UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Investigating the molecular mechanisms of Fusarium Head Blight resistance in wheat Foroud, Nora Afsaneh 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2011_spring_foroud_nora.pdf [ 4.57MB ]
Metadata
JSON: 24-1.0071635.json
JSON-LD: 24-1.0071635-ld.json
RDF/XML (Pretty): 24-1.0071635-rdf.xml
RDF/JSON: 24-1.0071635-rdf.json
Turtle: 24-1.0071635-turtle.txt
N-Triples: 24-1.0071635-rdf-ntriples.txt
Original Record: 24-1.0071635-source.json
Full Text
24-1.0071635-fulltext.txt
Citation
24-1.0071635.ris

Full Text

INVESTIGATING THE MOLECULAR MECHANISMS OF FUSARIUM HEAD BLIGHT RESISTANCE IN WHEAT  by  Nora Afsaneh Foroud  B.Sc., The University of Lethbridge, 2002 M.Sc., The University of Lethbridge, 2005  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  The Faculty of Graduate Studies  (Plant Science)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  March 2011  © Nora Afsaneh Foroud, 2011  Abstract  Fusarium Head Blight is a disease of cereal crops caused by a group of trichotheceneproducing Fusarium species. Two major forms of resistance to Fusarium Head Blight are Type I resistance (resistance to initial infection) and Type II resistance (resistance to disease spread). Using functional genomics approaches, the effect of FHB-elicitors on the defense response of three wheat genotypes that share the susceptible cv. 'Superb' pedigree were evaluated. Distinct differences were observed between the resistant genotypes and 'Superb', as well as between the Type I and Type II genotypes. The data presented in this thesis suggests that different molecular mechanisms exist not only between susceptibility and resistance responses, but also between different forms of genetic resistance. It is proposed here that Type I resistance involves a combination of structural features that slow fungal penetration and the activation of a systemic response in uninfected tissues adjacent to the site of infection to prevent and minimize secondary infection; whereas, Type II resistance is more likely a form of local resistance. Based on the results from the functional genomics study, follow up experiments where wheat heads were primed with FHB elictiors and subsequently inoculated with a virulent F. graminearum strain and evaluated for changes in disease outcomes, support the hypothesis that Type I resistance involves the activation of a systemic response. Furthermore, an analysis of the role of plant hormone signalling using a combination of genetic and biochemical analysis suggest that jasmonic acid signalling is involved in Fusarium Head Blight resistance.  ii  Preface  This thesis and all of its contents, including figures and diagrams, is original work, prepared by Nora A. Foroud, using Microsoft Office programs and ChemSketch (http://www.acdlabs.com/resources/freeware/chemsketch/). A version of Chapter 1 has been published as a review (Foroud NA., Eudes F. 2009. Trichothecenes in cereal grains. Int. J. Mol. Sci. 10:147-173).  The experiments presented in Chapter 2 were designed by Dr. François Eudes and Nora A. Foroud, with feedback provided by Dr. Brian Ellis. The remaining experiments (Chapters 3-4), were designed by Nora A. Foroud, with feedback provided by Drs. François Eudes and Brian Ellis. The project was funded by Agriculture and Agri-Food Canada (AAFC)-Lethbridge Research Centre, and the Alberta Agriculture Research Initiative.  All experimental work was conducted by Nora A. Foroud, with support provided as defined below: 1. Hybridization of fragmented and labeled cRNA to Affymetrix microarray chips (Chapter 2) was conducted by Brenda Oosterveen from Dr. Mark Jordan’s lab (AAFC-Winnipeg). 2. Dr. Thérèse Ouellet (AAFC-Ottawa) provided an improved annotation of the Affymetrix Wheat Gene Chip (Chapter 2). 3. Jenna Friedt (Co-op, University of Lethbridge), helped in the disease evaluation of FHB-infected heads for the hormone silencing experiment (Chapter 3). 4. Additional support is described within the thesis, including: a. protein sequencing (Chapter 2), hormone and DON quantification (Chapter 3) conducted at various service labs; b. transgenic plant material provided from other research teams within and outside of AAFC (Chapters 3 and 4). iii  Table of Contents  Abstract.............................................................................................................................. ii Preface............................................................................................................................... iii Table of Contents ............................................................................................................. iv List of Tables ..................................................................................................................... x List of Figures................................................................................................................... xi List of Schemes ............................................................................................................... xiii List of Abbreviations ..................................................................................................... xiv Acknowledgements ...................................................................................................... xviii Dedication ....................................................................................................................... xix 1. Introduction................................................................................................................... 1 1.1 History and Background ......................................................................................... 2 1.1.1 Fusarium Head Blight: a brief history ........................................................... 2 1.1.2 The impact of Fusarium Head Blight............................................................. 3 1.1.3 Fusarium Head Blight management strategies .............................................. 5 1.2 Fusarium Species.................................................................................................... 7 1.2.1 Diseases caused by Fusarium species............................................................ 7 1.2.2 Fusarium morphology and classification....................................................... 9 1.3 Trichothecenes ...................................................................................................... 11 1.3.1 Trichothecene structure and toxicity............................................................ 11 1.3.2 Trichothecenes as aggressiveness factors in Fusarium Head Blight ........... 13 1.4 Fusarium Head Blight Resistance......................................................................... 19 iv  1.4.1 Mechanisms of Fusarium Head Blight resistance........................................ 19 1.4.2 Sources of Fusarium Head Blight resistance ............................................... 23 1.4.3 Breeding for Fusarium Head Blight resistance............................................ 25 1.4.4 Engineering for Fusarium Head Blight resistance ....................................... 27 1.5 Overview............................................................................................................... 31 2. Differential Gene Expression and Protein Accumulation Patterns in Resistant and Susceptible Fusarium Head Blight Interactions in Wheat.......................................... 33 2.1 Introduction........................................................................................................... 33 2.2 Materials and Methods.......................................................................................... 36 2.2.1 Plant material ............................................................................................... 36 2.2.2 Inocula.......................................................................................................... 36 2.2.3 Inoculations and tissue collection ................................................................ 37 2.2.4 Microarray.................................................................................................... 39 2.2.5 Real-time RT-PCR....................................................................................... 40 2.2.6 Protein sample preparations ......................................................................... 41 2.2.7 2D-electrophoresis ....................................................................................... 42 2.2.8 2D-electrophoresis optimization for resolution in the basic range .............. 44 2.3 Results................................................................................................................... 46 2.3.1 Real-time RT- PCR validation of microarray results .................................. 76 2.3.2 Constitutive differences in gene expression ................................................ 76 2.3.3 Challenge-induced differences in global gene expression........................... 76 2.3.4 Challenge-induced differential gene expression related to defence response pathways ...................................................................................................... 77 v  2.3.5 2D-electrophoresis: optimization and resolution ......................................... 80 2.3.6 Genotype differences in protein accumulation ............................................ 81 2.3.7 Challenge-induced differential protein accumulation.................................. 83 2.4 Discussion ............................................................................................................. 84 2.4.1 Constitutive differences in gene expression ................................................ 84 2.4.2 Challenge-induced differences in gene expression and protein accumulation patterns ......................................................................................................... 85 2.4.3 Deoxynivalenol-induced up-regulation of genes encoding ribosomal proteins in Fusarium Head Blight-resistant wheat..................................................... 87 2.4.4 Early expression of pathogenesis-related proteins in resistant wheat.......... 88 2.4.5 Up-regulation of phenylpropanoid metabolism in Type I resistant DH1 .... 90 2.4.6 Jasmonic acid signalling and Type II resistance.......................................... 92 2.5 Conclusions........................................................................................................... 93 3. The Role of Plant Hormone Signalling in Mediating Fusarium Head Blight Resistance in Wheat........................................................................................................ 95 3.1 Introduction........................................................................................................... 95 3.2 Materials and Methods........................................................................................ 110 3.2.1 Plant material ............................................................................................. 110 3.2.2 Screening for hormone silencing ............................................................... 111 3.2.3 Inoculations................................................................................................ 112 3.2.4 Fusarium Head Blight disease assays ........................................................ 113 3.2.4.1 Priming experiment ............................................................................ 113 3.2.4.2 Point-inoculation controls for priming experiment............................ 113 vi  3.2.4.3 Hormone silencing experiment .......................................................... 114 3.2.5 Deoxynivalenol quantification from priming experiment ......................... 114 3.2.6 Hormone profiling of primed wheat spikes ............................................... 115 3.3 Results................................................................................................................. 117 3.3.1 The effect of point-inoculation on disease outcomes ................................ 117 3.3.2 Priming experiment disease evaluation ..................................................... 118 3.3.3 Priming has no effect on SA or JA accumulation within point-inoculated wheat spikes ............................................................................................... 120 3.3.4 DON accumulation in mature kernels from primed and spray-inoculated wheat spikes is primarily correlated with disease severity ........................ 121 3.3.5 Screening for hormone silencing ............................................................... 123 3.3.5.1 Screening for NAHG over-expression and SA degradation .............. 123 3.3.5.2 Screening for silencing of JA biosynthesis ........................................ 124 3.3.5.3 Screening for silencing of ET signalling............................................ 125 3.3.6 Hormone silencing disease evaluation....................................................... 132 3.4 Discussion ........................................................................................................... 135 3.4.1 Priming induces changes in FHB-resistance and -susceptibility of wheat 135 3.4.2 The role of hormone signalling in FHB-resistance.................................... 137 3.5 Conclusions......................................................................................................... 140 4. Investigating a Putative Role for TaLTP3, a Wheat Lipid Transfer Protein, in Fusarium Head Blight Resistance ............................................................................... 142 4.1 Introduction......................................................................................................... 142 4.2 Materials and Methods........................................................................................ 144 vii  4.2.1 Plant material ............................................................................................. 144 4.2.2 TaLTP3 and TaPIP1 gene expression analysis.......................................... 145 4.2.3 Microscopy ................................................................................................ 146 4.2.4 Recombinant expression and purification of TaLTP3 ............................... 147 4.2.4.1 Recombinant protein expression ........................................................ 147 4.2.4.2 Recombinant protein purification....................................................... 148 4.2.4.3 Trx tag removal trial from recombinant TaLTP3 fusion protein ....... 149 4.2.5 LTP binding and antifungal assays ............................................................ 151 4.2.6 Transgenic modification of TaLTP3 expression in DH1 and ‘Superb’ ..... 153 4.3 Results................................................................................................................. 154 4.3.1 Tissue-specific expression of TaLTP3 and TaPIP1 in DH1...................... 154 4.3.2 Cuticle thickness ........................................................................................ 154 4.3.3 Purification and binding activity assay for recombinant LTP3trx............. 156 4.3.4 rLTP3trx-F. graminearum inhibition assays ............................................. 163 4.3.5 Transgenic modification of TaLTP3 expression in DH1 and ‘Superb’ ..... 164 4.4 Discussion ........................................................................................................... 164 4.4.1 Validation of TaLTP3 and TaPIP1 transcript accumulation and evaluation of organ-specific expression in DH1.............................................................. 164 4.4.2 Measurement of cuticle thickness in DH1 compared with ‘Superb’ ......... 166 4.4.3 TaLTP3 does not exhibit antifungal activity towards F. graminearum..... 167 4.5 Conclusions......................................................................................................... 167 5 Conclusions................................................................................................................. 170 Bibliography .................................................................................................................. 178 viii  Appendix: Supplementary Tables and Figures.......................................................... 212  ix  List of Tables  Table 1.1 Genes involved in trichothecene production. ................................................... 15 Table 1.2 FHB resistance mechanisms in cereals. ............................................................ 20 Table 2.1 Primer sequences for qPCR validation. ............................................................ 40 Table 2.2 Constitutive difference between transcriptomes of FHB-resistant genotypes and susceptible ‘Superb’.......................................................................................................... 47 Table 2.3 Genotype differences in challenge-induced protein accumulation................... 52 Table 2.4 Challenge-dependent changes in defence-related genes in FHB-susceptible ‘Superb’ and resistant genotypes. ..................................................................................... 56 Table 2.5 Challenge-induced differential protein accumulation....................................... 68 Table 2.6 qPCR validation of 2FD in microarray............................................................. 75 Table 3.1 Transgenic crosses for hormone silencing...................................................... 111 Table 3.2 Constitutive levels of SA and JA in untreated wheat heads. .......................... 122 Table 3.3 Time-course analysis of SA and JA accumulation in wheat spikes primed with FHB elicitors. .................................................................................................................. 122 Table 3.4 Effect of priming in DON accumulation in wheat kernels. ............................ 123 Table 3.5 Screen of transgenic crosses by hormone quantification and qPCR. ............. 126 Table 4.1 Tracking TaLTP3 and TaPIP1 expression within the wheat spikelet............. 156 Table A1. Challenge-dependent differentially regulated genes in FHB-susceptible ‘Superb’ amd resistant genotypes. .................................................................................. 212 Table A2. Effect of hormone silencing on disease severity at different days after inoculation....................................................................................................................... 286 x  List of Figures  Figure 1.1 Macroconidia of Fusarium graminearum. ........................................................ 9 Figure 1.2 Type A and B trichothecene structures. .......................................................... 12 Figure 2.1 Inoculation of wheat spikes and harvesting of spikelets for RNA and protein extractions. ........................................................................................................................ 38 Figure 2.2 Number of treatment-dependent differentially regulated transcripts. ............. 78 Figure 2.3 2D-electrophoresis optimization. .................................................................... 82 Figure 3.1 Structure of chemical priming agents.............................................................. 98 Figure 3.2 Phytohoromone biosynthesis and signalling pathways ................................. 103 Figure 3.3 Disease progression in three wheat genotypes: ‘Superb’, DH1, and DH2.... 120 Figure 3.4 Effect of hormone silencing on FHB-disease progression in wheat ............. 134 Figure 4.1 Components of the wheat floret for organ dissection.................................... 145 Figure 4.2 Wheat lipid transfer protein 3 sequence and construct designs..................... 150 Figure 4.3 TEM of GC from ‘Superb’ and DH1. ........................................................... 157 Figure 4.4 Recombinant LTP3trx digest trial ................................................................. 159 Figure 4.5 Purification of recombinant TaLTP3trx and Trx........................................... 161 Figure 4.6 TaLTP3 binding and inhibition assays .......................................................... 163 Figure 5.1 Model for molecular mechanisms of FHB defence response........................ 177 Figure A1. NahG expression cassette ............................................................................. 291 Figure A2. AOS sequence and RNAi silencing construct. ............................................. 292 Figure A3. EIN2 sequence and RNAi silencing construct ............................................. 295 Figure A4. Elongation factor 1-alpha (EF1α) housekeeping gene sequence.................. 296 xi  Figure A5. TaLTP3 sequence alignment and primer and probe design ......................... 300 Figure A6. TaPIP1 sequence alignment and primer and probe design........................... 312  xii  List of Schemes  Scheme 1.1 Trichothecene biosynthesis pathways ........................................................... 16  xiii  List of Abbreviations  15-ADON  15-O-acetyl deoxynivalenol  3-ADON  3-O-acetyl deoxynivalenol  4,15-DAS  4,15-diacetoxyscirpenol  4-VP  4-vinylpyridine  ACC  1-aminocyclopropane-1-carboxylic acid  ACO  1-aminocyclopropane-1-carboxylic acid oxidase  ACS  1-aminocyclopropane-1-carboxylic acid synthase  AOC  allene oxide cyclase  AOS  allene oxide synthase  ATA  alimentary toxic aleukia  BA2H  benzoic acid 2-hydrolase  BSMV  barley stripe mosaic virus  BTH  benzothiadiazole  COI1  coronatine-insensitive 1  CTR1  constitutive triple response 1  DON  4-deoxynivalenol  DTT  dithiothreitol  EC  expression construct  EDS5  enhanced disease susceptibility 5  EIN  ethylene insenstive  EIP  ethylene-inducible protein xiv  EK  enterokinase  ET  ethylene  ETR  ethylene receptor  ETRF  ethylene response factor  FD  fold-difference  FDK  Fusarium Damaged Kernels  FEB  Fusarium Ear Blight  FgTri5-  Fusarium graminearum GZ3639 trichothecene non-producing mutant  FgTri5+  Fusarium graminearum GZ3639 wild-type strain  FHB  Fusarium Head Blight  GST  glutathione-S-transferase  HC  hairpin construct  HST  host-selective toxin  IAA  iodoacetamide  ICS  isochorismate synthase  IEF  isoelectric focusing  JA  jasmonic acid  JIP  jasmonic acid-inducible protein  LBB  lipid transfer protein binding buffer  LOX  lipoxygenase  LTP  lipid transfer protein  MeJA  methyl jasmonate  MFS  major facilitator superfamily xv  MS  mass spectrometry  NBB  native binding buffer  NEB  native elution buffer  NIV  nivalenol  NPR1  non-pathogenesis related 1  OPR  12-oxophytodienoic acid reductase  PAL  phenylalanine ammonia lyase  PIP  aquaporin plasma membrane intrinsic protein  PK  protein kinase  POX  peroxidase  PR  pathogenesis-related  QTL  quantitative trait locus  rEK  recombinant enterokinase  RG  rosetta gami 2 cells  RISC  RNA-induced silencing complex  rLTP3trx  recombinant wheat lipid transfer protein-thioredoxin fusion protein  RNAi  RNA interference  ROS  reactive oxygen species  rTrx  recombinant thioredoxin  SA  salicylic acid  SAM  S-adenosylmethionine  SEC  size exclusion chromatography  SID1  SA induction-deficient 1 xvi  ssRNA  single stranded RNA  TaLTP  wheat lipid transfer protein  TBP  tributylphosphine  TCEP  tris(2)carboxyethylphosphine  TEM  transmission electron microscopy  TF  transcription factor  TOF  time-of-flight  TRI5  trichodiene synthase  Trx  thioredoxin  VIGS  virus-induced gene silencing  ZON  zearalenone  xvii  Acknowledgements  My supervisors, Dr. François Eudes and Dr. Brian Ellis, thank you for your confidence, your support and your guidance throughout my thesis program. I could not have asked for two better mentors.  My supervisory committee, Dr. Leonard Foster and Dr. Steven Lund, thank for your advice and feedback, and for keeping me on track.  My friends, colleagues, and mentors at the Agriculture and Agri-Food Canada, Denise Nilsson, Eric Amundsen, Dr. Ana Badea, Dr. André Laroche, Dr. Denis Gaudet, Dr. Thérèse Ouellet, Michele Frick, Carolyn Penniket, Byron Puchalski, Dr. Fran Legget, Jenna Friedt, Thérèse Despins, Dr. Rob Graf, Dr. Harpinder Randhawa, Dr. Gopal Subramaniam, thank you for your friendship, your feedback and support.  My fellow graduate students and post-docs at the University of British Columbia, Hardy Hall, QingNing Zeng, Mathias Schuetz, Apruv Bhargava, Jia Cheng, Adrienne Nye, thank you for your friendship and for helping see things from another perspective.  Thank you to the greenhouse staff, at the Lethbridge Research Centre, for your support.  Thank you to my family: my parents Zahra and Nader Foroud, my sister and her husband, Afra Foroud and Brad Gom, my sister Rebecca Foroud, and my husband Paul Hazendonk, for your never ending support, love and friendship.  xviii  Dedication  To my mother and father, Zahra Foroud and Dr. Nader Foroud, for your support and guidance.  ‫ع‬  To my husband Dr. Paul Hazendonk, for your patience and love.  xix  1. Introduction  Fusarium Head Blight (FHB) is a destructive disease of grain crops, with worldwide economic and health impacts. Wheat is one of the most widely FHB-affected crops and suffers the largest damage. The disease is caused by a range of trichothecene-producing Fusarium species, F. graminearum (teleomorph: Gibberella zeae) being the most economically relevant (Parry et al., 1995; Tóth et al., 2005). The fungus infects the cereal inflorescence during anthesis and grain development. Once established within the floret, fungal hyphae can spread from spikelet to spikelet through the vascular bundles of the rachis (Parry et al., 1995). Fusarium species produce trichothecene mycotoxins that accumulate in the kernels of infected spikelets, reducing both food quality and grain germination. Trichothecenes are phytotoxic and are associated with aggressiveness of F. graminearum disease spread in Triticeae (Proctor et al., 1995a; Eudes et al., 2001; Bai et al., 2002; Langevin et al., 2004; Jansen et al., 2005; Maier et al., 2006), but are not necessary for establishing initial infection (Bai et al., 2002; Jansen et al., 2005). The most effective means to prevent damage caused by this disease is to cultivate crops with high levels of genetic resistance to FHB (Eudes et al., 2004; Foroud and Eudes, 2009). Two major forms of FHB resistance have been characterized in wheat (Schroeder and Christensen, 1963). Type I resistance is defined as resistance to initial infection, and Type II resistance is resistance to disease spread within an infected spike. An improved understanding of the molecular mechanisms associated with resistance has the potential to provide essential new tools for the development of improved FHBresistant germplasm. 1  1.1 History and Background  1.1.1 Fusarium Head Blight: a brief history The first documented FHB-outbreak occurred in England in 1884, where the disease was named “wheat scab” (Stack, 2003). Outbreaks have since been reported in the Americas (Moschini and Fortugno, 1996; Gilbert and Tekauz, 2000; McMullen, 2003), Eurasia (Bhat et al., 1989; Parry et al., 1995; McCormick, 2003), Australia (Burgess et al., 1987), and South Africa (Scott et al., 1988; Kriel and Pretorius, 2008). The most notorious epidemic in North America spanned the 1990s, where in the United States alone, estimated economic losses approached 3 billion USD (McMullen et al., 1997). Rice-wheat rotations are routine in many Asian countries, and while FHB is more endemic in the latter, rice crops still serve as a host for inoculum buildup that could lead to an outbreak. FHB of barley and wheat is a pervasive problem in China. From 1951 to 1990, wheat farmers were burdened with seven severe epidemics (exceeding 40% yield losses) and 14 moderate epidemics (10-20% yield losses). A reduced frequency of severe epidemics has subsequently been observed with the introduction of moderately resistant cultivars (Hongxiang et al., 2008). In South Africa, a double cropping system (with maize as a summer crop and wheat as a winter crop) in combination with conservation tillage has led to a growing FHB problem, especially in regions where irrigation is required (Kriel and Pretorius, 2008). Maize crop debris is one of the worst culprits for harbouring Fusarium ascospores. Increased maize production in the United States driven by the biofuel initiatives (Cassman and Liska, 2007) may introduce an increased threat of FHB in North America—a threat that may become an issue of food security. Maize is a major 2  staple food and the increase in maize production for non-food products is already removing valuable farmland from food production (Cassman and Liska, 2007), thus reducing the volume of wheat and barley, among other crops, available for food uses. If the soil-borne inocula were to increase as a result of expanded maize cultivation, this would threaten the already dwindling food supply of wheat and other grains. This concern also emphasizes the need to improve FHB-management strategies and the importance of producing highly resistant cultivars.  1.1.2 The impact of Fusarium Head Blight FHB-related yield losses are directly related to effects of trichothecenes, which accumulate in the grain of wheat spikes that become infected during or post-anthesis (Del Ponte et al., 2007), although significant yield losses are more relevant in early infections (during anthesis to the early stages of kernel development) (Bushnell et al., 2003; Steffenson, 2003). The kernels that do develop from FHB-infected spikes are usually contaminated with trichothecenes, 4-deoxynivalenol (DON) being the most prevalant. Trichothecene-contaminated grain is readily distinguished from its shriveled and discolored appearance. Several studies have shown that the percentage of Fusarium Damaged Kernels (FDK) serves as a reliable estimate of DON content (Miedaner et al., 2001; Mesterházy, 2002). This allows for rapid visual screening of FDK in order to prevent contaminated grain entering the food chain in unsafe quantities. Nevertheless, FDK screening for toxin contamination should be used with caution since reduced physical damage is observed if infection occurs past the soft dough stages of kernel development (Pestka and Smolinski, 2005; Del Ponte et al., 2007). FDK can therefore be 3  used as a preliminary screen when sorting and grading grain, but quantitative trichothecene testing is advisable before the grain enters the food chain. Maximum FDK limits in place for different Canadian wheat classes and varieties are enforced by the Canadian Grain Commission at licensed grain elevators. DON-testing is carried out on end-products by the Canadian Food Inspection Agency and Health Canada to ensure the maximum allowable levels of this trichothecene in food-stuffs are not exceeded. Currently, the maximum limit of DON is set at 2 ppm for Canadian soft wheat (1 ppm for use in baby food), and the establishment of maximum limits of DON in hard wheat is currently being evaluated (Tom Nowicki and Randall Clear, Canadian Grain Commission, Winnipeg, Manitoba, personal communications). The established DON limits are also being reviewed, and more rigid standards may be imposed in order to harmonize the Canadian standards with those of the European Union. DON tolerance in China, Hungary, Russia, Switzerland, and the United States is 1 ppm; and in Austria, Germany, and the Netherlands is 0.5 ppm (Pestka and Smolinski, 2005). Standards are also in place for grain that is used in animal feed, since trichothecenes cause similar ailments in farm animals as in humans (Rotter et al., 1996). Ingestion of contaminated grain can cause severe intestinal irritation in mammals, resulting in feed refusal in livestock (Eriksen and Pettersson, 2004), and can lead to a potentially fatal condition in humans and other mammals known as alimentary toxic aleukia (ATA). In addition to gastrointestinal irritation, symptoms of ATA can include ataxia, dyspenia, and subcutaneous hemorrhaging (Lutsky et al., 1978). The first recorded Fusarium-related ATA outbreak occurred in Siberia in 1913, but the human impacts of ATA may go as far back as the 5th century B.C.; it has been suggested that the plague of 4  Athens in 430-426 B.C. was an outbreak of ATA (Schoental, 1994). Symptoms of a reported disease epidemic in New Hampshire in the 1730s are also reminiscent of ATA (reviewed in Stack, 2003). The most devastating outbreak on record occurred in Russia between 1942 and 1948, where at least 100,000 people died. In this case, a post-world war II famine in Russia led people to consume moldy over-wintered grain which had become contaminated with the T-2 trichothecene toxin producers F. sporotrichioides or F. poae (Mayer, 1953; Yagen and Joffe, 1976). However, despite these massive foodborne illness outbreaks, it was not until 1950 that the connection between Fusarium toxins and ATA was established. While some Fusarium species may proliferate on grain during storage, or over-wintered in the field, the main source of trichothecenes in the food chain is from FHB-infection of growing grain. The most effective means to minimize mycotoxin contamination in food-stuff is therefore to find ways to prevent or minimize the impact of this disease on wheat crops in the field.  1.1.3 Fusarium Head Blight management strategies FHB-management strategies are essential for reducing the economic damage and potential health hazards associated with this disease. Three components have been identified as being necessary for an FHB outbreak: (1) the source of inoculum, (2) the presence of susceptible hosts, and (3) favorable environmental conditions. Strategies have been developed to target each of these components. The first component, inoculum source, is usually present in the form of ascospores in the soil. It has been demonstrated that crop-rotation, tillage, chemical/ biological control, and the use of FHB-resistant cultivars can all contribute to reducing the presence of Fusarium/Gibberella5  contaminated crops and/or crop debris and thereby reducing inoculum buildup in the soil (Miller et al., 1998; Dill-Macky and Jones, 2000; Jones, 2000; Gilbert and Fernando, 2004; Horsley et al., 2006; Khan et al., 2006; Paul et al., 2007). The second essential component for an outbreak is a suitable host on which spores can germinate and establish disease. Unfortunately, the number of registered cultivars possessing good resistance is limited, and the cultivation of resistant cultivars is the only way, short of growing only non-host crops, to deny a suitable host for the disease. Moreover, farmers preferentially select cultivars with good agronomic characteristics, and these, regrettably, tend to correlate with poor resistance (see section 1.4). The third component necessary for disease establishment, namely favorable environmental conditions, is difficult to affect. FHB thrives in wet, humid conditions with an optimum temperature of 25oC during the anthesis and grain filling stages of crop development (Parry et al., 1995). While the weather cannot be controlled, disease forecasting models can be used to devise an effective spraying schedule for chemical control, and for more organized post-harvest management of potentially diseased kernels (Moschini and Fortugno, 1996; De Wolf et al., 2003; Xu, 2003; Prandini et al., 2008). Application of more than one management strategy (McMullen et al., 2008) has been shown to be the most effective route to reducing FHB severity and trichothecene accumulation in grains—although, the development of highly resistant cultivars with good agronomic qualities would have the largest impact. The use of resistant cultivars can manage each of the three components essential for disease. First, it can reduce the amount of inoculum buildup in host-crop debris (and subsequently in the soil). Second, the suitability of host crops can be reduced by using highly-resistant cultivars. Finally, 6  while a strong genotype-environment interaction has been observed in FHB disease outcomes (Miedaner et al., 2001), studies have shown that the effect of the environment can be indirectly managed by using highly-resistant genotypes. In contrast, while genotypes with moderate or intermediate resistance can reduce the impact of FHB, this resistance is not stable under high disease pressure. In a two-year FHB field trial of winter wheat, rye and triticale genotypes, grown in three regions of South-West Germany, Miedaner et al. (2001) observed strong interactions between genotype and disease outcomes, and between genotype and trichothecene accumulation. They also observed a significant impact of the environment on these interactions, but the effect of the environment was reduced in more resistant genotypes. Similar interactions have been observed between wheat genotypes and F. graminearum strains (Foroud et al., in preparation), where resistance to both disease spread and the development of FDK is stable in highly resistant lines, but variable in intermediate/moderate sources of resistance. These studies emphasize the importance of developing highly resistant cultivars. Furthermore, the level of resistance “is more important in governing DON accumulation in a given cultivar than is the aggressiveness of an isolate (Mesterházy, 2002)”.  1.2 Fusarium Species  1.2.1 Diseases caused by Fusarium species The genus Fusarium consists of a wide range of soil-borne saprophytic and pathogenic fungi. Some species of Fusarium, including F. moniliforme, oxysporum, solani, and 7  verticillioides, are known to infect immune-compromised humans (Guarro and Gené, 1995), but plant species are the main target of Fusarium pathogenicity. Fusarium fungi are known to be the causative agents in a variety of plant diseases in addition to FHB; it is said that most species of plants are susceptible to at least one disease caused by this genus of fungi (Leslie and Summerell, 2006). A broad range of host plants are susceptible to vascular wilt disease caused by Fusarium species, in which the fungus colonizes the xylem via the roots and the growing mycelium eventually causes vessel obstruction, blocking transport of water to the aerial parts of the plant (Pietro et al., 2003). Over 100 F. oxysporum formae speciales have been identified for various crops species, including F. oxysporum f. sp. cucumerinum, lycopersici, and pisi, which infect cucumber, tomato, and pea crops, respectively (Pietro et al., 2003). F. oxysporum f. sp. cubense was responsible for the vascular wilt epidemic of bananas, known as panama disease, in the 1950s which forced growers to switch cultivars from Gros Michael to a more resistant cultivar, Cavendis, although the threat of this disease is still pervasive (Ploetz, 1994). F. oxysporum, among other species, is are also responsible for crown rot disease in a variety of crops, including tomatoes (Pharand et al., 2002), asparagus (Hartung and Stephens, 1983), and alfalfa (Couture et al., 2002). Wheat and barley are susceptible to crown rot, caused by species similar to those responsible for FHB, including F. graminearum, pseudograminearum, and culmorum (Backhouse et al., 2004; Smiley et al., 2005; Mudge et al., 2007). Interestingly, DON accumulation in wheat spikes, similar to that observed by FHB, can be observed in wheat inoculated with the crown rot pathogens, F. graminearum or pseudograminearum (Mudge et al., 2007).  8  A.  B.  Figure 1.1 Macroconidia of Fusarium graminearum. A. The F. graminearum strain GZ3639 produce macroconidia with a straight ventral (lower) and slightly arched dorsal (upper) side, with well defined septa. The apical cell (left) is tapered and the basal cell (right) is foot shaped. B. Macroconidia develop off the hyphae of growing mycelium, and are eventually released by pinching off at the basal cell (arrow). Photographs were taken under light microscopy with 100 x magnification.  1.2.2 Fusarium morphology and classification Fusarium species are ascomycetes with teleomorphs in Gibberella, Albonectria, and Haematonectria, but in some species, such as F. culmorum and sporotrichioides, no teleomorph has yet been identified. While it is standard practice to use the teleomorphic name when referring to the holomorph, in the case of Fusarium the anamorphic name is more commonly used (Leslie and Summerell, 2006). Fusarium species produce crescentshaped macroconidia spores and some also produce microconidia. The size and number of septa in the macroconidia are often used to differentiate between species (Leslie and 9  Summerell, 2006). F. graminearum produce elongated 5-6 septate pale orange macroconidia with a tapered apical and a foot-shaped basal cell (Figure 1.1). The ascospores from the sexual stage, G. zeae, are slightly curved, fusoid-shaped spores with 1-3 septa, which are released from a dark purple-black perithecium. F. culmorum, which does not have a known sexual stage, produces short orange macroconidia that are wide relative to their length, with 3-4 septa, and a rounded apical and notched basal cell. F. sporotrichioides produces macroconidia with variable morphological features, generally with 3-5 septa, and also produces microconidia that are 1-septate and ellipsoid in shape (Leslie and Summerell, 2006). The F. graminearum species complex (Fg complex), the main group responsible for FHB in North America, is composed of more than 10 phylogenetically distinct species that produce primarily DON and DON-derivatives (O'Donnell et al., 2000; Starkey et al., 2007; Ward et al., 2008). Over the past decade, the nature of the pathogen has been evolving, and a shift in the trichothecene genotype and/or chemotypes of the Fg complex has been observed (Ward et al., 2008). Historically, the 15-O-acetyl DON (15-ADON) chemotype had been the most prevalent chemotype in North America. However, in recent years, 3-O-acetyl DON (3-ADON) chemotypes, and strains with increased 15ADON production, have been identified on this continent. The high-producing 15ADON population is composed of strains that are genetically similar to, and are believed to have parts of their genomes derived from the 3-ADON population (Gale et al., 2005; Ward et al., 2008). Additionally, an increased presence of NIV chemotypes has also been observed in North America (Starkey et al., 2007). The 3-ADON chemotypes appear to be more virulent than the 15-ADON chemotypes (Ward et al., 2008), although there is no 10  evidence linking the trichothecene-chemotype itself to this observed phenotypic difference. It has been proposed that additional factors of aggressiveness in the 3-ADON genotypes may be responsible, at least in part, for the difference in aggressiveness between these populations, since differences in aggressiveness were observed in a study conducted with strains that are genetically coded for 3-ADON production, but where 3ADON production has not been observed in planta (Foroud et al., in preparation).  1.3 Trichothecenes  1.3.1 Trichothecene structure and toxicity Trichothecenes are toxic sesquiterpenoid compounds composed of a central core of fused cyclohexene/tetrahydropyran rings, with a cyclopentyl moiety fused to the tetrahydropyran ring through C-2 and C-5 (Figure 1.2). Furthermore, C-12 comprises part of an epoxide functionality which has been deemed crucial for toxicity (Desjardins et al., 1993). There are five positions at which functionality varies, most commonly featuring hydroxyl or acetyl groups. Four types of trichothecenes have been identified from trichothecene-producing fungi: types A, B, C and D. The major type A trichothecenes in Fusarium species include T-2 toxin and HT-2 toxin, both of which possess an isovalerate ester at C-8 (Mirocha et al., 2003). F. sporotrichioides and F. poae are some of the major type A trichothecene producers (Liddell, 2003). Type A trichothecenes are highly toxic; T-2 toxin has been reported to be roughly ten times more toxic in mammals than DON (Ueno, 1983). Type A toxins are thought to have been responsible for the previously described ATA outbreak of post-world war Russia. On the other hand, DON is the most 11  prevalent toxin associated with FHB, and belongs to the more phytotoxic (Eudes et al., 2001) Type B trichothecenes which feature a ketone at C-8 (Mirocha et al., 2003). F. culmorum and F. graminearum, which are the major disease agents in FHB of wheat, produce mainly DON, NIV, and their derivatives (Liddell, 2003). Type C and D trichothecenes, which are characterized by a second epoxide (C-7,8 or C-9,10) or an ester-linked macrocycle (C-4,16), respectively, are not associated with FHB (Sudakin, 2003). Other mycotoxins, such as zearalenone (ZON), fumonisins, moniliformin and butenolide are also produced by Fusarium species (Mirocha et al., 2003; Desjardins et al., 2007b; Harris et al., 2007), but trichothecenes are the toxins of main interest in this disease. The trichothecene biosynthesis pathway is summarized in Scheme 1, and genes associated with trichothecene production are presented in Table 1.1.  R1  O  10  16  11  9  2 13  8  R5  6 7  R3  15  O 12  5  R4  3  14  4  R2  Toxin  R1  R2  R3  R4  R5  DON  –OH  –H  –OH  –OH  =O  3-ADON  –OAc  –H  –OH  –OH  =O  15-ADON  –OH  –H  –OAc  –OH  =O  NIV  –OH  –OH  –OH  –OH  =O  T-2 toxin  –OH  –OAc –OAc  –H  –OIsoval  HT-2 toxin  –OH  –OH –OAc  –H  –OIsoval  Figure 1.2 Type A and B trichothecene structures. Type A trichothecenes include T-2 toxin, HT-2 toxin, 4,15-diacetoxyscirpenol (4,15-DAS). Type B trichothecenes include nivalenol (NIV), 4-deoxynivalenol (DON), 3-O-acetyl DON (3-ADON), and 15-O-acetyl DON (15-ADON). OAc = acetyl function; OIsoval = isovalerate function.  12  Trichothecene exposure can lead to growth retardation in eukaryotes, reproductive dysfunction in mammals and inhibition of seedling growth/regeneration in plants (reviewed in Rocha et al., 2005). The toxicity of trichothecenes is attributed to their ability to inhibit the peptidyl transferase activity of 60S ribosomes (McLaughlin et al., 1977). Additional impacts of trichothecene toxicity (reviewed in Ueno, 1977; Ueno, 1985; Rocha et al., 2005) include disruption of nucleic acid synthesis, mitochondrial function, membrane integrity, and cell division. Trichothecenes have also been shown to induce apoptosis in animal cells (Shifrin and Anderson, 1999), and may induce programmed cell death in plants (reviewed in Rocha et al., 2005).  1.3.2 Trichothecenes as aggressiveness factors in Fusarium Head Blight Different levels of aggressiveness and pathogenicity have been observed in different isolates of a given Fusarium species. These differences can be attributed only in part to fitness, which suggests that aggressiveness factors may contribute to disease outcomes. Toxins have long been implicated as aggressiveness factors in various pathogen systems. Host-selective toxins (HSTs) are pathogen-produced toxins shown to be necessary for disease to occur in some plant-pathogen interactions. HSTs are toxic only toward the target host (reviewed in Wolpert et al., 2002). Examples of HSTs include AK-toxin of Alternaria alternata, victorin of Cochliobolus victoriae, and T-toxin of C. heterostrophus, the causal agents in black spot of Japanese pear (Tanaka et al., 1999), Victoria blight of oats (Navarre and Wolpert, 1999), and corn leaf blight (Baker et al., 2006), respectively. Other examples of toxins with less host specificity, but still involved plant pathogen aggressiveness or pathogenicity, include botrydial and its derivatives from 13  Botrytis cinerea, which causes grey mould in over 200 plant species (Choquer et al., 2007; Williamson et al., 2007), and zinniol, which is produced by Alternaria species responsible for a variety of plant diseases (Cotty and Misaghi, 1984; Robeson and Strobel, 1984; Thuleau et al., 1988; Moreno-Escobar et al., 2005). Over the past few decades, evidence that trichothecenes act as non-host-selective toxins involved in aggressiveness of Fusarium-related diseases has been accumulating. Observations by Beremand et al. (1991) suggested a link between trichothecene production, fertility, and pathogenicity of F. sambucinum isolates. Correlations between fungal biomass (measured by ergosterol quantification) and DON accumulation in cereal grains have been observed (Perkowski et al., 1996; Miedaner et al., 2000; Miedaner et al., 2001). A link between DON accumulation and disease outcomes has also been observed (Hart et al., 1984; Snijders and Perkowski, 1990). The trichothecene chemotype of Fusarium isolates (Foroud et al., in preparation), and the cumulative impact of multiple trichothecenes produced either by a single isolate (Mesterhazy et al., 1999) or by a composite of isolates (Arseniuk et al., 1993), may increase disease severity. In addition, some FHB-resistant plant genotypes have been shown to detoxify DON, primarily by glycosylation (reviewed in Boutigny et al., 2008). Together, these data suggest that the ability of Fusarium species to cause disease is linked to trichothecene accumulation in the host, and that reduced aggressiveness may be linked to either reduced toxin production by the pathogen, or removal/degradation of the toxin by the host.  14  Table 1.1 Genes involved in trichothecene production. For more details on trichothecene gene cluster see (Hohn et al., 1993; Alexander et al., 1997; Kimura et al., 2003; Brown et al., 2004; Kimura et al., 2007). Gene  Cluster  Description  References  Enzymes: for pathway reactions see also Scheme 1 Tri1  Tri1-  C-7 monooxygenase (F. graminearum); C-8  (Beremand, 1987; Brown et  Tri16  monooxygenase (F. graminearum, F.  al., 2003; Meek et al., 2003;  sporotrichioides)  McCormick et al., 2006)  Tri3  Core Tri  15-O-acetyltransferase  (McCormick et al., 1996)  Tri4  Core Tri  monooxygenase  (Hohn and Vanmiddlesworth, 1986; Tokai et al., 2007)  Tri5  Core Tri  sesquiterpene cyclase  (Hohn and Beremand, 1989)  Tri7  Core Tri  4-O-acetyltransferase; functional F.  (Brown et al., 2001; Lee et  graminearum TRI7 required for NIV-  al., 2002)  chemotype; functional F. sporotrichioides TRI7 required for T-2 toxin production Tri8  Core Tri  C-3 deacetylase; functional F.  (Brown et al., 2001;  sporotrichioides TRI8 required for T-2 toxin  McCormick and Alexander,  production  2002)  Tri9  Core Tri  Tri11  Core Tri  C-15 monooxygenase  (McCormick et al., 1999)  Tri13  Core Tri  monooxygenase; functional F. graminearum  (Lee et al., 2002; Kim et al.,  TRI13 required for NIV-chemotype  2003)  Tri14  Core Tri  Tri16  Tri1-  Tri101  None  (Brown et al., 2001)  (Peplow et al., 2003) 15-O-acetyltransferase  (McCormick et al., 1990; Kimura et al., 1998)  Transcription Factors Tri6 Tri10  Core Tri  zinc-finger; binding motif (YNAGGCC) in most  (Proctor et al., 1995b; Hohn  promoter regions within Tri5 cluster  et al., 1999; Brown et al.,  Core Tri  (Tag et al., 2001)  Other Tri12  Core Tri  MFS transporter involved in trichothecene  (Alexander et al., 1999a; Tag  efflux  et al., 2001)  15  Proctor et al. (1995a) developed a trichothecene non-producing strain of F. graminearum (FgTri5-; wild-type FgTri5+) by disruption of the locus encoding trichodiene synthase (Tri5), whose gene product catalyzes the first committed step in trichothecene biosynthesis (Scheme 1.1) (Hohn and Vanmiddlesworth, 1986; Desjardins et al., 1993; Proctor et al., 1995a). Other Tri5 mutants have also been produced in other strains. In order to clarify the role of trichothecenes in FHB-aggressiveness, these mutants have been compared with the wild type strains, and the results are consistent with a role for trichothecenes in disease spread in Triticeae (Proctor et al., 1995a; Bai et al., 2001; Eudes et al., 2001; Langevin et al., 2004; Maier et al., 2006) and in maize (Harris et al., 1999; Maier et al., 2006). The current view is that trichothecenes are not necessary for initial infection (Bai et al., 2002), or infection through the wheat fruit coat, but that they are required for entry into the rachis and subsequently for disease spread (Jansen et al., 2005). In the absence of trichothecene production, F. graminearum has been shown to be contained in point-inoculated spikelets by cell wall thickening at the rachis node (Jansen et al., 2005).  