transplant 18:833-845 362. Ochiai M, Arita S, Nagai T, Sakamoto Y, Smith CV, Shevlin L, Mullen Y 1998 Islet toxicity of FK506 measured in canine autografts. Transplant Proc 30:663 363. Kuypers DR, Claes K, Bammens B, Evenepoel P, Vanrenterghem Y 2008 Early clinical assessment of glucose metabolism in renal allograft recipients: diagnosis and prediction of post- transplant diabetes mellitus (PTDM). Nephrol Dial Transplant 23:2033-2042 364. Bussiere CT, Lakey JR, Shapiro AM, Korbutt GS 2006 The impact of the mTOR inhibitor sirolimus on the proliferation and function of pancreatic islets and ductal cells. Diabetologia 49:2341-2349 365. Mita A, Ricordi C, Miki A, Barker S, Haertter R, Hashikura Y, Miyagawa S, Burke GW, 3rd, Inverardi L, Ichii H 2008 Anti-proinflammatory effects of sirolimus on human islet preparations. Transplantation 86:46-53 366. Penfornis A, Kury-Paulin S 2006 Immunosuppressive drug-induced diabetes. Diabetes Metab 32:539-546 367. Aronovitz A, Josefson J, Fisher A, Newman M, Hughes E, Chen F, Moons DS, Kiyokawa H, Lowe WL, Jr. 2008 Rapamycin inhibits growth factor-induced cell cycle regulation in pancreatic beta cells. J Investig Med 56:985-996 368. Larsen JL, Bennett RG, Burkman T, Ramirez AL, Yamamoto S, Gulizia J, Radio S, Hamel FG 2006 Tacrolimus and sirolimus cause insulin resistance in normal sprague dawley rats. Transplantation 82:466-470 369. Johnson JD, Ao Z, Ao P, Li H, Dai L, He Z, Tee M, Potter KJ, Klimek AM, Meloche RM, Thompson DM, Verchere CB, Warnock GL 2009 Different effects of FK506, rapamycin, and 174  mycophenolate mofetil on glucose-stimulated insulin release and apoptosis in human islets. Cell Transplant 370. Shimodahira M, Fujimoto S, Mukai E, Nakamura Y, Nishi Y, Sasaki M, Sato Y, Sato H, Hosokawa M, Nagashima K, Seino Y, Inagaki N Rapamycin impairs metabolism-secretion coupling in rat pancreatic islets by suppressing carbohydrate metabolism. J Endocrinol 204:37-46 371. D'Amico E, Hui H, Khoury N, Di Mario U, Perfetti R 2005 Pancreatic beta-cells expressing GLP-1 are resistant to the toxic effects of immunosuppressive drugs. J Mol Endocrinol 34:377- 390 372. Nir T, Melton DA, Dor Y 2007 Recovery from diabetes in mice by beta cell regeneration. J Clin Invest 117:2553-2561 373. Cross SE, Richards SK, Clark A, Benest AV, Bates DO, Mathieson PW, Johnson PR, Harper SJ, Smith RM 2007 Vascular endothelial growth factor as a survival factor for human islets: effect of immunosuppressive drugs. Diabetologia 50:1423-1432 374. Laugharne M, Cross S, Richards S, Dawson C, Ilchyshyn L, Saleem M, Mathieson P, Smith R 2007 Sirolimus toxicity and vascular endothelial growth factor release from islet and renal cell lines. Transplantation 83:1635-1638 375. Jacobson PA, Green KG, Hering BJ 2005 Mycophenolate mofetil in islet cell transplant: variable pharmacokinetics but good correlation between total and unbound concentrations. J Clin Pharmacol 45:901-909 376. Fiorina P, Vergani A, Petrelli A, D'Addio F, Monti L, Abdi R, Bosi E, Maffi P, Secchi A 2008 Metabolic and immunological features of the failing islet-transplanted patient. Diabetes Care 31:436-438 377. Harding HP, Ron D 2002 Endoplasmic reticulum stress and the development of diabetes: a review. Diabetes 51 Suppl 3:S455-461 378. English AR, Zurek N, Voeltz GK 2009 Peripheral ER structure and function. Curr Opin Cell Biol 21:596-602 379. Sprecher H, Luthria DL, Mohammed BS, Baykousheva SP 1995 Reevaluation of the pathways for the biosynthesis of polyunsaturated fatty acids. J Lipid Res 36:2471-2477 380. Eizirik DL, Cardozo AK, Cnop M 2008 The role for endoplasmic reticulum stress in diabetes mellitus. Endocr Rev 29:42-61 381. Oyadomari S, Araki E, Mori M 2002 Endoplasmic reticulum stress-mediated apoptosis in pancreatic beta-cells. Apoptosis 7:335-345 382. Scheuner D, Kaufman RJ 2008 The unfolded protein response: a pathway that links insulin demand with beta-cell failure and diabetes. Endocr Rev 29:317-333 383. Kitiphongspattana K, Mathews CE, Leiter EH, Gaskins HR 2005 Proteasome inhibition alters glucose-stimulated (pro)insulin secretion and turnover in pancreatic {beta}-cells. J Biol Chem 280:15727-15734 384. Herbert TP 2007 PERK in the life and death of the pancreatic beta-cell. Biochem Soc Trans 35:1205-1207 385. Yusta B, Baggio LL, Estall JL, Koehler JA, Holland DP, Li H, Pipeleers D, Ling Z, Drucker DJ 2006 GLP-1 receptor activation improves beta cell function and survival following induction of endoplasmic reticulum stress. Cell Metab 4:391-406 386. Shameli A, Yamanouchi J, Thiessen S, Santamaria P 2007 Endoplasmic reticulum stress caused by overexpression of islet-specific glucose-6-phosphatase catalytic subunit-related protein in pancreatic Beta-cells. Rev Diabet Stud 4:25-32 387. Lo D, Burkly LC, Widera G, Cowing C, Flavell RA, Palmiter RD, Brinster RL 1988 Diabetes and tolerance in transgenic mice expressing class II MHC molecules in pancreatic beta cells. Cell 53:159-168 388. Herbach N, Rathkolb B, Kemter E, Pichl L, Klaften M, de Angelis MH, Halban PA, Wolf E, Aigner B, Wanke R 2007 Dominant-negative effects of a novel mutated Ins2 allele causes early- onset diabetes and severe beta-cell loss in Munich Ins2C95S mutant mice. Diabetes 56:1268- 1276 175  389. Yoshioka M, Kayo T, Ikeda T, Koizumi A 1997 A novel locus, Mody4, distal to D7Mit189 on chromosome 7 determines early-onset NIDDM in nonobese C57BL/6 (Akita) mutant mice. Diabetes 46:887-894 390. Laybutt DR, Preston AM, Akerfeldt MC, Kench JG, Busch AK, Biankin AV, Biden TJ 2007 Endoplasmic reticulum stress contributes to beta cell apoptosis in type 2 diabetes. Diabetologia 50:752-763 391. Ladiges WC, Knoblaugh SE, Morton JF, Korth MJ, Sopher BL, Baskin CR, MacAuley A, Goodman AG, LeBoeuf RC, Katze MG 2005 Pancreatic beta-cell failure and diabetes in mice with a deletion mutation of the endoplasmic reticulum molecular chaperone gene P58IPK. Diabetes 54:1074-1081 392. Luciani DS, Gwiazda K, Yang TL, Kalynyak TB, Bychkivska Y, Frey MH, Jeffrey KD, Sampaio AV, Underhill TM, Johnson JD 2008 Roles of IP3R and RyR Ca2+ Channels in Endoplasmic Reticulum Stress and {beta}-Cell Death. Diabetes 393. Kitiphongspattana K, Khan TA, Ishii-Schrade K, Roe MW, Philipson LH, Gaskins HR 2007 Protective role for nitric oxide during the endoplasmic reticulum stress response in pancreatic beta-cells. Am J Physiol Endocrinol Metab 292:E1543-1554 394. Huang CJ, Haataja L, Gurlo T, Butler AE, Wu X, Soeller WC, Butler PC 2007 Induction of endoplasmic reticulum stress-induced beta-cell apoptosis and accumulation of polyubiquitinated proteins by human islet amyloid polypeptide. Am J Physiol Endocrinol Metab 293:E1656-1662 395. Haataja L, Gurlo T, Huang CJ, Butler PC 2008 Many commercially available antibodies for detection of CHOP expression as a marker of endoplasmic reticulum stress fail specificity evaluation. Cell Biochem Biophys 51:105-107 396. Ortsater H, Sjoholm A 2007 A busy cell--endoplasmic reticulum stress in the pancreatic beta- cell. Mol Cell Endocrinol 277:1-5 397. Choi SE, Lee YJ, Jang HJ, Lee KW, Kim YS, Jun HS, Kang SS, Chun J, Kang Y  2008 A chemical chaperone 4-PBA ameliorates palmitate-induced inhibition of glucose-stimulated insulin secretion (GSIS). Arch Biochem Biophys 475:109-114 398. Hou ZQ, Li HL, Gao L, Pan L, Zhao JJ, Li GW 2008 Involvement of chronic stresses in rat islet and INS-1 cell glucotoxicity induced by intermittent high glucose. Mol Cell Endocrinol 291:71-78 399. Martinez SC, Tanabe K, Cras-Meneur C, Abumrad NA, Bernal-Mizrachi E, Permutt MA 2008 Inhibition of Foxo1 protects pancreatic islet beta-cells against fatty acid and endoplasmic reticulum stress-induced apoptosis. Diabetes 57:846-859 400. Diakogiannaki E, Morgan NG 2008 Differential regulation of the ER stress response by long- chain fatty acids in the pancreatic beta-cell. Biochem Soc Trans 36:959-962 401. Kharroubi I, Ladriere L, Cardozo AK, Dogusan Z, Cnop M, Eizirik DL 2004 Free fatty acids and cytokines induce pancreatic beta-cell apoptosis by different mechanisms: role of nuclear factor-kappaB and endoplasmic reticulum stress. Endocrinology 