UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Investigation of methylation and gene expression in placenta of pregnancies conceived by assisted reproductive… Sakian, Sina 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2011_spring_sakian_sina.pdf [ 3.21MB ]
Metadata
JSON: 24-1.0071600.json
JSON-LD: 24-1.0071600-ld.json
RDF/XML (Pretty): 24-1.0071600-rdf.xml
RDF/JSON: 24-1.0071600-rdf.json
Turtle: 24-1.0071600-turtle.txt
N-Triples: 24-1.0071600-rdf-ntriples.txt
Original Record: 24-1.0071600-source.json
Full Text
24-1.0071600-fulltext.txt
Citation
24-1.0071600.ris

Full Text

Investigation of Methylation and Gene Expression in Placenta of Pregnancies Conceived by Assisted Reproductive Technology (ART)  by Sina Sakian  B.Sc., The University of British Columbia, 2008  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in The Faculty of Graduate Studies (Reproductive and Developmental Science)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) February 2011  © Sina Sakian, 2011  Abstract  With the increasing use of assisted reproductive techniques (ART) every year, concerns have been raised regarding the possible effect these procedures have on the health of the children procured by them. Although patients born via ART are usually healthy, studies have associated these procedures with increased incidence of low birth weight (LBW), chromosomal abnormalities, birth defects and imprinting disorders. No study has proposed a single defined cause for any of these defects in ART infants, however it is believed that they may be due to both the invasiveness of ART and to genetic defects that are at the root of the infertility in the parents. In this study, changes in the methylation of the H19 and IGF2 imprinting control region 1 (ICR1) were investigated for both ART (n=92) and naturally conceived controls (n=19) using pyrosequencing.  Expression of H19 and IGF2 was also investigated for both the ART  population (n=31) and controls (n=14) using quantitative real-time PCR. No significant changes in H19 or IGF2 methylation or gene expression were found between the ART groups and the natural conception group. Methylation levels at ICR1 for the IVF, ICSI and control cases were averaged at 49.3% ±3.4%, 49.6%±1.9% and 48.7%±1.7%, respectively. Compared to the controls IVF and ICSI patients both showed an increase in H19 gene expression (by a factor of 1.78±0.74 and 1.93±0.71, respectively) while showing a decrease (by a factor of 0.83±0.34 and 0.74±0.27, respectively) for the expression of IGF2; these differences were not proven significant using ANOVA (P > 0.05). The study did find, however, that the previously proposed H19 and IGF2 regulatory model is not a good indicator of how these two genes are controlled in human placenta.  Comparing methylation analysis with  expression analysis did not show the expected negative correlation implying that there may be ii  other factors influencing the expression of H19 and IGF2 in human placental tissue. Although our results suggest that ART does not have a significant negative effect on H19 and IGF2 imprinting in the placenta, it merits further investigation looking at the regulation of these two genes in this tissue.  iii  Preface  This project was supported and funded by the Canadian Institute of Health Research (CIHR) issued to Dr. Sai Ma. An ethics certificate of minimal risk approval was provided by the CIHR (Certificate number: H06-03668). Preliminary results from cases included in this thesis were presented at the European Society of Human Reproduction and Embryology (ESHRE) by Sina Sakian. This project was designed by both Sina Sakian and Dr. Sai Ma.  iv  Table of Contents  Abstract ...........................................................................................................................................ii Preface …………...........................................................................................................................iv Table of Contents ............................................................................................................................v List of Tables ...............................................................................................................................viii List of Figures ................................................................................................................................ix List of Abbreviations ......................................................................................................................x Acknowledgements .......................................................................................................................xii  Chapter 1 INTRODUCTION ...........................................................................................................1 1.1 Project overview ..................................................................................................................1 1.2 Fertility problems and assisted reproductive technologies (ARTs) .....................................2 1.2.1 Gametogenesis ..............................................................................................................4 1.2.1.1 Spermatogenesis .....................................................................................................4 1.2.1.2 Oogenesis ................................................................................................................7 1.2.2 Infertility .......................................................................................................................9 1.2.2.1 Female infertility .....................................................................................................9 1.2.2.1.1 Ovulation and female fertility .......................................................................11 1.2.2.2 Male infertility ......................................................................................................14 1.2.2.2.1 Non-genetic causes of male infertility .........................................................15 1.2.2.2.1 Genetic causes of male infertility ................................................................16 1.2.3 Assisted reproductive technologies (ARTs) ................................................................18 1.2.3.1 In vitro fertilization ...............................................................................................18 v  1.2.3.1.1 Concerns with IVF ........................................................................................19 1.2.3.2 Intracytoplasmic sperm injection (ICSI) ...............................................................21 1.2.3.2.1 Concerns with ICSI .......................................................................................21 1.3 Epigenetics .........................................................................................................................24 1.3.1 DNA methylation ........................................................................................................26 1.3.2 Gene expression ..........................................................................................................29 1.3.3 Genomic imprinting ....................................................................................................32 1.3.3.1 Imprinting disorders, Beckwith-Wiedemann syndrome and ART .......................33 1.3.3.2 Imprinting genes H19 and IGF2 ...........................................................................38 1.3.4 Genomic reprogramming ............................................................................................42 1.3.4.1 Genomic reprogramming during gametogenesis ..................................................44 1.3.4.2 Genomic reprogramming after fertilization ..........................................................45 1.3.5 Epigenetic modification and ART ..............................................................................47 1.3.5.1 DNA methylation alterations in ART pregnancies ...............................................48 1.3.5.2 Ovulation induction in ART and imprinting defects ............................................49 1.3.5.3 ART in vitro culture media and imprinting defects ..............................................50 1.4 Fetal growth restriction ......................................................................................................51 1.4.1 Fetal growth restriction and ART ...............................................................................53 1.5 Placental development and function ..................................................................................55 1.5.1 Trophoblast invasion ...................................................................................................58 1.5.2 Trophoblast differentiation .........................................................................................59 1.5.3 Placental function ........................................................................................................60 1.6 Rationale, objectives and hypothesis .................................................................................62  Chapter 2: MATERIALS AND METHODS ................................................................................68 vi  2.1 Patient recruitment and sample collection ........................................................................68 2.2 DNA extraction .................................................................................................................71 2.3 Bisulphite conversion of DNA and methylation analysis using pyrosequencing .............71 2.4 RNA extraction and cDNA conversion ............................................................................73 2.5 Quantitative real time RT-PCR .........................................................................................74 2.6 Clinical outcome analysis .................................................................................................75 2.7 Data and statistical analysis ..............................................................................................78  Chapter 3: RESULTS ...................................................................................................................79 3.1 Clinical outcomes ..............................................................................................................79 3.2 DNA methylation ..............................................................................................................82 3.3 Gene expression ................................................................................................................84 3.4 DNA methylation compared to relative gene expression for individual cases ................85 3.5 Placental DNA methylation and gene expression for SGA patients .................................87  Chapter 4: DISCUSSION .............................................................................................................89 4.1 Discussion of results .........................................................................................................93 4.1.1 Clinical analysis of ART patients ............................................................................93 4.1.2 ICR1 methylation in ART placenta .........................................................................95 4.1.3 H19 and IGF2 expression in ART placenta .............................................................98 4.1.4 ICR1 methylation and H19/IGF2 expression ........................................................100 4.2 Addressing the hypothesis ..............................................................................................101 4.3 Limitations ......................................................................................................................103 4.4 Future directions .............................................................................................................104 4.5 Concluding remarks ........................................................................................................105  References ...................................................................................................................................107  vii  List of Tables  Table 1.1  Studies comparing congenital malformations between IVF and control infants ...20  Table 1.2  Studies comparing congenital malformations between ICSI and control infants ..23  Table 1.3  Common human disorders due to imprinting defects ............................................34  Table 2.1  ICR1 reverse, forward and sequence primers used in pyrosequencing .................73  Table 2.2  H19 and IGF2 primers used in real-time PCR analysis .........................................75  Table 3.1  Clinical information for IVF term pregnancies .....................................................80  Table 3.2  Clinical information for ICSI term pregnancies ...................................................81  Table 3.3  Clinical information for natural conception term pregnancies ..............................81  Table 3.4  DNA methylation and gene expression in placenta of two SGA patients .............88  viii  List of Figures Figure 1.1  Schematic of spermatogenesis .................................................................................6  Figure 1.2  Schematic of oogenesis ............................................................................................8  Figure 1.3  The menstrual cycle: hormone activity. .................................................................12  Figure 1.4  Simplified DNA methyltransferase mediated methyl-transfer pathway. ...............28  Figure 1.5  Simplified model of the gene expression process ..................................................30  Figure 1.6  Schematic of genomic imprinting and possible imprinting defects. ......................37  Figure 1.7  Simplified schematic of the proposed H19 and IGF2 regulation model ...............40  Figure 1.8  Looping model of H19 and IGF2 control ..............................................................41  Figure 1.9  DNA methylation and demetylation mechanisms during early development .......43  Figure 1.10  Methylation reprogramming during gametogenesis ..............................................45  Figure 1.11  Methylation reprogramming in preimplantation embryos .....................................46  Figure 1.12  Schematic of placental tissue .................................................................................57  Figure 1.13  Differentiating cells of developing human blastocyst ..........................................57  Figure 1.14  Cytrotrophoblast cell differentiation ......................................................................60  Figure 2.1  Protocols for RNA expression and DNA methylation analysis .............................70  Figure 2.2  Location of region of ICR1 investigated for methylation .....................................72  Figure 2.3  Canadian Perinatal Surveillance System (CPSS) guidelines for small for gestational age ........................................................................................................77  Figure 3.1  Average DNA methylation in the placenta of control (n=19), ICSI (n=40) and IVF n=52) groups ..........................................................................................................82  Figure 3.2  Pyrosequencing results for (A) random control, (B) IVF sample with lower than average methylation, (C) sperm sample.................................................................83  Figure 3.3  Average relative gene expression (Rq) of H19 and IGF2 in the placenta of ICSI (n=14), IVF (n=17) and control (n=14) patients ....................................................85  Figure 3.4  Relative gene expression of both H19 and IGF2 as compared to DNA methylation at the regulatory ICR1 region in ART placenta. ....................................................86 ix  Figure 3.5  Relative H19 expression vs. IGF2 expression levels for individual cases in ART placenta ..................................................................................................................87  LIST OF ABBREVIATIONS This thesis follows rules established by the Human Genome Organization (HUGO) for naming genes. Human genes are reported as all capital letters, while those in mice have only the first letter capitalized. Italicized letters indicate the gene or RNA, while non-italicized letters indicate the protein.  2n 1n ADP ART AS AZF BW BWS CA CF CI CO CPM CTCF DNA DNMT FSH GCA GH GnRH H2AX ICSI IGF2 IgG inv IUGR IVF IVM LH MI MII mRNA NA  Diploid Haploid Adenosine diphosphate Assisted reproductive technologies Angelman syndrome Azoospermic factor Birth weight Beckwith-Wiedemann syndrome Chromosomal abnormalities Cystic fibrosis Confidence interval Crossover Confined placental mosaicism CCCTC-binding factor Deoxyribonucleic acid DNA methyltransferase Follicle stimulating hormone Germ cell arrest Growth hormone Gonadotropin-releasing hormone H2A histone family, member X Intracytoplasmic sperm injection Insulin-like growth factor 2 Immunoglobulin G Inversion Intrauterine growth restriction In vitro fertilization In vitro maturation Luteinizing hormone Meiosis I Meiosis II Messenger ribonucleic acid Not available x  NC NCA NOA NS OA p PBD PBS PCR PGC q R² RNA RNA Pol II RPA Rq SA SCOS SD SGA SNP SNUPE SRS SRY SSC TESE UPD WHO  Natural conception Numerical chromosomal abnormalities Non-obstructive azoospermia Not significant Obstructive azoospermia Short chromosome arm Phosphate-buffered detergent Phosphate-buffered saline Polymerase Chain Reaction Primordial germ cell Long chromosome arm Coefficient of determination Ribonucleic acid Ribonuclei acid polymerase II Replication protein A Relative expression Spontaneous abortion Sertoli cell only syndrome Standard deviation Small for gestational age Single nucleotide polymorphism Single nucleotide primer extension Silver-Russell syndrome Sex determining region Y Spermatogonial stem cell Testicular sperm extraction Uniparental disomy World health organization  xi  ACKNOWLEDGEMENTS  I would like to take this opportunity to thank those whom I am indebted to for making my graduate career a rewarding and pleasurable experience. For anyone I may have left out, I truly apologize. I wish to express deep gratitude to my supervisor Dr. Sai Ma for allowing me to perform the research in her laboratory and for her continuous training, support, guidance and friendship. I am also grateful to the members of my supervisory committee, Dr. Anthony Perks, Dr. Petrice Eydoux and Dr. Wan Lam for their support and very informative, constructive and helpful suggestions. I am also indebted to the many members of Dr. Sai Ma’s lab who I have shared lab space with and who have become great friends and colleagues: Edgar Chan Wong, Agata Minor, Gordon Kirkpatrick, Elizabeth Wu, Kevin Ma, Andrew Wilson, Chantelle Chand, Tanya Vinning, Rita Lau, Sanuja Pitigalaarachchi. Finally, and most importantly, I would like to thank my family, specifically my dear mother Shahin Sakian and father Mansoor Sakian for everything they have gone through that has allowed me to have the opportunity to accomplish all that I have achieved in life. Also I would like to thank my brother, Nima Sakian, for his support and encouragement throughout the years.  xii  CHAPTER 1: INTRODUCTION 1.1 Project overview The use of assisted reproductive technologies (ARTs) is on the rise in the western world with recent estimates suggesting that up to 4% of all pregnancies in Canada are conceived using either in vitro fertilization (IVF) or intracytoplasmic sperm injection (ICSI) (Bohlmann et al., 2009). Both IVF and ICSI pregnancies experience unnatural culturing condition and bypass many of the natural mechanisms in human reproduction. The invasiveness of these procedures could possibly be affecting proper genetic development and maintenance in the offspring conceived through these techniques. Here, we are investigating placental tissue and looking at two important developmental genes (H19 and IGF2) to try to see if defects in these genes are hindering placental function. The placenta is essential for allowing proper fetal growth and we aim to see if abnormalities in ART placentas are to blame for the increased incidences of growth restrictions in this population group (Schieve et al., 2002; Katalinic et al., 2004; Wang et al., 2005). Previous research has reported on the adverse effects of ART including increased rates of chromosome abnormalities (Chang et al., 1999, Ohashi et al., 2001), genetic disease (Sutcliffe et al., 2006), physical malformations (Bonduelle et al., 2005; Fedder et al; 2007), and intrauterine growth restriction (IUGR) (Schieve et al., 2002; Katalinic et al., 2004; Wang et al., 2005). Recently, there has been heightened interest in possible epigenetic alterations associated with ART. Epigenetics deals with inherited and acquired changes in phenotype which are caused by factors independent of the DNA sequence itself (Goldberg, 2007). Epigenetic changes affecting DNA methylation and gene expression have been reported in relation to elements associated with  infertility treatments such as culture conditions (Mann et al., 2004), ovulation induction (Sato et al., 2007), and parental infertility abnormalities (Marques et al., 2008; Kobayashi et al., 2007). Epigenetic regulation is important in the development of the placenta (Nelissen et al., 2010; Fowden et al., 2010) and this organ is in turn itself vital to proper human development; deficiencies in the placenta have been previously linked to IUGR (Laurini et al., 1994; Fowden et al., 2010). The aim of this study is to determine if there are differences in both the DNA methylation and gene expression of IGF2 and H19 in the placenta of ART pregnancies as compared to placentas from natural pregnancies. Changes in H19 and IGF2 were monitored because of their importance in human development already observed in other studies (Brannan et al., 1990; Tanos et al., 2004).  Because ART pregnancies have been associated with fetal growth  restriction (Schieve et al., 2002; Katalinic et al., 2004; Wang et al., 2005), we were interested in monitoring these two developmental genes in this population group. Furthermore, we were interested to see if DNA methylation at the imprinting control region of these two genes is associated with H19 and IGF2 expression in human placenta.  1.2 Fertility problems and assisted reproductive technologies (ARTs) Fertility problems are on the rise in the western world and it is thought that our lifestyles are to blame. Thankfully assisted reproductive technologies (ARTs) have made is possible for us to bypass this problem in many instances. Concerns have been raised, however, regarding both the problems that are at the root of the infertility that may be passed on to the offspring born after ART and also regarding the techniques themselves and how their invasiveness influences the 2  conceptus. Here we discuss the various possible causes of both male and female infertility while also explaining the ART procedures and outlining the concerns that have arisen regarding the adverse effects of ART use. Female infertility is usually a result of maternal age and the condition is on the rise considering women are beginning to wait longer and longer to conceive. Advanced age results in poor quality oocytes (Westhoff et al., 2000) and it is believed that fertilization and implantation of such oocytes may be associated with deleterious effects on the offspring (Nicolaidis and Peterson, 1998). Male infertility results from either genetic or non-genetic abnormalities.  Non-genetic infertility in men is usually a result of either hormonal  insufficiencies (Spratt et al., 1987; Freeman, 1991) or physical constraints (Howards, 1992). Genetic causes affect the sperm and lead to various phenotypic consequences that disallow fertilization (Ferlin et al., 2007; Ferguson et al., 2007). These abnormalities usually arise during gametogenesis during which diploid or haploid precursor cells undergo cell division and differentiate to form mature haploid gametes in organs called gonads (Sadler, 2006). Males and females have different forms of gametogenesis and these separate processes are called spermatogenesis and oogenesis, respectively.  3  1.2.1 Gametogenesis 1.2.1.1 Spermatogenesis Spermatogenesis is the process by which the male spermatogonium develops into a mature spermatozoa, or male gamete. During the first 8 weeks after gestation, Sertoli cells located in the seminiferous tubules begin to secrete anti-Müllerian hormone which inhibits the development of the Müllerian duct thus preventing the development of female internal genitalia (Bullock et al., 2001). The Leydig cells which lie in between the seminiferous tubules secrete testosterone and thereby initiate sexual differentiation and allow the development of male genitalia (Sadler et al., 2006). At the age of around 10-13, most individuals experience a specific interaction between the hypothalamus, pituitary gland and Leydig cells that results in the onset of spermatogenesis; this period is referred to as puberty. It is after this change in hormonal control when males can undergo spermatogenesis in the spermatogonium of their testis. The spermatogonium consists of a three types of cells: A dark (d), A pale (p) and B cells. Type A(d) cells divide and thereby provide a constant supply of spermatogonia to fuel spermatogenesis. Type A(p) cells divide to produce type B cells. It is the type B cells which will give rise to primary spermatocytes. Each primary spermatocyte then duplicates its DNA before undergoing meiosis I to produce two haploid secondary spermatocytes. Each of these haploid units then divide further by undergoing meiosis II to produce two spermatids (figure 1.1). The haploid spermatids undergo spermiogenesis to produce spermatozoa. Spermatozoa are the mature male gametes in humans and many other sexually reproducing organisms. Spermatozoa are characterized by an elongated shape with a compact nucleus and a flagellum. Spermatozoa undergo a final stage of maturation in the epididymis; these sperm cells become  4  motile and are ready to travel to the female oocyte after capacitation into the female reproductive tract. In humans, spermatogenesis takes place in the male testes and epididymis within approximately 64 days which is unlike the prolonged female oogenesis which we will discuss below.  The process of spermatogenesis starts at puberty for males and it continues on until  death. It is vital, however, that optimal conditions are maintained for proper spermatogenesis to occur.  The process is highly sensitive to changes in environmental factors such as hormone  levels and temperature. As mentioned above, starting at puberty, the hypothalamus begins interacting with the pituitary gland via gonadotropin-releasing hormone (GnRH); this promotes the pituitary gland to synthesize and release luteinizing hormone (LH) and follicle stimulating hormone (FSH). FSH stimulates the production of androgen binding proteins by Sertoli cells which then in turn play an essential role in concentrating testosterone in levels high enough to maintain proper spermatogenesis. LH acts on the Leydig cells to produce testosterone which both stimulates the Sertoli cells for sperm production and also plays a role in the negative feedback process by inhibiting the hypothalamus (Brehm and Steger, 2005).  Changes in hormones such as  testosterone can disrupt the important processes during spermatogenesis by interrupting the optimal release of proteins by Sertoli cells (Roberts and Griswold, 1989) and by interfering with peritubular cell action thus influencing other key factors which modulate important Sertoli cell functions (Norton and Skinner, 1989).  5  Figure 1.1 Schematic of spermatogenesis. Type Ad, Ap and B spermatogonia divide via mitosis to become the primary spermatocyte. The primary spermatocyte begins undergoing meiosis I to produce two haploid (n) secondary spermatocytes. These spermatocytes then divide further by undergoing meiosis II and procuring a total of four spermatids or male germ cells. The haploid spermatids then undergo gametogenesis to become highly specialized spermatozoa. 6  1.2.1.2 Oogenesis Oogenesis refers to the process that leads to the creation of a single ovum.  Oogenesis  starts with the production of ovarian follicles by the germinal epithelium. This is followed by oocytogenesis, ootidogenesis, and finally ovum maturation (Gilbert, 2000).  During  oocytogenesis, the oogonium undergoes a series of mitotic events to produce the primary oocyte. This process happens either before or very shortly after birth and it is believed that there are about seven million primary oocytes created but that this number falls to around 2 million shortly after birth. The primary oocyte then develops into a secondary oocyte (and a polar body) in a process called ootidogenesis. Ootidogenesis is a meiotic event and begins at prenatal age but stops at the diplotene stage of prophase I where the cells remain until puberty. It is during this first meiosis I event where crossing over may occur thus resulting in genetic problems in the offspring procured from these oocytes. The haploid secondary oocyte quickly transitions into meiosis II and this process is halted again at metaphase II until fertilization. Subsequently, the secondary oocyte (which is now haploid) begins the completion of meiosis II. This leads to the production of another polar body (which is later discarded) and the mature ovum (figure 1.2). This mature ovum is now ready to be ovulated. This ovulation process is under the strict control of key hormones as will be discussed below (section 1.2.2.1.1).  