Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Expression and stability of wild-type and mutant RUNX1 protein isoforms in T-cell acute lymphoblastic… Olena, Shevchuk Olehivna 2013

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


24-ubc_2013_fall_shevchuk_olena.pdf [ 24.64MB ]
JSON: 24-1.0071996.json
JSON-LD: 24-1.0071996-ld.json
RDF/XML (Pretty): 24-1.0071996-rdf.xml
RDF/JSON: 24-1.0071996-rdf.json
Turtle: 24-1.0071996-turtle.txt
N-Triples: 24-1.0071996-rdf-ntriples.txt
Original Record: 24-1.0071996-source.json
Full Text

Full Text

EXPRESSION AND STABILITY OF WILD-TYPE AND MUTANT RUNX1 PROTEIN ISOFORMS IN T-CELL ACUTE LYMPHOBLASTIC LEUKEMIA  by Olena Olehivna Shevchuk  B.Sc., University of British Columbia, 2009  A THESIS SUBMITTED IN PARTIAL FULLFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Interdisciplinary Oncology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  June 2013  ©Olena Olehivna Shevchuk, 2013  Abstract  Acute lymphoblastic leukemia (ALL) is the most common type of cancer diagnosed in children, and while many patients treated with standard chemotherapy achieve cure, the disease returns in many cases. Current treatments are highly toxic and can cause learning deficits, growth problems, and several other side effects that can persist long after treatment is completed. There is therefore a great need to generate targeted therapies that exploit the molecular linchpins of this disease if clinical improvements are to be made. In seeking out pathways amenable to therapeutic targeting, we have focused recently on the Runt-related (RUNX) gene family members which are known to play important roles in gene regulation generally, are well known to be recurrently mutated in myeloid malignancies, and have recently been discovered to be mutated frequently in T-ALL. The human RUNX1 gene is composed of 12 exons and transcripts are initiated from two different promoters, leading to production of multiple protein isoforms. Of the 3 major isoforms, RUNX1A encodes essentially just the N-terminal, DNA-binding Runt domain and may act in a dominant negative fashion as compared to RUNX1B and RUNX1C, both of which encode substantial C-terminal domains that are thought to mediate protein-protein interactions. Interestingly, a subset of recurrent RUNX1 mutations identified recently in TALL introduce premature stop codons that theoretically encode truncated, RUNX1A-like proteins. In order to understand the role of RUNX1 in T-ALL, we felt it was critical first to determine which of the 3 RUNX1 isoforms are actually expressed at the protein level. To this end, we designed a mass spectrometry based approach to determine the expression and ii  absolute abundance of RUNX1 isoforms in T-ALL cell lines. Further, we sought to determine whether RUNX1 mutations that are predicted to produce dominant-negative polypeptides actually lead to stably expressed truncated peptides, and whether these mutations may alter the expression of the wild-type isoforms. The results from our studies will aid in understanding the functional role of alternatively spliced RUNX1 isoforms and mutations in leukemia and help to determine if targeting of RUNX1 and/or its downstream targets is a viable therapeutic option.  iii  Preface  All experiments were conducted by Olena O. Shevchuk with the exception of the collaborations listed below. Proteomics analysis was facilitated by the Proteomics Core at the Canada’s Michael Smith Genome Sciences Centre, BC Cancer Agency, led by Dr. Gregg Morin. In particular, Se-Wing Grace Cheng, staff scientist - proteomics and mass spectrometry, assisted in the MRM design for protein isoform detection and quantification. Vincent Chen, staff scientistproteomics platform manager, assisted with proteomics sample preparation and operated the mass spectrometer and HPLC systems. Christopher Jenkins assisted with primer design and cloning strategy for the construction of viral 2A peptide vectors. Informed consent of patients or their legal guardians was obtained for the use of primary samples for research purposes. Leukemic samples were obtained at initial diagnosis using approved protocols from institutional review boards (Human ethics protocol #H0600028) and following guidelines set forth by the Declaration of Helsinki. All mice used in these experiments were bred and housed in the Animal Resource Centre of the BC Cancer Research Centre. Using guidelines established by the Canadian Council on Animal Care, animals were bred, maintained and subsequently euthanized under humane conditions and any use of animals as described in these experiments was approved by the animal care committee of the University of British Columbia (Animal Research Protocol #A09-0771).  iv  Table of contents  Abstract.................................................................................................................................... ii! Preface..................................................................................................................................... iv! Table of contents ......................................................................................................................v! List of tables..............................................................................................................................x! List of figures.......................................................................................................................... xi! List of abbreviations ............................................................................................................ xiii! Acknowledgements ............................................................................................................. xvii! Chapter 1: Introduction .........................................................................................................1! 1.1! T-cell acute lymphoblastic leukemia ........................................................................... 1! 1.1.1! Clinical features and diagnosis ............................................................................. 1! 1.1.2! Genetic alterations in T-ALL................................................................................ 2! 1.2! Characteristics of RUNX transcription factors ............................................................ 4! 1.2.1! Runt-related (RUNX) transcription factor family of genes .................................. 4! 1.2.2! Functional domains of RUNX proteins ................................................................ 6! 1.3! Transcriptional, translational and post-translational regulation of RUNX1................ 9! 1.3.1! RUNX1 isoforms .................................................................................................. 9! 1.3.2! Translational regulation of RUNX1 expression through two 5’ UTRs .............. 11! 1.3.3! Post-translational modifications of RUNX1....................................................... 11! 1.4! Transcriptional regulation by RUNX1....................................................................... 13! 1.4.1! Transcriptional activation ................................................................................... 13! 1.4.2! Transcriptional repression................................................................................... 14! v  1.5! Role of RUNX1 in hematopoiesis ............................................................................. 14! 1.5.1! Fetal hematopoiesis............................................................................................. 14! 1.5.2! Adult hematopoiesis............................................................................................ 15! 1.6! Role of RUNX1 in leukemia...................................................................................... 16! 1.6.1! Chromosomal translocations............................................................................... 16! 1.6.2! FPD/AML: germ-line mutations and decreased dosage of RUNX1 in disease.. 20! 1.6.3! Down syndrome: amplifications and increased dosage of RUNX1 in disease... 20! 1.6.4! Somatic point mutations ..................................................................................... 21! 1.6.5! Multistep leukemogenesis in RUNX1-associated leukemias ............................. 22! 1.7! HPLC-ESI-MS/MS .................................................................................................... 22! 1.7.1! High performance liquid chromatography.......................................................... 23! 1.7.2! Tandem mass spectrometry................................................................................. 23! 1.7.3! Multiple reaction monitoring (MRM)................................................................. 25! 1.8! Viral 2A peptide multicistronic vectors..................................................................... 26! 1.9! Thesis objectives........................................................................................................ 27! Chapter 2: Material and methods .......................................................................................28! 2.1! Cell culture................................................................................................................. 28! 2.1.1! Culture of T-ALL cell lines ................................................................................ 28! 2.1.2! Culture of adherent cell types ............................................................................. 28! 2.2! Plasmid construction.................................................................................................. 29! 2.2.1! pcDNA3-nFlag-constructs .................................................................................. 29! 2.2.2! Viral 2A peptide constructs ................................................................................ 30! 2.2.3! RUNX1 truncated R139fs*47 mutant construct ................................................. 34! vi  2.3! Transient transfection................................................................................................. 35! 2.4! Lentivirus generation and spinfection........................................................................ 35! 2.5! Protein analysis - western blotting............................................................................. 35! 2.5.1! Western blot procedure ....................................................................................... 35! 2.5.2! Antibodies utilized in western blot analysis ....................................................... 36! 2.6! Immunoprecipitation.................................................................................................. 37! 2.6.1! Large-scale anti-Flag immunoprecipitation and mass spectrometry .................. 37! 2.6.2! Anti-RUNX1 immunoprecipitation and mass spectrometry............................... 41! 2.7! Genomic DNA extraction, amplification and sequencing ......................................... 41! 2.8! Quantitative real-time PCR........................................................................................ 42! 2.9! Direct immunofluorescent staining - RUNX1 subcellular localization in 293T ....... 44! Chapter 3: Results.................................................................................................................45! 3.1! Characterization of RUNX1 expression in T-ALL..................................................... 45! 3.1.1! Rationale and hypothesis .................................................................................... 45! 3.1.2! Endogenous RUNX1 mRNA expression............................................................. 46!! Assay design and optimization .................................................................... 46!! Results obtained in the human T-ALL cell lines and xenograft-expanded primary patient samples .............................................................................................. 48! 3.1.3! RUNX1 !Exon7 subcellular localization ........................................................... 51! 3.1.4! Endogenous RUNX1 protein expression ............................................................ 53!! Results obtained in the human T-ALL cell lines ......................................... 54!! Results obtained in the human xenograft-expanded primary T-ALL.......... 55! 3.2! Examination of RUNX1 protein levels by mass spectrometry (MS) ........................ 58! vii  3.2.1! Rationale and hypothesis .................................................................................... 58! 3.2.2! Mass spectrometry assay design ......................................................................... 59! 3.2.3! Protein standards for mass spectrometry analysis .............................................. 60!! Overexpression of recombinant RUNX1 proteins in heterologous 293T.... 61!! Optimization of transfection efficiency in 293T cells ................................. 63!! Detection of RUNX1 recombinant proteins in polyacrylamide gel............. 64! 3.2.4! Optimization of anti-nFlag immunoprecipitation ............................................... 65! 3.2.5! Selection of target peptides................................................................................. 67! 3.2.6! Protein enrichment using anti-RUNX1 immunoprecipitation ............................ 73!! Anti-RUNX1 IP in 293T cells transfected with recombinant proteins........ 73!! Relative efficiency of anti-RUNX1 R0406 antibody................................... 74!! Anti-RUNX1 IP in the human T-ALL cell line RPMI 8402 ....................... 76! 3.3! Relevance of RUNX1 mutations in T-ALL................................................................ 77! 3.3.1! Rationale and hypothesis .................................................................................... 77! 3.3.2! RUNX1 mutation hotspots in T-ALL.................................................................. 78! 3.3.3! Exogenous mutated RUNX1 protein expression ................................................ 78! 3.3.4! Evaluation of mutated RUNX1 protein stability ................................................ 81!! Assay design ................................................................................................ 81!! Results obtained in heterologous 293T cells ............................................... 81!! Results obtained in the human T-ALL cell line HPB-ALL......................... 83! Chapter 4: Discussion ...........................................................................................................91! 4.1! Wild-type isoforms and mutant RUNX1 proteins in T-ALL..................................... 91! 4.1.1! RUNX1 mRNA isoforms .................................................................................... 91! viii  4.1.2! RUNX1 protein isoforms.................................................................................... 93! 4.1.3! RUNX1 mutants in T-ALL................................................................................. 97! 4.2! Future directions ...................................................................................................... 101! 4.2.1! Quantitative assessment of the endogenous RUNX1 mutant protein fraction of the total RUNX1 protein pool....................................................................................... 101! 4.2.2! A proteomic-based approach for identifying protein-protein interactions ....... 102! 4.2.3! A proteomic approach for identifying phosphorylated-RUNX1 isoforms ....... 103! 4.2.4! Functional relevance of RUNX1 mutations in T-ALL...................................... 105! Chapter 5: Concluding chapter .........................................................................................108! References.............................................................................................................................109!  ix  List of tables  Table 2.1 RUNX1 mutational status of selected T-ALL cell lines......................................... 28! Table 2.2 Mammalian expression plasmids and primer design.............................................. 29! Table 2.3 PCR mix and program conditions........................................................................... 30! Table 2.4 Viral 2A peptide constructs and primer design ...................................................... 31! Table 2.5 List of reagents used for immunoprecipitation ....................................................... 39! Table 2.6 Recipe for IP lysis/wash buffer............................................................................... 39! Table 3.1 Selection of transitions for targeted peptides selected for MRM ........................... 69! Table 3.2 Synthetic peptides corresponding to common and unique target regions .............. 72! Table 4.1 Experimentally verified RUNX1 interactions partners on the dbPTM database.. 103!  x  List of figures  Figure 1.1 RUNX1/CBF"/DNA complex ................................................................................ 6! Figure 1.2 Structure of the Runt domain .................................................................................. 7! Figure 1.3 RUNX1 protein domains......................................................................................... 8! Figure 1.4 RUNX1 isoforms and genomic locus.................................................................... 10! Figure 1.5 Histology of RUNX1 wild-type and knockout embryos....................................... 15! Figure 1.6 RUNX1 fusion genes associated with leukemia ................................................... 17! Figure 1.7 The mass analyzer in tandem mass spectrometry.................................................. 24! Figure 2.1 Design of nFlag-CBF"---E2A---nFlag-GFP---P2A---nFlag-RUNX1 vectors...... 33! Figure 3.1 Development of a qRT-PCR method to quantify RUNX1 isoforms...................... 49! Figure 3.2 qRT-PCR showing mRNA expression levels of RUNX1 isoforms....................... 51! Figure 3.3 Expression of exogenous RUNX1B !Exon7 in 293T cells .................................. 53! Figure 3.4 Expression of endogenous RUNX1 in T-ALL cell lines....................................... 55! Figure 3.5 Expression of endogenous RUNX1 in xenograft-expanded primary T-ALL ....... 56! Figure 3.6 Alignment of RUNX1 isoforms: RUNX1A, RUNX1B and RUNX1C ................ 59! Figure 3.7 MRM experimental design .................................................................................... 60! Figure 3.8 Expression of exogenous RUNX1 in 293T cell .................................................... 62! Figure 3.9 Transfection method optimization......................................................................... 63! Figure 3.10 Recombinant RUNX1 proteins on polyacrylamide gel....................................... 64! Figure 3.11 Anti-nFlag immunoprecipitation ......................................................................... 67! Figure 3.12 Sequence coverage obtained for RUNX1 isoforms in MS/MS analysis............. 68! Figure 3.13 Validation of multiple reaction monitoring (MRM) transitions.......................... 71! xi  Figure 3.14 Anti-RUNX1 (R0406) immunoprecipitation ...................................................... 74! Figure 3.15 Efficiency of anti-RUNX1 IP antibody in contrast to anti-Flag M2 resin .......... 75! Figure 3.16 IP western blot RUNX1 analysis of T-ALL cell line RPMI 8402 ...................... 76! Figure 3.17 RUNX1 mutants identified in T-ALL ................................................................. 78! Figure 3.18 Expression of exogenous RUNX1 in 293T cells................................................. 80! Figure 3.19 Cleavage and expression of 2A peptide linked proteins in transfected 293T ..... 83! Figure 3.20 Cleavage and expression of 2A peptide linked proteins in HPB-ALL ............... 88! Figure 3.21 Immunoprecipitation and growth competition assay of 2A peptide constructs in the T-ALL cell line HPB-ALL ............................................................................................... 90!  xii  List of abbreviations  Ab: Antibody AGM: aorta-gonad-mesonephros ALL: Acute lymphoblastic leukemia AML1: acute myeloid leukemia 1 APC: anaphase promoting complex B-ALL: B-cell precursor acute lymphoblastic leukemia C/EBP#: CCAAT/enhancer binding protein # CBF: core binding factor Cdc20: cell-division cycle protein 20 CDK: cyclin-dependent kinase CDKN2A: cyclin-dependent kinase inhibitor 2A CDKN2B: cyclin-dependent kinase inhibitor 2B CNS: central nervous system CML: Chronic myelogenous (or myeloid) leukemia DNA: Deoxyribonucleic acid DMSO: Dimethyl sulfoxide DS: Down syndrome ETP: early T-cell precursor ETS: E-twenty six FBS: Fetal bovine serum FBW7: F-box and WD repeat domain-containing 7 xiii  FPD/AML: Familial platelet disorder with predisposition to acute myelogenous leukemia G-CSF: Granulocyte colony stimulating factor GM-CSF: Granulocyte macrophage colony stimulating factor g: Gram HAT: Histone acetyl transferase HDAC: Histone deacetylases HRP: Horseradish peroxidase HOXA: Homeobox protein A HPLC: High Performance Liquid Chromatography HPLC-ESI-MS/MS: HPLC-Electrospray tandem mass spectrometry INK4: Inhibitors of CDK4 IL: Interleukin Kb: Kilobase pairs kDa: Kilodaltons L: Litre LMO1: LIM domain only 1 LMO2: LIM domain only 2 LYL1: Lymphoblastic leukemia derived sequence 1 µg: Microgram µl: Microlitre M-CSF: Macrophage colony stimulating factor mg: Milligram ml: Millilitre xiv  mM: Millimolar mRNA: Messenger ribonucleic acid mAb: Monoclonal antibody MDS: myelodysplastic syndrome MDS-AML: MDS-related acute myeloid leukemia MLL: mixed-lineage leukemia MRM: Multiple Reaction Monitoring MS: Mass spectrometry NOTCH1: Notch homolog 1, translocation-associated NF-$B: nuclear factor kappa-light-chain-enhancer of activated B cells NFAT: Nuclear factor of activated T-cells NMTS: nuclear matrix targeting signal P53: tumor protein 53 PAGE: Polyacrylamide gel electrophoresis PBS: Phosphate-buffered saline PCR: Polymerase chain reaction PEBP2: polyomavirus enhancer-binding protein 2 PEI: polyethylenimine PEST: proline (P), glutamic acid (E), serine (S) and threonine (T) rich PRMT: protein arginine methyl transferase PTM: post-translational modification Py: pyrimidine RT-PCR: reverse transcription-polymerase chain reaction xv  RUNX: Runt-related SDS: Sodium dodecyl sulphate STAT: Signal transducers and activators of transcription TAD: Transcriptional activation domain TAL1: T-cell acute lymphocytic leukemia 1 TAL2: T-cell acute lymphocytic leukemia 2 T-ALL: T-cell acute lymphoblastic leukemia TCR: T-cell receptor TLE: Transducin-like enhancer TLX1/HOX11: T-cell leukemia homeobox 1 UTR: Upstream terminal region WT: Wild type  xvi  Acknowledgements  I would like to express my deepest gratitude to my supervisor Dr. Andrew Weng, who gave me an opportunity to work under his guidance on a number of exciting projects that led to a very productive MSc degree. The invaluable research experience gained in the Weng lab helped me to realize my career goals. Sincere thanks go out to my thesis supervisory committee, Dr. Gregg Morin and Dr. Aly Karsan, for their insightful comments and direction. Additionally, I would like to thank my thesis defense external examiner Dr. Kevin Bennewith and thesis defense chair Dr. Cathie Garnis for taking time out of their busy schedules to assist in the final steps towards the completion and defense of my thesis. I would like to thank our collaborators Se-Wing Grace Cheng and Vincent Chen, for all their assistance. Special regards to all my colleagues in the Weng lab. Special thanks are owed to my parents and sister, who have encouraged and supported me in all my endeavors.  xvii  Dedication  To my loving husband Christopher R. Jenkins  xviii  Chapter 1: Introduction  1.1 1.1.1  T-cell acute lymphoblastic leukemia Clinical features and diagnosis Acute lymphoblastic leukemia (ALL) is the most common malignancy diagnosed in  children, accounting for 30% of cancer diagnoses made under the age of 20 years (Smith et al. 2010). Of these cases, roughly 15% derive from the T-cell lineage (T-ALL) (Pui, Relling, and Downing 2004). Steady improvements in treatment protocols have recently led to survival rates near 80% in children (Pui and Evans 2006); however, the remaining 20% have uniformly poor outcomes (Klumper et al. 1995). Although, this malignancy is rare in adults (25% of adult ALLs), it carries a very poor prognosis with an overall long-term survival rate of only 30-40% (Rowe et al. 2005). T-ALL is an aggressive type of leukemia characterized by high peripheral white blood cell counts, frequent mediastinal masses with pleural effusions in the thoracic cavity, and involvement of the central nervous system (Grabher, von Boehmer, and Look 2006). Symptoms of T-ALL are a reflection of bone marrow infiltration and subsequent failure; including anemia (low numbers of red blood cells), thrombocytopenia (low platelet counts), and neutropenia (low number of neutrophils). The diagnosis of T-ALL is established upon blood and bone marrow tests: complete blood count, immunophenotyping, morphological examination of bone marrow aspirate and cytogenetic analysis of the blasts (Mandrell 2009). So far, the therapeutic strategies implemented have focused on intensifying multiagent chemotherapy (Asselin et al. 2011). Current treatments are highly toxic and can cause learning deficits, growth problems and chronic health conditions that persist long after treatment is completed, especially in pediatric patients 1  (Robison 2011). For these reasons, attention should be focused on furthering our understanding of the molecular pathways that support T-ALL in order to generate targeted therapies that reduce the potential years of life lost in children and improving survival outcomes for adults (Seibel et al. 2008).  