145:5087-5096 402. Lipson KL, Fonseca SG, Ishigaki S, Nguyen LX, Foss E, Bortell R, Rossini AA, Urano F 2006 Regulation of insulin biosynthesis in pancreatic beta cells by an endoplasmic reticulum- resident protein kinase IRE1. Cell Metab 4:245-254 403. Oyadomari S, Takeda K, Takiguchi M, Gotoh T, Matsumoto M, Wada I, Akira S, Araki E, Mori M 2001 Nitric oxide-induced apoptosis in pancreatic beta cells is mediated by the endoplasmic reticulum stress pathway. Proc Natl Acad Sci U S A 98:10845-10850 404. D'Hertog W, Overbergh L, Lage K, Ferreira GB, Maris M, Gysemans C, Flamez D, Cardozo AK, Van den Bergh G, Schoofs L, Arckens L, Moreau Y, Hansen DA, Eizirik DL, Waelkens E, Mathieu C 2007 Proteomics analysis of cytokine-induced dysfunction and death in insulin-producing INS-1E cells: new insights into the pathways involved. Mol Cell Proteomics 6:2180-2199 405. Pallet N, Fougeray S, Beaune P, Legendre C, Thervet E, Anglicheau D 2009 Endoplasmic reticulum stress: an unrecognized actor in solid organ transplantation. Transplantation 88:605-613 176  406. Vilatoba M, Eckstein C, Bilbao G, Smyth CA, Jenkins S, Thompson JA, Eckhoff DE, Contreras JL 2005 Sodium 4-phenylbutyrate protects against liver ischemia reperfusion injury by inhibition of endoplasmic reticulum-stress mediated apoptosis. Surgery 138:342-351 407. Kaneto H, Matsuoka TA, Nakatani Y, Kawamori D, Miyatsuka T, Matsuhisa M, Yamasaki Y 2005 Oxidative stress, ER stress, and the JNK pathway in type 2 diabetes. J Mol Med 83:429- 439 408. Drews G, Krippeit-Drews P, Dufer M Oxidative stress and beta-cell dysfunction. Pflugers Arch 460:703-718 409. Zito E, Chin KT, Blais J, Harding HP, Ron D ERO1-beta, a pancreas-specific disulfide oxidase, promotes insulin biogenesis and glucose homeostasis. J Cell Biol 188:821-832 410. Marchetti P, Del Prato S, Lupi R, Del Guerra S 2006 The pancreatic beta-cell in human Type 2 diabetes. Nutr Metab Cardiovasc Dis 16 Suppl 1:S3-6 411. Robertson RP, Harmon J, Tran PO, Tanaka Y, Takahashi H 2003 Glucose toxicity in beta- cells: type 2 diabetes, good radicals gone bad, and the glutathione connection. Diabetes 52:581- 587 412. Stiegler P, Stadlbauer V, Hackl F, Schaffellner S, Iberer F, Greilberger J, Strunk D, Zelzer S, Lackner C, Tscheliessnigg K Prevention of oxidative stress in porcine islet isolation. J Artif Organs 13:38-47 413. Emamaullee J, Liston P, Korneluk RG, Shapiro AM, Elliott JF 2005 XIAP overexpression in islet beta-cells enhances engraftment and minimizes hypoxia-reperfusion injury. Am J Transplant 5:1297-1305 414. Mohseni Salehi Monfared SS, Larijani B, Abdollahi M 2009 Islet transplantation and antioxidant management: a comprehensive review. World J Gastroenterol 15:1153-1161 415. Nagatani S, Sudo T, Murakami Y, Uemura K, Hiyama E, Sueda T Edaravone, a Free Radical Scavenger, Promotes Engraftment of Intraportally Transplanted Islet Cells. Pancreas 416. Kaneto H, Nakatani Y, Kawamori D, Miyatsuka T, Matsuoka TA, Matsuhisa M, Yamasaki Y 2006 Role of oxidative stress, endoplasmic reticulum stress, and c-Jun N-terminal kinase in pancreatic beta-cell dysfunction and insulin resistance. Int J Biochem Cell Biol 38:782-793 417. Song B, Scheuner D, Ron D, Pennathur S, Kaufman RJ 2008 Chop deletion reduces oxidative stress, improves beta cell function, and promotes cell survival in multiple mouse models of diabetes. J Clin Invest 118:3378-3389 418. Oyadomari S, Koizumi A, Takeda K, Gotoh T, Akira S, Araki E, Mori M  2002 Targeted disruption of the Chop gene delays endoplasmic reticulum stress-mediated diabetes. J Clin Invest 109:525-532 419. Araki E, Oyadomari S, Mori M 2003 Endoplasmic reticulum stress and diabetes mellitus. Intern Med 42:7-14 420. Breckenridge DG, Germain M, Mathai JP, Nguyen M, Shore GC 2003 Regulation of apoptosis by endoplasmic reticulum pathways. Oncogene 22:8608-8618 421. Lin JH, Walter P, Yen TS 2008 Endoplasmic reticulum stress in disease pathogenesis. Annu Rev Pathol 3:399-425 422. Ueda K, Kawano J, Takeda K, Yujiri T, Tanabe K, Anno T, Akiyama M, Nozaki J, Yoshinaga T, Koizumi A, Shinoda K, Oka Y, Tanizawa Y 2005 Endoplasmic reticulum stress induces Wfs1 gene expression in pancreatic beta-cells via transcriptional activation. Eur J Endocrinol 153:167-176 423. Zhu X, Orci L, Carroll R, Norrbom C, Ravazzola M, Steiner DF 2002 Severe block in processing of proinsulin to insulin accompanied by elevation of des-64,65 proinsulin intermediates in islets of mice lacking prohormone convertase 1/3. Proc Natl Acad Sci U S A 99:10299-10304 424. Furuta M, Carroll R, Martin S, Swift HH, Ravazzola M, Orci L, Steiner DF 1998 Incomplete processing of proinsulin to insulin accompanied by elevation of Des-31,32 proinsulin intermediates in islets of mice lacking active PC2. J Biol Chem 273:3431-3437 425. Marzban L, Soukhatcheva G, Verchere CB 2005 Role of carboxypeptidase E in processing of pro-islet amyloid polypeptide in {beta}-cells. Endocrinology 146:1808-1817 177  426. Marzban L, Trigo-Gonzalez G, Zhu X, Rhodes CJ, Halban PA, Steiner DF, Verchere CB 2004 Role of beta-cell prohormone convertase (PC)1/3 in processing of pro-islet amyloid polypeptide. Diabetes 53:141-148 427. Marzban L, Rhodes CJ, Steiner DF, Haataja L, Halban PA, Verchere CB 2006 Impaired NH2-terminal processing of human proislet amyloid polypeptide by the prohormone convertase PC2 leads to amyloid formation and cell death. Diabetes 55:2192-2201 428. Arnal-Monreal FM, Goltzman D, Knaack J, Wang NS, Huang SN 1977 Immunohistologic study of thyroidal medullary carcinoma and pancreatic insulinoma. Cancer 40:1060-1070 429. An T, Kaye GI 1978 Amyloid formation in insulinoma. Arch Pathol Lab Med 102:227-232 430. Sempoux C, Guiot Y, Dubois D, Moulin P, Rahier J 2001 Human type 2 diabetes: morphological evidence for abnormal beta-cell function. Diabetes 50 Suppl 1:S172-177 431. Westermark P, Wilander E, Westermark GT, Johnson KH 1987 Islet amyloid polypeptide- like immunoreactivity in the islet B cells of type 2 (non-insulin-dependent) diabetic and non- diabetic individuals. Diabetologia 30:887-892 432. Westermark P, Engstrom U, Westermark GT, Johnson KH, Permerth J, Betsholtz C 1989 Islet amyloid polypeptide (IAPP) and pro-IAPP immunoreactivity in human islets of Langerhans. Diabetes Res Clin Pract 7:219-226 433. Marzban L, Park K, Verchere CB 2003 Islet amyloid polypeptide and type 2 diabetes. Exp Gerontol 38:347-351 434. Potes CS, Turek VF, Cole RL, Vu C, Roland BL, Roth JD, Riediger T, Lutz TA Noradrenergic neurons of the area postrema mediate amylin's hypophagic action. Am J Physiol Regul Integr Comp Physiol 299:R623-631 435. Trevaskis JL, Turek VF, Wittmer C, Griffin PS, Wilson JK, Reynolds JM, Zhao Y, Mack CM, Parkes DG, Roth JD Enhanced amylin-mediated body weight loss in estradiol-deficient diet-induced obese rats. Endocrinology 151:5657-5668 436. Seth R, Knight WD, Overton JM Combined amylin-leptin treatment lowers blood pressure and adiposity in lean and obese rats. Int J Obes (Lond) 437. Moon HS, Chamberland JP, Diakopoulos KN, Fiorenza CG, Ziemke F, Schneider B, Mantzoros CS Leptin and amylin act in an additive manner to activate overlapping signaling pathways in peripheral tissues: in vitro and ex vivo studies in humans. Diabetes Care 34:132-138 438. Chase HP, Lutz K, Pencek R, Zhang B, Porter L 2009 Pramlintide lowered glucose excursions and was well-tolerated in adolescents with type 1 diabetes: results from a randomized, single- blind, placebo-controlled, crossover study. J Pediatr 155:369-373 439. Lee NJ, Norris SL, Thakurta S Efficacy and harms of the hypoglycemic agent pramlintide in diabetes mellitus. Ann Fam Med 8:542-549 440. Wojcik MH, Meenaghan E, Lawson EA, Misra M, Klibanski A, Miller KK Reduced amylin levels are associated with low bone mineral density in women with anorexia nervosa. Bone 46:796-800 441. Naot D, Cornish J 2008 The role of peptides and receptors of the calcitonin family in the regulation of bone metabolism. Bone 43:813-818 442. Guzel S, Gunes N, Yildiz H, Yilmaz B 2009 Effects of amylin on bone development and egg production in hens. Poult Sci 88:1719-1724 443. Furrer