Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Molecular genetic analysis of seed coat mucilage mutants of arabidopsis thaliana Huang, Jun 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2011_spring_huang_jun.pdf [ 2.2MB ]
Metadata
JSON: 24-1.0071669.json
JSON-LD: 24-1.0071669-ld.json
RDF/XML (Pretty): 24-1.0071669-rdf.xml
RDF/JSON: 24-1.0071669-rdf.json
Turtle: 24-1.0071669-turtle.txt
N-Triples: 24-1.0071669-rdf-ntriples.txt
Original Record: 24-1.0071669-source.json
Full Text
24-1.0071669-fulltext.txt
Citation
24-1.0071669.ris

Full Text

Molecular Genetic Analysis of Seed Coat Mucilage Mutants of Arabidopsis thaliana by  Jun Huang  M.Sc., China Agricultural University, China, 2002  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Botany)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  March 2011  © Jun Huang, 2011  ABSTRACT  During differentiation, the Arabidopsis seed coat epidermal cells produce copious amounts of mucilage that is extruded from the seed coat upon imbibition. Mucilage is composed primarily of pectin, a polysaccharide that is a main component of the cell wall. For this reason, the Arabidopsis seed coat is a good system for studying the biosynthesis, secretion and modification of pectin. Mutants with mucilage defects can be used to identify genes involved in the production of pectin. Mucilage-Modified mutants, including mum1, mum2 and mum4, were identified using screens of EMS mutagenized plants. Both mum1 and mum2 lack the ability to release the mucilage when mature seeds are imbibed. MUM2 encodes a β-galactosidase that modifies the mucilage structure in the apoplast. I have cloned the MUM1 gene and shown it to encode a putative transcription factor LEUNIG_HOMOLOG (LUH). Cellular localization and transcriptional assay results suggest that LUH/MUM1 is a nuclear-localized, transcriptional activator. LUH/MUM1 is expressed in all the tissues examined including the seed coat. qRT PCR data suggest that LUH/MUM1 is expressed throughout seed coat development, reaching peak expression late in differentiation. MUM2 expression in the luh/mum1 mutant was reduced dramatically, relative to that of wild type. Over-expression of MUM2 could partially rescue the mum1 phenotype. These data suggest that LUH/MUM1 is a positive regulator of MUM2. qRT PCR data revealed a similar expression level of LUH/MUM1 in wild type compared to plants homozygous for mutations in several genes encoding regulators of seed coat mucilage, namely APETALA2, TRANSPARENT TESTA ii  GLABRA1 (TTG1), TTG2 and GLABRA2. Thus the LUH/MUM1-MUM2 regulatory pathway appears to be independent of other transcription factors known to regulate aspects of seed coat mucilage biology. Mutations in the MUM4 gene result in seeds that release little mucilage. A mum4 mutant was mutagenized and resulting M2 progeny screened for modifier mutants. Ten enhancers (mum4 enhancer (men)) and ten suppressors (mum4 suppressors (msu)) mutants were isolated and partially characterized genetically and phenotypically. Further studies are needed to characterize these mutants.  iii  TABLE OF CONTENTS ABSTRACT ................................................................................................................................................ iiii TABLE OF CONTENTS ............................................................................................................................ iv LIST OF TABLES...................................................................................................................................... vii LIST OF FIGURES................................................................................................................................... viii LIST OF ABBREVIATIONS ...................................................................................................................... x ACKNOWLEDGEMENTS ...................................................................................................................... xiii  1  GENERAL INTRODUCTION ........................................................................................................... 1  1.1  PECTIN IN PLANT CELL WALLS ............................................................................................. 1  1.1.1 1.1.2 1.1.3 1.2  SEED COAT IN ARABIDOPSIS ................................................................................................. 10  1.2.1 1.2.2 1.2.3 1.3  1.4  SEED COAT DEVELOPMENT MUTANTS .......................................................................................... 17 MUCILAGE BIOSYNTHESIS MUTANTS ........................................................................................... 20 MUTANTS AFFECTING THE REGULATION OF MUCILAGE BIOSYNTHESIS ........................................ 20 HORMONE-ASSOCIATED MUCILAGE MUANTS ............................................................................... 25 MUCILAGE ADHESION MUTANTS .................................................................................................. 25 THE MUM4 MUTANT ..................................................................................................................... 26 MUTANTS EFFECTING PECTIN MODIFICATION ............................................................. 28  1.4.1 1.4.2  2  DEVELOPMENT OF THE SEED COAT .............................................................................................. 11 SEED COAT MUCILAGE SECRETION ............................................................................................... 14 SEED COAT MUCILAGE COMPOSITION........................................................................................... 15 GENETIC ANALYSIS OF SEED COAT MUCILAGE PRODUCTION................................ 17  1.3.1 1.3.2 1.3.3 1.3.4 1.3.5 1.3.6  1.5  PECTIN STRUCTURE ....................................................................................................................... 2 PECTIN BIOSYNTHESIS AND SECRETION ......................................................................................... 5 FUNCTIONS OF PECTIN ................................................................................................................... 8  THE PECTIN MODIFICATION MUTANTS.......................................................................................... 28 THE MUM1 MUTANT ..................................................................................................................... 30 THE THESIS OBJECTIVES ....................................................................................................... 31  METHODS ......................................................................................................................................... 32  2.1 PLANT MATERIAL AND GROWTH CONDITIONS .................................................................... 32 2.2 MICROSCOPY .................................................................................................................................... 33 2.3 POSITIONAL CLONING OF MUM1................................................................................................ 35 2.4 EXTRACTION OF SEED MUCILAGE ............................................................................................ 38 2.5 MONOSACCHARIDE AND LINKAGE ANALYSES ..................................................................... 39 2.6 RNA ISOLATION, RT-PCR AND QRT PCR .................................................................................. 40  iv  2.7 PROTOPLAST ISOLATION ............................................................................................................. 41 2.8 SUBCELLULAR LOCALIZATION OF MUM1 .............................................................................. 43 2.9 TRANSCRIPTIONAL ACTIVITY .................................................................................................... 44 2.10 SCREENING FOR MUM4-1 MODIFIERS ..................................................................................... 45 3  MUM1 PHENOTYPIC ANALYSIS AND CLONING OF THE MUM1 GENE .......................... 47  3.1 INTRODUCTION ................................................................................................................................ 47 3.2 RESULTS .............................................................................................................................................. 49 3.2.1 THE SEED COAT MUCILAGE PHENOTYPE OF MUM1 ............................................................................ 49 3.2.2 CHEMICAL ANALYSIS OF MUM1 MUCILAGE ...................................................................................... 55 3.2.3 POSITIONAL CLONING OF MUM1 ..................................................................................................... 61 3.2.4 MUM1 EXPRESSION PATTERN ......................................................................................................... 69 3.2.5 SUBCELLULAR LOCALIZATION OF MUM1 ........................................................................................ 72 3.2.6 THE TRANSCRIPTIONAL REGULATORY ACTIVITY OF LUH ................................................................ 72 3.3 DISCUSSION........................................................................................................................................ 74 3.3.1 LUH /MUM1 IS REQUIRED FOR NORMAL MUCILAGE STRUCTURE .................................................... 77 3.3.2 LUH /MUM1 ENCODES A PUTATIVE TRANSCRIPTION FACTOR ......................................................... 79 3.3.3 THE TEMPORAL AND SPATIAL EXPRESSION OF LUH ......................................................................... 80 4  THE REGULATORY ROLES OF LUH ......................................................................................... 82  4.1 INTRODUCTION ................................................................................................................................ 82 4.2 RESULTS .............................................................................................................................................. 83 4.2.1 THE REGULATION OF MUM2 BY MUM1 .......................................................................................... 83 4.2.2 LUH FUNCTIONS INDEPENDENTLY FROM OTHER MUCILAGE-RELATED TRANSCRIPTION FACTORS ... 86 4.3 DISCUSSION........................................................................................................................................ 88 4.3.1 LUH/MUM1 IS REQUIRED FOR ACTIVATION OF THE MUM2 GENE .................................................. 88 4.3.2 THE ROLE OF LUH IS INDEPENDENT OF OTHER TRANSCRIPTION FACTORS CONTROLLING SEED MUCILAGE BIOLOGY .................................................................................................................................. 89 5  GENETIC MODIFIERS OF MUM4 ............................................................................................... 92  5.1 INTRODUCTION ................................................................................................................................ 92 5.2 RESULTS .............................................................................................................................................. 93 5.2.1 SCREEN FOR THE MODIFIERS OF MUM4-1 .......................................................................................... 93 5.2.2 THE ENHANCERS OF MUM4-1 ............................................................................................................ 94 5.2.3 THE SUPPRESSORS OF MUM4-1 ....................................................................................................... 101 5.2.4 GENETIC SEGREGATION ANALYSIS OF MUM4 MODIFIER LINES ....................................................... 101 5.2.5 MEN10 .......................................................................................................................................... 108 5.3 DISCUSSION.......................................................................................................................................110 5.3.1 MUM4 IS A GOOD GENETIC BACKGROUND FOR SCREENING FOR NEW GENES AFFECTING MUCILAGE 110 5.3.2 FURTHER CHARACTERIZATION OF MODIFIER MUTANTS .................................................................. 112  v  6  CONCLUSIONS AND FUTURE DIRECTIONS ..........................................................................113  6.1 CLONING AND CHARACTERIZATION OF MUM1 ...................................................................113 6.2 SCREENING FOR MUM4 MODIFIERS .........................................................................................116 BIBLIOGRAPHY .....................................................................................................................................117  vi  LIST OF TABLES Table 1- 1 Seed coat mucilage mutants ......................................................................................... 18 Table 2- 1 The primers used for map-based cloning of MUM1 .................................................... 36 Table 2- 2 Sequencing primers of At2g32700............................................................................... 37 Table 2- 3 Primers for RT-PCR and qRT PCR ............................................................................. 42 Table 3- 1 Monosaccharide distribution in mole percentage of carboxyl-reduced mucilage polysaccharides from seeds successively extracted with water, 0.2 M NaOH, and 2.0 M NaOH 57 Table 3- 2 Comparison of linkage distribution in mucilage and other polymers extracted from seeds sequentially with water, 0.2 M NaOH, and 2.0 M NaOH.................................................... 58 Table 5- 1 The modifiers of mum4-1 ............................................................................................. 95 Table 5- 2 The F2 phenotypes of reciprocal crosses between men mum4-1 lines ......................... 97 Table 5- 3 The F2 phenotypes of modifiers crossed with some known mucilage mutants .......... 100 Table 5- 4 The F2 phenotypes of reciprocal crosses between msu mum4-1 lines ........................ 104 Table 5- 5 The F2 phenotypes of the modifiers backcrossed with mum4-1 ................................. 106 Table 5- 6 The F3 segregation ratios of the selected modifiers backcrossed with Col-2 or mum4-1 ..................................................................................................................................................... 107  vii  LIST OF FIGURES Figure 1- 1 Representative structures of common domains of pectin ............................................. 3 Figure 1- 2 The development of ovule integuments ...................................................................... 12 Figure 1- 3 Regulatory pathways of seed coat mucilage production............................................. 24 Figure 3- 1 Seed coat mucilage phenotypes of wild type, mum1-1 and mum2-1 .......................... 50 Figure 3- 2 Scanning electron microscopy of wild type and mum1 seeds..................................... 52 Figure 3- 3 Seed coat development of wild type and mum1.......................................................... 53 Figure 3- 4 Test for seed coat mucilage expansion ...................................................................... 544 Figure 3- 5 The relative uronic acid/fraction of wild type, mum1-1 and mum2-1 ........................ 566 Figure 3- 6 The positional cloning of MUM1................................................................................ 63 Figure 3- 7 LUH/MUM1 protein structure .................................................................................... 65 Figure 3- 8 The phenotype of the weak allele of luh-5/mum1-1 ................................................... 66 Figure 3- 9 Complementation test of MUM1 ................................................................................ 68 Figure 3- 10 The alignment of LUH and LUG proteins ................................................................ 70 Figure 3- 11 LUH expression analyses ......................................................................................... 71 Figure 3- 12 Subcellular localization of LUH ............................................................................... 73 Figure 3- 13 LUH transcriptional activation assay ........................................................................ 76 Figure 4- 1 Comparison of MUM2 seed coat expression in wild type and luh-5 .......................... 84 Figure 4- 2 The seed coat mucilage phenotype of the transgenic plant luh-5+35S:MUM2 .......... 85 Figure 4- 3 The comparison of LUH expression in wild type and mutants .................................. 87 Figure 4- 4 Proposed regulatory pathways for seed coat mucilage biosynthesis .......................... 90  viii  Figure 5- 1 The phenotypes of the mum4-1 enhancer mutants ...................................................... 96 Figure 5- 2 The phenotypes of the suppressors of mum4-1 ......................................................... 102 Figure 5- 3 The seed coat mucilage phenotype of men10 ........................................................... 109  ix  LIST OF ABBREVIATIONS 4-MU  4-methylumbelliferone  ABA1  ABSCISIC ACID1  ABRC  Arabidopsis Biological Resource Center  AG  AGAMOUS  AP  APETALA  ARAD1  ARABINAN DEFICIENT1  ATS  ABERRANT TESTA SHAPE  BLAST  Basic Local Alignment Search Tool  bp  base pair  CAPS  Cleaved Amplified Polymorphic Sequence  CAT  Chloramphenicol acetyltrasferase  CCRC  Complex Carbohydrate Research Center (Athens, GA)  cDNA  Complementary DNA  CIA  Chloroform:Isoamyl alcohol=24:1  Col  Columbia ecotype  DMSO  dimethyl sulfoxide  DNA  Deoxyribounucleic acid  DPA  Day Post Anthesis  EDTA  ethylene diamine tetraacetic acid, dissodium salt dihydrate  EGL3  ENHANCER OF GLABRA3  EIMS  electron impact mass spectrometry  EMS  ethylmethane sulfonate  FIL  FILAMENTOUS FLOWER  GA  gibberellic acid  GA3OX4  GIBBERELLINS 3-OXIDASE4  GalA  alpha-(1,4)-linked D-galactopyranosyluronic acid  GATL  GAUT-like  GAUT  GALACTURONOSYLTRANSFERASE  GD  Gal4 binding domain  GFP  Green fluorescent protein  GL  GALABRA  x  GLC  gas-liquid chromatography  HD-zip  homeodomain-leucine zipper  HG  homogalacturonan  KAN4  KANADI4  Ler  Landsberg erecta ecotype  LUG  LEUNIG  LUH  LEUNIG HOMOLOG  MEN  MUM4 ENHANCER  MMg  0.4 mM mannitol, 15 mM MgCl2, and 4 mM Mes, pH 5.7  MOR  MICROTUBLE ORGANIZING  MS  mass spectrometer  MS medium  Murashige and Skoog medium  MSU  MUM4 SUPPRESSOR  MT  methyltransferase  MUG  4-methylumbelliferyl-β-D-glucuronide  MUM  MUCILAGE-MODIFIED  NCBI  National Center for Biotechnology Information  NDP-sugars  Nucleoside diphosphate sugars  OSU1  OVERSENSITIVE TO SUGAR1  PA  proanthocyanidin  PCR  polymerase chain reaction  PEG  polyethylene glycol  PGM1  PHOSPHOGLUCOMUTASE1  PME  pectin methylesterase  Q  Glutamine  qRT-PCR  quantitative reverse transcriptase PCR  QUA  QUASIMODO  REB  25 mM Tris-HCl pH 8.0, 25 mM EDTA, 75 mM NaCl, 1% SDS  RG I  Rhamnogalacturonan I  RG II  Rhamnogalacturonan II  RGXT  RHAMNOGALACTURONAN XYLOSYLTRANSFERASE  RHM  RHAMNOSE BIOSYNTHESIS  RSW3  RADIAL SWELLING3  xi  RT-PCR  Reverse Transcriptional PCR  SBT1.7  SUBTILISIN-LIKE SERINE PROTEASE1.7; SUBTILASE1.7  SEM  scanning electron microscopy  SEU  SEUSS  SSDP  single-stranded DNA-binding protein  SSLP  simple sequence length polymorphism  TAIR  The Arabidopsis Information Resource  T-DNA  transfer DNA of Agrobacterium tumefaciens  TEM  Transmission electron microscopy  TFA  trifluoroacetic acid  TGN  trans-Golgi network  TSD2  TUMOROUS SHOOT DEVELOPMENT2  TT  TRANSPARENT TESTA  TTG  TRANSPARENT TESTA GLABRA  UASGal4  upstream activation sequence of Gal4 promoter  UDP  uridine diphosphate 154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 5 mM glucose, and 1.5 mM Mes,  W5  pH 5.7  WD40  Tryptophan -Aspartic acid dipeptide  WI  0.5 M mannitol, 20 mM KCl, and 4 mM Mes, pH 5.7  YAB  YABBY  xii  ACKNOWLEDGEMENTS  It is my pleasure to thank those who make this thesis possible. First of all, I would like to express my sincere gratitude to my academic supervisor, Dr. George Haughn. His enthusiasm, inspiration, thoughtful advice and encouragement made it possible for me to make progress on my projects during my Ph.D years. This thesis could not have been done without his help in writing. I also owe thanks to the academic committee, Drs. Ljerka Kunst, Lacey Samuels and Geoffrey Wasteneys, for their expertise and research insights. I am grateful to the staff at the University of British Columbia BioImaging facility for invaluable help with sample fixations and microscopy. I thank Dr. Shucai Wang for helping and sharing the plasmids for the transcriptional activity assay. I greatly appreciate the suggestions, discussion and assistance from the past and present members of the Haughn and Kunst labs. Finally, I wish to thank my friends and family. Special thank goes to my wife, Ying Chang, whose support was important for me to finish my work.  xiii  1 General Introduction 1.1 Pectin in plant cell walls  The wall is an important structure of plant cells. It determines the cell shape and size, which in turn affect plant morphology. It also has many biological functions including cell communication, counterbalance for osmotic pressure, and protection against pathogen invasion. In addition, the cell wall represents a large pool of terrestrial biomass and renewable energy since most carbon from photosynthesis is incorporated into cell wall polymers (Reiter, 2002). Cell wall polymers are used for biofuels (Pauly and Keegstra, 2010). The conventional model of the primary cell wall states that walls consist of three polysaccharide components, cellulose, hemicellulose and pectin, as well as structural and enzymatic proteins. The cell wall can be compared to reinforced concrete, in which cellulose and hemicellulose form the steel rod network embedded in a pectinaceous concrete (Emons and Mulder, 2000). The cellulose-hemicellulose network is considered as the major tension-bearing structure (Jarvis and McCann, 2000) while pectin, also found in the middle lamella, is responsible for porosity control, cell adhesion and defense signalling (Carpita and Gibeaut, 1993; Mohnen, 2008).  1  1.1.1 Pectin structure  There are three common domains in pectin: homogalacturonan (HG), rhamnogalacturonan I (RG I) and rhamnogalacturonan II (RG II). HG is a linear unbranched array of 1,4-linked α-D-galactosyluronic acid (GalA) typically in stretches of approximately 100 GalA residues (Figure 1-1; Zhan et al., 1998; Yapo et al., 2007). A high proportion of GalA residues of HG are typically methyl esterified at the C-6 carboxyl group (O'Neill et al., 2001). The backbone of RG I is a linear chain of 1, 2- α L-rhamnose-1, 4- α-D-galacturonic acid units. Unlike HG, RG I is branched. Polymeric 1,4- β –linked D-galactosyl and 1,5-α-linked L-arabinosyl residues form many of the side chains (Mohnen, 1999). Despite the name, RG II is structurally different from RG I. In fact, RG II shares the same backbone with HG but it has branches. The GalA residues are substituted with two structurally different oligoglycosyl side chains (side chains A and B Figure 1-1) and two structurally different disaccharide side chains (side chains C and D; Figure 1-1; Vidal et al., 2000; Glushka et al., 2003). RG II seems to be much less variable than RG I in structural diversity or modulation of its fine structure (Willats et al., 2001b) All three domains are believed to be linked covalently to form the matrix (Ridley et al., 2001; Willats et al., 2001c). Ishii and Matsunaga (2001) treated saponified pectin with endo- and exo-polygalacturonase. The dialysis of the mixture provided evidence that RG II is covalently linked to HG. Mass spectrometry analysis of the segments of HG and RG I with controlled acid hydrolysis indicates covalent linkage between the two. It is not  2  Figure 1-1 Representative structures of common domains of pectin The structures of HG, RGII and RGI backbone are given. HG is unbranched. RGII has the same side chains (side chains A-D) across species. RGI has varible side chains often comprised of arabinose and galactose (Mohnen, 2008). 