Scheme 1.1 Trichothecene biosynthesis pathways (pages 17-18). Steps in the pathway are catalyzed by Tri-gene products (see Table 1 for more details), and have been identified in either F. graminearum (Fg), F. sporotrichioides (Fs), or both. OAc = acetyl function; IsovalO = isovalerate function. Diagram is a compilation adapted from (Hohn et al., 1993; Brown et al., 2001; Mesterházy, 2002; McCormick, 2003).  16  Scheme 1.1 (page 1 of 2) 10  6  8  TRI4  13  11  9  5  TRI4  TRI4  12  O OH  2  7  trichodiene4  OH  12,13-epoxy-9,10trichoene-2-ol  2-hydroxytrichodiene  3  TRI5 OH  O  FgTRI8  O OPP  O  farnesyl-pyrophosphate  OH AcO  15-acetyldeoxynivalenol FgTRI13  OH  O  OAc  O  FgTRI8  O O  O O  O OAc  OH AcO  OAc  OH AcO  4,15-diacetylnivalenol  OH  OH  3,4,15-triacetylnivalenol  AcO  3,15-diacetylnivalenol  OH  O  OH  O  OAc  O  FgTRI7  O  O  O O OAc  OH HO  OAc  AcO  4,15-diacetoxyscirpenol  4-acetylnivalenol  ∆FsTRI8 OAc  O  FsTRI8?  O HO OAc  AcO  OAc  AcO  3-acetoxyineosolaniol  3-acetyl T-2 toxin  O  FsTRI1  O  IsovalO OH  O  OAc  O  IsovalO AcO  OAc  T-2 toxin OH  O  OAc  O  O  O  IsovalO  IsovalO OH  AcO  HT-2 toxin  AcO  OH  3-acetyl HT-2 toxin  17  Scheme 1.1 (page 2 of 2)  TRI4  TRI4  OH  OH HO  O  O  O  OH  2  OH  isotrichodiol  trichotriol  isotrichotriol  3  OH  OH  OAc  O  FgTRI8  OH  O O  O  2  3  OH AcO  OH  O  3,15-diacetyldeoxynivalenol  OAc  O  isotrichodermol O  HO  FgTRI13  TRI101 OH AcO  7,8-dihydroxycalonectrin OAc  O O  isotrichodermin TRI11  OAc  O O  OAc  O  TRI3  O  HO  AcO  calonectrin  15-deacetylcalonectrin  TRI13  ∆FsTRI8 OAc  O  FsTRI1 O  O OH  AcO  3,4,15-triacetoxyscirpenol  OH  O  O  OAc  AcO  OAc  O  FsTRI3  3,15-diacetoxyscirpenol  HO  3,15-dideacetylcalonectrin  ∆FsTRI7  OAc  O  OH  O  O HO  O O  O AcO  OH  3,15-diacetyl T-2 tetraol  OH  O  FgTRI3  O  OH HO  OH  nivalenol  OH HO  deoxynivalenol  18  1.4 Fusarium Head Blight Resistance  1.4.1 Mechanisms of Fusarium Head Blight resistance FHB resistance is both dominant and quantitative. A gene-for-gene resistance interaction has not been identified in FHB-resistance, nor has immunity to the disease been observed. Stability of resistance is dependent on environmental factors at the time of infection and/or aggressiveness factors associated with the invading Fusarium strain, although resistance has been shown to be stable in genotypes with very high levels of resistance (Mesterházy, 1995; Miedaner et al., 2001; Foroud et al., in preparation). Several different forms of resistance have been identified (Table 1.2). These mechanisms of resistance can interact with each other to improve the overall resistance. Type I (resistance to initial infection) and Type II (resistance to disease spread) resistances, first described in wheat by Schroeder and Christensen (1963), are the best documented forms of resistance, since they are the most readily assayed. Due to the physiological differences between maize and other cereals, resistance to Fusarium Ear Blight (FEB) of maize is defined separately from that of FHB. Type I resistance in FHB is phenomenologically comparable to silk resistance in maize, where the fungus cannot penetrate the silk channel to infect the kernels (Reid et al., 1992). Type II resistance in FHB is comparable to kernel-resistance in FEB, where the fungus cannot penetrate the rachis, or ‘cob’, and hence does not spread from kernel to kernel (Chungu et al., 1996).  19  Table 1.2 FHB resistance mechanisms in cereals. Resistance  Description  Reference  Resistance in Small Grain Cereals (as defined in Mesterházy, 2003) (Schroeder and Christensen, 1963) (Schroeder and Christensen, 1963)  Type I  Resistance to initial infection  Type II  Resistance to disease spread  Type III  Resistance to kernel infection  (Mesterházy, 1995)  Type IV  Tolerance against FHB and trichothecenes  (Mesterházy, 1995)  Type V  Resistance to trichothecene accumulation  (Miller et al., 1985)  Class 1  By chemical modification of trichothecenes  (Boutigny et al., 2008)  Class 2  By inhibition of trichothecene synthesis  (Boutigny et al., 2008)  Resistance in Maize Silk Resistance  Resistance to silk penetration  Kernel Resistance Resistance to kernel disease spread  (Reid et al., 1992) (Chungu et al., 1996)  Type I resistance can be measured as the percentage of spikelets exhibiting symptoms after exposure to the pathogen. Plants are typically sprayed during anthesis with macroconidial (or ascosporic) suspensions and high humidity is maintained (by bagging infected heads or by mist-irrigation) for a few days post-inoculation. Alternatively, the grain spawn method, where infected wheat or corn is dispersed in the field, can be used to better mimic natural conditions of infection (Rudd et al., 2001; Dill-Macky, 2003). 20  Resistance is measured 7 to 21 days after anthesis, and is typically reported as a ‘disease index’, and scored for average ‘incidence’ (percentage of diseased spikes) and ‘severity’ (percentage of infected spikelets on diseased spikes). Acquiring accurate assessments of Type I resistance is challenged by several factors: (a) the amount of inoculum that actually reaches the spikelets is unquantified, resulting in variability in the exposure of different spikes or plants within and between experiments; (b) environmental conditions are difficult to control, especially in field experiments; and (c) ‘disease index’ is not a measure of Type I resistance alone, but rather a combination of resistance to initial infection, disease spread and tolerance (Rudd et al., 2001; Eudes et al., 2004). Some researchers equate ‘incidence’ with Type I resistance and ‘severity’ with Type II resistance, while others treat ‘disease index’ as an estimate of both Type I and II resistances; thus, it has been proposed that the definition of Type I resistance is in need of re-evaluation (Mesterházy et al., 2008). Evaluation of Type II resistance is more straightforward (Rudd et al., 2001). A quantifiable amount of inoculum is injected into individual spikelets at anthesis, and high humidity is maintained for several days. Resistance is subsequently measured as the number of infected spikelets below the inoculation point (note that the disease typically spreads down the spike through the rachis). Delayed hyphal colonization of the vascular bundles in the rachis is observed in Type II resistant genotypes (Kang and Buchenauer, 2000a). As previously mentioned, trichothecenes are necessary for disease spread (Proctor et al., 1995a; Eudes et al., 2001; Bai et al., 2002; Langevin et al., 2004), but they do not appear to play a role in establishing initial infection by spray or point inoculation (Bai et al., 2002) or for infection of the fruit coat (Jansen et al., 2005). Using GFP 21  expression under control of the TRI5 promoter as a reporter for trichothecene gene expression, Ilgen et al. (2009) recently demonstrated that the trichothecene biosynthetic pathway is induced following colonization of the developing kernel, and later at the rachis node . Together, these data suggest that trichothecenes, which are necessary for disease spread, do not accumulate until after initial infection has been established. If trichothecenes are not necessary for establishing initial infection, and since evaluation methods for resistance to initial infection are confounded by resistance to disease spread, perhaps a more accurate estimate of resistance to “initial infection” would be obtained by using spray inoculation with FgTri5-, or even by using grain spawn infected with FgTri5- . This would eliminate the interaction between Type I and II resistance in the evaluation of resistance to initial infection. Such a strategy would also eliminate the interaction of Type I resistance with other forms of resistance that are directly related to trichothecenes (namely Type IV and V resistance). Type III, IV, and V resistance cannot be directly quantified. This is, in part, because the nature of these forms of resistance is often intermingled with each other and/or with Type I and II resistance. Type III resistance can be assessed by FDK evaluation. Type IV resistance is defined as tolerance to FHB, meaning that yield and quality of the grain product is maintained in spite of disease presence. Type IV resistance may also be defined as DON tolerance, in which case it could be evaluated by comparing FDK values to DON content; if FDK is low but DON content is high, tolerance to DON and FHB would then be observed. Type V resistance (resistance to toxin accumulation) can be estimated by DON quantification of FHB-infected plants or by an in vitro tissue assay (Miller et al., 1985; Wang and Miller, 1988). Type V resistance can be subdivided into 22  two classes as defined by Boutigny et al. (2008): Type V-1 resistance refers to the host’s ability to chemically modify trichothecenes, resulting in toxin degradation or detoxification; Type V-2 resistance refers to the host’s ability to inhibit trichothecene biosynthesis in the invading fungus.  1.4.2 Sources of Fusarium Head Blight resistance The development of FHB-resistant cultivars has proven to be a difficult task. While cereal breeders worldwide have invested considerable effort in the development of FHBresistant germplasm (Miedaner, 1997; Gilbert and Tekauz, 2000; Tekauz et al., 2000; Bai et al., 2003; Mesterházy, 2003; Tekauz et al., 2004), relatively few resistant cultivars have been generated by conventional breeding methods. Moreover, most of the work has focused on wheat and barley breeding, since they are the most heavily FHB-affected crops (especially wheat). Barley has an inherent Type II resistance, but unconventional disease spread can be observed externally from spikelet to spikelet without penetration of the rachis (Langevin et al., 2004). Six-row barley, which is more susceptible than tworow barley and is preferred for malting, is nearly as susceptible as wheat (Tekauz et al., 2004). Resistance in two-row barley is attributed to a quantitative trait locus (QTL) that is associated with the Vrs1 locus, which controls spike type. It is not clear whether resistance is functionally linked to Vrs1, or if there is a pleiotropic effect at play (de la Pena et al., 1999; Zhu et al., 1999; Ma et al., 2000). Durum wheat (Triticum turgidum subsp. durum) is one of eight subspecies of tetraploid (AABB) wheat (Oliver et al., 2008), and is far more FHB-susceptible than hexaploid (AABBDD) bread wheat (Gilbert and Tekauz, 2000). Rye is generally more resistant than wheat and barley (Miedaner, 23  1997; Langevin et al., 2004). Oats are also considered to be more FHB-resistant than wheat and barley (Langevin et al., 2004), but this pattern may be deceptive since FHB symptoms are not as readily discerned in oats compared with other crops (Tekauz et al., 2008). Furthermore, DON and T-2 toxin accumulation in oats is more severe than in wheat (Tekauz et al., 2004; Bjørnstad and Skinnes, 2008). Over 100 FHB resistance-related QTLs have been reported from FHB-resistant wheat sources, 22 of which have been detected in multiple mapping populations (summarized in Bürstmayr et al., 2009). The best characterized and most widely used source of resistance in hexaploid wheat is the Chinese cultivar, ‘Sumai3’ (Bürstmayr et al., 2009). ‘Sumai3’derived resistance is attributed to the Fhb1 locus on chromosome 3BS, the major QTL conferring Type II resistance. Positional cloning of Fhb1 is underway, and gene identification may become available within the next few years (Liu et al., 2008). Additional QTLs from ‘Sumai3’ include Fhb2 (6BS) and Qfhs.ifa-5A (5A); the latter is associated with Type I resistance and has been found in different germplasm sources from around the world (Bürstmayr et al., 2009). Another popular resistance source comes from the Brazilian cultivar, ‘Frontana’, which possesses moderate FHB resistance, and whose resistance-associated QTLs have been mapped to positions 3A, 5A, 2B, 3AL, and 7AS (Steiner et al., 2004; Han et al., 2005; Mardi et al., 2006; Bürstmayr et al., 2009). An interesting set of QTLs for FHB resistance may be associated with Rht, plant height regulators. Some studies have shown that plant height is correlated with FHB-resistance (Couture, 1982; Steiner et al., 2004; Klahr et al., 2007), although rare exceptions may be found (A. Comeau, personal communications). Rht-D1 co-localizes with a FHB resistance QTL on 4DS, found in the European winter wheat cultivar, ‘Arina’ (Draeger et 24  al., 2007). Rht-B1 is on the same chromosome (4B) as an FHB-resistant QTL, and Rht8 is located close to a QTL on 2D. Rht-B1 and Rht-D1 are de-repressors of gibberellins signalling, and Rht8 conditions gibberellin-responsiveness, while the so-called semidwarfing alleles, Rht-B1b and Rht-D1b, confer gibberellin-insensitivity (Zhang et al., 2006b). Rht-D1b, but not Rht-B1b, also confers FHB-susceptibility (Draeger et al., 2007; Nicholson et al., 2008). It has not yet been determined whether there is a pleiotropic effect that would explain this interaction (Draeger et al., 2007).  1.4.3 Breeding for Fusarium Head Blight resistance Some of the challenges breeders are confronted with include: (1) poor agronomic traits associated with highly-resistant germplasm sources, which are often derived from exotic sources, (2) the polygenic nature of resistance, and (3) variability in disease rating accuracy, as previously described. Unfortunately, breeders have been limited in their choices of resistance sources, and therefore some of these problems perpetuate themselves. For example, while gene-for-gene resistance brings with it its own set of difficulties (such as the development of an arms-race between host and pathogen; Dodds et al., 2006), the lack of vertical resistance in FHB-host interactions precludes the prospect of immunity. As a consequence, the few available sources of strong resistance are recycled through various breeding programs, a phenomenon that may ultimately lead to the arms race scenario observed in gene-for-gene resistance. This limitation brings us back to the original problem: FHB-resistance is quantitative, and thus, the use of only a limited number of resistant sources in the development of resistant germplasm is not very effective. Furthermore, most of these resistance sources have poor agronomic traits. 25  ‘Sumai3’ is the prime example of a stable resistant source that is used in breeding programs worldwide. The stability and level of resistance is higher in this germplasm than in any other known source of resistance. Unfortunately, ‘Sumai3’ germplasm brings with it several agronomic deficiencies that seem to co-segregate with the 3BS QTL, including susceptibility to kernel shattering and reduced yields (Zhang and Mergoum, 2007). Over the past few decades, several tactics have emerged as enhancements, or as an alternative to, traditional breeding methods. Traditional breeding is a long and tedious process, requiring many generations of screening, which can be costly and time consuming. Breeders often screen thousands of lines, narrowing them down every year, for up to ten years, before they are ready to apply for the registration of one or two cultivars. A promising alternative approach to developing FHB-resistant cultivars involves an in vitro selection process, as proposed by Bruins et al., (1993). It was suggested that single-cell microspores might be well suited for in vitro selection for resistance, since a large proportion of the plant genome is expressed in both the sporophyte and the gametophyte. This approach can be used to efficiently screen a large population of cells for trichothecene or Fusarium resistances. Fadel and Wenzel (1993) were the first to report a selection scheme using mixed culture filtrates of 99 F. graminearum isolates co-cultured with 10-day old anther cultures, but they had little success in selecting for resistance among plants regenerated from the anthers. Following a similar strategy, Eudes et al. (2008) applied crude trichothecenes to anther cultures and reported successful selection for both reduced mycotoxin accumulation and FHB resistance in the resulting regenerated double haploid plants. 26  1.4.4 Engineering for Fusarium Head Blight resistance Genetic engineering can be effective both as tool for studying the mechanisms of FHB-resistance, and towards the development of FHB-resistant crops. Some of the major challenges in any genetic manipulation of wheat are directly related to the complexity of the wheat genome. Common bread wheat, Triticum aestivum, is a hexaploid (AABBDD) with seven homologous chromosome pairs derived from each of three ancestors, T. uratu (AA), Aegilops speltoides (SS, closely related to the B genome), and A. tauschii (DD), all of which co-evolved from a common ancestor. T. uratu and A. speltoides first converged to form the tetraploid (AABB) durum wheat (T. turgidum), which later (over 8000 years ago) converged with A. tauschii to produce T. aestivum (reviewed in Huang et al., 2002; Dubcovsky and Dvorak, 2007). The genetic redundancy encoded within the wheat genome, in combination with the large genome size (16,000 Mb; Gill et al., 2004), makes for a system that is difficult to manipulate using either conventional genetic approaches or transgenic technology, since transgenes are easily lost to segregation after a few generations. The in vitro selection process described by Eudes et al. (2008) for the development of FHB-resistant plants can be used in combination with cell penetrating peptides to introduce foreign genes into the microspore genome, providing a promising tool for the production of double haploid transgenic wheat lines. This methodology should, in theory, overcome the problems of transgene segregation. Furthermore, this approach can also be used for gene silencing by employing RNA-interference (RNAi). RNAi technology takes advantage of the plant’s endogenous machinery responsible for degradation of doublestranded RNA (dsRNA), and subsequent degradation of any single stranded RNA 27  (ssRNA) with the same sequence. The RNAi gene silencing machinery has been identified in many organisms, including nematodes, plants, and mammals. Foreign dsRNA species, often introduced by viruses, are targeted by Dicer and Dicer-like proteins (Hammond et al., 2000; Liu et al., 2009), nucleases that cleave dsRNA into 21- to 26-mer products known as short interfering RNA (siRNA) (Elbashir et al., 2001), which are then incorporated into an RNA-induced silencing complex (RISC) (Paroo et al., 2007). The RISC subsequently targets single-stranded RNA (ssRNA) homologous to the siRNA, and degrades the ssRNA. Similarly, micro-RNAs (miRNAs), endogenous regulatory noncoding RNAs 20- to 24-mer in length, are also targeted by RISCs (Zhang et al., 2006a). Thus, RNAi-mediated gene silencing can be conferred by transgenically expressing a sequence homologous to the gene of interest, followed by a short spacer sequence and the antisense sequence (reviewed in Mansoor et al., 2006). The transcribed RNA product will form a hairpin loop, where the reverse antisense sequence folds onto the sense strand, forming dsRNA, which would then be targeted by Dicer and RISC. The RISC would subsequently degrade any messenger RNAs (mRNAs) with homologous sequences, thus preventing translation of the gene of interest. Similarly, virus-induced gene silencing (VIGS) (van Kammen, 1997; Ruiz et al., 1998; Baulcombe, 1999), provides a transient gene silencing approach based on RNAi. The VIGS technology has been applied in a variety of species, where a sequence from the target gene for silencing is encoded in a vector within an RNA virus, which is then used to systemically infect the plant. Once infected, the RNA expressed by the virus is targeted by RISC for degradation. Tobacco mosaic virus, potato virus X, and barley stripe mosaic virus (BSMV) are examples of some viruses that have been used in the VIGS system. 28  Using BSMV, this technology was recently adapted for use in wheat, and has been successfully implemented in identifying disease resistance genes (Scofield et al., 2005). Both gene silencing and over-expression of genes of interest have been successfully implemented in the study of gene function associated with FHB-resistance in wheat (Anand et al., 2003; Makandar et al., 2006; Chen et al., 2009). Genetic engineering towards FHB-resistance could be an effective approach to reducing mycotoxin accumulation in cereals, bypassing the problems of both limited sources of resistance and the co-segregation of resistance with poor agronomic traits. Transgenic crops could directly reduce trichothecene accumulation when the modifications include expression of genes or pathways within the host that inhibit trichothecene synthesis, detoxify trichothecenes, or remove them from the cell by efflux. Examples of enzymes that may be involved in detoxification include epoxidases, acetyltransferases, and glycosyltransferases (Boutigny et al., 2008). While trichothecene de-epoxidation has not been observed in planta (Boutigny et al., 2008), the epoxide group has been shown to be essential for trichothecene toxicity (Ehrlich and Daigle, 1987). Trichothecene 3-Oacetyltransferase activity of TRI101, which leads to DON-acetylation, has been shown to reduce toxicity of trichothecenes in F. graminearum (Kimura et al., 1998). It has also been demonstrated that a C-3 acetylation reduces the phytoxicity of various trichothecenes in plants (Alexander et al., 1999b; Muhitch et al., 2000; Desjardins et al., 2007a; Ohsato et al., 2007). However, this may be species-dependent since DON and its C-3 acetylated counterpart, 3-ADON have been shown to be equally phytotoxic in wheat coleoptile growth inhibition assays (Eudes et al., 2000). Since TRI101 activity reduces trichothecene toxicity in Fusarium by C-3 acetylation, and since C-3 acetylation has been 29  shown to reduce phytotoxicity of trichothecenes in some plant species, it was thought that similar outcomes may be observed in plants. In fact, transgenic expression of this gene has shown improved FHB- and trichothecene-resistance in plants (Okubara et al., 2002; Ohsato et al., 2007; Alexander, 2008). Another Fusarium gene, Tri12, which is a Major Facilitator Superfamily (MFS) transporter responsible for trichothecene efflux from F. sporotrichioides (Alexander et al., 1999a), might also have the potential to reduce trichothecene accumulation in plants if it were ectopically expressed in transgenic wheat. Wheat UDP-glucosyltransferase has been shown to detoxify DON by condensation of a glucose molecule with the hydroxyl group at C-3 (Poppenberger et al., 2003), and glycosylated-DON derivatives have been observed in Fusarium-infected cereals (Berthiller et al., 2005; Dall’Asta et al., 2005; Lemmens et al., 2005). It has been hypothesized that the 3BS QTL of ‘Sumai3’ is in fact a UDP-glucosyltransferase (Lemmens et al., 2005). However, fine-mapping of the 3BS QTL by James Anderson’s research group in Minnesota has narrowed it down to a few candidate genes, and none of these encode UDP-glucosyltransferase. Nevertheless, this does not eliminate the possibility that the 3BS QTL is involved in the regulation of UDP-glucosyltransferase expression (Liu et al., 2008). Interestingly, differential accumulation of UDPglucosyltransferase transcripts and protein has been observed in maize upon exposure to Fusarium (Harris et al., personal communications). Transgenic expression of UDPglucosyltransferase might lead to improved FHB-resistance and reduced toxin accumulation in cereals and maize crops, although this approach may be unsuitable for food crop production since glycosylated-ZON has been shown to be converted back to ZON in the intestinal tract of swine (Gareis et al., 1990). 30  1.5 Overview  Both Type I and Type II resistance to FHB are multigenic, and because of their complex nature it has been difficult to define the genetic basis in either case. The physiological mechanism of Type II resistance is more clearly defined, in part due to the relative simplicity of evaluation of this resistance compared with that of Type I. Furthermore, high levels of Type II resistance have thus far been found only in ‘Sumai 3’ and derived genotypes with the 3BS QTL. In contrast, many QTL have been identified for Type I resistance, but the different QTLs for Type I resistance tend to be associated with different sources of resistance; thus, no one QTL has repeatedly been correlated with Type I resistance. It is proposed here that the molecular mechanisms of Type I resistance are variable and genotype-dependent, whereas Type II resistance likely involves a more specific set of molecular responses to the pathogen. Furthermore, since trichothecenes are involved in FHB-disease spread, I hypothesized that the molecular mechanism of Type II resistance involves a specific response to the effect of trichothecenes, and that this response could be resolved from the more complex responses to live pathogen challenge by an appropriately designed evaluation of elicited changes in gene/protein expression. Since previous functional genomics studies to date have not been able to clearly identify a specific pathway for Type II resistance, I designed and carried out a series of studies using molecular plant pathology approaches in three related wheat genotypes (‘Superb’, DH1, and DH2) in an effort to isolate the differences in Type I and Type II resistance. ‘Superb’ is a susceptible Canadian cultivar; DH1 (‘CIMMYT 11’/’Superb’*2; Type I resistant) and DH2 (‘CM82036’/’Superb’*2; Type II resistant) are resistant double 31  haploid lines generated by in vitro selection of microspore-derived embryos using a trichothecene toxin screen (0.23 mg L-1 deoxynivalenol, 0.23 mg L-1 15-O-acety-4deoxynivalenol, 0.47 mg L-1 nivalenol, and 0.7mg L-1 T2 toxin) as described by (Eudes et al., 2008). In order to compare the interaction between trichothecenes and disease outcomes in a Type II resistant genotype with their interaction in genotypes that do not have the 3BS QTL for FHB-resistance, the effects of three elicitors (FgTri5+, FgTri5-, and the trichothecene DON) were compared. In Chapter 2, experiments in functional genomics were performed to provide preliminary insights into the molecular pathways that are differentially regulated in resistant and susceptible wheat genotypes in their response to the same three elicitors. Chapters 3 and 4 present results from experiments designed to follow up novel results obtained from functional genomics studies. A summary of my findings, their implications and proposed future research directions are presented in Chapter 5.  32  2. Differential Gene Expression and Protein Accumulation Patterns in Resistant and Susceptible Fusarium Head Blight Interactions in Wheat  2.1 Introduction  Functional genomics studies of the FHB-host interaction have been reported throughout the past decade (Pritsch et al., 2000; Pritsch et al., 2001; Zhou et al., 2005; Boddu et al., 2006; Zhou et al., 2006; Bernardo et al., 2007; Boddu et al., 2007; Golkari et al., 2007; Li and Yen, 2008; Golkari et al., 2009; Steiner et al., 2009). Pritsch et al. (2000) tracked the F. graminearum-induced transcript accumulation of six genes encoding pathogenesis-related (PR) proteins: PR-1, PR-2 (β-1,3-glucanase), PR-3 (chitinase), PR-4, PR-5 (thaumatin-like protein), and peroxidase (POX), and observed increased accumulation for all six. Among these, PR-4 and -5 accumulated earlier and in higher quantities in Type II resistant ‘Sumai 3’ than in the susceptible cv. ‘Wheaton’. In a second study, they found that PR-1, -2 and -5 accumulated in the uninvaded spikelets of wheat heads (Pritsch et al., 2001). F. graminearum-induced up-regulation of PR-2, -4 and -5 has also been observed in ‘Sumai 3’, but not in two ‘Sumai 3’ near-isogenic lines that are susceptible to FHB (Golkari et al., 2009). In another resistant cultivar, ‘Ning 7840’, F. graminearum infection induced up-regulation of PR-1 and a chitinase precursor, relative to the response of the same genes in the susceptible cv. ‘Clark’ (Bernardo et al., 2007). Protein accumulation studies in barley have shown PR-3 and PR-5 up-regulation in resistant lines compared with susceptible ones (Geddes et al., 2008).  33  Fewer studies have used global protein profiling to explore the differential proteomics of FHB and wheat. Zhou et al. (2005) observed up-regulation of antioxidant and PR proteins in F. graminearum-infected spikelets of ‘Ning7840’. In the other protein accumulation studies in wheat, F. graminearum has been shown to induce downregulation of metabolism-related proteins and upregulation of defence-related proteins; these responses were observed as early as 6 hai in a resistant wheat cv. ‘Wangshuibai’ (Wang et al., 2005), and at 3 dai in an independent study in the susceptible wheat cv. ‘Crystal’ (Zhou et al., 2006). Consistent with functional genomics analyses, over-expression of various PR or defence-related proteins has been shown to improve cereal resistance to FHB, as well as Arabidopsis resistance to F. oxysporum (Epple et al., 1997; Anand et al., 2003; Makandar et al., 2006). Regulation of PR protein expression is often mediated by host signalling metabolites, including salicylic acid (SA), jasmonic acid (JA), and ethylene (ET) (Glazebrook, 2005). The related signalling pathways are well characterized in dicots, but increasing evidence indicates that they may differ in monocots (Huckelhoven et al., 1999; Molina et al., 1999; Lu et al., 2006). JA/ET signalling is typically seen as the preferred pathway mediating a resistance response to necrotrophic pathogens in both monocots and dicots, whereas SA signalling tends to be associated with resistance to biotrophic pathogens (Glazebrook, 2005). In the case of FHB, it remains unclear which pathways are involved in either Type I or Type II resistances responses. Despite advances in our knowledge of the genes and pathways associated with FHBresistance, the molecular processes that actually confer a resistance or susceptible response remain unclear. The absence of gene-for-gene resistance increases the 34  complexity of the disease response, and makes it difficult to identify discrete mechanisms underlying resistance or susceptibility. In order to better understand the cellular processes controlling disease outcomes and to create opportunities for developing novel forms of resistance, we need to better define the molecular pathways in FHB-challenged wheat tissues that result in resistance. Since changes in gene expression are expected to reflect the suite of host cell responses during FHB infection, I conducted a time-course study of the differential transcriptome of three wheat genotypes in their response to isolated components of FHB. The three wheat genotypes, ‘Superb’, DH1 and DH2 (as described in Chapter 1), were challenged with four inocula (water, FgTri5+, FgTri5- and DON). Transcriptome and proteome analysis was performed on uninoculated spikelets harvested from point-inoculated wheat spikes, a sampling strategy that would be expected to capture the changes resulting from a systemic, rather than local, host tissue response. This experimental design allowed for comparison of the molecular biology of susceptible vs resistant host responses, as well as a comparison of Type I vs Type II resistant host responses, while at the same time allowing an exploration of how different components of FHB disease affect the disease outcomes. Furthermore, by isolating the effects of aggressiveness factors and the effects of trichothecens in these three wheat genotypes, this design allowed me to investigate the hypothesis presented in Chapter 1, that the molecular mechanisms of Type II resistance involves a specific response to the effect of trichothecenes.  35  2.2 Materials and Methods  2.2.1 Plant material The three wheat genotypes defined in Chapter 1, namely ‘Superb’, DH1 and DH2, were used in this study. Seeds were sown in 4 L pots (1 plant per pot) containing Cornell Mix (Boodley and Sheldrake, 1977) and grown in a greenhouse (21/18oC, 16 h photoperiod). Plants were watered as needed and fertilized biweekly with 20-20-20 (N-PK). At the 5-7 leaf stage they were treated with Tilt™ (2.5 mL L-1 propiconazole, Syngenta Crop Protection Canada, Guelph, ON) and Intercept™ (0.004 g L-1of soil, Imidacloprid, Bayer Crop Science Canada, Toronto, ON) as preventative measures against powdery mildew and aphids.  2.2.2 Inocula All four inocula defined in Chapter 1 were used in this study: water, FgTri5+, FgTri5-, and DON. For FgTri5+ or FgTri5- inocula, four mycelium plugs (1 cm2 each) from cultures grown on potato dextrose agar plates were used to inoculate 500 mL CMC broth (1.5% carboxymethylcellulose (SIGMA C1011), 0.1% NH4NO3, 0.1% KH2PO4, 0.05% MgSO4·7H2O, 0.1% yeast extract; Cappellini and Peterson, 1965). The culture was incubated at room temperature with gentle agitation (150 rpm) for two weeks and then filtered through cheese cloth. The filtrate was diluted with sterile ddH2O to a working concentration of 40,000 macroconidia mL-1. For DON-containing inocula, DON (D0156, Sigma-Aldrich, Oakville, ON, Canada) was dissolved in 40% ethanol to a concentration of 1 mg mL-1, and diluted to a working concentration of 2 1 mg mL-1 in ddH2O. 36  2.2.3 Inoculations and tissue collection Plants were moved to a mist-irrigated greenhouse (25oC, 95% humidity, 16 h photoperiod) during anthesis. Two spikelets (one on each row) near the center of the spike were point-inoculated with 10 µL inoculum. In order to reduce the variation in transcript profiles due to the circadian cycle, all inoculations took place between 0700 and 1000. Up to six spikelets above and below each inoculation point (for a total of up to 12 spikelets; see Figure 2.1) were collected at 3, 8 and 24 hours after inoculation (hai) for RNA extractions and at 3 days after inoculation (dai) for protein extraction. Zero hour uninoculated controls were also collected for RNA extractions (up to 12 spikelets above/below the centre were harvested between the hours 0700 and 1000). Three experimental repetitions were performed, each with three biological replicates, where experimental repetitions were differentiated by seeding dates. Each biological replicate consisted of one spike from one plant for a given condition. The three biological replicates (spikelets from three spikes) were pooled together for RNA or protein extractions. Thus, for each experimental repetition, a total of 39 RNA extractions were performed, as well as 15 protein extractions.  37  discard  A.  spikelets  Protein  2D-electrophoresis  RNA  Affymetrix  H 2O  B.  III  I FgTri5+  II  DON  IV FgTri5-  Figure 2.1 Inoculation of wheat spikes and harvesting of spikelets for RNA and protein extractions. A. The two central spikelets (4 florets; shaded in figure) of the wheat head were each point-inoculated with 10 µL inoculum, and incubated in a mistirrigated greenhouse. Spikelets above and below the inoculation point were collected at 3, 8 and 24 hai, and the remainder of the head was discarded For 0 hai controls, plants were not inoculated, but spikelets were collected above and below the two central spikelets at anthesis. Total RNA or protein was extracted from the collected spikelets. B. Analysis of differential transcriptomics or proteomics included four treatment comparisons: I. effect F. graminearum wild-type (FgTri5+); II. effect of trichothecene non-producing F. graminearum (FgTri5-); III. effect of DON; and IV. effect of aggressiveness factors (FgTri5+ vs FgTri5-).  38  2.2.4 Microarray For each of the three experimental repetitions, harvested spikelets were ground under liquid nitrogen, and total RNA was extracted from 0.1 g of the resultant powder using QIAGENs RNeasy® Plant Mini Kit with an on-column DNase digestion. RNA quality was verified on a 1% agarose gel and 5 µg total RNA was used for biotin labelling. The two-cycle cDNA synthesis, cRNA labeling and hybridization to the Affymetrix GeneChip® Wheat Genome Array were done according to manufacturers instructions (Affymetrix). A total of 117 chips were used, corresponding to the 39 RNA extractions in each of three experimental repetitions. The Affymetrix cel files resulting from scanning will be deposited in the Gene Expression Omnibus (NCBI) for public accessibility. Cel files were subjected to GCRMA (Wu et al., 2004b) and MAS5 (Hubbell et al., 2002) algorithms for background subtraction, data normalization, and probe summarization, using the ArrayAssist® (Stratagene) software. Default settings were used in statistical analysis to calculate fold difference (FD) and p-value. Treatment comparisons were made within each plant line, at each harvest time (3, 8 and 24 hai), with a 2.0 FD cut-off (p < 0.05). Treatment comparisons are presented in Figure 2.1 and include: (I) effect of wildtype F. graminearum (FgTri5+); (II) effect of the trichothecene non-producing F. graminearum (FgTri5-); and (III) effect of DON; (IV) effect of FgTri5+ compared directly with FgTri5-. Comparisons were also made between plant lines for the 0 hai harvest with a 5.0 FD cut-off (p < 0.05). Probe sets were initially annotated using an automated procedure by BLASTint against the SwissProt non-redundant protein database and the plant and fungal sections of the non-redundant nucleotide database (NCBI). Probe sets of potential interest were then manually curated to identify those with BLAST 39  match(es) that strongly supported annotation of the corresponding wheat gene as an homolog of a biochemically characterized gene in wheat or another plant species (Ouellet et al., unpublished). Most of the gene annotations are putative gene descriptions; thus, the gene descriptions in this text are mainly putative descriptions.  Table 2.1 Primer sequences for qPCR validation. Sequences were selected to have overlapping regions corresponding to the probes used in the Affymetrix GeneChip®. Probe set  Forward Primer  Reverse Primer  AFFX-Ta_Sucsyn_3_at  5’-AGTGTCGGCTGCGTTATGAT  5’-CACAAATGTGCCGAGACAAC  TaAffx.106139.1.S1_at  5’-GCTGCTGAGCAAAAACAAATC  5’- AATCAAATCTTGGAGGGGATG  TaAffx.108735.1.S1_at  5’-CTACGACTGTGGCTGGCGGC  5’-TGCAACCGCCACAACACCTTCA  TaAffx.111195.1.S1_at  5’-GAGTTTAACGCGGTTTCCAC  5’-ATAGCTGGGTGCTCACGATT  Ta.526.1.S1_x_at  5’-GGTGTTCATCCGCACCAT  5’-TGCCCGAGGTAAATCTCATC  Ta1207.1.S1_x_at  5’-CGACCCACATGCACTCGGGA  5’-GGGCAGGAGCCCGTGAGGTA  Ta.1967.1.S1_x_at  5’-CCCAACAGCATCTCCATTTA  5’- TGTCCCATTCCAATTATACCC  Ta.16723.2.S1_x_at  5’-GTGCTCGCGCAGATGTGCCT  5’-AGCATGGCTCTGCCCCAGGA  Ta.24501.1.S1_at  5’-GCTATCCTGCTCCCTCTCC  5’-TCGTAGAAGTCCTGGGTGCT  2.2.5 Real-time RT-PCR cDNA synthesis was performed on 2 µg total RNA using Invitrogen’s SuperScriptTM III Reverse Transcriptase according to manufacturer’s instructions, and the product was diluted 20-fold in nuclease-free water. Primers were designed to amplify gene products from eight unique probe sets (Table 2.1). The gene product corresponding to the housekeeping probe set AFFX-Ta_Sucsyn_5_at was selected as a housekeeping gene for real-time RT-PCR (qPCR), as this gene showed little variation accross gene chips for the various conditions and genotypes used for the microarray experiment, with an average signal for log-transformed data of 7.2 + 0.8. The qPCR reaction mix was set up using 40  Qiagen’s QuantiTectTM SYBR® Green Master Mix with 2 µL of cDNA, and 0.5 µM of both forward and reverse primers, in a final reaction volume of 15 µL. Samples were run on an Applied Biosystems’ 7900HT Fast Real-Time PCR System, with a 15 min hotstart at 95oC, followed by 40 cycles through 95oC (30 s) and 60oC (60 s). A melting curve was included in order to confirm amplification of a single gene product. Fold-differences and standard error were calculated from CT-values using Qiagen’s REST 2006 software package.  2.2.6 Protein sample preparations For total protein extractions, harvested spikelets were ground under liquid nitrogen and the powder suspended 10 mL Precipitation Buffer (90% acetone, 10% trichloroacetic acid, 0.07% β-mercaptoethanol) for an overnight protein precipitation at -20oC. Following an initial centrifugation, the pellet was washed and spun three times using cold 10 mL Wash Buffer (acetone with 0.07% β-mercaptoethanol). All centrifugation steps were performed at 12,000 x g for 20 min at 4oC. After the third wash step, the pellet was air dried in the fume hood on ice, for 20 min. The protein was solubilized for 20 min at room temperature in 3 mL Rehydration Buffer 3-10 (7 M Urea, 2 M thiourea, 4% CHAPS, 0.5% ZOOM® Carrier Ampholytes pH 3-10, 10 mM tris(2)carboxyethylphosphine (TCEP)), and after a centrifugation step the supernatant was transferred to a new tube. In order to concentrate the samples, the protein was precipitated from the supernatant for 2 h at -20oC in 30 mL Precipitation Buffer, after which the precipitate was spun down. The resulting pellet was washed and spun three times in 5 mL pre-chilled Wash Buffer, air dried at room temperature for up to 10 min, 41  and then resuspended in 600 µL Rehydration Buffer 3-10. Samples were cleaned using ReadyPrepTM 2-D Cleanup Kit (BioRad), and resuspended in 600 µL Rehydration Buffer 3-10. Purified protein was quantified by Bradford Assay (BioRad) and 2 mg of total protein in 600 µL Rehydration Buffer 3-10 with 400 mM 4-vinylpyridine (4-VP) was vortexed at approximately 1000 rpm for 60 min at room temperature (reductionprotection technique adapted from Bai et al. (2005)). Pyridilation was terminated by the addition of 400 mM dithiothreitol (DTT) and incubation at room temperature for 15 min. Samples were diluted to a final volume of 3.25 mL in Rehydration Buffer 3-10 for 2Delectrophoresis.  2.2.7 2D-electrophoresis Samples were pre-fractionated according to isoelectric point using a ZOOM® isoelectric focusing (IEF) Fractionator with ZOOM® discs pH 3, 7, and 10, according to manufacturer’s instructions (Invitrogen). The resulting pH 3-7 and 7-10 fractions were quantified by Bradford Assay (BioRad) and loaded onto a 17 cm ReadyStripTM immobilized pH gradient (IPG) Strips (BioRad) which was allowed to rehydrate for 16 h at 20oC. For pH 3-7 fractions, a total of 100 µg protein in 300 µL Rehydration Buffer 4-7 (7 M Urea, 2 M thiourea, 4% CHAPS, 10mM TCEP, 0.5% ZOOM® Carrier Ampholytes pH 4-7) was loaded onto pH 4-7 IPG strips. For pH 7-10 fractions, a total of 150 µg protein in 300 µL Rehydration Buffer 7-10 (7 M Urea, 2 M thiourea, 4% CHAPS, 10mM TCEP, 0.5% Bio-Lyte® 7/10) was loaded onto pH 7-10 IPG strips. Isoelectric focusing was performed in a Protean IEF Cell (BioRad) with 5 µA maximum per gel for pH 4-7 strips (ramp to 250V for 30 min, slow ramp to 10,000 V for 2 h, hold at 10,000 V for 40 42  kVh) and for pH 7-10 strips (ramp to 150 V for 2 h, 300 V for 4 h, 1500 V for 1 h, 5000 V for 5 h, 7000 V for 6 h, 10,000 V for 3 h). Strips were equilibrated twice for 10 min in Equilibration Buffer (6 M Urea, 15% (w/v) glycerol, 1% SDS, 0.1 M Tris-HCl, pH 8.8), with 10 mM TCEP included in the second equilibration. Strips were rinsed in Running Buffer (192 mM glycine, 0.1% SDS, 25 mM Tris-HCl, pH 8.3) and loaded onto 12% acrylamide gels for second dimension electrophoresis (15 mA per gel for 30 min, 30 mA per gel for 4.5 h). For each pH range a total of 45 gels were run, corresponding to the 45 protein extractions. 2D-gels were stained with Sypro-Ruby (BioRad) and the resulting images were captured using a Typhoon 9400 scanner (600 V, normal sensitivity; 610 BP30/532 nm; GE Healthcare). 2D-gel patterns were analyzed using Phoretix 2D Expression v2005 (Nonlinear Dynamics). For each treatment and plant line, an average gel was created from three experimental replicates (see Inoculations and Tissue Isolation). A normalized spot volume for each spot was calculated as a percentage of the total spot volume. Warping, spot matching between average gels and comparison gels, and mean spot volumes were calculated by the software. Spot matches were then manually confirmed. For comparison of average gels, differentially regulated spots were defined as having greater than a 2FD (p < 0.05). The same four treatment comparisons were performed within each plant line as described for the microarray analysis. Comparisons were also made between plant lines for each of the four treatments. All differentially regulated spots were selected for protein sequencing. Selected spots were excised from the gels and sent for sequencing at the Proteomics/Mass Spectrometry Core Facility at the Institute for Biological Sciences, 43  National Research Council of Canada. Spots were trypsin (Promega)-digested overnight at 37oC at a ratio of 30:1 (protein:enzyme, v/v) in 50 mM ammonium bicarbonate. The resulting peptide solutions were injected onto a C18 trap column (Symmetry C18, 5 µm, 180 µm x 20 mm) on a nano-Acquity UPLC (Waters, Milford, MA). The C18 trap was brought in line with a C18 capillary column (100 µm x 100 mm nano-Acquity UPLC column). A 14-minute gradient from 1% acetonitrile/0.2% formic acid (99% 0.2% formic acid in water) to 40% acetonitrile/0.2% formic acid (60% 0.2% formic acid in water) was used from chromatographic separation. The nano-Acquity UPLC effluent was connected to a nano-electrospray source on a Q-TOF-Ultima hybrid quadrupole time-of-flight (TOF) mass spectrometer (Waters, Milford, MA). The ions were analyzed by TOF-MS (survey scan) and when a 2+ or a 3+ ion is detected, an MSMS scan on this ion triggered.  2.2.8 2D-electrophoresis optimization for resolution in the basic range Several reduction/protection techniques were used for optimization of resolution in the basic pH range of the IEF gradient. These include: (1) ReadyPrepTM ReductionAlkylation (BioRad) using tributylphosphine (TBP) and iodoacetamide (IAA); (2) reduction with TBP and pyridylation with 4-VP, as described in Bai et al. (2005); and (3) reduction with TCEP and pyridylation with 4-VP, adapted from Bai et al. (2005). Total protein was extracted as described in section 2.2.6, but it was solubilized in 1 mL Rehydration Buffer 3-10 with 50 mM DTT and without TCEP. The total protein was then cleaned using the ReadyPrepTM 2-D Cleanup Kit (BioRad) as described in section 2.2.6, except the samples were resuspended in 600 µL Rehydration Buffer 3-10 without TCEP 44  or other reducing agents. All reduction-protection protocols were conducted at room temperature. In the first approach, 250 µL total protein in Rehydration Buffer 3-10 without TCEP was combined and vortexed at approximately 1000 rpm with 7.5 µL alkylating buffer and TBP to a final concentration of 5 mM. After a 30 min incubation, 15 mM fresh iodoacetamide (IAA) was added and the mixture vortexed. Alkylation was terminated after 60 min by adjusting the TBP concentration to 10 mM, followed by 15 min incubation. In the second and third reduction-protection approaches, samples were first reduced with TBP and TCEP, respectively, and then pyridylated with 4-VP to protect the sulphur groups. These reactions were performed as described in section 2.2.6, except, in the second approach, the Rehydration Buffer 3-10 without TCEP was combined with 5 mM TBP and 40 mM Tris-HCl pH 8.8 and pyridilation was performed with 20 mM 4-VP and terminated with 20 mM DTT. Following each of the three reduction protection steps used, samples were cleaned again using ReadyPrepTM 2-D Cleanup Kit (BioRad), as described in section 2.2.6, and then quantified by the Bradford Assay (BioRad). The 17 cm ReadyStripTM IPG pH 7-10 Strips (BioRad) were rehydrated for 11 h at 20oC in 330 µL Rehydration Buffer 7-10 (7 M Urea, 2 M thiourea, 4% CHAPS, 0.5% Bio-Lyte® 7/10). The reduced/protected total protein samples (450 µg protein in 130 µL) were then loaded into a cup placed on the anode side of the strips. IEF was performed in a Protean IEF Cell (BioRad) with 5 µA maximum current per gel (ramp to 250V for 30 min, linear ramp to 10,000 V for 1 h, hold at 10,000 V for 30 kVh). Strips were equilibrated twice for 10 min in Equilibration Buffer first with 2% DTT and then with  45  2.5% IAA. The second dimension separation was performed as described in section 2.2.7, and resolution of protein gels were compared visually.  2.3 Results  Affymetrix GeneChip® microarray and 2D-electrophoresis analyses were used to investigate induced transcriptional and proteomic differences, respectively, in the wheat response upon exposure to different treatments (defined in Figure 2.1). Genotype-specific differences in constitutive gene expression between ‘Superb’, DH1, and DH2 were examined in the zero-hour uninoculated control samples. Genes showing at least five-fold differences (FD) in constitutive expression (p < 0.05) are listed in Table 2.2 and discussed below. Constitutive differences were not evaluated in the proteome, but genotype differences were observed within each of the four treatments, and those with > 2-FD (p < 0.05) are listed in Table 2.3. In challenge experiments, analysis was conducted on the uninoculated spikelets from inoculated heads collected at 3, 8 and 24 hai for microarray analysis and at 3 dai for protein profiling. Four treatment comparisons (Figure 2.1) were made within each genotype: (I) FgTri5+ vs. water (effect of FgTri5+); (II) FgTri5- vs. water (effect of FgTri5-); (III) DON vs. water (effect of DON); and (IV) FgTri5+ vs FgTri5-. Genes showing challenge-dependent expression changes of at least 2-FD (p < 0.05) are presented in Table A1, and a subset of those (presented in Table 2.4) are discussed in the current report. Proteins showing challenge-dependent changes of at least 2-FD (p < 0.05) are presented in Table 2.5. Technical validation of the 2-FD cut-off values observed in the microarray experiments was conducted by qPCR (Table 2.6). 