UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Identification of fumarate reductase as a potential Mycobacterium tuberculosis virulence factor and as… Nicholls, Allison Tari 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2011_spring_nicholls_allison.pdf [ 8.59MB ]
Metadata
JSON: 24-1.0071750.json
JSON-LD: 24-1.0071750-ld.json
RDF/XML (Pretty): 24-1.0071750-rdf.xml
RDF/JSON: 24-1.0071750-rdf.json
Turtle: 24-1.0071750-turtle.txt
N-Triples: 24-1.0071750-rdf-ntriples.txt
Original Record: 24-1.0071750-source.json
Full Text
24-1.0071750-fulltext.txt
Citation
24-1.0071750.ris

Full Text

IDENTIFICATION OF FUMARATE REDUCTASE AS A POTENTIAL MYCOBACTERIUM TUBERCULOSIS VIRULENCE FACTOR AND AS AN IMPORTANT FACTOR IN ANTIMICROBIAL SUSCEPTIBILITY by ALLISON TARI NICHOLLS BSc.H, The University of Victoria, 2008  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Microbiology and Immunology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  April 2011  © Allison Tari Nicholls, 2011  Abstract During an infection, Mycobacterium tuberculosis resides within a phagosome of a macrophage (MΦ), an environment thought to be hypoxic, nitrosative, oxidative and carbohydrate poor. Previous research evaluating which M. tuberculosis genes are important for surviving the harsh MΦ phagosome environment suggested that the fumarate reductase (FRD) enzyme might be an important factor not only for intra-MΦ survival but for M. tuberculosis virulence as well. FRD is used in anaerobic respiration (when oxygen is limiting) and helps maintain a balanced cellular redox state by using fumarate as a terminal electron acceptor. We engineered an M. tuberculosis FRD knock out that demonstrated a decrease in viability in hypoxic conditions, confirming the role of FRD in surviving hypoxia. The M. tuberculosis FRD knock out also showed a statistically significant decrease in intracellular colony forming units 4days post MΦ infection. This suggested that FRD is also an M. tuberculosis virulence factor. As such, targeting and inhibiting FRD with a drug may be a novel means for treating tuberculosis by preventing M. tuberculosis from performing anaerobic respiration. Putative FRD inhibitors were tested for mycobactericidal activity. Three out of 7 putative FRD inhibitors tested showed mycobactericidal activity in hypoxic conditions, which supported the hypothesis. Additionally, we engineered an Mycobacterium smegmatis strain to express M. tuberculosis FRD. This changed its colony morphology and rendered it more susceptible to a variety of antimicrobials, suggesting that FRD may also affect cell envelope composition. These findings further implicate FRD as a target of interest for novel anti-mycobacterial drug options. In summary, this research gives hope to alleviate the ever growing resistance problem seen in tuberculosis infections by opening up a new route for drug development and discovery.  ii  Preface Dr. Alice Li designed the primers used to engineer the mycobacteriophage. Mrs. Jie Liu engineered the mycobacteriophage used to generate the Mycobacterium tuberculosis fumarate reductase mutant. Ms. Sharlene Eivemark engineered the Mycobacterium tuberculosis fumarate reductase mutant. Allison Nicholls designed and performed all other experiments, analyzed the data and wrote this thesis.  iii  Table of contents Abstract.......................................................................................................................................... ii Preface ........................................................................................................................................... iii Table of contents .......................................................................................................................... iv List of tables.................................................................................................................................. ix List of figures ................................................................................................................................. x List of abbreviations ................................................................................................................... xii Acknowledgements ..................................................................................................................... xv Dedication ................................................................................................................................... xvi Chapter 1: Introduction ............................................................................................................... 1 1.1  Tuberculosis ..................................................................................................................... 1  1.1.1 Mycobacterium tuberculosis .......................................................................................... 1 1.1.2 Infection and disease ...................................................................................................... 2 1.1.3 Treatment ....................................................................................................................... 3 1.1.4 BCG vaccine and prevention ......................................................................................... 4 1.2 Macrophages and phagosomes .......................................................................................... 5 1.2.1 Phagosome maturation ................................................................................................... 5 1.2.2 Survival of M. tuberculosis within the phagosome ....................................................... 6 1.3 Fumarate reductase ............................................................................................................ 8 1.3.1 Regulation ...................................................................................................................... 9 1.4 Models for Mycobacterium tuberculosis .......................................................................... 12 1.4.1 Mycobacterium bovis BCG .......................................................................................... 12 1.4.2 Mycobacterium smegmatis........................................................................................... 13  iv  1.5 Project goals ...................................................................................................................... 14 1.5.1 Objective 1: Evaluating the role of fumarate reductase as a Mycobacterium tuberculosis virulence factor ................................................................................................. 14 1.5.1.1 Hypothesis............................................................................................................. 14 1.5.1.2 Experimental approach ......................................................................................... 15 1.5.2 Objective 2: Evaluating putative fumarate reductase inhibitors as a novel treatment option for tuberculosis .......................................................................................................... 15 1.5.2.1 Hypothesis............................................................................................................. 15 1.5.2.2 Experimental approach ......................................................................................... 15 1.5.3 Objective 3: Investigating the role of fumarate reductase in drug susceptibility and/or resistance in Mycobacterium smegmatis ............................................................................... 16 1.5.3.1 Hypothesis............................................................................................................. 16 1.5.3.2 Experimental approach ......................................................................................... 16 Chapter 2: Materials and methods............................................................................................ 18 2.1 Mycobacteria ..................................................................................................................... 18 2.2 Cloning – Mycobacterium tuberculosis .......................................................................... 19 2.2.1 Primer design ............................................................................................................... 19 2.2.2 Allelic exchange substrate (AES) plasmid construction .............................................. 19 2.2.3 Phasmid construction ................................................................................................... 22 2.2.4 Phasmid screening ....................................................................................................... 23 2.2.5 Phage preparation......................................................................................................... 23 2.2.6 Preparation of high titre phage lysate .......................................................................... 24 2.2.7 Transduction of M. tuberculosis H37Rv with p0004S ................................................ 24  v  2.2.8 Isolation of RNA .......................................................................................................... 25 2.2.9 Purification of mycobacterial RNA ............................................................................. 25 2.2.10 RT-PCR ..................................................................................................................... 26 2.2.11 Confirmation of FRD knock-out using PCR ............................................................. 26 2.2.12 Maintaining stock of M. tuberculosis H37Rv FRD KO ............................................ 28 2.3 Cloning – Mycobacterium smegmatis ............................................................................... 29 2.3.1 Amplification of the FRD operon from M. tuberculosis H37RV genomic DNA ....... 29 2.3.2 Cloning FRD insert into pGEM®-T Easy Vector ........................................................ 29 2.3.3 Cloning FRD insert into pMV361 ............................................................................... 31 2.3.4 Transformation of M. smegmatis mc2155 with pMV361:FrdABCD and empty vector control ................................................................................................................................... 32 2.3.5 Isolation of M. smegmatis genomic DNA.................................................................... 32 2.3.6 Confirmation of successful M. smegmatis transformation with pMV361:FrdABCD . 34 2.4 Growth/viability of mycobacteria .................................................................................... 35 2.4.1 Growth in aerobic conditions ....................................................................................... 35 2.4.2 Viability in hypoxic conditions.................................................................................... 36 2.5 Infection of murine bone marrow-derived macrophages (BMMΦ) with M. tuberculosis H37Rv and FRD KO.......................................................................................... 36 2.5.1 BMMΦ cell culture ...................................................................................................... 36 2.5.2 Preparation of BMMΦs and mycobacteria for infection ............................................. 37 2.5.3 Mycobacterial infection of BMMΦ ............................................................................. 38 2.6 Resazurin assay for cell viability ..................................................................................... 38 2.6.1 MIC of antimicrobials and putative FRD inhibitors in aerobic conditions ................. 38  vi  2.6.2 Checkerboard assay ..................................................................................................... 40 2.7 Effectiveness of putative FRD inhibitors in aerobic and hypoxic conditions .............. 40 2.8 Statistical analysis ............................................................................................................. 43 Chapter 3: Evaluation of fumarate reductase and it role in Mycobacterium tuberculosis virulence and drug susceptibility in Mycobacterium smegmatis ............................................. 44 3.1 Introduction ....................................................................................................................... 44 3.2 Rationale ............................................................................................................................ 46 3.3 Results – Evaluation of fumarate reductase and it role in Mycobacterium tuberculosis virulence ................................................................................................................................... 46 3.3.1 Growth and viability of Mycobacterium tuberculosis WT and FRD KO in liquid culture ................................................................................................................................... 46 3.3.2 Putative FRD inhibitors show little to no cytotoxic effect on mammalian cells ......... 47 3.3.3 Mycobacterium tuberculosis FRD KO has an intra-MΦ survival defect .................... 51 3.3.4 The drug susceptibility profile of the Mycobacterium tuberculosis FRD KO is similar to WT in aerobic conditions .................................................................................................. 51 3.3.5 Putative FRD inhibitors in the MPNO family are effective at reducing mycobacterial cell viability in hypoxic conditions only............................................................................... 54 3.4 Results – Evaluation of fumarate reductase and it role in drug susceptibility in Mycobacterium smegmatis ...................................................................................................... 60 3.4.1 Mycobacterium smegmatis FRDhsp has a distinct colony morphology ........................ 60 3.4.2 Growth and viability of Mycobacterium smegmatis WT, VC and FRDhsp in liquid culture ................................................................................................................................... 63 3.4.3 Determining relationships between FRD and antimicrobials ...................................... 63  vii  3.5 Discussion .......................................................................................................................... 71 3.5.1 Role of fumarate reductase in Mycobacterium tuberculosis........................................ 71 3.5.2 Role of fumarate reductase in Mycobacterium smegmatis .......................................... 78 Chapter 4: Conclusions and future directions ......................................................................... 89 4.1 Conclusions ........................................................................................................................ 89 4.2 Future directions ............................................................................................................... 90 4.2.1. Complementation of the M. tuberculosis FRD KO .................................................... 90 4.2.2. Growth of M. tuberculosis WT, FRD KO and complement in aerobic and hypoxic conditions in the presence and absence of fumarate ............................................................. 90 4.2.3. Evaluating FRD as an M. tuberculosis virulence factor in vivo ................................. 91 4.2.4. Treatment of M. tuberculosis-infected macrophages with putative FRD inhibitors . 91 4.2.5. Cell envelope composition and permeability of M. smegmatis FRDhsp...................... 92 References .................................................................................................................................... 93 Appendix A: Supplementary figures....................................................................................... 101  viii  List of tables Table 1: Primers used in the PCR amplification of upstream and downstream flanking sequences of the fumarate reductase operon for allelic exchange substrate (AES) plasmid construction. ............................................................................................................................................... 20 Table 2: Primers used to confirm the Mycobacterium tuberculosis FRD knock-out. .................. 27 Table 3: Primers used to generate the Mycobacterium smegmatis FRDhsp strain......................... 30 Table 4: Complete list of antimicrobials used in resazurin MIC assays. ...................................... 41 Table 5. Complete list of putative FRD inhibitors used in resazurin and hypoxic MIC assays. .. 42 Table 6: All putative FRD inhibitors tested show little to no cytotoxic effect to BMMΦs as determined via a resazurin assay........................................................................................... 50 Table 7: FRDhsp Mycobacterium smegmatis shows increased susceptibility to diverse antibiotics relative to WT and VC using the resazurin assay. ................................................................ 68 Table 8: Addition of fumarate or succinate in combination with antimicrobials is generally antagonistic for Mycobacterium smegmatis FRDhsp and synergistic for VC as determined by the resazurin assay. ............................................................................................................... 69  ix  List of figures Figure 1. Schematic of frdABCD regulation in E. coli................................................................. 11 Figure 2. Upstream cloned section of pMV361:FrdABCD highlighting the Hsp6- -35 and -10 sites as well as the putative FRD promoter and FNR binding site ....................................... 33 Figure 3: Aerobic growth kinetics of Mycobacterium tuberculosis H37Rv wild-type (WT) and FRD knock-out mutant (KO) are similar. ............................................................................. 48 Figure 4: Fumarate maintains viability of Mycobacterium tuberculosis H37Rv (WT) but not FRD knock-out mutant (KO) in hypoxic conditions after 21 days. .............................................. 49 Figure 5: Intra-MΦ growth defect of FRD knock-out mutant (KO) relative to Mycobacterium tuberculosis H37Rv wild-type (WT). ................................................................................... 52 Figure 6: Mycobacterium tuberculosis H37Rv (WT) and FRD knock-out mutant (KO) show a similar drug susceptibility profile in the minimal medium Proskauer and Beck. ................. 53 Figure 7: Effect of FRD inhibitors on Mycobacterium tuberculosis Erdman in aerobic conditions. ............................................................................................................................................... 56 Figure 8: Three putative FRD inhibitors (MPNO related) inhibit survival of Mycobacterium tuberculosis H37Rv in both aerobic and hypoxic conditions ............................................... 57 Figure 9: Two out of five putative FRD inhibitors inhibit survival of Mycobacterium bovis BCG in hypoxic conditions. ........................................................................................................... 58 Figure 10: Mycobacterium smegmatis FRDhsp has a distinct colony morphology compared to WT and VC. ................................................................................................................................. 61 Figure 11. PCR of Mycobacterium smegmatis genomic DNA with primers for the frdABCD operon confirms insertion in the FRDhsp strain. .................................................................... 62  x  Figure 12: Aerobic growth of Mycobacterium smegmatis WT (a), VC (b) and FRDhsp (c) in Proskauer and Beck in the presence or absence of 0.3 M Fumarate..................................... 64 Figure 13: Mycobacterium smegmatis FRDhsp but not wild type (WT) or pMV361 vector control (VC) resists inhibition by fumarate after 7 days of treatment under hypoxic conditions. .... 65 Figure 14: Mycobacterium smegmatis FRDhsp is less sensitive than the VC to fumarate in hypoxic conditions. ............................................................................................................... 66 Figure 15: Sample FIC graphs representing each type of interaction using the data presented in Table 8. ................................................................................................................................. 70 Figure S1. pMV361:FrdABCD plasmid map ............................................................................. 101 Figure S2. pMV361:FrdABCD plasmid sequence ..................................................................... 102  xi  List of abbreviations AES  allelic exchange substrate  AsnB  L-asparaginase  ATCC  American Type Culture Collection  BCG  Bacille de Calmette et Guèrin  BLAST  Basic Local Alignment Search Tool  BMMΦ  bone marrow-derived macrophage  CAP  catabolite activator protein  CDC  Centres for Disease Control and Prevention  CFP-10  culture filtrate protein 10  CFRI  Child and Family Research Institute  CFU  colony forming units  CL3  containment level 3  CRP  cAMP receptor protein  EEA-1  early endosome antigen -1  ESAT-6  early secretory antigenic target 6  ESX-1  ESAT-6 system 1  FIC  fractional inhibitory concentration  FNR  fumarate nitrate regulator  FRD  fumarate reductase  HIV  Human Immunodeficiency Virus  HygR  hygromycin resistance  IFN-γ  interferon-gamma  xii  IPTG  isopropyl β-D-1-thiogalactopyranoside  KO  knock out  LAM  lipoarabinomannan  LAMP-1  lysosome- associated membrane protein 1  LB  Luria-Bertani  LM  lipomannan  M-CSF  monocyte-colony stimulating factor  MDR  multi-drug resistance  MHC  major histocompatibility complex  MIC  minimal inhibitory concentration  MOI  multiplicity of infection  MP  mycobacteriophage buffer  MPNO  mercaptopyridine-N-Oxide  mPTPB  mycobacterium protein tyrosine phosphatase B  MΦ  macrophage  NAD+  nicotinamide adenine dinucleotide  NADH  reduced nicotinamide adenine dinucleotide  NAG  N-acetylglucosamine  NAM  N-acetulmuramic acid  OADC  oleic acid, albumin, dextrose complex  OD  optical density  ORF  open reading frame  PB&T  Proskauer and Beck medium supplemented with Tween-80  xiii  PDIM  phthiocerol dimycocerosate  PFU  plaque forming units  PhyA  phytoene synthase A  PPD  purified protein derivative  RD1  region of difference 1  rpm  rotations per minute  SAP  shrimp alkaline phosphotase  SDH  succinate dehydrogenase  SEM  standard error of the mean  SigB  sigma factor σB  SOB  super optimal broth with catabolite repression  STHE  stearyl thiohydroxamic ester  TB  tuberculosis  TDM  trehalose 6, 6’-dimycolate  TLC  thin layer chromatography  TST  tuberculin skin test  VC  vector control  WT  wild type  X-gal  bromo-chloro-indolyl-galactopyranoside  XDR  extensively-drug resistance  xiv  Acknowledgements I owe my deepest gratitude to my supervisors, Dr. Richard Stokes and Dr. Charles Thompson, who made this thesis possible. Their encouragement, guidance, support and patience was inspiring – I would have been lost without them. I would also like to thank the members of the Stokes and Thompson lab for their valuable input and advice. Last but not least, I thank my parents for their ongoing support both emotionally and financially.  xv  Dedication This work is dedicated to J, S & B  xvi  Chapter 1: Introduction 1.1 Tuberculosis Tuberculosis (TB) is an infectious disease that infects approximately one third of the world’s population and causes an estimated 2 million deaths annually [1]. Typical symptoms include weight loss, poor appetite, fever, fatigue, blood-tinged sputum and night sweats. It is thought that M. tuberculosis evolved approximately 35,000 years ago from environmental mycobacteria, which themselves have been tracked back 2,500,000 years [2]. This disease has long been associated with humans. There is evidence of tuberculosis in a 9,000-year-old ancient Egyptian mummy [2]. Tuberculosis likely spread out of Africa along with human migration and expansion along land routes [3]. The 1930s and 40s was a booming era for the development of novel anti-tuberculosis drugs like streptomycin and rifampin [4,5]. Unfortunately, not long after introduction of these antibiotics, the number of drug resistant cases was on the rise. An increase in the number of multi-drug resistant (MDR) and extensively-drug resistant cases (XDR) ultimately led to an increased incidence of tuberculosis in both developing and developed countries [5]. There is a vital need for the development of novel anti-tuberculosis treatments.  