Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Coxsackievirus-induced myocarditis : identifying disease mediators Poffenberger, Maya Chikako 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2011_spring_poffenberger_maya.pdf [ 4.74MB ]
Metadata
JSON: 24-1.0071659.json
JSON-LD: 24-1.0071659-ld.json
RDF/XML (Pretty): 24-1.0071659-rdf.xml
RDF/JSON: 24-1.0071659-rdf.json
Turtle: 24-1.0071659-turtle.txt
N-Triples: 24-1.0071659-rdf-ntriples.txt
Original Record: 24-1.0071659-source.json
Full Text
24-1.0071659-fulltext.txt
Citation
24-1.0071659.ris

Full Text

COXSACKIEVIRUS-INDUCED MYOCARDITIS: IDENTIFYING DISEASE MEDIATORS by Maya Chikako Poffenberger B.Sc., University of Victoria, 2005  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Microbiology and Immunology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  March 2011  © Maya Chikako Poffenberger, 2011  Abstract Myocarditis-induced dilated cardiomyopathy is a major cause of heart disease and sudden death in young adults. Development of myocarditis is thought to involve both genetic and environmental factors such as pathogen infection, with the most commonly associated pathogen being the enterovirus coxsackievirus. Herein is a summary of three research projects aimed at identifying genes associated with coxsackievirus-induced myocarditis. In the first project, the role of IL-6 in coxsackievirus-induced myocarditis was investigated. IL-6 was found to have a protective role in disease development as IL-6 deficient mice developed increased chronic disease pathology following viral infection. Recombinant IL-6 treatment in these mice decreased the disease severity, suggesting that IL-6 production during the initiation of the disease regulates myocarditis severity. The second research project was aimed at identifying genetic loci that confer susceptibility to coxsackievirus-induced myocarditis. Using chromosome substitution mouse strains (CSS) and congenic mice generated from the CSS mice, three loci on chromosome 17 were shown to confer susceptibility to chronic myocarditis. Two of the loci, Vam1 and Vam2, do not contain any genes previously associated with myocarditis development. Real-time PCR analysis identified Igf2r and Cacna1h to be strong candidates for the susceptibility genes in the Vam1 and Vam2 loci, respectively. In the third research project, the immune response following coxsackievirus infection was monitored in four inbred mouse strains in order to identify immune factors involved in disease development. Three of the strains, A/J, NOD and BALB/c, were susceptible to disease while the fourth strain, C57BL/6, was resistant to disease. Two interesting responses were observed. The first was increased TNFα levels in the resistant mice and the second was increased PD-L1 expression in the susceptible mice. Administered recombinant TNFα to the susceptible A/J mice was sufficient to increase their survival, indicating a disease protective role for TNFα in virus-induced myocarditis. All together, these data indicate that a network of many genes, both immune and non-immune, is involved in myocarditis development following virus infection. Identifying and elucidating the role of these genes in myocarditis induction could suggest ways to limit disease progression by developing therapies to target these disease modifiers. ii  Preface A version of chapter 3 has been published. Poffenberger MC, Straka N, El Warry N, Fang D, Shanina I, Horwitz MS. (2009) Lack of IL-6 during coxsackievirus infection heightens the early immune response resulting in increased severity of chronic autoimmune myocarditis. PLoS One. 4(7): p. e6207. I conducted all the experiments, analyzed the data and wrote the manuscript under the guidance of Dr. Marc S. Horwitz with the following exception: The plaque assay data presented in Figure 3.1d was collected by Nadine Straka and Nahida El Warry. A version of chapter 4 has been published. Poffenberger MC, Shanina I, Aw C, El Warry N, Straka N, Fang D, Baskin-Hill AE, Spiezio SH, Nadeau JH, Horwitz MS. (2010) Novel nonmajor histocompatibility complex-linked loci from mouse chromosome 17 confer susceptibility to viral-mediated chronic autoimmune myocarditis. Circ Cardiovasc Genet. 3(5): p. 399-408. I conducted all the experiments, analyzed the data and wrote the manuscript under the guidance of Dr. Marc S. Horwitz with the following exceptions: The B6.A17 mice as well as the A17.M20, A17.M14, A17.V19 and A17.V27 strains were generated by our collaborator Dr. Nadeau at Case Western Reserve University. The plaque assay data presented in Figure 4.1b was collected by Iryna Shanina, Connie Aw, Nahida El Warry and Nadine Straka. Statistical analysis to determine the significance of strain susceptibility differences was carried out by Sabrina Spiezio. The data presented in Table 5.1, Table 5.2 and Table 5.3 were generated by our collaborator Dr. Bruce M. McManus at the University of British Columbia. The data were analyzed with the parameters that I requested. Ethics approval: Biohazard Approval Certificate Protocol number: B06-0199 Animal Care Certificate (Animal Care Committee) Application number: A08-0622 Application number: A08-0415 iii  Table of Contents Abstract .......................................................................................................................... ii	
   Preface........................................................................................................................... iii	
   Table of Contents ......................................................................................................... iv	
   List of Tables .............................................................................................................. viii	
   List of Figures ............................................................................................................... ix	
   List of Abbreviations .................................................................................................... xi	
   Acknowledgements ..................................................................................................... xv	
   Dedication ................................................................................................................... xvi	
   1	
   Introduction .............................................................................................................. 1	
   1.1	
   Myocarditis in humans and mice ......................................................................... 2	
   1.2	
   Disease models of myocarditis............................................................................ 4	
   1.2.1	
   Pathogen-induced autoimmune myocarditis................................................. 4	
   1.2.2	
   Experimental autoimmune myocarditis (EAM).............................................. 4	
   1.3	
   Pathogens associated with myocarditis development......................................... 8	
   1.3.1	
   Chlamydia and myocarditis........................................................................... 8	
   1.3.2	
   Streptococcus pyogenes and myocarditis .................................................... 8	
   1.3.3	
   Trypanosoma cruzi and myocarditis ............................................................. 9	
   1.3.4	
   Mouse cytomegalovirus and myocarditis.................................................... 10	
   1.3.5	
   Parvovirus B19 and myocarditis ................................................................. 10	
   1.4	
   Coxsackie B viruses .......................................................................................... 12	
   1.4.1	
   Virulence factors associated with CB3 ....................................................... 14	
   1.4.2	
   Persistence of CB3 ..................................................................................... 16	
   1.5	
   Myocarditis disease pathogenesis following viral infection ............................... 18	
   1.5.1	
   Cytokines associated with myocarditis ....................................................... 18	
   1.5.2	
   Chemokines associated with myocarditis ................................................... 23	
   1.5.3	
   Immune cells associated with myocarditis .................................................. 24	
   1.5.4	
   Toll-like receptors associated with myocarditis........................................... 25	
   1.5.5	
   Complement receptors associated with myocarditis................................... 27	
   1.6	
   Host genes associated with myocarditis development...................................... 29	
   1.6.1	
   Dystrophin................................................................................................... 29	
   1.6.2	
   Apoptosis .................................................................................................... 30	
   iv  1.6.3	
   Microarray data ........................................................................................... 31	
   1.7	
   Susceptibility to myocarditis and DCM .............................................................. 32	
   1.7.1	
   Previous pathogen exposure ...................................................................... 32	
   1.7.2	
   Gender susceptibility .................................................................................. 32	
   1.7.3	
   Disease pathogenesis in inbred mouse strains .......................................... 34	
   1.7.4	
   Loci that confer susceptibility to myocarditis............................................... 36	
   1.7.5	
   Microarray data ........................................................................................... 38	
   1.8	
   Summary ........................................................................................................... 39	
   2	
   Materials and Methods .......................................................................................... 40	
   2.1	
   Animals.............................................................................................................. 41	
   2.2	
   Congenic mouse generation ............................................................................. 41	
   2.3	
   DNA isolation and genotyping ........................................................................... 44	
   2.4	
   Sequencing ....................................................................................................... 44	
   2.5	
   Virus .................................................................................................................. 45	
   2.6	
   Quantitation of the replicative virus in the heart ................................................ 45	
   2.7	
   Histology............................................................................................................ 46	
   2.8	
   Isolation of heart infiltrate .................................................................................. 46	
   2.9	
   Flow cytometry .................................................................................................. 46	
   2.10	
   Antibodies........................................................................................................ 47	
   2.11	
   Cytometric bead array ..................................................................................... 47	
   2.12	
   ELISA .............................................................................................................. 48	
   2.13	
   RNA isolation................................................................................................... 48	
   2.14	
   cDNA ............................................................................................................... 48	
   2.15	
   Real-time PCR ................................................................................................ 49	
   2.16	
   Statistics .......................................................................................................... 49	
   3	
   Lack of IL-6 During Coxsackievirus Infection Heightens the Early Immune Response Resulting in Increased Severity of Chronic Autoimmune Myocarditis 52	
   3.1	
   Introduction........................................................................................................ 53	
   3.2	
   Results .............................................................................................................. 55	
   3.2.1	
   Increased severity of chronic myocarditis in IL-6KO mice .......................... 55	
   3.2.2	
   Cardiac viral replication in IL-6KO mice is similar to wt controls ................ 59	
   3.2.3	
   Increased CD69 expression by T cells in CB3-infected IL-6KO but not in wt controls ................................................................................................................... 59	
   v  3.2.4	
   Early upregulation of MCP-1, TNFα and IL-10 in IL-6KO mice................... 64	
   3.2.5	
   Increased cardiac infiltration of macrophage/monocytes in CB3-infected IL6KO mice................................................................................................................ 68	
   3.2.6	
   Recombinant IL-6 treatment in IL-6KO mice results in decreased chronic disease severity...................................................................................................... 68	
   3.2.7	
   Recombinant IL-6 regulates early inflammatory responses in IL-6KO mice71	
   3.2.8	
   Altered serum levels of IL-12, MIP-1β and MCP-1 with IL-6R blocking antibody treatment.................................................................................................. 76	
   3.2.9	
   Increased cardiac infiltration in rIL-6 treated IL-6KO mice.......................... 76	
   3.3	
   Discussion ......................................................................................................... 83	
   4	
   Novel Non-MHC Linked Loci From Mouse Chromosome 17 Confer Susceptibility to Viral-Mediated Chronic Autoimmune Myocarditis....................... 88	
   4.1	
   Introduction........................................................................................................ 89	
   4.2	
   Results .............................................................................................................. 91	
   4.2.1	
   Chromosome 17 confers susceptibility to coxsackievirus-induced chronic myocarditis ............................................................................................................. 91	
   4.2.2	
   At least two novel susceptibility loci for CB3-induced chronic myocarditis are located on chromosome 17 .................................................................................... 95	
   4.2.3	
   Two novel susceptibility loci for CB3-induced chronic myocarditis are located in the proximal 16.4 cM of chromosome 17............................................... 98	
   4.3	
   Discussion ....................................................................................................... 106	
   5	
   Identification and Characterization of Susceptibility Genes for Viral-Induced Autoimmune Myocarditis.......................................................................................... 117	
   5.1	
   Introduction...................................................................................................... 118	
   5.2	
   Results ............................................................................................................ 119	
   5.2.1	
   A number of genes within Vam1, Vam2 and Vam3 are differentially expressed following coxsackievirus infection in A/J mice .................................... 119	
   5.2.2	
   Igf2r is a potential susceptibility gene in Vam1......................................... 126	
   5.2.3	
   Cacna1h is a potential susceptibility gene in Vam2.................................. 128	
   5.3	
   Discussion ....................................................................................................... 131	
   6	
   Immune Genes Correlating Susceptibility to Coxsackievirus-Induced Myocarditis................................................................................................................. 134	
   6.1	
   Introduction...................................................................................................... 135	
   vi  6.2	
   Results ............................................................................................................ 137	
   6.2.1	
   A/J mice have an increased rate of mortality post infection...................... 137	
   6.2.2	
   Serum TNFα and Rantes levels are increased in C57BL/6 mice compared to susceptible strains of mice ............................................................................... 137	
   6.2.3	
   A/J mice have increased macrophage infiltration in the heart post CB3 infection ................................................................................................................ 140	
   6.2.4	
   PD-L1 is increased on splenocytes from susceptible but not resistant mice post infection ........................................................................................................ 140	
   6.2.5	
   PD-L1 expression is increased in heart tissue from susceptible but not resistant mice ....................................................................................................... 146	
   6.2.6	
   Resistant mice have decreased viral genome in the heart at day 7 post infection ................................................................................................................ 149	
   6.2.7	
   TNFα injection at the time of infection improves the survival rate in CB3 infected A/J mice .................................................................................................. 152	
   6.3	
   Discussion ....................................................................................................... 154	
   7	
   General Discussion and Future Perspectives................................................... 158	
   7.1	
   General Discussion ......................................................................................... 159	
   7.1.1	
   The role of IL-6 in viral-induced chronic myocarditis ................................ 159	
   7.1.2	
   Genetic susceptibility may not be due to immune related genes.............. 160	
   7.1.3	
   Influence of immune related genes in disease susceptibility .................... 161	
   7.2	
   Future Perspectives ........................................................................................ 163	
   7.2.1	
   IL-6 is both pathogenic and protective...................................................... 163	
   7.2.2	
   Identification of susceptibility loci/genes for viral-induced myocarditis ..... 164	
   7.2.3	
   Anti-viral immune responses can direct disease susceptibility ................. 166	
   7.3	
   Concluding remarks ........................................................................................ 168	
   References ................................................................................................................. 169	
   Appendix A	
   Generation of A17.MCP mice ............................................................ 183	
    vii  List of Tables Table 2.1 Primers of microsatellite markers used to identify new congenic mice generated from the A17.M20 and A17.V19 strains ................................................ 43	
   Table 2.2 Primers used for cDNA generation and real-time PCR of CB3 ..................... 50	
   Table 2.3 Primers used for real-time PCR to determine gene expression levels of potential susceptibility genes on chromosome 17.................................................. 51	
   Table 4.1 Genotypes and chronic disease incidence of A17.MCP strains generated from the A17.M20 and A17.V19 strain mice ................................................................... 99	
   Table 4.2 Names and locations of the 35 genes located within Vam1 that have SNP difference between A/J and C57BL/6 mice .......................................................... 107	
   Table 4.3 Names and locations of the 69 genes located within Vam2 that have SNP difference between A/J and C57BL/6 mice .......................................................... 109	
   Table 4.4 Names and locations of the 258 genes located within Vam3 that have SNP difference between A/J and C57BL/6 mice .......................................................... 112	
   Table 5.1 Chromosome 17 genes differentially expressed in the hearts of A/J mice at day 3 PI ................................................................................................................ 120	
   Table 5.2 Chromosome 17 genes differentially expressed in the hearts of A/J mice at day 9 PI ................................................................................................................ 122	
   Table 5.3 Chromosome 17 genes differentially expressed in the hearts of A/J mice at day 30 PI .............................................................................................................. 124 Table A.1 A17.M20-C57BL/6 x C57BL/6 mice with recombination events.................. 186	
   Table A.2 A17.V19-C57BL/6 x C57BL/6 mice with recombination events .................. 187	
    viii  List of Figures Figure 1.1 Myocarditis disease models ........................................................................... 6	
   Figure 1.2 Schematic representation of the disease course following coxsackievirus infection .................................................................................................................... 7	
   Figure 1.3 Schematic representation of possible paths of disease course following CB3 infection .................................................................................................................. 13	
   Figure 1.4 Cytokines linked with myocarditis................................................................. 19	
   Figure 2.1 Schematic representation of the generation of congenic mice from the A17.M20 and A17.V19 strains................................................................................ 42	
   Figure 3.1 IL-6KO mice develop increased chronic myocarditis severity without an increase in virus in the heart .................................................................................. 56	
   Figure 3.2 Cardiac damage in IL-6KO mice and wild type mice did not differ at day 7 PI ............................................................................................................................... 58	
   Figure 3.3 IL-6KO mice have increased expression of the early activation marker CD69 at 3 days PI ............................................................................................................ 60	
   Figure 3.4 IL-6KO mice have increased expression of the early activation marker CD69 at 3 days PI ............................................................................................................ 62	
   Figure 3.5 IL-6KO mice have decreased regulatory T cells .......................................... 65	
   Figure 3.6 TNFα, IL-10 and MCP-1 expression is increased in the absence of IL-6..... 67	
   Figure 3.7 IL-6KO mice have increased monocyte/macrophage infiltration into the heart at 7 days post infection........................................................................................... 69	
   Figure 3.8 IL-6KO mice have an increased number of monocyte/macrophage cells in the heart at 7 days post infection ........................................................................... 70	
   Figure 3.9 Injection of rIL-6 in IL-6KO mice decreased acute disease severity following CB3/LPS treatment ................................................................................................ 72	
   Figure 3.10 Injection of rIL-6 in IL-6KO mice decreased chronic disease severity following CB3/LPS treatment ................................................................................. 73	
   Figure 3.11 Injection of rIL-6 in IL-6KO mice decreased early inflammatory responses at 3 days post infection............................................................................................... 74	
   Figure 3.12 Injection of IL-6R blocking antibody decreased serum concentrations IL12p70 and increased concentrations of MIP-1β and MCP-1 at day 3 PI ............... 77	
    ix  Figure 3.13 rIL-6 injection in IL-6KO mice increased innate and adaptive immune cell infiltration in the heart ............................................................................................. 78	
   Figure 3.14 rIL-6 injection in IL-6KO mice increased the number of innate and adaptive immune cells infiltrating in the heart at 10 days post infection ............................... 80	
   Figure 4.1 Chromosome 17 confers susceptibility to chronic myocarditis..................... 92	
   Figure 4.2 Serum C3 and TNFα levels do not correlate with disease susceptibility...... 94	
   Figure 4.3 Multiple loci on chromosome 17 confer susceptibility to chronic myocarditis96	
   Figure 4.4 Sequencing data for Pde10a...................................................................... 100	
   Figure 4.5 Sequencing data for Dll1 ............................................................................ 101	
   Figure 4.6 Sequencing data for Mapk8ip3................................................................... 103	
   Figure 4.7 Sequencing data for Telo2 ......................................................................... 104	
   Figure 4.8 Sequencing data for Ppard......................................................................... 105	
   Figure 5.1 Gene expression of potential candidate genes in the Vam1 locus............. 127	
   Figure 5.2 Susceptible A/J and B6.A17 mice have significantly decreased expression of Cacna1h ............................................................................................................... 130	
   Figure 6.1 A/J mice have an increased rate of mortality following CB3 infection ........ 138	
   Figure 6.2 Serum cytokines and chemokines levels at 3 days post CB3 infection...... 139	
   Figure 6.3 Macrophage infiltration in the heart correlates with increased mortality in A/J mice ...................................................................................................................... 141	
   Figure 6.4 Immune cells from susceptible but not resistant strains of mice increase expression of PD-L1 during the viral infection ...................................................... 142	
   Figure 6.5 A/J macrophages expressed decreased levels of PD-L1 during acute and chronic myocarditis............................................................................................... 144	
   Figure 6.6 Cardiac immune infiltrate did not show a correlation between myocarditis susceptibility and PD-L1 expression .................................................................... 147	
   Figure 6.7 Susceptible strains of mice have increased cardiac expression of Pd-l1 at day 7 PI ................................................................................................................ 148	
   Figure 6.8 C57BL/6 mice have decreased viral RNA in the heart at day 7 PI............. 150	
   Figure 6.9 Terminal deletion mutants of CB3 were observed in all strains of mice..... 151	
   Figure 6.10 Injection of TNFα at the time of infection is sufficient to increase survival in A/J mice................................................................................................................ 153	
    x  List of Abbreviations Agpat4  1-acylglycerol-3-phosphate O-acyltransferase 4  bp  base pair  C3  complement component 3  Cacna1h  calcium channel, voltage-dependent, T type, alpha 1H subunit (aka Cav3.2)  cAMP  cyclic adenosine monophosphate  CAR  coxsackievirus and adenovirus receptor  CB3  Coxsackievirus B3  CBA  Cytometric Bead Array  cDNA  complementary DNA  Ceat1  chronic experimental autoimmune thyroiditis  CFA  complete Freund’s adjuvant  Chd1  chromodomain helicase DNA binding protein 1  chr  chromosome  CR  complement receptor  CSS  chromosome substitution strains  cTnI  cardiac troponin I  CVB  group B coxsackievirus  DAF  decay accelerating factor  DC  dendritic cell  DCM  dilated cardiomyopathy  Dll1  delta-like 1  DNA  deoxyribonucleic acid  DMEM  Dulbecco's Modified Eagle Medium  EAE  experimental autoimmune encephalomyelitis  EAM  experimental-induced autoimmune myocarditis  ECM  extracellular matrix  ELISA  enzyme linked immunosorbent assay  EMCV  encephalomyocarditis virus  Foxp3  forkhead box P3  G-CSF  granulocyte colony stimulating factor 3 xi  GM-CSF  granulocyte macrophage colony stimulating factor  gp130  interleukin 6 signal transducer  Gr1  lymphocyte antigen 6 complex, locus G (aka Ly6g)  HCM  hypertrophic cardiomyopathy  Idd  Insulin dependent diabetes  IFNγ  interferon gamma  Ig  immunoglobulin  Igf2r  insulin-like growth factor 2 receptor  IL  interleukin  IL-6R  interleukin-6 receptor  ILK  integrin-linked kinase  iNOS  inducible nitric oxide synthase  IRES  internal ribosome entry site  KC  chemokine (C-X-C motif) ligand 1 (aka CXCL1)  LCMV  lymphocytic choriomeningitis virus  LPS  lipopolysaccharide  LV  left ventricular  Map3k4  mitogen-activated protein kinase kinase kinase 4 aka Mekk4  Mapk8ip3  mitogen-activated protein kinase 8 interacting protein 3  MCMV  mouse cytomegalovirus  MCP-1  monocyte chemoattractant protein-1  MHC  major histocompatibility  MIG  chemokine (C-X-C motif) ligand 9 (aka CXCL9)  MIP-1α  macrophage inflammatory protein-1 alpha (aka CCL3)  MIP-1β  macrophage inflammatory protein-1 beta (aka CCL4)  mRNA  messenger ribonucleic acid  Mrpl18  mitochondrial ribosomal protein L18  Mrpl28  mitochondrial ribosomal protein L28  MyD88  myeloid differentiation primary response gene 88  Myhc-α  myosin, heavy polypeptide 6, cardiac muscle, alpha  NK  natural killer  NKT  natural killer T  Nme4  Non-metastatic cells 4 xii  NO  nitric oxide  NTR  non-translated region  PBS  phosphate buffered saline  PCR  polymerase chain reaction  PD-1  programmed cell death 1 (aka CD279)  Pde10a  phosphodiesterase 10A  PD-L1  programmed cell death 1 ligand 1 (aka CD274)  PD-L2  programmed cell death 1 ligand 2 (aka CD273)  PFU  plaque forming units  PI  post infection  Ppard  peroxisome proliferator activator receptor delta  Plg  Plasminogen  pVam  putative viral autoimmune myocarditis  PVB19  parvovirus B19  Rantes  chemokine (C-C motif) ligand 5 (aka CCL5)  rhIL-10  recombinant human interleukin 10  rIL-6  recombinant interleukin-6  RNA  ribonucleic acid  RORγt  retinoic-acid-receptor-related orphan receptor gamma t  rTNFα  recombinant tumor necrosis factor alpha  SCID  severe combined immune deficient  SE  standard error  siRNA  small interfering ribonucleic acid  Smoc2  SPARC related modular calcium binding 2  SNP  single nucleotide polymorphism  TCR  T cell receptor  TD  terminal deletion  Telo2  TEL2, telomerase maintenance 2  TGFβ  transforming growth factor beta  Th  helper T cell  TLR  toll-like receptor  TNFα  tumor necrosis factor alpha  Vam  viral autoimmune myocarditis xiii  wt  wild type  Wtap  Wilms' tumour 1-associating protein  xiv  Acknowledgements I would like to thank my supervisor, Dr. Marc Horwitz, for giving me the opportunity to join his lab and for all the support over these last five years. I would also like to thank my committee, Dr. Ninan Abraham, Dr. Michael Gold and Dr. Louis Lefebvre, for their feedback and suggestions about my research. I extend my gratitude to the Michael Smith Foundation for Health Research for funding me during my PhD studies. The funding for computer equipment and conference expenses has been invaluable to my career. Thanks for all the support from Lisa Osborne, Munreet Chehal, Nahida ElWarry, Nadine Straka, Dianne Fang, Iryna Shanina, Costanza Casiraghi, Kia Duthie, Gerry Greco, Mark Pryjma, Caylib Durand, Kristen Browne, Steve Bond, Catherine Gaudin, Vincent Lavallee… well the list goes on so pretty much everyone in the LSI. It’s been a good five years. Thanks to all my friends outside of science especially Tracy Kung and Sandy Leung for dinners, drinks and lots of laughs. Finally, thanks to my husband. You have been amazing and I look forward to our lives together.  xv  Dedication  To my mother  xvi  1  Introduction  1  1.1  Myocarditis in humans and mice Myocarditis is a disease with both familial (genetic) and acquired (pathogen-  associated) origins. Approximately one third of myocarditis patients spontaneously heal from the disease. However in the remaining patients, disease progresses to dilated cardiomyopathy (DCM) [1]. This disease results in left ventricular (LV) enlargement with impaired contraction ability of the heart. With an incidence of 5-8 per 100,000 and a prevalence of 40 per 100,000 [2-6], DCM is a leading cause of heart failure in the United States. In addition to genetics and pathogen history, disease contributing factors include age [7], gender [7] and nutrition [8, 9]. However, genetics is thought be the major factor in disease development contributing to 30-50% of DCM cases [10-12]. Approximately 30% of relatives of DCM patients have circulating autoantibodies to heart antigens, such as α- and β-cardiac myosin heavy chain, as well as left ventricular enlargement and cytokine activation in the periphery strongly indicating the influence of genetics in DCM development [13]. These early signs of disease may be due to purely genetic influences or a combination of genetics and common pathogen infection. Of the pathogens associated with myocarditis development, coxsackievirus is the most studied. This enterovirus is thought to contribute to approximately 50% of myocarditis cases and 10% of DCM cases [14]. While the exact mechanism by which pathogen infection leads to myocarditis development is unclear, persistence of the virus has been associated with progressive LV ejection fraction impairment while clearance of the virus is linked with LV improvement [15]. The effects of persistence on LV function may be due to the continued direct cytopathic effects of the pathogen on the cardiac cells, the continued inflammatory response to the pathogen or an autoimmune response triggered by the pathogen. Conversely, pathogen presence during the acute infection could be sufficient to induce a persistent disease without a corresponding persistent infection. This is evident as transplant of naïve hearts into myocarditic mice leads to myocarditis development without observable virus [16]. In this case, damage to the heart and release of heart antigens following pathogen-associated myocyte destruction in combination with an anti-pathogen immune response could lead to uptake  2  of self-antigen in the context of infection and therefore would be driving the chronic autoimmune disease in the heart.  3  1.2  Disease models of myocarditis Animal models are used to study the induction and pathogenesis of myocarditis  development. Mouse models are most commonly used to study myocarditis, however, rat [17], hamster [18] and canine [19] models are also used by some groups. Of the other animal models, the rat model of myocarditis is the most commonly used with Lewis rats being the most susceptible strain to disease development. Following disease induction, rats develop a granulomatous myocarditis or giant cell myocarditis [20, 21]. This model of disease results in a different pathology of disease with different pathogenic epitopes compared to the mouse model of myocarditis [21].  1.2.1 Pathogen-induced autoimmune myocarditis To study myocarditis in mice, there are two main established disease models, pathogen-induced and adjuvant-induced (Figure 1.1). The most commonly studied pathogen-induced models of disease are initiated by the enteroviruses coxsackievirus B3 (CB3) and encephalomyocarditis virus (EMCV) or the parasite Trypanosoma cruzi. Infection by these pathogens initiates a biphasic disease that consists of an acute stage and a chronic phase (Figure 1.2). Interestingly, rats are not susceptible to coxsackievirus induced myocarditis.  1.2.2 Experimental autoimmune myocarditis (EAM) The adjuvant-induced model of disease is initiated by injection of cardiac myosin protein emulsified in complete Freund’s adjuvant (CFA). Cardiac myosin is the most abundant protein in the heart and is thought to be the major antigen in chronic myocarditis. Murine, rat and porcine cardiac myosin protein can all induce myocarditis following injection in to mice or rats [20, 22]. Using this method of disease induction, the chronic stage of disease can be mimicked without the earlier complications of a pathogen infection. Indicative of the model’s similarity to natural acquisition of disease is development of chronic disease only in mouse strains that are genetically susceptible to CB3-induced myocarditis [22]. 4  Disease induction by this method is specific for cardiac (alpha-) myosin as injection of soleus muscle (beta-) myosin fails to induce disease in mice [22]. By comparing alpha- and beta-myosin protein sequences, regions with amino acid differences were identified [23]. Disease induction by injection of peptides generated from these amino acid sequences identified pathogenic epitopes. By this method, three pathogenic peptides were identified. Two of the peptides are located in the rod portion of the protein, while the third, major pathogenic peptide is located in the head portion of the molecule [23]. Injection of this peptide, Myhc-α-614-634, emulsified in CFA is also sufficient to induce myocarditis in mice [24].  5  Figure 1.1 Myocarditis disease models There are two main models used to study myocarditis development. The first is experimental autoimmune myocarditis in which disease is induced by injection of cardiac myosin protein or peptide emulsified in CFA. The second model is a pathogeninduced model in which disease is initiated by an infection. Enteroviruses such as coxsackievirus or encephalomyocarditis virus are the pathogens most commonly used to study myocarditis development. With permission: Poffenberger MC, Horwitz MS. (2009) IL-6 during viral-induced chronic autoimmune myocarditis. Ann N Y Acad Sci. 1173:318-25.  6  Figure 1.2 Schematic representation of the disease course following coxsackievirus infection The replicative virus in the heart peaks at 5 days post infection (PI) and is cleared by 15 days PI. Acute disease characterized by an infiltration of immune cells occurs between days 7 and 14 PI with the peak at 12 days PI. The chronic, autoimmune phase, characterized by fibrosis and immune cell infiltration, starts at 21 days PI with a peak in histology at 35 days PI and is cleared by 56 days PI. With permission: Richer, M., Poffenberger MC, Horwitz MS. (2007) Early inflammatory responses direct chronic autoimmunity development in the heart following coxsackievirus infection. Future Virology. 2(3): p. 283-291.  7  1.3  Pathogens associated with myocarditis development Pathogens such as the viruses human cytomegalovirus [25], human herpes virus  6 [15], parvovirus B19 (PVB19) and adenovirus [26] as well as the bacteria Campylobacter [27-29], Chlamydia [30-34], Staphylococcus [35] and Streptococcus [3640] and the parasite Trypanosoma cruzi [41] have all been linked to myocarditis development.  1.3.1 Chlamydia and myocarditis Infection by the Gram negative bacteria Chlamydia pneumoniae, Chlamydia psittae and Chlamydia trachomatis have all been linked with endocarditis, myocarditis and pericarditis development in patients (reviewed in [30]). Using a mouse model of Chlamydia-induced myocarditis, molecular mimicry has been suggested to be the mechanism of disease induction [33]. Comparison of the pathogenic residues of the dominant aggressive epitope of α-cardiac myosin heavy chain with peptide sequences of pathogens associated with myocarditis identified a similarity in the sequence of an outer membrane protein of C. trachomatis [33]. In addition, homologous sequences were identified in C. psittae and C. pneumoniae. Injection of these Chlamydia peptide sequences into mice is sufficient to induce cardiomyopathy with immune cell infiltration. Further, injection of cardiac myosin peptide in conjunction with C. trachomatis DNA, is sufficient to induce disease [33]. However, Chlamydia infection is not often associated with myocarditis in patients. Therefore factors such as genetics and the extent of infection are likely involved in susceptibility to this mode of disease development.  1.3.2 Streptococcus pyogenes and myocarditis Molecular mimicry has also been implicated as the disease mechanism in the mouse model of Streptococcus pyogenes-induced heart disease. M protein, which extends from the bacterial cell wall, has structural homology to heart proteins such as cardiac myosin and tropomyosin [42]. The autoreactive immune response triggered by 8  S. pyogenes involves both the humoral and cellular branches with antibodies and T cell clones cross-reactive to both virus and host antigens [43]. Interestingly, cross-reactive antibodies to cardiac myosin and M protein are also cross-reactive to coxsackievirus [44]. Further, CD4 T cells from coxsackievirus-infected cells react to a peptide derived from S. pyogenes M protein [45]. Also, tolerization of mice to this peptide protects from coxsackievirus-induced myocarditis [46]. In patients with S. pyogenes-induced myocarditis, genetic susceptibility has been linked to the MHC [38], mannose binding lectin [47], Toll-like receptor 2 [48] and polymorphisms in the promoter region of the TNFα gene [39].  1.3.3 Trypanosoma cruzi and myocarditis In South America, the parasite Trypanosoma cruzi is the leading causative agent for chronic myocarditis and heart lymphocytic infiltration [41, 49]. The prevalence and differences in myocarditis disease severity among patients is thought to be due to variations in both pathogen and patient genetics. T. cruzi can be transmitted by blood transfusion, organ transplantation, transplacental, ingestion of triatomine bug contaminated food or most commonly by feces of the triatomine entering the body following triatomine bug bite [50]. Following T. cruzi infection, an acute stage of disease occurs that lasts 4-8 weeks. During this stage, heart tissue destruction is caused by the parasite acting directly on heart tissue. This is associated with necrosis in the heart as well as cytotoxic destruction of infected cells by CD8 T cells, and to a lesser extent CD4 T cells. There is a 10% mortality rate during the acute stage of this form of the disease [51]. Following acute disease, up to 30% of patients develop the chronic stage of disease 10-20 years later. This stage of disease is characterized by heart tissue destruction, interstitial fibrosis and thinning of the left ventricular wall [52, 53]. Persistence of the parasite has been suggested to be the underlying cause of chronic disease development. Additionally, the levels of MHC class I and II [54], NF-κB [55] and cytokines [56-58] following infection have been associated with chronic myocarditis development. It is likely a combination of the parasite and the immune response to the parasite that leads to development of the chronic stage of disease.  