Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Regulated expression of aggrecanases of ADAMTS family in endometrial physiology and pathology Wen, Jiadi 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2011_spring_wen_jiadi.pdf [ 1.55MB ]
Metadata
JSON: 24-1.0071568.json
JSON-LD: 24-1.0071568-ld.json
RDF/XML (Pretty): 24-1.0071568-rdf.xml
RDF/JSON: 24-1.0071568-rdf.json
Turtle: 24-1.0071568-turtle.txt
N-Triples: 24-1.0071568-rdf-ntriples.txt
Original Record: 24-1.0071568-source.json
Full Text
24-1.0071568-fulltext.txt
Citation
24-1.0071568.ris

Full Text

REGULATED EXPRESSION OF AGGRECANASES OF ADAMTS FAMILY IN ENDOMETRIAL PHYSIOLOGY AND PATHOLOGY  by Jiadi Wen M.Sc., The University of British Columbia, Canada, 2006 M.D., Capital University of Medical Sciences, China, 1993  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Reproductive and Developmental Sciences)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) December 2010  © Jiadi Wen, 2010  ABSTRACT The ADAMTS (A Disintegrin and Metalloproteinase with TromboSpondin Repeats) are a novel family of secreted metalloproteinases. There is increasing evidence that distinct ADAMTS subtypes play key roles in embryonic development, reproduction and cancer. Nineteen ADAMTS subtypes have been identified in humans but most of them have been characterized only at the structural level. ADAMTS-1, -4, -5, -8, -9 and -15 have been subclassified into a subfamily, known as aggrecanases, owing to their ability to cleave the important extracellular matrix components, versican and aggrecan. Previous studies have determined that ADAMTS-1 and -5 are expressed in first trimester decidual cells and are regulated by IL-1ß and TGF- ß1. I have now found that gonadal steroids have complex regulatory effects upon ADAMTS-1 mRNA and ADAMTS-1 levels in endometrial stromal cells during the human menstrual cycle. I further demonstrate that progesterone (P4) and 5α-dihydrotestosterone (DHT), differentially regulated ADAMTS-5, -8, and -9 mRNA and protein levels in human endometrial stromal cells, suggesting that aggrecanases contribute to steroid-mediated ECM remodeling in the endometrium in preparation for pregnancy. My loss- and gain- of function studies have confirmed a function for ADAMTS-1 in endometrial cancer invasion. Overexpression of ADAMTS-1 in well-differentiated ECC-1 endometrial carcinoma cells promoted cell invasion. In contrast, siRNA-mediated silencing of endogenous ADAMTS-1 in poorly differentiated KLE cells decreased their invasive capacity. I have also found that 17ß-estradiol (E2) can up-regulate ADAMTS-1 mRNA and protein levels in ECC-1 cells. This suggests that ADAMTS-1 plays an important role in endometrial cancer progression, and that E2 promotes well-differentiated endometrial cancer cell invasion, at least in part by specific  ii  up-regulating ADAMTS-1 expression. Overall, my research provides useful insight into the molecular mechanisms that regulate endometrial physiology and pathology, and additional support for the concept that ADAMTS represent potentially useful prognostic biomarkers of recurrent pregnancy loss and endometrial cancer.  iii  PREFACE Clinical Research Ethics Board has approved the studies that present in this thesis. The number of the Certificate of Expedited Approval is C03-0542.  iv  TABLE OF CONTENTS Abstract ………………………………………………………………………………….. ii Preface..…………………………………………………………………………………..iv Table of Contents..………………………………………………………………………...v List of Tables....…………………………………………………………………………....x List of Figures...…………………………………………………………………………..xi List of Abbreviations..…………………………………………………………………..xiv Acknowledgements ………..…………………………………………………………...xvi CHAPTER 1. 1.1  INTRODUCTION .................................................................................. 1  Endometrial Physiology........................................................................................ 2  1.1.1  Histological Features of Endometrial Receptivity......................................... 2  1.1.2  Molecular Character of Endometrial Receptivity.......................................... 4  1.1.3  Endometrial Cell Model Systems ................................................................... 5  1.2  Endometrial Pathology and Endometrial Cancer.................................................. 7  1.2.1  Pathological Characteristics of Endometrial Carcinoma ............................. 8  1.2.2  Cell Model System of Endometrial Cancer Research.................................. 10  1.3  Gonadal Steroids and Endometrial Remodeling................................................. 12  1.3.1  Role of Gonadal Steroids in Decidualization .............................................. 13  1.3.2  Role of Gonadal Steroids in Endometrial Cancer Development ................. 18  1.3.3  Anti-steroidal Compounds ........................................................................... 21  1.4  Extracellular Matrix (ECM) Remodeling of the Endometrium.......................... 24  1.4.1 1.5  Proteolytic Mechanism of Endometrial ECM Remodeling.......................... 28  The ADAMTS Gene Family of Metalloproteinases........................................... 37  v  1.5.1  Structural and Functional Organization of ADAMTS Subtypes.................. 39  1.5.2  Cell Biology of ADAMTS ............................................................................. 45  1.5.3  Regulation of ADAMTS Expression and Function ...................................... 48  1.5.4  ADAMTS and Pregnancy............................................................................. 50  1.5.5  ADAMTS and Cancer .................................................................................. 52  1.6  Hypothesis and Rationale ................................................................................... 54  CHAPTER 2. 2.1  MATERIALS AND METHODS ......................................................... 58  Cells and Culture Conditions .............................................................................. 58  2.1.1  Tissues.......................................................................................................... 58  2.1.2  Endometrial Stromal Cells........................................................................... 59  2.1.3  Endometrial Cancer Cell Lines ................................................................... 60  2.2  Experimental Culture Conditions ....................................................................... 60  2.2.1  Steroid Treatment......................................................................................... 60  2.2.2  Antisteroid Treatment .................................................................................. 61  2.3  Methods............................................................................................................... 62  2.3.1  RNA Preparation and Synthesis of First Strand cDNA ............................... 62  2.3.2  Design of Oligonucleotide Primers ............................................................. 63  2.3.3  Real-time Quantitative (q)RT-PCR.............................................................. 64  2.3.4  Semiquantitative RT-PCR ............................................................................ 65  2.3.5  Western Blot Analysis .................................................................................. 66  2.3.6  Transwell Invasion Assay ............................................................................ 67  2.3.7  siRNA Transfection ...................................................................................... 68  2.3.8  Expression Vector ........................................................................................ 69  vi  2.3.9 2.4  Transient Transfection of Full-length ADAMTS-1 cDNA .......................... 69  Statistical Analysis.............................................................................................. 70  CHAPTER 3.  REGULATION AND FUNCTION OF AGGRECANASES IN THE  MATURATION OF HUMAN ENDOMETRIUM .......................................................... 71 3.1  Results................................................................................................................. 71  3.1.1  Expression Levels of Aggrecanases and Versican in Endometrial Stroma  and First Trimester Decidual Cells .......................................................................... 71 3.1.2  Distinct Regulatory Effects of Gonadal Steroids on ADAMTS-4, -5, -8, and -  9 mRNA Levels in Human Endometrial Stromal Cells in vitro ................................ 72 3.1.3  Combinatorial Effects of Gonadal Steroids on Stromal ADAMTS-5, -8, and -  9 mRNA Levels.......................................................................................................... 73 3.1.4  Regulatory Effects of Anti-steroidal Compounds on Stromal ADAMTS-4, -5,  -8, and -9 mRNA Levels ............................................................................................ 74 3.1.5  Distinct Regulatory Effects of Gonadal Steroids on ADAMTS-5 and -8  Levels in Human Endometrial Stromal Cells in vitro............................................... 75 3.1.6  Combinatorial Effects of Gonadal Steroids on Endometrial Stromal  ADAMTS-5 and -8 Levels ......................................................................................... 76 3.1.7  Regulatory Effects of Anti-steroidal Compounds on Stromal ADAMTS -5  and -8 Levels ........................................................................................................... 77 3.2  Discussion ........................................................................................................... 77  CHAPTER 4.  ADAMTS-1 PROMOTES AN INVASIVE PHENOTYPE IN HUMAN  ENDOMETRIAL CANCER CELLS IN VITRO........................................................... 105  vii  4.1  Estrogen–induced Cancer Cell Invasion Involves Regulated ADAMTS-1  Expression in Human Endometrial Carcinoma Cells in vitro..................................... 106 4.1.1  Estrogen  Promotes  Well-differentiated  Endometrial  Cancer  Cell  Invasion…............................................................................................................... 106 4.1.2  Estrogen Up-regulates ADAMTS-1 in Well-differentiated Endometrial  Cancer Cells in vitro............................................................................................... 106 4.1.3  Progesterone Inhibits E2-mediated Increase of ADAMTS-1 Expression in  ECC-1 Cells ............................................................................................................ 107 4.1.4  Anti-estrogen Inhibits E2-induced Increases of ADAMTS-1 Expression in  ECC-1 cells ............................................................................................................. 109 4.2  Function of ADAMTS-1 in Endometrial Cancer Invasion............................... 109  4.2.1  Expression of Aggrecanases and Versican in Human Endometrial Cancer  Cells in vitro............................................................................................................ 109 4.2.2  Invasive Capacity of Different Endometrial Cancer Cells ........................ 110  4.2.3  Loss of Function of ADAMTS-1 Decreases the Invasive Capability of Poorly  Differentiated Endometrial Cancer Cells in vitro .................................................. 110 4.2.4  Overexpression of ADAMTS-1 Increases the Invasive Capability of Well-  differentiated Endometrial Cancer Cells in vitro ................................................... 111 4.3  Discussion ......................................................................................................... 112  CHAPTER 5. 5.1  GENERAL DISCUSSION, SUMMARY AND CONCLUSIONS…..136  General Discussion ........................................................................................... 136  5.1.1  Aggrecanases Play Pivotal Role in Endometrial Physiology .................... 137  5.1.2  ADAMTS-1 Promotes Endometrial Cancer Cell Invasion ........................ 140  viii  5.2  Conclusions....................................................................................................... 145  5.3  Future Directions .............................................................................................. 146  References………………………………………………………………………………150  ix  LIST OF TABLES Table 1.1 Features of the structural and functional domains of the ADAMTS............... 44 Table 2.1 Primer sequences for real-time qPCR analysis............................................... 63 Table 2.2 Primer sequences and PCR conditions for the semiquantitative RT-PCR analysis.............................................................................................................................. 66 Table 3.1 Summary of the effects of gonadal steroids on ADAMTS expression……....79  x  LIST OF FIGURES Figure 1.1 Schematic representation of the basic domain structures of the ADAMTS family of metalloproteinases............................................................................................. 43 Figure 3.1 Comparison of the mRNA expression levels of aggrecanases and versican in primary culture of human endometrial stromal cells and first trimester decidual stromal cells. ................................................................................................................................ 87 Figure 3.2 Regulatory effects of P4 on aggrecanase mRNA levels in human endometrial stromal cells.. .................................................................................................................... 88 Figure 3.3 Regulatory effects of E2 on aggrecanase mRNA levels in human endometrial stromal cells. ..................................................................................................................... 89 Figure 3.4 Regulatory effects of DHT on aggrecanase mRNA levels in human endometrial stromal cells. ................................................................................................. 90 Figure 3.5 Combinatory effects of P4 plus E2 in stromal ADAMTS-4, -5, -8, and -9 mRNA levels. .................................................................................................................. 91 Figure 3.6 Combinatory effects of DHT plus P4 in stromal ADAMTS-4, -5, -8, and -9 mRNA levels..................................................................................................................... 92 Figure 3.7 Inhibitory effects of RU486 on P4-mediated regulatory effects of ADAMTS-8 and -9 mRNA expression levels in endometrial stromal cells. ....................................... 93 Figure 3.8 Inhibitory effects of RU486 on DHT-mediated regulatory effects of ADAMTS-5 and -8 mRNA expression levels in endometrial stromal cells..................... 94 Figure 3.9  Inhibitory effects of hydroxyflutamide on the DHT-mediated regulatory  effects of ADAMTS -5 and -8 mRNA levels in endometrial stromal cells...................... 95  xi  Figure 3.10 Inhibitory effects of hydroxyflutamide on the P4-mediated regulatory effects of ADAMTS-8 and -9 mRNA levels in endometrial stromal cells. ............................... 96 Figure 3.11 Western blot analyses of ADAMTS-8 expressions under the regulation of P4 and DHT............................................................................................................................ 97 Figure 3.12 Western blot analyses of ADAMTS-5 expressions under the regulation of DHT. ............................................................................................................................... 98 Figure 3.13 Western blot analysis of ADAMTS-8 expressions under the combinatory regulation of P4 and E2..................................................................................................... 99 Figure 3.14 Western blot analysis of ADAMTS-8 and ADAMTS-5 expression under the combinatory regulation of P4 and DHT.......................................................................... 100 Figure 3.15 Western blot analysis of the effect of RU486 on P4-mediated ADAMTS-8 expression. ...................................................................................................................... 101 Figure 3.16 Western blot analysis of the effect of hydroxyflutamide on DHT-mediated ADAMTS-8 expression.. ................................................................................................ 102 Figure 3.17 Western blot analysis of the effect of hydroxyflutamide on DHT-mediated ADAMTS-5 expression. ............................................................................................... 103 Figure 3.18 Schematic diagram for 2000 bp in the ADAMTS gene promoter region and the novel steroid response element (SRE) sequences. .................................................... 104 Figure 4.1 The expression of steroids receptors in endometrial cancer cell lines……..119 Figure 4.2 Estrogen promotes ECC-1 cell invasion....................................................... 120 Figure 4.3 Effects of P4, E2 and DHT on ADAMTS-1 mRNA levels in ECC-1 cells.. 121 Figure 4.4 Effects of E2 on ADAMTS-1 protein levels in ECC- cells......................... 122 Figure 4.5 Effects of P4 and DHT on ADAMTS-1 protein levels in ECC-1 cells…….123  xii  Figure 4.6 Combinatory effects of gonadal steroids on ADAMTS-1 mRNA levels in ECC-1 cells. .................................................................................................................... 124 Figure 4.7 Combinatary effects of E2 and P4 on ADAMTS-1 protein levels in ECC-1 cells. ................................................................................................................................ 125 Figure 4.8 Combinatary effects of E2 and DHT on ADAMTS-1 protein levels in ECC-1 cells. ................................................................................................................................ 126 Figure 4.9 Effects of ICI 182 780 on ADAMTS-1 mRNA levels in ECC-1 cells…….127 Figure 4.10 Effects of ICI 182 780 on E2-mediated ADAMTS-1expression in ECC-1 cells. ................................................................................................................................ 128 Figure 4.11 Expression of aggrecanases and versican in ECC-1 and KLE cells........... 129 Figure 4.12 Invasive capacities of ECC-1 and KLE cells.. ........................................... 130 Figure 4.13 Silencing of ADAMTS-1 expression in KLE cells…..…………………131 Figure 4.14 Silencing of ADAMTS-1 expression in KLE cells leads to a decrease in invasive capacity............................................................................................................. 132 Figure 4.15 Exogenous expression of ADAMTS-1 in ECC-1 cells………..………….133 Figure 4.16 Exogenous expression of ADAMTS-1 in ECC-1 cells confers an invasive phenotype........................................................................................................................ 134 Figure 4.17 Schematic diagram of a 2000 bp fragment in the ADAMTS-1 gene promoter region containing a novel estrogen response element (ERE) sequence.......................... 135 Figure 5.1 Proposed model for the regulation of aggrecanases by gonadal steroids in human endometrial stromal cells in preparation for embryoimplantation......……..…...148 Figure 5.2 Proposed model for the regulation and function of ADAMTS-1 in promoting well-differentiated endometrial carcinoma cell invasion ……………………..………..149  xiii  LIST OF ABBREVIATIONS ADAM ADAMTS E2 ER P4 PR T DHT AR ECM MMP MT-MMP TIMPs uPA tPA PAI SEM PRL IGFBP-1 PRM HSPG TSP SVMP PCR cDNA DMEM dNTP DNA DNAase FBS ANOVA PRE SRE ERE CUB PLAC TGF IL GAPDH RT-PCR LGL  A Disintegrin and Metalloproteinase A Disintegrin and Metalloproteinase with TromboSpondin Repeats 17β-estradiol Estrogen Receptor Progesterone Progesterone Receptor Testosterone 5α-dihydrotestosterone Androgen Receptor Extracellular Matrix Matrix Metalloproteinase Membrane-type Matrix Metalloproteinase Tissue Inhibitors of MMPs Urokinase Plasminogen Activator Tissue-type Plasminogen Activator Plasminogen Activator Inhibitor Standard Error of Mean Prolactin Insulin-like Growth Factor Binding Protein-1 Progesterone Receptor Modulator Heparan Sulfate Proteoglycan Thrombospondin Snake Venom Metalloprotease Polymerase Chain Reaction Complementary Deoxyribonucleic Acid Dulbecco’s Modified Eagle Medium Deoxynucleoside Triphosphate Deoxyribonucleic Acid Deoxyribonuclease Fetal Bovine Serum Analysis of Variance Progesterone Response Element Steroid Response Element Estrogen Response Element Complement component Clr/Cls, Uegf, and Bone morphogenic protein 1 Protease and Lacunin Transforming Growth Factor Interleukin Glyceraldehyde-3-Phosphate Dehydrogenase Reverse Transcriptase-Polymerase Chain Reaction Large Granular Lymphocyte  xiv  17-HSDs STS EST PCOS Fn EGF EVT RGD GR MR  17ß-Hydroxysteroid Dehydrogenases Steroid Sulfatase Estrogen Sulfotransferase Polycystic Ovarian Syndrome Fibronectin Epidermal Growth Factor Extravillous Trophoblast Arginine-Glycine-Aspartic glucocorticoid receptor mineralocoticoid receptor  xv  ACKNOWLEDGEMENTS  First, I would like to express my deepest gratitude to Dr. Colin D. MacCalman, my research supervisor, for providing excellent mentorship to me these past years; for guiding my research with understandable and clear direction through the various stages of this work. Truly speaking, without his brilliant ideas, personal guidance and patient instruction, it never would have been possible to complete this project in first place. Secondly, I want to thank Dr. Geoffrey L. Hammond, the Director of Reproductive and Developmental Sciences, who has put a lot of time and effort in supervising the preparation of this thesis. I also thank Dr. Peter C.K. Leung for his valuable suggestions and guidance of my study and I truly appreciated all the support from the department of OB/GYN and from the Graduate Studies of UBC. I want to take this opportunity to thank my supervisory committee: Dr. Peter McComb, Dr. Catherine J. Pallen, Dr. Dan Rurak, and Dr. Mark Carey for overseeing my research progress and giving me valuable and constructive suggestions. I would like to express my most sincere appreciation for their most valuable time and comments on this thesis. I would also like to thank Dr. Hua Zhu in Dr. MacCalman’s lab for her most valuable technical support, advice, comments, and friendship. As well, I would like to take this opportunity to express my appreciation to all my colleagues for their constant support and friendship during the time we have spent together. Finally, I am forever indebted to my parents for their nurture, for giving me courage and confidence as I grow up. I would also like to thank my husband and my son for their sharing my burden, for their understanding and the love and happiness they have given me. Here I dedicate this thesis to my family by expressing my sincere appreciation to the people I deeply loved.  xvi  CHAPTER 1.  INTRODUCTION  The uterus is one of the most important reproductive organs in the female reproductive tract. The endometrium, which is the inner lining of the uterus, undergoes cyclic remodeling in preparation for pregnancy, primarily under the influence of steroid hormones. There is increasing evidence that the abnormal levels of the steroids and their receptors are major causes of infertility, pregnancy loss, in addition to endometrial dysfunction and other pathological conditions (Eckmann and Kockler, 2009; Burney et al., 2007; Igarashi et al., 2005; Cohen and Rahaman, 1995; Navaratnarajah et al., 2008).  In the 21st century, pregnancy loss is a major health concern, and an especially important part of reproductive medicine. It has been estimated that about 50% of pregnancies never come to term, and that approximately 15% of couples trying to establish a family suffer from severe fertility problems (Paria et al., 2002; Rai and Regan, 2006; Dey, 2010; Kamel, 2010). These are not just clinical problems because they also cause considerable psychological stresses to the families involved. Unfortunately, these clinical problems will likely increase in the future due to an increasing incidence of health issues, such as obesity, which are also associated with anovulation and infertility (Nelson and Fleming, 2007; Vrbikova and Hainer, 2009). Furthermore, women in the developed countries continue to delay child-bearing, and this results in ovarian aging and associated infertility (Ventura et al., 2003; Martine et al., 2006, 2007).  The increasing number of infertility cases has led to an increase in the use of assisted  1  reproductive technology (ART) (Ziebe et al., 2010). However, the problems that prevent women from experiencing a natural conception may also contribute to the failure of ART to achieve a successful pregnancy (Ziebe and Devroey, 2008). Despite recent advances made in ART, the pregnancy rates from in vitro fertilization and embryo transfer (IVFET) have not changed appreciably (Nygren and Andersen, 2002), and this under-scores the importance of better understanding the molecular mechanisms of embryonic implantation and placentation.  1.1  Endometrial Physiology  1.1.1  Histological Features of Endometrial Receptivity  The classical work describing the dating of the endometrium by Noyes et al. (1950) was first published 60 years ago. The human endometrium undergoes cyclic changes in preparation for pregnancy, primarily under the regulation of progesterone (P4) and estradiol (E2) (Noyes et al., 1950; Gellersen and Brosens, 2003). E2 promotes endometrium regeneration that occurs following menstruation, and causes extensive proliferation of epithelial and stromal cells, and the formation of a dense cellular stroma containing narrow proliferative tubular glands and small blood vessels. After ovulation, when P4 is the predominant steroid, the endometrium is characterized by secretory glandular cells and stromal cell decidualization. By the late luteal phase of the menstrual cycle, large, rounded cells that resemble the terminal differentiated decidual cells of  2  regnancy surround the spiral arterioles in the endometrum become a predominant feature. If pregnancy does not occur, P4 levels drop and menstruation ensues.  However, if fertilization is achieved, embryonic implantation may occur in the midsecretory phase of the cycle, which is also known as the “window of implantation” (Adam et al., 1956). The hallmark of this receptive period in humans is decidualization, which is characterized by distinct morphological and molecular changes in the luminal epithelium and stroma of the endometrium, and this is a prerequisite for successful implantation (Lindenberg, 1991). A specific structure, called a “pinopod”, is a belb-like protrusion that is found on the apical surface of the endometrial epithelium (Usadi et al., 2003), and is only present during the putative “window of implantation” (Nikas, 1999, Aghajanova et al., 2003). Morphologically, decidualization presents as the differentiation of stromal cells, which increase in size and acquire a polyhedral shape. Moreover, there is an extensive development of the organelles involved in protein synthesis and secretion, and the appearance of desmosomes and gap junctions in these cells (Lawn et al., 1971; Wynn, 1974; Jahn et al., 1995; Maruyama and Yoshimura, 2008). There is also a significant population of bone-marrow derived cells, which includes large granular lymphocytes (LGLs), macrophages and to a lesser extent, T cells, which account for over 40% of cells in the decidua (Starkey et al., 1988; Bulmer et al., 1990). There is extensive proliferation of LGLs in the uterus during the secretory phase of mestrual cycle and this continues into early pregnancy. The LGLs are believed to control the placentation process and protect the uterus from trophoblast over-invasion (King and Loke 1991; Bulmer et al., 1988).  3  The diverse populations of cells that constitute the decidua allow this dynamic tissue to fulfill paracrine, nutritional, and immuno-regulatory functions throughout pregnancy (Lala and Kearns, 1985; Kearns and Lala 1982). In addition, the decidua plays a key embryo regulatory role by virtue of its intrinsic ability to regulate the invasion of trophoblastic cells into the underlying maternal tissues and vasculature during early pregnancy (Bischof et al., 2000; Cohen and Bischof, 2007, 2009). The depth of trophoblast invasion is precisely controlled by the decidua, and a restricted period of endometrial receptivity may protect the mother from being invaded uncontrollably by embryounic tissues (Cohen and Bischof, 2007). Teklenburg et al. employed a human coculture model which consists of decidualizing endometrial stromal cells and single hatched blastocysts. This study showed that the decidual stromal cells responded differently in secreting implantation associated factors, such as IL-1ß, -6, -10, -17, -18, eotaxin, and HB-EGF, when cultured with healthy blastocysts compared to the chromosomally abnormal blastocysts (Teklenburg et al., 2010). This suggests that the changes in the embryonic genome are opposed by maternal countermeasures and decidual stroma cells, which thereby act as biosensors of embryo quality by synchronizing implantation with embryo development (Teklenburg et al., 2010). Most importantly, impaired cyclic decidualization of the endometrium is associated with pregnancy failure (Cross et al., 1994; Paria et al., 2002; Salker et al., 2010).  1.1.2  Molecular Character of Endometrial Receptivity  Along with the cyclic change in the structure of the endometrium, gene expression  4  patterns undergo cycle-specific shifts (Talbi et al., 2006). Among the differentially expressed genes, integrin is one of the best-studied markers of endometrial receptivity. Integrin α1ß1, α4ß1, and αvß3 are uniquely expressed during the implantation window (Lessey et al., 1994). Among these, αvß3 presents on the pinopods, decidual stroma, and epithelial cells of the embryo, and has been proposed as a potential receptor for embryo attachment (Lessey et al., 1994; Lessey, 2000, 2003). Functional decidua can also secrete prolactin (PRL) and insulin-like growth factor binding protein-1 (IGFBP-1) (Maslar and Riddick, 1979; Lala et al., 1984). Within the human endometrium, IL-6 mRNA and protein levels increase gradually through the mid- to late-secretory phases, in particular during the window of implantation, and decrease in the late-secretory phase (Vandermolen and Gu, 1996; von Wolff et al., 2002a, b; Tabibzadeh et al., 1991, 1995). Strong immuno-staining of IL-6 is present in the epithelial and glandular cells when compared with the stroma (Tabibzadeh et al., 1995). In addition, the blastocyst and the endometrium have been reported to have positive expression of IL-6 receptor (Sharkey et al., 1995). IL-1 is also expressed in the stroma and glandular cells of human endometrium throughout the menstrual cycle, and reaches maximal levels during the luteal phase (Simon et al., 1993). These observations indicate that cytokines may be important paracrine/autocrine mediators of local intercellular interactions in endometrial tissue (Achache and Revel, 2006).  1.1.3  Endometrial Cell Model Systems  Most of our information regarding the process of decidualization and placentation relies  5  upon histological studies of hysterectomy or term placental tissue specimens (Hertig, 1967; Hamilton and Grimes, 1970; Pijnenborg et al., 1980). The morphological differences between decidualization in humans and in experimental and domestic animals illustrate the limitation of animal studies (Leiser and Kaufmann, 1994). However, in vivo experiments to understand the development of the uterine environment required to support pregnancy in humans are not feasible. Consequently, several in vitro model systems have therefore been developed to examine the biochemical and cellular mechanisms underlying the development, maintenance and regression of the human endometrium.  Ovariectomized rodent models were used initially to demonstrate that gonadal steroids regulate the cyclic remodeling processes in the endometrium (Psychoyos, 1976). Considering the fact that human decidualization initiates independently of the implanting embryo at the late secretory phase of menstruation, and that this differs from the rodent model (Noyes et al., 1950; Hertig, 1967), a variety of cell model systems have been generated to investigate the molecular and biochemical mechanisms underlying the differentiation of the human endometrium. These include cultures of endometrial explants (Bentin-Ley et al., 1994) and endometrial carcinoma cell lines (Somkuti et al., 1997). They also include primary cultures of cells isolated from endometrial tissues obtained from women with various medical conditions at different stages of the menstrual cycle and early pregnancy (Irwin et al., 1989; Fernandez-Shaw et al., 1992; Shiokawa et al., 1996), as well as co-cultures of primary human endometrial stromal cells with human pre-implantation blastocysts (Carver et al., 2003).  6  These in vitro models include primary cultures of stromal and glandular epithelial cells that can be enzymatically isolated and maintained in culture (Irwin et al., 1989; Fernandez-Shaw et al., 1992; Shiokawa et al., 1996; Pierro et al. 2001). Bone marrowderived cells and vascular cells have also been recovered from endometrial decidua using similar enrichment procedures (Starkey et al., 1988), and it is important to define and characterize the cells present in the culture models because of the likelihood of intercellular communication via soluble mediators (Wegmann et al., 1993). For example, the addition of gonadal steroids to the culture medium of endometrial stromal cells stimulates decidualization. It has been determined by morphological differentiation and the production of biochemical markers including prolactin, laminin and IGFBP-1 (Irwin et al., 1989). The removal of gonadal steroids from this model culture system mimics many of the molecular and biochemical events associated with the late luteal phase and menstruation (Salamonsen et al., 1997). In addition, the differentiation state of the cell cultures is also an important variable that needs to be considered.  1.2  Endometrial Pathology and Endometrial Cancer  Endometrial cancer is one of the most severe uterine pathologies. It develops in about 142,000 women in North America each year and is the seventh most common malignant disorder among women worldwide; the incidence varies in different geographic regions (Amant et al., 2005; WHO, 2003). It is the most frequently diagnosed gynecologic malignancy in North America, and both the incidence and mortality rates have recently increased (Jemal et al., 2008; Ueda et al., 2008). The early appearance of symptoms  7  leads to early diagnosis, thus the prognosis for endometrial cancer is excellent, with an overall 5-year survival of around 80% if diagnosed at an early stage. However, tumors with particular morphological variants, adverse histopathological features, and/or advanced stage usually manifest aggressive behavior and poor prognosis, and the 5-year survival rate of patients presenting with metastases is less than 20% (Jemal et al., 2005). Over the last two decades, our understanding of endometrial carcinoma has improved dramatically, and this may be attributed to advances made by basic scientists and clinical researchers. In particular, animal studies have provided critical concepts about the actions of hormones, and when coupled with studies using human subjects and tissues, they have provided insights into the molecular mechanisms that are pivotal to the progress of endometrial carcinoma. Biomarkers and genetic mutations involved in the early initiation of endometrial carcinoma have also been identified. However, despite all efforts to improve early diagnosis and treatment of endometrial cancer, the annual incidence and mortality rates are still rising (Jemal et al., 2008). This indicates that further comprehensive investigations of the molecular mechanisms underlying the development of endometrial carcinoma are required to improve the diagnosis and successful treatment of this disease.  1.2.1  Pathological Characteristics of Endometrial Carcinoma  Endometrial cancer arises in the epithelial glandular lining of the uterus (endometrium) and accounts for about 90% of all uterine cancers. In 1983, Bockman first described the two main clinico-pathological variants of endometrial carcinoma (Bockman, 1983). Type  8  I tumors are commonly estrogen-related cancers and occur in younger, obese, or perimenopausal women. These tumors are usually low-grade, well- to intermediatelydifferentiated and arise in a background of endometrial hyperplasia, which is a proliferative process involving the glands that leads to an increase in the glandular:stroma ratio. Endometrioid adenocarcinoma is the most common histological type, accounting for 57-80% of cases (Hoffman et al., 1995; Longacre et al., 1995). The tumors strongly express estrogen and progestin receptors and thus endocrine therapy has favorable outcomes even in advanced stages (Sherman, 2000; Cohen and Rahaman, 1995; Nyholm et al., 1993; Deligdisch and Cohen, 1985; Deligdisch and Holinka, 1986; Bockman, 1983).  The second type of endometrial carcinoma develops in older women who do not have the classical risk factors for this disease. It is not associated with hyper-estrogenic states. Type II endometrial cancers usually arise from the atrophic endometrium, they are mostly high-grade, poorly differentiated serous-papillary or clear cell carcinoma, and present clinically with deep myometrial invasion and early lymph node or distance metastases with much poorer prognosis (Hamilton et al., 2006; Burton and Wells, 1998). There are rarely detectable functional estrogen and/or progestin receptors, so this type of tumor is poorly responsive to hormone treatment. Therefore, although type II endometrial carcinoma constitutes less than 20% of endometrial tumors, it results in the majority of endometrial cancer related deaths (Ueda et al., 2008; Hamilton et al., 2006).  9  The molecular alterations involved in the progress of Type I carcinomas are different from those of the Type II carcinomas (Lax et al., 1997; Matias-Guiu et al., 2001; Llobet et al., 2009). Type I endometrial carcinomas are characterized by microsatellite instability, and mutations in PTEN, k-RAS, PIK3CA and ß-catenin genes (Di Cristofano and Ellenson, 2007; Hayes et al., 2006; Bussaglia et al., 2000; Catasus et al., 1998, 2008; Catasus et al., 1996). Research has shown that endometrial carcinomas with these features have relatively favorable outcomes. On the other hand, Type II endometrial carcinomas are mostly characterized by p53 mutations, inactivation of p16 and Ecadherin, and alterations in genes that regulate the mitotic spindle checkpoint (STK-15) (Okuda et al., 2010; Llobet et al., 2009; ).  1.2.2  Cell Model System of Endometrial Cancer Research  Immortalized cell lines allow the opportunity to study molecular mechanisms in most human tissues. Over 40 years ago, Kuramoto generated the first endometrial carcinoma cell line, HEC-1 (Kuramoto, 1972). Since then, many different endometrial cell lines have been established and are fundamental tools for in vitro studies of endometrial biology. Among these, are Ishikawa cells, one of the best-characterized endometrial cancer cell lines (Nishida et al., 1985; Lessey et al., 1996; Castelbaum et al., 1997; Lovely et al., 2000). This cell line maintains functional estrogen, progesterone, and androgen receptors, and is particularly useful for a wide range of studies of steroidmediated factors involved in endometrial carcinoma. After athymic nude mice became available, ECC-1 endometrial adenocarcinoma cells have been generated from EnCa101  10  endometrial adenocarcinoma. They formed tumors with glandular structures after transplantation to athymic nude mice (Satyaswaroop et al., 1983; Satyaswaroop and Tabibzadeh, 1991; Vollmer, 2003). The EnCa101/ECC-1 tumor model is the most complete endometrial tumor model because it is a stable and highly responsive cell line, which maintains both estrogen receptors (ERα and ERß), both isoforms of the progesterone receptor (PR-A and PR-B), and the androgen receptor (AR), along with the steroid receptor co-activators NCOA1, NCOA2, and NCOA3 (Mo et al., 2006). This model has been extensively used to study the regulatory mechanisms of hormone and growth factors in endometrial carcinoma, such as estrogen-related signalling and steroid mediated gene expression and regulation. This model also has been used to determine the tumorigenic effect of selective estrogen receptor modulators (SERMs), such as tamoxifen in endometrium (Molitoris et al., 2009; Gielen et al., 2005, 2006, 2007; Farnell and Ing, 2003).  KLE cells were generated from a poorly differentiated endometrial carcinoma (Richardson et al., 1984). The original tissue was from a tumor metastasis in a 68-yearold Caucasian woman, and was inoculated into five nude mice. Tumors harvested from the nude mice bearing inoculums for more than a month, resembled the original specimen. They are aneuploid with chromosome numbers ranging from 51 to 66. Electron microscopy showed microvilli, many junction processes, glycogenation, and a prominent nucleolonema. The KLE cells lack the estrogen receptor in the nucleus and KLE cells in female mice showed no increased growth under estrogen treatment, suggesting that KLE cells are not hormone sensitive (Richardson et al., 1984). This characteristic makes KLE  11  cells especially valuable for studies of the mechanisms underlying the growth of estrogen-independent tumors, their gene regulation, signalling pathways and gene expression profiles under chemo- and/or radiation therapy (Ikeda et al., 2010; Dong et al., 2009; Bellehumeur et al., 2009; Du et al., 2009; Gagnon et al., 2008). In summary, these endometrial cancer cell lines provide an opportunity to trace out the mechanism of carcinogenesis in the human endometrium, to search for specific tumor markers, including tumor-associated antigens, and importantly, to test therapeutically promising cytotoxic agents in vitro.  1.3  Gonadal Steroids and Endometrial Remodeling  Gonadal steroids exhibit a broad spectrum of physiological functions ranging from regulation of the menstrual cycle and reproduction (Noy et al., 1950; Gellerson and Brosens, 2003), to the modulation of bone density, brain function, and cholesterol mobilization. Any disruption in the bioavailability of these gonadal steroids during the menstrual cycle, which may occur via the effects of endogenous or exogenous factors on serum hormone concentrations and/or the spatiotemporal expression patterns/levels of their corresponding receptors in the endometrium, may result in poor reproductive outcomes  (infertility,  pregnancy  loss)  and  menstrual  disorders  (irregularity,  dysmenorrhea, endometriosis) (Fisher et al., 1998; Amanda et al., 2009). The reproductive and menstrual characteristics established during the early stages of a woman’s life may also influence her risk for endometrial cancer during the menopause by influencing her lifetime exposure to estrogens (Shpiro et al., 1980).  