Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Identification and characterization of DyP peroxidases from Rhodococcus jostii RHA1 Roberts, Joseph N. 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2011_spring_joseph_roberts.pdf [ 20.48MB ]
Metadata
JSON: 24-1.0071615.json
JSON-LD: 24-1.0071615-ld.json
RDF/XML (Pretty): 24-1.0071615-rdf.xml
RDF/JSON: 24-1.0071615-rdf.json
Turtle: 24-1.0071615-turtle.txt
N-Triples: 24-1.0071615-rdf-ntriples.txt
Original Record: 24-1.0071615-source.json
Full Text
24-1.0071615-fulltext.txt
Citation
24-1.0071615.ris

Full Text

IDENTIFICATION AND CHARACTERIZATION OF DYP PEROXIDASES FROM Rhodococcus jostii RHA1  by  Joseph N. Roberts    A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIRMENTS FOR THE DEGREE OF   MASTER OF SCIENCE  in  THE FACULTY OF GRADUATE STUDIES (Microbiology and Immunology)       THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  February 2011  © Joseph N. Roberts, 2011   ii ABSTRACT  The lignin-degrading soil bacterium Rhodococcus jostii RHA1 contains two genes encoding DyP-type peroxidases. Based on phylogenetic studies, the enzymes were classified as DypA, which carries a TAT sequence, and DypB, which carries a C-terminal sequence predicted to target it to an icosahedral protein nanocompartment. Consistent with other DyPs, DypA showed 6-fold greater apparent specificity for the anthraquinone dye Reactive Blue 4 (kcat/Km = 12,800 ± 600 M-1s-1) than either ABTS or pyrogallol. By contrast, DypB showed greatest apparent specificity for ABTS (kcat/Km = 2000 ± 100 M-1s-1) and also oxidized Mn(II) (kcat/Km = 25.1 ± 0.1 M-1s-1). Herein the x-ray crystal structure of DypB is presented to 1.4 Å resolution, revealing a hexa-coordinated heme molecule and an additional Asn residue in the active site which is unique to DypB. Analysis of the DypB structural surface provides additional contrast to the structure of plant peroxidases, and identifies a potential substrate-binding pocket distal to the heme center. Assay of gene deletion mutants using a colorimetric lignin degradation assay reveals that a !dypB mutant shows greatly reduced lignin degradation activity, consistent with a role in lignin breakdown. Recombinant DypB protein also shows activity in the colorimetric assay, which is increased 5-fold in the presence of Mn(II). Overall, the different reactivities of the RHA1 DyPs with reducing substrates and Mn(II) enhanced ligninolytic activity of DypB have important implications for biotechnological applications.         iii PREFACE  Parts of this thesis are pending publication in refereed journals. The crystal structure and fundamental biochemical characterization of the DyP homologs of RHA1 has been submitted (Roberts, J.N.*; Singh, R.*; Grigg, J.C.; Murphy, M.E.P.; Bugg, T.D.H.; Eltis, L.D. “Characterization of DyP peroxidases from Rhodococcus jostii RHA1” Submitted. (*shared first authorship)). In this manuscript, I was responsible for the steady-state kinetic analysis, assisting with x-ray crystal structure solution, and preparation of the complete manuscript with Dr. Rahul Singh in the group of Lindsay D. Eltis (University of British Columbia).  Identification of the ligninolytic properties of DypB has also been submitted (Ahmad, M.*; Roberts, J.N.*; Singh, R.; Hardiman, E.M.; Eltis, L.D.; Bugg, T.D.H. “Identification of DypB from Rhodococcus jostii RHA1 as a lignin peroxidase” Submitted. (*shared first authorship)) In the manuscript, I was responsible for the gene cloning, purification, knockout mutant production, and phylogenetic analysis of DyPs, and the preparation of the manuscript pertaining to these sections.  Crystal structures were determined with Dr. Rahul Singh in collaboration with Jason C. Grigg in the group of Michael M.E. Murphy (University of British Columbia).  DypB mediated lignin degradation was characterized by Mark Ahmad in the group of Timothy D.H. Bugg (University of Warwick).     iv TABLE OF CONTENTS  ABSTRACT................................................................................................................................... ii!  PREFACE..................................................................................................................................... iii!  TABLE OF CONTENTS ............................................................................................................ iv!  LIST OF TABLES ....................................................................................................................... vi!  LIST OF FIGURES .................................................................................................................... vii!  LIST OF ABBREVIATIONS ..................................................................................................... ix!  ACKNOWLEDGEMENTS ......................................................................................................... x!  1      INTRODUCTION ................................................................................................................ 1! 1.1! Heme peroxidases .............................................................................................................. 1! 1.1.1 Heme peroxidase classification...................................................................................... 1! 1.1.2 Structure of plant peroxidases........................................................................................ 2! 1.1.3 Substrate access channels .............................................................................................. 2! 1.2 Dye-decolorizing peroxidases (DyPs) .................................................................................. 5! 1.2.1 Synthetic dyes ................................................................................................................ 5! 1.2.2 Dye-decolorizing peroxidases........................................................................................ 6! 1.2.2.1 Structure of DyPs.................................................................................................... 7! 1.2.2.2 Reaction mechanism of DyPs ................................................................................. 7! 1.3 Lignin degradation ................................................................................................................ 8! 1.3.1 Structure and biosynthesis of lignin............................................................................... 8! 1.3.2 Fungal lignin degradation .............................................................................................. 9! 1.3.2.1 Manganese peroxidases .......................................................................................... 9! 1.3.3 Bacterial lignin degradation......................................................................................... 12! 1.3.4 Nitrated lignin assay .................................................................................................... 12! 1.3.5 Rhodococcus jostii RHA1............................................................................................ 13! 1.3.5.1 RHA1 mediated lignin degradation ...................................................................... 13! 1.3.6 Aim of this study.......................................................................................................... 14!  2      MATERIALS AND METHODS ....................................................................................... 15! 2.1 Reagents and chemicals ...................................................................................................... 15! 2.2 DNA manipulation and plasmid construction..................................................................... 15! 2.3 Construction of mutants...................................................................................................... 17! 2.4 Bacterial strains and growth................................................................................................ 18! 2.5 Protein purification ............................................................................................................. 18! 2.6 Protein analysis ................................................................................................................... 20! 2.7 Phylogenetic analyses ......................................................................................................... 20! 2.8 Steady-state kinetic analysis ............................................................................................... 21! 2.9 DypB structure determination............................................................................................. 22!   v 2.10 Electronic absorption spectroscopy .................................................................................. 25! 2.11 Nitrated lignin UV-vis assays ........................................................................................... 25!  3      RESULTS ............................................................................................................................ 26! 3.1 Bioinformatic analysis of RHA1 DypA and DypB ............................................................ 26! 3.1.1 Predicted DyPs of RHA1............................................................................................. 26! 3.1.2 Phylogenetic analysis................................................................................................... 28! 3.2 Heterologous production of DyPs....................................................................................... 31! 3.3 Analysis of gene deletion mutants .................................................................................. 31! 3.4 Spectroscopic analysis of RHA1 DypA and DypB ............................................................ 33! 3.4.1 Electronic structure of ferric DypA and DypB............................................................ 33! 3.4.2 Formation of intermediates upon reaction with H2O2.................................................. 34! 3.5 Substrate analysis of DyPs.................................................................................................. 34! 3.6 Kinetic evaluation of recombinant DypA and DypB.......................................................... 38! 3.7 X-ray crystallography ......................................................................................................... 39! 3.7.1 crystallization of the RHA1 DyPs................................................................................ 39! 3.7.2 DypB structural overview............................................................................................ 40! 3.7.1 Substrate access channels ............................................................................................ 42!  4      DISCUSSION ...................................................................................................................... 45! 4.1 Phylogenetic analysis.......................................................................................................... 45! 4.2 Substrate analysis................................................................................................................ 46! 4.3 Electronic structure of heme ............................................................................................... 49! 4.4 Structure and mechanism of DypB..................................................................................... 50! 4.4.1 Substrate access channels ............................................................................................ 51! 4.5 Lignin degradation .............................................................................................................. 52! 4.6 Cellular localization of DypB ............................................................................................. 53! 4.7 Concluding remarks ............................................................................................................ 54!  BIBLIOGRAPHY....................................................................................................................... 56!  APPENDIX I: MULTIPLE SEQUENCE ALIGNMENT ...................................................... 63!  APPENDIX II: CRYSTALLOGRAPHIC DATA ................................................................... 65!         vi LIST OF TABLES  Table 1. Strains used in this study................................................................................................ 16!  Table 2. Fosmids/Plasmids used in this study.............................................................................. 16!  Table 3. Oligonucleotides used in this study................................................................................ 16!  Table 4. X-ray diffraction data collection and refinement statistics. ........................................... 24!  Table 5. Annotation of DyPs and proteins encoded by predicted co-transcribed genes in the RHA1 genome ...................................................................................................................... 27!  Table 6. Steady-state kinetic parameters of DypA and DypB from RHA1 ................................. 37!  Table 7. Apparent specificity constants of bacterial and fungal DyPs for various Reactive Blue dyes ....................................................................................................................................... 47!  Table 8. ABTS, Pyrogallol, and H2O2 apparent steady-state kinetic parameters of characterized DyPs...................................................................................................................................... 48!  Table A1. Initial screen crystallization conditions of RHA1 DypA and DypB........................... 65!                   vii LIST OF FIGURES  Figure 1. Structure of ferriprotoporphyrin IX................................................................................ 1!  Figure 2. Representative structures of each class of plant peroxidases ......................................... 4!  Figure 3. General structures of (A) reactive azo dyes and (B) anthraquinone............................... 5!  Figure 4. Structure of lignin complex .......................................................................................... 11!  Figure 5. Schematic representation of the cell walls of plants..................................................... 11!  Figure 6. Nitrated lignin assay for monitoring of lignin degradation .......................................... 13!  Figure 7. Degradation of the lignin component of lignocellulose by RHA1 yielded two major products identified by GC MS and LC MS as !-hydroxypropiovanillone (HPV) and 5- carboxyvanillate (5CVA)...................................................................................................... 14!  Figure 8. Operonic structure of dypA and dypB in R. jostii RHA1.............................................. 27!  Figure 9. Radial phylogram of DyPs ........................................................................................... 29!  Figure 10. Confirmation of the "dypA and "dypB mutant strains by DNA gel electrophoresis of PCR products ........................................................................................................................ 32!  Figure 11. Ability of RHA1 mutants to degrade nitrated lignin .................................................. 32!  Figure 12. Electronic absorption spectra of (A) DypA and (B) DypB ........................................ 33!  Figure 13. Monitoring the formation of malonate-Mn(III) complexes from the DypB mediated peroxidation of Mn(II) .......................................................................................................... 35!  Figure 14. Monitoring the formation of PPi-Mn(III) complexes from the DypB mediated peroxidation of Mn(II) .......................................................................................................... 35!  Figure 15. Activity (change in absorbance over 20 min assay) of 25 #g recombinant DypA and DypB protein in nitrated lignin UV-vis assay....................................................................... 38!  Figure 16. Photographs of RHA1 DyP crystals yielding diffraction data ................................... 39!  Figure 17. Structure of DypB from R. jostii RHA1..................................................................... 41!  Figure 18. The (2Fo-Fc) electron density (gray, contour level = 1 $) of the refined DypB structure; The refined ball and stick model of the DypB active site..................................... 42!  Figure 19. Heme access channels of R. jostii RHA1 DypB......................................................... 43!    viii Figure 20. Putative substrate binding pocket of DyP-type peroxidases ...................................... 44!  Figure 21. EPR spectra of DypA and DypB ................................................................................ 49!  Figure A1. Structure-based sequence alignment of DyPs............................................................ 64!  Figure A2. Preliminary model of a DypB protomer containing five identified selenium sites used for phase determination......................................................................................................... 66!  Figure A3. X-ray diffraction pattern of crystallized DypA ......................................................... 67!                                   ix LIST OF ABBREVIATIONS  ABTS  2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid APX  ascorbate peroxidase AQ  anthraquinone CcP  cytochrome c peroxidase CPO  chloroperoxidase CT  charge transfer band DMSO  dimethyl sulfoxide DyP  dye decolorizing peroxidase DyPDec1 dye decolorizing peroxidase from Thanatephorus cucumeris Dec1 GC MS gas chromatography-mass spectroscopy EDTA  ethylenediaminetetraacetic acid EPR  electron paramagnetic resonance spectroscopy HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid HPLC  high performance liquid chromatography HRP  horseradish peroxidase isozyme C Ht  poly his-tag IMAC  immobilized metal affinity chromatography LB  lysogeny broth LBP  lysogeny broth peptone LC MS liquid chromatography mass spectroscopy LiP  lignin peroxidase MnP  manganese peroxidase MOPS  3-(N-morpholino) propanesulfonic acid MWL  milled wood lignin PCR  polymerase chain reaction PDB  protein databank PPi  Pyrophosphate RB4  reactive blue 4 RMSD  root mean square deviation Rz  Reinheitszahl SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis TLS  translation liberation screw UV  ultraviolet ViP  versatile peroxidase       x ACKNOWLEDGEMENTS  I would like to thank my supervisor Dr. Lindsay Eltis for his patience, understanding, mentorship, and experience.  Many thanks to my committee members, Dr. Grant Mauk and Dr. Michael Murphy for their valuable advice and continued support.  