3  clear whether RG I and RG II are covalently linked (Willats et al., 2001c; Coenen et al., 2007). It is now generally accepted that RG II can dimerize via 1:2 borate-diol diesters (Kobayashi et al., 1996). Dimerization involves a single borate diester cross link and the ester is formed between the apiosyl residue in side chain A of each monomer subunit (O'Neill et al., 1996; Ishii et al., 1999; O'Neill et al., 2001). The antiparallel HG chains can be cross-linked by Ca2+. The hydroxyl group (-OH) of the unesterified C-6 carboxyl group of GalA residues can form alkoxide (-O), two of which can cross-link with one Ca2+ to form part of a ‘junction zone’ (Rees, 1977; Jarvis, 1984). At low concentrations two chains are thought to form a stable junction with maximum strength from about 14 GalA residues up to the length of about 200 GalA residues (Carpita and Gibeaut, 1993; Kobayashi et al., 1999). If sufficient Ca2+ exists, more HG chains can be cross-linked to form larger aggregates (Morris et al., 1982). Once the carboxyl group is methyl esterified, the Ca2+-mediated linkage cannot be formed. Thus the methyl ester at C-6 can affect the gelling properties of pectin. Pectin is believed to be crosslinked to hemicellulosic xyloglucans and xylans as well (Nakamura et al., 2002; Duan et al., 2004; Popper and Fry, 2008). The side chains of pectin can bind to cellulose in vitro (Zykwinska et al., 2005).  4  1.1.2 Pectin biosynthesis and secretion  Information concerning pectin biosynthesis and secretion is still fragmentary. Autoradiography of isotope-labelled glucose demonstrated that pectin originated in the Golgi apparatus, and was transported in vesicles to the plasma membrane (Northcote and Pickett-Heaps, 1966). Moore et al. (1991) found that HG and RG I epitopes could be identified in both the cis and medial Golgi using immunogold labelling. So it is presumed that the biosynthesis of these pectins occurs in cis Golgi (Moore et al., 1991; Lynch and Staehelin, 1992), and continues into the medial Golgi (Moore et al., 1991). Pectin is believed to be transported as a highly methyl-esterified polymer to the apoplast via vesicles from the Golgi (Liners et al., 1994; Dupree and Sherrier, 1998). New evidence of seed coat mucilage pectin secretion will be discussed in section 1.2.2. Nucleoside diphosphate sugars (NDP-sugars) are thought to be the precursors of all carbohydrates in the cell wall (Goubet and Mohnen, 1999). All the NDP-sugars are derived from some central NDP-sugars, such as UDP-Glc and GDP-Man. 39 enzymes in 13 groups in Arabidopsis have been predicted or proven to be required for NDP-sugar interconversion  (Caffall  and  Mohnen,  2009),  including  RHAMNOSE  BIOSYNTHESIS1-3 (RHM1-3) hypothesized to convert UDP-D-Glc to UDP-L-Rha (Reiter and Vanzin, 2001). RHM2 is also known as MUM4, which will be discussed in section 1.3.6. The biosynthesis of pectin is thought to be complex, requiring at least 67 distinct biosynthetic glycosyl-, methyl-, or acetyl-transferase enzymes, assuming distinct enzymes are required for each different glucosyl linkage present among pectins (Mohnen, 5  2008). Much more research is required to understand this process since very few of these enzymes have been characterized. Glycosyl residues are transferred to growing polysaccharide chains through the action of various glycosyltransferases (Mohnen, 2008). Before any gene encoding a glycosyltransferase was identified, research on the biosynthesis of cell wall polysaccharides focused on the purification and characterization of the enzymatic properties of active glycosyltransferases (Gibeaut and Carpita, 1994). The first pectin biosynthetic enzyme identified both enzymatically and through cloning was the Arabidopsis protein GALACTURONOSYLTRANSFERASE1 (GalAT; GAUT1), with HG α-1,4-GalAT activity (Sterling et al., 2006). Another characterized member of 15 GAUT1-related family members is QUASIMODO1 (QUA1)/GAUT8 whose deficiency results in dwarfed plants, reduced cell adhesion and 25% reduction of GalA in leaves. These  data  suggest  that  QUA1  encodes  a  homogalacturonan  α-1-4-D-  galacturonosyltransferase activity that is reduced or absent in qua1-1 stems (Bouton et al., 2002; Orfila et al., 2005). At low humidity, the parvus mutant is semi-sterile dwarf with reduced anther dehiscence. PARVUS encodes a putative GAUT-like (GATL) enzyme, which may be responsible for the reduced branching of RG I and an increase in wall pectin (Lao et al., 2003; Brown et al., 2007). Most enzymes for biosynthesis of RG I have not been identified. ARABINAN DEFICIENT1 (ARAD1) encodes a putative arabinosyltransferase that is believed to form α-1,5-arabinan side chains on RG I (Harholt et al., 2006).  6  RHAMNOGALACTURONAN  XYLOSYLTRANSFERASE1  (RGXT1)  or  RGXT2 transfers xylose from UDP-α-D-Xylose onto fucose forming α-1,3-linkage, which is found in the side chain A of RG II (Egelund et al., 2006). Though no wall structural alteration was detected in rgxt1 or rgxt2 mutants, the RG II from either mutant can be used as an acceptor for D-[14C]-Xylose using either RGXT1 or RGXT2, while the counterpart of wild type cannot (Egelund et al., 2006). NpGUT1 encodes a putative glucuronyltransferase involved in RG II biosynthesis (Iwai et al., 2002). In addition to glycosyltransferases, methyltransferases are of upmost importance in pectin biosynthesis. Pectin methyltransferases (MT) add methyl groups to the C-6 carboxyl group, or acetyl groups at O-2 or O-3 of GalA residues (Caffall and Mohnen, 2009). The Golgi-localized protein QUASIMODO2 (QUA2)/ TUMOROUS SHOOT DEVELOPMENT2 (TSD2)/ OVERSENSITIVE TO SUGAR1 (OSU1) has a putative MT domain, though the catalytic activity is undetermined. The corresponding mutant shows dwarf, reduced cell adhesion and 50% of HG of wild type (Krupkova et al., 2007; Mouille et al., 2007; Gao et al., 2008). However the degree of methylesterification of HG in the mutant is unaltered. It is noteworthy to observe that QUA2 is co-transcribed with QUA1/GAUT8 (Mouille et al., 2007). In contrast, pectin methylesterase (PME) can catalyze the demethylesterification of HG to generate acidic pectin which can cross-link with Ca2+. Given the fact that 70-80% GalA residues of HG are methyl esterified at the C-6 carboxyl group (O'Neill et al., 1990), this kind of enzyme is very important for the formation of pectic gels.  7  1.1.3 Functions of pectin  Pectin is a multifunctional complex. It helps maintain the mechanical stability of the cell wall, is involved in cell growth and development, and provides a source of oligosaccharide signals. Given that antiparallel HG chains can be cross-linked by Ca2+, and RG II can dimerize with the help of borate, pectin is believed to play important roles in maintaining the rigidity of the cell wall. Further, since pectin occupies most of the middle lamella, it is thought to be responsible for the adhesion of cells. Several lines of evidence support the connection between cell-cell adhesion and pectin crosslinking. First, a T-DNA insertional mutant from Nicotiana plumbaginifolia, nolac-H18, has non-organogenic callus with loosely attached cells. The gene, cloned using T-DNA as a probe, was named NpGUT1, mentioned above. Examination of RG II from the mutant cells showed that it had less glucuronic acid which would be expected to dramatically reduce the formation of borate cross-linking. It was suggested that the loss of adhesion is the direct result of decrease in borate cross-linking (Iwai et al., 2002). Second, the mutant quasimodo, has a reduction in cell adhesion that is correlated with a 25% reduction in GalA (Bouton et al., 2002). Since QUA encodes a putative glycosyltransferase it is possible that the cell adhesion in the mutant is a consequence of a decrease in pectin biosynthesis. Pectin composition can change between cell types and in a given tissue, organ or cell type over time. For example, following the development of bean pods, Stolle-Smits et al. (1999) found that in young pods, exponentially growing cell walls contained large amounts of neutral-, pectic polymers (rhamnogalacturonan); in the elongating pods, more 8  galatose-rich pectic polymers were deposited into the cell wall, the level of branched rhamnogalacturonan remained constant, and the level of linear homogalacturonan steadily increased; in the mature pods, galactose-rich pectin was degraded, while the accumulation of soluble homogalacturonan continued; in the senescent pods, there was an increase in the amount of ionically complex pectin, mainly at the expense of freely soluble pectin. However, whether such changes in pectin composition are required for cell differentiation is unclear. Rhamnogalacturonan lyase from Aspergillus aculeatus can cleave the RG I backbone at specific sites. Transgenic potato tubers expressing the Aspergillus rhamnogalacturonan lyase gene have morphological alterations, including radial swelling of the periderm cells and the development of intercellular spaces in the cortex. Sugar composition analysis and immunocytochemical studies showed a large reduction of galactan and arabinan side chains of RG I. But the corresponding epitopes were mostly found in the expanded middle lamella at cell corners of tubers. So, RG I might be important in anchoring galactans and arabinans at particular regions in cell walls and in normal development of the periderm (Oomen et al., 2002). Considering its many roles in cell biology, development and physiology, understanding the biosynthesis and secretion of pectin is an important goal. The genetic analysis of mutants defective in cell wall pectin is an effective and, under-utilized approach to studying pectin biosynthesis. However, most such mutants are expected to be lethal making their isolation difficult.  9  1.2 Seed coat in Arabidopsis  Seed coats differentiate from cells of the ovule integuments and play important roles in dormancy, germination and longevity of seeds (Debeaujon et al., 2000). The seed coat contains several cell layers that are highly specialized. One distinctive feature found in the seed coat epidermis is myxospermy, referring to the release of mucilage upon exposure to aqueous solutions. This property is found in a variety of species, including members of Brassicaceae, Solanaceae, Linaceae, and Plantaginaceae (Young and Evans, 1973; Frey-Wyssling, 1976; Grubert, 1981; Van Caeseele et al., 1981; Van Caeseele et al., 1987; Boesewinkel and Bouman, 1995). Mucilage is primarily composed of pectin (Goto 1985; Western et al., 2000) and is believed to play roles in seed germination. When the seeds of mutants, such as myb61, sbt1.7 and mum4 men discussed below, are placed on a filter paper moistened with polyethylene glycol (PEG) solutions to limit the water access to the seeds, the mutant seeds show lower, or slower germination, compared to wild type (Penfield et al., 2001; Rautengarten et al., 2008; Arsovski et al., 2009a). Arabidopsis thaliana, a member of Brassicaceae, is myxospermous. After maturity, dry seeds of Arabidopsis can release mucilage, containing two distinct layers, upon hydration. The outer layer of the mucilage is relatively diffuse, is weakly stained by ruthenium red and can be easily removed from the seed by vigorous shaking (Western et al., 2000; Macquet et al., 2007a). The inner layer, however, is compact, strongly stained by ruthenium red and is much more difficult to remove from the seed (Western et al., 2000; Macquet et al., 2007a). 10  The Arabidopsis seed coats can be used to study pectin biosynthesis and modification. The dry mature seeds release large quantities of a specific pectin that is dispensable under laboratory conditions. Therefore seed coat pectin is amenable to both chemical and molecular genetic analyses, and provides an opportunity to identify genes involved in pectin biology.  1.2.1 Development of the seed coat  During germination, the pollen tube releases two sperm nuclei into the embryo sac to accomplish the double fertilization in angiosperms. One sperm fuses with the egg initiating embryogenesis, while the other sperm fuses with two polar nuclei to form the endosperm which supplies nutrients for the growing embryo. This process initiates the differentiation of seed coat from the maternal ovule integuments that occurs over a period of 2–3 weeks (Haughn and Chaudhury, 2005). At the beginning stage of seed coat development (0 days post-anthesis, DPA), the four to five layers of cells in the ovule integuments (outer and inner) are relatively undifferentiated (Beeckman et al., 2000; Debeaujon et al., 2003). The outer integument (oi) includes two cell layers, an inner (oil) and an outer (oi2; epidermis) layer while the inner integument (ii) consists of two to three cell layers (iil, iil` and ii2, labelled from inner to outer; Figure 1-2; Schneitz et al., 1995; Beeckman et al., 2000). Immediately after the fertilization, the cells of the iil layer became vacuolated. In these cells the pigment, proanthocyanidin (PA), a flavonoid compound (Dixon et al., 11  Figure 1-2 The development of ovule integuments The right column shows the development of the seed coat from ovule integuments, with the seed development as the reference (left column). Al, endosperm aleurone; Em, embryo; En, endosperm; Es, embryo sac; Ii, inner integument; Oi, outer integument (adapted from Haughn and Chaudhury, 2005). 12  2005) accumulates in the vacuoles eventually forming condensed tannins, and is then deposited in the cytoplasm as well (Beeckman et al., 2000). The cells in this layer eventually go through programmed cell death after which the tannins are released into surrounding layers (Beeckman et al., 2000). Oxidation of the tannins results in the brown colour characteristic of Arabidopsis seeds. The cells in the iil` and ii2 layers first expand after the fertilization, with an extensive vacuolisation in cells. The bent-cotyledon embryo stage is the turning point for the cells in these two layers since the cells undergo programmed cell death (Nakaune, et al. 2005) and are ultimately crushed into a thin layer by maturity (Beeckman et al., 2000). The appearance of starch grains characterizes the early growth of the oi1 and oi2 layers (Western et al., 2000; Windsor et al., 2000; Beeckman et al., 2000). In the oi1 layer, a secondary wall is produced on the inner tangential side of the cell resulting in a palisade-like appearance (Beeckman et al., 2000). The oi2 (epidermal) layer is the one that produces mucilage and its differentiation has been studied intensely. During the first 4 DPA, the cell size increases roughly 4-fold, with the expansion of the vacuole that occupies the centre of the cell, pushing the cytoplasm to the outer margins (Western et al., 2000; Windsor et al., 2000; Young et al., 2008). Globular prominent amyloplasts are observed in cells beginning at 3 DPA, with both the size and number increasing until 7 DPA. At 6 to 7 DPA, pink-staining acidic polysaccharide is seen in growing pockets at the junction of the radial and outer tangential cell walls indicating the beginning of mucilage synthesis. From 7 through 9 DPA, the cytoplasm and amyloplasts form a column at the centre of the cells defined by the growing mucilage pockets (Western et al., 2000; Windsor et al., 2000; Young et al., 13  2008). By 10 DPA, a secondary cell wall called the columella starts to be formed along the outer surface of the cytoplasmic column while the amyloplasts become smaller and darker. As the walls of columellae are thickened, the cytoplasmic column is displaced toward the bottom of the cell until the cytoplasm is replaced entirely by the growing secondary cell wall. Thus, by maturity, the volcano-shape columella is surrounded by a donut-shaped space, which is filled with mucilage (Western et al., 2000; Windsor et al., 2000). Given the correlation between the appearance and disappearance of amyloplasts and the biosynthesis of mucilage and columellae, the starch grains are considered to be the source of much of the carbohydrate for pectin and secondary cell wall, although normal amounts of mucilage are produced in the starchless mutant phosphoglucomutase1 (pgm1) when grown in continuous light many fewer seeds (2 or 3 compared to 50-60 in the wild type) were produced per silique (Caspar et al., 1985; Caspar and Pickard, 1989; Western et al., 2000).  1.2.2 Seed coat mucilage secretion  Similar to cell wall pectin, mucilage pectin is produced in the Golgi stacks and secreted during seed coat development (Young et al., 2008). Accordingly, at 7 DPA, at the height of mucilage synthesis, the Golgi has swollen cis cisternae and more extensive trans-Golgi network (TGN) than Golgi at 4 DPA (Young et al., 2008). In addition, the number of Golgi stacks increases dramatically during this period (Young et al., 2008). An anti-mucilage antibody (CCRC-M36) was used to investigate the appearance and localization of mucilage in developing seed coats (Young et al., 2008; Pattathil et al. 14  2010). Mucilage was detected in the Golgi Bodies and vesicles and mucilage pockets during (7 DPA) but not before (4 DPA) or after (9 DPA) mucilage deposition (Young et al., 2008). Although the secretion of mucilage is targeted to a specific region of the cell, the Golgi apparatus is evenly distributed in the cytoplasm (Young et al., 2008). How such targeted secretion occurs is unclear. Cortical microtubules are found lining the mucilage secretion domain of the plasma membrane in the seed coat epidermal cells (McFarlane et al., 2008). By contrast, actin microfilaments are distributed evenly throughout the cytoplasm (McFarlane et al., 2008). To test the hypothesis that microtubules guide mucilage vesicle transportation to the mucilage pocket, mucilage deposition was examined in microtubule organization1-1 (mor1-1), which has disordered cortical microtubules when grown at high temperatures (Whittington et al., 2001; Kawamura et al., 2006). However seed coat development in mor1-1 was found to be normal suggesting that mucilage secretion is not dependent on microtubule organization (McFarlane et al., 2008).  1.2.3 Seed coat mucilage composition  To investigate the nature of the Arabidopsis seed coat mucilage, various approaches have been applied, including chemical analysis, cytological staining, and antibody labelling.  15  Monosaccharide and linkage analysis of Arabidopsis mucilage identified the major sugars in mucilage as 2-Rha and 4-GalA, suggesting that RG I is a major component of mucilage (Goto, 1985; Western et al., 2000, 2001, 2004; Penfield et al., 2001; Usadel et al., 2004; Dean et al., 2007; Macquet et al., 2007a; Arsovski et al., 2009b). In addition, the chemical analysis was consistent with the presence of cellulose, xyloglucan and HG, but at a relatively low level compared to RG I. Cytological analyses have also identified RG I, HG, XG and cellulose as being present in mucilage. Ruthenium red, which can stain acidic polysaccharides (Luft, 1971; Fletcher and Floodgate, 1973; Frey-Wyssling, 1976), and widely used as an indicator of pectin, stains mucilage (Western et al., 2000; Willats et al., 2001a; Macquet et al., 2007a). The anti-mucilage antibody CCRC-M36 is believed to bind strongly to unbranched backbone of RG I from Arabidopsis, tomato (Solanum lycopersicum), lettuce (Lactuca sativa), and soybean (Glycine max) and mustard (Sinapis alba; Young et al., 2008; Pattathil et al. 2010). Cellulose in the mucilage  was suggested by the staining by  calcoflour white, which can detect β-1, 4-glucans, and demonstrated through the binding of a cellulose binding domain (Willats et al., 2001a; Blake et al., 2006; Macquet et al., 2007a; Young et al., 2008). LM5 and LM6, which recognize (1, 4)-β-galactan and (1, 5)α-arabinan of the RG I side chains, also bind mucilage (Jones et al., 1997; Willats et al., 1998; Willats et al., 2000). HG was detected in mucilage by anti-HG monoclonal antibodies JIM5 and JIM7 and PAM1 (Willats et al., 2000; Willats et al., 2001a; Macquet et al., 2007a; Young et al., 2008). JIM7 recognizes the outer layer of seed coat mucilage while JIM5 recognizes the inner layer. Thus the data indicate that the outer region of mucilage consists of highly esterified HG, and the inner region more de-esterified HG. 16  Finally, XG has also been identified as a component using antibody binding (Macquet et al., 2007a; Young et al., 2008). Therefore, the major component of mucilage is RG I, with much lower quantities of cellulose, XG and HG. However, the relative arrangements of different components are still unclear.  1.3 Genetic analysis of seed coat mucilage production  Because the Arabidopsis thaliana seed coat epidermal cells are a non-essential cell type that produces copious amounts of easily accessible pectin at a specific time in development, this cell type can be useful as a model to study the processes of biosynthesis, secretion and modification of pectin.  Discovering genes involved in  mucilage production by identifying mutants defective in seed coat mucilage can help us obtain more insights into the processes of pectin production. Several mutants have already been identified and studied (Table 1-1).  1.3.1 Seed coat development mutants  Among the seed coat mucilage mutants, aberrant testa shape (ats) and apetala2 (ap2) affect the integument development/ differentiation. Neither can produce normal seed coat cells.  17  Table 1-1 Seed coat mucilage mutants Mutant aberrant testa shape (ats)  Mutant phenotype  Gene product  reduced mucilage  KANADI TF  abscisic acid1 (aba1)  reduced mucilage release  Zeaxanthin epoxidase  apetala2 (ap2)  no mucilage or columella  AP2 TF  enhancer of glabra3 (egl3)  reduced mucilage and flattened columella (egl3 tt8 double mutant)  bHLH TF  galacturonosyltransfer ase11 (gaut11)  reduced mucilage and flattened columella  Galacturonosyltransferase  gibberellin 3-oxidase4 (GA3ox4) glabra2 (gl2)  reduced mucilage release and abnormal columella reduced mucilage and flattened columella  mucilage-modified1 (mum1)  no mucilage on hydration with normal development  WD40 TF  mum2  no mucilage on hydration with normal development  Glycosyl hydrolase  mum3 mum4 mum5  myb23 myb5 myb61 patchy radial swelling3 (rsw3) subtilisin-like serine protease1.7 (subtilase1.7; sbt1.7)  ttg2  Homeobox TF  altered mucilage staining reduced mucilage and flattened columella  Unknown  altered mucilage staining reduced mucilage and flattened columella (constitutive chemeric repressor ) reduced mucilage and flattened columella reduced mucilage and flattened columella  Unknown  patchy release of mucilage reduced mucilage and flattened columella  Glycosyl hydrolase  no mucilage on hydration with normal development  reduced mucilage and flattened transparent testa2 (tt2) columella (myb5 tt2 double mutant) tt8 transparent testa glabra1 (ttg1)  Gibberellin 3-oxidase4  reduced mucilage and flattened columella (egl3 tt8 double mutant) reduced mucilage and flattened columella reduced mucilage and flattened columella  18  NDP-L-rhamnose synthase  MYB TF MYB TF MYB TF  Glucosidase II  Subtilase MYB TF bHLH TF WD40 TF WRKY TF  ats is a heart-shaped seed mutant that produces much less mucilage than wild type upon hydration. Unlike the wild type ovule, which has two integuments with five layers of cells, ats mutant has only one integument with three cell layers. The endothelium of the ats mutant develops normally but the epidermal cells fail to produce a normal amount of mucilage. The single integument in ats demonstrates normal pigment and less mucilage (Leon-Kloosterziel et al., 1994). ATS encodes KANADI4 (KAN4), a member of the KAN family of putative transcription factors. In situ hybridization data revealed that ATS expression is confined to the abaxial side of the inner integument and the adaxial side of the outer integument at the time of integument primordium initiation. These data suggest that ATS is required for the separation of the two integuments (McAbee et al., 2006). However, the role of ATS in mucilage production is still unclear. The ap2 mutant was first isolated as a floral organ identity mutant, but has defects in a number of different processes, including seed coat differentiation. The seeds of ap2 are heart-shaped and the seed coat epidermis has flattened columellae (Bowman et al., 1989; Kunst et al., 1989; Jofuku et al., 1994). AP2 is a member of a DNA-binding transcription factor family defined by AP2 domain (Okamuro et al., 1997). Electron and light microscopy were used to examine the differences in ap2 ovule integument development compared to wild type. The cells in outer integument develop normally until 4 DPA. However the cells stop differentiating, and retain a vacuolated state. No discernable epidermal or palisade cell layers develop in mature ap2 seeds (Western et al., 2001). Therefore, AP2 functions as a regulator of outer integument differentiation.  