7  Figure 1.2 Schematic of oogenesis. The female primary oocyte begins dividing through meiosis I and produces a haploid secondary oocyte and a polar body. Both these then further divide; the secondary oocyte leads to both a mature ovum and a polar body while the first polar body divides into two resulting in a total of three polar bodies.  8  1.2.2 Infertility Infertility is a diagnosis made when a couple undergoes one year of regular unprotected intercourse without conceiving a child. The condition is thought to affect about 14% of the general population (Boivin et al., 2007). Though infertility can be linked to either the male or female in the relationship, there is no clear distribution of male and female causes of infertility. A 1987 World Health Organization (WHO) study has attributed 20 percent of cases to male factors, 38 percent to female factors, 27 percent to factors in both partners and 15 percent to no partner at all (WHO, 1987).  1.2.2.1 Female infertility The WHO examined the 38 percent of woman who were found to be attributors to infertility and identified six major female factors that led to the condition (WHO, 1987). In order of most prevalent, female infertility was found to be a result of: ovulatory disorders (25%), endometriosis (15%), pelvic adhesions (12%), tubal blockage (11%), other tubal abnormalities (11%) and hyperprolactinemia (7%).  More recently, however, increasing attention has to been  put on female age, genetic abnormalities and oocyte chromosomal problems in female infertility. Regardless of what it is attributed to, problems in female fertility is still the leading cause of infertility in couples suffering from this condition. Ovulatory disorders that affect fertility do so by making ovulation in these individuals either less frequent (oligoovulation) or absent (anovulation); this results in a reduction in the availability of oocytes for fertilization (Urman and Yakin, 2006). Endometriosis has also been linked to infertility in woman; this is a condition in which there is a growth of endometrial tissue 9  outside of the uterine cavity (Overton and Park, 2010). The growth usually causes anatomic distortion from pelvic adhesions, damage to ovarian tissue and the production of certain cytokines and growth factors which then in turn impair proper ovulation, fertilization and implantation. Finally, any blockage or abnormalities in the fallopian tube of woman wanting to become pregnant can be problematic when normal transport of the oocyte and/or sperm is distorted (Papaioannou, 2004). A determinant of female infertility that has recently become increasingly important is female age. The germ cell supplement of the ovary starts at about 6 to 7 million in midgestation of the female fetus and steadily decreases as the woman ages; there are only about 1 to 2 million follicles left at birth and this number goes down to 300,000 at the onset of puberty (Baker, 1971). The rate of follicle depreciation remains steady until the woman reaches her mid-thirties after which there is a sudden acceleration of the rate of loss (Richardson et al., 1987). Even though women may continue to ovulate through their thirties and into their forties, infertility may still result due to the poor quality of oocytes remaining in the terminal follicular pool (Westhoff et al., 2000) as we will discuss in more detail below. Increasing age in women is therefore detrimental to both oocyte quantity and quality. Genetic abnormalities have also been linked to infertility in women. Female infertility has been associated with an increase in chromosome abnormalities including trisomies, mosaicism and translocations as compared to the general population (Clementini et al., 2005). Specific genes that have been identified as having important roles in female reproduction include: KAL1 (Christensen et al., 1992) , GnRH receptor (Layman et al., 1998), FSH receptor (Aittomaki et al., 1995), LH receptor (Toledo et al., 1996), FMR1 (Schwartz et al., 1994), DAX1 (Achermann, et al., 2001), LEP and its receptor (Montague et al., 1997; Clement et al., 1998) 10  and GPR54 (Seminara et al., 2003).  Deletions in any of these genes may have a significant  impact on the fertility of these women. Oocyte abnormalities are becoming a concern and it is predicted that 15-20% of human oocytes present chromosome abnormalities as a result of both whole chromosome nondisjunction and chromatid separation leading to oocyte aneuploidy (Ma et al., 1989; Pellestor et al., 2006). The majority of these abnormalities are due to maternal meiotic errors during the first meiotic division (Hassold and Hunt, 2001).  Advanced maternal age is thought to be a major cause of  these meiotic errors and is the only factor that has been very strongly associated with human oocyte aneuploidy (Nicolaidis and Peterson, 1998; Eichenlaub-Ritter, 1998). As women age, both the number of oocytes and the quality of these oocytes decreases; the increase in aneuploid oocytes is largely due to dysfunction of meiotic spindle (Volarcik et al., 1998) which results in segregation errors and then eventually to higher rates of chromosomally abnormal embryos. After around the age of 45, most oocytes still present are said to be aneuploid (Westhoff et al., 2000; Pellestor et al., 2003) and may result in abnormalities in offspring if fertilized.  1.2.2.1.1 Ovulation and female fertility Hormones are involved in the natural progression of the menstrual cycle that leads to proper ovulation as outlined in figure 1.3. During the ovarian cycle up to 20 primordial follicles are activated and begin to grow and mature. From these only one Graafian follicle develops in a period referred to as the follicular phase. When ovulation begins, this Graffian follicle is released and there is a transition into the luteal phase during which the corpus luteum and corpus albicans are produced. Both these phases last around 14 days and are under the strict control of 11  hormones released by the anterior pituitary and the ovary (Sherman and Korenman, 1975). Proper hormone release is essential for successful ovulation to occur and errors during any of the phases will result in unsuccessful ovulation.  Figure 1.3 The menstrual cycle: hormone activity. During the first two weeks of the menstrual cycle, the ovarian follicle begins to grow and on day 14, ovulation occurs. Just prior to ovulation there is a marked increase of both luteinizing hormone and follicle stimulating hormone (released from the anterior pituitary) which peak during ovulation and then begin to fall right after and remain low during the development of the corpus luteum. The ovary also slowly releases estradiol during the development of the follicle and this peaks during ovulation after which there is a sudden cessation of estradiol excretion before it begins to be released again during the progression of the corpus luteum along with progesterone. 12  During the follicular phase, the thickening of the epithelium surrounding the oocyte results in the formation of cuboidal granulosa cells and a Zona pellucida forms between the oocyte and these granulose cells. Granulosa cells then proliferate and form a multi-layered capsule around the oocyte. Any of the follicles that succeed (most regress and die) take up fluid and develop an antrum cavity. The first meiotic division is completed toward the end of this phase and the oocyte becomes known as a secondary oocyte and transitions into the second round of meiosis. Ovulation occurs when the ovarian wall ruptures and expels the secondary oocyte into the peritoneal cavity. The oocyte does not complete the second round of meiosis until it is fertilized. During the luteal phase, the granulosa cells proliferate to form the corpus luteum which in turn secretes progesterone and estrogen. These hormones prepare the endometrium for implantation; if fertilization does not occur, the corpus luteum begins to degenerate and forms the corpus albicans. However, in cases where fertilization does occur, the developing placenta quickly secretes human chorionic gonadotrophin (hCG) preventing the corpus luteum from degenerating and thus allowing further hormone secretion. After about 6 weeks, the placenta is developed well enough to take over hormone requirements. Hormones released during ovulation are at the root of the menstrual process. Both follicle stimulating hormone (FSH) and luteinizing hormone (LH) are produced by the anterior pituitary and are under the control of the gonadotrophin releasing hormone (GnRH) secreted by the hypothalamus (Welt et al., 1997). These two hormones promote follicular growth. The growing follicle itself also begins to secrete estrogen which has a negative feedback effect on the anterior pituitary signalling it to lower FSH and LH output. As estrogen secretion by the dominant follicle increases, however, it promotes GnRH production and results in a sudden 13  increase of LH and FSH during ovulation. This burst of hormones is what stimulates the completion of the first round of meiosis in the developing oocyte. When ovulation occurs, the LH levels promote the formation of the corpus luteum which then in turn begins secreting progesterone and estrogen (Stocco et al., 2007). These hormones once again cause the negative feedback loop on the anterior pituitary and thereby inhibit to production of FSH and LH. This causes the degeneration of the corpus luteum which in turn causes the cessation of progesterone and estrogen. The progesterone and estrogen re-establishes LH and FSH levels and a new cycle begins.  It is vital that these hormones work properly to orchestrate this process as  insufficiencies lead to female infertility.  It is believed that bypassing this process using  unnatural means can also lead to problems in the developing oocyte as will be discussed below.  1.2.2.2 Male infertility Male infertility is diagnosed based on sperm parameters. The World Health Organization (WHO, 1999) has developed an evaluation criteria for diagnosing infertile men based on sperm parameters (concentration, motility and morphology). Oligozoospermia is diagnosed when there is a sperm concentration of less than 20 x 106 per millilitre, and normal sperm motility and morphology. The severity of oligozoospermia depends on the concentration of sperm and can range from very severe (less than 1 x 106 per millilitre) or moderate (5-20 x 106 per millilitre). Asthenozoospermia is diagnosed when less than 50% of the sperm are motile. Teratozoospermia is diagnosed when less than 30% of sperm have normal morphology. And finally, men with no sperm in ejaculate are said to have azoospermia. Azoospermic men can, however, have sperm present in the testis depending on the pathology of the condition; in obstructive azoospermia,  14  sperm is produced but is not allowed into the ejaculate while in non-obstructive azoospermia, no sperm is produced. Normal sperm parameters are achieved when the sperm concentration is greater than 20 x 106 per millilitre, motility of greater than 50% and which has greater than 30% normal sperm morphology. Causes of male infertility can be either nongenetic or genetic; nongenetic causes include hormonal problems, systemic diseases or conditions such as varicocele while genetic problems are due to chromosomal abnormalities, genetic diseases, and Y-chromosome microdeletions. Unfortunately, the cause of male infertility is unknown in about half of men who experience infertility (de la Celle et al., 2001).  1.2.2.2.1 Non-genetic causes of male infertility There are many non-genetic problems that can lead to male infertility. Systemic diseases such as hypothalamic or pituitary disease can cause deficiencies in either gonadotropin-releasing hormone (GnRH) or gonadotropin itself (hypogonadotropic hypogonadism) which is linked to infertility (Spratt et al., 1987). Hormonal problems have also been linked to infertility problems in men. Androgen excess, estrogen excess and glucocorticoid excess have all been associated with male infertility (Freeman, 1991; Veldhuis et al., 1987, MacAdams et al., 1986). Varicoceles is also a common cause of infertility; it is characterized by the dilation of the pampiniform plexus of the spermatic veins in the scrotum usually due to defective valves (Howards, 1992). Infertility most likely ensues as a result of the warming that occurs in the testis; such changes in temperature disrupt proper spermatogenesis.  15  1.2.2.2.2 Genetic causes of male infertility Genetic problems associated with male factor infertility include chromosome abnormalities,  genetic  diseases,  and  Y-chromosome  microdeletions.  Chromosomal  abnormalities can be either somatic and found in the autosome and sex chromosome, or they can be meiotic and found in the germ line (sperm). Autosomal chromosomal abnormalities include aneuploidy, balanced structural rearrangements, inversions, supernumerary marker chromosomes and rings (Gekas et al., 2001) ) and have been found at a higher frequency in infertile men compared to the general population (Rives et al., 2003). Sex chromosome aneuploidies are found in a substantially higher percentage of infertile men as compared to men in the general population (Gekas et al., 2001; Kirkpatrick et al., 2008) with Klinefelter syndrome (47, XXY) being the most common abnormality (Foresta et al., 1998). Infertile men with a normal somatic karyotype can have chromosomally abnormal sperm. A higher incidence of chromosome abnormalities in the sperm affecting the autosomes and the sex chromosomes has been found in infertile men (Ferguson et al., 2007; Tang et al., 2004; Shi and Martin, 2001; Levron et al., 2001). Y chromosome microdeletions are recognized as an important genetic cause of azoospermia and severe oligozoospermia (Ferlin et al., 2007). Vogt and colleagues (1996) were the first to isolate specific regions on the Y-chromosome that they saw as being especially important in male fertility; they named these regions azoospermia factor A, B, and C. Genes represented in these regions include DAZ, YRRM, DFFRY, RBM1 and SPGY (Reijo et al., 16  1996; Vogt et al., 2005; Brown et al., 1998); these genes are not only involved in spermatogenesis, but also regulate RNA metabolism of other spermatogenesis genes not found in the AZF regions. Genes such as the DAZL gene which is an autosomal homolog of the DAZ gene cluster and have shown to be an important regulator of spermatogenesis (Teng et al., 2006; Tung et al., 2006). Deletions in the AZFa region are often associated with Sertoli-cell-only syndrome where only Sertoli cells are present (without germ cells) in the ejaculate. Though these patients produce ejaculate, there are no sperm cells present and they are therefore infertile. AZFb deletions are associated with arrest at the spermatocyte stage, and depending on the degree and stage of spermatocyte arrest, these patients may show differing severity of infertility characterized by oligozoospermia (McElreavey et al., 2006). Finally, AZFc deletions show variable pathology from Sertoli-cell-only syndrome to hypospermatogenesis. AZF deletions are the most common deletions and represent the largest, well-defined recurrent deletion in the human genome (Kuroda-Kawaguchi et al., 2001).  Oligozoospermia and azoospermia are not  the sole consequence of Y-chromosome microdeletion. Recent research has shown that Ychromosome deletions were found in men with testicular dysfunctions such as cryptochidism, varicocele and obstructive problems in the vas deferens (Krausz et al., 1999; Foresta et al., 1999).  Y-chromosome deletions, therefore, can give rise not only to problems with  spermatogenesis, but to abnormalities in the proper testicular function and development.  17  1.2.3 Assisted reproductive technologies (ARTs) Assisted reproductive technology (ART) refers to the various different techniques used to help infertile couples conceive. Of these, in vitro fertilization (IVF) and intracytoplasmic sperm injection (ICSI) are the most popular. It is estimated that more than 4% of children born today are conceived using one of these two methods (Bohlmann et al., 2009).  Although most  individuals born via these techniques turn out to be healthy, some negatives outcomes have been observed. Here we will talk about these two techniques in more detail while discussing the various negative pregnancy outcomes associated with both IVF and ICSI.  1.2.3.1 In vitro fertilization (IVF) In vitro fertilization (IVF) is one of the first successful assisted reproductive technologies developed for couples suffering from infertility. The technique involves ovarian stimulation by a combination of fertility medications followed by subsequent oocyte aspiration from the ovarian follicles. These oocytes are then fertilized after being incubated with multiple sperm in Petri dish; the resulting fertilized embryo is then transferred into the uterine cavity. This technique was developed over thirty years ago (Steptoe et al., 1976) and has been used ever since as the technique of choice for individuals suffering from both female and male factor infertility.  18  1.2.3.1.1 Concerns with IVF Pregnancies procured via IVF are associated with an increased incidence of several complications.  These complications include: multiple gestation, monozygotic multiples,  preclinical pregnancy loss, congenital malformations, preterm birth, low birth weight and imprinting disorders.  Although none of these conditions have a strong enough and direct  correlation with IVF as to cause cessation of the procedure in society, they are still important to monitor as possible consequences of ART and merit further investigation. Of these conditions, low birth weight and imprinting disorders are of especial importance to us and will be addressed in detail in the following chapters. The higher incidence of multiple gestation and monozygotic multiples has been associated with the transfer of multiple embryos in IVF. Even though IVF accounts for around 2% of all births in the United States, it accounts for over 18% of all multiple births (Adamson et al., 2006). These multiple births have been associated with health issues and many times one of two twins is lost during pregnancy resulting in a singleton pregnancy.  The increase in  monozygotic multiples is thought to be due to the in vitro culture media used and to the embryo manipulation that is performed during the IVF procedure (Schieve et al., 2000; Steinman et al., 2003). Furthermore, it has been suggested that IVF may lead to preclinical pregnancy loss which refers to the reproductive loss that occurs between the time of implantation and the onset of menses (Coulam et al., 1998; La Sala et al., 2004; Kovacs et al., 2004); there is again no clear correlation between IVF and preclinical loss because the high rates of these losses in IVF may be due to the high proportion of singletons (as mentioned above) that result from vanishing twins (Pinborg et al., 2005). Further research must observe an adverse effect from early spontaneous  19  loss of one of two twins to establish whether or not the IVF procedure is the reason for many of these losses. Congenital malformations have been investigated in infants born via IVF (table 1.1). Rimm et al. (2004) performed a meta-analysis from 16 different studies, involving 28,524 IVF infants and compared these to 2,520,988 controls. The group found an odds ratio of 1.51 for congenital malformations in singleton IVF babies. Another recent study out of Japan found a significant increase in the rate of malformations in IVF patients (7.4%) compared to natural controls (2.1%) (Kuwata et al., 2004). Although these studies show a clear concern, it is not clear what genetic or epigenetic processes are at the root of these malformations. Table 1.1 Studies comparing congenital malformations between IVF and control infants Study Verlaenin et al., 1995 Palmero et al., 1996 D’Souza et al., 1997 Wennerholm et al, 1998 Bowen et al., 1998 Westergaard et al., 1999 Pinborg et al., 2000 Anthony et al, 2002 Hansen et al., 2002 Merlob et al., 2002 Isaksson et al., 2002 Zadori et al., 2003 Place et al., 2003 Olson et al., 2005 Bonduelle et al., 2005 Kuwata et al., 2004  IVF Cohort size Malformation rate (%) 140 0 1796 1.7 278 2.5 510 2.9 84 3.6 1913 4.9 3393 4.1 4224 0.7 837 9.0 964 9.5 1901 4.4 188 2.1 52 5.8 986 6.2 437 2.0 148 7.4  Control Cohort size Malformation rate (%) 140 0 297468 2.5 278 0 252 3.2 80 5.0 2228 4.6 10239 4.8 314605 0.5 4000 4.2 3775 1.9 345 3.5 188 0.5 59 5.1 6374 4.4 538 2.0 188 2.1  20  1.2.3.2 Intracytoplasmic sperm injection (ICSI) Intracytoplasmic sperm injection (ICSI) is a technique where a single sperm is injected directly through the zona pellucida into the cytoplasm of a mature oocyte. ICSI is more invasive than IVF, but it becomes the necessary treatment for infertility when there are extremely low sperm counts in the male partner. The first ICSI patient was conceived in 1992 (Palermo et al., 1992). Though ICSI provides a solution to couples suffering male infertility, it bypasses natural selection and procures children from sperm that would otherwise not have been able to fertilize the ooctye.  1.2.3.2.1 Concerns with ICSI ICSI has been associated with various complications including preterm birth, imprinting disorders, increased risk of monochorionic twins, congenital malformations, imprinting disorders, cystic fibrosis and chromosomal abnormalities.  Although these have all been  associated with ICSI, none of the studies looking at these effects have any clear and definite link between the ICSI procedure and any of these conditions. One limiting factor is the fact that most individuals conceived through ICSI are still relatively young and a lot of conditions that have late onset have as of yet probably gone unnoticed. Regardless, as researchers in the field, it is important to appreciate and understand each of the possible risks associated with ICSI as any observed genetic or epigenetic alternations may be influencing these complications. ICSI pregnancies have been associated with an increase in the risk of serious malformations including conditions affecting the heart, GI tract, kidneys and hypospadias. Although studies have identified an increased incidence of these abnormalities, no study to date 21  has identified the genetic cause. Congenital malformations may be life threatening and so will have a great psychological influence on the patients depending on the severity of the malformation. Although multiple studies have looked at malformations in ICSI (table 1.2), two important studies (one out of Australia and one out of Germany) compared a large sample group of both ICSI and natural conception pregnancies. The Australian group found a malformation rate of 8.6% in the ICSI group as compared to 4.2% in the natural conception group giving an odds ratio of 2.0 (95% CI, 1.3-3.2) for ICSI (Hansen et al, 2002). The German group confirmed these results finding a similar 8.7% malformation rate in ICSI compared to 6.1% in the controls with an odds ratio of 1.44 (95% CI, 1.25 – 1.65) for this population (Katalinic et al, 2004). These results have been supplemented with studies looking at older ICSI patients. One study evaluating 540 ICSI children at 5 years of age found an odds ratio of 2.77 (95% CI, 1.41-5.46) of major malformation in these children as compared to non-ICSI children (Bonduelle et al., 2005). This same group followed up and looked at these children at 8 years of age and found the ICSI group maintained the major congenital malformation rates, but did not show any increase in neurological defects at this age (Belva et al., 2007). The rate of congenital malformation in ICSI patients therefore merits further investigation into the genetic or epigenetic causes of these abnormalities.  22  Table 1.2 Studies comparing congenital malformations between ICSI and control infants Study Bowen et al., 1998 Westergaard et al., 1999 Sutcliffe et al., 2001 Hansen et al., 2002 Sutcliffe et al., 2003 Place et al., 2003 Katalinic et al., 2004 Bonduelle et al., 2004 Kuwata et al., 2004  ICSI Cohort size Malformation rate (%) 89 4.5 177 1.7 208 4.8 301 8.6 56 9.0 66 7.6 3372 8.7 300 6.3 84 13  Control Cohort size Malformation rate (%) 80 5.0 2228 4.6 221 4.5 4000 4.2 39 12.8 59 5.1 8016 6.1 266 3.0 188 2.1  Furthermore, monitoring and identifying chromosomal abnormalities is becoming increasingly important in patients born via ICSI (Chang et al., 1999). Many studies have shown both de novo and inherited chromosome aberrations in both the sex chromosomes as well as in the autosomal chromosomes (Lam et al., 2001; Ohashi et al., 2001). There are a few possible reasons for this.  First, the invasiveness of the ICSI technique may be causing increased  chromosome aberrations. Second, we must realize that subfertile men are more likely than fertile men to have chromosome abnormalities which they can then pass down to their children (Woldringh et al., 2009).  Large studies have shown that the rate of de novo chromosomal  abnormalities in ICSI offspring is threefold higher (1.6 versus 0.5 percent) than that seen in control cases (Bonduelle et al., 2002). Furthermore, another study showed that out of a group of 22 patients who inherited chromosome abnormalities, 17 of them were derived from the father (Pang et al., 2005) suggesting that paternally derived abnormalities are more common than maternally derived ones; this is an especially important finding when one considers the  23  significant amount of abnormalities present in men suffering from severe oligozoospermia or obstructive azoospermia. Fetal growth restriction and imprinting error associations with ART pregnancies are the conditions of most interest to us in this thesis. Studies have observed a small increase in late preterm birth and low birth weight in pregnancies conceived through ICSI and IVF (Schieve et al., 2002; Katalinic et al., 2004; Wang et al., 2005). Research has also suggested that there is a possibility of interference with genomic imprinting during germ cell development and preimplantation in infants born through ICSI (Nikolettos et al., 2006) which can lead to imprinting disorders.  The association between ART and both fetal growth restriction and  imprinting errors will be discussed in more detail in the forthcoming sections.  1.3 Epigenetics As its name suggests, epigenetics is a field of study that goes a level above our traditional view of genetics. Epigenetics deals with changes in phenotype or gene expression caused by factors that are independent of the DNA sequence.  These changes may remain through  subsequent cell divisions for the remainder of the cell’s life and may even be translated to later generations.  The process of cellular differentiation such as that observed early in human  development during which various pluripotent cell lines of the embryo differentiate into cells of different types is a prime example of the importance of epigenetics in multicellular organisms. Although every nucleotide and all genes in the genome have the potential to be transcribed (Birney et al., 2007), there are specific epigenetic marks that control the eventual expression of these genes and this results in cell-specific transcriptional programs that accounts for the 24  difference in cell activity. Each cell type in the body has its own epigenetic signature which reflects its genotype, environmental conditions and developmental history. These factors all contribute to the ultimate phenotype of the individual by influencing various epigenetic processes. The human cell contains over six billion base pairs which constitute its DNA and these base pairs can extend to over 2 meters (Annunziato, 2008); it is therefore important that organisms have a way of organizing their genome to account for such an extensive network of genes. This organization must also be flexible as situational access to genes that are incorporated in the sequence is important. Cells have therefore acquired the ability to compact their DNA into structures called chromosomes. This organization is achieved via processes that are collectively referred to as chromatin; this includes the DNA, histones and other proteins within the nucleus of the cell (Li and Workman, 2007). It is these chromatin elements that control the epigenetics of individuals as they determine which genes are accessible to certain transcription factors (TFs) and therefore allowed to be transcribed. Chromatin comes in two forms; in cases where DNA is accessible to TFs, the process is called euchromatin and in more compact cases where there is no access it is called heterochromatin. There must be an extraordinary control network that allows for differential expression of genes in all organisms. This control and specificity is achieved through epigenetic processes and differences between individuals and species have occurred due to epigenetic modifications which alter the degree of gene expression for each group. Epigenetic modification can take many forms and the molecular epigenetic mechanisms are very complex.  