I would like to thank all of the past and present members of the Eltis lab, especially Dr. Rahul Singh, for his considerable work on this project, expert knowledge, guidance, and friendship. Many thanks to Jie Liu for her technical assistance and Eltis lab members, past and present, for their support. I would especially like to thank Dr. Sachi Okamoto and Antonio Ruzzini for their friendship, which has extended outside of the laboratory.   Thanks to Dr. Jason Grigg for his work on the data collection and solution of the DypB crystal structures, as well as training in the analysis of crystallographic data.  Importantly, I would like to thank Stephanie Oshiro for her continued moral and emotional support throughout the duration of my studies.  I would like to acknowledge the National Science and Engineering Research Council (Canada) for funding support in the form of a postgraduate scholarship.     1 N N N N H3C CH3 CH3H3C CH2 CH2 Fe O OOH HO ! " # $ 1 INTRODUCTION  1.1 Heme peroxidases  Peroxidases are a ubiquitous and diverse group of enzymes. Utilizing hydrogen peroxide (H2O2) as an oxidant, they catalyze numerous reactions of physiological and environmental relevance including wound defense and the metabolism of plant cell wall and hormones (1). In general, peroxidases lack substrate specificity and are therefore able to oxidize a broad range of organic substrates and dyes. As a result, these enzymes are often used as markers in numerous biochemical applications. The common feature of all heme peroxidases is that their active site contains a similar prosthetic group. For all known plant peroxidases, this prosthetic group is ferriprotoporphyrin IX (Figure 1).          Figure 1. Structure of ferriprotoporphyrin IX. The carbon atoms of the four methene bridges are labeled %, !, &, and '.  1.1.1 Heme peroxidase classification  Heme peroxidases are divided into two broad groups: the animal and the plant peroxidases. Based on sequence similarity, the plant peroxidase superfamily is divided into three families (2). The Class I family comprises peroxidases of prokaryotic origin, and includes the   2 yeast cytochrome c peroxidase (CcP), cytosolic ascorbate peroxidases (APX), and the gene- duplicated catalase-peroxidase. Class II includes the secreted fungal peroxidases lignin peroxidase (LiP), manganese peroxidase (MnP), and versatile peroxidase (ViP), all of which contain a signal sequence targeting the enzymes for secretion. Finally, Class III comprises the classical secretory plant peroxidases, which include the intensively studied horseradish peroxidase isozyme C (HRP). While the majority of known peroxidases fit into this classification scheme, several structurally divergent exceptions including chloroperoxidase (CPO) from Caldariomyces fumago cannot be ordered in the three-family system.  1.1.2 Structure of plant peroxidases   Comparison of representative plant peroxidases CcP, LiP and HRP reveals the structural elements common among members of each peroxidase family (Figure 2A). In all cases, the heme ligand is situated between the distal and proximal helices B and F, respectively (3). In addition, the residues comprising the heme environment of each peroxidase are conserved. Using the amino acid numbering of yeast cytochrome c peroxidase (CcP), Arg48 and His52 of helix B and Asn82 are on the distal side of the heme (Figure 2B). Val169 and His175 of helix F and Asp235 are on the peroximal side, where His175 is the fifth ligand of the heme iron and is hydrogen bonded to Asp235. The only exception is the distal Trp51, which is unique to the CcP and substituted to phenylalanine in both LiP and HRP.  1.1.3 Substrate access channels  It is increasingly accepted that substrates interact with plant peroxidases at an exposed heme edge (4). Two major routes provide access lateral to the catalytic heme center in peroxidases: a smaller opening situated between the heme propionate groups at the &-meso   3 carbon, and a larger channel oriented towards the '-meso heme carbon. The latter is believed to be the point of substrate access, primarily based on the covalent attachment of substrate-like suicide inhibitors to the '-meso heme carbons of peroxidases (5).  The substrate access channels of class I and III plant peroxidases such as CcP and HRP all appear to be wide open (Figure 2C,D) whereas the channel of class II peroxidase LiP is far more restricted (Figure 2E). The nature of substrate access in plant peroxidases suggests that the specific enzyme-substrate complex necessary for many enzymes is not required for peroxidase function.  ! !  4 A       B             C     D     E             Figure 2. Representative structures of each class of plant peroxidases. (A) superimposed ribbon and helical structures of class I yeast cytochrome c peroxidase (CcP) in green, class II lignin peroxidase (LiP) in blue, and class III horse radish peroxidase (HRP) in red. The heme prosthetic groups are represented as ball and stick models and colored pink. Helix B and F are labeled. (B) Ball and stick model of the CcP active site. Nitrogen, oxygen and iron atoms are coloured blue, red, and brown, respectively. Carbon atoms for protein residues and protoporphyrin IX are colored green and pink, respectively. Names for each of the surrounding residues are shown. Vacuum electrostatic surface representation of the major heme access channels of (C) CCP, (D) LiP and (E) HRP.   ! !  5  1.2 Dye-decolorizing peroxidases (DyPs)  1.2.1 Synthetic dyes  It is estimated that 10-15% of the over one million tons of synthetic dyes produced each year are released as effluent into wastewaters (6). Synthetic dyes, including the azo and anthraquinone (AQ) dyes (Figure 3), are classified based on the chemical structure of the chromophoric group. The former account for over half of all dyes produced. Since many dyes are very stable and considered xenobiotic, they often accumulate in the environment and/or are converted into harmful compounds. In response to these concerns, researchers have explored the microbial degradation of synthetic dyes to reduce their prevalence and environmental impact. Azo dyes have been found to be predominantly degraded by Class II peroxidases (7-9). These enzymes abstract hydrogen from hydroxyl groups present in these dyes, generating free radicals. The ensuing radical chemistry results in either the degradation or the polymerization of the azo dye. In contrast, the hydroxyl-free nature of the chromophoric groups renders the enzymatic degradation of AQ dyes relatively resistant to degradation by Class II peroxidases (10).     Figure 3. General structures of (A) reactive azo dyes and (B) anthraquinone.    O O N N R R' A B ! !  6 1.2.2 Dye-decolorizing peroxidases  By screening soil samples for microorganisms capable of decolorizing both azo and anthraquinone dyes, Kim et al. isolated Thanatephorus cucumeris Dec1 (formerly Geotrichum candidum Dec1) a strain of fungus that degrades a broad spectrum of dyes (11). Interestingly, the rate of dye-decolorization by the culture broth of T. cucumeris Dec1 was higher for AQ dyes than for azo dyes.  Enrichment of the dye-decolorizing activity resulted in the purification of the novel extracellular dye-decolorizing peroxidase (DyPDec1)(12). Although DyPDec1 contains a heme prosthetic group, it is unique in two respects: it is able to effectively decolorize hydroxyl- free AQ dyes with high specificity and lacks sequence similarity with plant-type peroxidases.  Since the discovery of DyPDec1, numerous DyP-type peroxidases have been annotated from diverse bacterial and fungal genomes. Further studies have demonstrated that in addition to AQ dyes, these enzymes exhibit peroxidase activity towards a wide range of carotenoids, methoxylated aromatic compounds such as veratryl alcohol, lignin model compounds, and more typical peroxidase substrates such as 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid (ABTS) (10, 13-16). Consistent with their peroxidase activity, DyPs have been suggested to be part of the bacterial oxidative stress response based on the co-induction of a DyP with structural components of gas vesicles during oxidative stress (17). Similarly, DyPs may act as virulence factors in plant pathogens based on the death of plant cells in suspension and the wilting of seedlings exposed to purified enzyme (18). Nevertheless, the physiological role of DyPs as peroxidases has not been unequivocally established. Recent molecular genetic evidence suggests that in Escherichia coli, two native paralogous DyPs assist in the capturing of iron from heme while keeping the tetrapyrrole skeleton intact (19). Intriguingly, some DyPs occur within icosohedral shells formed by the protein encapsulin, which is also predicted to compartmentalize ! !  7 some bacterial ferritin-like proteins (20). Sequence-based phylogenetic analysis have classified DyPs into four discrete subfamilies: A, B, and C are bacterial while D are fungal (21, 22).  1.2.2.1 Structure of DyPs  Structural analyses have revealed that DyPs have a ferredoxin-like fold and thus belong to a different superfamily than the plant-type peroxidases (23). The first published X-ray structure for the DyP family is that of recombinant DyPDec1 (protein data bank (PDB) ID: 2D3Q) (23). The crystal structures of three bacterial DyPs have also been solved: TyrA (PDB ID: 2HAG) from Shewanella oneidensis, BtDyP (2GVK) from Bacteroides thetaiotaomicron VPI- 5482, and EfeB (2WX6) from E. coli K-12 (23, 24). Analysis of the structures of the four DyPs reveals a ferredoxin-like fold with a unique motif: two sets of anti-parallel !-sheets located between two %-helices above the distal portion of the heme (25). The heme environments of DyPs contain most of the residues conserved among the plant peroxidases with one major substitution: Asp171 (DyPDec1 numbering) replaces the catalytically important distal His of plant peroxidases.  1.2.2.2 Reaction mechanism of DyPs  The catalytic mechanism of DyPs has been proposed to be similar to that of plant-type peroxidases (23, 25) despite their different structures. Accordingly, the ferric enzyme reacts with H2O2 to yield Compound I, a high valent intermediate designated [Fe(IV)=O]Por•+ that is two reducing equivalents more oxidized than the ferric enzyme. Compound I reacts with one equivalent of the reducing substrate, whose nature determines its fate in potential downstream reactions, to yield a [Fe(IV)=O] intermediate called Compound II. Reaction with a second equivalent of the reducing substrate yields the resting state Fe(III) peroxidase. Nevertheless, the ! !  8 direct evidence for this mechanism is weak, involving spectrophotometrically monitoring reactions of ferric enzyme with H2O2 on a timescale of minutes (25).  Moreover, the few mechanistic and structural studies of DyPs indicate important differences with the plant-type peroxidases. For example, the reaction of DyPDec1 with H2O2 yielded a species with a half-life of ~9 min that was assigned as an unusually stable [Fe(IV)=O]Por•+, and which slowly decays to ferric enzyme with no detectable Compound II-type intermediate (23, 25-27). Finally, although the heme is ligated by a proximal histidine that forms a hydrogen bond with a conserved acidic residue in both classes of peroxidases, the residues on the distal face of the heme differ (23, 28). Thus, DyPs have a conserved aspartate and arginine on the distal face. The former replaces the catalytic histidine of plant-type peroxidases, and, based on the reduced reactivity of the D171N variant towards H2O2 (23), has been proposed to shuttle a proton in the formation of Compound I from H2O2, analogous to the distal glutamate of chloroperoxidase (CPO). For its part, the arginine has been proposed to stabilize the negative charge on distal oxygen of the Fe-bound peroxide during O-O bond cleavage (25) as proposed by Poulos and Kraut (29). However, this role has not been substantiated experimentally. More extensive structure-function studies of DyPs, particularly involving EPR and stopped-flow absorption spectroscopies, are required to investigate their catalytic mechanism and to elucidate the roles of active site residues.  1.3 Lignin degradation  1.3.1 Structure and biosynthesis of lignin  Lignin is the second most abundant biopolymer in nature after cellulose, comprising 30% of the non-fossil organic carbon (30). Plants and some algae synthesize lignin polymers (Figure 4A) via a radical process initiated from cinnamyl precursors derived from 4-hydroxyphenyl, ! !  9 guaiacyl, and syringyl, respectively (Figure 4B). Found in the secondary cell wall of plants, lignin is physically and chemically associated with hemicelluloses and surrounds the energy-rich cellulose polymers, forming an insoluble, relatively unreactive, heterogeneous layer (Figure 5). The degradation products of lignin and cellulose are of considerable interest due to their potential as a renewable source of second-generation biofuels, high-value aromatic compounds and other biomass-derived products (31). Currently, industrial processing of plant biomass requires breaking down the lignocellulose by degrading the lignin and separating the cellulose component through an expensive, energy intensive, and relatively inefficient pre-treatment step (32). Biological pretreatment offers a potentially more environmentally friendly and economic method of lignocellulose decomposition.  1.3.2 Fungal lignin degradation  To date, the most extensively studied lignin-degrading organisms are the white-rot fungi, such as Phanerochaete chrysosporium. These fungi break down the polymer using extracellular laccase and peroxidase enzymes (33, 34). Among these are the above-mentioned LiP, MnP and ViP which catalyze peroxide-dependent lignin degradation via redox mediators and/or radical chemistry. However, despite more than 30 years of effort, difficulty achieving high yields of active fungal enzymes has rendered their industrial application too expensive (35).  1.3.2.1 Manganese peroxidases  The Class II MnP is a major component of the fungal lignin-degrading system. The MnP of P. chrysosporium has a single Mn(II) binding site, which includes one of the heme propionates (36). MnP oxidizes Mn(II) to Mn(III) which in turn oxidizes organic substrates (36, 37). Thus the manganese ion participates in the lignin-degradation reaction as a redox coupler, ! !  10 whose relatively small ionic radius is capable of penetrating and oxidizing the dense matrices of lignin polymers (34). While MnPs are best characterized in fungi, Mn(II) oxidation has also been observed in the bacterial Class I catalase-peroxidase from Mycobacterium (38) and animal-like heme peroxidases recently discovered from two marine %-proteobacteria (39).  ! !  11  Figure 4. Structure of lignin complex. (A) Schematic of different types of linkages that occurs in lignin. (B) Three different types of lignin monomers. Adapted from Ahmad et al. (2010) (40).              Figure 5. Schematic representation of the cell walls of plants. Cullulose, hemicellulose, and lignin are labeled in yellow, blue and red, respectively (41). OH HO OH HO O OH HO OO 4-hydroxyphenyl (H) subunit guaiacyl (G) subunit syringyl (S) subunit ORMeO OH OMe O O OMe OMe O OH OMe OAr OMe OH OMeOH RO O OHOMe MeOOMe O ROOH O OH OMe OMe HO !-aryl ether phenylcoumarane biphenyl pinoresinol biaryl ether diaryl propane A B ! !  12 1.3.3 Bacterial lignin degradation  Soil-dwelling bacteria have long been recognized to contribute to lignin degradation (42). The best-studied lignin-degrading bacterium is Streptomyces viridosporus T7A, which produces an extracellular lignin peroxidase capable of depolymerizing lignin and catabolizing lignin model compounds (43). In addition, a variety of lignin-derived fragments can be broken down by Sphingobium paucimobilis SYK-6 via protocatechuate or 3-O-methylgallate (44). A radiochemical assay of 14C-labeled lignin was used to identify strains of Nocardia autotrophica and Rhodococcus sp. exhibiting lignin-mineralizing activity (45). However, no bacterial enzymes capable of degrading intact high molecular weight lignin have ever been characterized.  1.3.4 Nitrated lignin assay  More recently, a novel spectrophotometric assay for lignin degradation has been developed for screening new bacteria and fungi for ligninolytic activity (40).  The assay involves the use of Milled wood lignin (MWL), generated from a variety of plant sources (wheat, miscanthus, and pine), and nitrated via a chemical process (40). Degradation of this modified lignin by ligninolytic organisms results in the release of nitrated polysubstituted aromatics, producing an absorbance increase that may be monitored spectrophotometrically at 430 nm (Figure 6). This method of screening bacteria and fungi can detect ligninolytic activity in known lignin degraders, such as P. chrysosporium, while also identifying several bacterial strains as lignin degraders, including Pseudomonas putida and Rhodococcus jostii RHA1 (40).  ! !  13   Figure 6. Nitrated lignin assay for monitoring of lignin degradation (40).   1.3.5 Rhodococcus jostii RHA1  Rhodococcus is a genus of catabolically versatile soil bacteria that belong to the mycolic acid-containing suborder of actinobacteria (46). The ability of rhodococci to transform a wide range of natural and manmade organic compounds and pollutants, combined with their robust growth and exceptional stress tolerance, has led to their use in a wide range of biotechnological applications (47).  Rhodococcus jostii RHA1 was isolated from lindane-contaminated soil, and was initially characterized for its potent PCB (polychlorinated biphenyl)-degrading properties (48).  Subsequent genomic studies of RHA1 have provided important insights into the physiology and catabolic versatility of rhodococci and related actinobacteria (49).  1.3.5.1 RHA1 mediated lignin degradation  Most recently, it was demonstrated that RHA1 can degrade lignin and ligno-cellulose, producing a number of monocyclic phenolic compounds (Figure 7)(40). This is consistent with RHA1’s ability to degrade a wide range of such aromatic compounds (46, 49). However, due to the complex nature of the substrate, the rate and completeness of lignin degradation remains unclear. Bioinformatic analysis of ligninolytic bacteria identified in a nitrated lignin screen lead H3CO OH HO H3CO OH HO NO2 H3CO OH CHO NO2 Lignin Degrader Lignin Nitrated Lignin Increase in A430 ! !  14 OH OCH3 O OH COOH H3CO OH COOH 5CVAHPV to the hypothesis that a DyP-type peroxidase contributes to the ability of RHA1 to degrade lignin (40).          Figure 7. Degradation of the lignin component of lignocellulose by RHA1 yielded two major products identified by GC MS and LC MS as !-hydroxypropiovanillone (HPV) and 5- carboxyvanillate (5CVA)(40).  