12  1.3.1  Role of Gonadal Steroids in Decidualization  Progesterone and estrogen are the dominant gonadal steroids that regulate endometrial growth and differentiation during the menstrual cycle and early pregnancy. Like other steroids, these gonadal steroids interact with target organs through their corresponding and specific nuclear receptors.  Two structurally related subtypes of ER, commonly known as ERα and ERβ, have been identified in humans and in other mammals (Green et al., 1986; Kuiper et al., 1996; Mosselman et al., 1996). There is only 56% amino acid identity between ERα and ERβ in their hormone binding domains, and their tissue distribution and ligand binding characteristics are significantly different (Katzenellenbogen et al., 2000; Taylor and AlAzzawi, 2000; Pallottini et al., 2008). ERβ is able to activate transcription of estrogenresponse element (ERE)-containing reporter gene constructs (Kuiper et al., 1996). Furthermore, homodimers and heterodimers of the two ER subtypes are capable of activating transcription, in an estrogen-dependent manner, from reporter gene constructs containing EREs. However, the activation of these reporter gene constructs is more efficient with homodimers of ERα (Pettersson et al., 1997). ERα knockout mice have a hypoplastic uterus and are unable to support implantation, while ERβ null mutant uteri are able to support implantation (Ogawa et al., 1999; Wada-Hiraike, 2006), indicating that ERα is the major functional receptor for estrogens in the uterus (Lubahn, 1993). The ablation of ERα in PR-positive endometrium results in defective decidualization, again indicating an important role of ERα in this process (Soyal et al., 2005). Studies have  13  demonstrated that the ER also mediates gene transcription from an AP1 enhancer element that requires ligand and the AP1 transcription factors Fos and Jun for transcriptional activation. In this regard, the two ER subtypes have opposite regulatory modes of action in response to treatment with the natural estrogen, estradiol (E2). For instance, ERα activates transcription while ERβ inhibits transcription of a promoter containing an AP-1 site (Paech et al., 1997). This may also account for the different biological roles of these ER subtypes in cancer (Pearce and Jordan, 2004).  Progesterone supports decidualization in ERα knockout mice suggesting that P4 is sufficient for decidualization through its receptor (Curtis et al., 1999; Paria et al., 1999). The PR has two isoforms, PR-A and PR-B (Truss and Beato, 1993), which are encoded by a single gene under the control of distinct promoters (Kastner et al., 1990). Both PR isoforms are capable of binding progestins and interacting with a progesterone-response element (PRE). Female mice lacking both PRs are infertile with multiple ovarian and uterine defects (Lydon et al., 1995). Although mice that lack PR-B are fertile, they have defects in decidualization caused by loss of cell cycle regulatory control (Das, 2009), revealing an important role for PR-B in supporting decidualization.  Both ERα and the PR are highly expressed in glandular epithelial cells and stroma cells of the human endometrium during the proliferative phase of the menstrual cycle. However, there is a marked decrease in ERα level as the menstrual cycle enters the secretory phase (Snijders et al., 1992; Mertens et al., 2001; Taylor et al., 2005). The loss of normal down-regulation of ERα may be caused by many factors, such as over-  14  expression of the aromatase enzyme, or progesterone resistance. Thus, the loss of ERα down-regulation in secretory endometrium is associated with infertility and endometriosis (Eckmann and Kockler, 2009; Burney et al., 2007; Igarashi et al., 2005). In contrast, ERβ levels are low in proliferative endometrial glands with maximum levels being detected in this compartment of the secretory endometrium. ERβ is also present in endometrial endothelial cells, suggesting that estrogens may also act directly upon the vasculature of the uterus (Critchley et al., 2000; Lecce et al., 2001). Estrogens also up-regulate the PR, whereas P4 decreases the levels of both PR isoforms in isolated human glandular epithelial cells (Eckert and Katzenellenbogen, 1981; Evans and Leavitt, 1980; Katzenellenbogen, 1980). In contrast, P4 up-regulates the expression of PR-A and PR-B in human endometrial stromal cells in vitro (Tseng and Zhu, 1997). It has also been well established that progesterone opposes the function of estrogen through down-regulating estrogen receptors, and by modulating other signaling pathways that estrogen uses to enhance cell proliferation, involving for instance WNT, FOXO1 and Mig-6 (Tulac et al., 2003; Labied et al., 2006; Leong et al., 2009). A recent study has also introduced a new idea that progesterone regulates the expression of microRNA (miRNA), to fine tune the expression of endometrial genes (Kuokkanen et al., 2010; Lessey, 2010). MicroRNAs are small nonprotein coding RNAs that regulate the levels of specific mRNAs posttranscriptionally by targetting them for degradation or by blocking their translation. The precursor miRNAs of 70 to 90 nucleotides are transported to the cytoplasm, eventually forming a single-stranded miRNA that binds to complementary sequences on target mRNA and preventing their translation (Bartel, 2004). Binding of a miRNA to a mRNA can also accelerate poly(A) tail removal, thereby hastening mRNA degradation (Eulalio  15  et al., 2009). In tissues such as the endometrium where rapidly changing steroid hormone signaling occurs, with well-demarcated stages of development, it is not be surprising that miRNAs maintain a role in gene regulation. Studies have suggested a role for miRNAs in down-regulating the expression of some cell cycle genes such as cyclins and cyclindependent kinases in the secretory-phase endometrial epithelium, thereby suppressing cell proliferation (Kuokkanen et al., 2010; Bartel, 2004).  The role of androgens in remodeling events that occur in the endometrium under normal and pathological conditions is controversial, and is especially interesting because the concentrations of androgens in the human endometrium exceeds those in plasma (Guerrero et al., 1975; Vermeulen-Meiners et al., 1988). Furthermore, chronic hyperandrogenism is associated with poor reproductive outcomes, and high androgen concentrations may specifically act in the human endometrium in women with recurrent miscarriage (Okon et al., 1998). In polycystic ovarian syndrome (PCOS) patient, there is also an increase in the level of circulating androgen and over-expression of AR and steroid co-activators in the endometrium (Apparao et al., 2002; Giudice, 2006).  The biological actions of androgens are mediated by the spatio-temporal expression of the AR in the endometrium. The AR is immuno-localized to the nuclei of cells in human endometrial stromal compartments and in first trimester decidua (Burton et al., 2003; Milne et al., 2005). Recently, it has been reported that AR and PR regulate the expression of genes that mediate decidualization. For example, AR may regulate genes involved in cell motility and organization of cytoskeleton (Cloke et al., 2008). It has been suggested  16  that progestogens-mediated anti-proliferative effects in the endometrium in the presence of estrogens are involved in the up-regulation of AR expression in glandular epithelium (Narvekar et al., 2004; Brenner et al., 2003).  Animal studies highlight the biological actions of androgens upon endometrial tissues, where androgens can mimic the function of both P4 and E2. In the rodent uterus, androgens primarily have an estrogenic effect. Testosterone (T) and the non-aromatizable androgen, 5α-dihydrotestosterone (DHT), which cannot be converted into estrogen, markedly increase uterine weight and the height of the uterine luminal epithelium, and modulate biological events simply by mimicking estrogen. These effects are not inhibited by the co-administration of anti-estrogens (Gonzalez-Diddi et al., 1972). There is also a significant overlap between E2 and DHT stimulated gene expression in the rat endometrium (Nantermet et al., 2005), which demonstrates that these two sex steroids have both overlapping and distinct regulatory effects on genes underlying the morphological and functional maturation of this dynamic tissue. DHT is also capable of maintaining decidualization in the mouse but does not substitute for P4 in the priming of the mouse endometrium, suggesting a dual role of androgens in rodent uterus that depends upon the stage of the reproductive cycle (Zhang et al., 1996).  In the human, androgens may have progestogenic effect. Recently, we have identified that DHT and P4 both increase the expression of ADAMTS-1, an extracellular matrix (ECM) metalloproteinase, in human endometrial stromal cells, and that this is inhibited by flutamide and RU486 respectively (Wen et al., 2006). Similar studies have shown that  17  T significantly inhibited MMP-1, one of the key MMPs for menstruation and embryo implantation in human endometrium, in a similar manner to progestins. Flutamide, a specific androgen receptor blocker, completely reversed the decrease of MMP-1 induced by testosterone in human endometrial stromal cells (Ishikawa et al., 2007). Previous studies have also shown that T and DHT both induce prolactin (PRL) production, a biochemical marker of decidualization, in a similar manner to that observed in cells cultured with P4. Furthermore, a combination of P4 and T enhanced prolactin (PRL) production in these cell cultures compared to those cultured in the presence of either steroid alone. Flutamide also inhibits T- and DHT- but not P4-induced PRL secretion (Narukawa et al., 1994). Collectively, these observations suggest that progestins and androgens have independent but cooperative actions on endometrial stromal cell differentiation in vivo and in vitro.  1.3.2  Role of Gonadal Steroids in Endometrial Cancer Development  It has been acknowledged for over 50 years that continuous exposure to estrogens in the absence of sufficient levels of progestins promotes the development of endometrial cancer. In the early 1970s, a 20-35% increase in the incidence of endometrial cancer was reported in Caucasian women who had undergone estrogen replacement therapy (Shapiro et al., 1980). Subsequently, numerous clinical, biological, and epidemiological studies have all demonstrated that the typical risk factors such as obesity, anovulatory states, early menarche and late menopause, nulliparity and exogenous estrogens will cause excessive and/or prolonged exposure to unopposed estrogens. These circumstances  18  increase the risk of endometrial carcinomas (Cohen and Rahaman, 1995; Sherman, 2000; Kaaks et al., 2002).  The majority of women with early-stage endometrial cancer are obese, and obesity is positively associated with a higher mortality rate (Courneya et al., 2005; Amanda et al., 2009). Obesity causes an increase in endogenous estrogen because of increased peripheral conversion of androstenedione into estrone by adipose tissue. Other than obesity, estrogen-producing tumors, polycystic ovary syndrome (PCOS), cirrhosis, and tamoxifen may also induce an estrogen predominant environment (Fisher et al., 1998).  The polycystic ovary syndrome is characterized by the absence of ovulation, and increased secretion of ovarian androgens that are peripherally converted to estrogens. Estrogen-producing tumors and PCOS carry a high risk for endometrial cancer in young women (Cohen and Rahaman, 1995; Navaratnarajah et al., 2008). Unopposed estrogen replacement in menopause is associated with a four- to eight-fold increased risk of disease, whereas estrogen and progesterone replacement therapy in menopause decreases the risk of disease. Progestin-containing or combination oral contraceptives taken during the reproductive years also decrease the risk of disease in later life by approximately 50% (Grimes and Economy, 1995; Sorosky, 2008).  Recently, there has been a focus on the importance of in situ estrogen metabolism and synthesis in the etiology and progression of various human estrogen-dependent epithelial neoplasms, including breast cancers and endometrial carcinoma. Higher concentrations of  19  E2 have been reported in endometrial cancer tissue specimens, as compared with microscopically normal endometrium (Berstein et al., 2003). It is also been reported that E2, E1, and testosterone levels in the tumor tissues are several times higher than those in serum (Ito et al., 2006). The enzymes such as aromatase, 17ß-hydroxysteroid dehydrogenases (17-HSDs), steroid sulfatase (STS), and estrogen sulfotransferase (EST) are primarily involved in the formation of E2. They are highly expressed in these cancer tissues, and are responsible for the intra-tumoral elevation of estrogen in post-menopausal patients with endometrial carcinoma (Segawa et al., 2005; Utsunomiya et al., 2004; Sasano et al., 2000; Watanabe et al., 1995).  Ferreira et al. have outlined several possible molecular mechanisms to explain the link between estrogens and cancer (Ferreira, 2009): (1) using ER-mediated signalling, by upregulation of WNT1 expression, which causes the tumor to escape from apoptosis (Katoh, 2003). (2) via ER-independent signalling in ER negative cells, such as phosphorylation of AKT and ERK (Zhang et al., 2009). (3) Estrogens can generate toxic species such as catechol-estrogens that can cause DNA damage and induce tumor development (Liehr, 2000; Roy, 1999; Fernandez, 2006). (4) Estrogens are associated with altered DNA methylation status, and estrogen-induced hyper-methylation of the mismatch repair gene, MLH1, is associated with endometrial cancer of Lynch syndrome (Campan et al., 2006; Esteller et al., 1999, 1998). Furthermore, estrogens can activate the protein kinase A pathway, insulin-like growth factor 1(IGF-1) receptor, and EGF receptor signalling (Song et al., 2007).  20  On the other hand, the roles of P4 in the regulation of the glandular epithelium of the endometrium may antagonize estrogen-mediated cell proliferation and induce cell differentiation (Graham and Clark, 1997). In the clinical setting, progesterone provides some protection against the stimulatory effects of estrogenic agents. In vitro studies using endometrial cancer cell lines and primary culture of endometrial cancer and stromal cells have shown that progesterone can inhibit cell growth and invasion through regulation of responsive genes, such as MMP-1, -2, -7, -9, FOXO1, Bcl-2, BAX and AP-1 (Di Nezza et al., 2003; Ward et al., 2008; Vereide et al., 2005; Dai et al., 2003). There are also compelling data suggesting that P4 resistance in endometrium contributes to infertility, pregnancy loss, endometriosis, and endometrial cancer (Donaghay and Lessey, 2007; Burney et al., 2007). However, the molecular mechanisms underlying steroid-regulated endometrial carcinoma differentiation, invasion and cancer metastasis are still under investigation.  1.3.3  Anti-steroidal Compounds  The use of anti-steroidal compounds to manage/treat steroid-dependent medical conditions, including some forms of cancer and endometriosis, as well as facilitating better control of menstruation and fertility, has gradually replaced surgery as the main therapeutic approach during the last decade. In addition to their use in the clinical setting, anti-steroidal compounds have become useful tools for studies of the molecular and cellular mechanisms underlying the biological actions of gonadal steroids under normal and pathological conditions.  21  1.3.3.1  Anti-progestins  The physiological effects of progesterone and its synthetic analogs have been exploited clinically, and they are consequently utilized as pharmacological agents in contraception, the control of uterine bleeding, and hormone replacement therapy (HRT). The antiprogestins include pure progesterone receptor antagonists, selective progesterone receptor modulator which has mixed agonists/antagonists effect, and progesterone receptor modulators (Spitz, 2005; Chabbert-Buffet et al., 2005; Spitz and Chwalisz, 2000; Elger et al., 2000). They are also major therapeutic candidates. For instance, mifepristone (RU486), a progesterone and glucocorticoid receptor antagonist is the first and the best characterized antiprogestin (Gagne et al., 1985). RU486 has an effective anti-gestational function when given during the luteal phase of the menstrual cycle, and if it is administered during pregnancy, it is abortifacient (Gobello, 2006). Gradually, antiprogestins have also been applied for the management of aberrant endometrial bleeding, endometriosis, tumors, and contraception (Croxatto, 2003; Chwalisz, 2003). RU486 has much higher binding affinity to the PR than P4, and results in lost of function of P4 in cells (Baulieu, 1997). In addition, RU486 also decreases PR levels in the human endometrium (Zaytseva et al., 1993). However, a recent study with HEC-1A and Ishikawa endometrial carcinoma cell lines demonstrated that RU486 can up-regulate PR expression in the cancer cell lines with no change in ER levels (Navo et al., 2008).  22  1.3.3.2  Anti-estrogens  Anti-estrogens are a pharmacologic group of compounds that inhibit or modify estrogen action, and they include the gonadotropin releasing hormones (GnRH) and their analogs, aromatase inhibitors, and estrogen receptor blockers (Williams et al., 1996). Clomiphene and tamoxifen citrate are synthetic non-steroidal anti-estrogenic compounds, which competitively block estrogen receptors with a combined antagonistic-agonistic effect (Hoffmann and Schuler, 2000). Such effect is tissue specific. For example, tamoxifen has an antagonistic effect on the mammary gland that is used to treat breast cancer but an estrogenic effect on the uterus that causes endometrial hyperplasia (Jordan, 1995). Therefore, the carcinogenic effect of tamoxifen in the endometrium is of great interest in both clinical medicine and basic research, and studies implicate gene regulation via an estrogen receptor-dependent pathway as the mechanism of tamoxifen action in the uterus (Shang, 2006).  ICI 182, 780, is a pure ER antagonist (Wakeling, 1991; Wakeling et al., 1991; Dukes et al., 1992): its ER binding affinity is approximately 100 times greater than that of tamoxifen, and it has no agonistic activity on target tissues including the endometrium and uterus. It has been used in clinical trials to replace tamoxifen for the treatment of advanced and tamoxifen-resistant breast cancer, as it has a longer duration of response and fewer side effects (Robertson, 2001a, b; Hu et al., 1993). Additionally, ICI 182, 780 has been widely used experimentally to investigate the role of estrogen and other hormones in vivo and in vitro.  23  1.3.3.3  Anti-androgens  Flutamide is a non-steroidal anti-androgen that competitively inhibits the binding of androgens to the AR (Hoffmann et al., 2000). Clinically, flutamide has yielded good results in treating prostatic hyperplasia and prostate cancer with few side effects (Wirth et al., 2007). In addition, hydroxyflutamide has anti-progestagenic activities in the uterus, cervix, and hypothalamus of rats (Chandrasekhar and Armstrong, 1991; Chandrasekhar, 1991). Other than clinical applications, flutamide has been widely used in reproductive and developmental research to study the mechanism of steroid-mediated cancer progression (Vo et al., 2009; Welsh et al., 2009; Lovely et al., 2000).  1.4  Extracellular Matrix (ECM) Remodeling of the Endometrium  The ECM has become recognized as a key regulatory component in cellular physiology, not only providing support and strength to cells within tissues but also providing an environment for cell proliferation, differentiation, migration, and adhesion. It is fundamental to normal development. Remodeling of the endometrial ECM is a key event underlying the morphological and functional maturation of this dynamic tissue and in the regulation of trophoblast invasion at the maternal-fetal interface.  Gene microarray studies in the mouse have demonstrated that approximately 560 genes are differentially expressed in the uterus, and are thought to be involved in the maintenance or regulation of ECM integrity (Helvering et al., 2005; Cox and Helvering,  24  2006). The biological actions of gonadal steroids, in terms of regulating these ECM remodeling related genes that are associated with endometrial physiology and pathologies (Cox and Helvering, 2006), remain to be elucidated.  The ECM is a complex and incompletely characterized macro-molecular structure. The ECM is composed of the structural proteins such as collagen and elastin; the adhesion proteins which including fibrillin, fibronectin, vitronectin, and laminin; and the proteoglycans that are connected to glycosaminoglycans with a core protein (Berrier and Yamada, 2007). Some growth factors and cytokines are trapped within the ECM and are activated at the appropriate time for remodeling of the tissue. Undifferentiated stroma produces an ECM that has a classical mesenchymal composition; in particular collagens I, III, V, and VI and fibronectin (Fn) have all been shown to be present and there are periglandular deposits of tenascin that appear to reflect the proliferative state of the epithelial compartment (Vollmer et al., 1990). Regeneration of the endometrium during the proliferative phase of the menstrual cycle involves the deposition of an ECM scaffold (Aplin et al., 1988; Mylona et al., 1995; Church et al., 1996). The epithelium and blood vessels are surrounded by basement membranes containing laminin, collagen type IV and heparan sulfate proteoglycan (HSPG).  Decidualization is accompanied by changes in ECM components (Spiess et al., 2007; Wewer et al., 1985; Kisalus et al., 1987; Ruck et al., 1994). Studies in cows indicate a decrease in type I collagen, fibronectin and laminin of endometrium after implantation (Yamada et al., 2002; Hirata et al., 2003). In addition, type IV collagen and laminin of  25  the epithelial basement membrane also decreased remarkably during early pregnancy (Yamada et al., 2002). Studies using a mouse model have shown that collagen I, III, and V are expressed in the pregnant and non-pregnant endometrium, and that there are significant changes in their expression and localization in response to decidulization and implantation (Spiess et al., 2007; Wewer et al., 1988). Laminin and collagen IV are highly expressed in human endometrial stromal and decidual cells. Laminin enhances endometrial regeneration during the proliferative phase, but collagen IV becomes dominant when decidualization occurs (Tanaka et al., 2008; Iwahashi et al., 1996).  Collagen IV plays an important role in angiogenesis. It also plays a key role in the integration and structural stabilization of tissue architecture. Collagen IV is abundant in endometrium during the proliferative phase, but its expression is lost during the secretory phase (Aplin et al., 1988; Tanaka et al., 2009). Collagen IV may regulate endometrial epithelial remodeling and stromal cell structures, viability and differentiation during the menstrual cycle in an autocrine and paracrine fashion (Tanaka et al., 2009, 2008). The αchains of collagen IV can generate certain factors, such as Canstatin, Arresten and Tumstain that are known endogenous angiogenesis inhibitors (Hamano and Kalluri, 2005; Maeshima et al., 2001, 2002; Colorado et al., 2000; Kamphaus et al., 2000). It is therefore not surprising that they are involved in the female reproductive cycle, tissue repair, endometriosis, and endometrial cancer (Mundel and Kalluri, 2007).  Impaired expression and/or localization of the endometrial ECM components is associated with endometrial pathologies. For example, laminin 5 as well as its main  26  cellular binding protein, the integrin receptor α3ß1, are involved in the invasive activities of cells in endometriosis tissue (Giannelli, 2007). Versican belongs to the large aggregating chondroitin sulfate proteoglycan family of ECM components. In fact, versican expression has been correlated with tumor progression in breast cancer, melanoma, cervical cancer, and lung cancer (Kischel et al., 2010; Gambichler et al., 2008; Suwiwat et al., 2004; Pirinen et al., 2005; Ricciardelli et al., 1998). An up-regulation in versican expression causes a decrease in cell-ECM adhesion, and therefore promotes tumor invasion and metastasis (Sakko et al., 2001). The stromal cells that enriched with versican may also favour tumor progression in endometrial cancer (Kodama, et al., 2007).  Alterations in the composition of the endometrial ECM are coordinated with regulated changes in the expression of cell-matrix receptors on the cell surface. In particular, during the window of implantation in humans, there is a marked increase in endometrial levels of αv and β3 integrin subunits, which are members of a gene super-family of calciumdependent cell-matrix adhesion molecules (Lessey, 2002). Aberrant expression of αvß3 integrin subunits in the endometrium is also associated with infertility and recurrent pregnancy loss (Lessey, 1998; Gonzalez et al., 2001; Stoikos et al., 2010; Sokalska et al., 2010).  The ECM has complex functions in regulating the behavior of cells connected to it, rather than a simple scaffold tissue for physical support (Hidai et al., 2007). This is also true in tumors. Remodeling of the ECM through altered expression of molecules that are involved in the cell-to-cell and cell-to-matrix interactions, is critical in local tumor  27  invasion and metastasis (Kresse and Schonherr, 2001). The ECM has extensive roles in modulating the proliferation, differentiation, motility, and survival of tumor cells (Varga et al., 2010; Gieni and Hendzel, 2008). In turn, the tumor cells are continually remodeling and influencing the surrounding ECM (Kresse and Schonherr, 2001).  1.4.1  Proteolytic Mechanism of Endometrial ECM Remodeling  During the cyclic change of the endometrium, tissue remodeling involves the degradation of ECM components. In the first trimester of pregnancy, the invading trophoblast further degrades the decidua by using mechanisms resembling those in play during tumor cell invasion and metastasis (Strickland and Richards, 1992; Bischof et al., 2000a, 2000b, 2003; Staun-Ram et al., 2009).  A large number of molecules with protease activities are involved in proteolytic processing of the ECM (Curry and Osteen, 2001). Among the ECM proteases, the urokinase plasminogen activator (uPA) system and the matrix metalloproteinase (MMP) system have been extensively studied. They have been assigned key roles in the process of tissue remodeling. In particular, uPA and MMPs have shown to work in concert or in cascades in endometrum to degrade or process specific ECM components (Plaisier et al., 2008; Curry et al., 2001; Fata et al., 2000). It has been recognized that some gynecologic conditions such as infertility and recurrent pregnancy loss are associated with aberrant expression or distribution of ECM components in the endometrial stroma (Ramon et al., 2005; Jokimaa et al., 2002; Bilalis et al., 1996). Accumulating evidence also  28  demonstrates the crucial role of proteolytic enzymes in cancer development and progression. It is therefore important to define the full repertoire of proteinases, their regulation, and individual contribution(s) to the development of a uterine environment that is capable of supporting pregnancy, as well as their function in the cancer process.  1.4.1.1  Plasminogen Activators and their Inhibitors  The plasminogen activators are substrate-specific serine proteinases that convert plasminogen to plasmin (Andreasen et al., 2000). The plasminogen activator system includes the urokinase-type plasminogen activator (uPA), the tissue-type PA (tPA), and their endogenous inhibitors, PA inhibitor-1 and -2 (PAI-1 and PAI-2, respectively) and their common receptor, the uPA receptor. They play important roles in a wide variety of physiologic and pathologic processes, such as menstruation, trophoblast invasion, the implantation process, as well as tumor growth, invasion and metastasis (Mekkawy et al., 2009; McMahon and Kwaan, 2008; Plaisier et al., 2008; Alfano et al., 2005; Blasi and Carmeliet, 2002; Sidenius and Blasi, 2003).  The uPA is temporally expressed in endometrium during the menstrual cycle, with the highest levels being detected during the secretory phase and in the first trimester decidua (Plaisier et al., 2008; Casslen and Astedt, 1983; Koh et al., 1992). PAI-1 expression levels are highest during the secretory phase and decline with the onset of menstruation (Koh et al., 1992). There is an increase of uPA and a decrease of PAI-1 expression after P4 withdrawal from the culture medium of endometrial stromal cells (Schatz et al., 1999).  29  uPA is produced by human trophoblast cells in vitro and in vivo, and impaired expression of ECM proteases is associated with poor trophoblast invasion. (von Steinburg et al., 2009; Astedt et al., 1986; Queenan et al., 1987; Yagel et al., 1988). In addition, the membrane-bound uPA receptor is expressed by invasive extravillous trophoblasts (EVTs) during the first trimester of pregnancy (Multhaupt et al., 1994; Pierleoni et al., 1998; Aflalo et al., 2005). Furthermore, IL-1β and epidermal growth factor (EGF) enhance trophoblast invasion, and they up-regulate the expression of uPA in EVTs (Karmakar and Das, 2002; Anteby et al., 2004). TGF-β1, a growth factor that inhibits trophoblast invasion, also up-regulates the expression of PAI-1 and -2 in EVTs (Graham, 1997; Karmakar and Das, 2002). Based on these observations, it has been suggested that uPA plays a key role in regulating the decidualization and implantation processes. However, mice null mutant for uPA, urokinase receptor (uPAR), or tPA, do not exhibit reduced fertility (Bugge et al., 1996), indicating that other proteinases are also involved in these complex processes.  Plasminogen activator and its inhibitor play an important role in tissue remodeling in invasion and metastasis of many types of cancer cells (Kinder et al., 1993; Duggan et al., 1995; Festuccia et al., 1998; Dano et al., 2005). uPA is overexpressed in a variety of cancer cell lines in vitro and has been demonstrated to positively regulate cancer cell invasion (Meissauer et al, 1991; Delbaldo et al, 1994; Liu and Rabbani, 1995; Xing and Rabbani, 1996; Mohanam et al, 1997), likely by initiating proteolytic cascades that facilitate the invasion of blood vessels by tumor cells. Furthermore, the uPA proteolytic system enhances the dissemination of tumor cells through vascular and lymphatic vessels,  30  and thereby facilitates metastasis (Fisher et al., 2000). In addition, uPA is expressed by the stroma of ductal breast cancer and colon cancer, and by macrophages in prostate cancer and squamous cell lung cancer, where it may function in a paracrine manner (Romer et al., 1991; Usher et al., 2005). Furthermore, PAI-1 can alternatively retard or enhance cell migration and adhesion, and its concentration is critical for tumor invasion (Bajou, 2004; Chazaud, 2002).  1.4.1.2  Matrix Metalloproteinases and their Endogenous Inhibitors  Matrix metalloproteinases (MMPs) belong to the metzincin superfamily of proteases, which comprises 23 distinct members in humans (Woessner, 1991; Fata et al., 2000; Nagase et al., 2006). These MMP subtypes can be further divided into several subgroups based upon their substrate specificities and/or structural similarities: collagenases (MMP1, MMP-8, MMP-13), gelatinases (MMP-2, MMP-9), stromelysins (MMP-3, MMP-7, MMP-10, MMP-11), membrane-type MMPs (MT-MMP1 through MT-MMP6) and a miscellaneous group that contains MMP-12 and MMP-19 through MMP-26. In general, MMPs are synthesized as latent zymogens that must be cleaved to become activated (Nagase et al., 2006; Fingleton, 2006). Most MMPs can be activated by a variety of serine proteases and by other MMPs (Nagase, 1997). On the other hand, MMPs are potent ECM enzymes that are capable of cleaving cytokines, chemokines, cell adhesion molecules like cadherins and integrins, zymogen forms of themselves, other MMPs, and some proteanase inhibitors (Egebald and Werb, 2002).  31  The activities of MMPs are regulated by endogenous tissue inhibitors of MMPs (TIMPs) (Woessner, 1991; Handsley and Edwards, 2005). There are four homologous TIMP subtypes; TIMP-1, -2, -3, and -4. TIMPs are small secreted proteins (21-28 kDa) that form tight, non-covalent bonds with the proteolytic domains of the MMP subtypes (Woessner, 1991; Egebald and Werb, 2002). TIMP-3 is able to bind heparan-sulphatecontaining proteoglycans and possibly chondroitin-sulphate-containing proteoglycans in the ECM (Yu et al., 2000). TIMPs also exhibit other biological functions that are independent of their ability to inhibit the proteolytic activity of MMPs.  MMPs and their inhibitors play important roles in female reproductive physiology and pathology. As many as 13 MMPs have been detected in the human endometrium during the menstrual cycle (Curry and Osteen, 2001; Fata et al., 2000; Goffin et al., 2003), and the complex expression patterns observed for each of these endometrial MMP subtypes suggests distinct roles for each in the development, maintenance and regression of this tissue. Immunolocalization has shown that MMP-7, MMP-11, MMP-26, and MT3-MMP expression is high during the proliferative phase of the menstrual cycle and is decreased in the secretory phase. In contrast, MMP-2, MMP-19, MT1-MMP and MT2-MMP are constitutively expressed in the endometrium throughout the menstrual cycle whereas MMP-1, MMP-3, MMP-8, MMP-9, and MMP-12 are only detected in the endometrium during menstruation (Salamonsen and Woolley, 1996, 1999). Their levels fluctuate in response to gonadal steroids, and failure to do so increases the risk of pathological conditions (Slayden and Brenner, 2006; Osteen et al., 2005). MMP-2, MMP-3, and MMP-9 but not MMP-1 or MMP-7 have been detected in the decidua of early pregnancy  32  whereas only MMP-2 and MMP-9 are expressed in the endometrium at term (Xu et al., 2000).  The cellular localization of only some of the MMPs in the human endometrium has been determined. MMP-1, MMP-2 and MMP-3 have been detected in the stroma during the proliferative phase of endometrium, while MMP-9 is present in the glandular epithelium, neutrophils and monocytes (Rodgers et al., 1993, 1994; Hampton et al., 1995; Irwin et al., 1996; Jeziorska et al., 1996). In the secretory phase, MMP-3, MMP-10 and MMP-11 are present in the stroma, while MMP-7 is located in the glandular epithelium, and MMP-9 is present in the glandular epithelium and neutrophils (Rodgers et al., 1994; Irwin et al., 1996; Jeziorska et al., 1996). During menstruation, MMP-2, MMP-9, MMP-10 and MMP-11 are present in the stroma, MMP-1 and MMP-3 locate in stromal cells near blood vessels, MMP-7 is in the glandular epithelium, and MMP-9 is in monocytes, neutrophils and macrophages (Rodgers et al., 1993, 1994; Hampton et al., 1994, 1995; Marbaix et al., 1995; Kokorine, 1996).  The human endometrium also constitutively expresses TIMP-1, TIMP-2, and TIMP-3 but not TIMP-4 (Fata et al., 2000, Osteen and Curry, 2001; Goffin et al., 2003). There appear to be only small fluctuations in the overall levels of TIMP-1, TIMP-2 and TIMP-3 in the endometrium during the menstrual cycle.  However, localized increases in TIMP-1  mRNA and protein levels have been detected near small arteriolar and capillary tissues, and TIMP-2 has a similar localization around the vasculature in the secretory endometrium and menstrual tissue, suggesting that it may be focally regulated in the  33  endometrial vasculature (Rodgers et al., 1993; Salamonsen and Woolley, 1996; Zhang and Salamonsen, 1997). In pre-decidual cells, TIMP-3 levels are increased indicating that it may serve as a cellular marker of decidualization and/or play a critical role in regulating trophoblast invasion (Zhang and Salmonsen, 1997; Goffin et al., 2003). MMPs and TIMPs are also produced by human trophoblasts and further regulate the implantation process (Higuchi et al., 1995; Hurskainen et al., 1996; Ruck et al., 1996 Staun-Ram and Shalev, 2005). Therefore, the activity of endometrial MMPs is counterbalanced by the spatial expression of various TIMPs within the two cellular compartments of the endometrium.  Studies using primary cultures of human endometrial cells have revealed roles for MMPs and TIMPs in the cyclic remodeling events that occur in the endometrium during each menstrual cycle. The latent forms of MMP-1, MMP-2, MMP-3, MMP-9 and MMP-11 and TIMP-1, TIMP-2 and TIMP-3 have been detected in conditioned media from stromal cells isolated from human endometrial tissues (Salamonsen et al., 1996). The addition of P4, but not E2, to the culture medium of these primary cell cultures causes a significant decrease in the levels of these MMP subtypes, and a concomitant increase in TIMP levels (Marbaix et al., 1995; Osteen et al., 1994; Schatz et al., 1999). In contrast, the withdrawal of gonadal steroids from the culture medium of endometrial stromal cells results in a marked increase in all of the MMP subtypes in these primary cultures and allows steroidmediated menstruation (Salamaonsen et al., 1997). Studies have shown that unexplained infertility and implantation failure in IVF cases correlate with differential expression of MMPs, as the expression of MMP-2 and TIMP-3 were both dramatically down-regulated  34  in the infertile group when compared with the fertile group (Konac et al., 2009). Studies with trophoblast cells also indicate that MMPs are produced by cytotrophoblastic cells and are instrumental to their invasive behavior (Cohen et al., 2010; Cohen and Bischof, 2007). These studies add some new information at the molecular level and highlight the fact that ECM proteases are involved in the complex preparation of the endometrium for implantation.  MMPs not only play important roles in physiological ECM remodeling, but are also implicated in various pathologies, including inflammatory diseases, cancer development, invasion and metastasis (Egeblad and Werb, 2002; Burrage et al., 2006; Page-McCaw, 2007; Kessenbrock et al., 2010). The roles of MMPs in cancer are diverse and complex. They can facilitate tumorigenesis simply by degrading ECM components; thus enabling tumor invasion, intravasation into the blood or lymphatic circulation, extravasation from the circulation, and local migration/invasion at metastatic sites (Crawford and Matrisian, 1994; Jodele et al., 2006). MMPs are also involved in more complex processes that regulate cancer cell invasion, and these include regulating cell-cell adhesion (Ribeiro et al, 2010; Moss et al., 2009; Hendrix et al., 2003), cell-ECM adhesion (Deryugina et al., 2002; Ratnikov et al., 2002), and growth factor/cytokine availability (Zhang et al., 2004; Koshikawa et al., 2005, 2010). MMP-2 and MMP-9 were among the first members of the MMP family to be cloned and characterized (Liotta et al., 1982; Collier et al., 1988). Localization of these MMPs in malignant cells has provided evidence for their respective roles in cancer cell invasion (Collier et al., 1988). MMP-2, MMP-9 and MMP-14 are involved in key events in cancer cells, including proliferation, apoptosis and angiogenesis  35  (Goldman et al., 2003; Nguyen et al., 2001). Overexpression of MMP-2 or MMP-9 has been associated with poor survival in endometrial cancer patients (Aglund et al., 2004). The expression of MMPs in cancer is not solely confined to cancer cells, as their expression has been documented in stromal and endovascular cells adjacent to cancer cells. For instance, the expression of MMP-2 has been localized to stromal cells surrounding invasive cutaneous melanomas (Hofmann et al., 2005). In addition, MMP-2, MMP-9 and MMP-14 have been localized to vascular endothelial cells in certain cancers (Basset et al., 1990; Jia et al., 2000; Chun et al., 2004), and they can modulate TGF-β expression as part of their tumor-promoting effects (Tatti et al., 2008). MMP-9 has a distinct role in tumor angiogenesis mainly by regulating vascular endothelial growth factor (VEGF) expression, and MMP-3, -7, -9, and -16 can directly cleave matrix-bound VEGF resulting in its altered bioavailability in tumor cells in vivo (Bergers et al., 2000; Lee et al., 2005). Furthermore, in stomach cancer cells, MMP-7 was involved in extracellular cleavage of E-cadherin and promoted tumor cell migration and invasion (Lee et al., 2007). The function of TIMPs in cancer is complex. Indeed, the expression of individual MMPs and their endogenous inhibitors correlates with tumor progression and clinical outcome. An increased level of TIMPs has been detected in various human cancer tissues (Shiomi and Okada, 2003). Consequently, TIMP-1 has been considered as a growth promoting factor and/or anti-apoptotic factor for cancer cells (Mannello and Gazzanelli, 2001). Perhaps, this is most obvious in colorectal cancer where high levels of TIMP-1 correlate with lymph node and distant metastatic spread (Zeng et al., 1995; Giaginis et al., 2009; Mroczko et al., 2010). Other studies have reported an association between poor prognosis and high levels of expression of TIMP-1 in lung cancer and  36  gastric cancer (Fong et al., 1996; Gouyer et al., 2005; Mroczko et al., 2009), and TIMP-2 in bladder cancer (Grignon et al., 1996; Eissa et al., 2010). TIMP-3 has been shown to promote apoptosis in human melanoma and colon carcinoma cells (Smith et al., 1997; Ahonen et al., 2003). An imbalance of the MMP-2: TIMP-2 ratio has been observed in lymph node positive breast carcinomas (Onisto et al., 1995; Figueira et al., 2009; Jezierska and Motyl, 2009). Patients with lymph node metastasis have higher MMP-2 levels relative to TIMP-2. These studies indicate that evaluation of the MMP: TIMP balance and/or measurements of their serum levels may constitute an early prognostic indicator in various types of human cancer (Onisto et al., 1995; Li et al., 2005; Jinga et al., 2006).  Despite the important role of MMPs in cancer development, attempts to target MMPs for cancer therapies have not been successful owing to their broad spectrum of substrates and extensive roles in physiology (Coussens et al., 2002; Murphy and Nagase, 2008). In the meantime, another family of metzincin has attracted much attention in this regard: the ADAM and ADAMTS family.  