UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterizing the role of secretory phospholipase A₂ group IIA in glial cell-mediated neurotoxicity 2011

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
ubc_2011_spring_villanueva_erika.pdf [ 3.19MB ]
Metadata
JSON: 1.0071683.json
JSON-LD: 1.0071683+ld.json
RDF/XML (Pretty): 1.0071683.xml
RDF/JSON: 1.0071683+rdf.json
Turtle: 1.0071683+rdf-turtle.txt
N-Triples: 1.0071683+rdf-ntriples.txt
Citation
1.0071683.ris

Full Text

  CHARACTERIZING THE ROLE OF SECRETORY PHOSPHOLIPASE A2 GROUP IIA IN GLIAL CELL-MEDIATED NEUROTOXICITY  by  Erika Bianca Villanueva  B.Sc., The University of Waterloo, 2008    A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF   MASTER OF SCIENCE  in  The College of Graduate Studies  (Biology)   THE UNIVERSITY OF BRITISH COLUMBIA (Okanagan)  April 2011   © Erika Bianca Villanueva, 2011   ii Abstract Microglia are a type of non-neuronal glial cell that represent the mononuclear phagocyte system and innate immunity in the central nervous system. Astrocytes are another glial cell type. Under pathological circumstances, both glia types are capable of sustaining chronic inflammation in the brain, which results in neuronal death. Immune response involves glial secretion of pro-inflammatory mediators. Phospholipases A2 (PLA2) convert cell membrane glycerophospholipids into arachidonic acid, which in turn is a precursor to several pro-inflammatory eicosanoids that are released by glial cells. It is well established that secretory PLA2 group IIA (sPLA2IIA) is a pro-inflammatory mediator, however little is known about the role this enzyme plays in neurodegeneration. This thesis focuses on sPLA2IIA and its role in chronic inflammation underlying neurodegenerative disorders such as Alzheimer’s and Parkinson’s diseases. Activated astrocytes have been shown to secrete sPLA2IIA. However, no information is available on sPLA2IIA expression and regulation in microglia. This thesis hypothesizes that sPLA2IIA is a toxin secreted by activated glial cells, which causes neuronal death. If sPLA2IIA contributes to neurotoxicity, then agents that inhibit, modify, or remove sPLA2IIA from extracellular space should reduce the cytotoxic effects of glial secretions.  The following human cells were used to study sPLA2IIA expression, secretion and functions: microglia-like promonocytic THP-1 cells, U-373 MG astrocytoma cells, primary human astrocytes and neuroblastoma SH-SY5Y cells. Reverse transcriptase polymerase chain reaction (RT-PCR) revealed that stimulation by pro-inflammatory mediators induced sPLA2IIA mRNA expression by glial cells. Stimulated glial cell  iii supernatants were toxic to neuronal SH-SY5Y cells. Stimulation caused increased sPLA2IIA protein concentrations in supernatants from all three types of glial cells. Despite observing increased sPLA2IIA-specific enzymatic activity in stimulated glial cell supernatants, neither specific nor non-specific PLA2 inhibitors exhibited anti-cytotoxic effects. However, the removal of sPLA2IIA from supernatants by immunosorbents resulted in significantly increased neuronal survival, suggesting that sPLA2IIA neurotoxicity relies on a non-enzymatic mechanism. Based on in vitro experiments and a literature review, potential sPLA2IIA neurotoxicity mechanisms are proposed. The data obtained provide valuable information toward a more detailed mechanistic understanding of neuroinflammation and may guide future research toward more effective therapeutic agents for neurodegenerative disorders.  iv Preface To date, none of my research on sPLA2IIA has been published. To experiment with primary human astrocytes, I obtained approval to work with Biosafety Level 2 materials (certificate # B08-0040).  I am responsible for all experimental data and writing presented in this thesis, except for the publication presented in Appendix B. For this publication, I was involved with obtaining fresh porcine tissues and developing the extraction technique for porcine glial cells, in addition to writing parts of the manuscript. V.A. Ionescu was the primary author of the manuscript and was also involved with developing the extraction technique for porcine glial cells. M. Bahniwal was responsible for the tumor necrosis factor-α enzyme- linked immunosorbent assay data, in addition to characterizing the effects of cytokine- stimulated porcine astrocyte supernatants on neuronal SH-SY5Y cells. S. Hashioka produced the immunostaining images of porcine glial cells. A. Klegeris designed the study, wrote a significant portion of the manuscript and is the corresponding author for this study.   v Table of Contents Abstract ................................................................................................................... ii Preface .................................................................................................................... iv Table of Contents ................................................................................................... v List of Tables ......................................................................................................... ix List of Figures ......................................................................................................... x List of Abbreviations and Symbols .................................................................... xii Acknowledgements ............................................................................................. xvi Dedication ...........................................................................................................xvii 1 Introduction ......................................................................................................... 1      1.1   Neurodegeneration ......................................................................................................... 1 1.1.1   Cells of the Central Nervous System (CNS) ............................................................ 1 1.1.2   Intercellular Communication between Glial Cells and Neurons .............................. 1 1.1.2.1   Glia to Glia Communication .................................................................................... 1 1.1.2.2   Glia to Neuron Interactions ...................................................................................... 2 1.1.3   Neurodegenerative Disorders ................................................................................... 3 1.1.3.1   Alzheimer’s Disease ................................................................................................ 3 1.1.3.2   Parkinson’s Disease ................................................................................................. 5 1.1.4   Inflammatory Hypothesis of Neurodegeneration ..................................................... 6 1.1.5   Cell Culture Models of Neurodegeneration ............................................................. 6      1.2   Phospholipases A2 and Inflammation .......................................................................... 9 1.2.1   Phospholipase A2 Isoforms..................................................................................... 10 1.2.2   Secretory Phospholipases A2 (sPLA2) .................................................................... 11      1.3   sPLA2IIA ....................................................................................................................... 12 1.3.1   Structure of sPLA2 .................................................................................................. 12 1.3.2   Enzymatic Activity and Known Inhibitors of sPLA2 ............................................. 13 1.3.3   Non-Enzymatic Activity of sPLA2IIA ................................................................... 15    vi 1.3.4   Pathologies involving sPLA2IIA ............................................................................ 16 1.3.4.1   Rheumatoid Arthritis ............................................................................................. 16 1.3.4.2   Atherosclerosis ....................................................................................................... 17 1.3.4.3   Cancer .................................................................................................................... 17 1.3.4.4   Neurodegenerative Disease .................................................................................... 18 1.3.5   sPLA2IIA Regulation.............................................................................................. 19 1.3.6   Neurotoxic Mechanisms of sPLA2IIA.................................................................... 20      1.4   Research Overview and Hypotheses .......................................................................... 24 2 Materials and Methods ..................................................................................... 26      2.1   Chemicals and Reagents .............................................................................................. 26      2.2   Equipment .................................................................................................................... 28      2.3   Cell Culture Models ..................................................................................................... 29      2.4   Collecting Glial Cell Supernatants ............................................................................. 30      2.5   Plating SH-SY5Y Cells for Experiments ................................................................... 31      2.6   Cytotoxicity Assays: Lactate Dehydrogenase (LDH) ............................................... 31      2.7   Cytotoxicity Assays: MTT ........................................................................................... 32      2.8   Cytotoxicity Assays: Live/Dead Immunofluorescence ............................................. 33      2.9   Immunosorbent Experiments ..................................................................................... 35      2.10 Enzyme-Linked Immunosorbent Assay (ELISA) ..................................................... 36      2.11 RNA Isolation and Reverse Transcription (RT) ....................................................... 37      2.12 Polymerase Chain Reaction (PCR) ............................................................................ 40      2.13 PCR Primer Design and Restriction Analyses .......................................................... 41      2.14 Neurotoxicity of Exogenous sPLA2 ............................................................................ 43 2.14.1   Bee Venom sPLA2 type III (sPLA2III) ................................................................. 43 2.14.2   Human rsPLA2IIA ................................................................................................ 43 2.14.3   Bacterial Lipopolysaccharide (LPS)..................................................................... 44      2.15 Experiments with Enzyme Inhibitors and Receptor Antagonists ........................... 44 2.15.1   Specific sPLA2 Inhibitors ..................................................................................... 44 2.15.2   Non-Specific PLA2 Inhibitors and PGE2 Receptor Antagonists .......................... 45      2.16 Measurement of PLA2 Enzymatic Activity ................................................................ 46   vii      2.17 Potential Mechanisms of sPLA2IIA Neurotoxicity ................................................... 48 2.17.1   Effects of sPLA2IIA on SH-SY5Y Cells Pre-Treated with H2O2 ........................ 48 2.17.2   sPLA2IIA Regulation via PPARα ........................................................................ 49 2.17.3   Non-Enzymatic Complex between sPLA2IIA and Neuronal TLR4 ................................................................................................. 49      2.18 Statistical Analysis ....................................................................................................... 50 3 Results…………………………………………………………………… ........ 52      3.1   Inflammatory Stimuli Evoke Neurotoxic Glial Cell Response ................................ 52      3.2   Neurotoxicity of sPLA2 Isoforms ................................................................................ 54      3.3   sPLA2IIA mRNA Expression by Human Cell Lines and Astrocytes ...................... 59      3.4   Concentrations of sPLA2IIA in Glial Cell Supernatants ......................................... 61      3.5   PLA2 Enzymatic Activity in Cell Supernatants ........................................................ 62      3.6   Effects of Specific sPLA2 Inhibitors on Neurotoxicity of Stimulated Glial Cell Supernatants .......................................................................... 66      3.7   Removal of sPLA2IIA from Cell Supernatants ......................................................... 70      3.8   Effects of Non-Specific PLA2 Inhibitors and PGE2 Receptor Antagonists on THP-1 Cytotoxicity Toward SH-SY5Y Cells ................................. 73      3.9   Possible Mechanisms of sPLA2IIA Toxicity .............................................................. 79 3.9.1   Effect of rsPLA2IIA on H2O2–Induced Neurotoxicity ........................................... 79 3.9.2   Experiments with the PPARα Antagonist MK886 ................................................ 81 3.9.3   Effects of the Anti-TLR4/MD-2 Antibodies on sPLA2IIA Toxicity Toward SH-SY5Y Cells ....................................................................... 84 4 Discussion........................................................................................................... 86      4.1   Neurotoxins Secreted by Stimulated Glial Cells ....................................................... 86 4.1.1   Stimulated Glial Cells Secrete Neurotoxic sPLA2IIA ............................................ 86 4.1.2   Comparison of sPLA2IIA Protein Concentrations in Cell Culture Supernatants with Exogenous sPLA2IIA Concentrations Required to Induce Neurotoxicity ....................................................................................... 87      4.2   Inhibition of sPLA2IIA Enzymatic Activity  ............................................................. 87 4.2.1   sPLA2IIA Enzymatic Activity is Significantly Higher in Stimulated than Unstimulated THP-1 and U-373 MG Cell Supernatants ............................. 88 4.2.2   sPLA2IIA-Specific Inhibitor Failed to Protect SH-SY5Y Cells from rsPLA2IIA Toxicity or Glial Cell-Induced Neurotoxicity .......................... 90  viii      4.3   Removal of sPLA2IIA and PGE2 from Stimulated Glial Cell Supernatants Significantly Decreased Neuronal Death .......................................... 91      4.4   Non-Specific PLA2 Inhibitors and PGE2 Receptor Antagonists Failed to Protect SH-SY5Y Cells from Glial Cell-Induced Toxicity ................................. 92      4.5   Non-Enzymatic Mechanisms of sPLA2IIA Neurotoxicity ........................................ 95 4.5.1   H2O2-Induced Neuronal Apoptosis Does Not Enhance rsPLA2IIA Toxicity ............................................................................................. 96 4.5.2   sPLA2IIA Regulation Through PPARα Cannot be Confirmed Due to Cytotoxicity of Receptor Antagonist MK886 ......................................... 97 4.5.3   Neuronal TLR4 Does Not Mediate sPLA2IIA Neurotoxicity ................................ 98 5 Conclusions ...................................................................................................... 100      5.1   Strengths and Limitations of this Study .................................................................. 100      5.2   Future Directions ....................................................................................................... 101      5.3   Significance of Findings ............................................................................................. 103 References ........................................................................................................... 105 Appendices .......................................................................................................... 116      Appendix A: RNA Purity Values...................................................................................... 116      Appendix B: Publication ................................................................................................... 117  ix List of Tables Table 1.1:       Classification of PLA2 Isoforms .......................................................................... 10 Table 2.1: Non-Specific PLA2 Inhibitor and PGE2 Receptor Antagonist Targets and their Concentrations Used in Experiments ...................................... 46   x List of Figures Figure 1.1: Events Surrounding the Pathological Activation of Glial Cells and Related Neuronal Death ................................................................................. 5 Figure 1.2:      Human Cell Culture Model of Neuroinflammation .............................................. 9 Figure 1.3: Proposed PLA2 Pathways Leading to the Up-Regulation of Endogenous sPLA2IIA mRNA ............................................................................ 21 Figure 2.1:      Typical Calibration Curve for the sPLA2IIA-Specific ELISA ............................ 38 Figure 3.1: Neurotoxicity of Stimulated Glial Cell Models  ................................................. 53 Figure 3.2:      Neurotoxicity of Bee venom sPLA2III ................................................................ 55 Figure 3.3:      Neurotoxicity of Human rsPLA2IIA ................................................................... 56 Figure 3.4: Neurotoxicity of Bacterial LPS and Human IFN-γ at                         Concentrations Used in Experiments .................................................................. 58 Figure 3.5: sPLA2IIA mRNA Expression in Stimulated and Unstimulated Glial Cells ............................................................................................................ 60 Figure 3.6: sPLA2IIA Protein Concentrations in Stimulated and Unstimulated Glial Cell Supernatants ........................................................................................ 61 Figure 3.7: PLA2 Enzymatic Activity in Stimulated and Unstimulated Glial Cell Supernatants ........................................................................................ 62 Figure 3.8: Effects of the Specific sPLA2 Inhibitors on rsPLA2IIA-Specific Enzymatic Activity .............................................................................................. 63 Figure 3.9: Effects of the Specific sPLA2 Inhibitors on PLA2 Enzymatic Activity in Stimulated THP-1 cell Supernatants ................................................. 64 Figure 3.10: rsPLA2IIA-Specific Enzymatic Activity in Stimulated and Unstimulated Glial Cell Supernatants ................................................................. 65 Figure 3.11: Effects of the Specific sPLA2 Inhibitors on the Neurotoxicity of Exogenous rsPLA2IIA ......................................................................................... 67 Figure 3.12: Effects of the Specific sPLA2 Inhibitors on the Neurotoxicity of Stimulated THP-1 Cell Supernatants .................................................................. 68 Figure 3.13:    Neuroprotective Effects of the Specific sPLA2 Inhibitors .................................. 69 Figure 3.14: Effects of sPLA2IIA- or PGE2-Specific Immunosorbents on Stimulated THP-1 Cell Supernatant Neurotoxicity (LDH and MTT Assays) ..................................................................................... 71 Figure 3.15: Effects of sPLA2IIA- or PGE2-Specific Immunosorbents on Stimulated THP-1 Cell Supernatant Neurotoxicity (Live/Dead Immunofluorescence) ......................................................................  72  xi Figure 3.16: Effects of sPLA2IIA- or PGE2-Specific Immunosorbents on Stimulated U-373 MG Cell or Human Astrocyte Supernatant Neurotoxicity) ..................................................................................................... 74 Figure 3.17: Cytotoxicity of Non-Specific PLA2 Inhibitors Toward THP-1 Cells ........................................................................................... 75 Figure 3.18: Effects of Non-Specific PLA2 Inhibitors on the Neurotoxicity of Stimulated THP-1 Cell Supernatants .............................................................. 77 Figure 3.19:    Neuroprotective Effects of Non-Specific PLA2 Inhibitors .................................. 78 Figure 3.20:    Effect of rsPLA2IIA on H2O2-Induced Neurotoxicity ......................................... 80 Figure 3.21:    Cytotoxicity of PPARα Antagonist MK886 toward THP-1 Cells ...................... 82 Figure 3.22:  Effects of PPARα Antagonist MK886 on the Neurotoxicity of Stimulated THP-1 Cell Supernatants .................................................................. 83 Figure 3.23:    Neuroprotective Effects of Anti-TLR4/MD-2 mAb ........................................... 85   xii List of Abbreviations and Symbols α5β3  Alpha-5-beta-3 integrin Aβ  Amyloid beta (Alzheimer’s disease hallmark protein) AD  Alzheimer’s disease AH6809 6-isopropoxy-9-oxoxanthene-2-carboxylic acid; antagonizes prostaglandin E2 receptors 1, 2 and 3 AM  Acetoxymethyl ester (of calcein) ANOVA Analysis of variance α-syn  Alpha-synuclein (Parkinson’s disease hallmark protein)  β-NAD Beta-nicotinamide adenine dinucleotide bp Base pair BPPA  5-(4-benzyloxyphenyl)-4S-(7-phenylheptanoylamino) pentanoic acid; phospholipase A2 inhibitor  cAMP  Cyclic adenine monophosphate cDNA  Complementary deoxyribonucleic acid CNS  Central nervous system ConA  Concanavalin A COX  Cyclooxygenase cPLA2  Cytosolic phospholipase A2  d  Difference DNA  Deoxyribonucleic acid DMDA 7,7-dimethyl-5,8-eicosadienoic acid; phospholipase A2 inhibitor DMEM-F12 Dulbecco’s Modified Eagle’s Medium - nutrient mixture Ham’s F12 DMF  N,N-dimethylformamide DMSO  Dimethyl sulfoxide       xiii EDTA  Ethylenediaminetetraacetic acid ELISA  Enzyme-linked immunosorbent assay EP1-4 Prostaglandin E2. receptors. (4 known isoforms: EP1, EP2, EP3 and EP4) ERK1/2  Extracellular signal-regulated kinases 1 and 2 EthD-1 Ethidium homodimer-1 EtOH  Ethanol  F5  Dulbecco’s Modified Eagle’s Medium - nutrient mixture Ham’s F12 with 5% added fetal bovine serum F10  Dulbecco’s Modified Eagle’s Medium - nutrient mixture Ham’s F12 with 10% added fetal bovine serum Fas L  Fas ligand FBS  Fetal bovine serum FITC  Fluorescein isothiocyanate  GPCR  Guanine nucleotide-binding protein-coupled receptor  IC50 Half-maximal inhibitory concentration; the amount of compound required to reduce the effect of a biological process by half IFN-γ  Interferon-gamma IL  Interleukin IL-1β  Interleukin-1 beta IL-6  Interleukin-6 INT  Iodonitrotetrazolium chloride iPLA2  Calcium-independent phospholipase A2  L-161,982 N-[[4’-[[3-butyl-1,5-dihydro-5-oxo-1-[2-(trifluoromethyl)phenyl]-4H- 1,2,4-triazol-4-yl]methyl][1,1’-biphenyl]-2-yl]sulfonyl]-3-methyl-2- thiophenecarboxamide; antagonizes prostaglandin E2 receptor 4 LDH  Lactate dehydrogenase (measured as indicator of cell death) LPS  Lipopolysaccharide LSD  Least significant difference  xiv mAb  Monoclonal antibody MAFP  Methyl arachidonyl fluorophosphonate; phospholipase A2 inhibitor MAPK  Mitogen activated protein kinase MD-2 Lymphocyte antigen 96; associated with toll-like receptor 4 to form a complex targeted by bacterial lipopolysaccharide Me-indoxam Secretory phospholipase A2 group IIA-specific inhibitor MK886 Peroxisome proliferator-activated receptor-alpha antagonist mRNA  Messenger ribonucleic acid MTT  Formazan dye (measured as indicator of cell viability)  NF-κB  Nuclear factor-kappa-B NFT  Neurofibrillary tangle (Alzheimer’s disease hallmark aggregate) NFW  Nuclease-free water  OD  Optical density OPHAO 4-[(1-oxo-7-phenylheptyl)amino]-(4R)-octanoic acid; non-specific PLA2 inhibitor  PBS  Phosphate-buffered saline PCR  Polymerase chain reaction PD  Parkinson’s disease PG  Prostaglandin PGE2  Prostaglandin E2 PGPM  1-hexadecanoyl-2-(1-pyrenedecanoyl)-sn-glycero-3-phosphomethanol; substrate for phospholipase A2 enzyme activity assay PKC Protein kinase C PLA2 Phospholipase A2 PPARα Peroxisome proliferator-activated receptor-alpha     xv Ras Guanine triphosphatase involved in signal transduction; originally identified as a rat sarcoma oncogene product RO032107 Secretory phospholipase A2 group IIA-specific inhibitor RO041709 Inactive control compound to RO032107 RO092906 Secretory phospholipase A2 group X-specific inhibitor ROS  Reactive oxygen species RNA  Ribonucleic acid RNS  Reactive nitrogen species rsPLA2IIA Recombinant sPLA2IIA RT  Reverse transcription RT-PCR Reverse transcription polymerase chain reaction  S-2427  Non-steroidal anti-inflammatory compound SDS  Sodium dodecyl sulfate SH-SY5Y Human dopaminergic neuroblastoma cell line (neuron model) sPLA2  Secretory phospholipase A2 sPLA2IIA Secretory phospholipase A2 group IIA sPLA2III Secretory phospholipase A2 group III (found in bee venom) sPLA2V Secretory phospholipase A2 group V sPLA2X Secretory phospholipase A2 group X STAT-3 Signal transducer and activator of transcription type 3 SYBR safe Deoxyribonucleic acid stain  THP-1  Human immortalized promonocytic leukemia cell line (microglia model) TLR4  Toll-like receptor 4 TNF-α  Tumor necrosis factor-alpha  U-373 MG Human immortalized astrocytoma cell line (astrocyte model)  YM-26734-1 Secretory phospholipase A2 group IIA-specific inhibitor  xvi Acknowledgements My sincerest gratitude and utmost respect are offered to my supervisor, Dr. Andis Klegeris, whose wisdom, patience and leadership has taught me the value of perseverance (particularly when faced with embarrassingly difficult super quizzes). Thank you so much for the opportunity to learn from and work with you.  Thank you to Dr. Mark Rheault’s laboratory for the use of equipment. Thanks to Drs. Michael Gelb and Rob Oslund for providing samples of rsPLA2IIA and the specific sPLA2 inhibitors that were key in the completion of this study. I thank my colleagues at the Laboratory of Cellular and Molecular Pharmacology, whose jovial and honourable spirits motivated me to carry on through both favourable and frustrating circumstances. Thanks to my committee members Dr. Bruce Mathieson and Dr. Mark Rheault, whose leadership helped me maintain perspective from day one of this project. I thank Dr. Jason Loeppky for advice with statistical methods and Dr. Mary Forrest for restriction enzymes. In addition, I thank the faculty and staff of the University of British Columbia Okanagan Department of Biology for their continued support and cheerful personalities.  Special thanks are offered to my Parents, my brother Karl, friends and family for steadying my perpetual state of confusion and helping me through my addiction to higher learning despite the temporal, spatial and financial challenges faced. Finally, I thank Andrew, my better half, whose love continues to be my utmost inspiration.   xvii   In loving memory of my grandmother (1920-2010), whose departure set her free from Alzheimer’s disease.   1 1 Introduction 1.1 Neurodegeneration 1.1.1 Cells of the Central Nervous System (CNS) The CNS consists of the brain and the spinal cord. Cellular populations in the brain include approximately 15% neurons and 85% glial cells (Hickey 2001; Rock et al. 2004). Neurons are excitable cells that respond to stimuli, communicate with other cells and conduct impulses. Among other functions, glial cells support neurons with vital nutrients and protection. In the CNS, glial cells include: a) oligodendrocytes, which wrap neuronal processes with a myelin sheath allowing rapid conduction of electrical signals within the CNS; b) astrocytes, which are star-shaped glial cells that provide nutrients for neurons; and c) microglia, which represent the innate immune system of the CNS (Aloisi 2001; Hume 2006). This study focuses on microglial, astrocytic and neuronal interactions in the brain; therefore, the terms “glia” and “glial cell” refer to microglia and astrocytes only.  1.1.2 Intercellular Communication between Glial Cells and Neurons 1.1.2.1 Glia to Glia Communication Microglia are macrophages that belong to the mononuclear phagocyte system; they are derived from progenitor cells in the bone marrow and are thought to have migrated to the CNS during embryonic development (Hume 2006; Rock 2009). Microglia are essential for defense against pathological events that may occur in the CNS (Aloisi 2001; Bessis et al. 2007). Astrocytes play a role in potassium homeostasis in the CNS  2 and communicate to other astrocytes through intercellular gap junctions (Peuchen et al. 1997). Pathological formations (such as amyloid-beta (Aβ) plaques in Alzheimer’s disease (AD)) have been shown to activate both types of glial cells, which release mediators that function to dispose of the formations (Streit et al. 2004). Specific pro- inflammatory mediators include cytokines in addition to eicosanoids such as PGE2 (Town et al. 2005), all of which trigger the activation and proliferation of other microglia; these events lead to increased and accelerated neuronal death. Pro-inflammatory cytokines endogenous to the central nervous system include tumor necrosis factor alpha (TNF-α), interleukin (IL)-1β and IL-6. These pro-inflammatory signals activate other surrounding microglia and astrocytes, ultimately amplifying the immune response (Aloisi 2001; Hashioka et al. 2009). The activation and multiplication of glial cells in a way that is detrimental to neurons form basis of neuroinflammation (Mattson 2000; Streit et al. 2004).  1.1.2.2 Glia to Neuron Interactions At rest, glial cells function as support structures for neurons (Rock et al. 2004). Microglia are thought to be responsible for scavenging cellular debris produced as a result of physiological tissue renewal and remodeling in addition to playing a neurotrophic (supporting neuronal survival) role in the developing brain; however, in the adult brain, the role of resting microglia is poorly understood (Rock et al. 2004). Astrocytes provide neurons with nutrients such as lactate and growth factors such as nerve growth factor (Peuchen et al. 1997; Wagner et al. 2006).  3 Neurons die as a part of the normal aging process; however, in neurodegenerative disorders such as AD and Parkinson’s disease (PD), the rate of neuronal death is accelerated and the magnitude of neuronal loss is increased (Cummings 2004; McNaught and Olanow 2006; Rock 2009). Several studies have suggested that microglia and/or astrocytes initiate inflammation in response to either pathologic substances that are present in AD and PD, or neuronal cell death (Bessis et al. 2007; Kermer et al. 2004; Mattson 2000; Nakajima and Kohsaka 2001; Streit et al. 2004; Wang et al. 2005). During inflammation, glial cells initiate several processes that can cause substantial neuronal death, including: a) production of free radicals including reactive oxygen and nitrogen species; and b) release of toxins such as lysozymes, glutamate and proteases (Block et al. 2007; Coyle and Puttfarcken 1993). Because neurons depend on glial cells for survival, it has been theorized that these imbalanced interactions between glial cells and neurons exacerbate neurodegenerative diseases (Aschner et al. 1999; Block and Hong 2007; Parpura and Haydon 2000).  