UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Exploring the genetic interactome of a Saccharomyces cerevisiae separase mutant Ho, Krystina 2013

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2013_spring_ho_krystina.pdf [ 38.17MB ]
Metadata
JSON: 24-1.0071976.json
JSON-LD: 24-1.0071976-ld.json
RDF/XML (Pretty): 24-1.0071976-rdf.xml
RDF/JSON: 24-1.0071976-rdf.json
Turtle: 24-1.0071976-turtle.txt
N-Triples: 24-1.0071976-rdf-ntriples.txt
Original Record: 24-1.0071976-source.json
Full Text
24-1.0071976-fulltext.txt
Citation
24-1.0071976.ris

Full Text

EXPLORING THE GENETIC INTERACTOME OF A SACCHAROMYCES CEREVISIAE SEPARASE MUTANT by Krystina Ho  B.MSc., The University of Western Ontario, 2007  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Biochemistry and Molecular Biology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  April 2013  © Krystina Ho, 2013  Abstract The budding yeast Saccharomyces cerevisiae is used as a model organism for understanding cellular dynamics such as cell cycle regulation. Separase endopeptidases are essential to these events, being responsible for cleavage of cohesin – the molecular glue holding sister chromatids together. To examine the function of separases in a systematic fashion, a temperature sensitive mutant of the yeast homologue, Esp1, was subjected to a high-throughput technique known as synthetic genetic array to identify genetic interactions. Examination of the list of alleles confirmed to cause a synthetic lethal or synthetic dosage lethal phenotype in the query esp1-1 mutant (“hits”) established the legitimacy of these screens, as many related to known Esp1 functions. Surprisingly, categorization of these hits by biological process revealed an enrichment for genes involved in RNA metabolic processes. Concurrent affinity immunoprecipitation of separase followed by mass spectrometry further showed a physical interaction between Esp1 and the integrase portion of Ty1 retrotransposons. Evidence that this interaction was indicative of a role for separase in retrotransposition was attained when the esp1-1 mutant was found to have transposition defects. Similar defects were also present in mutants of both the cohesin loader, SCC2, and the structural maintenance of chromosome, SMC3, genes. Interestingly, cohesin loads at loci transcribed by RNA polymerase III, while hotspots of Ty1 integration are upstream of the same sites. I propose that separase acts as a bridge to aid in targeting the Ty1 pre-integration complex to these hotspots. The aforementioned categorization of esp1-1 genetic interactors also indicated that separase may somehow be involved in mRNA biogenesis. As esp1-1 mutants have intact translational machinery, my data suggests that separase functions either  ii  directly in transcription or, more likely, post-transcriptionally. In all, screening for esp1-1 genetic interactions has revealed several new avenues for separase studies.  iii  Preface The work presented in this dissertation comprises my graduate work from September 2007 to present. I performed all the work presented under the supervision of Dr. Vivien Measday at the Wine Research Centre at the University of British Columbia, with the following noted exceptions. To do the SGA screening and analyses described in Chapter 2, I worked primarily in the Loewen laboratory at the University of British Columbia through November and December 2008 with the help of a research associate, Dr. Barry Young. Under my supervision, an undergraduate student, Cynthia Xe, aided with the confirmation of esp1-1 SDL genetic interactions presented in Figure 2-4. A graduate student in Dr. Charlie Boone’s laboratory at the University of Toronto, Anastasia Baryshnikova, compared the unconfirmed esp1-1 SL interactions to the Boone SGA database with the help of Dr. Michael Costanzo (Figure 2-6) and also looked at protein-protein interactions amongst the confirmed SL and SDL esp1-1 genetic interactors (Figure 4-4). Nancy Fang in the Mayor laboratory at the University of British Columbia performed the affinity immunoprecipitation mass spectrometry data found in Figure 3-3, and Dr. Thibault Mayor the analysis in Table 3-1. Dr. Lina Ma in the Measday laboratory undertook the Ty1 plasmid induction analysis (Figure 37). Finally, the Coller lab at Case Western University analyzed esp1-1 polysome formation (Figure 4-9). A subset of the work presented in Chapter 2 and 3 is currently in the process of being written up for submission.  iv  Table of contents Abstract.................................................................................................................................... ii! Preface ..................................................................................................................................... iv! Table of contents ..................................................................................................................... v! List of tables............................................................................................................................ xi! List of figures ......................................................................................................................... xii! List of symbols and abbreviations ...................................................................................... xiv! Nomenclature ..................................................................................................................... xviii! Acknowledgements .............................................................................................................. xix! Dedication ............................................................................................................................. xxi! Chapter 1: Perspectives on separase – a general introduction .......................................... 1! 1.1! An overview of the eukaryotic cell cycle as it pertains to budding yeast .................... 1! 1.2! Regulating the cell cycle: a matter of checkpoints ...................................................... 2! 1.3! Cohesins: the molecular glue holding sister chromatids together ............................... 3! 1.3.1! The core cohesin complex and its architecture ..................................................... 3! 1.3.2! The cohesin cycle .................................................................................................. 5! 1.4! Bipolar attachment: one sister chromatid to each spindle pole body........................... 5! 1.4.1! Microtubule-kinetochore interactions ................................................................... 5! 1.4.2! Sensing tension: the spindle assembly checkpoint ............................................... 7! 1.5! Cutting the ties that bind: the budding yeast separase, Esp1 ....................................... 8! 1.5.1! Securing Esp1 activity by Pds1............................................................................. 8! 1.5.2! The kleisin subunit Scc1 as a target for separase .................................................. 9! 1.5.3! Other known targets for Esp1 ............................................................................. 11!  v  1.5.4! Using FEAR to exit mitosis ................................................................................ 12! 1.5.5! Separase activity ensures an efficient anaphase.................................................. 14! 1.6! Evolutionarily conserved separase – beyond budding yeast...................................... 15! 1.6.1! Separases are present from yeast to humans ....................................................... 15! 1.6.2! Sister chromatid separation in vertebrates .......................................................... 17! 1.6.3! The importance of human separase: clinical implications .................................. 17! 1.7! Analyzing ESP1 function using a systematic, high-throughput screening method ... 18! Chapter 2: Examining the scope of genetic interactions for the esp1-1 temperature sensitive allele of separase .................................................................................................... 30! 2.1! Introduction ................................................................................................................ 30! 2.2! Results ........................................................................................................................ 33! 2.2.1! Creation of the esp1-1 allele for SGA analysis ................................................... 33! 2.2.2! Examination of the SGA esp1-1 allele................................................................ 33! 2.2.3! SGA screening of esp1-1 negative genetic interactions ..................................... 35! 2.2.4! Analysis of confirmed negative esp1-1 genetic interactions .............................. 36! 2.2.5! Comparison of esp1-1 SL profile with other SGA analyses ............................... 37! 2.2.6! Screening of SDL hits for an Esp1 substrate ...................................................... 39! 2.2.7! Screening for suppressors of the esp1-1 temperature sensitivity ........................ 40! 2.3! Discussion .................................................................................................................. 42! 2.3.1! A dense negative genetic interaction network for a mutant of ESP1 ................. 42! 2.3.2! Genetic interactions of esp1-1 relate to essential Esp1 functions ....................... 44! 2.3.3! Negative genetic interactions of esp1-1 emphasize a role for Esp1 in maintaining spindle stability ............................................................................................................... 46!  vi  2.3.4! The genetic interaction network of esp1-1 suggests potential new roles for separase ........................................................................................................................... 46! 2.4! Materials and methods ............................................................................................... 47! 2.4.1! Yeast strains and growth ..................................................................................... 47! 2.4.2! Testing temperature sensitivity of the esp1-1 allele ........................................... 48! 2.4.3! Assaying for Esp1 substrates .............................................................................. 49! 2.4.4! Western blotting .................................................................................................. 49! 2.4.5! SGA screening .................................................................................................... 50! 2.4.6! Confirmation of genetic interactions .................................................................. 51! 2.4.7! Comparison of esp1-1 SL profile with Boone lab SL database .......................... 52! Chapter 3: The budding yeast separase, Esp1, regulates Ty1 retrotransposition ......... 77! 3.1! Introduction ................................................................................................................ 77! 3.2! Results ........................................................................................................................ 80! 3.2.1! esp1-1 genetic interactors are involved in the life cycle of Ty1 retrotransposons .............................................................................................................. 80! 3.2.2! Mass spectrometry reveals a physical interaction between Esp1 and Ty1 proteins............................................................................................................................ 82! 3.2.3! esp1-1 has defects in Ty1 transposition .............................................................. 83! 3.2.4! esp1-1 does not fail to induce the pGAL1Ty1-H3mHIS3AI plasmid .................. 85! 3.2.5! Endogenous levels of TY1 mRNA are not decreased in esp1-1.......................... 86! 3.2.6! Gag processing is intact in esp1-1 ...................................................................... 87! 3.2.7! Several cohesin mutants also show defects in Ty1 transposition ....................... 87! 3.3! Discussion .................................................................................................................. 88!  vii  3.3.1! Screening for genetic and physical interactions point to a potential role for Esp1 in Ty1 retrotransposition ................................................................................................. 89! 3.3.2! Assaying for Ty1 transposition in conditional alleles......................................... 89! 3.3.3! Esp1 has a role in promoting the integration of Ty1 cDNA during retrotransposition ............................................................................................................ 90! 3.3.4! Esp1 may be responsible for targeting the PIC to hotspots of Ty1 integration .. 92! 3.3.4.1!A model for PIC recruitment to hotspots of transposition .............................. 92! 3.3.4.2!Evidence for an Esp1/cohesin mediated recruitment of PIC to hotpots of integration ................................................................................................................... 93! 3.3.4.3!Removal or translocation of cohesin may be necessary for successful integration ................................................................................................................... 94! 3.4! Materials and methods ............................................................................................... 96! 3.4.1! Yeast strains and growth conditions ................................................................... 96! 3.4.2! Affinity mass spectrometry ................................................................................. 97! 3.4.2.1!Affinity IP and mass spectrometry ................................................................. 97! 3.4.2.2!Analysis of mass spectrometry data ................................................................ 99! 3.4.3! Co-immunoprecipitation ..................................................................................... 99! 3.4.4! Western blotting ................................................................................................ 100! 3.4.5! Ty transposition assay ....................................................................................... 100! 3.4.6! Quantitative PCR analysis ................................................................................ 101! 3.4.6.1!RNA preparation ........................................................................................... 101! 3.4.6.2!Conversion to cDNA..................................................................................... 101! 3.4.6.3!Real-time PCR .............................................................................................. 102!  viii  Chapter 4: Examination of a role for the budding yeast separase, Esp1, in mRNA biogenesis ............................................................................................................................. 119! 4.1! Introduction .............................................................................................................. 119! 4.2! Results ...................................................................................................................... 122! 4.2.1! Protein-protein interactions amongst the confirmed esp1-1 SL and SDL hits are enriched for mRNA regulatory complexes ................................................................... 122! 4.2.2! Separase-mediated gene expression .................................................................. 125! 4.2.2.1!Analysis of an inducible heat shock gene, HSP30 ........................................ 125! 4.2.2.2!Analysis of the silenced mating cassette through HMRA2 ........................... 127! 4.2.3! Esp1 and decapping factors .............................................................................. 128! 4.2.4! Translational machinery is intact in an esp1-1 mutant ..................................... 129! 4.3! Discussion ................................................................................................................ 130! 4.3.1! A role for Esp1 prior to translation ................................................................... 130! 4.3.2! Sister chromatid cohesion and gene regulation: transcriptional implications for Esp1? ....................................................................................................................... 131! 4.3.3! Esp1 and the 7-methylguanosine cap ................................................................ 133! 4.3.4! Esp1 and nuclear export .................................................................................... 134! 4.3.5! A new landscape for Esp1 study ....................................................................... 134! 4.4! Materials and methods ............................................................................................. 135! 4.4.1! Yeast strains and growth ................................................................................... 135! 4.4.2! Spot assays ........................................................................................................ 136! 4.4.3! qPCR analysis ................................................................................................... 137! 4.4.4! Flow cytometry ................................................................................................. 137!  ix  4.4.5! Co-immunoprecipitation ................................................................................... 138! 4.4.6! Western blotting ................................................................................................ 138! 4.4.7! Polysome assay ................................................................................................. 139! Chapter 5: Conclusions and future directions ................................................................ 151! 5.1! Summary and perspectives ...................................................................................... 151! 5.2! Future Studies .......................................................................................................... 154! 5.2.1! Saturation of separase genetic interactions ....................................................... 154! 5.2.2! Further defining the role of separase in Ty1-mediated integration................... 155! 5.2.2.1!Testing the model.......................................................................................... 155! 5.2.2.2!Cohesin, Esp1 and the PIC............................................................................ 156! 5.2.3! Esp1 and mRNA biogenesis ............................................................................. 158! 5.3! Final thoughts .......................................................................................................... 160! Bibliography ........................................................................................................................ 161! !  x  List of tables Table 2-1. Classification of SL hits for esp1-1 ...................................................................... 53! Table 2-2. Classification of SDL hits for esp1-1 ................................................................... 54! Table 2-3. Fold enrichment of GO biological processes identified by analysis of esp1-1 SL and SDL interactions............................................................................................................... 56! Table 2-4. Comparison of esp1-1’s SL profile to the Boone database .................................. 58! Table 2-5. SR hits for esp1-1 ................................................................................................. 62! Table 2-6. Strains used in this chapter ................................................................................... 64! Table 3-1. Affinity mass spectrometry peptides identified for Esp1 ................................... 103! Table 3-2. Strains used in this chapter ................................................................................. 108! Table 4-1. Strains used in this chapter ................................................................................. 140!  xi  List of figures Figure 1-1. The eukaryotic cell cycle .................................................................................... 19! Figure 1-2. Cohesin establishment and maintenance ............................................................. 21! Figure 1-3. A bioriented mitotic spindle in budding yeast .................................................... 22! Figure 1-4. Kinetochore-MT interactions .............................................................................. 24! Figure 1-5. The spindle assembly checkpoint........................................................................ 25! Figure 1-6. Scc1 cleavage by Esp1 ........................................................................................ 26! Figure 1-7. FEAR and MEN pathways .................................................................................. 27! Figure 1-8. Separase in mammalian cells .............................................................................. 28! Figure 1-9. Separase as a oncogene ....................................................................................... 29! Figure 2-1. Genetic interactions reveal functional relationships ........................................... 66! Figure 2-2. Analysis of the SGA esp1-1 allele ...................................................................... 68! Figure 2-3. Confirmation of SL hits ...................................................................................... 69! Figure 2-4. Confirmation of esp1-1 SDL hits ......................................................................... 71! Figure 2-5. GO analysis of confirmed esp1-1 SL and SDL genetic interactions .................. 72! Figure 2-6. Comparison of esp1-1’s SL profile ..................................................................... 73! Figure 2-7. lrs4∆ is SL with esp1-1 ...................................................................................... 74! Figure 2-8. Assaying for an esp1-1 substrate......................................................................... 75! Figure 2-9. Rescue of esp1-1 lethality by a overeexpression of a truncated Ty4 element .... 76! Figure 3-1. Structure of the Ty family of elements ............................................................. 109! Figure 3-2. Genes identified in esp1-1 SL and SDL screens have roles in the life cycle of Ty1 retrotranposons .............................................................................................................. 110! Figure 3-3. Mass Spectrometry reveals a physical interaction between Esp1 and Ty1-IN . 112!  xii  Figure 3-4. The defect in Ty1 transposition in an esp1-1 mutant is rescued by scc1-73..... 114! Figure 3-5. Expression of IN from the pGAL1Ty1-H3mHISA1 plasmid ............................. 115! Figure 3-6. esp1-1 strains are capable of Ty1 element expression and TyA-TyB polypeptide processing ............................................................................................................................. 116! Figure 3-7. scc2-4 and smc3-1 strains have defects in transposition defects....................... 117! Figure 3-8. Model for Esp1-mediated insertion ................................................................... 118! Figure 4-1. Overview of eukaryotic transcription................................................................ 141! Figure 4-2. Schematic representation of cap-dependent processes ..................................... 142! Figure 4-3. mRNA decapping .............................................................................................. 143! Figure 4-4. esp1-1 protein-protein interaction network ....................................................... 144! Figure 4-5. esp1-1 is sensitive to changes in mRNA regulation.......................................... 145! Figure 4-6. HSP30 mRNA levels are upregulated in the esp1-1 mutant in response to heat shock ..................................................................................................................................... 146! Figure 4-7. HMRA2 transcript levels are upregulated in esp1-1 .......................................... 147! Figure 4-8. Pat1 and Dhh1 do not physically interact with separase ................................... 149! Figure 4-9. Polyribosome analysis of the esp1-1 mutant ..................................................... 150!  xiii  List of symbols and abbreviations ∆  Deletion, null mutant  6AU  6 azauracil  AI  Artificial intron  APC  Anaphase promoting complex  ATP  Adenosine triphosphate  Bp  Base pair  C-  Carboxy  Cdc  Cell division cycle  Cdk  Cyclin dependent kinase  cDNA  Complementary DNA  CHX  Cycloheximide  C-Mad2  Closed isoform of Mad2  CTD  C-terminal domain  DaMP  Decreased abundance by mRNA perturbation  DMSO  Dimethylsulfoxide  DNA  Deoxyribonucleic acid  DTT  Dithiothreitol  Esp1  Extra spindle poles 1  EDTA  Ethylenediaminetetraacetic acid  Eif  Eukaryotic initiation factor  FACS  Fluorescence activated cell sorting  FEAR  Cdc14 early anaphase release  xiv  GO  Gene ontology  GST  Glutathione s-transferase  GTase  Guanosine triphosphate:mRNA guanylyltransferase  HA  Hemagglutinin  His  Histidine  HU  Hydroxyurea  hSecurin  Human Securin  hSeparase  Human separase  IB  Immunoblot  IN  Integrase  IP  Immunoprecipitation  Log  Logarithmic  Lrs4  Loss of rDNA silencing  Mcd1  Mitotic chromosome determinant 1  MEN  Mitotic exit network  mRNA  Messenger RNA  MT  Microtubule  N-  Amino  NP-40  Nonidet P-40  Nz  Nocodazole  O.D.  Optical density  ORF  Open reading frame  O-Mad2  Open isoform of Mad2  xv  Paf1C  Paf1 complex  PCR  Polymerase chain reaction  PIC  Pre-integration complex  PP2A  Protein phosphatase 2A  PR  Protease  qPCR  Quantitative PCR  rDNA  Ribosomal DNA  RNA  Ribonucleic acid  RNAPII  RNA polymerase II  RNAPIII  RNA polymerase III  RT  Reverse transcriptase  RTPase  RNA 5’-triphosphatase  S. cerevisiae Saccharomyces cerevisiae SC  Synthetic complete  Scc1  Sister chromatid cohesion 1  SDL  Synthetic dosage lethal  SDR  Synthetic dosage rescue  SDS  Synthetic dosage sick  SDS PAGE  Sodium dodecyl sulfate polyacrylamide gel electrophoresis  SGA  Synthetic genetic array  SL  Synthetic lethal  SPT  Suppressor of Ty  Smc  Structural maintenance of chromosomes  xvi  SPB  Spindle pole body  SR  Synthetic rescue  SS  Synthetic sick  rDNA  Ribosomal DNA  RENT  Regulator of nucleolar silencing and telophase  RH  Ribonuclease H  RT  Reverse transcriptase  tRNA  Transfer RNA  Ts  Temperature sensitive  URA  Uracil  WCL  Whole cell lysate  WT  Wild type  VLP  Virus like particle  YPD  Yeast peptone dextrose  xvii  Nomenclature Wild type alleles of S. cerevisiae are represented by capitalized and italicized letters (e.g. ESP1). Mutant alleles are denoted by lower cased italics, indicating a deletion (e.g. lte1∆), point mutation (e.g. C1513A, esp1C1531A) or conditional allele (e.g. esp1-1). Genes are expressed from their endogenous promoter unless another is indicated (e.g. GAL1, GAL1/10). Gene products have their first letter capitalized. Plasmids/vectors are indicated by a p and are italicized.  xviii  Acknowledgements They say it takes a village, and graduate training is no exception. Without the support system I had around me, I can say with certainty that I wouldn’t have made it through. First and foremost, I’d like to thank my family, especially since they’ve had to put up with being across the country for six years. So, thank you a million times mom and dad who have always been there for me and have never been more than a phone call away. Mikey and Kalia (and Dyson too!), thank you for giving me a place to crash without question every time I’m in the city. Ama and Yeye, you taught me it could be done; Granny and Pepere, j’suis toujours ta p’tite poupoune. To all my friends back in Ontario, I miss all your faces and love seeing you whenever I’m back east. To all my friends here in Vancouver, thank you for giving me a reason to get out of the lab on occasion. To everyone in the Measday lab, past and present, thank you being there for me through it all! Nina, I don’t think I could’ve gotten anything done without your help. Jenny, you always have my back, so thank you for always listening. Lina, thank you for your help throughout the years, especially lately with all the work on my project. Mike and Jay, my two wine aficionados, you guys always make the lab fun, and thank you for giving me an education in yeast that was outside the cell cycle. Flo and Cynthia, thank you for all your hard work on my project. Everyone else at the WRC, in the Van Vuuren and Lund labs, you guys make it a great place to work. Maria, you are one of the most impressive women I have ever met. Thank you for always coming in with a smile and making sure I’m fed and get home safely!  xix  To my committee, Dr. Chistopher Loewen, Dr Thibault Mayor and Dr. Ivan Sadowski, your advice over the years has been very much appreciated. Vivien, thank you for this opportunity and all your guidance over the years. Finally, thank you to all my funding sources over the years, specifically the University Graduate Fellowships, CIHR Banting and Best Doctoral Fellowship Award, and the Four Year Fellowship. I wouldn’t have had the same opportunities throughout graduate school without them.  xx  Dedication “Wisdom is not a product of schooling but the life attempt to acquire it” ~Albert Einstein  xxi  Chapter 1: Perspectives on separase – a general introduction 1.1  An overview of the eukaryotic cell cycle as it pertains to budding yeast The eukaryotic cell cycle is typically defined in terms of chromosomal events,  beginning with the replication of each chromosome during S phase. This whole genome duplication is followed by M phase, which can be subdivided into two distinct categories: nuclear division (mitosis) and cell division (cytokinesis). Throughout mitosis, duplicated chromosomes – referred to hereafter as sister chromatids – are paired until each is attached to an opposite microtubule organizing centre. Once this bipolar attachment is achieved (“metaphase”), sister chromatids are permitted to separate and are pulled to opposite sides of the cell (“anaphase”). There are also two designated “Gap” phases which allow for cell growth; G1 occurs before replication while G2 precedes progression into M phase (Morgan, 2007). Cell cycle dynamics are well established to be a product of a central biochemical oscillator governed by cyclin-cyclin dependent kinase (Cdk) complexes. Indeed, greater than ten percent of yeast genes are cell cycle regulated, being transcribed at specific intervals during the process (Cho et al., 1998; Pramila et al., 2006; Spellman et al., 1998). Cdks themselves are constitutively present throughout the cell cycle; rather, their oscillatory activity depends on binding various cyclins that are expressed at different stages. G1 cyclinCdk complexes commit the cell to a new cell cycle (“Start”) during late G1 and activate S phase cyclin-Cdk complexes to initiate deoxyribonucleic acid (DNA) replication. M phase cyclin-Cdk activity then results in the progression through mitosis, and subsequent cyclin destruction initiates mitotic exit (Morgan, 2007) (Figure 1-1A).  1  Our lab uses the budding yeast Saccharomyces cerevisiae (S. cerevisiae), as a model organism, taking advantage of the intrinsically simplistic nature of its cellular processes. The capacity of S. cerevisiae to propagate as a haploid at a rapid doubling rate (~two hours) allows for ease of genetic manipulation within the yeast genome. Moreover, the high degree of correlation of cell cycle regulatory mechanisms to higher eukaryotes makes S. cerevisiae an ideal model for studying cell cycle control. S. cerevisiae, as its colloquial name suggests, divides by budding. The daughter (“bud”) first makes its appearance at Start and continues to grow throughout mitosis. After receiving a full set of chromosomes, cytokinesis occurs at the bud neck, separating the mother cell from its daughter (Forsburg and Nurse, 1991; Morgan, 2007). These cell cycle dynamics are modulated by one central Cdk (Cdk1/Cdc28) in conjunction with both Clns (G1 cyclins) and Clbs (S and M cyclins) (Morgan, 2007) (Figure 1-1B).  1.2  Regulating the cell cycle: a matter of checkpoints The ultimate goal of mitotic cell division is for a cell to faithfully propagate its  genetic material. Although a simple notion in principle, the actual execution necessitates a complex series of events. As a result, quality control mechanisms known as checkpoints continually monitor a cell’s progression through the cell cycle and serve to effect an appropriate response should an error occur. Without checkpoints, mistakes may result in the inheritance of abnormal genomic content. From a clinical perspective, this can lead to a variety of ailments, with genetic disorders (e.g. Down’s Syndrome) and cancer being predominant examples.  2  Generally speaking, cell cycle checkpoints are coordinated through complex molecular signaling cascades. For example, the DNA replication checkpoint responds to the stalling of replication forks during DNA replication or to the depletion of nucleotide pools by the ribonucleotide reductase inhibitor hydroxyurea (HU). This signaling cascade, which results in the phosphorylation of the kinase Rad53 by Mec1, prevents premature entry into mitosis while simultaneously restraining spindle elongation by inhibiting the microtubuleassociated proteins Cin8 and Stu2 (Bachant et al., 2005; Krishnan et al., 2004; Ma et al., 2007). A similar S-phase checkpoint can occur as a response to genotoxic stress; this socalled DNA damage checkpoint is also capable of inducing arrest in both the G1 and G2 phases. Coordinated by either the aforementioned Mec1 or another similar kinase Tel1, the downstream effectors (Rad53 or Chk1) stall progression through the cell cycle and concurrently activate relevant DNA damage response proteins [reviewed in (Melo and Toczyski, 2002; Putnam et al., 2009)]. How these pathways inhibit mitotic entry will be the subject of further discussion of this chapter as the internal regulatory dynamics of sister chromatid segregation are explained.  1.3 1.3.1  Cohesins: the molecular glue holding sister chromatids together The core cohesin complex and its architecture To tether sister chromatids together, a proteinaceous structure known as cohesin  embraces the two strands of DNA. The core cohesin complex consists of four members: two structural maintenance of chromosome (Smc1 and Smc3) subunits and two non Smc subunits (Scc1/Mcd1 and Scc3) [(Guacci et al., 1997; Michaelis et al., 1997), reviewed in (Nasmyth and Haering, 2009)]. The Smc proteins are folded to form a rod shaped structure: an  3  intramolecular coiled-coil separates a globular “hinge” domain from an adenosine triphosphate (ATP) binding head. Together, the Smc subunits form a V-shaped heterodimer, with the hinge domain at one end and the ABC-like ATPases at the other (Haering et al., 2002). The kleisin subunit Scc1/Mcd1 completes the canonical tripartite ring structure by acting as a bridge between the ATPase heads, forming a primary contact with Smc1 through its carboxy (C-) terminus while its amino (N-) terminus binds the Smc3 subunit (Gruber et al., 2003; Haering et al., 2004) (Figure 1-2A). This bridge-like subunit was first identified as a mitotic chromosome determinant (Mcd1) in the Koshland laboratory, but for the purposes of this dissertation will be referred to by its other common name, sister chromatid cohesion 1 or Scc1 (Guacci et al., 1997). Based on the architecture, the ring is thought to encircle both sister chromatids, however there remains the possibility that a dimer ring formation occurs instead (the “handcuff model”) (Huang et al., 2005; Nasmyth and Haering, 2009). Binding of Scc1 to the Smc heterodimer also recruits other critical members for sister chromatid cohesion, including the other kleisin subunit Scc3 and a HEAT containing protein known as Pds5 (Gruber et al., 2003; Hartman et al., 2000; Mc Intyre et al., 2007; Panizza et al., 2000; Toth et al., 1999b). Another protein, Wapl (Wpl1/Rad61 in yeast), complexes with Pds5 to inhibit cohesin loading (Sutani et al., 2009). Other pertinent members of cohesin include those that are necessary for establishment of cohesin but not its maintenance, such as the Scc2/4 loading complex and the acetyl-transferase Eco1 (Ciosk et al., 2000; Toth et al., 1999b) (Figure 1-2A). Cohesin is not only essential for sister chromatid tethering, but is also versatile, with roles in regulating gene expression, DNA recombination and repair and centromeric structure [reviewed in (Hagstrom and Meyer, 2003)]. Cohesin’s role in transcription will be touched on further in Chapter 4 of this dissertation.  4  1.3.2  The cohesin cycle Cohesin loading at centromeric DNA and discrete loci along chromosome arms  during late G1/early S phase requires the Scc2/4 loading complex (Laloraya et al., 2000; Lengronne et al., 2004; Megee et al., 1999; Tanaka et al., 1999). Though the exact mechanism is still unknown, loading is dependent on two criteria: (1) ATP hydrolysis by Smc1 and Smc3, and (2) opening of the hinge domain (Arumugam et al., 2003; Gruber et al., 2006). Cohesin loading is initially counteracted by Wap1-Pds5 activity, allowing cohesin to release sister chromatids. Thus, cohesin establishment is a dynamic process, with loading occurring through the hinge “entrance” gate and releasing through a kleisin-ATPase “exit” gate (Chan et al., 2012). Eco1-mediated acetylation of the Smc3 subunit neutralizes Wap1Pds5 activity and is thought to lock cohesin shut (Unal et al., 2008). This post-translation modification persists until anaphase, when countered by the Hos1 deacetylase (Beckouet et al., 2010; Borges et al., 2010; Xiong et al., 2010) (Figure 1-2B). Stable cohesin eventually translocates/slides away from sites of loading to the 3’ end of genes, coming to rest at intergenic regions throughout the genome, and remains present on the genome until the G2/M transition (Glynn et al., 2004; Lengronne et al., 2004).  