1.5  The ADAMTS Gene Family of Metalloproteinases  ADAM (A Disintegrin And Metalloproteinase) and ADAMTS (A Disintegrin And Metalloproteinases with ThromboSpondin motifs) families of metzincin proteinases are closely related to the MMPs.  37  The ADAMs are a family of transmembrane and secreted proteins with functions in cell adhesion and proteolytic processing of the ectodomains of diverse cell surface receptors and signalling molecules (Edwards et al., 2008). ADAMs possess some or all of the following domains: a signal peptide, a propeptide, a metalloprotease, a disintegrin, a cysteine-rich, an epidermal growth factor (EGF)-like domain, a transmembrane sequence and a cytoplasmic tail (Duffy et al., 2003). Thus, the ADAMs have the potential to act as adhesion molecules and/or proteinases. Two well-known functions of the ADAM proteases are the proteolytic function of degrading ECM to facilitate cell migration/invasion; and the function of working as sheddase to activate signalling pathways through shedding of cell surface cytokines and growth factors (Reiss and Saftig, 2009; Edwards et al, 2008; Duffy et al., 2003; Black and White, 1998; Wolfsberg et al., 1995). The ADAMs fulfills a broad spectrum of functions with roles in fertilization, development, and cancer (Murphy, 2008; Edwards et al., 2008).  The ADAMTS are a novel family of secreted zinc-dependent metalloproteinases, and the first to be described was ADAMTS-1, which was characterized as a cachexigenic tumor selective gene product involved in inflammation (Kuno et al., 1997a). Since then, 19 ADAMTS subtypes have been described in humans (Porter et al., 2005). These enzymes play important roles in the turnover of extracellular matrix proteins in various tissues, and their altered regulation has been implicated in diseases such as cancer, arthritis, and atherosclerosis. Unlike other metalloproteinases, ADAMTS members demonstrate a narrow substrate specificity, this makes ADAMTS enzymes potential pharmaceutical targets (Tortorella et al., 2009). Thus, considerable attention has been focused on  38  elucidating their structure, biological function and molecular mechanisms in relation to physiological and pathological conditions.  1.5.1  Structural and Functional Organization of ADAMTS Subtypes  The ADAMTS are organized into conserved domains. These domains are portrayed schematically in Figure 1.1. All of the ADAMTS are characterized by four structural and functional subunits: an amino terminal prodomain, a catalytic domain, a disintegrin-like domain, and an ECM binding domain at the carboxy terminal end of the protein (which is composed of a central thrombospondin (TSP) type 1 motif, a spacer region and a variable number of TSP-like motifs) (Kuno et al., 1997b; Hurskainen et al., 1999; Vazquez et al., 1999; Tang and Hong, 1999; Tang, 2001). The structural features of these domains are further summarized in Table 1.1. Thus all members of this gene family have the potential to act as MMPs and to regulate cell adhesion.  The ADAMTS are all synthesized initially as inactive pre-proenzymes that undergo Nterminal processing prior to being secreted from the cell. The initial step in ADAMTS processing involves cleavage of the signal peptide domain by a signal peptidase during translation and transit of the protein through the endoplasmic reticulum (Porter et al., 2005). The removal of the pro-domain, which preserves the latency of the enzyme, then occurs, and its removal may also be important for correct protein folding and secretion (Russell et al., 2003). Following the pro-domain is the catalytic or MMP-like domain (Apte, 2004). The MMP-like domain consists of a reprolysin-type zinc-binding motif  39  characterized by an amino acid sequence of HEXXHXXG/N/SXXHD, where ‘X’ represents any amino acid residue (Porter et al., 2005). The aspartic acid residue is conserved in ADAM and ADAMTS metalloproteinases but not in MMPs (Porter et al., 2005). Furthermore, a methionine residue exists within the sequence downstream of the third zinc-binding histidine residue and forms a structure known as a “Met-turn” (Kuno et al., 1997; Vasquez et al., 1999; Tortorella et al., 1999; Porter et al., 2005), and this is assumed to play an essential role in the structure and/or activity of metalloproteinases (Gomis-Ruth, 2003). After the MMP-like domain is the disintegrin-like domain. This domain shares sequence similarity to the soluble snake venom disintegrins, a family of polypeptides in which some members contain an arginine-glycine-aspartic acid (RGD) integrin recognition sequence (Williams, 1992; Porter et al., 2005). It has been reported that the disintegrin-like domains of many ADAMs are capable of acting as integrin ligands to support cell adhesion (Bridges and Bowditch, 2005). However, ADAMTS subtypes do not contain an RGD sequence in their disintegrin-like domain and there is no evidence yet to suggest that ADAMTS metalloproteinases interact with integrins (Porter et al., 2005). The function of this domain in ADAMTSs therefore remains to be elucidated.  The ancillary or ECM-binding domains perform their functions by interacting with components of the ECM (Apte, 2004, 2009). The first ECM-binding domain is a central thrombospondin type I-like (TSP) repeat (Kuno et al., 1997; Kuno and Matsushima, 1998; Porter et al., 2005). Thrombospondins are multidomain calcium-binding extracellular glycoproteins that associate with the ECM and play key roles in platelet aggregation,  40  inflammatory responses, and angiogenesis during wound repair and tumor growth (Bornstein et al., 2000; Tucker, 2004; Adams and Lawler, 2004). Thrombospondins have also been shown to modulate cell proliferation, cell migration and invasion, possibly through regulating extracellular proteinases, cytokines and growth factors (Adams, 2001; Bornstein et al., 2004). Following the central TSP repeat is a highly conserved cysteinerich domain containing ten cysteine residues, a spacer domain of variable length and a varying number of C-terminal TSP repeats that range in number from 14 C-terminal repeats in ADAMTS-20 to none in ADAMTS-4 (Tortorella et al., 1999; Llamazares et al., 2003).  Additional C-terminal modules are expressed in some ADAMTS subtypes. For example, ADAMTS-9 and -20 contain a GON domain, first described in gon-1, an ADAMTS subtype involved in gonadal development in C. elegans (Blelloch and Kimble, 1999). The GON domain is characterized by the presence of several conserved cysteine residues (Llamazares et al., 2003). ADAMTS-7 and -12 both have a mucin domain between the third and fourth TSP repeat (Cal et al., 2001; Somerville et al., 2004). ADAMTS-13 is a unique ADAMTS subtype that contains two CUB (complement components C1r/C1s, Uegf (sea urchin fibropellins), and bone morphogenic protein 1) domains (Zheng et al., 2001). Proteins that contain CUB domains are thought to be involved in developmental processes such as embryogenesis or organogenesis (Bork and Beckmann, 1993). Finally, ADAMTS-2, -3, -10, -12, -14, -17 and -19 contain a PLAC (protease and lacunin) domain at their C-terminus (Cal et al., 2001; Somerville et al., 2003). Some ADAMTS subtypes have been further sub-classified according to the identification of common  41  substrates. ADAMTS-1, -4, -5, -8 and -15 have been assigned to the subfamily of ADAMTS subtypes known as the aggrecanases, owing to their ability to cleave the large chondroitin sulphates: versican, brevican, aggrecan and neurocan (Tang et al., 1999, 2001; Nagase and Kashiwagi, 2003; Porter et al., 2005).  Removal of the ancillary C-terminal domain of the ADAMTS has a profound impact on the proteolytic activity, substrate specificity and sub-cellular localization of these enzymes. The C-terminal protein fragments of some of the ADAMTS also have independent and distinct biological functions. For example, the C-terminal fragment of ADAMTS-2 and -4 inhibits the enzymatic activity of the mature forms of these ADAMTS subtypes, whereas those of ADAMTS-1 and -8 exhibit potent anti-angiogenic properties (Porter et al., 2005; Rodriguez-Manzaneque et al., 2000; Vazquez et al., 1999). Recently, the exogenous expression of the mature form of ADAMTS-1 was shown to have pro-metastatic effects on carcinoma cells whereas the C-terminal fragment of this ADAMTS subtype exhibited anti-metastatic effects on the cells in vivo (Liu et al., 2006). The structural-functional relationships, and the molecular mechanisms underlying the distinct biological activities of the C-terminal fragments of these and the other ADAMTS subtypes that regulate the activation process remain to be elucidated.  42  ADAMTS1, 15 ADAMTS4 ADAMTS5, 8 ADAMTS2,3,14 ADAMTS9,20 ADAMTS6, 10, 17, 19 ADAMTS-13 ADAMTS16,18 ADAMTS7,12  e pr tid a in llo ep m a p t o in l e d M ma ona r g o i P d s  T re hro pe m at bo (s sp ) on PL di n AC do m ai n GO N1 do m ai n CU B do m ai n PN P do m ain  n ai in n m o a i ond d m h on do osp if gi ric n t b e i o ne r m rr m i eg o ce nt Thr e 1 ste i a s p Cy Sp Di ty  e as in e ot  ECM Binding region  Figure 1. 1. Schematic representation of the basic domain structures of the ADAMTS family of metalloproteinases. The ADAMTS are a secreted protein and are comprised of a signal peptide, a pro-domain, a metalloproteinase domain, a disintegrinlike domain, and an ancillary/extracellular matrix binding region consisting of a central thrombospondin (TS) type I domain, a cysteine-rich region, a spacer region, and depending on the ADAMTS subtype, any number of TS repeats. The ADAMTS carboxy terminal may further contain a PLAC domain, a GON-1 domain, a CUB domain and/or a PNP domain.  43  Table 1.1. Features of the structural and functional domains of the ADAMTS DOMAIN Signal Peptide Prodomain  MMP-domain  isintegrin domain  ECM Binding cassette • Central TSP-1 domain • Cysteine rich domain • Spacer Region • TSP-like domains  GENERAL FEATURES All ADAMTS contain an SPC (subtilisin-like proprotein convertase) cleavage site and with the exception of ADAMTS-10 and -12 (furin recognition sequences following the consensus RXR/KR). ADAMTS-1, -6, -7, -10, -12 and -15 contain a cysteine residue in their prodomain within a XXCGVD motif that loosely resembles that of the cysteine switch in MMPs A metalloproteinase domain with a reprolysin-type zinc binding motif HEXXHXXG/N/SXXHD. The conserved aspartic acid residue distinguishes the ADAM and ADAMTS from other MMPs and a methionine residue within the sequence V/IMAS/S or Met-turn down, downstream of the 3rd zinc binding histidine.  BIOLOGICAL FUNCTIONS Maintain latency of catalytic domain. Correct protein folding and secretion. Cleaved in Golgi prior to secretion. ADAMTS-7 and -13 can be catalytically active with their prodomains still attached.  All ADAMTS subtypes exhibit proteolytic activity in vitro. ADAMTS-2, -13 and -14 are procollagen N-proteinases: processing pro-collagens to collagen. ADAMTS-1, -4, 5, -8 and -15 preferentially cleave hyalectans. ADAMTS13 cleaves the large proteoglycan, von Willebrand factor (vWF) Shares sequence similarity to the soluble snake venom No biological activity identified in any disintegrin, a family of polypeptides which contain an ADAMTS subtype. integrin recognition sequence (RGD). No evidence that ADAMTS disintegrin No ADAMTS has an RGD motif in their disintegrin domain associates with integrins. domain. TSP-1 repeat seen in thrombospondins 1 and 2. Deletion mutants demonstrated that central High sequence homology among ADAMTS subtypes, TSP-1, spacer region and TSP-1-like motifs contains 10 cysteine residues. all contribute to ECM binding and Spacer region is of variable length with no distinguishing subsequent proteolytic activity/specificity of structural features. the ADAMTS, particularly, ADAMTS-1, Variable number of C-terminal TSP-1 motifs (range from 2, -4, and -8. 0 repeats in ADAMTS-4 to 14 repeats in ADAMTS-20).  44  1.5.2  Cell Biology of ADAMTS  The majority of the distinct ADAMTS subtypes have been characterized only at the structural level. However, studies suggest that these novel proteases are involved in organogenesis during embryonic development (Cho et al., 1998; Tang, 2001; Shindo et al., 2000) and in the development of thrombotic and inflammatory conditions (Kuno et al., 1997; van Goor et al., 2009). There is also increasing evidence indicating that these proteases play important roles in the cyclic remodeling of reproductive tissues (Cho et al., 1998; Boerboom et al., 2003; Young et al., 2004) and in the onset and progression of cancer (Rocks et al., 2008; Porter et al., 2006; Held-Feindt et al., 2006).  ADAMTS-1 was first identified in a cytokine-induced cancer cachexia in mouse; thus establishing a role for this novel gene family in cancer and inflammatory diseases (Kuno et al., 1997). Subsequently, many other members of the ADAMTS family such as ADAMTS-4 and -5 have been studied in the initiation of inflammatory responses in osteoarthritis (Arner et al., 1999; Tortorella et al., 1999; Kuno et al., 2000; Yamanishi et al., 2002). ADAMTS-4 and -5 are capable of cleaving the Glu373-Ala374 cleavage site in aggrecan and they are overexpressed in osteoarthritic articular cartilage (Arner et al, 1999; Tortorella et al, 1999). Mice null-mutant for the ADAMTS-5 gene exhibit significant osteoarthritic cartilage destruction, indicating the importance of this aggrecanase in the onset of arthritis (Rogerson et al., 2008). In addition to ADAMTS-4 and -5, ADAMTS-1, -8, -9, and -15 have also been demonstrated to have aggrecan-degrading abilities in vitro and in vivo (Kuno et al., 2000; Sandy et al., 2001;  45  Somerville et al., 2003; Collins-Racie et al., 2004), so these ADAMTSs have been subclassified as aggrecanases.  Furthermore, ADAMTS-7 and -12 have recently been shown to play key roles in the onset of osteoarthritis in part by their ability to degrade the cartilage matrix protein (Liu et al., 2006a, 2006b). The expression of multiple ADAMTS subtypes in articular cartilage suggests that there is some overlap/compensation amongst these proteinases in initiating inflammatory responses in arthritic disease. In view of this, it is possible that these ADAMTS genes present overlapping roles in other physiological and pathological responses, such as in endometrial decidualization and cancer development.  In addition to aggrecan, ADAMTS-1, -4, -5, -8 and -9 can cleave the closely related ECMassociated aggregating chondroitin sulfate proteoglycans versican and brevican (Russell et al., 2003; Sandy et al., 2001; Somerville et al., 2003; Westling et al., 2004). Versican has been identified in a variety of tissues and appears to be ubiquitously expressed (Wight, 2002). Recent studies have demonstrated the importance of versican degradation by ADAMTS-1 and -4 in cumulus and endothelial cells of the ovulating ovary and there is evidence to suggest ADAMTS-1 plays key roles in versican-remodeling processes in vascular smooth muscle cells in the human aorta (Jonsson-Rylander et al, 2005; Richards et al, 2005). Taken together, these studies emphasize the importance of ADAMTS functions in a variety of tissues.  Angiogenesis is an essential characteristic of many physiologic processes. It has important function in the organ development and growth, wound healing, and in the female reproductive  46  cycle (Carmeliet and Jain, 2000). Angiogenesis is also a crucial event in solid tumor development and progression (Carmeliet and Jain, 2000). ADAMTS-1 and -8 possess a potent angio-inhibitory activity, inhibiting both fibroblast growth factor (FGF)-2 and vascular endothelial growth factor (VEGF)-mediated angiogenic effects upon endothelial cells (Vazquez et al., 1999; Basile et al., 2008). It is has been suggested that the C-terminal TSP repeats facilitate these angio-inhibitory actions as it has been previously shown that the TSP repeats in thrombospondin-1 and -2 inhibit angiogenesis (Vasquez et al., 1999; Lawler and Detmar, 2004). The anti-angiogenic effect of thrombospondin-1 and -2 involves mechanisms such as direct interaction with VEGF, inhibiting MMP-9 activation, suppressing endothelial cell migration and inducing apoptosis (Lawler and Detmar, 2004). An up-regulation of ADAMTS-4 mRNA expression has also been reported in an in vitro model of angiogenesis (Kahn et al., 2000).  ADAMTS-2 is capable of processing procollagen I, II and III, whereas ADAMTS-3 and -14 process the N-terminals of procollagen I and II, respectively. Mutations in the ADAMTS-2 gene cause aberrant procollagen processing (Colige et al., 1999). Point and frame-shift mutations in ADAMTS-2 result in the onset of dermatosparaxis in sheep and cattle, and Ehlers-Danlos syndrome in humans, both of which disorders are characterized by severe skin fragility (Colige et al., 2004; Bar-Yosef et al., 2008). In addition to developing fragile skin, ADAMTS-2 null-mutant male mice were found to be sterile, characterized by a marked decrease in testicular sperm (Li et al., 2001). This observation illustrates the putative importance that ADAMTS-2 plays in spermatogenesis.  47  ADAMTS-13 has been characterized as the von Willebrand factor cleaving proteinase (vWFCP) (Zheng et al., 2001; Levy et al., 2001; Lenting et al., 2010). Deficiency of ADAMTS-13 leads to the development of the disease thrombotic thrombocytopenic purpura (TTP), characterized by the formation of microvascular vWF- and platelet-rich thrombi (Levy et al., 2001; Sadler et al., 2004; Zipfel et al., 2010). Mutations in its CUB and spacer domains have revealed the importance of these domains in ADAMTS-13 function. Furthermore, function-inhibiting autoantibodies generated in people with TTP consistently interact with the cysteine-rich/spacer regions of the ECM binding domain (Klaus et al., 2004). These findings provide yet another example of the functional significance of the ancillary components in ADAMTS function.  1.5.3  Regulation of ADAMTS Expression and Function  The similarity between the ADAMTS zinc-dependent catalytic domain and the catalytic domain of MMPs established the possibility that ADAMTS subtypes could be inhibited by the broadly effective MMP inhibitors, TIMPs. Studies have demonstrated that TIMP-3 is the most potent natural inhibitor of the ADAMTS aggrecanases (Gendron et al., 2003). It can potently inhibit ADAMTS-4 and -5 function and partially inhibited ADAMTS-1 (Arner et al., 1999; Kashiwagi et al., 2001; Rodriguez-Manzaneque et al., 2002; Troeberg et al., 2009; Pockert et al., 2009). In addition to TIMP-3, ADAMTS-1, -4, and -5 are effectively inhibited by catechin gallate esters found in green tea (Vankemmelbeke et al., 2003). Finally, inhibition of ADAMTS-1 by the synthetic inhibitors EDTA, 1,10-phenthroline, BB-94 and MMP-  48  inhibitor-2 has been demonstrated (Arner et al., 1999; Kuno et al., 1999; RodriguezManzaneque et al., 2000).  Papilin is an ECM glycoprotein that contains a conserved sequence referred to as a ‘papilin cassette’ (Kramerova et al., 2000, John et al., 2004; Fessler et al., 2004). The papilin cassette shares close homology to the ancillary C-terminal domains of ADAMTS subtypes. In vitro, papilin was capable of inhibiting ADAMTS-2 function in a non-competitive manner, thought to be mediated by the interaction of the ‘papilin cassettes’ (Kramerova et al., 2000). Another family of proteins structurally related to the ADAMTS metalloproteinases is the ADAMTSlike (ADAMTSL) family (Hirohata et al., 2002; Hall et al., 2003). These proteins are similar in structure to papilin as they contain a papilin cassette. We do not have enough information regarding vertebrate papilins and the related ADAMTS-like proteins. However, in vitro studies indeed point out that some in vivo interactions between papilins and ADAMTS metalloproteases are quite likely.  Growth factors, cytokines and hormones can regulate ADAMTS metalloproteinases. TGF-β1 has been shown to induce ADAMTS-2, -4 and -12 mRNA expression levels in osteosarcoma cells, human fetal fibroblasts and fibroblast-like synoviocytes and to reduce ADAMTS-1, -5, 9, and -15 mRNA levels in prostatic cancer cells (Cal et al., 2001; Yamanishi et al., 2002; Wang et al., 2003; Cross et al., 2005). Studies from our laboratory also indicated that TGF-β1 decreases ADAMTS-1 and -5 mRNA and protein levels in human endometrial decidual stromal cells (Ng et al., 2006; Zhu et al., 2007). IL-1 induces the expression of the aggrecanases ADAMTS-1, -4 and -5 in articular cartilage and chondrocytic cell lines (Pratta  49  et al., 2003; Kashiwagi et al., 2004). IL-1β also increases the expression of ADAMTS-1 and 5 in decidual stromal cells (Ng et al., 2006; Zhu et al., 2007).  Hormones can regulate specific ADAMTS subtypes as well. Tri-iodothyronine (T3) was shown to up-regulate the expression of ADAMTS-5, but not ADAMTS-4 in growth plate cartilage during endochondral ossification whereas parathyroid hormone upregulated ADAMTS-1 mRNA expression in bone and osteoblasts (Miles et al., 2000; Makihira et al., 2003). ADAMTS-1 expression in granulosa cells is regulated by luteinizing hormone (LH)/human chorionic gonadotropin (hCG) in a progesterone receptor (PR)-dependent manner, as determined through PR knockout studies (Russell et al., 2003; Boerboom et al., 2003; Shimada et al., 2004). They demonstrated that the mechanism by which the PR mediates ADAMTS-1 gene expression does not involve classic PR binding elements within the promoter, but rather it regulates promoter activity by regulating other transcription factors through protein-protein interactions (Doyle et al., 2004). Studies from our laboratory indicated that progesterone, 17β-estradiol, and dihydrotestosterone have complex regulatory effects on the expression levels of ADAMTS-1 in human endometrial stromal cells (Wen et al., 2006).  1.5.4  ADAMTS and Pregnancy  Recently we demonstrated that ADAMTS-1 is expressed in human endometrial stromal cells and first trimester decidua stromal cells in vivo. It has been shown to be differentially regulated by the cytokines IL-1β and TGF-β1 (Ng et al., 2006), and gonadal steroids (Wen et  50  al., 2006) in vitro, suggesting that this proteinase play a role in ECM remodeling events during the process of decidualization.  ADAMTS-1 is expressed in the uterus of pregnant mice (Shindo et al., 2000; Mittaz et al., 2004) and a significant increase in ADAMTS-1 mRNA levels has been detected in the periimplantation endometrium (Kim et al., 2005). Gene knockout studies indicated that some mice null-mutant for ADAMTS-1 developed large cysts in the endometrial tissues and morphological changes during decidulization (Shindo et al., 2000), but some mice still can undergo normal morphological decidualization (Mittaz et al., 2004). However, all ADAMTS1 gene knockout female mice are reported to have reduced pregnancy rates due to the abnormality of the endometrium and ovulation (Shindo et al., 2000; Mittaz et al., 2004). Studies also have demonstrated that ADAMTS-1 is expressed in granulosa cells of rupturing follicles during ovulation and also that PR is involved in the regulation of ADAMTS-1 in the mouse ovary (Robker et al., 2000; Espey et al., 2000, Shozu et al., 2005). These findings suggest that ADAMTS-1 may play important roles in the process of ovulation and maintenance of pregnancy and/or placentation (Mittaz et al., 2004).  ADAMTS-5 was determined to be specifically expressed in the 7-day mouse embryo, a period that correlates with peri-implantation, and in trophoblastic cells lining the uterine cavity in 8.5-day-old embryos (Hurskainen et al., 1999). Furthermore, ADAMTS-5 expression was shown to increase during the decidual reaction in mice, providing evidence that this ADAMTS subtype also plays an important role during implantation (Hurskainen et al., 1999). Recently we have demonstrated that ADAMTS-5 is expressed in human  51  endometrial stroma in vivo and increases with decidualization, and is under the regulation of cytokines (Zhu et al., 2007). These findings implicate a role for ADAMTS-5 in controlling ECM-remodeling processes in endometrial and placental development. In addition, the mRNA of other ADAMTS subtypes, ADAMTS-1, -4, -5, -6, -7, -9, and -10, has been detected in human term placenta (Abbaszade et al., 1999; Hurskainen et al., 1999; Llamazares et al., 2003; Somerville et al., 2003, 2004) and ADAMTS-2 in the first trimester placenta (Farina et al., 2006). The expression of multiple ADAMTS subtypes in the human placenta is supportive of their potential roles in ECM degradation/activation during placental development.  1.5.5  ADAMTS and Cancer  Studies have demonstrated that aberrant expression of ADAMTSs has been found in diverse tumor types and is involved in multiple steps of cancer development by regulating tumor cell proliferation, apoptosis and invasiveness (Rocks et al., 2008). For example, ADAMTS-1 level is down-regulated in non-small cell lung carcinoma when compared to non-cancerous tissues (Rocks et al., 2006). ADAMTS-4 and -12 are differentially expressed between paired normal gastric and brain tissues and in tumors, with expression levels consistently higher in the tumor samples (Matthews et al., 2000; Cal et al., 2001). ADAMTS-4 and -5 are overexpressed in human glioblastomas and contribute to the invasiveness of glioblastoma cells by cleavage of brevican (Held-Feindt et al., 2006). Brain tumors possess lower levels of ADAMTS-8 and ADAMTS-13 than the tissues of normal brain (Bohm et al., 2003, Dunn et al., 2006). It has been reported that patients with an advanced stage and metastasis of cancer display lower  52  ADAMTS-13 levels (Koo et al., 2002; Oleksowicz et al., 1999). Low ADAMTS-13 activity could decrease vWF (Von Willebrand Factor) cleavage, and cause an accumulation of highly polymeric vWF that facilitates adhesive interactions between circulating tumor cells and platelets (Bohm et al., 2003). ADAMTS-8 and -15 are expressed in breast cancer, and patients with increased levels of ADAMTS-8 and decreased levels of ADAMTS-15 are associated with an unfavorable clinical prognosis (Porter et al., 2006). In the prostate, cells that have differentiated into benign prostatic hyperplasia and prostatic cancers exhibit an accumulation of the ECM proteoglycan versican, one of the main substrates of some ADAMTS genes (Ricciardelli et al., 1998; Luo et al., 2002). Furthermore, versican expression appears to be an indicator of poor prognosis in prostate cancers and is enhanced by the tumor cell-derived growth factor TGF-β1 (Sakko et al., 2001; Cross et al., 2005). Together, these data suggest a positive role for ADAMTS metalloproteinases in the progression of specific cancers.  ADAMTS-1 is the best characterized ADAMTS gene. It was initially identified in an animal model for colon cancer cachexia as an inflammation-associated protein (Kuno et al., 1997a). Higher levels of ADAMTS-1 have been associated with pancreatic and hepatocellular cancer (Masui et al., 2001), and ADAMTS-1 mRNA levels are decreased in lung carcinomas (Rocks et al., 2006). Among pancreatic cancer cases, higher levels of ADAMTS-1 were associated with increased local invasion and lymph node metastasis and poorer prognosis (Masui et al., 2001). Furthermore, the exogenous expression of ADAMTS-1 has been shown to decrease the experimental metastasis of Chinese hamster ovary cells (Kuno et al., 2004) but to increase the metastatic potential of mammary and lung cancer cell lines in vivo (Liu et al., 2006).  53  Further studies are required to evaluate the biological and clinical significance of (dys)regulated expression levels of ADAMTS-1, alone or in combination with other distinct ADAMTS subtypes, in the onset and/or progression of cancer to later stages.  1.6  Hypothesis and Rationale  The ADAMTS are a novel gene superfamily of metalloproteinases composed of 19 genetically distinct members in human. The expression of distinct ADAMTS subtypes has been associated with pre- and postnatal growth and developmental of tissues and the onset and progression of cancer, arthritis, Alzheimer’s disease and a number of inflammatory and thrombotic conditions.  Studies from our laboratory have determined that ADAMTS-1 and -5 are spatiotemporally expressed in the human endometrium during the menstrual cycle and in pregnancy (Ng et al., 2006; Zhu et al., 2007). In particular, ADAMTS-1 and-5 expressions were readily detectable throughout the glandular epithelium but restricted to the pre-decidualized stromal cells surrounding the spiral arterioles of the secretory endometrium. Extensive ADAMTS-1 and -5 immunostaining were subsequently detected in the stromal cells of first trimester decidua and were regulated by two cytokines, IL-1ß and TGF- ß1( Ng et al., 2006, Zhu et al., 2007). In addition, I have determined that combinations of gonadal steroids and anti-steroidal compounds have complex regulatory effects on ADAMTS-1 expression in endometrial stromal cells (Wen et al., 2006). Our studies also show that ADAMTS-1 was expressed in the well-differentiated human endometrial carcinoma cells in vitro.  54  My study aimed to define the regulation and function of the ADAMTSs in the endometrium during the physiological conditions of the menstrual cycle, as well as in endometrial carcinoma.  OVERALL HYPOTHESIS  ADAMTS subtypes influence ECM remodeling events that occur in the human endometrium under physiological and pathological conditions.  OBJECTIVE 1: To investigate the regulation of aggrecanases in the maturation of human endometrium  Aim 1: Determine the ability of progestin, estrogen and androgen to regulate ADAMTS4, -5, -8, and -9 mRNA and protein levels in primary cultures of human endometrial stromal cells.  To determine the regulatory effects of gonadal steroids on the aggrecanases expression in the human endometrium, I examined the abilities of P4, E2, and DHT, alone or in combination, to regulate ADAMTS-4, -5, -8 and -9 mRNA and protein levels in a dose- and time-dependent manner. This was achieved by using primary cultures of human endometrial stromal cells. The ability of gonadal steroids to regulate ADAMTSs mRNA and protein levels in these  55  primary cell cultures was determined by using a real-time qPCR strategy and Western blot analysis, respectively.  Aim 2: Determine the regulatory effects of antisteroidal compounds on ADAMTS-4, -5, 8 and -9 mRNA and protein levels in primary cultures of human endometrial stromal cells.  I examined the regulatory effects of the antisteroidal compounds, RU486 (an anti-progestin), ICI 182, 780 (an anti-estrogen) or flutamide (an anti-androgen) alone or in combination with P4, E2, and DHT, to regulate ADAMTS-4 , -5, -8 and -9 mRNA and protein expression levels in a dose- and time-dependent manner. This was achieved by using the same primary cell cultures and approaches as described above.  OBJECTIVE 2: To test the hypothesis that members of ADAMTS subfamily play integral roles in the progression of endometrial cancer.  Aim 2A: Investigate whether estrogen–induced cancer cell invasion involves regulated ADAMTS-1 expression in well-differentiated human endometrial carcinoma cells in vitro  I used a Transwell Matrigel invasion assay to explore the effects of gonadal steroids on the invasion capacity of well-differentiated ECC-1 endometrial carcinoma cells. I then examined  56  the regulatory effects of steroids on ADAMTS-1 mRNA and protein levels by real-time qPCR and Western blot analysis in ECC-1 cells.  Aim 2B: Identify the function of ADAMTS-1 in endometrial cancer cell invasion  In this set of studies, I first examined the invasive capacity and the expression of aggrecanases and versican in well- and poorly differentiated endometrial carcinoma cells, respectively the ECC-1 and KLE cell lines, by using Matrigel invasion assays, RT-PCR and Western blot analysis. Secondly, the full-length ADAMTS-1 cDNA construct and ADAMTS1 siRNA were transfected into ECC-1 and KLE cell, to examine the effects of loss and gain of ADAMTS-1 on cancer cell invasiveness.  57  CHAPTER 2.  MATERIALS AND METHODS  2.1  Cells and Culture Conditions  2.1.1  Tissues  Endometrial tissue samples were obtained from women (n = 12) 35 to 45 years old undergoing a hysterectomy for reasons other than endometrial cancer or hyperplasia in accordance with a protocol for use of human tissues approve by the UBC Clinical Ethic Review Board. All of these women had normal menstrual cycles and did not receive hormonal treatments for at least 3 months prior to the time of surgery. Menstrual cycle stage was determined by the last menses and was confirmed by subsequent histological evaluation (Noyes et al., 1950). Only endometrial tissues obtained prior to the perimenstrual stage of the late secretory phase were used for stromal cell isolation.  Tissue samples of first trimester endometrial decidua were obtained from women undergoing elective termination of pregnancy (gestation ages ranging from 6-12 weeks) (n=5).  The use of these tissues was approved by the Committee for Ethical Review of Research on the Use of Human Subjects, University of British Columbia. All patients provided informed written consent.  58  2.1.2  Endometrial Stromal Cells  Enriched cultures of stromal cells were isolated from endometrial tissues by enzymatic digestion and mechanical dissociation as previously described (Chen et al., 1998). In this protocol, endometrial tissue samples were minced and subjected to 0.1% collagenase (type IV, Sigma Chemical Co, St Louis, MO) and 0.1% hyaluronidase (type I-S, Sigma Chemical Co, St Louis, MO) digestion in a shaking water bath at 37°C for 60 min. The cell digests were then passed through a nylon sieve (38µm). The isolated glands and any undigested tissue fragments were retained on the sieve, and the eluate containing the stromal cells was collected in a 50ml tube. The stromal cells were then pelleted by centrifugation at 800 × g for 10 min at room temperature. The cell pellets were washed once with phenol red-free DMEM containing 10% charcoal-stripped fetal bovine serum (FBS), and the cells were then resuspended and plated in phenol red-free DMEM containing 25 mM glucose, L-glutamine, antibiotics (100U/ml penicillin, 100µg/ml streptomycin) and supplemented with 10% charcoal-stripped FBS. The culture medium was replaced 30 min after plating to reduce epithelial cell contamination.  The purity of the endometrial stromal cell cultures was determined by  immunocytochemical staining for vimentin (fibroblast), cytokeratin (epithelial), muscle actin (muscle cells) and factor VIII (endothelial). These cellular markers are used to determine the purity of human endometrial cell cultures (Irwin et al., 1989). As defined by these criteria, the endometrial stromal cell cultures used in these studies contained < 1% epithelial or vascular cells.  59  2.1.3  Endometrial Cancer Cell Lines  ECC-1 and KLE cell lines were obtained from the American Type Culture Collection (ATCC) and maintained  in phenol red-free DMEM/F12 media containing 25 mM glucose, L-  glutamine, antibiotics (100U/ml penicillin, 100µg/ml streptomycin) and  10% charcoal-  stripped FBS (Intergen, Purchase, NY). Cells were grown in 10 cm2 culture dishes in an air:carbon dioxide (95%:5%) atmosphere at 37°C.  2.2  Experimental Culture Conditions  2.2.1  Steroid Treatment  Endometrial stromal cells (passage 2 to 4) were grown to 80% confluence, washed with PBS and cultured in phenol red-free DMEM supplemented with 10% charcoal-stripped FBS containing either increasing concentrations of P4 (1-10µM), E2 (1-100nM), or DHT (1500nM) for 72h or a fixed concentrations of P4 (1µM), E2 (30nM) or DHT (100nM) for 0, 6, 12, 24, 48, or 72h.  To determine whether a combination of steroids was required for maximal ADAMTS-4, -5, -8, and -9 expression in endometrial stromal cells, the cells were cultured in the presence of P4 plus E2, P4 plus DHT or E2 plus DHT for 0-72 h before harvesting for real-time qPCR and Western blot analysis.  60  ECC-1 cells were grown to 80% confluence in phenol red free DMEM/F12 with 10% charcoal-stripped FBS and cultured with steroids in the concentrations described above.  2.2.2  Antisteroid Treatment  Endometrial stromal cells and ECC-1 cells were cultured in phenol red-free culture medium with 10% charcoal-stripped FBS with either increasing concentrations of RU486 (25nM10µM), ICI 182, 780 (1nM-1µM)) or hydroxyflutamide (1nM-1µM) for 72 hours, or a fixed concentration of RU486 (2.5µM), ICI 182, 780 (100nM) or hydroxyflutamide (100nM) for 0, 6, 12, 24, 48, or 72 hours.  To examine the inhibitory effects of anti-steroidal compounds on the steroid-mediated effects on aggrecanases, the endometrial stromal cells were cultured with P4 (1µM) plus increasing concentration of RU486 (25nM-10µM) or hydroxyflutamide (1nM-1µM), and DHT (100nM) plus increased concentrations of hydroxyflutamide or RU486. The ECC-1 cells were cultured in the presence of E2 (30nM) plus increasing concentrations of ICI 182 780 (1nM-1µM).  Endometrial stromal cells cultured with vehicle (0.1% ethanol) served as controls for these studies. The concentrations of steroids and anti-steroidal compounds, and the time points examined in this study, were based upon previous studies (Chen et al., 1998, 1999; Ling et al., 2002). All of the primary cultures of endometrial stromal cells and ECC-1 cells were harvested for either total RNA or protein extraction.  61  2.3  Methods  2.3.1  RNA Preparation and Synthesis of First Strand cDNA  Total RNA was prepared from endometrial cell cultures using Tri-Reagent (Bio/Can, Mississauga, Canada) using a protocol recommended by the manufacturer. Total RNA extracts were treated with Deoxyribonuclease-1 (Sigma Aldrich) to eliminate possible genomic DNA contamination. To verify the integrity of the RNA, aliquots of the total RNA extracts were electrophoresed in a 1% (w/v) denaturing agarose gel containing 3.7% (v/v) formaldehyde, and the 28 S and 18 S ribosomal RNA subunits were visualized by ethidium bromide staining. The purity and concentration of total RNA present in each of the extracts was quantified by optical densitometry (260/280nm) using a DU-64 UV-spectrophotometer (Beckman Coulter, Mississuaga, ON, Canada)  Aliquots (~1 µg) of the total RNA extracts prepared from each of the cell cultures were then reverse-transcribed into cDNA using a First Strand cDNA Synthesis Kit according to the manufacturer’s protocol (Amersham Pharmacia Biotech, Oakville, ON, Canada). Briefly, an aliquot (1µg) of the total RNA dissolved in DNase/RNase-free water (8µl in total) was heated at 65°C for 10 min and cooled on ice. Dithiothreitol (DTT) (1µl), oligo-dT (1µl), and bulk mixture (dATP, dCTP, dGTP, dTTP) (5µl) was added to the sample, and the mixture was incubated at 37°C for 1 h. After incubation, the sample was boiled for 5 min to inactive reverse transcriptase and subsequently stored at -20°C until use.  62  2.3.2  Design of Oligonucleotide Primers  Nucleotide sequences specific for human ADAMTSs were identified in the Genebank database using the BLAST (basic Local Alignment Search Tool) computer program (www.ncbi.com). Forward and reverse oligonucleotide primers specific for ADAMTS-1, -4, 5, -8, -9 , versican and GAPDH, which served as an internal control, were designed using the PRIMER EXPRESS software (Applied Biosystems) for real-time qPCR studies. The specific nucleotide sequences of these primers are listed in Table 2.1. Forward and reverse oligonucleotide primers specific for ADAMTS-1, ERα, ERβ, PR, AR and GAPDH that were used for semi-quantitative RT-PCR were generated by Primer3 software. The specific nucleotide sequences of these primers are listed in Table 2.2.  Table 2.1. Primer sequences for real-time qPCR analysis Gene GAPDH forward GAPDH reverse  Primer sequence(5’-3’) ATGGAAATCCCATCACCATCTT CGCCCCACTTGATTTTGG  Position 269-290 325-308  ADAMTS-1 F ADAMTS-1 R  GCTCATCTGCCAAGCCAAAG CTACAACCTTGGGCTGCAAAA  1979-1999 2037-2016  59  ADAMTS-4 F ADAMTS-4 R  CACATCCTACGCCGGAAGAG GAGCCTTGACGTTGCACATG  536-555 596-577  61  ADAMTS-5 F ADAMTS-5 R  AATAACCCTGCTCCCAGAAACA GCGGTAGATGGCCCTCTTC  1785-1807 1844-1825  60  ADAMTS-8 F ADAMTS-8 R  CCAGCATCAAGAATTCCATCAA CCCATTTTTCATCTTCTACGATCA  774-795 839-816  66  ADAMTS-9 F ADAMTS-9 R  GGAACAAAACAAACCCCACATC CCTTCCTGTTGAGGGCTCTCT  595-616 661-642  57  ADAMTS-15 F ADAMTS-15 R  GGCCTGCGTGGAGAGACA CCCATTTGGCCCAGGAA  1507-1524 1568-1552  62  Versican F Versican R  TCAGCCTACCTTGTCATTTTTCAAC CATTTGATGCGGAGAAATTCAC  119-143 197-176  78  63  Product (bp) 57  2.3.3  Real-time Quantitative (q)RT-PCR  The first-strand cDNA generated from the endometrial stromal cell and ECC-1 cell cultures served as a template for real-time qPCR using the ABI PRISM 7300 Sequence Detection System (Perkin-Elmer Applied Biosystems, CA, USA) equipped with a 96-well optical reaction plate for primers specific for ADAMTSs or the housekeeping gene, GAPDH.  Real-time qPCR was performed using 12.5 µl SYBR® Green PCR Master Mix (Perkin-Elmer Applied Biosystems), 7.5µl of primer mixture (300nM) and 5µl of cDNA template (diluted 1: 8 v/v) under the following optimized conditions: 52ºC for 2 min followed by 95ºC for 10 min, and 40 cycles of 95ºC for 15 sec and 60ºC for 1 min. All PCR reactions were performed in duplicate, with the mean being used to determine mRNA levels. A negative control containing water instead of sample cDNA was included in each plate. Each set of primers generated a single PCR product of the appropriate size when visualized by agarose gel electrophoresis, and by the melt curve analysis following qRT-PCR. Nucleotide sequences of the resultant PCR products were confirmed by BLAST (http://www.ncbi.nlm.nih.gov). The amplification efficiency was determined by plotting log cDNA dilution against ∆CT (∆CT =CT.Target-CT.GAPDH), the slope of which was close to zero indicating maximal and similar efficiency of the target and reference genes (data not shown). Relative ADAMTS-1, -4, -5, -8, and -9 mRNA levels were determined using the formula 2−∆∆CT where ∆∆CT = (CT.TargetCT.GAPDH)X-(CT.Target-CT.GAPDH)0 . In this formula, X represents any time point or experimental treatment with control cultures being assigned a value of zero (Kenneth and Thomas, 2001). Data were analyzed using SDS 2.0 software (Applied Biosystems). This experimental  64  approach was validated by the observation that differences between the CT for the target gene and GAPDH remained relatively constant for each amount of DNA examined.  2.3.4  Semiquantitative RT-PCR  Semiquantitative RT-PCR was performed using the primer sets specific for ADAMTS-1, ERα, ERß, PR, AR, GAPDH, and template cDNA generated from the total RNA extracts prepared from ECC-1 and KLE cells. The primers and optimized numbers of cycles subsequently used to amplify the ADAMTS-1, steroids receptors and GAPDH identified in each of these samples are listed in Table 3. Aliquots (10 µl) of the PCR products generated from the cell samples were separated by electrophoresis in a 2% (w/v) agarose gel and visualized by ethidium bromide staining. The intensity of ethidium bromide staining of the PCR products was analysed by UV densitometry (Biometra, Whiteman Co., Gottigen, Germany). Volume counts (mm3) of the PCR products were then determined using the Scion Image computer software (Scion Image Co., Frederick, MD).  