D, Kaufmann K, Reusch CE, Lutz TA Amylin reduces plasma glucagon concentration in cats. Vet J 184:236-240 444. Hay DL, Christopoulos G, Christopoulos A, Sexton PM 2004 Amylin receptors: molecular composition and pharmacology. Biochem Soc Trans 32:865-867 445. Kahn SE, Andrikopoulos S, Verchere CB 1999 Islet amyloid: a long-recognized but underappreciated pathological feature of type 2 diabetes. Diabetes 48:241-253 446. Verchere CB, D'Alessio DA, Wang S, Andrikopoulos S, Kahn SE 1997 Transgenic overproduction of islet amyloid polypeptide (amylin) is not sufficient for islet amyloid formation. Horm Metab Res 29:311-316 178  447. Westermark G, Arora MB, Fox N, Carroll R, Chan SJ, Westermark P, Steiner DF 1995 Amyloid formation in response to beta cell stress occurs in vitro, but not in vivo, in islets of transgenic mice expressing human islet amyloid polypeptide. Mol Med 1:542-553 448. Verchere CB, D'Alessio DA, Palmiter RD, Weir GC, Bonner-Weir S, Baskin DG, Kahn SE 1996 Islet amyloid formation associated with hyperglycemia in transgenic mice with pancreatic beta cell expression of human islet amyloid polypeptide. Proc Natl Acad Sci U S A 93:3492-3496 449. Soeller WC, Janson J, Hart SE, Parker JC, Carty MD, Stevenson RW, Kreutter DK, Butler PC 1998 Islet amyloid-associated diabetes in obese A(vy)/a mice expressing human islet amyloid polypeptide. Diabetes 47:743-750 450. Westermark GT, Gebre-Medhin S, Steiner DF, Westermark P 2000 Islet amyloid development in a mouse strain lacking endogenous islet amyloid polypeptide (IAPP) but expressing human IAPP. Mol Med 6:998-1007 451. Westermark G, Westermark P, Eizirik DL, Hellerstrom C, Fox N, Steiner DF, Andersson A 1999 Differences in amyloid deposition in islets of transgenic mice expressing human islet amyloid polypeptide versus human islets implanted into nude mice. Metabolism 48:448-454 452. Janson J, Soeller WC, Roche PC, Nelson RT, Torchia AJ, Kreutter DK, Butler PC 1996 Spontaneous diabetes mellitus in transgenic mice expressing human islet amyloid polypeptide. Proc Natl Acad Sci U S A 93:7283-7288 453. Hubbard GB, Steele KE, Davis KJ, 3rd, Leland MM 2002 Spontaneous pancreatic islet amyloidosis in 40 baboons. J Med Primatol 31:84-90 454. Guardado-Mendoza R, Davalli AM, Chavez AO, Hubbard GB, Dick EJ, Majluf-Cruz A, Tene-Perez CE, Goldschmidt L, Hart J, Perego C, Comuzzie AG, Tejero ME, Finzi G, Placidi C, La Rosa S, Capella C, Halff G, Gastaldelli A, DeFronzo RA, Folli F 2009 Pancreatic islet amyloidosis, beta-cell apoptosis, and alpha-cell proliferation are determinants of islet remodeling in type-2 diabetic baboons. Proc Natl Acad Sci U S A 106:13992-13997 455. Wagner JD, Cline JM, Shadoan MK, Bullock BC, Rankin SE, Cefalu WT 2001 Naturally occurring and experimental diabetes in cynomolgus monkeys: a comparison of carbohydrate and lipid metabolism and islet pathology. Toxicol Pathol 29:142-148 456. Ma Z, Westermark GT, Sakagashira S, Sanke T, Gustavsson A, Sakamoto H, Engstrom U, Nanjo K, Westermark P 2001 Enhanced in vitro production of amyloid-like fibrils from mutant (S20G) islet amyloid polypeptide. Amyloid 8:242-249 457. Sakagashira S, Hiddinga HJ, Tateishi K, Sanke T, Hanabusa T, Nanjo K, Eberhardt NL 2000 S20G mutant amylin exhibits increased in vitro amyloidogenicity and increased intracellular cytotoxicity compared to wild-type amylin. Am J Pathol 157:2101-2109 458. Sakagashira S, Sanke T, Hanabusa T, Shimomura H, Ohagi S, Kumagaye KY, Nakajima K, Nanjo K 1996 Missense mutation of amylin gene (S20G) in Japanese NIDDM patients. Diabetes 45:1279-1281 459. Hayakawa T, Nagai Y, Ando H, Yamashita H, Takamura T, Abe T, Nomura G, Kobayashi KI 2000 S20G mutation of the amylin gene in Japanese patients with type 2 diabetes. Diabetes Res Clin Pract 49:195-197 460. Abedini A, Raleigh DP 2006 Destabilization of human IAPP amyloid fibrils by proline mutations outside of the putative amyloidogenic domain: is there a critical amyloidogenic domain in human IAPP? J Mol Biol 355:274-281 461. Jaikaran ET, Higham CE, Serpell LC, Zurdo J, Gross M, Clark A, Fraser PE 2001 Identification of a novel human islet amyloid polypeptide beta-sheet domain and factors influencing fibrillogenesis. J Mol Biol 308:515-525 462. Abedini A, Raleigh DP 2005 The role of His-18 in amyloid formation by human islet amyloid polypeptide. Biochemistry 44:16284-16291 463. Scrocchi LA, Ha K, Chen Y, Wu L, Wang F, Fraser PE 2003 Identification of minimal peptide sequences in the (8-20) domain of human islet amyloid polypeptide involved in fibrillogenesis. J Struct Biol 141:218-227 179  464. Cao P, Meng F, Abedini A, Raleigh DP The ability of rodent islet amyloid polypeptide to inhibit amyloid formation by human islet amyloid polypeptide has important implications for the mechanism of amyloid formation and the design of inhibitors. Biochemistry 49:872-881 465. Jiang P, Xu W, Mu Y 2009 Amyloidogenesis abolished by proline substitutions but enhanced by lipid binding. PLoS Comput Biol 5:e1000357 466. Potter KJ, Abedini A, Marek P, Klimek AM, Butterworth S, Driscoll M, Baker R, Nilsson MR, Warnock GL, Oberholzer J, Bertera S, Trucco M, Korbutt GS, Fraser PE, Raleigh DP, Verchere CB Islet amyloid deposition limits the viability of human islet grafts but not porcine islet grafts. Proc Natl Acad Sci U S A 107:4305-4310 467. Bedrood S, Jayasinghe S, Sieburth D, Chen M, Erbel S, Butler PC, Langen R, Ritzel RA 2009 Annexin A5 directly interacts with amyloidogenic proteins and reduces their toxicity. Biochemistry 48:10568-10576 468. Hull RL, Zraika S, Udayasankar J, Aston-Mourney K, Subramanian SL, Kahn SE 2009 Amyloid formation in human IAPP transgenic mouse islets and pancreas, and human pancreas, is not associated with endoplasmic reticulum stress. Diabetologia 52:1102-1111 469. Brender JR, Hartman K, Reid KR, Kennedy RT, Ramamoorthy A 2008 A single mutation in the nonamyloidogenic region of islet amyloid polypeptide greatly reduces toxicity. Biochemistry 47:12680-12688 470. Muthusamy K, Albericio F, Arvidsson PI, Govender P, Kruger HG, Maguire GE, Govender T Microwave assisted SPPS of amylin and its toxicity of the pure product to RIN-5F cells. Biopolymers 471. Hebda JA, Saraogi I, Magzoub M, Hamilton AD, Miranker AD 2009 A peptidomimetic approach to targeting pre-amyloidogenic states in type II diabetes. Chem Biol 16:943-950 472. Bai JZ 2008 Beta-amyloid peptides 1-40betaA and 25-35betaA suppress human amylin-mediated death of RINm5F islet beta-cells with distinct actions on fibril formation. Cell Biol Int 32:447- 455 473. Janciauskiene S, Ahren B 1998 Different sensitivity to the cytotoxic action of IAPP fibrils in two insulin-producing cell lines, HIT-T15 and RINm5F cells. Biochem Biophys Res Commun 251:888-893 474. Kapurniotu A 2001 Amyloidogenicity and cytotoxicity of islet amyloid polypeptide. Biopolymers 60:438-459 475. Konarkowska B, Aitken JF, Kistler J, Zhang S, Cooper GJ 2006 The aggregation potential of human amylin determines its cytotoxicity towards islet beta-cells. FEBS J 273:3614-3624 476. Meier JJ, Kayed R, Lin CY, Gurlo T, Haataja L, Jayasinghe S, Langen R, Glabe CG, Butler PC 2006 Inhibition of human IAPP fibril formation does not prevent beta-cell death: evidence for distinct actions of oligomers and fibrils of human IAPP. Am J Physiol Endocrinol Metab 291:E1317-1324 477. Haataja L, Gurlo T, Huang CJ, Butler PC 2008 Islet amyloid in type 2 diabetes, and the toxic oligomer hypothesis. Endocr Rev 29:303-316 478. Jha S, Sellin D, Seidel R, Winter R 2009 Amyloidogenic propensities and conformational properties of ProIAPP and IAPP in the presence of lipid bilayer membranes. J Mol Biol 389:907- 920 479. Khemtemourian L, Lahoz Casarramona G, Suylen DP, Hackeng TM, Meeldijk JD, de Kruijff B, Hoppener JW, Killian JA 2009 Impaired processing of human pro-islet amyloid polypeptide is not a causative factor for fibril formation or membrane damage in vitro. Biochemistry 48:10918-10925 480. Brender JR, Lee EL, Hartman K, Wong PT, Ramamoorthy A, Steel DG, Gafni A Biphasic effects of insulin on islet amyloid polypeptide membrane disruption. Biophys J 