1.4 1.4.1  Bipolar attachment: one sister chromatid to each spindle pole body Microtubule-kinetochore interactions When a new round of cell division is triggered, not only are chromosomes duplicated,  but the microtubule organizing centre (spindle pole body, SPB, in yeast) is as well. Each SPB then migrates to opposite sides of the nuclear membrane, forming a dynamic array of microtubules (MTs) that is referred to as the mitotic spindle. Long pole-pole MTs  5  interdigitate to structure the mitotic spindle while shorter MTs contact sister chromatids through the highly structured kinetochore complex that assembles on centromeric DNA [reviewed in: (Jaspersen and Winey, 2004; Westermann et al., 2007; Winey and O'Toole, 2001)] (Figure 1-3). Kinetochore-MT interactions are primarily mediated by both the Dam1/DASH complex - a ten-membered protein structure encircling MTs - and the Ndc80 complex (Lampert et al., 2010; Tien et al., 2010). The latter is an evolutionarily conserved four-membered complex, whose rod shaped structure comes from the Ndc80-Nuf2 and Spc24-Spc25 dimers forming two separate heads that connect through a coiled-coiled shaft (Cheeseman et al., 2006; Ciferri et al., 2005; Wei et al., 2005). The Spc24-25 head interacts with the inner kinetochore, protruding the rod structure out and enabling the Ndc80-Nuf2 dimer to bind MTs through the Dam1/DASH complex (Cheeseman et al., 2006; DeLuca et al., 2006; Lampert et al., 2010; Tien et al., 2010) (Figure 1-4A). The kinetochores first contact the lateral surface of dynamically growing and shrinking MTs (“search and capture”), and subsequently start sliding towards the SPB from which the MT emanates, in a manner dependent on the Kar3 kinesin motor protein (Tanaka et al., 2005). This lateral sliding is subject to frequent pausing, and is often converted to endon pulling - whereby the kinetochore is attached to the MT plus end as it shrinks - in a process that requires the Dam1/DASH complex (Kitamura et al., 2007; Tanaka et al., 2007). Simply contacting each chromosome sister chromatid, however, does not ensure that sister chromatids are bioriented. Bipolar – or amphitelic – attachments are indeed the goal; however, both sister chromatids can also contact the same SPB (syntelic attachment) or one sister chromatid can even fail to attach (monotelic attachment). In higher eukaryotes, where more than one MT contacts each kinetochore, sister chromatids are also able to attach to both  6  poles (merotelic attachment) [reviewed in (Pinsky and Biggins, 2005; Tanaka, 2008)] (Figure 1-4B). To rectify this situation, the Ipl1 Aurora kinase localizes to kinetochores and promotes the turnover of kinetochore-MT interactions by phosphorylating key players in kinetochore-MT interactions (i.e. the Dam1/DASH and Ndc80 complexes) until there is proper tension across the spindle (Akiyoshi et al., 2009; Cheeseman et al., 2002; Cheeseman et al., 2006; DeLuca et al., 2006) (Figure 1-4C).  1.4.2  Sensing tension: the spindle assembly checkpoint As turnover frees sister chromatids from inappropriate kinetochore-MT attachments,  the lack of tension generated by these unattached kinetochores will stall cycle progression until all sister chromatids are bioriented. The binding of hyperphosphorylated Mad1 to MTfree kinetochores propagates this signal. Mad1 acts as the receptor, recruiting the closed form of Mad2 (C-Mad2) to kinetochores. The open isoform of Mad2 (O-Mad2) subsequently binds to this docked Mad1/Mad2 dimer, undergoes a conformational change and is released back into the cytosol as C-Mad2 (De Antoni et al., 2005; Mariani et al., 2012; Nezi et al., 2006). This cytosolic C-Mad2 is proposed to form a mitotic checkpoint complex, in cooperation with Mad3 and Bub3, in order to inactivate Cdc20, an anaphase promoting complex (APC) coactivator (Fraschini et al., 2001; Lau and Murray, 2012). The mitotic checkpoint complex-Cdc20 interaction is further thought to act as a cytosolic amplification signal, recruiting and converting more Mad2 in order to fully inhibit Cdc20 (De Antoni et al., 2005) (Figure 1-5). APCCdc20 activity is also targeted by the DNA replication checkpoint and the DNA damage response, as its downregulation is critical to preventing precocious sister chromatid separation and inappropriate mitotic entry (Clarke et al., 2003).  7  1.5  Cutting the ties that bind: the budding yeast separase, Esp1 In the late 1980s, Breck Byers’ laboratory discovered, through ethyl  methanosulfonate mutagenesis, a temperature sensitive (ts) mutant that confers a multipolar phenotype, ultimately designating the wild type (WT) allele with the moniker extra spindle poles 1, or ESP1 (Baum et al., 1988). Subsequent analysis of the esp1-1 mutation found that this allele is essential to successful nuclear division, culminating in the identification of Esp1 as the enzyme responsible for separating sister chromatids at the G2/M transition (McGrew et al., 1992; Uhlmann et al., 1999; Uhlmann et al., 2000). A large protein at a molecular weight of 180kDa, Esp1 belongs to the evolutionarily conserved separin family of endopeptidases, whose members possess a C-terminal “separase” domain that has been predicted to adopt the fold of CD clan cysteine proteases (Aravind and Koonin, 2002; Ciosk et al., 1998; Uhlmann et al., 2000).  1.5.1  Securing Esp1 activity by Pds1 Temporal regulation of Esp1 involves the activity of Pds1, a 42kDa protein of the  securin family that is capable of restricting Esp1’s proteolytic activity until the cell is ready to enter anaphase (Ciosk et al., 1998; Yamamoto et al., 1996a, b) (Figure 1-6). Throughout the cell cycle, Esp1 levels are relatively stable, with a three-fold decrease in expression in G1 being the noted exception (Jensen et al., 2001). In contrast, Pds1 expression is highly cell cycle regulated, with transcript levels peaking as a new round of DNA synthesis begins and protein levels reaching their maximal levels shortly thereafter during mitosis (Cohen-Fix and Koshland, 1999; Spellman et al., 1998). An Esp1/Pds1 complex is established early on in the cell cycle, forming as soon as securin appears (Jensen et al., 2001). Pds1 acts as a direct  8  inhibitor of separase proteolytic activity by contacting both the N- and C- termini of Esp1, disrupting interactions between the two ends that are critical for enzymatic function (Hornig et al., 2002). In addition to inhibiting the catalytic activity of Esp1, phosphorylated securin also enables efficient nuclear targeting of Esp1 (Agarwal and Cohen-Fix, 2002; Jensen et al., 2001). Once proper bipolar assembly has been achieved, the APC - an E3 ubiquitin ligase – in conjunction with Cdc20, targets Pds1 for ubiquitin-mediated degradation (Cohen-Fix et al., 1996; Visintin et al., 1997). Analysis of Pds1’s open reading frame (ORF) revealed a nine amino acid sequence (RLPLAAKDN) that bears similarity to cyclin destruction boxes and is necessary for the degradation of securin (Cohen-Fix et al., 1996; Yamamoto et al., 1996a). Specificity of Pds1-ubiquitination is provided through the recognition of this motif by Cdc20 (Hilioti et al., 2001).  1.5.2  The kleisin subunit Scc1 as a target for separase At the turn of the century, separase was shown to promote the disassociation of the  cohesin complex from chromosomes by targeting Scc1 for cleavage. Amino-terminal sequence analysis revealed that Esp1-mediated Scc1 cleavage occurs between a pair of arginine residues at positions 268 and 269. Interestingly, abrogation of this site continues to support Scc1 cleavage, albeit with a cleavage product that is now approximately 10 kDa larger. Cleavage at this new site is immediately C-terminal to arginine 180. Though R268 appears to be more readily cleaved, the presence of either site is sufficient for anaphase initiation. However, mutation of both R180 and R268 to aspartic acid is lethal, as cell proliferation is prohibited by a failure to separate sister chromatids (Uhlmann et al., 1999).  9  After cleavage occurs, the C-terminal fragment is short lived; R269 as a newly formed Nterminal residue is destabilizing by the N-end rule and as such the fragment is subject to ubiquitin/proteasome dependent degradation. Perhaps this degradation is necessary to circumvent the formation of new cohesin complexes until the next cell cycle, though this point remains conjecture (Rao et al., 2001; Varshavsky, 1996). Not long after these discoveries, in vitro cleavage assays confirmed that Esp1 itself is responsible for Scc1 cleavage, with mutation of a critical histidine residue at position 1505 or cysteine at 1531 sufficient to abolish Esp1 proteolytic activity (Uhlmann et al., 2000) (Figure 1-6). Interestingly, only phosphorylated Scc1 is capable of being efficiently processed by Esp1, as phosphatase treated Scc1 is almost completely resistant to cleavage. This posttranslational modification is cell cycle regulated, with hyperphosphorylation of Scc1 occurring shortly before Scc1 is cleaved – in a manner dependent on the activity of the Polo/Cdc5 kinase (Alexandru et al., 2001; Uhlmann et al., 2000). The finding that it is specifically chromatin-bound Scc1 that is targeted for phosphorylation events demonstrates that the cell has a securin independent means of regulating chromosome segregation (Hornig and Uhlmann, 2004). Indeed, these overlapping regulatory mechanisms explain why pds1 mutants demonstrate WT kinetics with regards to sister chromatid separation (Alexandru et al., 1999; Uhlmann et al., 2000). Two serine phosphorylations (S175 and S263) are essential for Scc1 regulation in the absence of pds1 (Alexandru et al., 2001) (Figure 1-6). Events regulating the phosphorylation of Scc1 will be discussed further in section 1.5.5.  10  1.5.3  Other known targets for Esp1 Cohesin cleavage by Esp1 is not limited to mitosis; around the same time that  separase’s interaction with Scc1 was discovered, Esp1 was also found to cleave Rec8 – a meiotic specific cohesin protein. The similarity between the two interactions is striking. Rec8 cleavage also occurs at two separate locations along the polypeptide, both of which are C-terminal to arginine residues (R431 and R453). Mutation of either site alone is not sufficient to prevent cleavage, but the combination proves to be unable to support fragmentation of the protein. The resultant carboxy fragment of cleavage is then subject to the N-end rule pathway for degradation (Buonomo et al., 2000). Also like Scc1, Esp1 recognition of Rec8 is dependent on the cohesin protein’s hyperphosphorylation (Ishiguro et al., 2010; Katis et al., 2010) Alignment of both cohesin cleavage sites allowed Sullivan et al to identify a third target for separase cleavage: the kinetochore associated protein Slk19 (Sullivan et al., 2001; Zeng et al., 1999). Phosphorylated Slk19 is cleaved at the G2/M transition at only one arginine residue (R77) - though unlike both Scc1 and Rec8, the carboxy cleavage fragment is both stable and persistent throughout the next cell cycle. This is because the amino terminus of the newly formed fragment is predicted to carry a stabilizing serine residue (Sullivan et al., 2001; Varshavsky, 1996). Sullivan et al also determined a degenerate core consensus sequence for Esp1: (DE)XXR/X, where X is any amino acid and / denotes the cleavage site. Other than an invariant arginine and an acidic residue in the P4 position, not much specificity is rendered by this motif. Indeed, they were unable to find any new substrates by screening ORFs within the yeast genome with this sequence, limiting the currently known Esp1 substrates to the aforementioned three proteins. (Sullivan et al., 2004).  11  1.5.4  Using FEAR to exit mitosis Like the G2/M transition, exiting from mitosis is a highly regulated process, requiring  a switch from a state of high to low Clb-Cdk1 activity. This inhibition of mitotic cyclins occurs by two known mechanisms, the first of which is APC-mediated degradation. The APC not only facilitates the G2/M transition, but also cooperates with a different co-activator known as Cdh1/Hct1 to stimulate Clb degradation at the end of mitosis (Schwab et al., 1997; Visintin et al., 1997). Clb-Cdk1 activity is also repressed through binding of the Cdk1 inhibitor Sic1 (Mendenhall, 1993; Schwob et al., 1994). If either of these two pathways is defective, the other is sufficient to trigger the exit from mitosis (Schwab et al., 1997; Visintin et al., 1997). Both mechanisms of Clb destruction, however, hinge on the activity of the Cdc14 phosphatase (Visintin et al., 1998). Cdc14 serves to reverse inhibitory phosphorylation on Cdh1, while its mechanism of action on Sic1 is twofold (Jaspersen et al., 1999; Visintin et al., 1998). (1) The SIC1 transcriptional regulator Swi5 is inhibited by Cdk1 kinase activity, being relegated to the cytoplasm until dephosphorylated by Cdc14 (Knapp et al., 1996; Moll et al., 1991; Toyn et al., 1997; Visintin et al., 1998). (2) Sic1 itself is dephosphorylated, preventing recognition by the SCFCdc4 ubiquitin-protein ligase complex (Verma et al., 1997a; Verma et al., 1997b; Visintin et al., 1998). Cdc14 is sequestered in the nucleolus until the Cdc5/Polo kinase releases the phosphatase from its inhibitor, Cfi1/Net1 (Visintin et al., 1999; Visintin et al., 2003). The release of Cdc14 is promoted through two separate pathways, one of which is stimulated by separase [reviewed in (Bardin and Amon, 2001; D'Amours and Amon, 2004)].  12  Initially, Cdc14 release from the nucleolus was thought to be subject to only one regulatory series of events: the mitotic exit network (MEN) (Shou et al., 1999; Visintin et al., 1999) (Figure 1-7). MEN promotes Cdc14 release through a signaling cascade that initiates with the Tem1 GTPase. The migration of one SPB into the daughter cell during mitosis brings inhibited Tem1 into contact with its putative guanine exchange factor Lte1 (Bardin et al., 2000; Pereira et al., 2000). Active Tem1 then stimulates the Cdc15 kinase to phosphorylate the Dbf2-Mob1 downstream effectors (Asakawa et al., 2001; Mah et al., 2001). Disruption of MEN causes cells to arrest in telophase with Cdc14 still sequestered in the nucleolus (Shou et al., 1999; Visintin et al., 1999). However, examination of individual MEN mutants as they progress through the cell cycle revealed a transient release of Cdc14 in early anaphase, a pathway that came to be aptly termed Cdc14 early anaphase release (FEAR) (Stegmeier et al., 2002) (Figure 1-7). Cdc14 release through the FEAR pathway is contingent on both the activity of Esp1 and Slk19. Interestingly, a cleavage-resistant Slk19 is able to stimulate FEAR, and a strain carrying a mutation of the critical cysteine residue in separase, esp1C1531A, is able to rescue the mitotic exit defects of esp1-1 (Stegmeier et al., 2002; Sullivan and Uhlmann, 2003). These observations suggest that the role for Esp1 in the FEAR pathway is not dependent on its proteolytic activity. Instead, separase is thought to cooperate with Zds1 and Zds2 to inhibit the protein phosphatase 2A (PP2A) subunit Cdc55 (Queralt and Uhlmann, 2008b). Downregulation of PP2ACdc55 stimulates Net1 phosphorylation, allowing Cdc14 to escape the nucleolus (Queralt et al., 2006) (Figure 1-7). Though the FEAR pathway has yet to be fully understood, Spo12 and Bns1 are also positive regulators while other negative factors  13  include Pds1 and the nucleolar protein Fob1 (Cohen-Fix and Koshland, 1999; Stegmeier et al., 2004; Stegmeier et al., 2002; Tinker-Kulberg and Morgan, 1999). So why do cells exhibit two distinct waves of Cdc14 release? The first (FEAR) is transient, causing Cdc14 to be rapidly resequestered into the nucleolus until late anaphase, where the more prolonged release occurs (MEN) (Stegmeier et al., 2002). One explanation is that Cdc14 acts as a feedback mechanism, with FEAR required for timely activation of MEN – a reasoning confirmed when it was found that dephosphorylation by Cdc14 stimulates Cdc15 activity (Stegmeier et al., 2002). The biphasic Cdc14 release is also thought to mediate oscillations in CDK substrate degradation; S-phase Cdk substrates are subject to FEAR-induced dephosphorylation and mitotic Cdk substrates to MEN-induced dephosphorylation (Jin et al., 2008).  1.5.5  Separase activity ensures an efficient anaphase The antagonist relationship between Esp1 and PP2ACdc55 is mutual, with the  overexpression of Cdc55 capable of preventing cohesin cleavage. PP2ACdc55 activity is thought to be downstream of the cohesin protector shugoshin (Sgo1 in yeast), which senses a lack of MT tension thereby initiating events to prevent premature Scc1 degradation (Clift et al., 2009). Presumably, PP2ACdc55 promotes the dephosphorylation of chromatin bound Scc1, preventing its recognition by Esp1 (Yaakov et al., 2012). This is similar to meiotic events, where Rec8 is dephosphorylated by PP2A, though with a different catalytic subunit, Rtf1 (Kitajima et al., 2006; Riedel et al., 2006). During nuclear division the inhibition of PP2ACdc55 by separase can therefore be thought of as having a twofold effect. At the G2/M transition, active separase targets chromatin bound Scc1 as well as inhibits PP2ACdc55. This  14  inhibition not only stimulates the release of Cdc14 but also leads to an increase in Scc1 phosphorylation, resulting in a rapid and efficient cleavage of all cohesin while simultaneously initiating mitotic events that will cause mitotic exit (Yaakov et al., 2012). Esp1 activity also contributes to anaphase spindle dynamics. Though delocalized throughout G1, Esp1 quickly accumulates in the nucleus upon interacting with Pds1 and is eventually found exclusively at SPBs and the spindle midzone as the cell progresses through anaphase (Ciosk et al., 1998; Hornig et al., 2002; Jensen et al., 2001). Not only is Pds1 needed for nuclear accumulation of Esp1 as described, but securin is also crucial for the spindle localization of separase. An explanation for this localization phenotype was provided when esp1tsscc1∆ double mutants were found to exhibit short spindles – suggesting that Esp1 is necessary for anaphase spindle elongation in a manner distinct from its role in sister chromatid segregation (Jensen et al., 2001). Additionally, Esp1 cleavage of Slk19 is necessary for the stabilization of MT spindles, which follows with evidence for a role for FEAR in the stabilization of MT dynamics at the onset of anaphase (Higuchi and Uhlmann, 2005; Sullivan et al., 2001).  1.6 1.6.1  Evolutionarily conserved separase – beyond budding yeast Separases are present from yeast to humans In Schizzasaccharomyces pombe, CUT1 - a gene that causes unequal distribution of  DNA in a phenotype that is classified as cell ultimately torn – was found to share significant homology to Esp1 (Hirano et al., 1986; Uzawa et al., 1990). Similarly, separase endopeptidases have been identified in many eukaryotes, with Aspergillus (bimB), Caenorhabditis elegans (Sep-1), Drosophila melanogaster (SSE), Xenopus and humans  15  being prime examples (Jager et al., 2001; May et al., 1992; Siomos et al., 2001; Zou et al., 1999). Among the various separases, homology at the level of the primary amino acid sequence is most notable in the C-terminal domain. That is not to say that the amino termini of these endopeptidases are dissimilar, as computational analysis showed that they adopt similar tertiary alpha-alpha superhelix folds (Jager et al., 2004). Nor is it accurate to assume their unimportance; indeed, in S. cerevisiae, the amino region of Esp1 was found to be required for its activity (Hornig et al., 2002). As well, in Drosophila melanogaster, SSE was thought to be a uniquely small separase, until it was discovered that SSE associates not only with the securin protein Pimples (PIM) but also with the Three Rows Protein (THR). The latter is now known to correspond to the N-terminal domains in other separase homologs (Leismann et al., 2000). The structure of human separase (hSeparase) was solved using electron microscopy (Viadiu et al., 2005). Interestingly, hSeparase also separates the N- and C- termini of the protein by undergoing an autocatalytic cleavage prior to anaphase (Waizenegger et al., 2002; Waizenegger et al., 2000). However, though this proteolysis of hSeparase itself is not essential for Scc1 cleavage, it is necessary for both timely entry into M phase and correct assembly of the bipolar spindle (Papi et al., 2005; Waizenegger et al., 2002). The exact mechanistic purpose behind hSeparase autocleavage was discovered when it was observed that autocleavage disrupts hSeparase binding to PP2A (Gorr et al., 2005; Holland et al., 2007; Wardlaw, 2010). Closer to anaphase initiation, human securin (hSecurin) is degraded and hSeparase auto-cleaves, releasing PP2A and allowing a second inhibitor, Cdk1-cyclin B1, to bind hSeparase until anaphase onset (Wardlaw, 2010) (Figure 1-8A). This has led to a model that hSecurin restricts hSeparase activity only throughout early mitosis.  16  1.6.2  Sister chromatid separation in vertebrates Though separase is commonly found in both yeast and higher eukaryotes, in  vertebrates, cohesin removal is distinctly more complex than in budding yeast. During prophase, the majority of cohesin is removed, specifically from chromosome arms (Losada et al., 1998). However, this disassociation does not occur through cohesin cleavage, but rather the phosphorylation of the cohesin subunit SA2 – a mitotic orthologue of Scc3 present in higher eukaryotes - by Plk1 and Aurora-B in a process that also involves the Sororin and Wap1 proteins (Gimenez-Abian et al., 2004; Hauf et al., 2005; Sumara et al., 2002). Phosphorylated Sororin, a cohesin protein for which an orthologue has not yet been identified in budding yeast, initiates the removal of arm cohesin by recruiting Plk1 to phosphorylate SA2 (Zhang et al., 2011). Plk1 further phosphorylates Sororin itself, leading to its displacement by Wapl, which then facilitates the removal of cohesin complexes from sister chromatid arms (Gandhi et al., 2006; Kueng et al., 2006; Nishiyama et al., 2010; Zhang et al., 2011). SA2 at centromeric bound cohesin is protected from phosphorylation by Shugoshin, leaving centromeric cohesin to be removed by separase-mediated cleavage of Scc1 at the metaphase to anaphase transition (Hauf et al., 2001; Kitajima et al., 2006; McGuinness et al., 2005) (Figure 1-8B).  1.6.3  The importance of human separase: clinical implications  The oncogenic potential of hSeparase was first suggested when small interfering ribonucleic acid (RNA) knockdown of separase in human cells resulted in polyploidy and when separase-deficiency in mice had similar genetic anomalies (Kumada et al., 2006; Waizenegger et al., 2002; Wirth et al., 2006). Further evidence came from aneuploidy  17  caused by the overexpression of separase in p53-null mice mammary epithelial cells exposed to hormone (Pati et al., 2004). Direct testing showed that induction of separase expression in transplanted mammary cells results in tumour development in mice within a month (Zhang et al., 2008). Further analysis by immunofluorescence microscopy of tumour specimens revealed that hSeparase is overexpressed in osteosarcomas as well as in breast and prostate cancers (Meyer et al., 2009) (Figure 1-9). All this data supports the theory that hSeparase is an oncogene, with its overexpression also associated with a higher recurrence rate, metastasis and a lower five year survival rate (Meyer et al., 2009).  1.7  Analyzing ESP1 function using a systematic, high-throughput screening method The clinical importance of hSeparase has underlined the need for a thorough  understanding of separase activity. In higher eukaryotes, separases have also been shown to have roles outside cohesin cleavage, being implicated in such processes as centrosome duplication in humans, cell polarity in Arabidopsis thaliana and epithelial re-organization in Drosophila melanogaster (Pandey et al., 2005; Tsou et al., 2009; Yang et al., 2011). In S. cerevisiae, the relationship of Esp1 with Slk19 has revealed a role for separase in mitotic exit and spindle stability. The goal of this dissertation is to examine Esp1 function using a systematic, high-throughput screening method in order to discover whether any other roles could be ascribed to separase in budding yeast. My investigation into the genetic interactome of a mutant of separase, esp1-1, has revealed involvement of Esp1 in the transposition of Ty elements as well as potentially in messenger RNA (mRNA) biogenesis.  18  A.  B.  Figure 1-1. The eukaryotic cell cycle (A) Oscillations in CDK-cyclin complexes govern cell division, as cells progress through the cell cycle. Cited from (Morgan, 2007). Reprinted with permission © Oxford University Press. (B) S. cerevisiae divides by budding. The daughter cell forms as a bud at “Start”, eventually pinching off the mother at cytokinesis. G1 (The “Clns”) and S and M phase cyclins (“Clbs”) interact with one major Cdk – Cdk1/Cdc28. Cited from (Bloom and Cross, 2007). Reprinted with permission © Nature Publishing Group.  19  A.  B.  20  Figure 1-2. Cohesin establishment and maintenance (A) Cohesin forms a tripartite ring consisting of two Smc subunits and Scc1 (kleisin) bridge. Another kleisin subunit, Scc3, is thought to be a member of the core cohesin complex as well, recruited by Scc1. All known cohesin/cohesin-related proteins for yeasts, Drosophila melanogaster and humans are indicated. Cited from (Haering et al., 2002; Nasmyth, 2011). Reprinted with permission © Elsevier and Nature Publishing Group. (B) The establishment of sister chromatid cohesion begins with a dynamic process as chromatids are loaded through the entry hinge gate by Scc2/4 and released by Wapl/Pds5. Eco1 acetylation of the Smc3 subunit locks cohesin onto sister chromatids, inhibiting precocious separation of the replicates. Cited from (Chan et al., 2012). Reprinted with permission © Elsevier.  21  Figure 1-3. A bioriented mitotic spindle in budding yeast Pole-pole (interpolar) MTs emanate from spindle pole bodies, structuring the mitotic spindle. Shorter MTs contact sister chromatids through a complex known as the kinetochore in such a way that each sister chromatid binds to an opposing spindle pole body. + refers to the plus end of the microtubule, the minus end is at the spindle pole body. Cited from (Morgan, 2007). Reprinted with permission © Oxford University Press.  22  A. Microtubule  Centromeric DNA  Ndc80 complex  Dam1/DASH complex  B.  C.  23  Figure 1-4. Kinetochore-MT interactions (A) Kinetochore-MT interactions are dependent on the ringed Dam1/DASH complex and the rod-shaped Ndc80 complex. Cited from (Bloom and Joglekar, 2010). Reprinted with permission © Nature Publishing Group. (B) MTs can contact sister chromatids in the following way: (1) the preferred bioriented manner (amphitelic attachments) (2) only one sister chromatid attached (monotelic) (3) sister chromatids attach to the same pole (syntelic) (4) unequal distribution of attachments (merotelic). (C) The Ipl1Aurora kinase corrects kinetochore-MT attachments by phosphorylating key proteins (e.g. Dam1/DASH and Ndc80 complexes). Cited from (Tanaka, 2008). Reprinted with permission from © Springer.  24  Figure 1-5. The spindle assembly checkpoint Unattached kinetochores signal the recruitment of the Mad1 receptor. Mad1 binds C-Mad2 to form a heterodimer, which is recognized by O-Mad2. O-Mad2 comes to the relevant kinetochore, and is released back into the cytosol as C-Mad2. This newly formed C-Mad2 functions within the mitotic checkpoint complex (MCC) to inactivate Cdc20. Cited from (Mariani et al., 2012). Reprinted with permission © Elsevier.  25  Figure 1-6. Scc1 cleavage by Esp1 Phosphorylated, chromatin bound Scc1 is targeted for cleavage upon Esp1 release from its inhibitor, Pds1. Cited from (Alexandru et al., 2001). Reprinted with permission © Elsevier.  26  Figure 1-7. FEAR and MEN pathways Throughout the FEAR pathway, Esp1 in cooperation with Zds1/2 inactivates PP2ACdc55, thereby allowing Cdc5 to phosphorylate Net1 and stimulate the release of Cdc14 from the nucleolus. A more prolonged release of Cdc14 occurs later in the cell cycle, through Lte1 stimulation of the Tem1 GTPase activity. Downstream phosphorylation of Cdc15 and then Dbf2-Mob1 stimulates Net1 release of Cdc14. Cited from (Queralt and Uhlmann, 2008a). Reprinted with permission © Elsevier.  27  A.  B.  Figure 1-8. Separase in mammalian cells (A) The dual inhibition of hSeparase. hSecurin inhibits hSeparase during early mitosis. Closer to anaphase initiation, PP2A binding is inhibited, allowing cyclin B1-Cdk to inhibit hSeparase until anaphase onset. Cited from (Wardlaw, 2010). Reprinted with permission © Oxford University Press. (B) Cohesin is removed in prophase from the chromosomal arms by Plk1 phosphorylation of the SA2 subunit. Centromeric chromatin is protected, and is only removed at the metaphase-anaphase transition by separase cleavage of Scc1/Rad21. Cited from (Gutierrez-Caballero et al., 2012). Reprinted with permission © Elsevier.  28  Figure 1-9. Separase as a oncogene Separase is overexpressed in prostate cancers. Separase is in red while 4’,4-diamidino-2phenylindole staining (blue) indicates DNA. Cited from (Meyer et al., 2009). Reprinted with permission © American Association for Cancer Research.  29  Chapter 2: Examining the scope of genetic interactions for the esp1-1 temperature sensitive allele of separase 2.1  Introduction An inherent advantage afforded by the use of S. cerevisiae as a model organism is the  ease of genetic manipulation. In a worldwide collaborative effort, budding yeast was the first fully sequenced eukaryotic genome (Goffeau et al., 1996). Since then, numerous large scale yeast collections have been created, including ones that have systematically deleted each gene (the yeast deletion mutant collection) and epitope tagged each gene either endogenously [with green fluorescent protein, tandem affinity purification, V5 HIS6, or hemagglutinin (HA) tags] or on an overexpression plasmid [with a glutathione s-tranferase (GST) tag] (Ghaemmaghami et al., 2003; Giaever et al., 2002; Huh et al., 2003; Kumar et al., 2002; Sopko et al., 2006). These collections have allowed high-throughput analyses of proteinprotein and genetic interactions as well as protein localization studies and represent a significant advance of yeast systems biology. In 2001, a technique known as synthetic genetic array (SGA) was developed to examine – on a more global scale - a genetic relationship where the combination of two mutants demonstrate a fitness defect more pronounced than either mutant on its own: a synthetic lethal (SL) interaction. With the use of the yeast knockout collection, the seminal SGA paper performed SL analyses with eight null mutants as query strains and found 291 interactions amongst 204 genes (Tong et al., 2001). The notion of genetic interactions was first introduced by William Bateson, who presented the idea that simple Mendelian genetics could be distorted through gene interaction (Bateson and Mendel, 1909). He used the term “epistasis” to describe the phenotypic effect whereby one gene masks the allelic effects at another locus. A more statistical approach was 30  then conducted by R.A. Fisher, who explored the idea of genetic interactions as deviations from what one would expect by the combination of alleles (Fisher, 1919) [reviewed in (Boone et al., 2007; Phillips, 1998)]. In order to assess these genetic interactions systematically, SGA methodology was developed as a series of replica pinning steps that allows for the selection of recombinant haploid double mutants - after a query mutant is mated to the entire deletion mutant collection and the resultant diploids are sporulated. Double mutants that have smaller than expected colony sizes are considered to be synthetic sick (SS) or SL (Tong et al., 2001). Similarly, synthetic dosage lethal (SDL) interactions occur when overexpression of a gene is detrimental to a mutant strain but not a WT strain. The SGA technique has been adapted to enable high-throughput analyses of SDL interactions using either the galactose inducible pGAL1/10-GST-ORFX overexpression collection in a single deletion mutant or a small set of pGAL overexpression plasmids in the deletion mutant collection (Measday et al., 2005; Sopko et al., 2006). The purpose of creating a complex genetic interaction network is primarily for the identification of functional relationships, as physical interaction data to date does not carry significant overlap with genetic data (Tong et al., 2004). Though the meaning behind a particular genetic relationship is not always obvious, interpretations of the mechanistic basis can often be applied - in particular for SL interactions. For example, for SL relationships between nonessential null mutants, “between pathway” interactions can occur when the genes function in separate pathways that both contribute to an essential biological function. Therefore, while the interference with only one pathway is buffered, destruction of both pathways can result in cell lethality (Guarente, 1993; Kelley and Ideker, 2005) (Figure 2-1A). With essential genes, whereby conditional alleles are used to examine genetic relationships,  31  “within” pathway interactions can occur instead. Here, the mutation of one protein can disrupt the interaction of a protein complex, though not enough to impinge on cell viability. However, by mutating another member of the same complex, the interaction may be sufficiently weakened as to disturb the essential pathway, resulting in cell death (Guarente, 1993; Kelley and Ideker, 2005) (Figure 2-1B). In addition, SDL interactions identified in the pho85∆ mutant has served as a proof of principle that disrupting the function of an enzyme can be lethal in combination with the overexpression of a substrate (Measday and Hieter, 2002; Sopko et al., 2006) (Figure 2-1C). By understanding the genetic interaction network of a gene, not only can known functional relationships be identified, but novel ones as well. For example, in the first SGA screens, the profile of bbc1∆ SL interactions was enriched for genes involved in actin regulation. Follow up experiments demonstrated that Bbc1, a previously uncharacterized protein, localized to corticol actin patches and bound proteins that control the assembly of these patches (Tong et al., 2001). To attain a more comprehensive understanding of the cellular role for separase, I assembled a genetic interaction network for ESP1. As Esp1 is an essential protein, a conditional allele of ESP1, esp1-1, was subjected to SGA analysis. Not only did I examine negative (SL and SDL) genetic interactions, I also looked for potential suppressors of the temperature sensitivity of esp1-1. The analysis of the spectrum of esp1-1 genetic interactions is explored in this chapter while follow up examination of new roles for separase is the subject of subsequent chapters.  32  2.2 2.2.1  Results Creation of the esp1-1 allele for SGA analysis To uncover potential new roles for Esp1 using systematic genetic interaction studies,  I subjected the prototypical ESP1 ts mutant, esp1-1, to SGA analysis (Baum et al., 1988). To that end, the entire ~5000 base pair (bp) ORF of esp1-1 was sequenced to determine the location of the relevant mutation(s). Fortuitously, I identified a single point mutation at bp 4211 (CT), resulting in conversion of proline 1404 to leucine (Figure 2.2A). The proximity of this mutation to histidine 1505 and cysteine 1531, the canonical proteolytic residues in Esp1, implicated a physical disruption of the catalytic dyad as a possible reason for the conditional phenotype of esp1-1 (Uhlmann et al., 2000). The placement of this mutation allowed me to amplify the C-terminus of esp1-1 (including bp 4211) with polymerase chain reaction (PCR), and then use that fragment to integrate the mutation into the SGA starting strain as described (Tong et al., 2001).  2.2.2  Examination of the SGA esp1-1 allele Several quality control experiments were undertaken to ensure that the esp1-1 allele  functioned as expected in the SGA strain background. As a first step, esp1-1 was confirmed to be a ts conditional allele by analyzing its growth on rich media using a serial dilution spot assay at various temperatures: 25˚C, 30˚C, 33˚C and 35˚C (Figure 2-2B). esp1-1 growth was slightly impeded at 30˚C as compared to control, negligible at 33˚C and non-existent at 35˚C. The nature of the temperature sensitivity of esp1-1 in the SGA strain background could thus be defined as a non-restrictive/permissive temperature of 25˚C, a semi-permissive temperature of 30˚C, and a restrictive/non-permissive temperature of 35˚C. The esp1-1  33  growth phenotype in the SGA strain background is consistent with the severity of temperature sensitivity demonstrated by both an esp1-1 mutant in another strain background and broadly to other conditional alleles of Esp1 (Baskerville et al., 2008). The length of time at the restrictive temperature that was necessary to adversely affect esp1-1 viability in the SGA background was also examined in detail. WT and esp1-1 cells were first grown to mid-logarithmic (log) phase at 25˚C then shifted to 35˚C for a total of four hours, with samples taken every two hours. Samples were immediately serially diluted and spotted onto yeast peptone dextrose (YPD), with cell viability determined by growth that occurred after three days of incubation at 25˚C (Figure 2-2C). In the span of approximately one doubling (two hours), cell viability was noticeably affected in the esp1-1 strain. Cell lethality was exacerbated further at four hours, suggesting the SGA esp1-1 allele cannot recover well when subjected to a non-permissive temperature for even a few doublings. Finally, as the conditional phenotype of esp1-1 was expected to correspond with a disruption in the proteolytic activity of separase, a known Esp1 substrate (Slk19) was examined to ensure proteolytic processing was indeed affected in the SGA esp1-1 allele. WT and esp1-1, both carrying a pGAL1/10-GST-SLK19 vector, were grown in raffinose at 35˚C for one hour in order to reduce esp1-1 activity. Overexpression of the N-terminally tagged GST-Slk19 was then induced by switching of the carbon source from raffinose to galactose and growing at the restrictive temperature for another hour. Western blot analysis revealed a band that was reliably present when Slk19 was overexpressed in WT cells but not esp1-1 cells (Figure 2-2D). The migration of this band was consistent with the expected molecular weight of the N-terminal fragment produced upon cleavage of Slk19 (Sullivan et al., 2001). Clearly, cleavage of Slk19 is impeded in the SGA esp1-1 strain, and the integrated mutation  34  affected separase proteolytic activity. Taken together, the sequence validation of the point mutation and the analysis of both temperature sensitivity and proteolytic function confirmed that the esp1-1 allele behaved as expected in the SGA background.  2.2.3  SGA screening of esp1-1 negative genetic interactions After careful analysis of the allele, the esp1-1 query strain was mated to the ~4700  nonessential deletion mutant collection (geneX∆) and the ~5300 strains from the pGAL1/10GST-ORFX overexpression collection to identify SL and SDL interactions, respectively (Giaever et al., 2002; Sopko et al., 2006). A total of 114 SL and 248 SDL interactions (“hits”) were identified in this manner, and ranked according to the severity of the phenotype. SL genetic interactions were scored by comparing the colony size of the double mutant to geneX∆ on its own using a quantitative scoring program (Colony Scorer) (Tong et al., 2004). Similarly, SDL genetic interactions were scored by comparing colony growth of esp1-1 strains expressing the pGAL1/10-GST-ORFX plasmid to the viability of overexpressing ORFX on its own. The top 60 SL and top 100 SDL hits (e.g. the ones that were most lethal to esp1-1 viability) were confirmed through rigorous testing. For SL interactions, heterozygous diploids were independently sporulated, and the growth phenotype of individual haploids analyzed by tetrad dissection (Figure 2-3). Expected esp1-1 geneX∆ haploids that were consistently unable to produce viable haploid progeny were considered to be SL; double mutants that reproducibly formed smaller colonies than either single mutant on its own were identified as SS. SDL interactions were confirmed by extracting the pGAL1/10-GST-ORFX plasmid from the colony, retransforming each plasmid into WT and esp1-1 cells, performing a serial dilution spot assay to compare growth on galactose versus viability on dextrose, and  35  finally sequence validation of ORFX (Figure 2-4). Genes that caused a growth defect in esp1-1 but not WT when overexpressed on galactose were scored as SDL or synthetic dosage sick (SDS). The final list of confirmed hits consisted of 15 null mutants and 44 overexpressed proteins that were shown to negatively impact the growth of esp1-1 mutants (Tables 2-1 and 2-2). This corresponded to a confirmation rate of 50-60% for both screens. Two of the esp11 SL interactors - hsc82∆ and lte1∆ - have been previously described. The former terminal phenotype is perhaps indicative of the Hsp90 type chaperone protein, Hsc82, being involved in the promotion of Esp1 function while the latter is due to defects in promoting both pathways controlling mitotic exit (FEAR and MEN) (D'Aquino et al., 2005; Sarin et al., 2004; Stegmeier et al., 2002). I also identified Slk19 in the esp1-1 SDL screen which supports the notion that increased dosage of a substrate in the presence of its defective enzyme can be detrimental to cells (Measday and Hieter, 2002; Sopko et al., 2006; Sullivan et al., 2001).  