65  Table 2.2. Primer sequences and PCR conditions for the semiquantitative RT-PCR analysis  Gene  Primer Sequence  ADAMTS-1  Forward: 5’-CGAGTGTGCAAAGGAAGTGA-3’ Reverse: 5’-CTACCCCATAATCCCACCT-3’  560bp  ER-ɑ  Forward: 5’-GTGCCTGGCTAGAGATAATG-3’ Reverse: 5’-GATGTGGGAGAGGATGAGGA-3’  401bp  ER-ß  Forward: 5’-CGAAGTGGGAATGGTGAAGT-3’ Reverse: 5’-ACAAAGCCGGGAATCTTCTT-3’  330bp  PR  Forward: 5'-ACACCTTGCCTGAAGTTTCG-3' Forward: 5'-TTTGCCCTTCAGAAGCGG -3'  592bp  AR  Forward: 5’-CGAAGTGGGAATGGTGAAGT-3’ Reverse: 5’-CTCTCGCCTTCTAGCCCTTT-3’  378bp  GAPDH  Forward: 5’-CCCAATTCTCTACGGAGTCG-3’ Reverse: 5’-AATCTCCCAGGGTTGCTTCT-3’  203bp  2.3.5  Product Size  PCR Conditions Denaturing: 94°C 60s Annealing: 60°C 60s Extension: 72°C 60s 30 cycles Denaturing: 94°C 60s Annealing: 58°C 35s Extension: 72°C 60s 30 cycles Denaturing: 94°C 60s Annealing: 59°C 60s Extension: 72°C 60s 30 cycles Denaturing: 94°C 60s Annealing: 60°C 60s Extension: 72°C 60s 30 cycles Denaturing: 94°C 60s Annealing: 60°C 60s Extension: 72°C 60s 30 cycles Denaturing: 94°C 60s Annealing: 55°C 45s Extension: 72°C 60s 20 cycles  Western Blot Analysis  Endometrial stromal cell and endometrial carcinoma cell cultures were washed three times in cold 1% PBS and incubated in 100 µl of cell extraction buffer (Biosource International, Camarillo, CA) supplemented with 1mM PMSF and protease inhibitor cocktail at 4°C for 30 min on a rocking platform. The cell lysates were centrifuged at  10, 000 x g for 20 min at  4°C and the supernatants were used for Western blot analysis. The concentrations of protein in the cell lysates were determined using a BCA kit (Pierce Chemicals, Rockford, IL). ADAMTS-1 was detected using a polyclonal antibody directed against human ADAMTS-1  66  (Biodesign Intl., Saco, ME). To standardize the amounts of protein loaded into each lane, the blots were reprobed with a monoclonal antibody directed against human β-actin (Sigma Chemical Co.). The Amersham ECL system was used to detect the amount of each antibody bound to antigen and the resultant autoradiograms analyzed by UV densitometry. The absorbance values obtained for ADAMTS-1, -4, -5, and -8 were then normalized relative to the corresponding β-actin absorbance value.  2.3.6  Transwell Invasion Assay  In vitro cellular invasion assay was performed using Transwells fitted with Millipore Corp. membranes coated with a thin layer of growth factor-reduced Matrigel (6.5-mm filters, 8-µm pore size; Costar, Toronto, ON, Canada) as previously described (Zhou et al., 1997). Briefly, growth-factor reduced Matrigel (BD Biosciences, USA) was thawed at 4°C overnight and then diluted with cold serum-free DMEM/F12 at 1:40 ratio, then the diluted Matrigel was plated into pre-cooled 12-well insert. After incubation at 37°C for 4 hours, the suspension was removed. ECC-1 and KLE cells suspended in DMEM/F12 with 0.1% FBS were added (2x105 cells/ml, 250µl) to the upper wells of the Transwell chamber, which was then immediately immersed into the culture well containing 800ul of DMEM/F12 supplemented with 10% FBS. After 24 hours of incubation in a humidified environment (5% CO2) at 37°C, the medium inside was poured out, and the insert was placed into methanol at -20°C for 30min for fixation of cells. The insert was then immersed in PBS and stained with Hemacolor (EMD chemicals, Germany). After washing with PBS, the noninvaded cells from the upper surface of the Matrigel layer were completely removed by gentle swabbing, the remaining cells that had 67  invaded into the matrigel appeared on the underside of the filter membrane. The membrane was then excised from the Transwells, and mounted upside-down onto glass slides with Cytoseal XYL (Richard-Allan Scientific, USA). Invasion indices were determined by counting the number of stained cells in 10 randomly selected, non-overlapping fields at 40X magnification using a light microscope. Invasion was tested in triplicate wells, on three independent occasions.  2.3.7  siRNA Transfection  Before starting the loss-of-function studies, five siRNA targeting the human ADAMTS-1 mRNA were tested, and one siRNA (5’-CGGCAGTGGTCTAAAGCATTA-3’) was found to be most effective in terms of its ability in silencing the mRNA and protein levels of ADAMTS-1 in KLE cells, and was used in the ADAMTS knock-down study in KLE cells. The concentration of siRNAs and the transfection reagent: siRNA concentration ratio was also optimized before these studies (data not shown).  The siRNA oligonucleotide (catolog # SI00093583, Qiagen, US) targeting the human ADAMTS-1 mRNA transcript 5’-CGGCAGTGGTCTAAAGCATTA-3’ were transfected into KLE cells (6 nmol/35mm2 culture dish) using 8 µl of HiPerFect Transfection Reagent (Qiagen, Valencia, CA) according to the manufacturer’s protocol. Cells transfected with a non-silencing,  scrambled  AllStars  Negative  Control  siRNA  (5’-  AATTCTCCGAACGTGTCACGT-3’), (catolog # 1027310, Qiagen, USA) or cultured in the presence of transfection reagent alone, served as negative controls for these studies. Verification of ADAMTS-1 knockdown in KLE cells was determined by analyzing 68  ADAMTS-1 mRNA and protein levels using semi-quantitative RT-PCR and Western blot analysis.  The cells were harvested 24 h after siRNA transfection, and mRNA and protein were extracted using the protocol described in 2.3.1 and 2.3.5. Some cells were trypsinized 24 h after siRNA transfection, and added (2x105 cells/ml, 250µl) into Matrigel precoated invasion chambers for a 24 h Transwell invasion assay (see detail in 2.3.6)  2.3.8  Expression Vector  A mammalian expression vector (pCMV6-Entry) containing full-length human ADAMTS-1 cDNA is transfection-ready DNA was obtained from OriGene (OriGene Technology, USA). pCMV6-Entry expression vector is tagged with C-terminal MYC/DDK tag for easy antibody detection and purification. The fusion protein is under CMV promoter for strong constitutive expression. The empty vector served as a control for these studies.  2.3.9  Transient Transfection of Full-length ADAMTS-1 cDNA  ECC-1 cells were seeded at 0.5 x 105/ml in 35 mm2 plates containing DMEM/F12 supplemented with 10% FBS. The cells were cultured overnight and then transfected with pCMV6-ADAMTS1 or pCMV6-Entry using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s instructions. After 24 h, ECC-1 cells were harvested for mRNA and protein analysis or for use in invasion assays.  69  2.4  Statistical Analysis  The absorbance values obtained from the real-time qPCR products and the autoradiograms generated by Western blotting were subjected to statistical analysis using GraphPad Prism 4 computer software (GraphPad, San Diego, CA). Statistical differences between the absorbance values were assessed by the analysis of variance (ANOVA). Differences were considered significant for p < 0.05. Significant differences between the means were determined using Dunnett’s test (Getsios et al., 1998; Chou et al., 2002). The results are presented as the mean relative absorbance (+ S.E.M.) obtained using cell cultures isolated from tissue samples obtained from at least 3 different patients.  Cellular invasion was analyzed by one-way ANOVA followed by the Tukey multiple comparison test (Xu et al., 2002). Differences were accepted as significant at P<0.05.  70  CHAPTER 3.  REGULATION AND FUNCTION OF  AGGRECANASES IN THE MATURATION OF HUMAN ENDOMETRIUM  Our previous studies have suggested that ADAMTS-1 and ADAMTS-5, two aggrecanases that are members of the ADAMTS subfamily, are expressed in the human endometrium during the menstrual cycle and in pregnancy. I have previously performed a comprehensive study of the regulatory effects of gonadal steroids on ADAMTS-1 expression in endometrial stromal cells (Wen et al., 2006). In this set of experiments, I further characterized the repertoire of aggrecanases present in primary cultures of human endometrial stromal cells, and examined the ability of gonadal steriods to regulate the expression levels of these ADAMTS subtypes, in order to gain a better understanding of the roles that these aggrecanases play in endometrial physiology.  3.1  Results  3.1.1  Expression Levels of Aggrecanases and Versican in Endometrial Stroma and First Trimester Decidual Cells  I first determined the mRNA levels of distinct aggrecanases and their common substrate, versican, in primary cultures of endometrial stromal cells, when compared to primary cultures of first trimester decidual stromal cells. ADAMTS-1, -4, -5, -8, -9 and versican are expressed in both cell types at the mRNA level, but ADAMTS-15 mRNA was not detectable in these 71  cell cultures. In decidual stromal cells, ADAMTS-1 and -8 mRNA levels are approximately 4-fold higher, ADAMTS-5 mRNA level is about 6-fold higher, and ADAMTS-9 mRNA level is about 11-fold higher, than in endometrial stromal cells. In contrast, versican mRNA level is approximately 6-fold lower in decidual cells (Figure 3.1).  3.1.2  Distinct Regulatory Effects of Gonadal Steroids on ADAMTS-4, -5, -8, and -9 mRNA Levels in Human Endometrial Stromal Cells in vitro  Progesterone (P4) significantly (p < 0.05) increased stromal ADAMTS-8 and -9 mRNA levels in these primary cell cultures in a concentration- and time-dependent manner (Figure 3.2). The addition of vehicle (ethanol) alone to the culture medium had no significant effect on aggrecanase mRNA levels at any of the time points examined (data not shown). The gonadal steroid P4 significantly (p < 0.05) increased ADAMTS-8 and -9 mRNA levels after 12 h and 24 h of culture (Figure 3.2A), respectively, and these increases continued until the termination of the experiment at 72 h. In addition, ADAMTS-8 and -9 mRNA levels were significantly increased after treatment with high concentrations (1µM and 5µM) of P4 (Figure 3.2B). In contrast, P4 had no effects on the mRNA levels of ADAMTS-4 and 5. Moreover, 17-ß estradiol (E2) treatment had no effect on ADAMTS-4, -5, -8 and -9 mRNA levels at any of the time points and concentrations examined in these studies (Figure 3.3).  The non-aromatizable androgen, DHT, significantly (p < 0.05) increased ADAMTS-8 mRNA levels in a time- and concentration-dependent manner (Figure 3.4). Increased ADAMTS-8 mRNA levels were detectable starting 12 h after treatment with 100nM DHT, increased to 4-  72  fold at 48 h, and was maintained for at least 72 h of treatment (Figure 3.4A). The DHTinduced increase in ADAMTS-8 mRNA was only observed after 72 h treatment with high concentrations (100nM and 500nM) of DHT but not with concentrations of 10nM or less (Figure 3.4B). DHT decreased ADAMTS-5 mRNA levels by about 40 percent in endometrial stromal cells after 12 h of culture (Figure 3.4A) and this was also observed at 72 h of treatment with high (100nM and 500nM) but not low (< 10 nM) concentrations of DHT (Figure 3.4B). In contrast, ADAMTS-4 and -9 mRNA levels remained relatively constant in all of the endometrial cell cultures after these steroid hormone (P4, E2, and DHT) treatments (Figures 3.2-3.4).  3.1.3  Combinatorial Effects of Gonadal Steroids on Stromal ADAMTS-5, -8, and -9 mRNA Levels  E2 can abolish the P4-mediated increase in stromal ADAMTS-1 mRNA level (Wen et al., 2006), but increasing concentrations of E2 had no influence on the P4-mediated increases of stromal ADAMTS-8 and -9 mRNA levels in the primary cultures of endometrial stromal cells (Figure 3.5).  A combination of P4 plus DHT caused a significant (p < 0.05) increase in ADAMTS-8 and -9 mRNA levels beginning from 48 h, and reaching about 4-fold and 2.5-fold increases, respectively, by 72 h. The increased mRNA levels of ADAMTS-8 and -9 were similar to those observed in endometrial stromal cells cultured in the presence of P4 or DHT alone (Figure 3.6A and B, also compare with Figures 3.2 and 3.4). However, the up-regulation of  73  ADAMTS-8 and -9 mRNAs induced by the combination treatment with P4 and DHT was delayed (to 48 h) compared to that induced by P4 alone (evident at 12 h/24 h) or by DHT alone (evident at 12 h) (Figure 3.6A compare with Figures 3.2 and 3.4). Therefore, this combination seems to suppress the increase in ADAMTS-8 and -9 mRNAs at early times (12 and 24 h) but not at later times (48 and 72 h). The combination treatment caused a significant (p < 0.05) decrease (about 40 percent) in ADAMTS-5 mRNA levels starting from 12 h in a manner similar to that observed in endometrial stromal cells cultured in the presence of DHT alone (Figure 3.6A, compare with Figure 3.4). However, no synergistic or inhibitory effects of this P4 plus DHT combination treatment on ADAMTS-5 mRNA expression were observed (Figure 3.6B).  3.1.4  Regulatory Effects of Anti-steroidal Compounds on Stromal ADAMTS-5, -8, and -9 mRNA Levels  The PR antagonist RU486 had no significant effect on ADAMTS-4, -5, -8, and -9 mRNA levels when present at increasing concentrations for 72 h (Figure 3.7A). RU486 inhibited the P4-mediated increase in stromal ADAMTS-8 and -9 mRNA levels in a concentrationdependent manner (Figure 3.7B). Maximal inhibition was observed at approximately 2.5µM RU486 (Figure 3.7B). In contrast, levels of ADAMTS-8 mRNA remained elevated and ADAMTS-5 mRNA levels remain decreased in stromal cells cultured in the presence of DHT and increasing concentrations of RU486 (Figure 3.8).  74  The mRNA levels of ADAMTS-4, -5, -8 and -9 remained relatively constant in endometrial stromal cells cultured in the presence of increasing concentrations of hydroxyflutamide alone (Figure 3.9A). Hydroxyflutamide inhibited the DHT-mediated increase in stromal ADAMTS8 and decrease in ADAMTS-5 mRNA levels in a concentration-dependent manner. A maximal inhibitory effect was observed at 10nM and higher concentrations of hydroxyflutamide, but not at the lower concentrations of 0.1 and 1nM (Figure 3.9B). However, this anti-androgen compound had no significant effect on the levels of ADAMTS-8 and-9 mRNA in stromal cells cultured in the presence of P4, at least at the concentrations used in these studies (Figure 3.10).  3.1.5  Distinct Regulatory Effects of Gonadal Steroids on ADAMTS-5 and -8 Protein Levels in Human Endometrial Stromal Cells in vitro  Western blot analysis was used to examine the levels of aggrecanases in human endometrial stromal cells. Since the mRNA level of ADAMTS-4 was low and did not change after steroid treatments (Figures 3.1-3.4), and my preliminary data showed that the expression of ADAMTS-4 and -9 protein was very low and barely detectable, I did not conduct further studies on these two aggrecanases.  Therefore, these following experiments focused on  characterizing the protein levels of two ADAMTS subtypes, i.e., ADAMTS-5 and ADAMTS8, in endometrial stromal cells cultured with and without P4 and DHT.  The mRNA level of ADAMTS-8 significantly increased after treating with P4 and DHT, while DHT decreased ADAMTS-5 mRNA levels in endometrial stromal cells. The  75  ADAMTS-8 and ADAMTS-5 zymogens of 110kDa and 120kDa, respectively, were detectable in the cultured endometrial stromal cells. In agreement with the lack of observed effect of vehicle (ethanol) alone on ADAMTS-5 and -8 mRNA levels, the levels of ADAMTS-5 and -8 zymogens remained relatively constant in the endometrial stromal cell cultures treated with vehicle alone (data not shown). However, P4 and DHT significantly (p < 0.05) increased ADAMTS-8 protein level by approximately 3-fold, and this was detectable beginning 12-24 h after treatment and extended to at least 72 h (Figure 3.11A and B). Moreover, in accordance with the ADAMTS-5 mRNA measurements, ADAMTS-5 levels in the endometrial stromal cells decreased significantly in a time-dependent manner upon treatment with DHT (Figure 3.12).  3.1.6  Combinatorial Effects of Gonadal Steroids on Endometrial Stromal ADAMTS-5 and -8 protein Levels  When endometrial stromal cells were co-treated with P4 and E2 for 72 h, the ADAMTS-8 protein levels remained the same as in cells treated with P4 alone (Figure 3.13), corresponding to the lack of effect of E2 on P4-induced ADAMTS-8 mRNA level (Figure 3.5). Moreover, when the cells were treated with P4 plus DHT for 72 h, the ADAMTS-8 levels increased about 3-fold in a manner similar to that observed after P4 treatment alone (Figure 3.14A), whereas ADAMTS-5 protein levels decreased more than 40 percent to a level similar to that observed with DHT treatment alone (Figure 3.14B). Thus, these two hormones do not act synergistically in this regard.  76  3.1.7  Regulatory Effects of Anti-steroidal Compounds on Stromal ADAMTS -5 and -8  The anti-progestin, RU486, had no effect on the endometrial stromal cell ADAMTS-8 protein levels (Figure 3.15, compare lanes 1 and 2). However, RU486 significantly inhibited the P4mediated increase of ADAMTS-8 protein level when present at a concentration of 2.5µM or higher (Figure 3.15, compare lanes 6-8 with 3).  The anti-androgen, hydroxyflutamide, had no significant effect on ADAMTS-8 and ADAMTS-5 protein levels in endometrial stromal cells (Figure 3.16 and 3.17, compare lane 1 and 2). It specifically abolished the DHT-induced increase in ADAMTS-8 protein level (Figure 3.16), and it inhibited the DHT-mediated decrease of ADAMTS-5 protein levels (Figure 3.17). Both these effects of hydroxyflutamide were observed at concentrations of 10nM or higher.  3.2  Discussion  Members of the aggrecanases subfamily of ADAMTS (ADAMTS-1, -4, -5, -8, and -9) have been detected in a wide array of adult human tissues including term placenta and the nonpregnant uterus (Abbaszade et al., 1999; Vazquez et al., 1999; Somerville et al., 2003, 2004). My previous studies demonstrated that the expression of ADAMTS-1 in human endometrial stromal cells is under the control of gonadal steroids (Wen et al., 2006). Gene knockout studies have also indicated that ADAMTS-1 null female mice have reduced pregnancy rates (Shindo et al., 2000; Mittaz et al., 2004), although normal morphological decidualization  77  occurs in some of these animals (Mittaz et al., 2004). The latter observations suggest that ADAMTS-1 is neither necessary nor sufficient to mediate decidualization but may play an important role in the later stages of implantation and placentation, and/or that other ADAMTS subtypes expressed in the endometrium may have overlapping and thus, non-redundant functions in this multi-step reproductive process.  In my current studies, I have determined the regulation of mRNA and protein levels of ADAMTS-4, -5, -8, and -9 in human endometrial stromal cells by gonadal steroids. The results are summarized in Table 3.1. In particular, P4 increased ADAMTS-8 at protein and mRNA levels and P4 increased ADAMTS-9 at least at mRNA levels, while DHT increased ADAMTS-8 but decreased ADAMTS-5 at both mRNA and protein levels. E2 alone had no regulatory effect on either mRNA or protein levels of these ADAMTS subtypes in endometrial stromal cell cultures. Combination treatments with the different gonadal steroids had similar effects to those observed with individual steroids, and did not show any synergistic or antagonistic effects at 72 h. In contrast, the synthetic steroid antagonists RU486 and hydroxyflutamide specifically inhibited the increase in ADAMTS-8 and/or -9 expression levels, and the decrease of ADAMTS-5 levels mediated by P4 and DHT, respectively. These results suggest that the specific ADAMTS subtypes such as ADAMTS-1, -8, and -9 may have overlapping functions on the human endometrium during the menstrual cycle that are independent from those of ADAMTS-4 and -5. Such redundancy in gene families is common (Fata et al., 2000; Curry and Osteen, 2001; Madan et al., 2003). Studies have shown both redundant and non-redundant roles for distinct ADAMTS subtypes in follicular growth,  78  ovulation and in the formation and regression of the corpus luteum in mouse and bovine ovary (Espey et al., 2000; Madan et al., 2003; Russsel et al., 2003; Richards et al., 2005).  Table 3.1. Summary of the effects of 72 hours treatment with gonadal steroids on ADAMTS expression in cultured human endometrial stromal cells.  ADAMTS  ADAMTS  Treatment  4 mRNA  5 protein  mRNA  8 protein  mRNA  9 protein  mRNA  protein  P4  N.D.  N.D.  E2  N.D.  N.D.  DHT  N.D.  N.D.  P4+E2  N.D.  N.D.  P4+DHT  N.D.  N.D.  , no change at mRNA or protein levels. , increased levels of less than 3fold. , increased levels of > 3-fold. N.D., not detected  79  Of the gonadal steroids examined in this study, progesterone was the most potent regulator of ADAMTS genes expression. In addition to ADAMTS-1, progesterone also regulated ADAMTS-8 and -9 expression in human endometrial stromal cells. Progesterone exerts physiological effect primarily through activating progesterone receptor (PR) (Graham and Clarke, 1997). The progesterone-PR complex then binds to a specific DNA sequence, the progesterone response element, in the promoter region of a target gene to initiate gene transcription (Giangrande and McDonnell, 1999; Tsai and O'Malley, 1994). The consensus response element identified for PR is a 15 bp sequence of 5’-GG/TTACAnnnTGTTCT-3’. This response element is also recognized by the androgen receptor (AR), glucocorticoid receptor (GR) and mineralocorticoid receptor (MR), hence it is also called the steroid response element (SRE) (Cato et al., 1987; Roche et al., 1992). The 5’-TGTTCT/N-3’ has been recognized as a fixed half core sequence. Mutations at certain positions of the 15 bp sequence, including the fixed half site, will alter the steroid receptor binding affinity, and are important for differential control of gene transcription (Lindzey et al., 1994; Yie et al., 2006). Mutations are common and most of those mutations do not affect the transcriptional response (Lieberman et al., 1993). Although AR and PR bind to the same response element, they have different preferences for binding to the different variations of the DNA sequence (Colleen et al., 1999).  In my study, progesterone and DHT-mediated regulated effects on ADAMTS-5, -8 and -9 expression were abolished by RU486 or hydroxyflutamide, suggesting that progesterone and DHT regulate ADAMTS gene expression via their intracellular receptors. However, a computer-based search of the ADAMTS-5, -8 and-9 gene promoter regions (2000 bp) failed  80  to identify the classical 15 bp PRE sequence, and only one or several half-sites of the sequence were identified (Figure 3.18). Although there is no direct evidence that these sequences can be utilized as functional response elements by progesterone or androgen in regulating ADAMTS gene transcription, there is indeed evidence indicating that the response element sequence requirements for steroid hormones to induce transcription of steroidresponsive genes are less stringent. Variations within the defined consensus sequences (60% homology) still allowed positive regulation of transcription (Yie et al., 2006). Furthermore, research showed that two fragments of the SRE, located distal to each other and containing sequences with limited homologies with each half-motif of the defined consensus SRE, could bind the steroid receptor in vitro and mediate the steroid-dependent induction of transcriptional activity (Kato et al., 1992; Lamian et al., 1993). If this is also applicable to the P4 or DHT-mediated regulation of ADAMTS genes, then the DNA sequences located at 1602 bp (5’-GTTACA-3’) and -1444 bp (5’-TGTCCT-3’) within the ADAMTS-8 promoter (Figure 3.18) could form an entire steroid response element. These sequences are likely to have a preference for binding to the PR because the half sequence at -1602bp has GTTACA instead of GGTACA, as reported in another study (Colleen et al., 1999). It is possible that the half-site sequence in the ADAMTS promoter region could be the true steroid response element and this requires further investigation. We can assume that after binding of progesterone and androgen to their receptors, these complexes will bind to the same response element, and regulate ADAMTS expression through the same downstream signaling pathway, this would explain why no synergistic effect on ADAMTS-8 expression was observed upon co-treatment with P4 and DHT for 48 h or 72 h. However, the combination treatment showed some suppressive effects at earlier time points (12 and 24h) when compared to P4 or DHT  81  treated alone, suggesting that negative SRE-mediated repression also exists (Geserick et al., 2005; Dostert and Heinzel, 2004). Such negative SRE usually only possess one consensus half-site (Geserick et al., 2005). Multiple half-site SRE sequences were found in the ADAMTS-8 promoter region (Figure 3.18). It is possible that when two hormones, like P4 and DHT, present at the same time, they will compete for binding to the same response element which has high binding affinity. In the meantime, a negative SRE which has lower binding affinity will be activated as well and exert a repressive effect to neutralize the positive regulatory effect. However, the respective roles of these SREs, and their cooperation and interaction with cofactors, need further investigation.  ADAMTS-5, also known as aggrecanase-2 (Abbaszade et al., 1999; Hurskainen et al., 1999), is expressed primarily in the murine placenta and the corresponding maternal decidua during the peri-implantation period, and this is the basis of its trivial name ‘implantin’ (Abbaszade et al., 1999). It may represent a potential candidate for the partial rescue of the reproductive capacity of ADAMTS-1 gene knockout mice. Thus using mice double knockout for ADAMTS-1 and -5 genes to detect the effect on decidualization and implantation would shed light on the potential compensatory roles that these ADAMTS genes play in the human endometrium.  The factors capable of regulating ADAMTS-5 expression remain poorly characterized. Studies from our laboratory have determined that ADAMTS-1 and -5 are expressed in human decidual stromal cells in vivo and in vitro. IL-1β and TGF-β1, two key regulators of the proteolytic mechanisms operative at the maternal–fetal interface, were also found to be  82  capable of regulating ADAMTS-1 and -5 mRNA and protein levels in these cells in vitro (Zhu et al., 2007; Ng et al., 2006). In particular, IL-1ß increases, whereas TGF-ß1 decreases, ADAMTS-5 expression in decidual stromal cells. In my study, ADAMTS-5 has a 5-fold higher mRNA level in decidual stromal cells compared to endometrial stromal cells, making it likely to be a progesterone-responsive gene. However, estradiol and progesterone have not shown significant influences on ADAMTS-5 expression in primary cultures of endometrial stromal cells, suggesting that ADAMTS-5 expression is independent of direct regulation by progesterone. Although no ADAMTS-5 gene knockout studies have focused on uterine physiology, ADAMTS-5 null mutant mice are viable and fertile (Stanton et al., 2005), indicating that ADAMTS-5 may only play a supporting role in the preparation of the endometrium for the implanting embryo. DHT significantly down-regulated ADAMTS-5 expression in the human endometrial stromal cell cultures, raising the possibility that ADAMTS-5 may be responsible for some infertility conditions associated with high androgen levels, such as PCOS.  Studies of ADAMTS-8 are quite limited. Like ADAMTS-1, ADAMTS-8 has been proven an anti-angiogenic factor. These ADAMTSs were first named METH-1 and METH-2, respectively, because they both contain metalloprotease and thrombospondin domains. The overall amino acid sequence identity between METH-1 and METH-2 is 52% (Vázquez et al., 1999). Their anti-angiogenic properties are mediated either by the TSP motif or through direct VEGF binding (Lawler, 2000; Lawler and Detmar, 2004). Both angiogenesis and ECM degradation are important in reproduction and cancer development (Carmeliet and Jain, 2000). Down-regulation of ADAMTS-8 has been found in brain tumors and lung cancer (Dunn et al.,  83  2004, 2006), but high expression of ADAMTS-8 in patients with breast cancer is associated with poor prognosis (Porter et al., 2006), suggesting a role for ADAMTS-8 in tumorigenesis. However, the expression and regulation of ADAMTS-8 in reproductive tissues has never been reported before. I have found that ADAMTS-8 is expressed in human endometrial stromal cells and in first trimester decidua calls in vitro. Furthermore, P4 and DHT but not E2 significantly increase ADAMTS-8 levels in endometrial stromal cells. The regulation of ADAMTS-8 and ADAMTS-1 by gonadal steroids is similar, indicating the possibility of an overlapping function in the human endometrium. Thus, ADAMTS-8 has the potential to contribute to the development of a uterine environment that is capable of supporting a pregnancy via the regulated degradation of the endometrial ECM and/or the extensive vascular changes that occur during the menstrual cycle.  ADAMTS-9 also belongs to the aggrecanases subfamily of ADAMTS. However, as an ADAMTS subtype with a gon-1 domain, which was first identified in C. elegans and has an essential role in reproduction, it has been a focus of attention for developmental biologists. Previous studies have shown widespread expression of Adamts9 during mouse embryo development, and it continues to be expressed in a variety of adult tissues (Clark et al., 2000; Somerville et al., 2003; Jungers et al., 2005). As an aggrecanase, ADAMTS-9 has also been investigated in cancers and appears to function as a cancer suppressor gene (Lung et al., 2008), and hypermethylation of the ADAMTS-9 gene is associated with carcinogenesis in humans (Zhang et al., 2010). In this study, I found that ADAMTS-9 is expressed in human endometrial stromal cells and in first trimester decidual tissue. Progesterone significantly increases the ADAMTS-9 expression at least at the mRNA level. Thus, ADAMTS-9 may also  84  be involved in ECM remodeling events involved in preparing the endometrium for the implanting embryo.  Gonadal steroids govern the developmental fate of the human endometrium across the reproductive lifespan and into the menopause. Throughout the childbearing years, the endometrium undergoes cycles of growth, differentiation and shedding. This series of progressive cellular events which occur in the endometrium in preparation for pregnancy are orchestrated primarily by corresponding fluctuations in the physiological levels of estrogens (estradiol; E2), progestagens (progesterone; P4), and to a lesser extent by androgens (dihydrotestosterone; DHT). Estradiol begins to increase starting from the early follicular phase, ends at its preovulatory peak, and maintains a high level to the mid-luteal phase. Progesterone levels starts to increase after ovulation, reaches a plateau at the end of the early luteal phase, and maintain the plateau levels during the mid-luteal phase, which is also characterized as the “implantation window”. Androgens are sex hormones that are produced by both the ovaries and adrenal glands. Testosterone levels vary during the menstrual cycle just like other sex hormones, with testosterone peaking during the middle phase of the menstrual cycle around the time of ovulation (Judd and Yen, 1973). Considering the regulatory effect of steroids upon ADAMTS expression, we predict that along with the fluctuation of gonadal steroids during the menstrual cycle, some ADAMTS subtypes such as ADAMTS-1, -8, and -9 will increase after ovulation according the increased circulation level of progesterone and reach a peak level at the mid-secretory phase when decidualization occurs.  85  In summary, my studies have shown that ADAMTS-4, -5, -8 and -9 are expressed in human endometrial stromal cells at the mRNA and protein levels. In addition to ADAMTS-1, I have demonstrated that the regulation of ADAMTS-5, -8 and -9 in human endometrial stromal cells in vitro involves at least progestins and androgens. These observations suggest that these aggecanases play key roles in steroid-mediated ECM remodeling events that occur in the human endometrium in preparation for pregnancy.  86  8 7  Relative mRNA levels  6  Endometrial  5 4  Decidual 3 2 1 0  1  4  5  8  9  15  versican  ADAMTS  Figure 3.1. Comparison of aggrecanases and versican mRNA levels in primary culture of human endometrial stromal cells and first trimester decidual stromal cells. Real-time qPCR analysis of ADAMTS-1, -4, -5, -8, -9, -15, and their common substrate versican mRNA levels in primary cultures of human endometrial stromal cells compared with first trimester endometrial decidual cells. Values for ADAMTS mRNA levels present in each sample were normalized to the corresponding GAPDH mRNA levels. The results were derived from at least four sets of samples and were represented (mean+S.E.M.; n > 4) in the bar graphs.  87  A 5  *  4.5  ADAMTS / GAPDH Relative mRNA level  4  *  *  *  3.5  ADAMTS-4  3 2.5  *  2  *  *  ADAMTS-5 ADAMTS-8  1.5  ADAMTS-9  1 0.5 0  0  6  12  24  48  72  Time (h)  B  4  *  ADAMTS / GAPDH Relative mRNA level  3.5  *  3  ADAMTS-4  *  2.5  *  2 1.5  ADAMTS-5 ADAMTS-8 ADAMTS-9  1 0.5 0  0  0.01  0.1  1  5  P4 (µM)  Figure 3.2. Regulatory effects of P4 on aggrecanase mRNA levels in human endometrial stromal cells. A. Time-dependent effects of 1µM P4 on ADAMTS-4, -5, -8, and-9 mRNA levels in human endometrial stromal cells. B. Concentration-dependent effects of P4 on ADAMTSs mRNA levels in cells cultured for 72 h. Values for ADAMTS mRNA levels present in each sample were normalized to the corresponding GAPDH mRNA levels. The results were derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs (*, P<0.05 vs. untreated control).  88  A  3  ADAMTS / GAPDH Relative mRNA level  2.5  ADAMTS-4  2  ADAMTS-5  1.5  ADAMTS-8 1  ADAMTS-9  0.5 0  0  6  12  24  48  72  Time (h)  B  3  ADAMTS / GAPDH Relative mRNA level  2.5  ADAMTS-4  2  ADAMTS-5  1.5  ADAMTS-8  1  ADAMTS-9 0.5 0  0  1  10  30  100  E2 (nM)  Figure 3.3. Regulatory effects of E2 on aggrecanase mRNA levels in human endometrial stromal cells. A. Time-dependent effects of E2 (30nM) on ADAMTS-4, -5, -8, and-9 mRNA levels in human endometrial stromal cells. B. Concentration-dependent effects of E2 on ADAMTSs mRNA levels in cells cultured for 72 h. Values for ADAMTS mRNA levels present in each sample were normalized to the corresponding GAPDH mRNA levels. The results were derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs. No significant changes in ADAMTS subtype expression were found.  89  A  6  *  ADAMTS / GAPDH Relative mRNA level  5 4  * ADAMTS-4  *  *  ADAMTS-5  3  ADAMTS-8 2  *  1  ADAMTS-9  *  *  *  24  48  72  0  0  6  12  Time (h)  B  4.5  *  ADAMTS / GAPDH Relative mRNA level  4 3.5  *  3  ADAMTS-4 ADAMTS-5  2.5 2  ADAMTS-8  1.5  ADAMTS-9  1  *  *  100  500  0.5 0  0  0.1  1  10  DHT (nM)  Figure 3.4. Regulatory effects of DHT on aggrecanase mRNA levels in human endometrial stromal cells. A. Time-dependent effects of DHT (100nM) on ADAMTS-4, -5, -8, and -9 mRNA levels in human endometrial stromal cells. B. Concentration-dependent effects of DHT on ADAMTS mRNA levels after 72 h treatment. Values for ADAMTS mRNA levels present in each sample were normalized to the corresponding GAPDH mRNA levels. The results were derived from at least four sets of independent samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs (*, P<0.05 vs. untreated control).  90  A 5  *  4.5  ADAMTS / GAPDH Relative mRNA level  4  *  3.5  ADAMTS-4  3  *  *  2.5  *  *  2  *  1.5  ADAMTS-5 ADAMTS-8 ADAMTS-9  1 0.5 0  0  6  12  24  48  72  Time (h)  N.S.  B 5  ADAMTS / GAPDH Relative mRNA level  4.5  *  4 3.5 3  ADAMTS-8  *  2.5 2  ADAMTS-9  1.5 1 0.5 0  P4 (µM) E2 (nM)  0 0  1 0  1 0.1  1 1  1 10  1 30  1 100  Figure 3.5. Combinatory effects of P4 plus E2 in stromal ADAMTS-4, -5, -8, and -9 mRNA levels. A. Endometrial stromal cells were treated with fixed concentrations of P4(1µM) plus E2 (30nM) for up to 72 h. B. ADAMTS-8, and-9 mRNA levels in endometrial stromal cells cultured in the absence or presence of P4 (1µM) alone or in combination with increasing concentrations of E2 for 72 h. Values for ADAMTS mRNA levels present in each sample were normalized to the corresponding GAPDH mRNA levels. The results were derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs. While all treated samples showed significant increases (*, P<0.05) in ADAMTS-8 and -9 mRNA compared to untreated samples, no significant differences (N.S.) were found when E2 was present with P4 compared to P4 alone.  91  A 6  *  ADAMTS / GAPDH Relative mRNA level  5  ADAMTS-4  4  *  *  3  *  2  ADAMTS-5 ADANTS-8 ADAMTS-9  *  1  *  *  *  0  0  6  12  24  48  72  Time (h)  B  N.S.  6  ADAMTS / GAPDH Relative mRNA level  5  *  *  N.S.  *  4  *  3 2  N.S.  1  * *  ctrl  *  P4 DHT P4+DHT  0  ADAMTS-5  ADAMTS-8  ADAMTS-9  Figure 3.6. Combinatory effects of DHT plus P4 in stromal ADAMTS-4, -5, -8, and -9 mRNA levels. A. Endometrial stromal cells were treated with fixed concentrations of P4 (1µM) plus DHT (100nM) for up to 72 h. B. ADAMTS-5, -8, and-9 mRNA levels in endometrial stromal cells cultured in the presence of P4 (1µM) or DHT (100nM) alone or in combination for 72 h. Values for ADAMTS mRNA levels present in each sample were normalized to the corresponding GAPDH mRNA levels. The results were derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs (*, P<0.05 vs. untreated control). No significant differences (N.S.) were found upon co-treatment with P4 and DHT compared to P4 or DHT alone .  92  A  3  ADAMTS / GAPDH Relative mRNA level  2.5 2  ADAMTS-4  1.5  ADAMTS-5 ADAMTS-8  1  ADAMTS-9 0.5 0  0  0.025  0.25  2.5  5  10  RU486 (µM)  B  5  *  4.5  ADAMTS / GAPDH Relative mRNA level  4 3.5 3  ** **  *  2.5  ADAMTS-8 ADAMTS-9  2 1.5 1 0.5 0  P4 (µM) RU486 (µM)  0 0  1 0  1 0.025  1 0.25  1 2.5  1 5  1 10  Figure 3.7. Inhibitory effects of RU486 on P4-mediated regulatory effects of ADAMTS8 and -9 mRNA levels in endometrial stromal cells. A. mRNA expressions of ADAMTS4, -5, -8, and -9 in endometrial stroma cells cultured with increasing concentration of RU486 for 72 h. B. ADAMTS-8, and -9 mRNA levels in endometrial stromal cells cultured in the presence of P4 (1 µM) alone or in combination with increasing concentrations of RU486 for 72 h. The results were derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs (*, P<0.05 vs. untreated control; **, P<0.05 vs. P4 treated alone).  93  N.S. 5 4.5  *  ADAMTS / GAPDH Relative mRNA level  4 3.5 3  ADAMTS-5  2.5  ADAMTS-8  2 1.5  *  1 0.5 0  DHT (nM) RU486 (µM)  0 0  100 0  100 0.025  100 0.25  100 2.5  100 10  Figure 3.8. Inhibitory effects of RU486 on DHT-mediated regulatory effects of ADAMTS-5 and -8 mRNA levels in endometrial stromal cells. ADAMTS-5, and -8 mRNA levels in endometrial stromal cells cultured in the presence of DHT (100nM) alone or in combination with increasing concentrations of RU486 for 72 h. The results are derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs. While all treated samples showed significant increases (*, P<0.05 vs. untreated control) in ADAMTS-8 and decreases in ADAMTS-5 mRNA compared to untreated samples, no significant differences (N.S.) were found when RU486 was present with DHT compared to DHT alone.  94  A  3  ADAMTS / GAPDH Relative mRNA level  2.5  ADAMTS-4  2  ADAMTS-5 1.5  ADAMTS-8  1  ADAMTS-9  0.5 0  0  0.1  1  10  100  1000  Flutamide (nM)  B  4  *  ADAMTSs / GAPDH Relative mRNA levels  3.5 3  ADAMTS-5  ** **  2.5 2 1.5 1  ADAMTS-8  *  0.5 0  DHT (nM) 0 Flutamide (nM) 0  100 0  100 0.1  100 1  100 10  100 100  100 1000  Figure 3.9. Inhibitory effects of hydroxyflutamide on the DHT-mediated regulatory effects of ADAMTS -5 and -8 mRNA levels in endometrial stromal cells. A. mRNA expressions of ADAMTS-4, -5, -8, and -9 in endometrial stroma cells cultured with increasing concentration of hydroxyflutamide for 72 h. B. ADAMTS-5 and -8 mRNA levels in endometrial stromal cells cultured in the presence of DHT (100n M) alone or in combination with increasing concentrations of flutamide for 72 h. The results were derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs (*, P<0.05 vs. untreated control; **, P<0.05 vs. DHT treated alone).  95  N.S. 4  ADAMTS / GAPDH Relative mRNA level  3.5  *  3  *  2.5  ADAMTS-8  2  ADAMTS-9  1.5 1 0.5 0  P4 (µM) 0 Flutamide (nM) 0  1 0  0 100  1 0.1  1 1  1 10  1 100  1 1000  Figure 3.10. Inhibitory effects of hydroxyflutamide on the P4-mediated regulatory effects of ADAMTS-8 and -9 mRNA levels in endometrial stromal cells. ADAMTS-8 and -9 mRNA levels in endometrial stromal cells cultured in the presence of P4 (1µM) alone or in combination with increasing concentrations of hydroxyflutamide for 72 h. The results are derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs. While all P4 treated samples showed significant increases (*, P<0.05 vs. untreated control) in ADAMTS-8 and -9 mRNA compared to untreated samples, no significant differences (N.S.) were found when hydroxyflutamide was present with P4 compared to P4 alone. .  96  Time (h)  A  0  6  12  24  48  72  ADAMTS-8  110kD  β-actin  42kD  4  ADAMTS-8 / ß-actin Relative protein level  *  *  3.5  *  3  *  2.5 2 1.5 1 0.5 0  0  6  12  24  48  72  Time (h) B  Time (h)  0  6  12  24  48  72  ADAMTS-8  110kD  β-actin  42kD  ADAMTS-8 / ß-actin Relative protein level  3  *  2.5  *  *  2 1.5 1 0.5 0  0  6  12  24  48  72  Time (h) Figure 3.11. Western blot analyses of ADAMTS-8 under the regulation of P4 and DHT. Cell lysates were analyzed by SDS-PAGE and immunoblotting, with the top half of membrane probed for ADAMTS-8 and the bottom half probed for ß-actin. ADAMTS-8 levels in the presence of A. P4 (1µM), B. DHT (100nM) for up to 72 h. Values of ADAMTS-8 present in protein extraction (30µg) of endometrial stromal cell cultures were normalized to the corresponding β-actin levels. The results were derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs (*, P<0.05 vs. untreated control).  97  Time (h)  0  6  12  24  48  72  ADAMTS-5  120kD  β-actin  42kD  1.2  ADAMTS-5 / ß-actin Relative protein level  1  *  *  0.8  *  0.6  *  0.4 0.2 0  0  6  12  24  48  72  Time (h)  Figure 3.12. Western blot analyses of ADAMTS-5 under the regulation of DHT. Cell lysates were analyzed by SDS-PAGE and immunoblotting, with the top half of membrane probed for ADAMTS-5, and the bottom half probed for ß-actin. ADAMTS-5 levels in the presence of DHT (100nM) for 0-72 h. Values of ADAMTS-5 present in protein extraction (30µg) of endometrial stromal cell cultures were normalized to the corresponding β-actin levels. The results were derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs (*, P<0.05 vs. untreated control).  98  1  2  3  4  5  6  7  ADAMTS-8  110kD  β-actin  42kD  N.S 4  *  ADAMTS-8 / ß-actin Relative protein level  3.5 3 2.5 2 1.5 1 0.5 0  P4 (µM) E2 (nM)  0 0  1 0  0 30  1 1  1 10  1 30  1 100  Figure 3.13. Western blot analysis of ADAMTS-8 under the combinatory regulation of P4 and E2. Cell lysates were analyzed by SDS-PAGE and immunoblotting, with the top half of membrane probed for ADAMTS-8, and the bottom half probed for ß-actin. ADAMTS-8 protein level in the presence of P4, E2 or P4 plus increased concentration of E2 for 72 h. While P4 treated samples showed significant increases in ADAMTS-8 protein level compared to untreated samples (lanes 1 and 2), no significant differences were found when E2 was present with P4 compared to P4 alone (lanes 4-7 compare to lane 2). Values of ADAMTS-8 present in protein extracts (30µg) of endometrial stromal cell cultures were normalized to the corresponding β-actin levels. The results were derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs (*, P<0.05 vs. untreated control, N.S., no significant difference).  