100:685-692 481. Weise K, Radovan D, Gohlke A, Opitz N, Winter R Interaction of hIAPP with model raft membranes and pancreatic beta-cells: cytotoxicity of hIAPP oligomers. Chembiochem 11:1280- 1290 482. Despa F Endoplasmic reticulum overcrowding as a mechanism of beta-cell dysfunction in diabetes. Biophys J 98:1641-1648 180  483. Costes S, Huang CJ, Gurlo T, Daval M, Matveyenko AV, Rizza RA, Butler AE, Butler PC beta-cell dysfunctional ERAD/ubiquitin/proteasome system in type 2 diabetes mediated by islet amyloid polypeptide-induced UCH-L1 deficiency. Diabetes 60:227-238 484. Casas S, Novials A, Reimann F, Gomis R, Gribble FM 2008 Calcium elevation in mouse pancreatic beta cells evoked by extracellular human islet amyloid polypeptide involves activation of the mechanosensitive ion channel TRPV4. Diabetologia 51:2252-2262 485. Zhang S, Liu J, Dragunow M, Cooper GJ 2003 Fibrillogenic amylin evokes islet beta-cell apoptosis through linked activation of a caspase cascade and JNK1. J Biol Chem 278:52810- 52819 486. Li XL, Chen T, Wong YS, Xu G, Fan RR, Zhao HL, Chan JC Involvement of mitochondrial dysfunction in human islet amyloid polypeptide-induced apoptosis in INS-1E pancreatic beta cells: An effect attenuated by phycocyanin. Int J Biochem Cell Biol 43:525-534 487. Park K, Verchere CB 2001 Identification of a heparin binding domain in the N-terminal cleavage site of pro-islet amyloid polypeptide. Implications for islet amyloid formation. J Biol Chem 276:16611-16616 488. Westermark GT, Westermark P, Nordin A, Tornelius E, Andersson A 2003 Formation of amyloid in human pancreatic islets transplanted to the liver and spleen of nude mice. Ups J Med Sci 108:193-203 489. Westermark GT, Westermark P, Berne C, Korsgren O 2008 Widespread amyloid deposition in transplanted human pancreatic islets. N Engl J Med 359:977-979 490. Udayasankar J, Kodama K, Hull RL, Zraika S, Aston-Mourney K, Subramanian SL, Tong J, Faulenbach MV, Vidal J, Kahn SE 2009 Amyloid formation results in recurrence of hyperglycaemia following transplantation of human IAPP transgenic mouse islets. Diabetologia 52:145-153 491. Wong WP, Scott DW, Chuang CL, Zhang S, Liu H, Ferreira A, Saafi EL, Choong YS, Cooper GJ 2008 Spontaneous diabetes in hemizygous human amylin transgenic mice that developed neither islet amyloid nor peripheral insulin resistance. Diabetes 57:2737-2744 492. Rickels MR, Collins HW, Naji A 2008 Amyloid and transplanted islets. N Engl J Med 359:2729; author reply 2729-2731 493. Frontoni S, Choi SB, Banduch D, Rossetti L 1991 In vivo insulin resistance induced by amylin primarily through inhibition of insulin-stimulated glycogen synthesis in skeletal muscle. Diabetes 40:568-573 494. Koopmans SJ, van Mansfeld AD, Jansz HS, Krans HM, Radder JK, Frolich M, de Boer SF, Kreutter DK, Andrews GC, Maassen JA 1991 Amylin-induced in vivo insulin resistance in conscious rats: the liver is more sensitive to amylin than peripheral tissues. Diabetologia 34:218- 224 495. Furnsinn C, Nowotny P, Roden M, Rohac M, Pieber T, Parzer S, Waldhausl W 1993 Insulin resistance caused by amylin in conscious rats is independent of induced hypocalcemia and fades during long-term exposure. Acta Endocrinol (Copenh) 129:360-365 496. Kreutter DK, Orena SJ, Torchia AJ, Contillo LG, Andrews GC, Stevenson RW 1993 Amylin and CGRP induce insulin resistance via a receptor distinct from cAMP-coupled CGRP receptor. Am J Physiol 264:E606-613 497. Molina JM, Cooper GJ, Leighton B, Olefsky JM 1990 Induction of insulin resistance in vivo by amylin and calcitonin gene-related peptide. Diabetes 39:260-265 498. Leighton B, Cooper GJ 1990 The role of amylin in the insulin resistance of non-insulin- dependent diabetes mellitus. Trends Biochem Sci 15:295-299 499. Leighton B, Cooper GJ 1988 Pancreatic amylin and calcitonin gene-related peptide cause resistance to insulin in skeletal muscle in vitro. Nature 335:632-635 500. Tabata H, Hirayama J, Sowa R, Furuta H, Negoro T, Sanke T, Nanjo K  1992 Islet amyloid polypeptide (IAPP/amylin) causes insulin resistance in perfused rat hindlimb muscle. Diabetes Res Clin Pract 15:57-61 181  501. Sowa R, Sanke T, Hirayama J, Tabata H, Furuta H, Nishimura S, Nanjo K  1990 Islet amyloid polypeptide amide causes peripheral insulin resistance in vivo in dogs. Diabetologia 33:118-120 502. Ye JM, Lim-Fraser M, Cooney GJ, Cooper GJ, Iglesias MA, Watson DG, Choong B, Kraegen EW 2001 Evidence that amylin stimulates lipolysis in vivo: a possible mediator of induced insulin resistance. Am J Physiol Endocrinol Metab 280:E562-569 503. Ma Z, Westermark P, Westermark GT 2000 Amyloid in human islets of Langerhans: immunologic evidence that islet amyloid polypeptide is modified in amyloidogenesis. Pancreas 21:212-218 504. Kapurniotu A, Bernhagen J, Greenfield N, Al-Abed Y, Teichberg S, Frank RW, Voelter W, Bucala R 1998 Contribution of advanced glycosylation to the amyloidogenicity of islet amyloid polypeptide. Eur J Biochem 251:208-216 505. Pepys MB, Baltz M, Gomer K, Davies AJ, Doenhoff M 1979 Serum amyloid P-component is an acute-phase reactant in the mouse. Nature 278:259-261 506. Naiki H, Higuchi K, Hosokawa M, Takeda T 1989 Fluorometric determination of amyloid fibrils in vitro using the fluorescent dye, thioflavin T1. Anal Biochem 177:244-249 507. Kudva YC, Mueske C, Butler PC, Eberhardt NL 1998 A novel assay in vitro of human islet amyloid polypeptide amyloidogenesis and effects of insulin secretory vesicle peptides on amyloid formation. Biochem J 331 ( Pt 3):809-813 508. Scrocchi LA, Chen Y, Waschuk S, Wang F, Cheung S, Darabie AA, McLaurin J, Fraser PE 2002 Design of peptide-based inhibitors of human islet amyloid polypeptide fibrillogenesis. J Mol Biol 318:697-706 509. Warnock GL, Meloche RM, Thompson D, Shapiro RJ, Fung M, Ao Z, Ho S, He Z, Dai LJ, Young L, Blackburn L, Kozak S, Kim PT, Al-Adra D, Johnson JD, Liao YH, Elliott T, Verchere CB 2005 Improved human pancreatic islet isolation for a prospective cohort study of islet transplantation vs best medical therapy in type 1 diabetes mellitus. Arch Surg 140:735-744 510. Akashi S, Sho M, Kashizuka H, Hamada K, Ikeda N, Kuzumoto Y, Tsurui Y, Nomi T, Mizuno T, Kanehiro H, Hisanaga M, Ko S, Nakajima Y 2005 A novel small-molecule compound targeting CCR5 and CXCR3 prevents acute and chronic allograft rejection. Transplantation 80:378-384 511. Roelen DL, Huurman VA, Hilbrands R, Gillard P, Duinkerken G, van der Meer-Prins PW, Versteeg-van der Voort Maarschalk MF, Mathieu C, Keymeulen B, Pipeleers DG, Roep BO, Claas FH 2009 Relevance of cytotoxic alloreactivity under different immunosuppressive regimens in clinical islet cell transplantation. Clin Exp Immunol 156:141-148 512. Balamurugan AN, Bottino R, Giannoukakis N, Smetanka C 2006 Prospective and challenges of islet transplantation for the therapy of autoimmune diabetes. Pancreas 32:231-243 513. Roep BO, Stobbe I, Duinkerken G, van Rood JJ, Lernmark A, Keymeulen B, Pipeleers D, Claas FH, de Vries RR 1999 Auto- and alloimmune reactivity to human islet allografts transplanted into type 1 diabetic patients. Diabetes 48:484-490 514. Rickels MR, Kamoun M, Kearns J, Markmann JF, Naji A 2007 Evidence for allograft rejection in an islet transplant recipient and effect on beta-cell secretory capacity. J Clin Endocrinol Metab 92:2410-2414 515. Campbell PM, Salam A, Ryan EA, Senior P, Paty BW, Bigam D, McCready T, Halpin A, Imes S, Al Saif F, Lakey JR, Shapiro AM 2007 Pretransplant HLA antibodies are associated with reduced graft survival after clinical islet transplantation. Am J Transplant 7:1242-1248 516. Okitsu T, Bartlett ST, Hadley GA, Drachenberg CB, Farney AC 2001 Recurrent autoimmunity accelerates destruction of minor and major histoincompatible islet grafts in nonobese diabetic (NOD) mice. Am J Transplant 1:138-145 517. Thivolet C, Abou-Amara S, Martin X, Lefrancois N, Petruzzo P, McGregor B, Bosshard S, Dubernard JM 2000 Serological markers of recurrent beta cell destruction in diabetic patients undergoing pancreatic transplantation. Transplantation 69:99-103 182  518. Jaeger C, Brendel MD, Hering BJ, Eckhard M, Bretzel