19  1.3.2 Mucilage biosynthesis mutants  As discussed previously, the biosynthesis of mucilage likely involves many enzymes. Loss-of-function mutations can help identify genes encoding these enzymes. One example of such a mutant is mum4, which has severe mucilage reduction, and the mutated gene encodes a rhamnose synthase. Since this mutant is directly involved in one of my projects, it will be discussed in detail below. Another enzyme-encoding gene related to seed coat mucilage is GALACTURONOSYLTRANSFERASE11 (GAUT11) which was identified in a reverse-genetics study of the GAUT family (Caffall et al., 2009). The reduced mucilage release observed in this mutant and the monosaccharide composition of the mucilage are consistent with a reduction of HG (Caffall et al., 2009). The radial swelling3 mutant (rsw3) shows reduced mucilage and flattened columela typical of mutants deficient in mucilage synthesis. RSW3 encodes the α-subunit of a putative glucosidase II with homology to enzymes that process N-glycans during ER quality control (Burn et al., 2002). The cellulose in roots of rsw3 is also reduced (Peng et al., 2000). The exact function of RSW3 is unclear but it could be related to glycosylation defects of cell wall biosynthetic enzymes (Burn et al., 2002).  1.3.3 Mutants affecting the regulation of mucilage biosynthesis  A number of mucilage-defective mutants identified transcription factors involved in the regulation of mucilage biosynthesis.  Three such transcription factors are  TRANSPARENT TESTA GLABRA1 (TTG1), GLABRA2 (GL2) and TTG2. None of the three mutants, ttg1, gl2 and ttg2, release mucilage in water, and their columellae are 20  flattened (Koornneef, 1981; Rerie et al., 1994; Western et al., 2001; Johnson et al., 2002). Chemical analysis determined that the monosaccharide composition of mucilage is unchanged but the quantity is decreased in all three mutants compared to wild type. Further, the differentiation of epidermal cells is altered. The large vacuole does not contract completely and the secondary cell wall is deposited on top of the vacuole. When the vacuole collapses on desiccation, the columella flattens (Western et al., 2001). TTG1 encodes a WD40 repeat protein (Walker et al., 1999) and GL2 a homeodomain-leucine zipper (HD-zip) transcription factor (Rerie et al., 1994). TTG2 encodes a WRKY transcription factor expressed specifically in the innermost layer of the inner integument and later in multiple layers of the seed coat (Johnson et al., 2002). The mutants ttg1, gl2 and ttg2 also have defects in trichome and root hair development and seed colour (Koornneef, 1981; Rerie et al., 1994; Johnson et al., 2002). Trichomes are absent on the leaves of mutants ttg1 and gl2, while ttg2 has reduced amount of trichome branching (Koornneef, 1981; Rerie et al., 1994; Johnson et al., 2002). Unlike in wild type root epidermis where the hair-bearing cells and hairless cells are arranged alternately, all cells are hair-bearing ones in ttg1 and gl2, which leads to more root hairs in both mutants (Galway et al., 1994; Masucci and Schiefelbein, 1996; Di Cristina et al., 1996; Masucci et al., 1996). The root hair phenotype of ttg1 is not found in ttg2 (Johnson et al., 2002). The seeds of ttg1 and ttg2 are yellow in appearance resulting from a reduction of tannins in the pigmented cell layer (Koornneef, 1981; Walker et al., 1999; Johnson et al., 2002). The pleiotropic phenotypes of ttg1, gl2 and ttg2 suggest that the epidermal cells of seed coat, trichome and root hair share a common mechanism to determine cell  21  specification. TTG1, a WD40 repeat protein, forms a complex with a MYB protein and a bHLH protein (Payne et al., 2000) to promote epidermal cell fate in a variety of tissues. A specific fate is determined by the specific MYB and bHLH proteins in the complex (Payne et al., 2000; Zhang et al., 2003; Schiefelbein, 2003; Larkin et al., 2003; Schellmann et al., 2007; Larkin et al., 1994; Zhao et al., 2008; Kang et al., 2009). TTG2 and GL2 are downstream targets of the complex (Szymanski et al., 1998; Johnson et al., 2002; Western et al., 2004; Ishida et al., 2007). One cell type promoted by the WD40-bHLH-MYB complex is the seed coat mucilage epidermal cells (Zhang et al., 2003; Western et al., 2004). EGL3 and TT8 are bHLH proteins that interact with TTG1 and act redundantly to specify the seed coat epidermis (Zhang et al., 2003). Similarly MYB5 and TT2 act redundantly as the MYB component. The data that myb5 has pleiotropic phenotypes and both MYB5 and TTG1 upregulate the same genes suggest that MYB5 is likely part of the WD40-bHLH-MYB complex (Li et al., 2009; Gonzalez et al., 2009). Both TRANSPARENT TESTA8 (TT8) and ENHANCER OF GLABRA3 (EGL3) encode a basic helix-loop-helix domain protein (Nesi et al., 2000; Zhang et al., 2003). The tt8 mutant was isolated as the yellowish seeds in contrast to the wild type brown ones (Nesi et al., 2000). Egl3 was identified as a mutant with completely hairless plants (Zhang et al., 2003) when screening for the enhancer of glabra3 (gl3), which has reduced trichomes (Payne et al., 2000). Only the double mutant egl3 tt8 has no mucilage extrusion in water and collapsed columellae (Zhang et al., 2003). These data suggest that EGL3 and TT8 have redundant roles in mucilage production. Much less mucilage and flattened columellae are found in the seed epidermal cells in myb5, compared to wild type (Li et al.,  22  2009; Gonzalez et al., 2009). MYB5 and TT2 are redundant in mucilage production since the double mutant has a more severe mucilage phenotype than myb5, although tt2 seed coat has wild type development and mucilage (Gonzalez et al., 2009). MYB61 is a member of an independent pathway from the TTG1-dependent pathway (Penfield et al., 2001; Western et al., 2004). The myb61 mutant lacks mucilage extrusion and volcano-shaped columellae, resulting from the reduction of mucilage deposition (Penfield et al., 2001). MYB61 differs from other transcription factors in its control of MUM4 (Western et al., 2004). All transcription factors in the TTG1 pathway except TTG2 are required for normal levels of MUM4 expression while MYB61 is not. The role of MYB61 in the mucilage production is still unclear. Another study demonstrated that MYB61 is required for the control of stomatal aperture and suggested a role in balancing carbon supply with demand (Liang et al., 2005). Perhaps its role in mucilage deposition is connected to carbon supply. Combining all the information mentioned above, a model of the regulatory pathways of seed coat mucilage biosynthesis have been proposed (Figure 1-3; Western et al., 2004; Li et al., 2009; Gonzalez et al., 2009). MYB23 is a transcription factor that cannot yet be incorporated into the mucilage biosynthesis regulatory pathway, although there is some evidence for its involvement in mucilage production. A chimeric MYB23 repressor leads to phenotypes that are similar to the loss-of-function alleles of TTG1. These phenotypes include the defects in trichome development, hairy shorter roots, elongation of leaves and of stems, and absence of columellae and seed coat mucilage on hydration (Matsui et al., 2005). More studies showed that MYB23 participates in cell fate determination in roots and trichomes (Kirik  23  Figure 1-3 Regulatory pathways of seed coat mucilage production  TTG1 forms a complex with TT8/EGL3 and MYB5/TT2. Together with AP2, the complex regulates GL2 and TTG2. GL2 controls mucilage production at least in part through MUM4, a rhamnose synthase. MYB61 is independent from other regulatory components (adapted from Western et al., 2004; Li et al., 2009; Gonzalez et al., 2009).  24  et al., 2001; Kirik et al., 2005; Kang et al., 2009). MYB23 and MYB5 show redundancy in trichome development, however, MYB23 does not seem to share a similar role as MYB5 in mucilage production since myb23 releases a large amount of mucilage and myb5 myb23 double mutant is similar to a myb5 single mutant (Li et al., 2009).  1.3.4 Hormone-associated mucilage mutants  Two mutants with seed coat mucilage phenotypes can be rescued by hormones, abscisic acid1 (aba1) and gibberellin-3 oxidase4 (GA3ox4; Karssen et al., 1983; Kim et al., 2005). The aba1 mutant defective in the ABA biosynthetic enzyme zeaxanthin epoxidase shows reduction of mucilage extrusion which can be recovered by exogenous ABA (Karssen et al., 1983). The only obvious difference in GA3ox4 seed coat development from wild type is the delayed disappearance of starch granules, which may contribute to the formation of columellae. The defective mucilage release phenotype in the GA3ox4 mutant can be rescued by the application of gibberellic acid (GA; Kim et al., 2005). These data suggest that ABA and GA simulate the production of mucilage, though the mechanism remains unclear.  1.3.5 Mucilage adhesion mutants  Another group of seed coat mutants are mucilage-modified1 (mum1) through mum5 which were isolated in a screen for seed coat defects (Western et al., 2001). In mum3 and mum5, mucilage is present when hydrating seeds in ruthenium red without shaking. However, both layers disappear after agitation. The adherent inner layer of 25  mucilage becomes diffuse and water-soluble, like the outer layer. As yet MUM3 and MUM5 remain to be identified (Western et al., 2001; Macquet et al., 2007a).  The mutants mum1, mum2, patchy and subtilisin-like serine protease1.7 (subtilase1.7; sbt1.7) are defective in the mucilage release. Since they are the focus of my thesis research, they will be discussed below in detail.  1.3.6 The mum4 mutant  The mutant mum4 was found in a screen for Arabidopsis mutants defective in mucilage extrusion. When mum4 is immersed in water, no mucilage comes out. However, the seed coat releases a little mucilage after treatment with EDTA. Light microscopy of mum4 seeds suggests that the amount of mucilage is lower than that of wild type. In addition, mum4 has columellae that are flatter than those of wild type (Western et al., 2001; Western et al., 2004). The MUM4 gene was identified by map-based cloning. It encodes a protein of 667 amino acids. BLAST of the nucleotide sequence of MUM4 indicated that the N-terminal domain was similar to dTDP-D-glucose-4, 6-dehydratases and the C-terminal domain was similar to bacterial 4-reductases from the reductase/epimerase/dehydrogenase protein superfamily responsible for rhamnose biosynthesis in bacteria (Western et al., 2004; Usadel et al., 2004). The MUM4 gene is one of three members of a small gene family: RHM1, MUM4/RHM2 and RHM3 (Usadel et al., 2004; Western et al., 2004). MUM4 gene is expressed ubiquitously in Arabidopsis (Usadel et al., 2004; Western et al., 2004) 26  but it is up-regulated in the silique during mucilage synthesis. Characterization of MUM4 expression showed that MUM4 is transcribed less in the mutants ap2, ttg1 and gl2 than in the wild type but this was not the case in the mutants ttg2 and myb61. Thus AP2, TTG1 and GL2 are necessary for the up-regulation of MUM4 expression, but not TTG2 and MYB61 (Western et al., 2004; Figure 1-3). The mum4 mutant is a good tool for screening for mutations in new genes that are involved in the biosynthesis and secretion of pectin and/or the differentiation of secondary cell walls. Because the mum4 mutant seed coats make only small amounts of mucilage, it is easier to detect small changes in the amount (either increases or decreases) of mucilage relative to wild type. For this reason, mutations that affect the amount of pectin can be more easily detected in a mum4 genetic background. Secondary mutations that result in more mucilage or more pronounced columellae are termed mum4 suppressors (msu). Secondary mutations that result in less mucilage or less pronounced columellae are termed mum4 enhancers (men). Such modifier screening can identify genes involved in pectin or cell wall biosynthesis that may not have been recognizable by previous screening methods. Eight independent men mutants were identified, including two alleles of the previously known genes, MUM2 and MYB61 (Arsovski et al., 2009b). The other six double mutants identified new loci: men1-1 mum4-1, men4-1 mum4-1, and men5-11 mum4-1 deposit less mucilage than mum4-1, while men2-1 mum4-1 and men6-1 mum4-1 fail to release mucilage even after the treatment of EDTA (Arsovski et al., 2009b). No single mutant shows a seed coat mucilage phenotype, except men4, which has less  27  mucilage in EDTA than wild type, and larger columellae than mum4 (Arsovski et al., 2009b).  1.4 Mutants effecting pectin modification  Seed coat mucilage mutants that fail to extrude mucilage can result from the reduction of mucilage production, like the ones discussed above. Another class of mucilage mutants do not have a dramatic change in the amount of mucilage, but still fail to extrude mucilage. These mutants may have alterations in the structure of mucilage, the primary cell wall, or both, that limit the capability of mucilage to expand in water. mum2, sbt1.7, patchy and mum1 are in this class. The MUM2, SBT1.7 and PATCHY genes have been cloned and characterized.  1.4.1 The pectin modification mutants  Except for the lack of mucilage extrusion, differentiation of the mum2 mutant seed coat appears to be cytologically normal, with similar amounts of mucilage deposited into the mucilage pocket (Western et al., 2001; Dean et al., 2007; Macquet et al., 2007b). When seeds are sectioned such that the cell walls are not completely intact, the mucilage still fails to expand, suggesting that the failure to extrude is due, at least in part, to changes to the mucilage itself (Dean et al., 2007; Macquet et al., 2007b). The MUM2 gene encodes a β-galactosidase secreted to the apoplast (Dean et al., 2007; Macquet et al., 2007b). β-galactosidase activity is absent in the mum2 mutant and recombinant MUM2 28  protein shows β-galactosidase activity (Dean et al., 2007; Macquet et al., 2007b). MUM2 is expressed in many tissues of the plant besides the seed coat. Chemical analysis of the mum2 mucilage is consistent with the absence of β-galactosidase activity. The mum2 mucilage has more RG I galactan and arabinan side chains than that of wild type (Dean et al., 2007; Macquet et al., 2007b). The highly branched mucilage resulting from the absence of MUM2 may be responsible for the alteration in the hydration and expansion properties of mucilage in mum2. The patchy mutant has only patches of mucilage released from seed coat epidermal cells (Arsovski et al., 2009a). Like in mum2, patchy seed coat development is normal. Increases in a neutral side chain α-1-5 linked arabinans in mucilage, and in primary cell walls, were detected by chemical analysis and immunofluorescence, respectively (Arsovski et al., 2009a). An exogenous α-arabinofuranosidase helps the wild type mucilage release in patchy (Arsovski et al., 2009a). PATCHY was found to encode a bi-functional β-xylosidase/α-arabinofuranosidase previously named BXL1 (Goujon et al., 2003), expressed in all the tissues examined (Arsovski et al., 2009a). PATCHY/BXL1 is predicted to be targeted to the extracellular matrix, and to trim arabinan side chains for weakening of primary cell walls and/or normal mucilage release. SBT1.7 encodes a subtilisin-like serine protease (subtilase) that is expressed ubiquitously, but peaks during seed development (Rautengarten et al., 2008). The seeds of the sbt1.7 mutant do not release mucilage in water but in EDTA, the mucilage is partially released (Rautengarten et al., 2008). However, no structural or developmental changes were detected during the seed coat development (Rautengarten et al., 2008). The mucilage composition of analysis suggests the RG I level is unchanged (Rautengarten et  29  al., 2008). Coincidentally, pectin methylesterase (PME) activity was found to increase in sbt1.7 late in seed coat development (12-14 DPA) when the SBT1.7 protein accumulates in the seed coat (Rautengarten et al., 2008). Low pectin methylesterification in sbt1.7, which might lead to higher cross linkage of pectin by Ca2+, could explain the mucilage expansion defect and the cell wall change. Thus SBT1.7 may activate a PME possibly through cleavage of a repressor domain (Rautengarten et al., 2008). The functions of MUM2, SBT1.7 and PATCHY genes suggest that the modification of mucilage/cell wall structure after mucilage biosynthesis is necessary for mucilage extrusion and illustrates the usefulness of seed coat cells as a model system to study cell wall dynamics.  1.4.2 The mum1 mutant  mum1 has a mucilage extrusion phenotype closely resembling that of the mum2 mutant (Western et al., 2001). The seed coat development of mum1 is indistinguishable from that of wild type (Western et al., 2001). Monosaccharide analysis of mum1 whole seed revealed a similar monosaccharide composition to that of wild type (Western et al., 2001). Methylation analysis shows an increase in mum1 and mum2, compared to wild type (Western et al., 2001). This change was hypothesized to be responsible for the retention of the mum1 mucilage (Western et al., 2001). Given the similar phenotypes of mum1 and mum2, it would be interesting to investigate the role of MUM1 in mucilage modification, and its relationship with MUM2.  30  1.5 The thesis objectives  Given the essential roles of pectin in cell wall architecture, it is important to understand pectin biosynthesis and its regulation, secretion and modification. Therefore the objectives of my thesis are as follows: PART A: To explore the mum1 phenotype. Previous studies revealed that mum1 is defective in releasing mucilage on hydration. Two possible reasons for this phenotype, strengthening of the primary cell wall or modification of mucilage, can be tested. Further, the similar phenotypes of mum1 and mum2 raise the question as to whether the functions of the two genes are related. PART B: To identify the MUM1 gene. The identity of the MUM1 gene should provide clues concerning the biochemical role of the gene. In addition, the expression pattern of MUM1 will suggest when and where the gene product is required in the course of the seed coat development. PART C: To characterize the activity of MUM1 and its role in pectin biosynthesis. Once MUM1 is identified, its relationship with other known mucilage-related genes can be determined. The connection between MUM1 and other genes will help to establish how the function of MUM1 fits with other proteins involved in mucilage biosynthesis. PART D: To identify mum4 modifier mutants as a means to discover new genes involved in the biosynthesis and/or the secretion of seed coat mucilage, and the biosynthesis of the secondary cell wall. The new genes may provide more information about the biosynthesis and secretion process of mucilage and therefore insight into the mechanism of the biosynthesis of the cell wall.  31  2 Methods 2.1 Plant material and growth conditions  The Arabidopsis ecotypes Columbia-2 (Col-2) and Landsberg erecta (Ler) were used as wild type controls. mum1/luh-5 and mum2-1 were isolated from an ethyl methanesulfonate (EMS) –mutagenized M3 population of wild type Col-2 Arabidopsis thaliana plants (Western et al., 2001). luh-1 (CS91893), luh-3 (SALK_107245), luh-4 (SALK_097509) and luh-6 (CS90546) were ordered from the Arabidopsis Biological Resource  Center  (ABRC),  Ohio  State  University  through  TAIR  (http://www.arabidopsis.org). ap2-1, gl2-1, ttg1-1 and tt2-1 (Ler ecotype) were obtained from ABRC by Western et al. (2004). The construct 35S:MUM2-GFP was obtained from an earlier study (Dean et al., 2007). Seeds were placed on AT minimal medium (Haughn and Somerville, 1986) in Petri dishes at 4°C for 2 days, before being moved to growth chambers at 20°C under continuous light (90 to 120 µmol m-2s-1 photosynthetically active radiation (PAR)). The 7-to-10-day-old seedlings were transferred to prepared soil mix (Sunshine Mix 5; Sun Gro Horticulture), watered once with liquid AT medium, and grown under the same conditions as above. To isolate different developmental stages of siliques, newly open flowers were defined as 0 day post anthesis (DPA). Open flowers were marked with different colors of nontoxic, water-soluble paint to allow specific developmental stages to be harvested. The 32  seed coats were collected and used experimentally when they reached the appropriate age (Western et al., 2001; Dean et al., 2007). The luh-5/mum1 plants were transformed by the Agrobacterium tumefaciens– mediated floral dip method (Clough and Bent, 1998). The transgenic plants were checked for the mum1 background using the CAPS primers At2g32700 CAPS1/2 (5'TGAATTACGTAACTGACCAGTGG-3'/  5'-AGGCTGCTTCATGCGTTCC-3').  The  DNA fragments were cut using Pst I which produces 2 bands in the wild type background (87 + 152 bp), but only one band (239bp) in the mum1 background.  2.2 Microscopy  Seed mucilage was stained by shaking whole seeds in 0.01% (w/v) ruthenium red (Sigma-Aldrich) for 2 h. The seeds were observed using a Leica WILD M8 dissecting microscope. To observe the effects of Ca2+ chelators (such as EDTA) and alkali, seeds were shaken in corresponding solutions (for example Na2CO3, see Figure 3-1 ) for 2 h before being stained with ruthenium red as described above (Dean et al., 2007). For resin embedding and sectioning, developing seeds were punctured with a needle to allow penetration of the fixative and resin before being fixed with 3% (v/v) glutaraldehyde (Canemco, Montreal, Canada) in 0.5 M sodium phosphate buffer, pH 7. Samples were post-fixed for 1 to 2 h in 1% (v/v) osmium tetraoxide in 0.5 M phosphate buffer, dehydrated using an ethanol solution series and transferred to a solution of  33  propylene oxide, and then solutions of Spurrs resin (Canemco, Montreal, Canada) in increasing increments for infiltration. Samples were embedded in resin for polymerization at 60°C in an oven. Seeds were sectioned (0.2 to 0.5 µm) with glass knives on a microtome (Reichert-Jung, Vienna). Sections were mounted on glass slides, and then stained with 1% (w/v) toluidine blue O in a 1% (w/v) sodium borate solution, pH 11 (Western et al., 2000) and examined under a Zeiss AxioScop light microscope (Carl Zeiss, Oberkochen, Germany). To determine if mucilage would expand from sectioned, hydrated cells, mature dry seeds were added to molten paraplast (Sigma-Aldrich, Saint Louis, USA) at 60°C. After incubation for 2 h, the paraplast was solidified at room temperature overnight. 20 µm sections were produced on a HM 325 microtome (Microm, Boise, USA), then mounted on slides and hydrated with 0.01% (w/v) ruthenium red and examined as described above (Dean et al., 2007). Seeds to be examined by SEM were mounted on stubs, coated with goldpalladium in a SEM Prep2 sputter coater (Omicron NanoTechnology, Taunusstein , Germany), and imaged using a Hitachi S4700 scanning electron microscope (Hitachi High-Technologies Schaumburg, IL, USA). Digital images were cropped and labelled in the softwares ImageJ (National Institutes of Health, DC, USA) and Adobe Photoshop (Adobe Systems, San Jose, CA, USA).  34  2.3 Positional cloning of MUM1  The mapping population of 420 F2 plants was derived from F1 plants made by crossing mum1 (Col-2 background) and wild type Ler. DNA samples of individual F2 plants were stored by crushing young leaves on FTA classic card (Whatman). Small discs containing samples were punched from FTA cards for PCR reactions (Zhang et al., 2007). Sequence information was obtained from the Arabidopsis Genome Initiative (The Arabidopsis Genome Initiative, 2000) and Cereon (Jander et al., 2002) at the TAIR website (http://www.arabidopsis.org) to generate simple sequence length polymorphism (SSLP) markers for map-based cloning. Primer sequences are listed in Table 2-1. The sequences of the luh-5/mum1-1 mutant allele and Col-2 wild type were determined using 6 sequencing primers for At2g32700 (Table 2-2). Gene sequence was amplified using genomic DNA samples on the FTA classic cards as a template, then sequenced. Genomic sequences were amplified by primers At2g32700 TF/TR (5'ATTGCGGCCGCCCGGTTTTGCTTCTTCTTTTTC-3'/  5'-  TTAGCGGCCGCGTTGAAAGAGAGGCAGAGTCATTC-3') with the Not I enzyme site included in both primers in order to conduct transgenic complementation of luh5/mum1. Both the fragment and the vector pART27 were digested with Not I before ligation. The luh-5/mum1 plants were transformed by the Agrobacterium tumefaciens– mediated floral dip method (Clough and Bent, 1998).  