99  A  ctrl  P4  DHT  P4+DHT  ADAMTS-8  110kD  β-actin  42kD  5  ADAMTS-8 / ß-actin Relative protein level  4.5  *  *  4 3.5  *  3 2.5 2 1.5 1 0.5 0  P4 (µM) DHT (nM)  0 0  ctrl Ctrl  B  1 0  P4 P4  0 100  DHT DHT  1 100  P4+DHT P4+DHT  ADAMTS-5  120kD  β-actin  42kD  1.4  ADAMTS-5 / ß-actin Relative protein level  1.2 1 0.8  *  0.6  *  0.4 0.2 0  P4 (µM) DHT (nM)  0 0  1 0  0 100  1 100  Figure 3.14. Western blot analysis of ADAMTS-8 and ADAMTS-5 under the combinatory regulation of P4 and DHT. Cell lysates were analyzed by SDS-PAGE and immunoblotting, with the top half of membrane probed for ADAMTS-8 or -5, and the bottom half probed for ß-actin. Protein level of A. ADAMTS-8, B. ADAMTS-5, in the presence of P4, DHT or P4 plus DHT for 72 h. Values of each of ADAMTS present in protein extracts (30µg) of endometrial stromal cell cultures were normalized to the corresponding β-actin levels. The results were derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs (*, P<0.05 vs. untreated control). 100  1  2  3  4  5  6  7  8  ADAMTS-8  110kD  β-actin  42kD  *  4 3.5  ADAMTS-8 / ß-actin Relative protein level  3  **  2.5 2 1.5 1 0.5 0  P4 (µM) RU486 (µM)  0 0  0 2.5  1 0  1 0.025  1 0.25  1 2.5  1 5  1 10  Figure 3.15. Western blot analysis of the effect of RU486 on P4-mediated ADAMTS-8 expression. Cell lysates were analyzed by SDS-PAGE and immunoblotting, with the top half of membrane probed for ADAMTS-8, and the bottom half probed for ß-actin. ADAMTS-8 expression in protein extracts (30µg) prepared from endometrial stromal cells cultured in the presence of P4 (1µM), RU486 (2.5µM) or P4 plus increasing concentrations of RU486. Values of ADAMTS-8 were normalized to the corresponding β-actin levels. The results were derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs (*, P<0.05 vs. untreated control; **, P<0.05 vs. P4 treated alone).  101  1  2  3  4  5  6  7  ADAMTS-8  110kD  β-actin  42kD  3.5  *  ADAMTS-8 / ß-actin Relative protein level  3 2.5  **  2 1.5 1 0.5 0  DHT (nM) Flutamide (nM)  0 0  0 100  100 0  100 1  100 10  100 100  100 1000  Figure 3.16. Western blot analysis of the effect of hydroxyflutamide on DHT-mediated ADAMTS-8 expression. Cell lysates were analyzed by SDS-PAGE and immunoblotting, with the top half of membrane probed for ADAMTS-8, and the bottom half probed for ß-actin. ADAMTS-8 expression in protein extracts (30µg) prepared from endometrial stromal cells cultured in the presence of DHT, hydroxyflutamide or DHT plus increasing concentrations of hydroxyflutamide. Values of ADAMTS-8 were normalized to the corresponding β-actin levels. The results were derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs (*, P<0.05 vs. untreated control; **, P<0.05 vs. DHT treated alone).  102  1  2  3  4  5  6  7 120kD  ADAMTS-5 β-actin  42kD  2 1.8  ADAMTS-5 / ß-actin Relative protein level  1.6  **  1.4 1.2 1 0.8  *  0.6 0.4 0.2 0  DHT (nM) 0 Flutamide (nM) 0  0 100  100 0  100 1  100 10  100 100  100 1000  Figure 3.17. Western blot analysis of the effect of hydroxyflutamide on DHT-mediated ADAMTS-5 expression. Cell lysates were analyzed by SDS-PAGE and immunoblotting, with the top half of membrane probed for ADAMTS-5, and the bottom half probed for ß-actin. ADAMTS-5 expression in protein extracts (30µg) prepared from endometrial stromal cells cultured in the presence of DHT, hydroxyflutamide or DHT plus increasing concentrations of hydroxyflutamide. Values of ADAMTS-5 were normalized to the corresponding β-actin levels. The results were derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs (*, P<0.05 vs. untreated control; **, P<0.05 vs. DHT treated alone).  103  -1000  -2000  -697  -358 ADAMTS-5  GGTAC  -2000  -1602  -1444  -1100 -1000  -2000  -810 ADAMTS-8  TGTTC  TGTCCT GTTACA  TGTTC  GGTAC  -1194  -1000  ADAMTS-9  TGTTCT Consensus SRE  5’-GG/TTACAnnnTGTTCT-3’  Figure 3.18. Schematic diagram of 2000 bp region in the ADAMTS gene promoter region containing the potential steroid response element (SRE) sequences. The positions of the putative SRE sequences that match half-site of the consensus SRE are shown relative to the transcription initiation sites of the ADAMTS genes. The consensus SRE is recognized by progesterone receptor (PR), androgen receptor (AR), glucocorticoid receptor (GR) and mineralocoticoid receptor (MR).  104  CHAPTER 4.  ADAMTS-1 PROMOTES AN INVASIVE PHENOTYPE  IN HUMAN ENDOMETRIAL CANCER CELLS IN VITRO  Type I endometrial cancer is the most common histological type of uterine cancer, accounting for 57-80% of cases (Hoffman et al., 1995; Longacre et al., 1995). Most Type I endometrial cancers are well-to-intermediately differentiated, estrogen-dependent tumors with strong expression of estrogen and progestin receptors (Bockman 1983; Deligdisch and Cohen, 1985; Deligdisch and Holinka, 1986; Sherman, 2000). However, the underlying mechanisms by which estrogen promotes endometrial cancer differentiation and invasion are not well understood. Most Type II endometrial cancers are poorly differentiated and are not associated with hyper-estrogenic states. They rarely express functional estrogen and/or progesterone receptors, and, clinically, present with aggressive myometrial invasion and early lymph node metastases (Hamilton et al., 2006; Burton and Well, 1998). Cases with distant metastases have a much poorer prognosis and account for the majority of deaths from this disease (Ueda et al., 2008; Hamilton et al., 2006). The molecular and cellular mechanisms behind this aggressive behavior remain under investigation.  ADAMTS-1 is the first and the best characterized ADAMTS subtype. It was initially identified in a colon cancer metastasis (Kuno et al., 1997), and later in many different types of cancers (Rocks et al., 2006; Masui et al., 2001; Liu et al., 2006). Recently, the exogenous expression of the mature form of ADAMTS-1 has been shown to have pro-metastatic effects on cancer cells in vivo (Liu et al., 2006). However, to my knowledge, there is no study of the regulation and function of ADAMTS-1 gene in endometrial cancer yet. In this study, I 105  examined the effect of estrogen on the expression of ADAMTS-1 in the well-differentiated ECC-1 human endometrial carcinoma cell line, and investigated the function of ADAMTS-1 in promoting endometrial cancer cell invasion.  4.1  Estrogen–induced Cancer Cell Invasion Involves Regulated ADAMTS-1  Expression in Human Endometrial Carcinoma Cells in vitro  4.1.1  Estrogen Promotes Invasion of Well-differentiated Endometrial Cancer Cells  ECC-1 cells are a well-differentiated endometrial adenocarcinoma cell line, which I confirmed, express estrogen receptor alpha (ERα), progesterone and androgen receptors (Figure 4.1), but not ERß mRNA. This is in agreement with other studies (Greenberger et al., 2001; Dardes et al., 2002). Estradiol significantly (p < 0.05) increased the invasive capacity of ECC-1 cells in vitro by about 70%. Although progesterone alone had no effect on cell invasive capacity, it specifically inhibited the E2-induced increase in invasion (Figure 4.2). The anti-estrogenic compound ICI 182 780 also abolished the E2-mediated increase in the invasive potential of ECC-1 cells in vitro (Figure 4.2).  4.1.2  Estrogen Up-regulates ADAMTS-1 in Well-differentiated Endometrial Cancer Cells  In preliminary studies, ADAMTS-1 transcripts were detected in the ECC-1 cells, and the addition of vehicle (ethanol) to the culture medium had no significant effects on ADAMTS-1 mRNA and protein levels in these cell cultures (data not shown).  106  A significant (p < 0.05) increase (about 2.5-fold) in ADAMTS-1 mRNA level was detected in ECC-1 cells cultured for 24 h in the presence of E2 (30nM), and this increase continued until the termination of these experiments at 72 h (Figure 4.3A). In contrast, P4 or DHT alone had no significant effect on ADAMTS-1 mRNA levels, at any of the time points examined in these studies (Figure 4.3A). Furthermore, ADAMTS-1 mRNA levels increased significantly (p < 0.05) in a concentration-dependent manner after treatment with increasing concentrations of E2 but not with P4 or DHT. In this experiment, ADAMTS-1 mRNA levels increased after treatment with 10nM or higher concentrations of E2 (Figure 4.3B).  Treatment of ECC-1 cells with gonadal steroids had similar time-dependent effects on ADAMTS-1 protein levels to those observed on ADAMTS-1 mRNA levels (Figure 4.4). Western blot analysis revealed the presence of an ADAMTS-1 protein species of 110kD in all the ECC-1 cell cultures, corresponding to the ADAMTS-1 zymogen. E2 significantly (p < 0.05) increased ADAMTS-1 protein by approximately 4-fold at 24 h treatment, and this increase continued up to 72 h in these studies (Figure 4.4A). ADAMTS-1 levels were increased (3-fold) by treatment with 10nM E2 and reached about a 4-fold increase with 30nM and 100nM E2 (Figure 4.4B). P4 or DHT had no effect on ADAMTS-1 protein level, at least at the time points examined in this study (Figure 4.5A and B).  4.1.3  Progesterone Inhibits the E2-mediated Increase of ADAMTS-1 in ECC-1 Cells  Although progesterone alone had no effect on ADAMTS-1 expression in ECC-1 cells, it can abolish the E2-induced increase in ADAMTS-1 expression at both the mRNA and protein  107  levels. When ECC-1 cells were co-treated with a fixed concentration of E2 (30nM) plus increasing concentrations of P4 (0.1-5µM) for 72 h, the ADAMTS-1 mRNA level significantly decreased compare to the cells treated with E2 alone. The highest inhibitory effects presented at P4 concentrations of 1µM and 5µM, and there was no significant difference when compared the result of combinatory treatment to P4 treatment alone or to the untreated control cells (Figure 4.6A). However, in cells co-treated with the same concentration of E2 together with increasing concentrations of DHT, the ADAMTS-1 mRNA levels showed no significant changes when compared to cells treated with E2 alone (Figure 4.6 B).  Western blot analysis showed that ADAMTS-1 levels tend to return to the untreated control level after treating with E2 together with high concentrations of P4 (1µM and 5µM) (Figure 4.7). The levels of protein significantly decreased when cells were treated with E2 plus P4 (Figure 4.7, compare lanes 6 and 7 with 2) compared to E2 treatment alone, and showed no significant difference with the control level or P4 treatment alone (Figure 4.7, compare lanes 6 and 7 with 3). The regulation of ADAMTS-1 protein expression is consistent with that observed with ADAMTS-1 mRNA, indicating that P4 can fully inhibit the E2-induced increase of ADAMTS-1 at both the mRNA and protein levels. In addition, co-treatment with DHT had no inhibitory effect on the E2-mediated increase of ADAMTS-1 levels at any of the concentrations tested (Figure 4.8).  108  4.1.4  Anti-estrogen Inhibits E2-induced Increases of ADAMTS-1 Expression in ECC-1 cells  ICI 182 780 is a pure anti-estrogen (Wakeling, 1991; Wakeling et al., 1991; Dukes et al., 1992). When ECC-1 cells were treated with ICI 182 780 alone, ADAMTS-1 mRNA expression levels did not change in a time- or concentration-dependent manner (Figure 4.9). However, ICI 182 780, at a concentration of 100nM, was sufficient to fully inhibit the E2mediated increase of ADAMTS-1 expression at both the mRNA (Figure 4.10A) and protein levels (Figure 4.10B). The mRNA and protein levels showed significant decreases when treated with E2 plus ICI 182 780 at 100-1000nM (Figure 4.10B, compare lanes 7 and 8 with lanes 3, 4, or 5) and had no differences with the untreated control and ICI 182 780 treatment alone (Figure 4.10B, compare lanes 7 and 8 with lanes 1 or 6).  4.2  Function of ADAMTS-1 in Endometrial Cancer Invasion  4.2.1  Expression of Aggrecanases and Versican in Human Endometrial Cancer Cells in vitro  The mRNAs of ADAMTS-1, -5, -8, -9 -15 and their common substrate, versican, were detected in well-differentiated ECC-1 cells and poorly differentiated KLE cells (Figure 4.11A). Although ADAMTS-4 mRNA could be detected using real-time qPCR, the levels were extremely low in both cell lines (Figure 4.10A). In addition, there was no significant difference between the mRNA levels of ADAMTS-8 and ADAMTS-9 observed in these two  109  cell lines. However, ADAMTS-1, -5, and versican mRNA and protein levels were significantly higher in KLE cells than in ECC-1 cells (Figure 4.11A and B). Specifically, at the mRNA level, ADAMTS-1 was 3-fold, ADAMTS-5 was 8-fold and versican was over 20fold higher in KLE cells than in ECC-1 cells. In contrast, ADAMTS-15 mRNA levels were 6fold lower in KLE cells than in ECC-1 cells (Figure 4.11A). When comparing protein levels, ADAMTS-1 was 6-fold, ADAMTS-5 was 13-fold and versican was 3-fold higher in KLE cells than in ECC-1 cells, respectively (Figure 4.11B).  4.2.2  Invasive Capacity of Different Endometrial Cancer Cells  Matrigel invasion assays indicated that the poorly differentiated KLE cells had a more than 3fold higher invasive index than well-differentiated ECC-1 cells. Thus, the higher expression of ADAMTS-1, -5 and versican was present in the KLE endometrial carcinoma cell line with a more invasive phenotype (Figure 4.12). . 4.2.3  Loss of Function of ADAMTS-1 Decreases the Invasive Capability of Poorly Differentiated Endometrial Cancer Cells in vitro  In this study, I determined whether a reduction in ADAMTS-1 expression in KLE cells resulted in a concomitant decrease in their invasive capacity. In order to reduce ADAMTS-1 levels in cultures of KLE cells, they were transfected with a siRNA specific to human ADAMTS-1. Both RT-PCR and Western blot analysis revealed that >70% decreases in ADAMTS-1 mRNA and protein levels occurred after 24 h of treatment (Figure 4.13A and B).  110  In contrast, there were no significant differences between ADAMTS-1 mRNA and protein levels in two control KLE cell cultures, in which cells were transfected with a non-silencing, scrambled siRNA or cultured in the presence of transfection reagent alone (Figure 4.13 A and B).  After 24 h, ADAMTS-1 siRNA transfected KLE cells were seeded in Matrigel invasion chambers for another 24 h, and the invasion index was subsequently determined. The number of cells that penetrated the Matrigel and appeared on the other side of the chamber was ~ 80% lower in cultures of KLE cells transfected with ADAMTS-1 siRNA, as compared to the control cell cultures (Figure 4.14).  4.2.4  Overexpression of ADAMTS-1 Increases the Invasive Capability of Welldifferentiated Endometrial Cancer Cells in vitro  The effect of exogenous expression of ADAMTS-1 on invasive phenotype was then examined in the well-differentiated ECC-1 cell, which contains lower levels of ADAMTS-1. The ECC-1 cells were transiently transfected for 24 h with pCMV6-ADAMTS1, a mammalian expression vector (pCMV6-Entry) containing a full-length human ADAMTS-1 cDNA. The expression vector pCMV6-entry and the transfection reagent were used as controls. Overexpression of ADAMTS-1 at both mRNA and protein levels was observed in the cells transfected with full-length ADAMTS-1 (Figure 4.15 A and B). There were an approximately 3-fold increase in ADAMTS-1 at the mRNA level and a 2-fold increase in the protein level. Moreover, the invasive capacity of the ADAMTS-1 over-expressing ECC-1 cell  111  was increased two-fold when compare to the control groups (Figure 4.16), indicating that increased levels of ADAMTS-1 are associated with increased cancer cell invasiveness.  4.3  Discussion  Previous studies have shown that ADAMTS-1 and -5 are expressed in secretory human endometrium and first trimester decidua (Ng et al., 2006; Zhu et al., 2007). Multiple ADAMTS subtypes, including ADAMTS-1, -4, -5, -8, and -9, were detected in primary cultures of normal endometrial stromal cells, while ADAMTS-15 was not. ADAMTS-1, -5, 8, -9 and -15 were found to be differentially expressed in the endometrial cancer cell lines, although ADAMTS-4 was not. This repertoire of ADAMTS subtypes was maintained in cultures of poorly differentiated, highly invasive KLE cells and well-differentiated ECC-1 cells, albeit at different levels. Although the overall biological significance of this expression pattern of ADAMTS subtypes in the human endometrium and endometrial cancer remains to be elucidated, my studies demonstrate that ADAMTS-1 plays a pivotal role in human endometrial cancer cell invasion in vitro. In addition, the present results show that ADAMTS1 mRNA and protein levels in ECC-1 cells are differentially regulated by estrogen in a concentration- and time-dependent manner. These data show that ADAMTS-1 expression is tightly regulated in human endometrial cancer cells, and that estrogen-mediated signaling pathways control the invasion process, at least in part, by up-regulating ADAMTS-1 gene expression.  112  The detection of multiple ADAMTS subtypes in tissues under normal and pathological conditions suggests that members of this gene family have important biological function(s) (Madan et al., 2003; Porter et al., 2004, Richards et al., 2005). Other than in normal human tissues, including the human endometrium, and placenta (Tang, 2001; Ng et al., 2006, Wen et al., 2006), ADAMTS-1 mRNA is detected in cancer tissues and cancer cell lines of diverse origin (Rocks et al., 2008). Although these findings suggest role(s) for this ADAMTS subtype in the development of an invasive cell phenotype, my studies are the first to assign this biological function to ADAMTS-1 in human endometrial cancer, and provide insight into the molecular mechanisms of tumor cell metastasis.  ADAMTS-1 is an inflammation and cancer associated protein (Kuno et al., 1997a). Endometrial tissues of ADAMTS-1 null-mutant mice develop large cysts (Shindo et al., 2000), suggesting a function for ADAMTS-1 in maintaining endometrial integrity. Our previous data have indicated that ADAMTS-1 is a steroid hormone responsive gene (Wen et al., 2006), and it was therefore not a surprise to find that this gene is involved in the development of estrogen-dependent endometrial cancer.  The stimulation of target gene expression by E2 is thought to occur through two mechanisms. Firstly, by ‘direct binding’, where the E2-ER complex binds directly to the estrogen response element (ERE) and interacts with a coactivator to activate and/or enhance the transcription of target genes (Klinge, 2000; 2001), and secondly, where ER does not bind to the ERE, but interacts with other DNA-bound transcription factors (Webb et al., 1999; Qin et al., 1999). ER differs from the PR and AR that bind to a common response element, as discussed  113  previously. The minimal consensus ERE sequence is a 13 bp perfect palindromic inverted repeat: 5'-GGTCAnnnTGACC-3' (Klein-Hitpass et al., 1988). Computer-based searches in the promoter region (2000 bp) of ADAMTS-1 gene identified an imperfect sequence at -219 bp from the transcription start site of ADAMTS-1, with a half-site fully matched and a halfsite with 60% similarity (Figure 4.17). Most EREs identified in the promoter of estrogenregulated genes are imperfect, non-palindromic EREs rather than the perfect consensus ERE, and certain degree of variation is common (Ee et al., 2004; Klinge, 2001; Driscoll, et al., 1998). Studies also suggest that more nucleotide changes from the consensus ERE will lead to decreased ER binding affinity and transcriptional activity. EREs in which sequences are changed in both arms have lower transcriptional activity than those containing alterations in only one-half of the ERE palindrome (Klinge, et al., 1996; Klinge, 2001; Tyulmenkov and Klinge 2001). In addition, the varying degree of transcriptional activation is cell-type specific and also depends on the coactivators (Tremblay et al., 1997; Ee et al., 2004; Klinge, 2001). It remain to be determined if the potential ERE sequence on the promoter region of ADAMTS-1 is indeed functional, and this could be done in the future by mutating this ERE in the context of a luciferase reporter gene driven by the ADAMTS-1 promoter sequence.  Progestin therapy has been used for decades for treatment of endometrial neoplasias. Endometrial cancer cell lines have provided insight into the effect of progesterone on cancer cell behavior and target genes that are regulated by this hormone (Kim and Chapman-Davis, 2010). In endometrial cancer cell lines, progesterone treatment can inhibit cell growth, invasion, and expression of cellular adhesion molecules (Dai et al., 2002; Ueda et al., 1996). Studies have demonstrated that progesterone inhibits the growth of endometrial cancer cells  114  or tumors especially when they express PR-B (Smid-Koopman et al., 2003; Hanekamp et al., 2004). Microarray studies have revealed progesterone-regulated genes that are involved in biological processes such as the cell cycle, cell proliferation and differentiation, apoptosis, immune responses, and the inhibition of genes that promote metastasis (Paulssen et al., 2008; Davies et al., 2004; Hanekamp et al., 2002). Progestins have been implicated to mediate the inhibition of cell growth and invasiveness through regulation of genes such as cyclin D1, MMP-1, -2, -7 and -9 (Saito et al., 2004, Di Nezza et al., 2003).  In my study, P4 abolished E2 induced cancer cell invasion. This effect is possible at least in part by antagonising the E2-mediated increase of ADAMTS-1 in ECC-1 cells. ECC-1 cells express progesterone receptor; however, computer-based searches of nucleotide sequence and functional assay failed to identify a progesterone response element in the promoter region of the murine Adamts-1 gene (Doyle et al., 2004). I also carried out a search of the human ADAMTS-1 promoter region (2000 bp), but likewise failed to identify a PRE. Thus, P4 appears to suppress the E2-mediated up regulation of ADAMTS-1 through an indirect mechanism.  In mice, P4 regulated ADAMTS-1 gene expression involves the DNA  transcription factors Sp1/Sp3, C/EBPß and NF-1 (Dolye et al., 2004), and these transcription factors can also collaborate with ER to active the ERE in estrogen-dependent genes (Levy et al., 2007). Furthermore, two cytokines, interleukin-1ß (IL-1 ß) and transforming growth factor- ß1 (TGF- ß1), have been shown to mediate many of the biological actions of P4 on the human endometrium (Oner et al., 2008; Florio  et al., 2007; Fazleabas et al., 2004;  Salamonsen et al., 2003, 2000). They regulate gene expression via the Sp1/Sp3 complex in human articular chondrocytes (Chadjichristos et al., 2002, 2003). These two cytokines also  115  have been reported to regulate ADAMTS-1 in several mammalian cell types including decidual stroma cells (Ng et al., 2006). In view of these findings, we can assume that in endometrial cancer cells, certain levels of crosstalk between steroids and cytokines also exist. It has been shown that the repression of ER activity by PR is not due to a reduction of ER levels or interference with the binding of ER to its response element (Katzenellenbogen, 2000), but rather by interfering ER to interact with the transcription complex. Perhaps, PR may affect the recruitment of promoter-specific and cell type-specific inhibitory proteins to the promoter (Levine and Manley, 1989). Such crosstalk between ER and PR could also be the mechanism that progesterone utilizes to suppress estrogen induced ADAMTS-1 expression.  Higher levels of ADAMTS-1 have been associated with pancreatic and hepatocellular cancer (Masui et al., 2001). However, ADAMTS-1 mRNA levels are decreased in lung carcinomas (Rocks et al., 2006), whereas ADAMTS-1 mRNA levels have been shown to be either increased (Kang et al., 2003) or decreased (Porter et al., 2004) in breast carcinomas. Among pancreatic cancer cases, higher levels of ADAMTS-1 are associated with increased local invasion and lymph node metastasis and poorer prognosis (Masui et al., 2004). Furthermore, exogenous expression of ADAMTS-1 has been shown to decrease the experimental metastasis of Chinese hamster ovary cells (Kuno et al., 2004). However, in human mammary and lung cancer cell lines, overexpression of ADAMTS-1 has been reported to promote tumor angiogenesis and invasion, such that it has been associated with increased metastatic potential (Liu et al., 2006). My studies revealed a correlation between the expression of ADAMTS-1 and the invasive capacity of endometrial cancer cells. Thus, higher expression of ADAMTS-1  116  is associated with a more invasive phenotype of endometrial cancer, and overexpression of ADAMTS-1 can induce a more invasive phenotype. Studies suggest that the proteolytic status of ADAMTS-1 determines its effect on tumor metastasis and that the metalloproteinase activity is required for the pro-metastatic activity of ADAMTS-1 because ADAMTS-1 fragments without the proteolytic domain lose their invasive potential and instead inhibit tumor cell invasion (Liu et al., 2006). In addition, ADAMTS-1 has been reported to promote cell invasion by inducing the shedding of transmembrane proteins like the heparin-binding epidermal growth factor (HB-EGF), and by activating the epidermal growth factor receptor (EGFR) (Liu et al., 2009).  Recent reports have revealed an important role of ADAMTS genes in rheumatic diseases and cancer (Tortorella and Malfait, 2008; Huang and Wu, 2010; Dunn et al., 2004, 2006; Rocks et al., 2006). In particular, studies of head and neck squamous cell carcinoma indicated that the aggrecanases ADAMTS-1, -4, -5, -8, -9, and -15 are expressed in the primary tumor tissues with significant up-regulation in tumor metastasis (Demircan et al., 2009). Furthermore, it has been reported that ADAMTS-8, in conjunction with ADAMTS-15, may serve as clinically prognostic cellular markers. Breast tumors with relatively high expression levels of ADAMTS-8, and with relatively low expression levels of ADAMTS-15, have a much higher chance of relapse and poorer survival (Porter et al., 2006). My study shows that ADAMTS-1 and ADAMTS-5 have similar expression patterns in vitro, suggesting a potential overlapping function of these ADAMTS subtypes in cancer differentiation and invasion. In addition, ADAMTS-15 is not expressed in normal endometrial stroma, but is expressed in the endometrial cancer cells, and is expressed at very high levels in well-differentiated ECC-1  117  cells, suggesting that ADAMTS-15 may predict a favorable outcome in endometrial cancer. In contrast, ADAMTS-4 is not expressed in endometrial cancer cells. These findings suggest independent functions of these ADAMTSs in the development of endometrial cancer. Further studies are required to evaluate the biological and clinical significance of the (dys)regulated expression levels of distinct ADAMTS subtypes, alone or in combination, in terms of the onset and/or progression of cancer to later stages of the disease.  118  ECC-1  KLE  ERα  401 bp  ERß  330 bp  PR  592 bp  AR  378 bp  GAPDH  203 bp  Figure 4.1. The expression of steroid receptor mRNA in endometrial cancer cell lines. Semiquantitative RT-PCR analysis of ER, PR and AR expression in the well-differentiated ECC-1 carcinoma cell line and the poorly differentiated KLE carcinoma cell line.  119  Control  E2  Cell Invasion index  E2+ICI 182 780  P4  E2+P4  *  2 1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0  ** **  Control  E2  P4  E2+ E2+P4 ICI 182 780  Figure 4.2. Estrogen promotes ECC-1 cell invasion. ECC-1 cells were cultured in DMEM/F12 medium. E2 (30nM), P4 (1µM), E2 plus P4 or E2 plus ICI 182 780 (100nM) were added to the culture medium, and after 72 hours, the cells (1 x 105 cells/ml) were placed into Matrigel-coated Transwell inserts. After 24 h, the invasion index was determined by counting the number of cells that had invaded through to the underside of the Matrigel-coated inserts as described in Chapter 2, section 2.3.6. Invasion assays were performed in triplicate and repeated on at least three independent occasions. Data were standardized to the untreated control and are represented as mean+S.E.M., n>3. (*, P<0.05 vs. untreated control, **, P<0.05 vs. E2 treated alone).  120  A ADAMTS-1 / GAPDH Relative mRNA level  3 2.5  *  *  *  2  P4  1.5  E2 DHT  1 0.5 0  0  6  12  24  48  72  Time (h)  B ADAMTS-1 / GAPDH Relative mRNA level  3  *  *  2.5  *  P4  2  E2 1.5  DHT  1 0.5 0  P4 (µM) 0 E2 (nM) 0 DHT (nM) 0  0.01 1 1  0.1 10 10  1 30 100  5 100 1000  Figure 4.3. Effects of P4, E2 and DHT on ADAMTS-1 mRNA levels in ECC-1 cells. A. Time-dependent effects of ADAMTS-1 mRNA levels in ECC-1 cells after culture in the presence of the steroid hormones for up to 72 h. B. Concentration-dependent effects of P4 (05µM), E2 (0-100nM) and DHT(0-1µM) on ADAMTS-1 mRNA levels after culture for 72 h. Values for ADAMTS-1 mRNA expression were normalized to the corresponding GAPDH mRNA levels. The results derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs (*, P<0.05 vs. untreated control).  121  A  Time (h)  0  6  12  24  48  72  110kD  ADAMTS-1  42kD  β-actin  ADAMTS-1 / β-actin Relative protein level  6 5  *  *  48  72  *  4 3 2 1 0  0  6  12  24  Time (h) B  E2 (nM)  0  1  10  30  100  110kD  ADAMTS-1  42kD  β-actin  ADAMTS-1 / β-actin Relative protein level  5  *  *  30  100  4  *  3 2  1 0  E2 (nM)  0  1  10  Figure 4.4. Effects of E2 on ADAMTS-1 protein levels in ECC-1 cells. Western blot analysis of ADAMTS-1 expression in lysates (30µg) prepared from ECC-1 cells cultured in the presence of A. E2 (30nM) for 0-72 h, or B. increasing concentrations of E2 (0-100nM) for 72 h. Cell lysates were analyzed by SDS-PAGE and immunoblotting, with the top half of membrane probed for ADAMTS-1, and the bottom half probed for ß-actin. Values for ADAMTS-1 expression were normalized to the corresponding β-actin levels. The results derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs (*, P<0.05 vs. untreated control).  122  A  Time (h)  0  6  12  24  48  72  ADAMTS-1  110kD  β-actin  42kD  ADAMTS-1 / β-actin Relative protein level  2  1.5  1  0.5  0  0  6  12  24  48  72  Time (h) B  Time (h)  0  6  12  24  48  72  ADAMTS-1  110kD  β-actin  42kD  ADAMTS-1 / β-actin Relative protein level  2  1.5  1  0.5  0  0  6  12  24  48  72  Time (h) Figure 4.5. Effects of P4 and DHT on ADAMTS-1 protein levels in ECC-1 cells. Western blot analysis of ADAMTS-1 expression in lysates (30µg) prepared from ECC-1 cells cultured in the presence of A. P4 (1µM), or B. DHT (100nM) for 0-72 hours. Cell lysates were analyzed by SDS-PAGE and immunoblotting, with the top half of membrane probed for ADAMTS-1, and the bottom half probed for ß-actin. Values for ADAMTS-1 expression were normalized to the corresponding β-actin levels. The results derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs.  123  A ADAMTS-1 / GAPDH Relative mRNA level  3  N.S.  *  2.5  **  2 1.5 1 0.5 0  E2 (nM) P4 (µM)  0 0  30 0  0 1  30 0.1  30 1  30 5  N.S.  B ADAMTS-1 / GAPDH Relative mRNA level  2.5  *  2  1.5  1  0.5  0  E2 (nM) DHT (nM)  0 0  30 0  0 100  30 1  30 10  30 100  Figure 4.6. Combinatory effects of gonadal steroids on ADAMTS-1 mRNA levels in ECC-1 cells. ADAMTS-1 mRNA levels in cells cultured with A. E2, P4 or E2 plus increasing concentrations of P4 for 72 h. B. E2, DHT or E2 plus increasing concentrations of DHT for 72 h. Values for ADAMTS-1 mRNA expression were normalized to the corresponding GAPDH mRNA levels. The results derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs (*, P<0.05 vs. untreated control; **, P<0.05 vs. E2 treated alone; N.S., not significantly different).  124  1  2  3  4  5  6  7  110kD  ADAMTS-1 β-actin  42kD  N.S  *  6  ADAMTS-1 / β-actin Relative protein level  5  4  **  3 2  1  0  E2 (nM) P4 (µM)  0 0  30 0  0 1  30 0.01  30 0.1  30 1  30 5  Figure 4.7. Combinatory effects of E2 and P4 on ADAMTS-1 protein levels in ECC-1 cells. Western blot analysis of ADAMTS-1 expression in protein extracts (30µg) prepared from ECC-1 cells cultured in the presence of E2, P4 or E2 plus increasing concentrations of P4 for 72 h. Cell lysates were analyzed by SDS-PAGE and immunoblotting, with the top half of membrane probed for ADAMTS-1, and the bottom half probed for ß-actin. Values for ADAMTS-1 expression were normalized to the corresponding β-actin levels. The results derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs (*, P<0.05 vs. untreated control; **, p<0.05 vs. E2 treated alone; N.S., not significantly different).  125  ADAMTS-1  110kD 42kD  β-actin  N.S.  *  4.5 4  ADAMTS-1 / β-actin Relative protein level  3.5 3 2.5 2 1.5 1 0.5 0  E2 (nM) DHT (nM)  0 0  30 0  0 100  30 1  30 10  30 100  Figure 4.8. Combinatory effects of E2 and DHT on ADAMTS-1 protein levels in ECCcells. Western blot analysis of ADAMTS-1 expression in protein extracts (30µg) prepared from ECC-1 cells cultured in the presence of E2, DHT or E2 plus increasing concentrations of DHT for 72 h. Cell lysates were analyzed by SDS-PAGE and immunoblotting, with the top half of membrane probed for ADAMTS-1, and the bottom half probed for ß-actin. Values for ADAMTS-1 expression were normalized to the corresponding β-actin levels. The results derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs (*, P<0.05 vs. untreated control; N.S., not significantly different vs. E2 treated alone).  126  A ADAMTS-1 / GAPDH Relative mRNA level  2  1.5  1  0.5  0  0  6  12  24  48  72  Time (h)  B ADAMTS-1 / GAPDH Relative mRNA level  2  1.5  1  0.5  0  ICI 182 780 (nM) 0  1  10  100  1000  Figure 4.9. Effects of ICI 182 780 on ADAMTS-1 mRNA levels in ECC-1 cells. A. Timedependent effects of ICI 182 780 (100nM) on ADAMTS-1 mRNA levels in ECC-1 cells for up to 72 h. B. Concentration-dependent effects of ICI 182 780 (1-1000nM) on ADAMTS-1 mRNA levels in ECC-1 cells after culture for 72 h . Values for ADAMTS-1 mRNA expression were normalized to the corresponding GAPDH mRNA levels. The results derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs. No significant differences from control cells and cells cultured with ICI 182 780 were found.  127  A ADAMTS-1 / GAPDH Relative mRNA level  .  N.S.  3  *  2.5  **  2  1.5 1 0.5 0  E2 (nM) 0 ICI 182 780(nM) 0  30 0  1  B  2  3  0 10  4  5  30 100  6  7  30 1000  8  110kD  ADAMTS-1  42kD  β-actin  *  ADAMTS-1 / β-actin Relative protein levels  5  4  N.S.  3  **  2 1  0  E2 (nM) 0 ICI 182 780(nM) 0  1 0  10 0  30 0  100 0  0 10  30 100  30 1000  Figure 4.10. Effects of ICI 182 780 on E2-mediated ADAMTS-1 expression in ECC-1 cells. A. ADAMTS-1 mRNA levels in cells cultured with E2 (30nM), ICI 182 780 (100nM) or E2 (30nM) with increasing concentrations of ICI 182 780 for 72 h. B. Western blot analysis of ADAMTS-1 levels in protein extracts (30µg) prepared from ECC-1 cells cultured in the presence E2 (1-100nM), ICI 182 780 (100nM) or E2 (30nM) with increasing concentrations of ICI 182 780 for 72 hours. Cell lysates were analyzed by SDS-PAGE and immunoblotting, with the top half of membrane probed for ADAMTS-1, and the bottom half probed for ß-actin. Values for ADAMTS-1 expression were normalized to the corresponding GAPDH or β-actin levels. The results derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs (* P<0.05 vs. untreated control; **, p<0.05 vs. E2 treated alone; N.S. not significant different vs. ICI 182 780 treated alone). 128  A  0.04  Relative mRNA level  0.035 0.03  ECC-1  0.025 0.02  KLE  0.015 0.01 0.005 0  1  4  5  8  9  15  versican  ADAMTS  B  ECC-1  KLE 110kD  ADAMTS-1  120kD  ADAMTS-5  versican  75kD  β-actin  42kD  1.4  Relative protein level  1.2 1  ECC-1  0.8 0.6  KLE  0.4 0.2 0  ADAMTS-1  ADAMTS-5  versican  Figure 4.11. Expression of aggrecanases and versican in ECC-1 and KLE cells. A. Realtime qPCR analysis of mRNA levels of aggrecanases and versican in ECC-1 and KLE cells. B. Western blot analysis of ADAMTS-1, -5 and versican expression in ECC-1 and KLE cells. Values of mRNA or protein levels were normalized to the corresponding GAPDH or β-actin levels. The results derived from at least three sets of samples are represented (mean+S.E.M.; n > 3) in the bar graphs.  129  ECC-1  KLE  Cell invasion index  4.5 4 3.5 3 2.5 2 1.5 1 0.5 0  ECC-1  KLE  Figure 4.12. Invasive capacities of ECC-1 and KLE cells. ECC-1 and KLE cells (1x105 cells/ml) were cultured in Matrigel-coated Transwell invasion chambers for 24 h. After 24 h, cells were stained with eosin. Invasive capacity was determined by counting the number of cells that had invaded to the underside of the Matrigel-coated insert. ECC-1 cells were assigned an invasion index of 1, and the KLE cell invasion index was calculated relative to this. Invasion assays were performed in triplicate and were repeated on at least three independent occasions, and are represented (mean+S.E.M.; n > 3) in the bar graphs.  130  A  Control  NS  A1siRNA ADAMTS-1  ADAMTS-1 / GAPDH Relative mRNA level  GAPDH 1.4 1.2 1 0.8 0.6  *  0.4 0.2 0  Control  B  Control  NS  NS  A1siRNA  A1siRNA 110kD  ADAMTS-1 β-actin  42kD  ADAMTS-1 / β-actin Relative protein level  1.2 1 0.8 0.6 0.4  *  0.2 0  Control  NS  A1siRNA  Figure 4.13. Silencing of ADAMTS-1 in KLE cells. Semiquantitative RT-PCR and Western blot analysis of A. mRNA, and B. protein levels of ADAMTS-1 in KLE cells transfected with siRNA directed against ADAMTS-1 (A1siRNA) or a non-silencing siRNA (NS). Untransfected KLE cells served as control. Values for ADAMTS-1 expression were normalized to the corresponding GAPDH or β-actin levels. The results derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs (*, P<0.05 vs. untreated control).  131  Cell invasion index  1.2 1 0.8 0.6 0.4  *  0.2 0  Control  NS  A1siRNA  Figure 4.14. Silencing of ADAMTS-1 in KLE cells leads to a decrease in invasive capacity. Bar graphs represent the 24h invasive capacity of KLE cells cultured on Matrigelcoated Transwell invasion chambers after transfection with ADAMTS-1 siRNA or nonsilencing siRNA for 24 h. The invasive index was determined by counting the number of cells that had invaded through to the underside of Matrigel pre-coated inserts. Untransfected KLE cells served as a control and were given an invasion index of 1, and all other values were calculated relative to this. Invasion assays were performed in triplicate and were repeated on at least three independent occasions, and are represented (mean+S.E.M.; n>3) in the bar graphs (*, P<0.05 vs. untransfected control).  132  A  Control  pCMV6-Entry  pCMV6-A1 ADAMTS-1 GAPDH  *  ADAMTS-1 / GAPDH Relative mRNA level  4.5 4 3.5 3 2.5 2 1.5 1 0.5 0  Control  Control  B  pCMV6-Entry  pCMV6-Entry  pCMV6-A1  pCMV6-A1 110kD  ADAMTS-1 β-actin  42kD  ADAMTS-1/ β-actin Relative protein level  2.5  *  2  1.5  1  0.5  0  Control  pCMV6-Entry  pCMV6-A1  Figure 4.15. Exogenous expression of ADAMTS-1 in ECC-1 cells. Semiquantitative RTPCR and Western blot analysis of ADAMTS-1 A. mRNA, and B. protein expression in ECC1 cells transfected with a full-length ADAMTS-1 cDNA construct (pCMV6-A1) or with the expression vector (pCMV6-Entry). Untransfected ECC-1 cells served as a control. Values of mRNA or protein levels were normalized to the corresponding GAPDH or β-actin levels. The results derived from at least four sets of samples were standardized to the untreated control and are represented (mean+S.E.M.; n > 4) in the bar graphs (* P<0.05 vs. untreated control).  133  *  Cell invasion index  2.5 2 1.5 1 0.5 0  Control  pCMV6-Entry  pCMV6-A1  Figure 4.16. Exogenous expression of ADAMTS-1 in ECC-1 cells confers an invasive phenotype. Bar graphs represent the 24h invasive capacity of ECC-1 cells cultured on Matrigel-coated Transwell invasion chambers after transfection with full-length ADAMTS-1 or pCMV6-Entry vector for 24 h. The invasive index was determined by counting the number of cells that had invaded through to the underside of Matrigel precoated inserts. Untransfected ECC-1 cells served as a control and were given an invasion index of 1, and all other values were calculated relative to this. Invasion assays were performed in triplicate and were repeated on at least three independent occasions and are represented (mean+S.E.M.; n > 3) in the bar graphs (*, P<0.05 vs. untransfected control).  134  -2000  -219  -1000  ADAMTS-1  Putative ERE Consensus ERE  GGTCA cag CGCCC 5'-GGTCA nnn TGACC- 3'  Figure 4.17. Schematic diagram of a 2000 bp fragment in the ADAMTS-1 gene promoter region containing a potential estrogen response element (ERE) sequence. The position of the novel ERE relative to the transcription initiation site of the ADAMTS-1 gene is shown. The sequence of the novel ERE is aligned in the boxed area for comparison with the consensus ERE sequence.  135  CHAPTER 5.  GENERAL DISCUSSION, CONCLUSIONS AND  FUTURE DIRECTIONS  5.1  General Discussion  The current study is the first to demonstrate that the subfamily of ADAMTS genes known as aggrecanases (i.e., ADAMTS-1, -4, -5, -8, -9, and -15) are expressed and regulated by gonadal steroids in primary cultures of human endometrial stromal cells. It is also the first series of studies to define the expression profiles of these in the well- and poorlydifferentiated endometrial carcinoma cells, and to determine a function of ADAMTS-1 in promoting endometrial cancer cell invasion.  All ADAMTS proteins are secreted, multi-domain, multi-functional proteins (Apte, 2004; Porter et al., 2005). Among the 19 ADAMTS family members in humans, ADAMTS-1, together with ADAMTS-4, -5, -8, -9, and -15, constitute a subfamily of proteinases named aggrecanases due to their proteolytic cleavage of important ECM components, including chondroitin proteoglycans, aggrecan, brevican, neurocan, and versican (Nagase and Kashiwaga, 2003; Apte, 2004; Porter et al., 2005). They have been implicated in cartilage degradation (Collins-Racie et al., 2004; Held-Feindt et al., 2006) and cancer development (Dunn et al., 2004, 2006; Porter et al., 2004; Rocks et al., 2006, 2008). Animal studies suggesting a function of some aggrecanases in the reproductive system (Mittaz et al., 2004; Robker et al., 2000; Stanton et al., 2005; Kim et al., 2005). In my studies, I have linked the expression of this subfamily of ADAMTS proteins in the human endometrium with their 136  hormonal regulation and function in this tissue during physiological and pathological conditions.  5.1.1  Aggrecanases Play Pivotal Roles in Endometrial Physiology  Gonadal steroids regulate the proliferation, differentiation and shedding of the endometrium during the human menstrual cycle. Progesterone is regarded as a key hormone in regulating female fertility. After ovulation, progesterone acts on the estrogen- primed endometrium to initiate stromal cell differentiation into decidual stromal cells, and this characterizes the “window of implantation”. If fertilization occurs, plasma progesterone levels remain high and maintain the first trimester decidua to support the embryo.  