1.1.3. Neurodegenerative Disorders 1.1.3.1 Alzheimer’s Disease A major cause of neurodegeneration is AD, which is devastating to the quality of life of patients. Sadly, there is neither an effective treatment nor a cure for this disorder. The risk of developing neurodegenerative conditions including AD increases with age; therefore, an increasing number of aging North Americans are at risk for neurodegenerative disorders (Bird, 2008). Research on treatment and preventative  4 therapy against neurodegeneration is necessary in order to properly facilitate the health care needs of the aging population (Cummings 2004). The characteristic symptoms of patients at advanced stages of AD include severe memory loss and the inability to independently carry out daily tasks (Cummings 2004). In AD, neuronal death occurs mainly in the hippocampus and cerebral cortex (Coyle et al. 1983). Acetylcholine-releasing (cholinergic) neurons are affected first, which ultimately leads to loss of memory and cognition (Coyle et al. 1983; Kar et al. 2004). Research has revealed the following three hallmarks of AD: neurofibrillary tangles (NFT), Aβ plaques and chronic inflammation (Bird 2008; Cummings 2004; Sastre et al. 2006). Though NFT and Aβ plaques are found in healthy non-AD brains, the number of NFT and Aβ plaques is significantly higher in brains of individuals with AD (Cummings 2004). Several studies suggest that chronic neuroinflammation in the brain can lead to increased numbers of both formations, which in turn perpetuates inflammation (LaFeria et al. 2007; Moses et al. 2006; Sastre et al. 2006). It is not known what triggers the initial inflammation, although several factors including gene mutations and environmental factors are being rigorously studied. Figure 1.1 depicts the cyclic nature of glial cell- mediated inflammation that may contribute to neurodegeneration in AD. Several major factors impede the discovery of successful treatment for AD, one of which is the complex mechanism of neurodegeneration. Biochemical pathways thought to be involved in neurodegeneration are complex and multifaceted, making it necessary to study the finer details of each mechanism in order to discover more effective therapeutic treatments. Another hurdle to therapy development is that there are no species, other than humans, that can model all aspects of AD pathophysiology. Because it  is challenging to study human AD brains models of neurodegeneration mechanisms of neurodegeneration and eventually Figure 1.1: Glial cells (microglia and astrocytes and NFTs in AD; Lewy bodies in PD) and to the production of pro-inflammatory mediators including several prostaglandins (e.g. PGH PGE2) and cytokines (e.g. TNF- (e.g. glutamate and proteases) and free radicals (e.g. reactive oxy nitrogen species (RNS)), which are directly neurotoxic feedback pathways of activated glial cell mediators, which activate other glial cells   1.1.3.2 Parkinson’s Disease Like AD, a hallmark of activated glial cells (McNaught presence of intracellular proteinaceous Lewy bodies syn) aggregates (McNaught and there is significant death of pigmented dopaminergic neurons in the substantia nigra of the mid-brain. Oxidative stress and free radical production contribute to the loss of in vivo, research on potential in vitro will aid tremendously in the effort towards confirming the finding a cure.  ) are activated by pathological formations (A as a result of neuronal death. Glial cell activation alpha, IL-6). In addition, activated glial cells can release gen species (ROS) and reactive . Broken line arrows highlight . PD pathology is chronic inflammation caused by  and Olanow 2006). Another hallmark of PD is the  composed of alpha-synuclein ( Olanow 2006; Moore et al. 2005). In PD-affected brains, 5  and animal β leads 2, toxins possible  α-  6 neurons in this region (Moore et al. 2005). The resulting symptoms of PD pathology include tremor, rigidity, loss of balance, and impaired motor control.  1.1.4. Inflammatory Hypothesis of Neurodegeneration Though different regions of the brain are affected by AD (cholinergic neurons of the hippocampus and cerebral cortex) and PD (dopaminergic neurons of the substantia nigra and other areas), increasing evidence suggests that these two neurodegenerative illnesses share the same underlying symptom, which is chronic inflammation (Hirsch and Hunot 2009). Increased pro-inflammatory cytokine levels have been found in AD brains compared to unaffected brains. Brain tissue contains no pain receptors; therefore, people experiencing chronic inflammation in their brain cannot feel its detrimental effects. Research in neurodegenerative diseases has begun to investigate the effects of anti- inflammatory compounds to combat the inflammation; however, conventional steroidal and non-steroidal anti-inflammatory compounds both have severe side-effects if taken long term, and can ultimately pose a greater risk to the patient than neurodegeneration itself (Klegeris and McGeer 2005b). It has therefore become important to study the biochemical mechanisms of chronic inflammation in order to design more efficacious anti-inflammatory drugs.  1.1.5 Cell Culture Models of Neurodegeneration Though primary human astrocytes are relatively easy to culture and are able to proliferate in vitro, human microglia and neurons are limited in their ability to survive post-mortem conditions. Therefore, alternative methods of studying neuroinflammation  7 exist, including the use of immortalized human and murine (e.g. rat or mouse) cell lines as well as primary animal cell cultures. Immortalized human cell lines are cells that have been extracted from various source tissues and have acquired ability to proliferate indefinitely. Culturing and maintaining cell lines are relatively simple and inexpensive compared to in vivo animal models; thus, use of cell lines makes conducting numerous experiments relatively easy. The downside to using human cell lines is that their original morphologies and functions may differ from the original source tissue depending on the cell type.  Animal primary cells are much easier to obtain than human primary cells due to the relative availability of animal post-mortem tissue. Though murine primary cell lines are readily accessible for a variety of research purposes and are good models of the CNS, the physiological differences between human and murine cells are difficult to account for; therefore, an animal model more closely related to humans is preferred where available. Before our laboratory gained access to primary human astrocytes, we developed a technique to culture porcine glia from fresh adult pig brain tissues (Ionescu et al. 2011, see Appendix B for the publication). The comparison of microglia-neuron interactions in two different species (human and pig) can determine whether porcine glial cells can serve as good models for human glial cells. The use of porcine cells and tissues to study human physiology is widespread, since many physiological mechanisms in pigs and humans are similar (Hu et al. 1996; Ibrahim et al. 2006). The techniques that we have developed may provide other researchers with valuable methodology on how to extract and culture glial cells from adult porcine brains (see Appendix B).  8  The following human cell lines were used to construct an in vitro neuroinflammatory model for this thesis: THP-1 promonocytic leukemia cells, U-373 MG astrocytoma cells and SH-SY5Y neuroblastoma cells. All three immortalized cell lines have been used extensively in neuroinflammatory studies to model microglia, astrocytes and neurons (Combs et al. 2001; Hashioka et al. 2009; Klegeris et al. 2005; Klegeris and McGeer 2000; Xie et al. 2010). In 2000, Klegeris and McGeer determined that the combination of exogenous pro-inflammatory bacterial lipopolysaccharide (LPS) and human interferon-gamma (IFN-γ) can be used on THP-1 cells to induce a cytotoxic response that models the pathological activation of microglia (Klegeris and McGeer 2000). Stimulation with IFN-γ alone activates both U-373 MG cells and human astrocytes to produce similar cytotoxic responses (Hashioka et al. 2009). Though neither LPS nor IFN-γ is endogenous to the CNS, they induce a similar activation response in THP-1 cells, U-373 MG cells and human astrocytes as endogenous pro-inflammatory TNF-α, IL-6 and IL-1β, but in a significantly more robust manner (Hashioka et al. 2009; Klegeris et al. 2005). Stimulating model glial cells allows us to assess the pro-inflammatory and cytotoxic compounds released as a result of activation.  This model can also be used to screen various compounds for their anti-cytotoxic or neuroprotective properties. Figure 1.2 depicts the in vitro neuroinflammatory model that will be used in this study. Experiments and end-point analyses are described in more detail in the Methods section.   Figure 1.2: Human cell culture model of neuroinflammation. A glial cell model (either m like THP-1 cells, astrocytic U-373 MG cells or human astrocytes) is stimulated with bacterial LPS and human IFN-γ for 48 h at the average human body temperature, 37 the glial cell model are then transferred to neuron another 72 h at 37°C. Adding compounds at point A assesses their anti whether they are capable of preventing assesses whether the compounds are neuroprotective by acting on various mediators in the cell supernatant before being added to SH assesses the neuroprotective capabilities End-point analyses are conducted on both the glial cell model and on SH times indicated in the figure.   1.2 Phospholipases A2 and Inflammation All known phospholipase A glycerophospholipids into arachidonic acid, which in turn is a substrate for cyclooxygenases (COX) and lipoxygenases ( converted by COX-1 or COX  °C. Supernatants from -like SH-SY5Y cells, which are incubated for -cytotoxic properties (i.e. glial cell cytotoxicity). Adding compounds at point B -SY5Y cells. Finally, adding compounds at point C of compounds by acting directly on the SH -SY5Y cells during the  2 (PLA2) isoforms convert cell membrane Farooqui and Horrocks 2006). When -2, arachidonic acid yields prostaglandin (PG) H 9 icroglia- glial -SY5Y cells. 2, the  10 precursor of pro-inflammatory PGE2 (Dennis 1994; Farooqui and Horrocks 2006). When converted by lipoxygenases, arachidonic acid yields several leukotrienes (Dennis 1994; Farooqui and Horrocks 2006). Both PGs and leukotrienes act as intracellular messengers that mediate either anti- or pro-inflammatory responses (Dennis 1994).  1.2.1 Phospholipase A2 Isoforms There are three main isoforms of phospholipase A2: cytosolic PLA2 (cPLA2), secretory or secreted PLA2 (sPLA2), and Ca2+-independent PLA2 (iPLA2) (Dennis 1994; Lambeau and Gelb 2008). Each type of PLA2 has a number of isozymes, and therefore they are considered “groups” (see Table 1.1), which are generally classified based on nucleotide sequences and order of discovery (Dennis 1994; Lambeau and Gelb 2008).  Table 1.1: Classification of PLA2 Isoforms (previously published in Cummings et al. 2000)    It is currently under debate as to which PLA2 isoform contributes in the greatest extent to arachidonic acid production in inflammatory events; however, it is generally accepted that cPLA2α (also known as PLA2IVA) is the major contributor to inflammatory eicosanoid production (Han et al. 2003). Ca2+ release from mitochondrial stores has been shown to rely on Ca2+-independent PLA2β (also known as iPLA2β or PLA2VIA), which is important for the constriction of major arteries (Park et al. 2008). Physiological functions of extracellular PLA2s known as sPLA2s are discussed below.  11 1.2.2 Secretory Phospholipases A2 (sPLA2) Earlier studies on phospholipases have shown that sPLA2, specifically group IIA (sPLA2IIA), are secreted by macrophages in human synovial fluid in rheumatoid arthritis and may mediate pathogenic inflammation in atherosclerosis (Bobik 2009; Casserly and Topol 2004; Ibeas et al. 2009; Mathisen et al. 2007; Piek and de Winter 2003). There are currently nine forms of sPLA2 expressed in humans, each coded by separate genes (Lambeau and Gelb 2008). Some forms of sPLA2 that are structurally similar to those found in humans have been described in other animals such as rodents, pigs, snakes and bees (Lambeau and Gelb 2008). Thus far, it has been shown that sPLA2IIA, sPLA2 group X (sPLA2X) and sPLA2 group V (sPLA2V) contribute most to human inflammatory events (Lambeau and Gelb 2008). The exogenous addition of recombinant (r) sPLA2IIA has been shown to induce death in rat cortical neurons (Yagami et al. 2002). There is also evidence that the neurotoxic sPLA2 forms found in bee venom (sPLA2III) and rattlesnake venom (sPLA2IIA) are structurally similar to human sPLA2III and sPLA2IIA, respectively (Dennis 1994). Studying both exogenous and recombinant forms of pro-inflammatory sPLA2s may lead to insights as to the mechanism of sPLA2IIA neurotoxicity (Burke and Dennis 2009; Lambeau et al. 1991; Mounier et al. 2001; Pluckthun and Dennis 1985). Since microglia are a type of macrophage, the stimulation of microglia is hypothesized to result in the secretion of sPLA2IIA, which would subsequently induce neurotoxicity. Furthermore, there is growing evidence that sPLA2IIA plays a key role in neurodegeneration (Moses et al. 2006; Saegusa et al. 2008; Yagami et al. 2002). One study found that levels of sPLA2IIA are elevated in the post-mortem brain tissues of AD  12 patients (Moses et al. 2006). Isozymes of sPLA2 are also thought to contribute to reactive oxygen species production and oxidative stress found in PD pathology (Wei et al. 2003; Yagami et al. 2002). Other studies have suggested that sPLA2IIA may have a non- enzymatic role in inflammation (Birts et al. 2008; Saegusa et al. 2008), which is discussed in detail below. Little is known about the relationship between microglial cells and sPLA2IIA. It has been shown that astrocytes release sPLA2IIA (Lin et al. 2004; Oka and Arita 1991); however, it is not known whether microglia secrete sPLA2IIA, or whether glial sPLA2IIA contributes to glial-cell mediated neurotoxicity in the brain. Therefore, the role of sPLA2IIA in human neurotoxicity is the primary focus of this project.   1.3 sPLA2IIA 1.3.1 Structure of sPLA2  All extracellular PLA2 isoforms are interfacial enzymes, which are enzymes that function at the interface of water and lipid surfaces (Berg et al. 2001; Bezzine et al. 2002). Interfacial enzymes, including sPLA2IIA, have distinct catalytic (enzymatic substrate-binding) and interfacial (cell surface-binding) sites (Berg et al. 2001). Ca2+ is required at the sPLA2IIA catalytic site for catalysis; however, it has been recently noted that sPLA2IIA interfacial binding occurs with more frequency in the absence of Ca2+ (Olson et al. 2010). Upon membrane binding, the interface between sPLA2IIA and the cell membrane usually spans between 30-40 glycerophospholipid molecules (Bezzine et al. 2002).  13 Because human sPLA2IIA is considered a low molecular weight protein (~16 kDa (Lambeau and Gelb 2008)), it is possible that sPLA2IIA is secreted through a specific channel; however, there is no current evidence suggesting the existence of PLA2-specific channels in cell membranes. Cells must therefore use exocytosis in order to release sPLA2IIA into the extracellular environment (Lambeau and Gelb 2008). Similarly, the internalization of sPLA2IIA may involve pinocytosis or phagocytosis following its binding to either membrane phospholipids or cell surface proteins (Boilard et al. 2003). The surface composition of the sPLA2IIA protein includes many arginine and lysine residues, making sPLA2IIA uniquely cationic compared to other PLA2 isoforms (Bezzine et al. 2002). The catalytic active site of sPLA2IIA has a high affinity for anionic glycerophospholipids such as phosphatidylethanolamine and phosphatidylserine. For this reason, sPLA2IIA does not bind well to zwitterionic phosphatidylcholine-rich mammalian cell membranes under physiological circumstances (Bezzine et al. 2002); however, the ability of sPLA2IIA to bind to mammalian cell membranes increases during apoptosis (Boilard et al. 2003). Upon membrane blebbing, the bi-layered cell membrane inverts, exposing the layer normally positioned facing the cytosol; the inner membrane layer contains phosphatidylserine, which sPLA2IIA has a higher affinity for (Boilard et al. 2003).  1.3.2 Enzymatic Activity and Known Inhibitors of sPLA2  All PLA2s, including sPLA2IIA, are capable of producing arachidonic acid by hydrolyzing membrane glycerophospholipids. The catalytic site of sPLA2IIA comprises an aspartate-histamine diad and Ca2+ bound by a peptide loop, which is conserved in all  14 active sites of mammalian sPLA2s (Lambeau and Gelb 2008). Membrane binding increases the efficiency of substrate binding to the catalytic site, as well as overall catalytic efficiency (Lambeau and Gelb 2008). Several sPLA2 and specific sPLA2IIA inhibitors have been developed within the past decade. The compound named ‘sPLA2IIA inhibitor 1’ (a cyclic pentapeptide) is effective at micromolar concentrations (Church et al. 2001); however, it has been suggested that inhibitors with potency in this concentration range may have limited specificity due to an increased chance of non-specific binding at such high concentrations (Lambeau and Gelb 2008). YM-26734-1 is a natural derivative from the fruit of Horsfieldia amygdaline and is highly specific for human sPLA2IIA with nanomolar potency (Miyake et al. 1992). Indoxam (LY315920) and its derivative Me-indoxam are also sPLA2IIA-specific inhibitors and were found to be more potent than YM-26734-1 (Oslund et al. 2008). In 2008, Drs. Rob Oslund and Michael Gelb synthesized an indoxam derivative RO032107 (14b in Oslund et al. 2008) that exhibited greater potency at lower nanomolar concentrations than indoxam (Oslund et al. 2008). Another compound, RO041709 (15b in Oslund et al. 2008), was designed as a methylated control compound to RO032107, meaning that it contains an N-methyl group that prevents a key hydrogen bond from occurring between the inhibitor and a histidine or aspartate residue in the catalytic site of sPLA2IIA. RO041709 has at least 30-fold lower IC50 (half-maximal inhibitory concentration) than RO032107 (Oslund et al. 2008). A third inhibitor, RO092906 (11h in Oslund et al. 2008), was synthesized to specifically inhibit sPLA2X.   15 1.3.3 Non-Enzymatic Activity of sPLA2IIA Due to its cationic surface, sPLA2IIA exhibits potent bactericidal effects in several ways: 1) sPLA2IIA has a strong affinity for anionic peptidoglycans, which represent a large component of bacterial cell membranes (Lambeau and Gelb 2008; Wei et al. 2003; Wu et al. 2010); 2) sPLA2IIA is also basic and electrostatically attracted to acidic lipoteichoic acids present in Gram-positive bacterial cell walls and hydrolyzes the underlying plasma membrane (Birts et al. 2009; Lambeau and Gelb 2008; Wei et al. 2003); and 3) sPLA2IIA disrupts the LPS-containing coat and increases the permeability of Gram-negative bacterial cell walls, which enables it to hydrolyze the underlying cell wall (Lambeau and Gelb 2008). In addition, it has been shown that the cationic surface of sPLA2IIA allows it to bind with high affinity to anionic heparin sulfate proteoglycans, which are expressed on cell surfaces and may serve as sPLA2IIA interfacial-binding sites (Boilard et al. 2003). The use of heparin and heparinase III to block sPLA2IIA from binding to heparin sulfate proteoglycans only partially prevented sPLA2IIA from binding to apoptotic cells, which suggests that sPLA2IIA may also bind to other membrane proteins (Boilard et al. 2003). Beck et al. (2003) hypothesized that sPLA2IIA interacted with the muscle (M)- type receptor, which is one of the two types of cell surface receptors that binds to neurotoxic snake venom sPLA2s (Lambeau et al. 1995). Another sPLA2-binding receptor, the neuronal (N)-type receptor, is expressed in rabbit brain, heart and kidney and may be involved in sPLA2IIA-mediated mechanisms (Kolko et al. 2002; Lambeau et al. 1995; Lambeau et al. 1991). Recently however, it was discovered that the sPLA2IIA-M-type receptor interaction is species specific, and that human sPLA2IIA does not bind  16 effectively to human M-type receptors (Lambeau and Gelb 2008). The global cationic structure of sPLA2IIA contributes to its ability to aggregate with anionic lipid vesicles and may contribute to cellular uptake and removal of cellular debris (Birts et al. 2008). Upon investigating cellular uptake of sPLA2IIA and an enzymatically inactive mutant of sPLA2IIA using confocal microscopy, it was found that once sPLA2IIA was inside the cell, it was targeted to the nucleus and somehow escaped proteolysis during and after endocytic uptake (Birts et al. 2008). It is possible that by binding to cell surface heparin sulfate proteoglycans (Boilard et al. 2003), the cell initiates either phagocytosis or pinocytosis to internalize sPLA2IIA and its bound liposome (Birts et al. 2008).  1.3.4 Pathologies involving sPLA2IIA Increased levels of sPLA2IIA have been detected in various inflammatory conditions such as rheumatoid arthritis, atherosclerosis, cancer, AD and PD. It is still debated as to whether the role of sPLA2IIA is to exacerbate or resolve inflammation; however, current studies on sPLA2IIA function suggest that the action of sPLA2IIA may be tissue and/or disease specific.  1.3.4.1 Rheumatoid Arthritis  Rheumatoid arthritis is characterized by chronic inflammation in the joints, leading to pain and damage to joint cartilage and bone (Choy and Panayi 2001). Human sPLA2IIA was originally isolated from inflamed synovial joint fluid of rheumatoid arthritis patients (Bidgood et al. 2000; Masuda et al. 2005). It has been consistently  17 shown that the sPLA2IIA concentration in rheumatoid-arthritic synovial joints is significantly higher than in non-arthritic joints (Bryant et al. 2010; Jamal et al. 1998; Masuda et al. 2005). Several studies have linked TNF-α-induced sPLA2IIA with increased cPLA2/COX-2-coupled production of pro-inflammatory PGE2 in synovial joint fluid (Bidgood et al. 2000; Bryant et al. 2010), a relationship that has also been demonstrated in TNF-α-stimulated rat mesangial cells (Beck et al. 2003; Han et al. 2003).  1.3.4.2 Atherosclerosis  Atherosclerosis is the thickening of arterial walls by cholesterol-laden plaques. Several studies have shown high concentrations of sPLA2IIA within the serum plasma of atherosclerotic patients compared to patients with no history of cardiovascular problems (Ghesquiere et al. 2005). It has been reported that sPLA2IIA contributes to atherosclerosis both in an enzymatic (catalytic) and non-enzymatic manner. Enzymatically, sPLA2IIA hydrolyzes oxidized low-density lipoproteins, which releases fatty acids and lysophospholipids that can be further metabolized into inflammatory mediators (Divchev and Schieffer 2008). Due to its uniquely anionic surface, sPLA2IIA binds to proteoglycans in the extracellular matrix, which has been linked to increased collagen deposition and development of atherosclerotic plaques.  1.3.4.3 Cancer The over-expression of sPLA2IIA has been found in many cancerous tissues. Inhibitors of sPLA2IIA were found to suppress the growth of esophageal adenocarcinoma  18 cells (Mauchley et al. 2009). It was also found that sPLA2IIA attenuated colorectal cancer tumorigenesis in a manner independent of the adenomatous polyposis coli tumor suppressor gene. Research on both prostate cancer and colorectal cancer has found that sPLA2IIA contributes to cancerous cell survival (Jiang et al. 2002). sPLA2IIA-induced astrocytoma proliferation through Ras (guanine triphosphatase involved in signal transduction; originally identified as a rat sarcoma oncogene product) activation and promoted mitochondria-independent accumulation of reactive oxygen species (ROS) (Hernandez et al. 2010; Martin et al. 2009; Mathisen et al. 2007). Such evidence suggests that sPLA2IIA participates in cell regulation by acting through the nuclear factor-kappa-B (NF-κB) pathway and mitogen-activated protein kinase (MAPK) cascade (Martin et al. 2009). It has been demonstrated that depending on the cell type sPLA2IIA could either promote or inhibit cell growth (Dong et al. 2010).  1.3.4.4 Neurodegenerative Disease One study found that levels of sPLA2IIA are elevated in the post-mortem brain tissues of AD patients compared to patients with no dementia (Moses et al. 2006). The enzymatic activity of sPLA2IIA is also thought to be responsible for free radical production and oxidative stress that contributes to PD pathology (Chiricozzi et al. 2010; Wei et al. 2003; Yagami et al. 2002). The combined evidence of several in vitro studies that showed sPLA2IIA-induced neuronal apoptosis (Chiricozzi et al. 2010; Yagami et al. 2002) and the presence of increased levels of sPLA2IIA in AD and ischemic brains prompted a recent review to conclude that sPLA2IIA exacerbates neuronal death in neurodegenerative diseases (Schaeffer et al. 2010).  19 1.3.5 sPLA2IIA Regulation Numerous studies have reported that various pro-inflammatory compounds including TNF-α, IL-1β, IFN-γ and exogenous LPS induce sPLA2IIA mRNA expression in a number of different cell types (Lin et al. 2004; Massaad et al. 2000). In rat cortical astrocytes, TNF-α induction of sPLA2IIA was mediated by cyclic adenosine monophosphate (cAMP), while the induction of sPLA2IIA by LPS involved protein kinase C (PKC) (Oka and Arita 1991). IFN-γ induced sPLA2IIA mRNA in human arterial smooth muscle cells, which appeared to be cell type specific and involved STAT (signal transducer and activator of transcription)-3 activation (Peilot et al. 2000). Extracellular signal-regulated kinase (ERK)1/2 and PKC had to be activated in order for sPLA2IIA and sPLA2V to enhance the effect of H2O2-induced arachidonic acid release in mouse mesangial cells; sPLA2IIA amplified cPLA2 activity and its coupling with COX enzymes (Han et al. 2003; Jensen et al. 2009). The first study to document the astrocytic production of group II sPLA2 was published in 1991 (at the time of the study, group II sPLA2 was not yet differentiated into subtypes e.g. sPLA2IIA): inflammatory cytokines TNF-α, IL-1β and IFN-γ were found to enhance the expression of sPLA2IIA mRNA in cultured rat astrocytes (Oka and Arita 1991). In a more recent study, the up-regulation of sPLA2IIA mRNA was found in reactive astrocytes after transient focal cerebral ischemia in rat brain tissue (Lin et al. 2004). Several studies have concluded that sPLA2 and cPLA2 isozymes regulate each other during inflammation (Beck et al. 2003; Kuwata et al. 2000; Murakami et al. 1999). It was also suggested that cPLA2 isozymes contribute to membrane hydrolysis and  20 arachidonic acid release during inflammatory events to a greater extent than sPLA2 isozymes (Han et al. 2003; Lambeau and Gelb 2008). Figure 1.3 illustrates a proposal by Beck et al. (2003), which states that, upon cPLA2-mediated generation of eicosanoids, the peroxisome proliferator-activated receptor alpha (PPARα) up-regulates sPLA2IIA mRNA production. Because sPLA2IIA is involved in numerous inflammatory diseases, it is difficult to characterize a single sPLA2IIA function, target or contributing pathway. Therefore, the next section will focus primarily on evidence supporting either an enzymatic or non- enzymatic mechanism of sPLA2IIA-induced neurotoxicity, though it is likely that the protein engages in both actions.  1.3.6 Neurotoxic Mechanisms of sPLA2IIA In 2002, it was found that exogenous application of human recombinant sPLA2IIA (rsPLA2IIA) to rat cortical neurons resulted in significant neuronal death (Yagami et al. 2002). Rat cortical neurons undergoing apoptosis were found to exhibit a change in membrane phospholipids; specifically, upon increased exposure to oxidants during oxidative stress, phospholipid composition of plasma membrane shifted to containing more arachidonic acid. cPLA2α has been shown to provide the majority of arachidonic acid liberated from cell membranes (Han et al. 2003). Even though sPLA2IIA has a low affinity for mammalian cell membranes, it still may act on neuronal membranes that have been pre-damaged by H2O2 (Han et al. 2003). Cell membrane hydrolysis via sPLA2 isozymes increases during apoptotic or necrotic cell death, partially due to the cell losing its normal resistance to membrane hydrolysis (Olson et al. 2010).  Figure 1.3: Proposed PLA2 pathways leading to the up mRNA (previously published in eicosanoids, the nuclear receptor PPAR α and IL-1β can directly increase sPLA secreted by the cell, it may contribute to its own positive feedba sulfate proteoglycans on the cell membrane surface, which activates cPLA results in further sPLA2IIA up-regulation  Bee venom-derived sPLA increase causing subsequent neuronal death in prenatal rat neurons (DeCoster 2002). Snake venom sPLA2IIA binds to N induced neuronal death (Kolko N-methyl-D-aspartic acid and receptors have both been implicated in snake venom sPLA (Kolko et al. 2002). Glutamate ionotropic N hydroxyl-5-methyl-4-isoxazole  -regulation of endogenous sPLA  Beck et al. 2003). Once the activation of cPLA2 produces α up-regulates sPLA2IIA mRNA. Cytokines such as TNF 2IIA mRNA production. Once sPLA2IIA is produced and ck loop by binding to heparin 2 and PPAR . 2 type III can potentiate glutamate-induced Ca -type receptors and potentiates glutamate et al. 2002; Lambeau et al. 1995). Glutamate ionotropic α-amino-3-hydroxyl-5-methyl-4-isoxazole-propionate 2-mediated neuronal death -methyl-D-aspartic acid and α-amino -propionate receptor antagonists have exhibited 21 2IIA - α, and 2+  et al. -  -3-  22 neuroprotective effects, particularly in ischemia and epilepsy (Kolko et al. 2002). sPLA2IIA inhibitor 1 has been found to reduce glutamate-mediated reactive oxygen species proliferation in rat granular neurons (Mathisen et al. 2007). Therefore it is possible that sPLA2IIA enzymatic activity contributes to glutamate-induced excitotoxicity. Ca2+ homeostasis may be affected by the up-regulation of sPLA2IIA; it has been demonstrated that sPLA2IIA enhances Ca2+ intake into rat cortical neurons via the L-type voltage-gated Ca2+ channel (Yagami et al. 2003). An influx of intracellular Ca2+ is required for glutamate ionotropic receptor-mediated long-term potentiation (Pineau and Lacroix 2009). Low concentrations of bee venom sPLA2III potentiated glutamate- stimulated intracellular Ca2+ increase in rat cortical neurons (DeCoster et al. 2002). It is possible that sPLA2IIA may contribute to the regulation of Ca2+ channels in a similar way. The glutamate ionotropic N-methyl-D-aspartic acid receptor antagonist MK-801 attenuated the effects of both human sPLA2IIA and bee venom sPLA2III on glutamate signaling (Putz et al. 2007). Mitochondria purified from rat brain astrocytes, neuron-like PC-12 cells and U- 251 astrocytoma cells were found to store sPLA2IIA (Macchioni et al. 2004). Reduced membrane potential and oxidative stress caused mitochondria from rat brain astrocytes to release sPLA2IIA into the cytosol; this not only may activate cPLA2-driven arachidonic acid production (see Fig. 3.1), but may also contribute to neuronal death by hydrolyzing the inner layer of the plasma membrane (Macchioni et al. 2004). The localization of sPLA2IIA in mitochondria may be a result of prior internalization through binding with heparin sulfate proteoglycans (Boilard et al. 2003; Macchioni et al. 2004).  