9  1.3.4 Mouse cytomegalovirus and myocarditis The herpes virus mouse cytomegalovirus (MCMV) has been associated with acute and chronic myocarditis in mouse models of myocarditis. The effects of MCMV infection in susceptible versus resistant mouse strains have been examined. Similar to mouse models of coxsackievirus-induced myocarditis, both the resistant C57BL/6 strain and the susceptible BALB/c strain develop an acute stage of disease where virus can be detected in the heart. During this stage, inflammatory foci comprised of CD8 T cells, CD4 T cells, macrophages, B cells and neutrophils are observed in the heart [59]. These lesions are smaller in size with few macrophages and neutrophils in the resistant C57BL/6 mice compared to the BALB/c mice suggesting that early differences in the viral infection determine the course of the chronic disease. One week post infection, no replicative virus is present in the heart; however there is evidence suggesting a latent infection of the virus. Following viral clearance, the resistant C57BL/6 mice completely resolve the myocardial disease. Susceptible BALB/c mice, however, progress to the chronic stage in which there is diffuse mononuclear cell infiltration and necrosis of myofibres [59]. Genetic susceptibility to the chronic stage of MCMV in mice has been linked to both MHC and non-MHC genes and is not related to the level of viral infection in cardiac tissue [25].  1.3.5 Parvovirus B19 and myocarditis PVB19 has recently generated a lot of interest as a myocarditis-causing pathogen. The disease pathology of this single stranded DNA virus differs from that of other viruses as it does not infect cardiac myocytes [60]. Instead, it infects myocardial endothelial cells of the small intracardiac arterioles and venules. This leads to impaired myocardial microcirculation with secondary myocyte necrosis [60]. Damage in the heart has been associated with increased levels of the cytokines IFNγ, TNFα, IL-6 and IL-8 [61]. While the prevalence of this virus in DCM patients with heart inflammation is approximately 33%, the prevalence in patients without DCM or heart inflammation is approximately 17% [26]. As this incidence in healthy patients is quite high, it should be  10  determined if genetics or infection by a second pathogen promote chronic heart disease development following PVB19 infection.  11  1.4  Coxsackie B viruses Coxsackievirus is a non-enveloped RNA virus of the Picornaviridae family and  Enterovirus genus. Entry of coxsackievirus into cells is mediated by the coxsackievirus and adenovirus receptor (CAR) [62] and decay accelerating factor (DAF or CD55) in humans [63]. CAR is a tight-junction protein that is important in cell-cell communication and maintenance of cell membrane integrity. It is expressed by many cell types such as gut epithelial cell, immune cells, neurons and cardiomyocytes. CAR is upregulated following coxsackievirus infection. This may lead to increased virus uptake by the cells. Conversely, reduced expression of CAR is associated with resistance to myocarditis development [64]. Following entry into a cell, the single stranded positive sense RNA viral genome is directly translated as a single polyprotein. The polyprotein is cleaved into the capsid proteins (VP1-4) and non-structural proteins (2A, 2B, 2C, 3A, 3B, 3C, 3D). The nonstructural proteins include the viral cysteine proteases 2A and 3C. These proteases cleave the polyprotein into functional units and also act on cellular targets, such as proteins that mediate cell-cell and cell-matrix connections. This aids in replication and release of viral progeny. Coxsackieviruses are divided into two groups, group A and group B, based on their pathogenicity in mice. Group B coxsackieviruses (CVB) are associated with myocarditis development. CVB-induced myocarditis is the most well characterized model of pathogen-induced myocarditis. Of the six CVB serotypes, CVB serotype 3 (CB3) is the best characterized in the context of myocarditis development. CB3 has tropisms for many organs including the spleen, liver, heart and pancreas. The pancreas is thought to be the primary site of infection [65]. Because CB3 is an RNA virus and the RNA dependent RNA polymerase needed for viral replication has no proofreading ability, CB3 exists as a quasispecies with many variant genotypes. Only some of these variants are myocarditic while others are amyocarditic. Following CB3 infection in mice, this serotype follows one of three disease pathogenesis paths: (1) pancreatitis and myocarditis, (2) pancreatitis only, or (3) no pancreatitis or myocarditis [66] (Figure 1.3). Myocarditis without pancreatitis has not been observed, indicating a link between virusinduced damage in the pancreas and the ensuing disease in the heart. However, the 12  Figure 1.3 Schematic representation of possible paths of disease course following CB3 infection Following CB3 infection, virus replicates in the pancreas. Pancreatitis is a necessary precursor for myocarditis development. Following pancreatitis, the disease will resolve or progress to acute myocarditis. If the virus is cleared, disease will either resolve or progress to chronic myocarditis. If the virus persists in the heart, disease will progress to chronic myocarditis.  13  extent of pancreatic tissue damage does not correlate with heart disease. Independent of the disease outcome, the virus is present in the pancreas until day 8 PI, indicating that replication in the pancreas is not sufficient to cause pancreatitis [66]. Infectious virus can also be isolated from the sera and heart following infection with all virus variants. However, cardiovirulent myocarditic variants replicate to higher titres and at earlier time points in the sera, pancreas and hearts of infected mice [66]. Persistence in the heart correlates with heart pathology [65]. Differences in disease pathogenesis by viral variants indicate that many factors, including viral genetics, are involved in determining the disease outcome following CB3 infection. Following CB3 infection in the heart, one of three possible outcomes occurs: (1) acute infection that heals spontaneously, (2) persistent infection with progression to chronic disease, or (3) viral clearance with chronic deterioration of the heart and heart failure (Figure 1.3). Host genetics are the deciding factor in the development of acute but resolving disease versus acute disease that progresses to chronic disease. Following clearance of replicative virus, susceptible but not resistant strains of mice develop a chronic stage of disease that is characterized by fibrosis and necrosis as well as diffuse lymphocytic infiltration [67]. During the chronic stage of disease heart-specific autoantibodies are produced in disease susceptible mice, with the major autoantigen being cardiac myosin. However cardiac myosin reactivity does not drive disease development as mice tolerized to cardiac myosin prior to infection remained susceptible to disease induction [68]. Further, transfer of myosin-specific autoantibodies alone is not sufficient to drive disease development [69]. However, injection with cardiac myosin specific autoantibodies is sufficient to induce apoptosis and cardiomyopathic effects in rats [70]. Injection of heart specific autoantibodies in Lewis rats results in IgG depositions in the heart and increased cAMP-dependent protein kinase A activity [70].  1.4.1 Virulence factors associated with CB3 Of the many naturally occurring variants of CB3, the commonly studied laboratory strains represent only one of the four branches of this virus serotype [71]. This branch mostly represents myocarditis causing variants. Therefore comparison with 14  closely related amyocarditic strains within this branch can lead to identification of myocarditis virulence factors in the CB3 genome [71]. Comparison of the myocarditic variant CB3/m with the amyocarditic variant CB3/o identified a single U to C nucleotide substitution at nucleotide position 234 in the 5’ nontranslated region (NTR) that is necessary and sufficient to induce myocarditis in mice [72]. Nucleotide 234 is part of a 5-mer that is highly conserved among enteroviruses. Nucleotides 232-236, which is otherwise invariably 5’-CGUUA-3’, is mutated to 5’-CGCUA-3’ in the amyocarditic CB3/o [71]. This site is part of an established 2o structure that is thought to be involved in the internal ribosome entry site (IRES) site and is therefore involved in translation of the viral polypeptide [73, 74]. However no difference in translation efficiency was noted in this CB3 variant. In fact, mutation at this position has been shown to affect the replication efficiency of the virus as CB3/o transcription efficiency is 10-fold lower than CB3/m [71]. Therefore, lack of myocarditis development following CB3/o infection is likely due to decreased replication of the virus in the host. Comparison of the genotype at nucleotide 234 in naturally-occurring myocarditic and amyocarditic isolates failed to identify this nucleotide as conferring virulence since this nucleotide is invariably a U [71]. This is likely due to the reduced transcription efficiency of the U to C mutation, which would cause this variant not be selected for in a natural infection, such that it would therefore be rapidly out competed by more virulent progeny. Additionally, comparison of the virulent H3 variant with the attenuated antibody escape mutant H310A1, identified a virulence factor at nucleotide 1442 [75]. An A to G nucleotide substitution at this position results in an asparagine to aspartate substitution at amino acid 165 in the Puff region of the capsid protein VP2 [75]. The Puff region lines the rim of the canyon floor on the outside of the virus [76] and this mutation likely results in a decreased efficiency of interaction between Puff and the virus receptor DAF. Further, infection with the H310A1 mutant leads to a Th2-driven immune response rather than the Th1 response seen following H3 infection [75]. This would lead to a decrease in the pathogenic CD8 T cell response and therefore decreased damage by immune system to the host.  15  1.4.2 Persistence of CB3 The ability to clear virus following acute infection has been suggested to play a major role in chronic myocarditis development. Immunohistological detection of a conserved epitope from the enterovirus capsid protein VP1 has shown that approximately 50% of DCM patients are positive for VP1, compared to 8% of healthy patients [77]. 70% of patients with fatal myocarditis are positive for VP1, indicating that persistence of virus likely plays a role in fatal myocarditis [77]. Indicative of a role for persistent infection in myocarditis development, transfection of cardiac myocytes with a replication-restricted CB3 mutant is sufficient to induce cytopathic effects in the transfected cells [78, 79]. Further, transgenic expression of the noninfectious CB3 viral genome specifically in the heart is sufficient to induce myocardial interstitial fibrosis and degeneration of myocytes in mice [79]. Therefore, the persistent presence of viral proteins within cardiac cells is sufficient to induce myocardial damage. This suggests that viral persistence in the heart is sufficient to drive disease development. Compelling evidence for the existence of persistent virus in chronic myocarditis development is the isolation of terminal deletion (TD) CB3 from the hearts of infected mice [80]. Following infection, CB3 with 7-, 12-, 17-, 30- and 49-base pair deletions from the 5’ NTR can be isolated from the hearts of mice with 49 base pairs being the maximum TD in viruses capable of persisting [80]. The 5’ NTR is a region of the genome that is rich with 2o structures and is divided into six domains of stem-loop structures. The first of these domains is a cloverleaf-type structure comprised of a stem and three stem loops. Deletions from the 5’ NTR result in disruption of the cloverleaf structure with the maximum deletion preserving the third stem loop. This indicates a requirement for this structure for replication initiation [80]. TD mutants can arise following infection in primary cell lines but not immortal cell lines such as HeLa cells [81]. However, once a TD has occurred, these mutants can persist in immortalized cell lines without cytopathic effects [81]. Infection of mice with TD mutants does not cause necrosis or inflammation in the heart and virus can persist for up to five months after infection. TD mutants have been isolated from human heart tissue [82]. However the role of TD mutants in cardiac disease development must still be determined. It is possible 16  that genetic factors, as well as the effects of acute myocarditis and TD mutant persistence, all impact chronic disease development.  17  1.5  Myocarditis disease pathogenesis following viral infection  1.5.1 Cytokines associated with myocarditis Cytokine and chemokine production is a major determinant of myocarditis development. Indicative of a central role for these immune factors in myocarditis development is disease resistance in mice treated with an NF-κB inhibitor following EMCV infection [83]. In viral models of disease induction, cytokines and chemokines are necessary to mount an effective antiviral response in order to clear virus from the host. However, this cytokine/chemokine production must be precisely limited to prevent excessive inflammation during the acute, chronic and autoimmune stages of disease. A number of cytokines are associated with disease development (Figure 1.4). Some, such as IFNγ and TGFβ prevent myocarditis development [84, 85] while others such as IL-17 and IL-1β have a pathogenic role in disease development [86, 87]. Some cytokines have complex effects that may be due to differences in mouse strains used, adjuvant-induction versus viral-induction, or EMCV infection versus CB3 infection. Following coxsackievirus infection, a number of cytokines and chemokines are expressed including TNFα, IFNγ, IL-12 and IL-6 [88-90]. These cytokines are part of the anti-viral response. However, these same factors can drive development of autoimmune disease by either allowing for viral persistence or driving the autoimmune response directly. An important factor affecting the immune response to the virus and viral clearance is IFNγ. Coxsackievirus infection in mice deficient in IFNγ results in increased disease severity with a corresponding increase in viral replication in the heart [67, 91, 92]. Similarly, expression of this cytokine specifically in the pancreas is sufficient to decrease viral replication as well as the virus-mediated damage in the heart and the ensuing autoimmune disease [85]. Taken together, IFNγ limits myocarditis pathology by decreasing viral replication and therefore virus-mediated damage. Interestingly, IFNγ not only controls disease severity by limiting the virusmediated damage, this cytokine also controls disease severity following adjuvantinduction of disease. Antibody depletion of IFNγ increases chronic disease severity following adjuvant-induction of disease [93, 94]. The same is true for IFNγ receptor 18  Figure 1.4 Cytokines linked with myocarditis Many cytokines have been linked with myocarditis. Some contribute to acute and chronic disease development while others limit disease by reducing inflammation and viral replication. The role of the cytokine is dependent on the stage of myocarditis.  19  deficient mice [95]. Further, treatment with exogenous IFNγ decreases myocarditis severity [95]. Therefore IFNγ influences disease development during both the acute viral and chronic autoimmune stages of disease. In addition to IFNγ, the Th2 cytokines IL-4, IL-10 and IL-13 oppose disease development. IL-13 protects against both viral- and adjuvant-induced myocarditis [96]. Mice deficient in this cytokine develop increased disease pathology that is associated with increased infiltration in the heart, heart-specific antibodies and fibrosis. The macrophage infiltrate in the heart is altered in the IL-13 deficient mice so that it is predominantly inflammatory M1 macrophages, rather than alternatively activated M2 macrophages. These mice also produce increased levels of the inflammatory cytokines IL-1β and IL-18 in the heart [96]. Therefore, IL-13 influences disease development by regulating inflammatory cytokines and disease development. IL-4 has both a protective and redundant role in disease development. This cytokine is protective in BALB/c mice following coxsackievirus infection. Exogenous IL4 reduces myocardial inflammation and improved ventricular function [97]. Further, BALB/c mice that overexpress the IL-4 gene develop decreased CB3-induced myocarditis [98]. Interestingly, however, BALB/c mice depleted of IL-4, as well as IL-4 deficient BALB/c mice, develop disease pathology similar to wild type mice following EAM-induction [96]. This could suggest that IL-4 influences the infection but not the autoimmune phase of disease thus influencing overall severity. However, antibodymediated depletion of IL-4 in A/J mice results in decreased disease severity following EAM-induction, suggesting that genetic differences between inbred strains also dictate the role of this cytokine [94]. Therefore the differences observed in the role of IL-4 in disease development differ depending on inbred mouse strain and/or disease models of myocarditis. IL-10 is produced in the myocardium during both the acute and chronic stages of virus-induced myocarditis [88, 99]. It has been suggested that the persistent production of IL-10 could be causing the progression of disease from the acute to chronic stage possibly by allowing for persistence of low numbers of virus and therefore a continuing inflammatory response. However, rhIL-10 treated mice develop decreased acute disease with increased survival following EMCV infection [100]. Further, infection of mice with a CB3 variant that produces IL-10 results in lower viral titres with a significant decrease in pathology that is limited to the pancreas [101]. This suggests that IL-10 is 20  acting to limit viral replication without impairing the hosts’ ability to clear the virus. Additionally, CB3 infection in IL-10 deficient mice results in prolonged inducible nitric oxide synthase (iNOS) production suggesting that IL-10 also acts to limit the inflammatory responses [102]. These results all suggest that IL-10 prevents virusinduced disease development. IL-10 also has a protective role in adjuvant-induced myocarditis. IL-10 blockade during the effector phase of EAM results in increases disease incidence and severity while blocking IL-10 during the induction phase has no effect [103]. Therefore IL-10 is protective during the chronic stage of disease but is dispensable during the initiation of disease. These results show that the role of IL-10 in disease development is predominantly protective. Th1 cytokines are often linked with initiation and progression of autoimmune and inflammatory diseases. The two cytokines most often related to myocarditis development are IL-1β and TNFα [39, 93, 104-118]. The observation that LPS injection at the time of CB3 infection is sufficient to overcome genetic resistance of mice led to the identification of IL-1 and TNFα as the cause of the change in disease course. In fact, injection of IL-1 or TNFα alone is sufficient to overcome the genetic resistance to CB3- and EAM-induced myocarditis [113, 114]. This change in disease susceptibility is associated with increased TNFα and IL-1 producing infiltrate in the heart [114]. IL-1β is produced specifically in the heart post CB3 infection [107]. Production of this cytokine begins during the acute stage of disease but persists into the chronic phase of disease and the levels of IL-1β in the heart correlate with the degree of fibrotic lesions present in the heart post viral infection in mice [119]. Injection of an IL-1R agonist prior to infection is sufficient to decrease viral titres in the heart and mortality [120]. IL-1 signaling is also essential for adjuvant-induction of disease as IL-1R signaling on dendritic cells is necessary to trigger autoimmune disease [87]. IL-1 production also influences disease course following infection of myocarditic and amyocarditic variants of CB3. IL-1 was suggested to be a disease-causing factor as monocytes infected with an amyocarditic variant of CB3 produce significantly decreased levels of IL-1 compared to monocytes infected with a myocarditic variant [121]. Tellingly, IL-1 injection of mice at the time of infection with an amyocarditic variant of CB3 can drive myocarditis development. 21  TNFα is often associated with myocarditis development and heart failure [106, 110]. TNFα is made directly in the heart by myocardial macrophages and cardiac myocytes [115]. Human cardiac myocytes expresses the TNFα receptors TNFR1 (TNFRp55) and TNFR2 (TNFRp75). Binding of TNFα to TNFR1 results in negative inotropic effects on cardiac myocytes [116] and apoptosis [115]. Deficiency of TNFR1 in A/J mice is sufficient to protect mice from EAM-induced myocarditis [116]. Further, antibody depletion of TNFα can ameliorate adjuvant-induced disease if treatment occurs during the initiation of disease [93]. Indicative of a central role in disease induction, mice constitutively expressing TNFα specifically in the heart develop cardiomegaly and myocarditis [105, 111, 112]. Cardiac dysfunction in these mice could be due to increased induction of iNOS [122]. Interestingly, infection of the TNFα transgenic mice with the amyocarditic CB3 variant H310A1 leads to generation of myocarditis protective regulatory T cells. This difference in disease course is thought to be due to decreased TNFα production following H310A1 infection compared to infection with the myocarditic variant H3 [123]. The Th1 cytokine IL-12 is made up of the p40 and p35 subunits and signals through a heterodimeric receptor composed of IL-12Rβ1 and IL-12Rβ2. Disease absence in p40 and IL-12Rβ1 deficient mice following adjuvant-induction and disease exacerbation in mice treated with exogenous IL-12 initially suggested that IL-12 drives disease development similar to IL-1β and TNFα [91, 124]. However, p35 deficient mice do not differ in chronic disease pathology following viral infection [92] suggesting the IL12 does not affect chronic disease development. The effect of the p40 deficiency is in fact due to the lack of IL-23, which is composed of the p19 as well as the p40 subunit common to both IL-12 and IL-23. While IL-12 does not appear to affect chronic disease development, IL-12 production does affect viral replication in the heart with p35 deficient mice having increased replication in the heart following infection. This increased replication is due to decreased IFNγ and macrophage and neutrophil infiltration in the heart [92]. In agreement, exogenous addition of recombinant IL-12 decreases viral replication in the heart and mortality post EMCV infection while antibody depletion of IL-12 increases viral replication and mortality [125]. The effect observed may not be through IL-12Rβ1  22  signaling as mice deficient in IL-12Rβ1 do not differ in their myocarditis development following viral-induced disease [67]. Th17 cells and their related cytokines have been determined to be pathogenic in many adjuvant-induced models of autoimmunity including experimental autoimmune encephalomyelitis [126] and rheumatoid arthritis [127, 128]. Th17 cells are IL-17 producing CD4+ that are generated in the presence of TGFβ in conjunction with IL-6 or to a lesser extent IL-21. As IL-17 depletion as well as vaccination to IL-17 results in decreased EAM severity, this cytokine is also pathogenic in adjuvant-induced autoimmune myocarditis [86, 129]. Disease absence in IL-6 deficient mice following adjuvant-induction of disease was speculated to be due to the disruption of Th17 cell generation. The role of IL-21 in Th17 cell generation, however, is dispensable as IL-21R deficient mice develop disease at a prevalence and severity similar to wild type controls [130]. IL-23, a cytokine involved in the expansion of Th17 cells, is likewise involved in disease severity as mice deficient in IL-23 or antibody blocking of IL-23 results in decreased disease severity [86, 129]. Further downstream, GM-CSF is necessary for IL-6 and IL-23 production by dendritic cells during the initiation of disease and therefore the generation and expansion of Th17 cells [131]. In addition to EAM, IL-17 production is observed after viral infection in the heart. Following CB3 infection in BALB/c mice, cardiac expression of IL-17 correlates with viral RNA. Neutralization of the IL-17 leads to decreased cardiac replication and acute stage damage in the heart suggesting that IL-17 production disrupts the antiviral response and therefore the acute stage of disease [132, 133].  1.5.2 Chemokines associated with myocarditis Migration of immune cells to the heart and the subsequent release of cytokines and presentation of self-antigen is a key step in disease pathogenesis. Therefore chemokines play a key role in the disease course. Specific roles of a few chemokines have been investigated in the initiation of myocarditis. The chemokines MCP-1 (CCL2) and MIP-1α (CCL5) contribute to myocarditis development following both viral- and adjuvant-induction of disease. These chemokines direct the migration of monocytes to the heart following inflammatory insult. Further, 23  mice depleted of MCP-1 or MIP-1α develop decreased disease pathology at a decreased incidence following EAM-induction of disease. The importance of these molecules in disease pathogenesis was confirmed by a similar decrease in disease in mice deficient in the receptors for these chemokines, CCR2 and CCR5 respectively [134]. Lack of disease in these mice following myocarditis induction suggests that migration of monocytes to the heart is a major step in myocarditis development [135].  1.5.3 Immune cells associated with myocarditis Following viral infection, a cellular immune response is needed to completely clear the virus. However these same cells can be driving the chronic inflammation and autoimmune responses. A number of cells are associated with virus-induced myocarditis. CD4+ T cells, CD8+ T cells and macrophages have all been observed in the hearts of patients with coxsackievirus-associated myocarditis and DCM [136]. CD4+ T cells, CD8+ T cells, γδ T cells, B cells, macrophages, mast cells, neutrophils, NK cells and DC cells are all observed in the hearts of mice post CB3 infection. Some of these cells drive the progression of myocarditis while others ameliorate myocarditis during the disease course [137, 138]. Macrophages are the most abundant immune cell in the heart postcoxsackievirus infection [138]. The predominant role of these antigen-presenting cells in disease development is dependent on the subset of macrophage. Transfer of the inflammatory M1 macrophages into viral infected mice results in increased disease while transfer of alternatively activated M2 macrophages alleviates disease [139]. M2 macrophage transfer may be protecting mice by changing the local cytokine milieu as well as promoting regulatory T cell differentiation in the periphery [139]. Mast cells have been associated with susceptibility to disease. The cytokines produced early following viral infection are those typically produced by mast cells suggesting a role for these cells during the initiation of disease. Mast cells are present in the heart post infection as well as in elevated numbers in the spleens of susceptible BALB/c mice compared with resistant C57BL/6 mice [140]. Mast cells have also been suggested to be a contributing factor to the increased pericardial disease observed in IFNγ deficient mice [67]. 24  γδ T cells have both an innate and adaptive role in the immune response. Depletion of γδ T cells results in decreased viral titres in the heart and decreased macrophages in correlation with decreased myocarditis severity suggesting that γδ T cells promote disease progression in viral-mediated heart disease. γδ T cells may be influencing the disease course by affecting the regulatory T cells. Mice depleted of γδ T cells have increased functionally active regulatory T cells suggesting that γδ T cells disrupt proper immune regulation by these cells and thereby allow for chronic disease development [141]. The role of T cells subsets has been investigated to determine which subsets are pathogenic or protective in myocarditis development. IFNγ producing CD4 Th1 cells are protective following EAM-induction of disease as lack of the Th1 specific transcription factor, Tbet, results in increased myocarditis [129]. The mechanism by which the Th1 cells protect is through stimulation of IFNγ production that in turn regulates IL-17 production by Th17 cells [129]. Specifically, IFNγ producing CD8 cells have been shown to limit damage in the heart by limiting IL-17 production [129]. Similar to the role of regulatory T cells in the development of other autoimmune diseases, regulatory T cells have a protective role in myocarditis development. Regulatory T cell transfer before infection results in decreased mortality compared to naïve CD4 transfer. Regulatory T cell treated mice have decreased cardiac expression of CAR, the receptor for coxsackievirus entry, correlating with decreased viral replication and inflammatory disease [142]. Therefore the decrease in disease observed may be due to decreased viral entry, which would limit viral-mediated damage. However, following regulatory T cell transfer, the decreased mortality observed is not as low as non-transfer mice therefore it is most likely a combination of regulatory T cells as well as another immune cell subset that act together to limit disease severity.  1.5.4 Toll-like receptors associated with myocarditis Signaling through pattern recognition receptors is one of the first steps to mount a proper immune response. The role of specific Toll-like receptors (TLR) in myocarditis development has been investigated in both viral and adjuvant models of myocarditis. 25  TLR2, TLR3, TLR4, TLR5, TLR7 and TLR9 are all expressed in murine hearts and therefore have the potential to affect disease development in the heart [143]. Coxsackievirus infection activates TLR signaling directly through different viral components. In humans, the main TLR triggered is TLR8 with TLR7 and TLR4 also contributing [144]. TLR8 and TLR7 are located within endosomes and are sensors for single stranded RNA such as CB3 genome. In human myocarditis patients, cardiac levels of TLR8 and MyD88, the TLR adaptor protein, are increased in virus-associated DCM patients and increased levels of TLR8 and MyD88 correlate with heart failure [145]. TLR4 is thought to promote virus-induced myocarditis. Following viral infection, TLR4 activation is through an interaction with a virion protein [144]. TLR4 expression is increased in viral myocarditis and DCM patients with TLR4 levels correlating with enteroviral RNA levels. TLR4 is expressed on both the infiltrating cells and the myocytes and co-localizes with viral proteins [146, 147]. CB3 infected TLR4 deficient mice develop decreased autoimmune disease with a corresponding decrease in viral replication and IL-1β and IL-18 production [148]. Therefore increased TLR4 signaling can contribute to disease development by increasing the inflammatory response beyond what is needed for viral clearance. In addition to viral-induced myocarditis, TLR4 deficient mice are also protected from adjuvant-induced myocarditis. The protection of TLR4 deficient mice from EAMinduced myocarditis has been attributed to increased apoptosis of CD4 T cells in the inflammatory lesion [149]. TLR3, which recognizes double stranded RNA, is important in the antiviral response. TLR3 deficient mice develop increased acute myocarditis and mortality following coxsackievirus infection [150]. Increased disease is associated with decreased production of IL-12p40, IFNγ and IL-1β post infection. Mice deficient in the TLR3 adaptor protein, Trif, have a similar disease course as TLR3 deficient mice suggesting that the TLR3-Trif pathway is important in the host response to CB3 infection [150]. TLR3 polymorphisms could be contributing to increased susceptibility to myocarditis. In myocarditis patients, a common TLR3 polymorphism resulting in reduced TLR3 signaling after stimulation is associated with incidence of myocarditis [151]. Cell lines expressing this particular TLR3 polymorphism have a decreased type 26  one interferon response following CB3 infection and increased viral replication. Therefore TLR3 polymorphisms could be increasing susceptibility to viral-induced myocarditis by allowing for increased viral replication and therefore viral-mediated damage and release of heart antigen. Interestingly, human cardiac myosin can activate TLR2 and TLR8 signaling in monocytes. This activation is limited to cardiac myosin as skeletal myosin does not produce the same result [152]. While pathogen infection can initiate the inflammatory response and cause release of self-antigens, including cardiac myosin, the continued presence of cardiac myosin can sustain the chronic inflammation and autoimmune disease. SNP differences between susceptible and resistant strains of mice within the TLR2 gene locus suggest that this receptor could also be contributing to disease susceptibility. As many TLRs have been linked with disease development and susceptibility, it is not surprising that the TLR adaptor protein MyD88 also plays a central role in disease development. Cardiac expression of MyD88 is greatly increased following CB3 infection and infection of MyD88 deficient mice results in increased survival with a corresponding decrease in cardiac inflammation [153]. MyD88 deficient mice are also protected from adjuvant-induced myocarditis [154]. The effect is due to expression of MyD88 on bone marrow derived cells [24]. Overall, these results outline a major role for TLR signaling in the initiation and continuation of disease. Following disease induction by either viral infection or adjuvant injection, the acute inflammatory response is triggered. However, with continued TLR stimulation by viral persistence or self-proteins such as cardiac myosin, the chronic inflammation continues.  1.5.5 Complement receptors associated with myocarditis Complement is another key component in the innate immune response. Complement receptors 1 (CR1) and 2 (CR2) are associated with disease development. CR1/CR2 deficiency in mice results in increased myocarditis development and heart failure following coxsackievirus infection without a corresponding change in the replicative virus found in the heart [155]. These mice also develop earlier dilation of the 27  left ventricle indicating a role for these receptors in chronic myocarditis and DCM development. Hearts of CR1/CR2 deficient mice have increased macrophages present post infection but decreased T and B cells indicating that macrophages are driving the increased disease in this model [155].  28  1.6  Host genes associated with myocarditis development  1.6.1 Dystrophin Over 20 genes have been associated with familial dilated cardiomyopathy including dystrophin, cardiac troponin and laminin A/C (reviewed in [156]). Dystrophin has also been linked with acquired myocarditis following CB3 infection through a series of elegant experiments. As transgenic expression of a replication restricted CB3 mutant in the heart is sufficient to induce myocarditis pathology [79], it is clear that the viral proteins played an integral role in disease development. Algorithms designed to identify cleavage sites in host proteins by the two viral proteases 2A and 3C, identified dystrophin as a probable cellular target of 2A [157]. Further, purified 2A cleaves dystrophin in myocyte cell cultures and CB3 infection in mice results in dystrophin cleavage [158] indicating that cleavage of dystrophin is part of the viral life cycle. The virus likely cleaves dystrophin in an attempt to weaken the cellular membrane thereby facilitating exit of viral progeny. 2A is sufficient for disease induction as cardiac restricted expression of 2A is sufficient to induce DCM [159]. This mouse disease model is representative of cardiomyopathy due to a persistent infection as 2A expression levels are similar to that seen during an acute viral infection. However, this model only produces a small increase in the interstitial fibrosis and inflammation [159] whereas expression of the full length viral genome in the heart results in fibrosis and inflammation [79]. Therefore, presence of other viral proteins within the cell may be necessary to induce an inflammatory response via pattern recognition receptors. In uninfected hearts, dystrophin co-localizes with α-sarcoglycan and βdystroglycan and connects the internal F-actin-based cytoskeleton to laminin-2 of the extracellular space. However, in CB3 infected cells there is a loss of sarcolemmal localization of the dystrophin [160, 161]. Cleavage of dystrophin by CB3 resembles the disease phenotype of the familial DCM disease, Duchenne muscular dystrophy [158]. Dystrophin cleavage could lead to release of self-antigens over time and therefore the ensuing heart disease.  29  Also linking familial and acquired myocarditis, CB3 infection in mice that possess a mutated dystrophin, similar to that seen in Duchenne muscular dystrophy patients, results in increased cardiomyopathy as well as increased viral replication and release of virus from infected cells [162]. This would suggest that genetic predisposition to familial DCM increases predisposition to CB3-induced acquired DCM. Further, expression of cleavage resistant dystrophin is sufficient to reduce viral release and cytopathic events [162] therefore suggesting that dystrophin mutation can be a resistance gene as well as a susceptibility gene to cardiomyopathy. Treatments that lead to increased NO may limit cleavage of dystrophin by 2A as NO nitrosylation of the active site of 2A inhibits the cleavage ability of this protease [163]. Therefore, release of virus from infected cells and the resulting cardiomyopathy would be limited. NO is increased in human DCM patients and could be part of the body’s mechanism of combating the virus and the subsequent heart disease.  1.6.2 Apoptosis Apoptosis of infected cells is a major component of the disease pathology following CB3 infection. These apoptotic events are observed in some DCM patients as well as infected mouse strains. The viral proteases 2A and 3C can induce apoptosis in infected cells through the caspase-dependent mechanism, specifically caspase-8 mediated activation of caspase-3 [164]. These proteases can also induce mitochondria-mediated apoptosis, which involves release of cytochrome c and activation of caspase-9 [164]. CB3 capsid proteins can also interact with host proteins to induce apoptosis. The capsid protein VP2 can directly interact with the human and mouse proapoptotic protein, Siva [165]. Siva contains a death domain and is involved in the CD27/CD70 apoptotic pathway. Further transcription of Siva is increased in mice following CB3 infection. Transcription of Siva occurs in the same apoptotic cells in which CD27, CD70, activated caspase-3 and CB3 are present [165]. Using the VP2 proteins from the myocarditic CB3 variant H3 and the amyocarditic antibody escape mutant H310A1, which differ by an asparagine to aspartate mutation at amino acid 165 of VP2, this amino acid was identified to be 30  involved in stable interaction between VP2 and Siva [166]. Without the interaction between Siva and VP2, infection with the H310A1 mutant results in reduced apoptosis, viral spread and inflammatory response in association with decreased Siva transcription. However, the viral load following infection with H310A1 mutants is not significantly different compared to infection with H3. Infection with H310A1/VP2-D165N mutants, which contain an aspartate to asparagine substitution at amino acid 165, results in increased Siva transcription in the pancreas and hearts of infected mice indicating that this amino acid is required for the increased Siva transcription following CB3 infection [166].  1.6.3 Microarray data Microarray analysis has been used identify host genes expressed following viral infection. Gene expression in A/J mice at 3, 9 and 30 days post CB3 infection was compared with uninfected controls [168]. 169 known genes are differentially expressed during the course of infection including poly A binding protein, extracellular matrix (ECM) proteins and ECM/cytoskeletal linker proteins [168]. The poly A binding protein may be increased as a compensatory mechanism as the viral protease 2A acts to cleave it during infection. Increased ECM and ECM/cytoskeletal linker protein expression may also be a mechanism by which the host repairs damage caused by the viral infection [168].  31  1.7  Susceptibility to myocarditis and DCM  1.7.1 Previous pathogen exposure Susceptibility to myocarditis is due to a number of factors including pathogens, gender and genetics. While a single infection with a virus such as CB3 can induce disease in murine models, the infection history of patients is most likely contributing to susceptibility and severity of chronic disease. Indicative of the role of pathogen history in myocarditis development, injection of the TLR ligand LPS at the time of CB3 infection is sufficient to overcome the genetic resistance of B10.A and C57BL/6 mice to chronic disease development [169]. As this effect is thought to be mediated through increased TNFα and IL-1 production [113], it is likely that if a patient is infected with a pathogen which induces a TNFα and/or IL-1 response at the time of CB3 infection, this patient would develop chronic myocarditis regardless of their genetic predisposition. Previous exposure to an enterovirus may also affect disease severity following CB3 infection. Infection with the amyocarditic CB1 followed by infection with the myocarditic CB3-m 28 days later results in increased disease pathology compared to CB3-m infection alone [170]. This disease is T cell dependent, as athymic mice do not produce the same phenotype. Importantly, infection of CB1 followed by the amyocarditic CB3-o also results in more severe disease pathology than CB3-o infection alone [170] suggesting that previous infections can allow for normally amyocarditic virus variants to induce myocarditis development. Multiple infections with myocarditic variants may also lead to increased development of DCM. Mice infected with a second dose of virus develop increased left ventricular dilation compared to mice infected only once. This increased dilation is not associated with an increase in cellular infiltration in the heart [171].  