35  Table 2-1 The SSLP maker primers used for map-based cloning of MUM1  36  Primer name  Chromosome  AGI position  F primer  R primer  Ler fragment  Col fragment  NGA361  II  13.2 mb  5'ACATATCAATATATTAAAGTAGC3'  5'AAAGAGATGAGAATTTGGAC-3'  120 bp  114 bp  MASC06579  II  13.51 mb  5'-TTGCAAGGGAAGCTTTGTCT-3'  5'-TTGCTCCAAAATCACGTCAG3'  98 bp  94 bp  2m13834  II  13.834 mb  5'-GGTTTATTGAGAGTGGAGC-3'  5'GAATCCTAATCAGAAGAAGAG3'  82 bp  74 bp  2m13873  II  13.873 mb  5'-TGCAGTGATCAGTTTATAAGG3'  5'-CTTGCGTCAAATACTAGTTC3'  103 bp  95 bp  2m13937  II  13.937 mb  5'-TATGTGTGAGGCCAAGAACC-3'  5'-CCACCTCATGCATGTGTTAT3'  246 bp  279 bp  2m13995  II  13.995 mb  5'-CTCGGCGAACTTCTCCTTC-3'  5'GTCCAACGTTTCCAATATAAG-3'  96 bp  104 bp  2m1404  II  14.04 mb  5'-TCACCGGTTCAAGATCAGG-3'  5'-CACGCCGGAATTCTACAGG-3'  116 bp  125 bp  2m14315  II  14.315 mb  5'-CTTTCTCACACCAATGCATCC3'  5'GTGTTTCATCTTCCAATTTGAG3'  96 bp  89 bp  MASC06557  II  14.44 mb  5'-GGTCACCTAACTTACCATGG-3'  5'-CTTCAATCACATGATCCTAG3'  172 bp  180 bp  F3G5II-16  II  15.6 mb  5'GCTCCTTTATAATGCAAGAATG-3'  5'CAGTCTCCAACTGTTCTATGTG3'  125 bp  138 bp  Table 2-2 Sequencing primers of At2g32700  Primer name  Sequence  At2g32700 seq1  5'-TGTTTGGGCTTTTATTCAGG-3'  At2g32700 seq2  5'-ATCAGCAACAAACCATCATGG-3'  At2g32700 seq3  5'-TCTTTCCGTTGCTTGTTGG-3'  At2g32700 seq4  5'-TGTCATGGCCCTAAAACAGC-3'  At2g32700 P1  5'-TCAACAGATTCCACTGCATCC-3'  At2g32700 P2  5'-AAAAGTCCTGAGCTCTCTGC-3'  37  Sequenced  sequences  were  compared  to  the  databases  at  TAIR  (http://www.arabidopsis.org) and NCBI (http://www.ncbi.nlm.nih.gov/) using BLAST. Sequence  alignments  were  generated  using  Bioedit  software  (Hall,  1999;  http://www.mbio.ncsu.edu/BioEdit/bioedit.html) and Gene Runner (version 3.05; Hastings Software Inc., http://www.generunner.net/).  2.4 Extraction of seed mucilage  To an equal amount of seeds (125 mg) 5 mL of water were added, and the suspension gently swirled every 15 min for 1 h. The water extract was removed from the settled seeds; the seeds were rinsed with 2 mL of water and gentle swirling, and the water was combined with the extract. Five mL of 0.2 M and 2.0 M NaOH containing 3 mg ml– 1  NaBH4 were added sequentially to the settled seeds, with each extraction step repeated  as for water. The NaOH extracts were chilled and neutralized with glacial acetic acid, and aliquots saved for carbohydrate analyses. The majority of the extracts was dialyzed against running deionized water for 36 h, and then with several changes of nanopure water for 8 h.  38  2.5 Monosaccharide and linkage analyses  This part of work was done in the Carpita Lab in Purdue University by Danisha DeBowles. The uronosyl residues in the neutralized and dialyzed mucilage extracts were carboxyl-reduced with NaBD4 after activation with a water-soluble carbodiimide, as described by Kim et al. (1992) and modified by Carpita and McCann (1996). Uronosylreduced wall material (1 to 2 mg) was hydrolyzed in 1 mL of 2 M trifluoroacetic acid (TFA) at 120C for 90 min, and the supernatant was then evaporated in a stream of nitrogen. The monosaccharides were reduced with NaBH4 and alditol acetates were prepared as described previously (Gibeaut and Carpita, 1991).  Derivatives were  separated by gas-liquid chromatography (GLC) on a 0.25-mm x 30-m column of SP-2330 (Supelco, Bellefonte, PA). Temperature was held at 80°C during injection, then ramped quickly to 170C at 25C min–1, and then to 240C at 5C min–1 with a 10-min hold at the upper temperature. Helium flow was 1 mL min–1 with splitless injection. The electron impact mass spectrometry (EIMS) was performed with a Hewlett-Packard MSD at 70 eV and a source temperature of 250C. The proportion of 6,6-dideuteriogalactosyl was calculated using pairs of diagnostic fragments m/z 187/189, 217/219 and 289/291 according to the equation described in Kim and Carpita (1992) that accounts for spillover of 13C. For linkage analysis polysaccharides were  per-O-methylated with Li+  methylsulfinylmethanide, prepared by addition of n-butyllithium to dry dimethyl sulfoxide (DMSO) and methyl iodide according to Gibeaut and Carpita (1991). The per39  O-methylated polymers were recovered after addition of water to the mixture and partitioning into chloroform. The chloroform extracts were washed five times with a three-fold excess of water each, and the chloroform was evaporated in a stream of nitrogen gas. The partly methylated polymers were hydrolyzed in 2 M TFA for 90 min at 120°C, the TFA was evaporated in a stream of nitrogen gas, and the sugars were reduced with NaBD4 and acetylated. The partly methylated alditol acetates were separated on the same column as the alditol acetates; after a hold at 80°C for 1 min during injection and rapid ramping, the derivatives were separated in a temperature program of 160°C to 210°C at 2°C per min, then to 240°C at 5°C per min, with a hold of 5 min at the upper temperature. All derivative structures were confirmed by electron-impact mass spectrometry (Carpita and Shea 1989).  2.6 RNA isolation, RT-PCR and qRT PCR  RNA was isolated from plant tissues except siliques using TRIzol reagent (Invitrogen, ON, Canada; Simms et al., 1993). The extraction procedure was adapted (Downing et al., 1992; Western et al., 2004) to extract RNA from siliques because of their high content of polysaccharides. Siliques at specific stages were collected and ground in liquid nitrogen. 1 ml REB (25 mM Tris-Hcl pH 8.0, 25 mM EDTA, 75 mM NaCl, 1% SDS) was added to the dry powder and the RNA extracted with one volume of a decreasing solution series of phenol: CIA (Chloroform:Isoamyl alcohol=24:1) solutions, and finally with CIA. RNA was precipitated with 2 M LiCl on ice. RNA samples were  40  transcribed with SuperScript II reverse transcriptase (Invitrogen, ON, Canada) according to manufacturer`s instructions. For isolation of RNA specifically from seed coats/endosperm, seed coats of the appropriate stage were separated from the embryo using two pairs of fine forceps in distilled water under dissecting microscope. The seed coat tissue included the single layer of endosperm at later stages. The isolated seed coats were quickly frozen on dry ice and ground in liquid nitrogen. RNAqueous-Micro kit (Ambion) was used to extract RNA. First strand cDNA was synthesized using SuperScript III reverse transcriptase (Invitrogen, ON, Canada) according to manufacturer`s instructions. Gene specific primers (Table 2-3) were used to amplify cDNA fragments spanning an intron. GAPC was used as the loading control of RNA samples. GAPC, LUH/MUM1 and MUM2 were amplified under nonsaturating conditions. SYBR Green Supermix reagent (Bio-Rad, ON, Canada) was used to monitor the real time PCR reactions. qRT-PCR was performed using the MJ Mini Opticon real-time PCR system (Bio-Rad, ON, Canada). Actin2 was used as the internal control. Data were analyzed using Gene Expression Macro software (version 1.1; Bio-Rad, ON, Canada). Reactions were performed in triplicate.  2.7 Protoplast isolation  Arabidopsis mesophyll protoplasts were isolated following the method developed by Wang et al. (Kovtun et al., 2000; Wang et al., 2005). Wild type Col-2 plants were 41  Table 2-3 Primers for RT-PCR and qRT PCR  Primer name  Sequences  GAPCp1  5'-TCAGACTCGAGAAAGCTGCTAC-3'  GAPCp2  5'-GATCAAGTCGACCACACGG-3'  MUM1RT3F MUM1RT3R/At2g32700 P2  5'-TGATAGCAACAATGATATTCGC-3'  MUM2/At5g63800 F5  5'-GCAAACGATTCTCTCCTTGG-3'  MUM2/At5g63800 R5  5'-CCATGTAAGCTCCAGAGTCC-3'  MUM1realtime F  5'-CATCCACGAGCTTAGCAACA-3'  MUM1realtime R  5'-GGCCTGCTACCGTCATACAT-3'  MUM2p1  5'-GTTACAACGCCGGTTCAAGT-3'  MUM2p2  5'-ACGTGGACAACATGTCCTGA-3'  Actin2-RT-FW  5'-CCA GAA GGA TGC ATA TGT TGG TGA-3'  Actin2-RT-RW  5'-GAG GAG CCT CGG TAA GAA GA-3'  5'-AAAAGTCCTGAGCTCTCTGC-3'  42  germinated and grown under the conditions described above. Approximately 1 g of leaves from 4-6 week old plants were collected and cut into 0.5-1 mm strips. The strips were digested in 25 ml of enzyme solution (1% cellulase R10 (SERVA Electrophoresis, Heidelberg, Germany), 0.25% macerozyme R10 (SERVA Electrophoresis, Heidelberg, Germany), 0.4 M mannitol, 80 mM CaCl2, and 20 mM Mes(2(N-morpholino) ethanesulfonic acid), pH 5.7). Vacuum infiltration for 20 min was used to improve digestion. The digestion was conducted in darkness with slow shaking (40 rpm) for 3 hours. Protoplasts were filtered through a 200-mm nylon mesh (Spectrum Laboratories), washed by pre-chilled W5 solution (154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 5 mM glucose, and 1.5 mM Mes, pH 5.7), and incubated on ice for 30 min. The protoplasts were pelleted and resuspended in pre-chilled MMg solution (0.4 mM mannitol, 15 mM MgCl2, and 4 mM Mes, pH 5.7) and used for transfection.  2.8 Subcellular localization of MUM1  LUH/MUM1 cDNA was amplified by the primers MUM1 ACT4 F/R (5'ACGCGTCGACATTAATATGGCTCAGAGTAATTGGGAAGCTGA-3'/  5'-  ACGCGTCGACATCGATCTACTTCCAAATCTTTACGGATTTGT-3'). The fragment was digested with Sal I and introduced into the intermediate vector pBluescript2 SK+ to produce pBS-LUH. The LUH/MUM1 cDNA was excised from pBS-LUH with Cla I and Ase I and ligated into the destination vector (pUC19 containing a GFP sequence driven by the 35S promoter (Dr. Wang, personal communication) digested with Cla I and Nde I 43  (Ase I and Nde I make compatible ends) to produce the GFP-LUH gene. The same plasmid with no insert was used to produce free GFP (unfused to another polypeptide). Plasmid DNA was prepared by Endofree Plasmid Maxi Kits (Qiagen, ON, Canada). 10 µg of plasmid DNA was used for transfection of mesophyll protoplasts using the polyethylene glycol (PEG) method (Kovtun et al., 2000; Wang et al., 2005). An equal volume of 40% PEG 3350 (Sigma Aldrich) was added to 200 µl of protoplasts (2 X 104 protoplasts) together with the plasmid DNA. The PEG solution was removed after incubation for 20 min at room temperature. Protoplasts were resuspended in 1 ml WI solution (0.5 M mannitol, 20 mM KCl, and 4 mM Mes, pH 5.7). After incubation at room temperature for 18-20 hours in darkness, the GFP signals were observed under a Leica MZ6 microscope equipped with a digital camera. The images were manipulated using ImageJ (National Institutes of Health, USA) and Adobe Photoshop (Adobe Systems, CA, USA).  2.9 Transcriptional activity  LUH/MUM1 cDNA was obtained from the subclone pBS-LUH described above by digesting with enzymes Cla I and Ase I, and then ligated to the destination vector pUC19 containing the Gal4 binding domain (GD) driven by the 35S promoter (Wang et al., 2005; Wang et al., 2007). LUG was amplified using the primers LUG act F/R (5'TACTATTAATATGTCTCAGACCAACTGGGAAG-3'/  5'-  TTGAGAGCTCTCACTTCCACAGTTTCACTAGCTT-3'), and then linked to the same 44  destination vector as an Ase I-Sac I fragment. GD, Gal4-GUS, LexA-Gal4-GUS, LexA DD (LD)-VP16, and Chloramphenicol acetyltransferase (CAT) plasmids were obtained from Dr. Wang (Tiwari et al., 2003). The plasmid DNA was prepared by Endofree Plasmid Maxi Kits (Qiagen, ON, Canada), and transfected into mesophyll protoplasts by the PEG method as described above. Since different amounts of plasmid DNA were used in transfection assays (1x vs 2x) CAT plasmid was used to adjust DNA amounts such that all transfections had the same quantity of DNA. After incubation at room temperature for approximately 20h, protoplasts were lysed by Cell Culture Lysis Reagent (Promega, WI, USA; E153A). 100µl of 1 mM 4-methylumbelliferyl-β-D-glucuronide (MUG) was used as the substrate for β-glucuronidase (GUS) reaction to produce 4-methylumbelliferone (4MU). After incubation for 60 min at 37°C, 100 ml of 0.2 M Na2CO3 was added to stop the reaction. Fluorescence of 4-MU at 455 nm with excitation at 365 nm was measured from a Fluoroskan Finstruments Microplate Reader (MTX Lab Systems Inc., VA, USA; Jefferson et al., 1987; Fujii and Uchimiya, 1991).  2.10 Screening for mum4-1 modifiers  The Arabidopsis mum4-1 seeds were mutagenized with ethylmethane sulfonate (EMS) by Dr. Tamara Western. M2 seeds from approximately 100 M1 plants were pooled. M3 seeds from individual M2 plants were harvested and examined for seed coat phenotypes separately. Dry seeds were treated with 0.5 M EDTA solution for 1 hour,  45  before staining with aqueous 0.01% (w/v) ruthenium red (Sigma-Aldrich) for 2 hours and examined under a dissecting microscope. Candidate mum4-1 modifiers were examined in the next generation (M4) in order to check if the phenotypes were heritable. Putative suppressors of mum4-1 were checked for the possibility of wild type contamination of seed stocks by determining if they were homozygous for the mum4-1 allele. Genomic DNA of putative suppressor mutants was used as a template for PCR amplification of MUM4 (primers MUM4 p1/p8), the resulting products digested with of Mse I and fragment sizes determined by gel electrophoresis. The  wild  type  produced  3 bands  (230+139+97bp)  and  mum4-1  4  bands  (165+139+97+65bp). During genetic analysis of the modifier mutants, Pearson's chi-square test and Student`s T-test were applied to determine if the phenotype segregations match the expected Mendelian ratios.  46  3 mum1  Phenotypic  Analysis  and  Cloning of the MUM1 Gene 3.1 Introduction  As introduced in chapter 1, Arabidopsis seed coats are useful as a system to study aspects of cell wall biosynthesis, for the following reasons: 1. seed coats release mucilage upon imbibition; 2. the major component of mucilage is pectin; 3. mucilage is easily observed under the microscope after staining; 4. the seed coat mucilage is dispensable under the laboratory conditions. Thus the seed coat system can be used to identify mutants defective in pectin biosynthesis, and, subsequently, the corresponding genes which provide insight into the process of pectin production. In an effort to identify seed coat mucilage mutants, M3 seed from a population of 1000 ethylmethane sulfonate (EMS)-mutagenized lines of Arabidopsis were checked for a mucilage phenotype. Twelve mutants with altered seed coat mucilage, representing five loci, were identified. The mutants were named mucilage-modified (mum1) through mum5 (Western et al., 2001). The mum1 and mum2 mutants were characterized by the inability to release mucilage on hydration (Western et al., 2001). Since the phenotypes could result from changes in the composition and/or the amount of mucilage, mum1 and mum2 were checked for mucilage polysaccharide content. Whole seeds were ground for the comparison between wild type and the mutants, because neither mum1 nor mum2 extrude 47  mucilage in water. Both mum1 and mum2 showed a similar profile of the monosaccharide to that of wild type seeds, although mum1 had a slightly increased content of most sugars, compared to wild type seeds. The significance of this increase is unclear. The mum2 mutant has been further characterized and the MUM2 gene cloned. MUM2 encodes a β-galactosidase (Macquet et al., 2007b; Dean et al., 2007). The seed coat development of mum2-1 was identical to that of wild type. Carbohydrate linkage analysis of Na2CO3-extracted mucilage indicated that the mucilage RG I of mum2-1 has more side chain branches than wild type, and mucilage monosaccharide analysis revealed a relative increase in RG I side chain sugars galactose and arabinose to backbone sugars rhamnose and galacturonic acid.  Thus MUM2 is proposed to remove side-chain  galactose sugars and this impacts, in some way, the ability of mucilage to swell in water. The primary focus of my thesis is the characterization of the mum1 mutant. In this chapter, I describe the phenotype analysis, the positional cloning of MUM1 and the characterization of the MUM1 expression pattern and subcellular localization. Since the positional cloning data indicated that MUM1 encodes a putative transcription factor that is a homologue of a known transcriptional repressor, the transcriptional activity of MUM1 was also tested.  48  3.2 Results 3.2.1 The seed coat mucilage phenotype of mum1  When dry mature seeds of wild type are put into water, a thick layer of mucilage extrudes from the epidermal cells. The mucilage can be stained with ruthenium red, and observed easily under a light microscope. However, no visible mucilage was extruded by mum1-1 seeds under these conditions (Figure 3-1). This phenotype is similar to that of mum2. mum2 can release some mucilage when treated with chelators or alkali (Dean et al., 2007). Chelators help to release mucilage by extracting the Ca2+ that cross-links the unesterified GalA, the monosaccharide comprising homogalacturonan (HG). Alkali can hydrolyze ester-linked GalA. HG is one of three major components of pectin. It is partially methylesterified at the C-6 position of GalA (Fry, 2000). We tested the ability of both chelators and alkali to allow for the extrusion of mucilage from mum1-1 seeds. Similar to their effect on unextruded mum2-1 mucilage (Dean et al., 2007), EDTA, EGTA and CDTA at 0.05M, the weak alkali Na2CO3 (1M), and strong alkali KOH (0.5M) resulted in the release of mum1 mucilage (Figure 3-1), except that mum1-1 seeds released more mucilage than mum2-1 when treated with the same chemical. These data suggest that, as for the mum2 mutant, the mum1 mutant synthesizes mucilage but the mucilage does not extrude. Some mucilage mutants like mum4/rhm2 have morphological defects such as a flattened columella (Western et al., 2001; Western et al., 2004; Usadel et al., 2004) that can be observed using scanning electron microscopy (SEM). For this reason, I compared  49  Figure 3-1 Seed coat mucilage phenotypes of wild type, mum1-1 and mum2-1  mum1 mucilage lacks the capability to extrude following exposure to water. All the seeds were stained with ruthenium red after treatment with the indicated solutions. mum1-1 and mum2-1 could not release any mucilage when treated with water, unlike wild type seeds which could form a capsule of mucilage surrounding the seeds. Both mutants released a small amount of mucilage in other chemical solutions. mum1-1 released more mucilage than mum2-1 under the same treatment. Scale bars=50µm.  50  the cell surface features between wild type and mum1 seeds using SEM, but no differences were observed (Figure 3-2). The mum1 seed coat mucilage phenotype might have cytological developmental defects that would provide clues concerning the timing and nature of MUM1 function. To examine the cell structure during development, seeds of wild type and mum1-1 at 4, 7 and 10 DPA were observed using light microscopy. When examined in this way, the development of wild type and mum1 were found to be indistinguishable (Figure 3-3). In order to investigate if the failure of mum1 seed mucilage to extrude is due to an inability of the mucilage to expand when exposed to water, wild type and mum1-1 mature seeds were embedded in paraffin wax without fixation, and then sectioned (Macquet et al., 2007b; Dean et al., 2007). The thickness of the sections (20µm) ensured that most of the seed coat epidermal cells were not intact, exposing the mucilage without the primary cell wall as a barrier. The sections, mounted on slides, were exposed to an aqueous solution containing the stain ruthenium red. The mucilage extruded from wild type but not from the mum1 sections (Figure 3-4). These results suggest that the mum1 mucilage, like that of mum2 (Dean et al., 2007; Macquet et al., 2007b) has lost the capability to expand, although we cannot exclude the possibility that, in addition, the phenotype results from stronger tangential primary cell walls.  51  Figure 3-2 Scanning electron microscopy of wild type and mum1 seeds  Mature dry seeds of wild type and mum1 show similar epidermal-cell surface features under the scanning electron microscope.  52  Figure 3-3 Seed coat development of wild type and mum1  Developing seeds at 4, 7 and 10 DPA were fixed, sectioned and stained with toluidine blue. The seed epidermal cells at these stages were examined using light microscopy. The cytological characteristics of developing mum1 seed coat epidermal cells are similar to that of wild type.  53  Figure 3-4 Test for seed coat mucilage expansion  mum1 mutant mucilage lacks the capability of expanding following hydration. Mucilage expands (indicated by double-headed arrow) from sections of wild type seed stained with ruthenium red while mucilage in sections of mum1 seed stays in the mucilage pockets (indicated by arrowhead). Scale bars = 50µm.  54  3.2.2 Chemical analysis of mum1 mucilage  The composition and structural analysis of mucilage reveals differences between mum1 mucilage and wild type. Given the similar mucilage extrusion phenotypes of mum1 and mum2, mum2 mucilage was also included for comparison. This part of work was done in the Carpita Lab at Purdue University by Danisha DeBowles. The amount of mucilage released sequentially in water, 0.2 M NaOH, and 2 M NaOH was determined as uronic acid equivalents (Figure 3-5). Only the wild type released significant amounts of mucilage in water. However, 0.2 M NaOH caused rupture of the epidermal wall to release large amounts of mucilage from mum1 seeds and lesser amounts from mum2 seeds. The 0.2 M NaOH is not strong enough to remove the gel layer tightly held by wild type and mutant seeds, but 2 M NaOH strips this layer from wild type and mutant equally (Figure 3-5). Because of the differences in mucilage extraction profiles, monosaccharide and linkage analyses were performed to determine the compositions. After extraction of the mucilage fractions in water, 0.2 and 2 M sodium hydroxide, neutralized and dialyzed preparations were reduced with sodium borodeuteride to label former uronic acids as their 6,6-di-deuterio-sugar residues. Monosaccharide analysis showed that for water extracts, wild type released a high proportion of Rha and GalA, indicative of RG I, whereas the small amounts of material from mum1 and mum2 were mostly HG, as judged by high proportions of GalA compared to vanishingly small amounts of Rha (Table 3-1). Addition of 0.2 M NaOH caused disruption of the outer seed coat wall and release of large amounts of material containing primarily Rha and GalA from the mutants as well as additional mucilage from wild type (Figure 3-5, Table 3-1). The tightly held gel layer  55  Figure 3-5 The relative uronic acid/fraction of wild type, mum1-1 and mum2-1  Mature dry seeds were treated with water, 0.2 M NaOH, and then 2.0 M NaOH sequentially, in order to extract mucilage. These extracts after dialysis were carboxyl reduced with NaBD4 to reveal uronic acids as their respective neutral sugars. The error bars represent the SD from 3 biological replicates.  56  Table 3-1 Monosaccharide distribution in mole percentage of carboxyl-reduced mucilage polysaccharides from seeds successively extracted with water, 0.2 M NaOH, and 2.0 M NaOH  57  Extract  Water  0.2 M NaOH  2.0 M NaOH  Genotype  Col  mum1  mum2  Col  mum1  mum2  Col  mum1  mum2  Rha  40.9±3.3  3.9±0.3  5.8±4.0  37.7±5.1  31.9±4.2  27.6±1.7  33.9±0.7  29.6±5.5  27.2±1.6  Fuc  trc  trc  trc  trc  trc  trc  trc  trc  trc  Ara  0.4±0.0  2.3±0.4  2.2±0.2  0.8±0.0  2.3±0.8  4.1±1.6  4.7±1.3  2.8±1.2  6.7±0.2  Xyl  2.4±0.0  3.2±0.3  3.8±0.6  3.1±0.0  3.2±0.7  2.0±1.1  6.8±0.5  6.8±2.0  8.1±1.3  Man  0.6±0.0  3.8±0.8  4.6±0.2  1.3±0.1  1.8±0.8  2.0±0.7  5.1±0.0  6.0±1.9  6.4±2.2  Gal  3.9±0.1  7.5±0.8  6.7±0.6  5.0±0.4  9.3±1.7  12.1±0.2  7.3±0.7  10.3±0.4  10.4±0.4  Glc  1.2±0.0  11.4±1.0  17.3±5.7  2.3±0.3  4.5±2.6  3.7±0.6  7.9±0.1  9.0±3.2  9.6±3.5  GalA  50.8±3.0  68.1±3.4  59.8±2.8  49.9±4.3  47.2±1.1  48.7±3.3  34.5±1.9  35.6±2.3  31.7±4.8  Values are mean±variance of two independent extractions; tr = trace amounts less than 0.05%  Table 3-2 Comparison of linkage distribution in mucilage and other polymers extracted from seeds sequentially with water, 0.2 M NaOH, and 2.0 M NaOH (to be continued)  Extraction ___________________ Sugar Fucose: t-Fuc  Water ____________________ Col mum1 mum2  0.2 M NaOH __________________ Col mum1 mum2  2.0 M NaOH Col  mum1  mum2  tr  tr  tr  tr  tr  tr  tr  tr  Rhamnose: t-Rha  0.1  tr  tr  tr  0.2  0.2  0.5  tr  0.5  2-Rha  38.7  2.8  5.2  35.7  25.6  22.3  31.0  23.2  21.4  2,3-Rha  0.6  0.3  0.2  0.8  0.5  0.4  0.8  0.4  0.5  2,4-Rha  1.5  0.8  0.4  1.2  5.6  4.7  1.6  6.0  4.8  Arabinose: t-Araf  0.1  1.0  0.1  0.7  1.5  2.8  2.7  1.9  3.7  2-Araf  n.d.  tr  tr  n.d.  tr  tr  0.7  0.2  0.8  3-Araf  n.d.  tr  tr  n.d.  tr  tr  tr  tr  5-Araf  0.3  1.2  2.0  0.1  0.7  1.0  1.3  0.7  1.9  2,5-Araf  n.d.  tr  tr  n.d.  tr  0.2  tr  tr  0.1  3,5-Araf  n.d.  tr  tr  n.d.  tr  tr  tr  tr  0.2  58  tr  tr  Values are mean of two samples, with variance less than 5% for all samples. Values are scaled to monosaccharide analysis in Table I; n.d. = not detected, and tr = trace amounts less than 0.05%.  Table 3-2 Comparison of linkage distribution in mucilage and other polymers extracted from seeds sequentially with water, 0.2 M NaOH, and 2.0 M NaOH (continuing) Extraction ___________________ Sugar Xylose: t-Xyl  Water ____________________ Col mum1 mum2  0.2 M NaOH __________________ Col mum1 mum2  2.0 M NaOH Col  mum1  mum2  59  0.3  tr  0.2  0.4  0.4  0.2  1.0  0.5  0.6  2-Xyl  0.1  0.2  0.3  0.3  0.3  0.2  0.6  0.5  0.7  4-Xyl  0.7  1.2  1.7  1.5  1.5  0.8  3.1  3.4  3.7  2,4-Xyl  1.1  1.5  1.4  0.8  0.9  0.7  1.9  2.1  2.7  3,4-Xyl  0.2  0.3  0.2  0.1  0.1  0.1  0.2  0.3  0.4  tr  tr  tr  tr  tr  tr  tr  tr  tr  4-Man  0.5  3.4  3.7  1.1  1.5  1.7  1.3  1.3  2.1  4,6-Man  0.1  0.4  0.9  0.2  0.3  0.3  3.8  4.7  4.3  tr  2.8  1.8  3.2  8.4  8.6  6.8  9.7  9.4  3-Gal  tr  tr  tr  tr  tr  0.5  tr  tr  tr  4-Gal  3.7  4.7  4.9  1.5  0.1  0.3  tr  0.5  0.4  Mannose: t-Man  Galactose: t-Gal  Values are mean of two samples, with variance less than 5% for all samples. Values are scaled to monosaccharide analysis in Table I; n.d. = not detected, and tr = trace amounts less than 0.05%.  