23 Mitochondrially-located sPLA2IIA may also regulate intra-neuronal Ca2+ concentrations because neurons have intracellular stores of Ca2+ in both the endoplasmic reticulum and mitochondria. As a result, the neurotoxic mechanism of sPLA2IIA may be attributed to its binding to neuronal surface receptors and initiating cell death pathways or to disrupting Ca2+ regulation and contributing to glutamate-induced neuronal excitotoxicity (Yagami et al. 2003). A more recent model of the non-enzymatic sPLA2IIA neurotoxicity involves its interaction with the cell surface integrins. In 2008, it was shown that sPLA2IIA had high affinity for the integrin alpha-5-beta-3 (α5β3) and that binding of sPLA2IIA to this receptor induced proliferation of U937 human monocytic lymphoma cells (Saegusa et al. 2008). Affiliation with integrin receptors indicates that sPLA2IIA may regulate the cell signaling pathways responsible for activating monocytes. Since microglia are a type of tissue macrophage that originates from monocytes, it is possible that sPLA2IIA may also contribute the activation of microglia. Another possible sPLA2IIA receptor may be the toll-like receptor 4 (TLR4) that is expressed by both neuronal and glial cells (Tang et al. 2008). LPS binding to TLR4 complexed with MD-2 (lymphocyte antigen 98) induces the NF-κB cascade in microglia- like THP-1 cells (Zhang et al. 1999). As sPLA2IIA has been shown to initiate the NF-κB cascade (Alaoui-El-Azher et al. 2002; Martin et al. 2009), it may do so by binding to TLR4. By blocking sPLA2IIA from binding to TLR4 on neurons, it may be possible to attenuate sPLA2IIA-induced neuronal death. If the sPLA2IIA neurotoxicity is due to its enzymatic activity, then the addition of sPLA2IIA-specific inhibitors to cytotoxic glial cell supernatants should result in reduced  24 neuronal death; however, if sPLA2IIA-specific inhibitors fail to reduce cytotoxicity of glial secretions, then the non-enzymatic activity of sPLA2IIA should be suspected. Therefore, if sPLA2IIA is secreted by glial cells upon stimulation with inflammatory factors and induces neurotoxicity in a non-enzymatic manner, it can be hypothesized that either 1) removing sPLA2IIA from the glial supernatants, or 2) blocking sPLA2IIA from forming complexes with potential cell surface receptors should result in reduced neuronal death.   1.4 Research Overview and Hypotheses Studying the role of sPLA2IIA in glial cell-neuron interactions may offer more insight as to its function in neuroinflammation. Previous work has shown that sPLA2IIA may function as an intercellular mediator or neurotoxin during inflammation; therefore, studies are needed to better understand the sPLA2IIA-mediated cellular processes that occur during neuroinflammation. Though the association between sPLA2IIA and astrocytes has been investigated before, no information is available about the relationship between microglia and sPLA2IIA. Furthermore, the contribution of sPLA2IIA enzymatic activity to glia-mediated neuroinflammation has not been studied before. Activated (stimulated) microglia and astrocytes contribute to neuroinflammation by releasing a plethora of pro-inflammatory mediators and neurotoxins. The following neurotoxins released from stimulated glial cells have been indentified: the excitotoxic amino acid glutamate (Moriguchi et al. 2003; Parpura and Haydon 2000), soluble Fas ligand (Fas L) (Ciesielski-Treska et al. 2001), tissue plasminogen activator (Flavin et al.  25 2000), cathepsin B (Gan et al. 2004; Kingham and Pocock 2001), and several proteases including metalloproteases (Harris et al. 2007) and chymotrypsin-like proteases (Klegeris and McGeer 2005a). A number of unidentified soluble neurotoxic proteins have also been observed to originate from activated glial cells (Flavin et al. 1997; Giulian et al. 1993); these unidentified neurotoxins may include extracellular phospholipases such as sPLA2IIA. The central hypothesis of this study is that sPLA2IIA is a toxin secreted by activated glial cells, which causes neuronal death. Human cell lines THP-1 promonocytic leukemia cells, U-373 MG astrocytoma cells and SH-SY5Y neuroblastoma cells are used to model microglia, astrocytes and neurons, respectively. Human primary astrocytes are also used to confirm processes studied in U-373 MG cells. The selective sPLA2IIA inhibitor RO032107 is used to assess the contribution of sPLA2IIA enzymatic activity to glial cell neurotoxicity. The effect of sPLA2IIA on neuronal cells pre-damaged by hydrogen peroxide is examined, as well as the regulatory role of PPARα in sPLA2IIA- induced neurotoxicity. The effect of using a sPLA2IIA-specific immunosorbent to remove it from stimulated cell supernatants is also investigated. Outcomes of this thesis may contribute to the development of drugs that disrupt the pro-inflammatory and cytotoxic effects of sPLA2IIA in neuroinflammation.  26 2 Materials and Methods 2.1 Chemicals and Reagents The following reagents were supplied by Cayman Chemical Company (Ann Arbor, MI, USA): 1-[(4-chlorophenyl)methyl]-3-[(1,1-dimethylethyl)thio]-α,α-dimethyl- 5-(1-methylethyl)-1H-indole-2-propanoic acid sodium salt (MK885, Cat#10133), 4-[(1- oxo-7-phenylheptyl)amino]-(4R)-octanoic acid (OPHAO, Cat#13181), 7,7-dimethyl-5,8- eicosadienoic acid (DMDA, Cat#70500), 6-isopropoxy-9-oxoxanthene-2-carboxylic acid (AH6809, Cat# 14050), bee venom sPLA2III (Cat#60500), methyl arachidonyl fluorophosphonate (MAFP, Cat#70660), mouse anti-PGE2 immunosorbent (Cat#414020), mouse anti-human PGE2 monoclonal antibody (Cat# 414013), mouse anti- human sPLA2 type IIA (sPLA2IIA) monoclonal antibody (Cat#160500), mouse anti- human sPLA2IIA immunosorbent (Cat#485009), N-[[4’-[[3-butyl-1,5-dihydro-5-oxo-1- [2-(trifluoromethyl)phenyl]-4H-1,2,4-triazol-4-yl]methyl][1,1’-biphenyl]-2-yl]sulfonyl]- 3-methyl-2-thiophenecarboxamide (L-161,982, Cat#10011565), and sPLA2IIA enzyme- linked immunosorbent assay (ELISA) kit (Cat#585000). The following reagents were purchased from Fisher Scientific (Ottawa, ON, Canada): bovine serum albumin (BSA), diethanolamine, Dulbecco’s modified Eagle medium nutrient mixture F-12 Ham (DMEM-F12), ethanol (EtOH), ethylenediaminetetraacetic acid (EDTA) sodium salt, glycine, HCl, H2O2, NaCl, N,N- dimethylformamide (DMF), sodium acetate, sodium borate, sodium dodecyl sulfate (SDS), SYBR safe dye, and tris(hydroxymethyl)aminomethane (Tris). The following reagents were obtained from Sigma-Aldrich (Oakville, ON, Canada): 3-(4,5-dimethylthiazol-2-yl) 2,5-diphenyl 21 tetrazolium bromide (MTT), 5-(4-  27 benzyloxyphenyl)-4S-(7-phenylheptanoylamino) pentanoic acid (BPPA, Cat#S3319), agarose, beta-nicotinamide adenine dinucleotide (β-NAD), CaCl2•2H2O, diaphorase (from Clostridium kluyveri), dimethyl sulfoxide (DMSO), iodonitrotetrazolium chloride (INT), lipopolysaccharide (LPS, from Escherichia coli 055:B5), sodium L-lactate (lactate), oxamic acid, and Triton X-100. IDSol Pre-mixed 30% acrylamide:Bis (29:1) solution (Cat# IS003) was supplied by Dgel Electrosystem Inc. (Montreal, QC, Canada). Concanavalin A (ConA, a tetrameric metalloprotein extracted from the jack bean Canavalia ensiformis) sepharose 4B (Cat#17-0440-03) was obtained from GE Healthcare (Baie d’Urfe, QC, Canada). sPLA2IIA forward and reverse primers were ordered from Integrated DNA Technologies (IDT, San Diego, CA, USA). The live/dead mammalian cell viability/cytotoxicity assay kit (Cat# L-3224) was purchased from Invitrogen (Burlington, ON, Canada). Penicillin (100,000 U/ml) and streptomycin (100,000 µg/ml) dual antibiotic solution was obtained from MP Biomedicals (Solon, OH, USA). Human IFN-γ was ordered from PeproTech (Ottawa, ON, Canada). The SV Total RNA Isolation System (50 preparations, Cat#Z3100), Improm-II Reverse Transcription (RT) System (100 reactions, Cat#A3802), GoTaq Green Master Mix kit, 100 bp and 1 kb ladders were purchased from Promega (Madison, WI, USA). Trypsin/EDTA solution and fetal bovine serum (FBS) were obtained from Thermo Scientific (Waltham, MA, USA). Phosphate-buffered saline (PBS) tablets were purchased from Takara Bio Incorporated (Madison, WI, USA). Mary Forrest of the Department of Biology, University of British Columbia Okanagan, in Kelowna, BC, Canada generously provided the restriction enzymes BamHI and Dde1. Michael Gelb and the Laboratory of Medicinal Enzymology, University of  28 Washington, in Seattle, WA, USA generously provided RO032107, RO041709, and RO092906 inhibitors as well as a sample of human recombinant sPLA2IIA (rsPLA2IIA). Another human rsPLA2IIA sample was obtained from ProSpec (East Brunswick, NJ, USA, Cat#ENZ-290). Mouse antibodies against human toll-like receptor 4 (TLR4)/MD-2 complex (Cat#HM2246) were purchased from Hycult Biotech (Burlington, ON, Canada). 10-(1-Pyrenyl)-decanoic acid (1-pyrenedecanoic acid, Cat#5236) and 1-hexadecanoyl-2- (1-pyrenedecanoyl)-sn-glycero-3-phosphomethanol (PGPM, Cat#2276) were purchased from Genolite Biotek (Portland, OR, USA)   2.2 Equipment Tissue culture dishes (10 cm) and 96-well sterile plastic plates (Corning Inc., Corning, NY, USA) were used where the experiment involved collection of large volumes of supernatants or treatments in small volumes, respectively. The rest of cell culture experiments were conducted by using sterile 24-well plastic cell culture plates (Corning). Cell cultures were grown in T-75 flasks (Sarstedt, Montreal, QC, Canada) in a Steri-Cycle HEPA Class 100 carbon dioxide (CO2) incubator (Model#370, Thermo Scientific). A hemocytometer (ChangBioscience, Castro Valley, CA, USA) was used to count cells. The Sorvall RT1 Centrifuge (Cat#75002384, Thermo Scientific) was used to centrifuge cell samples for supernatant collection or for use in the experiments. The C1000 Thermal Cycler (Model#185-1048) used to conduct polymerase chain reactions (PCR) and the Mini-PROTEAN Tetra Cell System with HC Power Supply (Cat#165-8001 and 164-5070, respectively) used for casting polyacrylamide gels and  29 running electrophoresis were purchased from Bio-Rad (Philadelphia, PA, USA). The Eppendorf Biophotometer Plus (Cat# 952000006) spectrophotometer was used to estimate mRNA concentrations. PCR products in polyacrylamide gels were visualized and digitally photographed using the AlphaView imaging system (Model FluorChem HD2) purchased from Alpha Innotech (Santa Clara, CA, USA). The Fluostar Omega microplate reader was purchased from BMG Labtech (Nepean, ON, Canada). Fluorescence images from the live/dead assay were visualized and digitally photographed using an inverted microscope with epi-fluorescence attachment (Model AE31) from Motic (Richmond, BC, Canada). Black 96-well plates (Cat#655076) used in the fluorescent enzyme activity assay were obtained from Grenier Bio-One (Monroe, NC, USA).   2.3 Cell Culture Models The SH-SY5Y dopaminergic neuroblastoma cell line was used as a neuronal model, while THP-1 promonocytic cell line was used as a microglial model. Primary human astrocytes prepared from surgically dissected human epilepsy tissues and the U- 373 MG astrocytoma cells were used as astrocyte models. All cell lines and human astrocyte cultures were obtained from the Kinsmen Laboratory of Neurological Research at the University of British Columbia, Vancouver, Canada. Cultures were grown in DMEM-F12 with 10% FBS, penicillin (100 U/ml) and streptomycin (100 µg/ml). Cultures were incubated in a CO2 incubator set at 37°C with 5% added CO2 and 100% humidity.  30 2.4 Collecting Glial Cell Supernatants 10 ml of THP-1 cells were seeded onto a 10 cm culture dish at 0.5 million cells/ml. After 15 min incubation in a CO2 incubator at 37°C, THP-1 cells were stimulated with a combination of LPS (0.5 µg/ml) and IFN-γ (150 U/ml) and incubated for 48 h at 37°C in a CO2 incubator. Supernatant was carefully collected and any remaining cells removed by centrifugation at 250 g for 10 min. Adherent U-373 MG astrocytoma cells were harvested from T-75 flasks by discarding supernatant and incubating cells with 1.5 ml of 0.05% trypsin/EDTA solution for 2 min at 37°C. The trypsin was then inactivated by adding 10 ml DMEM-F12 medium with 10% FBS (F10). U-373 MG cells were then counted with a hemocytometer, centrifuged and reconstituted with fresh DMEM-F12 plus 5% FBS (F5) to a concentration of 0.25 million cells/ml in 10 ml. The cells were seeded onto a 10 cm culture dish and incubated at 37°C in a CO2 incubator. After incubation for 24 h, medium was replaced with fresh F5 and cells were stimulated with IFN-γ (150 U/ml) and incubated for an additional 48 h at 37°C in a CO2 incubator. Supernatant was carefully collected via aspiration into a sterile plastic 50 ml tube and any remaining cells removed by centrifugation at 250 g for 10 min. Adherent primary human astrocytes were harvested from T-75 flasks by removing cell supernatant and incubating cells with 1.5 ml of 0.25% trypsin/EDTA solution for 2 min at 37°C. From this point, the protocol described above for collecting U-373 MG cell supernatants was followed, except that human astrocytes were plated at a density of 0.2 million cells/ml in 10 ml.  31 Experiments with THP-1 and U-373 MG cell supernatants were performed on at least three independently grown batches of cells. Human astrocytes prepared from three different surgical cases were used. All supernatants were tested for toxicity on SH-SY5Y cells before sorbent and other experiments were initiated.   2.5 Plating SH-SY5Y Cells for Experiments Adherent SH-SY5Y cells were detached from T-75 flasks by removing supernatant and incubating with 1.5 ml of 0.05% trypsin/EDTA for 2 min. Trypsin was then inactivated with 10 ml F10. SH-SY5Y cells were counted with a hemocytometer, centrifuged, and reconstituted with fresh F5 to a concentration of 0.2 million cells/ml. The cells were then seeded onto 24-well plates at 0.4 ml/well and incubated for 24 h at 37°C in a CO2 incubator before use in experiments.   2.6 Cytotoxicity Assays: Lactate Dehydrogenase (LDH) LDH enzymatic activity was measured to estimate the percent cell death as compared to a 100% lysed cell control where all cells were lysed by adding 1% Triton X- 100. LDH is a stable enzyme that catalyzes the conversion of lactate to pyruvate, which is a reaction that is important for cell survival. LDH is present in the cytosol and is released from cells with damaged membranes. Conversion of lactate to pyruvate by LDH requires the reduction of beta-nicotinamide adenine dinucleotide (β-NAD), which can be coupled with the diaphorase-catalyzed reduction of iodonitrotetrazolium (INT) dye to a purple  32 formazan. (Decker and Lohmann-Matthes 1988). The optical density of INT is linearly correlated with the concentration of LDH in the sample (Nachlas et al. 1960). Cell supernatant (0.1 ml) was collected from each experimental sample and transferred to a 96-well plate. INT was added to each well to a concentration of 260 µg/ml, and an initial measurement of optical density (OD) at 490 nm was performed. A reaction mixture containing lactate (750 µg/ml in sample), β-NAD (60 µg/ml in sample) and diaphorase (55 µg/ml in sample) in PBS was added to each well and the reaction was allowed to proceed for 20-30 min until it was terminated by the addition of oxamic acid (1.5 mg/ml in sample). An end point measurement of OD at 490 nm was performed after the addition of oxamic acid, and percent cell death for each sample was determined by using the following two-step equation: (1) Afinal – Ainitial = dAn (2) [(dAn – dAmedium)/(dAlysis – dAmedium)] x 100 = % death, where Ainitial represents initial absorbance, Afinal represents final absorbance, dAn represents the difference between Ainitial and Afinal for experimental samples (i.e. each well containing 0.1 ml cell supernatant), dAmedium represents dAn for the medium control, and dAlysis represents dAn for the lysed cell control.   2.7 Cytotoxicity Assays: MTT MTT is a yellow formazan dye that is reduced by metabolically active mitochondria into purple crystals. The optical density of MTT is linearly correlated with the concentration of live cells in the sample (Hansen et al. 1989; Mosmann 1983). After  33 collecting 0.1 ml supernatant for LDH assay from each experimental well, 30 µl of 5 mg/ml MTT solution was added to the remaining 0.3 ml cell culture medium and plates incubated at 37°C in CO2 incubator for 1 h. Subsequently, 0.4 ml of a 20% SDS/50% DMF solution in deionized water was added and the plates incubated overnight at 37°C to solublize the crystals. To measure OD of the samples, 0.1 ml from each well was transferred to a 96-well plate and absorbances at 570 nm were measured using a microplate reader. Percent cell viability (% viability) for each well was determined using the following two-step equation: (3) An – Amedium = dAn   (4) [dAn / dAuntreated] x 100% = % viability, where An represents the absorbance value for the sample in question, dAn is the difference between An and Amedium, Amedium represents the absorbance value for the medium control and dAuntreated represents the difference between Auntreated (absorbance value for the untreated control) and Amedium.   2.8 Cytotoxicity Assays: Live/Dead Immunofluorescence The live/dead assay uses two fluorescent dyes to differentiate living cells from dead cells. Non-fluorescent calcein acetoxymethyl ester (AM) is permeable to intact cell membranes and is converted by ubiquitous intracellular esterases into fluorescent calcein, which causes viable cells to fluoresce green. Ethidium homodimer-1 (EthD-1), though impermeable to intact cell membranes, is able to enter cells with damaged membranes.  34 EthD-1 is non-fluorescent until it binds to nucleic acids, which causes dead cells to fluoresce red. The viability of SH-SY5Y cells used in immunosorbent experiments (see section 2.9) was assessed using the live/dead assay. Supernatants were removed and 0.2 ml of 1 µM calcein AM and 1 µM EthD-1 in PBS was added to each well. The plate was incubated at 37°C in CO2 incubator for 5-10 min before visualizing the cells on an inverted microscope. Live cells were visualized through a fluorescein isothiocyanate (FITC) fluorescence set of filters, while dead cells were visualized through a Texas Red fluorescence set of filters. Digital photographs were taken of each experimental well at 100x total magnification. A 4 x 6 grid containing 4.5 cm x 4.2 cm rectangles was overlaid on each photograph. Cell counts were conducted in a blinded fashion in that the counter did not know which images represented which treatments. The counter chose 3 random rectangles from which to count live (green) and dead (red) cells, and determined the average (x) for each sample (i.e. average cells per well). The percentages of live and dead cells were determined using the following equations: (5) % Live cells = xlive cells/ [xlive cells + xdead cells] x 100% (6) % Dead cells = xdead cells/ [xlive cells + xdead cells] x 100%, where xlive cells represents the average number of live cells in the sample and xdead cells represents the average number of dead cells in the sample. At least 170 cells were counted for each sample.    35 2.9 Immunosorbent Experiments Immunosorbents for sPLA2IIA and PGE2 were composed of sepharose 4b beads coated with mouse anti-human sPLA2IIA or mouse anti-human PGE2 antibodies, respectively. Both sorbents were supplied as a 1:1 (v/v) suspension in PBS. ConA-coated sepharose, also containing sepharose 4b beads, was used as a control for the sepharose 4b matrix used in both sPLA2IIA and PGE2 sorbents. The initial 1:1 sorbent aliquots (total volume 0.1 ml each) were centrifuged at 500 g for 1 min and reconstituted at a ratio of 1:20 v/v by replacing the supernatant with 1 ml PBS. Each aliquot underwent one regeneration cycle before use in experiments, which consisted of rinses with four different solutions in the following order: 1 x 1 ml HCl- glycine buffer (pH 4), 1 x 1 ml 100% molecular-grade EtOH, 2 x 1 ml PBS, and 1 x 1 ml serum-free DMEM-F12. Prior to each solvent rinse, sorbent aliquots were centrifuged at 500 g for 1 min to sediment the sorbent before proceeding to the next solvent. After each centrifugation step, supernatant was discarded and the sorbent was gently pipetted up and down 5x to disperse sorbent before subsequent rinsing. After rinsing, 1 ml cell culture supernatant was added to each sorbent aliquot, dispersed via pipetting, and incubated on a bench-top rocker for 10 min at room temperature. Sorbent-treated samples were then centrifuged at 500 g for 1 min, the sorbent-free supernatants transferred to SH-SY5Y cells and cultures were incubated at 37°C in a CO2 incubator. LDH and MTT assays were performed on the SH-SY5Y cells cultures after 72 h incubation.    36 2.10 Enzyme-Linked Immunosorbent Assay (ELISA) The ELISA was conducted exactly as specified in Cayman Chemical Company’s protocol. Briefly, the assay utilized a double-antibody “sandwich” technique, allowing any sPLA2IIA in cell supernatant samples to first bind with a primary antibody immobilized to the well surface. The secondary antibody was an acetylcholinesterase:antigen-binding fragment conjugate that bound selectively to an alternative epitope on the sPLA2IIA protein, forming an immobilized sPLA2IIA “sandwich” between the primary and secondary antibodies. After rinsing the plate from excess supernatant and antibodies, Ellman’s reagent was added, which contained substrate for acetylcholinesterase causing production of a yellow colour upon being converted by acetylcholinesterase. The optical density of the samples at 405 nm was measured and the concentration of sPLA2IIA derived by using samples containing known concentrations of rsPLA2IIA. Cell supernatants (0.1 ml) and eight ELISA standards of known rsPLA2IIA concentration were transferred to a 96-well plate pre-coated with mouse anti-human sPLA2IIA antibodies, after which 0.1 ml of acetylcholinesterase:antigen-binding fragment conjugate was added to each well except one blank well. The plate was covered and incubated for 24 h at 4°C. After incubation, plate contents were discarded and the plate was washed 5x with wash buffer provided with the kit. 0.2 ml Ellman’s reagent was added to each well, after which the plate was incubated in the dark on an orbital rotator for 2 h. Absorbance at 405 nm was measured using the microplate reader, and concentrations of sPLA2IIA in each sample (i.e. each well containing 0.2 ml Ellman’s reagent) were determined using the following equations:  37 (7) An – Ablank = dAn (8) [dAn – Y intercept] / slope = sPLA2IIA concentration (pg/ml) where An represents the absorbance of the sample in question, Ablank is the absorbance of the blank sample, and dAn is the difference between An and Ablank. The Y intercept and slope values were determined from an equation derived by plotting the absorbance versus concentration for the rsPLA2IIA standards (for an example of the calibration curve, see Figure 2.1). All resulting values were then converted from pg/ml to pmol/L (sPLA2IIA molecular weight =16 kDa). The detection limit of the assay (pmol/L) was determined by multiplying the standard deviation of all blank absorbance values by 2 and calculating the corresponding sPLA2IIA concentration.   2.11 RNA Isolation and Reverse Transcription (RT) RNA from both stimulated and unstimulated THP-1 cells, U-373 MG cells, and human astrocytes was isolated using the SV RNA isolation kit from Promega. Procedures were performed as specified in the manufacturer’s protocols. All reagents listed in this section were provided in the kits with the following exceptions: LPS, human IFN-γ and 100% molecular-grade EtOH. Briefly, 10 ml of a 0.5 million cells/ml solution of each cell type were seeded on separate 10 cm tissue culture dishes. THP-1 cells were incubated at 37°C in a CO2 incubator for 15 min before stimulation with LPS (0.5 µg/ml) and human IFN-γ (150 U/ml). U-373 MG cells and human astrocytes were allowed to adhere for 24 h before stimulation with IFN-γ (150 U/ml). THP-1 cells were stimulated for 4, 24 and 48 h, after  which cells were harvested into separate 1.5 ml microtubes and centrifuged at 250 10 min. U-373 MG cells were stimulated were removed and cells were d into 1.5 ml microtubes and centrifuged at 250 stimulated for 48 h with human IFN were detached with 0.25% trypsin centrifuged at 250 g for 10 min  Figure 2.1: A typical calibration curve for the sPLA sPLA2IIA ELISA were linearly correlated with the absorbance equation in addition to the R2 value  After centrifugation, supernatants were removed and the remaining cells were treated with 175 µl RNA lysis buffer and 1% v/v β-mercaptoethanol) buffer at pH 7 containing 0.9 M NaCl and 0.09 M sodium citrate, 10 mM Tris 7.4, 1 mM EDTA and 0.25% w/v SDS) with IFN-γ for 24 h, after which supernatants etached by using 0.05% trypsin/EDTA solution g for 10 min. Human astrocytes were -γ, after which supernatants were removed and cells /EDTA solution, collected into 1.5 ml microtubes and .  2IIA ELISA. Standard concentrations for the values at 405 nm. The slope for the linear relationship is shown on the graph.  (4 M guanidine thiocyanate, 0.01 M Tris at pH 7.5  and 350 µl RNA dilution buffer (6x saline-sodium citrate . The microtubes were placed in a heating block at 38 g for , collected  -HCl at pH  39 70°C for 3 min and subsequently centrifuged for 10 min at 13,000 g. The resulting supernatant was collected into a spin column assembly (consisting of a filter nested within a 2 ml collection tube) and mixed thoroughly with 200 µl 100% molecular-grade EtOH. The spin column assembly was centrifuged for 1 min at 13,000 g, after which the collection tube was emptied and 600 µl of RNA wash solution (162.8 mM potassium acetate and 27.1 mM Tris-HCl at pH 7.5) was added to each assembly. After centrifugation for 1 min at 13,000 g, 40 µl yellow core buffer (22.5 mM Tris at pH 7.5, 1.25 M NaCl and 0.0025% w/v yellow dye), 10 µl 0.09 M MnCl2•4H2O and 10 µl DNase I enzyme were added to each assembly and left to incubate at room temperature for 15 min. 200 µl DNase stop solution was added to each assembly and centrifuged at 13,000 g for 1 min. After emptying the collection tube, filters were rinsed twice with RNA wash buffer: 600 µl with centrifugation at 13,000 g for the first rinse, and 250 µl with centrifugation at 16,000 g for the second rinse. Collection tubes beneath the filters were replaced with fresh 1.5 ml microtubes for the collection of mRNA. To collect THP-1 and U-373 MG mRNA, 100 µl nuclease-free water (NFW) was added to each filter and assemblies were centrifuged at 13,000 g for 1 min. For human astrocyte RNA, only 50 µl NFW was added before centrifugation to obtain more concentrated RNA samples. RNA concentrations in all samples were estimated using a spectrophotometer and were within the acceptable 260/280 range of 1.7 to 2.3 (see Appendix A for RNA purity values). More concentrated samples were diluted with NFW to match the lowest concentration per cell type.  The Promega Improm 2 RT kit was used to convert mRNA samples to cDNA as specified in the manufacturer’s protocol. Random hexamer (1 µl) was added to 4 µl of  40 mRNA samples and the mixture was heated to 70°C for 5 min. Samples were placed on ice for 5 min, after which 15 µl of a solution containing RT, 6 mM MgCl2, deoxynucleotide triphosphates, reaction buffer (250 mM Tris-HCl (pH 8.3 at 25°C), 250 mM KCl, 50 mM MgCl2, 2.5 mM spermidine and 50 mM dithiothreitol) and NFW was added. Samples were incubated at room temperature for 5 min, then at 40°C for 1 h. The RT reaction was stopped by heating each sample at 70°C for 15 min.   2.12 Polymerase Chain Reaction (PCR) PCR amplification of cDNA was performed using GoTaq Green Master Mix (400 µM each of deoxyadenosine triphosphate, deoxyguanosine triphosphate, deoxycytidine triphosphate and deoxythymidine triphosphate, as well as 3 mM MgCl2 in Green GoTaq reaction buffer at pH 8.5) from Promega. Each PCR sample was prepared by mixing 1.5 µl 10 µM forward primer, 1.5 µl 10 µM reverse primer, 4 µl cDNA, 12.5 µl GoTaq Green Master Mix, and 5.5 µl NFW, for a total sample volume of 25 µl. The thermal cycler program for amplification of THP-1 cell and human astrocyte cDNA using sPLA2IIA-specific primers consisted of an initial 95°C denaturation step for 2 min, followed by 40 cycles of 30 sec denaturation at 95°C, 30 sec annealing at 62°C and 1 min extension at 74°C for 1 min, with the final extension step lasting 5 min. For amplification of U-373 MG cell cDNA using sPLA2IIA-specific primers, only 30 cycles of 30 sec denaturation were performed; otherwise the program was the same. The thermal cycler program for the amplification of all glial cell cDNA using both housekeeping primers (see next section) was the same as for sPLA2IIA primers except it continued for 35 cycles  41 and the annealing temperature was 55°C. PCR products were separated using electrophoresis on a 6% polyacrylamide gel and visualized by staining with SYBR safe dye. Digital photographs of the gels were taken with the AlphaView imaging system and software for image analysis.   2.13 PCR Primer Design and Restriction Analyses All primers were obtained from IDT and were designed using the Primer 3 software. sPLA2IIA-specific primers (Genbank accession NM000300.3) were designed to amplify a product to span at least two introns so that any resulting genomic DNA product would be much larger than the expected cDNA-amplified products. Homologous sequences in other genes for each primer were ruled out using a nucleotide Basic Local Alignment Search Tool (BLAST, http://blast.ncbi.nlm.nih.gov/Blast.cgi). Two PCR primer pairs were used to amplify sPLA2IIA cDNA. The first pair of primers (S1) contained: forward, 5’ AGGAAAGGAAGCCGCACTCAGTTA 3’; and reverse, 5’ AGAGAGGGAAATTCAGCACTGGGT 3’. The second pair of primers (S2) contained: forward, 5’ AGGAAAGGAAGCCGCACTCAGTTA 3’; and reverse, 5’ AGGCTGGAAATCTGCTGGATGTCT 3’. These primer pairs were designed to produce 386 base pair (bp) and 514 bp fragments, respectively. To ensure the identity of the PCR products, restriction enzyme analysis was conducted on PCR products obtained by the sPLA2IIA mRNA-specific primers. The restriction enzymes BamHI and Dde1 were used because they have recognition sequences common to both S1 and S2 PCR products. S1 PCR products (386 bp) were digested by  42 BamHI into 357 and 29 bp fragments, and by Dde1 into 312 and 74 bp fragments. S2 PCR products (514 bp) were digested by BamHI into 452 and 62 bp fragments, and by Dde1 into 497 and 17 bp fragments. Digested PCR products were separated on a 6% polyacrylamide gel and visualized by staining with SYBR safe dye. All digestion products were of the expected sizes (data not shown). Cyclophilin and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) were used as housekeeping genes on each sample because both cyclophilin and G3PDH are expressed in nearly all cells due to their roles in basic cellular metabolism (Zhong and Simons, 1999). Primers for the cyclophilin gene were designed to produce a 206 bp product and contained: forward, 5’ ATGGTCAACCCCACCGTGTTCTTCG 3’; and reverse, 5’ CGTGTGAAGTCACCACCCTGACACA 3’. Primers for the G3PDH gene were designed to produce a 215 bp product and contained: forward, 5’ CCATGTTCGTCATGGGTGTGAACCA 3’; and reverse, 5’ GCCAGTAGAGGCAGGGATGATGTTC 3’. Both housekeeping primer pairs were previously used by Klegeris and McGeer (2000). All primer pairs, including S1 and S2, were optimized for annealing temperature using a gradient between 50 and 65°C (data not shown).        43 2.14 Neurotoxicity of Exogenous sPLA2 2.14.1 Bee Venom sPLA2 type III (sPLA2III) To verify the effect of exogenous sPLA2 isozymes on SH-SY5Y neuroblastoma cells, bee venom-derived sPLA2III was used in similar concentrations at which human sPLA2IIA was reported to be neurotoxic (Yagami et al. 2002). Lyophilized sPLA2III (molecular weight = 14 kDa) was reconstituted in sterile deionized water to a stock concentration of 100 µM. The sPLA2III stock was serially diluted with deionized water before adding to SH-SY5Y cells to achieve the final concentrations of 1, 0.5, 0.1, 0.05, and 0.01 µM. SH-SY5Y cells were then incubated in a CO2 incubator at 37°C for 72 h before LDH and MTT assays were conducted.  