The main epigenetic processes are DNA methylation, histone tail  modifications, and non-histone protein chromatin binding (Bird, 2002; Li, 2002). These epigenetic modifications are maintained after the cell divides and although most epigenetic 25  changes are applied only during a specific individual’s life, certain modifications developed during gametogenesis in the sperm or egg cell can be passed on to the offspring of these individuals. Epigenetic mutations at these early reproductive stages can lead to human disorders associated with genomic imprinting which will be discussed below. These conditions can be serious and show the considerable influence deleterious epigenetic modifications can have on individuals. This thesis will focus on DNA methylation and its effect on gene expression.  1.3.1 DNA methylation Although epigenetics refers to processes which occur outside the control of the DNA sequence itself, these processes act on the individual’s DNA and regulate the expression of the myriad of genes found on the sequence. This modification can occur via one of two ways: either post translationally by acting on the amino acids that make up the histone proteins or by methylation of certain sites (mostly CpG sites) to convert cytosine to 5-methylcytosine. Although both of these processes are important, the latter is clearer to us and much easier to study; with the technologies available to us today, most epigenetic investigations look at methylation changes. There are a variety of factors involved in proper human methylation both during development and throughout successive cell divisions. DNA methylation occurs predominantly at cytosine residues present in CpG sites which are areas along the DNA where a cytosine nucleotide occurs next to a guanine nucleotide (Jones and Takai, 2001). Areas in the genome rich in CpG sites are referred to as CpG islands. Computers have allowed us to discover that the human genome has around 29,000 CpG islands (Lander et al., 200) and that 70% of human genes are associated with these islands (Yamashita et 26  al., 2005; Wang and Leug, 2004). Modifications at CpG sites are achieved by enzymes called DNA methyltransferases (DNMTs) which are conserved across animal and plant species (Law and Jacobsen, 2010). There are two types of DNMTs: there are those that are involved in de novo methylation which are patterns of DNA methylation that are developed early during the blastocyst formation and there are other DNMTs that are involved in maintenance that essentially maintain these methyl marks through successive cell divisions. Both these DNMTs will be discussed in further detail below when we talk about genomic reprogramming. Studies have shown how crucial these enzymes are as mice deficient in any of the DNMTs have had lethal phenotypic consequences (Okano et al., 1999; Li et al., 1992). The mechanism by which a methyl group is introduced and incorporated into the DNA strand is complex and involves various different molecules and enzymes (figure 1.4). Methyl groups are initially picked up by the cell from its environment through the incorporation of the important amino acid methionine (Selhub and Miller, 1992). Methionine, in most cases, is introduced first through an individual’s diet before being picked up by the cell; during the early stages of development, however, the levels of methionine depend greatly on the mothers who are bearing the developing embryo. Once taken up by the cell, methionine is converted to Sadenosyl-methionine after reacting with ATP through the catalytic work of methionine adinothyltransferase (Van den Veyver, 2002). It is this S-adenosyl-methionine compound that then transfers a methyl group to the cytosine of a CpG site to form 5-methylcytosine; this transfer is achieved through DNMT activity (Bestor, 2000). In humans, this 5-methylcytosine represents 1% of all DNA bases in the genome and is observed in 60-90% of all CpG dinucleotides (Nakao, 2001). Proper activity of all the enzymes and compounds mentioned are vital to proper epigenetic maintenance during all stages of life. 27  Figure 1.4 Simplified DNA methyltransferase mediated methyl-transfer pathway. Cells initially take in methionine from their environment. Methionine, once in the cell, reacts with ATP to make S-adenosyl-methionine through the action of the methionine adinosyltransferase enzyme. S-adenosyl-methionine retains the methyl group present in the original methionine compound. This methyl group is then transferred to the cytosine to form 5-methylcystosine at a CpG site within the individual’s DNA thereby methylating that particular site; this is orchestrated by the DNMT enzyme.  DNA methylation is an essential process which helps suppress the expression of sequences that represent certain transposable elements. The DNA methylation at promoter regions (which are rich in CpG sites) is correlated with condensed chromatin structure and  28  therefore results in gene silencing at that region by preventing TF access. Therefore most sites that are methylated result in gene expression suppression of the associated gene although this is not always the case as we will see when we discuss the H19 gene. This suppression of genes is impacted by DNA methylation by one of two ways: one way could be due to the physical impediment itself which prevents certain transcriptional proteins from binding to the gene in question or, alternatively, the methylated DNA may become bound by special proteins called methyl-CpG-binding domains (MBDs) which recruit a network of other proteins and subsequently alter the histones which then in turn silence the region by heightening compaction (Cedar and Bergman, 2009).  1.3.2 Gene expression The epigenetic processes we have discussed have an ultimate goal: to alter and control gene expression. Gene expression gives rise to the phenotypic products that all cells and therefore all individuals require to function. The DNA sequence itself merely contains the recipe for multiple products that differentiate all organisms and even all individuals from one another. Gene expression begins with transcription during which the sequence of a specific gene on the DNA strand is picked up and recreated via a RNA strand. This RNA blueprint is then used by certain elements within the cell to create a protein product in a process called translation (figure 1.5).  29  Figure 1.5 Simplified model of the gene expression process. During transcription, a specific region on the DNA is recognized by RNA polymerase and certain transcription factors which leads to a specific RNA transcript. rRNA transcripts form ribosomal complexes while mRNA transcripts hold the sequence for a specific protein product. Incorporation of mRNA into the ribosomal complex is followed by the recognition of certain tRNA transcripts which have are recruited by the complex and which add amino acids to the developing polypeptide in a process termed translation.  Transcription is divided into five states: pre-initiation, initiation, promoter clearance, elongation and termination. During pre-initiation, RNA polymerase seeks a core promoter sequence within the DNA strand and binds to this sequence but only in presence of specific transcription factors; if these transcription factors are present and the RNA polymerase binds, the process reaches the initiation step. After binding to the promoter sequence, the RNA polymerase must first clear the promoter. During this step, the complex releases RNA transcripts until a transcription elongation complex forms and disallows the RNA polymerase from slipping and therefore prematurely releasing RNA transcripts (Goldman et al., 2009). During elongation, one of the DNA strands is used as a template strand for RNA synthesis as RNA polymerase transverses the strand and creates a complementary RNA copy that is exactly the same as the DNA strand with the exception that thymines are replaced with uracils and the nucleotides are composed of ribose sugars instead of deoxyribose sugars. The whole process is terminated once a specific terminator sequence is encountered in a process that is still poorly understood. This  30  finished RNA transcript then usually travels outside of the cell nucleus where it can be used as a template for protein translation or can be involved in other processes within the cell. If the RNA transcript is destined to be a protein template, it is referred to as messenger RNA (mRNA). Otherwise, these transcripts can be ribosomal RNA (rRNA) which serve to assemble the ribosomes that are responsible for organizing the mRNA translation, or transfer RNA (tRNA) which aid in the amino acid incorporation process during the translation. In translation, the mRNA product of transcription is decoded by the ribosomal complex to create the final amino acid chain.  Translation involves an initiation, elongation and  termination step. During the initiation step, there is an interaction of key proteins with special tags that find and bind to the 5’-end of the mRNA strand that then interact with protein factors bound to a small ribosomal subunit. The rest of the ribosomal complex is then recruited and initiation is complete when all the components of protein synthesis are in place.  During  elongation, the ribosome facilitates decoding by allowing the incorporation of tRNAs which have the complementary anticodon sequence to the mRNA strand. When the match is found, the tRNAs begin incorporating each amino acid specific to the codon thereby producing the polypeptide. When a specific stop codon is encountered, this process ends and the polypeptide separates from the ribosomal complex. This polypeptide is the product of gene expression and can act alone or it can be incorporated into other complexes to produce various protein products. Proteins created by this process end up in different parts of the cell and are even sometimes transferred outside of the cell to carry on other tasks. There are specific signaling sequences that direct the proteins to their required destination. Each organism is the product of these processes mentioned here and there is an astonishing level of control and direction involved. The exact function of most genes found in the genome is not known, and new 31  technologies such as northern blotting and real time quantitative PCR are giving us a better understanding of what these proteins do and how important they are for any given organism. In this thesis, we will try to develop a better understanding of just two gene products (H19 and IGF2) to see how they act and function in human placental tissue.  1.3.3 Genomic imprinting Genomic imprinting refers to the parent-specific expression of genes that occurs without changes in DNA sequence; certain alleles of a gene are silenced or imprinted, depending upon the parent of origin. Up to two hundred genes are estimated to be imprinted in the human genome (Lucifero, 2004; Lueidi et al., 2007) and many of these genes have been shown to affect the expression of other genes up to several kilobases away from them (Spahn and Barlow, 2003). Because most imprinted genes are usually grouped together within clusters, they are able to share common regulatory elements (namely non-coding RNA elements and differentially methylated regions (DMRs)) and recently it was established that if these regulatory elements control more than one gene they should be referred to as imprinting control regions (or ICRs). Imprinted regions also possess an abundance of CpG islands (Paulsen et al., 2000) which are segments of DNA that are rich in cytosine and guanine nucleotides with studies showing a 40% increase in CpGs in these regions as compared to other regions in the DNA (Paulsen et al., 2000). It is the cytosine nucleotides that are methylated on one of the two alleles. Imprinting is established and maintained by DNA methylation at CpG sites along the individual’s genome and is important in embryonic and placental development (Miozzo and Simoni, 2002; Fowden et al., 2006) and consequently vital in proper mother-offspring 32  interactions (Isles and Holland, 2005). Recent studies have shown that altering embryo culturing conditions may affect DNA methylation; loss of DNA methylation at imprinting genes in the placenta was associated with reduced fetal growth in mice (Mann et al., 2004). Similar results have been found in humans where ART has previously been associated with a higher incidence of imprinting syndromes such as Beckwith-Wiedemann and Angelman Syndrome (Maher et al., 2003) which will be discussed below.  Because ART conceptions experience changes in  culturing conditions and because men who have severe infertility are at a higher risk of carrying imprinting errors in their sperm (Marques et al., 2004; Marques et al., 2008; Kobayashi et al., 2007) we suspect changes in both methylation and expression of these imprinting genes in the ART group. To address this it is important to first develop an understanding of a specific tissue type and specific imprinting genes which are to be investigated. In this case, we are looking at imprinting errors in H19 and IGF2 in human placental tissue to address the increased incidence of growth and developmental delay in our study group.  1.3.3.1 Imprinting disorders, Beckwith-Wiedemann syndrome and ART The proper development and maintenance of imprinted genes is an intricate process and not very well understand to date. Imprinting diseases are associated with multiple abnormalities including epimutations, uniparental disomies (UPD), deletions of a imprinting regulatory region, translocations, point mutations or microdeletions in imprinting regions (Walter and Paulsen, 2003). Despite our limited knowledge on the exact mechanisms involved in proper maintenance of imprinted genes, studies have been able to associate certain human disorders with problems at specific imprinting genes (table 1.3).  Of the major imprinting disorders and the one that  33  interests us the most is Beckwith-Wiedemann syndrome (BWS) which has been associated with H19 and IGF2 abnormalities (Weksberg et al., 2005) and with ART (DeBaun et al., 2003; Maher et al., 2003; Gicquel et al., 2003; Holliday et al., 2004). Table 1.3 Common human disorders due to imprinting defects. Disorder  Angelman Syndrome (AS) BeckwithWiedemann Syndrome (BWS) PraderWilli Syndrome (PWS) SilverRussell Syndrome (SRS)  Major phenotypic abnormality Neurological problems  Loci affected 15q1113  Major genes involved UBE3A  Pathogenesis  Prevalence  UPD; translocation; single gene mutation CDKN1C, UPD; IGF2, H19, translocation; KCNQ1OT1 duplication  1/20,000 – 1/12,000  1/15,000 – 1/13,000  Overgrowth, increased cancer risk  11p15.5  Hypotonia, obesity, lethargy  15q1113  SNRPN, multiple SnoRNAs  UPD; deletion  1/25,000 – 1/10,000  Dwarfism, IUGR, hypoglycemia  7p11.2, 7q32  GRB10, PEG1,  UPD; inversion, duplication  1/100,000 – 1/3,000  The most common cause of imprinting disorders are primary and secondary epimutations. Primary epimutations are ones that have occurred in the absence of DNA methylation while secondary epimutations occur as a direct consequence of DNA mutations in the genome (Horsthemke, 2006); of these two mutations, primary epimutations are more common. Both mutations can occur at different stages of human development and result in three different imprinting defects (figure 1.6). Imprinting erasure defects occur in the primordial germ cells after a failure to erase maternal imprints on the male primordial germ cell (leading to the sperm carrying a maternal imprint on a paternal chromosome) leads to a zygote carrying two maternal 34  imprints after fertilization. Defects in imprinting establishment can occur in germ cells as well when maternal imprints fail to develop during oogenesis and pass this defect on to the zygote which ends up lacking a maternal imprint. Finally, imprint maintenance defects can occur during the development of the embryo itself; this can occur in any somatic cell and is usually only serious when it occurs during global DNA demethylation periods and results in somatic mosaicism (Nazlican et al., 2004). Any of these can lead to activation of an allele that should actually be silenced, or, conversely, they can lead to the silencing of an allele that is supposed to be active. Both of these scenarios lead to improper dosages of whatever gene is in question which can, depending on the gene, have an adverse phenotypic consequence. Beckwith-Wiedemann syndrome is a heterogeneous congenital overgrowth disorder that is characterized by a variety of symptoms including macroglossia (large tongue), nephromegaly, abdominal wall defects, macrosomia (large birth weight) and neonatal hypoglycemia (low blood sugar after birth) among others (Elliot et al., 1994). BWS has also been associated with various types of tumors including carcinomas, blastomas and sarcomas (Wiedemann, 1983; Junien, 1992). It is shown to affect 1/13,700 of births (Thorburn et al., 1970; Engstrom et al., 1988) and is pan-ethnic, occurring with equal frequency in both females and males (Pettenati et al., 1986). BWS can occur due to both primary and secondary epimutations, although the latter of these is only seen rarely in BWS cases (Weksberg et al., 2005). Regardless of the mode of mutation, all BWS cases are common with regard to the region and genes that are affected. BWS patients all have alterations (either genetic or epigenetic) within regions containing important regulatory genes on the short arm of chromosome 11 (Weksberg et al., 2003); more specifically, changes have been seen within an imprinting control region (ICR1) which regulates H19 and IGF2 (Weksberg et al., 2005) along with changes in another region (ICR2) which controls CDKN1C 35  and KCNQ1OT1 expression (Weksberg et al., 2002). BWS patients therefore have alterations in the expression of these genes resulting in abnormal dosages of each gene product. Of the genes affected in BWS, H19 and IGF2 are thought to be more important (Weksberg et al., 2005) and both of these genes will be discussed in further detail below. Beckwith-Wiedemann syndrome has also been associated with assisted reproductive technologies by various groups (Maher et al., 2003; DeBaun et al., 2003; Gicquel et al., 2003; Holliday et al., 2004).  A study in England found ART-conceived patients had a threefold  increase chance of having BWS as compared to the naturally-conceived population (Maher et al., 2003). Another study comparing the rate of BWS in ART patients in the United States found the same six fold increase (DeBaun et al., 2003). A third study out of France found a threefold increase in BWS in ART patients (Gicquel et al., 2003) matching the English data. The studies have shown a strong link between ART and BWS that cannot be ignored. With this correlation established, the next thing we must look at are the genes affected in BWS to see if these same genes are also mal expressed in the ART population.  36  Figure 1.6. Schematic of genomic imprinting and possible imprinting defects. After being erased during the primordial germ cell stage, imprints are reestablished during gemetogenesis and continue on to zygote and embryo stages in development (outlined in the black rectangle). However, defects can arise during the primordial germ cell stage (imprint erasure), during the germ cell stage (imprint establishment defect) or during the embryonic cell stage (imprint maintenance defect). Blue lines represent chromosomes from the father while pink represents those from the mother.  1.3.3.2 Imprinting genes H19 and IGF2 H19 and IGF2 are two important genes that involved in early human development and lie about 70 kilo base pairs apart on the short (p) arm of chromosome 11. H19 is maternally expressed and paternally imprinted while IGF2 is the opposite: paternally expressed, and maternally imprinted. Although the exact role of these two genes is not properly understood, the H19 gene is thought to encode for a RNA transcript that is important in embryonic development (Brannan et al., 1990) while IGF2 is believed to encode for a mitogen that is important in the development of the placenta which is subsequently vital to proper fetal development (Tanos et al., 2004). It is believed that these two genes are controlled through the methylation activity of a region that sits between them and most studies looking at H19 and IGF2 activity have focused on this region to predict expression. The mechanism by which H19 and IGF2 are controlled is not properly understood, but there has been a general consensus that there is a differentially methylated region (DMR) between them that is at the heart of their control; methylation of this DMR prevents a CCCTCbinding factor from binding to the region which ultimately dictates which gene (H19 or IGF2) is expressed (figure 1.7). There has been some debate about how exactly differential enhancer promotion of IGF2 and H19 works, but studies looking at the same genes in mice had proposed a looping model (figure 1.8; Murrell et al., 2004). In the maternal allele, the CTCF protein bound to ICR1 interacts with complexes associated with the DMR1 region nearby which creates a loop structure that keeps IGF2 promoters well away of the enhancers and allows the enhancers to interact with the H19 promoters and thereby cause expression of the H19 gene. In the paternal allele, however, the methylated ICR1 region associates with complexes at another region (DMR2) which creates another loop that positions the IGF2 promoters close to the enhancers;  this causes the expression of IGF2. Although this is the widely accepted regulation model for these two genes, studies have questioned its effectiveness at predicting the expression of these two genes. One study has found that certain post-translational poly ADP-ribosylation of the CTCF protein are a significant determinant of expression as interruptions in these modifications have shown maternal expression of IGF2 regardless of CTCF binding (Yu et al., 2004). Furthermore, earlier studies have predicted that the H19 expressional product itself may in turn be affecting the expression of IGF2 (Forne et al., 1997; Wilken et al., 2000) which adds another layer of complexity to this system that most research has recently been ignoring. These findings suggest that although the proposed model is a good indicator of expression of H19 and IGF2, there are other factors that can be indirectly influencing the expression of these two genes that one must consider when making any conclusions and correlations between DMR methylation and expression levels. Previous studies looking at mice have found that the methylation patterns in these two genes are sensitive to changes in culturing conditions (Mann et al., 2004) which becomes especially important for our ART population who experience unnatural embryo culturing conditions in vitro prior to the transfer of the blastocyst into the mother’s uterus. It is thought that changes in culturing conditions may lead to changes in the methylation at the DMR and thus to changes in the expression of these two important genes. Other studies have supported this by showing that disruptions of imprinted genes in mice (including IGF2) lead to placental insufficiency and IUGR in the subjects (Constancia et al., 2002). These studies will be revisited when we discuss fetal growth restriction.  39  Figure 1.7 Simplified schematic of the proposed H19 and IGF2 regulation model. H19 and IGF2 are adjacently located on chromosome 11p15 in humans and have about 100kb of sequence between them. The expression of H19 and IGF2 is controlled by a differentially methylation region between the two genes which regulated the interaction between enhancers and promoters of the genes. When this DMR region is unmethylated, the CCCTC-binding factor is able to bind to the region and in turn blocks the interaction of enhancers within the promoter region of IGF2. When methylated, the binding protein is unable to bind and the enhancers are allowed to act on the IGF2 promoter.  40  Figure 1.8. Looping model of H19 and IGF2 control. H19 expressed in the maternal allele is acted upon by the nearby enhancer in the absence of IGF2 promoters. In the paternal allele, IGF2 is situated closer to the enhancers and is acted on by them. The differences in maternal and paternal allele is achieved due to the differential methylation status of ICR1. In the maternal allele, the CTCF protein binds to the unmethylated ICR1 region and recruits and interacts with complexes in the DMR1 region and thereby distances the IGF2 gene from the enhancer. In the paternal allele, the methylated ICR1 region interacts with complexes on the DMR2 region and thereby loops the chromosome and in so doing situates the IGF2 gene near the enhancer which consequently promotes IGF2 expression.  41  1.3.4 Genomic reprogramming Genomic reprogramming refers to the genome wide loss and subsequent reestablishment of methylation from primordial germ cell to blastocyst formation; the genome undergoes two rounds of DNA demethylation during this period before undergoing de novo methylation during gametogenesis and preimplantation (Okano et al., 1999). The loss of methylation in primordial germ cells is followed by both sex-specific DNA methylation establishment at imprinted genes and non-specific methylation at non-imprinted genes. When methylation again declines after fertilization from maternal and paternal genomes, it is believed that the methylation is still maintained at the imprinted genes which evade this demethylation cycle. Therefore, there are multiple important periods of methylation establishment both pre-fertilization during gametogenesis and post-fertilization during blastocyst formation. DNA methylation and demethylation are under the control of a variety of DNA methyltransferase (DNMT) enzymes (figure 1.9). The class of DNMTs involved in maintenance are referred to as DNMT1 while those involved in de novo methylation are DNMT3A and DNMT3B. In humans, DNMT1 has a high affinity for hemimethylated substratum and is responsible for the propagation and maintenance of DNA methylation during successive replication events. DNMT3A and DNMT3B, conversely, prefer unmethylated DNA and are the enzymes primarily responsible for establishing DNA methylation patterns early in development (Jones and Liang, 2009). The methylation patterns set by DNMT3A and DNMT3B are therefore maintained by DNMT1 through replication events. In instances where DNMT1 is absent, there is passive demethylation that occurs when the newly synthesized strands fail to be methylated. Recent studies have also predicted the occurrence of active demethylation that occurs after methylation is established (Kangaspeska et al., 2008; Métivier et al., 2008).  The exact 42  mechanisms involved in active demethylation are not properly understood but it has been proposed that the nuclear protein GADD45a is involved in catalyzing the process (Ooi and Bestor, 2008).  Figure 1.9 DNA methylation and demethylation mechanisms during early development. DNA methyltransferase 3A and 3B are the key enzymes involved in de novo DNA methylation during early development. These enzymes add methyl groups (shown above as yellow circles) to the DNA through the strand. When DNA replication occurs during cell division, these methyl groups are either maintained or not maintained depending on the presence or absence of DNMT1; the presence of DNMT1 maintains these methyl marks. When DNMT1 is not present during cell division, these marks are not maintained and the DNA will lose these methylation prints with successive rounds of replication and cell division which therefore results in passive demthylation of the DNA. Active methylation is also thought to occur whereby the once maintained methyl groups are lost through enzymatic replacement. This figure was adapted from a similar figure by Wu and Zhang, 2010.  43  1.3.4.1 Genomic reprogramming during gametogenesis Primordial germ cells are highly methylated before undergoing demethylation as they progress through the initial states of spermatogenesis. During the preleptotene to diplotene stages of spermatogenesis, there is a sex-specific reestablishment of methylation in imprinted genes; paternal imprinted genes in the male germ line experience de novo methylation while maternal genes during the same stages remain unmethylated. The paternal DNA methylation at imprinted genes is initiated at the prospermatogonia stage (Li et al., 2004) and is fully established prior to the initiation of meiosis in these cells (Kerjean et al., 2000). The maternal imprinted genes experience their de novo methylation during the oocyte transition where it proceeds to metaphase II before ovulation (figure 1.10). When both sperm and oocytes reach maturity, reprogramming is completed and DNA methylation is reestablished. At this stage the maternal oocyte is ready to be fertilized by the sperm and the imprints that were established during this reprogramming period are subsequently passed on to the offspring of these individuals.  