1.7.2 Gender susceptibility Gender is a major factor in disease susceptibility with male patients developing myocarditis at an increased prevalence compared with females. Cardiac infiltration of 32  immune cells following infection contributes to the cytokine production within the disease organ; therefore differences in the cardiac infiltrate likely contribute to susceptibility. Macrophages are the most abundant immune cell in the heart following viral infection and are key in cytokine release and antigen uptake. While female and male mice have similar numbers of macrophages infiltrating the heart post infection, the composition of the macrophage subsets differ. Female macrophage infiltrate is mainly composed of alternatively activated M2 macrophages while male mice infiltrate is skewed towards the inflammatory M1 macrophage phenotype [139]. This suggests that M2 macrophages play a protective role in myocarditis development while M1 macrophages contribute to myocarditis development. Hormones are a promising candidate for the gender dependent disease severity observed as gonadectomized mice develop decreased acute disease pathology compared with sham treated mice. Gonadectomized mice have decreased testosterone production correlating with a change in the macrophage infiltration in the heart from a M1 skewing to M2 [172]. Therefore a factor released by the testes influences the macrophage infiltration in the heart thereby affecting inflammatory disease following viral infection. Hormones also affect the susceptibility of female mice as female mice vary in disease susceptibility depending on the stage of the ovarian cycle the mouse is in at the time of infection. This difference is noted without a change in viral titre in the heart. The T cell composition in the heart does differ with IFNγ producing CD4+ T cells associating with increased disease while IL-4 producing CD4+ T cells associate with protection [173, 174]. T cell skewing is also associated with susceptibility differences between male and female mice. IFNγ producing CD4+ cells are associated with increased disease in male BALB/c mice whereas IL-4 producing CD4+ cells are associated with decreased disease observed in female BALB/c mice [137]. Additionally, female mice have increased regulatory T cells in the heart post infection compared with male mice [173]. This difference is observed without a corresponding change in virus in the heart. Therefore the female mice appear to be able to regulate the inflammatory response more effectively following infection thereby limiting the chronic disease compared with male mice.  33  TLR4 expression is another factor associated with gender susceptibility. TLR4 expression is increased in correlation with increased disease in male mice compared to female mice. This increased expression is not associated with a difference in the viral RNA present [173], however, excess signaling through TLR4 could lead to excessive cytokine stimulation and drive autoimmune disease development. The cytokines IL-1β, IFNγ, IL-18 and TNFα also influence the increased inflammatory disease in males compared to females following coxsackievirus infection [108, 175]. Treatment of the female mice with TNFα during the acute stage of disease is sufficient to overcome the resistance of the mice to myocarditis development. The mechanism by which the TNFα is contributing to disease susceptibility is thought to be through upregulation of CD1d on lymphoid cells [108].  1.7.3 Disease pathogenesis in inbred mouse strains Disease susceptibilities differ between mouse strains as is thought to be the case in patients. Mouse strains such as B10.A and C57BL/6 mice are resistant to chronic autoimmune disease development following CB3 infection while A/J, BALB/c, C3H, DBA/2 and NOD mice are susceptible [85, 176-178]. The pattern of susceptibility within inbred strains is not limited to CB3-induced disease as myocarditis development following T. cruzi [179], MCMV [59] and EMCV [180] infection follow a similar strain specificity. However some strain susceptibility does vary as A/J mice are resistant to the development of EMCV-induced myocarditis [180]. Within the susceptible strains, the disease pathology, ability to clear virus and autoimmune cells involved also differs. For example, chronic disease in BALB/c mice is dependent on CD8 T cells while disease in DBA/2 is dependent on CD4 T cells [181]. Further, disease in A/J mice is dependent on both CD4 and CD8 T cells [181]. All three strains produce IgM autoantibodies; however, IgG autoantibodies are produced predominantly in DBA/2 and A/J mice. IgG deposits are also present in the hearts of DBA/2 and A/J mice but not BALB/c mice. Despite the presence of the IgG deposits, the DBA/2 mice develop only a mild, transient disease [181]. In addition to genetic predisposition to disease development, there is a wide range of disease pathologies seen within susceptible strains following viral infection. 34  The degree of damage inflicted by the virus has also been shown to vary with the mouse strain infected. For example, A/J mice develop smaller and fewer lesions in the heart following CB3 infection compared C3H mice [66]. Infection of different immune cell populations is also thought to play a role in disease development. Comparison of the localization of CB3 RNA in the spleens of susceptible A/J mice with resistant C57BL/6 mice show a different localization pattern between the strains without a corresponding difference in viral load within the organ [182]. While the CB3 RNA in A/J spleens localize in the germinal centers of lymphoid follicles, the CB3 RNA in C57BL/6 spleens localize to the germinal cells, marginal zone and red pulp [182]. Within the splenic cells, B cell and follicular dendritic cells are infected by CB3 [182]. The inflammatory response is also integral to disease susceptibility. To determine the influence of the inflammatory response, the early cytokine responses and virus replication in the disease resistant C57BL/6 mice has been compared to that of the susceptible BALB/c mice [140]. Surprisingly, the resistant C57BL/6 mice have increased early virus replication in the heart, pancreas and liver compared to the susceptible BALB/c mice. Therefore early replication in the target organs is not a prerequisite for the later damage seen. The ability of C57BL/6 and BALB/c mice to clear virus may, however, contribute to susceptibility to chronic disease as BALB/c mice clear CB3 infection slower than the resistant C57BL/6 mice [183]. This correlates with a lower virus specific IgG and a higher IgM response in the BALB/c mice [183]. In contrast to viral replication, IL-12p70, IL-4, TNFα and IL-1β production are increased in the heart, pancreas and spleen of BALB/c mice [140]. This cytokine profile reflects an immune response with both Th1 and Th2 components and resembles cytokines produced by mast cells. In fact, mast cells are abundantly present in the spleens of BALB/c mice but not in C57BL/6 mice [140] suggesting a role for mast cells in myocarditis susceptibility. Interestingly, C57BL/6 mice have increased IFNγ, TNFα and IL-4 cytokine production in the liver [140]. This difference may reflect and increased presence of NK and NKT cells which are exceptionally active in C57BL/6 mice. The early cytokine response is known to determine susceptibility to chronic disease as injection of TNFα or IL-1β at the time of CB3 infection is sufficient to overcome the genetic resistance of C57BL/6 mice to development of chronic disease 35  [113]. Further, cytokine expression in organs distal to the heart are integral in the development of chronic disease. Specifically, pancreas-restricted constitutive expression of the cytokine TGFβ is sufficient to protect the otherwise susceptible NOD mice from CB3-induced chronic myocarditis [84].  1.7.4 Loci that confer susceptibility to myocarditis Genetic susceptibility to myocarditis is thought to involve both MHC and nonMHC associated genes in patients. Further, development of disease can be spontaneous due to a disease causing mutation or a mutation could predispose a patient to pathogen-associated myocarditis development. Using mouse models, H-2 congenics have been used to show the involvement of MHC in disease susceptibility [184]. However, many H-2 congenic mice that contained an MHC locus from a susceptible strain on an otherwise resistant strain background are resistant to disease development [184]. Additionally, BALB/c and DBA/2 mice, which have the same MHC haplotype (H-2d), have a different disease pathogenesis with CD4 T cells being pathogenic in DBA/2 mice and CD8 T cells being pathogenic in the BALB/c mice [185]. Therefore, it is clear that the non-MHC genes are playing a dominant role in disease development. To identify MHC-independent susceptibility genes, recombinant inbred strains were screened to identify loci that conferred susceptibility to viral-induced myocarditis in A/J and DBA/2J mice. A susceptibility locus was identified on chromosome 14 near a human susceptibility locus for familial hypertrophic cardiomyopathy. This locus is just distal to TCRα and α-cardiac myosin heavy chain. The influence of this locus is recessive as F1 progeny of A/J and B10.A mice have low disease prevalence. As αcardiac myosin heavy chain is located near the susceptibility loci, the sequence of this gene in the susceptible BALB/c and the resistant C57BL/6 mice was compared and found to differ by two amino acid residues [186]. Further characterization of the influence of these amino acid substitutions confirmed that the BALB/c amino acid sequence is more pathogenic in both the BALB/c and C57BL/6 mice compared to the sequence from C57BL/6 mice [186].  36  A subsequent search for susceptibility loci using an adjuvant-induced model of myocarditis failed to identify a susceptibility locus on chromosome 14 [187]. This may be either due to a false positive in the previous results or a difference in disease susceptibility mechanisms between viral- and adjuvant-induced models of disease. Use of the adjuvant-induced model did, however, identify two new susceptibility loci on chromosomes 1 and 6 [187]. These loci are associated with decreased sensitivity of immature and peripheral T cells to apoptosis in disease susceptible strains respectively [187]. Further investigation of these loci needs to be completed to determine how these loci influence T cell apoptosis and the involvement of apoptosis in disease susceptibility. Inconsistencies on the chromosome 6 loci must also be clarified as this locus seems to confer susceptibility to male but not female mice, however, the decreased sensitivity to immature T cell apoptosis appears to be female specific [187]. In an attempt to identify MHC-independent genes that confer susceptibility to acute damage by CB3, the disease susceptible A/J mice were crossed with the disease resistant H-2 congenic strain B10.A-H2a [188]. Three loci were identified to confer susceptibility to acute myocarditis on chromosomes 1, 3 and 4 [188]. The loci identified on chromosomes 1 and 4 were linked to sarcolemmal disruption in male mice. Interestingly, the disease genotype that confers susceptibility is from the B10.A genotype [188]. This strongly suggests that susceptibility is a multigenic process in which a combination of genes determines disease development and severity. The susceptibility locus on chromosome 3 was linked to myocardial infiltration as well as sarcolemmal disruption in females [188]. In general, male mice are more susceptible to sarcolemmal disruption than female mice [188]. Within susceptible strains of mice, there are also differences in their ability to induce myocarditis by in vivo administration of cardiac myosin specific IgG with DBA/2 but not BALB/c mice being susceptible to disease [189]. Susceptibility to anti-cardiac myosin antibody induced cardiomyopathy likely has to do with the presence of myosin in the myocardial extracellular membrane of susceptible strains [189]. Comparison of BALB/c mice, which are resistant to anti-cardiac myosin-induced myocarditis, with susceptible DBA/2 mice identified chromosomes 12 and 9 to confer susceptibility to disease in females while chromosome 1 confers susceptibility to male mice [190]. It still remains to be determined which gene or genes within these regions are involved in the susceptibility difference. 37  1.7.5 Microarray data Identification of susceptibility factors could be aided by fully understanding the genes involved in disease development. Microarray analysis has been used to determine which genes are differentially expressed in 4 week old and 10 week old A/J mice following infection [191]. As 4 week old mice develop an increased number of lesions in the heart and more extensive myocyte injury following CB3 infection, genes identified to be increased in 4 week old mice compared to the 10 week old mice could represent genes involved in disease severity. The genes found to be differentially expressed between the infected versus non-infected mice included both structural and non-structural genes [191].  38  1.8  Summary Development of myocarditis involves many factors including genetics and  pathogen infections. For disease to develop, an improperly regulated immune response in the heart must be initiated and sustained. I am interested in identifying genes involved in coxsackievirus-induced myocarditis development and progression. These genes may be immune-related and drive disease by altering the anti-viral, inflammatory or autoimmune response. Conversely the genes may be non-immune genes such as cardiac genes that affect disease susceptibility. Once genes of interest are identified, the specific genes will be investigated to elucidate the role of the gene in question in myocarditis development and progression. It is clear that there is a great need to completely understand the mechanisms of myocarditis initiation and identify myocarditis susceptibility genes. Until we fully understand the interplay between all involved components, both host and pathogen, we will not be able to efficiently prevent disease development in patients.  39  2  Materials and Methods  40  2.1  Animals Chapter 3: IL-6 deficient C57BL/6 (IL-6KO) and C57BL/6 mice were purchased  from The Jackson Laboratory (Bar Harbor, ME). These mice were maintained in the Wesbrook Animal Facility at the University of British Columbia (Vancouver, Canada). Chapter 4 and 5: A/J and C57BL/6 mice were purchased from Jackson Laboratory (Bar Harbor, ME). B6.A17 mice as well as the A17.M20, A17.M14, A17.V19 and A17.V27 strains were obtained through collaboration with Dr. Nadeau at Case Western Reserve University (Cleveland, OH). A17.MCP7, A17.MCP12, A17.MCP14, A17.MCP22 strains were generated in the Wesbrook animal facility. All mice were maintained in the Wesbrook animal facility at the University of British Columbia (UBC) (Vancouver, Canada). Chapter 6: A/J, BALB/c, NOD and C57BL/6 mice were purchased from Jackson Laboratory (Bar Harbor, ME). These mice were maintained in the Wesbrook Animal Facility at the University of British Columbia (Vancouver, Canada).  2.2  Congenic mouse generation A17.M20 and A17.V19 strains were independently crossed with C57BL/6 mice to  generate a mouse heterozygous for the region of interest (Figure 2.1). The heterozygous mouse was then further crossed with a C57BL/6 mouse. Pups from this breeding were genotyped to identify pups with a recombination event by PCR of microsatellite markers (Table 2.1). Once a recombination event was identified, mice were crossed with a C57BL/6 mouse to generate two mice of the same genotype. These mice were then intercrossed to generate mice homozygous for the new genotype. Homozygous mice were then bred to determine the impact of the genotype on disease incidence. The congenic strains A17.MCP7, A17.MCP12, A17.MCP14, A17.MCP22 were generated by this method.  41  Figure 2.1 Schematic representation of the generation of congenic mice from the A17.M20 and A17.V19 strains  42  Table 2.1 Primers of microsatellite markers used to identify new congenic mice generated from the A17.M20 and A17.V19 strains  Microsatellite marker D17Mit164 D17Mit113 D17Mit213 D17Mit133 D17Mit46 D17Mit100 D17Mit198 D17Mit101 D17Mit28 TNF-pAR D17Mit233  cM 4.1 6.5 9.33 10.4 11.7 11.75 16 16.4 18.44 19.06 20.9  bp start 3924615 12172308 16752157 24994554 25502885 26318983 27796090 29405253 34137861 35336335 36076118  bp end 3924747 12172432 16752280 24994740 25503120 26319104 27796190 29405394 34137980 35338941 36076233  Primer forward AGGCCCTAACATGTAGCAGG TCTGTCTCCTCCGTACTGGG AAACACAAATAGATACAAAGACACACG TCTGCTGTGTTCACAGGTGA TCCACCCCACTACCTGACTC GTTAAGAATGATTTTCACACTACAAGA TGCTTCTACCTCCCAAGGG GTCCAGTTCCATGGGATCC ACTCAGGACTCAGAATGAAGATCC GGACAGAGAAGAAATGGGTTTC GACTGGTCTACAGAATGAGTTCCA  Primer reverse TATTATTGAGACTGTGGTTGTTGTTG GTCAATAAGTTCAATCACTGAACACA TTAACCTGTGAGTCCTTTGATGG GCCCCTGCTAGATCTGACAG CCCTTCTGATGACCACAGGT AGCACATGTACTTACTCATATACGTGC CCAACCTTTCAAGTCAGATGTG TTTCTCTCACAAATAGGGAGTGG ATTCCTAGATGAAAAGTCTGTGGC TCGAATCTGGGGCCAATCAGGAGGG CCTCAGAACCCTGAGACCTG  A/J Product Size  C57BL/6 Product Size  126 105 114 177 214 131 116 131 96 93 110  136 127 124 195 238 123 102 143 120 103 122  Difference -10 -22 -10 -18 -24 8 14 -12 -24 -10 -12  43  2.3  DNA isolation and genotyping DNA was extracted from ear clippings of mice 4 weeks of age. DNA was  isolated by 50 mM NaOH treatment at 95oc followed by 0.5M Tris (pH 8.0) neutralization. Identification of recombinant congenic strains was completed by PCR of microsatellite markers on Chromosome 17 (Table 2.1). PCR products were distinguished by electrophoresis on 3% agarose gels and visualized by SYBR safe staining (Invitrogen; Carlsbad, CA). 2.4  Sequencing Sequencing of phosphodiesterase 10A (Pde10a), delta-like 1 (Dll1), mitogen-  activated protein kinase 8 interacting protein 3 (Mapk8ip3), TEL2, telomere maintenance 2, homolog (S. cerevisiae) (Telo2) and peroxisome proliferator activator receptor delta (Ppard) was performed by Nucleic Acid Protein Service Unit (UBC; Vancouver, Canada). Genes were PCR amplified and sequenced at regions that contained one or more SNP differences between A/J and C57BL/6 mice. A/J, C57BL/6 and B6.A17 DNA were sequenced for comparison with A17.MCP7, A17.MCP14 and A17.MCP22 strains. SNP differences were identified using the Mouse Genome Database (MGD), Mouse Genome Informatics, The Jackson Laboratory, Bar Harbor, Maine. World Wide Web (URL: http://www.informatics.jax.org). (March, 2009) [192]. Sequencing of the genes was performed using the forward primer used for PCR amplification of the gene of interest. Pde10a SNP differences at 9054346 bp, 9054355 bp, 9054375 bp, 9054414 bp, and 9054536 bp of chromosome 17 were observed to determine strain genotype. Dll1 SNP difference at 15511735 bp of chromosome 17 was observed to determine strain genotype. Mapk8ip3 SNP differences at 25072196 bp, 25072322 bp, 25072331 bp, and 25072425 bp of chromosome 17 were observed to determine strain genotype. Telo2 SNP differences at 25238730 bp, 25238732 bp, 25239269 bp and 25239279 bp of chromosome 17 were observed to determine strain genotype. Ppard SNP difference at 28370955 bp of chromosome 17 was observed to determine strain genotype. Sequences were aligned using ClustalW2 [193].  44  2.5  Virus Coxsackievirus group B type 3 (CB3) (Nancy strain) was obtained from Dr. J.K.  Chantler (UBC). Virus stocks of CB3 were prepared as previously described [85]. Virus stocks were stored at -80oc. Mice 8-12 weeks of age were infected intraperitoneally with a sublethal dose of 100 PFU of CB3 in Dulbecco's Modified Eagle Medium (DMEM) for the initial experiments in sections 3.2.1-3.2.5. In subsequent experiments in chapters 3, 4, 5 and 6, mice were infected with 10,000 PFU of CB3 in DMEM. Mice were sacrificed at day 10 post-infection to determine acute disease incidence by histological presence of inflammatory lesions in the heart. Mice were sacrificed at day 28 post-infection to determine chronic disease incidence by histological presence of fibrosis and cellular infiltration in the heart. Chapter 3: The IL-6KO mice are only commercially available on the C57BL/6 background which is genetically resistant to CB3-induced chronic autoimmune myocarditis, therefore, co-treatment with LPS at the time of infection is required to overcome genetic resistance [169]. C57BL/6 and IL-6KO mice were treated with CB3, CB3 plus 25µg LPS (S. minnesota) (CB3/LPS), 25µg LPS (S. minnesota) (SigmaAldrich, St. Louis, MO) or DMEM. Where noted, mice were injected with 50ng/mouse recombinant mouse IL-6 (rIL-6) (eBioscience; San Diego, CA) or DMEM at days 0, 1, 2 and 3 post treatment with CB3/LPS. Alternatively, where noted, mice were treated with IL-6 receptor blocking antibody. The IL-6 receptor blocking antibody was a gift from Chugai Pharmaceutical (Tokyo, Japan), rat IgG (Jackson ImmunoResearch; West Grove, PA) or sterile saline at day 0 post CB3/LPS treatment. Chapter 6: Where noted, A/J mice were injected with 200ng/mouse or 2ug/mouse of recombinant mouse TNFα (rTNFα) (eBiosceince) or DMEM at the time of CB3 infection. 2.6  Quantitation of the replicative virus in the heart Viral load was quantitated by plaque assay at day 5 PI for chapter 3 and days 3  and 7 PI for chapter 4. Heart samples were collected, weighed and homogenized at 10% weight/volume in DMEM. Dilutions of homogenates were incubated at 37oC with 45  rocking for one hour on a confluent monolayer of HeLa cells (ATCC CCL-2). Plates were incubated for three days to allow plaque formation. Plaque assays were performed in duplicate. 2.7  Histology At sacrifice, heart tissue was removed for paraffin sectioning. Tissue was  processed and stained by Wax-it Histology Services Inc. (UBC). Sections of 4 micron thickness were cut for staining. Tissue was stained by standard protocols with hematoxylin and eosin as well as Masson’s Trichrome to detect damage by cellular infiltration and fibrosis. Serial sections of the heart were scored blindly according to a 4tier scoring system: grade 1, 0-10% pathology; grade 2, 11-25%; grade 3, 26-50%; grade 4, greater than 50%. 2.8  Isolation of heart infiltrate Mice were anesthetized with 3.2mg Ketalean (Bimeda-MTC, Dublin, Ireland) and  0.08mg Xylazine (Bayer, Leverkusen, Germany) or 20mg Avertin and perfused with sterile PBS at 5, 7, 10, 14 or 21 days post disease induction. Hearts were minced and digested with 0.2% collagenase (Sigma-Aldrich), 0.25% pancreatin (Sigma-Aldrich) and 0.1% DNase (Roche Applied Science, Basel, Switzerland) for 7 minutes at 37oC. Digestion was stopped with addition of 0.1M EDTA. Following digestion, single cell suspensions of heart infiltrate were isolated by standard procedures and cells were stained for flow cytometry. 2.9  Flow cytometry At sacrifice, spleen tissue was removed and placed in phosphate buffered saline  (PBS) buffer on ice. Single cell suspensions of splenocytes were isolated by standard procedures. Cells were treated with Mouse BD FcBlock™ (clone 2.4G2) (BD Pharmingen, San Jose, CA) for 15 minutes prior to staining. Flow cytometry was performed on a FACS Calibur or a LSRII (BD Biosciences, San Jose, CA) and analyzed with FlowJo (Tree Star Inc., Ashland, Oregon) software. 46  2.10 Antibodies The following antibodies were purchased from BD Pharmingen: biotin-anti-CD69 (clone H1.2F3), biotin-anti-CD44 (clone IM7), biotin-anti-CD49b (clone DX5), biotin-antiCD3 (clone 145-2C11), biotin-anti-CD62L (clone MEL-14), APC-anti-CD11b (clone M1/70), biotin-anti-CD80 (clone 16-10A1), biotin-anti-CD86 (clone GL1) and biotin-antiCD40 (clone 3/23). The following antibodies were purchased from eBioscience: APCanti-CD4 (clone RM4-5), FITC-anti-CD8 (clone 53-6.2), FITC-anti-Foxp3 (clone FJK16s), PE-anti-RORγt (clone AFKJS-9), PE-anti-CD25 (clone PC61), FITC-anti-CD11c (clone N418), PE-anti-PD-1 (clone J43), PE-anti-PD-L1 (clone MIH1), PE-anti-PD-L2 (clone TY25), PB-anti-Gr1 (clone RB6-8C5), APC-anti-CD115 (clone AFS98), biotinanti-CD14 (clone Sa2-8) and biotin-anti-F4/80 (clone BM8). PE-anti-CD204 (clone 2F8) and Cy5-anti-CD301 (clone ER-MP23) were purchased from Adb Serotec (Kidlington, UK). Biotin-anti-CD206 (clone 15-Feb) was purchased from AbCam (Cambridge, MA). Hamster IgG1l (BD Pharmingen), rat IgG2aK (BD Pharmingen) and rat IgG2a (eBioscience) were used as isotype controls for CD69, Foxp3 and RORγt staining respectively. Streptavidin-PE (BD Pharmingen) or Streptavidin-PECy-7 (eBioscience) were used as secondary antibody to visualize biotinylated antibodies. 2.11 Cytometric bead array Serum was collected at days 1, 3, 7 and14 post treatments with DMEM, LPS, CB3 or CB3/LPS and stored at -80oC until analysis. Concentrations of TNFα, IFNγ, IL6, IL-12p70, IL-10 and MCP-1 were determined with a BD Cytometric Bead Array (CBA) Mouse Inflammation kit according to manufacturers’ instructions (BD Biosciences). Concentrations of IL-17A, G-CSF, GM-CSF, KC, MIP-1α, MIP-1β, MIG and RANTES were determined from serum samples collected at day 3 PI using a BD CBA flex set kit according to manufacturers’ instructions (BD Biosciences). Data was analyzed with FCAP Array software (BD Biosciences).  47  2.12 ELISA To determine serum C3 concentrations, serum samples were collected at days 0, 3, 7, 10 and 28 post-infection and were analyzed by direct ELISA. Nunc 96 well plates were coated with Goat IgG fraction to mouse complement C3 (MP Biomedical; Solon, Ohio) for detection of C3. Peroxidase-conjungated goat IgG fraction to mouse complement C3 (MP Biomedical) was used for detection of C3. To determine serum cardiac troponin I (cTnI) concentrations, serum was collected at days 7 post CB3 or CB3/LPS treatment. Serum samples were analyzed by the High Sensitivity Mouse Cardiac Troponin-I ELISA kit (Life Diagnostics; West Chester, PA). To measure heart specific autoantibodies, serum samples were collected at day 28 post infection and analyzed by indirect ELISA. Nunc 96 well plates were coated with 100 ul murine heart extract (2.5 ug/ml). Peroxidase-conjugated rat IgG fraction to mouse Fab (Sigma) was used for detection of heart specific antibodies. 2.13 RNA isolation Mice were anesthetized and perfused as described in section 2.8 at days 5, 7 and 10 PI. Heart were immediately placed in TRIzol® reagent (Invitrogen) and placed on dry ice. Samples were homogenized with a Fisher Scientific Tissuemiser Homogenizer. RNA was isolated TRIzol extraction. RNA was quantified using a Thermo Scientific nanodrop. Samples were stored at -80oc. 2.14 cDNA cDNA was prepared by iScript cDNA synthesis kit (Bio-rad; Hercules, CA). This kit uses a combination of oligo(dT) primers and random hexamers to prime cDNA synthesis. For viral RNA detection, cDNA was prepared by iScript select cDNA synthesis kit (Bio-rad). The CP2 primer was used for cDNA generation to measure positive strand  48  CB3 (Table 2.2). For terminal deletion mutants, cDNA was generated with the primer 998 (Table 2.2). 2.15 Real-time PCR SsoFast™ EvaGreen® (Bio-rad) was used for real-time PCR reactions. Thermal cycling protocol: (1) 95oc for 30 sec; (2) 95oc for 5 seconds; (3) 57.5oc for 5 seconds; (4) return to step (2) 39 times. Primers (Table 2.3) were used at a final concentration of 400 mM. Primers CP1 and CP2 were used for real-time PCR of CB3 (Table 2.2). To detect terminal deletion CB3, the internal KS1 primer was common to all reactions with primers S, S1, S2 and S3 detecting the various mutants (Table 2.2). 2.16 Statistics Statistical analysis was done by unpaired Student’s t-test for all plaque assay, cytokine analysis and immune cell population analysis. P values of <0.05 (*) were considered significant. Mann Whitney U test was used to calculate significance for differences in disease severity in chapter 3. In chapter 4, susceptibility loci were determined to be significant by sequential analysis [194]. P values were subsequently corrected for multiple testing and values <0.05 were considered significant.  49  Table 2.2 Primers used for cDNA generation and real-time PCR of CB3  CP1 CP2 998 KS1 S S1 S2 S3  Primer (5' -> 3') ACCTTTGTGCGCCTGTT CACGGACACCCAAAGTA CGTTATGGTGGAGTTACCTAATGT GCTAAGTGGTATAAACCCAACAAAG TTAAAACAGCCTGTGGGTTG TTAAAACAGCCTGTGGGTTGATCCCACC ATCCCACCCACAGGGCCCATTGGGCGCTA GGGCCCATTGGGCGCTAGCACTCTGGAT  50  Table 2.3 Primers used for real-time PCR to determine gene expression levels of potential susceptibility genes on chromosome 17  Map3k4 Smoc2 Chd1 Agpat4 Mrpl18 Igf2r Plg Wtap Cav3.2 a Cav3.2 b Gapdh  Forward Primer (5' -> 3') GACTGTACGCCATGAGCAGA GACCCCTCTTCCTCTTCTGG TCTCTGTCCCTTGTCTGTTTTG TTGAGAATCCCCACACCATG AAACTGGAGTGTGGGTTCG TGGGGCAGTCCTCAGTCTTC GAATATGGGGAGAGGGCTTA GTACAAGCTTTGGAGGGCAAGT AACCGAGGCATCATGGCAGC GCTGTTTGGGAGGCTAGAAT TGGTGAAGGTCGGTGTGAAC  Forward Primer (5' -> 3') GGGCTTGCAAACTCAAGAAG TCCTTCTTGCCAATGTCTCC TCTGAAAGTGTCCTGTGCAG AGTACCACATCCAGCCAATG TCTCGAGTGGATGCTGAAAC TCACCCTCCCTTTCCTTCAG TTTCAACAAAGGTCACAGCA TGGACTTGCTTGAGGTACTGGA GTTAGTCAGCTCATCAGGCT CGAAGGTGACGAAGTAGACG CCATGTAGTTGAGGTCAATGAAGG  51  3  Lack of IL-6 During Coxsackievirus Infection Heightens the Early Immune Response Resulting in Increased Severity of Chronic Autoimmune Myocarditis1  1  A version of chapter 3 has been published. Poffenberger MC, Straka N, El Warry N, Fang D, Shanina I, Horwitz MS. (2009) Lack of IL-6 during coxsackievirus infection heightens the early immune response resulting in increased severity of chronic autoimmune myocarditis. PLoS One. 4(7): p. e6207. 52  3.1  Introduction Autoimmune myocarditis, a precursor stage of dilated cardiomyopathy (DCM), is  the leading cause of sudden death in young adults [195]. Disease progression to DCM leaves heart transplantation as the only treatment option. DCM is often caused by enterovirus infection, predominantly the cardiotropic virus coxsackievirus [195]. Following coxsackievirus B3 (CB3) infection, an acute disease stage ensues in which heart damage is viral-mediated. In genetically susceptible individuals, disease can progress to a chronic autoimmune phase characterized by infiltration of autoreactive lymphocytes and fibrosis of the heart tissue. While the mechanism by which viral infection leads to autoimmune myocarditis is not completely understood, there is compelling evidence to suggest that interleukin (IL)-6 is involved [196-199]. IL-6 is a pleotropic cytokine that acts during both pro- and anti-inflammatory responses and has been observed in the context of infection, inflammation and autoimmunity. IL-6 is typically induced following pathogen stimulation as a part of the innate inflammatory response and its major functions include initiation of the acutephase response, activation of T cells and stimulation of B cell immunoglobulin production [200]. More recently, IL-6 has been linked to the release of otherwise suppressed effector T cells [201], inhibition of TGFβ induced regulatory T (Treg) cell generation [202] and induction of Th17 cells as a co-factor with TGFβ [203]. Further, signaling through gp130, a component of the IL-6 receptor complex, protects cardiac myocytes from CB3 infection directly [204]. IL-6 functions globally in response to inflammation and infection and it is important in our understanding of the development of autoimmunity. Specifically, lack of IL-6 has been demonstrated to be sufficient to prevent a plethora of autoimmune diseases such as experimental autoimmune encephalomyelitis (EAE) [126], pristane-induced lupus [205], experimental-induced arthritis [127, 128], autoimmune myasthenia gravis [206] and, most notably with regard to this report, experimental-induced autoimmune myocarditis (EAM) [196]. Following injection of cardiac myosin peptide emulsified in complete Freund’s adjuvant (CFA), EAM did not develop in IL-6 deficient mice (IL-6KO, BALB/c) [196]. IL-6KO mice had decreased levels of TNFα, complement component 3 and co-stimulatory molecules following induction of disease. While EAM is a useful model of myocarditis that allows for study 53  of the chronic stage of disease without the complication of the viral infection, it does not mimic the natural acquisition of disease and lacks the complexity of the response to virus. Thus, it is valuable to decipher the role of IL-6 in the context of viral-induced autoimmune myocarditis. In this report, we demonstrate that IL-6 regulates the development of CB3mediated chronic myocarditis. In contrast to the EAM findings, IL-6KO mice infected with CB3 developed significantly greater chronic heart disease. Heightened disease was associated with increases in early inflammatory responses including serum levels of TNFα, IL-10 and MCP-1 as well as T cell activation and cardiac monocyte/macrophage infiltration. The early inflammatory response and chronic disease severity was controlled by supplementing the viral infection with recombinant IL-6 indicating that IL-6 functions as a regulator of the early host response and has a protective role during the progression of CB3-induced chronic myocarditis.  54  3.2  Results  3.2.1 Increased severity of chronic myocarditis in IL-6KO mice To determine the role of IL-6 in the viral induction of autoimmune myocarditis, myocarditis was induced in IL-6KO and wild type C57BL/6 (wt) mice by injection of CB3 plus LPS (S. minnesota) (CB3/LPS). Control mice were concurrently challenged with CB3, LPS (S. minnesota) alone or DMEM. Heart tissue from mice sacrificed at day 10 PI showed pathology characteristic of the acute phase of myocarditis in both C57BL/6 and IL-6KO mice treated with CB3/LPS (Figure 3.1a). Acute disease pathology was not observed in IL-6KO mice treated with LPS or CB3 alone indicating that, as with wt mice, disruption of IL-6 does not alter the general immune response enough to allow LPS or CB3 alone to cause disease (Figure 3.1a). Serum levels of cardiac troponin I (cTnI) were also measured to examine the extent of heart damage during the acute stage of disease. No significant difference was observed between the IL-6KO and wt mice at day 7 PI (Figure 3.2) Heart tissue harvested from mice at day 28 PI showed fibrosis and immune cell infiltration characteristic of chronic myocarditis in both IL-6KO and wt mice treated with CB3/LPS (Figure 3.1b) indicating the IL-6 is not required for chronic myocarditis development. This chronic disease was autoimmune in nature as transfer of splenocytes from CB3/LPS treated IL-6KO mice into naïve RAG deficient mice was sufficient to induce disease (Data not shown). As expected, mice treated with CB3, LPS or DMEM alone showed no signs of chronic myocarditis or fibrosis at day 28 (Figure 3.1b, Data not shown). Comparison of chronic disease severity between the IL-6KO mice and wt controls showed significantly greater disease pathology in IL-6KO mice as compared to wt mice (Figure 3.1c). Over 65% of IL-6KO mice presented with infiltrating lesions and fibrosis with grade 4 severity, while 93% of wt mice had grade 2 or less heart pathology. Therefore, lack of IL-6 results in greater chronic disease severity post-infection and is indicative of a regulatory role for IL-6 in the host response to infection and the ensuing chronic pathology.  55  Figure 3.1 IL-6KO mice develop increased chronic myocarditis severity without an increase in virus in the heart (A) Representative Hematoxylin and Eosin stained cardiac sections from C57BL/6 or IL-6KO mice. Mice treated with LPS or CB3 alone did not develop acute disease lesions at day 10 PI (LPS: C57BL/6 n=4, IL-6KO n=4) (CB3: C57BL/6 n=5, IL6KO n=4). Mice treated with CB3/LPS developed lesions and immune cell infiltration at 10 days PI (C57BL/6 n=4, IL-6KO n=4). Magnification:400X. (B) Representative Masson’s Trichrome stained cardiac section from C57BL/6 or IL-6KO mice. Following treatment with CB3/LPS, mice developed disease pathology as determined by fibrosis in blue and immune cell infiltration within the fibrosis areas by 28 days PI (C57BL/6 n=15, IL-6KO n=20). Mice infected with LPS or CB3 alone did not develop significant chronic disease pathology (LPS: C57BL/6 n=5, IL-6KO n=5) (CB3: C57BL/6 n=6, IL6KO n=7). Magnification:400X. (C) Chronic cardiac disease histology was scored blindly by a four tier grading system to determine severity differences: grade 1, 0-10% pathology; grade 2, 11-25%; grade 3, 26-50%; grade 4, greater than 50% (black circles indicate wt mice, white circles indicate IL-6KO mice) (bar is mean±SE, *p<0.05). Disease severity was found to be significantly higher in the IL-6KO mice compared to wild type controls. (D) Quantification of replicative virus in the heart post infection showed no significant differences in viral titre between IL-6KO and wt mice at day 5 post infection (CB3: C57BL/6 n=5, IL-6KO n=5) (CB3/LPS: C57BL/6 n=5, IL-6KO n=5) (black bars indicate wt mice, white bars indicate IL-6KO mice) (mean±SE, NS=p>0.05). This indicates that IL-6 is not essential for control of viral replication in the heart.  56  57  Figure 3.2 Cardiac damage in IL-6KO mice and wild type mice did not differ at day 7 PI Serum concentration of cTnI was monitored following CB3 and CB3/LPS treatment using an ELISA assay (n=4 for each strain and treatment group). cTnI levels were increased in CB3/LPS treated mice compared with CB3 treated mice. There is no significant difference between IL-6KO and wild type levels of cTnI. (black bars indicate wt mice, white bars indicate IL-6KO mice) (mean±SE, NS=p>0.05).  58  3.2.2 Cardiac viral replication in IL-6KO mice is similar to wt controls The increased cardiac disease pathology observed in IL-6KO mice could be a direct result of an inability to control viral infection in the heart. To determine whether differences in viral numbers were responsible for the increased pathology, quantitative viral plaque assays were performed. No significant difference in the replicating viral numbers in the heart was observed between IL-6KO and wt mice at day 5 PI (Figure 3.1d). This suggests that the differences in disease severity were not a direct result of an inability of IL-6KO mice to control cardiac infection.  3.2.3 Increased CD69 expression by T cells in CB3-infected IL-6KO but not in wt controls To examine whether changes in the antigen presenting cells (APC) or the T cell response following infection were responsible for the increase in disease severity, an analysis of immune cells post-infection was performed. No differences were observed in the percentages of immune cell populations present as measured by APC markers CD11b and CD11c or the T cell co-receptors CD4 and CD8. Within these cell populations, no differences in activation state were observed as measured by the APC co-stimulatory markers CD80, CD86 or CD40 or the T cell activation markers CD44, CD62L or CD25 (Data not shown). However, in IL-6KO mice, the T cell activation marker, CD69, was significantly upregulated on both CD4+ and CD8+ T cells at day 3 PI as compared to wt controls (Figure 3.3a and Figure 3.4). By day 7 however, this difference in CD69 expression had diminished and was similar to that found on T cells in wt mice (Figure 3.3a and Figure 3.4). As CD69 is the only activation marker to be upregulated in the IL6KO mice, the increase in CD69+ cells reflects an important early T cell regulatory role for IL-6 and these cells may be integral to the increase in disease severity. Based on data suggesting that IL-6 is important in Treg induction and function [201, 202], we monitored changes in Treg cell populations over the course of infection. Tregs were identified using the cell markers CD4, CD25 and the Treg specific 59  Figure 3.3 IL-6KO mice have increased expression of the early activation marker CD69 at 3 days PI (A) T cell activation was monitored by flow cytometry analysis of splenocytes following DMEM, LPS, CB3 or CB3/LPS treatment. Activated T cells were identified by the surface markers CD4, CD8 and CD69. CD69 expression was significantly increased on both CD4+ and CD8+ T lymphocytes at 3 days post infection (DMEM: C57BL/6 n=4, IL-6KO n=4) (LPS: C57BL/6 n=7, IL-6KO n=8) (CB3: C57BL/6 n=8, IL6KO n=18) (CB3/LPS: C57BL/6 n=8, IL-6KO n=17) (black bars indicate wt mice, white bars indicate IL-6KO mice) (mean±SE, *p<0.05) and abrogated by 7 days post infection (DMEM: C57BL/6 n=4, IL-6KO n=4) (LPS: C57BL/6 n=4, IL-6KO n=4) (CB3: C57BL/6 n=4, IL-6KO n=4) (CB3/LPS: C57BL/6 n=4, IL-6KO n=5). (B) The percent of CD4+ Treg cells was determined by FACS of splenocytes at 3 and 7 days post DMEM, LPS, CB3 or CB3/LPS treatment. Treg cells were identified by expression of CD4 and the transcription factor Foxp3. IL-6KO mice with DMEM treatment contained a significantly lower percentage of CD4+ Foxp3+ cells compared to the wild type controls with DMEM treatment (DMEM: C57BL/6 n=8 at day 3 n=7 at day 7, IL-6KO n=8 at day 3 n=7 at day 7) (black bars indicate wt mice, white bars indicate IL-6KO mice) (mean±SE, *p<0.05). However, following treatment with CB3 or CB3/LPS but not LPS alone, the percentage of CD4+ Foxp3+ cells was not significantly different (LPS: C57BL/6 n=8 at day 3 n=12 at day 7, IL-6KO n=8 at day 3 n=14 at day 7) (CB3: C57BL/6 n=8 at day 3 n=11 at day 7, IL-6KO n=8 at day 3 n=17 at day 7) (CB3/LPS: C57BL/6 n=9 at day 3 n=13 at day 7, IL-6KO n=9 at day 3 n=18 at day 7) (mean±SE, *p<0.05) suggesting sufficient proportions of Treg cells are present to immunosuppress disease.  60  61  Figure 3.4 IL-6KO mice have increased expression of the early activation marker CD69 at 3 days PI (A) Representative flow cytometry analysis of splenocyte T cell activation at 3 days post DMEM, LPS, CB3 or CB3/LPS treatment. Activated T cells were identified by the surface markers CD4, CD8 and CD69. CD69 expression was significantly increased on both CD4+ and CD8+ T lymphocytes at 3 days post infection (DMEM: C57BL/6 n=4, IL-6KO n=4) (LPS: C57BL/6 n=7, IL-6KO n=8) (CB3: C57BL/6 n=8, IL6KO n=18) (CB3/LPS: C57BL/6 n=8, IL-6KO n=17) (grey line indicate wt mice, black line indicate IL-6KO mice, light grey area indicates isotype control). (B) Representative flow cytometry analysis of splenocyte T cell activation at 7 days post DMEM, LPS, CB3 or CB3/LPS treatment. Activated T cells were identified by the surface markers CD4, CD8 and CD69. CD69 expression was not significantly different on both CD4+ and CD8+ T lymphocytes at 7 days post infection (DMEM: C57BL/6 n=4, IL-6KO n=4) (LPS: C57BL/6 n=4, IL-6KO n=4) (CB3: C57BL/6 n=4, IL-6KO n=4) (CB3/LPS: C57BL/6 n=4, IL-6KO n=5) (grey line indicate wt mice, black line indicate IL-6KO mice, light grey area indicates isotype control).  