UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Investigations on the contribution of AtNRT2.6 gene to nitrate transport in Arabidopsis thaliana Nandanavanam, Ranganayaki 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2011_spring_nandanavanam_ranganayaki.pdf [ 2MB ]
Metadata
JSON: 24-1.0071816.json
JSON-LD: 24-1.0071816-ld.json
RDF/XML (Pretty): 24-1.0071816-rdf.xml
RDF/JSON: 24-1.0071816-rdf.json
Turtle: 24-1.0071816-turtle.txt
N-Triples: 24-1.0071816-rdf-ntriples.txt
Original Record: 24-1.0071816-source.json
Full Text
24-1.0071816-fulltext.txt
Citation
24-1.0071816.ris

Full Text

Investigations on the contribution of AtNRT2.6 gene to nitrate transport in Arabidopsis thaliana  by  Ranganayaki Nandanavanam   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF   MASTER OF SCIENCE  in  The Faculty of Graduate Studies (Botany)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  April 2011  © Ranganayaki Nandanavanam, 2011   ii  Abstract  Completion of the Arabidopsis genome helped to identify seven members of the NRT2 family (Nitrate Regulated Transport) that encode high-affinity nitrate transport. Extensive genetic and physiological studies have confirmed the primary role of AtNRT2.1 in induced high-affinity nitrate transport (IHATS). Moreover it is evident that AtNRT2.1 demonstrates functional association with another gene, AtNAR2 that functions as a part of a two-component system at the plasma membrane for the IHATS. Here we have investigated the contribution of AtNRT2.6 gene to nitrate transport by combining molecular and physiological studies in Arabidopsis thaliana WT, Atnrt2.6 T-DNA mutant and a AtNRT2.6:GFP transformant line of Arabidopsis thaliana. RT-PCR data from un-induced and nitrate re-induced plants demonstrated the constitutive expression of AtNRT2.6 gene in roots, shoots and in flowers. The transcript levels and tissue specific expression of AtNRT2.6:GFP  in root cortical cells and in pollen have confirmed the previous AtNRT2.6::GUS expression studies (Okamoto et al., 2002). The loss of function with regard to 13NO3 - influx (23% in root and to shoot by 33%), fresh weights (20% in root and 16% in shoot) was significant under un-induced conditions. There was no detectable difference in NO3 - flux and fresh weights in re-induced plants. The tissue nitrate levels at the optimal supply of 1mM NH4NO3 were reduced in mutant root by 56% and by 37% in shoots compared to WT. This loss of function Atnrt2.6 T-DNA mutant phenotype was restored in the AtNRT2.6:GFP line to the WT levels. Therefore our results confirm that AtNRT2.6 contributes to constitutive nitrate transport (CHATS). A significant reduction in viable pollen (50%) and pollen tube length in the Atnrt2.6 T-DNA mutant suggest a second possible role of AtNRT2.6 during reproduction. Protein-protein interaction studies using yeast two-hybrid system showed positive result suggesting a functional association of AtNRT2.6 and AtNAR2.1 proteins. This might be further iii  investigated by crossing AtNRT2.6:GFP line with AtNAR2.1 myc  line to isolate the putative functional AtNRT2.6 /AtNAR2.1 complex.                                iv  Table of Contents Abstract....................................................................................................................................... ii Table of Contents ....................................................................................................................... iv List of Tables ............................................................................................................................. vi List of Figures ........................................................................................................................... vii List of Abbreviations ................................................................................................................... ix Acknowledgements ..................................................................................................................... x 1 Introduction ............................................................................................................................. 1 1.1 General introduction ........................................................................................................................ 1 1.2 Review of literature .......................................................................................................................... 2    1.3 Research objectives .........................................................................................................13    1.4 Outline of research chapters ............................................................................................15 2 Expression profile of AtNRT2.6 gene .....................................................................................18 2.1 Introduction ..................................................................................................................................... 18 2.2 Materials and methods ................................................................................................................. 20 2.3 Results ............................................................................................................................................ 25 2.4 Discussion....................................................................................................................................... 37 3 Role of AtNRT2.6 gene in nitrate transport .............................................................................40 3.1 Introduction ..................................................................................................................................... 40 3.2 Materials and methods .................................................................................................................. 42 3.3 Results ............................................................................................................................................. 45 3.4 Discussion ....................................................................................................................................... 51 4. Contribution of AtNRT2.6 to pollen viability and development ...............................................55 4.1 Introduction ..................................................................................................................................... 55 4.2 Materials and methods ................................................................................................................. 57 4.3 Results ............................................................................................................................................ 59 4.4 Discussion....................................................................................................................................... 67 5 Protein-protein interaction of AtNRT2.6 with AtNAR2.1 ..........................................................71 5.1 Introduction ..................................................................................................................................... 71 5.2 Materials and methods ................................................................................................................. 73 5.3 Results ............................................................................................................................................ 74 5.4 Discussion....................................................................................................................................... 77 v  6 Conclusions and future scope ................................................................................................79 Bibliography ..............................................................................................................................83                   vi  List of Tables  Table1.1 Functional relation between NRT2.1, NRT2.2 and NAR2 mutants of Chlamydomonas reinhardii ...................................................................................................................................... 6 Table 1.2 Expression of NRT2 genes in response to nitrate supply (Okamoto et al., 2003) ......... 9 Table 2.1 AtNRT2.6 gene specific and other primers used in RT-PCR .......................................... 23 Table 2.2 Spectral data showing intensity of GFP expression in root ............................................. 33 Table2. 3 Spectral  data showing intensity of  GFP expression in pollen ....................................... 36 Table 3.1 Shoot and root fresh weights and shoot : root ratios for un-induced WT, Atnrt2.6 T- DNA mutant and AtNRT2.6:GFP transformant lines ........................................................ 48 Table 3.2 Shoot and root fresh weights and shoot: root ratios for re-induced WT, Atnrt2.6 T-DNA mutant and AtNRT2.6:GFP transformant lines .................................................................. 49 Table 4.1 Pollen size (m) and number of misshapen pollen grains excluded from count of WT, Atnrt2.6 mutant and AtNRT2.6:GFP transformant line ..................................................... 60 Table 5.1 Primers for cloning AtNRT2.6 with Xba-1 and Stu-1 restriction sites ............................. 73              vii   List of Figures  Figure1.1 A. Schematic diagram of Arabidopsis thaliana chromosomes with NRT2 gene loci B. AtNRT2.6 (At3g45060.1) gene model (source: TAIR http://www.arabidopsis.org) ...... 10 Figure 2.1 Schematic representation of AtNRT2.6:GFP construct ................................................... 24 Figure 2.2  Screening for Atnrt2.6 T-DNA mutant ............................................................................... 26 Figure 2.3 AtNRT2.6 expression in root, shoot and flower of WT and AtNRT2.6:GFP transformant lines of A. thaliana plants grown hydroponically. ..................................... 29 Figure 2.4 Relative expression of AtNRT2.6 gene based on real time PCR .................................. 30 Figure 2.5 Tissue specific localization of AtNRT2.6:GFP  in roots. .................................................. 32 Figure 2.6 Tissue specific localization of AtNRT2.6:GFP  in leaves ................................................ 33 Figure 2.7Tissue specific localization of AtNRT2.6:GFP  in pollen .................................................. 34 Figure 3.1 13NO3 - influx in root and to shoot in WT, Atnrt2.6 T-DNA mutant and AtNRT2.6:GFP transformant lines of Arabidopsis thaliana ......................................................................... 47 Figure 3.2 Tissue NO3 - concentration ( moles g-1 fresh weight) in WT, Atnrt2.6 T-DNA mutant and AtNRT2.6:GFP transformant lines of A. thaliana ....................................................... 50 Figure 4.1 Light micrographs of 0.5 m thick chemically fixed pollen at bi-cellular and tri-cellular stage ....................................................................................................................................... 61 Figure 4.2 Percentage pollen viability (distinctly visible and polarized nuclei) in WT, Atnrt2.6 T- DNA mutant and AtNRT2.6:GFP transformant line .......................................................... 62 Figure 4.3 DAPI stained pollen of A. thaliana. A. WT, B. Atnrt2.6 T-DNA mutant, C. AtNRT2.6:GFP transformant line,  D. Tobacco ................................................................. 63 viii  Figure 4.4 DAPI stained pollen with pollen tubes from WT (A,B) and AtNRT2.6:GFP transformant line (C,D) of A. thaliana .................................................................................. 64 Figure 4. 5 In vitro germination of A. thaliana pollen on liquid medium ........................................... 65 Figure 4. 6 In vitro germination of AtNRT2.6:GFP transformant line pollen of A. thaliana on liquid medium ................................................................................................................................... 66 Figure 4.7 Pollen tube length in WT, Atnrt2.6 T-DNA mutant and AtNRT2.6:GFP transformant line ........................................................................................................................................... 67 Figure 5.1 A. PCR amplification of full length CDS of AtNRT2.6 gene; B. PCR screening of transformant colonies ........................................................................................................... 75 Figure 5.2 A Ensuring correct expression of bait AtNRT2.6 co-transformed with pAlg5-NubI; B Ensuring correct expression of bait AtNRT2.6 co-transformed with pAlg5-NubG ......................... 76 Figure 5. 3 A Screening for protein-protein interaction of AtNRT2.6 and AtNAR2.1 ..................... 77              ix   List of Abbreviations AtNRT2.6 : Gene AtNRT2.6 : Transporter Atnrt2.6 : T-DNA mutant (GABI-Kat547C10) AtNRT2.6:GFP :  transformant line with  AtNRT2.6:GFP  in Atnrt2.6: T-DNA mutant background CHATS : Constitutive high-affinity nitrate transport system DAPI : 4’,6’-diamidino-2-phenylindole GFP : Green fluorescent protein GOGAT: Glutamate synthase GS : Glutamine synthase His : histidine IHATS : Induced high-affinity nitrate transport system LATS : Low-affinity nitrate transport system Leu : Leucine MFS : Major facilitator super family N: Nitrogen NO3 - : Nitrate 13NO3 - : radioactive nitrate supplied by TRIUMF ORF: open reading frame re-induced : 4 week old plants grown hydroponically on 1mM NH4NO3 subjected to N starvation for one week and re-supplied with 1mM KNO3 SD medium : Synthetic dextrose medium for yeast TMD : trans membrane domain TRIUMF: Tri university meson facility, Vancouver Trp : tryptophan Un-induced : 4 week old plants grown hydroponically on 1mM NH4NO3 subjected to N starvation for one week     x   Acknowledgements  First of all I thank my supervisor Professor Anthony DM Glass for guiding me through this journey of research, for his continued encouragement and financial support. His guidance helped me to gain a wealth of knowledge and experience.  I wish to thank my co-supervisor Professor Jeanette Whitton and my research committee member Professor George Haughn for their encouragement and suggestions during my research.  I would like thank Professor Lacey Samuels for the encouragement and allowing me to use sectioning and microscopy facilities...  I would like to thank Dr. Yaeesh M.  Siddiqi for his help and valuable suggestions.  My special thanks to all my lab colleagues during my tenure: Ye Wang, Wenbin Li, Zorica Kotur, and Zenhua Yong, whose support made my research fruitful.  Thanks to Kevin Hodgson and UBC Bioimaging Facility for helping with confocal microscopy.  I thank the Department of  Botany for giving me a Teaching Assistantship. Especially I thank senior instructor Dr. Santokh Singh for his support and encouragement.  Thanks to all graduate students, faculty and staff of the Botany Department for their friendly smiles.  Finally I thank my sister Lakshmi Vinnakota and her family for the loving support.  1   1 Introduction 1.1 General introduction  Since, the discovery of the first nitrate transport gene NRTA (initially named CrnA) from the fungus Aspergillus nidulans (Unkles et al., 1991), molecular developments in nitrate transport in plants have made tremendous progress to understand the role of NO3 - transporters in the uptake kinetics and physiological mechanisms. Nitrogen is an essential component of nucleic acids and proteins that are critical for plant growth and development, making up  4% of plant dry matter (review: Glass 2009).  Plants take up nitrogen mainly in the form of NO3 -, NO2 - , NH4 +, and amino acids depending on the plant species and type of soil. In agricultural soils NO3 - is the most abundant form available to plants even if ammonium and urea fertilizers are added to the soil as they quickly get converted to NO3 - by nitrification (Crawford and Glass, 1998, Wolt 1994, Glass 2009). NO3 -, being anionic, cannot bind to soil particles which are also negatively charged. Therefore NO3 - is highly mobile and gets leached out resulting in wide fluctuations in soil NO3 - concentration (Crawford and Glass 1998, Glass 2009). In addition, fertilizer inputs to manage N availability to plants is also a concern because runoff of NO3 - results in eutrophication of lakes, streams, rivers and oceans. Understanding NO3 - uptake processes in higher plants might help to reduce the present massive global N fertilizer inputs.  Plants have evolved efficient regulatory mechanisms to adapt to heterogeneity in the soil nitrogen status. NO3 -uptake in plants is an active process requiring metabolic energy (ATP) and facilitated by transporter proteins. Nitrate transporters are characterized on their kinetic basis into high-affinity transporters (HATS) that are saturable and operate when external NO3 - concentration  is in the micro-molar concentration range (<1mM) and low-affinity transporters 2  (LATS) that are non-saturable and operate at milli-molar concentrations (>1mM). Substantial information is available with regard to the kinetics and the major genes encoding NO3 - transporters (see reviews by Crawford and Glass1998; Forde 2000; Glass et al., 2002). The genes encoding HATS are grouped into the NRT2 family, while genes encoding the LATS belong in the NRT1 family.   In Arabidopsis the AtNRT2 family has seven members, of which AtNRT2.1 and AtNRT 2.2 are responsible for induced high-affinity transport. AtNRT2.1 is proven to be the major contributor to inducible high-affinity nitrate transport (IHATS) (Zhuo et al., 1999, Vidmar et al., 2000, Li et al., 2007).  Transcript abundance and nitrate influx studies using Atnrt2.1 and Atnrt2.2  mutants confirmed that AtNRT2.2  contributes to the IHATS to a small extent and  plays more of a compensatory role in the absence of AtNRT2.1 (Li et al 2007).  It has also been demonstrated that the AtNAR2.1 gene (not a member of the NRT2 family) is functionally associated with AtNRT2.1 for nitrate transport to occur and, in the absence of AtNAR2.1, HATS nitrate transport is completely curtailed (Okamoto et al., 2006, Yong et al., 2010).  The expression of another NRT2 member AtNRT2.7 in seeds and its role in nitrate uptake in a double mutant of Atnrt.1/Atnrt2.2 and also in the Xenopus system demonstrated its possible role in seed germination (Chopin et al., 2007). However the role of other members of the NRT2 family in nitrate transport awaits characterization. The aim of the current research is to investigate the role of AtNRT2.6 gene in nitrate transport in A. thaliana based on molecular and physiological characterization 1.2 Review of literature 1.2.1 Nitrate uptake across the cell membrane  Nitrate uptake by plants is an energy-requiring active process that occurs against the electrochemical potential gradient. The plasma membrane contains transport proteins, which make it possible for ions to move against this gradient. Physiological experiments in barley 3  using microelectrodes provided evidence for influx of nitrate across the membrane against the potential gradient even at high external nitrate where transport is via the LATS (Glass et al., 1992). This uphill movement of NO3 - involves the co-transport of two H+ for one NO3 - and the energy for active transport is provided by the H+ -ATPase (Glass et al., 1992, Meharg and Blatt 1995).  