UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Matrix metalloproteinase regulation of inflammatory proteins Starr, Amanda E. 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata


24-ubc_2011_spring_starr_amanda.pdf [ 4.3MB ]
JSON: 24-1.0071555.json
JSON-LD: 24-1.0071555-ld.json
RDF/XML (Pretty): 24-1.0071555-rdf.xml
RDF/JSON: 24-1.0071555-rdf.json
Turtle: 24-1.0071555-turtle.txt
N-Triples: 24-1.0071555-rdf-ntriples.txt
Original Record: 24-1.0071555-source.json
Full Text

Full Text

  MATRIX METALLOPROTEINASE REGULATION OF INFLAMMATORY PROTEINS by Amanda E. Starr B.Sc., University of Guelph, 1998 M.Sc., University of Guelph, 2002    A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in  THE FACULTY OF GRADUATE STUDIES (Biochemistry and Molecular Biology)   THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  December 2010      © Amanda E. Starr, 2010 ii ABSTRACT Recruitment of leukocytes is a hallmark feature of inflammation, as is the dissipation of the infiltrate for healing. Continual recruitment and leukocyte activation results in host tissue damage that is pathognomonic of chronic inflammatory disease. Matrix metalloproteases (MMPs) are an important family of endopeptidases that are elevated and associated with inflammatory diseases. Historically considered to promote cellular invasion by degrading components of the extracellular matrix, it is now recognized that MMPs specifically process bioactive molecules to alter the function of these proteins. A novel substrate discovery method identified that MMP truncation of the first 4 amino acid residues of the monocyte chemoattractant cytokine (chemokine) CCL7 produced a receptor antagonist that is capable of reversing the inflammatory response in vivo. Since this first discovery, nearly half of all chemokines have been identified as MMP substrates, resulting in products that promote and inhibit neutrophil recruitment, and inhibit monocyte recruitment and so implicating MMPs as major regulators of innate immunity.  I hypothesized that MMP processing of select chemokines would promote monocyte recruitment, and that neutrophil-specific membrane-type (MT)6-MMP processes chemokines and other inflammatory mediators during neutrophil migration through the endothelium and stroma. To identify chemokines activated by MMP-processing, I systematically evaluated all monocyte attracting CC chemokines, finding that all are cleaved by at least one MMP. Moreover, in vitro functional assays showed that MMP processing of CCL16 increases glycosaminoglycan binding of the chemokine, whereas CCL15 and CCL23 products have enhanced agonist activity. To identify substrates of MT6-MMP, chemokine cleavage was evaluated in vitro, and the proteomics method terminal amino isotopic labeling of substrates (TAILS) was applied to soluble and membrane-associated human lung fibroblast and human microendothelial cell proteomes. 14 chemokines, as well as vimentin, insulin-like growth factor binding protein-7, cystatin C, and galectin-1 were confirmed to be substrates of MT6-MMP. I propose that MT6-MMP has pleiotropic roles in inflammation by potentiating and then inhibiting neutrophil recruitment, contributing to monocyte recruitment, and promoting wound healing. Contributing to our understanding of the roles of MMPs in inflammation, iii my work also suggests new modalities whereby perturbing MMP regulation promotes inflammatory disease. iv PREFACE The chapters presented herein are all first-authored manuscripts prepared by the candidate with guidance from the graduate supervisor, Dr. Christopher Overall.  The data presented in the manuscript in Chapter 2 were acquired by the candidate except for the neutrophil activation chemotaxis assay, and calcium mobilization assay for the CCL23 (5-23) peptide, which was performed by Josephine Maier under the direction of the candidate. Blood cell isolation was approved by the UBC Clinical Research Ethics Board (H6-00047; Appendix C)  The candidate acquired the data for Chapter 3, with the following exceptions. Chemotaxis assays of THP-1 cells toward vimentin were performed by Dr. Caroline Bellac and Dr. Verena Goebler. In addition, Dr. Bellac performed the cleavage assays and gels for cystatin C, galectin-1, SPARC and IGFBP-7. Dr. Pitter Huesgen is acknowledged for preparation of the tryptic library for the PICS assay. Jason Rogalski is acknowledged for operating the QStar XL Hybrid ESI mass spectrometer.  For Chapter 4, Jason Rogalski is acknowledged for operating the QStar XL Hybrid ESI mass spectrometer. All other data was acquired and analyzed by the candidate. v TABLE OF CONTENTS ABSTRACT ..................................................................................................................... ii PREFACE ...................................................................................................................... iv TABLE OF CONTENTS .................................................................................................. v LIST OF TABLES...........................................................................................................vii LIST OF FIGURES........................................................................................................viii LIST OF ABBREVIATIONS............................................................................................. x ACKNOWLEDGEMENTS............................................................................................... xi CHAPTER 1: INTRODUCTION....................................................................................... 1 MATRIX METALLOPROTEINASES .................................................................................... 3 MT6-MMP .....................................................................................................................8 CHEMOKINES................................................................................................................11 MMPS IN THE ACUTE INFLAMMATORY RESPONSE ............................................................27 THEME AND HYPOTHESES .......................................................................................... 31 CHAPTER 2: MATRIX METALLOPROTEINASE PROCESSING OF MONOCYTE CHEMOATTRACTANTS: CCL15 AND CCL23 ARE ACTIVATED WHEREAS CCL16 CLEAVAGE INCREASES GLYCOSAMINOGLYCAN BINDING ................................... 33 SYNOPSIS................................................................................................................. 33 INTRODUCTION.......................................................................................................... 34 MATERIALS AND METHODS......................................................................................... 36 RESULTS .................................................................................................................. 40 DISCUSSION.............................................................................................................. 60 vi CHAPTER 3: MT6-MMP PROCESSES PROTEINS INVOLVED IN LEUKOCYTE MIGRATION AND MATRIX REMODELING TO PROGRESS TO WOUND HEALING . 67 SYNOPSIS................................................................................................................. 67 INTRODUCTION.......................................................................................................... 67 MATERIAL AND METHODS........................................................................................... 70 RESULTS .................................................................................................................. 76 DISCUSSION.............................................................................................................. 98 CHAPTER 4: DETERMINATION OF THE MT6-MMP SUBSTRATE DEGRADOME BY ITRAQ-TAILS QUANTITATIVE PROTEOMICS .......................................................... 105 SYNOPSIS............................................................................................................... 105 INTRODUCTION........................................................................................................ 105 MATERIAL AND METHODS......................................................................................... 107 RESULTS ................................................................................................................ 112 DISCUSSION............................................................................................................ 133 CHAPTER 5: CONCLUSIONS AND PERSPECTIVES ............................................... 138 REFERENCES............................................................................................................ 147 APPENDIX A: PEPTIDES IDENTIFIED IN HFL SECRETOME ANALYSIS................ 164 APPENDIX B: PEPTIDES IDENTIFIED FROM HFL OR HMEC FRACTIONS............ 176 APPENDIX C: CLINICAL RESEARCH ETHICS BOARD APPROVAL........................ 221  vii LIST OF TABLES Table 1.1 Human chemokine receptor preferences and truncation variants ................. 15 Table 2.1 MMP-truncation products of CC chemokines ................................................ 41 Table 3.1 Highest confident candidate substrates of MT6-MMP ................................... 92 Table 3.2 High confident candidate substrates of MT6-MMP........................................ 94 Table 3.3 Candidate substrates of MT6-MMP............................................................... 95 Table 4.1 Number of proteins (and peptides) identified in HFL experiments............... 113 Table 4.2 Number of proteins (and peptides) identified in HMEC experiments ........... 115 Table 4.3 Highest confident candidate substrates from HFL conditioned medium...... 118 Table 4.4 Candidate substrates from HFL conditioned medium.................................. 118 Table 4.5 Highest confident candidate substrates from HFL membrane fractions ...... 119 Table 4.6 Candidate substrates from HFL membrane fractions .................................. 120 Table 4.7 Highest confident candidate substrates from HMEC conditioned medium .. 121 Table 4.8 Candidate substrates from HMEC conditioned medium.............................. 122 Table 4.9 Highest confident candidate substrates from HMEC membrane fractions... 123 Table 4.10 Candidate substrates from HMEC membrane fraction .............................. 125  viii LIST OF FIGURES Figure 1.1 MMP structural characteristics ....................................................................... 4 Figure 1.2 MMP and chemokine receptor expression ..................................................... 7 Figure 1.3 Chemokine structure .................................................................................... 12 Figure 2.1 All MMPs evaluated processed CCL16. ....................................................... 43 Figure 2.2 Heparin binding is enhanced upon CCL16 processing................................. 46 Figure 2.3 All MMPs evaluated processed CCL15 at one or more sites. ...................... 48 Figure 2.4 Kinetics of CCL15 processing by MMPs. ..................................................... 49 Figure 2.5 All MMPs evaluated processed CCL23 at one or more sites. ...................... 52 Figure 2.6 MMP-mediated cleavages of CCL15 and CCL23 results in increased agonism in calcium mobilization assays................................................................. 54 Figure 2.7 Chemotactic potential of CCL15 and CCL23 is enhanced by MMP- processing.............................................................................................................. 56 Figure 2.8 A 19-mer peptide corresponding to CCL23 (5-23) had no identifiable function. ............................................................................................................................... 57 Figure 2.9 Synovial fluid MMP and serine proteases cleave CCL15............................. 58 Figure 2.10 Model of chemokine propogation of inflammation ...................................... 66 Figure 3.1 Expression and purification of soluble active and catalytically inactive MT6- MMP mutants. ........................................................................................................ 77 Figure 3.2 PICS analysis of MT6-MMP cleavage site specificity. .................................. 80 Figure 3.3 Kinetic analysis of MT6-MMP and inhibition by TIMPs................................. 82 Figure 3.4 MT6-MMP cleavage of gelatin and casein. .................................................. 83 Figure 3.5 CXC chemokine processing by MT6-MMP................................................... 85 Figure 3.6 CC chemokine processing by MT6-MMP. .................................................... 87 Figure 3.7 Venn diagram of the number of peptides identified by TAILS analysis......... 88 Figure 3.8 Natural N-termini distribution........................................................................ 90 Figure 3.9 Distribution of all peptides. ........................................................................... 91 Figure 3.10 Vimentin cleavage by MMPs results in a loss of chemotactic potential. ..... 96 Figure 3.11 Confirmation of novel MT6-MMP substrates. ............................................. 99 Figure 4.1 Schematic of method.................................................................................. 109 Figure 4.2 Venn diagrams of the identified peptides. .................................................. 114 Figure 4.3 Distribution of HFL iTRAQ ratios. ............................................................... 116 ix Figure 4.4 Distribution of HMEC iTRAQ ratios. ........................................................... 117 Figure 4.5 Distribution of subcellular and extracellular proteins identified by iTRAQ- labeled peptides. .................................................................................................. 127 Figure 4.6 Schematic to describe changes in iTRAQ ratios. ....................................... 128 Figure 4.7 IceLogo analysis of TAILS data.................................................................. 131 Figure 5.1 Model of MMP cleavage of inflammatory proteins...................................... 139 x LIST OF ABBREVIATIONS  APMA   4-aminophenylmercuric acetate CD   Cluster of differentiation DAMP s  Damage associated molecular patterns DMEM  Dulbeccos’ modified essential medium ESI-QUAD-TOF Electrospray ionization quadropule time of flight HFL   Human fetal lung fibroblast HMEC  Human microvascular endothelial cell IGFBP  Insulin-like growth factor binding protein IL   Interleukin LIX   LPS-inducible CXC chemokine LPS   Lipopolysaccharide MALDI-TOF  Matrix-assisted laser desorption/ionization-time of flight MMP   Matrix metalloproteinase PAMPs  Pathogen association molecular patterns PBS   Phosphate buffered saline PICS   Proteomic identification of protease cleavage sites PMN   Polymorphonuclear neutrophils PMSF   Phenylmethylsulfonyl fluoride RPMI   Roswell park memorial institute medium SDS   Sodium dodecyl sulfate SPARC  Secreted protein, acidic and rich in cysteine TAILS   Terminal amine isotopic labeling of substrates TIMP   Tissue inhibitor of metalloproteinase TPP   TransProteomic pipeline xi ACKNOWLEDGEMENTS First and foremost, I would like to thank Dr. Chris Overall for his support and encouragement as a supervisor. He has taught me that optimism is a necessity for scientific discovery, and to take a chance – how bad can it be. I would also like to thank my supervisory committee for their involvement and discussions that provided me with alternative perspectives to ultimately benefit this research, namely Dr. Leonard Foster, Dr. Francois Jean and Dr. Pauline Johnson.  Over the course of this research, there have been many people that have worked in the Overall lab; each has contributed directly through research or indirectly through excellent and thought provoking discussions. Thanks especially to my fellow graduate students Jen, for our 5-minute power talks and sharing windows to the chemokine world, and Patrick for 3 o’clock breaks, Friday afternoons and shared interests in between. Thanks to George for important conversations, guilt-free “5-dolla” diversions and a shared love of Fluevog; Rich and Caroline for providing guidance when I needed it and daily conversations in our shared space; Reini for her positive attitude and keeping the lab running; Anna and Verena for direction in the lab and “sew” much fun outside of it; Charlotte for helping me get started; Alain, Oded, Oliver, Olivier, Philipp, Pitter, Rich F. and Ulrich for sharing their expertise; the latin quarter, Magda and David, for their energy; and Yili “the purifier” for reminding me to do one thing at a time, and to do it right. Despite the challenges of science, I always looked forward to going to the lab, in large part because of the people that I spent my day with. Thanks to each of them for their insight and their friendship.  I want to express my thanks to my parents, Mike and Betty, and my in-laws, John and Nancy, who have always been encouraging and have made themselves available when we have needed extra support at home. Thanks to my amazing children Caleb and Caidra for understanding when I wasn’t always home at bedtime, or able to play on the weekend and especially during this most recent period when they encouraged me to “finish my paperwork” soon. Most of all, I want to thank my husband Greg for his never- ending support; celebrating successes, encouraging me through failures, and enabling me to get to this stage in my education.  1 CHAPTER 1: INTRODUCTION Inflammation is the host response to infection or injury, intended to remove the stimulus and initiate healing. The cardinal signs of inflammation – redness, heat, swelling, pain, and loss of function – are due to vascular changes including increased blood flow, and a migration of cells and fluid into the affected tissue (reviewed in (1)). The predominant white blood cells (leukocytes) of the innate immune response are polymorphonuclear neutrophils (PMNs, neutrophils) and mononuclear phagocytes.  Neutrophils are the most abundant circulating leukocyte, responding rapidly to infection. During bone marrow development, proteins that are responsible for neutrophil function are incorporated into characteristic primary (azurophilic), secondary (specific), and tertiary (gelatinase) granules, and secretory vesicles (2). In a targeting-by-timing hypothesis, the contents of these granules are associated with the timing of the protein biosynthesis and so represent a continuum rather then exact division into these granules (2). Included amongst these proteins are  β2-integrins, antimicrobial peptides and proteases (3-8). Neutrophils contribute to bacterial clearance through production of reactive oxygen and nitrogen species (9), antimicrobial peptides release (10), neutrophil extracellular traps (NETS)  (11), and phagocytosis.  The mononuclear phagocyte system includes a subgroup of leukocytes originally described as myeloid-derived circulating blood monocytes that differentiate into macrophages during inflammation. This traditional definition has recently undergone revision, recognizing that lymphoid precursors can differentiate into dendritic cells and macrophages (12) and that there is heterogeneity within monocyte populations (13,14), though notably differences between human and murine cell populations (12,15). The majority of circulating monocytes are inflammatory (classical) monocytes (human CD14+CD16-; similar to murine Gr1+/Ly6Chigh) (13,15), recruitment of which begins within hours after the initial assault and continues for days (16). Patrolling (non- classical) monocytes (human CD14lowCD16+; similar to murine Gr1-/Ly6Clow) represent about 10% of the monocyte population; these cells crawl along the endothelium in steady-state conditions to respond rapidly to infection (17) but also at the late stage of  2 injury-induced inflammation to promote healing through vascular endothelial growth factor and the stimulation of collagen production (18).  Under inflammatory conditions, monocytes differentiate into M1-type or M2-type macrophages (19,20). M1-type (or classical) macrophages, which are pro-inflammatory with significant production of reactive nitrogen and oxygen species (ROS) (19), produce IL-12 and IL-23 (21) and express monocytes and T-cells chemoattractants (19) . M2- type (or alternatively activated) macrophages that have enhanced endocytic clearance capabilities and scavenger receptor expression (22), promote T cell responses, and are involved in matrix deposition and tissue remodeling (23).  Acute inflammation, a rapid response initiated by cells resident at the affected site, is characterized by the predominance of recruited neutrophils, and is resolved within hours to days (1). The acute inflammatory response is actively terminated by the down- regulation of proinflammatory mediators and by the production of anti-inflammatory mediators that inhibit continued cell recruitment and promote resolution and wound healing. Chronic inflammation is a persistent response, predominated by mononuclear phagocytes (1), that involves concurrent resolution and destruction of host tissues in what has been termed frustrated repair. Chronic inflammation can progress to diseases including rheumatoid arthritis, chronic obstructive pulmonary disease, and cancer.  Tissue damage is mediated in part by dysregulated activity of proteases (protein- cleaving enzymes), which are capable of degrading extracellular matrices but also specifically process and alter the function of inflammatory proteins that are critical mediators of intercellular signaling. These enzymes may be released as a component of the recruited cells’ antimicrobial arsenal or be upregulated by stromal cells in response to injury. The altered activity of matrix metalloproteinases (MMPs) observed in human diseases, and the disease causing effects observed with naturally occurring human MMP mutations and MMP knockout murine models (reviewed in (24)) have provided evidence of the critical, biological involvement of MMPs in homeostasis and disease (25-28).  3 Matrix metalloproteinases MMPs are a family of calcium and zinc dependent proteases that were first described in tadpole development following the observation that fibrillar collagen was degraded during tadpole tail metamorphosis (29). A similar observation in human gingival tissue (30) led to the isolation of the first human MMP (31). Now, 23 human and 24 murine MMPs have been described (32). Historically, MMPs were considered to degrade all components of the extracellular matrix and thus contribute to diseases such as cancer and arthritis by creating passages in the basement membrane and extracellular matrix to allow cell migration. The extracellular matrix degrading activity of overexpressed MMPs in destructive inflammatory diseases was thought to account for the degenerative and destructive changes associated with chronic inflammation. Nonetheless, broad inhibition clinical trials of MMPs were unsuccessful (33) because, as we now understand, MMPs have a broad substrate profile with involvement in both homeostasis and disease (34-38). Moreover, in certain diseases, MMPs play a protective role (33,39- 41). Therefore, continued substrate discovery of individual MMPs is critical to understanding their functions in vivo.  Conserved features of MMPs include a signal sequence, an amino-terminal prodomain responsible for latency, a protease catalytic domain and a C-terminal hemopexin domain connected to the protease domain by a flexible proline-rich linker (Fig 1.1) (42- 44). In addition to the basic MMP structure, the gelatinases MMP-2 and -9 have fibronectin type II repeats that bind gelatin and collagen (45). MMPs are either secreted or membrane-bound, termed membrane-type (MT)-MMPs. Membrane-anchoring mechanisms include a transmembrane domain or a glycosphatidylinositol (GPI)-anchor (Fig 1.1).  The prodomain of MMPs contains the conserved sequence PRCXXPD (46,47), the cysteine of which binds the catalytically required zinc atom to maintain enzyme latency. Termed the cysteine-switch (47) disruption of the cysteine/zinc bond permits the replacement of the thiol group by a water molecule that facilitates nucleophilic attack of substrates. MMPs are generally secreted as zymogens that undergo proteolytic activation in vivo (48), though in vitro activation can be achieved with mercurial compounds, such as 4-aminophenylmercuric acetate, that disrupt the interaction  4           Figure 1.1 MMP structural characteristics The domain compositions of the 23 human MMPs are shown. The basic structure consists of a signal sequence (S), prodomain (PRO), catalytic domain, and hemopexin domain attached by a linker domain. The prodomain cysteine (C) associates with the catalytic zinc (Zn) to inhibit activity.  Gelatin-binding MMPs have additional fibronectin- domain inserts (Fn) in the catalytic domain. Proprotein convertase-activated MMPs have a consensus furin-like cleavage sequence (F) upstream of the catalytic domain. Additionally, membrane anchored MMPs have a transmembrane (TM) and cytoplasmic domain (Cs) or a glycosphotidylinositol (GPI) anchoring domain, or a cysteine-rich (Cys) and Ig domain.  5  6 between the prodomain and catalytic domain (49). Alternatively, membrane-type (MT)- MMPs, and MMP-11 and -28 contain the consensus cleavage sequence of proprotein convertases, RXXR, (50) in the residues at the C-terminus of the prodomain, which signals for removal of the prodomain by furin-like proteases within the trans-Golgi network and thus are activated intracellularly (51-55) The catalytic domain (reviewed in (56)) of MMPs is roughly spherical, with a shallow active-site cleft that requires substrate binding in an extended conformation (57). MMPs contain the highly conserved HEXGHXXGXXH sequence at the active site that coordinates the catalytic zinc. A mutation of the glutamate residue is sufficient to prevent enzyme activity (58,59). Substrate specificity for each MMP is mainly determined by the S1’ specificity loop, a pocket into which the residue C-terminal to the scissile bond fits. The hemopexin domain is a four-bladed propeller with a central calcium-containing pore. Absent from MMP-7 and MMP-26, the hemopexin domain present on all other MMPs contributes to substrate binding and specificity (60,61). A recombinant hemopexin domain of MMP-2 binds fibronectin and heparin in a calcium-dependent manner (62). The collagenase activity of MMP-1 and MMP-2 requires the hemopexin domain for processing of native collagen, in the case of MMP-2 this was shown to be through the unwinding of the collagen (63-65) Similarly, MMP-8, MMP-13 and MT1- MMP also bind collagen through the hemopexin domain (65-67). In addition to substrate recognition, the hemopexin domain can contribute to cell signaling as observed by MMP-9 hemopexin domain binding to low-density lipoprotein receptor-related protein to promote migration of schwann cells (68).  Regulation of MMP activity is maintained not only by latency in a zymogen form but also at the level of gene expression, by protease inhibition, and by specific localization. MMPs are generally expressed in response to external induction by cytokines, integrin- derived signals, cell stress and shape changes (reviewed in (69)) though exceptions to this include the constitutive production of MMP-2 (70) and MMP-7 (71), and neutrophil granule-stored MMPs, which are secreted following cell activation (5,72). MMP activity is inhibited by non-specific protease inhibitors including α2-macroglobulin and clusterin, and more specifically by four tissue inhibitors of metalloproteinases (TIMPs) (73). MMPs are produced by stromal cells and by immune cells (Fig 1.2) (25,74). While there is  7                          Figure 1.2 MMP and chemokine receptor expression Simplified view of the overlap in the distribution of both MMPs and chemokine receptors by multiple cell types including neutrophils (pink), mononuclear phagocytes (purple), endothelial cells (yellow), fibroblasts (orange) and lymphocytes (brown). The expression of MMP-8 and MMP-25/MT6-MMP is restricted to neutrophils, MMP-12 to mononuclear phagocytes, and MMP-26 and MMP-27 to lymphocytes.  8 considerable overlap in the source of some MMPs, others are specific to one cell type. MMP-2 and MMP-9 are widely distributed enzymes present in cells such as neutrophils, macrophages and fibroblasts (25). In contrast, MMP-8 (neutrophil collagenase/collagenase 2) and MT6-MMP (MMP-25/leukolysin) are found only in neutrophils (52,72,75,76), whereas MMP-12 (metalloelastase) is a macrophage-specific enzyme (77). Given the cellular localization, a role in inflammation is probable for these leukocyte-specific MMPs. Indeed, MMP-8, MMP-12 and MT6-MMP have all been implicated in inflammatory disease through the identification of elevated levels ((78-84)) or phenotypic effects in murine knockout models ((39,85)reviewed in (24)) . To understand the direct role of MMPs in disease is dependent upon knowing the substrate repertoire; what proteins are cleaved by a given MMP and what are the functional consequences. While both MMP-8 and MMP-12 have been shown to alter leukocyte recruitment through processing of inflammatory mediators (86-89), very little is known in regards to substrates of MT6-MMP. MT6-MMP MT6-MMP was first identified by Expressed Sequence Tag database searching against MT4-MMP (52). Tissue specificity was identified within peripheral leukocytes, thus the initial naming of the protein as leukolysin, and later confirmed to be specific to neutrophils (52,72). The C-terminus of the prodomain contains a sequence of five arginine residues, which correspond to the consensus cleavage sequence (RXXR) of furin-like proprotein convertases (PPC) (50) indicating the intracellular activation of MT6-MMP by PPCs (52). Based upon a hydrophobic segment at the C-terminus and no apparent cytosolic domain in the primary sequence, it was proposed and later confirmed that MT6-MMP was GPI-anchored to the plasma membrane (51,52,72).  GPI-anchors are post-translational modifications that occur in the endoplasmic reticulum (ER) composed of a phosphoethanolamine linker between the protein and glycan core, joined to a phospholipid tail for cell-surface anchoring (90). The GPI-anchor is synthesized within the ER where it is exchanged with the hydrophobic stretch of residues on the target protein (e.g. MT6-MMP) through a transamidation reaction (91). GPI-anchored proteins traverse through the trans-Golgi network and traffic to appropriate endosomes or lipid rafts in the cell membrane (92,93). In addition to MT6-  9 MMP, neutrophil expressed GPI-anchored proteins include the protease urokinase plasminogen activator (uPA) (94), uPA receptor (95), the complement regulatory protein cluster of differentiation (CD)59 (96), the β2 integrin-associated protein GPI-80  (97), and a lipopolysaccharide co-receptor CD14 (98). GPI-anchored proteins can be released from the cell surface by bacterial phosphoinsoitol-specific phospholipase (PL)C or serum-derived GPI-specific PLC (99,100).  Fractionation studies showed that MT6-MMP is located predominantly in tertiary granules and secretory vesicles but also on the plasma membrane and in secondary granules of resting neutrophils (72,99-101). Cell membrane-bound MT6-MMP is predominantly, though not exclusively, a homodimer through the hemopexin domain residue Cys532 (83,102). Stimulation of neutrophils by the chemokine CXCL8 or interferon (IFN)-gamma induces the release of MT6-MMP from intracellular stores (72), whereas stimulation and induction of apoptosis by PMA increases neutrophil surface localization of the enzyme (72,101). In a flow-cytometry based study with antibody to the MMP linker region, Fortin and colleagues could not detect MT6-MMP on the extracellular surface of resting neutrophils but only in permeabilized cells or on the extracellular surface of apoptotic cells, and so proposed that the enzyme faces inward. Yet, MT6-MMP is released from the resting neutrophil cell surface by PLC (72). An alternative hypothesis is that the structure of the enzyme is modified such that the epitope that this antibody detected is not available in resting cells.  As with other MMPs, enzymatic activity of MT6-MMP is regulated by TIMPs, including TIMP-1, -2, and -3, (101,103,104). Using a catalytic domain of MT6-MMP, English and colleagues identified TIMP-2 and TIMP-3 inhibitory activity to be greater than that of TIMP-1 (103). In contrast TIMP-1 inhibition was shown to be equivalent to that of TIMP- 2 against a soluble form of MT6-MMP containing the hemopexin domain (83,105), again highlighting the importance of this domain in protein interaction. The abundant serum protein clusterin is an additional inhibitor of MT6-MMP, identified by co-purification of the two proteins in a recombinant mammalian system and validated by addition to active protease (105).   10 Several studies have implicated MT6-MMP in both development and disease due to enhanced expression (83,84,106,107). Northern blot analysis of MT6-MMP identified elevated RNA levels in certain brain tumors, namely anaplastic astrocytomas and glioblastomas, but not in healthy brain tissue (84). Similarly, RNA was increased in a colon carcinoma cell line (84) and detected by in situ analysis in colon cancer tissue (83). Transformation of a colon cancer cell line with MT6-MMP resulted in cells with enhanced tumor growth in a murine model compared with the parent cell line (83). Increased expression of MT6-MMP was detected in a human NK cell line with enhanced migratory ability compared with an NK cell line lacking MMP expression (108). Together, these studies suggest a role for MT6-MMP in disease through the promotion of cell migration, though the substrates of MT6-MMP that are directly responsible have yet to be determined.  Several directed approaches have identified few MT6-MMP substrates. Proteolysis of myelin basic protein isoforms by MMPs, predominantly MT6-MMP, results in an immunogenic peptide proposed to contribute to MS pathogenesis (109). The activation of MMP-2 by MT6-MMP has been extensively studied, though with conflicting results. While a catalytic domain or a cell-associated form of MT6-MMP could not activate MMP-2 (51,84,103), a catalytically inactive MMP-2 was processed in the presence of catalytic MT6-MMP (110). The few other MT6-MMP substrates identified are extracellular matrix proteins (type IV collagen, gelatin, fibronectin, fibrin), alpha-1 proteinase inhibitor, and uPAR (103,109,111,112); galectin-3 has been reported, though no evidence has been shown (113). To identify disease-relevant substrates of MT6- MMP a novel approach, that has proven successful for other proteases, is required.  Unlike other proteases such as the aforementioned proprotein convertases that have a consensus cleavage sequence, MMPs have a broad specificity. Neither substrate nor cleavage site identification can be determined by analysis of the primary sequence of a protein. Therefore, substrate identification of MMPs requires biochemical analysis. To this end a number of methods have been successfully applied. A hypothesis-directed approach that evaluated MMP-8 proteolysis of all neutrophil-attracting chemokines in vitro revealed MMP-8 activation of the murine chemokine (m)CXCL5/LIX and human CXCL8/IL8, and showed this to be a critical step in the recruitment of neutrophils in vivo  11 (89).  Using a novel exosite scanning method, the Overall lab identified that CCL7/MCP- 3 bound to the hemopexin C-domain of MMP-2 in the yeast two-hybrid system, and confirmed this as a substrate (114). Proteolytic processing of CCL7/MCP-3 by MMP-2 resulted in an N-terminal truncation of the chemokine to remove the first 4 amino- terminal residues; a truncation that results in a strong receptor antagonist that is capable of reversing inflammatory responses in vivo (114,115). In a cell-based proteomics approach comparing Mmp2-/- cells expressing MMP-2 or inactive MMP-2, increased processing of heparin affin regulatory peptide (HARP) and connective tissue growth factor (CTGF) were observed and shown to decrease the inhibitory activity of these vascular endothelial growth factor (VEGF) binding proteins (116).  Significant progress has been made in the last decade to identify bioactive substrates of MMPs and their functional effects (reviewed by (34,38,117,118)). It is now recognized that MMPs process proteins involved in all stages of the inflammatory response. One family of proteins that is critical to inflammation, and half of which are confirmed substrates of MMPs, are chemokines. Chemokines The chemokine superfamily represents over 48 structurally related proteins that are required for the directional migration of leukocytes, both in homeostasis and disease (119). Though chemokine amino acid similarity ranges from 20-95%, all chemokines have the same general structure (120). This includes a flexible N-terminus prior to conserved cysteine residues, followed by a loop of ~10 amino acids (termed the 30s loop), a single-turn helix and three beta-strands leading into the C-terminal alpha-helix (120) (Fig 1.3). Division into four chemokine subfamilies is based on the pattern of the N-terminal cysteine residues, corresponding to C, CC (beta), CXC (alpha) and CX3C chemokines where X represents any amino acid (121). A further subdivision of CC chemokines is N6Ckines, so called due to the presence of an extended N-terminus and an additional disulfide bond. N6Ckines include mCCL6 and mCCL9 in mice and human (h)CCL15 and hCCL23 (122). The recent renaming of mCCL6 and mCCL9 (Chemokine Gordon Conference, 2010) to mCCL15 and mCCL23 is due to tertiary, but not primary structural homology. A sub-division of CXC chemokines is based upon the presence or absence of a Glu-Leu-Arg (ELR) sequence that is critical for agonist activity (123,124).  12                     Figure 1.3 Chemokine structure Schematic of the conserved structural features of chemokines. The N-terminus (NH2) is separated from the N loop by the conserved cysteine (C) residues. A β-strand leads into the 30s loop, which contains a cysteine that forms a disulfide bond with an N-terminal cysteine.  The second and third β-strand are followed by a fourth conserved cysteine residue, involved in a disulfide bond with the N-terminus, and finally an α-helix in the carboxy-terminus that is involved in glycosaminoglycan binding.  13 Chemokines can alternatively be divided functionally into homeostatic and inflammatory proteins. While homeostatic chemokines (CXCL12, CCL19, CCL20, CCL21, CCL25, CCL27) are constitutively produced and function primarily in directing cell migration in the bone marrow and lymphatics (125), inflammatory chemokines are upregulated in response to inflammatory stimuli (126,127), and function primarily in directing leukocytes to the affected tissue (128).  In response to an inflammatory stimulus, local cells release chemokines that form a haptotactic (substrate-bound) gradient by binding of the chemokine C-terminal α-helix to glycosaminoglycan (GAG) side-chains of proteoglycans (129,130). Heparan sulphate is ubiquitously expressed whereas heparin, chondroitin sulphate and dermatan sulphate have cell and organ specific localization (131). The interaction between negatively charged GAGs and chemokines is dependent upon a positively charged motif. The BBXB motif, where X is a basic residue, observed in CCL5 (132) is common to other chemokines (133-135). Through the use of chemokine mutations it was shown that in vivo, in addition to creating a high local concentration, GAG interaction permits oligomerization that is required for activation of cells by some chemokines, including CCL5 (129). Following chemokine arrest and gradient formation on GAGs, residues within the 30s-loop and N-loop or N-terminus of the chemokine bind residues in the extracellular domains of cognate leukocyte-expressed chemokine receptors (136-139). Chemokine receptors have an extracellular N terminus, seven transmembrane domains and an intracellular C-terminal domain that interacts with signaling molecules (140). Currently, there are 19 known G protein-coupled receptors (GPCR) that signal upon binding of chemokines (Table 1.1) (141,142) and an additional 4 receptors that bind but do not signal, thereby acting as decoy receptors (143). There is promiscuity among chemokines and their receptors in that more than one chemokine may bind to one receptor, and likewise one chemokine may bind multiple receptors (141,142). Yet, binding is generally restricted within subclasses, thus receptor nomenclature correlates with subclass specificity such that receptors binding to CC chemokines are termed CCR1 through CCR10. Chemokine receptor expression is not limited to leukocytes, but also occurs on endothelial, fibroblast and tumor cells (Fig 1.2), however, their exact roles here are less well studied. Similarly, chemokines reportedly have antimicrobial  14 (144,145) and angiogenic functions (146) though the mechanisms are less well understood than the effects on cell migration.  Following ligand binding, dissociation of the G protein initiates a cascade of events leading to calcium mobilization from intracellular stores, gene expression and ultimately cell polarization and migration (reviewed in (147,148)). While not fully understood, it appears that there are differences in chemokine activation of GPCR pathways through the G subunits involved in the intracellular signaling, perhaps providing selectivity in chemokine responses (149). Phosphorylation of Ser and Thr residues in the intracellular loops and carboxyl-terminus of the chemokine receptor can result in receptor desensitization and recruitment of adaptor molecules to promote clathrin-mediated endocytosis (150,151). Alternatively, internalization of some chemokine receptors is mediated through caveolae (152).  Given its role in receptor binding and activation, post-translational modification of the chemokine N-terminus results in significant functional effects (153). Similarly, changes to the C-terminus can alter the GAG-binding capacity, and thus the haptotactic potential of chemokines (154). A significant post-translational modification that has been observed to alter function of chemokines both in vitro and in vivo is proteolytic truncation of the termini (reviewed in (155,156)) (Table 1.1). The functional effect of chemokine processing is cleavage site and chemokine specific (Table 1.1). Yet, in general, the ELR+ CXC chemokines have enhanced activity following N-terminus proteolysis provided that the ELR motif remains intact (124,157). In contrast, ELR- CXC chemokine agonist function is reduced or eliminated by removal of any residues at the N-terminus. A distinction is less apparent among the CC chemokines though it appears from those that have been evaluated that N-terminus truncation results in a loss of agonist activity (Table 1.1). Notable exceptions are truncations of CCL14, CCL15 and CCL23 (122,158,159). Both exopeptidases, such as dipeptidyl peptidase (DPIV), and endopeptidases, including MMPs and the serine proteases, have roles in chemokine processing (Table 1.1) (155).  