1.1.1 Mycobacterium tuberculosis Tuberculosis is caused by Mycobacterium tuberculosis (Mtb), a facultative microaerophilic, non-spore-forming intracellular bacterium. Having just under 4000 annotated genes, the M. tuberculosis genome consists of approximately 4 million base pairs in the form of a single, circular chromosome [6]. Belonging to the taxon Actinomycetales, M. tuberculosis has a 1  complex, waxy, gram-positive-like cell envelope rich in mycolic acid containing lipids and various other glycolipids such as phthiocerol dimycocerosate (PDIM), lipomannan (LM) and lipoarabinomannan (LAM) [7]. The outermost layer or “capsule” of M. tuberculosis consists mainly of polysaccharide but also contains proteins and lipids [7]. Recently, it has been shown that certain capsular components (such as M. tuberculosis Cpn60.2) can interact with host cells (such as macrophage CD43) while some, such as the mycolic acid in cord factor (trehalose 6, 6’dimycolate (TDM)), are highly correlated with virulence [7,8]. M. tuberculosis has a plasma membrane and a thick peptidoglycan layer to which mycolic acids are attached. Due to the cell wall composition, M. tuberculosis does retain the gram reagents, so does not stain Gram positive. Instead, mycobacteria are ‘acid-fast’. When staining using Ziehl-Neelsen, carbol fuchsin or Auramin O, M. tuberculosis becomes highly resistant to decolourization using hydrochloric acid and/or ethanol, hence the term ‘acid-fast’ [9]. Of importance, this thick cell wall also poses a challenge in novel anti-tuberculosis treatments since it makes the bacilli highly impermeable.  1.1.2 Infection and disease The overwhelming global burden of tuberculosis is due to the ease with which it is transmitted via aerosols. An individual with a productive tuberculosis infection can expel droplet nuclei via a cough [10]. Droplet nuclei contain as few as 1-3 bacilli, are approximately 1-5µm in diameter and can be inhaled by another individual, depositing bacilli into lung alveoli [10]. The risk of infection from such an exposure is reported to be approximately 30%. For most individuals, this initial infection is often asymptomatic (primary tuberculosis) and resolves spontaneously [11]. Alveolar macrophages (MΦ) ingest bacilli and eliminate the threat. 2  However, in a small percentage of individuals, bacilli can replicate within non-activated MΦs, lyse the MΦs and spread to neighboring cells. Given that the MΦ cannot contain the infection, the host’s pro-inflammatory response is initiated. Mononuclear cells, neutrophils and lymphocytes are brought to the site of infection and form a wall around the bacilli [12]. This wall, typical of a latent infection, is called a tubercule or granuloma and contains the bacilli in an increasingly hypoxic environment [13,14]. Ultimately, bacterial growth is reduced until a dormant stage is reached. For reasons not yet fully known, dormant bacilli can reactivate years after the primary infection possibly leading to a chronic granulomatous infection [11]. Malnutrition, alcoholism, immunosuppression by disease or drugs and poorly controlled diabetes mellitus are factors that may contribute to this reactivation. The tuberculin skin test (TST), also known as Mantoux screening test, tuberculin sensitivity test or purified protein derivative test (PPD) is a common diagnostic tool for tuberculosis [15]. Administration of this test consists of injecting a standard dose of tuberculin intradermally (between dermis layers) and reading it 48-72 hours later. PPD-Tuberculin is a poorly defined precipitate of antigens obtained from sterile M. tuberculosis culture filtrates [15]. If a person has previously encountered tuberculosis, an immune response is mounted in the skin containing tuberculin. The response is measured by the diameter of induration. A disadvantage of this test is that it is not reliably able to differentiate between exposure to M. tuberculosis, environmental mycobacteria or the tuberculosis vaccine (discussed in Section 1.1.4).  1.1.3 Treatment The primary method for tuberculosis treatment relies on antibiotics, the first of which, streptomycin, was introduced in the 1940s [16]. Unfortunately, M. tuberculosis became resistant 3  to this antibiotic not long after it was introduced. Over the years, additional antibiotics with antimycobacterial properties were discovered. However, very few antimycobacterials have been identified since 1966 [17]. Currently, the typical antibiotic regime encompasses a combination of 4-6 antibiotics including isoniazid, rifampin, pyrazinamide, ethambutol and fluoroquinolones. This treatment regime can continue for up to 9 months and only 47% of patients who start treatment follow it to completion [18]. Such a long and aggressive treatment regimen results in low patient compliance, which then contributes to drug resistance. The emergence of MDR-TB (multiple drug resistant; resistant to at least the two front-line drugs rifampin and isoniazid) emphasizes the need for more effective therapies [16]. XDR-TB (extensively drug resistant; resistant to at least the two front-line drugs rifampin and isoniazid plus any quinolone plus at least one of the injectable second-line drugs such as capreomycin or amikacin) infections are very difficult to treat even using advanced therapeutics and health care [16].  1.1.4 BCG vaccine and prevention In the early 1900s, a TB vaccine was developed, Bacille de Calmette et Guèrin (BCG), by continually passaging a virulent strain of Mycobacterium bovis [19]. After more than 200 passages, the strain exhibited a loss of virulence and a protective effect in animal models [20]. Initially, this vaccine was quite effective. However, its protective effect seemed to wane over time possibly due to the delivery of BCG to various health care centers world-wide. Each laboratory may have a different technique for the maintenance of BCG leading to genetic changes ultimately affecting the effectiveness of the vaccine [21]. However, a recent study comparing evolutionarily early and evolutionarily late BCG strains in a guinea pig model 4  showed comparable efficacies of the two vaccines [22]. However, distinct differences have been identified and the mechanism by which the changes occurred or selected is still unclear. Efficiencies of current vaccines from different BCG strains range from 0-94% depending on the strain used and the population vaccinated [20]. For example, two studies performing BCG trials in India (Chingleput district) and in Malawi showed 0% effectiveness [23,24]. A potential cause for the decreased effectiveness of BCG in those studies may be due to the fact that other mycobacteria, environmental and/or virulent mycobacteria are prevalent in such areas. Perhaps BCG is being targeted and destroyed by the immune response already primed against other mycobacteria [25,26,27,28].  1.2 Macrophages and phagosomes M. tuberculosis is engulfed by MΦs during an infection. At this point, the bacilli reside within the hypoxic phagosome of the MΦ [29,30]. If non-pathogenic bacteria were in the same situation, the phagosome would mature along the endosome-lysosome pathway and the threat would be eradicated [31]. However, M. tuberculosis can commandeer the phagocytic machinery to subvert the maturation process and can survive and replicate within the MΦ.  1.2.1 Phagosome maturation A cell can internalize foreign particles via pinocytosis (for small molecules) or phagocytosis (for larger particles, like the M. tuberculosis bacilli) [31]. A phagosome (a type of endosome) is the resulting organelle and is derived from the plasma membrane of the cell that initially internalized the particle. Phagosomes mature to phagoslysosomes by interacting with vesicles of the endosome-lysosome pathway. This maturation process is not a single event but 5  rather a dynamic series of interactions between these two systems [32]. Furthermore, components of the ingested particle can either be degraded by lysosomes or they can be recycled back to the plasma membrane as part of the endosomal-recycling network. Initially, phagosomes contain many of the same components of the plasma membrane from which they were derived such as major histocompatibility complex (MHC) class I and II [32]. MHC molecules are responsible for the processing and presentation of antigens to the immune system. In the beginning of the maturation process, early phagosomes acquire certain protein markers like Rab5 (a GTPase), early endosome antigen-1 (EEA1), transferrin and its receptor [33,34]. Early phagosomes fuse with early endosomes, also containing Rab5. With this interaction, membrane-bound proton pumps are targeted to the early endosome, decreasing the pH from approximately 6 to 5.5 [32,33]. A more acidic pH as well as the acquisition of Rab7 and mannose-6-phosphate receptor amongst others is indicative of a late endosome. Maturation into late endosomes is promoted by interferon-gamma (IFN-γ), which in turn stimulates MΦ antimicrobial mechanisms such as the oxidative burst. This generates reactive oxygen intermediates (ROI; superoxide, for example) and reactive nitrogen intermediates (RNI; peroxynitrite, for example) that are toxic to the foreign body [35]. Furthermore, fusion of a phagosome with a late endosome results in a phagolysosome and proteolytic enzymes subsequently aid in the degradation of the remaining intracellular contents.  1.2.2 Survival of M. tuberculosis within the phagosome A signature of an M. tuberculosis infection is its ability to remain in mildly acidified phagosomes that fail to progress through the phagolysosome process described above [36]. This is advantageous for the bacilli as certain essential nutrients are readily available in a dynamic 6  early endosome. Experiments showed that transferrin is internalized by the early endosome ligated to the transferrin receptor, then loses its bound iron and is recycled to the cell surface [37]. Basically, the early endosome retains access to the endosomal-recycling network while the late endosome does not. This gives the intracellular bacilli access to the nutrients, such as iron (as described above), required for survival [38]. Previous studies showed that M. tuberculosis-infected phagosomes contain markers (like Rab5) indicative of early endosomes and lack markers (like Rab7, LAMP-2) indicative of late endosomes [32,34]. However, the M. tuberculosis-infected phagosome is often described as having LAMP-1, a late endosome marker [36]. The exact mechanism for the failure of M. tuberculosis-infected phagosomes to fuse to lysosomes has not yet been completely elucidated. Interestingly, if M. tuberculosis is ingested by a previously activated MΦ, the bacilli cannot reverse the maturation process and are ultimately destroyed by the acidic and proteolytic environment [39]. It has also been shown that M. tuberculosis has the ability to modulate immune system processes. Recall, both MHC molecules are present in abundance on the plasma membrane and are thus initially present on the phagosome membrane. Typically, MHC class I molecules are rapidly recycled during endocytosis while MHC class II molecules are excluded from the late endosome. However, M. tuberculosis-infected phagosomes display a delayed clearance of MHC class I molecules as well as maintaining a large population of MHC class II molecules [32]. The mechanisms by which M. tuberculosis antigens are processed and presented via MHC molecules are poorly understood [40]. Perhaps M. tuberculosis can manipulate the immune system via MHC class I and II molecules as a means of camouflage. Finally, as another means of survival within the MΦ, M. tuberculosis produces both superoxide dismutase (sodA; Rv3846, sodC;  7  Rv0432) and a catalase peroxidase (katG; Rv1908c) [41,42]. These enzymes can neutralize detrimental ROI/RNI generated by the MΦ. In sum, M. tuberculosis has a wide variety of mechanisms in which to prevent phagolysosome fusion, avoid host responses and survive within the MΦ, making it a threatening intracellular pathogen.  1.3 Fumarate reductase To gain a better understanding of the factors contributing to M. tuberculosis virulence with respect to survival within the host, recent work from the Stokes’ lab compared the gene expression of virulent M. tuberculosis (H37Rv) to that of avirulent M. tuberculosis (H37Ra) during a MΦ infection using bacterial artificial chromosome fingerprint arrays (BACFA) [43]. M. tuberculosis H37Rv is adept at surviving within a MΦ, while M. tuberculosis H37Ra is less adept and as such, differences in expression between the two may reveal important factors important for survival within the MΦ. Amongst other things, these experiments determined that M. tuberculosis fumarate reductase complex (FRD) is more rapidly upregulated in virulent M. tuberculosis than in avirulent M. tuberculosis [43]. TraSH screens used to identify genes for the survival of M. tuberculosis in macrophages and in mice did not identify FRD as essential [44,45,46]. This fact highlights an advantage of the BACFA technique – it allows for the identification of differences in operons, of which FRD is a part of. FRD is an enzyme that converts fumarate to succinate. It plays an important role in M. tuberculosis respiration under conditions of low oxygen concentration, such as the phagosome of a MΦ, using fumarate as the terminal electron acceptor [30,47]. FRD consists of four subunits encoded by four genes. The four components of M. tuberculosis FRD, frdABCD (Rv1552-1555) 8  are transcribed together in a single operon. Transcription start and end sites overlap in the organization of frdBCD, while frdA is separate. Even though the structure and/or function of each FRD component has not been specifically studied in M. tuberculosis, FrdA, FrdB and FrdC/D are predicted to be a flavoprotein subunit, an iron-sulfur domain and membrane anchoring domains, respectively, as they are in E. coli [47]. While FRD catalyzes the conversion of fumarate to succinate with concurrent oxidation of NADH to NAD+, succinate dehydrogenase (SDH) catalyzes the reverse reaction (succinate into fumarate with the concurrent reduction of NAD+ to NADH) [48]. M. tuberculosis SDH is similar to FRD and to SDH in E. coli in that it is also a four-subunit protein, comprised of SdhABDC (Rv3316-3319). Both E. coli enzymes can catalyze their reaction in either direction, however, FRD expression is repressed in aerobic conditions while SDH expression is repressed in hypoxic conditions. Interestingly, E. coli FRD can partially replace the function of SDH when the fumarate/nitrate regulator system (described below) is expressed under the control of a plasmid promoter [49]. The interplay between E. coli FRD and SDH has been extensively studied; however, this relationship has not yet been as extensively studied in M. tuberculosis.  1.3.1 Regulation In E. coli, the fumarate nitrate reductase regulator (FNR) is responsible for frdABCD expression during anaerobic cellular growth [50]. Structural predictions relate FNR to catabolite activator protein (CAP), also known as the cAMP receptor protein (CRP) [51]. Activation of FNR is governed by the redox state of the cell [52]. Low oxygen shifts the cell to a reducing environment, allowing FRD to dimerize via the binding of an oxygen-sensitive [4Fe-4S]2+ ironsulfur cluster at four conserved cysteine residues (Cys 20, 23, 29, 122) [48,53]. Binding of this 9  cluster induces a conformational change in the N-terminal region that allows FNR to bind DNA [51]. Once in its active form, this homodimer binds palindromic sequence of DNA with each monomer binding to one half of the site thus promoting transcription of frdABCD [51]. The FNR consensus sequence is TTGATNNNNATCAA [54]. In the presence of oxygen, the environment changes to an oxidizing one. The oxygensensitive iron-sulfur cluster is transformed from a cubane [4Fe-4S]2+ to a planar [2Fe-2S]2+ [55]. This results in another conformational change in the N-terminal region, rendering the regulator incapable of binding DNA [55]. Superseding the FNR-dependent FrdABCD control is another layer of regulation. In response to the presence of nitrate in the cell, FrdABCD is downregulated via the Nar twocomponent regulatory system [56]. In E. coli and M. tuberculosis, nitrate is preferred over fumarate as the terminal electron acceptor in anaerobic respiration as it provides a higher potential for ATP generation [57,58]. NarX senses the presence of nitrate and becomes phosphorylated in an ATP-dependent manner [58]. Phospho-NarX activates NarL through the transfer of its phosphate group. Phospho-NarL then binds in the FrdABCD promoter region to prevent FNR binding [59]. See Figure 1 for a schematic of FNR regulation in E. coli. FNR/FRD regulation has been extensively studied in E. coli; FNR/FRD regulation in M. tuberculosis is assumed to be analogous. M. tuberculosis does have a putative-FNR binding site (AATGTGATCTAGGTCACGTG) upstream of the FrdA start site and a complete Nar system [52]. Thus, regulation of FNR/FRD in M. tuberculosis is possibly similar to that in E. coli.  10  (a)  (b)  !!!!!!!"#$%&'!(")*!!!!!!!+,-./-&!(+"01*! +"01!  !!!!!!!"#$%&'!(")*!!!!!!!+,-./-&!(+"01*!  5#-./6&7787/.!9,7,&8!  +/.4! =!  3#-./4&5565/.!7,5,&6!  +/.2!  !  :$-;<;7!  !  8$-9:95! ;+E!  =!  ;+E!  2+3!  F;&1FA!!  ;+E!  H2&1HD!!  2+3!  CD!  );&1)A!  1")!  +/.>!  =!  ;+E!  );&1)A!  ;+E!  F;&1FA!!  +/.>! 2.?@!  2.?A!  2.?:!  2.?B!  BD!  @A!  +;!2.?@A:B!E./'<6.,FG;'!  ;+E!  ;.<=!  ;.<>!  ;.<8!  ;.<?!  ;.<=>8?!B./':4.,CD9'!  Figure 1. Schematic of frdABCD regulation in E. coli. (a) In the absence of oxygen and the presence of nitrate, NarX becomes phosphorylated in an ATP-dependent manner. NarX-P then activates NarL via phosphate transfer. NarL-P binds to the FrdABCD promoter region preventing FNR from binding and driving FRD transcription. (b) In the absence of oxygen and nitrate, the cell shifts to a reducing environment, which allows FNR to dimerize via the formation of an iron-sulfur (4Fe-4S) cluster. Once activated, FNR can bind the FrdABCD promoter sequence to allow FRD transcription. (Adapted from Akhter al., 2008 [44] and Guest 1992 [46]).  11  ?A!  1.4 Models for Mycobacterium tuberculosis Obviously, the best way to study tuberculosis is to use M. tuberculosis. However, working with such an organism comes with its own challenges. Firstly, M. tuberculosis is classified as a Containment Level 3 (CL3) or Risk Group 3 organism. According to the Centres for Disease Control and Prevention (CDC), BSL 3 organisms are “indigenous or exotic agents which may cause serious or potentially lethal disease as a result of exposure by the inhalation route (applicable to clinical, diagnostic, teaching, research or production facilities)” (http://www.absa.org/riskgroups/index.html). Working with such an organism requires a significant amount of training and a specialized Level 3 laboratory. Furthermore, M. tuberculosis is a slow-growing mycobacterium that has a doubling time between 14 and 24 hours, depending on the strain, growth conditions and media used [60]. It takes approximately three weeks for colonies to appear on agar plates. As such, experiments involving M. tuberculosis are timeconsuming. Gaining access to a CL3 laboratory may not always be possible and the risk factors and slow experimental progress that accompany such a pathogen may be undesirable. As such, the use of other mycobacteria as models for M. tuberculosis is becoming increasingly popular. However, just because a certain phenomenon is seen in the model doesn’t guarantee that the same is true in M. tuberculosis. These models should be used as a means to develop new ideas and techniques that can then be brought to M. tuberculosis for confirmation.  1.4.1 Mycobacterium bovis BCG Like M. tuberculosis, M. bovis BCG is a slow-growing mycobacterium; however, it is categorized as a CL2 organism. This removes the challenge of finding and obtaining authorization to work in a Level 3 laboratory. Recall that the BCG vaccine strain was generated 12  via numerous laboratory passages in liquid media. Since there was no host selection, there was less pressure to maintain factors required for infection and/or virulence [61]. While there are likely many deletions/mutations responsible for M. bovis BCG’s loss of virulence, a key deletion is in the Region of Difference 1 (RD1) [62]. M. bovis BCG seems to have lost this 9.8-kb genomic region during the original derivation of BCG [62]. Of importance, RD1 in M. tuberculosis is essential for virulence and deletion of RD1 from M. tuberculosis mimics the attenuation seen in M. bovis BCG [63]. The function of all 9 open-reading frames (ORFs) of RD1 is unknown. However, genes for the early secretory antigenic target 6 (ESAT-6) and culture filtrate protein 10 (CFP-10) are known to be part of RD1 [64]. The ESAT-6 system 1 (ESX-1), a type VII secretion system, is required for the secretion of ESAT-6 and CFP-10 and for M. tuberculosis virulence. ESX-1 is absent from M. bovis BCG.  1.4.2 Mycobacterium smegmatis M. smegmatis is a soil dwelling, non-pathogenic, CL2 mycobacterium. This is an attractive model for M. tuberculosis because of its rapid doubling time (approximately 4 hours) and the ease with which it can be genetically manipulated [65]. M. tuberculosis is notoriously challenging to manipulate and as such, M. smegmatis is used as a workhorse for cloning and exploring the role of M. tuberculosis genes. Furthermore, M. smegmatis mutants have been isolated that can be transformed with DNA at much higher efficiencies than the parent strain, allowing for more elaborate genetic manipulations [66]. Recently, M. smegmatis was used to develop the ‘recombineering’ (recombination-mediated genetic engineering) technique [67]. This method has been successfully used to generate both gene knock out and point mutations in M. smegmatis and M. tuberculosis [65]. 13  Of specific importance to this project, M. smegmatis is able to enter a dormant state similar to that of M. tuberculosis when oxygen is slowly depleted and as such provides an excellent model for studying mycobacterial viability in hypoxic conditions [68]. Like M. tuberculosis, M. smegmatis has a putative nitrate reductase and regulator system. However, M. smegmatis does not have a fumarate reductase. Giving M. smegmatis a copy of the M. tuberculosis FRD is thus a complementary method to generating a FRD knock out in M. tuberculosis for investigating the role of fumarate reductase in mycobacteria.  1.5 Project goals 1.5.1 Objective 1: Evaluating the role of fumarate reductase as a Mycobacterium tuberculosis virulence factor 1.5.1.1 Hypothesis Since M. tuberculosis resides within the hypoxic environment of a phagosome within MΦs, methods to quickly cope with suboptimal oxygen conditions are crucial [29,30]. My working hypothesis is that FRD is a virulence factor in M. tuberculosis. The increased FRD expression seen when M. tuberculosis H37Rv infects MΦs enables a rapid response to the hypoxic environment, a contributing factor that allows for efficient replication and survival. I hypothesize that without FRD, M. tuberculosis will not be able to survive within the phagosome of a MΦ, allowing the host to more easily clear the infection.  14  1.5.1.2 Experimental approach To test this hypothesis, a knock-out (KO) FRD mutant was generated in M. tuberculosis H37Rv using a mycobacteriophage. Since FRD has been implicated as an essential component for surviving hypoxic conditions, both wild type (WT) and FRD KO M. tuberculosis will be grown in broth in the presence and absence of oxygen and fumarate. To evaluate the role of FRD in virulence, growth of M. tuberculosis WT and FRD KO will be determined in a murine MΦ infection model.  1.5.2 Objective 2: Evaluating putative fumarate reductase inhibitors as a novel treatment option for tuberculosis 1.5.2.1 Hypothesis If evidence is obtained that FRD is an M. tuberculosis virulence factor, then we hypothesize FRD could be used as a novel drug target for tuberculosis treatment. If FRD could be inhibited, this would mimic a FRD knock out. Survival within the host MΦ should be impaired. Furthermore, FRD is not found in mammalian cells. This makes FRD an even more promising drug target for tuberculosis treatment since a specific FRD inhibitor should only target M. tuberculosis.  1.5.2.2 Experimental approach To investigate this hypothesis, various available putative FRD inhibitors will be tested for their antimycobactericidal activity using both M. tuberculosis and M. bovis BCG. M. bovis BCG will make a good model for M. tuberculosis in this experiment since it has a FRD operon that is  15  99% identical to that of M. tuberculosis H37Rv (BLASTn ID lcl|37973). Since FRD is proposed to be required in hypoxic conditions, it is expected that the operon would only be upregulated in low oxygen conditions. This experiment will therefore be performed in hypoxic conditions.  