2.14.2 Human rsPLA2IIA The protocol for plating SH-SY5Y cells to test the cytotoxicity of human rsPLA2IIA (molecular weight = 16 kDa) differed only in that the cells were seeded on to a sterile 96-well plate rather than a 24-well plate in order to conserve rsPLA2IIA stock. In addition, the well volumes were 0.1 ml rather than 0.4 ml. Samples of rsPLA2IIA were obtained from two independent sources. The lyophilized human rsPLA2IIA from ProSpec was reconstituted in 0.2 ml sterile PBS (pH 7.5) to a stock concentration of 3 µM. Serial dilutions of the ProSpec rsPLA2IIA stock were made in PBS before adding the protein to SH-SY5Y cells such that the final concentrations of 1, 0.5, 0.1, 0.05 and 0.01 µM were achieved. SH-SY5Y cells were then incubated in a CO2 incubator at 37°C for 72 h before LDH and MTT assays were conducted.  44 Another sample of 0.9 mg/ml (56.3 µM) rsPLA2IIA in 5 mM tris (pH 8) buffer was provided by Dr. Michael Gelb. Serial dilutions of rsPLA2IIA were made in tris (pH 8) before adding the protein to SH-SY5Y cells such that the final concentrations of 1, 0.5, 0.1, 0.05 and 0.01 µM were achieved. SH-SY5Y cells were then incubated in a CO2 incubator at 37°C for 72 h before LDH and MTT assays were conducted.  2.14.3 Bacterial Lipopolysaccharide (LPS) Because both rsPLA2IIA samples were produced in bacteria, it was necessary to exclude the possibility that chance residual bacterial lipopolysaccharide (LPS) was cytotoxic to SH-SY5Y cells. LPS was added directly to SH-SY5Y cells to achieve the final concentrations of 1, 0.5, 0.1, 0.05 and 0.01 µg/ml. SH-SY5Y cells were then incubated in a CO2 incubator at 37°C for 72 h before LDH and MTT assays were conducted.   2.15 Experiments with Enzyme Inhibitors and Receptor Antagonists 2.15.1 Specific sPLA2 Inhibitors Two specific sPLA2 inhibitors and their pharmacologically inactive derivative were kindly provided by Drs. Michael Gelb and Rob Oslund. RO032107 is a novel inhibitor highly selective for sPLA2IIA. RO041709 is a methylated control compound for RO032107, which is inactive towards sPLA2IIA. RO092906 is a novel inhibitor selective for sPLA2 type X (sPLA2X). Because of the specificity of these inhibitors towards secreted (extracellular) forms of PLA2, they were either 1) incubated with THP-1  45 supernatants from cells that had been stimulated with LPS and IFN-γ for 48 h before transfer to SH-SY5Y cells; 2) directly added to SH-SY5Y cells immediately after transfer of supernatants from cells that had been stimulated with LPS and IFN-γ for 48 h; or 3) added to SH-SY5Y cells treated with 1 µM rsPLA2IIA. SH-SY5Y cells were incubated at 37°C for 72 h in CO2 incubator before assessing cell viability with LDH and MTT assays. For each experiment, all three compounds were tested at 10, 5, 1, 0.5, and 0.1 µM, while keeping the DMSO content in each well at 0.5% v/v. In addition, a DMSO solvent control was included in each experiment  2.15.2 Non-Specific PLA2 Inhibitors and PGE2 Receptor Antagonists Four non-specific PLA2 inhibitors and two PGE2 receptor antagonists were tested for their 1) effects on THP-1 cytotoxicity, and 2) neuroprotective properties. To test the effects of the compounds on THP-1 cytotoxicity, THP-1 cells were plated onto 24-well plates at a density of 0.5 million cells/ml, 0.8 ml/well. Drugs were added to THP-1 cells 15 min before stimulation with the combination of LPS (0.5 µg/ml) and IFN-γ (150 U/ml). Plates were incubated at 37°C in CO2 incubator for 48 h and then supernatants were transferred to SH-SY5Y cells. After 72 h incubation at 37°C in CO2 incubator SH- SY5Y cell viability was assessed by using the LDH and MTT assays. To determine whether drugs had neuroprotective properties, they were added to SH-SY5Y cells immediately after the transfer of supernatants from stimulated THP-1 cells. The SH-SY5Y cells were then incubated at 37°C for 72 h in CO2 incubator before assessing cell viability by using the LDH and MTT assays.  46 All six compounds were dissolved in DMSO. The DMSO content in each well was kept at 0.5% v/v, and a DMSO solvent control was included in each experiment. Drug targets and concentrations used in experiments are listed in Table 2.1.    Table 2.1: Non-Specific PLA2 Inhibitor and PGE2 Receptor Antagonist Targets and their Concentrations Used in Experiments.   2.16 Measurement of PLA2 Enzymatic Activity This assay was used to determine sPLA2IIA enzymatic activity in cell-free supernatants from stimulated and unstimulated THP-1 cells, U-373 MG cells and human astrocytes. The rate at which sPLA2 enzymatically altered the substrate PGPM was measured. PGPM is a glycerophospholipid that has 1-pyrenedecanoic acid bound to the PLA2 target sn-2 position of the glycerol (Pernas et al. 1991). While bound, the fluorescence of 1-pyrenedecanoic acid is quenched. In the presence of enzymatically active PLA2, the 1-pyrenedecanoic acid is released; therefore, stronger fluorescent signals  47 are indicative of higher levels of PLA2 enzymatic activity (Pernas et al. 1991). Substrate buffer used to dilute PGPM consisted of 50 mM tris base, 500 mM NaCl, and 20 mM CaCl2, pH 8.5. Samples of rsPLA2IIA at 0.1 µM was used as positive controls. Since PGPM acts as a substrate for several sPLA2 isoforms, the sPLA2IIA-selective inhibitor RO032107 and the sPLA2X-selective inhibitor RO092906 were used at 10 µM to differentiate sPLA2IIA- and sPLA2X-specific activity. 50 µl samples of supernatants from stimulated and unstimulated THP-1 cells, U- 373 MG cells and human astrocytes were transferred to a black, top-read 96-well plate. The 1-pyrenedecanoic acid standard was diluted in F10 to achieve 10, 5, 2.5, and 1.25 µM concentrations after the addition of 50 µl substrate buffer to 50 µl of standard. To initiate the assay, 50 µl of substrate buffer was added to each supernatant sample, and fluorescence was read in a microplate reader for 5 min. A substrate blank, which consisted of 50 µl of F10 and 50 µl of substrate, was included with each plate. The microplate reader was programmed to measure fluorescence at 320 nm excitation and 405 nm emission every 30 sec for 5 min, orbitally shaking the plate for 3 sec before each measurement. The rate of sPLA2 enzyme activity for each supernatant sample (n) was determined using the following equations: (9) [Faven – Faveblank] = dFn (10) dFn x conversion factor = sPLA2 enzyme activity (pmol/min), where Faven represents the average fluorescence of sample n, Faveblank represents average fluorescence of the blank, and dFn represents the difference between Faven and Faveblank in relative fluorescence units (RFU)/min. The conversion factor (pmol/RFU) represents 1/slope, where the slope was determined by plotting absorbance versus concentration for  48 the 1-pyrenedecanoic acid standards. To determine sPLA2IIA-specific activity, the calculated sPLA2 enzyme activity for samples treated with RO032107 was subtracted from the values obtained from samples treated with DMSO. Similarly, sPLA2X-specific activity was calculated by subtracting sPLA2 activity for samples treated with RO092906 from values obtained from samples treated with DMSO.  sPLA2IIA-specific inhibitor RO032107, sPLA2X-specific RO092906 and control compound RO041709 were also tested for their effects on rsPLA2IIA activity. 1 µM of either compound or the corresponding volume of DMSO solvent was added to 50 µl of 0.1 µM rsPLA2IIA in F5 in a 96-well black plate. The plate was incubated at room temperature for 10 min before adding the substrate and reading the fluorescence over a 5 min period at the emission and excitation settings described above.   2.17 Potential Mechanisms of sPLA2IIA Neurotoxicity 2.17.1 Effects of sPLA2IIA on SH-SY5Y Cells Pre-Treated with H2O2  It is possible that sPLA2IIA becomes more toxic to cells with disrupted membranes; therefore, H2O2 was used to pre-damage SH-SY5Y cells before the addition of rsPLA2IIA. The experiment followed the protocol for testing 1 µM rsPLA2IIA toxicity on SH-SY5Y cells except that, 5 min prior to sPLA2IIA addition, 250 µM H2O2 was added to the well. SH-SY5Y cells were incubated at 37°C for 72 h in CO2 incubator before their viability was assessed by using the LDH and MTT assays.    49 2.17.2 sPLA2IIA Regulation via PPARα Certain cPLA2 products may stimulate PPARα and contribute to sPLA2IIA up- regulation in glial cells. MK886 was used to test whether antagonizing PPARα would affect THP-1 cytotoxicity. MK886 was dissolved in DMSO. THP-1 cells were seeded onto a 24-well plate at 0.5 million cells/ml in 0.8 ml/well. Cells were incubated at 37°C in CO2 incubator for 15 min, after which MK886 was added to achieve the final concentrations of 10, 5, 1, 0.5 and 0.1 µM, keeping the DMSO concentration at 0.5% v/v in each well. From this point the experiment was carried on exactly as described for testing the non-specific PLA2 inhibitors on THP-1 cytotoxicity (section 2.15.2).  2.17.3 Non-Enzymatic Complex between sPLA2IIA and Neuronal TLR4 To test the hypothesis that glial cell-derived sPLA2IIA cytotoxicity is caused by binding to neuronal TLR4, the anti-TLR4/MD-2 monoclonal antibody (mAb) was used to interfere with the hypothetical sPLA2IIA-TLR4 complex. Anti-TLR4/MD-2 mAb at 2, 1, 0.2, 0.1 or 0.02 ng/ml in sterile PBS (pH 7.5) was either 1) incubated with supernatants from THP-1 cells that had been stimulated for 48 h with LPS and IFN-γ- before transfer to SH-SY5Y cells, or 2) directly added to SH-SY5Y cells immediately after transfer of supernatants from THP-1 cells that had been stimulated for 48 h with LPS and IFN-γ. SH-SY5Y cells were then incubated at 37°C for 72 h in CO2 incubator before their viability was assessed by using LDH and MTT assays.     50 2.18 Statistical Analysis SPSS software (version 16.0; IBM SPSS, Chicago, IL, USA) was used to conduct statistical analyses of the data. Experiments were designed to allow pairwise comparisons or use of randomized block design analysis of variance (ANOVA) for statistical analysis, which lessened the impact of variability between experimental days by assigning each day as a block. Randomized block design ANOVA was performed with data obtained from the experiments involving concentration gradients, followed by the Fisher’s Least Significant Difference (LSD) post hoc test, which was used to assess all possible comparisons for significant differences. The Fisher’s LSD test is the least stringent post hoc test and was chosen in order to avoid overlooking any small (but significant) effects. Student’s T-test for paired observations was used to assess the differences between the effects of unstimulated and stimulated glial cell supernatants. Data on all figures are presented as means ± the standard error of the mean (SEM). A probability (P) value less than 0.05 was considered statistically significant, though cases that were less than 0.01 were also indicated for transparency. All cases where Fisher’s LSD test or paired Student’s t-test showed statistically significant differences are identified on the figures as either *P<0.05 or **P<0.01.  Randomized block design ANOVAs were conducted separately on LDH and MTT data sets. The dependent variable for the ANOVA was the LDH or MTT values, the independent variable was the compound concentration from 0 (solvent only value) to the highest compound concentration tested, and the random variable used to define the blocks was the day the experiment took place. Though the Fisher’s LSD test analyzed  51 each possible comparison within a data set, only comparisons made between the solvent only value and all other compound concentrations were reported on figures.  52 3 Results 3.1 Inflammatory Stimuli Evoke Neurotoxic Glial Cell Response The following experiments were conducted to test the central hypothesis that sPLA2IIA is 1) neurotoxic, and 2) produced and secreted by microglia-like cells and astrocytes upon stimulation with inflammatory factors. The toxicity of microglia and astrocytes toward neurons after stimulation with inflammatory factors has been demonstrated by several studies (Cameron and Landreth 2009; Zhang et al. 1999; Klegeris et al. 2003; Hashioka et al. 2009). A preliminary experiment was conducted to reproduce these experiments in our laboratory and confirm that monocytic THP-1 cells, U-373 MG astrocytoma cells, and primary human astrocytes become neurotoxic after 48 h of stimulation with pro-inflammatory IFN-γ alone or in combination with LPS. Cell-free supernatants from stimulated and unstimulated THP-1 cells, U-373 MG cells or human astrocytes were incubated with neuronal SH-SY5Y cells for 72 h, after which SH-SY5Y cell death and viability was determined using the LDH and MTT assays, respectively (Fig. 3.1). Student’s T-tests for paired observations were conducted to compare the effects of stimulated and unstimulated cell supernatants of each glial cell type. For all three glial cell types, stimulated supernatants showed a significantly higher toxicity towards SH-SY5Y cells, increasing cell death by at least 30% compared to the untreated control according to the LDH assay (Fig. 3.1.A). Similarly, MTT values showed that stimulated supernatants had significantly increased detrimental effects on SH-SY5Y cell viability compared to unstimulated supernatants (Fig. 3.1.B). LDH and MTT values for SH-SY5Y cells treated with unstimulated supernatants were not significantly different from values obtained from medium-treated SH-SY5Y cells.  Fig. 3.1: Supernatants from stimulated human THP toxic to human SH-SY5Y neuroblas assays were used to determine the effect of treating human SH supernatants from either unstimulated (Unstim.) or stimulated cells. THP with LPS (0.5 µg/ml) and IFN-γ stimulated with IFN-γ (150 U/ml) death after each treatment; results are The MTT assay was used to measure cell viability values obtained from medium-only treated experiments are presented as means unstimulated samples respective showing significance where *P<0.05.   -1 cells, U-373 MG cells and astrocytes were toma cells. LDH (A, white bars) and MTT (B, shaded bars -SY5Y neuroblastoma cells with -1 cell were stimulated  (150 U/ml), U-373 MG cell and human astrocytes were  only for 48 h. (A) The LDH assay was used to measure cell  expressed as a percentage of a 100% lysed cell control. (B) ; results are expressed as a percentage of the  SH-SY5Y cell control. Data from 5 independent . Pairwise comparisons were made between stimulated and of each cell type using Student’s T-test for paired observations  53 ) ,  54 3.2 Neurotoxicity of sPLA2 Isoforms It is known that bee venom is neurotoxic (Dennis 1994). An active ingredient of the bee venom, sPLA2III, is structurally similar to human sPLA2IIA. The neurotoxicity of sPLA2III was verified by using human SH-SY5Y neuroblastoma cells. Figure 3.2 illustrates that as the amount of sPLA2III added increased, the viability of SH-SY5Y cells decreased. 1 µM sPLA2III caused a significant increase in SH-SY5Y cell death (Fig. 3.2.A) and a decrease in cell viability (Fig. 3.2.B). Next we studied the effects of human rsPLA2IIA. Recombinant protein samples obtained from Prospec and the University of Washington were used. Similar to experiments with sPLA2III, the viability of SH-SY5Y cells decreased with increasing concentrations of added rsPLA2IIA. Figure 3.3.A shows significant enhancement of LDH release from SH-SY5Y cells treated with 1 µM rsPLA2IIA (Prospec) compared to the 100% lysed cell control. Figure 3.3.B shows that the addition of 1 µM rsPLA2IIA significantly decreased SH-SY5Y cell compared to the untreated SH-SY5Y cell viability. Because experiments with rsPLA2IIA were conducted in 96-well plates, the spontaneous death rate for untreated SH-SY5Y cells was higher than for untreated SH-SY5Y cells plated in 24-well plates (see untreated SH-SY5Y cell values in Fig. 3.2.A vs. Fig. 3.3.A). rsPLA2IIA from the University of Washington was tested in the same manner and also found to be significantly toxic to SH-SY5Y cells at 1 µM (data not shown).  Figure 3.2: Bee venom sPLA2III was toxic toward human SH µM. LDH (A) and MTT (B) assays were were treated with either medium only or with various concentrations of sPLA for each treatment is expressed as a percentage of a 100% lysed cell control. (B) Cell viability is expressed as a percentage of the values obtained from medium only from 3-5 independent experiments are presented randomized block design ANOVA, followed by the test, where *P<0.05 if significantly different from the         -SY5Y neuroblastoma cells used to measure the survival of SH-SY5Y cells, which 2III. (A) Cell death -treated SH-SY5Y cells. Data  as means. All values were compared using Fisher’s Least Significant Difference (LSD) medium only treated control. 55  at 1  Figure 3.3: Human rsPLA2IIA was toxic toward SH and MTT (B) assays were used to determine the effect of various concentrations of rsPLA for each treatment is expressed as a percentage of a 100% lysed cell control. (B) Cell viability is expressed as a percentage of the values obtained from medium only from 6 independent experiments are presented randomized block design ANOVA, followed by the significantly different from the performed in 96-well plates in order to conserve rsPLA spontaneous cell death rate was observed      -SY5Y cells at 1 µM concentration. LDH (A)  treating SH-SY5Y cells directly with 2IIA compared to a medium only-treated control. (A) Cell death -treated SH-SY5Y cells. Data  as means. All values were compared using Fisher’s LSD test, where *P<0.05 if medium only treated control. Note that these experiments w 2IIA stock; therefore, a higher for medium only treated SH-SY5Y cells. 56 ere  57 Since both rsPLA2IIA samples (from Prospec and University of Washington) were produced in bacteria, there was a possibility that the neurotoxicity observed was due to bacterial LPS contamination in the samples; therefore, the direct effect of LPS on SH- SY5Y cell viability was tested. Also, the cytotoxicity of human IFN-γ was tested to rule out the possibility that the cytotoxic effects of THP-1, U-373 MG, and human astrocyte supernatants were due to transfer of residual IFN-γ with supernatants from stimulated cell samples. Effects of LPS and IFN-γ on SH-SY5Y cell viability are shown in Figure 3.4. After 72 h incubation, only SH-SY5Y cells treated with the LPS concentration (1 µg/ml) that is two fold higher than used to stimulate THP-1 cells showed significantly elevated LDH values as compared with the untreated control (Fig. 3.4.A); the MTT assay failed to detect significant toxic effects of LPS (Fig. 3.4.B). Human IFN-γ did not significantly affect SH-SY5Y viability according to both assays. Since the effects of both sPLA2 types were observed at 1 µM, LPS would only be responsible for the observed effects if the sPLA2 samples have LPS contamination levels above 10 µg/ml, which is very unlikely.   Figure 3.4: Neither bacterial LPS nor human IFN SH-SY5Y cells at concentrations used for stimulation of human cell lines and astrocytes. LDH (A) and MTT (B) assays were used to determine the effect of treating SH with LPS (0.5 µg/ml) or IFN-γ (150 U/ml). (A) Cell death for each treatment is expressed as a percentage of a 100% lysed cell control. (B) Cell viability is expressed as a percentage values obtained for the medium only experiments are presented as means ANOVA, followed by the Fisher’s LSD test medium only treated control. Note that the 1 elevated LDH levels is higher than the concentration used to stimulate THP    -γ exhibited significant cytotoxic effects toward -SY5Y cells directly -treated SH-SY5Y cells. Data from 6 independent . All values were compared using randomized block design , where *P<0.05 if significantly different from the µg/ml concentration of LPS that significantly -1 cells. 58  of the    59 3.3 sPLA2IIA mRNA Expression by Human Cell Lines and Astrocytes Prior to mRNA extraction, THP-1 cells were stimulated with LPS (0.5 µg/ml) and IFN-γ (150 U/ml) for either 4, 24, or 48 h. U-373 MG cells were stimulated with IFN-γ (150 U/ml) for 24 h before mRNA collection, a time based on preliminary experiments that determined 24 h as an optimum stimulation period for sPLA2IIA mRNA expression in astrocytes. Human astrocytes were also stimulated with IFN-γ; however, due to the limited number of human astrocytes available, mRNA was extracted from the cultures used for supernatant collection, which were stimulated for 48 h. Unstimulated cells of all three cell types were incubated in tissue culture medium only for 48 h before RNA extraction. Figure 3.5 shows that mRNA for both cyclophilin and G3PDH housekeeping genes were found in all samples studied. Increased expression of sPLA2IIA mRNA- specific products was found in stimulated cell samples compared to unstimulated cell samples. For human astrocytes, only stimulated cells expressed sPLA2IIA mRNA- specific products.    Figure 3.5: Stimulated cells expressed increased cells. Total RNA samples extracted from stimulated and unstimulated THP cells and human astrocytes were G3PDH (C) mRNA-specific primers. The PCR produ and visualized using SYBR safe dye. The mRNA expression patterns shown are representative of THP-1 and U-373 MG cell samples collected from 3 independent astrocytes prepared from 3 different and 100 bp) are shown in the left two lanes of the gel.  sPLA2IIA mRNA compared to unstimulated -1 cells, U  amplified via RT-PCR using sPLA2IIA (A), cyclophilin (B) and cts were separated on polyacrylamide gels experiments, and surgical cases. Two different molecular weight ladders (1 kb  60  -373 MG human  3.4 Concentrations of sPLA Supernatants from stimulated and unstimulated THP human astrocytes were collected and a sPLA2IIA-specific ELISA. Figure 3.6 shows that, in all three sPLA2IIA concentrations were significantly higher in stimulated samples versus unstimulated samples. The detection li Figure 3.6: sPLA2IIA protein concentrations were significantly higher in stimulated compared to unstimulated human cell lines and astrocytes. Unstimulated cell supernatants (Unstim.) and 48 h stimulated cell supernatants (LPS+IFN respective to cell type), were collected from THP astrocytes and were analyzed for sPLA sPLA2IIA concentrations were determined using a calibration curve (see Methods). independent experiments are presented. unstimulated samples respective of each cell type using Student’s showing significance where *P<0.05   2IIA in Glial Cell Supernatants -1 cells, U-373 MG cells and analyzed for sPLA2IIA protein concentration using glial cell supernatants mit for the ELISA was 1.5 pM.  supernatants from -γ or IFN-γ alone -1 cells, U-373 MG cells and primary human 2IIA concentrations using a sPLA2IIA-specific ELISA. All  Pairwise comparisons were made between stimulated and T-test for paired observations  and **P<0.01. 61 , Data from 3-6 ,  3.5 PLA2 Enzymatic Activity in Cell Supernatants Cell supernatants were collected U-373 MG cells and human astrocytes using a fluorometric enzyme assay. No significant differences were found between PLA enzymatic activities in stimulated compar cell type (Fig. 3.7). Figure 3.7: PLA2 enzymatic activity measured in stimulated THP human astrocyte supernatants was not significantly different from respective unstimulated ce supernatants. Unstimulated (Unstim.) and 48 h stimulated cell supernatants (LPS+IFN alone respective to cell type) were collected from THP human astrocytes, and were analyzed from 3-5 independent experiments are presented between stimulated and unstimulated samples respective of each cell type using Student’s T for paired observations. No statistical sign  Before using the sPLA inhibitor RO092906 and control compound RO0 were first tested for inhibitory effects on 0.1  from unstimulated and stimulated THP  and analyzed for total PLA2 enzymatic activity ed unstimulated cell supernatants, regardless of  -1 cell, U-373 MG cell, and -1 cells, U-373 MG cells and primary  using a fluorometric sPLA2 enzyme activity assay. Data  as means. Pairwise comparisons were made ificance was found. 2IIA-specific inhibitor RO032107, sPLA2X-specific 41709 in the cell culture models µM rsPLA2IIA enzymatic activity (Fig. 3.8). 62 -1 cells, 2 ll -γ or IFN-γ -test , they  1 µM of compound or DMSO before adding the 1-pyrenedecanoic acid substrate. After 10 min that the sPLA2IIA-specific inhibitor enzymatic activity compared to the DMSO solvent control. As expected, the sPLA specific inhibitor RO092906 and control compound RO041709 did not inhibit rsPLA enzymatic activity.  Figure 3.8: The sPLA2IIA-specific activity. 1 µM of RO032107, sPLA RO041709 were incubated with 0.1 fluorometric PLA2 enzyme activity assay. means. All values were compared using randomized block design ANOVA, followed by Fisher’ LSD test for multiple comparisons, where * DMSO control.  Figure 3.9 shows the effects of 10 inhibitor RO092906 and control compound RO041709 on total PLA stimulated THP-1 cell supernatants. Compared with the DMSO solvent control, the sPLA2IIA-specific inhibitor RO032107 solvent was incubated with 0.1 µM rsPLA2IIA for 10 min  incubation, it was shown RO032107 significantly reduced rsPLA2  inhibitor RO032107 significantly inhibited rsPLA 2X-specific inhibitor RO092906 and control compound µM rsPLA2IIA for 10 min and then analyzed using a Data from 3 independent experiments are presented P<0.05 indicates a significant difference µM RO032107 as well as the sPLA 2 activity in  was found to significantly inhibit PLA 63 IIA 2X- 2IIA 2IIA specific  as s  compared to 2X-specific 2  enzymatic activity (P=0.03). As expected, control compound RO041709 did not significantly affect PLA2 enzymatic activity when compared to the DMSO solvent control (P=0.47).  Figure 3.9: The sPLA2IIA-specific inhibitor RO032107 significantly inhibited PLA activity in stimulated THP-1 cell supernatants. THP (0.5 µg/ml) and IFN-γ (150 U/ml), after which their supernatants were col inhibitor or DMSO for 10 min, and Data from 4 independent experiments are presented randomized block design ANOVA, followed by where *P<0.05 indicates a significant difference   In order to differentiate sPLA activity, the sPLA2IIA-specific inhibitor RO032107 unstimulated cell supernatants for all three cell types (Fig. 3.10). Results from RO032107-treated supernatants were subtracted from values obtained in absence of the inhibitor in order to derive sPLA enzymatic activity values from unstim were subtracted from values obtained from DMSO supernatants.  -1 cells were stimulated for 48 h with LPS lected, incubated with analyzed using a fluorometric sPLA2 enzyme activity assay.  as means. All values were compared using Fisher’s LSD test for multiple comparisons,  compared to DMSO control. 2IIA enzymatic activity from total PLA2  was used on both stimulated and 2IIA-specific enzymatic activity; For example, ulated THP-1 supernatant treated with RO032107 -treated unstimulated THP 64 2 enzymatic  enzymatic -1  Figure 3.10: Calculated sPLA2IIA enzymatic activity was significantly higher in stimulated versus unstimulated THP astrocyte supernatants. To derive sPLA RO032107-treated stimulated or unstimulated cell supernatants were subtracted from DMSO treated stimulated or unstimulated supernatants, respectively. Data from 3 experiments are presented as means unstimulated samples respective of each cell type using Student’s T where *P<0.05 was considered significant  Figure 3.10 shows the calculated sPLA unstimulated and stimulated supernatants from THP astrocytes. sPLA2IIA enzymatic activity was significantly higher in stimulated compared to unstimulated THP-1 and U appeared to be an increase in the activity in human astrocyte supernatant compared with the respective unstimulated sample; however, in this case the increase did not reach statistical significance (P=0.80).    supernatants of -1 cell and U-373 MG supernatants, but not in human 2IIA-specific activity, PLA2 activity values (pmol/min) for -5 independent . Pairwise comparisons were made between stimulate -test for paired comparisons  compared to corresponding unstimulated cells 2IIA-specific enzymatic activities in both -1 cells, U-373 MG cells and human -373 MG cell supernatants (P=0.02 for both). There  65 - d and , .  66 3.6 Effects of Specific sPLA2 Inhibitors on Neurotoxicity of Stimulated Glial Cell Supernatants  The sPLA2IIA-specific inhibitor RO032107 and its control compound RO041709 were used to attenuate the toxic effect of rsPLA2IIA on SH-SY5Y cells. 10 µM of compound or DMSO was added 5 min after 1 µM rsPLA2IIA was applied to SH-SY5Y cells. After 72 h, the death and viability of the SH-SY5Y cells were assessed using LDH and MTT assays, respectively. According to the LDH assay (Fig. 3.11.A), cell death resulting from DMSO only treatment was not significantly different from compound- treated samples (P=0.86 according to Fisher’s LSD test for multiple comparisons); however, the MTT assay (Fig. 3.11.B) showed a visible increase in cell viability in SH- SY5Y cells treated with RO032107 compared to the DMSO control (P=0.06 according to Fisher’s LSD test for multiple comparisons). Next, the compounds RO032107, RO092906 and RO041709 were tested for their neuroprotective abilities by 1) incubating the compounds with stimulated THP-1 cell supernatants for 10 min before transfer to SH-SY5Y cells (Fig. 3.12), or 2) adding the compounds to SH-SY5Y cells immediately after the transfer of stimulated THP-1 cell supernatants (Fig. 3.13). Lower LDH values or higher MTT values compared to the DMSO solvent control would indicate reduced toxicity of supernatants. The compounds showed no effect according to the LDH assay. The MTT revealed a modest trend towards reduced viability in samples treated with the control compound (Fig. 3.12.B). Direct addition of the compounds immediately after the transfer of stimulated THP-1 supernatant to SH-SY5Y cells also did not show any significant neuroprotective effects (Fig. 3.13). These findings indicate that either sPLA2IIA induces neurotoxicity in a non-enzymatic manner or other PLA2 isoforms may be involved.  Figure 3.11: The sPLA2IIA-specific inhibitor RO032107 and control compound RO041709 failed to significantly counteract rsPLA MTT (B) assays were used to determine the effect of compound or DMSO solvent to SH measure cell death for each treatment cell control. (B) The MTT assay was used to measure cell viability percentage of the values obtained from 5 independent experiments are presented block design ANOVA, followed by indicates significant difference between the two samples   2IIA-induced cytotoxicity toward SH-SY5Y cells. adding 1 µM rsPLA2IIA and 10 -SY5Y cells for 72 h. (A) The LDH assay was used to ; the results are expressed as a percentage of a 100% lysed ; the results are expressed as a medium-only treated SH-SY5Y cell control. Data from 3  as means. All values were compared using randomized Fisher’s LSD test for multiple comparisons, *P<0.05 . 67 LDH (A) and µM -   Figure 3.12: sPLA2IIA- and sPLA cytotoxicity of supernatants from stimulated THP used to determine the effect of adding various concentrations of either sPLA inhibitor RO032107, sPLA2X-specific inhibitor RO0 the supernatants from LPS+IFN SY5Y cells. (A) The LDH assay was used to measure cell death for each treatment expressed as a percentage of a 100% lysed cell control. (B) The MTT assay was used to measure cell viability; the results are expressed as a percentage of the values obtained from treated SH-SY5Y cell control. Data from 5 independent experiments are presented values were compared using randomized block design ANOVA, followed by Fisher’ for multiple comparisons, showing significance control.  2X-specific inhibitors showed no significant effects on the -1 cells. LDH (A) and MTT (B) assays were 2IIA-specific 92906, or control compound RO041709 to -γ-stimulated THP-1 cells 10 min before their transfer to SH ; the results are medium  as means where *P<0.05 when compared to the DMSO 68 -  -only . All s LSD test  Figure 3.13: sPLA2IIA- and sPLA (A) and MTT (B) assays were used to determine the effect of adding various concentrations of either sPLA2IIA-specific inhibitor RO032107, sPLA compound RO041709 to SH-SY5Y cells immedia LPS+IFN-γ-stimulated THP-1 cells. treatment; the results are expressed as a percentage of a 100% lysed cell control. (B) The MTT assay was used to measure cell viability obtained from medium-only treated are presented as means. All values were compared using randomized block design ANOVA, followed by the Fisher’s LSD test DMSO control.   