2.2.4  Analysis of confirmed negative esp1-1 genetic interactions Confirmed SL and SDL genes were classified according to Gene Ontology (GO)  Biological Process using Yeast-GO SLIM analysis and examined for those that exhibited enrichment above genome frequency (Figure 2-5, Table 2-3). As expected, the cell cycle (8 genes out of 59 total, or 13.6% frequency) was an enriched biological process, exhibiting an almost three-fold enrichment over the 4.7% genome frequency for this category (Figure 2-5, Table 2-3). Cell cycle genes identified included the aforementioned lte1∆ and SLK19, as well as two MT (kar3∆ and CIK1) and one actin (MYO2) motor protein. We also identified a  36  2.6-fold enrichment for genes involved in DNA repair which is consistent with a recently described role for Esp1 in promoting dissociation of cohesin during DNA double-strand break repair (McAleenan et al., 2013) (Figure 2-5, Table 2-3). Other biological processes of note were: protein folding (3/59 hits, correlating to a 3.64 fold enrichment), nuclear transport (also 3/59 hits, correlating to a 1.96 fold enrichment) and carbohydrate metabolic processes (4/59 hits; 1.59 fold enrichment) (Figure 2-5, Table 2-3). Most notably, a number of RNA metabolic processes were enriched, including: RNA catabolism, regulation of translation and RNA polymerase II (RNAPII) transcription (Figure 2-5, Table 2-3). Several of the RNA catabolic genes encode P-body proteins (lsm1∆, lsm7∆, PAT1, DHH1, SCD6) while RNAPII transcription genes encode members of the Paf1 complex (rtf1∆, leo1∆, cdc73∆) (Parker and Sheth, 2007; Rosonina and Manley, 2005). The enrichment of these categories was unexpected and suggested that Esp1 may be involved in a pathway that is dependent on a number of these proteins.  2.2.5  Comparison of esp1-1 SL profile with other SGA analyses As previously mentioned, SL relationships with mutations in essential genes, such as  esp1-1, may imply that genes function in parallel pathways that contribute to a common, essential biological function or that they function in the same essential pathway [reviewed in (Boone et al., 2007)]. It has been demonstrated that genes that function in the same pathway may have similar genetic interaction profiles, e.g. a significant number of SL hits in common (Tong et al., 2004). To determine which genes had a similar SL interaction profile to esp1-1, I collaborated with Dr. Charlie Boone’s lab at the University of Toronto. Anastasia  37  Baryshnikova and Dr. Michael Constanzo compared the entire unconfirmed SL profile of esp1-1 to the database of SGA analyses compiled by the Boone lab (Costanzo et al., 2010). The SL profiles of over 200 query mutants were identified as sharing a significant correlation with esp1-1 (Pearson coefficient above 0.2, data not shown), with the top 63 alleles subjected to further scrutiny (Figure 2-6, Table 2-4). As expected, several alleles identified corresponded to genes with known roles in cell cycle regulation, including ts mutants of cell division cycle (cdc) genes (cdc4-3, cdc7-4, cdc7-1, cdc4-2, cdc37-1, cdc2813, cdc23-1) and the MT motor CIK1 (cik1∆). Crucially, several query mutants identified (cdc20-3, slk19∆, spo12∆) encode proteins directly involved in the same functional pathways as Esp1. As well, though not among the top 63, a conditional mutation of securin shared similarity with the SL profile of esp1-1 (Pearson coefficient 0.203, pds1-128, data not shown). The pathways associated with these query mutants include the activation of Esp1 through APCCdc20 and the FEAR pathway (Stegmeier et al., 2002; Visintin et al., 1997). Further, mutants of the cohesin loader (scc2-4) and cohesin components themselves (smc1259) showed significant correlation (Pearson coefficient above 0.2) with the SL profile of esp1-1 (Figure 2-6, Table 2-4, data not shown). Direct evidence of shared functional relationships between Esp1 and genes with similar SL interactions thus underscored the robustness and strength of the SL screen in particular. Interestingly, the query allele with the highest correlation to esp1-1’s SL profile was lrs4∆ (Pearson coefficient 0.402, Figure 2-6, Table 2-4). Lrs4 is a protein involved in ribosomal DNA (rDNA) silencing (loss of rDNA silencing) (Smith et al., 1999). Along with Csm1, deletion of which also results in an overlapping SL profile with esp1-1, Lrs4 has been shown to interact with the regulator of nucleolar silencing and telophase exit (RENT)  38  complex to suppress unequal crossing over at the rDNA (Huang et al., 2006). The RENT complex, which includes Cdc14 and Cfi1/Net1, is responsible for restricting Cdc14 to the nucleolus until release is triggered by the FEAR pathway or MEN (Shou et al., 1999; Stegmeier et al., 2002; Visintin et al., 1999). Once released from the nucleolus, Cdc14 is not only responsible for promoting mitotic exit, but also the segregation of rDNA (D'Amours et al., 2004; Visintin et al., 1998). To further investigate the potential for a relationship between Esp1 and Lrs4, I looked for genetic interactions between esp1-1 and lrs4∆ and found them to be SL (Figure 2-7). Whether this genetic interaction is due to Esp1’s role in the FEAR pathway or, more excitingly, a direct role for Esp1 in either rDNA silencing or segregation remains to be investigated.  2.2.6  Screening of SDL hits for an Esp1 substrate Sullivan et al described a consensus sequence for separase cleavage but were unable  to identify any novel Esp1 substrates out of 63 candidate spindle associated proteins (Sullivan and Uhlmann, 2003). However, the confirmation of Slk19 as an SDL hit for esp1-1 lent credence to the idea that an SDL screen has the potential to identify substrates of a protease, and provided a new list of potential Esp1 targets to test. As all three known substrates of Esp1 are cleaved, a phenomenon visible by western blot analysis, I used the proteolytic processing of potential substrates to my advantage. In developing a screen that would allow me to identify Esp1 substrates in a relatively high throughput manner, I built on the approach used to confirm the proteolytic functionality of esp1-1 in the SGA background (see: section 2.2.2). The pGAL1/10-GST-ORFX vectors of interest were first overexpressed  39  individually at 25˚C in WT cells as a preliminary screen. Only proteins encoded by genes identified in the esp1-1 SDL screen that showed clear evidence of lower migrating bands by subsequent immunoblot analysis were further investigated (Figure 2-8A). From 44 initial proteins, 36 displayed evidence of potential cleavage products. For these 36 proteins, as with the pGAL1/10-GST-SLK19 vector, the plasmid of interest was induced at a non-permissive temperature in both WT and esp1-1 strains. Samples were then examined by western blot analysis for differences in protein mobility (Figure 2-8B). Apart from Slk19, none of the proteins tested showed notable variation between WT and esp1-1 when blots were probed for GST. Thus, at present, none of the SDL hits are obvious substrates for Esp1 though I cannot rule out the possibility that cleavage occurs at such a specific point of the cell cycle as to preclude being observed by such a high throughput analysis.  2.2.7  Screening for suppressors of the esp1-1 temperature sensitivity The conditional nature of the esp1-1 allele provides the opportunity to investigate not  only genetic interactions that result in lethality, but also those that serve to improve the cell viability of esp1-1 (epistatic relationships). To that end, the esp1-1 strains that were mated to both the deletion mutant and pGAL1/10-GST-ORFX overexpression collections were also grown at 35˚C after the final selective pinning steps to look for synthetic rescue (SR) and synthetic dosage rescue (SDR). 25 SR interactions were identified where esp1-1 geneX∆ double mutants grew but esp1-1 alone could not (Table 2-5). Though the genetic interactions were not confirmed, GO analysis demonstrated that like SL/SDL interactions, the SR relationships of esp1-1 were enriched for genes involved in RNA metabolic processes, with the transcription from RNAPII promoter (hap4∆, htz1∆, rpb4∆, rsc1∆, spt3∆, yap7∆) and  40  RNA modification (isu2∆, rit1∆) categories showing a 3.3 and 3.2 fold enrichment above genome frequency, respectively. Only one gene, kel1∆, has a role in cell cycle regulation, though, interestingly, Kel1 activity inhibits MEN. Kel1, a kelch domain containing protein, functions in a complex with Kel2 to repress mitotic exit through interaction with the MEN effectors Lte1 and Tem1 (Hofken and Schiebel, 2002; Nelson and Cooper, 2007; Philips and Herskowitz, 1998; Seshan et al., 2002). The downregulation of the MEN through deletion of LTE1 has already been shown to negatively impact the growth of esp1-1 (D'Aquino et al., 2005) (Figure 2-5). Therefore, stimulation of MEN (by deletion of KEL1) may rescue the growth of esp1-1. When the pGAL1/10-GST-ORFX overexpression collection was screened for highcopy suppressors of esp1-1, only one protein was able to consistently suppress the ts phenotype – a truncated form of a Ty4 element containing just the reverse transcriptase and ribonuclease H domains (hearafter referred to as pGAL1/10-GST-TY4-RT/RH). The rescue was confirmed by spot assay on both dextrose (control) and galactose media (to overexpress the protein) (Figure 2-9). Ty4 is a member of the long terminal repeat retrotranposons, of which there are 5 families (Ty1-5) in S. cerevisiae. Though Ty elements do not have an infectious stage, they have similar life cycles to retroviruses. They are composed of both TyA, which forms the virus like particle, and the TyB polyprotein, which contains the protease, integrase, RT and RH components [reviewed in (Lesage and Todeschini, 2005)]. Currently, it is unclear why this particular truncated Ty element is capable of rescuing the ts nature of esp1-1 as neither full-length elements nor individual proteins alone were able to consistently rescue esp1-1 (data not shown).  41  2.3  Discussion In this chapter, I examine the scope of genetic interactions of the esp1-1 allele as a  means to better understand the complexity of Esp1 function. The conditional nature of the esp1-1 strain afforded me the opportunity to examine both negative genetic interactions (SL and SDL) as well as epistatic relationships in a high-throughput manner. The identification of known esp1-1 SL interactors (hsc82∆ and lte1∆) and a known Esp1 substrate (SLK19) in the screens served as initial confirmation of the veracity of these screens. The esp1-1 genetic interaction network formed by these screens reflected known Esp1 functions, while also isolating pathways of interest for further study.  2.3.1  A dense negative genetic interaction network for a mutant of ESP1 As an essential allele with a large ORF, technical barriers had prevented the  performance of high-throughput, systematic screening of ESP1 until now. Low-throughput genetic analysis of the esp1-1 strain identified SL interactions with cdc14(1-374), hsc82∆, lte1∆ and pds1∆, and an SDL interaction with AMN1 (Ciosk et al., 1998; D'Aquino et al., 2005; Rahal and Amon, 2008; Sarin et al., 2004; Stegmeier et al., 2002; Wang et al., 2003). However, by performing large scale screening, I was able to gain a better picture of the scope of esp1-1 genetic interactions. Essential synthetic genetic networks have been shown to have an interaction density five times that of non-essential networks (Davierwala et al., 2005). SGA screening of esp11 isolated a large number of negative genetic interactions - 114 and 248 (unconfirmed) SL and SDL hits respectively. Though not all SL interactions were confirmed, the number of hits identified would indeed be more consistent with essential alleles, as nonessential genes  42  only average 34 SL interactions (Tong et al., 2004). The number of SDL hits for esp1-1 also appears to be substantial; recent SGA analysis of the spectrum of kinase mutants showed that the highest number of SDL hits identified was 156 and 113 for cla4∆ and slt2∆ respectively (Sharifpoor et al., 2012). As well, the depth of the SL and SDL screens in particular demonstrated the complexity and importance of ESP1, reflecting that the esp1-1 conditional allele impinges not only on the regulation of the metaphase to anaphase transition but also the exit from mitosis (Stegmeier et al., 2002; Uhlmann et al., 1999; Uhlmann et al., 2000). I did not find any direct overlap between genes identified as SL and SDL, consistent with previous findings from kinetochore SL and SDL screening (Measday et al., 2005). Though these two genetic screens probe different genetic relationships in general, GO analysis has shown consistency in relation to the various functions enriched from these hits. Inclusion of epistatic interactions in the analysis was an opportunity to further saturate the scale of the screen. Although bub2∆ and kin4∆ rescue the lethality of an esp1-1 lte1∆ double mutant and the dosage imbalance observed upon overexpression of ESP1 is rescued by simultaneous overexpression of either CLB2, CDH1 or PDS1, the rescue of the esp1-1 ts phenotype alone has not been examined on this level (D'Aquino et al., 2005; Kaizu et al., 2010; Stegmeier et al., 2002).  While screening for epistatic relationships contributed  to the overall picture of esp1-1 genetic interaction, the breadth of information provided was lower than that of lethal interactions, as only one dosage suppressor was identified. Esp1’s importance to cell viability promotes the susceptibility of esp1-1 to various perturbations, leading to a dense negative genetic interaction network.  43  2.3.2  Genetic interactions of esp1-1 relate to essential Esp1 functions Esp1’s function in the FEAR pathway was reflected in esp1-1 SL (lte1∆) and SDL  (SLK19) interactions as well as by the correlation of esp1-1’s SL profile with spo12∆ and slk19∆ mutants. However, because of the technical limitations of the screens performed, the direct identification of hits specifically involved in sister chromatid segregation was not anticipated. Screens using the deletion collection specifically probed non-essential alleles, which excluded a number of cell cycle genes (such as those encoding the core cohesin components) from the analysis (Giaever et al., 2002). In addition, though pds1∆ esp1-1 double mutants are SL when independently tested, pds1∆ mutants grow very poorly, and as such was a member of the 18.2% of genes omitted from the nonessential deletion collection (Giaever et al., 2002; Yamamoto et al., 1996a, b). For this reason, the pds1∆esp1-1 interaction was not recovered from the esp1-1 SL screen presented here. Similar caveats arise from screening of the pGAL1/10-GST-ORFX collection, as many cell cycle genes (SCC1 and PDS1 included) are lethal even when overexpressed in WT cells (Sopko et al., 2006). The inherent limitations of the SGA screening method must also be acknowledged. For example, the SGA SL screening methods would exclude loci that are genetically linked to the ESP1 ORF as well as those null mutants that are prone to sporulation and germination defects. As a result, bona fide esp1-1 SL interactions may be missed, which was reflected by finding that lrs4∆esp1-1 double mutants are SL through independent means (Figure 2-7). In addition, as demonstrated by the ~50% confirmation rate for both the SL and SDL screens, SGA analyses can also produce false positives. Many explanations may account for this, including the potential to spontaneously acquire secondary mutations throughout the process.  44  Note that the haploid selectable marker for the esp1-1 SGA strain used in the screen was the Schizzasaccharomyces pombe HIS5 gene under the control of the STE2 promoter and not the original MFA1pr-HIS3 SGA reporter in order to alleviate the false positive rates that have been known to occur with the latter recombinant allele due to leaky expression/HIS3 recombination (Daniel et al., 2006; Tong and Boone, 2007). In spite of these aforementioned restrictions, the impact of the well characterized role for Esp1 on sister chromatid cohesion was demonstrated by the overlap between the SL interaction profiles of esp1-1 and cdc20-3 or cohesin mutants (scc2-4, smc1-259) (Figure 2-6, data not shown). Cdc20, in conjunction with the APC, effectively enables the activation of Esp1, therefore null mutations exacerbating the conditional phenotype of cdc20-3 are likely to cause lethality in an esp1-1 mutant as well. However, an explanation for the similarity between the SL interaction profiles of esp1-1 and cohesin mutants is not immediately apparent, as these mutants share opposing phenotypes with respect to sister chromatid segregation. For example, cohesin loading in S phase requires Scc2, and in the scc2-4 mutant, cohesin association is weak and premature sister chromatid segregation occurs (Ciosk et al., 2000; Lengronne et al., 2004; Toth et al., 1999a). In contrast, the opposite occurs in esp1-1 cells as sister chromatid segregation is impeded due to a failure to cleave Scc1 (Uhlmann et al., 1999). Similarly, Smc1 mutants demonstrate defects in the tethering of sister chromatids (Toth et al., 1999a). However, as both separase and cohesin function in the maintenance of temporal control of sister chromatid segregation, further interference with this regulation may be similarly lethal in conditional mutants of both despite the difference in phenotype.  45  2.3.3  Negative genetic interactions of esp1-1 emphasize a role for Esp1 in  maintaining spindle stability When the confirmed SL and SDL genetic interactions were examined for enriched GO biological processes, I was particularly intrigued to find several spindle motor (Myo2 and Kar3) and motor-related proteins (Cik1) present in the expected cell cycle category. All serve to regulate spindle dynamics. Myo2 mediates proper spindle orientation throughout the cell cycle while a Kar3-Cik1 heterodimer promotes poleward transport of cargoes such as kinetochores along MTs (Barrett et al., 2000; Beach et al., 2000; Sproul et al., 2005; Tanaka et al., 2005; Yin et al., 2000). Esp1 localizes to and promotes stability of the elongating anaphase spindle; therefore, perturbation of spindle mechanics in an esp1-1 strain, which has spindle defects, is expected to be detrimental to esp1-1 cell viability (Jensen et al., 2001; Sullivan et al., 2001). The importance of proper spindle dynamics in esp1-1 viability at the permissive temperature was further exemplified through the similarity between the SL profiles of cik1∆ and esp1-1 mutants.  2.3.4  The genetic interaction network of esp1-1 suggests potential new roles for  separase The ability of the genetic interaction network of esp1-1 to reflect not only the wellstudied roles of Esp1 (sister chromatid cohesion, FEAR) but also less characterized ones (spindle dynamics) reinforces the potential for identification of novel roles for Esp1. Though no new novel substrates for Esp1 were found, I identified several functional pathways that merit further study. Both lrs4∆ and csm1∆ were shown to have SL profiles similar to esp1-1. Though this similarity may be predicated on the failure of the esp1-1 mutant to properly  46  release Cdc14 from the nucleolus in anaphase, thus possibly causing defects in rDNA segregation, I cannot exclude the possibility that Esp1 plays a direct role in the maintenance and separation of rDNA. However, the most striking finding from this study was the enrichment of RNA metabolic genes as genetic interactors of esp1-1. This opens two avenues for further investigation. The most direct possibility is that Esp1 plays some sort of role in the regulation of mRNA as SL and SDL hits specifically identified members of the Paf1C as well as P-body components. A role for Esp1 in the regulation of mRNA is further explored in Chapter 4. Another possibility is that Esp1 functions in another pathway whose regulation is dependent on these genes – a prospect that became increasingly likely when a truncated Ty element was identified as a dosage suppressor of esp1-1. Interestingly, many esp1-1 SL and SDL hits have an effect on the regulation of Ty elements in budding yeast (see: Chapter 3 for details) and a possible role for Esp1 in the regulation of Ty transposition is the subject of the next chapter.  2.4 2.4.1  Materials and methods Yeast strains and growth Strains used for these analyses are indicated in Tables 2-6. Strains were grown in  either YPD or synthetic complete (SC) media lacking uracil (SC-URA) and were incubated at 25˚C unless otherwise indicated. Standard protocols for yeast culture and transformation were followed (Guthrie and Fink, 2004). LRS4 was deleted using a PCR-based, homologous recombination method for S. cerevisiae (Longtine et al., 1998).  47  To create the esp1-1::NAT mutation in the SGA starting strain, a C-terminal fragment was amplified from esp1-1 (W303 strain background, gift from Yanchang Wang) (Baum et al., 1988). This fragment included the P1404L (bp4211 C→T) mutation, approximately 200 bp downstream of the stop codon and an additional 25 bp overlapping the TEF promoter in p4339 (Tong et al., 2001). Concurrently, the NATMX4 cassette from p4339 was also amplified to include 45 bp immediately downstream of the ESP1 ORF. Both amplicons were transformed simultaneously into Y7092. Successful double recombination was confirmed in three ways: (1) growth on YPD media containing clonNAT (2) temperature sensitivity at 37˚C (3) sequencing of the esp1-1::NAT mutation (Macrogen).  2.4.2  Testing temperature sensitivity of the esp1-1 allele WT and esp1-1 strains were grown to mid-log phase (optical density, O.D.600 = 0.5-  1.0) in YPD at which point cells were diluted to an O.D.600 of 0.1. Subsequently, cells were serially diluted four times by a factor of 1:5 in YPD. 4µL of each dilution was spotted onto YPD and plates grown at 25˚C, 30˚C, 33˚C or 35˚C for three days. WT and esp1-1::NAT cells grown to mid log phase were also diluted in prewarmed YPD and allowed to grow for four hours at 35˚C, with time points taken at 0, 2 and 4 hours. For each time point, samples were diluted to an O.D.600 of 0.1 and serially diluted as described above. Dilutions were spotted onto YPD and plates allowed to incubate at 25˚C for three days.  48  2.4.3  Assaying for Esp1 substrates To assay strictly for potential cleavage products, WT cells containing the pGAL1/10-  GST-ORFX plasmid were grown overnight in SC-URA + 2% raffinose + 0.1% dextrose. Cells were then diluted in SC-URA + 2% raffinose and grown to log phase. Cells were pelleted, washed and resuspended in SC-URA + 2% galactose, and allowed to grow for one hour before samples for western blot analysis were collected. To examine whether ORFX encoded a substrate for Esp1, WT and esp1-1::NAT cells containing pGAL-GST-ORFX were grown to log phase in SC-URA + 2% raffinose and transferred to 35˚C for one hour. Cells were then pelleted, washed and resuspended in prewarmed SC-URA + 2% galactose. Cells were then placed back at 35˚C for another hour at which point samples were taken for western blotting.  2.4.4  Western blotting 10-25mL of cells were harvested, washed with ice cold H20 and resuspended in lysis  buffer [50mM Tris-HCl pH 7.5, 10% Nonidet P-40 (NP-40), 250mM NaCl, 0.5mM ethylenediaminetetraacetic acid (EDTA), 1mM dithiothreitol (DTT) and protease inhibitors] at 4˚C. Glass beads were added, and the suspension vortexed at 4˚C in two minutes cycles, with two minutes on ice in between, until > 90% lysis was achieved. Lysates were centrifuged at 14 000 x g for ten minutes, and supernatant was kept as the whole cell lysate (WCL). Protein concentration was quantified using a NanoDrop® ND-1000. 40 µg of WT and 80µg of esp1-1::NAT were run using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE) and transferred onto nitrocellulose membranes by wet transfer. Membranes were immunoblotted with anti-GST HRP Conjugate (1:3000, GE Healthcare).  49  2.4.5  SGA screening SGA screens have been previously described in detail, and were all performed in Dr.  Christopher Loewen’s lab at the University of British Columbia under the supervision of a research associate, Dr. Barry Young (Tong and Boone, 2006; Tong et al., 2001; Tong and Boone, 2007). Using a Singer® RoToR HDA robot, esp1-1::NAT was mated to both the haploid deletion collection of nonessential alleles (BY4741, MATa, KanMX, a gift from C. Boone) and the 2 micron pGAL1/10-GST-ORFX overexpression array (Open Biosystems) (Sopko et al., 2006; Tong et al., 2001). For SL and SDL screens respectively, either double mutants (esp1-1::NAT geneX∆) or esp1-1::NAT carrying pGAL1/10-GST-ORFX were obtained through sporulation of heterozygous diploids with at least three colonies of each genotype being compared. A series of replica pinning steps to various selective medias isolated recombinant MATa cells of interest (esp1-1 in combination with geneX∆ or pGAL1/10-GST-ORFX for the SL or SDL screens, respectively. See (Tong and Boone, 2007) for full details on selection criteria. On the final selective media, MATa recombinants were allowed to grow at 25˚C or 35˚C, for negative interactions or suppressors respectively. Note that for SGA screens involving the pGAL-GST-ORFX collection, the final selective media was supplemented with 2% galactose as a carbon source instead of dextrose in order to induce overexpression of ORFX. After incubation, plates were scanned, colonies detected using Colony Imager, and colony size quantified using Colony Scorer (Tong et al., 2004). The ratio of colony size to control determined a genetic interaction. Only ORFs demonstrating growth below (for SL and SDL) or above (for SR and SDR) the cutoff score for all three replicates were considered to be genetic interactions (“hits”). SL interactions (colony size that was <0.19 that of control) and SDL interactions (colony size growing <0.3  50  of control) were chosen for further testing, narrowing each list to 43 and 74 different ORFs, respectively. All SDR hits (colony size >1.5 above background growth) were tested.  2.4.6  Confirmation of genetic interactions SL hits were confirmed by sporulation of the heterozygous diploid of interest.  Tetrads were then dissected and germinants analyzed. To confirm the identity of geneX∆, PCR analysis of heterozygous diploids was performed using the general KanB primer as well as each gene’s specific A confirmation primer (Giaever et al., 2002). esp1-1::URA3 lrs4∆::kanMX6 heterozygous diploids were also analyzed in this manner to confirm SL. Plasmids carrying the 74 genes identified as SDL with esp1-1::NAT were rescued from yeast and retransformed into both WT and esp1-1::NAT strains. Transformants were then grown overnight to log phase (O.D.600,= 0.5-1.0) in SC-URA + 2% raffinose + 0.1% dextrose media. Strains were then diluted to an O.D.600 of 0.1, and subsequently serially diluted four times by a factor of 1:5, all in SC-URA + 2% raffinose. Dilutions were then spotted onto either SC-URA + 2% dextrose or SC-URA + 2% galactose plates, and incubated for four days at the appropriate temperature (25˚C or 35˚C for SDL or SDR hits respectively). The identity of ORFX was confirmed by sequencing (Operon) using both a GST forward primer (OVM487 5’ TGCAGGGCTGGCAAG 3’, sequence from C. Loewen) and reverse primer specific to the vector (Sopko et al., 2006). SDR hits were analyzed similarly to SDL hits, though SC-URA plates were grown at 35˚C. esp1-1::NAT cells containing pGAL1/10-GST (empty vector) was used as a control.  51  2.4.7  Comparison of esp1-1 SL profile with Boone lab SL database An esp1-1 genetic interaction profile was generated from the entire (unconfirmed) SL  SGA dataset by averaging the values associated with the same ORF. A Pearson correlation coefficient between the esp1-1 profile and every screen in the published SGA dataset was generated (Costanzo et al., 2010). This was computed in two ways: (1) correlating across all pairs (both positive and negative interactions), and (2) correlating across negative genetic interactions only. By standard Precision-Recall analysis, the correlation strictly across negative (SL) interactions provided the most meaningful set of correlations.  52  Table 2-1. Classification of SL hits for esp1-1 Gene name  Systematic name  SL/ SS  Descriptiona Protein required for nuclear envelope morphology, nuclear APQ12 YIL040W SL pore complex localization, mRNA export from the nucleus Geranylgeranyl diphosphate synthase BTS1 YPL069C SS Component of the Paf1p complex CDC73 YLR418C SS Cytoplasmic chaperone of the Hsp90 family HSC82 YMR186W SL Nim1p-related protein kinase that regulates the HSL1 YKL101W SS morphogenesis and septin checkpoints Minus-end-directed microtubule motor that functions in KAR3 YPR141C SL mitosis and meiosis Component of the Paf1p complex LEO1 YOR123C SL Lsm (Like Sm) protein; forms heteroheptameric complex (with Lsm2p- Lsm7p) involved in degradation of LSM1 YJL124C SL cytoplasmic mRNAs Lsm (Like Sm) protein; part of heteroheptameric LSM7 YNL147W SL complexes (Lsm2p-7p and either Lsm1p or 8p) Protein required for asymmetric localization of Bfa1p at daughter-directed spindle pole bodies and for mitotic exit at LTE1 YAL024C SL low temperatures Subunit of an E3 ubiquitin ligase complex involved in MMS22 YLR320W SL replication repair FG-nucleoporin component of central core of the nuclear NUP60 YAR002W SL pore complex (NPC) Protein component of the small (40S) ribosomal subunit RPS27B YHR021C SL Component of the Paf1p complex RTF1 YGL244W SL Type I HSP40 co-chaperone YDJ1 YNL064C SL a adapted from Saccharomyces genome database (SGD – www.yeastgenome.org)  53  Table 2-2. Classification of SDL hits for esp1-1 Gene name ACO1 ADE6 CDC6 CIK1 COP1 CYM1 DHH1 DOT1 DTR1 EBS1 ECM10 EFT2 GAR1 GSP2 GZF3 HRP1 MNN4 MYO2 PAN2 PAT1 PDR1 PEX19 PEX8 PRD1 RAD27  Systematic name YLR304C YGR061C YJL194W YMR198W YDL145C YDR430C YDL160C YDR440W YBR180W YDR206W YEL030W YDR385W YHR089C YOR185C YJL110C YOL123W YKL201C YOR326W YGL094C YCR077C YGL013C YDL065C YGR077C YCL057W YKL113C  SDL/ SDS SDL SDL SDS SDL SDS SDS SDL SDS SDS SDL SDL SDL SDL SDL SDS SDL SDL SDS SDL SDL SDS SDS SDS SDL SDS  Descriptiona Aconitase, required for the tricarboxylic acid (TCA) cycle Formylglycinamidine-ribonucleotide (FGAM)-synthetase Essential ATP-binding protein required for DNA replication Kinesin-associated protein required for both karyogamy and mitotic spindle organization Alpha subunit of COPI vesicle coatomer complex Lysine-specific metalloprotease of the mitochondrial intermembrane space Cytoplasmic DExD/H-box helicase, stimulates mRNA decapping Nucleosomal histone H3-Lys79 methylase Putative dityrosine transporter of the major facilitator superfamily Protein involved in inhibition of translation and nonsense-mediated decay Heat shock protein of the Hsp70 family Elongation factor 2 (EF-2); catalyzes ribosomal translocation during protein synthesis Protein component of the H/ACA snoRNP pseudouridylase complex GTP binding protein (mammalian Ranp homolog) GATA zinc finger protein Subunit of cleavage factor I Putative positive regulator of mannosylphosphate transferase Mnn6p Type V myosin motor involved in actin-based transport of cargos Essential subunit of the Pan2p-Pan3p poly(A)-ribonuclease complex Deadenylation-dependent mRNA-decapping factor Transcription factor that regulates the pleiotropic drug response Chaperone and import receptor for newly-synthesized class I PMPs Intraperoxisomal organizer of the peroxisomal import machinery Zinc metalloendopeptidase 5' to 3' exonuclease, 5' flap endonuclease 54  Table 2-2. Classification of SDL hits for esp1-1 (continued) Gene name RAD53 REG1 RSC30 SCD6 SGS1 SIP4  Systematic name YPL153C YDR028C YHR056C YPR129W YMR190C YJL089W  SDL/ SDS SDL SDS SDL SDL SDS SDL  Descriptiona Protein kinase, required for cell-cycle arrest in response to DNA damage Regulatory subunit of type 1 protein phosphatase Glc7p Component of the RSC chromatin remodeling complex Repressor of translation initiation Nucleolar DNA helicase of the RecQ family C6 zinc cluster transcriptional activator Kinetochore-associated protein required for normal segregation of chromosomes in meiosis and SLK19 YOR195W SDL mitosis Putative histone acetylase with a role in transcriptional silencing SPT10 YJL127C SDS ER membrane protein involved in regulation of OLE1 transcription SPT23 YKL020C SDS G protein beta subunit, forms a dimer with Ste18p to activate the mating signaling pathway STE4 YOR212W SDS Protein required for rDNA silencing and mitotic rDNA condensation; stimulates Cdc14p phosphatase activity and biphasic release to promote rDNA repeat segregation; required for TOF2 YKR010C SDL condensin recruitment to the replication fork barrier site; Plasma membrane pyridoxine (vitamin B6) transporter TPN1 YGL186C SDS Regulatory subunit of trehalose-6-phosphate synthase/phosphatase TPS3 YMR261C SDS Interacts with Trm7p for 2'-O-methylation of C32 of substrate tRNAs TRM732 YMR259C SDS Ubiquitin-specific protease; cleaves ubiquitin from ubiquitinated proteins UBP12 YJL197W SDL Unknown YDR374C YDR374C SDS Putative glycosidase YIR007W YIR007W SDL Serine/threonine protein kinase YPK1 YKL126W SDS Unknown YPR174C YPR174C SDL a adapted from Saccharomyces genome database (SGD- www.yeastgenome.org)  55  Table 2-3. Fold enrichment of GO biological processes identified by analysis of esp1-1 SL and SDL interactions Fold Enrichment 5 3.64  GO term RNA catabolic process protein folding  Frequency 5 of 59 genes, 8.5% 3 of 59 genes, 5.1%  Genome Frequency 108 of 6334 genes, 1.7% 89 of 6334 genes, 1.4%  mitotic cell cycle  8 of 59 genes, 13.6%  300 of 6334 genes, 4.7%  DNA repair regulation of translation nuclear transport transcription from RNA polymerase II promoter carbohydrate metabolic process cellular respiration ribosomal small subunit biogenesis protein targeting protein phosphorylation Golgi vesicle transport mRNA processing nucleobase-containing small molecule metabolic process proteolysis involved in cellular protein catabolic process signaling  6 of 59 genes, 10.1% 2 of 59 genes, 3.4% 3 of 59 genes, 5.1%  239 of 6334 genes, 3.8% 90 of 6334 genes, 1.4% 164 of 6334 genes, 2.6%  8 of 59 genes, 13.6%  453 of 6334 genes, 7.2%  Gene(s) PAT1, DHH1, EBS1, LSM1, LSM7 ECM10, HSC82, YDJ1 LTE1, CDC6, HSL1, TOF2, CIK1, SLK19, MYO2, KAR3 PAN2, RAD27, MMS22, SGS1, RAD53, DOT1 EFT2, SCD6 APQ12, NUP60, GSP2 PDR1, RTF1, RSC30, GZF3, SPT10, SPT23, CDC73, LEO1  4 of 59 genes, 6.8% 1 of 59 genes, 1.7%  268 of 6334 genes, 4.2% 90 of 6334 genes, 1.4%  MNN4, TPS3, REG1, SIP4 ACO1  1.61 1.21  1 of 59 genes, 1.7% 2 of 59 genes, 3.4% 1 of 59 genes, 1.7% 1 of 59 genes, 1.7% 1 of 59 genes, 1.7%  126 of 6334 genes, 2% 262 of 6334 genes, 4.1% 176 of 6334 genes, 2.8% 187 of 6334 genes, 3% 192 of 6334 genes, 3.0%  RPS27B PEX19, PEX8 YPK1 COP1 HRP1  0.85 0.83 0.61 0.57 0.57  1 of 59 genes, 1.7%  187 of 6334 genes, 3%  ADE6  0.57  1 of 59 genes, 1.7% 1 of 59 genes, 1.7%  190 of 6334 genes, 3% 228 of 6334 genes, 3.6%  CYM1 STE4  0.57 0.5  2.89 2.66 2.42 1.96 1.89  56  Table 2-3. Fold enrichment of GO biological processes identified by analysis of esp1-1 SL and SDL interactions (continued) GO term transmembrane transport biological process unknown lipid metabolic process rRNA processing other  Frequency 1 of 59 genes, 1.7% 5 of 59 genes, 8.5% 1 of 59 genes, 1.7% 1 of 59 genes, 1.7% 2 of 59 genes, 3.4%  Genome Frequency 220 of 6334 genes, 3.5% 1188 of 6334 genes, 18.8% 295 of 6334 genes, 4.7% 296 of 6334 genes, 4.7%  Gene(s) DTR1 YDR374C, YIR007W, UBP12, TRM732, YPR174C BTS1 GAR1 PRD1, TPN1  Fold Enrichment 0.49 0.45 0.36 0.36  57  Table 2-4. Comparison of esp1-1’s SL profile to the Boone database SGA query ORFa  SGA query gene name  Pearson correlation to esp1-1 screen  YDR439W YFL009W_tsq334  LRS4 cdc4-3  0.402 0.347  YJR140C  HIR3  0.333  YMR078C YNL199C  CTF18 GCR2  0.333 0.332  YCR086W YPR070W  CSM1 MED1  0.33 0.319  YNL127W  FAR11  0.318  YAR002W YLR438CA_DAmP YGL116W_tsq368 YGL061C_tsq239 YIL084C  NUP60  0.31  LSM3_DAmP cdc20-3 duo1-2 SDS3  0.308 0.305 0.303 0.301  YDR435C  PPM1  0.298  YBR111W-A YBR026C  SUS1 ETR1  0.294 0.293  Descriptionb Nucleolar protein that forms a complex with Csm1p, and then Mam1p at kinetochores during meiosis I to mediate accurate homolog segregation; required for condensin recruitment to the replication fork barrier site and rDNA repeat segregation F-box protein required for G1/S and G2/M transition Subunit of the HIR complex; a nucleosome assembly complex involved in regulation of histone gene transcription Subunit of a complex with Ctf8p that shares some subunits with Replication Factor C and is required for sister chromatid cohesion Transcriptional activator of genes involved in glycolysis Nucleolar protein that forms a complex with Lrs4p and Mam1p; see LRS4 Subunit of the RNA polymerase II mediator complex Protein involved in recovery from cell cycle arrest in response to pheromone, in a Far1p-independent pathway FG-nucleoporin component of central core of the nuclear pore complex (NPC) Lsm (Like Sm) protein; part of heteroheptameric complexes (Lsm2p-7p and either Lsm1p or 8p) Activator of anaphase-promoting complex/cyclosome (APC/C) Essential subunit of the Dam1 complex Component of the Rpd3p/Sin3p deacetylase complex Carboxyl methyltransferase, methylates the C terminus of the protein phosphatase 2A catalytic subunit Component of both the SAGA histone acetylase and TREX-2 complexes 2-enoyl thioester reductase 58  Table 2-4. Comparison of esp1-1’s SL profile to the Boone database (continued) SGA query ORFa  SGA query gene name  Pearson correlation to esp1-1 screen  YLR320W  MMS22  0.293  YBR058C  UBP14  0.292  YOR259C_tsq260  rpt4-150  0.292  YDL017W_tsq131 YKL193C_tsq572 YER035W YOR123C  cdc7-4 sds22-5 EDC2 LEO1  0.291 0.29 0.289 0.287  YFR004W_tsq534 YDL017W_tsq880 YBR087W_tsq887 YFR052W_tsq405 YJR097W  rpn11-14 cdc7-1 rfc5-1 rpn12-1 JJJ3  0.286 0.285 0.284 0.283 0.282  YDL028C_tsq169  mps1-417  0.281  YER112W_DAmP YGL044C_tsq652 YHR167W  LSM4_DAmP 0.281 rna15-58 0.28 THP2 0.28  YHR039C-A YDR180W_tsq69  VMA10 scc2-4  0.279 0.273  Descriptionb Subunit of an E3 ubiquitin ligase complex involved in replication repair Ubiquitin-specific protease that specifically disassembles unanchored ubiquitin chains One of six ATPases of the 19S regulatory particle of the 26S proteasome involved in degradation of ubiquitinated substrates DDK (Dbf4-dependent kinase) catalytic subunit required for origin firing and replication fork progression Regulatory subunit of the type 1 protein phosphatase (PP1) Glc7p RNA-binding protein that directly activates mRNA decapping Component of the Paf1 complex Metalloprotease subunit of the 19S regulatory particle of the 26S proteasome lid See above: cdc7-4 allele Subunit of heteropentameric Replication factor C (RF-C) Subunit of the 19S regulatory particle of the 26S proteasome lid Protein of unknown function Dual-specificity kinase; required for spindle pole body (SPB) duplication and spindle checkpoint function Lsm (Like Sm) protein; part of heteroheptameric complexes (Lsm2p-7p and either Lsm1p or 8p) Component of the cleavage and polyadenylation factor I (CF I) Subunit of the THO and TREX complexes Subunit G of the eight-subunit V1 peripheral membrane domain of the vacuolar H+-ATPase (V-ATPase) Subunit of cohesin loading factor (Scc2p-Scc4p) 59  Table 2-4. Comparison of esp1-1’s SL profile to the Boone database (continued) SGA query ORFa YDR207C  SGA query gene name UME6  Pearson correlation to esp1-1 screen 0.273  YHR152W  SPO12  0.273  YMR198W YPR101W  CIK1 SNT309  0.271 0.27  YDR363W-A YER093C_tsq658  SEM1 tsc11-1  0.268 0.267  YHR191C  CTF8  0.267  YBL058W  SHP1  0.266  YBL034C_tsq822 YFL009W_tsq415  stu1-12 cdc4-2  0.263 0.263  YGL173C YOL012C YDR168W_tsq317 YPR119W  KEM1 HTZ1 cdc37-1 CLB2  0.263 0.262 0.261 0.261  YLR410W YFR002W_DAmP YLR272C_tsq432 YNL136W  VIP1 NIC96_DamP ycs4-1 EAF7  0.26 0.259 0.259 0.259  Descriptionb Key transcriptional regulator of early meiotic genes Nucleolar protein of unknown function, positive regulator of mitotic exit Kinesin-associated protein required for both karyogamy and mitotic spindle organization Member of the NineTeen Complex (NTC) Component of lid subcomplex of the 26S proteasome regulatory subunit Subunit of TORC2 (Tor2p-Lst8p-Avo1-Avo2-Tsc11p-Bit61p) Subunit of a complex with Ctf18p that shares some subunits with Replication Factor C and is required for sister chromatid cohesion UBX (ubiquitin regulatory X) domain-containing protein that regulates Glc7p phosphatase activity and interacts with Cdc48p Component of the mitotic spindle that binds to interpolar microtubules via its association with beta-tubulin F-box protein required for G1/S and G2/M transition Evolutionarily-conserved 5’-3’ exonuclease component of cytoplasmic processing (P) bodies involved in mRNA decay Histone variant H2AZ Essential Hsp90p co-chaperone B-type cyclin involved in cell cycle progression Inositol hexakisphosphate (IP6) and inositol heptakisphosphate (IP7) kinase Linker nucleoporin component of the nuclear pore complex (NPC) Subunit of the 60ondensing complex Subunit of the NuA4 histone acetyltransferase complex 60  Table 2-4. Comparison of esp1-1’s SL profile to the Boone database (continued) SGA query ORFa  SGA query gene name  Pearson correlation to esp1-1 screen  YOR083W  WHI5  0.258  YBR160W_tsq175  cdc28-13  0.257  YGR270W YOR027W  YTA7 STI1  0.257 0.257  YDR225W  HTA1  0.256  YMR235C_tsq172  rna1-S116F  0.255  YHR083W_tsq493 YBR193C_tsq741 YHR019C_DAmP  sam35-2 med8-51 DED81_DAmP  0.254 0.252 0.252  YHR166C_tsq89  cdc23-1  0.251  Descriptionb Repressor of G1 transcription that binds to SCB binding factor (SBF) at SCB target promoters in early G1 Catalytic subunit of the main cell cycle cyclin-dependent kinase (CDK) Protein that localizes to chromatin and has a role in regulation of histone gene expression Hsp90 cochaperone Histone H2A, core histone protein required for chromatin assembly and chromosome function GTPase activating protein (GAP) for Gsp1p, involved in nuclear transport Essential component of the sorting and assembly machinery (SAM complex or TOB complex) of the mitochondrial outer membrane Subunit of the RNA polymerase II mediator complex Cytosolic asparaginyl-tRNA synthetase Subunit of the Anaphase-Promoting Complex/Cyclosome (APC/C) Kinetochore-associated protein required for normal segregation of chromosomes in meiosis and mitosis; component of the FEAR regulatory network  YOR195W SLK19 0.251 (Costanzo et al., 2010) b adapted from Saccharomyces genome database (SGD- www.yeastgenome.org) a  61  Table 2-5. SR hits for esp1-1 Gene Name GYP6 MUQ1  Systematic Name YJL044C YGR007W  Ratio above background 2.884241667 2.621442  Standard Deviation ± 0.810697 ± 0.528578  p-value 0.017235041 0.003016929  SPT3 YER004W  YDR392W YER004W  2.351997333 2.248904  ± 0.714284 ± 0.468281  0.048982443 0.010612262  CIS1  YDR022C  1.846820667  ± 0.250445  0.003441325  TOM5 YGL152C  YPR133W-A YGL152C  1.746660667 1.735899  ± 0.085004 ± 0.255116  5.8463E-12 0.013270446  APM1 ISU2 YJR030C YAP7 RCE1 RIT1 ROD1  YPL259C YOR226C YJR030C YOL028C YMR274C YMR283C YOR018W  1.633821 1.629425 1.579406 1.913483333 1.900415333 2.287966667 2.023172333  ± 0.128945 ± 0.074595 ± 0.051141 ± 0.552570 ± 0.668476 ± 0.794785 ± 0.939081  0.000160931 3.66134E-10 5.95591E-16 0.089231678 0.137272246 0.079768792 0.181802133  KEL1 HTZ1 YOR139C YKL075C YIA6 RSC1  YHR158C YOL012C YOR139C YKL075C YIL006W YGR056W  1.723950333 2.111911333 3.343506667 2.371866333 2.022037667 1.978989667  ± 0.339991 ± 0.664830 ± 1.494872 ± 0.774513 ± 0.672625 ± 0.667040  0.051623979 0.078275137 0.072976629 0.060358616 0.102624894 0.112601965  HAP4  YKL109W  2.064200333  ± 0.725156  0.108766631  Descriptiona GTPase-activating protein (GAP) for Ypt6p Ethanolamine-phosphate cytidylyltransferase Subunit of the SAGA and SAGA-like transcriptional regulatory complexes Protein of unknown function Autophagy-specific protein required for autophagosome formation Component of the TOM (translocase of outer membrane) complex Dubious open reading frame unlikely to encode a protein Mu1-like medium subunit of the clathrin-associated protein complex (AP-1) Protein required for synthesis of iron-sulfur proteins Putative protein of unknown function Putative basic leucine zipper (bZIP) transcription factor Type II CAAX prenyl protease 2'-O-ribosyl phosphate transferase Membrane protein, binds the ubiquitin ligase Rsp5p Protein required for proper cell fusion and cell morphology; functions negatively regulate mitotic exit Histone variant H2AZ Dubious open reading frame unlikely to encode a protein Putative protein of unknown function Mitochondrial NAD+ transporter Component of the RSC chromatin remodeling complex Subunit of the heme-activated, glucose-repressed Hap2p/3p/4p/5p CCAAT-binding complex 62  Table 2-5. SR hits for esp1-1 (continued) Gene Systematic Ratio above Standard Name Name background Deviation p-value Descriptiona RPB4 YJL140W 2.680497333 ± 1.138821 0.092358777 RNA polymerase II subunit B32 MPD2 YOL088C 1.837100333 ± 0.631344 0.145339002 Member of the protein disulfide isomerase (PDI) family YGL235W YGL235W 2.197648 ± 0.770046 0.091015434 Putative protein of unknown function YJR146W YJR146W 2.430699333 ± 1.127255 0.131702287 Protein of unknown function a adapted from Saccharomyces genome database (SGD- www.yeastgenome.org)  63  Table 2-6. Strains used in this chapter Strain Y7092  Genotype Mat α can1∆::STE2pr-Sp_his5 lyp1∆ his3∆1 leu2∆0 ura3∆0 met15∆0 YKH64/65 Mat α can1∆::STE2pr-Sp_his5 lyp1∆ his3∆1 leu2∆0 ura3∆0 met15∆0 esp1-1::NATMX4 YKH60 Mat a ura3-52 lys2-801_amber ade2-101 trp1-Δ63 his3Δ200 leu2-Δ1 esp1-1::URA3 YKH519 Mat α ura3-52 lys2-801_amber ade2-101 trp1-Δ63 his3Δ200 leu2-Δ1 lrs4∆::KanMX6  Source (Tong and Boone, 2006) This study This study This study  64  A.  B.  65  C.  + Enzyme  Viable Overexpressed Substrate  +  Substrate  Viable  Mutant Dead  + Mutant  Overexpressed Substrate  Figure 2-1. Genetic interactions reveal functional relationships (A and B) Proteins functioning in parallel pathways (A1, A2, A3 in pathway A; B1, B2, B3 in pathway B) contributing to an essential biological function can have “between pathway” SL interactions (denoted by lines), as impinging on both pathways simultaneously (through gene mutation) is lethal to the cell. Essential proteins (C1, C2) functioning within the same pathway can also be SL, as mutating two genes encoding proteins that function within the same complex can result in lethality whereas mutating each individually would not. Cited from (Boone et al., 2007). Reprinted with permission © Nature Publishing Group. (C) Overexpressing a substrate in a strain carrying a mutation in the substrate’s enzyme can lead to SDL relationships - especially if the enzyme-substrate interaction (such as cleavage) is critical for cell function  66  67  Figure 2-2. Analysis of the SGA esp1-1 allele (A)  Sequence analysis of the esp1-1 allele (Query) revealed a point mutation at bp 4211  (highlighted by the black box) when compared to the ESP1 ORF (Sbjct). This caused a proline to leucine mutation within the catalytic domain at residue 1404. To illustrate the placement of this mutation in context, the esp1-1 ORF is shown as a rectangle, with the Cterminal proteolytic “separase” domain represented as a gradient filled box and the leucine (L) point mutation at residue 1404 highlighted. The locations of the critical catalytic histidine and cysteine residues (amino acid 1505 and 1531 respectively) are also indicated. (B) esp1-1 temperature sensitivity analysis by spot dilution assay on YPD at 25˚C, 30˚C, 33˚C and 35˚C. (C) Cell viability was assessed by spot dilution assay for cells grown for 0, 2 and 4 hours at 35˚C. (D) pGAL1/10-GST-SLK19 was overexpressed at 35˚C for one hour in WT and esp1-1 strains and immunoblotted against GST. A band corresponding to the Slk19 cleavage product is denoted by *. Molecular weight bands are indicated on the left. A line between lanes indicates that, although samples were run on the same gel, they were not run side by side.  68  A. PD  NPD  T  esp1-1 B. PD  NPD  T  esp1-1  Figure 2-3. Confirmation of SL hits SL hits were confirmed using tetrad analysis. Two representative examples are shown here. (A) hsc82Δ is known to be SL with esp1-1 and was identified in the SGA screen. (B) kar3Δ is a novel SL hit identified from the SGA screen. PD - parental ditype; NPD - non parental ditype; T – tetratype  69  Dextrose  Galactose  Dextrose  Galactose  Wild Type esp1-1 Gal-GST-ACO1  Gal-GST-GAR1 Wild Type  Gal-GST-ADE6  esp1-1  Gal-GST-GSP2  Wild Type esp1-1 Gal-GST-CDC6  Gal-GST-GZF3 Wild Type esp1-1  Gal-GST-CIK1  Gal-GST-HRP1 Wild Type  Gal-GST-COP1  esp1-1  Gal-GST-MNN4  Wild Type Gal-GST-CYM1  esp1-1  Gal-GST-MYO2  Wild Type Gal-GST-DHH1  esp1-1  Gal-GST-PAN2  Wild Type Gal-GST-DOT1  esp1-1  Gal-GST-PAT1  Wild Type esp1-1 Gal-GST-PDR1  Gal-GST-DTR1 Wild Type esp1-1 Gal-GST-EBS1  Gal-GST-PEX19 Wild Type esp1-1  Gal-GST-ECM10  Gal-GST-PEX8 Wild Type esp1-1  Gal-GST-EFT2  Gal-GST-PRD1  70  Dextrose  Galactose  Dextrose  Galactose  Wild Type esp1-1 Gal-GST-RAD27  Gal-GST-TPN1 Wild Type  Gal-GST-RAD53  esp1-1  Gal-GST-TPS3  Wild Type esp1-1 Gal-GST-REG1  Gal-GST-UBP12 Wild Type esp1-1  Gal-GST-RSC30  Gal-GST-YDR374C Wild Type esp1-1  Gal-GST-SCD6  Gal-GST-YIR007W Wild Type  Gal-GST-SGS1  esp1-1  Gal-GST-YMR259C  Wild Type Gal-GST-SIP4  esp1-1  Gal-GST-YPK1  Wild Type Gal-GST-SLK19  esp1-1  Gal-GST-YPR174C  Wild Type esp1-1 Gal-GST-SPT10  Figure 2-4. Confirmation of esp1-1  Wild Type SDL hits Gal-GST-SPT23  esp1-1 Wild Type  Gal-GST-STE4  esp1-1  Plasmids of interest were transformed into both WT and esp1-1 strains. Logarithmically growing cells were serially diluted and plated onto dextrose  Wild Type (control) or galactose containing media Gal-GST-TOF2  esp1-1  71  Transcription from an RNAPII promoter RNA Catabolic Process  Regulation of Translation  Carbohydrate Metabolic Process  DNA Repair  Other Nuclear Transport  Cell Cycle Protein Folding Unknown  Figure 2-5. GO analysis of confirmed esp1-1 SL and SDL genetic interactions Genes identified in the esp1-1 SL and SDL screens were categorized according to biological process using Saccharomyces Genome Database GO Slim Mapper. Enriched GO categories as well as unknown genes are highlighted; genes belonging to biological processes that were not enriched are presented as “Other”. SL hits are represented by italics; SDL hits are indicated with uppercase letters.  72  Figure 2-6. Comparison of esp1-1’s SL profile esp1-1’s SL hits were compared to the SL hits of other mutants that have been screened by Dr. Charlie Boone’s lab (Costanzo et al., 2010). Shown on the X axis are strains that shared a significant correlation with the esp1-1 SL profile, with Pearson coefficient on the Y-axis. Gene name alone indicates a deletion mutant. Analysis was performed by Anastasia Baryshnikova and Michael Costanzo.  73  PD  NPD  T  esp1-1 Figure 2-7. lrs4∆ is SL with esp1-1 Tetrad analysis from lrs4∆ esp1-1 heterozygotes. PD= parental ditype, NPD=non parental ditype, T=tetratype.  74  A.  100  55 35  35  70  GST-ECM10  GST-PRD1  55  GST-SLK19  70  100  100 70  55  35  W ild  100  1 es p1 -  Ty pe  -1  es p1  W ild  Ty p  e  B.  100  70 70 55  55  *  35  GST-SLK19  35  GST-RAD27  Figure 2-8. Assaying for an esp1-1 substrate (A) pGAL1/10-GST-ORFX plasmids were overexpressed in WT cells and immunoblotted for the GST fusions. GST-PRD1 is shown as a representative candidate that did not show cleavage products while GST-ECM10 is an example of one that was tested in both WT and esp1-1 strains. (B) pGAL1/10-GST-ORFX was overexpressed in both WT and esp1-1 at a non-permissive temperature (35˚C) for one hour. Banding patterns of GST-immunoblots were compared between the two strains. GST-SLK19, a known Esp1 substrate, is shown as a proof of principle for the assay. A band corresponding to the Slk19 cleavage product is denoted by *. Molecular weight bands are indicated on the left. A line between lanes indicates that, although samples were run on the same gel, they were not run side by side. 75  Glucose  Galactose  EV Ty4RT/RH Glucose  Galactose  EV Ty4RT/RH  Figure 2-9. Rescue of esp1-1 lethality by a overeexpression of a truncated Ty4 element An esp1-1 strain carrying either the pGAL1/10-GST (EV) or pGAL1/10-TY4-RT/RH were serially diluted and spotted onto media carrying 2% glucose (control) or 2% galactose (to overexpress the plasmid). Plates were then allowed to incubate at either 25˚C or 32˚C.  76  Chapter 3: The budding yeast separase, Esp1, regulates Ty1 retrotransposition 3.1  Introduction Retroviruses such as Human Immunodeficiency Virus and Human T-cell  Lymphotrophic Virus-1 are characterized by their capacity to self-propagate via an RNA intermediate (Barre-Sinoussi et al., 1983; Gallo, 1985; Poiesz et al., 1980; Poiesz et al., 1981). Similarly, eukaryotic retroelements encode the necessary factors for RNA-mediated mobility, though they lack an extracellular infectious stage (Boeke et al., 1985; Boeke and Sandmeyer, 1991). In S. cerevisiae, there are five families of retrotransposons known broadly as Ty elements (Ty1-5) (Figure 3-1). Most belong to the copia (Pseudoviridae) class of Ty elements (Ty1,2,4,5), but Ty3 is a member of the gypsy (Metaviridae) family [reviewed in: (Beauregard et al., 2008; Lesage and Todeschini, 2005)] (Figure 3-1). Ty retrotransposons are approximately 5.5-6 kb in size and are comprised of both a TYA and TYB sequence - analogous to retroviral gag and pol respectively - that are flanked by long terminal repeats. The TYA gene product is the structural protein that forms the virus like particles (VLPs), while TYB encodes a polyprotein, which is processed into the factors necessary for transposon mobility, namely a protease (PR), integrase (IN) and reverse transcriptase (RT) (Beauregard et al., 2008; Boeke and Sandmeyer, 1991; Lesage and Todeschini, 2005). The TYA-TYB mRNA transcript produces two proteins corresponding to either TyA alone or a TyA-TyB fusion product whose formation is dictated by a translational frameshifting event (Belcourt and Farabaugh, 1990; Clare and Farabaugh, 1985; Mellor et al., 1985; Wilson et al., 1986). Both the TyA and TyA-TyB fusion product are subsequently processed by the PR into the mature forms of their individual elements (VLPs, IN, RT, PR) 77  which are then capable of supporting successful Ty retrotransposition (Garfinkel et al., 1991; Merkulov et al., 1996; Youngren et al., 1988a). Together, Ty elements represent 3.1% of the S. cerevisiae genome, with the highest proportion of elements located on chromosome III. The Ty1 and Ty2 families of retrotransposons are by far the most abundant, with 32 and 13 full-length sequences in the genome respectively; by contrast, Ty3-5 have a total of five full-length elements. Amid a 62% amino acid identity, Ty1 and Ty2 elements are considered highly similar, with distinguishing characteristics between the two families arising primarily from within the TYA sequence and an extremely variable region of TYB that corresponds to the carboxy terminus of IN (Kim et al., 1998). Curcio et al monitored spontaneous Ty insertions into a promotorless HIS3 gene and found that 95% of events corresponded to Ty1 elements, while the rest were Ty2 (Curcio et al., 1990). Based on the number of sequences found in the genome for each family, the efficiency of Ty1 transposition relative to that of Ty2 was unexpected. However, the rate was instead found to correlate with the comparative levels of each transcript in the cell, with the cell containing 20-fold more Ty1 than Ty2 RNA. Together, Ty1 and Ty2 are thought to account for 0.1%-0.8% of total RNA in the cell, or as much as half the polyadenylated RNA (Curcio et al., 1990; Elder et al., 1981). Despite the abundance of transcripts, endogenous Ty transposition remains a relatively rare event, occurring at an approximate rate of 10-5-10-7 elements/generation (Curcio and Garfinkel, 1991). The transposition events stimulated by Ty elements can influence genome organization, with increases in Ty transposition and subsequent homologous recombination capable of “scrambling the yeast genome” (Fink et al., 1986). For example, RNA-mediated  78  recombination resulting from TY1 element expression has specifically been reported as a factor in intron loss and pseudogene formation in S. cerevisiae (Derr and Strathern, 1993). Thus, to mitigate the chance of insertional events that would negatively affect cell viability, Ty elements are targeted to specific areas of the genome to avoid disrupting promoters or ORFs (Boeke and Devine, 1998). Both Ty1 and Ty3 elements favour insertion into sequences upstream of RNA polymerase III (RNAPIII) transcribed genes with Ty1 inserting within ~1kb upstream and Ty3 inserting 2bp upstream of the RNAPIII gene. Ty5 is targeted to transcriptionally silent areas of the genome such as the mating loci and telomeres (Chalker and Sandmeyer, 1992; Devine and Boeke, 1996; Zou et al., 1996). The TFIIIB and TFIIIC RNAPIII transcription factor subunits have been found to mediate Ty3 specificity while Sir3 and Sir4 are necessary for targeting Ty5 (Kirchner et al., 1995; Zhu et al., 1999). To better understand the Ty1 retrotransposition cycle, several genome-wide studies have been undertaken to identify genes capable of influencing the rate of Ty1 retrotransposition. These investigations included systematic screening of the yeast deletion mutant collection to identify genes that inhibit and promote Ty1 transposition, or using transposition-mediated mutagenesis to identify loss of function mutations which cause upregulation of Ty1 transposition (Griffith et al., 2003; Nyswaner et al., 2008; Scholes et al., 2001). Other studies used classical mutagenesis techniques to uncover genes that influence individual stages of the Ty1 retrotransposition cycle. For example, a screen for mutants able to restore expression of genes whose 5’ region had been interrupted by a Ty sequence identified suppressor of Ty (SPT) genes that regulate transcription of the TY1 element (Winston, 1992; Yamaguchi et al., 2001); a rare transfer RNA (tRNA) gene was found to modulate translational frameshifting (Kawakami et al., 1993; Xu and Boeke, 1990); mutation  79  of FUS3 caused destabilization of Ty1 VLPs (Conte et al., 1998); mutations in PMR1 dramatically decreased the rate of reverse transcription (Bolton et al., 2002; Yarrington et al., 2007); and, multiple genes have a role in complementary DNA (cDNA) conversion/stability (Lee et al., 1998; Liebman and Newnam, 1993; Rattray et al., 2000). Genes that influence chromatin structure have also been shown to influence Ty1 target site distribution (Bachman et al., 2005; Gelbart et al., 2005; Mou et al., 2006). However, the method by which TY1 cDNA is recruited to hotpots of chromosomal integration has not yet been fully elucidated. Genetic interaction data of the esp1-1 budding yeast separase mutant suggested Esp1 might be involved in Ty retrotransposition (Chapter 2 of this dissertation). In this chapter, I present physical interaction data and analysis of Ty1 retrotransposition in esp1-1 and cohesin mutants, which suggest that Esp1 and cohesin have a previously unanticipated role in mediating transposition by interacting with Ty1 integrase.  3.2 3.2.1  Results esp1-1 genetic interactors are involved in the life cycle of Ty1 retrotransposons The retrotransposition cycle of Ty1 elements can be described in the following steps  (A) transcription of the TY1 element by RNAPII (B) nuclear export of the TY1 mRNA (C) translation of TY1 mRNA (D) assembly and maturation of the VLP (E) reverse transcription of the TY1 mRNA to cDNA (F) import into the nucleus and (G) integration of the TY1 cDNA into the genome (Beauregard et al., 2008). A closer examination of the host S. cerevisiae genes required for individual steps of the Ty1 life cycle revealed that many of the esp1-1 genetic interactors involved in RNA/DNA metabolism either promote or impede the Ty1 life cycle (Figure 3-2). Genome-  80  wide studies have implicated the P-body proteins Pat1, Dhh1 and Lsm1-7 in Ty1 retrotransposition as enhancers of the formation of retrotransposition-competent Ty1 VLPs (Beckham and Parker, 2008; Checkley et al., 2010; Griffith et al., 2003). Pat1 and Dhh1 were identified in the esp1-1 SDL screen whereas lsm1∆ and lsm7∆ were identified in the esp1-1 SL screen (Figure 2-5, Tables 2-1 and 2-2). The RecQ helicase Sgs1, which is SDS when overexpressed in esp1-1 cells, is likely involved in the suppression of TY1 cDNA recombination. Strains lacking SGS1 transpose heterogeneous Ty1 multimers/tandem arrays, which effectively increase the number of TY1 cDNAs per transposition event (Bryk et al., 2001; Nyswaner et al., 2008) (Figure 2-5, Table 2-1). The Fen-1 nuclease Rad27, which is also SDS when overexpressed in esp1-1 cells, is thought to degrade TY1 cDNA to prevent the formation of Ty1 multimers (Nyswaner et al., 2008; Sundararajan et al., 2003) (Figure 2-5, Table 2-2). Further, members of the Paf1C restrict Ty1 transposition, possibly posttranscriptionally or by limiting the amount of favourable hotspots for integration (Nyswaner et al., 2008). Deletion mutants of three members of the Paf1C - cdc73∆, leo1∆ and rtf1∆ are SL when combined with esp1-1 (Figure 2-5, Table 2-1). Finally, two esp1-1 SDL hits are SPT genes (Figure 2-5, Table 2-2). Either mutation (SPT10) or multicopy expression (SPT23) of these loci confers suppression of Ty1 insertion mutations (Burkett and Garfinkel, 1994; Fassler and Winston, 1988). Clearly, several genetic interactors of esp1-1 have important roles in promoting or impeding successful Ty1 transposition.  81  3.2.2  Mass spectrometry reveals a physical interaction between Esp1 and Ty1  proteins To corroborate the genetic interaction data, and better understand its functional significance, a search for physical interactors of Esp1 was also undertaken. Nancy Fang, a Ph.D. student in Dr. Thibault Mayor’s laboratory at the University of British Columbia, performed an immunoprecipitation (IP) of 13Myc-tagged Esp1 and an untagged strain (mock IP). The total number of peptides IP’d from the Esp1-13Myc strain was then compared to the mock, and we found 152 proteins that co-purify with Esp1 but were not enriched in mock experiments (Table 3-1). Among the physical interactors identified was the known separase inhibitor, Pds1 (Ciosk et al., 1998). Other proteins known to associate with Esp1 (Scc1, Slk19, Cdc55 and Zds1 as examples) may have been missed due to the transient nature or cell cycle specificity of these interactions (Queralt et al., 2006; Queralt and Uhlmann, 2008b; Sullivan et al., 2001; Sullivan and Uhlmann, 2003; Uhlmann et al., 2000). In addition to the Esp1 co-purifying proteins, a more than five-fold increase of spectral counts for Ty1 peptides corresponding to Ty1-IN and Ty1-RT was observed (Figure 3-3A). In comparison, peptides from the Ty1 coat protein and protease were readily identified in both the mock and Esp1 IPs, suggesting these Ty1 proteins may not specifically interact with Esp1. I confirmed the physical interaction of Esp1 with Ty1 proteins by independent co-IP experiments. The VLP can be detected at endogenous levels. However, using current methods, the TyB polypeptides cannot and must be overexpressed (Curcio and Garfinkel, 1992). Therefore, I induced pGTy1-H3, a Ty1 expression plasmid under control of the GAL1 promoter, in galactose media in both an untagged control strain and the Esp1-13Myc strain. Esp1-13Myc was purified, immunoblot analysis was performed and probed for the presence 82  of VLP, IN and RT (Figure 3-3B). I found that IN was specifically present in the Esp113Myc IP but not in the purification from the untagged strain. VLP was also identified in the Esp1-13Myc IP, however high background levels of VLP were detected in the untagged strain IP suggesting that this interaction was not specific. A very faint band corresponding to the RT in the Esp1-13Myc purification was also detected but the level was so low that it was difficult to determine that the RT was not present in the untagged control strain. Both the mass spectrometry and co-IP data suggested that Esp1 specifically interacts with Ty1 IN and possibly– to a lesser extent – the RT. Esp1 interacts with securin immediately after PDS1 expression in S phase until Pds1 is degraded in metaphase, whereby Esp1 is released to cleave the Scc1 cohesin (Jensen et al., 2001; Uhlmann et al., 1999; Uhlmann et al., 2000). I was therefore interested in testing whether Pds1 and Scc1 could also physically interact with Ty1 polypeptides. 13Myc-tagged Pds1 and Scc1 were IP’d individually from yeast lysates and immunoblot analysis performed. Similar to the analysis with Esp1, I found that Pds1-13Myc and Scc1-13Myc specifically co-purified with Ty1-IN, and a very faint band was detected when I probed the IPs with anti-RT antibodies (Figure 3-3C). The VLP immunoblot had high levels of background in the untagged control strain, suggesting that this interaction is nonspecific. These results demonstrated that the interaction of Esp1 with Ty1 proteins may occur when Esp1 is in a complex with Pds1 and associated with Scc1.  3.2.3  esp1-1 has defects in Ty1 transposition The interaction of esp1-1 with a large number of genes involved in Ty1 transposition  along with mass spectrometry data suggested that Esp1 itself might have a role in Ty1 83  transposition. I employed a Ty1 transposition assay whereby Ty1 is overexpressed on a plasmid (pGAL1Ty1-H3mHIS3AI) carrying the HIS3 gene with an artificial intron (AI) effectively interrupting its expression. After induction of Ty1 expression on galactose media, the intron is removed from the Ty1-H3mHIS3A1 mRNA intermediate, and successful cDNA integration renders the strain HIS3+(Curcio and Garfinkel, 1991) (Figure 3-4A). To determine whether Esp1 has a role in Ty1 transposition, pGAL1Ty1-H3mHISA1 was transformed into WT, esp1-1 and spt10∆ strains. SPT10, which was identified in the esp1-1 SDL screen, is required for efficient Ty1 transposition and was used as a negative control (Griffith et al., 2003). After allowing strains to grow on dextrose plates, cells were replica plated to galactose media to induce transposition for two days. To simultaneously impinge on Esp1 function in an esp1-1 mutant, strains were first grown at a permissive temperature (25˚C) overnight before shifting to a semi-restrictive temperature of 30˚C for the remainder of the 48 hours. I chose these conditions as opposed to incubating immediately at 30˚C because increasing temperature results in a decrease in transposition efficiency (Lawler et al., 2002; Paquin and Williamson, 1984) (data not shown). Transposition at 25˚C was also used as a comparative control. After induction, strains were tested for successful transposition by plating on media lacking histidine (His). At the permissive temperature of 25˚C, esp1-1 was able to induce transposition, as shown by colony growth on SC-His plates (Figure 3-4B). However, when shifted to a semi-permissive temperature of 30˚C, only a few colonies from the esp1-1 strain were able to grow on SC-His media compared to a lawn of colonies in the WT strain. The esp1-1 strain grew on SC media demonstrating that the strain is still viable at 30˚C (Figure 33B). The transposition defect of the esp1-1 mutant was also more severe than that of the  84  spt10∆ mutant at 30˚C (Figure 3-4B). Therefore, Esp1 is required for efficient transposition of a Ty1 element. Because Ty1 IN and VLP interacted with Pds1 and Scc1 in addition to Esp1, I tested if Ty1 transposition was affected in strains carrying mutations in the corresponding genes. I found that both pds1-128 and scc1-73 mutants were able to grow on SC-His media after induction of Ty1 transposition suggesting that, unlike Esp1, Pds1 and Scc1 are not required for Ty1 transposition at 30˚C (Figure 3-4C). Since Esp1 is required to cleave Scc1 in anaphase, I also wondered if the Ty1 transposition defect in the esp1-1 mutant was due to the prolonged presence of cohesin. Therefore, an esp1-1 scc1-73 double mutant strain was created and I found that the esp1-1 transposition defect was rescued in the double mutant (Figure 3-4D).  3.2.4  esp1-1 does not fail to induce the pGAL1Ty1-H3mHIS3AI plasmid There are many reasons why a mutant of separase could affect the rate of Ty1  transposition. The first possibility investigated was that the failure of esp1-1 to transpose the Ty1-HIS3+ element could be explained by an inability to properly induce the pGAL1Ty1H3mHIS3AI plasmid. Thus, IN levels were assessed by Dr. Lina Ma (a research associate in the Measday laboratory) for WT and esp1-1 strains carrying pGAL1Ty1-H3mHIS3AI that had been grown in galactose media for a total of 24 hours. As endogenous levels of IN cannot be detected by current immunoblotting techniques, only strains that had successfully overexpressed pGAL1Ty1-H3mHIS3AI and processed the TyB polypeptide would have a band corresponding to IN when probed with the anti-IN 8B11 antibody (Curcio and Garfinkel, 1992; Eichinger and Boeke, 1990). Therefore, induction of the vector was  85  successful in an esp1-1 mutant, as a visible IN band was observed by western blotting (Figure 3-5). Lina also tested scc1-73 and the esp1-1 scc1-73 double mutants, and found that they too had the ability to induce the pGAL1Ty1-H3mHIS3AI plasmid. Evidently, the HIS3 auxotrophy observed in esp1-1 is not due to a failure to overexpress the TY1 element.  3.2.5  Endogenous levels of TY1 mRNA are not decreased in esp1-1 As a number of esp1-1 SL and SDL genetic interactors are genes involved in RNA  metabolism, I was curious to determine whether endogenous TY1 mRNA levels were affected in strains defective for separase activity. Thus, mRNA levels of TY1 were measured using quantitative PCR (qPCR). Though transposition efficiency decreases at higher temperatures, Lawler et al showed that this temperature sensitivity was due to a deficiency in the proteolysis of the Ty1 Pol polyprotein and not because of transcriptional or translational effects (Lawler et al., 2002; Paquin and Williamson, 1984). I was therefore able to assay expression levels of TY1 for WT and esp1-1 at both a permissive (25˚C) as well as a nonpermissive (35˚C) temperature. TY1 mRNA expression levels were modestly (two-fold) elevated in an esp1-1 mutant as compared to control at the permissive temperature. After a subsequent shift to 35˚C for two hours, both WT and esp1-1 TY1 mRNA levels were equivalently increased (one to two-fold) compared to mRNA levels at 25˚C (Figure 3-6A). There did not appear to be an observable temperature effect on TY1 expression levels that is specific to esp1-1. The increase in TY1 mRNA levels in esp1-1 is interesting and may be due to a role for Esp1 in RNA metabolism (see: Chapter 4). This qPCR analysis suggests that a decrease in Ty1 mRNA levels is not likely the cause for Ty1 transposition defects in the esp1-1 mutant.  86  3.2.6  Gag processing is intact in esp1-1 The protease known to be responsible for proteolytic processing of TyA-TyB is  encoded within the element itself. However, since Esp1 is also a protease, I was curious to determine whether Ty1 processing was affected in an esp1-1 mutant. To that end, endogenous levels of precursor (p49) and mature (p45) gag were examined in both a WT and esp1-1 strain by immunoblot. Gag production and processing are critical for both VLP maturation and reverse transcription and are thus considered a sensitive indicator of PR function (Adams et al., 1987; Checkley et al., 2010; Youngren et al., 1988b). Thus, I subjected both WT and esp1-1 to a semi-permissive temperature of 30˚C for six hours. At neither 25˚C nor 30˚C did esp1-1 accumulate greater amounts of precursor (p49) than WT, and both have a greater level of p45 when compared to p49 (Figure 3-6B). This is contrast to mutants defective in PR function such as P body mutants (dhh1∆, kem1∆, lsm1∆ and pat1∆) which showed ratios of p45/49 of ~0.8 (Checkley et al., 2010). As the protease deficiency of esp1-1 did not appear to impinge on proteolytic processing of the TyA-TyB polypeptide, proteolysis of TyA-TyB is not likely to be the cause of the esp1-1 transposition deficiency. This data is consistent with the fact that proteolytic sites within the TyA-TyB polypeptide do not match recognition motifs for separase, suggesting that Esp1 activity is unlikely to be involved in these events (Merkulov et al., 2001; Merkulov et al., 1996; Sullivan et al., 2004).  3.2.7  Several cohesin mutants also show defects in Ty1 transposition The failure of esp1-1 to successfully undergo Ty1 transposition could be a separase-  specific phenotype or perhaps indicative of a more general consequence of failure to properly regulate sister chromatid segregation. To distinguish between these two possibilities, I also  87  looked at Ty1 transposition in conditional alleles of the cohesin loader Scc2 (scc2-4) and a structural component of cohesin, Smc3 (smc3-1) (Figure 3-7). Using the same Ty1 transposition assay described in 3.2.3, pGAL1Ty1-H3mHIS3AI was overexpressed in both scc2-4 and smc3-1 and assayed for the ability to become HIS3+. Both scc2-4 and smc3-1 were able to grow on media lacking histidine at 25˚C, but continued to be auxotrophic for HIS3 when shifted to a semi-restrictive temperature. As scc2-4 and smc3-1 both display premature sister chromatid segregation phenotypes, their failure to undergo Ty1 transposition would imply that cohesin-loading and a competent cohesin ring hinge domain are critical for retrotransposition to occur.  3.3  Discussion In assessing the genetic interactome of esp1-1 (see: Chapter 2), I was surprised to find  that although genes with a cell cycle function were uncovered in the esp1-1 SL and SDL screens, a number of genes identified in the screens have roles in other biological processes. Indeed, using mass spectrometry analysis, we made the unexpected discovery that Esp1 interacts with peptides encoded by the Ty1 retrotransposon. I confirmed that Esp1, its inhibitor Pds1 and its substrate Scc1 all interacted with the Ty1-IN. Moreover, esp1-1 mutants were unable to carry out Ty1 transposition and this defect was partially rescued by scc1-73.  88  3.3.1  Screening for genetic and physical interactions point to a potential role for Esp1  in Ty1 retrotransposition The esp1-1 genetic screens revealed that RNA metabolic processes are critical to esp1-1 viability (Figure 2-5). As well, a prominent number of genes identified in our esp1-1 SL and SDL screens have a role in the life cycle of Ty1 retroelements (Figure 3-2). The potential significance of this result was underscored when mass spectrometry data and subsequent co-IP confirmation studies demonstrated that Esp1 physically interacted with the Ty1-IN protein (Figure 3-3). Note that in order to discount the possibility that these interactions are a result of the Myc epitope, an alternative Esp1 tag could be tested for co-IP with Ty1-IN, or an unrelated protein C-terminally tagged with Myc. I do not yet know if defects in Ty1 transposition are responsible for the cell lethality upon overexpression of genes such as Pat1 and Dhh1 in the esp1-1 mutant. The esp1-1 SDL screen was performed at 25˚C where Ty1 transposition still occurs. The SDL phenotype could be due to mistargeting of Ty1 elements into essential genes or in their regulatory regions. Alternatively, errors in Ty1 element insertion may affect chromatin structure, which in combination with the defect in sister chromatid separation, is lethal. Instead, Esp1 may have a novel role in regulating transcription and/or translation, which is discussed further in Chapter 4.  3.3.2  Assaying for Ty1 transposition in conditional alleles The Ty1-H3mHIS3AI element has provided researchers with an efficient mechanism  of quantifying Ty1 transposition – a tool that has proven useful in both large-scale and lowthroughput studies. However, because of the temperature sensitive nature of  89  retrotransposition, essential genes have not to my knowledge been previously tested to determine the effect their disruption may have on the rate of retrotransposition. In these studies, I used a modification of the conventional plasmid based assay that allowed sufficient transposition to occur in WT cells at a higher temperature while providing a mechanism for testing conditional alleles. Using this technique, esp1-1 was shown to have defects in retrotransposition (Figure 3-4B). I do not believe the transposition defect in esp1-1 was a consequence of temperature sensitivity, as other conditional mutants (pds1-128, scc1-73) did not display similar decreases in Ty1 transposition (Figure 3-4C). Further evidence to this effect was demonstrated by the ability of scc1-73 to restore Ty1 retrotransposition in esp1-1 without substantial rescue of the temperature sensitivity (Figure 3-4D; data not shown). Thus, a modified Ty1-H3mHIS3AI assay using esp1-1 served as a proof of principle for a screen able to monitor Ty1 transposition in conditional alleles, while also suggesting Esp1 has a role in the stimulation of Ty1 retrotransposition events. That said, it does remain possible that reversion of the his3∆1 auxotrophy could be accounted for by gene conversion rather than transposition, and it is this process that is affected in the mutant strains tested. To investigate this possibility, a Southern blot analysis could be used to determine the frequency of the his3∆1 gene conversion, or the assay could be performed in a strain with the HIS3 allele completely deleted.  