15 Table 1.1 Human chemokine receptor preferences and truncation variants No differentiation is made between monocyte (Mono) subtypes or macrophage (Mφ) subtypes. Other cells types represented include neutrophil (PMN), dendritic cells (DC) and natural killer cells (NK). Italics indicates assumed by similarity (no experimental evidence); *indicates truncations identified in biological samples Chemokine Receptors Cell Source Target Cell Truncations Functional Effect Protease Reference CXC (ELR+) (4-73) Increased activity (30x) Unknown* (160) (5-73)  Increased activity (30x) Unknown* (160) PMN, Endothelial (6-73) Increased activity (30x) Unknown* (160) CXCL1 (1-73) CXCR2, CXCR1 Mono  Degraded Clearance MMP9 (161) Mono, PMN PMN (5-73) Decrease hematopoietic progenitor cell proliferation MMP-1 MMP-9 MMP-12 (87,162) CXCL2 (1-73) CXCR2   (7-73) ND MMP-12 (87) (5-73) Increased activity (5x) Unknown* (160) CXCL3 (1-73) CXCR2 Mono, Endothelial PMN, Endothelial (7-73) ND MMP-12 (87) Platelet PMN, Mono (17-70) Inhibit endothelial cell proliferation Unknown* (163) CXCL4 (1-70) CXCR3B   Degraded Clearance MMP9 (161) Mono PMN (5-78) Increased neutrophil activation Cathepsin G (164)   (6-78) ND MMP-9, MMP-12 (87) CXCL5 (1-78) CXCR1, CXCR2, DARC   (8-78) Increased activity MMP-1, MMP-8 (87,89)  16 Chemokine Receptors Cell Source Target Cell Truncations Functional Effect Protease Reference   (9-78) Increased neutrophil activation Cathepsin G (164)   (10-78) Reduced neutrophil activation Cathepsin G (89,164)    (11-78) ND MMP-12 (87) PMN (3-77) No change DPIV (165)  (5-77) Increased activity Unknown (166) Fibroblast, Epithelial  (9-77) Increased activity Unknown* (166)   (15-77) ND MMP-12 (87) CXCL6 (1-77) CXCR1, CXCR2, DARC   Degraded  MMP-1 MMP-9 (87) Platelet PMN, Fibroblast (1-57) ND MMP-12 (87)   (1-63) Increased activity Unknown* (167)   (1-66) Increased activity Unknown* (167,168)   (1-68) Increased antimicrobicidal  Unknown* (169) CXCL7 (1-70) CXCR2, DARC   Degraded Clearance MMP-9 (161) Mono, PMN ND Increased activity (10x) MMP-9 (170)  (5-77) Increased activity (5x)  Thrombin (171)  PMN, Basophil, T cell (6-77) Increased activity MMP-8, MMP-13, MMP-14 Thrombin (89,172) CXCL8 (1-77) CXCR1, CXCR2, DARC   (7-77) Increase CXCR1>CXCR2 (10x) MMP-1, MMP-9, (87,89,161,173)  17 Chemokine Receptors Cell Source Target Cell Truncations Functional Effect Protease Reference MMP-12   (7-72) No change to heparin binding Synthesized (173)   (10-77) Inactivating MMP-12 (87)    (1-69) (1-66) (1-63) (1-60) (1-58) (1-54) (1-51) Decrease heparin binding Synthesized (173)  CXC (ELR-) Fibroblast, Endothelial T cells (3-70) No change to inhibition of CXCL8 angiogenic activity DPIV (174,175) CXCL9 (1-103) CXCR3   (1-90) ND MMP-8 (154) Keratinocyte T cells, Mono 3-77 Receptor antagonist Decreased receptor binding DPIV, DPVIII (174-176)   (5-77) (6-77)  MMP-2, MMP-9 (177)   (1-73) No change to inhibition of CXCL8 angiogenic activity MMP-8 (154,174) CXCL10 (1-77) CXCR3   (1-71) ND MMP-8 (154)  18 Chemokine Receptors Cell Source Target Cell Truncations Functional Effect Protease Reference T Cell (3-73) Decreased activity DPVIII (174-176)  (4-73) R antagonist Synthesized (178) CXCL11 (1-73) CXCR3, CXCR7, DARC Mono, Fibroblast, Endothelial  (5-73) (5-58) (6-63) Receptor antagoinist Loss of GAG binding MMP-8, MMP-9, MMP-12 (154)  T cell, DC, B cell, Mono (3-67) Loss of CXCR4 activity DPIV (175,179)   (4-67) Loss of CXCR4 activity Elastase (180)   (5-67) Loss of CXCR4 activity CXCR3-mediated neurotoxicity MMP-1 MMP-2 MMP-3 MMP-9 MMP-13 MMP-14 (181-183) CXCL12 α (1-67)  CXCR4, CXCR7   (6-67) Loss of CXCR4 activity Cathepsin G (184) CXCL13  CXCR5  B cell, T cell ND CXCL16 (32-107) CXCR6  T cell, NK  Shedding ADAM10 (185,186)  CCL  19 Chemokine Receptors Cell Source Target Cell Truncations Functional Effect Protease Reference CCL1 (1-73) CCR8, CCR1, DARC, D6 T cell, Endothelial, Mφ PMN, T cell, Mono ND Mφ, Fibroblast, Endothelial, Basophil, Smooth muscle Mono, T cell, baso (1+9-97) CCR2 anataontist Synthesized (187)   (2-76) Increase eosinophil acivity Decrease basophil activity Synthesized (188)   (4-76) No change to basophil and eosinophil activity Synthesized (188) CCL2 (1-76) CCR2, CCR1, DARC, D6   (5-76) In vivo reduction of cell migration No change to basophil and eosinophil activity  MMP-1, MMP-2, MMP-3, MMP-8, MMP-9, MMP-12 MMP-13, MMP-14, (87,114,115,177) (188)     (6-76) Loss of activity Synthesized (188) CCL3 (1-70) CCR1 CCR5 D6 Mφ, T cell Mono, Mφ, T cell, Basophil, DC Unknown Loss of activity MMP8 (88)  20 Chemokine Receptors Cell Source Target Cell Truncations Functional Effect Protease Reference     Degraded Clearance Cathepsin D (189) Mφ, T cell, B cell Mono, Mφ, T cell, NK, Basophil, DC (3-69) Increase CCR1 activity No change to CCR5 DPIV (175,190) CCL4 (1-69) CCR1, CCR5, CCR8, D6   (7-69) (8-69) (9-69) Loss of Dimeric properties Synthesized (191)     Degraded Clearance Cathepsin D (189) T cell, platelet, Fibroblast Mono, Mφ, T cell, NK, Basophil, Eosinophil, DC (3-68) Decrease CCR1, CCR3 Activity Increase CCR5 Increase anti-HIV activity  (165,175,192-194)   (4-68) Receptor antagonist Decrease anti-HIV activity Unknown* (195) CCL5 (1-68) CCR1, CCR3, CCR5, DARC, D6   (9-68) Receptor antagonist Synthesized (196) Mφ, Mono, Fibroblast Mono, T cell, Eosinophil, Basophil, DC (5-76) Receptor antagonist In vivo reduction of cell migration MMP-1, MMP-2, MMP-3, MMP-12 MMP-13, MMP-14, (87,115) CCL7 (1-76) CCR2, CCR1, CCR3, CCR4, DARC, D6   (6-76) (10-76) Receptor antagonist Receptor antagonist Unknown* Synthesized (197) (196)  21 Chemokine Receptors Cell Source Target Cell Truncations Functional Effect Protease Reference  Fibroblast, mono (5-76)  MMP-3 MMP-12 (115) (87)  (1-73)  MMP-12 (87) CCL8 (1-76) CCR2, CCR1, CCR3, CCR5, D6  Mono, T cell, Eosinophil, Basophil (5-73)  MMP-12 (87) Mφ, Epithelial Mono, Eosinophil (3-74) Decrease CCR3 activity DPIV (198,199) CCL11 (1-74) CCR3, CCR5, D6, CXCR3   (4-74) No change Unknown* (200) Mφ, Endothelial, Epithelial Mono, T cell, Eosinophil, Basophil, DC (4-75) (5-75) CCR3 antagonist MMP-1, MMP-3 (115)   (8-75) CCR3 antagonist MMP-1 (115) CCL13 (1-75) CCR2, CCR3, CCR1, CCR5, DARC, D6   (5-72) ND MMP-12 (87) Epithelial Mono, T cells, PMN, Eosinophil (3-74) (4-74) (6-74) ND ND Ca2+ mobilization Unknown* Unknown* Synthesized (201) (201) (202)   (7-74) Increase CCR1, CCR3 and CCR5 activity Synthesized (202)   (8-74) Increase CCR1, CCR3 and CCR5 activity Synthesized (203) CCL14 (1-74) CCR1, CCR3, CCR5, D6   (9-74) Increase CCR1, CCR3 and CCR5 uPA, Plasmin (158,203,204)  22 Chemokine Receptors Cell Source Target Cell Truncations Functional Effect Protease Reference activity Increased Anti-HIV1 activity *further degraded by plasmin   (10-74) Highest agonist activity Synthesized (202)   (11-74) Increase CCR1, CCR3 and CCR5 activity Synthesized (202)    (12-74) Increase CCR1, CCR3 and CCR5 activity Synthesized (202) Mφ, T cell, B cell, NK, Epithelial Mono, T cell, DC, PMN? (5-92) Increase CCR1 activity Decrease CCR3 activity Synthesized (205)   (22-92) increase CCR1 Elastase (122,159)   (24-92) increase CCR1 Cathepsin G (159)   (25-92)  Increase CCR1 activity Synthesized (Lee et al., 2002)   (27-92) increase CCR1 Cathepsin G (159)   (28-92) increase CCR1 Synthesized (Lee et al., 2002)   (29-92) increase CCR1 Cathepsin G Chymase (122) (Lee et al, 2002) CCL15 (1-92) CCR1, CCR3, CCR5, DARC   (30-92) increase CCR1  (Lee et al., 2002) CCL16 (1-97) CCR1 CCR5 Mφ, NK, T cell Mono ND CCL17 (1-71) CCR4 CCR8 Mφ, Lymphocyte T cell, DC, NK ND  23 Chemokine Receptors Cell Source Target Cell Truncations Functional Effect Protease Reference DARC D6 Mφ, DC T cell (3-69) ND Unknown* (171)   (4-69) ND Unknown* CCL18 (1-69) Unknown   (1-68) ND Unknown* CCL19 (1-77) CCR7, CCXCKR Mφ T cell, DC, B cell (8-38) CCR7 antagonist Unknown* (206) Mφ Mono, T cell, DC (1-52) (1-55) Loss of activity Cathepsin D (207) CCL20 (1-70) CCR6   (1-66) No change Cathepsin B (207) CCL21 (1-111) CCR7, 8 CCXCKR, CXCR3 Mφ T cell, B cell (1-58), (59-111) Loss of activity Cathepsin D (189) Mφ, mDC, mono DC, NK, T cell (3-69) Effect Th cell response; Decrease CCR4 activity; Maintain anti-HIV activity  DPIV (175,208,209) CCL22 (1-69) CCR4, D6   (5-69) Decrease CCR4 activity Maintain anti-HIV activity DPIV (208) CCL23 (1-92) CCR1, D6 Mono Mono, T cell, DC, PMN (splice variant) (19-99) (22-99) (24-99) (25-99) (27-99) Increase ccr1 Increase ccr1 Increase ccr1 Increase ccr1 Increase ccr1 Unknown* Unknown* Unknown* Unknown* Cathepsin G (122) (122) (210) (210) (122)  24 Chemokine Receptors Cell Source Target Cell Truncations Functional Effect Protease Reference Chymase   (30-99) Increase ccr1 Elastase (122) CCL24 (1-93) CCR3, CCR5, D6 Mφ, T cell T cell, Eosinophil, Basophil ND CCL25 (1-127) CCR9, CCXCKR DC T cell ND CCL26 (1-77) CCR3 Mφ Eosinophil, Basophil ((2-9)-77)  Receptor antagoinst  (211) CCL27 (1-88) CCR10, CCR3 Epithelial T cell ND CCL28 (1-101) CCR10, CCR3 Epithelial T cell, Eosinophil ND  CXCL Mono, T cell  Shedding ADAM10 (212-215) CX3CL1 (1-316) *extra-cellular CX3CR1, DARC Endothelial  (4-71)  MMP-2 (216) XCL XCL1 (1-93) XCR1  T cell, NK ND XCL2 (1-93) XCR1  T cell ND  25 CXCL8 (1-77), the prodigal human neutrophil chemoattractant, is an ELR+ chemokine (with Glu at position 9) processed by MMP-8, MMP-13 (89), plasmin (217), thrombin (172), and cathepsin L (218) to the product CXCL8 (6-77) with increased chemotactic potential. The range of proteases capable of cleaving at this specific site indicate the importance of this activation, though additional activating truncation sites have also been identified including (7-77) (89), (8-77) (219) and (9-77) (217). Similarly, murine CXCL5/LIX (1-92), the orthologue of human CXCL8, is efficiently cleaved by MMP-1, 2, 8, 9 and 13 to the N-terminus truncation product (5-92) that has enhanced neutrophil chemotactic potential in vitro (89). In an air pouch model of inflammation, subcutaneous injection of LPS or mCXCL5/LIX (1-92) resulted in significantly decreased neutrophil influx in Mmp8-/- mice compared with wild-type counterparts (89). Injection of mCXCL5/LIX (5-92) into air pouches in Mmp8-/- mice resulted in equivalent cellular recruitment to that observed in the wild-type mouse (89), implicating MMP-8 in promoting cellular recruitment, and supporting previous results in which Mmp8-/- mice showed abrogated neutrophil recruitment in a skin carcinogenesis model and decreased mCXCL5/LIX processing in LPS-stimulated bronchoalveolar lavage fluid (39). The role of MMP-8 processing is an example of a positive feedback mechanism for neutrophil recruitment. A similar amplification is suggested for cathepsin G processing, and for MMP-8 and MMP-9 processing of human CXCL5 (89,164,220).  CXCL12 is an ELR- chemokine with two main isoforms (α and β) that differ at the C- terminus. Carboxy-peptidase activity on CXCL12α reduces the activity of the chemokine (221), whereas N-terminus truncation by DPIV (165,222-224), elastase (180), cathepsin G (184) and MMP-1, 2, 9, 13, 14 (181) results in a loss of CXCR4 agonist activity. Moreover, the MMP-truncated product CXCL12 (5-67) gains CXCR3 binding and signaling activity (182) wherein it is a potent and specific neurotoxin (183).  The first identification of a role of MMP processing of chemokines was made through a novel yeast two-hybrid screen using the MMP-2 hemopexin domain that identified the monocyte chemoattractant CCL7 as a binding protein (114). Further analysis showed that the interaction between CCL7 and MMP-2 was dependent upon the hemopexin domain, and was specific to CCL7 and not the related chemokine CCL2 (114). Additional work demonstrated specific N-termini proteolysis by MMPs of CCL2, CCL7,  26 CCL8 and CCL13 to result in products capable of binding but not activating CCR2 and CCR3, thereby transitioning to receptor antagonists (87,114,115). Moreover, in zymosan-induced murine intraperitoneal or carrageenan-stimulated rat paw inflammation models, injection of the MMP-truncated chemokines attenuated cell recruitment, demonstrating the capacity of truncated chemokines to halt the inflammatory response (114,115). Using an anti-neo-epitope antibody that recognizes the residues corresponding to the MMP-cleavage site, truncated CCL7 was identified in synovial fluid from arthritic patients, indicating that the cleavage occurs in vivo (114). However, it is evident from this finding that in chronic inflammatory disease other biological systems have overcome this apparent mechanism to inhibit cellular recruitment.  In contrast to the inactivation of those CC chemokines, serine proteases elastase, chymase and cathepsin G processing of the two human N6Ckines, CCL15 and CCL23, result in multiple products with enhanced CCR1 agonist activity (122,159). N-terminally truncated CCL15 and CCL23 were both identified in synovial fluid from arthritic patients at concentrations of 10- to 100-fold that of CCL3 and CCL5 (122). Elevated levels of CCL15, wherein the full-length and truncated forms were not differentiated, have also been detected in patients with sarcoidosis (225) and melanoma (226), while CCL23 is overexpressed in acute myeloid leukemia (227).  While most chemokines have an 8-10 residue N-terminus, CCL15 and CCL23 have 31 and 32 amino acids N-terminal to the conserved cysteine residues. Neither CCL15 nor CCL23 are potent chemoattractants in the full-length form (210,228) though they reportedly suppress myeloid cell differentiation (228,229). In recombinant expression systems, truncation variants were produced naturally and found to have enhanced agonist activity (210,230). In an in vitro assay, CCL15 (1-92) and CCL23 (1-99) were processed by synovial fluid from arthritic patients to the products CCL15 (25-92) and CCL23 (19-99) (122). Predicting a role for serine proteases in the processing of these chemokines, in vitro analysis was performed (122). Cathepsin G cleavage of CCL15 (1- 92) resulted in the truncation products (24-92), (27-92) and, as with chymase, the product (29-92). Both neutrophil supernant and elastase proteolysis produced CCL15 (22-92). Cathepsin G and chymase processing of CCL23 (1-99) produced (27-99) while  27 the product of elastase cleavage was (30-99). Therefore none of the serine proteases analyzed were responsible for the cleavages observed by synovial fluid, implicating other proteases in these truncations. Yet, this was the first report of an activating truncation of CC chemokines. Moreover, the presence of truncated CCL15 and CCL23 in synovial fluid indicates that these truncated chemokines may contribute to the cellular recruitment that is observed in chronic inflammation. While the role of MMPs in chemokine regulation to attract monocytes has yet to be demonstrated, CCL15 and CCL23 are likely MMP-candidates. It is important to identify the proteases responsible for this potentially important cell recruitment mechanism. MMPs in the acute inflammatory response Following an initiating stimulus, vascular damage induces the release of lipid mediators that contribute to vasodilation, cellular recruitment and ROS production. Further, host injury results in cell necrosis and thus the release of intracellular molecules and the upregulation of extracellular matrix components that are capable of initiating an inflammatory response (231). These endogenous factors, or alarmins bind to pattern recognition receptors on the surface of stromal cells to activate multiple interconnected systems. Tissue factor (TF), exposed on the injured vessel wall, interacts with plasma factor VIIIa, leading to the activation of the coagulation cascade. MMPs processing and decreasing activity of TF pathway inhibitor promotes coagulation (232,233). Ultimately, activated thrombin converts fibrinogen to fibrin for clot formation to limit blood loss.  The kallikrein-kinin system is activated by factor XIIa conversion of prekallikrein to kallikrein, a protease responsible for processing of high molecular weight kininogen to the vasoactive amine bradykinin. Bradykinin, a MMP-8 substrate (234), induces vasodilation and the production of proinflammatory cytokines and tissue-type plasminogen activator (tPA). Proinflammatory cytokines, including TNF-α and IL-1β, stimulate the release of chemoattractant cytokines, upregulate cellular adhesion molecules that mediate white blood cell rolling and attachment to the endothelial surface, and induce leukocyte activation. TNF-α activation in vivo appears to be due primarily to ADAM-17 (235), though both TNF-α and IL-1β are activated by MMPs in vitro (236,237), The fibrinolysis system is activated by tPA, kallikrein, or factor XIIa conversion of plasminogen to the fibrin-degrading enzyme plasmin, which regulates clot  28 formation. MMP-3, 7, 8, 12, 13, 14, and 17 promote fibrinolysis through cleavage of fibrin or degradation of fibrinogen (238-242). In addition, inhibition of the clotting cascade occurs through MMP degradation of factor XII (238,239).  Similar, to alarmins, infectious agents express non-self molecules, including LPS, bacterial proteins and proteoglycans, collectively termed pathogen-associated molecular patterns (PAMPs). Collectively, PAMPS and alarmins are termed damage associated molecular patterns (DAMPs) (231). PAMPS activate the complement system (reviewed by (243)), which contributes to opsonization and elimination of pathogens. Additionally, plasmin, factor XII and thrombin activate components of the complement system, which in turn promotes coagulation through induction of tissue factor and plasminogen-activator inhibitor (PAI-1). Complement inhibition may occur through the MMP-14 processing of C3b (244).  Alarmins are recognized by PRRs on the patrolling monocyte surface. These cells rapidly migrate into the tissue and, through production of proinflammatory cytokines including chemokines, promote the recruitment of neutrophils, which precedes the recruitment of inflammatory monocytes. Neutrophil recruitment in inflammation is rapid, occurring within hours and lasting for up to 24 hours. This responsiveness is due in part to presence of neutrophil chemoattractants as pre-stored proteins, or those enzymatically activated rather than requiring de novo synthesis (15). The predominant neutrophil-attracting chemokines CXCL5 and CXCL8 are enzymatically activated by MMP-8, 9, 12 (87,89,220) (Table 1.1), and bind to CXCR1 and CXCR2 on the neutrophil surface (Fig 1.2). Additionally, the MMP-8 cleavage of type I collagen produces the neutrophil chemoattractant peptide Pro-Gly-Pro (245). Cell migration is also enhanced through MMP-7 cleavage of E-cadherin to reduce inter-endothelial cell contacts (246).  Within tissue, activated neutrophils amplify the inflammatory response through leukotriene B4 release (247) and de novo synthesis of cytokines, chemokines and growth factors (248). Neutrophils release neutrophil extracellular traps (NETs) to contain bacteria (11,249), secrete antibacterial α-defensins, produce ROS and phagocytose bacteria. MMPs contribute to bacteria removal indirectly through MMP-7 activation of α-  29 defensin (250,251). Neutrophils also release monocyte chemoattractants to progress the inflammatory response. Following activation, degranulation and phagocytosis, neutrophils undergo apoptosis. Through the presentation of neutrophil proteins and charge changes on the surface (252) neutrophil apoptosis is an amplifying event for the recruitment and polarization of mononuclear phagocytes (253).  Inflammatory monocytes express CCR1, CCR2, CCR6, CXCR2 and CX3CR1 (Fig 1.2). Some of the ligands that bind to these receptors are produced by endothelial cells (CCL2), neutrophils (CCL3, CCL4), and by macrophages (CCL15, CCL23). Notably, the role of MMPs in activating monocyte recruitment has not been identified. The production of proinflammatory cytokines is lower in inflammatory monocytes than patrolling monocytes, but they have a higher bacterial clearance capacity. As outlined above, the differentiation of monocytes to macrophages is dependent upon cellular signals. It is likely that in infection, monocytes exposed to LPS and IFN-gamma would differentiate to M1-type macrophages, which produce IL-23, CCL5, CXCL9 and CXCL10 (19). Both CXCL9 and CXCL10 recruit Th1 cells, though MMP-8 processing of these chemokines results in receptor antagonists (154). M2b-type macrophages release pro-inflammatory mediators including TNF-α, IL-1β, IL-6 and CCL1. M2a-type cells produce IL-10, CCL2, CCL17, CCL18, CCL22 and CCL24, which may promote progression towards resolution through T-cell recruitment and M2c-type macrophage differentiation (19). M2c-type macrophages produce transforming growth factor (TGF)-β and the B-cell chemoattractant CXCL13. Macrophages function to eliminate pathogens through multiple pathways, the levels of which depend upon the subtype; pathogens are recognized by toll-like receptors on the macrophage surface, bacteria are eliminated by phagocytosis and the production of antimicrobial peptides or ROS.  While leukocytes are critical to the elimination of pathogens and debris resulting from injury, an unregulated response causes host tissue damage. Oxidizing agents including superoxide and nitric oxide, as well as proteases and antimicrobial proteins are capable of damaging host tissue, which propagates the inflammatory response. As such, the termination of leukocyte recruitment is a critical step in inflammation resolution. This is achieved by a lipid-mediator class switch (254,255), inhibition of leukocyte recruitment and production of anti-inflammatory cytokines. Neutrophil interaction with platelets and  30 endothelial cells induces the production of lipoxin (254), a lipid mediator that inhibits neutrophil migration through cell arrest (256). In contrast, lipoxin induces intracellular calcium mobilization, and thus chemotaxis, of monocytes (256-258), though the type of monocyte (inflammatory or patrolling) is unknown. Neutrophil-derived resolvins inhibit neutrophil migration and stimulate anti-inflammatory pathways in monocytes and macrophages (259,260). MMP-7 cleavage of syndecan eliminates the haptotactic gradient required for cell migration (261). Cleavage of intercellular adhesion molecule-1 by MMP-13 and MMP-14 (262-264), and of β2 integrin by MMP-9 (265) would inhibit leukocyte-endothelial interactions required for leukocyte migration.  The down-regulation of chemokines is achieved in part through the upregulation of decoy receptors – including CCR5 expression on apoptotic neutrophils and lymphocytes (266), and the non-signaling receptor D6 (267) thereby reducing inflammatory monocyte recruitment. In addition, proteolysis of chemokines is a critical step to modify their function, eliminating agonist activity and creating receptor antagonists to stop neutrophil and monocyte recruitment (87,114,115). CXCL1, CXCL2 and CXCL3 cleavage by MMP-9, MMP-12, and in the case of CXCL2 also by MMP-1, eliminate receptor activation and chemotactic potential toward neutrophils, suggesting a negative feed- back mechanism (87). Processing of the monocyte chemoattractants CCL2, CCL7, CCL8 and CCL13 by MMPs results in receptor antagonists, and in the case of CCL7 a product that reverses the inflammatory response in vivo (114,115). So far there is very little evidence for any proteolytic regulation of chemokine receptors, however this is difficult to study and so it is possible that this is yet another level of regulation.  Annexin A1, released from neutrophil granules, promotes neutrophil apoptosis and, along with complement C1q and thrombospondin, promotes phagocytosis by macrophages (268-270). C1q binding protein is cleaved by MMP-14 (244) as is mannose binding lectin, which is also involved in complement activation (271) and therefore cleavage may inhibit this activity. Macrophage phagocytosis of neutrophils reduces TNF-α, IL-1β and CXCL8 production while upregulating the anti-inflammatory cytokine TGF-β1 (272-274). Further MMP-1, 2, 3, and 9 process and inactivate IL-1β (275) while TGF-β1 is activated in vitro by MMP-2, 3, 9 and 14 (276-278).   31 TGF-β1 induces fibroblast differentiation and the production of matrix components while down-regulating several MMPs, with the exception of MMP-2, which has been proposed to remove misfolded collagen (279,280). Moreover, MMP-2 cleavage and inactivation of CCL chemokines to generate receptor antagonists down regulates monocyte recruitment (114,115). A provisional, fibronectin-rich matrix (281) is formed for the temporary adhesion of cells and initiation of angiogenesis. This is replaced by a collagen-rich matrix initially composed of type I collagen and ultimately a more permanent and durable collagen such as type III (279,282). Macrophage phagocytosis of neutrophils results in the secretion of VEGF (283) and MMP cleavage of CTGF and HARP, mobilizes VEGF, thus promoting angiogenic activity (65,116,284). As such, resolution of inflammation and wound healing begin.  Theme and Hypotheses The broad focus of the research presented herein is the role of MMPs in regulating inflammation. Specifically, I am interested in the events that occur after neutrophils are recruited, predominantly the role of the neutrophil-specific protease MMP-25/MT6-MMP, and the recruitment of inflammatory monocytes. At the time that this thesis research began, there was minimal information regarding substrates of MT6-MMP and thus little indication as to the functions of this enzyme. The following themes and hypotheses are addressed in this thesis.  i) In Chapter 2, I hypothesize that monocyte chemoattractants are MMP substrates, and that processing of these alters the inflammatory process. Therefore, I performed a family-wide screen of MMP-proteolysis of the 14 CC chemokines involved in monocyte recruitment. I found that all of the chemokines were processed by one or more MMPs. Furthermore, MMP-processing of CCL16 increased the glycosaminoglycan binding of the protein whereas a comprehensive analysis of the two N6C chemokines CCL15 and CCL23 revealed that processing by MMPs resulted in more potent receptor agonists.  ii) In Chapter 3, I hypothesize that MT6-MMP substrates would include extracellular matrix proteins, chemokines and proteins secreted from fibroblasts.  I expressed and purified a soluble form of MT6-MMP to evaluate the in vitro processing of potential  32 substrates.  Additionally, I applied a proteomics approach to identify novel substrates of MT6-MMP amongst the secreted proteins (secretome) of human fetal lung fibroblasts, identifying cystatin C, SPARC, galectin-1, insulin-like growth factor binding protein-7 and vimentin as substrates. Further, I identified vimentin as a chemotactic factor for THP-1 cells, a function that is terminated by MMP cleavage. These studies confirmed 19 substrates of MT6-MMP, and identified an additional 50 candidate substrates.  iii) In their recruitment to sites of inflammation and in situ, neutrophils interact with the endothelial layer and tissue. Thus, in Chapter 4 I hypothesize that both fibroblasts and endothelial cells produce proteins that are substrates of neutrophil MT6-MMP.  To evaluate this, I grew human fetal lung fibroblast cells and human microvascular endothelial cells in the presence of active or catalytically inactive soluble MT6-MMP. I then performed proteomic analyses on both the conditioned media and membrane- enriched protein fractions from these cells to identify novel substrates of MT6-MMP. Candidate substrates include prosaposin, progranulin, cluster of differentiation 59 and endoplasmic reticulum-golgi intermediate compartment (ERGIC)-53.  This research has advanced our knowledge of the function and mechanisms by which MMPs contribute to the progression of the acute inflammatory response towards wound healing, and how an overactive response could transition to chronic inflammation.  33 CHAPTER 2: MATRIX METALLOPROTEINASE PROCESSING OF MONOCYTE CHEMOATTRACTANTS: CCL15 AND CCL23 ARE ACTIVATED WHEREAS CCL16 CLEAVAGE INCREASES GLYCOSAMINOGLYCAN BINDING Synopsis Chemokines are structurally related chemoattractant cytokines that orchestrate leukocyte migration and activation in inflammation upon binding to G-protein coupled receptors. The matrix metalloproteinases (MMPs) are an important family of proteases responsible for maintaining the homeostatic signaling and extracellular matrix environment of connective tissue cells in health and inflammation. We have reported that MMP processing can activate or inactivate chemokines, generate antagonist forms, switch receptor specificity or alter glycosaminoglycan binding, and thus modulate chemokine roles in cellular recruitment. Here, we performed a family-wide investigation of MMP processing of all monocyte-directed CC chemokines. All 14 chemokines are cleaved by one or more MMPs. We identified and sequenced 149 MMP cleavage sites, 28 of which are novel, including the first reported instance of CCL1, CCL16 and CCL17 proteolysis. MMP processing of the 97 amino acid residue CCL16 (1-97) generates two products: CCL16 (8-77) and CCL16 (8-85) that exhibit enhanced glycosaminoglycan binding in vitro. CCL23 (1-99) and the related CCL15 (1-92) are unusual chemokines with 31 and 32 amino acid residue extended amino (N)-termini from the characteristic Cys-Cys motif. Both CCL23 and CCL15 were cleaved by MMPs at 8 and 5 sites respectively within these extensions. The most prominent product of CCL23 processing by MMPs, CCL23 (26-99), exhibited increased agonist activity compared with the full- length counterparts in calcium flux and Transwell migration assays using THP-1 cells and CCR1 receptor transfectants. MMPs process CCL15 (1-92) to CCL15 (25-92) and CCL15 (28-92). While CCL15 (25-92) has been previously identified ex vivo, the corresponding protease could not be identified. Here, the processing of CCL15 by proteases in synovial fluid was confirmed to occur by both MMPs and serine proteases. The generation of CCL25 (25-92) by proteases in synovial fluid indicates that this truncated form may be involved in the pathogenesis of chronic inflammatory diseases. This reveals for the first time that MMPs activate CCL15 and CCL23, which are responsible for monocyte recruitment during an inflammatory response.  34 Introduction Infection or injury initiates a cascade of tightly regulated events that culminate in an inflammatory response. Resident cells, including macrophages, produce mediators that are involved in the recruitment of leukocytes from the circulation into the affected tissue. Within hours, neutrophils are recruited and then subside by 24 to 48 h when inflammatory monocytes are recruited. These latter cells differentiate into macrophages and persist in the tissue until inflammation is resolved. Recruited cells are involved in resolution and repair in part through production of cytokines, free radicals and by phagocytosis. Yet, continual recruitment and activation of leukocytes results in host tissue damage as observed in chronic inflammatory diseases such as rheumatoid arthritis. Thus, regulation of cellular recruitment and termination of this intercellular signaling is critical to control the inflammatory response.  Chemokines are an important superfamily of chemoattractant cytokines that mediate directional leukocyte migration in innate and acquired host defense responses. Through interaction of residues in the chemokine carboxy (C)-termini α-helix with negatively charged glycosaminoglycans (GAGs), chemokines form a haptotactic gradient (129,130). The concentration of chemokine in tissue and on the endothelial surface, produced by local cells following stimulation by damage or pathogen associated molecular patterns, promotes the recruitment of leukocytes to an inflammatory site. There are four subfamilies of chemokines based upon the proximity of the conserved amino-terminal cysteine residues, the largest being the CXC and CC subfamilies. Chemokines exert activity by binding to receptors on leukocyte surfaces; CXC chemokines bind to CXC receptors (CXCRs) whereas CC chemokines bind CCRs.  The predominant CXCRs, namely CXCR1 and CXCR2, are expressed by neutrophils whereas monocytes express CCR1, CCR2, CCR3, CCR5 and CCR8 (141,142). The flexible amino (N)-terminus of a chemokine is involved in binding and activating its cognate receptor (136,137). Receptor activation causes intracellular signaling, including calcium mobilization, resulting in cell activation that is characterized by cell migration, gene transcription, relocation of receptors to the cell membrane, and the release of further inflammatory mediators.   35 Post-translational modifications of both the N- and C-termini of chemokines by proteolytic processing is a versatile mechanism of regulation; trimming chemokines into stronger agonists for recruitment of appropriate cells, into antagonists to terminate intercellular signaling events, or alternatively modifying the GAG binding domain to prevent haptotactic gradient formation (87,89,115,122,154,181,285). A number of chemokines are processed in vitro by proteases, and in particular by matrix metalloproteases (MMPs) (87,89,115,154,181). MMPs are an important family of extracellular endopeptidases that are upregulated in stromal cells and leukocytes following cell stimulation, and are associated with chronic inflammatory diseases. For example, fibroblasts express MMP-1, -2, -3, -7, -9, -13 and -14 but MMP-8 and MMP-12 are only expressed by neutrophils and macrophages, respectively, though these latter cells express other MMPs including MMP-9. The activity of MMPs is regulated in vivo by tissue inhibitors of metalloproteinases (TIMPs) and therapeutically by hydroxymate inhibitors including Marimastat (286).  MMPs degrade multiple components of the extracellular matrix and thus were thought to enable cell migration in inflammation by creating passages through the basement membrane and extracellular matrix. Due in part to work in our laboratory, it is now recognized that MMPs process bioactive molecules, including chemokines, to regulate intercellular signaling in innate immunity. Neutrophil chemoattractants CXCL8 and CXCL5 are processed by MMPs to become potent receptor agonists, a critical step for neutrophil recruitment (89,161). In contrast, all seven neutrophil CXCL agonists are inactivated by macrophage-derived MMP-12, terminating the recruitment of neutrophils (87). Proteolytic processing of CCL7 by MMP-2 removes the first 4 N-terminus residues; this truncation results in a strong receptor antagonist that is capable of reversing inflammatory responses in vivo (114). Although we have found that MMPs generate potent CCR1, CCR2 and CCR5 receptor antagonists by cleaving CCL2, 7, 8 and 13, roles for MMPs in promoting monocyte recruitment are yet to be determined. Given the critical role of macrophages in progression and resolution of the inflammatory response, understanding the recruitment of progenitor monocyte cells is essential. Herein, we evaluate MMP-processing of all 14 CC chemokines that are involved in monocyte recruitment. We report that MMP processing, and specifically MMP-12 proteolysis, of CCL16, CCL15 and CCL23 results in increased GAG binding and receptor activation,  36 and thus identify a role for MMPs in promoting monocyte recruitment. Further, these results implicate feed-forward mechanisms whereby macrophages and synovial fluid proteases promote the recruitment of monocytes, potentiating the transition of inflammation to a chronic response.  Materials and Methods Proteinases and chemokines: Recombinant human MMP-1, -2, -3, -8, -9, -12, -13, and soluble MMP-14 were expressed and purified using standard techniques (287); MMP-7 was purchased from U. S. Biochemical Corporation. All full-length chemokines were chemically synthesized using t-Boc solid phase chemistry, purified by high-performance liquid chromatography and validated for activity as previously described (288). A 19-mer peptide corresponding to CCL23 (5-23) was chemically synthesized (Sigma). CCL15 (25-92, 28-92), CCL16 (8-77, 8-85) and CCL23 (26-99) utilized for in vitro experiments were the fully truncated products of MMP-12 cleavage of full-length counterparts; these preparations lack full-length chemokine as detected by matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry (MS). Controls for functional assays, namely full-length chemokine and MMP-12 alone, were prepared at the same time.  Cells: Human CCR1-transfected B300-19 (PreB) cells were kindly provided by Dr B. Moser (Bern, Switzerland) and cultured in RPMI 1640 supplemented with 10% fetal bovine serum, 2 mM glutamine, 50 µM β-mercaptoethanol, and 1.5 µg/ml puromycin. The monocytic cell line of human THP-1 cells (ATCC) were grown in RPMI 1640 supplemented with 10% fetal bovine serum. Human peripheral neutrophils and monocytes were isolated from healthy volunteers as approved by the University of British Columbia Clinical Ethics Review Board (Appendix C). Peripheral blood was drawn into ACD-treated vaccutainers and layered on 6% Dextran/0.9% NaCl solution; the leukocyte-containing plasma was pelleted and leukocytes layered over Histopaque 1077 (Sigma) and monocytes or neutrophils were isolated as per the manufacturer’s protocol, resuspending in Hank’s balanced salt solution supplemented with 0.1% BSA, or appropriate buffer for analysis. Cells were greater than 95% viable and pure as determined by trypan blue or Wright’s-Giemsa staining of cytospins, respectively. E. coli  37 K12MG1655 and S. aureus RN4220, were kindly provided by Dr J. Davies (University of British Columbia, Canada).  Chemokine cleavage assays: The proenzymes MMP-1, -2, -8, -9, -13 and -14 were activated by incubation with 1 mM p-aminophenylmercuric acetate (APMA) for 45 min at 37°C. MMP-7 and -12 lacked a prodomain and so did not require chemical activation. MMP-3 was activated by incubation with 0.25 µM chymotrypsin for 30 min at 37°C, and then the chymotrypsin activity inhibited by addition of 1 mM phenylmethylsulfonyl fluoride (PMSF); all experiments with MMP-3 included a chymotrypsin/PMSF only control. The concentration of active MMPs was determined by active-site titration against TIMP-1 or TIMP-2 in a quenched fluorescence (QF) synthetic peptide cleavage assay with QF 24. In vitro chemokine cleavage assays with recombinant MMPs were performed in 50 mM Tris, 200 mM NaCl, 5 mM CaCl2, pH 7.4 for 16 h at 37°C. Initially, an enzyme to substrate molar ratio of 1:10 was assessed to screen for cleavage activity, followed by lower enzyme concentrations to confirm biological relevance. Cleavage assay products were analyzed, as previously described (289), by MALDI-TOF MS on a Voyager-DE STR (Applied Biosystems) or a 4700 (Applied Biosystems) using the matrices sinapic acid or α-cyano-4-hydroxycinnamic acid, respectively, and confirmed by silver-staining following 15% Tris-Tricine SDS-PAGE. Chemokine cleavage was defined to be positive when the mass spectrometry spectra showed a cleavage product with greater than 20% intensity of the full-length chemokine. For kinetic analysis gels were stained with Coomassie Brilliant Blue R-250 and bands were quantified by densitometry using Alpha-imager software.  Glycosaminoglycan binding: HiTrapTM cation exchange Sepharose or heparin- Sepharose (GE healthcare) 1 ml columns were washed and equilibrated before manual loading of 25 µg of chemokine diluted to 1 ml in 10 mM potassium phosphate, pH 7.5. Using an Akta Purifier (Amersham), columns were washed with 10 column volumes of 10 mM potassium phosphate and then a linear gradient was applied from 0 to 1.5 M NaCl over 30 min at a flow rate of 1 ml/min and monitored by in-line absorbance at 215 nm. Ascii files were imported into Prism (GraphPad) and normalized against baseline. The effects of soluble GAGs, namely heparan sulfate and chondroitin sulfate A, B, and  38 C (Seikagaku), on the in vitro cleavage of CCL15 by MMP-12 was assessed with a chemokine to GAG ratio of 1:5 (w/w) at an enzyme to substrate ratio of 1:25 (w/w).  Calcium mobilization: THP-1 or CCR1-transfected B300-19 cells resuspended at 1 x 107 cells/ml in RPMI 1640 media supplemented with 1% fetal calf serum were loaded with 2 µM Fluo-4-acetoxymethyl ester (Fluo-4, Molecular Probes) for 30 min at 37 ºC, 5% CO2. To remove unincorporated Fluor-4, cells were washed three times with assay buffer (Ca2+/Mg2+-free Hank’s balanced salt solution (HBSS; Invitrogen), 20 mM HEPES, 2.5 mM probenecid (Sigma), 0.1% bovine serum albumin (BSA)) and resuspended at 1 x 106 cells/ml in fresh assay buffer. Assays were performed on 6.5 x 105 cells in 800 µl cuvettes on an LS50B spectrofluorimeter (Perkin Elmer) in timedrive mode with excitation and emission at 494 and 515 nm, respectively. Cells were allowed to equilibrate for 3 min at 37 ºC before the addition of ligand. Calibration was made by addition of 5 µM ionomycin (Sigma) followed by 1 mM MnCl2 (FisherBiotech) to determine Fmax and Fmin, respectively. Absolute Ca2+ was calculated as Kd x [(F- Fmin)/(Fmax-F)] where the Kd of Fluo-4 is 345 nM (Molecular Probes). Experiments were carried out in duplicate and repeated a minimum of three times.  Transwell migration: THP-1 and CCR1-transfected cells were washed and resuspended at 1 x 106 cells/ml in RPMI 1640 media supplemented 0.1% or 1.0% BSA, respectively. Chemokine, or MMP and buffer controls, diluted in the same media in the lower chamber were separated from 2 x 105 cells/ml in the upper chamber of a 96-well Boyden chamber (Neuroprobe) by a 5 µM pore filter. Assays performed at 37 ºC, 5% CO2 were 90 min for THP-1 and 3 h for CCR1-transfected cells. Non-migrating cells were aspirated and the upper chamber washed with 2 mM EDTA. The contents of the lower chamber was transferred to a Maxisorb 96-well plate and frozen at -80 ºC for a minimum of 2 h. DNA content was determined by addition of CyQuant reagent (Invitrogen) to the thawed lysate and fluorescence evaluated by excitation/emission at 485/538 nm. The chemotactic index was calculated by the ratio of the relative fluorescence of samples from cells migrating in response to chemokine compared with the media control. Experiments were carried out in quadruplicate and repeated a minimum of three times. Statistical significance of cleaved versus full-length chemokines were evaluated by 2-way ANOVA and Bonferroni post-tests in Prism.  39 Neutrophil activation: Isolated neutrophils resuspended at 106 cell/ml were stimulated with 1 to 1000 nM CCL23 (5-23), 0.5% Triton or PBS for times ranging from 0 to 45 min in a 0.35 ml volume. At each time point, 150 µl of cell-free supernatant was assayed for myeloperoxidase (MPO) activity by the addition of the MPO substrate o-dianisidine (Sigma) in the presence of 1% hydrogen peroxide. Colorimetric change was evaluated at 405 nm.  Generation of reactive oxygen species: The measurement of reactive oxygen species (ROS) was performed with modification of the method described by Wang and Joseph (290). Briefly, THP-1 cells were resuspended at 106 cell/ml in complete HBSS (Invitrogen). Cells were treated with 10 to 1000 nM of each ligand, or 1 mM hydrogen peroxide as a positive control, in the presence of 0.1 mM 2,7-dichlorofluorescein diacetate. ROS production was measured kinetically at an excitation/emission of 485/520 nm using a Polarstar Optima 96-well fluorimeter (BMG).  Antimicrobial activity assays: The antimicrobial activity of chemokines and the peptide CCL23 (5-23) against E. coli and S. aureus were evaluated by three methods - zone of inhibition, colony forming unit production, and microtitre assay. For the zone of inhibition assay, bacteria in logarithmic growth stage were plated in a soft agar overlaid onto LB plates. Ligands, including kanamycin or buffer as a positive and negative controls, were applied to sterile paper discs (Avantec) and then placed onto the soft agar prior to overnight growth. A lack of growth in the area around the paper disc indicates antimicrobial activity. The colony forming unit assay was performed as described previously (144). Briefly, bacteria in logarithmic growth were grown in liquid culture in the presence of ligands for 2 h. Serially dilutions were then plated on LB plates for overnight growth and the number of colonies were counted. As a modification to this, aliquots of liquid culture were diluted in a microtitre plate and growth inhibition was measured by optical density at 595 nm.  Chemokine cleavage in synovial fluid: Cleavage of 2.5 µg of CCL15 (1-92) in 0.25 µg of synovial fluid pooled from eight rheumatoid arthritis patients was performed at 37 ºC for 16 h in cleavage assay buffer in the absence or presence of 1 mM PMSF (general serine proteinase inhibitor), 10 µM Marimastat (general metalloproteinase inhibitor), 100  40 µM TIMP-1 (inhibitor of specific metalloproteinases), 100 µM TIMP-2 (inhibititor of specific metalloproteinases), 10 µM E64 (cysteine protease inhibitor), 10 µM pepstatin (aspartyl protease inhibitor) and 100 µM leupeptin (inhibitor of specific serine and cysteine proteases) either alone or in combination. Cleavage of CCL15 was assessed by MALDI-TOF mass spectrometry and 15% Tris-Tricine SDS-PAGE, as detailed above. Results All monocytic responsive CC ligands are processed by MMPs To evaluate the MMP- processing capacity of all monocyte chemoattractants in the CC subfamily of chemokines, recombinant MMP-1, -2, -3, -7, -8, -9, -12, -13, and -14 were incubated for 16 h at 37°C with CCR1, 3, 5 and 8 ligands at a 1:10 molar ratio. All chemokines evaluated were cleaved by one or more MMPs (Table 2.1) to result in a product of greater then 20% signal intensity of the full-length chemokine by MALDI-TOF. Of the 149 cleavage sites identified in the 14 chemokines, 32 are novel MMP cleavage sites, and 28 of these are novel truncations wherein the cleavage results in a new N- or C- termini of the chemokine. The broadest specificities observed are for MMP-7 and -12, which processed 14 and 13 chemokines, respectively. Unlike the other MMPs used in this study, MMP-7 and -12 lack a hemopexin domain, indicating that the hemopexin domain may define the substrate specificity of MMPs and thus restrict their activity. The processing of CCL2, 7, 8 and 13 by MMP-7 contradicts the relative absence of activity of MMP7 we previously reported (115) due to improved procedures for preparing and storing active MMP-7.  41 Table 2.1 MMP-truncation products of CC chemokines Truncation products following MMP cleavage were deconvoluted from MALDI-TOF mass spectra. The residue numbers are shown in brackets. Sites in black represent novel truncation sites; grey numbers represent truncations previously identified. NC indicates that the full-length chemokine was not cleaved by that MMP. ND indicates that the cleavage site could not be determined MMP Chemokine 1 2 3 7 8 9 12 13 14 CCL1 (1-73) NC NC (8-73) (7-73) (7-70) NC NC (7-73) (6-73) NC CCL2 (1-76) (5-76) NC (5-76) (5-67) (5-76) (5-76) (5-76) (5-76) (5-76) NC CCL3 (1-70) (1-47) NC NC (9-63) (1-47) (16-64)  (16-64) ND (1-47) NC CCL4 (1-69) (16-62) (6-44) (7-69) (6-44) (1-61) (6-69) (7-69) (14-61) (7-69) NC (6-44) (7-69) CCL5 (1-69) NC NC NC (1-65) NC NC NC (5-69) NC CCL7 (1-76) (5-76) (5-76) (5-76) (7-76) (5-76)  NC (5-76) (5-76) (5-76) (9-76) (7-76) (5-76) CCL8 (1-76) (1-73) (5-73) (1-73) (5-76) (1-73) (5-73) (1-73) (5-73) NC (7-76) (1-73) (5-73) (1-73) (6-76) (5-73) (1-73) CCL11 (1-74) NC (10-74) NC (10-74) NC NC (10-74) NC NC CCL13 (1-75) (5-72) (5-75) (4-75) (5-75) (6-75) (4-75) (5-72) (5-72) (5-72) (5-72) (5-72) (4-75) CCL14 (1-74) NC NC NC (1-70) (1-66) NC NC (1-71) (4-72) (7-74) NC NC CCL15 (1-92) (25-92) (14-92) (25-92) (27-92) (28-92) (17-92) (25-92) (28-92) (17-88) (17-92) (25-92)  (25-92) (28-92) (25-92) (28-92) (25-92) (28-92) (25-92) (27-92) (28-92) (14-92) (27-92) CCL16 (1-97) (8-85) (5-97) (8-77) (8-85) (8-85) (8-85) (8-85) (8-77) (5-97) (8-85) (8-77) (8-85) (8-77) (5-97) (8-85) CCL17 (1-71) NC NC NC (4-69) (9-71) NC (4-69) (4-71) NC CCL23 (1-99) (11-99) (17-99) (23-99) (26-99) (28-99) (30-99) (11-99) (17-99) (26-99) (28-99) (11-99) (21-99) (26-99) (1-90)  (11-99) (17-99) (23-99) (26-99)   (1-90) (11-99) (17-99) (26-99) (11-99) (28-99) (11-99) (17-99) (23-99) (26-99) (28-99)   (1-90) (14-99) (30-99)     42 CCL15, CCL16 and CCL23 are most susceptible to processing, being cleaved by all of the MMPs evaluated. Conversely, processing of CCL5 and CCL14 is limited to MMP-7 plus MMP-13 or MMP-12, respectively. Proteolysis of CCL1, CCL16 and CCL17 had not been observed previously. This is the first identification of both N and C-termini proteolysis sites in CCL3. The truncation by MMP-8 to CCL3 (16-64) is likely the processing recently observed in vivo (291). The removal of the 5 to 8 N-terminus residues from CCL4 has been shown to alter dimeric properties (191) whereas the truncation product CCL4 (14-61) is reported to lack activity (292).  