46  Table 2.2 Constitutive difference between transcriptomes of FHB-resistant genotypes and susceptible ‘Superb’. Positive and negative values (FD > 5.0, p < 0.05) indicate higher transcript accumulation in the resistant line and ‘Superb’, respectively. DH1 vs ‘Superb’ Probe Set ID  Gene Description  FD  p-val  DH2 vs ‘Superb’ FD  p-val  Defense-Related Protein Ta.352.1.S1_at  Dehydration-responsive protein RD22 [Oryza sativa (japonica cultivargroup)]  +73.7  0.001  TaAffx.36658.1.S1_at  Disease resistance protein Hcr2-5D [O. sativa (japonica cultivargroup)]  +5.9  0.006  Ta.21646.1.S1_at  Lipid transfer protein [O. sativa (japonica cultivar-group)]  -10.8  0.026  Ta.21646.1.S1_x_at  Lipid transfer protein [O. sativa (japonica cultivar-group)]  -5.0  0.035  Ta.1282.4.S1_at  Lipid transfer protein 3 (LTP3) [Triticum aestivum]  Ta.28695.6.S1_at  Metallothionein (LOC542898) [T. aestivum]  -28.4  0.006  +38.8  0.000  Transport Protein Ta.2895.1.S1_at  Aquaporin PIP1 (Pip1)  +120.5  0.000  Ta.2895.1.S1_x_at  Aquaporin PIP1 (Pip1)  +143.2  0.000  TaAffx.113846.1.S1_s_at  Aquaporin PIP1 (Pip1) [T. aestivum]  +259.1  0.000  Ta.9751.1.A1_at  ABC transporter [O. sativa]  -13.2  0.000  47  DH1 vs ‘Superb’ Probe Set ID  Gene Description  FD  p-val  DH2 vs ‘Superb’ FD  p-val  +11.7  0.042  Structural Protein Ta.7378.6.S1_at  Alpha-tubulin (LOC543387)  +8.1  0.001  TaAffx.14498.1.S1_at  Alpha/beta-gliadin precursor (LOC543192)  +56.5  0.000  TaAffx.27775.1.S1_at  Receptor-like protein kinase 4 [O. sativa (japonica cultivar-group)]  +5.1  0.017  Ta.20570.1.A1_at  1-aminocyclopropane-1-carboxylate oxidase [Sorghum bicolor]  -16.7  0.002  Cell Signalling  Gene Expression Ta.9409.1.S1_at  Transcriptional coactivator p15 (PC4) family protein-like [O. sativa (japonica cultivar-group)]  Hydrolysis TaAffx.97452.1.A1_at  Lipase [O. sativa (japonica cultivar-group)]  -11.0  0.003  TaAffx.97535.1.S1_at  Lipase [O. sativa (japonica cultivar-group)]  -8.4  0.008  Ta.25832.1.A1_at  Cytochrome P450 [Triticum aestivum]  -14.6  0.000  Ta.5022.1.A1_at  NADH dehydrogenase (ubiquinone)  +5.7  0.020  Oxidases  48  DH1 vs ‘Superb’ Probe Set ID  Gene Description  FD  p-val  DH2 vs ‘Superb’ FD  p-val  Metabolism Ta.15908.1.S1_at  Argininosuccinate lyase  -6.7  0.034  Ta.27757.1.S1_at  Phosphoglycerate mutase family [O. sativa (japonica cultivar-group)]  -8.4  0.018  RNase S-like protein precursor [Hordeum vulgare]  +6.3  0.046  Other Ta.26907.1.S1_at  Protein with Unknown Function Ta.22794.1.S1_x_at  LOC543011  +8.5  0.011  Ta.22794.1.S1_at  LOC543011  +9.0  0.005  Ta.24733.1.S1_at  Hypothetical protein [O. sativa (japonica cultivar-group)]  -6.8  0.001  Ta.12402.1.S1_at  Hypothetical protein [O. sativa (japonica cultivar-group)]  -6.2  0.000  Ta.913.1.S1_x_at  O. sativa (japonica cultivar-group) cDNA clone:001-103-C02  -12.6  0.002  Ta.913.1.S1_at  O. sativa (japonica cultivar-group) cDNA clone:001-103-C02  -12.4  0.001  TaAffx.8202.1.S1_at  Unknown  -9.6  0.004  TaAffx.43135.1.A1_x_at  Unknown  +5.7  0.014  TaAffx.16415.2.S1_at  Unknown  -6.0  0.001  TaAffx.100436.1.S1_at  Unknown  -9.8  0.004  49  DH1 vs ‘Superb’ Probe Set ID  Gene Description  FD  Ta.28862.1.S1_at  Unknown  Ta.24761.1.S1_at  Unknown  -16.8  0.000  TaAffx.92842.1.S1_at  Unknown  +13.3  0.007  TaAffx.78888.1.S1_x_at  Unknown  -5.3  0.011  TaAffx.78888.1.S1_at  Unknown  -5.7  0.011  TaAffx.7810.2.S1_at  Unknown  +5.8  0.001  TaAffx.50853.1.S1_at  Unknown  TaAffx.31525.1.S1_at  Unknown  -5.6  0.003  Ta.8888.1.A1_at  Unknown  +6.7  0.002  Ta.7304.1.A1_at  Unknown  +6.4  0.001  Ta.3780.2.S1_a_at  Unknown  -8.8  0.001  Ta.3764.1.S1_at  Unknown  -6.5  0.001  Ta.30583.1.S1_at  Unknown  -9.9  0.035  Ta.30560.1.S1_at  Unknown  Ta.2963.1.S1_at  Unknown  Ta.29371.1.S1_at  Unknown  +11.3  p-val  DH2 vs ‘Superb’ FD  p-val  +5.2  0.031  +5.9  0.000  -6.8  0.049  +27.9  0.008  +5.8  0.000  0.000  50  DH1 vs ‘Superb’ Probe Set ID  Gene Description  FD  p-val  Ta.28366.1.S1_a_at  Unknown  -5.5  0.003  Ta.28236.1.S1_x_at  Unknown  -6.3  0.017  Ta.28079.1.S1_x_at  Unknown  +5.4  0.023  Ta.25945.1.S1_at  Unknown  +11.5  0.002  Ta.24736.1.S1_at  DH2 vs ‘Superb’ FD  p-val  Unknown  +8.3  0.016  Ta.14115.2.S1_at  Unknown  +5.4  0.006  Ta.13689.1.S1_at  Unknown  +6.5  0.000  Ta.1038.1.S1_a_at  Unknown  +18.4  0.000  -5.2  0.031  TaAffx.144000.1.S1_s_at  51  Table 2.3 Genotype differences in challenge-induced protein accumulation. Positive and negative FD values indicate higher and lower protein accumulation, respectively, observed in spots from 2D-electrophoresis in the pH 4-7 (A) and 7-10 (B) ranges. Accessions and protein descriptions were determined by MASCOT searches. Protein predictions with scores above 100 and a minimum of two queries matched are considered acceptable. The organism indicates which species to which the protein prediction was based upon.  FD  pvalue  Spot No.  Accession/ Gene ID  Protein Description  Pathway  Score  Queries  Coverage  Organism  DH1 Tri5+ vs water +2.09  0.002  386A  AY646352.1  spermidine synthase  polyamine synthesis  194  3  9%  Cucumis sativus  -2.30  0.039  458A  NM_001059187.1  ATP synthase subunit alpha, mitochondrial  ATP synthesis  105  5  4%  Oryza sativa  +2.37  0.050  167B  gi|54304033  catalase  oxidative stress  223  8  13%  Secale cereale  +4.45  0.006  198A  -  -  -  -  -  -  -  193B  -  -  -  -  -  -  -  DON vs water -2.53  0.006  52  FD  pvalue  Spot No.  Accession/ Gene ID  Protein Description  Pathway  Score  Queries  Coverage  Organism  +3.11  0.009  44B  gi|132270  Rubber elongation factor protein  lipid metabolism  52  1  7%  Hevea brasiliensis  Tri5+ vs Tri5-  -2.46  0.018  380A  P18492  Glutamate-1-semialdehyde 2,1-aminomutase (GSA), chloroplastic  -  184  4  11%  Hordeum vulgare  -2.09  0.001  123A  -  -  -  -  -  -  -  +2.12  0.026  177B  -  -  -  -  -  -  -  +2.37  0.045  198A  -  -  -  -  -  -  -  DH2 Tri5- vs water -3.62  0.015  240A  -  -  -  -  -  -  -  +2.01  0.033  74A  AJ313311.1  phosphoglucomutase  glycogenesis  274  9  11%  Triticum aestivum  +2.02  0.042  256B  -  -  -  -  -  -  -  +3.30  0.022  123B  -  -  -  -  -  -  -  +3.32  0.006  198A  -  -  -  -  -  -  -  DON vs water -3.79  0.004  240A  -  -  -  -  -  -  -  -2.98  0.007  128A  -  -  -  -  -  -  -  -2.55  0.046  309A  NC_002762.1  ATP synthase CF1 alpha subunit  ATP synthesis  673  19  32%  Triticum aestivum  53  FD  pvalue  Spot No.  Accession/ Gene ID  Protein Description  Pathway  Score  Queries  Coverage  Organism  -2.49  0.034  205B  gi|226316441  fructose-bisphosphate aldolase  glycolysis  307  11  23%  Triticum aestivum  -2.08  0.034  95B  gi|120680  Glyceraldehyde-3phosphate dehydrogenase, cytosolic  glycolysis  567  19  41%  Hordeum vulgare  -2.01  0.045  187B  gi|148508784  glyceraldehyde-3phosphate dehydrogenase  glycolysis  246  9  18%  Triticum aestivum  +2.53  0.013  226A  gi|115450493  glyceraldehyde 3phosphate dehydrogenase; Os03g0129300  glycolysis  248  8  15%  Oryza sativa  +4.03  0.037  123B  -  -  -  -  -  -  -  Tri5+ vs Tri5-3.88  0.048  319A  -  -  -  -  -  -  -  -3.44  0.001  299A  gi|56606827  calreticulin-like protein  signal transduction  57  2  4%  Triticum aestivum  -2.12  0.033  447A  gi|14017579  ATP synthase CF1 beta subunit  ATP synthesis  535  12  26%  Triticum aestivum  +2.55  0.047  321A  gi|66276267  ATP synthase beta subunit  ATP synthesis  106  2  2%  Coriaria ruscifolia  +3.16  0.028  225A  -  -  -  -  -  -  -  ‘Superb’  54  FD  pvalue  Spot No.  Accession/ Gene ID  Protein Description  Pathway  Score  Queries  Coverage  Organism  Tri5+ vs water -3.49  0.010  565A  -  -  -  -  -  -  -  -2.08  0.000  190B  gi|225465670  PREDICTED: hypothetical protein  Kalvin cycle  58  2  6%  Vitis vinifera  +2.22  0.044  298A  DQ435668.1  alpha tubulin-5D  cytoskeleton  160  5  11%  Triticum aestivum  +5.06  0.038  279B  -  -  -  -  -  -  -  Tri5- vs water -3.78  0.013  558A  DQ435659.1  alpha tubulin-2A  cytoskeleton  356  11  13%  Triticum aestivum  -2.17  0.030  9A  gi|15808779  ascorbate peroxidase  oxidative stress  177  4  22%  Hordeum vulgare  +2.07  0.022  444A  AY236152.1  cytosolic malate dehydrogenase  Kalvin cycle  247  7  18%  Triticum aestivum  +2.24  0.007  538A  -  -  -  -  -  -  -  +2.26  0.013  279B  -  -  -  -  -  -  -  DON vs water -4.65  0.024  564A  -  -  -  -  -  -  -  -2.71  0.034  470A  gi|18181983  myo-inositol-1-phosphate synthase  inositol phosphate metabolism  216  6  10%  Avena sativa  9A  gi|15808779  ascorbate peroxidase  oxidative stress  177  4  22%  Hordeum vulgare  Tri5+ vs Tri5-2.09  0.033  55  Table 2.4 Challenge-dependent changes in defence-related genes in FHB-susceptible ‘Superb’ and resistant genotypes. Positive and negative FD (FD > 2.0, p < 0.05) values indicate higher and lower transcript accumulation, respectively, in FgTri5+ (FgTri5+ vs water), FgTri5- (FgTri5- vs water), DON (DON vs water), and in FgTri5+ vs FgTri5-.  Predicted Gene Function  Plant Line  Treatment Comparison  hai  FD  p-value  TaAffx.31923.1.S1_at  Serine/threonine protein kinase [Oryza sativa (japonica cultivar-group)]  Superb  Tri5+ vs water  3  2.035  0.028  TaAffx.12878.1.A1_at  Wall-associated kinase 3 [Triticum aestivum]  Superb  Tri5+ vs water  8  2.077  0.006  Superb  Tri5+ vs water  8  2.656  0.005  Superb  Tri5- vs water  8  2.345  0.006  Probe Set ID Kinases  TaAffx.113624.2.S1_at TaAffx.113624.2.S1_at  Serine/threonine-protein kinase BRI1-like 3 precursor (Brassinosteroid insensitive1-like protein 3) Serine/threonine-protein kinase BRI1-like 3 precursor (Brassinosteroid insensitive 1-like protein 3)  Ta.18587.1.S1_x_at  Systemin receptor SR160 precursor (Brassinosteroid LRR receptor kinase) [Oryza sativa (japonica cultivargroup)]  Superb  Tri5- vs water  24  -2.296  0.000  Ta.3748.1.A1_at  Hexokinase1  Superb  Tri5- vs water  24  -2.201  0.015  Ta.3748.1.A1_at  Hexokinase1  Superb  DON vs water  24  -2.233  0.012  Ta.4972.1.A1_at  Aspartate kinase-homoserine dehydrogenase [Oryza sativa (japonica cultivar-group)] (contig annotation)  Superb  DON vs water  24  -2.096  0.046  Ta.10354.2.S1_x_at  Pyrophosphate--fructose 6-phosphate 1phosphotransferase alpha subunit (PFP) (6phosphofructokinase, pyrophosphate dependent)  Superb  DON vs water  24  -2.053  0.026  56  Probe Set ID  Predicted Gene Function  Plant Line  Treatment Comparison  hai  FD  p-value  TaAffx.110222.1.S1_x_at  Leucine-rich repeat-containing extracellular glycoprotein [Sorghum bicolor] / somatic embryogenesis receptor kinase SERK [Medicago truncatula]  Superb  DON vs water  24  2.217  0.004  Ta.20980.2.S1_at  Serine/threonine kinase receptor precursor (S-receptor kinase) (SRK)  Superb  Tri5+ vs Tri5-  24  2.202  0.012  TaAffx.64399.1.S1_at  Receptor-like kinase RHG1 [Glycine max]  DH1  Tri5+ vs water  3  -2.750  0.003  Ta.19909.1.A1_at  MAP kinase activating protein C22orf5  DH1  Tri5+ vs water  3  -2.482  0.026  TaAffx.84282.1.S1_at  CDPK-related protein kinase (PK421)  DH1  Tri5+ vs water  3  -2.401  0.000  Ta.1357.+2.A1_at  Protein kinase [Oryza sativa (japonica cultivar-group)]  DH1  Tri5+ vs water  8  2.002  0.031  DH1  Tri5+ vs water  8  2.027  0.010  DH1  Tri5+ vs water  8  2.073  0.048  DH1  Tri5+ vs water  8  2.188  0.022  Ta.18665.1.S1_at TaAffx.18131.1.S1_at Ta.5204.1.S1_at  Protein kinase G11A [Oryza sativa (japonica cultivargroup)] Putative phytosulfokine receptor precursor (Phytosulfokine LRR receptor kinase) ATP binding / kinase/ protein serine/threonine kinase [Arabidopsis thaliana]  Ta.3631.2.S1_at  3,4-dihydroxy-2-butanone kinase  DH1  Tri5+ vs water  8  2.203  0.035  TaAffx.37109.1.S1_at  Protein kinase [Arabidopsis thaliana]  DH1  Tri5+ vs water  8  2.382  0.003  Ta.5481.1.S1_at  Glucosidase II beta subunit precursor (Protein kinase C substrate, 60.1 kDa protein, heavy chain) (PKCSH) (80K-H protein) (Vacuolar system)  DH1  Tri5+ vs water  8  2.498  0.004  Ta.6683.1.A1_x_at  Mitogen-activated protein kinase kinase kinase 12 (Leucine-zipper protein kinase) (ZPK) (Dual leucine zipper bearing kinase) (DLK)  DH1  Tri5+ vs water  8  2.705  0.040  TaAffx.12878.1.A1_at  Wall-associated kinase 3 [Triticum aestivum]  DH1  Tri5+ vs water  24  -2.062  0.015  57  Probe Set ID  Predicted Gene Function  Plant Line  Treatment Comparison  hai  FD  p-value  Ta.6954.3.S1_x_at  Choline kinase [Oryza sativa (japonica cultivar-group)]  DH1  Tri5- vs water  3  -2.404  0.037  Ta.3322.3.S1_x_at  Ankyrin protein kinase-like [Poa pratensis]  DH1  Tri5- vs water  3  -2.190  0.023  TaAffx.38017.1.A1_at  Receptor-type protein kinase LRK1 [Oryza sativa (japonica cultivar-group)]  DH1  Tri5- vs water  3  -2.003  0.011  TaAffx.54339.1.S1_at  Mitogen-activated protein kinase homolog MMK2  DH1  Tri5- vs water  3  2.087  0.008  TaAffx.37109.1.S1_at  Receptor protein kinase [Arabidopsis thaliana]  DH1  Tri5- vs water  8  2.021  0.007  TaAffx.101059.2.S1_at  4-diphosphocytidyl-2-C-methyl-D-erythritol kinase, chloroplast precursor (CMK)  DH1  Tri5- vs water  8  2.238  0.010  TaAffx.52905.1.S1_x_at  Phosphoribulokinase  DH1  Tri5- vs water  8  2.251  0.002  TaAffx.12878.1.A1_at  Wall-associated kinase 3 [Triticum aestivum]  DH1  Tri5- vs water  8  2.398  0.000  TaAffx.56854.1.S1_at  Serine/threonine kinase receptor precursor-like protein [Oryza sativa (japonica cultivar-group)]  DH1  Tri5- vs water  24  2.029  0.005  Ta.3931.1.S1_at  30 kDa pollen allergen (GIX1) [Hordeum vulgare]  DH1  Tri5- vs water  24  2.082  0.020  DH1  Tri5- vs water  24  2.294  0.025  DH1  DON vs water  8  2.017  0.001  DH1  DON vs water  8  2.028  0.015  DH1  DON vs water  8  2.076  0.003  Ta.8249.3.S1_at Ta.29379.1.A1_at TaAffx.488+2.1.S1_at TaAffx.30003.1.S1_x_at  Similar to calmodulin-domain protein kinase [Oryza sativa (japonica cultivar-group)] Kinase interacting protein 1 -like [Oryza sativa (japonica cultivar-group)] Receptor-type protein kinase LRK1 [Oryza sativa (japonica cultivar-group)] Aegilops tauschii protein kinase 1 mRNA, complete cds  TaAffx.50893.1.S1_s_at  Serine/threonine protein kinase [Triticum aestivum]  DH1  DON vs water  8  2.269  0.008  Ta.5481.1.S1_at  Glucosidase II beta subunit precursor (Protein kinase C substrate, 60.1 kDa protein, heavy chain) (PKCSH) (80K-H protein) (Vacuolar system  DH1  DON vs water  8  2.429  0.027  58  Probe Set ID  Predicted Gene Function  Plant Line  Treatment Comparison  hai  FD  p-value  TaAffx.129414.2.S1_at  Receptor-like protein kinase precursor  DH1  DON vs water  24  -2.429  0.032  Ta.13013.2.S1_x_at  Pathogenesis-related protein 10b [Sorghum bicolor]  DH1  DON vs water  24  -2.416  0.004  Ta.22638.1.A1_at  YRK1  DH1  DON vs water  24  -2.326  0.030  DH1  DON vs water  24  -2.074  0.008  DH1  DON vs water  24  -2.035  0.010  DH1  DON vs water  24  -2.013  0.044  Ta.27812.1.A1_at TaAffx.10874.1.S1_at TaAffx.104820.1.S1_at  Receptor-protein kinase [Oryza sativa (japonica cultivar-group)] Receptor-protein kinase [Oryza sativa (japonica cultivar-group)] Receptor kinase [Oryza sativa (japonica cultivargroup)]  TaAffx.54339.1.S1_at  Mitogen-activated protein kinase homolog MMK2  DH1  Tri5+ vs Tri5-  3  -2.316  0.014  TaAffx.5699.1.S1_at  Receptor protein kinase CRINKLY4 precursor  DH1  Tri5+ vs Tri5-  3  2.005  0.030  DH1  Tri5+ vs Tri5-  8  -2.096  0.023  DH1  Tri5+ vs Tri5-  24  -2.136  0.021  DH1  Tri5+ vs Tri5-  24  -2.055  0.026  DH2  Tri5+ vs water  8  2.646  0.029  TaAffx.101059.2.S1_at TaAffx.59615.1.S1_at TaAffx.4882.1.S1_at Ta.4696.1.S1_at  4-diphosphocytidyl-2-C-methyl-D-erythritol kinase, chloroplast precursor (CMK) Receptor-like protein kinase [Oryza sativa (japonica cultivar-group)] Receptor-type protein kinase LRK1 [Oryza sativa (japonica cultivar-group)] Receptor protein kinase-like protein [Oryza sativa (japonica cultivar-group)]  Ta.1684.3.S1_at  Nucleoside diphosphate kinase III, chloroplast precursor (NDK III)  DH2  Tri5- vs water  3  -2.055  0.042  Ta.19909.1.A1_at  MAP kinase activating protein C22orf5  DH2  Tri5- vs water  8  2.098  0.009  TaAffx.114172.1.S1_s_at  Serine/threonine-specific protein kinase [Oryza sativa (japonica cultivar-group)]  DH2  Tri5- vs water  24  -2.238  0.010  TaAffx.5982.1.S1_at  MAPKK kinase [Hordeum vulgare subsp. vulgare]  DH2  DON vs water  3  -2.091  0.044  59  Probe Set ID  Ta.1684.3.S1_at Ta.16965.2.A1_at  Predicted Gene Function Nucleoside diphosphate kinase III, chloroplast precursor (NDK III) UNR-interacting protein (serine-threonine kinase receptor-associated protein)  Plant Line  Treatment Comparison  hai  FD  p-value  DH2  Tri5+ vs Tri5-  3  2.731  0.009  DH2  Tri5+ vs Tri5-  8  -2.068  0.044  Ribosomal Proteins TaAffx.108878.1.S1_x_at  60S ribosomal protein L5 [Neurospora crassa]  Superb  Tri5+ vs water  24  -2.086  0.019  TaAffx.6593.2.S1_at  Chloroplast 50S ribosomal protein L33  Superb  Tri5+ vs water  24  -2.070  0.010  TaAffx.35350.1.S1_at  Ribosomal protein S4 [Panax ginseng]  Superb  Tri5- vs water  3  2.246  0.001  TaAffx.128418.38.S1_at  18S ribosomal RNA [Glycine max]  Superb  DON vs water  3  -2.039  0.000  TaAffx.107003.1.S1_at  50S ribosomal protein L4, chloroplast (CL4) [Arabidopsis thaliana]  Superb  DON vs water  3  -2.018  0.016  TaAffx.128418.24.S1_at  28S ribosomal RNA [Triticum aestivum]  Superb  DON vs water  8  -2.637  0.030  Ta.12751.3.A1_at  Ribosomal protein L13a  Superb  Tri5+ vs Tri5-  8  2.274  0.012  Ta.10990.1.A1_at  40S ribosomal protein S19  DH1  Tri5+ vs water  8  2.022  0.019  TaAffx.107897.1.S1_at  Chloroplast 30S ribosomal protein S18  DH1  Tri5+ vs water  8  2.180  0.039  TaAffx.129824.5.S1_x_at  ribosomal protein S11 [Triticum aestivum]  DH1  Tri5+ vs water  8  2.393  0.041  TaAffx.113782.1.S1_at  60S ribosomal protein L11-1 (L16A)  DH1  Tri5+ vs water  24  -2.034  0.022  TaAffx.128418.24.S1_at  28S ribosomal RNA [Triticum aestivum]  DH1  Tri5- vs water  8  2.359  0.032  Ta.9507.2.S1_x_at  Ribosomal protein L6  DH1  DON vs water  8  2.678  0.026  Ta.9507.2.S1_at  Ribosomal protein L6  DH1  DON vs water  8  2.722  0.037  TaAffx.111195.1.S1_at  5S ribosomal RNA [Triticum aestivum]  DH1  DON vs water  8  3.004  0.012  60  Probe Set ID  Predicted Gene Function  Plant Line  Treatment Comparison  hai  FD  p-value  Ta.30687.2.S1_x_at  Ribosomal protein S29  DH2  Tri5+ vs water  3  -3.951  0.013  Ta.13787.1.S1_x_at  Plastid-specific 30S ribosomal protein 1, chloroplast precursor (CS-S5) (CS5) (S22) (ribosomal protein 1) (PSRP-1)  DH2  Tri5+ vs water  24  -2.313  0.032  TaAffx.111195.1.S1_at  5S ribosomal RNA [Triticum aestivum]  DH2  Tri5- vs water  3  -2.237  0.049  TaAffx.56089.1.S1_at  Ubiquitin/ribosomal fusion protein  DH2  Tri5- vs water  3  2.018  0.022  Ta.30687.2.S1_x_at  Ribosomal protein S29  DH2  Tri5- vs water  8  2.992  0.021  TaAffx.129824.5.S1_x_at  ribosomal protein S11 [Triticum aestivum]  DH2  Tri5- vs water  24  -3.485  0.049  TaAffx.129824.9.S1_x_at  30S ribosomal protein S11  DH2  Tri5- vs water  24  -3.466  0.045  Ta.30687.2.S1_x_at  Ribosomal protein S29  DH2  Tri5- vs water  24  -2.624  0.008  TaAffx.128896.21.S1_x_at  Chloroplast 30S ribosomal protein S8  DH2  Tri5- vs water  24  -2.372  0.020  TaAffx.129824.1.S1_s_at  Chloroplast 30S ribosomal protein S11  DH2  Tri5- vs water  24  -2.128  0.044  TaAffx.111195.1.S1_at  5S ribosomal RNA [Triticum aestivum]  DH2  DON vs water  3  -3.190  0.022  Ta.9507.+2.S1_x_at  Ribosomal protein L6  DH2  DON vs water  8  2.028  0.026  Ta.9507.2.S1_at  Ribosomal protein L6  DH2  DON vs water  8  2.083  0.027  Ta.30687.2.S1_x_at  Ribosomal protein S29  DH2  DON vs water  8  2.211  0.037  Ta.30687.2.S1_x_at  Ribosomal protein S29  DH2  DON vs water  24  -4.267  0.033  Ta.30687.2.S1_x_at  Ribosomal protein S29  DH2  Tri5+ vs Tri5-  3  -3.020  0.031  Ta.30687.2.S1_x_at  Ribosomal protein S29  DH2  Tri5+ vs Tri5-  24  2.411  0.011  61  Predicted Gene Function  Plant Line  Treatment Comparison  hai  FD  p-value  Ta.7022.1.S1_x_at  Phenylalanine ammonia-lyase  Superb  DON vs water  3  -2.258  0.016  Ta.9220.3.S1_at  Phenylalanine ammonia-lyase  DH1  DON vs water  8  2.012  0.013  Ta.3609.1.S1_a_at  4-coumarate-CoA ligase [Arabidopsis thaliana]  DH1  DON vs water  8  2.096  0.001  Ta.10418.2.S1_x_at  Chalcone synthase [Oryza sativa (japonica cultivargroup)]  DH1  DON vs water  8  2.242  0.033  TaAffx.84154.1.S1_at  Phenylalanine ammonia-lyase  DH1  DON vs water  8  2.272  0.020  Ta.9220.3.S1_x_at  Phenylalanine ammonia-lyase  DH1  Tri5+ vs water  8  2.129  0.003  Ta.8086.1.A1_at  Hydroxycinnamoyl transferase [Oryza sativa (japonica cultivar-group)]  DH1  Tri5- vs water  8  2.291  0.036  Ta.9220.3.S1_x_at  Phenylalanine ammonia-lyase  DH1  Tri5- vs water  8  2.660  0.003  Ta.9172.3.S1_at  Naringenin-chalcone synthase  DH1  Tri5- vs water  24  2.466  0.050  TaAffx.111664.1.S1_at  Cinnamyl alcohol dehydrogenase [Oryza sativa (japonica cultivar-group)]  DH2  Tri5- vs water  3  2.046  0.006  Ta.2256+2.1.S1_at  Glucan endo-1,3-beta-D-glucosidase  Superb  Tri5+ vs water  24  2.072  0.045  Ta.82.1.S1_at  Peroxidase  Superb  Tri5+ vs water  24  2.659  0.027  Ta.21120.1.S1_at  Glucan endo-1,3-beta-D-glucosidase  Superb  Tri5+ vs water  24  3.080  0.017  Ta.14461.3.S1_x_at  Nectarin 1 precursor (Superoxide dismutase [Mn])  Superb  DON vs water  8  -2.564  0.024  Ta.29496.2.S1_at  Peroxidase 12 precursor (Atperox P12) (PRXR6) (ATP4a)  Superb  DON vs water  8  -2.200  0.037  Probe Set ID Phenylpropanoid pathway  Pathogenesis-related (PR)  62  Probe Set ID  Predicted Gene Function  Plant Line  Treatment Comparison  hai  FD  p-value  TaAffx.32266.1.A1_at  Phospholipid hydroperoxide glutathione peroxidase (PHGPx) (Salt-associated protein)  Superb  DON vs water  24  -2.664  0.047  Ta.24715.1.S1_at  Peroxidase  Superb  DON vs water  24  2.019  0.037  Ta.8304.1.S1_x_at  Pathogenesis-related PR1a [Triticum monococcum]  Superb  DON vs water  24  2.084  0.010  TaAffx.116570.1.S1_at  Pathogenesis-related protein 4  Superb  DON vs water  24  2.207  0.050  Ta.28354.3.S1_x_at  Glutathione transferase  Superb  DON vs water  24  2.293  0.005  Ta.21307.1.S1_x_at  peroxidase [Oryza sativa (japonica cultivar-group)]  Superb  DON vs water  24  2.311  0.016  Ta.24501.1.S1_at  thaumatin-like protein  Superb  DON vs water  24  2.537  0.030  Ta.22562.1.S1_at  Glucan endo-1,3-beta-D-glucosidase  Superb  DON vs water  24  2.541  0.002  Ta.27762.1.S1_x_at  Thaumatin-like protein  Superb  DON vs water  24  2.764  0.029  Ta.21120.1.S1_at  Glucan endo-1,3-beta-D-glucosidase  Superb  DON vs water  24  3.205  0.001  Ta.82.1.S1_at  Peroxidase  Superb  DON vs water  24  4.072  0.007  Ta.14946.1.S1_at  ATHCHIB (basic chitinase) [Arabidopsis thaliana]  Superb  DON vs water  24  5.850  0.010  TaAffx.78864.1.S1_at  Glutathione S-transferase [Oryza sativa (japonica cultivar-group)]  Superb  Tri5+ vs Tri5-  8  -2.304  0.011  Ta.21386.1.S1_at  Nonspecific lipid-transfer protein 2 (LTP 2)  Superb  Tri5+ vs Tri5-  8  2.066  0.048  Ta.5235.1.S1_x_at  Peroxidase precursor  Superb  Tri5+ vs Tri5-  24  2.055  0.003  TaAffx.86266.1.S1_at  Beta-glucosidase homologue precursor  DH1  Tri5+ vs water  8  2.088  0.038  Ta.14580.1.S1_at  Peroxidase precursor  DH1  Tri5+ vs water  8  2.166  0.012  63  Probe Set ID  Predicted Gene Function  Plant Line  Treatment Comparison  hai  FD  p-value  Ta.30755.1.S1_at  Nonspecific lipid-transfer protein 2G (LTP2G) (Lipid transfer protein 2 isoform 1) (LTP2-1) (7 kDa lipid transfer protein 1)  DH1  Tri5+ vs water  8  2.420  0.044  Ta.14281.1.S1_at  Defensin  DH1  Tri5+ vs water  8  2.422  0.014  Ta.5481.1.S1_at  Glucosidase II beta subunit precursor (Protein kinase C substrate, 60.1 kDa protein, heavy chain) (PKCSH) (80K-H protein) (Vacuolar system)  DH1  Tri5+ vs water  8  2.498  0.004  Ta.13754.1.S1_s_at  Lipid transfer protein-related [Arabidopsis thaliana]  DH1  Tri5+ vs water  8  2.589  0.043  Ta.4601.2.S1_at  Beta-glucosidase  DH1  Tri5+ vs water  8  2.593  0.033  Type 2 non-specific lipid transfer protein precursor [Triticum aestivum] Type 2 non-specific lipid transfer protein [Triticum aestivum] Glucan endo-1,3-beta-D-glucosidase [Hordeum vulgare subsp. vulgare] (contig annotation)  DH1  Tri5+ vs water  24  -2.528  0.040  DH1  Tri5+ vs water  24  -2.463  0.042  DH1  Tri5- vs water  3  -2.312  0.034  Ta.23376.2.S1_s_at  Peroxidase 47 precursor (Atperox P47) (ATP32)  DH1  Tri5- vs water  3  -2.079  0.018  Ta.4328.1.S1_at  Pathogenesis-related protein 10b [Sorghum bicolor]  DH1  Tri5- vs water  8  2.299  0.015  Ta.4876.1.A1_x_at  Peroxidase  DH1  Tri5- vs water  8  2.342  0.045  Ta.761.1.S1_at  Glutathione S-transferase [Oryza sativa (japonica cultivar-group)] (contig annotation)  DH1  Tri5- vs water  8  2.358  0.038  Ta.26983.1.A1_at  Chitinase  DH1  Tri5- vs water  8  2.364  0.037  Ta.14281.1.S1_at  Defensin  DH1  DON vs water  8  2.059  0.047  TaAffx.32251.1.S1_at  Nonspecific lipid transfer protein 4.3 precursor (LTP 4.3)  DH1  DON vs water  8  2.064  0.022  Ta.8258.1.S1_x_at Ta.8258.2.S1_at Ta.11124.1.A1_at  64  Probe Set ID  Predicted Gene Function  Plant Line  Treatment Comparison  hai  FD  p-value  Ta.5481.1.S1_at  Glucosidase II beta subunit precursor (Protein kinase C substrate, 60.1 kDa protein, heavy chain) (PKCSH) (80K-H protein) (Vacuolar system)  DH1  DON vs water  8  2.429  0.027  Ta.26048.1.S1_x_at  Glucan endo-1,3-beta-D-glucosidase  DH1  DON vs water  24  -2.516  0.013  Ta.303.3.S1_x_at  Glutathione transferase  DH1  DON vs water  24  -2.482  0.043  Ta.28.1.S1_at  Glucan endo-1,3-beta-D-glucosidase  DH1  DON vs water  24  -2.463  0.012  Ta.13013.2.S1_x_at  Pathogenesis-related protein 10b [Sorghum bicolor]  DH1  DON vs water  24  -2.416  0.004  Ta.28354.3.S1_x_at  Glutathione transferase  DH1  DON vs water  24  -2.291  0.048  Ta.30739.1.A1_at  Pathogenesis-related 1a [Triticum monococcum]  DH1  Tri5+ vs Tri5-  8  -2.049  0.038  Ta.8828.3.S1_a_at  Peroxidase [Ananas comosus]  DH2  Tri5- vs water  3  2.427  0.038  TaAffx.113452.1.S1_at  Chitinase [Triticum aestivum]  DH2  Tri5- vs water  24  -2.198  0.025  TaAffx.113452.1.S1_at  Chitinase [Triticum aestivum]  DH2  Tri5- vs water  24  -2.198  0.025  Ta.4876.1.A1_x_at  Peroxidase  DH2  Tri5- vs water  24  -2.182  0.011  Ta.18560.1.S1_s_at  Class III peroxidase [Oryza sativa (japonica cultivargroup)]  DH2  DON vs water  8  2.051  0.011  TaAffx.108531.2.S1_at  Peroxidase  DH2  DON vs water  8  2.266  0.001  Ta.30944.1.S1_s_at  Glutathione transferase F2  DH2  DON vs water  8  2.699  0.035  DH2  DON vs water  24  -2.062  0.025  DH2  Tri5+ vs Tri5-  3  -2.139  0.042  DH2  Tri5+ vs Tri5-  8  -2.044  0.029  Ta.18647.1.S1_s_at Ta.14850.1.S1_at Ta.25024.1.S1_x_at  Nonspecific lipid-transfer protein AKCS9 precursor (LTP) Glutathione S-transferase [Oryza sativa (japonica cultivar-group)] Peroxidase [Arabidopsis thaliana]  65  Probe Set ID  Predicted Gene Function  Plant Line  Treatment Comparison  hai  FD  p-value  Ta.27389.1.S1_at  Gamma-purothionin - poulard wheat  DH2  Tri5+ vs Tri5-  24  2.093  0.003  Ta.30501.1.S1_at  Chitinase  DH2  Tri5+ vs Tri5-  24  2.420  0.031  Ta.5385.1.S1_at  Peroxidase  DH2  Tri5+ vs Tri5-  24  2.716  0.021  Ta.8304.1.S1_x_at  Pathogenesis-related PR1a [Triticum monococcum]  Superb  DON vs water  24  2.1  0.010  Ta.3322.3.S1_x_at  Ankyrin protein kinase-like [Poa pratensis]  DH1  Tri5- vs water  3  -2.2  0.023  Ta.526.1.S1_x_at  Lipoxygenase  Superb  DON vs water  3  -2.8  0.010  TaAffx.58772.1.S1_at  12-oxophytodienoate reductase 3 (12oxophytodienoate-10,11-reductase 3) (OPDAreductase 3) (LeOPR3)  Superb  Tri5- vs water  8  2.2  0.001  TaAffx.128684.1.S1_x_at  2-oxo-phytodienoic acid reductase [Zea mays]  DH1  DON vs water  24  -2.1  0.022  DH1  DON vs water  24  -2.4  0.015  DH1  DON vs water  24  -2.1  0.015  SA signalling  JA signalling  Ta.12757.1.A1_at Ta.1207.1.S1_at  Lipoxygenase-like protein (lox gene) [Hordeum vulgare subsp. vulgare] Oxo-phytodienoic acid reductase [Oryza sativa (japonica cultivar-group)]  Ta.30827.1.A1_x_at  32.6 kDa jasmonate-induced protein [H. vulgare]  DH1  Tri5- vs water  24  2.2  0.044  Ta.1967.1.S1_x_at  Lipoxygenase  DH2  Tri5- vs water  3  2.9  0.049  Ta.12757.1.A1_at  Lipoxygenase-like protein (lox gene) [H. Vulgare subsp. vulgare]  DH2  Tri5- vs water  24  -2.2  0.017  Ta.526.1.S1_x_at  Lipoxygenase (contig annotation)  DH2  Tri5+ vs Tri5-  3  -2.0  0.038  66  Probe Set ID  Predicted Gene Function  Plant Line  Treatment Comparison  hai  FD  p-value  Ta.1207.1.S1_at  Oxo-phytodienoic acid reductase [O. sativa (japonica cultivar-group)]  DH2  Tri5+ vs Tri5-  3  2.2  0.043  TaAffx.134501.1.A1_at  Lipoxygenase  DH2  Tri5+ vs Tri5-  24  2.2  0.048  DH2  Tri5+ vs water  3  2.2  0.032  DH2  Tri5+ vs water  3  3.2  0.004  Ta.1207.1.S1_x_at Ta.1207.1.S1_at  Oxo-phytodienoic acid reductase [O. sativa (japonica cultivar-group)] Oxo-phytodienoic acid reductase [O. sativa (japonica cultivar-group)]  ET signalling Ta.4470.1.S1_at  Ethylene-binding protein-like / AP2 domain-containing transcription factor-like [O. sativa (japonica cultivargroup)]  Superb  Tri5- vs water  3  2.3  0.049  Ta.6397.1.A1_at  Adenosylmethionine decarboxylase  Superb  DON vs water  24  -2.2  0.002  Superb  DON vs water  8  -2.1  0.025  DH1  Tri5+ vs water  8  2.0  0.019  DH2  Tri5- vs water  3  2.1  0.047  TaAffx.93223.1.A1_at TaAffx.128576.1.S1_at TaAffx.57475.1.S1_x_at  1-aminocyclopropane-1-carboxylate oxidase (ACC oxidase) (Ethylene-forming enzyme) (EFE) ethylene-forming enzyme [O. sativa (japonica cultivargroup)] Methionine adenosyltransferase  67  Table 2.5 Challenge-induced differential protein accumulation. Positive and negative FD values indicate higher and lower protein accumulation, respectively, observed in spots from 2D-electrophoresis in the pH 4-7 (A) and 7-10 (B) ranges. Accessions and protein descriptions were determined by MASCOT searches. Protein predictions with scores above 100 and a minimum of two queries matched are considered acceptable. The organism indicates which species to which the protein prediction was based upon. FD  pvalue  Spot No.  Accession/ Gene ID  Protein Description  Pathway  Score  photosynthesis  375  Kalvin cycle  162  -  Queries  Coverage  Organism  15  Hordeum vulgare  6  10  Bruguiera gymnorhiza  389  10  48  -  -  202  8  20  Oryza sativa  -  389  10  48  -  glycolysis  367  10  17  Triticum aestivum  DH1 vs ‘Superb’ Water ribulose 1,5-bisphosphate carboxylase activase isoform 1 dihydrolipoamide dehydrogenase precursor glycine-rich RNA-binding protein nucleoside diphosphate kinase; Os05g0595400  -2.39  0.024  141A  gi|167096  -2.37  0.012  163B  gi|13873336  -2.32  0.035  17A  gi|114145394  2.01  0.004  16B  BAF18429  -2.55  0.045  17A  gi|114145394  -2.39  0.005  260A  P12782  -2.30  0.017  174A  -  -  -  -  -  -  -  -2.05  0.014  586A  -  -  -  -  -  -  -  2.08  0.048  387A  BT039007.1  unknown  73  3  6  Zea mays  2.15  0.005  296A  -  -  -  -  -  -  Tri5+ glycine-rich RNA-binding protein Phosphoglycerate kinase, chloroplastic  -  68  FD  pvalue  Spot No.  Accession/ Gene ID  Protein Description  Pathway  Score  Queries  Coverage  Organism  0.046  21B  -  -  -  -  -  -  -  chlorophyl synthesis  184  4  11  Hordeum vulgare  501  19  -  -  186  6  20  Triticum aestivum  143  8  9  Zea mays  121  5  5  Glycine max  Tri5+ 2.31  0.012  380A  P18492  Glutamate-1-semialdehyde 2,1-aminomutase (GSA), chloroplastic  -3.71  0.004  75A  AB059557.2  myo-inositol-1-phosphate synthase  -2.81  0.000  369A  gi|4239821  germin-like protein 1  2.01  0.021  85B  gi|195622500  serine hydroxymethyltransferase  2.01  0.000  8A  gi|310561  ascorbate peroxidase  2.10  0.041  299A  gi|56606827  calreticulin-like protein  signal transduction  57  2  4  Triticum aestivum  2.24  0.044  86B  2.34  0.023  29CO  gi|83267753  FT-like protein  flowering  125  6  -  Hordeum vulgare  2.93  0.050  357A  -  -  -  -  -  -  -  2.97  0.002  387A  BT039007.1  unknown  -  73  3  6  Zea mays  3.99  0.008  198A  -  -  -  -  -  -  -  2.04  0.023  134B  gi|205830697  -  112  3  100  Pseudotsuga menziesii  2.08  0.014  110B  gi|75138360  shikimic acid pathway  79  1  2  Oryza sativa  2.99 Tri5-  oxidative stress amino acid synthesis oxidative stress  DON RecName: Full=Unknown protein 18 Phospho-2-dehydro-3deoxyheptonate aldolase 2, chloroplastic; AltName: Full=Phospho-2-keto-3-  69  FD  pvalue  Spot No.  Accession/ Gene ID  Protein Description  Pathway  Score  Queries  Coverage  Organism  +2.12  0.042  208B  -  -  -  -  -  -  -  +2.13  0.010  158B  gi|91694277  glycolysis  404  11  13  Triticum aestivum  +2.36  0.014  120B  gi|115450835  amino acid synthesis  227  5  9  Oryza sativa  +2.64  0.015  69B  gi|118748148  UCW116, putative lipase  lipid metabolism  90  4  7  Hordeum vulgare  glucose-6-phosphate isomerase phosphoserine aminotransferase, chloroplast 03g0157900  DH2 vs ‘Superb’ Water -2.06  0.047  183B  -  -  -  -  -  -  -  -2.05  0.016  538A  -  -  -  -  -  -  -  +2.11  0.036  75B  -  -  -  -  -  -  -  +2.38  0.005  53B  gi|223974435  unknown  -  82  2  6  Zea mays  +2.40  0.019  71B  gi|115488340  -  320  10  19  Oryza sativa  +2.75  0.027  447A  gi|14017579  ATP synthesis  535  12  26  Triticum aestivum  0.017  280B  -  -  -  -  -  -  -  -3.63  0.019  165B  X61626.1  catalase  oxidative stress  49  1  1  Oryza sativa  -2.63  0.016  434A  gi|115461739  legumin-like protein, putative, expressed; Os05g0116000  storage protein  199  7  11  Oryza sativa  RNA binding protein, putative, expressed; Os12g0420200 ATP synthase CF1 beta subunit  Water +2.84 Tri5+  70  FD  pvalue  Spot No.  Accession/ Gene ID  Protein Description  Pathway  Score  Queries  Coverage  Organism  -2.29  0.004  321A  gi|66276267  ATP synthase beta subunit  ATP synthesis  106  2  2  Coriaria ruscifolia  +2.14  0.012  116B  gi|115488340  RNA binding protein, putative, expressed; Os12g0420200  -  338  15  18  Oryza sativa  +2.23  0.007  93B  -  -  -  -  -  -  -  ATP synthesis  535  12  26  Triticum aestivum  +2.27  0.034  447A  gi|14017579  ATP synthase CF1 beta subunit  +2.41  0.026  53B  gi|223974435  unknown  -  82  2  6  Zea mays  +3.08  0.004  71B  gi|115488340  RNA binding protein, putative, expressed; Os12g0420200  -  320  10  19  Oryza sativa  +3.11  0.004  565A  -  -  -  -  -  -  -  -2.73  0.021  25A  AP003510.3  protein folding  108  3  9  Oryza sativa  -2.33  0.008  444A  AY236152.1  Kalvin cycle  247  7  18  Triticum aestivum  -2.20  0.014  591A  -  -  -  -  -  -  -  -2.19  0.001  369A  gi|4239821  germin-like protein 1  oxidative stress  186  6  20  Triticum aestivum  +2.04  0.018  134B  gi|205830697  Unknown  -  112  3  100  Pseudotsuga menziesii  +2.35  0.026  5A  gi|81176509  atp1  ATP synthesis  151  3  6  Triticum aestivum  +2.62  0.040  378A  gi|115450493  glyceraldehyde 3-phosphate dehydrogenase; Os03g0129300  glycolysis  331  8  15  Oryza sativa  +2.87  0.012  357A  -  -  -  -  -  -  -  +2.87  0.019  528A  -  -  -  -  -  -  -  Tri5putative chaperonin 21 precursor cytosolic malate dehydrogenase  Tri5-  71  FD  pvalue  Spot No.  Accession/ Gene ID  Protein Description  Pathway  Score  Queries  Coverage  Organism  +3.66  0.025  52A  -  -  -  -  -  -  -  +4.28  0.006  198A  -  -  -  -  --  -  -  -3.72  0.032  130A  gi|242089295  hypothetical protein SORBIDRAFT_09g001680  -  85  2  5  Sorghum bicolor  +2.28  0.024  86A  -  -  -  -  -  -  -  +2.43  0.032  110B  gi|75138360  shikimic acid pathway  79  1  2  Oryza sativa  +2.53  0.007  116B  gi|115488340  -  338  15  18  Oryza sativa  +2.66  0.043  347A  -  -  -  -  -  -  -  +2.74  0.015  5A  gi|81176509  atp1  ATP synthesis  151  3  6  Triticum aestivum  +4.40  0.043  4B  -  -  -  -  -  -  -  glycolysis  248  8  15  Oryza sativa  ATP synthesis  105  5  4%  Oryza sativa  -  90  5  20  Triticum aestivum  -  320  10  19  Oryza sativa  DON  Phospho-2-dehydro-3deoxyheptonate aldolase 2, chloroplastic RNA binding protein, putative, expressed; Os12g0420200  DH2 vs DH1 water gi|115450493  glyceraldehyde 3-phosphate dehydrogenase; Os03g0129300 ATP synthase subunit alpha, mitochondrial single-stranded nucleic acid binding protein RNA binding protein, putative, expressed; Os12g0420200  -3.27  0.013  226A  -2.77  0.034  458A  NM_0010591 87.1  -2.45  0.034  170A  gi|974605  +2.53  0.015  71B  gi|115488340  +2.63  0.045  280B  -  -  -  -  -  -  -  +3.36  0.004  163B  gi|13873336  dihydrolipoamide dehydrogenase precursor  Kalvin cycle  162  6  10  Bruguiera gymnorhiza  72  pvalue  Spot No.  Accession/ Gene ID  Protein Description  Pathway  Score  Queries  Coverage  Organism  -4.67  0.000  225A  -  -  -  -  -  -  -  -3.27  0.044  22B  -  -  -  -  -  -  -  -3.08  0.009  209A  EQ973790.1  Kalvin cycle  133  3  -  Ricinus communis  -2.84  0.026  380A  P18492  -  184  4  11  Hordeum vulgare  -2.21  0.005  123A  -  -  -  -  -  -  -  -2.19  0.037  39A  gi|20302473  ferredoxin-NADP(H) oxidoreductase  photosynthesis  178  4  12  Triticum aestivum  -2.03  0.009  204B  -  -  -  -  -  -  -  97  4  12  Triticum aestivum  FD Tri5+  pyruvate dehydrogenase, putative Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic  Tri5+  +2.03  0.007  30B  gi|37788312  cyclophilin-like protein  Signal transduction  +2.28  0.003  71B  gi|115488340  RNA binding protein, putative, expressed; Os12g0420200  -  320  10  19  Oryza sativa  +2.31  0.026  134B  gi|205830697  Unknown  -  112  3  100  Pseudotsuga menziesii  +6.21  0.031  401A  -  -  -  -  -  -  -  -3.34  0.017  299A  gi|56606827  calreticulin-like protein  signal transduction  57  2  4  Triticum aestivum  -3.17  0.025  86B  -  -  -  -  -  -  -  -3.16  0.003  177B  -  -  -  -  -  -  -  -2.39  0.001  434A  gi|115461739  legumin-like protein, putative, expressed; Os05g0116000  storage protein  199  7  11  Oryza sativa  Tri5-  73  FD  pvalue  Spot No.  Accession/ Gene ID  Protein Description  Pathway  Score  Queries  Coverage  Organism  -2.26  0.029  39A  gi|20302473  ferredoxin-NADP(H) oxidoreductase  photosynthesis  178  4  12  Triticum aestivum  +2.42  0.011  4B  -  -  -  -  -  -  -  +2.56  0.005  75A  AB059557.2  myo-inositol-1-phosphate synthase  501  19  25  Avena sativa  0.007  174A  -  -  -  -  -  -  -  gi|226316441  fructose-bisphosphate aldolase  glycolysis  307  11  23  Triticum aestivum  DON -3.28 -2.86  0.016  205B  -2.39  0.041  319A  -  -  -  -  -  -  -  -2.16  0.032  85B  gi|195622500  serine hydroxymethyltransferase  amino acid synthesis  143  8  9  Zea mays  74  Table 2.6 qPCR validation of 2FD in microarray. Positive and negative FD values indicate up- and down-regulation in the given treatment comparison. microarray Probe Set ID  Gene Description  qPCR  Plant line  comparison  hai  FD  p-val  FD  std error  TaAffx.106139.1.S1_at unknown  Superb  FgTri5- vs water  24  -2.1  0.004  -2.4  ±0.16  Ta.526.1.S1_x_at  DH2  FgTri5+ vs FgTri5- 3  -2.0  0.038  -3.1  ±0.92  DH1  FgTri5+ vs FgTri5- 8  +2.1  0.003  +2.2  ±0.27  Ta.1207.1.S1_at  Oxo-phytodienoic acid reductase [O. DH2 sativa (japonica cultivar-group)]  FgTri5+ vs FgTri5- 3  +2.2  0.043  +4.2  ±0.06  Ta.16723.2.S1_x_at  unknown protein [O. sativa (japonica DH1 cultivar-group)] gi|48716457|  DON vs water  8  +2.2  0.020  +2.4  ±1.54  Ta.24501.1.S1_at  Thaumatin-like protein  Superb  DON vs water  24  +2.5  0.030  +2.2  ±0.68  Ta.1967.1.S1_x_at  Lipoxygenase  DH2  FgTri5- vs water  3  +2.9  0.049  +2.3  ±0.78  DH1  DON vs water  8  +3.0  0.012  +2.0  ±0.49  DH2  FgTri5+ vs water  3  +3.2  0.004  +3.3  ±0.98  Lipoxygenase  TaAffx.108735.1.S1_at unknown  TaAffx.111195.1.S1_at 5S ribosomal RNA [T.aestivum] Ta.1207.1.S1_at  Oxo-phytodienoic acid reductase [O.sativa (japonica cultivar-group)]  75  2.3.1 Real-time RT- PCR validation of microarray results Eight genes from nine comparisons were randomly selected from the > 2.0 FD microarray data set for confirmation by quantitative RT-PCR (qPCR). While the absolute expression FD values obtained by qPCR differed from those observed in the microarray system, all nine comparisons showed the same expression trend in the qPCR and microarray data sets, and displayed FD values >2.0 in both systems (Table 2.6).  2.3.2 Constitutive differences in gene expression Expression levels of 44 and 14 transcripts were constitutively different in spikelets of ‘Superb’ vs. DH1 (Type I resistant) and ‘Superb’ vs DH2 (Type II resistant), respectively (Table 2.2). The most dramatic constitutive difference observed was that of a wheat aquaporin PIP1 (identified by three unique probe sets), which was highly over-expressed (143 to 259 FD) in DH1 compared with ‘Superb’. Other transcripts with potential connections to plant defence that were over-expressed in DH1, compared with ‘Superb’, include a gene with similarity to a dehydration-responsive protein from rice (RD22; 74 FD) and a wheat LTP (TaLTP3; 39 FD).  2.3.3 Challenge-induced differences in global gene expression Differences > 2.0 FD in transcript accumulation were observed in all treatment comparisons and at all harvest times (Figure 2.2), with an average of 36 differentially regulated transcripts for any combination of genotype and treatment. The largest number of expression differences between treatments was observed in Type I resistant DH1 compared with treatment-induced differences observed in Type II resistant DH2 and susceptible cv. 76  ‘Superb’. Additionally, by 24 hai no up-regulation of transcripts was observed in DH2 in response to the three elicitors being evaluated (FgTri5+, FgTri5-, or DON). DON treatment led mainly to down-regulation of transcripts in all three wheat lines at 3 hai. In ‘Superb’, strong DON-induced down-regulation of gene expression was also observed at 8 hai, and by 24 hai, two-thirds of the differentially regulated genes were down-regulated. In the resistant genotypes, DON-induced down-regulation was also observed at 24 hai. However, at 8 hai, a total of 122 genes were up-regulated and none were down-regulated in DH1, while 40 genes were up-regulated and only 6 were down-regulated in DH2.  2.3.4 Challenge-induced differential gene expression related to defence response pathways The genes displaying differential expression following challenge were associated with several distinct pathways. Some of these genes are known to be involved directly in the plant defence response or potentially involved in regulating defence responses (Table 2.4). Differential expression of protein kinases was observed in all three wheat lines. In DH1, a total of 38 differences in kinase gene expression were observed across the various treatment conditions, and these differences occurred in response to all treatment comparisons (less so in the FgTri5+ vs. FgTri5- comparison). In contrast, only 8 and 11 kinase gene expression differences were observed across the various conditions in DH2 and ‘Superb’, respectively.  77  Figure 2.2 Number of treatment-dependent differentially regulated transcripts. For each VEN diagram, the top left circle indicates the number of up (+) or down (-) regulated genes in DH1 for a given treatment comparison at a given harvest time; similarly, for the top right circle representing DH2 and for the bottom one representing ‘Superb’. The overlapping regions between circles indicate the number of differentially regulated transcripts in common between plant lines.  78  Differential expression of genes encoding ribosomal components was also observed. At 8 hai in DH1, all three elicitors (FgTri5+, FgTri5-, and DON) induced up-regulation of ribosomal gene expression. In DH2, DON (8 hai) and FgTri5- (3 and 8 hai) also induced up-regulation of similar genes. Down-regulation of these genes was observed in susceptible ‘Superb’ in response both to DON (3 and 8 hai) and FgTri5+ (24 hai). Challenge-induced differences in expression of pathogenesis-related (PR) genes, primarily up-regulation, was observed in all three wheat genotypes, but occurred mainly in DH1 and ‘Superb’, and typically occurred earlier in the resistant genotypes (Table 2.4). Differential expression of phenylpropanoid pathway genes was primarily limited to DH1, where up-regulation of two genes encoding L-phenylalanine ammonia-lyase (PAL) was observed at 8 hai: one of these genes (probeset Ta.845145.1.S1_at) occurred in response to DON, and the other (probeset Ta.9220.S1_at) was induced by DON, FgTri5+ and FgTri5- (Table 2.4). In susceptible ‘Superb’, DON induced down-regulation of a different PAL (probeset Ta.7022.1.S1_x_at) at 3 hai. PAL is the entry point to phenylpropanoid metabolism and is involved in the formation of a variety phenolic metabolites, including lignins, flavonoids, and SA (Dixon et al., 2002). In DH1, upregulation of genes involved in both lignin and flavonoid biosynthesis was observed in response to both FgTri5- and DON. Up-regulation of genes whose products have often been associated with SA signalling in Arabidopis, but not necessarily in wheat (Huckelhoven et al., 1999; Molina et al., 1999; Lu et al., 2006), were an ankyrin kinase-like protein that was down-regulated in DH1 (FgTri5- at 3 hai) and the SA-regulated PR-1, which was up-regulated in ‘Superb’ 24 hai after point inoculation with DON.  79  Jasmonic acid synthesis involves a well-characterized multi-step pathway that converts linolenic acid to the final hormone. Among the corresponding genes, up-regulation of oxophytodienoic acid reductase was observed in DH2 in response to FgTri5+ (3 hai) when compared to either FgTri5- or the water controls. Two genes encoding lipoxygenases, a class of enzymes thought to initiate JA biosynthesis, were also upregulated in response to the FgTri5+ treatment when compared with water (3 hai) or FgTri5- (24 hai) (Table 2.3). Up-regulation of JA biosynthesis or responsive genes was also observed in the ‘Superb’ and DH1 genotypes, but only in response to FgTri5- treatment. Point-inoculation with DON, on the other hand, induced down-regulation of JA signalling genes in both DH1 (24 hai) and ‘Superb’ (3 hai), but not in DH2 (Table 2.4).  2.3.5 2D-electrophoresis: optimization and resolution 2D-gels in the pH 4-7 range have successfully resolved wheat spikelet proteins in previous studies (Zhou et al., 2005; Zhou et al., 2006), but to my knowledge, the only reports on resolution of wheat proteins in the basic range were on pH 3-10 gels (Wang et al., 2005). In the current study, several techniques were tested for their ability to generate higher resolution of proteins in the basic range. First, the extracted proteins were reduced and protected prior to IEF. Three reduction/protection techniques were evaluated, using different reducing and protecting agents including (1) TBP and IAA; (2) TBP and 4-VP; and (3) TCEP and 4-VP. The reduction/protection step was followed by cup-loading onto the IPG strips, as recommended for basic range proteins (Biorad). Poor protein spot resolution was observed in the 2D-gels when using the TBP/IAA reagents. Overall 2D- gel resolution was improved in the other two approaches, which used 4-VP as a protecting 80  agent, but no resolved proteins were observed in the range of pH 8-9 (Figure 2.3A and B). In the next attempt to improve resolution, samples were reduced and protected using TCEP and 4-VP, and then pre-fractionated into proteins with isoelectric points in the ranges of pH 3-7 and pH 7-10 using a ZOOM® IEF Fractionator (Invitrogen). These pre-fractionated samples were then used to rehydrate IPG strips, in the pH 4-7 and 7-10 range, respectively, followed by IEF. The use of 4-VP as a protecting agent in combination with prefractionation according to pH resulted in improved resolution in the pH 7-10 gels (Figure 2.3D), although the resolution from pH 9-10 was inconsistent, and thus no analysis was performed in this range. This approach also provided good resolution in pH 4-7 range (Figure 2.3C). A total of 660 and 312 unique spots were resolved on pH 4-7 and 7-10 gels, respectively. For both sets of comparisons (genotype differences and challenge-induced differences), spots with more than a 2FD (p < 0.05) were sequenced. A total of 130 comparisons met these criteria (40 for the treatment comparisons, and 90 for the wheat genotype comparisons). Among the 130 differences, there were a total of 74 unique spots: 44 and 30 from the pH 4-7 and 7-10 ranges, respectively. Of the 74 unique spots, 45 had successful matches in the MASCOT searches with scores > 100.  2.3.6 Genotype differences in protein accumulation Constitutive differences in protein accumulation were not investigated in the spikelets of uninoculated spikes, as was done in the differential gene expression analysis, but genotype differences in protein accumulation were compared in spikelets of inoculated spikes (Table  81  2.3). Most of the genotype differences in the spikelets of water-challenged spikes were of metabolic proteins.  A.  B.  C.  D.  Figure 2.3 2D-electrophoresis optimization. A. Reduction-protection trials with TBP/4VP or B. TCEP/4-VP followed by cup loading onto pH 7-10 Biorad IPG strips (17 cm) and second dimension separation by SDS-PAGE. C. Reduction-protection with TCEP/4-VP, followed by pre-fractionation with ZOOM IEF fractionators into pH 3-7 and 7-10 fractions, which were then separated by IEF (passive rehydration) on pH 4-7 and D. 7-10 Biorad IPG strips (17 cm), respectively, and second dimension separation by SDS-PAGE. 82  The most interesting differences among the genotypes in response to challenge occurred in response to DON-challenge. This led to higher accumulation of a range of different proteins in the resistant genotypes, compared with ‘Superb’; only one protein (with unknown function) showed lower accumulation in the Type II resistant genotype, DH2. Among the four protein spots whose accumulation differed between the two resistant genotypes after DON-challenge, all showed lower expression in DH2. Most of the genotype differences in DON-challenged heads involved proteins predicted to be engaged in primary metabolism.  2.3.7 Challenge-induced differential protein accumulation Differential protein accumulation was observed within each of the three wheat genotypes challenged with the various elicitors as defined in Figure 2.1. As was observed in the gene expression differences of elicited wheat heads, most of the observed treatmentinduced changes in protein accumulation within a given genotype were of proteins involved in primary metabolism (Table 2.5). Again, some differences in defence-related proteins were also observed, some examples include down-regulation in the susceptible cv. ‘Superb’ of an oxidative stress-related protein, ascorbate peroxidase (spot 9A), in response to FgTri5-, and also in FgTri5+ compared with FgTri5-. Another oxidative stress-related protein, catalase (spot 167B), was up-regulated in Type I resistant DH1 in response to FgTri5- . In the Type II resistant genotype, DH2, FgTri5- treatments resulted in upregulation of four out of five differentially accumulated protein spots, one of which was identified as a metabolism-related protein (spot 74A). In contrast, challenge with DON in  83  DH2 led to down-regulation of six out of eight protein spots, mainly of proteins involved in metabolism.  2.4 Discussion  2.4.1 Constitutive differences in gene expression Among the observed genotype-dependent differences was the constitutively higher expression of a Type I lipid transfer protein (LTP), TaLTP3 (Jang et al., 2003; Jang et al., 2005), in DH1 compared with ‘Superb’. LTPs are small extracellular plant proteins with the capacity to transfer phospholipids between membranes in vitro (Kader et al., 1984; Yeats and Rose, 2008). Despite their conserved localization at the plant cell wall and their in vitro activity, the cellular/physiological function(s) of this multigene family remain elusive. Changes in LTP expression have been observed in response to both biotic stresses, including pests and fungal pathogens of wheat (Jang et al., 2003; Lu et al., 2005), and abiotic stress, such as cold-tolerance or wound-response (Gaudet et al., 2003; YuberoSerrano et al., 2003; Wu et al., 2004a), Some LTPs have been demonstrated to possess antimicrobial activity (Castro and Fontes, 2005; Gonorazky et al., 2005; Sun et al., 2008) or to be involved in cell signalling (Buhot et al., 2001; Blein et al., 2002). To our knowledge, TaLTP3 has not been functionally characterized, but it is possible that it could be contributing to resistance to F. graminearum penetration either via direct antifungal activity or through a role in cuticle strengthening in DH1. The higher steady-state expression TaLTP3 in DH1 was accompanied by a higher steady-state expression of an aquaporin, TaPIP1. Aquaporins are involved in transport of 84  water and uncharged solutes across the plasma membrane (Tornroth-Horsefield et al., 2006), and some LTPs have been reported to take part in cuticular wax deposition at the plant cell wall (Cameron et al., 2006; Kim et al., 2008; Samuels et al., 2008; DeBono et al., 2009; Kunst and Samuels, 2009). It is therefore intriguing that over-expression of a barley aquaporin PIP in transgenic rice was earlier reported to lead to increased cuticle thickness (Hanba et al., 2004). The cuticle layer can be an effective first line of defence against plant diseases (Martin, 1964), and the primary mode of invasion by FHB-causing species is by direct penetration of the host epidermis within the floral structure, most likely by cutinaseor lipase-mediated cuticular degradation (Kang and Buchenauer, 2000b; Voigt et al., 2005; Cuomo et al., 2007). The simultaneously elevated expression of TaLTP3 and TaPIP1 could potentially be contributed to cuticular strengthening as a defence against F. graminearum penetration in DH1. Further functional characterization of both TaLTP3 and TaPIP1 will be needed to define the nature of their relationship, if any, to Type I resistance.  