62  63  transcription factor, Foxp3. While the steady state ratio of Treg cells to CD4+ lymphocytes was found to be significantly lower in the IL-6KO mice compared to wt mice, following disease induction the ratio of Treg cells to CD4+ T cells did not significantly differ (Figure 3.3b and Figure 3.5). This suggests that there is likely a sufficient proportion of Treg cells present to regulate the T cell response following infection and we found no evidence to suggest that lack of IL-6 resulted in changes in the Treg population that influenced the severity of pathology observed post-infection in the heart.  3.2.4 Early upregulation of MCP-1, TNFα and IL-10 in IL-6KO mice To determine if changes in the inflammatory response post-infection are responsible for the differences in disease severity, serum was assayed post infection using the BD CBA kit to measure inflammatory cytokine levels. Serum was collected at 1, 3, 7 and 14 days PI and assayed for TNFα, IFNγ, IL-6, IL-12p70, IL-10 and MCP-1 (Figure 3.6). In response to CB3 infection, wt mice, but not IL-6KO mice, upregulated IL-6 with a peak in production at day 3 post infection indicating that IL-6 is involved in the early immune response following coxsackievirus infection (Figure 3.6). IFNγ and IL-12p70 levels increased at a similar rate in both IL-6KO and wt controls following CB3/LPS treatment (Figure 3.6). However, the levels of TNFα, IL-10 and MCP-1 were increased in IL-6KO mice compared to the wt controls (Figure 3.6). TNFα upregulation occurred following CB3/LPS and LPS treatment in wt mice and CB3/LPS, CB3 and LPS treatment in the IL-6KO mouse. An additive effect with CB3 and LPS treatment was observed only in the absence of IL-6. Conversely, increased IL-10 production in IL-6KO mice corresponded to the presence of LPS as levels were elevated following LPS or CB3/LPS treatment. This was only observed in the absence of IL-6. This strongly suggests that production of the immunosuppressive cytokine IL10 is regulated in part by IL-6. The change in MCP-1 levels in IL-6KO mice corresponded to viral infection as both CB3 and CB3/LPS treatment resulted in increased production whereas LPS treatment alone did not. This suggests that MCP-1 is regulated by IL-6 following CB3 infection. Taken together, these results suggest that in the absence of IL-6, there is an imbalance in the induction of early inflammatory 64  Figure 3.5 IL-6KO mice have decreased regulatory T cells (A) Representative flow cytometry analysis of splenocyte regulatory T cells 3 days post DMEM, LPS, CB3 or CB3/LPS treatment. Treg cells were identified by expression of CD4 and the transcription factor Foxp3. IL-6KO mice contained a significantly lower percentage of CD4+ Foxp3+ cells compared to the wild type controls with DMEM treatment (DMEM: C57BL/6 n=8, IL-6KO n=8). However, following treatment with CB3 or CB3/LPS but not LPS alone, the percentage of CD4+ Foxp3+ cells was not significantly different (LPS: C57BL/6 n=8, IL-6KO n=8) (CB3: C57BL/6 n=8, IL-6KO n=8) (CB3/LPS: C57BL/6 n=9, IL-6KO n=9) (grey line indicate wt mice, black line indicate IL-6KO mice, light grey area indicates isotype control) suggesting sufficient proportions of Treg cells are present to immunosuppress disease. (B) Representative flow cytometry analysis of splenocyte regulatory T cells 7 days post DMEM, LPS, CB3 or CB3/LPS treatment. Treg cells were identified by expression of CD4 and the transcription factor Foxp3. IL-6KO mice contained a significantly lower percentage of CD4+ Foxp3+ cells compared to the wild type controls with DMEM treatment (DMEM: C57BL/6 n=7, IL-6KO n=7). However, following treatment with CB3 or CB3/LPS but not LPS alone, the percentage of CD4+ Foxp3+ cells was not significantly different (LPS: C57BL/6 n=12, IL-6KO n=14) (CB3: C57BL/6 n=11, IL-6KO n=17) (CB3/LPS: C57BL/6 n=13, IL-6KO n=18) (grey line indicate wt mice, black line indicate IL-6KO mice, light grey area indicates isotype control).  65  66  Figure 3.6 TNFα, IL-10 and MCP-1 expression is increased in the absence of IL-6 The serum concentrations of the cytokines IL-12p70, IL-6, IL-10, IFNγ, TNFα and the chemokine MCP-1 were monitored following treatment with DMEM, LPS, CB3 and CB3/LPS by a BD cytometric bead array inflammation assay (n≥3 for each treatment group at day 1, 3 and 7, n≥2 for each treatment group at day 14) (mean±SE, *p<0.05). IL-6 increased following infection with CB3 indicating a role for IL-6 in the response to viral infection. TNFα, IL-10 and MCP-1 were significantly increased in the IL-6KO mice compared to the wild type controls indicating a possible role for IL-6 in the regulation of these immune components (orange diamonds indicate DMEM treatment, green squares indicate LPS treatment, blue triangles indicate CB3 treatment, red circles indicate CB3/LPS treatment).  67  modulators and that IL-6 likely functions as a regulator of the early immune response to infection.  3.2.5 Increased cardiac infiltration of macrophage/monocytes in CB3-infected IL6KO mice Increased levels of the chemokine MCP-1 have previously been associated with increased migration of mononuclear cells to the heart at 7 days post CB3 infection [207]. To determine if the heightened disease severity and MCP-1 production in IL-6KO mice reflected an increase in mononuclear cell infiltration in the heart during the initiation of disease, flow cytometry was used to directly characterize the immune cells infiltrating the heart (day 7 PI). Significant increases in the infiltration of monocyte/macrophages, as determined by forward and side scatter and surface expression of CD11b and CD11c, was observed in the hearts of IL-6KO mice treated with CB3/LPS as compared to their wt counterparts (Figure 3.7 and Figure 3.8). These CD11b+ cells were further determined to be 81.3% ± 1.1% F4/80 positive and 59.7% ± 2.8% CD14 positive identifying them as primarily monocyte/macrophages. No other significant difference in the immune cell infiltration was observed (Data not shown). This demonstrates that greater cardiac infiltration by macrophage/monocytes occurred in association with an increase in chronic disease severity following infection of IL-6KO mice. This strongly suggests that heightened MCP-1 levels in the absence of IL-6 leads to greater immune cell infiltration, specifically CD11b+ cells, and subsequent cardiac pathology.  3.2.6 Recombinant IL-6 treatment in IL-6KO mice results in decreased chronic disease severity The increased autoimmune disease observed in IL-6KO mice could be due to an early developmental defect in these mice rather than a lack of IL-6 specifically during the early immune response. To determine if IL-6 production during the early immune response regulates the chronic disease severity, recombinant IL-6 (rIL-6) or DMEM was administered to IL-6KO mice at days 0, 1, 2 and 3 PI and the acute and chronic disease 68  Figure 3.7 IL-6KO mice have increased monocyte/macrophage infiltration into the heart at 7 days post infection Heart infiltrate was measured by flow cytometry analysis at 7 days post treatment with CB3/LPS. Cardiac infiltrate determined based on forward and side scatter as well as CD11b and CD11c staining. IL-6KO mice had significantly increased monocyte/macrophage infiltration at 7 days post treatment compared to wt mice (C57BL/6 n=9, IL-6KO n=11) (black bars indicate wt mice, white bars indicate IL-6KO mice) (mean±SE, *p<0.05). This increased correlated with the elevated levels of the chemokine MCP-1 in IL-6KO mice and suggests a link between these two factors.  69  Figure 3.8 IL-6KO mice have an increased number of monocyte/macrophage cells in the heart at 7 days post infection Heart infiltrate was measured by flow cytometry analysis at 7 days post treatment with CB3/LPS. Cardiac infiltrate was determined based on forward and side scatter as well as CD11b and CD11c staining. IL-6KO mice had significantly increased monocyte/macrophage infiltration at 7 days post treatment compared to wt mice (C57BL/6 n=9, IL-6KO n=11) (black bars indicate wt mice, white bars indicate IL-6KO mice) (mean±SE, *p<0.05).  70  severity was observed at days 10 and 28 respectively. IL-6KO mice were found to have significantly increased acute and chronic disease severity compared to wild type controls; however, treatment with rIL-6 was sufficient to decrease the heart damage histology during both stages of disease (Figure 3.9 and Figure 3.10). This conclusively shows that IL-6 regulates myocarditis severity by regulating the early immune response following viral infection.  3.2.7 Recombinant IL-6 regulates early inflammatory responses in IL-6KO mice To characterize the changes following rIL-6 administration, we monitored the cytokine milieu at day 3 PI. IL-6KO mice were observed to have significantly increased serum levels of TNFα, IL-10, MCP-1, MIP-1β, MIG and RANTES compared to wild type mice at 3 days post CB3/LPS treatment (Figure 3.11). The MIP-1α levels were also increased in the IL-6KO mice however the increase was not significant. IL-6KO mice treated with rIL-6 during the early immune response following CB3/LPS infection had significantly decreased serum levels of TNFα, IL-10, MCP-1, MIP-1β, MIG and RANTES as well as decreased MIP-1α (Figure 3.11). This decreased early inflammatory response correlated with decreased chronic disease severity at 28 days post treatment (Figure 3.11) and demonstrates that IL-6 production during the initiation of disease regulates the early immune activation, which in turn determines the severity of chronic disease. In addition to changes in TNFα and IL-10, the cytokines IFNγ and IL-12p70 were differentially expressed between the wild type and knockout mice. IL-12p70 was significantly increased in the IL-6KO mice with and without rIL-6 treatment compared to wild type controls while IFNγ was increased in the IL-6KO treated with rIL-6 compared to wild type controls. While these increases do not correlate with disease severity, it is possible that they may be a mechanism of disease amelioration following rIL-6 treatment.  71  Figure 3.9 Injection of rIL-6 in IL-6KO mice decreased acute disease severity following CB3/LPS treatment Acute cardiac disease histology was scored blindly by a four tier grading system to determine severity differences: grade 1, 0-10% pathology; grade 2, 11-25%; grade 3, 26-50%; grade 4, greater than 50% (black circles indicate wt mice with DMEM, white circles indicate IL-6KO mice with DMEM, grey circles indicate IL-6KO mice with rIL-6) (bar is mean±SE, *p<0.05). Disease severity was found to be significantly higher in the IL-6KO mice treated with DMEM compared to IL-6KO mice treated with rIL-6 and wild type controls.  72  Figure 3.10 Injection of rIL-6 in IL-6KO mice decreased chronic disease severity following CB3/LPS treatment (A) Representative Masson’s Trichrome stained cardiac section from C57BL/6 or IL-6KO mice. Mice were treated with CB3/LPS and either DMEM or rIL-6 on days 0, 1, 2 and 3 post infection. Mice developed disease pathology as determined by fibrosis in blue and immune cell infiltration within the fibrosis areas by 28 days PI (C57BL/6 with DMEM n=15, IL-6KO with DMEM n=11, IL-6KO with rIL-6 n=9). Magnification:400X. (B) Chronic cardiac disease histology was scored blindly by a four tier grading system to determine severity differences: grade 1, 0-10% pathology; grade 2, 11-25%; grade 3, 26-50%; grade 4, greater than 50% (black circles indicate wt mice with DMEM, white circles indicate IL-6KO mice with DMEM, grey circles indicate IL-6KO mice with rIL-6) (bar is mean±SE, *p<0.05). Disease severity was found to be decreased in the IL-6KO mice treated with rIL-6 compared to DMEM treated IL-6KO mice.  73  Figure 3.11 Injection of rIL-6 in IL-6KO mice decreased early inflammatory responses at 3 days post infection (A) The serum concentrations of the cytokines IL-12p70, IL-6, IL-10, IFNγ and TNFα were monitored following treatment with CB3/LPS by a BD cytometric bead array inflammation assay at day 3 PI (C57BL/6 with DMEM n=10, IL-6KO with DMEM n=9, IL6KO with rIL-6 n=10) (black bars indicate wt mice with DMEM, white bars indicate IL6KO mice with DMEM, grey bars indicate IL-6KO mice with rIL-6) (mean±SE, *p<0.05). TNFα, IL-10 and IL-12p70 levels were significantly increased in the IL-6KO mice compared to wild type controls. rIL-6 treatment was sufficient to decrease the serum concentration of IL-10 and TNFα. (B) The serum concentrations of the chemokines MCP-1, MIP-1α, MIP-1β, MIG and RANTES were monitored following treatment with CB3/LPS by a BD cytometric bead array flex set assay at day 3 PI (C57BL/6 n=10, IL6KO with DMEM n=9, IL-6KO with rIL-6 n=10) (black bars indicate wt mice with DMEM, white bars indicate IL-6KO mice with DMEM, grey bars indicate IL-6KO mice with rIL-6) (mean±SE, *p<0.05). All chemokine levels were increased in the IL-6KO mice compared to wild type controls. Treatment with rIL-6 was sufficient to decrease the levels of all the chemokines.  74  75  3.2.8 Altered serum levels of IL-12, MIP-1β and MCP-1 with IL-6R blocking antibody treatment In addition to rIL-6 treatment of IL-6KO mice during the initiation of disease, wild type mice were treated with an IL-6 receptor blocking antibody. This treatment would confirm that the cytokine differences observed was due to a lack of IL-6 during only the initiation of disease rather than an earlier stage of development. C57BL/6 and IL-6KO mice were treated with saline, IgG or IL-6R antibody at the time of CB3/LPS infection. Serum concentration of cytokines and chemokines were measured at day 3 PI (Figure 3.12). No significant difference was noted between saline and IgG treatment (Data not shown). However, IL-6R blocking antibody treatment did significantly decrease IL-12p70 production and significantly increased MIP-1β and MCP-1 production to levels similar to IL-6KO mice. This is further evidence that IL-6 is regulating these factors during disease initiation. The serum levels of IL-10, TNFα and G-CSF were also increased in IL-6R antibody treated mice following disease initiation, however, the levels were not significantly different from wild type or IL-6KO mice.  3.2.9 Increased cardiac infiltration in rIL-6 treated IL-6KO mice As the chemokine production correlated with disease severity, the immune cell infiltration in the heart was characterized at the peak of the acute stage of disease (day 10 PI) in the wild type and IL-6KO mice with and without rIL-6 treatment. As observed at day 7 PI, IL-6KO mice treated with DMEM had significantly increased macrophage/monocyte infiltration compared to wild type controls at day 10 PI. Unexpectedly, while treatment with rIL-6 resulted in decreased chemokine production, increased cardiac infiltration was observed with increases in the percentage of CD11b+CD11c- and CD11b+CD11c+ monocyte/macrophages and CD4+ and CD8+ T cells (Figure 3.13a and Figure 3.14a). Specifically, the CD11b+CD11cmonocyte/macrophage population was 72.1% ± 1.6% F4/80 positive and 74.5% ± 0.7% CD14 positive, while the CD11b+CD11c+ monocytes/macrophage population was 83.5% ± 0.8% F4/80 positive and 81.0% ± 3.2% CD14 positive. Further 76  Figure 3.12 Injection of IL-6R blocking antibody decreased serum concentrations IL-12p70 and increased concentrations of MIP-1β and MCP-1 at day 3 PI Following CB3/LPS treatment, C57BL/6 and IL-6KO mice were treated with saline, IgG or IL-6R antibody. For antibody treatments, mice were injected with 2 mg of antibody at the time of infection. Serum was collected at day 3 PI and cytokine (A) and chemokine (B) levels were monitored. Treatment with IL-6R antibody resulted in significantly decreased IL-12p70 and increased MIP-1β and MCP-1 indicating that IL-6 production during the initiation of disease regulates the production of these immune factors.  77  Figure 3.13 rIL-6 injection in IL-6KO mice increased innate and adaptive immune cell infiltration in the heart (A) Heart infiltrate was measured by flow cytometry analysis at 10 days post treatment with CB3/LPS with or without rIL-6 treatment. Cardiac infiltrate was stained to determine innate and adaptive immune cell infiltration using the surface markers CD11b, CD11c, CD3, CD4 and CD8. rIL-6 treatment in the IL-6KO mice resulted in increased monocyte/macrophages (CD11b+CD11c- and CD11b+CD11c +), CD4+ T cells (CD3+CD4+) and CD8+ T cells (CD3+CD8+) at 10 days post treatment compared to wt and IL-6KO mice treated with DMEM (C57BL/6 with DMEM n=14, IL-6KO with DMEM n=10, IL-6KO with rIL-6 n=11) (black bars indicate wt mice with DMEM, white bars indicate IL-6KO mice with DMEM, grey bars indicate IL-6KO mice with rIL-6) (mean±SE, *p<0.05). (B) The percent of CD4+ cells that are Treg or Th17 cells was determined by flow cytometry analysis of cardiac infiltrate at 10 days post CB3/LPS treatment. Treg cells were identified by the presence of the surface marker CD4 and the transcription factor Foxp3 while Th17 cells were identified by the presence of the surface marker CD4 and the transcription factor RORγt. rIL-6 treated IL-6KO mice contained a significantly lower percentage of CD4+ cells that were Treg cells compared to the DMEM treated wild type controls and DMEM treated IL-6KO mice. Minimal Th17 cells were observed in the heart regardless of treatment (C57BL/6 with DMEM n=7, IL6KO with DMEM n=9, IL-6KO with rIL-6 n=8) (black bars indicate wt mice with DMEM, white bars indicate IL-6KO mice with DMEM, grey bars indicate IL-6KO mice with rIL-6) (mean±SE, *p<0.05).  78  79  Figure 3.14 rIL-6 injection in IL-6KO mice increased the number of innate and adaptive immune cells infiltrating in the heart at 10 days post infection (A) Heart infiltrate was measured by flow cytometry analysis at 10 days post treatment with CB3/LPS with or without rIL-6 treatment. Cardiac infiltrate was stained to determine innate and adaptive immune cell infiltration using the surface markers CD11b, CD11c, CD3, CD4 and CD8. rIL-6 treatment in the IL-6KO mice resulted in increased numbers of monocyte/macrophages (CD11b+CD11c- and CD11b+CD11c+), CD4+ T cells (CD3+CD4+) and CD8+ T cells (CD3+CD8+) at 10 days post treatment compared to wt mice (C57BL/6 with DMEM n=9, IL-6KO with DMEM n=8, IL-6KO with rIL-6 n=7) (black bars indicate wt mice with DMEM, white bars indicate IL-6KO mice with DMEM, grey bars indicate IL-6KO mice with rIL-6) (mean±SE, *p<0.05). (B) The number of Treg and Th17 cells was determined by flow cytometry analysis of cardiac infiltrate at 10 days post CB3/LPS treatment. Treg cells were identified by the presence of the surface marker CD4 and the transcription factor Foxp3 while Th17 cells were identified by the presence of the surface marker CD4 and the transcription factor RORγt. rIL-6 treated IL-6KO mice contained a significantly higher number of Treg cells compared to the DMEM treated wild type controls and DMEM treated IL-6KO mice. Minimal Th17 cells were observed in the heart regardless of treatment (C57BL/6 with DMEM n=7, IL-6KO with DMEM n=9, IL-6KO with rIL-6 n=8) (black bars indicate wt mice with DMEM, white bars indicate IL-6KO mice with DMEM, grey bars indicate IL6KO mice with rIL-6) (mean±SE, *p<0.05).  80  81  characterization of the CD11b+CD11c+ macrophages identified these cells as M2 macrophages by the characteristic markers Gr1, CD115, CD204, CD206 and CD301 (Data not shown). Further, within the cardiac infiltrating CD4+ cell population at day 10 PI, the proportion of Treg cells to CD4+ T cells did not significantly differ between the wt and IL-6KO mice. However, IL-6KO mice treated with rIL-6 had a significantly smaller proportion of CD4+ Tregs (Figure 3.13b and Figure 3.14b) despite a significantly greater number of infiltrating CD4+ T cells. This suggests that Treg suppression is not responsible for the decrease in inflammation and disease observed in rIL-6 treated IL6KO mice and that as expected, the presence of IL-6 is reducing the proportion of Tregs to effector T cells by day 10 PI. Interestingly, the IL-6 treatment results in a large number of infiltrating lymphocytes, yet this is commensurate with less observed pathology by day 28. Further, addition of rIL-6 decreased the regulation of the CD4+ T cell responses and therefore increases the adaptive immune response within the heart. Additionally, minimal Th17 cells were found in wt or IL-6KO mice, as measured by expression of the Th17 specific transcription factor RORγt at day 10 PI, regardless of the treatment (Figure 3.13b and Figure 3.14b) suggesting that Th17 cells do not play a major pathogenic role in viral-mediated autoimmune myocarditis development. Collectively, these results suggest that the four day administration of rIL-6 does not completely replicate the response of a wt IL-6 replete mouse and instead is responsible for a change in the make-up of the infiltrating cell population following infection (day 10) that is responsible for the control in the severity of late stage chronic disease.  82  3.3  Discussion Herein, we report that following coxsackievirus infection, IL-6KO mice develop  increased chronic autoimmune myocarditis. This result is in contrast to previous reports that IL-6 deficient mice were resistant to induction of autoimmune disease including experimental-induced myocarditis [196]. The study of experimental-induced disease lacks the complications of the viral infection and the early immune response that is essential to specifically clear virus from the host and is also responsible for triggering and controlling a pluripotent autoreactive response. In the absence of IL-6, we observed greater severity of chronic myocarditis that correlated with changes in the early immune response to virus infection. Most of the differences observed were prior to the peak of virus infection in the heart and clearance from the animal. Specifically, we observed an increase in systemic cytokine/chemokine production, splenic T cell activation and monocyte/macrophage infiltration in the heart. This heightened disease severity was not due to an inability to control viral replication as there was no difference in the viral titre in the heart at the peak of infection. Further indicating a regulatory role for IL-6, rIL-6 treatment during the early immune response was sufficient to decrease the early inflammatory response with a corresponding decrease in the chronic disease. These results strongly suggest that IL-6 regulates and controls the initial host response to pathogen insult and that absence of IL-6 early post infection leaves the host susceptible to increased long-term complications of autoimmune myocarditis. IL-6 has a pathogenic role in experimental autoimmune models such as EAM [196], EAE [126], pristane-induced lupus [205], experimental-induced arthritis [127, 128] and autoimmune myasthenia gravis [206]. Mice deficient in this cytokine were resistant to autoimmune disease development [126-128, 196, 205, 206]. Our results, however, clearly show induction of chronic disease with heightened severity in the absence of IL6. Therefore, viral induction of disease follows a different disease pathogenesis with a more complex immune response in which cytokines, such as IL-6, have varied specific roles compared to experimental models of autoimmunity. Our results suggest a regulatory role for IL-6 following viral infection. Previously, the addition of recombinant IL-6 following encephalomyocarditis virus (EMCV) infection resulted in a decrease in disease severity of autoimmune myocarditis [197]. However, EMCV infection in mice 83  which overexpress IL-6 leads to increased disease severity [199]. These results and ours suggest that IL-6 functions in a delicate balance as a regulator. Early after infection, IL-6 acts to dampen the strength of initial anti-viral immune response to reduce the risk of developing autoimmunity, however, its long-term presence as a chronic participant leads to heightened chronic disease. Specifically, IL-6 is an essential participant in the acute phase response following viral infection. IL-6 deficient mice were unable to control infection by vaccinia virus and lymphocytic choriomeningitis virus (LCMV) [200, 208]. In terms of CB3, an inability to control the viral infection would lead to greater viral and host directed cardiac damage and subsequently increase chronic disease. We observed no differences in the quantity of replicative virus between the hearts of IL-6KO and wt mice post infection. This suggests that the ability of IL-6 deficient hosts to control CB3 replication was not an issue. Our data suggests that for CB3 infection, the increase in disease severity is a consequence of a dysregulated immune response due to lack of IL-6 throughout the process. Our results suggest that IL-6 functions by regulating the balance of cytokines and chemokines during the early host response to infection. Thus, IL-6 control has both local and systemic implications and greatly differentiates disease outcome. Changes in the cytokine milieu in the early immune response following infection have been demonstrated to later influence the development of chronic autoimmunity [209]. IL-10 levels were found to be increased in the IL-6KO mice. As IL-10 is associated with the anti-inflammatory response and T cell suppression [210] this was a surprising observation. Produced primarily by monocytes and macrophages, IL-10 functions to decrease pro-inflammatory cytokine production by APCs [211]. Production of pro-inflammatory cytokines and IL-10 are initiated following the same stimuli in a cell intrinsic manner and this acts to regulate the inflammatory immune response [211]. Therefore, the early upregulation of IL-10 may serve to control the increased inflammatory cytokines produced in the absence of IL-6. The window of IL-10 expression is short and also observed to be upregulated by LPS treatment alone. In experimental models of autoimmunity including EAE and EAM, IL-10 suppresses disease severity [212, 213]. In contrast, it has been suggested that increased IL-10 following CB3 infection in human monocytes leads to a dysregulation of the immune response to the virus and ultimately allows for the progression to the chronic disease 84  [99]. In fact, increased levels of IL-10 in human patients with fulminant myocarditis correlates with increased mortality rates [214]. IL-10 is also increased in mice following CB3 infection and was again suggested to allow for disease progression from the acute stage of disease to the chronic stage of disease [88, 90]. As such, the increased IL-10 may play a role in increased disease severity. These results highlight the complex balance of pro- and anti-inflammatory mechanisms that are regulated by IL-6. The increases in TNFα and MCP-1 observed in the infected IL-6 deficient mice represent a heightened inflammatory response. Both TNFα and MCP-1 have previously been associated with both disease development and severity, and likely contribute to the increased disease pathology. TNFα has been instrumental in overcoming genetic resistance to CB3-mediated autoimmune myocarditis [113] and likely acts downstream of LPS signaling. TNFα was sufficient to induce spontaneous autoimmune myocarditis in mice constitutively overexpressing this cytokine in the heart [111]. In patients with enteroviral-induced myocarditis, TNFα levels are often increased and are associated with increased myocardial necrosis and cellular infiltration in the myocardium [106]. In our model, TNFα levels were associated with increased disease severity. In wt mice, similar TNFα levels were attained following treatment with CB3/LPS or LPS alone regardless of disease outcome suggesting that TNFα levels are not sufficient for disease observed in these mice. In the absence of IL-6, the level of TNFα increased with CB3/LPS and was associated with heightened disease severity, clearly indicating a role for TNFα as an important inflammatory co-factor in disease progression. Taken together, TNFα functions to increase inflammation associated with the induction of autoimmune heart disease and in the absence of IL-6, an imbalance of TNFα is induced during the viral response resulting in heightened disease pathology. MCP-1 is a potent chemoattractant for mononuclear cells, T cells and NK cells expressing CCR2, the receptor for MCP-1, on their surface [207, 215]. MCP-1 is secreted by endothelial cells [216], muscle cells [217] and most notably, coxsackievirus infected cardiac myocytes [207]. Further, elevated MCP-1 expression has been correlated with immune cell infiltration in the heart following coxsackievirus infection [207]. MCP-1 is expressed in a dose dependent manner during coxsackievirus infection [207] and increases over the course of infection thus suggesting that it benefits the host response to CB3 infection. Further, mice deficient in MCP-1 or CCR2 are resistant to the development of experimental-induced autoimmune myocarditis [134]. Heart specific 85  expression of MCP-1 is sufficient to induce monocyte/macrophage migration to the heart leading to myocarditis and fibrosis [218]. This suggests that MCP-1 and the migration of monocytes/macrophages to the heart is integral to the developing cardiac lesions. In our model, the absence of IL-6 results in increased early expression of MCP-1 associated with increased monocyte/macrophage infiltration during both the acute infection and the later chronic stage of disease. In the absence of IL-6, this increase in mononuclear cell migration to the heart could lead to heightened cardiopathology. Increased levels of macrophages and monocytes could lead to greater levels of uncontrolled damage and lesion development without a concomitant increase in viral replication or viral directed pathology. However, the further increase in heart infiltrate following rIL-6 treatment would suggest that this is not the mechanism of increased disease severity. In support, increased macrophage infiltration in the heart was seen with rIL-6 treatment following EMCV infection in correlation with decreased chronic disease pathology [197]. It was suggested that the increased macrophage infiltration could lead to faster clearance of virus and therefore decreased cardiac damage. Following rIL-6 treatment we observed increased innate and adaptive immune cell infiltration in combination with a decreased cytokine inflammatory response. It is likely that this combination results in faster viral clearance and better regulation of the early inflammatory responses and results in decreased chronic disease severity in these rIL-6 treated mice. Since it is likely that both viral and immune directed damage are controlling the outcome, the lack of IL- 6 results in slower clearance with less regulation of the early inflammatory responses leading to more inflammatory activity in the heart and results in heightened chronic disease and cardiac damage. We provide evidence that IL-6 acts to regulate the early immune response following coxsackievirus infection. Regulation of the early response in turn controls the severity of the subsequent chronic disease pathology. Immune factors associated with the increased disease severity included early T cell activation and inflammatory cytokine and chemokine responses following disease induction. Without IL-6 to regulate the early immune response after infection, the heightened early inflammatory response leads to increased chronic myocarditis severity as the disease progresses. These results suggest that, contrary to what was suggested by results from  86  experimental models of disease, anti-IL-6 treatment following viral-induced myocarditis could result in increased damage to the host.  87  4  Novel Non-MHC Linked Loci From Mouse Chromosome 17 Confer Susceptibility to Viral-Mediated Chronic Autoimmune Myocarditis.2  2  A version of chapter 4 has been published. Poffenberger MC, Shanina I, Aw C, El Warry N, Straka N, Fang D, Baskin-Hill AE, Spiezio SH, Nadeau JH, Horwitz MS. (2010) Novel nonmajor histocompatibility complex-linked loci from mouse chromosome 17 confer susceptibility to viral-mediated chronic autoimmune myocarditis. Circ Cardiovasc Genet. 3(5): p. 399-408. 88  4.1  Introduction Clinical myocarditis is considered a precursor to dilated cardiomyopathy (DCM)  and is a leading cause of sudden death in young adults [219]. It has been shown that clinical myocarditis is often the direct result of infection with viruses such as coxsackievirus [220, 221]. Myocarditis weakens and enlarges the heart leading to DCM and eventually requires cardiac transplantation [220]. Disease pathogenesis has best been modeled in mice using coxsackievirus B3 (CB3) to induce both acute and chronic aspects of myocarditis. This model closely resembles the profile of inflammation observed in patients. Chronic disease is characterized by the presence of circulating cardiac-specific immune cells and autoantibodies, immune infiltration of the heart including the development of inflammatory lesions with regions of fibrosis, loss of contractile function and ventricle enlargement, all occurring post-viral clearance [209]. Coxsackievirus mediated chronic myocarditis can be induced only in susceptible mouse strains such as A/J, BALB/c and NOD/ltj [85, 222, 223]. Resistant mouse strains such as C57BL/6 develop an acute infection of the heart that resolves with the clearance of virus from the host [224]. Host genetic factors are essential in the induction of disease in humans and mice, yet their identification is at an early stage and only a few putative loci have been reported [187, 188, 225, 226]. Genetic susceptibility to myocarditis is thought to involve both MHC and nonMHC associated genes in patients [227]. In mice, the segregation of mouse haplotypes has lent credibility to the notion that the Major Histocompatibility Complex (MHC) locus influences the susceptibility of the host to chronic disease, the evidence for non-MHC genetic influences is also quite strong and supported by experiments where genetic resistance was overcome by co-treatment with lipopolysaccharide [169, 184]. As such, the studies of host genetic elements have neglected the analysis of the MHC locus and its parent chromosome, chromosome 17, in disease susceptibility. Recent advances in mouse genetic techniques have led to the generation of mouse chromosome substitution strains (CSS), a new powerful tool in the identification of disease susceptibility loci [228]. Using the first set of CSS mice to be generated that is composed of a single donor A/J chromosome on an otherwise C57BL/6 host background we showed that chromosome 17 confers susceptibility to viral-mediated 89  chronic myocarditis. Further, generation of mice congenic for chromosome 17 allowed for the identification of four susceptibility loci on the substituted chromosome, three of which are not linked to the MHC locus.  90  4.2  Results  4.2.1 Chromosome 17 confers susceptibility to coxsackievirus-induced chronic myocarditis In order to identify chromosomes that contain susceptibility loci to viral-induced autoimmune myocarditis, a number of CSS mice were screened to identify loci of interest. These mice contained one chromosome from the genetically susceptible A/J strain on an otherwise resistant C57BL/6 strain background. Interestingly, we determined that A/J genotype on chromosomes 3 (B6.A3 mice), 4 (B6.A4) and 17 (B6.A17 mice) was sufficient to confer susceptibility to viral-induced chronic myocarditis while A/J genotype on chromosome 5 (B6.A5 mice) was not (Figure 4.1a and Data not shown). As B6.A17 mice were also susceptible to induction of myocarditis by injection of cardiac myosin protein emulsified in complete Freund’s adjuvant while B6.A3, B6.A4 and B6.A5 mice were not (Data not shown), we selected this chromosome for further analysis in the hopes of identifying an autoimmune susceptibility gene that was not restricted to viral-induction of disease. Disease susceptibility in the B6.A17 mice was not due to differences in the ability of CB3 to replicate in the heart as no significant difference was observed in the quantity of virus found in the tissue of B6.A17, A/J or C57BL/6 mice 3 days post infection (Figure 4.1b). Further, in all three strains, no replicative virus was detected in the heart at 7 days post infection. Susceptibility to myocarditis was not due to a difference in the mouse strain’s ability to clear the virus infection (Figure 4.1b). B6.A17 mice developed a disease with similar pathology and at a similar incidence to A/J mice following CB3 infection demonstrating that at least one locus from chromosome 17 confers susceptibility to chronic autoimmunity. Infection of B6.A17 mice with CB3 resulted in the development of chronic myocarditis in 64% of the mice tested as measured by histopathological analysis for cardiac lesions (Figure 4.1a). This compares to C57BL/6 mice that did not develop chronic disease and A/J mice that had a disease incidence of 67% (Figure 4.1a). Statistical analysis of the disease incidence in the B6.A17 mice compared to the A/J and C57BL/6 mice confirmed that chromosome 17 confers susceptibility to virus-induced autoimmune myocarditis (p<0.01 for the 91  Figure 4.1 Chromosome 17 confers susceptibility to chronic myocarditis (A) Representative heart disease histology and disease incidence at 28 days post CB3 infection. Tissue was stained by standard protocols with Masson’s Trichrome to detect damage by cellular infiltration as well as fibrosis. As previously shown, A/J mice develop chronic disease pathology while C57BL/6 did not. B6.A17 mice developed chronic disease histology at an incidence similar to the susceptible A/J strain suggesting the presence of one or more susceptibility genes on chromosome 17. Data is representative of at least three separate experiments. n represents the number of mice. * denotes p<0.01 compared to C57BL/6 strain. (B) Viral titre in the heart at days 3 and 7 post infection as determined by plaque assay. The dashed line represents the limit of detection by the assay. No significant difference was observed in heart viral titre at day 3 post infection in the A/J, C57BL/6 or B6.A17 mice. No replicative virus was detected in the heart at day 7 post infection.  92  B6.A17 and A/J strain compared to C57BL/6 mice). From these results, it is evident that mouse chromosome 17 encodes at least one allele that confers susceptibility to autoimmune myocarditis. Further, the susceptibility conferred by this chromosome is due to an A/J genotype beyond the proximal 4.1 cM as the B6.A17 strain is comprised of a C57BL/6 genotype up to and including the microsatellite marker, D17Mit164 at 4.1 cM (3924747 bp). As autoantibody production to heart antigens is a factor that can contribute to disease development, the autoantibody production against total heart extract as well as cardiac myosin protein was monitored in the B6.A17, A/J and C57BL/6 mice. No differences in the serum titre for either anti-cardiac myosin or anti-heart extract antibody production were detected in B6.A17 strains as compared to C57BL/6 mice. Autoantibodies are not likely contributing in the disease development in these mice (Data not shown). A genetic link between MHC, located on chromosome 17, and myocarditis has been clearly identified in both mice and humans [184, 227]. In addition to the MHC locus, chromosome 17 encodes at least two other genetic elements with documented relevance to autoimmune myocarditis, tumor necrosis factor alpha (Tnfα) [113, 114] and complement component 3 (C3) [196], making chromosome 17 a likely candidate for presence of disease susceptibility genes. C3, located at 34.4 cM (57343397 bp) of chromosome 17, plays a role in the activation of both the classical and alternative pathways of complement activation. The C3 locus in the susceptible A/J mice does differ from the resistant C57BL/6 mice by four intron SNPs as well as one SNP downstream of the gene [192], therefore it is possible that differences in the expression of this gene could contribute to susceptibility. Analysis of C3 levels showed no change in the levels of C3 over the course of infection and disease that could be correlated in any way with disease susceptibility (Figure 4.2a). The small differences in the genome between the two mouse strains could not be correlated to changes in serum levels of C3. Tnfα, located at 19.06 cM (35336335 bp) on chromosome 17, has been associated with autoimmune myocarditis disease development and susceptibility [113]. Specifically, TNFα injection at the time of coxsackievirus infection in disease resistant mice is sufficient to overcome this genetic resistance rendering the mice susceptible to chronic disease development [113]. Further, constitutive TNFα expression in the heart 93  Figure 4.2 Serum C3 and TNFα levels do not correlate with disease susceptibility (A) C3 levels in the serum in mice at days 0, 3, 7, 10 and 28 post CB3 infection. A/J, C57BL/6 and B6.A17 mice were not found to differ in serum C3 levels prior to or post infection. (B) Serum TNFα levels at days 0. 3, 7 and 28 post CB3 infection. A/J, C57BL/6 and B6.A17 mice were not found to differ in TNFα concentration in the serum.  94  is sufficient to induce spontaneous myocarditis, highlighting a role for TNFα in disease susceptibility [111]. Interestingly, analysis of serum TNFα levels in the susceptible A/J and B6.A17 strains versus the resistant C57BL/6 strain failed to demonstrate a difference that could be correlated to disease susceptibility (Figure 4.2b). However, serum concentrations of TNFα were increased in the C57BL/6 and B6.A17 mice compared to the A/J mice at 3 days post infection. This finding shows that decreased TNFα levels correlate with disease susceptibility in A/J mice, however as the B6.A17 mice have increased TNFα levels compared to A/J mice, a low concentration of serum TNFα is not the cause of the susceptibility in the B6.A17 mice. Further, the difference in TNFα level between strains suggests that the serum concentration of TNFα post CB3 infection is regulated by a factor on another chromosome of the genome. While this finding suggests that TNFα is not contributing to disease susceptibility, A/J mice differ from the C57BL/6 Tnf locus by five mRNA untranslated region SNPs, three intron SNPs and one upstream SNP [192]. Therefore, it is possible that a TNFα expression difference could exist in a site-specific manner, conferring susceptibility. As chromosome 17 contains hundred of genes which may be associated with disease development, further dissection of the chromosome was necessary to determine the exact location of the susceptibility gene(s).  