44  Figure 1.10. Methylation reprogramming during gametogenesis. The genome-wide reprogramming of methylation patterns begin at the primordial germ cells after a significant demethylation period. These imprints are then reestablished during the development of the prospermatogonia or the growing oocyte each of which begins at different times depending on the germ line. Methylation is fully reestablished in mature gametes. This figure was adapted from similar figures by Reik et al., 2001 and Gosden et al., 2003.  1.3.4.2 Genomic reprogramming after fertilization After fertilization, starting with zygote formation moving on to the 8-cell morula, there is an initial demethylation of both paternal and maternal genomes (with the paternal drop preceding the maternal) followed by slight methylation during blastocyst formation (figure 1.11; Gosden et al., 2003). The paternal genome from the sperm begins reprogramming just after fertilization during which sperm protamines are replaced by acetylated histones promoting chromatin remodeling and subsequent genome wide demethylation while the maternal reprogramming occurs shortly after this process ends (Mayer et al., 2000). De novo methylation does follow the demethylation in the inner cell mass of the blastocyst and proceeds until the 16 cell stage of the developing embryo (Reik et al., 2001). There is heightened methylation in cells destined to 45  become part of the embryo itself as compared to the extraembryonic cells that make up the placenta and amnion. No details are known regarding the exact mechanism that causes these events nor do we have insight of the enzymes that help with the process.  Figure 1.11 Methylation reprogramming in preimplantation embryos. The paternal genome rapidly undergoes active genome-wide DNA demethylation shortly after fertilization and remains so following many rounds of cell division. The maternal genome undergoes demethylation in a passive mechanism that is dependant on DNA replication. Both genomes are remethylated at the time of implantation which differs depending on the lineage of the cells (embryonic or extraembryonic). The de novo methylation patterns during blastocyst formation are established by DNA methyltransferase enzymes. This figure was adapted from similar figures by Reik et al., 2001 and by figures and text from Wu and Zhang, 2010.  46  1.3.5 Epigenetic modification and ART Studies have shown that epigenetic modifications (or ―epimutations’) are at least one or two magnitudes higher than somatic DNA mutations (Bennet-Baker et al., 2003). Although there has been much research done on genetic risks in ART, only recently have we found heightened interest in epigenetic alterations. ART bypasses many biological filters including selective gamete reabsorption, sperm competition, and selective sperm update; it also exposes the developing gamete and early embryo to environmental stress such as hormones, physical stress, and culture media. It is therefore reasonable to think that these stresses can have an evident effect on these embryos especially considering how vulnerable and malleable these embryos are during these early developmental stages (Reik et al., 2001; Wilkins-Haug, 2008). In addition to problems that may arise during development of the embryo, research has shown that the maternal genome may itself be vulnerable to imprinting and methylation defects after ovarian stimulation (which is performed for ART) and these defects can then be translated to the embryo (Hajkova et al., 2002; Obata et al., 1998). The accumulation of all the unnatural stressors that an ART conceptus experiences early on in development can lead to alterations in the epigenome of these developing embryos.  47  1.3.5.1 DNA methylation alterations in ART pregnancies Previous studies have looked at methylation patterns in individuals suffering from infertility. Three studies looked at oocytes of infertile women and found methylation defects in KVDMR1 (Geuns et al. 2007), hypermethylation at H19 (Sato et al. 2007) and hypomethylation in the LIT1 genes (Khoueiry et al. 2008). Furthermore, studies looking at sperm of infertile males found abnormal methylation of both maternal and paternal imprints (Sato et al. 2007). A more recent study looking at DNA methylation at 7 imprinted loci (H19, GTL2, PEG1, KCNQ1OT1, ZAC, PEG3 and SNRPN) in both ART aborted samples and in the sperm of their respective fathers found that any methylation defect found in the ART sample (which was observed in 7 of 17 samples) was also found in the sperm. This suggests that imprinting defects in the sperm may be especially important.  Finally, one study looking at methylation levels in  placenta found lower mean methylation levels in the placenta of ART children after performing illumine analysis of over 700 genes (Katari et al. 2009). These results show that imprinting errors are present in infertile couples and these errors can then subsequently be translated to the child; the child is also at risk of developing de novo imprinting errors because of the unnatural in vitro culturing conditions it experiences during a period that is vital for imprinting establishment and maintenance (Owen and Segars, 2009). Below we will discuss the two most probable culprits of de novo imprinting errors in ART conception.  48  1.3.5.2 Ovulation induction in ART and imprinting defects As discussed above, it is during ovulation that the maternal imprints are established after oogenesis (Owen and Segars, 2009). This is precisely why concerns have been raised regarding the induction process of ART procedures during which ovulation is induced in prospective ART mothers. This induction has already been linked to changes in DNA methylation of various imprinted genes in both women undergoing ART treatment and in mice who receive similar induction (Geuns et al., 2007, Sato et al., 2007). Although it is not known what exactly may be causing these defects, it is believed it may either be because oocytes that were not meant to be released are artificially induced to do so or because they are released before imprints are properly established.  Other studies suggest that the hormones administered during stimulation of  ovulation may be responsible for changes in imprinting observed in these superovulated oocytes (Anckaert et al., 2009, Market-Velker et al., 2010). In either case, it becomes important to investigate these defects in the ART population to see how they are affecting the various processes in pregnancies. H19 and IGF2 are two genes thought to be greatly affected by ovulation inductions. Changes in H19 methylation in metaphase I stage oocytes of superovulated infertile women have already been observed (Geuns et al., 2007); this study conducted methylation analysis of the ICR1 region during different stages of oocyte nuclear maturity as well as in sperm cells to find unmethylated patterns in oocyte that should have germline methylation imprints established. Another important study looking at IGF2 gene expression in the placental tissue of mice found that superovulation did in fact influence IGF2 expression in the placenta (Fortier et al., 2008). IGF2 expression was increased in the placenta following superovulation with embryo transfer suggesting it compromises oocyte quality and interferes with the maintenance of imprinting 49  during preimplantation development.  These observations merit the investigation of gene  expression of both H19 and IGF2 in human placenta of ART pregnancies to see if human development shows similar alternations.  Furthermore, these results merit more extensive  screening methods prior to ART treatment.  1.3.5.3 ART in vitro culture media and imprinting defects Because fertilization occurs in vitro in ART procedures, the embryo is initially subjected to culture media. In fact, an embryo is kept in the media for three to five days before being transferred to the uterus for implantation and it is precisely during these first five days that imprinting is maintained in these embryos (Owen and Segars, 2009).  Therefore there are  concerns that the unnatural media is affecting important imprinting mechanisms during blastocyst formation. It is believed methionine (which we have already discussed as being important in methylation establishment) is a critical factor in showing alternations in methylation in ART conceptions (Niemitz and Feinberg, 2004). Studies have already associated unnatural embryo culturing conditions with large offspring syndrome (LOS) in both cattle (Bertolini et al., 2002) as well as in sheep (Young et al., 2001). In the sheep study, this increase in weight was associated with changes in the expression of the IGF2R gene (Young et al., 2001). Similar studies looking at mice have found that in vitro culturing conditions influence the expression of both H19 and IGF2 (Khosla et al., 2001). It is believed that the placenta is the tissue most affected by these in vitro culturing conditions (Rivera et al., 2008). Looking at H19 and IGF2 gene expression in human placental tissue has yet to be done using reliable RNA preservation methods to determine if humans also show these significant alterations due to culture media.  50  1.4 Fetal growth restriction Fetal growth restriction is a serious condition that has been associated with perinatal mortality and morbidity (Barker, 1997; Malloy, 2007). There are various suspected causes of IUGR in pregnancies (Rizzo et al., 2009) and the condition has been linked to disease onsets later in life (Varvarigou, 2010; Claris et al., 2010). Different terms are used to define fetal growth restriction with intrauterine growth restriction (IUGR) and small for gestational age (SGA) being the terms most widely used in the US and Canada. The problem with this very serious birth complication is that there is no universally accepted definition or guideline. Many countries have different standards for defining fetal growth restriction. This makes the condition hard to investigate as comparisons may be impposible when different guidelines are used. Regardless of how fetal growth restriction is defined, there are underlying causes and consequences that are ultimately of concern. Fetal growth restriction has been linked to a variety of perinatal and postnatal complications and problems in individuals suffering from the condition (Malloy, 2007; Varvarigou, 2010).  Perinatal complications including hypoglycemia, encephalopathy, oxygen  deprivation and polycythemia (Resnik, 2002) have been noted in these individuals. Later onset complications in these individuals have also been noted and include insulin resistance, heart disease, seizures, attention deficit, decreased IQ and hypertension (Barker, 1997; Strauss, 2000; Resnik, 2002). The late onset complications are rarely stressed to parents with children suffering from fetal growth restriction; many parents believe getting through any initial complications during the first few weeks after pregnancy mark the end of the condition.  Further research is  needed to merit counseling parents for the possible long term effects of fetal growth restriction. 51  Genetic factors associated with fetal growth restriction have been found using population based intergenerational analysis; these studies have found that 30 to 50 percent of the variations in birth weight are due to genetic factors (Clausson et al., 2000; Svensson et al., 2006) while the other factors are most likely environmental (Lunde et al., 2007). The condition itself is thought to be heritable; infants born to mothers who suffered from fetal growth restriction at birth themselves have a two fold increase chance of experiencing the condition (Klebanoff et al., 1989). Furthermore, women who have had one child with fetal growth restriction have a higher risk of having subsequent children with the condition (Selling et al., 2006). The majority of abnormalities observed in fetal growth restriction appear to be due to problems in karyotype (Neerhof, 1995; Lin and Santolaya-Forgas, 1998).  There are various  different chromosomal abnormalities that have been associated with the condition including aneuploidy, chromosomal deletions, ring chromosomes, uniparental disomy, confined placental mosaicism and gene mutation (Gross, 1997; Abuzzahab et al., 2003). The genes that have already been linked to growth retardation are ADCY5, CCNLI, GCK, HN1beta (Freathy et al., 2010) and IGF-I (Walenkamp and Wit, 2008). A recent study looking at H19/IGF2 imprinting control found an association between these two genes and growth restriction (Bourque et al., 2010); they found reduced methylation of ICR1 is associated with IUGR and suggested reduction in placental IGF2 could be an adaptive response to restrict fetal growth in the presence of abnormal placentation or to the fetal growth retardation itself. Other studies have supported the idea that the placenta plays an especially important role in proper fetal development (Ananth and Vintzileos, 2006). As discussed above, the placenta is vital in proper human development and deficiencies in this organ have already been linked to IUGR (Laurini et al., 1994; Constancia et al., 2002; 52  Bourque et al., 2010). In this project, we try to see if abnormalities in the placenta are the cause of the increased growth restriction in ART infants. More specifically, we want to monitor changes in H19 and IGF2 which have already been established as important in human development (Brannan et al., 1990; Constancia et al., 2002; Tanos et al., 2004; Bourque et al., 2010) to see if the activity of these two genes in the placenta is somehow at the root of the increased incidence of fetal growth restriction in ART pregnancies. Before doing so, we must first develop a better understanding of the associations already made between ART and fetal growth restriction.  1.4.1 Fetal growth restriction and ART Associations have been made between ART techniques and intrauterine growth restriction (Schieve et al., 2002; Katalinic et al., 2004; Wang et al., 2005). No consensus has been reached with regard to the specific ART component that is at fault; it is not clear whether the ART procedures themselves are causing defects or whether it is the genetics of the infertile couple undergoing the technique that is at fault. One recent study has found that increased fetal growth restriction observed among infertile couples is not dependent on type of infertility treatment (Zhu et al., 2007) and suggests that infertility itself may be the leading cause of these heightened growth restrictions observed in this population. Although this observation is worthy of notice, the researchers fail to address the fact that subfertile couples who eventually succeed at becoming pregnant without treatment may have varying degrees of infertility and thus cannot be compared to the general ART groups. Wang et al., 2005 compliment these findings by noting that couples that are infertile due to female factors are at a higher risk of low birth weight  53  suggesting that maternal genetics play a key role in fetal development.  No study to date has  been able to determine with certainty why ART patients experience these higher rates of growth restriction. Population based analysis looking at 42,000 ART pregnancies conceived from 1996 to 1997 and 3 million natural births showed fetal growth restriction to be significantly more common in ART singleton pregnancies (6.5% vs 2.5%, 95% CI 2.4-2.7, relative risk 2.6) but not for ART twin pregnancies (Schieve et al., 2002). Furthermore, this same group found that preterm growth restriction was also higher among the ART singletons (6.6% vs 4.7%, 95% CI 1.3-1.5, relative risk 1.4).  This increased risk in low birth weight persisted even after  adjustments were made for maternal age, gestational age, and infertility causes. The most recent and largest mata-analytical investigation looking at low birth weight in ART conceptions found ART conceptions have a relative risk of 1.60 (95% CI 1.29,1.98) to experience low birth weight (<2500g) while having a relative risk of 2.65 (95% CI 1.83, 3.84) to have extreme low birth weight (<1500g) as compared to naturally conceived controls (McDonald et al., 2009). Again, although these strong associations between birth weight and ART have been made, no real consensus has been made regarding possible causes, although a few possible causes have been suspected. ART factors reported to affect growth include: origin of sperm used for fertilization, type of ovarian stimulation, number of embryos transferred, manipulation of gametes, luteal activity, use of frozen embryos, location of ART treatment and vanishing twin occurrences (Wennerholm et al., 2000; Jackson et al., 2004; Pinborg et al., 2007; Schieve et al., 2002; De Sutter et al., 2006). Of these predicted causes, the vanishing twin argument seems to be the strongest. Of all IVF singletons born, 10% have been shown to originate from twin gestation in early pregnancy 54  (Pinborg et al., 2005); these findings coupled with earlier findings showing that survivors of vanishing twin pregnancies are at higher risk of low birth weight (Dickey et al., 2002) may account for the increases in fetal growth restriction in ART pregnancies.  Other studies have  suggested that the socioeconomic status and parental anxiety of ART parents lead to higher rates of elective preterm delivery (observed to be 11.4 % in the ART group as compared to 6.7% control), but these groups were not able to attribute this to the fetal growth restriction (Jackson et al., 2004; Helmerhorst et al., 2004). Though these associations have been made with ART patients experiencing fetal growth restriction, no study has identified with certainty a specific component or set of components of ART treatment that cause these lower birth weights. Low birth weight in these patients is likely due to both parental factors (genetic or psychological) as well as treatment. Any research on the topic should consider both these factors in hopes that we can one day determine how important each of these influences are in causing fetal growth restriction.  1.5 Placental development and function Placental development is highly regulated and is crucial for normal fetal growth and development. The placenta serves as the interface between the mother and the developing fetus; it achieves this by preventing fetal allograft, by transporting and metabolizing nutrients and by providing necessary steroid and peptide hormones to the fetus. The organ itself is complex and consists of a few vital components (figure 1.12): the endometrium is connected to the maternal uterine wall and acts as the interface of exchange between fetus and mother. The umbilical cord connects to a highly vascularized chorionic villi layer that is the site of placental hormone production and the site where all fetal bound products are processed before being distributed. 55  Normal development and function of the placenta is essential for proper fetal growth and development as well as for the maintenance of a healthy pregnancy (Rossant et al., 2001); any disruption in these processes has serious consequences for the fetus. The development of the placenta occurs concurrently with that of the fetus; both begin shortly after fertilization as the the morula enters the uterus. Once in the uterus, the morula begins taking in uterine fluid and eventually transitions into a blastocyst with the appearance of an obvious hollow space called the blastocoel cavity. Further differentiation of the blastocyst leads to the creation of two types of cells: the inner cell mass cells (which will eventually lead to the development of the embryo) on the inside and the trophoblast cells (which will eventually form the placenta and fetal membranes) on the outside (figure 1.13). As the embryo progresses in its development, its oxygen and metabolic substrate demands begin to increase. The uterine secretions that the blastocyst utilizes soon become inadequate and so the blastocyst must implant itself in the uterine wall of the mother to attain these valuable and much needed resources. This invasion is achieved by the outer trophoblast cells and improper implantation has been reported to cause IUGR and pre-eclampsia (Brosen et al., 2002). It is vital that proper invasion take place to ensure a healthy pregnancy.  56  Figure 1.12. Schematic of placental tissue. The endometrium is connected to the maternal uterine wall and acts as the interface of exchange between fetus and mother. The umbilical cord connects to a highly vascularized chorionic villi layer that is the site of the major placental hormone production and the site where all fetal bound products are processed.  Figure 1.13. Differentiating cells of developing human blastocyst. The inner cell mass differentiates further to procure the fetus while the outer trophoblast cells eventually develop into the placenta and enshrouding amnion. 57  1.5.1 Trophoblast invasion Human trophoblast cells follow a differentiative pathway that leads to the development of highly invasive cells which penetrate into the maternal endometrium. As discussed, five days after conception, the 32-celled morula becomes a blastocyst which is a hollow ball of cells composed of an inner cell mass (which gives rise to the fetal and embryonic tissues) and an outer layer of trophoblast cells (Aplin, 2000) which become the placenta and amnion.  These  trophoblast cells play vital roles in implantation and placentation during human pregnancy. Before implantation occurs, the endometrium has to transform into a decidua in a process called decidualization. This process is thought to regulate subsequent trophoblast invasion and placenta formation by altering the expression of regulatory factors such as metalloproteinases, cytokines, surface integrins and other histocompatibility molecules (Lunghi et al., 2007). After the formation of the decidua, there is a short window of time during which blastocyst implantation can take place and where the blastocyst attaches to the uterine wall. This process depends on the interaction between adhesion molecules such as selectin, integrins and trophinins which are themselves expressed on both trophoblast cells and uterine epithelial cells (Aplin and Kimber, 2004).  Blastocyst implantation is controlled by levels of endometrial  chemokines and cytokines. Chemokines are thought to be responsible for the promotion of leukocyte migration to the decidua, while cytokines regulate the vascular processes of placentation (Lunghi et al., 2007). Once invasion is accomplished by these cells, they further differentiate to associate with spiral arteries and transform these narrow arteries to uteroplacental arteries. Proper invasion of trophoblast cells into the uterine wall is a highly controlled process. Defects in the process can lead to very serious problems such as preeclampsia, intrauterine growth restriction (IUGR) and miscarriage (Lyall, 2002). These conditions may arise due to 58  improper invasion of the spiral artieries which leads to both a lack of normal physiological adaptation of these arteries to pregnancy as well as to reduced blood flow into the intervillous space which in turn leads to hypoxia and ischemia.  To achieve successful invasion the  trophoblast cells must be highly proliferative and they achieve this by undergoing endoreduplication (Zybina et al., 2002), or by undergoing successive rounds of DNA synthesis without ceasing at mitosis.  1.5.2 Trophoblast differentiation It is during blastocyst implantation that cytotrophoblast stem cells fuse to form a nonproliferative multinucleated external layer. These cytotrophoblast cells can then give rise to either invasive extravillous trophoblast (EVT) cells or multinucleated syncytiotrophoblast cells (figure 1.14). The EVT cells invade the maternal decidua (the maternal uterine wall) beyond the endometrial/myometrial border and go through to the inner third of the myometrium (Benirscke and Kaufmann, 2000; Meekins et al., 1994); this intrusion establishes the flow of oxygenated blood to the placenta (Aplin et al., 1991) which becomes vital in ensuring a healthy pregnancy; it is crucial for these cells to work properly to ensure proper anchoring of the placenta to the decidua and the myometrium. The syncytiotrophoblast cells are also involved in developing maternal-fetal exchanges as well as ensuring proper placental endocrine functions.  It is  imperative that the EVT and syncytiotrophoblast cells are efficient and successful in their invasion for the proper development of the conceptus; inadequacies in these processes often leads to problems such intrauterine growth restriction (IUGR), preeclampsia and miscarriage (Lyall, 2002).  59  Figure 1.14 Cytrotrophoblast cell differentiation. Villous cytotrophoblasts first give rise to both syncytiotrophoblasts and extravillous trophoblast (EVT) cells. These EVT cells then specialize further to form both invasive EVT cells as well as proliferative EVT cells. The invasive cells are either interstitial or endovascular.  1.5.3 Placental function The human placenta has both metabolic and endocrine functions. Substrate and hormone production along with metabolism must be tightly controlled to ensure proper fetal growth and development.  Interactions between maternal blood and the intervillous space of the placenta  allows for the transfer of both nutrients and oxygen from mother to fetus while also allowing waste products and carbon dioxide transfer from the fetus back to the mother.  The placenta  must also evade the mother’s immune system as both fetus and placenta are regarded as a foreign allograft inside the mother.  With all these roles, it is important that the placenta function  properly during pregnancy as failure to do so would lead to problems in pregnancy such as growth retardation or even fetal death.  60  Metabolic function The metabolic functions of the placenta include synthesizing glycogen and cholesterol which the developing fetus uses as an energy source. Glycogen synthesis is dependent on the uptake of glucose from maternal circulation. This uptake relies on a series of enzymes and regulators including the enzyme glycogenin which is expressed along with GLUT-3 transporter in the endothelium, basal decidua, and extravillous trophoblast cells of the placenta (Hahn et al., 2001). Cholesterol is also very important for the fetus as it is used as a precursor for hormone production, namely estrogen and progesterone.  Although this need is met by maternal supply  early in development, the placenta itself is able to meet its own production needs in late gestation and stores it from placental fatty acid stores (Herrera et al., 2006). Protein metabolism is very important in the placenta and fetal demand rises throughout gestation; during the first 10 weeks of gestation, placental protein output is about 1.5 g per day but this rises to around 7.5 g per day by the end of pregnancy (Settle et al., 2004). As a consequence of protein metabolism, lactate builds up. This lactate is removed by L-lactate transporters that are active on the villous membrane of the placenta (Settle et al., 2004). Failure of any of these processes can have severe consequences to the developing fetus. Endocrine function The placenta also has important endocrine functions.  Because the placenta is not  innervated, it must rely on a humoral mode of communication when interacting with both mother and fetus.  There are two types of hormones released by the placenta: peptide hormones and  steroid hormones. The steroid hormones produced by the placenta are estrogen, progesterone and glucocorticoids. Peptide hormones include human chorionic gonadotropin (hCG), human  61  placental lactogen (hPL), cytokines, growth hormone (GH), placental growth factor (PIGF), insulin-like growth factor 1 and 2 (IGF1 and IGF2), VEGF and corticotropin releasing hormone (CRH).  These hormones are vital for both fetal and placental development during pregnancy;  IGF2 is the predominant growth factor here and acts by binding to IGF1 receptors and initiating a signaling cascade that induces cellular proliferation, survival and growth (Randhawa and Cohen, 2005). Both IGF1 and IGF2 are expressed in the developing conceptus starting from zygote formation and implantation until just before birth (Cohen and Rosenfeld, 2002). In mice, IGF2 and IGF1 knockouts exhibit growth retardation (of up to 40%) with IGF2 knockouts having the greater consequence suggesting that IGF2 also acts on other processes independent of IGF1 (Baker et al., 1993; Ludwig et al., 1996; Constancia et al., 2002).  IGF levels are very tightly  regulated (Allan et al., 2001) and are significantly influenced by fetal nutrition and insulin levels (Chard et al., 1994). Of the placental hormones released, these growth hormones seem to be especially important in both placental and fetal development (Constancia et al., 2002) and therefore become important in monitoring when looking at fetal growth restriction.  