RG 1997 Progressive islet graft failure occurs significantly earlier in autoantibody-positive than in autoantibody-negative IDDM recipients of intrahepatic islet allografts. Diabetes 46:1907-1910 519. Chari ST, DiMagno EP 2001 Chronic pancreatitis. Curr Opin Gastroenterol 17:430-433 520. Lee BW, Jee JH, Heo JS, Choi SH, Jang KT, Noh JH, Jeong IK, Oh SH, Ahn YR, Chae HY, Min YK, Chung JH, Lee MK, Lee MS, Kim KW 2005 The favorable outcome of human islet transplantation in Korea: experiences of 10 autologous transplantations. Transplantation 79:1568- 1574 521. Colman PG, Begley CG, Tait BD, Roberts-Thomson IC, Harrison LC 1987 Evidence against an immunogenetic basis for diabetes in chronic pancreatitis. Aust N Z J Med 17:392-395 522. Larsen S, Hilsted J, Jakobsen BK, Svejgaard A, Marner B, Worning H 1990 Insulin- dependent diabetes mellitus secondary to chronic pancreatitis is not associated with HLA or the occurrence of islet-cell antibodies. J Immunogenet 17:189-193 523. Velthuis JH, Unger WW, van der Slik AR, Duinkerken G, Engelse M, Schaapherder AF, Ringers J, van Kooten C, de Koning EJ, Roep BO 2009 Accumulation of autoreactive effector T cells and allo-specific regulatory T cells in the pancreas allograft of a type 1 diabetic recipient. Diabetologia 52:494-503 524. Kahn SE, Montgomery B, Howell W, Ligueros-Saylan M, Hsu CH, Devineni D, McLeod JF, Horowitz A, Foley JE 2001 Importance of early phase insulin secretion to intravenous glucose tolerance in subjects with type 2 diabetes mellitus. J Clin Endocrinol Metab 86:5824-5829 525. Rorsman P, Eliasson L, Renstrom E, Gromada J, Barg S, Gopel S 2000 The Cell Physiology of Biphasic Insulin Secretion. News Physiol Sci 15:72-77 526. Sol ER, Hovsepyan M, Bergsten P 2009 Proteins altered by elevated levels of palmitate or glucose implicated in impaired glucose-stimulated insulin secretion. Proteome Sci 7:24 527. Bergsten P 2000 Pathophysiology of impaired pulsatile insulin release. Diabetes Metab Res Rev 16:179-191 528. Porksen N, Grofte T, Greisen J, Mengel A, Juhl C, Veldhuis JD, Schmitz O, Rossle M, Vilstrup H 2002 Human insulin release processes measured by intraportal sampling. Am J Physiol Endocrinol Metab 282:E695-702 529. Butler AE, Janson J, Bonner-Weir S, Ritzel R, Rizza RA, Butler PC 2003 Beta-cell deficit and increased beta-cell apoptosis in humans with type 2 diabetes. Diabetes 52:102-110 530. Weir GC, Marselli L, Marchetti P, Katsuta H, Jung MH, Bonner-Weir S 2009 Towards better understanding of the contributions of overwork and glucotoxicity to the beta-cell inadequacy of type 2 diabetes. Diabetes Obes Metab 11 Suppl 4:82-90 531. Poitout V, Robertson RP 2008 Glucolipotoxicity: fuel excess and beta-cell dysfunction. Endocr Rev 29:351-366 532. Maris M, Ferreira GB, D'Hertog W, Cnop M, Waelkens E, Overbergh L, Mathieu C High glucose induces dysfunction in insulin secretory cells by different pathways: a proteomic approach. J Proteome Res 533. Jonas JC, Bensellam M, Duprez J, Elouil H, Guiot Y, Pascal SM 2009 Glucose regulation of islet stress responses and beta-cell failure in type 2 diabetes. Diabetes Obes Metab 11 Suppl 4:65- 81 534. Fonseca SG, Burcin M, Gromada J, Urano F 2009 Endoplasmic reticulum stress in beta-cells and development of diabetes. Curr Opin Pharmacol 9:763-770 535. Tripathy D, Chavez AO Defects in insulin secretion and action in the pathogenesis of type 2 diabetes mellitus. Curr Diab Rep 10:184-191 536. Kaneto H, Katakami N, Matsuhisa M, Matsuoka TA Role of reactive oxygen species in the progression of type 2 diabetes and atherosclerosis. Mediators Inflamm 2010:453892 537. Lenzen S 2008 Oxidative stress: the vulnerable beta-cell. Biochem Soc Trans 36:343-347 538. Robertson RP Antioxidant drugs for treating beta-cell oxidative stress in type 2 diabetes: glucose-centric versus insulin-centric therapy. Discov Med 9:132-137 539. Rickels MR, Mueller R, Teff KL, Naji A {beta}-Cell secretory capacity and demand in recipients of islet, pancreas, and kidney transplants. J Clin Endocrinol Metab 95:1238-1246 183  540. Rickels MR, Schutta MH, Markmann JF, Barker CF, Naji A, Teff KL 2005 {beta}-Cell function following human islet transplantation for type 1 diabetes. Diabetes 54:100-106 541. Taljedal IB, Shi CL, Rooth P 1994 Functional aspects of mouse islets transplanted to the kidney. Diabetologia 37 Suppl 2:S112-116 542. Shi CL, Taljedal IB 1996 Dynamics of glucose-induced insulin release from mouse islets transplanted under the kidney capsule. Transplantation 62:1312-1318 543. Davalli AM, Perego L, Bertuzzi F, Finzi G, La Rosa S, Blau A, Placidi C, Nano R, Gregorini L, Perego C, Capella C, Folli F 2008 Disproportionate hyperproinsulinemia, beta-cell restricted prohormone convertase 2 deficiency, and cell cycle inhibitors expression by human islets transplanted into athymic nude mice: insights into nonimmune-mediated mechanisms of delayed islet graft failure. Cell Transplant 17:1323-1336 544. Ogawa Y, Noma Y, Davalli AM, Wu YJ, Thorens B, Bonner-Weir S, Weir GC 1995 Loss of glucose-induced insulin secretion and GLUT2 expression in transplanted beta-cells. Diabetes 44:75-79 545. Leoni L, Roman BB MR imaging of pancreatic islets: tracking isolation, transplantation and function. Curr Pharm Des 16:1582-1594 546. Medarova Z, Moore A 2009 MRI as a tool to monitor islet transplantation. Nat Rev Endocrinol 5:444-452 547. Hull RL, Westermark GT, Westermark P, Kahn SE 2004 Islet amyloid: a critical entity in the pathogenesis of type 2 diabetes. J Clin Endocrinol Metab 89:3629-3643 548. Wang F, Hull RL, Vidal J, Cnop M, Kahn SE 2001 Islet amyloid develops diffusely throughout the pancreas before becoming severe and replacing endocrine cells. Diabetes 50:2514- 2520 549. Semple SC, Akinc A, Chen J, Sandhu AP, Mui BL, Cho CK, Sah DW, Stebbing D, Crosley EJ, Yaworski E, Hafez IM, Dorkin JR, Qin J, Lam K, Rajeev KG, Wong KF, Jeffs LB, Nechev L, Eisenhardt ML, Jayaraman M, Kazem M, Maier MA, Srinivasulu M, Weinstein MJ, Chen Q, Alvarez R, Barros SA, De S, Klimuk SK, Borland T, Kosovrasti V, Cantley WL, Tam YK, Manoharan M, Ciufolini MA, Tracy MA, de Fougerolles A, MacLachlan I, Cullis PR, Madden TD, Hope MJ Rational design of cationic lipids for siRNA delivery. Nat Biotechnol 28:172-176 550. Speight J, Reaney MD, Woodcock AJ, Smith RM, Shaw JA Patient-reported outcomes following islet cell or pancreas transplantation (alone or after kidney) in Type 1 diabetes: a systematic review. Diabet Med 27:812-822 551. Poggioli R, Faradji RN, Ponte G, Betancourt A, Messinger S, Baidal DA, Froud T, Ricordi C, Alejandro R 2006 Quality of life after islet transplantation. Am J Transplant 6:371-378 552. Westermark P, Eizirik DL, Pipeleers DG, Hellerstrom C, Andersson A 1995 Rapid deposition of amyloid in human islets transplanted into nude mice. Diabetologia 38:543-549 553. Palotay JL, Howard CF, Jr. 1982 Insular amyloidosis in spontaneously diabetic nonhuman primates. Vet Pathol Suppl 7:181-192 554. Matveyenko AV, Butler PC 2006 Islet amyloid polypeptide (IAPP) transgenic rodents as models for type 2 diabetes. ILAR J 47:225-233 555. Whittington KB, Solomon SS, Lu ZN, Selawry HP 1991 Islet allografts in the cryptorchid testes of spontaneously diabetic BB/Wor dp rats: response to glucose, glipizide, and arginine. Endocrinology 128:2671-2677 556. Faradji RN, Tharavanij T, Messinger S, Froud T, Pileggi A, Monroy K, Mineo D, Baidal DA, Cure P, Ponte G, Mendez AJ, Selvaggi G, Ricordi C, Alejandro R 2008 Long-term insulin independence and improvement in insulin secretion after supplemental islet infusion under exenatide and etanercept. Transplantation 86:1658-1665 557. Mineo D, Sageshima J, Burke GW, Ricordi C 2009 Minimization and withdrawal of steroids in pancreas and islet transplantation. Transpl Int 22:20-37 558. Gangemi A, Salehi P, Hatipoglu B, Martellotto J, Barbaro B, Kuechle JB, Qi M, Wang Y, Pallan P, Owens C, Bui J, West D, Kaplan B, Benedetti E, Oberholzer J 2008 Islet transplantation for brittle type 1 diabetes: the UIC protocol. Am J Transplant 8:1250-1261 184  559. Wajchenberg BL 2007 beta-cell failure in diabetes