Remodeling of the ECM is a hallmark of the steroid-mediated morphological and functional maturation of endometrium (Aplin et al., 1988; Iwahashi et al., 1996). Numerous proteolytic enzymes have been assigned key roles in the highly regulated series of events that are required for endometrial remodelling. Urokinase plasminogen activator and the MMPs act in concert or in cascades to process specific ECM components of the endometrium (Fata et al., 2000; Curry and Osteen, 2001, 2003). Another gene family of metzincins that resemble the MMPs, are the ADAMTS, which also contain a MMP catalytic domain, and may fulfill a significant function in the cyclic proteolysis process in preparation for the implanting embryo. In this study, I report that the aggrecanases, with the exception of ADAMTS-15, are also expressed in the human endometrium, at least during the secretory phase of menstrual cycle and first trimester pregnancy. Together with my previous study (Wen et al., 2006), my recent  137  experiments have demonstrated that gonadal steroids exert overlapping but specific regulatory effects on aggrecanase expression. Estrogen has no specific effect on these aggrecanases in endometrial stromal cells, and most of the regulatory effects are exerted by progesterone and androgen. This further suggests that the most significant functions of aggrecanases are exerted in the secretory endometrium, that is, during the progesterone dominant phase of the menstrual cycle. We can therefore assume that after ovulation, when plasma progesterone levels increase, and especially during the time when decidualization occurs after implantation of an embryo, the levels of ADAMTSs, such as ADAMTS-1, -8, and -9, will increase, and this will help to degrade the endometrial ECM and thereby facilitate embryo implantation.  In vivo studies have indicated that ADAMTS-1 is critical during ovulation, and its expression depends on the PR and is under the regulation of progesterone (Robker et al., 2000). Additionally, LH/FSH is also reported being involved in the regulation of ADAMTS-1 expression (Doyle et al., 2004; Young et al., 2004). Recent studies have also extended progesterone-dependent expression and regulation to more ADAMTS genes, including ADAMTS-1, -2, -4, -5, -7, -8, and -9 (Richards et al., 2005; Fortune et al., 2009).  ADAMTS-1 knockout mice become sub-fertile due to decreased ovulation and morphological changes in the endometrium, but some still undergo normal decidualization (Mittaz et al., 2004). This may be attributed to the overlapping/compensating functions of other ADAMTSs, in particularly, ADAMTS-5, -8, and -9. For instance, it is known that ADAMTS-8 has a similar anti-angiogenic function as ADAMTS-1 (Vazquez et al., 1999). Angiogenesis is a critical event during implantation and tumor invasion, and ADAMTS-1 and-8 have been  138  assigned this function in several kinds of tumors (Stokes et al., 2010; Dunn et al., 2004; 2006; Porter et al., 2006; Masui et al., 2001). In addition, P4 and DHT can both increase ADAMTS1 and -8 expression in human endometrial stromal cells, supporting their roles in decidualization. P4 is believed to regulate ADAMTS-1 expression, at least in mouse, through an indirect mechanism that involves multiple transcription factor sites, such as the C/EBPβ, NF1-like factor, and Sp1/ Sp3 binding sites (Doyle et al., 2004). ADAMTS-9 is another progesterone responsive gene in the human endometrium, which has also recently been reported to have an anti-angiogenic function in cancer (Lo et al., 2010; Koo et al., 2010). The low expression levels of ADAMTS-9 in human endometrium and first trimester decidua suggest a limited function in the endometrium.  Like ADAMTS-1, ADAMTS-5 is highly expressed in the first trimester decidua (Zhu et al., 2007; Ng et al., 2006). The response of ADAMTS-5 to IL-1ß and TGF-ß1, two potent regulators of proteolytic processes at the maternal-fetal interface (Salamonsen et al., 2000; 2003; Karmakar and Das, 2002), suggest an important role for ADAMTS-5 in preparing the endometrium for implantation. While ADAMTS-5 was not apparently regulated by estrogen or progesterone treatment, its expression was decreased by androgen. The likelihood that the AR mediates the biological actions of DHT on endometrium is supported by the ability of hydroxyflutamide to block its effects. Both DHT and P4 have similar potencies in maintaining decidualization in rodents, and induce decidualization markers in primary cultures of human endometrial stromal cells (Narukawa et al., 1994; Zhang and Croy, 1996), suggesting some degree of overlap/cross talk between these two hormones. Moreover, aberrant androgen-AR mediated effects have also been linked to recurrent miscarriage and  139  infertility (Apparao et al., 2002; Giudice, 2007; Pasquali and Gambineri, 2006). In view of my results, excessive androgen may cause aberrant expression of certain ADAMTS subtypes, in particular ADAMTS-5, which could disrupt the ECM remodelling process during the menstrual cycle.  In summary, my current results demonstrate that gonadal steroids exert complex regulatory effects on the expression of aggrecanases in primary cultures of human endometrial stromal cells. This suggests that these ADAMTS subtypes may play important roles in endometrial physiology, and that their functions in mediating decidualizaton could be overlapping, compensatory or unique. It will therefore be interesting to observe whether the development of mice that are triple null mutant for ADAMTS-1, -5, and -8 will lead to an infertile phenotype, and confirm our findings that these aggrecanases play distinct and/or compensatory roles during decidualization.  5.1.2  ADAMTS-1 Promotes Endometrial Cancer Cell Invasion  Since ADAMTS-1 was described as the first member of the ADAMTS family of proteases (Kuno et al., 1997), studies have explored its role in regulating angiogenesis, tumor growth, and tumor invasion (Gustavsson et al., 2010; Casal et al., 2010; Porter et al., 2004; Liu et al., 2006). However, the roles of ADAMTS-1 during tumor progression remain controversial. The C-terminal domain of ADAMTS-1 has been considered as an anti-tumor and antimetastatic region, but overexpression of full-length ADAMTS-1 has promoted tumor growth and cancer metastasis (Liu et al., 2006, Kuno et al., 2004). My studies indicate that  140  ADAMTS-1 is expressed in human endometrial carcinoma cells and is associated with more aggressive phenotype. This supports the possible function of ADAMTS-1 in carcinogenesis of endometrial cancer.  The majority of endometrial cancer cases are due to type I endometrial carcinoma, and unopposed estrogen exposure is a known risk factor. Estrogen stimulates the endometrium to increase mitogenic activity, whereas progestin or anti-estrogen reagent can inhibit this effect (Wing et al., 2003). Estrogen is believed to act as a cancer promoter or even a carcinogen (Emons et al., 2000). In this study, I have confirmed that estrogen can promote welldifferentiated endometrial cancer cell invasion, while progesterone and the anti-estrogen ICI 182 780 can inhibit the estrogen-induced increase of cancer invasion. Estrogen treatment causes significant increases of ADAMTS-1 expression at the mRNA and protein levels in well-differentiated endometrial cancer cells, raising the possibility that the E2-mediated increase of cancer cell invasion is, at least in part, caused by its ability to regulate the expression and function of ADAMTS-1. This hypothesis is further supported by the fact that over-expression of a full-length ADAMTS-1 cDNA in poorly invasive ECC-1 endometrial cancer cells leads to a more invasive phenotype; whereas loss of function of endogenous ADAMTS-1 in highly invasive, poorly differentiated KLE cells decreased their cell invasion capacity.  The main roles of ADAMTS-1 in carcinogenesis and metastasis likely involve breakdown of the ECM to promote invasion, as well as the loss of anti-angiogenic function. Although opposing roles for ADAMTS-1 have been reported in different cancer types, the aberrant  141  expression of ADAMTS-1 and other ADAMTS subtypes is a common feature in various cancer types (Vazquez et al., 1999; Demircan et al., 2009 Cross et al., 2005; Porter et al., 2004). Our findings agree with some previous studies. For example, higher levels of ADAMTS-1 in pancreatic cancer correlate with poorer prognosis, with evidence of increased local invasion and lymph node metastasis (Masui et al., 2001). There was no association between ADAMTS-1 and microvessel density in the pancreatic cancer cases, and ADAMTS8 was expressed at very low levels in both normal and cancer tissues, indicating that neither gene is closely linked with regulation of angiogenesis at metastatic sites in pancreatic cancer (Masui et al., 2001). However, some other studies suggested that ADAMTS-1 levels are down-regulated in human breast tumor samples compared with non-neoplastic mammary tissue (Porter et al., 2004). This difference may be caused by the different proteolytic status of ADAMTS-1, and seems to be tissue specific (Liu et al., 2005). Full-length ADAMTS-1 has tumor promoting activity, but the anti-tumor properties of ADAMTS-1 have been attributed to the anti-angiogenic function of its TSP-1 motif, which seems to be only exerted by a proteolytic fragment of ADAMTS-1 but has been masked in the full-length ADAMTS-1 protein (Liu et al., 2006). In my study, a significant increase in the zymogen form of ADAMTS-1 was detected in endometrial cancer cells after estrogen treatment. Considering the differential expression of ADAMTS-1 in well- and poorly-differentiated endometrial cancer cells, ADAMTS-1 could also be involved in the differentiation of endometrial cancer. Further investigation is required.  The regulation of ADAMTS-1 expression by the gonadal steroids is complex and cell specific, with a different regulatory pattern in cultures of normal endometrial stromal cells and  142  endometrial cancer cells. Although E2 alone has not been shown to influence the expression of any aggrecanase in isolated cultures of endometrial stromal cells (Wen et al., 2006), the regulatory effect of E2 in normal epithelial cells has never been examined. However, E2 significantly increases ADAMTS-1 expression at mRNA and protein levels in endometrial cancer cells. Although P4 has been previously shown to have regulatory effects in endometrial stromal cells (Wen et al., 2006) and it has no effect on cancer cells, P4 can abolish the E2-induced increase of ADAMTS-1 expression and inhibit E2-mediated cell invasion as well. E2 exerts specific regulatory effects likely through its receptor-mediated signalling pathway. This is supported by the fact that the ER antagonist ICI 182 780 blocks these effects of E2. However, the E2-dependent regulatory effects may also be mediated by the novel membrane-bound E2 receptor (G protein-coupled receptor 30) recently shown to be biologically active in human endometrial cancer cell lines (Vivacqua et al., 2006).  For several decades, progesterone has been used in the treatment of advanced or relapsed endometrial cancer, and there is no doubt that progestins have a protective function in the human endometrium (Kim and Chapman-Davis, 2010). In vivo studies show that progestins change the histological features of the endometrium in patients with complex atypical hyperplasia and well-differentiated endometrioid carcinoma, including a decrease in the gland-to-stroma ratio and decreased mitotic activity (Wheeler et al., 2007). Progestin treatment also promotes the involution or disappearance of PTEN null endometrial glands (Zheng et al., 2004). In vitro studies using endometrial cancer cell lines have also indicated that numerous genes, such as MMP-1, -2, -7, -9 and cyclin D1, have been associated with progestin-mediated inhibition of cell growth and invasiveness (Saito et al., 2004). Microarray  143  studies in endometrial cancer cells provide further evidence that progestins are involved in the regulation of genes associated with cell signalling, apoptosis, tumor suppressors, transcription factors and anti-inflammatory cytokines (Davies et al., 2004; Paulssen et al., 2008). Many of the effects of progesterone are thought to be due to its ability to oppose the actions of estrogen, particularly in the uterus. Progesterone abrogates estrogen induction of many of the known hormone-responsive genes, and this effect is mediated by down-regulation of cytoplasmic and nuclear ER concentrations, or by decreasing the active estrogen concentration (Graham and Clarke, 1997; Clarke, 1990). Progesterone can inhibit ER expression both in uterus and in breast tissues through decreasing the transcription of ER mRNA or by shortening the haf-life of ER protein (Graham and Clarke, 1997; Read et al., 1989; Takeda et al., 1986). Although my studies have not shown any direct regulatory effects of P4 on ADAMTS-1 expression in endometrial cancer cells, they provide evidence that P4 interacts with E2 in maintaining endometrial integrity. In particular, my studies indicate that P4 likely inhibits endometrial cancer progression and invasion, at least in part through inhibiting E2-induced increases in ADAMTS-1 expression. This may extend to other ADAMTSs as well. It is tempting to speculate that ADAMTS-1 expression in the endometrium and endometrial cancer tissues is dependent on the balance between the counterregulatory effects of estrogen and progesterone. However, the molecular mechanism by which P4 modulates E2-mediated increases in ADAMTS-1 expression in human endometrial cancer cells remains to be elucidated. The changes of mRNA and protein levels of ER under P4 treatment have not been examed in this study, but should be investigated in the future.  144  To date, I conclude that ADAMTS-1 is highly expressed in endometrial cancer cells and is under the regulation of both E2 and P4. Furthermore, the expression of ADAMTS-1 is directly related to cancer cell invasiveness.  5.2  Conclusions  In conclusion, the body of work presented in this thesis describes novel cellular mechanisms involved in regulating human endometrial stromal cells during the menstrual cycle; the possible function of aggrecanases during the process of decidualization and changes in their expression in response to the gonadal steroids. In the first part of this thesis, I identify additional aggrecanases that exhibit regulated expression in response to gonadal steroids. Thus, in addition to ADAMTS-1, P4 and DHT also up-regulate ADAMTS-8 and -9 in endometrial stromal cells. Moreover, ADAMTS-5 is down-regulated by DHT, whereas ADAMTS-4 expression remains unchanged after treatment with gonadal steroids. These findings provide evidence that aggrecanases contribute to steroid-mediated ECM remodeling events that occur in the endometrium in preparation for pregnancy.  The second part of this thesis describes the role of ADAMTS-1 in endometrial cancer cell invasion, and how gonadal steroids regulate its expression. ADAMTS-1 is expressed in human endometrial cancer cells, and E2 up-regulates ADAMTS-1 mRNA and protein levels in well-differentiated human endometrial cancer cells. Over-expression of ADAMTS-1 in well-differentiated ECC-1 cells promotes cell invasion. In contrast, silencing endogenous ADAMTS-1 in poorly differentiated, invasive KLE cells decreases the cell invasive capacity.  145  These results suggest that ADAMTS-1 is involved in steroid-regulated ECM remodeling events during cancer cell progression, and that E2 promotes well-differentiated endometrial cancer cell invasion, possibly by specifically up-regulating ADAMTS-1 expression. Thus, ADAMTS-1 likely plays a pivotal role in regulating endometrial cancer invasion, especially as loss or gain of function of ADAMTS-1 directly affects tumor cell invasiveness.  In summary, the studies in this report will improve our understanding of molecular mechanisms underlying the dynamic changes of human endometrium under physiological and pathological conditions, and will provide useful insight into the cell biology of ADAMTS family members. In this way, this work contributes to our long-term goals to develop ADAMTS as biomarkers to accurately diagnose and predict the outcomes of recurrent pregnancy loss and endometrial cancer.  5.3  Future Directions  1. To examine other aggrecanases, such as ADAMTS-5, their regulation and function in endometrial cancer invasion  The same experiment model system described in chapter 4 in this thesis can be used to examine the regulated expression of ADAMTS-5 in response to gonadal steroids. Loss- and gain- of function study can be performed in well-differentiated ECC-1 cell and poorly differentiated KLE endometrial carcinoma cell by using full length ADAMTS-5 cDNA and  146  ADAMTS-5 siRNA. Alterations in the invasive capacity of these endometrial cancer cells will be determined using Transwell invasion assays.  2. To investigate the molecular mechanisms involved in ADAMTS-1 mediated endometrial cancer cell invasion, for example, the interaction with integrin.  Preliminary data have shown that overexpression of ADAMTS-1 in ECC-1 cell or loss-of function of ADAMTS-1 in KLE cells will lead to the altered expression of certain integrin subtypes. To further investigate whether changes in integrin expression and function due to ADAMTS-1 expression facilitated the invasive phenotype in endometrial cancer cells, fluorimetric α and β integrin-mediated cell adhesion array kits can be used to analyze potential differences in integrin subtype expression and binding. Specific integrin antibodies can be used to inhibit the function of certain integrin subunit, to see whether the inhibition of integrin function will result in a change in cell invasion.  147  Progesterone  Endometrial stromal cell  Androgen  1  4  2 Decidual stromal cell  ADAMTS-1  2  3 2 ADAMTS-5  ADAMTS-8  ADAMTS-9  5  Basement membrane  Blastocyst  Figure 5.1. Proposed model for the regulation of aggrecanases by gonadal steroids in human endometrial stromal cells in preparation for embryo implantation. (1) After ovulation, the plasma progesterone level increases, and it acts upon the estrogen-primed endometrium to initiate the differentiation of stromal cells into decidual cells. (2) Increased production of some aggrecanases of ADAMTS subtypes, such as ADAMTS-1, -8, and -9 from endometrial stroma cells upon stimulation of progesterone, suggest that they influence decidualization. (3) Although ADAMTS-5 production by endometrial stromal cells may also increase, this is not regulated by progesterone. However, it is up-regulated by IL-1β, an important regulator of proteolytic processes during early pregnancy. (4) In my experiments, the non-aromatizable androgen, DHT, was shown to down-regulate ADAMTS-5, suggesting ADAMTS-5 may be implicated in some infertility conditions associated with high androgen levels. (5) The ADAMTSs metalloproteinases will degrade the endometrial extracellular matrix and thereby facilitate embryo implantation.  148  Estrogen  1 Endometrial epithelial cell  2 Endometrial carcinoma cell  3 ADAMTS-1 P4  4  + P4  5 Basement membrane  Figure 5.2. Proposed model for the regulation and function of ADAMTS-1 in promoting well-differentiated endometrial carcinoma cell invasion. (1) During menopause or after loss of ovarian progesterone, unopposed estrogen will cause endometrial hyperplasia and increase the incidence of endometrial cancer. (2) Estrogen stimulates cell proliferation and promotes progression of well-differentiated endometrial carcinoma cells. (3) Estrogen stimulates increased production of ADAMTS-1 in endometrial cancer cells. (4) In the absence of progesterone (P4), estrogen-induced increased production of ADAMTS-1 will degrade extracellular matrix and enhance cancer cell invasion. (5) In the presence of progesterone, the estrogen-induced increase of ADAMTS-1 will be lost and this will thereby inhibit the invasiveness of cancer cells.  149  REFERENCES Abbaszade I, Liu RQ, Yang F, Rosenfeld SA, Ross OH, Link JR, Ellis DM, Tortorella MD, Pratta MA, Hollis JM, Wynn R, Duke JL, George HJ, Hillman MC Jr, Murphy K, Wiswall BH, Copeland RA, Decicco CP, Bruckner R, Nagase H, Itoh Y, Newton RC, Magolda RL, Trzaskos JM, Burn TC. 1999. Cloning and characterization of ADAMTS11, an aggrecanase from the ADAMTS family. J Biol Chem. Aug 13;274(33):23443-50 Achache H, Revel A. 2006. Endometrial receptivity markers, the journey to successful embryo implantation. Hum Reprod Update. Nov-Dec;12(6):731-46. Adam EC, Hertig AT, Rock J. 1956. A description of 34 human ova within the first 17 days of development. Am J Anat. May; 98(3):435-93 Adams JC, Lawler J. 2004. The thrombospondins. Int J Biochem Cell Biol. Jun;36(6):961-8. Adams JC. 2001. Thrombospondins: multifunctional regulators of cell interactions. Annu Rev Cell Dev Biol. 17:25-51 Aflalo ED, Sod-Moriah UA, Potashnik G, Har-Vardi I. 2005. Expression of plasminogen activators in preimplantation rat embryos developed in vivo and in vitro. Reprod Biol Endocrinol. Feb 10;3:7. Aghajanova L, Stavreus-Evers A, Nikas Y, Hovatta O, Landgren BM. 2003. Coexpression of pinopodes and leukemia inhibitory factor, as well as its receptor, in human endometrium. Fertil Steril. Mar;79 Suppl 1:808-14. Aglund K, Rauvala M, Puistola U, Angström T, Turpeenniemi-Hujanen T, Zackrisson B, Stendahl U. 2004. Gelatinases A and B (MMP-2 and MMP-9) in endometrial cancer-MMP-9 correlates to the grade and the stage. Gynecol Oncol. Sep;94(3):699-704. Ahonen M, Poukkula M, Baker AH, Kashiwagi M, Nagase H, Eriksson JE, Kähäri VM. 2003. Tissue inhibitor of metalloproteinases-3 induces apoptosis in melanoma cells by stabilization of death receptors. Oncogene. Apr 10;22(14):2121-34. Alfano D, Franco P, Vocca I, Gambi N, Pisa V, Mancini A, Caputi M, Carriero MV, Iaccarino I, Stoppelli MP. 2005. The urokinase plasminogen activator and its receptor: role in cell growth and apoptosis. Thromb Haemost. 2005 Feb;93(2):205-11. Amanda Nickles Fader, Lucybeth Nieves Arriba, Heidi E. Frasure, Vivian E. von Gruenigen. 2009. Endometrial cancer and obesity: Epidemiology, biomarkers, prevention and survivorship. Gynecologic Oncology 114 121–127 Amant F, Moerman P, Neven P, Timmerman D, Van LimbergenE, Vergote I. 2005. Endometrial cancer. Lancet 366: 491–505  150  Andreasen PA, Egelund R, Petersen HH. 2000. The plasminogen activation system in tumor growth, invasion, and metastasis. Cell Mol Life Sci. Jan 20;57(1):25-40. Review. Anteby EY, Greenfield C, Natanson-Yaron S, Goldman-Wohl D, Hamani Y, Khudyak V, Ariel I, Yagel S. 2004. Vascular endothelial growth factor, epidermal growth factor and fibroblast growth factor-4 and -10 stimulate trophoblast plasminogen activator system and metalloproteinase-9. Mol Hum Reprod. Apr;10(4):229-35. Aplin JD, Charlton AK, Ayad S. 1988. An immunohistochemical study of human endometrial extracellular matrix during the menstrual cycle and first trimester of pregnancy. Cell Tissue Res. Jul;253(1):231-40. Apparao KB, Lovely LP, Gui Y, Lininger RA, Lessey BA. 2002. Elevated endometrial androgen receptor expression in women with polycystic ovarian syndrome. Biol Reprod. Feb;66(2):297-304. Apte SS. 2004. A disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motifs: the ADAMTS family. Int J Biochem Cell Biol. Jun;36(6):981-5. Apte SS. 2009. A disintegrin-like and metalloprotease (reprolysin-type) with thrombospondin type 1 motif (ADAMTS) superfamily: functions and mechanisms. J Biol Chem. Nov 13;284(46):31493-7. Astedt B, Hägerstrand I, Lecander I. 1986. Cellular localisation in placenta of placental type plasminogen activator inhibitor. Thromb Haemost. Aug 20;56(1):63-5. Bajou K, Maillard C, Jost M, Lijnen RH, Gils A, Declerck P, Carmeliet P, Foidart JM, Noel A. 2004. Host-derived plasminogen activator inhibitor-1 (PAI-1) concentration is critical for in vivo tumoral angiogenesis and growth. Oncogene. Sep 9;23(41):6986-90 Bartel DP. 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116: 281 297. Bar-Yosef O, Polak-Charcon S, Hoffman C, Feldman ZP, Frydman M, Kuint J. 2008. Multiple congenital skull fractures as a presentation of Ehlers-Danlos syndrome type VIIC. Am J Med Genet A. Dec 1;146A(23):3054-7. Basil JB, Goodfellow PJ, Rader JS, et al. 2000. Clinical significance of microsatellite instability in endometrial carcinoma. Cancer 89:1758–64. Basile DP, Fredrich K, Chelladurai B, Leonard EC, Parrish AR. 2008. Renal ischemia reperfusion inhibits VEGF expression and induces ADAMTS-1, a novel VEGF inhibitor. Am J Physiol Renal Physiol. Apr;294(4):F928-36.  151  Basset P, Bellocq JP, Wolf C, Stoll I, Hutin P, Limacher JM, Podhajcer OL, Chenard MP, Rio MC, Chambon P. 1990. A novel metalloproteinase gene specifically expressed in stromal cells of breast carcinomas. Nature. Dec 20-27;348(6303):699-704. Baulieu EE. 1996. RU 486 (mifepristone). A short overview of its mechanisms of action and clinical uses at the end of 1996. Theriogenology. Oct;66(6-7):1560-7. Bellehumeur C, Blanchet J, Fontaine JY, Bourcier N, Akoum A. 2009. Interleukin 1 regulates its own receptors in human endometrial cells via distinct mechanisms. Hum Reprod. Sep; 24(9):2193-204. Bentin-Ley U, Pedersen B, Lindenberg S, Larsen JF, Hamberger L, Horn T. 1994. Isolation and culture of human endometrial cells in a three-dimensional culture system. J Reprod Fertil. Jul;101(2):327-32 Bergers G, Brekken R, McMahon G, Vu TH, Itoh T, Tamaki K, Tanzawa K, Thorpe P, Itohara S, Werb Z, Hanahan D. 2000. Matrix metalloproteinase-9 triggers the angiogenic switch during carcinogenesis. Nat Cell Biol. Oct;2(10):737-44. Berrier AL, Yamada KM. 2007. Cell-matrix adhesion. J Cell Physiol. Dec;213(3):565-73. Berstein LM, Tchernobrovkina AE, Gamajunova VB, Kovalevskij AJ, Vasilyev DA, Chepik OF, Turkevitch EA, Tsyrlina EV, Maximov SJ, Ashrafian LA, Thijssen JH. 2003. Tumor estrogen content and clinico-morphological and endocrine features of endometrial cancer. J Cancer Res Clin Oncol. Apr;129(4):245-9. Bilalis DA, Klentzeris LD, Fleming S. 1996. Immunohistochemical localization of extracellular matrix proteins in luteal phase endometrium of fertile and infertile patients. Hum Reprod. Dec;11(12):2713-8 Bischof P, Meisser A, Campana A. 2000. Mechanisms of endometrial control of trophoblast invasion. J Reprod Fertil Suppl. 55:65-71. Review. Bischof P, Meisser A, Campana A. 2000. Paracrine and autocrine regulators of trophoblast invasion--a review. Placenta. Mar-Apr;21 Suppl A:S55-60. Bischof P, Truong K, Campana A. 2003. Regulation of trophoblastic gelatinases by protooncogenes. Placenta. Feb-Mar;24(2-3):155-63. Black RA, White JM. 1998. ADAMs: focus on the protease domain. Curr Opin Cell Biol. Oct;10(5):654-9. Review. Blasi F, Carmeliet P. 2002. uPAR: a versatile signalling orchestrator. Nat Rev Mol Cell Biol. 2002 Dec;3(12):932-43.  152  Blelloch R, Kimble J. 1999. Control of organ shape by a secreted metalloprotease in the nematode Caenorhabditis elegans.Nature. Jun 10;399(6736):586-90. Bockman JV. 1983. Two pathogenetic types of endometrial carcinoma. Gynecol Oncol 15:10–7 Boerboom D, Russell DL, Richards JS, Sirois J. 2003. Regulation of transcripts encoding ADAMTS-1 (a disintegrin and metalloproteinase with thrombospondin-like motifs-1) and progesterone receptor by human chorionic gonadotropin in equine preovulatory follicles.J Mol Endocrinol. Dec;31(3):473-85. Bohm M, Gerlach R, Beecken W.D, Scheuer T, Stier-Bruck I, Scharrer I. 2003. ADAMTS-13 activity in patients with brain and prostate tumors is mildly reduced, but not correlated to stage of malignancy and metastasis. Thromb. Res. 111 33e37. Bornstein P, Agah A, Kyriakides TR. 2004. The role of thrombospondins 1 and 2 in the regulation of cell-matrix interactions, collagen fibril formation, and the response to injury. Int J Biochem Cell Biol. Jun;36(6):1115-25. Review. Bornstein P, Kyriakides TR, Yang Z, Armstrong LC, Birk DE. 2000. Thrombospondin 2 modulates collagen fibrillogenesis and angiogenesis. J Investig Dermatol Symp Proc. Dec;5(1):61-6. Brenner RM, Slayden OD, Nayak NR, Baird DT, Critchley HO. 2003. A role for the androgen receptor in the endometrial antiproliferative effects of progesterone antagonists. Steroids.68:1033-1039. Bridges LC, Bowditch RD. 2005. ADAM-Integrin Interactions: potential integrin regulated ectodomain shedding activity. Curr Pharm Des.11(7):837-47. Bugge TH, Flick MJ, Danton MJ, Daugherty CC, Romer J, Dano K, Carmeliet P, Collen D, Degen JL. 1996. Urokinase-type plasminogen activator is effective in fibrin clearance in the absence of its receptor or tissue-type plasminogen activator. Proc Natl Acad Sci U S A. Jun 11;93(12):5899-904. Bulmer JN, Morrison L, Johnson PM, Meager A. 1990. Immunohistochemical localization of interferons in human placental tissues in normal, ectopic, and molar pregnancy. Am J Reprod Immunol. Mar-Apr;22(3-4):109-16. Bulmer JN, Pace D, Ritson A. 1988. Immunoregulatory cells in human decidua: morphology, immunohistochemistry and function. Reprod Nutr Dev. 28(6B):1599-613. Burney RO, Talbi S, Hamilton AE, Vo KC, Nyegaard M, Nezhat CR, Lessey BA, Giudice LC. 2007. Gene expression analysis of endometrium reveals progesterone resistance and candidate susceptibility genes in women with endometriosis. Endocrinology. Aug;148(8):3814-26. 153  Burrage PS, Mix KS, Brinckerhoff CE. 2006. Matrix metalloproteinases: role in arthritis. Front Biosci. Jan 1;11:529-43. Burton JL, Wells M. 1998. Recent advances in the histopathology and molecular pathology of carcinoma of the endometrium. Histopathology. Oct;33(4):297-303. Review. Burton KA, Henderson TA, Hillier SG, Mason JI, Habib F, Brenner RM, Critchley HO. 2003. Local levonorgestrel regulation of androgen receptor and 17beta-hydroxysteroid dehydrogenase type 2 expression in human endometrium. Hum Reprod. 18:2610-2617. Bussaglia E, del Rio E, Matias-Guiu X, et al. 2000. PTEN mutations in endometrial carcinomas. A molecular and clinicopathologic analysis of 38 cases. Hum Pathol 31:312–7. Caduff RF, Johnston CM, Svoboda-Newman SM, et al. 1996. Clinical and pathological significance of microsatellite instability in sporadic endometrial carcinoma. Am J Pathol 148:1671–8. Cal S, Arguelles JM, Fernandez PL, López-Otín C. 2001. Identification, characterization, and intracellular processing of ADAM-TS12, a novel human disintegrin with a complex structural organization involving multiple thrombospondin-1 repeats. J Biol Chem. May 25;276(21):17932-40. Campan M, Weisenberger DJ, Laird PW. 2006. DNA methylation profiles of female steroid hormone-driven human malignancies, Curr. Top. Microbiol. Immunol. 310 141–178. Carmeliet P, Jain RK. 2000. Angiogenesis in cancer and other diseases. Nature. Sep 14;407(6801):249-57. Carver J, Martin K, Spyropoulou I, Barlow D, Sargent I, Mardon H. 2003. An in-vitro model for stromal invasion during implantation of the human blastocyst. Hum Reprod. Feb;18(2):283-90. Casal C, Torres-Collado AX, Plaza-Calonge Mdel C, Martino-Echarri E, Ramón Y Cajal S, Rojo F, Griffioen AW, Rodríguez-Manzaneque JC. 2010. ADAMTS1 contributes to the acquisition of an endothelial-like phenotype in plastic tumor cells. Cancer Res. Jun 1;70(11):4676-86. Casslén B, Astedt B. 1983. Occurrence of both urokinase and tissue plasminogen activator in the human endometrium. Contraception. Dec;28(6):553-64. Castelbaum AJ, Ying L, Somkuti SG, Sun JG, Ilesanmi AO, Lessey BA. 1997. Characterization of integrin expression in a well differentiated endometrial adenocarcinoma cell line (Ishikawa). J Clin Endocrinol Metab; 82:136–142.  154  Catasu´s Ll, Machin P, Matias-Guiu X, Prat J. 1998. Microsatellite instability in endometrial carcinomas clinicopathologic correlations in a series of 42 cases. Hum Pathol 29:1160–4. Catasus L, Gallardo A, Cuatrecasas M, Prat J. 2008. PIK3CA mutations in the kinase domain (exon 20) of uterine endometrial adenocarcinomas are associated with adverse prognostic parameters. Mod Pathol21:131–9. Cato AC, Henderson D, Ponta H. 1987. The hormone response element of the mouse mammary tumour virus DNA mediates the progestin and androgen induction of transcription in the proviral long terminal repeat region. EMBO J. Feb;6(2):363-8. Chabbert-Buffet N, Meduri G, Bouchard P, Spitz IM. 2005. Selective progesterone receptor modulators and progesterone antagonists: mechanisms of action and clinical applications. Hum Reprod Update. May-Jun;11(3):293-307 Chadjichristos C, Ghayor C, Herrouin JF, Ala-Kokko L, Suske G, Pujol JP, Galéra P. 2002. Down-regulation of human type II collagen gene expression by transforming growth factor-beta 1 (TGF-beta 1) in articular chondrocytes involves SP3/SP1 ratio. J Biol Chem. Nov 15;277(46):43903-17. Chadjichristos C, Ghayor C, Kypriotou M, Martin G, Renard E, Ala-Kokko L, Suske G, de Crombrugghe B, Pujol JP, Galéra P. 2003. Sp1 and Sp3 transcription factors mediate interleukin-1 beta down-regulation of human type II collagen gene expression in articular chondrocytes. J Biol Chem. Oct 10;278(41):39762-72. Chandrasekhar Y, Armstrong DT. 1991. Regulation of uterine progesterone receptors by the nonsteroidal anti-androgen hydroxyflutamide. Biol Reprod. Jul;45(1):78-81. Chandrasekhar Y. 1991. Effects of hydroxyflutamide on female reproductive function. Adv Contracept Deliv Syst.;7(2):157-66. Chazaud B, Ricoux R, Christov C, Plonquet A, Gherardi RK, Barlovatz-Meimon G. 2002. Promigratory effect of plasminogen activator inhibitor-1 on invasive breast cancer cell populations. Am J Pathol. Jan;160(1):237-46. Chen GT, Getsios S, MacCalman CD. 1998. Progesterone regulates beta-catenin mRNA levels in human endometrial stromal cells in vitro. Endocrine. Dec;9(3):263-7 Chen GT, Getsios S, MacCalman CD. 1999. Antisteroidal compounds and steroid withdrawal down-regulate cadherin-11 mRNA and protein expression levels in human endometrial stromal cells undergoing decidualisation in vitro. Mol Reprod Dev. Aug;53(4):384-93.  155  Cho C, Bunch DO, Faure JE, Goulding EH, Eddy EM, Primakoff P, Myles DG. 1998. Fertilization defects in sperm from mice lacking fertilin beta. Science. Sep 18;281(5384):1857-9. Chun TH, Sabeh F, Ota I, Murphy H, McDonagh KT, Holmbeck K, Birkedal-Hansen H, Allen ED, Weiss SJ. 2004. MT1-MMP-dependent neovessel formation within the confines of the three-dimensional extracellular matrix. J Cell Biol. Nov 22;167(4):757-67 Church HJ, Vićovac LM, Williams JD, Hey NA, Aplin JD. 1996. Laminins 2 and 4 are expressed by human decidual cells. Lab Invest. Jan;74(1):21-32. Chwalisz K, Parker L and Williamson S. 2003. Treatment of uterine leiomyomas with the novel selective progesterone receptor modulat or(SPRM). J Soc Gynecol Invest 10,301A. Clarke CL, Feil PD, Satyaswaroop PG. 1987. Progesterone receptor regulation by 17bestradiol in human endometrial carcinoma grown in nude mice. Endocrinology 1987; 121:1642–1648. Cloke B, Huhtinen K, Fusi L, et al. 2008. The androgen and progesterone receptors regulate distinct gene networks and cellular functions in decidualizing endometrium. Endocrinology. 149: 4462-4474. Cohen CJ, Rahaman J. 1995. Endometrial cancer. Management of high risk and recurrence including the tamoxifen controversy. Cancer. Nov 15;76(10 Suppl):2044-52. Cohen M, Bischof P. 2007. Factors regulating trophoblast invasion. Gynecol Obstet Invest. 64(3):126-30. Cohen M, Bischof P. 2009. Coculture of decidua and trophoblast to study proliferation and invasion. Methods Mol Biol. 550:63-72. Cohen M, Wuillemin C, Irion O, Bischof P. 2010. Role of decidua in trophoblastic invasion. Neuro Endocrinol Lett. Apr 29;31(2):193-197. Colige A, Nuytinck L, Hausser I, van Essen AJ, Thiry M, Herens C, Adès LC, Malfait F, Paepe AD, Franck P, Wolff G, Oosterwijk JC, Smitt JH, Lapière CM, Nusgens BV. 2004. Novel types of mutation responsible for the dermatosparactic type of Ehlers-Danlos syndrome (Type VIIC) and common polymorphisms in the ADAMTS2 gene. J Invest Dermatol. Oct;123(4):656-63. Colige A, Sieron AL, Li SW, Schwarze U, Petty E, Wertelecki W, Wilcox W, Krakow D, Cohn DH, Reardon W, Byers PH, Lapière CM, Prockop DJ, Nusgens BV. 1999. Human Ehlers-Danlos syndrome type VII C and bovine dermatosparaxis are caused by mutations in the procollagen I N-proteinase gene. Am J Hum Genet. Aug;65(2):308-17. Colleen C. Nelson, Stephen C. Hendy, Robert J. Shukin, Helen Cheng, Nicholas Bruchovsky, Ben F. Koop, and Paul S. Rennie. 1999. Determinants of DNA Sequence 156  Specificity of the Androgen, Progesterone, and Glucocorticoid Receptors: Evidence for Differential Steroid Receptor Response Elements Mol. Endocrinol. 13: 2090-2107, Collier IE, Wilhelm SM, Eisen AZ, Marmer BL, Grant GA, Seltzer JL, Kronberger A, He CS, Bauer EA, Goldberg GI. 1988. H-ras oncogene-transformed human bronchial epithelial cells (TBE-1) secrete a single metalloprotease capable of degrading basement membrane collagen. J Biol Chem. May 15;263(14):6579-87. Collins-Racie LA, Flannery CR, Zeng W, Corcoran C, Annis-Freeman B, Agostino MJ, Arai M, DiBlasio-Smith E, Dorner AJ, Georgiadis KE, Jin M, Tan XY, Morris EA, LaVallie ER. 2004. ADAMTS-8 exhibits aggrecanase activity and is expressed in human articular cartilage. Matrix Biol. Jul;23(4):219-30. Colorado PC, Torre A, Kamphaus G, Maeshima Y, Hopfer H, Takahashi K, Volk R, Zamborsky ED, Herman S, Sarkar PK, Ericksen MB, Dhanabal M, Simons M, Post M, Kufe DW, Weichselbaum RR, Sukhatme VP, Kalluri R. 2000. Anti-angiogenic cues from vascular basement membrane collagen. Cancer Res. May 1;60(9):2520-6. Coussens LM, Fingleton B, Matrisian LM. 2002. Matrix metalloproteinase inhibitors and cancer: trials and tribulations. Science. Mar 29;295(5564):2387-92. Cox DA, Helvering LM. 2006. Extracellular matrix integrity: a possible mechanism for differential clinical effects among selective estrogen receptor modulators and estrogens? Mol Cell Endocrinol. Mar 9;247(1-2):53-9. Crawford HC, Matrisian LM.1994-1995. Tumor and stromal expression of matrix metalloproteinases and their role in tumor progression. Invasion Metastasis. 14(1-6):234-45. Cross JC, Werb Z, Fisher SJ. 1994. Implantation and the placenta:key pieces of the developmental puzzle. Science 266:1508-1518 Cross N.A., Chandrasekharan S., Jokonya N., et al.. 2005. The expression and regulation of ADAMTS-1, -4, -5, -9, and -15, and TIMP-3 by TGFbeta1 in prostate cells: relevance to the accumulation of versican. Prostate 63, 269-275. Croxatto HB. 2003. Mifepristone for luteal phase contraception. Contraception 68,483–488. Curry TE Jr, Osteen KG. 2003. The matrix metalloproteinase system: changes, regulation, and impact throughout the ovarian and uterine reproductive cycle. Endocr Rev. Aug;24(4):428-65. Curry TE Jr, Osteen KG.2001 Cyclic changes in the matrix metalloproteinase system in the ovary and uterus. Biol Reprod. May;64(5):1285-96.  157  Curtis SW, Clark J, Myers P, Korach KS. 1999. Disruption of estrogen signaling does not prevent progesterone action in the estrogen receptor alpha knockout mouse uterus. Proc Natl Acad Sci U S A. Mar 30;96(7):3646-51. Dai D, Litman ES, Schonteich E, Leslie KK. 2003. Progesterone regulation of activating protein-1 transcriptional activity: a possible mechanism of progesterone inhibition of endometrial cancer cell growth. J Steroid Biochem Mol Biol. Nov;87(2-3):123-31. Dai D, Wolf DM, Litman ES, White MJ, Leslie KK. 2002. Progesterone inhibits human endometrial cancer cell growth and invasiveness: down-regulation of cellular adhesion molecules through progesterone B receptors. Cancer Res 62(3):881–886 Danø K, Behrendt N, Høyer-Hansen G, Johnsen M, Lund LR, Ploug M, Rømer J. 2005. Plasminogen activation and cancer. Thromb Haemost. Apr;93(4):676-81. Review. Dardes RC, O’Reagan RM, Gajdos C, Robinson SP, Bentrem D, De Los Reyes A & Jordan VC. 2002. Effects of a new clinically relevant antiestrogen (GW5638) related to tamoxifen on breast and endometrial cancer growth in vivo. Clinical Cancer Research 8 1995–2001. Das SK. 2009. Cell cycle regulatory control for uterine stromal cell decidualization in implantation. Reproduction. Jun;137(6):889-99. Davies S, Dai D, Wolf DM, Leslie KK. 2004. Immunomodulatory and transcriptional effects of progesterone through progesterone A and B receptors in Hec50co poorly differentiated endometrial cancer cells. J Soc Gynecol Investig11(7):494–499 Delbaldo C, Masouye I, Saurat JH, Vassalli JD, Sappino AP. 1994. Plasminogen activation in melanocytic neoplasia. Cancer Res. Aug 15;54(16):4547-52. Deligdisch L, Cohen CJ. 1985. Histologic correlates and virulence implications of endometrial carcinoma associated with adenomatous hyperplasia. Cancer. Sep 15;56(6):14525. Deligdisch L, Holinka CF. 1986. Progesterone receptors in two groups of endometrial carcinoma. Cancer. Apr 1;57(7):1385-8. Demircan K, Gunduz E, Gunduz M, Beder LB, Hirohata S, Nagatsuka H, Cengiz B, Cilek MZ, Yamanaka N, Shimizu K, Ninomiya Y. 2009. Increased mRNA expression of ADAMTS metalloproteinases in metastatic foci of head and neck cancer. Head Neck. Jun;31(6):793-801. Deryugina EI, Ratnikov BI, Postnova TI, Rozanov DV, Strongin AY. 2002. Processing of integrin alpha(v) subunit by membrane type 1 matrix metalloproteinase stimulates migration of breast carcinoma cells on vitronectin and enhances tyrosine phosphorylation of focal adhesion kinase. J Biol Chem. Mar 22;277(12):9749-56. 158  Dey SK, Lim H, Das SK, Reese J, Paria BC, Daikoku T, Wang H. 2004. Molecular cues in implantation. Endocr Rev 25:341-373. Dey SK. 2010. How we are born. J Clin Invest. Apr;120(4):952-5. Di Cristofano A, Ellenson LH. 2007. Endometrial Carcinoma. Annu. Rev. Pathol. Mech. Dis. 2:57-85 Di Nezza LA, Jobling T, Salamonsen LA. 2003. Progestin suppresses matrix metalloproteinase production in endometrial cancer. Gynecol Oncol 89(2):325–333 Donaghay M, Lessey BA. 2007. Uterine receptivity: alterations associated with benign gynecological disease. Semin Reprod Med. Nov;25(6):461-75. Dong P, Xu Z, Jia N, Li D, Feng Y. 2009. Elevated expression of p53 gain-of-function mutation R175H in endometrial cancer cells can increase the invasive phenotypes by activation of the EGFR/PI3K/AKT pathway. Mol Cancer. Nov 16;8:103. Dostert A, Heinzel T. 2004. Negative glucocorticoid receptor response elements and their role in glucocorticoid action. Curr Pharm Des. 10(23):2807-16. Doyle KM, Russell DL, Sriraman V, Richards JS. 2004. Coordinate transcription of the ADAMTS-1 gene by luteinizing hormone and progesterone receptor. Mol Endocrinol. Oct;18(10):2463-78. Driscoll MD, Sathya G, Muyan M, Klinge CM, Hilf R and Bambara RA. 1998. Sequence requirements for estrogen receptor binding to estrogen response elements. J. Biol. Chem., 273, 29321–29330. Du XL, Jiang T, Wen ZQ, Li QS, Gao R, Wang F. 2009. Differential expression profiling of gene response to ionizing radiation in two endometrial cancer cell lines with distinct radiosensitivities. Oncol Rep. Mar;21(3):625-34. Duffy MJ, Lynn DJ, Lloyd AT, O'Shea CM. 2003. The ADAMs family of proteins: from basic studies to potential clinical applications. Thromb Haemost 89:622–31. Duggan C, Maguire T, McDermott E, O'Higgins N, Fennelly JJ, Duffy MJ. 1995. Urokinase plasminogen activator and urokinase plasminogen activator receptor in breast cancer. Int J Cancer. 1995 May 29;61(5):597-600. Dunn JR, Panutsopulos D, Shaw MW, Heighway J, Dormer R, Salmo EN, Watson SG, Field JK, Liloglou T. 2004. METH-2 silencing and promoter hypermethylation in NSCLC. Br J Cancer 2004;96:1149–1154.  