Table 3-2 Comparison of linkage distribution in mucilage and other polymers extracted from seeds sequentially with water, 0.2 M NaOH, and 2.0 M NaOH (continuing) Extraction ___________________ Sugar  Water ____________________ Col mum1 mum2  0.2 M NaOH __________________ Col mum1 mum2  2.0 M NaOH Col  mum1  mum2  60  6-Gal  n.d.  tr  tr  tr  tr  0.5  tr  tr  tr  3,4-Gal  0.2  tr  tr  0.3  0.8  0.6  0.3  0.1  0.6  3,6-Gal  tr  tr  tr  tr  0.1  1.6  0.2  tr  tr  Glucose: t-Glc  0.1  0.8  2.2  0.2  0.3  0.1  0.7  0.9  0.9  4-Glc  0.7  9.8  10.8  1.5  2.3  2.5  5.3  5.3  5.7  4,6-Glc  0.4  0.8  4.3  0.6  1.9  1.1  1.9  2.8  3.0  tr  0.2  1.7  1.2  2.9  2.8  2.7  0.1  0.3  4-GalA  46.7  67.1  55.4  46.4  40.4  41.8  29.3  31.4  26.3  3,4-GalA  4.1  0.8  2.7  2.3  3.9  4.1  2.5  4.1  5.1  Galacturonic Acid: t-GalA  Values are mean of two samples, with variance less than 5% for all samples. Values are scaled to monosaccharide analysis in Table I; n.d. = not detected, and tr = trace amounts less than 0.05%.  extracted by 2 M NaOH was similar in monosaccharide distribution between wild type and mutant. The gel layer is rich in Rha and GalA but also contains other sugars in greater abundance such as Xyl, Ara, Gal, and Glc. Carbohydrate linkage analyses confirmed that the mucilage released in wild type and mutant was primarily 2-Rha and 4-GalA, representing a relatively unbranched RG I backbone (Table 3-2). The presence of large amounts of primarily 4-GalA in the water extracts of mum1 and mum2 seeds confirms that a small amount of HG was the principal material present (Table 3-2). In contrast, the 0.2 M NaOH causes substantial uronic acidrich material to be released from the seed coats from both mum mutants, and linkage analysis shows most of the carbohydrate to be RG I. Additional amounts of mucilage are also released from wild type. Notably, the degree of branching of the RG I, as determined by the ratio of 2,4-Rha : 2-Rha, was substantially higher in both mum mutants compared to wild type; t-Ara and t-Gal residues in both mums were higher, accounting for the differences in Rha branch point residues. The 2 M NaOH extracts of both mum mutants of the gel layers also display increased RG I branching; whereas increases in t-Gal residues account for much of the increases in branching, increases in t-Ara over wild type amounts were found only in mum2 extracts (Table 3-2).  3.2.3 Positional cloning of MUM1  The mum1 mutant was isolated from an EMS-mutagenized seed population (Western et al., 2001). A backcross to wild type indicated that mum1 is a recessive  61  mutant (Western et al., 2001). Map-based cloning was used to identify the MUM1 gene. I generated a mum1 mapping population by crossing mum1 (Col-2 ecotype) and Landsberg erecta (Ler). Since the seed coat is maternal tissue, the phenotype of F2 plants (F2 lines) was scored by examining the F3 progeny of individual plants. Thirty-nine F3 lines showing the mum1 phenotype were used to determine the chromosome on which MUM1 is located. Seven simple sequence length polymorphism (SSLP) markers spread over all the 5 chromosomes were tested for linkage with MUM1. The marker NGA168 showed high linkage with MUM1 indicating that the MUM1 gene is located on Chromosome II. More SSLP markers from chromosome II, including T30L20II-10, F6K5II-13, NGA361 and F3G5II-16 were used to confirm the linkage. Fine structure mapping was then done with 420 F3 lines having either wild type or mum1 phenotypes using 15 SSLP markers (Figure 3-6). The region containing MUM1 was positioned between the molecular markers 13834 and 13937. There were 28 open reading frames located in this 103Kb interval. 29 available SALK insertion lines for the 28 genes were obtained and checked for seed coat mucilage phenotypes. Only the seeds of SALK_107245 showed a mum1 phenotype suggesting that the gene mutated in this line, At2g32700, is MUM1. When At2g32700 from mum1 and wild type are sequenced, a Cto-T transversion was identified. This nucleotide change is predicted to be a nonsense mutation that changes the 97th codon encoding a Glutamine to a Stop. We identified five alleles of At2g32700 from available T-DNA insertional (SALK_107245C and SALK_097509) and TILLING mutant lines (luh_172H3, luh_147A6 and CS90546; Figure 3-7; Seattle TILLING Project, http://tilling.fhcrc.org; Alonso et al., 2003). Each allele had a phenotype similar to mum1-1 (Figure 3-8; data not 62  Figure 3-6 The positional cloning of MUM1  The genetic map containing the MUM1 gene on the Chromosome II of Arabidopsis is represented schematically. The positions of SSLP markers on the chromosome II are indicated with arrows as well as numerically by the number following the @ symbol. The bottom map is an expanded view of the blue region in the top map. The pink region is the smallest interval obtained for the MUM1 locus.  63  A  Figure 3-7 LUH/MUM1 gene and protein structure (to be continued)  64  B  Figure 3-7 LUH/MUM1 gene and protein structure (continuing) A. The exons of the LUH/MUM1 gene are represented as bars, linked by lines representing introns. The coding regions are labelled in grey, from ATG to TAG. The untranslated regions (UTR) are labelled in black. The positions of the mutations of various alleles are shown. B. The predicted LUH/MUM1 protein is 787 amino acids in length. The numbers above the bar represent the amino acid position. The LUFS domain (black bar) is located at the N-terminus, and WD40 repeats (grey bar) at the C terminus (http://smart.embl-heidelberg.de/). The arrows indicate the positions of the mutations of various alleles.  65  wild type  luh-5/mum1-1  luh-6  Figure 3-8 The phenotype of the weak allele of luh-5/mum1-1  Mucilage phenotype of luh-6. luh-6 seeds extrude much less mucilage than wild type after shaking in water and staining in ruthenium red but more than luh-5/ mum1-1 seeds.Scale bars = 50µm.  66  shown). Sequence analysis of At2g32700 suggested that the gene encodes a transcription factor related to LEUNIG (LUG) named LEUNIG_HOMOLOG (LUH) with mutant alleles luh-1, luh-2, luh-3 (luh_172H3, luh_147A6, SALK_107245C respectively; Sitaraman et al., 2008) and luh-4 (SALK_097509; Stahle et al., 2009). Further, crosses between mum1-1 and the known luh alleles luh-1 and luh-4 produced F2 progeny that failed to extrude mucilage confirming that all three mutants represent luh alleles. We designate the two new alleles as luh-5 (mum1), and luh-6 (CS90546). The latter, a missense allele causing a change of Glu73 to Lys is a weak allele that results in the release of some mucilage when treated with water (Figure 3-8). To confirm that the mutation in At2g32700 was responsible for the mum1 phenotype, molecular complementation of mum1 was done. Wild type MUM1 genomic sequence, including 2.6 kb of 5` sequence, a 4.6 kb ORF and 0.6 kb of 3` sequence was cloned into the binary transformation vector pART27 and transformed into mum1 plants via Agrobacterium transformation. The mum1 mutant plants transformed with the MUM1 gene had a wild type phenotype while those transformed with the empty vector showed no such rescue (Figure 3-9). The open reading frame of LUH encodes a predicted protein of 787 amino acids. The N terminus of the predicted protein is defined as the LUFS domain, since this domain is found to be conserved in LUG, LUH, yeast Flo8, and human SSDP (for singlestranded DNA-binding protein). The function of the LUFS domain is still unclear, although in LUG, it is crucial for interaction with the cofactor SEUSS (SEU; Sridhar et al., 2004). The LUFS domain contains a LisH (Lissencephaly homology) domain that  67  Figure 3-9 Complementation test of MUM1  The MUM1 genomic sequence including sequences both upstream and downstream of MUM1 was cloned into the vector pART27. Both this construct and the empty plasmid were transformed into mum1 via Agrobacteriam. Only the plants with MUM1 showed a mucilage phenotype different from mum1. Scale bars=100 µm.  68  retains protein-binding function to result in protein dimerisation and tetramerisation (Cerna and Wilson, 2005). The C terminus contains several WD40 repeats. The WD40 repeat is usually 40 amino acids long, with a Tryptophan -Aspartic acid (W-D) dipeptide at the end. This motif is believed to be involved in protein-protein interactions. (http://smart.embl-heidelberg.de/; Figure 3-10). There are Q (Glutamine)-rich regions between the LUFS and WD40 domains (Sitaraman et al., 2008).  3.2.4 MUM1 expression pattern  To understand the relationship between LUH and the mum1 phenotype, it is important to investigate when and where the LUH gene is expressed in the course of the seed development. I used reverse transcriptional (RT) PCR to determine the qualitative pattern of MUM1 expression among the major plant organs: stem, root, leaf, and silique and quantitative reverse transcription PCR (qRT-PCR) to measure the transcript level quantitatively. RT-PCR data showed that LUH transcript was present in all tissues examined (siliques at 7 DPA, rosette leaves, cauline leaves, roots (6 days after germination), stems and open flowers; Figure 3-11A). In order to investigate more accurately the LUH expression in the seed coat, qRTPCR analysis was used. RNA was isolated from the seed coats at 4, 7 and 10 DPA. Because it is difficult to remove the endosperm from the seed coat at later stages of the  69  70 Figure 3-10 The alignment of LUH and LUG proteins The predicted protein sequences of LUH and LUG were aligned in the BioEdit software. Identical residues are in colour and represented as dots in the LUG sequence. The dashes represent the gaps. The WD40 repeats at the C terminus are underlined.  Figure 3-11 LUH expression analyses  (A) LUH expression in the indicated tissues was determined by RT-PCR. LUH was expressed in all the tissues examined. GAPC was used as the loading control. (B) The amount of LUH transcripts in three stages (4, 7 and 10 DPA) of seed coat development were examined by qRT-PCR. The data are presented as the relative change, where the LUH expression level at 4DPA was set as 1.0. LUH was expressed at all stages but most highly at 10 DPA. The error bars indicate SD derived from three independent biological replicates. The star indicates a significant difference from the expression level of 4 DPA assessed by Student`s t test (T=7.4475, P<0.01).  71  seed development, the gene expression data in seed coat includes expression in the endosperm. The results obtained from 3 biological replicates show that LUH is expressed during all stages of the seed coat development examined with the highest expression at 10 DPA (Figure 3-11B).  3.2.5 Subcellular localization of MUM1  The LUG gene product is located in the nucleus where it acts as a transcriptional repressor limiting the expression of AGAMOUS (AG), the C class floral homeotic gene, to the outer whorls of a flower (Liu and Meyerowitz, 1995). As a protein with high sequence similarity to LUG, I asked whether LUH might also be localized to the nucleus. To determine the subcellular localization of LUH, a 35S:GFP-LUH chimeric gene was expressed in mesophyll protoplasts (Sheen, 2002) and the subcellular location of GFP observed using fluorescence miscroscopy. DAPI staining was used to indicate the position of the nucleus. My results (Figure 3-12) confirmed that the subcellular localization of LUH is in the nucleus.  3.2.6 The transcriptional regulatory activity of LUH  To determine whether LUH acts as a transcriptional repressor or activator, the gene was fused in frame to the gene encoding Gal4 DNA binding domain (GD-LUH). In the test for a transcriptional repressor, LD-VP16 (LexA binding domain-VP16) and 72  Figure 3-12 Subcellular localization of LUH  (A) Arabidopsis mesophyll protoplast observed by Nomarski optics. (B) Localization of protoplast nucleus using DAPI staining (false coloured red). (C) Localization of GFP-LUH to the protoplast nucleus (false coloured green). (D) Localization of free GFP in a protoplast (false coloured green).  73  reporter LexA-UASGal4:GUS (UASGal4 is an upstream activation sequence of Gal4 promoter) were co-transfected with GD-LUH. Since VP16 is a known activator, it increases the background level of GUS expression. However, GD-LUH failed to decrease GUS expression (Figure 3-13A), suggesting that LUH is not a transcriptional repressor. To test whether LUH is an transcriptional activator, GD-LUH and the reporter UASGal4GUS were co-transfected into mesophyll protoplasts (Liu et al., 1994; Sheen, 2002; Wang et al., 2005). Because of the binding of GD to UASGal4, the properties of LUH can control the expression of GUS. The LUH protein significantly increased the GUS activity above that of the empty vector negative control, suggesting that LUH acts as a transcription activator rather than a repressor (Figure 3-13B). However, relative to the VP16 positive control (Triezenberg et al., 1988), activation by LUH was modest. Given the high sequence similarity between LUH and LUG, it was surprising to find that LUG is reported to be a repressor in flower (Sridhar et al., 2004) while LUH seems to be an activator. For this reason a GD-LUG chimeric gene was constructed and the activation assay was repeated using both GD-LUH and GD-LUG. The results of this assay suggest that LUG as well as LUH acts as modest transcriptional activators under the conditions of this assay (Figure 3-13).  3.3 Discussion  The mature dry seeds of luh-5/mum1-1 cannot release mucilage upon hydration, although the seed epidermal features and the cellular features throughout development 74  A 12000  Ralative GUS Activity  10000 8000 6000 4000 2000 0  Figure 3-13 LUH transcriptional activation assay (to be continued)  75  B 18000  Ralative GUS Activity  16000 14000 12000 10000 8000 6000 4000 2000 0  Figure 3-13 LUH transcriptional activation assay (continuing) A. GD-LUH was tested initially for the transcriptional repressor activity, given that LUG is a repressor. GD was used as a negative control. OFP1 is a known repressor (Wang et al., 2007) and VP16 a known activator (Triezenberg et al., 1988). The relative GUS activity was measured by detecting the GUS reaction product 4-MU, which excites at 365nm. B. The vectors GD (Gal4 DNA Binding Domain), GD-LUH, GD-LUG, GD-OFP1 and GD-VP16 were individually transfected into mesophyll protoplasts together with the reporter UASGal4-GUS and the GUS activity was measured. 2X indicates that the corresponding amount of DNA used in the assay was doubled. Error bars indicate SD.  76  appear indistinguishable from those of wild type. A mucilage expansion assay indicated that the luh-5/mum1-1 mucilage loses the capability to expand in water. The chemical analysis of luh-5/mum1-1 mucilage reveals that more side chains are found in the mutant than wild type. The LUH gene was cloned and its product identified as a putative transcription factor, which is localized in the nucleus, and has a transcriptional activator function. Our data suggest that MUM1 is indirectly involved in mucilage structural modification and that its targets could be genes encoding carbohydrate-active enzymes.  3.3.1 LUH /MUM1 is required for normal mucilage structure  The MUM1 gene was identified on the basis of a mutation that results in the failure of seed coat mucilage to extrude on hydration of mature seeds. We have cloned MUM1 and shown that it corresponds to the previously identified LUH gene (Conner and Liu, 2000; Sitaraman et al., 2008). Genetic analysis has suggested that LUH is redundant with LUG function in controlling floral morphogenesis, leaf polarity, embryo development and shoot apical meristem function (Sitaraman et al., 2008; Stahle et al., 2009). We have identified a novel role of LUH in producing seed coat mucilage with the correct hydration properties. The expression of LUH in the seed coat/endosperm (Figure 3-11) is consistent with such a role. Mature dry seeds of luh release little or no mucilage upon hydration. Failure to extrude mucilage could be due to the inability to synthesize high enough amounts of mucilage, a strengthened primary cell wall that fails to rupture during hydration, or  77  production of mucilage with modified composition that is unable to expand upon hydration. The luh/mum1 appears to make normal amounts of mucilage. This is reflected in the epidermal features and the cytological structure of mum1 seeds that are indistinguishable from those of wild- type throughout development, unlike mutants that synthesize low amounts of mucilage (Penfield et al., 2001; Western et al., 2001b; Western et al., 2004; Usadel et al., 2004). Indeed, monosaccharide analyses of ground whole seed suggest that luh/mum1 mutant seed is not deficient in mucilage (Western et al., 2001). Therefore it is unlikely that LUH/MUM1 influences the amount of mucilage produced. Similar to mum2 mutants, luh/mum1seed mucilage fails to expand even when sectioning directly exposes the mucilage to water, suggesting that the lack of mucilage extrusion in the seed is due to changes in the chemical properties of the mucilage rather than that of the primary cell wall (Dean et al., 2007; Macquet et al., 2007b). This hypothesis is consistent with the chemical analysis of luh/mum1 mucilage that also indicates changes in mucilage structure. The mum2 and luh-5/mum1-1 mutants have higher mole percentages of the RG I side chain monosaccharides galactose and arabinose relative to the backbone sugars rhamnose and galacturonic acid, suggesting the presence of more RG I side chains. Taken together, these data suggest that LUH/MUM1, like MUM2, is required for modification of mucilage RG I that impacts the ability of mucilage to swell upon hydration.  78  3.3.2 LUH /MUM1 encodes a putative transcription factor  The sequence of LUH has homology to WD40 transcription factors and is closely related to LUG, a known transcription factor reported to be a repressor in flowers (Sridhar, 2004; Sitaraman et al., 2008). Based on the conserved domains of WD40 and LisH (lissencephaly homology), both LUH and LUG are grouped into a small gene family of 13 members in Arabidopsis (Liu and Karmarkar, 2008), although not all these genes are highly related phylogenetically. The best studied of these, LUG, was identified on the basis of a mutation that enhanced the phenotype of the floral homeotic mutant ap2. Ectopic expression of the class C homeotic gene AG in lug suggests that AG expression is repressed by LUG in the whorls of sepals and petals (Liu and Meyerowitz, 1995). Besides flower development (Franks et al., 2002), LUG is also involved in gynoecial (Roe et al., 1997; Liu et al., 2000; Chen et al., 2000; Kuusk et al., 2006), leaf (Navarro et al., 2004; Cnops et al., 2004; Stahle et al., 2009) and vascular (Navarro et al., 2004; Franks et al., 2006) development. LUG localizes to the nucleus, has transcriptional repressor activity, and interacts both physically and genetically with transcription factor SEU (Sridhar et al., 2004) as well as FILAMENTOUS FLOWER (FIL), YABBY3 (YAB3) and YABBY5 (YAB5; Stahle et al., 2009). For these reasons, LUG is considered to be a transcription factor. Both LUG and SEU lack a DNA binding domain, suggesting that in order to function, LUG must interact with additional transcription factors (Sridhar et al., 2004). On the basis of deduced amino acid sequence, LUH is structurally similar to LUG with an overall amino acid identity of 44% (Conner and Liu, 2000), suggesting that, like 79  LUG, LUH acts as a transcription factor.  This hypothesis is supported by several  additional lines of evidence. First, LUH localizes to the nucleus (Figure 3-12). Second, a transcriptional activity assay suggests that LUH works as a transcriptional activator (Figure 3-13). Third, LUH has been shown to physically interact with the transcription factors SEU, FIL, YAB3 and YAB5 (Sitaraman et al., 2008; Stahle et al., 2009). Finally, luh can enhance lug phenotypes suggesting that its function is redundant with that of LUG (Sitaraman et al., 2008; Stahle et al., 2009). Despite the functional similarities between LUH and LUG noted above, significant differences have also been identified. Their single mutant phenotypes are distinct, 35S-LUH was unable to rescue the lug mutant phenotype, and the global expression profiles of LUG and LUH are significantly different (Sitaraman et al., 2008). These phenotypic differences extend to seed coat mucilage as both lug and seu mutants have normal seed mucilage extrusion (Huang and Haughn, unpublished results).  3.3.3 The temporal and spatial expression of LUH  LUH is expressed throughout seed coat development with its highest level detected at 10 DPA (Figure 3-11B). These results are in agreement with recent microarray expression data using RNA derived from 3, 7 and 11 DPA seed coats (unpublished data from Haughn Lab and Datla Lab). In addition, the public database Arabidopsis eFP browser reveals a similar expression pattern, although in this case the RNA was derived from siliques and seeds (http://bar.utoronto.ca/) rather than specifically  80  from seed coats. Therefore our data represent the temporal expression pattern of LUH that LUH is expressed at every stage, and reaches its peak at the late stage of seed coat development. During seed coat development, mucilage production starts at about 4 DPA, and finishes by 8-9 DPA (Beeckman et al., 2000; Windsor et al., 2000; Western et al., 2000). Since MUM1 is required for correct mucilage biosynthesis/processing, it would be expected that the LUH gene is expressed prior to or during mucilage biosynthesis (4-9 DPA) as was observed. Curiously, the highest level of LUH expression detected occurred after the end of mucilage biosynthesis marked by the beginning of synthesis of the secondary cell wall (columella). One reasonable explanation could be that LUH also functions in other seed coat or endosperm processes that occur at 10 DPA. LUH is expressed in all organs tested suggesting that the gene has functions other than in seed coat development. Indeed, LUH plays a partially redundant role with LUG in flower development. Expression was also observed in tissues where no function is known, such as stems and leaves. Interestingly, although the seed coat mucilage phenotype is the most obvious difference in comparison with wild type plants, the LUH expression in siliques is much lower than that in other tissues (Figure 3-11A). The low expression may result from the specific expression of LUH in seed coat, and non-expression in other cell types in siliques.  81  4 The Regulatory Roles of LUH 4.1 Introduction  The previous chapter revealed that LUH encodes a transcription factor, with an activator function. One proposed model for LUH is to regulate the expression of some enzyme required for normal mucilage production. Given that luh and mum2 have a similar seed coat mucilage phenotypes (Western et al., 2001), and that MUM2 encodes a β-galactosidase that modifies mucilage structure (Dean et al., 2007; Macquet et al., 2007b), MUM2 is a good candidate for regulation by LUH either directly or indirectly. Therefore, I decided to test the putative direct relationship between LUH and MUM2. As described in the General Introduction, it was shown that a several transcription factors are involved in the mucilage regulatory pathway including AP2, TTG1, TTG2, GL2, MYB5/TT2, and TT8/EGL3 (Figure 1-3). The regulatory pathway controls the expression of MUM4, an enzyme essential for the mucilage biosynthesis. Since LUH is a newly identified transcription factor regulating mucilage production, I also attempted to determine the relationship between LUH and the other transcription factors influencing seed mucilage accumulation.  