1.1.2  Genetic alterations in T-ALL T-cell acute lymphoblastic leukemia is a heterogeneous disease, involving a variety of  genetic alterations that lead to the transformation of lymphoid precursors along with eventual uncontrolled proliferation and clonal expansion of blasts (Graux et al. 2006). Chromosomal aberrations, the most common alteration in T-ALL (found in ~50% of T-ALL cases), affect key transcription factors involved in cell cycle, differentiation and survival of the cell (Aifantis, Raetz, and Buonamici 2008; Armstrong and Look 2005). Among the most recurrent chromosomal translocations in T-ALL are those involving the T-cell receptor (TCR) loci (Le Noir et al. 2012; Cauwelier et al. 2006). These take place during thymocyte development and often involve the juxtaposition of enhancer elements from the TCR genes with those encoding transcription factors, which may have roles in normal T-cell development but are expressed at levels higher than that found in normal development. Consequently, these abnormalities result in ectopic expression of genes such as TAL1, TAL2, LMO1, LMO2, LYL1, and TLX (HOX11) that upon activation block differentiation at specific stages of T cell development (Van Vlierberghe et al. 2008). In addition, chromosomal translocations can generate hybrid genes through juxtaposition of part of each gene into the joint segment, such as MLL-MLLT1 (ENL), resulting in chimeric proteins with oncogenic properties (Van Vlierberghe et al. 2008; Armstrong and Look 2005). A number of chromosomal 2  translocations occur in a mutually exclusive manner, and therefore can be employed to delineate T-ALL into distinct cytogenetic subtypes that were demonstrated to have dissimilar prognoses (Pui et al. 2012; Mullighan 2012). The most frequent deletions observed in T-ALL (up to 80% of cases) are of the tumor suppressor genes of cyclin-dependent kinase inhibitor genes, CDKN2B (p15(INK4b)) and CDKN2A (p16(INK4a), which play an important role in regulation of the cell cycle (Sulong et al. 2009; Faderl et al. 1999; Cayuela et al. 1996). These cryptic deletions of the INK4 locus leads to a loss of cell cycle control allowing cells to bypass cell cycle checkpoints which aid in the progression to T-ALL (Iolascon et al. 1996). One of the most important mutational targets in T-ALL is the transmembrane receptor NOTCH1, an important regulator of T-cell development (Radtke et al. 2004). NOTCH1 is mutated in more than 50% of cases of T-ALL resulting in the constitutive activation of the Notch signaling pathway (Weng et al. 2004). Moreover, inactivating mutations in negative regulatory elements of the Notch pathway, such as the ubiquitin ligase FBW7 (8-16% of cases), further potentiate Notch signaling (O'Neil et al. 2007; Thompson et al. 2007). These findings and subsequent functional studies have pointed to the Notch signaling pathway as a promising therapeutic target in T-ALL (Weng et al. 2004; Tatarek et al. 2011; Chiang et al. 2013). Emergence of next-generation DNA sequencing and mutational analyses have enhanced our ability to identify genetic alterations that help to refine the generalized classification schema based on abnormal karyotypes and include new ALL subtypes (Pui et al. 2012). A novel subtype comprising 15% of T-ALL, termed early T-cell precursor (ETP) ALL, has been identified as a high-risk subtype in which blasts have been characterized by their similarity to a subset of immature thymocytes that retain multilineage differentiation potential (myeloid and T-cells) 3  (Coustan-Smith et al. 2009). Whole-genome sequencing of ETP-ALL cases discovered cytokine receptor/ RAS signaling and histone-modifying gene activating mutations as well as inactivating mutations in transcription factors (including RUNX1) that play a role in normal hematopoietic development (Zhang et al. 2012). These findings suggest that patients with aggressive ETP-ALL that have poor response to standard chemotherapy treatment of T-ALL may benefit from new targeted therapies (Pui et al. 2012; Coustan-Smith et al. 2009).  1.2 1.2.1  Characteristics of RUNX transcription factors Runt-related (RUNX) transcription factor family of genes The Runt-related (RUNX) gene family consists of three paralogous mammalian members  that arose through gene duplication events (Rennert et al. 2003). RUNX1, RUNX2 and RUNX3 play an important role in cell specification during development and their deregulation has been implicated in human leukemia (Ito 2008). The founding member of the RUNX family was the Drosophila regulatory gene runt, that was found to play a role in embryonic segmentation pattern initiation and was subsequently discovered to impact neurogenesis and sex determination (Duffy, Kania, and Gergen 1991; Gergen and Butler 1988). Although, the three RUNX gene products bind to similar consensus DNA motifs (PyGPyGGTPy; where Py is pyrimidine) and interact with common transcriptional modulators, they nonetheless have distinct biological activities (Ito 1999). The importance of RUNX1 in the establishment of hematopoiesis during development is well recognized (Okuda et al. 1996; Wang, Stacy, Binder, et al. 1996). Identification of the fusion protein AML1-MTG8 (RUNX1-ETO) in t(8;21) acute myeloid leukemia, prompted extensive studies of RUNX1 in human leukemia which have since identified RUNX1 as one of the most mutated genes in human leukemia (Miyoshi et al. 1991). RUNX2 has an essential role in 4  bone/skeletal development (Yoshida, Furuichi, et al. 2002; Otto et al. 1997). It has been implicated in the development and/or progression of certain malignancies, such as prostate cancer and metastatic bone disease (Blyth et al. 2010; Pratap, Lian, and Stein 2011). RUNX3 is expressed in a broader range of tissues in contrast to other RUNX genes and findings suggest that it plays a prominent role in neuronal development (Levanon et al. 2002; Inoue et al. 2002) and in the maturation of single-positive (SP) CD8+ T cells (Woolf et al. 2003). Numerous reports implicate RUNX3 as a tumor suppressor in gastric, colon and breast cancers (Li et al. 2002; Ito et al. 2005; Lau et al. 2006; Goel et al. 2004). Interestingly, an oncogenic role for RUNX3 has also been suggested in ovarian, head and neck cancers and basal cell carcinomas (Tsunematsu et al. 2009; Lee et al. 2011; Salto-Tellez et al. 2006). To date, roles for the RUNX family genes have been described in various biological systems and RUNX gene products have been documented to have both oncogenic and tumor-suppressive functions. RUNX genes encode the DNA-binding (#) subunit of a heterodimeric transcription factor complex (Figure 1.1). The core binding factor (CBF) "-subunit is a cofactor that forms heterodimers with the #-subunit, enhancing the DNA-binding affinity and stability of the complex (Ito 2004; Blyth, Cameron, and Neil 2005; Wang, Stacy, Miller, et al. 1996; Ogawa, Inuzuka, et al. 1993). All three RUNX genes are trascriptionally regulated by distal (P1) and proximal (P2) promoter regions that encode isoforms with distinct sequences (Levanon and Groner 2004). The nomenclature of the genes encoding the Runt-domain class of transcription factors has been historically confusing, as different research groups who independently discovered this gene family were using a variety of names prior to systematic designation of RUNX adapted in  5  1999 (van Wijnen et al. 2004). RUNX genes designations: RUNX1(AML1/PEBP2!B/CBFA2), RUNX2 (AML3/PEBP2!A/CBFA1), and RUNX3 (AML2/PEBP2aC/CBFA3).  Figure 1.1 RUNX1/CBF!/DNA complex (A) Ribbon representation of the RUNX1/CBF"/DNA complex (PDB code 1H9). The RUNX1 Runt domain is depicted in grey and CBF" in green. (B) The !-subunit binds to the DNA sequence PyGPyGGT, where Py is a pyrimidine. The "-subunit forms a 1:1 complex with the !subunit, thereby increasing the binding affinity of RUNX1 for DNA.  1.2.2  Functional domains of RUNX proteins The 128 amino acid Runt domain is one of the most highly conserved features of RUNX  proteins and is found in close proximity to the N-terminal region (Huang et al. 1999). CBF" does not bind to DNA itself but instead interacts with the Runt domain of RUNX proteins to allosterically enhance the DNA-binding affinity and stability of this complex (Ito 2004; Blyth, Cameron, and Neil 2005; Wang, Stacy, Miller, et al. 1996; Ogawa, Inuzuka, et al. 1993). Nuclear magnetic resonance (NMR) spectroscopy has been used to determine the three-dimensional 6  structure of the Runt domain (Nagata et al. 1999). Crystal structures of the Runt domain/CBF"/DNA ternary complex followed thereafter (Bravo et al. 2001). The structure of the Runt domain was shown to consist of 12 anti-parallel " strands separated by flexible loops forming an S-type immunoglobulin fold (Bravo et al. 2001; Nagata et al. 1999; Warren et al. 2000) (Figure 1.2). Three loop regions involved in DNA recognition contact both the major and minor grooves of DNA, while CBF" binds at a face of Runt that is distinct from the DNA binding region (Bravo et al. 2001; Warren et al. 2000). Of note, the Runt domain fold is known to be structural similar to several transcription factors: p53, NF-$B, NFAT1, the T-domain of Brachyury T-box family of proteins and the STAT proteins (Nagata et al. 1999).  Figure 1.2 Structure of the Runt domain The Runt domain is composed of 12 " strands (shown here in yellow) separated by flexible loops forming as S-type immunoglobulin fold (PDB code 1H9).  Although the proline, serine and threonine (PST) rich C-terminal region of RUNX proteins is less conserved, common features include activation/inhibition domains and certain 7  specifically conserved motifs such as a nuclear localization signal (NLS), a nuclear matrix targeting signal (NMTS), and a VWRPY motif (Aronson et al. 1997; Zeng et al. 1997; Zeng et al. 1998) (Figure 1.3). An inhibitory domain, located juxtaposed to the C-terminal end of the activation domain, can influence the transactivation potential of full-length RUNX1 (Kanno et al. 1998). The RUNX1 protein contains two regions essential for its nuclear localization; An NLS is present at the end of the Runt domain and a NMTS in the C-terminal region of the protein mediates interaction of RUNX1 with the nuclear matrix (Zeng et al. 1998; Kanno et al. 1998). The VWRPY motif functions as a recruitment motif, mediating the Groucho/TLE-dependent transcriptional repressor activities (Aronson et al. 1997).  Figure 1.3 RUNX1 protein domains RUNX1 domains and conserved motifs are shown with annotations based on the RUNX1B isoform. Figure adapted from RUNX1 and RUNX1-ETO: roles in hematopoiesis and leukemogenesis (Lam and Zhang 2012), © Frontiers in Bioscience 2012, accessed January 2013.  8  1.3 1.3.1  Transcriptional, translational and post-translational regulation of RUNX1 RUNX1 isoforms Although several putative mRNA isoforms of RUNX1 have been detected, there are three  major mRNA and protein isoforms that are the collective output of alternatively spliced products driven by two promoters (Levanon et al. 2001). These are known as RUNX1A (250 amino acids), RUNX1B (453 amino acids) and RUNX1C (450 amino acids) (Figure 1.4). All three isoforms contain the Runt domain, yet only RUNX1B and RUNX1C encode full-length RUNX1 proteins. RUNX1A lacks the activation/inhibitory domains present in the C-terminal region common in the other two isoforms (Tanaka et al. 1995). This shorter isoform retains the Runt domain, but lacks the C-terminal end, and is thought to act as a competitive inhibitor of fulllength RUNX1 (Tanaka et al. 1995). RUNX1A and RUNX1B share the same N-terminal region; they are transcribed from the proximal promoter (P2) nested within a large CpG island and are produced by alternative splicing (Miyoshi et al. 1995; Levanon et al. 2001). RUNX1C differs from RUNX1B by only 32 unique amino acids in the N-terminal region; it’s the longest of the RUNX1 isoforms and is transcribed from a distal (P1) promoter (Levanon et al. 2001). RUNX1B and RUNX1C have the same PST rich C-terminal region which contains a transcriptional activation domain (Bae et al. 1994). The major RUNX1 isoform in terms of relative abundance is cell-context specific, and only a few reports have explored the expression of all three isoforms (Ghozi et al. 1996; Miyoshi et al. 1995). Endogenous RUNX1A thus far has been detected only by reverse transcription-polymerase chain reaction amplification (RT-PCR) (Challen and Goodell 2010; Miyoshi et al. 1995). The implications of having three different isoforms of RUNX1 in biology remains unclear.!The distinct RUNX1 isoforms may have different functions  9  and regulate specific subsets of target genes in a cell-context dependent manner (Levanon and Groner 2004).  Figure 1.4 RUNX1 isoforms and genomic locus (A) The RUNX1 genomic locus on chromosome 21 is shown with the location of the proximal and distal promoters and exons. (B) Exon usage of the three main transcriptional RNA isoforms of RUNX1. (C) The three main RUNX1 protein isoforms are shown with the Runt, Activation (AD) and Inhibition (ID) domains shaded. Figure adapted from RUNX1 and RUNX1-ETO: roles in hematopoiesis and leukemogenesis (Lam and Zhang 2012), © Frontiers in Bioscience 2012, accessed January 2013.  10  1.3.2  Translational regulation of RUNX1 expression through two 5’ UTRs The translational regulation of RUNX1 expression is largely influenced by the two 5'  untranslated regions (UTRs) (Levanon and Groner 2004). The P1-5’UTR (452bp long) directs efficient cap-dependent translation in vitro (Pozner et al. 2000). The P2-5’UTR (1631bp) is much longer, it regulates translation by a functional internal ribosomal entry site (IRES) and is thought to largely impede its translational activity in vitro due to its length and the various cisacting elements along it (Pozner et al. 2000). Although the biological significance of IRESdependent versus cap-dependent translational control is unclear, it adds an additional level control to the fine-tuned regulation of RUNX1 expression. The two promoters and translational control mechanisms produce protein isoforms that differ in their N-terminal region, and might play a role in the production of appropriate amounts of specific isoforms in a time and cell-context dependent manner. For instance, it was recently reported that both promoters play nonredundant roles, and are active at the very onset of hematopoiesis, with a skewing towards activity from the P2 promoter (Bee et al. 2010). Of note, the P1 5’UTR contains binding sites for the RUNX transcription factors, suggesting that RUNX1 protein may possibly autoregulate itself (Drissi et al. 2002).  1.3.3  Post-translational modifications of RUNX1 RUNX1 stability and activity are controlled by various post-translational modifications  (PTMs) including phosphorylation, methylation, acetylation and ubiquitination (Wang et al. 2009). These modifications impact DNA binding activity, heterodimerization, cellular localization and ubiquitin mediated degradation of this particular transcription factor. Furthermore, PTMs impact RUNX1 interactions with other transcription factor partners (Ets1, 11  MYB, T-bet and FoxP3 in T-cells) (Gu et al. 2000; Hernandez-Munain and Krangel 2002; Wong et al. 2011) and epigenetic regulators (p300, MOZ, PRMT1, SUV39H1, mSin3a, HDAC1/3) (Wang et al. 2009; Yoshida and Kitabayashi 2008). RUNX1 interacts with serine/threonine kinases that phosphorylate it at specific sites, mostly in the activation domain. Extracellular signal-regulated protein kinases (ERK1/2) and cyclin-dependent kinases (CDKs) have been shown to phosphorylate RUNX1 and enhance its transcriptional activation (Tanaka et al. 1996; Zhang et al. 2008). It has also been suggested that phosphorylation plays a role in regulating RUNX1 stability/degradation. The ability of the celldivision cycle protein 20 (Cdc20), an essential regulator of cell division, to target RUNX1 for degradation by the anaphase promoting complex (APC) is affected by the phosphorylation state of RUNX1 (Biggs et al. 2006). It appears based on these results that the interaction between RUNX1 and kinases may initially enhance its function, but appears to subsequently trigger its degradation, making this relationship far more complex than first appreciated. Stability of transcription factors is subject to regulation by ubiquitination. To date, complexes such as Cdc20–APC, were found to promote the degradation of phosphorylated RUNX1, yet very few studies have attempted to uncover the E3 ligase for RUNX1 (Shang et al. 2009; Biggs et al. 2006). CHIP/Stub1 is emerging as a candidate E3 ligase that interacts with RUNX1 and regulates its degradation through it ubiquitination activity (Shang et al. 2009). Of note, previous studies suggested that heterodimerization with CBF" may block RUNX1 from ubiquitination, thereby increasing the stability of the complex (Huang et al. 2001). Acetylation by the coactivator acetyltransferase p300 is thought to play an important role in RUNX1 regulation. p300 has been shown to acetylate RUNX1 at two conserved lysine residues (K24, K43) present in N-terminal region (Yamaguchi et al. 2004). This p300-mediated 12  acetylation significantly enhances the amount of RUNX1 bound to DNA and the net transcriptional activity of RUNX1 in vitro (Yamaguchi et al. 2004). A number of groups have suggested that methylation of RUNX1 by protein arginine methyl transferases (PRMTs) may regulate its function. Methylation of RUNX1 by PRMT1 has been demonstrated to affect the region of RUNX1 that interacts with the co-repressor mSin3a, which recruits histone deacetylases (HDACs) to aid in gene repression and silencing (Lutterbach et al. 2000). Upon PRMT1 methylation (R206, R210), the association between RUNX1 and mSin3a is abrogated (Zhao et al. 2008).  1.4 1.4.1  Transcriptional regulation by RUNX1 Transcriptional activation RUNX1 has been demonstrated to activate or repress gene expression depending on its  interactions with associated co-activators and co-repressors. On their own, RUNX proteins are poor activators and need to organize and assemble other regulatory proteins for efficient gene transcription. To achieve transcriptional activation, RUNX1 recruits lineage-specific transcription factors (e.g. ETS-1 in lymphoid cells) and co-activators (p300) that aid in active chromatin remodeling, thereby enhancing its transcription (Ito 2004). Most of the genes that have been demonstrated to be activated by RUNX1 are involved in hematopoiesis, such as surface receptors: T-cell receptors # and " (Sun, Graves, and Speck 1995), and macrophage colony-stimulating factor receptor (M-CSFR) (Zhang et al. 1994); growth factors: interleukin-3 (Uchida, Zhang, and Nimer 1997) and granulocyte-macrophage colony stimulating factor (GM-CSF) (Cockerill et al. 1996).  13  1.4.2  Transcriptional repression RUNX1 proteins can also function as transcriptional repressors, since they can recruit  several co-repressor complexes. Repression can either be direct or through gene silencing. The direct repression involves interaction of RUNX1 with non-DNA binding repressors that recruit histone deacetylases (HDACs) which repress transcription. The Transducin-like enhancer (TLE, mammalian homolog of Groucho) repressor complex can bind to the highly conserved Cterminal motif VWRPY on RUNX1, repressing transcription of target genes (Levanon et al. 1998; Imai et al. 1998). Furthermore, RUNX1 has the potential to interact with the co-repressor mSin3a through a region downstream of the DNA-binding domain (Lutterbach et al. 2000); subsequently recruiting HDACs that convert chromatin into a repressive state. Of note, mSin3A also has also been demonstrated to influence the stability and subnuclear localization of RUNX1 to the nuclear matrix (Imai et al. 2004). RUNX1 proteins can participate in strong, direct interaction with HDACs1, 3 and 9 (HDACs 2, 5, 6 weakly) in vitro, which promote gene silencing (Durst et al. 2003). Also, RUNX1 can recruit SUV39H1, histone methyltransferase that allows the binding of heterochromatin protein-1 (HP1) to silence gene expression (Durst and Hiebert 2004).  1.5 1.5.1  Role of RUNX1 in hematopoiesis Fetal hematopoiesis Evidence supporting the critical role of RUNX1 in hematopoiesis came from the analysis  of RUNX1 knockout mice. The blood islands of the embryonic yolk sac contain the first cells generated during primitive hematopoiesis in the developing mouse embryo, while definitive (fetal and adult) hematopoiesis originates in the aorta-gonad-mesonephros (AGM) region, and 14  then begins to establish sites of further colonization in the spleen, fetal liver and bone marrow (Dzierzak and Medvinsky 1995). Although RUNX1 null mice have normal morphogenesis and yolk-sac derived primitive erythropoiesis, they completely lack definitive fetal liver hematopoiesis and thus die at embryonic day E12.5 from hemorrhaging in the CNS (Okuda et al. 1996; Wang, Stacy, Binder, et al. 1996) (Figure 1.5). Of note, RUNX1-/- and CBF"-/- embryos demonstrate largely overlapping characteristics, suggesting that RUNX1/CBF" heterodimeric transcription complexes are responsible for the phenotypes observed (Sasaki et al. 1996; Wang, Stacy, Binder, et al. 1996).  Figure 1.5 Histology of RUNX1 wild-type and knockout embryos Gross image of Runx1+/- and Runx1-/- E12.5 embryos. Sites of hemorrhage in the Runx1-/embryo are present. Figure from AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis (Okuda et al. 1996), © Elsevier 1996, accessed January 2013.  1.5.2  Adult hematopoiesis The use of conditional knockout mice has recently elucidated the role of RUNX1 in adult  mouse hematopoiesis (Ichikawa et al. 2004). In contrast to hematopoietic defects observed in RUNX1 knockout embryos, adult mice survive as their hematopoietic progenitors remain intact. 15  These results suggest that RUNX1 may be dispensable for maintenance of hematopoietic stem cells (HSC) in adult hematopoiesis. However, studies have demonstrated that RUNX1 excision has lineage-specific effects; creating a block in T-cell and B-cell maturation and resulting in inefficient platelet production (Growney et al. 2005). In the T-cell lineage, a differentiation block in T-cell development was reported to occur during the transition from the DN2 (CD4-CD8CD44+CD25+) to the DN3 (CD4-CD8-CD44-CD25+) stage (Ichikawa et al. 2004). Accordingly, lymphoid development is dependent on RUNX1 at multiple stages of differentiation in order to generate a full complement of mature, differentiated cells. Interestingly, mild myeloid progenitor population expansion had been observed in RUNX1-deficient mice (Growney et al. 2005).  1.6 1.6.1  Role of RUNX1 in leukemia Chromosomal translocations The first implication that RUNX1 may play an important role in leukemia arose from the  discovery of recurrent chromosomal translocations such as the RUNX1-ETO t(8;21) fusion in Acute myeloid leukemia (AML) (Erickson et al. 1992; Miyoshi et al. 1991) and the TELRUNX1 t(12;21) fusion in B-cell precursor acute lymphoblastic leukemia (B-ALL) (Golub et al. 1995; Romana et al. 1995). Since then, multiple translocations involving RUNX1 or its heterodimerization partner CBF" have been identified (Speck and Gilliland 2002). Most frequently, RUNX1 translocations lead to the formation of chimeric transcripts made up of the 5% (N-terminal) region of RUNX1 (including Runt domain) and the 3% (C-terminal) region of a partner gene (ETO). Exceptions include TEL-RUNX1 (ETV6-CBF#2) in which the 3% region of RUNX1 is fused to the 5% region of TEL (Hiebert et al. 1996; Golub et al. 1995) (Figure 1.6). The fusion proteins arising from these translocations have been suggested to promote 16  leukemogenesis by acting as dominant negative inhibitors of canonical transcriptional activation by wild-type RUNX1. RUNX1-ETO and TEL-RUNX1 have been demonstrated to recruit corepressors and actively repress transcription of RUNX1 target genes (Frank et al. 1995; Gelmetti et al. 1998).  Figure 1.6 RUNX1 fusion genes associated with leukemia The RUNX1-ETO fusion gene is predominantly associated with the AML subtype M2. This t(8;21) translocation contains the DNA binding domain of RUNX1 protein, and most of ETO (repression domains, ZF zinc finger). The TEL–RUNX1 fusion gene is predominantly associated with pediatric pre-B-cell acute lymphoid leukemia (B-ALL). This t(12;21) translocation contains the DNA binding and transactivation domain (TA) of RUNX1 and the region of TEL responsible for transcriptional repression (PNT, pointed oligomerization motif). Figure adapted from Corebinding factors in haematopoiesis and leukaemia (Speck and Gilliland 2002), © Nature Publishing Group 2002, accessed January 2013.  