159  Dunn JR, Reed JE, du Plessis DG, Shaw EJ, Reeves P, Gee AL, Warnke P, Walker C. 2006. Expression of ADAMTS-8, a secreted protease with antiangiogenic properties, is downregulated in brain tumours. Br J Cancer. Apr 24;94(8):1186-93. Eckmann KR, Kockler DR. 2009. Aromatase inhibitors for ovulation and pregnancy in polycystic ovary syndrome. Ann Pharmacother. Jul;43(7):1338-46. Edwards DR, Handsley MM, Pennington CJ. 2008. The ADAM metalloproteinases. Mol Aspects Med 29:258–89. Ee PL, Kamalakaran S, Tonetti D, He X, Ross DD, Beck WT. 2004. Identification of a novel estrogen response element in the breast cancer resistance protein (ABCG2) gene. Cancer Res. Feb 15;64 (4):1247-51. Egeblad M, Werb Z. 2002. New functions for the matrix metalloproteinases in cancer progression. Nat Rev Cancer. Mar;2(3):161-74. Eissa S, Shabayek MI, Ismail MF, El-Allawy RM, Hamdy MA. 2010. iagnostic evaluation of apoptosis inhibitory gene and tissue inhibitor matrix metalloproteinase-2 in patients with bladder cancer. IUBMB Life. May;62(5):394-9. Elger W, Bartley J, Schneider B, Kaufmann G, Schubert G, Chwalisz K. 2000. Endocrine pharmacological characterization of progesterone antagonists and progesterone receptor modulators with respect to PR-agonistic and antagonistic activity. Steroids. OctNov;65(10-11):713-23. Emons G, Fleckenstein G, Hinney B, Huschmand A, Heyl W. 2000. Hormonal interactions in endometrial cancer. Endocr Relat Cancer. Dec;7(4):227-42. Review. Espey LL, Yoshioka S, Russell DL, Robker RL, Fujii S, Richards JS. 2000. Ovarian expression of a disintegrin and metalloproteinase with thrombospondin motifs during ovulation in the gonadotropin-primed immature rat. Biol Reprod. Apr;62(4):1090-5. Esteller M, Catasus L, Matias-Guiu X, Mutter GL, Prat J, Baylin SB, Herman JG. 1999. hMLH1 promoter hypermethylation is an early event in human endometrial tumorigenesis. Am J Pathol 155:1767–72. Esteller M, Levine R, Baylin SB, Ellenson LH, Herman JG. 1998. MLH1 promoter hypermethylation is associated with the microsatellite instability phenotype in sporadic endometrial carcinomas. Oncogene 17:2413–7. Eulalio, A.; Huntzinger, E.; Nishihara, T.; Rehwinkel, J.; Fauser, M.; Izaurralde, E. 2009. Deadenylation is a widespread effect of miRNA regulation. RNA January; 15(1): 21– 32.  160  Farnell YZ, Ing NH. 2003. The effects of estradiol and selective estrogen receptor modulators on gene expression and messenger RNA stability in immortalized sheep endometrial stromal cells and human endometrial adenocarcinoma cells. J Steroid Biochem Mol Biol. Mar;84(4):453-61. Fata JE, Ho AT, Leco KJ, Moorehead RA, Khokha R. 2000. Cellular turnover and extracellular matrix remodeling in female reproductive tissues: functions of metalloproteinases and their inhibitors. Cell Mol Life Sci. Jan 20;57(1):77-95. Fazleabas AT, Kim JJ, Strakova Z. 2004. Implantation: embryonic signals and the modulation of the uterine environment--a review. Placenta. Apr;25 Suppl A:S26-31. Fernandez SV, Russo IH, Russo J. 2006. Estradiol and its metabolites 4-hydroxyestradiol and 2-hydroxyestradiol induce mutations in human breast epithelial cells, Int. J. Cancer 118 1862–1868. Fernandez-Shaw S, Shorter SC, Naish CE, Barlow DH, Starkey PM. 1992. lation and purification of human endometrial stromal and glandular cells using immunomagnetic microspheres. Hum Reprod. Feb;7(2):156-61 Ferreira AM, Westers H, Albergaria A, Seruca R, Hofstra RM. 2009. Estrogens, MSI and Lynch syndrome-associated tumors. Biochim Biophys Acta. Dec;1796(2):194-200 Fessler JH, Kramerova I, Kramerov A, Chen Y, Fessler LI. 2004. Papilin, a novel component of basement membranes, in relation to ADAMTS metalloproteases and ECM development. Int J Biochem Cell Biol. Jun;36(6):1079-84. Festuccia, C., Dolo, V., Guerra, F., Violini, S., Muzi, P., Pavan, A., and Bolgna, M. 1998.. Plasminogen activator system modulates invasive capacity and proliferation in prostatic tumor cells. Clin Exp Metastasis 16, 513-28. Figueira RC, Gomes LR, Neto JS, Silva FC, Silva ID, Sogayar MC. 2009. Correlation between MMPs and their inhibitors in breast cancer tumor tissue specimens and in cell lines with different metastatic potential. BMC Cancer. Jan 14;9:20. Fingleton B. 2006.. Matrix metalloproteinases: roles in cancer and metastasis. Front Biosci 11, 479-91. Fisher JL, Field CL, Zhou H, Harris TL, Henderson MA, Choong PF. 2000. Urokinase plasminogen activator system gene expression is increased in human breast carcinoma and its bone metastases--a comparison of normal breast tissue, non-invasive and invasive carcinoma and osseous metastases. Breast Cancer Res Treat. May;61(1):1-12. Florio P, Rossi M, Viganò P, Luisi S, Torricelli M, Torres PB, Di Blasio AM, Petraglia F. 2007. Interleukin 1beta and progesterone stimulate activin a expression and secretion from cultured human endometrial stromal cells. Reprod Sci.Jan;14(1):29-36. 161  Fong KM, Kida Y, Zimmerman PV, Smith PJ. 1996. TIMP1 and adverse prognosis in nonsmall cell lung cancer, Clin Cancer Res, 2(8):1369–1372. Fortune JE, Willis EL, Bridges PJ, Yang CS. 2009. The periovulatory period in cattle: progesterone, prostaglandins, oxytocin and ADAMTS proteases. Anim Reprod. Jan;6(1):6071. Gagne D, Pons M, Philibert D. 1985. RU 38486: a potent antiglucocorticoid in vitro and in vivo. J Steroid Biochem. Sep;23(3):247-51. Gagnon V, Van Themsche C, Turner S, Leblanc V, Asselin E. 2008. Akt and XIAP regulate the sensitivity of human uterine cancer cells to cisplatin, doxorubicin and taxol. Apoptosis. Feb;13(2):259-71. Gambichler T, Kreuter A, Grothe S, Altmeyer P, Brockmeyer NH, Rotterdam S. 2008. Versican overexpression in cutaneous malignant melanoma. Eur J Med Res. Nov 24;13(11):500-4. Gellersen B and Brosens J. 2003. Cyclic AMP and progesterone receptor cross-talk in human endometrium:a decidualizing affair. J Endocrinol 178:357-372. Gendron C, Kashiwagi M, Hughes C, Caterson B, Nagase H. 2003. TIMP-3 inhibits aggrecanase-mediated glycosaminoglycan release from cartilage explants stimulated by catabolic factors. FEBS Lett. Dec 18;555(3):431-6. Geserick C, Meyer HA, Haendler B. 2005. The role of DNA response elements as allosteric modulators of steroid receptor function. Mol Cell Endocrinol. 2005 May 31;236(1-2):1-7. Review. Giaginis C, Nikiteas N, Margeli A, Tzanakis N, Rallis G, Kouraklis G, Theocharis S. 2009. Serum tissue inhibitor of metalloproteinase 1 and 2 (TIMP-1 and TIMP-2) levels in colorectal cancer patients: associations with clinicopathological variables and patient survival. Int J Biol Markers. Oct-Dec;24(4):245-52. Giangrande PH, McDonnell DP. 1999. The A and B isoforms of the human progesterone receptor: two functionally different transcription factors encoded by a single gene. Recent Prog Horm Res.4:291-313; discussion 313-4. Review. Giannelli G, Sgarra C, Di Naro E, Lavopa C, Angelotti U, Tartagni M, Simone O, Trerotoli P, Antonaci S, Loverro G. 2007. Endometriosis is characterized by an impaired localization of laminin-5 and alpha3beta1 integrin receptor. Int J Gynecol Cancer. JanFeb;17(1):242-7. Gielen SC, Burger CW, Kühne LC, Hanifi-Moghaddam P, Blok LJ. 2005. Analysis of estrogen agonism and antagonism of tamoxifen, raloxifene, and ICI182780 in endometrial 162  cancer cells: a putative role for the epidermal growth factor receptor ligand amphiregulin. J Soc Gynecol Investig. Oct;12(7):e55-67. Gielen SC, Hanekamp EE, Hanifi-Moghaddam P, Sijbers AM, van Gool AJ, Burger CW, Blok LJ, Huikeshoven FJ. 2006. Growth regulation and transcriptional activities of estrogen and progesterone in human endometrial cancer cells. Int J Gynecol Cancer. 2006 JanFeb;16(1):110-20. Gielen SC, Santegoets LA, Kühne LC, Van Ijcken WF, Boers-Sijmons B, HanifiMoghaddam P, Helmerhorst TJ, Blok LJ, Burger CW. 2007. Genomic and nongenomic effects of estrogen signaling in human endometrial cells: involvement of the growth factor receptor signaling downstream AKT pathway. Reprod Sci. Oct;14(7):646-54. Gieni RS, Hendzel MJ. 2008. Mechanotransduction from the ECM to the genome: are the pieces now in place? J Cell Biochem. Aug 15;104(6):1964-87. Giudice LC. 2006. Endometrium in PCOS: Implantation and predisposition to endocrine CA. Best Pract Res Clin Endocrinol Metab. Jun;20(2):235-44. Gobello C. 2006. Dopamine agonists, anti-progestins, anti-androgens, long-term-release GnRH agonists and anti-estrogens in canine reproduction: a review. Goffin F, Munaut C, Frankenne F, Perrier D'Hauterive S, Béliard A, Fridman V, Nervo P, Colige A, Foidart JM. 2003. Expression pattern of metalloproteinases and tissue inhibitors of matrix-metalloproteinases in cycling human endometrium. Biol Reprod. Sep;69(3):976-84. Goldman S, Weiss A, Eyali V, Shalev E. 2003. Differential activity of the gelatinases (matrix metalloproteinases 2 and 9) in the fetal membranes and decidua, associated with labour. Mol Hum Reprod. Jun;9(6):367-73. Gomis-Rüth FX. 2003. Structural aspects of the metzincin clan of metalloendopeptidases. Mol Biotechnol. Jun;24(2):157-202. Gonzalez RR, Palomino A, Vantman D, Gabler F, Devoto L. 2001. Abnormal pattern of integrin expression at the implantation window in endometrium from fertile women treated with clomiphene citrate and users of intrauterine device. Early Pregnancy. pr;5(2):132-43. Gouyer V, Conti M, Devos P, Zerimech F, Copin MC, Créme E, Wurtz A, Porte H, Huet G. 2005. Tissue inhibitor of metalloproteinase 1 is an independent predictor of prognosis in patients with nonsmall cell lung carcinoma who undergo resection with curative intent. Cancer. Apr 15;103(8):1676-84. Graham JD, Clarke CL. 1997. Physiological action of progesterone in target tissues. Endocr Rev. Aug;18(4):502-19.  163  Green S, Walter P, Greene G, Krust A, Goffin C, Jensen E, Scrace G, Waterfield M, Chambon P. 1986. Cloning of the human oestrogen receptor cDNA. J Steroid Biochem. Jan;24(1):77-83. Greenberger LM, Annable T, Collins KI, Komm BS, Lyttle CR, Miller CP, Satyaswaroop PG, Zhang Y & Frost P. 2001. A new antiestrogen, 2-(4-hydroxy-phenyl)-3methyl-1- [4-(2-piperidin-1-yl-ethoxy)-benzyl]-1H-indol-5-ol hydrochloride (ERA-923), inhibits the growth of tamoxifen-sensitive and -resistant tumors and is devoid of uterotropic effects in mice and rats. Clinical Cancer Research, 7; 3166–3177. Grignon DJ, Sakr W, Toth M, Ravery V, Angulo J, Shamsa F, Pontes JE, Crissman JC, Fridman R. 1996. High levels of tissue inhibitor of metalloproteinase-2 (TIMP-2) expression are associated with poor outcome in invasive bladder cancer. Cancer Res. Apr 1;56(7):1654-9. Grimes DA, Economy KE. 1995. Primary prevention of gynecologic cancers. Am J Obstet Gynecol. Jan;172(1 Pt 1):227-35. Gustavsson H, Tesan T, Jennbacken K, Kuno K, Damber JE, Welén K. 2010. ADAMTS1 alters blood vessel morphology and TSP1 levels in LNCaP and LNCaP-19 prostate tumors. BMC Cancer. Jun 14;10:288. Hall NG, Klenotic P, Anand-Apte B, Apte SS. 2003. ADAMTSL-3/punctin-2, a novel glycoprotein in extracellular matrix related to the ADAMTS family of metalloproteases. Matrix Biol. Nov;22(6):501-10. Hamano Y, Kalluri R. 2005. Tumstatin, the NC1 domain of alpha3 chain of type IV collagen, is an endogenous inhibitor of pathological angiogenesis and suppresses tumor growth. Biochem Biophys Res Commun. Jul 29;333(2):292-8. Hamilton CA, Cheung MK, Osann K, Chen L, Teng NN, Longacre TA, Powell MA, Hendrickson MR, Kapp DS, Chan JK. 2006. Uterine papillary serious and clear cell carcinomas predict for poorer survival compared to grade 3 endometrioid corpus cancers. Brit I Cancer. 94: 642-646 Hamilton WJ, Grimes DH. 1970. Growth relationship between the foetus and the placenta. Proc R Soc Med. May;63(5):496-8 Hampton AL, Butt AR, Riley SC, Salamonsen LA. 1995. Tissue inhibitors of metalloproteinases in endometrium of ovariectomized steroid-treated ewes and during the estrous cycle and early pregnancy. Biol Reprod. Aug;53(2):302-11 Hampton AL, Salamonsen LA. 1994. Expression of messenger ribonucleic acid encoding matrix metalloproteinases and their tissue inhibitors is related to menstruation. J Endocrinol. Apr;141(1):R1-3  164  Handsley MM, Edwards DR. 2005. Metalloproteinases and their inhibitors in tumor angiogenesis. Int J Cancer. Jul 20;115(6):849-60. Hanekamp EE, Kühne EC, Smid-Koopman E, de Ruiter PE, Chadha-Ajwani S, Brinkmann AO, Burger CW, Grootegoed JA, Huikeshoven FJ, Blok LJ. 2002. Loss of progesterone receptor may lead to an invasive phenotype in human endometrial cancer. Eur J Cancer 38(Suppl 6): S71–S72 Hanekamp EE, Ku¨hne LM, Grootegoed JA, Burger CW, Blok LJ. 2004. Progesterone receptor A and B expression and progestagen treatment in growth and spread of endometrial cancer cells in nude mice. Endocr Relat Cancer 11(4):831–841 Hayes MP, Wang H, Espinal-Witter R, et al. 2006. PIK3CA and PTEN mutations in uterine endometrioid carcinoma and complex atypical hyperplasia. Clin Cancer Res 12:5932– 5. Held-Feindt J, Paredes EB, Blömer U, Seidenbecher C, Stark AM, Mehdorn HM, Mentlein R. 2006. Matrix-degrading proteases ADAMTS4 and ADAMTS5 (disintegrins and metalloproteinases with thrombospondin motifs 4 and 5) are expressed in human glioblastomas, Int. J. Cancer 118 55e61. Helvering LM, Adrian MD, Geiser AG, Estrem ST, Wei T, Huang S, Chen P, Dow ER, Calley JN, Dodge JA, Grese TA, Jones SA, Halladay DL, Miles RR, Onyia JE, Ma YL, Sato M, Bryant HU. 2005. Differential effects of estrogen and raloxifene on messenger RNA and matrix metalloproteinase 2 activity in the rat uterus. Biol Reprod. Apr;72(4):830-41. Hendrix MJ, Seftor EA, Kirschmann DA, Quaranta V, Seftor RE. 2003. Remodeling of the microenvironment by aggressive melanoma tumor cells. Ann N Y Acad Sci. May;995:151-61. Hertig AT. 1967. Human trophoblast: normal and abnormal. A plea for the study of the normal so as to understand the abnormal. Ward Burdick Award Address. Am J Clin Pathol. Mar;47(3):249-68 Hidai C, Kawana M, Kitano H, Kokubun S. 2007. Discoidin domain of Del1 protein contributes to its deposition in the extracellular matrix. Cell Tissue Res. Oct;330(1):83-95. Higuchi T, Kanzaki H, Nakayama H, Fujimoto M, Hatayama H, Kojima K, Iwai M, Mori T, Fujita J. 1995. Induction of tissue inhibitor of metalloproteinase 3 gene expression during in vitro decidualization of human endometrial stromal cells. endocrinology. Nov;136(11):4973-81. Hirata M, Sato T, Tsumagari M, Hashizume K, Ito A. 2003. Discoordinate regulation of expression of matrix metalloproteinases and tissue inhibitor of metalloproteinases-3 in bovine endometrial stromal cells on type-I collagen gel. Biol Pharm Bull. Jul;26(7):1013-7.  165  Hirohata S, Wang LW, Miyagi M, Yan L, Seldin MF, Keene DR, Crabb JW, Apte SS. 2002. Punctin, a novel ADAMTS-like molecule, ADAMTSL-1, in extracellular matrix. J Biol Chem. Apr 5;277(14):12182-9. Hoffman K, Nekhlyudov L, Deligdisch L. 1995. Endometrial carcinoma in elderly women. Gynecol Oncol. Aug;58(2):198-201. Hoffmann B, Schuler G. 2000. Receptor blockers - general aspects with respect to their use in domestic animal reproduction. Anim Reprod Sci. Jul 2;60-61:295-312. Hofmann UB, Eggert AA, Blass K, Bröcker EB, Becker JC. 2005. Stromal cells as the major source for matrix metalloproteinase-2 in cutaneous melanoma. Arch Dermatol Res. Hu XF, Veroni M, De Luise M, Wakeling A, Sutherland R, Watts CK, Zalcberg JR. 1993. Circumvention of tamoxifen resistance by the pure anti-estrogen ICI 182,780. Int J Cancer. 1993 Nov 11;55(5):873-6. Huang K, Wu LD. 2010. Suppression of aggrecanase: a novel protective mechanism of dehydroepiandrosterone in osteoarthritis? Mol Biol Rep. 2010 Mar;37(3):1241-5. Epub 2009 Mar 10. Review. Hurskainen T, Höyhtyä M, Tuuttila A, Oikarinen A, Autio-Harmainen H. 1996. mRNA expressions of TIMP-1, -2, and -3 and 92-KD type IV collagenase in early human placenta and decidual membrane as studied by in situ hybridization.J Histochem Cytochem. Dec;44(12):1379-88. Hurskainen TL, Hirohata S, Seldin MF, Apte SS. 1999. ADAM-TS5, ADAM-TS6, and ADAM-TS7, novel members of a new family of zinc metalloproteases. General features and genomic distribution of the ADAM-TS family. J Biol Chem. Sep 3; 274(36): 25555-25563. Igarashi TM, Bruner-Tran KL, Yeaman GR, Lessey BA, Edwards DP, Eisenberg E, Osteen KG. 2005. Reduced expression of progesterone receptor-B in the endometrium of women with endometriosis and in cocultures of endometrial cells exposed to 2,3,7,8tetrachlorodibenzo-p-dioxin. Fertil Steril. Jul;84(1):67-74. Ikeda M, Kurose A, Takatori E, Sugiyama T, Traganos F, Darzynkiewicz Z, Sawai T. 2010. DNA damage detected with gammaH2AX in endometrioid adenocarcinoma cell lines. Int J Oncol. May;36(5):1081-8. Irwin JC, Kirk D, Gwatkin RB, Navre M, Cannon P, Giudice LC. 1996. Human endometrial matrix metalloproteinase-2, a putative menstrual proteinase. Hormonal regulation in cultured stromal cells and messenger RNA expression during the menstrual cycle. J Clin Invest. Jan 15;97(2):438-47  166  Irwin JC, Kirk D, King RJ, Quigley MM, Gwatkin RB. 1989. Hormonal regulation of human endometrial stromal cells in culture: an in vitro model for decidualization. Fertil Steril 52:761-768. Ishikawa T, Harada T, Kubota T, Aso T. 2007. Testosterone inhibits matrix metalloproteinase-1 production in human endometrial stromal cells in vitro. Reproduction. Jun;133(6):1233-9. Ito K, Utsunomiya H, Suzuki T, Saitou S, Akahira J, Okamura K, Yaegashi N, Sasano H. 2006. 17Beta-hydroxysteroid dehydrogenases in human endometrium and its disorders. Mol Cell Endocrinol. Mar 27;248(1-2):136-40. Iwahashi M, Ooshima A, Nakano R. 1996. Increase in the relative level of type V collagen during development and ageing of the placenta. J Clin Pathol. 1996 Nov;49(11):916-9. Jahn E, Classen-Linke I, Kusche M, Beier HM, Traub O, Grümmer R, Winterhager E. 1995. Expression of gap junction connexins in the human endometrium throughout the menstrual cycle. Hum Reprod. Oct;10(10):2666-70. Jemal A, Murray T, Ward E, Samuels A, Tiwari RC, Ghafoor A, Feuer EJ & Thun MJ. 2005. Cancer statistics, CA:A Cancer Journal for Clinicians 55 10–30. Jemal A, Siegel R, Ward E, et al. 2008. Cancer statistics, 2008. CA Cancer J Clin 58:71–96. Jezierska A, Motyl T. 2009. Matrix metalloproteinase-2 involvement in breast cancer progression: a mini-review. Med Sci Monit. Feb;15(2):RA32-40. Jeziorska M, Nagase H, Salamonsen LA, Woolley DE. 1996. Immunolocalization of the matrix metalloproteinases gelatinase B and stromelysin 1 in human endometrium throughout the menstrual cycle. J Reprod Fertil. May;107(1):43-51 Jia MC, Schwartz MA, Sang QA. 2000. Suppression of human microvascular endothelial cell invasion and morphogenesis with synthetic matrixin inhibitors. Targeting angiogenesis with MMP inhibitors.Adv Exp Med Biol. 476:181-94. Jinga DC, Blidaru A, Condrea I, Ardeleanu C, Dragomir C, Szegli G, Stefanescu M, Matache C. 2006. MMP-9 and MMP-2 gelatinases and TIMP-1 and TIMP-2 inhibitors in breast cancer: correlations with prognostic factors. J Cell Mol Med. Apr-Jun;10(2):499-510. Jodele S, Blavier L, Yoon JM, DeClerck YA. 2006. Modifying the soil to affect the seed: role of stromal-derived matrix metalloproteinases in cancer progression. Cancer Metastasis Rev. Mar;25(1):35-43. John H. Fessler, Irina Kramerova, Andrei Kramerov, Yali Chen, Liselotte I. Fessler JH. 2004. Papilin, a novel component of basement membranes, in relation to ADAMTS metalloproteases and ECM development Int J Biochem Cell Biol. Jun;36(6):1079-84. 167  Jokimaa V, Oksjoki S, Kujari H, Vuorio E, Anttila L. 2002. Altered expression of genes involved in the production and degradation of endometrial extracellular matrix in patients with unexplained infertility and recurrent miscarriages. Mol Hum Reprod. Dec;8(12):1111-6. Jönsson-Rylander AC, Nilsson T, Fritsche-Danielson R, Hammarström A, Behrendt M, Andersson JO, Lindgren K, Andersson AK, Wallbrandt P, Rosengren B, Brodin P, Thelin A, Westin A, Hurt-Camejo E, Lee-Søgaard CH. 2005. Role of ADAMTS-1 in atherosclerosis: remodeling of carotid artery, immunohistochemistry, and proteolysis of versican. Arterioscler Thromb Vasc Biol. Jan;25(1):180-5. Jordan VC. 1995. Tamoxifen and tumorigenicity: a predictable concern. J Natl Cancer Inst. 1995 May 3;87(9):623-6. Judd H.L.and Yen S.S.C. 1973. Serum Androstenedione and Testosterone Levels During the Menstrual J. Clin. Endocrinol. Metab. 36: 475-481, doi: 10.1210/jcem-36-3-475 Jungers KA, Le Goff C, Somerville RP, Apte SS. 2005. Adamts9 is widely expressed during mouse embryo development. Gene Expr Patterns. Jun;5(5):609-17. Kaaks R, Lukanova A, Kurzer MS. 2002. Obesity, endogenous hormones, and endometrial cancer risk: a synthetic review. Cancer Epidemiol. Biomarkers Prev. 11:1531–43 Kahn J, Mehraban F, Ingle G, Xin X, Bryant JE, Vehar G, Schoenfeld J, Grimaldi CJ, Peale F, Draksharapu A, Lewin DA, Gerritsen ME. 2000. Gene expression profiling in an in vitro model of angiogenesis. Am J Pathol. Jun;156(6):1887-900. Kamel RM. 2010. Management of the infertile couple: an evidence-based protocol Reproductive Biology and Endocrinology 8:21 Kamphaus GD, Colorado PC, Panka DJ, Hopfer H, Ramchandran R, Torre A, Maeshima Y, Mier JW, Sukhatme VP, Kalluri R. 2000. Canstatin, a novel matrix-derived inhibitor of angiogenesis and tumor growth.J Biol Chem. Jan 14;275(2):1209-15. Karmakar S, Das C. 2002. Regulation of trophoblast invasion by IL-1beta and TGF-beta1. Am J Reprod Immunol. Oct;48(4):210-9 Kashiwagi M, Enghild JJ, Gendron C, Hughes C, Caterson B, Itoh Y, Nagase H. 2004. Altered proteolytic activities of ADAMTS-4 expressed by C-terminal processing J Biol Chem. Mar 12;279(11):10109-19. Kashiwagi M, Tortorella M, Nagase H, Brew K. 2001. TIMP-3 is a potent inhibitor of aggrecanase 1 (ADAM-TS4) and aggrecanase 2 (ADAM-TS5) J Biol Chem. Apr 20;276(16):12501-4..  168  Kastner P, Krust A, Turcotte B, Stropp U, Tora L, Gronemeyer H, Chambon P. 1990. Two distinct estrogen-regulated promoters generate transcripts encoding the two functionally different human progesterone receptor forms A and B. EMBO J. May;9(5):1603-14. Kato S., Tora L., Yamauchi J., Masushige S., Ikllard M. and Chambon P. 1992. A far upstream estrogen response element of the ovalbumin gene contains several halfpalindromic 5'-TGACC-Y motifs acting synergistically. Cell 68; 731-742. Katoh M. 2003. Expression and regulation of WNT1 in human cancer:up-regulation of WNT1 by beta-estradiol in MCF-7 cells, Int. J. Oncol. 22 209–212. Katzenellenbogen BS, Choi I, Delage-Mourroux R, Ediger TR, Martini PG, Montano M, Sun J, Weis K, Katzenellenbogen JA. 2000. Molecular mechanisms of estrogen action: selective ligands and receptor pharmacology. J Steroid Biochem Mol Biol. Nov 30;74(5):27985. Katzenellenbogen BS. 2000. Mechanisms of Action and Cross-Talk Between Estrogen Receptor and Progesterone Receptor Pathways J Soc Gynecol Investig Vol. 7, No. 1 (Supplement), Jan./Feb. Kearns M, Lala PK. 1982. Bone marrow origin of decidual cell precursors in the pseudopregnant mouse uterus.J Exp Med. May 1;155(5):1537-54. Kenneth JL and Thomas DS. 2001. Analysis of Relative Gene Expression Data Using RealTime Quantitative PCR and the 2−∆∆CT Method. Methods. Dec;25(4):402-8 Kessenbrock K, Plaks V, Werb Z. 2010. Matrix metalloproteinases: regulators of the tumor microenvironment. Cell. Apr 2;141(1):52-67. Kim J, Kim H, Lee SJ, Choi YM, Lee SJ, Lee JY. 2005. Abundance of ADAM-8, -9, -10, 12, -15 and -17 and ADAMTS-1 in mouse uterus during the oestrous cycle. Reprod Fertil Dev. 17(5):543-55. Kim JJ, Chapman-Davis E. 2010. Role of progesterone in endometrial cancer. Semin Reprod Med. Jan;28(1):81-90. Epub 2010 Jan 26. Kinder DH, Berger MS, Mueller BA, Silber JR. 1993. Urokinase plasminogen activator is elevated in human astrocytic gliomas relative to normal adjacent brain. Oncol Res. 5(1011):409-14. Kinga A and Lokea YW. 1991. On the nature and function of human uterine granular lymphocytes. Immunology Today Volume 12, Issue 12, Dec 432-435 Kisalus LL, Herr JC, Little CD. 1987 Immunolocalization of extracellular matrix proteins and collagen synthesis in first-trimester human decidua. Anat Rec. Aug;218(4):402-15  169  Kischel P, Waltregny D, Dumont B, Turtoi A, Greffe Y, Kirsch S, De Pauw E, Castronovo V. 2010. Versican overexpression in human breast cancer lesions: known and new isoforms for stromal tumor targeting. Int J Cancer. 2010 Feb 1;126(3):640-50. Klaus C, Plaimauer B, Studt JD, Dorner F, Lämmle B, Mannucci PM, Scheiflinger F. 2004. Epitope mapping of ADAMTS13 autoantibodies in acquired thrombotic thrombocytopenic purpura. Blood. Jun 15;103(12):4514-9 Klein-Hitpass L, Ryffel GU, Heitlinger E and Cato AC. 1988. A 13 bp palindrome is a functional estrogen responsive element and interacts specifically with estrogen receptor. Nucleic Acids Res., 16, 647–663. Klinge CM, Traish AM, Bambara RA and Hilf R. 1996. Dissociation of 4hydroxytamoxifen, but not estradiol or tamoxifen aziridine, from the estrogen receptor when the receptor binds estrogen response element DNA. J. Steroid Biochem. Mol. Biol., 57, 51– 66. Klinge CM. 2000. Estrogen receptor interaction with co-activators and co-repressors. Steroids, 65, 227–251. Klinge CM. 2001. Estrogen receptor interaction with estrogen response elements Nucleic Acids Research Vol. 29, No. 14 2905-2919 Kodama J, Hasengaowa, Kusumoto T, Seki N, Matsuo T, Ojima Y, Nakamura K, Hongo A, Hiramatsu Y. 2007. Prognostic significance of stromal versican expression in human endometrial cancer. Ann Oncol. Feb;18(2):269-74. Koh SC, Wong PC, Yuen R, Chua SE, Ng BL, Ratnam SS. 1992. Concentration of plasminogen activators and inhibitor in the human endometrium at different phases of the menstrual cycle. J Reprod Fertil. Nov;96(2):407-13. Kokorine I, Marbaix E, Henriet P, Okada Y, Donnez J, Eeckhout Y, Courtoy PJ. 1996 Focal cellular origin and regulation of interstitial collagenase (matrix metalloproteinase-1) are related to menstrual breakdown in the human endometrium. J Cell Sci. Aug;109 ( Pt 8):215160 Konac E, Alp E, Onen HI, Korucuoglu U, Biri AA, Menevse S. 2009. Endometrial mRNA expression of matrix metalloproteinases, their tissue inhibitors and cell adhesion molecules in unexplained infertility and implantation failure patients. Reprod Biomed Online. Sep;19(3):391-7. Koo BH, Coe DM, Dixon LJ, Somerville RP, Nelson CM, Wang LW, Young ME, Lindner DJ, Apte SS. 2010. ADAMTS9 is a cell-autonomously acting, anti-angiogenic metalloprotease expressed by microvascular endothelial cells Am J Pathol. Mar;176(3):1494504.  170  Koo BH, Oh D, Chung SY, Kim NK, Park S, Jang Y, Chung KH. 2002. Deficiency of von Willebrand factor- cleaving protease activity in the plasma of malignant patients, Thromb. Res. 105 471e476. Koshikawa N, Minegishi T, Sharabi A, Quaranta V, Seiki M. 2005. Membrane-type matrix metalloproteinase-1 (MT1-MMP) is a processing enzyme for human laminin gamma 2 chain. J Biol Chem. Jan 7;280(1):88-93 Koshikawa N, Mizushima H, Minegishi T, Iwamoto R, Mekada E, Seiki M. 2010. Membrane Type 1-Matrix Metalloproteinase Cleaves Off the NH2-Terminal Portion of Heparin-Binding Epidermal Growth Factor and Converts It into a Heparin-Independent Growth Factor. Cancer Res. Jun 29. Kramerova IA, Kawaguchi N, Fessler LI, Nelson RE, Chen Y, Kramerov AA, KuscheGullberg M, Kramer JM, Ackley BD, Sieron AL, Prockop DJ, Fessler JH. 2000. Papilin in development; a pericellular protein with a homology to the ADAMTS metalloproteinases. Development. Dec;127(24):5475-85. Kresse H, Schönherr E. 2001. Proteoglycans of the extracellular matrix and growth control. J Cell Physiol. Dec;189(3):266-74. Review. Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA. 1996. Cloning of a novel receptor expressed in rat prostate and ovary.Proc Natl Acad Sci U S A. Jun 11;93(12):5925-30. Kuno K, Iizasa H, Ohno S, Matsushima K. 1997b. The exon/intron organization and chromosomal mapping of the mouse ADAMTS-1 gene encoding an ADAM family protein with TSP motifs. Genomics. Dec 15;46(3):466-71. Kuno K, Kanada N, Nakashima E, Fujiki F, Ichimura F, Matsushima K. 1997a. Molecular cloning of a gene encoding a new type of metalloproteinase-disintegrin family protein with thrombospondin motifs as an inflammation associated gene. J Biol Chem. Jan 3;272(1):556-62. Kuno K, Matsushima K. 1998. ADAMTS-1 protein anchors at the extracellular matrix through the thrombospondin type I motifs and its spacing region. J Biol Chem. May 29;273(22):13912-7. Kuno K, Okada Y, Kawashima H, Nakamura H, Miyasaka M, Ohno H, Matsushima K. 2000. ADAMTS-1 cleaves a cartilage proteoglycan, aggrecan. FEBS Lett. Aug 4;478(3):2415. Kuno K, Terashima Y, Matsushima K. 1999. ADAMTS-1 is an active metalloproteinase associated with the extracellular matrix. J Biol Chem. Jun 25;274(26):18821-6.  171  Kuramoto H, Tamura S, Notake Y. 1972. Establishment of a cell line of human endometrial adenocarcinoma in vitro. Am J Obstet Gynecol 114: 1012–1019. Lala PK, Kearns M, Colavincenzo V. 1984. Cells of the fetomaternal interface: their role in the maintenance of viviparous pregnancy. Am J Anat. Jul;170(3):501-17 Lala PK, Kearns M. 1985. Immunobiology of the decidual tissue. Contrib Gynecol Obstet. 14:1-15. Lamian V, Gonzalez BY, Michel FJ, Simmen RC. 1993 Non-consensus progesterone response elements mediate the progesterone-regulated endometrial expression of the uteroferrin gene. J Steroid Biochem Mol Biol. Oct;46(4):439-50. Lawler J, Detmar M. 2004. Tumor progression: the effects of thrombospondin-1 and -2. Int J Biochem Cell Biol. 2004 Jun;36(6):1038-45. Review. Lawler J. 2000. the function of thrombospondin-1 and -2, Curr. Opin. Cell Biol. 12 634-640 Lawn AM, Wilson EW, Finn CA. 1971. The ultrastructure of human decidual and predecidual cells.J Reprod Fertil. Jul;26(1):85-90. Lax SF, Kurman RJ. 1997. A dualistic model for endometrial carcinogenesis based on immunohistochemical and molecular genetic analyses. Verh Dtsch Ges Path 81:228–32. Lee S, Jilani SM, Nikolova GV, Carpizo D, Iruela-Arispe ML. 2005. Processing of VEGFA by matrix metalloproteinases regulates bioavailability and vascular patterning in tumors. J Cell Biol. May 23;169(4):681-91. Leiser R, Kaufmann P. 1994. Placental structure: in a comparative aspect. Exp Clin Endocrinol. 102(3):122-34 Lenting PJ, Pegon JN, Groot E, de Groot PG. 2010. Regulation of von Willebrand factorplatelet interactions. Thromb Haemost. Jun 10;104(3). Lessey BA, Castelbaum AJ, Buck CA, Lei Y, Yowell CW, Sun J. 1994. Further characterization of endometrial integrins during the menstrual cycle and in pregnancy. Fertil Steril. Sep;62(3):497-506. Lessey BA, Ilesanmi AO, Castelbaum AJ, Yuan LW, Somkuti SG, Satyaswaroop PG, Chwalisz K. 1996. Characterization of the functional progesterone receptor in an endometrial adenocarcinoma cell line (Ishikawa): progesterone-induced expression of the a1 integrin. J Steroid Biochem Mol Biol 59:31–39. Lessey BA. 1998. Endometrial integrins and the establishment of uterine receptivity. Hum Reprod. Jun;13 Suppl 3:247-58; discussion 259-61. Review  172  Lessey BA. 2000. Endometrial receptivity and the window of implantation.Baillieres Best Pract Res Clin Obstet Gynaecol. Oct;14(5):775-88. Review. Lessey BA. 2002. Adhesion molecules and implantation. J Reprod Immunol. May-Jun;55(12):101-12. Lessey BA. 2003. Two pathways of progesterone action in the human endometrium: implications for implantation and contraception. Steroids. Nov;68(10-13):809-15. Levine M, Manley JL. 1989. Transcriptional repression of eukarvotic promoters Cell 59; 405-8 Levy GG, Nichols WC, Lian EC, Foroud T, McClintick JN, McGee BM, Yang AY, Siemieniak DR, Stark KR, Gruppo R, Sarode R, Shurin SB, Chandrasekaran V, Stabler SP, Sabio H, Bouhassira EE, Upshaw JD Jr, Ginsburg D, Tsai HM. 2001. Mutations in a member of the ADAMTS gene family cause thrombotic thrombocytopenic purpura. Nature. Oct 4;413(6855):488-94 Levy N, Zhao X, Tang H, Jaffe RB, Speed TP, Leitman DC. 2007. Multiple transcription factor elements collaborate with estrogen receptor alpha to activate an inducible estrogen response element in the NKG2E gene. Endocrinology. Jul;148(7):3449-58 Li BH, Zhao P, Liu SZ, Yu YM, Han M, Wen JK. 2005. Matrix metalloproteinase-2 and tissue inhibitor of metallo-proteinase-2 in colorectal carcinoma invasion and metastasis. World J Gastroenterol. May 28;11(20):3046-50. Li SW, Arita M, Fertala A, Bao Y, Kopen GC, Långsjö TK, Hyttinen MM, Helminen HJ, Prockop DJ. 2001. Transgenic mice with inactive alleles for procollagen N-proteinase (ADAMTS-2) develop fragile skin and male sterility.Biochem J. Apr 15;355(Pt 2):271-8 Liehr JG. 2000. Role of DNA adducts in hormonal carcinogenesis, Regul. Toxicol. Pharmacol. 32 276–282 Lindenberg S. 1991. Experimental studies on the initial trophoblast endometrial interaction. Dan Med Bull. Oct;38(5):371-80 Lindzey J, Kumar MV, Grossman M, Young C, Tindall DJ. 1994. Molecular mechanisms of androgen action. Vitam Horm. 49:383-432. Review. Ling S, Dai A, Williams MR, Myles K, Dilley RJ, Komesaroff PA, Sudhir K. 2002. Testosterone (T) enhances apoptosis-related damage in human vascular endothelial cells. Endocrinology. Mar;143(3):1119-25. Liotta LA, Thorgeirsson UP, Garbisa S. 1982. Role of collagenases in tumor cell invasion. Cancer Metastasis Rev. 1(4):277-88.  173  Liu CJ, Kong W, Ilalov K, Yu S, Xu K, Prazak L, Fajardo M, Sehgal B, Di Cesare PE. 2006b. ADAMTS-7: a metalloproteinase that directly binds to and degrades cartilage oligomeric matrix protein. FASEB J. May;20(7):988-90. Liu CJ, Kong W, Xu K, Luan Y, Ilalov K, Sehgal B, Yu S, Howell RD, Di Cesare PE. 2006a. ADAMTS-12 associates with and degrades cartilage oligomeric matrix protein. J Biol Chem. Jun 9;281(23):15800-8. Liu DF, Rabbani SA. 1995. Induction of urinary plasminogen activator by retinoic acid results in increased invasiveness of human prostate cancer cells PC-3.Prostate. Nov;27(5):269-76. Liu YJ, Xu Y, Yu Q. 2006. Full-length ADAMTS-1 and the ADAMTS-1 fragments display pro- and antimetastatic activity, respectively. Oncogene. Apr 20;25(17):2452-67. Llamazares M, Cal S, Quesada V, López-Otín C. 2003. Identification and characterization of ADAMTS-20 defines a novel subfamily of metalloproteinases-disintegrins with multiple thrombospondin-1 repeats and a unique GON domain. J Biol Chem. Apr 11;278(15):13382-9. Epub 2003 Jan 31. Llobet D, Pallares J, Yeramian A, Santacana M, Eritja N, Velasco A, Dolcet X, MatiasGuiu X. 2009. Molecular pathology of endometrial carcinoma: practical aspects from the diagnostic and therapeutic viewpoints J Clin Pathol 62: 777-785 Llobet D, Pallares J, Yeramian A, Santacana M, Eritja N, Velasco A, Dolcet X, MatiasGuiu X. 2009. Molecular pathology of endometrial carcinoma: practical aspects from the diagnostic and therapeutic viewpoints. J Clin Pathol. Sep;62(9):777-85. Lo PH, Lung HL, Cheung AK, Apte SS, Chan KW, Kwong FM, Ko JM, Cheng Y, Law S, Srivastava G, Zabarovsky ER, Tsao SW, Tang JC, Stanbridge EJ, Lung ML. 2010. Extracellular protease ADAMTS9 suppresses esophageal and nasopharyngeal carcinoma tumor formation by inhibiting angiogenesis. Cancer Res. Jul 1;70(13):5567-76.. Longacre TA, Chung MH, Jensen DN, Hendrickson MR.1995. Proposed criteria for the diagnosis of well-differentiated endometrial carcinoma. A diagnostic test for myoinvasion. Am J Surg Pathol. Apr;19(4):371-406. Lovely LP, Appa Rao KB, Gui Y, Lessey BA. 2000. Characterization of androgen receptors in a well-differentiated endometrial adenocarcinoma cell line (Ishikawa). J Steroid Biochem Mol Biol 74:235–241. Lu X, Wang Q, Hu G, Van Poznak C, Fleisher M, Reiss M, Massagué J, Kang Y. 2009. ADAMTS1 and MMP1 proteolytically engage EGF-like ligands in an osteolytic signaling cascade for bone metastasis.Genes Dev. Aug 15;23(16):1882-94.  174  Lubahn DB, Moyer JS, Golding TS, Couse JF, Korach KS, Smithies O. 1993. Alteration of reproductive function but not prenatal sexual development after insertional disruption of the mouse estrogen receptor gene.Proc Natl Acad Sci U S A. Dec 1;90(23):11162-6. Lund LR, Rømer J, Rønne E, Ellis V, Blasi F, Danø K. 1991. Urokinase-receptor biosynthesis, mRNA level and gene transcription are increased by transforming growth factor beta 1 in human A549 lung carcinoma cells. EMBO J. Nov;10(11):3399-407. Lung HL, Lo PH, Xie D, Apte SS, Cheung AK, Cheng Y, Law EW, Chua D, Zeng YX, Tsao SW, Stanbridge EJ, Lung ML. 2008. Characterization of a novel epigeneticallysilenced, growth-suppressive gene, ADAMTS9, and its association with lymph node metastases in nasopharyngeal carcinoma. Int J Cancer. Jul 15;123(2):401-8. Luo JH, Yu YP, Cieply K, Lin F, Deflavia P, Dhir R, Finkelstein S, Michalopoulos G, Becich M. 2002. Gene expression analysis of prostate cancers. Mol Carcinog. Jan;33(1):2535. Lydon JP, DeMayo FJ, Funk CR, Mani SK, Hughes AR, Montgomery CA Jr, Shyamala G, Conneely OM, O'Malley BW. 1995. Mice lacking progesterone receptor exhibit pleiotropic reproductive abnormalities.Genes Dev. Sep 15;9(18):2266-78. . Madan P, Bridges PJ, Komar CM, Beristain AG, Rajamahendran R, Fortune JE, MacCalman CD. 2003. Expression of messenger RNA for ADAMTS subtypes changes in the periovulatory follicle after the gonadotropin surge and during luteal development and regression in cattle. Biol Reprod. Nov;69(5):1506-14. Maeshima Y, Manfredi M, Reimer C, Holthaus KA, Hopfer H, Chandamuri BR, Kharbanda S, Kalluri R. 2001. Identification of the anti-angiogenic site within vascular basement membrane-derived tumstatin.J Biol Chem. May 4;276(18):15240-8. Maeshima Y, Sudhakar A, Lively JC, Ueki K, Kharbanda S, Kahn CR, Sonenberg N, Hynes RO, Kalluri R. 2002. Tumstatin, an endothelial cell-specific inhibitor of protein synthesis. Science. Jan 4;295(5552):140-3. Makihira S, Yan W, Murakami H, Furukawa M, Kawai T, Nikawa H, Yoshida E, Hamada T, Okada Y, Kato Y. 2003. Thyroid hormone enhances aggrecanase-2/ADAMTS5 expression and proteoglycan degradation in growth plate cartilage. Endocrinology. Jun;144(6):2480-8. Mannello F and Gazzanelli G. 2001. Tissue inhibitors of metalloproteinases and programmed cell death: conundrums, controversies and potential implications, Apoptosis, 6(6):479–482. Marbaix E, Kokorine I, Henriet P, Donnez J, Courtoy PJ, Eeckhout Y. 1995. The expression of interstitial collagenase in human endometrium is controlled by progesterone and by oestradiol and is related to menstruation. Biochem J. Feb 1;305 ( Pt 3):1027-30. 175  Martin JA, Hamilton BE, Sutton PD, Ventura SJ, Menacker F, Kirmeyer S, Munson ML; Centers for Disease Control and Prevention National Center for Health Statistics National Vital Statistics System. 2007. Births: final data for 2005. Natl Vital Stat Rep. Dec 5;56(6):1-103. Martin JA, Hamilton BE, Sutton PD, Ventura SJ, Menacker F, Kirmeyer S. 2006. Births: final data for 2004.Natl Vital Stat Rep. Sep 29;55(1):1-101. Maruyama T, Yoshimura Y. 2008. Molecular and cellular mechanisms for differentiation and regeneration of the uterine endometrium. Endocr J55(5):795–810 Maslar IA, Riddick DH. 1979. Prolactin production by human endometrium during the normal menstrual cycle.Am J Obstet Gynecol.Nov 15;135(6):751-4. Masui T, Hosotani R, Tsuji S, Miyamoto Y, Yasuda S, Ida J, Nakajima S, Kawaguchi M, Kobayashi H, Koizumi M, Toyoda E, Tulachan S, Arii S, Doi R, Imamura M. 2001. Expression of METH-1 and METH-2 in pancreatic cancer. Clin Cancer Res 7:3437–3443. Matias-Guiu X, Catasus L, Bussaglia E, Lagarda H, Garcia A, Pons C, Muñoz J, Argüelles R, Machin P, Prat J. 2001. Molecular pathology of endometrial hyperplasia and carcinoma. Hum Pathol;32:569–77. Matthews RT, Gary SC, Zerillo C, Pratta M, Solomon K, Arner EC, Hockfield S. 2000. Brain-enriched hyaluronan binding (BEHAB)/brevican cleavage in a glioma cell line is mediated by a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS) family member. J Biol Chem. Jul 28;275(30):22695-703. Maxwell GL, Chandramouli GV, Dainty L, et al. 2005. Microarray analysis of endometrial carcinomas and mixed mullerian tumors reveals distinct gene expression profiles associated with different histologic types of uterine cancer. Clin Cancer Res 2005;11:4056–66. McMahon B, Kwaan HC. 2008. The plasminogen activator system and cancer. Pathophysiol Haemost Thromb. 36(3-4):184-94. Meissauer A, Kramer MD, Hofmann M, Erkell LJ, Jacob E, Schirrmacher V, Brunner G. 1991. Urokinase-type and tissue-type plasminogen activators are essential for in vitro invasion of human melanoma cells. Exp Cell Res. Feb;192(2):453-9. Mekkawy AH, Morris DL, Pourgholami MH. 2009. Urokinase plasminogen activator system as a potential target for cancer therapy. Future Oncol. Nov;5(9):1487-99. Review. Mertens H, Heineman MJ, Theunissen P, De Jong FH, Evers JLH. 2001 Androgen, estrogen and progesterone receptor expression in the human uterus during the menstrual cycle. Eur J Obstet Gynecol Reprod Biol 98:58-65  176  Miles RR, Sluka JP, Halladay DL, Santerre RF, Hale LV, Bloem L, Thirunavukkarasu K, Galvin RJ, Hock JM, Onyia JE. 2000. ADAMTS-1: A cellular disintegrin and metalloprotease with thrombospondin motifs is a target for parathyroid hormone in bone. Endocrinology. Dec;141(12):4533-42. Milne SA, Henderson TA, Kelly RW, Saunders PT, Baird DT, Critchley HO. 2005. Leukocyte populations and steroid receptor expression in human first-trimester decidua; regulation by antiprogestin and prostaglandin E analog. J Clin Endocrinol Metab. 90:43154321. Mittaz L, Russell DL, Wilson T, Brasted M, Tkalcevic J, Salamonsen LA, Hertzog PJ, Pritchard MA. 2004. Adamts-1 is essential for the development and function of the urogenital system. Biol Reprod.Apr;70(4):1096-105. Mo B, Vendrov AE, Palomino WA, DuPont BR, Apparao KB, Lessey BA. 2006. ECC-1 cells: a well-differentiated steroid-responsive endometrial cell line with characteristics of luminal epithelium. Bio Repro. Sep;75(3):387-394. Mohanam S, Chintala SK, Go Y, Bhattacharya A, Venkaiah B, Boyd D, Gokaslan ZL, Sawaya R, Rao JS. 1997. In vitro inhibition of human glioblastoma cell line invasiveness by antisense uPA receptor. Oncogene. Mar 20;14(11):1351-9. Molitoris KH, Kazi AA, Koos RD. 2009. Inhibition of oxygen-induced hypoxia-inducible factor-1alpha degradation unmasks estradiol induction of vascular endothelial growth factor expression in ECC-1 cancer cells in vitro. Endocrinology. Dec;150(12):5405-14. Mönckedieck V, Sannecke C, Husen B, Kumbartski M, Kimmig R, Tötsch M, Winterhager E, Grümmer R. 2009. Progestins inhibit expression of MMPs and of angiogenic factors in human ectopic endometrial lesions in a mouse model. Mol Hum Reprod. Oct;15(10):633-43. Moss NM, Barbolina MV, Liu Y, Sun L, Munshi HG, Stack MS. 2009. Ovarian cancer cell detachment and multicellular aggregate formation are regulated by membrane type 1 matrix metalloproteinase: a potential role in I.p. metastatic dissemination. Cancer Res. Sep 1;69(17):7121-9. Mosselman S, Polman J, Dijkema R. 1996. ER beta: identification and characterization of a novel human estrogen receptor.FEBS Lett. Aug 19;392(1):49-53. Mroczko B, Groblewska M, Okulczyk B, Kędra B, Szmitkowski M. 2010. The diagnostic value of matrix metalloproteinase 9 (MMP-9) and tissue inhibitor of matrix metalloproteinases 1 (TIMP-1) determination in the sera of colorectal adenoma and cancer patients. Int J Colorectal Dis.Jun 17. Mroczko B, Lukaszewicz-Zajac M, Groblewska M, Czyzewska J, Gryko M, GuzińskaUstymowicz K, Kemona A, Kedra B, Szmitkowski M. 2009. Expression of tissue inhibitors 177  of metalloproteinase 1 (TIMP-1) in gastric cancer tissue. Folia Histochem Cytobiol. Jan;47(3):511-6. Multhaupt HA, Mazar A, Cines DB, Warhol MJ, McCrae KR. 1994. Expression of urokinase receptors by human trophoblast. A histochemical and ultrastructural analysis. Lab Invest. Sep;71(3):392-400. Mundel TM, Kalluri R. 2007. Type IV collagen-derived angiogenesis inhibitors. Microvasc Res. Sep-Nov;74(2-3):85-9. Murphy G, Nagase H. 2008. Reappraising metalloproteinases in rheumatoid arthritis and osteoarthritis: destruction or repair? Nat Clin Pract Rheumatol Mar;4(3):128-35. Review. Murphy G. 2008. The ADAMs: signalling scissors in the tumour microenvironment. Nat Rev Cancer. Dec;8(12):929-41. Kuno K, Kanada N, Nakashima E, Fujiki F, Ichimura F, Matsushima K. 1997a. a gene encoding a new type of metalloproteinase-disintegrin family protein with thrombospondin motifs as an inflammation associated gene. J Biol Chem. Jan 3;272(1):556-62. Mylona P, Kielty CM, Hoyland JA, Aplin JD.1995. Expression of type VI collagen mRNAs in human endometrium during the menstrual cycle and first trimester of pregnancy. J Reprod Fertil. 