Concentration-dependent kinetic studies on inorganic ion uptake date back to 1937 when van Den Honert studied phosphate (Pi) uptake by sugarcane roots (Van Den Honert 1937). He observed that phosphate uptake followed hyperbolic kinetics and proposed a rotating conveyor belt model for transport of ions across the plasma membrane. Subsequent studies by Epstein (1972) on ion transport have led to the concept of carriers, relating the carrier kinetics to Michaelis - Menten enzyme kinetics, using Km and Vmax constants to describe the kinetics. Such kinetic studies on NO3 - uptake demonstrated that at concentrations <1mM, ion uptake followed hyperbolic (saturable) kinetics while > 1mM concentration NO3 - uptake was linear and never reached a plateau. This established the existence of multiple carrier/transport systems operating at low and high ion concentrations; these we refer to as high-affinity (HATS) and low-affinity (LATS) transport systems, respectively.  Nitrate influx studies using 13NO3 - in barley (Siddiqi et al., 1990) and in spruce (Kronzucker et al., 1995) at different nitrate concentrations, demonstrated the existence of three transport systems for nitrate uptake. These studies were carried out using different NO3 - pre treatments such as un-induced where plants were grown in medium without nitrate for 1 week and induced where un-induced plants were exposed to nitrate for several hours before measuring nitrate influx with NO3 - concentrations ranging from 1uM to 1mM. In these experiments, un- induced plants initially showed low rates of high-affinity uptake due to a constitutive high-affinity transport system (CHATS). Upon continued exposure to nitrate for several hours, uptake occurs 4  by both the inducible high-affinity transport (IHATS) as well as the CHATS. A third NO3 - transport system was evident at NO3 -  concentrations >1mM which was  constitutive, exhibiting linear kinetics even at 50mM NO3 - in barley and in A. thaliana with a low affinity for NO3 - (CLATS).  Subsequent studies in Arabidopsis have shown the presence of a fourth transport system, which is an inducible low-affinity transport (ILATS) system (Crawford and Glass 1998). Both constitutive and inducible high-affinity systems (CHATS and IHATS) operate with low Km values and follow hyperbolic saturable kinetics while the low-affinity transport systems exhibit linear kinetics (Siddiqi et al., 1990; Aslam, 1992; Kronzucker et al., 1995). Subsequently, genes encoding HATS (NRT2) and LATS (NRT1) have been identified (Forde 2000). 1.2.2 The discovery of NRTA (CrnA) the first nitrate transport gene and molecular developments  The first high-affinity nitrate transporter gene was discovered in Aspergillus nidulans and called NRTA, earlier named CrnA, which refers to the chlorate resistant mutant (Unkles et al., 1991). A second high-affinity nitrate transporter gene NRTB was later identified. Further experiments showed that a double mutant of NRTA and NRTB was completely unable to absorb nitrate while a mutant defective only in NRTA showed a substantial reduction in nitrate uptake compared to wild type strain (Unkles et al., 2001) but was still able to grow on nitrate. This confirms that NRTA (Km 108 uM) although the primary transporter, is assisted by another transporter NRTB (Km 11uM). The discovery of NRTA stood as a model in exploring the NRT2 genes from various other species.  Interestingly, in Chlamydomonas reinhardii, NRT2.1 and NRT2.2 genes are found in a gene cluster with genes involved in nitrate (Nia1) and nitrite (Nii1) reduction similar to A. nidulans; in 5  addition another gene (NAR2) was also found in the cluster. Studies on deletion mutants lacking NAR2, NRT2.1, NRT2.2 have revealed that CrNRT2.1 and CrNRT2.2, are functionally associated with CrNAR2 for nitrate transport (Queseda et al., 1994, Galvan and Fernandez 2001) (Table 1). This was further confirmed in a heterologous system using Xenopus oocytes (Zhuo et al., 2000)); thus, CrNRT2.1 and CrNRT2.2 are the first identified NRT 2 proteins, which participate in a  two-component system in conjunction with CrNAR2.1. Moreover in C. reinhardii, each of the NRT2 genes shows variable different affinity for substrate, with CrNRT2.1 showing a dual specificity for both nitrate and nitrite while CrNRT2.2 exhibits specificity for nitrate alone. A third member, CrNRT2.3 shows a high-affinity for nitrite alone (Galvan et al., 1996). Their role in nitrate transport and assimilation has been well discussed (Fernandez and Galvan 2008). 1.2.3 The discovery of NAR2 in Chlamydomonas reinhardii  Mutant studies in C. reinhardii have proved that NAR2 is essential for nitrate transport. In mutants expressing NRT2.1 and NAR2 or NRT2.2 and NAR2, nitrate transport was evident (Table1), while when NAR2 was deleted no nitrate transport was evident (Quesada et al., 1994). These genetic experiments established that NAR2, a smaller gene with no sequence identity in common with NRT2.1 and NRT2.2 is, however, critical for the function of high-affinity nitrate transport. Experiments in Xenopus oocytes expressing the nitrate transport gene of barley (HvNRT2.1) showed increased uptake when co-expressed with HvNAR2.3 (Tong et al., 2005). Likewise, in A.thaliana, AtNRT2.1 gives enhanced nitrate uptake when expressed together with AtNAR2 in Xenopus (Orsel et al., 2006). These experiments confirm the requirement for NAR2 to facilitate nitrate transport by NRT2.1.  Further studies to characterize NRT2 genes have been carried out in other higher plants, including barley (Trueman et al., 1996), tobacco (Queseda et al., 1997), soybean (Amarasighe 6  et al., 1998), Arabidopsis (Zhuo et al., 1999; Filleur and Daniel-Vedele 1999). rice (Miller et al., 2007), wheat (Zhao et al., 2004)         Table1.1 Functional relation between NRT2.1, NRT2.2 and NAR2 mutants of Chlamydomonas reinhardii ‘+’ present, ‘-’ absent (Information in this table is based on the work of   Queseda et al., (1994);Galvan and Fernandez (2001)  NRT2.1 NRT2.2 NAR2 Nitrate transport + _ _ _ _ + _ _ + + _ _ _ _ + _ + _ + + _ + + +  Genes HvNRT2.1 and HvNRT2.2 (earlier named as BCH1 and BCH2) from barley were the first cloned homologues from higher plants based on the sequences of AnNRTA and CrNRT2.1 from A.nidulans and C.reinhardii (Trueman et al., 1996). Degenerate primers with target sequences based on conserved motifs were used to isolate the HvNRT2.1 and HvNRT2.2 genes.  Based on sequence identities with A.nidulans and C.reinhardii and physiological 7  characterization using 13NO3 -  and transcript abundance studies, there is strong evidence that HvNRT2 family genes contribute to inducible high-affinity nitrate transport (Vidmar et al., 2000). Subsequent cloning experiments were carried out in A. thaliana using degenerate primers (Zhuo et al., 1999) and by a differential display method (Filleur and Daniel-Vedele 1999). The amino acid sequences of these clones were found to be similar to other high-affinity nitrate transporters. Moreover influx studies showed a strong correlation between patterns of 13 NO3 -  influx and AtNRT2.1 gene expression during induction and in experiments using different nitrate levels, supporting the belief that AtNRT2.1 is the major contributor to nitrate influx compared to AtNRT2.2 (Zhuo et al., 1999). These extensive cloning studies in algae, fungi and higher plants helped to isolate genes thought to be responsible for nitrate transport. And also the sequence similarities of these clones confirm the phylogenetic relationship among the various groups. Subsequent studies were focused on gene regulation and functional dependence of NRT2 genes on other genes (NAR2) in nitrate transport. 1.2.4 Expression and regulation of nitrate transport genes  Various kinetic studies demonstrated that whether the external concentration is maintained at 10 uM or 10 mM nitrate, plants could grow efficiently adapting to available nitrate. Glass and coworkers (Glass et al., 2002) showed that the HATS influx was suppressed when the plants were grown on high N, whether it was in the form of nitrate or ammonium. The question posed was which nitrogen form (nitrate, ammonium, or amino acids such as glutamate or glutamine) is responsible for suppressing HATS and NRT2 expression under high-N conditions.  Interestingly, only NO3 - and not NH4 + or other compounds such as amino acids are able to cause induction of HATS or NRT2 gene expression (Vidmar et al., 2000). Using various inhibitors it was clearly shown that glutamine is the intermediate responsible for suppressing 8  HATS through transcriptional regulation (Vidmar et al., 2000). Recent studies by Wang et al., (2007) using A. nidulans provided proof that, in addition to transcriptional regulation, post- transcriptional regulation of NRT2 proteins occurs. Mutants lacking nitrate-reductase activity exhibited higher NRTA transcript and NRTA protein abundance. Yet these mutants showed only ~5% of WT nitrate uptake and thus a post-transcriptional regulation was suggested. In summary the studies show that induction of nitrate transport by HATS (NRT2.1) is due to nitrate, whereas down-regulation is mediated by glutamine, acting transcriptionally. In addition post- transcriptional regulation is evident from studies with nitrate-reductase mutants of A. nidulans. 1.2.5 NRT2 protein domains, amino acid sequence and phylogeny  The NRT2 family belongs to the nitrate-nitrite-porter (NNP) family, which is one among the 17 such transporter families that belong to the major facilitator super family (MFS) (Pao et al., 1998). These transporters have 12 transmembrane domains arranged in two groups of six each connected by a cytosolic loop (Baldwin 1993; Forde 2000).  Extensive studies on topology and sequence similarity helped to further classify NNP transporters into, type I - in prokaryotes (E.coli), type II - in fungi with about 90 amino acids present in a large cytosolic loop between two groups of 6 transmembrane domains and  type III - in algae and higher plants with an extension of about 70 amino acids at the C terminal domain and some variation  by the presence or absence of an N terminal extension of ~20 amino acids. A sequence motif on the fifth transmembrane domain is found to be specific for NRT2 transporters (Pao et al., 1998). A part of this sequence was shared among A. nidulans, C. reinhardii, H. vulgare and in the prokaryote E.coli but is absent in other MFS family members and has been identified as the substrate binding site (Trueman et al., 1996). These studies help to understand the structure and phylogeny and to determine the location of genes based on amino acid and DNA sequence similarities (Forde 2000).  Analysis of the seven NRT2 proteins 9  of A. thaliana revealed that AtNRT2.1, AtNRT2.2, AtNRT2.3, AtNRT2.4 and AtNRT2.6 are known to possess identical domains while AtNRT2.5 is more similar to fungi (yeast) and AtNRT2.7 is related to proteins of both algae and fungi (Orsel et al.,2002). 1.2.6 NRT2 gene family: structure and expression studies  The seven gene homologues of NRT2 family identified in A. thaliana by were grouped into inducible, constitutive, and repressible categories (Table 1.2) based on their transcript abundance in response to nitrate availability (Okamoto et al., 2003). Chromosome map tool from TAIR (http://www.arabidopsis.org) for the NRT2 gene loci revealed the location of AtNRT2.1, AtNRT2.2 and AtNRT2.5 on Chromosome 1; AtNRT2.3, AtNRT2.4 and AtNRT2.7 on chromosome 5; AtNRT2.6 (the gene of interest) is present on chromosome 3 (Figure 1.1A). AtNRT2.6 gene is located on the reverse strand on chromosome 3 with a single intron (3`5`) (Figure1. 1B). It displays 68% amino acid identity with AtNRT2.1 and highest similarity with that of AtNRT2.3 (Okamoto et al., 2003).  Table 1.2 Expression of NRT2 genes in response to nitrate supply (Okamoto et al., 2003)  Gene Expression in response to NO3 −  supply Identity at amino acid level with respect to AtNRT2.1 AtNRT2.1 AtNRT2.2 Inducible 100% 87% AtNRT2.4 Modest induction 82% AtNRT2.5 Repressible 56% AtNRT2.3 AtNRT2.6 AtNRT2.7 Constitutive 68% 68% 44%   10    Figure1. 1 A. Schematic diagram of Arabidopsis thaliana chromosomes with NRT2 gene loci B. AtNRT2.6 (At3g45060.1) gene model (source: TAIR http://www.arabidopsis.org)  A.         B.      AtNRT2.1 AtNRT2.5 AtNRT2.2 AtNRT2.6 AtNRT2.7 AtNRT2.3 AtNRT2.4 1 2 3 4 5   5’utr 1-96  Exon1 1-936  Intron 937-1023 n Exon 1024-1922 2 3’ utr 1813 -1922  ORF 97-1812 11    1.2.7 Characterization of AtNRT2.1 and AtNRT2.2 and the requirement of AtNAR2 in IHATS by use of mutants in Arabidopsis thaliana  Studies using T-DNA disruption mutants of A. thaliana in which both AtNRT2.1 and part of AtNRT2.2 were disrupted showed a 63% reduction in nitrate uptake confirming the role of these two genes in high-affinity nitrate transport (Filleur et al., 2001). However these results could not explain clearly the individual role of the genes but confirmed that these two genes are important for high-affinity transport (Cerezo et al., 2001). Zhuo et al., 1999 and Okamoto et al., 2003 observed a significant correlation between transcript abundance of AtNRT2.1 and nitrate influx in A. thaliana plants which suggested the role of AtNRT2.1 in induced high-affinity (IHATS) transport. It is also evident from these experiments that AtNRT2.2 expression corresponded with influx only during the first few hours of exposure to NO3 - suggesting that AtNRT2.1 is the major contributor in IHATS. AtNRT2.1 also showed a significant role in lateral root initiation and growth (Little et al., 2005, Remans et al., 2006). But the specific role of AtNRT2.2 was not clear from these experiments.  Zhuo et al., 1999 showed that AtNRT2.1 and AtNRT2.2 were present in a head to head configuration.  Subsequent studies by Li et al., 2007 using a double mutant (Atnrt2.1-nrt2.2) confirmed that their disruption caused 80% reduction in IHATS and 30% in CHATS. Individual mutants Atnrt2.1 and Atnrt2.2 demonstrated a reduction in IHATS by 72% and 19%, respectively, but showed no effect on CHATS. Further it was observed that although AtNRT2.2 makes a small contribution in the presence of AtNRT2.1, when AtNRT2.1 is disrupted AtNRT2.2 is more highly expressed, perhaps compensating for the loss of AtNRT2.1 (Li et al., 2007). 12  Okamoto et al., (2006) demonstrated the functional requirement of AtNAR2.1 (AtNRT3.1) for high-affinity nitrate transport. The mutants of Atnar2.1-1 (promoter region) and Atnar2.1-2 (coding region) showed a major decrease in IHATS by 92% and 96% and also a decrease by 34% and 89% in high-affinity constitutive flux (CHATS), respectively. Interestingly LATS influx was not affected by these mutations. 1.2.8 Tissue specific localization studies on AtNRT2 genes  Spatial localization of AtNRT2.1 using a promoter::GUS (Nazoa et al., 2003; Okamoto et al., 2002) and with PNRT2.1-NRT2.1-GFP construct together with immunodetection studies using anti- AtNRT2.1 (Wirth et al., 2007) demonstrated strong expression of AtNRT2.1 in mature regions of root epidermal, cortical and endodermal cells. Likewise, tissue specific expression studies of AtNRT2 genes in GUS transformant lines of A. thaliana showed the expression of AtNRT2.1 and AtNRT2.2 in roots while AtNRT2.6 was expressed in both roots and in pollen (Okamoto et al., 2002). Whilst all AtNRT2 genes showed expression in roots, the GUS activity of AtNRT2.6 specific to pollen is a novel finding suggesting that nitrate may be required during pollen development. 1.2.9 Interaction studies between AtNRT2.1 and AtNAR2.1  Li et al., (unpublished work) demonstrated the interaction of AtNRT2.1 and AtNAR2.1 (At5g50200) at the protein level using the yeast two-hybrid system (Y2H). In a parallel study (Orsel et al., 2007) along with tissue specific localization studies on AtNRT2.1 in constitutively expressed 35S :: AtNRT2.1-GFP in an atnar2.1-1 background reduced GFP fluorescence  was observed in the absence of NAR2. The authors suggested that the expression of NAR2 was essential for the proper targeting of NRT2.1 to the plasma membrane. In a very recent study by Yong et al., (2010), AtNRT2.1 and AtNAR2.1 proteins were resolved from a single band on the 13  2nd dimension SDS-PAGE with anti-AtNRT2.1 and AtNAR2.1-myc antibody. This study provides the first evidence that AtNRT2.1 and AtNAR2.1 exist as a 150 kDa complex in the plasma membrane. 1.3 Research objectives  It is evident from the literature review that the AtNRT2 family is a multi-gene family and that each gene has a unique pattern of expression in response to nitrate availability. Physiological and molecular characterization of IHATS confirmed that AtNRT2.1 is the major contributor to IHATS and it requires the association of AtNAR2.1 for the IHATS uptake of nitrate. Whilst so much focus has been on characterization of AtNRT2.1 and AtNRT2.2 and their role in encoding IHATS, the other NRT2 genes need to be explored to identify their contribution to nitrate uptake. Questions remaining unanswered are 1. what is the role of other NRT2 genes in nitrate transport?  2. Which of these genes encode for constitutive high-affinity transport system (CHATS)? Some of the previous studies on the AtNRT2.6 gene have demonstrated the constitutive expression in response to nitrate availability and reporter GUS expression of promoter AtNRT2.6-GUS in roots and in pollen. AtNRT2.6-GUS expression in pollen is a novel finding and raises a question does pollen require nitrate during their development? Therefore I have framed the following objectives for the present project:  1. To analyze the expression profile of AtNRT2.6 gene, 2. To determine the contribution of AtNRT2.6 gene in nitrate uptake 3. To analyze the requirement of AtNRT2.6 gene for pollen development, 4. To determine  if AtNRT2.6 gene shows interaction with AtNAR2.1.   1.3.1 To analyze the expression profile of AtNRT2.6  I wish to address  question 1. What is the expression pattern of AtNRT2.6 under different conditions of NO3 - provision and in different organs? To answer this question,. I have 14  determined the expression levels of AtNRT2.6 gene quantitatively by real time PCR in WT, an Atnrt2.6 T-DNA mutant and in an AtNRT2.6:GFP transformant line. Tissue specific expression of AtNRT2.6 gene was analyzed in the AtNRT2.6:GFP transformant line using confocal laser scanning microscopy (CLSM).  1.3.2 To determine the contribution of AtNRT2.6 gene in nitrate uptake  My goal was to determine the contribution of AtNRT2.6 gene to NO3 - influx under un-induced and induced conditions.  