The most frequent translocation found in AML, the RUNX1-ETO t(8;21) fusion, accounts for 10-20% of all cases (Miyoshi et al. 1991). ETO (eight-twenty-one or MTG8) is a ubiquitously expressed nuclear protein that can recruit corepressors (mSin3A, numerous HDACs and Nuclear receptor corepressors (N-CoR) complex) to engage in transcriptional repression (Lutterbach et al. 1998). The RUNX1-ETO protein retains the Runt domain of RUNX1 and thus 17  is able to heterodimerize with CBF" and bind to specific RUNX consensus sequences with high affinity (Tanaka et al. 1998). The fusion protein can also efficiently recruit various co-repressors, because the ETO partner retains its ability to form stable complexes (Gelmetti et al. 1998). In many ways it’s not surprising that the RUNX1-ETO fusion protein has such potent leukemogenic potential, as the resulting strong DNA-binding repressor molecule can cause perturbations in the expression of genes normally regulated by RUNX1. For example, RUNX1ETO has been demonstrated to down-regulate the expression of the RUNX1 transcriptional targets PU.1 and C/EBP# (Vangala et al. 2003; Westendorf et al. 1998). Furthermore, RUNX1ETO can block the ability of RUNX1 to transactivate myeloid lineage-specific promoters and cause a differentiation block in myeloid cell lines (Westendorf et al. 1998; Frank et al. 1995). The phenotype of RUNX1-ETO knock-in mice provides further support for the antagonistic function of this fusion protein, as it closely resembles that of RUNX1-knockout mice. RUNX1ETO knock-in mice die around E13.5 from absence of definitive fetal liver hematopoiesis and lethal hemorrhages in the CNS (Okuda et al. 1998). However, the fetal livers of RUNX1-ETO embryos contained multilineage hematopoietic progenitors that demonstrated in vitro aberrant cell proliferation in contrast to RUNX1 or CBF" deficient mice (Okuda et al. 1998). In B-ALL, the TEL-RUNX1 fusion protein generated by the t(12; 21) chromosomal translocation occurs in approximately 25-30% of cases (Golub et al. 1995). TEL-RUNX1 contains the N-terminus (putative repressor domain) of TEL fused to a nearly full-length RUNX1 protein (Runt domain and the C-terminal activation domain). TEL (translocation-Etsleukemia or ETV6) is a transcription factor of the Ets family and contains a C-terminal DNA binding domain and a protein binding domain at the N-terminus (Romana et al. 1995). TEL is recognized to be essential for establishing hematopoietic output of all lineages in the bone 18  marrow (Wang et al. 1998). The TEL-RUNX1 fusion protein retains the ability to bind to the RUNX consensus sequence and can form heterodimers with CBF". Interestingly, despite having the entire C-terminal region of RUNX1, including the trans-activation domain; this fusion protein generally represses RUNX1 transactivation (Fears et al. 1997; Hiebert et al. 1996). This antagonistic activity is attributed to the recruitment of co-repressors; N-CoR and HDACs by TEL and mSin3a by both TEL and RUNX1 (Fenrick et al. 1999; Guidez et al. 2000). Of note, TEL-RUNX1 appears to have a more stable interaction with mSin3a than either TEL or RUNX1 alone (Fenrick et al. 1999). A number of studies have examined whether The TEL-RUNX1 fusion protein can induce leukemia in mice (Andreasson et al. 2001; Bernardin et al. 2002). Their results suggest that since TEL-RUNX1 generated leukemias with low penetrance and long latency, secondary neoplastic mutations are necessary to generate leukemias associated with this translocation. The evidence for preleukemic activity of TEL-RUNX1 comes from retroviral transduction of mouse fetal liver hematopoietic progenitor cells (Morrow et al. 2004). Morrow et al. demonstrated that TEL-RUNX1 causes B-cell progenitors to accrue due to a block in B-cell differentiation. In T-ALL, very few reports describe translocations involving RUNX1. The first reported chromosomal translocation involving RUNX1 in childhood T-cell ALL was t(4;21)(q31;q22) in 12-year-old boy (Mikhail et al. 2002). The fusion partner in this translocation has not been identified, yet it’s possible that the breakpoint resulted in the disruption of the RUNX1 gene function as seen in AML and B-ALL (Mikhail et al. 2002).  19  1.6.2  FPD/AML: germ-line mutations and decreased dosage of RUNX1 in disease The rare autosomal-dominant disorder, Familial platelet disorder with predisposition to  acute myelogenous leukemia (FPD/AML), is typified by thrombocytopenia and impaired platelet function. Individuals with this disorder have a markedly increased risk of developing AML (Ho et al. 1996). FPD/AML patients have heterozygous germline loss-of-function mutations in RUNX1 (Song et al. 1999). The most common mutations involve the Runt domain, but a few Cterminal mutations have also been described. Varying amounts of functional loss of RUNX1 is the result of heterogeneous mutation distributions, which may be reflective of the many different phenotypes between families with FPD/AML. Genetic evident suggests that haploinsufficiency (from the loss of one RUNX1 allele) is sufficient for the penetrance of this phenotype, yet the loss of function of the second allele might be required for progression to AML (Song et al. 1999; Preudhomme et al. 2009). Of note, certain mutations in FPD/AML cases were predicted to have dominant-negative effects (Michaud et al. 2002), suggesting that the amount of RUNX1 may be an essential component in leukemia generation or progression.  1.6.3  Down syndrome: amplifications and increased dosage of RUNX1 in disease Patients with Down syndrome (DS) with constitutional trisomy 21, have an increased risk  (10-20 fold) of acute leukemias with an incidence in AML of 1 in 300 (Gamis et al. 2003; Lange et al. 1998). The megakaryocytic subtype of AML (M7) occurs most frequently in children with DS (Gamis et al. 2003). As RUNX1 is located on chromosome 21 (21q22) it is expected that overexpression of RUNX1 in cases of DS might contribute to the hematological abnormalities observed. In determining, in DS-related megakaryoblastic leukemia, if a third copy of RUNX1 is directly responsible in the leukemogenesis of this disease, transgenic mouse models were 20  employed. Mice with overexpressed RUNX1 developed megakaryocytic leukemia, phenotypically similar to what was observed in DS patients (Yanagida et al. 2005). On a related note, intrachromosomal amplification of chromosome 21 (iAMP21) containing several additional copies of the RUNX1 gene is associated with leukemia of lymphoid lineage, in particular B-ALL (Berger 1997; Harewood et al. 2003). In summary, there is increasing evidence that the dosage of RUNX1 protein may be important in the balance between normal hematopoiesis and leukemogenesis.  1.6.4  Somatic point mutations Sporadic point mutations in the RUNX1 gene are frequently found in various myeloid  malignancies, including several AML subtypes (in particular M0), atypical CML and MDSAML (Osato 2004; Harada and Harada 2009; Zhao et al. 2012). Interestingly AML M0 mutations are predominantly biallelic suggesting possible selection for loss of RUNX1 function in this malignancy (Osato 2004). Recent next generation sequencing efforts have revealed that Tcell Acute Lymphoblastic Leukemias, particularly the ETP-ALL subtype, also harbor point mutations in RUNX1 which are predicted to promote leukemogenesis (Della Gatta et al. 2012; Zhang et al. 2012; Grossmann et al. 2011). The most frequently detected mutations are located in the region responsible for both DNA binding and interactions with its heterodimerization partner (CBF"), which is necessary for full activation or repression of RUNX1 target genes. RUNX1 mutations are heterozygous and in many cases are predicted to encode truncated proteins, and it has been suggested that these RUNX1 mutants may act in a dominant negative manner to antagonize canonical RUNX signaling. Mutations in the C-terminal region are also detected in a number of cases, but based on reporter assays are thought to have a milder inhibitory effect than 21  the Runt domain mutants (Yoshida, Kanegane, et al. 2002). In cases of loss-of-function RUNX1 mutations, haploinsufficient RUNX1 can apparently predispose to leukemia (Ganly, Walker, and Morris 2004).  1.6.5  Multistep leukemogenesis in RUNX1-associated leukemias Various genetic alterations in the RUNX1 gene play an important role in hematopoietic  abnormalities, but only to some extent. The fusion proteins arising from translocations have been suggested to have leukemogenic affect, yet RUNX1-ETO conditional knock-in mice failed to develop spontaneous leukemia and TEL-RUNX1 was able to induce only low incidence and long latency leukemias in small number of cases (Andreasson et al. 2001; Bernardin et al. 2002). Furthermore, RUNX1 mutations in FPD/AML only predispose to leukemia (Song et al. 1999). Cumulative evidence suggests that secondary mutations are necessary for clonal establishment of leukemia associated with RUNX1. The phenotype of malignancy in those cases would largely depend on the context of the affected cell lineage and which genes were somatically mutated following a RUNX1 mutation (Michaud et al. 2002).  1.7  HPLC-ESI-MS/MS  High performance liquid chromatography – Electrospray tandem mass spectrometry HPLC-ESI-MS/MS couples the separation potential of HPLC to mass spectrometry (MS), a specific and sensitive molecular detection method. This methodology aids in reducing the complexity of a sample for analysis. In the analysis of samples for MS, there is still no gold standard approach to the preparation of samples for downstream interpretation. In general, workflows require the optimization of cell lysis, subsequent depletion of confounding proteins or 22  specific enrichment of certain proteins, in-solution or in-gel digestion, followed by peptide enrichment and sample clean-up prior to MS analysis (Kaur and Asea 2011).  1.7.1  High performance liquid chromatography Mass spectrometry (MS) is an analytical technique that involves measuring the mass-to-  charge ratio of charged particles derived from molecules in a sample under study. The sample is ionized to generate charged molecule fragments and then placed in a mass detection system to measure their mass-to-charge ratios. To detect less abundant proteins by mass spectrometry it is common to first fractionate samples using column chromatography, which separates molecules based on chemical properties, such as size and polarity. This step helps to reduce the complexity of the sample. High Performance (Pressure) Liquid Chromatography (HPLC) is a type of column chromatography system that uses high pressures to force a sample mixture dissolved in a liquid (mobile phase) through a column with chromatographic packing material (stationary phase). The interactions between the molecules being analyzed and the two phases determine the sample retention. The chemical properties of the column material and the nature of the gradient influence the rate at which the sample’s molecules will pass through the system. Molecules with the least amount of interaction with the stationary phase (most with mobile phase) will exit the column faster. Following chromatographic separation, compounds get collected for subsequent ionization and mass spectrometry analysis.  1.7.2  Tandem mass spectrometry Tandem mass spectrometry, also called MS/MS, is a common technique that involves  multiple steps of peptide and fragment ion selection, with a fragmentation step occurring 23  between these stages (Lange et al. 2008). The intensities of peptide ions and fragment ions are recorded in addition to their mass-to-charge ratio (m/z). Electrospray ionization is utilized to produce ions from macromolecules (the eluent from the HPLC). The liquid containing the analytes of interest is sprayed though a fine capillary to which a strong electrical charge is applied, resulting in fine charged aerosol droplets. The creation of these ions allows sample molecules to be input into MS as the ions are accelerated into the mass analyzer. The mass analyzer component of the mass spectrometer consists of three sections: Quadrupole 1 (precursor ion selection), Quadrupole 2 (collision cell), and Quadrupole 3 (fragment ion selection) (Figure 1.7). Upon ionization, the analytes enter the first set of quadrupoles, which act as a filter to specifically select ions according to their m/z values. Only ions with a predefined m/z will have trajectory stable enough to pass through the Quadrupole 1 and into the collision cell, where ions are further dissociated or pass unhindered into Quadrupole 3. Fragment ions of interest are selected in Quadrupole 3 and are finally detected. This type of experiment is performed to identify transitions that can be used for quantification in a targeted MRM (see section 1.7.3).  Figure 1.7 The mass analyzer in tandem mass spectrometry Following electrospray ionization (LC-ESI), precursor ions of interest are selected based on their m/z values in the Quadrupole 1. In collision cell (Quadrupole 2), the analytes are fragmented to generate fragment ions. In Quadrupole 3 the m/z selection of fragment ions of interest is performed before detection. Figure from Selected reaction monitoring for quantitative proteomics: a tutorial (Lange et al. 2008), © EMBO and Nature Publishing Group 2008, accessed January 2013. 24  1.7.3  Multiple reaction monitoring (MRM) Multiple Reaction Monitoring (MRM) is a tandem mass spectrometry scan mode that  allows Quadrupole1 and Quadrupole3 to be fixed (restricted around the m/z value of the ions of interest), thus increasing the sensitivity of the method (Figure 1.8). Specifically, it involves fragmentation of selected peptides (parent ion) and detection of specific peptide fragments (transitions); producing ion chromatograms illustrating individual peaks for different peptides, and overlapping peaks for multiple peptide fragments of the same parent ion. In MRM the full mass spectra are not recorded, and in contrast to full-scan methods, this improves sensitivity by 1-2 orders of magnitude. Using this method allows researchers to detect proteins with relatively low abundance, such as transcription factors, and directly quantify them in highly complex mixtures.  Figure 1.8 Multiple reaction monitoring In data dependent MS/MS operating mode it is possible to mass-select precursor ion in the first stage (Q1), fragment it (Q2) and then detect all resultant fragment ions in the second mass 25  analyzer (Q3). In targeted MRM-MS mode, two stages of mass filtering are employed, where both math analyzers are set to a selected mass for predefined peptides (unique to a protein of interest) together with their most informative fragment ions. Synthetic peptides containing stable-isotope labels can be spiked in and used as internal standards to provide absolute quantification of endogenous analyte. Figure from Quantitative analysis of peptides and proteins in biomedicine by targeted mass spectrometry, © Nature Publishing Group 2012, accessed January 2013.  1.8  Viral 2A peptide multicistronic vectors Vectors designed to express multiple proteins are of great value to researchers since they  allow for efficient expression/delivery of multiple genes into the cell. Viruses can express multiple proteins from a single transcript utilizing 2A peptides (also referred to as cis-actinghydrolase elements). These 2A peptides (18-22 amino acids) were first identified in Picornaviruses (Ryan, King, and Thomas 1991), but since this original discovery, multiple 2A peptide-like sequences have been discovered and utilized from other viruses (E2A, T2A, P2A, F2A and others). The advantages of the use of 2A peptide sequences include their relatively small size and the capability of efficient co-expression of genes separated by these peptides through a 'ribosomal skip' mechanism (Szymczak and Vignali 2005). Ideally, stoichiometric protein expression would be achieved by 2A peptides having nearly 100% cleavage efficiency; however it has been reported that several of these 2A sequences may be relatively inefficient in certain contexts (Kim et al. 2011). The use of multiple promoters and IRES sequences results in nonstoichiometric protein expression and increased vector size. Once the 2A peptide has been cleaved it remains attached to the C-terminus of the N-terminal protein in the sequence, thus theoretically allowing for discrimination between endogenous and recombinant proteins. Moreover, antibodies against these peptides have been generated, allowing for tagging of proteins and their identification in assays. Several studies have already successfully utilized 2A 26  peptide vectors to great effect: co-expression of the two IL-2 subunits (Chaplin et al. 1999); expression of defined TCR-# and TCR-" proteins (Holst et al. 2006).  1.9  Thesis objectives The overall objective is to determine the quantity and stability of RUNX1 protein  isoforms and mutants in T-cell Acute Lymphoblastic Leukemia.  Aim1. Characterize the expression of RUNX1 isoforms in T-ALL Determine the expression and abundance of RUNX1 isoforms in T-ALL cell lines using qRTPCR, western blot analysis, and mass spectrometry (MS).  Aim2. Assess the effect of RUNX1 mutations on protein expression/stability Determine whether mutated RUNX1 proteins are expressed stably in the cell at the protein level using a viral 2A peptide approach.  27  Chapter 2: Material and methods  2.1 2.1.1  Cell culture Culture of T-ALL cell lines Human T-ALL cell lines were grown in RPMI 1640 media supplemented with 10% fetal  bovine serum, 1 mM sodium pyruvate, 2 mM L-glutamine, and antibiotics (penicillin and streptomycin mixture). All cell lines used in this study and their RUNX1 mutational status are summarized in Table 2.1 below.  Table 2.1 RUNX1 mutational status of selected T-ALL cell lines  2.1.2  Culture of adherent cell types 293T (human embryonic kidney; HEK293T) were cultured in Dulbecco's Modified  Eagle's Medium supplemented with 10% fetal bovine serum.  28  2.2 2.2.1  Plasmid construction pcDNA3-nFlag-constructs RUNX1 cDNA from pFlagCMV2-AML1B plasmid (Addgene ID: 12504) was  subcloned into the pcDNA3-nFlag vector (Invitrogen) using the primers indicated in Table 2.2.  Table 2.2 Mammalian expression plasmids and primer design  Construct  Primer FW: 5' -> 3'  Primer RV: 5' -> 3'  Template  pcDNA3nFlagRUNX1A  5’CTAAGATCTGGACTGC GTATCCCCGTAGATGCCA GCACGAGCCGC3’  pFlag CMV2AML1B  pcDNA3nFlagRUNX1B pcDNA3nFlagRUNX1C pcDNA3nFlag-CBF!  5’CTAAGATCTGGACTGC GTATCCCCGTAGATGCCA GCACGAGCCGC3’ 5’CTAAGATCTGGACTTGC TTCAGACAGCATATTTGA GTCATTTCC3’ 5’CTAAGATCTCTGCCGCG CGTCGTGCCCGA3’  5’CTAGAATTCTTAACATC TCCAGGGTGCTGTGTCTT CCTCCTGCATCGACTCTG AGGCTGAGGG3’ 5’CTAGAATTCTCAGTAG GGCCTCCACACGG3’ 5’CTAGAATTCTCAGTAG GGCCTCCACACGG3’  pFlag CMV2AML1B  5’CTAGAATTCCTAGGGTC TTGTTGTCTTCTTGCC3’  pDNR-Dual CBF"  pcDNA3nFlag-GFP  5’CTAAGATCTCTGGTGA GCAAGGGCGAG3’  5’CTAGAATTCTTACTTGT ACAGCTCGTCCATGCC3’  pRRLsin.cPPTCTS. MNDU3.BXE.PGK .GFP.WPRE  pFlag CMV2AML1B  Amplicon length: RUNX1A (753bp), RUNX1B (1362bp), RUNX1C (1443bp), GFP (750bp), CBF" isoforms 2 (549bp).  CBF" was amplified from pDNR-Dual CBF" clone HsCD00002473 (Dana-Farber Cancer Institute; Boston, MA) vector, while GFP was subcloned from lentiviral vector pRRLsin.cPPTCTS.MNDU3.BXE.PGK.GFP.WPRE (Dull et al. 1998). See Table 2.3 for PCR conditions used. 29  Table 2.3 PCR mix and program conditions PCR Mix 5X Phusion HF buffer 10mM dNTP 10µM FW primer 10µM RW primer Phusion DNA polymerase DMSO H 2O DNA template Total  1X ("l) 10 1 2.5 2.5 0.25 1.5 30 1-2 50  To PCR amplify RUNX1B and RUNX1C 5M Betaine (10&l/rxn) was used instead of DMSO.  The PCR products were purified and digested overnight at 37°C with the following restriction sites: BglII and EcoRI, in order to ligate them into pcDNA3-nFlag plasmids digested with BamHI and EcoRI restriction enzymes. One Shot® Mach1™ (Invitrogen) chemically competent E.coli were used for our bacterial transformations. The identity of constructs was verified with confirmation restriction enzyme digestion and by Sanger sequencing to ensure that no mutations were introduced by PCR amplification.  2.2.2  Viral 2A peptide constructs nFlag-CBF", E2A-nFlag-GFP, and P2A-nFlag-RUNX1 were PCR amplified and  subcloned into the pSP72 vector (Promega Corporation; Madison, WI) using the primers listed in Table 2.4.  30  Table 2.4 Viral 2A peptide constructs and primer design  Construct  Primer FW: 5' -> 3'  Primer RV: 5' -> 3'  Template  Bgl2-nFlag-  P1: Bgl2-Koz-nFlag-CBF!  P2: EcoR1-CBF! noSTOP  pcDNA3-nFlag-  CBF!-EcoRI  5’-GAAGATCTGCCGCCACCAT  5’-CCGACAGAATTCGG  CBF"  GGATTACAAGGATGACG-3’  GTCTTGTTGTCTTCTTG CCAG-3’  EcoRI-E2A-  P1: EcoR1-E2A outer  nFlag-GFP-Kpn1  5’-CCGACAGAATTCGGAAG CGGACAGTGTACTAATTATGC TCTCTTGAAATTGGCTGGAGAT  P2: Kpn1-eGFP noSTOP 5’-CCGACAGGTACCCTT  pcDNA3-nFlagGFP  GTACAGCTCGTCCATGC CGAGA -3’  G -3’  P3: E2A-nFlag inner 5’-CTCTCTTGAAATTGGCT GGAGATGTTGAGAGCAACCCT GGACCTATGGATTACAAGGAT GACG -3’  Kpn1-P2A-nFlagRUNX1-Xho1  P1: Kpn1-P2A outer:  P2: Xho1-nFlag RUNX1  5’-CCGACAGGTACCGGAA  5’-TTCCTCGAGTCAGTA  GCGGAGCTACTAACTTCAGCC  GGGCCTCCACACGGCCT  TGCTGAAGCAGGCTGGAGACG  CCTCCAG -3’  pcDNA3-nFlagRUNX1  TG -3’  P3: P2A-nFlag inner: 5’ -CTGAAGCAGGCTGGAGAC GTGGAGGAGAACCCTGGACCT ATGGATTACAAGGATGACG -3’  31  Two rounds of PCR were used to generate fragments of interest; specifically E2A-nFlagGFP, and P2A-nFlag-RUNX1. In the first round, the primer pair P1 and P2 was used; the product from this reaction was then run out on a 1% SYBR Safe™ agarose gel and the desired band was cut out and purified using QIAquick Gel Extraction Kit. This was then used as input material in the second round of “nested” PCR using the P3 primer to amplify the desired final product used for cloning (Figure 2.1). We decided to use the pSP72 vector in our cloning strategy because due its small size it can accommodate large inserts and it contains a large multiple cloning site region that allows for versatile restriction enzyme use. The order of inserts in our viral 2A vectors was critical. The 2A peptide sequences, when cloned between genes, allow for efficient cleavage and stoichiometric production of discrete protein products from a single promoter, within a single vector. Once cleaved, these relatively small (18–22 amino acids) 2A peptide sequence remain attached to the carboxyl terminus of the upstream protein. Thus in our viral 2A vector design, RUNX1 is positioned as the most 3’ cDNA to ensure that its amino acid sequence will be close to its native form upon 2A peptide cleavage (Figure 2.1). The nFlag-CBF" fragment was first subcloned into a pSP72 vector containing the E2A-nFlag-GFP fragment. Then, the P2A-nFlag-RUNX1 fragment was ligated to the intermediate pSP72-nFlag-CBF"---E2A---nFlag-GFP vector. Finally, the desired fragment containing all three insert cDNAs of interest was subcloned into the lentiviral vector pRRLsin.cPPTCTS.MNDU3.BXE.WPRE that uses the MNDU3 promoter to drive the expression of a single transcript encoding 3 different cDNAs separated by 2A peptide cleavage sequences (E2A, P2A). P2A indicates porcine teschovirus-1 2A; E2A, equine rhinitis A virus (ERAV) 2A.  32  Figure 2.1 Design of nFlag-CBF!---E2A---nFlag-GFP---P2A---nFlag-RUNX1 vectors (A) PCR amplification from pcDNA3-nFlag vectors. nFlag-CBF", E2A-nFlag-GFP and P2AnFlag- RUNX1 were subcloned into pSP72 vector backbone. (B) Schematic diagram of pSP72 and lentiviral vectors. P2A indicates porcine teschovirus-1 2A; E2A, equine rhinitis A virus (ERAV) 2A.  33  2.2.3  RUNX1 truncated R139fs*47 mutant construct RUNX1 was amplified using cDNA from the T-ALL cell line which is known to harbor  the mutation 139fs*47 using primers: 5’-CTAAGATCTGGACTTGCTTCAGACAGCATATTTGAGTCATTTCC-3’ and 5’CTAGAATTCTCAGTAGGGCCTCCACACGG-3’. Amplicons were digested with BglII and EcoRI and subcloned into the pcDNA3-nFlag vector (digested with BamHI and EcoRI). Generated pcDNA3-nFlagRUNX1 constructs were sequenced and the mutated RUNX1 clone was identified and used for subsequent cloning. P2A-nFlagRUNX1 mutant was PCR amplified from the pcDNA3-nFlagRUNX1 mutant plasmid using two rounds of PCR; the primer pair P1 and P2 was used in the first round, while the primer pair P1 and P3 was used in second round of amplifications. P1: 5’-CCGACAGGTACCGGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGG AGACGTG -3’  P2: 5’-TTCCTCGAGTCAGTAGGGCCTCCACACGGCCTCCTCCAG -3’ P3: 5’-CTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCTATGGATTACAAGG ATGACG -3’  Following PCR amplification, the amplicon was digested with KpnI and XhoI and subcloned into the pSP72 vector (digested with KpnI and XhoI). Subsequently, the P2A-nFlagRUNX1 mutant fragment was added to the intermediate pSP72-nFlag-CBF"---E2A---nFlag-GFP vector (digested with KpnI and XhoI). Finally, the desired fragment containing all three inserts of interest was subcloned into the lentiviral vector pRRLsin.cPPTCTS.MNDU3.BXE .PGK.GFP.WPRE. 34  2.3  Transient transfection The mammalian pcDNA3-based expression vector plasmids were transfected into 293T  cells (90% confluent 10cm dish) by using the polyethylenimine (PEI) transfection agent (Cedarlane Canada). Per 10cm dish, 8&g of plasmid was diluted in 1mL of serum-free DMEM and mixed with 24&l of PEI (1&g/&l). The mixture was incubated for 20min at room temperature and added drop-wise to the 293T cells. The cells were collected 36 hrs after transfection, and used to make lysates for either western blot or immunoprecipitation.  2.4  Lentivirus generation and spinfection High titer, lentivirus was produced by transfection of 293T producer cells utilizing  pCMV!R8.74, pCMV-VSV-G, and pRSV-REV packaging vectors. CBF", GFP and RUNX1 were overexpressed from the nFlag-CBF"---E2A---nFlag-GFP---P2A---nFlag-RUNX1 vectors. Viral transduction of T-ALL cell lines was performed by spinfection with 4&g/ml polybrene as described (Weng et al. 2006).  2.5 2.5.1  Protein analysis - western blotting Western blot procedure To generate whole cell lysates, cells were washed in ice-cold phosphate-buffered saline,  then lysed in ice-cold 50 mM Tris-HCl (pH 7.4), 1% Nonidet P-40, 0.25% sodium deoxycholate, 150 mM sodium chloride, 1 mM sodium orthovanadate, 1 mM sodium fluoride, 2.5 mM sodium pyrophosphate, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, and protease inhibitor cocktail (1:500 dilution; cat #539134, Calbiochem). The whole cell lysates were run out on SDSPAGE gels and then transferred onto Hybond-ECL membranes (Amersham). Membranes were 35  blocked with 5% nonfat dry milk, and then probed with primary antibodies (See list below). HRP-conjugated secondary antibodies were utilized, and signals were detected by autoradiography.  