82  4.2 Results 4.2.1 The regulation of MUM2 by MUM1  MUM2 encodes a β-galactosidase, which is required for proper mucilage structure and impacts its hydration properties (Dean et al., 2007; Macquet et al., 2007b). The fact that LUH is a transcription factor and luh has a phenotype similar to mum2 (Western et al., 2001; Dean et al., 2007) is consistent with the hypothesis that LUH is a positive regulator of MUM2. For this reason, I checked MUM2 expression by qRT-PCR in seed coats/endosperm of both wild type and luh-5, at 7 DPA when MUM2 has its peak expression (Dean et al., 2007). The dramatic decrease of MUM2 transcript levels in luh-5 seed coats, compared to wild type, indicates that LUH is a positive regulator of MUM2 in this tissue (Figure 4-1). Since MUM2 is required for mucilage extrusion, the luh seed coat phenotype could be due in large part to the decrease in MUM2 activity. This hypothesis was tested by introducing 35S:MUM2-GFP protein fusions into the luh-5 mutant. Eight of 38 transgenic lines transformed with 35S:MUM2-GFP partially rescued the mucilage phenotype (Figure 4-2). In contrast, none of the 22 plants transformed with the vector alone, produced seeds that extruded mucilage. These results suggest that the luh-5/mum1 phenotype is due in large part to the loss of MUM2 activity. Among the eight transgenic lines with partial recovery, line 5 and 9 were randomly selected to check for contamination. The luh-5 mutant has a transition from C to T, which removes a Pst I site. Cleaved Amplified Polymorphic Sequence (CAPS) 83  Figure 4-1 Comparison of MUM2 seed coat expression in wild type and luh-5  qRT-PCR analysis was used to determine the MUM2 transcript levels in 7 dpa seed coats/endosperm of both wild type and luh-5. Data are presented as the relative fold change, where the MUM2 expression in the wild type was set as 1.0. MUM2 transcript in luh-5 seed coats is less than 10% of that in the wild type. The error bars indicate SD. The star indicates that the expression in luh-5 is significantly different from that in Col-2 as assessed by Student`s t test (T= 9.5045, P<0.01).  84  Figure 4-2 The seed coat mucilage phenotype of the transgenic plant luh5+35S:MUM2  Dry mature seeds were harvested and imbibed in water. The seed coat mucilage phenotypes were examined under a light microscope after staining with ruthenium red. Wild type and luh-5 were used as the positive and negative controls respectively. The seeds from the transgenic plant luh-5+35S:MUM2 showed partial recovery of the mucilage phenotype. Scale bars = 100µm.  85  primers were designed. The PCR products were digested with the enzyme Pst I. The wild type product showed two bands: 87 + 152 bp, and the luh-5 product showed only one band: 239bp, indicating that the transformants were indeed homozygous for the mutant allele and not contaminants.  4.2.2 LUH functions independently from other mucilage-related transcription factors  Several transcription factors were found to be involved in mucilage production and a regulatory pathway has been proposed (Western et al., 2004; Li et al., 2009; Gonzalez et al., 2009). TTG1, TT8/EGL3 and MYB5/TT2 form a complex, together with AP2, to regulate the expression of GL2 and TTG2 (Figure 1-3) in the outer seed coat. LUH, as a transcription factor, might also be involved in this regulatory pathway although the luh phenotype is distinct from that of loss-of-function mutations in the other genes. To determine if LUH is regulated by any of these transcription factors, the LUH expression levels were identified in seed coats of wild type and mutants ap2-1, ttg1-1, tt2-1 and gl2-1. The ecotype of Landsberg erecta (Ler) was chosen for the wild type control since all the mutants have the Ler background. The data indicate that the expression level of LUH in the seed coat is not reduced significantly in the mutants ap2-1, ttg1-1, tt2-1 and gl2-1 compared to wild type (Figure 4-3). These data suggest that LUH is not regulated by any of the transcription factors known to influence mucilage biosynthesis. LUH is involved in a distinct regulatory pathway for mucilage biosynthesis that includes MUM2 (Figure 4-4).  86  percenage WT expression  300 250 200 150 100 50 0  Ler  ap2-1  ttg1-1  ttg2-1  gl2-1  Figure 4-3 The comparison of LUH expression in wild type and mutants  The LUH transcripts were examined by qRT-PCR at 10 DPA seed coats, when LUH reached the highest expression during the seed coat development (Figure 3-11B). The data are presented as the percentage of wild type. The white and the black bars represent two biological replicates. The error bars indicate SD, derived from three technical replicates.  87  4.3 Discussion  4.3.1 LUH/MUM1 is required for activation of the MUM2 gene  The MUM2 gene encodes a β-galactosidase that is secreted into the apoplast and is believed to be involved in the removal of RG I side chains from seed mucilage to allow for mucilage extrusion (Dean et al., 2007; Macquet et al., 2007b). Data provided in this chapter strongly support the hypothesis that LUH/MUM1 functions, at least in part, to activate MUM2 expression. The luh mutant phenotype is strikingly similar to that of mum2, as would be expected for an upstream regulator. Second, levels of MUM2 transcript are drastically reduced in seed coats of the luh mutant relative to wild type (Figure 4-1). Third, p35S::MUM2-GFP can partially rescue the mucilage defect of the luh mutant (Figure 4-2). Thus formally, LUH/MUM1 can be considered to be a positive regulator of MUM2 although whether such regulation is direct or not remains to be determined. Interestingly, the luh mutant phenotype appears weaker than that of mum2 even for lines homozygous for putative null alleles (e.g. luh-5; Figures 3-1, 5). This could be explained by the fact that MUM2 transcript can still be detected even in a strong luh mutant (Figure 4-1) and therefore some MUM2 activity likely remains in a luh mutant background. These data suggest that, in addition to LUH, other positive regulators of MUM2 exist. Since all aspects of the luh seed coat phenotype can be explained by the loss of MUM2 activity it is possible that the MUM2 gene is the only target of LUH/MUM1 in the seed coat. However, since p35S::MUM2-GFP did not completely rescue the 88  luh/mum1 seed mucilage phenotype, the possibility that LUH/MUM1 regulates other genes required for seed mucilage remains. We have shown that LUH can act as a transcriptional activator, albeit a weak one relative to the strong activator VP16. This is consistent with its role as a positive regulator of MUM2 but not with its role as a regulator redundant with LUG previously shown to have repressor activity (Sitaraman et al., 2008). Curiously, LUG also acted as a positive regulator in our assays. A possible explanation for this discrepancy is that LUG (and possibly LUH) can function both as an activator or repressor depending on the specific co-regulator with which it interacts, and that the available co-regulators can vary depending on the origin of the cells used in the transcription assay. In any case, strong conclusions concerning the molecular mode of action of LUH await a more complete understanding of the other proteins with which it must interact to influence transcription.  4.3.2 The role of LUH is independent of other transcription factors controlling seed mucilage biology  In addition to LUH, several transcription factors influencing seed mucilage have been identified (reviewed in Arsovski et al., 2010; Figure 4-4). Differentiation of seed coat mucilage epidermal cells requires AP2 and the TTG1 protein complex. The TTG1 protein complex, which includes proteins TTG1, EGL3 and/or TT8 and MYB5 and/or TT2, activates at least two genes, GL2 and TTG2, encoding transcription factors required for synthesis of mucilage. One target of GL2 is the MUM4 gene encoding a rhamnose synthase. 89  Figure 4-4 Proposed regulatory pathways for seed coat mucilage biosynthesis  TTG1, EGL3/ TT8 and MYB5/TT2 form a complex, which regulates GL2 and TTG2. LUH/MUM1 is independent of the other transcription factors and can activate MUM2. Since over-expression of MUM2 can only partially rescue the mum1 phenotype, LUH/MUM1 may be needed to activate other genes (the question mark in the figure) for normal mucilage production. The dotted line indicates possible regulation of MUM2 by TTG1 complex and AP2. MYB61 is independent of other regulatory components.  90  Our data reveal a new regulatory pathway required for mucilage modification (Figure 4-4). LUH regulates MUM2 but is not regulated by AP2, the MYB5/TT2EGL3/TT8-TTG1 complex, GL2 or TTG2 (Figure 4-3). Whether MUM2 is also regulated by AP2 and/or the MYB5/TT2-EGL3/TT8-TTG1 complex remains to be determined.  91  5 Genetic Modifiers of mum4 5.1 Introduction As introduced in chapter 1, mum4 was isolated in a screen for seed coat mucilage defects among approximately 1,000 ethylmethane sulfonate (EMS) mutagenized M3 lines. The mum4 seeds cannot release any mucilage in water, unlike the wild type. However a thin layer of mucilage can be released when seeds are treated with the chelator EDTA, consistent with the low production of mucilage in mum4 (Western, 1998; Western et al., 2004; Usadel et al., 2004). This phenotype provides a background to screen for mutations in new genes which have a small impact on seed mucilage and may not be recognized when screening in a wild type background. Two possible types of modifier phenotypes can be identified: enhancers (mum4 enhancers = men) can release even less mucilage than mum4, and suppressors (mum4 suppressors = msu) can release more mucilage. Both MEN and MSU genes can provide insights into mucilage biosynthesis and/or secretion. Six novel men mutants have already been isolated using such a screen. These mutants were affected in either mucilage biosynthesis or mucilage release (Arsovski et al., 2009). I have conducted a similar screen for mum4 modifiers. As described below, more men were isolated, and msu mutants were identified for the first time.  92  5.2 Results  5.2.1 Screen for the modifiers of mum4-1  The seeds of mum4-1 were mutagenized with EMS by Dr. Tamara L. Western while she was a postdoctoral fellow in the Haughn laboratory. Half of the population, in 32 independent batches, remained in the Haughn laboratory to be screened, while Dr. Western screened the remaining half of the population in her own laboratory (Arsovski et al., 2009). Each of the 32 batches represented pooled seeds from approximately 100 M2 plants. I have completed the screening of all 32 batches once, using 50-70 seeds from each batch (about 2000 plants in total). M2 seed was planted and plants harvested individually. The dry seeds of each line were treated with 0.05M EDTA and then stained with ruthenium red. mum4-1 served as negative control. Col-2 was used as the positive control for suppressors, and ttg1-1, which cannot release mucilage even when treated with EDTA, for enhancers. From this screen 28 putative enhancers and 20 putative suppressors were identified. The progeny of the putative mutants were re-screened for the mutant phenotypes. Ten of the putative enhancers and 15 of the putative suppressors were found to be heritable. Among the putative suppressors, several mutants have a wild type like mucilage phenotype. Because these could be true suppressors or wild type contamination, I checked whether these plants were homozygous for the mum4-1 allele. The mum4-1 allele has an extra MseI site compared to wild type (Western et al., 2004). On the basis of  93  this assay, three of the 15 suppressors were determined to be wild type contaminants. An additional 2 suppressor lines were lost. Therefore, following screening and re-screening I identitifed 10 men and 10 msu mutants (Table 5-1).  5.2.2 The enhancers of mum4-1  As described earlier, mum4-1 can only release a small amount of mucilage after treatment with EDTA solution. The men mutants in a mum4-1 background (men mum4-1) can release little or no mucilage after being treated with EDTA (Figure 5-1) but otherwise have a mum4-1-like phenotype, lacking a volcano-shaped columella. Twenty-two mum4-1 modifier mutants from 2000 M2 plants screened is a high frequency even assuming there are many genes involved in the complex processes of pectin biosynthesis and secretion. One explanation is that some mutants are homozygous for mutations in the same gene, a possibility that increases in likelihood when one considers that some mutants were found in the same seed batch (refer to Table 5-1) and may not have arisen independently. In an attempt to determine allelism, 44 reciprocal crosses were conducted (Table 5-2). However, because some enhancers showed only subtle differences from mum4-1, and the phenotypes varied with growth conditions, it was often difficult to distinguish the phenotypes of the crossed F2 generation. As a result, the data of the backcross and the complementation were unreliable. For these reasons I was unable to determine how many different modifier genes I have identified.  94  ENHANCERS Nomenclature  G5-13 men7 mum4-1  G5-21 men8 mum4-1  H2-28 men9 mum4-1  H2-8 men10 mum4-1  H3-43 men11 mum4-1  H6-8 men12 mum4-1  H7-61 men13 mum4-1  I3-49 men14 mum4-1  I7-48 men15 mum4-1  J4-1 men16 mum4-1  Heritable  Yes  Yes  Yes  Yes  Yes  Yes  Yes  Yes  Yes  Yes  water  0  0  0  0  0  0  0  0  0  0  EDTA  0+  0+  0++  0  0+  0+  0+  0+  0  0+  SUPPRESSORS  H4-55 msu1 mum4-1  H5-40 msu2 mum4-1  H6-49 msu3 mum4-1  H8-62 msu4 mum4-1  I2-2 msu5 mum4-1  I6-33 msu6 mum4-1  I6-38 msu7 mum4-1  I6-54 msu8 mum4-1  J3-47 msu9 mum4-1  J7-41 msu10 mum4-1  Heritable avoid contamination  Yes  Yes  Yes  Yes  Yes  Yes  Yes  Yes  Yes  Yes  Yes  Yes  Yes  Yes  Yes  Yes  Yes  Yes  Yes  Yes  water  1  1  1  1  1  1  1  1  1  1  EDTA  1++  1+++  1++++  1+  1++++  1+  1++  1++  1++  1+++  Nomenclature  95  Table 5-1 The modifiers of mum4-1  The modifiers of mum4-1 were identified from an EMS mutagenized population and determined to be heritable if their progeny produced seed with a similar phenotype. The phenotypes of modifiers were checked in either water or EDTA solutions. ‘0’ represents no mucilage. ‘1’ stands for the level of mum4-1 mucilage quantity and ‘+’ indicates an increase in mucilage amount relative to mum4-1. Every batch was named as a letter plus a number. The number after dash represents an individual M3 line.  Figure 5-1 The phenotypes of the mum4-1 enhancer mutants Mature dry seeds were first shaken in EDTA, before being transferred into ruthenium red solution. The phenotypes were observed under the dissecting microscope. Col-2, mum4-1 and ttg1-1 were used as controls for comparison. The inset shows the collumela. 96  F2 men16 mum4-1 X men14 mum4-1 men12 mum4-1 X men14 mum4-1 men14 mum4-1 X men15 mum4-1 men11 mum4-1 X men14 mum4-1 men13 mum4-1 X men7mum4-1 men12 mum4-1 X men13 mum4-1 men7mum4-1 X men15 mum4-1 men7mum4-1 X men12 mum4-1 men12 mum4-1 X men8 mum4-1 men14 mum4-1 X men7mum4-1 men13 mum4-1 X men8 mum4-1 men14 mum4-1 X men13 mum4-1 men14 mum4-1 X men16 mum4-1 men12 mum4-1 X men10 mum4-1 men11 mum4-1 X men12 mum4-1 men14 mum4-1 X men10 mum4-1 men7mum4-1 X men11 mum4-1 men11 mum4-1 X men10 mum4-1  phenotypes mum4 men                     NOTES  some WT, contamination?  men alleles? 14=16 12=14 14=15 11=14 7=13 12=13 7=15 7=12 8=12 7=14 8=13 13=14 14=16 12=10 11=12 14=10 7=11 11=10  Table 5-2 The F2 phenotypes of reciprocal crosses between men mum4-1 lines (To be continued)  The F2 progeny of individual F1 plants from reciprocal crosses between the men mum41 lines were examined for mucilage phenotypes to determine if two lines are allelic to each other. The check marks represent the corresponding phenotypes. ‘men alleles?’ infers if two genes are alleles based on the corresponding phenotype. ‘=’ represents alleles, while ‘<>’ not alleles.  97  F2 men15 mum4-1 X men11 mum4-1 men14 mum4-1 X men9 mum4-1 men16 mum4-1 X men12 mum4-1 men16 mum4-1 X men8 mum4-1 men13 mum4-1 X men9 mum4-1 men16 mum4-1 X men11 mum4-1 men13 mum4-1 X men15 mum4-1 men7mum4-1 X men8 mum4-1 men14 mum4-1 X men7mum4-1 men7mum4-1 X men8 mum4-1 men11 mum4-1 X men13 mum4-1 men16 mum4-1 X men7mum4-1 men14 mum4-1 X men13 mum4-1 men13 mum4-1 X men8 mum4-1 men16 mum4-1 X men10 mum4-1 men16 mum4-1 X men14 mum4-1 men11 mum4-1 X men8 mum4-1 men16 mum4-1 X men8 mum4-1 men16 mum4-1 X men7mum4-1 men13 mum4-1 X men7mum4-1 men16 mum4-1 X men13 mum4-1 men13 mum4-1 X men10 mum4-1 men14 mum4-1 X men8 mum4-1 men14 mum4-1 X men7mum4-1 men16 mum4-1 X men14 mum4-1  phenotypes mum4 men                           NOTES  less than mum4-1 less than mum4-1 less than mum4-1 less than mum4-1 less than mum4-1  more than mum4-1, ???  men alleles? 11<>15 9<>14 12<>16 8<>16 9<>13 11<>16 13<>15 7<>8 7<>14 7<>8 11<>13 7<>16 13<>14 8<>13 16<>10 14<>16 8<>11 8<>16 7<>16 7<>13 16<>13 13<>10 8<>14 7<>14 14<>16  Table 5-2 The F2 phenotypes of reciprocal crosses between men mum4-1 lines (continuing)  98  Some of the known mucilage mutants have pleiotropic phenotypes. Unlike the mutants apetala2 (ap2) (Jofuku et al., 1994; Western et al., 2001) and aberrant testa shape (ats) (Leon-Kloosterziel et al., 1994), the seed shapes of men mum4-1 lines reassembled those of the wild type. Therefore, men mutants are unlikely to be homozygous for alleles of ap2 or ats. The mutation in TTG1 results in a glabrous leaf phenotype, and the seeds show the color of yellow cotyledons because of the transparent testa lacking of purple anthocyanin pigments (Koornneef, 1981). The mutant ttg2 shows similar trichome phenotype and seed color defects as ttg1 (Johnson et al., 2002). The mutant gl2 reveals short spike-like trichomes (Rerie et al., 1994). None of men mutants showed abnormalities in seed color or leaf trichomes indicating that the MEN genes are unlikely to be TTG1, TTG2 and GL2. Genetic complementation was used to determine if the new mutants carry alleles of any of the genes known to be required for normal seed mucilage including ATS, AP2, TTG1, TTG2, GL2, MYB61, MUM1 and MUM2. Since the known mutants do not have mum4 in their background, the F2 seeds of individual F1 plants from crosses of a known mutant to mum4 enhancer mutants will show the corresponding known mutant phenotype if men is allelic. Otherwise the F2 seeds will show a wild type phenotype (if men is recessive). The results reveal that the men mutants are not alleles of any of the mutants tested (Table 5-3).  99  F2 men10 mum4-1 X gl-2 men10 mum4-1 X ttg1-1 men7mum4-1 X ttg2-1 mum2-1 X men7mum4-1 myb61 X men7mum4-1 men9 mum4-1 X mum2-1 myb61 X men11 mum4-1 men11 mum4-1 X ttg2-1 men11 mum4-1 X gl2-2 men11 mum4-1 X mum2-1 myb61 X men12 mum4-1 men12 mum4-1 X ttg2-1 men13 mum4-1 X ttg2-1 men13 mum4-1 X ap2-7 myb61 X men13 mum4-1 men13 mum4-1 X gl2-1 men13 mum4-1 X ttg2-1 men14 mum4-1 X ap2-7 men14 mum4-1 X ttg1-1 mum2-1 X men15 mum4-1 mum2-1 X men16 mum4-1 myb61 X men16 mum4-1  phenotypes Col2 mum4 ttg1                        NOTES  Table 5-3 The F2 phenotypes of modifiers crossed with some known mucilage mutants Genetic complementation analysis was used to determine if Mum4 modifier mutants and previously characterized mucilage mutants were allelic. F2 seeds of individual F1 plants from the indicated crosses were checked for the mucilage phenotypes after being treated with EDTA and ruthenium red.  100  5.2.3 The suppressors of mum4-1  Seeds of the mum4-1 msu double mutants can release more mucilage than mum41 when treated with EDTA solutions. However none completely suppress the mum4 defect such that all double mutants can typically be distinguished from the wild type (Figure 5-2). Like mum4-1, the msu mum4-1 lines do not release mucilage in water (data not shown). No irregular seed shape or abnormal seed color was found in the msu mum4-1 lines. Although the trichomes of msu1 mum4-1 and msu3 mum4-1 reveal unusual shapes (data not shown) the trichome phenotypes were found to be unlinked to the seed coat mucilage phenotypes (data not shown). Reciprocal crosses between msu mutants were conducted to determine the number of genes involved. Because of difficulty in scoring the phenotypes, the F2 seeds derived from 46 crosses failed to reveal clear relationships among the msu mum4-1 lines (Table 5- 4). Therefore allelism among the msu mum4-1 lines was undetermined.  5.2.4 Genetic segregation analysis of mum4 modifier lines  Once the mutant phenotypes were confirmed to be heritable, genetic analysis was used to determine how many genes were responsible for the phenotype and if the mutant phenotype of interest was recessive or dominant, crucial information for both complementation tests and positional cloning of the genes of interest.  101  Figure 5-2 The phenotypes of the suppressors of mum4-1 Mature dry seeds were treated with EDTA and ruthenium red solutions sequentially and observed with a dissecting microscope. Col-2, mum4-1 and ttg1-1 were used as controls to compare the amount of the stained mucilage. The inset indicates the wild type structure of collumela. 102  F2 msu4 mum4-1 X msu2 mum4-1 msu2 mum4-1 X msu3 mum4-1 msu4 mum4-1 X msu1 mum4-1 msu1 mum4-1 X msu9 mum4-1 msu1 mum4-1 X msu3 mum4-1 msu4 mum4-1 X msu10 mum41 msu4 mum4-1 X msu3 mum4-1 msu9 mum4-1 X msu3 mum4-1 msu4 mum4-1 X msu3 mum4-1 msu4 mum4-1 X msu9 mum4-1 msu7 mum4-1 X msu4 mum4-1 msu9 mum4-1 X msu7 mum4-1 msu1 mum4-1 X msu7 mum4-1 msu9 mum4-1 X msu3 mum4-1 msu4 mum4-1 X msu2 mum4-1 msu5 mum4-1 X msu3 mum4-1 msu1 mum4-1 X msu6 mum4-1 msu6 mum4-1 X msu2 mum4-1 msu6 mum4-1 X msu2 mum4-1 msu6 mum4-1 X msu3 mum4-1 msu6 mum4-1 X msu3 mum4-1 msu6 mum4-1 X msu4 mum4-1 msu5 mum4-1 X msu6 mum4-1 msu5 mum4-1 X msu6 mum4-1 msu6 mum4-1 X msu9 mum4-1 msu6 mum4-1 X msu9 mum4-1 msu6 mum4-1 X msu8 mum4-1 msu1 mum4-1 X msu8 mum4-1 msu4 mum4-1 X msu8 mum4-1 msu4 mum4-1 X msu8 mum4-1 msu5 mum4-1 X msu8 mum4-1 msu7 mum4-1 X msu8 mum4-1 msu9 mum4-1 X msu8 mum4-1 msu10 mum4-1 X msu8 mum41  phenotypes msu mum4       NOTES  msu Alleles? 2<>4 2<>3 1<>4 1<>9 1<>3                               4<>10 3<>4 3<>9 3<>4 4<>9 4<>7 7<>9 1<>7 3<>9 2<>4 3<>5 1<>6 2<>6 2<>6 3<>6 3<>6 4<>6 5<>6 5<>6 6<>9 6<>9 6<>8 1<>8 4<>8 4<>8 5<>8 7<>8 8<>9    8<>10  Table 5-4 The F2 phenotypes of reciprocal crosses between msu mum4-1 lines (To be continued) 103  F2 msu5 mum4-1 X msu1 mum4-1 msu1 mum4-1 X msu5 mum4-1 msu7 mum4-1 X msu5 mum4-1 msu5 mum4-1 X msu2 mum4-1 msu5 mum4-1 X msu2 mum4-1 msu5 mum4-1 X men7 mum4-1 msu1 mum4-1 X msu10 mum41 msu4 mum4-1 X msu1 mum4-1 msu9 mum4-1 X msu2 mum4-1 msu9 mum4-1 X msu3 mum4-1 msu5 mum4-1 X msu10 mum41 msu4 mum4-1 X msu5 mum4-1  phenotypes msu mum4        NOTES more than mum4-1 more than mum4-1 more than mum4-1 more than mum4-1 more than mum4-1 more than mum4-1  msu Alleles? 1=5 1=5 5=7 5=2 5=2 5=7       more than mum4-1 more than mum4-1 more than mum4-1 more than mum4-1  1=10 4=1 9=2 3=9     more than mum4-1 more than mum4-1  5=10 4=5  Table 5-4 The F2 phenotypes of reciprocal crosses between msu mum4-1 lines (continuing)  The reciprocal crosses between the msu mum4-1 lines reveal if two lines are allelic to each other. The F2 seed phenotypes were checked as described before. The check marks represent the corresponding phenotypes. ‘Notes’ indicate more details about the phenotypes. ‘msu alleles?’ infers if two genes are alleles based on the corresponding phenotype. ‘=’ represents alleles, while ‘<>’ not alleles.  104  The mutants were crossed with mum4-1 since the modifiers have the mum4-1 background, and the phenotype of the F1 plants was determined by examining mucilage extrusion in their F2 seeds.  Mutants where individual F1 plants produced seed with a  mum4 phenotype were considered to be recessive whereas those with a modifier phenotype were considered to be dominant. The number of genes underlying each mutant phenotype was determined by the ratio of mutant to wild type F2 plants (based on F3 seed phenotype). Results (Table 5-5) suggested that all mutants were the result of recessive mutations except msu5 and msu9 which were dominant. Two enhancers and three suppressors having the most obvious phenotypes were selected to check the F2 segregation ratios. In the cases of men10, men15 and msu3, the segregation showed mum4-1: modifier=3:1 (Table 5-6) suggesting that these phenotypes result from a single recessive mutation. However msu1 and msu2 appear to be single dominant mutations, since the segregation ratios are mum4-1: modifier=1:3. Noticeably, msu1 and msu2 are predicted to be recessive in Table 5-5. The hypothesis that both msu1 and msu2 are dominant however has better experimental support since it is based on the analysis of over 70 F2 lines instead of a few F1 lines. These opposing results are likely due to the difficulty of scoring phenotypes accurately. A cross with wild type (Col-2) can be used to determine if the modifier mutation has a phenotype in the absence of mum4. All the F2 seeds showed wild type phenotypes except that msu9 mum4-1 X Col-2 showed mum4-like phenotype (data not shown). Since MUM4 is recessive (Western et al., 2004; Usadel et al., 2004), the mum4-like phenotype may result from the mutation of dominant MSU9. Given the reasons mentioned above, 105  F2 men7 mum4-1 X mum4-1 men8 mum4-1 X mum4-1 men9 mum4-1 X mum4-1 men10 mum4-1 X mum4-1 mum4-1 X men11 mum4-1 men12 mum4-1 X mum4-1 men13 mum4-1 X mum4-1 men14 mum4-1 X mum4-1 men14 mum4-1 X mum4-1 men15 mum4-1 X mum4-1 mum4-1 X men15 mum4-1 mum4-1 X men16 mum4-1 mum4-1 X men16 mum4-1 mum4-1 X msu1 mum4-1 mum4-1 X msu2 mum4-1 mum4-1 X msu3 mum4-1 mum4-1 X msu3 mum4-1 msu4 mum4-1 X mum4-1 mum4-1 X msu5 mum4-1  phenotypes msu mum4 men                     mum4-1 X msu5 mum4-1 mum4-1 X msu6 mum4-1 mum4-1 X msu7 mum4-1 msu8 mum4-1 X mum4-1         mum4-1 X msu9 mum4-1 mum4-1 X msu10 mum4-1       Recessive or Dominant recessive recessive recessive recessive recessive recessive recessive recessive recessive recessive recessive recessive recessive recessive recessive recessive recessive recessive recessive a little more than mum4-1, dominant recessive recessive recessive a little more than mum4-1, dominant recessive  Table 5-5 The F2 phenotypes of the modifiers backcrossed with mum4-1  The confirmed homozygous modifiers were crossed with mum4-1 in order to determine the mutation is recessive or dominant. The F2 seeds were treated with EDTA solution before staining with ruthenium red. Col-2, mum4-1 and ttg1-1 were used as controls to score the phenotypes. The check marks represent the corresponding phenotypes.  