4.2.2 At least two novel susceptibility loci for CB3-induced chronic myocarditis are located on chromosome 17 Congenic mice encoding only portions of the A/J chromosome 17 were examined to further partition regions of chromosome 17 for disease susceptibility (Figure 4.3a). The genetic boundaries of the A/J sequence of the recombinant chromosome 17 mice were confirmed by PCR analysis of microsatellite markers. All the B6.A17 congenic strains infected with CB3 conferred chronic disease susceptibility (p<0.01 for each congenic strain compared to C57BL/6 mice) (Figure 4.3b), clearly indicating the multigenic influence of chromosome 17 on disease development. Certain segments of chromosome 17 provided a more robust disease phenotype as well as an increased  95  Figure 4.3 Multiple loci on chromosome 17 confer susceptibility to chronic myocarditis (A) Schematic representation of the congenic mice generated from B6.A17 mice at Case Western Reserve University. (B) Representative heart disease histology and chronic disease incidence at 28 days post CB3 infection. Disease pathology in both A17.V19 and A17.M14 strains suggests the presence of at least two susceptibility loci on the chromosome with the proximal portion of the chromosome conferring a greater influence than the distal portion. Data is representative of at least three separate experiments. n represents the number of mice. * denotes p<0.01 compared to C57BL/6 strain.  96  disease incidence over other segments. More specifically, the congenic strains A17.M20, A17.V19 and A17.V27, that encode from 4.1 cM to 16.4 cM, 22.8 cM and 33.8 cM of chromosome 17 from the A/J mouse strain, respectively, had a higher disease incidence of viral-induced disease than the A17.M14 congenic mice (Figure 4.3b). Further, the A17.M20, A17.V19 and A17.V27 strains developed increased disease pathology compared to the A17.M14 strain (unpublished observation). The A17.M14 mice have a reverse composition of A/J sequences on the distal portion of chromosome 17 starting at the 24.5 cM marker (Figure 4.3a). As disease was initiated in the congenic mice A17.M14 and A17.V19, and there is no overlap in the susceptibility sequences, at least two susceptibility loci are located on chromosome 17. Further, the genetic locus on the distal portion of chromosome 17 is less influential in disease susceptibility as compared to the proximal portion of the chromosome. Most interestingly, the A17.M20 congenic mice that are composed of only 12.3 cMs of A/J sequence were susceptible to chronic autoimmune myocarditis and disease was induced by CB3 at an incidence of 70% (Figure 4.3b). This region of chromosome 17 is outside of the MHC locus and the high incidence of susceptibility following CB3 infection demonstrates that one or more major genetic determinants of myocarditis susceptibility are located in this region. Of the multitude of genes located within this region, none have been linked to myocarditis. The A17.V19 strain consists of the same region of interest as the A17.M20 strain as well the adjacent 4.8 cM. Disease in these mice is likely aided by a common susceptibility gene that confers susceptibly in the A17.M20 region as well as one encoded in the region between 16.0 cM and 22.8 cM. This region encodes the MHC class I and class II loci, TNFα, as well as tapasin and likely influences CB3-induced chronic myocarditis. Susceptibility genes located in both the region defined by the A17.M20 strain as well as the adjacent MHC locus should influence disease pathology in the A17.V27 strain. However, the A17.V27 strain develops a decreased incidence of disease pathology compared to the A17.M20 and A17.V19 strains. This difference could indicate the presence of a disease antagonistic factor located in the region between 22.8 cM and 34.3 cM. Alternatively, it is possible that a disruption of the gene locus at the recombination site could have altered the expression of a protein involved in disease regulation. 97  4.2.3 Two novel susceptibility loci for CB3-induced chronic myocarditis are located in the proximal 16.4 cM of chromosome 17 To further narrow the susceptibly locus in the proximal portion of chromosome 17, the A17.M20 and A17.V19 strains were used to generate mice subcongenic for the proximal 22.8 cM of the chromosome (Figure 2.1). The subcongenic mice were mapped by PCR analysis of microsatellite markers (Table 2.1) to confirm the A/J region and ensure that no recombination occurred elsewhere on the chromosome. The mice were then bred to determine the impact of the genotype on disease severity. By screening these new congenic strains, we were able to identify three distinct susceptibility loci of interest in the proximal portion of chromosome 17. The congenic strains A17.MCP7, A17.MCP12, A17.MCP14 and A17.MCP22 all developed chronic disease pathology following CB3 infection (p<0.01 for each congenic strain compared to C57BL/6 mice) (Table 4.1). The first susceptibility locus identified by the congenic strains A17.MCP7 and A17.MCP14, Virus autoimmune myocarditis 1 (Vam1), is defined by a lower limit between the sequenced gene Pde10a (9054536 bp) (Figure 4.4) and the microsatellite marker D17Mit113 (6.5 cM, 12172308 bp) to between the sequenced gene Dll1 (15511735 bp) (Figure 4.5) and the microsatellite marker D17Mit213 (9.33 cM, 16752157 bp). This susceptibility locus overlaps with a susceptibility locus to Type 1 diabetes (Idd23) [192, 229] suggesting a possible global autoimmune susceptibility gene. A second susceptibility locus, Virus autoimmune myocarditis 2 (Vam2), identified by the strain A17.MCP22 is defined by a lower limit between the sequenced gene Mapk8ip3 (25072425 bp) (Figure 4.6) and the sequenced gene Telo2 (25239279 bp) (Figure 4.7) to a higher limit between the microsatellite marker D17Mit198 (16 cM, 27796190 bp) and the sequenced gene Ppard (28370955 bp) (Figure 4.8). This susceptibility locus overlaps with the susceptibility loci to type one diabetes (Idd16) [229] and chronic experimental autoimmune thyroiditis (Ceat1) [192, 230] again suggesting a possible global autoimmune susceptibility gene. The third susceptibility locus identified, Virus autoimmune myocarditis 3 (Vam3), identified by the strain A17.MCP12 is defined by a lower limit between the microsatellite  98  Table 4.1 Genotypes and chronic disease incidence of A17.MCP strains generated from the A17.M20 and A17.V19 strain mice Disease incidence in the A17.MCP7, A17.MCP14 and A17.MCP22 strains suggests the presence of at least two novel chronic disease susceptibility loci in the proximal portion of chromosome 17. Disease pathology in the A17.MCP12 strain maybe due to TNFα, MHC or a novel susceptibility gene located within this region. Data is representative of at least three separate experiments. n represents the number of mice. * denotes p<0.01 compared to C57BL/6 strain.  cM D17Mit164 Pde10a D17Mit113 Dll1 D17Mit213 D17Mit133 Mapk8ip3 Telo2 D17Mit46 D17Mit100 D17Mit198 Ppard D17Mit101 D17Mit28 TNF-pAR D17Mit233 D17Mit11  4.1 6.5 9.33 10.4  11.7 11.75 16 16.4 18.44 19.06 20.9 22.8  Disease Incidence:  bp location 3924615 9054536 12172308 15511735 16752157 24994554 25072425 25239279 25502885 26318983 27796090 28370955 29405253 34137861 35336335 36076118  B6.A17  C57BL/6  A17.MCP7  A17.MCP14  A17.MCP22  A17.MCP12  B6 A/J A/J A/J A/J A/J A/J A/J A/J A/J A/J A/J A/J A/J A/J A/J A/J  B6 B6 B6 B6 B6 B6 B6 B6 B6 B6 B6 B6 B6 B6 B6 B6 B6  B6 B6 A/J A/J B6 B6 B6 B6 B6 B6 B6 B6 B6 B6 B6 B6 B6  B6 B6 A/J A/J B6 B6 B6 B6 B6 B6 B6 B6 B6 B6 B6 B6 B6  B6 B6 B6 B6 B6 B6 B6 A/J A/J A/J A/J B6 B6 B6 B6 B6 B6  B6 B6 B6 B6 B6 B6 B6 B6 B6 B6 A/J A/J A/J A/J A/J A/J B6  50%* (n=8)  0% (n=7)  58%* (n=12)  59%* (n=22)  39%* (n=18)  67%* (n=6)  99  Figure 4.4 Sequencing data for Pde10a A17.MCP7 and A17.MCP14 were identified to be C57BL/6 at the SNP locations 9054346 bp, 9054355 bp, 9054375 bp, 9054414 bp, and 9054536 bp. Sequences were aligned using ClustalW2 [193].  100  Figure 4.5 Sequencing data for Dll1 A17.MCP7 and A17.MCP14 were identified to be A/J at the SNP location 15511735 bp. Sequences were aligned using ClustalW2 [193].  101  markers D17Mit100 (11.75 cM, 26319104 bp) and D17Mit198 (16.0 cM, 27796090 bp) and a higher limit between D17Mit233 (20.9 cM, 36076118 bp) and D17Mit11 (22.8 cM). As this locus contains the MHC locus as well as TNFα, a susceptibility link in this strain was to be expected however it is possible that an additional gene in this region is contributing to disease development. Disease incidence was similar between B6.A17 and congenic strains suggesting that each locus was sufficient to confer susceptibility equally (Table 4.1). As the A17.MCP12 strain includes the MHC locus as well as TNFα, while the A17.MCP7, A17.MCP14 and A17.MCP22 do not, it is clear that these novel loci contribute to susceptibility at a similar level to MHC.  102  Figure 4.6 Sequencing data for Mapk8ip3 A17.MCP22 were identified to be C57BL/6 at the SNP locations 25072196 bp, 25072322 bp, 25072331 bp, and 25072425 bp. Sequences were aligned using ClustalW2 [193].  103  Figure 4.7 Sequencing data for Telo2 A17.MCP22 were identified to be A/J at the SNP locations 25238730 bp, 25238732 bp, 25239269 bp and 25239279 bp. Sequences were aligned using ClustalW2 [193].  104  Figure 4.8 Sequencing data for Ppard A17.MCP7 and A17.MCP14 were identified to be C57BL/6 at the SNP location 28370955 bp. Sequences were aligned using ClustalW2 [193].  105  4.3  Discussion Herein, we have identified three novel and one predicted susceptibility loci to  viral-induced chronic myocarditis. Two of the novel loci that conferred a strong influence on susceptibility, are located in the proximal 16.4 cM of chromosome 17 while the third loci, located in the distal portion of the chromosome, confers a weak influence. The fourth locus contains MHC and was therefore predicted to be associated with disease susceptibility. CSS mice were used to identify chromosome 17 to contain at least one gene conferring susceptibility to chronic myocarditis. Further disease induction in mice congenic for chromosome 17 made it clear that the chromosome contained multiple susceptibility genes in the proximal and distal portion of the chromosome. While the genetic influence of the distal portion of the chromosome was relatively minor, the proximal portion of the chromosome was identified to contain multiple susceptibly genes with at least three susceptibility genes contained within the first 22.8 cM of the chromosome. Specifically, one susceptibility locus identified in the first 22.8 cM of chromosome 17 by the congenic strain A17.MCP12, Vam3, contains MHC and Tnf (Table 4.4). This locus likely contributes to susceptibility through MHC. By monitoring disease in various H-2 congenic mice, a role for MHC in chronic disease susceptibility has been indicated [184]. However, many H-2 congenic mice which contained an MHC locus from a susceptible strain on an otherwise resistant strain background remained resistant to disease development [184]. Additionally, BALB/c and DBA/2 mice, which have the same MHC haplotype (H-2d), have a different disease pathogenesis with CD4 T cells being pathogenic in DBA/2 mice and CD8 T cells being pathogenic in the BALB/c mice [185]. Therefore, it is clear that the non-MHC genes are playing a dominant role in disease development. We have identified two non-MHC linked susceptibility loci proximal to the MHC locus on chromosome 17. Chronic myocarditis disease development in the A17.MCP7 and A17.MCP14 strains following CB3 infection indicates that a disease susceptibility gene is located between 9054536 bp (between 4.1 and 6.5 cM) and 16752157 bp (between Dll1 and 9.33 cM). This locus contains no known genes previously 106  Table 4.2 Names and locations of the 35 genes located within Vam1 that have SNP difference between A/J and C57BL/6 mice The Vam1 susceptibility locus was identified by disease pathology in the A17.MCP7 and A17.MCP14 strains. Gene and SNP locations were obtained from www.informatics.jax.org [192].  bp coordinates  strand  cM position  8718237-9179513  +  10403044-10512719  -  10595878-11033177  -  10649082-10685921  +  11033250-12256227  +  12312150-12412506  +  12420487-12511526  -  12511719-12518094  +  12571474-12612250  +  7.3  12612838-12700570  -  12777055-12821331  +  12875279-12962530  -  12934240-13008415 12934240-13008415 12941161-12944859  +  13086970-13102751  -  13104215-13109211 13165551-13185412 13421718-13430055  +  13675419-13898832  -  13714322-13721299 13849582-13898608 13897546-14043157  Gene symbol  Gene name  Pde10a  phosphodiesterase 10A  5.9  Qk  quaking  5.9  Pacrg  PARK2 co-regulated  A230009B12Rik  RIKEN cDNA A230009B12 gene  Park2 Agpat4  Parkinson disease (autosomal recessive, juvenile) 2, parkin 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)  Map3k4  mitogen-activated protein kinase kinase kinase 4  4732491K20Rik  RIKEN cDNA 4732491K20 gene  Plg  plasminogen  7.31  Slc22a3  solute carrier family 22 (organic cation transporter), member 3  7.32  Slc22a2  solute carrier family 22 (organic cation transporter), member 2  7.35  Igf2r  insulin-like growth factor 2 receptor  +  2810051F02Rik  RIKEN cDNA 2810051F02 gene  +  2810434M15Rik  RIKEN cDNA 2810434M15 gene  Airn Pnldc1  antisense Igf2r RNA poly(A)-specific ribonuclease (PARN)-like domain containing 1  -  Mrpl18  mitochondrial ribosomal protein L18  -  Wtap  Wilms' tumour 1-associating protein  Smok2b  sperm motility kinase 2B  Tcte2  t-complex-associated testis expressed 2  +  Smok4a  sperm motility kinase 4A  -  2700054A10Rik  +  Mllt4  RIKEN cDNA 2700054A10 gene myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4  5.91  6.5  7.36  7.9  14332590-14341101  -  Dact2  dapper homolog 2, antagonist of beta-catenin (xenopus)  14416542-14541771  +  10  Smoc2  SPARC related modular calcium binding 2  14805653-14831242  -  8.1  Thbs2  thrombospondin 2  14955679-15080129  -  Wdr27  WD repeat domain 27  15082014-15098237  -  Phf10  PHD finger protein 10  15504318-15513836  -  Dll1  delta-like 1 (Drosophila)  15533210-15570544  +  Fam120b  family with sequence similarity 120, member B  15612924-15635262  -  8.25  Psmb1  proteasome (prosome, macropain) subunit, beta type 1  15636852-15654391  +  8.254  Tbp  TATA box binding protein  15840976-15842227  -  5830433I10Rik  RIKEN cDNA 5830433I10 gene  15842254-15907328  +  Chd1  chromodomain helicase DNA binding protein 1  15943217-15963550  -  Rgmb  RGM domain family, member B  8.2  7.2  107  associated with disease development. However the region does contains a susceptibility locus to Type 1 diabetes (Idd23) [229]. The peak of the Idd locus is located at 8 cM, which could indicate a common autoimmune susceptibility locus. There are 57 genes located within the loci identified by A17.MCP7 and A17.MCP14 (Vam1). Of these, 35 contain known SNP differences between the susceptible A/J and resistant C57BL/6 mice [192] (Table 4.3). Within these genes, there are a few likely candidates for the susceptibility gene. Map3k4 (Mekk4), located at 12420487-12511526 bp, is part of the p38 pathway. Inhibition of p38 leads to a decrease in the viral replication in the heart and CB3-mediated heart damage [231]. Therefore, as MAP3K4 can initiate p38 activation it is possible that increased activity by this protein in susceptible mice could lead to increased viral replication in the susceptible hearts leading to increased heart damage. Further, expression of MAP3K4 plays a role in heart development [232], therefore aberrant expression of MAP3K4 during development could lead to increased susceptibility to heart disease later in life. Smoc2, located at 14416542-14541771 bp, is another promising candidate gene. SMOC2 is a matricellular calcium-binding glycoprotein that is thought to influence growth factor signaling, migration, proliferation, and angiogenesis. SNP differences within this gene have been associated with vitiligo as a result of autoimmune loss of melanocytes [233]. This gene is located in close vicinity of a susceptibility loci for type I diabetes and rheumatoid arthritis [233] as well as the Vam1 susceptibility region strongly suggesting a possible role for Smoc2 as a global autoimmune susceptibility gene. Overall, the close proximity of Vam1 and Vam3 to two distinct Idd loci highlights the possibility that these loci encode global autoimmune susceptibly genes. Further, as type I diabetes can be induced by coxsackievirus infection in NOD mice, these susceptibility loci may also be associated to coxsackievirus- or other pathogenmediated autoimmune disease. The susceptibility locus identified by A17.MCP22, Vam2, contains 69 genes with SNP differences between A/J and C57BL/6 mice [192] however, no genes have been previously associated with viral-induced chronic myocarditis (Table 4.4). This region does contain a T-type calcium channel, Cacna1h (Cav3.2). CAV3.2 is expressed in heart tissue, predominantly during development [234]. Mice deficient of this protein develop spontaneous focal myocardial lesions [235]. As C57BL/6 and A/J mice differ in this protein by two amino acids [192], it is possible that this may add to susceptibility 108  Table 4.3 Names and locations of the 69 genes located within Vam2 that have SNP difference between A/J and C57BL/6 mice The Vam2 susceptibility locus was identified by disease pathology in the A17.MCP22 strain. Gene and SNP locations were obtained from www.informatics.jax.org [192].  strand  cM position  25029098-25073913  -  10  Mapk8ip3  mitogen-activated protein kinase 8 interacting protein 3  25032061-25034447  +  Mrps34  mitochondrial ribosomal protein S34  25033445-25034467  +  Nme3  non-metastatic cells 3, protein expressed in  25079415-25097568  -  Hn1l  hematological and neurological expressed 1-like  bp coordinates  11  Gene symbol  Gene name  25098248-25152171  -  Cramp1l  Crm, cramped-like (Drosophila)  25153036-25236440  +  Ift140  intraflagellar transport 140 homolog (Chlamydomonas)  25194647-25218126  -  Tmem204  transmembrane protein 204  25236515-25252912  -  Telo2  TEL2, telomere maintenance 2, homolog (S. cerevisiae)  25257722-25262211  +  1110018H23Rik  RIKEN cDNA 1110018H23 gene  25270336-25299049  +  Clcn7  chloride channel 7  25299787-25308796  +  Ccdc154  coiled-coil domain containing 154  25321520-25322450  +  BC003965  cDNA sequence BC003965  25359527-25371387  +  Unkl  unkempt-like (Drosophila)  25371262-25377061  -  Gnptg  N-acetylglucosamine-1-phosphotransferase, gamma subunit  25377149-25379742  +  0610007P22Rik  RIKEN cDNA 0610007P22 gene  25379605-25389080  -  Baiap3  BAI1-associated protein 3  10  25397456-25410336  -  Ube2i  ubiquitin-conjugating enzyme E2I  25435339-25437106  +  10.44  Prss34  protease, serine, 34  25445591-25448821  +  10.43  Prss28  protease, serine, 28  25457228-25459625  +  10.42  Prss29  protease, serine, 29  25480190-25482507  -  10.4  Tpsab1  tryptase alpha/beta 1  25503278-25505037  +  10.39  Tpsb2  tryptase beta 2  25507597-25511385  +  10.38  Tpsg1  tryptase gamma 1  25511232-25570713  -  7.5  Cacna1h  calcium channel, voltage-dependent, T type, alpha 1H subunit  25608535-25613539  +  Tekt4  tektin 4  25626820-25634198  -  13  Sstr5  somatostatin receptor 5  25716122-25799771  +  11.5  Lmf1  lipase maturation factor 1  25923525-25927458  +  Ccdc78  coiled-coil domain containing 78  26063372-26081455  -  Pigq  phosphatidylinositol glycan anchor biosynthesis, class Q  26088417-26100555  +  D630044L22Rik  RIKEN cDNA gene D630044L22 gene  26096501-26102450  -  Solh  small optic lobes homolog (Drosophila)  26125981-26206354  -  Rab11fip3  RAB11 family interacting protein 3 (class II)  Decr2  2-4-dienoyl-Coenzyme A reductase 2, peroxisomal  Tmem8  transmembrane protein 8 (five membrane-spanning domains)  Axin1  axin 1  Itfg3  integrin alpha FG-GAP repeat containing 3  26218156-26227274  -  26250261-26260199  +  17.1  26275633-26332761  +  26348767-26381168  -  26389855-26422449  +  Luc7l  Luc7 homolog (S. cerevisiae)-like  26551910-26578740  +  Neurl1B  neuralized homolog 1B (Drosophila)  26580489-26583258  +  C230078M08Rik  RIKEN cDNA C230078M08 gene  26691199-26698444  -  1700049J03Rik  26698471-26792295  +  Ergic1  RIKEN cDNA 1700049J03 gene endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1  11.8 11.8  109  bp coordinates  strand  26852595-26913580  +  26975610-26978510  -  27054036-27069524  cM position  Gene symbol  Gene name  A930001N09Rik  RIKEN cDNA A930001N09 gene  Nkx2-5  NK2 transcription factor related, locus 5 (Drosophila)  +  Kifc1  kinesin family member C1  27110112-27113150  +  Zbtb9  zinc finger and BTB domain containing 9  27110162-27173323  +  Ggnbp1  gametogenetin binding protein 1  27156755-27165954  -  Bak1  BCL2-antagonist/killer 1  27194249-27259168  +  Itpr3  inositol 1,4,5-triphosphate receptor 3  27259608-27270861  -  2900010M23Rik  RIKEN cDNA 2900010M23 gene  27280914-27304709  -  Ip6k3  inositol hexaphosphate kinase 3  27326702-27340693  -  Lemd2  LEM domain containing 2  27559332-27650286  -  Grm4  glutamate receptor, metabotropic 4  27693565-27700619  +  Hmga1  high mobility group AT-hook 1  27700520-27702694  -  AI413582  expressed sequence AI413582  27716327-27760410  -  Nudt3  nudix (nucleotide diphosphate linked moiety X)-type motif 3  27767367-27773574  -  Rps10  ribosomal protein S10  27792454-27848051  +  Pacsin1  protein kinase C and casein kinase substrate in neurons 1  27851297-27865895  -  Spdef  SAM pointed domain containing ets transcription factor  27888177-27957503  -  D17Wsu92e  DNA segment, Chr 17, Wayne State University 92, expressed  27976919-27988913  +  Snrpc  U1 small nuclear ribonucleoprotein C  27993435-28036985  +  Uhrf1bp1  28038067-28046187  -  Taf11  UHRF1 (ICBP90) binding protein 1 TAF11 RNA polymerase II, TATA box binding protein (TBP)associated factor  28046285-28199545  +  Anks1  ankyrin repeat and SAM domain containing 1  28203692-28217584  -  Tcp11  t-complex protein 11  13  19  13.19  13  14.35  28211995-28213622  -  4930526A20Rik  RIKEN cDNA 4930526A20 gene  28279261-28311797  +  Scube3  signal peptide, CUB domain, EGF-like 3  28314152-28342831  +  Zfp523  zinc finger protein 523  28344723-28365553  +  Def6  differentially expressed in FDCP 6  28369711-28438414  +  Ppard  peroxisome proliferator activator receptor delta  13.5  110  to chronic disease development following viral infection in the heart. Further, differing expression of CAV3.2 during development may also lead to a difference in heart disease susceptibility later in life. The distal portion of chromosome also contains a final putative locus that confers susceptibility to autoimmune myocarditis (pVam4). This region was identified by the strain A17.M14 and is defined as the portion of chromosome 17 distal to 24.5 cM. This region does not exert as strong an influence on disease development as the A17.M14 mice developed weak disease pathology at a lower incidence than other congenic strains. C3, located at 34.4 cM, is contained within this locus and may be involved in the disease susceptibly as this gene has previously been linked with autoimmune myocarditis [196]. In summary, we have identified two novel major determinants for CB3-induced disease located within the first 16.4 cM of chromosome 17. Further, two additional determinants for viral-induced disease were identified. At least one locus, Vam3, was identified between 11.75 cM - 22.8 cM, which is the region encoding the MHC locus and another determinant (pVam4) was demonstrated within the distal portion of chromosome 17 (greater than 24.5 cM). The analysis of host genetic elements involved in susceptibility to autoimmune myocarditis in humans and mice is at an early stage of study and there have been only a few recent publications [187, 188, 225, 226]. These reports have neglected the contribution of chromosome 17 and herein, we identify a number of determinants of disease susceptibility within this chromosome. The wealth of potential loci involved in disease susceptibility illustrates the complexity of the host-pathogen relationship and the multiple factors involved in the induction of autoimmunity. As susceptibility alleles are identified, the potential for preventative and therapeutic interventions increases.  111  Table 4.4 Names and locations of the 258 genes located within Vam3 that have SNP difference between A/J and C57BL/6 mice The Vam3 susceptibility locus was identified by disease pathology in the A17.MCP12 strain. Gene and SNP locations were obtained from www.informatics.jax.org [192].  bp coordinates 26275633-26332761 26348767-26381168 26389855-26422449 26551910-26578740 26580489-26583258 26691199-26698444  strand + + + + -  26698471-26792295 26852595-26913580 26975610-26978510 27054036-27069524 27110112-27113150 27110162-27173323 27156755-27165954 27194249-27259168 27259608-27270861 27280914-27304709 27326702-27340693 27559332-27650286 27693565-27700619 27700520-27702694 27716327-27760410 27767367-27773574 27792454-27848051 27851297-27865895 27888177-27957503 27976919-27988913 27993435-28036985  + + + + + + + + + +  28038067-28046187 28046285-28199545 28203692-28217584 28211995-28213622 28279261-28311797 28314152-28342831 28344723-28365553 28369711-28438414 28450475-28463513 28468616-28487750 28536040-28654469 28724593-28759466 28774728-28826932 28828287-28885349 28906252-28915643 28938035-28975491 28995356-29027253 29033342-29052269 29042210-29043716 29071236-29079207 29088895-29106494 29107830-29144890 29169618-29180311  + + + + + + + + + + + + +  cM position 11.8 11.8  13  19  13.19  13  14.35  13.5 8.5 13 13.3 13.4 13.5  17 11  Gene symbol Axin1 Itfg3 Luc7l Neurl1B C230078M08Rik 1700049J03Rik Ergic1 A930001N09Rik Nkx2-5 Kifc1 Zbtb9 Ggnbp1 Bak1 Itpr3 2900010M23Rik Ip6k3 Lemd2 Grm4 Hmga1 AI413582 Nudt3 Rps10 Pacsin1 Spdef D17Wsu92e Snrpc Uhrf1bp1 Taf11 Anks1 Tcp11 4930526A20Rik Scube3 Zfp523 Def6 Ppard Fance Tead3 Fkbp5 Srpk1 Slc26a8 Mapk14 Mapk13 Brpf3 Pnpla1 4930539E08Rik 1700030A11Rik Pxt1 Kctd20 Stk38 Sfrs3  Gene name axin 1 integrin alpha FG-GAP repeat containing 3 Luc7 homolog (S. cerevisiae)-like neuralized homolog 1B (Drosophila) RIKEN cDNA C230078M08 gene RIKEN cDNA 1700049J03 gene endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 RIKEN cDNA A930001N09 gene NK2 transcription factor related, locus 5 (Drosophila) kinesin family member C1 zinc finger and BTB domain containing 9 gametogenetin binding protein 1 BCL2-antagonist/killer 1 inositol 1,4,5-triphosphate receptor 3 RIKEN cDNA 2900010M23 gene inositol hexaphosphate kinase 3 LEM domain containing 2 glutamate receptor, metabotropic 4 high mobility group AT-hook 1 expressed sequence AI413582 nudix (nucleotide diphosphate linked moiety X)-type motif 3 ribosomal protein S10 protein kinase C and casein kinase substrate in neurons 1 SAM pointed domain containing ets transcription factor DNA segment, Chr 17, Wayne State University 92, expressed U1 small nuclear ribonucleoprotein C UHRF1 (ICBP90) binding protein 1 TAF11 RNA polymerase II, TATA box binding protein (TBP)associated factor ankyrin repeat and SAM domain containing 1 t-complex protein 11 RIKEN cDNA 4930526A20 gene signal peptide, CUB domain, EGF-like 3 zinc finger protein 523 differentially expressed in FDCP 6 peroxisome proliferator activator receptor delta Fanconi anemia, complementation group E TEA domain family member 3 FK506 binding protein 5 serine/arginine-rich protein specific kinase 1 solute carrier family 26, member 8 mitogen-activated protein kinase 14 mitogen-activated protein kinase 13 bromodomain and PHD finger containing, 3 patatin-like phospholipase domain containing 1 RIKEN cDNA 4930539E08 gene RIKEN cDNA 1700030A11 gene peroxisomal, testis specific 1 potassium channel tetramerisation domain containing 20 serine/threonine kinase 38 splicing factor, arginine/serine-rich 3 (SRp20)  112  bp coordinates 29227924-29237667 29272001-29285925 29293495-29374742 29387748-29401103 29405733-29439826 29455822-29466358 29469017-29484849 29497859-29516605 29627757-29632390 29662971-29686538 29686747-29743751 29751776-29778604 29797546-29840304 29826323-29853957 29964903-30024827 30142032-30346964 30357046-30667310 30763936-31012209 31038812-31073455 31091628-31147655 31194643-31252722 31277994-31281227 31316217-31335920 31344818-31379147 31391969-31414252  strand + + + + + + + + + + + + + + + -  31433702-31487569 31523179-31613255 31720641-31744629 31749568-31774144 31784028-31795660 31814890-31818669 31981193-31992737 32081714-32171453 32173045-32199810 32257765-32303825 32320715-32326408 32333219-32421667 32440621-32458098 32458370-32483746 32491011-32526361 32527604-32540528 32550306-32561112 32589668-32630265 32643407-32665839 32673574-32688742 32822624-32840296 32910210-32924492 32933958-32937883 32952400-32959145 33016173-33023028 33042016-33054023 33061633-33084347 33102759-33116178 33130074-33142402 33153808-33170347 33202045-33204771 33226255-33243148 33272533-33276628 33405671-33406621 33466287-33495823 33517124-33531582 33570612-33571071  + + + + + + + + + + + + + +  33661169-33690421 33692664-33744703  + +  cM position 15.23  8 16.4  16.9 18 17 17  13.25  18 17.4 17.4 18.18  20 20  17.5  Gene symbol Cdkn1a Rab44 Cpne5 Ppil1 BC004004 Pi16 Mtch1 Fgd2 Pim1 Tmem217 Tbc1d22b Rnf8 Ftsjd2 1110021J02Rik Mdga1 Zfand3 Btbd9 Dnahc8 Glp1r Umodl1 Abcg1 Tff2 Tmprss3 Ubash3a Rsph1 Slc37a1 Pde9a Pknox1 Cbs U2af1 Cryaa Sik1 Hsf2bp Rrp1b Notch3 Ephx3 Brd4 Akap8 Akap8l Wiz Rasal3 Pglyrp2 Cyp4f39 Cyp4f17 Cyp4f16 Cyp4f15 Zfp871 Zfp811 Zfp799 Zfp870 Cyp4f14 Cyp4f13 Zfp472 C920016K16Rik Zfp763 4921501E09Rik Zfp563 Morc2b Olfr63 Zfp81 Zfp101 Actl9 Adamts10 Myo1f  Gene name cyclin-dependent kinase inhibitor 1A (P21) RAB44, member RAS oncogene family copine V peptidylprolyl isomerase (cyclophilin)-like 1 cDNA sequence BC004004 peptidase inhibitor 16 mitochondrial carrier homolog 1 (C. elegans) FYVE, RhoGEF and PH domain containing 2 proviral integration site 1 transmembrane protein 217 TBC1 domain family, member 22B ring finger protein 8 FtsJ methyltransferase domain containing 2 RIKEN cDNA 1110021J02 gene MAM domain containing glycosylphosphatidylinositol anchor 1 zinc finger, AN1-type domain 3 BTB (POZ) domain containing 9 dynein, axonemal, heavy chain 8 glucagon-like peptide 1 receptor uromodulin-like 1 ATP-binding cassette, sub-family G (WHITE), member 1 trefoil factor 2 (spasmolytic protein 1) transmembrane protease, serine 3 ubiquitin associated and SH3 domain containing, A radial spoke head 1 homolog (Chlamydomonas) solute carrier family 37 (glycerol-3-phosphate transporter), member 1 phosphodiesterase 9A Pbx/knotted 1 homeobox cystathionine beta-synthase U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1 crystallin, alpha A salt inducible kinase 1 heat shock transcription factor 2 binding protein ribosomal RNA processing 1 homolog B (S. cerevisiae) Notch gene homolog 3 (Drosophila) epoxide hydrolase 3 bromodomain containing 4 A kinase (PRKA) anchor protein 8 A kinase (PRKA) anchor protein 8-like widely-interspaced zinc finger motifs RAS protein activator like 3 peptidoglycan recognition protein 2 cytochrome P450, family 4, subfamily f, polypeptide 39 cytochrome P450, family 4, subfamily f, polypeptide 17 cytochrome P450, family 4, subfamily f, polypeptide 16 cytochrome P450, family 4, subfamily f, polypeptide 15 zinc finger protein 871 zinc finger protein 811 zinc finger protein 799 zinc finger protein 870 cytochrome P450, family 4, subfamily f, polypeptide 14 cytochrome P450, family 4, subfamily f, polypeptide 13 zinc finger protein 472 RIKEN cDNA C920016K16 gene zinc finger protein 763 RIKEN cDNA 4921501E09 gene zinc finger protein 563 microrchidia 2B olfactory receptor 63 zinc finger protein 81 zinc finger protein 101 actin-like 9 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 10 myosin IF  113  cM position  bp coordinates 33766047-33768656 33775085-33782651 33783178-33823805 33825041-33855598 33883543-33897242 33911845-33918451  strand + + -  33961559-33975258 34045128-34046123  + -  Ndufa7 BC051226  33961559-33975258 34045128-34046123 34046463-34052461 34053174-34056270 34056423-34066235 34066840-34074628 34075868-34077250 34077668-34086639  + + + + + +  Ndufa7 BC051226 Daxx Zbtb22 Tapbp Rgl2 H2-Ke2 Wdr46  34087092-34088207 34088944-34092586 34092827-34103433 34132973-34137229 34158029-34161588 34162980-34165002 34165218-34168510 34168943-34175338 34176382-34203630 34248964-34259262 34272594-34276027 34282258-34288498 34290136-34297174  + + + + + +  34319044-34324275 34324825-34333744  18.3  17 18.41 18.41  Gene symbol Zfp414 Pram1 Hnrnpm March2 Rab11b Angptl4  18.48 18.48 18.49 18.51 18.53 18.56 18.57 18.58  B3galt4 Rps18 Vps52 H2-K1 Ring1 H2-Ke6 Slc39a7 Rxrb Col11a2 Brd2 H2-DMa H2-DMb2 H2-DMb1  +  18.59 18.6  Psmb9 Tap1  34335344-34338211 34341025-34353266 34375850-34382853 34442843-34453144 34462610-34477174 34479878-34481588 34491767-34506438 34514077-34522973 34535765-34597679 34605987-34612882 34669822-34684585 34701213-34725448 34729416-34734286 34734807-34737877 34738044-34740506  + + + + + + + + + + + -  18.61 18.62 18.63 18.66 18.67 18.7 18.7 18.7  Psmb8 Tap2 H2-Ob H2-Eb1 H2-Eb2 H2-Ea Btnl2 Btnl1 BC051142 Btn3a3 Btnl7 Notch4 Pbx2 Ager Rnf5  34745959-34750394 34750305-34752916 34753607-34764042 34766505-34770071 34784156-34792017 34807480-34856572 34865332-34880828 34938725-34941344 34946039-34960399 34960938-34973890 34974028-34976175 34976197-34987137 34987355-34993314 34993319-34999463 34993357-35032492  + + + + + + -  18.7 18.8 18.9  18.42 18.44  18.7 18.72  18.75  18.85 18.74 18.8 18.77 18.83  18.84 18.85 18.86  Agpat1 Egfl8 Ppt2 Prrt1 Atf6b Tnxb C4b Cyp21a1 C4a Stk19 Dom3z Skiv2l Rdbp Cfb C2  Gene name zinc finger protein 414 PML-RAR alpha-regulated adaptor molecule 1 heterogeneous nuclear ribonucleoprotein M membrane-associated ring finger (C3HC4) 2 RAB11B, member RAS oncogene family angiopoietin-like 4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7 (B14.5a) cDNA sequence BC051226 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7 (B14.5a) cDNA sequence BC051226 Fas death domain-associated protein zinc finger and BTB domain containing 22 TAP binding protein ral guanine nucleotide dissociation stimulator-like 2 H2-K region expressed gene 2 WD repeat domain 46 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4 ribosomal protein S18 vacuolar protein sorting 52 (yeast) histocompatibility 2, K1, K region ring finger protein 1 H2-K region expressed gene 6 solute carrier family 39 (zinc transporter), member 7 retinoid X receptor beta collagen, type XI, alpha 2 bromodomain containing 2 histocompatibility 2, class II, locus DMa histocompatibility 2, class II, locus Mb2 histocompatibility 2, class II, locus Mb1 proteasome (prosome, macropain) subunit, beta type 9 (large multifunctional peptidase 2) transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) proteasome (prosome, macropain) subunit, beta type 8 (large multifunctional peptidase 7) transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) histocompatibility 2, O region beta locus histocompatibility 2, class II antigen E beta histocompatibility 2, class II antigen E beta2 histocompatibility 2, class II antigen E alpha butyrophilin-like 2 butyrophilin-like 1 cDNA sequence BC051142 butyrophilin, subfamily 3, member A3 butyrophilin-like 7 Notch gene homolog 4 (Drosophila) pre B-cell leukemia transcription factor 2 advanced glycosylation end product-specific receptor ring finger protein 5 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) EGF-like domain 8 palmitoyl-protein thioesterase 2 proline-rich transmembrane protein 1 activating transcription factor 6 beta tenascin XB complement component 4B (Childo blood group) cytochrome P450, family 21, subfamily a, polypeptide 1 complement component 4A (Rodgers blood group) serine/threonine kinase 19 DOM-3 homolog Z (C. elegans) superkiller viralicidic activity 2-like (S. cerevisiae) RD RNA-binding protein complement factor B complement component 2 (within H-2S)  114  bp coordinates 35035414-35050997 35162922-35164861 35165550-35183567 35187377-35195665 35196046-35199040 35199638-35203129 35204270-35206993 35208293-35211409 35213887-35215749 35217425-35222555 35226239-35239698 35245245-35248898 35250889-35252345 35253144-35258181 35265942-35268697 35272187-35284181 35286021-35299993 35307937-35310223 35322040-35325384 35331467-35333247 35336335-35338941 35340108-35342128  strand + + + + + + + + + -  35357120-35372737 35370605-35375712 35378815-35390628 35400039-35404440 35457507-35462364 35516564-35521594 35516576-35521559 35531044-35532577 35643007-35647714 35650626-35653731 35654121-35667950 35670214-35671590 35689073-35694125 35704430-35705890 35772700-35780640 35818512-35841566 35958658-35959856 35960302-35969732 35970871-35975251 35981380-35996614 35997863-36003831 35998291-36002344 36002538-36012541 36016764-36029611 36029622-36034376 36034540-36047020 36047330-36053314 36053379-36069217 36093767-36106695 36109486-36117181 36116900-36126407 36142640-36157505 36216993-36221404 36216993-36221404 36292064-36292354 36322516-36327096 36322518-36327232 36392618-36394788 36395818-36408949 36421224-36423385 36459803-36463100 36501950-36505361 36595862-36599279  + + + + + + + + + + + + + + + + + + + + + -  cM position 18.87 18.9 19  19.01  19.02 19.03 19.04 19.05 19.06 19.061 19.06 19.059 19 19.12 19.09 19.14 19.16 19.2 19.23  21.5  20.5 20.5 19.72 19.72 19 19.91 19.78 20.03  20.2 19.84 20.295 20.2  Gene symbol Ehmt2 Ng23 Msh5 Clic1 Ddah2 AU023871 Ly6g6c Ly6g6d Ly6g6e Ly6g6f Bat5 Ly6g5c Ly6g5b Csnk2b Apom Bat3 Bat2 Aif1 Lst1 Ltb Tnf Lta Nfkbil1 Atp6v1g2 Bat1a H2-D1 H2-Q1 H2-gs10 H2-Q4 H2-Q8 Pou5f1 Tcf19 Cchcr1 Psors1c2 Cdsn 2300002M23Rik Dpcr1 Ddr1 Ier3 Flot1 Tubb5 Mdc1 5530401N12Rik Nrm 2310014H01Rik Dhx16 2310061I04Rik 2610110G12Rik Mrps18b Ppp1r10 Abcf1 Prr3 Gnal1 H2-T24 H2-Bl H2-T13 2410017I17Rik H2-T18 H2-T3 Rpp21 Trim39 H2-M10.2 H2-M10.1 H2-M10.3 H2-M10.4  Gene name euchromatic histone lysine N-methyltransferase 2 Ng23 protein mutS homolog 5 (E. coli) chloride intracellular channel 1 dimethylarginine dimethylaminohydrolase 2 expressed sequence AU023871 lymphocyte antigen 6 complex, locus G6C lymphocyte antigen 6 complex, locus G6D lymphocyte antigen 6 complex, locus G6E lymphocyte antigen 6 complex, locus G6F HLA-B associated transcript 5 lymphocyte antigen 6 complex, locus G5C lymphocyte antigen 6 complex, locus G5B casein kinase 2, beta polypeptide apolipoprotein M HLA-B-associated transcript 3 HLA-B associated transcript 2 allograft inflammatory factor 1 leukocyte specific transcript 1 lymphotoxin B tumor necrosis factor lymphotoxin A nuclear factor of kappa light polypeptide gene enhancer in Bcells inhibitor-like 1 ATPase, H+ transporting, lysosomal V1 subunit G2 HLA-B-associated transcript 1A histocompatibility 2, D region locus 1 histocompatibility 2, Q region locus 1 MHC class I like protein GS10 histocompatibility 2, Q region locus 4 histocompatibility 2, Q region locus 8 POU domain, class 5, transcription factor 1 transcription factor 19 coiled-coil alpha-helical rod protein 1 psoriasis susceptibility 1 candidate 2 (human) corneodesmosin RIKEN cDNA 2300002M23 gene diffuse panbronchiolitis critical region 1 (human) discoidin domain receptor family, member 1 immediate early response 3 flotillin 1 tubulin, beta 5 mediator of DNA damage checkpoint 1 RIKEN cDNA 5530401N12 gene nurim (nuclear envelope membrane protein) RIKEN cDNA 2310014H01 gene DEAH (Asp-Glu-Ala-His) box polypeptide 16 RIKEN cDNA 2310061I04 gene RIKEN cDNA 2610110G12 gene mitochondrial ribosomal protein S18B protein phosphatase 1, regulatory subunit 10 ATP-binding cassette, sub-family F (GCN20), member 1 proline-rich polypeptide 3 guanine nucleotide binding protein-like 1 histocompatibility 2, T region locus 24 histocompatibility 2, blastocyst histocompatibility 2, T region locus 13 RIKEN cDNA 2410017I17 gene histocompatibility 2, T region locus 18 histocompatibility 2, T region locus 3 ribonuclease P 21 subunit (human) tripartite motif-containing 39 histocompatibility 2, M region locus 10.2 histocompatibility 2, M region locus 10.1 histocompatibility 2, M region locus 10.3 histocompatibility 2, M region locus 10.4  115  bp coordinates 36684020-36686199 36777351-36779611 36806953-36809164 36909855-36913179 36949116-36952509 36974079-36996343 36997636-37004132 37006537-37014750 37018543-37026990 37035075-37047162 37086236-37088619 37091303-37095373 37095537-37102567 37147691-37160343 37183016-37210377 37229901-37230817 37248006-37248925 37287977-37288915 37399678-37400607 37436439-37437365  strand + + + + + + + + -  cM position 20.27 20.23 20.3 20.4  19.86  20.34 20.4  Gene symbol H2-M11 H2-M9 H2-M1 H2-M10.5 H2-M10.6 Trim26 Trim15 Trim10 Trim40 Trim31 Ppp1r11 Znrd1 1700022C21Rik Mog Gabbr1 Olfr91 Olfr92 Olfr93 Olfr98 Olfr101  Gene name histocompatibility 2, M region locus 11 histocompatibility 2, M region locus 9 histocompatibility 2, M region locus 1 histocompatibility 2, M region locus 10.5 histocompatibility 2, M region locus 10.6 tripartite motif-containing 26 tripartite motif-containing 15 tripartite motif-containing 10 tripartite motif-containing 40 tripartite motif-containing 31 protein phosphatase 1, regulatory (inhibitor) subunit 11 zinc ribbon domain containing, 1 RIKEN cDNA 1700022C21 gene myelin oligodendrocyte glycoprotein gamma-aminobutyric acid (GABA) B receptor, 1 olfactory receptor 91 olfactory receptor 92 olfactory receptor 93 olfactory receptor 98 olfactory receptor 101  116  5  Identification and Characterization of Susceptibility Genes for Viral-Induced Autoimmune Myocarditis  117  5.1  Introduction The identification of susceptibility genes for virus-induced chronic myocarditis  and dilated cardiomyopathy is a field still in its infancy. Identification of virus-induced myocarditis susceptibility genes will allow patients to be identified as susceptible to heart disease and be more efficiently monitored for disease progression. With identification of early onset patients, treatment could be started at the initiation of disease and thus limit the damage to the patient and stop or slow disease progression to dilated cardiomyopathy. Further, better identification of patients with increased susceptibility could lead to the practical development and use of a vaccine to reduce the development of myocarditis later in life. We have previously used chromosome substitution strain (CSS) mice to identify loci conferring susceptibility to coxsackievirus-induced chronic myocarditis [236]. CSS mice are a unique and powerful resource that allow the investigator to quickly identify genetic determinants associated with disease. The CSS mice we analyzed contain one chromosome from the disease susceptible A/J strain on an otherwise resistant C57BL/6 background. Using these mice and mice congenic for smaller segments of chromosome 17, we identified four susceptibility loci on chromosome 17 [236]. Two of these loci, Vam1 and Vam2, are novel in disease association and located in the proximal portion of the chromosome. The two loci encompass 35 and 69 possible susceptibly genes, respectively. A third locus, Vam3, encodes a number of genes associated with disease susceptibility including the MHC locus. Characterization of the expression and function of candidate genes within the disease-associated loci will allow us to identify the true susceptibility gene and determine how the gene influences susceptibility. Herein, we investigated potential susceptibility genes located in Vam1 and Vam2. Vam1 contains the potential susceptibility gene insulin-like growth factor 2 receptor. Vam2 contains the gene Cacna1h, a T-type calcium channel expressed in the heart, which is a strong candidate for a susceptibility gene.  118  5.2  Results  5.2.1 A number of genes within Vam1, Vam2 and Vam3 are differentially expressed following coxsackievirus infection in A/J mice To aid in the identification of the susceptibility genes, we compared microarray data from A/J mice to identify chromosome 17 genes differentially expressed during the disease course. Gene expression of cardiac tissue at days 3, 9 and 30 post coxsackievirus infection was compared to uninfected control tissue (Table 5.1 and Table 5.2 and Table 5.3). This data was previously published [168]; however, we reanalyzed the data to identify chromosome 17 genes with a 2-fold increase or decrease in expression. These genes were considered for their potential as susceptibility genes. Of the three regions, Vam3 had the most genes differentially expressed at days 3, 9 and 30 PI (Table 5.1 and Table 5.2 and Table 5.3). This finding was expected as Vam3 contains the MHC, Tnf and complement component 4 loci. MHC and TNFα have been linked with myocarditis susceptibility and development [111, 113, 184] therefore these genes are likely our disease susceptibility genes. However, other genes within the Vam3 region may be influencing disease susceptibility. In the Vam1 region, three genes were differentially expressed at day 9 PI while no genes from this locus were differentially expressed at days 3 or 30 PI (Table 5.1 and Table 5.2 and Table 5.3). The genes differentially expressed in this region were mitochondrial ribosomal protein L18 (Mrpl18), SPARC related modular calcium binding 2 (Smoc2) and chromodomain helicase DNA binding protein 1 (Chd1). Mrpl18 and Smoc2 were decreased in expression while Chd1 was increased. Two genes within the Vam2 region were differentially expressed post coxsackievirus infection (Table 5.1 and Table 5.2 and Table 5.3). Non-metastatic cells 4 (Nme4) and mitochondrial ribosomal protein L28 (Mrpl28) were decreased in expression on day 9 PI and Nme4 expression remained decreased at day 30 PI. Neither of the genes contain SNP differences between A/J and C57BL/6 mice [236] suggesting that these are not our susceptibility genes.  