1.6 Rationale, hypothesis and objectives Infertility is said to currently affect over 15 percent of couples and this has led to an increase in ART procedures being performed with some western countries reporting a 4 percent ART birth percentage with this number rising dramatically each year (Bohlmann et al., 2009). Because of the widespread use of these techniques, it has become increasingly important that we look at any possible consequence to the children procured by these procedures. With the advent of new investigative technologies such as pyrosequencing and real-time quantitative PCR, we are 62  able for the first time to look at epigenetic alterations in these individuals. Our hope is that these epigenetic studies will shed light on an aspect of ART that previous genetic analysis could not explain; specifically, to we aimed to better understand the cause(s) of the higher than normal incidence of fetal growth restriction. The problem with epigenetic analysis is that there are still many aspects of epigenetic regulation and function that we do not fully understand.  To  investigate these changes we recruited both ART and control patients with the goal of investigating both DNA methylation at the ICR1 region and gene expression of H19 and IGF2 in the placental villi tissue for each of these patient. Since the successful application and use of in vitro fertilization (IVF) in the late 1970’s, the use of ARTs has steadily risen. The creation of intracytoplasmic sperm injection (ICSI) in the 1990’s also gave even more hope for infertile couples by allowing them to bypass even male factor infertility in which sperm are unable to fertilize without assistance. With changes in lifestyle over the past decade, however, there has been a significant rise in the use of ARTs in the US and Canada along with many parts of Europe. Both IVF and ICSI utilize unnatural culturing conditions and bypass many of the natural selective mechanisms in conventional human reproduction. IVF involves direct introduction of multiple sperm to oocyte in Petri dish along with specific media outside of the mother’s body.  ICSI has a more invasive element as it  involves direct injection of sperm into the oocyte. Fertilized embryo from both procedures are then implanted into the uterus on days three to five post fertilization. The unnatural and invasive elements of both ICSI and IVF could possibly be affecting proper genetic development and maintenance in the offspring conceived through these techniques. In our study, we look at two important imprinting genes involved in fetal development. Imprinted genes are expressed in a parent-of-origin manner and are subsequently well 63  maintained after fertilization. These genes first undergo genomic reprogramming to establish these imprints which starts with a global demethylation of the DNA in the primordial germ cells (Szabo et al., 2002) followed by a re-establishment of imprinting gene methylation which differs between male and female germ lines.  In males, this process is initiated during the  prospermatogonia stage and continues until the initiation of meiosis (Li et al., 2004).  In  females, de novo methylation is initiated during the oocyte transition where it proceeds into metaphase II just before ovulation. Studies have shown that loss of DNA methylation in the sperm is associated with male infertility (Oakes et al., 2007; Doerksen et al., 2000) and loss of methylation has subsequently also been associated with a decrease in fertilization rate (Boissonnas et al., 2010). Furthermore, sperm of infertile men have been associated with abnormalities in meiotic recombination and to changes in sperm aneuploidy (Ferguson et al., 2007; Kirkpatrick et al., 2008). These changes can be passed on to the conceptions achieved via ART; one study found abnormal methylation at the H19 DMR in abortuses from ART conceptions and traced the same defect to the sperm of the fathers (Kobayashi et al., 2009). It is not known if abnormal methylation at these sites always leads to an aborted fetus or if pregnancy can proceed in cases where methylation is less severely affected. It is believed that the superovulation in females undergoing ART may be disrupting proper genomic reprogramming (Geuns et al., 2007, Sato et al., 2007). Superovulation in mice has already been associated with imprinting errors (Anckaert et al., 2009, Market-Velker et al., 2010). Furthermore, there may also be imprinting errors at the heart of the female infertility and these errors could be translated onto the child; studies have observed changes in DNA methylation in the oocytes of females suffering from infertility (Pellestor et al., 2006) and it is 64  believed that maternal age and in vitro maturation are important factors here (Nicolaidis and Peterson, 1998) which becomes worrisome considering individuals undergoing these in vitro procedures are older than the average age of pregnant women. The in vitro maturation of superovulated oocytes has been associated with abnormalities of the H19 imprinted gene (Borghol et al, 2006). In mice, the IGF2 gene was also shown to be affected after superovulation with the greatest degree of expressional change observed in the placental tissue (Fortier et al., 2008). Concerns about the consequence of the in vitro environmental conditions on the expression of H19 and IGF2 in ART pregnancies originally started when studies found that changes in culturing media caused changes in the methylation of these two genes in mouse placenta (Mann et al., 2004).  The same researchers found that the site most affected was at  CTCF-binding site in the differentially methylated region (DMR) between H19 and IGF2 (Szabó et al., 2004). Because ART conceptions experience in vitro conditions during a period where imprinting is shown to be vital (Owen and Segars, 2009) and because imprinting errors at the heart of the parental infertility may be transferred to the offspring, we became interested in looking at epigenetic defects in this region in the ART group. The H19 and IGF2 region also interested us because of their predicted roles in pregnancies; studies have postulated that H19 encodes for a RNA transcript that is important in embryonic development (Brannan et al., 1990) while IGF2 has been shown to encode a member of the insulin family of polypeptide growth factors that is involved in development and growth (Tanos et al., 2004). We thus predicted that these two genes may be at the root of the increase in IUGR in ART conceptions observed in various studies (Olivennes et al., 1993; Helmerhorst et al., 2004; Pinborg et al., 2005). These thoughts therefore lead us to our objectives and hypotheses: 65  o Hypothesis 1 -  ART pregnancies show alterations in DNA methylation at the distal end of the ICR1 region in placental villi tissue as compared to natural conception pregnancies.    Objective 1 -  To investigate changes in DNA methylation at the ICR1 region between genes H19 and IGF2 in human placental villi tissue attained from IVF, ICSI and naturally conceived pregnancies. This will allow us to see if methylation defects at the heart of parental infertility or the in vitro environmental exposure experience by both ART procedures cause any subsequent DNA methylation defect in the placenta.  o Hypothesis 2(a) -  ART pregnancies show alterations in DNA methylation at the distal end of the ICR1 region in placental villi tissue as compared to natural conception pregnancies.  o Hypothesis 2(b) -  ART pregnancies show changes in H19 and IGF2 gene expression in placental villu tissue as compared to natural conception pregnancies.    Objective 2 -  To investigate the H19 and IGF2 gene expression in human placental villi tissue attained from IVF, ICSI and naturally conceived pregnancies. We aim to see if 66  there are any changes in gene expression independent of methylation at these sites in human placenta. Concurrently, we are interested to see if the ICR1 methylation levels observed in objective 1, correlate with H19 and IGF2 expression levels as predicted by the proposed regulation model.  67  CHAPTER 2: MATERIALS AND METHODS Placental samples from IVF, ICSI and naturally conceived patients were collected and investigated for changes in DNA methylation and gene expression. DNA methylation was measured using pyrosequencing looking at the ICR1 region between the H19 and IGF2 genes. Gene expression levels were measured and quantified for each RNA sample using real-time PCR. Tissue was differentially processed for each of these procedures and caution was taken to ensure reliable sample quality. Samples that failed to meet our criteria were excluded from this study.  2.1 Patient recruitment and sample collection Patients for this study were recruited through a variety of methods which include: poster recruitment, infertility clinic referral through cooperation from various clinics in Vancouver, and via scheduled caesarean section patient recruitment whereby patients were told about the study prior to going into the operating room for caesarean section. IVF, ICSI and naturally conceived patients were recruited mostly from the Greater Vancouver area and an attempt was made to match all groups with regards to maternal age, gestational age and mode of delivery. Natural conceived patients had no history of infertility and were not included if they had any serious pregnancy complications; these patients achieved spontaneous pregnancies and did not undergo any infertility treatment of any sort. Written consent was attained in advance from the mother and father of each test patient prior to birth. Placental samples were collected within 30 minutes of delivery for cases that were analyzed for RNA expression and usually within one 68  day for those which were only investigated for methylation changes. Depending on what was being investigated, samples from each tissue underwent different preparation (figure 2.1) For cases destined for RNA investigation, a researcher was always called in prior to birth and set up outside the birthing room or operating room (depending on the mode of delivery). The placenta was handed over to the researcher right after its delivery and whole villi samples were collected from three sites of the placenta. In some cases, the placenta was transported to the laboratory before biopsy but this transport never surpassed five minutes.  These samples  consisted only of placental chorionic villi tissue and precautions were taken to extract only this tissue type as contamination with the extra-villous trophoblast layer which has maternal endothelium would compromise the results. A circular incision was made on the umbilical side (on the chorionic plate) to separate the plate layer from the chorionic villi layer; a piece was then extracted from the villi layer only. A sample of around 50 mg from each site was put in 2.5 ml of RNAlater® solution (Sigma-Aldrich Canada Ltd, Oakville, ON) and another sample of around 100 – 400 mg was put in regular tubes without treatment.  Samples in RNAlater® were  incubated at -4°C for 24 hours and then put in -80°C for storage before RNA extraction. Placental weight was determined usually before biopsy except in cases where tissue was being collected for RNA analysis. To measure placental weight, the placenta was separated from the amnion to which it was attached and weighed using an Acculab VI-I200 calibrated laboratory scale (Acculab, USA) with a reliability standard of 0.1g. Placentas from twin pregnancies were either cut along an obvious ridge between the two placentas or, in the case of monochorionic twin pregnancies, the whole placenta was weighed and each infant was assigned half of the total weight.  69  Figure 2.1 Protocols for RNA expression and DNA methylation analysis. One piece of placental chorionic villi tissue was put into RNAlater solution (Qiagen) immediately after birth while another piece was put in an untreated container. RNA was extracted using the RNeasy® Mini Kit (QIAGEN Inc., Mississauga, ON, Canada). Extracted RNA was then converted to cDNA using the Qiagen Quantitect Reverse Transcriptase cDNA Synthesis Kit (QIAGEN Inc., Mississauga, ON, Canada). This cDNA was then analyzed using real-time PCR after preparation with Taqman Gene Expression Master Mix (Applied Biosystems Inc). DNA was extracted using the QIAamp® DNA Mini Kit (QIAGEN Inc., Mississauga, ON, Canada). This DNA was then bisulfide modified using the EZ DNA Methylation-Gold™ Kit (Zymo Research, Orange, CA, USA). Pyrosequencing was performed on these samples to investigated DNA methylation. Figures displaying the Qiagen kits were attained form the Qiagen website (www.Qiagen.com). Figures outline bisulphite conversion and pyrosequencing were taken from the Invitrogen website (www.invitrogen.com). 70  2.2 DNA extraction DNA was extracted from placental tissue not stored in RNAlater using the QIAamp® DNA Mini Kit (QIAGEN Inc., Mississauga, ON, Canada) according to the manufacturer’s instructions. To start, 20-30mg of tissue was cut off, placed in a clean Petri dish, and minced using a sterile surgical blade to increase surface area.  Tissue was homogenized using a  mechanical motor homogenizer (Powergen 500 by Fisher Scientific).  The manufacturer’s  protocol was supplemented with a step to rid the sample of any contaminating RNA. This was done using the RNase-Free DNase Set (Qiagen Inc., Mississuaga, ON, Canada) during an optional step in the Qiagen manual. Concentrations were then recorded using a NanoSpec spectrometer (Nanovue by General Electic Inc., CT, USA) and each sample was diluted in a separate tube to contain 500ng of DNA. These samples were then subjected to bisulphite conversion prior to pyrosequencing analysis.  2.3 Bisulphite conversion of DNA and methylation analysis using pyrosequencing Before methylation analysis, the samples underwent bisulphite conversion in which unmethylated cystosines in the strand undergo deamination and are converted into uracil. Extracted DNA was subjected to bisulphite modification using the EZ DNA Methylation-Gold™ Kit (Zymo Research, Orange, CA, USA).  The amount of DNA extract for bisulfide  modification was consistently 500ng per sample. The modified DNA was amplified by PCR using HotStarTaq Polymerase (Qiagen Inc., Mississuaga, ON, Canada) and then subjected to pyrosequencing using a primer covering the distal end of ICR1 (figure 2.2, table 2.1). This ICR1 region was selected due its successful application in another study (Horike et al., 2009). All 71  primers were ordered from Sigma Scientific (Sigma-Aldrich Canada Ltd, Oakville, ON). During PCR amplification, each PCR tube contained 25 µl of solution containing the following: HotStarTaq buffer (including 1.5mM MgCl2), 0.2mM dNTP, 5pmol of each of the forward and reverse primers mentioned above, and 1.0U HotStarTaq DNA polymerase (QIAGEN, Mississuaga, ON, Canada) along with 2 µl of the converted DNA. PCR thermocycling conditions for these reactions were: 95oC for 15 min (for initial denaturation), (95oC 40 sec, 55oC 40 sec, 72oC 40 sec) X 40 cycles, 72oC 7 min. Pyrosequencing was performed in two replicates for each sample on the Qiagen PyroMark Q96 MD machine (Qiagen Inc., Mississuaga, ON, Canada) using 10 µl of PCR product. Each run comprised of a PCR plate and pyrosequencing plate preparation. Each well on the PCR plate contained 30µl water, 38µl binding buffer and 2 µl sequencing beads (all supplied by Qiagen. The pyrosequencing wells contained 0.36 µl of the appropriate primer and 11.64 µl of annealing buffer (Qiagen Inc., Mississuaga, ON, Canada). Pyro Q-CpG software (v1.0.9, 2006, Biotage AB) was used to analyze these results. Only the first three of four CpG sites were used to calculate average methylation for each of the patients due to the higher variability and unreliability of the fourth site.  Figure 2.2 Location of region of ICR1 investigated for methylation. The distal two of the seven (b1-b7) ICR1 binding sites on the ICR1 region were investigated. α and β mark the region covered by the designed probes. 72  Table 2.1 ICR1 reverse, forward and sequence primers used in pyrosequencing Primer Sequence ICR1 R 5'-ACAATACAAACTCACACATCACAAC ICR1 F 5'-TGAGTGTTTTATTTTTAGATGATTTT ICR1 SEQ 5'-GTGGTTTGGGTGATT  2.4 RNA extraction and cDNA conversion RNA was extracted from stored samples using the RNeasy® Mini Kit (QIAGEN Inc., Mississauga, ON, Canada) according to the manufacturer’s instructions. To start, 20-30 mg of tissue was cut off, placed on a clean Petri dish placed on dry ice blocks, and minced using a sterile surgical blade to increase surface area. Petri dishes were placed on dry ice to both prevent RNA degradation during this step and also because it eased the mincing process. Tissue was homogenized using a mechanical motor homogenizer (Powergen 500 by Fisher Scientific); two intervals of 20 seconds were used during homogenization to avoid excessive heating of the RNA from the machine. The manufacturer’s protocol was supplemented with a step to rid the samples of any DNA that may have contaminated it; during the optional purification step outlined in the kit’s manual, a DNase-Free RNase Set (Qiagen Inc., Mississuaga, ON, Canada) was used to eliminate DNA. Prior to analysis, RNA integrity was inspected on 1.5% agarose gel (40ml TAE + 0.6g agarose + 4 µl SybrSafe) using 1 µl of 6x orange loading dye and 2.5 µl of the RNA sample coupled with 1 µl of a low range DNA ladder; these were run at 95V for 60 minutes. Concentrations were then recorded using a NanoSpec spectrometer (Nanovue by General Electic Inc., CT, USA) and each sample was diluted to 1 µg/40 µL before being used to make 80 µL of cDNA product when added to a master mix containing 15.8 µL water, 8 µL RT buffer, 3.2 µL dNTP mix, 8 µL primer mix, 4 µL reverse transcriptase supplied by the cDNA kit. The samples 73  were converted to cDNA using the Qiagen Quantitect Reverse Transcriptase cDNA Synthesis Kit (QIAGEN Inc., Mississauga, ON, Canada) with the thermal profile of 10 minutes at 25°C, hold for 2 hours at 37°C and hold infinite at 4°C. The cDNA products were then diluted one in fifty times prior to being used for real-time PCR.  2.5 Quantitative real-time RT-PCR Expression analysis was performed on the prepared samples by quantitative real time PCR. We used the ABI 7500 Real-Time PCR System (Applied Biosystems Inc., Foster City, CA) with the Taqman Gene Expression Master Mix (Applied Biosystems Inc., Foster City, CA). Before analysis, RNA was diluted to 1 µg/40ul with H20; this 1 µg of RNA was then added to 40 µl of RT master mix (15.8 µl water, 8 µl 10x RT buffer, 3.2 µl 25x dNTP mix, 8 µl 10x random primer (RP) mix and 4 µl reverse transcriptase); this gave 1 µg RNA in 80 µL cDNA synthesis reaction. The thermal profile for the 80 µl cDNA synthesis was as follows: hold for 10 minutes at 25°C, hold for 2 hours at 37°C and hold infinite at 4°C. We assessed IGF2 and H19 mRNA transcription using primers supplied by ABI (Applied Biosystems Inc., Foster City, CA) (table 2.2). These primers were diluted to 10 µM prior to use. Reactions were run currently with an endogenous control run using Human 18s rRNA (20x) pre-developed by Applied Biosystems Inc. Sequences are not available due to patent agreements for this endogenous control, but the GenBank ID number for this product is X03205.1. Real-time PCR was performed in two replicates for each sample. Each well on the PCR plate designated for the test primers (H19 and IGF2) contained 15µl of master mix (10 µl TaqMan PCR mix, 1 µl respective primer, 4 µl water) and 5 µl of the specific cDNA sample. 74  The wells for the endogenous control samples contained 17.5 µl of master mix (10 µl TaqMan PCR mix, 1 µl 18s primer, 6.5 µl water) and 2.5 µl of the cDNA. Relative expression (Rq) values were determined by the ABI 7500 system software for each of the patients; these values were quantified using the incorporated control calibrators. At least ten controls were entered into the calibration mixture for each real-time PCR run to ensure reliable relative expression calculations.  Table 2.2 H19 and IGF2 primers used in real-time PCR analysis Sequence Primer Sequence Analyzed H19 F 5'- ATTTGCACTAAGTCATTTGCACTG H19 R 5'- CAGTCACCCGGCCCAGAT IGF2 F 5'- TTTGTCCCTCTCCTCCTCCA IGF2 R 5'- CAAGGCTCTCTGCCGAAACT  2.6 Clinical outcome analysis Information regarding maternal age, fetal birth weight and gestational age were acquired at the hospital either right after delivery or, in some cases, a phone call was made to the hospital to attain this information. We were not able to attain all three of these factors for every patient; we had full information for 92 of the 111 patients. Small for gestational age (SGA) was assigned based on guidelines set by the Canadian Perinatal Surveillance System (CPSS). The CPSS developed these guidelines after analysing data from 347,570 male and 329,035 female infants born in Canada during the years of 1994 and 1996. This investigation led to different guidelines depending on fetal sex (figure 2.3). Any of 75  our patients that were below the 5th percentile in birth weight for their gestational age were designated as being SGA. There were no guidelines for twin pregnancies and the nature of these pregnancies makes it hard to set such guidelines. Therefore SGA analysis in this thesis only involves singleton births.  76  Figure 2.3 Canadian Perinatal Surveillance System (CPSS) guidelines for small for gestational age. There are different guidelines for male (a) and female (b) conceptions. These guidelines are based on data from 347,570 male and 329,035 female infants born in Canada during the years of 1994 and 1996. These figures and graphs were taken from the CPSS public website: http://origin.phac-aspc.gc.ca/rhs-ssg/bwga-pnag/  77  2.7 Data and statistical analysis All data was tabulated in Microsoft Excel (Microsoft Corporation, Redmond, WA) and graphs were made using this program. All statistical analysis was performed using version 5.02 of GraphPad Prism (GraphPad Software, San Diego, CA) made for Microsoft Windows. Differences in both methylation and gene expression were assessed using two way ANOVA. Both IVF and ICSI patients were compared to natural conception controls for these tests. An unpaired t-test was done to quantify the p-values for each of these comparisons. Any p-value less than 0.05 (p < 0.05) was deemed as significant. The coefficient of determination (R²) was obtained using Microsoft Excel (Microsoft Corporation, Redmond, WA) and was based on incorporated data points. The accuracy of this statistical methodology was discussed with Boris Kuzeljevic, statistician and methodologist at the Child and Family Research Institute (CFRI). It should be noted that due to the real-time PCR technique, no real statistical analysis can be made to compare the differences in variance between the ART groups and the control group; the expression values quantified for the control cases are relative to themselves and we thus cannot compare their lack of deviation to that of the other groups.  78  CHAPTER 3: RESULTS 3.1 Clinical outcomes A total of 111 post-delivery placentas from both IVF and ICSI were included in this study. Of these patients, 52 were IVF, 40 ICSI and 19 were normal controls born without the use of artificial technologies. Of the IVF cases, 10 were twins and the other 42 singletons; 18 of the ICSI patients were twins with the remaining 22 being singleton; finally, 6 of the 19 normal controls patients were twins. Although not all of these patients were involved in the expressional experiments, all were included in the methylation part of this study. Of these patients, 45 were investigated for changes in H19 and IGF2 expression. Complete information regarding maternal age, gestational age, fetal birth weight and placental weight was known for 92 of the 111 patients. Averages for each of these factors were calculated for each group and compared to note any differences between our IVF, ICSI and natural conception group (table I-III). Small for gestational age was designated as outlined by the Canadian Perinatal Surveillance System; only singleton births were included as no reliable guideline was available for multiple birth pregnancies. The average maternal age (±SD) for the groups was not significantly different between the groups: 35.3±3.9 years for the IVF group, 34.1±2.9 years for the ICSI group and 32.4±8.7 years for the natural conception group. Birth weight (±SD) for each case was also recorded and averages for each of the groups were quantified: 2987g±774g for the IVF group, 2848g±662g for the ICSI group and 3324g±633g for the natural controls. Although birth weight averages were lower for the ICSI and IVF group, these did not prove to be significantly different (P > 0.05) namely due to the high variability in birth weight in each of the groups. Two patients were 79  observed to be small for gestational age (SGA) as defined by the CPSS guidelines leading to a higher rate of SGA in IVF (3%) and ICSI (5%) as compared to the natural conception group (0%) in our study population; a larger sample group is required to pursue any sort of statistical analysis on this factor. Placental weights (±SD) also showed the same trend between the IVF, ICSI and natural pregnancy groups (544g±112g, 509g±112g, 563g±95g respectively) but again proved not to be significant (P > 0.05). Furthermore, IVF pregnancies showed an unexpectedly higher gestation age average (±SD) of 38.1±2.2 weeks as compared to ICSI (37.0±2.6 weeks) and natural controls (37.5±2.4 weeks) but these differences between the groups were not significant (P > 0.05).  Table 3.1 Clinical information for IVF term pregnancies  n  %  Maternal  Gestational  Birth  Fetal birth  Placental  Small  age (yr)  age (wk)  after  weight (g)  weight (g)  For  (mean±SD) (mean±SD) >40WK (mean±SD) (mean±SD) Gestational ges.(%)  Age (%)*  Singletons 35  81  35.4±4.3  38.2±2.4  34  3045±797  551±113  3  Twins  8  19  35.0±2.1  37.8±1.6  13  2764±709  523±115  N/A  Total  43 100  35.3±3.9  38.1±2.2  30  2987±774  544±112  -  *Small for gestational age was designated as outlined by the Canadian Perinatal Surveillance System. There is no guideline for SGA and twins.  80  Table 3.2 Clinical information for ICSI term pregnancies  n  %  Maternal  Gestational  Birth  Fetal birth  Placental  Small  age (yr)  age (wk)  after  weight (g)  weight (g)  For  (mean±SD) (mean±SD)  >40WK  (mean±SD) (mean±SD) Gestational  ges.(%)  Age (%)*  Singletons  19  54  33.9±3.4  37.5±2.2  16  3042±708  517±133  5  Twins  16  46  34.4±2.2  36.4±3.0  13  2601±541  498±82  N/A  Total  35 100  34.1±2.9  37.0±2.6  14  2848±662  509±112  -  *Small for gestational age was designated as outlined by the Canadian Perinatal Surveillance System. There is no guideline for SGA and twins.  Table 3.3 Clinical information for natural conception term pregnancies  n  %  Maternal  Gestational  Birth  Fetal birth  Placental  Small  age (yr)  age (wk)  after  weight (g)  weight (g)  For  (mean±SD) (mean±SD) >40WK (mean±SD) (mean±SD) Gestational ges.(%)  Age (%)*  Singletons 13  68  33.5±9.4  38.2±2.6  23  3126±564  588±71  0  Twins  6  32  31.4±8.3  36.8±2.0  33  2948±491  551±106  N/A  Total  19 100  32.4±8.7  37.5±2.4  26  3324±633  563±95  -  *Small for gestational age was designated as outlined by the Canadian Perinatal Surveillance System. There is no guideline for SGA and twins.  81  3.2 DNA methylation Pyrosequencing was conducted on all placental samples using identical preparation protocols and sequencing conditions. Methylation percentages were averaged and tabulated for each group (control, IVF and ICSI) for comparison (figure 1). Minor methylation differences were seen at the ICR1 region (49.3% ±3.4% for IVF, 49.6%±1.9% for ICSI and 48.7%±1.7% for control). ANOVA testing yielded the differences between the groups as non-significant (p > 0.05). Furthermore, DNA from sperm samples were run in concurrence with the test samples to test the reliability of the results and, as expected for sperm, these samples never showed a lower than 95% methylation level (figure 3.2C). As mentioned, only the first three of four CpG sites were recorded in the average of each patient due to the unreliability of the fourth site as seen in figure 3.2 in which even sperm (figure 3.2C) DNA shows hypomethylation.  Average methylation (%)  ICR1 Methylation 100 75 48.7  49.6  49.3  Control  ICSI  IVF  50 25 0  Figure 3.1 Average DNA methylation in the placenta of control (n=19), ICSI (n=40) and IVF (n=52) groups. Methylation values for all patients were obtained using pyrosequencing. The first three of four CpG sites were averaged for each patient and methylation average of all patients in each group were subsequently averaged to attain the numbers on this graph. None of these changes proved to be significant using ANOVA analysis (P>0.05).  