1.5.3 Objective 3: Investigating the role of fumarate reductase in drug susceptibility and/or resistance in Mycobacterium smegmatis 1.5.3.1 Hypothesis Under aerobic conditions, oxygen is typically used as the terminal electron acceptor in the electron transport chain. However, in hypoxic conditions such as those found within the phagosome of a MΦ, fumarate can be used as the terminal electron acceptor, allowing for ATP synthesis in the absence of oxygen [48,69]. As mentioned previously, FRD is an enzyme responsible for converting fumarate to succinate. On the other hand, succinate dehydrogenase (SDH) catalyzes the reverse reaction, converting succinate into fumarate [69]. Both enzymes can lead to the production of toxic superoxide, a free radical [48]. A recent publication suggests that bactericidal antibiotics induce the production of hydroxyl radicals [70]. Perhaps there is a link between FRD and the generation of free radicals in response to antibiotics that may reveal novel routes of treating TB.  1.5.3.2 Experimental approach To investigate the role of FRD in drug susceptibility and/or resistance, Mycobacterium smegmatis mc2155 will be transformed with a plasmid containing the entire M. tuberculosis FRD operon to produce an FRD-gain-of function strain. M. smegmatis has SDH but does not have  16  FRD (http://www.tbdb.org/). If this strain is viable, any differences in susceptibility/resistance to a variety of antimicrobials with various targets will be evaluated using a resazurin-based assay. Furthermore, if there are significant differences in susceptibility/resistance of this M. smegmatis strain, the effect of adding fumarate and/or succinate to skew the equilibrium of FRD and/or SDH, making FRD more/less susceptible, will be evaluated.  17  Chapter 2: Materials and methods 2.1 Mycobacteria M. tuberculosis strain Erdman (Trudeau Mycobacterial Collections (TMC) #107; American Type Culture Collection (ATCC) #35801) and M. tuberculosis H37Rv (TMC#102, ATCC #27294) and M. bovis Bacille de Calmette et Guèrin (BCG) (TMC#1011, ATCC #35734) were grown to late log phase as measured by the optical density (OD) at 580 nm either in an enriched medium, Middlebrook 7H9 (Difco; per 900 mL: 0.5 g ammonium sulfate, 0.5 g Lglutamic acid, 0.1 g sodium citrate, 1.0 mg pyridoxine, 0.5 mg biotin, 2.5 g disodium phosphate, 1.0 g monopotassium phosphate, 0.04 g ferric ammonium citrate, 0.05 g magnesium sulfate, 0.5 mg calcium chloride, 1.0 mg zinc sulfate, 1.0 mg copper sulfate) supplemented with 10% OADC (oleic acid, albumin, dextrose complex; Difco) or a minimal medium, Proskauer & Beck (per 1 L: 5.0 g potassium phosphate, 5.0 g L-asparagine, 0.6 g magnesium sulfate heptahydrate, 1.0 g magnesium citrate, 20 mL glycerol) plus 0.05% Tween-80 at 37°C. For volumes of 100 mL or less, cultures were grown under static conditions with intermittent aeration (every 2 days). For volumes of 100 mL or more, cultures were grown in a roller bottle system (set at 2 rpm). M. smegmatis mc2155 (Trevisan Lehmann and Neuman; ATCC #700084) was grown to late log phase in Proskauer & Beck supplemented with 0.05% Tyloxapol (Sigma) in a shaker system (set at 200 rpm). For M. tuberculosis, BCG and M. smegmatis, cultures were stored at -80°C and tested for viability and bacterial cell concentration by colony forming units (CFU) counts on Middlebrook 7H10 (Difco) agar supplemented with 10% OADC.  18  2.2 Cloning – Mycobacterium tuberculosis Dr. Alice Li, Mrs. Jie Lie and Ms. Sharlene Eivemeark performed the protocols described in section 2.2 that generated the M. tuberculosis H37Rv FRD KO.  2.2.1 Primer design The target FRD DNA sequence plus the 999 bp upstream and downstream flanking sequences was obtained from Tuberculist (http://genolist.pasteur.fr/TubercuList/) and pasted into Oligo 6 (Molecular Biology Insights). The “search” function was used to identify primer pairs for PCR amplification of upstream and downstream flanking sequences of the fumarate reductase operon using the following parameters: primers = 20-25 nucleotides long, stringency = “very high”, left upstream primer = 1-980 bp, right upstream primer = 1050-2000 bp, left downstream primer = 1000bp upstream of the gene ending, right downstream primer = 400-1000 bp. A Van91I restriction site was added to the 5’ end of the primer sequences. Output primers (shown in Table 1) were ordered from Genewiz. The “Clone Manager” feature was used to generate the predicted AES plasmid sequence map.  2.2.2 Allelic exchange substrate (AES) plasmid construction The Advantage 2 DNA polymerase mix kit (BD Biosciences) was used to amplify the upstream and downstream flanks by PCR using the primers described above. Briefly, for each PCR reaction, 40 µL sterile, distilled water, 5 µL 10X BD Advantage 2 PCR Buffer, 1 µL 100 ng/µL M. tuberculosis H37Rv genomic DNA, 1 µL 10 µM forward primer, 1 µL reverse primer, 1µL 50X dNTP mix (10 mM each) and 1µL 50X BD Advantage 2 Polymerase Mix was added.  19  Table 1: Primers used in the PCR amplification of upstream and downstream flanking sequences of the fumarate reductase operon for allelic exchange substrate (AES) plasmid construction. A Van91I restriction enzyme site was added to the 5’ end of each primer (5’CCANNNNNTGG-3’) shown in bold. All primers are written in the 5’ to 3’ direction. Flanking sequence  Sequence  Forward  Upstream  TTTTTTTTCCATAAATTGGGTACTGCTGATCGGGTCGGTGGTCG  Reverse  Upstream  TTTTTTTTCCATTTCTTGGGGTGCGGATTGGTTTCGGCTATCGC  Primer Direction upLLfrd upLRRev dnRLfrd dnRRRev  Forward  Downstream TTTTTTTTCCATAGATTGGCCGAGTGATCGCCCTGTGGTGTTAC  Reverse  Downstream  TTTTTTTTCCATCTTTTGGGGTGAGGCTGGGGAGTATCACGTC  20  PCR conditions were as followed: 95°C for 1 minute, 25 repeats of 95°C for 30 seconds, 65°C for 30 seconds, 72°C for 1 minute. PCR products were stored at -20°C for future use. PCR products were purified using the QIAquick PCR Purification Kit (Qiagen). Briefly, 125 µL PB buffer was added to 25 µL cDNA and then transferred to the column provided. After centrifuging for 1 minute at 13,000 rpm, 500 µL PE buffer was added to wash the column and spun again. 250 µL PE buffer was then added and tubes were spun for 2 minutes. After transferring the column to a clean microfuge tube, 32 µL RNase-free water was added and the columns were spun for 2 minutes. cDNA quality and concentration was assessed using a NanoDrop ND-1000 (Thermo Scientific). Next, 10 µL of purified PCR product and 50 mg of p0004S [71] was digested with Van91I (Fermentas) for 1 hour in a reaction volume of 50 µL. The Van91I-digested p0004S was run on a 1.5% agarose gel and the hygromycin resistance (HygR)/sucrose sensitivity (SacB) (3.68 kb) and origin of replication (OriE) (1.6 kb) fragments were extracted using the QIAquick Gel Extraction Kit (Qiagen). Briefly, 3 volumes of QG buffer was added to 1 volume of extracted gel followed by incubation at 50°C for 10 minutes. At this point, the entire digestion from the upstream and downstream flanking PCR fragments was added to the Van91I-digested p0004S plasmid in QG buffer. Then, 1 gel volume of isopropanol was added and the sample was transferred to a QIAquick spin column. After spinning at 13,000 g for 1 minute, 0.75 mL of PE buffer was added and the sample was spun again. DNA was eluted with 30 µL EB buffer. To ligate the fragments, 2.5 µL 10X ligation buffer and 1.5 µL T4 DNA ligase was added to the digested fragments and followed by incubation at room temperature overnight. E. coli Top10 Chemically Competent cells (Invitrogen) at 109 CFU/mL were then transformed with 2 µL of the ligation mix and plated on Luria-Bertani (LB) agar containing 150 µg/mL hygromycin. 21  Plasmid DNA from 6 colonies was isolated using the QIAprep Miniprep (Qiagen) protocol. Briefly, 5 mL overnight cultures of each transformed E. coli were pelleted at 3700rpm for 25 minutes. Pellets were resuspended in 250 µL P1 buffer and transferred into a microcentrifuge tube. P2 buffer (250 µL) was added after which 350 µL N3 buffer was also added followed by mixing by inversion. Supernatant was collected by centrifuging at 13,000 rpm for 10 minutes and then applied to a QIAprep spin column. Then, 0.75 mL PE buffer was added to wash the column. After centrifuging for 1 minute, the flow-through was discarded and the tube was spun again. Plasmid DNA was eluted using 30 µL sterile, distilled water. DNA sequencing verified of the AES construct.  2.2.3 Phasmid construction To start, 1 µg of AES plasmid and 10 µg phAE159 (from Albert Einstein College of Medicine), a mycobacteriophage, was digested with one unit of PacI (New England Biolabs) at 37°C for 2 hours. For the phAE159 digest only, 0.5 µL of Shrimp Alkaline Phosphotase (SAP) was added for 20 minutes at 37°C followed by incubation for 20 min at 65°C. Ligation of PacIdigested p0004S plasmid and phAE159 was as follows: 2-4 µL ph159, 4-6 µL plasmid, 1 µL 10X T4 ligation buffer, 0.5 µL T4 DNA ligase (400U/µL) and sterile, distilled water up to a final volume of 10 µL. To package the ligated plasmid in vitro in phage, a MaxPlaxTM Lambda Packaging Extracts Kit (Epicentre Biotechnologies) was used. Briefly, 5 µL of the ligation mixture was directly added to MaxPlaxTM Packaging Extract on ice. After incubating at room temperature for a maximum of 2 hours, the reaction was stopped with 400 µL SM buffer and again incubated at room temperature for 30 minutes. Next, 1 mL of chemically competent E. coli HB101 host cells 22  were added directly to the packaging tube and was incubated at 37°C for 1 hour. Then, cells were centrifuged for 1 minute at 13,000rpm and the pellet was resuspended in 1mL fresh LB media. Finally, cells were plated on LB agar supplemented with 150 µg/mL hygromycin and incubated overnight at 37°C.  2.2.4 Phasmid screening Phasmid DNA was isolated as per the QIAprep Miniprep protocol described in Section 2.2.2. Each phasmid was screened using PacI (New England Biosciences) digestion (5µL DNA, 1µL 10X NEB 1, 1µL 10X BSA, 1µL PacI, 2µL sterile, distilled water) and a 1% agarose gel was run to obtain the digestion pattern. To check for the desired phasmid, the digestion pattern of the gel was compared against expected results from the previously constructed clone manager files (Section 2.2.1).  2.2.5 Phage preparation Mid-log (OD600 ~ 0.6) M. smegmatis cells were made electro-competent by sequential centrifugations and resuspentions in 10% glycerol and were stored at -80°C for future use. Then, 5-10 µL of phasmid DNA was electroporated into 400 µL electro-competent M. smegmatis mc2 155 cells using a GenePulser XcellTM (Biorad) set to 1250 V, 25 µF, 1000 Ω. Afterwards, 1 mL 7H9 was added and transformed cells were incubated at 37°C for 1 hour. 10-1 and 10-2 dilutions of the cells were plated onto pre-warmed 7H10 plates and incubated at 30°C for 3 days. To recover phage, 1-2 plaques were cored-out and placed into 200 µL of MaxPlaxTM (Epicentre  23  Biotechnologies) recovery buffer and incubated at room temperature for 1.5 hours. Recovered phage was stored at 4°C for future use.  2.2.6 Preparation of high titre phage lysate To start, 2-5 µL of recovered phage was added to 300 µL mid-log (OD600 ~ 0.6) M. smegmatis mc2155. A second aliquot of recovered phage was diluted 1:5 with MaxPlaxTM (Epicentre Biotechnologies) MP buffer before adding to M. smegmatis mc2155 as above. Each phage-M. smegmatis mixture was diluted 10-1 and 10-2, mixed with 3 mL 42°C molten 7H10 (without Tween-80), poured onto 7H10 plates and incubated at 30°C for two days. Plates with approximately 1000 plaques per plate were selected for their high titre and a PFU/mL (plaque forming units) was determined. MaxPlaxTM MP buffer (5 mL) was added to each plate. Plates were shaken at 4°C overnight and the lysate was collected by centrifugation.  2.2.7 Transduction of M. tuberculosis H37Rv with p0004S M. tuberculosis H37Rv was grown to mid-log phage (OD600 0.8-1.0) in 7H9 (Difco) supplemented with 10% OADC. 10 mL of culture was pelleted at 1200 rpm for 10 minutes at 23°C and resuspended in 10 mL mycobacteriophage buffer (MP: 50 mM Tris, pH 7.6, 150 mM NaCl, 10 mM anhydrous MgCl2, 2mM CaCl2). Cells were pelleted again and resuspended in 1mL MP buffer resulting in approximately 109 CFU/mL. Then, 1 mL of phage lysate (1010 pfu/mL) was added to the culture for a multiplicity of infection (MOI) of 10:1 and then incubated at 37°C. After 24 hours, infected cells were plated on 7H10 agar plates supplemented with 50 ug/mL hygromycin (MP Biomedicals). Plates were incubated at 37°C for three weeks.  24  2.2.8 Isolation of RNA Five colonies were picked off the selective 7H10+hygromycin plates and grown to midlog in 100 mL 7H9 supplemented with 50 ug/mL hygromycin. RNA was extracted as per previously published protocols by Butcher et al.[72]. Briefly, 4 volumes of GTC lysis buffer (per litre: 5 M guanidine isothiocyanate, 14.3 M beta-mercaptoethanol (MP Biomedicals), 3.5 mL Tween-80, 0.25% sodium lauryl sulfate, 25mM tri-sodium citrate) was added to 1 volume culture. After centrifuging at 3700 rpm for 15 minutes at 4°C, the GTC supernatant was discarded and the pellet was resuspended in 1 mL GTC. Cells were transferred into a microfuge tube and centrifuged at 13,000 g for 20 seconds. The pellet was resuspended in 1.2 mL RNApro solution (FastPrep Solutions, MP Biomedicals) and transferred into a 2 mL screw-top microfuge tube containing 1 mL of 0.1 mm ceramic beads (FastPrep Solutions, MP Biomedicals). The tubes were then inserted into the QBiogene ribolyser (MP Biomedicals) set at setting 6.5 W for 45 seconds to mechanically disrupt the mycobacterial cells. After cooling on ice for 1-2 minutes, the slurry was centrifuged for 5 minutes at room temperature at 13,000 g. The supernatant was transferred to a new tube and combined with 300 µL chloroform. After another 5 minute spin at 13,000 g, the aqueous phase was added to 500 µL 96% ethanol and incubated at -80°C overnight.  2.2.9 Purification of mycobacterial RNA The RNA pellets from above were spun down at 13,000 rpm at 4°C for 20 minutes. 500 µL of 75% ethanol and subsequently 500 µL 96% ethanol were added to wash the RNA. After air drying for approximately 5 minutes, the pellets were resuspended in 100 µL RNase-free water and purified using the RNeasy Purification kit from Qiagen. Briefly, RLT buffer was added to each RNA sample and then transferred to the RNeasy filter-column. Columns were centrifuged 25  at 11,000 rpm for 15 seconds and the flow-through was discarded. The DNase I – RDD solution was applied to the columns for 15 minutes for an on-column digestion of genomic DNA. After washing the column with 350 µL RW1 buffer, the columns were spun as previously described and the collection tube was exchanged for a new one. Columns containing bound RNA were washed a final time with 500 µL RPE buffer and 30µL RNase-free water was added. RNA quality and concentration was assessed using a NanoDrop ND-1000 (Thermo Scientific). Purified RNA was stored at -80°C for future use.  2.2.10 RT-PCR RNA (2 ug) was added to RNase-free water for a total volume of 11 µL. Samples were incubated at 95°C for 5 minutes in a Mastercycle Thermocycler (Eppendorf) and then incubated on ice for 5 minutes. For reverse transcription, 5 µL 5x First Strand buffer, 2.5 µL 0.1 M DTT, 2.3 µL 5 µM dNTP mix, 0.7 µL RNase-free water, 1 µL Random Primer and 2.5 µL SSII Reverse Transcriptase was added per reaction. Reactions were incubated at 25°C for 10 minutes, 42°C for 90 minutes and finally 95°C for 10 minutes in a Mastercycle Thermocycler (Eppendorf). After the final cycle, tubes now containing cDNA were incubated at -20°C for future use. cDNA was purified using the QIAquick PCR Purification Kit (Qiagen) using the protocol described in Section 2.2.2.  2.2.11 Confirmation of FRD knock-out using PCR Purified cDNA was first diluted 1:5 in sterile, distilled water. For each reaction, 14 µL sterile, distilled water, 2 µL 10X Magnesium-free PCR buffer (Invitrogen), 0.6 µL 50 µM  26  Table 2: Primers used to confirm the Mycobacterium tuberculosis FRD knock-out. All primers are written in the 5’ to 3’ direction.  Primer  Sequence  FrdA-F  CGATAGCCGAAACCAATCC  FrdA-R  CTGCTCACCTATTCCGACGT  Hyg-F  CACCAACCCCGTACTGGTC  Hyg-R  AGCAGTTCCGGGAAGACCTC  FrdD-F  TCGTAGTGCTGAACGTCGTC  FrdD-R  CAACCCGATCACCAAGCTT  27  MgCl2, 0.4 µL 10 µM forward primer, 0.4 µL reverse primer, 0.4 µL 10 mM dNTP and 0.2 µL Taq polymerase (Invitrogen) was added. Primers sequence is shown in Table 2. The amplification parameters are as follows: 10 minutes at 95°C and 40 repeating cycles of 2 minutes at 52°C, 1 minute at 60°C and 15 seconds at 95°C. Amplicons were visualized on a 1.5% agarose gel with 1% SybrSafe (Invitrogen) and an M. tuberculosis H37Rv FRD knock out strain (FRD KO) was confirmed.  2.2.12 Maintaining stock of M. tuberculosis H37Rv FRD KO The colony corresponding to the confirmed FRD KO was inoculated into 2.5 mL of 7H9 (Difco) supplemented with 10% OADC and 50 µg/mL hygromycin in a 14 mL polystyrene tube. The culture was grown in static conditions (aerated every 3 days) for 2 weeks at 37°C. Then, 1 mL of that culture was added to 23 mL of fresh 7H9 with the above supplements in a T-25 tissue culture flask (BD Falcon) also in static culture conditions. After another two weeks at 37°C, 5 mL of that culture was added to 95 mL 7H9 with the above supplements in a roller bottle and grown aerobically up to OD580 = ~0.8. 1 mL aliquots of the FRD KO were made and incubated overnight at -20°C and then stored at -80°C until future use. CFU counts were performed on one aliquot by first sonicating the cells, to disperse clumps, with a horn sonicator (Sonics and Materials; Danbury, CT) with three 30-second bursts. Then serial dilutions up to 10-6 were plated onto 7H10 agar plates and incubated at 37°C for three weeks. Finally, CFUs were enumerated.  28  2.3 Cloning – Mycobacterium smegmatis 2.3.1 Amplification of the FRD operon from M. tuberculosis H37RV genomic DNA Primers shown in Table 3 were used to amplify the entire FRD operon plus 350 bp upstream of the FrdA start site from M. tuberculosis H37Rv genomic DNA. This was done to ensure that the native FRD operon promoter was included in the construct. TaKaRa LA TaqTM (Takara Bio Inc) was used as it allows for high fidelity amplification for long products, such as the FRD operon (3799bp). Each reaction contained the following: 5 units TaKaRa LA TaqTM, 5 µL 10X LA PCR Buffer II, 5 µL 25 mM MgCl2, 8 µL 10 mM dNTP Mixture, 1µg template, 1.0 µM AclI-FrdA-Forward primer, 1 µM MfeI-FrdD-Reverse primer and sterile, distilled water up to 50 µL. The reaction conditions were 94°C for 1 minute, 30 cycles of 94°C for 30 seconds, 58°C for 1 minute, 72°C for 70 seconds followed by 72°C for 10 minutes. A 1.5% agarose gel visualized with SybrSafe (Invitrogen) was run to confirm specific amplification. The PCR amplicon was purified using the QIAquick PCR Purification Kit (Qiagen) and the protocol described in Section 2.2.2.  2.3.2 Cloning FRD insert into pGEM®-T Easy Vector The purified amplicon was ligated into a pGEM®-T Easy Vector (Promega) using the following parameters: 5 µL 2X Rapid Ligation Butter, T4 DNA Ligase, 1 µL pGEM®-T Easy Vector, 3 µL PCR product, 1µL T4 DNA Ligase and sterile, distilled water up to 10 µL. The insert-vector reaction was incubated overnight at 4°C. Next, the ligated plasmid was transformed into chemically competent E. coli JM109 cells according to manufacturers protocol. Briefly, 2 µL of the ligation reaction was added to 100 µL cells and the mixture was incubated on ice for 20 minutes. The cells were heat-shocked at 42°C 29  Table 3: Primers used to generate the Mycobacterium smegmatis FRDhsp strain. All primers are written in the 5’ to 3’ direction. Engineered restriction digest sites are indicated in bold  Primer  Direction  Sequence  Restriction Site  FrdA  Forward  AATTAACGTTCTACGACGACCTCAAGTTTTCC  AclI  FrdD  Reverse  AATTCAATTGATAGAACCGTTGTGGTGGTACAG  MfeI  30  for 45 seconds after which the tube was immediately placed on ice for 2 minutes. Then, 950 µL room-temperature super optimal broth with catabolite repression (SOC) was added and cells were incubated at 37°C for 1.5 hours with shaking (200 rpm). 100 µL of the transformation culture was plated onto LB agar plates supplemented with 100 µg/mL ampicillin, 0.1M isopropyl β-D-1-thiogalactopyranoside (IPTG) and 50 mg/mL bromo-chloro-indolyl-galactopyranoside (Xgal) and incubated overnight at 37°C. White clones contain inserts in the pGEM®-T Easy Vector and 3 were selected for minipreps. For this, the QIAprep Miniprep (Qiagen) protocol was followed as in Section 2.2.2. All three selected plasmids were sent for sequencing and one plasmid was error-free.  2.3.3 Cloning FRD insert into pMV361 The pGEM®-T Easy plasmid with the error-free insert and the integrative mycobacterial pMV361 vector (from Albert Einstein College of Medicine) was digested with one unit each of AclI and MfeI (New England Biosciences) at 37°C for 1 hour. A 1.5% agarose gel visualized with SybrSafe (Invitrogen) was run and the band at ~3.8 kbp in the pGEM®-T Easy lane (FRD operon insert) was extracted from the gel, along with the linearized pMV361 plasmid. Both the insert and linearized vector were purified using the QIAquick Gel Extraction Kit (Qiagen) as described in Section 2.2.2. The purified insert and linearized vector were ligated together using the Rapid DNA Dephos & Ligation Kit (Roche). Briefly, the linearized vector was dephosphorylated by incubating the following components at 37°C for 10 minutes: 1 µL linearized pMV361, 2 µL 10X rAPid Alkaline Phosphatase Buffer, 1 µL rAPid Alkaline Phosphatase and 6 µL sterile, deionized water. For the ligation, 50 ng Vector DNA, 150 ng insert DNA, 2 µL 5X DNA 31  Dilution Buffer, 10 µL 2X DNA ligation buffer, 1 µL T4 DNA ligase and sterile, deionized water up to 21 µL were mixed thoroughly and incubated at 15°C overnight. The ligation mixture (2 µL) was transformed into E. coli BL21(DE3) chemically competent cells according to the heat-shock protocol described in Section 2.3.2. Note that a pMV361 empty vector control (VC) was also transformed. Next, 100 µL of transformants were plated on LB supplemented with 100 µL ampicillin and incubated at 37°C overnight. The QIAprep Miniprep (Qiagen) protocol (as described in Section 2.2.2) was performed on 3 selected colonies of both the ligated plasmid and VC. Another AclI/MfeI digestion was performed and a 1.5% agarose gel was run (as described in Section 2.3.3) to check for the presence of insert in the pMV361 vector or absence in the VC. Of the ligated plasmid, three colonies had a ~3.8 kbp insert so one clone was named pMV361:FrdABCD and selected for future work. See Figure 2 and Supplementary Figures 1 and 2 for a description of the pMV361:FrdABCD plasmid map and sequence.  2.3.4 Transformation of M. smegmatis mc2155 with pMV361:FrdABCD and empty vector control Electrocompetent M. smegmatis mc2155 (100 µL) were electroporated with 5 µL pMV361:FrdABCD or as described in Section 2.2.5. Transformants were plated on 7H10 agar plates supplemented with 50 µg/mL kanamycin (Sigma) and incubated for 3 days at 37°C.  2.3.5 Isolation of M. smegmatis genomic DNA Three pMV361:FrdABCD- and VC-transformed M. smegmatis colonies were selected from the 7H10 plates described above and grown in 7H9 media plus 50 µg/mL kanamycin for 3 32  Figure 2: Upstream cloned section of pMV361:FrdABCD highlighting the Hsp60 -35 and 10 sites as well as the putative Frd promoter and FNR binding site. Shown above is 4021 – 4560 bp of pMV361:FrdABCD. Refer to Supplementary Figures 1 and 2 for the complete plasmid map and sequence. The AclI cut site is 317bp downstream from the C-terminus of the int gene. The FNR consensus sequence in E. coli is TTGATNNNNATCAA [54]  33  days. A culture of wild-type M. smegmatis grown in 7H9 alone was also included in this procedure. Genomic DNA was extracted using the Illustra Bacteria GenomicPrep Mini Spin Kit (GE Healthcare). Briefly, 1 mL of culture was centrifuged for 30 seconds at 16,000 g and 40 µL Lysozyme buffer was added. Lysozyme (10 µL, 10 mg/mL) was added to the sample and incubated at room temperature for 10 minutes. Next, 10 µL 20mg/mL Proteinase K was added and the sample was incubated at 55°C for 15 minutes. RNA was removed by incubating the sample with 5 µL 20 mg/mL RNase A for 15 minutes. Then, 500 µL of Lysis buffer type 4 was added and the sample was incubated at room temperature for 15 minutes. The sample was added to a column provided in the kit and spun for 1 minute at 11,000 g. The flowthrough was discarded and 500 µL of Lysis buffer type 4 was added to the column. After spinning again for 1 minute at 11,000 g, 500 µL of Wash buffer type 6 was added to the column and the sample was centrifuged for an additional 3 minutes. 