The CCL5 (5-69) product produced by MMP-13 activity is most likely to lose the chemokine activity similar to the CCL5 (3-69) and (4-69) products previously evaluated (194,195). A novel N- terminus truncation resulting in CCL11 (10-74) is observed following processing by MMP-2, -7 and -12. Unlike previously identified CCL11 truncations of 2 or 3 residues, which do not alter the chemoattractive potential (200), this MMP-processing occurs between the two conserved cysteine residues at PTTC9 ↓10CFNL, so likely inactivates the chemokine. The MMP-processing of CCL14 to CCL14 (7-74) product was previously shown to alter calcium mobilization (203), but C-terminal truncations of the chemokine have not previously been identified.  Selective processing of CCL16 by MMPs: CCL16 (1-97) is processed by MMPs at both the N and C-termini (Fig 2.1). This is the first identification of CCL16 (1-97) proteolysis. A CCL16 (5-97) product was observed by MMP-2, -8 and 14, and CCL16 (8-85) or (8- 77) were observed by all MMPs tested (Fig 2.2). By silver-stained gel the activity of MMP-1 appears minimal (Fig 2.1A), though a CCL16 (8-85) product was observed on MALDI-TOF mass spectrometry (Fig 2.1B). Conversely, MMP-14 appears to degrade CCL16 (1-97), yet both the CCL16 (5-97) and (8-85) products represent > 20% intensity in the mass spectra (results not shown). MMP-12 processing of CCL16 (1-97) at a 1:10 molar ratio results in complete truncation to two products that are evident by MALDI- TOF (Fig 2.1D); this preparation was used for in vitro functional assays.   43            Figure 2.1 All MMPs evaluated processed CCL16. Human CCL16 (1-97) was incubated with recombinant MMP-1, -2, -3, -7, -8, -9, -12, - 13, and -14 at 1:10 molar ratios at 37 ºC for 16 h. A) Cleavage assay products were visualized on silver-stained 15% Tris-Tricine gels. (B) Cleavage products were assigned by MALDI-TOF mass spectrometry by comparison of measured with predicted mass to charge ratios (m/z) with +1 charge ionization ([M + H]+). (C) Cleavage sites observed by each MMP are indicated on the CCL16 sequence. (D) Mass spectra of cleavage assay products of CCL16 in the absence (left) or presence (right) of MMP-12, showing that the predominant truncated forms CCL16 (8-77) and (8-85) are both present in the form used for functional assays.  44  45 Heparin binding affinity of CCL16 is increased by MMP-processing Given the role of chemokine C-termini in GAG binding, we hypothesized that cleavage of the C-terminus of CCL16 (1-97) would alter GAG binding of the MMP-truncated chemokine compared with the full-length counterpart. The binding of MMP-12-processed chemokine CCL16 (8-77, 8-85) compared with uncleaved CCL16 (1-97) was characterized using heparin- Sepharose chromatography (Fig 2.2A). The truncated CCL16 has greater affinity for heparin-Sepharose than full-length chemokine, eluting at 0.71 M versus 0.52 M NaCl, respectively. To control for charge effects, an equivalent experiment was performed with a strong cation exchange Sepharose column (Fig 2.2B). CCL16 (1-97) eluted at 0.51 M NaCl whereas CCL16 (8-77, 8-85) eluted at 0.56 M NaCl. The effect on the strong cation exchange column was not as marked as the heparin column suggesting that the interaction of specific amino acid residues or their spatial arrangement and not charge alone, is responsible for the increased GAG binding. Since the MMP-processed form of CCL16 includes both N- and C-termini truncations, the effect of each terminus on GAG- binding could not be determined. Processing of CCL16 by MMP-12 was not inhibited by the presence of soluble GAGs (Fig 2.2C), as was previously observed for CXCL11 (154), indicating that cleavage could occur to both soluble and GAG-bound full-length chemokine in vivo.  Selective processing of CCL15 by MMPs: CCL15 (1-92) is processed by all MMPs tested at the N-terminus (Fig 2.3) and by high concentrations of MMP-7 at the C- terminus. All MMPs processed CCL15 (1-92) to CCL15 (25-92), a product previously observed from recombinant production in insect cells (230). By silver-stained gel the activity of MMP-9 appears minimal (Fig 2.3B), though both CCL15 (25-92) and CCL15 (28-92) cleavage products are observed on MALDI-TOF mass spectrometry (Fig 2.3A). MMP-12 processing of CCL15 (1-92) at a 1:25 mole ratio results in complete truncation to two products that are evident by MALDI-TOF (Fig 2.3C); this heterogeneous preparation was used for in vitro functional assays.  Kinetics analysis of CCL15 processing: We incubated each of the MMPs with CCL15 at increasing molar ratios to compare the efficiency of processing (Fig 2.4). Using the equation kcat/Km = (ln2)/(E)(t1/2), we applied densitometry to Coomassie Brilliant Blue  46           Figure 2.2 Heparin binding is enhanced upon CCL16 processing. Elution profiles of CCL16 (1-97) and MMP-cleaved CCL16 (8-77, 8-85) from (A) heparin-Sepharose column or (B) strong cation exchange column. The absorbance at 215 nM was measured during a 30 mL gradient that reached 1.5 M NaCl. (C) CCL16 (1- 97) was incubated with recombinant MMP-12 at 1:10 molar ratios  in the presence of heparan sulfate (HS), chondrotin sulphate (CS)A, CSB or CSC in 5 –fold excess (w/w) at 37 ºC for 16 h. Cleavage assay products were visualized on silver-stained 15% Tris- Tricine gels. (D) Transwell migration of THP-1 cells for 90 min towards full-length or truncated chemokine through a 5 µm pore-sized filter. Migrated cells were quantified by CyQUANT assay and displayed as chemotactic index, defined as the ratio of cells migrating in response to stimulus compared with buffer control. Results shown are the mean +/- SEM of 2 biological replicates of experiments completed in quadruplicate.  47  48                            Figure 2.3 All MMPs evaluated processed CCL15 at one or more sites. Human CCL15 (1-92) was incubated with recombinant MMP-1, -2, -3, -7, -8, -9, -12, - 13, and -14 for 16 h at a 1:10 molar ratios at 37 ºC. (A) Cleavage products were assigned by MALDI-TOF mass spectrometry by comparison of measured with predicted mass to charge ratios (m/z) with +1 charge ionization ([M + H]+). Corresponding sequences are shown. (B) Cleavage assay products were visualized on silver-stained 15% Tris-Tricine gels. (C) Mass spectra of cleavage assay products of CCL15 in the absence (left) or presence (right) of MMP-12, showing that the predominant truncated forms CCL15 (25-92) and (28-92) are both present in the form used for functional assays.  49           Figure 2.4 Kinetics of CCL15 processing by MMPs. CCL15 (1-92) was incubated with increasing concentrations of recombinant MMP-1, -2, -3, -7, -8, -9, -12, -13, and -14 for 16 h at a 1:10 molar ratios at 37ºC. (A) Cleavage assay products were visualized on Coomassie Brilliant Blue R-250 stained 15% Tris- Tricine gels. (B) kcat/Km was determined by densitometry of gels.   50  51 stained SDS-PAGE gels to analyze the kinetics of cleavage of CCL15 by all MMPs (Fig 2.4). MMP-12 most efficiently processed CCL15, with a rate of 3,000 M-1s-1; this is > 100-fold faster than the least efficient CCL15 processing MMP, namely MMP-1. Interestingly, 2 of the most efficient MMPs with the fastest rates were leukocyte-specific MMPs, MMP-12 and MMP-8.  Selective processing of CCL23 by MMPs: CCL23 (1-97) is processed by all MMPs assessed at the N-terminus, and at the C-terminus by MMP-3, -7, and -13 (Fig 2.5). The detection of CCL23 (26-99) and the counterpart CCL23 (1-25) by MALDI-TOF mass spectrometry following MMP-1, -2, -3, -7, -8, and -12 cleavage (Fig 2.5A) suggests that although multiple cleavages can occur within the first 25 residues of CCL23 (1-99), CCL23 (26-99) is the predominant product. Similarly, both fragments resulting from cleavage of CCL23 (1-99) by MMP-14 were observed, namely CCL23 (1-29) and CCL23 (30-99). CCL23 (30-99) was previously reported to result from elastase processing of CCL23 (1-99) (122). From densitometry of  gels shown in Fig 2.5C, MMP- 12 processing of CCL23 (1-99) was deduced to occur at 95 M-1s-1, which is comparable to MMP-processing of other chemokines (154). The preparation used for in vitro functional assays lacks full-length chemokine and is solely CCL23 (26-99), as shown MALDI-TOF MS (Fig 2.5D).  Calcium mobilization in CCR1 transfected B300-19 and THP-1 cells in response to MMP-processed CCL15 and CCL23: MMP-truncated chemokines were tested for activity with human CCR1-transfected B300-19 cells. At a concentration of 10 nM chemokine, there was a significant increase in the activity of CCL15 (25-92, 28-92) and CCL23 (26-99) compared with the full-length counterparts (Fig 2.6A). Similar results were obtained with THP-1 cells (Fig 2.6B). MMP-processed chemokines caused a dose-dependent increase in THP-1 cell intracellular calcium mobilization whereas the response of CCL15 (1-92) and CCL23 (1-99) were elevated only at the highest concentration evaluated (Fig 2.6C). A calcium mobilization response was not observed following stimulation with the 19-mer peptide that corresponds to CCL23 (5-23), cleavage assay buffer, or MMP-12 (results not shown).   52            Figure 2.5 All MMPs evaluated processed CCL23 at one or more sites. Human CCL23 (1-99) was incubated with recombinant MMP-1, -2, -3, -7, -8, -9, -12, - 13, and -14 for 16 h at a 1:10 molar ratios at 37ºC. (A) Cleavage products were assigned by MALDI-TOF mass spectrometry by comparison of measured with predicted mass to charge ratios (m/z) with +1 charge ionization ([M + H]+). Corresponding sequences are shown. (B) Cleavage assay products were visualized on silver-stained 15% Tris-Tricine gels. (C) Mass spectra of cleavage assay products of CCL23 in the absence (left) or presence (right) of MMP-12, showing that the predominant truncated form CCL23 (26-99) is present in the form used for functional assays.   53  54                            Figure 2.6 MMP-mediated cleavages of CCL15 and CCL23 results in increased agonism in calcium mobilization assays. Representative trace of calcium flux, shown as burst in relative fluorescence units (RFU) following addition of 10 nM of full-length of MMP-truncated chemokine in (A) CCR1-transfected B300-19 and (B) THP-1 cells loaded with Fluo-4 calcium indicator reagent. (C) Calcium mobilization dose response of THP-1 cells. Calcium concentrations were calculated from relative fluorescence based on calibration with ionomycin and MnCl2.  55 Chemotactic response of CCR1 transfectants and THP-1 cells to MMP-processed CCL15 and CCL23: To confirm the calcium mobilization results, CCR-1 transfected B300-19 and THP-1 cells were evaluated for chemotaxis toward full-length and MMP- truncated CCL15 and CCL23. Both cell types had a dose dependent response, with the characteristic hyperbolic curve, to CCL15 (25-92, 28-92) and CCL23 (26-99) with minimal response to CCL15 (1-92) and CCL23 (1-99) (Fig 2.7). The response of THP-1 cells to CCL15 (25-92, 28-92) was highest at 1 nM, and showed equivalent chemotactic potential to a 10-fold higher concentration of CCL7—a prodigal monocyte chemoattractant (Fig 2.7B). The observed responses were due to chemokine since neither cleavage assay buffer nor MMP-12 controls induced chemotaxis. The 19-mer peptide corresponding to CCL23 (5-23) did not have chemotactic potential for THP-1 cells (Fig 2.8C).  Selective processing by CCL23 (5-23) 19-mer peptide: CCL15 and CCL23 have a high degree of homology in the N-termini, and particularly at residues 5-23 (Fig 2.8A). While both CCL15 (1-92) and CCL23 (1-99) are processed at Ser13 ↓ Lys14 and Pro16 ↓ Leu17, only CCL23 (1-99) is processed by MMP-3 at Pro20 ↓ Val21. We evaluated the capacity of MMPs to process a peptide corresponding to CCL23 (5-23), and thus differing from CCL15 at Phe10 and Val21. All MMPs processed the peptide to result in a product of CCL23 (11-23) (Fig 2.8B), a product observed for all MMPs, except MMP-14, from the full-length CCL23 (1-99). Similarly, the product CCL23 (17-23) was observed from processing of both the full-length and peptide. Since MMPs are not exopeptidases, the finding that MMP-3 did not process CCL23 (5-23) at Pro20 - Val21 was expected. We evaluated the peptide CCL23 (5-23) for activity in antimicrobial assays, ROS production, neutrophil degranulation and monocyte maturation but were unable to identify any function.  Synovial fluid processing of CCL15: CCL15 (Fig 2.9B) was added to synovial fluid pooled from arthritic patients (Fig 2.9A) to evaluate the role of MMP-processing ex vivo. Four peaks were observed following a 16 h incubation at 37 °C (Fig 2.9C). The m/z of 7,066, 7,438, 7,553, and 7,766 were deconvoluted to be CCL15 (28-92), CCL15 (25- 92), CCL15 (24-92) and CCL15 (22-92), respectively (Fig 2.9G). To determine the  56                      Figure 2.7 Chemotactic potential of CCL15 and CCL23 is enhanced by MMP- processing. Transwell migration of (A) CCR1-transfected B300-19 for 3 h or (B) THP-1 cells for 90 min towards full-length or truncated chemokine through a 5 µm pore-sized filter. Migrated cells were quantified by CyQUANT assay and displayed as chemotactic index, defined as the ratio of cells migrating in response to stimulus compared with buffer control. Results shown are the mean +/- SEM of 3 or more biological replicates of experiments completed in quadruplicate. Statistical analysis by two-way ANOVA with Bonferroni post-test; the level of significance comparing full-length to MMP-cleaved counterpart are *p<0.05, **p<0.01, ***p<0.001.  57                      Figure 2.8 A 19-mer peptide corresponding to CCL23 (5-23) had no identifiable function. (A) Homologous regions between CCL15 and CCL23 N-termini are shown in black. A peptide corresponding to CCL23 (5-23) was synthesized, differing from CCL15 at the Leu and Val residues, indicated in bold. (B) All MMPs cleaved CCL23 (5-23) as indicated, following deconvolution by MALDI-TOF. (C) Transwell migration of THP-1 cells for 90 min towards CCL23 (5-23) alone or in combination with 10 nM CCL7 through a 5 µm pore-sized filter. Migrated cells were quantified by CyQUANT assay and displayed as chemotactic index, defined as the ratio of cells migrating in response to stimulus compared with buffer control.  58           Figure 2.9 Synovial fluid MMP and serine proteases cleave CCL15. Synovial fluid (SF) from eight rheumatoid arthritis patients were pooled and 25 µg were incubated with 2.5 µg CCL15 in the absence or presence of inhibitors for 16 h at 37°C. Mass spectra of C18 ZipTip prepared samples after 16 h incubation of (A) SF, (B) CCL15 (1-92), (C) SF+CCL15, (D) SF+CCL15+marimastat (E) SF+CCL15+PMSF, and (F) SF+CCL15+marimastat+PMSF. (G) Cleavage products were assigned by MALDI- TOF mass by comparison of measured with predicted mass to charge ratios (m/z) with +1 charge ionization ([M + H]+) (H) Cleavage was visualized on silver-stained 15% Tris- Tricine gels.  59  60 protease classes responsible for CCL15 processing, the metalloproteinase inhibitors TIMP-1, TIMP-2, and Marimastat were added to the synovial fluid. For serine proteases PMSF, for cysteine E64, and aspartic proteases pepstatin or leupeptin were added either alone or in combination prior to the addition of chemokine. Two peaks, corresponding to CCL15 (28-92) (m/z 7066) and CCL15 (25-92) (m/z 7738) were eliminated when TIMPs or Marimastat were present (Fig 2.9D), indicating that these cleavage products are due to MMP activity, confirming our in vitro findings. The peak corresponding to CCL15 (24-92) (m/z 7553) was eliminated, and that for CCL15 (22-92) (m/z 7766) was significantly reduced in the presence of PMSF (Fig 2.9E, 9G), implicating a role for serine proteases. Synovial fluid cleavage products were visualized by gel electrophoresis (Fig 2.9H). Of note E64, pepstatin or leupeptin had no effect on processing of CCL15 (results not shown). Discussion We report here the first instance of MMP-processing of three chemokines implicated in monocyte recruitment, specifically by cleavage of CCL16, CCL15 and CCL23. Further, my results suggest the utlization of two mechanisms - enhanced haptotactic gradient formation and the generation of  more potent receptor agonists with increased chemotactic potential. A distinctive feature of CCL16, CCL15 and CCL23 is the protein size; at 97, 92 and 99 amino acids in length, respectively, they are much longer than standard chemokines which consist of 65-80 amino acids. The C-terminus of CCL16 extends 44 amino acids after the conserved fourth cysteine residue, whereas CCL15 and CCL23 have extended N-termini of 31 and 32 amino acids, respectively. Unlike all other chemokines evaluated, these three chemokines were cleaved by all MMPs tested (Table 2.1), suggesting that the extended termini, most likely showing increased disorder, improve their susceptibility to proteolysis and hence proteolytic regulation.  Truncated forms of both CCL15 and CCL23, but not CCL16, have been previously observed. E. coli and HEK-293 cells produced a recombinant CCL15 protein of the expected 92 amino acids (228,293), insect cells produced CCL15 (25-92) (294), whereas Pichia production resulted in CCL15 (27-92) (295). Similarly, recombinant expression in a baculovirus system generated CCL23 (1-99), (24-99) and (25-99) (210). The presence of N-termini truncation variants in disease was recently shown through  61 the use of separate antibodies to each terminus (122); the C-termini, but not N-termini, of CCL15 and CCL23 were identified in synovial fluid from rheumatoid arthritis patients. While the exact truncation sites could not be identified, Berahovich and colleagues showed that synovial fluid cleaved CCL15 (1-92) to a (25-92) product in vitro. Despite attempts by multiple groups (122) (159), the enzyme responsible for this processing could not be identified. We now show that MMP-1, -2, -3, -7, -8, -9, -12, and -13 cleave CCL15 (1-92) to the (25-92) product (Fig 2. 2 and 2.3).  Using a pool of synovial fluid obtained from arthritic patients, we confirmed the processing of CCL15 (1-92) to a (25-92) product observed in vitro biochemical assays has biological relevance in human disease. In addition, we observed stable cleavage products corresponding to (22-92), (24-92) and (28-92). By the addition of inhibitors, we determined that both serine proteases and MMPs were involved. Neutrophil elastase cleaves CCL15 (1-92) to a (22-92) product whereas cathepsin G processing results in products of (24-, 27-, and 29-92) (122,159) and so these may be the responsible serine proteases. Interestingly, in previous studies using PMN supernantant the CCL15 (25- 92) product was not identified (122) (159). Perhaps, these preparations were primarily azurophilic granular contents – including elastase and cathepsin G – and did not represent specific or gelatinase granules, which contain MMP-8 and MMP-9, respectively. Alternatively, while all MMPs are capable of processing CCL15 in vitro, the in vivo response may be specific to one MMP due to other factos such as limited expression, interactors or localization. This observation is supported by the finding that while several MMPs are capable of processing murine CXCL5/LIX in vitro, MMP-8 cleavage of the chemokine is critical in vivo and not compensated for by elevated MMP- 9 levels in the Mmp8 -/- neutrophils (89). Kinetic analysis of the MMP processing of CCL15 indicates that the macrophage specific MMP-12 is the most efficient MMP in conversion of the chemokine to truncated products (Fig 2.4).  Previous studies of the neutrophil chemoattractants CXCL8 and CXCL5 have shown that MMP-processing of the N-termini results in products with 10-fold higher chemotactic potential than the full-length counterpart (89,164,220,296). Though these neutrophil chemoattractants do not have extended termini like CCL15 and CCL23, the selective processing and maintenance of the critical ELR residues enables for more  62 efficient activation of the cognate receptors. While select monocyte chemoattractants have increased activity following dipeptidyl peptidase, cathepsin, urokinase-type plasminogen activator and chymase proteolysis (122,158,297) ours is the first study to identify MMP-activation of monocyte chemoattractants. We have confirmed previous findings that used chemically synthesized CCL15 (25-92) (295) (205,298) to show that MMP-processed CCL15 (25-92) induces significantly greater calcium mobilization than the full-length counterpart in THP-1 cells (Fig 2. 6B, C), and that this is through CCR1 activity (Fig 2.6A). Similarly, CCL23 (26-99) causes enhanced calcium mobilization in both THP-1 and CCR1-transfected B300-19 cells compared with CCL23 (1-99) (Fig 2.6C). Further, the chemotactic response of MMP-processed CCL15 (25-92, 28-92) and CCL23 (26-99) are significantly elevated in THP-1 cells and in CCR1-transfected cells (Fig 2.7). In contrast, MMP-processing of CCL16 (1-97) to CCL16 (5-97, 8-77, 8-85) did not alter the chemotactic response (Fig 2.2D) or calcium mobilization (results not shown) of THP-1 cells, as compared with full-length chemokine. In agreement with previous findings (299,300), a chemotactic response toward CCL16 was observed only at concentrations greater then 10 nM. These results indicate that MMP-processing of CCL15 (1-92) and CCL23 (1-99), but not CCL16 (1-97), generates more potent receptor agonists than the full-length counterparts.  Our results support the findings of Howard and colleagues (299) who describe the chemotactic potential of CCL16 as minimal, and suggest that it may have a more important role in cell adhesion. Immobilization on the cell-surface, and presentation to circulating leukocytes, through high affinity interactions with GAG side chains of proteoglycans are critical for the in vivo activity of many chemokines (129). By creating a high, localized concentration of chemokine, the haptotactic gradient provides the directionality for leukocytes as well as potentially placing the chemokine in a correct orientation for chemokine-receptor interactions (301). Disruption of the gradient by proteolysis of the proteoglycan core protein can decrease chemotaxis (261). Previous work in our laboratory showed that MMP-truncation of chemokines reduces GAG binding efficiency, specifically of CXCL11 (154). Unlike this previous report, we find that MMP-processing of CCL16 results in a product with enhanced GAG binding. CCL16 (8- 77, 8-85) interacts more tightly with heparin Sepharose then does the full-length counterpart (Fig 2.2A), an effect that cannot be explained by salt interactions alone (Fig  63 2.2B). Removal of 12 and 20 amino acids may allow for previously buried residues to form stronger interactions with the heparin. Specifically, the residues 47KRNR50 correlate with the BBXB signature GAG binding motif, where B represents a basic amino acid, that is found in other CC chemokines (132-134). These results suggest that processing at the C-terminus results in increased GAG binding in vitro, and thus a stronger haptotactic gradient could be formed in vivo. Retention of chemokine at the cell surface would result in a localized concentration of chemokine, thereby promoting monocyte migration.  In addition to the identification of the truncated chemokine forms of CCL23 by MALDI- TOF MS, the N-termini CCL23 (1-25) and (1-29) were identified (Fig 2.5A). This suggests that the N-terminus is released as a complete segment and therefore may have functionality. The N-terminus of CCL15 at residues Asp4 – Leu23 are 89.5% homologous and 94.7% similar to CCL23 (Fig 2.8A), suggesting that functionality for both chemokines may lie within this peptide. An alternatively spliced chemokine form of CCL23 not yet found in human tissue but isolated from THP-1 cells, termed CCL23β, contains an insert of 18 amino acids between Asp24 – Phe25, termed SHAAGtide, that is chemotactic for both monocytes and neutrophils through FPRL1 binding (302). In contrast to SHAAGtide, CCL23 (5-23) did not chemoattract THP-1 cells or isolated peripheral blood neutrophils, nor did it alter THP-1 cell chemotaxis to CCL7 (Fig 2.8C). Further, in three different assays the peptide did not have antibacterial properties against E. coli or S. aueus, though we were unable to confirm the antimicrobial activities of CCL15 (1-92) previously published (144)(results not shown). Finally, CCL23 (5-23) did not activate THP-1 cells or neutrophils, as assayed by reactive oxygen species production and degranulation respectively (results not shown). It is possible that a longer peptide, including the first four residues of CCL23 would have proinflammatory function given that the chemotactic potential of SHAAGtide was significantly reduced when lacking the residue Met1 (302).  As with SHAAGtide, CCL23 (5-23) was proteolytically processed in vitro, with cleavage sites comparable to those observed for CCL23 (Fig 2.8B). The exception to this is MMP-14, which cleaves CCL23 into the products CCL23 (14-99) and CCL23 (30-99). The identification of CCL23 (1-29) by MALDI-TOF suggests that both cleavages occur  64 concurrently and are not dependent upon the other. Yet, the identification of CCL23 (11- 23) from the peptide, but not from the full-length chemokine suggests that additional sites within the full chemokine modify the MMP preference, this may be due in part to exosite interactions of the MMP and chemokine that sterically hinder access by MMP-14 to Phe10 - Met11.  While the predominant, stable product of MMP-1, -2, -3, 7, -8 and -12 processing of CCL23 was CCL23 (26-99) an additional seven novel sites were identified. With the exception of MMP-14, all MMPs processed CCL23 (1-99) to (11-99) and (28-99), though the latter of these was only observed at high MMP concentrations. By silver- stained electrophoresis (Fig 2.5C), it is apparent that processivity exists, in that the MMP cleaves the chemokine at a preferred site, which then modifies the structure sufficiently that another cleavage site is available. A similar observation can be made for the CCL15 (1-92) cleavage by MMPs (Fig 2.4A). This is the first study to show proteolytic activity within the first 21 residues or CCL15, namely to produce (14-92) and (17-92) forms that were results of MMP-2, -13, -14 or MMP-3, and -7 processing. Yet, unlike CCL15 (25-92) we were unable to isolate these forms, suggesting that they are transient products whereas CCL15 (25-92) is a stable product. Moreover, this stable product has a high degree of functionality when compared with other CCL15 truncation variants described by Escher and colleagues (205).  The presence of four CCL15 truncation variants following processing by synovial fluid suggests that serine proteases and MMPs work in concert. Further, processing by one protease family is not dependent upon another given the presence of 2 products when one class of proteases was inhibited. While beyond the scope of this study, these results present a number of questions regarding the processing of a single protein at multiple sites, and by multiple proteases. Is this simply biological redundancy? Do the truncation variants have significantly different effects in vivo, such as the recruitment of different cell types, or do they function in antigenicity? In the case of arthritis, a chronic inflammatory disease, a combination of these is likely – and thus a reason for the disease state. In homeostasis or acute inflammation, protease activity is tightly regulated by latency as a zymogen, localization, and endogenous inhibitors and so a single protease or class may be responsible for normal function. In the synovial fluid  65 used in these experiments, the proteolytic activity was significant—completely processing a 10-fold excess of chemokine compared with total protein in the fluid. This suggests that in chronic disease the regulation mechanisms are overcome and thus multiple proteases can contribute to disease progression through redundant processing of chemokines.  In our previous work, we proposed a model whereby macrophages produce MMP-12 to terminate neutrophil recruitment (87). We now build upon that model by suggesting that macrophage MMP-12 acts in a positive feed-back mechanism to process CCL15, CCL16 and CCL23 to promote monocyte recruitment (Fig 2.10). Further, continual production of these chemokines and processing by MMPs could promote a transition from an acute to a chronic response. This study suggests that CCL16, CCL15 and CCL23 are expressed as prochemokines, perhaps with roles in homeostasis including basic antimicrobial activity (144) although we could not confirm such activity, but upon stimulation of an inflammatory response, the associated increased activity of MMPs results in processing of the full-length proteins to promote leukocyte chemoattraction through improved gradient formation or receptor activation.                66               Figure 2.10 Model of chemokine propogation of inflammation Following and initiating stimulus (1), resident cells including macrophages produce MMPs including MMP12 and the chemokines CCL15, CCL23 and CCL16. MMP cleavage (2) of CCL16 results in a product with enhanced glycosaminoglycan-binding and thus improved gradient formation (3) whereas MMP cleavage of CCL15 and CCL23 results in strong agonists that promote monocyte recruitment (4). Interstitially, inflammatory monocytes differentiate into macrophages (5) that release more MMP and chemokine, propogating the response in a positive feed-back manner.          67 CHAPTER 3: MT6-MMP PROCESSES PROTEINS INVOLVED IN LEUKOCYTE MIGRATION AND MATRIX REMODELING TO PROGRESS TO WOUND HEALING Synopsis Matrix metalloproteinases (MMPs) are a family of endopeptidases originally identified for their role in degradation of the extracellular matrix (ECM), but now recognized to process bioactive molecules and particularly to modify inflammatory responses. Membrane-type matrix metalloproteinase (MT)6-MMP/MMP-25, a neutrophil-specific MMP, is implicated in diseases including cancer and multiple sclerosis, though the functionality of this membrane protease is not yet known. To elucidate the biological roles of MT6-MMP, it is critical to identify the target substrates. Limited biochemical data has identified less than 10 extracellular matrix molecules and protease inhibitors as substrates. Herein, we expressed a soluble FLAG-tagged proprotein convertases mutant and a catalytically inactive mutant to assess the biochemical features of MT6- MMP and for in vitro cleavage assays of ECM proteins and chemokines we hypothesize are substrates. Further, we employed a proteomics approach to identify novel MT6- MMP substrates that are produced by human lung fibroblast cells. MT6-MMP processes 7 of each of the CXC and CC subfamilies of chemokines. Specifically, the neutrophil chemoattractant CXCL5 results in a product with increased agonist activity as do the monocyte chemoattractants CCL15 and CCL23. Further, we identified 58 candidate substrates of MT6-MMP in human lung fibroblast secretome, and following biochemical confirmation of vimentin as an MT6-MMP substrate we showed monocyte chemoattraction towards full-length vimentin that was reduced upon MMP-cleavage. We also confirmed cystatin C, insulin-like growth factor binding protein (IGFBP)-7, SPARC (secreted protein acidic and rich in cysteine), and galectin-1 as substrates for MT6- MMP. This work more than doubles the number of MT6-MMP substrates known, and through the processing of IGFBP-7 suggests a role for the enzyme in priming the tissue for wound healing. Introduction Polymorphonuclear neutrophils (PMNs) are critical components of the innate immune system in the defense against infection and in the progression of inflammation. Neutrophils are granulocytes, storing components within secretory vesicles and tertiary  68 granules that are required for transendothelial migration, and within primary and secondary granules that are antibacterial and proinflammatory (2). Within hours after injury, neutrophils are recruited to tissue wherein they release neutrophil extracellular traps (NETS) to contain bacteria (11), antimicrobial peptides, proteases, and proinflammatory cytokines and chemokines to propogate the response, phagocytose pathogens and then ultimately die by apoptosis. Recent work has identified roles for neutrophils in monocyte recruitment and macrophage activation, through the release of soluble mediators (255,259,303) and presentation of “eat-me” signaling proteins on the apoptotic membranes (268,304-306). Recruited monocytes differentiate into macrophages that are involved in resolution of inflammation.  The recruitment of neutrophils and monocytes is dependent in part upon chemoattracting cytokines, termed chemokines, which are produced and released from resident cells as well as recruited neutrophils. Of the two main chemokine subfamilies, CXC chemokines primarily recruit neutrophils whereas CC chemokines are more important in the recruitment of monocytes. Proteolysis of chemokine termini results in significant functional changes. Matrix metalloproteinases (MMPs) are family of enzymes, upregulated in inflammatory conditions, which are important for proteolysis of chemokine structure to modify cellular recruitment and inflammation in vivo (89,114). In Chapter 2, I showed the role of MMPs in activation of monocyte chemoattractants CCL15 and CCL23, and proposed a positive feed-forward mechanism. In contrast, monocyte chemoattractants CCL2, 7, 8, and 13 are inactivated by proteolysis of MMPs (87,114,115), including macrophage-specific MMP-12, implicating a negative feed-back mechanism for leukocyte control. The neutrophil human chemoattractants CXCL8 and CXCL5 and murine CXCL5/LIX are activated by stromal MMPs (87,89,220), and neutrophil-specific MMP-8, whereas human CXCL1, 2 and 3 are inactivated by MMP-1, -9 and the macrophage-specific MMP-12 (87). This leukocyte-specific MMP regulation of neutrophil and monocyte chemokines led us to question the role of the neutrophil- specific MT6-MMP in processing chemokines, for which limited substrates have been identified.  MT6-MMP is membrane-associated through a GPI-anchor, and contains a furin-like cleavage sequence for intracellular activation in the golgi (51,52). As with other MMPs,  69 enzymatic activity of MT6-MMP is regulated by tissue inhibitors of metalloproteinases (TIMPs), including TIMP-1, -2, -3, and -4, but also by the abundant serum protein clusterin (101,103,104). MT6-MMP is localized primarily to neutrophil gelatinase granules, but is also found in specific granules and secretory vesicles, and in lipid rafts on the plasma membrane of resting cells (72,101). Stimulation of neutrophils by CXCL8 and interferon (IFN)-gamma induces the release MT6-MMP, whereas stimulation and induction of apoptosis by PMA relocates MT6-MMP to the neutrophil surface (72,101). Together, these findings suggest a role for MT6-MMP not only in cellular migration but also in the functional effects observed for neutrophils interstitially and during apoptosis. There have been several studies implicating MT6-MMP in development and increased expression of the protease in inflammatory disease and cancers (83,84,307-310), yet few substrates of the protein have been identified. Through hypothesis-directed approaches, extracellular matrix proteins (type IV collagen, gelatin, fibronectin, fibrin), alpha-1 proteinase inhibitor, urokinase plasminogen activator receptor, and myelin basic protein have been identified as MT6-MMP substrates (103,109,111,112).  In the last decade, a significant amount of research in the protease field has been directed at the development of unbiased approaches for elucidating a protease’s substrate repertoire, termed the substrate degradome (311) (reviewed in (312)) wherein protease activity can be evaluated in a more relevant and complex biological system. Quantitiative shotgun proteomics has been successful in comparing proteomes differing in enzyme activity (116,216,287,313), though less abundant proteins may often go undetected. Therefore, enrichment strategies to isolate substrates from non-proteolyzed proteins are the current focus of research (314-318). Proteolysis at a single site results in a new (neo) amino (N)-terminus and a neo carboxy (C)-terminus, corresponding to residues at the prime and non-prime side of the substrate scissile bond respectively. Positive or negative selection techniques utilize the neo-N-terminus to enrich for substrates within the proteome prior to mass spectrometry analysis. We developed a method termed terminal amine isotopic labeling of substrates (TAILS) in which neo-N- termini in proteomes are differentially labeled (e.g. treated with active vs. inactive protease), combined, digested into peptides and then N-termini enriched by negative selection through an amine reactive polymer; peptide analysis by mass spectrometry provides quantitative identification of substrates and cleavage sites (318). The use of  70 isobaric tags for relative and absolute quantification (iTRAQ) reagents (iTRAQ-TAILS) enables for multiplex experimentation (319). Using TAILS, we have identified novel substrates for MMP-2, MMP-9, and MMP-11 (318,319).  To better understand the functional roles of MT6-MMP in neutrophil-dependent inflammation-promoting events, we expressed and purified a soluble form of MT6-MMP for use in a hypothesis directed approach and in a hypothesis generating proteomics approach to identify novel substrates of this enzyme. We evaluated the ability of MT6- MMP to cleave both neutrophil and monocyte chemoattractants to evaluate potential positive feed-back and feed-forward mechanisms. In addition, using a human fetal lung fibroblast (HFL) secretome as a relevant proteome that would be encountered by migrating neutrophils, we applied iTRAQ-TAILS to identify novel MT6-MMP substrates. The results of this research provide insight into the role of this enzyme in the potentiation and resolution of inflammation.  Material and Methods Proteins (chemokines, proteases, sources of ECM): Recombinant human MMP-1, -2, - 3, -8, -9, -12, -13, and soluble MMP-14, and recombinant murine TIMP-1, 2 and 4 were expressed and purified from mammalian systems using standard techniques (65,287,320); MMP-7 was purchased from U. S. Biochemical Corporation. All chemokines were chemically synthesized using t-Boc solid phase chemistry and purified by high-performance liquid chromatography and validated for activity as previously described (288). Marimastat was chemically synthesized as previously described (321). Recombinant human vimentin and galectin was purchased from R&D systems. DQ gelatin was purchase from Molecular Probes. Insulin-like growth factor binding protein (IGFBP)-7 protein and antibody, and cystatin C, were kindly provided by Kaoru Miyazaki (Yokohama City University, Japan) Magnus Abrahamson (University of Lund, Lund, Sweden).  Recombinant human MT6-MMP protein expression and purification: A pcDNA3.1 vector containing full-length MT6-MMP was kindly provided by Dr D. Pei (Guangzhou Institutes of Biomedicine and Health, China). A HindIII site was introduced at the 5’ end of the  71 construct using the forward primer 5’-CCGAAGCTTATGCGGCTGCGGCTCCGG-3’, allowing for 18 bp overlap with the original construct. Additionally, a FLAG tag, EcoRI site and stop sequence were exchanged with residues corresponding to the GPI-anchor region starting after Gly-514 to create soluble (s)MT6 using the forward primer 5’- CGGGAATTCCTACTTGTCATCG TCGTCCTTGTAGTCACCAGAGCTCGGGGCGGG- 3’. The product of a PCR reaction over 35 cycles at 95 °C for 30 sec, 60 °C for 30 sec, and 72 °C for 60 sec was visualized on 1% agarose gel electrophoresis, excised and extracted using the QIAGEN gel extraction kit in accordance with the manufacturers protocol. The purified product was digested with HindIII and EcoRI, separated by 1% agaose gel electrophoresis and again purified by QIAGEN gel extraction kit. After a 30 min A-tailing reaction of the purified digest product at 70 °C, it was ligated into pGEM-T for 16 h at 12 °C.  To produce a protein with increased stability in storage, the furin-like activation site of sMT6 was mutated at 103RRRRR107 to 103GAGAG107 resulting in sMT6Δfurin, hereafter termed sMT6ΔF. The site-directed mutagenesis was accomplished by reaction of 50 ng of sMT6 plasmid with 125 ng of each of the primers 5’-GGGGCTGGTCGGTGCCGG T GCCGGTTACG CTGTCAG-3’ and 3’-CCCCGACCAGCCACGGCCACGGCCAATGCG AGACTC-5’, where the bold text indicates the loop-in region. Reactions were carried out over 18 cycles of 95 °C for 30 sec, 55 °C for 60 sec, and 68 °C for 13.5 minutes. Separately, a second point-mutation was introduced into the sMT6 construct using the forward primer 5’-GGCTGTCCATGCGTTTGGCCACGCC-5’ and a reverse primer 3’- CCGACA GGTACGCAAACCGGTGCGG-5’ to mutate the catalytic Glu345 to Ala345, to produce sMT6EΔA. All PCR products were confirmed by DNA sequencing.  The three mutant constructs were separately ligated into pGW1GH vector and then transfected, in parallel with a vector control, into CHO-K1 cells by electroporation. After 24 h clonal selection was initiated by the addition of MPA to DMEM supplemented with 10% cosmic calf serum, HT supplement (Invitrogen) and xanthine. Surviving clones were screened for positive expression from 24 h conditioned media by Western blot using the M2-αFLAG primary antibody. A separate positive stable clone was used for expression of each of sMT6, sMT6ΔF and sMT6EΔA protein.  72 The protein purification procedure for each MT6-MMP construct was equivalent. Briefly, stable-transfectant CHO-K1 cells were grown to 90% confluency in MPA-containing growth media. Cells were washed three times with PBS and then media replaced with CHO-SFM. Conditioned media was collected every 24 h for 5 to 10 days. Media was clarified by centrifugation at 1500 x g for 10 min and filtered with 0.2 mm filter. A green Sepharose column (Sigma), resuspended in water, was used as a first purification step; after washing, proteins were eluted with 0.5 to 1.5 M NaCl. Eluates were pooled and dialyzed against Tris-buffered saline. Dialyzed samples were loaded onto a column prepared with αFLAG-agarose and eluted with 0.1 mM αFLAG-peptide (Sigma), according to the manufacturers protocol. Purity of proteins were confirmed by silver- stained 15% SDS-PAGE, and by Western blot using both M2αFLAG and rabbit αMT6- MMP (ab39031, Abcam). Proteins were quantified by Bradford assay, and activity of both sMT6 and sMT6ΔF quantified by active-site titration with recombinant TIMP-1 and TIMP-2 against the universal MMP quenched fluorescent substrate QF-24, having the sequence Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2, at excitation/emission of 320/405.  Peptide-based active site evaluation of MT6-MMP: Proteomic identification of cleavage sites (PICS) was completed in accordance with the method previously described (322). Briefly, 0.8 µg of active sMT6ΔF was added to 200 µg of tryptic peptide library prepared from K562 cells (ATCC #CCL-243) and incubated for 16 h at 37 °C in 50 mM HEPES, 10 mM CaCl2, 200 mM NaCl at pH 7.8. The reaction was heat inactivated at 70 °C for 30 min. The products were biotinylated with 0.5 mM sulfosuccinimidyl 2-(biotinamido)- ethyl-1,3-dithiopropionate (Pierce) at 22 °C for 2 h. In a 16 h reaction at 22 °C, biotin- labelled peptides were bound to streptavidin Sepharose (GE Healthcare) that was equilibrated in 50 mM HEPES, 150 mM NaCl, pH 7.4. Unbound peptides were removed by buffer washing and centrifugation at 1000 x g for 1 min in Spin Columns (Pierce). Bound peptides were eluted with 40 mM DTT in 50 mM HEPES. Impurities were removed with C18 Sep-Pak cartridges, eluting with 80% acetonitrile and the volume decreased under vacuum centrifugation. Peptide analysis was completed by LC-MS/MS on a QSTAR. Wiff files were searched with both Mascot and X!Tandem and results applied to WebPics (http://clipserve.dentistry.ubc.ca/pics/) and to IceLogo (http://iomics.ugent.be/icelogoserver/main.html) analysis (323).   