2.5.2  Antibodies utilized in western blot analysis  The dilution used for each antibody is provided in brackets. Company: Active Motif Europe (Belgium) 1. Anti-AML1/Runx1 (Catalog No: 39000), (1:1000) Company: Sigma-Aldrich 2. Anti-RUNX1 (N-terminal) (Catalog No: R0406), (1:1000) 3. Anti-"-Actin (Catalog No: A1978), (1:5000) 4. Anti-Flag M2 Monoclonal (Catalog No: F1804), (1:5000) Company: Cedarlane (Ontario, Canada) 5. Polyclonal rabbit Anti-Mouse IgG (H&L) (Catalog No: RL610-4320), (1:5000) Company: eBioscience 6. Mouse TrueBlot ULTRA: Anti-Mouse IgG HRP (Catalog No: 18-8817-31), (1:1000) 7. Rabbit TrueBlot®: Anti-Rabbit IgG HRP (Catalog No: 18-8816-33), (1:1000) Company: Invitrogen 8. HRP-Goat Anti-Rabbit IgG (H+L) Conjugate (ZyMax™ Grade) (Catalog No: 81-6120), (1:5000) 9. Company: Cell Signaling 10. Anti-GFP (Catalog No: 2555), (1:500)  36  2.6 2.6.1  Immunoprecipitation Large-scale anti-Flag immunoprecipitation and mass spectrometry This protocol was optimized for immunoprecipitation with the intent of isolating high  quantity of recombinant nFlag-RUNX1 proteins for subsequent mass spectrometry analysis. A list of reagents used for immunoprecipitation can be found in Table 2.5. A total of ~1 ' 108 transfected 293T cells were harvested, washed with 10ml of ice cold PBS (StemCell) and whole-cell lysates were prepared by adding 1ml lysis buffer per plate (i.e 10ml for 10 plate equivalents) to obtain ~106-107 cells/ml (see Table 2.6 for IP lysis/wash buffer recipe). The lysate was incubated for 30 minutes at 4°C on a nutator, centrifuged at maximum speed for 15 minutes at 4°C and clarified by passage through a 0.45 &m nylon syringe filter. The resulting lysate was our INPUT sample. Following cell lysis, lysates were diluted with binding buffer and precleared with Sepharose 4B for 1 hour at 4°C. Sepharose 4B was stored at 4°C in 20% ethanol; washed/equilibrated with lysis buffer; and 50 &l of packed Sepharose 4B resin per 10 plates of cells (100&l of 50% slurry) was used. An aliquot of pre-cleared lysate was collected for immunoblot analysis, this was our PRECLEARED (unbound to the beads alone) sample. nFlag-tagged RUNX1 complexes were immunoprecipitated with Anti-Flag M2 Agarose (Catalog No: A2220) by rotating overnight at 4°C. Anti-Flag M2 affinity resin was stored in 50% glycerol with buffer at -20°C and was washed/equilibrated with buffer at 2–8 °C just prior to use. 20 &l of packed Anti-Flag M2 affinity resin per 10 plates of cells (~40 &l of 50% beads slurry) was used. Following overnight incubation, the sample was centrifuged at 3,000 rpm in a table top centrifuge. The supernatant was largely discarded; 50 &l was saved for western blot analysis as our UNBOUND (to the antibody) sample. Anti-Flag M2 beads with captured nFlag 37  fusion proteins were washed with 1ml of cold lysis buffer 5 times and once with 1ml of 50 mM ammonium bicarbonate. Bound nFlag complexes were eluted with the addition of 100 &l of elution buffer (400 &g/ml Flag peptide and 50mM ammonium bicarbonate). The sample was incubated on nutator for 30 minutes at 4oC; centrifuged at 3000 rpm for 60 seconds at 4oC with the supernatant transferred to a fresh 1.5 ml tube. This is our ELUTED sample. Bound nFlag-containing complexes were washed 5 times with 1mL of PBS, resuspended in 1x LDS sample buffer ( ~20µL), resolved using a 4% -12% gradient gel (NuPAGE, Invitrogen) and stained with colloidal Coomassie stain containing 20% v/v methanol, 1.6% v/v phosphoric acid, 8% w/v ammonium sulfate and 0.08% w/v Commasie G-250. Following destaining, the gel was sliced into equal 16 pieces per lane and in-gel trypsin digestion was performed on areas of interest. The peptides with selected molecular weight were extracted from the gel using protocols described previously (Yap et al. 2011). High-performance liquid chromatography-electrospray-mass spectrometry (MS) was performed using a 4000 QTrap mass spectrometer (Applied Biosystems/Sciex) joined to an Agilent 1100 Nano-HPLC (Agilent Technologies) which included a nano-electrospray interface (Huang et al. 2000).  38  Table 2.5 List of reagents used for immunoprecipitation Product Anti-Flag M2 Agarose 3x Flag peptide Sepharose 4B, bead diameter 40-165 &m Tris (Base) NaCl (sodium chloride) Protease inhibitor cocktail Ammonium bicarbonate NP-40 (Igepal) "-glycerophosphate  Supplier Sigma Sigma Sigma VWR Sigma VWR Sigma Sigma Sigma  Cat. # A2220 F4799 4B200 VW1500-01 S 9888 80053-852 A6141 74385 G9891  Sodium orthovanadate PMSF (phenylmethanesulfonyl fluoride)  Sigma Sigma  450243 P 7626  Table 2.6 Recipe for IP lysis/wash buffer  Note: In the wash buffer increased the concentration of NaCl from 150&M to 350&M  39  Solutions used for immunoprecipitation Final Concentration  Amount  10x Tris buffered saline (TBS), pH 7.4 Tris ......................................................200 mM………………………..24.2 g NaCl ........................................................ 1.5 M………………………..87.7 g Add H2O to 800 ml then adjust the pH to 7.4 with HCl. Top up volume to 1000 ml final.  Flag peptide stock solution Final Concentration  Amount  Flag peptide............................. 5 mg/ml………………………...25 mg TBS, 10x ...........................................1x………………………...5 ml  Ammonium bicarbonate (pH 8) solution Final Concentration  Amount  Ammonium bicarbonate ……………50 mM…………………………..395 mg Add H2O to 100 ml  Elution buffer Final Concentration  Amount  Flag peptide (5 mg/ml)..…………...400 &g/ml……………………….32 &l Ammonium bicarbonate (50 mM)….50 mM…………………………..368 &l  40  2.6.2  Anti-RUNX1 immunoprecipitation and mass spectrometry This protocol was optimized for immunoprecipitation with the intent of isolating  endogenous RUNX1 in T-ALL cell lines. Solutions and buffers as per section 2.6.1. A total of 5 ' 107 cells from the RPMI 8402 cell line was harvested, rinsed with 10ml of ice cold PBS, and whole-cell lysates were prepared (as per Anti-Flag IP protocol). Lysates were precleared with Sepharose 4B for about 1 hour at 4°C. RUNX1 complexes were immunoprecipitated with either 4µg of Anti-RUNX1 antibody (N-terminal) (Sigma, Catalog No: R0406) or 4µg of Active Motif antibody (Anti-AML1/Runx1) by rotating samples overnight at 4°C. Then antibody-antigen complexes were incubated with 20µL of Protein G beads (Invitrogen) for 1 hour at 4°C. Bound RUNX1 complexes were washed and resuspended in 30µL of SDS-PAGE loading dye. Trypsin digestion was performed and high-performance liquid chromatography-electrospray-mass spectrometry (MS) utilized as described previously (Yap et al. 2011). 2.7  Genomic DNA extraction, amplification and sequencing TALL-1 genomic DNA was extracted according to the manufacturer’s instructions  (PureLink Genomic DNA kit; Invitrogen). Exon 5 of RUNX1 was PCR amplified for sequencing with Phusion polymerase (New England Biolabs/Thermo Scientific®) from genomic DNA using RUNX1_Fw 5’-CATTGCTATTCCTCTGCAACC-3’and RUNX1_Rv 5’ACCGAGTTTCTAGGGATTCCA-3’, as per (Della Gatta et al. 2012) on a Dyad Disciple thermal cycler (Bio-Rad). Sanger sequencing was done by McGill University/Genome Quebec using the primers listed above. Sequence analysis was completed using Vector NTI software (Life Technologies). PCR program: 98°C 30 sec, [98°C 5 sec, 68°C 20 sec, 72°C 20 sec] repeat for 30 cycles, then 72°C 10 minutes. 41  2.8  Quantitative real-time PCR  Total RNA was extracted after cell lysis in TRIzol reagent (Invitrogen). First-strand cDNA was generated by reverse transcription with GoScript™ Reverse Transcriptase (Promega) using a mix of random 15-mer and anchored oligo(dT)20+1 primers, 2&g input RNA, and then amplified and quantified using Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen) and the following specific primer sets: For total RUNX1B and RUNX1C: RUNX1B/C FW 5’-AGC GGC ATG ACA ACC CTC TCT-3’ RUNX1B/C RV 5’-GCG TCG GGG AGT AGG TGA AG-3’ For Exon7 skipping RUNX1B and RUNX1C variant: RUNX1B/C !Exon7 FW 5’-TGT CGG TCG AAG TGG AAG AG-3’ RUNX1B/C !Exon7 RV 5’-GGA TCT GCC TTG TAT TTC GAG GT-3’ For "-actin: hActB RT5 5’-CGCGAGAAGATGACCCAGAT-3’ and hActB RT3 5’-GATAGCACAGCCTGGATAGCAAC-3’ Each sample was assayed in triplicateand mRNA expression levels were quantified using a Dyad Disciple thermal cycler equipped with Chromo4 optical head (Bio-Rad Laboratories). In order to compare results between different T-ALL cell lines and xenograft-expanded primary patient T-ALL samples, two normalisation methods were employed. First, the same concentration of total isolated RNA (2&g) was used for each qPCR reaction. This allowed us to express our results as copies of the gene of interest per ng total RNA input. Alternatively, a housekeeping gene ("-actin) was employed to compare RNA levels between different samples. To ensure accurate quantitation of unknown samples, we ensured that all test points were in the 42  linear range of the standard curves. We also ensured that each primer pair only produced one PCR product by agarose gel electrophoresis.  Procedure and calculations 1. Concentration of the purified plasmid was quantified using a NanoDrop spectrophotometer at an absorbance of 260nm. 2. The number of copies for the gene of interest was calculated using the equation: copy# = 6.023x1023 x [DNA]g/L x (volume of DNA used in qPCR) (MW of plasmid + MW of insert) -  6.023x1023 is Avogadro’s number  -  [DNA] from the NanoDrop Spectrophotometer  -  Volume of DNA - amount of template DNA in qPCR reaction in Liters (2x10-6)L  This calculates how many copies of your gene of interest are in your standard. 3. Performed 10-fold dilutions all the way down to <100 copies/2&L 4. Ct values were graphed on the Y axis and the copy numbers on the X axis. A logarithmic curve fit was applied the equation displayed in a form y= -a ln (x) + b. 5.  x is the copy number per reaction; y is the Ct number  Equation was converted from the ln to a Log10, as follows y= -2.303a Log10 x + b  6. Solved for copy number using equation: x = 10^ (b - y)/2.303a 7. Expressed unknown samples as copies/reaction using equation in step 6 8. Reported expression values as copies/ng RNA input or copies/normalized to "-actin (endogenous reference/housekeeping gene, assumption that reference gene is expressed at similar levels between all cells) 43  -  2 &g total RNA (in 20&l reaction) was used for first-strand cDNA synthesis  -  For RUNX1 expression measurement unknown cDNA samples were diluted 100-fold and 2&l was used in qPCR run  -  For "-actin expression measurements unknown cDNA samples were diluted 2000fold and 2&l was used in qPCR run  2.9  Direct immunofluorescent staining - RUNX1 subcellular localization in 293T For functional studies of RUNX1 proteins: the wild-type RUNX1B sequence (1-453); the  exon7 skipping RUNX1B sequence (178-242 AA missing); the RUNX1B InsG mutant (R139fs*47) and the RUNX1B InsG mutant containing exon7 skipping (R139fs*363) were cloned and inserted into the pCDNA3-nFlag mammalian expression plasmid. The resultant plasmids were transfected into 293T cells seeded on gelatin pre-coated coverslips (Fisherbrand) using the PEI reagent. Immunofluorescence labeling of RUNX1 was performed 24hr posttransfection; untransfected 293T cells were used as a control. Briefly, cells grown on coverslides were washed twice with TBS (Tris buffered saline (TBS): 0.05 M Tris, 0.15 M NaCl, pH 7.4), then fixed with freshly prepared mixture of methanol:acetone (1:1) for 1min at room temperature; washed with TBS; and incubated with monoclonal Anti-Flag-M2-FITC antibody at 10 mg/ml in TBS at room temperature for 1 hour. 4',6-diamidino-2-phenylindole (DAPI) staining was used to visualize nuclei. ProLong® Gold reagent (Life Technologies) was applied directly to fluorescently labeled cell. Cells were examined using a fluorescence microscope with appropriate configuration for fluorescein visualization. FITC has an absorption maximum at approximately 492 nm with an emission maximum at 520 nm.  44  Chapter 3: Results  3.1 3.1.1  Characterization of RUNX1 expression in T-ALL Rationale and hypothesis  Objectives Several groups have recently suggested in contrasting reports that RUNX1 may agonize or antagonize the growth of T-ALL cells. These disparate results have yet to be reconciled, however any future functional studies to determine the role of RUNX1 signaling in this disease rely on determining to what extent is RUNX1 expressed and which of its isoforms are predominant in a T-ALL context. Hypothesis We hypothesize that RUNX1 mRNA and protein are variably expressed in T-ALL and that one of the canonical isoforms is dominant with respect to the others across T-ALL samples. Aims Aim 1: Determine the expression of endogenous RUNX1 mRNA using qRT-PCR Aim 2: Determine the expression of endogenous RUNX1 protein using western blot Predictions We predict that there may be heterogeneity in the expression of RUNX1 isoforms in T-ALL; however one isoform might be expressed more highly than any other at the level of protein.  45  3.1.2  Endogenous RUNX1 mRNA expression Assay design and optimization  To assess the expression pattern of the two major RUNX1 isoforms (RUNX1B and RUNX1C) we compared mRNA levels in selected T-ALL cell lines and xenograft-expanded primary patient samples. In order to quantify total RUNX1B/C isoforms, quantitative real-time polymerase chain reaction (qRT-PCR) was used with primers designed to span the junction of exons 9-10 as demonstrated previously (Edwards et al. 2009). In attempting to clone a naturally occurring truncated RUNX1 mutant from cDNA generated from the cell line TALL-1, we observed relatively frequent exon 7 skipping (!Exon7). This transcript had been previously reported in the unpublished study: "Full-length cDNA libraries and normalization" in Jurkat (T-ALL cell line) and deposited in Ensembl genome browser under RUNX1-009 (ENST00000399240). With this confirmation, we designed a qRT-PCR strategy to quantify the frequency of RUNX1B/C !Exon7 in T-ALL through the use of a reverse primer spanning a novel junction between exons 6-9 (Figure 3.1 panel A). We validated and optimized our qRT-PCR approach as follows. The annealing temperature of each primer set was tested over a temperature gradient from 50 to 65°C using the thermal gradient feature on our thermal cycler and subsequently, the reaction products were run on an agarose gel. Figure 3.1 panel B demonstrates the presence of a desired product of about 150bp (predicted product size RUNX1B/C of 154bp; RUNX1B/C !Exon7 of 134bp). An annealing temperature of 59°C was selected for RUNX1B/C reactions and 55°C for RUNX1B/C !Exon7. Figure 3.1 panel C illustrates a representative melting curve analysis that confirmed the presence of a single product due to a distinct DNA dissociation pattern (a single peak in the melt curve). Standard curves were generated for each primer set with serial 2-fold dilutions to determine the 46  efficiency and linear dynamic range of the primers; for the RUNX1B/C set the efficiency of the assay was 101.83% with R2=0.9983 (Figure 3.1 panel E); while for the RUNX1B/C !Exon7 assay, the efficiency was 99.13% with R2=0.997. The linear range of RUNX1B/C and for the RUNX1B/C !Exon7 assays was at least 3 logs (Figure 3.1 panel D). All assays were performed in technical triplicates (using same cDNA source), and showed consistency in Ct (cycle threshold) values across all replicate reactions. Two strategies were explored in analyzing our qRT-PCR data but both relied on the conversion of Ct values into copy number per reaction. The qPCR SYBR green signal was related to the input copy number using calibration curves generated from dosing in known amounts of pcDNA3-nFlag plasmids containing RUNX1 cDNA isoforms as appropriate. Figure 3.2 panel A shows a logarithmic curve fit for RUNX1B/C with an equation y = -1.253ln(x) + 35.068; which could be solved as x=10^((35.621-y)/3.01), where x is copy number per reaction. Figure 3.2 panel B shows a logarithmic curve fit for RUNX1B/C !Exon7 with an equation y = 1.309ln(x) + 35.621; which could be solved as x=10^((35.068-y)/2.89). In our first analysis, we normalized our expression data to total ng of RNA input, since the known amount of 2ng of RNA of input was used in each qRT-PCR reaction (Figure 3.2 panel C). Subsequently, the housekeeping gene ("-actin) was used as a reference to compare the relative expression levels between different cell lines and primary patient samples (Figure 3.2 panel D). Regardless of the method used, the overall trend of this gene expression data as normalized by either of these two approaches was comparable.  47  Results obtained in the human T-ALL cell lines and xenograft-expanded primary  patient samples Our results indicate that RUNX1B/C mRNA was expressed consistently in T-ALL cell lines and primary patient samples, although with some degree of variability (Figure 3.2). Notably, the level of RUNX1 expression appeared higher in cell lines in contrast to xenograft-expanded primary patient samples. The RUNX1B/C !Exon7 isoforms represented at most 1/2 of total RUNX1B/C pool in T-ALL. Importantly, our assay is not able to differentiate between the contributions of RUNX1B from RUNX1C to the expression levels measured, as our qRT-PCR primers target regions common to both isoforms. Thus, we were able to demonstrate the presence of endogenous RUNX1B/C mRNA using qRT-PCR and gain insight into the heterogeneity of the expression of RUNX1 isoforms in a TALL context.  48  Figure 3.1 Development of a qRT-PCR method to quantify RUNX1 isoforms (A) RUNX1 isoforms and variants; unique exon junctions targeted by qRT-PCR strategy are shown in red for RUNX1B/C (exon 9-10) and blue for RUNX1B/C !Exon7 (exon 6-9). 49  (B) to (E) Representative qRT-PCR method development and optimization, using RUNX1B/C total mRNA quantification as an example. (B) Agarose gel analysis of the reaction products for experimental determination of optimal annealing temperature, a gradient of 50 to 65°C was set; the temperature of 59°C was selected for further analysis. (C) Melt-curve analysis in which the desired amplicon (~150bp) was detected. (D) Standard Ct curve generated using a 2-fold dilution of a template, were each dilution point was assayed in triplicate. (E) Standard curve with the Ct plotted (Y-axis) against the log of template input (X-axis) for each dilution. The equation for the regression line and the R2 value are shown above the graph.  50  Figure 3.2 qRT-PCR showing mRNA expression levels of RUNX1 isoforms Calibration curve using dilutions of (A) pcDNA3-nFlag-RUNX1B plasmid and (B) pcDNA3nFlag-RUNX1B !Exon7 plasmid. Ct values were graphed on the Y axis and the copy numbers on the X axis. The logarithmic curve fit was applied to the equation displayed in a form y= -a ln (x) + b. RUNX1B/C total mRNA and RUNX1B/C !Exon7 mRNA expression levels were measured and normalized to (C) total ng of RNA input or (D) a housekeeping gene ("-actin). Plus (+) denotes the data obtained with RUNX1B/C !Exon7 (exon6-9) primers, while minus (() denotes the data obtained with RUNX1B/C (exon 9-10) primers.  3.1.3  RUNX1 #Exon7 subcellular localization Since our qRT-PCR data suggested that RUNX1 Exon7 skipping (!Exon7) isoforms  represent at most 1/2 of total RUNX1 levels, we sought to generate expression constructs containing RUNX1B !Exon7 to evaluate protein expression and stability (Figure 3.3). In Figure 3.3 panel A, a prominent band of about 40kDa is detected using the Anti-Flag M2 antibody in 51  the RUNX1B !Exon7 lane, consistent with an in silico predicted molecular weight of 41.8kDa for the !Exon7 isoform. An Anti-RUNX1 blot in panel B confirms the detection of a 40kDa band in the RUNX1B !Exon7 lane; the endogenous RUNX1B/C pool represented by the band at 55kDa appears to be unchanged in contrast to the 293T untransfected control. Due to literature evidence that Exon7 contains a nuclear localization signal for RUNX1, we attempted to use immunofluorescence to determine the subcellular localization of full-length RUNX1B and RUNX1B !Exon7 in 293T cell (Figure 3.3 panels C and D). RUNX1B, as a full-length transcription factor, appears to localize diffusely throughout the nucleus (Figure 3.3 panel C), while RUNX1B !Exon7 which lacks a NLS was more dispersed throughout the cytoplasm primarily (Figure 3.3 panel D). Since the RUNX1B/C !Exon7 isoform appears unable to translocate into the nucleus, it is expected that it would not interfere with the ability of wild-type RUNX1 transcription factors to properly function. However, theoretically these RUNX1B/C !Exon7 isoforms could sequester CBF" in cytoplasm. These results suggest that this relatively abundant RUNX1B/C !Exon7 isoform might either be non-functional or take on a neomorphic function in T-ALL.  52  Figure 3.3 Expression of exogenous RUNX1B #Exon7 in 293T cells Western blot analysis showing exogenous RUNX1 protein isoform expression using two different antibodies. Predicted molecular weight of RUNX1B (48.7kDa) and RUNX1B !Exon7 (41.8kDa). (A) Anti-Flag M2 (1:5000), 20sec exposure. (B) Anti-RUNX1 Sigma R0406 (1:1000), 2min exposure. "-Actin (1:5000) was used as a loading control. Direct immunofluorescent staining of transiently transfected 293T cells; stained using Anti-Flag-M2FITC antibody (10 mg/ml) and DAPI (1:200 at1ug/mL). (C) Cellular localization of full-length RUNX1B and (D) RUNX1B !Exon7 (178-242AA missing).  3.1.4  Endogenous RUNX1 protein expression  Three major protein isoforms of RUNX1 are currently recognized as RUNX1A (250 AA), RUNX1B (453 AA) and RUNX1C (450 AA) (Levanon et al. 2001). All three isoforms contain the Runt domain located in the N-terminal region; while only RUNX1B and RUNX1C encode full-length RUNX1 proteins (Tanaka et al. 1995).  53  Results obtained in the human T-ALL cell lines  Accordingly, we first attempted to assess endogenous RUNX1 isoform expression in T-ALL at the level of protein using western blot analysis across different T-ALL cell lines. Western blot indicated that although RUNX1 was endogenously expressed in all T-ALL cell lines investigated, there was an apparent variability in the levels of RUNX1 protein made in cells. Figure 3.4 demonstrates that the highest levels of RUNX1 protein were found in RPMI 8402, while the lowest were seen in HPB-ALL and ALLSIL, in agreement with qRT-PCR data (Figure 3.2). The Anti-RUNX1 Sigma R0406 antibody (immunogen sequence 42-52AA) recognized one thick band of 55-60kDa in T-ALL lysates. This antibody is unable to differentiate between the RUNX1B (48.7kDa) and RUNX1C (51.8kDa) isoforms, due to their close proximity in size. The Active Motif antibody (Anti-AML1/Runx1; immunogen sequence 231-245AA) recognized as least two distinct bands in the region 45-55kDa; however, by western blot alone we have no way of confirming whether these bands represent distinct isoforms of RUNX1 or post-translationally modified forms of one isoform in particular. The RUNX1A (27.4kDa) isoform was not detected with either RUNX1 antibody, suggesting that its steady-state levels are below the limits of our detection.  54  Figure 3.4 Expression of endogenous RUNX1 in T-ALL cell lines (A) T-ALL cell line protein extracts were processed for immunoblot analysis using Anti-RUNX1 antibodies. The Anti-RUNX1 Sigma R0406 antibody was used at 1:1000 dilution with a 10sec exposure. The Active Motif (Anti-AML1/Runx1) antibody was used at 1:1000 dilution using a 5min exposure. "-Actin (1:5000) was used as a loading control. Jurkat, TALL-1, P12 and CEM cell lines were previously reported to harbor RUNX1 mutations (Della Gatta et al. 2012). (B) The full-length RUNX1B isoform protein sequence with immunogens highlighted. The immunogen sequence for the Anti-RUNX1 Sigma R0406 antibody (42-52AA) was highlighted in blue. The immunogen sequence for the Active Motif (Anti-AML1/Runx1) antibody (231245AA) was highlighted in red. The Runt domain sequence was highlighted in bold.  Results obtained in the human xenograft-expanded primary T-ALL In order to better understand the role of RUNX1 in primary T-ALL, the level of  endogenous RUNX1 expression in xenograft-expanded primary T-ALL samples was also 55  assessed. Similar to the observation made in T-ALL cell lines, western blot analysis indicated an apparent variability in the levels of RUNX1 protein made in cells (Figure 3.5).  Figure 3.5 Expression of endogenous RUNX1 in xenograft-expanded primary T-ALL Xenograft-expanded primary patient samples were processed for immunoblot analysis using Anti-RUNX1 antibodies. The Anti-RUNX1 Sigma R0406 antibody was used at 1:5000 dilution with a 30sec exposure. The Active Motif (Anti-AML1/Runx1) antibody was used at 1:1000 dilution with a 4min exposure. "-Actin (1:5000) was used as a loading control. C57BL/6 mouse spleen cells and MS5-DL1 stromal feeder lysates were included as negative controls.  The two antibodies chosen for this analysis of expression levels differed in their abilities to pick-up RUNX1 isoforms and painted a dissimilar picture of relative protein abundances by western blot. The Active Motif (Anti-AML1/Runx1) blot based on protein products in region 4555kDa suggested that highest levels of RUNX1 protein were found in F09-1313 and D115-1-2, while the lowest levels were seen in M18-1 and M30-2 in agreement with qRT-PCR data (see Figure 3.2). Contrary to this, the Anti-RUNX1 Sigma R0406 antibody recognized one thick band 56  of 55-60kDa on our blot and suggested that expression levels between selected primary patient samples were similar, with H3255 demonstrating the relatively lower level of RUNX1 expression. The Active Motif antibody (Anti-AML1/Runx1) recognized RUNX1 proteins in the region 45-55kDa; however, abundant bands below 35kDa are also apparent. Due to possibly confounding sources of RUNX1 protein from the MS5-DL1 used for in vitro culture of xenograft-expanded primary patient T-ALL cells and from recipient NOD-SCID IL2R)-/- (NSG) spleen cells used to in vivo-expansion of primary patient samples, murine spleen cell and MS5DL1 cell lysates were included as controls. Since we cannot identify any protein species in these mouse and human cell types as assessed using an Anti-RUNX1 antibody, we conclude that any RUNX1 species we observe on the western blot are indeed derived from the xenograft-expanded primary patient material (Figure 3.5). In summary, we are able to detect RUNX1 protein species using two Anti-RUNX1 antibodies which recognize different epitopes; however despite these differences, the specific identity of the species observed on the western blot could not be determined. Furthermore, we are unclear of the identity of the RUNX1 gene products with a molecular weight below 35kDa. We predict that these either represent degradation products of RUNX1 that lack the N-terminal region which would not be detected with the Sigma R0406 antibody, RUNX1A isoform species, or new unidentified isoforms lacking the N-terminus of full-length RUNX1.  57  3.2 3.2.1  Examination of RUNX1 protein levels by mass spectrometry (MS) Rationale and hypothesis  Objectives Due to the very similar molecular weights of RUNX1B and RUNX1C, the resolution we acquired using western blot was insufficient to determine which isoform was more highly expressed in T-ALL cells and therefore we sought a method that would quantitatively resolve this ambiguity, mass spectrometry. Additionally, although we were unable to clearly identify a molecular weight species resembling RUNX1A on a western blot, a mass spectrometry-based approach would either confirm the absence of RUNX1A or conversely allow for sensitive identification and quantitative assessment of its abundance. Hypothesis We hypothesize that through the use of peptide standards, the absolute quantity of RUNX1A, RUNX1B and RUNX1C will be determined in a panel of T-ALL cell lines and that one of these isoforms will be more dominantly expressed. Furthermore, endogenous RUNX1A protein will represent a relatively small fraction of total RUNX1 levels. Aims Aim 1: Generate, optimize and validate a mass spectrometry-based method to quantify the absolute amounts of RUNX1A, RUNX1B and RUNX1C protein isoform expression. Predictions We predict that our mass spectrometry approach will be able to resolve the RUNX1B/RUNX1C contribution to the total RUNX1 pool; one of these isoforms will be more highly expressed than the other. As well, we predict that endogenous RUNX1A is not expressed at the protein level to any appreciable degree in T-ALL cells. 