2X-specific inhibitors showed no neuroprotective effects. LDH 2X-specific inhibitor RO092906, or control tely after transferring the supernatants from (A) The LDH assay was used to measure cell death for each ; the results are expressed as a percentage of the values  SH-SY5Y cell control. Data from 5 independent experiments , showing significance where *P<0.05 when compared to the 69  70 3.7 Removal of sPLA2IIA from Cell Supernatants Immunosorbent specific for sPLA2IIA was used to remove the protein from supernatants of stimulated THP-1 cells, U-373 MG cells and human astrocytes before transferring the supernatants to SH-SY5Y cells. Figure 3.14 shows that the removal of sPLA2IIA from stimulated THP-1 supernatants resulted in significantly increased SH- SY5Y viability as compared to the effect of either untreated supernatants from stimulated THP-1 cells or supernatants treated with Con A sepharose, which was used as a non- specific control. PGE2-specific sorbent also caused significantly increased SH-SY5Y cell viability. Effects of immunosorbents observed by the LDH and MTT assays (Fig. 3.14) were confirmed by the live/dead fluorescence assay (Fig. 3.15). Experiments using sPLA2IIA-specific immunosorbents were repeated with stimulated THP-1 cell supernatants; SH-SY5Y cell viability was assessed using the live/dead fluorescence assay. Green cells represent live SH-SY5Y cells (examples indicated by the solid arrows in Fig. 3.15.A-D), while red cells represent dead cells (examples indicated by the dashed arrows in Fig. 3.15.A-D). Figure 3.15.E shows that the percentage of live SH-SY5Y cells for the sPLA2IIA immunosorbent treated samples was significantly higher than for SH- SY5Y cells treated with stimulated THP-1 cell supernatants. Similarly, Figure 3.15.F shows that the percentage of dead SH-SY5Y cells for the sPLA2IIA immunosorbent treated samples was significantly lower than values obtained from SH-SY5Y cells treated with stimulated THP-1 cell supernatants.   Figure 3.14: Immunosorbents specific for 1 cell supernatants. LDH (A) and MTT (B) assays were used to determine the effect of treating neurotoxic THP-1 cell supernatants with sPLA SH-SY5Y cells were exposed to either supernatant, or IFN-γ+LPS-stimulated THP PGE2–specific immunosorbents. treatment; the results are expressed as a percentage of a 100% lysed cell control. (B) The MTT assay was used to measure cell viability obtained from medium-only treated are presented as means. All values were compared using randomized block design ANOVA, followed by Fisher’s LSD test, *      sPLA2IIA and PGE2 inhibited the cytotoxicity of THP 2IIA-, PGE2- or Con A-specific immunosorbents  medium only (-/-), IFN-γ+LPS stimulated THP -1 cell supernatant treated with Con A-, sPLA (A) The LDH assay was used to measure cell death for each ; the results are expressed as a percentage of the values  SH-SY5Y cell control. Data from 6 independent exper P<0.05 indicates significant difference between the two samples 71 - . -1 cell 2IIA- or iments .  Figure 3.15: Live/Dead fluorescence assay images show that decreased stimulated THP-1 cell supernatant cytotoxicity toward SH were exposed to either medium only (A), untreated IFN supernatant (B), stimulated THP (D). After 72 h, SH-SY5Y cells were stained with Calcein AM and live cells (solid line arrow) from red dead cells (broken line arrow). (E) % live and (F) % dead SH-SY5Y cells are expressed as percentages of the total cell count for each treatment. Data presented in (E) and (F) are expressed as means compared using randomized block *P<0.05 indicates significant difference    sPLA2IIA immunosorbent treatment -SY5Y cells. SH -γ+LPS-stimulated THP-1 cell -1 cell supernatant treated with Con A (C) or sPLA EthD-1 to differentiate green  from 3 independent experiments. All values were  design ANOVA, followed by Fisher’s LSD test, where  between the two samples. 72 -SY5Y cells 2IIA sorbent  73 Immunosorbent experiments were also repeated using supernatants from U-373 MG cells and human astrocytes that had been stimulated with IFN-γ (150 U/ml) for 48 h. Figure 3.16 shows the effect of sPLA2IIA sorbent on the cytotoxicity of stimulated U-373 MG cell and human astrocyte supernatants. In both cases, the removal of sPLA2IIA with a selective immunosorbent increased the viability of SH-SY5Y cells compared to untreated supernatants or Con A-treated supernatants.   3.8 Effects of Non-Specific PLA2 Inhibitors and PGE2 Receptor Antagonists on THP-1 Cytotoxicity Toward SH-SY5Y Cells  Since the sPLA2IIA- and sPLA2X-specific inhibitors showed no significant effects on the cytotoxicity of THP-1 cells (see Fig. 3.12 and 3.13), four non-specific PLA2 inhibitors were tested to determine whether stimulated THP-1 cell supernatant toxicity was due to other PLA2 isoforms. In addition, two PGE2 receptor antagonists, that together targeted all four prostaglandin receptor types (EP receptors), were studied. To test whether the compounds would affect stimulated THP-1 cytotoxicity, all six compounds were added to THP-1 cells immediately prior to stimulation with LPS and IFN-γ (Figure 3.17). A compound exhibiting anti-cytotoxic effects would reduce the cytotoxic effect of stimulated THP-1 cell supernatants on SH-SY5Y cells, as determined by the LDH and MTT assays. The PLA2 inhibitor MAFP was found to be significantly toxic to THP-1 cells at 10 µM according to the LDH assay (Fig. 3.17.A). BPPA, which is another PLA2 inhibitor, was found to be significantly toxic to THP-1 cells at 10 µM according to the MTT cell viability assay (Fig. 3.17.B); otherwise, both the non-specific  PLA2 inhibitors and PGE2 receptor antagonists THP-1 cells.  Figure 3.16: sPLA2IIA-specific immunosorbent reduced cytotoxicity of stimulated U cells and primary human astrocytes. LDH (A) and MTT (B) assays were used to determine the effect of treating neurotoxic U-373 MG and human astrocyte supernatants with sPLA specific sorbent. SH-SY5Y cells were exposed to either medium only, IFN MG cell supernatant, IFN-γ-simulated human astrocyte supernatant, or either supernatant type treated with Con A- or sPLA2IIA expressed as a percentage of a 100% lysed cell control. (B) Cell viability is expre percentage of values obtained from experiments are presented as means ANOVA, followed by Fisher’s LSD significant difference between the two samples  did not exhibit significant toxicity toward  -γ-stimulated U -specific immunosorbent. (A) Cell death for each treatment is ssed as a  untreated SH-SY5Y cell samples. Data from 4-6 independent . All values were compared using randomized block design  test for multiple comparisons, where *P<0.05 indicates a . 74 -373 MG 2IIA- -373  Figure 3.17: The PLA2 inhibitor PGE2 receptor antagonists, had significant cytotoxic effects toward THP MTT (B) assays were used to determine the effect of treating THP inhibitors MAFP, BPPA, DMDA, or OPHAO, or with L-161,982 at various concentrations. (A) percentage of a 100% lysed cell control. (B) values obtained from untreated THP presented as means. All values were comp followed by Fisher’s LSD test for multiple comparisons, where * from the DMSO solvent control. s MAFP and BPPA, but none of the other PLA2 inhibitors nor -1 cells. LDH (A) -1 cells directly with the PLA the PGE2 receptor antagonists AH6809 or THP-1 cell death for each treatment is expressed as a THP-1 cell viability is expressed as a percentage of -1 cell samples. Data from 6 independent experiments are ared using randomized block design ANOVA, P<0.05 if significantly different  75   and 2  76 Figure 3.18 shows viability of SH-SY5Y cells 72 h after the transfer of THP-1 cell supernatants. No statistically significant anti-cytotoxic effects were observed; on the contrary, the cPLA2/iPLA2 inhibitor MAFP and the non-specific sPLA2 inhibitor BPPA were found to enhance THP-1 cell cytotoxicity toward SH-SY5Y cells. The non-specific PLA2 inhibitors and PGE2 receptor antagonists were also tested for direct neuroprotective properties. Each compound was added to supernatants from THP-1 cells that had been stimulated for 48 h with LPS and IFN-γ prior to their transfer to SH-SY5Y cells. Lower LDH values or higher MTT values as compared to the DMSO solvent control in Figure 3.19 would be considered to be neuroprotective effects. No statistically significant neuroprotective effects were observed; furthermore, the PLA2 inhibitor OPHAO caused a significant, concentration-dependent decrease in SH-SY5Y cell viability. The inability of non-specific PLA2 inhibitors and PGE2 receptor antagonists to attenuate stimulated THP-1 cell toxicity indicates that the enzymatic function of sPLA2IIA and other PLA2 isoforms may not be important for their contribution to the toxicity of glial cell supernatants.   Figure 3.18: The PLA2 inhibitor cytotoxicity toward SH-SY5Y cells. LDH (A) and MTT (B) assays effect of stimulated THP-1 supernatants OPHAO, or PGE2 receptor antagonists AH6809 death for each treatment is expressed as a percent viability is expressed as a percentage of Data from 6 independent experiments are presented randomized block design ANOVA, followed by where *P<0.05 if significantly different from the DMSO solvent control. s MAFP and BPPA increased stimulated THP-1 cell supernatant  were used to determine the treated with PLA2 inhibitors MAFP, BPPA, DMDA,  or L-161,982, on SH-SY5Y viability. (A) Cell age of a 100% lysed cell control. (B) Cell values obtained from untreated SH-SY5Y cell  as means. All values were compared using Fisher’s LSD test for multiple comparisons,  77  or  cultures.  Figure 3.19: Non-specific PLA2 neuroprotective effects. LDH (A) and MTT (B) assays were used to measure SH and viability after 72 h incubation with THP sPLA2 inhibitors (MAFP, BPPA, DMDA or OPHAO) or with PGE (AH6809 or L-161,982). (A) Cell death for each treatment of a 100% lysed cell control. (B) Cell viability is expressed as a percentage of from untreated SH-SY5Y cell sample means. All values were compared using randomized block design ANOVA, followed by the Fisher’s LSD test, where **P<0.   inhibitors and PGE2 receptor antagonists showed no direct -SY5Y cell death -1 cell supernatants treated with either non 2 receptor antagonist condition is expressed as a percentage values obtained s. Data from 6 independent experiments are presented 01 if significantly different from the DMSO solvent control. 78  -specific s  as   79 3.9 Possible Mechanisms of sPLA2IIA Toxicity 3.9.1 Effect of rsPLA2IIA on H2O2-Induced Neurotoxicity  It has been shown that human sPLA2IIA does not bind well to mammalian cell membranes (Lambeau and Gelb 2008); however, damage to cell membranes could potentially alter cell membrane composition, exposing glycerophospholipids with higher affinity to sPLA2IIA interfacial binding sites. The effects of rsPLA2IIA added to SH- SY5Y cells 5 min after the addition of 250 µM H2O2 on SH-SY5Y cell viability was compared with the addition of either 1 µM rsPLA2IIA alone or 250 µM H2O2 alone (Fig. 3.20). The LDH assay failed to detect any significant differences between any of the treatments (Fig. 3.20.A); however, the combined rsPLA2IIA and H2O2 treatment resulted in a significant decrease in SH-SY5Y viability compared to both untreated SH-SY5Y cells and rsPLA2IIA-only treated cells according to the MTT assay (Fig. 3.20.B). In order to determine whether rsPLA2IIA toxicity was enhanced by the effect of H2O2 on SH-SY5Y cells, the following calculations were performed. Average % viability from H2O2-alone treatment was subtracted from the average % viability from rsPLA2IIA and H2O2 treatment to determine the % viability lost due to rsPLA2IIA in the presence of H2O2. This difference was then compared to the difference obtained when the average % viability from rsPLA2IIA-only treatment was subtracted from medium-only treatment to determine the % viability lost due to rsPLA2IIA alone. According to paired Student’s T- test, the % viability lost due to rsPLA2IIA in the presence of H2O2 was not significantly different from the % viability lost due to rsPLA2IIA alone (data not shown); therefore, the addition of H2O2 and rsPLA2IIA resulted in additive, but not synergistic, toxicity toward SH-SY5Y cells.  Figure 3.20: Decrease in SH-SY5Y cell viability due to H significantly different from H2O only, 1 µM rsPLA2IIA, 250 µM H for each treatment is expressed as a percentage of a 100% lysed cell control. (B) Cell viability is expressed as a percentage of values obtained from independent experiments are presented block design ANOVA, followed by Fisher’s difference between the two samples        2O2 plus rsPLA2IIA treatment was not 2 only cytotoxicity. SH-SY5Y cell treatments included medium 2O2, and 250 µM H2O2 plus 1 µM rsPLA2IIA. (A) Cell death untreated THP-1 cell samples. Data f  as means. All values were compared using randomized LSD test, where *P<0.05 indicates significant . 80 rom 5  81 3.9.2 Experiments with the PPARα Antagonist MK886  Previous studies have shown that stimulation of mononuclear phagocytes with inflammatory mediators increases the production of sPLA2IIA, which was suggested to occur via the activation of PPARα (Beck et al. 2003). The PPARα antagonist MK886 was therefore tested to determine whether antagonizing PPARα would decrease the cytotoxic effects of stimulated THP-1 cell supernatants. THP-1 cells were treated with various concentrations of MK886 before stimulation with LPS (0.5 µg/ml) and IFN-γ (150 U/ml). The LDH assay showed significant decreases in LDH activity at 5 and 10 µM MK886 (Fig. 3.21.A); however, according to the MTT assay, MK886 reduced cell viability by approximately 30% as compared to the DMSO solvent control (Fig. 3.21.B). The transfer of MK886-treated THP-1 supernatants to SH-SY5Y cells also resulted in a concentration-dependent decrease in both LDH (Fig. 3.21.A) and MTT (Fig. 3.21.B) values. MK886 caused severe loss of THP-1 cells at higher concentrations, which could be seen clearly upon microscopic examination. Since the LDH values in both Fig 3.21.A and 3.22.A were unexpectedly low, the MTT data in both figures appeared to be more reliable. The reduction of LDH activity measured at high MK886 concentrations could be due to denaturation of LDH or inhibition of its activity at low pH. No significant anti-cytotoxic effects of MK886 were observed, which suggests that sPLA2IIA production may be induced by mechanisms other than PPARα activation.  Figure 3.21: MK886 is toxic to THP (B) assays were used to determine the effect of treating THP receptor antagonist MK886 at various concentrations in the presence of the combination of LP and IFN-γ. (A) Cell death for each treatment is expressed as a percentage of a 100% lysed cell control. (B) Cell viability is expressed as a percentage of cell samples. Data from 5 independent experiments are presente compared using randomized block design ANOVA, followed by the multiple comparisons, where *P solvent control.  -1 cells at concentrations above 1 µM. LDH (A) and MTT -1 cells directly with the PPAR values obtained from untreated THP d as means. All values were Fisher’s LSD test for <0.05and **P<0.01 if significantly different from the DMSO 82  α S -1  Figure 3.22: Supernatants from SH-SY5Y cells at high concentrations effect of MK886 on stimulated THP each treatment is expressed as a percentage of a 100% lysed cell control. (B) Cell viability is expressed as a percentage of values obtained from independent experiments are presented block design ANOVA, followed by and **p<0.01 if significantly different from the DMSO solvent control.       MK886-treated stimulated THP-1 cells were cytotoxic . LDH (A) and MTT (B) assays were used to determine the -1 cell cytotoxicity toward SH-SY5Y cells. (A) Cell death for untreated THP-1 cell samples. Data from 5  as means. All values were compared using randomized Fisher’s LSD test for multiple comparisons, where *  83  toward P<0.05  84 3.9.3 Effects of the anti-TLR4/MD-2 Antibodies on sPLA2IIA Toxicity Toward SH- SY5Y Cells  A non-enzymatic mechanism of sPLA2IIA could involve TLR4 on neuronal plasma membrane, as TLR4 was found to interact with Aβ aggregates and cause neuronal apoptosis (Tang et al. 2008). To interfere with this complex, an anti-TLR4/MD-2 mAb was used. This mAb was either incubated with stimulated THP-1 supernatants before transfer to SH-SY5Y cells or directly applied to SH-SY5Y cells immediately after the transfer of stimulated THP-1 cell supernatants. After 72 h, the viability of SH-SY5Y cells was assessed by the LDH (Fig. 3.23.A) and MTT (Fig. 3.23.B) assays. Neither of the two methods of anti-TLR4/MD-2 mAb application resulted in significant neuroprotection, which indicates that sPLA2IIA may be acting through other cell membrane receptors.     Figure 3.23: Anti-TLR4/MD-2 mAb does not protect SH supernatant toxicity. LDH (A) and MTT (B) assays were used to determine the effect of TLR4/MD-2 mAb on THP-1 cytotoxicity toward SH TLR4/MD-2 mAb was either incubated with stimulated THP before transfer to SH-SY5Y cells or added treatment is expressed as a percentage of a 100% lysed cell control. as a percentage of values obtained from experiments are presented as means ANOVA, followed by the Fisher’s LSD were observed.    -SY5Y cells from stimulated THP -SY5Y cells using two methods. Th -1 cell supernatants for 10 min immediately after transfer. (A) Cell death for each (B) Cell viability is expressed untreated THP-1 cell samples. Data from 5 independent . All values were compared using randomized block design  test for multiple comparisons, no significant differen 85  -1 anti- e anti- ces  86 4 Discussion 4.1 Neurotoxins Secreted by Stimulated Glial Cells 4.1.1 Stimulated Glial Cells Secrete Neurotoxic sPLA2IIA There are three main reasons why sPLA2IIA was investigated in the context of neuroinflammation: 1) sPLA2IIA has been implicated in chronic inflammation inherent to rheumatoid arthritis (Bidgood et al. 2000; Bryant et al. 2010; Jamal et al. 1998; Masuda et al. 2005) and atherosclerosis (Divchev and Schieffer 2008; Ghesquiere et al. 2005; Lambeau and Gelb 2008); 2) increased sPLA2IIA mRNA concentrations have been observed in AD brains compared with non-dementia brains (Moses et al. 2006); and 3) exogenous sPLA2IIA added to rat cortical neurons resulted in neuronal apoptosis (Chiricozzi et al. 2010; Yagami et al. 2002). The results of this study support the central hypothesis that sPLA2IIA is a neurotoxin secreted by stimulated glial cells. First, it was shown that stimulating microglia-like THP-1 cells with bacterial LPS and IFN-γ for 48 h resulted in secretions that were significantly toxic to neuron-like SH-SY5Y cells (Fig. 3.1), which was consistent with previously published studies (Hashioka et al. 2009; Klegeris and McGeer 2000). Second, using RT-PCR, it was found that sPLA2IIA mRNA was expressed in stimulated but not unstimulated glial cells (Fig. 3.5), which has only been previously observed in the acute inflammation accompanying cerebral ischemia (Lin et al. 2004). These findings indicate that sPLA2IIA mRNA is expressed in glial cells upon stimulation with pro-inflammatory factors. An ELISA specific for sPLA2IIA was used to confirm that there was a significantly higher sPLA2IIA protein concentration in stimulated compared to unstimulated glial cell supernatants (Fig. 3.6). These results suggest that  87 glial cells increase secretion of sPLA2IIA upon stimulation with pro-inflammatory factors. Finally, we showed that at 1 µM, bee venom sPLA2III and human rsPLA2IIA induced significant neuronal death when added directly to human neuron-like SH-SY5Y cells (Fig. 3.2 for bee venom sPLA2III and 3.3 for human rsPLA2IIA), which validates findings from previous studies on sPLA2IIA neurotoxicity (Mathisen et al. 2007; Yagami et al. 2002). Combined, these results indicate that, upon stimulation with pro- inflammatory factors, glial cells secrete neurotoxic sPLA2IIA.  4.1.2 Comparison of sPLA2IIA Protein Concentrations in Cell Culture Supernatants with Exogenous sPLA2IIA Concentrations Required to Induce Neurotoxicity   Comparing Figures 3.3 and 3.6 reveals that there is a 500,000 times difference between the neurotoxic concentration of human rsPLA2IIA (1 µM, Fig. 3.3) and the sPLA2IIA protein concentration found in stimulated THP-1 cell supernatants (2 pM, Fig. 3.6). A possible explanation for this is that stimulated THP-1 cell supernatants contain a mixture of pro-inflammatory and cytotoxic mediators (Klegeris and McGeer 2000; Klegeris and McGeer 2003). Therefore, it is possible that the neurotoxicity of sPLA2IIA is enhanced by the presence of these other mediators, which are not present when assessing the neurotoxicity of rsPLA2IIA alone.   4.2 Inhibition of sPLA2IIA Enzymatic Activity  It is still uncertain as to whether the secretion of sPLA2IIA contributes to, or is a result of, neuroinflammation. This thesis included several experiments that were designed  88 to investigate the mechanism of sPLA2IIA neurotoxicity. Recent studies on sPLA2IIA suggest that, because of the net cationic charge of sPLA2IIA, the actions of this protein are independent of its enzymatic activity; however, the effects of sPLA2IIA-specific inhibitors have not been assessed in a neuroinflammatory model. It was therefore necessary to measure the effects of sPLA2IIA-specific inhibition on stimulated glial cell models in order to determine whether sPLA2IIA enzymatic activity significantly contributes to glial cell-mediated neurotoxicity.  4.2.1 sPLA2IIA Enzymatic Activity is Significantly Higher in Stimulated than Unstimulated THP-1 and U-373 MG Cell Supernatants  Before specific inhibitors were tested on PLA2 activity in stimulated THP-1 cell supernatants, the total PLA2 and sPLA2IIA-specific enzymatic activities were determined using a fluorescent enzymatic assay previously described by Radvanyi et al. (1989) and later modified by Pernas et al. (1991). Comparing total PLA2 activities between stimulated and unstimulated supernatants of THP-1 cells, U-373 MG cells and astrocytes revealed no significant differences (Fig. 3.7), which indicates that not all extracellular PLA2 groups are significantly affected by glial cell stimulation. The sPLA2IIA-specific inhibitor RO032107, sPLA2X-specific inhibitor RO092906 and control compound RO041709 were used to determine whether sPLA2IIA is enzymatically active in stimulated glial cell supernatants. The 50% maximal inhibitory concentrations (IC50) for RO032107, RO092906 and RO042107 toward 0.5 nM rsPLA2IIA-specific enzymatic activity have been estimated at 34 nM, >1600 nM and >900 nM, respectively (Oslund et al. 2008; Smart et al. 2004). Therefore, 1 µM of each compound was incubated with 0.1 µM rsPLA2IIA for 10 min before measuring their  89 effects on sPLA2IIA enzymatic activity using a fluorescent assay (Fig. 3.8). As expected, only the sPLA2IIA-specific inhibitor RO032107 significantly inhibited rsPLA2IIA activity compared to the DMSO control. This indicated that 1 µM RO032107 was sufficient to inhibit 0.1 µM rsPLA2IIA enzymatic activity. Next, 10 µM of each of the compounds were incubated with 50 µL of stimulated THP-1 cell supernatants for 10 min before measuring their effects on sPLA2IIA enzyme activity (Fig. 3.9). A concentration ten times higher was chosen due to the presence of high concentration of protein in tissue culture media that may cause non-specific binding and loss of activity of the inhibitors. Again, only the sPLA2IIA-specific inhibitor RO032107 significantly inhibited sPLA2IIA enzymatic activity. Using RO032107 allowed for the distinction between sPLA2IIA-specific enzymatic activity from total PLA2 enzymatic activity in both stimulated and unstimulated glial cell supernatants. Though the total PLA2 enzymatic activity was not significantly different in stimulated compared to unstimulated glial cell supernatants (Fig. 3.7), the observed sPLA2IIA-specific activity was significantly higher in stimulated compared to unstimulated cell supernatants from both THP-1 and U-373 MG cells (Fig. 3.10). Stimulated astrocyte supernatant revealed higher sPLA2IIA enzymatic activity compared to the unstimulated astrocyte supernatant, but the difference was not found to be statistically significant. These results indicate that there is sPLA2IIA-specific activity in stimulated glial cell supernatants and that sPLA2IIA enzymatic activity may play a role in stimulated glial cell toxicity toward SH-SY5Y cells.    90 4.2.2 sPLA2IIA-Specific Inhibitor Failed to Protect SH-SY5Y Cells from rsPLA2IIA Toxicity or Glial Cell-Induced Neurotoxicity  The sPLA2IIA-specific inhibitor RO032107, sPLA2X-specific inhibitor RO092906 and the control compound RO041709 were then tested using cell culture models. The first experiment involved direct addition of 1 µM rsPLA2IIA to SH-SY5Y cells 5 min before adding 10 µM of RO032107, RO092906, RO041709 or DMSO solvent. The SH-SY5Y cells were then incubated for 72 h before being assessed for viability. Figure 3.11 shows that the compounds failed to inhibit rsPLA2IIA-induced toxicity toward SH-SY5Y cells. The same compounds were then used to determine whether sPLA2IIA enzymatic activity contributed to stimulated THP-1 cell cytotoxicity toward SH-SY5Y cells. Compounds were either pre-incubated with stimulated THP-1 cell supernatants before transfer to SH-SY5Y cells, or were added immediately after the transfer of supernatants. Figure 3.12 shows that there was no significant reduction in THP-1 cell toxicity with any of the specific sPLA2 inhibitors. There are several explanations for these findings: 1) sPLA2IIA neurotoxicity could be due to a non-enzymatic mechanism (this explanation is supported by the fact that removing sPLA2IIA from stimulated glial supernatant reduced their cytotoxicity); 2) other PLA2 isoforms, which are not affected by the specific inhibitors, may be contributing to neurotoxicity (this explanation was ruled out by using non-specific PLA2 inhibitors, which also did not affect the cytotoxicity of supernatants); or 3) other enzymes or toxins may be responsible for the effects observed. There is evidence that L-type voltage-gated Ca2+ channel blockers and the non- steroidal anti-inflammatory compound S-2427 were successful at attenuating sPLA2IIA- mediated neuronal apoptosis (Yagami et al. 2003, 2005). Because the sPLA2IIA-specific  91 inhibitor RO032107 did not counter rsPLA2IIA-induced neuronal death, it is possible that the Ca2+ channel blockers and S-2427 affected upstream or downstream events that countered the neurotoxic effect of sPLA2IIA, rather than inhibiting its enzymatic activity. Lambeau and Gelb (2008) described this phenomenon as “non-specific inhibition”.   4.3 Removal of sPLA2IIA and PGE2 from Stimulated Glial Cell Supernatants Significantly Decreased Neuronal Death  Several studies have suggested that sPLA2IIA mediates cPLA2/COX-2-coupled production of pro-inflammatory eicosanoids, including PGE2 (Beck et al. 2003; Bidgood et al. 2000; Bryant et al. 2010). It is therefore possible that sPLA2IIA produced by stimulated glial cells provides feedback within a pathway that activates cPLA2/COX-2 production of PGE2. Whether PGE2 is neuroprotective or neurotoxic in the context of AD is still under debate; however, the effects of PGE2 are dependent on which of the four known EP receptors (EP1-4; G-coupled protein receptors or GPCRs) it binds to (Wei et al. 2010). It has been shown that in AD, PGE2 activation of EP1, EP2 or EP4 receptors results in neuronal death, while EP3 stimulation can result in neuroprotection (Wei et al. 2010). The removal of sPLA2IIA or PGE2 from stimulated glial cell supernatants would prevent either mediator from potentially activating cell death pathways in neurons. sPLA2IIA- and PGE2-specific immunosorbents were used on stimulated glial cell supernatants to investigate the effect of removing sPLA2IIA or PGE2 from supernatants before their transfer to SH-SY5Y cells. Preliminary experiments established that the optimal incubation period of stimulated THP-1 cell supernatants with either sPLA2IIA- or PGE2-specific immunosorbents was 10 min at room temperature on a bench-top rocker.  92 The removal of sPLA2IIA or PGE2 from stimulated glial cell supernatant significantly reduced cytotoxicity of this supernatant toward SH-SY5Y cells (Fig. 3.14-16). Stimulated glial cell supernatants treated with sPLA2IIA-specific immunosorbent were also tested for sPLA2IIA content using the sPLA2IIA-specific ELISA and it was confirmed that the sorbent effectively removed sPLA2IIA from the supernatants (data not shown).   4.4 Non-Specific PLA2 Inhibitors and PGE2 Receptor Antagonists Failed to Protect SH-SY5Y Cells from Glial Cell-Induced Toxicity  Because cPLA2 and iPLA2 have shown higher affinities to mammalian cell membranes than sPLA2 isoforms, the next set of experiments used non-specific PLA2 inhibitors on stimulated THP-1 cells to determine whether the enzymatic activity of other PLA2 isoforms were responsible for the neurotoxicity of glial cell supernatants. There was a significant decrease in stimulated THP-1 supernatant cytotoxicity toward SH- SY5Y cells as a result of removing PGE2; therefore, further investigation of the effects of PGE2 receptor antagonists on stimulated THP-1 cell cytotoxicity was warranted.  Four non-specific PLA2 inhibitors (MAFP, BPPA, DMDA and OPHAO) and two PGE2 receptor antagonists (AH6809 and L-161,982) were tested in the glia-induced neurotoxicity model by adding them both at the time of stimulation and directly after transfer of neurotoxic supernatants. MAFP has shown selectivity toward cPLA2 and iPLA2 isoforms and has an IC50 of 0.5 µM  (Lio et al. 1996). The sPLA2 inhibitor BPPA, also known as S3319 from Sigma, rescued oligodendrocytes from H2O2-induced cell death at 1.25 µM (Titsworth et al. 2009). DMDA (IC50 = 16 µM) was found to be selective toward the extracellular or sPLA2 isoforms and was used in one of the first  93 studies suggesting differential roles between intracellular and extracellular PLA2 isoforms (Lister et al. 1989). OPHAO is another sPLA2 inhibitor, but its IC50 has not yet been determined (Antonopoulou et al. 2008). AH6809 is known to antagonize receptors EP1-3 (Abramovitz et al. 2000) while L-161,982 antagonizes the EP4 receptor (Cherukuri et al. 2007). When the compounds were added to THP-1 cells at the time of stimulation, MAFP (cPLA2 and iPLA2 inhibitor) and BPPA (sPLA2 inhibitor) had significant cytotoxic effects on THP-1 cells (Fig. 3.17) and enhanced stimulated THP-1 cytotoxic effects on SH-SY5Y cells (Fig. 3.18). According to the MTT cell viability assay, the sPLA2 inhibitor OPHAO showed significant neurotoxicity at higher concentrations when added to SH-SY5Y cells immediately after stimulated THP-1 cell supernatant transfer (Fig. 3.19.B), but this concentration-dependent trend was not reflected in the LDH assay results (Fig. 3.19.A). Overall, the non-specific PLA2 inhibitors did not protect SH-SY5Y cells from stimulated THP-1 cytotoxicity. Because the products of arachidonic acid formation can be either pro- or anti-inflammatory depending on the combinations of mediators, cell types and environment, it is possible that by inhibiting multiple forms of PLA2 at once the beneficial pro-resolution pathways are also inhibited. The lack of significant neuroprotective effects of PGE2 receptor antagonists suggests that PGE2 may not play a role in THP-1 cytotoxicity, which is opposite to what was predicted based on the results of using a PGE2-specific immunosorbent on stimulated THP-1 supernatants (see Fig. 3.14) as well as studies suggesting the neurotoxicity of PGE2 (Hanson et al. 2003). Since the PGE2-specific immunosorbent was able to reduce  94 the toxicity of stimulated THP-1 supernatants toward SH-SY5Y cells, it was predicted that antagonizing all known PGE2 receptors (EP1-4) would result in an overall decrease in cytotoxicity of supernatants from stimulated THP-1 cells. It can therefore be concluded that either: 1) PGE2 is not involved in stimulated THP-1 cell cytotoxicity; 2) PGE2 may be acting through mechanisms involving receptors other than EP1-4; or 3) antagonizing the EP3 receptor significantly prevented neuroprotection (Wei et al. 2010). In addition, there are other PG forms that are suspected to have pro-inflammatory and cytotoxic effects (Li et al. 2004; Yagami et al. 2002) and may have also been removed by the PGE2 immunosorbent due to cross- reactivity of antibodies. The neurotoxic effects of sPLA2IIA on rat cortical neurons were suggested to involve the conversion of arachidonic acid to delta12-PGJ2 (Li et al. 2004; Yagami et al. 2002); however, given that the sPLA2IIA-specific inhibitor RO032107 did not significantly affect stimulated THP-1 cell cytotoxicity, sPLA2IIA may not be the PLA2 species responsible for producing significant quantities of arachidonic acid leading to the formation of either PGE2 or delta 12-PGJ2. It is also unlikely that the PGE2 immunosorbent bound to delta12-PGJ2, since the specificity of the immunosorbent to other PG types was less than 0.1% according to the manufacturer, though delta 12-PGJ2 was not specifically tested (Cayman Chemical Company).      