2.4.2 Challenge-induced differences in gene expression and protein accumulation patterns The largest number of expression differences occurred in Type I resistant DH1, in response to all three elicitors (FgTri5+, FgTri5-, or DON). The high degree of differential gene expression observed in this genotype included numerous protein kinases (PKs), which are often involved in early signalling events in response to various stimuli. Thus, the systemic (neighbouring but uninoculated) tissues in DH1 appear to be the most strongly affected by FHB elicitors compared with the other two lines. In contrast to the impressive response observed in DH1, the Type II resistant DH2 showed fewer differences in global 85  gene expression, and by 24 hai, none of the three elicitors induced up-regulation of transcripts in this genotype. These data suggest that by 24 hai, DH2 has either already completed the changes involved in setting in motion a resistance response, or that the plant is reallocating resources for a defence response at the site of infection. Interestingly, while the DON treatment led mainly to down-regulation of transcripts in all wheat lines at the 3 and 24 hai time points, in ‘Superb’, a strong down-regulation pattern in response to DON was also observed at 8 hai. In contrast to this, a total of 122 genes were up-regulated at 8 hai in DH1 in response to DON, and none were down-regulated, while in DH2, 40 genes were up-regulated, and only 6 were down-regulated. Since several proteins accumulated to higher levels in either resistant line compared with ‘Superb’ following challenge with DON (see section 2.4.2), this result could potentially be related to the stronger pattern of DON-induced down-regulation of a gene expression in ‘Superb’. The pattern of DON-induced down-regulated molecular events suggests that trichothecenes may delay the plant’s defence response pathway in susceptible genotypes, but is less effective in doing so in resistant lines. These results demonstrate that when wheat spikelets respond to challenge with either F. graminearum or DON, the challenge is perceived in distal tissues and induces systemic changes in gene expression. The resulting gene expression patterns may be important in determining whether or not effective resistance develops in the challenged plant. Despite the 75% shared parentage between the three wheat genotypes being tested, very few of the transcriptional changes induced in systemic tissues were common among these lines, suggesting that the gene expression differences may be arising directly from the genome  86  fraction derived from the original resistant parents in the pedigrees, or from the interactions between that fraction and the shared genomic complement.  2.4.3 Deoxynivalenol-induced up-regulation of genes encoding ribosomal proteins in Fusarium Head Blight-resistant wheat The trichothecenes produced during infection by F. graminearum are known to induce ribotoxic stress and programmed cell death in eukaryotic cells (Shifrin and Anderson, 1999) as a result of their direct inhibition of ribosomal peptidyl transferase activity (McLaughlin et al., 1977). Interestingly, in the current study, direct application of DON induced up-regulation of a range of genes encoding ribosomal components in both resistant wheat lines, but not in the susceptible genotype. In both DH1 and DH2, this up-regulation was observed at 8 hai. Ribosomal genes were also up-regulated in DH1 (8 hai) in response to both FgTri5+ and FgTri5- inoculation, even though the FgTri5- fungal strain does not produce trichothecenes. Fungal challenge is expected to invoke a more complex set of responses than challenge with a defined aggressiveness factor, and thus, in DH2, FgTri5induced up-regulation of ribosomal genes at 3 and 8 hai, but many ribosomal genes were down-regulated again by 24 hai. In the susceptible ‘Superb’ genotype, down-regulation of ribosomal genes was observed in response to both DON and FgTri5+. Thus, when challenged with either DON or DON-producing fungi, the resistant wheat genotypes displayed increased expression of genes encoding components of the ribosomal machinery, whereas expression of these genes declined in susceptible wheat. It may be relevant that both of the resistant wheat lines evaluated here were originally recovered from an in vitro selection screen using a trichothecene toxin (Eudes et al., 2008). The resistant lines have, 87  therefore, already demonstrated both resistance to FHB and tolerance for the trichothecene virulence factor, which may result from induced over-production of ribosomes or DONsensitive ribosome components. Furthermore, the up-regulation of ribosomal component synthesis may also provide yet another explanation for the observed increase in protein spot intensity in the resistant genotypes compared with the susceptible (see section 2.4.2). Despite the fact that ribosomes are known targets of DON-toxicity, this is the first report, to my knowledge, on differential expression of ribosomal proteins in the plant response to trichothecenes or trichothecene-producing fungi. On the other hand, this is not the first report of microbial elicited changes in ribosomal gene expression (Dai et al., 2004; Gabriëls et al., 2006; Hall et al., 2007), and it has been proposed that modification of ribosomal composition can have a direct impact on regulating the translation of specific gene products (Mauro and Edelman, 2002). Thus, in addition to the potential alleviation of trichothecene-induced ribotoxicity, trichothecene-induced changes in ribosomal gene expression may represent a plausible mechanism for regulating translation of specific defence responses.  2.4.4 Early expression of pathogenesis-related proteins in resistant wheat Toxic stress in plants during pathogenic invasion arises not only from the direct impact of toxins produced by the pathogen, but also from the plant’s production of reactive oxygen species (ROS) as part of its suite of defence response. In order to protect itself against ROS-induced cellular damage, plants also produce antioxidants, including the PR proteins glutathione-S-transferase (GSTs) and peroxidases (POXs). The elicitor-induced upregulation of PR gene expression observed in DH2 consisted mainly of antioxidant gene 88  expression responses (Table 2.4). In response to challenge with DON, antioxidant genes were up-regulated at 8 hai in Type II resistant DH2, but later in ‘Superb’ (24 hai). In response to challenge with the fungus, POX up-regulation was observed earliest in DH2 at 3 hai (FgTri5-), then later (8 hai) in DH1 (FgTri5+ and FgTri5-), and finally only by 24 hai in ‘Superb’ (FgTri5+). In the proteomics analysis, no differential accumulation of PR proteins was observed, but some additional antioxidant-related proteins were observed. For instance, accumulation of a putative catalase (spot 167B) increased in DH1 when challenged with FgTri5-, and in ‘Superb’ a reduction in accumulation of a putative ascorbate peroxidase (spot 9A) was observed in response to FgTri5- (compared to water), and in FgTri5+ vs FgTri5-. Most of the differential PR protein expression, which consisted mainly of genes expressing antifungal proteins, was observed primarily in susceptible ‘Superb’ and Type I resistant DH1, occurring earlier in the resistant genotype. At 8 hai, challenge with the fungus (either FgTri5+ or FgTri5-) induced up-regulation of several antifungal genes in DH1, while fungus-induced up-regulation of PR genes in ‘Superb’ was delayed (24 hai), and involved fewer genes. DON itself also induced up-regulation of antifungal genes, but this was observed mainly in ‘Superb’ (24 hai). Thus, up-regulation of PR genes in DH1 not only occurred earlier than in the resistant genotypes, but was more pronounced in response to the fungus than to DON. In ‘Superb’, on the other hand, up-regulation occurred later and primarily in response to DON. Since DON is presumably a single effector, whereas challenge with a live fungus brings many potential effectors into play, this response difference is not surprising.  89  Early expression of PR genes was observed in both resistant genotypes compared with ‘Superb’, consistent with the model that an earlier plant defence response will often distinguish a susceptible from a resistant response, where the earlier response is observed in the resistant varieties. This has been previously reported for FHB, where early expression of PR proteins was observed in Fusarium-infected tissues of resistant cereal crops, when compared to the susceptible lines (Geddes et al., 2008). PR gene expression in the systemic tissues of resistant and susceptible wheat has also previously been observed in response to FHB (Pritsch et al., 2001). Thus, the observations presented here corroborate previous reports that early PR protein expression may contribute to FHB resistance. Accumulation of these gene products in the systemic tissue could presumably prevent secondary infection or reduce disease spread into these tissues.  2.4.5 Up-regulation of phenylpropanoid metabolism in Type I resistant DH1 With the exception of a single gene in DH2, up-regulation of genes encoding enzymes of the phenylpropanoid pathway was observed only in DH1. Phenylpropanoid compounds are secondary metabolites with diverse roles in the plant defence response. The first step in this pathway is the conversion of phenylalanine to cinnamate via the activity of PAL (Dixon et al., 2002). In susceptible ‘Superb’, DON induced down-regulation of a PAL gene at 3 hai. Up-regulation of a different PAL transcript was observed in DH1 at 8 hai in response to all three elicitors, and an additional isoform was also up-regulated in response to DON. It is not known how the different isoforms are functionally distinct. Perhaps the expression of the second PAL observed in response to DON occurs in different tissues within the spikelet of DH1. Alternatively, the dual expression in DH1 may be indicative of 90  DON-induced up-regulation of two different pathways since the product of PAL activity, namely cinnamate, is the precursor for multiple metabolic pathways, including flavonoid and lignin biosynthesis (Dixon et al., 2002). Up-regulation of genes from both of these branches of the phenylpropanoid pathway was observed in DH1 at 8 hai. Cell wall lignification or thickening of the lemma and of the rachis node has been implicated in FHB-resistance (Kang and Buchenauer, 2000a; Jansen et al., 2005). POX activity and hydrogen peroxide metabolism are involved in the process of cell wall lignification (Schopfer, 1996). In DH1, up-regulation of POX, which was limited to the fungal treatments (FgTri5+ and FgTri5-), was detected at the same time (8 hai) as the observed up-regulation of the lignin biosynthesis pathway in this genotype. Aquaporins, in addition to their ability to transport water across cellular membranes (del Martínez-Ballesta et al., 2006), can move small molecules, including H2O2, which is the substrate for POX (Bienert et al., 2006). The higher constitutive expression of aquaporin TaPIP1 in DH1 may facilitate accumulation of H2O2 at the cell wall for lignification. If this lignification were to occur in the glumes or lemma of uninfected spikelets, prevention of Fusarium penetration through the spike surface may be observed, thus increasing Type I resistance. On the other hand, cell wall lignification at the rachis node of an already infected spikelet would improve Type II resistance. It has already been demonstrated that the rachis node is a significant barrier for disease spread in FHB, and since it is a barrier that trichothecenes play a significant role in overcoming (Kang and Buchenauer, 2000a; Jansen et al., 2005; Voigt et al., 2005; Maier et al., 2006; Ilgen et al., 2009), it is perhaps surprising that upregulation of the phenylpropanoid pathway was so limited in DH2 tissues. On the other hand, since the analysis was performed on the systemic, uninoculated tissues, rather than 91  on the directly inoculated tissues, the up-regulation of lignin biosynthesis genes in this Type II resistant genotype may be occurring in a much more restricted location, at or near the site of infection.  2.4.6 Jasmonic acid signalling and Type II resistance No significant differential expression patterns were observed for those genes believed to be involved in SA and ET signalling, but up-regulation of JA biosynthesis and signalling genes was observed in treatment/genotype combinations where a resistance to disease spread was anticipated: i.e. in response to FgTri5+ challenge in DH2 (‘Sumai 3’-derived resistance with the 3BS QTL), and in response to FgTri5- challenge in ‘Superb’ and DH1 (where point-inoculation with the trichothecene non-producing strain phenocopies classical Type II FHB-resistance). Interestingly, treatment with pure DON, an important aggressiveness factor in FHB disease spread within the host, resulted in down-regulation of JA signalling genes in both ‘Superb’ and DH1, suggesting that the JA defense response pathway may be interdicted by DON-producing fungi in a susceptible interaction. It is well established that trichothecene production is an important factor for overcoming the host barrier at the rachis node (Jansen et al., 2005; Voigt et al., 2005; Ilgen et al., 2009), and that trichothecenes are required for disease spread (Proctor et al., 1995a; Eudes et al., 2001; Bai et al., 2002; Langevin et al., 2004; Maier et al., 2006). JA signalling can be a positive regulator of genes involved in lignin biosynthesis (Xue et al., 2008) and signalling through this pathway could potentially help modify cell wall lignification at the rachis node of an infected spikelet.  92  2.5 Conclusions  Both Type I and Type II resistance to FHB are multigenic and, because of their complex nature, it has been difficult to define the genetic basis in either case. Little new information was provided from the current differential proteomics study, which probably reflects the relative lack of sensitivity of classical 2D gel approaches in differential protein accumulations studies. In order to more deeply examine the proteome for changes in less abundant protein regulators, such as transcription factors and signal transduction components, more sensitive proteomics techniques, in combination with a more fully annotated wheat proteome database, will be necessary. On the other hand, gene expression analysis was sufficiently comprehensive to provide useful insights into the different mechanisms of resistance, even with an incomplete genome database as a reference. One of the earliest points at which resistance to pathogens can occur in plant tissues is by blocking initial pathogen invasion. In the case of FHB, this is thought to be the main mechanism underlying Type I resistance. Consistent with this model of slowing or preventing initial fungal penetration, constitutive gene expression differences observed between the Type I resistant DH1 and its susceptible parent cultivar, ‘Superb’, include higher expression of several genes that may participate in producing a form of constitutive defence against invading pathogens through accumulation of antifungal proteins or providing additional physical protection against the invading fungus by enhancing cuticle thickness and/or cell wall lignification. Several induced defence responses were observed in both of the resistant genotypes that were not observed in the susceptible genotype, including a more rapid elicitor-induced regulation of gene 93  expression. Compared with ‘Superb’, up-regulation of PR genes occurred earlier in DH1 and DH2, although more prominently in the former. While DON treatments induced downregulation of global gene expression in all three wheat genotypes, some transcript upregulation was observed at 8 hai, a response that was delayed in ‘Superb’ relative to the resistant genotypes. A number of DON-induced up-regulated genes were observed only in the resistant genotypes, including those encoding ribosomal components, which is the main target of DON toxicity. Despite these commonalities in the regulation of gene expression between the Type I and Type II resistant lines, in many cases more transcripts were upregulated in DH1. In fact, by 24 hai, DH2 showed no transcript up-regulation in the systemic tissues of wheat heads challenged with any of the three elicitors evaluated. Since disease containment is the mechanism of resistance to FHB spread, it would be logical for Type II resistance to be dictated primarily by host responses at the site of infection rather than a systemic response. It is proposed here that Type I resistance in DH1 involves a combination of i) structural features that slow fungal penetration and ii) activation of a systemic response in uninfected tissues adjacent to the site of infection to prevent or minimize secondary infection. Type II resistance, on the other hand is more likely a form of local resistance that may be regulated by JA signalling.  94  3. The Role of Plant Hormone Signalling in Mediating Fusarium Head Blight Resistance in Wheat  3.1 Introduction  The regulation of plant disease resistance responses by hormone signalling metabolites is a common process in many pathogen-host systems (Thomma et al., 1998; Ton et al., 2002; Park et al., 2007). For example, SA-signalling is necessary for a resistance response to Pseudomonas syringae in Arabidopsis (Cameron et al., 1999). In this case, the accumulation of SA leads to the activation of a hypersensitive response in which a localized burst of programmed cell death ultimately prevents this biotrophic pathogen from feeding on living plant material (Summermatter et al., 1995). A similar response to necrotrophs would not be as effective, since host cell death would be advantageous to these pathogens. JA and JA/ET signalling pathways are more commonly observed in a resistant response to nectrophic pathogens (Glazebrook, 2005). It is not clear which signalling pathways are involved in FHB resistance in cereals, in part because the available evidence points in disparate directions, as described in Chapter 2 (Yu and Muehlbauer, 2001; Makandar et al., 2006; Zhou et al., 2006; Bernardo et al., 2007; Geddes et al., 2008; Li and Yen, 2008; Chen et al., 2009; Thatcher et al., 2009; Makandar et al., 2010). These conflicting observations may be related to the observation that F. graminearum is believed to be a hemibiotroph that requires live tissues in the early stages of infection, but subsequently switches to a necrotrophic phase. This switch to necrotrophy presumably occurs around the time that the fungus commences trichothecene production. Activation of 95  the Tri5 gene promoter in F. graminearum, which regulates expression of the first enzyme in the trichothecene biosynthesis pathway (Scheme 1-1), has been observed when the invading mycelium reaches the rachis node of wheat spikes (Ilgen et al., 2009). Furthermore, immunocytological studies have demonstrated that DON accumulates ahead of the growing hyphae during F. culmorum invasion of wheat spikes, and that this accumulation is coincident with host cell death (Kang and Buchenauer, 1999). Thus, when Fusarium species reach the barrier between the infected spikelet and the rachis; namely, the rachis node, trichothecene production commences, leading to cell death. This not only provides nutrients for the growing fungus, but facilitates invasion of the rachis and subsequent disease spread. It is thus conceivable that the specific signalling pathways that mediate an FHB-resistance response would be dependent on the timing of this expression with respect to the phase of disease progression. Several techniques are available to study the roles of the hormone signalling molecules in FHB-resistance mechanisms, including (1) analysis of the differential expression of genes associated with these pathways in response to FHB-elicitors; (2) biochemical analysis of hormone accumulation in resistant and susceptible wheat genotypes in response to FHB-elicitors; and (3) modifying the signalling pathway by genetic approaches or chemical treatment, and observing the impact on FHB disease outcomes. The first of these approaches was pursued in Chapter 2. In the second approach (biochemical analysis), plant material can be harvested following treatment with pathogen elicitors and the endogenous concentrations of the metabolites of interest can be determined. Several methods are available for the quantitation of plant hormones; the most sensitive techniques utilize HPLC- or GC-MS (Engelberth et al., 2003; Pan et al., 2010). 96  In the third approach described for studying the role of hormone signalling pathways, modification of these pathways can be conducted by ‘priming’ plants through exogenous chemical treatments aimed at affecting the pathway of interest, an approach that has been shown to activate systemic defense responses and improve resistance to various pathogens (Conrath et al., 2006; Jung et al., 2009). Common priming agents (Figure 3.1) include: benzothiadiazole (BTH), a synthetic SA analogue that has been shown to entice a similar response in plant cells as those observed for SA application (Friedrich et al., 1996); methyl jasmonate (MeJA), a JA derivative that is produced by plants as part of the JA signalling pathways (Yamane et al., 1980; Creelman and Mullet, 1997); ethephon, a chemical precursor of ethylene (Maynard and Swan, 1963); silver ions, which inhibit ET perception by competitive inhibition of the copper binding site in the ET receptors (Beyer, 1976), but have also been shown to increase auxin efflux in plant cells (Strader et al., 2009). Priming with pathogens, or with elicitors derived from them, has also been shown to improve resistance, provided that the priming response successfully activates the appropriate set of pathways for an effective defense against the pathogen in question (Conrath et al., 2006; Jung et al., 2009). Modification of hormone signalling can also be conducted by manipulation of the genes involved in the biosynthesis of these molecules or of genes encoding key proteins in their downstream response. Both of these approaches, priming or genetic manipulation, are effective in altering the plant’s phenotype and if the targeted pathways are involved in mediating a resistant or susceptible outcome to specific plant diseases, changes in disease response can be observed. In Arabidopsis, loss-of-function mutants provide a popular resource for studying the role of a given gene in different processes, such as plant defense 97  (Delaney et al., 1995; Yu et al., 1998; Greenberg et al., 2000). In wheat, however, where gene redundancy and an unsequenced genome complicate matters, an alternative approach to silencing genes is needed. Fortunately, targeted silencing of specific genes or groups of genes by RNA interference (RNAi) can be used in this species (Hannon, 2002). Overexpression of the gene of interest in wild-type plants can also provide additional insights into its biological function. However, such targeted modifications of hormone signalling pathways requires knowledge of the identity of the genes involved in their biosynthesis and downstream responses.  A.  C. S O N  B. OH P Cl  OH  O  O  O  Figure 3.1 Structure of chemical priming agents. A. benzothiadiazole (BTH), B. ethephon, and C. methyl jasmonate (MeJA).  98  SA biosynthesis can occur via the phenylpropanoid or shikimic acid pathways (Figure 3.2a). In the phenylpropanoid pathway, phenylalanine is first converted to trans-cinnamic acid by phenylalanine ammonia lyase (PAL). After beta-oxidation of the cinnamic acid to shorten its side-chain the resulting benzoic acid derivative is hydroxylated to yield SA (Lee et al., 1995). SA biosynthesis can also take place via the shikimic acid pathway, where chorismate is first converted to isochorismate by isochorismate synthase (ICS), and isochorismate it then converted to salicylate. This pathway was first identified in bacteria (Marshall and Ratledge, 1971, 1972; Serino et al., 1995), but it was more recently determined that ICS is also involved in SA biosynthesis in plants (Nugroho et al., 2001; Wildermuth et al., 2001), and represents the main pathway for SA biosynthesis in some species, including Arabidopsis (Abreu and Munné-Bosch, 2009). It is not known which pathway is dominant in wheat, although a wheat EST for ICS (accession EV254155) has been identified. Enhanced Disease Susceptibility 5 (EDS5), a multidrug and toxin extrusion protein localized at the plastid membrane in Arabidopsis, is believed to be involved in SA transport into the cytosol (Ishihara et al., 2008). Studies conducted with allelic mutants of the Eds5 gene (eds5 and salicylic acid induction-deficient 1, sid1) have demonstrated that EDS5 is necessary for induction of SA-mediated defense (Nawrath and Metraux, 1999; Nawrath et al., 2002). SA accumulation in the cytosol has been proposed to lead to reduction of the intermolecular disulfide bonds that keep NPR1 in an oligomeric state, releasing NPR1 monomers that can then enter the nucleus and interact with transcription factors and up-regulate PR1 gene expression (Zhang et al., 1999; Mou et al., 2003).  99  Figure 3.2A  100  Figure 3.2B  101  Figure 3.2C  102  Figure 3.2 Phytohoromone biosynthesis and signalling pathways (pages 100-102). A. Salicylic acid (SA) biosynthesis can occur via the phenylpropanoid or shikimic acid pathway. In the former, SA biosynthesis involves phenylalanine ammonia-lyase (PAL) and benzoic acid 2-hydroxylase (BA2H) activities. The latter pathway involves isochorismate synthase (ICS) activity, and Enhanced Disease Susceptibility 5 (EDS5) is believed to mediate transport of SA from the chloroplast into the cytosol. SA accumulation in the cytosol leads to de-oligomerization of Non-expressor of Pathogenesis-Related 1 (NPR1), and monomeric NPR1 enters the nucleus and interacts with the TGA transcription factor (TF), resulting in up-regulation of Pathogenesis-Related Protein 1 (PR1). Transgenic expression of salicylate hydroxylase (NahG) can lead to the degradation of SA into catechol. B. Jasmonic acid (JA) biosynthesis is initiated in the chloroplast by activities of lipoxygenase (LOX), allene oxide synthase (AOS) and allene oxide cyclase (AOC). The 12-oxophytodienoic acid product is then reduced in peroxisomes via the activity of 12oxophytodienoic acid reductase (OPR), followed by three β-oxidation reactions. JA accumulation results in activation on COI1, which then forms an ubiquitination complex, and targets proteosomal degradation of inhibitors of TFs involved in the up-regulation of JA-inducible proteins (JIP). C. The ethylene (ET) biosynthesis pathway involves the activities of S-adenosylmethionine (SAM) synthase, to 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS), and ACC oxidase (ACO). In the absence of ET, the ET receptors (ETRs) constitutively activates Constitutive Triple Response 1 (CTR1), which in turn constitutively inhibits Ethylene Insensitive 2 (EIN2). Once ET binds the ETR, CTR1 is deactivated. EIN2 activity is de-repressed and interacts with TFs such as Ethylene Response Factors (ERFs), leading to up-regulation of ET-inducible proteins (EIP). 103  Many of the genes involved in SA signalling have been well characterized in Arabidopsis by studying mutants compromised in their SA signalling pathways (Cao et al., 1997; Li et al., 1999; Klessig et al., 2000; Loake and Grant, 2007). Evidence from gene expression studies and priming with BTH has suggested that downstream SA signalling in wheat differs substantially from that in Arabidopsis (Huckelhoven et al., 1999; Molina et al., 1999; Yu and Muehlbauer, 2001; Lu et al., 2006), although the overall pathway remains poorly characterized in monocots. Therefore, targeting genes involved in SA signalling for silencing of this pathway would be difficult in wheat. Furthermore, the precursors to SA accumulation are also precursors for other metabolic pathways. Thus, the most effective way of attenuating the SA response would be to express salicylate hydroxylase, an enzyme which catalyzes the hydroxylation and decarboxylation of salicylic acid to produce catechol. Salicylate hydroxylase was first purified in 1962 (Katagiri et al.) and the corresponding gene was cloned 20 years later from Pseudomonas putida (Yen and Gunsalus, 1982). While salicylate hydroxylase activity has been identified in some plant species (Ellis and Towers, 1969), transgenic expression of the bacterial gene ( NAHG), in plants has been shown to result in SA degradation, and this depletion compromises SAmediated defense responses (Gaffney et al., 1993; Vernooij et al., 1994). However, overexpression of functional NAHG in some plant species may not have an impact on steadystate SA levels within the tissues of the transgenic plants, as was demonstrated in poplar, where endogenous free SA and catechol levels were unaffected in NAHG over-expressing transgenic lines, but the levels of glucosylated SA decreased while levels of glucosylated catechol increased (Morse et al., 2007).  104  Key points from the JA signalling pathways are summarized in Figure 3.2b. In addition to defense signalling, such as the plant response to wounding (Howe, 2004) and biotic/abiotic stress responses (Creelman and Mullet, 1995), JA is involved in several physiological processes including root growth inhibition, floral development, and senescence (reviewed in Wasternack, 2007). JA biosynthesis is initiated at the plastid membrane where phospholipases release linolenic acid from membrane phospholipids (Ishiguro et al., 2001; Pohnert, 2002). Lipoxygenase (LOX) (Vick and Zimmerman, 1983; Bell et al., 1995; Feussner et al., 1995) and allene oxide synthase (AOS) (Vick and Zimmerman, 1981; Laudert and Weiler, 1998) sequentially catalyze the next two reactions to produce allene oxide, a highly unstable molecule which can spontaneously cleave into αand γ-ketols (Hamberg, 1987; Vick and Zimmerman, 1987). Cyclization of allene oxide at C-9,13, catalyzed by allene oxide cyclase (AOC), yields 12-oxo-phytodienoic acid (Hamberg, 1988), which undergoes a reduction of the 10,11-double bond by oxophytodienoic acid reductase (OPR) in the peroxisome (Schaller and Weiler, 1997; Schaller et al., 2000), followed by three β-oxidation steps to produce jasmonic acid. Several enzymes have been implicated in catalyzing the β-oxidation steps, including acyl-CoA oxidase (ACX1) (Li et al., 2005; Schilmiller et al., 2007), multifunctional protein (MFP) (reviewed in Wasternack, 2007), and L-3-ketoacyl-CoA thiolase (KAT) (reviewed in Wasternack, 2007). JA-regulated gene expression in plant defense and other pathways is mediated by coronatine insensitive 1 (COI1), an F-box protein involved in targeted protein ubiquitination for proteosome-mediated degradation (Xie et al., 1998; Devoto et al., 2002). This protein degradation is believed to de-repress JA responsive genes (Beckers and Spoel, 2006). Examples of stress-induced JA-responsive genes include systemin (Li et al., 2002) 105  and the PR-protein, defensin (Manners et al., 1998). JA is also a positive regulator of genes in the lignin (Xue et al., 2008) and ET biosynthesis pathways (Saniewski and Czapski, 1985; Creelman and Mullet, 1995). The ET signalling pathway is summarized in Figure 3.2c. Methionine, the biosynthetic precursor of ET (Lieberman and Mapson, 1964), is converted to S-adenosyl methionine (SAM) via the activity of SAM synthase (Adams and Yang, 1977; Wang et al., 2002). SAM, which is also a precursor in other metabolic pathways, including polyamine biosynthesis (Lu, 2000), is converted to 1-aminocyclopropane-1-carboxylic acid (ACC) (Adams and Yang, 1979) in the first committed step of ET biosynthesis (reviewed in Wang et al., 2002). This step is catalyzed by ACC synthase (ACS) in a reaction that also yields 5’-methylthioadenosine, which can be re-converted to methionine (Adams and Yang, 1977; Yu et al., 1979; Wang et al., 1982). The final step in ethylene biosynthesis is catalyzed by ACC oxidase (ACO; formerly known as ‘ethylene-forming enzyme’) (Kuai and Dilley, 1992). ET accumulation is perceived by ET-receptors at the PM membrane. Five ET receptors have been identified in Arabidopsis from two subfamilies, namely ET receptor 1 (ETR1) and ET response sensor 1 (ERS1) from subfamily I, and ETR2, ERS2, and ET insensitive 4 (EIN4) from subfamily II (Hua et al., 1998). Similarly, five receptors have also been identified in rice: ERS1and ERS2 from subfamily I, and ETR2-like (ERL1), ETR4 and ETR5 from subfamily II (reviewed in Wuriyanghan et al., 2009). A single ET receptor has been identified to date from wheat: the ETR1 homologue W-er1 (Ma and Wang, 2003). ET receptors are negative regulators of the ET signalling pathway, and unless bound by ET and copper as a co-factor, they constitutively activate the mitogenactivated protein kinase kinase kinase, constitutive triple response 1 (CTR1), which is also 106  a negative regulator of the ET response pathway (Kieber et al., 1993; Hua and Meyerowitz, 1998; Rodriguez et al., 1999). Once CTR1 is no longer activated, EIN2, a positive regulator of the ET response pathway, is activated, leading to up-regulation of EIN3 and ET response factor (ETRF) TFs (Alonso et al., 1999; Guo and Ecker, 2003). Similarly to JA, ET signalling is involved in the regulation of both physiological processes and plant defense. ET is well known for its role in senescence and fruit ripening (Gane, 1934; Grbić and Bleecker, 1995; Klee and Clark, 2010), and in some pathogen interactions this activity can result in increased disease susceptibility (reviewed in van Loon et al., 2006). In general, the role of ET in plant defense occurs in conjunction with JA signalling. Up-regulation of certain PR proteins requires concomitant JA and ET signalling (Xu et al., 1994), although antagonistic interactions have also been observed between these two molecules (Tuominen et al., 2004). Cross-talk also occurs between JA and SA signalling; in this case, an antagonistic interaction is more commonly observed (Glazebrook, 2005; Leon-Reyes et al., 2010a). This antagonistic interaction is mediated by the cytosolic monomer of NPR1, which is believed to interfere with COI1 activity (Spoel et al., 2003; Beckers and Spoel, 2006). Interestingly, all three hormone signalling systems may interact, since ET has recently been shown to block SA-mediated suppression of JA signalling (Leon-Reyes et al., 2009; Leon-Reyes et al., 2010b). Cross-talk between these three hormone signalling molecules may, in part, explain the contrasting results described in the literature describing the mechanism of FHB resistance. Makandar et al. (2010) recently proposed that the timing of SA/JA signalling may be crucial in differentiating an FHB-resistant outcome from a susceptible one. Silencing the SA signalling pathway in Arabidopsis (sid2, npr1, wrky18 mutant lines and a NAHG 107  overexpression line) resulted in increased susceptibility to F. graminearum; whereas, JA silencing (opr3, coil and jar1 mutant lines) led to increased resistance. Interestingly, the double mutant, jar1-npr1, was more susceptible than the npr1 mutant, suggesting that JA signalling is somehow involved in FHB-resistance in Arabidopsis. Furthermore, priming of Arabidopsis host tissues by exogenous application of MeJA led to improved resistance, but only when the priming occurred 12 h after F. graminearum infection. These data suggest that late JA signalling is involved in regulating resistance outcomes in Arabidopsis and since JA signalling is associated with resistance to necrotrophic pathogens (Glazebrook, 2005), this may be coincident with a switch in the pathogen’s life cycle from biotrophy to necrotrophy. Since the switch to necrotrophy in F. graminearum likely occurs when the pathogen is beginning to spread into the rachis, it may be relevant that JA-signalling has been implicated in Type II resistance in wheat (Thesis Chapter 2; Li and Yen, 2008). Furthermore, JA signalling is a positive regulator of lignin biosynthesis (Xue et al., 2008), and cell wall lignification at the rachis node appears to be important in preventing F. graminearum spread (Kang and Buchenauer, 2000b; Jansen et al., 2005). ET signalling has been implicated in susceptibility to F. graminearum in both wheat and Arabidopsis (Chen et al., 2009). Using RNAi to target the EIN2 transcripts, Travella et al. (2006) successfully silenced the ET signalling pathway in the FHB-susceptible wheat cv. ‘Bobwhite’. These lines were subsequently evaluated for changes in their response to FHB, and a notable decrease in susceptibility was observed (Chen et al., 2009). Furthermore, exogenous applications of ethephon or silver thiosulphate demonstrated that ET signalling enhances FHB-susceptibility in wheat and barley, an outcome that may be related to ETmediated host senescence (Chen et al., 2009). Since these studies were conducted in FHB108  susceptible cultivars, and since cross-talk and timing of expression may have an impact on disease outcomes, as was observed in the case of JA-signalling in Arabidopsis (Makandar et al., 2010), there is still much to be learned about the roles of these signalling molecules in mediating FHB-resistance and -susceptibility. In the differential transcriptomics study presented in Chapter 2, elicitor-induced systemic changes in wheat spikes were evaluated, where isolated components of FHB pathosystem were used to induce these changes. The effect of elicitors (FgTri5+, FgTri5-, and DON) was evaluated in three wheat genotypes (DH1, DH2, and ‘Superb’). Based on the differential gene expression pattern observed in the systemic, or uninoculated, tissue of the Type I and Type II resistant genotypes, it was proposed that Type I resistance in DH1 can be systemically induced, while Type II resistance in DH2 is a local response that cannot be systemically induced. In order to test the hypothesis presented in Chapter 2, a priming experiment was conducted on the same three wheat lines using the same three elicitors. To further explore the putative roles of hormone signalling in FHB-resistance of wheat, this study was complemented by hormone profiling of primed spikes. Additionally, the impact of suppressing specific hormone signalling pathways in wheat lines with ‘Superb’, DH1, and DH2 backgrounds was assessed in terms of the resistance/susceptibility of these lines to FHB. Silencing was performed by crossing the three experimental lines with cultivars that have been genetically compromised in SA, JA or ET signalling.  109  3.2 Materials and Methods  3.2.1 Plant material The three wheat genotypes defined in Chapter 1, namely ‘Superb’, DH1, and DH2, were used for the priming experiment in the current chapter. For the hormone silencing experiment, a total of 18 wheat crosses were used (Table 3.1), where each of three female parents (‘Superb’, DH1, and DH2) were crossed with each of six male parents (‘Bobwhite’, ‘Bobwhite’-∆EIN2, ‘Blizzard’, ‘Blizzard’-NAHG, Fielder’, and Fielder’-∆AOS). All of the non-transgenic male parents are FHB-susceptible cultivars. NAHG, AOS, and EIN2 gene sequences and construct design for transgenics are presented in Supplementary Figures 1, 2, and 3, respectively. Both ‘Bobwhite’- ∆EIN2 (Travella et al., 2006) and ‘Fielder’-∆AOS are RNAi lines (Eudes et al., unpublished), the former was kindly donated by B. Keller (Institute of Plant Biology, University of Zurich), and the latter was designed by N. Foroud and produced by Eudes et al. (unpublished) using cell penetrating peptides to introduce the silencing construct into microspore-derived embryos. The ‘Blizzard’-NAHG line was produced by biolistic transformation of the NAHG sequence from P. putida (Eudes et al., unpublished), and the transgenic lines were screened by Gaudet et al. (unpublished). Both ‘Blizzard’-NAHG and Fielder’-∆AOS lines are double haploids, the latter generated using the corn pollination technique (as described by Kisana et al., 1993), and the former produced by colchicine treatments, although often double haploidy is achieved spontaneously in microspore-derived embryogenesis. Transgenic crosses were screened for pathway silencing as described below. All plants were grown as described in Chapter 2 (section 2.2.1). 110  Table 3.1 Transgenic crosses for hormone silencing. Columns are arranged according to female parents, and rows according to male parents. Parent  ‘Superb’  DH1  DH2  ‘Blizzard’  S-SA  1-SA  2-SA  ‘Blizzard’-NahG  S-SAi  1-SAi  2-SAi  ‘Bobwhite’  S-ET  1-ET  2-ET  ‘Bobwhite’-∆ein2  S-ETi  1-ETi  2-ETi  ‘Fielder’  S-JA  1-JA  2-JA  ‘Fielder’-∆aos  S-JAi  1-JAi  2-JAi  3.2.2 Screening for hormone silencing The transgenic crosses were screened at three weeks after seeding for silencing of the EIN2 or AOS genes, or for overexpression of NAHG. Total RNA was extracted from the described tissues (Qiagen RNeasy® Plant Mini Kit with an on-column DNase digestion). cDNA synthesis and quantitative real-time PCR (qPCR) was performed as described in 2.2.5. Primer sequences are presented in Supplementary Figures 1-4. Fold-differences (FD) and standard errors were calculated from CT-values using Qiagen’s REST 2006 software package, where CT-values were normalized against the housekeeping gene, elongation factor (EF1α; Figure A4). Furthermore, crosses with ‘Blizzard’-NAHG and Fielder’-∆AOS, were screened for reduced accumulation of SA and JA, respectively, at six weeks after seeding. A total of 500 mg of leaf tissue was collected from three crosses for each of the transgenic and parent crosses, at each seeding date (thus, a total of 216 samples were collected) and hormone extraction and quantification was performed as described in section 3.2.6. 111  An additional screening was performed for the ‘Blizzard’-NAHG lines, where three week old seedlings of ‘Blizzard’ or ‘Blizzard’-NAHG were sprayed with SA as described below, and the leaves collected at 12 and 24 h after spraying for SA quantification. A total of three experimental repetitions were performed, where 60 seedlings divided into three 5” x 5” pots consisted of a single repetition. A 300 ppm SA solution was sprayed in 5 and 10 passes using a spray cabinet (Model 822-1547; Research Instrument Manufacturing Co. Ltd., Guelph, Ont.) set at 45 psi (1 psi = 6.895 kPa), 3.1 km h-1, spray width of 57 cm, and nozzle output of 370 mL min-1 set at 35 cm above the canopy.  3.2.3 Inoculations The same four inocula described in Chapter 2 (water, FgTri5+, FgTri5-, and DON) were prepared as described in section 2.2.2. For all FHB-disease experiments, three experimental repetitions were performed, where each repetition represented a different seeding date. For each repetition, a minimum of three biological replicates were used, where one plant for a given condition and plant line represents one biological replicates, and multiple spikes were treated within each biological replicate. For point inoculations (or priming), 10 µL of inoculum (water, FgTri5+, FgTri5- or DON) was injected into a single spikelet during anthesis, between 0700 and 1000 in the morning. For spray inoculations, an FgTri5+ spore suspension was sprayed in four passes with a spray cabinet as described in section 3.2.2. Spray inoculated plants were returned to the mist-irrigated greenhouse. Following point or spray inoculations, plants were incubated in a mist-irrigated greenhouse, maintaining 95% humidity at 25oC. Five days after spray  112  inoculation plants were moved to a normal humidity greenhouse at 22oC/18oC (day/night), where they were rated for disease.  3.2.4 Fusarium Head Blight disease assays Three types of experiments were performed for disease assays: (1) point-inoculation controls for the priming experiment, (2) priming experiment, and (3) hormone silencing experiments. The three wheat genotypes, ‘Superb, DH1, and DH2, were used in the first two experiments, and the crosses from Table 3.1 were used in the latter experiment.  3.2.4.1 Priming experiment Plants were primed by point inoculation as described in section 3.2.3, and then spray inoculated at 8 h after point inoculation (hai). The 8 h priming period was selected based on microarray results (Chapter 2) where a large number of changes in elicited transcript accumulation was observed at 8 hai compared with 3 and 24 hai, particularly in DH1. Plants were rated for FHB severity (percent of diseased spikelets per spike) at 7, 9, 12, and 18 days after inoculation (dai). Statistical analysis was performed as described in section 3.2.4.2. Plants were allowed to mature, and the grain harvested for DON quantification.  3.2.4.2 Point-inoculation controls for priming experiment Wheat spikes were point inoculated as described in section 3.2.3. Since point inoculation was not followed spray inoculation in this experiment, incubation in the mist-irrigated greenhouse lasted for 5 days and 8 h after point inoculation. Disease 113  rating was performed as described in section 3.2.4.1. Wilting was not evaluated, instead the total number of discolour spikelets were considered to be infected. Statistical analysis was performed on the combined data generated from the priming experiment (sections 3.2.4.1) and its point-inoculation controls (this section). Statistical analysis for disease rating was performed with SAS least square mean (LSMean) routine and grouped by dai. Data were considered statistically different when p < 0.05.  3.2.4.3 Hormone silencing experiment Crosses were spray inoculated in the evenings between 1700 and 1900 as described in section 3.2.2; no point inoculations were performed on these lines. Plants were rated for severity (percent of diseased spikelets per spike) and for FHB-index (average of severity and incidence (percent of diseased spike per plant)) at 6, 9, 12, 15 and 18 dai. Statistical analysis for disease rating was performed with SAS LSMean and grouped by dai or by cross. Data were considered statistically different when p < 0.05.  3.2.5 Deoxynivalenol quantification from priming experiment Kernels were harvested from matured spikes following the priming experiment, finely ground, and trichothecenes extracted from 1 g of material. Biological replicates within each experimental repetition were pooled for trichothecene extractions. Thus for the three wheat lines, four treatments, three harvest times, and three experimental repetitions, a total of 108 extractions were performed. The amount of DON per gram of kernel was determined by ELISA at the Eastern Cereal and Oilseed Research Centre, Agriculture and Agri-Food  114  Canada, as previously described (Savard et al, 2000). Statistical analysis was performed with SAS LSMean routine; data were considered statistically different when p < 0.05.  3.2.6 Hormone profiling of primed wheat spikes For hormone profiling, plants were point inoculated, or ‘primed’, as described in section 3.2.3. Inoculation was not followed by spray inoculation in this case, but the entire spike of primed spikes were collected at 3, 8 and 24 hai, frozen in liquid nitrogen and stored at 80oC for hormone extractions. Biological replicates within each experimental repetition were pooled for hormone extractions, where a total of 108 extractions were performed. Hormone extraction and quantification was performed at the National Research Council, Plant Biotechnology Institute of the National Research Council, Saskatoon, Canada (http://www.nrc-cnrc.gc.ca/eng/facilities/pbi/plant-hormone.html). The pooled spikes were ground to a fine powder in liquid nitrogen and 500 mg of the frozen powder was extracted in 3 mL of extraction solvent (methanol:water:glacial acetic acid (90:9:1, v/v/v)) to which 100 µL solution containing internal standards were added (acetonitrile:water, 50:50 v/v with 0.1% formic acid, containing 1 ng/µL of 3,4,5,6-d4-2-hydroxybenzoic acid and 0.5 ng/µL of 2,2-d2-jasmonic acid). The mixture was sonicated (5 min), incubated on an orbital shaker (4oC, 5 min), and then spun down (4.4 krpm, 10 min). The supernatant was collected, and the extraction procedure was repeated twice on the pellet first with 2 mL of extraction solvent, followed by 1 mL of methanol. The supernatants from all three extractions were pooled and evaporated under reduced pressure. To each dried sample kept on ice, 1 mL of aqueous 0.3 N NaOH was added, followed by extraction with 3 mL dichloromethane. The aqueous layer was collected, and the organic layer re-extracted with 115  2 mL aqueous 0.3 N NaOH. On ice, the combined aqueous layers were acidified with 1 mL 5% aqueous HCl, and then extracted with a 1 mL mixture of ethylacetate:cyclohexane (1:1, v/v). The organic phase was collected and the aqueous phase re-extracted with 0.5 mL ethylacetate:cyclohexane (1:1, v/v). The solvent was evaporated from combined organic fractions under nitrogen gas, and the samples reconstituted in 200 µL methanol:water (30:70 v/v) with 0.1 % formic acid and containing external standards (100 ng of 1,2,3,4,5,6-13C6-2-hydroxybenzoic acid and 50 ng of 12,12,12-d3-jasmonic acid). Extracted salicylic acid (SA) and jasmonic acid (JA), both free non-conjugated acids, were analyzed by UPLC/ESI-MS/MS, utilizing a Waters ACQUITY UPLC system equipped with a binary solvent delivery manager and sample manager coupled to a Waters Micromass Quattro Premier XE quadrupole tandem mass spectrometer via a Z-spray interface. The UPLC used an HSS C18 column (2.1 x 100 mm, 1.8 µm) and a gradient elution of mobile phase A (1% formic acid in HPLC-grade water) and mobile phase B (1% formic acid in HPLC-grade methanol). The analysis utilized the Multiple Reaction Monitoring (MRM) function of the MassLynx v4.1 (Waters Inc.) control software and Quanynx v4.1 software was used for SA and JA quantifications employing similarly to analytical procedures described by Ross et al. (2004). For treatment comparisons, the values for the water control were subtracted from the treatment values. All statistical analysis was performed with SAS LSMean routine; data were considered statistically different when p < 0.05.  116  3.3 Results  3.3.1 The effect of point-inoculation on disease outcomes Since the priming experiments combined point-inoculation with a subsequent sprayinoculation, an initial evaluation of the disease outcomes associated with point-inoculation by itself was performed as a control. These controls enabled us to determine the extent to which any symptoms directly induced by the initial point inoculation would impact the overall disease outcomes in the priming experiment. No disease symptoms were observed for the point-inoculation controls using either water or DON in ‘Superb’, DH1 or DH2 (data not shown). Disease symptoms were observed in inoculated spikelets of FgTri5point-inoculation controls, at 7 dai, but little to no disease spread was observed in any of the three wheat lines evaluated (Figure 3.3a). The method of disease evaluation, a measurement of severity (percent infected spikelet per spike) at multiple dai, was selected since an evaluation of Type I and II resistance was of interest; however, since the average number of total spikelets per spike differed between plant lines (data not shown), the infection of a single spikelet resulted in a different percentage of diseased spikelets for each plant line. For ‘Superb’, this ranged from 7-10 % across the four rating dates; 2-5 % for DH1; and 6-9 % in DH2 (Figure 3.3a). These results differed (p < 0.05) from priming with FgTri5- followed by spray inoculation with FgTri5+ in ‘Superb’, where 20 % of the spike was diseased at 7 dai, and 66 % by 18 dai. In both resistant genotypes, disease was higher in the priming experiment compared with the FgTri5- point-inoculation controls, but there was only one case where this was significant: DH1 at 18 dai, where 5% (18 dai) and 30 % (18 dai) of the spike was diseased. For FgTri5+ point-inoculation controls, little to no 117  disease spread was observed in DH2 which has good Type II resistance. There was also no difference observed in this genotype with either the FgTri5+ priming experiment, or the FgTri5- point-inoculation controls. In the Type I resistant genotype, DH1, disease spread was observed from 7 to 18 dai (FgTri5+), but no differences were observed between the point-inoculation controls and priming experiment (p > 0.05). Disease spread was also observed in FgTri5+ point-inoculation controls in susceptible ‘Superb’, and differences were observed between the point inoculation control and the priming experiment at 7 dai.  3.3.2 Priming experiment disease evaluation Wheat spikes were primed by point inoculation with water, FgTri5-, or DON, and then spray inoculated 8 hours later with FgTri5+. The water control for the priming experiment resulted in 7 % disease in the ‘Superb’ wheat spike at 7 dai, which increased over the remaining evaluation days (Figure 3.3b). Priming with FgTri5- led to an increase in disease severity (p < 0.05) at 7 dai compared with the water primed spikes, but these two treatments did not differ (p > 0.05) by 9 and up to 18 dai. In contrast, priming with FgTri5in DH1 led to a reduction in disease (p < 0.05) by 18 dai compared with water priming. Thus, FgTri5- priming increased susceptibility to early (or initial) infection in the susceptible cv. ‘Superb’, but increased resistance to disease in the later stages in Type I resistant DH1. In Type II resistant DH2, no significant differences were observed between the water-primed spikes and in the spikes primed with either FgTri5-. Furthermore, priming with DON did not have an impact on disease outcomes in any of the three genotypes when compared with water priming (p > 0.05)  118  A.  