73 Kinetic evaluation of fluorescent substrates: The kinetics of sMT6, sMT6ΔF and sMT6EΔA were evaluated against two quenched fluorescent (QF) substrates, namely QF24 and QF35, and compared to the relative fluorescence of 5 nM Mca. Increasing amounts of active site titrated enzyme were added to substrate and the reaction kinetics evaluated at excitation/emission of 320/405. The initial velocity (Vi) was calculated by ((ΔRFU/t) x [MCA])/RFUMCA where RFU is the relative fluorescent units due to enzyme activity, and t is time. This value was entered into the equation kcat/Km = Vi/([E][S]), to solve for kcat/Km. Reactions were carried out at 37 °C on a Polarstar Optima 96-well fluorimeter (BMG).  Inhibition of MT6-MMP: To evaluate the Ki of sMT6ΔF, the enzyme was incubated in the presence of increasing concentrations of recombinant murine TIMP-1, TIMP-2, TIMP-4 or Marimastat at 37 °C for 2 hours before the addition of QF24. The kinetics of the reactions were assessed at 37 °C on a Polarstar Optima 96-well fluorimeter. Data was imported and calculations for Morrison Ki were completed in Prism (GraphPad).  In vitro cleavage assays: In vitro assays by sMT6ΔF were performed in 50 mM HEPES, 200 mM NaCl, 5 mM CaCl2, pH 7.4. Cleavage of chemokines, vimentin, IGFBP-7, cystatin C, MMP-1, galectin-1 and Secreted protein, acidic and rich in cysteine (SPARC) were performed at enzyme to substrate 1:20 (w/w) ratios for 16 h at 37 °C. Collagen cleavage was performed for 16 h at 28 °C, or at 37 °C after enzyme-free collagen denaturation at 60 °C for 15 min. Chemokine cleavage assay products were analyzed, as previously described (289), by MALDI-TOF MS on a Voyager-DE STR (Applied Biosystems) or a 4700 (Applied Biosystems) using the matrices sinapinic acid or CHCA, respectively, and confirmed by silver-stained 15% Tris-Tricine SDS-PAGE. Chemokine cleavage was defined to be positive when the mass spectrometry spectra showed a cleavage product with greater than 20% intensity of the full-length chemokine. Cystatin C processing was confirmed by silver-stained 15% Tris-Tricine SDS-PAGE. Vimentin, IGFBP-7, MMP-1, galectin-1 and SPARC, and collagen cleavages were confirmed by silver-stained 15% or 7.5% Tris-glycine SDS-PAGE. Gelatin and casein processing were evaluated by zymography of gels polymerized in the presence of protein at 0.2 mg/ml. MMP processing of 25 µg/ml DQ gelatin was evaluated by an increase in  74 fluorescence at excitiation/emission of 495/515 nm on a Polarstar Optima 96-well fluorimeter (BMG).  HFL-1 secretome preparation: Human fetal lung fibroblast-1 cells (obtained from Dr. C Roberts, Vancouver, Canada) were grown to 90% confluency in DMEM containing 10% fetal calf serum. Cells were washed with PBS x3 and then with serum-free media x2, before adding fresh serum-free DMEM. After 16 h, serum-free media was clarified by centrifugation at 1500 x g for 10 min and filtered with 0.2 mm filter. Conditioned media was concentrated, and buffer exchanged to 50 mM HEPES, by ultracentrifugation at using 3-kDa-cutoff membranes (Amicon). The protein concentration was measured by Bradford assay (Bio-Rad).  Proteome digestion and terminal amine isotopic labeling of substrates (TAILS): Active sMT6ΔF or sMT6EΔA were added to concentrated, serum-free human fetal lung fibroblast (HFL-1) secretome in a 1:250 w/w ratio in 50 mM HEPES, 150 mM NaCl and 5 mM CaCl2, and incubated for 16 h at 37 °C. To enrich for N-terminus peptides, the resulting cleavage products were subjected to TAILS as a 2-plex iTRAQ experiment (318,319). Briefly, GuHCl and HEPES were added to HFL-1 cleavage assay products to a final concentration of 2.5 M and 250 mM respectively. Proteins were denatured with 1 mM tris(2-carboxyethyl)phosphine at 65 °C, and cysteines alkylated with 5 mM iodoacetamide. Proteins from sMT6ΔF or sMT6EΔA treatment were labeled in 50% DMSO with iTRAQ labels 114 and 115 respectively. After 30 min at 25 °C, the reaction was quenched with 100 mM ammonium bicarbonate. Labeled samples were combined and precipitated with 9 volumes of acetone/ methanol (8:1 volume ratio) at -20 °C. Protein precipitate was pelleted by centrifugation at 2500 x g for 30 min at 4 °C, washed with methanol, and resuspended in 50 mM HEPES for digestion with TrypsinGold (Promega) at a 1:100 enzyme:protein ratio for 16 h at 37 °C. Complete digestion was confirmed by silver-stained 15% SDS-PAGE.  N-termini enrichment was attained under acidic conditions at 37 °C for 16 h using a dendritic polyglycerol aldehyde polymer to deplete internal and C-terminal peptides. N-terminally blocked peptides, due to iTRAQ labeling or natural acetylation, were obtained from the unbound fraction by ultracentrifugation in 10,000-kDa-cutoff membranes (Amicon).   75 Samples were fractionated on a 1,200 series HPLC (Agilent Technologies) using a polysulfoethyl A 100 x 4.6 mm, 5 µM, 300 column (PolyLC Inc). Peptides were bound to the column and washed for 15 min in 10 mM potassium phosphate and 25% acetonitrile, pH 2.7. Peptides were eluted with a 22 min gradient to 0.3 M NaCl, then 6 min to 0.4 NaCl and 2 min to reach 1 M NaCl. Fractions collected every 1.5 min were concentrated under vacuum and desalted using C18 OMIX tips. Peptide samples were analyzed by nanospray LC-MS/MS using a C18 column interfaced with a QStar XL Hybrid ESI mass spectrometer (Applied Biosystems).  TAILS data analysis: Acquired MS2 scans were searched by both Mascot (version 2.2.2, Matrix Science) and X! Tandem (2007.07.01 release) against a human International Protein Index (IPI) protein database (v.3.69). Search parameters were: Semi-Arg-C cleavage specificity with up to 2 missed cleavages; fixed modifications of cysteine carbamidomethylation and lysine iTRAQ; variable modifications of N-terminal iTRAQ, N-terminal acetylation, methionine oxidation; peptide tolerance and MS/MS tolerance at 0.4 Da; scoring scheme was ESI-QUAD-TOF. Search results were analyzed with the TransProteomic Pipeline (TPP) (TPPv.4.3, rev 0, Build 200902191420) using PeptideProphet for peptide identification and Libra for quantification of iTRAQ reporter ion intensities (324,325). Each data set was modeled by TPP and included only the peptides with an iProphet probability error rate ≤ 0.05. Using in house software (321), termed Clipper, data sets were converted to a common format using ClipperConvert. Mascot and X! Tandem lists were combined for each experiment and analyzed as a single experiment or in tandem by Clipper. The data was normalized using a correction factor obtained by analysis of the average log2(ratio) natural N-termini peptides. Candidate substrates were identified as those having a ratio ≥ 2 standard deviation from the mean. The highest confidence substrates were proteins identified by the same peptide in biological replicate experiments. High confidence substrates were identified by multiple spectra in one experiment, whereas candidate substrates requiring biochemical validation were identified by only one spectra.  Transwell migration: THP-1 cells (ATCC) grown in RPMI 1640 supplemented with 10% fetal bovine serum were washed and resuspended at 1 x 106 cells/ml in RPMI 1640 media supplemented 0.1% bovine serum albumin. Chemoattractant, or MMP and buffer  76 controls, diluted in the same media in the lower chamber were separated from 2 x 105 cells/ml in the upper chamber of a 48-well Boyden chamber (Neuroprobe) by a 5 µm pore filter. Assays performed at 37 ºC, 5% CO2 were 90 min for THP-1. Non-migrating cells were aspirated and the upper chamber washed with 2 mM EDTA. The contents of the lower chamber was transferred to a Maxisorb 96-well plate and frozen at -80 ºC for a minimum of 2 h. DNA content was determined by addition of CyQuant reagent (Invitrogen) to the thawed lysate and fluorescence evaluated by excitation/emission at 485/538 nm. The chemotactic index was calculated by the ratio of the relative fluorescence of samples from cells migrating in response to chemokine compared with the media control. Experiments were carried out in ≥ quadruplicate and repeated two times. Statistical significance of cleaved versus full-length chemokine was evaluated by t-test. Results Purification of recombinant sMT6ΔF and sMT6EΔA: To prepare soluble forms of MT6- MMP that could be chemically activated (sMT6ΔF) or remain catalytically inactive (sMT6EΔA), the hydrophobic stem region was exchanged for a FLAG tag, and mutations made to the furin-like cleavage site or catalytic glutamate residue, respectively (Fig 3.1A). The proteins were expressed by CHO-K1 stable transfectants, and secreted into the media. The silver-stained 15% SDS-PAGE and Western blot of purified sMT6EΔA show comparable results under both reducing and non-reducing conditions (Fig 3.1B,C). A band corresponding to 46.5 kDa represents the catalytically inactive protein, lacking the prodomain, confirmed by Edman sequencing to start with 108YALSG112. A lower band, present at equimolar concentrations, was found by Western blot to be TIMP-2 (Fig 3.1D). This is consistent with previous studies that have identified TIMP-2 complexed with MT6-MMP (104).  Silver-stained 15% SDS-PAGE of purified sMT6ΔF protein revealed a doublet at ~47 kDa under-non-reducing conditions but under reducing conditions at ~27 kDa, and additional banding was evident at ~20 kDa (Fig 3.1B). Western blot detection of the same protein using an antibody to the linker region of MT6-MMP identified the additional degradation products under non-reducing conditions, and a triplicate at ~27 kDa under reducing conditions (Fig 3.1C). Edman sequencing revealed that the bands at 27 kDa  77        Figure 3.1 Expression and purification of soluble active and catalytically inactive MT6- MMP mutants. (A) Domain structures of MT6-MMP proteins that result from site-directed mutagenesis, indicating the signal peptide (S; yellow), propeptide (Pro; blue) with a furin-cleavage site (Navy), catalytic domain (green), flexible linker (grey), hemopexin domain (red), stalk and hydrophobic tail for GPI-anchoring (ST, orange). The stalk was truncated and a FLAG tag (black) appended to create a soluble MT6-MMP construct. An additional mutation to sMT6 was made to remove the furin cleavage site, resulting in the activatable sMT6ΔF protein. Alternatively, an additional mutation to sMT6 was made to remove the catalytic Glu residue, replacing it with Ala, resulting in the catalytically inactive sMT6EΔA protein. (B) Purified sMT6EΔA and sMT6ΔF proteins were visualized under non-reducing or reducing conditions on silver-stained 15% SDS-PAGE gels. Edman sequencing confirmed the N-termini of sMT6EΔA to be Tyr108 (arrow), for sMT6ΔF to be Leu101 (double arrows) and a degradation product of sMT6ΔF to occur within the hemopexin domain at Leu348 (double grey arrows). (C) Non-reduced or reduced sMT6EΔA and sMT6ΔF proteins analyzed by Western blot using a primary antibody against the linker region of MT6-MMP. (D) Western blot analysis of purified sMT6ΔF, sMT6EΔA and the control TIMP-2 with a primary antibody to TIMP-2 indicate the presence of TIMP-2 in the sMT6EΔA but not sMT6ΔF preparation. (E) Schematic of the predicted sMT6ΔF structure, indicating the catalytic domain (green) joined by linker (grey) to the FLAG-tagged (black) hemopexin domain (red). The hemopexin domain is cleaved, but the C-termini portion in bound to the N-termini of the hemopexin domain by disulfide bond.  78  79 correspond to 101LVGAG105, likely representing glycosylation variants (102). This indicates that despite mutation of the furin-like cleavage site at 103RRRRR107, the prodomain of sMT6ΔF is still cleaved off intracellularly, though this occurs 7 residues upstream of the natural start of the MT6-MMP catalytic domain. The bands at ~20 kDa have the N-terminal seqence 348LVSPR352, representing degradation of MT6-MMP wherein the hemopexin domain is separated from the catalytic domain. Proteolysis at 348LVSPR352 was previously observed in an sMT6 construct that was expressed by MDCK cells (105). Together, this data suggests that the disulfide bonded (C317 and Cys508, by homology with other MMPs) hemopexin domain of sMT6ΔF is cleaved, with the C-terminal fragment being retained to the catalytic domain by the disulfide bond (Fig 3.1E). Further, the lack of hemopexin domain degradation in the sMT6EΔA that was observed in the sMT6ΔF protein, suggests that this is an autocatalytic event and that sMT6ΔF is catalytically active despite the remnant prodomain amino acids at the N- terminal of purified sMT6ΔF. While the N-terminus is not directly involved in catalysis it may stabilize the active site. The MMP-8 N-terminus 79Phe ammonium group forms a salt-bridge through the carboxylate group of the conserved 232Asp in helix C to stabilize the catalytic site for enhance activity that is not observed in a 80Met truncated variant. Thus the activity of this purified sMT6ΔF with a 101Gly N-terminus may be slower than that of MT6-MMP with an N-terminus at 108Tyr (326).  Peptide identification of cleavage site specificity: To identify the preferred sequence cleavage site of sMT6ΔF, we employed the PICS technique, which enables the detection of prime side cleavage residues by mass spectrometry and for the bioinformatic identification of non-prime residues (322). PICS analysis of a tryptic peptide library used as diverse library of proteome derived peptides was incubated with sMT6ΔF resulting in the identification of 286 cleavage sites in the cleaved peptides. WebPics analysis of the data indicates a strong preference for Leu at P1’ and Val at P2’, and preferences for Pro/Val at P3 and Ala/Glu at P1 (Fig 3.2A). After adjusting for amino acid abundance, the IceLogo of the PICS confirm these preferences but also highlight preferences for Asn residues in P2 and P1 that are not observed in the heat map (Fig 3.2B). In general, these findings are consistent with other MMPs (Schilling et al, in preparation). Notably, MMP-2 and MT5-MMP have a preference for Gly at P1  80                       Figure 3.2 PICS analysis of MT6-MMP cleavage site specificity. (A) Heat map of the amino acid occurrence at positions P6 to P6’ (Schecter and Berger nomenclature (327)) of the 286 peptides analyzed and identified by MS/MS following PICS analysis of sMT6ΔF cleavage of a tryptic library. (B) IceLogo analysis of the PICS data, adjusting for relative abundance of the amino acids in the homo sapien proteome, indicating the relative occurrence of amino acids at positions P6 to P6’ from the 286 peptides analyzed and identified.  81 (322) Goebler and Overall, unpublished data) which MT6-MMP does not.  Characterization of catalytic activity and inhibition: To confirm the catalytic activity of the recombinant sMT6 preparations, we evaluated the kinetics of processing of fluorescent MMP substrates (Fig 3.3A). As expected, sMT6ΔF, but not sMT6EΔA, was catalytically active against QF24; the activity was not increased by the addition of chemical activators such as p-aminophenylmercuric acetate (results not shown).  The kcat/Km of sMT6ΔF was found to be 171 M-1s-1 for QF24 and 36 for QF35. In agreement with the findings for the catalytic domain of MT6-MMP by Nie and Pei (110) that contrasted with those of English and colleagues (103), sMT6ΔF showed a clear preference for QF24 over QF35 (Fig 3.3B). Yet, sMT6ΔF processing of the substrates is significantly lower than that of MT1-MMP, as is sMT6, suggesting that this is not the ideal substrate for MT6-MMP. This reduced activity is consistent with the different preferences observed by PICS analysis, specifically the preference for Gly at P1 by several MMPs that is not present for MT6-MMP, but is present in QF24 (Fig 3.3A).  English and colleagues found TIMP2 and TIMP3 to be much stronger inhibitors than TIMP1 of a catalytic domain construct of MT6-MMP (103), whereas other groups observed similar inhibition by TIMP1 and TIMP2 of both catalytic domain and sMT6 constructs of MT6-MMP (104,105). Despite the tight binding observed by TIMP-2 in purification of sMT6EΔA, TIMP-1 and TIMP-4 were stronger inhibitors of the sMT6ΔF protein, and all were significantly stronger inhibitors than the small molecule drug inhibitor Marimastat (Fig 3.3C).  Proteolysis of extracellular matrix components: The gelatinolytic activity of the catalytic domain of MT6-MMP has been shown by zymography and in vitro for type I gelatin (52,103,110) yet this is not consistent with the results of cell expressed full-length MT6- MMP (84). In agreement with Radichev and colleagues (104), we found that the gelatinolytic activity of sMT6ΔF is minimal. By gelatin zymography, 1,000 ng of sMT6ΔF resulted in only a slight clearing whereas 10 ng of MMP-9 results in a strong signal (Fig 3.4A). Further, in an assay using DQ-gelatin, in which a fluorescent signal is observed only upon gelatin cleavage, there was minimal activity of 10-fold more sMT6ΔF  82                      Figure 3.3 Kinetic analysis of MT6-MMP and inhibition by TIMPs. (A) Sequences of the quenched fluorescent substrates used to evaluate MMP activity. (B) The cleavages of QF substrates by 3 nM MMP at 24 or 36°C were compared by measurement of the increase in fluorescence at excitation/emission of 320/405 nM. (C) Inhibition of 3 nM sMT6ΔF processing of 1000 nM QF24 by increasing concentrations of TIMP-1, -2, and -4, and by Marimastat was evaluated by measurement of fluorescence at excitation/emission of 320/405 nm and Morrision Ki calculated in Prism (GraphPad).  83                    Figure 3.4 MT6-MMP cleavage of gelatin and casein. (A) Gelatin zymography, wherein a clear band indicates proteolysis of gelatin that is polymerized within the SDS-PAGE gel. 10 ng of MMP-9 resulted in a clear band (arrow) whereas 100 and 1000 ng of sMT6ΔF results in only a slight clearance, indicating weak gelatinolytic activity. (B) Quenched fluorescein-conjugated gelatin processing by sMT6ΔF compared with MMP-2 processing was monitored at excitation/emission of 485/530. (C) Casein processing by sMT6ΔF was evaluated by zymography, wherein a clear band indicates significant proteolysis. 10 ng of MMP-7 resulted in a clear band (arrow) whereas 100 and 1000 ng of sMT6ΔF results in only a slight clearance (arrow), indicating weak that casein is not a strong substrate for sMT6ΔF.  84 compared with MMP-2 (Fig 3.4B). Similar results were observed by casein zymography, in that 1,000 ng of sMT6ΔF cleaves casein only slightly compared with 10 ng of MMP-7 (Fig 3.4C).  Chemokine processing by MT6-MMP: MMP processing of chemokines is a critical event in the control of inflammation (114).  To evaluate the role of the neutrophil-specific MT6- MMP in modulating neutrophil recruitment, we evaluated sMT6ΔF in vitro processing of 14 neutrophil chemoattractants, specifically CXC chemokines. Cleavage sites were identified in 7 CXC chemokines (Fig 3.5). Cleavage of CXCL2 resulted in a product lacking the four N-termini residues as is common for many MMP cleaved chemokines. Cleavage was not observed in the related chemokines CXCL1 and CXCL3, which have Ser-Val residues where Pro-Leu are observed in P3-P2 of CXCL2. Similarly, murine (m) CXCL1 and mCXCL2 were not cleaved by sMT6ΔF; mCXCL1 has an Asn instead of Thr at the P1’ position of hCXCL2 whereas mCXCL2 has the sequence AVVASELR. Both human and murine CXCL5 were processed by sMT6ΔF at the N-terminus. The products hCXCL5 (8-78) and mCXCL5 (5-92) were previously shown to have increased agonist activity (89,164,220,296). The product mCXCL5 (10-92) had not been previously identified. CXCL6 was cleaved to a product that lacks the first 28 residues. Cleavage by MMPs beyond the conserved cysteine residues is rarely observed outside of degradation, yet this product was observed at all enzyme to chemokine ratios evaluated and was the only product observed. Further, this product resulted following incubation with all other MMPs evaluated (Fig 3.5C). The truncation product observed from CXCL9 incubation with sMT6ΔF of CXCL9 (1-90) was previously observed following MMP-7, -9 and -12 activity, though a change to function has not been evaluated (154,220). Processing of CXCL12 by sMT6ΔF showed results consistent with those of other MMPs, removing four N-termini residues; this product has been shown to result in a loss of CXCR4 activity and increased neurotoxic activity (181,183). Notably, in addition to those previously mentioned, human CXCL7, 8, 10 and 11 were not cleaved by sMT6ΔF (Fig 3.5D).   85                   Figure 3.5 CXC chemokine processing by MT6-MMP. (A) Human CXCL chemokines were incubated with recombinant sMT6ΔF at 1:20 molar ratios, or in the cases of CXCL6 at 1:250 – 1:1000, at 37ºC for 16 h. Cleavage assay products were visualized on silver-stained 15% Tris-Tricine gels. (B) Human CXCL6 was incubated with recombinant sMT6ΔF or MMP-1, -2, -3, -7, -8, -9, -12, -13, and -14 at 1:10 molar ratios at 37ºC for 16 h. Cleavage assay products were visualized on silver-stained 15% Tris-Tricine gels. (C) Cleavages of the CXCL chemokines listed were not detectable by MALDI-TOF following incubation at a 1:20 molar ratio with sMT6ΔF at 37ºC for 16 h. (D) Cleavage products were assigned by MALDI-TOF mass spectrometry by comparison of measured with predicted mass to charge ratios (m/z) with +1 charge ionization ([M + H]+). An arrow indicates deconvoluted cleavage sites in the corresponding sequence.  86 As with CXC chemokines, 7 CC chemokines were processed by sMT6ΔF (Fig 3.6). The removal of 4 N-terminus residues from CCL2, CCL7, and CCL13 by sMT6ΔF is consistent with the previous findings of processing by multiple MMPs; these products are receptor antagonists (Chapter 2) (87,114,115). CCL4 (1-69) was cleaved by sMT6ΔF to the product CCL4 (7-69), which is known to have reduced dimeric properties (191). CCL15 and CCL23 were cleaved at multiple sites by sMT6ΔF. These truncation products have enhanced agonist activity (Chapter 2). The processing of CCL16 by sMT6ΔF to result in truncation of the first 4 N-termini residues was previously identified by MMP-2, -8, and -14 processing, though appeared as an intermediate truncation form (Chapter 2).  TAILS analysis to identify MT6-MMP substrates: Secretomes from HFL-1 cells were incubated with sMT6ΔF or the catalytically inactive sMT6EΔA as control to identify substrates for MT6-MMP. Samples from two biological replicates were processed by TAILS, using iTRAQ labels 114 and 115 for active and inactive enzyme treatment, respectively. From Exp1, 312 and 224 unique peptides at >95% confidence were identified by Mascot and X! Tandem respectively (Fig 3.7A) combined to 407 unique peptides. From Exp 2, Mascot and X! Tandem searched identified 224 and 166 unique peptides with >95% confidence respectively for a combined total of 300 unique identifications. Clipper analysis of Exp1 and Exp2, requiring identification in both experiments (written as Exp1XExp2), identified 89 common peptides (Fig 3.7B) (Appendix A.1). Separate Clipper analysis, which has extremely stringent requirements for the quality of the spectra to peptide assignment, identified an additional 219 and 112 peptides in the Exp1 and Exp2 data sets that were not common to Exp1XExp2 (Fig 3.7) (Appendix A.2, A.3).  The N-terminal semi-tryptic peptides derived from the natural N-terminus of full-length proteins (± N-terminal methionine or ± signal peptide) were assumed to be unchanged and equally distributed in both sMT6ΔF- and sMT6EΔA-treated secretomes. The natural N-termini peptides were equally distributed between natural unblocked termini that were now labeled by iTRAQ and natural blocked peptides that were identified as being  87                        Figure 3.6 CC chemokine processing by MT6-MMP. (A) Human CCL chemokines were incubated with recombinant sMT6ΔF at 1:20 molar ratios at 37ºC for 16 h. Cleavage assay products were visualized on silver-stained 15% Tris-Tricine gels. (B) Cleavages of the CCL chemokines listed were not detectable by MALDI-TOF following incubation at a 1:20 molar ratio with sMT6ΔF at 37ºC for 16 h. (C) Cleavage products were assigned by MALDI-TOF mass spectrometry by comparison of measured with predicted mass to charge ratios (m/z) with +1 charge ionization ([M + H]+). An arrow indicates deconvoluted cleavage sites in the corresponding sequence.  88                          Figure 3.7 Venn diagram of the number of peptides identified by TAILS analysis. (A) Four-way Venn diagram of unique peptide identifications, with ≥95% confidence, by Mascot and X!Tandem in experiments (Exp)1 and Exp2. (B) Two-way Venn diagram of all unique peptides identified, after combining Mascot and X!Tandem search results for one experiment, only in Sec1, Sec2, or in both experiments. (C) Two-way Venn diagram of unique peptides that have reached the experimental cutoff for that dataset identified in Sec1, Sec2, or in both experiments.  89 acetylated (Fig 3.8)—distributions that are similar to previous TAILS analyses of secretomes (318,319). The mean log2(ratio) of natural N-terminus peptides was used for data normalization. The Exp1xExp2 data set included 32 unique peptides that were used for normalization (Appendix A.1) having a standard deviation of 0.24 (Fig 3.9A). The Exp1 data set included 82 unique peptides that were used for normalization (Appendix A.2), having a standard deviation of 0.27 (Fig 3.9B). The Exp2 data set included 31 unique peptides used for normalization (Appendix A.3), having a standard deviation of 0.60 (Fig 3.9C).  We assumed that MT6-MMP processing of soluble substrates would result in an iTRAQ ratio of 114(sMT6ΔF)/115(sMT6EΔA) ≥ 1 whereas a ratio ≤ 1 would indicate degradation of the n-terminus. To have increased confidence in the substrates identified, the value of the cutoff ratio for each experiment ≥ 2 standard deviations from the mean. Ultimately, 171 peptides corresponding to 58 unique proteins met the criteria for inclusion. Proteins that were identified in biological replicate experiments were considered to be the highest confidence candidate substrates of MT6-MMP (Table 3.1) whereas those identified by more ≥ 2 spectra or by 1 spectra were considered to be high confident (Table 3.2) or candidate substrates of MT6-MMP (Table 3.3) requiring biochemical validation, respectively.  Vimentin has chemotactic potential for THP-1 cells that is lost following MMP- processing: We identified vimentin as a highest confidence substrate of MT6-MMP (Table 3.1) by 10 different peptides, three of which were common to both experiments. The location of the peptides identified are indicated on the vimentin sequence (Fig 3.10A). Previous proteomics experiments have identified vimentin as a substrate for MMPs but this was never biochemically validated (Overall lab, unpublished data). By in vitro cleavage assay, we confirmed that vimentin is cleaved not only by sMT6ΔF but also by all MMPs evaluated (3.10B). Vimentin is expressed on the surface of apoptotic neutrophils (328), and increases macrophage activity (329). Based on this information, we reasoned that vimentin may be a monocyte chemoattractant, acting as an “eat-me” signal (305). In a Transwell migration assay, we show that full-length vimentin is a chemoattractant for THP-1 cells whereas MMP-cleaved vimentin is not (Fig 3.10C). The  90                            Figure 3.8 Natural N-termini distribution. Analysis of peptides identified in biological replicate experiments. Distribution of N- terminal modifications among original N-termini identified by TAILS analysis of (A) Exp1xExp2 (n=133 peptides). (B) Exp1 (n=82 peptides). (C) Exp2 (n= 31 peptides).  91                              Figure 3.9 Distribution of all peptides. Histogram distribution of log2(iTRAQ ratio) of all normalized peptides (A) Exp1xExp2, (B) Exp1, (C) Exp2. Vertical lines indicate the cut-off ratio for each experiment.  92 Table 3.1 Highest confident candidate substrates of MT6-MMP Substrates were identified by the same peptide in biological replicates following HFL secretome treatment with sMT6ΔF (114 label) or sMT6EΔA (115 label). *indicates additional peptide identification in Exp1, §indicates additional peptide identification in Exp2. Protein Ratio 114/115 Peptide 26S protease regulatory subunit 8 1.82 2 ALDGPEQMELEEGKAGSGLR Actin 0.64 22 GFAGDDAPR  2.22 31 AVFPSIVGR  11.14 107 LTEAPLNPKANR  4.41 300 VLSGGTTMYPGIADR  4.53 8 LVVDNGSGMCKAGFAGDDAPR*  26.19 45 VMVGMGQKDSYVGDEAQSKR§  21.62 54 SYVGDEAQSKR§ Collagen type I α-1 chain 10.29 1001 GPPGLAGPPGESGR  31.73 977 GPSGEPGKQGPSGASGER§  10.98 1004 GLAGPPGESGR§  36.17 1005 LAGPPGESGR§  42.57 1006 AGPPGESGR§  12.67 1050 APGAPGPVGPAGKSGDR§  12.27 1052 GAPGPVGPAGKSGDR§  0.36 1075 AGPVGPVGAR§  6.55 1237 SLSQQIENIR§  23.76 1239 SQQIENIR§ Collagen type I α-2 chain 1.42 868 GAPGILGLPGSR  2.33 333 VGAAGATGAR  4.68 1141 SLNNQIETLLTPEGSR   17.94 113 FQGPAGEPGEPGQTGPAGAR§   14.84 115 GPAGEPGEPGQTGPAGAR§  0.65 121 GEPGQTGPAGAR*   20.15 331 GPVGAAGATGAR§   48.93 370 GPPGPSGEEGKR§  1.48 385 GEAGSAGPPGPPGLR*   43.99 559 GPSGPAGEVGKPGER§   7.94 784 GMTGFPGAAGR§   23.30 808 GPPGPAGKEGLR§   3.10 868 GAPGILGLPGSR§   24.51 967 GPVGPAGKHGNR§  38.25 1103 VSGGGYDFGYDGDFYR§   10.94 1109 DFGYDGDFYR§   14.89 1110 FGYDGDFYR§   29.73 1111 GYDGDFYR§  27.86 1112 YDGDFYR§   20.83 1144 NQIETLLTPEGSR§  39.22 1142 LNNQIETLLTPEGSR§   25.98 1143 NNQIETLLTPEGSR§  93 Protein Ratio 114/115 Peptide   42.37 1146 IETLLTPEGSR§   22.07 1149 LLTPEGSR§ Cystatin-C 5.54 35 LVGGPMDASVEEEGVRR   26.71 35 LVGGPMDASVEEEGVR   26.35 36 VGGPMDASVEEEGVR§   7.48 37 GGPMDASVEEEGVR§   31.22 42 ASVEEEGVR§ IGFBP-5 0.63 164 KFVGGAENTAHPR   2.97 213 AVYLPNCDR   0.18 165 FVGGAENTAHPR§   0.29 166 VGGAENTAHPR* IGFBP-7 1.46 98 AGAAAGGPGVSGVCVCKSR  2.42 98 AGAAAGGPGVSGVCVCKSR§   6.72 99 GAAAGGPGVSGVCVCKSR§   32.03 100 AAAGGPGVSGVCVCKSR§ MT6-MMP 8.38 318 EGNFDAIANIR  36.59 29 VSLGVDWLTR*  8.67 254 FYQGPVGDPDKYR*   4.41 255 YQGPVGDPDKYR*   8.83 318 EGNFDAIANIR*  23.62 359 FWEGLPAQVR§   8.73 386 SGPQFWVFQDR*   17.25 473 GDTYFFKGAHYWR* Transgelin 0.66 2 ANKGPSYGMSR Tropomyosin α-4 chain 3.56 133 LVILEGELER   0.68 16 ALQQQADEAEDR*   19.62 115 AKHIAEEADR§  15.24 134 VILEGELER§ Vimentin 0.58 55 SSPGGVYATR  2.05 87 SLADAINTEFKNTR   1.55 88 LADAINTEFKNTR   0.30 54 ASSPGGVYATR§   0.65 91 AINTEFKNTR*   35.77 114 FANYIDKVR§   0.39 258 VDVSKPDLTAALR§   8.83 295 FADLSEAANR§   2.69 296 ADLSEAANR§   4.21 330 VDALKGTNESLER§ YIPF3 0.71 321 DIPAMLPAAR       94 Table 3.2 High confident candidate substrates of MT6-MMP. Substrates were identified by ≥ 2 spectra following HFL secretome treatment with sMT6ΔF (114 label) or sMT6EΔA (115 label). *indicates peptide identification in Exp1, §indicates peptide identification in Exp2. Protein Ratio 114/115 Peptide No. of Spectra Α-actinin-1 24.56 13 MQPEEDWDR§ 2 Collagen type II α-1 chain  43.76 576 GPAGPAGER§ 2  8.59 825 GATGFPGAAGR§ 2 Collagen type IV α-2 chain 6.84 76 GLQGFPGLQGR§ 1  20.66 461 FPGLPGSPGAR§ 1  32.24 651 GPAGTPGQIDCDTDVKR§ 1  5.81 655 TPGQIDCDTDVKR§ 1 Collagen type VI α-1 chain 1.71 443 GDPGEAGPQGDQGR* 1  16.85 497 GPPGDPGLMGER§ 2  7.81 500 GDPGLMGER§ 1 Collagen type VI α-3 chain 2.96 3106 LTETDICKLPKDEGTCR§ 1 Dickkopf-related protein 3 33.89 131 TVITSVGDEEGR§ 2  15.46 54 VEELMEDTQHKLR§ 1  51.66 252 ITWELEPDGALDR§ 1 Extracellular matrix protein 1 0.15 20 ASEGGFTATGQR§ 3 Fibrillin-1 precursor 0.37 25 ADANLEAGNVKETR§ 2 MMP-1 4.98 328 LEAAYEFADR* 2  7.30 364 IYSSFGFPR* 1 Peptidyl-prolyl cis-trans isomerase A 7.88 9 DIAVDGEPLGR§ 3  8.52 8 FDIAVDGEPLGR§ 1 Procollagen C- endopeptidase enhancer 1 37.52 309 SPSAPDAPTCPKQCR§ 2 Protein-lysine 6-oxidase 0.61 59 SLGSQYQPQR* 2  4.75 57 LLSLGSQYQPQR* 2  0.39 22 APPAAGQQQPPR§ 1  2.12 58 LSLGSQYQPQR* 1 Serpin H1 0.23 139 SVSFADDFVR* 2 Sulfhydryl oxidase 1  42.01 565 AMGALELESR§ 7  32.69 566 MGALELESR§ 2 Stromal cell derived factor 4 precursor 12.27 84 GKDLGGFDEDAEPR§ 1  7.94 88 GGFDEDAEPR§ 1 Syndecan-4 7.00 24 TEVIDPQDLLEGR§ 2  7.49 26 VIDPQDLLEGR§ 1 Tropomyosin 3  6.84 170 LVIIEGDLER§ 1  38.06 171 VIIEGDLER§ 2 Tropomyosin beta chain 41.62 22 AEQAEADKKQAEDR§ 2  48.86 24 QAEADKKQAEDR§ 1  17.45 74 AEKKATDAEADVASLNR§ 1  23.20 151 AKHIAEDSDR§ 1  95 Table 3.3 Candidate substrates of MT6-MMP. Substrates were identified by 1 spectra following HFL secretome treatment with sMT6ΔF (114 label) or sMT6EΔA (115 label). *indicates peptide identification in Exp1, §indicates peptide identification in Exp2. Protein Ratio 114/115 Peptide 40S ribosomal protein SA  4.33 90 FAAATGATPIAGR§ 5,6-dihydroxyindole-2- carboxylic acid oxidase 21.06 425 FPLENAPIGHNR§ 60S ribosomal protein L26- like 1 0.57 1 MKFNPFVTSDR* α2-macroglobulin 8.24 708 YESDVMGR* Calumenin precursor 10.54 53 LGAEEAKTFDQLTPEESKER§ Cellular nucleic acid-binding protein 50.29 45 FVSSSLPDICYR§ Dihydrolipoyllysine-residue succinyltransferase 0.66 51 DDLVTVKTPAFAESVTEGDVR* Elongation factor 1-delta 2.58 60 SLAGSSGPGASSGTSGDHGELVVR§ Fibulin-1 precursor 36.94 170 EQEDPYLNDR§ Filamin-C 4.27 2304 FTVGPLGEGGAHKVR§ Galectin-1 3.22 35 LGKDSNNLCLHFNPR§ Galectin-3-binding protein 9.49 447 FQAPSDYR§ Gelsolin precursor 1.47 404 GLGLSYLSSHIANVER* Glyceraldehyde-3- phosphate dehydrogenase 6.84 4 VKVGVNGFGR* Latent-transforming growth factor beta-binding protein 2 1.48 1729 FEGLQAEECGILNGCENGR*  5.36 249 SSAAGEGTLAR§ Nestin 5.54 1397 LLDPAAWDR* Polymerase I and transcript release factor 11.70 344 VGADDDEGGAER§ Protein disulfide-isomerase A6 precursor 0.45 72 LYSSSDDVIELTPSNFNR* Protein-lysine 6-oxidase 0.25 56 SLLSLGSQYQPQR§ Sodium-dependent phosphate transport protein 51.66 319 ISSVLQANLR§ SPARC 0.63 156 LDSELTEFPLR* Spondin-2 25.78 251 FIPPAPVLPSR§ Sulfhydryl oxidase 1 precursor 51.66 34 ALYSPSDPLTLLQADTVR§ Transcription elongation factor SPT4 0.65 2 ALETVPKDLR* Tubulin α-4A chain 6.46 92 LITGKEDAANNYAR* VEGF C 1.52 112 AHYNTEILKSIDNEWR* V-type proton ATPase subunit G 1 2.03 2 ASQSQGIQQLLQAEKR* WD repeat-containing protein 1 6.84 8 VFASLPQVER§  96           Figure 3.10 Vimentin cleavage by MMPs results in a loss of chemotactic potential. (A) Protein sequence of vimentin. Green and red indicate peptides identified with increased or decreased iTRAQ-ratio by TAILS analysis respectively. (B) Vimentin was incubated in the presence of MT6-MMP (25), MMP-1, 2, 7, 8, 9, 12, 13, and 14 at a 1:20 molar ratio for 16 h at 37°C. Cleavage assay products were visualized by silver-stained 15% SDS-PAGE. Arrow indicates full-length vimentin; broken arrow indicates cleavage product in the presence of MT6-MMP. (C) Transwell migration response of THP-1 cells to full-length of MMP-12 cleaved vimentin for 90 min through a 5 µm pore-sized filter. Migrated cells were quantified by CyQUANT assay and displayed as chemotactic index, defined as the ratio of cells migrating in response to stimulus compared with buffer control. Results shown are the mean +/- SEM of 2 biological replicates of experiments completed with 8 replicates.  97  98 peak response was observed at 450 nM, which is high compared with classical chemoattractants including CCL7 (included as a positive control), but comparable with that of other intracellular proteins with chemoattractant potential (330).  Validation of TAILS candidate proteins: In addition to vimentin, we biochemically validated highest candidate substrates, and candidate substrates using biochemical cleavage assays of proteins identified by TAILS analysis. By gel electrophoresis, the shift of cystatin C following sMT6ΔF processing is evident and appears complete (Fig 3.11A). Cystatin C processing has previously been shown by MMP-2 (216). By gel electrophoresis and Western blot analysis, sMT6ΔF cleavage of IGFBP-7 was confirmed (Fig 3.11B). IGFBP-7 was previously identified to be an MMP-2 substrate, but was not confirmed. Related to IGFBP-7, IGFBP-1, -2, -3, -4, and -6 were previously confirmed MMP substrates (216,319,331-337). Galectin-1 and SPARC were both identified by only one spectra and so required biochemical validation for inclusion as substrates for MT6-MMP (Table 3.3). A shift is observed by gel electrophoresis in the band corresponding to galectin-1, confirming processing by MT6-MMP (Fig 3.11C); galectin-1 is also processed by MMP-2 and -14 (216,313). SPARC was previously identified as a substrate of MMP-2, 3, 7, 9 and 13 (338,339), and we now confirm processing by sMT6ΔF (Fig 3.11D). Notably, unlike the other proteins validated in vitro, the experiment iTRAQ ratio for SPARC was decreased, indicating degradation. Consistent with this, there is a complete loss of the full-length SPARC band (Fig 3.11D). Discussion Since MT6-MMP is a neutrophil-specific proteinase our hypothesis was that the activity of this cell surface proteinase would be involved in cleavage and regulation of specific inflammatory molecules and pathways involved in innate inflammatory processes. Indeed, 14 chemokines that recruit neutrophils and monocytes were precisely cleaved by MT6-MMP leading to inactivation or activation of their biological activities (Fig 3.5, 3.6). Further, using TAILS proteomics we identified with high confidence 26 candidate substrates and an additional 28 potential substrate of MT6-MMP (Tables 3.1-3.3), several of which are known to contribute to inflammation through leukocyte migration and extracellular matrix remodeling. Gelatin was a poor substrate (Fig 3.4) and with only 20% of the substrates identified in our screens being ECM proteins, rather than being  99                       Figure 3.11 Confirmation of novel MT6-MMP substrates. Candidate substrates (A) Cystatin C, (B) IGFBP7, (C) Galectin-1, or (D) SPARC were incubated in the presence of sMT6ΔF at a 1:20 molar ratio for 16 h at 37°C. Cleavage assay products were visualized by silver-stained SDS-PAGE. Arrow indicates full-length protein; broken arrow indicates cleavage product in the presence of MT6-MMP.  100 primarily an extracellular matrix degrader, MT6-MMP appears to be primarily involved in inflammatory cell regulation.  Neutrophils are amongst the first cells recruited, and remain present for the first two days of the early phase of wound healing. The predominant neutrophil chemoattractant CXCL8 is produced by macrophages, monocytes and neutrophils, and is activated by MMP-8, -9, -12, -13, and -14 (87,89,220,287). Similarly, the murine (m) orthologue CXCL5/LIX is activated by MMP-8, and -9 (89,220). In an air pouch model of inflammation, mice lacking neutrophil-specific MMP-8, specifically Mmp8-/- mice, had deficient cellular recruitment to LPS and full-length mCXCL5/LIX but an equivalent response to truncated mCXCL5/LIX when compared with wild-type counterparts, indicating that MMP-8 is important for chemokine activation in vivo (89). Moreover, this suggests a positive feedback mechanism wherein recruited neutrophils propagate the inflammatory response by both releasing and activating the chemokine responsible for further neutrophil recruitment. Following activation by CXCL8 and IFN-gamma, neutrophils express MT6-MMP on the surface and release the enzyme in an active, soluble form (72,101). We identified that MT6-MMP processes the neutrophil chemoattractants CXCL2 and CXCL5 to the products CXCL2 (5-73) and CXCL5 (8-78) (Fig 3.5D). CXCL2 (5-73) has enhanced agonist activity with stronger calcium mobilization and chemotactic potential than full-length CXCL2 (162). Similarly, CXCL5 (8-78) is a stronger receptor agonist than CXCL5 (1-78) (89,164,220,296). Together, these results suggest a role for MT6-MMP in promoting neutrophil migration, acting in a positive feedback manner similar to that observed for MMP-8 activation of CXCL8. Notably, while mCXCL5/LIX was cleaved by MT6-MMP (Fig 3.5A), CXCL8 was not (Fig 3.5C), suggesting that the two neutrophil-specific enzymes function differently, perhaps in a temporal-dependent manner to amplify the CXCL8 response.  In contrast, the MT6-MMP cleavage of the neutrophil chemoattractant CXCL6, which was also observed from all MMPs evaluated (Fig 3.5B), is likely to cause chemokine inactivation since truncation occurs beyond the conserved cysteine residues. While in vitro cleavage assays provide an indication of in vivo substrates of proteases, it lacks the temporal and spatial regulation that would occur in vivo. As yet, there has not been a comprehensive study to elucidate the kinetics of chemokine production. Further,  101 abundance of chemokine, as detected by ELISA, does not indicate the functionality of chemokines in acute or chronic inflammation. Yet, we predict that, based on cellular sources, CXCL2 and CXCL5 released by activated neutrophils and epithelial cells, respectively, are activated by MT6-MMP for early recruitment of neutrophils. CXCL6 production is more tightly regulated then CXCL5, and appears to be more critical in disease than in acute inflammation (340,341).  In addition to promoting neutrophil recruitment, we propose that MT6-MMP promotes the recruitment of monocytes to progress the inflammatory response to the next cellular stage. Both CCL15 and CCL23 are produced by macrophages and monocytes, but are relatively weak CCR1 receptor agonists in the full-length form. In vitro processing of CCL15 and CCL23 by MT6-MMP results in N-termini-truncated forms (Fig 3.6A, 3.6C) that were previously shown to have increased agonist activity with increased chemotactic potential (Chapter 2). This suggests a role for neutrophils, through MT6- MMP, in a positive feed-forward mechanism to progress the inflammatory response through increased recruitment of monocytes expressing CCR1.  In contrast to CCL15 and CCL23, which require proteolytic activation, CXCL12, CCL2, CCL7, CCL13 lost agonist activity or become receptor antagonists following N-termini truncation (87,114,115,181), which was observed by MT6-MMP proteolysis (Fig 3.5D, 3.6C). Once recruited to tissue, monocyte receptor expression changes from CCR1high (binding CCL15 and CCL23) to CCR2high (CCL2) thus this differential processing of chemokines by MT6-MMP may function to halt recruited cells—signaling that they have reached the target site.  In addition to chemoattractant processing, cleavage of the proteoglycans can alter haptotactic gradients to contribute to cell recruitment. Syndecan is a proteoglycan with heparan sulfate glycosaminoglycans. MMP-7 processing of syndecan enabled for passage of the chemokine-bound proteoglycan into the alveolar space to contribute to chemotactic gradient formation (342). We have identified syndecan-4 processing by MT6-MMP in the extracellular region of the protein (Table 3.2), suggesting that a similar role may exist for MT6-MMP processing in developing a chemotactic gradient. In contrast, inhibition of cell migration by MT6-MMP may occur through modification of GAG binding. The lymphocyte chemoattractant CXCL9 is processed in the C-termini by  102 MT6-MMP to CXCL9 (1-90) (Fig 3.5A, D) a site previously observed by MMP-7, 8, and - 12 proteolysis (154,343). The significance of this cleavage was not ascertained, though in removing five positively charged residues, we predict that there would be a reduction in GAG binding, and thus loss of the chemotactic gradient associated with this chemokine. A similar effect was previously observed following MMP-truncation within the C-termini of CXCL11 (154).  One of the highest candidate substrates by TAILS analysis was vimentin (Table 3.1). Intracellularly, vimentin functions to anchor organelles within the cytosol, but recent studies have suggested a bona fide extracellular role for this “moonlighting” protein (34). Vimentin is actively secreted by macrophages following TNF- α stimulation to increase ROS production (329),  In addition, vimentin is expressed on the surface of apoptotic neutrophils, though only detected by antibodies to regions in the C-termini (328). Neutrophil apoptosis is a final critical event, important for chemotaxis and activation of macrophages (268,304-306), and during which there is enhanced surface expression of MT6-MMP (101). We found that full-length vimentin is chemotactic for THP-1 monocytic cells, but this chemotactic potential is lost following MMP processing (Fig 3.10C). Therefore, we propose that MT6-MMP processes necrosis-released vimentin, whereas cell-surface bound vimentin chemoattracts and signals to macrophages for specific cell clearance by phagocytosis.  A number of proteins identified by TAILS analysis are components of cell proliferation collagen production, likely to be involved in the early phase of wound healing. Peptides for insulin-like growth factor binding protein (IGFBP)-5 and -7 were found increased in the secretome treated with active MT6-MMP compared with inactive enzyme (Table 3.1). IGFBP-7 was confirmed to be a substrate of MT6-MMP by SDS-PAGE (Fig 3.11B) and Western blot (results not shown) of in vitro cleavage assay products. Similarly, TAILS analysis suggests that IGFBP-5 is a candidate substrate of MT6-MMP (Table 3.1). IGFBP-1, -2, -3 and -4 and -6 were previously shown to be MMP substrates (116,287,313,319,331-335,337). IGFBPs are critical regulators of IGF; sequestering and inhibiting the activity of approximately 99% of circulating IGF (344,345). Unbound IGF binds surface expressed IGF receptor to promote cell growth (346,347). Thus, cleavage and inactivation of IGFBPs would promote IGF activity.  