200 µL of Elution buffer type 5 was added to the column and the sample was incubated at room temperature for 1 minute. Finally, the column was centrifuged for 2 minutes to recover purified genomic DNA, which was stored at -20°C until future use.  2.3.6 Confirmation of successful M. smegmatis transformation with pMV361:FrdABCD Primers and PCR conditions described in Section 2.3.1 were used to amplify the FrdABCD operon from the isolated M. smegmatis genomic DNA described above. A positive control of M. tuberculosis H37Rv genomic DNA was included in this PCR reaction. Amplicons were run on a 1% Agarose gel visualized with SybrSafe (Invitrogen). This confirmed the presence of the FRD operon in M. tuberculosis genomic DNA and in the M. smegmatis strain  34  transformed with pMV361:FrdABCD. This confirmed strain was given the name M. smegmatis mc2155 plus Fumarate Reductase (FRDhsp). Freezer stock vials of each strain (wild-type (WT), VC and FRDhsp) were prepared by growing the cultures to late-log phase (OD600 ~0.8) in Proskauer and Beck, shaking (200 rpm) at 37°C. One mL aliquots were made and incubated at -20°C overnight, and then stored at -80°C. Viable counts were determined by thawing an aliquot, serial diluting them 10-1 to 10-6, plating on 7H10 agar plates, incubating at 37°C for 3 days and enumerating the resulting colonies.  2.4 Growth/viability of mycobacteria 2.4.1 Growth in aerobic conditions M. tuberculosis H37Rv and FRD KO stocks of known CFU/mL were thawed, syringed 10 times using a 25-gauge blunt-end needle to disperse clumps and diluted to ~104 CFU/mL in 7H9 media [73]. To monitor growth via optical density, 1 mL of culture was transferred to a cuvette and OD580 was measured. To monitor growth via colony forming units, 1 mL of culture was sonicated for three 30-second bursts in a horn sonicator (Sonics and Materials; Danbury, CT) to disperse clumps and plated on 7H10 [73]. CFUs were enumerated as described in Section 2.2.11. CFUs and OD was determined for both strains every 2 days for 14 days. M. smegmatis mc2155 wild type (WT), VC and FRDhsp of known CFU/mL were thawed and diluted to ~104 CFU/mL in Proskauer and Beck supplemented with 0.05% Tween-80 in the presence or absence of 0.3 M sodium fumarate (Sigma). Then, 200 µL of each strain and media condition was plated in octuplicate in a Honeycomb plate (Oy Growth Curves Ab Ltd) and OD600 was measured every 3 hours for 5 days in Bioscreen-C Automated Growth Curve Analysis System (Oy Growth Curves Ab Ltd). 35  2.4.2 Viability in hypoxic conditions M. tuberculosis H37Rv and FRD KO stocks of known CFU/mL were thawed, syringed 10 times using a 25-gauge blunt-end needle and diluted down to ~104 CFU/mL in either 7H9 (Difco) supplemented with 10% OADC or in Proskauer and Beck supplemented with 0.05% Tween-80, both with or without 0.3 M sodium fumarate (Sigma). M. smegmatis mc2155 wild type (WT), VC and FRDhsp of known CFU/mL were thawed and diluted to ~104 CFU/mL in Proskauer and Beck in the presence or absence of varying concentrations of sodium fumarate (Sigma). Then, 10 mL of each diluted culture was added to a plastic 16 x100 mm round bottom Vacutainer® tube (BD Biosciences) with a tight-fitting rubber cap. 1.5 ug/mL of methylene blue (Sigma) was added to a control tube for each condition. Tubes were incubated statically (without aeration) for the M. tuberculosis strains and shaking at 200 rpm for the M. smegmatis strains at 37°C until the blue methylene blue color becomes colorless. This indicates that the oxygen has been depleted [74]. The day of methylene blue depletion was set as “Day 0” and the cells were incubated further in hypoxic conditions for 21 or 7 days (for M. tuberculosis and M. smegmatis strains, respectively) CFUs were then enumerated as per Section 2.2.11 and 2.3.6).  2.5 Infection of murine bone marrow-derived macrophages (BMMΦ) with M. tuberculosis H37Rv and FRD KO 2.5.1 BMMΦ cell culture BMMΦs were prepared from 6-24 week old, female, CD1 mice (Charles River Laboratories; Wilmington, MA) maintained at the Child & Family Research Institute (CFRI) Animal Care Facility according to the Canadian Council on Animal Care and UBC standards. To acquire BMMΦ, mice were euthanized via cervical dislocation and bone marrow was extracted 36  from the femurs by flushing out the dissected bones with complete RPMI medium (RPMI 1640 medium (Gibco, Grand Island, NY), 10% heat inactivated fetal calf serum (Gibco), 10% L929 cell medium, 2 mM glutamine, 1 mM sodium pyruvate). The L929 cell medium was obtained by growing L929 cells in RPMI supplemented with 10% heat inactivated fetal calf serum, 2 mM glutamine for approximately 3 days and filtering the supernatant. This supernatant provides a source of murine monocyte-colony stimulating factor (M-CSF), which is essential for the differentiating monocytes into MΦs. Red blood cells in the bone marrow extract were lysed with 0.17 M NH4Cl for 3 minutes. Remaining cells were pelleted at 1100 g for 3 minutes at 15°C, resuspended in 10 mL RPMI and then transferred into a T150 tissue culture flask (BD Falcon). The flask was incubated at 37°C/5% CO2 for 4 hours to allow for cell recovery and to remove any adherent cells such as mature MΦs and fibroblasts. Next, non-adherent cells were quantified using a hemocytometer and seeded on 12 mm acid-washed glass coverslips in 24-well tissue culture plates at 2.5 x 105 cells in a final volume of 1 mL complete RPMI. Plates were incubated at 37°C/5% CO2 for 5 days at which point an additional 0.5 mL complete RPMI was added. After incubating for an additional 2 days, the bone marrow has differentiated into BMMΦs and these were ready for subsequent use.  2.5.2 Preparation of BMMΦs and mycobacteria for infection After removing the supernatant, cells were washed twice with 0.5 mL phagocytosis media (138 mM NaCl, 8.1 mM Na2HPO4, 1.5 mM KH2PO4, 2.7 mM KCl, 1.0 mM MgCl2, 5.5 mM D-glucose). Then, 0.25 mL of phagocytosis media was added and cells were allowed to equilibrate at 37°C/5% CO2 for 10 minutes. Meanwhile, M. tuberculosis H37Rv and FRD KO 37  stocks of known CFU/mL were thawed on ice and spun at 13,000 g for 5 minutes. The pellet was resuspended in 1mL phagocytosis media and syringed 10 times using a 25-gauge blunt-end needle.  2.5.3 Mycobacterial infection of BMMΦ Syringed M. tuberculosis H37Rv and FRD KO was diluted in phagocytosis media such that a multiplicity of infection (MOI) of 60 bacteria per 1 MΦ is achieved. Next, 0.25 mL of diluted M. tuberculosis H37Rv and FRD KO was added to the MΦ monolayers and plates were gently mixed in a Nutator® (TCS Scientific Corporation) three dimensional rotating rocking mixer at 37°C/5% CO2 for 1 hour and then left static for an additional 2 hours. After three washes with phagocytosis media to wash away free mycobacteria, 1 mL incomplete RPMI (complete RPMI minus the L929 cell medium) was added. Plates were incubated at 37°C/5% CO2 until future use. This procedure resulted in an average infection rate of 1 bacterium per MΦ. To assess bacterial viability after 0 and 4 days, 1 mL phagocytosis media was added to each well and monolayers were sonicated three times for 10 seconds each using a multi-probe sonicator. Enumeration of released bacteria was performed by plating 100 to 10-3 dilutions onto 7H10 agar plates supplemented with 10% OADC.  2.6 Resazurin assay for cell viability 2.6.1 MIC of antimicrobials and putative FRD inhibitors in aerobic conditions Table 4 and 5 displays the antimicrobials and FRD inhibitors tested using this assay along with the minimal inhibitory concentration (MIC) previously determined for each [Ramón-García  38  et al., unpublished data]. Concentrated stock solutions for each antimicrobial was made at 64x the MIC listed in Table 4 and 100 µL of each was added to a 96-well plate. Next, ten two-fold serial dilutions were performed for each antimicrobial. M. tuberculosis H37Rv WT and KO, M. tuberculosis Erdman and M. smegmatis WT, VC and FRDhsp were diluted to ~2 x 104 CFU/mL in Proskauer and Beck supplemented with 0.05% Tween-80 as described in Section 2.4.1 and 100 µL of bacteria was added to each well (except for the negative control). Cultures were incubated at 37°C for 48 hours at which point 25 µL 10 mg/100 mL resazurin (Sigma) was added. Reduction of resazurin (blue) to resorufin (pink) occurs in the presence of metabolic products, such as NADH, from living cells. If an FRD inhibitor is active against Mtb, fewer metabolic by-products will be produced and the more “blue” resazurin will be. Conversely, if an FRD inhibitor is not active against Mtb, metabolic by-products will be produced and the more “pink” resazurin will be. For M. tuberculosis, Abs570 and Abs600 were measured at 48 hours post-resazurin addition. Percent resazurin reduction was determined using the following calculation: [(Ox600)(A570) – (Ox570)(A600)] / [(Red570)(A600) – (Red600)(A570)] x100. A570/A600 = absorbance at 570 nm and 600 nm. Extinction coefficients are as follows: lower oxidized wavelength (Ox570) = 80586, upper oxidized wavelength (Ox600) = 117216, lower reduced wavelength (Red570) = 155677, upper reduced wavelength (Red600) = 14652. Then, the contents of each well were plated on 7H10 agar plates and incubated for 21 days at 37°C to assess bacterial cell viability. The MIC was set at the concentration at which the percent reduction was less than 20%. For M. smegmatis, the MIC was defined as the last concentration at which resazurin remained blue and was determined 24 hours post-resazurin addition. The resazurin assay was also used to determine the MIC of putative FRD inhibitors  39  (Table 5) on mammalian cells. Murine bone marrow-derived MΦs (BMMΦs) were exposed to each FRD inhibitor at each concentration used in the M. tuberculosis-based experiment above. Cell viability was evaluated after 72 hours using the same colorimetric resazurin assay described above.  2.6.2 Checkerboard assay To assess the effectiveness of various antimicrobials in the presence or absence of fumarate or succinate, 256-fold MIC stock antimicrobials listed in Table 4 were first diluted 2fold in a 96-well plate from left of the plate to right of the plate as described in Section 2.6.1. Then, 5 M stock sodium fumarate (Sigma) and sodium succinate (Sigma) were diluted two-fold 7 times from the bottom of the plate to the top of the plate. M. smegmatis WT, VC and FRDhsp were diluted to ~104 CFU/mL in Proskauer and Beck as described in Section 2.4.1 and 100 µL of diluted bacteria was added to each well. Resazurin was added and MICs were determined as per Section 2.6.1. Synergy is presented as the fractional inhibitory index (FIC) as described by Stevens et al., 1998.  2.7 Effectiveness of putative FRD inhibitors in aerobic and hypoxic conditions M. tuberculosis H37Rv and M. bovis BCG were diluted to ~104 CFU/mL in 7H9 supplemented with 10% OADC as described in Section 2.4.1. Hypoxic cultures were set up as per Section 2.4.2. A 8 mm x 1.5 mm Spinbar® magnetic stirring flea (Sigma) was added to the M. bovis BCG samples and the cultures were incubated at 37°C on a Variomag Poly 60 Multipoint Stirrer (Thermo Scientific) at 100 rpm for 21 days. In parallel, M. tuberculosis cultures were incubated statically at 37°C for 14 days. Following the hypoxic incubation, 40  Table 4: Complete list of antimicrobials used in resazurin MIC assays. Minimal inhibitory concentration (MIC) refers to previously determined values for M. smegmatis [Ramón-García et al., unpublished data]. All compounds were purchased from Sigma unless otherwise noted. Antimicrobial Amikacin Azithromycin Bacitracin Cadmium acetate Capreomycin Chloramphenicol Chlorpromazine Clarithromycin (LKT) Clofazamine D-cycloserine Diamide Erythromycin Ethambutol Fusidic Acid Gatifloxacin (LKT) Imipenem (Molekula) Isoniazid Mitomycin Moxifloxacin (LKT) Novobiocin Ofloxacin Rifampin (Fisher) Roxithromycin Spectinomycin Spiramycin (TLI) Streptomycin Tetracycline Thimerosal Thioridazine Triclosan Vancomycin  MIC (µg/mL) 0.06 4 512 0.015 0.25 40 32 4 3.2 32 64 32 0.25 8 0.04 2 2 0.125 0.04 0.5 0.5 4 16 64 4 0.1 0.12 0.1 16 4 2  41  Table 5. Complete list of putative FRD inhibitors used in resazurin and hypoxic MIC assays. Minimal inhibitory concentration (MIC) refers to previously published/determined values. Antimicrobial  Supplier  MIC (µg/mL)  Reference  Organism Used  Albendazole  MP Biomedicals  0.15 – 0.4  [75,76,77,78]  Moniezia benedeni, Ascaris suum, Trichinella spiralis  Benzimidazole  MP Biomedicals  0.42 – 0.84  [75,79,80]  Moniezia benedeni, Haemonchus contortus, Ascaris suum  Chloroquine  MP Biomedicals  1.9 – 5.0  [81,82]  Plasmodium falciparum, Ascaris suum  Levamisole  MP Biomedicals  300 – 800  [82]  Ascaris suum  MPNO-Na+  Sigma  1.5 – 30.0  [83]  Trypanosoma cruzi  MPNO-Zn2+  Sigma  1% to 2% (w/v)  [84]  Pseudomonas aeruginosa  Praziquantel  MP Biomedicals  160 – 320  [82]  Ascaris suum  Stearyl thiohydroxamic ester  CDRD  1.5 – 30.0  [85]  Trypanosoma cruzi  Thiabendazole  MP Biomedicals  150 – 1000  [82]  Ascaris suum  42  a viable count was performed (see Section 2.2.11) to assess bacterial cell numbers prior to putative FRD inhibitor treatment. Putative FRD inhibitors at various concentrations (described in viable count of remaining bacteria was performed after 0, 1, 4, 7 and 14 days for M. tuberculosis and at 7 days for M. bovis BCG. Cells were enumerated after incubation at 37°C for 21 days.  2.8 Statistical analysis Data are expressed as the mean ± standard error of the mean (SEM). When applicable, the Student’s unpaired t-test was performed. All statistics were evaluated using GraphPad Prism, version 5.0 for Mac OS X (GraphPad Software, San Diego, CA).  43  Chapter 3: Evaluation of fumarate reductase and it role in Mycobacterium tuberculosis virulence and drug susceptibility in Mycobacterium smegmatis 3.1 Introduction Previous research indicated the possibility that FRD acts as an M. tuberculosis virulence factor because it is rapidly upregulated following entry into MΦs [43]. One of the best ways to evaluate the specific role of a gene in an organism is to generate a strain without that particular gene. This gene knock out (KO) strain can then be compared to the parent, wild type (WT) strain and any phenotypic differences between the two can be attributed to the lack of the specific gene. Since M. tuberculosis has a slow growth rate and inefficient DNA uptake (as well as a high frequency of illegitimate recombination), generating a knock out strain can be challenging. As such, methods to overcome this have been developed. For example, the generalized transduction method was chosen to generate the FRD operon KO in the experiments described below. Specialized transduction is based on the natural exchange of DNA from phage to the bacteria and can be exploited to deliver specific DNA sequence to a specific genomic location [86]. For example, mycobacteriophage phAE159 is a conditionally replicating vector that fails to grow at 37°C. phAE159 is a derivative of phAE87 engineered to permit a larger cloning capacity. phAE87 in turn is a derivative of the mycobacteriophage PH101 (ts) [86]. phAE159 was used to specifically knock out the FRD operon by replacing it with a DNA cassette containing hygromycin resistance and sucrose sensitivity. However, gene knock-outs can be complicated by the fact that removing or replacing this particular gene may result in unwanted effects on the transcription of downstream genes. For example, if the gene of interest is part of a multi gene operon, then its removal might also impact the expression of downstream genes. Furthermore, mycobacteria are notorious for their high 44  frequency of illegitimate recombination, the process by which DNA sequences without extensive homology are joined, thereby generating random spontaneous mutations [87,88]. If there were genetic differences between the KO and the WT, it would be very difficult to know exactly what contributed to the phenotypic differences. As such, complementation is required as a control. For this, the KO is transformed with a copy of the WT gene, usually in plasmid form. If the WT copy of the gene can restore the KO phenotype back to that of WT, then it can be assured the differences seen in the KO are due to the targeted gene (or genes within a polycistronic cluster) and not to spontaneous mutations at other sites in the genome or polar effects on the expression of downstream genes. For mycobacteria, two plasmids are commonly used in gene knock out studies: pMV361 (an integrative vector) and pMV261 (an extrachromosomal vector). Both vectors provide kanamycin resistance (aph), the E. coli origin of replication (oriE) and the mycobacterial hsp60 promoter. pMV361 has elements for integration (attP, int genes), which will bind and insert into the attB site of the mycobacterial genome [89,90]. pMV261 has a mycobacterial plasmid origin of replication (oriM), which allows for multiple extrachromosomal copies [89]. For complementation, the entire FRD operon as well as approximately 350 bp of upstream sequence was cloned into pMV361 downstream of the Hsp60 promoter provided by the plasmid. Even though this plasmid has been engineered, complementation studies were not performed since access to a Containment Level 3 Laboratory was limited. However, experiments described below were performed with WT and the FRD KO and these data are not conclusive until the experiments are repeated with the complemented strain.  45  3.2 Rationale The goal of the following experiments was to determine whether or not FRD is in fact an M. tuberculosis virulence factor. For this purpose a FRD knock out strain was generated for evaluating viability in a MΦ infection model. If the FRD KO indeed shows decreased viability, the possibility of using FRD inhibitors as a novel treatment for tuberculosis will be determined. Due to the unavailability of a Containment Level 3 Laboratory, studies involving an M. tuberculosis FRD complemented strain were not possible. Instead, M. smegmatis was used to further the FRD story. This was accomplished by introducing the M. tuberculosis FRD operon to M. smegmatis via electroporation. M. smegmatis was grown in aerobic and hypoxic conditions in the presence and absence of fumarate. Furthermore, the minimal inhibitory concentration (MIC) of a variety of antibiotics against each M. smegmatis strain in the presence or absence of fumarate and succinate was determined using the resazurin assay.  3.3 Results – Evaluation of fumarate reductase and it role in Mycobacterium tuberculosis virulence 3.3.1 Growth and viability of Mycobacterium tuberculosis WT and FRD KO in liquid culture Growth and viability in aerobic cultures and viability in hypoxic cultures of M. tuberculosis WT and FRD KO was determined using CFUs and OD580nm as outlined in Section 2.4. As seen in Figure 3, in aerobic conditions the FRD KO appears to grow like WT, according to both CFUs and OD580nm. Of importance, while the cultures were grown in 7H9 medium, an aliquot of FRD KO was plated on 7H10 agar plates containing hygromycin (Figure 3b). This was done because in the FRD KO, a hygromycin resistance cassette replaces most of the frdABCD 46  operon. Since the CFU counts were similar for FRD KO plated in the presence and absence of hygromycin, it appears that the mutation is stable over time in the absence of selective media. The colony morphology of the FRD KO was the same as WT when plated on 7H10 agar (data not shown). Incubating M. tuberculosis WT and FRD KO in the presence or absence of fumarate in hypoxic and aerobic conditions tested the effect of fumarate on cell viability. The defined, minimal Proskauer & Beck (PB&T) media was used. Figure 4 shows that both WT and FRD KO were viable in aerobic conditions in the presence and absence of fumarate. Neither the WT nor the FRD KO were viable in hypoxic conditions without fumarate as indicated by low CFUs. However, viability of the WT was greater in hypoxic conditions when in the presence of fumarate than was the FRD KO. This indicated that the FRD knock-out is unable to use the fumarate as a terminal electron acceptor in hypoxic conditions, whereas the WT could.  3.3.2 Putative FRD inhibitors show little to no cytotoxic effect on mammalian cells For clinical purposes, the concentration of a FRD inhibitor required to kill M. tuberculosis must have no significant toxic effects on the host cell at therapeutic concentrations. Since FRD is absent in mammalian cells, any FRD-specific inhibitor should have little or no cytotoxic effect on the mammalian cells. Therefore, the concentration at which each putative FRD inhibitor is cytotoxic to mammalian cells was evaluated. BMMΦs were exposed to each FRD inhibitor at each concentration used in the bacteria-based experiment above. Table 6 summarized the MIC observations. Over three biological replicates in triplicate, the following observations were made: (1) the most effective way to solubilize thiabendazole is with organic solvents. As such, the efficacy of this drug might be confounded by the toxicity of the organic 47  M. tuberculosis: WT versus FRD KO in PB&T (OD580) (a)  OD580  0.6  WT KO  0.4  0.2  0.0  0  5  10  15  Day  M. tuberculosis: WT versus FRD KO in PB&T (CFU counts) (b) Log(CFU/mL)  10  WT KO KO(H)  9 8 7 6  0  2  4  6  8  10  Day  Figure 3: Aerobic growth kinetics of Mycobacterium tuberculosis H37Rv wild-type (WT) and FRD knock-out mutant (KO) are similar. Both strains were grown in 7H9 for 14 days, aerating every 2-3 days. Note that the FRD knock-out mutant has a hygromycin resistance cassette. At each time point, the OD580nm was measured (a) and a viable CFU/mL count was performed (b). Another aliquot of FRD knock-out mutant was also plated on 7H10+hygromycin (KO(H)) to ensure that the mutation is stable over time without selective pressure, which it appears to be. This experiment was performed once in duplicate.  48  Microaerophilic Growth in PB&T (b)MtbH37Rv and FRD KO: 21 Days Hypoxic 10  8  8  O  D ay  21  K  21  0  21  D ay  21  D ay  O 0  K D ay  ay  0 D  D ay  D ay  D ay  0  W T  0  W T W T D + 2 ay 1 0. K 3M 21 O Fu K O m +0 ar .3 at M e Fu m ar at e  2  W T  2  W T W T D + 2 ay 1 0. K 3M 21 O Fu K O m +0 ar .3 at M e Fu m ar at e  4  0  4  6  D ay  6  ay  Log(CFU/mL)  10  D  Aerobic MtbH37Rv and FRD KO: 21 Days Aerobic Growth in PB&T  Log(CFU/mL)  (a)  Figure 4: Fumarate maintains viability of Mycobacterium tuberculosis H37Rv (WT) but not FRD knock-out mutant (KO) in hypoxic conditions after 21 days. WT and KO strains were grown in Proskauer & Beck medium supplemented with 0.05% Tween-80 for 21 days in either an aerobic (a) or hypoxic (b) environment at which point a viable CFU/mL count was performed. The bold line at 2 indicates the limit of reliability for CFU/mL counts. This experiment was performed once in duplicate.  49  Table 6: All putative FRD inhibitors tested show little to no cytotoxic effect to BMMΦs as determined via a resazurin assay. MPNO (Mercaptopyridine-N-Oxide). “-“ denotes a FRD inhibitor that remained non-toxic to macrophages at every concentration tested.  FRD Inhibitor  Common concentration range used in helminth or protozoan infection (µg/mL)  Concentration lethal to MØs (µg/mL)  Albendazole  0.15 – 0.4  -  Benzimidazole  0.42 – 0.84  -  Chloroquine  1.9 – 5.0  350  Levamisole  300 - 800  -  MPNO  2.4 – 32.2  670  Praziquantel  160 - 320  1600  Thiabendazole  150 - 1000  Insoluble  50  solvent carrier; (2) albendazole, benzimidazole and levamisole appear to be non-toxic to mammalian cells at all concentrations tested (resazurin was reduced to resorufin in all conditions); (3) chloroquine, MPNO and praziquantel were non-toxic until concentrations were at least 100-fold greater than the highest published value for use to treat a nematode or a protozoan infection.  3.3.3 Mycobacterium tuberculosis FRD KO has an intra-MΦ survival defect Since M. tuberculosis is thought to be in a functionally hypoxic state when exposed to the phagosome within a MΦ [30], it follows that FRD could be a component required for energy acquisition in such an environment and is required for intra-MΦ survival. This effect is seen in Figure 5, where the FRD KO has a 0.774 log10 reduction in CFUs at Day 4 post BMMΦ infection (P<0.005). This indicates that the FRD KO is less adept at surviving in the MΦ relative to the WT at day 4 post infection.  