1995 Jan;103(1):159-67. Nagase H, Kashiwagi M. 2003. Aggrecanases and cartilage matrix degradation. Arthritis Res Ther5(2):94-103 Nagase H. 1997. Activation mechanisms of matrix metalloproteinases.Biol Chem. MarApr;378(3-4):151-60. Review. Nagase, H., Visse, R., and Murphy, G. 2006. Structure and function of matrix metalloproteinases and TIMPs. Cardio Res 69, 562-573. Nantermet PV, Masarachia P, Gentile MA, Pennypacker B, Xu J, Holder D, Gerhold D, Towler D, Schmidt A, Kimmel DB, Freedman LP, Harada S, Ray WJ. 2005. Androgenic induction of growth and differentiation in the rodent uterus involves themodulation of estrogen-regulated genetic pathways. Endocrinology. 146:564-578. Narukawa S, Kanzaki H, Inoue T, Imai K, Higuchi T, Hatayama H, Kariya M, Mori T. 1994. Androgens induce prolactin production by human endometrial stromal cells in vitro. J Clin Endocrinol Metab. Jan;78(1):165-8. Naruse K, Lash GE, Bulmer JN, Innes BA, Otun HA, Searle RF, Robson SC. 2009. The urokinase plasminogen activator (uPA) system in uterine natural killer cells in the placental bed during early pregnancy. Placenta. May;30(5):398-404.  178  Narvekar N, Cameron S, Critchley HO, Lin S, Cheng L, Baird DT. 2004. Low-dose mifepristone inhibits endometrial proliferation and up-regulates androgen receptor. J Clin Endocrinol Metab. 89:2491-2497. Navaratnarajah R, Pillay OC, Hardiman P. 2008. Polycystic ovary syndrome and endometrial cancer. Semin Reprod Med. Jan;26(1):62-71. Navo MA, Smith JA, Gaikwad A, Burke T, Brown J, Ramondetta LM. 2008. In vitro evaluation of the growth inhibition and apoptosis effect of mifepristone (RU486) in human Ishikawa and HEC1A endometrial cancer cell lines. Cancer Chemother Pharmacol. Aug;62(3):483-9 Nelson SM, Fleming RF. 2007. The preconceptual contraception paradigm: obesity and infertility. Hum Reprod ;22:912–915. Ng YH, Zhu H, Pallen CJ, Leung PC, MacCalman CD. 2006. Differential effects of interleukin-1beta and transforming growth factor-beta1 on the expression of the inflammation-associated protein, ADAMTS-1, in human decidual stromal cells in vitro. Hum Reprod.Aug;21(8):1990-9. Nguyen M, Arkell J, Jackson CJ. 2001. Human endothelial gelatinases and angiogenesis. Int J Biochem Cell Biol. 2001 Oct;33(10):960-70. Nikas G. 1999. Cell-surface morphological events relevant to human implantation. Hum Reprod. Dec;14 Suppl 2:37-44 Nishida M, Kasahara K, Kaneko M, Iwasaki H. 1985. Establishment of a new human endometrial adenocarcinoma cell line, Ishikawa cells, containing estrogen and progesterone receptors. Nippon Sanka Fujinka Gakkai Zasshi 37:1103–1111. Noyes RW, Hertig AT, Rock J. 1950. Dating the endometrial biopsy. Fertile Steril 1:3-25 Hum Reprod 2004;19:490–503 Nygren KG, Andersen AN. 2002. Assisted reproductive technology in Europe, 1999. Results generated from European registers by ESHRE. Hum Reprod. Dec;17(12):3260-74. Nygren KG, Andersen AN; European IVF-monitoring programme (EIM). 2001a. Assisted reproductive technology in Europe, 1998. Results generated from European registers by ESHRE. European Society of Human Reproduction and Embryology. Hum Reprod. 2001 Nov;16(11):2459-71 Nyholm HC, Nielsen AL, Lyndrup J, Dreisler A, Thorpe SM. 1993. Estrogen and progesterone receptors in endometrial carcinoma: comparison of immunohistochemical and biochemical analysis. Int J Gynecol Pathol. Jul;12(3):246-52.  179  Ogawa S, Chan J, Chester AE, Gustafsson JA, Korach KS. and Pfaff DW. 1999. Survival of reproductive behaviors in estrogen receptor beta gene-deficient (betaERKO) male and female mice. Proc. Natl. Acad. Sci. USA 96, pp. 12887–12892. Okuda T, Sekizawa A, Purwosunu Y, Nagatsuka M, Morioka M, Hayashi M, Okai T. 2010. Genetics of endometrial cancers.Obstet Gynecol Int. 984013. Oleksowicz L, Bhagwati N, DeLeon-Fernandez M. 1999. Deficient activity of von Willebrand’s factor-cleaving protease in patients with disseminated malignancies, Cancer Res. 59 2244e2250. Oner C, Schatz F, Kizilay G, Murk W, Buchwalder LF, Kayisli UA, Arici A, Lockwood CJ. 2008. Progestin-inflammatory cytokine interactions affect matrix metalloproteinase-1 and -3 expression in term decidual cells: implications for treatment of chorioamnionitis-induced preterm delivery. J Clin Endocrinol Metab. Jan;93(1):252-9. Onisto M, Riccio MP, Scannapieco P, Caenazzo C, Griggio L, Spina M, StetlerStevenson WG, Garbisa S. 1995. Gelatinase A/TIMP-2 imbalance in lymph-node-positive breast carcinomas, as measured by RT-PCR, Int J Cancer, 63(5):621–626. Osteen KG, Bruner-Tran KL, Eisenberg E. 2005. Reduced progesterone action during endometrial maturation: a potential risk factor for the development of endometriosis. Fertil Steril. Mar;83(3):529-37. Review. Osteen KG, Rodgers WH, Gaire M, Hargrove JT, Gorstein F, Matrisian LM. 1994.Stromal-epithelial interaction mediates steroidal regulation of metalloproteinase expression in human endometrium. Proc Natl Acad Sci U S A. Oct 11;91(21):10129-33. Paech K, Webb P, Kuiper GG, Nilsson S, Gustafsson J, Kushner PJ, Scanlan TS. 1997. Differential ligand activation of estrogen receptors ERalpha and ERbeta at AP1 sites. Science. Sep 5;277(5331):1508-10. Page-McCaw, A., Ewald, A.J., and Werb, Z. 2007. Matrix metalloproteinases and the regulation of tissue remodelling. Nat. Rev. Mol. Cell Biol. 8, 221–233. Pallottini V, Bulzomi P, Galluzzo P, Martini C, Marino M. 2008. Estrogen regulation of adipose tissue functions: involvement of estrogen receptor isoforms. Infect Disord Drug Targets. Mar;8(1):52-60. Review. Paria BC, Reese J, Das SK, Dey SK. 2002. Deciphering the crosstalk of implantation: advances and challenges. Science 296:2185-2188 Paria BC, Tan J, Lubahn DB, Dey SK, Das SK. 1999. Uterine decidual response occurs in estrogen receptor-alpha-deficient mice. Endocrinology. Jun;140(6):2704-10.  180  Pasquali R, Gambineri A. 2006. Metabolic effects of obesity on reproduction. Reprod Biomed Online. May;12(5):542-51. Paulssen RH, Moe B, Grønaas H, Orbo A. 2008. Gene expression in endometrial cancer cells (Ishikawa) after short time high dose exposure to progesterone. Steroids 73(1):116– 128 Pearce ST, Jordan VC. 2004. The biological role of estrogen receptors alpha and beta in cancer. Crit Rev Oncol Hematol. Apr;50(1):3-22. Pettersson K, Grandien K, Kuiper GG, Gustafsson JA. 1997. Mouse estrogen receptor beta forms estrogen response element-binding heterodimers with estrogen receptor alpha. Mol Endocrinol. Sep;11(10):1486-96. Pierleoni C, Samuelsen GB, Graem N, Rønne E, Nielsen BS, Kaufmann P, Castellucci M. 1998. Immunohistochemical identification of the receptor for urokinase plasminogen activator associated with fibrin deposition in normal and ectopic human placenta. Placenta. Sep;19(7):501-8. Pierro E, Minici F,Alesiani O, et al. 2001. Stromal-epithelial interactions modulate estrogen responsiveness in normal human endometrium. Bio Reprod. ; 64(3)831-838 Pirinen R, Leinonen T, Böhm J, Johansson R, Ropponen K, Kumpulainen E, Kosma VM. 2005. Versican in nonsmall cell lung cancer: relation to hyaluronan, clinicopathologic factors, and prognosis. Hum Pathol. Jan;36(1):44-50. Plaisier M, Koolwijk P, Willems F, Helmerhorst FM, van Hinsbergh VW. 2008. Pericellular-acting proteases in human first trimester decidua. Mol Hum Reprod. Jan;14(1):41-51. Pockert AJ, Richardson SM, Le Maitre CL, Lyon M, Deakin JA, Buttle DJ, Freemont AJ, Hoyland JA. 2009. Modified expression of the ADAMTS enzymes and tissue inhibitor of metalloproteinases 3 during human intervertebral disc degeneration. Arthritis Rheum. Feb;60(2):482-91. Porter S, Clark IM, Kevorkian L, Edwards DR. 2005. The ADAMTS metalloproteinases. Biochem J. Feb 15;386(Pt 1):15-27. Review. Porter S, Scott SD, Sassoon EM, et al. 2004. Dysregulated expression of adamalysinthrombospondin genes in human breast carcinoma. Clin Cancer Res 2004;10: 2429–2440. Porter S, Span PN, Sweep FC, Tjan-Heijnen VC, Pennington CJ, Pedersen TX, Johnsen M, Lund LR, Rømer J, Edwards DR. 2006. ADAMTS8 and ADAMTS15 expression predicts survival in human breast carcinoma. Int J Cancer. Mar 1;118(5):1241-7.  181  Pratta MA, Scherle PA, Yang G, Liu RQ, Newton RC. 2003. Induction of aggrecanase 1 (ADAM-TS4) by interleukin-1 occurs through activation of constitutively produced protein. Arthritis Rheum. Jan;48(1):119-33. Psychoyos A. 1976. Hormonal control of uterine receptivity for nidation. J Reprod Fertil Suppl. Oct;(25):17-28 Qin C, Singh P, and Safe S. 1999. Transcriptional activation of insulin-like growth factorbinding protein-4 by 17ß-estradiol in MCF-7 cells: role of estrogen receptor–Sp1 complexes. Endocrinology, 140, 2501–2508. Queenan JT Jr, Kao LC, Arboleda CE, Ulloa-Aguirre A, Golos TG, Cines DB, Strauss JF 3rd, 1987. Regulation of urokinase-type plasminogen activator production by cultured human cytotrophoblasts. J Biol Chem. Aug 15;262(23):10903-6. Rai R, Regan L. 2006. Recurrent miscarriage. Lancet 368: 601–611. Ramathal CY, Bagchi IC, Taylor RN, Bagchi MK. 2010. Endometrial decidualization: of mice and men. Semin Reprod Med. Jan;28(1):17-26 Ramón L, Gilabert-Estellés J, Castelló R, Gilabert J, España F, Romeu A, Chirivella M, Aznar J, Estellés A. 2005. mRNA analysis of several components of the plasminogen activator and matrix metalloproteinase systems in endometriosis using a real-time quantitative RT-PCR assay. Hum Reprod. Jan;20(1):272-8 Ratnikov BI, Rozanov DV, Postnova TI, Baciu PG, Zhang H, DiScipio RG, Chestukhina GG, Smith JW, Deryugina EI, Strongin AY. 2002. An alternative processing of integrin alpha(v) subunit in tumor cells by membrane type-1 matrix metalloproteinase. J Biol Chem. Mar 1;277(9):7377-85. Read LD, Greene GL, Katzenellenbogen BS 1989 Regulation of estrogen receptor messenger ribonucleic acid and protein levels in human breast cancer cell lines by sex steroid hormones, their antagonists, and growth factors. Mol Endocrinol 3:295–304 Reiss K, Saftig P. 2009. The "a disintegrin and metalloprotease" (ADAM) family of sheddases: physiological and cellular functions. Semin Cell Dev Biol. Apr; 20(2):126-37. Ribeiro AS, Albergaria A, Sousa B, Correia AL, Bracke M, Seruca R, Schmitt FC, Paredes J. 2010. Extracellular cleavage and shedding of P-cadherin: a mechanism underlying the invasive behaviour of breast cancer cells. Oncogene. Jan 21;29(3):392-402 Ricci MS, et al. 1999. ECC-1 human endometrial cells as a model system to study dioxin disruption of steroid hormone function. In Vitro Cell. Dev. Biol. Anim. 35: 183-189,.  182  Ricciardelli C, Mayne K, Sykes PJ, Raymond WA, McCaul K, Marshall VR, Horsfall DJ. 1998. Elevated levels of versican but not decorin predict disease progression in earlystage prostate cancer. Clin Cancer Res. 1998 Apr;4(4):963-71. Richards JS, Hernandez-Gonzalez I, Gonzalez-Robayna I, Teuling E, Lo Y, Boerboom D, Falender AE, Doyle KH, LeBaron RG, Thompson V, Sandy JD. 2005. Regulated expression of ADAMTS family members in follicles and cumulus oocyte complexes: evidence for specific and redundant patterns during ovulation.Biol Reprod. May;72(5):124155. Richardson GS, Dickersin GR, Atkins L, MacLaughlin DT, Raam S, Merk LP, Bradley FM. 1984. KLE: a cell line with defective estrogen receptor derived from undifferentiated endometrial cancer. Gynecol Oncol. Feb;17(2):213-30. Robertson JF. 2001a. Faslodex (ICI 182, 780), a novel estrogen receptor downregulator-future possibilities in breast cancer. J Steroid Biochem Mol Biol. 2001 Dec;79(1-5):209-12. Robertson JF. 2001b. ICI 182,780 (Fulvestrant)--the first oestrogen receptor downregulator--current clinical data.Br J Cancer. 2001 Nov;85 Suppl 2:11-4. Robker RL, Russell DL, Yoshioka S, Sharma SC, Lydon JP, O'Malley BW, Espey LL, Richards JS. 2000. Ovulation: a multi-gene, multi-step process. Steroids. Oct-Nov;65(1011):559-70. Roche PJ, Hoare SA, Parker MG. 1992. A consensus DNA-binding site for the androgen receptor. Mol Endocrinol. Dec;6(12):2229-35. Rocks N, Paulissen G, El Hour M, Quesada F, Crahay C, Gueders M, Foidart JM, Noel A, Cataldo D. 2008. Emerging roles of ADAM and ADAMTS metalloproteinases in cancer. Biochimie. Feb;90(2):369-79. Rocks N, Paulissen G, Qusada-Calvo F, et al. 2006. Expression of a disintegrin and metalloprotease (ADAM and ADAMTS) enzymes in human non-small-cell lung carcinomas (NSCLC). Br J Cancer 2006;94:724–730. Rodgers WH, Osteen KG, Matrisian LM, Navre M, Giudice LC, Gorstein F. 1993. Expression and localization of matrilysin, a matrix metalloproteinase, in human endometrium during the reproductive cycle. Am J Obstet Gynecol. Jan;168(1 Pt 1):253-60 Rodriguez-Manzaneque JC, Milchanowski AB, Dufour EK, Leduc R, Iruela-Arispe. 2000. Characterization of METH-1/ADAMTS1 processing reveals two distinct active forms J Biol Chem. Oct 27;275(43):33471-9. Rodríguez-Manzaneque JC, Westling J, Thai SN, Luque A, Knauper V, Murphy G, Sandy JD, Iruela-Arispe ML. 2002. ADAMTS1 cleaves aggrecan at multiple sites and is 183  differentially inhibited by metalloproteinase inhibitors. Biochem Biophys Res Commun. Apr 26;293(1):501-8. Rogers WH, Matrisian LM, Guudice LC, Dsupin B, et al. 1994. Patterns of matrix mettaloproteinase expression in cycling endometrium imply differential function and regulation by steroid hormones. J Clin Invest 94: 946-953 Rogerson FM, Stanton H, East CJ, Golub SB, Tutolo L, Farmer PJ, Fosang AJ. 2008. Evidence of a novel aggrecan-degrading activity in cartilage: Studies of mice deficient in both ADAMTS-4 and ADAMTS-5. Arthritis Rheum. Jun;58(6):1664-73. Roy D, Liehr J.G. 1999. D.N.A. Estrogen, damage and mutations, Mutat. Res. 424 107–115 Ruck P, Marzusch K, Horny HP, Dietl J, Kaiserling E. 1996. The distribution of tissue inhibitor of metalloproteinases-2 (TIMP-2) in the human placenta. Placenta. May;17(4):263-6. Ruck P, Marzusch K, Kaiserling E, Horny HP, Dietl J, Geiselhart A, Handgretinger R, Redman CW. 1994. Distribution of cell adhesion molecules in decidua of early human pregnancy. An immunohistochemical study. Lab Invest. Jul;71(1):94-101 Russell DL, Doyle KM, Ochsner SA, Sandy JD, Richards JS. 2003. Processing and localization of ADAMTS-1 and proteolytic cleavage of versican during cumulus matrix expansion and ovulation. J Biol Chem. Oct 24;278(43):42330-9 Russell DL, Doyle KM, Ochsner SA, Sandy JD, Richards JS. 2003. Processing and localization of ADAMTS-1 and proteolytic cleavage of versican during cumulus matrix expansion and ovulation. J Biol Chem. Oct 24;278(43):42330-9. Sadler JE, Moake JL, Miyata T, George JN. 2004. Recent advances in thrombotic thrombocytopenic purpura. Hematology Am Soc Hematol Educ Program. 2004:407-23. Saito T, Mizumoto H, Tanaka R, Satohisa S, Adachi K, Horie M, Kudo R. 2004. Overexpressed progesterone receptor form B inhibit invasive activity suppressing matrix metalloproteinases in endometrial carcinoma cells. Cancer Lett;209(2):237–243 Sakko AJ, Ricciardelli C, Mayne K, Tilley WD, Lebaron RG, Horsfall DJ. 2001. Versican accumulation in human prostatic fibroblast cultures is enhanced by prostate cancer cell-derived transforming growth factor beta1. Cancer Res. Feb 1;61 (3):926-30. Salamonsen LA, Butt AR, Hammond FR, Garcia S, Zhang J. 1997. Production of endometrial matrix metalloproteinases, but not their tissue inhibitors, is modulated by progesterone withdrawal in an in vitro model for menstruation. J Clin Endocrinol Metab. 1997 May;82(5):1409-15. Salamonsen LA, Dimitriadis E, Jones RL, Nie G. 2003. Complex regulation of decidualization: a role for cytokines and proteases--a review. Placenta. Apr;24 Suppl A:S7685. 184  Salamonsen LA, Dimitriadis E, Robb L. 2000. Cytokines in implantation. Semin Reprod Med.18(3):299-310. Salamonsen LA, Woolley DE. 1996. Matrix metalloproteinases in normal menstruation. Hum Reprod. Oct;11 Suppl 2:124-33. Salamonsen LA, Woolley DE. 1999. Menstruation: induction by matrix metalloproteinases and inflammatory cells. J Reprod Immunol. Sep;44(1-2):1-27. Sandy, J. D., Westling, J., Kenagy, R. D., Iruela-Arispe, M. L., Ver scharen, C., Rodriguez-Mazaneque, J. C., Zimmermann, D. R., Lemire, J. M., Fischer, J. W., Wight, T. N., and Clowes, A. W. 2001. Versican V1 proteolysis in human aorta in vivo occurs at the Glu441-Ala442 bond, a site that is cleaved by recombinant ADAMTS-1 and ADAMTS-4. J. Biol. Chem. 276, 13372–13378 Sasano H, Suzuki T, Takeyama J, Utsunomiya H, Ito K, Ariga N, Moriya T. 2000. 17beta-hydroxysteroid dehydrogenase in human breast and endometrial carcinoma. A new development in intracrinology. Oncology. 59 Suppl 1:5-12. Review. Satyaswaroop PG & Tabibzadeh SS. 1991. Extracellular matrix and the patterns of differentiation of human endometrial carcinomas in vitro and in vivo. Cancer Research 51 5661–5666. Satyaswaroop PG, Zaino RJ & Mortel R. 1983. Human endometrial adenocarcinoma transplanted into nude mice: growth regulation by estradiol. Science 219 58–60. Schatz F, Krikun G, Runic R, Wang EY, Hausknecht V, Lockwood CJ.1999 Implications of decidualization-associated protease expression in implantation and menstruation. Semin Reprod Endocrinol. 17(1):3-12. Segawa T, Shozu M, Murakami K, Kasai T, Shinohara K, Nomura K, Ohno S, Inoue M. 2005. Aromatase expression in stromal cells of endometrioid endometrial cancer correlates with poor survival. Clin Cancer Res. Mar 15;11(6):2188-94. Shang Y. 2006. Molecular mechanism of oestrogen and SERMs in endometrial carcinogenesis. Nat Rev Cancer 6:360-368 Shapiro S, Kaufman DW, Slone D, Rosenberg L, Miettinen OS, Stolley PD, Rosenshein NB, Watring WG, Leavitt T Jr, Knapp RC. 1980. Recent and past use of conjugated estrogens in relation to adenocarcinoma of the endometrium. N Engl J Med.Aug 28;303(9):485-9. Sharkey AM, Dellow K, Blayney M, Macnamee M, Charnock-Jones S and Smith SK. 1995. Stage-specific expression of cytokine and receptor messenger ribonucleic acids in human preimplantation embryos. Biol Reprod 53,974–981. 185  Sherman ME. 2000. Theories of endometrial carcinogenesis: a multidisciplinary approach. Mod Pathol. Mar;13(3):295-308. Shimada M, Nishibori M, Yamashita Y, Ito J, Mori T, Richards JS. 2004. Downregulated expression of A disintegrin and metalloproteinase with thrombospondin-like repeats-1 by progesterone receptor antagonist is associated with impaired expansion of porcine cumulus-oocyte complexes. Endocrinology. Oct;145(10):4603-14. Shindo T, Kurihara H, Kuno K, Yokoyama H, Wada T, Kurihara Y, Imai T, Wang Y, Ogata M, Nishimatsu H, Moriyama N, Oh-hashi Y, Morita H, Ishikawa T, Nagai R, Yazaki Y, Matsushima K. 2000. ADAMTS-1: a metalloproteinase-disintegrin essential for normal growth, fertility, and organ morphology and function. J Clin Invest. May;105(10):1345-52. Shiokawa S, Yoshimura Y, Nagamatsu S, Sawa H, Hanashi H, Oda T, Katsumata Y, Koyama N, Nakamura Y. 1996. Expression of beta 1 integrins in human endometrial stromal and decidual cells. J Clin Endocrinol Metab. Apr;81(4):1533-40 Shiomi T, Okada Y. 2003. MT1-MMP and MMP-7 in invasion and metastasis of human cancers, Cancer Metastasis Rev, 22(2–3):145–152 Shozu M, Minami N, Yokoyama H, Inoue M, Kurihara H, Matsushima K, Kuno K. 2005. ADAMTS-1 is involved in normal follicular development, ovulatory process and organization of the medullary vascular network in the ovary. J Mol Endocrinol. Oct;35(2):343-55. Sidenius N, Blasi F. 2003. The urokinase plasminogen activator system in cancer: recent advances and implication for prognosis and therapy. Cancer Metastasis Rev. Jun-Sep;22(23):205-22. Review. Simon C, Piquette GN, Frances A and Polan ML. 1993. Localization of interleukin-1 type I receptor and interleukin-1 beta in human endometrium throughout the menstrual cycle. J Clin Endocrinol Metab 77,549–555. Slayden OD, Brenner RM. 2006. A critical period of progesterone withdrawal precedes menstruation in macaques. Reprod Biol Endocrinol.4 Suppl 1:S6. Review Smid-Koopman E, Blok LJ, Ku¨hne LC, et al. 2003. Distinct functional differences of human progesterone receptors A and B on gene expression and growth regulation in two endometrial carcinoma cell lines. J Soc Gynecol Investig 10(1):49–57 Smith MR, Kung H, Durum SK, Colburn NH, Sun Y. 1997. TIMP-3 induces cell death by stabilizing TNF-alpha receptors on the surface of human colon carcinoma cells. Cytokine. Oct;9(10):770-80. Snijders MP, de Goeij AF, Debets-Te Baerts MJ, Rousch MJ, Koudstaal J, Bosman FT. 1992. Immunocytochemical analysis of oestrogen receptors and progesterone receptors in the 186  human uterus throughout the menstrual cycle and after the menopause. J Reprod Fertil. Mar;94(2):363-71 Sokalska A, Duleba AJ, Pawelczyk LA. 2010. Correlation of the expression of integrin alphavbeta3 in endometrium and peripheral blood lymphocytes in infertile patients. Reprod Sci. 2010 May;17(5):487-93. Somerville RP, Longpré JM, Apel ED, Lewis RM, Wang LW, Sanes JR, Leduc R, Apte SS. 2004. ADAMTS7B, the full-length product of the ADAMTS7 gene, is a chondroitin sulfate proteoglycan containing a mucin domain.J Biol Chem. Aug 20;279(34):35159-75. Somerville RP, Longpre JM, Jungers KA, Engle JM, Ross M, Evanko S, Wight TN, Leduc R, Apte SS. 2003. Characterization of ADAMTS-9 and ADAMTS-20 as a distinct ADAMTS subfamily related to Caenorhabditis elegans GON-1. J Biol Chem. Mar 14;278(11):9503-13 Somkuti SG, Yuan L, Fritz MA, Lessey BA. 1997. Epidermal growth factor and sex steroids dynamically regulate a marker of endometrial receptivity in Ishikawa cells. J Clin Endocrinol Metab. Jul;82(7):2192-7 Song RX, Zhang Z, Chen Y, Bao Y, Santen RJ. 2007. Estrogen signaling via a linear pathway involving insulin-like growth factor I receptor, matrix metalloproteinases, and epidermal growth factor receptor to activate mitogen-activated protein kinase in MCF-7 breast cancer cells, Endocrinology 148 4091–4101. Sorosky JI. 2008 Endometrial Cancer. Obstetrics & Gynecology Feb.111 (2), 436-447 Soyal SM, Mukherjee A, Lee KY, Li J, Li H, DeMayo FJ, Lydon JP. 2005. Cre-mediated recombination in cell lineages that express the progesterone receptor. Genesis. Feb;41(2):5866. Spiess K, Teodoro WR, Zorn TM. 2007. Distribution of collagen types I, III, and V in pregnant mouse endometrium. Connect Tissue Res. 48(2):99-108. Spitz IM, Chwalisz K. 2000. Progesterone receptor modulators and progesterone antagonists in women's health. Steroids. Oct-Nov;65(10-11):807-15. Spitz IM. 2005. Progesterone receptor antagonists and selective progesterone receptor modulators (SPRMs). Semin Reprod Med. Feb;23(1):3-7. Stanton H, Rogerson FM, East CJ, Golub SB, Lawlor KE, Meeker CT, Little CB, Last K, Farmer PJ, Campbell IK, Fourie AM, Fosang AJ. 2005. ADAMTS5 is the major aggrecanase in mouse cartilage in vivo and in vitro. Nature.Mar 31;434(7033):648-52.  187  Starkey PM, Sargent IL, Redman CW. 1988. Cell populations in human early pregnancy decidua: characterization and isolation of large granular lymphocytes by flow cytometry. Immunology. Sep;65(1):129-34. Staun-Ram E, Goldman S, Shalev E. 2009. p53 Mediates epidermal growth factor (EGF) induction of MMP-2 transcription and trophoblast invasion. Placenta. Dec;30(12):1029-36. Staun-Ram E, Shalev E. 2005. Human trophoblast function during the implantation process. Reprod Biol Endocrinol. Oct 20;3:56. Review. Stoikos CJ, Salamonsen LA, Hannan NJ, O'Connor AE, Rombauts L, Dimitriadis E. 2010. Activin A regulates trophoblast cell adhesive properties: implications for implantation failure in women with endometriosis-associated infertility. Hum Reprod. May 10. Stokes A, Joutsa J, Ala-Aho R, Pitchers M, Pennington CJ, Martin C, Premachandra DJ, Okada Y, Peltonen J, Grénman R, James HA, Edwards DR, Kähäri VM. 2010. Expression profiles and clinical correlations of degradome components in the tumor microenvironment of head and neck squamous cell carcinoma. Clin Cancer Res. Apr 1;16(7):2022-35. Strickland S, Richards WG. 1992. Invasion of the trophoblasts. Cell. Oct 30;71(3):355-7. Suwiwat S, Ricciardelli C, Tammi R, Tammi M, Auvinen P, Kosma VM, LeBaron RG, Raymond WA, Tilley WD, Horsfall DJ. 2004. Expression of extracellular matrix components versican, chondroitin sulfate, tenascin, and hyaluronan, and their association with disease outcome in node-negative breast cancer. Clin Cancer Res. Apr 1;10(7):2491-8. Swisher EM, Peiffer-Scheider S, Mutch DG, et al. 1999. Differences in patterns of TP53 and KRAS2 mutations in a large series of endometrial carcinomas with or without microsatellite instability. Cancer 85:119–26. Tabibzadeh S, Kaffka KL, Kilian PL, Satyaswaroop PG. 1990. Human endometrial epithelial cell lines for studying steroid and cytokine actions. In Vitro Cell. Dev. Biol. 26: 1173-1179, Tabibzadeh S. 1991. Human endometrium: an active site of cytokine production and action. Endocr Rev. Aug;12(3):272-90. Review. Tabibzadeh S, Kong QF, Babaknia A and May LT. 1995. Progressive rise in the expression of interleukin-6 in human endometrium during menstrual cycle is initiated during the implantation window. Hum Reprod 10,2793–2799. Takeda A, LeavittWW1986 Progestin-induced downregulation of nuclear estrogen receptor in uterine decidual cells: analysis of receptor synthesis and turnover by the density-shift method. Biochem Biophys Res Commun 135:98–104  188  Talbi S, Hamilton AE, Vo KC, Tulac S, Overgaard MT, Dosiou C, Le Shay N, Nezhat CN, Kempson R, Lessey BA, Nayak NR, Giudice LC. 2006. Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women.Endocrinology. Mar;147(3):1097-121. Tanaka T, Wang C, Umesaki N. 2008. Autocrine/paracrine regulation of human endometrial stromal remodeling by laminin and type IV collagen. Int J Mol Med. Nov;22(5):581-7. Tanaka T, Wang C, Umesaki N. 2009. Remodeling of the human endometrial epithelium is regulated by laminin and type IV collagen. Int J Mol Med. Feb;23(2):173-80. Tang BL, Hong W. 1999. ADAMTS: a novel family of proteases with an ADAM protease domain and thrombospondin 1 repeats. FEBS Lett. Feb 26;445(2-3):223-5. Tang BL. 2001. ADAMTS: a novel family of extracellular matrix proteases. Int J Biochem Cell Biol. 2001 Jan;33(1):33-44. Tatti, O., Vehvilainen, P., Lehti, K., and Keski-Oja, J. 2008. MT1-MMP releases latent TGF-beta1 from endothelial cell extracellular matrix via proteolytic processing of LTBP-1. Exp. Cell Res. 314, 2501–2514. Taylor A.H. and Al-Azzawi F. 2000. Immunolocalisation of oestrogen receptor beta in human tissues. J Mol Endocrinol 24 pp. 145–155 Taylor AH, Guzail M, Wahab M, Tompson JR, Al-Azzawi F. 2005. Quantitative histomorphometric analysis of gonadal steroid receptor distribution in the normal human endometrium through the menstrual cycle. Histochem Cell Biol 123: 463-474 Teklenburg G, Salker M, Molokhia M, Lavery S, Trew G, Aojanepong T, Mardon HJ, Lokugamage AU, Rai R, Landles C, Roelen BA, Quenby S, Kuijk EW, Kavelaars A, Heijnen CJ, Regan L, Brosens JJ, Macklon NS. 2010. Natural selection of human embryos: decidualizing endometrial stromal cells serve as sensors of embryo quality upon implantation. PLoS One. Apr 21;5(4):e10258. Tortorella MD, Burn TC, Pratta MA, Abbaszade I, Hollis JM, Liu R, Rosenfeld SA, Copeland RA, Decicco CP, Wynn R, Rockwell A, Yang F, Duke JL, Solomon K, George H, Bruckner R, Nagase H, Itoh Y, Ellis DM, Ross H, Wiswall BH, Murphy K, Hillman MC Jr, Hollis GF, Newton RC, Magolda RL, Trzaskos JM, Arner EC. 1999. Purification and cloning of aggrecanase-1: a member of the ADAMTS family of proteins. Science. Jun 4;284(5420):1664-6. Tortorella MD, Malfait AM. 2008. Will the real aggrecanase(s) step up: evaluating the criteria that define aggrecanase activity in osteoarthritis. Curr Pharm Biotechnol. Feb;9(1):1623. Review.  189  Tortorella MD, Malfait F, Barve RA, Shieh HS, Malfait AM. 2009. A review of the ADAMTS family, pharmaceutical targets of the future. Curr Pharm Des. 15(20):2359-74. Tremblay,G.B., Tremblay,A., Copeland,N.G., Gilbert,D.J., Jenkins,N.A., Labrie,F. and Giguere,V. 1997. Cloning, chromosomal localization, and functional analysis of the murine estrogen receptor ß. Mol. Endocrinol., Troeberg L, Fushimi K, Scilabra SD, Nakamura H, Dive V, Thøgersen IB, Enghild JJ, Nagase H. 2009. The C-terminal domains of ADAMTS-4 and ADAMTS-5 promote association with N-TIMP-3. Matrix Biol. Oct;28(8):463-9. Truss M, Beato M. 1993. Steroid hormone receptors: interaction with deoxyribonucleic acid and transcription factors. Endocr Rev. 1993 Aug;14(4):459-79. Review. Tsai MJ, O'Malley BW. 1994. Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem. 63:451-86. Tucker RP. 2004. The thrombospondin type 1 repeat superfamily. Int J Biochem Cell Biol. Jun;36(6):969-74. Tyulmenkov,V.T. and Klinge,C.M. 2001. A mathematical approach to predict the affinity of estrogen receptors {alpha} and ß binding to estrogen response elements, half-sites, and direct repeats. Mol. Cell. Endocrinol.,182,1;109-119 Ueda M, Fujii H, Yoshizawa K, Abe F, Ueki M. 1996. Effects of sex steroids and growth factors on migration and invasion of endometrial adenocarcinoma SNG-M cells in vitro. Jpn J Cancer Res 87(5):524–533 Ueda SM, Kapp DS, Cheung MK, Shin JY, Osann K, Husain A, Teng NN, Berek JS, Chan JK. 2008. Trends in demographic and clinical characteristics in women diagnosed with corpus cancer and their potential impact on the increasing number of deaths. Am J Obstet Gynecol 198:218 e1–218 e6 Usadi RS, Murray MJ, Bagnell RC, Fritz MA, Kowalik AI, Meyer WR, Lessey BA. 2003. Temporal and morphologic characteristics of pinopod expression across the secretory phase of the endometrial cycle in normally cycling women with proven fertility. Fertil Steril. 2003 Apr;79(4):970-4. Usher PA, Thomsen OF, Iversen P, Johnsen M, Brünner N, Høyer-Hansen G. 2005. Andreasen P, Danø K, Nielsen BS Expression of urokinase plasminogen activator, its receptor and type-1 inhibitor in malignant and benign prostate tissue Int J Cancer. Mar 1;113(6):87080. Utsunomiya H, Ito K, Suzuki T, Kitamura T, Kaneko C, Nakata T, Niikura H, Okamura K, Yaegashi N, Sasano H. 2004. Steroid sulfatase and estrogen sulfotransferase in human endometrial carcinoma. Clin Cancer Res. Sep 1;10(17):5850-6. 190  van Goor H, Melenhorst WB, Turner AJ, Holgate ST. 2009. Adamalysins in biology and disease. J Pathol. Nov; 219(3):277-86. Review. Vandermolen DT and Gu Y. 1996. Human endometrial interleukin-6 (IL-6): in vivo messenger ribonucleic acid expression, in vitro protein production, and stimulation thereof by IL-1 beta. Fertil Steril 66,741–747. Vankemmelbeke MN, Jones GC, Fowles C, Ilic MZ, Handley CJ, Day AJ, Knight CG, Mort JS, Buttle DJ. 2003. Selective inhibition of ADAMTS-1, -4 and -5 by catechin gallate esters. Eur J Biochem. Jun;270(11):2394-403. Varga I, Hutóczki G, Petrás M, Scholtz B, Mikó E, Kenyeres A, Tóth J, Zahuczky G, Bognár L, Hanzély Z, Klekner A. 2010. Expression of Invasion-Related Extracellular Matrix Molecules in Human Glioblastoma Versus Intracerebral Lung Adenocarcinoma Metastasis. Cen Eur Neurosurg. Apr 15. Vázquez F, Hastings G, Ortega MA, Lane TF, Oikemus S, Lombardo M, Iruela-Arispe ML. 1999. METH-1, a human ortholog of ADAMTS-1, and METH-2 are members of a new family of proteins with angio-inhibitory activity. J Biol Chem. 1999 Aug 13;274(33):2334957. Ventura SJ, Hamilton BE, Sutton PD. 2003. Revised birth and fertility rates for the United States, 2000 and 2001.Natl Vital Stat Rep. Feb 6;51(4):1-18. Vereide AB, Kaino T, Sager G, Ørbo A; Scottish Gynaecological Clinical Trials Group. 2005. Bcl-2, BAX, and apoptosis in endometrial hyperplasia after high dose gestagen therapy: a comparison of responses in patients treated with intrauterine levonorgestrel and systemic medroxyprogesterone.Gynecol Oncol Jun;97(3):740-50. Vivacqua A, Bonofiglio D, Recchia AG, Musti AM, Picard D, Andò S, Maggiolini M. 2006. The G protein-coupled receptor GPR30 mediates the proliferative effects induced by 17beta-estradiol and hydroxytamoxifen in endometrial cancer cells.Mol Endocrinol. Mar;20(3):631-46 Vo TT, Jung EM, Dang VH, Jung K, Baek J, Choi KC, Jeung EB. 2009. Differential effects of flutamide and di-(2-ethylhexyl) phthalate on male reproductive organs in a rat model. J Reprod Dev. Aug;55(4):400-11. Vollmer G. 2003. Endometrial cancer: experimental models useful for studies on molecular aspects of endometrial cancer and carcinogenesis. Endocrine-Related Cancer (2003) 10 23–42 Vollmer G, Kniewe M, Meyn U, Tuchel L, Arnholdt H, Knuppen R. 1990. Spatial and molecular aspects of estrogen and progesterone receptor expression in human uteri and uterine carcinomas.J Steroid Biochem. Jun;36(1-2):43-55.  191  von Steinburg SP, Krüger A, Fischer T, Mario Schneider KT, Schmitt M. 2009. Placental expression of proteases and their inhibitors in patients with HELLP syndrome. Biol Chem. Nov;390(11):1199-204. von Wolff M, Stieger S, Lumpp K, Bucking J, Strowitzki T and Thaler CJ. 2002a. Endometrial interleukin-6 in vitro is not regulated directly by female steroid hormones, but by pro-inflammatory cytokines and hypoxia. Mol Hum Reprod 8,1096–1102. von Wolff M, Thaler CJ, Zepf C, Becker V, Beier HM and Strowitzki T. 2002b. Endometrial expression and secretion of interleukin-6 throughout the menstrual cycle. Gynecol Endocrinol 16,121–129. Vrbikova J, Hainer V. 2009. Obesity and polycystic ovary syndrome. Obes Facts. 2(1):2635. Wada-Hiraike O, Hiraike H, Okinaga H, Imamov O, Barros RP, Morani A, Omoto Y, Warner M, Gustafsson JA. 2006. Role of estrogen receptor beta in uterine stroma and epithelium: Insights from estrogen receptor beta-/- mice.Proc Natl Acad Sci U S A. Nov 28;103(48):18350-5. Wakatsuki A, Okatani Y, Ikenoue N, Fukaya T. 2002. Effect of medroxyprogesterone acetate on vascular inflammatory markers in postmenopausal women receiving estrogen. Circulation. Mar 26;105(12):1436-9. Wakeling AE, Dukes M, Bowler J. 1991. A potent specific pure antiestrogen with clinical potential. Cancer Res. Aug 1;51(15):3867-73. Wakeling AE. 1991. Regulatory mechanisms in breast cancer. Steroidal pure antiestrogens. Cancer Treat Res. 53:239-57. Review. Wang WM, Lee S, Steiglitz BM, Scott IC, Lebares CC, Allen ML, Brenner MC, Takahara K, Greenspan DS. 2003. Transforming growth factor-beta induces secretion of activated ADAMTS-2. A procollagen III N-proteinase. J Biol Chem. May 23;278(21):1954957. Ward EC, Hoekstra AV, Blok LJ, Hanifi-Moghaddam P, Lurain JR, Singh DK, Buttin BM, Schink JC, Kim JJ. 2008. The regulation and function of the forkhead transcription factor, Forkhead box O1, is dependent on the progesterone receptor in endometrial carcinoma.Endocrinology. 2008 Apr;149(4):1942-50. Watanabe K, Sasano H, Harada N, Ozaki M, Niikura H, Sato S, Yajima A. 1995. Aromatase in human endometrial carcinoma and hyperplasia. Immunohistochemical, in situ hybridization, and biochemical studies. Am J Pathol Feb;146(2):491-500. Webb P, Nguyen P, Valentine C, Lopez GN, Kwok GR, McInerney E, Katzenellenbogen BS, Enmark E, Gustafsson JA, Nilsson S and Kushner PJ. 1999. The estrogen receptor 192  enhances AP-1 activity by two distinct mechanisms with different requirements for receptor transactivation functions. Mol. Endocrinol., 13, 1672–1685. Wegmann TG, Lin H, Guilbert L, Mosmann TR. 1993. Bidirectional cytokine interactions in the maternal-fetal relationship: is successful pregnancy a TH2 phenomenon? Immunol Today. Jul;14(7):353-6 Welsh M, Sharpe RM, Walker M, Smith LB, Saunders PT. 2009. New insights into the role of androgens in wolffian duct stabilization in male and female rodents. Endocrinology. May;150(5):2472-80 Wen J, Zhu H, Murakami S, Leung PC, MacCalman CD. 2006. Regulation of A Disintegrin And Metalloproteinase with ThromboSpondin repeats-1 expression in human endometrial stromal cells by gonadal steroids involves progestins, androgens, and estrogens. J Clin Endocrinol Metab. Dec;91(12):4825-35. Westling J, Gottschall PE, Thompson VP, Cockburn A, Perides G, Zimmermann DR, Sandy JD. 2004. ADAMTS4 (aggrecanase-1) cleaves human brain versican V2 at Glu405Gln406 to generate glial hyaluronate binding protein. Biochem J. 2004 Feb 1;377(Pt 3):78795. Wewer UM, Albrechtsen R, Fisher LW, Young MF, Termine JD. 1988. Osteonectin/SPARC/BM-40 in human decidua and carcinoma, tissues characterized by de novo formation of basement membrane. Am J Pathol. Aug;132(2):345-55 Wewer UM, Faber M, Liotta LA, Albrechtsen R. 1985. Immunochemical and ultrastructural assessment of the nature of the pericellular basement membrane of human decidual cells. Lab Invest. Dec;53(6):624-33. Wheeler DT, Bristow RE, Kurman RJ. 2007. Histologic alterations in endometrial hyperplasia and well-differentiated carcinoma treated with progestins Am J Surg Pathol. Jul;31(7):988-98.. Wight TN. 2002. Versican: a versatile extracellular matrix proteoglycan in cell biology. Curr Opin Cell Biol Oct;14(5):617-23. Wilcox AJ, Baird DD, Weinberg CR. 1999 Time of implantation of the conceptus and loss of pregnancy. N Engl J Med. Jun 10;340(23):1796-9 Williams JA. 1992. Disintegrins: RGD-containing proteins which inhibit cell/matrix interactions (adhesion) and cell/cell interactions (aggregation) via the integrin receptors. Pathol Biol (Paris). Oct;40(8):813-21. Williams JP, Blair HC, McKenna MA, Jordan SE, McDonald JM. 1996. Regulation of avian osteoclastic H+ -ATPase and bone resorption by tamoxifen and calmodulin antagonists. Effects independent of steroid receptors. J Biol Chem. May 24;271(21):12488-95. 193  Wilson CG, Vanderploeg EJ, Zuo F, Sandy JD, Levenston ME. 2009. Aggrecanolysis and in vitro matrix degradation in the immature bovine meniscus: mechanisms and functional implications. Arthritis Res Ther. 11(6):R173. Epub 2009 Nov 17. Wing LY, Chuang PC, Wu MH, Chen HM, Tsai SJ. 2003. Expression and mitogenic effect of fibroblast growth factor-9 in human endometriotic implant is regulated by aberrant production of estrogen. J Clin Endocrinol Metab. Nov;88(11):5547-54. Wirth MP, Hakenberg OW, Froehner M. 2007. Antiandrogens in the treatment of prostate cancer. Eur Urol. Feb;51(2):306-13; discussion 314. Epub 2006 Sep 11. Review Woessner JF Jr. 1991. Matrix metalloproteinases and their inhibitors in connective tissue remodeling. FASEB J. May;5(8):2145-54 Wolfsberg TG, Primakoff P, Myles DG, White JM. 1995. ADAM, a novel family of membrane proteins containing A Disintegrin And Metalloprotease domain: multipotential functions in cell-cell and cell-matrix interactions. J Cell Biol Oct;131(2):275-8. Review. No abstract available. Wynn RM. 1974. Ultrastructural development of the human decidua. Am J Obstet Gynecol. Mar 1;118(5):652-70. Xing RH, Rabbani SA. 1996. Overexpression of urokinase receptor in breast cancer cells results in increased tumor invasion, growth and metastasis. Int J Cancer. Jul 29;67(3):423-9. Xu P, Wang YL, Zhu SJ, Luo SY, Piao YS, Zhuang LZ. 2000. Expression of matrix metalloproteinase-2, -9, and -14, tissue inhibitors of metalloproteinase-1, and matrix proteins in human placenta during the first trimester Biol Reprod. Apr;62(4):988-94. Yagel S, Parhar RS, Jeffrey JJ, Lala PK. 1988. Normal nonmetastatic human trophoblast cells share in vitro invasive properties of malignant cells. J Cell Physiol. Sep;136(3):455-62. Yamada O, Todoroki J, Takahashi T, Hashizume K. 2002. The dynamic expression of extracellular matrix in the bovine endometrium at implantation. J Vet Med Sci. Mar;64(3):207-14. Yamanishi Y, Boyle DL, Clark M, Maki RA, Tortorella MD, Arner EC, Firestein GS. 2002. Expression and regulation of aggrecanase in arthritis: the role of TGF-beta. J Immunol. Feb 1;168(3):1405-12. Yie S, Xiao R and Librach C.L. 2006. Progesterone regulates HLA-G gene expression through a novel progesterone response element. Human Reproduction Vol.21, No.10 pp. 2538–2544  194  Young KA, Tumlinson B, Stouffer RL. 2004. ADAMTS-1/METH-1 and TIMP-3 expression in the primate corpus luteum: divergent patterns and stage-dependent regulation during the natural menstrual cycle. Mol Hum Reprod. Aug;10(8):559-65. Yu WH, Yu S, Meng Q, Brew K, Woessner JF Jr. 2000. TIMP-3 binds to sulfated glycosaminoglycans of the extracellular matrix J Biol Chem. Oct 6;275(40):31226-32. Zaytseva TS, Goncharova VN, Morozova MS, Astakhova TM, Manuilova IA, Pankov YA. 1993. The effect of RU486 on progesterone and oestrogen receptor concentration in human decidua on early pregnancy. Hum Reprod. Aug;8(8):1288-92. Zeng ZS, Cohen AM, Zhang ZF, Stetler-Stevenson WG, Guillem JG. 1995. Elevated tissue inhibitor of metalloproteinase 1 RNA in colorectal cancer stroma correlates with lymph node and distant metastases, Clin Cancer Res, 1(8):899–906. Zhang C, Shao Y, Zhang W, Wu Q, Yang H, Zhong Q, Zhang J, Guan M, Yu B, Wan J. 2010. High-resolution melting analysis of ADAMTS9 methylation levels in gastric, colorectal, and pancreatic cancers. Cancer Genet Cytogenet. Jan 1;196(1):38-44. Zhang J, Salamonsen LA. 1997. Tissue inhibitor of metalloproteinases (TIMP)-1, -2 and -3 in human endometrium during the menstrual cycle. Mol Hum Reprod. Sep;3(9):735-41 Zhang L, Li X, Zhao L, Zhang L, Zhang G, Wang J, Wei L. 2009. Nongenomic effect of estrogen on the MAPK signaling pathway and calcium influx in endometrial carcinoma cells, J. Cell Biochem. 106 553–562. Zhang LJ, Chen YX, Chen ZX, Huang YH, Yu JP, Wang XZ. 2004. Effect of interleukin10 and platelet-derived growth factor on expressions of matrix metalloproteinases-2 and tissue inhibitor of metalloproteinases-1 in rat fibrotic liver and cultured hepatic stellate cells. World J Gastroenterol. Sep 1;10(17):2574-9. Zhang X, Croy BA. 1996. Maintenance of decidual cell reaction by androgens in the mouse. Biol Reprod. Sep;55(3):519-24. Zheng W, Baker HE, Mutter GL. 2004. Involution of PTEN-null endometrial glands with progestin therapy. Gynecol Oncol. Mar;92(3):1008-13. Zheng X, Chung D, Takayama TK, Majerus EM, Sadler JE, Fujikawa K. 2001. Structure of von Willebrand factor-cleaving protease (ADAMTS13), a metalloprotease involved in thrombotic thrombocytopenic purpura. J Biol Chem. Nov 2;276(44):41059-63. Zhou, Y., Fisher, S., Janatpour, M., Genbacev, O., Dejana, E., Wheelock, M., and Damsky, C. 1997a. Human cytotrophoblasts adopt a vascular phenotype as they differentiate. A strategy for successful endovascular invasion? J Clin Invest 99, 2139-51.  195  Zhu H, Leung PC, MacCalman CD. 2007. Expression of ADAMTS-5/implantin in human decidual stromal cells: regulatory effects of cytokines. Hum Reprod. Jan;22(1):63-74. Ziebe S, Devroey P; State of ART 2007 Workshop Group. 2008. Assisted reproductive technologies are an integrated part of national strategies addressing demographic and reproductive challenges.Hum Reprod Update. Nov-Dec;14(6):583-92. Zipfel PF, Heinen S, Skerka C. 2010. Thrombotic microangiopathies: new insights and new challenges. Curr Opin Nephrol Hypertens. Jun 9 Zorn KK, Bonome T, Gangi L, et al. 2005. Gene expression profiles of serous, endometrioid,and clear cell subtypes of ovarian and endometrial cancer. Clin Cancer Res 11:6422–30.AA  196  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0071568/manifest

Comment

Related Items