95 4.5 Non-Enzymatic Mechanisms of sPLA2IIA Neurotoxicity Since the specific inhibition of sPLA2IIA enzymatic activity and the non-specific inhibition of PLA2 enzymatic activity had no effect on THP-1 cell cytotoxicity, it is possible that sPLA2IIA may induce neurotoxicity in a non-enzymatic manner. The non- enzymatic mechanism was investigated by using an immunosorbent specific for sPLA2IIA to remove sPLA2IIA protein from stimulated THP-1 cell supernatants. The removal of sPLA2IIA significantly decreased stimulated THP-1 cell toxicity toward SH- SY5Y cells (Fig. 3.14 and 3.15). Using the sPLA2IIA-specific immunosorbent on stimulated U-373 MG cell and stimulated human astrocyte supernatants also significantly decreased their toxicity toward SH-SY5Y cells (Fig 3.16). These results, combined with the observed lack of neuroprotection provided by the sPLA2IIA-specific inhibitor RO032107, indicate that sPLA2IIA does play a role in glial cell neurotoxicity and is acting in a non-enzymatic manner. Other enzymes have also been investigated for their non-enzymatic activities. 17β-hydroxysteroid dehydrogenase, which is another protein implicated in AD, has been found to contribute to the structural integrity of mitochondria in a manner independent of its enzymatic activity (Rauschenberger et al. 2009). Acetylcholinesterase is also secreted from neurons and has been suggested to induce Ca2+ entry into neurons in a non- hydrolytic manner, which may be remnant of a trophic-toxic mechanism in developing brains (Greenfield et al. 2008). In addition, Raveh et al. (2010) suggest that GPCR kinases not only phosphorylate GPCRs, but may competitively bind with and lure G- protein subunits away from the GPCR in order to deactivate the channel.  96   There are several lines of evidence that suggest that sPLA2IIA may non- enzymatically interact with cell surface proteins. Adsorption to the cell membrane by sPLA2IIA and its binding to surface proteins has been shown to activate cell signaling pathways leading to neuronal death (Kolko et al. 2002), increase monocytic cell proliferation (Saegusa et al. 2008), and signal macrophages to ingest and dispose of abnormal debris (Boilard et al. 2003). It is also possible that once sPLA2IIA is bound to a receptor or cell membrane, the cell engulfs sPLA2IIA, which then may hydrolyze anionic glycerophospholipids of the plasma membrane.  4.5.1 H2O2-Induced Neuronal Apoptosis Does Not Enhance rsPLA2IIA Toxicity  It has been proposed that neurons undergoing apoptosis are more vulnerable to sPLA2IIA adsorption and therefore likely to experience sPLA2IIA-induced toxicity (Olson et al. 2010). During apoptosis, plasma membrane glycerophospholipids rearrange and bring anionic phosphatidylserine, which is normally located on the inner layer of the plasma membrane, to the outer membrane layer (Bezzine et al. 2002; Han et al. 2003). H2O2 has been shown to induce the liberation of arachidonic acid from murine mesangial cell membranes (Han et al. 2003) and cause apoptosis in rat cortical neurons 20 h after exposure to 25 µM H2O2 for 5 min (Hoyt et al. 1997); therefore, H2O2 was used to induce apoptosis prior to the addition of rsPLA2IIA in order to assess whether pre-damage of SH-SY5Y cell membranes would enhance sPLA2IIA neurotoxicity. 200 µM H2O2 incubated with primary astrocytes for 30 min maximally activated ERK in the MAPK cascade and arrested the cell cycle  (Tournier et al. 1997). A shorter incubation period of 5 min and 250 µM H2O2 was used to treat SH-SY5Y cells. 1 µM  97 rsPLA2IIA was then added to the SH-SY5Y cells. After 72 h, the SH-SY5Y cells were assessed for survival (Fig. 3.22). The pre-incubation of SH-SY5Y cells with H2O2 for 5 min before the addition of rsPLA2IIA did not enhance rsPLA2IIA-mediated neurotoxicity; rather, rsPLA2IIA treatment caused the same percent reduction in cell viability when used alone and in combination with H2O2. Further experiments with longer H2O2 pre-incubation times may be needed, as it is possible that 5 min incubation was not sufficient to induce the plasma membrane composition rearrangement required for increased sPLA2IIA binding. In addition, it is possible that the rearrangement of the plasma membrane composition altered biochemical conformation of unidentified sPLA2IIA receptors, which may have prevented sPLA2IIA from binding to the sites and subsequently limited the effect of sPLA2IIA non-enzymatic activity.  4.5.2 sPLA2IIA Regulation Through PPARα Cannot be Confirmed Due to Cytotoxicity of Receptor Antagonist MK886   Though non-specific PLA2 inhibitors did not effectively attenuate stimulated THP-1 cell cytotoxicity, it was still possible that cPLA2α contributed to sPLA2IIA regulation in THP-1 cells. It had been suggested that cPLA2α products activate PPARα, which then up-regulates sPLA2IIA transcription and expression (Beck et al. 2003; Han et al. 2003). A PPARα antagonist was used to determine whether the antagonism of PPARα would reduce sPLA2IIA in THP-1 cell supernatants causing subsequent reduction of stimulated THP-1 cell cytotoxicity toward SH-SY5Y cells. MK886, a PPARα antagonist, was added to THP-1 cells at the time of their stimulation. After 48 h,  98 THP-1 supernatants were transferred to SH-SY5Y cells, which were then incubated for another 72 h before being assessed for cell viability. Concentrations of MK886 used in this study were selected based on experiments described by Kehrer et al. (2001). MK886 exhibited significant toxicity toward THP-1 cells at 5 and 10 µM, which were the two highest MK886 concentrations used (Fig. 3.20.B). Transferring stimulated THP-1 cell supernatants treated with 5 or 10 µM MK886 to SH-SY5Y cell cultures resulted in increased neuronal cell death (Fig. 3.21.B). Observation of both THP-1 cells and SH-SY5Y cells under microscope showed the absence of intact cells after treatment with 5 and 10 µM MK886. The LDH assay indicated low LDH activity in supernatants of cells treated with 5 or 10 µM MK886 despite the visual confirmation of cell death (Fig. 3.21.A). This suggests that any LDH present in THP-1 cells was either inhibited or denatured by MK886 at concentrations greater than 1 µM. Because of the cytotoxicity of MK886, it is inconclusive as to whether PPARα antagonism would result in decreased THP-1 cell cytotoxicity toward SH-SY5Y cells. To find a definitive answer, another PPARα receptor antagonist must be used.  4.5.3 Neuronal TLR4 Does Not Mediate sPLA2IIA Neurotoxicity  Because several studies have demonstrated association of sPLA2IIA with the nuclear factor kappa B (NF-κB) and MAPK cell signaling pathways (Alaoui-El-Azher et al. 2002; Martin et al. 2009), it is possible that sPLA2IIA may induce neuronal apoptosis by binding to toll-like receptor 4 (TLR4), which has been shown to activate both NF-κB and MAPK pathways (Tang et al. 2008). An anti-TLR4/MD-2 mAb was either pre- incubated with stimulated THP-1 cell supernatants before transfer to SH-SY5Y cells or  99 added directly to SH-SY5Y cells immediately after transfer in order to disrupt the potential binding of sPLA2IIA to TLR4 (Fig. 3.23). The results indicate that the anti- TLR4/MD-2 mAb was unsuccessful at attenuating stimulated THP-1 cell cytotoxicity toward SH-SY5Y cells. It is possible that the anti-TLR4/MD-2 complex mAb does not bind to TLR4 alone, or that it did not block the site that sPLA2IIA binds to. It is also possible that sPLA2IIA does not bind to TLR4. Mechanistic studies involving rsPLA2IIA and TLR4 are warranted to investigate this potential relationship further by using another anti-TLR4 mAb to block the sPLA2IIA-TLR4 interaction or by using immunoprecipitation technique.                100 5 Conclusions 5.1 Strengths and Limitations of this Study Many previous studies have alluded to the involvement of sPLA2IIA in the pathological events in rheumatoid arthritis (Bidgood et al. 2000; Bryant et al. 2010; Jamal et al. 1998; Masuda et al. 2005), atherosclerosis (Divchev and Schieffer 2008; Ghesquiere et al. 2005; Lambeau and Gelb 2008), cancer (Hernandez et al. 2010; Jiang et al. 2002; Martin et al. 2009; Mathisen et al. 2007; Mauchley et al. 2009) and neurodegeneration (Chiricozzi et al. 2010; Moses et al. 2006; Schaeffer et al. 2010; Wei et al. 2003; Yagami et al. 2002); however, the mechanisms of sPLA2IIA action had not been addressed directly in the context of neuroinflammation. This thesis investigates the role of sPLA2IIA in glial cell-mediated inflammation and neurotoxicity. The results of this thesis indicate that sPLA2IIA acts in a manner independent of its enzymatic activity; therefore, future studies exploring the role of sPLA2IIA in neuroinflammation should focus on its non-enzymatic activity, rather than its catalytic activity. The use of primary human astrocytes has also confirmed that both sPLA2IIA mRNA and protein are up- regulated in IFN-γ stimulated astrocytes, which points to the potential detrimental role of activated astrocytes in neuroinflammation. Several limitations were present throughout this thesis. The protein sequence that the sPLA2IIA-specific mAb was raised against is proprietary and therefore it could not be confirmed if other proteins released from THP-1 cells were not also bound by the sPLA2IIA-specific mAb used to prepare the immunosorbent. Since the sPLA2IIA-specific mAb was used in both the ELISA and immunosorbent experiment, it is possible that results were confounded by other proteins that may express the same amino acid  101 sequence or epitopes similar to the one recognized by the sPLA2IIA-specific mAb. In order to confirm these results, the ELISA and immunosorbent experiments must be repeated with sPLA2IIA-specific mAbs from different companies. Another limitation is that immortalized cell lines were used to model human microglia and neurons. It would strengthen the arguments made in this thesis to use primary human microglia and neurons in addition to the primary astrocytes used; however, as already mentioned in the introduction, opportunities to obtain human post- mortem brain tissue for microglia culture preparation are limited, and culturing primary human neurons is not currently possible.   5.2 Future Directions Further studies on sPLA2IIA and glial cell-mediated neurotoxicity will contribute to the overall understanding of neuroinflammation, which may in turn aid in the design of more specific anti-inflammatory drugs that can combat the underlying chronic inflammation inherent to neurodegenerative disorders. To increase the relevance of the in vitro experiments performed in this study, future work should use endogenous pro- inflammatory stimulants such as TNF-α and IL-1β, as well as pathological stimulants such as Aβ (found in AD tissues) or α-syn (found in PD tissues). In addition, if possible, primary human microglia should be used to confirm the findings of this thesis. It would also be useful to determine protein concentrations of sPLA2IIA in glial cells from humans with neurodegenerative disease or animal models of neurodegeneration. One aspect of sPLA2IIA neurotoxicity that was not addressed by the experiments  102 in this thesis is the role that sPLA2IIA may play in glutamate-induced neurotoxicity. As mentioned, Ca2+ homeostasis may also be affected by the up-regulation of sPLA2IIA; it has been demonstrated that sPLA2IIA enhances Ca2+ intake into rat cortical neurons via the L-type voltage-gated Ca2+ channel (Yagami et al. 2003). Mitochondria purified from rat brain astrocytes, neuron-like PC-12 cells and U-251 astrocytoma cells were found to store sPLA2IIA (Macchioni et al. 2004). It is critical to investigate what causes sPLA2IIA to migrate to the mitochondria of neurons and the implications of the presence of sPLA2IIA in neuronal mitochondria and intracellular Ca2+ stores (Macchioni et al. 2004; Mathisen et al. 2007; Yagami et al. 2003). It has already been shown that sPLA2IIA does not interfere with Ca2+ homeostasis in the absence of glutamate (Macchioni et al. 2004); however, it would contribute to the overall understanding of neuronal excitotoxicity if the role of sPLA2IIA is further investigated in glutamate-induced Ca2+ release from mitochondria.  The localization of sPLA2IIA in mitochondria may be a result of prior internalization through binding with heparin sulfate proteoglycans or other cell surface receptors (Boilard et al. 2003; Macchioni et al. 2004). Future studies on sPLA2IIA may test the effect of anti-integrin β3 mAb on the cytotoxicity of stimulated glial cells, and test whether this mAb would be neuroprotective by preventing sPLA2IIA from binding with α5β3 integrin (Saegusa et al. 2008). In a similar manner, heparinase III and heparin could be used to prevent sPLA2IIA from binding to heparin sulfate proteoglycans in order to investigate this particular binding mechanism. The identification of other potential sPLA2IIA binding sites as well as compounds that block sPLA2IIA from binding to  103 receptors that lead to cell death pathways may be beneficial in inhibiting sPLA2IIA neurotoxicity.   5.3 Significance of Findings The results of this study expand our knowledge of how sPLA2IIA functions in inflammatory pathologies. Specifically, the experimental data in this study indicate that sPLA2IIA transcription, expression and secretion are up-regulated in stimulated microglia-like cells as well as astrocytes, which causes death in neuron-like cells. Most importantly, sPLA2IIA appears to contribute to neuronal death through a mechanism independent of its enzymatic activity; this observation is consistent with emerging evidence that sPLA2IIA contributes to inflammatory processes in a non-enzymatic manner. Though the sPLA2IIA-specific inhibitor RO032107 was able to significantly reduce both rsPLA2IIA enzymatic activity and sPLA2IIA activity in stimulated THP-1 cell supernatants, the inhibitor did not reduce rsPLA2IIA toxicity toward SH-SY5Y cells, nor did it attenuate stimulated THP-1 cell neurotoxicity. In addition, the removal of sPLA2IIA significantly reduced the cytotoxicity of stimulated glial cell supernatants toward neuron-like SH-SY5Y cells, which confirms that sPLA2IIA interacts with the neuronal membrane surface in order to initiate cell death. These results suggest that future studies on the role of sPLA2IIA in glial cell-mediated neurotoxicity should focus on possible sPLA2IIA binding sites on both neuronal and glial cell surfaces. Compounds that prevent sPLA2IIA from binding to cell surface receptors may inhibit sPLA2IIA-  104 mediated glial cell proliferation or neuronal cell death; therefore, such compounds could contribute to the resolution of chronic inflammation. Bringing an end to chronic inflammation can prevent further neurodegeneration, which may offer therapeutic relief and momentous hope to patients suffering from AD or PD.  105 References  1. Abramovitz M, Adam M, Boie Y, Carriere M, Denis D, Godbout C, Lamontagne S, Rochette C, Sawyer N, Tremblay NM et al. The utilization of recombinant prostanoid receptors to determine the affinities and selectivities of prostaglandins and related analogs. Biochim Biophys Acta 2000;1483(2):285-93. 2. Alaoui-El-Azher M, Wu Y, Havet N, Israel A, Lilienbaum A, Touqui L. Arachidonic acid differentially affects basal and lipopolysaccharide-induced sPLA(2)-IIA expression in alveolar macrophages through NF-kappaB and PPAR-gamma-dependent pathways. Mol Pharmacol 2002;61(4):786-94. 3. Aloisi F. Immune function of microglia. Glia 2001;36(2):165-79. 4. Antonopoulou G, Barbayianni E, Magrioti V, Cotton N, Stephens D, Constantinou- Kokotou V, Dennis EA, Kokotos G. Structure-activity relationships of natural and non- natural amino acid-based amide and 2-oxoamide inhibitors of human phospholipase A(2) enzymes. Bioorg Med Chem 2008;16(24):10257-69. 5. Aschner M, Allen JW, Kimelberg HK, LoPachin RM, Streit WJ. Glial cells in neurotoxicity development. Annu Rev Pharmacol Toxicol 1999;39:151-73. 6. Beck S, Lambeau G, Scholz-Pedretti K, Gelb MH, Janssen MJ, Edwards SH, Wilton DC, Pfeilschifter J, Kaszkin M. Potentiation of tumor necrosis factor alpha-induced secreted phospholipase A2 (sPLA2)-IIA expression in mesangial cells by an autocrine loop involving sPLA2 and peroxisome proliferator-activated receptor alpha activation. J Biol Chem 2003;278(32):29799-812. 7. Berg OG, Gelb MH, Tsai MD, Jain MK. Interfacial enzymology: the secreted phospholipase A(2)-paradigm. Chem Rev 2001;101(9):2613-54. 8. Bessis A, Bechade C, Bernard D, Roumier A. Microglial control of neuronal death and synaptic properties. Glia 2007;55(3):233-8. 9. Bezzine S, Bollinger JG, Singer AG, Veatch SL, Keller SL, Gelb MH. On the binding preference of human groups IIA and X phospholipases A2 for membranes with anionic phospholipids. J Biol Chem 2002;277(50):48523-34. 10. Bidgood MJ, Jamal OS, Cunningham AM, Brooks PM, Scott KF. Type IIA secretory phospholipase A2 up-regulates cyclooxygenase-2 and amplifies cytokine-mediated prostaglandin production in human rheumatoid synoviocytes. J Immunol 2000;165(5):2790-7. 11. Bird TD. Genetic aspects of Alzheimer disease. Genet Med 2008;10(4):231-9. 12. Birts CN, Barton CH, Wilton DC. A catalytically independent physiological function for human acute phase protein group IIA phospholipase A2: cellular uptake facilitates cell debris removal. J Biol Chem 2008;283(8):5034-45.  106 13. Birts CN, Barton CH, Wilton DC. Catalytic and non-catalytic functions of human IIA phospholipase A2. Trends Biochem Sci 2009;35(1):28-35. 14. Block ML, Hong JS. Chronic microglial activation and progressive dopaminergic neurotoxicity. Biochem Soc Trans 2007;35(Pt 5):1127-32. 15. Block ML, Zecca L, Hong JS. Microglia-mediated neurotoxicity: uncovering the molecular mechanisms. Nat Rev Neurosci 2007;8:57-69. 16. Bobik A. Secretory phospholipase A2 type IIA: a regulator of immune function in atherosclerosis? Cardiovasc Res 2009;81(1):9-10. 17. Boilard E, Bourgoin SG, Bernatchez C, Poubelle PE, Surette ME. Interaction of low molecular weight group IIA phospholipase A2 with apoptotic human T cells: role of heparan sulfate proteoglycans. FASEB J 2003;17(9):1068-80. 18. Bozzo C, Lombardi G, Santoro C, Canonico PL. Involvement of beta(1) integrin in betaAP-induced apoptosis in human neuroblastoma cells. Mol Cell Neurosci 2004;25(1):1- 8. 19. Bryant KJ, Bidgood MJ, Lei PW, Taberner M, Salom C, Kumar V, Lee L, Church WB, Courtenay B, Smart BP et al. A bifunctional role for group IIA secreted phospholipase A2 in human rheumatoid fibroblast-like synoviocyte arachidonic acid metabolism. J Biol Chem 2010;286(4):2492-503. 20. Burke JE, Dennis EA. Phospholipase A2 structure/function, mechanism, and signaling. J Lipid Res 2009;50 Suppl:S237-42. 21. Cameron B, Landreth GE. Inflammation, microglia, and Alzheimer's disease. Neurobiol Dis;37(3):503-9. 22. Casserly I, Topol E. Convergence of atherosclerosis and Alzheimer's disease: inflammation, cholesterol, and misfolded proteins. Lancet 2004;363(9415):1139-46. 23. Cherukuri DP, Chen XB, Goulet AC, Young RN, Han Y, Heimark RL, Regan JW, Meuillet E, Nelson MA. The EP4 receptor antagonist, L-161,982, blocks prostaglandin E2- induced signal transduction and cell proliferation in HCA-7 colon cancer cells. Exp Cell Res 2007;313(14):2969-79. 24. Chiricozzi E, Fernandez-Fernandez S, Nardicchi V, Almeida A, Bolanos JP, Goracci G. Group IIA secretory phospholipase A2 (GIIA) mediates apoptotic death during NMDA receptor activation in rat primary cortical neurons. J Neurochem 2010;112(6):1574-83. 25. Choy EH, Panayi GS. Cytokine pathways and joint inflammation in rheumatoid arthritis. N Engl J Med 2001;344(12):907-16. 26. Church WB, Inglis AS, Tseng A, Duell R, Lei PW, Bryant KJ, Scott KF. A novel approach to the design of inhibitors of human secreted phospholipase A2 based on native peptide inhibition. J Biol Chem 2001;276(35):33156-64.  107 27. Ciesielski-Treska J, Ulrich G, Chasserot-Golaz S, Zwiller J, Revel MO, Aunis D, Bader MF. Mechanisms underlying neuronal death induced by chromogranin A-activated microglia. J Biol Chem 2001;276(16):13113-20. 28. Combs CK, Karlo JC, Kao SC, Landreth GE. beta-Amyloid stimulation of microglia and monocytes results in TNFalpha-dependent expression of inducible nitric oxide synthase and neuronal apoptosis. J Neurosci 2001;21(4):1179-88. 29. Coyle JT, Price DL, DeLong MR. Alzheimer's disease: a disorder of cortical cholinergic innervation. Science 1983;219(4589):1184-90. 30. Coyle JT, Puttfarcken P. Oxidative stress, glutamate, and neurodegenerative disorders. Science 1993;262(5134):689-95. 31. Cummings BS, McHowat J, Schnellmann RG. Phospholipase A(2)s in cell injury and death. J Pharmacol Exp Ther 2000;294(3):793-9. 32. Cummings JL. Alzheimer's Disease. N Engl J Med 2004;351(1):56-67. 33. Decker T, Lohmann-Matthes ML. A quick and simple method for the quantitation of lactate dehydrogenase release in measurements of cellular cytotoxicity and tumor necrosis factor (TNF) activity. J Immunol Methods 1988;115(1):61-9. 34. DeCoster MA, Lambeau G, Lazdunski M, Bazan NG. Secreted phospholipase A2 potentiates glutamate-induced calcium increase and cell death in primary neuronal cultures. J Neurosci Res 2002;67(5):634-45. 35. Dennis EA. Diversity of group types, regulation, and function of phospholipase A2. J Biol Chem 1994;269(18):13057-60. 36. Divchev D, Schieffer B. The secretory phospholipase A2 group IIA: a missing link between inflammation, activated renin-angiotensin system, and atherogenesis? Vasc Health Risk Manag 2008;4(3):597-604. 37. Dong Z, Liu Y, Scott KF, Levin L, Gaitonde K, Bracken RB, Burke B, Zhai QJ, Wang J, Oleksowicz L et al. Secretory phospholipase A2-IIa is involved in prostate cancer progression and may potentially serve as a biomarker for prostate cancer. Carcinogenesis 2010;31(11):1948-55. 38. Farooqui AA, Horrocks LA. Phospholipase A2-generated lipid mediators in the brain: the good, the bad, and the ugly. Neuroscientist 2006;12:245-61. 39. Flavin MP, Ho LT, Coughlin K. Neurotoxicity of soluble macrophage products in vitro-- influence of dexamethasone. Exp Neurol 1997;145(2 Pt 1):462-70. 40. Flavin MP, Zhao G, Ho LT. Microglial tissue plasminogen activator (tPA) triggers neuronal apoptosis in vitro. Glia 2000;29(4):347-54.    108 41. Gan L, Ye S, Chu A, Anton K, Yi S, Vincent VA, von Schack D, Chin D, Murray J, Lohr S et al. Identification of cathepsin B as a mediator of neuronal death induced by Abeta- activated microglial cells using a functional genomics approach. J Biol Chem 2004;279(7):5565-72. 42. Ghesquiere SA, Gijbels MJ, Anthonsen M, van Gorp PJ, van der Made I, Johansen B, Hofker MH, de Winther MP. Macrophage-specific overexpression of group IIa sPLA2 increases atherosclerosis and enhances collagen deposition. J Lipid Res 2005;46(2):201-10. 43. Giulian D, Corpuz M, Chapman S, Mansouri M, Robertson C. Reactive mononuclear phagocytes release neurotoxins after ischemic and traumatic injury to the central nervous system. J Neurosci Res 1993;36(6):681-93. 44. Greenfield SA, Zimmermann M, Bond CE. Non-hydrolytic functions of acetylcholinesterase. The significance of C-terminal peptides. FEBS J 2008;275(4):604-11. 45. Han WK, Sapirstein A, Hung CC, Alessandrini A, Bonventre JV. Cross-talk between cytosolic phospholipase A2 alpha (cPLA2 alpha) and secretory phospholipase A2 (sPLA2) in hydrogen peroxide-induced arachidonic acid release in murine mesangial cells: sPLA2 regulates cPLA2 alpha activity that is responsible for arachidonic acid release. J Biol Chem 2003;278(26):24153-63. 46. Hansen MB, Nielsen SE, Berg K. Re-examination and further development of a precise and rapid dye method for measuring cell growth/cell kill. J Immunol Methods 1989;119(2):203-10. 47. Hanson AJ, Prasad JE, Nahreini P, Andreatta C, Kumar B, Yan XD, Prasad KN. Overexpression of amyloid precursor protein is associated with degeneration, decreased viability, and increased damage caused by neurotoxins (prostaglandins A1 and E2, hydrogen peroxide, and nitric oxide) in differentiated neuroblastoma cells. J Neurosci Res 2003;74(1):148-59. 48. Harris JE, Nuttall RK, Elkington PT, Green JA, Horncastle DE, Graeber MB, Edwards DR, Friedland JS. Monocyte-astrocyte networks regulate matrix metalloproteinase gene expression and secretion in central nervous system tuberculosis in vitro and in vivo. J Immunol 2007;178(2):1199-207. 49. Hashioka S, Klegeris A, Schwab C, McGeer PL. Interferon-gamma-dependent cytotoxic activation of human astrocytes and astrocytoma cells. Neurobiol Aging 2009. 50. Hernandez M, Martin R, Garcia-Cubillas M, Maeso-Hernandez P, Nieto M. Secreted PLA2 induces proliferation in astrocytoma through the EGF receptor: another inflammation-cancer link. Neuro Oncol 2010;12(12):1328. 51. Hickey WF. Basic principles of immunological surveillance of the normal central nervous system. Glia 2001;36(2):118-24. 52. Hirsch EC, Hunot S. Neuroinflammation in Parkinson’s disease: a target for neuroprotection? Lancet Neurol 2009;8(4):382-97.  109 53. Hoyt KR, Gallagher AJ, Hastings TG, Reynolds IJ. Characterization of hydrogen peroxide toxicity in cultured rat forebrain neurons. Neurochem Res 1997;22(3):333-40. 54. Hu S, Chao CC, Khanna KV, Gekker G, Peterson PK, Molitor TW. Cytokine and free radical production by porcine microglia. Clin Immunol Immunopathol 1996;78(1):93-6. 55. Hume DA. The mononuclear phagocyte system. Curr Opin Immunol 2006;18(1):49-53. 56. Ibeas E, Fuentes L, Martin R, Hernández M, Nieto ML. Secreted phospholipase A2 type IIA as a mediator connecting innate and adaptive immunity: new role in atherosclerosis. Cardiovasc Res 2009;81:54-63. 57. Ibrahim Z, Busch J, Awwad M, Wagner R, Wells K, Cooper DK. Selected physiologic compatibilities and incompatibilities between human and porcine organ systems. Xenotransplantation 2006;13(6):488-99. 58. Ionescu VA, Villanueva EB, Hashioka S, Bahniwal M, Klegeris A. Cultured adult porcine astrocytes and microglia express functional interferon-gamma receptors and exhibit toxicity towards SH-SY5Y cells. Brain Res Bull 2011;84(3):244-51. 59. Jamal OS, Conaghan PG, Cunningham AM, Brooks PM, Munro VF, Scott KF. Increased expression of human type IIa secretory phospholipase A2 antigen in arthritic synovium. Ann Rheum Dis 1998;57(9):550-8. 60. Jensen MD, Sheng W, Simonyi A, Johnson GS, Sun AY, Sun GY. Involvement of oxidative pathways in cytokine-induced secretory phospholipase A2-IIA in astrocytes. Neurochem Int 2009;55(6):362-8. 61. Jiang J, Neubauer BL, Graff JR, Chedid M, Thomas JE, Roehm NW, Zhang S, Eckert GJ, Koch MO, Eble JN et al. Expression of group IIA secretory phospholipase A2 is elevated in prostatic intraepithelial neoplasia and adenocarcinoma. Am J Pathol 2002;160(2):667- 71. 62. Kar S, Slowikowski SP, Westaway D, Mount HT. Interactions between beta-amyloid and central cholinergic neurons: implications for Alzheimer's disease. J Psychiatry Neurosci 2004;29(6):427-41. 63. Kehrer JP, Biswal SS, La E, Thuillier P, Datta K, Fischer SM, Vanden Heuvel JP. Inhibition of peroxisome-proliferator-activated receptor (PPAR)alpha by MK886. Biochem J 2001;356(Pt 3):899-906. 64. Kermer P, Liman J, Weishaupt JH, Bahr M. Neuronal apoptosis in neurodegenerative diseases: from basic research to clinical application. Neurodegener Dis 2004;1(1):9-19. 65. Kingham PJ, Pocock JM. Microglial secreted cathepsin B induces neuronal apoptosis. J Neurochem 2001;76(5):1475-84. 66. Klegeris A, McGeer PL. Interaction of various intracellular signaling mechanisms involved in mononuclear phagocyte toxicity toward neuronal cells. J Leukoc Biol 2000;67(1):127- 33.  110 67. Klegeris A, McGeer PL. Toxicity of human monocytic THP-1 cells and microglia toward SH-SY5Y neuroblastoma Cells is reduced by inhibitors of 5-lypoxygenase and its activating protein FLAP. J Leukoc Biol 2003;73:369-78. 68. Klegeris A, Bissonnette CJ, McGeer PL. Modulation of human microglia and THP-1 cell toxicity by cytokines endogenous to the nervous system. Neurobiol Aging 2005a;26:673- 82. 69. Klegeris A, McGeer PL. Chymotrypsin-like proteases contribute to human monocytic THP-1 cell as well as human microglial neurotoxicity. Glia 2005b;51(1):56-64. 70. Klegeris A, McGeer PL. Non-steroidal anti-inflammatory drugs (NSAIDs) and other anti- inflammatory agents in the treatment of neurodegenerative disease. Curr Alzheimer Res 2005;2(3):355-65. 71. Kolko M, de Turco EB, Diemer NH, Bazan NG. Secretory phospholipase A2-mediated neuronal cell death involves glutamate ionotropic receptors. Neuroreport 2002;13(15):1963-6. 72. Kuwata H, Yamamoto S, Miyazaki Y, Shimbara S, Nakatani Y, Suzuki H, Ueda N, Murakami M, Kudo I. Studies on a mechanism by which cytosolic phospholipase A2 regulates the expression and function of type IIA secretory phospholipase A2. J Immunol 2000;165(7):4024-31. 73. LaFeria FM, Green KM, Oddo S. Intracellular amyloid-b in Alzheimer's disease. Nat Rev Neurosci 2007;8(499-509). 74. Lambeau G, Lazdunski M, Barhanin J. Properties of receptors for neurotoxic phospholipases A2 in different tissues. Neurochem Res 1991;16(6):651-8. 75. Lambeau G, Ancian P, Nicolas JP, Beiboer SH, Moinier D, Verheij H, Lazdunski M. Structural elements of secretory phospholipases A2 involved in the binding to M-type receptors. J Biol Chem 1995;270(10):5534-40. 76. Lambeau G, Gelb MH. Biochemistry and physiology of mammalian secreted phospholipases A2. Annu Rev Biochem 2008;77:495-520. 77. Li Z, Jansen M, Ogburn K, Salvatierra L, Hunter L, Mathew S, Figueiredo-Pereira ME. Neurotoxic prostaglandin J2 enhances cyclooxygenase-2 expression in neuronal cells through the p38MAPK pathway: a death wish? J Neurosci Res 2004;78(6):824-36. 78. Lin TN, Wang Q, Simonyi A, Chen JJ, Cheung WM, He YY, Xu J, Sun AY, Hsu CY, Sun GY. Induction of secretory phospholipase A2 in reactive astrocytes in response to transient focal cerebral ischemia in the rat brain. J Neurochem 2004;90(3):637-45. 79. Lio YC, Reynolds LJ, Balsinde J, Dennis EA. Irreversible inhibition of Ca(2+)- independent phospholipase A2 by methyl arachidonyl fluorophosphonate. Biochim Biophys Acta 1996;1302(1):55-60.   111 80. Lister MD, Glaser KB, Ulevitch RJ, Dennis EA. Inhibition studies on the membrane- associated phospholipase A2 in vitro and prostaglandin E2 production in vivo of the macrophage-like P388D1 cell. Effects of manoalide, 7,7-dimethyl-5,8-eicosadienoic acid, and p-bromophenacyl bromide. J Biol Chem 1989;264(15):8520-8. 