1.3.6 Aim of this study  This study describes two DyPs from RHA1. Phylogenetic and bioinformatic analyses were performed to define their relationship to other DyPs. The two DyPs were heterologously produced, purified and characterized with respect to their biochemical properties. The substrate specificity of these enzymes for a range of organic substrates as well as the enzymes’ reactivities with H2O2 were investigated. An X-ray crystal structure for RHA1 DypB was solved to 1.3 Å, and potential access routes to the heme prosthetic group were defined. Finally, each of dypA and dypB were deleted from RHA1 to investigate their involvement in lignin degradation. The results are discussed with respect to other DyPs as well as plant-type peroxidases.  ! !  15 2 MATERIALS AND METHODS  2.1 Reagents and chemicals  HPLC grade DMSO was from Alfa Aesar. All other reagents and chemicals were purchased from SIGMA-Aldrich, ACROS, MP Biomedicals, or Fisher and were used without further purification. Enzymes for molecular cloning were purchased from New England Biolabs. Water for protein manipulations was purified using a Barnstead NANOpure UV apparatus (Barnstead International, Dubuque, IA) to a resistivity of greater than 17 M(!cm. MWL from wheat was prepared and nitrated as described previously (40).  2.2 DNA manipulation and plasmid construction  DNA was propagated in E. coli DH5% (Table 1), purified and manipulated according to standard procedures (50). Polymerase chain reactions (PCR) were performed using Expand High-Fidelity Polymerase (Roche) and a Veriti 96-well Thermal Cycler (Applied Bio-systems). Primer synthesis and nucleotide sequencing of the obtained clones were performed at the Nucleic Acid-Protein Services Unit (University of British Columbia). The dyp genes were amplified from fosmid clones RF0013J14 and RF0013A20 (Table 2) containing appropriate fragments of RHA1 genomic DNA (www.rhodococcus.ca (49)). Amplicons generated using dypAFor (Table 3) and dypARev for dypA and dypBFor and dypBRev for dypB were cloned into pET28a(+) (Novagen) using NdeI and HindIII, yielding pETDYPA1 and pETDYPB1, respectively, in which the genes are under the control of the T7 promoter.  The resulting genes encoded recombinant proteins with a cleavable N-terminal poly-His tag (Ht-) and corresponded to residues 50-429 of DypA (i.e., without the TAT signal sequence) and 1-350 of DypB.  ! !  16 Table 1. Strains used in this study. Strain Relevant genotype or characteristicsa Reference E. coli DH5% endA1, hsdR17, supE44, thi-1, )-recA1, gyrA96, relA1, "lacU169 (*80lacZ"M15) (51) E. coli S17-1 recA, thi, pro, hsdR-M+, RP4::2-Tc::Mu::Km::Tn7, Tpr, Smr (52) E. coli BL21(DE3) F-, dcm, ompT, hsdSB(rB-, mB-), gal, )(DE3)  (53) R. jostii RHA1 Wild-type strain (54) R. jostii RHA035 "dypA This work R. jostii RHA036 "dypB This work aTPr, trimetoprim resistance; Smr, streptomycin resistance.  Table 2. Fosmids/Plasmids used in this study. Fosmids/Plasmids Relevant genotype, phenotype, or characteristicsa Reference/origin RF0013J14 Ampr (49) RF0013A20 Ampr (49) pET28a(+) Kanr Novagen pETDYPA1 Kanr, pET28a(+) containing dypA This work pETDYPB1 Kanr, pET28a(+) containing dypB This work pK18mobsacB CmrKanr (55) pK18dpA CmrKanr, pk18mobsacB dypA gene deletion plasmid This work pK18dpB CmrKanr, pk18mobsacB dypB gene deletion plasmid This work aAmpr, ampicillin resistance; Cmr, chloramphenicol resistance; Kmr, kanamycin resistance. Table 3. Oligonucleotides used in this study. Oligo- nucleotide Sequence (5’ to 3’) Restrict. site dypAFor TAATCATATGGCCGAACCGCCACTCTCGCA NdeI dypARev GCATAAGCTTCTACGTGAACAGTCCCTGACCC HindIII dypBFor TAATCATATGCCAGGCCCAGTCGCGAGATTG NdeI dypBRev CGATAAGCTTTCATTGCGATACTCCTTTGAGAC HindIII dAUF GAAGGCGAATTCTGCAGCGCGCGGGAG EcoRI dAUR CCCAAGTCTAGAGCGATGAACGAGTACATCCAGCACGTCGG XbaI dBUF CGCCTAGAATTCCGCAGGAGTGGACCGATCGG EcoRI dBUR GCCACGTCTAGAGTCGTCGGAGTCCCCGGC XbaI dADF CAGTGCTCTAGAGGCGCCGAACAGACGTCGTC XbaI dADR CGACTCAAGCTTGCTACATCCGCAGCCAGGTCG HindIII dBDF GCTCAGTCTAGAGGCGCGGAGTCGGCACC XbaI dBDR CGACTGAAGCTTATCGACAGGTCCGTGCCGAGG HindIII odAKOF AGCTCGCACACAGCCTGGG odAKOR CGCAATCCCGAACTGTCCGCG odBKOF GGAGCCACCACCAACAGATTCCG odBKOR GTAGGAGTATCCGAACGGTCCCGC aThe recognition sequences for the indicated restriction sites are underlined. ! !  17 The mutagenic plasmid for !dypA and !dypB genetic knockout strains were designed as described previously (56) using 800-1000 kb amplicons flanking the target gene. The dypA and dypB upstream amplicons were prepared from RHA1 genomic DNA and the following primers: dAUF, dAUR, dBUF, and dBUR (Table 3). These yielded a 790 bp amplicon which included the 5’ 90 bp of dypA and 1000 bp amplicon that included the 5’ 99 bp of dypB, respectively. The downstream amplicons were similarly generated using dADF, dADR, dBDF, and dBDR (Table 2). These yielded amplicons of 999 and 799 bp, respectively, which included the 3’ 99 bp of the respective genes. For each of dypA and dypB, a three-fragment ligation using EcoRI, XbaI and HindIII, was performed to clone the flanking amplicons into pK18mobsacB (Table 2) yielding pK18dpA and pK18dpB, respectively.  2.3 Construction of mutants  The "dypA and "dypB deletion mutants of RHA1 were constructed essentially as described previously (56). Wild-type RHA1 was grown in Lysogeny Broth Peptone media (LBP) containing 30 #g/ml nalidixic acid at 30 °C for 72 hrs with shaking. The cultures were subsequently plated on solid LBP agar containing 30 #g/ml nalidixic acid and incubated for 72 hrs at 30 °C followed by 24 hrs incubation at room temperature. Constructs pK18dpA and pK18dpB (Table 2) were respectively transformed into E. coli S17-1 (Table 1) and grown for 24 hrs on LBP plates supplemented with 25 #g/ml of kanamycin at 37 °C. Cells from both the RHA1 and transformed E. coli S17-1 plates were re-suspended in 2 ml of LBP media and aliquots 750 #l of both strains were mixed carefully. The cell mixture was harvested by centrifugation (9300 g + 1 min), re-suspended in 1 ml of LBP media, and 100-#l aliquots were spread on LBP agar and incubated at 30 °C for 24 hrs to facilitate conjugation. Biomass was harvested from the plates, re-suspended in 2 ml LBP, and spread as 25-#l aliquots on LBP agar ! !  18 supplemented with 50 #g/ml of kanamycin and 30 #g/ml of nalidixic acid. After 72 hrs incubation at 30 °C to initiate the integration of the pK18mobsacB construct, kanamycin- resistant colonies (Kanr) were replica-plated on each of (a) LBP supplemented with 10% (w/v) sucrose and (b) LBP supplemented with 50 #g/ml kanamycin. Both media also contained 30 #g/ml of nalidixic acid. Colonies that were Kanr and sucrose-sensitive (Kanr/Sucs) were cultured in 25 ml LBP media overnight at 30 °C and 25 #l aliquots were plated on LBP agar supplemented with 10% (w/v) sucrose. Plates were incubated for 72 hrs at 30 °C, sucrose resistant (Sucr) colonies were grown for 24 hrs at 30 °C following replica plating on each of (a) LBP agar and (b) LBP agar supplemented with 50 #g/ml of kanamycin. Kanamycin sensitive (Kans) colonies were screened by PCR using the odAKOF and odAKOR primers for truncated dypA and odBKOF and odBKOR primers for truncated dypB gene products (Table 3).  2.4 Bacterial strains and growth  Ht-DypA and DypB were produced in E. coli BL21(DE3) (Table 1). Cells containing either pETDYPA1 or pETDYPB1 were grown in LB (57) containing 25 µg/ml of kanamycin at 37°C with shaking. Cultures were grown to an OD600 of 0.5 at which point isopropyl-!-D- thiogalacto-pyranoside (IPTG) was added to a final concentration of 0.5 mM to induce dyp expression. Cells were incubated for a further 12 h at 20 °C with shaking before harvesting by centrifugation. Pellets were washed three times with 20 mM sodium phosphate, 10% glycerol, pH 8.0 and frozen at -80 °C until use.  2.5 Protein purification  Unless otherwise stated, the DyPs were purified using the same protocol described below. Approximately 4.5 g cells (wet weight) were thawed in 20 ml of 20 mM sodium phosphate, 0.1 ! !  19 mM EDTA, pH 8.0 and were lysed at 4 °C using an Emulsi Flex-C5 homogenizer (Avestin). Cell debris was removed by centrifugation (140,000 g + 50 min). Ht-DyP was purified from the supernatant fluid using a column of 10 ml Ni-NTA resin (QIAgen) according to the manufacturer’s instructions in the presence of 0.1 mM EDTA. DyP was eluted as apoprotein from the column, and was exchanged into 20 mM 3-(N-morpholino) propanesulfonic acid (MOPS), 80 mM NaCl, pH 7.5 (buffer A) using a 30 K NMWL Amicon Ultra-15 Centrifugal Filter Device (Millipore). The affinity tag was removed by incubating a 200:1 molar ratio of the protein with human %-thrombin (Haematologic Technologies Inc.) for 12 h at room temperature, followed by a second immobilized metal affinity chromatography (IMAC) column. The DyPs were eluted from the second IMAC column using buffer A containing 20 mM imidazole and subsequently buffer exchanged into buffer A. As purified, preparations of DypA and DypB had Rz values (Asoret/A280) of less than 0.1. To reconstitute the proteins, hemin chloride (Sigma- Aldrich) was dissolved in DMSO to 20 mg/ml and added drop-wise with gentle stirring to protein in buffer A to a final 2:1 hemin/protein molar ratio. Excess hemin was removed via centrifugation followed by gel filtration chromatography using Sephadex G-25 fine (GE Healthcare). The reconstituted DyPs were dialyzed overnight at 4°C in buffer A containing 1 mM EDTA and were loaded onto 8 ml of Source 15Q anion exchange resin (GE Healthcare) packed in an AP-1 column (Waters Corp., Milford, MA) that had been equilibrated with buffer A and operated at a flow rate of 3 ml/min. DyPs were eluted using a linear gradient of 80 to 500 mM NaCl in 20 column volumes. Reconstituted DypA and DypB had Rz values of 2.7 and 2.9, respectively. The purified protein, which was >95% apparent homogeneity, as determined by SDS-PAGE, was exchanged into buffer A, concentrated to 20 mg/ml, frozen as beads in liquid nitrogen, and stored at -80 °C until use. The protocol for the production of selenomethionine- labeled DypB was adapted from (58) and purified similarly to native DypB. ! !  20 2.6 Protein analysis  Protein concentration was measured using the Micro BCA assay (Pierce). Heme concentration was determined using a pyridine hemochromogen assay (59).  2.7 Phylogenetic analyses  Structure-based alignments were generated using STRAP (60, 61) and CLUSTALX2.0 (62). Briefly, the STRAP editor and the TM-Align algorithm (60, 61) were used to align the four DyPs with published structures: EfeB of E. coli (PDB ID: 2WX6); BtDyp of Bacteroides thetaiotaomicron VPI-5482 (PDB ID: 2GVK) and TyrA of Shewanella oneidensis (PDB ID: 2HAG); and DyPDec1 (PDB ID: 2D3Q). The associated TM-score for the four aligned sequences exceeded 0.75, with overall RMSD values ranging from 3.1 to 3.2 Å, consistent with the shared ferredoxin-like structural fold of these proteins. The TM-align superposition further indicated that the four DyPs have 234 equivalent residue positions. The resulting alignment was used as a profile in CLUSTALX2.0 to align DyP sequences. Initially, all sequences deposited in the Peroxibase database and DyP family sequences found in the literature were considered for this analysis. Sequences were parsed such that none in the final data set shared greater than 40% identity. Signal sequences, as predicted by SignalP 3.0, were removed from the input sequences (63). Sequences lacking any one of the conserved residues Asp153, His226, Arg244, and Asp288 (DypB numbering), or a glutamate in place of an aspartate, were removed from the analysis. The final data set had 39 sequences (Appendix Figure A1).  For the phylogenetic analyses, the alignment was edited to only contain equivalent residues. Accordingly, columns were deleted if they contained insertions, deletions or residues that were not within 3.0 Å RMSD of the equivalent residues in each of the superimposed DyP ! !  21 structures. Chlorite dismutase, a heme-containing enzyme with the same structural fold as DyPDec1 (24), was excluded from the alignment because the TM-scores were below 0.6; the overall RMSD values ranged from 3.5 to 3.8 Å; and the enzyme lacks the distal aspartate of DyPs (64). This alignment (Appendix Figure A1), corresponding to an average of 55% of each sequence, served as the input for a maximum-likelihood tree built using the PHYLIP package version 3.69 (65). A best tree was generated by jumbling the sequence input order 21 times. Bootstrapping was performed using 100 datasets and jumbling the input order 21 times for each bootstrap.  2.8 Steady-state kinetic analysis  Steady-state reaction kinetics were monitored spectrophotometrically. The standard assay was performed in 1 mL 50 mM sodium acetate, pH 4.5, 25.0 ± 0.5 °C, containing 10 mM 2,2'- azino-bis(3-ethylbenz-thiazoline-6-sulphonic acid) (ABTS), 1.0 mM H2O2 and the appropriate amount of DyP. Reactions were initiated with the addition of H2O2 and initial rates were monitored at 414 nm (,414 = 36.6 mM-1cm-1 (66)).  Apparent steady-state kinetic parameters were evaluated for each of ABTS, pyrogallol (1,2,3-trihydroxybenzene), reactive blue 4 (RB4), and MnSO4 using 1.0 mM H2O2 and the following wavelengths for each of the last three reductants: 430 nm (,430, 2.47 mM-1cm-1 (67)), 610 nm (,610, 4.2 mM-1cm-1 (68)), and 270 nm (,270, 11.59 mM-1cm-1 (69)). Reactions with ABTS (1.0-40 mM), pyrogallol (0.1-20 mM) and RB4 (0.1-0.6 mM) were performed using 50 mM sodium acetate, pH 4.5. Reactions with 1-20 mM MnSO4 were performed using 50 mM sodium malonate, pH 4.5 as described previously (69). Kinetic parameters were evaluated for H2O2 at each of 10 mM ABTS, 20 mM Pyrogallol, 5 mM RB4, and 17.5 mM MnSO4. Steady- state kinetic equations were fit to the data using LEONORA (70). ! !  22 2.9 DypB structure determination  Crystallization conditions of purified heme-bound DypA and DypB were screened using the following commercial kits: Wizard I and II (Emerald Biosystems), Crystal Screen I and II (Hampton Research), and Index (Hampton Research). Each condition was tested using sitting drop vapor diffusion at room temperature. Each drop was made from 1 µL of well solution and 1 µL of 18 mg/mL DypB or 10 mg/mL DypA protein solution prepared in Buffer A, respectively. No further refinement of initial screen crystallization conditions was performed.  Heme-bound DypB crystals were grown by hanging drop vapor diffusion at room temperature. The well solution for the selenomethionine and native primitive trigonal (P3221) crystal forms contained 3.5 M sodium formate, pH 7.0. The well solution for the R-centered trigonal (R32) crystal form contained 1.26 M ammonium sulphate, 0.1 M HEPES, pH 7.5. Drops were made from 2 µl of 18 mg/mL protein solution and 2 µL of well solution. The P3221 crystals grew overnight. The R32 crystals grew over the course of 3 months. Crystals were briefly soaked in well solution supplemented to 16% glycerol and then flash frozen by immersion in liquid nitrogen.  X-ray diffraction data were collected at the Canadian Light Source on beamline 08ID-1 and at the Stanford Synchrotron Radiation Laboratory on beamline 7-1 for the P3221 and R32 crystal forms, respectively. Multiple wavelength anomalous diffraction data were collected at wavelengths of 0.9788 (peak), 0.9790 (inflection) and 0.9769 (remote) Å. Native crystal data were collected at wavelengths of 0.9795 and 1.0000 Å for the P3221 and R32 crystal forms, respectively. Data for the selenomethionine-labeled protein were processed using XDS (71) and native data were processed using HKL2000 (72). Selenomethionine and native crystals grew in the space group P3221 with three DypB molecules in the asymmetric unit whereas the native ! !  23 crystals grown in the space group H23 contained one molecule in the asymmetric unit. The programs Solve (73) and Resolve (74, 75) were used to obtain phases from the fifteen identified selenium sites and to build a preliminary model (Appendix Figure A2). The model built by Resolve contained 789 of a possible 1011 residues with 503 residues assigned to the sequence. The phase solution had an initial figure of merit of 0.66 that was improved to 0.74 by density modification. The structure was manually edited using Coot (76) and refined using translation libration screw (TLS) parameters (77) with Refmac5 (78) from the CCP4 program suite (79). The data for the R32 space group were processed using iMosflm (80) and the structure was determined by molecular replacement using a single protein chain from the P3221 structure as a search model in the program MolRep (81). The native P3221 and R32 structures were considered identical with overall RMSD of all atoms and TM-scores of 0.24 Å and 1, respectively. All analysis and figures were generated from the native structure refined in space group R32, because this crystal form diffracted to higher resolution. Relative to the peptide sequence (49), the crystal structure is missing 5 and 37 residues at the N and C termini, respectively. The final model for DypB includes one protein molecule (residues 6-313), two molecules of glycerol, two molecules of sulfate, and 409 water molecules. More than 92.1% of (*,-) angles fall within the most favorable regions of Ramachandran plots, and none are in the disallowed regions. Data collection and refinement statistics are shown in Table 4. Structure figures were generated in PYMOL (DeLano Scientific, San Carlos, CA).    ! !  24     Table 4. X-ray diffraction data collection and refinement statistics.   SeMet-DypB  DypB DypB Data collectiona     Resolution range (Å) 46.7 – 2.6 (2.74 – 2.60) 48.4 – 2.1 (2.32 – 2.10) 33.93-1.40 (1.48-1.40)     Space group P3221 P3221 R32     Unit cell dimensions (Å) a = 132.9, b = 132.9,  a = 132.4, b = 132.4, a = 127.7, b = 127.7,  c = 160.8 c = 160.2 c = 178.2     Unique reflections 97024 94410 108171     Completeness (%) 100 (100) 99.5 (70.0) 98.9 (96.2)     Average I/!I 8.3 (4.5) 19.1 (2.0) 16.3 (3.3)     Redundancy 5.9 (5.8) 6.6 (3.7) 6.1 (5.3)     Rmerge 0.061 (0.167) 0.060 (0.614) 0.049 (0.387) Refinement     Rwork (Rfree) -- 18.7 (22.7) 13.2 (14.8)     B-factors (Å2) --        All atoms -- 45.3 16.9        Protein -- 45.4 14.4        Heme -- 36 10.5        Water -- 47 27.1     r.m.s.d. bond length (Å) -- 0.023 0.012      In most-favourable region -- 90.1 92.1     In disallowed regions -- 0.4 0 a Values in parenthesis represent highest resolution shell   ! !  25 2.10 Electronic absorption spectroscopy  Spectra were recorded from 250 and 700 nm using a Cary 5000 spectrophotometer (Varian) equipped with a thermostatted cuvette holder maintained at 25.0 ± 0.5 °C.  2.11 Nitrated lignin UV-vis assays  A stock solution of nitrated MWL hereward wheat lignin (0.015 mM) was prepared in 750 mM Tris buffer pH 7.4 containing 50 mM NaCl. Assays (200 µL total volume) were carried out in 96 well Falcon Microtest clear plates, using a TECAN GENios plate reader. To each well was added 30 !L of culture supernatant or recombinant protein solution (0.1 mg/mL), 160 !L nitrated lignin, 10 !L of 40 mM H2O2. Absorbance at 430 nm was measured at 1 min intervals for 20 min. Each assay was carried out in duplicate, with controls in which nitrated lignin or protein solution was replaced with 750 mM Tris pH 7.4 containing 50 mM NaCl. Assays of recombinant DypA and DypB were also carried out in the presence of 30 µL 50 mM MnCl2. The whole plate was repeated without addition of H2O2. The presented readings represent an average of duplicate experiments.          ! !  26 3 RESULTS  3.1 Bioinformatic analysis of RHA1 DypA and DypB  3.1.1 Predicted DyPs of RHA1   The genome of Nocardia farcinica, closely related to Nocardia autotrophica which degrades lignin (40), was analyzed for peroxidase genes of unknown function. N. farcinica contains three unannotated peroxidase genes, having Genbank accession numbers BAD57916, BAD56437, and BAD59877, respectively. Searches using the BLAST algorithm revealed that BAD59877, annotated as a DyP-type peroxidase, has two predicted homologues in R. jostii RHA1: ro05773 (accession number ABG97551) ro02407 (ABG94212) have 50% and 52% amino acid sequence identity with BAD59877, respectively. Based on the phylogenetic analysis below, ABG97551 and ABG94212 were named DypA and DypB, respectively.  To gain insight into the identity and function of the predicted RHA1 DyPs, local alignments were employed to explore the dyp genes and their genomic context (Figure 8). The predicted DypA protein shares 32% amino acid sequence identity with EfeB from E. coli K-12, also known as YcdB in strain O157:H7 (Table 5). In E. coli, this gene belongs to the efeUOB operon involved in Fe(II) uptake under acidic conditions (82). Consistent with this finding, EfeB has a Twin-Arginine Transport (TAT) signal sequence, EfeO possesses an N-terminal cupredoxin domain, and EfeU is a homolog of the high-affinity iron permease FTR1 from S. cerevisiae (83). The efeUOB operon is conserved in RHA1 (Figure 8, Table 5), and DypA contains a predicted TAT signal sequence, suggesting that it is exported.   ! !  27 ro 02 40 6 ro 02 40 7 ro 02 40 8 dypB ro 05 77 2 ro 05 77 3 ro 05 77 4 ro 05 77 5 dypA enc ro 02 40 9 ro 05 77 6       Figure 8. Operonic structure of dypA and dypB in R. jostii RHA1.   Among characterized homologs, DypB shares highest amino acid sequence identity with BtDyP, whose crystal structure has been solved (24). The dypB gene is predicted to be operonically coupled with ro02408, annotated here as enc as its gene product is a homologue of encapsulin (Figure 8; (20)).  Moreover, the RHA1 DypB is predicted to contain the C-terminal sequence responsible for targeting proteins for encapsulation (20).    Table 5. Annotation of DyPs and proteins encoded by predicted co-transcribed genes in the RHA1 genome. Gene ID Annotation BeTs a to characterized homologues Percent Identity (%)b ro02407 DypB BtDyp of B. thetaiotaomicron VPI-5482 41% ro02408  encapsulin Encapsulin of T. maritima 34% ro05773 DypA EfeB of E. coli K-12 32% ro05774 lipoprotein EfeO of E. coli K-12 35% ro05775 Fe(II)/Pb(II) permease EfeU of E. coli K-12 27%   ! !  28 3.1.2 Phylogenetic analysis  Using a maximum likelihood analysis, the DyP sequences group into four discrete subfamilies (Figure 9). These were identified as A through D to be consistent with a previous analysis (22). The four DyPs with available structural data belong to subfamilies A, B, and D. Subfamilies A and B, which group within the phylogram, comprise bacterial DyPs. Subfamilies C and D, which also group together, comprise bacterial and fungal sequences, respectively. The most divergent of the analyzed DyPs share only 6% overall amino acid sequence identity. Within subfamilies, this value is 15%. RHA1 DypA and DypB were named according to the subfamilies in which they grouped.  ! !  29 Figure 9. Radial phylogram of DyPs. The names of bacterial or fungal strains are indicated in subscript with the protein or abbreviated organism names. Structure-based sequences alignments were performed using: EfeBK-12 from E. coli K-12 (PDB ID: 2WX6), TyrA from Shewanella oneidensis (2HAG), BtDyPVPI-5482 from Bacteroides thetaiotaomicron VPI-5482 (2GVK), DyPDec1 from T. cucumeris Dec1 (2D3Q), DypARHA1 and DypBRHA1 from R. jostii RHA1 (Genbank accession numbers: ABG97551.1, ABG94212.1), YfeXK-12 from E. coli K-12 (BAE76711.1), AnaPXPCC 7120 from Anabaena sp. PCC 7120 (BAB77951.1), TfuDypYX from Thermobifida fusca YX, MsP1 from Marasmius scorodonius, TalTAP from Termitomyces albuminosus, Bsu168 from Bacillus subtilis 168 (CAB15852.1), MvaPYR-1 from Mycobacterium vanbaalenii PYR-1 (ABM12972.1), PdePD1222 from Paracoccus denitrificans PD1222 (ABL69832.1), RpABisB18 from Rhodopseudomonas palustris BisB18 (ABD87513.1), CteKF-1 from Comamonas testosteroni KF-1 (EED66859.1), DdiAX4 from Dictyostelium discoideum AX4 (EAL70759.1), MtbH37Rv from Mycobacterium tuberculosis H37Rv (CAB09574.1), Cco13826 from Campylobacter concisus 13826 (EAT98288.1), AcspADP1 from Acinetobacter sp. ADP1 (CAG67144.1), PpaSIR-1 from Plesiocystis pacifica SIR-1 (EDM76509.1), CyspPCC 7424 from Cyanothece sp. PCC 7424 (ACK71272.1), CviATCC 12472 from Chromobacterium violaceum ATCC 12472 (AAQ59612.1), MxaDK 1622 from Myxococcus xanthus DK 1622 (ABF90727.1), OanATCC 49185 from Ochrobactrum anthropi ATCC 49185 (ABS17389.1), PsspPRwf-1 from Psychrobacter sp. PRwf-1 (ABQ94167.1), ChuATCC 33406 from Cytophaga hutchinsonii ATCC 49185 (ABG59511.1), Pos from Pleurotus ostreatus (CAK55151.1), PgrCRL from Puccinia graminis CRL (AAWC01001299.1), Ppa from Phakopsora pachyrhizi, Lbi1S238N-H82 and Lbi2S238N-H82 from Laccaria bicolor S238N-H82 (ABFE01001782.1, EDR12662.1), BfuB05.10 from Botryotinia fuckeliana B05.10 (EDN26366.1), PchWisconson 54-1255 from Penicillium chrysogenum Wisconson 54-1255 (CAP99029.1), AfuAf293 from Aspergillus fumigatus Af293 (EAL86784.2), PplMad-698-R from Postia placenta Mad-698-R (EED79944.1), and Amsp1 and Amsp2 from Amycolatopsis sp. (personal communication with Michelle Chang, UC Berkley). Bootstrap values of critical nodes are indicated.                      ! !  30 AcspADP1 TyrA NpuPCC 73102Lbi2S238N-H82 PplMad-698-R AfuAf293 PchWisconsin 54-1255 BfuB05.10 Lbi1S238N-H82 Ppa PgrCRL MsP1 DyPDec1 TalTAP Pos Amsp2 AnaPXPCC 7120 ChuATCC 33406 Amsp1 PsspPRwf-1 OanATCC 49188 MxaDK 1622 CviATCC 12472 CyspPCC 7424 PpaSIR-1 100 37 Bsu168 DypARHA1 TfuDypYX MvaPYR-1 RpABisB18 PdePD1222 EfeBK12 94 100 CteKF-1 YfeXK12 DdiAX4 DypBRHA1 MtbH37Rv Cco13826 btDyPVPI-5482 D C A B                                               ! !  31 3.2 Heterologous production of DyPs  The dyp genes were each cloned into pET-based vectors as described in section 2.2. Protein production and solubility in E. coli BL21(DE3) were verified 3, 6, 12, and 24 hrs after induction with IPTG at each of 16, 20, 30 and 37 °C. Optimal production of both DyPs was observed at 16°C after 12 hrs. As purified by affinity and anion-exchange chromatographies, neither DyP contained detectable amounts of heme. Upon reconstitution with ferric heme, DypA and DypB absorbed maximally at 408 and 404 nm, respectively, and exhibited Rz values of 2.7 and 2.9, respectively. These values did not change significantly over 24 hours at 4 °C or when solutions of protein were flash frozen in liquid nitrogen and stored at -80 °C for up to 6 months. Approximately 6 mg of DypA and 24 mg of DypB per litre of E. coli culture were purified and reconstituted using the method described in section 2.5.  3.3 Analysis of gene deletion mutants   The !dypA and !dypB RHA1 mutant strains were constructed as described in section 2.3 and confirmed using PCR (Figure 10). Culture supernatants from the !dypA and !dypB mutant strains were examined for lignin degradation activity using a UV/vis assay (40) described in section 2.11 in which lignin-degrading strains show an increase in absorbance at 430 nm, relative to controls.  By contrast, non-degraders show a zero or negative value. The !dypB strain shows a decrease in activity in the presence or absence of hydrogen peroxide (Figure 11), whereas the !dypA strain retains some activity, consistent with a role for DypB in lignin breakdown.    ! !  32    1      2       3                      1     2     3       A             B         Figure 10. Confirmation of the !dypA and !dypB mutant strains by DNA gel electrophoresis of PCR products.  (A) PCR products of templates amplified with the dAF and dAR primers. Templates used include: Lane 1, pk18dpA; Lane 2, !dypA RHA1 genomic DNA; Lane 3, wt RHA1 genomic DNA. (B) PCR products of templates amplified with the dBF and dBR primers. Templates used include: Lane 1, pk18dpB; Lane 2, !dypB RHA1 genomic DNA; Lane 3, wt RHA1 genomic DNA.                         Figure 11. Ability of RHA1 mutants to degrade nitrated MWL. Activity (!A430) was measured using a UV/vis assay of culture supernatant obtained from wild-type RHA1, the !dypB mutant and the !dypA mutant in the presence (clear) and absence (gray) of 2 mM H2O2. Bars represent standard error of the mean.    ! !  33 3.4 Spectroscopic analysis of RHA1 DypA and DypB  3.4.1 Electronic structure of ferric DypA and DypB  The electronic structure of ferric DypA and DypB was analyzed using UV-vis spectroscopy. The electronic absorption spectra of ferric DypA (Figure 12A, solid line) and DypB (Figure 12B, solid line) showed distinct spectral features for heme in the two paralogues. DypA harbored sharp spectral features with Soret at 408 nm and charge transfer bands, CT1 and CT2, at 634 nm and 503 nm, respectively. By contrast, the Soret of DypB was at 404 nm with broad features and a shoulder appearing at c.a. 360 nm. Using a pyridine-hemochrome assay, the molar absorption coefficients of reconstituted DypA and DypB were !408 = 126 and !404 = 84 mM-1   cm-1, respectively.  Figure 12. Electronic absorption spectra of (A) DypA and (B) DypB. The samples contained 10 !M ferric enzyme (solid line) or the same sample with 10 !M H2O2 (dotted line) in 20 mM MOPS, 80 mM NaCl, pH 7.5 (25 °C).   ! !  34 3.4.2 Formation of intermediates upon reaction with H2O2  To investigate the nature of intermediates formed during catalytic turnover of the DyPs, each was mixed with H2O2 and the spectra were recorded. Adding one equivalent of H2O2 to DypA at pH 7.5 yielded a species with a red-shifted, hypo-chromatic Soret at 419 nm and ! and " bands at 557 nm and 528 nm, respectively (Figure 12A, dashed line). These spectral features are consistent with those reported for an [Fe(IV)=O] (Compound II) type species (3). Under similar conditions, DypB yielded a species with a blue-shifted, hypo-chromatic Soret at 397 nm, a prominent shoulder around 340 nm, and bands at 580 nm, 615 nm and 649 nm overlaying a broad hyper-chromaticity between 540 nm and 700 nm (Figure 12B, dashed line). This spectrum resembled those of the [Fe(IV)=O]Por+• (Compound I) type species in other DyPs (12, 25) and had a half-life of ~9 min at 25 °C.  3.5 Substrate analysis of DyPs  Using ABTS as a substrate, the optimal pH of the reaction with DypA and DypB was 3.5 and 4, respectively (results not shown). For DypB, the activity at pH 7.5 was 1% that at pH 4. For DypA, the activity was not detected above pH 6. As DypB precipitated below pH 4.0, 50 mM acetate, pH 4.5 was used in subsequent experiments. Reactions involving ABTS were corrected for the non-enzymatic reaction of this compound with H2O2. In the standard assay, the non-enzymatic increase in A414 accounted for 32% of the total rate observed in the presence of DypA, and 11% of the rate in the presence of DypB. Both DyPs oxidized each of ABTS, pyrogallol, and the AQ-based dye RB4 in an H2O2-dependent fashion under steady-state conditions. DypB was also found to oxidize Mn(II) in an H2O2-dependent fashion in the presence of malonate, as indicated by an increase in absorbance at 270 nm (Figure 13). The oxidation of ! !  35 !!" !#" !$" !%" &"" &!" &#" "'"" "'"( "')" "')( &*+,- !*+,- )*+,- "*+,- ! ! . /0 12 /3 -4 5 637585-9:;*<-+= !(>*-+ Mn(II) by DypB was also observed using an assay developed to monitor the bacterial oxidation of Mn(II) (84) (Figure 14).                  Figure 13. Monitoring the formation of malonate-Mn(III) complexes from the DypB-mediated peroxidation of Mn(II) in 50 mM malonate pH 4.5 (25°C).            Figure 14. Monitoring the formation of PPi-Mn(III) complexes from the DypB-mediated peroxidation of Mn(II) in 20 mM HEPES pH 4.5 (25°C).  ! !  36 In the presence of 1 mM H2O2, the two DyPs possessed similar apparent specificities (kcat/Km) for ABTS. However, they had very different apparent specificities for the reductive substrates (Table 6). Thus, DypA utilized the substrates in the following order: RB4 > ABTS > pyrogallol, and did not detectably oxidize Mn(II). By contrast, DypB utilized the substrates in the following order: ABTS > pyrogallol > RB4 > Mn(II). In the presence of constant concentrations of reducing substrates, the DyPs also showed different apparent specificities for H2O2 (Table 6). More specifically, the apparent specificity of DypB for H2O2 was relatively low in the presence of RB4, and of DypA was relatively low in the presence of ABTS and pyrogallol. Inspection of the steady-state data further revealed that DypA was not saturated with H2O2 under the conditions used to study ABTS and pyrogallol oxidation. Attempts to perform studies at higher concentrations of H2O2 were confounded by non-enzymatic reactions. ! !  37       Table 6. Steady-state kinetic parameters of DypA and DypB from RHA1.a   Reducing Substrate H2O2  Dyp Km (mM) kcat (s-1) kcat/Km (M-1s-1) Km (µM) kcat (x 10-3 s-1) kcat/Km (x 103 M-1s-1) A 8.2 (0.5) 16.83 (0.04) 2000 (100) 4100 (200) 68000 (2000) 16.8 (0.5) ABTS B 23 (2) 55 (2) 2400 (100) 67 (3) 14100 (200) 210 (8) A 9.9 (1.3) 0.49 (0.03) 50 (3) 640 (40) 310 (10) 0.49 (0.03) pyrogallol B 5.7 (0.4) 3.4 (0.1) 600 (20) 30 (1) 2080 (40) 79 (2) A 1 (0.2) 13 (2) 12800 (600) 48 (2) 4900 (40) 102 (3) RB4 B 0.35 (0.05) 0.050 (0.003) 140 (10) 6.4 (0.9) 21.5 (0.6) 3.4 (0.4) Mn(II) B 24 (2) 0.59 (0.04) 25.1 (0.1) 1.3 (0.2) 17600 (500) 134 (2) aValues in parenthesis represent the standard error.     ! !  38 3.6 Kinetic evaluation of recombinant DypA and DypB  Each protein was tested in the nitrated lignin UV-vis assay (40), in the presence and absence of 2 mM hydrogen peroxide. DypB showed activity in the presence of hydrogen peroxide, but not in the absence of hydrogen peroxide (Figure 15). Under the same conditions, DypA showed no activity, either in the presence or absence of hydrogen peroxide (Figure 15). DypB was found to show 5-fold greater activity in this assay in the presence of 1 mM MnCl2 (results not shown).  Figure 15. Activity (change in absorbance over 20 min assay) of 25 !g recombinant DypA and DypB protein in nitrated lignin UV-vis assay, in presence (clear) or absence (gray) of 2 mM H2O2 ! !  39 3.7 X-ray crystallography  3.7.1 crystallization of the RHA1 DyPs  The initial crystallization screens of purified RHA1 DyPs described in section 2.9 yielded 4 and 20 separate crystallization conditions for DypA and DypB, respectively (Appendix Table A1). The most promising DypA crystals collected from the initial screen formed non- reproducible elongated clusters of needles overnight (Figure 16A). However, while these crystals diffracted to 1.8 Å resolution, the poor quality of the collected data prevented proper processing (Appendix Figure A3). Two conditions of the DypB initial screen yielded large and discrete crystals overnight. Crystals grown in sodium acetate trihydrate pH 4.5, 3.0 M NaCl diffracted to 2.2 Å, but a lengthy cell edge made processing too complex. Alternatively, crystals grown in 0.1 M sodium formate, pH 7.5 (Figure 16B) diffracted to 2.1 Å. Data sets were processed and solved as described in section 2.9. Over the course of 3 months, a single crystal formed in 1.26 M ammonium sulphate, 0.1 M HEPES, pH 7.5 (Figure 16C) and diffracted to 1.4 Å resolution.    A                     B                C       Figure 16. Photographs of RHA1 DyP crystals yielding diffraction data. (A) DypA crystals grown overnight with 0.1 M BIS-TRIS pH 6.5, 25% w/v Polyethylene glycol 3,350; (B) DypB crystal grown overnight with 0.1 M sodium formate, pH 7.5; (C) DypB crystals grown over the course of 3 months with 1.26 M ammonium sulphate, 0.1 M HEPES, pH 7.5.   ! !  40 3.7.2 DypB structural overview  The selenomethionine and native DypB structures were refined in the space group P3221 to 2.6 Å and 2.1 Å, respectively (Table 4). Unless otherwise stated, the model described hereafter is the one that was refined in space group R32, because this crystal form diffracted to a higher resolution of 1.4 Å. The structure reveals a two-domain, ! + " protein. Each domain contains a four-stranded, anti-parallel "-sheet sandwiched by !-helices in a ferredoxin-like fold (Figure 17A) similar to chlorite dismutase (64) and DyPDec1 (23). Heme is bound in the C-terminal domain of DypB. Of the 350 residues in DypB, 174 residues form 9 !-helices and 15 "-strands. The tertiary structure of DypB shares structural homology with the four above-mentioned DyPs with published structures, based on TM-scores exceeding 0.75, with overall RMSD values for all atoms ranging from 3.1 to 3.6 Å (60, 64).           ! !  41 A       B             Figure 17. Structure of DypB from R. jostii RHA1. (A) The structure of the DypB protomer. !- helices, "-sheets are colored skyblue and violet, respectively. Turns, loops, and random coils are colored wheat. Ball and stick models represent the heme prosthetic group colored pink. (B) Ball and stick model of the DypB active site. Nitrogen, oxygen and iron atoms are coloured blue, red, and brown, respectively. The water molecule is colored light blue. Carbon atoms for protoporphyrin IX and heme surrounding residues are colored pink and wheat, respectively. Distances in Å between key atoms are shown.   The residues in the heme-binding pocket are shown (Figure 17B). The proximal His226 acts as the fifth ligand to the heme iron, and is also within hydrogen bonding distance with the proximal Asp288. A water molecule coordinates at the sixth position 2.1 Å from the distal side of the heme iron. Also positioned on the distal side of the heme are Asp153 and Arg244, which are 2.9 and 3.4 Å from the heme iron, respectively. Additionally, Arg244 also appears to be within hydrogen bonding distance to a distally positioned heme propionate group, perpendicular to the plane of the heme. Interestingly, Asn246 is also located on the distal side of the heme, 0.1 Å closer to the distal water molecule than Asp153. However, the average B-factors of the Asn246 amide group is slightly elevated to an average of 24 Å2, suggesting it is not well ordered when compared to the heme atoms (average B-factors of 11 Å2) (Figure 18). ! !  42                  Figure 18. The (2Fo-Fc) electron density (gray, contour level = 1 !) of the refined DypB structure; The refined ball and stick model of the DypB active site. Nitrogen, oxygen and iron atoms are coloured blue, red, and brown, respectively. The distal water molecule is colored light blue. Carbon atoms for protoporphyrin IX and surrounding residues are colored pink and wheat, respectively; names of each of the heme-surrounding residues are shown.   