Disease progression in point inoculation controls vs priming experiment ‘Superb’  DH1  severity  a a b c  a a b c  a b bc d  a a cd a d a cd d  a ab bc d  a ab c d  a ab bc c  dai  B.  DH2  a a a a dai  a a a a  a a a a  a a a a  dai  Disease progression in priming experiment ‘Superb’  DH1  DH2  a a a  a a b  severity  a a a a a a  a ab b  a ab b  a ab b  a ab b  dai  a a a  dai  a a a  a a a  a a a  dai  Figure 3.3 119  Figure 3.3 Disease progression in three wheat genotypes: ‘Superb’, DH1, and DH2 (page 119). A. FgTri5+ (○) and FgTri5- (∆) point inoculation controls were compared with priming experiment (FgTri5+ priming (●) and FgTri5- priming (▲), followed by spray inoculation with FgTri5+ at 8 hai). B. Disease progression was also compared between wheat heads priming with water (□), FgTri5- (▲), or DON (♦), followed by spray inoculation with FgTri5+ at 8 hai. Significant differences (p < 0.05) are represented for each plant line at a given dai.  3.3.3 Priming has no effect on SA or JA accumulation within point-inoculated wheat spikes Constitutive levels of free SA and JA were quantified in uninoculated wheat spikes at anthesis, and results showed that the steady-state levels of JA in DH2 were roughly twice as high as those observed in the other two wheat lines (p < 0.05) (Table 3.2). The level of SA detected in uninoculated wheat spikes was 240 parts per billion (ppb) (data not shown), which is quite low compared with what has been observed in other species. Free SA accumulation has been reported in the range of 2000 to 9000 ppb from mustard and rice seedlings, respectively (Chen et al., 1997; Dat et al., 1998). On the other hand the low levels of JA accumulation, 45 ppb from uninoculated wheat spikes (data not shown), seems to be consistent with what has been observed in other species. Free JA accumulation has been reported to range from 5 to 20 ppb in tomato and rice (Schweizer et al., 1997; Thoma et al., 2003).  120  Free SA and JA were also measured in wheat spikes primed by point-inoculation with FgTri5+, FgTri5-, or DON, at 3, 8 and 24 hai. Spikes primed with water served as controls. Differences in SA accumulation, compared with the water-primed spikes, ranged between 52 and +84 ppb, and no significant differences (p > 0.05) were observed over time or between treatments (Table 3.3). Likewise, JA accumulation in point-inoculated spikes did not differ significantly among treatments or over time, when compared with the waterprimed spikes.  3.3.4 DON accumulation in mature kernels from primed and spray-inoculated wheat spikes is primarily correlated with disease severity DON accumulation was quantified from kernels of mature spikes that were primed with water, FgTri5+, FgTri5-, or DON at anthesis and subsequently spray inoculated with FgTri5+. DON accumulation ranged from 30 to 215 ppm in ‘Superb’, 12 to 31 ppm in DH1, and 6 to 20 ppm in DH2 (Table 3.4). Thus, the highest DON accumulation was observed in genotypes where disease was highest. In all cases, priming with FgTri5+ resulted in the highest accumulation. Despite some of the large differences observed between treatments or genotypes, no significant differences were observed among any of these comparisons. This lack of significance may be attributed to the variation introduced by the small sample size within experimental replicates. The total mass of kernels harvested per experimental replicate did not exceed 2-3 g, and while trichothecene extractions were conducted on only 1 g of ground kernel, a larger sample size from which to sample 1 g of material would have reduced the variation observed between experimental replicates. 121  Table 3.2 Constitutive levels of SA and JA in untreated wheat heads. Letter grouping indicates differences (p < 0.05) for LSMean of SA or JA accumulation in leaf tissues among the three wheat genotypes. Plant Line  SA (ppb)  ‘Superb’  129  DH1  122  DH2  154  JA (ppb)  a  25  a  a  34  a  61  a b  Table 3.3 Time-course analysis of SA and JA accumulation in wheat spikes primed with FHB elicitors. LSMean for SA and JA accumulation in wheat spikes primed by point inoculation with FgTri5+, FgTri5-, or DON, are presented, with values from water priming subtracted. Letter grouping indicates that no significant differences (p < 0.05) in SA or JA accumulation, where levels were compared across all conditions and wheat lines evaluated. Condition  SA (ppb) 3 hai  JA (ppb)  8 hai  24 hai  3 hai  8 hai  24 hai  ‘Superb’ a  FgTri5+ vs water  +20  FgTri5- vs water  -12  DON vs water  +56  a  a  a  +4  -13 a  -4  a  +51  a  a  a  -6  a  a  +26  +31  a  -11  a  +69  a  -5  a  +33  -8  a  -6  a  -5  a  +12  a  -18  +7  a  +7  a  -6  a  +8  a  +9  a  +1  a  +12  a a  DH1 FgTri5+ vs water  +33  FgTri5- vs water  +30  DON vs water  0  a  a  +54  +84  a  +7  a  a  +3  +2  a  -2  a  +3  a a  DH2 a  FgTri5+ vs water  +39  FgTri5- vs water  -52  DON vs water  +10  a a  a  a  +13  -11  a  +3  a  -12  a  +6  a  -12  -26  -37  a  -27  -4  a  +15  -26  a  a  -7  a  a  -3  a  -1  a a  122  Table 3.4 Effect of priming in DON accumulation in wheat kernels. DON accumulation (ppm) in mature kernels of three lines (rows) primed by point-inoculation with one of four inocula (columns) 8 h prior to spray inoculation with FgTri5+. Letter grouping (superscript) indicates that no significant differences (p < 0.05) in DON accumulation were observed among the conditions evaluated. Plant line/Condition  water  ‘Superb’  29.6  DH1 DH2  8.1  FgTri5+  a  214.6  a  11.5  a  30.8  a  19.7  FgTri5a  45.2  a  23.9  64.1  a  12.4  a  7.9  a  DON a a  a  5.9  3.3.5 Screening for hormone silencing  3.3.5.1 Screening for NAHG over-expression and SA degradation The Blizzard-NAHG parent was screened for the effects of SA silencing by Gaudet et al. (unpublished): (1) F1 seeds were germinated on mannitol as a screen for SA- deficiency, since it has previously been demonstrated that osmotic stress using mannitol causes necrosis wild-type Arabidopsis seedlings, but yields healthy green tissue in NAHG overexpression lines (Borsani et al., 2001); (2) the presence of the gene was confirmed by PCR, although transcript accumulation was not observed by qPCR using the NahG1 primers (Figure A1); (3) disease assays showed that the transgenic lines were more susceptible to wheat leaf and stripe rusts and to snow mold, but had no effect on bunt resistance. Since ‘Blizzard’-NAHG was produced by biolistic transformation and the resulting transgenic lines were made into double haploids after transformation, all F1 123  crosses with this line should be positive for the NAHG gene. All crosses with ‘Blizzard’-NAHG were intended to be screened for NAHG transcript accumulation by qPCR, but no transcript accumulation was detected by qPCR using any of the four primer sets presented in Figure A1. A sample set of the crosses was randomly selected for SA quantification, but SA accumulation was highly variable and it was not possible to observe any differences in accumulation among the crosses with ‘Blizzard’ compared with ‘Blizzard’-NAHG (Table 3.5). Due to the inconclusive results from these screens, an additional test was conducted: both ‘Blizzard’ and ‘Blizzard’-NAHG were treated with SA, followed by SA quantification 12 and 24 h after treatment to determine whether SA degradation could be observed in the transgenic line. Final data are not yet available from this experiment.  3.3.5.2 Screening for silencing of JA biosynthesis Although the ‘Fielder’-∆AOS parent is a double haploid line, experimental evidence suggests that transgene incorporation into the microspore genome when using cell penetrating peptides may occur after the stage of chromosome doubling (Eudes et al.unpublished data). Thus, crosses of other wheat genotypes with ‘Fielder’-∆AOS may result in segregation of the transgene, and PCR-based genotyping of the progeny of the transgenic crosses was necessary prior to disease evaluation. Some variability in AOS transcript accumulation among wild-type crosses made it difficult to set a clear FD cutoff value when selecting for JA-silenced crosses (Table 3.5). JA quantification generally supported a CT-value cut-off at a difference of > 8.0 between the housekeeping gene and AOS for JA silencing. However, a large degree of variability in the JA accumulation 124  was also observed, and low levels of JA accumulation were observed in some of the wild-type crosses, especially in the second experimental repetition for 2-JA. Due to the low number of JA-silenced crosses available, the selected transgenic plants were ‘cloned’ at 4-5 weeks by dividing them into three or four separate plants, in an effort to effectively increase the biological replicates.  3.3.5.3 Screening for silencing of ET signalling ‘Bobwhite’-∆EIN2 lines are not double haploids, and since segregation of the transgene was expected, all of the ‘Bobwhite’-∆EIN2 crosses were genotyped by PCR for reduced expression of the EIN2 transcript. qPCR screens of crosses with ‘Bobwhite’ or ‘Bobwhite’-∆EIN2 was initially performed with the EIN2-RT primer set that was used in the screening when these transgenic lines were originally produced (Travella et al., 2006). Unexpectedly high CT-values (>30) were typically observed with the crosses, resulting in highly variable data (data not shown). When new primers sets were designed, both Ein2-1 and Ein2-2 had CT-values of approximately 24, and yielded reproducible results. Thus screening for EIN2 silencing in the current study was conducted with primer set Ein2-1. Unfortunately, only a few transgenic crosses were found to display reduced expression of EIN2, and this was using a low FD cut-off value (1.5 FD) in comparisons with the wild-type crosses (Table 3.5).  125  Table 3.5 Screen of transgenic crosses by hormone quantification and qPCR. Three biological replicates (BR) from each of the three experimental repetitions (ER) were randomly selected from each of the crosses with the wild-type male parents for controls in hormone quantification and/or qPCR analysis. All crosses with the transgenic parents were screened by qPCR. The FD was calculated between a given transgenic cross, CTdifferences (CT-diff; CT-value of gene of interest with CT-value of the housekeeping gene) of a single BR from the transgenic cross was compared with the average CT-diff of BR within the same ER of the wild-type parent. qPCR with primer sets AOS1 and EIN1 for were used for JA/JAi and ET/ETi crosses, respectively, both yielded CT-values higher than the housekeeping gene (EF1α); thus, higher CT-diff indicates reduction in transcript accumulation of the gene of interest. qPCR data for transgenic crosses are presented only for the samples which were selected for FHB disease assays, with the exception of two replicates (red font, marked with an asterisk), which are presented here since SA and JA data were collected for these samples and provide some support for the selected CT-diff. ppb ER  qPCR  BR  SA  JA  CT-diff  FD  stdev  1  1  50.6  16.8  NA  NA  NA  1  2  64.0  17.1  NA  NA  NA  1  3  69.2  9.3  NA  NA  NA  2  1  48.7  3.0  NA  NA  NA  2  2  40.6  2.5  NA  NA  NA  2  3  265.5  10.5  NA  NA  NA  3  1  157.0  3.6  NA  NA  NA  3  2  156.7  4.6  NA  NA  NA  3  3  186.1  4.1  NA  NA  NA  1  1  49.9  4.7  NA  NA  NA  1  2  105.2  31.8  NA  NA  NA  S-SA  S-SAi  126  ppb  qPCR  ER  BR  SA  JA  CT-diff  FD  stdev  1  3  108.2  24.6  NA  NA  NA  2  1  35.1  4.1  NA  NA  NA  2  2  127.8  4.0  NA  NA  NA  2  3  295.7  3.8  NA  NA  NA  3  1  40.6  4.3  NA  NA  NA  3  2  56.4  4.4  NA  NA  NA  3  3  120.6  3.2  NA  NA  NA  3  4  148.2  4.6  NA  NA  NA  1  1  12.0  4.9  NA  NA  NA  1  2  19.0  12.5  NA  NA  NA  1  3  50.1  6.9  NA  NA  NA  2  1  26.2  4.7  NA  NA  NA  2  2  30.7  5.5  NA  NA  NA  2  3  34.6  4.5  NA  NA  NA  3  1  119.4  9.3  NA  NA  NA  3  2  141.8  3.1  NA  NA  NA  3  3  216.8  5.7  NA  NA  NA  1  1  12.5  8.9  NA  NA  NA  1  2  63.5  12.7  NA  NA  NA  1  3  203.0  13.7  NA  NA  NA  2  1  17.4  5.6  NA  NA  NA  2  2  55.5  7.6  NA  NA  NA  2  3  49.9  3.7  NA  NA  NA  3  1  147.8  5.6  NA  NA  NA  3  2  124.5  5.4  NA  NA  NA  3  3  270.1  9.1  NA  NA  NA  3  4  27.8  5.5  NA  NA  NA  1  1  22.5  9.9  NA  NA  NA  1  2  34.1  12.3  NA  NA  NA  1  3  19.5  7.0  NA  NA  NA  2  1  73.3  4.7  NA  NA  NA  2  2  22.0  3.3  NA  NA  NA  2  3  37.4  3.3  NA  NA  NA  3  1  47.5  3.5  NA  NA  NA  1-SA  1-SAi  2-SA  127  ppb  qPCR  ER  BR  SA  JA  CT-diff  FD  stdev  3  2  87.5  21.5  NA  NA  NA  3  3  59.6  3.3  NA  NA  NA  1  1  73.2  6.9  NA  NA  NA  1  2  24.9  4.7  NA  NA  NA  2  1  15.3  3.6  NA  NA  NA  2  2  47.1  5.9  NA  NA  NA  2  3  61.3  4.8  NA  NA  NA  3  1  175.3  10.1  NA  NA  NA  3  2  62.9  4.1  NA  NA  NA  3  3  165.8  7.0  NA  NA  NA  2-SAi  'Blizzard' NA  NA  26.8  7.3  NA  NA  NA  NA  NA  36.7  7.0  NA  NA  NA  'Blizzard'-NahG NA  NA  17.0  7.7  NA  NA  NA  NA  NA  17.1  8.0  NA  NA  NA  NA  NA  42.8  7.0  NA  NA  NA  1  1  36.4  7.4  8.2  NA  NA  1  2  45.9  13.1  3.4  NA  NA  1  3  54.1  14.0  6.6  NA  NA  2  1  130.3  6.8  5.1  NA  NA  2  2  194.3  7.5  5.0  NA  NA  2  3  820.7  10.1  5.3  NA  NA  3  1  67.4  4.2  2.5  NA  NA  3  2  176.3  6.5  4.7  NA  NA  3  3  181.3  10.1  2.5  NA  NA  1  1  15.1  1.7  8.6  -14.9  ±0.08  1  2  30.3  1.5  8.3  -13.1  ±0.04  2  1  217.8  5.3  8.4  -12.5  ±0.02  2  2  96.3  3.4  9.0  -8.8  ±0.03  3  1  96.3  2.5  9.5  -72.9  ±0.00  3  2  54.3  3.3  9.3  -63.3  ±0.01  3  3*  138.4  37.0  2.2  +2.2  ±0.60  S-Field  S-JAi  128  ppb ER  qPCR  BR  SA  JA  CT-diff  FD  stdev  1  1  19.0  2.8  6.6  NA  NA  1  2  27.3  7.9  7.1  NA  NA  1  3  50.2  8.0  5.4  NA  NA  2  1  84.2  2.4  5.8  NA  NA  2  2  179.2  2.4  3.6  NA  NA  2  3  171.6  2.6  5.7  NA  NA  2  4  233.0  2.7  3.6  NA  NA  3  1  124.4  3.6  NA  NA  NA  3  2  242.2  7.1  2.9  NA  NA  3  3  476.5  14.5  3.7  NA  NA  1  1  58.6  2.1  8.7  -5.2  ±0.09  1  2  58.0  2.5  8.6  -4.9  ±0.09  1  3  22.1  2.0  8.2  -3.5  ±0.14  2  1  246.6  4.9  10.7  -43.9  ±0.01  2  2  NA  NA  9.1  -19.3  ±0.05  3  1  63.3  2.3  8.1  -15.1  ±0.03  3  2  129.7  5.5  NA  NA  NA  3  3  38.9  2.6  NA  NA  NA  1  1  13.0  6.6  6.1  NA  NA  1  2  21.6  8.0  NA  NA  NA  1  3  16.0  9.9  4.4  NA  NA  2  1  78.4  5.1  6.5  NA  NA  2  2  221.6  9.9  5.6  NA  NA  2  3  157.8  11.1  5.4  NA  NA  3  1  159.6  5.0  NA  NA  NA  3  2  165.1  5.0  NA  NA  NA  3  3  159.8  6.7  NA  NA  NA  1  1*  162.1  27.7  7.3  -4.0  ±0.10  2  1  64.5  3.1  9.0  -9.3  ±0.04  3  1  70.5  2.2  9.4  -12.7  ±0.03  3  2  22.0  3.9  8.8  -6.8  ±0.04  3  3  113.6  2.9  NA  NA  NA  3  4  226.6  4.3  NA  NA  NA  1-Field  1-JAi  2-Field  2-JAi  129  ppb ER  qPCR  BR  SA  JA  CT-diff  FD  stdev  1  1  NA  NA  4.9  NA  NA  1  2  NA  NA  4.3  NA  NA  1  3  NA  NA  4.3  NA  NA  2  1  NA  NA  6.1  NA  NA  2  2  NA  NA  5.8  NA  NA  2  3  NA  NA  5.7  NA  NA  3  1  NA  NA  6.8  NA  NA  3  2  NA  NA  5.6  NA  NA  1  1  NA  NA  5.8  -2.4  ±0.08  1  2  NA  NA  5.2  -1.7  ±0.14  1  3  NA  NA  5.2  -1.6  ±0.16  3  1  NA  NA  6.8  -1.5  ±0.57  1  1  NA  NA  5.4  NA  NA  1  2  NA  NA  4.8  NA  NA  1  3  NA  NA  4.3  NA  NA  2  1  NA  NA  5.6  NA  NA  2  2  NA  NA  6.3  NA  NA  3  1  NA  NA  5.4  NA  NA  3  2  NA  NA  4.3  NA  NA  1  1  NA  NA  6.3  -2.6  ±0.10  1  2  NA  NA  5.8  -2.0  ±0.13  1  3  NA  NA  5.7  -1.7  ±0.11  1  4  NA  NA  5.6  -1.7  ±0.16  1  5  NA  NA  5.6  -1.7  ±0.12  1  6  NA  NA  5.5  -1.5  ±0.14  2  1  NA  NA  6.6  -1.5  ±0.16  3  1  NA  NA  5.5  -1.6  ±0.23  3  2  NA  NA  5.9  -2.1  ±0.15  3  3  NA  NA  6.7  -3.8  ±0.08  3  4  NA  NA  6.1  -2.5  ±0.11  1  1  NA  NA  5.3  NA  NA  1  2  NA  NA  4.8  NA  NA  S-ET  S-ETi  1-ET  1-ETi  2-ET  130  ppb  qPCR  ER  BR  SA  JA  CT-diff  FD  stdev  1  3  NA  NA  4.6  NA  NA  2  1  NA  NA  6.3  NA  NA  2  2  NA  NA  5.5  NA  NA  2  3  NA  NA  5.4  NA  NA  3  1  NA  NA  6.9  NA  NA  3  2  NA  NA  6.7  NA  NA  2  1  NA  NA  6.5  -1.7  ±0.15  2  2  NA  NA  6.4  -1.6  ±0.15  3  1  NA  NA  6.7  -2.0  ±0.17  3  2  NA  NA  6.7  -1.9  ±0.14  3  3  NA  NA  6.5  -1.7  ±0.22  4  NA  NA  6.5  -1.6  ±0.13  2-ETi  3  NA = not available  131  3.3.6 Hormone silencing disease evaluation Comparisons were made in disease severity and FHB-index among the different crosses at selected times post-challenge. The observed differences (p < 0.05) in disease severity were identical to the observed differences in FHB-index (data not shown) and, thus, only severity is considered in the current analysis. Significant differences in disease severity (percent of infected spikelets per spike) were observed between crosses at specific time points, and differences in disease progression (the change in disease severity over time) were also observed over time within a given cross. SA silencing in the DH2 background resulted in increased FHB susceptibility: 2-SA and 2-SAi showed an average difference of 17% in disease severity at a given dai, where disease was higher in the 2-SAi line (Figure 3.4). On the other hand, SA silencing had little or no impact on disease outcomes in the other two genetic backgrounds. JA silencing in both the DH1 and DH2 backgrounds resulted in an increase in disease severity, which was significant as early as 6 dai. Thus, resistance to initial infection increased when JA signalling had been compromised in the resistant backgrounds. On the other hand, disease progression was relatively consistent in all of the JAi crosses compared with the respective wild-type crosses. In other words, the change in disease severity over time occurred at similar rates between the wild-type and JA-silenced crops, suggesting that, in contrast to initial infection, disease spread was unaffected by JA silencing.  132  Figure 3.4 133  Figure 3.4 Effect of hormone silencing on FHB-disease progression in wheat (page 133). Multivariate analysis was used to determine whether there were differences in disease severity and in disease progression among crosses (see Table A2 for the complete analysis), and is presented above in groups, where the ‘Superb’ (S), DH1 (1), or DH2 (2) crossed with the ‘Blizzard’ (SA), ‘Fielder’ (JA), or ‘Bobwhite’ (ET), are compared directly with the respective hormone silenced cross (SAi, JAi or ETi). Differences marked with an asterisk indicate differences between the crosses at a given dai (p < 0.05). Grouping by letters indicate disease progression, or differences over time, within a given cross (p < 0.05), upper and lowercase letters are used to demonstrate disease progression within the wild-type and silenced crosses, respectively.  ET silencing resulted in significant changes in resistance to initial infection (disease severity observed at 6 dai) in both the susceptible and DH2 backgrounds. However, due to the low number of replicates available in the ETi crosses the reproducibility of this data has not been tested. In the susceptible background, ET silencing (S-ETi) increased host susceptibility, but in the Type II resistant background, ET silencing (2-ETi) resulted in an increase in resistance compared with the respective wild-type crosses (S-ET and 2-ET). In both cases differences were observed in initial infection (observed at 6 dai). Some minor but statistically significant differences (p < 0.05) were observed among the three genetic backgrounds (‘Superb’, DH1, and DH2) crossed with the wild-type (nontransgenic) lines (Table A2). The most notable differences were observed in DH2, where 134  disease severity in 2-ET was generally higher than the other wild-type crosses in this genetic background (namely, 2-SA and 2-JA).  3.4 Discussion  3.4.1 Priming induces changes in FHB-resistance and -susceptibility of wheat Point-inoculation controls were used to determine whether the disease symptoms which develop directly from the point of inoculation would have an impact on disease progression following the subsequent spray inoculation for the priming experiment. Point inoculations with DON or FgTri5- did not adversely affect the interpretation of results in the priming experiment, since disease symptoms (if any) were confined to the inoculated floret. Priming with DON had no impact on subsequent infection by FgTri5+ in any of the three wheat lines evaluated. Priming with FgTri5-, on the other hand, resulted in increased susceptibility to initial infection by FgTri5+ in ‘Superb’, observed at 7 dai. In contrast, improved resistance to disease spread in DH1was observed when FgTri5- priming was used. A trend toward improved resistance was observed as early as 7 dai in this genotype, but the difference became significant by 18 dai. Thus, priming with FgTri5- increased resistance to subsequent infection by wild-type F. graminearum in the Type I resistant genotype. In contrast with the susceptible and Type I resistant genotypes, resistance in DH2 was unaffected by priming with FgTri5- inoculation. DH2, which has good Type II resistance, allowed little or no disease spread in any of the treatments. It has already been demonstrated that resistance to disease spread occurs at the rachis node of the infected 135  spikelet (Kang and Buchenauer, 2000a). Our results suggest that the strong local resistance mechanism exhibited in the ‘Sumai 3’-derived genotype precludes the induction of a systemic defense response in spikelets distal to the point of infection. It is interesting that initial infection (assessed at 7 dai) and the final disease outcome (assessed at 18 dai) did not appear to differ between water-primed spikes of DH1 and ‘Superb’. This was unexpected since DH1 was previously evaluated to have good Type I resistance, and Superb is a susceptible cultivar. If one considers the methodology used to define their resistance/susceptibility, in combination with the observations made in the current report, this discrepancy can be explained. Type I FHB resistance for both DH1 and ‘Superb’ were previously evaluated under field conditions (unpublished data), where the plants were sprayed with FgTri5+ macroconidia on three successive occasions (as described by Eudes et al. 2008). Together, these data imply that the first spray inoculation date during the evaluation of DH1 Type I resistance, which occurred when 50 % of the spikes had emerged from the boot, could have effectively primed the plants by inducing some level of systemic resistance to the subsequent inoculations, which occurred two and four days later. When DON profiling was performed on kernels from mature spikes at the end of the priming experiment, no significant differences in DON levels could be correlated with the different priming treatments, but much lower DON accumulation was detected in both the resistant lines, as might be predicted, based on their reduced levels of fungal colonization.  136  3.4.2 The role of hormone signalling in FHB-resistance In order to determine which signalling pathways might be induced in the non-inoculated tissues of primed wheat spikes, SA and JA accumulation patterns were examined in primed wheat spikes at 3, 8 and 24 hai, and tested for correlations with the observed disease resistance and susceptibility outcomes. Unfortunately, the low endogenous levels of SA and JA in this material, possibly combined with minor variations in developmental staging for the point-inoculated spikelets, made it impossible to obtain replicable differences in analyte data from the available tissue. Interestingly, while no major challenge-induced differences were observed in SA or JA accumulation patterns, the phytohormone analyses did establish that spikes from Type II resistant DH2 constitutively accumulate almost twice as much JA as do either ‘Superb’ or DH1. Higher steady-state JA levels may play a role in prompt activation of a local resistance mechanism in this genotype. As previously reported, priming with MeJA increased susceptibility to F. graminearum infection in Arabidopsis during the early stages of infection, but improved resistance could be observed if priming was performed at 12 hai (Makandar et al., 2010). Furthermore, (FgTri5-)-priming induced up-regulation of JA signalling-related transcripts at 3 hai in ‘Superb’ (Chapter 2) and also increased susceptibility to initial infection by FgTri5+ in the current study. In DH1, (FgTri5-)priming induced a more delayed (24 hai) up-regulation of JA signalling transcripts (Chapter 2) and also led to increased resistance to FgTri5+ infection (observed by 18 dai in the current study), suggesting that priming had improved resistance to disease spread in this genotype by triggering JA-mediated responses at an effective time-point (24 hai). It is interesting that JA signalling is associated with resistance to necrotrophs (Glazebrook, 137  2005) and that late JA signalling is involved in resistance to F. graminearum in Arabidopsis, presumably when the fungus has entered a necrotrophic phase (Makandar et al., 2010). These observations, taken in combination with the results from differential transcriptomics studies presented in Chapter 2, suggest that appropriate timing of JA signalling may be an important feature of the mediation of Type II FHB-resistance mechanisms in wheat. Furthermore, trichothecene production, which is known to be necessary for disease spread, may inhibit the JA-mediated response in a susceptible interaction, since DON was shown to down-regulate genes involved in JA signalling in ‘Superb’ and DH1 (Chapter 2). However, FHB-disease assays in the JAi lines suggests that JA may play a more prominent role in Type I resistance (see below). The remaining discussion, based on the silencing of SA, JA, or ET and their impacts on disease outcomes, is based on the assumption that silencing was successful and that the data are reproducible, although, as previously discussed, more work is necessary to validate these assumptions. Putative SA silencing resulted in an increase in susceptibility, but only in the Type II resistant background. These conclusions would be consistent with results presented by Makander et al. (2010), where Arabidopsis plants with compromised SA accumulation or signalling pathways showed an increase in susceptibility to F. graminearum infection. If one considers the hypothesis that JA signalling increases susceptibility to initial infection, but improves resistance to disease spread, I could predict that SA signalling serves to suppress the potentially adverse effects of the constitutively higher JA accumulation on Type I resistance in DH2. However, the impact of JA silencing in both resistant backgrounds suggest that JA signalling is positive regulator of Type I resistance. Whether JA signalling impacts both Type I and II resistance or whether this is 138  specifically associated with a Type I resistance mechanism remains unclear. A more accurate assessment of Type II resistance, using point inoculation studies, would provide a clearer indication of the impact of JA silencing on this resistance mechanism. ET silencing also had an impact in disease severity in the Type II resistant background, since the 2-ETi genotype showed an overall improvement in resistance compared with 2ET. Interestingly, the disease severity in 2-ET was generally higher than in the other wildtype crosses in this genetic background (namely, 2-SA and 2-JA). It was previously demonstrated that ET silencing in the male parent line used here, ‘Bobwhite’, reduced susceptibility to FHB (Chen et al., 2009). Thus, it was surprising that a positive interaction between ET silencing and FHB resistance in the current study was observed only in the Type II resistant background. The observed increase in disease severity in 2-ET compared with 2-SA and 2-JA, and subsequent reduction in severity in the ET-silenced genotype (2ETi), suggests that the susceptibility in this cross arises directly from the interaction of the ‘Bobwhite’ and DH2 backgrounds and that this susceptibility is correlated with ET signalling. Since similar differences were not observed in the other two genetic backgrounds silenced in the ET signalling pathway, and in fact the opposite response was observed in the susceptible background in this study, it is likely that the specific mechanisms of resistance or susceptibility are highly genotype-dependent. In an analogous situation, affecting ET signalling by chemical treatments was shown to enhance susceptibility in susceptible wheat and barley cultivars, ‘Hobbit’ and ‘Golden Promise’, respectively (Chen et al., 2009), while similar experiments in another susceptible wheat line, landrace Y1193-6, had the opposite effect (Li and Yen, 2008).  139  3.5 Conclusions  Results from both the priming and hormone silencing experiments emphasize the complex nature of genetic resistance or susceptibility to FHB, and suggest that the mechanisms of resistance and susceptibility are diverse. For instance, priming with FgTri5elicited opposite responses in ‘Superb’ and DH1, where susceptibility increased in the latter, but resistance improved in the former. These differences may simply be a question of a delayed response in one genotype compared with the other, but could also mean that the different pathways were activated in each genotype. The incongruent effects of ET signalling in different host backgrounds support the hypothesis that different disease outcomes are mediated by different pathways. While ET signalling appears to be correlated with susceptibility in ‘Bobwhite’, it does not seem to explain the susceptibility in ‘Superb’. In fact, in the ‘Bobwhite’ by ‘Superb’ cross, ET silencing increased susceptibility, suggesting that ET signalling effectively reduces susceptibility in this background. These opposing outcomes are likely mediated by cross-talk with other pathways. Improved resistance was observed in the ‘Bobwhite’ and DH2 cross when the ET signalling pathway was silenced. In this DH2 background, both SA and JA signalling seem to be involved in mediating a resistance outcome, whereas these two pathways have little impact on FHB development in ‘Superb’. Furthermore, in DH1, silencing of ET signalling had no effect on disease, but JA signalling may be important in mediating resistance in this genotype. Perhaps ET signalling only increases susceptibility if it occurs in conjunction with an active role for JA and/or SA signalling.  140  In the Type I resistant DH1, priming-induced systemic resistance was observed, and results from the current study, in combination with those from Chapter 2, suggest that JA signalling may be involved both in the induced, as well as the innate resistance mechanisms of this genotype. By contrast, Type II resistance in DH2 is a local response, and in this case, the innate resistance may be mediated by both JA and SA signalling. Thus, these three wheat genotypes, which share a high degree of genetic identity in their genomes, not only appear to express different types or mechanisms of resistance/susceptibility, but also differ in their biochemical/molecular responses to FHB infection. One commonality observed in both resistant backgrounds, which nevertheless differ in their mechanism of resistance, is that JA signalling appears to mediate resistance, at least in part, in both genotypes.  141  4. Investigating a Putative Role for TaLTP3, a Wheat Lipid Transfer Protein, in Fusarium Head Blight Resistance  4.1 Introduction  Lipid transfer proteins (LTPs), first identified in 1975 (Kader) from potato tubers, are small extracellular proteins that are highly conserved in structure and in vitro activity. Two major types of LTPs have been identified. Type 1 LTPs are 9 kDa proteins with four αhelices, four disulfide bridges and a hydrophobic cavity. Type 2 LTPs are similar in structure, except smaller (7 kDa) with only three α-helices. The hydrophobic cavity allows enhanced rates of phospholipid exchange between membranes, as observed in vitro (Kader et al., 1984; Yeats and Rose, 2008). However, the in vivo biological activity of LTPs is still poorly understood. Furthermore, while most LTPs that have been functionally characterized belong to the Type 1 group, it is not clear if and how these two groups may be functionally distinct. Some LTPs have been implicated in the plant stress response (Gaudet et al., 2003; Jung et al., 2003; Yubero-Serrano et al., 2003; Wu et al., 2004a; Lu et al., 2005), with putative roles in cell signalling (Buhot et al., 2001; Blein et al., 2002; Maldonado et al., 2002) and antimicrobial behaviour (Castro and Fontes, 2005; Gonorazky et al., 2005; Sun et al., 2008; Cruz et al., 2010). Sun et al. (2008) evaluated the in vitro antifungal activity of seven Type 1 and one Type 2 stress-inducible wheat LTPs, and found that a few of the Type 1 LTPs inhibited spore germination and/or hyphal growth of several fungal species, including F. graminearum, Verticillium dahliae, and Puccinia graminis.  142  LTPs have also been shown to partake in physiological and developmental processes (reviewed in Carvalho Ade and Gomes, 2007). LTP5 from Arabidopsis and an LTP from Lilium longiflorum (stigma/style cysteine-rich adhesion; SCA) have been shown to mediate fertilization during sexual reproduction (Chae et al., 2009). Several LTPs have been reported to be involved in cuticular wax deposition at the plant cell wall (Cameron et al., 2006; Kim et al., 2008; Samuels et al., 2008; DeBono et al., 2009; Kunst and Samuels, 2009). The main function of the plant cuticle is thought to be in the regulation of water loss (Goodwin and Jenks, 2007), but it also serves as the first line of defense against many invasive pathogens and pests (Martin, 1964; Mendgen et al., 1996). Constitutively higher expression of the TaLTP3 transcript was observed in the spikelets of untreated Type 1 FHB-resistant DH1 genotype compared with its susceptible parent, ‘Superb’ (Chapter 2). The TaLTP3 gene product has not been functionally characterized, but it is a stress inducible Type 1 LTP gene. First cloned from a differential cDNA library of a wheat-rye translocation line infested with Hessian fly (Mayetiola destructor) larvae (Jang et al., 2003), TaLTP3 was later found to be SA- (but not MeJA-) inducible and to be differentially expressed in the phloem and the epidermis (Jang et al., 2005). Constitutively higher transcript accumulation of a plasma membrane intrinsic protein, aquaporin TaPIP1, was also observed in the spikelets of untreated DH1 compared with ‘Superb’ (Chapter 2). Aquaporins PIPs are involved in water transport across the plasma membrane (TornrothHorsefield et al., 2006), and transgenic over-expression of a barley aquaporin PIP in rice has been reported to result in increased cuticle thickness (Hanba et al., 2004). Cuticle thickness or composition may play a role in preventing or minimizing FHB host-infection, since the primary mode of Fusarium invasion of plant cells is by direct penetration of the 143  host epidermis, and apparent cuticular degradation has been observed during F. culmorum invasion of wheat spikes (Kang and Buchenauer, 2000b). Cuticle degradation can occur by hydrolytic activity of cutinases or lipases, and expression of Fusarium genes encoding both enzyme classes has been implicated in FHB aggressiveness (Voigt et al., 2005; Cuomo et al., 2007). Furthermore, it has been observed that F. graminearum germinates and grows more easily on leaves of A. thaliana CER1, a cuticular wax-deficient mutant, than on wildtype plants (Ouellet et al., unpublished data). Thus, the simultaneously higher expression of TaLTP3 and TaPIP1 observed in spikelets of Type I FHB-resistant DH1, compared with its susceptible parent ‘Superb’, could potentially contribute to cuticular strengthening and ultimately minimize F. graminearum penetration in this genotype. I therefore conducted a series of experiments to determine whether the constitutively higher expression of TaLTP3 in DH1 compared with the FHB-susceptible cv. ‘Superb’ has an impact on FHB-resistance, and preliminary results are presented here.  4.2 Materials and Methods  4.2.1 Plant material Two wheat genotypes were used for analysis of cuticle thickness and for TaLTP3 and TaPIP1 expression analysis: ‘Superb’ and DH1. Plants were grown as described in Chapter 2 (section 2.2.1).  144  Figure 4.1 Components of the wheat floret for organ dissection. Total RNA extraction was performed on four organs, namely the glume (G), lemma (L) palea (P), and ovary (O). For microscopy, two regions of the G were isolated, the edge (GE; highlighted in blue) and the centre (GC; highlighted in red), one region of the L (highlighted in yellow) and one region of the P (highlighted in green).  4.2.2 TaLTP3 and TaPIP1 gene expression analysis. Spikelets were collected from ‘Superb’ and DH1 at anthesis, and frozen in liquid nitrogen. For DH1, spikelet organs (glumes (G), lemma (L), palea (P), and ovaries (O)) were also collected and frozen at anthesis (Figure 4.1). Total RNA was extracted from the 145  described tissues according to manufacturers’ instructions (Qiagen RNeasy® Plant Mini Kit with an on-column DNase digestion) and cDNA synthesis was conducted as described in 2.2.5. Primer and probe sequences are presented in Supplementary Figures 4, 5, and 6, for EF1α, TaLTP3, and TaPIP1, respectively. Fold-differences (FD) and standard errors were calculated from CT-values using Qiagen’s REST 2006 software package, where CTvalues were normalized against the housekeeping gene (EF1α).  4.2.3 Microscopy The G, L, P, O and anthers (A) were collected from ‘Superb’ and DH1 at anthesis. For G, L and P, the tissue were cut into 2-5 x 2-5 mm pieces from the center and edge of the glume (GC and GE, respectively), and from the top center of the L or P (Figure 4.1). The tissue was fixed overnight in 2% gluteraldehyde and 0.1 M phosphate buffer, pH 7.2. All steps prior to embedding were performed at room temperature under gently agitation. The tissue was then washed three times in 0.1 M phosphate buffer, pH 7.2, for 10 min each, fixed for 4 h in 1% osmium tetraoxide in 0.1 M phosphate buffer, pH 7.2, followed by three 15 min washes in water. An overnight perfusion with 2% uranyl acetate in water was performed, followed by three 15 min washes in water. The tissue was then dehydrated in a series of increasing ethanol concentrations (30%, 50%, 70%, 70%, 95%, 95%, 100%, 100% and 100%) each for 15 min. Resin (25% (w/v) vinyl-4-cyclohexene dioxide, 15% (w/v) diglycidyl ether of polypropyleneglycol, 65% (w/v) nonenyl succinic anhydride, and 0.01% (w/v) 2-dimethylaminoethanol) infiltration was conducted in a series of ratios of absolute ethanol:resin, first for 4 h with 3:1 (v/v), then overnight at a ratio of 1:1 (v/v) and twice at 3:1 (v/v) for 12 h each. The tissue was then infiltrated with pure resin for three days, 146  replacing with fresh resin twice per day, and then embedded in resin at 70oC for 8 h. Thin (70 nm) and thick (1 µm) sections were prepared with a microtome for transmission electron microscopy (TEM) and confocal microscopy, respectively. Thin sections were stained with lead citrate and thick sections were differentially stained with methylene blueazure A and basic fuchsin.  4.2.4 Recombinant expression and purification of TaLTP3 The sequence for TaLTP3, excluding the signal peptide, was synthesized by Genscript and cloned into a pET32a(+) expression vector (Novagen). with a 17 kD N-terminal tag (composed of an N-terminal thioredoxin (Trx), internal His-tag, a C-terminal S-tag followed by an enterokinase site). The fusion protein rLTP3trx has a predicted molecular weight of 26 kD. The predicted product of the rTrx expression, from the empty pET32a(+) vector, is 20 kD, where the extra 3 kD consists of ‘junk’ sequence from the multiple cloning site downstream of the enterokinase site. The purified plasmid (pET32a-TaLTP3) was provided by Genscript (Figure 4.2A). Both pET32a and pET32a-TaLTP3 were transformed into Novagen’s Rosetta-Gami 2 cells (RG) according to manufacturer’s instructions.  4.2.4.1 Recombinant protein expression Cells for each of pET32a(RG) for Trx-tag (rTrx) expression and pET32a-TaLTP3(RG) for the TaLTP3-trx fusion protein (rLTP3trx) expression were each cultured in 250 mL erlenmeyer flasks with 50 mL LB with 50 µg mL-1 carbenicillin. When an OD600 of 0.8-0.9 was reached, expression was induced with 1 mM IPTG. A total of eight-50 mL 147  reactions were combined, and the 400 mL of cells were collected and spun at 8000 x g for 5 min, resuspended in 40 mL Native Binding Buffer (NBB; 0.5 M NaCl; 20 mM sodium phosphate, pH 7.4), and spun for another 5 min. Cells were resuspended in 36 mL NBB and 4 mL 10x FastBreak (Promega) with 20 µg DNase I, 40 µg RNase A and 8 mg lysozyme. The cells were lysed for 60 min at room temperature under gently agitation, and the cell lysate was pushed through a 22 gauge needle syringe, spun at 8000 x g for 5 min, and supernatant was filtered through a 0.45 µm syringe filter.  4.2.4.2 Recombinant protein purification Optimization of His-tag purification was conducted on 1 mL of the cell lysate, which was loaded onto a 1 mL HisTrapTM HP connected to an ÄKTA purifier 10 FPLC at 4oC (GE Healthcare). The column was washed with 5 mL of NBB, followed by a 40 mL gradient elution with 0 to 500 mM imidazole in NBB (1 mL min-1). Following optimization, up to 50 mL was loaded onto a 1 mL HisTrapTM HP connected to the FPLC at 4oC, washed with 10 mL of NBB with 200 mM imidazole, eluted in 5 mL NBB with 300 mM imidazole. The eluate was diluted to 15 mL with NBB and then concentrated in an Amicon Ultra-15 with a 10 kD molecular weight cut-off by centrifugation at 20oC 3220 x g in a swinging bucket rotor for 30 min. The concentrated sample (approximately 200 µL) was diluted with 1 mL LTP Binding Buffer (LBB; 10 mM MOPS, 8 mM β-mercaptoethanol). The sample was then injected (0.9 mL) onto a HiLoad 16/60, Superdex 75 prep grade size exclusion column connected to the FPLC at 4oC for size exclusion chromatography (SEC) and eluted with LBB (0.3 mL min-1). rTrx and rLTP3trx were eluted at 207 and 359 min, respectively. Various fractions from the 148  different stages of rTrx and rLTP3trx purification were analyzed by SDS-PAGE and Western blotting as described in section 4.2.5.  4.2.4.3 Trx tag removal trial from recombinant TaLTP3 fusion protein rLTP3trx expression was conducted as described in section 4.2.4.1, and purified using ProBondTM Purification System (Invitrogen). A total of 50 mL cells were collected 3 h after induction, washed and resuspended in NBB (with 20 mM imidazole) as described in section 4.2.4, with a final cell lysate volume of 8 mL. The cell lysate was loaded onto a 2 mL ProBond nickel-chelating resin and incubated at room temperature with gentle agitation for 60 min. The unbound proteins were eluted by gravity, and the column was washed by gravity elution twice with 8 mL NBB with 20 mM imidazole, once with 8 mL NBB with 40 mM imidazole, then with 100 mM imidazole. The rLTP3trx was then either digested on-column with enterokinase, or eluted in 2 mL NBB with 250 mM imidazole and followed by post-purification enterokinase digest. For post-column digest, the purified rLTP3trx was digested in 50 µL reactions for 8 and 16 h with 1 U Tag-offTM High Activity rEK (rEK) and 1x rEK buffer (Novagen) at room temperature. For on-column digest, following the 100 mM imidazole wash, the resin was washed with 8 mL LBB and then suspended in 2 mL LBB with 10 µL rEK and 10 µL of 10x rEK buffer. The digest proceeded at room temperature under gentle agitation, and 20 µL aliquots were collected at 0.75, 2, 6, 17 and 24 h intervals. Digested fractions were analyzed by SDS-PAGE and some fractions were also evaluated by Western blotting, using the HRP substrate detection method as described in section 4.2.5.  149  A.  B.  Figure 4.2 Wheat lipid transfer protein 3 sequence and construct designs (page 148). A. The nucleotide (lowercase) and corresponding the protein sequence (uppercase) for TaLTP3 (accession AY22680). The highlighted amino acid sequence was used to develop a rabbit polyclonal antibody (Genscript). The signals peptide sequence is in blue font. B. For the TaLTP3 over-expression and silencing, an expression construct (EC) and a hairpin construct (HC) were designed, respectively. The TaLTP3 sequence for the EC consisted of the coding domain of TaLTP3 from ‘A’. The hairpin sequence for the HC was based on a 27 mer sequence (highlighted in grey in ‘A’). 150  4.2.4.4 Western blotting of recombinant proteins SDS-PAGE gels were stained in Coomasie R-250, or transferred to a 0.2 µm nitrocellulose membrane. Prior to transfer, both the gel and membrane were soaked in Transfer Buffer (NuPAGE® Transfer Buffer (Invitrogen) with 20% methanol) for 15 min, and the transfer was performed at 100 V for 60 min in Transfer Buffer. Immunodetection was conducted using a One-Hour WesternTM Advanced Kit, according to manufacturer’s instructions (GenScript). Each blot was incubated at room temperature for 40 min with 1 µg of the appropriate antibody in 10 mL of buffer. The blot was either developed directly on the membrane using the LumiSensorTM Super Chemiluminescent HRP Substrate (GenScript) or by exposing the membrane to a plastic film for 20 s and then developed according to manufacturers’ instructions (GenScript). Two different antibodies were used for detection: a His-tag rabbit polyclonal antibody (His-pAb) (GenScript) and a polyclonal antibody that was raised in rabbits (GenScript) against a peptide sequence from TaLTP3 (LTP-pAb) (LNGLARSSPDRKIAC; Figure 4.2A).  4.2.5 LTP binding and antifungal assays The purified rLTP3trx and rTrx were quantified by Bradford activity assay (BioRad), and diluted to a concentration of 10 µM each in LBB. An LTP binding assay was performed (adapted from Zachowski et al., 1998), where different concentrations (0 to 15 µM final concentrations) of the fatty acid analog D3821 (4,4-difluoro-5,7-dimethyl-4-bora3a,4a-diazas-indacene-3-hexadecanoic acid; Invitrogen) from a 100-µM stock solution in LBB with 1% ethanol to 100 µL protein in a 96-well plate. Control reactions were also run, 151  with 1 µM BSA and 10 µM lysozyme, both in LBB, and a blank reaction (LBB). The excitation wavelength employed was 490 nm and the emission spectrum was recorded at 520 nm on a BioTek Gen5. Antifungal assays were performed using a mycelium growth inhibition test (as described by Sun et al. (2008) and a spore germination inhibition test. For the mycelium growth inhibition test, 1 µL of macroconidia in water (300,000 macroconida mL-1) was used to inoculate the center of a 100-mm petri dish with 20 mL potato dextrose agar (PDA) with supplemented 50 µg mL-1 spectromycin sulfate. After two days of growth at room temperature, three 0.5 cm discs of Whatman Filter paper No.1 were placed 1 cm from the growing hyphae. A total of 100, 150, 200, 250 or 300 µL of 10 µM rTrx or rLTP3trx was pipetted onto the discs, 25 µL at a time and a 90 min period was provided for sample absorption on to the discs between each application. A control sample was pipetted onto the third disc (50 µg of the antimicrobial peptide MsrA2, which was previously reported to inhibit mycelium growth of certain F. graminearum strains (Badea et al., 2009). Mycelium growth was subsequently monitored at room temperature for 24 h. For spore germination inhibition tests, 100 µL of F. graminearum spores (300,000 macroconidia mL-1) were spread onto petri dishes of PDA with supplemented 50 µg mL-1 spectromycin sulfate. Three discs were immediately placed onto the media, and a total of 100, 150, 200, 250 or 300 µL of 10 µM rTrx or rLTP3trx was pipetted onto the discs as described above. The control reaction on the third disc consisted of 50 µg 10R, an antimicrobial peptide previously reported to inhibit spore germination of select F. graminearum strains (Badea et al., 2009). The petri dishes were incubated at room temperature and spore germination was monitored for 24 h. In order to determine whether 152  rLTP3trx activity remained consistent over the incubation period, protein samples were also incubated at room temperature for 24 h, after which a fatty acid binding assay was conducted as described in above.  4.2.6 Transgenic modification of TaLTP3 expression in DH1 and ‘Superb’ An expression cassette designed for RNAi-mediated silencing of TaLTP3 (hairpin construct; HC) and another for over-expression of TaLTP3 (expression construct; EC) were constructed as described in Figure 4.2. The TaLTP3 sequence for the EC consisted of the coding domain of TaLTP3. The hairpin sequence for the HC was based on a 27 mer sequence with high GC-content for the design of hairpin loop sequence using Integrated DNA Technologies SciTools RNAi Design (http://www.idtdna.com/Scitools/Applications/RNAi/RNAi.aspx?source=menu). Both the TaLTP3 and hairpin sequences were synthesized by synthesized by Geneart with appropriate adapter sequences for direct cloning with MultiSite Gateway® Pro 3.0 system. The EC and HC was constructed into the pDEST vector from which it excised and is composed of an actin promoter sequence, followed by the TaLTP3 sequence for overexpression or the hairpin sequence for TaLTP3 silencing, and a nos1 terminator sequence. The EC and HC were introduced into microspores of ‘Superb’ and DH1, respectively, using cell penetrating peptides by E. Amundsen. Details of the transformation procedure are proprietary information (F. Eudes). Plantlets were colchicine treated by M. Fast for double haploid production. The seed produced from the resulting plants can be seeded and the leaf tissue screened by qPCR for changes in TaLTP3 expression as described in section  153  4.2.1, followed by FHB-disease assays by spray inoculation as described in Chapter 3 (section 3.2.3).  