58  3.2.2  Mass spectrometry assay design In order to design a targeted MRM study, we first needed to select a predetermined set of  RUNX1 peptides and determine their specific MRM transitions. Using the UniProt database, three isoforms of interest were aligned and unique regions for each isoform were identified (Figure 3.6).  Figure 3.6 Alignment of RUNX1 isoforms: RUNX1A, RUNX1B and RUNX1C The three major isoforms of the RUNX1 protein were accessed using the UniProt database and aligned on the UniProt website using the ClustalW algorithm in order to find unique regions ( Q01196, Q01996-3 and Q01996-8 represent RUNX1B, RUNX1A and RUNX1C, respectively. RUNX1B isoform was been chosen as the 'canonical' sequence. All positional information in this study refers to it as reference.  59  RUNX1A has a unique C-terminus, while RUNX1C has a unique N-terminus (Figure 3.7). RUNX1B has no region that is unique from RUNX1A and RUNX1C to identify this targeted isoform and thus, its abundance was to be calculated by subtraction from the total RUNX1 levels as determined using the common peptides. Figure 3.7 demonstrates the overall design of our MRM experiment, highlighting unique and common regions targeted.  Figure 3.7 MRM experimental design A cartoon representation of target peptide selection based on RUNX1sequences. Common peptides between all isoforms of interest are indicated in blue. RUNX1A and RUNX1B have identical N-termini, indicated in green. RUNX1B and RUNX1C share an identical C-terminus, indicated in orange. RUNX1A and RUNX1C have unique peptide signatures in C-terminus (purple) and N-terminus (red), respectively. RUNX1B doesn’t have any unique peptides; its abundance is calculated using the formula RUNX1B = Total – (A+C)  3.2.3  Protein standards for mass spectrometry analysis In order to harness the power of mass spectrometry to measure the absolute relative  abundance of protein isoforms, we required recombinant RUNX1 proteins to be generated for optimization and validation of our experimental approach.  60  Overexpression of recombinant RUNX1 proteins in heterologous 293T We first cloned our cDNAs into a mammalian expression vector, pcDNA3 (Invitrogen),  in order to overexpress RUNX1 proteins in human 293T cells (Figure 3.8 panel A). Our epitope tagging strategy utilized a small tag, nFlag (N-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys-C); against which well-validated commercial antibodies were available. pcDNA3-nFlag-RUNX1 isoform constructs were cloned and demonstrated to correctly express exogenous RUNX1 by western blot analysis using Anti-Flag M2 antibody. The RUNX1A isoform showed a prominent band at 30-35kDa, while RUNX1B and RUNX1C migrated at about 55kDa and 57kDa, respectively (Figure 3.8 panel B). The Anti-Flag M2 western blot also suggested that RUNX1A is the easiest to overexpress in 293T cells. This is most likely due to greater transfection efficiency of this smaller construct, as the band at 30-35kDa of relatively high intensity was observed in contrast to bands in 55-60kDa region. When equivalent amounts of lysate were probed with Anti-RUNX1 Sigma R0406 antibody, the RUNX1A isoform was detected at roughly 30kDa (and was not present in 293T control); while RUNX1B and RUNX1C isoforms did not seem to increase the total pool of RUNX1 in the cell, based on the band in the molecular mass range of 55kDa (Figure 3.8 panel B). Accordingly, effective overexpression of RUNX1 isoforms in heterologous 293T cells was achieved using the pcDNA3 vector with a strong promoter driving the high-level expression of recombinant proteins in these mammalian cells.  61  Figure 3.8 Expression of exogenous RUNX1 in 293T cell (A) Map of mammalian expression vector pcDNA3 with the CMV promoter and a neomycinresistance marker. pcDNA3-nFlag-RUNX1 isoform constructs were generated and transiently transfected into 293T cells. Western blot analysis showed that the exogenous proteins were expressed. Predicted molecular weight of RUNX1A (27.4kDa), RUNX1B (48.7kDa) and RUNX1C (51.8kDa). (B) Anti-Flag M2 (1:5000), 30sec exposure. (C) Anti-RUNX1 Sigma R0406 (1:1000), 30sec exposure. "-Actin (1:5000) was used as a loading control.  62  Optimization of transfection efficiency in 293T cells Of note, due to size differences the relatively smaller RUNX1A isoform is more  efficiently transfected into 293T cells in contrast to RUNX1B and especially RUNX1C. A number of transfection reagents were tested in order to optimize this transfection efficiency: polyethyleneimine (PEI), calcium phosphate (CaPO4), and Thermo Scientific TurboFect Transfection Reagent (Figure 3.9). PEI was found to result in a higher frequency of transfected cells and was the most consistent of the methods tested, and therefore was subsequently used for the duration of the study.  Figure 3.9 Transfection method optimization 293T cells were transfected with the pRRLsin.cPPTCTS.MNDU3.BXE.PGK.GFP.WPRE lentivector (7823bp) transiently using three methods: PEI, CaPO4 and the commercially available reagent TurboFectTM. Green fluorescent protein (GFP) was used as reporter for monitoring transfection efficiency. The expression of GFP was detected by fluorescence microscopy at 24hr and 48hr post-transfection.  63  Detection of RUNX1 recombinant proteins in polyacrylamide gel We were able to achieve high-level protein production in 293T cells, and 10 X 10cm  dishes of material were pooled for each recombinant protein (Figure 3.10). Apart from bands of expected molecular weight (RUNX1A of 35kDa, RUNX1B of 55kDa, RUNX1C of 57kDa), other species were detected on the polyacrylamide gel stained with Coomassie Dye. Upon mass spectrometry analysis of 70kDa and 90kDa bands, only heat shock proteins (HSP) were detected. Specifically, 90kDa corresponds to HS90A and 70kDa corresponds to HSP71 (Figure 3.10).  Figure 3.10 Recombinant RUNX1 proteins on polyacrylamide gel Polyacrylamide gel stained with Coomassie Dye. RUNX1 bands of expected molecular weight are indicated with black boxes. Anti-Flag M2 antibody was used to immunoprecipitate nFlagRUNX1 isoforms from 293T cell extracts. Untransduced 293T cells were used as negative control. 64  3.2.4  Optimization of anti-nFlag immunoprecipitation RUNX1 protein immunoprecipitation using the Anti-Flag M2 antibody (Invitrogen) was  performed in order to provide enough material for optimization and validation of mass spectrometry analysis. Our RUNX1 constructs were tagged with the Flag epitope against which highly specific antibodies were commercially available. We utilized a highly specific monoclonal Anti-Flag-M2 affinity gel antibody covalently attached to agarose resin to immunoprecipitate recombinant RUNX1 isoforms. Cell lysis buffer was modified for efficient lysis of 293T cells and NaCl concentration was increased at least 2-fold during washing steps in order to minimize nonspecific interactions and obtain high purity products. All three isoforms of RUNX1 were efficiently immunoprecipitated, as demonstrated by Anti-Flag M2 and Anti-RUNX1 western blots (Figure 3.11). Untransfected 293T cell lysates were used as negative controls. In Figure 3.11 panel A, the Anti-RUNX1 Sigma R0406 antibody was used for detecting RUNX1 isoforms of interest. All Input and Unbound lanes contain a band of about 55-60kDa, representing endogenous RUNX1 levels. For RUNX1A in the Input-A lane, a 35kDa band is apparent and this product is efficiently immunoprecipitated and detected in RUNX1A-IP lane as a doublet, suggesting RUNX1A may or may not be post-translationally modified. In the Input293T lane, the endogenous RUNX1 (55kDa) band is present, and the absence of a band in the Control-IP lane demonstrates that the immunoprecipitation is specific to the Flag-tagged isoforms. In the Input-B and Input-C lanes it is not possible to differentiate the exogenous RUNX1B/C isoforms from endogenous RUNX1 in 293T cells using an anti-RUNX1 antibody; however, a clear enrichment in proteins of the molecular weight of 55kDa is observed in RUNX1B-IP and RUNX1C-IP lanes. 65  In Figure 3.11 panel B, an Anti-Flag antibody with secondary Mouse TrueBlot antibody was used for visualization. Input lanes contain the isoforms of interest: RUNX1A, RUNX1B, RUNX1C, at sizes of 35kDa, 55kDa and 57kDa, respectively. Unbound lanes do not contain a relatively high abundance of RUNX1 isoforms since they were efficiently picked up using antiFlag immunoprecipitation. All RUNX1-IP lanes contain additional bands of lower apparent molecular mass; however, they do not obscure the detection of any isoforms of interest. In summary, we have achieved a desirable immunoprecipitation result, with enrichment demonstrated by the improved signal strength of the recombinant RUNX1 proteins of interest relative to other bands.  66  Figure 3.11 Anti-nFlag immunoprecipitation Anti-Flag immunoprecipitation was performed with 293T cells transiently expressing nFlagtagged RUNX1 isoforms or untransfected 293T (control) and analysed by western blot analysis. (A) Western blot with Anti-RUNX1 Sigma R0406 (1:1000) and Goat Anti-Rabbit IgG (1:5000), with a 2sec exposure. The arrows indicate input and eluted products of interest. (B) Western blot with Anti-Flag, Clone M2 (Sigma) 1:5000 and Mouse TrueBlot ULTRA: Anti-Mouse Ig HRP (eBioscience) 1:1000, 10sec exposure. Arrows point to bands of interest in the ‘Input’ lane.  3.2.5  Selection of target peptides We proceeded to then identify the peptides of interest that would have good MS  responses. Trypsin was used to cleave recombinant RUNX1 isoforms. Since it cuts at the Cterminal side of lysine (K) and arginine (R), based on in silico RUNX1 sequence information it was predicted that tryptic cleavage would provide sufficient coverage. Figure 3.12 demonstrated that despite the reportedly high specificity of trypsin, we observed multiple peptides with missed cleavages. Nonetheless, 77%, 46% and 36% sequence coverage was obtained for RUNX1A, RUNX1B and RUNX1C, respectively (Figure 3.12).  67  Figure 3.12 Sequence coverage obtained for RUNX1 isoforms in MS/MS analysis Formatted sequence of the RUNX1A, RUNX1B and RUNX1C protein in 1-letter code. MS/MS spectra were searched against a sequence database. The identification of the peptides was performed using the Mascot search engine. Matched peptides are shown in bold red.  68  The best 2-4 transitions (Q3 Mass) per peptide were selected for quantitative assays (Table 3.1). Unspecific signals may derive from other peptides with precursor/fragment ion pairs of similar masses to that of protein of interest and therefore validations of transitions were performed (Figure 3.13). Overall, highly detectable peptides were observed and it was possible to select true tryptic peptides (with high ion current) for subsequent quantitative analysis, as demonstrated by clean high intensity peaks eluting at the same time in Figure 3.13 panel A with low levels non-specific/background signals (low intensity) in Figure 3.13 panel B. Table 3.1 Selection of transitions for targeted peptides selected for MRM Peptide Name  Peptide Sequence  Q1 Mass  Q3 Mass  RUNX1com1  LSELEQLR  494.3521  RUNX1Cpep1  ECILGMNPSR  596.843  874.4629 787.4308 658.3883 903.4717  494.2281  790.3876 872.4221  RUNX1Cpep2  DVHDASTSR  RUNX1ABpep  IPVDASTSRR  473.3284  RUNX1Apep1d  ASLNHSTAFNPQPQSQ  991.0639  MQEEDTAPWR (deamination) RUNX1Apep1d/ox  ASLNHSTAFNPQPQSQ MQEEDTAPWR (deamination, oxidation)  996.3544  773.3537 636.2947 832.4159 735.3632 636.2947 1477.638 1390.606 1262.547 1131.507 1003.448 1493.633 1406.601 1278.542 1131.507 1003.448 69  70  Figure 3.13 Validation of multiple reaction monitoring (MRM) transitions RUNX1B protein was digested with trypsin and run on a mass spectrometer in MRM mode to confirm that transitions monitored were derived from our peptides of interest and not another unrelated molecule having similar transitions. MRM transitions must co-elute as a single peak. RUNX1ABpep, and RUNX1com1 peptides were detected as two peaks with co-eluting transitions are apparent at 15.9 and 24.3 min. RUNX1Cpep1 is an example of relatively low background noise because of low intensity (y-axis) and sporadic (non overlapping signal).The yaxis represents signal intensity (cps) and the x-axis represents time (min).  Following digestion of recombinant RUNX1 isoforms with trypsin in order to select unique peptides to be used for MRM, we purchased synthetic peptides to optimize conditions/transitions  71  on the MS (Table 3.2). These peptides contain heavy labeled L-arginine [Arg-10; U-13C6, 15N4] modification highlighted in bold in table 3.2 below. Thus, appropriate coverage was obtained with tryptic digest. We were then able to select targeted peptides with appropriate observability and signal intensity. Finally, transitions were validated and we are confident that false identification/quantification caused by unspecific signals derived from other peptides with fragment ion pairs of similar masses will not be problematic to the interpretation of results.  Table 3.2 Synthetic peptides corresponding to common and unique target regions Peptide sequence  Target region  VVALGDVPDGTLVTVMAGNDENYSAELR  Exon5 [RUNX1 common*]  QKLDDQTKPGSLSFSER  Exon7 [RUNX1 common]  LSELEQLR  Exon7 [RUNX1 common]  ASLNHSTAFNPQPQSQMQEEDTAPWR  Exon7-8 junction [RUNX1A]  LEEAVWRPY  Exon10 [RUNX1B and RUNX1C]  IPVDASTSR  Exon4a [RUNX1A and RUNX1B]  ECILGMNPSR  Exon3 [RUNX1C]  DVHDASTSR  Exon3-4 junction [RUNX1C]  *RUNX1 common refer to a peptide present in all three isoforms  72  3.2.6  Protein enrichment using anti-RUNX1 immunoprecipitation Anti-RUNX1 IP in 293T cells transfected with recombinant proteins To determine the absolute abundance of endogenous RUNX1 isoforms in T-ALL cell  lines, we employed Anti-RUNX1 immunoprecipitation to enrich for our proteins of interest prior to MRM analysis. In addition to optimization steps mentioned for Anti-FlagM2 immunoprecipitation (Section 3.1.4), the bead charging step had to be optimized for effective RUNX1-IP. In Method A, Protein G beads were mixed with RUNX1 (R0406) antibody and after the incubation period the pre-cleared lysate was added. In Method B, the cell lysate was mixed with RUNX1 (R0406) antibody directly and following incubation, Protein G beads were added to immunoprecipitate the complex. There appeared to be no difference in the two different immunoprecipitation methods tested (Figure 3.14). In both of the methods tested, exogenous RUNX1A (35kDa band), RUNX1B (55kDa band) and RUNX1C (57kDa band) were transfected into 293T cells and immunoprecipitated with Anti-RUNX1 R0406 antibody. Enrichment of RUNX1 recombinant proteins was achieved (bands of desired molecular weight in the eluted fractions); however, some proteins were still detected in the unbound fraction. Of note, apart from the species of interest no additional bands were observed. The Anti-RUNX1 R0406 antibody appeared to immunoprecipitate all three isoforms, although not very efficiently, since proteins were detected in the unbound fractions and the intensity of the band in the eluted fraction was not much higher in contrast to the Input. It is important to note that the concentration of the antibody, beads and input material could still potentially be varied further to improve the enrichment of RUNX1 in the future.  73  Figure 3.14 Anti-RUNX1 (R0406) immunoprecipitation (A) Exogenous RUNX1A, (C) RUNX1C, and (D) RUNX1B transfected into 293T cells and immunoprecipitated with Anti-RUNX1 N-terminus (R0406) Sigma antibody. (B) Beads alone (no antibody added) were used as a negative control. Input and unbound lanes were loaded with 10!l from a total of 500!l (2% of input). Eluted lanes were loaded with 10!l from a total of 30!l (33% of output). nFlag-tagged RUNX1 isoforms were detected with Anti-Flag M2 antibody. Two immunoprecipitation methods tested were denoted as method A and method B. TrueBlot antibody was utilized as it preferentially detects the native disulfide form of rabbit IgG, thus reducing interference signals of Heavy (55 kDa) and Light (23 kDa) chains of the immunoprecipitating RUNX1 antibody used in IP.  Relative efficiency of anti-RUNX1 R0406 antibody In order to get a better idea of the Anti-RUNX1 N-terminus (R0406) antibody efficiency,  head-to-head immunoprecipitation was carried with Anti-RUNX1 antibody and Anti-Flag M2 resin (Figure 3.15). 74  Figure 3.15 Efficiency of anti-RUNX1 IP antibody in contrast to anti-Flag M2 resin IP western blot analysis of 293T cells transfected with an exogenous source of RUNX1: (A) RUNX1A and (B) RUNX1C. 1mL of 293T-nFlag RUNX1 lysate was split into two 500!l fractions. One fraction was immunoprecipitated with Anti-Flag M2 affinity resin, and one with Anti-RUNX1 (bound to the Protein G) antibody. Samples were eluted by boiling at 95ºC for 5min in SDS-page buffer. Input and unbound lanes were loaded with 10!l of 500!l (2% of input). Eluted lanes were loaded with 10!l of 30!l (33% of output). RUNX1 was detected with Anti-Flag M2 antibody. Our immunoprecipitation results illustrated that the Anti-RUNX1 (Sigma; N-terminus) antibody is at least 5-fold less efficient in contrast to Anti-Flag M2 affinity resin for RUNX1 immunoprecipitation (Figure 3.15). Overexpression of the RUNX1A (250AA) isoform was easily achieved at high levels, and the unbound lane in panel A contained material that was left after the immunoprecipitation (Figure 3.15 panel A). In contrast, RUNX1C full-length (480AA) isoform was harder to transiently transfect into 293T cells, and was largely absent from the unbound fractions after immunoprecipitation, as expected (Figure 3.15 panel B).  75  Anti-RUNX1 IP in the human T-ALL cell line RPMI 8402 Since our goal was to quantitate the absolute amount of RUNX1 protein in T-ALL cells,  RUNX1 immunoprecipitation and western blot analysis was performed on T-ALL cell lines. Figure 3.16 shows that the two RUNX1 antibodies tested in IP application, Sigma (GKLRSGDRSMV; 42-52AA) and Active Motif (AFNPQPQSQMQDTR; 231-245AA) were able to immunoprecipitate endogenous RUNX1. These antibodies recognize different epitopes generated against the N-terminus and middle region of RUNX1, respectively. Variable affinity for endogenous RUNX1 proteins of the selected antibodies was observed based on the doublet in the eluted lane with molecular masses ranging from 45-55kDa. It is currently unknown what is responsible for the variable affinity of the selected antibodies for endogenous RUNX1, however the identity of the eluted RUNX1 proteins will be determined using mass spectrometry in future studies and help uncover the difference.  Figure 3.16 IP western blot RUNX1 analysis of T-ALL cell line RPMI 8402 Immunoprecipitation was performed with Active Motif (Anti-AML1/Runx1) and Sigma (R0406) RUNX1 antibodies. The western blot was detected with Anti-RUNX1 R0406 (1:5000) and Rabbit TrueBlot antibodies, 30sec exposure. The elution was performed by boiling beads in SDS-PAGE buffer at 95ºC for 5min and subsequently eluted in 30!l. 76  3.3 3.3.1  Relevance of RUNX1 mutations in T-ALL Rationale and hypothesis  Objectives RUNX1 mutations have been recently discovered independently by several groups and occur predominantly in the ETP-ALL subgroup of T-ALL. Prior to any functional studies, the stability of the mutated proteins should be evaluated in order to determine if these mutations contribute in a meaningful way to the biology of the cell. If so, they could potentially generate selective pressure for compensation from the remaining wild type allele. Hypothesis We hypothesize that certain RUNX1 mutations are unstable and do not contribute appreciably to the total pool of total RUNX1 protein. Aims Aim 1: Clone RUNX1 mutants into expression vectors suitable for the evaluation of protein stability. Aim 2: Assess the stability of RUNX1 mutants. Predictions We predict that mutations resulting in truncations or altered reading frames may alter the stability and increase the degradation of RUNX1 protein. As well, proteins resulting in relatively conservative single amino acid changes may result in stable proteins that will appreciably contribute to the RUNX1 protein pool.  77  3.3.2  RUNX1 mutation hotspots in T-ALL Recent next generation sequencing efforts have revealed that some T-ALL cases harbor  abnormalities in the RUNX1 coding sequence. The location of reported mutations has been mapped out using Swiss PDB Viewer (Figure 3.17) to demonstrate mutation hotspots (in yellow) in the Runt domain (DNA binding and interactions with CBF!).  Figure 3.17 RUNX1 mutants identified in T-ALL Molecular surface of RUNX1/CBF!/DNA complex visualized using published crystal structure (PDB code 1H9) and Swiss PDB Viewer. The RUNX1 Runt domain is depicted in grey and CBF! in green. RUNX1 mutations reported in T-ALL are highlighted in yellow.  3.3.3  Exogenous mutated RUNX1 protein expression A heterozygous truncating mutation occurring naturally in the cell line TALL-1  (R139fs*47) has been previously reported (Della Gatta et al. 2012), and having access to this line, we confirmed the presence of this mutation through Sanger sequencing of RUNX1 Exon 5. First, we generated exogenous constructs (pCDNA3-nFlag vector) containing the RUNX1B R139fs*47 mutant and the RUNX1B R139fs*363 (contains "Exon7) mutant, which were PCR amplified from TALL-1 cDNA. Figure 3.18 demonstrates that the expression of the R139fs*47 mutant resulted in a species at about 25-27kDa (detected at a higher molecular weight than the 78  predicted size of 20kDa) as assayed on western blot, while the R139fs*363 protein appeared to be partially degraded indicating potential instability of this protein (~30kDa and ~40kDA products). Endogenous 293T RUNX1 appears on the western blot in Figure 3.18 panel C around 55kDa. Since by western blot alone we could not definitively identify the presence of endogenous R139fs*47 mutant in the TALL-1 cell line (Figure 3.4 panel A), we decided to clone it into the pcDNA3 construct for further studies. Thus, we now have a relevant truncated mutant from T-ALL for our mutant RUNX1 stability studies.  79  Figure 3.18 Expression of exogenous RUNX1 in 293T cells (A) RUNX1B R139fs*47 mutant contains Exons 4a-7 only and arose from the insertion of <G> between 413_414. Western blot analysis showing the expression of (B) exogenous and (C) total [combination of endogenous and exogenous] protein. Predicted molecular weights of RUNX1B R139fs*47 and RUNX1B R139fs*363 are 20 kDa and 54kDa, respectively. (B) Anti-Flag M2 (1:5000), 20sec exposure. (C) Anti-RUNX1 Sigma R0406 (1:1000), 2min exposure. !-Actin (1:5000) was used as a loading control.  80  3.3.4  Evaluation of mutated RUNX1 protein stability Assay design To assess the stability of the R139fs*47 protein we decided to incorporate its cDNA into  a viral construct containing GFP (trackable marker) and CBF! (heterodimerization partner) under the control of the MNDU3 promoter and separated by 2A self-cleaving sequences (Figure 3.19 panel A). Since we did not have a cloning vector harboring a ubiquitous promoter and a 2A gene flanked by multiple cloning sites, we utilized a staggered PCR-based strategy to introduce the 2A peptides into our lentiviral vector for co-expression of the three genes. The cleavage efficiency of the respective 2A peptides was then assessed using western blot. Figure 3.19 panel A demonstrates our strategy to assess the stability of the RUNX1B R139fs*47 mutant and to contrast it to that of wild-type (full-length) RUNX1B. Both vectors contain nFlag-CBF!-E2A-nFlag-GFP followed by P2A-nFlagRUNX1B wild-type or R139fs*47. We then planned to compare the ratio between RUNX1B and GFP to that of RUNX1B R139fs*47 and GFP in order to determine the stability of the mutation normalized relative to a control gene, in this case GFP.  Results obtained in heterologous 293T cells In Figure 3.19 panel B, 293T cells were transfected with 2A peptide constructs or were  left untransfected. The 2A tag, which remains attached to the relative N-terminal protein in the construct, affects protein migration. In a western blot probed with anti-Flag antibody in CBF!GFP-RUNX1B lane 4 bands were observed: 25kDa (CBF!-E2A), 30kDa (eGFP-P2A), 48kDa (very faint, RUNX1B) and prominent 55kDa (possible miscleavage). While in CBF!-GFPR139fs*47 lane 5 bands were observed: two bands below 20kDa (potential degradation 81  products), 25kDa (CBF!-E2A), 27kDa (GFP-P2A), and 55kDa (possible miscleavage). When the same lysates were probed with anti-RUNX1 antibody (Figure 3.19 panel C), the 55kDa endogenous RUNX1 species was detected in all lanes and an additional ~27kDa band was detected in the CBF!-GFP-R139fs*47 lane, possibly representing a truncated RUNX1 mutant detected at a higher molecular weight than predicted by sequence analysis (20kDa).  82  Figure 3.19 Cleavage and expression of 2A peptide linked proteins in transfected 293T (A) The vector design strategy to assess the stability of the RUNX1 mutant R139fs*47. The MNDU3 promoter drives the transcription of three genes: CBF!, GFP and RUNX1. The ratio of wild-type RUNX1 to that of the R139fs*47 mutant are to be normalized to GFP. (B) 293T cells were transiently transfected with CBF!-GFP-RUNX1B and CBF!-GFP-R139fs*47 constructs, or left untransfected. The transfected cells were processed for western blot 48hrs posttransfection. Predicted molecular weight of RUNX1B (48.7kDa) and RUNX1B R139fs*47 (20kDa). (B) Anti-Flag M2 (1:5000), 1min exposure. (C) Anti-RUNX1 R0406 (1:1000), 1min exposure. !-Actin (1:5000) was used as a loading control.  Results obtained in the human T-ALL cell line HPB-ALL Following our results in 293T cells, we went on to test the cleavage efficiency of our  viral 2A peptide constructs in the disease-specific context of T-ALL. We transduced the cell line HPB-ALL with either empty vector, CBF!-GFP-RUNX1B or CBF!