3.3.3  Esp1 has a role in promoting the integration of Ty1 cDNA during  retrotransposition Though Ty1 integration occurs through IN-mediated mechanisms, TY1 cDNA is also capable of inserting itself through homologous recombination – a process that is dependent  90  on the RAD52 DNA recombination/repair gene (Melamed et al., 1992; Resnick, 1975; Sharon et al., 1994). I have been unable to determine whether Esp1 contributes to recombination mediated integration, as esp1-1 rad52∆ haploid double mutants were unable to germinate - an SL relationship that is likely a consequence of an increase in DNA damage induced by esp1-1 lethality in combination with defects in DNA repair (Mendoza et al., 2009; Paques and Haber, 1999; Symington, 2002) (data not shown). However, further investigation into the relationship of Esp1 and IN indicated that an involvement for Esp1 in homologous recombination events is unlikely. A few aspects of the data suggest that Esp1 may more specifically have a role in TY1 cDNA integration into the genome and not in another part of the Ty1 life cycle. First, endogenous TY1 mRNA levels were not substantially decreased in an esp1-1 mutant; indeed, TY1 mRNA levels may in fact be slightly elevated (Figure 3-5A). Second, the ratio of endogenous Ty1 gag mature and precursor protein levels were not noticeably different in an esp1-1 strain, demonstrating that Esp1 did not affect proteolytic processing of the Ty1 polypeptide (Figure 3-5B). Third, our lab has also examined the TY1 cDNA profile of both WT and esp1-1 strains by Southern blot (data not shown), and we did not observe any change in the levels of TY1 cDNA in separase mutants, suggesting that Esp1 is unlikely to affect transposition at the level of reverse transcription. This assay also indicates that the esp1-1 transposition defect is not due to a failure to splice out the AI, as there was no detectable size difference between the WT and esp1-1 TY1 cDNA bands (data not shown).  Finally, Esp1  directly interacted with Ty1-IN - implicating Esp1 in targeting of TY1 cDNA into the genome (Figure 3-3B).  91  Following reverse transcription, TY1 cDNA and IN are transported into the nucleus as components of a pre-integration complex (PIC) that has not been well defined, though it is known that a nuclear localization sequence within Ty1-IN mediates its entry into the nucleus (Kenna et al., 1998; Moore et al., 1998). The process of integration suggests two possible mechanisms of action for Esp1, which are not necessarily mutually exclusive: (1) Esp1 is required for effective PIC entry into the nucleus, and (2) Esp1 is responsible for targeting of the PIC to hotspots of Ty1 integration. Esp1 is initially expressed in the cytoplasm until S phase where Pds1 is expressed and the Esp1-Pds1 complex is transported into the nucleus (Jensen et al., 2001). In strains lacking Pds1, Esp1 no longer localizes to the nucleus suggesting that the nuclear transport machinery recognizes the Esp1-Pds1 complex, and not Esp1 alone (Jensen et al., 2001). Though I have not ruled out the possibility that the Esp1Pds1 complex functions to promote entry of the PIC into the nucleus, successful Ty1 transposition in a pds1-128 strain would suggest that this is not the case. pds1-128 strains have been shown to decrease the efficiency of the nuclear import of Esp1, thus if the function of Esp1 in mediating Ty1 transposition was strictly to aid nuclear import, I would expect pds1-128 strains to exhibit a similar transposition defect (Jensen et al., 2001).  3.3.4 3.3.4.1  Esp1 may be responsible for targeting the PIC to hotspots of Ty1 integration A model for PIC recruitment to hotspots of transposition In S phase, cohesin loads on chromosomes at sites defined by the Scc2/4 cohesin  loading complex after which it moves to sites of convergent transcription (Ciosk et al., 2000; Lengronne et al., 2004). The sites of cohesin loading correlate with tRNA sites and other genes transcribed by RNAPIII (D'Ambrosio et al., 2008). Notably, Ty1 elements  92  preferentially integrate upstream of genes transcribed by RNAPIII, such as tRNA genes, in a loosely defined window ranging from about 80 to several hundred base pairs (Devine and Boeke, 1996; Hani and Feldmann, 1998; Ji et al., 1993; Kim et al., 1998). This hallmark specificity of target integration events is by design to avert catastrophic insertion events – e.g. interruption of an essential genes (Boeke and Devine, 1998). I therefore propose a model whereby an Esp1-Pds1-Scc1-IN complex may form shortly after cohesin has loaded during S phase, thereby targeting the PIC to preferred sites of integration. I further speculate that upon targeting, cohesin must subsequently move away from sites of insertion or be removed altogether for IN-mediated Ty1 integration to occur (Figure 3-8).  3.3.4.2  Evidence for an Esp1/cohesin mediated recruitment of PIC to hotpots of  integration Evidence for an Esp1-Pds1-Scc1-IN complex formation for recruitment came from co-IP experiments demonstrating that each are capable of physically interacting with Ty1 IN (Figure 3-3). However, as both pds1-128 and scc1-73 mutants did not show a transposition defect, it appears that the Esp1-IN interaction is critical for recruitment of the PIC complex (Figure 3-4). Ty1 transposition defects in a conditional mutant of the Scc2 loader then further suggested that the timing of a cohesin-Esp1-PIC complex formation might be limited to S phase (Figure 3-7). S phase is the perfect window of opportunity for successful integration, as chromosomes are in a decondensed state, providing the integration machinery with unimpeded access to the genome. Although the failure of smc3-1 mutants to undergo successful transposition is also consistent with this model, mutation of the Scc1 kleisin subunit would at first glance appear  93  to contradict it (Figure 3-4, 3-7). However, the scc1-73 mutant supporting Ty1 transposition may still be consistent with the model that cohesin-Esp1 recruits the PIC. Although scc1-73 interferes with the interaction of Scc1 with the Smc1/3 heterodimer, the possibility exists that scc1-73 mutants attempt loading of the Smc1/3 cohesin proteins, which would then fail to securely entrap sister chromatids due to the absence of a functional Scc1 (Haering et al., 2004). If this is the case, Esp1 may be able to recruit the PIC by interacting with either the cohesin loader or Smc1/3 heterodimer – a physical interaction that I have not yet tested. Thus, the successful Ty1 transposition in the scc1-73 mutant does not necessarily preclude recruitment of the PIC to hotspots of integration by an Esp1-cohesin complex. In addition, the scc1-73 mutant, also known as mcd1-1, is known to have sharp change in viability at its restrictive temperature. Increasing the temperature to 30˚C may have been enough to rescue the Ty1 transposition defect of the esp1-1 allele, but not enough to impinge on a potential role for Scc1 in transposition [(Guacci et al., 1997) B. Lavoie, personal communication]. Further investigation into the phenotype of the scc1-73/mcd1-1 allele at 30˚C and perhaps using an integrated Ty1-mHIS3AI element to quantify the rate of transposition for this mutant may resolve some of these questions.  3.3.4.3  Removal or translocation of cohesin may be necessary for successful  integration The impact that regulation of chromatin structure has on IN-mediated Ty1 integration was demonstrated when a member of the yeast ISW1 remodeling complex, Isw2, was shown to be recruited to tRNA gene sites by RNAPIII transcription. Mutants of ISW2 were subsequently shown to disrupt the prototypical 80bp periodicity of Ty1 target sites  94  though actual recruitment to the tRNA gene target sites was not affected (Bachman et al., 2005; Gelbart et al., 2005). Interestingly, human ISW1 complexes have also been associated with the loading of cohesin proteins (Hakimi et al., 2002). The impact of nucleosome positioning on Ty1 element integration events reflects the importance of local chromatin structure on integration events. Thus, just as cohesin translocation is necessary to allow the transcriptional machinery access to transcribed genes, once recruited, Ty1 IN may also require that chromatin be unhindered by cohesin for successful integration to occur (Lengronne et al., 2004). This step would either likely occur through cohesin translocation or its local removal. scc2-4 mutants are known to support initial loading events, though cohesin is then unable to move from sites of loading (Lengronne et al., 2004). Thus, the transposition defects are likely not a result of failure to recruit the Esp1-PIC complex to hotspots of transposition, but likely because cohesin fails to move from them. Loading of cohesin onto DNA is thought to occur by ATP hydrolysis of the Smc head domains which disassociates them from the Scc1 kleisin, creating a gateway for DNA to pass through (Arumugam et al., 2003). Likewise, ATP hydrolysis is necessary for translocation of cohesin from its initial loading sites (Hu et al., 2011). It would therefore be of interest to determine whether ATP hydrolysis is necessary for Ty1 transposition. The rescue of the esp1-1 transposition defect by scc1-73 suggests that disruption of cohesin from sister chromatids is capable of rescuing the transposition defect of esp1-1. Whether cohesin is capable of translocation in an esp1-1 mutant has still yet to be determined. Another possibility is that cohesin needs to be locally removed for IN to gain access to chromatin – a process that would be dependent on the protease activity of Esp1.  95  Studies in both fission and budding yeast have shown that separase is required for the local removal of cohesin during DNA double-strand break repair, therefore precedence exists for non-mitotic separase activity (McAleenan et al., 2013; Nagao et al., 2004). The loading of cohesin at tRNA genes and the interaction of Ty1-IN with Esp1-Pds1 and Scc1 suggest a means for how Ty1 elements propagate themselves without damage to the host genome. Ty1-IN may hitch a ride with the cohesin loading machinery to insert Ty1-cDNA into regions of active transcription at the same time that cohesin is loaded onto chromatin.  3.4 3.4.1  Materials and methods Yeast strains and growth conditions All strains for this chapter are listed in Table 3-2. Strains were grown in either rich  (YPD) or minimal (SC) media and were incubated at 25˚C unless otherwise indicated. Standard protocols for yeast culture and transformation were followed (Guthrie and Fink, 2004). Strains were C-terminally tagged with 13Myc using a PCR-based homologous recombination method (Longtine et al., 1998). To assess endogenous expression of TY1, WT and esp1-1 were grown to log phase in YPD, spun down and resuspended in prewarmed YPD before being shifted to 35˚C for two hours. 2mL of cells were harvested for qPCR analysis. Endogenous gag processing was also examined in WT and esp1-1; cells were grown to log phase and shifted to 30˚C for six hours. 10-25mL of cells was pelleted for western blot analysis (western blot sample preparation, see: section 2.4.4). To ensure proper expression of the pGAL-Ty1H3-mHIS3AI plasmid in WT, esp1-1::NAT, scc1-73::KanMX6 and the esp1-1::NAT scc1-73::KanMX6 double mutant, strains transformed with the vector were grown in SC-URA + 2% raffinose + 0.1%  96  dextrose overnight to log phase. Switching of carbon sources to 2% galactose induced expression of the plasmid, and samples for western blot analysis were taken after 24 hours (western blot sample preparation, see: section 2.4.4).  3.4.2 3.4.2.1  Affinity mass spectrometry Affinity IP and mass spectrometry Esp1 was IP’d using a one-step Myc-tag approach based on Field et al (Field et al.,  1988). Briefly, 1L each of WT and ESP1-13Myc::KanMX6 strains were grown to an O.D.600 of ~0.9. Cells were lysed in 100mM Tris-HCl pH 7.5, 150mM NaCl, 0.1% Tween 20, 1% NP-40, 10% glycerol, 5mM EDTA, 1mM DTT, 1mM phenylmethylsulfonyl fluoride, 10mM chloroacetamide and a 1x protease inhibitor cocktail by glass bead beating. Lysates were cleared by centrifugation at 10,000 x g, 4˚C for 15 minutes. IPs were performed using a 9E10 anti-Myc antibody cross-linked to Sepharose (MMS-150P, Covance). 400µl beads (bed volume) were mixed with each lysate for four hours at 4˚C and washed five times in 100mM Tris-HCl pH 7.5, 500mM NaCl, 0.05% Tween 20, 0.5% NP-40, 10% glycerol, 5mM EDTA and 1mM DTT. Proteins were eluted twice with 200µL of SDS loading sample buffer without reducing agent prior to TCA precipitation. Proteins were then separated by SDSPAGE followed by in-gel digestion for mass spectrometry analysis. The protein gel was first incubated in fixation buffer (5% acetic acid, 47.5% methanol) with coomassie Blue G for 30 minutes following by a four hour wash in H2O. Gel pieces from each sample (Esp1-IP and control) were divided into five fractions: three fractions above 55 kDa; one fraction bellow 55 kDa without immunoglobulins; and one fraction containing the immunoglobulin G heavy chain and light chains (55kDa and 25kDa bands). In-gel trypsin digestion was based on  97  Shevchenko et al. with minor changes (Shevchenko et al., 2000). Digestion buffer contained 50mM ammonium bicarbonate, and gel pieces were dehydrated using ethanol. Gel pieces were incubated at 56˚C for 45 minutes in 10mM DTT followed by a 30-minute incubation in 55mM chloroacetamide at room temperature. Peptides were extracted once with 0.5% acetic acid, twice with 30% acetonitrile, 0.5% acetic acid and twice with 100% acetonitrile. Dried peptide-extraction samples were resuspended in 0.5% acetic acid solution and acetified to a pH below 2 using 100% acetic acid. Peptide samples were then purified by solid phase extraction on C-18 stage tips (Ishihama et al., 2006; Rappsilber et al., 2003; Rappsilber et al., 2007). Purified peptides were analyzed using a linear-trapping quadrupole - Orbitrap mass spectrometer (LTQ-Orbitrap Velos; ThermoFisher Scientific) coupled to an Agilent 1200 Series high-performance liquid chromatography using a nanospray ionization source that included a 100-µm-inner diameter fused silica trap column packed with 5 µm-diameter Aqua C-18 beads (Phenomenex, www.phenomenex.com), 50-µm-inner diameter fused silica fritted analytical column packed with 3 µm-diameter Reprosil-Pur C-18-AQ beads (Dr. Maisch, www.Dr-Maisch.com) and a 20-µm-inner diameter fused silica gold coated spray tip. Fractions from each sample were run at a 60-minute high-performance liquid chromatography gradient from 0.5% acetic acid to 0.5% acetic acid and 26% acetonitrile). The LTQ-Orbitrap was set to acquire a full-range scan at 60,000 resolution from 350 to 1600 Th in the Orbitrap and to simultaneously fragment the top ten peptide ions in each cycle in the LTQ (minimum intensity 1000 counts). Singly charged ions were excluded and parent ions were then excluded from MS/MS for the next 30 sec. The Orbitrap was continuously recalibrated using lock-mass function (Olsen et al., 2005).  98  3.4.2.2  Analysis of mass spectrometry data Centroided fragment peak lists were processed with Proteome Discoverer v. 1.2  (ThermoFisher Scientific) followed by a Mascot analysis (2.3.0, Matrix Science) against a Saccharomyces cerevisiae protein database (www.yeastgenome.org; 05012010, 6147 protein sequences) with the following parameters: peptide mass accuracy 10 parts per million; fragment mass accuracy 0.6 Da; trypsin enzyme specificity; fixed modifications – carbamidomethyl; variable modifications - methionine oxidation, lysine acetylation, serine/threonine/tyrosine phosphorylation; ESI-TRAP fragment characteristics. Only those peptides with IonScores exceeding the individually calculated 99% confidence limit (false positive discovery rate <=1%) were considered as accurately identified.  3.4.3  Co-immunoprecipitation WT as well as epitope-tagged ESP1-13Myc::KanMX6, PDS1-13Myc::KanMX6 and  SCC1-13Myc::HIS3MX6 strains were transformed with pGAL-Ty1-H3 (pJEF724, generous gift from Jef Boeke) and were grown overnight to log phase in SC-URA + 2% raffinose + 0.1% dextrose. Cells were then diluted down to an O.D.600 <0.08, resuspended in SC-URA + 2% galactose to induce Ty1 expression for 24 hours. Cells were harvested, washed with ice cold H20 and resuspended in lysis buffer (50mM Tris-HCl pH 7.5, 10%NP-40, 350mM NaCl, 0.5mM EDTA, 1mM DTT and protease inhibitors) at 4˚C. Glass beads were added, and the suspension vortexed two minutes on, two minutes off at 4˚C until > 90% lysis was achieved. Lysates were centrifuged at 14 000 x g for ten minutes, and supernatant was kept as the WCL. Protein concentration was quantified using NanoDrop 1000. Equivalent amounts of protein were incubated with 20µL of a 1:1 Covance® 9E10 affinity matrix slurry  99  at 4˚C for 2.5 hours. Beads were then washed four times with wash buffer (lysis buffer without protease inhibitors), and finally resuspended in 40µL 2X SDS loading buffer containing 200mM β mercaptoethanol. Equal concentration of WCL, and equal amounts of IP were loaded for western blot analysis  3.4.4  Western blotting Samples were run on 8% or 10% SDS PAGE gels and transferred to polyvinylidene  difluoride. Membranes were probed with anti-c-Myc (1:5000, 9E10, Roche), anti-IN [1:1000, 8B11, J. Boeke (Eichinger and Boeke, 1990)], anti-VLP [1:10 000, J. Boeke (Youngren et al., 1988a)], or anti-RT (1:1000, J.Boeke). Blots were imaged with a ChemiDoc™ MP (Biorad).  3.4.5  Ty transposition assay The pGAL1-Ty1H3-mHIS3AI plasmid was generously provided by Jef Boeke (Curcio  and Garfinkel, 1991). Strains were transformed with pGAL1-TY1H3-mHIS3AI and first grown on SC-URA + 2% dextrose plates. After three days of growth, plates were then replicated to SC-URA + 2% galactose and grown for two days at either 25˚C (permissive temperature for esp1-1::NAT and scc1-73::KanMX6 strains) or 25˚C for 12-16 hours and then shifted to 30˚C (semi-restrictive temperature for esp1-1::NAT and scc1-73::KanMX6 strains). Subsequently, plates were replicated to YPD for one day and then SC and SChistidine media for two days.  100  3.4.6 3.4.6.1  Quantitative PCR analysis RNA preparation Samples were thawed on ice and subjected to a modified RNA extraction protocol to  extract total RNA (Rneasy Mini Kit, Qiagen). 100µL of buffer RLT with β-mercaptoethanol (10µL/mL) was added to pellets along with equivalent amount of glass beads. After vortexing samples twice for 45 seconds (4˚C), with five minutes on ice between cycles, an additional 260µL of buffer RLT + β-mercaptoethanol was added and samples mixed by inversion. Samples were then spun at 14 000 x g (4˚C) for two minutes. The resulting supernatant was mixed with 350µL of 70% ethanol and immediately placed on provided columns. Columns were then washed once with 700µL RWI buffer and twice with 500µL buffer RPE. For each wash, columns were spun at 10 000 x g for 15 seconds with the exception of the last wash, which was spun for two minutes. Residual ethanol was carefully pipetted off the ring of the column and the column switched to a fresh RNAse-free eppendorf. 40µL of diethylpyrocarbonate treated ddH2O was added and column spun at 10 000 x g for one minute. 1µL of each RNA sample was run on a 1% agarose gel as quality control, and then concentration determined by NanoDrop ND 1000.  3.4.6.2  Conversion to cDNA 1µg of total RNA was used to generate cDNA in a 20µL reaction volume using the  SuperScript® VILO™ kit (Invitrogen). The reverse transcription reaction was performed using a themocycler (RoboCycler Gradient 96, Stratagene). Samples were incubated at 25˚C for 10 minutes, 42˚C for 60 minutes, and finally 85˚C for five minutes.  101  3.4.6.3  Real-time PCR Real-time PCR was performed in triplicate for each sample in a 96 Well Optical  Reaction Plate with Barcode (Applied Biosystems) with a reaction volume of 25µL for each replicate [14.65µL ddH2O, 6.25µL SYBR® Green Master Mix (Applied Biosystems), 0.05 µL each of 100mM forward and reverse primer, 4µL of 1/100 cDNA]. A standard two hour comparative PCR analysis was performed using a 7500 Real Time PCR System (Applied Bioystems). Primers were designed against YML054W as a representative TY1 element using Primer Express v. 2.0 (Applied Biosystem) (forward primer, OVM760, 5’ ACCCACAGCAGTGCATGATG3’, and reverse primer, OVM761, 5’ TGGCCCAGGTGGAAAGTACA 3’). TAF10 was used as an internal control [forward primer, OVM695, 5’ GGCGTGCAGCAGATTTCAC 3’, and reverse primer, OVM696, 5’ TGAGCCCGTATTCAGCAACA 3’] (Teste et al., 2009). Relative transcript values and error bars (upper/lower limits) were quantified as described (Guide to Performing Relative Quantitation of Gene Expression Using Real-Time Quantitative PCR, Applied Biosystems, view at: www.appliedbiosystems.com).  102  Table 3-1. Affinity mass spectrometry peptides identified for Esp1 ORF  Name  YNR016C YGL195W YMR229C YGR098C YPL160W YJL034W YBR079C YOR335C YBL076C YLR153C YDR127W YER036C YGL206C YPL226W YDR037W YHR020W YMR012W YDR113C YOR204W YIL018W YGL173C YDL171C YGR264C YKL210W YOR153W YLR342W YER091C YGL137W YPL131W YGR285C YOR341W YDL145C YOR168W YDR238C YOR361C YHR027C YGL207W  ACC1 GCN1 RRP5 ESP1 CDC60 KAR2 RPG1 ALA1 ILS1 ACS2 ARO1 ARB1 CHC1 NEW1 KRS1 YHR020W CLU1 PDS1 DED1 RPL2B KEM1 GLT1 MES1 UBA1 PDR5 FKS1 MET6 SEC27 RPL5 ZUO1 RPA190 COP1 GLN4 SEC26 PRT1 RPN1 SPT16  Protein Score 1020 799 392 546 738 608 451 522 571 318 313 773 296 316 314 349 370 359 319 381 272 308 261 208 277 354 175 253 194 231 189 111 163 215 151 160 200  Peptides Identified 46 35 32 29 29 29 22 21 21 20 19 18 18 17 17 16 16 16 16 16 15 15 15 14 13 12 12 12 12 12 11 11 11 11 10 10 10  Sequence Coverage (%) 17 10.7 13.9 14.3 23.5 32.4 21.6 20.9 17.1 16 11.4 22 8.7 15.7 18.8 28.6 13 32.4 21.9 35.8 8.3 5.8 14.6 12 8.5 8.1 16.7 10.7 28.3 17.1 5.9 10 13.3 11.6 13 9.9 11  Peptides Identified in mock 10 0 6 0 6 7 5 2 5 5 4 3 4 0 3 0 0 0 2 3 0 3 3 3 0 0 0 2 2 2 0 0 0 0 0 2 2 103  Table 3-1. Affinity mass spectrometry peptides identified for Esp1 (continued) ORF  Name  YIL041W YMR108W YHR047C YGR061C YGL234W YEL046C YBR196C YDR234W YDR341C YKR001C YNL104C YNL287W YHR183W YGR162W YIL075C YBR084W YDL084W YER086W YFR009W YEL031W YLR106C YDL143W YER025W YGL150C YGL210W YGR185C YMR080C YOR046C YGL120C YGR175C YLR100W YPR181C YGR218W YKL145W YNL132W YBR143C YCL018W  GVP36 ILV2 AAP1 ADE6 ADE5,7 GLY1 PGI1 LYS4 YDR341C VPS1 LEU4 SEC21 GND1 TIF4631 RPN2 MIS1 SUB2 ILV1 GCN20 SPF1 MDN1 CCT4 GCD11 INO80 YPT32 TYS1 NAM7 DBP5 PRP43 ERG1 ERG27 SEC23 CRM1 RPT1 KRE33 SUP45 LEU2  Protein Score  Peptides Identified  208 164 166 150 176 185 125 271 81 117 74 215 137 233 75 157 135 88 104 135 178 174 135 51 62 76 41 133 160 136 31 168 80 151 114 150 31  10 10 9 9 9 9 8 8 8 8 8 8 8 7 7 7 7 7 7 6 6 6 6 6 6 6 6 6 6 6 6 6 5 5 5 5 5  Sequence Coverage (%) 30.1 13.5 8.9 8 11.3 22.5 18.6 16.7 11.9 13.1 11 9.4 16.4 10.2 5.6 8.3 14.3 15.6 9.8 3.7 1.5 12.5 13.3 1.1 33.8 12.7 3.1 9.5 9 9.7 12.4 5.6 4.4 9.2 4 8.7 15.1  Peptides Identified in mock 2 2 0 0 2 2 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 104  Table 3-1. Affinity mass spectrometry peptides identified for Esp1 (continued) ORF  Name  YCL040W YCR009C YDL140C YER031C YER062C YFR010W YGR116W YKR095W YLR058C YLR447C YBR080C YDR382W YMR241W YFR002W YBL022C YBR145W YDL147W YDR101C YDR170C YER070W YER125W YFL004W YHR137W YHR179W YIR006C YJL050W YJR064W YKL009W YKL104C YLR303W YLR384C YMR038C YMR125W YOR108W YBL039C YBR039W YBR221C  GLK1 RVS161 RPO21 YPT31 HOR2 UBP6 SPT6 MLP1 SHM2 VMA6 SEC18 RPP2B YHM2 NIC96 PIM1 ADH5 RPN5 ARX1 SEC7 RNR1 RSP5 VTC2 ARO9 OYE2 PAN1 MTR4 CCT5 MRT4 GFA1 MET17 IKI3 CCS1 STO1 LEU9 URA7 ATP3 PDB1  Protein Score  Peptides Identified  62 55 58 51 122 62 68 84 100 95 59 195 245 51 122 75 70 55 68 109 51 61 53 75 57 93 92 82 97 116 48 59 78 74 159 113 58  5 5 5 5 5 5 5 5 5 5 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4  Sequence Coverage (%) 6.6 18.1 2.3 24.7 10 13.4 2.4 2.3 10.4 11 4.6 60.9 7 4.3 3.8 2.3 8.5 5.1 1.8 5.2 6.8 5.8 6.2 10.5 2.8 3.9 6.9 20.3 7.3 9.9 3 9.2 4.9 6 6.6 15.4 13.4  Peptides Identified in mock 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 105  Table 3-1. Affinity mass spectrometry peptides identified for Esp1 (continued) ORF  Name  YDR211W YDR406W YER178W YPR041W YDR381W YKL029C YKL120W YML123C YPR019W YCR057C YCR084C YDL100C YDR129C YDR158W YDR353W YER003C YER052C YGL026C YGR229C YGR256W YHR098C YIL109C YJL033W YKL126W YKL216W YLL018C YLR196W YNL163C YNL220W YNL231C YNL241C YNL307C YOR151C YOR165W YPL043W YPL058C YPL190C  GCD6 PDR15 PDA1 TIF5 YRA1 MAE1 OAC1 PHO84 MCM4 PWP2 TUP1 GET3 SAC6 HOM2 TRR1 PMI40 HOM3 TRP5 SMI1 GND2 SFB3 SEC24 HCA4 YPK1 URA1 DPS1 PWP1 RIA1 ADE12 PDR16 ZWF1 MCK1 RPB2 SEY1 NOP4 PDR12 NAB3  Protein Score  Peptides Identified  82 81 44 68 99 140 74 31 25 34 109 36 187 63 144 27 41 98 69 79 105 57 27 90 33 53 73 31 66 26 100 48 53 51 58 66 28  4 4 4 4 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3  Sequence Coverage (%) 4.5 1.9 7.4 9.1 14.2 7 10.8 6.6 1.7 2.7 4.6 7.9 5.8 5.8 15.7 9.1 6.6 5.9 5.9 6.7 3.9 3.8 3.4 5.7 4.8 6.5 4.5 2.4 5.3 9.4 7.5 5.9 2.9 3.5 5 1.5 3.5  Peptides Identified in mock 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 106  Table 3-1. Affinity mass spectrometry peptides identified for Esp1 (continued) ORF  Name  Protein Score  Peptides Identified  YPL242C YDL058W YIL043C YPL119C  IQG1 USO1 CBR1 DBP1  19 53 34 0  3 3 3 3  Sequence Coverage (%) 0.7 1.5 9.9 2.9  Peptides Identified in mock 0 0 0 0  107  Table 3-2. Strains used in this chapter Strain Y7092  Genotype Mat α can1∆::STE2pr-Sp_his5 lyp1∆ his3∆1 leu2∆0 ura3∆0 met15∆0 YKH64/65 Mat α can1∆::STE2pr-Sp_his5 lyp1∆ his3∆1 leu2∆0 ura3∆0 met15∆0 esp1-1::NATMX4 TS MATa his3Δ1 leu2Δ0 lys2Δ0 met15Δ ura3Δ0 pds1collection 128::KanMX6 TS MATa his3Δ1 leu2Δ0 lys2Δ0 met15Δ ura3Δ0 scc1collection 73::KanMX6 TS MATa his3Δ1 leu2Δ0 lys2Δ0 met15Δ ura3Δ0 scc2collection 4::KanMX6 TS MATa his3Δ1 leu2Δ0 lys2Δ0 met15Δ ura3Δ0 smc3collection 1::KanMX6 YKH612 MATa his3Δ1 leu2Δ0 lys2Δ0 met15Δ ura3Δ0 scc173::KanMX6 esp1-1::NATMX6 YKH186 Mat a ura3-52 lys2-801_amber ade2-101 trp1-Δ63 his3Δ200 leu2-Δ1 ESP1-13Myc::KanMX6 YM8 Mat a ura3-52 lys2-801_amber ade2-101 trp1-Δ63 his3Δ200 leu2-Δ1 PDS1-13Myc::KanMX6 YKH407 Mat a ura3-52 lys2-801_amber ade2-101 trp1-Δ63 his3Δ200 leu2-Δ1 SCC1-13Myc::His3MX6  Source (Tong and Boone, 2006) This study (Li et al., 2011) (Li et al., 2011) (Li et al., 2011) (Li et al., 2011) This study This study This study This study  108  Figure 3-1. Structure of the Ty family of elements Cited from (Lesage and Todeschini, 2005). Reprinted with permission © S Karger AG.  109  Nucleus Rad27 Paf1 Rtf1 Leo1 Sgs1  Cytoplasm  G F E  TY1  A AAAA  A  D  P Body  B AAAA  A  A  C  AAAA  TY1 mRNA TY1 cDNA  VLP  Pat1 Dhh1 Lsm1-7  Pat1/Dhh1  esp1-1 SL hits  Lsm1-7  esp1-1 SDL hits  Figure 3-2. Genes identified in esp1-1 SL and SDL screens have roles in the life cycle of Ty1 retrotranposons The retrotransposition cycle of Ty1 elements can be described in the following steps: (A) transcription of the element by RNAPII (B) nuclear export (C) translation of retrotransposon mRNA (D) assembly and maturation of the VLP (E) reverse transcription of the Ty1 element to cDNA (F) import to the nucleus and (G) integration of the cDNA into the genome. Host proteins that stimulate Ty1 retrotransposition are in green, host proteins that inhibit Ty1 retrotransposition are in red. Genes identified in the esp1-1 SDL screen are marked with filled stars while those identified in the SL screen are marked with outlined stars. Image adapted from (Beauregard et al., 2008).  110  55 IP Esp1-13Myc  IN  VLP  IB: (descending) Myc, IN, VLP and RT IP: Myc 130 WCL IP WCL IP  3 4 1 3 4 1 1 1 1 2 1 2 1 2 1 1 2 1 2 15 7 13  2 1 1 1 2 0 1 3 0 0 0 0 0 0 0 0 0 0 0 1 0 0 7 4 0  yc  1  LNNNGIHINNK VACQLIMR VTNIIDR YVRPPPMLTSPNDFPNWVK AHNVSTSNNSPSTDNDSISK STTEPIQLNNK AVSPTDSTPPSTHTEDSKR EVDPNISESNILPSK LDQFNYDALTFDEDLNR MLAHANAQTIR NQFQASVLVIQMDR SAPSYFISFTDETTK SDGTVLAPIVK TLLDDCR TVDTTNYVILQGK TVPQISDQETEK EVNQLLK LGMENSLTEK LNVPLNPK  Rev Transcriptase/RNAse H  Integrase  Protease  Gag/coat protein  YDEAITYNK  2  3M  -1  c1  yc  M  -1 3  e  C.  Sc  WCL  s1  IP  Pd  WCL  Ty p  Wild Type Esp1-13Myc  W ild  B. 4  EVHTNQDPLDVSASK  Esp1 IP Mock  DILSVDYTDIMK  Peptide  A. 6 Esp1 IP  1 Mock  WCL IP Scc1-13Myc  100 Pds1-13Myc  IN  RT  55 VLP  RT  IB: (descending) Myc, IN, VLP and RT IP: Myc  111  Figure 3-3. Mass Spectrometry reveals a physical interaction between Esp1 and Ty1-IN (A) Ty1 peptides identified in Esp1-13Myc mass spectrometry versus untagged (mock) strain are color coded as follows: coat protein (blue), PR (yellow), IN (orange) and RT/RNAse H (green). (B) and (C) Immunoblot (IB) of anti-Myc IPs carried out from untagged WT, Esp113Myc Pds1-13Myc, Scc1-13Myc WCLs. Expression of a Ty1 element (pGAL1-Ty1-H3) was induced in all strains for 24 hours prior to cell lysis. Blots were probed with anti-Myc, anti-IN, anti-VLP and anti-RT antibodies. Where possible, molecular weights are indicated to the left of blots.  112  A.  esp1-1 Wild Type  B. SC  SC - His  SC  SC - His  Shift C.  SC - His  SC  SC - His  scc1-73  pds1-128  SC  Shift  113  D. SC - His  SC  SC - His  esp1-1 scc1-73  SC  Shift Figure 3-4. The defect in Ty1 transposition in an esp1-1 mutant is rescued by scc1-73 (A) Design of the pGAL1Ty1-H3mHIS2AI. Cited from (Curcio and Garfinkel, 1991). Reprinted with permission © Joan Curcio and David Garfinkel. (B-D) WT, esp1-1, spt10∆, pds1-128, scc1-73 and esp1-1 scc1-73 strains carrying pGAL1Ty1-H3mHIS3A1 were patched onto SC-URA + 2% galactose plates for two days, then replica plated to SC (control) or SCHis to test for successful transposition. Strains were tested at both 25˚C and a temperature shift (25˚C overnight during initial induction, and shifted to 30˚C for the rest of the assay).  114  e sc sp1 c1 -1 -7 3  73 c1 sc  -1  e p1  Ty p  es  W ild 100 70 27  IN Non-specific band  Figure 3-5. Expression of IN from the pGAL1Ty1-H3mHISA1 plasmid The pGAL1Ty1-H3mHISA1 plasmid was induced for 24 hours in galactose media in WT, esp1-1, scc1-73, esp1-1 scc1-73 strains. Immunoblot probed with anti-IN; a non-specific band identified by anti-IN was used to ensure equal loading. Molecular weights are indicated on left. Analysis performed by Lina Ma.  115  Relative Transcript Levels  A.  Wild Type -  esp1-1 -  Wild Type -  esp1-1 -  Sample B. WT  esp1-1  p49 p45  Figure 3-6. esp1-1 strains are capable of Ty1 element expression and TyA-TyB polypeptide processing (A) Relative transcript levels of TY1 mRNA in the esp1-1 mutant compared to WT quantified by qPCR. qPCR was performed in triplicate on samples taken at 25˚C and after a two hour incubation at 35˚C. Samples are displayed on the X-axis while relative transcript level compared to WT Nz treatment is shown on the Y-axis. Upper and lower limits for the three technical replicates are also displayed accordingly as error bars. TAF10 was used as an internal control. (B) Endogenous gag processing in WT versus the esp1-1 mutant at 25˚C and after 6 hours incubation at 30˚C. p49 = unprocessed; p45 = processed. spt3∆ serves as a negative control for gag expression  116  SC - His  SC  SC - His  smc3-1  scc2-4 Wild Type  SC  Shift  Figure 3-7. scc2-4 and smc3-1 strains have defects in transposition defects WT, scc2-4, smc3-1 and spt10∆ strains carrying pGAL1Ty1-H3mHIS3A1 were induced to undergo transposition on galactose media and tested for successful transposition indicated by a HIS3+ phenotype. Strains were tested at both 25˚C and a temperature shift (25˚C overnight during initial induction, and shifted to 30˚C for the rest of the assay).  117  Figure 3-8. Model for Esp1-mediated insertion As cohesin is loaded, Esp1 targets the PIC to hotspots of integration. After targeting, cohesin slides or is removed to allow the integration of the cDNA.  118  Chapter 4: Examination of a role for the budding yeast separase, Esp1, in mRNA biogenesis 4.1  Introduction Eukaryotic transcription is a result of the activity of the multimeric RNAPII, an  enzyme conserved from yeast to humans [reviewed in (Young, 1991)]. The regulation of gene expression rests on the presence of DNA elements – upstream activation or repressive sequences. Recognition of these elements is what drives transcriptional regulation by promoting (through transcriptional activators) or blocking (through transcriptional repressors) the recruitment of RNAPII. Basal transcription is initiated through minimalist transcriptional architecture via assembly of the pre-initiation complex on the core promoter element. In S. cerevisiae, assembly of this complex is dependent on co-activators, such as SAGA, TFIID and mediator, which recognize transcriptional activators and modulate RNAPII recruitment [reviewed in (Hahn and Young, 2011)] (Figure 4-1). RNAPII is a distinctive RNA polymerase, because it possesses an extra C-terminal domain (CTD) on its largest subunit, Rpb1. This CTD consists of multiple YSPTSPS heptamer repeats, which are highly phosphorylated throughout transcriptional events. During assembly of the pre-initiation complex, the mediator complex functions as a bridge between upstream activators and RNAPII, recruiting the polymerase to the promoter. In doing so, the CTD kinase activity of the transcription factor TFIIH is stimulated, phosphorylating serine 5 of the heptamer repeat. This modification is present for the first few hundred nucleotides of elongation, and has been linked to mRNA capping events. As serine 5 phosphorylation levels drop, serine 2 kinases are recruited to induce phosphorylation of the second serine residue, which in turn stimulates transcriptional elongation [reviewed in (Buratowski, 2009)] 119  (Figure 4-1). In order to escape the nucleus to be translated, pre-mRNAs must first be capped, spliced and polyadenylated to form mature transcripts. Capping is a three-step enzymatic process that adds a 7-methyl guanosine moiety to the 5’ of the transcript. In the first step, an RNA 5’-triphosphatase (RTPase) removes the γ phosphate from the 5’ end of the mRNA and a guanosine triphosphate:mRNA guanylyltransferase (GTase) then transfers a guanine monophosphate to the newly exposed diphosphate. This guanosine cap is subsequently methylated to produce the final cap (m7GpppN where N is the first nucleotide) [reviewed in: (Topisirovic et al., 2011)]. In budding yeast, the capping enzyme is a heterodimeric complex, with RTPase and GTase subunits encoded by CET1 and CEG1, respectively (Itoh et al., 1987; Shibagaki et al., 1992; Tsukamoto et al., 1997). The importance of the cap is considerable. Not only is it necessary for efficient translation, but it also serves to protect transcripts from exonucleolytic degradation, as well as promoting the transcription, polyadenylation, splicing and nuclear export of the mRNA. These processes are mediated by two known cap-binding proteins, one of which is found in the nucleus (nuclear cap binding complex) while the other is present in the cytoplasm (eIF4E). The heterodimeric nuclear cap binding complex binds to mRNA transcripts as they are capped, and is critical for nuclear export and splicing while eIF4E binding is needed for cap-dependent recruitment of the ribosome (Topisirovic et al., 2011) (Figure 4-2). Mature mRNA transcripts can subsequently be regulated by mRNA decay, which generally begins in budding yeast with shortening of the polyadenylated tail by the Pan2/Pan3 or Ccr4-NOT deadenylases (Boeck et al., 1996; Brown et al., 1996; Tucker et al., 2001). The translational repressors Dhh1 and Pat1 then mediate assembly of the decapping  120  complex, recruiting other stimulatory factors such as the Lsm1-7 complex to initiate the activity of the decapping enzymes Dcp1/2 (Figure 4-3) [reviewed in (Ling et al., 2011)]. Upon removal of the cap, the transcript is decayed through Xrn1 5’ to 3’ exonucleolytic activity (Stevens, 1980) [for mRNA turnover review, see: (Meyer et al., 2004)]. This turnover became a point of interest in cellular regulation when it was found that eukaryotic cells have cytoplasmic ribonucleolytic complexes, such as P-bodies and stress granules, which are thought to be sites of translationally repressed mRNAs/transcript storage. These transient structures are actively assembled on free mRNA transcripts and determine the cellular fate of these transcripts – decay, storage or ultimately translation [reviewed in (Kedersha and Anderson, 2009)]. The exact mechanisms by which events within cytoplasmic P-bodies are decided still remain a point of investigation. Mature transcripts can also be carefully regulated throughout translation - indeed, 40% of the proteome variability cannot be accounted for by changes at the transcript level (Brockmann et al., 2007). The events of translation can be succinctly described in four major stages: initiation, elongation, termination and recycling. The small 40S subunit of the ribosome is first recruited to the transcript by general initiation factors (eukaryotic initiation factors, eIFs). Scanning of the transcript then occurs until the start codon is identified, at which point an initiation tRNA is brought in, eIFs disassociate and the large 60S ribosomal subunit is recruited to form a functional 80S ribosome. Throughout elongation, the following cycle occurs: (1) binding of the relevant tRNA to the aminoacyl site of the ribosome (2) establishment of a peptide bond with the growing polypeptide in the peptidyl site, and finally (3) translocation of the ribosome so that a new tRNA can enter the aminoacyl site, the newly elongated peptidyl-tRNA moves to the peptidyl site and the newly deacylated tRNA transfers  121  to the exit site. Synthesis of the polypeptide chain progresses until a stop codon is reached and termination is initiated [reviewed in (Marintchev and Wagner, 2004)]. The enrichment of genes involved in RNA metabolic processes in the esp1-1 SGA screen (see: Chapter 2) motivated an investigation of a potential role for the budding yeast separase in mRNA biogenesis – a notion that was further evidenced by closer examination of protein-protein interactions among the SL and SDL hits. Interestingly, a role for separase in mRNA biogenesis has already been suggested when the overexpression of ESP1 was found to rescue the temperature sensitivity of capping enzyme mutant, ceg1-ts (Schwer and Shuman, 1996). Follow up studies in this chapter on transcription and translation efficacy in esp1-1 mutants highlight mRNA regulation as a potential new area of Esp1 study.  4.2 4.2.1  Results Protein-protein interactions amongst the confirmed esp1-1 SL and SDL hits are  enriched for mRNA regulatory complexes In the second chapter of this dissertation, I confirmed the phenotype of 15 SL and 44 SDL relationships for the esp1-1 mutant (see: section 2.2.3). Surprisingly, GO analysis of these hits demonstrated that negative esp1-1 genetic interactions were enriched for genes involved in RNA metabolic processes (Figure 2-5). To obtain a better understanding of the nature of this relationship, Anastasia Baryshnikova (Boone Lab) isolated the protein-protein interactions that exist strictly amongst the confirmed SL and SDL hits (Figure 4-4). Interestingly, two complexes involved in mRNA biogenesis were identified in this manner. Several genes whose products form the Paf1C were isolated in the esp1-1 SL screen: CDC73, LEO1, and RTF1 (Chang et al., 1999; Mueller and Jaehning, 2002; Wade et al.,  122  1996). Paf1C is a transcriptional elongation complex that is distinct from mediator and directly affects the expression of only a specific subset of genes (Betz et al., 2002; Chang et al., 1999; Penheiter et al., 2005; Shi et al., 1997; Shi et al., 1996; Zhang et al., 2009). This complex has also been implicated in posttranscriptional events as well, with mutants of the Paf1C being defective in pre-mRNA 3’ end processing (Penheiter et al., 2005; Sheldon et al., 2005). Notably, deletion of any member of the Paf1C caused cell lethality in combination with the esp1-1 mutant, emphasizing the importance of Paf1C-mediated events in the survival of a conditional mutant of separase at permissive temperature. In addition to the enrichment of the Paf1C, factors involved in the decapping step of mRNA degradation were specifically identified in esp1-1 SL and SDL screens. The overexpression of the stimulatory mRNA decapping factors PAT1 and DHH1 triggered cell lethality in esp1-1, as did the deletion of the Lsm genes, LSM1 and LSM7 (Bonnerot et al., 2000; Coller et al., 2001; Fischer and Weis, 2002; Sweet et al., 2012; Wyers et al., 2000) (Figure 4-4). Lsm proteins in budding yeast are able to form two distinct heteroheptameric ring complexes; Lsm2-8 functions in mRNA splicing while Lsm1-7 stimulates decapping (Bouveret et al., 2000; Tharun et al., 2000). The Dcp1-Dcp2 decapping enzyme itself was not identified in the screens; however, both Dcp1 and Dcp2 are essential genes which are not present in the haploid yeast deletion mutant collection (Dunckley and Parker, 1999; Giaever et al., 2002; LaGrandeur and Parker, 1998). Though there was no consistency in whether it was the loss of or gain of function of these decapping factors that caused lethality in esp1-1, the regulation of mRNA decay appears to be consequential in maintaining cell viability.  