4.3 Results  4.3.1 Tissue-specific expression of TaLTP3 and TaPIP1 in DH1 No differences in TaLTP3 transcript accumulation were observed between DH1 and ‘Superb’ (Table 4.1). TaPIP1 transcript accumulation was also examined, in order to determine whether the constitutively higher TaPIP1 and TaLTP3 expression that was observed in DH1 in the microarray experiment described in Chapter 2 occurred in the same organs. qPCR results demonstrated higher TaPIP1 transcript accumulation in DH1 vs ‘Superb’, and also showed higher and lower TaPIP1 accumulation in the palea (P) and ovaries (O), respectively, compared with accumulation in the spikelet of DH1. Similar expression patterns in the spikelets of DH1 were observed with the TaLTP3 primer/probe set.  4.3.2 Cuticle thickness Measurement of cuticle thickness by TEM proved to be a difficult task, yielding inconsistent results. Sections were prepared only for GE and GC, for preliminary investigation; however, as a result of the problems encountered, the remaining tissue has not been evaluated. Some of the challenges faced included: (1) difficulties infiltrating fixed tissue sufficiently for the preparation of thin sections; (2) irregularities in the cuticle thickness from spikelet to spikelet, and also within a given section; (3) difficulties 154  acquiring a consistent sectioning plane. The first major challenge described did not become apparent until thin sections were prepared, where the cells would ‘fall out’ (Figure 4.3A) of the section, although the cell wall remained attached to the resin. The most feasible explanation for this phenomenon is that the tissue was not completely infiltrated with the resin. In case this was a result of incomplete dehydration of the tissue prior to infiltration, fresh plant material was grown and new GE, GC, and L, tissue was fixed and embedded in resin. In this case, an initial infiltration at 3:1 (alcohol:resin) was conducted and the final infiltration in pure resin proceeded for three days, changing the resin twice per day, as described in section 4.2.2. This differed from the original protocol, where the first 3:1 infiltration was omitted and the final infiltration in pure resin proceeded for only 24 h. Unfortunately, the additional steps were unsuccessful in preventing the ‘falling out’ phenomenon, but it was possible to proceed with TEM, since the cell wall and cuticle layer remained embedded in the resin. As noted above, cuticle thickness was highly variable, both between spikelets and within a section. The spikelet to spikelet variation may be, at least in part, attributed to the inconsistency of the sectioning plane. An image of the cuticles from ‘Superb’ and DH1 is presented in Figure 4.3B and C, respectively. Thick sections for confocal microscopy differentially stained with a combination of methylene blue-azure A and basic fuchsin (stains cellulose walls and cuticle red and lignified walls green) are currently being prepared for further investigation.  155  Table 4.1 Tracking TaLTP3 and TaPIP1 expression within the wheat spikelet. qPCR was conducted on cDNA from RNA collected from spikelets of untreated wheat spikes from (A) microarray experiment, where plants were incubated in the mist-irrigated greenhouse for 24 h prior to sampling and from (B) spikelets and spikelet organs of untreated wheat spikes that were not exposed to high humidity. CT-values from amplification and hybridization with The TaLTP3 primer and probe set 2 (Figure A5) and TaPIP1 primer and probe set (Figure A6) were each normalized against the housekeeping gene, EF1α (Figure A4). Positive and negative FD values indicate up- and downregulation in the given treatment comparison. TaLTP3 Comparison  TaPIP1  RNA  FD  stdev  FD  stdev  DH1 vs 'Superb' spikelet  A  +1.1  0.3  +1.7  0.3  DH1 vs 'Superb' spikelet  B  +1.3  0.3  +2.7  0.3  DH1 glume vs spikelet  B  +1.2  0.3  +1.2  0.2  DH1 lemma vs spikelet  B  +1.2  0.3  -1.2  0.2  DH1 ovary vs spikelet  B  -2.1  0.2  -5.0  0.3  DH1 palea vs spikelet  B  +2.6  0.3  +1.8  0.2  4.3.3 Purification and binding activity assay for recombinant LTP3trx Results from initial purification of rLTP3trx demonstrate that the Trx-tag cannot be removed from the fusion protein without simultaneously losing the LTP. The His-tagged rLTP3trx recombinant protein has a predicted molecular mass of 26 kD, and both oncolumn and post-purification digests yielded two products, one with an apparent molecular mass of 26 kD, and the other with a mass of 17 kD (Figure 4.4). Furthermore, both digest products were co-eluted from the on-column digest, indicating that both products have an 156  affinity for nickel ions, suggesting that both products still possess a His-tag. This would be consistent with an incomplete digest where the 26 kD product corresponds to the uncleaved fusion protein, and the 17 kD product corresponds to the Trx-tag with TaLTP3 removed. No product was observed with a mass of 9 kD, suggesting that the purified TaLTP3 was insoluble or unstable.  Figure 4.3 TEM of GC from ‘Superb’ and DH1. A. The ‘falling out’ phenomenon can be observed in this section of ‘Superb’. The black arrow indicates a white space where the cell should be. The cell wall (CW) and cuticle (C) remained attached to the resin. Guard cells were observed in this image, as indicated by the white arrows. Magnification x 1500. B. and C. Examples of good sections of ‘Superb’ and DH1, respectively, where the cells remained attached to the resin, and the cuticle layer (CL), cuticle proper (CP), and epicuticular wax (EP) can be clearly distinguished. Magnification x 10,000. 157  rLTP3trx was therefore directly purified by FPLC, and a preliminary gradient elution with an increasing concentration of imidazole (0 to 500 mM) from a 1 mL HisTrap nickel column established that the fusion protein can be eluted off the column at 250 mM imidazole (data not shown). A stepwise elution was then performed to maximize both purity and yield, and Western blotting confirmed elution of rLTP3trx, as well as rTrx, at 300 mM imidazole. Since the desired recombinant proteins were co-eluting with degradation products (Figure 4.5), the eluted products were further fractionated by size exclusion chromatography (SEC) with a Superdex 75 column. rTrx was co-eluted with some lower-molecular weight products, but rLTP3trx was free of detectable contaminants following SEC. The product identity was confirmed by Western blotting with both anti-His and anti-TaLTP3 polyclonal antibodies. A lipid binding assay was performed in order to test rLTP3trx activity. The fatty acid analogue D3821 contains a fluorescent group that emits a strong fluorescence in nonaqueous environments, such as the fatty acid binding cavity of LTP molecules (Invitrogen). This approach has previously been utilized to demonstrate LTP binding activity by other authors (Zachowski et al., 1998; Sun et al., 2008). The increase in fluorescence with increasing concentrations of D3821 incubated with rLTP3trx, but not with Trx, demonstrates successful binding activity of rLTP3trx (Figure 4.6A).  158  Figure 4.4 Recombinant LTP3trx digest trial. A. rLTP3trx purified with a ProBond nickel-chelating resin (lane 1) was digested for 6 h (lane 2) or 18 h (lane 3). Gel was stained with Sypro Ruby. B. Whole cell lysate of pET32a-LTP3(RG) collected 3 h after IPTG induction (IL) (lane 1), IL was digested with rEK for 6 h (lane 2), and purified rLTP3trx digested with rEK for 6 h (lane 3), were resolved by SDS-PAGE, transferred to a 0.2 µm nitrocellulose membrane, and immunodetection with the LTP-pAB was conducted directly on the membrane. C. IL (lane 10), was loaded (8 mL) onto ProBond nickelchelating 2 mL resin, washed three times with NBB, and once with LBB. The resin was then resuspended in 2 mL LBB with 20 U Tag-offTM High Activity rEK (rEK). Samples were collected from the suspension at 0.75 h (lane 1), 2 h (lane 2), 6 h (lane 3), 17 h (lane 4), 24 h (lane 5), and then the resin washed with NBB with 100 mM imidazole (lane 6), 250 mM imidazole (land 7), and 500 mM imidazole. Gel was stained with Coomasie Blue.  159  Figure 4.5 160  Figure 4.5 Purification of recombinant TaLTP3trx and Trx (page 160). A. rTrx purification by affinity chromatography using a HisTrapTM HP column (top chromatogram), and fraction 2 (F2) was further resolved by SEC (bottom chromatogram). rTrx was eluted in F4 by SEC (0.3 mL min-1) a retention time of 207. Uninduced (UT) and induced (IT) whole cell lysate of pET32a(RG), the flow through (FT) from affinity chromatography and selected fractions were resolved by SDS-PAGE (stained in Coomassie blue; top image) and Western blotting with a His-pAb developed on a plastic film (bottom image) was used to track purification. B. Similarly to rTrx purification, rLTP3trx was purified affinity chromatography (top chromatogram), and fraction 2 (F2) was resolved by SEC (bottom chromatogram). rLTP3trx was eluted in F6 by SEC (0.3 mL min-1) a retention time of 359. Uninduced (UL) and induced (IL) whole cell lysate of pET32aTaLTP3(RG), the FT and selected fractions were resolved by SDS-PAGE (top image), and Western blotting was performed using His-pAb (middle image) and LTP-pAb (bottom image) developed on a plastic film.  161  A.  B.  Figure 4.6  162  Figure 4.6 TaLTP3 binding and inhibition assays (page 162). A. Binding assay with the fatty acid analogue D3821 (4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaz-indacene-3hexadecaonoic acid) which emits fluorescence when captured in a non-aqueous environment. An increase in fluorescence was observed with increasing concentrations of D3821 applied to rLTP3trx and rLTP3trx which has been incubated at room temperature for 24 h (rLTP3trx(RT). The fluorescence for rLTP3trx and rLTP3trx(RT) for > 2 µM D3821 continued; however, the instrument was unable to provide a reading because the detector was ‘overflowed’. The limited fluorescence emitted from rTrx did not exceed fluorescence emitted by the blank reaction, LBB. B. F. graminearum mycelium (left) and spore germination (right) inhibition tests with 50 µg 10R (1), 50 µg MsrA2 (2), 100 µL of 10 µM rTrx (3), and 100 µL of 10 µM rLTP3trx (4). Similar results to those observed in 3 and 4, were also observed at all molar quantities of rTrx and rLTP3trx evaluated: 150 µL, 200 µL, 250 µL, and 300 µL of 10 µM protein (data not shown). Only MsrA2 showed antifungal activity towards F. graminearum, and both mycelium growth and spore germination were affected. Although the photograph was not able to clearly capture MsrA2 mycelium inhibition, the results were quite evident by visual inspection: the hypha extended over all the other discs, except for disc 2, where the mycelium clearly grew around the disc.  4.3.4 rLTP3trx-F. graminearum inhibition assays It was previously demonstrated that some wheat LTPs can inhibit mycelium growth of F. graminearum in in vitro assays (Sun et al., 2008). Using the same approach in the 163  current study, I found that rLTP3trx does not exhibit antifungal activity towards the growing mycelium or germinating spores of F. graminearum strain GZ3639 (Figure 4.6B).  4.3.5 Transgenic modification of TaLTP3 expression in DH1 and ‘Superb’ A total of seven and two plantlets were produced from the DH1-HC and ‘Superb’-EC transformation, respectively, but only two DH1-HC and one ‘Superb’-EC transformant survived colchicine treatment. Seed is not yet available.  4.4 Discussion  4.4.1 Validation of TaLTP3 and TaPIP1 transcript accumulation and evaluation of organ-specific expression in DH1 In the microarray experiment (Chapter 2) both TaLTP3 and TaPIP1 showed constitutively higher transcript accumulation in untreated DH1 spikelets compared with its susceptible parent ‘Superb’. qPCR was used here to confirm this expression pattern. qPCR was conducted both on RNA collected during the microarray experiment (spikelets of untreated wheat spikes incubated under high humidity in the mist-irrigated greenhouse) and on RNA collected from spikelets of untreated spikes that were not exposed to high humidity (Table 4.1). The constitutive higher TaPIP1 expression in DH1 compared with ‘Superb’ was substantially higher (259 FD) on the Affymetrix gene chip compared with qPCR results (Table 4.1). By contrast, the qPCR reaction conducted on cDNA synthesized from the same RNA collected for the microarray experiment, showed only a 1.7 FD higher transcript accumulation in DH1 spikelets compared with ‘Superb’. A slightly greater 164  difference was observed from RNA collected from spikelets grown under normal humidity, where transcript accumulation was 2.7 FD higher in DH1 compared with ‘Superb’. Thus, the constitutively higher TaPIP1 transcript accumulation in DH1 spikelets was validated by qPCR, but on a much lower scale than observed in the microarray experiment. Higher TaLTP3 transcript accumulation in DH1 vs ‘Superb’, on the other hand was not validated. LTPs are highly conserved sequences, and while steps were taken to maximize primer and probe specificity in the qPCR design (Figure A5), the probability of cross-reactivity remains high. By contrast, the Affymetrix gene chip contains multiple probes which would increase the specificity of a specific LTP over the gene family. No other LTPs genes were shown to be constitutively over-expressed in DH1 vs ‘Superb’ in the microarray experiment (Table 2.2). Furthermore, since the FD in the microarray experiment was so high for this gene (> 30 FD), and since it was not only observed in the uninoculated controls (as shown in Chapter 2) but also in elicitor treated-DH1 compared with elicitor treated-‘Superb’ (where differences ranged from 30 to 100 FD; data not shown), it is unlikely that the results of the microarray experiment were artifactual. An effort to determine in which organ(s) TaLTP3 expression occurred, and also to observe whether or not this coincided with TaPIP1 expression, transcript accumulation of both genes was tracked in specific organs, namely the glumes (G), lemma (L), palea (P), and ovaries (O). I postulated that by tracking organ-specific expression, some insight into the putative functions of these genes as they pertain to FHB-resistance may be revealed. For instance, if high levels of TaLTP3 occurs in any of the described tissues, and if TaLTP3 expresses antifungal activity, this could contribute to FHB-resistance; if expression occurs in outer tissues of the spikelet (G or L), then putative antifungal activity 165  could contribute more specifically to Type I resistance. If both TaLTP3 and TaPIP1 expression occurs in G, expression of these genes could result in enhanced cuticle deposition, since some LTPs and PIPs have been implicated in cuticle thickening or deposition (Hanba et al., 2004; Samuels et al., 2008). qPCR with the selected TaLTP3 and TaPIP1 primers and probes suggest that transcript accumulation were highest in the P and lowest in the O of DH1. Since the primer/probe specificity for TaLTP3 has not been confirmed, the biological significance of these results remains elusive.  4.4.2 Measurement of cuticle thickness in DH1 compared with ‘Superb’ To determine whether or not the constitutively higher transcript accumulation of TaLTP3 has an impact on cuticle thickness in DH1, I attempted to measure cuticle thickness by quantitative analysis of TEM sections. Unfortunately, technical challenges in the experimental design were encountered, and more work will be necessary to address this question. It may be possible to overcome some of these challenges by evaluating a large number of replicates. An analysis of cuticle thickness in ‘Superb’ and DH1 compared with the transgenic lines (‘Superb’-EC and DH1-HC) will also be necessary to address the question of whether TaLTP3 expression quantitatively influences cuticle deposition. It would also be worthwhile to evaluate cuticle composition in the different genotypes, since this may also affect resistance. The types of waxes and fatty acids present in the cuticle can affect a resistance or susceptible response to different plant pathogens (Bessire et al., 2007; Lee et al., 2009; Curvers et al., 2010). Leaf cuticle waxes have been known induce spore germination (Podila et al., 1993) and/or appresorium formation (Uchiyama et al., 1979; Uchiyama and Okuyama, 1990; Podila et al., 1993) of various pathogens, including 166  the rice blast fungus Pyricularide oryzae and the causative agent of anthracnose in avocado plants, Colletotrichum gloeosporioides.  4.4.3 TaLTP3 does not exhibit antifungal activity towards F. graminearum Antifungal properties of recombinant TaLTP3 (rLTP3trx) were evaluated by inhibition assays of F. graminearum spore germination and mycelial growth. Using a series of rLTP3trx concentrations, no adverse effects were observed in either type of assay, suggesting that this LTP does not exhibit antifungal properties. It should be noted that some LTPs have been shown to exhibit antimicrobial properties towards some genera of fungi, but not others (Sun et al., 2008). Furthermore, the antimicrobial properties of the peptides LR10 and MsrA2, which have been shown to inhibit mycelia growth and/or spore germination in a variety of Fusarium species, were found to be strain-specific; even within F. graminearum species, some strains were unaffected by these peptides (Badea et al., 2009). Since the antifungal assays in the current study were conducted using a single F. graminearum strain, namely GZ3639, the possibility that these results are exclusive to this particular strain cannot be eliminated until these studies have been repeated with different strains and/or species.  4.5 Conclusions  The premise of these experiments was that TaLTP3 might play a role in the Type I resistance mechanism of DH1. However, the results have provided little support for such a role. It is therefore possible that TaLTP3 does not, in fact, play a role in FHB-resistance, 167  since the hypothesis presented in Chapter 2 was based on inferences from comparative transcriptomics data. Nevertheless, recent studies by T. Ouellet and colleagues (Agriculture and Agri-Food Canada, Ottawa) suggest that TaLTP3 gene expression is highly correlated with the 5A QTL associated with Type I resistance to FHB in wheat cultivars ‘Wuhan’ and ‘NuyBai’, and in a series of derived lines (personal communication). Interestingly, no QTLs for resistance have been identified specifically in DH1 (Eudes et al. unpublished data). It is nonetheless possible that TaLTP3 is involved in the mechanism of resistance in wheat genotypes with the 5A QTL and also in DH1, if the gene(s) of interest associated with the 5A QTL interact with TaLTP3 in mediating resistance. The ambiguous results of my experiments do not conclusively eliminate a role for TaLTP3 in FHB-resistance; additional studies will be required to address this question thoroughly. It will be necessary to validate the constitutively higher transcript accumulation of TaLTP3 in DH1 compared with ‘Superb’. This information could also provide some insight into the broader biological role of TaLTP3. F. graminearum spore germination and mycelium growth inhibition assays have suggested that TaLTP3 does not have any direct antifungal properties towards Fusarium, but it will be necessary to extend these results using additional F. graminearum strains and Fusarium species. In order to gain some insight into TaLTP3’s possible role in cuticle deposition, improved methods will have to be developed that allow cuticle thickness and composition to be assessed in a consistent fashion. Since the biological role of LTPs in plants is not well defined, it is still conceivable that this protein may participate in conferring FHB-resistance through a mechanism that we are not yet aware of. Analysis of the impact of transgenic modification of the expression of 168  this gene on disease outcomes should provide some insight into whether or not this protein can, in fact, impact resistance. Furthermore, these studies can be complemented with Fusarium leaf colonization assays to determine whether the change in TaLTP3 expression can impact germination on wheat leaves, and whether cuticle composition or thickness has been affected.  169  5 Conclusions  While the molecular mechanisms of FHB-resistance are poorly understood, the physiological mechanisms are more clearly defined, particular in the case of Type II resistance. Studies using a Type II resistant background inoculated with trichotheceneproducing Fusarium species (Kang and Buchenauer, 2000a), and studies using susceptible genotypes inoculated with trichothecene non-producing F. graminearum (Jansen et al., 2005), have demonstrated that resistance to disease spread is associated with cell wall thickening at the rachis node of the infected spikelet, thereby preventing the pathogen from invading the rachis. Less is known about the mechanisms of Type I resistance. In theory, Type I resistance could be conferred by the presence of structural features at the spikelet surface, such as thick cuticles or cell walls, that would block or slow penetration of the fungus. Alternatively, the host could reduce the build-up of fungal biomass available for host invasion by producing antimicrobial proteins that would inhibit spore germination or hyphal growth. It is interesting that Type II resistance, which has a well understood physiological mechanism of resistance, is tightly correlated with the presence of the 3BS QTL, whereas no single QTL has been consistently correlated with Type I resistance, whose physiological mechanism is less well defined. Based on the available information, I proposed at the outset of this study that the mechanisms of Type I resistance would be variable and genotype-dependent, and that Type II resistance involves a very specific molecular response to Fusarium species. Furthermore, since Type II resistance can be phenocopied in 170  otherwise susceptible wheat inoculated with trichothecene non-producing Fusarium strains, I hypothesized that the specific pathway(s) that are upregulated during a Type II resistance response interact in some way with trichothecenes to suppress their effectiveness. In Chapter 2, a functional genomics study using both differential transcriptomics and proteomics was used to evaluate this hypothesis. The systemic response in uninoculated wheat spikes primed with different elicitors of FHB (FgTri5+, FgTri5-, and DON) was compared in three wheat genotypes (susceptible Canadian cv. ‘Superb’, Type I resistant DH1, and Type II resistant DH2). The results led to the development of three new hypotheses: (1) Type II resistance is mediated by JA-signalling, a response that is inhibited by trichothecenes in genotypes that do not display the 3BS QTL for resistance to disease spread, (2) Type I resistance can be systemically induced in DH1, whereas Type II resistance is a local response conferred by the 3BS QTL, and cannot be systemically induced in DH2, and (3) Type I resistance in DH1 involves a combination of structural features and antifungal activities of proteins that slow fungal penetration. The first of these new hypotheses was an extension of the original hypothesis, where it was proposed that the specific pathway(s) that are up-regulated interact in some way with trichothecenes to minimize their impact. An interaction was observed between the Type II resistant response and trichothecenes, and involved the up-regulation of a specific pathway, namely JA-signalling. Differential transcriptomics data revealed up-regulation of JA biosynthesis/responsive genes in DH2 elicited by FgTri5+. While, DH1 and ‘Superb’ also showed up-regulation of similar genes, this occurred only under conditions where these two genotypes would phenocopy Type II resistance, namely in response to FgTri5-.  171  Furthermore, DON induced down-regulation of genes from this pathway in ‘Superb’ and DH1, but not in DH2. In order to test this hypothesis, the role of JA signalling was evaluated in Chapter 3. The hormone silencing studies suggest that JA-signalling is important in Type I resistance, but point inoculation studies will be necessary to determine whether or not it also plays a role in Type II resistance. Hormone quantification did, however, show that JA constitutively accumulates in higher quantities in the Type II resistant background DH2. It is not known how this signalling pathway would lead to a resistant outcome, but it is known that JA signalling can be a positive regulator of the lignin biosynthesis pathway (Xue et al., 2008). Furthermore, increasing evidence suggests that cell wall lignification at the rachis node is an important feature of Type II resistance. It is also likely that cell wall lignification at the spikelet surface would improve Type I resistance, since Fusarium infects by direct penetration of the epidermis. Interestingly, I observed that the lignin biosynthesis pathway was strongly up-regulated by FHB-elicitors in the systemic tissues of DH1 in the differential transcriptomic study (Chapter 2). Other hormone signalling pathways were also investigated in the hormone silencing experiment, and the FHB disease assay revealed a complex interaction between hormone signalling and resistance vs susceptible outcomes. The data suggest that SA and ET signalling have a positive and negative effect, respectively, on resistance to initial infection in Type II resistant DH2; whereas, no effect of either hormone pathways was observed on resistance in the DH1 background. In the susceptible genotype, neither JA nor SA signalling appeared to have an impact on resistance, but ET signalling was shown to reduce susceptibility to initial infection—the opposite of what was observed in DH2 in this 172  experiment and also in the susceptible wheat cv. Bobwhite in an experiment conducted by Chen and colleagues (2009). Perhaps, ET-signalling only leads to susceptibility when it occurs in conjunction with increased SA signalling. Future studies in silencing multiple pathways simultaneously in wheat, as was recently conducted in Arabidopsis (Makandar et al., 2010), should help to elucidate the role of cross-talk in these interactions. It was also interesting that silencing of the SA-signalling pathway was shown to have an adverse impact on resistance to initial infection in DH2, but not in Type I resistant DH1. The wild-type DH2, which has a good Type II resistance, also has a moderate Type I resistance. Together, these data suggest that not only are the mechanisms of Type I resistance genotype-dependent, as proposed in the initial hypothesis presented in Chapter 1, but so are the mechanisms of susceptibility. The priming experiment in Chapter 3 demonstrated that systemic resistance can be improved by priming with an FHB elicitor in DH1, and not in DH2. These results support the second hypothesis proposed in Chapter 2. Interestingly, while FgTri5- priming improved resistance in DH1, the opposite effect was observed in ‘Superb’. These results, together with the hormone silencing data, demonstrate the complexity of the FHB interaction in wheat, and provide additional support to the first part of the original hypothesis presented in Chapter 1; i.e. that the mechanisms of resistance are genotypedependent. Future priming studies and hormone silencing experiments using a wider range of plants, with different backgrounds of Type I or Type II resistance, will be valuable in further testing this hypothesis. The third hypothesis presented in Chapter 2, states that Type I resistance in DH1 is conferred by combination structural features and antifungal activities of proteins that 173  reduces or inhibits fungal penetration. The functional genomics experiment revealed constitutively higher expression of two genes of interest, namely TaPIP1 and TaLTP3, in the spikelets of untreated spikes of DH1 compared with its susceptible parent ‘Superb’. Since fungal treatments (FgTri5+ and FgTri5-) induced up-regulation of lignin biosynthetic genes, and since aquaporins can transport both water and hydrogen peroxide, increased levels of TaPIP1 in DH1 may facilitate accumulation of H2O2 at the cell wall for lignification, thus providing additional physical protection against the invading fungus. TaLTP3 may be involved in either directly affecting the pathogen through its potential antifungal properties, or may contribute, together with TaPIP1, to enhance cuticle deposition, which would provide a protective barrier against pathogen invasion. In Chapter 4, the putative roles for TaLTP3 in FHB-resistance were investigated. Antifungal assays did not reveal any antimicrobial activities of TaLTP3 towards F. graminearum strain GZ3639, and the comparisons of cuticle thickness in the glumes of ‘Superb’ vs DH1 by TEM was inconclusive. More work will be necessary to determine the putative role of TaLTP3 and/or TaPIP1 in FHB-resistance. The most crucial experiment will be to assess the impact of modified expression of these genes on disease outcomes. If expression of these genes does in fact affect FHB-resistance, then it would be worthwhile to further pursue the studies of cuticle thickness or composition in DH1 compared with ‘Superb’. Additional studies to investigate putative FHB-elicited changes in cell wall lignification of DH1 would also provide insights into the mechanisms of Type I resistance in DH1. In summary, results from Chapters 2 and 3 support the original hypothesis that the mechanisms of resistance are genotype-dependent, and also suggest that the mechanisms of 174  susceptibility are also genotype-dependent. Furthermore, the JA signalling pathway was implicated in FHB-resistance. It is not yet clear whether this pathway is involved in both Type I and Type II resistance, and how SA and ET signalling interact with JA-signalling in conferring different types of resistance. The first hypothesis presented in Chapter 2, suggests that Type II resistance is conferred by JA-signalling, and that trichothecenes inhibit this response in other genotypes. If JA-signalling is also important in Type I resistance, as is suggested in Chapter 3, trichothecene-mediated suppression of JAsignalling would not have any impact on Type I resistance since trichothecene biosynthesis does not occur until after initial infection has been established. The second hypothesis presented in Chapter 2, states that Type I resistance can be systemically induced in DH1, but not in DH2, and results from the priming experiment Chapter 3 support this hypothesis. The next step will be to determine whether or not these outcomes can be observed in different Type I and Type II resistant backgrounds. More work will be necessary to evaluate the third hypothesis presented in Chapter 2, which states that Type I resistance in DH1 involves a combination of structural features and antifungal activities of proteins that slow fungal penetration. Based on all of my results, I have proposed a model for the molecular basis of FHBresistance in wheat (Figure 5.1). In a susceptible interaction, the Fusarium spores germinate and the hyphae easily penetrate the surface of spikelet. In some relatively susceptible cultivars, such as ‘Superb’, this penetration can be suppressed by ET signalling; in other backgrounds, such as ‘Bobwhite’ or DH2, this ease of penetration is actually enhanced by ET signalling. These genotypic differences are likely mediated by cross-talk with other hormone signalling pathways. Upon spikelet invasion, DON synthesis begins, 175  and as this metabolite accumulates, it inhibits a JA signalling response that would normally up-regulate lignin production for cell wall strengthening at the rachis node. Suppression of the wall strengthening response ultimately results in hyphal penetration of the rachis. In a Type I resistant interaction, spore germination or mycelial growth may be inhibited by antimicrobial peptides or proteins (AMPs). Upon recognition of the presence of Fusarium, JA biosynthesis is induced, and this may lead to lignin biosynthesis and subsequent lignification of the glume or lemma, ultimately inhibiting fungal penetration. Penetration may be also be inhibited by the structure or composition of the cuticle. SA signalling may also improve Type I resistance in some genotypes, possibly by inducing a hypersensitive response which would prevent the fungus from establishing initial infection during the biotrophic phase of disease progression. In a situation where the fungus does infect the spikelet, DON production initiates the necrotrophic phase of disease progression and also leads to inhibition of JA accumulation as described in the susceptible interaction. By contrast, in a Type II resistant interaction, the 3BS QTL would over-ride the DONmediated inhibition of JA biosynthesis, and cell wall lignification at the rachis node would prevent the fungus from invading the rachis.  176  Figure 5. Model for molecular mechanisms of FHB defence response 177  Bibliography  Abreu, M.E., and Munné-Bosch, S. 2009. Salicylic acid deficiency in NahG transgenic lines and sid2 mutants increases seed yield in the annual plant Arabidopsis thaliana. J Exp Bot 60:1261-1271. Adams, D.O., and Yang, S.F. 1977. Methionine metabolism in apple tissue: implication of S-adenosylmethionine as an intermediate in the conversion of methionine to ethylene. Plant Physiol 60:892-896. Adams, D.O., and Yang, S.F. 1979. Ethylene biosynthesis: Identification of 1aminocyclopropane-1-carboxylic acid as an intermediate in the conversion of methionine to ethylene. Proc Natl Acad Sci USA 76:170-174. Alexander, N.J. 2008. The TRI101 story: engineering wheat and barley to resist Fusarium head blight. World Mycotoxin J 1:31-37. Alexander, N.J., Hohn, T.M., and McCormick, S.P. 1997. Molecular characterization of TRI12 which encodes an apparent transport protein involved in trichothecene production by Fusarium sporotrichioides. Cereal Res Commun 25:347-348. Alexander, N.J., McCormick, S.P., and Hohn, T.M. 1999a. TRI12, a trichothecene efflux pump from Fusarium sporotrichioides: Gene isolation and expression in yeast. Mol Gen Genet 261:977-984. Alexander, N.J., McCormick, S.P., and Ziegenhorn, S.L. 1999b. Phytotoxicity of selected trichothecenes using Chlamydomonas reinhardtii as a model system. Nat Toxins 7:265-269. Alonso, J.M., Hirayama, T., Roman, G., Nourizadeh, S., and Ecker, J.R. 1999. EIN2, a bifunctional transducer of ethylene and stress responses in Arabidopsis. Science 284:2148-2152. Anand, A., Zhou, T., Trick, H.N., Gill, B.S., Bockus, W.W., and Muthukrishnan, S. 2003. Greenhouse and field testing of transgenic wheat plants stably expressing genes for thaumatin-like protein, chitinase and glucanase against Fusarium graminearum. J Exp Bot 54:1101-1111.  178  Arseniuk, E., Góral, T., and Czembor, H.J. 1993. Reaction of triticale, wheat and rye accessions to graminaceous Fusarium spp. infection at the seedling and adult plant growth stages. Euphytica 70:175-183. Backhouse, D., Abubakar, A.A., Burgess, L.W., Dennis, J.I., Hollaway, G.J., Wildermuth, G.B., Wallwork, H., and Henry, F.J. 2004. Survey of Fusarium species associated with crown rot of wheat and barley in eastern Australia. Australas Plant Pathol 33:255-261. Badea, A., Eudes, F., Graf, R., Laroche, A., Berg, A.E., and Misra, S. 2009. In vitro evaluation of antimicrobial peptides against Fusarium species. Can J Plant Sci 89:739-743. Bai, F., Liu, S., and Witzmann, F.A. 2005. A de-streaking method for two-dimensional electrophoresis using the reducing agent tris(2-carboxyethyl)-phosphine hydrochloride and alkylating agent vinylpyridine. Proteomics 5:2043-2047. Bai, G.-H., Desjardins, A.E., and Plattner, R.D. 2002. Deoxynivalenol-nonproducing Fusarium graminearum causes initial infection, but does not cause disease spread in wheat spikes. Mycopathologia 153:91-98. Bai, G.-H., Chen, L.-F., and Shaner, G.E. 2003. Breeding for resistance to fusarium head blight of wheat in China. Pages 296-317 in: Fusarium Head Blight of Wheat and Barley. Eds. K.J. Leonard and W.R. Bushnell. The American Phytopathological Society, St. Paul, Minnesota. Bai, G.H., Plattner, R., Desjardins, A., and Kolb, F. 2001. Resistance to Fusarium head blight and deoxynivalenol accumulation in wheat. Plant Breed 120:1-6. Baker, S.E., Kroken, S., Inderbitzin, P., Asvarak, T., Li, B.Y., Shi, L., Yoder, O.C., and Turgeon, B.G. 2006. Two polyketide synthase-encoding genes are required for biosynthesis of the polyketide virulence factor, T-toxin, by Cochliobolus heterostrophus. Mol Plant-Microbe Interact 19:139-149. Baulcombe, D.C. 1999. Fast forward genetics based on virus-induced gene silencing. Curr Opin Plant Biol 2:109-113. Beckers, G.J.M., and Spoel, S.H. 2006. Fine-tuning plant defence signalling: salicylate versus jasmonate. Plant Biol 8:1-10.  179  Bell, E., Creelman, R.A., and Mullet, J.E. 1995. A chloroplast lipoxygenase is required for wound-induced jasmonic acid accumulation in Arabidopsis. Proc Natl Acad Sci USA 92:8675-8679. Beremand, M.N. 1987. Isolation and characterization of mutants blocked in T-2 toxin biosynthesis. Appl Environ Microbiol 53:1855-1859. Beremand, M.N., Desjardins, A.E., Hohn, T.M., and Vanmiddlesworth, F.L. 1991. Survey of Fusarium sambucinum (Gibberella pulicaris) for mating type, trichothecene production, and other selected traits. Phytopathology 81:1452-1458. Bernardo, A., Bai, G., Guo, P., Xiao, K., Guenzi, A.C., and Ayoubi, P. 2007. Fusarium graminearum-induced changes in gene expression between Fusarium head blightresistant and susceptible wheat cultivars. Funct Integr Genomics 7:69-77. Berthiller, F., Dall'Asta, C., Schuhmacher, R., Lemmens, M., Adam, G., and Krska, R. 2005. Masked mycotoxins: Determination of a deoxynivalenol glucoside in artificially and naturally contaminated wheat by liquid chromatography-tandem mass spectrometry. J Ag Food Chem 53:3421-3425. Bessire, M., Chassot, C., Jacquat, A.-C., Humphry, M., Borel, S., Petetot, J.M.-C., Metraux, J.-P., and Nawrath, C. 2007. A permeable cuticle in Arabidopsis leads to a strong resistance to Botrytis cinerea. EMBO J 26:2158-2168. Beyer, E.M., Jr. 1976. A potent inhibitor of ethylene action in plants. Plant Physiol 58:268271. Bhat, R.V., Beedu, S.R., Ramakrishna, Y., and Munshi, K.L. 1989. Outbreak of Trichothecene Mycotoxicosis Associated with Consumption of Mold-Damaged Wheat Products in Kashmir Valley India. Lancet 1:35-37. Bienert, G.P., Schjoerring, J.K., and Jahn, T.P. 2006. Membrane transport of hydrogen peroxide. Biochim Biophys Acta 1758:994-1003. Bjørnstad, Å., and Skinnes, H. 2008. Resistance to Fusarium infection in oats (Avena sativa L.) Cereal Res Commun 36:57-62. Blein, J.P., Coutos-Thevenot, P., Marion, D., and Ponchet, M. 2002. From elicitins to lipidtransfer proteins: a new insight in cell signalling involved in plant defence mechanisms. Trends Plant Sci 7:293-296.  180  Boddu, J., Cho, S., and Muehlbauer, G.J. 2007. Transcriptome analysis of trichotheceneinduced gene expression in barley. Mol Plant-Microbe Interact 20:1364-1375. Boddu, J., Cho, S., Kruger, W.M., and Muehlbauer, G.J. 2006. Transcriptome analysis of the barley-Fusarium graminearum interaction. Mol Plant-Microbe Interact 19:407417. Boodley, J.W., and Sheldrake, R. 1977. Cornell peat-lite mixes for commercial plant growing. Cornell Univ Coop Ext Div Info Bull 43. Borsani, O., Valpuesta, V., and Botella, M.A. 2001. Evidence for a role of salicylic acid in the oxidative damage generated by NaCl and osmotic stress in Arabidopsis seedlings. Plant Physiol 126:1024-1030. Boutigny, A.L., Richard, F.F., and Barreau, C. 2008. Natural mechanisms for cereal resistance to the accumulation of Fusarium trichothecenes. Eur J Plant Pathol 121:411-423. Brown, D.W., Proctor, R.H., Dyer, R.B., and Plattner, R.D. 2003. Characterization of a fusarium 2-gene cluster involved in trichothecene C-8 modification. J Ag Food Chem 51:7936-7944. Brown, D.W., McCormick, S.P., Alexander, N.J., Proctor, R.H., and Desjardins, A.E. 2001. A genetic and biochemical approach to study trichothecene diversity in Fusarium sporotrichioides and Fusarium graminearum. Fungal Genet Biol 32:121-133. Brown, D.W., Dyer, R.B., McCormick, S.P., Kendra, D.F., and Plattner, R.D. 2004. Functional demarcation of the Fusarium core trichothecene gene cluster. Fungal Genet Biol 41:454-462. Bruins, M.B.M., Karsaï, I., Schepers, J., and Snijders, C.H.A. 1993. Phytotoxicity of deoxynivalenol to wheat tissue with regard to in vitro selection for Fusarium Head Blight resistance. Plant Sci 94:195-206. Buhot, N., Douliez, J.P., Jacquemard, A., Marion, D., Tran, V., Maume, B.F., Milat, M.L., Ponchet, M., Mikes, V., Kader, J.C., and Blein, J.P. 2001. A lipid transfer protein binds to a receptor involved in the control of plant defence responses. FEBS Lett 509:27-30. Burgess, L.W., Klein, T.A., Bryden, W.L., and Tobin, N.F. 1987. Head Blight of Wheat Caused by Fusarium-Graminearum Group 1 in New South Wales Australia in 1983. Australas Plant Pathol 16:72-78. 181  Bürstmayr, H., Ban, T., and Anderson, A.J. 2009. QTL mapping and marker-assisted selection for Fusarium head blight resistance in wheat: a review. Plant Breed 128:126. Bushnell, W.R., Hazen, B.E., and Pritsch, C. 2003. Histology and physiology of Fusarium head blight. Pages 44-84 in: Fusarium Head Blight of Wheat and Barley. Eds. K.J. Leonard and W.R. Bushnell. The American Phytopathological Society, St. Paul, Minnesota. Cameron, K.D., Teece, M.A., and Smart, L.B. 2006. Increased accumulation of cuticular wax and expression of lipid transfer protein in response to periodic drying events in leaves of tree tobacco. Plant Physiol 140:176-183. Cameron, R.K., Paiva, N.L., Lamb, C.J., and Dixon, R.A. 1999. Accumulation of salicylic acid and PR-1 gene transcripts in relation to the systemic acquired resistance (SAR) response induced by Pseudomonas syringae pv. tomato in Arabidopsis. Physiol Mol Plant Path 55:121-130. Cao, H., Glazebrook, J., Clarke, J.D., Volko, S., and Dong, X. 1997. The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell 88:57-63. Carvalho Ade, O., and Gomes, V.M. 2007. Role of plant lipid transfer proteins in plant cell physiology-a concise review. Peptides 28:1144-1153. Cassman, K.G., and Liska, A.J. 2007. Food and fuel for all: realistic or foolish. Biofuels, Bioprod Bioref 1:18-23. Castro, M.S., and Fontes, W. 2005. Plant defense and antimicrobial peptides. Protein Pept Lett 12:13-18. Chae, K., Kieslich, C.A., Morikis, D., Kim, S.-C., and Lord, E.M. 2009. A gain-of-function mutation of Arabidopsis lipid transfer protein 5 disturbs pollen tube tip growth and fertilization. Plant Cell 21:3902-3914. Chen, X., Steed, A., Travella, S., Keller, B., and Nicholson, P. 2009. Fusarium graminearum exploits ethylene signalling to colonize dicotyledonous and monocotyledonous plants. New Phytol 182:975-983. Chen, Z., Iyer, S., Caplan, A., Klessig, D.F., and Fan, B. 1997. Differential accumulation of salicylic acid and salicylic acid-sensitive catalase in different rice tissues. Plant Physiol 114:193-201. 182  Choquer, M., Fournier, E., Kunz, C., Levis, C., Pradier, J.M., Simon, A., and Viaud, M. 2007. Botrytis cinerea virulence factors: new insights into a necrotrophic and polyphageous pathogen. FEMS Microbiol Lett 277:1-10. Chungu, C., Mather, D.E., Reid, L.M., and Hamilton, R.I. 1996. Inheritance of kernel resistance to Fusarium graminearum in maize. J Hered 87:382-385. Conrath, U., Beckers, G.J.M., Flors, V., García-Agustín, P., Jakab, G., Mauch, F., Newman, M.-A., Pieterse, C.M.J., Poinssot, B., Pozo, M.J., Pugin, A., Schaffrath, U., Ton, J., Wendehenne, D., Zimmerli, L., and Mauch-Mani, B. 2006. Priming: getting ready for battle. Mol Plant-Microbe Interact 19:1062-1071. Cotty, P.J., and Misaghi, I.J. 1984. Zinniol production by Alternaria species. Phytopathology 74:785-788. Couture, L. 1982. Susceptibility of spring cereal cultivars to seed contamination by Fusarium-Spp during inflorescence. Can J Plant Sci 62:29-34. Couture, L., Dhont, C., Chalifour, F.-P., Drapeau, R., Tremblay, G., Castonguay, Y., Bélanger, G., and Nadeau1, P. 2002. Fusarium root and crown rot in alfalfa subjected to autumn harvests. Can J Soil Sci 82:621-624. Creelman, R.A., and Mullet, J.E. 1995. Jasmonic acid distribution and action in plants: regulation during development and response to biotic and abiotic stress. Proc Natl Acad Sci USA 92:4114-4119. Creelman, R.A., and Mullet, J.E. 1997. Biosynthesis and action of jasmonates in plants. Annu Rev Plant Physiol Plant Mol Biol 48:355-381. Cruz, L.P., Ribeiro, S.F., Carvalho, A.O., Vasconcelos, I.M., Rodrigues, R., Da Cunha, M., and Gomes, V.M. 2010. Isolation and partial characterization of a novel lipid transfer protein (LTP) and antifungal activity of peptides from chilli pepper seeds. Protein Pept Lett 17:311-318. Cuomo, C.A., Gcoldener, U., Xu, J.R., Trail, F., Turgeon, B.G., Di Pietro, A., Walton, J.D., Ma, L.J., Baker, S.E., Rep, M., Adam, G., Antoniw, J., Baldwin, T., Calvo, S., Chang, Y.L., DeCaprio, D., Gale, L.R., Gnerre, S., Goswami, R.S., Hammond Kosack, K., Harris, L.J., Hilburn, K., Kennell, J.C., Kroken, S., Magnuson, J.K., Mannhaupt, G., Mauceli, E., Mewes, H.W., Mitterbauer, R., Muehlbauer, G., McOnsterkcetter, M., Nelson, D., O' Donnell, K., Ouellet, T., Qi, W., Quesneville, H., Roncero, M.I.G., Seong, K.Y., Tetko, I.V., Urban, M., Waalwijk, C., Ward, T.J., Yao, J., Birren, B.W., and Kistler, H.C. 2007. The Fusarium graminearum 183  genome reveals a link between localized polymorphism and pathogen specialization. Science 317:1400-1402. Curvers, K., Seifi, H., Mouille, G., De Rycke, R., Asselbergh, B., Van Hecke, A., Vanderschaeghe, D., Hofte, H.R., Callewaert, N., Van Breusegem, F., and Hofte, M.M. 2010. ABA-deficiency causes changes in cuticle permeability and pectin composition that influence tomato resistance to Botrytis cinerea. Plant Physiol 154:847-860. Dai, H., Tian, B., Zhao, W., Leung, A., Smith, S., Wan, J., and Yao, X. 2004. Dynamic integration of gene annotation and its application to microarray analysis. J Bioinform Comput Biol 1:627-645. Dall’Asta, C., Berthiller, F., Schuhmacher, R., Adam, G., Lemmens, M., and Krska, R. 2005. DON-glycosides: characterisation of synthesis products and screening for their occurrence in DON-treated wheat samples. Mycotoxin Research 21:123–127. Dat, J.F., Foyer, C.H., and Scott, I.M. 1998. Changes in salicylic acid and antioxidants during induced thermotolerance in mustard seedlings. Plant Physiology 118:14551461. de la Pena, R.C., Smith, K.P., Capettini, F., Muehlbauer, G.J., Gallo, M.M., Dill, M.R., Somers, D.A., and Rasmusson, D.C. 1999. Quantitative trait loci associated with resistance to Fusarium head blight and kernel discoloration in barley. Theor Appl Genet 99:561-569. De Wolf, E.D., Madden, L.V., and Lipps, P.E. 2003. Risk assessment models for wheat Fusarium head blight epidemics based on within-season weather data. Phytopathology 93:428-435. DeBono, A., Yeats, T.H., Rose, J.K.C., Bird, D., Jetter, R., Kunst, L., and Samuels, L. 2009. Arabidopsis LTPG is a glycosylphosphatidylinositol-anchored lipid transfer protein required for export of lipids to the plant surface. Plant Cell 21:1230-1238. del Martínez-Ballesta, M.C., Silva, C., López-Berenguer, C., Cabañero, F.J., and Carvajal, M. 2006. Plant aquaporins: new perspectives on water and nutrient uptake in saline environment. Plant Biol 8:535-546. Del Ponte, E.M., Fernandes, J.M.C., and Bergstrom, G.C. 2007. Influence of growth stage on fusarium head blight and deoxynivalenol production in wheat. J Phytopathol 155:577-581. 184  Delaney, T.P., Friedrich, L., and Ryals, J.A. 1995. Arabidopsis signal transduction mutant defective in chemically and biologically induced disease resistance. Proc Natl Acad Sci U S A 92:6602-6606. Desjardins, A.E., Hohn, T.M., and McCormick, S.P. 1993. Trichothecene biosynthesis in Fusarium species: chemistry, genetics, and significance. Microbiol Rev 57:595-604. Desjardins, A.E., McCormick, S.P., and Appell, M. 2007a. Structure−Activity Relationships of Trichothecene Toxins in an Arabidopsis thaliana Leaf Assay. J Ag Food Chem 55:6487-6492. Desjardins, A.E., Busman, M., Proctor, R.H., and Stessman, R. 2007b. Wheat kernel black point and fumonisin contamination by Fusarium proliferatum. Food Addit Contam 24:1131-1137. Devoto, A., Nieto-Rostro, M., Xie, D., Ellis, C., Harmston, R., Patrick, E., Davis, J., Sherratt, L., Coleman, M., and Turner, J.G. 2002. COI1 links jasmonate signalling and fertility to the SCF ubiquitin–ligase complex in Arabidopsis. Plant J 32:457466. Dill-Macky, R. 2003. Inoculation methods and evaluation of Fusarium head blight. Pages 184-210 in: Fusarium Head Blight of Wheat and Barley. Eds. K.J. Leonard and W.R. Bushnell. The American Phytopathological Society, St. Paul, Minnesota. Dill-Macky, R., and Jones, R.K. 2000. The effect of previous crop residues and tillage on Fusarium head blight of wheat. Plant Dis 84:71-76. Dixon, R.A., Achnine, L., Kota, P., Liu, C.J., Reddy, M.S.S., and Wang, L. 2002. The phenylpropanoid pathway and plant defence—a genomics perspective. Mol Plant Pathol 3:371-390. Dodds, P.N., Lawrence, G.J., Catanzariti, A.M., Teh, T., Wang, C.I.A., Ayliffe, M.A., Kobe, B., and Ellis, J.G. 2006. Direct protein interaction underlies gene-for-gene specificity and coevolution of the flax resistance genes and flax rust avirulence genes. Proc Natl Acad Sci USA 103:8888-8893. Draeger, R., Gosman, N., Steed, A., Chandler, E., Thomsett, M., Srinivasachary, Schondelmaier, J., Bürstmayr, H., Lemmens, M., Schmolke, M., Mesterhazy, A., and Nicholson, P. 2007. Identification of QTLs for resistance to Fusarium head blight, DON accumulation and associated traits in the winter wheat variety Arina. Theor Appl Genet 115:617-625. 185  Dubcovsky, J., and Dvorak, J. 2007. Genome plasticity a key factor in the success of polyploid wheat under domestication. Science 316:1862-1866. Ehrlich, K.C., and Daigle, K.W. 1987. Protein synthesis inhibition by 8 oxo-12,13epoxytrichothecenes. Biochim Biophys Acta 923:206-213. Elbashir, S.M., Lendeckel, W., and Tuschl, T. 2001. RNA interference is mediated by 21and 22-nucleotide RNAs. Genes Dev 15:188-200. Ellis, B.E., and Towers, G.H.N. 1969. The biogenesis of catechol in Gaultheria. Phytochem 8:1415-1417. Engelberth, J., Schmelz, E.A., Alborn, H.T., Cardoza, Y.J., Huang, J., and Tumlinson, J.H. 2003. Simultaneous quantification of jasmonic acid and salicylic acid in plants by vapor-phase extraction and gas chromatography-chemical ionization-mass spectrometry. Anal Biochem 312:242-250. Epple, P., Apel, K., and Bohlmann, H. 1997. Overexpression of an endogenous thionin enhances resistance of Arabidopsis against Fusarium oxysporum. Plant Cell 9:509520. Eriksen, G.S., and Pettersson, H. 2004. Toxicological evaluation of trichothecenes in animal feed. Anim Feed Sci Technol 114:205-239. Eudes, F., Comeau, A., Rioux, S., and Collin, J. 2000. Phytotoxicité de huit mycotoxines associées à la fusariose de l'épi chez le blé. Canadian Journal of Plant Pathology 22:286-292. Eudes, F., Comeau, A., Rioux, S., and Collin, J. 2001. Impact of trichothecenes on Fusarium head blight (Fusarium graminearum) development in spring wheat (Triticum aestivum). Can J Plant Pathol 23:318-322. Eudes, F., Zhou, W., Badea, A., and Laroche, A. 2004. Toward the development of Fusarium head blight resistance and reduced levels of mycotoxin in wheat and barley. Recent Res Develop Plant Pathol 3:1-33. Eudes, F., Comeau, A., Rioux, S., and Collin, J. 2008. Trichothecene-mediated in vitro selection in wheat for reduced mycotoxin accumulation caused by Fusarium graminearum. Can J Plant Sci 88:1115-1125. Fadel, F., and Wenzel, G. 1993. In vitro selection for tolerance to Fusarium in F-1 microspore populations of wheat. Plant Breeding 110:89-95. 186  Feussner, I., Hause, B., Vörös, K., Parthier, B., and Wasternack, C. 1995. Jasmonateinduced lipoxygenase forms are localized in chloroplasts of barley leaves (Hordeum vulgare cv. Salome). Plant J 7:949-957. Foroud, N.A., and Eudes, F. 2009. Trichothecenes in cereal grains. Int J Mol Sci 10:147173. Foroud, N.A., McCormick, S., MacMillan, T., Ellis, B.E., Kendra, D.F., and Eudes, F. in preparation. Increased aggressiveness of emergent Fusarium graminearum strains in North America. New Phytol. Friedrich, L., Lawton, K., Ruess, W., Masner, P., Specker, N., Rella, M.G., Meier, B., Dincher, S., Staub, T., Uknes, S., Métraux, J.P., Kessmann, H., and Ryals, J. 1996. A benzothiadiazole derivative induces systemic acquired resistance in tobacco. Plant J 10:61-70. Gabriëls, S.H.E.J., Takken, F.L.W., Vossen, J.H., de Jong, C.F., Liu, Q., Turk, S.C.H.J., Wachowski, L.K., Peters, J., Witsenboer, H.M.A., de Wit, P.J.G.M., and Joosten, M.H.A.J. 2006. cDNA-AFLP combined with functional analysis reveals novel genes involved in the hypersensitive response. Mol Plant-Microbe Interact 19:567576. Gaffney, T., Friedrich, L., Vernooij, B., Negrotto, D., Nye, G., Uknes, S., Ward, E., Kessmann, H., and Ryals, J. 1993. Requirement of salicylic acid for the induction of systemic acquired resistance. Science 261:754-756. Gale, L.R., Bryant, J.D., Calvo, S., Giese, H., Katan, T., O'Donnell, K., Suga, H., Taga, M., Usgaard, T.R., Ward, T.J., and Kistler, H.C. 2005. Chromosome complement of the fungal plant pathogen Fusarium graminearum based on genetic and physical mapping and cytological observations. Genetics 171:985-1001. Gane, R. 1934. Production of ethylene by some ripening fruits. Nature 134:1008. Gareis, M., Bauer, J., Thiem, J., Plank, G., Grabley, S., and Gedek, B. 1990. Cleavage of zearalenone-glycoside, a "masked" mycotoxin, during digestion in swine. Zentralbl Veterinarmed B 37:236-240. Gaudet, D.A., Laroche, A., Frick, M., Huel, R., and Puchalski, B. 2003. Cold induced expression of plant defensin and lipid transfer protein transcripts in winter wheat. Plant Physiol 117:195-205.  