In addition I have determined  the tissue nitrate levels to investigate if AtNRT2.6 makes any contribution to internal redistribution of nitrate (e.g between vacuole and cytoplasm or between root and shoot) rather than uptake from external media. To address these questions 13NO3 - influx in un-induced and induced WT, Atnrt2.6 T-DNA mutant and in AtNRT2.6:GFP transformant line were measured and tissue nitrate content was determined in plants subjected to N deprivation. 1.3.3 To analyze the requirement of AtNRT2.6 gene for pollen development  The observation, based upon promoter AtNrt2.6:GUS expression in pollen is interesting and needed  confirmation. Therefore to analyze the requirement of AtNRT2.6 gene in pollen development I would like to answer the question:   What is the role of AtNRT2.6 gene in pollen viability and development? To answer this viable pollen were counted and percent pollen germination was determined in WT, Atnrt2.6 T-DNA mutant and in an AtNRT2.6:GFP transformant line. Light micrographs of chemically fixed anthers were compared to identify structural and developmental differences in the pollen.   15  1.3.4 To identify if the AtNRT2.6 gene shows interaction with AtNAR2.1.  Physiological and immunological studies have confirmed the functional association of AtNRT2.1 and AtNAR2.1. This raises another question: Does AtNRT2.6  also show interaction with AtNAR2.1? To answer this, the yeast two-hybrid split ubiquitin system was used by modifying the C terminal half of split ubiquitin with AtNRT2.6 as a bait construct and the N terminal half with AtNAR2.1 as prey. Interaction between these proteins was determined based on positive response to - histidine auxotrophy and Galactocidase acivity by performing X-Gal filter assay. 1.4 Outline of research chapters  Chapter 2 of this thesis describes the expression profile of AtNRT2.6 gene in un-induced plants which were deprived of any N source for one week and induced (re-induced with 1mM KNO3 for 6 h) both in root and shoot. Relative quantitative expression of AtNRT2.6 was determined in WT, Atnrt2.6 T-DNA mutant (GABI-Kat 547C10), and in AtNRT2.6:GFP transformant line by real time PCR. In addition, tissue specific expression pattern of AtNRT2.6:GFP  construct under the native promoter was also  examined by confocal microscopy. Previous studies have measured the transcript abundance of AtNRT2.6 based on time course experiments (Okomoto et al., 2003) both in root and shoot and by semi-quantitative PCR in root (Orsel et al., 2002). The present study provides quantitative relative expression levels of AtNRT2.6 in all the genotypes to correlate with the physiological data. The GFP expression pattern under native promoter of AtNRT2.6 gene is a confirmation of the GUS reporter assay for AtNRT2.6-GUS (Okamoto, 2002).  Chapter 3 focuses on analyzing the contribution of AtNRT2.6 to nitrate influx into roots and flux to shoot in A .thaliana by measuring 13NO3 - influx (expressed as a flux per unit root fresh weight) 16  of the plant in WT, Atnrt2.6 T-DNA mutant and in the AtNRT2.6:GFP transformant line. In addition analysis of tissue nitrate content in the root and shoot tissues will investigate the partitioning of nitrate from root to shoot and its utilization pattern during a one week period of N deprivation from external source. Using this reverse genetics approach we hypothesize that the loss of function in Atnrt2.6 T-DNA mutant would help to understand the role of AtNRT2.6 gene in nitrate transport.   This work will add to the information available with regard to the physiological role of NRT2 family members  AtNRT2.1, AtNRT2.2 (Okamoto et al., 2006; Li et al., 2007) and help in functional characterization of AtNRT2.6 gene.  Chapter 4 investigates the contribution of AtNRT2.6 to pollen viability and development. Male gametophyte (pollen) is a good model system to study the contribution of AtNRT2.6  to pollen development as we can observe different stages of cell growth and morphogenesis (Feijo et al., 2001)   Pollen represent an isolated sink without plasmadesmatal connections to the tissues of the anther, hence any ion or substrate exchange (e.g. sucrose) require transporters (Schneindereit et al., 2003).  This work will be an addition to the AtNrt2.6:GUS expression studies in pollen of Arabidopsis (Okamoto et al., 2002 unpublished) to confirm the expression in pollen and its role if any in pollen development. It has been established that AtNRT2.1 contributes to lateral root development (Remans et al., 2006) and AtNRT2.6:GUS expression in root is similar to that of AtNRT2.1:GUS (Okamoto et al.,, 2002 unpublished). Chapter 5 demonstrates the functional relation of AtNRT2.6 with AtNAR2.1 in the yeast two- hybrid split-ubiquitin system. This system is used to explore potential interactions between two proteins. An AtNRT2.6 clone is used as a bait to check the interaction with AtNAR2.1 as a prey. Thus far, AtNRT2.1 and AtNRT2.2 proteins have been shown to interact with AtNAR2.1 by this method and using the Xenopus heterologous expression system (Zhuo et al., 2000, Tong et al., 2005, Orsel et al., 2006) 17  Chapter 6   is a conclusion on findings from the present research on the role of the AtNRT2.6 gene in nitrate transport using a reverse genetic approach based on a T-DNA mutant Atnrt2.6 and the restoration of function in AtNRT2.6:GFP transformant line. The phenotypes are compared based on gene expression profile, nitrate uptake and pollen development. In addition functional association of AtNRT2.6 with AtNAR2.1 has also been evaluated based on protein interaction studies in the yeast two-hybrid split-ubiquitin system.                         18   2 Expression profile of AtNRT2.6 gene 2.1 Introduction  Physiological studies in Arabidopsis provide evidence for the existence of three nitrate transport systems, two High-Affinity Transport Systems (HATS): constitutive (CHATS) and induced (IHATS) at nitrate concentrations <1mM and a Low-Affinity Transport System (LATS) at >1mM external NO3 - concentrations. Two gene families, NRT2 and NRT1 are known to code for HATS and LATS, respectively (reviews: Crawford and Glass 1998; Forde 2000; Glass et al., 2002, Glass 2009). Nitrate transport genes AtNRT2.1 and AtNRT2.2 from Arabidopsis were cloned for the first time using degenerate primers based on conserved sequences of NRTA (A. nidulans) and NRT2.1 (C. reinhardtii)  genes (Zhuo et al., 1999). In a parallel study Filleur and Daniel- Vedele, (1999) used a differential display technique in response to nitrate provision and identified AtNRT2.1 as a putative high-affinity transport gene.  Completion of the Arabidopsis genome sequence identified five more homologues from the NRT2 gene family (Glass et al., 2001). Multiple members of the NRT2 family are also found in other species. To date two nitrate/nitrite transport genes (NRTA and NRTB) have been documented in A. nidulans (Unkles et al., 2001), six NRT2 genes in C. reinhardtii (Fernandez and Galvan 2008) and ten in barley (Hordeum vulgare). All belong to the NRT2 family (Forde 2000). Other higher plant NRT2 genes have been identified from several other species (Glass, 2010) including tobacco (Quesada et al., 1997) and soybean (Amarasinghe et al., 1998).  Bioinformatic studies confirmed that AtNRT2.1, AtNRT2.2 and AtNRT2.4 and AtNRT2.3 and AtNRT2.6 show high homology (Table 1.1 chapter 1) at the protein level (Okamoto et al., 2003). Transcript abundance studies in response to nitrate provision helped to classify NRT2 genes in 19  to three categories: - inducible: AtNRT2.1, AtNRT2.2 and AtNRT2.4; constitutive: AtNRT2.3, AtNRT2.6, and AtNRT2.7; and repressible: AtNRT2.5 (Okamoto et al., 2003). As outlined in Chapter 1, there is strong evidence that IHATS is mainly encoded by AtNRT2.1. However, when AtNRT2.1 is disrupted AtNRT2.2 may compensate (Li et al., 2007).  Using a promoter GUS construct (Nazoa et al., 2003) and GFP fusion and immunodetection studies with anti-AtNRT2.1 (Wirth et al., 2007), it was demonstrated that AtNRT2.1 expression was restricted to matured regions of root epidermal, cortical and endodermal cells.  In a recent study AtNRT2.1 and AtNAR2.1 (AtNRT3.1) were shown to be functionally associated in the plasma membrane of root cells as a 150 kDa complex  based on BN-PAGE and YFP tagged protoplast fusion (Yong et al., 2010). Thus far, gene expression profile studies and functional characterization based on nitrate influx in appropriate mutants have demonstrated that AtNRT2.1 and AtNRT2.2 are candidates for IHATS in response to NO3 - supply. In contrast to AtNRT2.1 and AtNRT2.2 that are NO3 -  inducible genes, Okamoto et al., (2003) reported that AtNRT2.6 was expressed constitutively both in NO3 - - starved and NO3 - - induced conditions and continued exposure to nitrate  (72hrs) failed to produce any change of transcript abundance (Okamoto et al., 2003). Preferential expression of the AtNRT2.6 gene in roots was demonstrated in time-course experiments (Okamoto et al., 2003). Studies by Orsel et al., (2002) also have reported the expression of AtNRT2.6 gene in roots of plants at vegetative and flowering stages . Expression of promoter AtNRT2.6-GUS in the pollen of young flowers is a novel finding (Okamoto 2002) which needs confirmation by further study. To obtain more details on the expression profile of AtNRT2.6 that may give clues regarding functional role(s), I chose to examine AtNRT2.6 expression in vegetative and in flowering phases, and substrate effects (induced and un- induced by nitrate).  20  In this chapter, I have presented the results on: 1. the location of the T-DNA insertion in the Atnrt2.6 mutant (GABI-Kat547C10), 2. Relative expression levels of AtNRT2.6 gene in root and shoot based on real time PCR data, 3.Tissue specific expression of AtNRT2.6: GFP  in root cortical cells and in pollen of the young flower buds (stages 9 and 10) as viewed by confocal microscopy. Relative expression levels of AtNRT2.6 gene were determined in roots and shoots of un-induced (no N supply for one week) re-induced (N starved plants resupplied with 1mM NO3 - for 6 h) plants of WT, T-DNA mutant Atnrt2.6 and in AtNRT2.6:GFP transformant line. 2.2 Materials and methods 2.2.1 Plant growth conditions  Arabidopsis thaliana WT Columbia, Atnrt2.6 mutant line (GABI-Kat line 547C10) and a GFP transformant line in the mutant background Atnrt2.6-AtNRT2.6:GFP (Wang, unpublished) seeds were used for the plant material. Plants were grown hydroponically (Okamoto et al., 2003) on Styrofoam floating discs (30X25 cm) with 25 holes made in five rows with 3 cm spacing between the holes. The holes are made to fit ~1.5cm diameter 2 cm length tubes cut from 10ml disposable pipette tips. The bottoms of each tube were closed using a nylon mesh and the tubes were filled with sterilized sand. Floating discs with tubes were placed in plastic trays (capacity 8 L) connected to an air supply to maintain continuous aeration in the solution. This design is very useful to grow Arabidopsis plants in hydroponics as the roots can grow quickly in to the nutrient solution through the nylon mesh and also it is possible to take out intact seedlings to flash freeze in liquid N2 or to measure nitrate influx. Seeds of chosen Arabidopsis lines were surface sterilized in 1% bleach for 5 min and after repeated washings with sterile water were left overnight at room temperature prior to sowing. Floating discs with sand filled tubes were initially kept in water and seeds were sown on the moistened sand (3 plants per disc) and maintained in a growth room for germination. After germination the discs were transferred to nutrient solution. 21  Modified Johnson nutrient solution (1/10 dilution) contained  1mM KH2PO4, 0.5 mM MgSO4, 0.25 mM CaSO4, 20 µM Fe-EDTA, 25 µM H3BO3, 2 µM ZnSO4, 2 µM MnSO4, 0.5 µM CuSO4, 0.5 µM (NH4)6Mo7O24 at pH 6 maintained by adding approximately 2 g of powdered CaCO3. In addition, the plants were generally supplied with 1mM NH4NO3. In order to investigate AtNrt2.6 expression and 13NO3 - influx in wild type (WT), Atnrt2.6 mutants and mutants restored with the AtNRT2.6:GFP cDNA, plants were grown for 4 weeks after germination in media containing 1mM NH4NO3.  Thereafter, plants were deprived of NH4NO3 for 1 week, and then resupplied with 1mM KNO3 for 6hrs to induce nitrate-inducible genes. KNO3 is used for re-induction in place of NH4NO3 because NH4 + inhibits NO3 - influx during short induction times (Kronzucker et al., 1999). Plants were maintained in walk-in growth rooms with 8/16 hrs light/dark periods at 23oC with 70% relative humidity. Philips fluorescent lights (TL90 series of F32T8/TL950 (Hg)) were used as light source with irradiance of ~100 m-2 s-1 at plant level.  Sampling for RNA isolation was done during vegetative (starting from 4 weeks after germination) and at flowering stages (6-7 weeks) four hours after the start of the light period.  Root and shoot samples were flash frozen in liquid nitrogen and brought to the laboratory for further experiments. 2.2.2 Confirmation of T-DNA in the Atnrt2.6 mutant (GABI-Kat 547C10)  Arabidopsis thaliana mutant seed (Atnrt2.6) obtained from GABI-Kat (GABI-Kat 547C10) with the genetic background of Columbia-0 was screened for T-DNA insertion. Seeds were sterilized in 1% bleach for 5 min. and washed several times with sterile water. Sterilized seeds were then plated on complete MS medium with vitamins (plant media) 4.4 g/L, 3% sucrose, 0.8% agar and sulfadiazine (75 mg/10 ml), pH 5.7. WT and transformant line Atnrt2.6-AtNRT2.6:GFP  seeds were also plated alongside the Atnrt2.6 seeds on sulfadiazine  to verify the  resistance of Atnrt2.6 seed to sulfadiazine. Genomic DNA was isolated (from the selected Atnrt2.6 seedlings and PCR screening was done using gene specific and T-DNA primers from GABI-Kat to confirm 22  the T-DNA insertion. The PCR product was sequenced to determine the location of the T-DNA insertion. Sequence results were verified using CLCbio workbench for DNA analysis (http://www.clcbio.com/index.php?id=27).  2.2.3 RNA isolation and relative RT-PCR  Total RNA was isolated from flash frozen root, shoot and flower samples separately either by using Trizol reagent (Invitrogen) or by using RNeasy plant mini kit for total RNA mini preps from plant tissues (Quiagen). Concentrations of total RNA were determined by using a UV spectrophotometer (Biospec-1601 Shimadzu) at A260. Two step RT-PCR was performed to check the expression of AtNrt2.6 gene. First strand cDNA was prepared by using reagents and protocol from the manufacturers (Invitrogen). Initially RT-PCR was performed in MJ mini PCR cycler under the following conditions: with initial denaturation at 95oC for 3 min., 30 cycles of 94oC for 30sec for denaturation, 58 oC for 45 sec for annealing, 72oC for 2 min for extension and final extension at 72oC for 10 min using 250 ng cDNA in a reaction volume of 25 L with thermopol reaction buffer, 2.5 mM dNTPs and Taq polymerase (New England Bio Labs). Annealing temperatures were adjusted based on the melting temperatures of the primers.  Gene specific primers for complete and internal gene primers of AtNRT2.6 were used in the RT-PCR (IDT) (Table 2.1). Quantitative real-time PCR  Real time PCR was performed using SYBR Green detection using BIO-RAD Miniopticon Real time PCR system with gene specific primers designed to get a 200 bp product size (IDT) (Table1) and Actin 2 primers were used to measure presence of  a house-keeping gene. 20 L of reaction mixture contained 10 L of iQ SYBR Green Supermix (Cat 170-8880,Bio-rad), 1L 23   Table 2. 1 AtNRT2.6 gene specific and other primers used in RT-PCR Primers Primer sequence Product size bp AtNRT2.6 gene specific primers to flank exons F: 5’ TAAAGACAAATTCTCCAAGGTCTTTTGGTT CGCTGTGAAAAACT 3’ R: 5’TCGGGAGTTACTCAACTTCTTTTCTTCTCT TCCTCGAGGTTTAGTACGGC 3’  505 Real time PCR F: 5’-AAGTTTCTAAAGACAAATTCTCCAAG- 3’ R: 5’- TAGAAGTATCCAGATATAACGTTGTTG3’  200 Actin 2 F: 5’-ACACTGTGCCAATCTACGAGGGTT- 3’ R: 5’-ACAATTTCCCGCTCTGCTGTTGTG- 3’  200 mGFP F:5’-TCAAGGAGGACGGAAACATC-3’ R: 5’-AAAGGGCAGATTGTGTGGACG-3  200 T-DNA screening (GABI-Kat) T-DNA primer,  5'-ATATTGACCATCATACTCATTGC-3' gene specific primer,  5'-AGCTGTAAGCATAAGTGAGAAGGC-3' 600  cDNA (50 ng), and 0.8 L(10 mol)  each of the primers. PCR was run under the following conditions: 95oC 3 min for initial denaturation and 30 cycles at 95oC for 30 sec, 56oC for 20 sec and 72oC for 30 sec. Plate reading was set at the end of every cycle. The threshold for detection was set manually in the linear range of the primary curve. Three replicate reactions for each sample were used. The relative expression levels of AtNRT2.6 gene was calculated based on the C(t) values of the house keeping gene, Actin 2 (Pfaffl 2001). 24   2.2.4 AtNRT2.6:GFP  gene construct and transformation  A T-DNA mutant of Atnrt2.6 (GABI-Kat line 547C10) was used to receive   the AtNRT2.6: GFP construct. Promoter AtNRT2.6 and open reading frame (ORF) were cloned from the A. thaliana WT. P-ORF AtNRT2.6 C terminal was linked to the upstream of GFP5 gene. Thus GFP was placed  downstream to the ORF of AtNRT2.6 gene, and this allows the expression of GFP as a reporter under the control of the AtNRT2.6 promoter (Figure 2.2 ). AtNRT2.6:GFP construct was inserted into a  binary vector pVKH18GFPN  (Zheng et al., 2005) with kanamycin resistance cassette. AtNRT2.6 gene was cloned with both promoter and ORF to place the gene upstream of the GFP gene. Agrobacterium was cultured with the plasmid clone pVKH18GFPN with P AtNRT2.6 ORFC insert and transformed into the Atnrt2.6 mutant (Columbia 0) by the floral dip technique (Wang Y, unpublished).  Figure2. 1Schematic representation of AtNRT2.6:GFP construct  Promoter ORF At NRT2.6 GFP  2.2.5 Tissue specific expression of AtNRT2.6 gene  T2 seeds of the AtNRT2.6:GFP transformant line were grown hydroponically under the conditions described above.  Root, leaf and flower samples were collected to detect GFP expression at the tissue level using confocal microscopy. Confocal images (Zeiss 510 Meta Laser Scanning Confocal Microscope) were taken with settings for green channel adjusted to 488 nm excitation and emission 510-530 nm (GFP) and red channel with excitation at 568 and 25  emission at 580-660 nm (chlorophyll). Optical sections along the Z-axis and meta analysis were performed to identify the GFP localization and to measure the intensity of the signal. WT and Atnrt2.6 mutant lines were used as controls to subtract the noise due to intrinsic fluorescence to determine the GFP signal. 2.3 Results 2.3.1 Confirmation of T-DNA insert in Atnrt2.6 T-DNA mutant (GABI-Kat 547C10)  Figure 2.2A shows the resistance of Atnrt2.6 T-DNA mutant seedlings (GABI-Kat 547C10) to sulfadiazine on the marker plate. AtNRT2.6:GFP transformant line in the Atnrt2.6 mutant background  was also found to be resistant to sulfadiazine while the WT  seeds did not grow (Figure 2.2A ). PCR results with the T-DNA primers and gene specific primers demonstrated the presence of insert in both Atnrt2.6 T-mutant and AtNRT2.6:GFP line genomic DNA (Figure 2.2B). Sequencing results for this confirmed the T-DNA location in the promoter region ending just 5 base pairs before the start codon (Figure 2.2 C).               