123  4.2.1.1.1  Drugs affecting transcription and translation induce a growth phenotype in  esp1-1 To determine if mRNA regulation is of critical importance to the esp1-1 strain, I monitored the effect of disrupting the transcriptional or translational machinery. I assessed the growth of the esp1-1 mutant in the presence of two different drugs at both permissive and semi-restrictive temperatures: 6-azauracil (6AU) and cycloheximide (CHX). 6AU inhibits inosine-5’-monophosphate dehydrogenase leading to a reduction in intracellular guanosine triphosphate pools and stalling of RNAPII (Exinger and Lacroute, 1992). Meanwhile, CHX blocks translation by interfering with the translocation step of elongation (Schneider-Poetsch et al., 2010). As a pyrimidine analogue, the action of 6AU requires that media where the drug is present be depleted of uracil - meaning that strains tested for growth on 6AU must be capable of expressing the URA3 gene. Therefore, the auxotrophic WT and esp1-1 mutant were first transformed with the centromeric URA3 pRS316 plasmid, and grown to log phase before being serially diluted and spotted onto SC-URA media supplemented with either dimethylsulfoxide (DMSO) or 100µg/mL 6AU (Sikorski and Hieter, 1989). After five days of growth at a permissive temperature (25˚C), esp1-1 mutants were clearly sensitive to the presence of 6AU when compared to both WT and DMSO controls (Figure 4-5A). Using a similar approach, WT and esp1-1 cells, without the pRS316 vector, were spotted onto YPD alone or YPD containing a subinhibitory amount of CHX (0.025µg/mL) (Figure 4-5B). After three days of growth at 33˚C, CHX mildly rescued the esp1-1 ts phenotype. Note that WT and esp1-1 cells here are both in the YPH499 background, where the esp1-1 restrictive temperature is slightly higher, allowing for some growth at 33˚C (data not shown).  124  The drug sensitivity data suggests that disruption of either transcription or translation has the opposite effects on esp1-1 growth. Perhaps the sensitivity of esp1-1 to 6AU but the rescue by CHX reflects a role for Esp1 prior to translation – either in transcription or the post-transcriptional regulation of mRNA transcripts. If this were the case, stalling transcriptional machinery would be detrimental to esp1-1; however, by using modest amounts of CHX - which would slow but not completely stall translational elongation defects in transcription/post-transcriptional regulation may be more easily tolerated resulting in the increase of the esp1-1 restrictive temperature.  4.2.2 4.2.2.1  Separase-mediated gene expression Analysis of an inducible heat shock gene, HSP30 As discussed in Chapter 3, cohesin is translocated after loading at site of RNAPIII  transcription to areas of convergent transcription. Lengronne et al found that alterations in the transcriptional program can influence cohesin positioning along chromosomes. For example, upon activation of the heat shock gene HSP30, cohesin that initially covered most of the HSP30 ORF was quickly shifted downstream to the neighbouring MAK32/PET18 locus (Lengronne et al., 2004). Similarly, a gene that is actively repressed during heat shock, SR09, was free of cohesin until a shift to high temperature resulted in the relocation of cohesin to the SR09 ORF (Gasch et al., 2000; Lengronne et al., 2004). I therefore sought to investigate the possibility that separase is involved in the promotion of cohesin translocation, thereby influencing transcriptional events. To determine whether this is the case, the transcript level of HSP30 and SRO9 were evaluated in both a WT and esp1-1 mutant by qPCR (Figure 4-6). WT and esp1-1 strains  125  were first treated with nocodazole (Nz) at 30˚C for two hours before being shifted to 37˚C for 15 minutes, again in media containing Nz. The reason for the initial treatment was twofold. First, by arresting cells in metaphase using Nz, the sister chromatid segregation defect in the esp1-1 mutant at high temperature would not factor into the analysis when cells were subjected to heat shock. Any difference in the growth rate between the two strains at restrictive temperatures would also be negated. Second, a two hour incubation at 30˚C prior to heat shock would serve to suppress the activity of esp1-1 – an effect that would likely not be achieved within a 15-minute heat shock window. Samples for real-time PCR analysis were taken both before and after heat shock. Prior to heat shock, the transcript level of both HSP30 and SR09 was slightly increased in an esp1-1 strain compared to WT (approximately 1.2-1.3 fold). After a shift to 37˚C, HSP30 levels in WT cells rose fourfold as expected while SR09 transcripts showed a threefold decrease. In contrast, esp1-1 mutants exhibited a stronger induction of HSP30 (sixfold) while SRO9 levels were comparable to WT. A gene that did not undergo a change in cohesin pattern during heat shock, YCR016W, was also included and I found that although the amount of YCR016W mRNA decreased when shifted to 37˚C, there was no notable difference in transcript levels between WT and esp1-1 (Lengronne et al., 2004). It is likely that in the event of a defect in heat shock-mediated cohesin relocation, HSP30 transcript levels would not rise as expected and amount of SR09 mRNA would either stay the same or decrease, depending on whether cohesin translocation is critical for SR09 repression. As esp1-1 was able to induce HSP30 upon heat shock, separase does not appear critical for cohesin translocation; or, if indeed it is, there seems to be buffering mechanisms allowing the mutant to overcome this defect. A possible explanation, since esp1-1 HSP30 levels appear to  126  increase even more readily than in WT, is that separase somehow contributes to the repression of transcription.  4.2.2.2  Analysis of the silenced mating cassette through HMRA2 If Esp1 indeed does have a role in repressing transcription, it may also affect  silencing. In budding yeast, hallmark sites of silenced chromatin include the HM mating loci, telomeres and ribosomal RNA sites [reviewed in (Rusche et al., 2003)]. The HML and HMR loci, which each contain a cryptic copy of either MATa and MATα respectively, allow for interconversion of mating type in homothallic strains through the action of the sitespecific HO endonuclease (Kostriken et al., 1983; Nickoloff et al., 1986; Strathern et al., 1982). Silencing at HM mating loci is mediated by Sir proteins, but as it is a canonical heterochromatic site, I wondered whether Esp1 also had an effect on the silencing of the HM locus [reviewed in (Hickman et al., 2011)]. Thus, I examined the transcript levels of the HMRA2 allele by qPCR. WT and esp1-1 cells were shifted to 35˚C for two hours in rich media, and samples were taken for real-time PCR analysis (Figure 4-7). In comparison to WT, esp1-1 cells seemed to show a slight rise in HMRA2 mRNA at a permissive temperature (~1.4 fold), which grew more substantial upon shifting to a restrictive temperature. This apparent increase may be consistent with a potential role for Esp1 in maintaining silenced chromatin. However, as a similar phenomenon was not seen at ribosomal RNA loci (data not shown), the role of Esp1 in transcriptional regulation is likely more complex than initially anticipated.  127  4.2.3  Esp1 and decapping factors Aside from transcriptional control, Esp1 may also function in the posttranscriptional  regulation of mRNA transcripts. The identification of mRNA decapping factors (PAT1, DHH1, lsm1∆, lsm7∆) highlighted the fact that Esp1 may function in mRNA biogenesis to regulate these factors (Figure 4-8). As PAT1 and DHH1 overexpression negatively affected the viability of esp1-1, their gene products are the most obvious potential Esp1 targets since substrate overexpression is capable of causing an SDL phenotype in a relevant enzyme mutant (Measday and Hieter, 2002; Sopko et al., 2006). I have already tested pGAL1/10GST-PAT1 and pGAL1/10-GST-DHH1 as candidate substrates (see: section 2.2.6), and neither was shown to be an obvious Esp1 target. However, in order to rule out that either was a substrate when under the influence of their native promoter or that their cleavage could be cell cycle specific, I subjected both epitope-tagged Pat1-HA and Dhh1-HA strains to various drug treatments that would result in cell cycle arrest at G1 (mating pheromone), S (HU) and metaphase (Nz). After two hours of treatment, samples for each strain were taken for immunoblotting. Neither Pat1 nor Dhh1 showed any difference in banding pattern at any of the stages of the cell cycle tested when compared to their log phase control or the pGAL1/10-GST-ORFX experiments (Figure 4-8A). Subsequent analysis of esp1-1 cells grown at a restrictive temperature for a total of four hours confirmed that, for Pat1, no band visible by western analysis was due to Esp1 cleavage in logarithmically growing cells (Figure 4-8B). As protease independent functions have also been ascribed to Esp1, even though Pat and Dhh1 were not demonstrably cleaved, I still wondered whether a physical interaction existed between Esp1 and either Pat1 or Dhh1(Sullivan and Uhlmann, 2003). Esp1-13Myc  128  was IP’d from strains grown to log phase that also contained either Pat1 or Dhh1 epitope tagged with HA. As neither Pat1-HA nor Dhh1-HA was visible above background in the IP fractions when samples were immunoblotted and probed for HA, no physical interaction between Esp1 and Pat1/Dhh1 was confirmed (Figure 4-8C). It does, however, remain a possibility that a transient interaction occurs that was not detected by the attempted methods. Follow up work with IPs of cells that are arrested at specific stages of the cell cycle - or else treated with CHX to stimulate mRNA decapping - could help illuminate whether this remains a possibility.  4.2.4  Translational machinery is intact in an esp1-1 mutant The identification of a genes in the esp1-1 SL and SDL screens that function in  translation, such as elongation factor 2 which catalyzes ribosomal translocation during protein synthesis, prompted me to test if separase has a role in maintaining functional translational machinery (Perentesis et al., 1992). I collaborated with Dr. Jeff Coller’s laboratory at Case Western University to analyze polysome formation in WT and esp1-1 strains. After growing cells to log phase and then shifting them to 35˚C for two hours to suppress esp1-1 activity, CHX was added and cells were harvested to make extracts that were run on sucrose gradients to separate free 40S and 60S ribosomal subunits from polysomes. No increase in individual subunit peaks (40S, 60S) was observed in esp1-1, nor was any decrease in the amount of polysomes noted. Therefore, mutants of esp1-1 appear to be capable of forming functional polysomes even at high temperatures, indicating that there are no defects in the translation of mRNA transcripts in this mutant.  129  4.3  Discussion Screening for SL and SDL genetic interactions with the budding yeast separase  mutant, esp1-1, as the query identified genes involved in RNA and DNA metabolism. Further examination of the protein-protein interactions amongst these hits has revealed a potential role for Esp1 in mRNA regulation. Subsequent studies of gene expression, posttranscriptional regulation and translational control have illuminated several avenues through which Esp1 may exert influence on mRNA biogenesis.  4.3.1  A role for Esp1 prior to translation The hallmark function of Esp1 is the cleavage of a specific subset of proteolytic  targets – namely the Scc1 or Rec8 kleisin subunits of cohesin and the kinetochore associated Slk19 protein (Buonomo et al., 2000; Sullivan et al., 2001; Uhlmann et al., 1999; Uhlmann et al., 2000). However, the examination of esp1-1 negative genetic interactions – most specifically, the enrichment of the Paf1C and mRNA decapping complex - intimated that separase-mediated regulation might not only occur post-translationally, but at the transcript level as well (Figure 4-1). Additionally, several pieces of evidence suggested that this potential role for Esp1 in mRNA regulation would likely occur prior to translation. Firstly, drugs that inhibit translation would likely further exacerbate a mutant’s translational defects - but instead, the addition of CHX rescued the growth of esp1-1 (Figure 4-2). Secondly, the translational machinery was intact in an esp1-1 mutant (Figure 4-9). This data is consistent with the notion that separase functions directly in transcription or as a regulator of post-transcriptional modifications.  130  4.3.2  Sister chromatid cohesion and gene regulation: transcriptional implications for  Esp1? Studies have found that cohesin association patterns in the S. cerevisiae genome are influenced by the local transcriptional status (Bausch et al., 2007; Lengronne et al., 2004). Moreover, more recently, Skibbens et al have shown that cohesin inactivation in late G1 can cause significant transcriptional changes for 29 unique loci (Skibbens et al., 2010). This direct influence of sister chromatid cohesion on transcription is consistent with other species. In Schizosaccharomyces pombe, for example, the Rad21 kleisin subunit promotes G2-specific transcription termination between convergent genes (Gullerova and Proudfoot, 2008). Nipped B and Stromalin, orthologues of Scc2 and Scc3 respectively, regulate the long-range activation of the cut gene in Drosophila melanogaster (Rollins et al., 2004). And, crucially, differential gene expression patterns were observed in patients with Cornelia de Lange Syndrome – a clinical manifestation of mutations within the NIPLB cohesin regulator or the SMC1A cohesin structural component (Liu et al., 2009). To my knowledge, separase, though involved in the regulation of sister chromatid cohesion, has not previously been associated with transcriptional regulation. Yet, the enrichment of Paf1C mutants in esp1-1 SL interactions suggests that Esp1 might influence gene expression. In considering how Esp1 may exert such a control, two avenues of possible explanations emerge, neither of which has been negated by these studies: (1) Esp1 directly activates/represses gene expression, or (2) Esp1 exerts transcriptional control through its influence on sister chromatid cohesion. Notably, it was strictly the loss of function mutations in Paf1C genes that negatively impacted the growth of the esp1-1 mutant at a permissive temperature (Figure 4-1).  131  Interestingly, although associated with RNAPII at all transcriptionally active yeast loci, mutants of the Paf1C only affect a small subset of genes (~200) – a substantial number of which are involved in cell wall biosynthesis, RNAPII transcription and ribosomal RNA processing (Penheiter et al., 2005; Shi et al., 1997). Therefore, it is reasonable to suggest that, like the Paf1C complex, separase may influence the expression of a specific number of genes, whose transcription would then be misregulated in esp1-1 mutants. Such defects, in combination with the transcriptional irregularities introduced by Paf1C mutants, could then be lethal. The observed increase in mRNA transcript level of the HSP30 and the HMRA2 loci in esp1-1 would suggest that this is a possibility (Figures 4-3, 4-4). Note that the qPCR analysis was performed in triplicate on technical replicates, and would need to be repeated with biological replicates to determine whether this increase is in fact statistically significant. In addition, global microarray analysis would be necessary to state with certainty that Esp1 in fact regulates transcription. The mechanism by which Esp1 may directly influence gene expression is also unclear at this point. Testing of the HSP30 locus also implied that any transcriptional influence Esp1 may have is unlikely due to a failure in cohesin translocation (Figure 4-3). However, this does not prohibit the possibility that Esp1’s influence on cohesin impacts gene expression in another manner. Indeed, the noted increase in HMRA2 expression in separase mutants could implicate a role for Esp1 in maintaining silenced chromatin (Figure 4-4). Although the SL of Paf1C mutants with esp1-1 suggested that separase may have a role in transcription, the alternative prospect that ESP1 expression itself is subject to Paf1C regulation must also be given due consideration. However, as ESP1 – or any obvious factors that may influence Esp1 activity such as PDS1, CDC20 and core cohesin components – were  132  not among the some 200 genes that exhibited changes in transcription upon deletion of critical Paf1C components, this explanation for the noted SL did not appear likely (Penheiter et al., 2005).  4.3.3  Esp1 and the 7-methylguanosine cap In comparison to the Paf1C, the genetic relationship between mRNA decapping  factors and esp1-1 was not straightforward. It was the loss of function of the Lsm proteins, but contrastingly the overexpression of the Pat1 and Dhh1 stimulatory decapping factors, that was the cause of lethality in an esp1-1 mutant (Figure 4-4). Interestingly, a relationship between Esp1 and the 5’ 7-methylguanosine cap of mature transcripts was already established when the overexpression of ESP1 was found to be capable of rescuing the temperature sensitivity of a mutant of the budding yeast capping enzyme guanylyltransferase (CEG1) (Schwer and Shuman, 1996). Specifically, it was the amino terminus of Esp1 – which lacks the catalytic domain – that proved sufficient for suppressing ceg1-ts growth defects. Schwer and Shuman speculated to the existence of a physical interaction between Ceg1 and Esp1, thereby stabilizing the capping enzyme against degradation (Schwer and Shuman, 1996). Another explanation, however, could be that Esp1 itself is directly involved in mRNA capping. Indeed, Schwer and Shuman noted segments of homology between the N-terminal domain of Esp1 and the D12 subunit of the vaccinia virus capping enzyme (Schwer and Shuman, 1996). Whether Ceg1 proves to be unstable in separase mutants or esp1-1 has defects in the capping reaction itself, both explanations could indeed explain how the misregulation of decapping factors impinges on esp1-1 viability. Further, Paf1C mutants cause an increase in transcripts targeted for nonsense mediated decay due to defects in pre-  133  mRNA 3’ end processing (Penheiter et al., 2005). In combination with capping mutants, the pervasive lack of stable mature transcripts could negatively impact cellular fitness. As a caveat, however, it is notable that ceg1-ts mutants result in a decline in mRNA levels by pulse-chase experiments, which is contrary to what was found for the HSP30 and HMRA2 loci (Schwer et al., 1998). Again, a genome wide analysis of esp1-1’s transcriptional profile at a restrictive temperature would be key in examining this further.  4.3.4  Esp1 and nuclear export Separase could also affect the rate of decapping – an explanation that could also  account for the suppression of ceg1-ts defects. A disruption of these activities in an esp1-1 mutant would also be exacerbated by the misregulation of decapping factors (Figure 4-1). I could not find evidence for a direct physical relationship between Esp1 and either Pat1 or Dhh1, making a direct role in decapping unlikely (Figure 4-5). So how else might Esp1 affect the rate of decapping? The answer might again lie in esp1-1 SGA screening hits (Figure 2-5, Tables 2-1, 2-2). APQ12, a gene that when deleted was found to be SL with esp1-1, has known defects in mRNA export (Baker et al., 2004). This genetic relationship, along with the identification of a nucleoporin (nup60∆) as SL with esp1-1 and a Ran GTPase (GSP2) as SDL, could reflect a role for separase in the export of mature transcripts from the nucleus (Kadowaki et al., 1993; Rout et al., 2000) (Figure 2-5, Tables 2-1, 2-2).  4.3.5  A new landscape for Esp1 study Investigating into the esp1-1 genetic interactome (see: Chapter 2) has ascribed a new  area of Esp1 function in mRNA regulation that has not been previously explored. The initial  134  studies described in this chapter have yet to elucidate the exact mechanism by which separase may influence the transcriptional landscape in S. cerevisiae. Microarray studies which could examine gene expression across the genome in an esp1-1 mutant may help illuminate whether the transcriptional landscape itself is regulated by separase or instead Esp1 acts posttranscriptionally. Subsequent investigations into the rate of mRNA capping/decapping and mRNA export and decay in esp1-1 would serve to facilitate further understanding of the exact nature of this new Esp1 function. The studies presented in this chapter are a prelude to an exciting new area of investigation into separase function.  4.4 4.4.1  Materials and methods Yeast strains and growth Strains used for this study are indicated in Tables 4-1. Strains were grown in either  rich (YPD) or minimal (SC) media and were incubated at 25˚C unless otherwise indicated. Standard protocols for yeast culture and transformation were followed (Guthrie and Fink, 2004). PAT1 and DHH1 were C-terminally tagged with 3HA::HIS3MX6 using a PCR-based method homologous recombination method for S. cerevisiae (Longtine et al., 1998). For analysis of heat shock genes, WT and esp1-1::URA3 cells were grown to log phase, then treated for two hours with Nz (15µg/mL, Sigma-Aldrich) at 30˚C. Cells were pelleted, resuspended in prewarmed YPD media, and incubated at 37˚C for 15 minutes. Samples were taken for fluorescence activated cell sorting (FACS, see: flow cytometry) and qPCR analysis before and after heat shock. HMRA2 mRNA transcript levels were monitored in WT and esp1-1::NAT strains grown to log phase in YPD and then shifted to 35˚C for two hours. Samples for qPCR were taken before and after temperature shift.  135  For observing Pat1 and Dhh1 banding patterns, WT strains carrying PAT1HA::HIS3MX6 or DHH-:HA-HIS3MX6 alleles, generously provided by Roy Parker, were grown to log phase, and split into four, separate 10mL fractions. One fraction was left untreated, while alpha factor (5µg/mL), HU (0.2M) or Nz (15µg/mL) was added to the other three fractions. Samples were taken for FACS analysis, and the remainder of the fraction was harvested for immunoblotting. WT and esp1-1 were also grown to log phase in 50 mL of YPD. Cells were then spun down and resuspended in prewarmed YPD and placed at 35˚C. Samples for immunoblotting were taken before and after four hours of temperature shift. Western blot sample preparation was as described in section 2.4.4, and 40µg of protein was run for each sample.  4.4.2  Spot assays WT and esp1-1::URA3 strains carrying the pRS316 vector were grown to mid-log  phase (O.D.600 = 0.5-1.0) in SC-URA at which point cells were diluted to an O.D.600 of 0.1. Subsequently, cells were serially diluted four times by a factor of 1:5 in YPD. 4µL of each dilution was spotted onto SC-URA containing either DMSO or 100µg/mL 6AU (stock prepared in DMSO). Plates were grown for a total of five days. The same strains, without pRS316, were also grown in YPD, serially diluted as described above, and 4µL of each dilution spotted on YPD and YPD plates supplemented with 0.025 µg/mL of CHX (stock prepared in ddH2O). Plates were grown at 33˚C for three days.  136  4.4.3  qPCR analysis RNA preparation and cDNA conversion for qPCR is described in 3.4.6.1 and 3.4.6.2.  Real-time PCR was done in triplicate and analyzed as described in 3.4.5.3. For heat shock analysis, three genes of interest were investigated: HSP30 (primers: forward, OVM732, 5’ GCG GCTCCTGAAACAAAAGA 3’; reverse, OVM733, 5’ GGGTTCGTGGATTGCAG TCT), SR09 (primers: forward: OVM734, 5’ GAAGCCGCTACCGTCAATGT 3’; reverse, OVM735, 5’ TTGGCTTCACCGGTAACGTT 3’) and YCR016W (primers: forward, OVM736: 5’ HMRA2 was tested for the mating tester locus (forward primer, OVM754, 5’ CTT GGA CGA AAT CCC CTC AGT 3’; reverse, OVM755, 5’ TTC CAC ATA GTC GTT CCA TTG C 3’) GGCGGATGGGTTGGTATTTA 3’ ; reverse primer, OVM 755, 5’ GGGTTCTCGATGTTCTTTGCA 3’). TAF10 was used as an internal control. Primers were designed using Primer Express (Applied Biosystems).  4.4.4  Flow cytometry For FACS analysis, 500µL-1mL of cells were harvested and resuspended in 1mL of  70% EtOH and kept overnight at 4˚C. To process the samples, cells were pelleted, resuspended in 200µL of 1mg/mL RNAseA in 0.2M Tris-HCl pH7.5 and incubated overnight at 37˚C. The next morning, 5µL of Proteinase K (20mg/mL) was added to the cells and incubated for an hour at 50˚C.  Cells were then pelleted, resuspended in 400µL of  0.2M Tris-HCl pH 7.5 and sonicated with a Branson sonifier for 20 seconds at 20% amplitude. Samples were then diluted with 600µL of 1mg/mL propidium iodide diluted in 0.2M TrisHCl pH 7.5. Samples were kept in the dark and allowed to stain for at least 30 minutes at room temperature. Flow cytometry was performed by a BD FACScan (BD  137  Biosciences) with BD Cell Quest Pro software and analyzed using FlowJo (Version 10.0.4). Data was gated for 1N populations and greater, with N> 20 000.  4.4.5  Co-immunoprecipitation WT and ESP1-13Myc::kanMX6 strains alone or in combination with PAT1-  HA::HIS3MX6 or DHH1-HA::HIS3MX6 were grown in 50 mL of YPD. Cells were harvested and lysed similarly to western blot samples (see: section 2.4.4). Beads were prepared by washing, per sample, 15µL of immunoglobulin G coupled Dynabeads® (Invitrogen) three times with 1mL of 5mg/mL bovine serum albumin dissolved in phosphate buffered saline . Beads were then resuspended in the wash buffer to create a 30µL 1:1 bead slurry, and incubated with 1µL anti-c-Myc antibody (9E10, Roche) overnight at 4˚C. For each strain tested, this 1:1 Myc-coupled bead slurry was added to 4mg of WCL and incubated overnight at 4˚C. After IP, beads were washed a total of 4 times with 1mL of 1X PBS/BSA and resuspended in 40µL 2x SDS loading buffer. 40µg of WCL and 5µL of IP were run for western blot analysis  4.4.6  Western blotting All samples were run on a 10% SDS PAGE gels and transferred to a nitrocellulose  membrane. Blots were probed with either anti-Myc (1:5000, 9E10, Roche), anti-HA (1:500, 12CA5, Roche ) or anti-Pat1 antibodies [1:5000, generous gift from Roy Parker (Nissan et al., 2010)]  138  4.4.7  Polysome assay Polysome analysis was then performed as described (Brengues et al., 2005). 200mL  of WT and esp1-1::URA3 cells were grown to mid-log phase in synthetic media. Cells were then pelleted, resuspended in prewarmed media and incubated at 35˚C for two hours. After harvesting, CHX (212µL of 53µg/mL stock) was added and cells harvested. Polysome extracts were then made and run on sucrose gradients to monitor polysome/ribosomal subunit distribution at an absorbance of 255 nm. The polysome assay was done in the lab of Jeff Coller.  139  Table 4-1. Strains used in this chapter Strain Y7092 YKH64/65 YVM1761 YKH60 YKH186 YJC751 YJC753 YKH299 YKH305  Genotype Mat α can1∆::STE2pr-Sp_his5 lyp1∆ his3∆1 leu2∆0 ura3∆0 met15∆0 Mat α can1∆::STE2pr-Sp_his5 lyp1∆ his3∆1 leu2∆0 ura3∆0 met15∆0 esp1-1::NATMX4 Mat a ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 Mat a ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 esp1-1::URA3 Mat a ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 ESP1-13myc::kanMX6 Mat a ura3 leu2 his3 met15 PAT1-3HA::HIS3MX6 Mat a ura3 leu2 his3 met15 DHH1-3HA::HIS3MX6 Mat a S288Ca ESP1-13Myc::KanMX6 PAT13HA::HIS3MX6 Mat a S288Ca ESP1-13Myc::KanMX6 DHH13HA::HIS3MX6 MATa his3Δ1 leu2Δ0 lys2Δ0 met15Δ ura3Δ0 pat1∆  Source (Tong and Boone, 2006) This study P. Hieter This study This study Parker lab Parker lab This study This study  Deletion (Giaever et al., collection 2002) a a combination of YPH499/YVM1761 (ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1) and yJC151 (ura3 leu2 his3 met15, Parker lab) thus the exact genotype is unknown  140  Figure 4-1. Overview of eukaryotic transcription (1-2) Transcription activation mediates assembly of the pre-initiation complex on the core promoter. (3) Serine 5 phosphorylation of the Rpb1 CTD initiates transcriptional elongation. (4-5) Subsequent phosphorylation of Serine 2 stimulates processive elongation of RNAPII. (6-7) Termination signals cause diassociation and recycling of the RNAPII complex. Cited from (Aygun and Svejstrup, 2010). Reprinted with permission © Elsevier.  141  Figure 4-2. Schematic representation of cap-dependent processes The 5’ mRNA cap binds to both nuclear (nuclear cap binding protein, denoted as nCBC here) and cytoplasmic (eIF4E) proteins to mediate important post-transcriptional events. CE = capping enzyme, MT= methyltransferase, NMD = nonsense mediated decay, SMD = Staufen mediated decay. Cited from (Topisirovic et al., 2011). Reprinted with permission © John Wiley and Sons.  142  Figure 4-3. mRNA decapping The translational repressors Pat1 and Dhh1 recruit the assembly of additional factors to mediate the removal of the 5’ cap by the Dcp1/2 decapping enzyme. Cited from (Ling et al., 2011). Reprinted with permission © John Wiley Sons.  143  mRNA decapping  Paf1 complex  Synthetic lethality hit  Query gene  Synthetic dosage lethality hit  Protein-protein interaction  Figure 4-4. esp1-1 protein-protein interaction network Protein-protein interactions among esp1-1 SL (red circles) and SDL (blue circles) genetic interactions. Analysis was performed by Anastasia Baryshnikova.  144  DMSO  6-azauracil  YPD  Cycloheximide  esp1-1  Wild Type  A.  esp1-1  Wild Type  B.  Figure 4-5. esp1-1 is sensitive to changes in mRNA regulation A serial dilution of esp1-1 and WT cells was spotted onto (A) YPD containing either DMSO or 100 µg/mL 6AU and incubated at the esp1-1 permissive temperature of 25˚C (B) YPD or YPD containing 0.025 µg/mL CHX at the esp1-1 semi-permissive temperature of 33˚C.  145  6  N=20 0000  Relative Transcript Levels  7 HSP30 esp1-1  SR09  Wild Type  5  YCR016W  1N 2N  4 3 2 1 0  Wild Type - Nz !"#$%&'()%*+,-%  esp1-1Nz ).(/0/%*+,-%  Wild Type - HS !"#$%&'()%*1.-%  esp1-1HS ).(/0/%*1.-%  Samples  Figure 4-6. HSP30 mRNA levels are upregulated in the esp1-1 mutant in response to heat shock WT and esp1-1 cells were grown for 2 hours in Nz at 30˚C, and then subjected to a 15 minute heat shock. qPCR analysis of the HSP30, SRO9 and YCR116W genes was performed in triplicate on cDNA from both strains before and after heat shock. FACS analysis confirmed the metaphase cell cycle arrest induced by Nz treatment. Samples are displayed on the Xaxis while relative transcript level compared to WT Nz treatment is shown on the Y-axis. Upper and lower limits for the three technical replicates are also displayed accordingly as error bars. TAF10 was used as an internal control.  146  Relative Transcript Levels  2.25 2 1.75 1.5 1.25 1 0.75 0.5 0.25 0  !"#$%&'()%*+% Wild Type  ),(-.-%*+% esp1-1  !/%0+% Wild Type  ),(-.-%0+% esp1-1  Samples Figure 4-7. HMRA2 transcript levels are upregulated in esp1-1 WT and esp1-1 cells were grown at a restrictive temperature of 35˚C for two hours. qPCR analysis of the HMRA2 locus was performed in triplicate on cDNA samples from before and after cells were shifted to the higher temperature. Samples are displayed on the X-axis while relative transcript level compared to the WT 25˚C control is shown on the Y-axis. TAF10 was used as an internal control. Upper and lower limits for the three technical replicates are also displayed accordingly as error bars. The location of the HMRA2 locus on chromosome III in relation to surrounding genes is also shown (www.yeastgenome.org), with the arrow denoting direction of transcription.  147  D  e  le  Ty p  ou b  W ild  le  ou b  D  Ty pe  W ild es Ty p1 pe -1  W ild T es yp p1 e -1  55  IP  IP  IP  IP  IP  IP  IP  IP  W ild  A.  Log  Log  B.  C.  55  148  Figure 4-8. Pat1 and Dhh1 do not physically interact with separase (A) Pat1-HA and Dhh1-3A full length and truncated protein migration in yeast lysates isolated from log phase, α-factor treated, HU treated and Nz treated cells. Blots probed with anti-HA (B) Pat1 protein fragments in WT versus esp1-1 strains that were shifted from a 25˚C permissive temperature to a restrictive 35˚C temperature for four hours. Blots were probed with anti-Pat1 antibody. A line between lanes indicates that, though samples were run on the same gel, they were not run side by side. (C) Anti-Myc IP from WT, Esp1-13Myc, Pat1-HA, Dhh1-HA, Pat1-HA Esp1-13Myc and Dhh1-3HA Esp1-13Myc strains. Immunoblot analysis was performed and probed with anti-Myc to detect presence of Esp1, and anti-HA to detect presence of Pat1 or Dhh1 in the IPs. Note: the ~55 kDa band present in all IPs (WT, Esp1-13Myc, Dhh1-HA and Double) shown in the HA immunoblot on the right corresponds to IgG. Molecular weights for all immunoblots are indicated on the left.  149  RNP  80S  RNP  80S  Polyribosome  60S  Polyribosome  60S 40S  40S  Wild Type  esp1-1  Figure 4-9. Polyribosome analysis of the esp1-1 mutant Polyribosome formation was analyzed in WT versus the esp1-1 mutant at a non-permissive temperature of 35˚C. The level of absorbance at 255nm is indicated by peak height, with density of fractions examined increasing from left to right. Individual peaks corresponded to ribonucleoproteins (RNPs), the small (40S) and large (60S) ribosomal subunits, the fully functional 80S ribosome as well as polyribosomes. This analysis was performed in Jeff Coller’s lab.  150  Chapter 5: Conclusions and future directions 5.1  Summary and perspectives Separin endopeptidases (separases) have been a marked area of research as they were  discovered to be responsible for sister chromatid separation throughout the late 1990s to early 2000s (Uhlmann et al., 1999; Uhlmann et al., 2000). Moreover, recent investigation into the clinical implications of separase activity has revealed a potential oncogenic role for hSeparase, with hSeparase overexpression common to many tumour profiles (Meyer et al., 2009). hSeparase’s securin inhibitor, pituitary tumour transforming gene (PTTG), has also become a well-established and characterized oncogene, even serving as a marker for malignancy (Fong et al., 2012; Solbach et al., 2004). As such, a thorough understanding of separase function using model organisms as a basis could prove important for future clinical research. Indeed, the sister chromatid separation role of separase was first defined in budding yeast, predominantly through ground-breaking work from the Nasmyth laboratory while at the Research Institute of Molecular Pathology in Vienna, Austria (Uhlmann et al., 1999; Uhlmann et al., 2000). Since then, research on Esp1 has uncovered further roles for the budding yeast separase in both spindle stability and mitotic exit (Jensen et al., 2001; Stegmeier et al., 2002; Sullivan et al., 2001). Mitotic exit delays are also present in zebrafish mutants of separase, again emphasizing the relevance of model organism separase studies to higher eukaryotes (Shepard et al., 2007). Presently, there are three known separase targets in budding yeast: one mitotic (Scc1) and one meiotic (Rec8) cohesin protein as well as the kinetochore-associated Slk19 protein (Buonomo et al., 2000; Sullivan et al., 2001; Uhlmann et al., 1999; Uhlmann et al., 2000). However, to my knowledge, Esp1 function has not been examined before on a global level.  151  The goal of this dissertation was therefore to provide a genome-wide perspective of Esp1 that could generate data suggestive of a novel separase function in S. cerevisiae. Taking advantage of the vast number of yeast genome collections, I collaborated with the Loewen laboratory here at the University of British Columbia to perform an array based robotic technique known as SGA, with the canonical esp1-1 separase mutant as a query (Tong et al., 2001). Using this SGA analysis to probe both the yeast deletion collection as well as the 2 micron pGAL1/10-GST-ORFX overexpression collection for genetic interactions, I uncovered and confirmed 15 null mutants (geneX∆) and 44 overexpressed ORFs (pGAL1/10-GSTORFX) capable of inducing lethality in the esp1-1 strain (Giaever et al., 2002; Sopko et al., 2006) (Figure 2-3 to 2-5, Tables 2-1 and 2-2). Both known SL hits - hsc82∆ and lte1∆ - and an Esp1 substrate (SLK19) were identified, lending credence to the veracity of these screens (Sarin et al., 2004; Stegmeier et al., 2002; Sullivan et al., 2001). Moreover, further examination of the genetic interactions using two approaches – GO analysis and comparison of the esp1-1 SL profile to the extensive database of query mutant SL profiles maintained by the Boone laboratory – further legitimized both screens, with both analyses identifying known Esp1 activities (Figures 2-5 and 2-6). The observations presented in Chapter 2 of this dissertation therefore further support the evidence for already characterized roles for separase, and more excitingly, propose new avenues of separase study to pursue. Two of these possibilities are presented in Chapter 3 and Chapter 4, and were followed up through work performed by Dr. Lina Ma and myself in the Measday laboratory as well as through collaborations with the Mayor laboratory here at the University of British Columbia and the Coller laboratory at Case Western University.  152  The most surprising finding from the SGA screens was the high enrichment of genes involved in RNA metabolic processes (Figure 2-5). Many of the proteins identified within these functional pathways had known involvement in transposition events (Figure 3-2). Affinity purification of Esp1 followed by mass spectrometry performed by Nancy Fang in the Mayor laboratory uncovered a potential physical interaction between Esp1 and yeast Ty elements. I confirmed that Esp1 interacts specifically with the IN portion of Ty1 elements by co-IP analysis (Figure 3-3). Using a pGAL1-Ty1-H3mHIS3AI assay, I found that esp1-1, smc3-1 and scc2-4 mutants have transposition defects, and that the esp1-1 defect in Ty1 transposition is rescued by the scc1-73 conditional allele (Figure 3-4 and 3-7). Interestingly, cohesin is first loaded at RNAPIII-transcribed genes while Ty1 integration is targeted upstream of genes transcribed by the same polymerase (Ciosk et al., 2000; D'Ambrosio et al., 2008; Devine and Boeke, 1996; Ji et al., 1993; Lengronne et al., 2004). Taken together, these results suggested that Esp1 may somehow be involved in targeting of the PIC complex specifically to preferred hotspots of integration in the genome shortly after cohesin is loaded. Physical interactions amongst SL and SDL hits also highlighted an enrichment for the Paf1C and mRNA decapping proteins (Figure 4-4). With a noticeable response of esp1-1 growth to drugs known to inhibit transcription/translation, I postulate that Esp1 may in fact function in mRNA biogenesis (Figure 4-5). I would further speculate that this role is prior to translation, as separase mutants have intact translational machinery (Figure 4-9). Analysis of expression levels of key genes in an esp1-1 mutant are consistent with the fact that separase may play a direct role in transcription (Figure 4-6 and 4-7). However, other SL/SDL hits and a prior study demonstrating a relationship between Esp1 and a subunit of mRNA capping enzyme - make a role in posttranscriptional modifications or nuclear export more likely  153  (Schwer and Shuman, 1996). Both transposition and mRNA biogenesis are novel areas of study for Esp1 activity, and quite outside the realm of what is currently know about separase function. In this way, these observations could prove significant to the already exciting field of separase study.  