81. Macchioni L, Corazzi L, Nardicchi V, Mannucci R, Arcuri C, Porcellati S, Sposini T, Donato R, Goracci G. Rat brain cortex mitochondria release group II secretory phospholipase A(2) under reduced membrane potential. J Biol Chem 2004;279(36):37860- 9. 82. Martin R, Hernandez M, Ibeas E, Fuentes L, Salicio V, Arnes M, Nieto ML. Secreted phospholipase A2-IIA modulates key regulators of proliferation on astrocytoma cells. J Neurochem 2009;111(4):988-99. 83. Massaad C, Paradon M, Jacques C, Salvat C, Bereziat G, Berenbaum F, Olivier JL. Induction of secreted type IIA phospholipase A2 gene transcription by interleukin-1beta. Role of C/EBP factors. J Biol Chem 2000;275(30):22686-94. 84. Masuda S, Murakami M, Komiyama K, Ishihara M, Ishikawa Y, Ishii T, Kudo I. Various secretory phospholipase A2 enzymes are expressed in rheumatoid arthritis and augment prostaglandin production in cultured synovial cells. FEBS J 2005;272(3):655-72. 85. Mathisen GH, Thorkildsen IH, Paulsen RE. Secretory PLA2-IIA and ROS generation in peripheral mitochondria are critical for neuronal death. Brain Res 2007;1153:43-51. 86. Mattson MP. Apoptosis in neurodegenerative disorders. Nat Rev Mol Cell Biol 2000;1(2):120-9. 87. Mauchley D, Meng X, Johnson T, Fullerton DA, Weyant MJ. Modulation of growth in human esophageal adenocarcinoma cells by group IIa secretory phospholipase A(2). J Thorac Cardiovasc Surg 2009;139(3):591-9; discussion 599. 88. McNaught KSP, Olanow CW. Protein aggregation in the pathogenesis of familial and sporadic Parkinson's disease. Neurobiol Aging 2006;27:530-45. 89. Miyake A, Yamamoto H, Takebayashi Y, Imai H, Honda K. The novel natural product YM-26567-1 [(+)-trans-4-(3-dodecanoyl-2,4,6- trihydroxyphenyl)-7-hydroxy-2-(4- hydroxyphenyl)chroman]: a competitive inhibitor of group II phospholipase A2. J Pharmacol Exp Ther 1992;263(3):1302-7. 90. Moore DJ, West AB, Dawson VL, Dawson TM. Molecular pathophysiology of Parkinson's disease. Annual Rev Neurosci 2005;28:57-87. 91. Moriguchi S, Mizoguchi Y, Tomimatsu Y, Hayashi Y, Kadowaki T, Kagamiishi Y, Katsube N, Yamamoto K, Inoue K, Watanabe S et al. Potentiation of NMDA receptor- mediated synaptic responses by microglia. Brain Res Mol Brain Res 2003;119(2):160-9. 92. Moses GS, Jensen MD, Lue LF, Walker DG, Sun AY, Simonyi A, Sun GY. Secretory PLA2-IIA: a new inflammatory factor for Alzheimer's disease. J Neuroinflammation [Internet]. 2006;3(28). Available from: http://www.jneuroinflammation.com/content/3/1/28  112 93. Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 1983;65(1-2):55-63. 94. Mounier CM, Bon C, Kini RM. Anticoagulant venom and mammalian secreted phospholipases A(2): protein- versus phospholipid-dependent mechanism of action. Haemostasis 2001;31(3-6):279-87. 95. Murakami M, Kambe T, Shimbara S, Kudo I. Functional coupling between various phospholipase A2s and cyclooxygenases in immediate and delayed prostanoid biosynthetic pathways. J Biol Chem 1999;274(5):3103-15. 96. Nachlas MM, Margulies SI, Goldberg JD, Seligman AM. The determination of lactic dehydrogenase with a tetrazolium salt. Anal Biochem 1960;1:317-26. 97. Nakajima K, Kohsaka S. Microglia: activation and their significance in the central nervous system. J Biochem 2001;130(2):169-75. 98. Oka S, Arita H. Inflammatory factors stimulate expression of group II phospholipase A2 in rat cultured astrocytes. Two distinct pathways of the gene expression. J Biol Chem 1991;266(15):9956-60. 99. Olson ED, Nelson J, Griffith K, Nguyen T, Streeter M, Wilson-Ashworth HA, Gelb MH, Judd AM, Bell JD. Kinetic evaluation of cell membrane hydrolysis during apoptosis by human isoforms of secretory phospholipase A2. J Biol Chem 2010;285(14):10993-1002. 100. Oslund RC, Cermak N, Gelb MH. Highly specific and broadly potent inhibitors of mammalian secreted phospholipases A2. J Med Chem 2008;51(15):4708-14. 101. Oslund RC, Cermak N, Verlinde CL, Gelb MH. Simplified YM-26734 inhibitors of secreted phospholipase A2 group IIA. Bioorg Med Chem Lett 2008;18(20):5415-9. 102. Park KM, Trucillo M, Serban N, Cohen RA, Bolotina VM. Role of iPLA2 and store- operated channels in agonist-induced Ca2+ influx and constriction in cerebral, mesenteric, and carotid arteries. Am J Physiol Heart Circ Physiol 2008;294(3):H1183-7. 103. Parpura V, Haydon PG. Physiological astrocytic calcium levels stimulate glutamate release to modulate adjacent neurons. Proc Natl Acad Sci U S A 2000;97(15):8629-34. 104. Peilot H, Rosengren B, Bondjers G, Hurt-Camejo E. Interferon-gamma induces secretory group IIA phospholipase A2 in human arterial smooth muscle cells. Involvement of cell differentiation, STAT-3 activation, and modulation by other cytokines. J Biol Chem 2000;275(30):22895-904. 105. Pernas P, Masliah J, Olivier JL, Salvat C, Rybkine T, Bereziat G. Type II phospholipase A2 recombinant overexpression enhances stimulated arachidonic acid release. Biochem Biophys Res Commun 1991;178(3):1298-305. 106. Peuchen S, Bolanos JP, Heales SJ, Almeida A, Duchen MR, Clark JB. Interrelationships between astrocyte function, oxidative stress and antioxidant status within the central nervous system. Prog Neurobiol 1997;52(4):261-81.  113 107. Piek JJ, de Winter RJ. Type II secretory phospholipase A2: the emerging role of biochemical markers of plaque inflammation. Eur Heart J 2003;24(20):1804-6. 108. Pineau I, Lacroix S. Endogenous signals initiating inflammation in the injured nervous system. Glia 2009;57(4):351-61. 109. Pluckthun A, Dennis EA. Activation, aggregation, and product inhibition of cobra venom phospholipase A2 and comparison with other phospholipases. J Biol Chem 1985;260(20):11099-106. 110. Putz T, Ramoner R, Gander H, Rahm A, Bartsch G, Bernardo K, Ramsay S, Thurnher M. Bee venom secretory phospholipase A2 and phosphatidylinositol-homologues cooperatively disrupt membrane integrity, abrogate signal transduction and inhibit proliferation of renal cancer cells. Cancer Immunol Immunother 2007;56(5):627-40. 111. Radvanyi F, Jordan L, Russo-Marie F, Bon C. A sensitive and continuous fluorometric assay for phospholipase A2 using pyrene-labeled phospholipids in the presence of serum albumin. Anal Biochem 1989;177(1):103-9. 112. Rauschenberger K, Scholer K, Sass JO, Sauer S, Djuric Z, Rumig C, Wolf NI, Okun JG, Kolker S, Schwarz H et al. A non-enzymatic function of 17beta-hydroxysteroid dehydrogenase type 10 is required for mitochondrial integrity and cell survival. EMBO Mol Med 2009;2(2):51-62. 113. Raveh A, Cooper A, Guy-David L, Reuveny E. Nonenzymatic rapid control of GIRK channel function by a G protein-coupled receptor kinase. Cell 2010;143(5):750-60. 114. Rock RB, Gekker G, Hu S, Sheng WS, Cheeran M, Lokensgard JR, Peterson PK. Role of microglia in central nervous system infections. Clin Microbiol Rev 2004;17(4):942-64. 115. Rock KL. Pathobiology of inflammation to cell death. Biol Blood Marrow Transplant 2009;15(1 Suppl):137-8. 116. Saegusa J, Akakura N, Wu CY, Hoogland C, Ma Z, Lam KS, Liu FT, Takada YK, Takada Y. Pro-inflammatory secretory phospholipase A2 type IIA binds to integrins alphavbeta3 and alpha4beta1 and induces proliferation of monocytic cells in an integrin-dependent manner. J Biol Chem 2008;283(38):26107-15. 117. Sastre M, Klockgether T, Heneka MT. Contribution of inflammatory processes to Alzheimer's disease: molecular mechanisms. International Journal of Developmental Neuroscience 2006;24:167-76. 118. Schaeffer EL, da Silva ER, Novaes Bde A, Skaf HD, Gattaz WF. Differential roles of phospholipases A(2) in neuronal death and neurogenesis: implications for Alzheimer disease. Prog Neuropsychopharmacol Biol Psychiatry 2010;34(8):1381-9. 119. Smart BP, Pan YH, Weeks AK, Bollinger JG, Bahnson BJ, Gelb MH. Inhibition of the complete set of mammalian secreted phospholipases A(2) by indole analogues: a structure- guided study. Bioorg Med Chem 2004;12(7):1737-49.  114 120. Streit WJ, Mrak RE, Griffin WS. Microglia and neuroinflammation: a pathological perspective. J Neuroinflammation [Internet]. 2004;1(14). Available from: http://www.jneuroinflammation.com/content/1/1/14 121. Tang SC, Lathia JD, Selvaraj PK, Jo DG, Mughal MR, Cheng A, Siler DA, Markesbery WR, Arumugam TV, Mattson MP. Toll-like receptor-4 mediates neuronal apoptosis induced by amyloid beta-peptide and the membrane lipid peroxidation product 4- hydroxynonenal. Exp Neurol 2008;213(1):114-21. 122. Titsworth WL, Cheng X, Ke Y, Deng L, Burckardt KA, Pendleton C, Liu NK, Shao H, Cao QL, Xu XM. Differential expression of sPLA2 following spinal cord injury and a functional role for sPLA2-IIA in mediating oligodendrocyte death. Glia 2009;57(14):1521- 37. 123. Tournier C, Thomas G, Pierre J, Jacquemin C, Pierre M, Saunier B. Mediation by arachidonic acid metabolites of the H2O2-induced stimulation of mitogen-activated protein kinases (extracellular-signal-regulated kinase and c-Jun NH2-terminal kinase). Eur J Biochem 1997;244(2):587-95. 124. Town T, Nikolic V, Tan J. The microglial "activation" continuum: from innate to adaptive responses. J Neuroinflammation [Internet]. 2005;2:24. Available from: http://www.jneuroinflammation.com/content/2/1/24 125. Wagner B, Natarajan A, Grunaug S, Kroismayr R, Wagner EF, Sibilia M. Neuronal survival depends on EGFR signaling in cortical but not midbrain astrocytes. EMBO J 2006;25(4):752-62. 126. Wang X, Chen S, Ma G, Ye M, Lu G. Involvement of proinflammatory factors, apoptosis, caspase-3 activation and Ca2+ disturbance in microglia activation-mediated dopaminergic cell degeneration. Mech Ageing Dev 2005;126(12):1241-54. 127. Wei LL, Shen YD, Zhang YC, Hu XY, Lu PL, Wang L, Chen W. Roles of the prostaglandin E2 receptors EP subtypes in Alzheimer's disease. Neurosci Bull 2010;26(1):77-84. 128. Wei S, Ong WY, Thwin MM, Fong CW, Farooqui AA, Gopalakrishnakone P, Hong W. Group IIA secretory phospholipase A2 stimulates exocytosis and neurotransmitter release in pheochromocytoma-12 cells and cultured rat hippocampal neurons. Neuroscience 2003;121(4):891-8. 129. Wu Y, Raymond B, Goossens PL, Njamkepo E, Guiso N, Paya M, Touqui L. Type-IIA secreted phospholipase A2 is an endogenous antibiotic-like protein of the host. Biochimie 2010;92(6):583-7. 130. Xie HR, Hu LS, Li GY. SH-SY5Y human neuroblastoma cell line: in vitro cell model of dopaminergic neurons in Parkinson's disease. Chin Med J (Engl);123(8):1086-92.    115 131. Yagami T, Ueda K, Asakura K, Hata S, Kuroda T, Sakaeda T, Takasu N, Tanaka K, Gemba T, Hori Y. Human group IIA secretory phospholipase A2 induces neuronal cell death via apoptosis. Mol Pharmacol 2002;61(1):114-26. 132. Yagami T, Ueda K, Asakura K, Nakazato H, Hata S, Kuroda T, Sakaeda T, Sakaguchi G, Itoh N, Hashimoto Y et al. Human group IIA secretory phospholipase A2 potentiates Ca2+ influx through L-type voltage-sensitive Ca2+ channels in cultured rat cortical neurons. J Neurochem 2003;85(3):749-58. 133. Yagami T, Ueda K, Hata S, Kuroda T, Itoh N, Sakaguchi G, Okamura N, Sakaeda T, Fujimoto M. S-2474, a novel nonsteroidal anti-inflammatory drug, rescues cortical neurons from human group IIA secretory phospholipase A(2)-induced apoptosis. Neuropharmacology 2005;49(2):174-84. 134. Zhang FX, Kirschning CJ, Mancinelli R, Xu XP, Jin Y, Faure E, Mantovani A, Rothe M, Muzio M, Arditi M. Bacterial lipopolysaccharide activates nuclear factor-kappaB through interleukin-1 signaling mediators in cultured human dermal endothelial cells and mononuclear phagocytes. J Biol Chem 1999;274(12):7611-4.   116 Appendices  Appendix A: RNA Purity Values  RNA sample purity was determined using an Eppendorf Biophotometer Plus spectrophotometer (see Methods for company information). RNA absorbs at 260 nm, while contaminants such as organic compounds, protein and particulates absorb at 230, 280 and >340 nm, respectively. The 260/280 ratio was used to determine RNA purity; a relatively pure RNA sample measures between 1.8-2.0 according to the manufacturer.  117   Appendix B: Publication Ionescu VA, Villanueva EB, Hashioka S, Bahniwal M, Klegeris A. Cultured adult porcine astrocytes and microglia express functional interferon-γ receptors and exhibit toxicity towards SH-SY5Y cells. Brain Res Bull 2011;84(3):244-51.   Brain Research Bulletin 84 (2011) 244–251 Contents lists available at ScienceDirect Brain Research Bulletin journa l homepage: www.e lsev ier .com/ lo Research report Cultured adult porcine astrocytes and microglia e receptors and exhibit toxicity towards SH-SY5Y c Vlad A. Io , Ma a Department o , V1V b Kinsmen Labo 1 Can a r t i c l Article history: Received 21 Ju Received in re 14 December 2 Accepted 19 D Available onlin Keywords: Aging In vitro culture model Neuroinflammation Neurodegenerative diseases Neurotoxicity Pig glia pes a hum issue nd ag ilari an g glia a demonstrate that both microglia and astrocytes derived from adult porcine brains express functional interferon- receptors (IFN--R) and CD14. They become toxic towards SH-SY5Y neuroblastoma cells when exposed to proinflammatory mediators. Upon such stimulation with lipopolysaccharide (LPS) and interferon- (IFN-), adult porcinemicroglia, but not astrocytes, secrete tumor necrosis factor- (TNF-) while both cell types do not secrete detectable levels of nitric oxide (NO). Comparison of our experi- 1. Introdu Consider cesses play disorders [1 esis of neur post morte and culturi vous system microglia a the nervous in various p approaches Abbreviatio ture F12ham; GFAP, glial fibr tors; IL, inter 2,5-diphenyl t TNF-, tumor ∗ Correspon E-mail add 0361-9230/$ – doi:10.1016/j.mental data with previously published studies indicates that adult porcine glial cultures have certain functional characteristics that make them similar to human glial cells. Therefore adult porcine glial cells may be a useful model system for studies of human diseases associated with adulthood and advanced age. Adult porcine tissues are relatively easy to obtain in most countries and could be used as a reliable and inexpensive source of cultured cells. Crown Copyright © 2010 Published by Elsevier Inc. All rights reserved. ction able evidence suggests that neuroinflammatory pro- a significant role in a number of neurodegenerative 6,18,28]. Data supporting this inflammatory hypoth- odegeneration have been collected by analysing human m tissue samples, studying transgenic animal models ng various cell types derived from the central ner- of various animal species. It has become evident that nd astrocytes play a crucial role in the homeostasis of system; however, they also become actively involved athological processes of the brain [6,46]. One of the best for studyinghumanmicroglia and astrocyte physiology ns: DMEM-F12, Dulbecco’s modified Eagle’s medium–nutrient mix- ELISA, enzyme-linked immunosorbent assay; FBS, fetal bovine serum; illary acidic protein; IFN-, interferon-; IFN--R, interferon- recep- leukin; LPS, lipopolysaccharide; MTT, 3-(4,5-dimethylthiazol-2-yl) etrazoliumbromide;NO,nitric oxide; PBS, phosphate-buffered saline; necrosis factor-. ding author. Tel.: +1 250 807 9557; fax: +1 250 807 8005. ress: andis.klegeris@ubc.ca (A. Klegeris). and pathology has been culturing these cells from either human post-mortem, surgical or fetal tissues [14,30,37]. However, due to ethical issues associated with such experiments and the limited availability of human tissues, there is a need for alternative model systems. Themost commonly used surrogates for human glial cells have been cell lines derived mainly from humans or mice, as well as primary mouse or rat glial cells that are usually prepared from perinatal animals. The advantages of these culture systems include the fact that tissues are easily accessible and that the obtained cells are readily dividing, which allows significant numbers of cells to be harvested. Nevertheless, due to the existing interspecies dif- ferences in the case of rodent tissues as well as the alterations in oncogene expression and appearance of subclones in the case of cell lines, these culture systems are not ideal [1,3,45]. Pigs represent a species that might be a good model for human biomedical research in general, as well as an appropriate model for studies on immune and neuroinflammatory processes [44]. Of all the non-primate mammals, pigs have the physiology, anatomy and body size most similar to that of humans. The pig immune system is also very similar to humans and an intensive research effort has beendirected towards the use of porcine organs for xeno- transplantation in humans [12]. Various porcine cell types have see front matter. Crown Copyright © 2010 Published by Elsevier Inc. All rights reserved. brainresbull.2010.12.011nescua, Erika B. Villanuevaa, Sadayuki Hashiokab f Biology, University of British Columbia Okanagan, 3333 University Way, Kelowna, BC ratory of Neurological Research, University of British Columbia, Vancouver, BC, V6T 2A e i n f o ly 2010 vised form 010 ecember 2010 e 24 December 2010 a b s t r a c t In vitro cultures of various glial cell ty cesses associatedwith age-dependent choose to use neonatal rodent brain t glial cell functions that are species a immune systemshave a number of sim cytes may be good surrogates for hum to prepare more than 90% pure microcate /bra inresbul l xpress functional interferon- ells npreet Bahniwala, Andis Klegerisa,∗ 1V7 Canada ada re common systems used to model neuroinflammatory pro- anneurodegenerativediseases. Even thoughmost researchers s as the source of glial cells, there are significant variations in e dependent. It has been established that human and swine ties,which suggests that cultured porcinemicroglia and astro- lial cell types. Here we describe a method that could be used nd astrocyte cultures derived from adult porcine tissues. We V.A. Ionescu et al. / Brain Research Bulletin 84 (2011) 244–251 245 been cultured thus far, including peripheral blood lymphocytes [42], aortic and brain-derived endothelial cells [11,38], kidney cells [54] as well as myenteric and brain-derived neurons [2,5]. Several reports have already described porcine glial cell cultures, including mixedglial which pure far, neonata studied [22 To the b adult porci described a was prepar while Yang characteriz immunohis tured glial porcine mic these cells upon stimu cells. 2. Methods 2.1. Adult por Except du Eagle’s mediu catalogue num fetal bovine s supplemented 100U/ml peni antibiotics, Hy Intact hea licensed local tissues were k placed into co without FBS. A collected into otics); large b washes with 1 blade was use (for approxim ing 45ml of D solution (HyC in a water bat Units/ml, Sigm lowed by furth 10ml serologi DMEM-F12 (1 ual trypsin an re-suspended tered through 352360). The fi andwas carefu centrifuge tub v/v Percoll (GE with phospha ful not to dist cell suspensio a fixed-angle debris, was dis was carefully c Following a 10 containing the and plated on 430167). Cell c CO2 and 95% a pigs. Following washed off wi medium. The which the cult treal, Quebec, and cells were tion (HyClone antibiotics), c in DMEM-F12 (10%FBS, 1× antibiotics) before being plated into tissue culture flasks. After themixed glial cell cultures became confluent again (typically 7–10 days), flasks were shaken at 200 rpm for 1h at room temperature on an orbital shaker to remove the loosely adherent microglia cells. Microglia in the mixed glial culture tantsw F12 (1 s desc es. T from t . For t ofmi er a p transf w/v lture was d owth ere pe mes. C otic, unofl mmun rveste cientifi lls we ng sol ture f bbit a enmar tibodi a. Sub onX-1 t conj sbenz was u s we on, ON doubl IFN- , Conc (1:1 w dis al an of ast ; Wak --R2 d com Abcam ubate use Ig 6-con 3325 were mages agePr staini was o l cyto toxici ma ce ods p cells es we tratio ile po re for ml o m Esc n- ( were u ml of c ichha batio rescenculturesprepared fromone-dayoldanimals [5,50], from microglia and astrocyte cultures were extracted. Thus l pigs have been the main source of microglia cultures ,34,41,48–50]. est of our knowledge, only two reports have described ne glial cells: Jeliazkova-Mecheva and Bobilya [25] porcine astrocyte/endothelial cell culture model that ed from 3 to 4 months old Yucatan miniature pigs, et al. [54] used adult pig retinal wholemounts to e microglia and other immune cells in this tissue by tochemical staining; the latter study did not use cul- cells. Here we describe preparation of purified adult roglia and astrocyte cell cultures and demonstrate that express interferon- receptors (IFN--R), CD14 and lation become cytotoxic to human neuronal SH-SY5Y cine glial cell cultures ring tissue extraction, all cells were cultured in Dulbecco’s modified m–nutrient mixture F12 ham (DMEM-F12, HyClone, Logan, UT, USA, ber 3026101) supplemented with either 5% or 10% heat-inactivated erum (FBS, HyClone, 3039603HI). For cell culture, the media was with an antibiotic/antimycotic solution at a final concentration of cillin G, 100g/ml streptomycin and 0.25g/ml amphotericin (1× Clone, 3007901). ds from one year old land-raised Pietrain pigs were collected from a abattoir. Post-mortem delays varied between 3 and 5h during which ept on ice. Brain tissues were excised under sterile conditions and ld DMEM-high glucose (HyClone, 3024302) containing 5× antibiotics pproximately 10g of the cortical tissue was cut into small blocks, a sterile Petri dish with DMEM-high glucose (0% FBS, 5× antibi- lood vessels and the meninges were carefully removed. Following 3 0ml of DMEM-high glucose (0% FBS, 5× antibiotics), a sterile razor d to mechanically dissociate the brain tissue to a fine consistency ately 2min). The tissues were transferred into 50ml tubes contain- MEM-high glucose (0% FBS, 5× antibiotics), 5ml of 2.5% w/v trypsin lone, 3003701) was added and tubes incubated at 37 ◦C for 30min h with shaking. The tissues were treated with DNase 1 (40 Kunitz a–Aldrich, St. Louis, MO, USA, D4263) for an additional 10min, fol- ermechanical homogenization via repetitive pipetting using a sterile cal pipette. The resulting mixture was split into two 50ml tubes. 0% FBS, 1× antibiotics) was added to each tube to inhibit any resid- d cells were centrifuged at 250× g for 10min at 4 ◦C. The pellet was in a total volume of 15ml DMEM-F12 and the suspension was fil- a sterile cell strainer (100m, BD Falcon, Mississauga, ON, Canada, ltrate was dilutedwith DMEM-F12 to reach the final volume of 30ml lly layered onto a Percoll density gradient solution prepared in 50ml es. The Percoll gradient was produced by gently layering 15ml of 25% Healthcare, Piscataway, NJ, USA, 17-0891-01) isotonically adjusted te buffered saline (PBS), onto 5ml of 70% v/v Percoll. We were care- urb the interface that appeared between the Percoll layers and the n. The resulting mixture was spun at 15,000× g for 10min at 4 ◦C in rotor. The upper cloudy layer, which contained the myelin and cell carded. The cloudy interface layer containing the glial cells (2–3ml) ollected and diluted in 10ml of DMEM-F12 (10% FBS, 1× antibiotics). min spin at 250× g to wash the residual Percoll, the resulting pellet glial cells was re-suspended in DMEM-F12 (10% FBS, 1× antibiotics) to two 100mm tissue culture-treated plates (Corning, Lowell, MA, ultureswere incubated in a designated CO2 incubator (humidified 5% ir atmosphere) set at 39 ◦C, which is the normal body temperature for 48h incubation, the non-adherent cells and any residual debris were th warm PBS with 1× antibiotics followed by the addition of fresh cell cultures reached confluence after 14–20 days incubation, after ures were transferred to 75 cm2 tissue culture flasks (Sarstedt, Mon- Canada, 831811002) as follows: the original media was removed trypsinized for 5min using 5ml of 0.25% w/v trypsin/EDTA solu- , 3004202). Cells were washed with 15ml DMEM-F12 (10% FBS, 1× ollected by centrifugation at 250× g for 10min and re-suspended superna DMEM- iments a three tim sample less cells depleted twice ov split by by 0.25% tissue cu cultures in cell gr ments w than 5 ti scope (M camera. 2.2. Imm For i were ha Fisher S 24h. Ce a blocki tempera clonal ra Dako, D IBA-1 an microgli 0.1%Trit fragmen 5M bi B2261) the slide Burlingt For against national antibody 1403, no polyclon fication dilution anti-IFN also use 1:1000; then inc anti-mo Fluor 54 Hoechst cultures Japan), i with Im immuno activity 2.3. Glia Cyto roblasto by meth SH-SY5Y astrocyt a concen FBS, wh to adhe with 0.8 pure, fro interfero 985-PI) tion, 0.4 cells,wh 72h incu cell fluoere collected by centrifugation at 250× g for 10min, re-suspended in 0% FBS, 1× antibiotics), and plated in 24-well plates for further exper- ribed below.Microglia were harvested at oneweek intervals for up to ypically, the yield of microglia was 0.25–0.4 million per 10g of tissue he initial two shakes. The third shaking generated at least four times he isolation of astrocytes, confluentmixed glial cell cultureswere first croglia by shaking. Astrocyte-enriched cultureswerepassagedat least eriod of 3 weeks before initiating the experiments; astrocytes were erring 1/5th of cells into a new flask after cells had been detached trypsin/EDTA solution. Astrocyte yield from one confluent 75 cm2 flasks was up to 2.5million cells. Senescence in astrocyte-enriched etected in several cases after 6 or 7 passages as a significant decrease rate associatedwith changes in cell morphology; therefore no experi- rformed with astrocytes-enriched cultures that were passaged more ells in culture were observed with an inverted phase contrast micro- Richmond, BC, Canada) and photographed using Motic 3000 digital uorescence light microscopy ocytochemical assessment of culture purity, astrocytes andmicroglia d as described above, plated on 4-well chambered slides (Lab-tek, c, Ottawa, ON, Canada) at 5×105 cells/ml and allowed to adhere for re fixed with 4% buffered paraformaldehyde for 15min, treated with ution containing 5% skim milk and/or 4% normal goat serum at room or 1h and incubated with primary antibodies at 4 ◦C overnight. Poly- nti-glial fibrillary acidic protein (GFAP) antibodies (1:2,000 dilution; k, Z0334) were used to stain astrocytes, and polyclonal rabbit anti- es (1:200dilution;Wako,Osaka, Japan, 019-19741)wereused to stain sequently, the slides were washed in 50mM Tris–HCl, pH 7.4, saline, 00 (TBST) for 1hand incubatedat roomtemperaturewithCy3-F(ab’)2 ugated sheep anti-rabbit IgG (1:2000dilution, Sigma–Aldrich, C2306). imide H33342 trihydrochloride (Hoechst H33342, Sigma–Aldrich, sed for nuclear counterstaining. Following 3×20min wash in TBST, re coverslipped with ProLong Gold 8 anti-fade reagent (Invitrogen, , Canada, P36930). e immunofluorescence staining, the monoclonal mouse antibody -R2 (1:500 dilution; clone MMHGR-2, Fitzgerald Industries Inter- ord, MA, USA, 10R-I145A) and the monoclonal mouse anti-CD14 00 dilution; clone RPA-M1, Zymed, San Francisco, CA, USA, 07- tributed by Invitrogen) were used combined with either the rabbit tibody against GFAP (1:1000 dilution; Dako, Z0334) for the identi- rocytes or with the rabbit polyclonal anti-IBA-1 antibodies (1:200 o, 019-19741) for the staining of microglia. The rabbit polyclonal antibody (1:100 dilution; Abcam, Cambridge,MA, USA, ab77246)was bined with the mouse monoclonal anti-S100 beta antibody (S100B, , ab11178) for the identification of astrocytes. Cell cultures were d at room temperature for 1h with Alexa Fluor 488-conjugated goat G antibody (1:1000–1:500 dilutions; Invitrogen, A-10667) or Alexa jugated goat anti-rabbit IgG (1:1000–1:500; Invitrogen, A-11010). 8 (Sigma–Aldrich, B2883) was used for nuclear counterstaining. Cell examined under a fluorescence microscope (Olympus, BX-51, Tokyo, were acquired with a digital Olympus DP71 camera and colocalized o software (Improvision, Waltham, MA, USA). Negative controls for ng were performed by omitting the primary antibody; no immunore- bserved in these negative controls. toxicity experiments ty of porcine astrocytes and microglia towards human SH-SY5Y neu- lls (a gift fromDr. R. Ross, FordhamUniversity, NY, USA) was assessed reviously established for analysis of human cell cytotoxicity [20,26]. were usedwithout initial retinoic acid differentiation. Briefly, porcine re seeded into 24-well tissue culture-treated plates (Corning, 3524) at n of 6×105 cells/well in 0.8ml of DMEM-F12 medium containing 5% rcine microglia were used at 8×104 cells/well. Cells were allowed 48h, after which cell culture medium was removed and replaced f fresh medium. Bacterial lipopolysaccharide (LPS, 0.5g/ml, >97% herichia coli 055:B5, Sigma–Aldrich, L6529) and recombinant porcine IFN-, 0.1g/ml, >97% pure, R&D Systems, Minneapolis, MN, USA, sed alone or in combination to stimulate glial cells. After 48h incuba- ell-free supernatantwas transferred to eachwell containing SH-SY5Y dbeenplated24hearlier at a concentrationof 8×104 cells/well. After n, SH-SY5Y cell survival was assessed by the MTT assay and live/dead t staining. 246 V.A. Ionescu et al. / Brain Research Bulletin 84 (2011) 244–251 Fig. 1. Adult p microglia cells microglia-enri shows that mi were stainedw (J, green), whi counterstained and in C–E=50 article.) 2.4. Measurem The MTT a based on the a (3-(4,5-dimethorcine glial cultures. (A, B) Phase contrast microscopy of mixed primary glial cell culture that are loosely adherent on top of astrocyte monolayer. (C–E) Double immunofluor ched cultures. Cells were stained with a monoclonal IFN--R specific antibody (C, green) a croglia cells are positive for IFN--R (E). (F–K) Double immunofluorescence staining of IF ith two different antibodies against IFN--R (F, green; I, red) and either the polyclonal ant ch are the markers of astrocytes. The merged images show that most of the IFN--R-im by Hoechst H33258 (E, H, K, blue). Photos are representative of cell cultures prepared f m. See Section 2 for experimental details. (For interpretation of the references to colou ent of cell viability ssay was performed as described previously [20,26]. This method is bility of viable, but not dead cells, to convert the tetrazolium salt MTT ylthiazol-2-yl) 2,5-diphenyl tetrazolium bromide, Sigma–Aldrich, M2128) to col at 37 ◦C for 1h of SDS/DMF ex mamide, pH 4 measured. Thes (A) and astrocyte-enriched cultures (B). White arrows (A) indicate escence staining of IFN--R and microglia-specific marker IBA-1 in nd a polyclonal antibody against IBA-1 (D, red). The overlayed image N--R and glial-specific markers in astrocyte-enriched cultures. Cells ibody against GFAP (G, red) or themonoclonal antibody against S100B munoreactive cells correspond to astrocytes (H, K). Cell nuclei were rom four different animals. Magnification bars in A, B, F–K=100m r in this figure legend, the reader is referred to the web version of the oured formazan. SH-SY5Y cells were incubated with 0.5mg/ml MTT , the dark crystals formed were dissolved by adding an equal volume traction buffer (20% sodium dodecyl sulphate, 50% N,N-dimethyl for- .7, both from Fisher Scientific) and optical densities at 570nm were percent viable cellswere calculated using values obtained fromwells V.A. Ionescu et al. / Brain Research Bulletin 84 (2011) 244–251 247 Fig. 2. Adult p tainin cultures. Cells l antib cells are posit te ma monoclonal CD e mer representative See Se to colour in th exposed to ce ton X-100. In t by Molecular percentage of rogen, L-3224 from porcine a size in a total was counted a respectively. C total cell num pared from 4 d in a blinded fa 2.5. Measurem Porcinem for cytotoxicit used alone or supernatants f at 5000× g to and nitrite con available enzy BioSource Inte instructions. T The conce ouslydescribe (1% sulfanilam phoric acid) an 2.6. Statistica Data are p evaluation of design analysi comparisons. 