82  A  B  C  Figure 3.2 Pyrosequencing results for (A) random control, (B) IVF sample with lower than average methylation, (C) sperm sample. Quantitative pyrosequencing of bisulphite induced C/T polymorphisms in the ICR1 region. Shaded areas represent C/T polymorphisms and the values above these regions are the calculated % C/T at each polymorphism. Although the IVF sample and control samples both show similar, we see the expected high methylation levels in the sperm DNA. 83  3.3 Gene expression Expressional analysis was conducted on the placental villi tissue of 45 patients (17 IVF, 14 ICSI and 14 controls). Real-time quantitative PCR analysis of all the groups procured relative expressions for each sample as compared to the controls which were run concurrently. Expressional results were averaged for both groups looking at both H19 and IGF2. Results were tabulated to visualize differences between expression for each of these genes in the two study groups (figure 3.3). Compared to the controls IVF and ICSI patients both showed an increase in H19 gene expression (by a factor of 1.78±0.74 and 1.93±0.71, respectively) while showing a decrease (by a factor of 0.83±0.34 and 0.74±0.27, respectively) for the expression of IGF2. Control cases were also run separately and showed H19 and IGF2 relative expressions of 1.15±0.30 and 0.95±0.31, respectively. Although there were noticeable changes in expression, none of these changes proved to be significant using ANOVA (p > 0.05). Differences in gene expression variability between the ART and control groups could not be analyzed because these results are relative to the control cases themselves and each Rq value is merely a relative value and not a definite representation of expression.  84  Gene Expression 5  Gene Expression (Rq)  H19  IGF2  4  3  1.93  1.78 2  1.15  0.83  0.74  0.95  1  0  IVF  ICSI  Control  Figure 3.3 Average relative gene expression (Rq) of H19 and IGF2 in the placenta of ICSI (n=14), IVF (n=17) and control (n=14) patients. Gene expression was attained via real-time PCR. These results were normalized to 18S gene and were quantified using the naturally conceived control cases as calibrators.  3.4 DNA methylation compared to relative gene expression for individual cases Comparisons in DNA methylation and gene expression were made for individual patients to see how changes in methylation at ICR1 is correlated to changes in either H19 and IGF2 expression (figure 3.4); we also aimed to see if the proposed H19/IGF2 regulation model accurately predicts expression in human placental tissue. Expectantly, H19 expression decreased with increased ICR1 methylation while IGF2 expression increased as predicted by the aforementioned model.  The coefficient of determination (R²) values however show that  methylation and expression results for each individual are not very effective at predicting one  85  another; this is especially true in the case of IGF2 where the R² value is 0.0054 as compared to 0.0319 for H19. Comparison between IGF2 and H19 expression (figure 3.5) showed the expected negative correlation between the genes as predicted by the regulation model, but the R² (0.0045) value shows little predictive significance. Knowing the expression of one of the genes does not allow for the accurate prediction of the other gene as would be expected if they were both under the opposite control of a single methylation event.  Gene expression vs. DNA methylation in ART placenta 3.5 Gene Expression (Rq)  3 2.5  R² = 0.0319  2  H19 expression  1.5  IGF2 expression Linear (H19 expression)  1  Linear (IGF2 expression)  R² = 0.0054  0.5 0 44  46  48  50  52  54  56  ICR1 DNA methylation (%)  Figure 3.4 Relative gene expression of both H19 and IGF2 as compared to DNA methylation at the regulatory ICR1 region in ART placenta. Methylation analysis was done via pyrosequencing and expression values were attained via real-time PCR. H19 samples are shown as diamonds and IGF2 samples are shown as squares. There was no significant correlation between methylation and either H19 or IGF2 expression (R² = 0.0319 and 0.0054, respectively). P>0.05 for both H19 and IGF2 regression using ANOVA.  86  IGF2 expression vs. H19 expression in ART placenta  IGF2 Expression (Rq)  2.5 2 1.5 R² = 0.0045 1 0.5 0 0.8  1.3  1.8  2.3  2.8  3.3  H19 Expression (Rq)  Figure 3.5 Relative H19 expression vs. IGF2 expression levels for individual cases in ART placenta. Placental expression values were attained via real-time PCR analysis for both IVF and ICSI patients. There was no significant correlation between H19 and IGF2 expression (R² = 0.0045). Knowing the expression of one gene does not allow proper prediction of the other.  3.5 Placental DNA methylation and gene expression for SGA patients To determine if changes in H19 and IGF2 in the placenta are somehow affecting fetal growth we looked at the methylation of ICR1 and the expression of both these genes in patients who had obvious growth restrictions (table 3.4). From all of our patients, we observed two small for gestational age infants as defined by the CPSS guidelines above; one was in the IVF group and the other in the ICSI group. Neither of these two patients showed any noticeable difference in ICR1 methylation (50% for the IVF case and 49% for the ICSI case) as compared to the average of the total control cases (48.7%±1.7%) or the average of total IVF and ICSI cases (49.3% ±3.4% and 49.6%±1.9%, respectively). These results match similar results found in our lab looking at ICSI patients and 87  using completely different guidelines and techniques (Hatakeyama, 2006). Both patients however showed increases in the relative expression of H19 (1.99 for the IVF patient and 2.16 for the ICSI) and decreases in relative IGF2 expression (0.74 for the IVF patient and 0.69 for the ICSI). Although the relative expression of both cases still fell into the range of their respective group, both SGA placentas showed a notable increase in H19 expression and decrease IGF2 expression. Although no statistical analysis can be made here because of the number of cases, it should be noted that the H19 relative expression for these two SGA cases goes well above the average of the control cases (1.15±0.31) while the IGF2 expression seems not to have as a dramatic difference when compared to the IGF2 control averages (0.95±0.31). This limited data suggests H19 expression plays an important role in fetal development and this is likely independent of ICR1 methylation in human placenta. More placentas attained from SGA patients must be investigated to solidify these findings.  Table 3.4 DNA methylation and gene expression in placenta of two SGA patients Case IVF-SGA ICSI-SGA  ICR1 Methylation (%) 50 49  H19 Expression (Rq) 1.99 2.16  IGF2 Expression (Rq) 0.74 0.69  88  CHAPTER 4: DISCUSSION Human reproduction and development is a beautiful process that has taken millions of years to be refined and we often forget the intricacies of this process. Recently, technologies have allowed us to bypass certain natural mechanisms involved in reproduction and questions have been raised regarding the possible impact this has on the offspring. Although the majority of ART patients are in good health, concerns have been raised based on some abnormalities associated with the techniques. An important study published in the New England Journal of Medicine has already established a twofold increase in major birth defects in ART conceptions as compared to naturally conceived children (Hansen et al., 2002). There are far too many genetic and epigenetic factors that are thought to influence human development with recent research shedding light on the importance of genomic imprinting in placentation and subsequent fetal development (Miozzo et al., 2002, Fowden et al., 2006). Here, we look at the activity of two important genes (IGF2 and H19) to try to investigate how these genes work and whether in vitro fertilization influences them in any way. Genomic imprinting refers to the parent-specific expression of genes that occurs without changes in DNA sequence. Imprinted regions along the length of DNA possess an abundance of CpG islands (Paulsen et al., 2000) which are segments of DNA that are rich in cytosine and guanine nucleotides with studies showing a 40% increase in CpGs in these regions as compared to other regions in the DNA (Paulsen et al., 2000). Imprinting is established and maintained by DNA methylation at CpG sites along the individual’s genome and is important in embryonic and placental development (Miozzo and Simoni, 2002; Fowden et al., 2006) and consequently vital in proper mother-offspring interactions (Isles and Holland, 2005).  DNA methylation and  89  demethylation are under the control of a variety of DNA methyltransferase (DNMT) enzymes which both establish the imprints and maintain them through subsequent cell divisions. DNA methylation is implicated in the control of gene expression and this can be achieved either through a direct process such as promoter methylation or an indirect process such as recruiting transcription factors which modify histones in that region (Jones et al., 2001). Up to two hundred genes are estimated to be imprinted in the human genome (Lucifero, 2004; Lueidi et al., 2007) and these genes can influence the expression of other genes up to several kilobases away from them (Spahn and Barlow, 2003). H19 and IGF2 are two of the most studied imprinting genes namely because of their importance in development. Concerns regarding epigenetic abnormalities in ART pregnancy stem from observations looking at changes in the sperm (Ferlin et al., 2007; Ferguson et al., 2007) and oocyte (Pellestor et al., 2006) of infertile parents, disruption in epigenetic maintenance after ovulation induction (Fortier et al., 2008) and methylation changes observed in mice after in vitro culturing conditions (Schieve et al., 2000).  Infertile men show higher incidence of chromosome aneuploidy in  autosomes (Rives et al., 2003), sex chromosomes (Gekas et al., 2001; Kirkpatrick et al., 2008) and in sperm (Ferguson et al., 2007; Tang et al., 2004; Shi and Martin, 2001; Levron et al., 2001).  Male infertility has also been associated with Y-chromosome microdeletions  (McElreavey et al., 2006; Kuroda-Kawaguchi et al., 2001) which can then be passed on to the male offspring of these individuals (Minor et al., 2007; Sakian et al., 2008). Female infertility has been associated with oocyte abnormalities such as trisomies, mosaicism and translocation (Clementini et al., 2005) which often occur due to maternal meiotic errors during the first meiotic division (Hassold and Hunt, 2001). Advanced maternal age is thought to be the major indicator of these abnormalities (Nicolaidis and Peterson, 1998) and although women of 90  advancing age can still ovulate, the oocytes released are usually of poor quality (Westhoff et al., 2000) and if fertilization occurs, chromosomal abnormalities may be translated to the offspring. Superovulation in the ART procedure can also procure heritable abnormalities by disruption of genomic reprogramming (Geuns et al., 2007, Sato et al., 2007) as such changes have already been associated with ovulation induction in mice (Anckaert et al., 2009, Market-Velker et al., 2010).  Finally, studies associating in vitro culturing conditions to birth weight syndromes in  cattle (Bertolini et al., 2002), sheep (Young et al., 2001) and mice (Khosla et al., 2001) have raised concerns regarding the possibility that similar abnormalities may be observed in ART offspring. The birth weight changes observed in in vitro animal studies have been attributed to changes in the H19 and IGF2 imprinted genes (Young et al., 2001; Khosla et al., 2001). The exact mechanism of control and the roles of H19 and IGF2 are not fully understood but H19 has been shown to encode for a RNA transcript that is important in embryonic development (Brannan et al., 1990) while IGF2 encodes for a mitogen that is important in the development of the placenta which is subsequently vital to proper fetal development (Tanos et al., 2004). Research has linked H19 and IGF2 to various phenotypic disorders with the most extreme alteration of these genes being observed in mice: mouse knockout models for H19 showed increase in placental weight and fetal overgrowth (Leighton et al., 1995) while IGF2 knockouts showed reduced placental growth followed by growth restriction with later gestational age knockouts showing a more severe phenotypic change (Constancia et al., 2002, Constancia et al., 2005). Previous studies looking at mice have also found that the methylation patterns in these two genes are sensitive to changes in culturing conditions (Mann et al., 2004) which become especially important for our ART population who experience in vitro embryo culturing conditions prior to the transfer of the blastocyst into the mother’s uterus.  Because ART 91  procedures have already been linked to placental problems and an increased incidence of fetal growth restriction (Schieve et al., 2002; Katalinic et al., 2004; Wang et al., 2005), determining if there are changes in H19 and IGF2 becomes important in ART conceptions. Regrettably, we lack a large enough sample group to possess a significant number of placentas from small for gestational age (SGA) pregnancies needed to address this aspect of ART. Although relaxing our strict criteria for SGA pregnancy may have given us more cases to investigate, we chose to only designate those individuals that were on the lower 5th percentile of the guideline set by the Canadian Perinatal Surveillance System. Furthermore, another factor that limits any significant analysis here is the criteria used to designate controls. Although controls of all birth weights and gestational age were accepted, no controls with serious health complications were included in our results.  Because no such criteria was used in the ART group, it would not have been  accurate to compare the groups based on phenotypic changes. It should be noted, however, that only one control case was omitted from the results due to a serious birth complication. By looking at imprinting defects in pregnancies derived from ART, we may be able to develop a better understanding of the possible impact these procedures have on the resultant children. Because the ART procedures bypass important natural conditions and because infertile parents have a higher incidence of epigenetic modification, it is important that we identify any possible defects that may occur because of these procedures especially considering the increase in the rates of IVF and ICSI procedures during the past decade. These results along with others in the field may allow us to improve ART techniques in the future to bypass any errors that it may produce and may justify the use of prenatal tests for individuals who are conceiving using IVF or ICSI.  92  4.1 Discussion of results In this study we performed pyrosequencing on bisulfide converted DNA extracted from the placental villi tissue attained from IVF, ICSI and naturally conceived pregnancies. The methylation of the ICR1 region between H19 and IGF2 was measured and averaged for all the groups. We looked at the distal end of the ICR1 region associated with the CTCF binding proteins and most accurately correlated to promoter activity (Horike et al., 2009). This region contained four CpG sites but only three sites were recorded due to the unreliability of the fourth site. RNA was also extracted from the same tissue and H19 and IGF2 expression was quantified using real-time PCR. Relative expression values were calculated in relation to RNA samples from the placenta of naturally conceived pregnancies with no birth complications. The reason for using these techniques was because they are one of the most reliable methods for investigating methylation and gene expression. As mentioned in the introduction, various studies have looked at methylation and gene expression in human ART tissue, but no published paper has looked at the methylation status of this particular ICR1 region using pyrosequencing and no paper has looked at H19 and IGF2 gene expression using the strict RNA preservation methods we have used in this project.  4.1.1 Clinical analysis of ART patients Complete clinical information was available for 92 of our 111 patients. We did not find any significant difference between our IVF, ICSI and naturally conceived group in maternal age, gestational age, fetal birth weight or placental weight (tables 3.1, 3.2, 3.3). Of these clinical outcomes, the ones that interested us the most were fetal birth weight and the occurrence of small 93  for gestational age (SGA) as previous studies have linked in vitro culturing conditions to changes in birth weight in cattle, sheep and mice (Bertolini et al., 2002; Young et al., 2001; Khosla et al., 2001). Furthermore, studies looking at humans have found increased incidence of fetal growth restriction in ART conceptions as compared to the natural conception controls (Schieve et al., 2002; Katalinic et al., 2004; Wang et al., 2005). The increased incidence of fetal growth restriction observed by others directed us in choosing H19 and IGF2 for investigation. Because H19 and IGF2 have been associated with growth (Brannan et al., 1990; Tanos et al., 2004), we were interested to see if our ART group showed any differences in these imprinted genes as compared to our natural conception group. It should be noted that although associations between IUGR and ART have been made by other studies, we did not observe significant increases in SGA in our ART group as compared to our control group due to our small sample size. We did, however, observe considerable changes in birth weight between our groups. Birth weight (±SD) for each case was recorded and averages for each of the groups were quantified: 2987g±774g for the IVF group, 2848g±662g for the ICSI group and 3324g±633g for the natural controls. Although the ART groups did not have a significant decrease in birth weight, they do seem to be substantially lower than our control group and these differences may prove to be significant looking at a much larger sample size. As mentioned, other studies have already linked ART pregnancies to fetal growth restriction (Schieve et al., 2002; Katalinic et al., 2004; Wang et al., 2005) and there is a possibility that we would see similar trends with a comparable sample size. Our next step was to determine how many of our patients were considered small for gestational age. The problem with such designation is that there are multiple SGA guidelines and it was important that we decided on one that fit our population group. 94  We used the SGA guidelines set by the Canadian Perinatal Surveillance System (CPSS) which is the guideline most commonly used in Canada. The CPSS developed these guidelines after analysing data from 347,570 male and 329,035 female infants born in Canada during the years of 1994 and 1996. Any of our patients that were below the 5th percentile in birth weight for their gestational age were designated as being SGA. Because there were no guidelines for twin pregnancies we omitted twin conceptions in designating SGA patients and our results thus involve singleton births only. Two patients were observed to be small for gestational age as defined by the CPSS guidelines leading to a higher rate of SGA in the IVF (3%) and ICSI (5%) group as compared to the natural conception group (0%) in our study population; a larger sample group is required to pursue any sort of statistical analysis on this factor.  4.1.2 ICR1 methylation in ART placenta Genome-wide methylation analysis looking at over 700 genes in ART placenta using illumina arrays found hypomethylation in the ART group as compared to the naturally conceived group (Katari et al., 2009). The next step is to investigate specific genes using more accurate methods such as pyrosequencing to determine where these methylation changes are occurring and what possible phenotypic consequence(s) they have. Imprinted genes such as H19 and IGF2 are believed to act in the placenta by influencing proper nutrient allocation to the developing embryo and are thought to play a crucial role in development and programming of adult health and disease (Fowden et al., 2010). Methylation at the ICR1 region between H19 and IGF2 is thought to control the expression of these two genes (Murrell et al., 2004). Methylation at the ICR1 site disallows the binding of certain CTCF binding proteins; when these proteins are not  95  bound, complex looping at that site allows enhancers to interact with the IGF2 promoter and thereby results in the expression of IGF2. When unmethylated, ICR1 is bound by the CTCF protein and this results in another looping structure that positions the enhancers above the H19 promoter and results in H19 expression (Murrell et al., 2004).  We therefore investigated the  distal end of ICR1 which has been established as being a site most representative of CTCF binding activity (Horike et al., 2009) to monitor changes in ART conceptions as compared to controls. Pyrosequencing was performed on the bisulphite converted DNA extracted from the placental villi tissue of all of our patients. Minor methylation differences were seen at the ICR1 region (49.3% ±3.4% for IVF, 49.6%±1.9% for ICSI and 48.7%±1.7% for control) but ANOVA statistical analysis yielded the differences between the groups as non-significant (p > 0.05). Although methylation analysis has been previously performed on the differentially methylated region between H19 and IGF2, no study has looked at the specific distal end of ICR1 in the placenta of ART patients and we therefore could not compare our results to any study. The ICR1 primers were selected after its successful application in another study looking at the methylation of this region in patients with Silver-Russell syndrome (Horike et al., 2009). Previously, pyrosequencing was not an efficient tool in investigating the methylation status of the ICR1 region because of the multiple SNPs sites in the region; the paper by Horkike et al. showed that the distal end of the ICR1 region which contains the important CTCF binding sites is very representative of methylation activity at the H19 promoter making it a perfect candidate for ICR1 investigation. Our results also support this by showing the 50% methylation level that would be expected in imprinted genes in fetal tissue while showing almost 100% methylation in sperm samples. When we looked at a region containing the same CTCF binding sites using the 96  single nucleotide primer extension assays (SNUPE), we got similar but not identical results (Hatakeyama, 2006). Our interest in ICR1 methylation was sparked by a few studies looking at ART individuals. One study looking at H19 promoter methylation found hypermethylated oocytes from ART-treated infertile women (Sato et al., 2007). We suspected that if these methylation defects occur in the oocytes of infertile women, the defects could be passed on to the offspring. Similar defects were observed in the sperm of infertile men; recent studies observed methylation changes at the ICR1 region in oligozoospermic men when compared to fertile men with normal sperm parameters (Marques et al., 2008; Hammoud et al., 2010). Another paper brought on concerns regarding the possible effects the artificial environment of developing ART embryos may have on the methylation at this site; a study looking at methylation at the same differential methylated region found a decrease in methylation in the placenta of mice and attributed this change to culturing conditions (Mann et al., 2004). Our methylation results do not correlate with the results of these other studies. This could be because of differences in primer selection; none of the studies looking at the infertile population mentioned above used the same sequence we did in examining ICR1 methylation. Furthermore, the Mann et al. (2004) study looked at mouse tissue and although mice are a good model for investigation, it is likely that methylation and expression of these genes may not act the same in humans.  In fact, the respective genes are found in a completely different  chromosome in mice; H19 and IGF2/IGF2 are located on chromosome 7 in mice and on chromosome 11 in humans.  97  4.1.3 H19 and IGF2 expression in ART placenta The expression of both H19 and IGF2 were examined using real-time quantitative PCR. One of the most important aspects of this analysis was proper RNA preservations.  RNA  degrades very quickly in most human tissue but it is especially quick to degrade in placental tissue (Guo et al., 2008). It was important for us to extract tissue within a set and strict time frame to keep the results we attained for each of the groups consistent. Therefore no tissue was included for RNA investigation that had not been processed within 30 minutes of pregnancy. We were able to meet this requirement in only 45 of our 111 patients. Compared to the controls IVF and ICSI patients both showed an increase in H19 gene expression (by a factor of 1.78±0.74 and 1.93±0.71, respectively) while showing a decrease (by a factor of 0.83±0.34 and 0.74±0.27, respectively) for the expression of IGF2. Control cases were also run separately and showed H19 and IGF2 relative expressions of 1.15±0.30 and 0.95±0.31, respectively. Although there were noticeable changes in expression, none of these changes proved to be significant using ANOVA (p > 0.05). Differences in gene expression variability between the ART and control groups could not be analyzed because these results are relative to the control cases themselves and each Rq value is merely a relative value and not a definite representation of expression. Therefore the lower deviation observed in the H19 control cases is due to the fact that the relative expression levels were calculated in comparison to the expression observed in quantified values containing samples of each of these controls. To accurately compare deviations here, we would need to run all control samples to another set of controls that would not be included in the data but that would only be used as PCR controls for all samples quantified by the real-time PCR machine.  98  When this project was started, there had been no study looking at gene expression of H19 and IGF2 in the placenta of ART conceptions.  Recently, however, a study out of Japan  investigated the placental expression of these two genes in 65 ART patients and 924 naturally conceived children (Katagiri et al., 2010). The researchers found similar relative expressions in both H19 and IGF2 for both of their groups; all relative expressions were very close to 1, although no numerical values were given in the paper. The relative expression levels, the lack of mention of RNA preservation time, and the large sample size (rare for such experiments) lead us to believe that the tissue in these samples were not processed immediately after birth and therefore the samples most likely had negligible RNA. This is an important paper because it shows the importance of rapid RNA preservation in placental expressional analysis. Although these researchers shared our interest in the H19 and IGF2 region in human ART placenta, they would have benefited had they compared expression levels they received in their stored samples to those of fresh samples. There relative expression levels of 1 in indicative of samples with little RNA; we believe that both their ART samples and their control samples had negligible RNA present and therefore a comparison between these very low numbers yielded a relative expression of 1. One of the reasons we investigated H19 and IGF2 was because of the heightened rate of fetal growth restriction previously observed in ART pregnancies (Schieve et al., 2002; Katalinic et al., 2004; Wang et al., 2005). Both these imprinted genes have been associated with growth restrictions. In a mouse study, targeted deletion of the IGF2 gene resulted in decrease expression of IGF2 and significantly reduced growth (DeChiara et al., 1991). This study was supported by other mouse studies which showed increased placental weight and fetal overgrowth in H19 knockout models (Leighton et al., 1995), while IGF2 knockouts showed reduced placental 99  growth followed by growth restriction with later gestational age knockouts showing a more severe phenotypic change (Constancia et al., 2002, Constancia et al., 2005). Although we did not attain any significant results here, we did observe trends that support these mouse studies. Because the placenta is vital to proper human development we expected the expression of growth factors such as IGF2 in this tissue to be affected due to the increased incidence of fetal growth restriction in ART. Although a small sample size made it hard to make any statistically sound comparison between SGA in the ART group as compared to the control group, we did see higher incidence of SGA in IVF and ICSI cases. We also observed a lower average birth weight for both these groups. The decreases in IGF2 expression in our ART groups could account for these birth weights but since neither differences in birth weight nor changes in IGF2 expression were significant in this study, we cannot make any strong correlations here.  4.1.4 ICR1 methylation and H19/IGF2 expression The results of this study displayed no significant changes in ICR1 methylation or H19 and IGF2 expression after ART, but did reveal inconsistencies with the previously proposed H19/IGF2 regulation model (Murrell et al., 2004). Although increased methylation at the ICR1 region had a general increase and decrease in IGF2 and H19 expression, respectively, we did not see this trend when we looked at individuals separately. Plotting IGF2 expression with H19 expression (figure 3.4) did not show the expected significant negative correlation. These results show that although methylation at ICR1 influences expression, there are significant other factors that are influencing the production of both H19 and IGF2 products. Our results are supported by a recent study looking at H19 and IGF2 gene expression in 9.5 day old mouse conceptions; the 100  researchers found H19 independent IGF2 expression in mouse placenta (Rivera et al., 2008). These results could mean that H19 and IGF2 expression is not controlled the same way in placenta as in other human tissue. Further research needs to be performed looking at different tissue types from the same individuals to confirm this.  