5.2 5.2.1  Future Studies Saturation of separase genetic interactions The SGA screens presented in Chapter 2 have greatly increased the genetic  interactome of esp1-1 – indeed, few SL and SDL interactions have previously been uncovered (see: http://thebiogrid.org/33341/summary/saccharomyces-cerevisiae/esp1.html for a full summary of known Esp1 physical and genetic interactions). However, many cell cycle genes are essential and as such were not subject to SL screening. There are several avenues to studying the ~1000 essential genes as conditional alleles, including promoter shutoff strains and heat-activated degron alleles (Dohmen and Varshavsky, 2005; Kanemaki et al., 2003). There are also collections of hypomorphic alleles, e.g. the decreased abundance by mRNA perturbation (DAmP) collection (Breslow et al., 2008; Schuldiner et al., 2005). However, more recently, the Boone laboratory at the University of Toronto and the Hieter laboratory at the University of British Columbia has collated over 700 conditional ORFs under the control of their native promoters and linked to a kanMX marker for ease of SGA screening (Ben-Aroya et al., 2008; Li et al., 2011). Performing another SGA analysis screen with this ts collection would allow us to amass another set of esp1-1 genetic relationships. It may also be of interest to probe the non-essential deletion mutant array, the ts collection and the pGAL1/10-GST-ORFX collection using a different conditional mutant of esp1 as a query  154  strain, specifically one that interferes with a different aspect of separase function. For example, the esp1-N5 mutant appears to have mutations confined to the first 500 bp of the ESP1 ORF and would be a good candidate as these analyses could serve to uncover further information about the as yet uncharacterized N-terminal domain of separase (Baskerville et al., 2008).  5.2.2 5.2.2.1  Further defining the role of separase in Ty1-mediated integration Testing the model The model put forth in Chapter 3 suggests that the PIC is targeted in an Esp1  dependent manner shortly after cohesin is loaded, and subsequent cohesin translocation perhaps even opening of the ring - is necessary to fulfill the integration (Figure 3-8). To more directly test that loading is necessary to integration, Smc proteins with defects in their ATPase domains (smc1E1158Q and smc3E1155Q) can be transformed with pGAL-Ty1H3mHIS3AI and tested for efficiency of Ty1 integration as described (see: section 3.4.4) (Hu et al., 2011). If cohesin loading/ATPase activity is in fact necessary for Ty1 transposition, the aforementioned mutants should reflect that Ty1 transposition is impeded and remain auxotrophic for HIS3 throughout the assay. I have also confirmed that transposition defects in esp1-1 are rescued by the simultaneous mutation of the cohesin protein scc1-73, perhaps suggesting that the cohesin ring must be opened to alleviate Ty1 integration errors caused by the lack of separase activity (Figure 3-4). To determine conclusively that separase-mediated integration is dependent on Esp1 proteolytic activity, a protease-deficient esp1 strain (esp1C1531A) can be examined (Uhlmann et al., 2000). As the mutation on its own is lethal, esp1C1531A is expressed under  155  inducible control through a GAL1 promoter at the TRP1 locus. Two strains should therefore be created - GAL1-ESP1 esp1-1 as a control and GAL1-esp1C1531A esp1-1 – and transformed with the pGAL1-Ty1-H3mHIS3AI vector. Ty1 transposition assays will be performed as described in 3.4.4 and assessed for transposition efficiency by their ability to become HIS3+. Note that placing these strains on galactose media will allow the simultaneous expression of the TY1 element as well as the WT/protease deficient ESP1 allele. WT ESP1 should consistently rescue the transposition defect of esp1-1, while the esp1C1531A allele would not be expected to if the proteolytic activity of separase is required for Ty1 transposition. Furthermore, under the conditions tested, the scc1-73 mutant itself did not appear to have transposition defects (Figure 3-4); however, the does not preclude the possibility that targeted Scc1 cleavage may in fact be necessary. After examining whether separase proteolytic activity is necessary for Ty1 transposition, it would also be of interest to test a non-cleavable version of SCC1 (SCC1R180DR268D) using the pGAL1-Ty1-H3mHIS3AI assay (Uhlmann et al., 1999). If Esp1 protease activity and Scc1 cleavage were necessary for Ty1 integration, it would support the notion that not only is translocation of the ring necessary for Ty1 integration necessary, but opening of the ring itself.  5.2.2.2  Cohesin, Esp1 and the PIC The next step would then be to fully understand all the components of the cohesin  complex that are required for Ty1 transposition by using the pGAL1-Ty1-H3mHIS3AI to test smc1, scc3, scc4, pds5 and wpl1 mutants. Our lab has access to the extensive collection of ts mutants (Li et al., 2011). Some ts mutants (pds1-128, scc1-73) have already been tested and do not display transposition defects (Figure 3-4). Our methodology for examining ts mutants  156  for Ty1 transposition efficiency through the pGAL1-Ty1-H3mHIS3AI system, however, has the caveat that all ts mutants have different restrictive temperatures. Thus, an alternative possibility would be to use the aforementioned DAmP collection. 842 essential yeast genes – including ESP1, PDS1, and all the major cohesin proteins - have been collected, with their 3’ untranslated region disrupted by an antibiotic resistance cassette (Breslow et al., 2008). As a result of this disruption, the mRNA transcript levels for these genes are reduced two to tenfold. Strains of interest can quite easily be obtained through Thermo Scientific and transformed with pGAL1-Ty1-H3mHIS3AI, affording us the ability to have consistency across strains and perform the assay at 25˚C as well (see: section 3.4.4). Transposition efficiency can again be measured by a HIS3+ phenotype to determine which cohesin proteins are necessary for Ty1 tranposition. Subsequently, all cohesin proteins of interest can be endogenously epitope tagged and examined for an interaction with the PIC through the co-IP approaches used for Esp1-13myc, Pds1-13myc and Scc1-13myc (see: section 3.4.3). As I suspect that Esp1 is the critical bridge between the PIC and cohesin, it would be of interest to also examine these interactions in an esp1-1 strain that has been incubated at a restrictive temperature to repress Esp1 activity. Finally, to test whether integration patterns of Esp1 and cohesin proteins mediate correct Ty1 insertion events, Dr. Lina Ma in our laboratory is currently examining de novo transposition events that occur at the preferred SUF16 locus on chromosome III [see for details: (Nyswaner et al., 2008)]. WT, esp1-1 and cohesin mutant strains carrying the pGAL1-Ty1-H3mHIS3A1 plasmid are induced in triplicate in liquid galactose media for 24 hours first at the permissive temperature of 25˚C. She will then also optimize a temperature for this assay that will allow us to inactivate Esp1 or cohesin but maintain some level of 157  transposition. Genomic DNA will be prepared and PCR analysis will be performed using one primer within the SNR33 gene and one primer in TY1. TY1 insertion events are expected as a ladder of PCR products ~1000bp to 1700bp. If esp1-1 or cohesin mutants have defects in targeting Ty1 either no PCR products will be detected, or a change in the pattern of Ty1 integration events (e.g. changes in PCR banding patterns) will be noticeable.  5.2.3  Esp1 and mRNA biogenesis As mentioned in discussing the observations presented in Chapter 4, the first  approach to investigating Esp1’s role in mRNA biogenesis would be to determine definitively the manner in which Esp1 facilitates mRNA events – either a direct involvement in transcription or a post-transcriptional function. Global examination of the impact of the esp1-1 mutation on transcriptional events would involve a collaboration with Dr. Zongli Luo in the Van Vuuren laboratory at the University of British Columbia. WT and esp1-1 cells will be grown to log phase in rich media and shifted to the restrictive temperature of 35˚C. Total mRNA will be prepared from each strain using an RNeasy Mini Kit (Qiagen) and hybridized to GeneChIP Yeast Genome 2.0 (Affymetrix) S. cerevisiae microarrays, which are comprised of 5,744 probe sets for 5841 yeast genes. Transcriptional events in esp1-1 mutants will be compared and contrasted to WT to determine the extent of transcriptional changes that exist when separase activity is repressed. Further, our lab could examine whether RNAPII recruitment is altered in separase mutants in collaboration with the Howe and Kobor laboratories at the University of British Columbia. WT and esp1-1 cells shifted to a nonpermissive temperature will be treated with 1% formaldehyde prior to chromatin extraction and shearing. After cross link reversal, DNA that contacts polymerase will be 158  purified using antibodies against RNAPII and then amplified, labeled with biotin, and finally hybridized to GeneChip 1.0R (Affymetrix) S. cerevisiae microarrays, which are comprised of over 3.2 million probes covering the complete genome (Schulze et al., 2009). Defects in polymerase recruitment in esp1-1 mutants would again be suggestive of a direct role in transcriptional stimulation. As also indicated in Chapter 4, I feel it is more likely that Esp1 has a role in posttranscriptional events. Overexpression of ESP1 has already been shown to alleviate the ts defects of the mRNA capping enzyme ceg1 mutant. To examine the relationship between Esp1 and Ceg1 more in depth, I propose adding a C-terminal 3HA epitope tag to CEG1 and mating it to ESP1-13myc::KanMX6. The resultant strain can then be used to determine whether Esp1 and Ceg1 co-IP, with a protocol similar to one described in 4.4.3. Further, we can examine the amount of capped versus uncapped pre-mRNA in the esp1-1 for specific genes of interest by preparing total RNA from both WT and esp1-1 cells grown at the restrictive temperature and then using anti-m7G antibodies to IP capped mRNA. Uncapped (supernatant) versus capped (IP’d) mRNA can then be examined using Northern analysis (He et al., 2008). The finding that esp1-1 SL/SDL hits enriched for nuclear export factors as well suggest that separase may have a role in nuclear export. Our laboratory can perform a fairly conventional in situ hybridization of polyadenlyated RNA. WT and esp1-1 cells will be grown at a restrictive temperature for two hours. These cells will then be fixed with formaldehyde, adhered to slides and hybridized with labeled oligo (dT). Slides will be mounted using media containing 4',6-diamidino-2-phenylindole, and the mRNA export can be observed using our Zeiss Axioplan 2 fluorescence microscope to quantify localization of 159  the polyadenylated mRNA . If esp1-1 in fact has nuclear export defects, far more polyadenlyated mRNA would be expected to localize to the nucleus (overlap with 4',6diamidino-2-phenylindole) than seen in WT cells (Baker et al., 2004).  5.3  Final thoughts Over the last 20 years, separase research has helped us comprehend sister chromatid  segregation and how it pertains to further mitotic events. Through the work presented in this dissertation and further work left for our laboratory to pursue, hopefully new insight into the complexity of Esp1 function can be provided.  160  Bibliography Adams, S.E., Mellor, J., Gull, K., Sim, R.B., Tuite, M.F., Kingsman, S.M., and Kingsman, A.J. (1987). The functions and relationships of Ty-VLP proteins in yeast reflect those of mammalian retroviral proteins. Cell 49, 111-119. Agarwal, R., and Cohen-Fix, O. (2002). Phosphorylation of the mitotic regulator Pds1/securin by Cdc28 is required for efficient nuclear localization of Esp1/separase. Genes & development 16, 1371-1382. Akiyoshi, B., Nelson, C.R., Ranish, J.A., and Biggins, S. (2009). Analysis of Ipl1-mediated phosphorylation of the Ndc80 kinetochore protein in Saccharomyces cerevisiae. Genetics 183, 1591-1595. Alexandru, G., Uhlmann, F., Mechtler, K., Poupart, M.A., and Nasmyth, K. (2001). Phosphorylation of the cohesin subunit Scc1 by Polo/Cdc5 kinase regulates sister chromatid separation in yeast. Cell 105, 459-472. Alexandru, G., Zachariae, W., Schleiffer, A., and Nasmyth, K. (1999). Sister chromatid separation and chromosome re-duplication are regulated by different mechanisms in response to spindle damage. The EMBO journal 18, 2707-2721. Aravind, L., and Koonin, E.V. (2002). Classification of the caspase-hemoglobinase fold: detection of new families and implications for the origin of the eukaryotic separins. Proteins 46, 355-367. Arumugam, P., Gruber, S., Tanaka, K., Haering, C.H., Mechtler, K., and Nasmyth, K. (2003). ATP hydrolysis is required for cohesin's association with chromosomes. Curr Biol 13, 1941-1953. Asakawa, K., Yoshida, S., Otake, F., and Toh-e, A. (2001). A novel functional domain of Cdc15 kinase is required for its interaction with Tem1 GTPase in Saccharomyces cerevisiae. Genetics 157, 1437-1450. Aygun, O., and Svejstrup, J.Q. (2010). RECQL5 helicase: connections to DNA recombination and RNA polymerase II transcription. DNA Repair (Amst) 9, 345-353. Bachant, J., Jessen, S.R., Kavanaugh, S.E., and Fielding, C.S. (2005). The yeast S phase checkpoint enables replicating chromosomes to bi-orient and restrain spindle extension during S phase distress. The Journal of cell biology 168, 999-1012. Bachman, N., Gelbart, M.E., Tsukiyama, T., and Boeke, J.D. (2005). TFIIIB subunit Bdp1p is required for periodic integration of the Ty1 retrotransposon and targeting of Isw2p to S. cerevisiae tDNAs. Genes & development 19, 955-964. Baker, K.E., Coller, J., and Parker, R. (2004). The yeast Apq12 protein affects nucleocytoplasmic mRNA transport. RNA 10, 1352-1358. 161  Bardin, A.J., and Amon, A. (2001). Men and sin: what's the difference? Nat Rev Mol Cell Biol 2, 815-826. Bardin, A.J., Visintin, R., and Amon, A. (2000). A mechanism for coupling exit from mitosis to partitioning of the nucleus. Cell 102, 21-31. Barre-Sinoussi, F., Chermann, J.C., Rey, F., Nugeyre, M.T., Chamaret, S., Gruest, J., Dauguet, C., Axler-Blin, C., Vezinet-Brun, F., Rouzioux, C., et al. (1983). Isolation of a Tlymphotropic retrovirus from a patient at risk for acquired immune deficiency syndrome (AIDS). Science 220, 868-871. Barrett, J.G., Manning, B.D., and Snyder, M. (2000). The Kar3p kinesin-related protein forms a novel heterodimeric structure with its associated protein Cik1p. Mol Biol Cell 11, 2373-2385. Baskerville, C., Segal, M., and Reed, S.I. (2008). The protease activity of yeast separase (esp1) is required for anaphase spindle elongation independently of its role in cleavage of cohesin. Genetics 178, 2361-2372. Bateson, W., and Mendel, G. (1909). Mendel's principles of heredity (Cambridge,, At the University press). Baum, P., Yip, C., Goetsch, L., and Byers, B. (1988). A yeast gene essential for regulation of spindle pole duplication. Mol Cell Biol 8, 5386-5397. Bausch, C., Noone, S., Henry, J.M., Gaudenz, K., Sanderson, B., Seidel, C., and Gerton, J.L. (2007). Transcription alters chromosomal locations of cohesin in Saccharomyces cerevisiae. Molecular and cellular biology 27, 8522-8532. Beach, D.L., Thibodeaux, J., Maddox, P., Yeh, E., and Bloom, K. (2000). The role of the proteins Kar9 and Myo2 in orienting the mitotic spindle of budding yeast. Curr Biol 10, 1497-1506. Beauregard, A., Curcio, M.J., and Belfort, M. (2008). The take and give between retrotransposable elements and their hosts. Annu Rev Genet 42, 587-617. Beckham, C.J., and Parker, R. (2008). P bodies, stress granules, and viral life cycles. Cell Host Microbe 3, 206-212. Beckouet, F., Hu, B., Roig, M.B., Sutani, T., Komata, M., Uluocak, P., Katis, V.L., Shirahige, K., and Nasmyth, K. (2010). An Smc3 acetylation cycle is essential for establishment of sister chromatid cohesion. Molecular cell 39, 689-699. Belcourt, M.F., and Farabaugh, P.J. (1990). Ribosomal frameshifting in the yeast retrotransposon Ty: tRNAs induce slippage on a 7 nucleotide minimal site. Cell 62, 339-352.  162  Ben-Aroya, S., Coombes, C., Kwok, T., O'Donnell, K.A., Boeke, J.D., and Hieter, P. (2008). Toward a comprehensive temperature-sensitive mutant repository of the essential genes of Saccharomyces cerevisiae. Molecular cell 30, 248-258. Betz, J.L., Chang, M., Washburn, T.M., Porter, S.E., Mueller, C.L., and Jaehning, J.A. (2002). Phenotypic analysis of Paf1/RNA polymerase II complex mutations reveals connections to cell cycle regulation, protein synthesis, and lipid and nucleic acid metabolism. Mol Genet Genomics 268, 272-285. Bloom, J., and Cross, F.R. (2007). Multiple levels of cyclin specificity in cell-cycle control. Nature reviews Molecular cell biology 8, 149-160. Bloom, K., and Joglekar, A. (2010). Towards building a chromosome segregation machine. Nature 463, 446-456. Boeck, R., Tarun, S., Jr., Rieger, M., Deardorff, J.A., Muller-Auer, S., and Sachs, A.B. (1996). The yeast Pan2 protein is required for poly(A)-binding protein-stimulated poly(A)nuclease activity. The Journal of biological chemistry 271, 432-438. Boeke, J.D., and Devine, S.E. (1998). Yeast retrotransposons: finding a nice quiet neighborhood. Cell 93, 1087-1089. Boeke, J.D., Garfinkel, D.J., Styles, C.A., and Fink, G.R. (1985). Ty elements transpose through an RNA intermediate. Cell 40, 491-500. Boeke, J.D., and Sandmeyer, S. (1991). Yeast Transposable Elements. In The Molecular and Cellular Biology of the Yeast Saccharomyces, J.R. Broach, J.R. Pringle, and E.W. Jones, eds. (Cold Spring Harbor, Cold Spring Harbor Laboratory Press), pp. 193-261. Bolton, E.C., Mildvan, A.S., and Boeke, J.D. (2002). Inhibition of reverse transcription in vivo by elevated manganese ion concentration. Molecular cell 9, 879-889. Bonnerot, C., Boeck, R., and Lapeyre, B. (2000). The two proteins Pat1p (Mrt1p) and Spb8p interact in vivo, are required for mRNA decay, and are functionally linked to Pab1p. Molecular and cellular biology 20, 5939-5946. Boone, C., Bussey, H., and Andrews, B.J. (2007). Exploring genetic interactions and networks with yeast. Nat Rev Genet 8, 437-449. Borges, V., Lehane, C., Lopez-Serra, L., Flynn, H., Skehel, M., Rolef Ben-Shahar, T., and Uhlmann, F. (2010). Hos1 deacetylates Smc3 to close the cohesin acetylation cycle. Molecular cell 39, 677-688. Bouveret, E., Rigaut, G., Shevchenko, A., Wilm, M., and Seraphin, B. (2000). A Sm-like protein complex that participates in mRNA degradation. The EMBO journal 19, 1661-1671. Brengues, M., Teixeira, D., and Parker, R. (2005). Movement of eukaryotic mRNAs between polysomes and cytoplasmic processing bodies. Science 310, 486-489. 163  Breslow, D.K., Cameron, D.M., Collins, S.R., Schuldiner, M., Stewart-Ornstein, J., Newman, H.W., Braun, S., Madhani, H.D., Krogan, N.J., and Weissman, J.S. (2008). A comprehensive strategy enabling high-resolution functional analysis of the yeast genome. Nat Methods 5, 711-718. Brockmann, R., Beyer, A., Heinisch, J.J., and Wilhelm, T. (2007). Posttranscriptional expression regulation: what determines translation rates? PLoS Comput Biol 3, e57. Brown, C.E., Tarun, S.Z., Jr., Boeck, R., and Sachs, A.B. (1996). PAN3 encodes a subunit of the Pab1p-dependent poly(A) nuclease in Saccharomyces cerevisiae. Molecular and cellular biology 16, 5744-5753. Bryk, M., Banerjee, M., Conte, D., Jr., and Curcio, M.J. (2001). The Sgs1 helicase of Saccharomyces cerevisiae inhibits retrotransposition of Ty1 multimeric arrays. Mol Cell Biol 21, 5374-5388. Buonomo, S.B., Clyne, R.K., Fuchs, J., Loidl, J., Uhlmann, F., and Nasmyth, K. (2000). Disjunction of homologous chromosomes in meiosis I depends on proteolytic cleavage of the meiotic cohesin Rec8 by separin. Cell 103, 387-398. Buratowski, S. (2009). Progression through the RNA polymerase II CTD cycle. Molecular cell 36, 541-546. Burkett, T.J., and Garfinkel, D.J. (1994). Molecular characterization of the SPT23 gene: a dosage-dependent suppressor of Ty-induced promoter mutations from Saccharomyces cerevisiae. Yeast 10, 81-92. Chalker, D.L., and Sandmeyer, S.B. (1992). Ty3 integrates within the region of RNA polymerase III transcription initiation. Genes & development 6, 117-128. Chan, K.L., Roig, M.B., Hu, B., Beckouet, F., Metson, J., and Nasmyth, K. (2012). Cohesin's DNA exit gate is distinct from its entrance gate and is regulated by acetylation. Cell 150, 961-974. Chang, M., French-Cornay, D., Fan, H.Y., Klein, H., Denis, C.L., and Jaehning, J.A. (1999). A complex containing RNA polymerase II, Paf1p, Cdc73p, Hpr1p, and Ccr4p plays a role in protein kinase C signaling. Molecular and cellular biology 19, 1056-1067. Checkley, M.A., Nagashima, K., Lockett, S.J., Nyswaner, K.M., and Garfinkel, D.J. (2010). P-body components are required for Ty1 retrotransposition during assembly of retrotransposition-competent virus-like particles. Mol Cell Biol 30, 382-398. Cheeseman, I.M., Anderson, S., Jwa, M., Green, E.M., Kang, J., Yates, J.R., 3rd, Chan, C.S., Drubin, D.G., and Barnes, G. (2002). Phospho-regulation of kinetochore-microtubule attachments by the Aurora kinase Ipl1p. Cell 111, 163-172.  164  Cheeseman, I.M., Chappie, J.S., Wilson-Kubalek, E.M., and Desai, A. (2006). The conserved KMN network constitutes the core microtubule-binding site of the kinetochore. Cell 127, 983-997. Cho, R.J., Campbell, M.J., Winzeler, E.A., Steinmetz, L., Conway, A., Wodicka, L., Wolfsberg, T.G., Gabrielian, A.E., Landsman, D., Lockhart, D.J., et al. (1998). A genomewide transcriptional analysis of the mitotic cell cycle. Molecular cell 2, 65-73. Ciferri, C., De Luca, J., Monzani, S., Ferrari, K.J., Ristic, D., Wyman, C., Stark, H., Kilmartin, J., Salmon, E.D., and Musacchio, A. (2005). Architecture of the human ndc80hec1 complex, a critical constituent of the outer kinetochore. The Journal of biological chemistry 280, 29088-29095. Ciosk, R., Shirayama, M., Shevchenko, A., Tanaka, T., Toth, A., and Nasmyth, K. (2000). Cohesin's binding to chromosomes depends on a separate complex consisting of Scc2 and Scc4 proteins. Mol Cell 5, 243-254. Ciosk, R., Zachariae, W., Michaelis, C., Shevchenko, A., Mann, M., and Nasmyth, K. (1998). An ESP1/PDS1 complex regulates loss of sister chromatid cohesion at the metaphase to anaphase transition in yeast. Cell 93, 1067-1076. Clare, J., and Farabaugh, P. (1985). Nucleotide sequence of a yeast Ty element: evidence for an unusual mechanism of gene expression. Proceedings of the National Academy of Sciences of the United States of America 82, 2829-2833. Clarke, D.J., Segal, M., Andrews, C.A., Rudyak, S.G., Jensen, S., Smith, K., and Reed, S.I. (2003). S-phase checkpoint controls mitosis via an APC-independent Cdc20p function. Nature cell biology 5, 928-935. Clift, D., Bizzari, F., and Marston, A.L. (2009). Shugoshin prevents cohesin cleavage by PP2A(Cdc55)-dependent inhibition of separase. Genes & development 23, 766-780. Cohen-Fix, O., and Koshland, D. (1999). Pds1p of budding yeast has dual roles: inhibition of anaphase initiation and regulation of mitotic exit. Genes & development 13, 1950-1959. Cohen-Fix, O., Peters, J.M., Kirschner, M.W., and Koshland, D. (1996). Anaphase initiation in Saccharomyces cerevisiae is controlled by the APC-dependent degradation of the anaphase inhibitor Pds1p. Genes Dev 10, 3081-3093. Coller, J.M., Tucker, M., Sheth, U., Valencia-Sanchez, M.A., and Parker, R. (2001). The DEAD box helicase, Dhh1p, functions in mRNA decapping and interacts with both the decapping and deadenylase complexes. RNA 7, 1717-1727. Conte, D., Jr., Barber, E., Banerjee, M., Garfinkel, D.J., and Curcio, M.J. (1998). Posttranslational regulation of Ty1 retrotransposition by mitogen-activated protein kinase Fus3. Molecular and cellular biology 18, 2502-2513.  165  Costanzo, M., Baryshnikova, A., Bellay, J., Kim, Y., Spear, E.D., Sevier, C.S., Ding, H., Koh, J.L., Toufighi, K., Mostafavi, S., et al. (2010). The genetic landscape of a cell. Science 327, 425-431. Curcio, M.J., and Garfinkel, D.J. (1991). Single-step selection for Ty1 element retrotransposition. Proc Natl Acad Sci U S A 88, 936-940. Curcio, M.J., and Garfinkel, D.J. (1992). Posttranslational control of Ty1 retrotransposition occurs at the level of protein processing. Mol Cell Biol 12, 2813-2825. Curcio, M.J., Hedge, A.M., Boeke, J.D., and Garfinkel, D.J. (1990). Ty RNA levels determine the spectrum of retrotransposition events that activate gene expression in Saccharomyces cerevisiae. Mol Gen Genet 220, 213-221. D'Ambrosio, C., Schmidt, C.K., Katou, Y., Kelly, G., Itoh, T., Shirahige, K., and Uhlmann, F. (2008). Identification of cis-acting sites for condensin loading onto budding yeast chromosomes. Genes Dev 22, 2215-2227. D'Amours, D., and Amon, A. (2004). At the interface between signaling and executing anaphase--Cdc14 and the FEAR network. Genes Dev 18, 2581-2595. D'Amours, D., Stegmeier, F., and Amon, A. (2004). Cdc14 and condensin control the dissolution of cohesin-independent chromosome linkages at repeated DNA. Cell 117, 455469. D'Aquino, K.E., Monje-Casas, F., Paulson, J., Reiser, V., Charles, G.M., Lai, L., Shokat, K.M., and Amon, A. (2005). The protein kinase Kin4 inhibits exit from mitosis in response to spindle position defects. Mol Cell 19, 223-234. Daniel, J.A., Yoo, J., Bettinger, B.T., Amberg, D.C., and Burke, D.J. (2006). Eliminating gene conversion improves high-throughput genetics in Saccharomyces cerevisiae. Genetics 172, 709-711. Davierwala, A.P., Haynes, J., Li, Z., Brost, R.L., Robinson, M.D., Yu, L., Mnaimneh, S., Ding, H., Zhu, H., Chen, Y., et al. (2005). The synthetic genetic interaction spectrum of essential genes. Nat Genet 37, 1147-1152. De Antoni, A., Pearson, C.G., Cimini, D., Canman, J.C., Sala, V., Nezi, L., Mapelli, M., Sironi, L., Faretta, M., Salmon, E.D., et al. (2005). The Mad1/Mad2 complex as a template for Mad2 activation in the spindle assembly checkpoint. Current biology : CB 15, 214-225. DeLuca, J.G., Gall, W.E., Ciferri, C., Cimini, D., Musacchio, A., and Salmon, E.D. (2006). Kinetochore microtubule dynamics and attachment stability are regulated by Hec1. Cell 127, 969-982. Derr, L.K., and Strathern, J.N. (1993). A role for reverse transcripts in gene conversion. Nature 361, 170-173.  166  Devine, S.E., and Boeke, J.D. (1996). Integration of the yeast retrotransposon Ty1 is targeted to regions upstream of genes transcribed by RNA polymerase III. Genes & development 10, 620-633. Dohmen, R.J., and Varshavsky, A. (2005). Heat-inducible degron and the making of conditional mutants. Methods in enzymology 399, 799-822. Dunckley, T., and Parker, R. (1999). The DCP2 protein is required for mRNA decapping in Saccharomyces cerevisiae and contains a functional MutT motif. The EMBO journal 18, 5411-5422. Eichinger, D.J., and Boeke, J.D. (1990). A specific terminal structure is required for Ty1 transposition. Genes Dev 4, 324-330. Elder, R.T., St John, T.P., Stinchcomb, D.T., Davis, R.W., and Scherer, S. (1981). Studies on the transposable element Ty1 of yeast. I. RNA homologous to Ty1. II. Recombination and expression of Ty1 and adjacent sequences. Cold Spring Harb Symp Quant Biol 45 Pt 2, 581591. Exinger, F., and Lacroute, F. (1992). 6-Azauracil inhibition of GTP biosynthesis in Saccharomyces cerevisiae. Curr Genet 22, 9-11. Fassler, J.S., and Winston, F. (1988). Isolation and analysis of a novel class of suppressor of Ty insertion mutations in Saccharomyces cerevisiae. Genetics 118, 203-212. Field, J., Nikawa, J., Broek, D., MacDonald, B., Rodgers, L., Wilson, I.A., Lerner, R.A., and Wigler, M. (1988). Purification of a RAS-responsive adenylyl cyclase complex from Saccharomyces cerevisiae by use of an epitope addition method. Molecular and cellular biology 8, 2159-2165. Fink, G.R., Boeke, J.D., and Garfinkel, D.J. (1986). The Mechanism and Consequences of Retrotransposition. Trends in Genetics 2, 118-123. Fischer, N., and Weis, K. (2002). The DEAD box protein Dhh1 stimulates the decapping enzyme Dcp1. The EMBO journal 21, 2788-2797. Fisher, R.A. (1919). The correlation between relatives on the supposition of mendelian inheritance. Transactions of the Royal Society of Edinburgh 52, 399-433. Fong, M.Y., Farghaly, H., and Kakar, S.S. (2012). Tumorigenic potential of pituitary tumor transforming gene (PTTG) in vivo investigated using a transgenic mouse model, and effects of cross breeding with p53 (+/-) transgenic mice. BMC Cancer 12, 532. Forsburg, S.L., and Nurse, P. (1991). Cell cycle regulation in the yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe. Annu Rev Cell Biol 7, 227-256.  167  Fraschini, R., Beretta, A., Sironi, L., Musacchio, A., Lucchini, G., and Piatti, S. (2001). Bub3 interaction with Mad2, Mad3 and Cdc20 is mediated by WD40 repeats and does not require intact kinetochores. The EMBO journal 20, 6648-6659. Gallo, R.C. (1985). The human T-cell leukemia/lymphotropic retroviruses (HTLV) family: past, present, and future. Cancer Res 45, 4524s-4533s. Gandhi, R., Gillespie, P.J., and Hirano, T. (2006). Human Wapl is a cohesin-binding protein that promotes sister-chromatid resolution in mitotic prophase. Current biology : CB 16, 24062417. Garfinkel, D.J., Hedge, A.M., Youngren, S.D., and Copeland, T.D. (1991). Proteolytic processing of pol-TYB proteins from the yeast retrotransposon Ty1. Journal of virology 65, 4573-4581. Gasch, A.P., Spellman, P.T., Kao, C.M., Carmel-Harel, O., Eisen, M.B., Storz, G., Botstein, D., and Brown, P.O. (2000). Genomic expression programs in the response of yeast cells to environmental changes. Molecular biology of the cell 11, 4241-4257. Gelbart, M.E., Bachman, N., Delrow, J., Boeke, J.D., and Tsukiyama, T. (2005). Genomewide identification of Isw2 chromatin-remodeling targets by localization of a catalytically inactive mutant. Genes & development 19, 942-954. Ghaemmaghami, S., Huh, W.K., Bower, K., Howson, R.W., Belle, A., Dephoure, N., O'Shea, E.K., and Weissman, J.S. (2003). Global analysis of protein expression in yeast. Nature 425, 737-741. Giaever, G., Chu, A.M., Ni, L., Connelly, C., Riles, L., Veronneau, S., Dow, S., LucauDanila, A., Anderson, K., Andre, B., et al. (2002). Functional profiling of the Saccharomyces cerevisiae genome. Nature 418, 387-391. Gimenez-Abian, J.F., Sumara, I., Hirota, T., Hauf, S., Gerlich, D., de la Torre, C., Ellenberg, J., and Peters, J.M. (2004). Regulation of sister chromatid cohesion between chromosome arms. Current biology : CB 14, 1187-1193. Glynn, E.F., Megee, P.C., Yu, H.G., Mistrot, C., Unal, E., Koshland, D.E., DeRisi, J.L., and Gerton, J.L. (2004). Genome-wide mapping of the cohesin complex in the yeast Saccharomyces cerevisiae. PLoS Biol 2, E259. Goffeau, A., Barrell, B.G., Bussey, H., Davis, R.W., Dujon, B., Feldmann, H., Galibert, F., Hoheisel, J.D., Jacq, C., Johnston, M., et al. (1996). Life with 6000 genes. Science 274, 546, 563-547. Gorr, I.H., Boos, D., and Stemmann, O. (2005). Mutual inhibition of separase and Cdk1 by two-step complex formation. Molecular cell 19, 135-141.  168  Griffith, J.L., Coleman, L.E., Raymond, A.S., Goodson, S.G., Pittard, W.S., Tsui, C., and Devine, S.E. (2003). Functional genomics reveals relationships between the retrovirus-like Ty1 element and its host Saccharomyces cerevisiae. Genetics 164, 867-879. Gruber, S., Arumugam, P., Katou, Y., Kuglitsch, D., Helmhart, W., Shirahige, K., and Nasmyth, K. (2006). Evidence that loading of cohesin onto chromosomes involves opening of its SMC hinge. Cell 127, 523-537. Gruber, S., Haering, C.H., and Nasmyth, K. (2003). Chromosomal cohesin forms a ring. Cell 112, 765-777. Guacci, V., Koshland, D., and Strunnikov, A. (1997). A direct link between sister chromatid cohesion and chromosome condensation revealed through the analysis of MCD1 in S. cerevisiae. Cell 91, 47-57. Guarente, L. (1993). Synthetic enhancement in gene interaction: a genetic tool come of age. Trends in genetics : TIG 9, 362-366. Gullerova, M., and Proudfoot, N.J. (2008). Cohesin complex promotes transcriptional termination between convergent genes in S. pombe. Cell 132, 983-995. Guthrie, C., and Fink, G.R. (2004). Guide to Yeast Genetics and Molecular and Cell Biology, Vol 1. Gutierrez-Caballero, C., Cebollero, L.R., and Pendas, A.M. (2012). Shugoshins: from protectors of cohesion to versatile adaptors at the centromere. Trends in genetics : TIG 28, 351-360. Haering, C.H., Lowe, J., Hochwagen, A., and Nasmyth, K. (2002). Molecular architecture of SMC proteins and the yeast cohesin complex. Molecular cell 9, 773-788. Haering, C.H., Schoffnegger, D., Nishino, T., Helmhart, W., Nasmyth, K., and Lowe, J. (2004). Structure and stability of cohesin's Smc1-kleisin interaction. Molecular cell 15, 951964. Hagstrom, K.A., and Meyer, B.J. (2003). Condensin and cohesin: more than chromosome compactor and glue. Nature reviews Genetics 4, 520-534. Hahn, S., and Young, E.T. (2011). Transcriptional regulation in Saccharomyces cerevisiae: transcription factor regulation and function, mechanisms of initiation, and roles of activators and coactivators. Genetics 189, 705-736. Hakimi, M.A., Bochar, D.A., Schmiesing, J.A., Dong, Y., Barak, O.G., Speicher, D.W., Yokomori, K., and Shiekhattar, R. (2002). A chromatin remodelling complex that loads cohesin onto human chromosomes. Nature 418, 994-998. Hani, J., and Feldmann, H. (1998). tRNA genes and retroelements in the yeast genome. Nucleic Acids Res 26, 689-696. 169  Hartman, T., Stead, K., Koshland, D., and Guacci, V. (2000). Pds5p is an essential chromosomal protein required for both sister chromatid cohesion and condensation in Saccharomyces cerevisiae. The Journal of cell biology 151, 613-626. Hauf, S., Roitinger, E., Koch, B., Dittrich, C.M., Mechtler, K., and Peters, J.M. (2005). Dissociation of cohesin from chromosome arms and loss of arm cohesion during early mitosis depends on phosphorylation of SA2. PLoS Biol 3, e69. Hauf, S., Waizenegger, I.C., and Peters, J.M. (2001). Cohesin cleavage by separase required for anaphase and cytokinesis in human cells. Science 293, 1320-1323. He, F., Amrani, N., Johansson, M.J., and Jacobson, A. (2008). Chapter 6. Qualitative and quantitative assessment of the activity of the yeast nonsense-mediated mRNA decay pathway. Methods in enzymology 449, 127-147. Hickman, M.A., Froyd, C.A., and Rusche, L.N. (2011). Reinventing heterochromatin in budding yeasts: Sir2 and the origin recognition complex take center stage. Eukaryot Cell 10, 1183-1192. Higuchi, T., and Uhlmann, F. (2005). Stabilization of microtubule dynamics at anaphase onset promotes chromosome segregation. Nature 433, 171-176. Hilioti, Z., Chung, Y.S., Mochizuki, Y., Hardy, C.F., and Cohen-Fix, O. (2001). The anaphase inhibitor Pds1 binds to the APC/C-associated protein Cdc20 in a destruction boxdependent manner. Curr Biol 11, 1347-1352. Hirano, T., Funahashi, S., Uemura, T., and Yanagida, M. (1986). Isolation and characterization of Schizosaccharomyces pombe cutmutants that block nuclear division but not cytokinesis. The EMBO journal 5, 2973-2979. Hofken, T., and Schiebel, E. (2002). A role for cell polarity proteins in mitotic exit. EMBO J 21, 4851-4862. Holland, A.J., Bottger, F., Stemmann, O., and Taylor, S.S. (2007). Protein phosphatase 2A and separase form a complex regulated by separase autocleavage. The Journal of biological chemistry 282, 24623-24632. Hornig, N.C., Knowles, P.P., McDonald, N.Q., and Uhlmann, F. (2002). The dual mechanism of separase regulation by securin. Current biology : CB 12, 973-982. Hornig, N.C., and Uhlmann, F. (2004). Preferential cleavage of chromatin-bound cohesin after targeted phosphorylation by Polo-like kinase. EMBO J 23, 3144-3153. Hu, B., Itoh, T., Mishra, A., Katoh, Y., Chan, K.L., Upcher, W., Godlee, C., Roig, M.B., Shirahige, K., and Nasmyth, K. (2011). ATP hydrolysis is required for relocating cohesin from sites occupied by its Scc2/4 loading complex. Curr Biol 21, 12-24.  170  Huang, C.E., Milutinovich, M., and Koshland, D. (2005). Rings, bracelet or snaps: fashionable alternatives for Smc complexes. Philos Trans R Soc Lond B Biol Sci 360, 537542. Huang, J., Brito, I.L., Villen, J., Gygi, S.P., Amon, A., and Moazed, D. (2006). Inhibition of homologous recombination by a cohesin-associated clamp complex recruited to the rDNA recombination enhancer. Genes Dev 20, 2887-2901. Huh, W.K., Falvo, J.V., Gerke, L.C., Carroll, A.S., Howson, R.W., Weissman, J.S., and O'Shea, E.K. (2003). Global analysis of protein localization in budding yeast. Nature 425, 686-691. Ishiguro, T., Tanaka, K., Sakuno, T., and Watanabe, Y. (2010). Shugoshin-PP2A counteracts casein-kinase-1-dependent cleavage of Rec8 by separase. Nature cell biology 12, 500-506. Ishihama, Y., Rappsilber, J., and Mann, M. (2006). Modular stop and go extraction tips with stacked disks for parallel and multidimensional Peptide fractionation in proteomics. J Proteome Res 5, 988-994. Itoh, N., Yamada, H., Kaziro, Y., and Mizumoto, K. (1987). Messenger RNA guanylyltransferase from Saccharomyces cerevisiae. Large scale purification, subunit functions, and subcellular localization. The Journal of biological chemistry 262, 1989-1995. Jager, H., Herzig, A., Lehner, C.F., and Heidmann, S. (2001). Drosophila separase is required for sister chromatid separation and binds to PIM and THR. Genes & development 15, 25722584. Jager, H., Herzig, B., Herzig, A., Sticht, H., Lehner, C.F., and Heidmann, S. (2004). Structure predictions and interaction studies indicate homology of separase N-terminal regulatory domains and Drosophila THR. Cell cycle 3, 182-188. Jaspersen, S.L., Charles, J.F., and Morgan, D.O. (1999). Inhibitory phosphorylation of the APC regulator Hct1 is controlled by the kinase Cdc28 and the phosphatase Cdc14. Current biology : CB 9, 227-236. Jaspersen, S.L., and Winey, M. (2004). The budding yeast spindle pole body: structure, duplication, and function. Annu Rev Cell Dev Biol 20, 1-28. Jensen, S., Segal, M., Clarke, D.J., and Reed, S.I. (2001). A novel role of the budding yeast separin Esp1 in anaphase spindle elongation: evidence that proper spindle association of Esp1 is regulated by Pds1. J Cell Biol 152, 27-40. Ji, H., Moore, D.P., Blomberg, M.A., Braiterman, L.T., Voytas, D.F., Natsoulis, G., and Boeke, J.D. (1993). Hotspots for unselected Ty1 transposition events on yeast chromosome III are near tRNA genes and LTR sequences. Cell 73, 1007-1018. Jin, F., Liu, H., Liang, F., Rizkallah, R., Hurt, M.M., and Wang, Y. (2008). Temporal control of the dephosphorylation of Cdk substrates by mitotic exit pathways in budding yeast. 