3.3.4 The drug susceptibility profile of the Mycobacterium tuberculosis FRD KO is similar to WT in aerobic conditions The resazurin viability assay was used to determine whether loss of FRD affected susceptibility or resistance to the commonly used anti-mycobacterial drugs isoniazid, rifampin and ethambutol (see Section 2.6.1). Mercaptopyridine-N-oxide (MPNO), a putative FRD inhibitor, was also used and is more thoroughly evaluated in Section 3.3.5. It can be seen in Figure 6 that the FRD KO has a drug susceptibility profile similar to that of the WT for the four drugs tested. Note that the MIC was set as the last concentration to give a percent reduction less than 20%, corresponding to 51  7  *  Log(CFU/mL)  6  WT KO  5 4 3 2 1 0  * = P < 0.005 0  4  Day  Figure 5: Intra-MΦ growth defect of FRD knock-out mutant (KO) relative to Mycobacterium tuberculosis H37Rv wild-type (WT). Murine bone marrow-derived MΦs were infected with either WT or KO at an MOI of 60:1 and the extracellular bacteria were washed away. This resulted in an infection of approximately 1 intracellular bacterium per MΦ. At days 0 and 4, the MΦs were sonicated and the remaining intracellular bacteria were plated on 7H10. This experiment was performed in triplicate over four biological replicates. An unpaired ttest compared fold increase of WT to KO after Day 4.  52  (a)Isonaizid: MtbH37Rv WT vs. FRD KO MIC (48 Hours) 70  70  WT KO  50 40 30 20  40 30 20  0  4. 0.0 90 0 0e 0 -0 04 0. 00 1 0. 00 2 0. 00 4 0. 00 8 0. 01 6 0. 03 1 0. 06 3 0. 12 5  0. 00 0 0. 00 4 0. 00 8 0. 01 6 0. 03 1 0. 06 3 0. 12 5 0. 25 0 0. 50 0 1. 00 0  10  0  Isoniazid (ug/mL) [INH] ug/mL  [RIF] (ug/mL)  Rifampin (ug/mL)  (c)  Ethambutol: MtbH37Rv WT vs. FRD KO MIC (48 Hours)  (d)  MPNO-Na+: MtbH37Rv WT vs. FRD KO MIC (48 Hours) 70  WT KO  40 30 20  50 40 30 20  0  0 0. 00 0 0. 07 5 0. 15 0 0. 30 0 0. 60 0 1. 20 0 2. 40 0 4. 80 0 9. 60 19 0 .2 00  10  0. 0 0. 5 1. 0 2. 0 4. 0 8. 0 16 .0 32 .0 64 .0 12 8. 0  10  [EMB] (ug/mL) Ethambutol (ug/mL)  WT KO  60  % Reduction  50  % Reduction  50  10  60  WT KO  60  % Reduction  60  % Reduction  (b) Rifampin: MtbH37Rv WT vs. FRD KO MIC (48 Hours)  [MPNO-Na+] (uM)(uM) MPNO-Na+  Figure 6: Mycobacterium tuberculosis H37Rv (WT) and FRD knock-out mutant (KO) show a similar drug susceptibility profile in the minimal medium Proskauer and Beck in aerobic conditions. The resazurin assay was used to determine bacterial viability after treatment with different concentrations of (a) Isoniazid, (b) rifampin, (c) ethambutol or (d) MPNO-Na+. Both strains were incubated with each drug for 24 hours at which point resazurin was added. The resulting color was measured at 48 hours post drug addition. The coloured line on the x-axis depicts the color of resazurin as seen in each well of the 96-well plate. The arrow denotes the concentration at which CFUs where no longer seen after plating on 7H10 plates from cultures grow in 7H9 supplemented with 10% OADC. This experiment was performed once in duplicate.  53  the lowest concentration at which resazurin remained blue and the concentration at which no bacteria grew on 7H10 plates.  3.3.5 FRD inhibitors in the MPNO family are effective at reducing mycobacterial cell viability in hypoxic conditions Inhibition of FRD should prevent anaerobic respiration of M. tuberculosis (using fumarate) within the host MΦ environment with detrimental effects on M. tuberculosis survival. To investigate this possibility, 7 commonly used anti-helminth and anti-protozoan putative FRD inhibitors: albendazole, benzimidazole, chloroquine, levamisole, MPNO-Na+, praziquantel and thiabendazole were employed. Preliminary experiments were performed in aerobic conditions using M. tuberculosis Erdman as described in Section 2.6.1. As seen in Figure 7, the only FRD inhibitor to prevent M. tuberculosis Erdman from reducing resazurin to resorufin and from growing on 7H10 plates is MPNO-Na+ at 0.5 and 1 µg/mL, similar to the published inhibitor concentration (assayed using M. tuberculosis)[43]. Note that MPNO-Na+ is also effective at 250, 375 and 500 µg/mL but not effective between 5 and 175 µg/mL. While MPNO-Na+ is thought to be a FRD inhibitor, it also has other actions such as inhibiting membrane transport and protein synthesis in fungi [91]. The data supports a model involving two independently regulated resistance systems. Perhaps at low concentrations of MPNO-Na+, a sensitive regulatory protein activates a system that confers resistance to low levels of drug. When the concentration of MPNO-Na+ reaches 0.5 or 1 µg/mL, this resistance system is overwhelmed and the organism becomes nonviable. When the concentration of MPNO-Na+ is increased even further, a second regulatory protein that responds only to higher concentrations of drug, upregulates a second, more effective resistance system. Increasing the concentration of MPNO-Na+ to 250 µg/mL 54  overwhelms the second resistance system and the organism becomes susceptible again. This would give rise to the bimodal-like response seen in Figure 7e. M. tuberculosis Erdman treated with the other FRD inhibitors had a resazurin reduction pattern similar to untreated M. tuberculosis Erdman with similar CFUs on 7H10 plates at each concentration. Note that FRD is required for survival in hypoxic conditions, similar to the low oxygen environment of the MΦ where M. tuberculosis resides during an infection (See Figure 4). It is likely that M. tuberculosis growth inhibition by the other FRD inhibitors was not observed because the experiment was performed in aerobic conditions. If oxygen is abundant, M. tuberculosis would not need to upregulate an enzyme required to survive in hypoxic conditions. If FRD is not upregulated, then the FRD inhibitor would not have a target and would be ineffective. As such, a similar experiment to the one described above evaluated FRD inhibitors in hypoxic conditions as in Section 2.7. Shown in Figure 8, MPNO-Na+ and two derivatives, MPNO-Zn2+ and STHE were effective in reducing CFUs in both aerobic and hypoxic conditions. Even though FRD is thought to be upregulated only in hypoxic conditions, these putative FRD inhibitors were effective in both aerobic and hypoxic conditions. This supports the hypothesis that these FRD inhibitors are not specific to fumarate reductase and have other targets that are not dependent on the presence or absence of oxygen. Also note that the drugs appear to be less efficient in hypoxic conditions than in aerobic conditions. Perhaps the hypoxic cells are in a stationary phase, having a slower basal metabolic rate and corresponding lower MIC [92]. The inhibition might be less in hypoxic conditions, giving the appearance of a less efficient drug.  55  Albendazole: Mtb H37Rv MIC 50  (b)  50  % Reduction  40  (d)  60  % Reduction  40  20  40  20  0  50 10 0 17 5 25 0 30 0 50 0  2 10 20  1  0 0. 2  0 5 10 50 10 0 25 0 50 0 75 10 0 0 15 0 0 20 0 00  % Reduction  50  Levamisole:[Benzimidazole] Mtb H37Rv MIC (24 Hours) (ug/mL)  0  [CHL] (ug/mL)  [LEV] (ug/mL)  Praziquantel: Mtb H37Rv MIC (24 Hours)  MPNO-Na+: Mtb H37Rv (ug/mL) MIC (24 Hours) [Chloroquine]  (e)  25  [BDZ] (ug/mL)  [ABZ] (ug/mL)  60  5  0 0. 01 0. 05 0. 1 0. 5  50  25  0  5  0 10  10  1  10  Chloroquine: Mtb H37Rv (ug/mL) MIC (24 Hours) [Albendazole]  (c)  20  10  20  30  1  30  0 0. 01 0. 05 0. 1 0. 5  % Reduction  40  1  (a)  Benzimidazole: Mtb H37Rv MIC (24 Hours)  [Levamisole] (ug/mL)  (f)  60  50  % Reduction  % Reduction  40 40  20  30 20 10  0  [MPNO] (ug/mL) [MPNO-Na+] (ug/mL)  10 0  50  10  5  1  0. 5  0  5 10 50 10 0 17 5 25 0 37 5 50 0  1  0 0. 1 0. 5  0  [PZQ] (ug/mL)(ug/mL) [Praziquantel]  Figure 7: Effect of FRD inhibitors on Mycobacterium tuberculosis Erdman in aerobic conditions. Resazurin was added to cultures after 24 hours treatment with each FRD inhibitor at the indicated concentrations. The percent reduction, a measure of cell viability was calculated by the formula described in Section 2.6.1 (a) Albendazole, (b) Benzimidazole, (c) Chloroquine, (d) Levamisole, (e) MPNO, (f) Praziquantel. The coloured line on the x-axis depicts the color of resazurin as seen in each well. This experiment was performed in triplicate over three biological replicates.  56  (a)  Aerobic  Log(CFU/mL)  8  Day 0 Day 1 Day 2 Day 3 Day 4  6 4 2  (b)  ST H E  M PN O -N a+ M PN O -Z n2 +  D  M  SO  0  Hypoxic  Log(CFU/mL)  8  Day 0 Day 1 Day 4 Day 7 Day 14  6 4 2  ST H E  M PN O -N a+ M PN O -Z n2 +  D  M  SO  0  Figure 8: Three putative FRD inhibitors (MPNO related) inhibit survival of Mycobacterium tuberculosis H37Rv in both aerobic and hypoxic conditions. M. tuberculosis H37Rv was grown in the Wayne model for static hypoxic growth for 14 days in 7H9 at which point the cells were treated with 1.5 µg/mL MPNO (complexed with either Na+ or Zn2+) or stearyl-MPNO derivative, STHE. After 0, 1, 4, 7 and 14 days of FRD inhibitor treatment, CFUs were determined by plating on 7H10. An aerobic counterpart to this experiment was performed in parallel and viability was assessed after 0, 1, 2, 3 and 4 days of FRD inhibitor treatment. This experiment was performed once in duplicate.  57  (b)  8  6  Log(CFU/mL)  4 2  4 2  0  50  10 0  16 00  0  50  10 0  20 0  40 0  80 0  16 00  20 0  0  0  40 0  Log(CFU/mL)  6  8  80 0  (a)  [BDZ] (ug/mL) [Benzimidazole] (ug/mL)  [Albendazole] (ug/mL) Log(CFU/mL) Log(CFU/mL) of BCG after 7 days treatment with Chloroquine (CHL) in of BCG after 7 days treatment with Levamisole (LEV) microaerophilic conditions microaerophilic conditions [BCG] before treatment: Log(CFU/mL) = 6.47 [BCG] before treatment: Log(CFU/mL) = 6.47 [ABZ] (ug/mL)  (d)  7  7 6  Log(CFU/mL)  5 4 3 2  5 4 3 2 1  0  0  0  10 00 00 50 00 0 25 00 0 12 50 0 62 50 31 2 15 5 62 . 78 5 1. 25  1 10 00 00 50 00 0 25 00 0 12 50 0 62 50 31 2 15 5 62 . 78 5 1. 25  Log(CFU/mL)  6  0  (c)  [LEV] (ug/mL) [Levamisole] (ug/mL)  [CHL] (ug/mL) [Chloroquine] (ug/mL)  (e)  (f) 8  Log(CFU/mL)  6 4  6 4 2  2  0  25  50  12 .5  0  25 12 .5  50  + +] (ug/mL) [MPNO-Na [MPNO-Na ] (µg/mL)  16 00 80 0 40 0 20 0 10 0  0  0 16 00 80 0 40 0 20 0 10 0  Log(CFU/mL)  8  2+ 2+ [MPNO-Zn ] (ug/mL) [MPNO-Zn ] (ug/mL)  58  (g)  Log(CFU/mL)  8 6 4 2  0  25 12 .5  50  16 00 80 0 40 0 20 0 10 0  0  [STHE] (µg/mL) Figure 9: Three out of seven putative FRD inhibitors decrease survival of Mycobacterium bovis BCG in hypoxic conditions. BCG was grown according to the Wayne model for hypoxic growth for 21 days in 7H9 at which point the cells were treated with (a) Albendazole, (b) Benzimidazole, (c) Chloroquine, (d) Levamisole, and MPNO related compounds (e) MPNO-Na+, (f) MPNO-Zn2+ or (g) STHE. The concentration range for each FRD inhibitor tested was based on the concentration range commonly used to treat protozoan or helminth infections (Table 5). Cells were treated for 7 days before CFUs were determined by plating on 7H10. Cell density of BCG before treatment was ~106/mL. (a), (e), (f) and (g) were performed three times in duplicate while (b), (c) and (d) were performed once in duplicate.  59  A larger panel of putative FRD inhibitors was tested against M. bovis BCG in hypoxic conditions, as shown in Figure 9. Benzimidazole, chloroquine and levamisole showed no mycobactericidal activity under hypoxic conditions. However, MPNO-Zn2+, MPNO-Na+ and STHE had mycobactericidal activity. This was not a surprise since all three MPNO derivatives inhibited M. tuberculosis viability in hypoxic conditions (Figure 8).  3.4 Results – Evaluation of fumarate reductase and it role in drug susceptibility in Mycobacterium smegmatis 3.4.1 Mycobacterium smegmatis FRDhsp has a distinct colony morphology M. smegmatis mc2155 was transformed with a pMV361 plasmid containing the complete M. tuberculosis FRD operon, including the FRD promoter region (Figure 2). This modified strain is referred to as M. smegmatis FRDhsp. Both the M. smegmatis WT and vector control (VC; pMV361 alone) have characteristic M. smegmatis colony morphology. Grown on 7H10 agar, colonies appeared cream-colored, umbonate and dry-looking. However, the FRDhsp strain had a unique colony morphology. Colonies on 7H10 agar appeared yellow-coloured, round and wetlooking. After four to five days at room temperature, FRDhsp colonies acquired indented concentric circles and became a bright orange colour, indicating a photochromagenic phenotype. Photographs of each colony type are shown in Figure 10. The altered colony morphology of FRDhsp suggests a change in cell-envelope composition. PCR of M. smegmatis WT, VC and FRDhsp genomic DNA (Figure 11) confirmed the insertion of the M. tuberculosis FrdABCD operon into the genome of FRDhsp. PCR of M. tuberculosis H37Rv genomic DNA was also performed as a positive control.  60  (a)  (b)  (c)  Figure 10: Mycobacterium smegmatis FRDhsp has a distinct colony morphology compared to WT and VC. Cells were grown on 7H10 supplemented with 10% OADC for 72 hours. M. smegmatis mc2155 WT (a), VC (b) and FRD (c).  61  TB  WT  VC  FRDhsp  ~3800bp  Figure 11. PCR of Mycobacterium smegmatis genomic DNA with primers for the frdABCD operon confirms insertion in the FRDhsp strain. Note that a distinct band appears for the FRD and the positive control (M. tuberculosis H37Rv genomic DNA, TB) at approximately 3800 bp. Genomic DNA sources: TB = M. tuberculosis H37Rv, WT = M. smegmatis mc2155, VC = M. smegmatis mc2155:pMV361, FRDhsp = M. smegmatis mc2155:pMV361:FrdABCD.  62  3.4.2 Growth and viability of Mycobacterium smegmatis WT, VC and FRDhsp in liquid culture The Bioscreen-C Automated Growth Curve Analysis System was used to evaluate the growth rate of M. smegmatis WT, VC and FRDhsp in aerobic conditions. As seen in Figure 12, all three strains grow at similar rates in Proskauer & Beck in the absence of fumarate. Addition of 0.3 M fumarate increased the lag phase for all three strains by approximately 20 hours. Note that the FRDhsp strain is clumpy in liquid cultures, which may alter the OD readings. Next, the role of FRD was evaluated in hypoxic conditions using the same basic Wayne model for hypoxic growth described in Section 2.4.2. As seen in Figure 13, the addition of 0.3 M fumarate significantly reduced the number of CFUs for WT and VC (P = 0.0169, P = 0.0027, respectively) but not for FRDhsp. Note that 0.3 M fumarate was chosen, as it was the concentration used to initially isolate FRD mutants in E. coli [93]. In order to further investigate this effect, the experiment described above was repeated using a fumarate dilution series. Figure 14 depicts the results. Since WT and VC were very similar, for clarity only VC and FRDhsp are shown. At all concentrations of fumarate used, FRDhsp CFUs were not significantly affected by fumarate, whereas the VC CFUs were significantly reduced.  3.4.3 Determining relationships between FRD and antimicrobials As stated previously, a recent paper implies that the activity of many bactericidal antibiotics results from their ability to produce hydroxyl radicals regardless of their target [70]. Of importance, FRD (and SDH) can “leak electrons” to produce superoxides [48]. Superoxide is produced when a single electron is spontaneously transferred form a donor molecule, most commonly flavins, quinones and metal centers, to molecular oxygen [94]. FRD contains both a 63  (a) 2.5  WT WT + 0.3M F  OD600  2.0 1.5 1.0 0.5 0.0  0  20  40  60  80  100  Time (h)  (b) 2.5  VC VC + 0.3M F  OD600  2.0 1.5 1.0 0.5 0.0  0  20  40  60  80  100  Time (h)  (c) 2.5  FRDhsp FRDhsp + 0.3M F  OD600  2.0 1.5 1.0 0.5 0.0  0  20  40  60  80  100  Time (h)  Figure 12: Aerobic growth of Mycobacterium smegmatis WT (a), VC (b) and FRDhsp (c) in Proskauer and Beck in the presence or absence of 0.3 M Fumarate. OD600 was automatically determined every 3 hours for 3 days using a Bioscreen-C Automated Growth Curve machine. This experiment was run three times over 5 technical replicates.  64  Log(CFU/mL)  5 4  *  **  3 2 1  VC VC ,0 .3 M F FR FR Dh sp Dh sp ,0 .3 M F  W T W T, 0. 3M F  0  Figure 13: Mycobacterium smegmatis FRDhsp but not wild type (WT) or pMV361 vector control (VC) resists inhibition by fumarate after 7 days of treatment under hypoxic conditions. Initial M. smegmatis cell density ~104/mL. Cells were grown in sealed tubes and oxygen depletion was measured using methylene blue. After 7 days of hypoxic incubation, cells were plated on 7H10 and incubated at 37°C for 3 days, at which point CFUs were counted. An unpaired t-test compared decrease in CFUs of WT to WT+0.3M fumarate (* = P<0.05) and VC to VC+0.3M fumarate (** = P<0.005). The experiment was performed in duplicate over three biological replicates.  65  Log(CFU/mL)  5  VC FRDhsp  4 3  * *  2 1 0  1.0  0.5  0.25  0  [Fumarate] (M)  Figure 14: Mycobacterium smegmatis FRDhsp is less sensitive than the VC to fumarate in hypoxic conditions. Initial M. smegmatis cell density was ~104/mL. Treatment was for 7 days. Note that the fumarate concentration range was 1.0 M to 0.00195 M. All concentrations smaller than 0.25 M produced results similar to untreated cells and were thus omitted for clarity. Furthermore, M. smegmatis WT was also included in this experiment and it behaved in the same manner as VC. For clarity, therefore, only VC is shown. An unpaired t-test compared the untreated control group with the corresponding fumarate treated groups (* = P<0.05). This experiment was performed three times in duplicate.  66  bound flavin and an iron-sulfur cluster, both of which are capable of producing superoxide [95]. More recently, however, it was shown that it was the flavin moiety responsible for superoxide production [94]. Furthermore, the altered colony morphology and clumpy nature in liquid culture of FRD implies that it has a different cell envelope composition. For both above reasons, it is hypothesized that FRD will have a different drug susceptibility/resistance profile than WT/VC. To test this hypothesis, 31 common antimicrobials with different targets were assayed for their antimycobacterial activity against M. smegmatis WT, VC and FRDhsp using the resazurin assay. In general, FRDhsp was at least 2-fold more susceptible to the selected drug when compared to WT or VC, which supported the hypothesis that the FRDhsp was more susceptible than WT and VC. Table 7 lists the antibiotics and their MICs for WT, VC and FRDhsp along with the change in susceptibility for FRDhsp. Of significance, FRD showed a greater than 8-fold increased susceptibility to 6 antimicrobials: bacitracin, fusidic acid, novobiocin, rifampin, spectinomycin and vancomycin. To further evaluate the interplay between FRD and these 6 antimicrobials, WT, VC or FRDhsp were treated with them in combination with either fumarate or succinate using the Checkerboard assay (2 fold dilutions). To characterize the interaction, the fractional inhibitory concentration (FICI) was calculated for each combination and was classified under the following categories [96,97,98]: Synergy, FICI index ≤ 1; No Interaction, FICI index = 1; Antagonism, 1 < FICI index ≤ 3; Suppression, FICI index > 3. Table 8 contains summarized data and Figure 15 shows a sample graph for each type of interaction. According to the FICI in Table 8, fumarate and succinate have no effect on the action of some antimicrobials on VC, or are synergistic. For FRDhsp, fumarate and succinate have no effect on the action of some antimicrobials or result in suppression.  67  Table 7: FRD Mycobacterium smegmatis shows increased susceptibility to diverse antibiotics relative to WT and VC using the resazurin assay. The greater the fold difference, the more susceptible the FRD strain is to an antimicrobial than the VC. This experiment was performed three times in duplicate.  Drug Amikacin Azithromycin Bacitracin Cadmium acetate Capreomycin Chloramphenicol Chlorpromazine Clarithromycin Clofazamine D-Cycloserine Diamide Erythromycin Ethambutol Fusidic Acid Gatifloxacin Imipenem Isoniazid Mitomycin Moxifloxacin Novobiocin Ofloxacin Rifampin Roxithromycin Spectinomycin Spiramycin Streptomycin Tetracycline Thimerosal Thioridazine Triclosan Vancomycin  WT 0.06 4–8 512 – 1024 0.015 0.25 40 32 4 1.6 – 3.2 32 32 – 64 32 0.25 8 0.04 2 4 0.125 0.04 0.5 0.5 4–8 16 32 – 64 4 0.1 0.06 – 0.12 0.1 16 4 2–4  MIC (ug/mL) VC 0.06 4–8 512 0.015 0.25 40 32 4 1.6 – 3.2 32 32 – 64 32 0.25 4–8 0.04 – 0.08 2 4 0.125 0.04 0.5 0.5 4–8 16 32 – 64 4–8 0.1 0.12 0.1 16 4 4  hsp  FRD 0.12 – 0.24 2 32 – 64 0.0038 – 0.0075 0.25 10 – 20 16 4 1.6 8 – 16 16 – 32 32 0.25 0.5 0.04 2 4 0.0313 – 0.0156 0.04 0.0625 0.25 – 0.5 0.125 – 0.25 16 2 1 0.1 0.06 0.1 16 4 0.125  Fold Susceptibility (VC, WT to FRDhsp) 2–4 2–4 8 – 32 2–4 0 2–4 2 0 0–2 2–4 0–2 0 0 8 – 16 0–2 0 0 4–8 0 8 0–2 16 – 32 0 16 – 32 4–8 0 0–2 0 0 0 16 – 32 68  Table 8: Addition of fumarate or succinate in combination with antimicrobials is generally antagonistic for Mycobacterium smegmatis FRDhsp and synergistic for VC as determined by the resazurin assay. Cultures were grown aerobically in Proskauer & Beck supplemented with tyloxapol in the presence or absence of fumarate/succinate and antimicrobial for 48 hours. Resazurin was added and the colour change was evaluated after 24. The FIC was calculated as the sum of FICA and FICB where FICA = (MICA in combination)/(MICA alone) and FICB = (MICB in combination)/(MICB alone). FIC indices were used to characterize antibiotic interactions as follows [96,97,98]: Synergy, FIC index ≤ 1, No Interaction, FIC index = 1, Antagonism, 1 < FIC index ≤ 3, Suppression, FIC index > 3  Strain  Compound A  MICA (µg/mL)  Bacitracin  256  Fusidic Acid  8.0  Novobiocin  0.5  VC  FRDhsp  Rifampin  2.0  Spectinomycin  64.0  Vancomycin  1.0  Bacitracin  8.0  Fusidic Acid  1.0  Novobiocin  0.063  Rifampin  0.25  Spectinomycin  4.0  Vancomycin  0.125  Compound B Fumarate Succinate Fumarate Succinate Fumarate Succinate Fumarate Succinate Fumarate Succinate Fumarate Succinate Fumarate Succinate Fumarate Succinate Fumarate Succinate Fumarate Succinate Fumarate Succinate Fumarate Succinate  MICB (µg/mL)  1.25  0.313  FICI  Interpretation  1.0 0.375 0.5 0.375 0.5 0.5 0.75 0.5 1.0 1.0 1.0 1.0 3.5 3.5 1.0 1.0 1.0 1.0 1.0 1.0 3.5 3.0 1.0 4.75  No Interaction Synergy Synergy Synergy Synergy Synergy Synergy Synergy No Interaction No Interaction No Interaction No Interaction Suppression Suppression No Interaction No Interaction No Interaction No Interaction No Interaction No Interaction Suppression Suppression No Interaction Suppression 69  (a)  (b)  VC  1.0  1.0  0.8  0.8  FIC Vancomycin  FIC Fusidic Acid  VC  0.6 0.4 FICI = 0.375  0.2 0.0 0.0  0.2  0.4  0.6  0.8  X 0.4 0.2 0.0 0.0  1.0  FICI = 1.0  0.6  0.2  (d)  Sample Data  FIC Vancomycin  FIC Antimicrobial B  0.4 0.2  0.2  0.4  0.6  1.0  0.8  1.0  FIC Antimicrobial A  FICI = 4.75  4.0  FICI = 1.5  0.6  0.0 0.0  0.8  FRDhsp  1.0 0.8  0.6  FIC Fumarate  FIC Fumarate  (c)  0.4  X 3.0 2.0 1.0 0.0 0.0  0.2  0.4  0.6  0.8  1.0  FIC Succinate  Figure 15: Sample FIC graphs representing each type of interaction using the data presented in Table 8. The Y-axis depicts the FIC of Compound A and the X-axis depicts the FIC of Compound B. Interactions were classified according to Chait et al. [96]: (a) synergy, (b) no interaction, (c) antagonism, (d) suppression. Note that no fumarate/succinate-antimicrobial combination resulted in an antagonistic interaction. However, a schematic representation of an antagonistic interaction was presented in (c).  