26  Figure2. 2Screening for Atnrt2.6 T-DNA mutant  A. Sulfadiazine marker plate showing the resistance of Atnrt2.6 mutant and AtNRT2.6:GFP transformant line, B. PCR results showing T-DNA insert, (lane 2  –WT no product, lane 3  –Atnrt2.6, lane 4 -AtNRT2.6:GFP transformant line  C. sequencing result showing the location of T-DNA insert.           B  1        2       3       4 A Atnrt2.6 AtNRT2.6:GFP WT 27             C 28  2.3.2 Expression of AtNRT2.6 by RT-PCR  It has been widely documented that the expression of nitrate transport genes is dependent on the external NO3 - concentration (reviews Forde 2000, Glass et al., 2002). In the present study AtNRT2.6 gene expression was analyzed under un-induced and re-induced conditions in different plant organs: root and shoot, to determine if there is any preferential expression. Primers were designed to flank the two exons of the gene to eliminate genomic DNA amplification (Table2.1). Regular RT- PCR experiments were done with 18S internal standards (3:7 ratio) to confirm the expression of AtNRT2.6 in root, shoot and flower samples of WT and AtNRT2.6:GFP transformant line. AtNRT2.6 gene expression was observed in un-induced and re-induced root and shoot samples (Figure 2.3 A, B). Figure 2.3 C shows the expression of AtNRT2.6 gene in WT and AtNRT2.6:GFP flower samples. The expression of the GFP gene in AtNRT2.6:GFP was confirmed by performing RT-PCR with the primers for the GFP gene (Figure 2,3D). Although by RT-PCR the quantitative expression of AtNRT2.6 gene cannot be determined exactly, these results provide the basic details about the transcript abundance with reference to 18S standards. In un-induced plants both root and shoot samples of WT showed high transcript abundance with reference to 18S standard. Whereas in AtNRT2.6:GFP the expression is high in shoot compared to root and in shoot the transcript level is similar to 18S standard. However, these results exhibit the expression of AtNRT2.6 in root, shoot, and flower and in both un-induced and re-induced plants. In addition, the RT-PCR with the primers to detect the GFP gene expression provides confirmation for the expression of reporter GFP in the transformant line.      29  Figure2. 3 AtNRT2.6 expression in root, shoot and flower of WT and AtNRT2.6:GFP transformant lines of A. thaliana plants grown hydroponically. A. un-induced samples after one week N starvation, B. plants re-induced with 1mM KNO3 for 6h. C. Expression of AtNRT2.6 in flowers of WT and AtNRT2.6GFP and confirmation of GFP PCR product.   A un-induced B re-induced    AtNRT2.6 18S  WT Root shoot   AtNRT2.6:GFP Root shoot   WT Root shoot   AtNRT2.6:GFP Root shoot     AtNRT2.6 18S   C Root D Flower                   AtNRT2.6                         GFP  WT    AtNRT2.6:GFP   WT    AtNRT2.6:GFP    AtNRT2.6    GFP  Real time PCR for relative quantitative expression of AtNRT2.6 gene Real time PCR was performed to measure the relative expression levels of AtNRT2.6 gene with reference to the housekeeping gene Actin 2  in root and shoot samples after 7 days of N deprivation and 6h re-induction with 1mM KNO3. The relative expression of AtNRT2.6 gene in WT, Atnrt 2.6 T-DNA mutant and AtNRT2.6:GFP transformant levels was calculated from the mean values of two experiments. Cycle threshold (Ct) values were considered at 20 cycles, where the curves representing all the samples start to show an exponential increase and the threshold line is set to derive the data from the graph. Ct values of the samples were used to calculate the expression levels with reference to Actin 2 housekeeping gene at the same threshold point according to Pfaffl (2001).  30  Figure 2.4A shows the relative expression levels of AtNRT2.6 gene in un-induced plants based on the ∆Ct value in WT, Atnrt2.6 T-DNA mutant and AtNRT2.6:GFP transformant line. The expression of AtNRT2.6 gene in Atnrt2.6 T-DNA mutant is reduced by 45% in root and 67% in shoot compared to WT (P<=0.05). The expression levels in re-induced plants was reduced by 55% in root and 80% in shoot compared to WT (P<=0.05). By contrast, the expression of AtNRT2.6 gene was restored to WT levels in both un-induced and re-induced transformant plants. Figure2. 4 Relative expression of AtNRT2.6 gene based on real time PCR  (Ct =20 cycles) in root and shoot samples of WT, Atnrt2.6 T-DNA mutant and AtNRT2.6:GFP transformant line grown hydroponically. A. un-induced plants after N-deprivation for one week B. re-induced with 1 mM KNO3 for 6 h. Results are the means of three separate experiments using 3 replicates for each sample P<=0.05, n=3)       A              B  31   Confocal Microscopy for tissue-specific localization of AtNRT2.6 gene Transformant lines of A. thaliana were developed with the AtNRT2.6:GFP construct in Atnrt2.6 mutants.  GFP was fused downstream to the AtNRT2.6 ORF thus both the expression of AtNRT2.6 and GFP are operated under the control of the native promoter of AtNRT2.6. AtNRT2.6:GFP transformant lines grown hydroponically were used to detect the GFP expression in roots, leaves and pollen by confocal microscopy.  Tissue-specific expression of GFP was observed by setting the wavelengths at 488 nm for excitation and 506-530 for emission and the signal was measured under both green and red channels of the microscope. GFP expression was observed in root cortical cells along the cell membrane (Figure 2.5 A-F). The signal intensity was measured by spectral analysis (Table 2.2). Wild type plants (WT) without GFP were used as negative controls. In leaves a strong signal is seen in the trichomes of the leaf while the signal was not clear in the mesophyll cells Figure 2.6 A-B)  Young flower buds at stage 9 and 10 (pre-anthesis stage) were used to detect AtNRT2.6:GFP expression. GFP signal was observed as a border (presumably the plasma membrane) of the pollen (Figure.2.7 A-F). WT anthers were used as the negative control to compare signal intensity.        WT 32     Figure2. 5Tissue specific localization of AtNRT2.6:GFP  in roots.  A. root cortical cells showing GFP signal (white arrows). B. WT control. C. Orthogonal section of AtNRT2.6:GFP root showing the GFP signal in cortical cells while the signal is not strong in central vascular cylinder. D. WT control. E, and F show spectral images of AtNRT2.6:GFP  and WT control. Marked areas in the image are region of interests showing corresponding spectrum (Table 2.2).    520 540 560 580 600 620 640 Emission wavelength (nm) 0 50 100 150 200 250 Intensity ROI 1 ROI 2 ROI 3  520 540 560 580 600 620 640 Emission wavelength (nm) 0 50 100 150 200 250 Intensity ROI 1 ROI 2 ROI 3    A B C 1 1 2 3 D F E 3 2 33      Table 2.2 Spectral data showing intensity of GFP expression in roots  Intensity expressed in a.u. (arbitrary units) ROI: region of interest marked in figure 2.5 E, F  Genotype Wavelength (nm) ROI 1 ROI 2 ROI 3 Average interpolated intensity at 510nm  (a.u) AtNRT2.6:GFP 506 99.4 32.5 41.3 70.06  517 161.9 50.0 63.0 WT 506 31.0 28.5 29.4 29.77  517 28.2 30.0 31.8     Figure2. 6Tissue specific localization of AtNRT2.6:GFP  in leaves A. AtNRT2.6:GFP line showing trichome and mesophyll tissue B. WT leaf showing mesophyll tissue  Bold arrow pointing to trichome showing GFP signal and fine arrow showing mesophyll tissue.       A B 34    Figure2. 7Tissue specific localization of AtNRT2.6:GFP  in pollen . Anthers from stage 9 and 10 flowers of AtNRT2.6:GFP  transformant line (A,C); Anther of WT (B,D) Bold arrow pointing to pollen           C  D D A B 35     Figure 2.7. Continued. E-F Tissue specific localization of AtNRT2.6:GFP  in pollen. E- F pollen squeezed out from the anthers, G. Pollen from the WT (negative control), H..spectral image of pollen from AtNRT:2.6GFP line, I. spectral image of pollen from WT (negative control). Images A-E were captured with  20X and F- H 40X objective. Coloured circles around the pollen (H,I) are the region of interest (ROI) delimited with selection to measure fluorescence intensity.(data in Table 2. 3)     D E  D F  D G 36  510 520 530 540 550 560 570 580 Emission wavelength (nm) 0 50 100 150 200 250 Intensity ROI 1 ROI 2 ROI 3 ROI 4 ROI 5  510 520 530 540 550 560 570 580 Emission wavelength (nm) 0 50 100 150 200 250 Intensity ROI 1 ROI 2 ROI 3  Table2. 3 Spectral  data showing intensity of  GFP expression in pollen G. H  WT control Intensity was measured in a .u. (arbitrary units) ROI: region of interest marked in figure 2.7 G,H Average intensity of five pollen at  = 506 -517  and is presented in the table   Genotype Wavelength (nm) Average intensity (a.u) Average interpolated intensity at 510 nm (a.u) AtNRT2.6:GFP 506 61.42 62.7  517 61.9 WT 506 27.46 28  517 28.86       D H  D 1  D 2  D 3  D 4  D 5  D 3  D 4  D 1  D 2  D 3  D I 37  2.4 Discussion  Transcript abundance in response to nitrate provision during time course experiments, led to the classification of AtNRT2 genes into inducible, constitutive and repressible genes (Okamoto et al., 2003). Clear evidence is available from previous studies on the expression profile of AtNRT2.1 to document its spatial and temporal expression pattern (Okamoto et al 2003, Nazoa et al 2003, Girin et al, 2007). In the present study the expression profile of AtNrt2.6 is determined in response to nitrate availability at different stages of plant growth in different organs and tissues. 2.4.1 AtNRT2.6 gene expression pattern RT-PCR and real time PCR studies  Earlier reports demonstrated a constitutive expression pattern of AtNRT2.6 gene in roots of A. thaliana in re-induced plants (Okamoto et al 2003) based upon RT-PCR and GUS expression. Likewise, Orsel et al., (2002) showed similar expression levels of AtNRT2.6 in roots during different growth stages using nitrate induced plants by RT-PCR. In addition Okamoto et al., (2003) observed low levels of AtNRT2.6 in shoots and (based upon patterns of GUS expression) relatively high expression levels in pollen ((Okamoto et al., 2002).  By contrast, in their semi-quantitative RT-PCR study, Orsel et al., (2002) failed to observe expression in shoots and flowers. In the present study RT-PCR and real time PCR data demonstrated the expression of AtNRT2.6 both in root and shoot, in un-induced and re-induced plants of WT and AtNRT2.6:GFP transformant lines (Figure 2.3. A, B and Figure. 2.4 A,B). In addition expression in flowers was also confirmed by the RT-PCR result (Figure 2.3 D). Strong expression of the AtNRT2.6 gene in flowers observed in this study is a confirmation to the transcriptome data ( efp browser http://bar.utoronto.ca; https://www.genevestigator.com/gv/user/gvLogin.jsp). The expression of AtNRT2.6 gene in all the organs, namely root, shoot and flower and its restoration 38  in the AtNRT2.6:GFP transformant line to the WT levels is an important observation in this study. Reduced expression in un-induced plants of Atnrt2.6 T-DNA mutant by 45% in root and 67% in shoot compared to WT (P≤0.05) and by 55% in root and 80% in shoot compared to WT (P P≤0.05) in re-induced plants. The position and the length of T-DNA determine the expression of the gene of interest in the mutants. Insertional mutagenesis studies( Krysan et al.,1999) have reported that location of T-DNA insert in the promoter or in the 3’ UTR  results in reduced expression and thus generates a  knock-down mutant. T-DNA  insertion in the coding region will result in null expression and produces a  knock-out mutant. In the present study the  sequencing results of the PCR product of Atnrt2.6 T-DNA mutant (GABI-Kat 547C10) with gene specific and T-DNA primers confirmed the location of the T-DNA insert in  the promoter region just 5 base before the start codon. Therefore the reduced expression of AtNRT2.6 gene in the T-DNA mutant Atnrt2.6 (Figure 2.4) suggests that the mutant is a knock down mutant. 2.4.2 Tissue specific localization of AtNRT2.6 gene in GFP transformant lines  Consistent with the RT-PCR results of the present study ( Figure.2.3 & 2.4) the expression of AtNRT2.6:GFP transformant line showed the AtNRT2.6 gene expression in the roots, shoot (trichomes) and flower (specifically in  pollen), which is evident from the GFP expression. The GFP expression is localized in the cortical cells clearly observed in the orthogonal section of root (2.5 B) and from the corresponding  spectral data (Table2,2 & Figure 2.5 C), compared to the wild type controls. An earlier study on the AtNRT2.6-GUS gene in roots showed a similar localization pattern (Okamoto 2002) and in GUS transformed lines of AtNRT2.1 (Okamoto et al 2002; Nazoa et al 2003; Girin et al., 2007). AtNRT2.1GFP (Wirth et al 2007) was reported to be localized in epidermis and cortical cells suggesting that this gene is showing a similar localization pattern. In the present study AtNRT2.6:GFP expression  was also observed in pollen (Figure 2.7); the anther at stage 9 and 10 of flower development  showed a strong signal 39  compared to wild type controls. This observation is similar to the earlier report on the expression of AtNRT2.6GUS in pollen of young flowers (Okamoto 2002). Earlier studies on gene expression profile in epidermal, basal and trichomes cells reported the expression of nitrate/chlorate transporter (Lieckfeldt et al 2008), and GUS assay studies reported AtNRT2.3 and AtNRT2.4 gene expression in hydathodes and trichomes (Leggewie et al 2001). In this study AtNRT2.6:GFP is observed in trichomes (Figure 2.6 A). The mesophyll cells did not show a GFP signal similar to the wild type control.  In summary, the results from RT-PCR studies demonstrated the constitutive expression pattern of AtNRT2.6 gene in roots and shoots of NO3 - un-induced and re-induced plants. It is evident from the real time PCR studies that the expression of AtNRT2.6 gene in AtNRT2.6:GFP transformant line has been restored to WT level. The constitutive expression of the AtNRT2.6 gene leads to an interesting hypothesis that it might contribute to the constitutive NO3 - uptake and so far not much research has been done on the molecular basis of constitutive uptake of NO3 - under N-limited conditions. Thus the present findings regarding AtNRT2.6 expression studies lead to an interesting study to determine the role of AtNRT2.6 in NO3 - uptake (chapter 3). Moreover the localized expression of AtNRT2.6 in pollen observed in the present study lead to the further investigation on the possible role  of AtNRT2.6  in pollen development (chapter 4).        40  3 Role of AtNRT2.6 gene in nitrate transport 3.1. Introduction The ability of plants to absorb nitrogen under conditions wherein N resources are chemically heterogeneous and fluctuating in concentration in soils depends on their physiological and developmental adaptations. Such adaptations include having  highly regulated nitrate transport systems as well as a good foraging root system that can explore large soil volumes (reviews: Forde and Walch-Liu, 2009, Glass et al., 2002, Glass 2009). Physiological studies on nitrate uptake provide evidence for the existence of two distinct NO3 - transport systems, a low-affinity (LATS) and a high-affinity (HATS) transport system (Aslam et al., 1992; Siddiqi et al., 1989, Kronzucker et al., 1995). NRT1 and NRT2 nitrate transporters belongs to major facilitator super family (MSF) encoded by two gene families NRT1 and NRT2 respectively (review ed. by Forde 2000).  Based on homology search and transcript abundance studies Okamoto et al., (2003), reported that the AtNRT2 gene family is represented by seven members, each of which shows characteristic expression patterns in response to NO3 - provision, categorized as inducible (AtNRT2.1, AtNRT2.2, AtNRT2.4); constitutive (AtNRT2.3, AtNRT2.6, AtNRT2.7) repressible (AtNRT2.5) and also in terms of spatial distribution based on promoter GUS assay (e.g. AtNRT2.1 is preferentially expressed in roots). In addition, biochemical and molecular studies have confirmed that the high-affinity nitrate transport is a two-component system which requires expression of both AtNRT2.1 and  AtNAR2.1 (AtNRT3.1) to facilitate NO3 - transport (Okamoto et al., 2006; Yong et al., 2010). Moreover the expression and regulation of AtNRT2.1 is dependent on feedback regulation from nitrogen metabolites (Vidmar et al., 2000; Glass et al., 2002). Recently it has been reported that AtNRT2.1 expression is under the control of the signaling pathway of the low-affinity nitrate transporter gene AtNRT1.1, also known as CHL1 (Vert and Chory, 2009; Ho et al., 2009, Girin et al.,2010). 41  Various physiological studies using mutant lines have confirmed that AtNRT2.1 and AtNRT2.2 are the major contributors to induced high-affinity nitrate transport (Zhuo et al.,1999; Filleur et al 2001, Okamoto et al., 2006; Li et al.,2007). Reports from recent studies (Kotur et al., unpublished work) demonstrated that AtNRT2.1 and AtNRT2.2 are capable of transporting both NO3 - and NO2 -, as is the case for CrNRT2.1 the Chlamydomonas homolog (Quesada et al 1994). Except for transcript abundance studies, the physiological roles of other members of the AtNRT2 family have not been worked out so far. Based on transcript abundance Okamoto et al., (2003) reported that AtNRT2.6 was constitutively expressed in both roots and shoots. Unlike AtNRT2.1 and AtNRT2.2 that show several fold increases in abundance after exposure to NO3 -, no change in the transcript abundance was observed for AtNRT2.6.  Moreover in the present study also the expression of AtNRT2.6 was found to be constitutive, and neither NO3 - provision (un-induced and re-induced conditions) nor plant age had any effect on expression levels. (chapter 2).  In addition to the expression profile, it is important to work on the physiological characterization of AtNRT2.6 gene because the patterns of gene expression may give clues regarding its function, and only through physiological studies can transport functions be resolved. Given that AtNRT2.6 is constitutively expressed its function may be that of an internal nitrate transporter rather than one involved in uptake of nitrate from the external environment.  Again, having 68% amino acid identity at the protein level with AtNRT2.1 an inducible high-affinity NO3 - transporter (Okamoto et al., 2003) suggests that AtNRT2.6 may also be involved in transporting nitrate. Interestingly, AtNRT2.6, in addition to its expression in root,  is also found in the leaf, flower and in pollen (chapter 2) while AtNRT2.1 show a preferential expression in the root (Okamoto et al., 2003; Orsel et al., 2002). Studies on the regulation of nitrate uptake have reported that NO3 -, once inside root epidermal cells,  may be i. reduced to NH4 + and enter metabolic pathways, ii. 42  stored in the vacuole,  iii. transported to the xylem for long distance transport to the shoot or iv.may be released from the root (effluxed) as unreduced NO3 - (Glass et al 2002). The expression of AtNRT2.6 in shoots suggests its possible role in nitrate uptake by leaf tissues or in long distance transport. The present work is aimed at characterizing the physiological role of AtNRT2.6 by determining the NO3 - influx in un-induced and NO3 - re-induced plants. In this chapter the results of 13NO3 - influx studies and fresh weights, as well as root to shoot transport of NO3 - in  un-induced and re-induced A. thaliana WT, Atnrt2.6 T-DNA insertion mutant (GABI-Kat 547C10) and in AtNRT2.6:GFP transformant line are presented. In addition tissue NO3 - concentration in root and shoot in plants subjected to N starvation are also presented. 