103 Galectin-1 and SPARC were both identified by only one spectra and so required biochemical validation for inclusion as substrates for MT6-MMP (Table 3.3). Both are matricellular proteins with multifunctional roles including proinflammatory function, and wound healing (348-350). Galectin-1 is a substrate of MMP-2 and -14 (216,313), whereas SPARC is cleaved by MMP-1, -3, -7, -9 and -13 (338,339). We now confirm processing of both proteins by MT6-MMP in vitro (Fig 3.11C, D). This result highlights the strength of this TAILS analysis, to identify protease substrates by single spectra. Consistent with this, type IV collagen was previously shown to be a substrate of MT6- MMP (103), though was identified in only one experiment (Table 3.2). In contrast, type I collagen was identified by biological replicate experiments by 24 peptides (Table 3.1) but previously found to not be a substrate by catalytic domain MT6-MMP (103). The MMP hemopexin domain is required for binding and perturbing the structure of native collagen (65) and thus could explain the differences observed. Alternatively, the collagen type I proteolysis observed in the TAILS analysis by MT6-MMP might be through an indirect effect by increasing the activity of a stronger collagenase. The cysteine protease cathepsin K has strong collagenase activity (351) that would normally be inhibited by cystatin C. Previously shown to be a substrate of MMP-2 (116), cystatin C was identified as one of the highest confidence candidate substrate for MT6-MMP by 5 peptides with increased ratios (Table 3.1). Mutational loss of cystatin C activity is linked with diseases associated with protein deposition (352,353), likely through loss of inhibitory activity towards cysteine protease and the metalloprotease meprin (354). MT6-MMP proteolysis of cystatin C is complete in vitro, confirming the protease inhibitor to be a substrate for MT6-MMP (Fig 3.11A) and implicating MT6-MMP in modification of the ‘protease web’.  Through hypothesis-directed and hypothesis-generating approaches, we have confirmed and identified a number of candidate MT6-MMP substrates. These results implicate MT6-MMP in contributing to neutrophil recruitment through the activation of CXCL2 and CXCL5, and in the progression of the acute inflammatory response toward monocyte recruitment by activation of CCL15 and CCL23. Further, interstitial roles for MT6-MMP are proposed wherein monocyte chemoattractants, including vimentin, are processed to halt haptotaxis. In view of the biological activities of the new MT6-MMP  104 substrates and cleavage products we propose a model whereby MT6-MMP contributes to this regulatory environment of inflammation and wound healing at multiple stages.   105 CHAPTER 4: DETERMINATION OF THE MT6-MMP SUBSTRATE DEGRADOME BY ITRAQ-TAILS QUANTITATIVE PROTEOMICS Synopsis Proteolysis of signaling proteins, cell-surface molecules and intercellular signaling molecules is an irreversible modification that alters the function of these proteins. As such, identification of protease substrates is critical to understanding the biological role of a protease in vivo. Membrane-type (MT) 6-matrix metalloproteinase (MMP) is implicated in inflammatory disease and is associated with a number of cancers, yet few substrates have been identified for this neutrophil-specific protease. We applied the quantitative proteomics method isobaric tag for relative and absolute quantitation - terminal amine isotopic labeling of substrates (iTRAQ-TAILS), to identify novel substrates of MT6-MMP. Since neutrophils traverse through vascular endothelium to the subjacent connective tissue we examined conditioned media proteins and membrane- enriched proteins from human microvascular endothelial (HMEC) cells and human fetal lung fibroblasts (HFL-1) grown in the presence of exogenous soluble, constitutively active MT6-MMP protein (sMT6ΔF) or an inactive counterpart (sMT6EΔA). From 463 proteins identified, 218 showed a significant change in iTRAQ ratios and are considered candidate substrates of MT6-MMP. Known substrates of other MMPs, including prosaposin, galectin-1, progranulin and cluster of differentiation (CD)59 were identified indicating they were high confidence MT6-MMP substrates, as was a protein not previously identified to be an MMP-substrate, namely endoplasmic reticulum-Golgi intermediate compartment (ERGIC)-53. This unbiased approach provides a reference to begin to more fully elucidate the roles of MT6-MMP.  Introduction Proteolysis is a non-reversible modification of protein structure. While degradation is the cleavage of proteins at multiple sites leading to the clearing of a protein, specific proteolytic processing results in a modified protein with a new amino (N)-terminus, termed the neo-N-terminus, often with an altered or even completely different function. Understanding how a protease functions depends upon knowing the substrate repertoire. A number of methods have been used to identify the substrates of a given  106 protease—including directed approaches using the knowledge base of related proteases, to more sophisticated unbiased screens. Recently, proteomics approaches, and more specifically, mass spectrometry-based techniques have led the way in substrate identification (312,355,356)  We recently developed a method for the quantitative identification of N-termini (318). Termed terminal amine isotopic labeling of substrates (TAILS), this method enriches for N-termini through the use of an amine reactive polymer. Originally using dimethylation for quantification, TAILS was enhanced by the introduction of isobaric tags for relative and absolute quantification (iTRAQ) labels (319). In brief, primary amines from samples treated with and without protease are differentially iTRAQ labeled at the protein level, combined and then digested with trypsin. This results in a mixture of peptides with labeled natural N-termini, neo-N-termini, and lysine residues but unlabeled internal peptides. Using an amine-reactive polymer, only unlabeled internal peptides are removed, thus enriching for the natural and neo-N-termini. This is a powerful approach and an important advance in the identification of matrix metalloproteinases (MMPs) that has been applied to elucidate substrates of MMP-2, MMP-8 and MMP-9 (318,319,321).  The MMPs are a family of 23 endopeptidases with a broad specificity and diverse substrate repertoire. First identified by the collagenolytic activity of MMP-1, the role of MMPs was traditionally considered to reside in degradation of the extracellular matrix. Due to substrate discovery methods including yeast 2-hybrid (114) and TAILS, it is now recognized that MMPs have a critical role in the processing of bioactive molecules including those involved in cell adhesion, proliferation, migration and inflammation. Some MMPs have been well investigated resulting in significant knowledge of their substrate repertoire. In contrast, membrane-type (MT)6-MMP has been the focus of very few studies.  MT6-MMP is produced primarily by neutrophils (52). It is membrane bound through a GPI-anchor (51) and located both in neutrophil granules and in lipid rafts in the plasma membrane (101). Following neutrophil activation, MT6-MMP is released from granules (72) presumably as a component of the neutrophil arsenal as it passes through the endothelium into infected tissue where these cells are critical in the elimination of  107 pathogens and the progression of the acute inflammatory response to promote healing. Despite evidence for a role of MT6-MMP in development, inflammatory diseases and cancer, the number of known substrates is limited. Substrates include collagen IV, gelatin, fibronectin, fibrin (103), α1-proteinase inhibitor (109,112) and myelin basic protein isoforms (109). In addition, we previously identified candidate substrates of MT6-MMP from a human fetal lung fibroblast (HFL) secretome (Chapter 3), including galectin-1, insulin-like growth factor binding protein (IGFBP)-7, cystatin C and chemokines, suggesting roles for the protease in inflammation and wound healing. To build upon this data, we sought to evaluate MT6-MMP proteolysis in a cellular system as we have done previously for MT1-MMP and MMP-2 (116,216,313). To represent the proteome that MT6-MMP is likely to encounter we used proteomes from both HFL and human microvascular endothelial cells (HMEC). Despite the challenge of analyzing data that is subject to biological effects such as protein synthesis and endocytosis, our approach has successfully identified candidate substrates for this previously modestly characterized MMP.  Material and Methods Proteins: Recombinant human soluble, constitutively active MT6-MMP protein (sMT6ΔF) and its inactive counterpart (sMT6EΔA) were expressed and purified as previously described (Chapter 2). Bradford assay (Bio-Rad) was used to quantify the amount of sMT6EΔA, whereas sMT6ΔF was quantified by active-site titration with recombinant TIMP-1 against the universal MMP quenched fluorescent substrate having the sequence Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2, at excitation/emission wavelengths of 320/405 nm.  Cell culture and proteome preparation: HFL-1 cells (obtained from Dr C. Roberts, University of British Columbia, Canada) were grown to 80-90% confluency in DMEM containing 10% fetal bovine serum. HMEC cells at passage number 17 were grown to 80-90% confluency in MCDB 131 media supplemented with 10% fetal bovine serum, 10 ng/ml endothelial growth factor, antibiotics (penicillin and streptomycin) And glutamine. Cells were washed three times with phosphate-buffered saline (PBS) and then twice  108 with serum-free media. Cells were grown in appropriate serum-free containing sMT6ΔF or sMT6EΔA at a final concentration of 0.1 µg/ml for 20 h at 37 °C, 5% CO2.  For conditioned medium preparation, media was harvested, and protease inhibitors were added (1 mM phenylmethylsulfonyl fluoride, 1 mM EDTA, 1 µM pepstatin, 5 µM E64). The conditioned medium was clarified by centrifugation at 1,500 X g for 10 min and filtered  (0.22 µm filter). Conditioned media was concentrated 100-fold, and buffer exchanged to 50 mM HEPES, pH 8.0, by ultracentrifugation using 3-kDa cutoff membranes according to manufacturers instructions (Centricon; Amicon). The protein concentration was measured by Bradford assay (Bio-Rad) and stored at -70 °C prior to iTRAQ labeling.  After removal of conditioned medium, membrane-enriched protein fractions were prepared as previously described (357). Briefly, cells were washed with PBS and detached in versine (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 . 7H2O, 1.8 mM NaH2PO4, 0.5 mM EDTA, 1.1 mM glucose, pH 7.4). Cells were then washed in cold membrane buffer (50 mM HEPES, 200 mM NaCl, 10 mM CaCl2, pH 6.8), pelleted by centrifugation and resuspended in fresh membrane buffer containing protease inhibitors (as above). Cells were lysed on ice by nitrogen decompression for 30 min at 600 lb/in2 N2 in a cell disruption bomb (Parr Instrument Co., Moline, IL). Following rapid decompression and cell lysis, the cell lysate was centrifuged at 1,100 X g for 10 min at 4 °C. The supernatant was then centrifuged at 48,000 X g for 60 min at 4 °C. Membrane pellets were resuspended in an equal volume (less than150 µl) of 8.0 M GuHCl and 100 mM HEPES, pH 8.0. The protein concentration was measured by Bradford assay (Bio- Rad) and stored at -70 °C prior to iTRAQ labeling.  Terminal amine isotopic labeling of substrates (TAILS): To enrich for N-terminus peptides a 4-plex iTRAQ-TAILS was applied for each HFL or HMEC experiment (318,319). The method is outlined schematically in Figure 4.1. The four conditions came sMT6ΔF- or sMT6EΔA-treatment comparisons of both conditioned medium and membrane fractions.  Briefly, GuHCl and HEPES were added to conditioned media and membrane-fractions to a final concentration of 2.5 M and 250 mM respectively, in a final  109          Figure 4.1 Schematic of method. Overview of the method for analysis of the TAILS analysis of conditioned medium and cell membrane fractions. Cells (HFL or HMEC) were treated with active (sMT6ΔF) or catalytically inactive (sMT6EΔA) protease in serum-free medium for 20 h at 37°C. Conditioned medium was collected and concentration, and membrane fractions prepared. Fractions were labeled with iTRAQ reagents and then combined for the TAILS procedure. Precipitated proteins were labeled, digested with trypsin and then the N-terminome was enriched by incubation with an amine-reactive polymer. Unbound (natural blocked or neo-N-termini) peptides were fractionated and fractions then evaluated by LC MS/MS. Mascot searches and X-Tandem searches were performed and analyzed with the TransProteomic Pipeline separately. Mascot and X!Tandem search results were then combined by Clipper and analyzed. Conditioned medium and membrane fractions were analyzed separately, and compared with biological replicate experiment in Clipper.  110  111 volume of 541 µl. Proteins were denatured with 1 mM tris(2-carboxyethyl)phosphine at 65 °C, and cysteines were alkylated with 5 mM iodoacetamide. Proteins from conditioned medium treated with sMT6ΔF or sMT6EΔA were labeled with iTRAQ labels 114 and 115, respectively. Proteins from membranes treated with sMT6ΔF or sMT6EΔA were labeled with iTRAQ labels 116 and 117, respectively. The amounts of protein labeled within one experiment were equal, though between experiments ranged from 250-350 µg/label. After 30 min at 25 °C, the reaction was quenched with 100 mM ammonium bicarbonate. Labeled samples were combined and precipitated with 9 volumes of acetone/ methanol (8:1 volume ratio) at -20 °C. Protein precipitate was pelleted by centrifugation at 2,500 X g for 30 min at 4 °C, washed with methanol, and resuspended in 50 mM HEPES for digestion with TrypsinGold (Promega) at a 1:100 enzyme:protein ratio for 16 h at 37 °C. Complete digestion was confirmed by silver- stained 15% SDS-PAGE.  Enrichment of N-termini was carried out under acidic conditions at 37 °C for 16 h using a dendritic polyglycerol aldehyde polymer to deplete internal and C-terminal peptides. N-terminally blocked peptides, due to iTRAQ labeling or natural acetylation, were obtained from the unbound fraction by centrifugation through 10-kDa cut-off membranes (Centricon; Amicon).  Samples were fractionated on a 1,200 series HPLC (Agilent Technologies) using a polysulfoethyl A 100 x 4.6 mm, 5 µm, 300 column (PolyLC Inc). Peptides were bound to the column and washed for 15 min with 10 mM potassium phosphate, 25% acetonitrile, pH 2.7. Peptides were eluted with a 22 min gradient from 0-0.3 M NaCl, then 6 min from 0.3-0.4 NaCl and 2 min 0.4-1.0 M NaCl. Fractions collected every 1.5 min were concentrated under vacuum and desalted using C18 OMIX tips. Peptide samples were analyzed by nanospray LC-MS/MS using a C18 column interfaced with a QStar XL Hybrid ESI mass spectrometer (Applied Biosystems).  TAILS analysis: Acquired MS2 scans were searched using both Mascot (version 2.2.2 Matrix Science) and X! Tandem (2007.07.01 release) against a human International Protein Index (IPI) protein database (v.3.69). Search parameters were: Semi-ArgC cleavage specificity with up to 2 missed cleavages; fixed modifications of cysteine carbamidomethylation and lysine iTRAQ; variable modifications of N-terminal iTRAQ, N-  112 terminal acetylation, methionine oxidation; peptide tolerance and MS/MS tolerance at 0.4 Da; scoring scheme was ESI-QUAD-TOF. Search results were analyzed with the TransProteomic Pipeline (TPP) (TPPv.4.3, rev 0, Build 200902191420) using PeptideProphet for peptide identification and Libra for quantification of iTRAQ reporter ion intensities (324,325). Each data set was modeled by TPP and included only the peptides with an iProphet probability error rate ≤ 5%. Using in house software (321), termed Clipper, data sets were converted to a common format using ClipperConvert. Mascot and X! Tandem lists were combined for each experiment.  To obtain high confidence substrates, tandem analysis of biological replicate experiments by Clipper was performed with the requirement that peptides must be identified by both experiments. In addition, a separate evaluation of each experiment was performed in Clipper, requiring identification only once but so forming a lower confidence peptide list. Conditioned medium and membrane fractions were then separated for analysis. The data was normalized using a correction factor obtained by analysis of the average log2(ratio) for all labeled peptide pairs in that data set. Candidate substrates were identified as those having a ratio ≥ 1 standard deviation from the mean. These results were narrowed to include only proteins identified by ≥ 2 spectra.  Analysis of cleavage specificity sequence: To determine the preferred sequence specificity of MT6-MMP, TAILS data sets were analyzed with the iceLogo web application (http://iomics.ugent.be/icelogoserver/main.html) (323) against the homo sapiens reference library. The sequence was determined for residues P4-P4’ from all unique neo-N-terminus peptides identified by TAILS that did not include Arg at the P1 position. A second analysis was performed with the further condition that the included peptides must also have a ratio ≥ 1 standard deviation for the data set that it was identified in (i.e. only peptides from substrate candidates).  Results The majority of proteins were identified by a single peptide. This is not unexpected since TAILS analysis enriches for N-termini and so the measure of success of a TAILS  113 experiment is exactly this. In the case of natural N-termini, the few proteins that were identified by multiple peptides represent peptides differing in the presence of the initiating Met residue (e.g. HFL2 conditioned medium: Elongation factor 2) or missed tryptic cleavage (e.g. HFL2 conditioned medium: protein-lysine 6-oxidase). For neo-N- termini, multiple peptide identifications represent different internal sites of proteolysis (e.g. vimentin). All identified peptides are provided in Appendix B.  From HFL conditioned medium, a total of 121 unique proteins were identified with 20% overlap between biological replicates whereas 234 unique proteins were identified in HFL membranes with 23% overlap between biological replicates (Table 4.1; Fig 4.2B). Similarly, the number of unique proteins identified in the conditioned media of HMEC cells was lower than that of the membrane fraction at 230 versus 280 respectively. Further, 32% and 20% of the proteins were identified by replicate experiments from HMEC conditioned medium and membrane fractions respectively (Table 4.2; Fig 4.2C). The low degree of overlap between biological replicates is due in part to the effects of biology that can not be controlled in an open system such as used here, wherein protein synthesis and secretion is modified by exogenous protein. Additionally, under-sampling is an inherent issue in mass spectrometry, in that a limited number of peptides are sequenced and identified.  Table 4.1 Number of proteins (and peptides) identified in HFL experiments based on IPI identification  Conditioned Medium HFL1              HFL2 Membrane HFL1            HFL2 Total 35 (37) 110 (135) 74 (85) 214 (255) Natural N-termini 19 (19) 61 (63) 43 (45) 127 (130) Neo N-termini 16 (18) 52 (72) 31 (30) 92 (125)    114                      Figure 4.2 Venn diagrams of the identified peptides. Mascot and X!Tandem analysis of TAILS data indicating the number and overlap of peptides found from each experiment. (A) Number of peptides identified in the conditioned medium in the experiments HFL1, HFL2, HMEC1 or HMEC2). (B) Number of peptides identified in the membrane fraction in the experiments HFL1, HFL2, HMEC1 or HMEC2).  115 Table 4.2 Number of proteins (and peptides) identified in HMEC experiments based on IPI identification  Conditioned Medium HMEC1       HMEC2 Membrane HMEC1            HMEC2 Total 180 (214) 123 (146) 263 (296) 72 (77) Natural N-Termini 107 (108) 50 (51) 169 (176) 46 (50) Neo N-Termini 79 (106) 75 (95) 101 (120) 26 (27)  iTRAQ-TAILS analysis: Under the assumption that the majority of peptides identified would not be altered due to MT6-MMP proteolysis, the data was normalized using the mean ratio for each data set. All data sets conformed to a Gaussian distribution, suggesting that this assumption is accurate. The histograms of the HFL data sets are shown in Figure 4.3, and the HMEC data sets are shown in Figure 4.4.  Recently, a statistical approach was developed to set a cut-off value for TAILS data that enables confident substrate identification (321). This approach works well for a system in which biological variance is limited, such as addition of exogenous protease to a previously harvested secretome in vitro (319,321) but is not appropriate for a system that is subject to perturbation by exogenous protease activity, such as cultured cells. In fluid systems, such as that evaluated here, the cutoff ratio for determining protease- generating peptides is based on known substrates (216,313,358). Since very few MT6- MMP substrates have been identified, a combination of these techniques was applied. The cut-off ratio was set to 1 standard deviation from the mean. Tables 4.3 to 4.6 list the candidate substrates of MT6-MMP identified by biological replicate experiments or by multiple spectra in one experiment from conditioned medium and membrane fractions of HFL treated cells. The corresponding lists from HMEC cells are shown in Tables 4.7 to 4.10.        116                          Figure 4.3 Distribution of HFL iTRAQ ratios. Histogram distribution of log2(iTRAQ ratio) of all normalized peptides in (A) HFL1xHFL2 conditioned media, (B) HFL1 conditioned media (C) HFL2 conditioned media (D) HFL1xHFL2 membrane fraction (E) HFL1 membrane fraction (F) HFL2 membrane fraction. Bars represent all peptides, red squares are neo-N-termini, and blue squares are natural N-termini.   117                          Figure 4.4 Distribution of HMEC iTRAQ ratios. Histogram distribution of log2 (iTRAQ ratio) of all normalized peptides in (A) HMEC1xHMEC2 conditioned media, (B) HMEC1 conditioned media (C) HMEC2 conditioned media (D) HMEC1xHMEC2 membrane fraction (E) HMEC1 membrane fraction (F) HMEC2 membrane fraction. Bars represent all peptides, red squares are neo-N-termini, and blue squares are natural N-termini.   118 Table 4.3 Highest confident candidate substrates from HFL conditioned medium Secreted or soluble candidate substrates of MT6-MMP were identified by the same peptide in biological replicates from HFL conditioned medium following cell treatment with sMT6ΔF (114 label) or sMT6EΔA (115 label). N-termini Protein Ratio 114/115 Peptide 60S ribosomal protein L11 6.22 2 AQDQGEKENPMR Coiled-coil domain-containing protein 56 9.84 2 ASSGAGDPLDSKR Dynein light chain roadblock-type 1 2.50 2 AEVEETLKR Natural Mitochondrial 2-oxoglutarate/malate carrier protein 10.89 2 AATASAGAGGIDGKPR 3--ketoacyl-CoA 0.08 8 LSGAPQASAADVVVVHGR Neo Kinectin 0.26 238 DNADSSPVVDKR  Table 4.4 Candidate substrates from HFL conditioned medium Secreted or soluble candidate substrates of MT6-MMP were identified by peptides found in ≥2 spectra in one experiment from HFL conditioned medium following cell treatment with sMT6ΔF (114 label) or sMT6EΔA  (115 label). §Indicates peptide identification in HFL1 experiment,  *indicates peptide identification in HFL2 N-termini Protein Ratio 114/115 Peptide No. of Spectra Galectin-1 2.58 2 ACGLVASNLNLKPGECLR* 7 Kinesin-1 heavy chain 2.48 2 ADLAECNIKVMCR* 2 Poly [ADP-ribose] polymerase 1 2.44 2 AESSDKLYR* 2 Prohibitin-2 5.62 2 AQNLKDLAGR* 2 Natural Stathmin 2.06 2 ASSDIQVKELEKR§ 2 ACAA1 (aceyltranserase) 0.06 15 SAADVVVVHGR* 1 Neo  0.03 8 LSGAPQASAADVVVVHGR* 1   119 Table 4.5 Highest confident candidate substrates from HFL membrane fractions Candidate substrates of MT6-MMP were identified by the same peptide in biological replicates from HFL membrane fractions following cell treatment with sMT6ΔF (116 label) or sMT6EΔA (117 label). §indicates additional peptide identification in HFL1 experiment,  *indicates additional peptide identification in HFL2 experiment. N-termini Protein Ratio 116/117 Peptide Natural ATP synthase subunit alpha 0.69 44 QKTGTAEMSSILEER  Cytochrome c oxidase subunit 5A 1.35 42 SHGSQETDEEFDAR  Glycogen phosphorylase 2.17 2 AKPLTDSEKR  NADH dehydrogenase [ubiquinone] 1  0.71 2 TGYTPDEKLR  Polypyrimidine tract-binding protein 1 1.48 1 MDGIVPDIAVGTKR  Stathmin 1.71 2 ASSDIQVKELEKR Neo Actin 1.58 108 TEAPLNPKANR   4.27 360 QEYDESGPSIVHR*  Annexin VI isoform 2 1.81 484 SLEDALSSDTSGHFR  Beta-1C of Integrin beta-1 precursor 0.64 65 DDLEALKKKGCPPDDIENPR  EH domain-containing protein 2 1.55 412 GAFEGTHMGPFVER  Fibrillin-1 precursor 0.56 25 ADANLEAGNVKETR  Protocadherin gamma-C3 precursor 0.64 30 STVIHYEIPEER  Prosaposin 1.40 195 GDVCQDCIQMVTDIQTAVR 0.56 87 SLADAINTEFKNTR 1.60 90 DAINTEFKNTR 0.29 329 EVDALKGTNESLER* 0.33 88 LADAINTEFKNTR 0.37 258 VDVSKPDLTAALR* 0.45 86 FSLADAINTEFKNTR* 0.45 55 SSPGGVYATR* 0.49 260 VSKPDLTAALR* 0.53 89 ADAINTEFKNTR* 0.57 328 CEVDALKGTNESLER* 0.62 330 VDALKGTNESLER* 1.31 91 AINTEFKNTR§  Vimentin 1.42 89 ADAINTEFKNTR§  120 Table 4.6 Candidate substrates from HFL membrane fractions Candidate substrates of MT6-MMP were identified by peptides found in ≥2 spectra in one experiment from HFL membrane fractions following cell treatment with sMT6ΔF (116 label) or sMT6EΔA  (117 label). §indicates peptide identification in HFL1 experiment,  *indicates peptide identification in HFL2 experiment. N-termini Protein Ratio 116/117 Peptide No. of Spectra Natural 40S ribosomal protein S16 0.62 2 PSKGPLQSVQVFGR* 2  Alpha-soluble NSF attachment protein 1.68 1 MDNSGKEAEAMALLAEAER* 2  Cytochrome c oxidase subunit 5B 0.66 32 ASGGGVPTDEEQATGLER§ 4  Dolichyl-diphosphooligosaccharide-- protein glycosyltransferase subunit 1 0.57 25 SSEAPPLINEDVKR* 2  Enoyl-CoA hydratase 0.62 28 ASGANFEYIIAEKR* 4  Extracellular matrix protein 1 1.80 20 ASEGGFTATGQR* 3  Galectin-1 1.56 2 ACGLVASNLNLKPGECLR* 7  GPI-anchor transamidase 1.89 28 SHIEDQAEQFFR* 2  Surfeit locus protein 4 1.68 2 GQNDLMGTAEDFADQFLR* 4  Plasminogen activator inhibitor 1 RNA- binding protein 1.72 2 PGHLQEGFGCVVTNR* 4  Protein transport protein Sec61 subunit β 0.66 2 PGPTPSGTNVGSSGR§ 2  T-complex protein 1 subunit zeta 0.53 2 AAVKTLNPKAEVAR* 2 Neo Brain of Clathrin light chain A 1.56 95 AAISQVDR* 2  CD59 glycoprotein 1.64 65 WKFEHCNFNDVTTR* 2  Fibulin-1 precursor 4.80 30 DVLLEACCADGHR* 4  Progranulin 0.44 205 SVMCPDAR* 1+M   0.74 101 DVKCDMEVSCPDGYTCCR§ 1+M  KDEL motif-containing protein 2 precursor 1.60 21 GAPEVLVSAPR* 2  Peptidyl-prolyl cis-trans isomerase 1.72 39 GVQVETISPGDGR* 2   121 Table 4.7 Highest confident candidate substrates from HMEC conditioned medium Secreted or soluble candidate substrates of MT6-MMP were identified by the same peptide in biological replicates from HMEC conditioned medium following cell treatment with sMT6ΔF (114 label) or sMT6EΔA (115 label). §indicates additional peptide identification in HMEC1 experiment, *indicates additional peptide identification in HMEC2 experiment. N-termini Protein Ratio 114/115 Peptide Natural 40S ribosomal protein S20 2.04 2 AFKDTGKTPVEPEVAIHR  60S ribosomal protein L11 2.34 2 AQDQGEKENPMR  Actin-related protein 2/3 complex subunit 5 0.59 2 SKNTVSSAR  Aminoacyl tRNA synthase complex-interacting multifunctional protein 1 3.01 2 ANNDAVLKR  BAG family molecular chaperone regulator 2 2.35 2 AQAKINAKANEGR  Cofilin-1 1.83 2 ASGVAVSDGVIKVFNDMKVR  Endoplasmin 1.88 22 DDEVDVDGTVEEDLGKSR  Galectin-1 1.68 2 ACGLVASNLNLKPGECLR  Leucine zipper protein 1 2.99 2 AEFTSYKETASSR  MT6-MMP 1.84 108 YALSGSVWKKR  Mitochondrial 2-oxoglutarate/malate carrier protein 9.27 2 AATASAGAGGIDGKPR  Nuclear RNA export factor 1 6.92 2 ADEGKSYSEHDDER  PALM2-AKAP2 protein isoform 1 4.72 2 AEAELHKER  Prohibitin-2 14.55 2 AQNLKDLAGR  Protein phosphatase 1; catalytic subunit; alpha isoform 3 0.49 2 SDSEKLNLDSIIGR  Protein transport protein Sec61 subunit β 1.85 2 PGPTPSGTNVGSSGR  Ras suppressor protein 1 1.72 2 SKSLKKLVEESR  THO complex subunit 4 2.04 2 ADKMDMSLDDIIKLNR Neo 60S ribosomal protein L31 0.53 15 SAINEVVTR  Actin 0.43 87 IWHHTFYNELR   0.56 23 FAGDDAPR   0.52 197 GYSFTTTAER§  DNA-binding protein A 0.58 270 GVPEGAQLQGPVHR  Heterogeneous nuclear ribonucleoprotein R 0.41 428 STAYEDYYYHPPPR  122 N-termini Protein Ratio 114/115 Peptide  Insulin-like growth factor-binding protein 5 0.54 164 KFVGGAENTAHPR  Insulin-like growth factor-binding protein 6 0.55 79 APGLQCHPPKDDEAPLR  KH domain-containing; RNA-binding; signal transduction- associated protein 1 0.42 18 SGSMDPSGAHPSVR  Microtubule-associated protein RP/EB family member 1 0.41 169 TAAAPKAGPGVVR  Nucleophosmin 0.56 36 DENEHQLSLR  PDZ and LIM domain protein 1 0.51 55 GENTSNMTHLEAQNR  THUMPD1 Putative uncharacterized protein DKFZp686C1054 0.40 88 AAPAQQTTQPGGGKR  Vimentin 2.41 86 FSLADAINTEFKNTR   0.53 262 KPDLTAALR*  Table 4.8 Candidate substrates from HMEC conditioned medium Secreted or soluble candidate substrates of MT6-MMP were identified by peptides found in ≥2 spectra in one experiment from HMEC conditioned medium following cell treatment with sMT6ΔF (114 label) or sMT6EΔA  (115 label). §indicates peptide identification in HFL1 experiment,  *indicates peptide identification in HFL2 experiment. N-termini Protein Ratio 114/115 Peptide No. of Spectra Natural Cytochrome c oxidase subunit 5A 2.63 42 SHGSQETDEEFDAR§ 2  CXCL1 21.58 35 ASVATELR* 6 Neo Beta-actin-like protein 2 0.53 246 GQVITIGNER 5  Follistatin-related protein 1 2.23 243 GAETEVDCNR* 2  Progranulin 1.62 205 SVMCPDAR* 1+M   0.53 360 GWACCPYR§ 1+M  MT6-MMP 38.59 255 YQGPVGDPDKYR* 3  Nucleosome assembly protein 1-like 1 0.53 58 GLVETPTGYIESLPR 2  WW domain-binding protein 11 0.51 588 ENKGATAAPQR* 1  123 Table 4.9 Highest confident candidate substrates from HMEC membrane fractions Candidate substrates of MT6-MMP were identified by the same peptide in biological replicates from HMEC membrane fractions following cell treatment with sMT6ΔF (116 label) or sMT6EΔA (117 label). §indicates additional peptide identification in HFL1 experiment,  *indicates additional peptide identification in HFL2 experiment. N-termini Protein Ratio 116/117 Peptide Natural 40S ribosomal protein S16 1.26 2 PSKGPLQSVQVFGR  40S ribosomal protein S19 1.39 2 PGVTVKDVNQQEFVR  40S ribosomal protein S29 0.79 2 GHQQLYWSHPR  Actin-binding protein anillin 0.68 1 MDPFTEKLLER  Annexin IV 1.26 2 AMATKGGTVKAASGFNAMEDAQTLR  ATP synthase subunit b 1.38 43 PVPPLPEYGGKVR  Cytochrome c oxidase subunit 6C 0.78 2 APEVLPKPR  ERGIC-53 1.31 31 DGVGGDPAVALPHR  FAM50A 0.79 2 AQYKGAASEAGR  Galectin-1 0.74 2 ACGLVASNLNLKPGECLR  Glutathione S-transferase P 1.40 1 MPPYTVVYFPVR  GPI transamidase component PIG-S 0.77 2 AAAGAAATHLEVAR  Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-5 1.37 2 SGSSSVAAMKKVVQQLR  Heterogeneous nuclear ribonucleoproteins A2/B1 0.62 1 MEKTLETVPLER  Histone-binding protein RBBP4 0.75 2 ADKEAAFDDAVEER  Mesencephalic astrocyte-derived neurotrophic factor 0.65 22 LRPGDCEVCISYLGR  Nicotinamide N-methyltransferase 1.25 1 MESGFTSKDTYLSHFNPR  Non-POU domain-containing octamer-binding protein 1.28 1 MQSNKTFNLEKQNHTPR  PHD finger-like domain-containing protein 5A 0.75 2 AKHHPDLIFCR  Phosphoribosylformylglycinamidine synthase 1.27 2 SPVLHFYVR  Plasminogen activator inhibitor 1 RNA-binding protein 1.44 2 PGHLQEGFGCVVTNR  Poly [ADP-ribose] polymerase 1 0.62 2 AESSDKLYR  Probable ribosome biogenesis protein NEP1 0.67 2 AAPSDGFKPR  Protein-L-isoaspartate(D-aspartate) O- methyltransferase 0.68 2 AWKSGGASHSELIHNLR  124 N-termini Protein Ratio 116/117 Peptide  Protein-tyrosine phosphatase-like member B 1.43 2 AAVAATAAAKGNGGGGGR  Ras suppressor protein 1 1.34 2 SKSLKKLVEESR  RuvB-like 2 0.76 2 ATVTATTKVPEIR  Serine/threonine-protein kinase PAK 2 1.51 2 SDNGELEDKPPAPPVR  Signal peptidase complex catalytic subunit SEC11A 0.76 1 MLSLDFLDDVR  Similar to small nuclear ribonucleoprotein polypeptide A' SNRPA1 2.52 2 VKLTAELIEQAAQYTNAVR  Sulfate transporter 1.76 2 SSESKEQHNVSPR Neo Acyl-CoA dehydrogenase; mitochondrial precursor 1.26 87 AGGAAQLALDKSDSHPSDALTR  Acyl-coenzyme A thioesterase 2; mitochondrial precursor 0.73 64 AATLILEPAGR  A-kinase anchor protein 12 isoform 2 0.71 320 EVHVSTVEER  Integrin beta-1 precursor 1.43 65 DDLEALKKKGCPPDDIENPR  CXCL12 chemokine (C-X-C motif) ligand 12 gamma 1.46 22 KPVSLSYR  Cytochrome b-c1 complex subunit Rieske 0.80 79 SHTDIKVPDFSEYR  FKBP1A Peptidyl-prolyl cis-trans isomerase 0.70 39 GVQVETISPGDGR  Heterogeneous nuclear ribonucleoprotein R 1.50 428 STAYEDYYYHPPPR  Isoleucyl-tRNA synthetase; mitochondrial precursor 0.49 45 VSGASNHQPNSNSGR  Kinectin 0.77 238 DNADSSPVVDKR  Mitochondrial of Fumarate hydratase 1.52 45 ASQNSFR  Neuroblast differentiation-associated protein AHNAK 1.49 578 VAAPKVKGGVDVTLPR  Polypyrimidine tract-binding protein 1 1.25 173 AGMAMAGQSPVLR  Sialomucin core protein 24 0.75 55 TPAPETCEGR  Spectrin alpha chain 0.80 1206 SQLLGSAHEVQR  Splicing factor; arginine/serine-rich 7 0.70 107 YECGEKGHYAYDCHR  Vimentin 0.74 54 ASSPGGVYATR   0.71 38 YSLGSALRPSTSR§   0.72 54 ASSPGGVYATR§   0.77 332 ALKGTNESLER§  125 Table 4.10 Candidate substrates from HMEC membrane fraction Candidate substrates of MT6-MMP were identified by ≥2 peptides in one experiment from HMEC membrane fraction following cell treatment with sMT6ΔF (116 label) or sMT6EΔA  (117 label). §indicates peptide identification in HFL1 experiment,  *indicates peptide identification in HFL2 experiment. N-termini Protein Ratio 116/117 Peptide No. of spectra Natural ATP synthase subunit b 1.40 43 PVPPLPEYGGKVR§ 2  Heterogeneous nuclear ribonucleoprotein A1 0.77 2 SKSESPKEPEQLR§ 3  Histone H1.0 1.36 1 MTENSTSAPAAKPKR* 2  NADH dehydrogenase [ubiquinone] iron-sulfur protein 3 1.32 37 ESAGADTRPTVR§ 2 Neo 14-3-3 protein beta/alpha 1.32 3 MDKSELVQKAKLAEQAER§ 2  acyl-CoA dehydrogenase 1.43 87 AGGAAQLALDKSDSHPSDALTR* 2  A-kinase anchor protein 12 isoform 2 0.72 320 EVHVSTVEER§ 2  ATP synthase subunit beta; mitochondrial precursor 0.77 47 AAQTSPSPKAGAATGR§ 4  ATPase inhibitory factor 1 isoform 3 precursor 0.64 26 GSDQSENVDR* 2  Citrate synthase; mitochondrial precursor 1.32 26 ASASSTNLKDILADLIPKEQAR§ 2  Fumarate hydratase; mitochondrial precursor 1.37 45 ASQNSFR* 2  Histone H3.2 0.53 74 EIAQDFKTDLR§ 1   0.71 55 YQKSTELLIR§ 1  Peptidyl-prolyl cis-trans isomerase FKBP9 0.73 30 LGSDAELQIER§ 2  Protein disulfide-isomerase A4 0.77 24 AEGPDEDSSNR§ 2  Serine protease HTRA1 0.69 30 SAPLAAGCPDR§ 3   126 Interestingly, the cellular distributions of the proteins identified within the conditioned medium versus membrane-enriched fraction were similar (Fig 4.5). In particular, of the candidate substrates identified in the conditioned medium, 14% are considered extracellular (Fig 4.5C) whereas 11% were extracellular when the entire proteome was considered (Fig 4.5A). This is in contrast to an evaluation of MMP-2 substrates (216), wherein the extracellular proteins represented 50% of identified proteins. The lack of a significant increase of extracellular proteins in the conditioned medium may be due to the shedding of membrane-associated proteins from the cell surface in the presence of MT6-MMP. Further, the incomplete annotation of proteins in the databases is reflected here. For example, while vimentin is most abundant within the cell and is annotated as intracellular, it can also be expressed on the cell surface (329). The membrane fraction showed a slight increase in membrane-annotated proteins, from 19% in the identified proteome to 22% representing the candidate substrates identified from the membrane fractions (Fig 4.5D).  Candidate Substrates of MT6-MMP: We predicted that, aside from the biological consequences due to altered protein synthesis (which can also provide functional information), the effect of MT6-MMP proteolysis would be observed by a change of both natural and neo-N-termini, evaluated as the ratio of peptides observed from cells treated with active compared with inactive protease (sMT6ΔF/sMT6EΔA). We developed a model to comprehend how a change in natural or neo-N-terminus peptides in either the conditioned medium or membrane fraction could result from proteolytic activity on the associated protein (Fig 4.6). In general, MT6-MMP substrates would have increased ratios in the conditioned medium and decreased ratio on the membrane due to shedding, though increased neo-N-termini on the membrane would also represent an MT6-MMP substrate.  Other changes to natural or neo-N- termini in the medium and membrane fraction would represent indirect proteolysis or degradation. Aside from the biological effects due to altered cell synthesis or protein expression, a reduced iTRAQ ratio could represent addition cleavages within a semi- tryptic peptide so that this alternative peptide is undetected by mass spectrometry due to reduced ionization, or is unidentified by bioinformatic analysis.    127                       Figure 4.5 Distribution of subcellular and extracellular proteins identified by iTRAQ- labeled peptides. (A) in conditioned medium and membrane fractions by iTRAQ-labeled tryptic peptides (B) in conditioned medium and membrane fractions having a ratio ≥ 1 standard deviation from the mean (C) in conditioned medium having a ratio ≥ 1 standard deviation from the mean (D) in conditioned medium having a ratio ≥ 1 standard deviation from the mean.  128            Figure 4.6 Schematic to describe changes in iTRAQ ratios. Comparison of the untreated cell (left) and protease treated cell (right, black scissors) in conditioned media and membrane fractions showing the effects on (A) natural N- termini (Blue N) and (B) neo-N-termini (Red N).  129  130 The majority of candidate substrates identified in the conditioned medium by the natural N-termini have increased iTRAQ ratios (Table 4.3, 4.4, 4.7, 4.8). Amongst these, galectin-1 and endoplasmin are confirmed MMP substrates (Table 4.8) (216,318,358) while several others, including ribosomal proteins (Table 4.3, 4.7) are currently under investigation (Overall lab, unpublished results). Interestingly, CXCL1 was identified at significantly elevated levels (Table 4.8), though when evaluated in vitro cleavage was not observed (Chapter 2) suggesting increased expression of the protein in response to MT6-MMP activity affecting signaling.  A limited number of proteins were identified with increased neo-N-termini in the conditioned medium. These include vimentin (Table 4.7), previously confirmed to be an MT6-MMP substrate (Chapter 2), MT6-MMP (Table 4.8), indicating autoproteolysis of the exogenous sMT6ΔF protein, and the two novel substrates follistatin-related protein 1 and progranulin (Table 4.8). Notably, decreased ratios of different peptides for vimentin and progranulin were observed. In the case of vimentin, this could represent cell-associated regions of the protein that remain cell-attached, as was observed upon peptide mapping of MMP-2 substrates (216). For progranulin, this may represent different processing of the precursor protein that is required for the production of active granulin proteins (359).  The majority of unique proteins were identified within membrane fractions (Tables 4.5, 4.6, 4.9, 4.10). A number of natural N-terminal peptides that were decreased correspond to intracellular components including ribosomal proteins (Table 4.5, 4.9), heterogeneous nuclear ribonucleoproteins (Tables 4.9, 4.10), and ERGIC-53 (Table 4.9). Galectin 1, noted above as increased in the conditioned medium (Table 4.7), was reduced in the corresponding membrane fraction (Table 4.9), confirming the shedding from the cell surface. Further cleavage at the membrane is indicated by the increase in neo-N-termini in the conditioned medium of CD59, peptidyl-prolyl cis-trans isomerase, annexin VI, prosaposin, and integrin β1 precursor (Tables 4.5, 4.6, 4.9). CXCL12, a confirmed MT6-MMP substrate (Chapter 3), was identified with increased neo-N- termini iTRAQ ratios in a membrane fraction (Table 4.9). Peptides identified in membrane fractions with a decreased neo-N-termini ratio included progranulin, fibrillin-   131                           Figure 4.7 IceLogo analysis of TAILS data. The cleavage site specificity of  MT6-MMP was analyzed by iceLogo  using TAILS data of (A) all annotated peptides (B) peptides with iTRAQ ratios >1 standard deviation. (C) IceLogo of MT6-MMP evaluated by PICS analysis.  132 1 precursor, kinectin and peptidyl-prolyl cis-trans isomerase (Tables 4.5, 4.6, 4.9, 4.10), indicates further processing of these proteins.  Cleavage site specificity of MT6-MMP: Using the peptides identified by TAILS analysis, the preferred consensus sequence for MT6-MMP was evaluated with iceLogo. From the 593 neo-N-terminus peptides identified, only 300 peptides were unique and lacked an Arg at position P1; the resulting iceLogo is shown in Figure 4.7A. Narrowing the peptide list to peptides with ratios ≥ 1 standard deviation, 103 peptides remained (Fig 4.7B). The narrowing of criteria did not significantly affect the iceLogo obtained for MT6-MMP. For comparison purposes, the iceLogo from PICS analysis (Chapter 3), where MT6-MMP cleavage of a peptide library is used to define cleavage specificity (322), is shown in Fig 4.7C.  The current method identified Cys at P1 whereas this was absent from the PICS analysis; the modification of cysteine residues prior to the addition of protease in PICS analysis could interfere with the protease-peptide interaction and thus go unidentified (322). Similarly, the Arg at P2 from the TAILS data is lacking in the peptide-based logo since the peptide library was prepared with trypsin. This may be overcome by preparing the library with a protease that cleaves after other residues, such as GluC. Both methods identified Asp in the P1 position, and a preference for hydrophobic residues on the prime side.  A Pro is characteristically found at P3 according to PICS analysis of MMPs (Schilling et al, 2010) but surprisingly this is lacking in the proteome-based analysis of MT6- MMP. Additionally, the Gly and Ser residues on the prime side of the cleavage site are not characteristic of MMPs. An under-representation of Pro at P1 and P1’ observed from the TAILS data may explain the low collagenolytic activity that we previously observed for MT6-MMP (Chapter 3). Since MMPs are proteases with a broad specificity and diverse substrate repertoires, these results highlight complementary approaches for evaluating MMP cleavage preferences.   133 Discussion Proteomics represents an unbiased approach to substrate discovery. As such, a number of qualitative techniques have been developed, and quantitative labels applied in the identification of degradomes (312,355-357). TAILS enrichment of N-termini represents a high-throughput approach that enables both substrate and cleavage site identification (318). The use of iTRAQ labels enables multiplex experimentation with quantitative results (216). To determine roles for MT6-MMP through substrate identification, iTRAQ-TAILS (319,321) was applied to conditioned medium and membrane fractions from protease-treated cells. By comparing active (sMT6ΔF) with inactive (sMT6EΔA) protease-treated fractions, the effects due to MT6-MMP catalytic activity could be inferred. Furthermore, the use of two different cell lines, namely HFL- 1 and HMEC, expanded the experimental proteome to more closely represent the proteome that is encountered in vivo by inflammation-recruited neutrophils wherein MT6-MMP would be released from secretory vesicles and tertiary granules during transendothelial migration, and function interstitially on the membrane surface.  The iTRAQ-TAILS methodology is straightforward, though data analysis is complex. iTRAQ-TAILS was validated during evaluation of MMP-2 and MMP-9 proteolysis of isolated secretomes (319,321). Therein, a statistical method was applied to determine a critical iTRAQ ratio cutoff, separating potential from highly confident substrates (321). While an important advancement to iTRAQ-TAILS analysis, this system could not be accurately applied to the data presented herein. Here, the protease was added to cells, rather than an isolated secretome, and since few MT6-MMP substrates have been identified, the statistical method could not be validated for this dynamic system. Hierarchical substrate winnowing is an alternative approach, in which ratio cutoffs are based upon those obtained for known substrates (216,313,318). Again, this could not be applied here. Hence, due to the limited information on MT6-MMP a hybrid approach was applied. Specifically, only peptides with ratios >1 standard deviation from the normalized mean contributed to the identification of candidate substrates, which were identified by two or more spectra (either biological replicates or from one experiment).  Among the 218 candidate substrates identified from 377 unique peptides, were proteins that we previously confirmed as MT6-MMP substrates (vimentin, CXCL12  134 (Table 4.9) [Chapter 3]), that are family members of MT6-MMP substrates (IGFBPs, galectins (Table 4.7) (Chapter 3), and are substrates of other MMPs (annexins (Table 3.9) (319,358,360)). Notably, CXCL5 was previously confirmed to be an MT6-MMP substrate (Chapter 3), but did not fulfill the requirements to be considered a candidate substrate in this TAILS analysis since the identification was made only by one spectra, indicating the stringency of our analyses (IPI00292936, Appendix B.9). Candidate substrates identified in these analyses include proteins involved in activation of the inflammatory response, chemotaxis, cell and matrix adhesion.  Activation of the inflammatory response involves vascular changes and activation of the complement system. ERGIC-53 protein, identified by an increased ratio for the natural N-terminus peptide in HMEC membrane fractions (Table 4.9), has a critical function in coagulation (361). Mutations in the ERGIC-53 gene cause factor IV and factor VIII deficiency (361) as it plays a direct role in export of these coagulation factors (362).CD59 (Table 4.5) is an inhibitor of complement activation. An increased ratio for the neo-N-termini peptide commencing at residue 65Trp in HMEC membrane fractions suggests that the inhibitory activity found within residues 44-55 (363-365) would be lost. This implicates a role for MT6-MMP in promoting neutrophil activation of the complement system.  