119  Table 5.1 Chromosome 17 genes differentially expressed in the hearts of A/J mice at day 3 PI 30 genes in Vam3 were differentially expressed at 3 days PI in A/J mice compared to uninfected controls. Genes highlighted in blue are located within the Vam3 locus.  120  Gene Name  Chromosome  bp location  94297_at  chr17  28536040  Fkbp5  FK506 binding protein 5  3.0  94881_at  chr17  29227924  Cdkn1a  cyclin-dependent kinase inhibitor 1A (P21)  4.5  98067_at  chr17  29227924  Cdkn1a  cyclin-dependent kinase inhibitor 1A (P21)  6.6  98049_at  chr17  29686744  1300018I05Rik  RIKEN cDNA 1300018I05 gene  2.7  96125_at  chr17  34046463  Daxx  Fas death domain-associated protein  2.7  100154_at  chr17  34056423  Tapbp  TAP binding protein  1.9  93714_f_at  chr17  34112135  Gm7035  predicted gene 7035 predicted gene 7035 /// histocompatibility 2, D region locus 1 /// histocompatibility 2, K1, K region /// histocompatibility 2, D region /// histocompatibility 2, Q region locus 2 /// histocompatibility 2, T region locus 17 /// histocompatibility 2, T region locus 22 /// histocompatibility 2, T region locus 23 /// MHC class Ib T9 /// similar to MHC class I antigen precursor /// similar to H-2 class I histocompatibility antigen, L-D alpha chain precursor predicted gene 7035 /// histocompatibility 2, Q region locus 1 /// histocompatibility 2, Q region locus 2  1.7  Gene Symbol  Gene Title  log2 (Fold Change)  102161_f_at  chr17  34112135  97173_f_at  chr17  34112135  Gm7035 /// H2-D1 /// H2K1 /// H2-L /// H2-Q2 /// H2T17 /// H2-T22 /// H2-T23 /// H2-t9 /// LOC547349 /// LOC676708 Gm7035 /// H2-Q1 /// H2Q2  97125_f_at  chr17  34132973  H2-K1  histocompatibility 2, K1, K region  1.6  93120_f_at  chr17  34132973  H2-K1  1.9  93085_at  chr17  34319044  Psmb9  103035_at  chr17  34324825  Tap1  102791_at  chr17  34335344  Psmb8  102873_at  chr17  34341025  Tap2  histocompatibility 2, K1, K region proteasome (prosome, macropain) subunit, beta type 9 (large multifunctional peptidase 2) transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) proteasome (prosome, macropain) subunit, beta type 8 (large multifunctional peptidase 7) transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)  92866_at  chr17  34419696  H2-Aa  histocompatibility 2, class II antigen A, alpha  -2.9  94285_at  chr17  34442843  H2-Eb1  -2.8  103033_at  chr17 /// chr17  34946037  C4a /// C4b  histocompatibility 2, class II antigen E beta complement component 4A (Rodgers blood group) /// complement component 4B (Childo blood group)  93875_at  chr17 /// chr17  35106945  Hspa1a  heat shock protein 1A  2.2  97540_f_at  chr17  35400039  H2-D1  histocompatibility 2, D region locus 1  1.9  101886_f_at  chr17  35400039  chr17  35400039  histocompatibility 2, D region locus 1 histocompatibility 2, D region locus 1 /// histocompatibility 2, K1, K region /// similar to H-2K(d) antigen  2.6  97541_f_at  H2-D1 H2-D1 /// H2-K1 /// LOC100044874  99378_f_at  chr17  35516564  H2-gs10  MHC class I like protein GS10  2.4  98438_f_at  chr17 /// chr17  35576161  H2-Q7  2.4  98472_at  chr17  36166921  C920025E04Rik /// H2-T23  histocompatibility 2, Q region locus 7 RIKEN cDNA C920025E04 gene /// histocompatibility 2, T region locus 23  101681_f_at  chr17  36216993  H2-Bl  1.1  93865_s_at  chr17  36254035  H2-T10 /// H2-T17 /// H2T22 /// H2-T9  101876_s_at  chr17  36254035  H2-T10 /// H2-T17 /// H2T22 /// H2-T9  histocompatibility 2, blastocyst histocompatibility 2, T region locus 10 /// histocompatibility 2, T region locus 17 /// histocompatibility 2, T region locus 22 /// histocompatibility 2, T region locus 9 histocompatibility 2, T region locus 10 /// histocompatibility 2, T region locus 17 /// histocompatibility 2, T region locus 22 /// histocompatibility 2, T region locus 9  102731_g_at  chr17  37407179  H2-M3  histocompatibility 2, M region locus 3  2.2  104333_at  chr17  D17H6S56E-5  DNA segment, Chr 17, human D6S56E 5  5.1  97420_at  chr17  56259103  Lrg1  leucine-rich alpha-2-glycoprotein 1  1.8  93497_at  chr17  57343397  C3  complement component 3  2.2  97950_at  chr17  74233248  Xdh  xanthine dehydrogenase  3.1  93672_at  chr17  79251904  Eif2ak2  eukaryotic translation initiation factor 2-alpha kinase 2  4.0  99979_at  chr17  80106293  Cyp1b1  cytochrome P450, family 1, subfamily b, polypeptide 1  2.3  98822_at  chr17 /// chr4  155573589  Isg15  ISG15 ubiquitin-like modifier  7.7  161511_f_at  chr17 /// chr4  155573589  Gm9706 /// Isg15  8.7  99379_f_at  chr17  predicted gene 9706 /// ISG15 ubiquitin-like modifier similar to H-2 class I histocompatibility antigen, L-D alpha chain precursor  LOC676689  2.8 4.9  3.8 6.8 4.3 3.1  4.2  3.0  3.5  3.5 4.4  1.9  121  Table 5.2 Chromosome 17 genes differentially expressed in the hearts of A/J mice at day 9 PI 3 genes in Vam1, 2 genes in Vam2 and 39 genes in Vam3 were differentially expressed at 9 days PI in A/J mice compared to uninfected controls. Genes highlighted in yellow are located within the Vam1 locus. Genes highlighted in orange are located within the Vam2 locus. Genes highlighted in blue are located within the Vam3 locus.  GeneName 97962_at 98007_at  Chromosome chr17 chr17  bp location 5941280 7374464  93786_i_at 96926_at 101459_at 160473_at 96652_at 94297_at 94881_at 98067_at 104533_at 98049_at 97874_at 96125_at 100154_at 93714_f_at  chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17  13104215 14416542 15842254 26228679 26260465 28536040 29227924 29227924 29627757 29686744 31657120 34046463 34056423 34112135  97173_f_at  chr17  34112135  Gm13675 /// Mrpl18 Smoc2 Chd1 Nme4 Mrpl28 Fkbp5 Cdkn1a Cdkn1a Pim1 1300018I05Rik Ndufv3 Daxx Tapbp Gm7035 Gm7035 /// H2-Q1 /// H2-Q2  Gene Symbol Synj2 Rps6ka2  102161_f_at 97125_f_at 93120_f_at  chr17 chr17 chr17  34112135 34132973 34132973  Gm7035 /// H2-D1 /// H2-K1 /// H2-L /// H2Q2 /// H2-T17 /// H2T22 /// H2-T23 /// H2-t9 /// LOC547349 /// LOC676708 H2-K1 H2-K1  93085_at  chr17  34319044  Psmb9  103035_at  chr17  34324825  Tap1  102791_at  chr17  34335344  Psmb8  102873_at 92866_at 99613_at 94285_at  chr17 chr17 chr17 chr17  34341025 34419696 34419696 34442843  Tap2 H2-Aa Mut H2-Eb1  103033_at 93875_at 92887_at 93921_at 102940_at 97540_f_at 101886_f_at  chr17 /// chr17 chr17 /// chr17 chr17 chr17 chr17 chr17 chr17  34946037 35106945 35196046 35272187 35331467 35400039 35400039  97541_f_at 99378_f_at  chr17 chr17  35400039 35516564  C4a /// C4b Hspa1a Ddah2 Bat3 Ltb H2-D1 H2-D1 H2-D1 /// H2-K1 /// LOC100044874 H2-gs10  Gene Title synaptojanin 2 ribosomal protein S6 kinase, polypeptide 2 predicted gene 13675 /// mitochondrial ribosomal protein L18 SPARC related modular calcium binding 2 chromodomain helicase DNA binding protein 1 non-metastatic cells 4, protein expressed in mitochondrial ribosomal protein L28 FK506 binding protein 5 cyclin-dependent kinase inhibitor 1A (P21) cyclin-dependent kinase inhibitor 1A (P21) proviral integration site 1 RIKEN cDNA 1300018I05 gene NADH dehydrogenase (ubiquinone) flavoprotein 3 Fas death domain-associated protein TAP binding protein predicted gene 7035 predicted gene 7035 /// histocompatibility 2, Q region locus 1 /// histocompatibility 2, Q region locus 2 predicted gene 7035 /// histocompatibility 2, D region locus 1 /// histocompatibility 2, K1, K region /// histocompatibility 2, D region /// histocompatibility 2, Q region locus 2 /// histocompatibility 2, T region locus 17 /// histocompatibility 2, T region locus 22 /// histocompatibility 2, T region locus 23 /// MHC class Ib T9 /// similar to MHC class I antigen precursor /// similar to H-2 class I histocompatibility antigen, L-D alpha chain precursor histocompatibility 2, K1, K region histocompatibility 2, K1, K region proteasome (prosome, macropain) subunit, beta type 9 (large multifunctional peptidase 2) transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) proteasome (prosome, macropain) subunit, beta type 8 (large multifunctional peptidase 7) transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) histocompatibility 2, class II antigen A, alpha methylmalonyl-Coenzyme A mutase histocompatibility 2, class II antigen E beta complement component 4A (Rodgers blood group) /// complement component 4B (Childo blood group) heat shock protein 1A dimethylarginine dimethylaminohydrolase 2 HLA-B-associated transcript 3 lymphotoxin B histocompatibility 2, D region locus 1 histocompatibility 2, D region locus 1 histocompatibility 2, D region locus 1 /// histocompatibility 2, K1, K region /// similar to H-2K(d) antigen MHC class I like protein GS10  log2 (Fold Change) -2.2 -3.6 -1.2 -1.5 1.3 -1.1 -1.8 3.6 4.5 7.2 1.3 1.7 -1.1 1.8 2.5 1.3 2.5  2.9 1.5 1.7 4.2 7.1 4.8 2.2 -1.9 -1.9 -1.4 4.5 2.6 -1.4 -3.0 1.6 1.9 2.5 3.6 2.9  122  GeneName 98438_f_at 94788_f_at  Chromosome chr17 /// chr17 chr17  bp location 35576161 35970871  95159_at  chr17 /// chr2  36047330  98472_at 101681_f_at  chr17 chr17  36166921 36216993  Gm13552 /// Mrps18b C920025E04Rik /// H2T23 H2-Bl  93865_s_at  chr17  36254035  H2-T10 /// H2-T17 /// H2-T22 /// H2-T9  101876_s_at 100720_at 102731_g_at 104333_at 103520_at 161511_f_at  chr17 chr17 chr17 chr17 chr17 chr17 /// chr4  36254035 36525416 37407179 46153942 46543872  H2-T10 /// H2-T17 /// H2-T22 /// H2-T9 Pabpc1 H2-M3 D17H6S56E-5 Vegfa Gm9706 /// Isg15  96146_at 160480_at 93497_at 96811_at 92309_i_at 101502_at 97950_at 103752_r_at 93672_at 99979_at 160273_at 104212_at  chr17 /// chr16 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17  50837846 56551854 57343397 66001069 67016883 71193545 74233248 79049253 79251904 80106293 84583271 85104587  Btg3 /// Gm7334 Ptprs C3 Rab31 Ptprm Tgif1 Xdh Strn Eif2ak2 Cyp1b1 Zfp36l2 Lrpprc  101837_g_at 102698_at 100033_at 98822_at  chr17 /// chr1 chr17 chr17 chr17 /// chr4  85357355 87153482 88071912 155573589  99379_f_at  chr17  Gene Symbol H2-Q7 Tubb5  Ppm1b Epas1 Msh2 Isg15 LOC676689  Gene Title histocompatibility 2, Q region locus 7 tubulin, beta 5 predicted gene 13552 /// mitochondrial ribosomal protein S18B RIKEN cDNA C920025E04 gene /// histocompatibility 2, T region locus 23 histocompatibility 2, blastocyst histocompatibility 2, T region locus 10 /// histocompatibility 2, T region locus 17 /// histocompatibility 2, T region locus 22 /// histocompatibility 2, T region locus 9 histocompatibility 2, T region locus 10 /// histocompatibility 2, T region locus 17 /// histocompatibility 2, T region locus 22 /// histocompatibility 2, T region locus 9 poly(A) binding protein, cytoplasmic 1 histocompatibility 2, M region locus 3 DNA segment, Chr 17, human D6S56E 5 vascular endothelial growth factor A predicted gene 9706 /// ISG15 ubiquitin-like modifier B-cell translocation gene 3 /// B-cell translocation gene 3 pseudogene protein tyrosine phosphatase, receptor type, S complement component 3 RAB31, member RAS oncogene family protein tyrosine phosphatase, receptor type, M TGFB-induced factor homeobox 1 xanthine dehydrogenase striatin, calmodulin binding protein eukaryotic translation initiation factor 2-alpha kinase 2 cytochrome P450, family 1, subfamily b, polypeptide 1 zinc finger protein 36, C3H type-like 2 leucine-rich PPR-motif containing protein phosphatase 1B, magnesium dependent, beta isoform endothelial PAS domain protein 1 mutS homolog 2 (E. coli) ISG15 ubiquitin-like modifier similar to H-2 class I histocompatibility antigen, L-D alpha chain precursor  log2 (Fold Change) 2.4 1.2 1.1 3.5 1.0 4.0 5.6 1.2 3.0 1.6 -1.8 8.0 1.8 -2.3 3.2 1.0 -3.2 2.8 3.6 3.5 2.5 5.0 1.8 -1.7 -1.4 -1.7 -2.2 7.3 2.5  123  Table 5.3 Chromosome 17 genes differentially expressed in the hearts of A/J mice at day 30 PI One gene in Vam2 and 28 genes in Vam3 were differentially expressed at 30 days PI in A/J mice compared to uninfected controls. Genes highlighted in orange are located within the Vam2 locus. Genes highlighted in blue are located within the Vam3 locus.  124  GeneName  Chromosome  bp location  160473_at  chr17  26228679  Nme4  non-metastatic cells 4, protein expressed in  94297_at  chr17  28536040  Fkbp5  FK506 binding protein 5  1.2  97874_at  chr17  31657120  Ndufv3  NADH dehydrogenase (ubiquinone) flavoprotein 3  -1.1  102689_at  chr17  34056423  Tapbp  TAP binding protein  2.0  93714_f_at  chr17  34112135  Gm7035  2.1  97173_f_at  chr17  34112135  Gm7035 /// H2-Q1 /// H2-Q2  predicted gene 7035 predicted gene 7035 /// histocompatibility 2, Q region locus 1 /// histocompatibility 2, Q region locus 2  97125_f_at  chr17  34132973  H2-K1  histocompatibility 2, K1, K region  2.3  93120_f_at  chr17  34132973  H2-K1  histocompatibility 2, K1, K region  2.3  98035_g_at  chr17  34290136  H2-DMb1  2.7  93085_at  chr17  34319044  Psmb9  103035_at  chr17  34324825  Tap1  102791_at  chr17  34335344  Psmb8  102873_at  chr17  34341025  Tap2  histocompatibility 2, class II, locus Mb1 proteasome (prosome, macropain) subunit, beta type 9 (large multifunctional peptidase 2) transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) proteasome (prosome, macropain) subunit, beta type 8 (large multifunctional peptidase 7) transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)  100998_at  chr17  34400185  H2-Ab1  histocompatibility 2, class II antigen A, beta 1  4.6  92866_at  chr17  34419696  H2-Aa  histocompatibility 2, class II antigen A, alpha  7.1  94285_at  chr17  34442843  H2-Eb1  5.7  103033_at  chr17 /// chr17  34946037  C4a /// C4b  histocompatibility 2, class II antigen E beta complement component 4A (Rodgers blood group) /// complement component 4B (Childo blood group)  97540_f_at  chr17  35400039  H2-D1  histocompatibility 2, D region locus 1 predicted gene 7035 /// histocompatibility 2, D region locus 1 /// histocompatibility 2, K1, K region /// histocompatibility 2, D region /// histocompatibility 2, Q region locus 2 /// histocompatibility 2, T region locus 17 /// histocompatibility 2, T region locus 22 /// histocompatibility 2, T region locus 23 /// MHC class Ib T9 /// similar to MHC class I antigen precursor /// similar to H-2 class I histocompatibility antigen, L-D alpha chain precursor  2.3  2.8  Gene Symbol  Gene Title  log2 (Fold Change) -1.0  5.8  3.2 4.8 3.2 1.4  5.8  102161_f_at  chr17  35400039  Gm7035 /// H2-D1 /// H2-K1 /// H2-L /// H2Q2 /// H2-T17 /// H2T22 /// H2-T23 /// H2-t9 /// LOC547349 /// LOC676708  101886_f_at  chr17  35400039  H2-D1  97541_f_at  chr17  35400039  H2-D1 /// H2-K1 /// LOC100044874  histocompatibility 2, D region locus 1 histocompatibility 2, D region locus 1 /// histocompatibility 2, K1, K region /// similar to H2K(d) antigen  99378_f_at  chr17  35516564  H2-gs10  MHC class I like protein GS10  3.1  98438_f_at  chr17 /// chr17  35576161  chr17  36166921  histocompatibility 2, Q region locus 7 RIKEN cDNA C920025E04 gene /// histocompatibility 2, T region locus 23  2.9  98472_at  H2-Q7 C920025E04Rik /// H2T23  101681_f_at  chr17  36216993  H2-Bl  1.3  93865_s_at  chr17  36254035  H2-T10 /// H2-T17 /// H2-T22 /// H2-T9  101876_s_at  chr17  36254035  H2-T10 /// H2-T17 /// H2-T22 /// H2-T9  histocompatibility 2, blastocyst histocompatibility 2, T region locus 10 /// histocompatibility 2, T region locus 17 /// histocompatibility 2, T region locus 22 /// histocompatibility 2, T region locus 9 histocompatibility 2, T region locus 10 /// histocompatibility 2, T region locus 17 /// histocompatibility 2, T region locus 22 /// histocompatibility 2, T region locus 9  102731_g_at  chr17  37407179  H2-M3  histocompatibility 2, M region locus 3  1.1  104333_at  chr17  D17H6S56E-5  DNA segment, Chr 17, human D6S56E 5  1.1  93497_at  chr17  57343397  C3  complement component 3  2.2  101502_at  chr17  71193545  Tgif1  1.4  99979_at  chr17  80106293  Cyp1b1  101837_g_at  chr17 /// chr1  85357355  Ppm1b  TGFB-induced factor homeobox 1 cytochrome P450, family 1, subfamily b, polypeptide 1 protein phosphatase 1B, magnesium dependent, beta isoform  102698_at  chr17  87153482  Epas1  endothelial PAS domain protein 1  1.4  98822_at  chr17 /// chr4  155573589  Isg15  1.1  99379_f_at  chr17  ISG15 ubiquitin-like modifier similar to H-2 class I histocompatibility antigen, L-D alpha chain precursor  LOC676689  2.8  3.6  2.7  2.9  4.1  1.4 1.0  3.0  125  5.2.2 Igf2r is a potential susceptibility gene in Vam1 To further investigate the potential susceptibility genes in Vam1, we used realtime PCR to measure the gene expression of candidate genes. We compared cardiac gene expression in infected and uninfected C57BL/6, A/J, B6.A17 and A17.MCP7 mice. B6.A17 mice consist of A/J genome on chromosome 17 on an otherwise C57BL/6 background while A17.MCP7 mice consist of A/J genome in the Vam1 locus on an otherwise C57BL/6 background. The first time point that we investigated was day 10 PI. Day 10 is thought to be the peak of coxsackievirus-induced acute myocarditis and contained the most genes differentially expressed in the A/J mice over the course of disease (Table 5.1 and Table 5.2 and Table 5.3). The first genes assessed were those differentially expressed in A/J mice following coxsackievirus infection, Mrpl18, Smoc2 and Chd1. Mrpl18, observed to be decreased in expression in A/J mice at day 9 PI by microarray (Table 5.2), was not observed to be differentially expressed by real-time PCR (Figure 5.1a). In fact there was no significant difference between the expression levels in the four strains or between infected versus uninfected mice indicating that Mrpl18 may not be our candidate gene. Smoc2 expression was also observed to be decreased in A/J mice at day 9 post infection by microarray analysis (Table 5.2). By real-time PCR, A/J mice were observed to express significantly decreased levels of Smoc2 at 10 day PI compared to uninfected controls, however, the decrease was also observed in the C57BL/6 and A17.MCP7 strains suggesting that Smoc2 may not be our susceptibility gene (Figure 5.1b). Chd1 expression was observed to be increased in A/J mice at day 9 PI by microarray analysis (Table 5.2). A significant increase in Chd1 expression was observed in A/J mice at day 10 PI by real-time PCR, however, this increase was not observed in the C57BL/6, B6.A17 or A17.MCP7 mice (Figure 5.1c). This suggests that an A/J gene on a chromosome other than chromosome 17 is regulating expression of this gene. Chd1 may be contributing to susceptibility to disease; however, it may not be the susceptibility gene conferring susceptibility in the B6.A17 or A17.MCP7 mice.  126  Figure 5.1 Gene expression of potential candidate genes in the Vam1 locus Real-time PCR of cardiac expressed genes within the Vam1 locus in uninfected and infected mice at day 10 PI. Igf2r is a potential candidate susceptibility gene in this locus. (* denotes p<0.05, § denotes p<0.05 compared to uninfected C57BL/6 mice, ‡ denotes p<0.05 compared to infected C57BL/6 mice)  127  In addition to the genes differentially expressed in A/J mice post infection, we also have monitored the gene expression of 5 other genes in the Vam1 locus with known SNP differences between A/J and C57BL/6 mice. Expression of mitogenactivated protein kinase kinase kinase 4 (Map3k4 aka Mekk4) (Figure 5.1d) and 1acylglycerol-3-phosphate O-acyltransferase 4 (Agpat4) (Figure 5.1e) were significantly decreased in A/J mice compared to the C57BL/6 mice. However, this difference is not observed in the B6.A17 and A17.MCP7 mice suggesting that these may not be our Vam1 susceptibility gene. Also, the data suggests that, similar to Chd1, an A/J gene on a chromosome other than chromosome 17 is regulating expression of these genes. Plasminogen (Plg) expression was decreased in A/J and C57BL/6 mice compared with B6.A17 and A17.MCP7 mice, however this decrease did not correlate with disease susceptibility (Figure 5.1f). In addition, expression levels of Wilms' tumour 1-associating protein (Wtap) in uninfected and infected mice did not indicate this gene to be a susceptibility gene (Figure 5.1g). Real-time PCR analysis of insulin-like growth factor 2 receptor gene (Ig2fr) at day 10 PI revealed a significant decrease in the expression of this gene in infected susceptible A/J, B6.A17 and A17.MCP7 mice compared to resistant C57BL/6 mice (Figure 5.1h). This decrease was also evident in uninfected mice but was not significant. Therefore the levels of Igf2r prior to or during disease induction may be affecting susceptibility to viral-induced chronic myocarditis.  5.2.3 Cacna1h is a potential susceptibility gene in Vam2 Within the Vam2 region, the two genes differentially expressed post infection in A/J mice, Nme4 and Mrpl28, did not contain SNP differences between A/J and C57BL/6 mice [236] making them unlikely candidates for our susceptibility gene. This suggested that our susceptibility gene is either a gene with mRNA expression differences, protein expression differences or amino acid differences between A/J and C57BL/6 mice rather than a gene only differentially expressed following disease induction in disease susceptible A/J mice. We believed the cardiac expressed T-type calcium channel Cacna1h to be a potential candidate gene in Vam2 [236], and investigated this gene further. Cacna1h contains two amino acid differences between A/J and C57BL/6 128  indicating that expression levels of the mRNA or protein may not be the contributing factor to susceptibility. However, as a first assessment, we used real-time PCR to measure the cardiac gene expression of the Cacna1h gene in uninfected and infected A/J, C57BL/6 and B6.A17 mice at day 10 PI. Primers selected were compared to known SNP differences within the A/J and C57BL/6 genome to ensure that the primers did not overlap with any known SNPs. Surprisingly, the susceptible A/J and B6.A17 mice had significantly decreased expression levels of Cacna1h compared to the resistant C57BL/6 controls (Figure 5.2a). The expression of this gene was not altered post infection; rather expression was dependent on strain susceptibility. To ensure that the difference in the Cacna1h expression observed was genuine and not due to an unknown SNP difference at the primer site within the Cacna1h gene, real-time PCR using a different set of primers with no known SNPs associated was used to confirm the previous result. Using the second Cacna1h primer set, similar results were observed indicating that the expression difference observed was genuine (Figure 5.2b). As differences in mRNA levels are not always indicative of protein levels, cardiac protein lysates were assayed for CACNA1h protein however to protein levels were too low for detection by western blot analysis (Data not shown). An immunoprecipitation step may be necessary for detection of CACNA1h protein in the heart.  129  Figure 5.2 Susceptible A/J and B6.A17 mice have significantly decreased expression of Cacna1h Real-time PCR of Cacna1h in the hearts in uninfected and infected mice at day 10 PI using primer set one (A) and primer set two (B). Susceptible A/J and B6.A17 had significantly decreased expression levels of Cacna1h compared to the resistant C57BL/6 mice. (* denotes p<0.05 compared to uninfected C57BL/6 mice; ‡ denotes p<0.05 compared to infected C57BL/6 mice)  130  5.3  Discussion Herein we have attempted to identify the susceptibility genes located in the  myocarditis susceptibility loci Vam1, Vam2 and Vam3. Susceptibility could be conferred by altered mRNA, protein expression levels, protein localization or protein structure differences between A/J and C57BL/6 mice before or during disease induction. We used real-time PCR to compare the cardiac gene expression of resistant C57BL/6 and susceptible A/J, B6.A17 and A17.MCP7 mice in uninfected and infected mice at day 10 PI. In the Vam1 region, of the 35 genes with SNP differences between A/J and C57BL/6 mice [236], 3 were differentially expressed in A/J mice following infection. Mrpl18 and Smoc2 mRNA expression decreased while Chd1 mRNA expression increased in the heart following coxsackievirus infection. However, the decreased expression of Mrpl18 was not observed by real-time PCR analysis in the A/J, C57BL/6, B6.A17 or A17.MCP7 at day 10 PI making Mrpl18 an unlikely candidate for our susceptibility gene. Further, as with the microarray analysis, real-time PCR of Smoc2 gene expression revealed decreased levels in the A/J mice at day 10 PI, however, the levels were also decreased in the C57BL/6 and A17.MCP7 mice indicating that decreased expression may not confer susceptibility. Chd1 expression was increased in A/J mice post infection by both real-time PCR and microarray analysis. However, the expression was not decreased in the B6.A17 or A17.MCP7 suggesting this gene may not be our Vam1 susceptibility gene. In the Vam1 region, the most interesting susceptibility gene candidate identified by real-time PCR was Igf2r. This gene was decreased in both infected and uninfected susceptible strains compared with the resistant C57BL/6 mice. Igf2r is an interesting susceptibility candidate as SNP difference within this gene have been associated with susceptibility to type one diabetes [237]. Protein expression levels of this gene should be measured to determine if IGF2R protein levels also correlate with disease susceptibility. To continue the search for the Vam1 susceptibility gene, we will use real-time PCR to measure the gene expression of more genes with SNP differences within the Vam1 region as well as monitor protein levels of genes located within this region. We will monitor these factors at different time points as well as in different tissues as the 131  susceptibility gene may be affecting the disease course from a site distal to the heart. Protein levels will need to be quantified for all genes within Vam1 region with SNP differences between A/J and C57BL/6 mice regardless of a difference in mRNA expression levels as the mRNA levels may not reflect the levels of protein production. Additionally, rather than a difference in protein levels, location of the protein may also be altered between susceptible and resistant strains of mice. Therefore localization of the proteins in the heart may need to be determined. Finally, for genes with amino acid differences, it will be important to determine if the residue changes affect the protein function or structure and therefore disease susceptibility. In the Vam2 region, 69 genes have known SNP differences between A/J and C57BL/6 mice [236]. Microarray analysis identified two genes to be differentially expressed in A/J mice following infection, however, neither gene was associated with SNP differences making them unlikely candidates. Of the genes with SNP differences, we were most interested in the T-type calcium channel Cacna1h. Two amino acids within this gene differed between A/J and C57BL/6 mice indicating that a functional difference in the protein may be conferring susceptibility. Real-time PCR analysis revealed that, surprisingly, Cacna1h gene expression was significantly decreased in the susceptible A/J and B6.A17 mice compared with the resistant C57BL/6 controls. The decrease was observed regardless of infection. As C57BL/6 mice deficient in Cacna1h develop spontaneous focal myocardial lesions [235], it is possible that the significantly decreased levels of Cacna1h in A/J and B6.A17 mice could increase their susceptibility to cardiac diseases resulting in myocardial lesions. Differences in Cacna1h expression levels may also alter cardiac development as Cacna1h is also expressed in the heart during development [234]. Altered development may contribute to susceptibility at a later stage of life. As such, it would be interesting to determine if the cardiac expression of Cacna1h differs between these strains during embryonic development. Expression of Cacna1h in other susceptible and resistant inbred mouse strains should also be monitored to determine if Cacna1h could be conferring susceptibility in other mouse strains. SNP analysis of Cacna1h identified 135 SNP differences between A/J and C57BL/6 mice [192]. Interestingly, the majority of the A/J SNP differences are common with other susceptible strains such as the NOD/ShiLtJ, C3H/HeJ and DBA/2 132  strains [192]. SNP data for the susceptible BALB/c strain was not available; however, BALB/c mice contain an insertion in the genome immediately downstream of the Cacna1h gene that is common with the susceptible C3H/HeJ strain [192]. To confirm a link between Cacna1h and myocarditis susceptibility, we will use Cacna1h deficient mice on a C57BL/6 background to determine if lack of this gene confers susceptibility to viral-induced myocarditis. Chronic disease development in the Cacna1h deficient mice will confirm a role for Cacna1h in disease susceptibility. To determine when Cacna1h expression differences are conferring susceptibility, we will also use conditional Cacna1h knock-out mice on a C57BL/6 background to separate the involvement of Cacna1h during heart development versus disease initiation. In addition, we can use siRNA knockdown of Cacna1h to dampen the Cacna1h expression in C57BL/6 mice during the initiation of disease to determine if decreased expression of the calcium channel during the initiation of disease is conferring susceptibility. To date, we have measured the cardiac gene expression of 9 genes at day 10 PI. In the Vam1 locus, Igf2r is a potential candidate for viral-induced myocarditis susceptibility. In the Vam2 locus, Cacna1h is a strong candidate for a myocarditis susceptibility gene. More characterization of these genes must be carried out to fully determine the involvement of these genes in viral-induced myocarditis development.  133  6  Immune Genes Correlating Susceptibility to Coxsackievirus-Induced Myocarditis  134  6.1  Introduction Myocarditis progressing to dilated cardiomyopathy (DCM) is often associated  with infection by a pathogen such as the positive sense RNA virus, coxsackievirus [1]. Following infection, patients are either resistant to disease or develop myocarditis [14]. Development of myocarditis has been associated with viral persistence however persistence is not necessary for disease development [15, 16]. Chronic, autoimmune myocarditis development is due to an aberrant immune response post disease induction. While many immune factors have been associated with pathogenesis, a clear regulator of disease susceptibility has yet to be identified. By comparing the disease courses in susceptible and resistant strains of mice we can identify common themes that could be contributing to susceptibility or resistance to chronic myocarditis. These themes may be related to the early anti-viral response or regulation of the inflammatory response. Specifically, we are interested in the role of cytokines and chemokines in disease development. While we have learned a lot about the role of specific cytokines in disease development from knock-out mice, a thorough characterization of the immune response in a panel of susceptible and resistant strains of mice can increase our understanding of the role of specific cytokines in disease development. It is not likely the deficiency of a gene that is causing disease susceptibility but rather a difference in levels of a gene following viral infection is skewing the immune response towards chronic inflammation rather than a regulated anti-viral response. In addition to cytokine and chemokine production, we are also interested in the role of the negative co-stimulatory receptor PD-1 and the ligands PD-L1 and PD-L2 in myocarditis development. PD-1, PD-L1 and PD-L2 are expressed on a variety of immune cells; furthermore PD-L1 is also expressed on non-hematopoietic cells such as pancreatic beta cells and cardiac myocytes [238-240]. PD-1 has been associated with autoimmune disease development as mice deficient in this gene develop autoimmune disease dependent on their genetic background. For example PD-1 deficient C57BL/6 mice develop a lupus-like disease [241] while PD-1 deficient NOD mice develop diabetes at an accelerated rate [242]. Most importantly for our research, PD-1 deficient BALB/c mice develop spontaneous DCM [243] and PD-1 deficient MRL mice develop 135  fatal myocarditis [244] strongly indicating a link between PD-1 expression and myocarditis development. PD-1 polymorphisms have also been linked with susceptibility to a number of autoimmune diseases [245-248]. Interestingly, myocarditis susceptible A/J and NOD mice share similar polymorphisms within the PD-1 locus that differ from the resistant C57BL/6 mice. This strongly suggests a link between PD-1 and myocarditis susceptibility. Decreased PD-1 expression in susceptible strains of mice would likely lead to insufficient regulation of self-reactive immune cells through interaction with PDL1 expressed on the cardiac myocytes. Conversely, increased PD-1 expression in susceptible strains could lead to slower clearance of virus from the heart leading to increased viral-mediated cardiac damage and release of heart antigen in the context of infection. Therefore, PD-1 and PD-L1 expression differences could contribute to development of chronic inflammatory disease in the heart. PD-1 and PD-L1 also have a role in chronic infections. PD-1 is expressed on exhausted T cells during chronic infections and blockade of PD-1 or PD-L1 is sufficient to restore the anti-viral response and clear the chronic infection [249]. Therefore a dysregulation of PD-1 or PD-L1 following viral infection could allow for persistence of the virus and thereby possibly drive heart disease. In this report, we identified a number of factors that could be contributing to susceptibility to coxsackievirus-induced myocarditis. PD-L1 expression was increased in susceptible but not in resistant mice during the acute stage of myocarditis possibly identifying a role for PD-L1 in viral persistence. In addition, TNFα production was increased in the resistant but not susceptible mice during the early inflammatory response. These results suggest that the susceptible strains of mice do not produce a robust anti-viral response post infection and further dampened their immune response during acute myocarditis prior to viral clearance.  136  6.2  Results  6.2.1 A/J mice have an increased rate of mortality post infection In order to identify how susceptible and resistant strains differ during the disease course, resistant C57BL/6 and susceptible A/J, BALB/c and NOD mice were infected with 10,000 PFU CB3. Following infection, A/J mice had the highest rate of mortality (Figure 6.1a). Examination of moribund mice revealed fulminant myocarditis in approximately half of the mice (Data not shown). Serum autoantibody levels were monitored as a measure of the immune response to self-antigen during the chronic stage of disease at day 28 PI (Figure 6.1b). The highest levels of IgG reactive to heart antigen were noted in the A/J mice. C57BL/6, NOD and BALB/c mice all produced similarly low levels of anti-heart antibodies.  6.2.2 Serum TNFα and Rantes levels are increased in C57BL/6 mice compared to susceptible strains of mice Serum cytokine and chemokines levels were measured at day 3 post infection to measure the inflammatory response during early disease development (Figure 6.2). Unexpectedly, following infection, the NOD mice had little to no serum cytokine or chemokine production (Figure 6.2). This suggests that these mice do not efficiently mount an anti-viral response to limit viral-mediated damage. The susceptible A/J and BALB/c mice produced increased levels of IL-6, MCP-1 and G-CSF and moderate levels of MIG, MIP-1β, Rantes and KC at 3 days PI (Figure 6.2). The levels of IL-6, MCP-1 and G-CSF were highly variable in the A/J and BALB/c mice compared to the resistant C57BL/6 mice. This variability was most notable in the A/J mice. C57BL/6 mice produced increased levels of IL-6, TNFα, MIG, MIP-1β, Rantes, MCP-1 and G-CSF following infection. Interestingly, the levels of IFNγ, TNFα and Rantes in the C57BL/6 mice were significantly increased compared to the susceptible 137  Figure 6.1 A/J mice have an increased rate of mortality following CB3 infection (A) Following infection with the same dose of CB3, A/J mice have the highest rate of mortality followed by the NOD mice. (n=6 for each strain) (B) A/J mice have increased IgG autoantibodies reactive to heart antigens compared with the BALB/c, NOD and C57BL/6 mice at day 28 PI. (n=5 for A/J and NOD; n=6 for BALB/c and C57BL/6)  138  Figure 6.2 Serum cytokines and chemokines levels at 3 days post CB3 infection C57BL/6 mice appear to produce a consistent level of (A) cytokines and (B) chemokines post infection while A/J and BALB/c mice have more variation in cytokine/chemokines levels. NOD mice produce very limited amounts of cytokines and chemokines post infection. (* denotes p<0.05 compared to C57BL/6 mice) (n=6 for A/J and NOD; n=5 for BALB/c and C57BL/6)  139  strains. This suggests that resistant C57BL/6 mice mount a more consistent and efficient anti-viral response compared to the susceptible strains of mice.  6.2.3 A/J mice have increased macrophage infiltration in the heart post CB3 infection The composition of the heart infiltrate in the four inbred strains was monitored during the course of the disease to determine if infiltration of a specific immune cell correlated with disease development. The levels of B cells, CD4 T cells and CD8 T cells in the heart were not significantly altered between the susceptible and resistant strains of mice (Data not shown), however, there was a notable difference in the macrophage infiltration post infection (Figure 6.3). A/J mice were observed to have increased macrophages infiltrating in the heart post infection. The increase occurred between days 5 and 10 and was sustained until at least day 21 PI. Interestingly, the increased mortality observed in the A/J mice occurred at the same stage of disease as the macrophage infiltration in the heart.  6.2.4 PD-L1 is increased on splenocytes from susceptible but not resistant mice post infection As we were interested in a possible role for the negative co-stimulatory receptor PD-1 and the ligands PD-L1 and PD-L2 in viral-induced myocarditis development, we monitored the expression of these molecules on splenocytes post infection. While there was no difference in the PD-1 and PD-L2 expression on splenocytes post infection (Data not shown), a difference in the PD-L1 expression was observed (Figure 6.4 and Figure 6.5). The expression of PD-L1 on macrophages, B cells, CD4 and CD8 T cells was increased compared to uninfected control mice in the susceptible but not resistant strains of mice at day 7 post infection (Figure 6.4b). This could suggest an inappropriately dampened immune response in the susceptible strains of mice prior to viral clearance.  140  Figure 6.3 Macrophage infiltration in the heart correlates with increased mortality in A/J mice Macrophage infiltration in the heart increased greatly in the A/J mice during the acute stage of disease and remained increased during the chronic stage of disease. (* denotes p<0.05 compared to C57BL/6 mice) (Day 0: n=12 for A/J, BALB/c and NOD; n=11 for C57BL/6) (Day 5: n=6 for each strain) (Day 10: n=5 for A/J; n=6 for BALB/c, C57BL/6 and NOD) (Day 21: n=4 for A/J; n=6 for BALB/c, C57BL/6, and NOD)  141  Figure 6.4 Immune cells from susceptible but not resistant strains of mice increase expression of PD-L1 during the viral infection Splenocytes were collected at day 5 (A) and 7 (B) PI. PD-L1 expression was measured on the macrophages, dendritic cells, B cells, CD4 T cells and CD8 T cells. Following infection with CB3, susceptible but not resistant mice increased the expression of PD-L1 on these immune cells. (* denotes p<0.05 compared to uninfected controls) (Day 5: n=3 for uninfected A/J and C57BL/6; n=4 for uninfected BALB/c; n=2 for uninfected NOD; n=5 for infected A/J; n=6 for infected BALB/c, C57BL/6 and NOD) (Day 7: n=2 for uninfected A/J; n=4 for uninfected BALB/c and C57BL/6; n=3 for uninfected NOD; n=2 for infected A/J; n=4 for infected BALB/c and C57BL/6; n=3 for infected NOD)  142  143  Figure 6.5 A/J macrophages expressed decreased levels of PD-L1 during acute and chronic myocarditis Splenocytes were collected at days 10 (A) and 21 (B) PI. PD-L1 expression was measured on the macrophages, dendritic cells, B cells, CD4 T cells and CD8 T cells. Macrophages from A/J mice had a marked decrease in PD-L1 expression during acute and chronic myocarditis. (* denotes p<0.05 compared to uninfected controls) (Day 10: n=3 for uninfected A/J; n=4 for uninfected BALB/c, C57BL/6 and NOD; n=5 for infected A/J; n=6 for infected BALB/c, C57BL/6 and NOD) (Day 21: n=2 for uninfected A/J; n=4 for uninfected BALB/c; n=3 for uninfected C57BL/6 and NOD; n=4 for infected A/J and NOD; n=6 for infected BALB/c and C57BL/6)  144  145  At the peak of the acute stage (day 10) and during the chronic stage of disease (day 21), the difference in PD-L1 expression was abrogated (Figure 6.5). However, A/J mice expressed significant decreased PD-L1 on macrophages and B cells at these time points. As macrophages number were significantly increased in the hearts of A/J mice during the acute and chronic stages of disease, we wanted to determine if these cardiac infiltrating macrophages expressed decreased PD-L1 compared to macrophages from uninfected controls. To this effect, the immune infiltrate in the heart was monitored for PD-1, PD-L2 (Data not shown) and PD-L1 (Figure 6.6) expression at days 5, 10 and 21 postinfection. While decreased PD-L1 expression was observed in heart infiltrating macrophages during the chronic stage of disease in A/J mice, the difference was not significant (Figure 6.6c). No other difference in PD-L1, PD-1 or PD-L2 expression correlating with disease susceptibility was observed in the heart infiltrate suggesting that the role for these negative co-stimulatory molecules is systemic rather than organ specific.  