70  3.5 Discussion 3.5.1 Role of fumarate reductase in Mycobacterium tuberculosis Several previous studies have shown that M. tuberculosis encodes an array of virulence factors that are required for survival within the host MΦ such as protein tyrosine phosphatase B, Sigma Factor σB, and the transcriptional regulator PhoP [99,100,101]. My results suggest that M. tuberculosis fumarate reductase can be added to that list. The work by Li et al. proposed FRD is a novel M. tuberculosis virulence factor and, the present study began with construction of a frdABCD operon KO. As seen in Figure 3, both the M. tuberculosis H37Rv WT and FRD KO grow at similar rates during log phase in aerobic conditions as assessed by CFU counts and OD readings. Note that the growth curves were only performed for 14 days and as such only the log phase of growth was assessed. If the growth curve had continued into stationary phase, perhaps there may be a difference between WT and FRD KO growth and/or survival. For the growth curve, two methods were chosen to assess growth, OD and CFU counts, as M. tuberculosis tends to clump in liquid culture. OD is based on the amount of light transmitted through a defined distance at a particular wavelength. If the culture is clumpy, readings may not be accurate. Also, M. tuberculosis cultures require a method of dispersal such as sonicating or syringing for accurate CFU counts. Neither treatment results in loss of bacterial viability [73]. Since FRD is thought to be inactive (Figure 1) due to the absence of active FNR in aerobic conditions, no difference in growth in aerobic conditions is expected [59]. Bacterial viability was also assessed in hypoxic conditions in vitro (Figure 4). Using minimal media, the effect of fumarate on hypoxic survival (in the absence of nitrate) was evaluated. The 71  concentration used in this experiment was the same as the concentration first used to isolate FRD mutants in E. coli (0.3 M) [93]. Both WT and FRD KO were viable in the presence and absence of fumarate in aerobic conditions. After 21 days of aerobic growth, M. tuberculosis H37Rv should be entering stationary phase [43]. As such, even though the growth curve in Figure 3 only shows the log phase, the fact that both WT and FRD KO grew to the same CFU in aerobic conditions in Figure 4a makes it tempting to speculate that both strains behave similarly during stationary phase. Both the WT and FRD KO M. tuberculosis strains had decreased viability (as measured by CFU) in hypoxic conditions in the absence of fumarate (Figure 4b). However, addition of fumarate helped maintain WT but not FRD KO viability in hypoxic conditions. Since FRD acts as a terminal electron acceptor in anaerobic respiration, it follows that the addition of the FRD substrate, fumarate, allows WT to drive the FRD reaction and acquire the NAD+ needed to drive cellular processes essential for survival such as degradation of complex sugars and betaoxidation of fatty acids [58]. However, since the KO does not have FRD, addition of fumarate is irrelevant and the strain still loses viability. Note the distinction between viability and growth. Since this experiment only evaluated CFU counts as an end point, only bacterial viability after 21 days could be assessed. Growth could be evaluated more thoroughly by looking at CFU counts at several timepoints throughout the experiment, rather than just at the end. The media used in this experiment was Proskauer and Beck, which contains a source of nitrogen in the form of L-asparagine (nitrate is a medium component). M. tuberculosis has a probable L-asparaginase (AsnB, Rv1538c) that converts asparagine to aspartate and releases ammonia. However, there is no known nitrification process in M. tuberculosis that converts ammonia into nitrate [102,103]. Only certain bacteria can perform nitrification, such as those  72  from the genera Nitrosomonas, Nitrosococcus, Nitrobacter, Nitrococcus [104]. Thus, even though a source of nitrogen was supplied in the media in the form of asparagine, only fumarate anaerobic respiration could have occurred. In sum, FRD is required for M. tuberculosis viability in hypoxic conditions in vitro. To more thoroughly assess the role of FRD, M. tuberculosis WT and FRD KO were used in a MΦ infection model in vitro. During an M. tuberculosis infection, bacteria are phagocytosed by MΦs and the process of phagosome maturation commences. However, M. tuberculosis can arrest the progression of phagosomal maturation and can alter processes within the MΦ (including cell death pathways, reactive oxygen/nitrogen species and MHC antigen loading) to make the phagosome environment more favorable for their survival [105]. Given that the phagosome environment is thought to drive M. tuberculosis to a functionally hypoxic state (including the presence of NO, which induces an hypoxic response), factors that can cope with that stress may be important for M. tuberculosis survival within a MΦ [30]. Figure 5 supports the hypothesis that FRD contributes to M. tuberculosis survival in MΦ. At day 4 post infection of BMMΦs, there was an approximately 1-log reduction in FRD KO intracellular bacteria relative to WT. This corresponds to an almost 90% reduction in bacterial load. This also implies that FRD is not absolutely essential for survival within the MΦ. M. tuberculosis still has the Nar system and can use nitrate as the terminal electron acceptor to survive in hypoxic conditions [57]. The nitrate/fumarate hypoxic response is more thoroughly studied in other organisms and it is known that E. coli preferentially uses nitrate rather than fumarate as the hypoxic response substrate [58]. Perhaps M. tuberculosis has the same substrate preference as E. coli. It would follow that M. tuberculosis would use up the available nitrate/nitrite in the MΦ [106] before using fumarate.  73  Next, the susceptibility profiles of M. tuberculosis WT and FRD KO to commonly used anti-mycobacterials and one putative FRD-inhibitor (discussed more thoroughly below) were determined to evaluate whether loss of FRD affects drug susceptibility and/or resistance. Both the resazurin assay and CFU counts were used. The first method is an indirect measure of cellular viability using resazurin, a reagent that is pink in the presence of live cells capable of producing reductive metabolic products and blue when cells are dead [107,108]. The calculated percent reduction is a quantification of the percentage of live cells to dead cells. The second method, CFU counts, is a direct measure of cellular viability in which the bacteria are plated on 7H10 at the completion of the experiment. For this experiment and other experiments involving resazurin and CFU counts, the MIC determined using resazurin was the same as the MIC determined by CFU counts. This indicates that the indirect resazurin method is as accurate as the direct CFU count method. As seen in Figure 6, WT and FRD KO have similar profiles with similar MICs to a small sample of drugs including: isoniazid, 0.125 µg/mL; rifampin, 0.016 µg/mL; ethambutol, 4 µg/mL; and MPNO-Na+, 4.8 µM. This experiment was performed in aerobic conditions and since FRD is only upregulated in hypoxic conditions, inactivation of FRD should not have a great impact under these conditions. However, this experiment was only performed once in duplicate so maybe a difference in MIC might be seen once more biological replicates are performed. Knowing that FRD is required in part for M. tuberculosis survival within MΦs, FRD inhibition could perhaps be used as a novel treatment for tuberculosis. Inhibition of FRD should prevent hypoxic respiration of M. tuberculosis within the host MΦ environment with detrimental effects on survival. To investigate this possibility, commonly used putative anti-protozoan and  74  anti-helminth FRD inhibitors (albendazole, benzimidazole, chloroquine, levamisole, MPNO-Na+, praziquantel and thiabendazole) were employed under aerobic conditions. Studies have shown that these drugs are effective against helminth and protozoan infections and that the drugs bind and inhibit FRD, but are not completely specific for FRD [75,76,85]. One thing to note is that this experiment was performed with M. tuberculosis Erdman and not H37Rv. This experiment needs to be repeated using M. tuberculosis H37Rv. However, both M. tuberculosis Erdman and H37Rv are equally virulent in animal and MΦ models of infection and are the two most commonly used laboratory strains of M. tuberculosis. From Figure 7 it appears that the only FRD inhibitor effective against M. tuberculosis in aerobic conditions is MPNO-Na+ at 0.5 and 1 µg/mL (3.3 µM and 6.6 µM, respectively) as determined by resazurin and CFU counts (Figure 7e). This is similar to the published inhibitor concentration value for M. tuberculosis [43]. This also means that this putative FRD inhibitor has more than one target. FRD is poorly expressed and not necessary for growth under aerobic conditions. As such, any specific FRD inhibitor would not be effective in aerobic conditions since its target would not be upregulated. Yet, Figure 7e shows that MPNO-Na+ does have an effect in aerobic conditions. However, Li et al.[43] did see minimal FRD expression in aerobic conditions. However, other FRD inhibitors did not affect M. tuberculosis viability (Figure 7ad,f). If FRD basal expression under aerobic conditions was great enough for MPNO-Na+ to be effective, then it follows that the other putative FRD inhibitors would be effective too. Perhaps no M. tuberculosis growth inhibition by the other FRD inhibitors was observed because the experiment was performed in aerobic conditions. To reiterate, if oxygen were abundant, M. tuberculosis would not need to upregulate an enzyme required to survive in hypoxic conditions. Thus, a similar experiment to the one  75  described above evaluated FRD inhibitors in hypoxic conditions. M. tuberculosis H37Rv was treated with MPNO-Na+, as well as two MPNO derivatives, MPNO-Zn2+ and STHE in aerobic and hypoxic conditions [85]. All three drugs were effective at reducing bacterial CFUs at all time points tested in both aerobic and hypoxic conditions (Figure 8). This supports the idea that MPNO-Na+ and the two MPNO derivatives are not specific to FRD. However, they were effective in hypoxic conditions and the implications of this are still significant. This experiment was performed once in duplicate and only three putative FRD inhibitors were tested at only one drug concentration. This experiment, therefore, should be repeated using a variety of concentrations for a complete FRD inhibitor evaluation. However, due to the unavailability of a Containment Level 3 laboratory to work with M. tuberculosis, this was not possible. Therefore, M. bovis BCG was employed. M. bovis BCG is a slow-growing mycobacterium with a Level 2 classification and an FRD operon 99% identical to that of M. tuberculosis (BLASTn ID lcl|37973). As such, M. bovis BCG was used as a model organism to test the remaining putative FRD inhibitors as described above. Thiabendazole proved to be very insoluble and therefore was omitted from this experiment because the efficacy of this drug might be confounded by the toxicity of the organic solvent carrier. As seen in Figure 9, albendazole, benzimidazole, chloroquine and levamisole showed no mycobactericidal activity under hypoxic conditions (Figure 9b,c,d). However, MPNO-Na+, MPNO-Zn2+ and STHE had mycobactericidal activity (Figure 9e-g). This was not a surprise for MPNO-Na+, MPNO-Zn2+ and STHE since it was already shown to inhibit M. tuberculosis growth in hypoxic conditions (Figure 8). This also validates the use of M. bovis BCG as a model  76  for M. tuberculosis for this experiment since the drugs were effective against both mycobacteria at the same MIC. The next logical experimental step was to see if these putative FRD inhibitors were effective in a MΦ infection. MPNO-Na+ was previously shown to be effective in reducing M. tuberculosis H37Rv CFU counts in a MΦ infection model so it is likely that other FRD inhibitors may have an effect too [43]. Furthermore, for clinical purposes, the concentration of a FRD inhibitor required to kill M. tuberculosis must have no toxic effects on the host cell. Since FRD is found in prokaryotes, helminthes and trypanosomatids yet absent from mammalian cells, any FRD-specific inhibitor should have little or no cytotoxic effect on the mammalian cells [109,110,111]. The resazurin assay was used to determine the concentration at which each putative FRD inhibitor is cytotoxic to BMMΦ (Table 6). Albendazole, benzimidazole and levamisole were non-toxic to mammalian cells at all concentrations tested and chloroquine, MPNO-Na+ and praziquantel were non-toxic until concentrations at least 100-fold greater than the highest published value for use against a nematode or a protozoan infection [75,76,85]. Taken together, FRD inhibition may prove to be another route for treating tuberculosis. The drugs used in these experiments were all FRD inhibitors, however, the specificity of each is unknown. As seen in Figures 7 and 8, MPNO-Na+, MPNO-Zn2+ and STHE were effective in both aerobic and hypoxic conditions. Since FRD should only be upregulated in hypoxic conditions, the inhibitors should have been ineffective in aerobic conditions. However, this was not the case. As such, it is likely that the FRD inhibitor has more than one target. While studies have shown that the putative FRD inhibitors can inhibit FRD activity, this inhibition may not be exclusive [82]. For example, it has been shown that MPNO-Na+ can inhibit Trypanosoma cruzi with an ID50 of 35µM but there isn’t any mention of specificity [83]. Furthermore, other  77  FRD inhibitors (levamisole, praziquantel and chloroquine) inhibit other enzymes besides FRD such as NADH oxidase in Ascaris suum [82]. Note that most of the studies evaluating the activity of FRD inhibitors have not been done in bacteria. As such, to fully evaluate the effectiveness of the putative FRD inhibitors, the M. tuberculosis FRD enzyme should be purified and enzyme/inhibitor kinetic studies should be performed. However, this is a membrane-bound enzyme that is sensitive to oxygen and as such, purification may be difficult. Furthermore, an M. tuberculosis transposon library may help evaluate the specificity of MPNO-Na+ and its derivatives. Mapping the location of a transposon in a mutant no longer sensitive to the FRD inhibitor or overexpression of potential target genes could yield insights into what the other target may be.  3.5.2 Role of fumarate reductase in Mycobacterium smegmatis While frd genes are encoded in many mycobacterial species, including M. tuberculosis, M. bovis BCG and M. avium, they are not found in Mycobacterium smegmatis (a rapidly growing Mycobacterium) (http://www.tbdb.org/). To study the effect of frd on drug resistance and physiology, the M. tuberculosis frd operon was introduced into M. smegmatis. For this, a plasmid initially engineered to complement the M. tuberculosis FRD KO and its empty vector counterpart was re-purposed and was used to deliver the FRD operon to M. smegmatis mc2155 via electroporation. This resulting M. smegmatis strain will subsequently be referred to as M. smegmatis FRDhsp. To confirm the insertion of FRD into the M. smegmatis genome, genomic DNA was extracted and PCR was performed using primers that amplify the entire operon. As seen in Figure 11 (lane 5), FRDhsp shows a PCR product at the predicted molecular weight while the WT and VC do not (lanes 3, 4). PCR of FRD from genomic M. tuberculosis H37Rv DNA 78  was also performed (lane 2) as a positive control. Since this positive control band corresponds to the FRD band, it can be confirmed that the M. tuberculosis FRD operon was inserted into the genome of M. smegmatis. As seen in Figure 10, both the M. smegmatis WT and vector control VC (Figure 10a,b) maintained the typical M. smegmatis colony morphology phenotype (undulate and dry) while the FRDhsp strain (Figure 10c) had a unique smooth and wet colony morphology [112]. Furthermore, the FRDhsp strain was clumpy in liquid culture. Both of those features suggest that FRDhsp has a change in cell envelope composition [113,114]. Also, overexpression of FRD in E. coli lead to differences in fatty acid composition of fumarate reductase-enriched inner membranes, which lead to an altered colony morphology [115]. Since FRD is a membrane-bound enzyme, perhaps the M. tuberculosis FRD is being anchored in inner membrane of FRDhsp thus causing the colony morphology change [109]. Mass spectrometry may provide more detailed information about the differences in cell wall composition. Another unique characteristic of FRDhsp is that it is photochromogenic, turning a bright orange color if left at room temperature for at least 4 days. Photochromogenicity is found in certain mycobacteria such as M. avium, M. kansasii, M. marinum and M. vaccae and is commonly due to an abundance of beta-carotene [116]. Porphyrin, synthesized in part by phytoene synthase (PhyA), is a putative photoreceptor used for the photoinduction process of beta-carotene production in M. smegmatis, as well in other mycobacteria (MMAR_407, Rv3397c) [117]. Perhaps there is a link between frdABCD and phyA expression that could account for the increased pigmentation in the FRDhsp M. smegmatis strain. To test the hypothesis that FRDhsp has greater beta-carotene levels than WT/VC, beta-carotene can be extracted from each M. smegmatis strain using the methanol/petroleum ether/acetone described by Viveiros et al.  79  [118] and quantified using high-performance liquid chromatography with photodiode array detection coupled to mass spectrometry (HPLC-PDA-MS) [119]. Next, if there is a difference in beta-carotene levels, phyA expression can be evaluated in each M. smegmatis strain using realtime quantitative PCR (RT-q-PCR). If there is no difference in beta-carotene levels, perhaps the change in cell envelope in FRDhsp simply allows the beta-carotene to be more visible. Compared to parental and VC strains, the FRDhsp strain has a clumpy phenotype in aerobically grown liquid cultures. If expression of the M. tuberculosis FRD is driven only by its own promoter, then this phenotype should only be seen in hypoxic conditions, when the FRD is expressed (by analogy to E. coli). When engineering the complementation construct, it was important to include the promoter region of M. tuberculosis FRD when cloning into pMV361. Since M. smegmatis has a nitrate regulator that is 98% similar to the FNR found in M. tuberculosis (Blast ID lcl|11753), and the FRD promoter includes sequences similar to the FNR operator site, it is plausible that the M. smegmatis nitrate regulator may regulate the M. tuberculosis FRD operon. However, if the M. smegmatis nitrate regulator was driving FRD expression as proposed, any phenotype should only be seen in hypoxic conditions. Since an aerobic phenotype was observed, it is possible that the Hsp60 promoter (including both -10 and 35 sites) supplied by the pMV361 plasmid, positioned directly upstream of the cloned FRD operon, is likely directing FRD expression leading to the phenotype. While expression from the hypoxic induced putative FRD promoter is unlikely, it cannot be ruled out. The primary evidence for the role of the Hsp60 promoter in driving FRD transcription is that the clone generates a distinctive clumpy phenotype even in aerobic conditions. While FRD enzyme activity [115] may be difficult to assay, FRD transcription could readily be measured and its start site mapped under various growth conditions.  80  Next, growth of M. smegmatis WT, VC and FRDhsp in aerobic conditions was evaluated to ensure that any future experiments are not affected by differences in their basal rate of growth. All three strains were grown in Proskauer and Beck supplemented with tyloxapol (Figure 12). The growth curves for WT and VC are almost superimposable (Figure 12a,b) while FRDhsp follows a similar curve until 30 hours of growth where it appears to slow down (Figure 12c). As previously stated, the FRDhsp strain was more heavily clumped than was that of WT and VC, which could skew the OD readings. Tyloxapol is a detergent used to prevent aggregation. Since it can be metabolized by mycobacterial species, presumably by beta oxidation, it is possible that the FRDhsp strain effectively depletes it from the medium, resulting in clumping. As mentioned above, FAD+ generated by FRDhsp is a cofactor for beta oxidation. To determine if FRDhsp is or is not affected by the addition of fumarate, a second set of cultures was grown in the presence of 0.3 M fumarate. For all three strains, there was an approximately 20-hour lag in reaching exponential phase when fumarate is present (Figure 12a,b,c). Fumaric acid, the salt of which is fumarate, is commonly used as a food preservative, inhibiting the growth of lactic acid fermenting bacteria [120]. In those circumstances, the concentration of fumaric acid ranges from 10 mM to 60 mM. In this experiment, however, approximately ten times as much fumarate was added. Perhaps such a high concentration of fumarate is detrimental to the viability of WT, VC and FRDhsp in aerobic conditions leading to the longer lag phase. Next, hypoxic viability of the M. smegmatis strains was evaluated. In the slow-growing, pathogenic M. tuberculosis and M. bovis BCG, the DosS (DevS) and DosT histidine kinases form a two-component system together with the DosR (DevR) response regulator which likely acts as a key regulator in the adaptation to hypoxia [121,122,123]. M. smegmatis, however, has a single histidine kinase, DevS (which closely resembles DosT) and a DevR response regulator,  81  which are also implicated in hypoxic adaptation [121]. Note that the Nar system (described in Figure 1) is part of the Dos/Dev regulon while FRD is not [124,125]. Since the Nar system is responsible for the regulation of FRD in M. tuberculosis, then it follows that FRD is indirectly regulated by the Dos/Dev regulon. Since FRD is implicated in mycobacterial hypoxic survival, growth of each M. smegmatis strain was evaluated in hypoxic conditions in experiments similar to those performed with M. tuberculosis H37Rv WT and FRD KO and M. bovis BCG (Figure 4). As shown in Figure 13, all three strains were equally viable in hypoxic conditions in the absence of fumarate. This implies that the introduction of M. tuberculosis FRD to M. smegmatis (FRDhsp) does not affect DevSR function, as viability in the hypoxic environment is unchanged. However, when 0.3 M fumarate is added, there is a statistically significant reduction in viable CFUs for both WT (P = 0.0169) and VC (P = 0.0490) but not FRDhsp (P =0.2386). It was initially hypothesized that FRDhsp grown in hypoxic conditions in the presence of fumarate would result in increased viable CFUs relative to FRDhsp grown in the absence of fumarate, not similar viable CFUs as seen in Figure 13. This hypothesis was based on the assumption that FRDhsp only performs its function of acting as an additional terminal electron acceptor during hypoxic respiration when its substrate, fumarate, is provided. This would generate more energy for cell survival and replication, leading to an increased viable CFU. Additionally, the reduction in viable CFUs for both WT and VC support the hypothesis that 0.3 M fumarate is detrimental to bacterial survival, as in Figure 12. However, 0.3M fumarate does not negatively affect FRDhsp viability in hypoxic conditions (Figure 12c). In fact, the presence of FRD in both M. smegmatis and M. tuberculosis (Figure 4b) increases viability in hypoxic condition in the presence of 0.3M fumarate. This supports the hypothesis that mycobacterial FRD can use fumarate as the terminal electron acceptor in anaerobic respiration.  82  To investigate these hypotheses more thoroughly, hypoxic viability of the M. smegmatis strains in a variety of fumarate concentrations was evaluated. As seen in Figure 14, the trend of increased viability of FRDhsp relative to WT/VC in the presence of high concentrations of fumarate was consistent (P < 0.05). Even at the highest concentration of fumarate, FRDhsp was as viable as untreated cells. To improve these experiments, the viable CFUs of each strain should be evaluated in the presence or absence of fumarate at multiple time points to evaluate growth rather than viability. Furthermore, cultures should be syringed or sonicated prior to fumarate addition to disperse possible clumps. Finally, FRD expression in FRDhsp and intracellular free radical concentration needs to be thoroughly evaluated. Given that FRDhsp is likely to have a different cell envelope composition, it follows that the bacteria may become more or less permeable to antimicrobials. Studies have shown that the cell envelope is a key factor in antimicrobial effectiveness and alterations can make it more or less susceptible/resistant [126,127,128]. Furthermore, the presence of the FRD enzyme in FRDhsp may increase the intracellular free radical concentration thus altering the fitness of the cell. This could lead to increased susceptibility of FRDhsp to a variety of antimicrobials. The resazurin assay was used to evaluate the mycobactericidal activity of 31 antimicrobials with varying targets on M. smegmatis WT, VC and FRDhsp in Proskauer and Beck (Table 7). For many of the antimicrobials evaluated, FRDhsp was at least 2-fold more susceptible than WT or VC and FRDhsp was never more resistant than WT or VC. Of significance, FRDhsp was at least 8-fold more susceptible to bacitracin (8 – 32-fold), fusidic acid (8 – 16-fold), novobiocin (8-fold), rifampin (16 – 32-fold), spectinomycin (16 – 32-fold) and vancomycin (16 – 32-fold). Also of significance is the fact that each of the drugs listed above has a different target: bacitracin targets the cell wall by interfering with C55-isoprenyl pyrophosphate [129]; fusidic acid targets protein  83  synthesis by interfering with elongation factor G [130]; novobiocin targets DNA gyrase [131]; rifampin targets prokaryotic DNA-primed RNA polymerase [132]; spectinomycin targets the 30S ribosomal subunit and interrupts protein synthesis [133]; vancomycin targets N-acetylmuramic acid (NAM) and N-acetylglucosamine (NAG) and prevents them from being incorporated into the cell wall [134]. An initial hypothesis proposed that FRDhsp would be more susceptible to antimicrobials relative to WT/VC because FRDhsp is known to produce toxic free radicals. The presence of toxic free radicals would decrease cellular fitness and less antimicrobial would be required to decrease viability. However, this experiment was performed in defined, minimal Proskauer and Beck medium without the addition of fumarate. Even with FRD transcription presumably driven in aerobic conditions under the Hsp60 promoter, FRDhsp should still be inactive relative to anaerobic conditions since its substrate (fumarate) is being consumed by fumarase in the TCA cycle. Thus, electrons might not be “leaked”. However, M. smegmatis will have a minimal amount of intracellular fumarate, and levels would be determined in part by the activity of TCA cycle enzymes. This could theoretically drive the FRD enzyme in FRDhsp, leading to electron leakage. However, if the amount of fumarate was enough to significantly decrease the fitness of FRDhsp leading to a more susceptible phenotype, then FRDhsp should have an intrinsic growth defect in aerobic conditions relative to WT and VC, which it did not (Figure 12). Finally, it was proposed that the clumpy nature of FRDhsp could have protected cells within the clump from being exposed to fumarate, thus maintaining viability in hypoxic conditions in the absence and presence of fumarate (Figure 13, 14). If this were truly the case, then it would be expected that FRDhsp be more resistant to antimicrobials, not more susceptible, as cells would be protected from exposure.  