187  Geddes, J., Eudes, F., Laroche, A., and Selinger, L.B. 2008. Differential expression of proteins in response to the interaction between the pathogen Fusarium graminearum and its host, Hordeum vulgare. Proteomics 8:545-554. Gilbert, J., and Tekauz, A. 2000. Review: recent developments in research on fusarium head blight of wheat in Canada. Can J Plant Pathol 22:1-8. Gilbert, J., and Fernando, W.G.D. 2004. Epidemiology and biological control of Gibberella zeae / Fusarium graminearum. Can J Plant Pathol 26:464-472. Gill, B.S., Appels, R., Botha-Oberholster, A.-M., Buell, C.R., Bennetzen, J.L., Chalhoub, B., Chumley, F., Dvorak, J., Iwanaga, M., Keller, B., Li, W., McCombie, W.R., Ogihara, Y., Quetier, F., and Sasaki, T. 2004. A workshop report on wheat genome sequencing: international genome research on wheat consortium. Genetics 168:1087-1096. Glazebrook, J. 2005. Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu Rev Phytopathol 43:205-227. Golkari, S., Gilbert, J., Prashar, S., and Procunier, J.D. 2007. Microarray analysis of Fusarium graminearum-induced wheat genes: identification of organ-specific and differentially expressed genes. Plant Biotechnol J 5:38-49. Golkari, S., Gilbert, J., Ban, T., and Procunier, J.D. 2009. QTL-specific microarray gene expression analysis of wheat resistance to Fusarium head blight in Sumai-3 and two susceptible NILs. Genome 52:409-418. Gonorazky, A.G., Regente, M.C., and de la Canal, L. 2005. Stress induction and antimicrobial properties of a lipid transfer protein in germinating sunflower seeds. J Plant Physiol 162:618-624. Goodwin, S.M., and Jenks, M.A. 2007. Plant cuticle function as a barrier to water loss. Pages 14-36 in: Plant Abiotic Stress. Eds. M.A. Jenks and P.M. Hasegawa. Blackwell Publishing Ltd. Grbić, V., and Bleecker, A.B. 1995. Ethylene regulates the timing of leaf senescence in Arabidopsis. Plant J 8:595-602. Greenberg, J.T., Silverman, F.P., and Liang, H. 2000. Uncoupling salicylic acid-dependent cell death and defense-related responses from disease resistance in the Arabidopsis mutant acd5. Genetics 156:341-350. 188  Guarro, J., and Gené, J. 1995. Opportunistic fusarial infections in humans. Eur J Clin Microbial Infect Dis 14:741-754. Guo, H., and Ecker, J.R. 2003. Plant responses to ethylene gas are mediated by SCFEBF1/EBF2-dependent proteolysis of EIN3 transcription factor. Cell 115:667677. Hall, H.C., Samuel, M.A., and Ellis, B.E. 2007. SIPK conditions transcriptional responses unique to either bacterial or oomycete elicitation in tobacco. Mol Plant Pathol 8:581-594. Hamberg, M. 1987. Mechanism of corn hydroperoxide isomerase: detection of 12,13(S)oxido-9(Z),11-octadecadienoic acid. Biochim Biophys Acta 920:76-84. Hamberg, M. 1988. Biosynthesis of 12-oxo-10,15(Z)-phytodienoic acid: Identification of an allene oxide cyclase. Biochem Biophys Res Commun 156:543-550. Hammond, S.M., Bernstein, E., Beach, D., and Hannon, G.J. 2000. An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 404:293-296. Han, F.P., Fedak, G., Ouellet, T., Dan, H., and Somers, D.J. 2005. Mapping of genes expressed in Fusarium graminearum-infected heads of wheat cultivar 'Frontana'. Genome 48:88-96. Hanba, Y.T., Shibasaka, M., Hayashi, Y., Hayakawa, T., Kasamo, K., Terashima, I., and Katsuhara, M. 2004. Overexpression of the barley aquaporin HvPIP2;1 increases internal CO2 conductance and CO2 assimilation in the leaves of transgenic rice plants. Plant Cell Physiol 45:521-529. Hannon, G.J. 2002. RNA interference. Nature 418:244-251. Harris, L.J., Desjardins, A.E., Plattner, R.D., Nicholson, P., Butler, G., Young, Y.C., Weston, G., Proctor, R.H., and Hohn, T.M. 1999. Possible role of trichothecene mycotoxins in virulence of Fusarium graminearum on maize. Plant Dis 83:954-960. Harris, L.J., Alexander, N.J., Saparno, A., Blackwell, B., McCormick, S.P., Desjardins, A.E., Robert, L.S., Tinker, N., Hattori, J., Piche, C., Schernthaner, J.P., Watson, R., and Ouellet, T. 2007. A novel gene cluster in Fusarium graminearum contains a gene that contributes to butenolide synthesis. Fungal Genet Biol 44:293-306.  189  Hart, L.P., Pestka, J.J., and Liu, M.T. 1984. Effect of kernel development and wet periods on production of deoxynivalenol in wheat infected with Gibberella zeae. Phytopathology 74:1415-1418. Hartung, A.C., and Stephens, C.T. 1983. Effects of allelopathic substances produced by asparagus on incidence and severity of asparagus decline due to Fusarium crown rot. J Chem Ecol 9:1163-1174. Hohn, T.M., and Vanmiddlesworth, F. 1986. Purification and characterization of the sesquiterpene cyclase trichodiene synthetase from Fusarium sporotrichioides. Arch Biochem Biophys 251:756-761. Hohn, T.M., and Beremand, P.D. 1989. Isolation and nucleotide sequence of a sesquiterpene cyclase gene from the trichothecene-producing fungus Fusarium sporotrichioides. Gene 79:131-138. Hohn, T.M., McCormick, S.P., and Desjardins, A.E. 1993. Evidence for a gene cluster involving trichothecene-pathway biosynthetic genes in Fusarium sporotrichioides. Curr Genet 24:291-295. Hohn, T.M., Krishna, R., and Proctor, R.H. 1999. Characterization of a transcriptional activator controlling trichothecene toxin biosynthesis. Fungal Genet Biol 26:224235. Hongxiang, M., Yao, J., Zhou, M., Zhang, X., Ren, L., Yu, G., and Lu, W. 2008. Molecular breeding for wheat fusarium head blight resistance in China. Cereal Res Commun 36:203-212. Horsley, R.D., Pederson, J.D., Schwarz, P.B., McKay, K., Hochhalter, M.R., and McMullen, M.P. 2006. Integrated use of tebuconazole and Fusarium head blightresistant barley genotypes. Agron J 98:194-197. Howe, G.A. 2004. Jasmonates as signals in the wound response. J Plant Growth Regul 23:223-237. Hua, J., and Meyerowitz, E.M. 1998. Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis thaliana. Cell 94:261-271. Hua, J., Sakai, H., Nourizadeh, S., Chen, Q.G., Bleecker, A.B., Ecker, J.R., and Meyerowitz, E.M. 1998. EIN4 and ERS2 are members of the putative ethylene receptor gene family in Arabidopsis. Plant Cell 10:1321-1332. 190  Huang, S., Sirikhachornkit, A., Su, X., Faris, J., Gill, B., Haselkorn, R., and Gornicki, P. 2002. Genes encoding plastid acetyl-CoA carboxylase and 3-phosphoglycerate kinase of the Triticum/Aegilops complex and the evolutionary history of polyploid wheat. Proc Natl Acad Sci USA 99:8133-8138. Hubbell, E., Liu, W.-M., and Mei, R. 2002. Robust estimators for expression analysis. Bioinformatics 18:1585-1592. Huckelhoven, R., Fodor, J., Preis, C., and Kogel, K.-H. 1999. Hypersensitive cell death and papilla formation in barley attacked by the powdery mildew fungus are associated with hydrogen peroxide but not with salicylic acid accumulation. Plant Physiol 119:1251-1260. Ilgen, P., Hadeler, B., Maier, F.J., and Schäfer, W. 2009. Developing kernel and rachis node induce the trichothecene pathway of Fusarium graminearum during wheat head infection. Mol Plant-Microbe Interact 22:899-908. Ishiguro, S., Kawai-Oda, A., Ueda, J., Nishida, I., and Okada, K. 2001. The DEFECTIVE IN ANTHER DEHISCENCE1 gene encodes a novel phospholipase A1 catalyzing the initial step of jasmonic acid biosynthesis, which synchronizes pollen maturation, anther dehiscence, and flower opening in Arabidopsis. Plant Cell 13:2191-2209. Ishihara, T., Sekine, K.T., Hase, S., Kanayama, Y., Seo, S., Ohashi, Y., Kusano, T., Shibata, D., Shah, J., and Takahashi, H. 2008. Overexpression of the Arabidopsis thaliana EDS5 gene enhances resistance to viruses. Plant Biol 10:451-461. Jang, C.S., Johnson, J.W., and Seo, Y.W. 2005. Differential expression of TaLTP3 and TaCOMT1 induced by Hessian fly larval infestation in a wheat line possessing H21 resistance gene. Plant Sci 168:1319-1326. Jang, C.S., Kim, J.Y., Haam, J.W., Lee, M.S., Kim, D.S., Li, Y.W., and Seo, Y.W. 2003. Expressed sequence tags from a wheat-rye translocation line (2BS/2RL) infested by larvae of Hessian fly (Mayetiola destructor (Say)). Plant Cell Rep 22:150-158. Jansen, C., von Wettstein, D., Schaefer, W., Kogel, K.H., Felk, A., and Maier, F.J. 2005. Infection patterns in barley and wheat spikes inoculated with wild-type and trichodiene synthase gene disrupted Fusarium graminearum. Proc Natl Acad Sci USA 102:16892-16897. Jones, R.K. 2000. Assessments of Fusarium head blight of wheat and barley in response to fungicide treatment. Plant Dis 84:1021-1030. 191  Jung, H.W., Kim, W., and Hwang, B.K. 2003. Three pathogen-inducible genes encoding lipid transfer protein from pepper are differentially activated by pathogens, abiotic, and environmental stresses. Plant Cell Environ 26:915-928. Jung, H.W., Tschaplinski, T.J., Wang, L., Glazebrook, J., and Greenberg, J.T. 2009. Priming in systemic plant immunity. Science 324:89-91. Kader, J.-C., Julienne, M., and Vergnolle, C. 1984. Purification and characterization of a spinach-leaf protein capable of transferring phospholipids from liposomes to mitochondria or chloroplasts. Eur J Biochem 139:411-416. Kader, J.C. 1975. Proteins and the intracellular exchange of lipids: I. stimulation of phospholipid exchange between mitochondria and microsomal fractions by proteins isolated from potato tuber. Biochim Biophys Acta 380:31-44. Kang, Z., and Buchenauer, H. 1999. Immunocytochemical localization of fusarium toxins in infected wheat spikes by Fusarium culmorum. Physiol Mol Plant Path 55:275288. Kang, Z., and Buchenauer, H. 2000a. Ultrastructural and immunocytochemical investigation of pathogen development and host responses in resistant and susceptible wheat spikes infected by Fusarium culmorum. Physiol Mol Plant Path 57:255-268. Kang, Z.S., and Buchenauer, H. 2000b. Cytology and ultrastructure of the infection of wheat spikes by Fusarium culmorum. Mycol Res 104:1083-1093. Katagiri, M., Yamamoto, S., and Hayaishi, O. 1962. Flavin adenine dinucleotide requirement for the enzymic hydroxylation and decarboxylation of salicylic acid. J Biol Chem 237:PC2413-PC2414. Khan, M.R., Fischer, S., Egan, D., and Doohan, F.M. 2006. Biological control of fusarium seedling blight disease of wheat and barley. Phytopathology 96:386-394. Kieber, J.J., Rothenberg, M., Roman, G., Feldmann, K.A., and Ecker, J.R. 1993. CTR1, a negative regulator of the ethylene response pathway in arabidopsis, encodes a member of the Raf family of protein kinases. Cell 72:427-441. Kim, H.-S., Lee, T., Dawlatana, M., Yun, S.-H., and Lee, Y.-W. 2003. Polymorphism of trichothecene biosynthesis genes in deoxynivalenol-and nivalenol-producing Fusarium graminearum isolates. Mycol Res 107:190-197. 192  Kim, T.H., Park, J.H., Kim, M.C., and Cho, S.H. 2008. Cutin monomer induces expression of the rice OsLTP5 lipid transfer protein gene. J Plant Physiol 165:345-349. Kimura, M., Tokai, T., Takahashi, A.N., Ohsato, S., and Fujimura, M. 2007. Molecular and genetic studies of Fusarium trichothecene biosynthesis: pathways, genes and evoluion. Biosci Biotechnol Biochem 71:2105-2123. Kimura, M., Kaneko, I., Komiyama, M., Takatsuki, A., Koshino, H., Yoneyama, K., and Yamaguchi, I. 1998. Trichothecene 3-O-acetyltransferase protects both the producing organism and transformed yeast from related mycotoxins. Cloning and characterization of Tri101. J Biol Chem 273:1654-1661. Kimura, M., Tokai, T., O'Donnell, K., Ward, T.J., Fujimura, M., Hamamoto, H., Shibata, T., and Yamaguchi, I. 2003. The trichothecene biosynthesis gene cluster of Fusarium graminearum F15 contains a limited number of essential pathway genes and expressed non-essential genes. FEBS Lett 539:105-110. Kisana, N.S., Nkongolo, K.K., Quick, J.S., and Johnson, D.L. 1993. Production of doubled haploids by anther culture and wheat X maize method in a wheat breeding programme. Plant Breed 110:96-102. Klahr, A., Zimmermann, G., Wenzel, G., and Mohler, V. 2007. Effects of environment disease progress, plant height and heading date on the detection of QTLs or resistance to Fusarium head blight in an European winter wheat cross. Euphytica 154:17-28. Klee, H.J., and Clark, D.G. 2010. Ethylene signal transduction in fruits and flowers. Pages 377-398 in: Plant Hormones. Ed. P.J. Davies. Springer Netherlands. Klessig, D.F., Durner, J., Noad, R., Navarre, D.A., Wendehenne, D., Kumar, D., Zhou, J.M., Shah, J., Zhang, S., Kachroo, P., Trifa, Y., Pontier, D., Lam, E., and Silva, H. 2000. Nitric oxide and salicylic acid signaling in plant defense. Proc Natl Acad Sci USA 97:8849-8855. Kriel, W.M., and Pretorius, Z.A. 2008. The FHB challenge to irrigation wheat production in South Africa. Cereal Res Commun 36:569-571. Kuai, J., and Dilley, D.R. 1992. Extraction, partial purification and characterization of 1aminocyclopropane-1-carboxylic acid oxidase from apple fruit. Postharvest Biol Technol 1:203-211.  193  Kunst, L., and Samuels, L. 2009. Plant cuticles shine: advances in wax biosynthesis and export. Curr Opin Plant Biol 12:721-727. Langevin, F., Eudes, F., and Comeau, A. 2004. Effect of trichothecenes produced by Fusarium graminearum during Fusarium head blight development in six cereal species. Eur J Plant Pathol 110:735-746. Laudert, D., and Weiler, E.W. 1998. Allene oxide synthase: a major control point in Arabidopsis thaliana octadecanoid signalling. Plant J 15:675-684. Lee, H.I., León, J., and Raskin, I. 1995. Biosynthesis and metabolism of salicylic acid. Proc Natl Acad Sci USA 92:4076-4079. Lee, S.B., Go, Y.S., Bae, H.-J., Park, J.H., Cho, S.H., Cho, H.J., Lee, D.S., Park, O.K., Hwang, I., and Suh, M.C. 2009. Disruption of glycosylphosphatidylinositolanchored lipid transfer protein gene altered cuticular lipid composition, increased plastoglobules, and enhanced susceptibility to infection by the fungal pathogen Alternaria brassicicola. Plant Physiol 150:42-54. Lee, T., Han, Y.K., Kim, K.H., Yun, S.H., and Lee, Y.W. 2002. Tri13 and Tri7 determine deoxynivalenol- and nivalenol-producing chemotypes of Gibberella zeae. Appl Environ Microbiol 68:2148-2154. Lemmens, M., Scholz, U., Berthiller, F., Dall'Asta, C., Koutnik, A., Schuhmacher, R., Adam, G., Bürstmayr, H., Mesterhazy, A., Krska, R., and Ruckenbauer, P. 2005. The ability to detoxify the mycotoxin deoxynivalenol colocalizes with a major quantitative trait locus for Fusarium head blight resistance in wheat. Mol PlantMicrobe Interact 18:1318-1324. Leon-Reyes, A., Van der Does, D., De Lange, E., Delker, C., Wasternack, C., Van Wees, S., Ritsema, T., and Pieterse, C. 2010a. Salicylate-mediated suppression of jasmonate-responsive gene expression in Arabidopsis is targeted downstream of the jasmonate biosynthesis pathway. Planta 232:1423-1432. Leon-Reyes, A., Du, Y., Koornneef, A., Proietti, S., Körbes, A.P., Memelink, J., Pieterse, C.M.J., and Ritsema, T. 2010b. Ethylene signaling renders the jasmonate response of Arabidopsis insensitive to future suppression by salicylic acid. Mol PlantMicrobe Interact 23:187-197. Leon-Reyes, A., Spoel, S.H., De Lange, E.S., Abe, H., Kobayashi, M., Tsuda, S., Millenaar, F.F., Welschen, R.A.M., Ritsema, T., and Pieterse, C.M.J. 2009. Ethylene modulates the role of NONEXPRESSOR OF PATHOGENESIS194  RELATED GENES1 in cross talk between salicylate and jasmonate signaling. Plant Physiol 149:1797-1809. Leslie, J.F., and Summerell, B.A. 2006. The Fusarium Laboratory Manual. Blackwell, Ames, Iowa. Li, C., Schilmiller, A.L., Liu, G., Lee, G.I., Jayanty, S., Sageman, C., Vrebalov, J., Giovannoni, J.J., Yagi, K., Kobayashi, Y., and Howe, G.A. 2005. Role of βoxidation in jasmonate biosynthesis and systemic wound signaling in tomato. Plant Cell 17:971-986. Li, G., and Yen, Y. 2008. Jasmonate and ethylene signaling pathway may mediate Fusarium head blight resistance in wheat. Crop Sci 48:1888-1896. Li, L., Li, C., Lee, G.I., and Howe, G.A. 2002. Distinct roles for jasmonate synthesis and action in the systemic wound response of tomato. Proc Natl Acad Sci USA 99:64166421. Li, X., Zhang, Y., Clarke, J.D., Li, Y., and Dong, X. 1999. Identification and cloning of a negative regulator of systemic acquired resistance, SNI1, through a screen for suppressors of npr1-1. Cell 98:329-339. Liddell, C.M. 2003. Systematics of Fusarium species and allies associated with Fusarium head blight. Pages 35-43 in: Fusarium Head Blight of Wheat and Barley. Eds. K.J. Leonard and W.R. Bushnell. The American Phytopathological Society, St. Paul, Minnesota. Lieberman, M., and Mapson, L.W. 1964. Genesis and biogenesis of ethylene. Nature 204:343-345. Liu, Q., Feng, Y., and Zhu, Z. 2009. Dicer-like (DCL) proteins in plants. Funct Integr Genomics 9:277-286. Liu, S., Pumphrey, M.O., Gill, B.S., Trick, H.N., Zhang, J.X., Dolezel, J., Chalhoub, B., and Anderson, J.A. 2008. Toward positional cloning of Fhb1, a major QTL for Fusarium head blight resistance in wheat Cereal Res Commun 36:195-201. Loake, G., and Grant, M. 2007. Salicylic acid in plant defence--the players and protagonists. Curr Opin Plant Biol 10:466-472. Long, X.-Y., Wang, J.-R., Ouellet, T., Rocheleau, H., Wei, Y.-M., Pu, Z.-E., Jiang, Q.-T., Lan, X.-J., and Zheng, Y.-L. 2010. Genome-wide identification and evaluation of 195  novel internal control genes for Q-PCR based transcript normalization in wheat. Plant Mol Biol 74:307-311. Lu, S.C. 2000. S-adenosylmethionine. Int J Biochem Cell Biol 32:391-395. Lu, Z.X., Gaudet, D.A., Frick, M., Puchalski, B., Genswein, B., and Laroche, A. 2005. Identification and characterization of genes differentially expressed in the resistance reaction in wheat infected with Tilletia tritici, the common bunt pathogen. J Biochem Mol Biol 38:420-431. Lu, Z.X., Gaudet, D., Puchalski, B., Despins, T., Frick, M., and Laroche, A. 2006. Inducers of resistance reduce common bunt infection in wheat seedlings while differentially regulating defence-gene expression. Physiol Mol Plant Path 67:138-148. Lutsky, I., Mor, N., Yagen, B., and Joffe, A.Z. 1978. The role of T-2 toxin in experimental alimentary toxic aleukia: A toxicity study in cats. Toxicol Appl Pharmacol 43:111124. Ma, Q.H., and Wang, X.M. 2003. Characterization of an ethylene receptor homologue from wheat and its expression during leaf senescence. J Exp Bot 54:1489-1490. Ma, Z., Steffenson, B.J., Prom, L.K., and Lapitan, N.L. 2000. Mapping of quantitative trait loci for Fusarium Head Blight resistance in Barley. Phytopathology 90:1079-1088. Maier, F.J., Miedaner, T., Hadeler, B., Felk, A., Salomon, S., Lemmens, M., Kassner, H., and Schaefer, W. 2006. Involvement of trichothecenes in fusarioses of wheat, barley and maize evaluated by gene disruption of the trichodiene synthase (Tri5) gene in three field isolates of different chemotype and virulence. Mol Plant Pathol 7:449-461. Makandar, R., Essig, J.S., Schapaugh, M.A., Trick, H.N., and Shah, J. 2006. Genetically engineered resistance to Fusarium Head Blight in wheat by expression of Arabidopsis NPR1. Mol Plant-Microbe Interact 19:123-129. Makandar, R., Nalam, V., Chaturvedi, R., Jeannotte, R., Sparks, A.A., and Shah, J. 2010. Involvement of salicylate and jasmonate signaling pathways in Arabidopsis interaction with Fusarium graminearum. Mol Plant-Microbe Interact 23:861-870. Maldonado, A.M., Doerner, P., Dixon, R.A., Lamb, C.J., and Cameron, R.K. 2002. A putative lipid transfer protein involved in systemic resistance signalling in Arabidopsis. Nature 419:399-403. 196  Manners, J.M., Penninckx, I.A.M.A., Vermaere, K., Kazan, K., Brown, R.L., Morgan, A., Maclean, D.J., Curtis, M.D., Cammue, B.P.A., and Broekaert, W.F. 1998. The promoter of the plant defensin gene PDF1.2 from Arabidopsis is systemically activated by fungal pathogens and responds to methyl jasmonate but not to salicylic acid. Plant Mol Biol 38:1071-1080. Mansoor, S., Amin, I., Hussain, M., Zafar, Y., and Briddon, R.W. 2006. Engineering novel traits in plants through RNA interference. Trends Plant Sci 11:559-565. Mardi, M., Pazouki, L., Delavar, H., Kazemi, M.B., Ghareyazie, B., Steiner, B., Nolz, R., Lemmens, M., and Buerstmayr, H. 2006. QTL analysis of resistance to Fusarium head blight in wheat using a 'Frontana'-derived population. Plant Breed 125:313317. Marshall, B.J., and Ratledge, C. 1971. Conversion of chorismic acid and isochorismic acid to salicylic acid by cell-free extracts of Mycobacterium smegmatis. Biochim Biophys Acta 230:643-645. Marshall, B.J., and Ratledge, C. 1972. Salicylic acid biosynthesis and its control in Mycobacterium smegmatis. Biochim Biophys Acta 264:106-116. Martin, J.T. 1964. Role of cuticle in the defense against plant disease. Annu Rev Phytopathol 2:81-100. Mauro, V.P., and Edelman, G.M. 2002. The ribosome filter hypothesis. Proc Natl Acad Sci USA 99:12031-12036. Mayer, C.F. 1953. Endemic panmyelotoxicosis in the Russian grain belt. I. The clinical aspects of alimentary toxic aleukia (ATA); a comprehensive review. Mil Surg 113:173-189. Maynard, J.A., and Swan, J.M. 1963. Organophosphorus compounds. I. 2chloroalkylphosphonic acids as phosphorylating agents. Aust J Chem 16:596-608. McCormick, S. 2003. The role of DON in pathogenicity. Pages 165-183 in: Fusarium Head Blight of Wheat and Barley. Eds. K.J. Leonard and W.R. Bushnell. The American Phytopathological Society, St. Paul, Minnesota. McCormick, S.P., and Alexander, N.J. 2002. Fusarium Tri8 encodes a trichothecene C-3 esterase. Appl Environ Microbiol 68:2959-2964.  197  McCormick, S.P., Hohn, T.M., and Desjardins, A.E. 1996. Isolation and characterization of Tri3, a gene encoding 15-O-acetyltransferase from Fusarium sporotrichioides. Appl Environ Microbiol 62:353-359. McCormick, S.P., Alexander, N.J., and Proctor, R.H. 2006. Heterologous expression of two trichothecene P450 genes in Fusarium verticillioides. Can J Microbiol 52:220-226. McCormick, S.P., Taylor, S.L., Plattner, R.D., and Beremand, M.N. 1990. Bioconversion of possible T-2 toxin precursors by a mutant strain of Fusarium sporotrichioides NRRL 3299. Appl Environ Microbiol 56:702-706. McCormick, S.P., Alexander, N.J., Trapp, S.E., and Hohn, T.M. 1999. Disruption of TRI101, the gene encoding trichothecene 3-O-acetyltransferase, from Fusarium sporotrichioides. Appl Environ Microbiol 65:5252-5256. McLaughlin, C.S., Vaughn, M.H., Campbell, J.M., Wei, C.M., and Stafford, M.E. 1977. Inhibition of protein synthesis by trichothecenes. Pages 263–275 in: Mycotoxins in Human and Health Eds. J.V. Rodricks, C.W. Hesseltine, and M.A. Mehlman. Pathotox Publishers, Park Forest South, Illenois. McMullen, M. 2003. Impacts of Fusarium head blight on the North American agriculture community: the power of one disease to catapult change. Pages 484-503 in: Fusarium Head Blight of Wheat and Barley. Eds. K.J. Leonard and W.R. Bushnell. The American Phytopathological Society, St. Paul, Minnesota. McMullen, M., Jones, R., and Gallenberg, D. 1997. Scab of wheat and barley: a reemerging disease of devasting impact. Plant Dis 81:1340-1348. McMullen, M., Halley, S., Schatz, B., Meyer, S., Jordahl, J., and Ransom, J. 2008. Integrated strategies for Fusarium head blight management in the United States. Cereal Res Commun 36:563-568. Meek, I.B., Peplow, A.W., Ake, C., Jr., Phillips, T.D., and Beremand, M.N. 2003. Tri1 encodes the cytochrome P450 monooxygenase for C-8 hydroxylation during trichothecene biosynthesis in Fusarium sporotrichioides and resides upstream of another new Tri gene. Appl Environ Microbiol 69:1607-1613. Mendgen, K., Hahn, M.G., and Deising, H. 1996. Morphogenesis and mechanisms of penetration by plant-pathogenic fungi. Annu Rev Phytopathol 34:367-386.  198  Mesterhazy, A., Bartok, T., Mirocha, C.G., and Komoroczy, R. 1999. Nature of wheat resistance to Fusarium head blight and the role of deoxynivalenol for breeding. Plant Breed 118:97-110. Mesterházy, A., Tóth, B., Bartók, T., and Varga, M. 2008. Breeding strategies against FHB in winter wheat and their relation to type I resistance Cereal Res Commun 36:37-43. Mesterházy, Á. 1995. Types and components of resistance to Fusarium head blight of wheat. Plant Breed 114:377-386. Mesterházy, Á. 2002. Role of deoxynivalenol in aggressiveness of Fusarium graminearum and F. culmorum and in resistance to Fusarium head blight. Eur J Plant Pathol 108:675-684. Mesterházy, Á. 2003. Conrol of Fusarium head blight of wheat by fungicides. Pages 363380 in: Fusarium Head Blight of Wheat and Barley. Eds. K.J. Leonard and W.R. Bushnell. The American Phytopathological Society, St. Paul, Minnesota. Miedaner, T. 1997. Breeding wheat and rye for resistance to Fusarium diseases. Plant Breed 116:201-220. Miedaner, T., Reinbrecht, C., and Schilling, A.G. 2000. Association among aggressiveness, fungal colonization, and mycotoxin production of 26 isolates of Fusarium graminearum in winter rye head blight. Z Pflanzenkr Pflanzenschutz 107:124-134. Miedaner, T., Reinbrecht, C., Lauber, U., Schollenberger, M., and Geiger, H.H. 2001. Effects of genotype and genotype-environment interaction on deoxynivalenol accumulation and resistance to Fusarium head blight in rye, triticale, and wheat. Plant Breed 120:97-105. Miller, J.D., Young, J.C., and Sampson, D.R. 1985. Deoxynivalenol and Fusarium Head Blight resistance in spring cereals. J Phytopathol 113:359-367. Miller, J.D., Culley, J., Fraser, K., Hubbard, S., Meloche, F., Ouellet, T., Seaman, W.L., Seifert, K.A., Turkington, K., and Voldeng, H. 1998. Effect of tillage practice on fusarium head blight of wheat. Can J Plant Pathol 20:95-103. Mirocha, C.J., Xie, W., and Filho, E.R. 2003. Chemistry and detection of Fusarium mycotoxins. Pages 144-164 in: Fusarium Head Blight of Wheat and Barley. Eds. K.J. Leonard and W.R. Bushnell. The American Phytopathological Society, St. Paul, Minnesota. 199  Molina, A., Görlach, J., Volrath, S., and Ryals, J. 1999. Wheat genes encoding two types of PR-1 proteins are pathogen inducible, but do notrespond to activators of systemic acquired resistance. Mol Plant-Microbe Interact 12:53-58. Moreno-Escobar, J., Puc-Carrillo, A., Ceres-FarfÁN, M.C., PeÑa-RodrÍGuez, L.M., and Gamboa-Angulo, M.M. 2005. Two new zinniol-related phytotoxins from Alternaria solani. Nat Prod Lett 19:603 - 607. Morse, A.M., Tschaplinski, T.J., Dervinis, C., Pijut, P.M., Schmelz, E.A., Day, W., and Davis, J.M. 2007. Salicylate and catechol levels are maintained in nahG transgenic poplar. Phytochem 68:2043-2052. Moschini, R.C., and Fortugno, C. 1996. Predicting wheat head blight incidence using models based on meteorological factors in Pergamino, Argentina. Eur J Plant Pathol 102:211-218. Mou, Z., Fan, W., and Dong, X. 2003. Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell 113:935-944. Mudge, A.M., Dill-Macky, R., Dong, Y., Gardiner, D.M., White, R.G., and Manners, J.M. 2007. A role for the mycotoxin deoxynivalenol in stem colonisation during crown rot disease of wheat caused by Fusarium graminearum and Fusarium pseudograminearum. Physiol Mol Plant Path 69:73-85. Muhitch, M.J., McCormick, S.P., Alexander, N.J., and Hohn, T.M. 2000. Transgenic expression of the TRI101 or PDR5 gene increases resistance of tobacco to the phytotoxic effects of the trichothecene 4,15-diacetoxyscirpenol. Plant Sci 157:201207. Navarre, D.A., and Wolpert, T.J. 1999. Victorin induction of an apoptotic/senescence-like response in oats. Plant Cell 11:237-249. Nawrath, C., and Metraux, J.-P. 1999. Salicylic acid induction–deficient mutants of Arabidopsis express PR-2 and PR-5 and accumulate high levels of camalexin after pathogen inoculation. Plant Cell 11:1393-1404. Nawrath, C., Heck, S., Parinthawong, N., and Metraux, J.-P. 2002. EDS5, an essential component of salicylic acid-dependent signaling for disease resistance in Arabidopsis, is a member of the MATE transporter family. Plant Cell 14:275-286.  200  Nicholson, P., Sriniv Asachary, N., Gosman, N., Steed, A., and Chen, X. 2008. Role of phytohormone signalling in resistance of wheat to Fusarium head blight Cereal Res Commun 36:213-216. Nugroho, L.H., Verberne, M.C., and Verpoorte, R. 2001. Salicylic acid produced by isochorismate synthase and isochorismate pyruvate lyase in various parts of constitutive salicylic acid producing tobacco plants. Plant Sci 161:911-915. O'Donnell, K., Kistler, H.C., Tacke, B.K., and Casper, H.H. 2000. Gene genealogies reveal global phylogeographic structure and reproductive isolation among lineages of Fusarium graminearum, the fungus causing wheat scab. Proc Natl Acad Sci USA 97:7905-7910. Ohsato, S., Ochiai, F.T., Nishiuchi, T., Takahashi, A.N., Koizumi, S., Hamamoto, H., Kudo, T., Yamaguchi, I., and Kimura, M. 2007. Transgenic rice plants expressing trichothecene 3-O-acetyltransferase show resistance to the Fusarium phytotoxin deoxynivalenol. Plant Cell Rep 26:531-538. Okubara, P.A., Blechl, A.E., McCormick, S.P., Alexander, N.J., Dill, M.R., and Hohn, T.M. 2002. Engineering deoxynivalenol metabolism in wheat through the expression of a fungal trichothecene acetyltransferase gene. Theor Appl Genet 106:74-83. Oliver, R.E., Cal, X., Friesen, T.L., Halley, S., Stack, R.W., and Xu, S.S. 2008. Evaluation of Fusarium head blight resistance in tetraploid wheat (Triticum turgidum L.). Crop Sci 48:213-222. Pan, X., Welti, R., and Wang, X. 2010. Quantitative analysis of major plant hormones in crude plant extracts by high-performance liquid chromatography-mass spectrometry. Nat Protoc 5:986-992. Park, S.-W., Kaimoyo, E., Kumar, D., Mosher, S., and Klessig, D.F. 2007. Methyl salicylate is a critical mobile signal for plant systemic acquired resistance. Science 318:113-116. Paroo, Z., Liu, Q., and Wang, X. 2007. Biochemical mechanisms of the RNA-induced silencing complex. Cell Res 17:187-194. Parry, D.W., Jenkinson, P., and McLeod, L. 1995. Fusarium ear blight (scab) in small grain cereals—a review. Plant Pathol 44:207-238.  201  Paul, P.A., Lipps, P.E., Hershman, D.E., McMullen, M.P., Draper, M.A., and Madden, L.V. 2007. A Quantitative Review of Tebuconazole Effect on Fusarium Head Blight and Deoxynivalenol Content in Wheat. Phytopathology 97:211-220. Peplow, A.W., Meek, I.B., Wiles, M.C., Phillips, T.D., and Beremand, M.N. 2003. Tri16 is required for esterification of position C-8 during trichothecene mycotoxin production by Fusarium sporotrichioides. Appl Environ Microbiol 69:5935-5940. Perkowski, J., Kiecana, I., Schumacher, U., Mueller, H.M., Chelkowski, J., and Golinski, P. 1996. Head blight and biosynthesis of Fusarium toxins in barley kernels field inoculated with Fusarium culmorum. Eur J Plant Pathol 102:491-496. Pestka, J.J., and Smolinski, A.T. 2005. Deoxynivalenol: toxicology and potential effects on humans. J Tox Env Health 8:36-39. Pharand, B., Carisse, O., and Benhamou, N. 2002. Cytological aspects of compostmediated induced resistance against Fusarium Crown and Root Rot in tomato. Phytopathology 92:424-438. Pietro, A.D., Madrid, M.P., Caracuel, Z., Delgado-Jarana, J., and Roncero, M.I.G. 2003. Fusarium oxysporum: exploring the molecular arsenal of a vascular wilt fungus. Mol Plant Pathol 4:315-325. Ploetz, R.C. 1994. Panama disease: Return of the first banana menace. Int J Pest Manag 40:326 - 336. Podila, G.K., Rogers, L.M., and Kolattukudy, P.E. 1993. Chemical signals from avocado surface wax trigger germination and appressorium formation in Colletotrichum gloeosporioides. Plant Physiol 103:267-272. Pohnert, G. 2002. Phospholipase A2 activity triggers the wound-activated chemical defense in the diatom Thalassiosira rotula. Plant Physiol 129:103-111. Poppenberger, B., Berthiller, F., Lucyshyn, D., Sieberer, T., Schuhmacher, R., Krska, R., Kuchler, K., Glossl, J., Luschnig, C., and Adam, G. 2003. Detoxification of the Fusarium mycotoxin deoxynivalenol by a UDP-glucosyltransferase from Arabidopsis thaliana. J Biol Chem 278:47905-47914. Prandini, A., Sigolo, S., Filippi, L., Battilani, P., and Piva, G. 2008. Review of predictive models for Fusarium head blight and related mycotoxin contamination in wheat. Food Chem Toxicol 47:927-931. 202  Pritsch, C., Muehlbauer, G.J., Bushnell, W.R., Somers, D.A., and Vance, C.P. 2000. Fungal development and induction of defense response genes during early infection of wheat spikes by Fusarium graminearum. Mol Plant-Microbe Interact 13:159-169. Pritsch, C., Vance, C.P., Bushnell, W.R., Somers, D.A., Hohn, T.M., and Muehlbauer, G.J. 2001. Systemic expression of defense response genes in wheat spikes as a response to Fusarium graminearum infection. Physiol Mol Plant Path 58:1-12. Proctor, R.H., Hohn, T.M., and McCormick, S.P. 1995a. Reduced virulence of Gibberella zeae caused by disruption of a trichothecene toxin biosynthetic gene. Mol PlantMicrobe Interact 8:593-601. Proctor, R.H., Hohn, T.M., McCormick, S.P., and Desjardins, A.E. 1995b. Tri6 encodes an unusual zinc finger protein involved in regulation of trichothecene biosynthesis in Fusarium sporotrichioides. Appl Environ Microbiol 61:1923-1930. Reid, L.M., Bolton, A.T., Hamilton, R.I., Woldemariam, T., and Mather, D.E. 1992. Effect of silk age on resistance of maize to Fusarium graminearum. Can J Plant Pathol 14:293-298. Robeson, D.J., and Strobel, G.A. 1984. Zinniol induces chlorophyll retention in barley leaves: the selective action of a non host-specific phytotoxin. Phytochem 23:15971599. Rocha, O., Ansari, K., and Doohan, F.M. 2005. Effects of trichothecene mycotoxins on eukaryotic cells: A review. Food Addit Contam 22:369-378. Rodriguez, F.I., Esch, J.J., Hall, A.E., Binder, B.M., Schaller, G.E., and Bleecker, A.B. 1999. A copper cofactor for the ethylene receptor ETR1 from Arabidopsis. Science Feb 283:996-998. Ross, A.R.S., Ambrose, S.J., Cutler, A.J., Allan Feurtado, J., Kermode, A.R., Nelson, K., Zhou, R., and Abrams, S.R. 2004. Determination of endogenous and supplied deuterated abscisic acid in plant tissues by high-performance liquid chromatography-electrospray ionization tandem mass spectrometry with multiple reaction monitoring. Anal Biochem 329:324-333. Rotter, B.A., Prelusky, D.B., and Pestka, J.J. 1996. Toxicology of deoxynivalenol (Vomitoxin). J Tox Env Health 48:1-34.  203  Rudd, J.C., Horsley, R.D., McKendry, A.L., and Elias, E.M. 2001. Host plant resistance genes for Fusarium Head Blight: sources, mechanisms, and utility in conventional breeding systems. Crop Sci 41:620-627. Ruiz, M.T., Voinnet, O., and Baulcombe, D.C. 1998. Initiation and maintenance of virusinduced gene silencing. Plant Cell 10:937-946. Samuels, L., Kunst, L., and Jetter, R. 2008. Sealing plant surfaces: cuticular wax formation by epidermal cells. Annu Rev Plant Biol 59:683-707. Saniewski, M., and Czapski, J. 1985. Stimulatory effect of methyl jasmonate on the ethylene production in tomato fruits. Cell Mol Life Sci 41:256-257. Schaller, F., and Weiler, E.W. 1997. Enzymes of octadecanoid biosynthesis in plants 12oxo-phytodienoate 10,11-reductase. Eur J Biochem 245:294-299. Schaller, F., Biesgen, C., Müssig, C., Altmann, T., and Weiler, E.W. 2000. 12Oxophytodienoate reductase 3 (OPR3) is the isoenzyme involved in jasmonate biosynthesis. Planta 210:979-984. Schilmiller, A.L., Koo, A.J.K., and Howe, G.A. 2007. Functional diversification of acylcoenzyme A oxidases in jasmonic acid biosynthesis and action. Plant Physiol 143:812-824. Schoental, R. 1994. Mycotoxins in food and the plague of Athens. J Nutr Med 4:83-85. Schopfer, P. 1996. Hydrogen peroxide-mediated cell-wall stiffening in vitro in maize coleoptiles. Planta 199:43-49. Schroeder, H.W., and Christensen, J.J. 1963. Factors affecting resistance of wheat to scab by Gibberella zeae. Phytopathology 42:720-727. Schweizer, P., Buchala, A., and Metraux, J.P. 1997. Gene-expression patterns and levels of jasmonic acid in rice treated with the resistance inducer 2,6-dichloroisonicotinic acid. Plant Physiology 115:61-70. Scofield, S.R., Huang, L., Brandt, A.S., and Gill, B.S. 2005. Development of a virusinduced gene-silencing system for hexaploid wheat and its use in functional analysis of the Lr21-mediated leaf rust resistance pathway. Plant Physiol 138:21652173.  204  Scott, D.B., De Jager, E.J.H., and Van Wyk, P.S. 1988. Head blight of irrigated wheat in South Africa. Phytophylactica 20:317-319. Serino, L., Reimmann, C., Baur, H., Beyeler, M., Visca, P., and Haas, D. 1995. Structural genes for salicylate biosynthesis from chorismate in Pseudomonas aeruginosa. Mol Gen Genet 249:217-228. Shifrin, V.I., and Anderson, P. 1999. Trichothecene mycotoxins trigger a ribotoxic stress response that activates c-Jun N-terminal kinase and p38 mitogen-activated protein kinase and induces apoptosis. J Biol Chem 274:13985-13992. Smiley, R.W., Gourlie, J.A., Easley, S.A., Patterson, L.-M., and Whittaker, R.G. 2005. Crop damage estimates for crown rot of wheat and barley in the Pacific Northwest. Plant Dis 89:595-604. Snijders, C.H.A., and Perkowski, J. 1990. Effects of head blight caused by Fusarium culmorum on toxin content and weight of wheat kernels. Phytopathology 80:570. Spoel, S.H., Koornneef, A., Claessens, S.M.C., Korzelius, J.P., Van Pelt, J.A., Mueller, M.J., Buchala, A.J., Metraux, J.-P., Brown, R., Kazan, K., Van Loon, L.C., Dong, X., and Pieterse, C.M.J. 2003. NPR1 modulates cross-talk between aalicylate- and jasmonate-dependent defense pathways through a novel function in the cytosol. Plant Cell 15:760-770. Stack, R.W. 2003. History of Fusarium head blight with emphasis on North America. Pages 1-34 in: Fusarium Head Blight of Wheat and Barley. Eds. K.J. Leonard and W.R. Bushnell. The American Phytopathological Society, St. Paul, Minnesota. Starkey, D.E., Ward, T.J., Aoki, T., Gale, L.R., Kistler, H.C., Geiser, D.M., Suga, H., Toth, B., Varga, J., and O'Donnell, K. 2007. Global molecular surveillance reveals novel Fusarium head blight species and trichothecene toxin diversity. Fungal Genet Biol 44:1191-1204. Steffenson, B.J. 2003. Fusarium head blight of barley: impact, epidemics, management, and strategies for identifying and utilizating genetic resistance. Pages 241-295 in: Fusarium Head Blight of Wheat and Barley. Eds. K.J. Leonard and W.R. Bushnell. The American Phytopathological Society, St. Paul, Minnesota. Steiner, B., Kurz, H., Lemmens, M., and Buerstmayr, H. 2009. Differential gene expression of related wheat lines with contrasting levels of head blight resistance after Fusarium graminearum inoculation. Theor Appl Genet 118:753-764. 205  Steiner, B., Lemmens, M., Griesser, M., Scholz, U., Schondelmaier, J., and Bürstmayr, H. 2004. Molecular mapping of resistance to Fusarium head blight in the spring wheat cultivar Frontana. Theor Appl Genet 109:215-224. Strader, L.C., Beisner, E.R., and Bartel, B. 2009. Silver ions increase auxin efflux independently of effects on ethylene response. Plant Cell 21:3585-3590. Sudakin, D.L. 2003. Trichothecenes in the environment: Relevance to human health. Toxicol Lett 143:97-107. Summermatter, K., Sticher, L., and Metraux, J.P. 1995. Systemic responses in Arabidopsis thaliana infected and challenged with Pseudomonas syringae pv syringae. Plant Physiol 108:1379-1385. Sun, J.Y., Gaudet, D.A., Lu, Z.X., Frick, M., Puchalski, B., and Laroche, A. 2008. Characterization and antifungal properties of wheat nonspecific lipid transfer proteins. Mol Plant-Microbe Interact 21:346-360. Tag, A.G., Garifullina, G.F., Peplow, A.W., Ake, C., Jr., Phillips, T.D., Hohn, T.M., and Beremand, M.N. 2001. A novel regulatory gene, Tri10, controls trichothecene toxin production and gene expression. Appl Environ Microbiol 67:5294-5302. Tanaka, A., Shiotani, H., Yamamoto, M., and Tsuge, T. 1999. Insertional mutagenesis and cloning of the genes required for biosynthesis of the host-specific AK-toxin in the Japanese pear pathotype of Alternaria alternata. Mol Plant-Microbe Interact 12:691-702. Tekauz, A., McCallum, B., and Gilbert, J. 2000. Review: Fusarium head blight of barley in western Canada. Can J Plant Pathol 22:9-16. Tekauz, A., McCallum, B., Ames, N., and Fetch, J.M. 2004. Fusarium head blight of oat— current status in western Canada. Can J Plant Pathol 26:473-479. Tekauz, A., Mitchell Fetch, J.W., Rossnagel, B.G., and Savard, M.E. 2008. Progress in assessing the impact of Fusarium head blight on oat in western Canada and screening of avena germplasm for resistance. Cereal Res Commun 36:49-56. Thatcher, L.F., Manners, J.M., and Kazan, K. 2009. Fusarium oxysporum hijacks COI1mediated jasmonate signaling to promote disease development in Arabidopsis. Plant J 58:927-939.  206  Thoma, I., Loeffler, C., Sinha, A.K., Gupta, M., Krischke, M., Steffan, B., Roitsch, T., and Mueller, M.J. 2003. Cyclopentenone isoprostanes induced by reactive oxygen species trigger defense gene activation and phytoalexin accumulation in plants. The Plant Journal 34:363-375. Thomma, B.P.H.J., Eggermont, K., Penninckx, I.A.M.A., Mauch-Mani, B., Vogelsang, R., Cammue, B.P.A., and Broekaert, W.F. 1998. Separate jasmonate-dependent and salicylate-dependent defense-response pathways in Arabidopsis are essential for resistance to distinct microbial pathogens. Proc Natl Acad Sci USA 95:1510715111. Thuleau, P., Graziana, A., Rossignol, M., Kauss, H., Auriol, P., and Ranjeva, R. 1988. Binding of the phytotoxin zinniol stimulates the entry of calcium into plant protoplasts. Proc Natl Acad Sci USA 85:5932-5935. Tokai, T., Koshino, H., Takahashi, A.N., Sato, M., Fujimura, M., and Kimura, M. 2007. Fusarium Tri4 encodes a key multifunctional cytochrome P450 monooxygenase for four consecutive oxygenation steps in trichothecene biosynthesis. Biochem Biophys Res Commun 353:412-417. Ton, J., Van Pelt, J.A., Van Loon, L.C., and Pieterse, C.M.J. 2002. Differential effectiveness of salicylate-dependent and jasmonate/ethylene-dependent induced resistance in Arabidopsis. Mol Plant-Microbe Interact 15:27-34. Tornroth-Horsefield, S., Wang, Y., Hedfalk, K., Johanson, U., Karlsson, M., Tajkhorshid, E., Neutze, R., and Kjellbom, P. 2006. Structural mechanism of plant aquaporin gating. Nature 439:688-694. Tóth, B., Mesterházy, Á., Horvath, Z., Bartók, T., Varga, M., and Varga, J. 2005. Genetic variability of central European isolates of the Fusarium graminearum species complex. Eur J Plant Pathol 113:35-45. Travella, S., Klimm, T.E., and Keller, B. 2006. RNA interference-based gene silencing as an efficient tool for functional genomics in hexaploid bread wheat. Plant Physiol 142:6-20. Tuominen, H., Overmyer, K., Keinänen, M., Kollist, H., and Kangasjärvi, J. 2004. Mutual antagonism of ethylene and jasmonic acid regulates ozone-induced spreading cell death in Arabidopsis. Plant J 39:59-69. Uchiyama, T., and Okuyama, K. 1990. Participation of Oryza sativa leaf wax in appressorium formation by Pyricularia oryzae. Phytochem 29:91-92. 207  Uchiyama, T., Ogasawara, N., Nanba, Y., and Ito, H. 1979. Conidial germination and appressorial formation of the plant pathogenic fungi on the coverglass or cellophane coated with various lipid components of plant waxes. Agric Biol Chem 43:383-384. Ueno, Y. 1977. Mode of action of trichothecenes. Ann Nutr Aliment 31:885-900. Ueno, Y. 1983. Trichothecenes: chemical, biological and toxicological aspects. Elsevier Scientific Publishers, Amsterdam. Ueno, Y. 1985. The toxicology of mycotoxins. Crit Rev Toxicol 14:99-133. van Kammen, A. 1997. Virus-induced gene silencing in infected and transgenic plants. Trends Plant Sci 2:409-411. van Loon, L.C., Geraats, B.P.J., and Linthorst, H.J.M. 2006. Ethylene as a modulator of disease resistance in plants. Trends Plant Sci 11:184-191. Vernooij, B., Friedrich, L., Morse, A., Reist, R., Kolditz-Jawhar, R., Ward, E., Uknes, S., Kessmann, H., and Ryals, J. 1994. Salicylic acid is not the translocated signal responsible for inducing systemic acquired resistance but is required in signal transduction. Plant Cell 6:959-965. Vick, B.A., and Zimmerman, D.C. 1981. Lipoxygenase, hydroperoxide isomerase, and hydroperoxide cyclase in young cotton seedlings. Plant Physiol 67:92-97. Vick, B.A., and Zimmerman, D.C. 1983. The biosynthesis of jasmonic acid: a physiological role for plant lipoxygenase. Biochem Biophys Res Commun 111:470477. Vick, B.A., and Zimmerman, D.C. 1987. Pathways of fatty acid hydroperoxide metabolism in spinach leaf chloroplasts. Plant Physiol 85:1073-1078. Voigt, C.A., Schafer, W., and Salomon, S. 2005. A secreted lipase of Fusarium graminearum is a virulence factor required for infection of cereals. Plant J 42:364375. Wang, K.L.C., Li, H., and Ecker, J.R. 2002. Ethylene biosynthesis and signaling networks. Plant Cell 14:S131-151.  208  Wang, S.Y., Adams, D.O., and Lieberman, M. 1982. Recycling of 5'-methylthioadenosineribose carbon atoms into methionine in tomato tissue in relation to ethylene production. Plant Physiol 70:117-121. Wang, Y., Yang, L., Xu, H., Li, Q., Ma, Z., and Chu, C. 2005. Differential proteomic analysis of proteins in wheat spikes induced by Fusarium graminearum. Proteomics 5:4496-4503. Wang, Y.Z., and Miller, J.D. 1988. Effects of Fusarium graminearum metabolites on wheat tissue in relation to Fusarium Head Blight resistance. J Phytopathol 122:118125. Ward, T.J., Clear, R.M., Rooney, A.P., O'Donnell, K., Gaba, D., Patrick, S., Starkey, D.E., Gilbert, J., Geiser, D.M., and Nowicki, T.W. 2008. An adaptive evolutionary shift in Fusarium head blight pathogen populations is driving the rapid spread of more toxigenic Fusarium graminearum in North America. Fungal Genet Biol 45:473-484. Wasternack, C. 2007. Jasmonates: an update on biosynthesis, signal transduction and action in plant stress response, growth and development. Ann Bot 100:681-697. Wildermuth, M.C., Dewdney, J., Wu, G., and Ausubel, F.M. 2001. Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature 414:562-565. Williamson, B., Tudzynski, B., Tudzynski, P., and Van Kan, J.A.L. 2007. Botrytis cinerea: the cause of grey mould disease. Mol Plant Pathol 8:561-580. Wolpert, T.J., Dunkle, L.D., and Ciuffetti, L.M. 2002. Host-selective toxins and avirulence determinants: what's in a name? Annu Rev Phytopathol 40:251-285. Wu, G., Robertson, A.J., Liu, X., Zheng, P., Wilen, R.W., Nesbitt, N.T., and Gusta, L.V. 2004a. A lipid transfer protein gene BG-14 is differentially regulated by abiotic stress, ABA, anisomycin, and sphingosine in bromegrass (Bromus inermis). J Plant Physiol 161:449-458. Wu, Z., Irizarry, R.A., Gentleman, R., Martinez-Murillo, F., and Spencer, F. 2004b. A model-based background adjustment for oligonucleotide expression arrays. J Am Stat Assoc 99:909-917. Wuriyanghan, H., Zhang, B., Cao, W.-H., Ma, B., Lei, G., Liu, Y.-F., Wei, W., Wu, H.-J., Chen, L.-J., Chen, H.-W., Cao, Y.-R., He, S.-J., Zhang, W.-K., Wang, X.-J., Chen, S.-Y., and Zhang, J.-S. 2009. The ethylene receptor ETR2 delays floral transition and affects starch accumulation in rice. Plant Cell 21:1473-1494. 209  Xie, D.-X., Feys, B.F., James, S., Nieto-Rostro, M., and Turner, J.G. 1998. COI1: an Arabidopsis gene required for jasmonate-regulated defense and fertility. Science 280:1091-1094. Xu, X. 2003. Effects of environmental conditions on the development of Fusarium ear blight. Eur J Plant Pathol 109:683-689. Xu, Y., Chang, P.F.L., Liu, D., Narasimhan, M.L., Raghothama, K.G., Hasegawa, P.M., and Bressan, R.A. 1994. Plant defense genes are synergistically induced by ethylene and methyl jasmonate. Plant Cell 6:1077-1085. Xue, Y.J., Tao, L., and Yang, Z.M. 2008. Aluminum-induced cell wall peroxidase activity and lignin synthesis are differentially regulated by jasmonate and nitric oxide. J Ag Food Chem 56:9676-9684. Yagen, B., and Joffe, A.Z. 1976. Screening of toxic isolates of Fusarium poae and Fusarium sporotrichioides involved in causing alimentary toxic aleukia. Appl Environ Microbiol 32:423-427. Yamane, H., Sugawara, J., Suzuki, Y., Shimamura, E., and Takahashi, N. 1980. Syntheses of jasmonic acid related compounds and their structure-activity relationships on the growth of rice seedings. Agric Biol Chem 44:2857. Yeats, T.H., and Rose, J.K. 2008. The biochemistry and biology of extracellular plant lipidtransfer proteins (LTPs). Protein Sci 17:191-198. Yen, K.M., and Gunsalus, I.C. 1982. Plasmid gene organization: naphthalene/salicylate oxidation. Proc Natl Acad Sci USA 79:874-878. Yu, G.Y., and Muehlbauer, G.J. 2001. Benzothiadiazole-induced gene expression in wheat spikes does not provide resistance to Fusarium Head Blight. Physiol Mol Plant Path 59:129-136. Yu, I.C., Parker, J., and Bent, A.F. 1998. Gene-for-gene disease resistance without the hypersensitive response in Arabidopsis dnd1 mutant. Proc Natl Acad Sci U S A 95:7819-7824. Yu, Y.-B., Adams, D.O., and Yang, S.F. 1979. 1-Aminocyclopropanecarboxylate synthase, a key enzyme in ethylene biosynthesis. Arch Biochem Biophys 198:280-286.  210  Yubero-Serrano, E.M., Moyano, E., Medina-Escobar, N., Munoz-Blanco, J., and Caballero, J.L. 2003. Identification of a strawberry gene encoding a non-specific lipid transfer protein that responds to ABA, wounding and cold stress. J Exp Bot 54:1865-1877. Zachowski, A., Guerbette, F., Grosbois, M., Jolliot-Croquin, A., and Kader, J.C. 1998. Characterisation of acyl binding by a plant lipid-transfer protein. Eur J Biochem 257:443-448. Zhang, B., Pan, X., Cobb, G.P., and Anderson, T.A. 2006a. Plant microRNA: a small regulatory molecule with big impact. Dev Biol 289:3-16. Zhang, G., and Mergoum, M. 2007. Molecular mapping of kernel shattering and its association with Fusarium head blight resistance in a Sumai3 derived population. Theor Appl Genet 115:757-766. Zhang, X., Yang, S., Zhou, Y., He, Z., and Xia, X. 2006b. Distribution of the Rht-B1b, RhtD1b and Rht8 reduced height genes in autumn-sown Chinese wheats detected by molecular markers. Euphytica 152:109-116. Zhang, Y., Fan, W., Kinkema, M., Li, X., and Dong, X. 1999. Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene. Proc Natl Acad Sci USA 96:6523-6528. Zhou, W., Kolb, F.L., and Riechers, D.E. 2005. Identification of proteins induced or upregulated by Fusarium head blight infection in the spikes of hexaploid wheat (Triticum aestivum). Genome 48:770-780. Zhou, W., Eudes, F., and Laroche, A. 2006. Identification of differentially regulated proteins in response to a compatible interaction between the pathogen Fusarium graminearum and its host, Triticum aestivum. Proteomics 6:4599-4609. Zhu, H., Gilchrist, L., Hayes, P., Kleinhofs, A., Kudrna, D., Liu, Z., Prom, L., Steffenson, B., Toojinda, T., and Vivar, H. 1999. Does function follow form? Principal QTLs for Fusarium head blight (FHB) resistance are coincident with QTLs for inflorescence traits and plant height in a doubled-haploid population of barley. Theor Appl Genet 99:1221-1232.  