3.2. Materials and methods 3.2.1 Plant growth conditions  WT, Atnrt2.6 T-DNA mutant (GABI-Kat 547C10)  and AtNrt2.6GFP transformant line of A. thaliana were grown hydroponically using Johnson’s nutrient solution (for solution composition refer to Chapter 2) containing either 1mM NH4NO3 or 1mM KNO3 as nitrogen source (Okamoto et al., 2003). Growth conditions are described in detail in chapter 2. To determine the un- induced flux, plants were deprived of N for one week by transferring into -N nutrient solution to ensure that all the nitrate reserves in the plant were consumed. For the induced flux measurements un-induced plants were re-induced with 1mM KNO3 for 6 hours, an optimal induction time (Siddiqi et al., 1989), prior to influx measurements. All lines of plants used to measure NO3 - and NO2 - fluxes were subjected to identical growth conditions as well as identical pretreatments prior to influx measurements.   43  3.2.2 NO3 - influx measurements  NO3 - influx measurements in both un-induced and re-induced plants were obtained in 100 M concentration of NO3 - , using 13NO3 - generated by TRIUMF (Tri- University Meson Facility), Vancouver, Canada. 13NO3 - provided by TRIUMF contains three major impurities that have to be removed before it can be used to measure 13NO3 - influx; namely traces of 13NH4 +, 13NO2 - and 18F-. Aqueous samples (usually 5 ml) are treated in the laboratory fume hood by adding 0.1 ml of 2N KOH and boiling for 2.5 min to drive off 13NH4 + as the volatile 13NH3. This is followed by acidifying the solution with 0.2 ml of 2N H2SO4 plus 1 ml of 10% H2O2 and boiling for a further 2.5 min. This treatment converts any 13NO2 - to 13NO3 -.  Finally, samples were treated with catalase, an enzyme that converts hydrogen peroxide to O2 and H2O, to remove any remaining hydrogen peroxide.  Influx measurements were carried out in a walk-in growth room, set up for tracer experiments with appropriate radioactive protection in the form of lead bricks and lead-infused glass (0.6 cm thickness). Growth rooms were maintained at similar conditions of light source, temperature and relative humidity as had been maintained in a separate walk-in growth room during the prior periods (up to 5 or 6 weeks) during which the plants had been grown. Care was taken to avoid any substantial perturbations to the experimental plants due to changes in the growth room conditions, by shifting them half an hour before the start of the experiment to the growth room set for radioactive tracer measurements. In preparation for immersion of roots of intact plants in the radioactive solutions, plants were transferred to prewash solutions containing identical chemical compositions (except for the tracer) to those of the influx solutions. The purpose of the prewash solution was to ensure that fluxes were stabilized at whatever N concentrations and temperatures were to be used for influx measurements. Influx measurements were obtained by transferring plants from the prewash solutions to tracer-labeled influx solutions for 10 min.   After 44  the uptake, plant roots were allowed to sit in non-labeled solutions of identical chemical composition to influx solutions (except for the absence of tracer) for 3 min to remove (desorb) tracer from the cell walls and the root surface. The roots were then cut off from the shoots and spun for 30 sec in a basket centrifuge to remove excess nutrient solution. The shoots and roots were loaded into scintillation vials and radioactivity counts were measured in a gamma counter (Minaxi Auto- 5000 series, Packard instruments). Timing for prewash, tracer treatment and post wash were based on the half-lives of 13NO3 - partitioning between external solution, cell wall and cytoplasm (Kronzucker et al., 1995).The composition of nutrient solution used to measure influx was similar to that used to grow the plants except for the changes in N source, which contained 100 M KNO3. 13NO3 -  influx per gram fresh weight of the plant, based on the specific activity of the labeling solution, was calculated according to Siddiqi et al., (1989). 3.2.3Tissue nitrate analysis  Tissue NO3 - content was measured in WT, Atnrt2.6 T-DNA mutant and a Atnrt2.6-AtNrt2.6GFP transformant lines subjected for one week to N starvation by transferring 4 week old plants grown hydroponically  to –N solution. Root and shoot samples were collected at zero time and after 1 day, 3 days and 7days of N deprivation. After determining the fresh weights, root and shoot samples were boiled in 5 ml of distilled H2O for 20 min (or until the samples boiled) in capped tubes on a water bath. The samples were centrifuged at 8000 rpm for 5 min. and the supernatants were analyzed for tissue nitrate content by the salicylic acid method (Cataldo et al., 1975). The reaction mixture contained 50 l of the root or shoot extract + 200 l of 5% (w/v) salicylic acid in concentrated  H2SO4. After incubation for 20 min samples were neutralized by adding 4.5 ml of 2N NaOH to bring the pH to >12. Samples were cooled to room temperature and NO3 - content was measured in a 94 well plate at 410 nm absorbance using BioTek Gen5 microplate data collection and analysis software.  Samples containing from 10 to 100 M KNO3 45  were used as standards to determine the NO3 - content in the extracts. Tissue NO3 - content was calculated per gram fresh weight (Okamoto et al., 2006).  3.3. Results 3.3.1 13NO3 - influx into roots and to the shoot  13NO3 - influx into roots and flux to shoots were measured in WT, an Atnrt2.6 T-DNA mutant and in AtNRT2.6:GFP transformant line  grown hydroponically for 4 weeks in Johnson’s modified nutrient solution (see Chapter 2) containing 1mM NH4NO3 as N source. Plants were then subjected to N deprivation for one week by growing in nutrient solution without N source (un- induced plants) to measure the un-induced fluxes and after 6 h re-induction with 1 mM KNO3, to measure fluxes in re-induced plants. Plants subjected to this last pretreatment, namely, re- induction, are commonly used to optimize the high-affinity influx of nitrate, because continued exposure to nitrate, either as NH4NO3 or as KNO3 causes N-metabolite down-regulation of influx (Okamoto et al., 2003). Un-induced 13NO3 -  flux  13NO3 - influx in roots and from root to shoot of un-induced WT, Atnrt2.6 T-DNA mutant and AtNRT2.6:GFP plants was measured at 100 M external 13NO3 -  concentration (Figure 3.1 A,B) in 15 samples of 3 different experiments. The un-induced nitrate influx into WT roots  was  3.4 ± 0.3 mol  g-1h-1  and 0.7 ± 0.1 mol  g-1h-1 to the shoot  whilst in Atnrt2.6 T-DNA mutant the un- induced root flux was 2.6 ± 0.33  mol  g-1h-1 and 0.5± .09 mol  g-1h-1 in shoot  (Figure 3.1A, B). 13NO3 - influx into roots and to the shoot in the Atnrt2.6 T-DNA mutant was reduced by 23% and 33%, respectively, compared to WT. The reduction in 13NO3 - influx in roots of Atnrt2.6 T-DNA 46  based upon three separate experiments (n=15) was statistically significant (p<0.05) and the ANOVA showed a significant difference between WT and mutant groups and also a lower interaction among the groups. Although flux to the shoot was reduced by 33%, the effect was not statistically significant (P=0.07) because of greater variability in the fluxes to shoot within the samples. It is evident in the present study that the influx rates were restored to the WT level (P>0.05) in the AtNRT2.6:GFP transformant line in the  Atnrt2.6 mutant background.  Induced 13NO3 - flux  The induced nitrate flux in roots of WT was 10.5 mol  g-1h-1± 2.1 (Figure 3.1C) which was about 3 times the un-induced flux. Except for the fact that higher 13NO3 -  influx rates are seen in 6h re- induced plants compared to un-induced plants, the results based upon four different experiments where n=22, showed virtually no difference in induced flux  between WT and T- DNA mutant Atnrt2.6 and AtNRT2.6:GFP transformant line ( Figure 3.1 C,D)).                47  Figure3.1 13NO3 - influx in root and to shoot in WT, Atnrt2.6 T-DNA mutant and AtNRT2.6:GFP transformant lines of Arabidopsis thaliana Plants were grown hydroponically for 4 weeks in Johnson’s nutrient solution with 1mM NH4NO3 and later subjected for N starvation by transferring to –N solution for 1 week (un- induced). A. un-induced root flux B. un-induced flux to shoot.  The results are the means of 3 experiments n=15. root flux (P<0.05) C. 13NO3 - influx in roots of re-induced plants with 1mM KNO3 for 6 hours. D. flux to shoot in re-induced plants Values are the mean of 4 different experiments n= 22 No significant difference among the genotypes in induced flux was seen.  t-test from Microsoft Excel was used as the test of significance.     3.3.2 Fresh weight and shoot to root ratio  Root and shoot fresh weights and shoot to root ratios were recorded in genotypes used for NO3 - influx measurements. Although the Atnrt2.6 T-DNA mutant plants showed reduced root and shoot fresh weights compared to WT both under un-induced (Table 3.1) conditions. In re- 48  induced plants (Table 3.2), no  difference in fresh weights was observed. The FW,s  were reduced  in roots by 20% and in shoots by 16% in un-induced plants (Table 3.1). Shoot- to- root ratios were reduced by 14 % in Atnrt2.6 mutant compared to WT and 25% to that of AtNRT2.6:GFP transformant line (Table 3.1) and the reduced FW in T-DNA mutant were restored back in AtNRT2.6:GFP transformant line in the mutant background. These results are based upon 3 different experiments and replicates of 5 each (n=15) were not significant (P=0.07) due to variance among the samples.  Table 3.1 Shoot and root fresh weights and shoot : root ratios for un-induced WT, Atnrt2.6 T-DNA mutant and AtNRT2.6:GFP transformant lines After 4 weeks of hydroponic growth in Johnson’s modified nutrient medium containing 1mM NH4NO3, plants were deprived of N for one week. Values are based on 3 experiments; n=15, (P=0.07)  WT Atnrt2.6 AtNRT2.6:GFP Shoot Fresh Weight (g/plant) 1.16 ± 0.3 0.76 ± 0.33 1.23 ± 0.5 Root Fresh Weights (g/ plant) 0.25 ± 0.07 0.19 ± 0.09 0.23 ± 0.09 Shoot : Root Ratios 4.64 ± 0.43 4.0 ± 0.77 5.34 ± 0.45        49    Table 3.2 Shoot and root fresh weights and shoot: root ratios for re-induced WT, Atnrt2.6 T-DNA mutant and AtNRT2.6:GFP transformant lines Un-induced plants were  re-induced by transfer to Johnson’s modified nutrient medium containing 1mM KNO3 for 6 h. Values are based on 4 experiments n=22 P>0.1 not significant.  WT Atnrt2.6 AtNRT2.6:GFP Shoot Fresh Weights (g/ plant) 1.02 ± 0.5 1.02 ± 0.5 1.01 ± 0.5 Root Fresh Weights (g/ plants) 0.23 ± 0.09 0.24 ± 0.09 0.25 ± 0.09 Shoot : Root Ratios 4.43 ± 0.7 4.65 ± 0.48 4.51 ± 0.8  3.3.3 Tissue nitrate content  Tissue nitrate content was determined in plants subjected to N starvation to understand the possible role of AtNRT2.6 in the distribution of NO3 - between root and shoot or internally between vacuole and cytoplasm. Tissue nitrate content in root and shoot was measured at zero time, after 1 day, 3 days and 7 days of N starvation in WT, Atnrt2.6 T-DNA mutant and AtNRT2.6:GFP transformant lines. Figure 3.2 A represent the tissue nitrate content in roots during N starvation. Compared to WT plants, the Atnrt2.6 T-DNA mutant showed a significant reduction in tissue NO3 - levels by 56% in roots at zero time P<0.05. It is also evident that the NO3 - content in the roots has reached to lowest levels (~0.1  moles g-1 fresh weight) by day 7. It is interesting to note that the root tissue nitrate content in AtNRT2.6:GFP  transformant line at zero time has been  restored to the WT levels. The shoot tissue nitrate content did not show any significant differences among the genotypes and in all lines the nitrate content was reduced to ~0.5 moles g-1 fresh weight by day 7. However the ratio of root to shoot nitrate content was 60% in WT while it is about 23% in Atnrt2.6 T-DNA mutant and 53% in AtNRT2.6:GFP 50  transformant line. A common observation was by 7days of N starvation nitrate content was reduced both in root and in shoot by 70-80% in all the three genotypes.    Figure3.2 Tissue NO3 - concentration ( moles g-1 fresh weight) in WT, Atnrt2.6 T-DNA mutant and AtNRT2.6:GFP transformant lines of A. thaliana subjected to N starvation. A. Root tissue NO3 - concentration B. shoot tissue NO3 - concentration. Results from zero time, day 1, day 3, day 7 of N starvation samples are presented. Tissue NO3 - concentration in WT, Atnrt2.6 T-DNA mutant and AtNRT2.6:GFP transformant lines are significantly different at zero time. Values are the means of two different experiments n=10.  Means that are different at P < 0.05 are shown by an asterisk.             A * * * * * 51  3.4. Discussion  So far, studies on NO3 - transport in Arabidopsis have focused on the kinetics of induced high- affinity transport and in characterizing AtNRT2.1 and AtNRT2.2 and their functional association with AtNAR2.1. These genes account for approximately 80% of inducible high-affinity NO3 - transport (Doddema and Telkamp 1979; Zhuo et al., 1999; Cerezo et al 2001; Filleur et al., 2001; Okamoto et al., 2006; Li et al., 2007).  In this chapter I have examined physiological characteristics of WT, Atnrt2.6-TDNA mutant and the AtNRT2.6:GFP transformant line in the mutant background with respect to 13NO3 - influx. In addition plant biomass, root : shoot ratios in FW and tissue nitrate concentration were evaluated with a view to defining a mutant phenotype. 3.4.1 Nitrate influx  Nitrate influx in un-induced Atnrt2.6  T-DNA mutant plants was reduced by 23% in roots and this reduction was statistically significant (at P<0.05). The flux to shoot was reduced by 33% in the mutant but this reduction was not statistically significant. Moreover the fluxes in the AtNRT2.6:GFP transformant line were restored to WT level. These fluxes measured in un- induced plants are considered to be fluxes due to the constitutive high-affinity system (CHATS) functioning when all NO3 - reserves were used up and the IHATS influx is lost because of de- induction (Okamoto et al 2006, Li et al., 2007). The reduced un-induced nitrate flux to shoot in Atnrt2.6 T-DNA mutant could be due to reduced nitrate influx (Li et al., 2007), suggesting the possible role of AtNRT2.6 in xylem loading and long distance transport and distribution among the different aerial parts similar to that of AtNRT1.4 and AtNRT1.5 (review: Dechorgnat et al., 2011).These reduced fluxes in the mutant correlate with the reduced expression of AtNRT2.6 in the  Atnrt2.6 T-DNA mutant revealed by  the real time PCR data (chapter 2) that showed   a 45% reduction in the root (P<0.05) and a  67% reduction in shoot (P).  By Contrast, in re- 52  induced plants (6h re-induction) although the transcript expression was lowered by 55% in root and 80% in shoot compared to WT (P<=0.05) in the mutant there was no difference in the flux. The absence of any reduction of influx may be because the constitutive influx is so small compared to the induced (IHATS) flux. Although not significant 13NO3 - flux to shoot was reduced by 33% in Atnrt2.6 T-DNA mutant line suggesting the possible role of AtNRT2.6 in xylem loading and long distance transport. 3.4.2 Plant growth – root, shoot fresh weight  In the present study root and shoot fresh weights were reduced by 20% in root and 16% in shoot in un-induced Atnrt2.6 T-DNA mutant plants compared to WT. These growth differences due to the loss of function in the Atnrt2.6 T-DNA mutant resulted in a 14% reduction in shoot to root ratio in un-induced plants. In re-induced mutant plants, there were small reductions of 12% in root and 7% in shoot fresh weights but no differences in shoot to root ratios . Variation in N availability results in morphological changes such as  altered root length, branching, density (Forde and Lorenzo 2001) and also shoot growth, and flowering time (Stitt 1999).  One characteristic feature exhibited by plants when subjected to limited N availability is the extensive lateral root growth that may result in greater interception of  nutrients specifically observed in nutrient rich patches (Forde and Walch-Liu, 2009). It is evident from earlier studies that AtNRT2.1 plays a major role in lateral root growth as well as encoding NO3 - HATS in plants subjected to limited N supply (Remans et al., 2006). As regards to NO3 - influx and allocation to shoot in the AtNRT2.1 defective mutant atnrt2a  Orsel et al., (2004) have observed a reduced biomass in shoot but  not in the root under N limited conditions. This suggests a plant response to limit the shoot growth when plants are subjected to limited NO3 - availability.   Moreover shoot- to-root ratio was reduced in mutants of Atnrt2.1 and Atnrt2.2 (Li et al., 2007) and in the Atnar2.1 mutant in which AtNAR2.1 is functionally associated with AtNRT2.1 (Okamoto et al., 2006; Yong 53  et al., 2010). Crawford and Forde (2002) have reported that the lateral root growth response was greater  when roots were in contact with NO3 - compared to NH4 +  or with organic forms like glutamine (Forde and Walch-Liu, 2009). The emerging consensus is that not only does AtNRT2.1 encode a nitrate transporter but that it interacts with root development (Little et al., 2005) and as a nitrate sensor to coordinate root growth. The phenotypic differences observed in the present study were 1. reduced fresh weights and 2. reduced shoot-to-root ratio in the Atnrt2.6 T-DNA mutant compared to WT in plants subjected to N starvation. These results correlate with the reduced expression levels of AtNRT2.6 gene (chapter 2 Figure 2.4) and reduced NO3 - influx (Figure 3.1) in un-induced plants. These results suggest that AtNRT2.6, like AtNRT2.1, may play a minor role in root growth in addition to other functions in ion influx. 3.4.2 Tissue nitrate content  Results from the present study showed a highly significant reduction in the tissue nitrate content (by 56%) in the roots of the Atnrt2.6 T-DNA mutant  (Figure 3.3A) at the start of the N starvation (zero time).  At this stage the plants had been growing in a constant supply of 1mM NH4NO3 for 4 weeks which is an optimal concentration for HATS and LATS. It is also evident that the root to shoot nitrate ratio in Atnrt2.6 T-DNA mutant was 23% compared to 60% in WT showing a 37% reduction in Atnrt2.6 T-DNA mutant. These results document the un-metabolized NO3 - content which can either be stored in the vacuole or can be translocated to the shoot via xylem loading (Crawford and Glass1998).  