6.2.5 PD-L1 expression is increased in heart tissue from susceptible but not resistant mice As PD-L1 is also expressed by cardiac myocytes, we measured the cardiac expression of this ligand by real-time PCR at days 5 and 7 PI. At day 5 PI, the peak of viral replication in the heart, Pd-l1 was expressed at increased levels in all four strains of mice compared with uninfected controls (Figure 6.7a). However, by day 7 PI, after the peak of viral replication in the heart, the levels of Pd-l1 remained increased in the hearts of the susceptible but not resistant strains of mice (Figure 6.7b). This increased Pd-l1 expression in the susceptible but not resistant strains of mice could suggest an inappropriate dampening of the immune response in the heart prior to viral clearance. This could allow for persistence of the virus and therefore increased viral-mediated damage and inflammation in the heart.  146  Figure 6.6 Cardiac immune infiltrate did not show a correlation between myocarditis susceptibility and PD-L1 expression Heart infiltrate were collected at days 5 (A), 10 (B) and 21 (C) PI. PD-L1 expression was measured on macrophages, B cells, CD4 T cells and CD8 T cells. (* denotes p<0.05 compared to uninfected controls) (Day 5: n=3 for uninfected A/J; n=4 for uninfected BALB/c, C57BL/6 and NOD; n=5 for infected A/J; n=6 for infected BALB/c, C57BL/6 and NOD) (Day 10: n=4 for uninfected A/J, BALB/c and NOD; n= for uninfected C57BL/6; n=5 for infected A/J; n=6 for infected BALB/c, C57BL/6 and NOD) (Day 21: n=2 for uninfected A/J; n=4 for uninfected BALB/c; n=3 for uninfected C57BL/6 and NOD; n=4 for infected A/J and NOD; n=6 for infected BALB/c; n=6 for infected C57BL/6)  147  Figure 6.7 Susceptible strains of mice have increased cardiac expression of Pd-l1 at day 7 PI (A) Cardiac expression of Pd-l1 is increased in all strains at day 5 PI. (B) The levels of Pd-l1 remain increased in the susceptible but not resistant strains of mice day 7 PI. (Day 5: n=4 for uninfected A/J, BALB/c and C57BL/6; n=3 for uninfected NOD; n=5 for infected A/J; n=6 for infected BALB/c, C57BL/6, and NOD) (Day 7: n=4 for each group/strains)  148  6.2.6 Resistant mice have decreased viral genome in the heart at day 7 post infection As the susceptible strains of mice appear to have a dampened immune response compared to resistant mice with decreased TNFα and Rantes production as well as increased PD-L1 expression on splenocytes and heart tissue prior to viral clearance, we were interested in measuring the viral RNA in the heart post infection. We used realtime PCR to monitor the amount of viral RNA in the heart during the infection (Figure 6.8). At the peak of viral replication in the heart, day 5 PI, all strains had a similar level of positive sense CB3 RNA in the heart. However, at 7 days PI, the level of viral RNA had decreased in the C57BL/6 mice but remained increased in the susceptible A/J, BALB/c and NOD mice. This is another indicator that the resistant C57BL/6 mice mount a better anti-viral response and thus clear virus and limit viral-mediated damage in the heart more efficiently. As persistence of terminal deletion (TD) mutants of CB3 has been suggested to have a role in chronic myocarditis development [80, 250, 251], we used real-time PCR to monitor the presence of these mutants in heart tissue. The internal reverse primer was common to all reaction, while the forward primers were located at various positions in the 5’ untranslated region. Each of the four primers used represented a different known terminal deletion mutant with the S primer representing no deletion and the S1, S2 and S3 primers representing progressively larger deletions. Real-time PCR of TD primers in heart tissue at day 7 PI revealed that all four strains contained TD mutants (Figure 6.9). The ratio of TD mutants to full length CB3 was similar in all strains suggesting that the presence of TD mutants is not conferring susceptibility. However, these results do not rule out the possibility of the TD mutants drive chronic disease at a later stage of disease. Quantification of TD mutants at later time points will be necessary as it is more likely the persistence of the TD mutants that contributes to chronic disease development rather than their presence during the acute stage of disease.  149  Figure 6.8 C57BL/6 mice have decreased viral RNA in the heart at day 7 PI Viral RNA is present in the hearts of all strains of mice at a similar level at 5 days PI, however the levels remain high in the susceptible but not resistant strains of mice at day 7 PI. (* denotes p<0.05 compared to C57BL/6 mice) (Day 5: n=5 for A/J; n=6 for BALB/c, C57BL/6 and NOD) (Day7: n=4 for each group)  150  Figure 6.9 Terminal deletion mutants of CB3 were observed in all strains of mice Real-time PCR for viral RNA was carried out on cardiac samples at day 7 PI. Samples were run with a common internal reverse primer and forward primers differing in location within the 5’ untranslated region. Products amplified with the S primer represent full-length genome. S1, S2 and S3 primer bind to the genome progressively closer to the translational start site. Differences in the ratio of products amplified with the S, S1 and S2 primer compared with the S3 primer suggests the presence of terminal deletion mutants. (n=6 for each strain)  151  6.2.7 TNFα injection at the time of infection improves the survival rate in CB3 infected A/J mice As TNFα was increased in the resistant but not susceptible mice, we were interested in the effects of boosting the TNFα levels in susceptible mice. The preliminary experiment was carried out on A/J mice as these mice most often developed fulminant myocarditis with increased mortality. Mice were injected with 2µg of TNFα, 200ng of TNFα or DMEM at the time of infection to determine if early increased TNFα alters disease development. From the preliminary experiment, TNFα injection appears to increase survival in A/J mice (Figure 6.10). Control mice injected with CB3 and DMEM had the highest rate of mortality with 60% mortality. Mice co-injected with 200ng of TNFα had slightly increased survival with a mortality rate of 40%. The most striking observation was the 100% survival rate in the mice co-injected with 2µg of TNFα. This strongly suggests that lack of TNFα production following viral infection may be contributing to the increased mortality observed in A/J mice.  152  Figure 6.10 Injection of TNFα at the time of infection is sufficient to increase survival in A/J mice A/J mice were injected with DMEM, 200ng of recombinant TNFα or 2µg of recombinant TNFα at the time of CB3 infection. Mice injected with DMEM had the highest rate of mortality. Mice injected with 200ng TNFα had a slightly lower mortality rate compared to control mice. Mice injected with 2µg of TNFα had a 100% survival rate. (n=5 for each group).  153  6.3  Discussion Herein we described the pathogenesis of CB3-induced myocarditis in four inbred  mouse strains in the hopes of identifying a common theme correlating with disease susceptibility. Three of the strains, A/J, NOD and BALB/c were genetically susceptible to chronic myocarditis development while the fourth strain, C57BL/6, was genetically resistant to disease development [85, 176-178]. We identified a few interesting themes during the characterization of the immune responses in the four inbred strains. The first was a strong correlation between macrophage infiltration in the heart and fulminant myocarditis and mortality in the A/J mice. As inflammatory M1 macrophages have been associated with increased myocarditis severity while the alternatively activated M2 macrophages have been associated with disease protection [139, 172, 252], it would be interesting to determine which subset is infiltrating the hearts of these mice. Macrophage polarization is thought to be gender specific with male mice developing increased M1 infiltration and disease compared with M2 infiltration in the relatively protected female mice [139]. As such, the data should be separated by gender before macrophage subsets are investigated. The second observation of interest was the increased PD-L1 expression on the immune cells and heart tissue of susceptible but not resistant mice in correlation with increased viral RNA in the heart at day 7 PI. These observations suggest that increased PD-L1 expression prior to viral clearance could be contributing to chronic disease development by allowing for viral persistence. Contradicting this theory, another group previously noted that following CB3 infection in C3H mice, blocking antibodies to PD-1 or PD-L1 resulted in increased acute stage damage and viral replication [238]. However, the difference may be due to the timing of the PD-L1 interaction. In the previous experiments, PD-L1 and PD-1 interaction were blocked at the time of infection and during the early anti-viral response, prior to the peak of viral replication in the heart. We are suggesting a dampening of the PD-L1 interaction during the acute stage of disease, after the peak of viral replication in the heart. This may aid in the clearance of virus from the heart and the elimination of viral antigens from the site of disease.  154  The cytokine and chemokine response following infection produced a number of interesting results. The first was the lack of substantial cytokine or chemokine production in the NOD mice. In combination with the notable increase in the Pd-l1 expression in the heart, these observations strongly indicate that the NOD mice do not mount an efficient anti-viral response following viral infection. This would lead to greater viral replication and therefore viral-mediated damage and could be contributing to disease susceptibility. In contrast the susceptible A/J and BALB/c mice produced IL-6, G-CSF and MCP-1 following infection, however the levels of these immune factors was highly variable between mice. As the incidence of chronic myocarditis is not 100% in these strains, it would be interesting to observe whether the mice with the high or low levels of these cytokines/chemokines are those developing chronic myocarditis. In particular, as both increased and decreased levels of IL-6 have been associated with increased chronic myocarditis development [199, 253], it would be interesting to determine if the mice developing chronic disease produced low or high levels of IL-6 during the early anti-viral response. The increased Rantes (CCL5) production in the resistant C57BL/6 mice was also an interesting observation. This chemokines directs that migration of T cell, monocytes, natural killer cells, basophils, eosinophils, dendritic cells and mast cells to the site of inflammation [254]. Increased levels of Rantes in the resistant but not susceptible strains suggest that these mice are able to mount a better anti-viral response following CB3 infection. With increased migration of immune cells to the site of infection, the infection would be limited and thus the viral-mediated damage. The most notable observation in the cytokine profiles was the increased TNFα in the resistant C57BL/6 mice. This occurred with little variability between mice of that strain. Increased TNFα in correlation with protection from chronic disease was a surprising observation as TNFα production is often associated with a detrimental role in chronic myocarditis development (Figure 1.3). TNFα alone is sufficient to induce myocarditis as transgenic mice that overexpress TNFα specifically in the heart develop spontaneous myocarditis and DCM [111, 112]. Further, as it has been previously found that TNFα injection at the time of CB3 infection is sufficient to render a resistant mouse susceptible to chronic myocarditis development [113, 114] it is surprising that the resistant C57BL/6 mice produce the highest levels of TNFα. 155  Using viral-induced models of myocarditis TNFα has been observed to increase disease severity during the anti-viral response in susceptible strains of mice. Multiple injections of TNFα during the initiation of disease in the susceptible DBA/2 mice leads to increased EMCV replication and acute stage damage in the heart suggesting the TNFα does not aid in the control of virus following infection [118]. Further anti-TNFα treatment results in increased survival and decreased acute damage [118]. However, conversely, TNFα deficient A/J mice have an increased rate of mortality following EMCV infection [117]. This increased mortality is associated with increased viral RNA and decreased inflammation in the heart. Treatment with recombinant human TNFα reverses the phenotype of these mice in a dose dependent manner [117]. In addition, increased disease following EMCV infection in C3H/HeJ mice that overexpress IL-6 specifically in the heart was attributed to an impaired upregulation of TNFα [199]. Subsequent injection of recombinant human TNFα at the time of infection reversed the phenotype [199]. The increased disease observed in these mice was due to impaired viral clearance due to a lack of TNFα, which was reversed with TNFα injection [199]. These studies suggest that the decreased mortality observed in the A/J mice treated with TNFα was due to an improved clearance of the virus. Viral RNA levels and replicative virus in the heart will need to be monitored with and without TNFα injections to determine if improved viral clearance could be contributing to the increased survival rate observed. In addition to cardiac levels of virus, it would also be interesting to determine the impact of TNFα on factors such as cytokine and chemokine production systemically and in the heart directly, macrophage infiltration in the heart, PD-L1 expression on splenocytes and in the heart as well as chronic disease development. As TNFα injection at the time of infection is sufficient to overcome genetic resistance to chronic disease, it is possible that the A/J mice are developing more severe chronic myocarditis despite the improved survival rate. It would also be of interest to test the impact of TNFα injection at different time points post infection. Injection during the first few days post infection, in particular, would be of interest as TNFα production was increased in the C57BL/6 mice during this stage of disease. Dose is another factor that would be interesting to further explore. While a single dose of 2µg was sufficient to improve survival rates, 200ng produced 156  little to no effect. This indicates that the dose of TNFα is important in disease development. The dose difference may also be the reason for the conflicting results observed with other laboratories. For example, the increased EMCV replication in DBA/2 mice was observed following multiple injections with TNFα, therefore this prolonged dose may be detrimental to the host. Further, our laboratory has observed increased viral replication in the hearts of C57BL/6 mice with CB3 and LPS co-injection [253]. As the effects of the LPS are thought to be due to an increase in the TNFα production [113, 114, 253], it is possible that in the C57BL/6 mice the level of TNFα naturally produced efficiently controls the viral infection, however a further increase in the TNFα production impairs the anti-viral response. In summary, we have identified several immune factors that correlate with disease susceptibility and resistance. Macrophage infiltration in the heart correlates with fulminant myocarditis and mortality, PD-L1 expression during the acute stage of disease correlates with chronic disease susceptibility and TNFα production correlates with resistance to chronic disease. Injection of TNFα at the time of infection was sufficient to increase survival of mice however the mechanism of protection must still be determined.  157  7  General Discussion and Future Perspectives  158  7.1  General Discussion The aim of my thesis was to identify factors that contribute to development of  chronic myocarditis following coxsackievirus infection. The first research chapter specifically looks at the role of the cytokine IL-6 in disease development while the remaining research chapters take a broad look at a panel of genes for their involvement in disease induction. Three approaches were used in my thesis research. The first was to use mice deficient in a specific gene to elucidate the role of the gene in myocarditis development. The second involved the use of chromosome substitution strains to identify genetic loci that confer susceptibility to viral-induced myocarditis. The third method was to screen four inbred mouse strains in an attempt to identify immune genes that correlated with disease susceptibility or resistance.  7.1.1 The role of IL-6 in viral-induced chronic myocarditis Following disease induction in C57BL/6 mice, IL-6 was found to have a protective role in disease severity as IL-6 deficient mice developed increased disease pathology compared to wild type controls [253]. However, this result contradicts the lack of disease observed in IL-6 deficient BALB/c mice following EAM-induction of disease [196]. The difference in the involvement of IL-6 in disease may be due to either: differences in method of disease induction, genetic differences between inbred mouse strains or the additional injection of LPS in the C57BL/6 mice. To determine if the LPS injection or the inbred mouse strain used was affecting the disease phenotype, we backcrossed the IL-6 knockout locus onto a NOD background. Infection of these mice resulted in disease development (Data not shown) suggesting that the LPS injection was not altering the role of IL-6 in viral-induced disease induction. Disease in the IL-6 deficient NOD mice also suggested that the mouse strain did not affect the role of IL-6 in disease development and that the model of disease induction is directing the role of IL-6. However, disease in the IL-6 deficient NOD mice did not exclude the possibility of a strain specific role for IL-6 in myocarditis development in other strains such as the A/J and BALB/c mice. Favoring this theory is 159  the recent finding of Th17 cells in the hearts of BALB/c mice post coxsackievirus infection [132]. Further BALB/c mice developed decreased acute disease pathology following IL-17 neutralization suggesting IL-6 may contribute to acute disease development by promoting the generation of Th17 cells and therefore IL-17 [133]. Examination of the early inflammatory response in the susceptible A/J, BALB/c and NOD mice compared with the C57BL/6 mice also suggests that the role of IL-6 in disease development is strain specific. Following infection, C57BL/6 mice increase production of IL-6, however the serum levels peak around 100 pg/ml with CB3 infection and 150 pg/ml with CB3/LPS treatment (Figure 3.6 and Figure 6.2). These levels are not exceedingly high suggesting that IL-6 does not play a major role in driving the chronic inflammatory response in C57BL/6 mice. Further, NOD mice express little to no IL-6 in the serum post infection indicating that IL-6 is not likely to play a role in disease development in this mouse strain (Figure 6.2). However, A/J and BALB/c mice produce relatively high levels of IL-6 following viral infection with serum concentration around 2000 pg/ml at 3 days PI (Figure 6.2). This is highly suggestive of a pathogenic role for IL-6 in myocarditis development in A/J and BALB/c mice and would explain the presence of Th17 cells in the hearts of BALB/c mice post infection while we did not observe their presence in C57BL/6 mice. As increased IL-6 levels have been associated with increased myocarditis severity and mortality in patients [198], it is likely that in these patients IL-6 is driving inflammation through the generation of pathogenic Th17 cells. As such, IL-6R antibody treatment may improve the disease outcome in these patients by decreasing the generation of Th17 cells and IL-17 production. However, in patients with low IL-6 production following disease induction, similar treatment would not likely decrease disease and in fact, these patients may develop increased disease as observed in the IL-6 deficient C57BL/6 mice.  7.1.2 Genetic susceptibility may not be due to immune related genes Using CSS mice, we identified three loci on chromosome 17 that confer susceptibility to viral-induced myocarditis [236]. One of the loci contained the MHC locus and therefore was a predicted susceptibility locus. However the two remaining 160  loci contained no genes previously associated with disease development. Examination of the genes within these regions revealed the presence of a variety of genes with many functions including immune-related genes. To date real-time PCR of the immunerelated genes within the susceptibility loci have failed to identify a clear susceptibility gene, however, expression levels of the calcium channel Cacna1h strongly indicates a role for this gene in disease susceptibility. Cacna1h is expressed during cardiac development and may be influencing susceptibility by expression differences during development [234]. If Cacna1h is a disease susceptibility gene, this would not be the first time that a cardiac protein has been linked with CB3-induced myocarditis. Cleavage of the cardiac protein dystrophin by the coxsackievirus protease 2A has been associated with CB3 infection and myocarditis [158, 159]. As dystrophin is part of a complex that links the cytoskeleton with the extracellular matrix, cleavage of dystrophin by 2A would lead to weakening of the cellular membrane. A weakened cell membrane could allow for either more efficient release of virus or leaking of self-proteins from the cardiac cells. Therefore, if Cacna1h expression during development affects the strength of the cardiac myocytes cell membrane this could lead to increased susceptibility to viral-induced myocarditis.  7.1.3 Influence of immune related genes in disease susceptibility In addition to chromosome 17 genes, we have associated a number of immune genes with chronic myocarditis development following CB3 infection. Monitoring a panel of the immune genes in a number of inbred mouse strains allowed us to identify a common theme of a dampened immune response in susceptible strains correlating with viral persistence. TNFα and PD-L1 expression levels have produced the most interesting results with decreased TNFα and increased PD-L1 associating with disease susceptibility. In the past, TNFα has been mainly associated with driving chronic disease development [105, 106, 113, 114], however, this maybe a strain specific role limited to strains such as genetically resistant C57BL/6 mice. As such, rTNFα treatment of patients with low serum levels of TNFα following viral infection may increase the survival of these patients. It still must be determined if such a treatment, while 161  increasing survival during the acute stage of disease, could increase their susceptibility to chronic myocarditis development. Anti-PD-L1 treatment of patients would be equally tricky. While it is desirable to limit the chronic inflammatory response, an efficient anti-viral response is still needed to clear viral antigen and limit viral-mediated damage. As such, treatment options will have to be catered to the patients. For example, in patients with persistence of virus and a minimal inflammatory response, anti-PD-L1 treatment may be beneficial. Conversely, in patients with chronic inflammation in the heart but no observable virus, similar treatment would be detrimental.  162  7.2  Future Perspectives  7.2.1 IL-6 is both pathogenic and protective As the role of IL-6 in myocarditis development is likely strain specific, it would be interesting to determine if IL-6 deficient A/J and BALB/c mice are resistant to the development of CB3-induced myocarditis. Concurrently, treatment of wild type A/J and BALB/c mice with IL-6R blocking antibody during the acute stage of disease would allow us to determine the role of IL-6 production in these inbred mouse strains. If IL-6R blocking antibody treatment during the acute stage of disease can alter chronic disease development, it may be possible to alter the course of disease in acute stage patients to stop progression to chronic disease. In addition, it would be interesting to determine if the protective role of IL-6 is specific for coxsackievirus or if IL-6 plays a similar role in other pathogen-induced models of myocarditis. Mouse models for EMCV-, MCMV-, S. pyogenes- and T. cruziinduced heart disease can all be investigated to determine the role of IL-6 in disease induction. It would also be interesting to know if IL-6 has a strain specific role in all pathogen-induced models of disease, or if that role differs depending on pathogen. Understanding the role of IL-6 following myocarditis infection by a variety of pathogens would increase our ability to treat myocarditis patients. Treatments can be catered to the patients depending on the pathogen associated with disease initiation. Finally, in NOD mice, while we know that IL-6 deficient mice develop CB3induced myocarditis, we don’t know if these mice develop increased disease severity as observed in the C57BL/6 IL-6 deficient mice. As such, NOD IL-6 deficient mice can be infected to determine if IL-6 plays a similar disease regulatory role in this inbred mouse strain. Additionally, as the NOD mice do not appear to produce a robust IL-6 response following viral infection, it may be interesting to determine if rIL-6 injection during the early stages of disease alters the course of disease development towards more severe pathology or decreased pathology.  163  7.2.2 Identification of susceptibility loci/genes for viral-induced myocarditis To continue the search for susceptibility genes, it would be very helpful to have a complete microarray analysis of the anti-viral response in both the A/J and C57BL/6 mice at different time points and in different organs post infection. While the microarray data that we currently have in the A/J mice is very informative, our susceptibility gene may be a gene that is not differentially expressed during disease induction but rather differentially expressed between A/J and C57BL/6 mice. Such a gene would not appear in the microarray data that we currently have. To the same end it would be helpful to have a thorough characterization of the cardiac tissue in A/J and C57BL/6 mice to determine if protein levels or cell structures differ prior to infection, predisposing the mice to pathogen-induced myocarditis and DCM. In addition, as gender has been linked with susceptibility to myocarditis with male mice developing disease at an increased incidence compared with female mice, it would also be interesting to determine the link between gender and the susceptibility loci that we have identified. While we have observed disease in both male and female mice in the sub-congenic CSS strains generated in our laboratory, we have not tested enough mice to determine if the incidence differs between genders. If gender is influencing the susceptibility loci, we will have to determine how this is happening. Additionally, maternal influence of our loci can be investigated as it may also influence disease susceptibility. With all susceptibility loci identified, the role of the gene of interest in other susceptible inbred strains should be determined. A quick indicator of a similar role in disease development would be a comparison of inbred strain for common SNP differences within the gene of interest. Further experiments, such as antibody depletion or siRNA knockdown, can be specifically designed to target the susceptibility gene during myocarditis development to further elucidate the role of the gene of interest. In addition, the role of the gene of interest should be determined following infection by other myocarditis causing pathogens such as MCMV, EMCV and T. cruzi. While genetic susceptibility to MCMV- [59], EMCV- [180] and T. cruzi-induced [179] myocarditis follow a similar strain susceptibility pattern indicating common susceptibility genes between the disease models, there is some variation as A/J mice are resistant to the development of chronic myocarditis following EMCV infection [180]. As such, it is 164  possible that the genes we identify using the CSS mice will not confer susceptibility following EMCV induction of disease. However it is also possible that the A/J mice have a strain-specific disease resistance gene and that genes identified by our screen still contribute to disease development. Also, to determine the effect of our susceptibility loci on susceptibility to myocarditis induced by pathogens other than CB3, disease susceptibility to EAM-induced myocarditis could suggest that our locus is linked with myocarditis development by other models of disease induction. However, infection of congenic mouse strain will be necessary to determine the precise role our susceptibility loci in EMCV-, MCMV- or T. cruzi-induced myocarditis. In addition to chromosome 17, our initial efforts to identify susceptibility chromosomes included investigation of chromosomes 3, 4 and 5 (Data not shown). While chromosome 5 weakly conferred susceptibility to viral-induced disease, chromosomes 3 and 4 conferred susceptibility to coxsackievirus-induced myocarditis at an incidence similar to chromosome 17. While chromosome 17 also conferred susceptibility to EAM-induced myocarditis, chromosomes 3 and 4 conferred susceptibility to only viral-induced disease (Data not shown). As loci on chromosomes 3 and 4 have previously been associated with susceptibility to CB3-induced acute myocarditis [188], it would be interesting to determine if the same loci/genes are conferring susceptibility to chronic myocarditis development. Disease following viral but not adjuvant induction of disease suggests that the susceptibility genes on chromosomes 3 and 4 may be viral-related genes. As a number of interesting immunerelated genes are located on these chromosomes it will be necessary to narrow the regions of interest using mice congenic for smaller portions of the chromosomes on an otherwise disease resistant background. If the genes of interest are anti-viral immune genes, it would be interesting to determine if the genes confers susceptibility to myocarditis induced by other viruses such as EMCV or MCMV. The final step that we can take would be to obtain genetic data from human myocarditis and DCM patients. Comparison of SNP differences between healthy controls and myocarditis and DCM patients can determine if genes identified by our research may direct disease development in patients. Ideally data would be available from myocarditis patient with pathogen-induced disease as well as disease of unknown origins.  165  The identification of viral-induced myocarditis susceptibility loci could also lead to the identification of genes causative for familial myocarditis and DCM as there is likely an overlap in the genes involved in disease initiation. In addition, as DCM and hypertrophic cardiomyopathy (HCM) often involve the same genes [255], it is possible that genes identified by our research may be also be involved in susceptibility to HCM.  7.2.3 Anti-viral immune responses can direct disease susceptibility To complete the characterization of CB3-induced disease in A/J, BALB/c, NOD and C57BL/6 mice, a number of experiments must be completed. First, while the cytokine/chemokine concentrations in the serum are informative about the systemic immune response, the cytokine/chemokine concentrations must be determined at the site of chronic disease, the heart. This may be more informative about the immune factors involved in viral persistence and chronic inflammation. Identifying the subsets of macrophages within the heart will be equally informative. As macrophage infiltration in A/J mice correlates with increased mortality and fulminant myocarditis, it would be advantageous to determine if the macrophages present are M1 or M2 macrophages. As M1 macrophages are associated with increased disease pathology while M2 macrophages are associated with disease protection [139, 172, 252], we will likely observe increased M1 macrophages. Further, as M1 macrophage infiltration is more prevalent in male BALB/c mice following infection while M2 macrophage infiltration is more prevalent in female BALB/c mice [139], it would be interesting to determine if A/J mice have a similar skewing of macrophage infiltration associated with a gender dependent increase in disease. Similarly, all data collected should be analyzed to determine if gender influences factors such as cytokine/chemokine production, PD-L1 expression and viral RNA in the heart. Finally, anti-PD-L1 blocking treatments would allow us to determine if the increased PD-L1 expression associated with susceptible strains of mice is allowing for viral persistence. Alternatively, the increased PD-L1 expression could be an attempt by the host’s immune system to limit chronic inflammation due to viral persistence. Treatment of mice with anti-PD-L1 blocking antibodies while monitoring the viral RNA  166  and cytolytic virus in the heart would help us determine the role of PD-L1 in disease development.  167  7.3  Concluding remarks While a number of genes have been associated with myocarditis, we still do not  completely understand the role of these genes in disease development. This research is another essential piece of the puzzle that expands on our knowledge of the role of immune and non-immune genes in myocarditis development. The data presented in this thesis and published by other groups must be taken together to determine the function of the gene in humans. As myocarditis patients respond differently depending on the genetics of the patient and the pathogen it will be advantageous for us to determine the role for genes such as IL-6, Igf2r, Cacna1h, TNFα and PD-L1 in a panel of inbred mouse strains following disease induction by more than one method. If we study only one or two mouse strains with only one model of disease induction we may not be able to account for all the diversity that we observe in humans.  168  References  1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19.  Towbin, J.A., K.R. Bowles, and N.E. Bowles, Etiologies of cardiomyopathy and heart failure. Nat Med, 1999. 5(3): p. 266-7. Bagger, J.P., et al., Cardiomyopathy in western Denmark. Br Heart J, 1984. 52(3): p. 327-31. Codd, M.B., et al., Epidemiology of idiopathic dilated and hypertrophic cardiomyopathy. A population-based study in Olmsted County, Minnesota, 19751984. Circulation, 1989. 80(3): p. 564-72. Dec, G.W. and V. Fuster, Idiopathic dilated cardiomyopathy. N Engl J Med, 1994. 331(23): p. 1564-75. Gillum, R.F., Idiopathic dilated cardiomyopathy. Epidemiology, 1994. 5(3): p. 383-5. Williams, D.G. and E.G. Olsen, Prevalence of overt dilated cardiomyopathy in two regions of England. Br Heart J, 1985. 54(2): p. 153-5. Gauntt, C.J., et al., Characterization and myocarditic capabilities of coxsackievirus B3 variants in selected mouse strains. J Virol, 1984. 52(2): p. 598-605. Beck, M.A., Increased virulence of coxsackievirus B3 in mice due to vitamin E or selenium deficiency. J Nutr, 1997. 127(5 Suppl): p. 966S-970S. Beck, M.A., D. Williams-Toone, and O.A. Levander, Coxsackievirus B3-resistant mice become susceptible in Se/vitamin E deficiency. Free Radic Biol Med, 2003. 34(10): p. 1263-70. Baig, M.K., et al., Familial dilated cardiomyopathy: cardiac abnormalities are common in asymptomatic relatives and may represent early disease. J Am Coll Cardiol, 1998. 31(1): p. 195-201. Grunig, E., et al., Frequency and phenotypes of familial dilated cardiomyopathy. J Am Coll Cardiol, 1998. 31(1): p. 186-94. Keeling, P.J., et al., Familial dilated cardiomyopathy in the United Kingdom. Br Heart J, 1995. 73(5): p. 417-21. Caforio, A.L., et al., Prospective familial assessment in dilated cardiomyopathy: cardiac autoantibodies predict disease development in asymptomatic relatives. Circulation, 2007. 115(1): p. 76-83. Felker, G.M., et al., The spectrum of dilated cardiomyopathy. The Johns Hopkins experience with 1,278 patients. Medicine (Baltimore), 1999. 78(4): p. 270-83. Kuhl, U., et al., Viral persistence in the myocardium is associated with progressive cardiac dysfunction. Circulation, 2005. 112(13): p. 1965-70. Nakamura, H., et al., Autoimmune response in chronic ongoing myocarditis demonstrated by heterotopic cardiac transplantation in mice. Circulation, 1996. 94(12): p. 3348-54. Kodama, M., et al., Immunohistochemical characterization of infiltrating mononuclear cells in the rat heart with experimental autoimmune giant cell myocarditis. Clin Exp Immunol, 1992. 90(2): p. 330-5. Morita, H., Experimental coxsackie B-3 virus myocarditis in golden hamsters. Light and electron microscopy findings in a long-term follow-up study. Jpn Circ J, 1981. 45(6): p. 713-29. Cruz-Chan, J.V., et al., Immunopathology of natural infection with Trypanosoma cruzi in dogs. Vet Parasitol, 2009. 162(1-2): p. 151-5. 169  20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38.  Kodama, M., et al., A novel experimental model of giant cell myocarditis induced in rats by immunization with cardiac myosin fraction. Clin Immunol Immunopathol, 1990. 57(2): p. 250-62. Li, Y., et al., Cryptic epitope identified in rat and human cardiac myosin S2 region induces myocarditis in the Lewis rat. J Immunol, 2004. 172(5): p. 3225-34. Neu, N., et al., Cardiac myosin induces myocarditis in genetically predisposed mice. J Immunol, 1987. 139(11): p. 3630-6. Pummerer, C.L., et al., Identification of cardiac myosin peptides capable of inducing autoimmune myocarditis in BALB/c mice. J Clin Invest, 1996. 97(9): p. 2057-62. Blyszczuk, P., et al., Myeloid differentiation factor-88/interleukin-1 signaling controls cardiac fibrosis and heart failure progression in inflammatory dilated cardiomyopathy. Circ Res, 2009. 105(9): p. 912-20. Lawson, C.M., et al., Genetic control of mouse cytomegalovirus-induced myocarditis. Immunology, 1990. 69(1): p. 20-6. Pankuweit, S., et al., Pathophysiology and aetiological diagnosis of inflammatory myocardial diseases with a special focus on parvovirus B19. J Vet Med B Infect Dis Vet Public Health, 2005. 52(7-8): p. 344-7. Cunningham, C. and C.H. Lee, Myocarditis related to Campylobacter jejuni infection: a case report. BMC Infect Dis, 2003. 3: p. 16. Hannu, T., et al., Three cases of cardiac complications associated with Campylobacter jejuni infection and review of the literature. Eur J Clin Microbiol Infect Dis, 2005. 24(9): p. 619-22. Westling, K. and B. Evengard, Myocarditis associated with Campylobacter infection. Scand J Infect Dis, 2001. 33(11): p. 877-8. Odeh, M. and A. Oliven, Chlamydial infections of the heart. Eur J Clin Microbiol Infect Dis, 1992. 11(10): p. 885-93. Odeh, M., et al., Dilated cardiomyopathy associated with Chlamydia trachomatis infection. J Intern Med, 1991. 229(3): p. 289-91. Gura, T., Chlamydia protein linked to heart disease. Science, 1999. 283(5406): p. 1238-9. Bachmaier, K., et al., Chlamydia infections and heart disease linked through antigenic mimicry. Science, 1999. 283(5406): p. 1335-9. Walder, G., et al., Co-infection with two Chlamydophila species in a case of fulminant myocarditis. Crit Care Med, 2007. 35(2): p. 623-6. Leleiko, R.M., D.J. Bower, and C.P. Larsen, MRSA-Associated Bacterial Myocarditis Causing Ruptured Ventricle and Tamponade. Cardiology, 2008. 111(3): p. 188-190. Guilherme, L., et al., T cell response in rheumatic fever: crossreactivity between streptococcal M protein peptides and heart tissue proteins. Curr Protein Pept Sci, 2007. 8(1): p. 39-44. Guilherme, L., J. Kalil, and M. Cunningham, Molecular mimicry in the autoimmune pathogenesis of rheumatic heart disease. Autoimmunity, 2006. 39(1): p. 31-9. Guilherme, L., et al., T-cell reactivity against streptococcal antigens in the periphery mirrors reactivity of heart-infiltrating T lymphocytes in rheumatic heart disease patients. Infect Immun, 2001. 69(9): p. 5345-51.  170  39. 40. 41. 42. 43. 44. 45.  46.  47. 48. 49. 50. 51. 52. 53. 54. 55. 56.  Ramasawmy, R., et al., Association of polymorphisms within the promoter region of the tumor necrosis factor-alpha with clinical outcomes of rheumatic fever. Mol Immunol, 2007. 44(8): p. 1873-8. Guilherme, L., et al., Molecular pathogenesis of rheumatic fever and rheumatic heart disease. Expert Rev Mol Med, 2005. 7(28): p. 1-15. Macedo, A.M., R.P. Oliveira, and S.D. Pena, Chagas disease: role of parasite genetic variation in pathogenesis. Expert Rev Mol Med, 2002. 4(5): p. 1-16. Gulizia, J.M., M.W. Cunningham, and B.M. McManus, Immunoreactivity of antistreptococcal monoclonal antibodies to human heart valves. Evidence for multiple cross-reactive epitopes. Am J Pathol, 1991. 138(2): p. 285-301. Fae, K.C., et al., Mimicry in recognition of cardiac myosin peptides by heartintralesional T cell clones from rheumatic heart disease. J Immunol, 2006. 176(9): p. 5662-70. Cunningham, M.W., et al., Cytotoxic and viral neutralizing antibodies crossreact with streptococcal M protein, enteroviruses, and human cardiac myosin. Proc Natl Acad Sci U S A, 1992. 89(4): p. 1320-4. Huber, S.A., A. Moraska, and M. Cunningham, Alterations in major histocompatibility complex association of myocarditis induced by coxsackievirus B3 mutants selected with monoclonal antibodies to group A streptococci. Proc Natl Acad Sci U S A, 1994. 91(12): p. 5543-7. Huber, S.A. and M.W. Cunningham, Streptococcal M protein peptide with similarity to myosin induces CD4+ T cell-dependent myocarditis in MRL/++ mice and induces partial tolerance against coxsakieviral myocarditis. J Immunol, 1996. 156(9): p. 3528-34. Messias Reason, I.J., et al., The association between mannose-binding lectin gene polymorphism and rheumatic heart disease. Hum Immunol, 2006. 