211  Appendix: Supplementary Tables and Figures  Table A1. Challenge-dependent differentially regulated genes in FHB-susceptible ‘Superb’ amd resistant genotypes. Positive and negative FD values indicate higher and lower transcript accumulation, respectively, in FgTri5+ (FgTri5+ vs water), FgTri5(FgTri5- vs water), DON (DON vs water), and in FgTri5+ vs FgTri5-. Probe Set ID  regulation  hai  FD  p-val  Ta.12319.1.A1_at  down  3  2.3  0.018  Ta.1979.2.S1_x_at  down  3  2.2  0.048  Ta.5633.3.A1_at TaAffx.27931.1.S1_at  down down  3 3  2.0 2.1  0.003 0.009  TaAffx.57167.1.S1_at  down  3  2.0  0.036  Ta.497.2.S1_x_at  down  8  2.6  0.008  TaAffx.52404.1.S1_at Ta.14235.2.S1_x_at Ta.16011.1.S1_at Ta.2638.1.S1_at  down down down down  8 24 24 24  2.7 2.1 2.3 2.6  0.000 0.037 0.010 0.046  Ta.27542.1.S1_at  down  24  2.0  0.007  Gene Symbol  Gene Title  Superb Tri5+ vs water  rab 15B  ribosomal protein S5 (animal contaminant) 31 kDa ribonucleoprotein, chloroplast precursor NITRATE REDUCTASE (NR) synaptobrevin [Triticum monococcum] similar to uroporphyrinogen decarboxylase [Oryza sativa (japonica cultivar-group)] PROTEIN TRANSPORT PROTEIN SEC23A (SEC23-RELATED PROTEIN A) unknown unknown unknown rab protein Ketol-acid reductoisomerase, chloroplast precursor (Acetohydroxy-acid reductoisomerase) (Alpha-keto-betahydroxylacil  212  Probe Set ID  regulation  hai  FD  p-val  Ta.9085.3.S1_x_at  down  24  2.2  0.012  TaAffx.108878.1.S1_x_at  down  24  2.1  0.019  TaAffx.111598.2.S1_s_at TaAffx.121246.1.S1_at TaAffx.64328.1.S1_at TaAffx.6593.2.S1_at TaAffx.88122.4.S1_at  down down down down down  24 24 24 24 24  2.3 2.1 2.0 2.1 2.1  0.035 0.003 0.004 0.010 0.002  Ta.11565.1.A1_at  up  3  2.6  0.016  TaAffx.111915.1.S1_at  up  3  2.2  0.040  TaAffx.31923.1.S1_at  up  3  2.0  0.028  TaAffx.56177.1.S1_at  up  3  2.2  0.038  Ta.10769.1.A1_at  up  8  2.4  0.000  Ta.10859.1.A1_at  up  8  2.1  0.048  Ta.20029.1.S1_at Ta.223.1.S1_at Ta.23165.1.S1_at Ta.26556.1.A1_at  up up up up  8 8 8 8  2.2 2.2 2.3 2.1  0.002 0.033 0.041 0.004  Ta.5445.2.S1_at  up  8  2.0  0.029  Ta.6578.2.S1_x_at  up  8  2.6  0.027  Gene Symbol  LOC543447  Gene Title unknown protein [Arabidopsis thaliana] gi|16649041|gb|AAL24372.1| unknown protein [Arabidopsis thaliana] gi|21618051|gb|AAM67101.1| unknown [Arabidopsis thaliana] 60S RIBOSOMAL PROTEIN L5 [Neurospora crassa] unknown unknown GTP-binding protein Chloroplast 50S ribosomal protein L33 Cytochrome P450 90D2 (C6-oxidase) putative Ca2+-dependent lipid-binding protein [Oryza sativa (japonica cultivar-group)] unknown serine/threonine protein kinase [Oryza sativa (japonica cultivar-group)] hypothetical protein [Oryza sativa (japonica cultivar-group)] unknown Transcribed locus, moderately similar to XP_473516.1 OSJNBa0017B10.7 [Oryza sativa (japonica cultivar-group)] unknown Beta-1,3-glucanase precursor (Glb3) unknown Zea mays unknown mRNA, partial sequence PREDICTED P0654B04.18 gene product [Oryza sativa (japonica cultivar-group)] gi|50912235|ref|XP_467525.1| unknown protein [Oryza sativa (japonica cultivar-group)] transaldolase ToTAL2 [Oryza sativa (japonica cultivar-group)]  213  Probe Set ID  regulation  hai  FD  p-val  Ta.7702.2.S1_x_at  up  8  2.1  0.039  Ta.8582.2.S1_a_at TaAffx.106775.1.S1_at  up up  8 8  2.0 2.1  0.001 0.017  TaAffx.107918.1.S1_at  up  8  2.0  0.015  TaAffx.108743.1.S1_at  up  8  2.1  0.007  TaAffx.109085.1.S1_at  up  8  2.2  0.010  TaAffx.113515.1.S1_at  up  8  2.1  0.003  TaAffx.113624.2.S1_at  up  8  2.7  0.005  TaAffx.128541.59.A1_at TaAffx.12878.1.A1_at TaAffx.218.1.S1_at TaAffx.36998.1.S1_at  up up up up  8 8 8 8  2.9 2.1 2.2 2.1  0.041 0.006 0.036 0.034  TaAffx.56014.3.S1_at  up  8  2.6  0.001  TaAffx.56793.1.S1_x_at  up  8  2.8  0.020  TaAffx.65440.1.S1_at  up  8  2.7  0.026  TaAffx.83019.1.S1_at  up  8  3.2  0.032  TaAffx.96741.2.S1_at  up  8  2.2  0.047  Ta.18832.2.S1_at  up  24  2.1  0.032  Ta.21120.1.S1_at  up  24  3.1  0.017  Gene Symbol  Gene Title Calcineurin B-like protein 3 (SOS3-like calcium binding protein 6) unknown unknown CYTOCHROME P450 71A1 (CYPLXXIA1) (ARP-2) similar to beta-1,3-glucanase 2a [Hordeum vulgare] glucosyltransferase [Oryza sativa (japonica cultivar-group)] (contig annotation) unknown Serine/threonine-protein kinase BRI1-like 3 precursor (BRASSINOSTEROID INSENSITIVE 1-like protein 3) transposon [Triticum aestivum] wall-associated kinase 3 [Triticum aestivum] unknown unknown 41 kD chloroplast nucleoid DNA binding protein (CND41) [Oryza sativa (japonica cultivar-group)] diaphanous homologue-like [Oryza sativa (japonica cultivar-group)] (contig annotation) peptide chain release factor subunit 1 (ERF1) [Oryza sativa (japonica cultivar-group)] Inorganic diphosphatase OSJNBa0039K24.21 [Oryza sativa (japonica cultivar-group)] gi|38345518|emb|CAE01802.2| OSJNBa0039K24.21 [Oryza sativa (japonica cultivar-group)] unknown Glucan endo-1,3-beta-D-glucosidase (contig annotation)  214  Probe Set ID  regulation  hai  FD  p-val  Ta.21650.1.A1_at  up  24  2.0  0.015  Ta.22562.1.S1_at  up  24  2.1  0.045  Ta.22981.3.S1_a_at  up  24  2.5  0.002  Ta.5042.1.A1_at Ta.82.1.S1_at Ta.8545.2.S1_at TaAffx.110215.1.S1_x_at  up up up up  24 24 24 24  2.0 2.7 2.3 2.7  0.047 0.027 0.024 0.013  TaAffx.131249.1.S1_s_at  up  24  2.4  0.036  TaAffx.27956.1.S1_at  up  24  2.2  0.010  TaAffx.4083.5.A1_x_at  up  24  3.1  0.000  TaAffx.57405.1.S1_x_at  up  24  2.2  0.017  TaAffx.59664.1.S1_at TaAffx.6823.1.S1_at TaAffx.71003.1.S1_at  up up up  24 24 24  2.1 2.4 2.1  0.016 0.014 0.028  TaAffx.79727.1.S1_at  up  24  2.2  0.049  TaAffx.81742.1.S1_at TaAffx.83360.1.S1_at  up up  24 24  2.7 2.0  0.027 0.005  TaAffx.9022.1.S1_at  up  24  2.8  0.028  TaAffx.92097.1.S1_at TaAffx.92097.1.S1_x_at  up up  24 24  2.2 2.3  0.037 0.019  Gene Symbol  LOC543287  SH6.2  Gene Title Transcribed locus, weakly similar to NP_921072.1 putative disease resistance gene [Oryza sativa (japonica cultivar-group)] Glucan endo-1,3-beta-D-glucosidase cytochrome P450 protein [Arabidopsis thaliana] unknown peroxidase unknown unknown beta-1,3-glucanase [Oryza sativa (japonica cultivar-group)] unknown similar to vacuolar sorting receptor protein homolog PV72 [Cucurbita cv. Kurokawa Amakuri] similar to tonoplast membrane integral protein [Oryza sativa (japonica cultivar-group)] (contig annotation) unknown S-adenosyl-L-homocysteine hydrolase unknown C2 domain-containing protein [Hordeum vulgare subsp. vulgare] unknown Annexin A13 (Annexin XIII) beta-1,3-glucanase precursor [Oryza sativa (japonica cultivar-group)] unknown unknown  Tri5- vs water  215  Probe Set ID  regulation  hai  FD  p-val  Ta.10781.1.A1_at  down  3  3.5  0.010  Ta.12470.1.A1_at Ta.9346.3.S1_x_at  down down  3 3  2.0 2.2  0.030 0.049  TaAffx.83824.1.S1_at  down  3  2.7  0.047  Ta.497.2.S1_x_at  down  8  2.4  0.004  TaAffx.52404.1.S1_at  down  8  2.7  0.019  Ta.10357.2.A1_s_at  down  24  2.0  0.049  Ta.10781.1.A1_at  down  24  4.9  0.009  Ta.11242.1.A1_at  down  24  2.2  0.009  Ta.11332.1.A1_at  down  24  2.1  0.050  Ta.11565.1.A1_at  down  24  2.3  0.043  Ta.12109.1.A1_at Ta.12319.1.A1_at  down down  24 24  2.2 4.6  0.041 0.041  Ta.12402.1.S1_at  down  24  2.5  0.039  Ta.16011.1.S1_at  down  24  2.7  0.002  Ta.18587.1.S1_x_at  down  24  2.3  0.000  Gene Symbol  Gene Title 60S acidic ribosomal protein P0 (DNA(apurinic or apyrimidinic site) lyase) (animal contaminant) unknown ABSCISIC STRESS RIPENING PROTEIN 1 dioscorin class A precursor [Oryza sativa (japonica cultivar-group)] PROTEIN TRANSPORT PROTEIN SEC23A (SEC23-RELATED PROTEIN A) unknown zinc finger protein [Oryza sativa] (contig annotation) 60S acidic ribosomal protein P0 (DNA(apurinic or apyrimidinic site) lyase) (animal contaminant) unknown P0421H07.26 [Oryza sativa (japonica cultivargroup)] gi|20804607|dbj|BAB92298.1| P0421H07.26 [Oryza sativa (japonica cultivargroup)] gi|13872913|dbj|BAB44019.1| P0684B02.6 [Oryza sativa (japonica cultivargrou putative Ca2+-dependent lipid-binding protein [Oryza sativa (japonica cultivar-group)] unknown ribosomal protein S5 (animal contaminant) hypothetical protein [Oryza sativa (japonica cultivar-group)] gi|48717095|dbj|BAD22868.1| hypothetical protein [Oryza sativa (japonica cultivar-group)] unknown systemin receptor SR160 precursor (Brassinosteroid LRR receptor kinase) [Oryza sativa (japonica cultivar-group)]  216  Probe Set ID  regulation  hai  FD  p-val  Ta.21213.3.S1_x_at  down  24  2.1  0.018  Ta.24110.1.A1_s_at  down  24  2.5  0.028  Ta.3748.1.A1_at  down  24  2.2  0.015  Ta.426.1.A1_at  down  24  2.5  0.022  TaAffx.106139.1.S1_at TaAffx.111283.1.S1_at  down down  24 24  2.1 2.0  0.004 0.040  TaAffx.120138.1.A1_at  down  24  2.3  0.025  TaAffx.120404.1.S1_at  down  24  2.1  0.006  TaAffx.128835.3.S1_x_at TaAffx.23052.1.S1_at TaAffx.23875.1.S1_at  down down down  24 24 24  2.1 2.1 2.4  0.014 0.004 0.011  TaAffx.50737.1.S1_at  down  24  2.0  0.047  TaAffx.56516.1.S1_at  down  24  2.5  0.049  TaAffx.59491.1.S1_at  down  24  2.2  0.005  TaAffx.82948.1.S1_at  down  24  2.5  0.021  Gene Symbol  Gene Title similar to myb family transcription factor [Arabidopsis thaliana] putative proline-rich protein [Oryza sativa (japonica cultivar-group)] gi|14488319|gb|AAK63900.1| Putative prolinerich protein [Oryza sativa] HEXOKINASE 1 linalool synthase [Oryza sativa (japonica cultivar-group)] / terpene synthase [Oryza sativa (japonica cultivar-group)] unknown unknown Transcribed locus, weakly similar to NP_919846.1 putative proline-rich protein [Oryza sativa (japonica cultivar-group)] putative permease 1 [Oryza sativa (japonica cultivar-group)] gi|38637273|dbj|BAD03537.1| putative permease 1 [Oryza sativa (japonica cultivar-group)] gi|38637220|dbj|BAD03486.1| putative permease 1 [Oryza sativ unknown unknown unknown Transcribed locus, weakly similar to NP_178396.1 protein binding / ubiquitinprotein ligase/ zinc ion binding [Arabidopsis thaliana] F-box containing protein transport inhibitor response TIR1-like [Oryza sativa (japonica cultivar-group)] T.aestivum atp-2 mRNA for ATP synthase beta subunit unknown  217  Probe Set ID  regulation  hai  FD  p-val  TaAffx.86251.1.S1_at  down  24  2.0  0.018  Ta.10200.1.A1_x_at  up  3  2.1  0.027  Ta.1614.1.S1_at  up  3  2.1  0.000  Ta.22966.3.S1_at  up  3  2.0  0.001  Ta.4470.1.S1_at  up  3  2.3  0.049  Ta.6173.3.S1_at  up  3  2.2  0.004  TaAffx.111915.1.S1_at TaAffx.128541.69.S1_at TaAffx.25679.1.S1_at TaAffx.35350.1.S1_at  up up up up  3 3 3 3  2.3 7.4 2.3 2.2  0.012 0.046 0.015 0.001  TaAffx.56177.1.S1_at  up  3  2.0  0.020  TaAffx.6790.2.S1_at  up  3  2.0  0.000  TaAffx.77918.1.S1_at  up  3  2.2  0.005  TaAffx.82114.1.S1_at TaAffx.83405.1.S1_at  up up  3 3  2.0 2.1  0.001 0.001  Ta.16143.1.A1_at  up  8  2.1  0.009  Ta.20297.1.S1_at  up  8  2.1  0.017  Ta.22172.1.S1_x_at  up  8  2.0  0.035  Gene Symbol  Gene Title Oryza sativa (japonica cultivar-group) cDNA clone:J023087L18, full insert sequence Xylem serine proteinase 1 precursor (AtXSP1) (Cucumisin-like protein) unknown F1F0-ATPase inhibitor protein [Oryza sativa (japonica cultivar-group)] (contig annotation) similar to ethylene-binding protein-like [Oryza sativa (japonica cultivar-group)] / AP2 domaincontaining transcription factor-like [Oryza sativa (japonica cultivar-group)] hypersensitive-induced reaction protein 4 [Hordeum vulgare subsp. vulgare] unknown unknown ribosomal protein S4 [Panax ginseng] hypothetical protein [Oryza sativa (japonica cultivar-group)] Triticum monococcum BAC clone 453N11, complete sequence Hordeum vulgare Ty3/gypsy retrotransposon cereba gag-pol polyprotein gene, partial cds unknown unknown Transcribed locus, weakly similar to NP_914180.1 P0475H04.16 [Oryza sativa (japonica cultivar-group)] unknown HGWP repeat containing protein-like [Oryza sativa (japonica cultivar-group)]  218  Probe Set ID  regulation  hai  FD  p-val  Ta.28224.2.S1_x_at  up  8  2.1  0.008  Ta.6578.2.S1_x_at  up  8  2.6  0.008  Ta.8071.1.A1_at  up  8  2.0  0.011  TaAffx.105364.1.S1_at  up  8  2.0  0.011  TaAffx.111861.1.S1_x_at  up  8  2.5  0.001  TaAffx.113624.2.S1_at  up  8  2.3  0.006  TaAffx.128541.59.A1_at TaAffx.218.1.S1_at  up up  8 8  4.9 2.2  0.025 0.007  TaAffx.25602.1.S1_s_at  up  8  2.1  0.042  TaAffx.29302.1.S1_at  up  8  2.0  0.013  TaAffx.30272.3.A1_at TaAffx.51102.1.S1_at  up up  8 8  2.0 2.0  0.040 0.002  TaAffx.58772.1.S1_at  up  8  2.2  0.001  TaAffx.59356.1.S1_at  up  8  2.1  0.001  TaAffx.65484.1.A1_at  up  8  2.0  0.001  TaAffx.81381.1.S1_at TaAffx.83019.1.S1_at  up up  8 8  2.0 3.2  0.047 0.027  Ta.22981.3.S1_a_at  up  24  2.4  0.006  Gene Symbol  Gene Title Transcribed locus, weakly similar to NP_918838.1 OSJNBb0093M23.11 [Oryza sativa (japonica cultivar-group)] transaldolase ToTAL2 [Oryza sativa (japonica cultivar-group)] Oryza sativa chromosome 3 BAC OSJNBa0052F07 genomic sequence, complete sequence unknown Ty3/gypsy-like retrotransposon [Triticum aestivum] Serine/threonine-protein kinase BRI1-like 3 precursor (BRASSINOSTEROID INSENSITIVE 1-like protein 3) transposon [Triticum aestivum] unknown tandem repeat sequence specific for chromosome arm 4AS [Triticum monococcum] retrotransposon protein, putative, Ty1-copia sub-class [Oryza sativa (japonica cultivargroup)] unknown unknown 12-oxophytodienoate reductase 3 (12oxophytodienoate-10,11-reductase 3) (OPDAreductase 3) (LeOPR3) Aegilops tauschii calcineurin B-like protein 8 (CBL8) [Oryza sativa (japonica cultivar-group)] (contig annotation) unknown Inorganic diphosphatase cytochrome P450 protein [Arabidopsis thaliana]  219  Probe Set ID  regulation  hai  FD  p-val  Ta.3420.2.S1_at  up  24  2.2  0.006  TaAffx.12576.1.A1_at  up  24  2.1  0.005  TaAffx.4083.5.A1_x_at  up  24  2.5  0.000  TaAffx.57405.1.S1_x_at  up  24  2.4  0.000  TaAffx.71003.1.S1_at  up  24  2.3  0.007  Ta.10532.1.A1_s_at Ta.12088.1.S1_at Ta.12470.1.A1_at Ta.13423.1.S1_at Ta.14129.3.S1_x_at Ta.19355.1.S1_at Ta.20147.2.S1_at Ta.20205.1.A1_s_at Ta.2278.2.S1_a_at  down down down down down down down down down  3 3 3 3 3 3 3 3 3  2.9 2.2 2.2 2.0 2.1 2.0 2.4 2.3 2.0  0.005 0.030 0.022 0.034 0.035 0.010 0.003 0.014 0.022  Ta.27268.1.S1_at  down  3  2.1  0.025  Ta.27725.1.S1_at  down  3  2.0  0.024  Ta.28171.1.S1_at  down  3  2.3  0.045  Ta.526.1.S1_x_at Ta.7022.1.S1_at Ta.7022.1.S1_x_at  down down down  3 3 3  2.8 2.1 2.3  0.010 0.026 0.016  Ta.9361.2.S1_x_at  down  3  2.0  0.004  Gene Symbol  Gene Title similar to acyl-CoA oxidase ACX3 [Arabidopsis thaliana] unknown similar to vacuolar sorting receptor protein homolog PV72 [Cucurbita cv. Kurokawa Amakuri] similar to tonoplast membrane integral protein [Oryza sativa (japonica cultivar-group)] (contig annotation) unknown  DON vs water LOC778394  ver2 LOC542963  wpi6  pore-forming toxin-like protein Hfr-2 unknown unknown unknown unknown unknown unknown ver2 protein Cyc07 Clone wl1.pk0012.d7:fis, full insert mRNA sequence plasma membrane protein Clone wdk2c.pk011.j13:fis, full insert mRNA sequence Lipoxygenase (contig annotation) Phenylalanine ammonia-lyase Phenylalanine ammonia-lyase Transcribed locus, moderately similar to NP_914565.1 putative zinc finger transcription factor [Oryza sativa (japonica cultivar-group)]  220  Probe Set ID  regulation  hai  FD  p-val  Ta.9590.1.S1_at  down  3  2.4  0.037  TaAffx.105521.1.S1_at  down  3  2.4  0.020  TaAffx.107003.1.S1_at  down  3  2.0  0.016  TaAffx.112290.2.S1_at  down  3  2.4  0.024  TaAffx.128418.38.S1_at  down  3  2.0  0.000  TaAffx.29617.1.S1_at TaAffx.52983.1.S1_at  down down  3 3  2.0 2.1  0.014 0.027  TaAffx.55998.1.S1_at  down  3  2.1  0.012  TaAffx.61713.1.S1_at  down  3  2.1  0.020  TaAffx.6797.2.S1_at  down  3  2.2  0.022  TaAffx.86830.1.S1_at  down  3  2.0  0.037  TaAffx.9179.1.S1_at  down  3  2.1  0.029  Gene Symbol  Gene Title unknown pore-forming toxin-like protein Hfr-2 [Triticum aestivum] similar to 50S ribosomal protein L4, chloroplast (CL4) [Arabidopsis thaliana] putative acid phosphatase [Hordeum vulgare subsp. vulgare] gi|41529149|emb|CAB71336.2| putative acid phosphatase [Hordeum vulgare subsp. vulgare] 18S Soybean (Glycine max) 18S ribosomal RNA Zea mays PCO130571 mRNA sequence unknown pentatricopeptide (PPR) repeat-containing protein-like [Oryza sativa (japonica cultivargroup)] Hypothetical protein C13C5.04 in chromosome I putative 41 kD chloroplast nucleoid DNA binding protein (CND41) [Oryza sativa (japonica cultivar-group)] gi|51964318|ref|XP_506944.1| PREDICTED OJ1008_D06.19 gene product [Oryza sativa (japonica OSJNBb0049O23.17 [Oryza sativa (japonica cultivar-group)] gi|15528730|dbj|BAB64676.1| P0697C12.11 [Oryza sativa (japonica cultivargroup)] gi|20161129|dbj|BAB90058.1| OSJNBb0049O23.17 [Oryza sativa (japonica cu unknown  221  Probe Set ID  regulation  hai  FD  p-val  Gene Symbol  Ta.10234.2.S1_x_at  down  8  2.1  0.009  Ta.10915.2.S1_at  down  8  2.1  0.028  Ta.11540.1.A1_x_at  down  8  2.1  0.030  Ta.12057.1.S1_at  down  8  2.3  0.003  Ta.14461.3.S1_x_at  down  8  2.6  0.024  Ta.15782.1.S1_at  down  8  2.1  0.046  Ta.18832.2.S1_a_at  down  8  2.1  0.002  Ta.18981.1.S1_at  down  8  3.3  0.037  Ta.2188.3.S1_at  down  8  2.5  0.036  Ta.26475.1.A1_at  down  8  2.0  0.001  Ta.27021.1.A1_at  down  8  2.2  0.017  Ta.28351.1.S1_at  down  8  3.0  0.038  LOC542989  Ta.28351.1.S1_x_at  down  8  3.5  0.022  LOC542989  Ta.28669.3.S1_at  down  8  2.4  0.016  Gene Title Transcribed locus, strongly similar to XP_001076100.1 PREDICTED: similar to Actin, cytoplasmic 2 (Gamma-actin) [Rattus norvegicus] unknown similar to prenylated Rab acceptor protein 1 [Oryza sativa (indica cultivar-group)] unknown Nectarin 1 precursor (Superoxide dismutase [Mn]) putative GAMYB-binding protein [Oryza sativa (japonica cultivar-group)] gi|55773651|dbj|BAD72190.1| putative GAMYB-binding protein [Oryza sativa (japonica unknown putative laccase [Oryza sativa (japonica cultivar-group)] gi|19571025|dbj|BAB86452.1| putative laccase [Oryza sativa (japonica cultivar-group)] unknown similar to rhomboid protein-related [Arabidopsis thaliana] (contig annotation) P0034A04.28 [Oryza sativa (japonica cultivargroup)] gi|29837187|dbj|BAC75569.1| leaf senescence related protein-like [Oryza sativa (japonica cultivar-group)] adenosine diphosphate glucose pyrophosphatase adenosine diphosphate glucose pyrophosphatase protein phosphatase 2C [Arabidopsis thaliana]  222  Probe Set ID  regulation  hai  FD  p-val  Ta.2929.2.S1_at  down  8  2.1  0.005  Ta.29496.2.S1_at  down  8  2.2  0.037  Ta.29587.3.A1_at  down  8  2.2  0.044  Ta.29895.2.A1_at  down  8  2.1  0.036  Ta.3249.3.A1_at  down  8  3.1  0.014  Ta.3909.2.A1_at  down  8  2.1  0.009  Ta.4147.1.S1_at  down  8  3.1  0.045  Ta.4245.2.S1_x_at  down  8  2.2  0.004  TaAffx.104550.2.S1_at  down  8  2.4  0.023  TaAffx.105412.1.S1_at  down  8  2.3  0.000  TaAffx.107244.2.S1_at  down  8  2.6  0.002  TaAffx.110801.1.S1_at  down  8  2.5  0.003  TaAffx.117382.1.S1_at  down  8  2.2  0.002  TaAffx.117651.2.S1_at  down  8  2.3  0.005  TaAffx.118866.1.S1_at  down  8  2.2  0.034  Gene Symbol  LOC543465  Gene Title DEOXYURIDINE 5'-TRIPHOSPHATE NUCLEOTIDOHYDROLASE (DUTPASE) (DUTP PYROPHOSPHATASE) (P18) Peroxidase 12 precursor (Atperox P12) (PRXR6) (ATP4a) Ribulosebisphosphate carboxylase small subunit Probable phosphomannomutase (PMM) chlorophyll a/b binding protein [Oryza sativa (japonica cultivar-group)] unknown protein [Oryza sativa (japonica cultivar-group)] MtN19 [Oryza sativa (japonica cultivar-group)] (contig annotation) terbinafine resistance locus protein [Oryza sativa (japonica cultivar-group)] PREDICTED P0443H10.4 gene product [Oryza sativa (japonica cultivar-group)] gi|50936599|ref|XP_477827.1| putative CDPK substrate protein 1 [Oryza sativa (japonica unknown protein [Oryza sativa (japonica cultivar-group)] hydrolase, alpha/beta fold protein-like [Oryza sativa (japonica cultivar-group)] unknown Transcribed locus, weakly similar to NP_173021.1 AVP1; ATPase [Arabidopsis thaliana] PREDICTED OJ1442_E05.19 gene product [Oryza sativa (japonica cultivar-group)] gi|50904779|ref|XP_463878.1| putative bHLH protein [Oryza sativa (japonica cultivar-group)] unknown  223  Probe Set ID  regulation  hai  FD  p-val  TaAffx.119097.1.S1_at  down  8  2.2  0.008  TaAffx.119225.1.S1_s_at  down  8  2.4  0.024  TaAffx.12424.2.S1_at  down  8  2.2  0.035  TaAffx.128418.24.S1_at  down  8  2.6  0.030  TaAffx.128682.1.S1_at  down  8  2.0  0.001  TaAffx.128862.4.S1_at  down  8  2.1  0.012  TaAffx.24121.1.S1_at TaAffx.24125.1.S1_at  down down  8 8  2.3 2.0  0.013 0.012  TaAffx.25572.1.S1_at  down  8  2.2  0.000  TaAffx.27404.1.S1_at  down  8  2.1  0.022  TaAffx.28135.1.S1_at  down  8  2.0  0.004  TaAffx.28815.1.S1_at  down  8  2.1  0.049  TaAffx.32506.1.S1_at  down  8  2.3  0.025  TaAffx.38460.1.S1_s_at  down  8  2.6  0.026  TaAffx.42438.1.A1_at TaAffx.52929.1.S1_at TaAffx.56300.1.S1_at TaAffx.62625.1.S1_at  down down down down  8 8 8 8  2.2 2.5 2.0 2.1  0.045 0.007 0.000 0.010  TaAffx.66676.2.S1_at  down  8  2.0  0.032  Gene Symbol  Gene Title Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNOa0048I04, complete sequence Major Facilitator Superfamily, putative [Oryza sativa (japonica cultivar-group)] mitochondrial transcription termination factorlike [Oryza sativa (japonica cultivar-group)] 28S ribosomal RNA [Triticum aestivum] endonuclease [Hordeum vulgare subsp. vulgare] similar to senescence-associated protein-like [Oryza sativa (japonica cultivar-group)] unknown unknown calmodulin-binding protein -like [Oryza sativa (japonica cultivar-group)] unknown hydrolase-like [Oryza sativa (japonica cultivargroup)] (contig annotation) unknown protein [Oryza sativa (japonica cultivar-group)] gi|33146668|dbj|BAC80014.1| unknown protein [Oryza sativa (japonica cultivar-group)] unknown similar to (contig annotation) lectin [Hordeum vulgare subsp. vulgare] unknown unknown unknown unknown similar to reverse transcriptase [Oryza sativa (japonica cultivar-group)]  224  Probe Set ID  regulation  hai  FD  p-val  TaAffx.71746.1.A1_at  down  8  2.2  0.029  TaAffx.77811.1.S1_at  down  8  2.1  0.001  TaAffx.79035.1.S1_at  down  8  2.0  0.002  TaAffx.86355.1.S1_at  down  8  2.0  0.036  TaAffx.93223.1.A1_at  down  8  2.1  0.025  Ta.10087.1.A1_at  down  24  2.3  0.025  Ta.10354.2.S1_x_at  down  24  2.1  0.026  Ta.10781.1.A1_at  down  24  4.1  0.015  Ta.11005.1.S1_at  down  24  2.1  0.048  Ta.11242.1.A1_at  down  24  2.1  0.011  Ta.11332.1.A1_at  down  24  2.6  0.011  Ta.1166.2.S1_a_at Ta.1197.1.S1_at Ta.12319.1.A1_at Ta.14235.2.S1_x_at  down down down down  24 24 24 24  2.1 2.2 4.7 2.7  0.015 0.046 0.041 0.025  Ta.1619.3.A1_x_at  down  24  2.0  0.001  Gene Symbol  LOC542862  Gene Title PHOTOSYSTEM II 10 KD POLYPEPTIDE PRECURSOR unknown Hydroquinone glucosyltransferase [Oryza sativa (japonica cultivar-group)] Hypothetical 171.1 kDa protein in RPL6ADAK1 intergenic region 1-aminocyclopropane-1-carboxylate oxidase (ACC oxidase) (Ethylene-forming enzyme) (EFE) unknown Pyrophosphate--fructose 6-phosphate 1phosphotransferase alpha subunit (PFP) (6phosphofructokinase, pyrophosphate dependent) 60S acidic ribosomal protein P0 (DNA(apurinic or apyrimidinic site) lyase) (animal contaminant) myosin 2 light chain [Lonomia obliqua] (animal contaminant) (contig annotation) unknown P0421H07.26 [Oryza sativa (japonica cultivargroup)] gi|20804607|dbj|BAB92298.1| P0421H07.26 [Oryza sativa (japonica cultivargroup)] gi|13872913|dbj|BAB44019.1| P0684B02.6 [Oryza sativa (japonica cultivargrou Fructose-bisphosphatase alpha 1,4-glucan phosphorylase ribosomal protein S5 (animal contaminant) unknown leucine-rich repeat-like protein [Oryza sativa (japonica cultivar-group)]  225  Probe Set ID  regulation  hai  FD  p-val  Ta.16225.1.A1_at  down  24  2.0  0.017  Ta.16547.1.S1_x_at Ta.16611.1.S1_at  down down  24 24  2.0 2.3  0.040 0.033  Ta.1876.1.S1_s_at  down  24  2.1  0.036  Ta.19172.1.S1_at  down  24  2.1  0.005  Ta.20218.1.A1_x_at  down  24  4.2  0.045  Ta.20528.1.A1_at  down  24  2.1  0.017  Ta.21394.2.A1_x_at  down  24  2.1  0.037  Ta.24110.1.A1_s_at  down  24  2.4  0.027  Ta.25836.1.S1_at  down  24  2.1  0.034  Ta.2638.1.S1_at  down  24  2.4  0.045  Ta.26970.1.A1_at  down  24  2.0  0.049  Ta.27983.2.S1_a_at  down  24  2.5  0.048  Ta.28063.1.S1_x_at Ta.28496.1.A1_x_at  down down  24 24  2.1 2.4  0.028 0.039  Ta.30702.1.S1_x_at  down  24  2.5  0.027  Ta.3249.1.S1_at  down  24  2.8  0.038  Gene Symbol  rab 15B  LOC542973  Gene Title similar to C4-dicarboxylate transporter/malic acid transport family protein [Arabidopsis thaliana] (contig annotation) unknown unknown cold shock protein [Erwinia carotovora subsp. atroseptica SCRI1043] unknown Triticum aestivum clone wrsu1.pk0006.a3:fis, full insert mRNA sequence Dihydrolipoyl dehydrogenase putative protodermal factor [Oryza sativa (japonica cultivar-group)] gi|49388954|dbj|BAD26174.1| putative protodermal factor [Oryza sativa (japonica putative proline-rich protein [Oryza sativa (japonica cultivar-group)] gi|14488319|gb|AAK63900.1| Putative prolinerich protein [Oryza sativa] drought-induced protein RDI [Oryza sativa Japonica Group] rab protein Leucoanthocyanidin reductase (LAR) (BANYULS) (Anthocyanin spotted testa) (ast) putative potyviral helper component proteaseinteracting protein 2 [Oryza sativa (japonica cultivar-group)] gi|46390299|dbj|BAD15748.1| putative potyviral helper component proteaseinteracting protein 2 unknown chlorophyll a/b binding protein chlorophyll a/b-binding protein WCAB precursor [Triticum aestivum] Thioredoxin M  226  Probe Set ID  regulation  hai  FD  p-val  Gene Symbol  Gene Title  Ta.3249.2.S1_x_at  down  24  2.0  0.014  LOC542973  Ta.3249.3.A1_at  down  24  2.6  0.021  Ta.3748.1.A1_at  down  24  2.2  0.012  Ta.3795.1.S1_x_at  down  24  3.4  0.027  Ta.4057.1.S1_at  down  24  2.2  0.040  Ta.4280.2.S1_at  down  24  2.0  0.034  Ta.4889.1.S1_at Ta.4940.1.A1_at  down down  24 24  2.0 2.5  0.037 0.000  Ta.4972.1.A1_at  down  24  2.1  0.046  Ta.5004.1.S1_at Ta.6397.1.A1_at  down down  24 24  2.9 2.2  0.036 0.002  Ta.7839.1.A1_at  down  24  2.0  0.005  Ta.7907.1.A1_at  down  24  2.2  0.026  Ta.9799.1.S1_at TaAffx.105964.1.S1_at  down down  24 24  2.1 2.2  0.001 0.005  TaAffx.114127.1.S1_x_at  down  24  3.1  0.040  TaAffx.12303.2.S1_at  down  24  2.3  0.037  TaAffx.12523.1.A1_at  down  24  2.6  0.036  TaAffx.23875.1.S1_at TaAffx.29871.1.S1_at  down down  24 24  2.2 2.3  0.010 0.043  Thioredoxin M chlorophyll a/b binding protein [Oryza sativa (japonica cultivar-group)] HEXOKINASE 1 chlorophyll a/b-binding protein WCAB precursor unknown Oryza sativa (japonica cultivar-group) cDNA clone:J023012A09, full insert sequence PISTILLATA-like MADS box protein unknown similar to aspartate kinase-homoserine dehydrogenase [Oryza sativa (japonica cultivar-group)] (contig annotation) Vignain precursor (Cysteine endopeptidase) Adenosylmethionine decarboxylase Probable xyloglucan endotransglucosylase/hydrolase protein 27 precursor (At-XTH27) (XTH-27) putative transthyretin, having alternative splicing products [Oryza sativa (japonica cultivar-group)] GAMMA-GLIADIN B PRECURSOR unknown CHLOROPHYLL A-B BINDING PROTEIN PRECURSOR (LHCII TYPE I CAB) (LHCP) unknown APETALA3-like MADS box protein [Triticum aestivum] unknown unknown  Wcab  WPI2  227  Probe Set ID  regulation  hai  FD  p-val  TaAffx.32266.1.A1_at  down  24  2.7  0.047  TaAffx.37096.2.S1_at  down  24  2.0  0.008  TaAffx.43723.1.A1_at  down  24  2.4  0.017  TaAffx.50369.1.S1_at TaAffx.59876.1.S1_at  down down  24 24  2.2 3.1  0.000 0.041  TaAffx.65101.2.S1_at  down  24  2.1  0.005  TaAffx.79227.1.S1_at TaAffx.80666.1.S1_x_at TaAffx.80911.1.S1_at  down down down  24 24 24  5.1 2.1 2.2  0.034 0.001 0.034  TaAffx.8262.1.S1_x_at  down  24  2.2  0.006  Ta.14946.1.S1_at  up  24  5.8  0.010  Ta.21120.1.S1_at  up  24  3.2  0.001  Ta.21307.1.S1_x_at  up  24  2.3  0.016  Ta.21353.1.S1_a_at  up  24  2.0  0.005  Ta.21353.1.S1_at  up  24  2.2  0.017  Gene Symbol  Gene Title Probable phospholipid hydroperoxide glutathione peroxidase (PHGPx) (Saltassociated protein) gene_id:MVI11.8~unknown protein [Arabidopsis thaliana] Betaine-aldehyde dehydrogenase, chloroplast precursor (BADH) unknown unknown OSJNBa0089N06.20 [Oryza sativa (japonica cultivar-group)] gi|39546250|emb|CAE04259.3| OSJNBa0089N06.20 [Oryza sativa (japonica cultivar-group)] unknown unknown unknown glutamyl-tRNA reductase [Hordeum vulgare] (poor sequence quality) Transcribed locus, weakly similar to NP_566426.1 ATHCHIB (BASIC CHITINASE); chitinase [Arabidopsis thaliana] Glucan endo-1,3-beta-D-glucosidase (contig annotation) peroxidase [Oryza sativa (japonica cultivargroup)] Transcribed locus, weakly similar to NP_179942.1 catalytic/ hydrolase, acting on ester bonds [Arabidopsis thaliana] Transcribed locus, weakly similar to NP_179942.1 catalytic/ hydrolase, acting on ester bonds [Arabidopsis thaliana]  228  Probe Set ID  regulation  hai  FD  p-val  Ta.21650.1.A1_at  up  24  2.2  0.001  Ta.22562.1.S1_at  up  24  2.5  0.002  Ta.22981.3.S1_a_at  up  24  2.0  0.006  Ta.24501.1.S1_at Ta.24715.1.S1_at  up up  24 24  2.5 2.0  0.030 0.037  Ta.27757.1.S1_at  up  24  2.8  0.034  Ta.27762.1.S1_x_at Ta.27882.1.S1_s_at Ta.28354.3.S1_x_at Ta.82.1.S1_at  up up up up  24 24 24 24  2.8 2.2 2.3 4.1  0.029 0.049 0.005 0.007  Ta.8304.1.S1_x_at  up  24  2.1  0.010  Ta.97.2.S1_x_at  up  24  2.8  0.034  TaAffx.108743.2.S1_at  up  24  2.1  0.005  TaAffx.110222.1.S1_x_at  up  24  2.2  0.004  TaAffx.116570.1.S1_at  up  24  2.2  0.050  TaAffx.131249.1.S1_at  up  24  2.8  0.027  TaAffx.131249.1.S1_s_at  up  24  2.8  0.008  TaAffx.28047.1.S1_at  up  24  2.5  0.038  TaAffx.81099.1.S1_at  up  24  4.2  0.041  Gene Symbol  LOC543292 pox3  Ta-TLP gstu3 LOC543287  PR4  Gene Title Transcribed locus, weakly similar to NP_921072.1 putative disease resistance gene [Oryza sativa (japonica cultivar-group)] Glucan endo-1,3-beta-D-glucosidase cytochrome P450 protein [Arabidopsis thaliana] thaumatin-like protein peroxidase similar to (contig annotation) phosphoglycerate mutase family, putative [Oryza sativa (japonica cultivar-group)] thaumatin-like protein unknown Glutathione transferase peroxidase pathogenesis-related PR1a [Triticum monococcum] pathogen-induced protein WIR1A [Triticum aestivum] beta-1,3-glucanase precursor [Triticum aestivum] leucine-rich repeat-containing extracellular glycoprotein [Sorghum bicolor] / somatic embryogenesis receptor kinase SERK [Medicago truncatula] Pathogenesis-related protein 4 beta-1,3-glucanase [Oryza sativa (japonica cultivar-group)] beta-1,3-glucanase [Oryza sativa (japonica cultivar-group)] Sterol 14-demethylase / cytochrome P450 [Oryza sativa (japonica cultivar-group)] Cycloartenol synthase  229  Probe Set ID  regulation  hai  FD  p-val  TaAffx.108604.1.S1_at TaAffx.109291.1.S1_at TaAffx.126278.1.S1_at  down down down  3 3 3  2.3 2.6 2.2  0.037 0.006 0.031  TaAffx.128510.10.S1_s_at  down  3  2.0  0.043  TaAffx.95411.1.S1_at  down  3  2.1  0.039  Ta.14032.1.S1_at  down  8  2.1  0.003  TaAffx.5790.1.S1_at  down  8  2.1  0.007  TaAffx.7349.1.S1_at  down  8  2.1  0.005  TaAffx.78864.1.S1_at  down  8  2.3  0.011  TaAffx.82012.1.S1_at  down  8  2.2  0.019  Ta.18870.1.S1_at  down  24  2.3  0.014  TaAffx.32362.1.S1_at  down  24  2.2  0.019  TaAffx.81741.1.S1_at Ta.3255.1.S1_at TaAffx.54615.1.S1_at Ta.12751.3.A1_at  down up up up  24 3 3 8  2.4 2.0 2.2 2.3  0.036 0.001 0.005 0.012  Ta.16366.1.S1_at  up  8  2.3  0.012  Ta.21386.1.S1_at  up  8  2.1  0.048  Gene Symbol  Gene Title  Tri5+ vs Tri5-  LOC606336  unknown Aegilops tauschii unknown OSJNBa0013K16.16 [Oryza sativa (japonica cultivar-group)] gi|38344284|emb|CAE03767.2| OSJNBa0013K16.16 [Oryza sativa (japonica cultivar-group)] unknown T-complex protein 1 subunit epsilon (TCP-1epsilon) [Avena sativa] (contig annotation) one helix protein [Deschampsia antarctica] (contig annotation) immediate-early fungal elicitor protein CMPG1 [Oryza sativa (japonica cultivar-group)] glutathione S-transferase [Oryza sativa (japonica cultivar-group)] Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1113A07, from chromosome 3, complete sequence Oryza sativa (japonica cultivar-group) cDNA clone:J023075G11, full insert sequence similar to lipase acylhydrolase [Arabidopsis thaliana] unknown unknown unknown Ribosomal protein L13a BTB and TAZ domain protein [Oryza sativa (japonica cultivar-group)] (contig annotation) Probable nonspecific lipid-transfer protein 2 (LTP 2)  230  Probe Set ID  regulation  hai  FD  p-val  TaAffx.128541.20.S1_at  up  8  2.2  0.005  TaAffx.129222.10.S1_at  up  8  2.2  0.003  TaAffx.53890.1.S1_at  up  8  2.1  0.007  TaAffx.78352.1.S1_at  up  8  2.0  0.000  TaAffx.80607.1.S1_at Ta.10184.2.S1_at  up up  8 24  2.0 2.0  0.021 0.002  Ta.1562.3.S1_s_at  up  24  2.9  0.016  Ta.20980.2.S1_at  up  24  2.2  0.012  Ta.28879.3.S1_at  up  24  2.1  0.044  Ta.30400.1.A1_at  up  24  2.2  0.027  Ta.5235.1.S1_x_at  up  24  2.1  0.003  Ta.6987.2.S1_at  up  24  2.2  0.025  Ta.8245.2.S1_at  up  24  2.4  0.033  Gene Symbol  Gene Title unknown Triticum monococcum BAC clones 116F2 and 115G1 gene sequence  prx  OSJNBa0020P07.12 [Oryza sativa (japonica cultivar-group)] gi|38344869|emb|CAE01295.2| OSJNBa0020P07.12 [Oryza sativa (japonica cultivar-group)] unknown Pre-mRNA cleavage complex II protein Clp1 2'-hydroxyisoflavone reductase (contig annotation) PUTATIVE SERINE/THREONINE KINASE RECEPTOR PRECURSOR (S-RECEPTOR KINASE) (SRK) protein phosphatase type 2C [Arabidopsis thaliana] (contig annotation) bHLH protein-like [Oryza sativa (japonica cultivar-group)] gi|41052738|dbj|BAD07594.1| bHLH protein-like [Oryza sativa (japonica cultivar-group)] gi|41052625|dbj|BAD08134.1| bHLH protein-like [Oryza sativa (jap Peroxidase precursor putative AT hook-containing MAR binding protein [Oryza sativa (japonica cultivar-group)] gi|29824463|gb|AAP04178.1| putative AT hook-containing MAR binding protein [Oryza sativa OSJNBa0060N03.12 [Oryza sativa (japonica cultivar-group)] gi|38567892|emb|CAE03647.2| OSJNBa0060N03.12 [Oryza sativa (japonica cultivar-group)]  231  Probe Set ID  regulation  hai  FD  p-val  Gene Symbol  Gene Title  Ta.9983.1.S1_s_at TaAffx.105995.1.S1_at TaAffx.110215.1.S1_x_at TaAffx.111546.1.S1_s_at TaAffx.27956.1.S1_at  up up up up up  24 24 24 24 24  2.1 2.0 2.1 2.4 2.4  0.031 0.014 0.045 0.028 0.004  DFR  dihydroflavonol 4-reductase  TaAffx.50140.1.S1_at  up  24  2.1  0.014  TaAffx.5139.1.S1_at TaAffx.6827.1.S1_s_at  up up  24 24  2.1 2.1  0.027 0.026  TaAffx.79727.1.S1_at  up  24  2.0  0.033  TaAffx.81742.1.S1_at TaAffx.92097.1.S1_x_at  up up  24 24  2.1 2.1  0.044 0.049  Ta.11460.1.A1_at  down  3  2.0  0.042  Ta.18959.1.S1_at  down  3  2.2  0.009  Ta.19909.1.A1_at  down  3  2.5  0.026  Ta.2107.2.S1_at  down  3  2.0  0.003  Ta.27238.1.S1_at  down  3  2.0  0.010  Ta.5989.3.S1_x_at  down  3  2.0  0.001  unknown GRAS family transcription factor, putative [Oryza sativa (japonica cultivar-group)] (contig annotation) unknown C2 domain-containing protein [Hordeum vulgare subsp. vulgare] unknown  DH1 Tri5+ vs water hypothetical protein LOC_Os11g14070 [Oryza sativa (japonica cultivar-group)] DNA-binding protein-like [Oryza sativa (japonica cultivar-group)] gi|37806155|dbj|BAC99660.1| DNA-binding protein-like [Oryza sativa (japonica cultivargroup)] gi|29467557|dbj|BAC66727.1| DNAbinding protein-li Putative MAP kinase activating protein C22orf5 Aldehyde dehydrogenase family 7 member A1 (Antiquitin 1) (Matured fruit 60 kDa protein) (MF-60) Clone wre1n.pk0020.d2:fis, full insert mRNA sequence unknown  232  Probe Set ID  regulation  hai  FD  p-val  TaAffx.119611.1.A1_at  down  3  2.1  0.008  TaAffx.129134.2.S1_at TaAffx.20193.1.A1_at  down down  3 3  2.3 2.1  0.046 0.021  TaAffx.64399.1.S1_at  down  3  2.8  0.003  TaAffx.64857.1.S1_at TaAffx.84282.1.S1_at Ta.10895.1.S1_at Ta.12713.1.S1_at Ta.12774.1.A1_at Ta.14612.1.S1_at Ta.22319.2.S1_a_at Ta.28379.1.S1_x_at  down down down down down down down down  3 3 24 24 24 24 24 24  2.2 2.4 2.9 3.2 2.0 2.4 3.4 2.6  0.022 0.000 0.022 0.019 0.033 0.034 0.004 0.015  Ta.8258.1.S1_x_at  down  24  2.5  0.040  Ta.8258.2.S1_at  down  24  2.5  0.042  TaAffx.113782.1.S1_at TaAffx.12878.1.A1_at  down down  24 24  2.0 2.1  0.022 0.015  TaAffx.65750.1.S1_at  down  24  2.0  0.010  TaAffx.79682.1.S1_x_at  down  24  2.3  0.011  Ta.13682.1.A1_at  up  3  2.1  0.010  Ta.20940.2.S1_at  up  3  2.9  0.001  TaAffx.108604.1.S1_at  up  3  2.1  0.036  Gene Symbol  a2b  Gene Title DEGREENING RELATED GENE DEE76 PROTEIN Glycosyltransferase hypothetical protein [Arabidopsis thaliana] similar to receptor-like kinase RHG1 [Glycine max] unknown CDPK-RELATED PROTEIN KINASE (PK421) unknown unknown unknown unknown unknown 5a2 protein [Triticum aestivum] type 2 non-specific lipid transfer protein precursor [Triticum aestivum] type 2 non-specific lipid transfer protein [Triticum aestivum] 60S ribosomal protein L11-1 (L16A) wall-associated kinase 3 [Triticum aestivum] Transcribed locus, moderately similar to NP_908628.1 B1012D10.25 [Oryza sativa (japonica cultivar-group)] HISTONE H2B.2 progesterone 5-beta-reductase [Oryza sativa (japonica cultivar-group)] Bowman-Birk type trypsin inhibitor (WTI) [Triticum aestivum] unknown  233  Probe Set ID  regulation  hai  FD  p-val  Ta.10185.2.S1_x_at  up  8  2.5  0.037  Ta.10465.1.S1_at  up  8  2.0  0.049  Ta.10574.1.S1_a_at  up  8  3.1  0.008  Ta.10729.3.S1_x_at Ta.10918.1.S1_at Ta.10990.1.A1_at Ta.10993.1.S1_a_at  up up up up  8 8 8 8  2.3 2.4 2.0 2.1  0.049 0.000 0.019 0.047  Ta.11358.2.A1_x_at  up  8  2.0  0.016  Ta.11360.1.A1_at  up  8  2.1  0.049  Ta.11584.3.S1_x_at  up  8  2.6  0.004  Ta.12060.2.S1_at  up  8  2.5  0.030  Ta.12176.1.S1_at  up  8  2.1  0.034  Ta.1291.1.A1_x_at  up  8  2.2  0.049  Ta.13468.1.S1_x_at  up  8  2.5  0.030  Ta.1357.2.A1_at  up  8  2.0  0.031  Gene Symbol  Gene Title P0018C10.44 [Oryza sativa (japonica cultivargroup)] gi|20161436|dbj|BAB90360.1| B1065E10.10 [Oryza sativa (japonica cultivargroup)] gi|21952826|dbj|BAC06242.1| P0018C10.44 [Oryza sativa (japonica cultivargro unknown Transcribed locus, moderately similar to XP_470664.1 Hypothetical protein [Oryza sativa (japonica cultivar-group)] unknown unknown 40S ribosomal protein S19 (contig annotation) unknown nuclear transport factor 2 (NTF2)-like protein [Oryza sativa (japonica cultivar-group)] putative 2,4-dihydroxydec-2-ene-1,10-dioic acid aldolase [Oryza sativa (japonica cultivargroup)] unknown putative agenet domain-containing protein [Oryza sativa (japonica cultivar-group)] gi|51536260|dbj|BAD38428.1| putative agenet domain-containing protein [Oryza sativa (japonica unknown Transcribed locus, weakly similar to NP_191286.1 BG1 (BETA-1,3-GLUCANASE 1); hydrolase, hydrolyzing O-glycosyl compounds [Arabidopsis thaliana] unknown protein kinase [Oryza sativa (japonica cultivargroup)]  234  Probe Set ID  regulation  hai  FD  p-val  Ta.13754.1.S1_s_at  up  8  2.6  0.043  Ta.13824.1.S1_x_at Ta.13829.1.S1_at Ta.13835.1.S1_at  up up up  8 8 8  3.9 2.8 2.7  0.042 0.047 0.038  Ta.13838.1.S1_at  up  8  2.5  0.002  Ta.13926.1.S1_a_at  up  8  2.0  0.030  Ta.14281.1.S1_at  up  8  2.4  0.014  Ta.1435.1.S1_at  up  8  2.2  0.047  Ta.14580.1.S1_at Ta.15095.1.S1_at Ta.16011.1.S1_at  up up up  8 8 8  2.2 2.4 2.1  0.012 0.028 0.044  Ta.16120.1.A1_at  up  8  2.1  0.009  Ta.16270.1.S1_at  up  8  2.0  0.009  Ta.16901.1.S1_at  up  8  2.1  0.018  Ta.18152.1.S1_at  up  8  2.2  0.028  Ta.18223.2.S1_at  up  8  2.2  0.028  Ta.18225.1.A1_at  up  8  2.8  0.042  Ta.18438.1.S1_at  up  8  2.0  0.009  Gene Symbol  Tad1  Gene Title similar to lipid transfer protein-related [Arabidopsis thaliana] unknown H.vulgare mRNA (clone NUC1) unknown similar to leucine-rich repeat protein [Oryza sativa] (contig annotation) hypothetical protein [Oryza sativa (japonica cultivar-group)] gi|24899450|gb|AAN65020.1| hypothetical protein [Oryza sativa (japonica cultivar-group)] defensin Clone wle1n.pk0039.d2:fis, full insert mRNA sequence PEROXIDASE PRECURSOR unknown unknown hypothetical protein [Oryza sativa (japonica cultivar-group)] gi|13236665|gb|AAK16187.1| hypothetical protein [Oryza sativa (japonica cultivar-group)] unknown NOD26-like membrane integral protein ZmNIP2-1 [Zea mays] unknown Anter-specific proline-rich protein APG precursor alpha-L-arabinofuranosidase/beta-Dxylosidase putative ATP-dependent Clp protease proteolytic subunit [Oryza sativa (japonica cultivar-group)]  235  Probe Set ID  regulation  hai  FD  p-val  Ta.18665.1.S1_at  up  8  2.0  0.010  Ta.19173.1.S1_at  up  8  2.3  0.033  Ta.20971.1.S1_at  up  8  2.2  0.050  Ta.21285.1.A1_at  up  8  2.7  0.015  Ta.21327.3.A1_x_at  up  8  2.1  0.045  Ta.21803.1.S1_at  up  8  2.0  0.013  Ta.21906.1.S1_at  up  8  2.4  0.019  Ta.22046.1.A1_at  up  8  2.0  0.022  Ta.22525.3.S1_x_at  up  8  2.3  0.026  Ta.22628.1.S1_at Ta.22694.1.A1_at Ta.22766.1.S1_a_at  up up up  8 8 8  2.2 2.3 2.3  0.043 0.048 0.042  Ta.22825.2.S1_at  up  8  2.0  0.014  Ta.22954.1.S1_a_at  up  8  2.2  0.048  Ta.23392.2.S1_x_at  up  8  2.3  0.010  Ta.24041.2.A1_x_at  up  8  2.3  0.018  Ta.2490.3.S1_at  up  8  2.0  0.031  Gene Symbol  TaHSP70d  Gene Title putative protein kinase G11A [Oryza sativa (japonica cultivar-group)] gi|55296796|dbj|BAD68122.1| putative protein kinase G11A [Oryza sativa (japonica unknown nodulin-like protein 5NG4 [Oryza sativa (japonica cultivar-group)] (contig annotation) Transcribed locus, weakly similar to XP_483682.1 putative auxin induced protein [Oryza sativa (japonica cultivar-group)] PROTEIN TRANSPORT PROTEIN SEC61 BETA SUBUNIT Zea mays PCO074907 mRNA sequence Clone wdk2c.pk007.a4:fis, full insert mRNA sequence 2-oxoglutarate dehydrogenase E1 component (Alpha-ketoglutarate dehydrogenase) proteinase inhibitor-related protein [Triticum aestivum] (contig annotation) HSP70 unknown unknown similar to embryogenesis transmembrane protein-like [Oryza sativa (japonica cultivargroup)] Triticum aestivum cultivar Renan clone BAC 930H14, complete sequence similar to membrane protein [Oryza sativa (japonica cultivar-group)] unknown METHIONINE AMINOPEPTIDASE 2 (METAP 2) (PEPTIDASE M 2) (INITIATION FACTOR 2 ASSOCIATED 67 KDA GLYCOPROTEIN) (P67)  236  Probe Set ID  regulation  hai  FD  p-val  Ta.25282.1.S1_x_at  up  8  2.0  0.034  Ta.25470.1.A1_at  up  8  2.6  0.019  Ta.26020.1.A1_at  up  8  2.1  0.037  Ta.26106.1.A1_at  up  8  2.3  0.022  Ta.26606.1.A1_at  up  8  2.1  0.022  Ta.26923.1.S1_at  up  8  2.1  0.048  Ta.27039.1.S1_at  up  8  2.1  0.040  Ta.27766.1.S1_at  up  8  2.8  0.046  Ta.2798.1.S1_x_at Ta.28132.1.S1_x_at  up up  8 8  2.2 2.0  0.001 0.005  Ta.2889.2.S1_a_at  up  8  2.3  0.026  Ta.2954.1.A1_at  up  8  2.1  0.040  Ta.3035.2.S1_at  up  8  2.2  0.018  Ta.30535.1.S1_at  up  8  2.1  0.015  Ta.30755.1.S1_at  up  8  2.4  0.044  Ta.3278.1.A1_x_at  up  8  2.6  0.034  Gene Symbol  LOC543497  Gene Title putative beta-glucuronidase precursor [Oryza sativa (japonica cultivar-group)] Homeobox-leucine zipper protein ATHB-4 (HD-ZIP protein ATHB-4) unknown OSJNBa0036M16.17 [Oryza sativa (japonica cultivar-group)] gi|28071338|dbj|BAC56026.1| hypothetical protein [Oryza sativa (japonica cultivar-group)] Zea mays CL672_1 mRNA sequence unknown protein [Oryza sativa (japonica cultivar-group)] Clone wr1.pk182.b10:fis, full insert mRNA sequence similar to endosperm specific protein [Zea mays] Em protein (AA 1-93) Histone H2A beta-1,3-glucanase [Oryza sativa (japonica cultivar-group)] beta-expansin/allergen protein [Arabidopsis thaliana] (contig annotation) RNA-binding protein [Oryza sativa (japonica cultivar-group)] (contig annotation) Zea mays clone EL01N0559A08.c mRNA sequence Nonspecific lipid-transfer protein 2G (LTP2G) (Lipid transfer protein 2 isoform 1) (LTP2-1) (7 kDa lipid transfer protein 1) calreticulin precursor [Oryza sativa (japonica cultivar-group)] (contig annotation)  237  Probe Set ID  regulation  hai  FD  p-val  Ta.3368.2.A1_at  up  8  2.4  0.006  Ta.3605.3.S1_x_at  up  8  2.2  0.038  Ta.3631.2.S1_at  up  8  2.2  0.035  Ta.3663.1.A1_a_at  up  8  2.4  0.037  Ta.3744.1.S1_at  up  8  2.1  0.011  Ta.3788.2.A1_x_at  up  8  2.5  0.025  Ta.4245.2.S1_x_at  up  8  2.5  0.011  Ta.46.1.A1_at Ta.4601.2.S1_at  up up  8 8  2.4 2.6  0.042 0.033  Ta.5204.1.S1_at  up  8  2.2  0.022  Ta.5269.1.A1_at  up  8  2.2  0.007  Ta.5481.1.S1_at  up  8  2.5  0.004  Gene Symbol  LOC543224 TaGlu1a  LOC606351  Gene Title Polyadenylate-binding protein 2 (Poly(A)binding protein 2) (PolyA binding protein II) (PABII) (Polyadenylate-binding nuclear protein 1) P0470A12.42 [Oryza sativa (japonica cultivargroup)] gi|20161390|dbj|BAB90314.1| P0470A12.42 [Oryza sativa (japonica cultivargroup)] gi|20804983|dbj|BAB92659.1| P0004D12.3 [Oryza sativa (japonica cultivargrou PUTATIVE 3,4-DIHYDROXY-2-BUTANONE KINASE OSJNBb0002J11.20 [Oryza sativa (japonica cultivar-group)] gi|38567850|emb|CAE05693.2| OSJNBb0002J11.20 [Oryza sativa (japonica cultivar-group)] gi|32489520|emb|CAE04723.1| OSJNBa0043L24.11 [Oryza sativa (japoni unknown Transcribed locus, weakly similar to NP_172176.1 ATTIC110/TIC110 [Arabidopsis thaliana] terbinafine resistance locus protein [Oryza sativa (japonica cultivar-group)] imidazoleglycerolphosphate dehydratase beta-glucosidase Transcribed locus, weakly similar to NP_200638.1 ATP binding / kinase/ protein serine/threonine kinase [Arabidopsis thaliana] Beta-expansin TaEXPB1 Glucosidase II beta subunit precursor (Protein kinase C substrate, 60.1 kDa protein, heavy chain) (PKCSH) (80K-H protein) (Vacuolar system  238  Probe Set ID  regulation  hai  FD  p-val  Ta.556.1.S1_x_at  up  8  2.8  0.045  Ta.5601.1.A1_at  up  8  2.1  0.045  Ta.6134.1.A1_at  up  8  2.1  0.044  Ta.6334.1.S1_at  up  8  2.0  0.021  Ta.6642.2.S1_at  up  8  2.3  0.012  Ta.6683.1.A1_x_at  up  8  2.7  0.040  Ta.673.1.S1_at  up  8  2.4  0.006  Ta.681.2.S1_at Ta.6896.1.A1_x_at  up up  8 8  2.6 2.4  0.049 0.042  Ta.7129.2.S1_at  up  8  2.2  0.007  Ta.7378.18.S1_x_at Ta.7378.37.S1_at Ta.7378.6.S1_at  up up up  8 8 8  2.3 2.3 2.4  0.028 0.045 0.017  Ta.7671.1.S1_at  up  8  2.0  0.046  Gene Symbol  wali1  LOC543387 LOC543387 LOC543387  Gene Title Transcribed locus, weakly similar to XP_467967.1 lipase class 3-like [Oryza sativa (japonica cultivar-group)] unknown P0682B08.20 [Oryza sativa (japonica cultivargroup)] gi|14495231|dbj|BAB60950.1| P0682B08.20 [Oryza sativa (japonica cultivargroup)] Oryza sativa (japonica cultivar-group) cDNA clone:001-102-H11, full insert sequence Metallothionein-like protein Mitogen-activated protein kinase kinase kinase 12 (Leucine-zipper protein kinase) (ZPK) (Dual leucine zipper bearing kinase) (DLK) OSJNBb0070J16.14 [Oryza sativa (japonica cultivar-group)] gi|32482945|emb|CAE02349.1| OSJNBb0072M01.10 [Oryza sativa (japonica cultivar-group)] gi|38345698|emb|CAE01918.2| OSJNBb0070J16.14 [Oryza sativa (japoni ferritin [Triticum monococcum] unknown Transcribed locus, weakly similar to XP_463207.1 putative auxin response factor [Oryza sativa (japonica cultivar-group)] Alpha-tubulin Alpha-tubulin Alpha-tubulin myosin-like protein [Oryza sativa (japonica cultivar-group)] gi|38175471|dbj|BAD01168.1| myosin-like protein [Oryza sativa (japonica cultivar-group)]  239  Probe Set ID  regulation  hai  FD  p-val  Ta.7791.1.A1_at  up  8  2.2  0.014  Ta.7835.3.S1_x_at  up  8  2.2  0.019  Ta.8448.1.A1_at  up  8  2.1  0.005  Ta.8726.1.S1_s_at  up  8  2.4  0.044  Ta.8834.1.S1_x_at  up  8  2.2  0.050  Ta.9117.3.A1_x_at Ta.9220.3.S1_x_at  up up  8 8  2.4 2.1  0.045 0.003  Ta.9347.2.A1_x_at  up  8  2.2  0.014  Ta.9347.3.S1_at  up  8  2.0  0.040  Ta.9401.3.S1_x_at  up  8  2.1  0.049  Ta.9534.1.A1_at  up  8  2.4  0.043  TaAffx.105165.1.S1_at TaAffx.105769.1.S1_at TaAffx.107897.1.S1_at  up up up  8 8 8  2.0 2.0 2.2  0.007 0.021 0.039  TaAffx.107939.1.S1_at  up  8  2.0  0.047  TaAffx.108735.1.S1_at  up  8  2.1  0.008  Gene Symbol  Gene Title Hordeum vulgare BAC 184G9, complete sequece unknown plant viral-response family protein-like [Oryza sativa (japonica cultivar-group)] 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase (PLC) (Phosphoinositide phospholipase P0470A12.42 [Oryza sativa (japonica cultivargroup)] gi|20161390|dbj|BAB90314.1| P0470A12.42 [Oryza sativa (japonica cultivargroup)] gi|20804983|dbj|BAB92659.1| P0004D12.3 [Oryza sativa (japonica cultivargrou unknown Phenylalanine ammonia-lyase membrane protein [Oryza sativa (japonica cultivar-group)] putative membrane protein [Oryza sativa (japonica cultivar-group)] B12D-like protein [Phaseolus vulgaris] OSJNBb0017I01.27 [Oryza sativa (japonica cultivar-group)] gi|32488629|emb|CAE03422.1| OSJNBa0032F06.5 [Oryza sativa (japonica cultivar-group)] gi|32487413|emb|CAE05747.1| OSJNBb0017I01.27 [Oryza sativa (japonic unknown unknown Chloroplast 30S ribosomal protein S18 cytochrome P450 monooxygenase [Hordeum vulgare subsp. vulgare] unknown  240  Probe Set ID  regulation  hai  FD  p-val  TaAffx.108931.1.S1_at TaAffx.110614.3.S1_at  up up  8 8  2.2 2.0  0.020 0.037  TaAffx.111293.1.S1_at  up  8  2.2  0.026  TaAffx.111446.1.S1_at  up  8  2.3  0.033  TaAffx.113263.16.S1_at TaAffx.114370.1.S1_at TaAffx.118564.1.A1_at  up up up  8 8 8  2.7 2.2 2.1  0.041 0.037 0.038  TaAffx.119097.1.S1_at  up  8  2.1  0.036  TaAffx.12368.2.S1_at  up  8  2.2  0.012  TaAffx.124056.1.S1_at  up  8  3.0  0.015  TaAffx.128541.69.S1_at  up  8  9.2  0.031  TaAffx.128576.1.S1_at  up  8  2.0  0.019  TaAffx.12867.1.S1_at  up  8  2.7  0.020  TaAffx.128686.3.A1_at TaAffx.128740.2.S1_s_at  up up  8 8  2.1 2.4  0.009 0.026  TaAffx.128795.21.S1_at  up  8  2.7  0.032  TaAffx.128795.21.S1_s_at  up  8  3.4  0.019  TaAffx.128828.1.A1_at TaAffx.129824.5.S1_x_at TaAffx.134856.1.S1_x_at TaAffx.134856.3.S1_s_at  up up up up  8 8 8 8  2.4 2.4 2.6 3.2  0.030 0.041 0.015 0.012  Gene Symbol  Gene Title unknown similar to Oxalate oxidase / germin OSJNBa0061G20.3 [Oryza sativa (japonica cultivar-group)] PDR-type ABC transporter-like [Oryza sativa (japonica cultivar-group)] Corn histone H3 (H3C3) gene, complete cds unknown unknown Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNOa0048I04, complete sequence unknown NADH dehydrogenase (ubiquinone) (intron left in?)  expb11  ethylene-forming enzyme [Oryza sativa (japonica cultivar-group)] Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0073L04, complete sequence Zea mays PCO123562 mRNA sequence expansin EXPB11 protein precursor Cytochrome b6-f complex subunit V (Cytochrome b6f complex subunit petG) Cytochrome b6-f complex subunit V (Cytochrome b6f complex subunit petG) Histone H2A ribosomal protein S11 [Triticum aestivum] Maturase K (Intron maturase) maturase [Triticum aestivum]  241  Probe Set ID  regulation  hai  FD  p-val  TaAffx.16988.1.A1_at  up  8  2.2  0.012  TaAffx.18131.1.S1_at  up  8  2.1  0.048  TaAffx.20799.1.A1_at  up  8  4.1  0.025  TaAffx.21659.1.A1_at  up  8  3.3  0.046  TaAffx.21983.2.S1_at TaAffx.25228.1.S1_at  up up  8 8  2.1 2.7  0.025 0.036  TaAffx.25375.1.S1_at  up  8  2.1  0.023  TaAffx.25602.1.S1_s_at  up  8  3.3  0.003  TaAffx.25679.1.S1_at TaAffx.25679.1.S1_x_at TaAffx.29059.1.S1_x_at TaAffx.29732.1.S1_at TaAffx.30052.1.S1_at TaAffx.31447.1.S1_at TaAffx.31627.1.S1_at TaAffx.3194.2.S1_at TaAffx.3194.2.S1_x_at  up up up up up up up up up  8 8 8 8 8 8 8 8 8  2.0 2.3 2.1 2.1 2.1 2.2 2.2 2.0 2.1  0.017 0.001 0.011 0.036 0.004 0.034 0.006 0.026 0.028  TaAffx.37109.1.S1_at  up  8  2.4  0.003  TaAffx.37517.1.A1_at  up  8  2.0  0.004  Gene Symbol  Gene Title putative Rieske iron-sulfur protein Tic55 [Oryza sativa (japonica cultivar-group)] gi|51964474|ref|XP_507022.1| PREDICTED OJ1249_F12.25 gene product [Oryza sativa (japonica Putative phytosulfokine receptor precursor (Phytosulfokine LRR receptor kinase) Fasciclin-like arabinogalactan protein 1 precursor envelope membrane protein [Triticum aestivum] unknown unknown putative H1 gene protein [Oryza sativa (japonica cultivar-group)] gi|53791799|dbj|BAD53744.1| putative H1 gene protein [Oryza sativa (japonica cultivargroup)] tandem repeat sequence specific for chromosome arm 4AS [Triticum monococcum] unknown unknown unknown unknown unknown unknown unknown unknown unknown similar to receptor protein kinase [Arabidopsis thaliana] unknown  242  Probe Set ID  regulation  hai  FD  p-val  TaAffx.38852.1.S1_at  up  8  2.7  0.037  TaAffx.39148.1.S1_x_at  up  8  2.0  0.014  TaAffx.40608.1.A1_at TaAffx.4142.1.S1_at  up up  8 8  2.3 2.3  0.044 0.026  TaAffx.4142.3.S1_at  up  8  2.2  0.030  TaAffx.4244.1.A1_at  up  8  2.2  0.036  TaAffx.43361.1.S1_at  up  8  2.1  0.049  TaAffx.44362.1.A1_at TaAffx.48020.1.S1_x_at TaAffx.5088.1.S1_at  up up up  8 8 8  2.0 4.4 2.1  0.037 0.012 0.041  TaAffx.52266.1.S1_at  up  8  2.4  0.001  TaAffx.52710.1.S1_at TaAffx.52879.1.S1_at  up up  8 8  2.1 2.0  0.005 0.009  TaAffx.53260.1.S1_at  up  8  2.3  0.021  TaAffx.54035.1.S1_at  up  8  2.3  0.000  TaAffx.54203.1.S1_at  up  8  2.1  0.000  TaAffx.54368.1.S1_at  up  8  2.0  0.029  TaAffx.5526.1.S1_at TaAffx.55413.1.S1_at TaAffx.55587.1.S1_at  up up up  8 8 8  3.3 2.3 2.8  0.013 0.003 0.017  Gene Symbol  Gene Title SWIRM domain containing protein [Oryza sativa (japonica cultivar-group)] (contig annotation) Transcription factor MYB86 (Myb-related protein 86) (AtMYB86) (Myb homolog 4) (AtMyb4) unknown rps16 Triticum aestivum chloroplast DNA, complete genome unknown Triticum aestivum clone wkm2n.pk004.a