The significant reduction in   tissue nitrate content in Atnrt2.6 T- DNA mutant compared to that of WT represent a functional loss in the mutant under optimal conditions. As such there was no difference in shoot nitrate content between WT and Atnrt2.6 T- DNA mutant except for the reduction in root to shoot ratio in nitrate content. The allocation of NO3 - from cytosol to xylem has been observed to decrease (Kronzucker et al., 1998) when nitrate is withheld  and this  is evident from the current study (Figure 3.3 A,B),    Another 54  possibility for the reduced NO3 - content could be defective uptake and internal signals of the N metabolites at optimal conditions (Orsel et al.,2004, Stitt 1999). The de-induced plants did not show any significant difference in the NO3 - utilization in the WT and in Atnrt2.6 T-DNA mutant during N starvation. However all the genotypes showed 70-80% utilization by 7 days of N starvation suggesting the disappearance of vacuolar reserves as vacuole to cytosol net transfer increases under N-limited conditions (van der Leij et al., 1998).  However it is evident from  the present study that the tissue NO3 -  accumulation and its root to shoot allocation is affected in the Atnrt2.6 T-DNA mutant suggesting the possible role of AtNRT2.6 in redistribution of un- metabolized NO3 -  similar to the function of NRT1.5 (Lin et al., 2008), a low-affinity analogue.  In summary, the present study demonstrates that AtNRT2.6 plays a minor role in plant growth and nitrate influx to roots in the un-induced condition, but not in the re-induced condition.  When nitrate is removed from the external solution supporting plant growth, expression of nitrate- inducible genes such as AtNRT2.1 and AtNRT2.2 and nitrate influx decline over a period. Nitrate that has been stored in the vacuole is mobilized and consumed in the root as well as being transferred to the shoot. Sustained growth during this time without N is dependent on this remobilization. By 7 days nitrate is virtually undetectable in roots and shoots (Okamoto et al., 2006,). Resupply of nitrate causes entry of nitrate via the constitutive high-affinity transporters (CHATS) and once absorbed, nitrate induces expression of AtNRT2.1 and AtNRT2.2, and the restoration of a greatly increased high-affinity influx. The phenotype observed in this study, affecting both nitrate influx and plant biomass only in the un-induced condition and tissue nitrate content at optimal levels of NO3 - supply, suggests that AtNRT2.6 may play a role in constitutive transport and in plant growth when internal stored nitrate is being consumed.   55    4. Contribution of AtNRT2.6 to pollen viability and development 4.1 Introduction Successful fertilization in flowering plants requires appropriate pollen development and pollen tube growth to deliver the sperm nuclei to the egg (Bock et al., 2006). Pollen development involves various mechanisms related to cell-nutrition, intercellular communication and intracellular signaling, growth and morphogenesis at physiological and molecular levels. Therefore pollen offers an attractive model system for these studies (Taylor and Hepler, 1997; McCormick, 2004). It is well established that the surrounding tapetum supplies the required nutrients and growth substances during microsporogenesis (Regan and Moffatt, 1990). Various studies have demonstrated the requirement of nutrients such as carbohydrates (Schneidereit et al., 2003), and amino acids (Foster et al., 2008). These nutrients are supplied symplastically during the initial stages of microsporogenesis but once pollen tetrads are formed they lose plasmodesmatal connections, and thus become isolated from the symplasm. Therefore membrane transporters are required to supply nutrients to the developing pollen (Schneidereit et al., 2003). The expression of the glucose specific transporter AtSTP9 (Schneidereit et al., 2003) and the amino acid transporter LHT (Foster et al., 2008) in pollen suggests that pollen is a significant sink for carbon and nitrogen. Studies on pollen tube development by Feizo et al., (2001) confirmed that signaling networks regulate a variety of pumps, porters, and channels to manage the ion gradients, oscillations and fluxes both in time and space. The physiological importance of inorganic nutrients in pollen development has been demonstrated by patch clamp studies on K+ and Ca+2  influx (Fan et al., 2001). The existence of an ammonium transporter AtAMT1.4 in pollen of Arabidopsis  (Yuan et al., 2009), and  evidence for higher NO3 - uptake in late bi-cellular stage pollen of Nicotiana (Andreyuk et al., 2000) suggests the requirement of 56  inorganic nitrogen for pollen development. Substantial work has not been done so far to provide molecular and physiological evidence for a NO3 - requirement in pollen development. A transcriptional profile of Arabidopsis pollen revealed the occurrence of 1584 genes of which 162 were specific to pollen (Backer et al., 2003). In addition, one third of the genes found in pollen showed 90% overlap with those found in vegetative tissues, therefore pollen can be used as a perfect system to study fundamental mechanisms (Backer et al., 2003). Moreover genes involved in cell wall metabolism, cytoskeleton and signaling are known to be over expressed in pollen (Honys and Twell, 2003). Transcriptomic studies by Bock et al., (2006) showed the presence of nitrate and peptide transporters in pollen. Information from BAR (The Bio-Array Resource for Plant Functional Genomics) http://bar.utoronto.ca/efp/cgi-bin/efpWeb.cgi shows the expression of the AtNRT2.6 gene in un-opened flower buds and in pollen at the bicellular stage. Genevestigator (https://www.genevestigator.com/gv/index.jsp) database showed an expression peak of AtNRT2.6 in young flowers. This information confirms the hypothesis (Okamoto et al., 2002) that AtNRT2.6 is required for nitrate transport to the developing pollen.  GUS promoter assay studies from our group (Okamoto 2002) demonstrated the expression of the AtNRT2.6 promoter gene in the pollen of A. thaliana, suggesting a possible role of high- affinity nitrate transport during pollen development. It is evident from our gene expression profile studies that AtNRT2.6 gene is constitutively expressed in all the organs: root, shoot and in flower and the localized expression of AtNRT2.6:GFP in pollen confirmed the GUS reporter expression studies by Okamoto (2002) (chapter 2). The work in this chapter is focused on understanding the requirement of AtNRT2.6 during pollen development by analyzing cytological differences, pollen viability and development. Studies on cellular organization and pollen tube growth help to detect any genetic anomalies compared to WT (Derksen et al., 2002). Therefore a phenotype with variation in growth and vacuolar organization, if any, in the Atnrt2.6 T-DNA 57  mutant would help to explain the role of AtNRT2.6 in pollen development. Pollen can be germinated in vitro in a nutrient medium although the germination rates and tube growth may not exactly match with in vivo growth (Taylor and Hepler, 1997); still this method can be used to observe growth rates among the WT and mutant genotypes to investigate the fitness of the pollen in relation to the expression of the AtNRT2.6 gene.  In this chapter light micrographs of pollen from WT, Atnrt2.6 T-DNA mutant (GABI-Kat 547C10) and the AtNRT2.6:GFP transformant line were compared to identify the phenotype (if any) based on cytological differences. The contribution of AtNRT2.6 to pollen development was analyzed by scoring the viable pollen with clear visible nuclei, in vitro percent germination and pollen tube growth. 4.2 Materials and methods 4.2.1 Plant material and growth conditions  Arabidopsis thaliana WT col., T-DNA mutant Atnrt2.6 (GABI-Kat line 547C10) and a transformant line of AtNRT2.6:GFP were grown hydroponically (details in chapter 2) in modified Johnson nutrient solution (1/10 dilution) containing 1mM NH4NO3 as nitrogen source. The three selected lines were grown separately to get enough material and to avoid contamination during flower collection. Plants were maintained in walk in growth rooms with 8/16hr light/dark period at 23oC with 70% relative humidity initially for 4 weeks to ensure good vegetative growth and later transferred to long day (16/8 hr) conditions for the plants to flower. Philips fluorescent lights (TL90 series of F32T8/TL950 (Hg)) were used as light source with irradiance of ~400m-2s-1 at plant level.  Pollens were collected before anthesis for pollen viability and pollen germination analysis. Pollen from WT tobacco was used as reference for viability tests. 58  4.2.2 Chemical fixation, Sectioning and Light Microscopy  Chemical fixation of the anthers was carried out according to Arizumi et al., (2003) with some modifications. Anthers were dissected from WT, Atnrt2.6 T-DNA  mutant and AtNRT2.6:GFP restored transformant line flowers and fixed in 4% Glutaraldehyde in 50 mM PIPES buffer pH 7 for one hour. Samples were then washed in PIPES buffer and post fixation was done in 1% (w/v) Osmium tetraoxide for 1 hour followed by washes again with PIPES buffer. Ethanol dehydration series was carried for one hour at each step (30%, 40%, 50%, 60%) and the samples were stored in 70% ethanol overnight. Later dehydration series was continued for one hour at each step (80%, 90%, 100%). Then the samples were embedded in spurr resin for one hour at each step (15%, 30%, 50%,) and stored in 75% overnight on a rotating bench. Following this the samples were transferred to 100% spurr resin for 1 hour (twice).Then samples were transferred to 100% resin in capped vials  polymerized overnight at 65oC and sectioned using ultra cut microtome. 0.5 m thick sections were cut using Leica Ultracut UCT (Leica Microsystems) and stained with 0.05% Toludine blue in Na borate (Young et al., 2008). Light micrographs (Leica DM6000B, Leica Microsystems) were captured and pollen size was measured using Open lab software. Distorted, incomplete pollen grains were excluded from the pollen size measurements. 4.2.3 Pollen viability test  DAPI fluorescent stain was used to analyze the viable pollen (Regan and Moffatt, 1990). Pollen from WT, Atnrt2.6 mutant and AtNRT2.6: GFP flowers were collected by dissecting the anthers on a glass slide under a stereo dissecting microscope and stained in a drop of DAPI (4,6- diamidino-2-phenylindole) in DMSO (1/10 dilution: 10l DAPI/DMSO + 90 l sterile d H2O =~ 2 g/ml) The slides were incubated in a moist chamber with the wet kimwipes overnight at 4oC. 59  DAPI stained pollen were observed in Leica florescent microscope with DAPI filter to score viable pollen. DAPI specifically binds to double stranded nucleic acids and fluoresces blue when excited with UV light thus the nuclei and their polarity can be clearly observed to determine the developmental stage and to score the viable pollen 4.2.4 Pollen germination  In vitro pollen germination was carried out by collecting pollen from the freshly collected flowers. Anthers were dissected using a stereo dissecting microscope. Pollens were  germinated either in a well slide or by the hanging drop method in pollen germinating medium containing sucrose 17% w/v, 1mM CaCl2 , 0.01% H3BO3 , 1mM Ca2(NO)3 ,1mM MgSO4, 30 g ml -1 Myo-inositol at pH 7 and incubated overnight at room temp (25oC). 0.6% agar was added to the above medium to grow pollen on solid medium. Dissected pistils with the stigmatic surface were added to the pollen in the liquid medium to provide some natural exudates from the pistils that might trigger pollen germination.   Images were captured using Zeiss AxioPlan 2 upright fluorescence microscope using transmitted light and GFP filters. Numbers of germinated pollen were scored using Image J particle analysis software. Pollen tube lengths were measured using Neuron J software. Measurements were calibrated to the microscope settings to determine the size in m. 4.3 Results 4.3.1 Light microscopy of chemically fixed pollen  Light micrographs (0.5 mm thick) of chemically fixed WT, Atnrt2.6 T-DNA mutant and AtNRT2.6:GFP  transformant line pollen were analyzed for cytological differences (Figure 4.1 A- D). Generally the pollen were at the bicellular stage showing two nuclei with vacuoles and well formed pollen walls. Pollen from WT and AtNRT2.6:GFP transformant line showed many 60  smaller vacuoles at the bicellular stage while the pollen from  Atnrt2.6 T-DNA mutant showed fewer and larger vacuoles. Distorted pollen grains  were more (33%)  in the Atnrt2.6 T-DNA mutant (Figure 4.2 B, C Table 4.1) compared to WT and GFP transformant line. Light micrographs of pollen from the AtNRT2.6:GFP transformant line showed very clear bicellular stage with distinct nuclei, numerous vacuoles and tapetal layer (Figure 4.1D).  Atnrt2.6 T-DNA pollen were smaller in size by 23% (P<0.05) compared to those of WT and AtNRT2.6:GFP (Table 4.1). Table 4. 1 Pollen size (m) and number of misshapen pollen grains excluded from count of WT, Atnrt2.6 mutant and AtNRT2.6:GFP transformant line Light micrographs magnification 63X and 40X.  (Leica DM6000B, Leica Microsystems) Pollen size was measured using Open lab software. (n=16; P<0.05)  Genotype Mean pollen size (m) number of misshapen pollen excluded from the count WT 18.7 ± 0.51 5 of 30 = 16% Atnrt2.6 T-DNA mutant 14.4 ± 0.7 10 of 30 = 34% AtNRT2.6:GFP transformant line 21.3 ± 1.21 6 of 30 = 20%  4.3.2 Pollen viability  DAPI (4’,6’-diamidino-2-phenylindole) specifically binds to double stranded nucleic acids and fluoresces when excited with UV  (excitation 340-380 Emission 450+). DAPI staining helps to identify the viable pollen and to determine the developmental stage and polarity of nuclei. Pollen viability in Arabidopsis lines WT, AtNRT2.6 T-DNA mutant and in AtNRT2.6 transformed line AtNRT2.6-AtNRT2.6: GFP lines was compared by scoring the pollen showing distinct nuclei with the DAPI staining. Pollen viability was found to be 63% in WT while in Atnrt2.6 T-DNA 61  mutant it is 33% showing a 50% reduction (P<0.05) in viable pollen which has been restored in AtNRT2.6:GFP transformant with 60% viable pollen (Figure 4.2).  Figure 4. 1 Light micrographs of 0.5 m thick chemically fixed pollen at bi-cellular and tri- cellular stage A. WT, B,C Atnrt2.6 T-DNA mutant, D. AtNRT2.6:GFP transformant line. Images B and C shows collapsed / distorted  pollen in T-DNA mutant.(white arrow) Magnification 63X (bc- bicellular pollen n-nucleus, v-vacuole, tp- tapetum)            A B D C n v v bc n tp 62      Figure 4.2 Percentage pollen viability (distinctly visible and polarized nuclei) in WT, Atnrt2.6 T-DNA mutant and AtNRT2.6:GFP transformant line Pollen (n=100-110) were counted using Image J particle analysis (cell counter)       Representative DAPI stained pollen are presented in Figure 4.3 A (WT), B. Atnrt2.6 mutant  and C. AtNRT2.6:GFP. Viable pollen showed polarized nuclei and also the germination beak. Arabidopsis pollen showed tri-nucleate condition while pollen from tobacco showed characteristic two nuclei (Figure 4.3 D). Some pollen from WT and AtNRT2.6: GFP transformant line (Figure 4.4) showed entangled long pollen tubes sometimes woven around the pollen mass.       63       Figure 4.3 DAPI stained pollen of A. thaliana. A. WT, B. Atnrt2.6 T-DNA mutant, C. AtNRT2.6:GFP transformant line,  D. Tobacco Viable pollen showing polarized nuclei with pollen tube protrusion (solid arrow). Magnification 20X        A B C D 64    Figure 4.4 DAPI stained pollen with pollen tubes from WT (A,B) and AtNRT2.6:GFP transformant line (C,D) of A. thaliana Germinated pollen showing pollen tube woven around pollen mass (white arrow).  D showing pollen tube with sperm nuclei (orange arrow) Magnification 40X          A B C D 65  4.3.3 In vitro pollen germination Figure 4.5 A-D represents the in vitro pollen germination. WT pollen showed very long pollen tubes with the mean tube length of 15.7m (Figure 4.5 A, B and 4.7 ) compared to Atnrt2.6 mutant pollen which showed about  5 m length (Figure 7C,D and 9). AtNRT2.6:GFP pollen length was 14.8 m  and  showed  expression of GFP signal along the  border (Figure.4.6 A-D) although the GFP signal was not strong in pollen tubes. The reduction in the pollen tube length in the Atnrt2.6 mutant by 67% was found to be highly significant (P<0.05) compared to WT and in the AtNRT2.6:GFP  transformant line (Figure 4.7).  Figure 4. 5 In vitro germination of A. thaliana pollen on liquid medium A-B WT pollen showing long pollen tubes (white arrow).C-D Atnrt2.6 T-DNA mutant showing comparatively shorter pollen tubes and few germinated pollen (n=10).     A B C D 66   Figure 4. 6 In vitro germination of AtNRT2.6:GFP transformant line pollen of A. thaliana on liquid medium (images were taken using GFP filter): A-C pollen showing GFP signal and with long pollen tubes (white arrow). D pollen germinated on the stigmatic surface (white arrow) GFP expression along the border of pollen (orange arrow)          A C D B F E 67    Figure 4.7 Pollen tube length in WT, Atnrt2.6 T-DNA mutant and AtNRT2.6:GFP transformant line Pollen tube lengths were measured using Neuron J plugin in the Image J software tool.    4.4 Discussion  Tissue specific expression studies have demonstrated the expression of AtNRT2.6:GFP  in pollen (chapter 2). Import of N resources to the flower is essential for the development of pollen, embryo and seed formation (Lee and Tejeder 2004). Membrane transporters are essential for nutrient uptake by pollen from the locule and stylar tissue during the development and pollen tube growth. In this chapter the cellular organization, pollen viability and pollen tube growth in WT, Atnrt2.6 T-DNA mutant and in AtNRT2.6:GFP  transformant line  were analyzed to determine the requirement of AtNRT2.6 gene in pollen development.  68  4.4.1 Light microscopy and cellular organization In the present study light micrographs (LM) were compared to visualize the cellular organization in WT, Atnrt2.6 T-DNA mutant and in AtNrt2.6:GFP transformant line (Fig. 4.1A-D) . Light micrographs of pollen did not show any striking variations to identify the mutant phenotype that might demonstrate the requirement of AtNRT2.6 gene during the pollen development. However LM images of the pollen provided basic cytological details about the bicellular stage and vacuolar morphology. The vacuolar fragmentation and formation of numerous small vacuoles is the usual process during pollen development to compensate for reduced tapetal resources that reach  maturity at the appropriate time (Whitney et al., 2004). Moreover vacuolar fission into smaller vacuoles and their uniform distribution increase the surface area and protect the cell from dehydration and lysis (Weisman 2003).  