106  Col-2 X (F3)  Note  mum4-1 X (F3)  men10 mum4-1 Expected  Col-2 : mum4-1 : men10 : men10 mum4-1 (9:3:3:1=81:27:27:9)  mum4-1 : men10 mum4-1 (3:1=54:18)  Observed  82:27:29:6 (Chi square=1.16, p=0.7625)  57:15 (Chi square=0.667, p=0.4142)  Expected  Col-2 : mum4-1 : men15 mum4-1 (12:3:1=108:27:9)  mum4-1 : men15 mum4-1 (3:1=54:18)  Observed  121:17:6 (Chi square=6.269, p=0.0435)  53:19 (Chi square=0.074, p=0.7855)  Expected  Col-2 : mum4-1 : msu1 mum4-1 (12:1:3=108:9:27)  mum4-1 : msu1 mum4-1 (1:3=18:54)  Observed  125:10:9 (Chi square=14.787, p=0.0006)  13:59 (Chi square=1.852, p=0.1736)  Expected  Col-2 : mum4-1 : msu2 mum4-1 (15:1:0=135:9:0)  mum4-1 : msu2 mum4-1 (1:3=18:54)  Observed  115:27:0 (Chi square=38.963, p=0)  17:55 (Chi square=0.074, p=0.7855)  single recessive gene, men10 has its own phenotype.  men15 mum4-1  single recessive gene.  msu1 mum4-1 Single, Dominant. mum4-1 X msu1 mum4-1 F2 seeds msu1 mum4-1 like. Confirmed dominant.  msu2 mum4-1  107  Single, Dominant. No msu2 mum4-1 like phenotypes among the Col-2 X msu2 mum4-1 F3 seeds.  msu3 mum4-1 Expected Observed  mum4-1 : msu3 mum4-1 (3:1=54:18) not obtained  55:17 (Chi square=0.074, p=0.7855)  single recessive gene  Table 5-6 The F3 segregation ratios of the selected modifiers backcrossed with Col-2 or mum4-1  Modifiers with the most obvious phenotypes were backcrossed to either Col-2 or mum4-1 and the F2 phenotypic segregation ratios determined by examining F3 seed mucilage derived from individual F2 plants. The ‘expected’ value are the predicted results based on the known phenotypes and Mendelian laws.  only 5 modifiers were checked for the F3 segregation ratios. Among the 5 modifiers, only men10 appeared to show a mucilage phenotype independent of mum4 (see section 5.2.5), with a men10, Col-2: mum4-1: men10: men10 mum4-1 ratio of 9:3:3:1. In the case of men15, a Col-2: mum4-1: men15 mum4-1 ratio of 12:3:1 was observed suggesting that men15 alone has a wild type mucilage phenotype. Similarly, the Col-2: mum4-1: msu1 mum4-1=12:1:3 ratio observed indicates that the msu1 phenotype alone is similar to wild type. Finally the observed Col-2: mum4-1: msu2 mum4-1 ratio of 15:1:0 indicates that not only does msu2 alone have a wild type phenotype but that the suppression of msu2 over mum4 is strong enough to make it difficult to distinguish the msu2 mum4-1 phenotype from wild type as well.  5.2.5 MEN10  The two men mutants with the strongest phenotypes were selected for genetic segregation analysis. Only men10 showed a mucilage phenotype independent of mum4. Shaken in EDTA solutions, the mucilage volume of men10 was between those of wild type and mum4-1 (Figure 5-3). The ruthenium red staining of men10 mucilage is also paler than that in wild type suggesting that the monosaccharide composition is altered. No seed shape, seed color or trichome phenotypes were found to associate with the seed coat mucilage phenotype suggesting that men10 is not a new allele of ATS, AP2, TTG1, TTG2, or GL2.  108  Figure 5-3 The seed coat mucilage phenotype of men10  men10 was isolated from the cross between Col-2 and men10 mum4-1. The dry seeds were successively treated with EDTA and ruthenium red. The phenotypes were examined and photographed using a dissecting microscope.  109  In order to test the reliability of the men10 phenotype independent of the mum4 background, I made the crosses men10 X mum4-1, men10 X Col-2 and men10 X mum41men10. The F3 seeds of men10 X mum4-1 and men10 X Col-2 and the F2 seeds of men10 X mum4-1men10 were examined for mucilage defects. In the case of men10 X mum4-1, the expected segregation ratio is WT: mum4-1: men10: mum4-1men10=9:3:3:1. The F3 seeds segregate as WT: mum4-1: men10: mum4-1men10=39:9:12:3. For the cross of men10 X Col-2 a phenotypic ratio of WT: men10=3:1 was expected. The result was WT: men10=33:12 (Chi square= 0.067, p= 0.7963). The F2 seeds of men10 X mum41men10 showed a men10 phenotype. The data indicated that the new phenotype resulted from the mutation in a single nuclear gene.  5.3 Discussion  5.3.1 mum4 is a good genetic background for screening for new genes affecting mucilage  Six mutants, including mum1 through mum5 (Western et al., 2004) and patchy (Arsovski et al., 2009a), have been isolated by screening for seed coat mucilage phenotypes in the wild type background with the forward genetic approach. All these mutants have obvious differences from wild type. However many genes involved in mucilage production may not result in a phenotype easily distinguishable from wild type. With the benefit of the mum4 modifier screen, 6 more mutants, men1 through men6, were  110  identified, along with the new alleles of mum2 and myb61 (Arsovski et al., 2009b). Among these mutants, men1, men4 and men5 in the mum4 background have a reduction of mucilage deposition compared to mum4, while men2 and men6 have a defect in mucilage release (Arsovski et al., 2009b). None of these single mutants exhibits defects in mucilage phenotype, except men4 which has reduced mucilage release (Arsovski et al., 2009b). In our screening in the mum4 background, 20 mum4 modifiers, including 10 men and 10 msu mutants, were isolated. Of these, only 5 modifiers were selected for genetic segregation analysis given the difficulty of scoring the phenotypes accurately. men10 is the only one which has a mucilage phenotype independent of mum4. Therefore, most of these single mutants could not be found by screening for mucilage mutants in the wild type background. My data demonstrate that the mum4 modifier screen is a good approach to identify new genes involved in mucilage biosynthesis, secretion and modification. It is intriguing that no msu mutants were identified in the secreening by Arsovski et al. (2009b, personal communication). 10 MSU genes found in our screen could play important roles in mucilage biosynthesis, given the nature of MUM4. MUM4 encodes a rhamnose synthase predicted to convert UDP-D-Glc to UDP-L-Rha (Reiter and Vanzin, 2001). Its family members, RHM1 and RHM3, are expressed redundantly. MSU genes may increase the expression of RHM1 or RHM3 to compensate for the absence of RHM2/MUM4. It is also possible that MSU genes result in increased extrusion by modifying cell walls or mucilage. Thus msu mutants may provide novel insights into cell wall biosynthesis.  111  Our data indicate that the secondary screening in the mum4 background is valid to identify new genes affecting mucilage production or modification. No mutants with more mucilage than wild type have been reported. With the help of the mum4 system, it may be possible to characterize genes which increase mucilage production.  5.3.2 Further characterization of modifier mutants  From the population of 2,000 plants, a total of 20 mutants were eventually identified. This mutant frequency is high considering a frequency of 2 X 10-4 mutations/locus (10 mM EMS, 24 hr) in a typical mutagenized population (Koornneef et al., 1982). Thus my results indicate that the mucilage biosynthesis is a complicated process involving many genes. Alternatively some of the mutants may be allelic to each other. Further characterization is needed to determine how many new genes are represented by the new mutants. To characterize the mutants thoroughly, a more reliable method of recognizing the mucilage phenotype is required. For some of the mutants however the phenotype may be too subtle to accurately characterize and clone the genes. Investigations on the seed coat development and the mucilage composition of the mutants may help us catagorize the mutants into phenotypic subgroups. Discovery of the new gene identities and their characterization may provide insights into pectin biosynthesis, secretion and modification.  112  6 Conclusions and Future Directions Pectin is an essential component of cell walls. It plays important roles in plant growth regulation and defense signaling. In my thesis, I used the Arabidopsis seed coat, which releases pectinaceous mucilage, as a system to study pectin biology. I carried out two projects, namely cloning and characterization of MUM1, and screening for mum4 modifiers.  6.1 Cloning and characterization of MUM1  mum1 was isolated as a mutant defective in mucilage release (Western et al., 2001). The development of the seed coat and the surface features of the epidermal cells showed no difference from that of wild type. The mum1 mucilage lost the capability to expand on hydration. The possibility that the cell walls of mum1 were stronger than wild type cannot be ruled out. Finally, mum1 mucilage RG I has more side chains than wild type. All these features resemble the phenotype of mum2, which is defective in a βgalactosidase needed to remove pectic side chains for normal mucilage release (Dean et al., 2007) suggesting that MUM1 and MUM2 function in the same pathway. Map-based cloning revealed that MUM1 encodes a putative transcription factor LEUNIG_HOMOLOG (LUH) with WD40 repeats at the C terminus of the protein. LUH/MUM1 is expressed in many tissues including the seed coat. LUH/MUM1 is expressed throughout the period of seed coat development (4, 7 and 10 DPA), peaking at 113  the later stages. The sub-cellular location of LUH/MUM1 is the nucleus. The transcriptional activity analysis indicates that LUH/MUM1 functions as a weak activator. Since no DNA binding domain is found in the LUH/MUM1 gene, another transcription factor is needed to form a complex with LUH/MUM1 to accomplish the regulatory function such as SEU does for LUG. However, seu does not show mucilage defects. A yeast two-hybrid screen can be applied to identify the proteins which interact with LUH/MUM1 in the future. Such an experiment should help to better understand how LUH/MUM1 regulates mucilage modification. Given the similar phenotypes of mum1 and mum2, and the molecular identities of the proteins encoded by LUH/MUM1 and MUM2, I tested the hypothesis that LUH/MUM1 regulates MUM2. MUM2 expression is dramatically decreased in the luh/mum1 background, relative to wild type. Over-expression of MUM2 can compensate for the loss of LUH/MUM1. These data suggest that LUH/MUM1 positively regulates MUM2. Although I confirmed that LUH/MUM1 regulates MUM2 positively, we are still not sure if LUH/MUM1 binds to the MUM2 gene directly. To discover whether MUM2 is a target of LUH/MUM1 regulation, chromatin immunoprecipitation (CHIP) technology can be applied. Recombinant protein of LUH/MUM1 or its co-regulator, fused with common epitope such as His-tag, FLAG-tag etc., can be recognized by the corresponding common antibody. This recombinant protein-common antibody can be used to identify and purify the antibody to LUH/MUM1 or its co-regulator. Using the antibody of LUH/MUM1 or its co-regulator, we can precipitate the transcription factor protein  114  complex, still bound to sheared-sonicated chromatin. PCR amplification using MUM2 primers can be used to identify if MUM2 sequences are represented among the precipitated chromatin. The similar expression levels of LUH/MUM1 in both wild type and mutants (Figure 4-3) indicates that LUH/MUM1 – MUM2 pathway is not under the regulation of other transcription factors known to be required for mucilage biosynthesis including AP2, TTG1, TTG2, GL2, MYB5/TT2 and TT8/EGL3 (Western et al., 2004; Li et al., 2009; Gonzalez et al., 2009). It is still possible that LUH/MUM1 is upstream of the TTG1 complex. Though this kind of hypothesis is not supported by the facts that ttg1 and luh5/mum1-1 have distinct mucilage phenotypes, it is still an experiment worth doing. Similarly, the connection of LUH/MUM1 and MYB61 was not tested because of the difference between these two mutants: myb61 shows decreased mucilage amount, and luh-5/mum1-1 mucilage structure is changed. However, exploring the relationship of LUH/MUM1 and MYB61 in the future could bring novel information. As described in the first chapter, two other mutants, patchy/bxl1and sbt1.7, have similar phenotypes to mum1 and mum2. Each of these mutants has seed mucilage incapable of expanding normally in water, although seed coat development is indistinguishable from wild type. BXL1 was found to encode a bi-functional βxylosidase/α-arabinofuranosidase (Arsovski et al., 2009a). SBT1.7 encodes a subtilisinlike serine protease (Rautengarten et al., 2008).. It would be interesting to check if MUM1 regulates either of these genes.  115  6.2 Screening for mum4 modifiers  The reduced mucilage release of mum4 provides us with a good opportunity to identify genes involved in the pectin biosynthesis, secretion and modification that were missed by previous screens. I obtained 10 enhancer mutants with more severe phenotypes, and 10 suppressor mutants with milder phenotypes than mum4. The allelism among the mutants could not be determined because of the difficulty with scoring at least some of the phenotypes accurately. Genetic segregation data of five selected mutants with most obvious phenotypes demonstrate that MEN10, MEN15 and MSU3 are recessive genes, while MSU1 and MSU2 appear to be dominant. Mucilage chemical analysis and seed coat development can provide us the hints of defects of new mutants. Positional cloning of the new mutants is needed to identify the mutated genes. Analysis of mucilage composition and seed coat development can help to categorize the remaining mutants. The complementation tests between mutants within the same category could reduce the misleading information. The mum4 msu mutants extrude more mucilage than mum4. Given the role of MUM4 in the essential conversion of UDP-D-Glc to UDP-L-Rha in mucilage, it is reasonable to hypothesize that the mutation of MSU compensates for the loss of MUM4. MUM4 is also known as RHM2, a member of RHM family, along with RHM1 and RHM3. Therefore, the mutation of MSU may increase the expression of RHM1 and/or RHM3, thus increasing the mucilage release. Alternatively, it is still possible that the mutation of MSU modifies the mucilage structure to make it extrude more easily.  116  Bibliography Alonso, J. M., Stepanova, A. N., Leisse, T. J. et al. (2003). Genome-Wide insertional mutagenesis of Arabidopsis thaliana. Science 301, 653-657. Arsovski, A. A., Popma, T. M., Haughn, G. W., Carpita, N. C., McCann, M. C., and Western, T. L. (2009a). AtBXL1 encodes a bifunctional {beta}-DXylosidase/{alpha}-L-Arabinofuranosidase required for pectic arabinan modification in Arabidopsis mucilage secretory cells. Plant Physiol. 150, 12191234. Arsovski, A. A., Villota, M. M., Rowland, O., Subramaniam, R., and Western, T. L. (2009b). MUM ENHANCERS are important for seed coat mucilage production and mucilage secretory cell differentiation in Arabidopsis thaliana. J. Exp. Bot. 60, 2601-2612. Arsovski, A. A., Haughn, G. W., and Western, T. L. (2010). Seed coat mucilage cells of Arabidopsis thaliana as a model for plant cell wall research. Plant Signaling and Behavior 5, 796 – 801. Beeckman, T., De Rycke, R., Viane, R., and Inze, D. (2000). Histological study of seed coat development in Arabidopsis thaliana. Journal of Plant Research 113, 139148. Blake A. W., McCartney L., Flint J. E., Bolam D. N., Boraston A. B., Gilbert H. J., Knox J. P. (2006). Understanding the biological rationale for the diversity of cellulose-directed carbohydrate-binding modules in prokaryotic enzymes. J. Biol. Chem. 281:29321-29329. Boesewinkel, F. D. and Bouman, F. (1995). The seed: structure and function. In Seed Development and Germination, J. Kigel and G. Galili, ed(s) (New York: Marcel Dekker), pp. 1-24. Bouton, S., Leboeuf, E., Mouille, G., Leydecker, M. T., Talbotec, J., Granier, F., Lahaye, M., Hofte, H., and Truong, H. N. (2002). QUASIMODO1 encodes a putative membrane-bound glycosyltransferase required for normal pectin synthesis and cell adhesion in Arabidopsis. Plant Cell 14, 2577-2590. Bowman, J. L., Smyth, D. R., and Meyerowitz, E. M. (1989). Genes directing flower development in Arabidopsis. Plant Cell 1, 37-52. Brown, D. M., Goubet, F., Wong, V. W., Goodacre, R., Stephens, E., Dupree, P., Turner, S. R. (2007) Comparison of five xylan synthesis mutants reveals new  117  insight into the mechanisms of xylan synthesis. The Plant Journal 52:11541168. Burn, J. E., Hurley, U. A., Birch, R. J., Arioli, T., Cork, A., and Williamson, R. E. (2002). The cellulose-deficient Arabidopsis mutant rsw3 is defective in a gene encoding a putative glucosidase II, an enzyme processing N-glycans during ER quality control. The Plant Journal 32, 949-960. Caffall, K. H., Pattathil, S., Phillips, S. E., Hahn, M. G., and Mohnen, D. (2009). Arabidopsis thaliana T-DNA mutants implicate GAUT genes in the biosynthesis of pectin and xylan in cell walls and seed testa. Mol Plant 2, 1000-1014. Caffall, K. H. and Mohnen, D. (2009). The structure, function, and biosynthesis of plant cell wall pectic polysaccharides. Carbohydrate Research 344, 1879-1900. Carpita, N. C. and Gibeaut, D. M. (1993). Structural models of primary cell walls in flowering plants: consistency of molecular structure with the physical properties of the walls during growth. The Plant Journal 3, 1-30. Carpita, N. C. and MaCann, M. C. (1996). Some new methods to study plant polyuronic acids and their esters. In Progress in Glycobiology, R. Townsend and A. Hotchkiss, ed(s) (New York: Marcell Dekker), pp. 155-216. Carpita N. C. and Shea E. (1989) Linkage structure of carbohydrates by gas chromatograph-mass spectrometry (GC-MS) of partially methylated alditol acetates. In Analysis of Carbohydrates by GLC and MS, CJ Biermann, GD McGinnis, eds (Boca Raton, FL: CRC Press), pp. 155–216 Caspar, T. and Pickard B.G. (1989). Gravitropism in a starchless mutant of Arabidopsis. Planta 177, 185-197. Caspar, T., Huber, S. C., and Somerville, C. (1985). Alterations in growth, photosynthesis, and respiration in a starchless mutant of Arabidopsis thaliana (L.) dDeficient in chloroplast phosphoglucomutase activity. Plant Physiol. 79, 11-17. Cavalier, D. M. et al. (2008). Disrupting two Arabidopsis thaliana xylosyltransferase genes results in plants deficient in xyloglucan, a major primary cell wall component. Plant Cell 20, 1519-1537. Chen, C., Wang, S., and Huang, H. (2000). LEUNIG has multiple functions in gynoecium development in Arabidopsis. genesis 26, 42-54. Clough, S. J. and Bent, A. F. (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. The Plant Journal 16, 735-743. Cnops, G., Jover-Gil, S., Peters, J. L., Neyt, P., De Block, S., Robles, P., Ponce, M. R., Gerats, T., Micol, J. L., Van Lijsebettens, M. (2004). The rotunda2 mutants 118  identify a role for the LEUNIG gene in vegetative leaf morphogenesis. J. Exp. Bot. 55, 1529-1539. Coenen, G. J., Bakx, E. J., Verhoef, R. P., Schols, H. A., and Voragen, A. G. J. (2007). Identification of the connecting linkage between homo- or xylogalacturonan and rhamnogalacturonan type I. Carbohydrate Polymers 70, 224-235. Conner, J. and Liu, Z. (2007). LEUNIG, a putative transcriptional corepressor that regulates AGAMOUS expression during flower development. Proc. Natl. Acad. Sci. USA 97, 12902-12907. Cosgrove, D. J. (1993). How do plant cell walls extend? Plant Physiol. 102, 1-6. Cosgrove, D. J. (1997). Assembly and enlargement of the primary cell wall in plants. Annual Review of Cell and Developmental Biology 13, 171-201. Cosgrove, D. J. (2001). Wall structure and wall loosening. a look backwards and forwards. Plant Physiol. 125, 131-134. Dean, G. H., Zheng, H., Tewari, J., Huang, J., Young, D. S., Hwang, Y. T., Western, T. L., Carpita, N. C., McCann, M. C., Mansfield, S. D., and Haughn, G.W. (2007). The Arabidopsis MUM2 gene encodes a {beta}-galactosidase required for the production of seed coat mucilage with correct hydration properties. Plant Cell 19, 4007-4021. Debeaujon, I., Leon-Kloosterziel, K. M., and Koornneef, M. (2000). Influence of the testa on seed dormancy, germination, and longevity in Arabidopsis. Plant Physiol. 122, 403-414. Di Cristina, M., Sessa, G., Dolan, L., Linstead, P., Baima, S., Ruberti, I., and Morelli, G. (1996). The Arabidopsis Athb-10 (GLABRA2) is an HD-Zip protein required for regulation of root hair development. The Plant Journal 10, 393-402. Dixon, R. A., Xie, D.-Y., and Sharma, S. B. (2005). Proanthocyanidins - a final frontier in flavonoid research? New Phytologist 165, 9-28. Downing, W. L., Mauxion, F., Fauvarque, M. O., Reviron, M. P., de Vienne, D., Vartanian, N., and Giraudat, J. (1992). A Brassica napus transcript encoding a protein related to the Kunitz protease inhibitor family accumulates upon water stress in leaves, not in seeds. The Plant Journal 2, 685-693. Duan, J., Zheng, Y., Dong, Q., and Fang, J. (2004). Structural analysis of a pectic polysaccharide from the leaves of Diospyros kaki. Phytochemistry 65, 609-615. Dupree, P. and Sherrier, D. J. (1998). The plant Golgi apparatus. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1404, 259-270.  119  Egelund, J. et al. (2006). Arabidopsis thaliana RGXT1 and RGXT2 encode Golgilocalized (1,3)-{alpha}-D-xylosyltransferases involved in the synthesis of pectic rhamnogalacturonan-II. Plant Cell 18, 2593-2607. Emons, A. M. and Mulder, B. M. (2000). How the deposition of cellulose microfibrils builds cell wall architecture. Trends in Plant Science 5, 35-40. Fletcher, M. and Floodgate, G. (1973). An electron-microscopic demonstration of an acidic polysaccharide involved in the adhesion of a marine bacterium to solid surfaces. J Gen Microbiol 74, 325-334. Franks, R. G., Wang, C., Levin, J. Z., and Liu, Z. (2002). SEUSS, a member of a novel family of plant regulatory proteins, represses floral homeotic gene expression with LEUNIG. Development 129, 253-263. Franks, R. G., Liu, Z., and Fischer, R. L. (2006). SEUSS and LEUNIG regulate cell proliferation, vascular development and organ polarity in Arabidopsis petals. Planta 224, 801-811. Frey-Wyssling, A. (1976). The plant cell wall. In Encyclopedia of Plant Anatomy, (Berlin: Gebruder Borntraeger). Fry, S. C. (2000). The growing plant cell wall: chemical and metabolic analysis. (Caidwell, NJ: The Blackburn Press). Fujii, N. and Uchimiya, H. (1991). Conditions favorable for the somatic embryogenesis in carrot cell culture enhance expression of the roIC promoter-GUS fusion gene. Plant Physiol. 95, 238-241. Galway, M. E., Masucci, J. D., Lloyd, A. M., Walbot, V., Davis, R. W., and Schiefelbein, J. W. (1994). The TTG gene is required to specify epidermal cell fate and cell patterning in the Arabidopsis root. Developmental Biology 166, 740754. Gao P., Xin Z., Zheng Z.L. (2008). The OSU1/QUA2/TSD2-encoded putative methyltransferase is a critical modulator of carbon and nitrogen nutrient balance response in Arabidopsis. PLoS ONE 3, e1387 Gibeaut, D. M. and Carpita, N. C. (1991). Tracing cell wall biogenesis in intact cells and plants : selective turnover and alteration of soluble and cell wall polysaccharides in grasses. Plant Physiol. 97, 551-561. Gibeaut, D. M., and Carpita, N. C. (1994). Biosynthesis of plant cell wall polysaccharides. FASEB J. 8, 904–915. Glushka, J. N., Terrell, M., York, W. S., O'Neill, M. A., Gucwa, A., Darvill, A. G., Albersheim, P., and Prestegard, J. H. (2003). Primary structure of the 2-O-  120  methyl-[alpha]--fucose-containing side chain of the pectic polysaccharide, rhamnogalacturonan II. Carbohydrate Research 338, 341-352. Gonzalez, A., Mendenhall, J., Huo, Y., and Lloyd, A. (2009). TTG1 complex MYBs, MYB5 and TT2, control outer seed coat differentiation. Developmental Biology 325, 412-421. Goto, N. (1985). A mucilage polysaccharide secreted from testa of Arabidopsis thaliana. Arabidopsis Inf Serv 22, 143-145. Goubet, F. and Mohnen, D. (1999). Subcellular localization and topology of homogalacturonan methyltransferase in suspension-cultured Nicotiana tabacum cells. Planta 209, 112-117. Goujon, T., Minic, Z., El Amrani, A., Lerouxel, O., Aletti, E., Lapierre, C., Joseleau, J.