171  Proceedings of the National Academy of Sciences of the United States of America 105, 16177-16182. Kadowaki, T., Goldfarb, D., Spitz, L.M., Tartakoff, A.M., and Ohno, M. (1993). Regulation of RNA processing and transport by a nuclear guanine nucleotide release protein and members of the Ras superfamily. The EMBO journal 12, 2929-2937. Kaizu, K., Moriya, H., and Kitano, H. (2010). Fragilities caused by dosage imbalance in regulation of the budding yeast cell cycle. PLoS Genet 6, e1000919. Kanemaki, M., Sanchez-Diaz, A., Gambus, A., and Labib, K. (2003). Functional proteomic identification of DNA replication proteins by induced proteolysis in vivo. Nature 423, 720724. Katis, V.L., Lipp, J.J., Imre, R., Bogdanova, A., Okaz, E., Habermann, B., Mechtler, K., Nasmyth, K., and Zachariae, W. (2010). Rec8 phosphorylation by casein kinase 1 and Cdc7Dbf4 kinase regulates cohesin cleavage by separase during meiosis. Developmental cell 18, 397-409. Kawakami, K., Pande, S., Faiola, B., Moore, D.P., Boeke, J.D., Farabaugh, P.J., Strathern, J.N., Nakamura, Y., and Garfinkel, D.J. (1993). A rare tRNA-Arg(CCU) that regulates Ty1 element ribosomal frameshifting is essential for Ty1 retrotransposition in Saccharomyces cerevisiae. Genetics 135, 309-320. Kedersha, N., and Anderson, P. (2009). Regulation of translation by stress granules and processing bodies. Prog Mol Biol Transl Sci 90, 155-185. Kelley, R., and Ideker, T. (2005). Systematic interpretation of genetic interactions using protein networks. Nature biotechnology 23, 561-566. Kenna, M.A., Brachmann, C.B., Devine, S.E., and Boeke, J.D. (1998). Invading the yeast nucleus: a nuclear localization signal at the C terminus of Ty1 integrase is required for transposition in vivo. Mol Cell Biol 18, 1115-1124. Kim, J.M., Vanguri, S., Boeke, J.D., Gabriel, A., and Voytas, D.F. (1998). Transposable elements and genome organization: a comprehensive survey of retrotransposons revealed by the complete Saccharomyces cerevisiae genome sequence. Genome Res 8, 464-478. Kirchner, J., Connolly, C.M., and Sandmeyer, S.B. (1995). Requirement of RNA polymerase III transcription factors for in vitro position-specific integration of a retroviruslike element. Science 267, 1488-1491. Kitajima, T.S., Sakuno, T., Ishiguro, K., Iemura, S., Natsume, T., Kawashima, S.A., and Watanabe, Y. (2006). Shugoshin collaborates with protein phosphatase 2A to protect cohesin. Nature 441, 46-52.  172  Kitamura, E., Tanaka, K., Kitamura, Y., and Tanaka, T.U. (2007). Kinetochore microtubule interaction during S phase in Saccharomyces cerevisiae. Genes & development 21, 33193330. Knapp, D., Bhoite, L., Stillman, D.J., and Nasmyth, K. (1996). The transcription factor Swi5 regulates expression of the cyclin kinase inhibitor p40SIC1. Molecular and cellular biology 16, 5701-5707. Kostriken, R., Strathern, J.N., Klar, A.J., Hicks, J.B., and Heffron, F. (1983). A site-specific endonuclease essential for mating-type switching in Saccharomyces cerevisiae. Cell 35, 167174. Krishnan, V., Nirantar, S., Crasta, K., Cheng, A.Y., and Surana, U. (2004). DNA replication checkpoint prevents precocious chromosome segregation by regulating spindle behavior. Mol Cell 16, 687-700. Kueng, S., Hegemann, B., Peters, B.H., Lipp, J.J., Schleiffer, A., Mechtler, K., and Peters, J.M. (2006). Wapl controls the dynamic association of cohesin with chromatin. Cell 127, 955-967. Kumada, K., Yao, R., Kawaguchi, T., Karasawa, M., Hoshikawa, Y., Ichikawa, K., Sugitani, Y., Imoto, I., Inazawa, J., Sugawara, M., et al. (2006). The selective continued linkage of centromeres from mitosis to interphase in the absence of mammalian separase. The Journal of cell biology 172, 835-846. Kumar, A., Agarwal, S., Heyman, J.A., Matson, S., Heidtman, M., Piccirillo, S., Umansky, L., Drawid, A., Jansen, R., Liu, Y., et al. (2002). Subcellular localization of the yeast proteome. Genes & development 16, 707-719. LaGrandeur, T.E., and Parker, R. (1998). Isolation and characterization of Dcp1p, the yeast mRNA decapping enzyme. The EMBO journal 17, 1487-1496. Laloraya, S., Guacci, V., and Koshland, D. (2000). Chromosomal addresses of the cohesin component Mcd1p. The Journal of cell biology 151, 1047-1056. Lampert, F., Hornung, P., and Westermann, S. (2010). The Dam1 complex confers microtubule plus end-tracking activity to the Ndc80 kinetochore complex. The Journal of cell biology 189, 641-649. Lau, D.T., and Murray, A.W. (2012). Mad2 and Mad3 cooperate to arrest budding yeast in mitosis. Current biology : CB 22, 180-190. Lawler, J.F., Jr., Haeusser, D.P., Dull, A., Boeke, J.D., and Keeney, J.B. (2002). Ty1 defect in proteolysis at high temperature. Journal of virology 76, 4233-4240. Lee, B.S., Lichtenstein, C.P., Faiola, B., Rinckel, L.A., Wysock, W., Curcio, M.J., and Garfinkel, D.J. (1998). Posttranslational inhibition of Ty1 retrotransposition by nucleotide  173  excision repair/transcription factor TFIIH subunits Ssl2p and Rad3p. Genetics 148, 17431761. Leismann, O., Herzig, A., Heidmann, S., and Lehner, C.F. (2000). Degradation of Drosophila PIM regulates sister chromatid separation during mitosis. Genes & development 14, 21922205. Lengronne, A., Katou, Y., Mori, S., Yokobayashi, S., Kelly, G.P., Itoh, T., Watanabe, Y., Shirahige, K., and Uhlmann, F. (2004). Cohesin relocation from sites of chromosomal loading to places of convergent transcription. Nature 430, 573-578. Lesage, P., and Todeschini, A.L. (2005). Happy together: the life and times of Ty retrotransposons and their hosts. Cytogenet Genome Res 110, 70-90. Li, Z., Vizeacoumar, F.J., Bahr, S., Li, J., Warringer, J., Vizeacoumar, F.S., Min, R., Vandersluis, B., Bellay, J., Devit, M., et al. (2011). Systematic exploration of essential yeast gene function with temperature-sensitive mutants. Nat Biotechnol 29, 361-367. Liebman, S.W., and Newnam, G. (1993). A ubiquitin-conjugating enzyme, RAD6, affects the distribution of Ty1 retrotransposon integration positions. Genetics 133, 499-508. Ling, S.H., Qamra, R., and Song, H. (2011). Structural and functional insights into eukaryotic mRNA decapping. Wiley Interdiscip Rev RNA 2, 193-208. Liu, J., Zhang, Z., Bando, M., Itoh, T., Deardorff, M.A., Clark, D., Kaur, M., Tandy, S., Kondoh, T., Rappaport, E., et al. (2009). Transcriptional dysregulation in NIPBL and cohesin mutant human cells. PLoS Biol 7, e1000119. Longtine, M.S., McKenzie, A., 3rd, Demarini, D.J., Shah, N.G., Wach, A., Brachat, A., Philippsen, P., and Pringle, J.R. (1998). Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14, 953-961. Losada, A., Hirano, M., and Hirano, T. (1998). Identification of Xenopus SMC protein complexes required for sister chromatid cohesion. Genes & development 12, 1986-1997. Ma, L., McQueen, J., Cuschieri, L., Vogel, J., and Measday, V. (2007). Spc24 and Stu2 promote spindle integrity when DNA replication is stalled. Molecular biology of the cell 18, 2805-2816. Mah, A.S., Jang, J., and Deshaies, R.J. (2001). Protein kinase Cdc15 activates the Dbf2Mob1 kinase complex. Proceedings of the National Academy of Sciences of the United States of America 98, 7325-7330. Mariani, L., Chiroli, E., Nezi, L., Muller, H., Piatti, S., Musacchio, A., and Ciliberto, A. (2012). Role of the mad2 dimerization interface in the spindle assembly checkpoint independent of kinetochores. Current biology : CB 22, 1900-1908.  174  Marintchev, A., and Wagner, G. (2004). Translation initiation: structures, mechanisms and evolution. Q Rev Biophys 37, 197-284. May, G.S., McGoldrick, C.A., Holt, C.L., and Denison, S.H. (1992). The bimB3 mutation of Aspergillus nidulans uncouples DNA replication from the completion of mitosis. The Journal of biological chemistry 267, 15737-15743. Mc Intyre, J., Muller, E.G., Weitzer, S., Snydsman, B.E., Davis, T.N., and Uhlmann, F. (2007). In vivo analysis of cohesin architecture using FRET in the budding yeast Saccharomyces cerevisiae. The EMBO journal 26, 3783-3793. McAleenan, A., Clemente-Blanco, A., Cordon-Preciado, V., Sen, N., Esteras, M., Jarmuz, A., and Aragon, L. (2013). Post-replicative repair involves separase-dependent removal of the kleisin subunit of cohesin. Nature 493, 250-254. McGrew, J.T., Goetsch, L., Byers, B., and Baum, P. (1992). Requirement for ESP1 in the nuclear division of Saccharomyces cerevisiae. Molecular biology of the cell 3, 1443-1454. McGuinness, B.E., Hirota, T., Kudo, N.R., Peters, J.M., and Nasmyth, K. (2005). Shugoshin prevents dissociation of cohesin from centromeres during mitosis in vertebrate cells. PLoS Biol 3, e86. Measday, V., Baetz, K., Guzzo, J., Yuen, K., Kwok, T., Sheikh, B., Ding, H., Ueta, R., Hoac, T., Cheng, B., et al. (2005). Systematic yeast synthetic lethal and synthetic dosage lethal screens identify genes required for chromosome segregation. Proceedings of the National Academy of Sciences of the United States of America 102, 13956-13961. Measday, V., and Hieter, P. (2002). Synthetic dosage lethality. Methods Enzymol 350, 316326. Megee, P.C., Mistrot, C., Guacci, V., and Koshland, D. (1999). The centromeric sister chromatid cohesion site directs Mcd1p binding to adjacent sequences. Molecular cell 4, 445450. Melamed, C., Nevo, Y., and Kupiec, M. (1992). Involvement of cDNA in homologous recombination between Ty elements in Saccharomyces cerevisiae. Molecular and cellular biology 12, 1613-1620. Mellor, J., Fulton, S.M., Dobson, M.J., Wilson, W., Kingsman, S.M., and Kingsman, A.J. (1985). A retrovirus-like strategy for expression of a fusion protein encoded by yeast transposon Ty1. Nature 313, 243-246. Melo, J., and Toczyski, D. (2002). A unified view of the DNA-damage checkpoint. Current opinion in cell biology 14, 237-245. Mendenhall, M.D. (1993). An inhibitor of p34CDC28 protein kinase activity from Saccharomyces cerevisiae. Science 259, 216-219.  175  Mendoza, M., Norden, C., Durrer, K., Rauter, H., Uhlmann, F., and Barral, Y. (2009). A mechanism for chromosome segregation sensing by the NoCut checkpoint. Nature cell biology 11, 477-483. Merkulov, G.V., Lawler, J.F., Jr., Eby, Y., and Boeke, J.D. (2001). Ty1 proteolytic cleavage sites are required for transposition: all sites are not created equal. Journal of virology 75, 638-644. Merkulov, G.V., Swiderek, K.M., Brachmann, C.B., and Boeke, J.D. (1996). A critical proteolytic cleavage site near the C terminus of the yeast retrotransposon Ty1 Gag protein. J Virol 70, 5548-5556. Meyer, R., Fofanov, V., Panigrahi, A., Merchant, F., Zhang, N., and Pati, D. (2009). Overexpression and mislocalization of the chromosomal segregation protein separase in multiple human cancers. Clinical cancer research : an official journal of the American Association for Cancer Research 15, 2703-2710. Meyer, S., Temme, C., and Wahle, E. (2004). Messenger RNA turnover in eukaryotes: pathways and enzymes. Crit Rev Biochem Mol Biol 39, 197-216. Michaelis, C., Ciosk, R., and Nasmyth, K. (1997). Cohesins: chromosomal proteins that prevent premature separation of sister chromatids. Cell 91, 35-45. Moll, T., Tebb, G., Surana, U., Robitsch, H., and Nasmyth, K. (1991). The role of phosphorylation and the CDC28 protein kinase in cell cycle-regulated nuclear import of the S. cerevisiae transcription factor SWI5. Cell 66, 743-758. Moore, S.P., Rinckel, L.A., and Garfinkel, D.J. (1998). A Ty1 integrase nuclear localization signal required for retrotransposition. Mol Cell Biol 18, 1105-1114. Morgan, D.O. (2007). The cell cycle : principles of control (London Sunderland, MA, Published by New Science Press in association with Oxford University Press ; Distributed inside North America by Sinauer Associates, Publishers). Mou, Z., Kenny, A.E., and Curcio, M.J. (2006). Hos2 and Set3 promote integration of Ty1 retrotransposons at tRNA genes in Saccharomyces cerevisiae. Genetics 172, 2157-2167. Mueller, C.L., and Jaehning, J.A. (2002). Ctr9, Rtf1, and Leo1 are components of the Paf1/RNA polymerase II complex. Molecular and cellular biology 22, 1971-1980. Nagao, K., Adachi, Y., and Yanagida, M. (2004). Separase-mediated cleavage of cohesin at interphase is required for DNA repair. Nature 430, 1044-1048. Nasmyth, K. (2011). Cohesin: a catenase with separate entry and exit gates? Nature cell biology 13, 1170-1177.  176  Nasmyth, K., and Haering, C.H. (2009). Cohesin: its roles and mechanisms. Annu Rev Genet 43, 525-558. Nelson, S.A., and Cooper, J.A. (2007). A novel pathway that coordinates mitotic exit with spindle position. Mol Biol Cell 18, 3440-3450. Nezi, L., Rancati, G., De Antoni, A., Pasqualato, S., Piatti, S., and Musacchio, A. (2006). Accumulation of Mad2-Cdc20 complex during spindle checkpoint activation requires binding of open and closed conformers of Mad2 in Saccharomyces cerevisiae. The Journal of cell biology 174, 39-51. Nickoloff, J.A., Chen, E.Y., and Heffron, F. (1986). A 24-base-pair DNA sequence from the MAT locus stimulates intergenic recombination in yeast. Proceedings of the National Academy of Sciences of the United States of America 83, 7831-7835. Nishiyama, T., Ladurner, R., Schmitz, J., Kreidl, E., Schleiffer, A., Bhaskara, V., Bando, M., Shirahige, K., Hyman, A.A., Mechtler, K., et al. (2010). Sororin mediates sister chromatid cohesion by antagonizing Wapl. Cell 143, 737-749. Nissan, T., Rajyaguru, P., She, M., Song, H., and Parker, R. (2010). Decapping activators in Saccharomyces cerevisiae act by multiple mechanisms. Molecular cell 39, 773-783. Nyswaner, K.M., Checkley, M.A., Yi, M., Stephens, R.M., and Garfinkel, D.J. (2008). Chromatin-associated genes protect the yeast genome from Ty1 insertional mutagenesis. Genetics 178, 197-214. Olsen, J.V., de Godoy, L.M., Li, G., Macek, B., Mortensen, P., Pesch, R., Makarov, A., Lange, O., Horning, S., and Mann, M. (2005). Parts per million mass accuracy on an Orbitrap mass spectrometer via lock mass injection into a C-trap. Mol Cell Proteomics 4, 2010-2021. Pandey, R., Heidmann, S., and Lehner, C.F. (2005). Epithelial re-organization and dynamics of progression through mitosis in Drosophila separase complex mutants. J Cell Sci 118, 733742. Panizza, S., Tanaka, T., Hochwagen, A., Eisenhaber, F., and Nasmyth, K. (2000). Pds5 cooperates with cohesin in maintaining sister chromatid cohesion. Current biology : CB 10, 1557-1564. Papi, M., Berdougo, E., Randall, C.L., Ganguly, S., and Jallepalli, P.V. (2005). Multiple roles for separase auto-cleavage during the G2/M transition. Nature cell biology 7, 1029-1035. Paques, F., and Haber, J.E. (1999). Multiple pathways of recombination induced by doublestrand breaks in Saccharomyces cerevisiae. Microbiol Mol Biol Rev 63, 349-404. Paquin, C.E., and Williamson, V.M. (1984). Temperature effects on the rate of ty transposition. Science 226, 53-55.  177  Parker, R., and Sheth, U. (2007). P bodies and the control of mRNA translation and degradation. Mol Cell 25, 635-646. Pati, D., Haddad, B.R., Haegele, A., Thompson, H., Kittrell, F.S., Shepard, A., Montagna, C., Zhang, N., Ge, G., Otta, S.K., et al. (2004). Hormone-induced chromosomal instability in p53-null mammary epithelium. Cancer Res 64, 5608-5616. Penheiter, K.L., Washburn, T.M., Porter, S.E., Hoffman, M.G., and Jaehning, J.A. (2005). A posttranscriptional role for the yeast Paf1-RNA polymerase II complex is revealed by identification of primary targets. Molecular cell 20, 213-223. Pereira, G., Hofken, T., Grindlay, J., Manson, C., and Schiebel, E. (2000). The Bub2p spindle checkpoint links nuclear migration with mitotic exit. Molecular cell 6, 1-10. Perentesis, J.P., Phan, L.D., Gleason, W.B., LaPorte, D.C., Livingston, D.M., and Bodley, J.W. (1992). Saccharomyces cerevisiae elongation factor 2. Genetic cloning, characterization of expression, and G-domain modeling. The Journal of biological chemistry 267, 1190-1197. Philips, J., and Herskowitz, I. (1998). Identification of Kel1p, a kelch domain-containing protein involved in cell fusion and morphology in Saccharomyces cerevisiae. J Cell Biol 143, 375-389. Phillips, P.C. (1998). The language of gene interaction. Genetics 149, 1167-1171. Pinsky, B.A., and Biggins, S. (2005). The spindle checkpoint: tension versus attachment. Trends in cell biology 15, 486-493. Poiesz, B.J., Ruscetti, F.W., Gazdar, A.F., Bunn, P.A., Minna, J.D., and Gallo, R.C. (1980). Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma. Proceedings of the National Academy of Sciences of the United States of America 77, 7415-7419. Poiesz, B.J., Ruscetti, F.W., Reitz, M.S., Kalyanaraman, V.S., and Gallo, R.C. (1981). Isolation of a new type C retrovirus (HTLV) in primary uncultured cells of a patient with Sezary T-cell leukaemia. Nature 294, 268-271. Pramila, T., Wu, W., Miles, S., Noble, W.S., and Breeden, L.L. (2006). The Forkhead transcription factor Hcm1 regulates chromosome segregation genes and fills the S-phase gap in the transcriptional circuitry of the cell cycle. Genes & development 20, 2266-2278. Putnam, C.D., Jaehnig, E.J., and Kolodner, R.D. (2009). Perspectives on the DNA damage and replication checkpoint responses in Saccharomyces cerevisiae. DNA Repair (Amst) 8, 974-982. Queralt, E., Lehane, C., Novak, B., and Uhlmann, F. (2006). Downregulation of PP2A(Cdc55) phosphatase by separase initiates mitotic exit in budding yeast. Cell 125, 719732.  178  Queralt, E., and Uhlmann, F. (2008a). Cdk-counteracting phosphatases unlock mitotic exit. Curr Opin Cell Biol 20, 661-668. Queralt, E., and Uhlmann, F. (2008b). Separase cooperates with Zds1 and Zds2 to activate Cdc14 phosphatase in early anaphase. J Cell Biol 182, 873-883. Rahal, R., and Amon, A. (2008). The Polo-like kinase Cdc5 interacts with FEAR network components and Cdc14. Cell cycle 7, 3262-3272. Rao, H., Uhlmann, F., Nasmyth, K., and Varshavsky, A. (2001). Degradation of a cohesin subunit by the N-end rule pathway is essential for chromosome stability. Nature 410, 955959. Rappsilber, J., Ishihama, Y., and Mann, M. (2003). Stop and go extraction tips for matrixassisted laser desorption/ionization, nanoelectrospray, and LC/MS sample pretreatment in proteomics. Anal Chem 75, 663-670. Rappsilber, J., Mann, M., and Ishihama, Y. (2007). Protocol for micro-purification, enrichment, pre-fractionation and storage of peptides for proteomics using StageTips. Nat Protoc 2, 1896-1906. Rattray, A.J., Shafer, B.K., and Garfinkel, D.J. (2000). The Saccharomyces cerevisiae DNA recombination and repair functions of the RAD52 epistasis group inhibit Ty1 transposition. Genetics 154, 543-556. Resnick, M.A. (1975). The repair of double-strand breaks in chromosomal DNA of yeast. Basic Life Sci 5B, 549-556. Riedel, C.G., Katis, V.L., Katou, Y., Mori, S., Itoh, T., Helmhart, W., Galova, M., Petronczki, M., Gregan, J., Cetin, B., et al. (2006). Protein phosphatase 2A protects centromeric sister chromatid cohesion during meiosis I. Nature 441, 53-61. Rollins, R.A., Korom, M., Aulner, N., Martens, A., and Dorsett, D. (2004). Drosophila nipped-B protein supports sister chromatid cohesion and opposes the stromalin/Scc3 cohesion factor to facilitate long-range activation of the cut gene. Molecular and cellular biology 24, 3100-3111. Rosonina, E., and Manley, J.L. (2005). From transcription to mRNA: PAF provides a new path. Mol Cell 20, 167-168. Rout, M.P., Aitchison, J.D., Suprapto, A., Hjertaas, K., Zhao, Y., and Chait, B.T. (2000). The yeast nuclear pore complex: composition, architecture, and transport mechanism. The Journal of cell biology 148, 635-651. Rusche, L.N., Kirchmaier, A.L., and Rine, J. (2003). The establishment, inheritance, and function of silenced chromatin in Saccharomyces cerevisiae. Annual review of biochemistry 72, 481-516.  179  Sarin, S., Ross, K.E., Boucher, L., Green, Y., Tyers, M., and Cohen-Fix, O. (2004). Uncovering novel cell cycle players through the inactivation of securin in budding yeast. Genetics 168, 1763-1771. Schneider-Poetsch, T., Ju, J., Eyler, D.E., Dang, Y., Bhat, S., Merrick, W.C., Green, R., Shen, B., and Liu, J.O. (2010). Inhibition of eukaryotic translation elongation by cycloheximide and lactimidomycin. Nat Chem Biol 6, 209-217. Scholes, D.T., Banerjee, M., Bowen, B., and Curcio, M.J. (2001). Multiple regulators of Ty1 transposition in Saccharomyces cerevisiae have conserved roles in genome maintenance. Genetics 159, 1449-1465. Schuldiner, M., Collins, S.R., Thompson, N.J., Denic, V., Bhamidipati, A., Punna, T., Ihmels, J., Andrews, B., Boone, C., Greenblatt, J.F., et al. (2005). Exploration of the function and organization of the yeast early secretory pathway through an epistatic miniarray profile. Cell 123, 507-519. Schulze, J.M., Jackson, J., Nakanishi, S., Gardner, J.M., Hentrich, T., Haug, J., Johnston, M., Jaspersen, S.L., Kobor, M.S., and Shilatifard, A. (2009). Linking cell cycle to histone modifications: SBF and H2B monoubiquitination machinery and cell-cycle regulation of H3K79 dimethylation. Molecular cell 35, 626-641. Schwab, M., Lutum, A.S., and Seufert, W. (1997). Yeast Hct1 is a regulator of Clb2 cyclin proteolysis. Cell 90, 683-693. Schwer, B., Mao, X., and Shuman, S. (1998). Accelerated mRNA decay in conditional mutants of yeast mRNA capping enzyme. Nucleic acids research 26, 2050-2057. Schwer, B., and Shuman, S. (1996). Multicopy suppressors of temperature-sensitive mutations of yeast mRNA capping enzyme. Gene Expr 5, 331-344. Schwob, E., Bohm, T., Mendenhall, M.D., and Nasmyth, K. (1994). The B-type cyclin kinase inhibitor p40SIC1 controls the G1 to S transition in S. cerevisiae. Cell 79, 233-244. Seshan, A., Bardin, A.J., and Amon, A. (2002). Control of Lte1 localization by cell polarity determinants and Cdc14. Curr Biol 12, 2098-2110. Sharifpoor, S., van Dyk, D., Costanzo, M., Baryshnikova, A., Friesen, H., Douglas, A.C., Youn, J.Y., VanderSluis, B., Myers, C.L., Papp, B., et al. (2012). Functional wiring of the yeast kinome revealed by global analysis of genetic network motifs. Genome research 22, 791-801. Sharon, G., Burkett, T.J., and Garfinkel, D.J. (1994). Efficient homologous recombination of Ty1 element cDNA when integration is blocked. Molecular and cellular biology 14, 65406551.  180  Sheldon, K.E., Mauger, D.M., and Arndt, K.M. (2005). A Requirement for the Saccharomyces cerevisiae Paf1 complex in snoRNA 3' end formation. Molecular cell 20, 225-236. Shepard, J.L., Amatruda, J.F., Finkelstein, D., Ziai, J., Finley, K.R., Stern, H.M., Chiang, K., Hersey, C., Barut, B., Freeman, J.L., et al. (2007). A mutation in separase causes genome instability and increased susceptibility to epithelial cancer. Genes & development 21, 55-59. Shevchenko, A., Chernushevich, I., Wilm, M., and Mann, M. (2000). De Novo peptide sequencing by nanoelectrospray tandem mass spectrometry using triple quadrupole and quadrupole/time-of-flight instruments. Methods in molecular biology 146, 1-16. Shi, X., Chang, M., Wolf, A.J., Chang, C.H., Frazer-Abel, A.A., Wade, P.A., Burton, Z.F., and Jaehning, J.A. (1997). Cdc73p and Paf1p are found in a novel RNA polymerase IIcontaining complex distinct from the Srbp-containing holoenzyme. Molecular and cellular biology 17, 1160-1169. Shi, X., Finkelstein, A., Wolf, A.J., Wade, P.A., Burton, Z.F., and Jaehning, J.A. (1996). Paf1p, an RNA polymerase II-associated factor in Saccharomyces cerevisiae, may have both positive and negative roles in transcription. Molecular and cellular biology 16, 669-676. Shibagaki, Y., Itoh, N., Yamada, H., Nagata, S., and Mizumoto, K. (1992). mRNA capping enzyme. Isolation and characterization of the gene encoding mRNA guanylytransferase subunit from Saccharomyces cerevisiae. The Journal of biological chemistry 267, 9521-9528. Shou, W., Seol, J.H., Shevchenko, A., Baskerville, C., Moazed, D., Chen, Z.W., Jang, J., Charbonneau, H., and Deshaies, R.J. (1999). Exit from mitosis is triggered by Tem1dependent release of the protein phosphatase Cdc14 from nucleolar RENT complex. Cell 97, 233-244. Sikorski, R.S., and Hieter, P. (1989). A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 1927. Siomos, M.F., Badrinath, A., Pasierbek, P., Livingstone, D., White, J., Glotzer, M., and Nasmyth, K. (2001). Separase is required for chromosome segregation during meiosis I in Caenorhabditis elegans. Current biology : CB 11, 1825-1835. Skibbens, R.V., Marzillier, J., and Eastman, L. (2010). Cohesins coordinate gene transcriptions of related function within Saccharomyces cerevisiae. Cell cycle 9, 1601-1606. Smith, J.S., Caputo, E., and Boeke, J.D. (1999). A genetic screen for ribosomal DNA silencing defects identifies multiple DNA replication and chromatin-modulating factors. Mol Cell Biol 19, 3184-3197. Solbach, C., Roller, M., Fellbaum, C., Nicoletti, M., and Kaufmann, M. (2004). PTTG mRNA expression in primary breast cancer: a prognostic marker for lymph node invasion and tumor recurrence. Breast 13, 80-81. 181  Sopko, R., Huang, D., Preston, N., Chua, G., Papp, B., Kafadar, K., Snyder, M., Oliver, S.G., Cyert, M., Hughes, T.R., et al. (2006). Mapping pathways and phenotypes by systematic gene overexpression. Mol Cell 21, 319-330. Spellman, P.T., Sherlock, G., Zhang, M.Q., Iyer, V.R., Anders, K., Eisen, M.B., Brown, P.O., Botstein, D., and Futcher, B. (1998). Comprehensive identification of cell cycleregulated genes of the yeast Saccharomyces cerevisiae by microarray hybridization. Molecular biology of the cell 9, 3273-3297. Sproul, L.R., Anderson, D.J., Mackey, A.T., Saunders, W.S., and Gilbert, S.P. (2005). Cik1 targets the minus-end kinesin depolymerase kar3 to microtubule plus ends. Curr Biol 15, 1420-1427. Stegmeier, F., Huang, J., Rahal, R., Zmolik, J., Moazed, D., and Amon, A. (2004). The replication fork block protein Fob1 functions as a negative regulator of the FEAR network. Current biology : CB 14, 467-480. Stegmeier, F., Visintin, R., and Amon, A. (2002). Separase, polo kinase, the kinetochore protein Slk19, and Spo12 function in a network that controls Cdc14 localization during early anaphase. Cell 108, 207-220. Stevens, A. (1980). Purification and characterization of a Saccharomyces cerevisiae exoribonuclease which yields 5'-mononucleotides by a 5' leads to 3' mode of hydrolysis. The Journal of biological chemistry 255, 3080-3085. Strathern, J.N., Klar, A.J., Hicks, J.B., Abraham, J.A., Ivy, J.M., Nasmyth, K.A., and McGill, C. (1982). Homothallic switching of yeast mating type cassettes is initiated by a doublestranded cut in the MAT locus. Cell 31, 183-192. Sullivan, M., Hornig, N.C., Porstmann, T., and Uhlmann, F. (2004). Studies on substrate recognition by the budding yeast separase. J Biol Chem 279, 1191-1196. Sullivan, M., Lehane, C., and Uhlmann, F. (2001). Orchestrating anaphase and mitotic exit: separase cleavage and localization of Slk19. Nat Cell Biol 3, 771-777. Sullivan, M., and Uhlmann, F. (2003). A non-proteolytic function of separase links the onset of anaphase to mitotic exit. Nat Cell Biol 5, 249-254. Sumara, I., Vorlaufer, E., Stukenberg, P.T., Kelm, O., Redemann, N., Nigg, E.A., and Peters, J.M. (2002). The dissociation of cohesin from chromosomes in prophase is regulated by Polo-like kinase. Molecular cell 9, 515-525. Sundararajan, A., Lee, B.S., and Garfinkel, D.J. (2003). The Rad27 (Fen-1) nuclease inhibits Ty1 mobility in Saccharomyces cerevisiae. Genetics 163, 55-67. Sutani, T., Kawaguchi, T., Kanno, R., Itoh, T., and Shirahige, K. (2009). Budding yeast Wpl1(Rad61)-Pds5 complex counteracts sister chromatid cohesion-establishing reaction. Current biology : CB 19, 492-497. 182  Sweet, T., Kovalak, C., and Coller, J. (2012). The DEAD-box protein Dhh1 promotes decapping by slowing ribosome movement. PLoS Biol 10, e1001342. Symington, L.S. (2002). Role of RAD52 epistasis group genes in homologous recombination and double-strand break repair. Microbiol Mol Biol Rev 66, 630-670, table of contents. Tanaka, K., Kitamura, E., Kitamura, Y., and Tanaka, T.U. (2007). Molecular mechanisms of microtubule-dependent kinetochore transport toward spindle poles. The Journal of cell biology 178, 269-281. Tanaka, K., Mukae, N., Dewar, H., van Breugel, M., James, E.K., Prescott, A.R., Antony, C., and Tanaka, T.U. (2005). Molecular mechanisms of kinetochore capture by spindle microtubules. Nature 434, 987-994. Tanaka, T., Cosma, M.P., Wirth, K., and Nasmyth, K. (1999). Identification of cohesin association sites at centromeres and along chromosome arms. Cell 98, 847-858. Tanaka, T.U. (2008). Bi-orienting chromosomes: acrobatics on the mitotic spindle. Chromosoma 117, 521-533. Teste, M.A., Duquenne, M., Francois, J.M., and Parrou, J.L. (2009). Validation of reference genes for quantitative expression analysis by real-time RT-PCR in Saccharomyces cerevisiae. BMC Mol Biol 10, 99. Tharun, S., He, W., Mayes, A.E., Lennertz, P., Beggs, J.D., and Parker, R. (2000). Yeast Smlike proteins function in mRNA decapping and decay. Nature 404, 515-518. Tien, J.F., Umbreit, N.T., Gestaut, D.R., Franck, A.D., Cooper, J., Wordeman, L., Gonen, T., Asbury, C.L., and Davis, T.N. (2010). Cooperation of the Dam1 and Ndc80 kinetochore complexes enhances microtubule coupling and is regulated by aurora B. The Journal of cell biology 189, 713-723. Tinker-Kulberg, R.L., and Morgan, D.O. (1999). Pds1 and Esp1 control both anaphase and mitotic exit in normal cells and after DNA damage. Genes & development 13, 1936-1949. Tong, A.H., and Boone, C. (2006). Synthetic genetic array analysis in Saccharomyces cerevisiae. Methods Mol Biol 313, 171-192. Tong, A.H., Evangelista, M., Parsons, A.B., Xu, H., Bader, G.D., Page, N., Robinson, M., Raghibizadeh, S., Hogue, C.W., Bussey, H., et al. (2001). Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science 294, 2364-2368. Tong, A.H., Lesage, G., Bader, G.D., Ding, H., Xu, H., Xin, X., Young, J., Berriz, G.F., Brost, R.L., Chang, M., et al. (2004). Global mapping of the yeast genetic interaction network. Science 303, 808-813.  183  Tong, A.H.Y., and Boone, C. (2007). High-Throughput Strain Construction and Systematic Synthetic Lethal Screening in Saccharomyces cerevisiae. Methods Microbiol 36, 369-386, 706-707. Topisirovic, I., Svitkin, Y.V., Sonenberg, N., and Shatkin, A.J. (2011). Cap and cap-binding proteins in the control of gene expression. Wiley Interdiscip Rev RNA 2, 277-298. Toth, A., Ciosk, R., Uhlmann, F., Galova, M., Schleiffer, A., and Nasmyth, K. (1999a). Yeast cohesin complex requires a conserved protein, Eco1p(Ctf7), to establish cohesion between sister chromatids during DNA replication. Genes & development 13, 320-333. Toth, A., Ciosk, R., Uhlmann, F., Galova, M., Schleiffer, A., and Nasmyth, K. (1999b). Yeast cohesin complex requires a conserved protein, Eco1p(Ctf7), to establish cohesion between sister chromatids during DNA replication. Genes Dev 13, 320-333. Toyn, J.H., Johnson, A.L., Donovan, J.D., Toone, W.M., and Johnston, L.H. (1997). The Swi5 transcription factor of Saccharomyces cerevisiae has a role in exit from mitosis through induction of the cdk-inhibitor Sic1 in telophase. Genetics 145, 85-96. Tsou, M.F., Wang, W.J., George, K.A., Uryu, K., Stearns, T., and Jallepalli, P.V. (2009). Polo kinase and separase regulate the mitotic licensing of centriole duplication in human cells. Dev Cell 17, 344-354. Tsukamoto, T., Shibagaki, Y., Imajoh-Ohmi, S., Murakoshi, T., Suzuki, M., Nakamura, A., Gotoh, H., and Mizumoto, K. (1997). Isolation and characterization of the yeast mRNA capping enzyme beta subunit gene encoding RNA 5'-triphosphatase, which is essential for cell viability. Biochemical and biophysical research communications 239, 116-122. Tucker, M., Valencia-Sanchez, M.A., Staples, R.R., Chen, J., Denis, C.L., and Parker, R. (2001). The transcription factor associated Ccr4 and Caf1 proteins are components of the major cytoplasmic mRNA deadenylase in Saccharomyces cerevisiae. Cell 104, 377-386. Uhlmann, F., Lottspeich, F., and Nasmyth, K. (1999). Sister-chromatid separation at anaphase onset is promoted by cleavage of the cohesin subunit Scc1. Nature 400, 37-42. Uhlmann, F., Wernic, D., Poupart, M.A., Koonin, E.V., and Nasmyth, K. (2000). Cleavage of cohesin by the CD clan protease separin triggers anaphase in yeast. Cell 103, 375-386. Unal, E., Heidinger-Pauli, J.M., Kim, W., Guacci, V., Onn, I., Gygi, S.P., and Koshland, D.E. (2008). A molecular determinant for the establishment of sister chromatid cohesion. Science 321, 566-569. Uzawa, S., Samejima, I., Hirano, T., Tanaka, K., and Yanagida, M. (1990). The fission yeast cut1+ gene regulates spindle pole body duplication and has homology to the budding yeast ESP1 gene. Cell 62, 913-925. Varshavsky, A. (1996). The N-end rule: functions, mysteries, uses. Proceedings of the National Academy of Sciences of the United States of America 93, 12142-12149. 184  Verma, R., Annan, R.S., Huddleston, M.J., Carr, S.A., Reynard, G., and Deshaies, R.J. (1997a). Phosphorylation of Sic1p by G1 Cdk required for its degradation and entry into S phase. Science 278, 455-460. Verma, R., Feldman, R.M., and Deshaies, R.J. (1997b). SIC1 is ubiquitinated in vitro by a pathway that requires CDC4, CDC34, and cyclin/CDK activities. Molecular biology of the cell 8, 1427-1437. Viadiu, H., Stemmann, O., Kirschner, M.W., and Walz, T. (2005). Domain structure of separase and its binding to securin as determined by EM. Nat Struct Mol Biol 12, 552-553. Visintin, R., Craig, K., Hwang, E.S., Prinz, S., Tyers, M., and Amon, A. (1998). The phosphatase Cdc14 triggers mitotic exit by reversal of Cdk-dependent phosphorylation. Mol Cell 2, 709-718. Visintin, R., Hwang, E.S., and Amon, A. (1999). Cfi1 prevents premature exit from mitosis by anchoring Cdc14 phosphatase in the nucleolus. Nature 398, 818-823. Visintin, R., Prinz, S., and Amon, A. (1997). CDC20 and CDH1: a family of substratespecific activators of APC-dependent proteolysis. Science 278, 460-463. Visintin, R., Stegmeier, F., and Amon, A. (2003). The role of the polo kinase Cdc5 in controlling Cdc14 localization. Molecular biology of the cell 14, 4486-4498. Wade, P.A., Werel, W., Fentzke, R.C., Thompson, N.E., Leykam, J.F., Burgess, R.R., Jaehning, J.A., and Burton, Z.F. (1996). A novel collection of accessory factors associated with yeast RNA polymerase II. Protein Expr Purif 8, 85-90. Waizenegger, I., Gimenez-Abian, J.F., Wernic, D., and Peters, J.M. (2002). Regulation of human separase by securin binding and autocleavage. Current biology : CB 12, 1368-1378. Waizenegger, I.C., Hauf, S., Meinke, A., and Peters, J.M. (2000). Two distinct pathways remove mammalian cohesin from chromosome arms in prophase and from centromeres in anaphase. Cell 103, 399-410. Wang, Y., Shirogane, T., Liu, D., Harper, J.W., and Elledge, S.J. (2003). Exit from exit: resetting the cell cycle through Amn1 inhibition of G protein signaling. Cell 112, 697-709. Wardlaw, C.P. (2010). Protein phophatase 2A contributes to separase regulation and the coordination of anaphase. Bioscience Horizons 3, 66-76. Wei, R.R., Sorger, P.K., and Harrison, S.C. (2005). Molecular organization of the Ndc80 complex, an essential kinetochore component. Proceedings of the National Academy of Sciences of the United States of America 102, 5363-5367. Westermann, S., Drubin, D.G., and Barnes, G. (2007). Structures and functions of yeast kinetochore complexes. Annual review of biochemistry 76, 563-591.  185  Wilson, W., Malim, M.H., Mellor, J., Kingsman, A.J., and Kingsman, S.M. (1986). Expression strategies of the yeast retrotransposon Ty: a short sequence directs ribosomal frameshifting. Nucleic acids research 14, 7001-7016. Winey, M., and O'Toole, E.T. (2001). The spindle cycle in budding yeast. Nature cell biology 3, E23-27. Winston, F. (1992). Analysis of SPT genes: A genetic approach towards analysis of TFIID, histones, and other transcription factors of yeast, 1271-1293 edn. Wirth, K.G., Wutz, G., Kudo, N.R., Desdouets, C., Zetterberg, A., Taghybeeglu, S., Seznec, J., Ducos, G.M., Ricci, R., Firnberg, N., et al. (2006). Separase: a universal trigger for sister chromatid disjunction but not chromosome cycle progression. The Journal of cell biology 172, 847-860. Wyers, F., Minet, M., Dufour, M.E., Vo, L.T., and Lacroute, F. (2000). Deletion of the PAT1 gene affects translation initiation and suppresses a PAB1 gene deletion in yeast. Molecular and cellular biology 20, 3538-3549. Xiong, B., Lu, S., and Gerton, J.L. (2010). Hos1 is a lysine deacetylase for the Smc3 subunit of cohesin. Current biology : CB 20, 1660-1665. Xu, H., and Boeke, J.D. (1990). Host genes that influence transposition in yeast: the abundance of a rare tRNA regulates Ty1 transposition frequency. Proceedings of the National Academy of Sciences of the United States of America 87, 8360-8364. Yaakov, G., Thorn, K., and Morgan, D.O. (2012). Separase Biosensor Reveals that Cohesin Cleavage Timing Depends on Phosphatase PP2A(Cdc55) Regulation. Dev Cell 23, 124-136. Yamaguchi, Y., Narita, T., Inukai, N., Wada, T., and Handa, H. (2001). SPT genes: key players in the regulation of transcription, chromatin structure and other cellular processes. J Biochem 129, 185-191. Yamamoto, A., Guacci, V., and Koshland, D. (1996a). Pds1p is required for faithful execution of anaphase in the yeast, Saccharomyces cerevisiae. The Journal of cell biology 133, 85-97. Yamamoto, A., Guacci, V., and Koshland, D. (1996b). Pds1p, an inhibitor of anaphase in budding yeast, plays a critical role in the APC and checkpoint pathway(s). The Journal of cell biology 133, 99-110. Yang, X., Boateng, K.A., Yuan, L., Wu, S., Baskin, T.I., and Makaroff, C.A. (2011). The radially swollen 4 separase mutation of Arabidopsis thaliana blocks chromosome disjunction and disrupts the radial microtubule system in meiocytes. PLoS One 6, e19459. Yarrington, R.M., Chen, J., Bolton, E.C., and Boeke, J.D. (2007). Mn2+ suppressor mutations and biochemical communication between Ty1 reverse transcriptase and RNase H domains. Journal of virology 81, 9004-9012. 186  Yin, H., Pruyne, D., Huffaker, T.C., and Bretscher, A. (2000). Myosin V orientates the mitotic spindle in yeast. Nature 406, 1013-1015. Young, R.A. (1991). RNA polymerase II. Annual review of biochemistry 60, 689-715. Youngren, S.D., Boeke, J.D., Sanders, N.J., and Garfinkel, D.J. (1988a). Functional organization of the retrotransposon Ty from Saccharomyces cerevisiae: Ty protease is required for transposition. Mol Cell Biol 8, 1421-1431. Youngren, S.D., Boeke, J.D., Sanders, N.J., and Garfinkel, D.J. (1988b). Functional organization of the retrotransposon Ty from Saccharomyces cerevisiae: Ty protease is required for transposition. Molecular and cellular biology 8, 1421-1431. Zeng, X., Kahana, J.A., Silver, P.A., Morphew, M.K., McIntosh, J.R., Fitch, I.T., Carbon, J., and Saunders, W.S. (1999). Slk19p is a centromere protein that functions to stabilize mitotic spindles. J Cell Biol 146, 415-425. Zhang, N., Ge, G., Meyer, R., Sethi, S., Basu, D., Pradhan, S., Zhao, Y.J., Li, X.N., Cai, W.W., El-Naggar, A.K., et al. (2008). Overexpression of Separase induces aneuploidy and mammary tumorigenesis. Proceedings of the National Academy of Sciences of the United States of America 105, 13033-13038. Zhang, N., Panigrahi, A.K., Mao, Q., and Pati, D. (2011). Interaction of Sororin protein with polo-like kinase 1 mediates resolution of chromosomal arm cohesion. The Journal of biological chemistry 286, 41826-41837. Zhang, Y., Sikes, M.L., Beyer, A.L., and Schneider, D.A. (2009). The Paf1 complex is required for efficient transcription elongation by RNA polymerase I. Proceedings of the National Academy of Sciences of the United States of America 106, 2153-2158. Zhu, Y., Zou, S., Wright, D.A., and Voytas, D.F. (1999). Tagging chromatin with retrotransposons: target specificity of the Saccharomyces Ty5 retrotransposon changes with the chromosomal localization of Sir3p and Sir4p. Genes & development 13, 2738-2749. Zou, H., McGarry, T.J., Bernal, T., and Kirschner, M.W. (1999). Identification of a vertebrate sister-chromatid separation inhibitor involved in transformation and tumorigenesis. Science 285, 418-422. Zou, S., Ke, N., Kim, J.M., and Voytas, D.F. (1996). The Saccharomyces retrotransposon Ty5 integrates preferentially into regions of silent chromatin at the telomeres and mating loci. Genes & development 10, 634-645.  187  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0071976/manifest

Comment

Related Items