We previously identified a number of chemokines as MT6-MMP substrates (Chapter 3). Two chemokines, namely CXCL1 and CXCL12, were identified from HMEC cells (Table 4.8, 4.10). Notably, both chemokines were identified by their natural N-termini. While CXCL1 is not a substrate of MT6-MMP, CXCL12 processing by MT6-MMP was confirmed in vitro (Chapter 3). The increase of CXCL12 on the membrane of HMEC cells indicates that the chemokine is binding to the cell through its unusually high affinity for glycosaminoglycans (GAGs) (130). MT6-MMP cleavage of CXCL12 occurs between 4Ser-Leu5 (Chapter 3) and so the resulting semi-tryptic neo-N-terminus peptide would be only four residues long, which is too small for detection and accurate identification by MS, possibly explaining the lack of identification of CXCL12 in conditioned medium. Alternately, both CXCL12 and CXCL1 might be upregulated in response to MT6-MMP. The identification of chemokines, generally present in  135 nanomolar concentrations, is a further indication of the sensitivity and dynamic range of the TAILS method.  Vimentin, identified in this study by one peptide in conditioned medium and several peptides in membrane fractions, was previously shown to have chemotactic activity for THP-1 cells. Moreover, we showed a loss of this chemotactic activity following MMP processing (Chapter 3). Similar to vimentin, the candidate substrate family of peptidyl- prolyl cis-trans isomerases is classically defined as intracellular, yet is known to be secreted and act as a chemoattractant during the inflammatory response (366). Several prolyl cis-trans isomerases have been identified in proteomics screens for MMP substrates and prolyl cis-trans isomerase A was validated as a substrate of MT1- MMP, MMP-2 and MMP-9, strengthening our finding that they are MT6-MMP substrates (313,318,319).  In addition to those mentioned above, several other intracellular proteins were identified in this TAILS study. Prosaposin (Table 4.6), ribosomal proteins (e.g. 60S ribosomal protein L11) (Tables 4.3, 4.5, 4.7, 4.9), and heterogeneous nuclear ribonucleoproteins (HNRPs) (Tables 4.7, 4.9, 4.10) were identified by multiple peptides. Though cell lysis, and thus sample contamination seems an obvious explanation for the identification of the proteins, this does not explain the significant change in the iTRAQ ratio between sMT6ΔF and sMT6EΔA-treated cells, and cell morphology did not appear different between conditions (results not shown). Further, only specific peptides were identified from a subset of intracellular proteins. Rather, two other hypotheses have recently developed, which may explain these results (34,117,355,357,367).  As recognized for vimentin and prolyl cis-trans isomerases, it was recently proposed that a number of “intracellular” proteins actually have a functional role in the extracellular environment as “moonlighting” proteins (117,357,367). Cauwe proposed that intracellular proteins reach the extracellular environment due to lysis, and are proteolyzed to inhibit autoantigen production (117). In contrast, Butler has suggested that intracellular proteins are actively secreted from the intracellular environment  136 through non-classical mechanisms, and have yet to be discovered functionality in the extracellular environment (357,367).  An alternative explanation for the identification of these intracellular proteins is in conflict to the long-held belief that MMPs function only in the extracellular environment. MMP-2, MMP-3, and MT1-MMP were shown to be in the nucleus (368-370), where MMP-3 is proposed to regulate transcription of connective tissue growth factor and MT1-MMP reportedly degrades pericentrin and causes chromosomal instability (371,372). MMP-2 processing of troponin I, α-actinin and myosin light chain 1 at the sarcomere attenuates contraction of cardiomyocytes (373). MT6-MMP, though present on the plasma membrane, is primarily contained within neutrophil granules (72). Further, the MT6-MMP that is localized in the lipid rafts of the plasma membrane reportedly faces into the cell, rather than outward, and inverts to the extracellular space following neutrophil activation wherein it can be released from the cells (101). Together, these studies suggest that MT6-MMP may play a homeostatic role within the cell, but is released during inflammation wherein it processes inflammatory mediators.  Growth promoting factors are an additional group of candidate substrates for MT6- MMP. The neo-N-terminus peptide 205SVMCPDAR of progranulin was identified with a decreased ratio on the membrane and increased ratio in conditioned medium (though from different experiments), suggesting shedding (Table 4.5, 4.9). Progranulin, a substrate of MT1-MMP (313), is a protein that is proteolytically processed into 8 different peptides shown to modify cell growth (359).  The natural N-terminus of granulin-3 is at Val205, suggesting that MT6-MMP may be shedding granulin-2 from the membrane surface. Other growth promoting proteins that were identified as candidate MT6-MMP substrates include IGFBP-5, IGFBP-6, galectin-1 and follistatin-1 (Table 4.4, 4.5, 4.7, 4.8). IGFBP-7 is a confirmed substrate of MT6-MMP and IGFBP-5 was found to be a candidate substrate in that study (Chapter 3), while other family members including IGFBP-6 are confirmed substrates of MMP-2 (116,318,319,358). Similarly, galectin-1 is a confirmed substrate of MT6-MMP and MMP-2 (Chapter 3, (116,318)). While the functional effects of MMP-processing of these growth-promoting proteins have yet to be determined, the identification and validation of their processing provides further evidence that these are MT6-MMP substrates.  137  Further evaluation of the candidate substrates for MT6-MMP indicates a number of matrix and cell adhesion molecules. Neo-N-termini peptides were altered for the proteins fibrillin, fibulin, integrin β1 and kinectin. Notably lacking from this list are collagen proteins, which were identified by MT6-MMP secretome analysis (Chapter 3). A cell-based proteomics study with MMP-2, which also identified the candidate substrates galectin-1, prosaposin and IGFBP-7, identified nine different collagen isoforms (116). Using the candidate substrate cleavage sites, iceLogo analysis of MT6-MMP shows a lack of Pro and Gly at P3 and P1, respectively. These are residues observed at high levels in collagen and which were observed by iceLogo analysis of MMP-2 TAILS data (321). Together, these results support our previous finding that, unlike MMP-2, MT6-MMP is not collagenolytic. Further, these results highlight the importance of unbiased substrate identification for MMPs.  Applying iTRAQ-TAILS to a cell-based approach, we have identified 218 candidate substrates for MT6-MMP. Experimentation in a dynamic system where shedding of membrane-associated proteins can be analyzed in both the membrane and the conditioned medium, provides greater insight into the biological function of a protease, and is a progression of the iTRAQ-TAILS technique previously applied to an isolated secretome. Amongst the candidate substrates of MT6-MMP are proteins involved in complement activation, cell migration and growth promotion. We provide here not only a starting point for future studies on the role of MT6-MMP, but an approach to future protease degradome analysis, moving beyond the secretome to identify authentically presented MMP substrates.  138 CHAPTER 5: CONCLUSIONS AND PERSPECTIVES MMP regulation of multiple stages of inflammation  The most significant findings of this research are identifying substrates of MT6-MMP that contribute to inflammation through to wound healing by defining a role for the enzyme in a positive feed-back of neutrophil chemoattraction, positive feed-forward of monocyte chemoattraction, and in the progression of the inflammatory response (Chapter 3, 4). Furthermore, identifying that MMPs are responsible for the activating truncation of the monocyte chemoattractants CCL15 and CCL23, and characterizing the first proteolysis of CCL16, which translates functionally to a novel enhanced glycosaminoglycan binding, are important aspects in understanding acute and chronic inflammation (Chapter 2, 3).  The intent of this research was to focus on the roles and interactions of MMPs and chemokines in modification of neutrophil and mononuclear phagocyte recruitment, though the effects of the MMP-modified chemokines identified are likely to go beyond what is explored herein. For example, CCL15 promotes chemotaxis not only of monocytes but also lymphocytes (228), indicating a role in adaptive immunity. In addition, while CCL11 can attract monocytes, it is predominantly involved in eosinophil chemoattraction (374). Therefore, the family-wide approach to evaluating the MMP- processing of monocyte chemoattractants (Chapter 2) has not only given insight into the innate immune response, but also provides a starting point for the evaluation of the functional effects in other systems. Further, in combination with previous results that have evaluated the effects of other truncation variants, this study provides a global perspective and thus insight into the many potential roles of MMP regulation of chemokine function.  Combining our knowledge about cellular sources of MMPs and chemokines, and now knowing which MMPs may be responsible for chemokine cleavage in vivo, I propose a temporal model (Fig 5.1) of positive feed-back and feed-forward mechanisms that promote both neutrophil and monocyte recruitment, and inhibition of recruitment following injury. Potentiating these chemokine-specific effects would be the functional  139      Figure 5.1 Model of MMP cleavage of inflammatory proteins MT6-MMP from neutrophils contributes to complement activation through cleavage of CD59, and propagates neutrophil recruitment through activation of CXCL5. MMPs, including MT6-MMP, activate CCL15 and CCL23 which recruit monocytes. 1) MMP-9 produced by resident macrophages and fibroblasts process and activate locally produced CXCL8 for early recruitment of neutrophils (89), 2) in a positive feed- back mechanism, neutrophils release more chemokine, which is then activated by neutrophil-specific MT6-MMP and MMP-8 (Chapter 2, (89)), 3) MMP-cleavage of CCL16 enhances GAG-binding to promote haptotaxis of CCR1 expressing cells, 4) recruited and resident cells activate CCL15 and CCL23 through MMP-processing to promote inflammatory monocyte recruitment (Chapter 2, Chapter 3) 5) inflammatory macrophages produce MMP-12, which then inactivates neutrophil chemoattractants (87) as does MT6-MMP (Chapter 3),  6) monocyte recruitment is reduced through MMP inactivation of monocyte chemoattractants (Chapter 2, (87)). MMP-independent mechanisms are required for inactivation of CCL15 and CCL23.  140  141   effects of MT6-MMP processing of candidate substrates. For example, MT6-MMP processing of CD59 (Chapter 4) could promote complement activation to enhance inflammation. As debris and complement fixed antigens are removed, wound healing begins in part through MT6-MMP cleavage and inactivation of IGFBP-5, -6, and -7 (Chapter 3 and 4) to release growth-promoting IGF. Additionally, apoptotic neutrophils produce short and tight gradients by alternative chemoattractants including vimentin (Chapter 2) as “eat-me” signals to macrophages. The phagocytosis of apoptotic neutrophils by macrophages leads to a change in the inflammatory cytokine profile, increasing TGF-β production, reducing TNF-α and IL-1β cytokines which is an important step in the transition to resolution of the inflammatory response (272).  The identification of CCL15 (25-92) in expression systems (Forssman et al., 2002) and in disease tissue (Berahovich et al., 2005, Haringman et al., 2006) prompted several groups to evaluate potential proteases involved. Despite these efforts the responsible proteases were not identified, until now. Using a systematic approach I have shown that in fact nearly all MMPs are capable of processing CCL15 to this potent truncation variant. In addition, all MMPs activate CCL23 and process CCL16 into a chemokine with stronger haptotactic potential. However, this result raises the question as to which are the relevant enzymes in vivo. Using Mmp8-/- mice in an air pouch model of cellular recruitment towards murine CXCL5/LIX, we showed the in vivo lack of redundancy in chemokine processing that was observed in vitro (89). Based upon kinetic data alone MMP-12 appears to be the most likely candidate for CCL15 activation (Chapter 2). Yet, when considering the temporal events, MMP-12 processing of CCL15 and CCL23 is less likely to be important initially since it is produced by macrophages, which are significantly outnumbered by neutrophils in the first 24 hours following initiation of inflammation. Thus despite the better kinetic properties of MMP-12, neutrophil produced MT6-MMP may be involved in early activation of these monocyte chemoattractants (Chapter 3). It is likely that MMP-12 activation of these monocyte chemoattractants would potentiate the response and could lead to chronic inflammation, as proposed in Chapter 2.   142 Previous work by several groups has identified proteolytic mechanisms that result in antagonists or loss of agonist receptor activity for both neutrophil and monocyte chemokines (Table 1.1) (reviewed in (155)). While we have shown a role for MMP activation of CCL15 and CCL23, we have not identified an inactivating truncation for these chemokines by MMPs (Chapter 2), indicating the involvement of a different protease family or different mechanism for down-regulation. The serine proteases neutrophil elastase, cathepsin G and chymase also result in activating truncations (122) though other serine or cysteine proteases should be evaluated. Alternatively, degradation rather than specific proteolysis resulting in inactivation of the chemokines may occur as it does for several CXC chemokines by elastase (Cox, unpublished data). Reduced production of CCL15 and CCL23 is also a strong possibility, as is decoy receptor binding (143,375).  While it is recognized that mononuclear phagocytes are the primary source of these chemokines, recent research has highlighted that not all monocytes and macrophages are created equally (12,14). Patrolling and inflammatory monocytes express different receptors, and have different capacities for proinflammatory mediator production and phagocytosis (14). Similarly, M1-type and M2-type macrophages differentiate under different conditions, have different functions, and specific chemokine receptor expression and ligand production (19). Perhaps CCL15 and CCL23 are not inactivated, but rather produced only by transient patrolling monocytes - providing an initial burst of a strong chemoattractant before the cells differentiate or migrate out of the tissue. Due to the limited studies on this cell type, this is a hypothesis requiring further investigation.  Along with specific cell-type expression of chemokines, there appears a lack of knowledge in temporal production of chemokines. While elevated levels of chemokines in disease tissue provides prognostic evidence that the chemokine is promoting cellular recruitment (376), the temporal pattern and functionality are often overlooked. The elevated levels of CCL7 and CCL15 detected in arthritic synovial fluid by antibodies indicates that these proteins are mediators of the disease (377) yet the presence of active MMPs, as observed by synovial fluid processing of CCL15 (Chapter 2) suggests that the chemokines may be present in truncated forms, which have  143 significantly different functions than the full-length counterparts. In fact, using antibodies directed towards the N- and C-termini, Berahovich identified N-terminally truncated forms of CCL15 in arthritic synovial fluid, though the truncation site could not be identified (122). With knowledge of the truncation site for the chemokine, neo- epitope polyclonal antibodies that recognized the new N-terminus of CCL7 successfully identified truncated CCL7 in synovial fluid (114). The antibody did not recognize the full-length form but was specific to the truncated CCL7; conversely an antibody toward the original CCL7 N-terminus did not identify the truncated chemokine. The use of neo-epitope antibodies has also been successfully applied to the identification of truncated CXCL12 in brain tissue of HIV-infected individuals (182).  Similar to the directed approach with neo-epitope antibodies, a mass spectrometry method could not only identify but also quantify full-length and truncated chemokine in tissue. Selected reaction monitoring (SRM) is a tandem mass spectrometry based method for quantifying specific peptides within a known m/z window (378). Internal standards synthesized and isotopically labeled that correspond to the semi-tryptic peptide of the original N- or C-terminus and the neo-terminus added to a complex sample can be used to identify a particular chemokine and truncation variant. By multiplexing the reaction (multiple reaction monitoring), several chemokines and truncation forms could be evaluated in one experiment to provide evidence of not only the presence but also the functionality of the proteins. This method could be applied to other substrate families of the MMPs. Application of this, or similar proteomics methods for the identification of chemokine functional states in biological samples is a much needed step in identifying therapeutic targets in disease.  The potential role of MMP-12 in contributing to the transition from an acute to a chronic inflammatory response through activation of CCL15 and CCL23 implicates MMP-12 as a potential therapeutic target. While in the past many clinical trials of MMP inhibitors failed as a result of negative side effects, this was due in part to the broad specificity of the inhibitors and thus inhibition of anti-targets – MMPs with beneficial activity (286). A recently developed selective inhibitor of MMP-12 has shown promising results in a murine lung inflammation model and is being evaluated for the treatment of chronic obstructive pulmonary disease (379). Several other selective inhibitors of MMP-12 are  144 also under development for the treatment of rheumatoid arthritis, cancer, and lung diseases including asthma and emphysema (380,381).  Based on the MT6-MMP proteomics data presented in Chapters 3 and 4, and in combination with previous studies (216,319,358,360) there are a number of protein families, aside from chemokines, that are likely to be regulated by MMPs with specificity occurring at the individual protein level. IGFBP-7 was confirmed and IGFBP- 5 and 6 both identified as candidate substrates of MT6-MMP, whereas IGFBP-1, 2, 3, 4, and 6 are confirmed substrates of other MMPs (331,332,334,336,337). IGFBPs inhibit the growth promoting activity of IGF by binding circulating IGF, and thus preventing the interaction between IGF and its cognate receptor. IGFs are upregulated locally for wound healing, but over-activity is associated with disease progression, specifically cancer. Thus, while the processing of IGFBPs by MT6-MMP and other MMPs is likely an important mechanism to initiate wound healing during an acute inflammatory response, the over-expression of MMPs may precede the enhanced IGF activity.  Similarly, Galectin-1 was confirmed to be an MT6-MMP substrate and, along with galectin-3, was previously shown to be a substrate of MMPs (216,313,382,383). As with IGF, galectin-1 contributes to cancer growth, but does so by promoting vascular growth (384) and by inhibiting T cell function and tumor avoidance of immune attack (385). Further, galectin-1 has anti-inflammatory activity through the inhibition of leukocyte migration (386-388). Therefore, in the acute inflammatory response, MT6- MMP may contribute to leukocyte recruitment through the cleavage and decreasing the inhibitory activity of galectin-1.  Vimentin was identified by all TAILS analysis (Chapter 2 and 3) to be a substrate of MT6-MMP. While often overlooked in proteomics screens due to the high abundance of the protein and assumption that it is a byproduct of cell lysis, studies have shown that it is preferentially released to the surface of apoptotic neutrophils (328) and secreted by activated macrophages (329)  – implicating a function in innate immunity. Surprisingly, Vim-/- mice did not show significant phenotypes in response to acute inflammatory stimuli including an LPS air pouch model (389). However, Vim-/- mice do  145 have impaired wound healing (390). The phagocytosis of neutrophils by macrophages is a critical step in the progression of the inflammatory response. Together these results combined with the finding in Chapter 3 that vimentin has chemotactic properties for THP-1 monocytic cells suggests that as a surface expressed molecule, vimentin contributes to the progression of inflammation. Further investigation in a complex biological system could elucidate the functional effects of MMP-processing of vimentin, and the contribution of both these proteins in wound healing.  The identification of an extracellular function for vimentin supports recent proposals of “moonlighting” proteins. In addition to vimentin, a number of proteins that are annotated as intracellular proteins met the criteria to be considered MMP substrates in the proteomics studies presented in this thesis, as well as in other MMP proteomics studies. Upon further evaluation, several of these were processed by MMPs in vitro. The proposal that the role of MMPs is to degrade these “intracellular” proteins to prevent autoantigenicity (117,355) is reminiscent of the constrained definition of MMPs as degraders of the extracellular matrix. While MMPs can degrade some proteins, more often they function in specific processing of bioactive molecules to alter the functional role. Similarly, while some “intracellular” proteins may be degraded by MMPs, these proteins may have extracellular functions that are altered by specific processing to contribute to either homeostasis or disease. Proteomics analyses are a means to identify protease substrates in an unbiased manner, therefore candidate substrates should be impartially evaluated, starting with in vitro analysis, through cells and ultimately to complex biological systems.  Murine models of inflammation are an excellent system to evaluate functional effects of proteases (24). While an MT6-MMP knockout mouse has not yet been developed, the phenotypic responses of the mice would provide clues on the role of this protease. Given the common cell specificity of the two enzymes I predict that the phenotype of Mt6-/- mice would have some similarity to Mmp8-/- mice, including an altered neutrophil infiltration and accumulation in a disease specific-manner (39,89,391). Yet, the divergent granule and membrane localization within the neutrophil, and thus temporal release of the enzymes, combined with different substrate profiles in vitro (including collagen and chemokines) indicates that the function of the enzymes does  146 not completely overlap. Given the substrates identified in Chapter 3 and 4, I predict that Mt6-/- mice would have a prolonged inflammatory response with delays in wound healing in response to acute stimuli. In contrast to the proposed function of MMP-12 as a mediator of chronic inflammation and thus a therapeutic target outlined above, MT6- MMP may be an anti-target in inflammatory disease.  In conclusion, the research presented in this thesis highlights the roles of MMPs in inflammation. I have built upon the information obtained in earlier work to provide evidence that MMPs both activate and inactivate the recruitment of neutrophils and monocytes. Through MT6-MMP, I have shown that this can occur not only through processing of chemokines, but also of vimentin, an intracellular protein with an extracelluar function. Moreover, I have more than doubled the number of substrates for the neutrophil-specific enzyme MT6-MMP, providing evidence for a role of this protease not only in cell migration but also in progressing the inflammatory response. This thesis provides a starting point for the evaluation of novel MMP substrates, to understand the mechanisms involved in acute inflammation and to provide insight into the progression toward chronic inflammation.  147 REFERENCES 1. Lawrence, T., Willoughby, D. A., and Gilroy, D. W. (2002) Nat Rev Immunol 2(10), 787-795 2. Borregaard, N., and Cowland, J. B. (1997) Blood 89(10), 3503-3521 3. Faurschou, M., and Borregaard, N. (2003) Microbes Infect 5(14), 1317-1327 4. Feuk-Lagerstedt, E., Movitz, C., Pellme, S., Dahlgren, C., and Karlsson, A. (2007) Proteomics 7(2), 194-205 5. Lominadze, G., Powell, D. W., Luerman, G. C., Link, A. J., Ward, R. A., and McLeish, K. R. (2005) Mol Cell Proteomics 4(10), 1503-1521 6. Tomazella, G. G., da Silva, I., Laure, H. J., Rosa, J. C., Chammas, R., Wiker, H. G., de Souza, G. A., and Greene, L. J. (2009) Proteome Sci 7, 32 7. Tomazella, G. G., daSilva, I., Thome, C. H., Greene, L. J., Koehler, C. J., Thiede, B., Wiker, H. G., and de Souza, G. A. (2010) J Proteome Res 9(4), 2030-2036 8. Uriarte, S. M., Powell, D. W., Luerman, G. C., Merchant, M. L., Cummins, T. D., Jog, N. R., Ward, R. A., and McLeish, K. R. (2008) J Immunol 180(8), 5575- 5581 9. Bogdan, C. (2001) Nat Immunol 2(10), 907-916 10. Cederlund, A., Agerberth, B., and Bergman, P. (2010) J Innate Immun 11. Brinkmann, V., Reichard, U., Goosmann, C., Fauler, B., Uhlemann, Y., Weiss, D. S., Weinrauch, Y., and Zychlinsky, A. (2004) Science 303(5663), 1532-1535 12. Doulatov, S., Notta, F., Eppert, K., Nguyen, L. T., Ohashi, P. S., and Dick, J. E. (2010) Nat Immunol 11(7), 585-593 13. Geissmann, F., Gordon, S., Hume, D. A., Mowat, A. M., and Randolph, G. J. (2010) Nat Rev Immunol 10(6), 453-460 14. Geissmann, F., Manz, M. G., Jung, S., Sieweke, M. H., Merad, M., and Ley, K. (2010) Science 327(5966), 656-661 15. Soehnlein, O., and Lindbom, L. (2010) Nat Rev Immunol 10(6), 427-439 16. Soehnlein, O., Zernecke, A., Eriksson, E. E., Rothfuchs, A. G., Pham, C. T., Herwald, H., Bidzhekov, K., Rottenberg, M. E., Weber, C., and Lindbom, L. (2008) Blood 112(4), 1461-1471 17. Auffray, C., Fogg, D., Garfa, M., Elain, G., Join-Lambert, O., Kayal, S., Sarnacki, S., Cumano, A., Lauvau, G., and Geissmann, F. (2007) Science 317(5838), 666-670 18. Nahrendorf, M., Swirski, F. K., Aikawa, E., Stangenberg, L., Wurdinger, T., Figueiredo, J. L., Libby, P., Weissleder, R., and Pittet, M. J. (2007) J Exp Med 204(12), 3037-3047 19. Mantovani, A., Sica, A., Sozzani, S., Allavena, P., Vecchi, A., and Locati, M. (2004) Trends Immunol 25(12), 677-686 20. Martinez, F. O., Gordon, S., Locati, M., and Mantovani, A. (2006) J Immunol 177(10), 7303-7311 21. Verreck, F. A., de Boer, T., Langenberg, D. M., Hoeve, M. A., Kramer, M., Vaisberg, E., Kastelein, R., Kolk, A., de Waal-Malefyt, R., and Ottenhoff, T. H. (2004) Proc Natl Acad Sci U S A 101(13), 4560-4565 22. Gordon, S. (2003) Nat Rev Immunol 3(1), 23-35 23. Mosser, D. M. (2003) J Leukoc Biol 73(2), 209-212 24. Fanjul-Fernandez, M., Folgueras, A. R., Cabrera, S., and Lopez-Otin, C. (2010) Biochim Biophys Acta 1803(1), 3-19  148 25. Kessenbrock, K., Plaks, V., and Werb, Z. (2010) Cell 141(1), 52-67 26. Lagente, V., and Boichot, E. J Mol Cell Cardiol 48(3), 440-444 27. Le, N. T., Xue, M., Castelnoble, L. A., and Jackson, C. J. (2007) Front Biosci 12, 1475-1487 28. Murphy, G., and Nagase, H. (2008) Nat Clin Pract Rheumatol 4(3), 128-135 29. Gross, J., and Lapiere, C. M. (1962) Proc Natl Acad Sci U S A 48, 1014-1022 30. Bennick, A., and Hunt, A. M. (1967) Arch Oral Biol 12(1), 1-10 31. Bauer, E. A., Eisen, A. Z., and Jeffrey, J. J. (1970) Biochim Biophys Acta 206(1), 152-160 32. Overall, C. M., and Lopez-Otin, C. (2002) Nat Rev Cancer 2(9), 657-672 33. Overall, C. M., and Kleifeld, O. (2006) Nat Rev Cancer 6(3), 227-239 34. Butler, G. S., and Overall, C. M. (2009) Nat Rev Drug Discov 8(12), 935-948 35. Gill, S. E., and Parks, W. C. (2008) Int J Biochem Cell Biol 40(6-7), 1334-1347 36. Manicone, A. M., and McGuire, J. K. (2008) Semin Cell Dev Biol 19(1), 34-41 37. Parks, W. C., Wilson, C. L., and Lopez-Boado, Y. S. (2004) Nat Rev Immunol 4(8), 617-629 38. Morrison, C. J., Butler, G. S., Rodriguez, D., and Overall, C. M. (2009) Curr Opin Cell Biol 21(5), 645-653 39. Balbin, M., Fueyo, A., Tester, A. M., Pendas, A. M., Pitiot, A. S., Astudillo, A., Overall, C. M., Shapiro, S. D., and Lopez-Otin, C. (2003) Nat Genet 35(3), 252- 257 40. Gutierrez-Fernandez, A., Inada, M., Balbin, M., Fueyo, A., Pitiot, A. S., Astudillo, A., Hirose, K., Hirata, M., Shapiro, S. D., Noel, A., Werb, Z., Krane, S. M., Lopez-Otin, C., and Puente, X. S. (2007) Faseb J 21(10), 2580-2591 41. Jost, M., Folgueras, A. R., Frerart, F., Pendas, A. M., Blacher, S., Houard, X., Berndt, S., Munaut, C., Cataldo, D., Alvarez, J., Melen-Lamalle, L., Foidart, J. M., Lopez-Otin, C., and Noel, A. (2006) Cancer Res 66(10), 5234-5241 42. Nagase, H., Visse, R., and Murphy, G. (2006) Cardiovasc Res 69(3), 562-573 43. Sternlicht, M. D., and Werb, Z. (2001) Annu Rev Cell Dev Biol 17, 463-516 44. Visse, R., and Nagase, H. (2003) Circ Res 92(8), 827-839 45. Steffensen, B., Wallon, U. M., and Overall, C. M. (1995) J Biol Chem 270(19), 11555-11566 46. Springman, E. B., Angleton, E. L., Birkedal-Hansen, H., and Van Wart, H. E. (1990) Proc Natl Acad Sci U S A 87(1), 364-368 47. Van Wart, H. E., and Birkedal-Hansen, H. (1990) Proc Natl Acad Sci U S A 87(14), 5578-5582 48. Murphy, G., Stanton, H., Cowell, S., Butler, G., Knauper, V., Atkinson, S., and Gavrilovic, J. (1999) Apmis 107(1), 38-44 49. Stetler-Stevenson, W. G., Krutzsch, H. C., Wacher, M. P., Margulies, I. M., and Liotta, L. A. (1989) J Biol Chem 264(3), 1353-1356 50. Roebroek, A. J., Creemers, J. W., Ayoubi, T. A., and Van de Ven, W. J. (1994) Biochimie 76(3-4), 210-216 51. Kojima, S., Itoh, Y., Matsumoto, S., Masuho, Y., and Seiki, M. (2000) FEBS Lett 480(2-3), 142-146 52. Pei, D. (1999) Cell Res 9(4), 291-303 53. Pei, D., and Weiss, S. J. (1995) Nature 375(6528), 244-247 54. Wang, X., and Pei, D. (2001) J Biol Chem 276(38), 35953-35960 55. Yana, I., and Weiss, S. J. (2000) Mol Biol Cell 11(7), 2387-2401  149 56. Tallant, C., Marrero, A., and Gomis-Ruth, F. X. (2010) Biochim Biophys Acta 1803(1), 20-28 57. Bode, W., Fernandez-Catalan, C., Grams, F., Gomis-Ruth, F. X., Nagase, H., Tschesche, H., and Maskos, K. (1999) Ann N Y Acad Sci 878, 73-91 58. Arza, B., De Maeyer, M., Felez, J., Collen, D., and Lijnen, H. R. (2001) Eur J Biochem 268(3), 826-831 59. Crabbe, T., Zucker, S., Cockett, M. I., Willenbrock, F., Tickle, S., O'Connell, J. P., Scothern, J. M., Murphy, G., and Docherty, A. J. (1994) Biochemistry 33(21), 6684-6690 60. Overall, C. M. (2002) Mol Biotechnol 22(1), 51-86 61. Overall, C. M., McQuibban, G. A., and Clark-Lewis, I. (2002) Biol Chem 383(7- 8), 1059-1066 62. Wallon, U. M., and Overall, C. M. (1997) J Biol Chem 272(11), 7473-7481 63. Murphy, G., Allan, J. A., Willenbrock, F., Cockett, M. I., O'Connell, J. P., and Docherty, A. J. (1992) J Biol Chem 267(14), 9612-9618 64. Gioia, M., Monaco, S., Fasciglione, G. F., Coletti, A., Modesti, A., Marini, S., and Coletta, M. (2007) J Mol Biol 368(4), 1101-1113 65. Tam, E. M., Moore, T. R., Butler, G. S., and Overall, C. M. (2004) J Biol Chem 279(41), 43336-43344 66. Hirose, T., Patterson, C., Pourmotabbed, T., Mainardi, C. L., and Hasty, K. A. (1993) Proc Natl Acad Sci U S A 90(7), 2569-2573 67. Knauper, V., Cowell, S., Smith, B., Lopez-Otin, C., O'Shea, M., Morris, H., Zardi, L., and Murphy, G. (1997) J Biol Chem 272(12), 7608-7616 68. Mantuano, E., Inoue, G., Li, X., Takahashi, K., Gaultier, A., Gonias, S. L., and Campana, W. M. (2008) J Neurosci 28(45), 11571-11582 69. Yan, C., and Boyd, D. D. (2007) J Cell Physiol 211(1), 19-26 70. Nuttall, R. K., Pennington, C. J., Taplin, J., Wheal, A., Yong, V. W., Forsyth, P. A., and Edwards, D. R. (2003) Mol Cancer Res 1(5), 333-345 71. Saarialho-Kere, U. K., Crouch, E. C., and Parks, W. C. (1995) J Invest Dermatol 105(2), 190-196 72. Kang, T., Yi, J., Guo, A., Wang, X., Overall, C. M., Jiang, W., Elde, R., Borregaard, N., and Pei, D. (2001) J Biol Chem 276(24), 21960-21968 73. Brew, K., and Nagase, H. (2010) Biochim Biophys Acta 1803(1), 55-71 74. Bar-Or, A., Nuttall, R. K., Duddy, M., Alter, A., Kim, H. J., Ifergan, I., Pennington, C. J., Bourgoin, P., Edwards, D. R., and Yong, V. W. (2003) Brain 126(Pt 12), 2738-2749 75. Lazarus, G. S., Brown, R. S., Daniels, J. R., and Fullmer, H. M. (1968) Science 159(3822), 1483-1485 76. Murphy, G., Reynolds, J. J., Bretz, U., and Baggiolini, M. (1977) Biochem J 162(1), 195-197 77. Shapiro, S. D., Kobayashi, D. K., and Ley, T. J. (1993) J Biol Chem 268(32), 23824-23829 78. Liu, M., Sun, H., Wang, X., Koike, T., Mishima, H., Ikeda, K., Watanabe, T., Ochiai, N., and Fan, J. (2004) Arthritis Rheum 50(10), 3112-3117 79. Marcaccini, A. M., Novaes, A. B., Jr., Meschiari, C. A., Souza, S. L., Palioto, D. B., Sorgi, C. A., Faccioli, L. H., Tanus-Santos, J. E., and Gerlach, R. F. (2009) Clin Chim Acta 409(1-2), 117-122 80. Molet, S., Belleguic, C., Lena, H., Germain, N., Bertrand, C. P., Shapiro, S. D., Planquois, J. M., Delaval, P., and Lagente, V. (2005) Inflamm Res 54(1), 31-36  150 81. Pradhan-Palikhe, P., Vikatmaa, P., Lajunen, T., Palikhe, A., Lepantalo, M., Tervahartiala, T., Salo, T., Saikku, P., Leinonen, M., Pussinen, P. J., and Sorsa, T. (2010) Scand J Immunol 72(2), 150-157 82. Rajasekhar, L., Liou, L. B., Chan, C. Y., Tsai, W. P., and Cheng, C. Y. (2004) Clin Exp Rheumatol 22(5), 597-602 83. Sun, Q., Weber, C. R., Sohail, A., Bernardo, M. M., Toth, M., Zhao, H., Turner, J. R., and Fridman, R. (2007) J Biol Chem 282(30), 21998-22010 84. Velasco, G., Cal, S., Merlos-Suarez, A., Ferrando, A. A., Alvarez, S., Nakano, A., Arribas, J., and Lopez-Otin, C. (2000) Cancer Res 60(4), 877-882 85. Hautamaki, R. D., Kobayashi, D. K., Senior, R. M., and Shapiro, S. D. (1997) Science 277(5334), 2002-2004 86. Churg, A., Wang, R. D., Tai, H., Wang, X., Xie, C., Dai, J., Shapiro, S. D., and Wright, J. L. (2003) Am J Respir Crit Care Med 167(8), 1083-1089 87. Dean, R. A., Cox, J. H., Bellac, C. L., Doucet, A., Starr, A. E., and Overall, C. M. (2008) Blood 112(8), 3455-3464 88. Quintero, P. A., Knolle, M. D., Cala, L. F., Zhuang, Y., and Owen, C. A. (2010) J Immunol 184(3), 1575-1588 89. Tester, A. M., Cox, J. H., Connor, A. R., Starr, A. E., Dean, R. A., Puente, X. S., Lopez-Otin, C., and Overall, C. M. (2007) PLoS One 2(3), e312 90. Paulick, M. G., and Bertozzi, C. R. (2008) Biochemistry 47(27), 6991-7000 91. Kinoshita, T., Ohishi, K., and Takeda, J. (1997) J Biochem 122(2), 251-257 92. Chatterjee, S., and Mayor, S. (2001) Cell Mol Life Sci 58(14), 1969-1987 93. Sangiorgio, V., Pitto, M., Palestini, P., and Masserini, M. (2004) Ital J Biochem 53(2), 98-111 94. Hoyer-Hansen, G., Pessara, U., Holm, A., Pass, J., Weidle, U., Dano, K., and Behrendt, N. (2001) Biochem J 358(Pt 3), 673-679 95. Ploug, M., Ronne, E., Behrendt, N., Jensen, A. L., Blasi, F., and Dano, K. (1991) J Biol Chem 266(3), 1926-1933 96. Sugita, Y., Nakano, Y., Oda, E., Noda, K., Tobe, T., Miura, N. H., and Tomita, M. (1993) J Biochem 114(4), 473-477 97. Yoshitake, H., Takeda, Y., Nitto, T., and Sendo, F. (2002) J Leukoc Biol 71(2), 205-211 98. Simmons, D. L., Tan, S., Tenen, D. G., Nicholson-Weller, A., and Seed, B. (1989) Blood 73(1), 284-289 99. Sharom, F. J., and Lehto, M. T. (2002) Biochem Cell Biol 80(5), 535-549 100. Tsujioka, H., Misumi, Y., Takami, N., and Ikehara, Y. (1998) Biochem Biophys Res Commun 251(3), 737-743 101. Fortin, C. F., Sohail, A., Sun, Q., McDonald, P. P., Fridman, R., and Fulop, T. (2010) Int Immunol 22(8), 637-649 102. Zhao, H., Sohail, A., Sun, Q., Shi, Q., Kim, S., Mobashery, S., and Fridman, R. (2008) J Biol Chem 283(50), 35023-35032 103. English, W. R., Velasco, G., Stracke, J. O., Knauper, V., and Murphy, G. (2001) FEBS Lett 491(1-2), 137-142 104. Radichev, I. A., Remacle, A. G., Shiryaev, S. A., Purves, A. N., Johnson, S. L., Pellecchia, M., and Strongin, A. Y. (2010) J Biol Chem 285(21), 16076-16086 105. Matsuda, A., Itoh, Y., Koshikawa, N., Akizawa, T., Yana, I., and Seiki, M. (2003) J Biol Chem 278(38), 36350-36357 106. Dong, Z., Katar, M., Alousi, S., and Berk, R. S. (2001) Invest Ophthalmol Vis Sci 42(13), 3223-3227  151 107. Fortunato, S. J., and Menon, R. (2002) J Assist Reprod Genet 19(10), 483-486 108. Edsparr, K., Johansson, B. R., Goldfarb, R. H., Basse, P. H., Nannmark, U., Speetjens, F. M., Kuppen, P. J., Lennernas, B., and Albertsson, P. (2009) Immunol Cell Biol 87(6), 489-495 109. Shiryaev, S. A., Savinov, A. Y., Cieplak, P., Ratnikov, B. I., Motamedchaboki, K., Smith, J. W., and Strongin, A. Y. (2009) PLoS One 4(3), e4952 110. Nie, J., and Pei, D. (2003) Cancer Res 63(20), 6758-6762 111. Andolfo, A., English, W. R., Resnati, M., Murphy, G., Blasi, F., and Sidenius, N. (2002) Thromb Haemost 88(2), 298-306 112. Nie, J., and Pei, D. (2004) Exp Cell Res 296(2), 145-150 113. Sohail, A., Sun, Q., Zhao, H., Bernardo, M. M., Cho, J. A., and Fridman, R. (2008) Cancer Metastasis Rev 27(2), 289-302 114. McQuibban, G. A., Gong, J. H., Tam, E. M., McCulloch, C. A., Clark-Lewis, I., and Overall, C. M. (2000) Science 289(5482), 1202-1206 115. McQuibban, G. A., Gong, J. H., Wong, J. P., Wallace, J. L., Clark-Lewis, I., and Overall, C. M. (2002) Blood 100(4), 1160-1167 116. Dean, R. A., Butler, G. S., Hamma-Kourbali, Y., Delbe, J., Brigstock, D. R., Courty, J., and Overall, C. M. (2007) Mol Cell Biol 27(24), 8454-8465 117. Cauwe, B., Martens, E., Proost, P., and Opdenakker, G. (2009) Integr Biol (Camb) 1(5-6), 404-426 118. Cauwe, B., Van den Steen, P. E., and Opdenakker, G. (2007) Crit Rev Biochem Mol Biol 42(3), 113-185 119. Luster, A. D. (1998) N Engl J Med 338(7), 436-445 120. Fernandez, E. J., and Lolis, E. (2002) Annu Rev Pharmacol Toxicol 42, 469-499 121. Zlotnik, A., and Yoshie, O. (2000) Immunity 12(2), 121-127 122. Berahovich, R. D., Miao, Z., Wang, Y., Premack, B., Howard, M. C., and Schall, T. J. (2005) J Immunol 174(11), 7341-7351 123. Clark-Lewis, I., Schumacher, C., Baggiolini, M., and Moser, B. (1991) J Biol Chem 266(34), 23128-23134 124. Hebert, C. A., Vitangcol, R. V., and Baker, J. B. (1991) J Biol Chem 266(28), 18989-18994 125. Sallusto, F., and Lanzavecchia, A. (2000) Immunol Rev 177, 134-140 126. Sica, A., Matsushima, K., Van Damme, J., Wang, J. M., Polentarutti, N., Dejana, E., Colotta, F., and Mantovani, A. (1990) Immunology 69(4), 548-553 127. Sica, A., Wang, J. M., Colotta, F., Dejana, E., Mantovani, A., Oppenheim, J. J., Larsen, C. G., Zachariae, C. O., and Matsushima, K. (1990) J Immunol 144(8), 3034-3038 128. Strieter, R. M., Standiford, T. J., Huffnagle, G. B., Colletti, L. M., Lukacs, N. W., and Kunkel, S. L. (1996) J Immunol 156(10), 3583-3586 129. Proudfoot, A. E., Handel, T. M., Johnson, Z., Lau, E. K., LiWang, P., Clark- Lewis, I., Borlat, F., Wells, T. N., and Kosco-Vilbois, M. H. (2003) Proc Natl Acad Sci U S A 100(4), 1885-1890 130. Laguri, C., Arenzana-Seisdedos, F., and Lortat-Jacob, H. (2008) Carbohydr Res 343(12), 2018-2023 131. Proudfoot, A. E. (2006) Biochem Soc Trans 34(Pt 3), 422-426 132. Proudfoot, A. E., Fritchley, S., Borlat, F., Shaw, J. P., Vilbois, F., Zwahlen, C., Trkola, A., Marchant, D., Clapham, P. R., and Wells, T. N. (2001) J Biol Chem 276(14), 10620-10626  152 133. Graham, G. J., Wilkinson, P. C., Nibbs, R. J., Lowe, S., Kolset, S. O., Parker, A., Freshney, M. G., Tsang, M. L., and Pragnell, I. B. (1996) Embo J 15(23), 6506-6515 134. Laurence, J. S., Blanpain, C., De Leener, A., Parmentier, M., and LiWang, P. J. (2001) Biochemistry 40(16), 4990-4999 135. Amara, A., Lorthioir, O., Valenzuela, A., Magerus, A., Thelen, M., Montes, M., Virelizier, J. L., Delepierre, M., Baleux, F., Lortat-Jacob, H., and Arenzana- Seisdedos, F. (1999) J Biol Chem 274(34), 23916-23925 136. Baysal, C., and Atilgan, A. R. (2001) Proteins 43(2), 150-160 137. Blanpain, C., Doranz, B. J., Bondue, A., Govaerts, C., De Leener, A., Vassart, G., Doms, R. W., Proudfoot, A., and Parmentier, M. (2003) J Biol Chem 278(7), 5179-5187 138. Pease, J. E., Wang, J., Ponath, P. D., and Murphy, P. M. (1998) J Biol Chem 273(32), 19972-19976 139. Zoffmann, S., Chollet, A., and Galzi, J. L. (2002) Mol Pharmacol 62(3), 729-736 140. Allen, S. J., Crown, S. E., and Handel, T. M. (2007) Annu Rev Immunol 25, 787- 820 141. Murphy, P. M. (2002) Pharmacol Rev 54(2), 227-229 142. Murphy, P. M., Baggiolini, M., Charo, I. F., Hebert, C. A., Horuk, R., Matsushima, K., Miller, L. H., Oppenheim, J. J., and Power, C. A. (2000) Pharmacol Rev 52(1), 145-176 143. Graham, G. J. (2009) Eur J Immunol 39(2), 342-351 144. Kotarsky, K., Sitnik, K. M., Stenstad, H., Kotarsky, H., Schmidtchen, A., Koslowski, M., Wehkamp, J., and Agace, W. W. (2009) Mucosal Immunol 145. Nguyen, L. T., Chan, D. I., Boszhard, L., Zaat, S. A., and Vogel, H. J. (2010) Biochim Biophys Acta 1798(6), 1062-1072 146. Strieter, R. M., Belperio, J. A., Burdick, M. D., and Keane, M. P. (2005) Curr Drug Targets Inflamm Allergy 4(1), 23-26 147. Mellado, M., Serrano, A., Martinez, C., and Rodriguez-Frade, J. M. (2006) Methods Mol Biol 332, 141-157 148. Thelen, M., and Stein, J. V. (2008) Nat Immunol 9(9), 953-959 149. Tian, Y., New, D. C., Yung, L. Y., Allen, R. A., Slocombe, P. M., Twomey, B. M., Lee, M. M., and Wong, Y. H. (2004) Eur J Immunol 34(3), 785-795 150. Krupnick, J. G., and Benovic, J. L. (1998) Annu Rev Pharmacol Toxicol 38, 289- 319 151. Ferguson, S. S., Downey, W. E., 3rd, Colapietro, A. M., Barak, L. S., Menard, L., and Caron, M. G. (1996) Science 271(5247), 363-366 152. Manes, S., Lacalle, R. A., Gomez-Mouton, C., del Real, G., Mira, E., and Martinez, A. C. (2001) Semin Immunol 13(2), 147-157 153. Mortier, A., Van Damme, J., and Proost, P. (2008) Pharmacol Ther 120(2), 197- 217 154. Cox, J. H., Dean, R. A., Roberts, C. R., and Overall, C. M. (2008) J Biol Chem 283(28), 19389-19399 155. Wolf, M., Albrecht, S., and Marki, C. (2008) Int J Biochem Cell Biol 40(6-7), 1185-1198 156. Cox, J. H., and Overall, C. M. (2008) Cytokine substrates: MMP regulation of inflammatory signalling molecules. In: Edwards, D., Hoyer-Hansen, G., Blasi, F., and Sloane, B. F. (eds). Proteases and cancer biology, Springer, New York  153 157. Clark-Lewis, I., Dewald, B., Geiser, T., Moser, B., and Baggiolini, M. (1993) Proc Natl Acad Sci U S A 90(8), 3574-3577 158. Detheux, M., Standker, L., Vakili, J., Munch, J., Forssmann, U., Adermann, K., Pohlmann, S., Vassart, G., Kirchhoff, F., Parmentier, M., and Forssmann, W. G. (2000) J Exp Med 192(10), 1501-1508 159. Richter, R., Bistrian, R., Escher, S., Forssmann, W. G., Vakili, J., Henschler, R., Spodsberg, N., Frimpong-Boateng, A., and Forssmann, U. (2005) J Immunol 175(3), 1599-1608 160. Wuyts, A., Govaerts, C., Struyf, S., Lenaerts, J. P., Put, W., Conings, R., Proost, P., and Van Damme, J. (1999) Eur J Biochem 260(2), 421-429 161. Van den Steen, P. E., Proost, P., Wuyts, A., Van Damme, J., and Opdenakker, G. (2000) Blood 96(8), 2673-2681 162. King, A. G., Johanson, K., Frey, C. L., DeMarsh, P. L., White, J. R., McDevitt, P., McNulty, D., Balcarek, J., Jonak, Z. L., Bhatnagar, P. K., and Pelus, L. M. (2000) J Immunol 164(7), 3774-3782 163. Gupta, S. K., Hassel, T., and Singh, J. P. (1995) Proc Natl Acad Sci U S A 92(17), 7799-7803 164. Nufer, O., Corbett, M., and Walz, A. (1999) Biochemistry 38(2), 636-642 165. Proost, P., Struyf, S., Schols, D., Durinx, C., Wuyts, A., Lenaerts, J. P., De Clercq, E., De Meester, I., and Van Damme, J. (1998) FEBS Lett 432(1-2), 73- 76 166. Starckx, S., Wuyts, A., Opsomer, I., Van Coillie, E., Proost, P., Arnold, B., Van Damme, J., and Opdenakker, G. (2002) J Interferon Cytokine Res 22(9), 965- 974 167. Ehlert, J. E., Gerdes, J., Flad, H. D., and Brandt, E. (1998) J Immunol 161(9), 4975-4982 168. Ehlert, J. E., Petersen, F., Kubbutat, M. H., Gerdes, J., Flad, H. D., and Brandt, E. (1995) J Biol Chem 270(11), 6338-6344 169. Krijgsveld, J., Zaat, S. A., Meeldijk, J., van Veelen, P. A., Fang, G., Poolman, B., Brandt, E., Ehlert, J. E., Kuijpers, A. J., Engbers, G. H., Feijen, J., and Dankert, J. (2000) J Biol Chem 275(27), 20374-20381 170. Starckx, S., Van den Steen, P. E., Wuyts, A., Van Damme, J., and Opdenakker, G. (2002) Leuk Lymphoma 43(2), 233-241 171. Schutyser, E., Struyf, S., Proost, P., Opdenakker, G., Laureys, G., Verhasselt, B., Peperstraete, L., Van de Putte, I., Saccani, A., Allavena, P., Mantovani, A., and Van Damme, J. (2002) J Biol Chem 277(27), 24584-24593 172. Hebert, C. A., Luscinskas, F. W., Kiely, J. M., Luis, E. A., Darbonne, W. C., Bennett, G. L., Liu, C. C., Obin, M. S., Gimbrone, M. A., Jr., and Baker, J. B. (1990) J Immunol 145(9), 3033-3040 173. Webb, L. M., Ehrengruber, M. U., Clark-Lewis, I., Baggiolini, M., and Rot, A. (1993) Proc Natl Acad Sci U S A 90(15), 7158-7162 174. Proost, P., Schutyser, E., Menten, P., Struyf, S., Wuyts, A., Opdenakker, G., Detheux, M., Parmentier, M., Durinx, C., Lambeir, A. M., Neyts, J., Liekens, S., Maudgal, P. C., Billiau, A., and Van Damme, J. (2001) Blood 98(13), 3554-3561 175. Lambeir, A. M., Proost, P., Durinx, C., Bal, G., Senten, K., Augustyns, K., Scharpe, S., Van