-GFP-R139fs*47 and included untransduced HPB-ALL cells as a control. In Figure 3.20 panel A, cleaved and uncleaved products of our 2A peptide constructs were mapped out based on predicted molecular weights. Western blot analysis was used to assess expression in cells that were transduced with lentivirus containing 2A peptide constructs. Anti-RUNX1 Active Motif (Anti-AML1/Runx1) 83  blotting demonstrated that full-length RUNX1B (lane 2; 55kDa) was 2.2-fold overexpressed in contrast to empty vector control (Figure 3.20 panel B). Anti-RUNX1 Sigma (R0406) antibody revealed that R139fs*47 mutant was estimated to be at least 20-fold less abundant than fulllength 55kDa RUNX1, as indicated by the absence of a band corresponding with the mutant (Figure 3.20 panel C). This abundance estimation was derived from the band intensity of the 55 kDa RUNX1 species relative to the background of the western blot as measured using the ImageJ software. Furthermore, this antibody could not be used to assess the expression of exogenous full-length RUNX1, since the 55kDa endogenous RUNX1 species confounded this area of interest. The relative cleavage efficiency of our 2A peptide constructs was also assessed by AntiFlag M2 antibody (Figure 3.20 panel D). Specifically, in the CBF!-GFP-RUNX1B lane, 4 bands were observed: 25kDa (CBF!), 27kDa (GFP), 48kDa (RUNX1B) and a prominent 55kDa species (possible miscleavage). While in the CBF!-GFP-R139fs*47 lane, 3 bands were observed: 25kDa (CBF!), 27kDa (GFP), and 55kDa (possible miscleavage). Overall, we assessed that the full-length RUNX1B, CBF!, and GFP were made (produced single, discreet bands) and had roughly 87%, 42% and 52% relative cleavage efficiency, respectively. The efficiency of the R139fs*47 mutant could not be assessed since this protein species was expected to co-migrate with CBF!-E2A on the western blot. Anti-GFP detection was performed (Figure 3.20 panel E), and demonstrated a GFP band of 27kDa in the empty vector lane; while in lanes containing 2A constructs a band of ~30kDa (GFP plus E2A peptide) was observed. Another band of about 60kDa appearing only in the lanes containing 2A constructs was detected, potentially corresponding to uncleaved nFlagGFP-E2A-nFlagCBF!, that suggested nearly 82% cleavage of GFP was achieved in our 2A peptide constructs. 84  In summary, we observed that despite some limitations in assay performance due to partial cleavage efficiency, we were able to conclude that the mutated RUNX1 allele is at least 20-fold less abundant at steady state than the full length wild-type protein. Since these cDNAs were driven by the same promoter in an identical expression construct, we conclude that the mutated/truncated allele is substantially less stable than the wild-type/full length allele.  85  86  87  Figure 3.20 Cleavage and expression of 2A peptide linked proteins in HPB-ALL The T-ALL cell line HPB-ALL was transduced with lentiviral constructs containing CBF!GFP-RUNX1B and CBF!-GFP-R139fs*47, empty vector or left untransduced. The transduced cells were processed for western blot 7days post-transduction. (A) Predicted molecular weight of cleaved and uncleaved products of our 2A peptide constructs. The † (dagger) symbol in the table denotes deviation from the predicted molecular weight, since R139fs*47 runs at 25kDa on western blot (in contrast to 20kDa prediction). (B) Active Motif (Anti-AML1/Runx1) (1:1000), 10min exposure. (C) Anti-RUNX1 Sigma R0406 (1:1000), 88  1min exposure. (D) Anti-Flag M2 (1:5000), 1min exposure. (E) Anti-GFP Cell Signaling (1:500), 1min exposure. !-Actin (1:5000) was used as a loading control. Relative cleavage efficiency was calculated as cleaved form divided by sum of cleaved plus uncleaved form. The amount of each form was estimated from its band intensity on the western blot measured by ImageJ software.  In order to evaluate our ability to immunoprecipitate our 2A peptide constructs, we performed anti-Flag M2 IP. The results in Figure 3.21 panel A show that we are able to efficiently immunoprecipitate all bands found in the input lane. Immunoprecipitation was efficient, as no proteins were detected in the Unbound lane. Furthermore, immunoprecipitation allowed us to confirm the presence of uncleaved forms: CBF!-E2AGFP-P2A-RUNX1B at ~100kDa, GFP-P2A-RUNX1B at ~75kD, and CBF!-E2A-GFP-P2A at ~55kDa. Since we had transduced HPB-ALL cells with our 2A peptide constructs, we decided to monitor the stability of GFP in these vectors using an in vitro growth competition flow assay, monitoring the percent of GFP from transduced cells relative to untransduced control cells. Figure 3.21 panel B suggests that GFP signal is stable in our 2A peptide constructs, in a manner similar to the non-silencing control. In conclusion, we are able to obtain enough post-enrichment material following the transduction of T-ALL cell lines with our 2A peptide constructs and subsequent in vitro expansion of transduced cells, to analyze the stability of our mutant RUNX1 in contrast to wild-type polypeptides using mass spectrometry in future studies.  89  Figure 3.21 Immunoprecipitation and growth competition assay of 2A peptide constructs in the T-ALL cell line HPB-ALL (A) Anti-Flag immunoprecipitation was performed with HPB-ALL cell transduced with a CBF!-GFP-RUNX1 construct. Western blot with Anti-Flag M2 (1:5000) and Mouse TrueBlot ULTRA: Anti-Mouse Ig HRP (eBioscience) 1:1000, 15sec exposure. (B) Growth competition assay monitoring GFP positive cells using flow cytometry over a 17 day culture period. If the viral construct is selected against, the GFP percentage will decrease; if the viral construct is selected for, the GFP percentage will increase.  90  Chapter 4: Discussion  4.1  Wild-type isoforms and mutant RUNX1 proteins in T-ALL  4.1.1  RUNX1 mRNA isoforms  The transcription of RUNX1 is regulated by two promoters, designated as the distal P1 and the proximal P2 (Ghozi et al. 1996). The resulting primary transcripts are processed into a variety of alternatively spliced mRNAs that differ in their 5! and 3!UTRs and coding regions due to alternative cleavage and polyadenylation (Levanon and Groner 2004). Although a handful of studies have analyzed the expression of RUNX1 isoforms in acute lymphoblastic leukemia (ALL) patients at the level of mRNA, at present, the abundance of RUNX1 isoforms at the level of protein and their significance in T-ALL remains unclear (Montero-Ruiz et al. 2012; Liu et al. 2009). Liu et al. observed a higher level of expression of RUNX1A in ALL patients; while Montero-Ruiz et al. did not observe any RUNX1A overexpression in their study of bone marrow aspirates from children with ALL. In turn, they determined that the RUNX1C isoform was present in all patients, and that RUNX1A and RUNX1B could be detected in some cases (Montero-Ruiz et al. 2012). Of note, the ALL studies discussed above looked into RUNX1 mRNA expression in a cohort of predominantly B-cell lineage (B-ALL) cases, where only a small portion of their data was relevant to TALL. While attempting to clone a naturally occurring mutant (R139fs*47) from a pool of cDNA generated from the T-ALL cell line TALL-1, we unexpectedly discovered a variant of RUNX1 lacking exon 7 which appeared to have been a result of alternative splicing. To that end, we quantified total RUNX1B/C and RUNX1B/C "Exon7 mRNA levels in a number of TALL cell lines and xenograft-expanded primary patient samples in order to determine the 91  levels of RUNX1B/C and the frequency of exon 7 skipping in this disease. Since the RUNX1A isoform lacks exon 9 (Figure 1.4B), and because we were unable to clone a RUNX1A isoform which contained an exon 6-8 junction from our cDNA pool, we did not analyze the levels of RUNX1A mRNA in T-ALL. Although, we were not able to differentiate between RUNX1B and RUNX1C contribution to the total RUNX1 pool, we were able to compare expression levels between T-ALL samples. To transform our qRT-PCR expression data into meaningful values, we utilized calibration curves. Then, the data was normalized to ng RNA input or !actin an endogenous reference gene (denominators for comparison of samples). Both normalization methods have their limitations; since the conversion of mRNA to cDNA is arguably the most variable step in the whole quantification procedure, and !-actin levels can be influenced by cellular growth rates that in turn can vary between cell lines (Leclerc, Leclerc, and Barredo 2002). Of note, the expression patterns were similar between the two normalization methods used. Cell lines with high RUNX1B/C mRNA expression included RPMI 8402, TALL-1, P12 Ichikawa and Jurkat. Interestingly, 3 out of 4 cell lines with high RUNX1 mRNA expression contained somatic heterozygous mutations of the RUNX1 gene, however this is only a correlation (TALL-1, P12 Ichikawa, and Jurkat). It is possible that due to selective pressure to maintain net RUNX1 activity, the remaining wild-type allele has increased its expression in order to compensate for the mutations, although this requires that the mutations are in fact deleterious. Alternatively, it is also possible that the differences in RUNX1B/C mRNA levels merely reflect the genetic diversity between patients/cell lines which in the case of cell lines could be further confounded by prolonged in vitro cell culture since the 1970s. Xenograft-expanded primary patient T-ALL also displayed generally lower RUNX1 mRNA expression in contrast to immortalized cell lines. 92  RUNX1B/C !Exon7 mRNA had a similar expression pattern to that of total RUNX1B/C and in some cases represented up to half of total RUNX1 levels, suggesting that exon7 skipping is a relatively common occurrence in T-ALL. The biological consequences of RUNX1 exon 7 skipping remains to be determined in future studies, however, these variants lack the nuclear localization signal found in exon 7 and are thus predicted to lack the ability to enter the nucleus to carry out canonical RUNX1 functions as a transcription factor, which could be suggestive of neomorphic function.  4.1.2  RUNX1 protein isoforms The NCBI Reference Sequence Database (RefSeq) has annotated 3 representative  RUNX1 transcripts (RUNX1A, RUNX1B and RUNX1C), however the RUNX1 gene contains 19 distinct gt-ag introns that can undergo alternative splicing and therefore the theoretical expression of other variants is possible (Thierry-Mieg and Thierry-Mieg 2006). Due to a clear lack of relevant information on RUNX1 protein isoform abundance in T-ALL, and due to known differences in the efficiency of known isoforms to be translated due to different 5’ UTRs, we sought out to determine the identity and abundance of RUNX1 protein in T-ALL cell lines. Our western blot results suggested that the dominant RUNX1 proteins fall into a molecular mass range of 50-60kDa. Based on the prediction of molecular weight from amino acid sequence, RUNX1B (48.7kDa) and RUNX1C (51.8kDa) both fall into a range which cannot be distinguished using western blot alone. Notably, because RUNX1B and RUNXC differ only at the N-terminal end by 27amino acids and there is no known antibody that is specific to either isoform, we were unable to differentiate the relative contribution of these two isoforms to the total RUNX1 pool in T-ALL. To that end, we 93  sought out to develop a mass spectrometry based approach to quantify the absolute abundance of RUNX1 isoforms in T-ALL. Since RUNX1 isoform variants may have a relevant and as yet unknown impact on T-ALL biology, we required a sensitive and comprehensive detection method to study their abundance at steady-state in T-ALL cell lines. To date, our spectrometry approach has been optimized and validated. Recombinant RUNX1 proteins were overexpressed in pcDNA3-nFlag mammalian expression vector and exogenous RUNX1 proteins were isolated and enriched using immunoprecipitation. Since this method contains numerous context-specific steps (lysis of cells, binding of antigen and antibody, the complexed antibody-antigen precipitation followed by washing and subsequent dissociation), the optimization of our protocol was necessary in order for it to be RUNX1specific. Our RUNX1 constructs were tagged with the Flag epitope (N-Asp-Tyr-Lys-AspAsp-Asp-Asp-Lys-C) against which highly specific antibodies were commercially available. We utilized an Anti-Flag-M2 affinity gel (Invitrogen), which contains a highly specific monoclonal antibody covalently attached to agarose resin to immunoprecipitate the recombinant RUNX1 isoforms. The use of affinity resin removed the need for charging of beads and optimization of antibody-antigen complex precipitation. The cell lysis buffer was modified for efficient lysis of 293T cells and [NaCl] concentration was increased at least 2fold during washing steps, in order, to minimize non-specific interactions and obtain high purity products. Once recombinant RUNX1 isoforms were isolated, they were run out on the polyacrylamide gel stained with Coomassie Dye and bands of unknown origin were detected. We hypothesized that RUNX1 interaction partners (such as CBF!) might be pulled down with RUNX1 in a complex. RUNX factors alone are relatively weak activators of 94  transcription and are known to interact with other transcription factors to cooperate in transcriptional regulation (Ito 2004). However, upon mass spectrometry analysis of selected bands, only heat shock proteins (HSP) were detected; HS90A and HSP71. Since 293T cells in which the overexpression was carried out are known to have high levels of endogenous HSPs, these leads were not further pursued (Beere et al. 2000). We went on to test whether selected peptides of interest also had good MS responses (intense MS signal) (Mallick et al. 2007). Generally, in order to determine the presence or absence and specifically quantitate a polypeptide of interest, a subset of peptides are targeted as representatives of the entire protein. Observability and signal intensity are critical factors for the success of MS analysis (Mallick et al. 2007). In order to assess these critical parameters, we analyzed a tryptic digest of recombinant RUNX1 isoforms. Trypsin cuts at the C-terminus side of lysine (K) and arginine (R), and based on our MS/MS analysis an appropriate sequence coverage was obtained. Targeted peptides were selected for subsequent MRM analysis of endogenous RUNX1 isoforms in T-ALL cell lines. To determine the absolute abundance of endogenous RUNX1 isoforms in T-ALL cell lines, we employed Anti-RUNX1 immunoprecipitation to enrich for our proteins of interest prior to MRM analysis. Antibodies selected for such application would ideally: (1) recognize a region common to all isoforms of interest, (2) recognize an epitope on the surface of intact protein (exposed region), (3) target an epitope that is not frequently mutated in T-ALL, (4) be polyclonal (better efficiency in contrast to monoclonal). The immunogen sequence used to develop N-terminus (R0406) RUNX1 antibody was: GKLRSGDRSMV (42-52AA) (Sigma). Although, previously untested, it theoretically fulfilled the requirements listed above to be an effective IP antibody. In addition to the optimization steps outlined for Anti-FlagM2 95  immunoprecipitation, a bead charging step had to be optimized for effective RUNX1-IP. The RUNX1 Sigma antibody appeared to be capable of immunoprecipitating all three isoforms. Since, we are interested in determining the accurate abundance of RUNX1 protein isoforms in T-ALL cells; we designed isotopically labeled reference peptides to be spiked into our samples. This is known to be an absolute quantification method, as the exact amount of these isotopically labeled peptides is determined and the amount of the target protein can be inferred from the relative intensity of the light/heavy transitions (Lange et al. 2008). Once established, our MRM assays can be used in any study to quantitatively assess the abundance of RUNX1A, RUNX1B and RUNX1C isoforms. Since we had generated constructs containing RUNX1 isoforms capable of exogenous expression, a number of overexpression studies were performed. We noticed that overexpression of RUNX1B and RUNX1C isoforms did not seem to increase the total pool of RUNX1 in the cell, possibly due to quick turnover of the protein. Both full-length isoforms contain a C-terminal region which is rich in proline, glutamic acid, serine/threonine residues (PEST domain) and mediates ubiquitin-mediated degradation of the protein, thus enhancing proteolysis (Ogawa, Maruyama, et al. 1993). Our pcDNA3 RUNX1 constructs lacked co-expression of the heterodimerization partner CBF!, which is known to stabilize the " subunit (RUNX1) and inhibit its proteolysis (Huang et al. 2001). Utilizing a pcDNA3nFlag-RUNX1B #Exon7 construct we were able to demonstrate that this isoform variant does not localize in the nucleus in contrast to full-length RUNX1 transcription factor. Exon 7 skipping would result in a protein lacking a nuclear localization signal (NLS) (amino acids 167 to 183) (Aronson et al. 1997; Zeng et al. 1997; Zeng et al. 1998). Michaud et al. previously revealed, through transfection of RUNX1 mutants lacking an NLS into NIH3T3 96  cells and immunostaining of the expressed RUNX1 proteins that these mutants localize almost exclusively to the cytoplasm. One important caveat of the overexpression of Flagtagged proteins in our study is that we cannot rule out that tagging the RUNX1 protein and expressing it at potentially supraphysiologic levels may interfere with the protein’s normal, endogenous function.  4.1.3  RUNX1 mutants in T-ALL Mutations in RUNX1 have been recently identified in roughly 4-18% of T-ALL cases  using both next-generation and targeted Sanger sequencing (Della Gatta et al. 2012; Zhang et al. 2012; Grossmann et al. 2011). Primarily mutated in a subtype of T-ALL termed ETPALL, defined by a distinct myeloid immunophenotype and a global expression pattern similar to that of a mouse early thymic progenitor (ETP), the mutations in this subset appear to be associated with particularly poor outcome as measured by overall survival (Della Gatta et al. 2012; Zhang et al. 2012; Grossmann et al. 2011). While some functional work has been done on a number of RUNX1 mutants in myeloid malignancies (Osato 2004; Harada and Harada 2009; Zhao et al. 2012), in T-ALL thus far, only the ability to transactivate a myeloid specific RUNX1-target has been explored for a handful of mutants (Della Gatta et al. 2012). We were able to clone out a naturally occurring frame-shift mutant R139fs*47 (TALL-1 cell line cDNA) resulting in a truncated RUNX1 protein of 186 amino acids. This mutation was caused by an insertion of <G>; and falls within the DNA binding (135-143aa) Runt domain. In this regard, R139fs*47 is truncated in the middle/end of the Runt domain and has no C-terminus. This mutant was predicted to have disrupted DNA binding and no transactivation activity (demonstrated experimentally by Della Gatta et al). 97  In order to evaluate the stability of the R139fs*47 protein in a cellular context, we utilized 2A peptide sequence-containing lentiviral constructs to achieve co-expression of multiple proteins from one promoter. Although there are a number of different strategies to express multiple proteins, our approach has the benefit of a single promoter leading to a relatively high degree of coordinate, stoichiometric expression (Szymczak and Vignali 2005). Two different 2A sequences (P2A, E2A) were utilized in our approach to separate the cDNAs of interest without the caveats of multiple promoters (promoter interference), internal initiation – IRES (disparate expression levels, only two genes), and fusion proteins (altered protein folding/function). GFP was included as trackable marker and CBF! is a heterodimerization partner known to improve the stability of wild-type RUNX1 (Ito 2004; Blyth, Cameron, and Neil 2005; Wang, Stacy, Miller, et al. 1996; Ogawa, Inuzuka, et al. 1993). P2A was previously demonstrated to have the highest cleavage efficiency in HEK293T cells and thus was inserted in front of the RUNX1 gene (Kim et al. 2011). Nucleotide sequences encoding “flexible” Gly-Ser-Gly motifs were added to the 5"end of the 2A sequences to improve cleavage efficiency (Szymczak et al. 2004). As the cleavage occurs at the end of the 2A peptide, most of it remains attached to the C-terminus of the N-terminal protein. Therefore, for the most part RUNX1 protein retains its ‘natural’ sequence. No adverse effects have been reported due to the presence of 2A peptides, but this remains an important consideration in vector design and interpretation of results (Szymczak et al. 2004). The cleavage efficiency of the respective 2A peptides was assessed using western blotting. We were able to achieve roughly 2-fold overexpression of full-length RUNX1B using our 2A peptide constructs in the T-ALL cell line HPB-ALL, which has relatively lower endogenous RUNX1 expression, however the viability of the cells after sorting using FACS 98  was prohibitive to downstream analysis. Furthermore, E2A cleavage between CBF! and GFP was measured to be a relatively inefficient 50-80% (depending on the antibody used to assess relative cleavage, Anti-Flag M2 and Anti-GFP, respectively) as indicated by the presence of an uncleaved product at ~55kDa (adding up to the total molecular weight of CBF!-E2AGFP-P2A). The P2A cleavage between GFP and RUNX1 was more efficient, with relative cleavage of about 87%, as assessed by Anti-Flag M2 antibody. Kim et al. showed that among the four different 2A peptides typically used in lentiviral expression vectors (T2A, P2A, E2A, F2A), a 2A peptide derived from porcine teschovirus-1 (P2A) had the highest cleavage efficiency in human cell lines. However, E2A efficiency was at best 50% in the same cell lines tested (Kim et al. 2011). It is important to note then that the predominant miscleavage form was at an E2A site and not the more efficient P2A site. Having a potentially abundant chimeric CBF!-E2A-GFP-P2A protein species is perhaps not entirely problematic, assuming that CBF! would still be able to fold properly and stabilize the RUNX1 in a complex, it would be akin to making a C-terminal GFP fusion. Our 2A peptide constructs allowed us to assess the relative stability of the R139fs*47 truncated RUNX1 mutant in contrast to full-length RUNX1B, using western blot analysis. At first, we established the R139fs*47 mutant in a pcDNA3-nFlag vector, which contains a relatively strong promoter driving high-level expression in mammalian cells, to run at about 27kDa on the western blot although its predicted molecular weight is ~20kDa. When the CBF!-E2A-GFP-P2A-R139fs*47 construct was transfected into 293T, 2-days posttransfection we are able to detect low (more than 10-fold below endogenous full-length RUNX1) levels of the 27kDa species on our western blot. Of note, we observed a lower transfection efficiency of the tricistronic (CBF!-E2A-GFP-P2A-RUNX1) vectors compared 99  to that of monocistronic (pcDNA3-RUNX1) vectors as assessed by the percentage of GFP positive cells following transduction. Once the same 2A peptide construct was transduced into the T-ALL cell line HPBALL (~10-20% transduction efficiency), cells sorted for GFP expression and lysates prepared following 7days in culture, the R139fs*47 truncated protein was below the limit of our detection, estimated to be at least 14-fold and possibly even 20-fold less abundant/stable than full-length RUNX1. Since this truncated R139fs*47 mutant lacks the region of the Runt domain that was predicted to mediate DNA binding and interactions with CBF! (Runt domain region 50-177AA), the altered affinity of CBF! for mutated RUNX1 might explain the observed instability of R139fs*47, due to increased ubiquitin-mediated degradation (Huang et al. 2001). It therefore would be of great interest to study RUNX1 mutants which contain intact Runt domains to verify the importance of the CBF!/RUNX1 interaction in regulating the stability of RUNX1 in our artificial 2A peptide system. To optimize 2A peptide cleavage efficiency, we could potentially use a number of different approaches in the future. The order of genes in the vector can be modified, different 2A peptide sequences can be tested for their cleavage efficiency in our system, or the 3 cDNAs can be split across multiple vectors and cells co-transduced to ensure the coexpression of genes. Currently we are designing the following new constructs: (1) CBF! with trackable marker (Cherry) or selectable marker (Puromycin) and (2) nFlag-GFP-P2ARUNX1, where P2A is predicted to provide the best cleavage efficiency as previously reported. We plan to first introduce CBF! into T-ALL cell lines, select for stably expressing cells and transduce them with nFlag-GFP-P2A-RUNX1-containing constructs. Conversely,  100  simultaneous transduction with both constructs can be attempted if efficient transduction is achieved with high titre lentivirus.  4.2  Future directions Although the absolute abundance of RUNX1 protein isoforms in T-ALL cell lines  and primary patient samples is yet to determined, experiments to resolve this question are in the final stages. Additional experiments could be performed to determine the isoformspecific interaction partners, as well as the phosphorylation status of different isoforms. This information would give us a better understanding of the role these RUNX1 isoforms might play in T-ALL.  4.2.1  Quantitative assessment of the endogenous RUNX1 mutant protein fraction of  the total RUNX1 protein pool The generation of a protocol involving MRM-MS for assessing the absolute abundance of RUNX1 isoforms has been optimized and validated. However, a similar design can be implemented to quantitatively determine what fraction of the total RUNX1 protein pool is represented by naturally occurring RUNX1 mutants at steady state using a proteomics-based approach. RUNX1 mutations have been identified in four T-ALL cell lines: a truncating mutation in TALL-1 (R139fs*47) as well as heterozygous missense mutations in P12Ichikawa (58H>N), Jurkat (122 A>T) and CCRF-CEM (343 A>T) (Della Gatta et al. 2012; Forbes et al. 2008). We can use these cell lines harboring RUNX1 mutations to our advantage as representative mutations. However, targeted peptides must be designed to target 101  each specific mutant of interest, limiting the universality of this approach. Other limitations include potential inefficiency of RUNX1 antibodies in immunoprecipitating mutated protein, the epitopes usable for MRM design (coverage), and the inherent complexity of targeting missense mutants which involve a single nucleotide change.  