3.7.1 Substrate access channels  The crystal structure of DypB revealed two possible points of access to the heme edge:  a large distal binding pocket and a smaller lateral opening. The lateral channel appears to be plugged by one of the heme propionates, which, despite being well ordered, does not appear to be in an H-bonded network to surrounding residues. The major access to the heme of DypB is ! !  43 likely provided by an overall acidic, elongated distal pocket just above the heme iron (Figure 19A). Residues lining the distal binding pocket include Pro17, Ser18, Ala19, Arg141, Ser145, Asp147, Val152, Gyl154, Thr155, Asn157, Asp245, Ala248, and Thr259, as well as active site residues Asp153, Arg244, and Asn246 (Figure 19B).  A           B         Figure 19. Heme access channels of R. jostii RHA1 DypB. (A) Vacuum electrostatic surface representation generated using PYMOL (DeLano Scientific, San Carlos, CA) and (B) solvent- accessible area surface representation (grey) generated using Hollow 1.1 (85). Ball and stick models represent heme in pink. The distal water molecule is colored light blue.   To further investigate the presence of a distal substrate-binding pocket in DypB and the three other holo DyP homologs with crystal structures, VOIDOO (86) was used to detect and measure protein pockets using a probe with a 1.4 Å radius. The volumes of the distal pocket of DypB, TyrA (B-type) and D-type DyPDec1 were calculated to be 90, 151, and 397 Å3, respectively (Figure 20). Interestingly, no distal pocket was detected in the heme-bound crystal form of the A-type EfeB (PDB ID: 2Y4F).  ! !  44  A          B           C                   Figure 20. Putative substrate binding pocket of DyP-type peroxidases. Ball and stick models represent heme and protoporphyrin IX in pink. Solvent accessible area surface representation of binding pockets generated using VOIDOO (86). (A) DypB, (B) TyrA, and (C) DyP. ! !  45 4 DISCUSSION  Bioinformatic analysis of the genomes of ligninolytic bacteria identified two candidate lignin-degradation genes encoding DyP-type peroxidases in the RHA1 genome. Phylogenetic analysis classified these enzymes as DypA and DypB, based on their relationship with characterized DyPs. The enzymes showed different apparent specificities for an AQ dye and known peroxidase substrates, while DypB was discovered to oxidize Mn(II). The crystal structure of DypB was solved to 1.4 Å, revealing a hexa-coordinated heme molecule, a putative substrate-binding pocket distal to the heme, and an Asn residue in the active site, which is unique to this enzyme. A !dypB deletion mutant of RHA1 showed greatly reduced lignin degradation activity in a colorimetric assay, consistent with a role in lignin breakdown. In addition, recombinant DypB protein also showed activity in the colorimetric assay, which was increased 5-fold in the presence of Mn(II). These various findings are discussed below.  4.1 Phylogenetic analysis  The phylogenetic analyses herein confirm and extend previous studies. Using only a sequence-based alignment and neighbor-joining methods, DyPs had been classified into four discrete subfamilies, A to D (87). As in the current analysis, A, B, and C were classified as bacterial while D was fungal, consistent with the Peroxibase database (21). However, this analysis re-classifies some DyPs. For example, the cyanobacterial AnaPX (22) appears to be a C- type enzyme. The similarity between A- and B-type DyPs on the one hand with C- and D-types on the other has been disputed due to their low sequence identity (88). However, the current TM- align superposition establishes the homology of the DyPs through their common structural fold and conserved active site residues. It is possible that the enzymes of the different subfamilies have different physiological roles. In this respect, further analysis revealed that of the 111 unique ! !  46 A-type DyP genes in the Biocyc database (89), 86% are predicted to have a TAT signal sequence and 90% are encoded by genes that are co-localized with those predicted to encode iron-uptake proteins. Consistent with this, the A-type DyP of E. coli, EfeB, is periplasmic (27). Moreover, 14% of the 150 B-type dyp genes in the Biocyc database are co-localized with those predicted to encode encapsulin. Interestingly, all such co-localization occurs in burkholderials and actinomycetales. To our knowledge, no other dyp genes are co-localized with encapsulin- encoding genes.  4.2 Substrate analysis  Although DyPs were initially defined for their ability to degrade AQ dyes with high specificity (12, 13, 15, 22, 24, 25), the relatively low specificity of DypB for RB4 indicates that this is not a ubiquitous characteristic of these enzymes. Indeed, the available data indicate that the C- and D-type DyPs have up to four orders of magnitude higher specificity for AQ dyes than do the A- and B-type enzymes (Table 7). More generally, only the D-type DyPs AjPI and AjPII (13) have steady-state kinetic parameters for reductive substrates and H2O2 that are of the same order of magnitude as plant-type peroxidases. The RHA1 isozymes are more typical of DyPs in that their substrate specificities are from ~10 to ~104 fold lower (Table 7). Similarly, the apparent kcat/Km of DypB for Mn(II) is ~104-105 fold lower than that of MnP from Phanerochaete chrysosporium (90), Panus tigrinus (91) and Bjerkandera sp. BOS55 (92). In addition, the apparent kcat of the RHA1 DyPs is up to three orders of magnitude lower than that of plant-type peroxidases (Table 8). While it is possible that the peroxidase activity of some of the DyP enzymes is not physiologically relevant, the AQ dye and lignin degradation activity (93) are significant for their potential biotechnological applications in dye degradation and the breakdown/modification of lignin polymers. ! !  47               Table 7. Apparent specificity constants of bacterial and fungal DyPs for various Reactive Blue dyes.a Subfamily Enzyme Organism Reactive Blue dye kcat/Km (x 104 M-1s-1) A TfuDyP Thermobifida fusca 19 35 A DypA R. jostii RHA1 4 1.3 B DypB R. jostii RHA1 4 0.01 B TyrA Shewanella oneidensis 5 7 C AnaPX Anabaena sp. PCC 7120 5 1200 D AjPI Auricularia auricula-judae 5 500 D AjPII Auricularia auricula-judae 5 1700 D DyP T. cucumeris Dec 1 5 480 Plant-type HRP Armoracia rusticana 5 240 aKinetic constants were obtained from the literature in the case of TfuDyp (15), DypA and DypB (this study), TyrA (24), AnaPX (22), AjPI and AjPII (13), and DyP (12). ! !  48      Table 8. ABTS, Pyrogallol, and H2O2 apparent steady-state kinetic parameters of characterized DyPs.a    Km (µM)  kcat (s-1)  kcat/Km (x 103 M-1s-1) Super- family Organism Enzyme ABTS Pyrogallol H2O2 (ABTS)  ABTS Pyrogallol H2O2 (ABTS)  ABTS Pyrogallol H2O2 (ABTS) DyP A R. jostii RHA1 DypA 8200 9900 4100  16 0.5 68  2 0.05 1.7 DyP B R. jostii RHA1 DypB 2300 5700 67  55 3.4 14  2.4 0.6 21 DyP D A. auricula-judaeb AjPI 20000 ND 10  368 ND 268  18 ND 26800 DyP D A. auricula-judaeb AjPII 20000 ND 5  322 ND 238  16 ND 47600 I Escherchia coli KatG 53 1100 146  92 44 175  1735 40 1200 II Panus tigrinus MnP 196 293 ND  20 21 ND  103 72 ND III Armoracia rusticana HRP 3800 4900 14  57 2180 57  15 440 4213 aKinetic constants were obtained from the literature in the case of AjPI and AjPII (13), KatG (94), MnP (91), and HRP (95, 96). ND, not determined bAuricularia auricula-judae     ! !  49 4.3 Electronic structure of heme  The presented electronic absorption indicates that in both RHA1 DyPs, the heme is high spin ferric in the resting state. This result has been further confirmed by EPR spectrometry (Singh and Eltis, unpublished data). Thus, the EPR spectrum of ferric DypA (Figure 21A) predominantly comprised a rhombically distorted (gx ! gy) axial resonance at g! " 6 (gy = 6.32, gx = 5.45 and gz = 1.97). The resonance between g = 3 and g = 2 further suggests the presence of a significant proportion of low spin heme in the reconstituted protein. For DypB (Figure 21B), the major resonance was axial at g! " 6 with a slightly resolved rhombic feature (gy = 6.09, gx = 5.45) and g# =1.97. The absolute difference in g-values ($g = gy-gx) at g = 6 was used to calculate percentage of rhombicity, R (R = $g/16 % 100%), in the major DyP species (97). The $g-values for DypA and DypB were calculated to be 0.87 and 0.65, respectively, yielding R values of 5.44% for DypA and 4.06% for DypB.           Figure 21. EPR spectra of DypA and DypB. Samples contained ferric DypA (A), ferric DypB (B) and DypB incubated for ~2 s in the presence of 2 mM H2O2. All samples contained 0.1 mM DyP in 20 mM MOPS, 80 mM NaCl, pH 7.5.  Spectra were recorded at 5 K using a 9-GHz spectrometer (Singh and Eltis, unpublished data). ! !  50 The extent of rhombicity on the EPR signal has been associated with the changes in the heme iron coordination environment (98, 99). Thus, the better resolved rhombic EPR signal of DypA could be the result of deviation from the square-planer geometry of heme, which would provide a more constrained environment as compared to DypB. Comparison with other DyPs is hindered by a lack of data: most studies have utilized preparations with very low Rz values, others provide incomplete electronic absorption spectra (100), and none have provided EPR spectra. Nevertheless, A-type EfeB from E. coli has a Soret at 406 nm with weak features at 485 and 660 nm (27) while another A-type enzyme, TfuDyP of Thermobifida fusca, has a Soret at 409 nm and two bands at 540 and 575 nm (15). While there are differences in the residues surrounding the hemes in DypA and DypB, further studies are required to determine their roles in modulating the electronic structure of the heme and the substrate specificities of the enzymes.  4.4 Structure and mechanism of DypB  The formation of a relatively long-lived Compound I in DypB is consistent with what has been reported in the D-type DyPDec1 (25). In this case, the [Fe(VI)=O]Por+• intermediate decayed to ferric enzyme without the formation of an [Fe(VI)=O] intermediate. Interestingly, a broad EPR signal (~250 G) of Compound I is observed at 5 K (Figure 21C), and is most similar to that of Compound I from chlorite dismutase (101, 102), despite the lack of a distal aspartate in the latter. The relaxation properties of the hyperfine structure at higher temperatures could be the result of weak coupling between the radical and the ferryl-iron as shown in CcP (103) and KatG (98, 104).  Despite their different overall folds, the heme pocket residues of DyPs and plant peroxidases are surprisingly similar. Thus, the proximal heme ligand in both proteins is a histidine although this is located on a C-terminal helix in DyPs (His226 in DypB) and in the N- ! !  51 terminus in plant peroxidases. Moreover, this histidine is within hydrogen bonding distance with an acidic residue: either an aspartate in plant peroxidases and some DyPs (Asp288 in DypB) or a glutamate in other DyPs, such as EfeB and DyPDec1). The identity of the aspartate or glutamate residue H-bonded to the proximal histidine is not DyP sub-family specific. Finally, both plant peroxidases and DyPs have an arginine residue positioned on the distal side of the heme (29). A major difference between plant peroxidases and DyPs is the identity of the residue on the distal side of the heme iron. In DyPs, this is an aspartate (Asp153 in DypB), while it is a histidine in plant peroxidases.  Catalytic roles for the distal Asp and Arg of DyPs have been proposed based on structural and mutagenesis studies (25, 105). Thus, Asp153 has been proposed to act as a proton shuttle in the formation of Compound I from H2O2 based on its similarity to the distal Glu of CPO while Arg244 has been proposed to stabilize the negative charge during the heterolytic cleavage of the peroxide group, as in plant-type peroxidases (29). However, the role of neither residue has been convincingly established.  Indeed, DyPs must stabilize the [Fe(VI)=O]Por+• intermediate differently than CPO as the latter has a cysteinyl proximal ligand, a histidine that modulates the distal glutamate (106), and no distal arginine. Interestingly, the proximity of the distal Asn246 to the heme iron in DypB suggests that it contributes to stabilizing Compound I formation, however it appears to be unique to the RHA1 ortholog. Regardless, the structural basis for the unusual stability of Compound I in DyPs remains unclear.  4.4.1 Substrate access channels  Substrate access to the heme in DypB is provided by a small lateral opening and a larger elongated binding pocket located distal to the heme iron. Plant peroxidases lack a distal pocket, and instead contain a large substrate channel that provides access to the !-meso carbon heme ! !  52 edge (Figure 2). While the smaller lateral opening to the !-meso carbon is shared amongst DypB and plant peroxidases, it appears that it is blocked by one of the heme propionate groups in the DypB structure (Figure 15A). Despite appearing to be well-ordered in the crystal structure, the carboxyl group of the exposed heme propionate only forms H-bonds with water molecules, and not with any protein residues. It is possible that the propionate is in a “closed” conformation in this structure, blocking the lateral opening. In solution, it might also exist in an “open” conformation that would allow access to the !-meso carbon of the heme edge.  The potential distal substrate access channel in the RHA1 DypB appears to occur in B- and D-type DyPs but not A-type DyPs. Moreover, it appears as though their shape and amino acid composition differ between the B-, and D-type enzymes (Figure 16), being 2- to 3-fold greater in volume in the D-type DypDec1 .  However, due to the search space for calculating the volume of the binding pocket using VOIDOO is limited to a finite cube, the accuracy of these volume calculations need to be treated with caution. Finally, it is noted that no such distal heme pocket occurs in plant peroxidases.  4.5 Lignin degradation    Collectively, the data indicate that peroxidase DypB is involved in lignin breakdown by RHA1. Bioinformatic approaches identified DypA and DypB in RHA1 that have homologs in other lignin-degrading bacteria. Gene deletion studies showed that a "dypB deletion mutant of RHA1 has greatly impaired activity for lignin breakdown, whereas a "dypA deletion mutant was unimpaired compared with wild-type RHA1. Expression of recombinant DypA and DypB proteins and assay in the nitrated lignin UV-vis assay has confirmed that DypB shows activity in the presence of hydrogen peroxide, which is enhanced in the presence of MnCl2, whereas DypA does not. DypB also showed Michaelis-Menten kinetic behavior with samples of Kraft lignin, ! !  53 shows effects upon lignocellulose breakdown in the presence of MnCl2, and accepts a !-aryl ether lignin model compound as a synthetic substrate (93). The turnover of only the disubstituted !-aryl ether, and not other lignin model compounds (93), suggests that DypB is selective in its lignin-degrading activity. Despite this information, it remains unclear whether the degradation of lignin by DypB is complete, or if RHA1 is even capable of mineralizing the reaction products. Furthermore, there is no evidence indicating that lignin is a physiologically relevant substrate: it is possible that the observed ligninolytic activity of DypB is adventitious. Further studies are warranted to better characterize the completeness and physiological relevance of the observed lignin degradation, along with the identity and fate of the various reaction products.  4.6 Cellular localization of DypB  The sample used for the nitrated lignin UV-vis assay of gene deletion mutants is the extracellular protein fraction after centrifugation, suggesting that the localization of DypB is extracellular. However, the protein sequence for RHA1 DypB does not contain a Sec or TAT signal sequence typically involved in protein export. Interestingly, upstream to the dypB gene (ro02407) in the RHA1 genome is enc (ro02408), which is predicted to encode an encapsulin protein that has been shown to form icosahedral nanocompartments (20). Six DyP molecules are predicted to be housed by the spherical assembly of 60 encapsulin monomers forming each 240 Å diameter nanocompartment. Furthermore, a C-terminal peptide tag has been found in proteins that associate with encapsulin (20), and this C-terminal tag is found in RHA1 DypB. It therefore seems probable that the targeting of RHA1 DypB is somehow achieved with the aid of the adjacent encapsulin gene, though the precise mechanism of this process remains to be determined. Interestingly, further support for the extracellular localization of encapsulin ! !  54 nanocompartments is provided by members of the encapsulin family, which have been identified in the supernatants of mycobacterial and brevibacterial cell cultures (107, 108).  4.7 Concluding remarks  Contrary to its nomenclature, the DyP family is emerging as a class of diverse enzymes. Although their physiological roles remain ill-defined, they have been implicated in oxidative stress (17) and deferrochelation (19). To better understand the DyP family, this study provides a careful phylogenetic analysis of these enzymes, which allows for the future study of DyPs within the context of protein subfamilies. Detailed kinetic analyses of the RHA1 DyPs revealed lower substrate specificity for AQ dye-decolorization in the A- and B-type DyPs when compared to the C- and D-types. Moreover, when compared to plant peroxidases, DypA and DypB have considerably lower substrate specificity for both reducing substrates and hydrogen peroxide, which could in part be explained by the lower rate of compound I formation in the RHA1 DyPs (101). This study has provided a crystal structure of DypB to a higher resolution than any other member of the DyP family. Further analysis of the structure of DypB and other DyPs has revealed a potential substrate-binding pocket distal to the heme iron center. This feature, which is unique to the DyP family of enzymes, could help in explaining observed saturation kinetics and the selectivity in turnover of DypB for certain lignin model compound substrates.  In addition to dye decolorization, this study provides potential biotechnological applications for DyPs which include lignin degradation, which is largely supported by colorimetric lignin assays of purified protein and RHA1 deletion mutants. Indeed, a radical- mediated mechanism has been proposed to be responsible for the C-C bond cleavage of a disubstituted !-aryl ether model compound (93).  This is the first study to provide evidence for Mn(II) oxidation in a DyP enzyme. This study also shows that the ability of DypB to degrade ! !  