84  It is more likely that the increased antimicrobial susceptibility is due to increased permeability. With the Hsp60 promoter active in aerobic conditions, FRDhsp could be overexpressed and anchored to the inner membrane. This may change the cell envelope conformation, resulting in permeability changes, allowing increased rates of drug penetration into the cell and cell death at lower concentrations of drug. This would account for the independence from the drug’s cellular target. Since it was proposed that fumarate might increase intracellular free radicals in FRDhsp, perhaps adding fumarate in combination with the antimicrobials would also increase its susceptibility. Furthermore, succinate is the product of the FRD reaction. As such, the antimicrobials were also tested in combination with succinate with the thought that it may cause FRD to act in the reverse direction, also altering susceptibility/resistance. Note that succinate is the primary reactant of the succinate dehydrogenase (SDH) enzyme, of which fumarate is the product. Even though M. smegmatis does not have a FRD enzyme, it has an SDH enzyme (sdhABDC; MSMEG_1669-1672). Both FRD and SDH can catalyze their reaction in both directions and both can “leak” electrons, generating superoxide free radicals [94,135]. The six antimicrobials discussed above were assessed in combination with fumarate and succinate using an aerobic resazurin checkerboard assay. To quantify the interaction, the fractional inhibitory concentration (FICI) was calculated. Table 8 summarizes the FICI data and Figure 15 shows an example for each type of possible interaction. The definition for each type of possible interaction according to Chait et al. [96] is as follows. Synergistic combinations have a combined effect larger than the effect predicted by each component alone (Figure 15a). Antagonistic combinations have a combined effect smaller than the effect predicted by each component alone (Figure 15c). Suppressive combinations are a subclass of hyper-antagonism  85  whereby the effect of the combination is even less than that of one of the components alone (Figure 15d). Finally, a combination may result in no interaction (Figure 15b). Figure 15c shows sample data in an antagonistic interaction for completeness, however none of the different combinations of fumarate/succinate and drug for any M. smegmatis strains resulted in an antagonistic interaction. FRDhsp had three primary effects on sensitivity spectra as described below. Firstly, FRDhsp was 4-fold more sensitive to both fumarate and succinate in aerobic conditions (fumarate and succinate MIC: VC = 1.25 µg/mL, FRD = 0.313). This supports the hypothesis that addition of fumarate or succinate drives FRD and SDH to produce free radicals, thus leading to decreased cellular viability. Secondly, fumarate or succinate were synergistic with certain drugs. For example, fusidic acid, novobiocin and rifampin in combination with succinate or fumarate and bacitracin in combination with succinate but not fumarate, were synergistic in the VC strain. The synergistic effect was not target dependent; indeed, the drugs exhibiting synergy had different targets. Furthermore, the synergism corroborates the hypothesis that fumarate can be toxic to the cell as discussed previously (Figures 11-13). By decreasing cellular fitness with the addition of fumarate, a lower concentration antibiotic would be required for killing, and vice versa. Furthermore, since SDH “leaks” electrons and can catalyze its reaction in both directions, addition of fumarate and succinate could increase the intracellular free radical concentration. Since certain antimicrobials are known to target and inactivate superoxide dismutases, the cell’s defense against free radicals would be impaired [136]. All of these possibilities could further lead to synergy and contribute to cell death. However, if these were the sole factors involved in the phenomenon, all combinations of bactericidal drugs with fumarate/succinate should lead to  86  synergy, which is not the case. Bacitracin in combination with fumarate and spectinomycin and vancomycin in combination with succinate or fumarate had no interaction in the VC strain. To more thoroughly evaluate the role of SDH and drug susceptibility in combination with fumarate or succinate, an SDH knock out M. smegmatis strain would need to be generated. It would then follow that without SDH, electrons would not be leaked in the absence of fumarate or succinate, leading to a non-synergistic profile. This may prove difficult to evaluate since even though SDH is non-essential in M. tuberculosis, SDH is involved in the basic cellular process of respiration and its removal may have other detrimental effects [137]. Thirdly, bacitracin and spectinomycin in combination with succinate or fumarate and vancomycin in combination with succinate but not fumarate showed a suppressive, hyperantagonistic interaction in FRDhsp. Again, this is not a target-specific effect since the antimicrobials all have different targets. This provides evidence against FRDhsp having increased permeability. If permeability were increased, then it would be expected that addition of two compounds in combination would be synergistic, not suppressive or antagonistic. As such, possibilities for suppression/antagonism were explored. Studies have shown that certain salts can inhibit the action of certain antimicrobials [138,139]. For example, monovalent and divalent cation salts can inhibit the action of aminoglycosides and ethambutol against M. smegmatis [138,140]. This effect seems to be universal since cations can affect multiple drug classes. In general, a cell requires a small, optimal amount of cations to maintain its intracellular ionic state. However, in higher concentrations, cations can prevent antimicrobials from reaching their target. For example, binding of dihydrostreptomycin to its target, the ribosome, was significantly decreased in the presence of 10 mM Mg2+[141]. Both fumarate and succinate are added to the media in the form  87  of their sodium salt. Sodium is a monovalent cation and as such may contribute to this effect. Fumarate and succinate were added at high concentrations relative to the drug in combination. Perhaps the cell envelope in FRDhsp is in fact more permeable than VC and more fumarate/succinate can enter the cell. This could effectively increase the amount of intracellular sodium cation, which could in turn prevent the antimicrobial from reaching its target. The end result would be antagonism. Furthermore, excess cation may skew the cellular ionic balance thus affecting other basic cellular processes. With other cellular processes involved, the apparent antagonistic effect seen is no longer fumarate/succinate and antimicrobial-specific. Since this is speculation, the uptake and binding of each antimicrobial needs to be evaluated in the presence of other monovalent and divalent cations to see if the antagonism seen is specific to sodium salt and/or fumarate/succinate. Furthermore, this effect is not universal as fusidic acid, novobiocin and rifampin in combination with fumarate and succinate and vancomycin in combination with fumarate had no interaction. Reasons for this are unclear. Uptake and binding assays could provide insight.  88  Chapter 4: Conclusions and future directions 4.1 Conclusions The results presented in this thesis indicate a role for FRD in M. tuberculosis virulence. Supporting evidence includes the observed decreased viability in MΦs of the M. tuberculosis FRD KO compared to WT. FRD is hypothesized to allow M. tuberculosis to use fumarate as a terminal electron acceptor when oxygen is limiting. In so doing, NAD+ is regenerated and can then drive other processes necessary for cellular life. During an infection, M. tuberculosis resides within the phagosome of a MΦ, an environment that is oxygen limited. In the M. tuberculosis FRD KO, bacilli do not have the means to acquire energy in this environment and as such, viability is decreased. To use this information on a greater scale, inhibitors specific to FRD could be used as a valuable tool in treating tuberculosis. An inhibitor specific to FRD should produce the same effect as the M. tuberculosis FRD KO – fewer viable bacteria within MΦs. This idea is promising since mammals do not have FRD. Thus, any FRD-specific inhibitor should cause few or no unwanted side effects. Some putative FRD inhibitors did work against M. tuberculosis and M. bovis BCG, though specificity is doubtful. The results presented in this thesis also demonstrate a link between FRD and drug susceptibility. This interpretation is supported by the fact that M. smegmatis expressing M. tuberculosis FRD is more susceptible to a variety of antimicrobials. Two theories to explain these results have been proposed. (1) M. smegmatis FRDhsp has a different colony morphology than WT, which indicates a change in cell envelope composition. This change may make FRDhsp more permeable to antimicrobials and thus more sensitive.  89  (2) FRD can “leak electrons” which can combine with other cellular components to produce toxic free radicals. FRDhsp would thus have an initial decreased fitness relative to WT and as such, be more susceptible to antibiotics. While the effect of the FrdABCD construct in M. smegmatis is obvious, the mechanism of action of this effect is still unknown. Perhaps elucidating this mechanism may reveal insights into the role of FRD in virulence, hypoxic growth and drug susceptibility/resistance all leading to novel treatment options for tuberculosis.  4.2 Future directions 4.2.1. Complementation of the M. tuberculosis FRD KO It was shown that M. tuberculosis FRD KO is less viable in MΦs relative to WT, implicating FRD in M. tuberculosis virulence. However, the decrease in virulence cannot be completely attributed to FRD until the complemented strain has been generated. This should also be done with a construct in which FRD expression is driven exclusively by its own promoter. All experiments presented comparing M. tuberculosis WT and FRD KO must also be repeated with the complemented strain. Only then can FRD be named as an M. tuberculosis virulence factor.  4.2.2. Growth of M. tuberculosis WT, FRD KO and complement in aerobic and hypoxic conditions in the presence and absence of fumarate Although the growth of WT and FRD KO was evaluated in aerobic conditions, the length of the experiment needs to be increased to include the stationary phase of growth. Furthermore,  90  the experiment assessing viability of WT and FRD KO after 21 days of hypoxic growth should be repeated to include multiple time points. Note that the FRD complemented strain should be included in both experiments discussed above.  4.2.3. Evaluating FRD as an M. tuberculosis virulence factor in vivo To obtain a deeper understanding of FRD and its role in M. tuberculosis virulence, an in vivo study needs to be performed. CD1 mice will be infected with M. tuberculosis WT, FRD KO and complemented strain. CFU counts from the lungs and spleen will determine the M. tuberculosis burden and survival over time will be monitored.  4.2.4. Treatment of M. tuberculosis-infected macrophages with putative FRD inhibitors It has been shown that certain putative FRD inhibitors are effective in reducing viable M. tuberculosis CFUs in hypoxic conditions. Since the phagosome of the MΦ has a low oxygen tension, it follows that those same putative FRD inhibitors should also be mycobactericidal in a MΦ infection model. Furthermore, if MΦs are infected with M. tuberculosis FRD KO and treated with a FRD inhibitor, there should be no effect since the drug target is absent. This would only work if each FRD inhibitor were specific to only FRD, which is known not to be the case. As such, the specificity of each putative FRD inhibitor against M. tuberculosis FRD should also be evaluated.  91  4.2.5. Cell envelope composition and permeability of M. smegmatis FRD As stated previously, the colony morphology of M. smegmatis FRDhsp is different from WT. This difference is likely due to a change in cell envelope composition. Mass spectrometry of cell envelope lipids would be a useful tool in determining the reason behind this unique morphology. Furthermore, a change in cell envelope usually indicates a change in permeability. Permeability could be evaluated using a radioactive antibiotic and quantifying how much antibiotic gets into M. smegmatis WT versus FRDhsp.  92  References 1. Dye C (2000) Tuberculosis 2000-2010: control, but not elimination. Int J Tuberc Lung Dis 4: S146-152. 2. Iwai K, Maeda S, Murase Y (2010) [Archaeology of tubercle bacilli and tuberculosis]. Kekkaku 85: 465-475. 3. Comas I, Gagneux S (2009) The past and future of tuberculosis research. PLoS Pathog 5: e1000600. 4. Brooks WD, Juler FA, Williams ER (1940) On the relationship between chronic iridocyclitis and tuberculosis, and the appripriate theryapy. Br J Ophthalmol 24: 317-366. 5. Koul A, Arnoult E, Lounis N, Guillemont J, Andries K (2011) The challenge of new drug discovery for tuberculosis. Nature 469: 483-490. 6. Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, et al. (1998) Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393: 537-544. 7. Daffé M, Draper P (1998) The envelope layers of mycobacteria with reference to their pathogenicity. Advances in Microbial Physiology 39: 131-203. 8. Hickey TBM, Thorson LM, Speert DP, Daffé M, Stokes RW (2009) Mycobacterium tuberculosis Cpn60.2 and DnaK are located on the bacterial surface, where Cpn60.2 facilitates efficient bacterial association with macrophages. Infection and Immunity 77: 3389-3401. 9. TRUANT JP, BRETT WA, Thomas W (1962) Fluorescence microscopy of tubercle bacilli stained with auramine and rhodamine. Henry Ford Hosp Med Bull 10: 287-296. 10. LoBue PA, Enarson DA, Thoen TC (2010) Tuberculosis in humans and its epidemiology, diagnosis and treatment in the United States. Int J Tuberc Lung Dis 14: 1226-1232. 11. Andreu J, Cáceres J, Pallisa E, Martinez-Rodriguez M (2004) Radiological manifestations of pulmonary tuberculosis. Eur J Radiol 51: 139-149. 12. Hopewell PC (1995) A clinical view of tuberculosis. Radiol Clin North Am 33: 641-653. 13. Boshoff HIM, Barry CE (2005) Tuberculosis - metabolism and respiration in the absence of growth. Nat Rev Microbiol 3: 70-80. 14. Via LE, Lin PL, Ray SM, Carrillo J, Allen SS, et al. (2008) Tuberculous granulomas are hypoxic in guinea pigs, rabbits, and nonhuman primates. Infection and Immunity 76: 2333-2340. 15. Sellam J, Hamdi H, Roy C, Baron G, Lemann M, et al. (2007) Comparison of in vitrospecific blood tests with tuberculin skin test for diagnosis of latent tuberculosis before anti-TNF therapy. Ann Rheum Dis 66: 1610-1615. 16. Zhang Y, Yew WW (2009) Mechanisms of drug resistance in Mycobacterium tuberculosis. Int J Tuberc Lung Dis 13: 1320-1330. 17. Check E (2007) After decades of drought, new drug possibilities flood TB pipeline. Nat Med 13: 266. 18. Sterling TR (2008) New approaches to the treatment of latent tuberculosis. Semin Respir Crit Care Med 29: 532-541. 19. Mustafa Abu S, Al-Attiyah R (2003) Tuberculosis: looking beyond BCG vaccines. J Postgrad Med 49: 134-140. 20. Oettinger T, Jørgensen M, Ladefoged A, Hasløv K, Andersen P (1999) Development of the Mycobacterium bovis BCG vaccine: review of the historical and biochemical evidence for a genealogical tree. Tuber Lung Dis 79: 243-250. 93  21. Osborn TW (1983) Changes in BCG strains. Tubercle 64: 1-13. 22. Horwitz MA, Harth G, Dillon BJ, Maslesa-Galić S (2009) Commonly administered BCG strains including an evolutionarily early strain and evolutionarily late strains of disparate genealogy induce comparable protective immunity against tuberculosis. Vaccine 27: 441445. 23. Fine PE, Floyd S, Stanford JL, Nkhosa P, Kasunga A, et al. (2001) Environmental mycobacteria in northern Malawi: implications for the epidemiology of tuberculosis and leprosy. Epidemiol Infect 126: 379-387. 24. Brimnes N (2008) BCG vaccination and WHO's global strategy for tuberculosis control 1948-1983. Soc Sci Med 67: 863-873. 25. Brandt L, Elhay M, Rosenkrands I, Lindblad EB, Andersen P (2000) ESAT-6 subunit vaccination against Mycobacterium tuberculosis. Infect Immun 68: 791-795. 26. Lozes E, Denis O, Drowart A, Jurion F, Palfliet K, et al. (1997) Cross-reactive immune responses against Mycobacterium bovis BCG in mice infected with non-tuberculous mycobacteria belonging to the MAIS-Group. Scand J Immunol 46: 16-26. 27. Flaherty DK, Vesosky B, Beamer GL, Stromberg P, Turner J (2006) Exposure to Mycobacterium avium can modulate established immunity against Mycobacterium tuberculosis infection generated by Mycobacterium bovis BCG vaccination. Journal of Leukocyte Biology 80: 1262-1271. 28. de Lisle GW, Wards BJ, Buddle BM, Collins DM (2005) The efficacy of live tuberculosis vaccines after presensitization with Mycobacterium avium. Tuberculosis (Edinb) 85: 7379. 29. James PE, Grinberg OY, Michaels G, Swartz HM (1995) Intraphagosomal oxygen in stimulated macrophages. J Cell Physiol 163: 241-247. 30. Schnappinger D, Ehrt S, Voskuil MI, Liu Y, Mangan JA, et al. (2003) Transcriptional Adaptation of Mycobacterium tuberculosis within Macrophages: Insights into the Phagosomal Environment. J Exp Med 198: 693-704. 31. Desjardins M (1995) Biogenesis of phagolysosomes: the 'kiss and run' hypothesis. Trends Cell Biol 5: 183-186. 32. Clemens DL (1996) Characterization of the Mycobacterium tuberculosis phagosome. Trends Microbiol 4: 113-118. 33. Pitt A, Mayorga LS, Stahl PD, Schwartz AL (1992) Alterations in the protein composition of maturing phagosomes. J Clin Invest 90: 1978-1983. 34. Axelrod S, Oschkinat H, Enders J, Schlegel B, Brinkmann V, et al. (2008) Delay of phagosome maturation by a mycobacterial lipid is reversed by nitric oxide. Cellular Microbiology 10: 1530-1545. 35. Kaufmann SH (2001) How can immunology contribute to the control of tuberculosis? Nat Rev Immunol 1: 20-30. 36. Clemens DL, Horwitz MA (1995) Characterization of the Mycobacterium tuberculosis phagosome and evidence that phagosomal maturation is inhibited. J Exp Med 181: 257270. 37. Sturgill-Koszycki S, Schaible UE, Russell DG (1996) Mycobacterium-containing phagosomes are accessible to early endosomes and reflect a transitional state in normal phagosome biogenesis. EMBO J 15: 6960-6968.  94  38. Xu S, Cooper A, Sturgill-Koszycki S, van Heyningen T, Chatterjee D, et al. (1994) Intracellular trafficking in Mycobacterium tuberculosis and Mycobacterium aviuminfected macrophages. J Immunol 153: 2568-2578. 39. van Crevel R, Ottenhoff THM, van der Meer JWM (2002) Innate immunity to Mycobacterium tuberculosis. Clin Microbiol Rev 15: 294-309. 40. Grotzke JE, Harriff MJ, Siler AC, Nolt D, Delepine J, et al. (2009) The Mycobacterium tuberculosis phagosome is a HLA-I processing competent organelle. PLoS Pathog 5: e1000374. 41. Piddington DL, Fang FC, Laessig T, Cooper AM, Orme IM, et al. (2001) Cu,Zn superoxide dismutase of Mycobacterium tuberculosis contributes to survival in activated macrophages that are generating an oxidative burst. Infection and Immunity 69: 49804987. 42. Jackett PS, Aber VR, Lowrie DB (1978) Virulence and resistance to superoxide, low pH and hydrogen peroxide among strains of Mycobacterium tuberculosis. J Gen Microbiol 104: 37-45. 43. Li AH, Lam WL, Stokes RW (2008) Characterization of genes differentially expressed within macrophages by virulent and attenuated Mycobacterium tuberculosis identifies candidate genes involved in intracellular growth. Microbiology (Reading, Engl) 154: 2291-2303. 44. Sassetti CM, Boyd DH, Rubin EJ (2001) Comprehensive identification of conditionally essential genes in mycobacteria. Proc Natl Acad Sci USA 98: 12712-12717. 45. Sassetti CM, Rubin EJ (2003) Genetic requirements for mycobacterial survival during infection. Proc Natl Acad Sci USA 100: 12989-12994. 46. Rengarajan J, Bloom BR, Rubin EJ (2005) Genome-wide requirements for Mycobacterium tuberculosis adaptation and survival in macrophages. Proc Natl Acad Sci USA 102: 8327-8332. 47. Van Hellemond JJ, Tielens AG (1994) Expression and functional properties of fumarate reductase. Biochem J 304 ( Pt 2): 321-331. 48. Cecchini G, Schröder I, Gunsalus RP, Maklashina E (2002) Succinate dehydrogenase and fumarate reductase from Escherichia coli. Biochim Biophys Acta 1553: 140-157. 49. Guest JR (1981) Partial replacement of succinate dehydrogenase function by phage- and plasmid-specified fumarate reductase in Escherichia coli. J Gen Microbiol 122: 171-179. 50. Akhter Y, Tundup S, Hasnain SE (2007) Novel biochemical properties of a CRP/FNR family transcription factor from Mycobacterium tuberculosis. Int J Med Microbiol 297: 451-457. 51. Crack J, Green J, Thomson AJ (2004) Mechanism of oxygen sensing by the bacterial transcription factor fumarate-nitrate reduction (FNR). J Biol Chem 279: 9278-9286. 52. Akhter Y, Yellaboina S, Farhana A, Ranjan A, Ahmed N, et al. (2008) Genome scale portrait of cAMP-receptor protein (CRP) regulons in mycobacteria points to their role in pathogenesis. Gene 407: 148-158. 53. Green J, Guest JR (1993) Activation of FNR-dependent transcription by iron: an in vitro switch for FNR. FEMS Microbiol Lett 113: 219-222. 54. Guest JR (1992) Oxygen-regulated gene expression in Escherichia coli. The 1992 Marjory Stephenson Prize Lecture. J Gen Microbiol 138: 2253-2263. 55. Green J, Bennett B, Jordan P, Ralph ET, Thomson AJ, et al. (1996) Reconstitution of the [4Fe-4S] cluster in FNR and demonstration of the aerobic-anaerobic transcription switch in vitro. Biochem J 316 ( Pt 3): 887-892. 95  56. Jones HM, Gunsalus RP (1985) Transcription of the Escherichia coli fumarate reductase genes (frdABCD) and their coordinate regulation by oxygen, nitrate, and fumarate. Journal of Bacteriology 164: 1100-1109. 57. Schnell R, Agren D, Schneider G (2008) 1.9 A structure of the signal receiver domain of the putative response regulator NarL from Mycobacterium tuberculosis. Acta Crystallogr Sect F Struct Biol Cryst Commun 64: 1096-1100. 58. Gunsalus RP (1992) Control of electron flow in Escherichia coli: coordinated transcription of respiratory pathway genes. Journal of Bacteriology 174: 7069-7074. 59. Schröder I, Wolin CD, Cavicchioli R, Gunsalus RP (1994) Phosphorylation and dephosphorylation of the NarQ, NarX, and NarL proteins of the nitrate-dependent twocomponent regulatory system of Escherichia coli. Journal of Bacteriology 176: 49854992. 60. James BW, Williams A, Marsh PD (2000) The physiology and pathogenicity of Mycobacterium tuberculosis grown under controlled conditions in a defined medium. J Appl Microbiol 88: 669-677. 61. Kozak RA, Alexander DC, Liao R, Sherman DR, Behr MA (2011) Region of difference 2 contributes to virulence of Mycobacterium tuberculosis. Infection and Immunity 79: 5966. 62. Mahairas GG, Sabo PJ, Hickey MJ, Singh DC, Stover CK (1996) Molecular analysis of genetic differences between Mycobacterium bovis BCG and virulent M. bovis. Journal of Bacteriology 178: 1274-1282. 