Although the Atnrt2.6 T-DNA mutant showed a similar developmental pattern, some pollen showed larger vacuoles suggesting the slower development of numerous small vacuole, the characteristic of bicellular and tricellular stage (Whitley et al., 2009). It is also evident from the LM images that some mutant pollen were collapsed and or distorted in shape (Fei and Sawhney 2001). However the pollen size was significantly reduced in Atnrt2.6 mutant (Table 4.1) compared to WT and AtNRT2.6:GFP transformant line. Another significant observation was that the pollen from the transformant line AtNRT2.6:GFP showed  a clear bicellular developmental stage and the anther locule with clear tapetum layer restoring the normal WT development (Fei and Sawhney 2001). Light microscopy provided  fundamental details about the pollen morphology at a cytological level even though no clear evidence for the abnormal pollen development could be sought to explain the requirement of AtNRT2.6 for the pollen development. 69   4.4.2 Pollen viability, in vitro pollen germination - the possible physiological role of AtNRT2.6 gene  The present study showed 63% viable pollen in WT compared to 33% in Atnrt2.6 T-DNA knockdown mutant, a 50% reduction in visible and polarized nuclei suggesting a delay in pollen maturation in the mutant (Figure 4.3 B). A similar trend was observed in pollen tube growth where WT pollen showed longer pollen tubes compared to those of the Atnrt2.6 T-DNA mutant which showed a 67% reduction in tube length. It is also evident from this study that the transformant line of this mutant with re-introduced AtNRT2.6:GFP gene showed a restoration in viability and pollen tube growth (Figures 4.5 - 4.7) suggesting a possible contribution of AtNRT2.6 through nitrate transport to  pollen development. In addition reports on the existence of the ammonium transporter AtAMT1.4, the amino acid AtLHT genes and AtProT1 (Bock et al. 2006, Sze et al., 2006, Foster et al., 2008) and transcriptome studies on pollen-specific glutamine synthetase gene  AtGLN1;5  clearly indicate the requirement for a  N source and N metabolism during  pollen development and the requirement of transporters to facilitate transport of inorganic and organic nitrogen to the pollen which are symplastically isolated. Further, during microsporogenesis many metabolic processes are concentrated in the tapetal layer which require large amounts of nutrient loading to tapetal cells that are eventually released into the locule for the pollen nourishment  (Lee and Tegeder 2004). The shift in the expression of the LHT2 amino acid transporter following the degeneration of tapetal tissue in the pollen and the expression LHT5 and LHT6 in pollen tubes and transmitting tissue of the pistil demonstrates the requirement of transporters to facilitate nutrient transport during pollen development (Foster et al 2008). Taken together, the results from  light microscopy demonstrated  a significant reduction in the pollen size suggests the slow and delayed growth in Atnrt2.6 mutant. Moreover in vitro 70  germination results showed a significant reduction in % pollen germination and pollen tube growth also suggests the possible role of AtNRT2.6 in the pollen development and pollen fitness. Earlier studies provide evidence for the role of transporters in the pollen tube growth as they help in nutrient transport, osmoregulation (Robertson et al., 2004) and help to maintain turgidity and cellular expansion. Presumably NO3 - might contribute to the N reserves required for pollen development and tube growth (Zhang et al., 2007,Yuan et al.,2009). Moreover NO3 - might contribute to the osmoticum and to the solute concentration during the re-hydration and pollen germination. Despite anomalous pollen developmentin the Atnrt2.6 T-DNA mutant line over production of pollen may result in normal fertilization so that a phenotype with respect to reduced fertility may not be seen.              71   5 Protein-protein interaction of AtNRT2.6 with AtNAR2.1 5.1 Introduction Research so far provides substantial evidence for physiological role of AtNRT2.1 in high-affinity nitrate transport. The primary role of AtNRT2.1 transporter in IHATS has been confirmed using a double mutant (Filleur 2001) and individual mutants of AtNRT2.1 and AtNRT2.2 (Li et al., 2007) in NO3 - influx experiments. Although AtNRT2.1 encode for IHATS in Arabidopsis, AtNAR2.1 is required for nitrate uptake (Okamoto et al., 2006). The existence of a functional association between NRT2.1 or NRT2.2 and NAR2 was first demonstrated in Chlamydomonas reinhardtii based on functional complementation of individual mutants of NRT2.1 and NRT2.2 with NAR2. These experiments revealed that only when either one of these NRT2 genes is associated with NAR2 in the same cluster is nitrate uptake achieved (Quesada et al., 1994). Further, the requirement of NAR2 for nitrate uptake was confirmed in Xenopus system by Zhuo et al., (2000). With reference to higher plants, the functional interaction of  HvNRT2.1 and HvNAR2.3 (NAR2 like gene) was demonstrated in the Xenopus system confirming the requirement of NAR2 for nitrate uptake (Tong et al., 2005). Studies using the split ubiquitin Yeast two-hybrid system and Xenopus system have confirmed that AtNRT2.1 and AtNAR2.1 proteins interact ( Li et al unpublished work, Orsel et al., 2006).   In the two-component nitrate transport system (NRT2.1/NAR2) the NRT2.1 encodes for a polypeptide with 12 transmembrane domains (reviews Forde 2000, Glass 2009) while NAR2 encodes for a protein with  a single transmembrane domain (Tong et al 2005). It was suggested that NAR2 might function as a co-transporter or exchanger or receptor modifying the protein or that it might produce a conformational change to the AtNRT2.1 protein (Zhuo et al., 2000). Experiments using the Xenopus system by Tong et al.,(2005) and protein-protein interaction in 72  mating based split ubiquitin system (Orsel et al., 2006) suggest that the two polypeptides are interacting at post translational level. Wirth et al., (2007) proposed that NAR2 might  stimulate the synthesis of NRT2.1 or prevent degradation of NRT2.1. Biochemical studies by Wirth et al., (2007) claimed  that AtNRT2.1 exist in both monomeric form of ~45 kDa  along with a high molecular weight protein complex of ~120 kDa but could not resolve  this higher molecular weight protein. Further, they suggested that the monmeric form of AtNRT2.1 was the functional nitrate transporter. Using split YFP protoplast expression and immunological techniques Yong et al., (2010) demonstrated the co-existence of AtNRT2.1 and AtNAR2.1 as a 150 kDA complex of the 48 kDa (AtNRT2.1) and 26 kDa (AtNAR2.1) in the plasma membrane and proposed that, this complex was a tetramer. In this recent immunological study it was suggested that AtNAR2.1 is essential for the stability of the AtNRT2.1 : AtNAR2.1 complex in the  plasma membrane (Yong et al., 2010)  An earlier study using an AtNAR2.1 (AtNRT3.1) mutant had demonstrated that in addition to the  complete loss of IHATS, CHATS was also affected (Okamoto et al., 2006) while no change was detected in LATS. In the present study on gene expression and NO3 - flux it has been confirmed that AtNRT2.6 is constitutive in expression and appears to impact the constitutive flux (chapter 2 and chapter 3). The work in this chapter is focused on identifying if there is any interaction between AtNRT2.6 and AtNAR2.1 of the sort already demonstrated for AtNRT2.1 that might help to explain any functional association of these two proteins in  nitrate uptake. Here the interaction between AtNRT2.6 and AtNAR2.1 was studied using the split- ubiquitin Yeast two-hybrid system (Stagijar et al, 1998). The positive interaction between the two proteins was identified based on the histidine auxotrophy and –galactosidase assay.   73  5.2 Materials and methods 5.2.1 Cloning AtNRT2.6 into pTMBV4 vector and preparation of bait construct  A full length coding sequence of AtNRT2.6 was PCR amplified with gene specific primers containing X-ba1and Stu-1 restriction sites (Table 5.1) designed specific to the cloning site of pTMBV4 vector using high fidelity DNA polymerase (Roche) kit. Cloning of the AtNRT2.6 insert into the pTMBV4 vector was done using X-ba1and Stu-1 restriction enzymes. Dephosphorylation of plasmid digest was done using Shrimp alkaline phosphatase (Fermentas) and ligation was performed using the Rapid DNA ligation kit (K1422 - Fermentas). The clone was transformed into E.coli (DH5 competent cells – Invitrogen) and plated on to LB medium plates containing Kanamycin. The transformant colonies were PCR analyzed to confirm the presence of the insert. Transformant colonies were then cultured overnight in liquid LB medium containing Kanamycin. Cloned plasmids were recovered (mini prep plasmid isolation kit) and sequenced for correct orientation of the insert using sequencing primer TEFfw  (Table 5.1) specific to pTMBV4 vector (Dual systems Biotech).  Table 5. 1Primers for cloning AtNRT2.6 with Xba-1 and Stu-1 restriction sites AtNRT2.6 full length coding sequence primer FW - 5’CTC ATT AGA AAG AAA GCA TAG CAA TCT AAT CTA AGT TTT CTA GAG AAA  AAT GGC TGA GAA 3’ RV- 5’ TAA GCT TGA TAT CGA ATT CCT GCA GAT ATA CCC ATG GAG GCC TTT GAC ATG AGC CGG CCT CT3’  TEFfw primer  5`ACGGTCTTCACAATTTCTCAAG 74   5.2.2 Transformation of bait construct into yeast  Yeast strain DYS-1 was used to transform the bait construct as per the standard protocols of Dualsystems Biotech. DSY-1 yeast colonies were cultured overnight in YPAD medium to an OD of 0.6 - 0.8.  Transformation of bait vector was performed using PEG/LiOAc method (SOP Dualsystems Biotech) and plated on SD-Leu plate and incubated at 30oC for 2-3 days.  Yeast transformants were selected and re-streaked on SD-Leu plate to make a master plate for further experiments. Correct expression of the bait protein was confirmed by co-transformation with Alg5-NubI and based on Histidine auxotrophy by growing on SD-leu –trp/-his plate. 5.2.3 Library transformation and screening for protein interaction  Modified Cub domain of pTMBV4 vector with AtNRT2.6 bait construct was tested for interaction with the NAR2.1 prey fused to NubG of PDL-NX.  Both bait and prey constructs were co- transformed with salmon sperm DNA as carrier using the PEG/LiOAc method (SOP - Dualsystems Biotech). The transformants were plated on SD-leu –trp and SD-leu–trp/-his plates supplemented with 3AT and incubated at 30oC for 2-3 days. Transformants from SD-leu–trp/-his plates were streaked on SD-leu–trp/-his +3AT  plates and x-Gal filter assay was performed. 5.3 Results  The PCR amplification product for full length coding sequences was cloned into pTMBV4 vector and the clone was PCR screened and sequenced for correct insertion (Figure 5.1 A, B). Sequencing results showed 98% similarity with AtNRT2.6 sequence and the insert was in correct orientation. This was used to construct the bait and transformed to Yeast DSY-1 strain. Test for confirmation of correct expression of the bait was performed by co-transforming 75  AtNRT2.6 bait fused to Cub-LexA-VP16 reporter with pAlg5-NubI as positive control (Figure 5.2A) and pAlg5NubG as negative control (Figure 5.2B).  Co-transformation of bait with pAlg5NubG as negative control showed no  growth on SD-leu–trp/-his plate confirming the correct expression of bait. Figure 5.3 A shows positive results confirming protein-protein interaction when AtNRT2.6 bait fused to Cub-LexA-VP16 reporter co-transformed with NAR2.1 prey fused to NubG of PDL-NX on SD-leu–trp/-his plate (Histidine auxotrophy). When these colonies were re-streaked on SD-leu–trp/-his plate and X-Gal filter assay was performed a positive -galactosidase activity confirmed the LacZ gene activation.   Figure 5. 1 A. PCR amplification of full length CDS of AtNRT2.6 gene; B. PCR screening of transformant colonies                AtNRT2.6 full length CDS 1335 bp AtNRT2.6 primers flanking exons 505 bp AtNRT2.6 full length CDS 1335 bp 76  Figure 5. 2 A Ensuring correct expression of bait AtNRT2.6 co-transformed with pAlg5- NubI; B Ensuring correct expression of bait AtNRT2.6 co-transformed with pAlg5-NubG                    B A 77  Figure 5. 3 A Screening for protein-protein interaction of AtNRT2.6 and AtNAR2.1 AtNRT2.6 bait fused to Cub-LexA-VP16 reporter with NAR2.1 prey fused to NubG of PDLNX. Colonies from SD-leu–trp/-his plate are re-streaked on SD-leu–trp/-his. B.. X-Gal filter assay      5.4 Discussion  The results of the Yeast two-hybrid system confirms the interaction between AtNRT2.6 and AtNAR2.1 protein by reassembly of split ubiquitin when they are co-transformed. This is an interesting finding because it extends the apparent interaction between NAR2.1and NRT2.1 and NRT2.1 to NAR2.1 and NRT2.6. Previous studies have confirmed a positive interaction between AtNRT2.1 and AtNAR2.1 in the yeast two hybrid system (Li et al unpublished work; Orsel et al., A B 78  2006). Interestingly, although AtNRT2.3  shows 68% similarity in protein sequence with AtNRT2.1 (Orsel et al 2006) it was reported to show no interaction with AtNAR2 in the  yeast system.  It was demonstrated by Orsel et al.,(2006) and Yong et al., (2010) that  atnar2.1-1 mutants equivalent to atnrt3.1-2 (Okamoto et al 2006) showed more severe defect in the growth and greater reduction of IHATS influx compared to atnrt2.1-1 mutants thus suggesting that AtNAR2.1 might also interact with other proteins.  In the present study we have confirmed that AtNRT2.6 is constitutive in expression (chapter 2) and contributes  ~23% of constitutive flux (chapter 3). Physiological studies by Okamoto et al., (2006) demonstrated the reduction of both the constitutive flux (CHATS) and the induced flux (IHATS) in the AtNAR2.1 mutants, suggesting that AtNAR2.1 also interact with proteins that are constitutively expressed. In our experiments Atnrt2.6 mutant showed a constitutive flux of 2.6 ± 0.33 mol gFW-1h-1 in root representing 23% reduction compared to WT (Figure 3.1A, B). In the previous study by Okamoto et al., (2006) atnrt3.1-2 (=atnar2.1-1 mutants) showed a constitutive flux of 0.3 mol g FW-1h-1. These results demonstrate that the flux in atnrt3.1-2 mutant is substantially lower than the flux in the Atnrt2.6 mutant. The present study confirms that AtNRT2.6 and AtNAR2.1 interact at the membrane by the reconstitution of split ubiquitin. This suggests the possible functional association between AtNRT2.6 and AtNAR2.1. Our physiological data provides additional support for the possible functional association of AtNRT2.6 and AtNAR2.1.  It might be possible using the AtNRT2.6:GFP transformant line crossed with the myc labeled AtNAR2 line to isolate a putative PM complex between AtNRT2.6 and AtNAR2.    79   6 Conclusions and future scope  The RT-PCR results in the present study demonstrated the constitutive expression of the AtNRT2.6 gene that belongs to the AtNRT2 gene family that includes AtNRT2.1 and AtNRT2.2 that encode for high-affinity nitrate transport  in roots.. The relative quantitative expression of AtNRT2.6 gene in WT, Atnrt2.6 T-DNA mutant and AtNRT2.6:GFP transformant line by real time PCR analysis has revealed the reduced expression in Atnrt2.6 mutant by  45 % in root and 67% in shoot compared to WT (P<=0.05) in un-induced plants. Whereas in nitrate re-induced plants the reduction was still higher i.e. by 55% in root and 80% in shoot compared to WT (P<=0.05). The loss in AtNRT2.6 gene in Atnrt2.6 T-DNA mutant has been restored in the AtNRT2.:GFP transformant to the WT levels. In addition, real time PCR also confirms the constitutive expression of AtNRT2.6 in un-induced and NO3 - re-induced conditions both in root and shoot. Confocal microscopy has demonstrated the tissue specific expression of AtNRT2.6:GFP in pollen and in root cortical cells. It appears that this polypeptide is expressed in the plasma membrane. The present study provides additional confirmation of the earlier reports on transcript abundance during time course experiments on nitrate provision and tissue expression patterns using the GUS reporter assay (Okamoto 2002, Okamoto et al., 2003). In a semi quantitative RT-PCR study reported by Orsel et al., (2002) the expression of AtNRT2.6 gene was not detectable in flowers. However the findings from the present work on the expression of AtNRT2.6 gene in flower correspond to the  earlier report from our group (Okamoto 2002) and to the information available from transcriptome database (https://www.genevestigator.com/gv/index.jsp; efp browser http://bar.utoronto.ca).  80  The constitutive expression pattern of AtNRT2.6 gene and its reduced expression in T-DNA mutant Atnrt2.6 compared to WT and the recovery in the transformant line AtNRT2.6:GFP provided a basis to extend the work to physiological studies. 13NO3 - influx results in the present study in WT, Atnrt2.6 T-DNA mutant and AtNRT2.6:GFP transformant line have revealed that AtNRT2.6 contributes to the un-induced flux. In Atnrt2.6 T-DNA mutant the un-induced 13NO3 - influx into the root was reduced   by 23% while the flux to the shoot was reduced by 33%. These fluxes were restored to the WT level in the transformant line with AtNRT2.6:GFP gene. Although there was a reduction in transcript level in Atnrt2.6 T-DNA mutant under re-induced conditions the loss of 13NO3 - influx function was not detectable. This could be due to the high-capacity (inducible) IHATS operating in response to NO3 - provision obscuring the small effect of the AtNRT2.6 disruption of the constitutive flux. Moreover the fresh weights and shoot-root- ratios were reduced by 20% in Atnrt2.6 mutant in un-induced plants.  Earlier studies using Atnrt2.1, Atnrt2.2 and Atnrt2.1-Atnrt2.2 mutants   provide substantial evidence for the role of AtNRT2.1 and AtNRT2.2 in IHATS and contribution to the plant growth (Li et al., 2007).  Except for few reports on CHATS using a chlorate resistant nrt2 mutant (Wang and Crawford 1996) and Atnrt2.1-Atnrt2.2 mutant that showed a 30% reduction in CHATS along with 80% reduction in IHATS (Li et al., 2007) there  is no molecular work done so far on the CHATS in nitrate uptake in Arabidopsis. Our findings in the present study confirm the contribution of AtNRT2.6 gene to the CHATS. In addition the tissue nitrate accumulation and allocation of nitrate from root to shoot  was reduced by 56% compared to WT at optimal external concentration (1mM NO3 -) in the Atnrt2.6 T-DNA mutant; this reduction was reversed  in the AtNRT2.6:GFP line. These results suggests that AtNRT2.6  might also contribute to re-distribution of nitrate from root to shoot similar to the low affinity analogue NRT1.5 (Lin et al., 2008).  