Damme, J., and De Meester, I. (2001) J Biol Chem 276(32), 29839-29845  154 176. Ajami, K., Pitman, M. R., Wilson, C. H., Park, J., Menz, R. I., Starr, A. E., Cox, J. H., Abbott, C. A., Overall, C. M., and Gorrell, M. D. (2008) FEBS Lett 582(5), 819-825 177. Denney, H., Clench, M. R., and Woodroofe, M. N. (2009) Biochem Biophys Res Commun 382(2), 341-347 178. Clark-Lewis, I., Mattioli, I., Gong, J. H., and Loetscher, P. (2003) J Biol Chem 278(1), 289-295 179. Campbell, T. B., and Broxmeyer, H. E. (2008) Front Biosci 13, 1795-1805 180. Valenzuela-Fernandez, A., Planchenault, T., Baleux, F., Staropoli, I., Le- Barillec, K., Leduc, D., Delaunay, T., Lazarini, F., Virelizier, J. L., Chignard, M., Pidard, D., and Arenzana-Seisdedos, F. (2002) J Biol Chem 277(18), 15677- 15689 181. McQuibban, G. A., Butler, G. S., Gong, J. H., Bendall, L., Power, C., Clark- Lewis, I., and Overall, C. M. (2001) J Biol Chem 276(47), 43503-43508 182. Vergote, D., Butler, G. S., Ooms, M., Cox, J. H., Silva, C., Hollenberg, M. D., Jhamandas, J. H., Overall, C. M., and Power, C. (2006) Proc Natl Acad Sci U S A 103(50), 19182-19187 183. Zhang, K., McQuibban, G. A., Silva, C., Butler, G. S., Johnston, J. B., Holden, J., Clark-Lewis, I., Overall, C. M., and Power, C. (2003) Nat Neurosci 6(10), 1064-1071 184. Delgado, M. B., Clark-Lewis, I., Loetscher, P., Langen, H., Thelen, M., Baggiolini, M., and Wolf, M. (2001) Eur J Immunol 31(3), 699-707 185. Abel, S., Hundhausen, C., Mentlein, R., Schulte, A., Berkhout, T. A., Broadway, N., Hartmann, D., Sedlacek, R., Dietrich, S., Muetze, B., Schuster, B., Kallen, K. J., Saftig, P., Rose-John, S., and Ludwig, A. (2004) J Immunol 172(10), 6362- 6372 186. Gough, P. J., Garton, K. J., Wille, P. T., Rychlewski, M., Dempsey, P. J., and Raines, E. W. (2004) J Immunol 172(6), 3678-3685 187. Jarnagin, K., Grunberger, D., Mulkins, M., Wong, B., Hemmerich, S., Paavola, C., Bloom, A., Bhakta, S., Diehl, F., Freedman, R., McCarley, D., Polsky, I., Ping-Tsou, A., Kosaka, A., and Handel, T. M. (1999) Biochemistry 38(49), 16167-16177 188. Weber, M., Uguccioni, M., Baggiolini, M., Clark-Lewis, I., and Dahinden, C. A. (1996) J Exp Med 183(2), 681-685 189. Wolf, M., Clark-Lewis, I., Buri, C., Langen, H., Lis, M., and Mazzucchelli, L. (2003) Am J Pathol 162(4), 1183-1190 190. Guan, E., Wang, J., Roderiquez, G., and Norcross, M. A. (2002) J Biol Chem 277(35), 32348-32352 191. Laurence, J. S., LiWang, A. C., and LiWang, P. J. (1998) Biochemistry 37(26), 9346-9354 192. Oravecz, T., Pall, M., Roderiquez, G., Gorrell, M. D., Ditto, M., Nguyen, N. Y., Boykins, R., Unsworth, E., and Norcross, M. A. (1997) J Exp Med 186(11), 1865-1872 193. Schols, D., Proost, P., Struyf, S., Wuyts, A., De Meester, I., Scharpe, S., Van Damme, J., and De Clercq, E. (1998) Antiviral Res 39(3), 175-187 194. Struyf, S., De Meester, I., Scharpe, S., Lenaerts, J. P., Menten, P., Wang, J. M., Proost, P., and Van Damme, J. (1998) Eur J Immunol 28(4), 1262-1271 195. Lim, J. K., Burns, J. M., Lu, W., and DeVico, A. L. (2005) J Leukoc Biol 78(2), 442-452  155 196. Gong, J. H., Uguccioni, M., Dewald, B., Baggiolini, M., and Clark-Lewis, I. (1996) J Biol Chem 271(18), 10521-10527 197. Proost, P., Struyf, S., Couvreur, M., Lenaerts, J. P., Conings, R., Menten, P., Verhaert, P., Wuyts, A., and Van Damme, J. (1998) J Immunol 160(8), 4034- 4041 198. Lambeir, A. M., Durinx, C., Proost, P., Van Damme, J., Scharpe, S., and De Meester, I. (2001) FEBS Lett 507(3), 327-330 199. Struyf, S., Proost, P., Schols, D., De Clercq, E., Opdenakker, G., Lenaerts, J. P., Detheux, M., Parmentier, M., De Meester, I., Scharpe, S., and Van Damme, J. (1999) J Immunol 162(8), 4903-4909 200. Noso, N., Bartels, J., Mallet, A. I., Mochizuki, M., Christophers, E., and Schroder, J. M. (1998) Eur J Biochem 253(1), 114-122 201. Richter, R., Schulz-Knappe, P., John, H., and Forssmann, W. G. (2000) Biochemistry 39(35), 10799-10805 202. Richter, R., Casarosa, P., Standker, L., Munch, J., Springael, J. Y., Nijmeijer, S., Forssmann, W. G., Vischer, H. F., Vakili, J., Detheux, M., Parmentier, M., Leurs, R., and Smit, M. J. (2009) J Immunol 183(2), 1229-1237 203. Stropes, M. P., Schneider, O. D., Zagorski, W. A., Miller, J. L., and Miller, W. E. (2009) J Virol 83(19), 10016-10027 204. Vakili, J., Standker, L., Detheux, M., Vassart, G., Forssmann, W. G., and Parmentier, M. (2001) J Immunol 167(6), 3406-3413 205. Escher, S. E., Forssmann, U., Frimpong-Boateng, A., Adermann, K., Vakili, J., Sticht, H., and Detheux, M. (2004) J Pept Res 63(1), 36-47 206. Pilkington, K. R., Clark-Lewis, I., and McColl, S. R. (2004) J Biol Chem 279(39), 40276-40282 207. Hasan, L., Mazzucchelli, L., Liebi, M., Lis, M., Hunger, R. E., Tester, A., Overall, C. M., and Wolf, M. (2006) J Immunol 176(11), 6512-6522 208. Proost, P., Struyf, S., Schols, D., Opdenakker, G., Sozzani, S., Allavena, P., Mantovani, A., Augustyns, K., Bal, G., Haemers, A., Lambeir, A. M., Scharpe, S., Van Damme, J., and De Meester, I. (1999) J Biol Chem 274(7), 3988-3993 209. Struyf, S., Proost, P., Sozzani, S., Mantovani, A., Wuyts, A., De Clercq, E., Schols, D., and Van Damme, J. (1998) J Immunol 161(6), 2672-2675 210. Macphee, C. H., Appelbaum, E. R., Johanson, K., Moores, K. E., Imburgia, C. S., Fornwald, J., Berkhout, T., Brawner, M., Groot, P. H., O'Donnell, K., O'Shannessy, D., Scott, G., and White, J. R. (1998) J Immunol 161(11), 6273- 6279 211. Shinkai, A., Komuta-Kunitomo, M., Sato-Nakamura, N., and Anazawa, H. (2002) Protein Eng 15(11), 923-929 212. Garton, K. J., Gough, P. J., Blobel, C. P., Murphy, G., Greaves, D. R., Dempsey, P. J., and Raines, E. W. (2001) J Biol Chem 276(41), 37993-38001 213. Hundhausen, C., Misztela, D., Berkhout, T. A., Broadway, N., Saftig, P., Reiss, K., Hartmann, D., Fahrenholz, F., Postina, R., Matthews, V., Kallen, K. J., Rose- John, S., and Ludwig, A. (2003) Blood 102(4), 1186-1195 214. Hundhausen, C., Schulte, A., Schulz, B., Andrzejewski, M. G., Schwarz, N., von Hundelshausen, P., Winter, U., Paliga, K., Reiss, K., Saftig, P., Weber, C., and Ludwig, A. (2007) J Immunol 178(12), 8064-8072 215. Andrzejewski, M. G., Koelsch, A., Kogel, T., Dreymueller, D., Schwarz, N., and Ludwig, A. (2010) Biochem Biophys Res Commun 395(2), 178-184 216. Dean, R. A., and Overall, C. M. (2007) Mol Cell Proteomics 6(4), 611-623  156 217. Nakagawa, H., Hatakeyama, S., Ikesue, A., and Miyai, H. (1991) FEBS Lett 282(2), 412-414 218. Ohashi, K., Naruto, M., Nakaki, T., and Sano, E. (2003) Biochim Biophys Acta 1649(1), 30-39 219. Padrines, M., Wolf, M., Walz, A., and Baggiolini, M. (1994) FEBS Lett 352(2), 231-235 220. Van Den Steen, P. E., Wuyts, A., Husson, S. J., Proost, P., Van Damme, J., and Opdenakker, G. (2003) Eur J Biochem 270(18), 3739-3749 221. Davis, D. A., Singer, K. E., De La Luz Sierra, M., Narazaki, M., Yang, F., Fales, H. M., Yarchoan, R., and Tosato, G. (2005) Blood 105(12), 4561-4568 222. Christopherson, K. W., 2nd, Hangoc, G., and Broxmeyer, H. E. (2002) J Immunol 169(12), 7000-7008 223. Ohtsuki, T., Hosono, O., Kobayashi, H., Munakata, Y., Souta, A., Shioda, T., and Morimoto, C. (1998) FEBS Lett 431(2), 236-240 224. Shioda, T., Kato, H., Ohnishi, Y., Tashiro, K., Ikegawa, M., Nakayama, E. E., Hu, H., Kato, A., Sakai, Y., Liu, H., Honjo, T., Nomoto, A., Iwamoto, A., Morimoto, C., and Nagai, Y. (1998) Proc Natl Acad Sci U S A 95(11), 6331- 6336 225. Arakelyan, A., Kriegova, E., Kubistova, Z., Mrazek, F., Kverka, M., du Bois, R. M., Kolek, V., and Petrek, M. (2009) Clin Exp Immunol 155(3), 457-465 226. Harlin, H., Kuna, T. V., Peterson, A. C., Meng, Y., and Gajewski, T. F. (2006) Cancer Immunol Immunother 55(10), 1185-1197 227. Steinbach, D., Schramm, A., Eggert, A., Onda, M., Dawczynski, K., Rump, A., Pastan, I., Wittig, S., Pfaffendorf, N., Voigt, A., Zintl, F., and Gruhn, B. (2006) Clin Cancer Res 12(8), 2434-2441 228. Youn, B. S., Zhang, S. M., Lee, E. K., Park, D. H., Broxmeyer, H. E., Murphy, P. M., Locati, M., Pease, J. E., Kim, K. K., Antol, K., and Kwon, B. S. (1997) J Immunol 159(11), 5201-5205 229. Han, I. S., Ra, J. S., Kim, M. W., Lee, E. A., Jun, H. Y., Park, S. K., and Kwon, B. S. (2003) Mol Cells 15(2), 176-180 230. Forssmann, U., Magert, H. J., Adermann, K., Escher, S. E., and Forssmann, W. G. (2001) J Leukoc Biol 70(3), 357-366 231. Bianchi, M. E. (2007) J Leukoc Biol 81(1), 1-5 232. Belaaouaj, A. A., Li, A., Wun, T. C., Welgus, H. G., and Shapiro, S. D. (2000) J Biol Chem 275(35), 27123-27128 233. Cunningham, A. C., Hasty, K. A., Enghild, J. J., and Mast, A. E. (2002) Biochem J 367(Pt 2), 451-458 234. Diekmann, O., and Tschesche, H. (1994) Braz J Med Biol Res 27(8), 1865- 1876 235. Mohan, M. J., Seaton, T., Mitchell, J., Howe, A., Blackburn, K., Burkhart, W., Moyer, M., Patel, I., Waitt, G. M., Becherer, J. D., Moss, M. L., and Milla, M. E. (2002) Biochemistry 41(30), 9462-9469 236. English, W. R., Puente, X. S., Freije, J. M., Knauper, V., Amour, A., Merryweather, A., Lopez-Otin, C., and Murphy, G. (2000) J Biol Chem 275(19), 14046-14055 237. Schonbeck, U., Mach, F., and Libby, P. (1998) J Immunol 161(7), 3340-3346 238. Tschesche, H., Lichte, A., Hiller, O., Oberpichler, A., Buttner, F. H., and Bartnik, E. (2000) Adv Exp Med Biol 477, 217-228  157 239. Hiller, O., Lichte, A., Oberpichler, A., Kocourek, A., and Tschesche, H. (2000) J Biol Chem 275(42), 33008-33013 240. Bini, A., Itoh, Y., Kudryk, B. J., and Nagase, H. (1996) Biochemistry 35(40), 13056-13063 241. Bini, A., Wu, D., Schnuer, J., and Kudryk, B. J. (1999) Biochemistry 38(42), 13928-13936 242. Hiraoka, N., Allen, E., Apel, I. J., Gyetko, M. R., and Weiss, S. J. (1998) Cell 95(3), 365-377 243. Ricklin, D., Hajishengallis, G., Yang, K., and Lambris, J. D. (2010) Nat Immunol 11(9), 785-797 244. Rozanov, D. V., Savinov, A. Y., Golubkov, V. S., Postnova, T. I., Remacle, A., Tomlinson, S., and Strongin, A. Y. (2004) J Biol Chem 279(45), 46551-46557 245. Lin, M., Jackson, P., Tester, A. M., Diaconu, E., Overall, C. M., Blalock, J. E., and Pearlman, E. (2008) Am J Pathol 173(1), 144-153 246. McGuire, J. K., Li, Q., and Parks, W. C. (2003) Am J Pathol 162(6), 1831-1843 247. Tager, A. M., and Luster, A. D. (2003) Prostaglandins Leukot Essent Fatty Acids 69(2-3), 123-134 248. Borregaard, N., Sorensen, O. E., and Theilgaard-Monch, K. (2007) Trends Immunol 28(8), 340-345 249. Papayannopoulos, V., and Zychlinsky, A. (2009) Trends Immunol 30(11), 513- 521 250. Ayabe, T., Satchell, D. P., Pesendorfer, P., Tanabe, H., Wilson, C. L., Hagen, S. J., and Ouellette, A. J. (2002) J Biol Chem 277(7), 5219-5228 251. Wilson, C. L., Schmidt, A. P., Pirila, E., Valore, E. V., Ferri, N., Sorsa, T., Ganz, T., and Parks, W. C. (2009) J Biol Chem 284(13), 8301-8311 252. Peter, C., Waibel, M., Radu, C. G., Yang, L. V., Witte, O. N., Schulze-Osthoff, K., Wesselborg, S., and Lauber, K. (2008) J Biol Chem 283(9), 5296-5305 253. Chalaris, A., Rabe, B., Paliga, K., Lange, H., Laskay, T., Fielding, C. A., Jones, S. A., Rose-John, S., and Scheller, J. (2007) Blood 110(6), 1748-1755 254. Levy, B. D., Clish, C. B., Schmidt, B., Gronert, K., and Serhan, C. N. (2001) Nat Immunol 2(7), 612-619 255. Serhan, C. N., and Savill, J. (2005) Nat Immunol 6(12), 1191-1197 256. Chiang, N., Serhan, C. N., Dahlen, S. E., Drazen, J. M., Hay, D. W., Rovati, G. E., Shimizu, T., Yokomizo, T., and Brink, C. (2006) Pharmacol Rev 58(3), 463- 487 257. Maddox, J. F., Colgan, S. P., Clish, C. B., Petasis, N. A., Fokin, V. V., and Serhan, C. N. (1998) Faseb J 12(6), 487-494 258. Maddox, J. F., Hachicha, M., Takano, T., Petasis, N. A., Fokin, V. V., and Serhan, C. N. (1997) J Biol Chem 272(11), 6972-6978 259. Arita, M., Ohira, T., Sun, Y. P., Elangovan, S., Chiang, N., and Serhan, C. N. (2007) J Immunol 178(6), 3912-3917 260. Serhan, C. N. (2008) J Periodontol 79(8 Suppl), 1520-1526 261. Li, Q., Park, P. W., Wilson, C. L., and Parks, W. C. (2002) Cell 111(5), 635-646 262. Essick, E., Sithu, S., Dean, W., and D'Souza, S. (2008) Mol Cell Biochem 314(1-2), 151-159 263. Sithu, S. D., English, W. R., Olson, P., Krubasik, D., Baker, A. H., Murphy, G., and D'Souza, S. E. (2007) J Biol Chem 282(34), 25010-25019 264. Tarin, C., Gomez, M., Calvo, E., Lopez, J. A., and Zaragoza, C. (2009) Arterioscler Thromb Vasc Biol 29(1), 27-32  158 265. Xu, D., Suenaga, N., Edelmann, M. J., Fridman, R., Muschel, R. J., and Kessler, B. M. (2008) Mol Cell Proteomics 7(11), 2215-2228 266. Ariel, A., Fredman, G., Sun, Y. P., Kantarci, A., Van Dyke, T. E., Luster, A. D., and Serhan, C. N. (2006) Nat Immunol 7(11), 1209-1216 267. Jamieson, T., Cook, D. N., Nibbs, R. J., Rot, A., Nixon, C., McLean, P., Alcami, A., Lira, S. A., Wiekowski, M., and Graham, G. J. (2005) Nat Immunol 6(4), 403- 411 268. Kennedy, A. D., and DeLeo, F. R. (2009) Immunol Res 43(1-3), 25-61 269. Perretti, M., and D'Acquisto, F. (2009) Nat Rev Immunol 9(1), 62-70 270. Scannell, M., Flanagan, M. B., deStefani, A., Wynne, K. J., Cagney, G., Godson, C., and Maderna, P. (2007) J Immunol 178(7), 4595-4605 271. Butler, G. S., Sim, D., Tam, E., Devine, D., and Overall, C. M. (2002) J Biol Chem 277(20), 17511-17519 272. Fadok, V. A., Bratton, D. L., Konowal, A., Freed, P. W., Westcott, J. Y., and Henson, P. M. (1998) J Clin Invest 101(4), 890-898 273. Huynh, M. L., Fadok, V. A., and Henson, P. M. (2002) J Clin Invest 109(1), 41- 50 274. Lucas, M., Stuart, L. M., Savill, J., and Lacy-Hulbert, A. (2003) J Immunol 171(5), 2610-2615 275. Ito, A., Mukaiyama, A., Itoh, Y., Nagase, H., Thogersen, I. B., Enghild, J. J., Sasaguri, Y., and Mori, Y. (1996) J Biol Chem 271(25), 14657-14660 276. Karsdal, M. A., Larsen, L., Engsig, M. T., Lou, H., Ferreras, M., Lochter, A., Delaisse, J. M., and Foged, N. T. (2002) J Biol Chem 277(46), 44061-44067 277. Maeda, S., Dean, D. D., Gomez, R., Schwartz, Z., and Boyan, B. D. (2002) Calcif Tissue Int 70(1), 54-65 278. Yu, Q., and Stamenkovic, I. (2000) Genes Dev 14(2), 163-176 279. Overall, C. M., Wrana, J. L., and Sodek, J. (1989) Connect Tissue Res 20(1-4), 289-294 280. Overall, C. M., Wrana, J. L., and Sodek, J. (1991) J Periodontal Res 26(3 Pt 2), 279-282 281. Xu, J., and Clark, R. A. (1996) J Cell Biol 132(1-2), 239-249 282. Wrana, J. L., Overall, C. M., and Sodek, J. (1991) Eur J Biochem 197(2), 519- 528 283. Golpon, H. A., Fadok, V. A., Taraseviciene-Stewart, L., Scerbavicius, R., Sauer, C., Welte, T., Henson, P. M., and Voelkel, N. F. (2004) Faseb J 18(14), 1716- 1718 284. Hashimoto, G., Inoki, I., Fujii, Y., Aoki, T., Ikeda, E., and Okada, Y. (2002) J Biol Chem 277(39), 36288-36295 285. Gong, J. H., and Clark-Lewis, I. (1995) J Exp Med 181(2), 631-640 286. Overall, C. M., and Kleifeld, O. (2006) Br J Cancer 94(7), 941-946 287. Butler, G. S., Tam, E. M., and Overall, C. M. (2004) J Biol Chem 279(15), 15615-15620 288. Clark-Lewis, I., Vo, L., Owen, P., and Anderson, J. (1997) Methods Enzymol 287, 233-250 289. Starr, A. E., and Overall, C. M. (2009) Methods Enzymol 461, 281-307 290. Wang, H., and Joseph, J. A. (1999) Free Radic Biol Med 27(5-6), 612-616 291. Quintero, P. A., Knolle, M. D., Cala, L. F., Zhuang, Y., and Owen, C. A. J Immunol 184(3), 1575-1588  159 292. Ryu, O. H., Choi, S. J., Firatli, E., Choi, S. W., Hart, P. S., Shen, R. F., Wang, G., Wu, W. W., and Hart, T. C. (2005) J Biol Chem 280(17), 17415-17421 293. Wang, W., Bacon, K. B., Oldham, E. R., and Schall, T. J. (1998) J Clin Immunol 18(3), 214-222 294. Forssmann, U., Delgado, M. B., Uguccioni, M., Loetscher, P., Garotta, G., and Baggiolini, M. (1997) FEBS Lett 408(2), 211-216 295. Pardigol, A., Forssmann, U., Zucht, H. D., Loetscher, P., Schulz-Knappe, P., Baggiolini, M., Forssmann, W. G., and Magert, H. J. (1998) Proc Natl Acad Sci U S A 95(11), 6308-6313 296. Wuyts, A., D'Haese, A., Cremers, V., Menten, P., Lenaerts, J. P., De Loof, A., Heremans, H., Proost, P., and Van Damme, J. (1999) J Immunol 163(11), 6155-6163 297. Proost, P., Menten, P., Struyf, S., Schutyser, E., De Meester, I., and Van Damme, J. (2000) Blood 96(5), 1674-1680 298. Escher, S. E., Sticht, H., Forssmann, W. G., Rosch, P., and Adermann, K. (1999) J Pept Res 54(6), 505-513 299. Howard, O. M., Dong, H. F., Shirakawa, A. K., and Oppenheim, J. J. (2000) Blood 96(3), 840-845 300. Nomiyama, H., Hieshima, K., Nakayama, T., Sakaguchi, T., Fujisawa, R., Tanase, S., Nishiura, H., Matsuno, K., Takamori, H., Tabira, Y., Yamamoto, T., Miura, R., and Yoshie, O. (2001) Int Immunol 13(8), 1021-1029 301. Kuschert, G. S., Coulin, F., Power, C. A., Proudfoot, A. E., Hubbard, R. E., Hoogewerf, A. J., and Wells, T. N. (1999) Biochemistry 38(39), 12959-12968 302. Miao, Z., Premack, B. A., Wei, Z., Wang, Y., Gerard, C., Showell, H., Howard, M., Schall, T. J., and Berahovich, R. (2007) J Immunol 178(11), 7395-7404 303. Bliss, S. K., Marshall, A. J., Zhang, Y., and Denkers, E. Y. (1999) J Immunol 162(12), 7369-7375 304. Guzik, K., Bzowska, M., Smagur, J., Krupa, O., Sieprawska, M., Travis, J., and Potempa, J. (2007) Cell Death Differ 14(1), 171-182 305. Guzik, K., and Potempa, J. (2008) Biochimie 90(2), 405-415 306. Parente, L., and Solito, E. (2004) Inflamm Res 53(4), 125-132 307. Brown, G. D., and Nazarali, A. J. (2010) BMC Dev Biol 10(1), 93 308. Emingil, G., Kuula, H., Sorsa, T., and Atilla, G. (2006) J Periodontol 77(4), 664- 671 309. Kuula, H., Salo, T., Pirila, E., Hagstrom, J., Luomanen, M., Gutierrez- Fernandez, A., Romanos, G. E., and Sorsa, T. (2008) Arch Oral Biol 53(2), 175- 186 310. Wallard, M. J., Pennington, C. J., Veerakumarasivam, A., Burtt, G., Mills, I. G., Warren, A., Leung, H. Y., Murphy, G., Edwards, D. R., Neal, D. E., and Kelly, J. D. (2006) Br J Cancer 94(4), 569-577 311. Lopez-Otin, C., and Overall, C. M. (2002) Nat Rev Mol Cell Biol 3(7), 509-519 312. Impens, F., Colaert, N., Helsens, K., Plasman, K., Van Damme, P., Vandekerckhove, J., and Gevaert, K. (2010) Proteomics 10(6), 1284-1296 313. Butler, G. S., Dean, R. A., Tam, E. M., and Overall, C. M. (2008) Mol Cell Biol 28(15), 4896-4914 314. Gevaert, K., Goethals, M., Martens, L., Van Damme, J., Staes, A., Thomas, G. R., and Vandekerckhove, J. (2003) Nat Biotechnol 21(5), 566-569 315. Gray, D. C., Mahrus, S., and Wells, J. A. (2010) Cell 142(4), 637-646  160 316. McDonald, L., Robertson, D. H., Hurst, J. L., and Beynon, R. J. (2005) Nat Methods 2(12), 955-957 317. Van Damme, P., Staes, A., Bronsoms, S., Helsens, K., Colaert, N., Timmerman, E., Aviles, F. X., Vandekerckhove, J., and Gevaert, K. (2010) Nat Methods 7(7), 512-515 318. Kleifeld, O., Doucet, A., auf dem Keller, U., Prudova, A., Schilling, O., Kainthan, R. K., Starr, A. E., Foster, L. J., Kizhakkedathu, J. N., and Overall, C. M. (2010) Nat Biotechnol 28(3), 281-288 319. Prudova, A., auf dem Keller, U., Butler, G. S., and Overall, C. M. (2010) Mol Cell Proteomics 9(5), 894-911 320. Bigg, H. F., Morrison, C. J., Butler, G. S., Bogoyevitch, M. A., Wang, Z., Soloway, P. D., and Overall, C. M. (2001) Cancer Res 61(9), 3610-3618 321. auf dem Keller, U., Prudova, A., Gioia, M., Butler, G. S., and Overall, C. M. (2010) Mol Cell Proteomics 9(5), 912-927 322. Schilling, O., and Overall, C. M. (2008) Nat Biotechnol 26(6), 685-694 323. Colaert, N., Helsens, K., Martens, L., Vandekerckhove, J., and Gevaert, K. (2009) Nat Methods 6(11), 786-787 324. Deutsch, E. W., Mendoza, L., Shteynberg, D., Farrah, T., Lam, H., Tasman, N., Sun, Z., Nilsson, E., Pratt, B., Prazen, B., Eng, J. K., Martin, D. B., Nesvizhskii, A. I., and Aebersold, R. (2010) Proteomics 10(6), 1150-1159 325. Pedrioli, P. G. (2010) Methods Mol Biol 604, 213-238 326. Reinemer, P., Grams, F., Huber, R., Kleine, T., Schnierer, S., Piper, M., Tschesche, H., and Bode, W. (1994) FEBS Lett 338(2), 227-233 327. Schechter, I., and Berger, A. (1967) Biochem Biophys Res Commun 27(2), 157- 162 328. Moisan, E., and Girard, D. (2006) J Leukoc Biol 79(3), 489-498 329. Mor-Vaknin, N., Punturieri, A., Sitwala, K., and Markovitz, D. M. (2003) Nat Cell Biol 5(1), 59-63 330. Oppenheim, J. J., Dong, H. F., Plotz, P., Caspi, R. R., Dykstra, M., Pierce, S., Martin, R., Carlos, C., Finn, O., Koul, O., and Howard, O. M. (2005) J Leukoc Biol 77(6), 854-861 331. Coppock, H. A., White, A., Aplin, J. D., and Westwood, M. (2004) Biol Reprod 71(2), 438-443 332. Fowlkes, J. L., Suzuki, K., Nagase, H., and Thrailkill, K. M. (1994) Endocrinology 135(6), 2810-2813 333. Manes, S., Llorente, M., Lacalle, R. A., Gomez-Mouton, C., Kremer, L., Mira, E., and Martinez, A. C. (1999) J Biol Chem 274(11), 6935-6945 334. Miyamoto, S., Yano, K., Sugimoto, S., Ishii, G., Hasebe, T., Endoh, Y., Kodama, K., Goya, M., Chiba, T., and Ochiai, A. (2004) Cancer Res 64(2), 665- 671 335. Park, H. I., Turk, B. E., Gerkema, F. E., Cantley, L. C., and Sang, Q. X. (2002) J Biol Chem 277(38), 35168-35175 336. Sadowski, T., Dietrich, S., Koschinsky, F., and Sedlacek, R. (2003) Mol Biol Cell 14(11), 4569-4580 337. Wu, H. B., Lee, C. Y., and Rechler, M. M. (1999) Horm Metab Res 31(2-3), 186- 191 338. Sage, E. H., Reed, M., Funk, S. E., Truong, T., Steadele, M., Puolakkainen, P., Maurice, D. H., and Bassuk, J. A. (2003) J Biol Chem 278(39), 37849-37857 339. Sasaki, T., Miosge, N., and Timpl, R. (1999) Matrix Biol 18(5), 499-508  161 340. Fillmore, R. A., Nelson, S. E., Lausch, R. N., and Oakes, J. E. (2003) Invest Ophthalmol Vis Sci 44(8), 3432-3437 341. Wuyts, A., Struyf, S., Gijsbers, K., Schutyser, E., Put, W., Conings, R., Lenaerts, J. P., Geboes, K., Opdenakker, G., Menten, P., Proost, P., and Van Damme, J. (2003) Lab Invest 83(1), 23-34 342. Dunsmore, S. E., Saarialho-Kere, U. K., Roby, J. D., Wilson, C. L., Matrisian, L. M., Welgus, H. G., and Parks, W. C. (1998) J Clin Invest 102(7), 1321-1331 343. Van den Steen, P. E., Husson, S. J., Proost, P., Van Damme, J., and Opdenakker, G. (2003) Biochem Biophys Res Commun 310(3), 889-896 344. Firth, S. M., and Baxter, R. C. (2002) Endocr Rev 23(6), 824-854 345. Pollak, M. (2008) Nat Rev Cancer 8(12), 915-928 346. Clemmons, D. R., Sleevi, M., Allan, G., and Sommer, A. (2007) J Clin Endocrinol Metab 92(7), 2652-2658 347. Liu, X. J., Malkowski, M., Guo, Y., Erickson, G. F., Shimasaki, S., and Ling, N. (1993) Endocrinology 132(3), 1176-1183 348. Almkvist, J., and Karlsson, A. (2004) Glycoconj J 19(7-9), 575-581 349. Chlenski, A., and Cohn, S. L. (2010) Semin Cell Dev Biol 21(1), 55-65 350. Malik, R. K., Ghurye, R. R., Lawrence-Watt, D. J., and Stewart, H. J. (2009) Glycobiology 19(12), 1402-1407 351. Dejica, V. M., Mort, J. S., Laverty, S., Percival, M. D., Antoniou, J., Zukor, D. J., and Poole, A. R. (2008) Am J Pathol 173(1), 161-169 352. Levy, E., Lopez-Otin, C., Ghiso, J., Geltner, D., and Frangione, B. (1989) J Exp Med 169(5), 1771-1778 353. Zurdel, J., Finckh, U., Menzer, G., Nitsch, R. M., and Richard, G. (2002) Br J Ophthalmol 86(2), 214-219 354. Hedrich, J., Lottaz, D., Meyer, K., Yiallouros, I., Jahnen-Dechent, W., Stocker, W., and Becker-Pauly, C. (2010) Biochemistry 355. Cauwe, B., and Opdenakker, G. (2010) Crit Rev Biochem Mol Biol 45(5), 351- 423 356. Doucet, A., Butler, G. S., Rodriguez, D., Prudova, A., and Overall, C. M. (2008) Mol Cell Proteomics 7(10), 1925-1951 357. Butler, G. S., Dean, R. A., Smith, D., and Overall, C. M. (2009) Methods Mol Biol 528, 159-176 358. Butler, G. S., and Overall, C. M. (2007) Curr Pharm Des 13(3), 263-270 359. Bateman, A., and Bennett, H. P. (1998) J Endocrinol 158(2), 145-151 360. Tam, E. M., Morrison, C. J., Wu, Y. I., Stack, M. S., and Overall, C. M. (2004) Proc Natl Acad Sci U S A 101(18), 6917-6922 361. Zhang, B., Cunningham, M. A., Nichols, W. C., Bernat, J. A., Seligsohn, U., Pipe, S. W., McVey, J. H., Schulte-Overberg, U., de Bosch, N. B., Ruiz-Saez, A., White, G. C., Tuddenham, E. G., Kaufman, R. J., and Ginsburg, D. (2003) Nat Genet 34(2), 220-225 362. Zheng, C., Liu, H. H., Yuan, S., Zhou, J., and Zhang, B. (2008) Blood 363. Yu, J., Abagyan, R., Dong, S., Gilbert, A., Nussenzweig, V., and Tomlinson, S. (1997) J Exp Med 185(4), 745-753 364. Yu, J., Dong, S., Rushmere, N. K., Morgan, B. P., Abagyan, R., and Tomlinson, S. (1997) Biochemistry 36(31), 9423-9428 365. Zhao, X. J., Zhao, J., Zhou, Q., and Sims, P. J. (1998) J Biol Chem 273(17), 10665-10671  162 366. Sherry, B., Yarlett, N., Strupp, A., and Cerami, A. (1992) Proc Natl Acad Sci U S A 89(8), 3511-3515 367. Butler, G. S., and Overall, C. M. (2009) Biochemistry 48(46), 10830-10845 368. Ip, Y. C., Cheung, S. T., and Fan, S. T. (2007) Mol Carcinog 46(3), 225-230 369. Kwan, J. A., Schulze, C. J., Wang, W., Leon, H., Sariahmetoglu, M., Sung, M., Sawicka, J., Sims, D. E., Sawicki, G., and Schulz, R. (2004) Faseb J 18(6), 690-692 370. Si-Tayeb, K., Monvoisin, A., Mazzocco, C., Lepreux, S., Decossas, M., Cubel, G., Taras, D., Blanc, J. F., Robinson, D. R., and Rosenbaum, J. (2006) Am J Pathol 169(4), 1390-1401 371. Eguchi, T., Kubota, S., Kawata, K., Mukudai, Y., Uehara, J., Ohgawara, T., Ibaragi, S., Sasaki, A., Kuboki, T., and Takigawa, M. (2008) Mol Cell Biol 28(7), 2391-2413 372. Golubkov, V. S., Boyd, S., Savinov, A. Y., Chekanov, A. V., Osterman, A. L., Remacle, A., Rozanov, D. V., Doxsey, S. J., and Strongin, A. Y. (2005) J Biol Chem 280(26), 25079-25086 373. Schulz, R. (2007) Annu Rev Pharmacol Toxicol 47, 211-242 374. Ponath, P. D., Qin, S., Ringler, D. J., Clark-Lewis, I., Wang, J., Kassam, N., Smith, H., Shi, X., Gonzalo, J. A., Newman, W., Gutierrez-Ramos, J. C., and Mackay, C. R. (1996) J Clin Invest 97(3), 604-612 375. Savino, B., Borroni, E. M., Torres, N. M., Proost, P., Struyf, S., Mortier, A., Mantovani, A., Locati, M., and Bonecchi, R. (2009) J Biol Chem 284(38), 26207-26215 376. Sharma, M. (2010) Crit Rev Biotechnol 30(1), 1-22 377. Haringman, J. J., Smeets, T. J., Reinders-Blankert, P., and Tak, P. P. (2006) Ann Rheum Dis 65(3), 294-300 378. Huttenhain, R., Malmstrom, J., Picotti, P., and Aebersold, R. (2009) Curr Opin Chem Biol 13(5-6), 518-525 379. Li, W., Li, J., Wu, Y., Wu, J., Hotchandani, R., Cunningham, K., McFadyen, I., Bard, J., Morgan, P., Schlerman, F., Xu, X., Tam, S., Goldman, S. J., Williams, C., Sypek, J., and Mansour, T. S. (2009) J Med Chem 52(7), 1799-1802 380. Devel, L., Garcia, S., Czarny, B., Beau, F., Lajeunesse, E., Vera, L., Georgiadis, D., Stura, E., and Dive, V. (2010) J Biol Chem 381. Norman, P. (2009) Expert Opin Ther Pat 19(7), 1029-1034 382. Ochieng, J., Fridman, R., Nangia-Makker, P., Kleiner, D. E., Liotta, L. A., Stetler-Stevenson, W. G., and Raz, A. (1994) Biochemistry 33(47), 14109- 14114 383. Ochieng, J., Green, B., Evans, S., James, O., and Warfield, P. (1998) Biochim Biophys Acta 1379(1), 97-106 384. Thijssen, V. L., Barkan, B., Shoji, H., Aries, I. M., Mathieu, V., Deltour, L., Hackeng, T. M., Kiss, R., Kloog, Y., Poirier, F., and Griffioen, A. W. (2010) Cancer Res 70(15), 6216-6224 385. Rubinstein, N., Alvarez, M., Zwirner, N. W., Toscano, M. A., Ilarregui, J. M., Bravo, A., Mordoh, J., Fainboim, L., Podhajcer, O. L., and Rabinovich, G. A. (2004) Cancer Cell 5(3), 241-251 386. Cooper, D., Norling, L. V., and Perretti, M. (2008) J Leukoc Biol 83(6), 1459- 1466 387. Norling, L. V., Sampaio, A. L., Cooper, D., and Perretti, M. (2008) Faseb J 22(3), 682-690  163 388. Rabinovich, G. A., Sotomayor, C. E., Riera, C. M., Bianco, I., and Correa, S. G. (2000) Eur J Immunol 30(5), 1331-1339 389. Moisan, E., Chiasson, S., and Girard, D. (2007) Clin Exp Immunol 150(1), 158- 168 390. Eckes, B., Colucci-Guyon, E., Smola, H., Nodder, S., Babinet, C., Krieg, T., and Martin, P. (2000) J Cell Sci 113 ( Pt 13), 2455-2462 391. Cox, J. H., Starr, A. E., Kapplehoff, R., Yan, R., Roberts, C. R., and Overall, C. M. (2010) Arthritis Rheum 62    164 APPENDIX A: PEPTIDES IDENTIFIED IN HFL SECRETOME ANALYSIS Appendix A.1 Peptides identified by iTRAQ-TAILS in Exp1xExp2. Combined list of Mascot and X!Tandem entries, sorted by peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 114) or sMT6EΔA (iTRAQ 115) treated secretome. iTRAQ ratios represent uncorrected values; peptides used for normalization are highlighted with yellow. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. # Prob z Precursor Mass Error [Da] N-term Peptide iTRAQ 114/ iTRAQ 115 IPI# 1 1.00 3 1774.9877 0.046 iTRAQ n[145.11]ADANLEAGNVK[272.20]ETR 0.70 IPI00328113 2 0.98 2 1089.5605 0.0069 iTRAQ n[145.11]ADLSEAANR 1.06 IPI00418471 3 0.98 2 1319.5791 0.008 iTRAQ n[145.11]AEGPDEDSSNR 0.96 IPI00009904 4 0.97 2 1245.611 0.0039 iTRAQ n[145.11]AEQNDSVSPR 0.86 IPI00005564 5 1.00 3 2048.1435 0.0936 iTRAQ n[145.11]AGAAAGGPGVSGVC[160.03]VC[160.03]K[272.20]SR 1.27 IPI00016915 6 0.99 2 1119.535 -0.0081 iTRAQ n[145.11]AGFAGDDAPR 1.16 IPI00008603 7 0.94 2 1214.5412 -0.0601 iTRAQ n[145.11]APDQDEIQR 0.80 IPI00021794 8 0.99 10 1360.6693 -0.064 iTRAQ n[145.11]APPAAGQQQPPR 0.89 IPI00002802 9 1.00 3 2631.2742 0.0195 iTRAQ n[145.11]AQEPTGNNAEIC[160.03]LLPLDYGPC[160.03]R 0.87 IPI00009198 10 1.00 2 1324.5832 -0.0665 iTRAQ n[145.11]ASEGGFTATGQR 0.67 IPI00003351 11 0.98 2 1208.635 0.0079 iTRAQ n[145.11]ASSPGGVYATR 0.96 IPI00418471 12 0.90 2 1088.6363 -0.0104 iTRAQ n[145.11]AVFPSIVGR 1.93 IPI00008603 13 0.94 2 1250.6166 -0.0033 iTRAQ n[145.11]AVYLPNC[160.03]DR 2.58 IPI00029236 14 1.00 2 1523.7077 -0.066 iTRAQ n[145.11]DAGEFVDLYVPR 0.76 IPI00017448 15 1.00 3 1664.7441 -0.105 iTRAQ n[145.11]DAPEEEDHVLVLR 1.02 IPI00010796 16 0.97 3 1340.5895 -0.0336 iTRAQ n[145.11]DAPQDFHPDR 0.76 IPI00302592 17 0.85 2 931.4782 -0.0063 iTRAQ n[145.11]DDANVVR 0.98 IPI00297646 18 1.00 3 2265.1457 0.0605 iTRAQ n[145.11]DDEVDVDGTVEEDLGK[272.20]SR 0.76 IPI00027230 19 1.00 3 1503.8389 0.0473 iTRAQ n[145.11]DGVGGDPAVALPHR 0.98 IPI00026530 20 0.97 2 1197.6032 -0.0629 iTRAQ n[145.11]DIPAMLPAAR 0.62 IPI00329688 21 0.96 2 1362.6771 0.02 iTRAQ n[145.11]DLEPGTMDSVR 1.10 IPI00007752 22 0.99 2 1428.699 -0.0592 iTRAQ n[145.11]DLEPTVIDEVR 0.82 IPI00166768 23 0.94 3 1658.6747 -0.088 iTRAQ n[145.11]DVLLEAC[160.03]C[160.03]ADGHR 1.15 IPI00218803 24 0.99 2 1343.5743 -0.0694 iTRAQ n[145.11]EAGEQGDIEPR 0.88 IPI00012442 25 1.00 2 1506.7115 -0.0842 iTRAQ n[145.11]EFQTNLVPYPR 1.11 IPI00007750  165 # Prob z Precursor Mass Error [Da] N-term Peptide iTRAQ 114/ iTRAQ 115 IPI# 26 0.99 2 1362.7232 0.0219 iTRAQ n[145.11]EGNFDAIANIR 7.28 IPI00014758 27 1.00 3 2296.0773 0.0436 iTRAQ n[145.11]FEGLQAEEC[160.03]GILNGC[160.03]ENGR 1.04 IPI00292150 28 1.00 2 1497.6704 -0.0633 iTRAQ n[145.11]FQSDIGPYQSGR 0.84 IPI00749245 29 0.99 3 2014.0746 0.0019 iTRAQ n[145.11]FSLADAINTEFK[272.20]NTR 0.76 IPI00418471 30 1.00 3 1398.7356 0.023 iTRAQ n[145.11]FVGGAENTAHPR 0.63 IPI00029236 31 1.00 3 2207.0958 -0.0695 iTRAQ n[145.11]FYTK[272.20]PPQC[160.03]VDIPADLR 1.08 IPI00749245 32 0.99 2 1237.6386 -0.0881 iTRAQ n[145.11]GAPGILGLPGSR 1.23 IPI00304962 33 0.99 2 1213.6913 0.0013 iTRAQ n[145.11]GASSAGLGPVVR 0.89 IPI00018305 34 0.99 2 1048.4493 -0.0564 iTRAQ n[145.11]GFAGDDAPR 0.56 IPI00008603 35 0.99 2 1391.7565 0.0286 iTRAQ n[145.11]GPPGLAGPPGESGR 8.94 IPI00297646 36 1.00 2 1457.7211 -0.0386 iTRAQ n[145.11]GVQVETISPGDGR 0.91 IPI00413778 37 0.98 2 1168.7094 0.0044 iTRAQ n[145.11]IGGIGTVPVGR 0.76 IPI00014424 38 0.87 2 1162.591 -0.0042 iTRAQ n[145.11]ISSPTETER 1.12 IPI00013895 39 1.00 10 1670.9223 0.0127 iTRAQ n[145.11]K[272.20]FVGGAENTAHPR 0.55 IPI00029236 40 0.99 3 1601.9943 0.0347 iTRAQ n[145.11]K[272.20]LVIIESDLER 0.91 IPI00000230 41 0.94 3 1779.9023 -0.07 iTRAQ n[145.11]LADAINTEFK[272.20]NTR 1.35 IPI00418471 42 0.99 2 1373.7478 0.0206 iTRAQ n[145.11]LGSDAELQIER 0.82 IPI00182126 43 0.85 2 1019.4965 -0.0557 iTRAQ n[145.11]LPASFDAR 0.92 IPI00295741 44 1.00 10 1962.7976 -0.1031 iTRAQ n[145.11]LQAEEC[160.03]GILNGC[160.03]ENGR 0.91 IPI00220249 45 0.97 3 1938.0001 0.0424 iTRAQ n[145.11]LRPGDC[160.03]EVC[160.03]ISYLGR 0.97 IPI00328748 46 0.94 3 1610.9928 0.0581 iTRAQ n[145.11]LTEAPLNPK[272.20]ANR 9.67 IPI00008603 47 1.00 2 1803.8284 -0.0513 iTRAQ n[145.11]LVGGPMDASVEEEGVR 23.20 IPI00032293 48 0.98 3 1960.0246 0.044 iTRAQ n[145.11]LVGGPMDASVEEEGVRR 4.81 IPI00032293 49 0.97 2 1313.6862 -0.0814 iTRAQ n[145.11]LVILEGELER 3.09 IPI00010779 50 0.99 2 1611.8739 0.0134 iTRAQ n[145.11]MPPYTVVYFPVR 0.76 IPI00219757 51 1.00 3 2241.2008 0.0131 iTRAQ n[145.11]PGGLLLGDVAPNFEANTTVGR 0.86 IPI00220301 52 0.95 2 1480.7433 -0.0767 iTRAQ n[145.11]PPYTVVYFPVR 0.89 IPI00219757 53 1.00 2 1466.6345 -0.0782 iTRAQ n[145.11]SAGDVDTLAFDGR 0.93 IPI00374563 54 0.99 2 1257.5589 -0.0668 iTRAQ n[145.11]SAPLAAGC[160.03]PDR 0.83 IPI00003176 55 0.99 2 1714.8958 0.0276 iTRAQ n[145.11]SDMPPLTLEGIQDR 0.92 IPI00022442 56 1.00 2 1782.7434 -0.0963 iTRAQ n[145.11]SDVLELTDDNFESR 0.93 IPI00025252 57 1.00 3 1595.899 0.0479 iTRAQ n[145.11]SK[272.20]FADLSEAANR 0.98 IPI00418471 58 1.00 3 1867.0747 0.0704 iTRAQ n[145.11]SLADAINTEFK[272.20]NTR 1.78 IPI00418471 59 0.99 2 1619.9115 0.0362 iTRAQ n[145.11]SLLSLGSQYQPQR 0.67 IPI00002802  166 # Prob z Precursor Mass Error [Da] N-term Peptide iTRAQ 114/ iTRAQ 115 IPI# 60 1.00 2 1914.9535 -0.0597 iTRAQ n[145.11]SLNNQIETLLTPEGSR 4.06 IPI00304962 61 0.90 2 1026.4892 -0.0688 iTRAQ n[145.11]SLPEAGPGR 0.82 IPI00017968 62 1.00 3 1522.8515 0.029 iTRAQ n[145.11]SPALTIENEHIR 1.07 IPI00012989 63 0.97 2 1219.5808 -0.0109 iTRAQ n[145.11]SQDASDGLQR 0.93 IPI00009276 64 0.94 2 1137.5298 -0.0602 iTRAQ n[145.11]SSPGGVYATR 0.50 IPI00418471 65 0.97 3 1615.8491 0.0164 iTRAQ n[145.11]STVIHYEIPEER 0.65 IPI00001872 66 0.99 2 1934.0204 0.0337 iTRAQ n[145.11]SYELPDGQVITIGNER 1.03 IPI00003269 67 0.99 3 1671.8865 -0.0902 iTRAQ n[145.11]VDVSK[272.20]PDLTAALR 0.88 IPI00418471 68 0.99 2 973.5266 -0.0161 iTRAQ n[145.11]VGAAGATGAR 2.02 IPI00304962 69 1.00 2 1680.7951 -0.0676 iTRAQ n[145.11]VLSGGTTMYPGIADR 3.83 IPI00008603 70 0.97 2 1234.6085 -0.0707 iTRAQ n[145.11]VNFTVDQIR 0.89 IPI00186290 71 0.96 2 1286.6425 -0.072 iTRAQ n[145.11]YTVVYFPVR 1.22 IPI00219757 72 1.00 2 1328.6829 -0.0705 Ac-lysine n[43.02]AATTGSGVK[272.20]VPR 1.00 IPI00472498 73 0.97 2 1231.7108 -0.0669 Ac-lysine n[43.02]AAYK[272.20]LVLIR 0.91 IPI00374975 74 1.00 2 1750.759 -0.0537 Ac-lysine n[43.02]ADK[272.20]EAAFDDAVEER 0.88 IPI00328319 75 0.94 2 1343.7946 0.0052 Ac-lysine n[43.02]AGITTIEAVK[272.20]R 0.76 IPI00218319 76 0.99 2 1342.7025 -0.0665 Ac-lysine n[43.02]AGLNSLEAVK[272.20]R 0.83 IPI00010779 77 0.98 3 2272.1472 0.0345 Ac-lysine n[43.02]ALDGPEQMELEEGK[272.20]AGSGLR 1.58 IPI00023919 78 0.94 2 1352.6585 -0.0043 Ac-lysine n[43.02]ANK[272.20]GPSYGMSR 0.57 IPI00216138 79 0.87 3 2188.0652 0.0105 Ac n[43.02]ARSASAAAMGVQVETISPGDGR na IPI00413778 80 0.99 3 1831.9619 -0.0628 Ac-lysine n[43.02]ASSDIQVK[272.20]ELEK[272.20]R 0.71 IPI00479997 81 0.87 2 1389.751 -0.0075 Ac-lysine n[43.02]ATDELATK[272.20]LSR 1.01 IPI00060181 82 0.93 2 1198.7136 -0.002 Ac-lysine n[43.02]AVSTGVK[272.20]VPR 0.82 IPI00019600 83 0.98 3 2938.2397 -0.08 Ac-lysine n[43.02]DDDIAALVVDNGSGMC[160.03]K[272.20]AGFAGDDAPR 0.86 IPI00021439 84 0.83 3 2994.4559 0.0742 Ac-lysine n[43.02]EEEIAALVIDNGSGMC[160.03]K[272.20]AGFAGDDAPR 0.80 IPI00021440 85 0.99 2 1630.808 -0.0637 Ac-lysine n[43.02]MEK[272.20]TLETVPLER 0.87 IPI00396378 86 0.95 2 1134.6073 -0.0042 Ac-lysine n[43.02]SK[272.20]NTVSSAR 0.70 IPI00007280 87 0.99 2 1678.8586 0.0302 Ac-lysine n[43.02]SQAEFEK[272.20]AAEEVR 0.91 IPI00010182 88 0.86 2 1429.652 0.032 Ac-lysine n[43.02]SSNEC[160.03]FK[272.20]C[160.03]GR 0.91 IPI00430813 89 0.98 2 1569.9127 0.0279 Ac-lysine n[43.02]VDVSK[272.20]PDLTAALR 0.82 IPI00418471    167 Appendix A.1 Peptides identified by iTRAQ-TAILS in Exp1. Combined list of Mascot and X!Tandem entries, sorted by peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 114) or sMT6EΔA (iTRAQ 115) treated secretome. iTRAQ ratios represent uncorrected values; peptides used for normalization are highlighted with yellow. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated.  # Prob. z Precursor Mass Error [Da] N-term Peptide iTRAQ 114/ iTRAQ 115 IPI # 1 0.99 3 1797.0499 0.0648 iTRAQ n[145.11]AAK[272.20]FDGILGMAYPR 1.28 IPI00011229 2 0.91 3 1758.0221 0.0593 iTRAQ n[145.11]AAQTSPSPK[272.20]AGAATGR 0.83 IPI00303476 3 0.89 2 1254.767 0.0253 iTRAQ n[145.11]AATLILEPAGR 0.96 IPI00220906 4 0.94 2 1093.5718 -0.0169 iTRAQ n[145.11]AAYEEVIR 1.12 IPI00003406 5 0.91 3 1666.9326 0.0444 iTRAQ n[145.11]ADAINTEFK[272.20]NTR 1.07 IPI00418471 6 0.97 2 1931.8637 -0.0766 iTRAQ n[145.11]ADGFYGDAVTAK[272.20]NC[160.03]R 0.85 IPI00375294 7 0.92 4 2539.4065 0.0934 iTRAQ n[145.11]AEEAK[272.20]TFDQLTPEESK[272.20]ER 0.96 IPI00014537 8 0.90 2 1199.5294 -0.0069 iTRAQ n[145.11]AEFSSEAC[160.03]R 0.97 IPI00030877 9 0.91 2 1081.5782 -0.0107 iTRAQ n[145.11]AELSYSLR 0.96 IPI00298793 10 0.99 2 1770.9684 0.0298 iTRAQ n[145.11]AEQQVPLVLWSSDR 0.81 IPI00552748 11 0.97 3 2312.3004 0.0817 iTRAQ n[145.11]AFK[272.20]QMEQISQFLQAAER 1.27 IPI00550363 12 0.98 2 1408.7693 0.022 iTRAQ n[145.11]AGEFVDLYVPR 1.20 IPI00017448 13 0.99 2 1594.7997 0.0176 iTRAQ n[145.11]AGEPGEPGQTGPAGAR 0.86 IPI00304962 14 1.00 3 2544.2327 -0.042 iTRAQ n[145.11]AGHPSLK[272.20]QDAC[160.03]QGDSGGVFAVR 1.16 IPI00296165 15 0.96 3 2276.1764 -0.0029 iTRAQ n[145.11]AHYNTEILK[272.20]SIDNEWR 1.34 IPI00028076 16 0.88 2 1345.7106 0.0147 iTRAQ n[145.11]AILEDEQTQR 0.83 IPI00215743 17 0.89 3 1480.8309 0.0068 iTRAQ n[145.11]AINTEFK[272.20]NTR 0.57 IPI00418471 18 0.95 3 2145.2505 0.0355 iTRAQ n[145.11]AIVFIK[272.20]QPSSQDALQGR 0.66 IPI00168813 19 0.92 3 1504.8758 0.0301 iTRAQ n[145.11]ALK[272.20]GTNESLER 0.83 IPI00418471 20 0.99 2 1516.7525 0.0286 iTRAQ n[145.11]ALQQQADEAEDR 0.60 IPI00010779 21 1.00 3 1856.0639 0.0602 iTRAQ n[145.11]ASGANFEYIIAEK[272.20]R 0.75 IPI00024993 22 0.99 2 1652.9418 0.0563 iTRAQ n[145.11]ASPAGGPLEDVVIER 0.71 IPI00303300 23 0.94 2 989.5478 -0.0149 iTRAQ n[145.11]ASVATELR 0.87 IPI00013874 24 0.96 2 1753.8731 0.0369 iTRAQ n[145.11]ASVPTTC[160.03]C[160.03]FNLANR 0.93 IPI00019945 25 0.92 2 1129.6684 0.0107 iTRAQ n[145.11]AVLSAEQLR 0.93 IPI00032140 26 1.00 3 2692.3416 -0.0371 iTRAQ n[145.11]AVTVETSDHDNSLSVSIPQPSPLR 0.75 IPI00027377 27 0.98 3 1595.9039 0.0532 iTRAQ n[145.11]DAINTEFK[272.20]NTR 0.85 IPI00418471 28 0.99 3 1981.1147 0.0271 iTRAQ n[145.11]DAPSWDPVALK[272.20]LPER 0.98 IPI00329482 29 0.91 2 1125.5266 0.0093 iTRAQ n[145.11]DASGTNDFR 0.90 IPI00016112 30 1.00 3 2536.3792 0.0527 iTRAQ n[145.11]DDLVTVK[272.20]TPAFAESVTEGDVR 0.58 IPI00384016 31 0.99 4 2199.1601 0.0945 iTRAQ n[145.11]DEAIHC[160.03]PPC[160.03]SEEK[272.20]LAR 0.88 IPI00305380 32 0.95 2 1159.6308 -0.0011 iTRAQ n[145.11]DEATALQLR 0.87 IPI00014898 33 0.98 3 1580.8435 0.0155 iTRAQ n[145.11]DEEVHAGLGELLR 1.18 IPI00032140 34 0.92 2 1212.5675 0.0108 iTRAQ n[145.11]DGEFSMDLR 1.11 IPI00216691  168 # Prob. z Precursor Mass Error [Da] N-term Peptide iTRAQ 114/ iTRAQ 115 IPI # 35 0.96 2 1660.7877 0.0386 iTRAQ n[145.11]DLDGSEDWVYYR 0.83 IPI00036578 36 0.83 2 1018.5128 -0.0037 iTRAQ n[145.11]DLSEAANR 0.93 IPI00418471 37 0.96 3 1589.8614 0.0361 iTRAQ n[145.11]DNADSSPVVDK[272.20]R 0.69 IPI00328753 38 0.98 2 1411.6715 0.0192 iTRAQ n[145.11]DNEAIYDIC[160.03]R 0.96 IPI00007750 39 0.96 2 1574.8468 0.0082 iTRAQ n[145.11]DQALEALSASLGTR 0.89 IPI00220857 40 1.00 3 2161.148 0.0223 iTRAQ n[145.11]DQDFYSLLGVSK[272.20]TASSR 0.92 IPI00293260 41 1.00 3 1768.048 0.0506 iTRAQ n[145.11]DSK[272.20]LTFDAITTIR 0.64 IPI00008561 42 0.93 3 1665.9548 0.0621 iTRAQ n[145.11]DSK[272.20]VFGDLDQVR 0.94 IPI00184375 43 1.00 3 2430.3027 0.0756 iTRAQ n[145.11]DSVDFSLADAINTEFK[272.20]NTR 0.88 IPI00418471 44 0.95 2 1045.6097 0.0207 iTRAQ n[145.11]DSVLDVVR 1.01 IPI00007752 45 0.99 3 1641.8732 0.0535 iTRAQ n[145.11]DSYVGDEAQSK[272.20]R 0.87 IPI00008603 46 0.86 2 1336.6954 0.0097 iTRAQ n[145.11]EANAPGPVPGER 0.96 IPI00301144 47 0.96 2 1368.6814 0.0167 iTRAQ n[145.11]EATTEFSVDAR 1.00 IPI00302592 48 0.94 2 1272.6151 0.0261 iTRAQ n[145.11]EDC[160.03]NELPPR 0.81 IPI00029739 49 0.96 2 1496.7031 0.0279 iTRAQ n[145.11]EDDETIPSEYR 0.69 IPI00220857 50 0.96 2 1466.7117 -0.0006 iTRAQ n[145.11]EEAENTLQSFR 0.96 IPI00418471 51 1.00 2 1382.7015 0.0393 iTRAQ n[145.11]EEATLNEMFR 1.27 IPI00002714 52 1.00 3 2619.0719 -0.0524 iTRAQ n[145.11]EEGQC[160.03]VC[160.03]DEGFAGVDC[160.03]SEK[272.20]R 1.01 IPI00867560 53 0.90 2 1398.7158 0.0301 iTRAQ n[145.11]EEQPPETAAQR 0.72 IPI00386755 54 0.91 4 2060.1943 0.1108 iTRAQ n[145.11]EK[272.20]IWHHTFYNELR 0.81 IPI00021428 55 0.98 3 1624.8857 0.038 iTRAQ n[145.11]ELQQAVLHMEQR 0.91 IPI00295542 56 0.98 2 1699.9386 0.0371 iTRAQ n[145.11]EQQVPLVLWSSDR 0.72 IPI00552748 57 0.99 2 1507.8143 0.0292 iTRAQ n[145.11]ESETTTSLVLER 0.95 IPI00029744 58 0.98 2 1361.7215 0.0154 iTRAQ n[145.11]ESPAVAAPAYSR 0.74 IPI00025512 59 0.85 3 1848.0448 0.0616 iTRAQ n[145.11]EVDALK[272.20]GTNESLER 0.78 IPI00418471 60 0.96 2 991.4714 -0.0131 iTRAQ n[145.11]FAGDDAPR 1.10 IPI00008603 61 0.94 2 1139.5453 0.0126 iTRAQ n[145.11]FDSDAASQR 0.88 IPI00472013 62 0.92 4 2659.2664 -0.0352 iTRAQ n[145.11]FEK[272.20]NEAIQAAHDAVAQEGQC[160.03]R 1.04 IPI00018352 63 0.94 2 1396.6584 0.0243 iTRAQ n[145.11]FGSDQSENVDR 0.75 IPI00258804 64 0.85 4 2325.2831 -0.0339 iTRAQ n[145.11]FK[272.20]DTGK[272.20]APVEPEVAIHR 0.58 IPI00176655 65 0.97 3 1828.9918 0.0571 iTRAQ n[145.11]FYQGPVGDPDK[272.20]YR 7.65 IPI00014758 66 0.98 3 1677.8374 0.0319 iTRAQ n[145.11]GAFEGTHMGPFVER 0.77 IPI00100980 67 0.98 2 1238.7319 0.0212 iTRAQ n[145.11]GAPEVLVSAPR 0.85 IPI00143921 68 1.00 2 1483.7193 0.0419 iTRAQ n[145.11]GDPGEAGPQGDQGR 1.51 IPI00291136 69 0.97 4 1934.9834 0.0163 iTRAQ n[145.11]GDTYFFK[272.20]GAHYWR 15.22 IPI00014758 70 0.99 2 1462.7941 0.0294 iTRAQ n[145.11]GEAGSAGPPGPPGLR 1.31 IPI00304962 71 0.98 2 1469.6609 -0.0122 iTRAQ n[145.11]GEDC[160.03]LWYLDR 0.96 IPI00514190 72 0.99 2 1337.7341 0.0244 iTRAQ n[145.11]GEFVDLYVPR 0.74 IPI00017448 73 0.96 2 1240.6523 0.0241 iTRAQ n[145.11]GEPGQTGPAGAR 0.57 IPI00304962 74 0.94 3 1788.0879 0.0589 iTRAQ n[145.11]GFPGTPGLPGFK[272.20]GIR 0.74 IPI00304962 75 0.91 2 1381.6981 0.0199 iTRAQ n[145.11]GGTTMYPGIADR 1.23 IPI00008603 76 0.96 2 1394.8031 0.0279 iTRAQ n[145.11]GIPGPVGAAGATGAR 0.77 IPI00304962 77 0.99 3 1671.9502 0.0315 iTRAQ n[145.11]GK[272.20]DYYQTLGLAR 0.79 IPI00015947 78 1.00 3 1859.0205 0.0182 iTRAQ n[145.11]GLGLSYLSSHIANVER 1.30 IPI00026314  169 # Prob. z Precursor Mass Error [Da] N-term Peptide iTRAQ 114/ iTRAQ 115 IPI # 79 0.99 2 1384.6188 0.0141 iTRAQ n[145.11]GMEEGEFSEAR 1.27 IPI00007750 80 0.97 2 1317.7038 -0.0129 iTRAQ n[145.11]GNPITIFQER 0.92 IPI00219018 81 0.94 3 1650.9688 0.0391 iTRAQ n[145.11]GNSTAIQELFK[272.20]R 1.10 IPI00007752 82 0.99 2 1365.6409 0.0279 iTRAQ n[145.11]GSTAEDEEQTR 0.80 IPI00180404 83 0.98 2 1258.5391 0.0055 iTRAQ n[145.11]GYGNDGFDDR 1.09 IPI00013877 84 0.90 2 1275.6142 -0.0075 iTRAQ n[145.11]GYSFTTTAER 1.20 IPI00021439 85 1.00 3 1437.7421 0.0298 iTRAQ n[145.11]HWPSEPSEAVR 0.69 IPI00028911 86 1.00 3 2156.0091 0.07 iTRAQ n[145.11]HWYVGEGMEEGEFSEAR 0.76 IPI00007750 87 0.90 2 1053.6618 -0.005 iTRAQ n[145.11]IALDLLPR 0.83 IPI00470607 88 0.91 2 1303.7144 -0.0223 iTRAQ n[145.11]IEGAGNFLAIR 0.85 IPI00036578 89 0.90 3 2206.1322 0.1715 iTRAQ n[145.11]ISGGMGSMNSVTGGMGMGLDR 0.89 IPI00555833 90 0.99 3 1709.9516 0.0579 iTRAQ n[145.11]ITGK[272.20]EDAANNYAR 1.14 IPI00007750 91 0.95 2 1216.6345 -0.0017 iTRAQ n[145.11]IYSSFGFPR 6.44 IPI00008561 92 1.00 3 1391.7772 0.0375 iTRAQ n[145.11]K[272.20]AGFAGDDAPR 1.17 IPI00008603 93 0.97 3 1586.0061 0.0415 iTRAQ n[145.11]K[272.20]LVILEGELER 0.78 IPI00010779 94 0.97 3 1790.063 0.0336 iTRAQ n[145.11]K[272.20]QDIVFDGIAQIR 0.84 IPI00027780 95 1.00 3 2061.1567 0.0435 iTRAQ n[145.11]K[272.20]SPQELLC[160.03]GASLISDR 1.00 IPI00019568 96 0.93 3 2206.2426 0.0589 iTRAQ n[145.11]K[272.20]SYELPDGQVITIGNER 0.85 IPI00008603 97 1.00 3 2041.1721 0.0786 iTRAQ n[145.11]K[272.20]VEQAVETEPEPELR 1.01 IPI00021842 98 0.99 2 1462.7947 0.0158 iTRAQ n[145.11]LDSELTEFPLR 0.56 IPI00014572 99 0.96 2 1327.6581 0.0051 iTRAQ n[145.11]LEAAYEFADR 4.39 IPI00008561 100 0.99 2 1350.8027 -0.0078 iTRAQ n[145.11]LGAPGILGLPGSR 1.12 IPI00304962 101 0.85 3 2239.1765 0.0308 iTRAQ n[145.11]LGRPSEEDEELVVPELER 0.80 IPI00005908 102 1.00 3 1823.0475 0.0694 iTRAQ n[145.11]LITGK[272.20]EDAANNYAR 5.70 IPI00007750 103 0.97 4 2425.1005 -0.0328 iTRAQ n[145.11]LK[272.20]C[160.03]LYHTEGEHC[160.03]QFC[160.03]R 0.90 IPI00013976 104 0.84 2 1199.6199 -0.0221 iTRAQ n[145.11]LLDPAAWDR 4.89 IPI00010800 105 0.98 2 1463.9151 0.0205 iTRAQ n[145.11]LLGAPGILGLPGSR 1.19 IPI00304962 106 0.98 2 1532.8693 0.026 iTRAQ n[145.11]LLSLGSQYQPQR 4.19 IPI00002802 107 0.98 2 1257.7433 0.0084 iTRAQ n[145.11]LMNLGGLAVAR 1.13 IPI00550363 108 0.96 2 1879.9943 -0.0603 iTRAQ n[145.11]LPVC[160.03]GK[272.20]PVNPVEQR 0.87 IPI00296165 109 1.00 2 1581.8121 0.0174 iTRAQ n[145.11]LSGGTTMYPGIADR 1.07 IPI00008603 110 0.98 2 1419.7563 -0.0029 iTRAQ n[145.11]LSLGSQYQPQR 1.87 IPI00002802 111 0.86 3 2125.2004 0.004 iTRAQ n[145.11]LSTC[160.03]K[272.20]TIDMELVK[272.20]R 0.93 IPI00000075 112 0.94 2 1179.6375 0.0118 iTRAQ n[145.11]LTFEELER 0.92 IPI00180404 113 0.99 2 1574.8363 0.0267 iTRAQ n[145.11]LVDLEPGTMDSVR 1.22 IPI00007752 114 1.00 3 2424.2278 0.0508 iTRAQ n[145.11]LVVDNGSGMC[160.03]K[272.20]AGFAGDDAPR 4.00 IPI00021439 115 0.88 3 2200.0873 0.0106 iTRAQ n[145.11]LYSSSDDVIELTPSNFNR 0.40 IPI00299571 116 0.98 2 1126.6406 0.0119 iTRAQ n[145.11]MAPTPIPTR 0.87 IPI00003406 117 0.95 2 1333.7613 0.0315 iTRAQ n[145.11]MFIVNTNVPR 0.66 IPI00293276 118 0.99 2 1522.7945 0.0261 iTRAQ n[145.11]MGPPGLAGPPGESGR 0.93 IPI00297646 119 0.98 3 1418.8919 0.0396 iTRAQ n[145.11]MK[272.20]DSLVLLGR 1.07 IPI00008791 120 0.95 3 1628.9291 0.0704 iTRAQ n[145.11]MK[272.20]FNPFVTSDR 0.50 IPI00007144 121 1.00 2 1654.9159 0.0213 iTRAQ n[145.11]MQNPQILAALQER 0.89 IPI00023860 122 0.95 2 1365.7073 -0.0124 iTRAQ n[145.11]MVNFTVDQIR 0.79 IPI00186290  170 # Prob. z Precursor Mass Error [Da] N-term Peptide iTRAQ 114/ iTRAQ 115 IPI # 123 0.99 3 1967.1637 0.0553 iTRAQ n[145.11]NEFSILK[272.20]SPGSVVFR 0.87 IPI00168884 124 0.99 2 1642.87 -0.01 iTRAQ n[145.11]PFLELDTNLPANR 0.85 IPI00293867 125 0.98 3 1787.0728 0.043 iTRAQ n[145.11]PSK[272.20]GPLQSVQVFGR 0.96 IPI00221092 126 0.98 3 2302.1244 -0.0488 iTRAQ n[145.11]QK[272.20]IC[160.03]DQWDALGSLTHSR 0.80 