55 Lignin is increased 5-fold in the presence of Mn(II). The colorimetric assays of the !dypB RHA1 strain and the operonic coupling of dypB with the enc gene suggests that the enzyme is exported outside of the cell, where it could come in contact with lignin polymers. However, this has yet to be supported experimentally. Additional studies of DyPs from different subfamilies are warranted to determine their physiological roles as well as the structural basis for their various activities.                                ! !  56 BIBLIOGRAPHY   1. Everse, J., Everse, K. E., and Grisham, M. B. (1991) Peroxidases in chemistry and biology, CRC Press, Boca Raton, Fla. 2. Welinder, K. G. (1992) Superfamily of plant, fungal and bacterial peroxidases, Current Opinion in Structural Biology 2, 388-393. 3. Dunford, H. B. (1999) Heme peroxidases, John Wiley, New York. 4. Schuller, D. J., Ban, N., Huystee, R. B., McPherson, A., and Poulos, T. L. (1996) The crystal structure of peanut peroxidase, Structure 4, 311-321. 5. Ortiz de Montellano, P. R. (1992) Catalytic sites of hemoprotein peroxidases, Annu Rev Pharmacol Toxicol 32, 89-107. 6. Spadaro, J. T., Gold, M. H., and Renganathan, V. (1992) Degradation of azo dyes by the lignin-degrading fungus Phanerochaete chrysosporium, Appl Environ Microbiol 58, 2397-2401. 7. Ollikka, P., Alhonmaki, K., Leppanen, V. M., Glumoff, T., Raijola, T., and Suominen, I. (1993) Decolorization of Azo, Triphenyl Methane, Heterocyclic, and Polymeric Dyes by Lignin Peroxidase Isoenzymes from Phanerochaete-Chrysosporium, Applied and Environmental Microbiology 59, 4010-4016. 8. Chivukula, M., Spadaro, J. T., and Renganathan, V. (1995) Lignin peroxidase-catalyzed oxidation of sulfonated azo dyes generates novel sulfophenyl hydroperoxides, Biochemistry 34, 7765-7772. 9. Goszczynski, S., Paszczynski, A., Pasti-Grigsby, M. B., Crawford, R. L., and Crawford, D. L. (1994) New pathway for degradation of sulfonated azo dyes by microbial peroxidases of Phanerochaete chrysosporium and Streptomyces chromofuscus, J Bacteriol 176, 1339-1347. 10. Sugano, Y., Matsushima, Y., Tsuchiya, K., Aoki, H., Hirai, M., and Shoda, M. (2009) Degradation pathway of an anthraquinone dye catalyzed by a unique peroxidase DyP from Thanatephorus cucumeris Dec 1, Biodegradation 20, 433-440. 11. Kim, S. J., Ishikawa, K., Hirai, M., and Shoda, M. (1995) Characteristics of a Newly Isolated Fungus, Geotrichum-Candidum Dec-1, Which Decolorizes Various Dyes, J of Ferment Bioeng 79, 601-607. 12. Kim, S. J., and Shoda, M. (1999) Purification and characterization of a novel peroxidase from Geotrichum candidum Dec 1 involved in decolorization of dyes, Appl Environ Microbiol 65, 1029-1035. 13. Liers, C., Bobeth, C., Pecyna, M., Ullrich, R., and Hofrichter, M. (2010) DyP-like peroxidases of the jelly fungus Auricularia auricula-judae oxidize nonphenolic lignin model compounds and high-redox potential dyes, Appl Microbiol Biotechnol 85, 1869- 1879. 14. Sugano, Y., Sasaki, K., and Shoda, M. (1999) cDNA cloning and genetic analysis of a novel decolorizing enzyme, peroxidase gene dyp from Geotrichum candidum Dec 1, J Biosci Bioeng 87, 411-417. 15. van Bloois, E., Pazmino, D. E. T., Winter, R. T., and Fraaije, M. W. (2010) A robust and extracellular heme-containing peroxidase from Thermobifida fusca as prototype of a bacterial peroxidase superfamily, Appl Microbiol Biotechnol 86, 1419-1430. 16. Zelena, K., Zorn, H., Nimtz, M., and Berger, R. G. (2009) Heterologous expression of the msp2 gene from Marasmius scorodonius, Arch Microbiol 191, 397-402. ! !  57 17. Kaur, A., Van, P. T., Busch, C. R., Robinson, C. K., Pan, M., Pang, W. L., Reiss, D. J., Diruggiero, J., and Baliga, N. S. Coordination of frontline defense mechanisms under severe oxidative stress, Mol Syst Biol 6, 393. 18. Kong, L., Guo, D., Zhou, S., Yu, X., Hou, G., Li, R., and Zhao, B. (2010) Cloning and expression of a toxin gene from Pseudomonas fluorescens GcM5-1A, Arch Microbiol 192, 585-593. 19. Letoffe, S., Heuck, G., Delepelaire, P., Lange, N., and Wandersman, C. (2009) Bacteria capture iron from heme by keeping tetrapyrrol skeleton intact, Proc Natl Acad Sci U S A 106, 11719-11724. 20. Sutter, M., Boehringer, D., Gutmann, S., Gunther, S., Prangishvili, D., Loessner, M. J., Stetter, K. O., Weber-Ban, E., and Ban, N. (2008) Structural basis of enzyme encapsulation into a bacterial nanocompartment, Nat Struct Mol Biol 15, 939-947. 21. Koua, D., Cerutti, L., Falquet, L., Sigrist, C. J., Theiler, G., Hulo, N., and Dunand, C. (2009) PeroxiBase: a database with new tools for peroxidase family classification, Nucleic Acids Res 37, D261-266. 22. Ogola, H. J. O., Kamiike, T., Hashimoto, N., Ashida, H., Ishikawa, T., Shibata, H., and Sawa, Y. (2009) Molecular Characterization of a Novel Peroxidase from the Cyanobacterium Anabaena sp Strain PCC 7120, Appl Environ Microbiol 75, 7509-7518. 23. Sugano, Y., Muramatsu, R., Ichiyanagi, A., Sato, T., and Shoda, M. (2007) DyP, a unique dye-decolorizing peroxidase, represents a novel heme peroxidase family: ASP171 replaces the distal histidine of classical peroxidases, J Biol Chem 282, 36652-36658. 24. Zubieta, C., Krishna, S. S., Kapoor, M., Kozbial, P., McMullan, D., Axelrod, H. L., Miller, M. D., Abdubek, P., Ambing, E., Astakhova, T., Carlton, D., Chiu, H. J., Clayton, T., Deller, M. C., Duan, L., Elsliger, M. A., Feuerhelm, J., Grzechnik, S. K., Hale, J., Hampton, E., Han, G. W., Jaroszewski, L., Jin, K. K., Klock, H. E., Knuth, M. W., Kumar, A., Marciano, D., Morse, A. T., Nigoghossian, E., Okach, L., Oommachen, S., Reyes, R., Rife, C. L., Schimmel, P., van den Bedem, H., Weekes, D., White, A., Xu, Q., Hodgson, K. O., Wooley, J., Deacon, A. M., Godzik, A., Lesley, S. A., and Wilson, I. A. (2007) Crystal structures of two novel dye-decolorizing peroxidases reveal a beta-barrel fold with a conserved heme-binding motif, Proteins 69, 223-233. 25. Sugano, Y. (2009) DyP-type peroxidases comprise a novel heme peroxidase family, Cell Mol Life Sci 66, 1387-1403. 26. Ogola, H. J., Hashimoto, N., Miyabe, S., Ashida, H., Ishikawa, T., Shibata, H., and Sawa, Y. Enhancement of hydrogen peroxide stability of a novel Anabaena sp. DyP-type peroxidase by site-directed mutagenesis of methionine residues, Appl Microbiol Biotechnol 87, 1727-1736. 27. Sturm, A., Schierhorn, A., Lindenstrauss, U., Lilie, H., and Bruser, T. (2006) YcdB from Escherichia coli reveals a novel class of TAT-dependently translocated hemoproteins, J Biol Chem 281, 13972-13978. 28. Zubieta, C., Joseph, R., Krishna, S. S., McMullan, D., Kapoor, M., Axelrod, H. L., Miller, M. D., Abdubek, P., Acosta, C., Astakhova, T., Carlton, D., Chiu, H. J., Clayton, T., Deller, M. C., Duan, L., Elias, Y., Elsliger, M. A., Feuerhelm, J., Grzechnik, S. K., Hale, J., Han, G. W., Jaroszewski, L., Jin, K. K., Klock, H. E., Knuth, M. W., Kozbial, P., Kumar, A., Marciano, D., Morse, A. T., Murphy, K. D., Nigoghossian, E., Okach, L., Oommachen, S., Reyes, R., Rife, C. L., Schimmel, P., Trout, C. V., van den Bedem, H., Weekes, D., White, A., Xu, Q. P., Hodgson, K. O., Wooley, J., Deacon, A. M., Godzik, A., Lesley, S. A., and Wilson, I. A. (2007) Identification and structural characterization of heme binding in a novel dye-decolorizing peroxidase, TyrA, Proteins 69, 234-243. ! !  58 29. Poulos, T. L., and Kraut, J. (1980) The stereochemistry of peroxidase catalysis, J Biol Chem 255, 8199-8205. 30. Boerjan, W., Ralph, J., and Baucher, M. (2003) Lignin biosynthesis, Annu Rev Plant Biol 54, 519-546. 31. Zakzeski, J., Bruijnincx, P. C., Jongerius, A. L., and Weckhuysen, B. M. The catalytic valorization of lignin for the production of renewable chemicals, Chem Rev 110, 3552- 3599. 32. Ward, O. P., and Singh, A. (2002) Bioethanol technology: developments and perspectives, Adv Appl Microbiol 51, 53-80. 33. Singh, D., and Chen, S. (2008) The white-rot fungus Phanerochaete chrysosporium: conditions for the production of lignin-degrading enzymes, Appl Microbiol Biotechnol 81, 399-417. 34. Gold, M. H., and Alic, M. (1993) Molecular biology of the lignin-degrading basidiomycete Phanerochaete chrysosporium, Microbiol Rev 57, 605-622. 35. Sena-Martins, G., Almeida-Vara, E., and Duarte, J. C. (2008) Eco-friendly new products from enzymatically modified industrial lignins, Industrial Crops and Products 27, 189- 195. 36. Sundaramoorthy, M., Kishi, K., Gold, M. H., and Poulos, T. L. (1994) The crystal structure of manganese peroxidase from Phanerochaete chrysosporium at 2.06-A resolution, J Biol Chem 269, 32759-32767. 37. Glenn, J. K., Akileswaran, L., and Gold, M. H. (1986) Mn(II) Oxidation Is the Principal Function of the Extracellular Mn-Peroxidase from Phanerochaete-Chrysosporium, Archives of Biochemistry and Biophysics 251, 688-696. 38. Magliozzo, R. S., and Marcinkeviciene, J. A. (1997) The role of Mn(II)-peroxidase activity of mycobacterial catalase-peroxidase in activation of the antibiotic isoniazid, Journal of Biological Chemistry 272, 8867-8870. 39. Anderson, C. R., Johnson, H. A., Caputo, N., Davis, R. E., Torpey, J. W., and Tebo, B. M. (2009) Mn(II) Oxidation Is Catalyzed by Heme Peroxidases in "Aurantimonas manganoxydans" Strain SI85-9A1 and Erythrobacter sp Strain SD-21, Applied and Environmental Microbiology 75, 4130-4138. 40. Ahmad, M., Taylor, C. R., Pink, D., Burton, K., Eastwood, D., Bending, G. D., and Bugg, T. D. H. (2010) Development of novel assays for lignin degradation: comparative analysis of bacterial and fungal lignin degraders, Molecular Biosystems 6, 815-821. 41. (2009) Bioenergy Research Centers: An Overview of the Science,  (Energy, U. S. D. o., Ed.), pp DOE/SC-0116. 42. Zimmermann, W. (1990) Degradation of Lignin by Bacteria, J Biotechnol 13, 119-130. 43. Ramachandra, M., Crawford, D. L., and Hertel, G. (1988) Characterization of an extracellular lignin peroxidase of the lignocellulolytic actinomycete Streptomyces viridosporus, Appl Environ Microbiol 54, 3057-3063. 44. Masai, E., Katayama, Y., and Fukuda, M. (2007) Genetic and biochemical investigations on bacterial catabolic pathways for lignin-derived aromatic compounds, Biosci Biotechnol Biochem 71, 1-15. 45. Zimmermann, W. (1990) Degradation of Lignin by Bacteria, Journal of Biotechnology 13, 119-130. 46. Yam, K. C., Okamoto, S., Roberts, J. N., and Eltis, L. D. (2010) Adventures in Rhodococcus - from steroids to explosives, Can J Microbiol, In Press. ! !  59 47. van der Geize, R., and Dijkhuizen, L. (2004) Harnessing the catabolic diversity of rhodococci for environmental and biotechnological applications, Curr Opin Microbiol 7, 255-261. 48. Seto, M., Masai, E., Ida, M., Hatta, T., Kimbara, K., Fukuda, M., and Yano, K. (1995) Multiple polychlorinated biphenyl transformation systems in the gram-positive bacterium Rhodococcus sp. strain RHA1, Appl Environ Microbiol 61, 4510-4513. 49. McLeod, M. P., Warren, R. L., Hsiao, W. W., Araki, N., Myhre, M., Fernandes, C., Miyazawa, D., Wong, W., Lillquist, A. L., Wang, D., Dosanjh, M., Hara, H., Petrescu, A., Morin, R. D., Yang, G., Stott, J. M., Schein, J. E., Shin, H., Smailus, D., Siddiqui, A. S., Marra, M. A., Jones, S. J., Holt, R., Brinkman, F. S., Miyauchi, K., Fukuda, M., Davies, J. E., Mohn, W. W., and Eltis, L. D. (2006) The complete genome of Rhodococcus sp. RHA1 provides insights into a catabolic powerhouse, Proc Natl Acad Sci U S A 103, 15582-15587. 50. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular cloning : a laboratory manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 51. Hanahan, D. (1983) Studies on transformation of Escherichia coli with plasmids, J Mol Biol 166, 557-580. 52. Simon, R., Priefer, U., and Puhler, A. (1983) A Broad Host Range Mobilization System for In vivo Genetic-Engineering: Transposon Mutagenesis in Gram-Negative Bacteria, Nature Biotechnology 1, 784-791. 53. Studier, F. W., and Moffatt, B. A. (1986) Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes, J Mol Biol 189, 113-130. 54. Seto, M., Kimbara, K., Shimura, M., Hatta, T., Fukuda, M., and Yano, K. (1995) A Novel Transformation of Polychlorinated Biphenyls by Rhodococcus sp. Strain RHA1, Appl Environ Microbiol 61, 3353-3358. 55. Schafer, A., Tauch, A., Jager, W., Kalinowski, J., Thierbach, G., and Puhler, A. (1994) Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum, Gene 145, 69-73. 56. van der Geize, R., Hessels, G. I., van Gerwen, R., van der Meijden, P., and Dijkhuizen, L. (2001) Unmarked gene deletion mutagenesis of kstD, encoding 3-ketosteroid Delta1- dehydrogenase, in Rhodococcus erythropolis SQ1 using sacB as counter-selectable marker, FEMS Microbiol Lett 205, 197-202. 57. Bertani, G. (2004) Lysogeny at mid-twentieth century: P1, P2, and other experimental systems, J Bacteriol 186, 595-600. 58. Van Duyne, G. D., Standaert, R. F., Karplus, P. A., Schreiber, S. L., and Clardy, J. (1993) Atomic structures of the human immunophilin FKBP-12 complexes with FK506 and rapamycin, J Mol Biol 229, 105-124. 59. Falk, J. E. (1964) Porphyrins and metalloporphyrins; their general, physical and coordination chemistry, and laboratory methods, Elsevier Pub. Co., Amsterdam, New York,. 60. Zhang, Y., and Skolnick, J. (2005) TM-align: a protein structure alignment algorithm based on the TM-score, Nucleic Acids Res 33, 2302-2309. 61. Gille, C., and Frommel, C. (2001) STRAP: editor for STRuctural Alignments of Proteins, Bioinformatics 17, 377-378. 62. Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A., McWilliam, H., Valentin, F., Wallace, I. M., Wilm, A., Lopez, R., Thompson, J. D., ! !  60 Gibson, T. J., and Higgins, D. G. (2007) Clustal W and Clustal X version 2.0, Bioinformatics 23, 2947-2948. 63. Bendtsen, J. D., Nielsen, H., von Heijne, G., and Brunak, S. (2004) Improved prediction of signal peptides: SignalP 3.0, J Mol Biol 340, 783-795. 64. de Geus, D. C., Thomassen, E. A., Hagedoorn, P. L., Pannu, N. S., van Duijn, E., and Abrahams, J. P. (2009) Crystal structure of chlorite dismutase, a detoxifying enzyme producing molecular oxygen, J Mol Biol 387, 192-206. 65. Felsenstein, J. (1989) PHYLIP -- Phylogeny Inference Package (Version 3.2), Cladistics 5, 164-166. 66. Childs, R. E., and Bardsley, W. G. (1975) Steady-State Kinetics of Peroxidase with 2,2'- Azino-Di-(3-Ethylbenzthiazoline-6-Sulphonic Acid) as Chromogen, Biochem J 145, 93- 103. 67. Hiner, A. N. P., Rodriguez-Lopez, J. N., Arnao, M. B., Raven, E. L., Garcia-Canovas, F., and Acosta, M. (2000) Kinetic study of the inactivation of ascorbate peroxidase by hydrogen peroxide, Biochem J 348, 321-328. 68. Vickers, T. J., and Fairlamb, A. H. (2004) Trypanothione S-transferase activity in a trypanosomatid ribosomal elongation factor 1B, J Biol Chem 279, 27246-27256. 69. Wariishi, H., Valli, K., and Gold, M. H. (1992) Manganese(II) Oxidation by Manganese Peroxidase from the Basidiomycete Phanerochaete-Chrysosporium - Kinetic Mechanism and Role of Chelators, J Biol Chem 267, 23688-23695. 70. Cornish-Bowden, A. (1995) Analysis of enzyme kinetic data, Oxford University Press, Oxford ; New York. 71. Kabsch, W. XDS, Acta Crystallogr D Biol Crystallogr 66, 125-132. 72. Otwinowski, Z., and Minor, W. (1997) Processing of X-ray diffraction data collected in oscillation mode, Macromolecular Crystallography, Pt A 276, 307-326. 73. Terwilliger, T. C., and Berendzen, J. (1999) Automated MAD and MIR structure solution, Acta Crystallogr D Biol Crystallogr 55, 849-861. 74. Terwilliger, T. C. (2000) Maximum-likelihood density modification, Acta Crystallogr D Biol Crystallogr 56, 965-972. 75. Terwilliger, T. C. (2003) Automated main-chain model building by template matching and iterative fragment extension, Acta Crystallogr D Biol Crystallogr 59, 38-44. 76. Emsley, P., and Cowtan, K. (2004) Coot: model-building tools for molecular graphics, Acta Crystallogr D Biol Crystallogr 60, 2126-2132. 77. Painter, J., and Merritt, E. A. (2006) Optimal description of a protein structure in terms of multiple groups undergoing TLS motion, Acta Crystallogr D Biol Crystallogr 62, 439- 450. 78. Murshudov, G. N., Vagin, A. A., and Dodson, E. J. (1997) Refinement of macromolecular structures by the maximum-likelihood method, Acta Crystallogr D Biol Crystallogr 53, 240-255. 79. CCP4. (1994) The CCP4 suite: programs for protein crystallography, Acta Crystallogr D Biol Crystallogr 50, 760-763. 80. Powell, H. R. (1999) The Rossmann Fourier autoindexing algorithm in MOSFLM, Acta Crystallogr D Biol Crystallogr 55, 1690-1695. 81. Vagin, A., and Teplyakov, A. Molecular replacement with MOLREP, Acta Crystallogr D Biol Crystallogr 66, 22-25. 82. Cao, J., Woodhall, M. R., Alvarez, J., Cartron, M. L., and Andrews, S. C. (2007) EfeUOB (YcdNOB) is a tripartite, acid-induced and CpxAR-regulated, low-pH Fe(II) ! !  61 transporter that is cryptic in Escherichia coli K-12 but functional in E. coli O157:H7, Mol Microbiol 65, 857-875. 83. Stearman, R., Yuan, D. S., Yamaguchi-Iwai, Y., Klausner, R. D., and Dancis, A. (1996) A permease-oxidase complex involved in high-affinity iron uptake in yeast, Science 271, 1552-1557. 84. Webb, S. M., Dick, G. J., Bargar, J. R., and Tebo, B. M. (2005) Evidence for the presence of Mn(III) intermediates in the bacterial oxidation of Mn(II), Proc Natl Acad Sci U S A 102, 5558-5563. 85. Ho, B. K., and Gruswitz, F. (2008) HOLLOW: generating accurate representations of channel and interior surfaces in molecular structures, BMC Struct Biol 8, 49. 86. Kleywegt, G. J., and Jones, T. A. (1994) Detection, delineation, measurement and display of cavities in macromolecular structures, Acta Crystallogr D Biol Crystallogr 50, 178- 185. 87. Ogola, H. J., Kamiike, T., Hashimoto, N., Ashida, H., Ishikawa, T., Shibata, H., and Sawa, Y. (2009) Molecular characterization of a novel peroxidase from the cyanobacterium Anabaena sp. strain PCC 7120, Appl Environ Microbiol 75, 7509-7518. 88. Hofrichter, M., Ullrich, R., Pecyna, M. J., Liers, C., and Lundell, T. (2010) New and classic families of secreted fungal heme peroxidases, Appl Microbiol Biotechnol 87, 871- 897. 89. Karp, P. D., Ouzounis, C. A., Moore-Kochlacs, C., Goldovsky, L., Kaipa, P., Ahren, D., Tsoka, S., Darzentas, N., Kunin, V., and Lopez-Bigas, N. (2005) Expansion of the BioCyc collection of pathway/genome databases to 160 genomes, Nucleic Acids Res 33, 6083-6089. 90. Kishi, K., Kusters-van Someren, M., Mayfield, M. B., Sun, J., Loehr, T. M., and Gold, M. H. (1996) Characterization of manganese(II) binding site mutants of manganese peroxidase, Biochemistry 35, 8986-8994. 91. Petruccioli, M., Frasconi, M., Quaratino, D., Covino, S., Favero, G., Mazzei, F., Federici, F., and D'Annibale, A. (2009) Kinetic and redox properties of MnP II, a major manganese peroxidase isoenzyme from Panus tigrinus CBS 577.79, J Biol Inorg Chem 14, 1153-1163. 92. Mester, T., and Field, J. A. (1998) Characterization of a novel manganese peroxidase- lignin peroxidase hybrid isozyme produced by Bjerkandera species strain BOS55 in the absence of manganese, J Biol Chem 273, 15412-15417. 