4.2.2  A proteomic-based approach for identifying protein-protein interactions Protein-protein interactions are critical for deepening our understanding of the  biological functions of a protein of interest. Currently known RUNX1 interaction partners include CDK6 (negative regulator of cell cycle), p300 (co-activator), HIPK2 (kinase). Experimentally validated interactions have been deposited on dbPTM database (Table 4.1), however these interactions are most likely cell context specific and therefore it would be of interest to characterize and study potential RUNX1 interaction partners in T-ALL. Based on literature, the best approach to capture these often transient interactions is to incorporate formaldehyde cross-linking of cells expressing epitope-tagged protein of interest, followed by immunoaffinity purification, and mass spectrometry-based (MS/MS) protein identification. For instance, Hall et al. were able to identify interaction partners of VP16 transcriptional activator protein by using mild formaldehyde cross-linking coupled to immunoprecipitation (Hall and Struhl 2002). While this approach involves cross-linking of an exogenously produced protein and as such could lead to spurious hits due to overexpression, it is one of the most straight-forward experimental approaches and all potential interactions would be confirmed using endogenous co-IP using an Anti-RUNX1 antibody and the reciprocal antibody of the interactor.  102  Table 4.1 Experimentally verified RUNX1 interactions partners on the dbPTM database  The first column of the table indicates the name of RUNX1 interacting protein; second column identifies the type of interaction; third column indicates the source ID for each entry; fourth column gives the resource from which information was obtained; and last column contains links to Pubmed ID/articles for each entry listed. HPRD: Human Protein Reference Database. MINT: Molecular INTeraction database (Lee et al. 2006).  4.2.3  A proteomic approach for identifying phosphorylated-RUNX1 isoforms Post-translational modifications (PTMs) play an important role in the regulation of  protein activity, subcellular localization and interactions in multi-protein complexes. 103  Phosphorylation is the most frequently observed PTMs in mammalian cells; where serine (Ser), threonine (Thr) and tyrosine (Tyr) residues account for about 90%, 10% and 0.1% of the total phosphorylation, respectively (Hunter and Sefton 1980). Utilizing an MS/MS approach based on the neutral loss of metaphosphoric acid HPO3 (80Da) or phosphoric acid H3PO4 (98Da) moieties we can identify phosphorylated peptides on RUNX1 isoforms. This method works best for p-Ser and p-Thr containing phosphopeptides, as p-Tyr group does not detach as easily and will not lose 80 or 98Da (Schlosser et al. 2001). Our preliminary MS/MS data suggests there may be differential phosphorylation of RUNX1 isoforms in human cells. Thus far, RUNX1A overexpressed in 293T demonstrated two variants; one containing phosphorylation on T14 (ASTSRRFTPPSTALS), T18 (RRFTPPSTALSPGKM), S21 (TPPSTALSPGKMSEA) residues; another containing T14, S17 (SRRFTPPSTALSPGK), S50 (KLRSGDRSMVEVLAD), S212. In RUNX1B the following residues were phosphorylated: S21, T84 (THWRCNKTLPIAFKV), S212 (RRTAMRVSPHHPAPT); while in RUNX1C: T14, S21, S67 (GELVRTDSPNFLCSV). It appears as though S21 phosphorylation in the N-terminal region is common between all three isoforms. Our MS/MS analysis picked up previously unreported (using the PhosphoSitePlus database as reference) modifications in the RUNT domain: S50, S67 and T84. The limitation of these preliminary results included poor MS coverage of C-terminal regions; where most post-translational modifications are predicted to occur. Furthermore, PTM information might be cell-context specific, thus out studies should be performed in a TALL cell context in order to determine if these modifications may have relevance to this disease and might be worth studying. Overall, mass spectrometry can be effectively utilized to characterize novel PTMs due to its high sensitivity and capacity to identify PTMs in 104  complex mixtures; however, this method requires a great deal of optimization since most PTMs are low abundance and can be labile during MS analysis (Larsen et al. 2006). Selective enrichment of PTM proteins and peptides prior to mass spectrometry can improve the validity of this method.  4.2.4  Functional relevance of RUNX1 mutations in T-ALL There is great need to clarify the role of RUNX1 mutations in T-ALL, as their current  functions are unknown and how they relate to the pathogenesis of this disease is of immense interest. Once the stability and expression levels of the various classes of these mutations is established, in vitro and in vivo functional experiments should be of great priority. In vitro functional studies could include but are not limited to: subcellular location (immunofluorescence or confocal microscopy); capacity to bind DNA (gel shift assay); capacity to interact with CBF! (co-IP), ability to transactivate a T-lymphoid specific RUNX1-target; ability to inhibit wild type RUNX1 allele functions; ability to impede or enhance growth when exogenously expressed. Thus far, most of the RUNX1 mutations discovered are clustered in the Runt domain and might potentially result in (1) defective DNA binding but active CBF! binding (dominant inhibitory effects, antagonizing canonical RUNX signaling); (2) defective CBF!binding only (decreased stability, hypomorphic allele), (3) defective DNA binding and defective CBF! interaction (non-functional protein) (Matheny et al. 2007). As in myeloproliferative disorders, the mutations observed in T-ALL in the Runt domain mainly consist of frameshift and nonsense mutations that are predicted to be deleterious (Zhang, 2012 Nature). Nonsense-mediated mRNA decay (NMD) is presumed to degrade the mRNA 105  of these mutants as it encounters a premature stop codon (Chang, Imam, and Wilkinson 2007). Missense mutations that occur in T-ALL, are largely C>T/G>A transitions. It is currently unclear which of these single nucleotide changes are of functional significance, leading to susceptibility to leukemia or represent polymorphisms. In the C-terminus of RUNX1, which contains important TAD and TID domains, frameshift mutations resulting in fusion proteins have been reported. Studies suggest that these C-terminal mutants might also have dominant negative effects since their DNA binding and CBF! interaction domains are unaltered; however these mutants were reported to have milder inhibitory effects in luciferase assays (Yoshida, Kanegane, et al. 2002). To that end, we have selected a number of RUNX1 mutations previously reported in T-ALL that we intend to investigate based on predicted functional changes. For example, missense mutations include H78Y (decreased DNA binding), S114P (decreased CBF! interaction) and A343T (structurally disruptive mutation in TAD domain, found in CCRF-CEM cell line). Additionally, nonsense mutations resulting in truncated proteins include R174X (end of Runt domain; decrease in DNA binding only) and S295X (TAD domain non-functional). Finally, we intend to investigate the frameshift mutations R139fs*47 (deleterious truncation) and IIle337Valfsx231 (fusion, predicted dominant negative activity). Since a number of groups have predicted that certain RUNX1 mutants can have dominant-negative inhibitory effects, such claims need to be further validated. First, the stability of the mutants that are predicted to be the most structurally disruptive should be assessed. In our current study we provide at least one relevant method involving the use of 2A peptide constructs to determine the stability of mutated peptides in contrast to full-length protein. 106  In vivo studies of mutants are also of potential interest as perhaps certain types of mutants may contribute in different ways to the transforming potential of preleukemic cells. The 2A peptide approach can be very helpful in this regard, as RUNX1 mutants can be introduced into the cell with CBF! interaction partner to improve the stability of the complex. Furthermore, since RUNX1 mutation only predispose to leukemia (Song et al. 1999), other known T-ALL oncogenes such as NOTCH1 can be incorporated into a 2A peptide vector to test their collaborations with RUNX1 to induce leukemia.  107  Chapter 5: Concluding chapter The aims of this thesis were to determine the expression and absolute abundance of RUNX1 isoforms in T-ALL using mass spectrometry and to evaluate whether mutated RUNX1 proteins are expressed stably in the cell at the protein level using a viral 2A peptide approach. The results presented here demonstrate the development of a mass spectrometry approach that can be effectively applied to determine the expression and abundance of RUNX1 isoforms in T-ALL specifically. The absolute abundance of RUNX1 protein isoforms quantified with our targeted mass spectrometry approach is currently pending. The use of a 2A peptide method can be used to contrast the stability of RUNX1 mutants to that of wild-type protein; however this method relies on achieving highly efficient cleavage of the 2A peptides. Very little is currently known regarding the relative abundance of RUNX1 isoforms in T-ALL. We demonstrated the presence of a relatively frequent exon 7 skipping phenomenon in T-ALL and quantified total RUNX1B/C mRNA levels in T-ALL cell lines and xenograft-expanded primary patient samples. We have determined that western blot analysis alone is insufficient to differentiate between isoforms RUNX1B and RUNX1C, and currently RUNX1A is entirely undetectable using this method. The RUNX1 community will largely benefit from the mass spectrometry approach we designed as it can be applied to quantify RUNX1isoforms across any tissue or disease context. The results from our studies will serve as a stepping stone for better understanding the expression of alternatively spliced RUNX1 isoforms and mutations in leukemia and help to determine if targeting of RUNX1 and/or its downstream targets is a viable therapeutic option.  108  References Aifantis, I., Raetz, E., and Buonamici, S. (2008). Molecular pathogenesis of T-cell leukaemia and lymphoma. Nat Rev Immunol 8 (5):380-90. Andreasson, P., Schwaller, J., Anastasiadou, E., Aster, J., and Gilliland, D. G. (2001). The expression of ETV6/CBFA2 (TEL/AML1) is not sufficient for the transformation of hematopoietic cell lines in vitro or the induction of hematologic disease in vivo. Cancer Genet Cytogenet 130 (2):93-104. Armstrong, S. A., and Look, A. T. (2005). Molecular genetics of acute lymphoblastic leukemia. Journal of Clinical Oncology 23 (26):6306-15. Aronson, B. D., Fisher, A. L., Blechman, K., Caudy, M., and Gergen, J. P. (1997). Grouchodependent and -independent repression activities of Runt domain proteins. Mol Cell Biol 17 (9):5581-7. Asselin, B. L., Devidas, M., Wang, C. G., Pullen, J., Borowitz, M. J., Hutchison, R., Lipshultz, S. E., and Camitta, B. M. (2011). Effectiveness of high-dose methotrexate in T-cell lymphoblastic leukemia and advanced-stage lymphoblastic lymphoma: a randomized study by the Children's Oncology Group (POG 9404). Blood 118 (4):874-83. Bae, S. C., Ogawa, E., Maruyama, M., Oka, H., Satake, M., Shigesada, K., Jenkins, N. A., Gilbert, D. J., Copeland, N. G., and Ito, Y. (1994). Pebp2-Alpha-B/Mouse Aml1 Consists of Multiple Isoforms That Possess Differential Transactivation Potentials. Mol Cell Biol 14 (5):3242-52. Bee, T., Swiers, G., Muroi, S., Pozner, A., Nottingham, W., Santos, A. C., Li, P. S., Taniuchi, I., and de Bruijn, M. F. T. R. (2010). Nonredundant roles for Runx1 alternative promoters reflect their activity at discrete stages of developmental hematopoiesis. Blood 115 (15):3042-50. Beere, H. M., Wolf, B. B., Cain, K., Mosser, D. D., Mahboubi, A., Kuwana, T., Tailor, P., Morimoto, R. I., Cohen, G. M., and Green, D. R. (2000). Heat-shock protein 70 inhibits apoptosis by preventing recruitment of procaspase-9 to the Apaf-1 apoptosome. Nat Cell Biol 2 (8):469-75. Berger, R. (1997). Acute lymphoblastic leukemia and chromosome 21. Cancer Genet Cytogenet 94 (1):8-12. Bernardin, F., Yang, Y., Cleaves, R., Zahurak, M., Cheng, L., Civin, C. I., and Friedman, A. D. (2002). TEL-AML1, expressed from t(12;21) in human acute lymphocytic leukemia, induces acute leukemia in mice. Cancer Res 62 (14):3904-8. Biggs, J. R., Peterson, L. F., Zhang, Y., Kraft, A. S., and Zhang, D. E. (2006). AML1/RUNX1 phosphorylation by cyclin-dependent kinases regulates the degradation of AML1/RUNX1 by the anaphase-promoting complex. Mol Cell Biol 26 (20):7420-9. Blyth, K., Cameron, E. R., and Neil, J. C. (2005). The RUNX genes: gain or loss of function in cancer. Nat Rev Cancer 5 (5):376-87. Blyth, K., Vaillant, F., Jenkins, A., McDonald, L., Pringle, M. A., Huser, C., Stein, T., Neil, J., and Cameron, E. R. (2010). Runx2 in normal tissues and cancer cells: A developing story. Blood Cells Mol Dis 45 (2):117-23. 109  Bravo, J., Li, Z., Speck, N. A., and Warren, A. J. (2001). The leukemia-associated AML1 (Runx1)-CBF beta complex functions as a DNA-induced molecular clamp. Nat Struct Biol 8 (4):371-78. Cauwelier, B., Dastugue, N., Cools, J., Poppe, B., Herens, C., De Paepe, A., Hagemeijer, A., and Speleman, F. (2006). Molecular cytogenetic study of 126 unselected T-ALL cases reveals high incidence of TCRbeta locus rearrangements and putative new Tcell oncogenes. Leukemia 20 (7):1238-44. Cayuela, J. M., Madani, A., Sanhes, L., Stern, M. H., and Sigaux, F. (1996). Multiple tumorsuppressor gene 1 inactivation is the most frequent genetic alteration in T-cell acute lymphoblastic leukemia. Blood 87 (6):2180-6. Challen, G. A., and Goodell, M. A. (2010). Runx1 isoforms show differential expression patterns during hematopoietic development but have similar functional effects in adult hematopoietic stem cells. Experimental Hematology 38 (5):403-16. Chang, Y. F., Imam, J. S., and Wilkinson, M. F. (2007). The nonsense-mediated decay RNA surveillance pathway. Annu Rev Biochem 76:51-74. Chaplin, P. J., Camon, E. B., Villarreal-Ramos, B., Flint, M., Ryan, M. D., and Collins, R. A. (1999). Production of interleukin-12 as a self-processing 2A polypeptide. Journal of Interferon and Cytokine Research 19 (3):235-41. Chiang, M. Y., Shestova, O., Xu, L., Aster, J. C., and Pear, W. S. (2013). Divergent effects of supraphysiologic Notch signals on leukemia stem cells and hematopoietic stem cells. Blood 121 (6):905-17. Cockerill, P. N., Osborne, C. S., Bert, A. G., and Grotto, R. J. (1996). Regulation of GM-CSF gene transcription by core-binding factor. Cell Growth Differ 7 (7):917-22. Coustan-Smith, E., Mullighan, C. G., Onciu, M., Behm, F. G., Raimondi, S. C., Pei, D., Cheng, C., Su, X., Rubnitz, J. E., Basso, G., Biondi, A., Pui, C. H., Downing, J. R., and Campana, D. (2009). Early T-cell precursor leukaemia: a subtype of very highrisk acute lymphoblastic leukaemia. Lancet Oncology 10 (2):147-56. Della Gatta, G., Palomero, T., Perez-Garcia, A., Ambesi-Impiombato, A., Bansal, M., Carpenter, Z. W., De Keersmaecker, K., Sole, X., Xu, L., Paietta, E., Racevskis, J., Wiernik, P. H., Rowe, J. M., Meijerink, J. P., Califano, A., and Ferrando, A. A. (2012). Reverse engineering of TLX oncogenic transcriptional networks identifies RUNX1 as tumor suppressor in T-ALL. Nature Medicine 18 (3):436-40. Della Gatta, G., Palomero, T., Perez-Garcia, A., Ambesi-Impiombato, A., Bansal, M., Carpenter, Z. W., De Keersmaecker, K., Sole, X., Xu, L. Y., Paietta, E., Racevskis, J., Wiernik, P. H., Rowe, J. M., Meijerink, J. P., Califano, A., and Ferrando, A. A. (2012). Reverse engineering of TLX oncogenic transcriptional networks identifies RUNX1 as tumor suppressor in T-ALL. Nature Medicine 18 (3):436-U198. Drissi, H., Pouliot, A., Stein, J. L., van Wijnen, A. J., Stein, G. S., and Lian, J. B. (2002). Identification of novel protein/DNA interactions within the promoter of the bonerelated transcription factor Runx2/Cbfa1. Journal of Cellular Biochemistry 86 (2):403-12. Duffy, J. B., Kania, M. A., and Gergen, J. P. (1991). Expression and function of the Drosophila gene runt in early stages of neural development. Development 113 (4):1223-30.  110  Dull, T., Zufferey, R., Kelly, M., Mandel, R. J., Nguyen, M., Trono, D., and Naldini, L. (1998). A third-generation lentivirus vector with a conditional packaging system. J Virol 72 (11):8463-71. Durst, K. L., and Hiebert, S. W. (2004). Role of RUNX family members in transcriptional repression and gene silencing. Oncogene 23 (24):4220-4. Durst, K. L., Lutterbach, B., Kummalue, T., Friedman, A. D., and Hiebert, S. W. (2003). The inv(16) fusion protein associates with corepressors via a smooth muscle myosin heavy-chain domain. Mol Cell Biol 23 (2):607-19. Dzierzak, E., and Medvinsky, A. (1995). Mouse embryonic hematopoiesis. Trends Genet 11 (9):359-66. Edwards, H., Xie, C., LaFiura, K. M., Dombkowski, A. A., Buck, S. A., Boerner, J. L., Taub, J. W., Matherly, L. H., and Ge, Y. (2009). RUNX1 regulates phosphoinositide 3kinase/AKT pathway: role in chemotherapy sensitivity in acute megakaryocytic leukemia. Blood 114 (13):2744-52. Erickson, P., Gao, J., Chang, K. S., Look, T., Whisenant, E., Raimondi, S., Lasher, R., Trujillo, J., Rowley, J., and Drabkin, H. (1992). Identification of breakpoints in t(8;21) acute myelogenous leukemia and isolation of a fusion transcript, AML1/ETO, with similarity to Drosophila segmentation gene, runt. Blood 80 (7):1825-31. Faderl, S., Kantarjian, H. M., Manshouri, T., Chan, C. Y., Pierce, S., Hays, K. J., Cortes, J., Thomas, D., Estrov, Z., and Albitar, M. (1999). The prognostic significance of p16INK4a/p14ARF and p15INK4b deletions in adult acute lymphoblastic leukemia. Clin Cancer Res 5 (7):1855-61. Fears, S., Gavin, M., Zhang, D. E., Hetherington, C., Ben-David, Y., Rowley, J. D., and Nucifora, G. (1997). Functional characterization of ETV6 and ETV6/CBFA2 in the regulation of the MCSFR proximal promoter. Proc Natl Acad Sci U S A 94 (5):194954. Fenrick, R., Amann, J. M., Lutterbach, B., Wang, L., Westendorf, J. J., Downing, J. R., and Hiebert, S. W. (1999). Both TEL and AML-1 contribute repression domains to the t(12;21) fusion protein. Mol Cell Biol 19 (10):6566-74. Forbes, S. A., Bhamra, G., Bamford, S., Dawson, E., Kok, C., Clements, J., Menzies, A., Teague, J. W., Futreal, P. A., and Stratton, M. R. (2008). The Catalogue of Somatic Mutations in Cancer (COSMIC). Curr Protoc Hum Genet Chapter 10:Unit 10 11. Frank, R., Zhang, J., Uchida, H., Meyers, S., Hiebert, S. W., and Nimer, S. D. (1995). The AML1/ETO fusion protein blocks transactivation of the GM-CSF promoter by AML1B. Oncogene 11 (12):2667-74. Gamis, A. S., Woods, W. G., Alonzo, T. A., Buxton, A., Lange, B., Barnard, D. R., Gold, S., and Smith, F. O. (2003). Increased age at diagnosis has a significantly negative effect on outcome in children with down syndrome and acute myeloid leukemia: A report from the Children's Cancer Group Study 2891. Journal of Clinical Oncology 21 (18):3415-22. Ganly, P., Walker, L. C., and Morris, C. M. (2004). Familial mutations of the transcription factor RUNX1 (AML1, CBFA2) predispose to acute myeloid leukemia. Leuk Lymphoma 45 (1):1-10. Gelmetti, V., Zhang, J., Fanelli, M., Minucci, S., Pelicci, P. G., and Lazar, M. A. (1998). Aberrant recruitment of the nuclear receptor corepressor-histone deacetylase complex by the acute myeloid leukemia fusion partner ETO. Mol Cell Biol 18 (12):7185-91. 111  Gergen, J. P., and Butler, B. A. (1988). Isolation of the Drosophila segmentation gene runt and analysis of its expression during embryogenesis. Genes Dev 2 (9):1179-93. Ghozi, M. C., Bernstein, Y., Negreanu, V., Levanon, D., and Groner, Y. (1996). Expression of the human acute myeloid leukemia gene AML1 is regulated by two promoter regions. Proc Natl Acad Sci U S A 93 (5):1935-40. Goel, A., Arnold, C. N., Tassone, P., Chang, D. K., Niedzwiecki, D., Dowell, J. M., Wasserman, L., Compton, C., Mayer, R. J., Bertagnolli, M. M., and Boland, C. R. (2004). Epigenetic inactivation of RUNX3 in microsatellite unstable sporadic colon cancers. International Journal of Cancer 112 (5):754-59. Golub, T. R., Barker, G. F., Bohlander, S. K., Hiebert, S. W., Ward, D. C., Bray-Ward, P., Morgan, E., Raimondi, S. C., Rowley, J. D., and Gilliland, D. G. (1995). Fusion of the TEL gene on 12p13 to the AML1 gene on 21q22 in acute lymphoblastic leukemia. Proc Natl Acad Sci U S A 92 (11):4917-21. Grabher, C., von Boehmer, H., and Look, A. T. (2006). Notch 1 activation in the molecular pathogenesis of T-cell acute lymphoblastic leukaemia. Nat Rev Cancer 6 (5):347-59. Graux, C., Cools, J., Michaux, L., Vandenberghe, P., and Hagemeijer, A. (2006). Cytogenetics and molecular genetics of T-cell acute lymphoblastic leukemia: from thymocyte to lymphoblast. Leukemia 20 (9):1496-510. Grossmann, V., Kern, W., Harbich, S., Alpermann, T., Jeromin, S., Schnittger, S., Haferlach, C., Haferlach, T., and Kohlmann, A. (2011). Prognostic relevance of RUNX1 mutations in T-cell acute lymphoblastic leukemia. Haematologica 96 (12):1874-7. Growney, J. D., Shigematsu, H., Li, Z., Lee, B. H., Adeisperger, J., Rowan, R., Curley, D. P., Kutok, J. L., Akashi, K., Williams, I. R., Speck, N. A., and Gilliland, D. G. (2005). Loss of Runx1 perturbs adult hematopoiesis and is associated with a myeloproliferative phenotype. Blood 106 (2):494-504. Gu, T. L., Goetz, T. L., Graves, B. J., and Speck, N. A. (2000). Auto-inhibition and partner proteins, core-binding factor beta (CBF beta) and Ets-1, modulate DNA finding by CBF alpha 2 (AML1). Mol Cell Biol 20 (1):91-103. Guidez, F., Petrie, K., Ford, A. M., Lu, H., Bennett, C. A., MacGregor, A., Hannemann, J., Ito, Y., Ghysdael, J., Greaves, M., Wiedemann, L. M., and Zelent, A. (2000). Recruitment of the nuclear receptor corepressor N-CoR by the TEL moiety of the childhood leukemia-associated TEL-AML1 oncoprotein. Blood 96 (7):2557-61. Hall, D. B., and Struhl, K. (2002). The VP16 activation domain interacts with multiple transcriptional components as determined by protein-protein cross-linking in vivo. Journal of Biological Chemistry 277 (48):46043-50. Harada, Y., and Harada, H. (2009). Molecular Pathways Mediating MDS/AML With Focus on AML1/RUNX1 Point Mutations. Journal of Cellular Physiology 220 (1):16-20. Harewood, L., Robinson, H., Harris, R., Al-Obaidi, M. J., Jalali, G. R., Martineau, M., Moorman, A. V., Sumption, N., Richards, S., Mitchell, C., and Harrison, C. J. (2003). Amplification of AML1 on a duplicated chromosome 21 in acute lymphoblastic leukemia: a study of 20 cases. Leukemia 17 (3):547-53. Hernandez-Munain, C., and Krangel, M. S. (2002). Distinct roles for c-Myb and core binding factor/polyoma enhancer-binding protein 2 in the assembly and function of a multiprotein complex on the TCR delta enhancer in vivo. J Immunol 169 (8):4362-9. Hiebert, S. W., Sun, W., Davis, J. N., Golub, T., Shurtleff, S., Buijs, A., Downing, J. R., Grosveld, G., Roussell, M. F., Gilliland, D. G., Lenny, N., and Meyers, S. (1996). 