63. Lewis KN, Liao R, Guinn KM, Hickey MJ, Smith S, et al. (2003) Deletion of RD1 from Mycobacterium tuberculosis mimics bacille Calmette-Guérin attenuation. J Infect Dis 187: 117-123. 64. Mclaughlin B, Chon JS, Macgurn JA, Carlsson F, Cheng TL, et al. (2007) A mycobacterium ESX-1-secreted virulence factor with unique requirements for export. PLoS Pathog 3: e105. 65. Shiloh MU, DiGiuseppe Champion PA (2010) To catch a killer. What can mycobacterial models teach us about Mycobacterium tuberculosis pathogenesis? Curr Opin Microbiol 13: 86-92. 66. Snapper SB, Melton RE, Mustafa S, Kieser T, Jacobs WR (1990) Isolation and characterization of efficient plasmid transformation mutants of Mycobacterium smegmatis. Mol Microbiol 4: 1911-1919. 67. van Kessel JC, Marinelli LJ, Hatfull GF (2008) Recombineering mycobacteria and their phages. Nat Rev Micro 6: 851-857. 68. Mayuri, Bagchi G, Das TK, Tyagi JS (2002) Molecular analysis of the dormancy response in Mycobacterium smegmatis: expression analysis of genes encoding the DevR-DevS twocomponent system, Rv3134c and chaperone alpha-crystallin homologues. FEMS Microbiol Lett 211: 231-237. 69. Horsefield R, Iwata S, Byrne B (2004) Complex II from a structural perspective. Curr Protein Pept Sci 5: 107-118. 70. Kohanski MA, Dwyer DJ, Hayete B, Lawrence CA, Collins JJ (2007) A common mechanism of cellular death induced by bactericidal antibiotics. Cell 130: 797-810. 71. van Kessel JC, Hatfull GF (2007) Recombineering in Mycobacterium tuberculosis. Nat Methods 4: 147-152.  96  72. Mangan JA, Sole KM, Mitchison DA, Butcher PD (1997) An effective method of RNA extraction from bacteria refractory to disruption, including mycobacteria. Nucleic Acids Res 25: 675-676. 73. Stokes RW, Norris-Jones R, Brooks DE, Beveridge TJ, Doxsee D, et al. (2004) The glycanrich outer layer of the cell wall of Mycobacterium tuberculosis acts as an antiphagocytic capsule limiting the association of the bacterium with macrophages. Infection and Immunity 72: 5676-5686. 74. Dick T, Lee BH, Murugasu-Oei B (1998) Oxygen depletion induced dormancy in Mycobacterium smegmatis. FEMS Microbiol Lett 163: 159-164. 75. Mottier ML, Alvarez LI, Pis MA, Lanusse CE (2003) Transtegumental diffusion of benzimidazole anthelmintics into Moniezia benedeni: correlation with their octanol-water partition coefficients. Exp Parasitol 103: 1-7. 76. Barrowman MM, Marriner SE, Bogan JA (1984) The fumarate reductase system as a site of anthelmintic attack in Ascaris suum. Biosci Rep 4: 879-883. 77. Rivera JC, Yépez-Mulia L, Hernández-Campos A, Moreno-Esparza R, Castillo R, et al. (2007) Biopharmaceutic evaluation of novel anthelmintic (1H-benzimidazol-5(6)yl)carboxamide derivatives. Int J Pharm 343: 159-165. 78. Showe (2008) Prestwick2007 TAACF Public Data.xls. Tuberculosis (Edinb): 1-280. 79. Malkin MF, Camacho RM (1972) The effect of thiabendazole on fumarate reductase from thiabendazole-sensitive and resistant Haemonchus contortus. J Parasitol 58: 845-846. 80. Ui H, Shiomi K, Yamaguchi Y, Masuma R, Nagamitsu T, et al. (2001) Nafuredin, a novel inhibitor of NADH-fumarate reductase, produced by Aspergillus niger FT-0554. J Antibiot 54: 234-238. 81. Chen M, Brøgger Christensen S, Zhai L, Rasmussen MH, Theander TG, et al. (1997) The novel oxygenated chalcone, 2,4-dimethoxy-4'-butoxychalcone, exhibits potent activity against human malaria parasite Plasmodium falciparum in vitro and rodent parasites Plasmodium berghei and Plasmodium yoelii in vivo. J Infect Dis 176: 1327-1333. 82. Köhler P, Bachmann R (1978) The effects of the antiparasitic drugs levamisole, thiabendazole, praziquantel, and chloroquine on mitochondrial electron transport in muscle tissue from Ascaris suum. Mol Pharmacol 14: 155-163. 83. Turrens JF, Newton CL, Zhong L, Hernandez FR, Whitfield J, et al. (1999) Mercaptopyridine-N-oxide, an NADH-fumarate reductase inhibitor, blocks Trypanosoma cruzi growth in culture and in infected myoblasts. FEMS Microbiol Lett 175: 217-221. 84. Lamore SD, Cabello CM, Wondrak GT (2010) The topical antimicrobial zinc pyrithione is a heat shock response inducer that causes DNA damage and PARP-dependent energy crisis in human skin cells. Cell Stress and Chaperones 15: 309-322. 85. Mracek J, Snyder SJ, Chavez UB, Turrens JF (1991) A soluble fumarate reductase in Trypanosoma brucei procyclic trypomastigotes. J Protozool 38: 554-558. 86. Bardarov S, Bardarov Jr S, Pavelka Jr MS, Sambandamurthy V, Larsen M, et al. (2002) Specialized transduction: an efficient method for generating marked and unmarked targeted gene disruptions in Mycobacterium tuberculosis, M. bovis BCG and M. smegmatis. Microbiology (Reading, Engl) 148: 3007-3017. 87. Kalpana GV, Bloom BR, Jacobs WR (1991) Insertional mutagenesis and illegitimate recombination in mycobacteria. Proc Natl Acad Sci USA 88: 5433-5437. 88. Aldovini A, Husson RN, Young RA (1993) The uraA locus and homologous recombination in Mycobacterium bovis BCG. Journal of Bacteriology 175: 7282-7289. 97  89. Stover CK, de la Cruz VF, Fuerst TR, Burlein JE, Benson LA, et al. (1991) New use of BCG for recombinant vaccines. Nature 351: 456-460. 90. Murry J, Sassetti CM, Moreira J, Lane J, Rubin EJ (2005) A new site-specific integration system for mycobacteria. Tuberculosis (Edinb) 85: 317-323. 91. Chandler CJ, Segel IH (1978) Mechanism of the antimicrobial action of pyrithione: effects on membrane transport, ATP levels, and protein synthesis. Antimicrob Agents Chemother 14: 60-68. 92. Gilbert P, Collier PJ, Brown MR (1990) Influence of growth rate on susceptibility to antimicrobial agents: biofilms, cell cycle, dormancy, and stringent response. Antimicrob Agents Chemother 34: 1865-1868. 93. Spencer ME, Guest JR (1973) Isolation and properties of fumarate reductase mutants of Escherichia coli. Journal of Bacteriology 114: 563-570. 94. Imlay JA (1995) A metabolic enzyme that rapidly produces superoxide, fumarate reductase of Escherichia coli. J Biol Chem 270: 19767-19777. 95. Blaut M, Whittaker K, Valdovinos A, Ackrell BA, Gunsalus RP, et al. (1989) Fumarate reductase mutants of Escherichia coli that lack covalently bound flavin. J Biol Chem 264: 13599-13604. 96. Chait R, Craney A, Kishony R (2007) Antibiotic interactions that select against resistance. Nature 446: 668-671. 97. Hall MJ, Middleton RF, Westmacott D (1983) The fractional inhibitory concentration (FIC) index as a measure of synergy. J Antimicrob Chemother 11: 427-433. 98. Stevens DL, Madaras-Kelly KJ, Richards DM (1998) In vitro antimicrobial effects of various combinations of penicillin and clindamycin against four strains of Streptococcus pyogenes. Antimicrobial Agents and Chemotherapy 42: 1266-1268. 99. Fontán PA, Voskuil MI, Gomez M, Tan D, Pardini M, et al. (2009) The Mycobacterium tuberculosis sigma factor sigmaB is required for full response to cell envelope stress and hypoxia in vitro, but it is dispensable for in vivo growth. Journal of Bacteriology 191: 5628-5633. 100. Ferrer NL, Gomez AB, Neyrolles O, Gicquel B, Martin C (2010) Interactions of attenuated Mycobacterium tuberculosis phoP mutant with human macrophages. PLoS ONE 5: e12978. 101. Chen L, Zhou B, Zhang S, Wu L, Wang Y, et al. (2010) Identification and characterization of novel inhibitors of mPTPB, an essential virulent phosphatase from Mycobacterium tuberculosis. ACS Med Chem Lett 1: 355-359. 102. Amon J, Titgemeyer F, Burkovski A (2009) A genomic view on nitrogen metabolism and nitrogen control in mycobacteria. J Mol Microbiol Biotechnol 17: 20-29. 103. Ohashi Y, Shi W, Takatani N, Aichi M, Maeda S-I, et al. (2011) Regulation of nitrate assimilation in cyanobacteria. Journal of Experimental Botany 62: 1411-1424. 104. Campbell MA, Chain PSG, Dang H, El Sheikh AF, Norton JM, et al. (2010) Nitrosococcus watsonii sp. nov., a new species of marine obligate ammonia-oxidizing bacteria that is not omnipresent in the world's oceans: calls to validate the names 'Nitrosococcus halophilus' and 'Nitrosomonas mobilis'. FEMS Microbiology Ecology. 105. Hope JC, Thom ML, McCormick PA, Howard CJ (2004) Interaction of antigen presenting cells with mycobacteria. Vet Immunol Immunopathol 100: 187-195. 106. Padgett EL, Pruett SB (1992) Evaluation of nitrite production by human monocyte-derived macrophages. Biochem Biophys Res Commun 186: 775-781. 98  107. Lougheed KEA, Taylor DL, Osborne SA, Bryans JS, Buxton RS (2009) New antituberculosis agents amongst known drugs. Tuberculosis (Edinb) 89: 364-370. 108. McMillian MK, Li L, Parker JB, Patel L, Zhong Z, et al. (2002) An improved resazurinbased cytotoxicity assay for hepatic cells. Cell Biol Toxicol 18: 157-173. 109. Lemire BD, Robinson JJ, Weiner JH (1982) Identification of membrane anchor polypeptides of Escherichia coli fumarate reductase. Journal of Bacteriology 152: 11261131. 110. Turrens JF (1987) Possible role of the NADH-fumarate reductase in superoxide anion and hydrogen peroxide production in Trypanosoma brucei. Mol Biochem Parasitol 25: 55-60. 111. Cheah KS (1967) The oxidase systems of Moniezia expansa (Cestoda). Comp Biochem Physiol 23: 277-302. 112. Belisle JT, Brennan PJ (1994) Molecular basis of colony morphology in Mycobacterium avium. Res Microbiol 145: 237-242. 113. Whiteford DC, Klingelhoets JJ, Bambenek MH, Dahl JL (2010) Deletion of the histone like protein (Hlp) from Mycobacterium smegmatis results in increased sensitivity to UV exposure, freezing, and isoniazid. Microbiology (Reading, Engl). 114. Newton GL, Unson MD, Anderberg SJ, Aguilera JA, Oh NN, et al. (1999) Characterization of Mycobacterium smegmatis mutants defective in 1-d-myo-inosityl-2-amino-2-deoxyalpha-d-glucopyranoside and mycothiol biosynthesis. Biochem Biophys Res Commun 255: 239-244. 115. Weiner JH, Lemire BD, Elmes ML, Bradley RD, Scraba DG (1984) Overproduction of fumarate reductase in Escherichia coli induces a novel intracellular lipid-protein organelle. Journal of Bacteriology 158: 590-596. 116. Runyon EH (1970) Pigment variations in photochromogenic mycobacteria with special reference to M. vaccae. Pneumonologie 142: 90-93. 117. Ramakrishnan L, Tran HT, Federspiel NA, Falkow S (1997) A crtB homolog essential for photochromogenicity in Mycobacterium marinum: isolation, characterization, and gene disruption via homologous recombination. Journal of Bacteriology 179: 5862-5868. 118. Viveiros M, Krubasik P, Sandmann G, Houssaini-Iraqui M (2000) Structural and functional analysis of the gene cluster encoding carotenoid biosynthesis in Mycobacterium aurum A+. FEMS Microbiol Lett 187: 95-101. 119. Choi S-K, Nishida Y, Matsuda S, Adachi K, Kasai H, et al. (2005) Characterization of betacarotene ketolases, CrtW, from marine bacteria by complementation analysis in Escherichia coli. Mar Biotechnol 7: 515-522. 120. Pérez-Díaz IM, McFeeters RF (2010) Preservation of acidified cucumbers with a natural preservative combination of fumaric acid and allyl isothiocyanate that target lactic acid bacteria and yeasts. Journal of Food Science 75: M204-208. 121. Kim M-J, Park K-J, Ko I-J, Kim YM, Oh J-I (2010) Different roles of DosS and DosT in the hypoxic adaptation of Mycobacteria. Journal of Bacteriology 192: 4868-4875. 122. Sherman DR, Voskuil M, Schnappinger D, Liao R, Harrell MI, et al. (2001) Regulation of the Mycobacterium tuberculosis hypoxic response gene encoding alpha -crystallin. Proc Natl Acad Sci USA 98: 7534-7539. 123. Tyagi JS, Sharma D (2002) Mycobacterium smegmatis and tuberculosis. Trends Microbiol 10: 68-69.  99  124. Park H-D, Guinn KM, Harrell MI, Liao R, Voskuil MI, et al. (2003) Rv3133c/dosR is a transcription factor that mediates the hypoxic response of Mycobacterium tuberculosis. Mol Microbiol 48: 833-843. 125. Flores Valdez MA, Schoolnik GK (2010) DosR-regulon genes induction in Mycobacterium bovis BCG under aerobic conditions. Tuberculosis (Edinb) 90: 197-200. 126. Purdy GE, Niederweis M, Russell DG (2009) Decreased outer membrane permeability protects mycobacteria from killing by ubiquitin-derived peptides. Molecular Microbiology 73: 844-857. 127. Barkan D, Liu Z, Sacchettini JC, Glickman MS (2009) Mycolic acid cyclopropanation is essential for viability, drug resistance, and cell wall integrity of Mycobacterium tuberculosis. Chemistry & Biology 16: 499-509. 128. Jarlier V, Nikaido H (1994) Mycobacterial cell wall: structure and role in natural resistance to antibiotics. FEMS Microbiol Lett 123: 11-18. 129. Stone KJ, Strominger JL (1971) Mechanism of action of bacitracin: complexation with metal ion and C 55 -isoprenyl pyrophosphate. Proc Natl Acad Sci USA 68: 3223-3227. 130. Bodley JW, Zieve FJ, Lin L, Zieve ST (1969) Formation of the ribosome-G factor-GDP complex in the presence of fusidic acid. Biochem Biophys Res Commun 37: 437-443. 131. Maxwell A (1999) DNA gyrase as a drug target. Biochem Soc Trans 27: 48-53. 132. Sethi VS (1971) Structure and function of DNA-dependent RNA-polymerase. Prog Biophys Mol Biol 23: 67-101. 133. Davies J, Anderson P, Davis BD (1965) Inhibition of protein synthesis by spectinomycin. Science 149: 1096-1098. 134. Perkins HR, Nieto M (1974) The chemical basis for the action of the vancomycin group of antibiotics. Ann N Y Acad Sci 235: 348-363. 135. Hirsch CA, Rasminsky M, Davis BD, Lin EC (1963) A fumarate reductase in Escherichia coli distinct from succinate dehydrogenase. J Biol Chem 238: 3770-3774. 136. Yazar E, Elmas M, Altunok V, Sivrikaya A, Oztekin E, et al. (2003) Effects of aminoglycoside antibiotics on renal antioxidants, malondialdehyde levels, and some serum biochemical parameters. Can J Vet Res 67: 239-240. 137. Sassetti CM, Boyd DH, Rubin EJ (2003) Genes required for mycobacterial growth defined by high density mutagenesis. Mol Microbiol 48: 77-84. 138. Beggs WH, Andrews FA (1973) Nonspecific ionic inhibition of ethambutol binding by Mycobacterium smegmatis. Antimicrob Agents Chemother 4: 115-119. 139. Beggs WH, Andrews FA (1976) Role of ionic strength in salt antagonism of aminoglycoside action on Escherichia coli and Pseudomonas aeruginosa. J Infect Dis 134: 500-504. 140. Beggs WH, Andrews FA (1975) Inhibition of dihydrostreptomycin action on Mycobacterium smegmatis by monovalent and divalent cation salts. Antimicrobial Agents and Chemotherapy 7: 636-639. 141. Chang FN, Flaks JG (1972) Binding of dihydrostreptomycin to Escherichia coli ribosomes: characteristics and equilibrium of the reaction. Antimicrobial Agents and Chemotherapy 2: 294-307.  100  Appendix A: Supplementary figures  Figure S1: pMV361:FrdABCD plasmid map  101  Figure S2: pMV361:FrdABCD plasmid sequence LOCUS SOURCE COMMENT FEATURES  pMV361:FrdABCD  CDS misc_feature misc_feature misc_feature misc_feature  CDS CDS CDS  DNA  circular  11-Apr-2011  This file was created by DNADynamo Location/Qualifiers  CDS  CDS  7976 bp  121..935 /gene="aph" /product="aph" 2737..3738 /gene="int" /product="int" 4055..4060 /label="Hsp60 Promoter -35" /note="Hsp60 -35" 4079..4084 /label="Hsp60 Promoter -10" /note="Hsp60 -10" 4085..4496 /label="Putative FRD Promoter" /note="Frd Promoter" 4211..4230 /label="Putative FNR binding site" /note="FNR binding site" 4497..6248 /gene="frdA" /product="frdA" 6251..6990 /gene="frdB" /product="frdB" 6991..7367 /gene="frdC" /product="frdC" 7368..7745 /gene="frdD" /product="frdD"  ORIGIN 1 61 121 181 241 301 361 421 481 541 601 661 721 781 841 901 961 1021 1081 1141 1201 1261  gctagccaac aatatatcat atgagccata gctgatttat tatcgcttgt gttgccaatg cttccgacca atccccggga gttgatgcgc tttaacagcg gttgatgcga gaaatgcata cttgataacc ggaatcgcag ccttcattac ttgcagtttc cactggcaga ttgctgagtt agcaaaagtt ccctcacttt cttcacgagg gatcttcttg  aaagcgacgt catgaacaat ttcaacggga atgggtataa atgggaagcc atgttacaga tcaagcattt aaacagcatt tggcagtgtt atcgcgtatt gtgattttga atcttttgcc ttatttttga accgatacca agaaacggct atttgatgct gcattacgct gaaggatcag caaaatcacc ctggctggat cagacctcac agatcctttt  tgtgtctcaa aaaactgtct aacgtcttgc atgggctcgc ccatgcgcca tgagatggtc tatccgtact ccaggtatta cctgcgccgg tcgtctcgct tgacgagcgt attctcaccg cgaggggaaa ggatcttgcc ttttcaaaaa cgatgagttt gacttgacgg atcacgcatc aactggtcca gatggggcga tagttccact tttctgcgcg  aatctctgat gcttacataa tcgaggccgc gataatgtcg gagttgtttc agactaaact cctgatgatg gaagaatatc ttgcattcga caggcgcaat aatggctggc gattcagtcg ttaataggtt atcctatgga tatggtattg ttctaatcag gacggcggct ttcccgacaa cctacaacaa ttcaggcctg gagcgtcaga taatctgctg  gttacattgc acagtaatac gattaaattc ggcaatcagg tgaaacatgg ggctgacgga catggttact ctgattcagg ttcctgtttg cacgaatgaa ctgttgaaca tcactcatgg gtattgatgt actgcctcgg ataatcctga aattggttaa ttgttgaata cgcagaccgt agctctcatc gtatgagtca ccccgtagaa cttgcaaaca  acaagataaa aaggggtgtt caacatggat tgcgacaatc caaaggtagc atttatgcct caccactgcg tgaaaatatt taattgtcct taacggtttg agtctggaaa tgatttctca tggacgagtc tgagttttct tatgaataaa ttggttgtaa aatcgaactt tccgtggcaa aaccgtggct gcaacacctt aagatcaaag aaaaaaccac  102  1321 1381 1441 1501 1561 1621 1681 1741 1801 1861 1921 1981 2041 2101 2161 2221 2281 2341 2401 2461 2521 2581 2641 2701 2761 2821 2881 2941 3001 3061 3121 3181 3241 3301 3361 3421 3481 3541 3601 3661 3721 3781 3841 3901 3961 4021 4081 4141 4201 4261 4321 4381 4441 4501 4561 4621 4681 4741 4801 4861 4921 4981 5041  cgctaccagc ctggcttcag accacttcaa tggctgctgc cggataaggc gaacgaccta ccgaagggag cgagggagct tctgacttga ccagcaacgc ttcctgcgtt ccgctcgccg ctagagtcga tcgctgagag gctgcaactc tggtgtgaat gaaagtagcc aagagttgca ggagcgggcg cacatatggg agaaattgca gtagccttgt gactcagcgc ctacgcgctg gcggctcatc cagcgccatc cggcaccagg agtggcggtc gaagcacccg ggtcgaggac gcgcgacgta gcactaccgg cgagcttcgc tggcgcttcc gcgtcctgtg tacgaagatg gtcgaagtcc actccgcatc gaccaaggag gatggcgtct ctcctgaaac tgtcagtacg acctgggcac tgaccacaac tgttgtcgtt gtcgaacgag gaataacgtt cgccagggcc gcatagtctg cgaccactac accacatcga gccgcgaaat acggcaaggt ccgcccaaca cgatagccga gcagccacac tcgatgaaca tcgaggcttt cgtggagccg tgcgcacctg ggctgctcac tcgacgacgg cgatccttgc  ggtggtttgt cagagcgcag gaactctgta cagtggcgat gcagcggtcg caccgaactg aaaggcggac tccaggggga gcgtcgattt ggccttttta atcccctgat cagccgaacg ccaccaaggg ccgtgaacga ccggtgcaac gcccctcgtc agatcaggga gacccctgga acgggaatcg ccggtcaaga ggtcgtagaa tcacgacgag agcgggagga cagacctacg gagatggaga acgctggagg gatctgtaca acagagatga actgcccgcc aagctgatcg gaggcgctga atcgcggcat cgcaaggaca cgcgtgggga acggttccgc aacaagggcc gcgttcacca cacgacctcc ctgatggccc gaggcccgcg gcaaaaagcc cgaagaacca cagccccgcc gacgcgcccg ggcggtcatg gggcatgacc gtaaacacaa gctgcgccgt aatgtgatct gcacttcccg gcgcgacgac ccggcatttc gttgaaggac caacatcgtg aaccaatccg cgtctcggct cgcgcacgac cgtggccgag taaaccagac gtttgccgcc ctattccgac cagggtatgt cgacgcggtg  ttgccggatc ataccaaata gcaccgccta aagtcgtgtc ggctgaacgg agatacctac aggtatccgg aacgcctggt ttgtgatgct cggttcctgg tctgtggata accgagcgca caccatctct cagggcgaac cttgtcccgg tgttcgcgca tgcgttgcaa aagaaaaatg aacccgcgta taggttttta gcgcgttgaa aggagaccta tccaagcctc acaacaagat cctggacccc agtacacccg gcgggcacgc cgccagctct ggcatgccta cagagaaccc cgcctgagga acatcctggc tcgtggacga acaagatcgt ctcacgtcgc ccgaggcatt agtcgctgaa gcgctgtcgg gtctcggtca acgaggctat cccctcccaa cgcctggccg gccgccagga ctttgatcgg ggccgaacat cggtgcgggg tcgcagaact ccagcgaacg aggtcacgtg aagcaaaaag gaaggccttg taccacgacg gagcacagcg gttatcggcg cacctggatg gagggcggcg acggtatccg gcgcccaaag gggcgcgttg gacaagacgg gtcatgcgct ggtctggtcg attctgtgca  aagagctacc ctgtccttct catacctcgc ttaccgggtt ggggttcgtg agcgtgagca taagcggcag atctttatag cgtcaggggg ccttttgctg accgtattac acgcgtgcgg gcttgggcca gccagcccgc tctattctct ggcggggggc ccgcgtatgc gccagagggc gctagtttgg ccccctctcg gcctgagagt gttggcacgt atacgtcaac ggacgccgaa tccacaggac gaagtggctc ggagcgccgc ggtgcgtgcg caacgtcctc gtgccggatc gctggacatc gtggacgagc cggcatgacg cgttggcaac ggagatgatc cctggtgacc gcgtggctac cgctacgttc cacgactcct cgctgaggcg ggacactgag cgagcgccag gcattgccgt ggacgtctgc actcacccgg cttcttgcac ggcccgcagg ggtcaaacgg ccagcaccgg cgccctgcgg cctacgacga gatccatgcg gcgatcacga gcggtggtgc tggcgatcgt ccgcggcggt gtggcgactg agttggtgca ccgttcgccc gatttcacct atgacgagtg ctatcgagtt ccggcggatg  aactcttttt agtgtagccg tctgctaatc ggactcaaga cacacagccc ttgagaaagc ggtcggaaca tcctgtcggg gcggagccta gccttttgct cgcctttgag ccgcggtacc ccccgttggc cgacggcgag tcactgcacc tctattcgtt ccaggtcaga gaaaacaccc aagaatgggt gctgcatcct tgcacaggag cgcggatggg ccgcaggacg gcctggctcg cgggcgaaga gtggagcgcg atctacccgg tggtgggccg cgggcggtga gagcagaagg gtcgccgctg ctccggttcg atgaagctcc gccaagaccg cgagcgcaca acgacgcagg gccaagatcg gccgctcagg aggatggcga atgtccaagc tcctaaagag caccgccgct tcccgccaga ggccgaccat atcggagggc tcggcatagg caatgagcga tggacgcgcc aggaggcggg gcacatggtt cctcaagttt ggtacgcacg agcgtgaacc gggtctgcgc ttccaaggtg gaccggtgac gctgtgtgac gctcgagcat gttcggcggg cctgcacacg gttcgctacg ggcgaccggg cgggcgggta  ccgaaggtaa tagttaggcc ctgttaccag cgatagttac agcttggagc gccacgcttc ggagagcgca tttcgccacc tggaaaaacg cacatgttct tgagctgata cggggatcct cgcagccagc ggttccgacc agctccaatc tgtcagcatc agagtcgcac tctgaccagc gtctgccgac ctaagtggaa ttgcaacccg gatcgctgaa gtgtgaggta cgggcgagaa aggcagccgc acctcgcaga tgctaggtga ggatgggtag tgaacacagc cagccgatga agatcttcga gagagctgat gggtgcgccg tccggtcgaa tgaaggaccg gcaaccggct gtcggccgga caggtgcgac tgaagtacca tggccaagac gggggtttct ctgtgcggag aatctagagg ttacgggtct cgaggacaag cgagtgctaa caaatgcggc atccccccgg actatggtcg gacggcgatc tcctgcggct attcgacacg agcgcgatga gccgcgattg tacccgatgc gacgacagcc caagatgcgg tggggctgtc atgaagaagc ttgtttcaac acgctgctgg cgcatcgaga tttccattca  103  5101 5161 5221 5281 5341 5401 5461 5521 5581 5641 5701 5761 5821 5881 5941 6001 6061 6121 6181 6241 6301 6361 6421 6481 6541 6601 6661 6721 6781 6841 6901 6961 7021 7081 7141 7201 7261 7321 7381 7441 7501 7561 7621 7681 7741 7801 7861 7921  ccaccaacgc ccctaaaaga tgatcaccga acctccagga tcgggcccag tcgacacccc tcgatgcaaa tggtcgaatt atatcaacgg gcattaatgg ctcgagcggg cgtcgtcggc gccgccatgg tggaaagcgc ttcgggtgct acaccgagct tcgaatcggg accgggacga tgcgggtcgg ggaggtaagg atcggccccg cggcctgacc gatgggtatc gacattcctt ggtgatccgc gccgtggctc ggccgaactc ggcgtgcccg gcagcggtac cgcggccgac aggcgtcgat gaagaagttg tactggtggg ttcgtggcct aattcctacc gtcgcgttga atggtgattc gcggcatggc catcggatgc ccgggggcat ttccgctcgg cgatcaccaa ggttccggtt tgtggtgtta tgtaaagtcg cacaacggtt tagttaacta gactgggcct  gaacatcaag catggaattc ggccgcacga ttacgacctc ggaccgactg gtacggcccc gttgccgttc ggtcccggta cgccacaacg cgccaaccgc ccgtgccgcc agtgcgggct ccagggaggc cgcgggtatt gcaggaacga gactgcgctg tttgcgccga cgagcatttc ctaccttccg atgatggatc acatttcagg tacatcaagg tgcggcagta gccgattacc gatctcgttg gtccggcatg gatgcattca gtgtacgcgc aacctggact ggcgcttggg cctgccggcg ctgttccctt cgaggcggcg ggtttgttct agcggttttt gtttcctgct aggttcgcgg tggtggtttc caggtcgcgc ggtcaccgcc gtggctcgac gcttgttgtg cgtgctcgac cggcatggcc ctggccgggc ctatcaattg gcgtacgatc ttcgttttat  accggcgacg gtccaatacc gctgaaggcg ggcaagccca tcgcaggcct gtcgtctatc gtacgtgagc cgaccggtag cttcccgggc ctggggtcga gcggattacg caggcccgca gaacgaatcg tatcgtgacg ttcgccacgg ctcgagttgt gaagaatccc ttggcgcaca gtcactatca gaattgtcat cctacgaggt atcacctcga gtggtatgac tacccgggcc tcgacatcag atgaaccgcc agcagttcag tggaccccga cgcgcgacca cgtgcaccct cgatccagcg gggggggcgg ttcttacctg ctatctgatg ggacttcagc gctgcatgct ccgccgggta ggtgatcgtt cgacgctcgg ctggttgcgc gcgcccgacc ctggtcctgg catgggctgc gtgttgggct gctttggccg cggatccagc gactgccagg ctgttgtttg  gcatggcgct accccaccgg gctggctgct cgcccgagcc tcgtacacga tagacctgcg tgtgccgcga tgcactacat tatatgccgc actcgctgcc cagcgcgcca ccgaggctct cggatattcg gacccaccct cgggcatcga cggggatgct gtggcgcaca ccttggttca ctcgctggcc ggaggtctcc tcccctcacc cggaacactc gatcaacggc ggtgcgggtg tgacttcatg cgtcgaagac catgtgtatc cttcctcggt aggtgcggcg ggtgggcgaa ctacaagctg atgagcgcct cgattcatgc ctggtattgc gccaatccgg gttacctggt cccgctcgcg gcctggatgg cggagccctt ccgtcctgct acgggcacct tggtactggc aactgggccg cggcgacggc ccggcacggt tgcagaattc catcaaataa tccggccatc  cgcattccgc actgccgttc caacaaagac caggctgcgc gcacaacaaa gcacctgggg ctaccagcac gatgggtggc aggtgaaaca cgagctgctg ccaaaagtcg acggctagag ggcggacatg caccaaagcg cgatcacagc cgacgttgca ccagcgaacc tagagaaagc accgggcgaa cggtatcggc cgcgaatggg tccttccgct gacccaaagc gagccgatgc gccaagctgc ggcgaatacc aactgcatgt ccggcggcga gatcgcaggg tgttcgacgg accgcggcca atcgccagcc ttcgcgaaat gcgccgttgg ttgtcgtagt tcggatcggc cggtccttgc tgctgtcatg cctgtggctg gttgctgttc actggcgatg cctgttccat gttcgaccga gggttggatg acggtacgga gaagcttatc aacgaaaggc atggccgcgg  gcgggcgcgc accgggatct ggctaccgct agtatggagc ggaaggacgg gcggacctga atcgaccccg gttcacaccg gcctgcgtga gtgttcgggg gaccgtggcc cgtgagctca caggccacct gtcgaggaga cgcacattca ctggcgatcg gactttccga gacggaacgc cgcgtgtatg ccgagatcga cggtgttgga ggtcgtgccg tggcgtgcgc gaaacttccc ccagtgtgaa ggcagacccc tgtgctactc tcgcgctggg atgtcctggc cttgtccgaa cgcacgcgct ggtcgaaaga cagttgcatc cgcgggcggg gctgaacgtc accgcgcgcg tgggcactac actccctcga ctgttcagcg ggactcgcgt gtgcgcaacc gcggcgcacc gtgatcgccc ttgctcacta cctgtaccac gatgtcgacg tcagtcgaaa tgatca  //  104  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0071750/manifest

Comment

Related Items