A more accurate H19 and IGF2  regulation model will first need to be proposed before any further investigation looking at alterations in imprinting at this region in human placenta.  4.2 Addressing the hypothesis Before undergoing this research, findings associating ART pregnancies with imprinting defects (Katari et al., 2009), increased incidence of fetal growth restriction (Schieve et al., 2002; Katalinic et al., 2004; Wang et al., 2005) and major malformations (Hansen et al., 2002) sparked our interest in investigating H19 and IGF2 in the ART population. We suspected that ART placenta is associated with epigenetic changes in these two genes and developed three hypothesis: o Hypothesis 1 -  ART pregnancies show alterations in DNA methylation at the distal end of the ICR1 region in placental villi tissue as compared to natural conception pregnancies.  o Hypothesis 2(a) -  ART pregnancies show changes in H19 and IGF2 gene expression in placental villi tissue as compared to natural conception pregnancies. 101  o Hypothesis 2(b) -  Changes in DNA methylation at the ICR1 region are negatively and positively correlated to changes in both H19 and IGF2 expression, respectively, in placental villi tissue.  Our first hypothesis was not supported by this study. Our ART group did not show significant changes in DNA methylation at the distal end of the ICR1 region in placental villi tissue. This lack of ICR1 modification in ART could be due to the fact that we only looked at the distal end of the ICR1 region which has previously been strongly associated with CTCF activity (Horike et al., 2009). ART may be affecting methylation at other regions of ICR1 but our study fails to address this; the length of the ICR1 region is difficult to investigate using pyrosequencing because of the multiple SNP sites. We were not able to prove our hypothesis 2(a).  Placental tissue from our ART  population did not show significant changes in H19 and IGF2 gene expression when compared to placental tissue from the naturally conceived population. We did, however, observe changes between the groups and a much larger sample size may prove our hypothesis. Finally, we were also unable to prove our hypothesis 2(b). Changes in DNA methylation at the ICR1 region did not negatively and positively correlate to changes in H19 and IGF2, respectively, in placental villi tissue. This is perhaps the most significant finding in our study as it brings the current regulation model into question. H19 and IGF2 expression do not seem to be regulated the same way in human placental tissue as in other tissue. Other factors independent of methylation at the region of the ICR1 gene associated with CTCF binding may be influencing H19 and IGF2 gene expression.  102  4.3 Limitations There are aspects of this study we would have done differently had we the chance to start the project over while there are also some other limitations that we simply could not bypass. Firstly, doing epigenetic analysis on just one tissue type did not allow us to see if these observed changes were tissue specific. In retrospect, doing analysis on fetal cord blood concurrently with the placental tissue would better allow us to determine how malleable these two genes are in human placenta. Although placental analysis is more appropriate when investigating prenatal development, cord blood would be a better overall indicator of epigenetic modification in ART infants. Another limiting factor is the amount of samples used for RNA analysis. Although we are happy with our preservation methods, this limited our sample size. Obtaining more control samples would have also allowed us to run the control samples with separate calibrating control mixes which would have given us insight into changes in H19 and IGF2 variance between all of our groups. Finally, the multiple SNP sites made it impossible to look at the entire ICR1 region when doing methylation analysis; although the distal end that we looked at included the major CTCF binding sites, it would be beneficial to observe methylation activity along the entire length of the ICR1 region. To do this, we will have to wait for the advent of other methylation investigation technologies as pyrosequencing is ineffective in investigating regions with extensive SNP sites.  103  4.4 Future direction Continuation of this project should include cord blood analysis together with placental tissue analysis to see if methylation and expression changes are tissue specific. A larger sample size would allow for better statistical analysis. There were some obvious changes in all factors that we looked at but none of these proved to be significant; a much larger sample size would potentially make these changes significant. A larger sample size could also increase the number of SGA cases thereby allowing investigation of ART-SGA placenta in comparison to random controls picked without bias. This would allow us to see if H19 and IGF2 are affected in cases where fetal growth is restricted.  Furthermore, changes in DNA methylation at ICR1 do not  properly predict H19 and IGF2 gene expression as predicted by the proposed model. It is important that we distinguish if this is a result of differences in placenta tissue regulation or if there are inadequacies in the model. It is likely that the regulation of H19 and IGF2 is far more complex than we once thought and the degree of complexity itself may be tissue specific and dependant on other RNA transcripts and transcription factors that may be influencing regulation. Future research should also include more imprinting genes in their analysis.  Because  epigenetics is a new field, we do not have a clear perspective of the different roles each imprinting gene plays. Fortunately, new papers are being published every year which give us new insight into the world of epigenetics. Studies that look at both methylation and expression will allow us to better understand how each of the genes is regulated and the roles they may play in each specific tissue.  104  4.5 Concluding remarks These findings merit further research looking at H19 and IGF2 in human placenta to distinguish the exact mechanism of their control; furthermore, once the mode of their maintenance is established, investigation into changes in gene methylation and expression of all prospective important regulatory regions should be carried out to see if there is a significant difference in the activity of H19 and IGF2 in ART conceptions. It is likely that there are other regions close to H19 and IGF2 that are important in regulating the expression of these two genes. We should not rely on mouse models to clarify the mechanisms involved in H19 and IGF2 control as humans may have evolved different processes to account for differences in pregnancy between these two species. Once a clearer regulation model is established, investigating changes in H19 and IGF2 imprinting in ART pregnancies will become much simpler. This study has shown that the classic H19 and IGF2 regulatory model is not representative of how these genes are controlled in human placental tissue. Before any such study is undertaken, it is important that we first identify any and all regions that affect H19 and IGF2 expression in the placenta. None of the results in this project have raised any immediate concern about ART pregnancies. We believe a reason for the lack of significant imprinting errors in this region despite all the environmental and parental risks is possibly because of the lower rates of implantation in ART. Many of the embryos introduced to the uterus during ART fail to implant (Racowsky, 2002) and we believe that this failure to implant may be buffering any serious imprinting abnormalities; any affected embryo would fail to develop further due to an inability to implant. Regardless of whether or not the implantation in ART can act as a quality control step, there is still a potential for imprinting defects in this group. Further research into epigenetic modification of not just H19 and IGF2 but other important imprinting genes in ART pregnancies 105  will help us make the procedures safer and, if need be, offer better counselling to parents who conceive via these techniques. It is important that a more accurate regulatory model is proposed for any respective gene of interest before making any correlations between methylation and expression. Abnormalities already associated with ART likely have a genetic or epigenetic cause and further research in this field is needed to make any confident conclusions regarding the safety of these procedures.  106  REFERENCES  Abuzzahab MJ, Schneider A, Goddard A, Grigorescu F, Lautier C, Keller E, Kiess W, Klammt J, Kratzsch J, Osgood D, Pfaffle R, Raile K, Seidel B, Smith RJ, Chernausek SD. IGF-I receptor mutations resulting in intrauterine and postnatal growth retardation. N Engl J Med 2003 Dec 4;349(23):2211-22. Achermann, JC, Meeks, JJ, Jameson, JL. Phenotypic spectrum of mutations in DAX-1 and SF-1. Mol Cell Endocrinol 2001; 185:17. Adamson, GD, de Mouzon, J, Lancaster, P, et al. World collaborative report on in vitro fertilization, 2000. Fertil Steril 2006; 85:1586. Aittomäki K, Lucena JL, Pakarinen P, Sistonen P, Tapanainen J, Gromoll J, Kaskikari R, Sankila EM, Lehväslaiho H, Engel AR,Nieschlag E, Huhtaniemi I, de la Chapelle A. Mutation in the follicle-stimulating hormone receptor gene causes hereditary hypergonadotropic ovarian failure. Cell 1995; 82:959. Allan GJ, Flint DJ, Patel K. Insulin-like growth factor axis during embryonic development, Reproduction 2001;122: 31–39. Ananth CV, Vintzileos AM. Maternal-fetal conditions necessitating a medical intervention resulting in preterm birth. Am J Obstet Gynecol. 2006;195(6):1557-63. Anckaert E, Adriaenssens T, Romero S, Dremier S, Smitz J. Unaltered imprinting establishment of key imprinted genes in mouse oocytes after in vitro follicle culture under variable follicle-stimulating hormone exposure. Int J Dev Biol. 2009; 53:541-548. Annunziato A. DNA packaging: Nucleosomes and chromatin. Nature Education. 2008;1(1). Anthony S, Buitendijk SE, Dorrepaal CA, Lindner K, Braat DDM, den Ouden AL: Congential malformations in 4224 children conceived after IVF. Hum Reprod 2002;17:2089–2095  107  Aplin JD. Implantation, trophoblast differentiation and haemochorial placentation: mechanistic evidence in vivo and in vitro. J Cell Sci, 1991; 99, 681-692. Aplin, J. D. The cell biological basis of human implantation. Baillieres Best Practice and Research. Clinical Obstetrics and Gynaecology, 2000; 14, 757 – 764. Aplin JD, Kimber SJ: Trophoblast-uterine interactions at implantation. Reprod Biol Endocrinol 2004, 2:48-59. Baker J, Liu JP, Robertson EJ, Efstratiadis A. Role of insulinlike growth factors in embryonic and postnatal growth, Cell 1993; 75: 73–82. Baker, TG. Radiosensitivity of mammalian oocytes with particular reference to the human female. Am J Obstet Gynecol 1971; 110:746. Barker DJ. The long-term outcome of fetal retarded growth. Clin Obstet Gynecol 1997; 40:853863. Bear CE, Li CH, Kartner N, Bridges RJ, Jensen TJ, Ramjeesingh M, Riordan JR. Purification and functional reconstitution of the cystic fibrosis transmembrane conductance regulator (CFTR). Cell 1992; 68:809. Belva F, Henriet S, Liebaers I, Van Steirteghem A, Celestin-Westreich S, Bonduelle M. Medical outcome of 8-year-old singleton ICSI children (born >or=32 weeks' gestation) and a spontaneously conceived comparison group. Hum Reprod. 2007 Feb;22(2):506-15. Bennett-Baker PE, Wilkowski J and Burke DT. Age-associated activation of epigenetically repressed genes in the mouse. Genetics, 2003; 165,2055–2062 Benirscke, K., & Kaufmann, P. Pathology of the Human Placenta, 4th edn. Berlin/Heidelberg/New York: Springer. 2000. Bertolini M, Mason E, Beam SW, Carneiro GF, Sween ML, Kominek DJ, Moyer AL, Famula TR, Sainz RD, Anderson GB. Morphology and morphometry of in vivo- and in vitroproduced bovine concepti from early pregnancy to term and association with high birth weights. Theriogenology. 2002; 58:973-994. 108  Bestor TH. The DNA methyltransferases of mammals. Hum Mol Genet 2000; 9:2395-2402 Bird, A. DNA methylation patterns and epigenetic memory. Genes Dev. 2002; 16:6-21. Bird A. Perceptions of epigenetics. Nature. 2007 May 24;447(7143):396-8. Birney E, Stamatoyannopoulos JA, Dutta A, Guigó R, Gingeras TR, Margulies EH, Weng Z. Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project. Nature. 2007;447(7146):799-816 Bohlmann MK, Fritzsching B, Luedders DW, Hornemann A, Göpel W, Pöschl J, Diedrich K, Griesinger G. Impact of assisted reproduction on obstetrics and neonatology Z Geburtshilfe Neonatol. 2009;213(6):221-7. Boissonnas CC, Abdalaoui HE, Haelewyn V, Fauque P, Dupont JM, Gut I, Vaiman D, Jouannet P, Tost J, Jammes H. Specific epigenetic alterations of IGF2-H19 locus in spermatozoa from infertile men. Eur J Hum Genet. 2010; 18:73-80. Boivin J, Bunting L, Collins JA, Nygren KG. International estimates of infertility prevalence and treatment-seeking: potential need and demand for infertility medical care. Human Reprod. 2007 Jun;22(6):1506-12. Epub 2007 Mar 21. Bonduelle M, Bergh C, Niklasson A, Palermo GD,Wennerholm UB: Medical follow-up study of 5-year-old children. Reprod Biomed Online 2004; 9: 91–101. Bonduelle M, Liebaers I, Deketelaere V, Derde MP, Camus M, Devroey P, Van Steirteghem A. Neonatal data on a cohort of 2 889 infants born after (1991–1999) and of 2 995 infants born after IVF (1983–1999). Hum Reprod 2002; 17: 671–94. Bonduelle M, Wennerholm UB, Loft A, Tarlatzis BC, Peters C, Henriet S, Mau C, VictorinCederquist A, Van Steirteghem A, Balaska A, Emberson JR, Sutcliffe AG. A multicentre cohort study of the physical health of 5-year-old children conceived after intracytoplasmic sperm injection, in vitro fertilization and natural conception. Hum Reprod 2005; 20:413.  109  Borghol N, Lornage J, Blachere T, Sophie Garret A, Lefevre A. Epigenetic status of the H19 locus in human oocytes following in vitro maturation. Genomics. 2006; 87:417-426. Bourque DK, Avila L, Peñaherrera M, von Dadelszen P, Robinson WP. Decreased placental methylation at the H19/IGF2 imprinting control region is associated with normotensive intrauterine growth restriction but not preeclampsia. Placenta. 2010 Mar;31(3):197-202. Bowen JR, Gibson FL, Leslie GI, Saunders DM: Medical and developmental outcome at 1 year for children conceived by intracytoplasmic sperm injection. Lancet 1998; 351: 1529–34. Brannan CI, Dees EC, Ingram RS, Tilghman SM. The product of the H19 gene may function as an RNA. Mol Cell Biol 1990;10:28–36. Brehm R, Steger K. Regulation of Sertoli cell and germ cell differentation. Adv Anat Embryol Cell Biol. 2005;181:1-93. Brosens JJ, Pijnenborg R, Brosens IA. The myometrial junctional zone spiral arteries in normal and abnormal pregnancies. Am J Obstet Gynecol 2002; 187:1416-1423. Brown GM, Furlong RA, Sargent CA, Erickson RP, Longepied G, Mitchell M, Jones MH, Hargreave TB, Cooke HJ,Affara NA. Characterisation of the coding sequence and fine mapping of the human DFFRY gene and comparative expression analysis and mapping to the Sxrb interval of the mouse Y chromosome of the Dffry gene. Hum Mol Genet. 1998 Jan;7(1):97-107. Bullock J, Boyle J, Wang MB. Physiology. Lippincott Williams and Wilkins. USA. Wolters Kluwer Compary. 2001; pp623-643. Cedar, H., Bergman, Y. Linking DNA methylation and histone modification: patterns and paradigms. Nat. Rev. Get. 2009; 10:295-304. Chard T. Insulin-like growth factors and their binding proteins in normal and abnormal human fetal growth, Growth Regul. 1994; 4: 91–100.  110  Chillón M, Casals T, Mercier B, Bassas L, Lissens W, Silber S, Romey MC, Ruiz-Romero J, Verlingue C, Claustres M. Mutations in the cystic fibrosis gene in patients with congenital absence of the vas deferens. N Engl J Med 1995; 332:1475. Christensen, RB, Matsumoto, AM, Bremmer, WJ. Idiopathic hypogonadotropic hypogonadism with anosmia (Kallmann syndrome). Endocrinologist 1992; 2:332 Claris O, Beltrand J, Levy-Marchal C. Consequences of intrauterine growth and early neonatal catch-up growth. Semin Perinatol. 2010 Jun;34(3):207-10. Clausson B, Lichtenstein P, Cnattingius S. Genetic influence on birthweight and gestational length determined by studies in offspring of twins. BJOG 2000 Mar;107(3):375-81. Clayton HB, Schieve LA, Peterson HB, Jamieson DJ, Reynolds MA, Wright VC. Ectopic Pregnancy Risk With Assisted Reproductive Technology Procedures. Obstet Gynecol 2006; 107:595. Clément K, Vaisse C, Lahlou N, Cabrol S, Pelloux V, Cassuto D, Gourmelen M, Dina C, Chambaz J, Lacorte JM, Basdevant A,Bougnères P, Lebouc Y, Froguel P, Guy-Grand B. A mutation in the human leptin receptor gene causes obesity and pituitary dysfunction. Nature 1998; 392:398. Clementini E, Palka C, Iezzi I, Stuppia L, Guanciali-Franchi P, Tiboni GM. Prevalence of chromosomal abnormalities in 2078 infertile couples referred for assisted reproductive techniques. Hum Reprod 2005; 20:437 Cohen P, Rosenfeld RG. Growth disorders. Sperling (Ed.), Textbook of Pediatric Endocrinology, second ed., 2002. Constancia M, Hemberger M, Hughes J, Dean W, Ferguson-Smith A, Fundele R, Stewart F, Kelsey G, Fowden A, Sibley C, Reik W. Placental-specific IGF-II is a major modulator of placental and fetal growth. Nature 2002; 417, 945-8. Constância M, Angiolini E, Sandovici I, Smith P, Smith R, Kelsey G, Dean W, Ferguson-Smith A, Sibley CP, Reik W, Fowden A. Adaptation of nutrient supply to fetal demand in the  111  mouse involves interaction between the IGF2 gene and placental transporter systems. Proc Natl Acad Sci U S A. 2005 Dec 27;102(52):19219-24. Epub 2005 Dec 19. Coulam CB, Chapman C, Rinehart JS. What is a preclinical pregnancy loss? J Assist Reprod Genet. 1998 Apr;15(4):184-7. Cox GF, Bürger J, Lip V, Mau UA, Sperling K, Wu BL, Horsthemke B. Intracytoplasmic sperm injection may increase the risk of imprinting defects. Am J Hum Genet. 2002 Jul;71(1):162-4. Epub 2002 May 8. de la Calle VJF, Rachou E, le Martelot MT, Ducot B, Multigner L, Thonneau PF. Male infertility risk factors in a French military population. Hum Reprod. 2001; 16:481-486. De Sutter P, Delbaere I, Gerris J, Verstraelen H, Goetgeluk S, Van der Elst J, Temmerman M, Dhont M. Birthweight of singletons after assisted reproduction is higher after singlethan after double-embryo transfer. Hum Reprod. 2006 Oct;21(10):2633-7. Dickey RP, Taylor SN, Lu PY, Sartor BM, Storment JM, Rye PH. Spontaneous reduction of multiple pregnancy: incidence and effect on outcome. Am J Obstet Gynecol 2002; 186:77-83. Doerksen T, Benoit G, Trasler JM. Deoxyribonucleic acid hypomethylation of male germ cells by mitotic and meiotic exposure to 5-azaccytidine is associated with altered testicular histology. Endocrinology. 2000; 141:3235-3244. DeBaun MR, Niemitz EL, Feinberg AP. Association of in vitro fertilization with BeckwithWiedemann syndrome and epigenetic alterations of LIT1 and H19. Am J Hum Genet 2003;72(1): 156–160. DeChiara TM, Robertson EJ, Efstratiadis A. Parental imprinting of the mouse insulin-like growth factor II gene. Cell. 1991 Feb 22;64(4):849-59. D’Souza SW, Rivlin E, Cadman J, Richards B, Buck P, Lieberman BA: Children conceived by in vitro fertilisation after fresh embryo transfer. Arch Dis Child 1997;76: F70–F74 Eichenlaub-Ritter U. Genetics of oocyte aging. Maturitas. 1998; 30:143-169. 112  Elliot M, Bayly R, Cole T, Temple IK, Maher ER. Clinical features and natural history of Beckwith-Wiedemann syndrome: Presentation of 74 new cases. Clin Genet. 1994; 46:168-174. Engstrom W, Lindham S, Schofield P. Wiedemann-Beckwith syndrome. Eur J Pediatr. 1988; 157:450-457. Fedder J, Gabrielsen A, Humaidan P, Erb K, Ernst E, Loft A. Malformation rate and sex ratio in 412 children conceived with epididymal or testicular sperm. Hum Reprod 2007; 22:1080. Ferguson KA, Wong EC, Chow V, Nigro M, Ma S. Abnormal meiotic recombination in infertile men and its association with sperm aneuploidy. Hum Mol Genet. 2007 Dec 1;16(23):2870-9 Ferlin A, Arredi B, Speltra E, Cazzadore C, Selice R, Garolla A, Lenzi A, Foresta C. Molecular and clinical characterization of y chromosome microdeletions in infertile men: a 10-year experience in Italy. J Clin Endocrinol Metab 2007; 92:762. Foresta C, Galeazzi C, Bettella A, Stella M, Scandellari C. High incidence of sperm sex chromosomes aneuploidies in two patients with Klinefelter's syndrome. J Clin Endocrinol Metab. 1998 Jan;83(1):203-5. Foresta C, Moro E, Garolla A, Onisto M, Ferlin A. Y chromosome microdeletions in cryptorchidism and idiopathic infertility. J Clin Endocrinol Metab 1999; 84:3660. Forne T, Oswald J, Dean W, Saam JR, Bailleul B, Dandolo L, Tilghman SM, Walter J, Reik W. Loss of the maternal H19 gene induces changes in IGF2 methylation in both cis and trans. Proc Natl Acad Sci. 1997; 94:10243-10248. Fortier AL, Lopes FL, Darricarrere N, Martel J, Trasler JM. Superovulation alters the expression of imprinted genes in the midgestation mouse placenta. Hum Mol Genet. 2008; 17:16531665.  113  Fowden AL, Coan PM, Angiolini E, Burton GJ, Constancia M. Imprinted genes and the epigenetic regulation of placental phenotype. Prog Biophys Mol Biol. 2010 Nov 23. Fowden AL, Sibley C, Reik W, Constancia M. Imprinted genes, placental development and fetal growth. Horm Res. 2006;65 Suppl 3:50-8. Freathy RM, Mook-Kanamori DO, Sovio U, Prokopenko I, Timpson NJ, Berry DJ, Warrington NM, Widen E, Hottenga JJ, Kaakinen M, Lange LA, Bradfield JP, Kerkhof M, Marsh JA, Magi R, Chen CM, Lyon HN, Kirin M, Adair LS, et al. Variants in ADCY5 and near CCNL1 are associated with fetal growth and birth weight. Nat Genet. 2010 May;42(5):430-5. Freeman, DA. Steroid hormone-producing tumors of the adrenal, ovary, and testes. Endocrinol Metab Clin North Am 1991; 20:751. Gekas J, Thepot F, Turleau C, Siffroi JP, Dadoune JP, Briault S, Rio M, Bourouillou G, CarréPigeon F, Wasels R,Benzacken B; Association des Cytogeneticiens de Langue Francaise. Chromosomal factors of infertility in candidate couples for ICSI: an equal risk of constitutional aberrations in women and men. Hum Reprod. 2001 Jan;16(1):82-90. Geuns E, Hilven P, Van Steirteghem A, Liebaers I, De Rycke M. Methylation analysis of KvDMR1 in human oocytes. J Med Genet. 2007 Feb;44(2):144-7. Epub 2006 Sep 1. Gicquel C, Gaston V, Mandelbaum J, Siffroi JP, Flahault A, Le Bouc Y. In vitro fertilization may increase the risk of Beckwith-Wiedemann syndrome related to the abnormal imprinting of the KCN1OT gene. Am J Hum Genet 2003;72(5):1338–1341. Gilbert FG. Developmental Biology. Sinauer Associates. 2000. Goldberg AD. Epigenetics: A Landscape Takes Shape. Cell. 2007;128(4):635. Goldman, R.; Ebright, H.; Nickels, E. Direct detection of abortive RNA transcripts in vivo. Science. 2009; 324 (5929): 927–928. Gosden R, Trasler J, Lucifero D, Faddy M. Rare congenital disorders, imprinted genes, and assisted reproductive technology. Lancet. 2003; 361:1975-1977.  114  Gross SJ. Intrauterine growth restriction: a genetic perspective. Clin Obstet Gynecol. 1997;40(4):730-9. Hahn D, Blaschitz A, Korgun ET, Lang I, Desoye G, Skofitsch G, Dohr G. From maternal glucose to fetal glycogen: expression of key regulators in the human placenta. Mol Hum Reprod. 2001;7(12):1173-1178. Hahnemann, JM, Vejerslev, LO. Accuracy of cytogenetic findings on chorionic villus sampling (CVS) - diagnostic consequences of CVS mosaicism and non-mosaic discrepancy in centres contributing to EUCROMIC 1986-1992. Prenat Diagn 1997; 17:801. Hajkova P, Erhardt S, Lane N, Haaf T, El-Maarri O, Reik W, Walter J, Surani MA. Epigenetic reprogramming in mouse primordial germ cells. Mech Dev 2002; 117(1–2):15–23 Halliday J, Oke K, Breheny S, Algar E, J Amor D. Beckwith-Wiedemann syndrome and IVF: a casecontrol study. Am J Hum Genet 2004;75(3):526–528. Hammoud SS, Purwar J, Pflueger C, Cairns BR, Carrell DT. Alterations in sperm DNA methylation patterns at imprinted loci in two classes of infertility. Fertil Steril. 2010 Oct;94(5):1728-33. Hansen M, Kurinczuk JJ, Bower C, Webb S. The risk of major birth defects after intracytoplasmic sperm injection and in vitro fertilization. N Engl J Med. 2002 Mar 7;346(10):725-30. Hassold T, Hunt P. To err (meiotically) is human: the genesis of human aneuploidy. Nat. Rev. Genet. 2001; 2:280-291. Hatakeyama, C. Roles of confined placental mosaicism (CPM) and H19/IGF2 imprinting in pregnancies derived from intracytoplasmic sperm injection (ICSI). Unpublished MSc thesis. 2006. University of British Columbia. Helmerhorst, FM, Perquin, DA, Donker, D, Keirse, MJ. Perinatal outcome of singletons and twins after assisted conception: a systematic review of controlled studies. BMJ 2004; 328:261.  115  Herrera E, Amusquivar E, Lopez-Soldado I, Ortega H. Maternal lipid metabolism and placental lipid transfer. Horm Res. 2006;65 Suppl 3:59-64. Hochedlinger K, Plath K. Epigenetic reprogramming and induced pluripotency. Development. 2009;136(4):509-23. Horike S, Ferreira JC, Meguro-Horike M, Choufani S, Smith AC, Shuman C, Meschino W, Chitayat D, Zackai E, Scherer SW, Weksberg R. Screening of DNA methylation at the H19 promoter or the distal region of its ICR1 ensures efficient detection of chromosome 11p15 epimutations in Russell-Silver syndrome. Am J Med Genet A. 2009 Nov;149A(11):2415-23. Horsthemke B. Epimutations in human disease. Curr Top Microbiol Immunol. 2006;310:45-59. Howards, SS. Varicocele. Infert Reprod Med Clin North Am 1992; 3:429. Isaksson R, Gissler M, Tiitinen A: Obstetric outcome among women with unexplained infertility after IVF: a matched casecontrol study. Hum Reprod 2002;17:1755–1761 Isles AR, Holland AJ. Imprinted genes and mother-offspring interactions. Early Hum Dev. 2005 Jan;81(1):73-7. Jackson RA, Gibson KA, Wu YW, Croughan MS. Perinatal outcomes in singletons following in vitro fertilization: a meta-analysis. Obstet Gynecol 2004;103:551–563. Jones PA, Liang G. Rethinking how DNA methylation patterns are maintained. Nat. Rev. Genet. 2009; 10:805-811. Jones PA, Takai D. The role of DNA methylation in mammalian epigenetics. Science. 2001; 293(5532):1068-70. Junien C. Beckwith-Wiedemann syndrome, tumourigenesis and imprinting. Curr Opin Genet Dev 1992;2(3):431–438. Kalousek DK, Dill FJ. Chromosomal mosaicism confined to the placenta in human conceptions. Science. 1983 Aug 12;221(4611):665-7.  116  Kalousek DK, Langlois S, Robinson WP, Telenius A, Bernard L, Barrett IJ, Howard-Peebles PN, Wilson RD. Trisomy 7 CVS mosaicism: pregnancy outcome, placental and DNA analysis in 14 cases. Am J Med Genet. 1996 Nov 11;65(4):348-52. Kalousek DK, Vekemans M. Confined placental mosaicism. J Med Genet. 1996 Jul;33(7):52933. Kangaspeska S, Stride B, Métivier R, Polycarpou-Schwarz M, Ibberson D, Carmouche RP, Benes V, Gannon F, Reid G. Transient cyclical methylation of promoter DNA. Nature. 2008 Mar 6;452(7183):112-5. Katagiri Y, Aoki C, Tamaki-Ishihara Y, Fukuda Y, Kitamura M, Matsue Y, So A, Morita M. Effects of assisted reproduction technology on placental imprinted gene expression. Obstet Gynecol Int. 2010;2010. pii: 437528. Katalinic, A, Rosch, C, Ludwig, M. Pregnancy course and outcome after intracytoplasmic sperm injection: a controlled, prospective cohort study. Fertil Steril 2004; 81:1604. Katari S, Turan N, Bibikova M, Erinle O, Chalian R, Foster M, Gaughan JP, Coutifaris C, Sapienza C. DNA methylation and gene expression differences in children conceived in vitro or in vivo. Hum Mol Genet. 2009 Oct 15;18(20):3769-78. Epub 2009 Jul 15. Kerjean A, Dupont JM, Vasseur C, Le Tessier D, Cuisset L, Paldi A, Jaunnet P, Jeanpierre M. Establishment of the paternal methylation imprint of the human H19 and MEST/PEG1 genes during spermatogenesis. Hum Mol Genet. 2000; 9:2183-2187. Khosla S, Dean W, Brown D, Reik W, Feil R. Culture of preimplantation mouse embryos affects fetal development and the expression of imprinted genes. Biol Reprod. 2001; 64:918-926. Kirkpatrick G, Ferguson KA, Gao H, Tang S, Chow V, Yuen BH, Ma S. A comparison of sperm aneuploidy rates between infertile men with normal and abnormal karyotypes. Hum Reprod. 2008 Jul;23(7):1679-83. Klebanoff MA, Meirik O, Berendes HW. Second-generation consequences of small-for-dates birth. Pediatrics 1989 Aug;84(2):343-347. 117  Kobayashi H, Sato A, Otsu E, Hiura H, Tomatsu C, Utsunomiya T, Sasaki H, Yaegashi N, Arima T. Aberrant DNA methylation of imprinted loci in sperm from oligospermic patients. Hum Mol Genet. 2007 Nov 1;16(21):2542-51. Kotzot D. Review and meta-analysis of systematic searches for uniparental disomy (UPD) other than UPD 15. Am J Med Genet. 