-P., and Jouanin, L. (2003). AtBXL1, a novel higher plant (Arabidopsis thaliana) putative beta-xylosidase gene, is involved in secondary cell wall metabolism and plant development. The Plant Journal 33, 677-690. Grubert, M. (1981). Mucilage or Gum in Seeds and Fruits of Angiosperms: A Review. (Munich: Minerva). Hall, T. A. (1999). BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95-98. Harholt, J., Jensen, J. K., Sorensen, S. O., Orfila, C., Pauly, M., and Scheller, H. V. (2006). ARABINAN DEFICIENT 1 is a putative arabinosyltransferase involved in biosynthesis of pectic arabinan in Arabidopsis. Plant Physiol. 140, 49-58. Haughn, G. and Chaudhury, A. (2005). Genetic analysis of seed coat development in Arabidopsis. Trends in Plant Science 10, 472-477. Haughn, G. W. and Somerville, C. (1986). Sulfonylurea-resistant mutants of Arabidopsis thaliana. Molecular and General Genetics MGG 204, 430-434. Ishida, T. et al. (2007). Arabidopsis TRANSPARENT TESTA GLABRA2 is directly regulated by R2R3 MYB transcription factors and is involved in regulation of GLABRA2 transcription in epidermal differentiation. Plant Cell 19, 2531-2543. Ishii, T., Matsunaga, T., Pellerin, P., O'Neill, M. A., Darvill, A. G., and Albersheim, P. (1999). The plant cell wall polysaccharide rhamnogalacuronan II selfassembles into a covalently cross-linked dimer. The Journal of Biological Chemistry 274, 13098-13104. Ishii, T. and Matsunaga, T. (2001). Pectic polysaccharide rhamnogalacturonan II is covalently linked to homogalacturonan. Phytochemistry 57, 969-974.  121  Iwai, H., Masaoka, N., Ishii, T., and Satoh, S. (2002). A pectin glucuronyltransferase gene is essential for intercellular attachment in the plant meristem. Proc. Natl. Acad. Sci. USA 99, 16319-16324. Jander, G., Norris, S. R., Rounsley, S. D., Bush, D. F., Levin, I. M., and Last, R. L. (2002). Arabidopsis map-based cloning in the post-genome era. Plant Physiol. 129, 440-450. Jarvis, M. C. (1984). Structure and properties of pectin gels in plant cell walls. Plant Cell Environ. 7, 153-164. Jarvis, M. C., and McCann, M. C. (2000). Macromolecular biophysics of the plant cell wall: Concepts and methodology. Plant Physiol. Biochem. 38: 1–13. Jefferson, R. A., Kavanagh, T. A., and Bevan, M. W. (1987). GUS fusion: bglucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO Journal 6, 3901-3907. Jofuku, K. D., Boer, B. G. W., Montagu, M. V., and Okamuro, J. K. (1994). Control of Arabidopsis flower and seed development by the homeotic gene APETALA2. Plant Cell 6, 1211-1225. Jofuku, K. D., Omidyar, P. K., Gee, Z., and Okamuro, J. K. (2005). Control of seed mass and seed yield by the floral homeotic gene APETALA2. Proc. Natl. Acad. Sci. USA 102, 3117-3122. Johnson, C. S., Kolevski, B., and Smyth, D. R. (2002). TRANSPARENT TESTA GLABRA2, a trichome and seed coat development gene of Arabidopsis, encodes a WRKY transcription factor. Plant Cell 14, 1359-1375. Jones, L., Seymour, G. B., and Knox, J. P. (1997). Localization of pectic galactan in tomato cell walls using a monoclonal antibody specific to (1[->]4)-[beta]-Dgalactan. Plant Physiol. 113 , 1405-1412. Kang, Y. H., Kirik, V., Hulskamp, M., Nam, K. H., Hagely, K., Lee, M. M., and Schiefelbein, J. (2009). The MYB23 gene provides a positive feedback loop for cell fate specification in the Arabidopsis root epidermis. Plant Cell 21, 1080-1094. Karssen, C. M., Brinkhorst-van der Swan, D. L. C., Breeklan, A. E., and Koornneef, M. (1983). Induction of dormancy during seed development by endogenous abscisic acid: studies on abscisic acid deficient genotype of Arabidopsis thaliana (L.) Heynh. Planta 158-165. Kawamura, E., Himmelspach, R., Rashbrooke, M. C., Whittington, A. T., Gale, K. R., Collings, D. A., and Wasteneys, G. O. (2006). MICROTUBULE ORGANIZATION 1 regulates structure and function of microtubule arrays during mitosis and cytokinesis in the Arabidopsis root. Plant Physiol. 140, 102-114.  122  Kim, J. B. and Carpita, N. C. (1992). Changes in esterification of the uronic acid groups of cell wall polysaccharides during elongation of Maize coleoptiles. Plant Physiol. 98, 646-653. Kim, Y. C., Nakajima, M., Nakayama, A., and Yamaguchi, I. (2005). Contribution of gibberellins to the formation of Arabidopsis seed coat through starch degradation. Plant Cell Physiol. 46, 1317-1325. Kirik, V., Lee, M. M., Wester, K., Herrmann, U., Zheng, Z., Oppenheimer, D., Schiefelbein, J., and Hulskamp, M. (2005). Functional diversification of MYB23 and GL1 genes in trichome morphogenesis and initiation. Development 132, 1477-1485. Kirik, V., Schnittger, A., Radchuk, V., Adler, K., Hulskamp, M., and Baulmlein, H. (2001). Ectopic expression of the Arabidopsis AtMYB23 gene induces differentiation of trichome cells. Developmental Biology 235, 366-377. Kobayashi, M., Matoh, T., and Azuma, J. (1996). Two chains of rhamnogalacturonan II are cross-linked by borate-diol ester bonds in higher plant cell walls. Plant Physiol. 110, 1017-1020. Kobayashi, M., Nakagawa, H., Asaka, T., and Matoh, T. (1999). Boraterhamnogalacturonan II bonding reinforced by Ca2+ retains pectic polysaccharide in higher-plant cell walls. Plant Physiol. 119, 199-203. Koornneef, M. (1981). The complex syndrome of ttg mutants. Arabidopsis Inf. Serv. 18, 45-51. Koornneef, M., Dellaert L.W., and van der Veen J.H. (1982). EMS- and radiationinduced mutation frequencies at individual loci in Arabidopsis thaliana (L.) Heynh. Mutat Res. 93, 109-123. Kovtun, Y., Chiu, W.-L., Tena, G., and Sheen, J. (2000). Functional analysis of oxidative stress-activated mitogen-activated protein kinase cascade in plants. Proc. Natl. Acad. Sci. USA 97, 2940-2945. Krupkova E., Immerzeel P., Pauly M., Schmulling T. (2007). The TUMOROUS SHOOT DEVELOPMENT2 gene of Arabidopsis encoding a putative methyltransferase is required for cell adhesion and co-ordinated plant development. Plant J 50, 735–750. Kunst, L., Klenz, J. E., Martinez-Zapater, J., and Haughn, G. W. (1989). AP2 gene determines the identity of perianth organs in flowers of Arabidopsis thaliana. Plant Cell 1, 1195-1208. Kuusk, S., Sohlberg, J. J., Eklund, D. M., and Sundberg, E. (2006). Functionally redundant SHI family genes regulate Arabidopsis gynoecium development in a dose-dependent manner. The Plant Journal 47, 99-111. 123  Lao, N. T., Long, D., Kiang, S., Coupland, G., Shoue, D. A., Carpita, N. C., and Kavanagh, T. A. (2003). Mutation of a family 8 glycosyltransferase gene alters cell wall carbohydrate composition and causes a humidity-sensitive semi-sterile dwarf phenotype in Arabidopsis. Plant Molecular Biology 53, 687-701. Larkin, J. C., Oppenheimer, D. G., Lloyd, A. M., Paparozzi, E. T., and Marks, M. D. (1994). Roles of the GLABROUS1 and TRANSPARENT TESTA GLABRA genes in Arabidopsis trichome development. Plant Cell 6, 1065-1076. Larkin, J. C., Brown, M. L., and Schiefelbein, J. (2003). How do cells know what they want to be when they grow up? Lessons from epidermal patterning in Arabidopsis. Annual Review of Plant Biology 54, 403-430. Leon-Kloosterziel, K. M., Keijzer, C. J., and Koornneef, M. (1994). A seed shape mutant of Arabidopsis that is affected in integument development. Plant Cell 6, 385-392. Li, S. F., Milliken, O. N., Pham, H., Seyit, R., Napoli, R., Preston, J., Koltunow, A. M., and Parish, R. W. (2009). The Arabidopsis MYB5 transcription factor regulates mucilage synthesis, seed coat development, and trichome morphogenesis. Plant Cell 21, 72-89. Liang, Y.-K., Dubos, C., Dodd, I. C., Holroyd, G. H., Hetherington, A. M., and Campbell, M. M. (2005). AtMYB61, an R2R3-MYB transcription factor controlling stomatal aperture in Arabidopsis thaliana. Curr. Biol. 15: 1201– 1206. Liepman, A. H., Wightman, R., Geshi, N., Turner, S. R., and Scheller, H. V. (2010). Arabidopsis - a powerful model system for plant cell wall research. The Plant Journal 61, 1107-1121. Liners, F., Gaspar, T., and Cutsem, P. (1994). Acetyl- and methyl-esterification of pectins of friable and compact sugar-beet calli: consequences for intercellular adhesion. Planta 192, 545-556. Liu, Z. and Meyerowitz, E. M. (1995). LEUNIG regulates AGAMOUS expression in Arabidopsis flowers. Development 121, 975-991. Liu, Z., Franks, R. G., and Klink, V. P. (2000). Regulation of gynoecium marginal tissue formation by LEUNIG and AINTEGUMENTA. Plant Cell 12, 1879-1892. Liu, Z. and Karmarkar, V. (2008). Groucho/Tup1 family co-repressors in plant development. Trends in Plant Science 13, 137-144. Luft, J. H. (1971). Ruthenium red and violet. I. Chemistry, purification, methods of use for electron microscopy and mechanism of action. Anat. Rec. 171, 347-368.  124  Lynch, M. A. and Staehelin, L. A. (1992). Domain-specific and cell type-specific localization of two types of cell wall matrix polysaccharides in the clover root tip. The Journal of Cell Biology 118, 467-479. Macquet, A., Ralet, M. C., Kronenberger, J., Marion-Poll, A., and North, H. M. (2007a). In situ, chemical and macromolecular study of the composition of Arabidopsis thaliana seed coat mucilage. Plant Cell Physiol. 48, 984-999. Macquet, A., Ralet, M. C., Loudet, O., Kronenberger, J., Mouille, G., Marion-Poll, A., and North, H. M. (2007b). A naturally occurring mutation in an Arabidopsis accession affects a {beta}-D-galactosidase that increases the hydrophilic potential of rhamnogalacturonan I in seed mucilage. Plant Cell 19, 3990-4006. Masucci, J. D. and Schiefelbein, J. W. (1996). Hormones act downstream of TTG and GL2 to promote root hair outgrowth during epidermis development in the Arabidopsis root. Plant Cell 8, 1505-1517. Masucci, J. D., Rerie, W. G., Foreman, D. R., Zhang, M., Galway, M. E., Marks, M. D., and Schiefelbein, J. W. (1996). The homeobox gene GLABRA2 is required for position-dependent cell differentiation in the root epidermis of Arabidopsis thaliana. Development 122, 1253-1260. Matsui, K., Hiratsu, K., Koyama, T., Tanaka, H., and Ohme-Takagi, M. (2005). A chimeric AtMYB23 repressor induces hairy roots, elongation of leaves and stems, and inhibition of the deposition of mucilage on seed coats in Arabidopsis. Plant Cell Physiol 46, 147-155. McAbee, J. M. et al. (2006). ABERRANT TESTA SHAPE encodes a KANADI family member, linking polarity determination to separation and growth of Arabidopsis ovule integuments. The Plant Journal 46, 522-531. McFarlane, H., Young, R., Wasteneys, G., and Samuels, A. (2008). Cortical microtubules mark the mucilage secretion domain of the plasma membrane in Arabidopsis seed coat cells. Planta 227, 1363-1375. Mohnen, D. (1999). Biosynthesis of pectins and galactomannans. In Comprehensive Natural Products Chemistry, E. B.M.Pinto, ed(s) (Elsevier, Oxford), pp. 497-527. Mohnen, D. (2008). Pectin structure and biosynthesis. Current Opinion in Plant Biology 11, 266-277. Moore, P. J., Swords, K. M. M., Lynch, M. A., and Staehelin, L. A. (1991). Spatial organization of the assembly pathways of glycoproteins and complex polysaccharides in the Golgi apparatus of plants. J Cell Biol 112, 589-602. Morris, E. R., Powell, D. A., Gidley, M. J., and Rees, D. A. (1982). Conformations and interactions of pectins : I. Polymorphism between gel and solid states of calcium polygalacturonate. Journal of Molecular Biology 155, 507-516. 125  Mouille G., Ralet M. C., Cavelier C., Eland C., Effroy D., et al. (2007). Homogalacturonan synthesis in Arabidopsis thaliana requires a Golgi-localized protein with a putative methyltransferase domain. Plant J 50, 605–614. Nakamura, A., Furuta, H., Maeda, H., Takao, T., and Nagamatsu, Y. (2002). Analysis of the molecular construction of xylogalacturonan isolated from soluble soybean polysaccharides. Biosci. Biotechnol. Biochem. 66, 1155-1158. Nakaune, S., Yamada, K., Kondo, M., Kato, T., Tabata, S., Nishimura, M. and Hara-Nishimura, I. (2005). A vacuolar processing enzyme, deltaVPE, is involved in seed coat formation at the early stage of seed development. Plant Cell, 17, 876–887. Navarro, C., Efremova, N., Golz, J. F., Rubiera, R., Kuckenberg, M., Castillo, R., Tietz, O., Saedler, H., and Schwarz-Sommer, Z. (2004). Molecular and genetic interactions between STYLOSA and GRAMINIFOLIA in the control of Antirrhinum vegetative and reproductive development. Development 131, 36493659. Nesi, N., Debeaujon, I., Jond, C., Pelletier, G., Caboche, M., and Lepiniec, L. (2000). The TT8 gene encodes a basic helix-loop-helix domain protein required for expression of DFR and BAN genes in Arabidopsis siliques. Plant Cell 12, 18631878. Northcote, D. H., and Pickett-Heaps, J. D. (1966). A function of the Golgi apparatus in polysaccharide synthesis and transport in the rootcap cells of wheat. O'Neill, M. A., Albersheim, P., and Darvill, A. (1990). The pectic polysaccharides of primary cell walls. In Methods in Plant Biochemistry, D.M.Dey, ed(s) (London: Academic Press), pp. 415-441. O'Neill, M. A., Warrenfeltz, D., Kates, K., Pellerin, P., Doco, T., Darvill, A., and Albersheim, P. (1996). Rhamnogalacturonan-II, a pectic polysaccharide in the walls of growing plant cell, forms a dimer that is covalently cross-linked by a borate ester: IN VITRO CONDITIONS FOR THE FORMATION AND HYDROLYSIS OF THE DIMER. J. Biol. Chem. 271, 22923-22930. O'Neill, M. A., Eberhard, S., Albersheim, P., and Darvill, A. G. (2001). Requirement of borate cross-linking of cell wall rhamnogalacturonan II for Arabidopsis growth. Science 294, 846-849. Ohto, M., Fischer, R. L., Goldberg, R. G., Nakamura, K., and Harada, J. (2005). Control of seed mass by APETALA2. Proc. Natl. Acad. Sci. USA 102, 3123-3128. Oka, T., Nemoto, T., and Jigami, Y. (2007). Functional analysis of Arabidopsis thaliana RHM2/MUM4, a multidomain protein involved in UDP-D-glucose to UDP-L-rhamnose conversion. J. Biol. Chem. 282, 5389-5403. 126  Okamuro, J. K., Caster, B., Villarroel, R., Van Montagu, M., and Jofuku, K. D. (1997). The AP2 domain of APETALA2 defines a large new family of DNA binding proteins in Arabidopsis. Proc. Natl. Acad. Sci. USA 94, 7076-7081. Oomen, R. J. F. J. et al. (2002). In muro fragmentation of the rhamnogalacturonan I backbone in potato (Solanum tuberosum L.) results in a reduction and altered location of the galactan and arabinan side-chains and abnormal periderm development. The Plant Journal 30, 403-413. Orfila, C., Sorensen, S., Harholt, J., Geshi, N., Crombie, H., Truong, H. N., Reid, J., Knox, J., and Scheller, H. (2005). QUASIMODO1 is expressed in vascular tissue of Arabidopsis thaliana inflorescence stems, and affects homogalacturonan and xylan biosynthesis. Planta 222, 613-622. Pattathil, S., Avci, U., Baldwin, D., Swennes, A. G., McGill, J. A., Popper, Z., Bootten, T., Albert, A., Davis, R. H., Chennareddy, C., et al (2010). A comprehensive toolkit of plant cell wall glycan-directed monoclonal antibodies. Plant Physiol 153: 514–525. Pauly, M. and Keegstra, K. (2010). Plant cell wall polymers as precursors for biofuels. Current Opinion in Plant Biology 13, 304-311. Payne, C. T., Zhang, F., and Lloyd, A. M. (2000). GL3 encodes a bHLH protein that regulates trichome development in Arabidopsis through interaction with GL1 and TTG1. Genetics 156, 1349-1362. Penfield, S., Meissner, R. C., Shoue, D. A., Carpita, N. C., and Bevan, M. W. (2001). MYB61 is required for mucilage deposition and extrusion in the Arabidopsis seed coat. Plant Cell 13, 2777-2791. Peng, L., Hocart, C. H., Redmond, J. W., and Williamson, R. E. (2000). Fractionation of carbohydrates in Arabidopsis root cell walls shows that three radial swelling loci are specifically involved in cellulose production. Planta 211, 406-414. Popper, Z. and Fry, S. protoplasmically, contribute to wall-assembly, and remain stable in the cell wall. Planta 227, 781-794. Rautengarten, C., Usadel, B., Neumetzler, L., Hartmann, J., Bussis, and Altmann (2008). A subtilisin-like serine protease essential for mucilage release from Arabidopsis seed coats. The Plant Journal 54, 466-480. Rees, D. A. (1977). Polysaccharide shapes. (London: Chapman and Hall). Reiter, W. D. and Vanzin, G. F. (2001). Molecular genetics of nucleotide sugar interconversion pathways in plants. Plant Molecular Biology 47, 95-113.  127  Reiter, W. D. (2002). Biosynthesis and properties of the plant cell wall. Current Opinion in Plant Biology 5, 536-542. Rerie, W. G., Feldmann, K. A., and Marks, M. D. (1994). The GLABRA2 gene encodes a homeo domain protein required for normal trichome development in Arabidopsis. Genes & Dev. 8, 1388-1399. Ridley, B. L., O'Neill, M. A., and Mohnen, D. (2001). Pectins: structure, biosynthesis, and oligogalacturonide-related signaling. Phytochemistry 57, 929-967. Roberts, K. (2001). How the cell wall acquired a cellular context. Plant Physiol. 125, 127-130. Roe, J. L., Nemhauser, J. L., and Zambryski, P. C. (1997). TOUSLED participates in apical tissue formation during gynoecium development in Arabidopsis. Plant Cell 9, 335-353. Schellmann, S., Hulskamp, M., and Uhrig, J. (2007). Epidermal pattern formation in the root and shoot of Arabidopsis. Biochem. Soc. Trans. 35, 146-148. Schiefelbein, J. (2003). Cell-fate specification in the epidermis: a common patterning mechanism in the root and shoot. Current Opinion in Plant Biology 6, 74-78. Schneitz, K., Hulskamp, M., and Pruitt, R. E. (1995). Wild type ovule development in Arabidopsis thaliana: a light microscope study of cleared whole-mount tissue. The Plant Journal 7, 731-749. Simms, D., Cizdziel, P. E., and Chomczynski, P. (1993). TRIZOLTM: a new reagent fro optimal single-step isolation of RNA. Focus 15, 99-102. Sitaraman, J., Bui, M., and Liu, Z. (2008). LEUNIG_HOMOLOG and LEUNIG perform partially redundant functions during Arabidopsis embryo and floral development. Plant Physiol. 147, 672-681. Sridhar, V. V., Surendrarao, A., Gonzalez, D., Conlan, R. S., and Liu, Z. (2004). Transcriptional repression of target genes by LEUNIG and SEUSS, two interacting regulatory proteins for Arabidopsis flower development. Proc. Natl. Acad. Sci. USA 101, 11494-11499. St Johnston, D. (2002). The art and design of genetic screens: Drosophila melanogaster. Nat Rev Genet 3, 176-188. Stahle, M. I., Kuehlich, J., Staron, L., von Arnim, A. G., and Golz, J. F. (2009). YABBYs and the transcriptional corepressors LEUNIG and LEUNIG_HOMOLOG maintain leaf polarity and meristem activity in Arabidopsis. Plant Cell 21, 3105-3118.  128  Sterling, J. D., Atmodjo, M. A., Inwood, S. E., Kumar Kolli, V. S., Quigley, H. F., Hahn, M. G., and Mohnen, D. (2006). Functional identification of an Arabidopsis pectin biosynthetic homogalacturonan galacturonosyltransferase. Proc. Natl. Acad. Sci. USA 103, 5236-5241. Stolle-Smits, T., Beekhuizen, J. G., Kok, M. T. C., Pijnenburg, M., Recourt, K., Derksen, J., and Voragen, A. G. J. (1999). Changes in cell wall polysaccharides of green bean pods during development. Plant Physiol. 121, 363-372. Szymanski, D. B., Jilk, R. A., Pollock, S. M., and Marks, M. D. (1998). Control of GL2 expression in Arabidopsis leaves and trichomes. Development 125, 11611171. The Arabidopsis Genome Initiative (2000). Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408, 796-815. Tiwari, S. B., Hagen, G., and Guilfoyle, T. (2003). The roles of auxin response factor domains in auxin-responsive transcription. Plant Cell 15, 533-543. Triezenberg, S., Kingsbury, R., and McKnight, S. (1988). Functional dissection of VP16, the trans-activator of herpes simplex virus immediate early gene expression. Genes & Dev. 2, 718-729. Usadel, B., Kuschinsky, A. M., Rosso, M. G., Eckermann, N., and Pauly, M. (2004). RHM2 is involved in mucilage pectin synthesis and is required for the development of the seed coat in Arabidopsis. Plant Physiol. 134 , 286-295. Van Caeseele, L., Mills, J. T., Sumner, M., and Gillespie, R. (1981). Cytology of mucilage production in the seed coat of Candle canola (Brassica campestris). Can. J. Bot. 59, 292-300. Vidal, S., Doco, T., Williams, P., Pellerin, P., York, W. S., O'Neill, M. A., Glushka, J., Darvill, A. G., and Albersheim, P. (2000). Structural characterization of the pectic polysaccharide rhamnogalacturonan II: evidence for the backbone location of the aceric acid-containing oligoglycosyl side chain. Carbohydrate Research 326, 277-294. Walker, A. R., Davison, P. A., Bolognesi-Winfield, A. C., James, C. M., Srinivasan, N., Blundell, T. L., Esch, J. J., Marks, M. D., and Gray, J. C. (1999). The TRANSPARENT TESTA GLABRA1 locus, which regulates trichome differentiation and anthocyanin biosynthesis in Arabidopsis, encodes a WD40 repeat protein. Plant Cell 11, 1337-1350. Wang, S., Tiwari, S. B., Hagen, G., and Guilfoyle, T. J. (2005). AUXIN RESPONSE FACTOR7 restores the expression of auxin-responsive genes in mutant Arabidopsis leaf mesophyll protoplasts. Plant Cell 17, 1979-1993.  129  Wang, S., Chang, Y., Guo, J., and Chen, J. (2007). Arabidopsis Ovate Family Protein 1 is a transcriptional repressor that suppresses cell elongation. The Plant Journal 50, 858-872. Western, T. L. (2006). Changing spaces: The Arabidopsis mucilage secretory cells as a novel system to dissect cell wall production in differentiating cells. Can. J. Bot. 84, 622-630. Western, T. L., Skinner, D. J., and Haughn, G. W. (2000). Differentiation of mucilage secretory cells of the Arabidopsis seed coat. Plant Physiol. 122, 345-356. Western, T. L., Burn, J., Tan, W. L., Skinner, D. J., Martin-McCaffrey, L., Moffatt, B. A., and Haughn, G. W. (2001). Isolation and characterization of mutants defective in seed coat mucilage secretory cell development in Arabidopsis. Plant Physiol. 127, 998-1011. Western, T. L., Young, D. S., Dean, G. H., Tan, W. L., Samuels, A. L., and Haughn, G. W. (2004). MUCILAGE-MODIFIED4 encodes a putative pectin biosynthetic enzyme developmentally regulated by APETALA2, TRANSPARENT TESTA GLABRA1, and GLABRA2 in the Arabidopsis seed coat. Plant Physiol. 134, 296306. Western, T. L. (2006). Changing spaces: the Arabidopsis mucilage secretory cells as a novel system to dissect cell wall production in differentiating cells. Canadian Journal of Botany 84, 622-630. Whittington, A. T., Vugrek, O., Wei, K. J., Hasenbein, N. G., Sugimoto, K., Rashbrooke, M. C., and Wasteneys, G. O. (2001). MOR1 is essential for organizing cortical microtubules in plants. Nature 411, 610-613. Willats, W. G. T., McCartney, L., and Knox, J. P. (2001a). In-situ analysis of pectic polysaccharides in seed mucilage and at the root surface of Arabidopsis thaliana. Planta 213, 37-44. Willats, W. G. T. et al. (2001b). Modulation of the degree and pattern of methylesterification of pectic homogalacturonan in plant cell walls: IMPLICATIONS FOR PECTIN METHYL ESTERASE ACTION, MATRIX PROPERTIES, AND CELL ADHESION. J. Biol. Chem. 276, 19404-19413. Willats, W. G. T., Marcus, S. E., and Knox, J. P. (1998). Generation of a monoclonal antibody specific to (1-->5)-[alpha]--arabinan. Carbohydrate Research 308, 149152. Willats, W. G. T. et al. (2000). Analysis of pectic epitopes recognised by hybridoma and phage display monoclonal antibodies using defined oligosaccharides, polysaccharides, and enzymatic degradation. Carbohydrate Research 327, 309320. 130  Willats, W. G. T., McCartney, L., Mackie, W., and Knox, J. P. (2001c). Pectin: cell biology and prospects for functional analysis. Plant Molecular Biology 47, 9-27. Windsor, J. B., Symonds, V. V., Mendenhall, J., and Lloyd, A. M. (2000). Arabidopsis seed coat development: morphological differentiation of the outer integument. Plant Journal 22, 483-493. Yapo, B. M., Lerouge, P., Thibault, J. F., and Ralet, M. C. (2007). Pectins from citrus peel cell walls contain homogalacturonans homogenous with respect to molar mass, rhamnogalacturonan I and rhamnogalacturonan II. Carbohydrate Polymers 69, 426-435. Young, J. A. and Evans, R. A. (1973). Mucilaginous seed coats. Weed Science 21, 5254. Young, R. E., McFarlane, H. E., Hahn, M. G., Western, T. L., Haughn, G. W., and Samuels, A. L. (2008). Analysis of the Golgi apparatus in Arabidopsis seed coat cells during polarized secretion of pectin-rich mucilage. Plant Cell 20, 1623-1638. Zhan, D., Janssen, P., and Mort, J. (1998). Scarcity or complete lack of single rhamnose residues interspersed within the homogalacturonan regions of citrus pectin. Carbohydrate Research 308 , 373-380. Zhang, Y., Glazebrook, J., and Li, X. (2007). Identification of components in diseaseresistance signaling in Arabidopsis by map-based cloning. Methods in Molecular Biology 354, 69-78. Zhao, M., Morohashi, K., Hatlestad, G., Grotewold, E., and Lloyd, A. (2008). The TTG1-bHLH-MYB complex controls trichome cell fate and patterning through direct targeting of regulatory loci. Development 135, 1991-1999. Zykwinska, A. W., Ralet, M.-C. J., Garnier, C. D., and Thibault, J.-F. J. (2005). Evidence for in vitro binding of pectin side chains to cellulose. Plant Physiol. 139: 397–407.  131  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0071669/manifest

Comment

Related Items