81  Another significant observation from our gene expression studies was the tissue specific localization of AtNRT2.6:GFP  gene in the pollen which led to the study of the requirement of NO3 - for  pollen development. Light microscopy of chemically fixed anthers demonstrated a few defective pollen with distorted shape and reduced pollen size in Atnrt2.6 T-DNA mutant compared to WT and AtNRT2.6:GFP  transformant line. Moreover the number of viable pollen and tube growth was highly reduced in the Atnrt2.6 T-DNA mutant by 50% and 67% respectively compared to WT; this defect was reversed in the transformant line. These results suggests the possible role of AtNRT2.6 in pollen development as regards to the supply of N reserves to the developing pollen for tube growth (Zhang et al., 2007,Yuan et al., 2009) and also to provide osmoticum and turgidity (Robertson et al., 2004)   In the present study using the Yeast two-hybrid split ubiquitin system identified the protein- protein interaction between AtNRT2.6 and AtNAR2.1 the second polypeptide in the two component IHATS system. AtNRT2.1 the major contributor to IHATS in Arabidopsis requires association with AtNAR2.1  for nitrate uptake by the two-component IHATS (Orsel et al., 2004, 2006; Okamoto et al., 2006; Li et al., 2007, Yong et al 2010). Studies using the Yeast two-hybrid system (Li et al unpublished work, Orsel et al., 2006) have demonstrated the protein-protein interaction between AtNRT2.1 and AtNAR2.1. Nitrate uptake was affected more severely in atnar2.1-1 mutants than in atnrt2.1-1 mutants and also CHATS were reduced along with IHATS (Okamoto et al 2006) suggesting that AtNAR2.1 also interact with other proteins. The loss of function in atnar2.1-1 mutants was found to be greater than that  in the Atnrt2.6 T-DNA mutant with regard to nitrate  uptake. In summary using Atnrt2.6 T-DNA mutant and AtNRT2.6:GFP transformant lines we have confirmed the constitutive expression of AtNRT2.6 both in un-induced and nitrate re-induced conditions. We have demonstrated the contribution of AtNRT2.6 to CHATS based on 13NO3 - 82  influx measurements. Our study also confirmed that growth was affected in the T-DNA mutant by reduced fresh weights in un-induced plants. Tissue nitrate concentration at optimal nitrate available conditions (1mM NO3 -) in the T-DNA mutant suggests that AtNRT2.6 play a role in the allocation of nitrate from root to shoot. The expression of AtNRT2.6:GFP in the pollen observed in the present study and the corresponding in vitro studies on  pollen viability and tube growth confirm the role of AtNRT2.6 in pollen development. Using Y2H split ubiquitin system we have confirmed the protein-protein interaction between AtNRT2.6 and AtNAT2.1.                     83   Bibliography  Amarasinghe, B.H.R.R, de Bruxelles, G.L., Braddon, M., Onyeocha, I., Forde, B.G. and Udvardi, M.K. (1998) Regulation of GmNrt2 expression and nitrate transport activity in roots of soybean (Glycine max). Planta 206: 44–52.  Andreyuk DS, Matveeva NP, Tukeevat M I, Ermakov IP (2000) Dynamics of inorganic ions in microspore and pollen grain during development of the tobacco male gametophyte Russian Journal of Developmental Biolog 31(2): 89-94. Translated from Ontogenez, Vol. 31, No. 2, 2000, pp. 114-119  Ariizumi T, Hatakeyama K, Hinata K, Sato S, Kato T, Tabata S, Toriyama K (2003) A novel male-sterile mutant of Arabidopsis thaliana,faceless pollen-1,produces pollen with smooth surface and an acetolysis-sensitive exine. Plant mol Biol 53:107-116  Aslam M, Travis R.L, and Huffaker R.C(1992) Comparative kinetics and reciprocal inhibition of nitrate and nitrite uptake in roots of uninduced and induced barley(Hordeum vulgare).seedlings. Plant Physiol 99: 1124-1133  Becker JD, Boavida LC, Carneiro J, Haury M, and Feijo JA 2003. Transcriptional profiling of Arabidopsis tissues reveals the unique characteristics of the pollen transcriptome Plant Physiol 133: 713–725.  Bock KW, Honys D, Ward JM, Padmnaban S, Nawrocki EP, Hirschi KD, Twell D, Sze H (2006). Integrating membrane transport with male gametophyte development and function through transcriptomics. Plant Physiol 140:1151-1168  Cataldo DA,Maroon M, Schrader LE, Youngs VL (1975) Rapid colorimetric determination of nitrate in plant tissue by nitration of salicylic acid. Communications in Soil Science and Plant Analysis 6(1):71-80 84  Chopin F, Orsel M, Dorbe MF, Chardon F, Truong HN, Miller AJ, Krapp A, Daniel-Vedele F (2007a)The Arabidopsis ATNRT2.7 nitrate transporter controls nitrate content in seeds. Plant Cell. 19(5):1590-1602. Chopin F, Wirth J, Dorbe MF, Lejay L, Krapp A, Gojon A, Daniel-Vedele F (2007b) The Arabidopsis nitrate transporter AtNRT2.1 is targeted to the root plasma membrane Plant Physiol Biochem. 45(8):630-635  Cle´ment C, Laporte P, Audran JC (1998) The loculus content and tapetum during pollen development in Lilium. Sex Plant Reprod11:94–106  Corezo M,Tilland P,Fileur S, Munos S, Daniel-Vedele F, Gojon A ( 2001) Major alterations of the regulation of root NO3- are associated with the mutations of Nrt2.1 and Nrt2.2 genes in Arabidopsis. Plant Physiol 127:262-271  Crawford NM and Glass ADM (1998). Molecular and Physiological aspects of nitrate uptake in plants. Trends in plant Sci. 3: 389-395  Dechorgnat J, Nguyen CT, Armengaud P, Jossier M, Diatloff E, Filleur SDaniel-Vedele F (2011) From soil to the seeds: the long journey of nitrate in plants. Journal of Exp..Botany 62 (4): 1349-1359  Derksen J, Knuiman B, Guyon KHA, Pierson SBES (2002) Growth and cellular organization of Arabidopsis pollen in vitro. Sex Plant reproduction 15:133-139  Doddema, H, and Telkamp, G.P. (1979). Uptake of nitrate by mutants of Arabidopsis thaliana disturbed in uptake or reduction of nitrate. II. Kinetics. Physiol. Plant. 45: 332–338.  Dong J, Kim ST, Lord EM (2005) Plantacyanin plays a role in reproduction in Arabidopsis. Plant Physiol 138:778–789  Epstein, E. (1972) Mineral Nutrition of Plants: Principles and Perspectives, Wiley 85  Fan LM, Wang YF, Wang H, Wu WH (2001) In vitro Arabidopsis pollen germination and characterization of the inward potassium currents in Arabidopsis pollen grain protoplasts. J Exp Bot 52:1603–1614  Fei H and Sawhney VK (2001) Ultrastructural characterization of male sterile33 (ms33) mutant in Arabidopsis affected in pollen desiccation and maturation. Can. J. Bot. 79(1): 118–129  Feijo JA, Sainhas J, Holdaway-Clarke T, Cordeiro MS, Kunkel JG, Hepler PK (2001) Cellular oscillations and the regulation of growth: the pollen tube paradigm. Bioessays (23) 86– 94  Fernandez E and Galvan A, (2008) Nitrate Assimilation in Chlamydomonas Eukaryotic Cell, 7(4):555-559.  Filleur S, Daniel-Vedele F (1999) Expression analysis of a high-affinity nitrate transporter isolated from Arabidopsis thaliana by differential display. Planta 207: 461–469  Filleur S, Dorbe MF, Cerezo M, Orsel M, Granier F, Gojon A, Daniel-Vedele F (2001) An Arabidopsis T-DNA mutant affected in Nrt2 genes is impaired in nitrate uptake. FEBS Lett 489: 220–224  Forde BG (2000) Nitrate transporters in plants: structure, function and regulation. Biochim and Biophys Acta 1465:219-235 Forde BG and Walch-Liu (2009). Nitrate and glutamate as environmental cues for behavioural responses in plant roots. Plant, Cell and Environment 32: 682–693  Foster J , Lee  Y.H., Tegeder M. ( 2008 ) Distinct expression of members of the LHT amino acid transporter family in flowers indicates specific roles in plant reproduction. Sexual Plant Reprod. 21: 143 – 152  Galva´n A, Ferna´ndez E (2001) Eukaryotic nitrate and nitrite transporters.Cell Mol Life Sci 58: 225–233 86  Galvan, A., Quesada, A. and Fernandez, E. (1996) Nitrate and nitrite are transported by different specific transport systems and by a bispecific transporter in Chlamydomonas reinhardtii. J. Biol. Chem. 271: 2088–2092.  Girin T, Lejay L, Wirth J, W idiez T,  Palenchar PM, Nazoa P, Touraine B,  Gojon A , Lepetit M (2007) Identification of a 150 bp cis-acting element of the AtNRT2.1 promoter involved in the regulation of gene expression by the N and C status of the plant. Plant Cell and Environment 30: 1366–1380 Glass ADM (2009) Nitrate uptake by plant roots. Botany 87: 659–667  Glass ADM, Brito DT, Kaiser BN, Kronzucker HJ, Kumar A, Okamoto M, Rawat SR, Siddiqi, MY, Silim SM, Vidmar JJ. and Zhuo D. (2001) Nitrogen transport in plants, with an emphasis on the regulation of fluxes to match plant demand. J. Plant Nutr. Soil Sci. 164: 99– 207. Glass ADM, Britto DT, Kaiser BN, Kinghorn JR, Kronzucker HJ, Kumar A, Okamoto M Rawat S, Siddiqi MY, Unkles SE and Vidmar JJ (2002). The regulation of nitrate and ammonium transport systems in plants Journal of Experimental Biology (53) 370:  855-864  Glass, A.D, Shaff, J.E. and Kochian, L.V. (1992) Studies of the uptake of nitrate in barley, IV. Electrophysiology, Plant Physiol. 99, 456–463 Ho CH, Lin SH, Hu HC,Tsay YF (2009) CHL1 functions as a nitrate sensor in plants. Cell 138: 1184-1194  Honys D, Twell D (2003) Comparative analysis of the Arabidopsis pollen transcriptome. Plant Physiol. 132: 640–652. Kiernan J.A. (1999) Histological and histochemical methods, theory and practice. Ed.3, Butterworth, Heinemann, Oxford, UK. Kleffmann T,  Russenberger  D,  von Zychlinski A, Christopher W, Sjolander K, Gruissem W,  Baginsky, S (2004).The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions,Curr. Biol. 14: 354e 362. 87  Kronzucker HJ, Glass ADM, Siddiqi MY. 1999. Inhibition of nitrate uptake by ammonium in barley. Analysis of component fluxes. Plant Physiology 120, 283–291.  Kronzucker, H. J., Siddiqi, M. Y. & Glass, A. D. M. (1995) Kinetics of NO3 _ influx in spruce PlantPhysiol. 109: 319–326.  Lee  YH, Tegeder  M. ( 2004 ) Selective expression of a novel high affinity transport system for acidic and neutral amino acids in the tapetum cells of Arabidopsis fl owers. Plant Journal 40: 60 – 74.  Leggewie G, Forde BG, Piepenburg K and Udvardi M (2001) Molecular biology of inducible high-affinity nitrate transport in higher plants.  Plant nutrition 92:12-13 Springer Netherlands DOI10.1007/0-306-47624-X  Lejay L., Tillard P, Lepetit M, Olive F, Filleur S, Daniel-Vedele F, Gojon A (1999) Molecular and functional regulation of two NO3 - uptake systems by N- and C-status of Arabidopsis plants. The Plant Journal 18, 509–519.  Li W, Wang Y, Okamoto M, Crawford NM, Siddiqi MY and Glass ADM (2007) Dissection of the AtNRT2.1:AtNRT2.2 Inducible high-affinity nitrate transporter gene cluster. Plant Physiol 143: 425-433  Lieckfeldt E, Simon-Rosin U, Kose F, Zoeller D, Schliep M,  Fisahn J(2008) Gene expression profiling of single epidermal, basal and trichome cells of Arabidopsis thaliana Journal of Plant Physiology 165: 1530-1544  Lin SH, Kuo HF, Canivenc G, Lin CS, Lepetit M, Hsu PK, Tillard P, Lin HL, Wang YY, Tsai CB (2008)  Mutation of the Arabidopsis NRT1.5 nitrate transporter causes defective root-to- shoot nitrate transport. Plant Cell, 20:2514-2528.  Little D.Y.,Rao H.,Oliva S.,Daniel-Vedele F.,Krapp A. & Malamy J.E. (2005) The putative high-affinity nitrate transporter NRT2.1represses lateral root initiation in response to nutritional cues.Proceedings of the National Academy of Sciences of the United States of America. 102, 13693–13698. 88  McCormick S (2004) Control of male gametophyte development. Plant cell (suppl) 16:S142- S153  Meharg AA, Blatt, MR (1995) NO3- transport across the plasma membrane of Arabidopsis thaliana root hairs: kinetic control by pH andmembrane voltage, J. Membr. Biol. 145: 49–66  Miller A, Smith S, Fan X, Shen, Q. (2007) Expression and functional analysis of rice NRT2 nitrate transporters. Comp. Biochem. Physiol. 146: S241  Nazoa P, Vidmar JJ, Tranbarger TJ, Mouline K, Damiani I, Tillard P, Zhuo D, Glass ADM and Touraine B. (2003) Regulation of the nitrate transporter gene AtNRT2.1 in Arabidopsis thaliana: responses to nitrate, amino acids and developmental stage. Plant Molecular Biology 52, 689–703.  Okamoto M (2002) Expression patterns of AtNRT  genes in Arabidopsis PhD thesis, University of British Columbia, Vancouver,Canada  Okamoto M, Kumar A , Li W, Wang Y ,  Siddiqi MY , Crawford NM, and Glass ADM (2006) High-affinity nitrate transport in roots of arabidopsis depends on expression of the NAR2-like gene AtNRT3.1. Plant Physiol ; 140: 1036-1046  Okamoto M, Vidmar JJ, Glass ADM (2003) Regulation of NRT1 and NRT2 gene families of Arabidopsis thaliana: response to nitrate provision. Plant cell Physiol 44 (3) 304-317  Orsel M,  Eulenberg K, Krapp A, Daniel-Vedele F (2004) Disruption of the nitrate transporter genes AtNRT2.1and AtNRT2.2 restricts growth at low external nitrate concentration. Planta 219: 714–721  Orsel M, Chopin F, Leleu O, Smith SJ, Krapp A, Daniel-Vedele F, Miller AJ (2007). Nitrate signaling and the two component high affinity uptake system in Arabidopsis. Plant Signaling & Behavior 2 (4):260-262  89  Orsel M, Chopin F, Leleu O, Smith SJ, Krapp A, Daniel-Vedele F, Miller AJ (2006) Characterization of a Two-Component High-Affinity Nitrate Uptake System in Arabidopsis. Physiology and Protein-Protein Interaction Plant Physiol 142: 1304-1317 Orsel M, Krapp A, Daniel-Vedele F (2002). Analysis of the NRT2 Nitrate transporter family in Arabidopsis. Structure and gene expression. Plant physiology 129: 886-896  Patrick J. Krysan PJ, Young JC, Sussman MR (1999) T-DNA as insertional mutagen in Arabidopsis The Plant Cell 11: 2283–2290  Quesada A, Galvan A, Fernandez E (1994) Identification of nitrate transporter genes in Chlamydomonas reinhardi. Plant J. 5: 407-419  Quesada A, Krapp A, Trueman LJ, Daniel-Vedele F, Ferna´ndez E, Forde BG, Caboche M (1997) PCR identification of a Nicotiana plumbaginifolia cDNA homologous to the high-affinity nitrate transporters of the crnA family. Plant Mol Biol 34: 265–274  Regan SM, Moffat BA (1990) Cytochemical analysis of pollen development in wild-type Arabidopsis and male-sterile mutant. The plant cell 2:877-899  Remans T,  Nacry P, Pervent M, Girin T, Tillard P, Lepetit M and Gojon A (2006) A Central Role for the Nitrate Transporter NRT2.1 in the Integrated Morphological and Physiological Responses of the Root System to Nitrogen Limitation in Arabidopsis Plant Physiol 140:909-921  Robertson WR, Clark K, Young JC, Sussman MR (2004) An Arabidopsis thaliana proton pump is essential for pollen development.Genetics168:1677-1688  Sanchez AM, Bosch M, Bots M, Nieuwland J, Feron R, Mariani C (2004) Pistil factors controlling pollination. Plant Cell 16:S98–S106  Schneidereit  A , Scholz-Starke J, Buttner  M ( 2003 ) Functional characterization and expression analyses of the glucose-specific AtSTP9 monosaccharide transporter in pollen of Arabidopsis. Plant Physiol. 133: 182 – 190. 90  Scipio FD, Raimondo S , Tos P ,  Geuna S (2008) A simple protocol for paraffin-embedded myelin sheath staining with osmium tetroxide for light microscope observation. Microscopy research and Technique 71:497–502  Shiela A, Brousseau J,  McCormick S (2004) A compendium of methods useful for characterizing Arabidopsis pollen mutants and gametophytically- expressed gene. The Plant Journal 39 (5): 761–775  Siddiqi MY, Glass ADM, Ruth TJ, Fernando M (1989) Studies of the regulation of nitrate influx by barley seedlings using I3NO3 -. Plant Physiol 90 806-813  Siddiqi MY, Glass ADM, Ruth TJ, Rufty TW (1990) Studies of the uptake of nitrate in barley. I. Kinetics of 13N0,- influx. Plant Physiol 93: 1426-1432  Stagijar I, Korostenskey C, Johnsson N, Le Heesen S (1998) A genetic system based on split-ubiquitin for the analysis of interactions between membrane proteins in vivo. Proc. Natl. Acad. Sci 95(9) : 5187-5192  Sze H, Frietsch S, Li X, Bock KW., Harper JF ( 2006 ) Genomic and molecular analyses of transporters in the male gametophyte. In The Pollen Tube: A Cellular and Molecular Perspective. Edited by Malhó, R. pp. 71– 93. Springer Berlin, Heidelberg.  Taylor LP, Hepler PK(1997). Pollen germination and tube growth. Annuual. Rev. of Plant physiol. and plant mol. Boil. 48: 461-491  Tong Y, Zhuo JJ, Li ZS, Miller AJ (2005) A two component high-affinity nitrate uptake system in barley. Plant J 41:442-450  Touraine B and Glass ADM. (1997). NO_3 and ClO_3 fluxes in the chl1-5 mutant of Arabidopsis thaliana - does the CHL1-5 gene encode a low-affinity NO_3 transporter? Plant Physiology 114: 137–144.  91  Trueman LJ, Richardson A, Forde BG (1996) Molecular cloning of higher plant homologues of the high-affinity nitrate transporters of Chlamydomonas reinhardtii and Aspergillus nidulans. Gene 175: 223–231  Tsay, Y.F, Chiu, C.C, Tsai, C.B, Ho, C.H, and Hsu, P.K. (2007). Nitrate transporters and peptide transporters. FEBS Lett. 581: 2290–2300  Unkles SE, Zhou D, Siddiqi MY, Kinghorn JR, Glass ADM (2001). Apparent genetic redundancy facilitates ecological plasticity for nitrate transport. EMBO Journal 20: 6246–6255.  Unkles, S.E., Hawker, K.L., Campbell, E.I., Montague, P. and Kinghorn, J.R. (1991) crnA encodes a nitrate transporter in Aspergillus nidulans. Proc. Nafl Acad. Sci. USA, 88: 204-208.  van den Honert, T.H. (1937). Over eigenschappen van plantenwortels welke een rol spelen bij de opname van voedigngszanten. Naturwet.Tijdschr. Ned. Indie, 97: 150–162.  Vidmar JJ, Zhuo D, Siddiqi MY, Schjoerring JK, Touraine B, Glass ADM. (2000) Regulation of HvNRT2 expression and high-affinity nitrate influx in roots of Hordeum vulgare by ammonium and amino acids. Plant Physiology 123, 307–318.  Wang  and Ferreira D, Glass ADM  Nitrate uptake and GFP localization of the nitrate transporter AtNrt2.6 in Arabidopsis thaliana (Unpublished work).  Wang R and Crawford NM (1996) Genetic identification of a gene involved in constitutive, high- affinity nitrate transport in higher plants. Proc. Natl. Acad. Sci. U.S.A. 93: 9297–9301.  Wang Y, Li W, Siddiqi Y, Kinghorn JR, Unkles SE, Glass ADM (2007) Evidence for post- transcriptional egulation of NrtA, the Aspergillus nidulans high-affinity nitrate transporter. New Phytologist 175 : 699-706  Weber, AP, Schwacke,R,  Flugge, U.I.  (2005) Solute transporters of the plastid envelope membrane, Annu. Rev. Plant Biol. 56: 133e164.  Weisman LS (2003) Yeast vacuole inheritance and dynamics Annu Rev Genet 37:435-460 92  Whitley P, Hinz S, Doughty J (2009) Arabidopsis FAB1/PIKfyve proteins are essential for development of viable pollen Plant Physiol 151:1812-1822  Wirth J, Chopin F, Santoni V, Viennois G, Tillard P, Krapp A, Lejay L, Daniel-Vedele F, Gojon A. (2007) Regulation of root nitrate uptake at the NRT2.1 protein level in Arabidopsis thaliana. J. Biol. Chem 282: 23541-23552.  Wolt, JD (1994) Soil Solution Chemistry: Applications to environmental science and agriculture. New York: Wiley  Yong Z, Kotur Z, Glass ADM (2010) Characterization of an intact two-component high- affinitynitrate transporter from Arabidopsis roots The Plant Journal 63: 739–748 Young RE, McFarlane HE, Hahn MG, Western TL, Haughn GW Samuels AL (2008) Analysis of the golgi apparatus in Arabidopsis seed coat cells during polarized secretion of pectin-rich mucilage The Plant Cell, 20: 1623–1638  Yuan L, Graff L, Loqué D, Kojima S ,Tsuchiya YN, Takahashi H, von Wirén N (2009) AtAMT1;4, a pollen-specific high-affinity ammonium transporter of the plasma membrane in Arabidopsis Plant Cell Physiol. 50(1): 13–25  Zhao XQ, Li YJ, Liu JZ, Li B, Liu QY, Tong YP, Li JY,  Li YS 2004. Isolation and expression analysis of a high-affinity nitrate transporter TaNRT2.3 from roots of wheat. Acta Bot. Sin. 46: 347–354.  Zhou JJ, Fernandez E, Galvan A, Miller AJ (2000) A high affinity nitrate transport system from Chlamydomonas requires two gene products FEBS Letters 466: 225-227 Zhuo D, Okamoto M,Vidmar JJ, Glass ADM.(1999) Regulation of putative high-affinity nitrate transporter (Nrt;1At) in roots of Arabidopsis thaliana. The Plant Journal 17: 563-568  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0071816/manifest

Comment

Related Items