67(12): p. 991-8. Berdeli, A., et al., TLR-2 gene Arg753Gln polymorphism is strongly associated with acute rheumatic fever in children. J Mol Med, 2005. 83(7): p. 535-41. Control of Chagas disease. Report of a WHO Expert Committee. World Health Organ Tech Rep Ser, 1991. 811: p. 1-95. Yacoub, S., A.O. Mocumbi, and M.H. Yacoub, Neglected tropical cardiomyopathies: I. Chagas disease: myocardial disease. Heart, 2008. 94(2): p. 244-8. Bestetti, R.B. and G. Muccillo, Clinical course of Chagas' heart disease: a comparison with dilated cardiomyopathy. Int J Cardiol, 1997. 60(2): p. 187-93. Punukollu, G., et al., Clinical aspects of the Chagas' heart disease. Int J Cardiol, 2007. 115(3): p. 279-83. Bestetti, R.B., et al., Clinical and morphological characteristics associated with sudden cardiac death in patients with Chagas' disease. Eur Heart J, 1993. 14(12): p. 1610-4. Tarleton, R.L., et al., Trypanosoma cruzi infection in MHC-deficient mice: further evidence for the role of both class I- and class II-restricted T cells in immune resistance and disease. Int Immunol, 1996. 8(1): p. 13-22. Hall, B.S., et al., Cell-specific activation of nuclear factor-kappaB by the parasite Trypanosoma cruzi promotes resistance to intracellular infection. Mol Biol Cell, 2000. 11(1): p. 153-60. Bahia-Oliveira, L.M., et al., IFN-gamma in human Chagas' disease: protection or pathology? Braz J Med Biol Res, 1998. 31(1): p. 127-31. 171  57. 58. 59. 60. 61. 62. 63. 64. 65. 66. 67.  68. 69. 70. 71. 72. 73. 74.  Powell, M.R., et al., Cytokine mRNA levels in the hearts of inbred mice that develop different degrees of cardiomyopathy during infection with Trypanosoma cruzi. Parasite Immunol, 1998. 20(10): p. 463-71. Umekita, L.F. and I. Mota, How are antibodies involved in the protective mechanism of susceptible mice infected with T. cruzi? Braz J Med Biol Res, 2000. 33(3): p. 253-8. Lenzo, J.C., et al., Characterisation of murine cytomegalovirus myocarditis: cellular infiltration of the heart and virus persistence. J Mol Cell Cardiol, 2002. 34(6): p. 629-40. Klingel, K., et al., Molecular pathology of inflammatory cardiomyopathy. Med Microbiol Immunol, 2004. 193(2-3): p. 101-7. Nigro, G., et al., Human parvovirus B19 infection in infancy associated with acute and chronic lymphocytic myocarditis and high cytokine levels: report of 3 cases and review. Clin Infect Dis, 2000. 31(1): p. 65-9. Bergelson, J.M., et al., Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science, 1997. 275(5304): p. 1320-3. Shafren, D.R., et al., Coxsackieviruses B1, B3, and B5 use decay accelerating factor as a receptor for cell attachment. J Virol, 1995. 69(6): p. 3873-7. Poller, W., et al., Highly variable expression of virus receptors in the human cardiovascular system. Implications for cardiotropic viral infections and gene therapy. Z Kardiol, 2002. 91(12): p. 978-91. Schmidtke, M., et al., The viral genetic background determines the outcome of coxsackievirus B3 infection in outbred NMRI mice. J Med Virol, 2007. 79(9): p. 1334-42. Tracy, S., et al., Group B coxsackievirus myocarditis and pancreatitis: connection between viral virulence phenotypes in mice. J Med Virol, 2000. 62(1): p. 70-81. Fairweather, D., et al., Interferon-gamma protects against chronic viral myocarditis by reducing mast cell degranulation, fibrosis, and the profibrotic cytokines transforming growth factor-beta 1, interleukin-1 beta, and interleukin-4 in the heart. Am J Pathol, 2004. 165(6): p. 1883-94. Horwitz, M.S., et al., Induction of antigen specific peripheral humoral tolerance to cardiac myosin does not prevent CB3-mediated autoimmune myocarditis. J Autoimmun, 2005. 25(2): p. 102-11. Neu, N., B. Ploier, and C. Ofner, Cardiac myosin-induced myocarditis. Heart autoantibodies are not involved in the induction of the disease. J Immunol, 1990. 145(12): p. 4094-100. Li, Y., et al., Mimicry and antibody-mediated cell signaling in autoimmune myocarditis. J Immunol, 2006. 177(11): p. 8234-40. Chapman, N.M., et al., Sites other than nucleotide 234 determine cardiovirulence in natural isolates of coxsackievirus B3. J Med Virol, 1997. 52(3): p. 258-61. Tu, Z., et al., The cardiovirulent phenotype of coxsackievirus B3 is determined at a single site in the genomic 5' nontranslated region. J Virol, 1995. 69(8): p. 460718. Meerovitch, K., R. Nicholson, and N. Sonenberg, In vitro mutational analysis of cis-acting RNA translational elements within the poliovirus type 2 5' untranslated region. J Virol, 1991. 65(11): p. 5895-901. Nicholson, R., et al., Structural and functional analysis of the ribosome landing pad of poliovirus type 2: in vivo translation studies. J Virol, 1991. 65(11): p. 588694. 172  75. 76. 77.  78. 79. 80. 81. 82. 83. 84. 85. 86. 87. 88. 89. 90. 91. 92.  Knowlton, K.U., et al., A mutation in the puff region of VP2 attenuates the myocarditic phenotype of an infectious cDNA of the Woodruff variant of coxsackievirus B3. J Virol, 1996. 70(11): p. 7811-8. Muckelbauer, J.K. and M.G. Rossmann, The structure of coxsackievirus B3. Curr Top Microbiol Immunol, 1997. 223: p. 191-208. Zhang, H., et al., Detection of enterovirus capsid protein VP1 in myocardium from cases of myocarditis or dilated cardiomyopathy by immunohistochemistry: further evidence of enterovirus persistence in myocytes. Med Microbiol Immunol, 2004. 193(2-3): p. 109-14. Wessely, R., et al., Low-level expression of a mutant coxsackieviral cDNA induces a myocytopathic effect in culture: an approach to the study of enteroviral persistence in cardiac myocytes. Circulation, 1998. 98(5): p. 450-7. Wessely, R., et al., Transgenic expression of replication-restricted enteroviral genomes in heart muscle induces defective excitation-contraction coupling and dilated cardiomyopathy. J Clin Invest, 1998. 102(7): p. 1444-53. Kim, K.S., et al., 5'-Terminal deletions occur in coxsackievirus B3 during replication in murine hearts and cardiac myocyte cultures and correlate with encapsidation of negative-strand viral RNA. J Virol, 2005. 79(11): p. 7024-41. Kim, K.S., N.M. Chapman, and S. Tracy, Replication of coxsackievirus B3 in primary cell cultures generates novel viral genome deletions. J Virol, 2008. 82(4): p. 2033-7. Chapman, N.M., et al., 5' terminal deletions in the genome of a coxsackievirus B2 strain occurred naturally in human heart. Virology, 2008. Matsumori, A., et al., Suppression of cytokines and nitric oxide production, and protection against lethal endotoxemia and viral myocarditis by a new NF-kappaB inhibitor. Eur J Heart Fail, 2004. 6(2): p. 137-44. Horwitz, M.S., et al., Transforming growth factor-beta inhibits coxsackievirusmediated autoimmune myocarditis. Viral Immunol, 2006. 19(4): p. 722-33. Horwitz, M.S., et al., Pancreatic expression of interferon-gamma protects mice from lethal coxsackievirus B3 infection and subsequent myocarditis. Nat Med, 2000. 6(6): p. 693-7. Sonderegger, I., et al., Neutralization of IL-17 by active vaccination inhibits IL-23dependent autoimmune myocarditis. Eur J Immunol, 2006. 36(11): p. 2849-56. Eriksson, U., et al., Activation of dendritic cells through the interleukin 1 receptor 1 is critical for the induction of autoimmune myocarditis. J Exp Med, 2003. 197(3): p. 323-31. Schmidtke, M., et al., Cytokine profiles in heart, spleen, and thymus during the acute stage of experimental coxsackievirus B3-induced chronic myocarditis. J Med Virol, 2000. 61(4): p. 518-26. Seko, Y., et al., Expression of cytokine mRNAs in murine hearts with acute myocarditis caused by coxsackievirus b3. J Pathol, 1997. 183(1): p. 105-8. Gluck, B., et al., Persistent expression of cytokines in the chronic stage of CVB3induced myocarditis in NMRI mice. J Mol Cell Cardiol, 2001. 33(9): p. 1615-26. Eriksson, U., et al., Dual role of the IL-12/IFN-gamma axis in the development of autoimmune myocarditis: induction by IL-12 and protection by IFN-gamma. J Immunol, 2001. 167(9): p. 5464-9. Fairweather, D., et al., IL-12 protects against coxsackievirus B3-induced myocarditis by increasing IFN-gamma and macrophage and neutrophil populations in the heart. J Immunol, 2005. 174(1): p. 261-9. 173  93. 94. 95. 96. 97. 98. 99. 100. 101. 102. 103. 104. 105. 106. 107. 108. 109.  Smith, S.C. and P.M. Allen, Neutralization of endogenous tumor necrosis factor ameliorates the severity of myosin-induced myocarditis. Circ Res, 1992. 70(4): p. 856-63. Afanasyeva, M., et al., Experimental autoimmune myocarditis in A/J mice is an interleukin-4-dependent disease with a Th2 phenotype. Am J Pathol, 2001. 159(1): p. 193-203. Eriksson, U., et al., Lethal autoimmune myocarditis in interferon-gamma receptor-deficient mice: enhanced disease severity by impaired inducible nitric oxide synthase induction. Circulation, 2001. 103(1): p. 18-21. Cihakova, D., et al., Interleukin-13 protects against experimental autoimmune myocarditis by regulating macrophage differentiation. Am J Pathol, 2008. 172(5): p. 1195-208. Li, J., et al., Immunomodulation by interleukin-4 suppresses matrix metalloproteinases and improves cardiac function in murine myocarditis. Eur J Pharmacol, 2007. 554(1): p. 60-8. Jiang, Z., et al., Remission of CVB3-induced viral myocarditis by in vivo Th2 polarization via hydrodynamics-based interleukin-4 gene transfer. J Gene Med, 2008. 10(8): p. 918-29. Hofmann, P., et al., Suppression of proinflammatory cytokines and induction of IL-10 in human monocytes after coxsackievirus B3 infection. J Med Virol, 2001. 64(4): p. 487-98. Nishio, R., et al., Treatment of experimental viral myocarditis with interleukin-10. Circulation, 1999. 100(10): p. 1102-8. Henke, A., et al., Expression of immunoregulatory cytokines by recombinant coxsackievirus B3 variants confers protection against virus-caused myocarditis. J Virol, 2001. 75(17): p. 8187-94. Szalay, G., et al., Sustained nitric oxide synthesis contributes to immunopathology in ongoing myocarditis attributable to interleukin-10 disorders. Am J Pathol, 2006. 169(6): p. 2085-93. Kaya, Z., et al., Cutting edge: a critical role for IL-10 in induction of nasal tolerance in experimental autoimmune myocarditis. J Immunol, 2002. 168(4): p. 1552-6. Bachmaier, K., et al., Low-molecular-weight tumor necrosis factor receptor p55 controls induction of autoimmune heart disease. Circulation, 1997. 95(3): p. 65561. Bryant, D., et al., Cardiac failure in transgenic mice with myocardial expression of tumor necrosis factor-alpha. Circulation, 1998. 97(14): p. 1375-81. Calabrese, F., et al., Overexpression of tumor necrosis factor (TNF)alpha and TNFalpha receptor I in human viral myocarditis: clinicopathologic correlations. Mod Pathol, 2004. 17(9): p. 1108-18. Henke, A., et al., Coxsackievirus B3-induced production of tumor necrosis factoralpha, IL-1 beta, and IL-6 in human monocytes. J Immunol, 1992. 148(7): p. 2270-7. Huber, S., Tumor necrosis factor-alpha promotes myocarditis in female mice infected with coxsackievirus B3 through upregulation of CD1d on hematopoietic cells. Viral Immunol, 2010. 23(1): p. 79-86. Huber, S.A. and D. Sartini, Roles of tumor necrosis factor alpha (TNF-alpha) and the p55 TNF receptor in CD1d induction and coxsackievirus B3-induced myocarditis. J Virol, 2005. 79(5): p. 2659-65. 174  110. 111. 112. 113. 114. 115. 116. 117. 118. 119. 120. 121. 122. 123. 124. 125. 126. 127. 128.  Jibiki, T., et al., Expression of tumor necrosis factor-alpha protein in the myocardium in fatal myocarditis. Pediatr Int, 2000. 42(1): p. 43-7. Kubota, T., et al., Cardiac-specific overexpression of tumor necrosis factor-alpha causes lethal myocarditis in transgenic mice. J Card Fail, 1997. 3(2): p. 117-24. Kubota, T., et al., Dilated cardiomyopathy in transgenic mice with cardiac-specific overexpression of tumor necrosis factor-alpha. Circ Res, 1997. 81(4): p. 627-35. Lane, J.R., et al., Interleukin 1 or tumor necrosis factor can promote Coxsackie B3-induced myocarditis in resistant B10.A mice. J Exp Med, 1992. 175(4): p. 1123-9. Lane, J.R., et al., Role of IL-1 and tumor necrosis factor in coxsackie virusinduced autoimmune myocarditis. J Immunol, 1993. 151(3): p. 1682-90. Meldrum, D.R., Tumor necrosis factor in the heart. Am J Physiol, 1998. 274(3 Pt 2): p. R577-95. Torre-Amione, G., et al., Expression and functional significance of tumor necrosis factor receptors in human myocardium. Circulation, 1995. 92(6): p. 1487-93. Wada, H., et al., Tumor necrosis factor-alpha (TNF-alpha) plays a protective role in acute viralmyocarditis in mice: A study using mice lacking TNF-alpha. Circulation, 2001. 103(5): p. 743-9. Yamada, T., A. Matsumori, and S. Sasayama, Therapeutic effect of anti-tumor necrosis factor-alpha antibody on the murine model of viral myocarditis induced by encephalomyocarditis virus. Circulation, 1994. 89(2): p. 846-51. Shioi, T., A. Matsumori, and S. Sasayama, Persistent expression of cytokine in the chronic stage of viral myocarditis in mice. Circulation, 1996. 94(11): p. 29307. Lim, B.K., et al., Local expression of interleukin-1 receptor antagonist by plasmid DNA improves mortality and decreases myocardial inflammation in experimental coxsackieviral myocarditis. Circulation, 2002. 105(11): p. 1278-81. Huber, S.A., et al., Augmentation of pathogenesis of coxsackievirus B3 infections in mice by exogenous administration of interleukin-1 and interleukin-2. J Virol, 1994. 68(1): p. 195-206. Funakoshi, H., et al., Involvement of inducible nitric oxide synthase in cardiac dysfunction with tumor necrosis factor-alpha. Am J Physiol Heart Circ Physiol, 2002. 282(6): p. H2159-66. Huber, S.A., A.M. Feldman, and D. Sartini, Coxsackievirus B3 induces T regulatory cells, which inhibit cardiomyopathy in tumor necrosis factor-alpha transgenic mice. Circ Res, 2006. 99(10): p. 1109-16. Afanasyeva, M., et al., Interleukin-12 receptor/STAT4 signaling is required for the development of autoimmune myocarditis in mice by an interferon-gammaindependent pathway. Circulation, 2001. 104(25): p. 3145-51. Shioi, T., et al., Protective role of interleukin-12 in viral myocarditis. J Mol Cell Cardiol, 1997. 29(9): p. 2327-34. Samoilova, E.B., et al., IL-6-deficient mice are resistant to experimental autoimmune encephalomyelitis: roles of IL-6 in the activation and differentiation of autoreactive T cells. J Immunol, 1998. 161(12): p. 6480-6. Alonzi, T., et al., Interleukin 6 is required for the development of collagen-induced arthritis. J Exp Med, 1998. 187(4): p. 461-8. Ohshima, S., et al., Interleukin 6 plays a key role in the development of antigeninduced arthritis. Proc Natl Acad Sci U S A, 1998. 95(14): p. 8222-6. 175  129. 130. 131. 132. 133. 134.  135. 136.  137. 138. 139. 140. 141. 142. 143. 144.  Rangachari, M., et al., T-bet negatively regulates autoimmune myocarditis by suppressing local production of interleukin 17. J Exp Med, 2006. 203(8): p. 200919. Frohlich, A., et al., IL-21 receptor signaling is integral to the development of Th2 effector responses in vivo. Blood, 2007. 109(5): p. 2023-31. Sonderegger, I., et al., GM-CSF mediates autoimmunity by enhancing IL-6dependent Th17 cell development and survival. J Exp Med, 2008. 205(10): p. 2281-94. Yuan, J., et al., Th17 cells contribute to viral replication in coxsackievirus B3induced acute viral myocarditis. J Immunol, 2010. 185(7): p. 4004-10. Yuan, J., et al., Neutralization of IL-17 inhibits the production of anti-ANT autoantibodies in CVB3-induced acute viral myocarditis. Int Immunopharmacol, 2010. 10(3): p. 272-6. Goser, S., et al., Critical role for monocyte chemoattractant protein-1 and macrophage inflammatory protein-1alpha in induction of experimental autoimmune myocarditis and effective anti-monocyte chemoattractant protein-1 gene therapy. Circulation, 2005. 112(22): p. 3400-7. Cook, D.N., et al., Requirement of MIP-1 alpha for an inflammatory response to viral infection. Science, 1995. 269(5230): p. 1583-5. Luppi, P., et al., Expansion of specific alphabeta+ T-cell subsets in the myocardium of patients with myocarditis and idiopathic dilated cardiomyopathy associated with Coxsackievirus B infection. Hum Immunol, 2003. 64(2): p. 194210. Huber, S.A., Increased susceptibility of male BALB/c mice to coxsackievirus B3induced myocarditis: role for CD1d. Med Microbiol Immunol, 2005. 194(3): p. 121-7. Fairweather, D. and N.R. Rose, Coxsackievirus-induced myocarditis in mice: a model of autoimmune disease for studying immunotoxicity. Methods, 2007. 41(1): p. 118-22. Li, K., et al., Differential macrophage polarization in male and female BALB/c mice infected with coxsackievirus B3 defines susceptibility to viral myocarditis. Circ Res, 2009. 105(4): p. 353-64. Fairweather, D., et al., Mast cells and innate cytokines are associated with susceptibility to autoimmune heart disease following coxsackievirus B3 infection. Autoimmunity, 2004. 37(2): p. 131-45. Huber, S.A., Depletion of gammadelta+ T cells increases CD4+ FoxP3 (T regulatory) cell response in coxsackievirus B3-induced myocarditis. Immunology, 2009. 127(4): p. 567-76. Shi, Y., et al., Regulatory T cells protect mice against coxsackievirus-induced myocarditis through the transforming growth factor beta-coxsackie-adenovirus receptor pathway. Circulation, 2010. 121(24): p. 2624-34. Boyd, J.H., et al., Toll-like receptor stimulation in cardiomyoctes decreases contractility and initiates an NF-kappaB dependent inflammatory response. Cardiovasc Res, 2006. 72(3): p. 384-93. Triantafilou, K., et al., Human cardiac inflammatory responses triggered by Coxsackie B viruses are mainly Toll-like receptor (TLR) 8-dependent. Cell Microbiol, 2005. 7(8): p. 1117-26.  176  145. 146. 147. 148. 149. 150. 151. 152. 153. 154. 155.  156. 157. 158. 159. 160. 161.  Satoh, M., et al., Association between toll-like receptor 8 expression and adverse clinical outcomes in patients with enterovirus-associated dilated cardiomyopathy. Am Heart J, 2007. 154(3): p. 581-8. Satoh, M., et al., Expression of Toll-like receptor 4 is associated with enteroviral replication in human myocarditis. Clin Sci (Lond), 2003. 104(6): p. 577-84. Satoh, M., et al., Toll-like receptor 4 is expressed with enteroviral replication in myocardium from patients with dilated cardiomyopathy. Lab Invest, 2004. 84(2): p. 173-81. Fairweather, D., et al., IL-12 receptor beta 1 and Toll-like receptor 4 increase IL-1 beta- and IL-18-associated myocarditis and coxsackievirus replication. J Immunol, 2003. 170(9): p. 4731-7. Gonnella, P.A., et al., Inhibition of experimental autoimmune myocarditis: peripheral deletion of TcR Vbeta 8.1, 8.2+ CD4+ T cells in TLR-4 deficient mice. J Autoimmun, 2008. 31(2): p. 180-7. Negishi, H., et al., A critical link between Toll-like receptor 3 and type II interferon signaling pathways in antiviral innate immunity. Proc Natl Acad Sci U S A, 2008. 105(51): p. 20446-51. Gorbea, C., et al., A role for Toll-like receptor 3 variants in host susceptibility to enteroviral myocarditis and dilated cardiomyopathy. J Biol Chem, 2010. 285(30): p. 23208-23. Zhang, P., et al., Cutting edge: cardiac myosin activates innate immune responses through TLRs. J Immunol, 2009. 183(1): p. 27-31. Fuse, K., et al., Myeloid differentiation factor-88 plays a crucial role in the pathogenesis of Coxsackievirus B3-induced myocarditis and influences type I interferon production. Circulation, 2005. 112(15): p. 2276-85. Marty, R.R., et al., MyD88 signaling controls autoimmune myocarditis induction. Circulation, 2006. 113(2): p. 258-65. Fairweather, D., et al., Complement receptor 1 and 2 deficiency increases coxsackievirus B3-induced myocarditis, dilated cardiomyopathy, and heart failure by increasing macrophages, IL-1beta, and immune complex deposition in the heart. J Immunol, 2006. 176(6): p. 3516-24. Karkkainen, S. and K. Peuhkurinen, Genetics of dilated cardiomyopathy. Ann Med, 2007. 39(2): p. 91-107. Blom, N., et al., Cleavage site analysis in picornaviral polyproteins: discovering cellular targets by neural networks. Protein Sci, 1996. 5(11): p. 2203-16. Badorff, C., et al., Enteroviral protease 2A cleaves dystrophin: evidence of cytoskeletal disruption in an acquired cardiomyopathy. Nat Med, 1999. 5(3): p. 320-6. Xiong, D., et al., Inducible cardiac-restricted expression of enteroviral protease 2A is sufficient to induce dilated cardiomyopathy. Circulation, 2007. 115(1): p. 94-102. Badorff, C. and K.U. Knowlton, Dystrophin disruption in enterovirus-induced myocarditis and dilated cardiomyopathy: from bench to bedside. Med Microbiol Immunol, 2004. 193(2-3): p. 121-6. Lee, G.H., C. Badorff, and K.U. Knowlton, Dissociation of sarcoglycans and the dystrophin carboxyl terminus from the sarcolemma in enteroviral cardiomyopathy. Circ Res, 2000. 87(6): p. 489-95.  177  162. 163. 164. 165. 166. 167. 168. 169. 170. 171. 172.  173. 174. 175. 176. 177. 178. 179.  Xiong, D., et al., Dystrophin deficiency markedly increases enterovirus-induced cardiomyopathy: a genetic predisposition to viral heart disease. Nat Med, 2002. 8(8): p. 872-7. Badorff, C., et al., Nitric oxide inhibits dystrophin proteolysis by coxsackieviral protease 2A through S-nitrosylation: A protective mechanism against enteroviral cardiomyopathy. Circulation, 2000. 102(18): p. 2276-81. Chau, D.H., et al., Coxsackievirus B3 proteases 2A and 3C induce apoptotic cell death through mitochondrial injury and cleavage of eIF4GI but not DAP5/p97/NAT1. Apoptosis, 2007. 12(3): p. 513-24. Henke, A., et al., Apoptosis in coxsackievirus B3-caused diseases: interaction between the capsid protein VP2 and the proapoptotic protein siva. J Virol, 2000. 74(9): p. 4284-90. Henke, A., et al., The apoptotic capability of coxsackievirus B3 is influenced by the efficient interaction between the capsid protein VP2 and the proapoptotic host protein Siva. Virology, 2001. 289(1): p. 15-22. Esfandiarei, M., et al., Novel role for integrin-linked kinase in modulation of coxsackievirus B3 replication and virus-induced cardiomyocyte injury. Circ Res, 2006. 99(4): p. 354-61. Taylor, L.A., et al., Host gene regulation during coxsackievirus B3 infection in mice: assessment by microarrays. Circ Res, 2000. 87(4): p. 328-34. Lane, J.R., et al., LPS promotes CB3-induced myocarditis in resistant B10.A mice. Cell Immunol, 1991. 136(1): p. 219-33. Kishimoto, C., Y. Hiraoka, and H. Takada, T cell-mediated immune response enhances the severity of myocarditis in secondary cardiotropic virus infection in mice. Basic Res Cardiol, 2001. 96(5): p. 439-45. Nakamura, H., et al., Repetitive coxsackievirus infection induces cardiac dilatation in post-myocarditic mice. Jpn Circ J, 1999. 63(10): p. 794-802. Frisancho-Kiss, S., et al., Gonadectomy of male BALB/c mice increases Tim-3(+) alternatively activated M2 macrophages, Tim-3(+) T cells, Th2 cells and Treg in the heart during acute coxsackievirus-induced myocarditis. Brain Behav Immun, 2009. 23(5): p. 649-57. Frisancho-Kiss, S., et al., Cutting edge: cross-regulation by TLR4 and T cell Ig mucin-3 determines sex differences in inflammatory heart disease. J Immunol, 2007. 178(11): p. 6710-4. Schwartz, J., D. Sartini, and S. Huber, Myocarditis susceptibility in female mice depends upon ovarian cycle phase at infection. Virology, 2004. 330(1): p. 16-23. Frisancho-Kiss, S., et al., Sex differences in coxsackievirus B3-induced myocarditis: IL-12Rbeta1 signaling and IFN-gamma increase inflammation in males independent from STAT4. Brain Res, 2006. 1126(1): p. 139-47. Chow, L.H., C.J. Gauntt, and B.M. McManus, Differential effects of myocarditic variants of Coxsackievirus B3 in inbred mice. A pathologic characterization of heart tissue damage. Lab Invest, 1991. 64(1): p. 55-64. Huber, S.A. and L.P. Job, Cellular immune mechanisms in Coxsackievirus group B, type 3 induced myocarditis in Balb/C mice. Adv Exp Med Biol, 1983. 161: p. 491-508. Leslie, K.O., et al., Progressive interstitial collagen deposition in Coxsackievirus B3-induced murine myocarditis. Am J Pathol, 1990. 136(3): p. 683-93. Leon, J.S. and D.M. Engman, Autoimmunity in Chagas heart disease. Int J Parasitol, 2001. 31(5-6): p. 555-61. 178  180. 181. 182. 183. 184. 185. 186. 187. 188. 189. 190. 191. 192. 193. 194. 195. 196. 197. 198.  Kawai, C., From myocarditis to cardiomyopathy: mechanisms of inflammation and cell death: learning from the past for the future. Circulation, 1999. 99(8): p. 1091-100. Lodge, P.A., et al., Coxsackievirus B-3 myocarditis. Acute and chronic forms of the disease caused by different immunopathogenic mechanisms. Am J Pathol, 1987. 128(3): p. 455-63. Anderson, D.R., et al., Direct interactions of coxsackievirus B3 with immune cells in the splenic compartment of mice susceptible or resistant to myocarditis. J Virol, 1996. 70(7): p. 4632-45. Leipner, C., et al., Coxsackievirus B3-induced myocarditis: differences in the immune response of C57BL/6 and Balb/c mice. Med Microbiol Immunol, 2004. 193(2-3): p. 141-7. Wolfgram, L.J., et al., Variations in the susceptibility to Coxsackievirus B3induced myocarditis among different strains of mice. J Immunol, 1986. 136(5): p. 1846-52. Van Houten, N. and S.A. Huber, Genetics of Coxsackie B3 (CVB3) myocarditis. Eur Heart J, 1991. 12 Suppl D: p. 108-12. Liao, L., et al., Cardiac alpha-myosin heavy chains differ in their induction of myocarditis. Identification of pathogenic epitopes. J Clin Invest, 1993. 92(6): p. 2877-82. Guler, M.L., et al., Two autoimmune diabetes loci influencing T cell apoptosis control susceptibility to experimental autoimmune myocarditis. J Immunol, 2005. 174(4): p. 2167-73. Aly, M., et al., Complex genetic control of host susceptibility to coxsackievirus B3-induced myocarditis. Genes Immun, 2007. 8(3): p. 193-204. Liao, L., et al., Antibody-mediated autoimmune myocarditis depends on genetically determined target organ sensitivity. J Exp Med, 1995. 181(3): p. 1123-31. Kuan, A.P., et al., Genetic control of autoimmune myocarditis mediated by myosin-specific antibodies. Immunogenetics, 1999. 49(2): p. 79-85. Yang, D., et al., Viral myocarditis: identification of five differentially expressed genes in coxsackievirus B3-infected mouse heart. Circ Res, 1999. 84(6): p. 70412. Bult, C.J., et al., The Mouse Genome Database (MGD): mouse biology and model systems. Nucleic Acids Res, 2008. 36(Database issue): p. D724-8. Larkin, M.A., et al., Clustal W and Clustal X version 2.0. Bioinformatics, 2007. 23(21): p. 2947-8. Shao, H., et al., Genetic architecture of complex traits: large phenotypic effects and pervasive epistasis. Proc Natl Acad Sci U S A, 2008. 105(50): p. 19910-4. Brown, C.A. and J.B. O'Connell, Myocarditis and idiopathic dilated cardiomyopathy. Am J Med, 1995. 99(3): p. 309-14. Eriksson, U., et al., Interleukin-6-deficient mice resist development of autoimmune myocarditis associated with impaired upregulation of complement C3. Circulation, 2003. 107(2): p. 320-5. Kanda, T., et al., Modification of viral myocarditis in mice by interleukin-6. Circ Res, 1996. 78(5): p. 848-56. Kanda, T. and T. Takahashi, Interleukin-6 and cardiovascular diseases. Jpn Heart J, 2004. 45(2): p. 183-93. 179  199. 200. 201. 202. 203. 204. 205. 206. 207.  208. 209. 210. 211. 212. 213. 214. 215.  Tanaka, T., et al., Overexpression of interleukin-6 aggravates viral myocarditis: impaired increase in tumor necrosis factor-alpha. J Mol Cell Cardiol, 2001. 33(9): p. 1627-35. Kopf, M., et al., Pleiotropic defects of IL-6-deficient mice including early hematopoiesis, T and B cell function, and acute phase responses. Ann N Y Acad Sci, 1995. 762: p. 308-18. Pasare, C. and R. Medzhitov, Toll pathway-dependent blockade of CD4+CD25+ T cell-mediated suppression by dendritic cells. Science, 2003. 299(5609): p. 1033-6. Bettelli, E., et al., Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature, 2006. 441(7090): p. 235-8. Korn, T., et al., IL-21 initiates an alternative pathway to induce proinflammatory T(H)17 cells. Nature, 2007. 448(7152): p. 484-7. Yajima, T., et al., Innate defense mechanism against virus infection within the cardiac myocyte requiring gp130-STAT3 signaling. Circulation, 2006. 114(22): p. 2364-73. Richards, H.B., et al., Interleukin 6 dependence of anti-DNA antibody production: evidence for two pathways of autoantibody formation in pristane-induced lupus. J Exp Med, 1998. 188(5): p. 985-90. Deng, C., et al., Resistance to experimental autoimmune myasthenia gravis in IL6-deficient mice is associated with reduced germinal center formation and C3 production. J Immunol, 2002. 169(2): p. 1077-83. Shen, Y., et al., Coxsackievirus group B type 3 infection upregulates expression of monocyte chemoattractant protein 1 in cardiac myocytes, which leads to enhanced migration of mononuclear cells in viral myocarditis. J Virol, 2004. 78(22): p. 12548-56. Kopf, M., et al., Impaired immune and acute-phase responses in interleukin-6deficient mice. Nature, 1994. 368(6469): p. 339-42. Richer, M., Poffenberger MC, Horwitz MS, Early inflammatory responses direct chronic autoimmunity development in the heart following coxsackievirus infection. Future Virology, 2007. 2(3): p. 283-291. Blackburn, S.D. and E.J. Wherry, IL-10, T cell exhaustion and viral persistence. Trends Microbiol, 2007. 15(4): p. 143-6. Girndt, M. and H. Kohler, Interleukin-10 (IL-10): an update on its relevance for cardiovascular risk. Nephrol Dial Transplant, 2003. 18(10): p. 1976-9. Bettelli, E., L.B. Nicholson, and V.K. Kuchroo, IL-10, a key effector regulatory cytokine in experimental autoimmune encephalomyelitis. J Autoimmun, 2003. 20(4): p. 265-7. Watanabe, K., et al., Protection against autoimmune myocarditis by gene transfer of interleukin-10 by electroporation. Circulation, 2001. 104(10): p. 1098100. Nishii, M., et al., Serum levels of interleukin-10 on admission as a prognostic predictor of human fulminant myocarditis. J Am Coll Cardiol, 2004. 44(6): p. 1292-7. Zhao, H.F., et al., Anti-monocyte chemoattractant protein 1 gene therapy attenuates experimental chronic pancreatitis induced by dibutyltin dichloride in rats. Gut, 2005. 54(12): p. 1759-67. 180  216. 217. 218. 219. 220. 221. 222. 223. 224. 225. 226. 227. 228. 229. 230. 231.  232. 233. 234. 235.  Rollins, B.J., et al., Cytokine-activated human endothelial cells synthesize and secrete a monocyte chemoattractant, MCP-1/JE. Am J Pathol, 1990. 136(6): p. 1229-33. Rollins, B.J., Chemokines. Blood, 1997. 90(3): p. 909-28. Kolattukudy, P.E., et al., Myocarditis induced by targeted expression of the MCP1 gene in murine cardiac muscle. Am J Pathol, 1998. 152(1): p. 101-11. Drory, Y., et al., Sudden unexpected death in persons less than 40 years of age. Am J Cardiol, 1991. 68(13): p. 1388-92. Feldman, A.M. and D. McNamara, Myocarditis. N Engl J Med, 2000. 343(19): p. 1388-98. Smith, W.G., Coxsackie B myopericarditis in adults. Am Heart J, 1970. 80(1): p. 34-46. Herskowitz, A., et al., Coxsackievirus B3 murine myocarditis: wide pathologic spectrum in genetically defined inbred strains. Hum Pathol, 1985. 16(7): p. 6713. Woodruff, J.F., Viral myocarditis. A review. Am J Pathol, 1980. 101(2): p. 425-84. Rose, N.R., et al., Postinfectious autoimmunity: two distinct phases of coxsackievirus B3-induced myocarditis. Ann N Y Acad Sci, 1986. 475: p. 146-56. Ligons, D.L., et al., A locus on chromosome 1 promotes susceptibility of experimental autoimmune myocarditis and lymphocyte cell death. Clin Immunol, 2009. 130(1): p. 74-82. Li, H.S., et al., Genetic differences in bone marrow-derived lymphoid lineages control susceptibility to experimental autoimmune myocarditis. J Immunol, 2008. 180(11): p. 7480-4. Li, H.S., D.L. Ligons, and N.R. Rose, Genetic complexity of autoimmune myocarditis. Autoimmun Rev, 2008. 7(3): p. 168-73. Singer, J.B., et al., Genetic dissection of complex traits with chromosome substitution strains of mice. Science, 2004. 304(5669): p. 445-8. Deruytter, N., O. Boulard, and H.J. Garchon, Mapping non-class II H2-linked loci for type 1 diabetes in nonobese diabetic mice. Diabetes, 2004. 53(12): p. 3323-7. Boulard, O., et al., An interval tightly linked to but distinct from the H2 complex controls both overt diabetes (Idd16) and chronic experimental autoimmune thyroiditis (Ceat1) in nonobese diabetic mice. Diabetes, 2002. 51(7): p. 2141-7. Marchant, D., et al., Bosentan enhances viral load via endothelin-1 receptor typeA-mediated p38 mitogen-activated protein kinase activation while improving cardiac function during coxsackievirus-induced myocarditis. Circ Res, 2009. 104(6): p. 813-21. Stevens, M.V., et al., MEKK4 regulates developmental EMT in the embryonic heart. Dev Dyn, 2006. 235(10): p. 2761-70. Birlea, S.A., et al., Genome-wide association study of generalized vitiligo in an isolated European founder population identifies SMOC2, in close proximity to IDDM8. J Invest Dermatol. 130(3): p. 798-803. Niwa, N., et al., Cav3.2 subunit underlies the functional T-type Ca2+ channel in murine hearts during the embryonic period. Am J Physiol Heart Circ Physiol, 2004. 286(6): p. H2257-63. Chen, C.C., et al., Abnormal coronary function in mice deficient in alpha1H Ttype Ca2+ channels. Science, 2003. 302(5649): p. 1416-8.  181  236. 237. 238. 239. 240. 241. 242. 243. 244. 245. 246. 247. 248. 249. 250. 251. 252. 253. 254. 255.  Poffenberger, M.C., et al., Novel nonmajor histocompatibility complex-linked loci from mouse chromosome 17 confer susceptibility to viral-mediated chronic autoimmune myocarditis. Circ Cardiovasc Genet, 2010. 3(5): p. 399-408. McCann, J.A., et al., The insulin-like growth factor-II receptor gene is associated with type 1 diabetes: evidence of a maternal effect. J Clin Endocrinol Metab, 2004. 89(11): p. 5700-6. Seko, Y., et al., Roles of programmed death-1 (PD-1)/PD-1 ligands pathway in the development of murine acute myocarditis caused by coxsackievirus B3. Cardiovasc Res, 2007. 75(1): p. 158-67. Dinesh, R.K., B.H. Hahn, and R.P. Singh, PD-1, gender, and autoimmunity. Autoimmun Rev, 2010. 9(8): p. 583-7. Francisco, L.M., P.T. Sage, and A.H. Sharpe, The PD-1 pathway in tolerance and autoimmunity. Immunol Rev, 2010. 236: p. 219-42. Nishimura, H., et al., Development of lupus-like autoimmune diseases by disruption of the PD-1 gene encoding an ITIM motif-carrying immunoreceptor. Immunity, 1999. 11(2): p. 141-51. Wang, J., et al., Establishment of NOD-Pdcd1-/- mice as an efficient animal model of type I diabetes. Proc Natl Acad Sci U S A, 2005. 102(33): p. 11823-8. Nishimura, H., et al., Autoimmune dilated cardiomyopathy in PD-1 receptordeficient mice. Science, 2001. 291(5502): p. 319-22. Wang, J., et al., PD-1 deficiency results in the development of fatal myocarditis in MRL mice. Int Immunol, 2010. 22(6): p. 443-52. Nielsen, C., et al., Association of a putative regulatory polymorphism in the PD-1 gene with susceptibility to type 1 diabetes. Tissue Antigens, 2003. 62(6): p. 4927. Kong, E.K., et al., A new haplotype of PDCD1 is associated with rheumatoid arthritis in Hong Kong Chinese. Arthritis Rheum, 2005. 52(4): p. 1058-62. Prokunina, L., et al., A regulatory polymorphism in PDCD1 is associated with susceptibility to systemic lupus erythematosus in humans. Nat Genet, 2002. 32(4): p. 666-9. Lee, S.H., et al., Association of the programmed cell death 1 (PDCD1) gene polymorphism with ankylosing spondylitis in the Korean population. Arthritis Res Ther, 2006. 8(6): p. R163. Barber, D.L., et al., Restoring function in exhausted CD8 T cells during chronic viral infection. Nature, 2006. 439(7077): p. 682-7. Sharma, N., et al., Functional role of the 5' terminal cloverleaf in Coxsackievirus RNA replication. Virology, 2009. 393(2): p. 238-49. Chapman, N.M., et al., 5' terminal deletions in the genome of a coxsackievirus B2 strain occurred naturally in human heart. Virology, 2008. 375(2): p. 480-91. Fairweather, D. and D. Cihakova, Alternatively activated macrophages in infection and autoimmunity. J Autoimmun, 2009. 33(3-4): p. 222-30. Poffenberger, M.C., et al., Lack of IL-6 during coxsackievirus infection heightens the early immune response resulting in increased severity of chronic autoimmune myocarditis. PLoS One, 2009. 4(7): p. e6207. Appay, V. and S.L. Rowland-Jones, RANTES: a versatile and controversial chemokine. Trends Immunol, 2001. 22(2): p. 83-7. Kimura, A., Molecular basis of hereditary cardiomyopathy: abnormalities in calcium sensitivity, stretch response, stress response and beyond. J Hum Genet, 2010. 55(2): p. 81-90. 182  Appendix A Generation of A17.MCP mice  183  To narrow the susceptibility regions of interest identified by the A17.M20 and A17.V19 mice, I generated mice congenic for smaller portions of these regions from an A/J genotype on an otherwise C57BL/6 background (Figure 2.1). The region identified by the A17.M20 mice was defined to be A/J between the microsatellite markers D17Mit164 (3924615 bp) and D17Mit101 (29405253 bp) while the A17.V19 mice contained an A/J genotype between the microsatellite markers D17Mit164 (3924615 bp) and D17Mit11. The exact base pair location of the microsatellite markers was determined using the Jackson Laboratory MGI database (http://www.informatics.jax.org/). I first bred A17.M20 and A17.V19 mice separately to C57BL/6 mice to generate mice heterozygous for the regions of interest (Figure 2.1). The heterozygous mice (A17.M20-B6 and A17.V19-B6) were then bred with C57BL/6 mice and the pups (F2 generation) were genotyped to identify mice with a recombination event within the region of interest. Pups with recombination events were identified by PCR of microsatellite markers within the regions of interest. Microsatellite markers are short sequence repeats that are known to differ in size between A/J and C57BL/6 mice. To identify microsatellite markers within the regions of interest I used the Jackson Laboratory MGI database Genes and Markers Query (http://www.informatics.jax.org/javawi2/servlet/WIFetch?page=markerQF). All pups from A17.M20-B6 x C57BL/6 breedings (M20-B6/B6 pups) were genotyped for the microsatellite markers D17Mit113, D17Mit46 and D17Mit198. Pups from the A17.V19-B6 x C57BL/6 breedings (V19-B6/B6 pups) were genotyped for microsatellite markers D17Mit113, D17Mit46, D17Mit198 and TNF-pAR. Pups identified to have a recombination event were genotyped for the remaining markers within the region of interest to generate a more precise map of the pup’s genotype. Of the 123 F2 generation mice generated from the A17.M20-B6 x C57BL/6 breeding, 8 pups had recombination events (Table A.1). Of the 176 F2 generation mice generated from the A17.V19-B6 x C57BL/6 breeding, 12 pups had recombination events (Table A.2). Eight M20-B6/B6 pups and nine V19-B6/B6 pups with recombination events were used to generate mice congenic for smaller segments of chromosome 17 (Table A.1 and A.2).  184  To generate mice homozygous for the new genotype, the F2 generation mice containing recombination events were bred with C57BL/6 mice (Figure 2.1). The pups (F3 generation) were screened for mice heterozygous for the new genotype. All microsatellite markers were PCR amplified to ensure that a new recombination event had not occurred. Female and male F3 generation mice heterozygous for the new genotype (Figure 2.1) were bred and the pups were screened to identify mice homozygous for the new genotype (A17.MCP strains). All microsatellite markers were PCR amplified to ensure that the genotype was correct. Mice homozygous for the new genotype were then bred to sustain the new congenic mouse strain (Figure 2.1). Two litters from each A17.MCP strain were infected to determine if the new genotype was sufficient to confer susceptibility to chronic myocarditis. The A17.MCP7, A17.MCP14 and A17.MCP22 strains were selected for further characterization as these mice contained small segments of A/J genotype conferring susceptibility to viral-induced myocarditis. These regions did not contain any genes previously linked with myocarditis development. The A17.MCP12 strain was selected for further characterized to determine the influence of the MHC/TNF locus alone. To precisely define the borders of these new congenic strains I sequenced genes with known SNP differences between the two microsatellite markers where the genotype changed from A/J to C57BL/6. Gene located near the center of the region between the known A/J and C57BL/6 microsatellite markers were sequenced first. Once the genotype at that location was determined, a new gene near the middle of the known A/J and C57BL/6 genotypes was chosen to be sequenced. Genes with SNP differences were identified using the Jackson Laboratory MGI database SNP Query (http://www.informatics.jax.org/javawi2/servlet/WIFetch?page=snpQF). Primer3 (http://frodo.wi.mit.edu/primer3/) was used to generate primers for amplification of DNA and sequencing. DNA from A/J, C57BL/6, B6.A17 and the strain of interest were sequenced for the SNPs of interest. Following PCR amplification of the region, the PCR products were isolated using a QIAquick PCR Purification Kit. The PCR products were then sequenced by the NAPS Unit (The University of British Columbia). The forward primer from the PCR amplification was used to prime the sequencing reaction.  185  Table A.1 A17.M20-C57BL/6 x C57BL/6 mice with recombination events  cM  D17Mit164 D17Mit113 D17Mit213 D17Mit46 D17Mit198 D17Mit101 D17Mit28 TNF D17Mit233 D17Mit11  4.1 6.5 9.33 11.7 16 16.4 18.44 19.06 20.9 22.8  bp location 3924615 12172308 16752157 25502885 27796090 29405253 34137861 35336335 36076118  A17.MCP strain number  .A17.M20  C57BL/6  M20B6/B6 36  M20B6/B6 46  M20B6/B6 48  M20B6/B6 65  M20B6/B6 76  M20B6/B6 77  M20B6/B6 89  M20B6/B6 101  B6 A/J A/J A/J A/J B6 B6 B6 B6 B6  B6 B6 B6 B6 B6 B6 B6 B6 B6 B6  B6 A/J A/J A/J B6 B6 B6 B6 B6 B6  B6 A/J A/J A/J B6 B6 B6 B6 B6 B6  B6 B6 A/J A/J A/J B6 B6 B6 B6 B6  B6 A/J B6 B6 B6 B6 B6 B6 B6 B6  B6 B6 A/J A/J A/J B6 B6 B6 B6 B6  B6 A/J A/J B6 B6 B6 B6 B6 B6 B6  B6 B6 B6 A/J A/J B6 B6 B6 B6 B6  B6 B6 B6 B6 A/J B6 B6 B6 B6 B6  1  2  3  10  9  16  22  21  186  Table A.2 A17.V19-C57BL/6 x C57BL/6 mice with recombination events  cM  D17Mit164 D17Mit113 D17Mit213 D17Mit46 D17Mit198 D17Mit101 D17Mit28 TNF D17Mit233 D17Mit11  4.1 6.5 9.33 11.7 16 16.4 18.44 19.06 20.9 22.8  bp location  3924615 12172308 16752157 25502885 27796090 29405253 34137861 35336335 36076118  A17.MCP strain number  .A17.V19  C57BL/6  V19B6/B6 24  V19B6/B6 27  V19B6/B6 62  V19B6/B6 66  V19B6/B6 92  V19B6/B6 96  V19B6/B6 103  V19B6/B6 123  V19B6/B6 126  V19B6/B6 142  V19B6/B6 148  V19B6/B6 151  B6 A/J A/J A/J A/J A/J A/J A/J A/J B6  B6 B6 B6 B6 B6 B6 B6 B6 B6 B6  B6 A/J A/J B6 B6 B6 B6 B6 B6 B6  B6 A/J A/J B6 B6 B6 B6 B6 B6 B6  B6 A/J A/J B6 B6 B6 B6 B6 B6 B6  B6 A/J B6 B6 B6 B6 B6 B6 B6 B6  B6 B6 B6 B6 A/J A/J A/J A/J A/J B6  B6 A/J A/J A/J B6 B6 B6 B6 B6 B6  B6 A/J B6 B6 B6 B6 B6 B6 B6 B6  B6 A/J B6 B6 B6 B6 B6 B6 B6 B6  B6 A/J A/J A/J B6 B6 B6 B6 B6 B6  B6 B6 B6 B6 B6 B6 B6 A/J A/J B6  B6 A/J B6 B6 B6 B6 B6 B6 B6 B6  B6 B6 A/J A/J A/J A/J A/J A/J B6 B6  7  12  13  17  14  15  18  19  20  187  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0071659/manifest

Comment

Related Items