3. Results 3.1. Phase c Phase co col produce ayer . It w ng in ed b anim g we rev sitivorcine microglia and astrocytes express CD14. (A–C) Double immunofluorescence s were stained with a monoclonal CD14 specific antibody (A, green) and a polyclona ive for CD14 (C). (D–F) Double immunofluorescence staining of CD14 and astrocy 14 specific antibody (D, green) and a polyclonal antibody against GFAP (E, red). Th of cell cultures prepared from three different animals. Magnification bars =50m. is figure legend, the reader is referred to the web version of the article.) ll culture medium only and wells containing cells lysed with 1% Tri- he case of porcine astrocytes, the MTT viability data were confirmed Probes fluorescent live/dead assay, which was used to estimate the dead cells. A protocol supplied by the manufacturer of the kit (Invit- ) was followed. Viability of SH-SY5Y cells exposed to supernatants strocytes was assayed by selecting 5 random fields of view of equal of 8 slides for each condition. The total number of cells in each field fter adding Calcein AM and EthD-1, which stain live and dead cells ellular viability was expressed as the ratio of total viable cells to the monol on top resulti confirm ferent shakin taining also pober in each field of view. Supernatants harvested from cultures pre- ifferent animalswere used for this study. Cell countswere performed shion. ent of tumor necrosis factor (TNF)-˛ and nitrite concentrations icroglia and astrocytes were plated exactly as described in Section 2.3 y experiments. LPS (0.5g/ml) and porcine IFN- (0.1g/ml) were in combination to stimulate glial cells. After 48h incubation, culture romunstimulatedandstimulatedcellswerecollectedandcentrifuged remove cellular debris. 100l aliquots were used to measure TNF- centrations. The TNF- levels were measured using a commercially me-linked immunosorbent assay (ELISA) kit (Swine TNF- CytoSet, rnational, Camarillo, CA, USA, CSC1753) according to manufacturer’s he mean detection limit for the assay was 0.44ng/ml. ntration of nitrite in tissue culture medium was measured as previ- d [26]bymixingequal volumes (100l) ofmediumandGriess reagent ide, 0.1%N-1-naphthyl-ethylenediamine dihydrochloride, 2.5% phos- d measuring absorbency at 550nm. l analysis resented as means± standard error of the mean (SEM). Statistical data was performed by Student’s t-test or the randomized blocks s of variance (ANOVA). Dunnett’s post-hoc test was used for multiple ontrast and immunofluorescence light microscopy ntrast microscopy revealed that our extraction proto- d mixed glial cell cultures, consisting of an astrocytic ther expans removal of tion) result F–K); imm from 4 diff GFAP posit that porcin (Fig. 2D–F) of microgli anti IFN-- purity was we confirm small numb smaller num ence of con out. 3.2. Glial cy Stimulat IFN- resul towardshu ofmicroglia ofmicroglia resulted in However, w nation of LPg of CD14 and microglia-specific marker IBA-1 in microglia-enriched ody against IBA-1 (B, red). The overlayed image shows that microglia rker GFAP in astrocyte-enriched cultures. Cells were stained with a ged image shows that astrocytes are positive for CD14 (F). Photos are ction 2 for experimental details. (For interpretation of the references and loosely adherent microglia (Fig. 1A, white arrows) as observed that shaking the plates dislodgedmicroglia, a highly enriched microglia cell culture. This was y immunostaining of cultures prepared from three dif- als, which showed that 94.6±2.9% of cells released by re IBA-1-positive microglia (Fig. 1D). Double immunos- ealed that 100% of the IBA-1 positive microglia were e for IFN--R (Fig. 1C–E) and CD14 (Fig. 2A–C). Fur- ion of the primary mixed cell cultures combined with microglia by shaking (as described in the methods sec- ed in highly purified astrocytic cell cultures (Fig. 1B, unostaining of astrocyte-enriched cultures prepared erent animals revealed that 98.3±1.1% of cells were ive. Double immunofluorescence experiments showed e astrocytes expressed IFN--R (Fig. 1F–K) and CD14 . There were no noticeable differences in the intensity a and astrocyte staining obtained using two different R antibodies and the anti-CD14 antibody. Since 100% not achieved for either microglia or astrocyte cultures, ed by means of immunocytochemistry the presence of er of astrocytes inmicroglia-enriched cultures andeven ber of microglia in astrocyte-enriched cultures. Pres- taminating oligodendrocytes also could not be ruled totoxicity assay ionof adultporcinemicrogliawithbothLPSandporcine ted in microglia supernatants with significant toxicity manSH-SY5Yneuroblastomacells (Fig. 3A). Stimulation with either LPS or IFN- alone, followed by the transfer cell-free supernatants to SH-SY5Yneuroblastomacells, only moderate level of toxicity towards neuronal cells. hen microglia stimulation was achieved with a combi- S and IFN-, only 38% of neuronal cells remained viable 248 V.A. Ionescu et al. / Brain Research Bulletin 84 (2011) 244–251 Fig. 3. Cell-fr cultures are t microglia (A) a porcine IFN- removed and plated 24h ea assay. Cultures Randomized b *P<0.05 signifi from unstimul following in microglia. We also showed sig lastoma cel cytotoxicity toxicity tow of LPS and stimulation We con live/dead fl a blinded fa supernatan had only a ronal viabil exposed to (data obtain in the total was much s ulated astro compared t Max=94; M Student’s t- indicate tha the culture was at leas Nonetheles cell prolifer Due to ity could be glial cell su studied the SH-SY5Y ce PS an itrite l rcine .1g/ tants from was u lated chang cubation, neither LPS nor IFN- at the concentrations used ulate glial cells caused reduction of SH-SY5Y cell viabilityee supernatants from stimulated porcine microglia and astrocyte oxic towards human neuroblastoma SH-SY5Y cells. Adult porcine nd astrocyte (B) cultures were stimulated by LPS (0.5g/ml) and/or (0.1g/ml) for 48h. Subsequently, cell-free supernatants were transferred to SH-SY5Y neuroblastoma cell cultures that had been rlier. Neuronal cell viability was measured 72h later by the MTT prepared fromseven (A) andfive (B) different animalswere analysed. locks design ANOVA was used to calculate F and P values; **P<0.01, cantlydifferent fromcell viability in cultures exposed to supernatants ated cells, Dunnett’s post-hoc test. cubation with supernatants from stimulated porcine demonstrated that stimulated porcine astrocytes nificant toxicity towards the human SH-SY5Y neurob- Fig. 4. L while n Adult po IFN- (0 superna prepared ANOVA unstimu nificant (B). 72h in to stimls (Fig. 3B). IFN- alone induced adult porcine astrocyte , while LPS alone failed to cause detectable levels of ards the neuronal cells. Furthermore, the combination IFN- caused the toxicity similar to that observed by of astrocytes with IFN- alone. firmed observations with porcine astrocytes using uorescent dye assay. Counting of the SH-SY5Y cells in shion revealed that cultures that had been exposed to ts from LPS and IFN--stimulated astrocytes for 72h small, but statistically significant reduction of neu- ity to 72.5±0.7%. The corresponding value in cultures supernatants from unstimulated cells was 89.1±1.0% ed from 4 independent experiments). The reduction number of SH-SY5Y cells (live +dead) per field of view maller in samples exposed to supernatants from stim- cytes (54.7±5.1 cells/field of view;Max=68;Min=46) o unstimulated cells (56.8±14.5 cells/field of view; in =38). This difference was not significant (P=0.55, test,N=8 slides for each condition). These observations t the decreases in MTT signal and percent live cells in s exposed to supernatants from stimulated astrocytes t partially due to the induction of SH-SY5Y cell death. s, possible effects of astrocyte supernatants on SH-SY5Y ation rate cannot be completely ruled out. the possibility that the observed SH-SY5Y cell toxic- caused by either LPS or IFN- present in stimulated pernatants that were transferred to neuronal cells, we direct effects of these proinflammatory mediators on ll viability. According to the MTT assay performed after (data not sh 3.3. Secreti Fig. 4A experiment detectable was statist LPS and IFN stimulus an was observ lated unde response d ulation of th TNF- conc cultures pre not shown) Measure that neithe four differe tissues resp nitric oxide 4. Discussi We tried been descri tal porcine extraction td IFN- treatment induces secretion of TNF- by porcine microglia, evels under the same experimental conditions remain unchanged. microglia cultures were stimulated by LPS (0.5g/ml) and/or porcine ml) for 48h. TNF- (A) and nitrite (B) concentrations in the cell-free were measured by ELISA and Griess reagents respectively. Cultures three different animals were analysed. Randomized blocks design sed to calculate F and P values; **P<0.01, significantly different from microglia samples, Dunnett’s post-hoc test (A). No statistically sig- es in nitrite levels were detected according to the Student’s t-testown). on of TNF-˛ and nitrite demonstrates that adult porcine microglia under the al conditions causing their cytotoxic response secrete levels of TNF-. The increase in TNF- concentration ically significant when LPS alone or a combination of -wereused as stimuli. IFN- alonewas amuchweaker d no statistically significant increase in TNF- secretion ed in these samples. Adult porcine astrocytes stimu- r the experimental conditions causing their cytotoxic id not respond with increased TNF- secretion. Stim- ese cells with 0.1g/ml IFN- for 48h did not increase entration in astrocyte-enriched culture supernatants; pared from four different animals were analysed (data . ment of nitrite levels in cell-free supernatants showed r microglia (Fig. 4B) nor astrocytes (data obtained from nt animals are not shown) prepared from adult porcine onded to LPS and IFN- stimulation with increased (NO) production. on several different cell extraction techniques that have bed in the literature thus far for preparation of neona- and adult human astrocyte and microglia cultures. The echnique that yielded the best results for adult pig glial V.A. Ionescu et al. / Brain Research Bulletin 84 (2011) 244–251 249 culture preparation is described in Section 2 and represents amod- ified version of the previously described procedures reported for isolation of glia from new-born pigs [22,50] and adult human tis- sues [26,29,30]. We achieved the best results by first preparing mixed glial erate a mo attached on purified mi to dislodge preparation used to pre Unlike neon be harveste adult porci on average each mixed four times not dividin We have p pared from (unpublishe laboratories also unable ential adhe orwithout t commonly from post-m brains [17,2 from all ot when trans ued passag cultures. We also A number rodent micr ious tissues porcine mic porcine IFN cell death ( IFN- alone ronal cells. observation response of gical sampl Recently MG cells st that they d very simila responded LPS alone t caused con tomicroglia mental data that adult p tion in a ma the resultin lower when cyte experi observed [4 Studies microglia a expressed f IFN--R on orescence t porcine gli which caus had no effect on this parameter in astrocytes (Fig. 3). It has been established that LPS initiates its biological activities through a het- eromeric receptor complex containing CD14, Toll-like receptor 4 (TLR4), and at least one other protein, MD-2 [10]. Since cultured e mic g. 2) uld s red t [24 tream ial ce path umb lial n inic a opro and ure ,51] les b con rcin ng T TNF- com d no refor uroto ell cu vene lia c oden ed lo with tes a wer pern indic lture orci our lia, w ditio emon emic ed se uced trocy d wi thus en sh stud and te t eviou ,29]. relea , app le, LP natio spe ed fr and ber o roxy [4,27cell cultures, which were expanded in vitro to gen- nolayer of astrocytes with microglia growing loosely top of the adherent astrocytes (Fig. 1A). Subsequently, croglia cultures were prepared by shaking the plates the loosely adherent microglia cells. This method of of microglia cell cultures is similar to the procedures pare neonatal rodent [17] and porcine [50] microglia. atal rodent microglia, which divide and therefore can d from mixed glial cultures for several weeks [15], ne microglia had only limited capacity to proliferate; , we were able to harvest microglia only twice from glial cell culture. The third shaking generated at least less cells;therefore, adult porcine microglia cells were g effectively under our in vitro cell culture conditions. reviously observed that adult human microglia pre- surgical and post-mortem specimens do not proliferate d observations), which has also been reported by other studying adult human microglia [32,36,52]. We were to achieve a good yield of microglia cells using differ- sion properties of microglia and astrocytes either with he use of Percoll gradients. These techniques have been used to prepare adult human microglia cultures either ortem or surgical specimens as well as from rodent 6,37]. Adult porcine astrocytes, similar to this cell type her species studied thus far, were actively dividing ferred to in vitro cell culture environment. With contin- ing we were able to achieve highly enriched astrocyte performed functional assays to assess the porcine glia. of studies have reported that stimulated human and oglia become toxic to neuronal cells derived from var- (reviewed in [28,51]). Our study confirmed that adult roglia, when stimulated with a combination of LPS and -, effectively induced human SH-SY5Y neuroblastoma Fig. 3A). Stimulation of porcine microglia with LPS or resulted in modest levels of toxicity towards neu- These data are very similar to our previously published s where LPS and IFN-were used to induce neurotoxic human microglia derived from post-mortem and sur- es [26,29]. it was reported that human adult astrocytes andU-373 imulated by IFN- become toxic to neuronal cells and o not respond to LPS stimulation [20]. We observed a r trend with cultured adult porcine astrocytes, which to IFN- stimulation by secreting neurotoxins while reatment was ineffective (Fig. 3B). Porcine astrocytes siderably lower levels of SH-SY5Y cell death compared according to theMTT assay. Comparison of our experi- with previously published observations demonstrated orcine glial cells responded to LPS and IFN- stimula- nner similar to their human counterparts, even though g toxicity levels (15–60% cell death) were considerably compared to human and rodent microglia or astro- ments, in which up to 90% neuronal cell death could be ,20,26,31,35,53]. on porcine glial cell neurotoxicity indicated that both nd astrocytes obtained from adult porcine tissues unctional IFN--R. We confirmed the expression of the both microglia and astrocytes by double immunoflu- echnique (Fig. 1). It was also apparent that the two al cell types responded differently to LPS treatment, ed significant upregulation of microglia toxicity, but porcin (see Fi tion co compa human downs two gl kinase A n sible g quinol metall ing NO a mixt see [28 molecu culture that po secreti tionof cells in also di . The glia ne  in c effecti microg using r report ulated astrocy We ture su which cell cu adult p ilar to microg tal con [22] d porcin increas ily ind and as respon tions; has be Our by LPS astrocy our pr [20,26 as the toxins examp combi oxygen prepar by LPS a num NO, pe toxinsroglia and astrocytes expressed similar levels of CD14 , the inability of astrocytes to respond to LPS stimula- tem from lower levels of TLR4 expression in astrocytes o microglia, which has already been reported for adult ] and murine [7] astrocytes. Differences existing in signaling engaged by the LPS receptor complex in the ll types, such as p38 mitogen-activated protein (MAP) way [33], also cannot be ruled out. er of different substances have been suggested as pos- eurotoxins. They include TNF-, glutamate, l-cysteine, cid, tissue plasminogen activator, cathepsin B, matrix teases, reactive oxygen and nitrogen species includ- peroxynitrite (ONOO−); glial cells may also release of toxins in response to specific stimuli (for reviews ). Here we studied secretion of two of these candidate y adult porcine microglia and astrocytes under the cell ditions causing their cytotoxic response. We showed e microglia responded to stimulation by LPS alone by NF-. IFN- on its own did not cause significant secre- , but ithadasynergistic effectwhenadded tomicroglia bination with LPS (Fig. 4A). Adult porcine astrocytes t respond to IFN- alone treatment by secreting TNF- e, under our experimental conditions, the adult porcine xic responses did not correlate with the levels of TNF- lture supernatants. The ineffectiveness of IFN- and ss of LPS alone to induce TNF- secretion in porcine ells is consistent with the previously published reports t glial cells [9]. Interestingly, Lafortune et al. [30] have w levels of TNF-mRNA inadult humanastrocytes stim- LPS and IFN- compared to stimulated fetal human nd adult human microglia. e unable to detect increased nitrite levels in cell cul- atants from either stimulated microglia or astrocytes, ated that the neuronal cell death observed under our conditions was not mediated by NO. The inability of ne glial cells to secrete detectable levels of NO is sim- previously published observations with human adult hich did not produce NO under the same experimen- ns that were used in the current study [26]. Hu et al. strated earlier that, similar to human cells, neonatal roglia did not respond to LPS and IFN- treatment with cretionofNO.Nitric oxidehasbeen reported tobe read- by these inflammatory mediators in rodent microglia tes [4,9,19,21]. It is possible that porcine glial cells may th NO production under different stimulatory condi- a combination of interleukin (IL)-1, TNF- and IFN- own to induce NOproduction in human astrocytes [23]. y shows that adult porcinemicroglia toxicity is induced IFN-, while only IFN- was able to trigger porcine oxicity. This activation pattern was consistent with s studies on adult human microglia and astrocytes However, the induction of glial neurotoxicity, as well se of various pro-inflammatory mediators and neuro- ears to be both species and stimulus dependent. For S alone inducedTNF-, IL-1 and IL-6 secretion,while a nof LPS and IFN-was required for inductionof reactive cies and neurotoxicity in both astrocytes and microglia omnewbornmice [39].Microglia neurotoxicity induced IFN- is well documented and has been attributed to f toxic species including superoxide anion, glutamate, nitrite, proteases, TNF- and a combination of different ,43,53]. 250 V.A. Ionescu et al. / Brain Research Bulletin 84 (2011) 244–251 Astrocyte-induced neurotoxicity has been less studied. Two reports have demonstrated that human fetal astrocytes stimulated by a combination of IFN- and IL-1 become neurotoxic [8,13]; application of specific inhibitors revealed involvement of TNF- andNOasm ment of glu that a mixt astrocyte ne Due to t tant to esta study mech medicines. teristics tha previous re microglia b NO product that porcine could be ind ilar to prev cells. Use of mechanism eases since been docum human [30] of tissues is and the fact obtain such adult porcin neuroprote Conflict of The auth Acknowled This wo and Enginee and Family the Pacific of Inland P the porcine discussions J. Powell for The stud collection, a manuscript References [1] D.D. Alle Caviedes, Drug Dev [2] M. Arcisz death in 1661–166 [3] J. Auwerx study of m [4] A. Bal-Pri oxide fro release an [5] K. Barnes tidyl pept Neurosci. [6] M.L. Bloc the molec [7] C.C. Bowm toll-like r [8] C.C. Chao stimulate Glia 3 (19 [9] S.H. Choi, D.H. Choi, K.S. Song, K.H. Shin, B.G. Chun, Zaprinast, an inhibitor of cGMP-selective phosphodiesterases, enhances the secretion of TNF-alpha and IL-1beta and the expressionof iNOS andMHCclass IImolecules in ratmicroglial cells, J. Neurosci. Res. 3 (2002) 411–421. [10] J. da Silva Correia, K. Soldau, U. Christen, P.S. Tobias, R.J. Ulevitch, Lipopolysac- ride is plex. 29–2 . Deli od–br l. Neu . Doo oc. M Down okine- tor-alp ilipov an fe . Flod tures r . Gao lled in –365 Giulia elopin . Glass g infl uo, N ivation nal. 5– ashio otoxic ng 12 . Helle ompa roglia P, J. N Hu, C okine unop u, W. uman . Jack, Antel astro . Jelia ture m 98. leger -1 ce ng 5 ( leger aguir AC an rotox leger er ant r. Alzh leger ards n AIDs) afortu F alph with –521 Le, D. amin rosci . Lee, W an fe . Lee, J in hu 00) 87 . Lip epelm roglia –211 iu, L. Q amin ibition Lue, L rap 96) 42 Lue, D easew –956ediators of astrocytic toxicity, aswell aspartial involve- tamate and reactive oxygen species, which indicated ure of several toxins was responsible for human fetal urotoxicity. he limited availability of human tissues, it is impor- blish alternative model systems that could be used to anisms of human diseases and to search for effective The porcine immune system has a number of charac- t makes it similar to human [44]. Furthermore, in a port Hu et al. [22] demonstrated that new-born porcine ehave similar to human cells in terms of cytokine and ion. Here we extended these observations by showing microglia and astrocytes prepared from adult animals uced to secrete neurotoxins in a manner that was sim- iously published observations with adult human glial adult cells could be advantageous for studies aimed at s of aging and age-associated neurodegenerative dis- age-dependent differences in glial cell physiology have ented for murinemicroglia [47], as well as rat [40] and astrocytes. Another advantage for choosing this source availability of adult porcine tissues in most countries, that there is no need for costly animal care facilities to tissues. Therefore, the described method of culturing e glial cells could be a useful tool for neuroscience and ctive drug discovery programs. interest ors declare that there are no conflicts of interest. gements rk was supported by grants from the Natural Sciences ring Research Council of Canada (A.K.), the Jack Brown Alzheimer’s Disease Research Foundation (A.K.) and Alzheimer Research Foundation (S.H.). We thank staff ackers and Mr. Richard Yntema for providing us with tissues. We also thank Dr. Douglas Walker for helpful on glial cell purification techniques and J. Madeira and technical assistance. y sponsors had no involvement in the study design; nalysis and interpretation of data; the writing of the ; the decision to submit themanuscript for publication. n, R. Caviedes, A.M. Cardenas, T. Shimahara, J. Segura-Aguilar, P.A. Cell lines as in vitro models for drug screening and toxicity studies, . Ind. Pharm. 8 (2005) 757–768. ewski, S. Pierzynowski, E. Ekblad, Lipopolysaccharide induces cell cultured porcine myenteric neurons, Digest. Dis. Sci. 9 (2005) 8. , The human leukemia cell line, THP-1: a multifacetted model for the onocyte–macrophage differentiation, Experientia 1 (1991) 22–31. ce, G.C. Brown, Inflammatory neurodegeneration mediated by nitric m activated glia-inhibiting neuronal respiration, causing glutamate d excitotoxicity, J. Neurosci. 17 (2001) 6480–6491. , A.J. Kenny, A.J. Turner, Localization of aminopeptidase N and dipep- idase IV in pig striatum and in neuronal and glial cell cultures, Eur. J. 4 (1994) 531–537. k, L. Zecca, J.S. Hong, Microglia-mediated neurotoxicity: uncovering ular mechanisms, Nat. Rev. Neurosci. 1 (2007) 57–69. an, A. Rasley, S.L. Tranguch, I. Marriott, Cultured astrocytes express eceptors for bacterial products, Glia 3 (2003) 281–291. , S. Hu, W.S. Sheng, D. Bu, M.I. Bukrinsky, P.K. Peterson, Cytokine- d astrocytes damage human neurons via a nitric oxide mechanism, 96) 276–284. cha com 211 [11] M.A blo Mo [12] M.D R. S [13] M. cyt fac [14] R. F hum [15] A.M cul [16] H.M tro 357 [17] D. dev [18] C.K lyin [19] G. G act Sig [20] S. H cyt Agi [21] R.P toc mic cAM [22] S. Cyt Imm [23] S. H of h [24] C.S J.P. and [25] V.V cul 91– [26] A. K THP Agi [27] A. K J. M SIL neu [28] A. K oth Cur [29] A. K tow (NS [30] L. L (TN son 515 [31] W. dop Neu [32] S.C hum [33] Y.B tion (20 [34] M.M Ho mic 208 [35] Y. L dop inh [36] L.F. from (19 [37] L.F. dis 945in close proximity to each of the proteins in its membrane receptor Transfer from CD14 to TLR4 and MD-2, J. Biol. Chem. 24 (2001) 1135. , C.S. Abraham, Y. Kataoka, M. Niwa, Permeability studies on in vitro ain barrier models: physiology, pathology, and pharmacology, Cell. robiol. 1 (2005) 59–127. ldeniya, A.N. Warrens, Xenotransplantation: where are we today? J. ed. 3 (2003) 111–117. en, T.D. Amaral, L.L. Hua, M.L. Zhao, S.C. Lee, Neuronal death in activated primary human brain cell culture: role of tumor necrosis ha, Glia 2 (1999) 114–127. ic, N. Zecevic, Neuroprotective role of minocycline in co-cultures of tal neurons and microglia, Exp. Neurol. 1 (2008) 41–51. en, C.K. Combs,Microglia repetitively isolated from in vitromixed glial etain their initial phenotype, J. Neurosci. Methods 2 (2007) 218–224. , J.S. Hong, Why neurodegenerative diseases are progressive: uncon- flammation drives disease progression, Trends Immunol. 8 (2008) . n, T.J. Baker, Characterization of ameboid microglia isolated from g mammalian brain, J. Neurosci. 8 (1986) 2163–2178. , K. Saijo, B. Winner, M.C. Marchetto, F.H. Gage, Mechanisms under- ammation in neurodegeneration, Cell 6 (2010) 918–934. .R. Bhat, Hypoxia/reoxygenation differentially modulates NF-kappaB and iNOS expression in astrocytes and microglia, Antioxid. Redox 6 (2006) 911–918. ka, A. Klegeris, C. Schwab, P.L. McGeer, Interferon-gamma-dependent activation of human astrocytes and astrocytoma cells, Neurobiol. (2009) 1924–1935. ndall, J.P. Ting, Differential regulation of cytokine-induced major his- tibility complex class II expression and nitric oxide release in rat and astrocytes by effectors of tyrosine kinase, protein kinase C, and euroimmunol. 1–2 (1997) 19–29. .C. Chao, K.V. Khanna, G. Gekker, P.K. Peterson, T.W. Molitor, and free radical production by porcine microglia, Clin. Immunol. athol. 1 (1996) 93–96. S. Sheng, P.K. Peterson, C.C. Chao, Differential regulation by cytokines astrocyte nitric oxide production, Glia 4 (1995) 491–494. N. Arbour, J. Manusow, V. Montgrain, M. Blain, E. McCrea, A. Shapiro, , TLR signaling tailors innate immune responses in human microglia cytes, J. Immunol. 7 (2005) 4320–4330. zkova-Mecheva, D.J. Bobilya, A porcine astrocyte/endothelial cell co- odel of the blood–brain barrier, Brain Res. Brain Res. Protoc. 2 (2003) is, C.J. Bissonnette, P.L. McGeer, Modulation of human microglia and ll toxicity by cytokines endogenous to the nervous system, Neurobiol. 2005) 673–682. is, J. Li, T.K. Bammler, J. Jin, D. Zhu, D.T. Kashima, S. Pan, S. Hashioka, e, P.L. McGeer, J. Zhang, Prolyl endopeptidase is revealed following alysis to be a novel mediator of human microglial and THP-1 cell icity, Glia 6 (2008) 675–685. is, P.L. McGeer, Non-steroidal anti-inflammatory drugs (NSAIDs) and i-inflammatory agents in the treatment of neurodegenerative disease, eimer Res. 3 (2005) 355–365. is, D.G. Walker, P.L. McGeer, Toxicity of human THP-1monocytic cells euron-like cells is reduced by non-steroidal anti-inflammatory drugs , Neuropharmacology 7 (1999) 1017–1025. ne, J. Nalbantoglu, J.P. Antel, Expression of tumor necrosis factor alpha a) and interleukin 6 (IL-6)mRNA in adult human astrocytes: compari- adultmicroglia and fetal astrocytes, J.Neuropath. Exp.Neurol. 5 (1996) . Rowe, W. Xie, I. Ortiz, Y. He, S.H. Appel, Microglial activation and ergic cell injury: an in vitro model relevant to Parkinson’s disease, J. . 21 (2001) 8447–8455. . Liu, C.F. Brosnan, D.W. Dickson, GM-CSF promotes proliferation of tal and adult microglia in primary cultures, Glia 4 (1994) 309–318. .W. Schrader, S.U. Kim, p38 Map kinase regulates TNF-alpha produc- man astrocytes and microglia by multiple mechanisms, Cytokine 7 4–880. ovsky, G. Gekker, W.R. Anderson, T.W. Molitor, P.K. Peterson, A.I. an, Phagocytosis of nonopsonized Cryptococcus neoformans by swine involves CD14 receptors, Clin. Immunol. Immunopathol. 2 (1997) . in, G. Li,W. Zhang, L. An, B. Liu, J.S. Hong, Dextromethorphan protects ergic neurons against inflammation-mediated degeneration through of microglial activation, J. Pharmacol. Exp. Ther. 1 (2003) 212–218. . Brachova, D.G. Walker, J. Rogers, Characterization of glial cultures id autopsies of Alzheimer’s and control patients, Neurobiol. Aging 3 1–429. .G. Walker, J. Rogers, Modeling microglial activation in Alzheimer’s ith humanpostmortemmicroglial cultures, Neurobiol. Aging6 (2001) . V.A. Ionescu et al. / Brain Research Bulletin 84 (2011) 244–251 251 [38] B.T. Metzger, D.M. Barnes, J.D. Reed, Purple carrot (Daucus carota L.) poly- acetylenes decrease lipopolysaccharide-induced expression of inflammatory proteins in macrophage and endothelial cells, J. Agric. Food. Chem. 10 (2008) 3554–3560. [39] T.Mizuno, R. Kuno, A. Nitta, T. Nabeshima, G. Zhang, J. Kawanokuchi, J.Wang, S. Jin, H. Takeuchi, A. Suzumura, Protective effects of nicergoline against neuronal cell death induced by activatedmicroglia and astrocytes, Brain Res. 1–2 (2005) 78–85. [40] T. Nakagawa, J.P. Schwartz, Gene expression patterns in in vivo normal adult astrocytes comparedwith cultured neonatal and normal adult astrocytes, Neu- rochem. Int. 2–3 (2004) 203–242. [41] P.K. Peterson, G. Gekker, S. Hu, W.B. Anderson, M. Teichert, C.C. Chao, T.W. Molitor, Multinucleated giant cell formation of swine microglia induced by Mycobacterium bovis, J. Infect. Dis. 5 (1996) 1194– 1201. [42] C. Pilon, F. Meurens, A. Dauba, H. Salmon, F. Velge-Roussel, Y. Lebranchu, C. Baron, Induction of porcine regulatory cells bymycophenolic acid-treated den- dritic cells, Transplant Proc. 2 (2009) 700–702. [43] L. Qin, Y. Liu, T. Wang, S.J. Wei, M.L. Block, B. Wilson, B. Liu, J.S. Hong, NADPH oxidasemediates lipopolysaccharide-inducedneurotoxicity andproinflamma- tory gene expression in activated microglia, J. Biol. Chem. 2 (2004) 1415– 1421. [44] H.J. Rothkotter, E. Sowa,R. Pabst, Thepigasamodelofdevelopmental immunol- ogy, Human Exp. Toxicol. 9–10 (2002) 533–536. [45] K. Sak, P. Illes, Neuronal and glial cell lines as model systems for studying P2Y receptor pharmacology, Neurochem. Int. 6 (2005) 401–412. [46] A.B. Salmina, Neuron–glia interactions as therapeutic targets in neurodegen- eration, J. Alzheimer Dis. 3 (2009) 485–502. [47] M. Sawada, H. Sawada, T. Nagatsu, Effects of aging on neuroprotective and neu- rotoxic properties of microglia in neurodegenerative diseases, Neurodegener. Dis. 3–4 (2008) 254–256. [48] G. Sowa, G. Gekker, M.M. Lipovsky, S. Hu, C.C. Chao, T.W. Molitor, P.K. Peter- son, Inhibitionof swinemicroglial cell phagocytosis ofCryptococcus neoformans by femtomolar concentrations of morphine, Biochem. Pharmacol. 6 (1997) 823–828. [49] B.R. Tambuyzer, I. Lambrichts, M. Lenjou, E.J. Nouwen, Effects of the pig renal epithelial cell line LLC-PK1 and its conditioned medium on the phenotype of porcine microglia in vitro, Eur. J. Cell Biol. 4 (2007) 221–232. [50] B.R. Tambuyzer, E.J. Nouwen, Inhibition of microglia multinucleated giant cell formation and induction of differentiation by GM-CSF using a porcine in vitro model, Cytokine 4 (2005) 270–279. [51] L. Walter, H. Neumann, Role of microglia in neuronal degeneration and regen- eration, Semin. Immunopathol. 4 (2009) 513–525. [52] K. Williams, A. Bar-Or, E. Ulvestad, A. Olivier, J.P. Antel, V.W. Yong, Biology of adult human microglia in culture: comparisons with peripheral blood mono- cytes and astrocytes, J. Neuropathol. Exp. Neurol. 5 (1992) 538–549. [53] Z. Xie, M. Wei, T.E. Morgan, P. Fabrizio, D. Han, C.E. Finch, V.D. Longo, Peroxynitrite mediates neurotoxicity of amyloid beta-peptide1-42- and lipopolysaccharide-activated microglia, J. Neurosci. 9 (2002) 3484–3492. [54] P. Yang, L. Chen, R. Zwart, A. Kijlstra, Immune cells in the porcine retina: distri- bution, characterization and morphological features, Invest. Ophthalmol. Vis. Sci. 5 (2002) 1488–1492.

Cite

Citation Scheme:

    

Usage Statistics

Country Views Downloads
United States 10 2
China 8 21
Germany 6 18
Russia 1 0
City Views Downloads
Ashburn 9 0
Beijing 8 0
Unknown 7 18
Sunnyvale 1 0

{[{ mDataHeader[type] }]} {[{ month[type] }]} {[{ tData[type] }]}

Share

Share to:

Comment

Related Items