93. Ahmad, M., Roberts, J. N., Singh, R., Hardiman, E., Eltis, L. D., and Bugg, T. D. (2011) Identification of DypB from Rhodococus jostii RHA1 as a Lignin Peroxidase, Submitted. 94. Moore, R. L., Powell, L. J., and Goodwin, D. C. (2008) The kinetic properties producing the perfunctory pH profiles of catalase-peroxidases, Biochim Biophys Acta 1784, 900- 907. 95. Rodriguez-Lopez, J. N., Gilabert, M. A., Tudela, J., Thorneley, R. N., and Garcia- Canovas, F. (2000) Reactivity of horseradish peroxidase compound II toward substrates: kinetic evidence for a two-step mechanism, Biochemistry 39, 13201-13209. 96. Rodriguez-Lopez, J. N., Smith, A. T., and Thorneley, R. N. (1996) Role of arginine 38 in horseradish peroxidase. A critical residue for substrate binding and catalysis, J Biol Chem 271, 4023-4030. 97. Peisach, J., Blumberg, W. E., Ogawa, S., Rachmilewitz, E. A., and Oltzik, R. (1971) The effects of protein conformation on the heme symmetry in high spin ferric heme proteins as studied by electron paramagnetic resonance, J Biol Chem 246, 3342-3355. ! !  62 98. Ivancich, A., Jakopitsch, C., Auer, M., Un, S., and Obinger, C. (2003) Protein-based radicals in the catalase-peroxidase of synechocystis PCC6803: a multifrequency EPR investigation of wild-type and variants on the environment of the heme active site, J Am Chem Soc 125, 14093-14102. 99. Carpena, X., Wiseman, B., Deemagarn, T., Singh, R., Switala, J., Ivancich, A., Fita, I., and Loewen, P. C. (2005) A molecular switch and electronic circuit modulate catalase activity in catalase-peroxidases, EMBO Rep 6, 1156-1162. 100. Sugano, Y., Ishii, Y., and Shoda, M. (2004) Role of H164 in a unique dye-decolorizing heme peroxidase DyP, Biochem Biophys Res Commun 322, 126-132. 101. Roberts, J. N., Singh, R., Grigg, J. C., Murphy, M. E. P., Bugg, T. D. H., and Eltis, L. D. (2011) Characterization of DyP peroxidases from Rhodococcus jostii RHA1, Submitted. 102. Lee, A. Q., Streit, B. R., Zdilla, M. J., Abu-Omar, M. M., and DuBois, J. L. (2008) Mechanism of and exquisite selectivity for O-O bond formation by the heme-dependent chlorite dismutase, Proc Natl Acad Sci U S A 105, 15654-15659. 103. Ivancich, A., Dorlet, P., Goodin, D. B., and Un, S. (2001) Multifrequency high-field EPR study of the tryptophanyl and tyrosyl radical intermediates in wild-type and the W191G mutant of cytochrome c peroxidase, J Am Chem Soc 123, 5050-5058. 104. Singh, R., Switala, J., Loewen, P. C., and Ivancich, A. (2007) Two [Fe(IV)=O Trp*] intermediates in M. tuberculosis catalase-peroxidase discriminated by multifrequency (9- 285 GHz) EPR spectroscopy: reactivity toward isoniazid, J Am Chem Soc 129, 15954- 15963. 105. Palcic, M. M., Rutter, R., Araiso, T., Hager, L. P., and Dunford, H. B. (1980) Spectrum of chloroperoxidase compound I, Biochem Biophys Res Commun 94, 1123-1127. 106. Sundaramoorthy, M., Terner, J., and Poulos, T. L. (1995) The crystal structure of chloroperoxidase: a heme peroxidase--cytochrome P450 functional hybrid, Structure 3, 1367-1377. 107. Rosenkrands, I., Rasmussen, P. B., Carnio, M., Jacobsen, S., Theisen, M., and Andersen, P. (1998) Identification and characterization of a 29-kilodalton protein from Mycobacterium tuberculosis culture filtrate recognized by mouse memory effector cells, Infect Immun 66, 2728-2735. 108. Valdes-Stauber, N., and Scherer, S. (1994) Isolation and characterization of Linocin M18, a bacteriocin produced by Brevibacterium linens, Appl Environ Microbiol 60, 3809-3814.!  ! !  63 Bsu168 DypARHA1 TfuDypYX MvaPYR-1 PdePD1222 EfeBK-12 RpABisB18 CteKF-1 YfeXK-12 DdiAX4 DypBRHA1 MtbDypH37Rv Cco13826 BtDyPVPI-5482 AcspADP1 TyrA NpuPCC73102 Lbi2S238N-H82 PplMad-698-R AfuAf293 PchWisconsin54-1255 BfuB05.10 Lbi1S238N-H82 Ppa PgrCRL MsP1 DyPDec1 TalTAP Pos AnaPXPCC7120 Amsp2 ChuATCC33406 Amsp1 PsspPRwf-1 OanATCC49188 MxaDK1622 CviATCC12472 CyspPCC7424 PpaSIR-1 Bsu168 DypARHA1 TfuDypYX MvaPYR-1 PdePD1222 EfeBK-12 RpABisB18 CteKF-1 YfeXK-12 DdiAX4 DypBRHA1 MtbDypH37Rv Cco13826 BtDyPVPI-5482 AcspADP1 TyrA NpuPCC73102 Lbi2S238N-H82 PplMad-698-R AfuAf293 PchWisconsin54-1255 BfuB05.10 Lbi1S238N-H82 Ppa PgrCRL MsP1 DyPDec1 TalTAP Pos AnaPXPCC7120 Amsp2 ChuATCC33406 Amsp1 PsspPRwf-1 OanATCC49188 MxaDK1622 CviATCC12472 CyspPCC7424 PpaSIR-1 Bsu168 DypARHA1 TfuDypYX MvaPYR-1 PdePD1222 EfeBK-12 RpABisB18 CteKF-1 YfeXK-12 DdiAX4 DypBRHA1 MtbDypH37Rv Cco13826 BtDyPVPI-5482 AcspADP1 TyrA NpuPCC73102 Lbi2S238N-H82 PplMad-698-R AfuAf293 PchWisconsin54-1255 BfuB05.10 Lbi1S238N-H82 Ppa PgrCRL MsP1 DyPDec1 TalTAP Pos AnaPXPCC7120 Amsp2 ChuATCC33406 Amsp1 PsspPRwf-1 OanATCC49188 MxaDK1622 CviATCC12472 CyspPCC7424 PpaSIR-1 Bsu168 DypARHA1 TfuDypYX MvaPYR-1 PdePD1222 EfeBK-12 RpABisB18 CteKF-1 YfeXK-12 DdiAX4 DypBRHA1 MtbDypH37Rv Cco13826 BtDyPVPI-5482 AcspADP1 TyrA NpuPCC73102 Lbi2S238N-H82 PplMad-698-R AfuAf293 PchWisconsin54-1255 BfuB05.10 Lbi1S238N-H82 Ppa PgrCRL MsP1 DyPDec1 TalTAP Pos AnaPXPCC7120 Amsp2 ChuATCC33406 Amsp1 PsspPRwf-1 OanATCC49188 MxaDK1622 CviATCC12472 CyspPCC7424 PpaSIR-1 10 20 30 40 50 60 GKHQA I T T QT YVY - F AAL DVT T L F R NWT S L T QML T T VT F GF GP GF F DR GL KS K - - - - KHL P G GE HQA I VT QDRMH - F VAF DVT AL L KKWT EMAARMT T L T I G F GP S L F F AKKP AA - - - - - - L P G MAAQR DAT P QP G I HV I AL DL AT AR DS AAAAL R S WTMVT VG I GGS L L AE R R P D - - - - - - A L P G GR HQA I AT QAHAL - F VAL DMAS P R DT L I AML R LWS T VT VG I G P HVF L AR R P DS - - - - - - L P G GR HQA I L T R P AS G I F AAF DVVDF E RML R L L T E R AAT I T L GL GAS L F L AL KP AR - - - - QR F P - GE HQA I - L QQAAMML VAF DVL DL E R L F R L L T QR F AT I T L S VGHS L F L AQMP KKL QKMT R F P G GP HQA I T T QP YAGL VAAF DVL E L R QL F I T L T T R AE TMT VAVGAS L F L AL KP KQ - - - - A E F P - T KAQA I L AP E QGR - YVF F T L ADL QNS L KKL QT S VDL QE L DKKL P LML KP QF E A - - - - - - - - Y S QVQS I L P C R AA I - W I E ANVKAL R AAS KT F ADKL AGAVVAF GNNTWGVAE E L K - - - - - - F P F - MAQS VL P C L YG - I F L E GNL KNDQE GL KKF KDN I KGGA I C F S S D I WK I K P KE L - - - - - - VNR L AP QAL T P AAS - - L F L VL VAGDDR AT VC DV I S G I D S C VVGVGAQF WS S P AHL H - - - - - F S GG VS P QP L AP P AA - - I F L VAT I GDGE AT VHDAL S K I S S VVVS I G S DAWGP P T E L H - - - - - F T GG VNS QE T QANNT - - V F QTW I L KAC KE GF AKL C AL VVNC VL GVGHDAW I S E L P KE - - - - N F KGG H I P QDVAGQGE NV I F I VYNL T DKVKDVC ANF S AM I S C TMGF GADAWP DGKP KE L S T F S E KGG VT AQS I L P S DHAR - F I VL R L GGL KKQL QAL F S T R DKT GVAF GAALWQS E GF KT - - - - - - L E A P R E QL VC AGNL HS VYLMF NANQL R P C I ANVAQY I YNGF VA I GANYWP E S R P EML KP F P AQE Y NN I QG I L GNKDYQT L L F L E I E A F KEWL KT Q I K F I AWVN I A F S F QGL DANF T DE - - - - AR L NV T NVQGVYL P KVR I A F I F F I I DKF R QAL QT YHP T S S MT Q I A F S QL GL DAS ML HD - - - - - - L G I KNVQG I YL P KDHE NF I F F A I R QF R R DL ANYT P T T S QT Q I A F S R S GL QT QT KDT F DGS NE L G I DN I QG I WP P KL HE F F L F F N I T R F R R DL KR L I P L VT GVNL AF S AKGL DDDNL KS F L GMDL VA I E N I QG I WP S KKHE L F VF F R I T KF KDHL AVL VP S L T A I NVAF S AKGL E P T DDVF - - GQDL L E L S N I QG I WP P KR I QKF MF F K I NDF KQR L R S F VKDGGGVN I A F T S T GL F T NE GAVF GGMDL GW I DN I QG I L S P KKT QS Y I F F Q I VKF R ADL AR F VP F VKGVN I A F S HL GF I D S S L GGF I GQDS L GL S N I QGVVVHKR VQAF VF I T L KDF R KL L KS K I L P Q I E L N I S F S AAGL I P DQL P GF R NQDAL G I KNVQGV I I QKR QE AF WF GT L R GF R KNL KT HL L P L I HVNL GF AYNGL L KE E I P T F S GQDAL G I T D I QG I L I KKNKE L F F F F S I T T F KAKL GS D I L E L I AVNVAF S S T GL I T DDL KDF E GMNAL S V NN I QG I L VKKQKE R F VF F QVNS F KT AL KT YVP E R I F VNL GF S NT GL I T DDL GDF P GQDAL G I E N I QA I L VKKQNE KF VF F H I NT F KS VL KT YAP AN I VVNVAF S QAGL VT DNL GDF T GQDAL G I E E I QG I M I R KP KE I F F F YS I QKF KS VL AKL I Y P H I ML NVAWT S QGL VL DDL GDF AGQDAGDT NDL QG I L KGR DHS VHL F L QF KVVKQW I QS F AQT Y I F ANF F L S R HGYE P Q I P GD - - MKE I L G I DE L QP I L KVR DR L - VL F L GF GE AR T F L NGL S GLMKYL GVGL T AHGYT AADP S F - - - - AAL A I HDVQG I I KDKL KAT F L L L E I T KT KQWL AS QL P MVT VAAL NVP AE AL E F E GMVT - - - - RML E I S DT QGL VR GGL R HT F L L F AVT AAR AT L R NL AAQVS MR AL GVP AE VVP F E GMT T - - - - R L S GV E E I Q S I L R P AP YYT L VAL KVNT GR QL L R C VL GGVS L KAL GVP QDS L NF AGME S - - - - KKVG I DD I QA I L R P E P YV I HAML HVDGGR DL I AR L AE Y I P L KAL GL P E DS L AF QGMAG - - - - T Q F G I DD I Q S VL R P S P YVT Y I L L R I DAGR E LMGR L C S VVAL E AL GVP R NS L E F QGMAA - - - - - - L G S DDVQG I L R R VE R A - H F I L R I DGAAGL I L KL VDGQL L S R L GL S DAQL S F KGAT D - - - - AGC DV AD I QG I VR NMNVV - Y F VL C VNKAKE F I GDL VNGE S L KAL DL R DDVNR NE AF R K - - I A P GT GH AQVQS VL R R QGE AQYL F L QF AAC R AL I DAL YP L VT VL N I GL S YAC L GGAR AL DF KGMR AL GL 70 80 90 100 110 120 D I C I QVC ADDE QVAF HAL R NL L NQAV - T C E VR F VNKGF L P R NL F GF KDGT GNQVW I QDWMT G D I A I QAC ANDP QVAVHA I R NL AR VAF - T AS VRWS QL GF GP R NL F GF KDGT NN I VWVAAWMGG DF ML QVGAE DP MVL T AAVE E L VAAAADAT AVRWS L R GF R P R NLMGQ I DGT ANP I T AR AWMDG D I L L Q I C ADDR VAVAHAAR VL L KNVR T L T VQRWR QDGF RMR NLMGQVDGT ANP VWDDP WF AG DL S L QF C ANL P DT N I HAL R D I VKNL S E F L VL RWM I E GS VAR NF L GF R DGS ANP VWT HEWAHG DVL L Q I C ANT QDT V I HAL R D I I KHT P DL L S VRWKR E GF I P I N L L GF KDGT ANP VWVT AWT I G DLM I QF C AE T P E E V I HAL R D I VKAT P DL L A I KWKQE GF AGR NL L GF KDGT ANAVWVQAWS VG AL C LWL R GDQR GE L I AL T AKL T NL L A - V F KL DH I VDAF VGR DL T GYE DGT E NP AE L G - - L DG DVL I H I L S L R HDVNF S VAQAAME AF GDC I E VKE E I HGF R E R DL S GF VDGT E NP AV I K - VDAG D I L I H I I S DRMDT C F KL AQDTMR NF GDQL D I KQE I HGF R E R DL T DF I DGT E NP VAAG - - N E F DL L F H I KAAR KDL C F E L GR Q I V S AL GS AAT VVDE VHGF R S R DL L GF VDGT E NP AL I G P DF R G DL L F H I R AE TMDVC F E L AGR I L KS MGDAVT VVDE VHGF R NR DL L GF VDGT E NP T T I GR NF AG D I H I H I R AL NAADC F DMAQN I KE VL F KF AE L T DE T QGF KGR A I I G F VDGT E NP AKVGAKF KG DL L F H I R AKQMGL C F E F AS I L DE KL KGAVVS VDE T HGF R GKA I I G F VDGT E NP AV I GADF AG DVL I H I A S AR AD I C F AL S QAF F E G I QDQVNVL DE R VC F R GR D I T GF I DGT E NP AL L GAVF R D DL F VHL R C DR YD I L HL VANE I S QMF E DL VE L VE E E R GF R S R DL T GF VDGT E NP AL VGP E F KG DVVL I VAS DL L E E VS R I L KS I V I F T DS GAK I T F I E E GANGHE HF GNL DG I S Q P F VF GKWADD HGV I MVC AKS QDKVDS GVQT I KDT F GAS WE I KQT L S GNAGKE HF GYQDGVS QP L I L GDWAR D HGV I I VAAS DADE C QT AT QNVKDAF KQS I YNVS EMDGNT GHE HF GYKDGVS QP I I C GDWT KD DGV I L VT GR S E QT AR AKL R E VKY I F I GYF GF T S S I R E L F S KE HF GYR DL I S Q P I I T NDWAT D DGVF T I T GDT E KT L VNT VR S VKKAF G I P S T GGHT I DT P S DKE HF GWVDG I S QP I L VGAWAKE DGVF L VT AE E E NHL NS MGNE I KE HF L ADT YL I S NDP A I E GKE HF GF E DG I S Q P I F AGDWAE D HGV I L I S GE S HE T L HKKKL E I E C I F GVR T I Q P S I F E VT S GHE HF GF L DG I S N P I VT GAWAVD DVL LM I T AP E DQL L NS KL NE L E HHL R P L T E F S F VKR GNVGHE HF GYL DG I S Q P I L VGS WQKD DF VVL I T AP DS NL L NQKL HQVR RMF NGF L S HS F L R QGNVANE HF GF P DA I S MA I L L GAWL KD HGVF L L AS DT I DNVNT E L AN I QT I L NGS I T E I HR L QGE AGHE HF GF MDG I S NP ML L GP WAKD HGVF L I G S DQDDF L DQF T DD I S S T F GS S I T QVQAL S GS AGHE HF GF L DG I S Q P I L T GS WAL D DGVF L I I S DQDS I I T QYQDDL QAKL GDAWT VVYDL S GAAGHE HF GYL DG I S N P I L VGAWAL D DGAF L I AAR DWE P I DT L L NQMKNWL GDA I VE T HS NR GAVGKE HF GWL DGF I Q P L L T KAWT KW HAL VL I ADDD I VDL L Q I VNQ I T QKL R Q I AE I VHR E DGF I I I E H F GF VDGVS QP I L VE T KDS Y DAVL L L GDAT AGP VR T L R R QVE AL R P AS VT VVGE E S GL GG I E HF GYVDGR S QP VL VP P T VHF HL L LML YAT DDS T L QHF YT E QKNT L DAGL K I AYQL E T S KE KE HF GF R DG I AQP F L F GDL GR N HL L VL VYAAT AT AL R R R VAQ I KR E S E - GL S L T VAL P T DP - T E P F GF R DGL S QP F VL GDL GR D H I C AA I I ADNE DKWQT K I QQL R QD I S P E E GD I E I L I DHQAKNVF GF R DG I S N P F VMGVL GKN AL T I YAADK - - P AL DVAVE KAMAE F D - A S T GVT L VGT HE AE NP F GF R DS I S Q P F VL GP L GR N DVHVVL T AL T QAQL E T AL E R AS KAVR GG I E A I WR QDC HAGKE P F GF KDG I S H P F VL GVL GR N HAL L S LWVDGE AQL E P AS AT L R R AF AS GVT E L S AQDAVANR VHF GYR DS I AQP F L L GE L S L N I L L F L L AE D - HDT L S QKS VE L R DKF E QE I QE L GYF DGAKDM I HF GYR DG I AQP F VL I I L GE N HAV I S L AS GDR GS L DT L R GE VDQR L AAGVAL VF E E R GQHGKE HF GYT DG I AQP F VL GQL F KN 130 140 150 160 170 180 GT YMAF R K I KMF L E VWDR - S L KDQE DT F GR R KS S GAP F Q I P S NS HVS L AKS T - Q I L R R AF S Y GAYL VAR R I RML I E QWDR - VL GE QE R V I GR S KGT GAP L V I DVDAHVR L AS AQ I Q I L R R GYNF GS YL VVR R I RML L T EWR K - DVAAR E R V I GR R L DT GAP L L I P E NAHVR L AS P E ARMF R R GYS Y GT VL V I R R I R S E L DTWDE - DR T S KE L T L GR R L DT GAP L V I P P NS HVAL AR R QE R F L R R GYNY GS YQAVR V I R NF VE RWDR - P L AE QE R I F GR T KMT GAP L T T P P DS H I R L ANP R NLML R R P F NY GS YQAVR L I Q F R VE F WDR T P L KE QQT I F GR DKQT GAP L V I AL DS H I R L AN - - S LML R R GYS Y GS YQVVR L VR NF VE RWDR - P L S E QE A I F GR AR NS GAP L K I P L T S H I R L ANP R AR L I R R GF NY C S YWAL QQWE HDYS AF GC - S T T E QDHAVGR R R S DNE E L - - P E S AHVKR T AQE AF VVR R S MP W GS YVF VQRWE HNL KQL NR - S VHDQEMM I GR T KE ANE E I E R P E T S HL T R VDL KL K I VR QS L P Y GS YVF T QR YVHNL KKWYP - P L S VQQDT VGR T KKDS I E I KR P I T S HVS R T DL S L K I VR QS L P Y GS YV I VQKYL HDMS AWNT - S T E E QE R V I GR T KL E NVE L AQP S NS HVT L NT I VHD I L R DNMAF S C YVHVQKYVHDMAS WE S - S VT E QE R V I GR T KL DD I E L AKP ANS HVAL NV I T R K I VR HNMP F GS YVF VQKYF HKMKEWNA - S VS E QE KV I GR S KE YD I EMVKP T NS HS S AANVGKKVVR GNMP F GS YVF VQKY I HDMVAWNAL P VE QQE KV I GR HKF NDVE L E KP GNAHNAVT N I GL K I VR ANMP F GS F VF AQR YAHDL E KWKK - KVDAQE QVMGR T KL E S I E L VKP DNAHVAR T VVE L E I L R HS L P Y GS Y I HVQKYAHNL S KWHR L P L KKQE D I I GR T KQDN I E YDKP L T S H I KR VNL K I E I L R QS MP Y GS YL VF R R L R QDVF KF HKL P R KVS AKL I GRWP S GAP T VR C P F I AHT R KT YP R HR L L R R G I P Y GS F MVF R KL E QDVKGWNNVANF VGAAL VGRWKS GAP I QYC P F NS HT R KT AP R S L I AR T G I P Y GT F MVF R KL E QDV I G F S NL AE L F GAR L VGRWKS GAP L AVC P F T AHT R KT AP RML V I R AGL P Y GS F L VF R KL KQL VP E F NR L T DQL S AR LMGRWKS GAP T F KC P F AAH I R KC R P R S S MMR R G I P Y GS F MVF R T YE QR T P E F VAC L R KF S S R I VGRWP NGAP L E R C P YAAH I R KC GP R HLMMR R G I P Y GS F L VF R DL QQL VP E F DKL KE KL AAYLMGRWKNGT P VDKC P F AAH I R KMR P R AV I I R R G I S Y GS F L VF R YL F QQVP E F NDL S DL L GAR L VGRWKS GAP I DR C P F AAHVR R T NP R NR I L R R GVQF GS F I V F R E L QQF VP E F DS VP GL I GAR I VGRWKS GAP VVKC P YAAH I R KS NP R HLM I R AG I P Y GS F MAF R E L R QL VP E F HHC GDF I GAR I VGRWKS GAP L T R C P YAAH I R KS NP R HLM I R NS I P Y GS F L VF R QMQQR AP E F NKL ADL L GAR I VGRWKS DAP I DR C P F S AH I R KANP R QH I I R AG I P Y GS F MAF R HF QQKVP E F NAT AE F L GARMF GRWKS GAP I DR C P F GAHVR KT NP R F HAMR S S I P Y GS F L AF R KL KQL VP E F HKT AL L L GS RMF GRWNS GAP I DR C P F T AH I R KT NP R F HA I R AGT P Y GS F MAYR QL QE L VP E F DDL ADL L GARMF GRWKS GT P L DYC P F S AH I R K I R P R NQM I R AS I P Y GS YL VYR KL E QNVKAF R E QE NL AGAL I VGR F ADGT P VT KC P F HS HT R KT NP R HR I T R R AVS Y GS YF VF R KL E QNVR L F KE E R E R AGAML VGR F E DGT P L T KC P F HAH I R KT NP R HLMAR R GQT Y GS ML VF R QL E QNVKAF WAAP E Y I A S KML GRWP NGS P L T KC P I GAH I R R ANP R F R I I R R GR S Y GS YL VF R QL R QDVDGF WAL AR R L AAKMVGRWP S GAP L VS C P L GAHVR R ANP R HR L L R R GR S Y GS F MVL R KYQC NVADF NR C ADKL AAKMF GRWR S GAP VT GC P F GS HT R RMNP R HR I I R R S VS F GS F VVL R KYDS R VGAF NE L QHAL AAKMF GRWR S GAP L P VC P HS S HMR RMNP R HR I I R R S S T F GT YVAF R KL HQR VAAF R QL E E F L AAKMMGRWR S GAP L AKT P P AS HVR R ANP R HRM I R R GT AY S S F AAF R I L E QDVP GF E R L AEML AAKVC GRWR NGNP L T KC P I G S H I R R S NP R HR I VR R AMP Y GS F AAF R VL E QNVVAF E KL P E T L AAKMC GRWR NGVP L DKC P I G S H I R R NNP R R R L I R R G I P Y GS F MVF R KL AQHVAR F HE T AE F VGS KM I GRWP S GAP L VAC P F GAH I R R NNP R HR I I R R AT P Y 190 200 210 220 230 T DAGL L F I S F QKNP DQF I P ML KL S A - DAL E YT QT I G S AL YAC P GG I Q T DAGL F F I AYC R NP QQF VP MQL L S R - DAME Y I QHVGS AL F AC P P GWQ DDAGL L F MAWQGDP AGF I P VQR L ADGDAL R Y I R HE GS AL F AVP AAL Q DDAGL I F AAYQR DP AQF VP VQR L AE - DAMP W I T T I G S AVF AML P GL Q S DQGL L F I AYQADL E GF I AVQNQL NGE P L E Y I K P VGGGYF F AL P GL A S DMGL L F VC YQHDL E GF L T VQKR L NGE AL E YVKP I GGGYF F AL P GF S S DMGL L F VS F QS DL AGF I AT QNR L NGE P L E Y I K P F GGGYYF VL P GL Q WR S GLMF S AF GC S F DF E AQMR R L GMS DGL - F S T P L T GC YF WC P P VT L GT HGL YF C AYC AR L H I E QQL L S F GDR DAM - F T KP VT GGYYF AP S L L A GE KGLMF I AYAC S L H I E KQL QS F GQHDL L KYT T P VT GS F YF AP S KL E GE YGT YF I GYAKDP AT E LML R R F L GYDR VDF S T AAT GT L F F VP S R L D GE YGT YF I GYS R T P T T E QML R NF L GT DR VDF S T AVT GGL F F S P T I P P T KT GT YF I AYAS T F S VE LML KKF I G S DR L DF S T P VT GAL YF AP T L L D AE YGT YF I GYAS T F S T T R RML E NMF T DR L DF S T A I T GT L F F VP S YL E GDQGL F F I AYT KDL G I DQML E R F GT HDR L HF VT P L DGAYYF AP S E L G GE QGLMF I S T C R T P DHF E KML HS MVHDHL HF T S AL T GS S F F AP S L L Q GDR GL HF L AYQT S I VQF E F VT KWS NHDP I DWV I P T GGGYF F AP S I L N GQR GL L F VC YQS AL DGF VR QT VF S S QDP I F F VT S HGGE YF F VP S I K P GP R GL L F L C YQS S T E GF WQQT R AVNQDP I Y F VT S R GGE YF F VP S VAG GE R GMF F L C YQS N I AGF R R VQEWC NADP I S C V I P KGGE YF F S P S I L N GDR GL L F VS YQS D I T GF R F VQKWAN I DA I RWV I P R GGE YF F AP S I I E GE R GL L F VC YQS D I R GF NF L T TWAS I DA I RWVVQR GGE YF F S P G I T A GGR GL L F AC YQT S I T GF QF L QKWANL DP L DF I I P R GGE YF F S P S L AP GE R GL L F VS YQS S I E G F QR VQQWC NF DL I D F VL P R GGE YL F VP S I I N GNR GL L F VAYQS D I VGF QF VQKWC NL DL L GNADP R NT VT AF QP F VL T GE R GL AF VAYQS N I QGF VF L QKWVDVDP L DF VVS R GGE YF F S P S L I T GDR GL L F VE YQS I I GGF R F QQ I WAN I E P I L F V I P KGGE YF F L P S I L A GDR GL AF VE YQS N I S G F R F QQVWANL DP VDF I V S NGGE YF F AP S I I E GE R GVAF VT YQS DL GGF HF QQAWANF DP I S F VVS KGGDYF F S P S M I H GGS GL L F L C F QS N I E QF NF MQS WANP DP L LW I NMKGGE YF F AP S I L T GDVGL L F MAF NS NL GQF E F T QQWANL DP VQAVTMKGGE YF F MP S L L S GE R GL YF L C F NS N I GQYE L I QQW I NP DP MR F VNVKGGGYF F MP GL L Y T E R GL HF L C L S ANL AQYE F VQHW I NADP L S F VQVR GGAYF F L P GVL Y GE R GL YF I G I NAQAMT L E F L QS W I NR DP L QF NT L QGGE YL F I P S I LW GE R GL F F I F I S AR AYT VE F L QQW I NP DP I T F NR L R GGE YMF MP S L S G GE R GLMF AF I GAHL GQF E F VQS WVNKDP L R F VVT R GGE YC F MP GL L D GKR GL I GYF I NAS L S QF E F VT S WAL E DVF R L I HT R GGAYC F F P S I L Y GE R GL L GL F I C AS L GQF E F VMKWVNKDP L R F I I T R GGAYC F L P S I L Y GDR G I L F VV I NAD I S Q F E F VQQWVDR DP L T F VT T KGGAYF L L P S I K I A B D C A B D C A B D C A B D C APPENDIX I: MULTIPLE SEQUENCE ALIGNMENT                                               ! !  