and preservation by clinical treatment. Endocr Rev 28:187-218 560. Nichols GA, Hillier TA, Brown JB 2007 Progression from newly acquired impaired fasting glusose to type 2 diabetes. Diabetes Care 30:228-233 561. Abedini A, Tracz SM, Cho JH, Raleigh DP 2006 Characterization of the heparin binding site in the N-terminus of human pro-islet amyloid polypeptide: implications for amyloid formation. Biochemistry 45:9228-9237 562. Rostambeigi N, Lanza IR, Dzeja PP, Deeds MC, Irving BA, Reddi HV, Madde P, Zhang S, Asmann YW, Anderson JM, Schimke JM, Nair KS, Eberhardt NL, Kudva YC Unique Cellular and Mitochondrial Defects Mediate FK506-Induced Islet beta-Cell Dysfunction. Transplantation 563. Brissova M, Fowler M, Wiebe P, Shostak A, Shiota M, Radhika A, Lin PC, Gannon M, Powers AC 2004 Intraislet endothelial cells contribute to revascularization of transplanted pancreatic islets. Diabetes 53:1318-1325 564. Stagner JI, Seelan RS, Parthasarathy RN, White K 2009 Reduction of ischemic cell death in cultured Islets of Langerhans by the induction of cytoglobin. Islets 1:50-54 565. Noguchi H, Matsumoto S, Kobayashi N, Hayashi S, Iwanaga Y, Nagata H, Jackson A, Naziruddin B, Okitsu T, Levy MF 2008 Effect of JNK inhibitor during islet isolation and transplantation. Transplant Proc 40:379-381 566. Esapa C, Moffitt JH, Novials A, McNamara CM, Levy JC, Laakso M, Gomis R, Clark A 2005 Islet amyloid polypeptide gene promoter polymorphisms are not associated with Type 2 diabetes or with the severity of islet amyloidosis. Biochim Biophys Acta 1740:74-78 567. Zhao HL, Sui Y, Guan J, He L, Lai FM, Zhong DR, Yang D, Baum L, Tong PC, Tomlinson B, Chan JC 2008 Higher islet amyloid load in men than in women with type 2 diabetes mellitus. Pancreas 37:e68-73 568. Maloy AL, Longnecker DS, Greenberg ER 1981 The relation of islet amyloid to the clinical type of diabetes. Hum Pathol 12:917-922 569. Kadir A, Marutle A, Gonzalez D, Scholl M, Almkvist O, Mousavi M, Mustafiz T, Darreh- Shori T, Nennesmo I, Nordberg A Positron emission tomography imaging and clinical progression in relation to molecular pathology in the first Pittsburgh Compound B positron emission tomography patient with Alzheimer's disease. Brain 134:301-317 570. Cummings BJ, Pike CJ, Shankle R, Cotman CW 1996 Beta-amyloid deposition and other measures of neuropathology predict cognitive status in Alzheimer's disease. Neurobiol Aging 17:921-933 571. Dickson DW 1997 Neuropathological diagnosis of Alzheimer's disease: a perspective from longitudinal clinicopathological studies. Neurobiol Aging 18:S21-26 572. Sherman MA, Lesne SE Detecting abeta*56 oligomers in brain tissues. Methods Mol Biol 670:45-56 573. Dickson DW 1996 Senile cerebral amyloidosis (pathological aging) and cognitive status predictions: a neuropathology perspective. Neurobiol Aging 17:936-937; discussion 945-937 574. Hermann D, Both M, Ebert U, Gross G, Schoemaker H, Draguhn A, Wicke K, Nimmrich V 2009 Synaptic transmission is impaired prior to plaque formation in amyloid precursor protein- overexpressing mice without altering behaviorally-correlated sharp wave-ripple complexes. Neuroscience 162:1081-1090 575. Shankar GM, Leissring MA, Adame A, Sun X, Spooner E, Masliah E, Selkoe DJ, Lemere CA, Walsh DM 2009 Biochemical and immunohistochemical analysis of an Alzheimer's disease mouse model reveals the presence of multiple cerebral Abeta assembly forms throughout life. Neurobiol Dis 36:293-302 576. Tomiyama T, Matsuyama S, Iso H, Umeda T, Takuma H, Ohnishi K, Ishibashi K, Teraoka R, Sakama N, Yamashita T, Nishitsuji K, Ito K, Shimada H, Lambert MP, Klein WL, Mori H A mouse model of amyloid beta oligomers: their contribution to synaptic alteration, abnormal tau phosphorylation, glial activation, and neuronal loss in vivo. J Neurosci 30:4845-4856 185  577. Tomic JL, Pensalfini A, Head E, Glabe CG 2009 Soluble fibrillar oligomer levels are elevated in Alzheimer's disease brain and correlate with cognitive dysfunction. Neurobiol Dis 35:352-358 578. Kayed R, Head E, Sarsoza F, Saing T, Cotman CW, Necula M, Margol L, Wu J, Breydo L, Thompson JL, Rasool S, Gurlo T, Butler P, Glabe CG 2007 Fibril specific, conformation dependent antibodies recognize a generic epitope common to amyloid fibrils and fibrillar oligomers that is absent in prefibrillar oligomers. Mol Neurodegener 2:18 579. Zhao HL, Sui Y, Guan J, He L, Gu XM, Wong HK, Baum L, Lai FM, Tong PC, Chan JC 2009 Amyloid oligomers in diabetic and nondiabetic human pancreas. Transl Res 153:24-32 580. Meng F, Marek P, Potter KJ, Verchere CB, Raleigh DP 2008 Rifampicin does not prevent amyloid fibril formation by human islet amyloid polypeptide but does inhibit fibril thioflavin-T interactions: implications for mechanistic studies of beta-cell death. Biochemistry 47:6016-6024 581. Hawkins PN 1994 Diagnosis and monitoring of amyloidosis. Baillieres Clin Rheumatol 8:635- 659 582. Hartig W, Leifsson PS, Nielsen OL 2005 Immunohistochemical identification of amyloid, using an anti-human serum amyloid P component (SAP) antibody, is possible in ruminants but not in dogs and cats. J Vet Med A Physiol Pathol Clin Med 52:447-453 583. Kalaria RN, Galloway PG, Perry G 1991 Widespread serum amyloid P immunoreactivity in cortical amyloid deposits and the neurofibrillary pathology of Alzheimer's disease and other degenerative disorders. Neuropathol Appl Neurobiol 17:189-201 584. Gillmore JD, Tennent GA, Hutchinson WL, Gallimore JR, Lachmann HJ, Goodman HJ, Offer M, Millar DJ, Petrie A, Hawkins PN, Pepys MB Sustained pharmacological depletion of serum amyloid P component in patients with systemic amyloidosis. Br J Haematol 148:760-767 585. Tan SY, Pepys MB 1994 Amyloidosis. Histopathology 25:403-414 586. Tan SY, Baillod R, Brown E, Farrington K, Soper C, Percy M, Clutterbuck E, Madhoo S, Pepys MB, Hawkins PN 1999 Clinical, radiological and serum amyloid P component scintigraphic features of beta2-microglobulin amyloidosis associated with continuous ambulatory peritoneal dialysis. Nephrol Dial Transplant 14:1467-1471 587. Pepys MB 2007 Science and serendipity. Clin Med 7:562-578 588. Sojkova J, Resnick SM In vivo Human Amyloid Imaging. Curr Alzheimer Res 589. Lam KY, Lo CY 1997 Pancreatic endocrine tumour: a 22-year clinico-pathological experience with morphological, immunohistochemical observation and a review of the literature. Eur J Surg Oncol 23:36-42 590. Westermark P, Wilander E 1978 The influence of amyloid deposits on the islet volume in maturity onset diabetes mellitus. Diabetologia 15:417-421 591. Boche D, Nicoll JA, Weller RO 2006 Immunotherapy for Alzheimer's disease and other dementias. Clin Neuropharmacol 29:22-27 592. Morgan D Immunotherapy for Alzheimer's disease. J Intern Med 269:54-63 593. Yan LM, Tatarek-Nossol M, Velkova A, Kazantzis A, Kapurniotu A 2006 Design of a mimic of nonamyloidogenic and bioactive human islet amyloid polypeptide (IAPP) as nanomolar affinity inhibitor of IAPP cytotoxic fibrillogenesis. Proc Natl Acad Sci U S A 103:2046-2051 594. Meng F, Abedini A, Plesner A, Middleton CT, Potter KJ, Zanni MT, Verchere CB, Raleigh DP The sulfated triphenyl methane derivative acid fuchsin is a potent inhibitor of amyloid formation by human islet amyloid polypeptide and protects against the toxic effects of amyloid formation. J Mol Biol 400:555-566 595. Meng F, Abedini A, Plesner A, Verchere CB, Raleigh DP The flavanol (-)-epigallocatechin 3- gallate inhibits amyloid formation by islet amyloid polypeptide, disaggregates amyloid fibrils, and protects cultured cells against IAPP-induced toxicity. Biochemistry 49:8127-8133 596. Levy M, Porat Y, Bacharach E, Shalev DE, Gazit E 2008 Phenolsulfonphthalein, but not phenolphthalein, inhibits amyloid fibril formation: implications for the modulation of amyloid self-assembly. Biochemistry 47:5896-5904 597. Daval M, Bedrood S, Gurlo T, Huang CJ, Costes S, Butler PC, Langen R The effect of curcumin on human islet amyloid polypeptide misfolding and toxicity. Amyloid 17:118-128 186  598. Elgersma RC, Mulder GE, Kruijtzer JA, Posthuma G, Rijkers DT, Liskamp RM  2007 Transformation of the