112  The t(12;21) translocation converts AML-1B from an activator to a repressor of transcription. Mol Cell Biol 16 (4):1349-55. Ho, C. Y., Otterud, B., Legare, R. D., Varvil, T., Saxena, R., DeHart, D. B., Kohler, S. E., Aster, J. C., Dowton, S. B., Li, F. P., Leppert, M., and Gilliland, D. G. (1996). Linkage of a familial platelet disorder with a propensity to develop myeloid malignancies to human chromosome 21q22.1-22.2. Blood 87 (12):5218-24. Holst, J., Szymczak-Workman, A. L., Vignali, K. M., Burton, A. R., Workman, C. J., and Vignali, D. A. (2006). Generation of T-cell receptor retrogenic mice. Nat Protoc 1 (1):406-17. Huang, G., Shigesada, K., Ito, K., Wee, H. J., Yokomizo, T., and Ito, Y. (2001). Dimerization with PEBP2beta protects RUNX1/AML1 from ubiquitin-proteasome-mediated degradation. EMBO J 20 (4):723-33. Huang, P. Q., Wall, D. B., Parus, S., and Lubman, D. M. (2000). On-line capillary liquid chromatography tandem mass spectrometry on an ion trap/reflectron time-of-flight mass spectrometer using the sequence tag database search approach for peptide sequencing and protein identification. Journal of the American Society for Mass Spectrometry 11 (2):127-35. Huang, X., Peng, J. W., Speck, N. A., and Bushweller, J. H. (1999). Solution structure of core binding factor beta and map of the CBF alpha binding site. Nat Struct Biol 6 (7):624-7. Hunter, T., and Sefton, B. M. (1980). Transforming Gene-Product of Rous-Sarcoma Virus Phosphorylates Tyrosine. Proceedings of the National Academy of Sciences of the United States of America-Biological Sciences 77 (3):1311-15. Ichikawa, M., Asai, T., Saito, T., Yamamoto, G., Seo, S., Yamazaki, I., Yamagata, T., Mitani, K., Chiba, S., Hirai, H., Ogawa, S., and Kurokawa, M. (2004). AML-1 is required for megakaryocytic maturation and lymphocytic differentiation, but not for maintenance of hematopoietic stem cells in adult hematopoiesis. Nature Medicine 10 (3):299-304. Imai, Y., Kurokawa, M., Tanaka, K., Friedman, A. D., Ogawa, S., Mitani, K., Yazaki, Y., and Hirai, H. (1998). TLE, the human homolog of Groucho, interacts with AML1 and acts as a repressor of AML1-induced transactivation. Biochem Biophys Res Commun 252 (3):582-89. Imai, Y., Kurokawa, M., Yamaguchi, Y., Izutsu, K., Nitta, E., Mitani, K., Satake, M., Noda, T., Ito, Y., and Hirai, H. (2004). The corepressor mSin3A regulates phosphorylationinduced activation, intranuclear location, and stability of AML1. Mol Cell Biol 24 (3):1033-43. Inoue, K., Ozaki, S., Shiga, T., Ito, K., Masuda, T., Okado, N., Iseda, T., Kawaguchi, S., Ogawa, M., Bae, S. C., Yamashita, N., Itohara, S., Kudo, N., and Ito, Y. (2002). Runx3 controls the axonal projection of proprioceptive dorsal root ganglion neurons. Nat Neurosci 5 (10):946-54. Iolascon, A., Faienza, M. F., Coppola, B., della Ragione, F., Schettini, F., and Biondi, A. (1996). Homozygous deletions of cyclin-dependent kinase inhibitor genes, p16(INK4A) and p18, in childhood T cell lineage acute lymphoblastic leukemias. Leukemia 10 (2):255-60. Ito, K., Liu, Q., Salto-Tellez, M., Yano, T., Tada, K., Ida, H., Huang, C. H., Shah, N., Inoue, M., Rajnakova, A., Hiong, K. C., Peh, B. K., Han, H. C., Ito, T., Teh, M., Yeoh, K. 113  G., and Ito, Y. (2005). RUNX3, a novel tumor suppressor, is frequently inactivated in gastric cancer by protein mislocalization. Cancer Res 65 (17):7743-50. Ito, Y. (1999). Molecular basis of tissue-specific gene expression mediated by the runt domain transcription factor PEBP2/CBF. Genes Cells 4 (12):685-96. ———. (2004). Oncogenic potential of the RUNX gene family: 'overview'. Oncogene 23 (24):4198-208. ———. (2008). RUNX genes in development and cancer: regulation of viral gene expression and the discovery of RUNX family genes. Adv Cancer Res 99:33-76. Kanno, T., Kanno, Y., Chen, L. F., Ogawa, E., Kim, W. Y., and Ito, Y. (1998). Intrinsic transcriptional activation-inhibition domains of the polyomavirus enhancer binding protein 2/core binding factor alpha subunit revealed in the presence of the beta subunit. Mol Cell Biol 18 (5):2444-54. Kaur, P., and Asea, A. (2011). Quantitation of heat-shock proteins in clinical samples using mass spectrometry. Methods Mol Biol 787:165-88. Kim, J. H., Lee, S. R., Li, L. H., Park, H. J., Park, J. H., Lee, K. Y., Kim, M. K., Shin, B. A., and Choi, S. Y. (2011). High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and mice. PLoS One 6 (4):e18556. Klumper, E., Pieters, R., Veerman, A. J. P., Huismans, D. R., Loonen, A. H., Hahlen, K., Kaspers, G. J. L., Vanwering, E. R., Hartmann, R., and Henze, G. (1995). In-Vitro Cellular-Drug Resistance in Children with Relapsed/Refractory Acute Lymphoblastic-Leukemia. Blood 86 (10):3861-68. Lam, K., and Zhang, D. E. (2012). RUNX1 and RUNX1-ETO: roles in hematopoiesis and leukemogenesis. Front Biosci 17:1120-39. Lange, B. J., Kobrinsky, N., Barnard, D. R., Arthur, D. C., Buckley, J. D., Howells, W. B., Gold, S., Sanders, J., Neudorf, S., Smith, F. O., and Woods, W. G. (1998). Distinctive demography, biology, and outcome of acute myeloid leukemia and myelodysplastic syndrome in children with Down syndrome: Children's cancer group studies 2861 and 2891. Blood 91 (2):608-15. Lange, V., Picotti, P., Domon, B., and Aebersold, R. (2008). Selected reaction monitoring for quantitative proteomics: a tutorial. Mol Syst Biol 4:222. Larsen, M. R., Trelle, M. B., Thingholm, T. E., and Jensen, O. N. (2006). Analysis of posttranslational modifications of proteins by tandem mass spectrometry. Biotechniques 40 (6):790-8. Lau, Q. C., Raja, E., Salto-Terez, M., Liu, Q., Ito, K., Inoue, M., Putti, T. C., Loh, M., Ko, T. K., Huang, C. H., Bhalla, K. N., Zhu, T., Ito, Y., and Sukumar, S. (2006). RUNX3 is frequently inactivated by dual mechanisms of protein mislocalization and promoter hypermethylation in breast cancer. Cancer Res 66 (13):6512-20. Le Noir, S., Ben Abdelali, R., Lelorch, M., Bergeron, J., Sungalee, S., Payet-Bornet, D., Villarese, P., Petit, A., Callens, C., Lhermitte, L., Baranger, L., Radford-Weiss, I., Gregoire, M. J., Dombret, H., Ifrah, N., Spicuglia, S., Romana, S., Soulier, J., Nadel, B., Macintyre, E., and Asnafi, V. (2012). Extensive molecular mapping of TCRalpha/delta- and TCRbeta-involved chromosomal translocations reveals distinct mechanisms of oncogene activation in T-ALL. Blood 120 (16):3298-309.  114  Leclerc, G. J., Leclerc, G. M., and Barredo, J. C. (2002). Real-time RT-PCR analysis of mRNA decay: half-life of Beta-actin mRNA in human leukemia CCRF-CEM and Nalm-6 cell lines. Cancer Cell Int 2 (1):1. Lee, C. W. L., Chuang, L. S. H., Kimura, S., Lai, S. K., Ong, C. W., Yan, B., Salto-Tellez, M., Choolani, M., and Ito, Y. (2011). RUNX3 functions as an oncogene in ovarian cancer. Gynecologic Oncology 122 (2):410-17. Lee, T. Y., Huang, H. D., Hung, J. H., Huang, H. Y., Yang, Y. S., and Wang, T. H. (2006). dbPTM: an information repository of protein post-translational modification. Nucleic Acids Res 34 (Database issue):D622-7. Levanon, D., Bettoun, D., Harris-Cerruti, C., Woolf, E., Negreanu, V., Eilam, R., Bernstein, Y., Goldenberg, D., Xiao, C., Fliegauf, M., Kremer, E., Otto, F., Brenner, O., LevTov, A., and Groner, Y. (2002). The Runx3 transcription factor regulates development and survival of TrkC dorsal root ganglia neurons. EMBO J 21 (13):3454-63. Levanon, D., Glusman, G., Bangsow, T., Ben-Asher, E., Male, D. A., Avidan, N., Bangsow, C., Hattori, M., Taylor, T. D., Taudien, S., Blechschmidt, K., Shimizu, N., Rosenthal, A., Sakaki, Y., Lancet, D., and Groner, Y. (2001). Architecture and anatomy of the genomic locus encoding the human leukemia-associated transcription factor RUNX1/AML1. Gene 262 (1-2):23-33. Levanon, D., Goldstein, R. E., Bernstein, Y., Tang, H., Goldenberg, D., Stifani, S., Paroush, Z., and Groner, Y. (1998). Transcriptional repression by AML1 and LEF-1 is mediated by the TLE/Groucho corepressors. Proc Natl Acad Sci U S A 95 (20):11590-95. Levanon, D., and Groner, Y. (2004). Structure and regulated expression of mammalian RUNX genes. Oncogene 23 (24):4211-19. Li, Q. L., Ito, K., Sakakura, C., Fukamachi, H., Inoue, K., Chi, X. Z., Lee, K. Y., Nomura, S., Lee, C. W., Han, S. B., Kim, H. M., Kim, W. J., Yamamoto, H., Yamashita, N., Yano, T., Ikeda, T., Itohara, S., Inazawa, J., Abe, T., Hagiwara, A., Yamagishi, H., Ooe, A., Kaneda, A., Sugimura, T., Ushijima, T., Bae, S. C., and Ito, Y. (2002). Causal relationship between the loss of RUNX3 expression and gastric cancer. Cell 109 (1):113-24. Liu, X., Zhang, Q., Zhang, D. E., Zhou, C., Xing, H., Tian, Z., Rao, Q., Wang, M., and Wang, J. (2009). Overexpression of an isoform of AML1 in acute leukemia and its potential role in leukemogenesis. Leukemia 23 (4):739-45. Lutterbach, B., Westendorf, J. J., Linggi, B., Isaac, S., Seto, E., and Hiebert, S. W. (2000). A mechanism of repression by acute myeloid leukemia-1, the target of multiple chromosomal translocations in acute leukemia. Journal of Biological Chemistry 275 (1):651-6. Lutterbach, B., Westendorf, J. J., Linggi, B., Patten, A., Moniwa, M., Davie, J. R., Huynh, K. D., Bardwell, V. J., Lavinsky, R. M., Rosenfeld, M. G., Glass, C., Seto, E., and Hiebert, S. W. (1998). ETO, a target of t(8;21) in acute leukemia, interacts with the N-CoR and mSin3 corepressors. Mol Cell Biol 18 (12):7176-84. Mallick, P., Schirle, M., Chen, S. S., Flory, M. R., Lee, H., Martin, D., Ranish, J., Raught, B., Schmitt, R., Werner, T., Kuster, B., and Aebersold, R. (2007). Computational prediction of proteotypic peptides for quantitative proteomics. Nature Biotechnology 25 (1):125-31. 115  Mandrell, B. N. (2009). The genetic profile and monitoring of acute lymphoblastic leukemia in children and adolescents. J Pediatr Nurs 24 (3):173-8. Matheny, C. J., Speck, M. E., Cushing, P. R., Zhou, Y., Corpora, T., Regan, M., Newman, M., Roudaia, L., Speck, C. L., Gu, T. L., Griffey, S. M., Bushweller, J. H., and Speck, N. A. (2007). Disease mutations in RUNX1 and RUNX2 create nonfunctional, dominant-negative, or hypomorphic alleles. EMBO J 26 (4):1163-75. Michaud, J., Wu, F., Osato, M., Cottles, G. M., Yanagida, M., Asou, N., Shigesada, K., Ito, Y., Benson, K. F., Raskind, W. H., Rossier, C., Antonarakis, S. E., Israels, S., McNicol, A., Weiss, H., Horwitz, M., and Scott, H. S. (2002). In vitro analyses of known and novel RUNX1/AML1 mutations in dominant familial platelet disorder with predisposition to acute myelogenous leukemia: implications for mechanisms of pathogenesis. Blood 99 (4):1364-72. Mikhail, F. M., Serry, K. A., Hatem, N., Mourad, Z. I., Farawela, H. M., El Kaffash, D. M., Coignet, L., and Nucifora, G. (2002). A new translocation that rearranges the AML1 gene in a patient with T-cell acute lymphoblastic leukemia. Cancer Genet Cytogenet 135 (1):96-100. Miyoshi, H., Ohira, M., Shimizu, K., Mitani, K., Hirai, H., Imai, T., Yokoyama, K., Soeda, E., and Ohki, M. (1995). Alternative splicing and genomic structure of the AML1 gene involved in acute myeloid leukemia. Nucleic Acids Res 23 (14):2762-9. Miyoshi, H., Shimizu, K., Kozu, T., Maseki, N., Kaneko, Y., and Ohki, M. (1991). T(8-21) Breakpoints on Chromosome-21 in Acute Myeloid-Leukemia Are Clustered within a Limited Region of a Single Gene, Aml1. Proc Natl Acad Sci U S A 88 (23):10431-34. Montero-Ruiz, O., Alcantara-Ortigoza, M. A., Betancourt, M., Juarez-Velazquez, R., Gonzalez-Marquez, H., and Perez-Vera, P. (2012). Expression of RUNX1 isoforms and its target gene BLK in childhood acute lymphoblastic leukemia. Leuk Res 36 (9):1105-11. Morrow, M., Horton, S., Kioussis, D., Brady, H. J., and Williams, O. (2004). TEL-AML1 promotes development of specific hematopoietic lineages consistent with preleukemic activity. Blood 103 (10):3890-6. Mullighan, C. G. (2012). The molecular genetic makeup of acute lymphoblastic leukemia. Hematology Am Soc Hematol Educ Program 2012:389-96. Nagata, T., Gupta, V., Sorce, D., Kim, W. Y., Sali, A., Chait, B. T., Shigesada, K., Ito, Y., and Werner, M. H. (1999). Immunoglobulin motif DNA recognition and heterodimerization of the PEBP2/CBF Runt domain. Nat Struct Biol 6 (7):615-9. O'Neil, J., Grim, J., Strack, P., Rao, S., Tibbitts, D., Winter, C., Hardwick, J., Welcker, M., Meijerink, J. P., Pieters, R., Draetta, G., Sears, R., Clurman, B. E., and Look, A. T. (2007). FBW7 mutations in leukemic cells mediate NOTCH pathway activation and resistance to gamma-secretase inhibitors. J Exp Med 204 (8):1813-24. Ogawa, E., Inuzuka, M., Maruyama, M., Satake, M., Naito-Fujimoto, M., Ito, Y., and Shigesada, K. (1993). Molecular cloning and characterization of PEBP2 beta, the heterodimeric partner of a novel Drosophila runt-related DNA binding protein PEBP2 alpha. Virology 194 (1):314-31. Ogawa, E., Maruyama, M., Kagoshima, H., Inuzuka, M., Lu, J., Satake, M., Shigesada, K., and Ito, Y. (1993). PEBP2/PEA2 represents a family of transcription factors homologous to the products of the Drosophila runt gene and the human AML1 gene. Proc Natl Acad Sci U S A 90 (14):6859-63. 116  Okuda, T., Cai, Z., Yang, S., Lenny, N., Lyu, C. J., van Deursen, J. M., Harada, H., and Downing, J. R. (1998). Expression of a knocked-in AML1-ETO leukemia gene inhibits the establishment of normal definitive hematopoiesis and directly generates dysplastic hematopoietic progenitors. Blood 91 (9):3134-43. Okuda, T., van Deursen, J., Hiebert, S. W., Grosveld, G., and Downing, J. R. (1996). AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell 84 (2):321-30. Osato, M. (2004). Point mutations in the RUNX1/AML1 gene: another actor in RUNX leukemia. Oncogene 23 (24):4284-96. Otto, F., Thornell, A. P., Crompton, T., Denzel, A., Gilmour, K. C., Rosewell, I. R., Stamp, G. W. H., Beddington, R. S. P., Mundlos, S., Olsen, B. R., Selby, P. B., and Owen, M. J. (1997). Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell 89 (5):765-71. Pozner, A., Goldenberg, D., Negreanu, V., Le, S. Y., Elroy-Stein, O., Levanon, D., and Groner, Y. (2000). Transcription-coupled translation control of AML1/RUNX1 is mediated by cap- and internal ribosome entry site-dependent mechanisms. Mol Cell Biol 20 (7):2297-307. Pratap, J., Lian, J. B., and Stein, G. S. (2011). Metastatic bone disease: role of transcription factors and future targets. Bone 48 (1):30-6. Preudhomme, C., Renneville, A., Bourdon, V., Philippe, N., Roche-Lestienne, C., Boissel, N., Dhedin, N., Andre, J. M., Cornillet-Lefebvre, P., Baruchel, A., Mozziconacci, M. J., and Sobol, H. (2009). High frequency of RUNX1 biallelic alteration in acute myeloid leukemia secondary to familial platelet disorder. Blood 113 (22):5583-7. Pui, C., Relling, M. V., and Downing, J. R. (2004). Mechanisms of disease: Acute lymphoblastic leukemia. New England Journal of Medicine 350 (15):1535-48. Pui, C. H., and Evans, W. E. (2006). Drug therapy - Treatment of acute lymphoblastic leukemia. New England Journal of Medicine 354 (2):166-78. Pui, C. H., Mullighan, C. G., Evans, W. E., and Relling, M. V. (2012). Pediatric acute lymphoblastic leukemia: where are we going and how do we get there? Blood 120 (6):1165-74. Radtke, F., Wilson, A., Mancini, S. J., and MacDonald, H. R. (2004). Notch regulation of lymphocyte development and function. Nat Immunol 5 (3):247-53. Rennert, J., Coffman, J. A., Mushegian, A. R., and Robertson, A. J. (2003). The evolution of Runx genes I. A comparative study of sequences from phylogenetically diverse model organisms. BMC Evol Biol 3:4. Robison, L. L. (2011). Late effects of acute lymphoblastic leukemia therapy in patients diagnosed at 0-20 years of age. Hematology Am Soc Hematol Educ Program 2011:238-42. Romana, S. P., Mauchauffe, M., Leconiat, M., Chumakov, I., Lepaslier, D., Berger, R., and Bernard, O. A. (1995). The T(12-21) of Acute Lymphoblastic-Leukemia Results in a Tel-Aml1 Gene Fusion. Blood 85 (12):3662-70. Rowe, J. M., Buck, G., Burnett, A. K., Chopra, R., Wiernik, P. H., Richards, S. M., Lazarus, H. M., Franklin, I. M., Litzow, M. R., Ciobanu, N., Prentice, H. G., Durrant, J., Tallman, M. S., and Goldstone, A. H. (2005). Induction therapy for adults with acute lymphoblastic leukemia: results of more than 1500 patients from the international ALL trial: MRC UKALL XII/ECOG E2993. Blood 106 (12):3760-7. 117  Ryan, M. D., King, A. M. Q., and Thomas, G. P. (1991). Cleavage of Foot-and-MouthDisease Virus Polyprotein Is Mediated by Residues Located within a 19 Amino-AcidSequence. Journal of General Virology 72:2727-32. Salto-Tellez, M., Peh, B. K., Ito, K., Tan, S. H., Chong, P. Y., Han, H. C., Tada, K., Ong, W. Y., Soong, R., Voon, D. C., and Ito, Y. (2006). RUNX3 protein is overexpressed in human basal cell carcinomas. Oncogene 25 (58):7646-49. Sasaki, K., Yagi, H., Bronson, R. T., Tominaga, K., Matsunashi, T., Deguchi, K., Tani, Y., Kishimoto, T., and Komori, T. (1996). Absence of fetal liver hematopoiesis in mice deficient in transcriptional coactivator core binding factor beta. Proc Natl Acad Sci U S A 93 (22):12359-63. Schlosser, A., Pipkorn, R., Bossemeyer, D., and Lehmann, W. D. (2001). Analysis of protein phosphorylation by a combination of elastase digestion and neutral loss tandem mass spectrometry. Analytical Chemistry 73 (2):170-6. Seibel, N. L., Steinherz, P. G., Sather, H. N., Nachman, J. B., DeLaat, C., Ettinger, L. J., Freyer, D. R., Mattano, L. A., Hastings, C. A., Rubin, C. M., Bertolone, K., Franklin, J. L., Heerema, N. A., Mitchell, T. L., Pyesmany, A. F., La, M. K., Edens, C., and Gaynon, P. S. (2008). Early postinduction intensification therapy improves survival for children and adolescents with high-risk acute lymphoblastic leukemia: a report from the Children's Oncology Group (vol 111, pg 2548, 2008). Blood 111 (10):526262. Shang, Y., Zhao, X., Xu, X., Xin, H., Li, X., Zhai, Y., He, D., Jia, B., Chen, W., and Chang, Z. (2009). CHIP functions an E3 ubiquitin ligase of Runx1. Biochem Biophys Res Commun 386 (1):242-6. Smith, M. A., Seibel, N. L., Altekruse, S. F., Ries, L. A. G., Melbert, D. L., O'Leary, M., Smith, F. O., and Reaman, G. H. (2010). Outcomes for Children and Adolescents With Cancer: Challenges for the Twenty-First Century. Journal of Clinical Oncology 28 (15):2625-34. Song, W. J., Sullivan, M. G., Legare, R. D., Loh, M., Roy, D. C., Busque, L., Willman, C., Gewirtz, A. M., Speck, N. A., Bushweller, J. H., Li, F. P., Poncz, M., Maris, J. M., and Gilliland, D. G. (1999). Haploinsufficiency of CBFA2 (AML1) causes familial thrombocytopenia with propensity to develop acute myelogenous leukemia (FPD/AML). Blood 94 (10):679a-79a. Speck, N. A., and Gilliland, D. G. (2002). Core-binding factors in haematopoiesis and leukaemia. Nat Rev Cancer 2 (7):502-13. Sulong, S., Moorman, A. V., Irving, J. A., Strefford, J. C., Konn, Z. J., Case, M. C., Minto, L., Barber, K. E., Parker, H., Wright, S. L., Stewart, A. R., Bailey, S., Bown, N. P., Hall, A. G., and Harrison, C. J. (2009). A comprehensive analysis of the CDKN2A gene in childhood acute lymphoblastic leukemia reveals genomic deletion, copy number neutral loss of heterozygosity, and association with specific cytogenetic subgroups. Blood 113 (1):100-7. Sun, W., Graves, B. J., and Speck, N. A. (1995). Transactivation of the Moloney murine leukemia virus and T-cell receptor beta-chain enhancers by cbf and ets requires intact binding sites for both proteins. J Virol 69 (8):4941-9. Szymczak, A. L., and Vignali, D. A. (2005). Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert Opin Biol Ther 5 (5):627-38. 118  Szymczak, A. L., Workman, C. J., Wang, Y., Vignali, K. M., Dilioglou, S., Vanin, E. F., and Vignali, D. A. A. (2004). Correction of multi-gene deficiency in vivo using a single 'self-cleaving' 2A peptide-based retroviral vector (vol 22, pg 589, 2004). Nature Biotechnology 22 (12):1590-90. Tanaka, K., Tanaka, T., Kurokawa, M., Imai, Y., Ogawa, S., Mitani, K., Yazaki, Y., and Hirai, H. (1998). The AML1/ETO(MTG8) and AML1/Evi-1 leukemia-associated chimeric oncoproteins accumulate PEBP2beta(CBFbeta) in the nucleus more efficiently than wild-type AML1. Blood 91 (5):1688-99. Tanaka, T., Kurokawa, M., Ueki, K., Tanaka, K., Imai, Y., Mitani, K., Okazaki, K., Sagata, N., Yazaki, Y., Shibata, Y., Kadowaki, T., and Hirai, H. (1996). The extracellular signal-regulated kinase pathway phosphorylates AML1, an acute myeloid leukemia gene product, and potentially regulates its transactivation ability. Mol Cell Biol 16 (7):3967-79. Tanaka, T., Tanaka, K., Ogawa, S., Kurokawa, M., Mitani, K., Nishida, J., Shibata, Y., Yazaki, Y., and Hirai, H. (1995). An acute myeloid leukemia gene, AML1, regulates hemopoietic myeloid cell differentiation and transcriptional activation antagonistically by two alternative spliced forms. EMBO J 14 (2):341-50. Tatarek, J., Cullion, K., Ashworth, T., Gerstein, R., Aster, J. C., and Kelliher, M. A. (2011). Notch1 inhibition targets the leukemia-initiating cells in a Tal1/Lmo2 mouse model of T-ALL. Blood 118 (6):1579-90. Thierry-Mieg, D., and Thierry-Mieg, J. (2006). AceView: a comprehensive cDNA-supported gene and transcripts annotation. Genome Biol 7 Suppl 1:S12 1-14. Thompson, B. J., Buonamici, S., Sulis, M. L., Palomero, T., Vilimas, T., Basso, G., Ferrando, A., and Aifantis, I. (2007). The SCFFBW7 ubiquitin ligase complex as a tumor suppressor in T cell leukemia. J Exp Med 204 (8):1825-35. Tsunematsu, T., Kudo, Y., Iizuka, S., Ogawa, I., Fujita, T., Kurihara, H., Abiko, Y., and Takata, T. (2009). RUNX3 Has an Oncogenic Role in Head and Neck Cancer. PLoS One 4 (6). Uchida, H., Zhang, J., and Nimer, S. D. (1997). AML1A and AML1B can transactivate the human IL-3 promoter. Journal of Immunology 158 (5):2251-58. Van Vlierberghe, P., Pieters, R., Beverloo, H. B., and Meijerink, J. P. (2008). Moleculargenetic insights in paediatric T-cell acute lymphoblastic leukaemia. Br J Haematol 143 (2):153-68. van Wijnen, A. J., Stein, G. S., Gergen, J. P., Groner, Y., Hiebert, S. W., Ito, Y., Liu, P., Neil, J. C., Ohki, M., and Speck, N. (2004). Nomenclature for Runt-related (RUNX) proteins. Oncogene 23 (24):4209-10. Vangala, R. K., Heiss-Neumann, M. S., Rangatia, J. S., Singh, S. M., Schoch, C., Tenen, D. G., Hiddemann, W., and Behre, G. (2003). The myeloid master regulator transcription factor PU.1 is inactivated by AML1-ETO in t(8;21) myeloid leukemia. Blood 101 (1):270-77. Wang, L., Huang, G., Zhao, X., Hatlen, M. A., Vu, L., Liu, F., and Nimer, S. D. (2009). Posttranslational modifications of Runx1 regulate its activity in the cell. Blood Cells Mol Dis 43 (1):30-4. Wang, L. C., Swat, W., Fujiwara, Y., Davidson, L., Visvader, J., Kuo, F., Alt, F. W., Gilliland, D. G., Golub, T. R., and Orkin, S. H. (1998). The TEL/ETV6 gene is 119  required specifically for hematopoiesis in the bone marrow. Genes Dev 12 (15):2392402. Wang, Q., Stacy, T., Binder, M., Marin-Padilla, M., Sharpe, A. H., and Speck, N. A. (1996). Disruption of the Cbfa2 gene causes necrosis and hemorrhaging in the central nervous system and blocks definitive hematopoiesis. Proc Natl Acad Sci U S A 93 (8):3444-9. Wang, Q., Stacy, T., Miller, J. D., Lewis, A. F., Gu, T. L., Huang, X., Bushweller, J. H., Bories, J. C., Alt, F. W., Ryan, G., Liu, P. P., Wynshaw-Boris, A., Binder, M., MarinPadilla, M., Sharpe, A. H., and Speck, N. A. (1996). The CBFbeta subunit is essential for CBFalpha2 (AML1) function in vivo. Cell 87 (4):697-708. Warren, A. J., Bravo, J., Williams, R. L., and Rabbitts, T. H. (2000). Structural basis for the heterodimeric interaction between the acute leukaemia-associated transcription factors AML1 and CBF beta. Embo Journal 19 (12):3004-15. Weng, A. P., Ferrando, A. A., Lee, W., Morris, J. P., Silverman, L. B., Sanchez-Irizarry, C., Blacklow, S. C., Look, A. T., and Aster, J. C. (2004). Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science 306 (5694):269-71. Weng, A. P., Millholland, J. M., Yashiro-Ohtani, Y., Arcangeli, M. L., Lau, A., Wai, C., Bianco, C., Rodriguez, C. G., Sai, H., Tobias, J., Li, Y., Wolfe, M. S., Shachaf, C., Felsher, D., Blacklow, S. C., Pear, W. S., and Aster, J. C. (2006). c-Myc is an important direct target of Notch1 in T-cell acute lymphoblastic leukemia/lymphoma. Genes Dev 20 (15):2096-109. Westendorf, J. J., Yamamoto, C. M., Lenny, N., Downing, J. R., Selsted, M. E., and Hiebert, S. W. (1998). The t(8;21) fusion product, AML-1-ETO, associates with C/EBP-alpha, inhibits C/EBP-alpha-dependent transcription, and blocks granulocytic differentiation. Mol Cell Biol 18 (1):322-33. Wong, W. F., Kohu, K., Chiba, T., Sato, T., and Satake, M. (2011). Interplay of transcription factors in T-cell differentiation and function: the role of Runx. Immunology 132 (2):157-64. Woolf, E., Xiao, C., Fainaru, O., Lotem, J., Rosen, D., Negreanu, V., Bernstein, Y., Goldenberg, D., Brenner, O., Berke, G., Levanon, D., and Groner, Y. (2003). Runx3 and Runx1 are required for CD8 T cell development during thymopoiesis. Proc Natl Acad Sci U S A 100 (13):7731-6. Yamaguchi, Y., Kurokawa, M., Imai, Y., Izutsu, K., Asai, T., Ichikawa, M., Yamamoto, G., Nitta, E., Yamagata, T., Sasaki, K., Mitani, K., Ogawa, S., Chiba, S., and Hirai, H. (2004). AML1 is functionally regulated through p300-mediated acetylation on specific lysine residues. Journal of Biological Chemistry 279 (15):15630-38. Yanagida, M., Osato, M., Yamashita, N., Huang, L. Q., Jacob, B., Wu, F., Cao, X. M., Nakamura, T., Yokomizo, T., Takahashi, S., Yamamoto, M., Shigesada, K., and Ito, Y. (2005). Increased dosage of Runx1/AML1 acts as a positive modulator of myeloid leukemogenesis in BXH2 mice. Oncogene 24 (28):4477-85. Yap, D. B., Chu, J., Berg, T., Schapira, M., Cheng, S. W. G., Moradian, A., Morin, R. D., Mungall, A. J., Meissner, B., Boyle, M., Marquez, V. E., Marra, M. A., Gascoyne, R. D., Humphries, R. K., Arrowsmith, C. H., Morin, G. B., and Aparicio, S. A. J. R. (2011). Somatic mutations at EZH2 Y641 act dominantly through a mechanism of selectively altered PRC2 catalytic activity, to increase H3K27 trimethylation. Blood 117 (8):2451-59. 120  Yoshida, C. A., Furuichi, T., Fujita, T., Fukuyama, R., Kanatani, N., Kobayashi, S., Satake, M., Takada, K., and Komori, T. (2002). Core-binding factor beta interacts with Runx2 and is required for skeletal development. Nature Genetics 32 (4):633-38. Yoshida, H., and Kitabayashi, I. (2008). Chromatin regulation by AML1 complex. Int J Hematol 87 (1):19-24. Yoshida, T., Kanegane, H., Osato, M., Yanagida, M., Miyawaki, T., Ito, Y., and Shigesada, K. (2002). Functional analysis of RUNX2 mutations in Japanese patients with cleidocranial dysplasia demonstrates novel genotype-phenotype correlations. Am J Hum Genet 71 (4):724-38. Zeng, C., McNeil, S., Pockwinse, S., Nickerson, J., Shopland, L., Lawrence, J. B., Penman, S., Hiebert, S., Lian, J. B., van Wijnen, A. J., Stein, J. L., and Stein, G. S. (1998). Intranuclear targeting of AML/CBFalpha regulatory factors to nuclear matrixassociated transcriptional domains. Proc Natl Acad Sci U S A 95 (4):1585-9. Zeng, C., van Wijnen, A. J., Stein, J. L., Meyers, S., Sun, W., Shopland, L., Lawrence, J. B., Penman, S., Lian, J. B., Stein, G. S., and Hiebert, S. W. (1997). Identification of a nuclear matrix targeting signal in the leukemia and bone-related AML/CBF-alpha transcription factors. Proc Natl Acad Sci U S A 94 (13):6746-51. Zhang, D. E., Fujioka, K. I., Hetherington, C. J., Shapiro, L. H., Chen, H. M., Look, A. T., and Tenen, D. G. (1994). Identification of a Region Which Directs the Monocytic Activity of the Colony-Stimulating Factor-1 (Macrophage-Colony-Stimulating Factor) Receptor Promoter and Binds Pebp2/Cbf (Aml1). Mol Cell Biol 14 (12):808595. Zhang, J., Ding, L., Holmfeldt, L., Wu, G., Heatley, S. L., Payne-Turner, D., Easton, J., Chen, X., Wang, J., Rusch, M., Lu, C., Chen, S. C., Wei, L., Collins-Underwood, J. R., Ma, J., Roberts, K. G., Pounds, S. B., Ulyanov, A., Becksfort, J., Gupta, P., Huether, R., Kriwacki, R. W., Parker, M., McGoldrick, D. J., Zhao, D., Alford, D., Espy, S., Bobba, K. C., Song, G., Pei, D., Cheng, C., Roberts, S., Barbato, M. I., Campana, D., Coustan-Smith, E., Shurtleff, S. A., Raimondi, S. C., Kleppe, M., Cools, J., Shimano, K. A., Hermiston, M. L., Doulatov, S., Eppert, K., Laurenti, E., Notta, F., Dick, J. E., Basso, G., Hunger, S. P., Loh, M. L., Devidas, M., Wood, B., Winter, S., Dunsmore, K. P., Fulton, R. S., Fulton, L. L., Hong, X., Harris, C. C., Dooling, D. J., Ochoa, K., Johnson, K. J., Obenauer, J. C., Evans, W. E., Pui, C. H., Naeve, C. W., Ley, T. J., Mardis, E. R., Wilson, R. K., Downing, J. R., and Mullighan, C. G. (2012). The genetic basis of early T-cell precursor acute lymphoblastic leukaemia. Nature 481 (7380):157-63. Zhang, L. S., Fried, F. B., Guo, H., and Friedman, A. D. (2008). Cyclin-dependent kinase phosphorylation of RUNX1/AML1 on 3 sites increases transactivation potency and stimulates cell proliferation. Blood 111 (3):1193-200. Zhao, L. J., Wang, Y. Y., Li, G., Ma, L. Y., Xiong, S. M., Weng, X. Q., Zhang, W. N., Wu, B., Chen, Z., and Chen, S. J. (2012). Functional features of RUNX1 mutants in acute transformation of chronic myeloid leukemia and their contribution to inducing murine full-blown leukemia. Blood 119 (12):2873-82. Zhao, X., Jankovic, V., Gural, A., Huang, G., Pardanani, A., Menendez, S., Zhang, J., Dunne, R., Xiao, A., Erdjument-Bromage, H., Allis, C. D., Tempst, P., and Nimer, S. D. (2008). Methylation of RUNX1 by PRMT1 abrogates SIN3A binding and potentiates its transcriptional activity. Genes Dev 22 (5):640-53. 121  


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items