2002 Sep 1;111(4):366-75. Kovacs GT, Breheny S, Maclachlan V, Lowe P, Howlett D. Outcome of pregnancies achieved by in vitro fertilisation techniques and diagnosed as twins at the 6 week ultrasound. Aust N Z J Obstet Gynaecol 2004; 44:510. Krausz C, Quintana-Murci L, Barbaux S, Siffroi JP, Rouba H, Delafontaine D, SouleyreauTherville N, Arvis G, Antoine JM, Erdei E, Taar JP, Tar A, Jeandidier E, Plessis G,Bourgeron T, Dadoune JP, Fellous M, McElreavey K. A high frequency of Y chromosome deletions in males with nonidiopathic infertility. J Clin Endocrinol Metab 1999; 84:3606. Kuchinka BD, Barrett IJ, Moya G, Sánchez JM, Langlois S, Yong SL, Kalousek DK, Robinson WP. Two cases of confined placental mosaicism for chromosome 4, including one with maternal uniparental disomy. Prenat Diagn. 2001 Jan;21(1):36-9. Kuroda-Kawaguchi T, Skaletsky H, Brown LG, Minx PJ, Cordum HS, Waterston RH, Wilson RK, Silber S, Oates R, Rozen S, Page DC. The AZFc region of the Y chromosome features massive palindromes and uniform recurrent deletions in infertile men. Nat Genet 2001; 29:279. Kuwata T, Matsubara S, Ohkuchi A, Watanabe T, Izumi A, Honma Y, Yada Y, Shibahara H, Suzuki M. The risk of birth defects indichorionic twins conceived by assisted reproductive technology. Twin Res 2004; 7: 223–7. La Sala GB, Nucera G, Gallinelli A, Nicoli A, Villani MT, Blickstein I. Spontaneous embryonic loss following in vitro fertilization: Incidence and effect on outcomes. Am J Obstet Gynecol 2004; 191:741.  118  Lam R, Ma S, Robinson WP, Chan T, Yuen BH. Cytogenetic investigation of fetuses and infants conceived through intracytoplasmic sperm injection. Fertil Steril. 2001 Dec;76(6):12725. Lander ES, Linton LM, Birren B et al. Initial sequencing and analysis of the human genome. Nature. 2001; 409: 860-921. Lanzendorf, SE, Maloney, MK, Veeck, LL, Slusser, J. A preclinical evaluation of pronuclear formation by microinjection of human spermatozoa into human oocytes. Fertil Steril 1988; 49:835. Laurini R, Laurin J, Marsal K. Placental histology and fetal blood flow in intrauterine growth retardation. Acta Obstet Gynecol Scand 1994;73:529-534. Law, JA, Jacobsen SE. Establishing, maintaining and modifying DNA methylation patterns in plants and animals. Nature Rev. Genet. 2010; 11:204-220. Layman LC, Cohen DP, Jin M, Xie J, Li Z, Reindollar RH, Bolbolan S, Bick DP, Sherins RR, Duck LW, Musgrove LC, Sellers JC, Neill JD. Mutations in gonadotropin-releasing hormone receptor gene cause hypogonadotropic hypogonadism. Nat Genet 1998; 18:14 Leighton PA, Ingram RS, Eggenschwiler J, Efstratiadis A, Tilghman SM. Disruption of imprinting caused by deletion of the H19 gene region in mice. Nature. 1995 May 4;375(6526):34-9. Levron J, Aviram-Goldring A, Madgar I, Raviv G, Barkai G, Dor J. Sperm chromosome abnormalities in men with severe male factor infertility who are undergoing in vitro fertilization with intracytoplasmic sperm injection. Fertil Steril. 2001 Sep;76(3):479-84. Los FJ, van den Berg C, Van Opstal D, Noomen P, Braat AP, Galjaard RJ, Pijpers L, CohenOverbeek TE, Wildschut HI, Brandenburg H. Abnormal karyotypes in semi-direct chorionic villus preparations of women with different cytogenetic risks. Prenat Diagn 1998; 18:1023. Li B, Carey M, Workman JL. The role of chromatin during transcription. Cell. 2007 Feb 23;128(4):707-19. 119  Li, E. Chromatin modification and epigenetic reprogramming in mammalian development. Nat. Rev. Genet. 2002; 3:662-673. Li E, Bestor TH, Jaenisch R. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell. 1992; 69:915-926 Li JY, Lees-Murdock DJ, Xu GL, Walsh CP. Timing of establishment of paternal methylation imprints in the mouse. Genomics. 2004; 84:952-960. Librach CL, Feigenbaum SL, Bass KE, Cui T, Verastas N, Sadovsky Y, Quigley JP, French DL, Fisher SJ. Interleukin-1β regulates human cytotrophoblast metalloproteinase activity and invasion in vitro. J Biol Chem., 1994; 269, 17125-17131. Lin CC, Santolaya-Forgas J. Current concepts of fetal growth restriction: part I. Causes, classification, and pathophysiology. Obstet Gynecol. 1998;92(6):1044-55. Lucifero D, Chaillet JR, Trasler JM. Potential significance of genomic imprinting defects for reproduction and assisted reproductive technology. Hum. Reprod. Update. 2004; 10:318. Ludwig T, Eggenschwiler J, Fisher P, Ercole AJ, Davenport ML, Efstratiadis A. Mouse mutants lacking the type 2 IGF receptor (IGF2R) are rescued from perinatal lethality in IGF2 and Igf1r null backgrounds, Dev. Biol. 1996; 177: 517–573. Luedi PP, Dietrich FS, Weirdman JR, Bosko JM, Jirtle RL, Hartemink AJ. Computational and experimental identification of novel human imprinted genes. Genome res. 2007; 17:1723-30. Lunde A, Melve KK, Gjessing HK, Skjaerven R, Irgens LM. Genetic and environmental influences on birth weight, birth length, head circumference, and gestational age by use of population-based parent-offspring data. Am J Epidemiol. 2007 Apr 1;165(7):734-41. Lunghi L, Ferretti ME, Medici S, Biondi C, Vesce F. Control of human trophoblast function. Reprod Biol Endocrinol. 2007 Feb 8;5:6 Lyall, F. The human placental bed revisited. Placenta 2002; 23, 555 – 562. 120  Ma S, Kalousek DK, Zouves C, Yuen BH, Gomel V, Moon YS. Chromosome analysis of human oocytes failing to fertilize in vitro. Fertil Steril. 1989 Jun;51(6):992-7. MacAdams, MR, White, RH, Chipps, BE. Reduction of serum testosterone levels during chronic glucocorticoid therapy. Ann Intern Med 1986; 104:648. Malloy MH. Size for gestational age at birth: impact on risk for sudden infant death and other causes of death, USA 2002. Arch Dis Child Fetal Neonatal Ed. 2007;92(6):F473-8. Mann MR, Lee SS, Doherty AS, Verona RI, Nolen LD, Schultz RM, Bartolomei MS. Selective loss of imprinting in the placenta following preimplantation development in culture. Development. Development. 2004 Aug;131(15):3727-35. Epub 2004 Jul 7. Maher ER, Brueton LA, Bowdin SC, Luharia A, Cooper W, Cole TR, Macdonald F, Sampson JR, Barratt CL, Reik W, Hawkins MM. Beckwith-Wiedemann syndrome and assisted reproduction technology (ART). J Med Genet. 2003; 40: 62-64. Market-Velker BA, Zhang L, Magri LS, Bonvissuto AC, Mann MR. Duel effects of superovulation: loss of maternal and paternal imprinted methylation in a dose-dependant manner. Hum Mol Genet. 2010; 19:36-51. Marques CJ, Carvalho F, Sousa M, Barros A.Genomic imprinting in disruptive spermatogenesis. Lancet. 2004 May 22;363(9422):1700-2. Marques CJ, Costa P, Vaz B, Carvalho F, Fernandes S, Barros A, Sousa M. Abnormal methylation of imprinted genes in human sperm is associated with oligozoospermia. Mol Hum Reprod. 2008 Feb;14(2):67-74. Mayer W, Niveleau A, Walter J, Fundele R, Haaf T. Demethylation of zygotic paternal genome. Nature. 2000; 403:501-502. McDonald SD, Han Z, Mulla S, Ohlsson A, Beyene J, Murphy KE; Knowledge Synthesis Group. Preterm birth and low birth weight among in vitro fertilization twins: a systematic review and meta-analyses. Eur J Obstet Gynecol Reprod Biol. 2010 Feb;148(2):105-13.  121  McElreavey K, Ravel C, Chantot-Bastaraud S, Siffroi JP. Y chromosome variants and male reproductive function. Int J Androl. 2006 Feb;29(1):298-303 Meekins, J. W., Pijnenborg, R., Hanssens, M., McFadyen, I. R., & Van Asshe, A. (1994). A study of placental bed spiral arteries and trophoblast invasion in normal and severe preeclamptic pregnancies. British Journal of Obstetrics and Gynaecology, 101, 669 – 674. Merlob P, Fisch B: Neonatal outcome and congenital malformations in children born after IVF.HumReprod 2002;17:3004– 3005 Metivier, R., Gallais, R., Tiffoche, C., Le Peron, C., Jurkowska, R.Z., Carmouche, R.P., Ibberson, D., Barath, P., Demay, F., Reid, G., Benes, V., Jeltsch, A., Gannon, F. & Salbert, G. Cyclical DNA methylation of a transcriptionally active promoter. Nature. 2008;452(7183):45-50. Miozzo M, Simoni G. The role of imprinted genes in fetal growth. Biol Neonate. 2002; 81(4):217-28. Minor A, Wong EC, Harmer K, Ma S. Molecular and cytogenetic investigation of Y chromosome deletions over three generations facilitated by intracytoplasmic sperm injection. Prenat Diagn. 2007 Aug;27(8):743-7. Montague CT, Farooqi IS, Whitehead JP, Soos MA, Rau H, Wareham NJ, Sewter CP, Digby JE, Mohammed SN, Hurst JA, Cheetham CH, Earley AR, Barnett AH, Prins JB, O'Rahilly S. Congenital leptin deficiency is associated with severe early-onset obesity in humans. Nature 1997; 387:903. Murrell A, Heeson S, Reik W. Interaction between differentially methylated regions partitions the imprinted genes IGF2 and H19 into parent specific chromatin loops. Nat. Genet. 2004; 36:889-893. Nakao M. Epigenetics: interaction of DNA methylation andchromatin. Gene. 2001; 278: 25-31. Nazlican H, Zeschnigk M, Claussen U, Michel S, Boehringer S, Gillessen-Kaesbach G, Buiting K, Horsthemke B.nSomatic mosaicism in patients with Angelman syndrome and an imprinting defect. Hum Mol Genet. 2004 Nov 1;13(21):2547-55. 122  Neerhof MG. Causes of intrauterine growth restriction. Clin Perinatol. 1995;22(2):375-85. Nelissen EC, van Montfoort AP, Dumoulin JC, Evers JL. Epigenetics and the placenta. Hum Reprod Update. 2010 Oct 19. Nicolaidis P, Peterson MB. Origin and mechanisms of non-disjunction in human autosomal trisomies. Hum Reprod. 1998; 13; 313-319. Niemitz E, Feinberg A. Epigenetics and assisted reproduction: a call for investigation. Am J Hum Genet 2004; 74:599-609. Norton JN, Skinner MK. Regulation of Sertoli cell function and differention through the actions of a testicular paracrine factor. Endocrinology 1989;I24:271 1-27 19. Oakes CC, Kelly TL, Robaire B, Trasler JM. Adverse effects of 5-aza-2’-deoxycytidine on spermatogenesis include reduced sperm function and selective inhibition of de novo DNA methylation. J Pharmacol Exp Ther. 2007; 322:1171-1180. Obata Y, Kaneko-Ishino T, Koide T, Takai Y, Ueda T, Domeki I, Shiroishi T, Ishino F, Kono T. Disruption of primary imprinting during oocyte growth leads to the modified expression of imprinted genes during embryogenesis. Development 1998;125(8):1553–1560 Ohashi Y, Miharu N, Honda H, Samura O, Ohama K . High frequency of XY disomy in spermatozoa of severe oligozoospermic men. Hum Reprod 2001; 16:703. Okano M, Bell DW, Haber DA, Li E. DNA methyltransferase Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell. 1999; 99:247-257. Olivennes F, Rufat P, André B, Pourade A, Quiros MC, Frydman R. The increased risk of complication observed in singleton pregnancies resulting from in-vitro fertilization (IVF) does not seem to be related to the IVF method itself. Hum Reprod 1993; 8:1297. Olson CK: In vitro fertilization is associated with an increase in major birth defects. Fertil Steril 2005; 84: 1308–15. Ooi SK, Bestor TH. The colorful history of active DNA demethylation. Cell. 2008;133(7):11458. 123  Overton C, Park C. Endometriosis. More on the missed disease. BMJ. 2010 ;341:c3727 Owen CM, Segars JH Jr. Imprinting disorders and assisted reproductive technology. Semin Reprod Med. 2009 Sep;27(5):417-28. Epub 2009 Aug 26. Palermo GD, Colombero LT, Schattman GL, Davis OK, Rosenwaks Z: Evolution of pregnancies and initial follow-up of newborns delivered after intra cytoplasmic sperm injection. JAMA 1996;276:1893–1897 Palermo, G, Joris, H, Devroey, P, Van Steirteghem, AC. Pregnancies after intracytoplasmic injection of single spermatozoon into an oocyte. Lancet 1992; 340:17. Pang, MG, Kim, YJ, Lee, SH, Kim, CK. The high incidence of meiotic errors increases with decreased sperm count in severe male factor infertilities. Hum Reprod 2005; 20:1688. Papaioannou S. A hypothesis for the pathogenesis and natural history of proximal tubal blockage. Hum Reprod. 2004 Mar;19(3):481-5. Patrizio P, Asch RH, Handelin B, Silber SJ. Aetiology of congenital absence of vas deferens: genetic study of three generations. Hum Reprod. 1993 Feb;8(2):215-20. Paulson M, El-Maarri O, Engemann S, Strodicke M, Franck O, Davies K, Reinhardt R, Reik W, Walter J. Sequence conservation and variability of imprinting in the BeckwithWiedemann syndrome gene cluster in human and mouse. Human Mol Genet. 2000; 9:1828-41. Pellestor F, Andreo B, Arnal F, Humeau C, Demaille J. Maternal aging and chromosomal abnormalities: new data drawn from in vitro unfertilized human oocytes. Hum Genet. 2003 Feb;112(2):195-203. Pellestor F, Andreo B, Anahory T, Hamamah S. The occurance of aneuploidy in human: lessons from the cytogenetic studies of human oocytes. Eur J of Med Genet. 2006; 49:103-116. Pettenati MJ, Haines JL, Higgins RR, Wappner RS, Palmer CG, Weaver DD. WiedemannBeckwith syndrome: presentation of clinical and cytogenetic data on 22 new cases and review of the literature. Hum Genet. 1986; 74:143-154.  124  Pezeshki K, Feldman J, Stein DE, Lobel SM, Grazi RV. Bleeding and spontaneous abortion after therapy for infertility. Fertil Steril 2000; 74:504. Pinborg, A, Lidegaard, O, la Cour, Freiesleben N, Andersen, AN. Consequences of vanishing twins in IVF/ICSI pregnancies. Hum Reprod 2005; 20:2821. Pinborg A, Lidegaard O, Freiesleben NC, Andersen AN. Vanishing twins: a predictor of smallfor-gestational age in IVF singletons. Hum Reprod 2007;22:2707–2714. Pinborg A, Loft A, Rasmussen S, Schmidt L, Langhoff-Ross J, Greisen G, Andersen AN: Neonatal outcome in a Danish national cohort of 3438 IVF/ICSI and 10362 nonIVF/ICSI twins born between 1995 and 2000. Hum Reprod 2004;19:435–441 Place I, Englert Y: A prospective longitudinal study of the physical,psychomotor, and intellectual development of singleton children upto 5 years who were conceived by intracytoplasmic sperm injectioncompared with children conceived spontaneously and by in vitro fertilization. Fertil Steril 2003; 80: 1388–97. Ponger L, Li WH.Evolutionary diversification of DNA methyltransferases in eukaryotic genomes. Mol Biol Evol. 2005 Apr;22(4):1119-28. Randhawa R, Cohen P. The role of the insulin-like growth factor system in prenatal growth. Mol Genet Metab. 2005 Sep-Oct;86(1-2):84-90. Racowsky C. High rates of embryonic loss, yet high incidence of multiple births in human ART: is this paradoxical? Theriogenology. 2002 Jan 1;57(1):87-96. Reijo R, Lee TY, Salo P, Alagappan R, Brown LG, Rosenberg M, Rozen S, Jaffe T, Straus D, Hovatta O, Diverse spermatogenic effects in humans caused by Y chromosome deletions encompassing a novel RNA-binding protein gene. Nat Genet 1995; 10:383. Reik W, Dean W, Walter J. Epigenetic reprogramming in mammalian development. Science 2001;293(5532):1089–1093. Resnik R. Intrauterine growth restriction. Obstet Gynecol 2002; 99:490-496.  125  Richardson, SJ, Senikas, V, Nelson, JF. Follicular depletion during the menopausal transition: evidence for accelerated loss and ultimate exhaustion. J Clin Endocrinol Metab 1987; 65:1231. Rimm AA, Katayama AC, Diaz M, Katayama KP: A meta-analysis of controlled studies comparing major malformation rates in IVF and ICSI infants with naturally conceived children. J Assist Reprod Genet 2004 ; 21: 437–43. Rivera RM, Stein P, Weaver JR, Mager J, Schultz RM, Bartolomei MS. Manipulations of mouse embryos prior to implantation result in aberrant expression of imprinted genes on day 9.5 of development. Hum Mol Genet. 2008; 17:1-14. Rives N, Jarnot M, Mousset-Siméon N, Joly G, Macé B. Fluorescence in situ hybridisation (FISH) analysis of chromosome segregation and interchromosomal effect in spermatozoa of a reciprocal translocation t(9,10)(q11;p11.1) carrier. J Hum Genet. 2003;48(10):53540. Epub 2003 Oct 2. Rizzo G, Arduini D. Intrauterine growth restriction: diagnosis and management. A review. Minerva Ginecol. 2009 Oct;61(5):411-20. Roberts K, Griswold MD. Testosterone induction of cellular proteins in cultured Sertoli cells from hypophysectomised rats and rats of different ages. Endocrinology 1989;125:l 1741179. Robinson WP, Barrett IJ, Bernard L, Telenius A, Bernasconi F, Wilson RD, Best RG, HowardPeebles PN, Langlois S, Kalousek DK. Meiotic origin of trisomy in confined placental mosaicism is correlated with presence of fetal uniparental disomy, high levels of trisomy in trophoblast, and increased risk of fetal intrauterine growth restriction. Am J Hum Genet. 1997 Apr;60(4):917-27. Rossant J, Cross JC. Placental development: lessons from mouse mutants. Nat Rev Genet. 2001 Jul;2(7):538-48. Sadler TW. Langman’s medical embryology. Lippincott Williams and Wilkins. USA. Wolters Kluwer Company, 2006; pp 11-28, 229-256. 126  Sakian S, Minor A, Miller K, Ferguson K, Chan Wong W, Ma S. The occurrence of Ychromosome microdeletions in babies born through intracytoplasmic sperm injection (ICSI) and in vitro fertilization (IVF). Presented at the American Society of Reproductive Medicine, San Fransicso. 2008; P-843. Sato A, Otsu E, Negishi H, Utsunomiya T, Arima T. Aberrant DNA methylation of imprinted loci in superovulated oocytes. Hum Reprod. 2007; Jan;22(1):26-35. Schieve LA, Meikle SF, Peterson HB, Jeng G, Burnett NM, Wilcox LS. Does assisted hatching pose a risk for monozygotic twinning in pregnancies conceived through in vitro fertilization? Fertil Steril 2000; 74:288. Schieve LA, Meikle SF, Ferre C, Peterson HB, Jeng G, Wilcox LS. Low and very low birth weight in infants conceived with use of assisted reproductive technology. N Engl J Med 2002;346:731–737. Schwartz CE, Dean J, Howard-Peebles PN, Bugge M, Mikkelsen M, Tommerup N, Hull C, Hagerman R, Holden JJ, Stevenson RE. Obstetrical and gynecological complications in fragile X carriers: a multicenter study. Am J Med Genet 1994; 51:400. Selhub J & Miller JW. The pathogenesis of homocysteinemia: interruption of the coordinate regulation by S-adenosylmethionine of the remethylation and transsulfuration of homocysteine. Amer J of Clin Nutrition. 1992; 55: 131-138. Selling KE, Carstensen J, Finnstrom O, Sydsjo G. Intergenerational effects of preterm birth and reduced intrauterine growth: a population-based study of Swedish mother-offspring pairs. BJOG. 2006 Apr;113(4):430-40. Seminara SB, Messager S, Chatzidaki EE, Thresher RR, Acierno JS Jr, Shagoury JK, Bo-Abbas Y, Kuohung W, Schwinof KM,Hendrick AG, Zahn D, Dixon J, Kaiser UB, Slaugenhaupt SA, Gusella JF, O'Rahilly S, Carlton MB, Crowley WF Jr, Aparicio SA,Colledge WH. The GPR54 gene as a regulator of puberty. N Engl J Med 2003; 349:1614  127  Settle P, Mynett K, Speake P, Champion E, Doughty IM, Sibley CP, D'Souza SW, Glazier J. Polarized lactate transporter activity and expression in the syncytiotrophoblast of the term human placenta. Placenta. 2004;25(6):496-504. Schieve LA, Meikle SF, Ferre C, Peterson HB, Jeng G, Wilcox LS. Low and very low birth weight in infants conceived with use of assisted reproductive technology. N Engl J Med 2002; 346:731. Sherman BM; Korenman SG. Hormonal characteristics of the human menstrual cycle throughout reproductive life. J Clin Invest 1975 Apr;55(4):699-706. Shi Q, Martin RH. Aneuploidy in human spermatozoa: FISH analysis in men with constitutional chromosomal abnormalities, and in infertile men. Reproduction. 2001 May;121(5):65566. Simoni G, Sirchia SM. Confined placental mosaicism. Prenat Diagn. 1994 Dec;14(13):1185-9. Skiadas CC, Missmer SA, Benson CB, Gee RE, Racowsky C. Risk factors associated with pregnancies containing a monochorionic pair following assisted reproductive technologies. Hum Reprod 2008; 23:1366. Spahn L, Barlow DP. An ICE pattern crystallizes. Nat Genet. 2003; 35; 11-2. Spratt DI, Carr DB, Merriam GR, Scully RE, Rao PN, Crowley WF Jr. The spectrum of abnormal patterns of gonadotropin releasing hormone secretion in men with idiopathic hypogonadotropic hypogonadism: Clinical and laboratory correlations. J Clin Endocrinol Metab 1987; 64:283 Steptoe, PC, Edwards, RG. Reimplantation of a human embryo with subsequent tubal pregnancy. Lancet 1976; 1:880 Steinman, G. Mechanisms of twinning. VI. Genetics and the etiology of monozygotic twinning in in vitro fertilization. J Reprod Med 2003; 48:583. Stetten G, Escallon CS, South ST, McMichael JL, Saul DO, Blakemore KJ. Reevaluating confined placental mosaicism. Am J Med Genet A 2004; 131:232. 128  Stocco C, Telleria C, Gibori G. The molecular control of corpus luteum formation, function, and regression. Endocr Rev. 2007 Feb;28(1):117-49. Strauss RS. Adult Functional Outcome of Those Born Small for Gestational Age: Twenty-sixYear Follow-up of the 1970 British Birth Cohort. JAMA 2000; 283:625-632. Sutcliffe AG, Peters CJ, Bowdin S, Temple K, Reardon W, Wilson L, Clayton-Smith J, Breuton LA, Bannister W, Maher ER. Assisted reproductive therapies and imprinting disorders— a preliminary survey. Human Reprod. 2006 Apr;21(4) 1009-11. Sutcliffe AG, Saunders K, McLachlan R, Taylor B, Edwards P, Grudzinskas G, Leiberman B, Thornton S. A retrospective casecontrolstudy of developmental and other outcomes in a cohort of Australian children conceived by intracytoplasmic sperm injectioncompared with a similar group in the United Kingdom. Fertil Steril 2003; 79: 512–6. Sutcliffe AG, Taylor B, Saunders K, Thornton S, Lieberman BA,Grudzinskas JG: Outcome in the second year of life after in-vitro fertilisation by intracytoplasmic sperm injection: a UK case-control study. Lancet 2001; 357: 2080–4. Svensson AC, Pawitan Y, Cnattingius S, Reilly M, Lichtenstein P. Familial aggregation of smallfor-gestational-age births: the importance of fetal genetic effects. Am J Obstet Gynecol. 2006 Feb;194(2):475-9. Szabó PE, Hübner K, Schöler H, Mann JR. Allele-specific expression of imprinted genes in mouse migratory primordial germ cells. Mech Dec. 2002; 115:157-160. Szabó PE, Tang SH, Silva FJ, Tsark WM, Mann JR. Role of CTCF binding sites in the IGF2/H19 imprinting control region. Mol Cell Biol. 2004 Jun;24(11):4791-800. Tanos V, Ariel I, Prus D, De-Groot N, Hochberg A. H19 and IGF2 gene expression in human normal, hyperplastic, and malignant endometrium. Int J Gynecol Cancer 2004;14:521–5. Teng YN, Lin YM, Sun HF, Hsu PY, Chung CL, Kuo PL. Association of DAZL haplotypes with spermatogenic failure in infertile men. Fertil Steril 2006; 86:129.  129  Thorburn MJ, Wright ES, Miller CG, Smith-Read EH. Exomphalos-macroglossia-gigantism syndrome in Jamaican infants. Am J Dis Child 1970;119(4):316–321. Toledo SP, Brunner HG, Kraaij R, Post M, Dahia PL, Hayashida CY, Kremer H Themmen AP. An inactivating mutation of the luteinizing hormone receptor causes amenorrhea in a 46,XX female. J Clin Endocrinol Metab 1996; 81:3850. Tung JY, Rosen MP, Nelson LM, Turek PJ, Witte JS, Cramer DW, Cedars MI, Reijo-Pera RA. Novel missense mutations of the Deleted-in-AZoospermia-Like (DAZL) gene in infertile women and men. Reprod Biol Endocrinol 2006; 4:40. Urman B, Yakin K. Ovulatory disorders and infertility. J Reprod Med. 2006 Apr;51(4):267-82. van der Ven K, Messer L, van der Ven H, Jeyendran RS, Ober C. Cystic fibrosis mutation screening in healthy men with reduced sperm quality. Hum Reprod. 1996 Mar;11(3):5137. Van den Veyver IB. Genetic effects of methylation diets. Annu Rev Nutr. 2002;22:255-82. Van Opstal D, Van den Berg C, Deelen WH, Brandenburg H, Cohen-Overbeek TE, Halley DJ, Van den Ouweland AM, In 't Veld PA, Los FJ. Prospective prenatal investigations on potential uniparental disomy in cases of confined placental trisomy. Prenat Diagn 1998; 18:35. Van Steirteghem A, Bonduelle M, Devroey P, Liebaers I. Follow-up of children born after ICSI. Hum Reprod Update. 2002 Mar-Apr;8(2):111-6. Varvarigou AA. Intrauterine growth restriction as a potential risk factor for disease onset in adulthood. J Pediatr Endocrinol Metab. 2010 Mar;23(3):215-24. Veldhuis, JD, Dufau, ML. Estradiol modulates the pulsatile secretion of biologically active luteinizing hormone in man. J Clin Invest 1987; 80:631. Vertino PM, Yen RW, Gao J, Baylin SB. De novo methylation of CpG island sequences in human fibroblasts overexpressing DNAn(cytosine-5-)-methyltransferase. Molecular and Cellular Biology. 1996; 16: 4555-4565. 130  Verlaenen H, Cammu H, Derde MP, Amy JJ: Singleton pregnancy after in vitro fertilization: expectations and outcome. Obstet Gynecol 1995;86:906–910 Vogt, PH. Azoospermia factor (AZF) in Yq11: towards a molecular understanding of its function for human male fertility and spermatogenesis. Reprod Biomed Online 2005; 10:81. Vogt PH, Edelmann A, Kirsch S, Henegariu O, Hirschmann P, Kiesewetter F, Köhn FM, Schill WB, Farah S, Ramos C, Hartmann M, Hartschuh W, Meschede D, Behre HM, Castel A, Nieschlag E, Weidner W, Gröne HJ, Jung A, Engel W, Haidl G. Human Y chromosome azoospermia factors (AZF) mapped to different subregions in Yq11. Hum Mol Genet. 1996 Jul;5(7):933-43. Volarcik K, Sheean L, Goldfarb J, Woods L, Abdul-Karim FW, Hunt P. The meiotic competence of in-vitro matured human oocytes is influenced by donor age: evidence that folliculogenesis is compromised in the reproductively aged ovary. Hum Reprod. 1998 Jan;13(1):154-60. Waddington CH. The Strategy of the Genes; a discussion of Some Aspects of Theoretical Biology. London: Allen & Unwin; 1957. Walenkamp MJ, Wit JM. Single gene mutations causing SGA. Best Pract Res Clin Endocrinol Metab. 2008 Jun;22(3):433-46. Walter, J, Paulsen, M. Imprinting and disease. Semin. Cell Dev. Biol., 2003; 14, 101-110. Wang Y, Leug FC. An evaluation of new criteria for CpGislands in the human genome as gene markers. Bioinformatics. 2004; 20: 1170-1177. Wang YA, Sullivan EA, Black D, Dean J, Bryant J, Chapman M. Preterm birth and low birth weight after assisted reproductive technology-related pregnancy in Australia between 1996 and 2000. Fertil Steril 2005; 83:1650. Weksberg R, Shuman C, Caluseriu O, Smith AC, Fei YL, Nishikawa J, Stockley TL, Best L, Chitayat D, Olney A, Ives E, Schneider A, Bestor TH, Li M, Sadowski P, Squire J. Discordant KCNQ1OT1 imprinting in sets of monozygotic twins discordant for Beckwith-Wiedemann syndrome. Hum Mol Genet 2002;11(11):1317–1325. 131  Weksberg R, Shuman C, Smith AC. Beckwith-Wiedemann syndrome. Am J Med Genet C Semin Med Genet 2005;137C(1):12–23. Weksberg R, Smith AC, Squire J, Sadowski P. Beckwith-Wiedemann syndrome demonstrates a role for epigenetic control of normal development. Hum Mol Genet 2003;12:61–68. Welt CK; Martin KA, Taylor AE, Lambert-Messerlian GM, Crowley WF Jr, Smith JA, Schoenfeld DA, Hall JE. Frequency modulation of follicle-stimulating hormone (FSH) during the luteal-follicular transition: evidence for FSH control of inhibin B in normal women. J Clin Endocrinol Metab 1997 Aug;82(8):2645-52. Wennerholm UB, Bergh C, Hamberger L, Westlander G, Wikland M, Wood M. Obstetric outcome of pregnancies following ICSI, classified according to sperm origin and quality. Hum Reprod 2000;15:1189–1194. Westergaard HB, Johansen AM, Erb K, Andersen AN: Danish nationalin-vitro fertilization registry 1994 and 1995: a controlled study ofbirths, malformations and cytogenetic findings. Hum Reprod 1999; 14: 1896–902. Westhoff, C, Murphy, P, Heller, D. Predictors of ovarian follicle number. Fertil Steril 2000; 74:624 Wiedemann H. Tumours and hemihypertrophy associated with Wiedemann-Beckwith syndrome. Eur J Pediatr 1983;141:129. Wilkin F, Paquette J, Ledru E, Hamelin C, Pollak M, Deal CL. H19 sense and antisense transgenes modify insulin-like growth factor-II mRNA levels. Eur J Biochem. 2000; 267:4020-4027. Wilkins-Haug L. Assisted reproductive technology, congenital malformations, and epigenetic disease. Clinical Obstetrics Gynecology 2008;51(1):96–105 Wilkins-Haug, L, Roberts, DJ, Morton, CC. Confined placental mosaicism and intrauterine growth retardation: a case-control analysis of placentas at delivery. Am J Obstet Gynecol 1995; 172:44.  132  Wolstenholme J, White I, Sturgiss S, Carter J, Plant N, Goodship JA. Maternal uniparental heterodisomy for chromosome 2: detection through 'atypical' maternal AFP/hCG levels, with an update on a previous case. Prenat Diagn. 2001 Oct;21(10):813-7. Woldringh GH, Janssen IM, Hehir-Kwa JY, van den Elzen C, Kremer JA, de Boer P, Schoenmakers EF. Constitutional DNA copy number changes in ICSI children. Hum Reprod 2009; 24:233. World Health Organization. Towards more objectivity in diagnosis and management of male infertility. Int J Androl 1987; 7(Suppl):1 World Health Organization. WHO laboratory manual for the examination of human semen and spermcervical mucus interactions. Cambridge University Press. 1999; 4:4-33. Wu SC, Zhang Y. Active DNA demethylation: many roads lead to Rome. Mol Cell Biol. 2010; 11:607-620. Yamashita R, Suzuki Y, Sugano S, Nakai K. Genome-wide analysis reveals strong correlation between CpG islands with nearby transcription start sites of genes and their tissue specificity. Gene. 2005; 350: 129-136. Young LE, Fernandes K, McEvoy TG, Buttersmith SC, Gutierrez CG, Carolan C, Broadbent PJ, Robinson JJ, Wilmut I, Sinclair KD. Epigenetic change in IGFR2 is associated with fetal overgrowth after sheep embryo culture. Nat Genet. 2001; 27:153-154. Yu W, Ginjala V, Pant V, Chernukhin I, Whitehead J, Docquier F, Farrar D, Tavoosidana G, Mukhopadhyay R, Kanduri C. Poly(ADP-ribosyl)ation regulates CTCF-dependant chromatin insulation. Nat Genet. 2004; 36:1105-1110. Zadori J, Kozinszky Z, Orvos H, Katona M, Ka´ ali SG, P´ al A: The incidence of major birth defects following in vitro fertilization. J Assist Reprod Genet 2003;20:131–132 Zybina, T. G., Kaufmann, P., Frank, H. G., Freed, J., Kadyrov, M., & Biesterfeld, S. (2002). Genome multiplication of extravillous trophoblast cells in human placenta in the course of differentiation and invasion into endometrium and myometrium. I. Dynamics of polyploidization. Tsitologiia, 44, 1058 –1067. 133  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0071600/manifest

Comment

Related Items