amyloidogenic peptide amylin(20-29) into its corresponding peptoid and retropeptoid: access to both an amyloid inhibitor and template for self-assembled supramolecular tapes. Bioorg Med Chem Lett 17:1837-1842 599. Elgersma RC, Meijneke T, de Jong R, Brouwer AJ, Posthuma G, Rijkers DT, Liskamp RM 2006 Synthesis and structural investigations of N-alkylated beta-peptidosulfonamide-peptide hybrids of the amyloidogenic amylin(20-29) sequence: Implications of supramolecular folding for the design of peptide-based bionanomaterials. Org Biomol Chem 4:3587-3597 600. Lee YY, Hong SH, Lee YJ, Chung SS, Jung HS, Park SG, Park KS Tauroursodeoxycholate (TUDCA), chemical chaperone, enhances function of islets by reducing ER stress. Biochem Biophys Res Commun 397:735-739 601. Davis ME, Zuckerman JE, Choi CH, Seligson D, Tolcher A, Alabi CA, Yen Y, Heidel JD, Ribas A Evidence of RNAi in humans from systemically administered siRNA via targeted nanoparticles. Nature 464:1067-1070 602. Kaiser PK, Symons RC, Shah SM, Quinlan EJ, Tabandeh H, Do DV, Reisen G, Lockridge JA, Short B, Guerciolini R, Nguyen QD RNAi-based treatment for neovascular age-related macular degeneration by Sirna-027. Am J Ophthalmol 150:33-39 e32 603. Tomanin R, Scarpa M 2004 Why do we need new gene therapy viral vectors? Characteristics, limitations and future perspectives of viral vector transduction. Curr Gene Ther 4:357-372 604. El-Aneed A 2004 An overview of current delivery systems in cancer gene therapy. J Control Release 94:1-14 605. Braun S 2008 Muscular gene transfer using nonviral vectors. Curr Gene Ther 8:391-405 606. Kimball KJ, Preuss MA, Barnes MN, Wang M, Siegal GP, Wan W, Kuo H, Saddekni S, Stockard CR, Grizzle WE, Harris RD, Aurigemma R, Curiel DT, Alvarez RD A phase I study of a tropism-modified conditionally replicative adenovirus for recurrent malignant gynecologic diseases. Clin Cancer Res 16:5277-5287 607. Gebre-Medhin S, Mulder H, Pekny M, Westermark G, Tornell J, Westermark P, Sundler F, Ahren B, Betsholtz C 1998 Increased insulin secretion and glucose tolerance in mice lacking islet amyloid polypeptide (amylin). Biochem Biophys Res Commun 250:271-277 608. Mulder H, Gebre-Medhin S, Betsholtz C, Sundler F, Ahren B 2000 Islet amyloid polypeptide (amylin)-deficient mice develop a more severe form of alloxan-induced diabetes. Am J Physiol Endocrinol Metab 278:E684-691 609. Gebre-Medhin S, Mulder H, Zhang Y, Sundler F, Betsholtz C 1998 Reduced nociceptive behavior in islet amyloid polypeptide (amylin) knockout mice. Brain Res Mol Brain Res 63:180- 183 610. O'Connell PJ, Hawthorne WJ, Holmes-Walker DJ, Nankivell BJ, Gunton JE, Patel AT, Walters SN, Pleass HC, Allen RD, Chapman JR 2006 Clinical islet transplantation in type 1 diabetes mellitus: results of Australia's first trial. Med J Aust 184:221-225 611. Watson DJ, Lander AD, Selkoe DJ 1997 Heparin-binding properties of the amyloidogenic peptides Abeta and amylin. Dependence on aggregation state and inhibition by Congo red. J Biol Chem 272:31617-31624 612. Konno T, Oiki S, Morii T 2007 Synergistic action of polyanionic and non-polar cofactors in fibrillation of human islet amyloid polypeptide. FEBS Lett 581:1635-1638 613. Motamedi-Shad N, Monsellier E, Chiti F 2009 Amyloid Formation by the Model Protein Muscle Acylphosphatase is Accelerated by Heparin and Heparan Sulfate Through a Scaffolding- Based Mechanism. J Biochem 614. Elimova E, Kisilevsky R, Ancsin JB 2009 Heparan sulfate promotes the aggregation of HDL- associated serum amyloid A: evidence for a proamyloidogenic histidine molecular switch. FASEB J 23:3436-3448 615. Relini A, De Stefano S, Torrassa S, Cavalleri O, Rolandi R, Gliozzi A, Giorgetti S, Raimondi S, Marchese L, Verga L, Rossi A, Stoppini M, Bellotti V 2008 Heparin strongly enhances the formation of beta2-microglobulin amyloid fibrils in the presence of type I collagen. J Biol Chem 283:4912-4920 187  616. Suk JY, Zhang F, Balch WE, Linhardt RJ, Kelly JW 2006 Heparin accelerates gelsolin amyloidogenesis. Biochemistry 45:2234-2242 617. Cortijo-Arellano M, Ponce J, Durany N, Cladera J 2008 Amyloidogenic properties of the prion protein fragment PrP(185-208): comparison with Alzheimer's peptide Abeta(1-28), influence of heparin and cell toxicity. Biochem Biophys Res Commun 368:238-242 618. Cohlberg JA, Li J, Uversky VN, Fink AL 2002 Heparin and other glycosaminoglycans stimulate the formation of amyloid fibrils from alpha-synuclein in vitro. Biochemistry 41:1502- 1511 619. Castillo GM, Cummings JA, Yang W, Judge ME, Sheardown MJ, Rimvall K, Hansen JB, Snow AD 1998 Sulfate content and specific glycosaminoglycan backbone of perlecan are critical for perlecan's enhancement of islet amyloid polypeptide (amylin) fibril formation. Diabetes 47:612-620 620. Klajnert B, Cortijo-Arellano M, Bryszewska M, Cladera J 2006 Influence of heparin and dendrimers on the aggregation of two amyloid peptides related to Alzheimer's and prion diseases. Biochem Biophys Res Commun 339:577-582 621. Yamaguchi I, Suda H, Tsuzuike N, Seto K, Seki M, Yamaguchi Y, Hasegawa K, Takahashi N, Yamamoto S, Gejyo F, Naiki H 2003 Glycosaminoglycan and proteoglycan inhibit the depolymerization of beta2-microglobulin amyloid fibrils in vitro. Kidney Int 64:1080-1088 622. Park K 2003 Domains in islet amyloid polypeptide important in fibril formation and toxicity. In: Pathology. Vancouver: University of British Columbia 623. Westermark P, Wernstedt C, Wilander E, Hayden DW, O'Brien TD, Johnson KH 1987 Amyloid fibrils in human insulinoma and islets of Langerhans of the diabetic cat are derived from a neuropeptide-like protein also present in normal islet cells. Proc Natl Acad Sci U S A 84:3881- 3885 624. Paulsson JF, Andersson A, Westermark P, Westermark GT 2006 Intracellular amyloid-like deposits contain unprocessed pro-islet amyloid polypeptide (proIAPP) in beta cells of transgenic mice overexpressing the gene for human IAPP and transplanted human islets. Diabetologia 49:1237-1246 625. Woodrow SI, Stewart RJ, Kisilevsky R, Gore J, Young ID 1999 Experimental AA amyloidogenesis is associated with differential expression of extracellular matrix genes. Amyloid 6:22-30 626. Patey SJ 2006 The role of heparan sulfate in the generation of Abeta. Drug News Perspect 19:411-416 627. Bucciantini M, Giannoni E, Chiti F, Baroni F, Formigli L, Zurdo J, Taddei N, Ramponi G, Dobson CM, Stefani M 2002 Inherent toxicity of aggregates implies a common mechanism for protein misfolding diseases. Nature 416:507-511 628. Rigacci S, Guidotti V, Bucciantini M, Parri M, Nediani C, Cerbai E, Stefani M, Berti A Oleuropein aglycon prevents cytotoxic amyloid aggregation of human amylin. J Nutr Biochem 21:726-735 629. Pallares I, Berenguer C, Aviles FX, Vendrell J, Ventura S 2007 Self-assembly of human latexin into amyloid-like oligomers. BMC Struct Biol 7:75 630. Wu JW, Breydo L, Isas JM, Lee J, Kuznetsov YG, Langen R, Glabe C Fibrillar oligomers nucleate the oligomerization of monomeric amyloid beta but do not seed fibril formation. J Biol Chem 285:6071-6079 631. Reinke AA, Abulwerdi GA, Gestwicki JE Quantifying prefibrillar amyloids in vitro by using a "thioflavin-like" spectroscopic method. Chembiochem 11:1889-1895 632. Wang J, Dickson DW, Trojanowski JQ, Lee VM 1999 The levels of soluble versus insoluble brain Abeta distinguish Alzheimer's disease from normal and pathologic aging. Exp Neurol 158:328-337 633. Sabek OM, Fraga DW, Minoru O, McClaren JL, Gaber AO 2005 Assessment of human islet viability using various mouse models. Transplant Proc 37:3415-3416 634. Pearson T, Shultz LD, Lief J, Burzenski L, Gott B, Chase T, Foreman O, Rossini AA, Bottino R, Trucco M, Greiner DL 2008 A new immunodeficient hyperglycaemic mouse model 188  based on the Ins2Akita mutation for analyses of human islet and beta stem and progenitor cell function. Diabetologia 51:1449-1456 635. Gaber AO, Fraga D, Kotb M, Lo A, Sabek O, Latif K 2004 Human islet graft function in NOD-SCID mice predicts clinical response in islet transplant recipients. Transplant Proc 36:1108-1110 636. Hanson MS, Park EE, Sears ML, Greenwood