64 Bsu168 DypARHA1 TfuDypYX MvaPYR-1 PdePD1222 EfeBK-12 RpABisB18 CteKF-1 YfeXK-12 DdiAX4 DypBRHA1 MtbDypH37Rv Cco13826 BtDyPVPI-5482 AcspADP1 TyrA NpuPCC73102 Lbi2S238N-H82 PplMad-698-R AfuAf293 PchWisconsin54-1255 BfuB05.10 Lbi1S238N-H82 Ppa PgrCRL MsP1 DyPDec1 TalTAP Pos AnaPXPCC7120 Amsp2 ChuATCC33406 Amsp1 PsspPRwf-1 OanATCC49188 MxaDK1622 CviATCC12472 CyspPCC7424 PpaSIR-1 Bsu168 DypARHA1 TfuDypYX MvaPYR-1 PdePD1222 EfeBK-12 RpABisB18 CteKF-1 YfeXK-12 DdiAX4 DypBRHA1 MtbDypH37Rv Cco13826 BtDyPVPI-5482 AcspADP1 TyrA NpuPCC73102 Lbi2S238N-H82 PplMad-698-R AfuAf293 PchWisconsin54-1255 BfuB05.10 Lbi1S238N-H82 Ppa PgrCRL MsP1 DyPDec1 TalTAP Pos AnaPXPCC7120 Amsp2 ChuATCC33406 Amsp1 PsspPRwf-1 OanATCC49188 MxaDK1622 CviATCC12472 CyspPCC7424 PpaSIR-1 Bsu168 DypARHA1 TfuDypYX MvaPYR-1 PdePD1222 EfeBK-12 RpABisB18 CteKF-1 YfeXK-12 DdiAX4 DypBRHA1 MtbDypH37Rv Cco13826 BtDyPVPI-5482 AcspADP1 TyrA NpuPCC73102 Lbi2S238N-H82 PplMad-698-R AfuAf293 PchWisconsin54-1255 BfuB05.10 Lbi1S238N-H82 Ppa PgrCRL MsP1 DyPDec1 TalTAP Pos AnaPXPCC7120 Amsp2 ChuATCC33406 Amsp1 PsspPRwf-1 OanATCC49188 MxaDK1622 CviATCC12472 CyspPCC7424 PpaSIR-1 Bsu168 DypARHA1 TfuDypYX MvaPYR-1 PdePD1222 EfeBK-12 RpABisB18 CteKF-1 YfeXK-12 DdiAX4 DypBRHA1 MtbDypH37Rv Cco13826 BtDyPVPI-5482 AcspADP1 TyrA NpuPCC73102 Lbi2S238N-H82 PplMad-698-R AfuAf293 PchWisconsin54-1255 BfuB05.10 Lbi1S238N-H82 Ppa PgrCRL MsP1 DyPDec1 TalTAP Pos AnaPXPCC7120 Amsp2 ChuATCC33406 Amsp1 PsspPRwf-1 OanATCC49188 MxaDK1622 CviATCC12472 CyspPCC7424 PpaSIR-1 10 20 30 40 50 60 GKHQA I T T QT YVY - F AAL DVT T L F R NWT S L T QML T T VT F GF GP GF F DR GL KS K - - - - KHL P G GE HQA I VT QDRMH - F VAF DVT AL L KKWT EMAARMT T L T I G F GP S L F F AKKP AA - - - - - - L P G MAAQR DAT P QP G I HV I AL DL AT AR DS AAAAL R S WTMVT VG I GGS L L AE R R P D - - - - - - A L P G GR HQA I AT QAHAL - F VAL DMAS P R DT L I AML R LWS T VT VG I G P HVF L AR R P DS - - - - - - L P G GR HQA I L T R P AS G I F AAF DVVDF E RML R L L T E R AAT I T L GL GAS L F L AL KP AR - - - - QR F P - GE HQA I - L QQAAMML VAF DVL DL E R L F R L L T QR F AT I T L S VGHS L F L AQMP KKL QKMT R F P G GP HQA I T T QP YAGL VAAF DVL E L R QL F I T L T T R AE TMT VAVGAS L F L AL KP KQ - - - - A E F P - T KAQA I L AP E QGR - YVF F T L ADL QNS L KKL QT S VDL QE L DKKL P LML KP QF E A - - - - - - - - Y S QVQS I L P C R AA I - W I E ANVKAL R AAS KT F ADKL AGAVVAF GNNTWGVAE E L K - - - - - - F P F - MAQS VL P C L YG - I F L E GNL KNDQE GL KKF KDN I KGGA I C F S S D I WK I K P KE L - - - - - - VNR L AP QAL T P AAS - - L F L VL VAGDDR AT VC DV I S G I D S C VVGVGAQF WS S P AHL H - - - - - F S GG VS P QP L AP P AA - - I F L VAT I GDGE AT VHDAL S K I S S VVVS I G S DAWGP P T E L H - - - - - F T GG VNS QE T QANNT - - V F QTW I L KAC KE GF AKL C AL VVNC VL GVGHDAW I S E L P KE - - - - N F KGG H I P QDVAGQGE NV I F I VYNL T DKVKDVC ANF S AM I S C TMGF GADAWP DGKP KE L S T F S E KGG VT AQS I L P S DHAR - F I VL R L GGL KKQL QAL F S T R DKT GVAF GAALWQS E GF KT - - - - - - L E A P R E QL VC AGNL HS VYLMF NANQL R P C I ANVAQY I YNGF VA I GANYWP E S R P EML KP F P AQE Y NN I QG I L GNKDYQT L L F L E I E A F KEWL KT Q I K F I AWVN I A F S F QGL DANF T DE - - - - AR L NV T NVQGVYL P KVR I A F I F F I I DKF R QAL QT YHP T S S MT Q I A F S QL GL DAS ML HD - - - - - - L G I KNVQG I YL P KDHE NF I F F A I R QF R R DL ANYT P T T S QT Q I A F S R S GL QT QT KDT F DGS NE L G I DN I QG I WP P KL HE F F L F F N I T R F R R DL KR L I P L VT GVNL AF S AKGL DDDNL KS F L GMDL VA I E N I QG I WP S KKHE L F VF F R I T KF KDHL AVL VP S L T A I NVAF S AKGL E P T DDVF - - GQDL L E L S N I QG I WP P KR I QKF MF F K I NDF KQR L R S F VKDGGGVN I A F T S T GL F T NE GAVF GGMDL GW I DN I QG I L S P KKT QS Y I F F Q I VKF R ADL AR F VP F VKGVN I A F S HL GF I D S S L GGF I GQDS L GL S N I QGVVVHKR VQAF VF I T L KDF R KL L KS K I L P Q I E L N I S F S AAGL I P DQL P GF R NQDAL G I KNVQGV I I QKR QE AF WF GT L R GF R KNL KT HL L P L I HVNL GF AYNGL L KE E I P T F S GQDAL G I T D I QG I L I KKNKE L F F F F S I T T F KAKL GS D I L E L I AVNVAF S S T GL I T DDL KDF E GMNAL S V NN I QG I L VKKQKE R F VF F QVNS F KT AL KT YVP E R I F VNL GF S NT GL I T DDL GDF P GQDAL G I E N I QA I L VKKQNE KF VF F H I NT F KS VL KT YAP AN I VVNVAF S QAGL VT DNL GDF T GQDAL G I E E I QG I M I R KP KE I F F F YS I QKF KS VL AKL I Y P H I ML NVAWT S QGL VL DDL GDF AGQDAGDT NDL QG I L KGR DHS VHL F L QF KVVKQW I QS F AQT Y I F ANF F L S R HGYE P Q I P GD - - MKE I L G I DE L QP I L KVR DR L - VL F L GF GE AR T F L NGL S GLMKYL GVGL T AHGYT AADP S F - - - - AAL A I HDVQG I I KDKL KAT F L L L E I T KT KQWL AS QL P MVT VAAL NVP AE AL E F E GMVT - - - - RML E I S DT QGL VR GGL R HT F L L F AVT AAR AT L R NL AAQVS MR AL GVP AE VVP F E GMT T - - - - R L S GV E E I Q S I L R P AP YYT L VAL KVNT GR QL L R C VL GGVS L KAL GVP QDS L NF AGME S - - - - KKVG I DD I QA I L R P E P YV I HAML HVDGGR DL I AR L AE Y I P L KAL GL P E DS L AF QGMAG - - - - T Q F G I DD I Q S VL R P S P YVT Y I L L R I DAGR E LMGR L C S VVAL E AL GVP R NS L E F QGMAA - - - - - - L G S DDVQG I L R R VE R A - H F I L R I DGAAGL I L KL VDGQL L S R L GL S DAQL S F KGAT D - - - - AGC DV AD I QG I VR NMNVV - Y F VL C VNKAKE F I GDL VNGE S L KAL DL R DDVNR NE AF R K - - I A P GT GH AQVQS VL R R QGE AQYL F L QF AAC R AL I DAL YP L VT VL N I GL S YAC L GGAR AL DF KGMR AL GL 70 80 90 100 110 120 D I C I QVC ADDE QVAF HAL R NL L NQAV - T C E VR F VNKGF L P R NL F GF KDGT GNQVW I QDWMT G D I A I QAC ANDP QVAVHA I R NL AR VAF - T AS VRWS QL GF GP R NL F GF KDGT NN I VWVAAWMGG DF ML QVGAE DP MVL T AAVE E L VAAAADAT AVRWS L R GF R P R NLMGQ I DGT ANP I T AR AWMDG D I L L Q I C ADDR VAVAHAAR VL L KNVR T L T VQRWR QDGF RMR NLMGQVDGT ANP VWDDP WF AG DL S L QF C ANL P DT N I HAL R D I VKNL S E F L VL RWM I E GS VAR NF L GF R DGS ANP VWT HEWAHG DVL L Q I C ANT QDT V I HAL R D I I KHT P DL L S VRWKR E GF I P I N L L GF KDGT ANP VWVT AWT I G DLM I QF C AE T P E E V I HAL R D I VKAT P DL L A I KWKQE GF AGR NL L GF KDGT ANAVWVQAWS VG AL C LWL R GDQR GE L I AL T AKL T NL L A - V F KL DH I VDAF VGR DL T GYE DGT E NP AE L G - - L DG DVL I H I L S L R HDVNF S VAQAAME AF GDC I E VKE E I HGF R E R DL S GF VDGT E NP AV I K - VDAG D I L I H I I S DRMDT C F KL AQDTMR NF GDQL D I KQE I HGF R E R DL T DF I DGT E NP VAAG - - N E F DL L F H I KAAR KDL C F E L GR Q I V S AL GS AAT VVDE VHGF R S R DL L GF VDGT E NP AL I G P DF R G DL L F H I R AE TMDVC F E L AGR I L KS MGDAVT VVDE VHGF R NR DL L GF VDGT E NP T T I GR NF AG D I H I H I R AL NAADC F DMAQN I KE VL F KF AE L T DE T QGF KGR A I I G F VDGT E NP AKVGAKF KG DL L F H I R AKQMGL C F E F AS I L DE KL KGAVVS VDE T HGF R GKA I I G F VDGT E NP AV I GADF AG DVL I H I A S AR AD I C F AL S QAF F E G I QDQVNVL DE R VC F R GR D I T GF I DGT E NP AL L GAVF R D DL F VHL R C DR YD I L HL VANE I S QMF E DL VE L VE E E R GF R S R DL T GF VDGT E NP AL VGP E F KG DVVL I VAS DL L E E VS R I L KS I V I F T DS GAK I T F I E E GANGHE HF GNL DG I S Q P F VF GKWADD HGV I MVC AKS QDKVDS GVQT I KDT F GAS WE I KQT L S GNAGKE HF GYQDGVS QP L I L GDWAR D HGV I I VAAS DADE C QT AT QNVKDAF KQS I YNVS EMDGNT GHE HF GYKDGVS QP I I C GDWT KD DGV I L VT GR S E QT AR AKL R E VKY I F I GYF GF T S S I R E L F S KE HF GYR DL I S Q P I I T NDWAT D DGVF T I T GDT E KT L VNT VR S VKKAF G I P S T GGHT I DT P S DKE HF GWVDG I S QP I L VGAWAKE DGVF L VT AE E E NHL NS MGNE I KE HF L ADT YL I S NDP A I E GKE HF GF E DG I S Q P I F AGDWAE D HGV I L I S GE S HE T L HKKKL E I E C I F GVR T I Q P S I F E VT S GHE HF GF L DG I S N P I VT GAWAVD DVL LM I T AP E DQL L NS KL NE L E HHL R P L T E F S F VKR GNVGHE HF GYL DG I S Q P I L VGS WQKD DF VVL I T AP DS NL L NQKL HQVR RMF NGF L S HS F L R QGNVANE HF GF P DA I S MA I L L GAWL KD HGVF L L AS DT I DNVNT E L AN I QT I L NGS I T E I HR L QGE AGHE HF GF MDG I S NP ML L GP WAKD HGVF L I G S DQDDF L DQF T DD I S S T F GS S I T QVQAL S GS AGHE HF GF L DG I S Q P I L T GS WAL D DGVF L I I S DQDS I I T QYQDDL QAKL GDAWT VVYDL S GAAGHE HF GYL DG I S N P I L VGAWAL D DGAF L I AAR DWE P I DT L L NQMKNWL GDA I VE T HS NR GAVGKE HF GWL DGF I Q P L L T KAWT KW HAL VL I ADDD I VDL L Q I VNQ I T QKL R Q I AE I VHR E DGF I I I E H F GF VDGVS QP I L VE T KDS Y DAVL L L GDAT AGP VR T L R R QVE AL R P AS VT VVGE E S GL GG I E HF GYVDGR S QP VL VP P T VHF HL L LML YAT DDS T L QHF YT E QKNT L DAGL K I AYQL E T S KE KE HF GF R DG I AQP F L F GDL GR N HL L VL VYAAT AT AL R R R VAQ I KR E S E - GL S L T VAL P T DP - T E P F GF R DGL S QP F VL GDL GR D H I C AA I I ADNE DKWQT K I QQL R QD I S P E E GD I E I L I DHQAKNVF GF R DG I S N P F VMGVL GKN AL T I YAADK - - P AL DVAVE KAMAE F D - A S T GVT L VGT HE AE NP F GF R DS I S Q P F VL GP L GR N DVHVVL T AL T QAQL E T AL E R AS KAVR GG I E A I WR QDC HAGKE P F GF KDG I S H P F VL GVL GR N HAL L S LWVDGE AQL E P AS AT L R R AF AS GVT E L S AQDAVANR VHF GYR DS I AQP F L L GE L S L N I L L F L L AE D - HDT L S QKS VE L R DKF E QE I QE L GYF DGAKDM I HF GYR DG I AQP F VL I I L GE N HAV I S L AS GDR GS L DT L R GE VDQR L AAGVAL VF E E R GQHGKE HF GYT DG I AQP F VL GQL F KN 130 140 150 160 170 180 GT YMAF R K I KMF L E VWDR - S L KDQE DT F GR R KS S GAP F Q I P S NS HVS L AKS T - Q I L R R AF S Y GAYL VAR R I RML I E QWDR - VL GE QE R V I GR S KGT GAP L V I DVDAHVR L AS AQ I Q I L R R GYNF GS YL VVR R I RML L T EWR K - DVAAR E R V I GR R L DT GAP L L I P E NAHVR L AS P E ARMF R R GYS Y GT VL V I R R I R S E L DTWDE - DR T S KE L T L GR R L DT GAP L V I P P NS HVAL AR R QE R F L R R GYNY GS YQAVR V I R NF VE RWDR - P L AE QE R I F GR T KMT GAP L T T P P DS H I R L ANP R NLML R R P F NY GS YQAVR L I Q F R VE F WDR T P L KE QQT I F GR DKQT GAP L V I AL DS H I R L AN - - S LML R R GYS Y GS YQVVR L VR NF VE RWDR - P L S E QE A I F GR AR NS GAP L K I P L T S H I R L ANP R AR L I R R GF NY C S YWAL QQWE HDYS AF GC - S T T E QDHAVGR R R S DNE E L - - P E S AHVKR T AQE AF VVR R S MP W GS YVF VQRWE HNL KQL NR - S VHDQEMM I GR T KE ANE E I E R P E T S HL T R VDL KL K I VR QS L P Y GS YVF T QR YVHNL KKWYP - P L S VQQDT VGR T KKDS I E I KR P I T S HVS R T DL S L K I VR QS L P Y GS YV I VQKYL HDMS AWNT - S T E E QE R V I GR T KL E NVE L AQP S NS HVT L NT I VHD I L R DNMAF S C YVHVQKYVHDMAS WE S - S VT E QE R V I GR T KL DD I E L AKP ANS HVAL NV I T R K I VR HNMP F GS YVF VQKYF HKMKEWNA - S VS E QE KV I GR S KE YD I EMVKP T NS HS S AANVGKKVVR GNMP F GS YVF VQKY I HDMVAWNAL P VE QQE KV I GR HKF NDVE L E KP GNAHNAVT N I GL K I VR ANMP F GS F VF AQR YAHDL E KWKK - KVDAQE QVMGR T KL E S I E L VKP DNAHVAR T VVE L E I L R HS L P Y GS Y I HVQKYAHNL S KWHR L P L KKQE D I I GR T KQDN I E YDKP L T S H I KR VNL K I E I L R QS MP Y GS YL VF R R L R QDVF KF HKL P R KVS AKL I GRWP S GAP T VR C P F I AHT R KT YP R HR L L R R G I P Y GS F MVF R KL E QDVKGWNNVANF VGAAL VGRWKS GAP I QYC P F NS HT R KT AP R S L I AR T G I P Y GT F MVF R KL E QDV I G F S NL AE L F GAR L VGRWKS GAP L AVC P F T AHT R KT AP RML V I R AGL P Y GS F L VF R KL KQL VP E F NR L T DQL S AR LMGRWKS GAP T F KC P F AAH I R KC R P R S S MMR R G I P Y GS F MVF R T YE QR T P E F VAC L R KF S S R I VGRWP NGAP L E R C P YAAH I R KC GP R HLMMR R G I P Y GS F L VF R DL QQL VP E F DKL KE KL AAYLMGRWKNGT P VDKC P F AAH I R KMR P R AV I I R R G I S Y GS F L VF R YL F QQVP E F NDL S DL L GAR L VGRWKS GAP I DR C P F AAHVR R T NP R NR I L R R GVQF GS F I V F R E L QQF VP E F DS VP GL I GAR I VGRWKS GAP VVKC P YAAH I R KS NP R HLM I R AG I P Y GS F MAF R E L R QL VP E F HHC GDF I GAR I VGRWKS GAP L T R C P YAAH I R KS NP R HLM I R NS I P Y GS F L VF R QMQQR AP E F NKL ADL L GAR I VGRWKS DAP I DR C P F S AH I R KANP R QH I I R AG I P Y GS F MAF R HF QQKVP E F NAT AE F L GARMF GRWKS GAP I DR C P F GAHVR KT NP R F HAMR S S I P Y GS F L AF R KL KQL VP E F HKT AL L L GS RMF GRWNS GAP I DR C P F T AH I R KT NP R F HA I R AGT P Y GS F MAYR QL QE L VP E F DDL ADL L GARMF GRWKS GT P L DYC P F S AH I R K I R P R NQM I R AS I P Y GS YL VYR KL E QNVKAF R E QE NL AGAL I VGR F ADGT P VT KC P F HS HT R KT NP R HR I T R R AVS Y GS YF VF R KL E QNVR L F KE E R E R AGAML VGR F E DGT P L T KC P F HAH I R KT NP R HLMAR R GQT Y GS ML VF R QL E QNVKAF WAAP E Y I A S KML GRWP NGS P L T KC P I GAH I R R ANP R F R I I R R GR S Y GS YL VF R QL R QDVDGF WAL AR R L AAKMVGRWP S GAP L VS C P L GAHVR R ANP R HR L L R R GR S Y GS F MVL R KYQC NVADF NR C ADKL AAKMF GRWR S GAP VT GC P F GS HT R RMNP R HR I I R R S VS F GS F VVL R KYDS R VGAF NE L QHAL AAKMF GRWR S GAP L P VC P HS S HMR RMNP R HR I I R R S S T F GT YVAF R KL HQR VAAF R QL E E F L AAKMMGRWR S GAP L AKT P P AS HVR R ANP R HRM I R R GT AY S S F AAF R I L E QDVP GF E R L AEML AAKVC GRWR NGNP L T KC P I G S H I R R S NP R HR I VR R AMP Y GS F AAF R VL E QNVVAF E KL P E T L AAKMC GRWR NGVP L DKC P I G S H I R R NNP R R R L I R R G I P Y GS F MVF R KL AQHVAR F HE T AE F VGS KM I GRWP S GAP L VAC P F GAH I R R NNP R HR I I R R AT P Y 190 200 210 220 230 T DAGL L F I S F QKNP DQF I P ML KL S A - DAL E YT QT I G S AL YAC P GG I Q T DAGL F F I AYC R NP QQF VP MQL L S R - DAME Y I QHVGS AL F AC P P GWQ DDAGL L F MAWQGDP AGF I P VQR L ADGDAL R Y I R HE GS AL F AVP AAL Q DDAGL I F AAYQR DP AQF VP VQR L AE - DAMP W I T T I G S AVF AML P GL Q S DQGL L F I AYQADL E GF I AVQNQL NGE P L E Y I K P VGGGYF F AL P GL A S DMGL L F VC YQHDL E GF L T VQKR L NGE AL E YVKP I GGGYF F AL P GF S S DMGL L F VS F QS DL AGF I AT QNR L NGE P L E Y I K P F GGGYYF VL P GL Q WR S GLMF S AF GC S F DF E AQMR R L GMS DGL - F S T P L T GC YF WC P P VT L GT HGL YF C AYC AR L H I E QQL L S F GDR DAM - F T KP VT GGYYF AP S L L A GE KGLMF I AYAC S L H I E KQL QS F GQHDL L KYT T P VT GS F YF AP S KL E GE YGT YF I GYAKDP AT E LML R R F L GYDR VDF S T AAT GT L F F VP S R L D GE YGT YF I GYS R T P T T E QML R NF L GT DR VDF S T AVT GGL F F S P T I P P T KT GT YF I AYAS T F S VE LML KKF I G S DR L DF S T P VT GAL YF AP T L L D AE YGT YF I GYAS T F S T T R RML E NMF T DR L DF S T A I T GT L F F VP S YL E GDQGL F F I AYT KDL G I DQML E R F GT HDR L HF VT P L DGAYYF AP S E L G GE QGLMF I S T C R T P DHF E KML HS MVHDHL HF T S AL T GS S F F AP S L L Q GDR GL HF L AYQT S I VQF E F VT KWS NHDP I DWV I P T GGGYF F AP S I L N GQR GL L F VC YQS AL DGF VR QT VF S S QDP I F F VT S HGGE YF F VP S I K P GP R GL L F L C YQS S T E GF WQQT R AVNQDP I Y F VT S R GGE YF F VP S VAG GE R GMF F L C YQS N I AGF R R VQEWC NADP I S C V I P KGGE YF F S P S I L N GDR GL L F VS YQS D I T GF R F VQKWAN I DA I RWV I P R GGE YF F AP S I I E GE R GL L F VC YQS D I R GF NF L T TWAS I DA I RWVVQR GGE YF F S P G I T A GGR GL L F AC YQT S I T GF QF L QKWANL DP L DF I I P R GGE YF F S P S L AP GE R GL L F VS YQS S I E G F QR VQQWC NF DL I D F VL P R GGE YL F VP S I I N GNR GL L F VAYQS D I VGF QF VQKWC NL DL L GNADP R NT VT AF QP F VL T GE R GL AF VAYQS N I QGF VF L QKWVDVDP L DF VVS R GGE YF F S P S L I T GDR GL L F VE YQS I I GGF R F QQ I WAN I E P I L F V I P KGGE YF F L P S I L A GDR GL AF VE YQS N I S G F R F QQVWANL DP VDF I V S NGGE YF F AP S I I E GE R GVAF VT YQS DL GGF HF QQAWANF DP I S F VVS KGGDYF F S P S M I H GGS GL L F L C F QS N I E QF NF MQS WANP DP L LW I NMKGGE YF F AP S I L T GDVGL L F MAF NS NL GQF E F T QQWANL DP VQAVTMKGGE YF F MP S L L S GE R GL YF L C F NS N I GQYE L I QQW I NP DP MR F VNVKGGGYF F MP GL L Y T E R GL HF L C L S ANL AQYE F VQHW I NADP L S F VQVR GGAYF F L P GVL Y GE R GL YF I G I NAQAMT L E F L QS W I NR DP L QF NT L QGGE YL F I P S I LW GE R GL F F I F I S AR AYT VE F L QQW I NP DP I T F NR L R GGE YMF MP S L S G GE R GLMF AF I GAHL GQF E F VQS WVNKDP L R F VVT R GGE YC F MP GL L D GKR GL I GYF I NAS L S QF E F VT S WAL E DVF R L I HT R GGAYC F F P S I L Y GE R GL L GL F I C AS L GQF E F VMKWVNKDP L R F I I T R GGAYC F L P S I L Y GDR G I L F VV I NAD I S Q F E F VQQWVDR DP L T F VT T KGGAYF L L P S I K I A B D C A B D C A B D C A B D C                                             Figure A1. Structure-based sequence alignment of DyPs. Conserved heme-pocket residues are indicated using a black background.  Other conserved residues are highlighted using gray. A non-conserved heme-pocket residue is highlighted using light gray. Sequences were ordered according to subfamily. ! !  65 APPENDIX II: CRYSTALLOGRAPHIC DATA Table A1. Initial screen crystallization conditions of RHA1 DypA and DypB. Dyp Kit Condition For ma A Hampton 0.1 M MES monohydrate pH 6.5, 12% w/v Polyethylene glycol 20,000 1  Index 0.1 M BIS-TRIS pH 6.5, 25% w/v Polyethylene glycol 3,350 1   0.1 M BIS-TRIS pH 6.5, 20% w/v Polyethylene glycol monomethyl ether 5,000 1    0.1 M BIS-TRIS pH 6.5, 28% w/v Polyethylene glycol monomethyl ether 2,000 1 B Index 0.1 M Sodium acetate trihydrate pH 4.5, 3.0 M Sodium chloride 3   1.26 M Sodium phosphate monobasic monohydrate, 0.14 M Potassium phosphate dibasic, pH 5.6 4   0.49 M Sodium phosphate monobasic monohydrate, 0.91 M Potassium phosphate dibasic, pH 6.9 3   0.8 M Succinic acid pH 7.0 2   3.5 M Sodium formate pH 7.0 4   1.1 M Sodium malonate pH 7.0, 0.1 M HEPES pH 7.0, 0.5% v/v Jeffamine® ED-2001 pH 7.0 1   1.0 M Succinic acid pH 7.0, 0.1 M HEPES pH 7.0, 1% w/v Polyethylene glycol monomethyl ether 2,000 1   0.2 M Sodium chloride, 0.1 M BIS-TRIS pH 5.5, 25% w/v Polyethylene glycol 3,350 1   0.2 M Lithium sulfate monohydrate, 0.1 M BIS-Tris pH 5.5, 25% w/v Polyethylene glycol 3,350 1  Hampton 0.2 M Lithium sulfate monohydrate, 0.1 M Tris hydrochloride pH 8.5, 30% w/v Polyethylene glycol 4,000 3   0.1 M HEPES sodium pH 7.5, 0.8 M Potassium sodium tartrate tetrahydrate 3   4.0 M Sodium formate 3   0.1 M Sodium acetate trihydrate pH 4.6, 2.0 M Sodium formate 3  0.1 M HEPES sodium pH 7.5, 0.8 M Sodium phosphate monobasic monohydrate, 0.8 M Potassium phosphate monobasic 4   0.1 M MES monohydrate pH 6.5, 1.6 M Magnesium sulfate heptahydrate 3  Wizard 0.1 M Phosphate-citrate pH 4.2, 1.6 M sodium phosphate dibasic, 0.4 M pottasium phosphate monobasic 3   0.1 M Tris pH 7.0, 1.0 M sodium citrate, 0.2 M sodium chloride 1   0.1 M Tris pH 7.0, 1.0 M potassium/sodium tartrate, 0.2 M lithium sulfate 2   0.1 M Acetate pH 4.5, 2.5 M sodium chloride, 0.2 M lithium sulfate 3     0.1 M Tris pH 7.0, 0.2 M magnesium chloride, 10% w/v Polyethylene glycol 8,000 2 a1, Needles (1D growth); 2, Plates (2D growth); 3, Single Crystals (3D growth < 0.2 mm); 4, Single Crystals (3D growth > 0.2 mm) ! !  66                                Figure A2. Preliminary model of a DypB protomer containing five identified selenium sites used for phase determination. !-helices, "-sheets and ribbons are colored skyblue, violet, and wheat, respectively. Ball and stick models represent the heme prosthetic group colored pink.               ! !  67                                      Figure A3. X-ray diffraction pattern of crystallized DypA.       

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0071615/manifest

Comment

Related Items