KK, Danobeitia JS, Hullett DA, Fernandez LA A simplified approach to human islet quality assessment. Transplantation 89:1178-1188 637. Teramura Y, Iwata H 2008 Islets surface modification prevents blood-mediated inflammatory responses. Bioconjug Chem 19:1389-1395 638. Lund T, Mangsbo SM, Scholz H, Gjorstrup P, Totterman TH, Korsgren O, Foss A Resolvin E1 reduces proinflammatory markers in human pancreatic islets in vitro. Exp Clin Endocrinol Diabetes 118:237-244 639. Moberg L, Olsson A, Berne C, Felldin M, Foss A, Kallen R, Salmela K, Tibell A, Tufveson G, Nilsson B, Korsgren O 2003 Nicotinamide inhibits tissue factor expression in isolated human pancreatic islets: implications for clinical islet transplantation. Transplantation 76:1285-1288 640. Akima S, Hawthorne WJ, Favaloro E, Patel A, Blyth K, Mudaliar Y, Chapman JR, O'Connell PJ 2009 Tirofiban and activated protein C synergistically inhibit the Instant Blood Mediated Inflammatory Reaction (IBMIR) from allogeneic islet cells exposure to human blood. Am J Transplant 9:1533-1540 641. Juszczak MT, Hughes SJ, Jones GL, Powis SH, Press M 2004 Effect of donor treatment with heparinoids on graft function after intraportal transplantation of a marginal islet mass: an experimental study. Transplant Proc 36:3117-3120 642. Hills FA, Abrahams VM, Gonzalez-Timon B, Francis J, Cloke B, Hinkson L, Rai R, Mor G, Regan L, Sullivan M, Lam EW, Brosens JJ 2006 Heparin prevents programmed cell death in human trophoblast. Mol Hum Reprod 12:237-243 643. Ishikawa Y, Kitamura M 1999 Inhibition of glomerular cell apoptosis by heparin. Kidney Int 56:954-963 644. Ludwig RJ 2009 Therapeutic use of heparin beyond anticoagulation. Curr Drug Discov Technol 6:281-289 645. Dahms SO, Hoefgen S, Roeser D, Schlott B, Guhrs KH, Than ME Structure and biochemical analysis of the heparin-induced E1 dimer of the amyloid precursor protein. Proc Natl Acad Sci U S A 107:5381-5386 646. Jiang X, Myatt E, Lykos P, Stevens FJ 1997 Interaction between glycosaminoglycans and immunoglobulin light chains. Biochemistry 36:13187-13194 647. Bazar E, Jelinek R Divergent heparin-induced fibrillation pathways of a prion amyloidogenic determinant. Chembiochem 11:1997-2002 648. Bourgault S, Solomon JP, Reixach N, Kelly JW Sulfated Glycosaminoglycans Accelerate Transthyretin Amyloidogenesis by Quaternary Structural Conversion. Biochemistry 50:1001- 1015 649. Nielsen SB, Franzmann M, Basaiawmoit RV, Wimmer R, Mikkelsen JD, Otzen DE beta- Sheet aggregation of kisspeptin-10 is stimulated by heparin but inhibited by amphiphiles. Biopolymers 93:678-689 650. Meng F, Abedini A, Song B, Raleigh DP 2007 Amyloid formation by pro-islet amyloid polypeptide processing intermediates: examination of the role of protein heparan sulfate interactions and implications for islet amyloid formation in type 2 diabetes. Biochemistry 46:12091-12099 651. Meng F, Raleigh DP Inhibition of Glycosaminoglycan-Mediated Amyloid Formation by Islet Amyloid Polypeptide and proIAPP Processing Intermediates. J Mol Biol 406:491-502 652. Madine J, Middleton DA Comparison of aggregation enhancement and inhibition as strategies for reducing the cytotoxicity of the aortic amyloid polypeptide medin. Eur Biophys J 39:1281- 1288 189  653. Bergamaschini L, Donarini C, Rossi E, De Luigi A, Vergani C, De Simoni MG 2002 Heparin attenuates cytotoxic and inflammatory activity of Alzheimer amyloid-beta in vitro. Neurobiol Aging 23:531-536 654. Timmer NM, Schirris TJ, Bruinsma IB, Otte-Holler I, van Kuppevelt TH, de Waal RM, Verbeek MM Aggregation and cytotoxic properties towards cultured cerebrovascular cells of Dutch-mutated Abeta40 (DAbeta(1-40)) are modulated by sulfate moieties of heparin. Neurosci Res 66:380-389 655. Hao LN, Zhang QZ, Yu TG, Cheng YN, Ji SL Antagonistic effects of ultra-low-molecular- weight heparin on Abeta25-35-induced apoptosis in cultured rat cortical neurons. Brain Res 1368:1-10 656. Perez M, Wandosell F, Colaco C, Avila J 1998 Sulphated glycosaminoglycans prevent the neurotoxicity of a human prion protein fragment. Biochem J 335 ( Pt 2):369-374 657. Bergamaschini L, Rossi E, Storini C, Pizzimenti S, Distaso M, Perego C, De Luigi A, Vergani C, De Simoni MG 2004 Peripheral treatment with enoxaparin, a low molecular weight heparin, reduces plaques and beta-amyloid accumulation in a mouse model of Alzheimer's disease. J Neurosci 24:4181-4186 658. Bucciantini M, Calloni G, Chiti F, Formigli L, Nosi D, Dobson CM, Stefani M  2004 Prefibrillar amyloid protein aggregates share common features of cytotoxicity. J Biol Chem 279:31374-31382 659. Necula M, Breydo L, Milton S, Kayed R, van der Veer WE, Tone P, Glabe CG 2007 Methylene blue inhibits amyloid Abeta oligomerization by promoting fibrillization. Biochemistry 46:8850-8860 660. Feng Y, Yang SG, Du XT, Zhang X, Sun XX, Zhao M, Sun GY, Liu RT 2009 Ellagic acid promotes Abeta42 fibrillization and inhibits Abeta42-induced neurotoxicity. Biochem Biophys Res Commun 661. Oz M, Lorke DE, Petroianu GA 2009 Methylene blue and Alzheimer's disease. Biochem Pharmacol 78:927-932 662. Aston-Mourney K, Hull RL, Zraika S, Udayasankar J, Subramanian SL, Kahn SE Exendin- 4 increases islet amyloid deposition but offsets the resultant beta cell toxicity in human islet amyloid polypeptide transgenic mouse islets. Diabetologia 663. Miettinen PJ, Ustinov J, Ormio P, Gao R, Palgi J, Hakonen E, Juntti-Berggren L, Berggren PO, Otonkoski T 2006 Downregulation of EGF receptor signaling in pancreatic islets causes diabetes due to impaired postnatal beta-cell growth. Diabetes 55:3299-3308 664. Ray KC, Blaine SA, Washington MK, Braun AH, Singh AB, Harris RC, Harding PA, Coffey RJ, Means AL 2009 Transmembrane and soluble isoforms of heparin-binding epidermal growth factor-like growth factor regulate distinct processes in the pancreas. Gastroenterology 137:1785-1794 665. Campbell SC, Macfarlane WM 2002 Regulation of the pdx1 gene promoter in pancreatic beta- cells. Biochem Biophys Res Commun 299:277-284 666. Miettinen P, Ormio P, Hakonen E, Banerjee M, Otonkoski T 2008 EGF receptor in pancreatic beta-cell mass regulation. Biochem Soc Trans 36:280-285 667. Means AL, Ray KC, Singh AB, Washington MK, Whitehead RH, Harris RC, Jr., Wright CV, Coffey RJ, Jr., Leach SD 2003 Overexpression of heparin-binding EGF-like growth factor in mouse pancreas results in fibrosis and epithelial metaplasia. Gastroenterology 124:1020-1036 668. Li M, Miyagawa J, Moriwaki M, Yuan M, Yang Q, Kozawa J, Yamamoto K, Imagawa A, Iwahashi H, Tochino Y, Yamagata K, Matsuzawa Y 2003 Analysis of expression profiles of islet-associated transcription and growth factors during beta-cell neogenesis from duct cells in partially duct-ligated mice. Pancreas 27:345-355 669. Aviezer D, Yayon A 1994 Heparin-dependent binding and autophosphorylation of epidermal growth factor (EGF) receptor by heparin-binding EGF-like growth factor but not by EGF. Proc Natl Acad Sci U S A 91:12173-12177 190  670. Badman MK, Pryce RA, Charge SB, Morris JF, Clark A 1998 Fibrillar islet amyloid polypeptide (amylin) is internalised by macrophages but resists proteolytic degradation. Cell Tissue Res 291:285-294 671. de Koning EJ, van den Brand JJ, Mott VL, Charge SB, Hansen BC, Bodkin NL, Morris JF, Clark A 1998 Macrophages and pancreatic islet amyloidosis. Amyloid 5:247-254 672. Myers SL, Jones S, Jahn TR, Morten IJ, Tennent GA, Hewitt EW, Radford SE 2006 A systematic study of the effect of physiological factors on beta2-microglobulin amyloid formation at neutral pH. Biochemistry 45:2311-2321 673. Cure P, Pileggi A, Froud T, Messinger S, Faradji RN, Baidal DA, Cardani R, Curry A, Poggioli R, Pugliese A, Betancourt A, Esquenazi V, Ciancio G, Selvaggi G, Burke GW, 3rd, Ricordi C, Alejandro R 2008 Improved metabolic control and quality of life in seven patients with type 1 diabetes following islet after kidney transplantation. Transplantation 85:801-812 674. Shapiro AM, Lakey JR, Ryan EA, Korbutt GS, Toth E, Warnock GL, Kneteman NM, Rajotte RV 2000 Islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid-free immunosuppressive regimen. N Engl J Med 343:230-