IPI00013808 127 0.96 2 1253.603 -0.0092 iTRAQ n[145.11]SEGGFTATGQR 0.79 IPI00003351 128 0.93 1 1297.2918 -0.3539 iTRAQ n[145.11]SEMYLEGLGR 0.88 IPI00026580 129 0.94 2 1291.6674 -0.0009 iTRAQ n[145.11]SFYTAYLQR 1.13 IPI00003590 130 0.99 2 1502.8165 0.0354 iTRAQ n[145.11]SGAQASSTPLSPTR 0.89 IPI00021405 131 0.86 3 1787.9833 0.0827 iTRAQ n[145.11]SGEPGK[272.20]QGPSGASGER 0.80 IPI00297646 132 1.00 3 2018.1376 0.0219 iTRAQ n[145.11]SGISGPPGPPGPAGK[272.20]EGLR 0.93 IPI00304962 133 0.98 3 1527.8511 0.0262 iTRAQ n[145.11]SGPAGEVGK[272.20]PGER 1.09 IPI00304962 134 0.93 2 1509.7438 -0.0049 iTRAQ n[145.11]SGPQFWVFQDR 7.70 IPI00014758 135 0.86 2 1099.5612 -0.0132 iTRAQ n[145.11]SGPSGLPGER 1.02 IPI00304962 136 0.99 2 1264.7029 0.0019 iTRAQ n[145.11]SGPVGPAGAVGPR 0.98 IPI00304962 137 1.00 3 1962.9659 0.0254 iTRAQ n[145.11]SGTLGHPGSLDETTYER 0.82 IPI00217745 138 0.88 3 1358.8339 0.0212 iTRAQ n[145.11]SK[272.20]PDLTAALR 0.99 IPI00418471 139 0.86 2 1415.7593 -0.005 iTRAQ n[145.11]SLGAWNLENLR 0.75 IPI00010800 140 0.96 2 1306.6816 0.0065 iTRAQ n[145.11]SLGSQYQPQR 0.54 IPI00002802 141 0.99 2 1463.7542 0.0131 iTRAQ n[145.11]SLNLEELSEMR 0.83 IPI00186581 142 0.99 2 1489.7323 0.0193 iTRAQ n[145.11]SLQEQADAAEER 0.75 IPI00216134 143 0.99 2 1433.7232 -0.0152 iTRAQ n[145.11]SNTTAIAEAWAR 0.99 IPI00007750 144 0.99 2 2184.9829 0.0692 iTRAQ n[145.11]SQQTNDYMQPEEDWDR 0.83 IPI00013508 145 0.97 2 1085.6274 -0.0041 iTRAQ n[145.11]SSAGLGPVVR 0.97 IPI00018305 146 0.98 2 1252.623 0.006 iTRAQ n[145.11]SSGSGPFTDVR 0.95 IPI00022418 147 1.00 3 3158.5171 0.0904 iTRAQ n[145.11]SSSDTC[160.03]GPC[160.03]EPASC[160.03]PPLPPLGC[160.03]LLGETR 0.81 IPI00016915 148 1.00 3 2796.4982 0.0595 iTRAQ n[145.11]SSSSLEK[272.20]SYELPDGQVITIGNER 1.26 IPI00008603 149 0.92 2 1146.5985 -0.013 iTRAQ n[145.11]STAAQQELR 0.72 IPI00019502 150 0.99 2 1696.9111 0.0422 iTRAQ n[145.11]STGGISVPGPMGPSGPR 0.97 IPI00297646 151 0.99 2 1285.6375 -0.005 iTRAQ n[145.11]SVSFADDFVR 0.20 IPI00032140 152 0.98 2 1589.8447 0.0276 iTRAQ n[145.11]SVSVSVPWDDSLR 0.89 IPI00010800 153 0.92 2 1092.5848 0.0131 iTRAQ n[145.11]SVVDLTC[160.03]R 0.91 IPI00022430 154 0.99 2 1212.6342 -0.0031 iTRAQ n[145.11]SWDLPAAPGR 0.96 IPI00006166 155 0.99 2 1360.6724 -0.0207 iTRAQ n[145.11]SYGGMLSAYLR 0.94 IPI00296141 156 0.94 2 1221.5928 0.018 iTRAQ n[145.11]SYSPEPDQR 0.99 IPI00298237 157 0.92 2 1168.6711 0.0025 iTRAQ n[145.11]TAPAAGVVPSR 0.91 IPI00220113 158 0.97 3 3156.3986 0.0083 iTRAQ n[145.11]TC[160.03]GQGYQLSAAK[272.20]DQC[160.03]EDIDEC[160.03]QHR 1.16 IPI00220249 159 0.94 3 1307.7296 0.0185 iTRAQ n[145.11]TDAAVEMK[272.20]R 0.73 IPI00003406 160 0.99 2 1540.7416 0.0176 iTRAQ n[145.11]TDATNPPEGPQDR 0.88 IPI00008780 161 0.96 3 1886.0138 0.0504 iTRAQ n[145.11]TFNSIMK[272.20]C[160.03]DVDIR 1.21 IPI00003269 162 1.00 3 1612.8073 0.0506 iTRAQ n[145.11]THEAEQNDSVSPR 1.07 IPI00005564 163 1.00 3 1710.8841 0.0142 iTRAQ n[145.11]THPEFAIEEELPR 1.08 IPI00012490 164 0.98 3 1897.1102 0.0767 iTRAQ n[145.11]TK[272.20]PPQC[160.03]VDIPADLR 0.62 IPI00749245 165 1.00 3 2702.1942 0.0046 iTRAQ n[145.11]TLEHSDC[160.03]AFMVDNEAIYDIC[160.03]R 0.98 IPI00007750 166 0.99 2 1358.8074 0.0247 iTRAQ n[145.11]TLMNLGGLAVAR 0.85 IPI00550363  171 # Prob. z Precursor Mass Error [Da] N-term Peptide iTRAQ 114/ iTRAQ 115 IPI # 167 0.96 2 1363.6908 -0.0231 iTRAQ n[145.11]TLSMIEEEIR 0.80 IPI00032064 168 0.95 2 1178.596 0.0059 iTRAQ n[145.11]TLTSEEEAR 1.21 IPI00217966 169 0.90 3 1875.0581 0.064 iTRAQ n[145.11]TNEK[272.20]VELQELNDR 0.71 IPI00418471 170 0.88 2 1260.5919 0.0029 iTRAQ n[145.11]TPAPETC[160.03]EGR 0.96 IPI00030241 171 0.99 2 1796.8882 0.043 iTRAQ n[145.11]TTFNIQDGPDFQDR 0.79 IPI00017799 172 1.00 3 2236.2643 -0.0028 iTRAQ n[145.11]TTIAGVVYK[272.20]DGIVLGADTR 0.92 IPI00003217 173 0.97 2 1544.7922 0.0329 iTRAQ n[145.11]TWELEPDGALDR 1.11 IPI00002714 174 0.96 2 1483.8027 0.0234 iTRAQ n[145.11]VDYYEVLGVQR 0.79 IPI00024523 175 1.00 2 1402.6642 -0.0031 iTRAQ n[145.11]VGFYESDVMGR 1.01 IPI00478003 176 0.99 3 1251.6548 0.0106 iTRAQ n[145.11]VGGAENTAHPR 0.26 IPI00029236 177 0.99 2 1619.863 0.032 iTRAQ n[145.11]VGSLNLEELSEMR 0.76 IPI00186581 178 0.87 3 1680.0056 0.0609 iTRAQ n[145.11]VIFSK[272.20]VDVNTDR 1.15 IPI00009794 179 0.93 3 1319.8419 0.0502 iTRAQ n[145.11]VK[272.20]VGVNGFGR 6.04 IPI00219018 180 0.93 2 1307.7346 0.0139 iTRAQ n[145.11]VLAELYVSDR 0.85 IPI00306960 181 0.91 2 1378.7448 0.0121 iTRAQ n[145.11]VLPGPEEPGGQR 1.04 IPI00010800 182 0.98 2 1512.7651 0.0174 iTRAQ n[145.11]VPTQC[160.03]DVPPNSR 0.91 IPI00293088 183 0.90 2 1130.6882 0.0101 iTRAQ n[145.11]VSAVLTELR 0.88 IPI00008079 184 0.97 3 1457.9246 0.0437 iTRAQ n[145.11]VSK[272.20]PDLTAALR 0.79 IPI00418471 185 0.94 2 1288.7261 0 iTRAQ n[145.11]VSLGVDWLTR 32.29 IPI00014758 186 0.99 3 1594.9231 0.0196 iTRAQ n[145.11]VSPAAGSSPGK[272.20]PPR 0.92 IPI00032293 187 0.98 2 1316.6818 -0.0029 iTRAQ n[145.11]VSVPWDDSLR 1.19 IPI00010800 188 0.83 2 998.5886 -0.0109 iTRAQ n[145.11]VVNGIPTR 0.92 IPI00025767 189 1.00 2 1099.506 -0.003 iTRAQ n[145.11]YESDVMGR 7.27 IPI00478003 190 0.85 2 1209.6291 0.0027 iTRAQ n[145.11]YNPEPPPPR 0.89 IPI00025084 191 0.98 3 1681.9316 0.0648 iTRAQ n[145.11]YQGPVGDPDK[272.20]YR 3.89 IPI00014758 192 0.94 2 1285.6634 0.0209 iTRAQ n[145.11]YVDDTQFVR 0.79 IPI00004657 193 1.00 3 1439.7875 0.0258 iTRAQ n[145.11]YVGDEAQSK[272.20]R 1.04 IPI00003269 194 0.91 2 1199.6888 -0.0107 Ac-lysine n[43.02]AAVDLEK[272.20]LR 0.98 IPI00332371 195 0.96 3 1797.1451 0.0735 Ac-lysine n[43.02]AAVK[272.20]TLNPK[272.20]AEVAR 0.95 IPI00027626 196 0.84 2 1356.7685 0.0202 Ac-lysine n[43.02]ADEIAK[272.20]AQVAR 0.83 IPI00239077 197 1.00 2 1845.9534 0.0457 Ac-lysine n[43.02]ADLEEQLSDEEK[272.20]VR 0.91 IPI00026182 198 0.94 2 1387.6716 -0.0097 Ac-lysine n[43.02]ADNEK[272.20]LDNQR 0.89 IPI00012578 199 0.93 3 1418.8498 0.0261 Ac-lysine n[43.02]AK[272.20]PAQGAK[272.20]YR 0.99 IPI00002459 200 0.95 3 1473.8579 0.0185 Ac-lysine n[43.02]AK[272.20]PLTDSEK[272.20]R 0.90 IPI00004358 201 0.91 2 1326.7396 -0.0231 Ac-lysine n[43.02]ALETVPK[272.20]DLR 0.57 IPI00002895 202 0.98 2 1185.6521 -0.0066 Ac-lysine n[43.02]ANNDAVLK[272.20]R 0.88 IPI00006252 203 0.97 2 1587.7607 0.0174 Ac-lysine n[43.02]AQDQGEK[272.20]ENPMR 0.96 IPI00376798 204 0.97 3 2437.416 0.0917 Ac-lysine n[43.02]ASGVAVSDGVIK[272.20]VFNDMK[272.20]VR 0.65 IPI00012011 205 0.98 2 1755.8475 0.0368 Ac-lysine n[43.02]ASK[272.20]EMFEDTVEER 0.92 IPI00395865 206 0.93 3 1970.0772 0.0106 Ac-lysine n[43.02]ASQSQGIQQLLQAEK[272.20]R 1.79 IPI00025285 207 0.99 2 1571.9306 0.0301 Ac-lysine n[43.02]ATVTATTK[272.20]VPEIR 0.87 IPI00009104 208 0.85 2 1499.7991 0.0249 Ac-lysine n[43.02]AVTLDK[272.20]DAYYR 1.15 IPI00026970 209 0.99 3 1848.0082 0.0219 Ac-lysine n[43.02]GDAPSPEEK[272.20]LHLITR 1.08 IPI00007074 210 1.00 2 1672.9275 0.0335 Ac-lysine n[43.02]MDGIVPDIAVGTK[272.20]R 1.02 IPI00179964  172 # Prob. z Precursor Mass Error [Da] N-term Peptide iTRAQ 114/ iTRAQ 115 IPI # 211 0.89 3 1429.7488 0.0199 Ac n[43.02]MDIAIHHPWIR na IPI00021369 212 0.98 4 2605.5822 0.1348 Ac-lysine n[43.02]MEK[272.20]TELIQK[272.20]AK[272.20]LAEQAER 1.04 IPI00018146 213 0.99 2 1427.6909 -0.008 Ac-lysine n[43.02]MFSWVSK[272.20]DAR 1.26 IPI00017184 214 0.98 3 2144.1194 0.0782 Ac-lysine n[43.02]MGQK[272.20]DSYVGDEAQSK[272.20]R 0.69 IPI00008603 215 0.99 2 1773.9461 -0.0108 Ac-lysine n[43.02]MLGPEGGEGFVVK[272.20]LR 1.05 IPI00003881 216 1.00 3 2003.9775 0.0041 Ac n[43.02]MNVDHEVNLLVEEIHR na IPI00514113 217 0.98 2 1553.7462 0.0044 Ac-lysine n[43.02]MQPASAK[272.20]WYDR 0.78 IPI00015029 218 0.97 2 1633.8715 0.021 Ac-lysine n[43.02]SSK[272.20]TASTNNIAQAR 0.95 IPI00221232 219 0.92 2 1709.9083 0.0377 Ac-lysine n[43.02]TTTTTFK[272.20]GVDPNSR 0.66 IPI00007764   173 Appendix A.3 Peptides identified by iTRAQ-TAILS in Exp2. Combined list of Mascot and X!Tandem entries, sorted by peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 114) or sMT6EΔA (iTRAQ 115) treated secretome. iTRAQ ratios represent uncorrected values; peptides used for normalization are highlighted with yellow. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated.  # Prob z Precursor Mass Error [Da] N-term Peptide iTRAQ 114/ iTRAQ 115 IPI # 1 1.00 3 1919.935 -0.0563 iTRAQ n[145.11]AAAGGPGVSGVC[160.03]VC[160.03]K[272.20]SR 24.8 IPI00016915 2 0.94 3 2220.5196 0.3119 iTRAQ n[145.11]AEK[272.20]K[272.20]ATDAEADVASLNR 13.51 IPI00013991 3 0.90 3 2020.2764 0.2217 iTRAQ n[145.11]AEQAEADK[272.20]K[272.20]QAEDR 32.23 IPI00013991 4 0.93 2 970.428 -0.0677 iTRAQ n[145.11]AGPPGESGR 32.96 IPI00297646 5 0.99 2 1023.5295 -0.0652 iTRAQ n[145.11]AGPVGPVGAR 0.28 IPI00297646 6 0.93 3 1428.7246 -0.0321 iTRAQ n[145.11]AK[272.20]HIAEDSDR 17.96 IPI00013991 7 0.83 3 1426.7439 -0.0328 iTRAQ n[145.11]AK[272.20]HIAEEADR 15.19 IPI00010779 8 1.00 2 2103.0622 -0.0715 iTRAQ n[145.11]ALYSPSDPLTLLQADTVR 40 IPI00003590 9 0.99 2 1219.566 -0.0692 iTRAQ n[145.11]AMGALELESR 32.531 IPI00003590 10 0.99 3 1777.9083 -0.0594 iTRAQ n[145.11]APGAPGPVGPAGK[272.20]SGDR 9.81 IPI00297646 11 0.98 2 1118.5129 -0.056 iTRAQ n[145.11]ASVEEEGVR 24.17 IPI00032293 12 0.97 3 2007.9143 -0.0996 iTRAQ n[145.11]C[160.03]EVDALK[272.20]GTNESLER 0.48 IPI00418471 13 0.83 3 2488.0126 -0.1401 iTRAQ n[145.11]C[160.03]SC[160.03]SPVHPQQAFC[160.03]NADVVIR 0.83 IPI00027166 14 0.88 2 887.3977 -0.0493 iTRAQ n[145.11]DEEVPR 0.75 IPI00023283 15 0.96 2 1397.556 -0.045 iTRAQ n[145.11]DFGYDGDFYR 8.47 IPI00304962 16 0.99 2 1284.6056 -0.0741 iTRAQ n[145.11]DIAVDGEPLGR 6.1 IPI00419585 17 0.86 2 1135.5162 -0.0582 iTRAQ n[145.11]DIGPYQSGR 0.74 IPI00749245 18 0.97 2 1792.8884 -0.0713 iTRAQ n[145.11]DWVIPPINLPENSR 0.92 IPI00290085 19 0.94 2 1882.7145 -0.1982 iTRAQ n[145.11]EC[160.03]K[272.20]TGYYFDGISR 1.1 IPI00218803 20 0.94 2 986.4581 -0.0574 iTRAQ n[145.11]EDDIPVR 1.37 IPI00032258 21 0.95 2 1316.5719 -0.0909 iTRAQ n[145.11]EQAPMAGALNR 1.02 IPI00396078 22 0.95 2 1421.5947 -0.0597 iTRAQ n[145.11]EQEDPYLNDR 28.6 IPI00218803 23 1.00 2 1346.6575 -0.0852 iTRAQ n[145.11]FAAATGATPIAGR 3.35 IPI00398958 24 0.98 2 1236.5628 -0.0592 iTRAQ n[145.11]FADLSEAANR 6.84 IPI00418471 25 0.96 3 1412.7483 -0.0534 iTRAQ n[145.11]FANYIDK[272.20]VR 27.7 IPI00418471 26 0.99 2 1431.6792 -0.0685 iTRAQ n[145.11]FDIAVDGEPLGR 6.6 IPI00419585 27 0.97 2 1282.5166 -0.0571 iTRAQ n[145.11]FGYDGDFYR 11.53 IPI00304962 28 0.89 2 1336.7201 -0.0788 iTRAQ n[145.11]FIPPAPVLPSR 19.96 IPI00305975 29 0.90 2 1198.595 -0.0631 iTRAQ n[145.11]FPGLPGSPGAR 16 IPI00306322 30 0.95 3 1507.7211 -0.0806 iTRAQ n[145.11]FPLENAPIGHNR 16.31 IPI00015913 31 0.87 2 1126.4918 -0.0611 iTRAQ n[145.11]FQAPSDYR 7.35 IPI00023673 32 0.99 3 2023.9223 -0.0614 iTRAQ n[145.11]FQGPAGEPGEPGQTGPAGAR 13.89 IPI00304962 33 0.97 3 1812.2126 0.1879 iTRAQ n[145.11]FTVGPLGEGGAHK[272.20]VR 3.31 IPI00178352 34 0.98 2 1586.7445 -0.044 iTRAQ n[145.11]FVSSSLPDIC[160.03]YR 38.94 IPI00430812  174 35 0.94 2 1345.6667 -0.06 iTRAQ n[145.11]FWEGLPAQVR 18.29 IPI00014758 36 0.99 3 1976.962 -0.0508 iTRAQ n[145.11]GAAAGGPGVSGVC[160.03]VC[160.03]K[272.20]SR 5.2 IPI00016915 37 0.95 3 1609.8187 -0.0593 iTRAQ n[145.11]GAPGPVGPAGK[272.20]SGDR 9.5 IPI00297646 38 1.00 2 1104.5172 -0.0625 iTRAQ n[145.11]GATGFPGAAGR 6.65 IPI00186460 39 0.90 2 1074.4551 -0.0696 iTRAQ n[145.11]GDPGLMGER 6.05 IPI00291136 40 1.00 2 1235.4923 -0.0614 iTRAQ n[145.11]GGFDEDAEPR 6.15 IPI00009794 41 1.00 2 1575.6616 -0.0705 iTRAQ n[145.11]GGPMDASVEEEGVR 5.79 IPI00032293 42 0.98 3 1792.8147 -0.069 iTRAQ n[145.11]GK[272.20]DLGGFDEDAEPR 9.5 IPI00009794 43 0.88 3 1648.9633 -0.0474 iTRAQ n[145.11]GK[272.20]VK[272.20]VGVNGFGR 0.82 IPI00219018 44 0.99 2 1140.5409 -0.06 iTRAQ n[145.11]GLAGPPGESGR 8.5 IPI00297646 45 0.97 2 1272.6347 -0.071 iTRAQ n[145.11]GLQGFPGLQGR 5.3 IPI00306322 46 0.99 2 1164.5269 -0.0558 iTRAQ n[145.11]GMTGFPGAAGR 6.15 IPI00304962 47 0.98 2 1748.7819 -0.0748 iTRAQ n[145.11]GPAGEPGEPGQTGPAGAR 11.49 IPI00304962 48 0.89 2 954.4344 -0.0661 iTRAQ n[145.11]GPAGPAGER 33.88 IPI00186460 49 0.98 3 2073.9656 -0.0701 iTRAQ n[145.11]GPAGTPGQIDC[160.03]DTDVK[272.20]R 24.96 IPI00306322 50 0.99 2 1325.5847 -0.0673 iTRAQ n[145.11]GPPGDPGLMGER 13.05 IPI00291136 51 0.85 3 1422.7701 -0.0486 iTRAQ n[145.11]GPPGPAGK[272.20]EGLR 18.04 IPI00304962 52 0.90 3 1454.9361 0.1644 iTRAQ n[145.11]GPPGPSGEEGK[272.20]R 37.89 IPI00304962 53 0.99 3 1941.9281 -0.0467 iTRAQ n[145.11]GPSGEPGK[272.20]QGPSGASGER 24.57 IPI00297646 54 1.00 3 1681.8306 -0.0685 iTRAQ n[145.11]GPSGPAGEVGK[272.20]PGER 34.06 IPI00304962 55 0.99 2 1127.5604 -0.0563 iTRAQ n[145.11]GPVGAAGATGAR 15.6 IPI00304962 56 0.96 3 1433.9651 0.1554 iTRAQ n[145.11]GPVGPAGK[272.20]HGNR 18.98 IPI00304962 57 0.99 2 1135.4562 -0.0495 iTRAQ n[145.11]GYDGDFYR 23.02 IPI00304962 58 0.99 2 1358.6798 -0.0729 iTRAQ n[145.11]IETLLTPEGSR 32.81 IPI00304962 59 0.96 3 1323.7747 -0.073 iTRAQ n[145.11]IK[272.20]IIAPPER 1.31 IPI00003269 60 0.99 2 1243.6279 -0.1091 iTRAQ n[145.11]ISSVLQANLR 40 IPI00023208 61 0.82 2 1657.7677 -0.076 iTRAQ n[145.11]ITWELEPDGALDR 40 IPI00002714 62 0.98 2 1083.5204 -0.0591 iTRAQ n[145.11]LAGPPGESGR 28.01 IPI00297646 63 0.99 4 2709.7163 0.2977 iTRAQ n[145.11]LGAEEAK[272.20]TFDQLTPEESK[272.20]ER 8.16 IPI00014537 64 0.86 3 2072.3019 0.2192 iTRAQ n[145.11]LGK[272.20]DSNNLC[160.03]LHFNPR 2.49 IPI00219219 65 0.92 2 1015.5237 -0.0547 iTRAQ n[145.11]LLTPEGSR 17.09 IPI00304962 66 0.99 2 1827.9168 -0.0649 iTRAQ n[145.11]LNNQIETLLTPEGSR 30.37 IPI00304962 67 0.84 3 2467.5464 0.2687 iTRAQ n[145.11]LTETDIC[160.03]K[272.20]LPK[272.20]DEGTC[160.03]R 2.29 IPI00022200 68 1.00 2 1299.6662 -0.0855 iTRAQ n[145.11]LVIIEGDLER 5.3 IPI00183968 69 0.99 2 1164.5323 -0.0607 iTRAQ n[145.11]MGALELESR 25.31 IPI00003590 70 0.99 2 1348.5347 -0.0492 iTRAQ n[145.11]MQPEEDWDR 19.02 IPI00013508 71 1.00 2 1714.8315 -0.0652 iTRAQ n[145.11]NNQIETLLTPEGSR 20.12 IPI00304962 72 1.00 2 1600.7863 -0.0684 iTRAQ n[145.11]NQIETLLTPEGSR 16.13 IPI00304962 73 0.97 3 1476.698 -0.0827 iTRAQ n[145.11]PGPDGPAASGPAAIR 1.27 IPI00292020 74 0.86 3 1819.9496 -0.0261 iTRAQ n[145.11]QAEADK[272.20]K[272.20]QAEDR 37.83 IPI00013991 75 0.94 3 2328.0706 -0.0721 iTRAQ n[145.11]SLAGSSGPGASSGTSGDHGELVVR 2 IPI00023048 76 1.00 2 1330.66 -0.0727 iTRAQ n[145.11]SLSQQIENIR 5.07 IPI00297646 77 0.99 2 1581.7966 -0.0518 iTRAQ n[145.11]SPAGGPLEDVVIER 1.74 IPI00303300 78 0.99 3 1958.8951 -0.0595 iTRAQ n[145.11]SPSAPDAPTC[160.03]PK[272.20]QC[160.03]R 29.05 IPI00299738 79 0.99 2 1130.5557 -0.0608 iTRAQ n[145.11]SQQIENIR 18.4 IPI00297646 80 0.98 2 1162.5577 -0.0487 iTRAQ n[145.11]SSAAGEGTLAR 4.15 IPI00292150  175 81 0.97 3 1526.9612 0.1675 iTRAQ n[145.11]SYVGDEAQSK[272.20]R 16.74 IPI00008603 82 1.00 2 1627.7864 -0.0673 iTRAQ n[145.11]TEVIDPQDLLEGR 5.42 IPI00011564 83 0.94 3 1791.865 -0.0379 iTRAQ n[145.11]TPGQIDC[160.03]DTDVK[272.20]R 4.5 IPI00306322 84 1.00 2 1405.6748 -0.0423 iTRAQ n[145.11]TVITSVGDEEGR 26.24 IPI00002714 85 0.82 3 1718.8745 -0.0661 iTRAQ n[145.11]VDALK[272.20]GTNESLER 3.26 IPI00418471 86 1.00 3 1915.1906 0.1829 iTRAQ n[145.11]VEELMEDTQHK[272.20]LR 11.97 IPI00002714 87 0.99 2 1288.6684 -0.0573 iTRAQ n[145.11]VFASLPQVER 5.3 IPI00216256 88 1.00 2 1333.5192 -0.0676 iTRAQ n[145.11]VGADDDEGGAER 9.06 IPI00176903 89 1.00 2 1674.7394 -0.0613 iTRAQ n[145.11]VGGPMDASVEEEGVR 20.4 IPI00032293 90 0.94 2 1397.6838 -0.0798 iTRAQ n[145.11]VIDPQDLLEGR 5.8 IPI00011564 91 0.93 2 1186.6077 -0.0602 iTRAQ n[145.11]VIIEGDLER 29.47 IPI00183968 92 0.91 2 1200.6052 -0.0784 iTRAQ n[145.11]VILEGELER 11.8 IPI00010779 93 0.83 3 2616.6384 0.3017 iTRAQ n[145.11]VMVGMGQK[272.20]DSYVGDEAQSK[272.20]R 20.28 IPI00008603 94 0.91 2 949.3849 -0.0558 iTRAQ n[145.11]VNDGDMR 1.09 IPI00023673 95 0.99 2 1917.7508 -0.0779 iTRAQ n[145.11]VSGGGYDFGYDGDFYR 29.62 IPI00304962 96 0.88 2 1078.4232 -0.0605 iTRAQ n[145.11]YDGDFYR 21.57 IPI00304962 97 0.99 2 1352.6242 -0.0455 iTRAQ n[145.11]YVLDDSDGLGR 0.72 IPI00008790 98 0.99 2 1330.4906 -0.0631 Ac n[43.02]AAGGDHGSPDSYR na IPI00026904 99 0.99 3 2156.999 -0.1166 Ac-lysine n[43.02]AC[160.03]GLVASNLNLK[272.20]PGEC[160.03]LR 1.04 IPI00219219 100 0.99 2 962.4041 -0.0529 Ac n[43.02]AEASPHPGR na IPI00155562 101 0.99 2 1094.4972 -0.0649 Ac n[43.02]AGLGHPAAFGR na IPI00220342 102 0.89 2 958.4089 -0.0532 Ac n[43.02]AGVSFSGHR na IPI00003406 103 0.87 2 1217.395 -0.231 Ac n[43.02]AIITC[160.03]C[160.03]LLGR na IPI00639851 104 0.95 2 1403.6817 -0.0561 Ac-lysine n[43.02]AK[272.20]ISSPTETER 0.73 IPI00013895 105 0.97 2 1224.4793 -0.069 Ac n[43.02]ASGEHSPGSGAAR na IPI00647400 106 0.91 2 1387.6629 -0.0548 Ac-lysine n[43.02]ASNVTNK[272.20]TDPR 0.51 IPI00216592 107 0.92 2 905.3244 -0.0457 Ac n[43.02]MEEYHR na IPI00020885 108 0.93 2 941.3861 -0.097 Ac n[43.02]RLFGDHR na IPI00748682 109 1.00 2 1142.5035 -0.0434 Ac n[43.02]SAAEAGGVFHR na IPI00305010 110 0.94 3 1881.7533 -0.0709 Ac n[43.02]SGDHLHNDSQIEADFR na IPI00413611 111 0.96 2 859.3476 -0.046 Ac n[43.02]SSAHFNR na IPI00021264 112 0.97 2 1042.4289 -0.0577 Ac n[43.02]TMLADHAAR na IPI00298961   176 APPENDIX B: PEPTIDES IDENTIFIED FROM HFL OR HMEC FRACTIONS Appendix B.1 Peptides identified by iTRAQ-TAILS in conditioned medium of HFL1xHFL2. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 114) or sMT6EΔA (iTRAQ 115) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. N-termini Prob z Precursor Mass Error [Da] N-term Peptide iTRAQ 114/ iTRAQ 115 IPI # Neo 1.00 3 1774.9752 0.0335 iTRAQ n[145.11]ADANLEAGNVK[272.20]ETR 1.51 IPI00328113 Neo 0.99 2 1119.5694 0.0263 iTRAQ n[145.11]AGFAGDDAPR 1.44 IPI00008603 Natural 0.99 2 1324.6681 0.0184 iTRAQ n[145.11]ASEGGFTATGQR 1.4 IPI00003351 Neo 0.99 3 1595.8747 0.024 iTRAQ n[145.11]DAINTEFK[272.20]NTR 1.6 IPI00418471 Natural 1.00 3 1664.876 0.0269 iTRAQ n[145.11]DAPEEEDHVLVLR 1.11 IPI00010796 Neo 0.99 3 1589.842 0.0163 iTRAQ n[145.11]DNADSSPVVDK[272.20]R 0.41 IPI00328753 Neo 0.99 3 1665.9093 0.0166 iTRAQ n[145.11]DSK[272.20]VFGDLDQVR 0.9 IPI00184375 Neo 1.00 3 1658.7858 0.0231 iTRAQ n[145.11]DVLLEAC[160.03]C[160.03]ADGHR 1.6 IPI00218803 Neo 0.99 2 1497.7012 -0.0325 iTRAQ n[145.11]FQSDIGPYQSGR 1.305 IPI00749245 Neo 1.00 3 1398.7245 0.0118 iTRAQ n[145.11]FVGGAENTAHPR 1.68 IPI00029236 Neo 0.97 3 1677.7825 -0.023 iTRAQ n[145.11]GAFEGTHMGPFVER 1.23 IPI00100980 Neo 0.99 2 1457.6893 -0.0704 iTRAQ n[145.11]GVQVETISPGDGR 1.194 IPI00413778 Neo 1.00 3 1877.0269 0.0028 iTRAQ n[145.11]LSGAPQASAADVVVVHGR 0.12 IPI00011522 Natural 1.00 10 1782.825 -0.0144 iTRAQ n[145.11]SDVLELTDDNFESR 1.11 IPI00025252 Natural 0.98 2 1219.59 -0.0015 iTRAQ n[145.11]SQDASDGLQR 1.23 IPI00009276 Neo 0.95 3 1497.8579 0.0072 iTRAQ n[145.11]TEAPLNPK[272.20]ANR 1.56 IPI00008603 Natural 1.00 3 1584.8604 0.0262 Ac-lysine n[43.02]AATASAGAGGIDGK[272.20]PR 17.39 IPI00219729 Natural 1.00 2 1328.764 0.0106 Ac-lysine n[43.02]AATTGSGVK[272.20]VPR 1.24 IPI00472498 Natural 1.00 10 1750.8356 0.0225 Ac-lysine n[43.02]ADK[272.20]EAAFDDAVEER 1.54 IPI00328319 Natural 0.98 2 1253.6487 0.0114 Ac-lysine n[43.02]AESSDK[272.20]LYR 3.93 IPI00449049 Natural 0.88 2 1259.6605 -0.0242 Ac-lysine n[43.02]AEVEETLK[272.20]R 3.87 IPI00063849 Natural 0.99 2 1342.7114 -0.0573 Ac-lysine n[43.02]AGLNSLEAVK[272.20]R 1.485 IPI00010779 Natural 0.96 3 1473.854 0.0146 Ac-lysine n[43.02]AK[272.20]PLTDSEK[272.20]R 0.74 IPI00004358 Natural 0.96 2 1587.6718 -0.0715 Ac-lysine n[43.02]AQDQGEK[272.20]ENPMR 9.94 IPI00376798 Natural 0.98 3 1832.0258 0.0011 Ac-lysine n[43.02]ASSDIQVK[272.20]ELEK[272.20]R 2.03 IPI00479997 Natural 0.99 2 1445.7413 0.0181 Ac-lysine n[43.02]ASSGAGDPLDSK[272.20]R 15.72 IPI00022277 Natural 0.93 2 1389.7258 -0.0327 Ac-lysine n[43.02]ATDELATK[272.20]LSR 1.72 IPI00060181 Natural 0.99 2 1198.7444 0.0288 Ac-lysine n[43.02]AVSTGVK[272.20]VPR 1.29 IPI00019600 Natural 0.92 2 1499.8024 0.0282 Ac-lysine n[43.02]AVTLDK[272.20]DAYYR 1.03 IPI00026970 Natural 0.96 2 1429.5753 -0.0447 Ac-lysine n[43.02]SSNEC[160.03]FK[272.20]C[160.03]GR 1.21 IPI00430813   177 Appendix B.2 Peptides identified by iTRAQ-TAILS in conditioned medium of HFL1. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 114) or sMT6EΔA (iTRAQ 115) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 114/ iTRAQ 115 IPI # Neo 1.00 3 1774.9752 0.0335 iTRAQ n[145.11]ADANLEAGNVK[272.20]ETR 0.71 IPI00328113 Neo 0.99 2 1119.5694 0.0263 iTRAQ n[145.11]AGFAGDDAPR 0.93 IPI00008603 Neo 0.95 3 1480.8527 0.0286 iTRAQ n[145.11]AINTEFK[272.20]NTR 0.6 IPI00418471 Natural 0.99 2 1324.6681 0.0184 iTRAQ n[145.11]ASEGGFTATGQR 0.74 IPI00003351 Natural 1.00 3 1664.876 0.0269 iTRAQ n[145.11]DAPEEEDHVLVLR 0.89 IPI00010796 Natural 0.98 3 2264.7461 -0.3386 iTRAQ n[145.11]DDEVDVDGTVEEDLGK[272.20]SR 1.34 IPI00027230 Neo 0.99 3 1589.842 0.0163 iTRAQ n[145.11]DNADSSPVVDK[272.20]R 0.41 IPI00328753 Neo 0.99 3 1665.9093 0.0166 iTRAQ n[145.11]DSK[272.20]VFGDLDQVR 0.76 IPI00184375 Neo 1.00 3 1658.7858 0.0231 iTRAQ n[145.11]DVLLEAC[160.03]C[160.03]ADGHR 1.09 IPI00218803 Neo 0.99 3 2619.0955 -0.0288 iTRAQ n[145.11]EEGQC[160.03]VC[160.03]DEGFAGVDC[160.03]SEK[272.20]R 0.9 IPI00867560 Neo 0.98 2 1497.7559 0.0222 iTRAQ n[145.11]FQSDIGPYQSGR 0.86 IPI00749245 Neo 1.00 3 1398.7446 0.0319 iTRAQ n[145.11]FVGGAENTAHPR 1.12 IPI00029236 Neo 0.98 2 1048.5111 0.0052 iTRAQ n[145.11]GFAGDDAPR 1.21 IPI00008603 Neo 0.98 2 1457.7791 0.0194 iTRAQ n[145.11]GVQVETISPGDGR 1.07 IPI00413778 Neo 0.99 3 1667.8801 0.0412 iTRAQ n[145.11]HPVGTDEEPLQFR 0.96 IPI00022418 Neo 1.00 3 1877.0269 0.0028 iTRAQ n[145.11]LSGAPQASAADVVVVHGR 0.25 IPI00011522 Neo 0.99 2 1466.7557 0.043 iTRAQ n[145.11]SAGDVDTLAFDGR 0.91 IPI00374563 Natural 1.00 10 1782.8676 0.0279 iTRAQ n[145.11]SDVLELTDDNFESR 0.91 IPI00025252 Natural 0.90 2 1219.6125 0.021 iTRAQ n[145.11]SQDASDGLQR 0.73 IPI00009276 Neo 0.83 3 1497.852 0.0013 iTRAQ n[145.11]TEAPLNPK[272.20]ANR 1.56 IPI00008603 Neo 1.00 3 1594.934 0.0305 iTRAQ n[145.11]VSPAAGSSPGK[272.20]PPR 0.65 IPI00032293 Neo 0.98 2 1352.6924 0.0227 iTRAQ n[145.11]YVLDDSDGLGR 0.87 IPI00008790 Natural 1.00 3 1584.8604 0.0262 Ac-lysine n[43.02]AATASAGAGGIDGK[272.20]PR 10.43 IPI00219729 Natural 1.00 2 1328.764 0.0106 Ac-lysine n[43.02]AATTGSGVK[272.20]VPR 0.95 IPI00472498 Natural 0.99 2 1750.8487 0.0356 Ac-lysine n[43.02]ADK[272.20]EAAFDDAVEER 0.83 IPI00328319 Natural 0.98 2 1253.6487 0.0114 Ac-lysine n[43.02]AESSDK[272.20]LYR 2.98 IPI00449049 Natural 0.82 2 1259.7059 0.0216 Ac-lysine n[43.02]AEVEETLK[272.20]R 2.55 IPI00063849 Natural 0.98 3 1514.8633 -0.0027 Ac-lysine n[43.02]AK[272.20]PLTDQEK[272.20]R 1.08 IPI00783313 Natural 0.96 3 1473.854 0.0146 Ac-lysine n[43.02]AK[272.20]PLTDSEK[272.20]R 0.74 IPI00004358 Natural 0.96 2 1587.768 0.0247 Ac-lysine n[43.02]AQDQGEK[272.20]ENPMR 9.91 IPI00376798 Natural 0.98 3 1832.0664 0.0417 Ac-lysine n[43.02]ASSDIQVK[272.20]ELEK[272.20]R 2.23 IPI00479997 Natural 0.90 2 1389.7669 0.0084 Ac-lysine n[43.02]ATDELATK[272.20]LSR 1.07 IPI00060181 Natural 0.99 2 1198.7444 0.0288 Ac-lysine n[43.02]AVSTGVK[272.20]VPR 0.98 IPI00019600 Natural 0.92 2 1499.8024 0.0282 Ac-lysine n[43.02]AVTLDK[272.20]DAYYR 0.83 IPI00026970 Neo 0.97 3 2075.1224 0.09 Ac-lysine n[43.02]QGDVIGIPFNVDVSSFPSR 1.16 IPI00299890  178 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 114/ iTRAQ 115 IPI # Natural 0.89 3 1844.0383 0.05 Ac-lysine n[43.02]SK[272.20]SESPK[272.20]EPEQLR 0.92 IPI00215965 Natural 0.93 2 1429.637 0.017 Ac-lysine n[43.02]SSNEC[160.03]FK[272.20]C[160.03]GR 1.11 IPI00430813   179 Appendix B.3 Peptides identified by iTRAQ-TAILS in conditioned medium of HFL2. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 114) or sMT6EΔA (iTRAQ 115) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 114/ iTRAQ 115 IPI # Neo 0.95 2 1002.5231 -0.0349 iTRAQ n[145.11]AAISQVDR 1.42 IPI00014587 Neo 1.00 3 1774.9705 0.0288 iTRAQ n[145.11]ADANLEAGNVK[272.20]ETR 2.17 IPI00328113 Neo 0.92 2 1245.622 0.0153 iTRAQ n[145.11]AEQNDSVSPR 2.03 IPI00005564 Neo 0.99 2 1119.5366 -0.0064 iTRAQ n[145.11]AGFAGDDAPR 1.81 IPI00008603 Neo 0.92 2 1345.6698 -0.0259 iTRAQ n[145.11]AILEDEQTQR 1.41 IPI00215743 Neo 0.99 3 2145.2496 0.0349 iTRAQ n[145.11]AIVFIK[272.20]QPSSQDALQGR 1.82 IPI00168813 Neo 0.88 3 1504.8559 0.0106 iTRAQ n[145.11]ALK[272.20]GTNESLER 1.76 IPI00418471 Natural 0.88 2 1159.5558 -0.0186 iTRAQ n[145.11]APDPGFQER 1.49 IPI00296141 Natural 0.91 2 1214.4876 -0.1141 iTRAQ n[145.11]APDQDEIQR 1.26 IPI00021794 Natural 0.99 3 1360.6797 -0.0536 iTRAQ n[145.11]APPAAGQQQPPR 1.52 IPI00002802 Natural 0.99 4 2393.2701 0.0227 iTRAQ n[145.11]APPAAGQQQPPREPPAAPGAWR 1.51 IPI00002802 Natural 0.99 2 1324.6148 -0.0349 iTRAQ n[145.11]ASEGGFTATGQR 1.506 IPI00003351 Neo 0.98 2 1208.5182 -0.1089 iTRAQ n[145.11]ASSPGGVYATR 1.82 IPI00418471 Neo 0.90 2 1568.8132 0.0175 iTRAQ n[145.11]ATLDVYNPFETR 1.31 IPI00453116 Neo 0.88 2 1088.6304 -0.016 iTRAQ n[145.11]AVFPSIVGR 1.46 IPI00008603 Neo 0.92 2 1081.6116 -0.0251 iTRAQ n[145.11]AVTVAPPGAR 1.44 IPI00479217 Neo 0.97 3 2008.021 0.0071 iTRAQ n[145.11]C[160.03]EVDALK[272.20]GTNESLER 1.45 IPI00418471 Natural 0.99 3 2488.1173 -0.0354 iTRAQ n[145.11]C[160.03]SC[160.03]SPVHPQQAFC[160.03]NADVVIR 1.02 IPI00027166 Neo 0.99 3 1595.8747 0.024 iTRAQ n[145.11]DAINTEFK[272.20]NTR 2.47 IPI00418471 Neo 0.89 2 931.4721 -0.0124 iTRAQ n[145.11]DDANVVR 1.53 IPI00297646 Neo 0.92 2 1197.6579 -0.0082 iTRAQ n[145.11]DIPAMLPAAR 1.4 IPI00329688 Neo 0.96 3 1665.8784 -0.0146 iTRAQ n[145.11]DSK[272.20]VFGDLDQVR 1.16 IPI00184375 Neo 1.00 3 1658.776 0.0133 iTRAQ n[145.11]DVLLEAC[160.03]C[160.03]ADGHR 1.78 IPI00218803 Natural 0.98 2 1507.7247 -0.06 iTRAQ n[145.11]ESETTTSLVLER 1.94 IPI00029744 Neo 0.99 3 1779.8578 -0.0118 iTRAQ n[145.11]ETVHC[160.03]DLQPVGPER 1.05 IPI00017567 Neo 0.93 2 995.4234 -0.0413 iTRAQ n[145.11]EVC[160.03]MASR 1.4 IPI00166039 Neo 0.90 3 1848.0212 0.0375 iTRAQ n[145.11]EVDALK[272.20]GTNESLER 2.53 IPI00418471 Neo 0.88 3 2659.1705 -0.1312 iTRAQ n[145.11]FEK[272.20]NEAIQAAHDAVAQEGQC[160.03]R 1.59 IPI00018352 Neo 0.98 2 1396.5923 -0.0414 iTRAQ n[145.11]FGSDQSENVDR 1.34 IPI00258804 Neo 0.99 2 1497.7012 -0.0325 iTRAQ n[145.11]FQSDIGPYQSGR 1.391 IPI00749245 Neo 0.99 3 2014.1094 0.0367 iTRAQ n[145.11]FSLADAINTEFK[272.20]NTR 1.615 IPI00418471 Neo 1.00 3 1398.7245 0.0118 iTRAQ n[145.11]FVGGAENTAHPR 1.8 IPI00029236 Neo 0.97 3 1677.7825 -0.023 iTRAQ n[145.11]GAFEGTHMGPFVER 1.23 IPI00100980 Neo 0.97 2 1238.6849 -0.0256 iTRAQ n[145.11]GAPEVLVSAPR 1.25 IPI00143921 Neo 0.86 2 1381.6747 -0.0035 iTRAQ n[145.11]GGTTMYPGIADR 2.04 IPI00008603  180 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 114/ iTRAQ 115 IPI # Neo 1.00 3 1858.9819 -0.0208 iTRAQ n[145.11]GLGLSYLSSHIANVER 1.22 IPI00026314 Natural 0.92 4 1968.1049 -0.01 iTRAQ n[145.11]GPAK[272.20]SPYQLVLQHSR 1.6 IPI00018219 Neo 0.90 2 1361.692 -0.0137 iTRAQ n[145.11]GPNPFTTLTDR 1.1 IPI00019901 Neo 0.95 3 1516.8771 0.0132 iTRAQ n[145.11]GPVLGLK[272.20]EC[160.03]TR 1.62 IPI00012503 Neo 0.85 2 1048.4855 -0.0416 iTRAQ n[145.11]GTNESLER 1.4 IPI00025363 Neo 0.99 2 1457.6893 -0.0704 iTRAQ n[145.11]GVQVETISPGDGR 1.42 IPI00413778 Neo 0.93 2 1168.6727 -0.0323 iTRAQ n[145.11]IGGIGTVPVGR 2.52 IPI00014424 Neo 0.87 2 1059.5592 -0.0276 iTRAQ n[145.11]IISAPEMR 1.58 IPI00029236 Neo 0.99 3 1779.9437 -0.029 iTRAQ n[145.11]LADAINTEFK[272.20]NTR 1.32 IPI00418471 Natural 0.92 3 2239.1072 -0.0385 iTRAQ n[145.11]LGRPSEEDEELVVPELER 1.45 IPI00005908 Neo 0.96 2 1175.6494 -0.0323 iTRAQ n[145.11]LGSATALMIR 1.7 IPI00006970 Neo 0.98 2 1373.6334 -0.0943 iTRAQ n[145.11]LGSDAELQIER 1.97 IPI00182126 Neo 1.00 3 1876.9835 -0.0402 iTRAQ n[145.11]LSGAPQASAADVVVVHGR 0.05 IPI00011522 Neo 0.93 2 1179.6152 -0.0105 iTRAQ n[145.11]LTFEELER 1.58 IPI00180404 Neo 0.98 3 1971.08 -0.0377 iTRAQ n[145.11]LVASNLNLK[272.20]PGEC[160.03]LR 1.67 IPI00219219 Neo 1.00 3 2200.0627 -0.014 iTRAQ n[145.11]LYSSSDDVIELTPSNFNR 1.5 IPI00299571 Natural 0.98 2 1611.8666 0.0061 iTRAQ n[145.11]MPPYTVVYFPVR 1.7 IPI00219757 Neo 1.00 3 1654.8555 -0.0392 iTRAQ n[145.11]MQNPQILAALQER 0.53 IPI00023860 Natural 0.91 2 1365.7104 -0.0092 iTRAQ n[145.11]MVNFTVDQIR 1.96 IPI00186290 Natural 0.92 2 1177.5681 -0.0168 iTRAQ n[145.11]PDYLGADQR 2.38 IPI00021435 Natural 1.00 3 2241.1758 -0.0119 iTRAQ n[145.11]PGGLLLGDVAPNFEANTTVGR 1.74 IPI00220301 Natural 0.99 10 1430.7768 -0.0058 iTRAQ n[145.11]PMFIVNTNVPR 1.37 IPI00293276 Natural 0.93 3 1618.8616 -0.0571 iTRAQ n[145.11]PNFSGNWK[272.20]IIR 1.42 IPI00216088 Natural 0.97 2 1613.7546 -0.005 iTRAQ n[145.11]PQYQTWEEFSR 1.33 IPI00216125 Neo 0.94 2 1252.6479 -0.0528 iTRAQ n[145.11]SAADVVVVHGR 0.09 IPI00011522 Neo 1.00 4 2290.1525 -0.0204 iTRAQ n[145.11]SAVHHPPSYVAHLASDFGVR 1.73 IPI00007118 Natural 1.00 3 1782.825 -0.0144 iTRAQ n[145.11]SDVLELTDDNFESR 1.25 IPI00025252 Neo 1.00 3 1711.7646 -0.0001 iTRAQ n[145.11]SGGC[160.03]FWDNGHLYR 1.21 IPI00298388 Neo 0.97 2 1468.7003 -0.0099 iTRAQ n[145.11]SGGTTMYPGIADR 1.45 IPI00008603 Neo 0.86 2 858.3944 -0.0737 iTRAQ n[145.11]SGLPGER 1.83 IPI00304962 Neo 0.99 3 1962.9338 -0.0067 iTRAQ n[145.11]SGTLGHPGSLDETTYER 1.89 IPI00217745 Neo 1.00 3 1875.9457 -0.047 iTRAQ n[145.11]SIAAHLDNQVPVESPR 1.02 IPI00018120 Neo 0.97 3 1866.9589 -0.0458 iTRAQ n[145.11]SLADAINTEFK[272.20]NTR 1.31 IPI00418471 Neo 0.96 3 1624.8518 0.0218 iTRAQ n[145.11]SLEDENK[272.20]EAFR 2.1 IPI00010800 Neo 1.00 3 1619.8502 -0.0251 iTRAQ n[145.11]SLLSLGSQYQPQR 2.26 IPI00002802 Neo 0.88 2 1026.5232 -0.0345 iTRAQ n[145.11]SLPEAGPGR 1.63 IPI00017968 Neo 0.98 2 1581.8367 -0.012 iTRAQ n[145.11]SPAGGPLEDVVIER 1.91 IPI00303300 Neo 1.00 3 1522.7745 -0.0482 iTRAQ n[145.11]SPALTIENEHIR 1.51 IPI00012989 Natural 0.98 2 1219.59 -0.0015 iTRAQ n[145.11]SQDASDGLQR 1.44 IPI00009276 Neo 0.97 2 1252.5825 -0.0345 iTRAQ n[145.11]SSGSGPFTDVR 1.08 IPI00022418 Neo 0.87 2 1137.5339 -0.0561 iTRAQ n[145.11]SSPGGVYATR 1.87 IPI00418471 Neo 0.88 2 1146.5478 -0.0637 iTRAQ n[145.11]STAAQQELR 1.31 IPI00019502 Neo 0.99 3 1615.8035 -0.0292 iTRAQ n[145.11]STVIHYEIPEER 1.2 IPI00001872 Neo 0.83 2 1221.5477 -0.0271 iTRAQ n[145.11]SYSPEPDQR 1.67 IPI00298237  181 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 114/ iTRAQ 115 IPI # Natural 0.99 3 1612.7872 0.0305 iTRAQ n[145.11]THEAEQNDSVSPR 1.78 IPI00005564 Neo 0.92 2 1796.8541 0.009 iTRAQ n[145.11]TTFNIQDGPDFQDR 1.24 IPI00017799 Natural 0.82 2 1017.5271 -0.0316 iTRAQ n[145.11]VAGMLMPR 0.78 IPI00014898 Neo 0.98 3 1718.9706 0.0299 iTRAQ n[145.11]VDALK[272.20]GTNESLER 2.22 IPI00418471 Neo 1.00 3 1671.9564 -0.0203 iTRAQ n[145.11]VDVSK[272.20]PDLTAALR 1.54 IPI00418471 Neo 0.88 2 1258.6309 -0.0328 iTRAQ n[145.11]VELQELNDR 1.61 IPI00418471 Neo 0.95 2 1023.5647 -0.03 iTRAQ n[145.11]VGPAGAVGPR 1.72 IPI00304962 Neo 0.98 2 1619.8545 0.0238 iTRAQ n[145.11]VGSLNLEELSEMR 2.11 IPI00186581 Natural 0.95 2 1307.6928 -0.0279 iTRAQ n[145.11]VLAELYVSDR 1.4 IPI00306960 Natural 0.85 2 949.4195 -0.0212 iTRAQ n[145.11]VNDGDMR 1.89 IPI00023673 Natural 0.94 2 1234.6738 -0.0053 iTRAQ n[145.11]VNFTVDQIR 1.99 IPI00186290 Natural 0.99 3 2089.1775 0.0808 iTRAQ n[145.11]VNPTVFFDIAVDGEPLGR 1 IPI00419585 Neo 0.96 3 1457.8742 -0.0067 iTRAQ n[145.11]VSK[272.20]PDLTAALR 1.78 IPI00418471 Neo 0.98 2 1316.6614 -0.0233 iTRAQ n[145.11]VSVPWDDSLR 1.66 IPI00010800 Natural 0.94 3 1828.9376 -0.0105 Ac-lysine n[43.02]AAGFK[272.20]TVEPLEYYR 2.3 IPI00552920 Natural 1.00 3 1584.8009 -0.0328 Ac-lysine n[43.02]AATASAGAGGIDGK[272.20]PR 20.33 IPI00219729 Natural 0.97 3 1737.9 0.0006 Ac-lysine n[43.02]AATFFGEVVK[272.20]APC[160.03]R 2.02 IPI00030770 Natural 0.98 2 1328.6865 -0.0672 Ac-lysine n[43.02]AATTGSGVK[272.20]VPR 1.48 IPI00472498 Natural 0.92 2 1199.6644 -0.0351 Ac-lysine n[43.02]AAVDLEK[272.20]LR 4.18 IPI00332371 Natural 0.95 3 1797.0327 -0.039 Ac-lysine n[43.02]AAVK[272.20]TLNPK[272.20]AEVAR 1.94 IPI00027626 Natural 0.99 3 2157.0122 -0.1034 Ac-lysine n[43.02]AC[160.03]GLVASNLNLK[272.20]PGEC[160.03]LR 4.46 IPI00219219 Natural 0.87 2 1356.7316 -0.0167 Ac-lysine n[43.02]ADEIAK[272.20]AQVAR 1.43 IPI00239077 Natural 1.00 3 1750.8356 0.0225 Ac-lysine n[43.02]ADK[272.20]EAAFDDAVEER 1.87 IPI00328319 Natural 0.98 3 1764.8383 -0.006 Ac-lysine n[43.02]ADLAEC[160.03]NIK[272.20]VMC[160.03]R 4.29 IPI00012837 Natural 0.99 3 1798.9884 -0.0026 Ac-lysine n[43.02]ADLDK[272.20]LNIDSIIQR 5.1 IPI00005705 Natural 1.00 3 1845.8797 -0.028 Ac-lysine n[43.02]ADLEEQLSDEEK[272.20]VR 2.31 IPI00026182 Natural 0.91 2 1459.6464 -0.0383 Ac-lysine n[43.02]ADQGEK[272.20]ENPMR 7.97 IPI00746438 Natural 0.99 3 2056.0095 0.0137 Ac-lysine n[43.02]AEDWLDC[160.03]PALGPGWK[272.20]R 6 IPI00438701 Natural 0.98 2 1253.602 -0.0353 Ac-lysine n[43.02]AESSDK[272.20]LYR 4.22 IPI00449049 Natural 0.88 2 1259.6605 -0.0242 Ac-lysine n[43.02]AEVEETLK[272.20]R 4.8 IPI00063849 Natural 0.99 2 1342.7114 -0.0573 Ac-lysine n[43.02]AGLNSLEAVK[272.20]R 1.498 IPI00010779 Natural 0.89 2 1200.5838 -0.0171 Ac-lysine n[43.02]AK[272.20]WGEGDPR 1.62 IPI00030706 Natural 0.95 2 1352.6193 -0.0435 Ac-lysine n[43.02]ANK[272.20]GPSYGMSR 1.67 IPI00216138 Natural 0.96 2 1587.6718 -0.0715 Ac-lysine n[43.02]AQDQGEK[272.20]ENPMR 9.95 IPI00376798 Natural 0.97 2 1270.6496 -0.0619 Ac-lysine n[43.02]AQNLK[272.20]DLAGR 9.73 IPI00027252 Natural 0.91 4 2437.2985 -0.0258 Ac-lysine n[43.02]ASGVAVSDGVIK[272.20]VFNDMK[272.20]VR 3.97 IPI00012011 Natural 0.97 2 1755.8442 0.0335 Ac-lysine n[43.02]ASK[272.20]EMFEDTVEER 2.01 IPI00395865 Natural 0.98 3 1832.0258 0.0011 Ac-lysine n[43.02]ASSDIQVK[272.20]ELEK[272.20]R 1.84 IPI00479997 Natural 0.98 2 1445.721 -0.0022 Ac-lysine n[43.02]ASSGAGDPLDSK[272.20]R 7.96 IPI00022277 Natural 0.93 2 1389.7258 -0.0327 Ac-lysine n[43.02]ATDELATK[272.20]LSR 2.12 IPI00060181 Natural 0.84 2 1089.5659 -0.0427 Ac-lysine n[43.02]ATGQK[272.20]LMR 1.69 IPI00000792 Natural 0.97 2 1571.8774 -0.0231 Ac-lysine n[43.02]ATVTATTK[272.20]VPEIR 1.73 IPI00009104 Natural 0.97 2 1198.6695 -0.0461 Ac-lysine n[43.02]AVSTGVK[272.20]VPR 1.6 IPI00019600 Natural 0.89 2 1499.7362 -0.038 Ac-lysine n[43.02]AVTLDK[272.20]DAYYR 1.17 IPI00026970  182 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 114/ iTRAQ 115 IPI # Natural 0.95 3 2938.3593 0.0396 Ac-lysine n[43.02]DDDIAALVVDNGSGMC[160.03]K[272.20]AGFAGDDAPR 1.36 IPI00021439 Neo 0.87 2 1411.8107 0.013 Ac-lysine n[43.02]MEK[272.20]PSPLLVGR 1.69 IPI00009057 Natural 0.91 2 1630.8363 -0.0354 Ac-lysine n[43.02]MEK[272.20]TLETVPLER 1.71 IPI00396378 Neo 0.83 2 1178.5362 -0.0295 Ac-lysine n[43.02]MNK[272.20]DAQMR 2.05 IPI00024620 Natural 0.98 2 1553.7341 -0.0077 Ac-lysine n[43.02]MQPASAK[272.20]WYDR 1.28 IPI00015029 Natural 0.88 2 1099.6587 -0.0248 Ac-lysine n[43.02]SGGLLK[272.20]ALR 0.63 IPI00183500 Natural 0.97 2 1134.5299 -0.0818 Ac-lysine n[43.02]SK[272.20]NTVSSAR 1.46 IPI00007280 Natural 0.99 2 1678.8101 -0.0186 Ac-lysine n[43.02]SQAEFEK[272.20]AAEEVR 1.6 IPI00010182 Natural 1.00 3 1633.7825 -0.068 Ac-lysine n[43.02]SSK[272.20]TASTNNIAQAR 1.44 IPI00221232 Natural 0.96 2 1429.5753 -0.0447 Ac-lysine n[43.02]SSNEC[160.03]FK[272.20]C[160.03]GR 1.33 IPI00430813 Neo 0.94 2 1569.8349 -0.0499 Ac-lysine n[43.02]VDVSK[272.20]PDLTAALR 1.61 IPI00418471 Natural 1.00 4 1993.0509 -0.0358 Ac-lysine n[43.02]VEEVQK[272.20]HSVHTLVFR 17.4 IPI00002624   183 Appendix B.4 Peptides identified by iTRAQ-TAILS in membrane fractions of HFL1xHFL2. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 116) or sMT6EΔA (iTRAQ 117) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI # Neo 0.92 2 1254.7463 -0.0179 iTRAQ n[145.11]AAINQILGRR 0.43 IPI00003325 Neo 0.95 2 1254.7554 0.0137 iTRAQ n[145.11]AATLILEPAGR 0.38 IPI00220906 Neo 1.00 3 1666.9365 0.0488 iTRAQ n[145.11]ADAINTEFK[272.20]NTR 0.48 IPI00418471 Neo 1.00 3 1774.9752 0.0335 iTRAQ n[145.11]ADANLEAGNVK[272.20]ETR 0.22 IPI00328113 Neo 0.96 2 1303.5889 -0.0423 iTRAQ n[145.11]ADC[160.03]ISEPVNR 0.4 IPI00017895 Neo 0.99 2 1319.5981 0.0274 iTRAQ n[145.11]AEGPDEDSSNR 0.43 IPI00009904 Neo 0.99 2 1119.5694 0.0263 iTRAQ n[145.11]AGFAGDDAPR 0.326 IPI00008603 Natural 0.99 2 1324.6681 0.0184 iTRAQ n[145.11]ASEGGFTATGQR 0.44 IPI00003351 Natural 1.00 3 1855.9678 -0.0359 iTRAQ n[145.11]ASGANFEYIIAEK[272.20]R 0.3 IPI00024993 Natural 1.00 10 1916.8873 -0.0324 iTRAQ n[145.11]ASGGGVPTDEEQATGLER 0.33 IPI00021785 Neo 0.99 3 1595.8747 0.024 iTRAQ n[145.11]DAINTEFK[272.20]NTR 0.63 IPI00418471 Natural 1.00 3 1664.876 0.0269 iTRAQ n[145.11]DAPEEEDHVLVLR 0.419 IPI00010796 Natural 1.00 3 2265.1239 0.0392 iTRAQ n[145.11]DDEVDVDGTVEEDLGK[272.20]SR 0.35 IPI00027230 Neo 1.00 4 2885.4594 -0.081 iTRAQ n[145.11]DDLEALK[272.20]K[272.20]K[272.20]GC[160.03]PPDDIENPR 0.25 IPI00217561 Natural 1.00 3 1503.8209 0.0292 iTRAQ n[145.11]DGVGGDPAVALPHR 0.34 IPI00026530 Neo 0.99 3 1589.842 0.0163 iTRAQ n[145.11]DNADSSPVVDK[272.20]R 0.48 IPI00328753 Neo 0.99 3 1612.9537 0.0033 iTRAQ n[145.11]DNIQGITK[272.20]PAIR 0.6 IPI00453473 Neo 0.99 3 1665.9093 0.0166 iTRAQ n[145.11]DSK[272.20]VFGDLDQVR 0.34 IPI00184375 Neo 0.99 10 2555.1197 0.0734 iTRAQ n[145.11]DVK[272.20]C[160.03]DMEVSC[160.03]PDGYTC[160.03]C[160.03]R 0.33 IPI00181753 Natural 0.96 3 1402.7717 0.043 iTRAQ n[145.11]ESAGADTRPTVR 0.38 IPI00025796 Natural 0.99 2 1507.7948 0.0097 iTRAQ n[145.11]ESETTTSLVLER 0.34 IPI00029744 Neo 0.99 2 1497.7012 -0.0325 iTRAQ n[145.11]FQSDIGPYQSGR 0.33 IPI00749245 Neo 0.97 3 1677.7825 -0.023 iTRAQ n[145.11]GAFEGTHMGPFVER 0.61 IPI00100980 Neo 1.00 3 2368.0797 -0.015 iTRAQ n[145.11]GDVC[160.03]QDC[160.03]IQMVTDIQTAVR 0.55 IPI00012503 Natural 0.93 2 968.5062 -0.0099 iTRAQ n[145.11]GGVGEPGPR 0.36 IPI00028040 Neo 0.99 2 1457.6893 -0.0704 iTRAQ n[145.11]GVQVETISPGDGR 0.51 IPI00413778 Neo 0.98 2 1313.7609 0.0296 iTRAQ n[145.11]LEPTVIDEVR 0.38 IPI00166768 Neo 1.00 3 1877.0269 0.0028 iTRAQ n[145.11]LSGAPQASAADVVVVHGR 0.39 IPI00011522 Neo 1.00 3 1610.9477 0.013 iTRAQ n[145.11]LTEAPLNPK[272.20]ANR 0.39 IPI00008603 Natural 1.00 3 1440.8557 0.019 iTRAQ n[145.11]MAPEVLPK[272.20]PR 0.47 IPI00015972 Natural 0.99 3 1513.701 -0.0597 iTRAQ n[145.11]PGPTPSGTNVGSSGR 0.31 IPI00220835 Natural 1.00 3 1983.0511 0.0325 iTRAQ n[145.11]QK[272.20]TGTAEMSSILEER 0.27 IPI00440493 Natural 1.00 10 1730.8784 0.0157 iTRAQ n[145.11]SDMPPLTLEGIQDR 0.33 IPI00022442 Natural 1.00 10 1782.825 -0.0144 iTRAQ n[145.11]SDVLELTDDNFESR 0.39 IPI00025252 Neo 1.00 3 1962.9902 0.0495 iTRAQ n[145.11]SGTLGHPGSLDETTYER 0.33 IPI00217745  184 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI # Natural 1.00 3 1750.8092 0.0575 iTRAQ n[145.11]SHGSQETDEEFDAR 0.53 IPI00025086 Neo 0.94 3 1512.7866 0.0299 iTRAQ n[145.11]SK[272.20]DNEGSWFR 0.39 IPI00304435 Neo 0.97 3 1866.9589 -0.0458 iTRAQ n[145.11]SLADAINTEFK[272.20]NTR 0.22 IPI00418471 Neo 1.00 3 1764.8862 0.0462 iTRAQ n[145.11]SLEDALSSDTSGHFR 0.71 IPI00002459 Neo 0.99 2 1581.8851 0.0367 iTRAQ n[145.11]SPAGGPLEDVVIER 0.35 IPI00303300 Natural 0.98 2 1219.59 -0.0015 iTRAQ n[145.11]SQDASDGLQR 0.4 IPI00009276 Natural 1.00 3 1842.0493 0.0403 iTRAQ n[145.11]SSEAPPLINEDVK[272.20]R 0.485 IPI00025874 Neo 0.99 3 1615.8035 -0.0292 iTRAQ n[145.11]STVIHYEIPEER 0.25 IPI00001872 Neo 0.95 3 1497.8579 0.0072 iTRAQ n[145.11]TEAPLNPK[272.20]ANR 0.62 IPI00008603 Neo 1.00 3 1439.7878 0.0261 iTRAQ n[145.11]YVGDEAQSK[272.20]R 0.35 IPI00003269 Natural 1.00 3 1584.8604 0.0262 Ac-lysine n[43.02]AATASAGAGGIDGK[272.20]PR 0.33 IPI00219729 Natural 1.00 2 1328.764 0.0106 Ac-lysine n[43.02]AATTGSGVK[272.20]VPR 0.32 IPI00472498 Natural 1.00 10 1750.8356 0.0225 Ac-lysine n[43.02]ADK[272.20]EAAFDDAVEER 0.3 IPI00328319 Natural 0.98 2 1253.6487 0.0114 Ac-lysine n[43.02]AESSDK[272.20]LYR 0.37 IPI00449049 Natural 0.88 2 1259.6605 -0.0242 Ac-lysine n[43.02]AEVEETLK[272.20]R 0.4 IPI00063849 Natural 0.99 2 1342.7114 -0.0573 Ac-lysine n[43.02]AGLNSLEAVK[272.20]R 0.304 IPI00010779 Natural 0.96 3 1473.854 0.0146 Ac-lysine n[43.02]AK[272.20]PLTDSEK[272.20]R 0.85 IPI00004358 Natural 0.96 2 1587.6718 -0.0715 Ac-lysine n[43.02]AQDQGEK[272.20]ENPMR 0.34 IPI00376798 Natural 0.98 3 1832.0258 0.0011 Ac-lysine n[43.02]ASSDIQVK[272.20]ELEK[272.20]R 0.67 IPI00479997 Natural 0.99 2 1445.7413 0.0181 Ac-lysine n[43.02]ASSGAGDPLDSK[272.20]R 0.35 IPI00022277 Natural 0.93 2 1389.7258 -0.0327 Ac-lysine n[43.02]ATDELATK[272.20]LSR 0.5 IPI00060181 Natural 0.98 2 1630.8967 0.017 Ac-lysine n[43.02]AVPPTYADLGK[272.20]SAR 0.33 IPI00216308 Natural 0.99 2 1198.7444 0.0288 Ac-lysine n[43.02]AVSTGVK[272.20]VPR 0.42 IPI00019600 Natural 0.92 2 1499.8024 0.0282 Ac-lysine n[43.02]AVTLDK[272.20]DAYYR 0.41 IPI00026970 Natural 0.95 3 2938.3902 0.0705 Ac-lysine n[43.02]DDDIAALVVDNGSGMC[160.03]K[272.20]AGFAGDDAPR 0.37 IPI00021439 Natural 0.99 3 1847.9435 -0.0432 Ac-lysine n[43.02]GDAPSPEEK[272.20]LHLITR 0.39 IPI00007074 Natural 0.99 2 1672.9123 0.0183 Ac-lysine n[43.02]MDGIVPDIAVGTK[272.20]R 0.58 IPI00179964 Natural 0.99 3 1748.9533 -0.0009 Ac-lysine n[43.02]SGELPPNINIK[272.20]EPR 0.46 IPI00009368 Natural 0.96 2 1429.5753 -0.0447 Ac-lysine n[43.02]SSNEC[160.03]FK[272.20]C[160.03]GR 0.42 IPI00430813 Natural 0.96 2 1364.7313 0.0255 Ac-lysine n[43.02]TGYTPDEK[272.20]LR 0.28 IPI00219385   185 Appendix B.5 Peptides identified by iTRAQ-TAILS in membrane fractions of HFL1. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 116) or sMT6EΔA (iTRAQ 117) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI # Neo 0.92 2 1254.7463 -0.0179 iTRAQ n[145.11]AAINQILGRR 0.43 IPI00003325 Neo 0.98 2 1702.9756 0.0268 iTRAQ n[145.11]AAPELPVPTGGPAVGAR 0.45 IPI00007812 Neo 0.95 2 1254.7554 0.0137 iTRAQ n[145.11]AATLILEPAGR 0.38 IPI00220906 Neo 0.97 3 1666.9057 0.0175 iTRAQ n[145.11]ADAINTEFK[272.20]NTR 0.77 IPI00418471 Neo 1.00 3 1774.9752 0.0335 iTRAQ n[145.11]ADANLEAGNVK[272.20]ETR 0.3 IPI00328113 Neo 0.92 2 1303.6443 0.0131 iTRAQ n[145.11]ADC[160.03]ISEPVNR 0.47 IPI00017895 Neo 0.99 2 1319.5981 0.0274 iTRAQ n[145.11]AEGPDEDSSNR 0.56 IPI00009904 Neo 0.99 2 1119.5694 0.0263 iTRAQ n[145.11]AGFAGDDAPR 0.45 IPI00008603 Natural 1.00 3 2441.306 -0.0067 iTRAQ n[145.11]AIAAK[272.20]EK[272.20]DIQEESTFSSR 0.58 IPI00783271 Neo 0.95 3 1480.8527 0.0286 iTRAQ n[145.11]AINTEFK[272.20]NTR 0.71 IPI00418471 Natural 1.00 3 1969.0752 -0.0124 iTRAQ n[145.11]APSVPAAEPEYPK[272.20]GIR 0.53 IPI00172460 Natural 1.00 3 1856.0295 0.0258 iTRAQ n[145.11]ASGANFEYIIAEK[272.20]R 0.5 IPI00024993 Natural 0.99 2 1916.954 0.0342 iTRAQ n[145.11]ASGGGVPTDEEQATGLER 0.36 IPI00021785 Neo 0.94 3 1595.8718 0.0207 iTRAQ n[145.11]DAINTEFK[272.20]NTR 0.77 IPI00418471 Natural 1.00 3 1664.876 0.0269 iTRAQ n[145.11]DAPEEEDHVLVLR 0.53 IPI00010796 Natural 0.98 3 2264.7461 -0.3386 iTRAQ n[145.11]DDEVDVDGTVEEDLGK[272.20]SR 0.56 IPI00027230 Neo 0.94 4 2885.5283 -0.0121 iTRAQ n[145.11]DDLEALK[272.20]K[272.20]K[272.20]GC[160.03]PPDDIENPR 0.62 IPI00217561 Natural 1.00 3 1503.8209 0.0292 iTRAQ n[145.11]DGVGGDPAVALPHR 0.43 IPI00026530 Neo 0.99 3 1589.842 0.0163 iTRAQ n[145.11]DNADSSPVVDK[272.20]R 0.63 IPI00328753 Neo 0.99 3 1612.9537 0.0033 iTRAQ n[145.11]DNIQGITK[272.20]PAIR 0.81 IPI00453473 Neo 0.99 3 1665.9093 0.0166 iTRAQ n[145.11]DSK[272.20]VFGDLDQVR 0.53 IPI00184375 Neo 0.99 4 2555.1197 0.0734 iTRAQ n[145.11]DVK[272.20]C[160.03]DMEVSC[160.03]PDGYTC[160.03]C[160.03]R 0.4 IPI00181753 Neo 0.82 3 1897.0006 0.0181 iTRAQ n[145.11]EEGK[272.20]EVWDYVTVR 0.39 IPI00012426 Neo 0.95 2 1248.5643 0.0306 iTRAQ n[145.11]EGPDEDSSNR 0.46 IPI00009904 Natural 0.96 3 1402.7717 0.043 iTRAQ n[145.11]ESAGADTRPTVR 0.4 IPI00025796 Natural 0.99 2 1507.7948 0.0097 iTRAQ n[145.11]ESETTTSLVLER 0.51 IPI00029744 Neo 0.98 2 1497.7559 0.0222 iTRAQ n[145.11]FQSDIGPYQSGR 1.05 IPI00749245 Neo 1.00 3 2368.148 0.0533 iTRAQ n[145.11]GDVC[160.03]QDC[160.03]IQMVTDIQTAVR 0.5 IPI00012503 Neo 0.98 2 1048.5111 0.0052 iTRAQ n[145.11]GFAGDDAPR 0.49 IPI00008603 Natural 0.84 2 968.5332 0.0171 iTRAQ n[145.11]GGVGEPGPR 0.31 IPI00028040 Neo 0.84 2 1229.6903 0.0053 iTRAQ n[145.11]GQVITIGNER 0.91 IPI00003269 Neo 0.98 2 1457.7791 0.0194 iTRAQ n[145.11]GVQVETISPGDGR 0.58 IPI00413778 Neo 1.00 3 2259.0867 0.03 iTRAQ n[145.11]K[272.20]ESSETPDQFMTADETR 0.73 IPI00297160 Neo 0.84 3 2206.2136 0.0299 iTRAQ n[145.11]K[272.20]SYELPDGQVITIGNER 0.61 IPI00008603 Neo 0.98 2 1313.7609 0.0296 iTRAQ n[145.11]LEPTVIDEVR 0.58 IPI00166768  186 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI # Neo 0.98 3 1605.8575 0.0378 iTRAQ n[145.11]LNTPSDK[272.20]SEDGR 0.51 IPI00106966 Neo 1.00 3 1877.0269 0.0028 iTRAQ n[145.11]LSGAPQASAADVVVVHGR 0.55 IPI00011522 Neo 1.00 3 1610.9477 0.013 iTRAQ n[145.11]LTEAPLNPK[272.20]ANR 0.53 IPI00008603 Natural 1.00 3 1440.8401 0.0035 iTRAQ n[145.11]MAPEVLPK[272.20]PR 0.56 IPI00015972 Natural 0.98 3 1513.7891 0.0284 iTRAQ n[145.11]PGPTPSGTNVGSSGR 0.36 IPI00220835 Natural 1.00 3 1898.0651 0.0144 iTRAQ n[145.11]PSVPAAEPEYPK[272.20]GIR 0.75 IPI00172460 Neo 0.87 3 1531.8587 0.014 iTRAQ n[145.11]QK[272.20]LIEVDDER 0.53 IPI00021840 Natural 0.99 3 1983.0578 0.0391 iTRAQ n[145.11]QK[272.20]TGTAEMSSILEER 0.52 IPI00440493 Natural 0.99 2 1730.8856 0.0229 iTRAQ n[145.11]SDMPPLTLEGIQDR 0.42 IPI00022442 Natural 1.00 10 1782.8676 0.0279 iTRAQ n[145.11]SDVLELTDDNFESR 0.54 IPI00025252 Neo 1.00 3 1962.9902 0.0495 iTRAQ n[145.11]SGTLGHPGSLDETTYER 0.4 IPI00217745 Natural 1.00 3 1750.8092 0.0575 iTRAQ n[145.11]SHGSQETDEEFDAR 0.62 IPI00025086 Neo 0.93 3 1512.7817 0.025 iTRAQ n[145.11]SK[272.20]DNEGSWFR 0.55 IPI00304435 Neo 0.92 3 1867.0549 0.0506 iTRAQ n[145.11]SLADAINTEFK[272.20]NTR 0.4 IPI00418471 Neo 1.00 3 1764.8862 0.0462 iTRAQ n[145.11]SLEDALSSDTSGHFR 0.5 IPI00002459 Neo 0.99 2 1581.8851 0.0367 iTRAQ n[145.11]SPAGGPLEDVVIER 0.51 IPI00303300 Natural 0.90 2 1219.6125 0.021 iTRAQ n[145.11]SQDASDGLQR 0.7 IPI00009276 Natural 1.00 3 1842.0493 0.0403 iTRAQ n[145.11]SSEAPPLINEDVK[272.20]R 0.587 IPI00025874 Neo 0.94 3 1615.8425 0.0098 iTRAQ n[145.11]STVIHYEIPEER 0.4 IPI00001872 Neo 0.83 3 1497.852 0.0013 iTRAQ n[145.11]TEAPLNPK[272.20]ANR 0.73 IPI00008603 Natural 0.95 3 2791.3542 0.0525 iTRAQ n[145.11]TGSSAQEEASGVALGEAPDHSYESLR 0.44 IPI00011416 Neo 0.97 3 1477.8252 0.016 iTRAQ n[145.11]VSSAAQTEK[272.20]GGR 0.43 IPI00024317 Neo 0.80 3 1439.7924 0.0307 iTRAQ n[145.11]YVGDEAQSK[272.20]R 0.47 IPI00003269 Neo 0.98 2 1352.6924 0.0227 iTRAQ n[145.11]YVLDDSDGLGR 0.29 IPI00008790 Natural 0.93 2 1212.6752 0.0168 Ac-lysine n[43.02]AAEADGPLK[272.20]R 0.49 IPI00025292 Natural 0.85 2 1230.672 0.0241 Ac-lysine n[43.02]AAPSDGFK[272.20]PR 0.24 IPI00025347 Natural 1.00 3 1584.8604 0.0262 Ac-lysine n[43.02]AATASAGAGGIDGK[272.20]PR 0.44 IPI00219729 Natural 1.00 2 1328.764 0.0106 Ac-lysine n[43.02]AATTGSGVK[272.20]VPR 0.43 IPI00472498 Natural 0.99 2 1750.8487 0.0356 Ac-lysine n[43.02]ADK[272.20]EAAFDDAVEER 0.56 IPI00328319 Natural 0.98 2 1253.6487 0.0114 Ac-lysine n[43.02]AESSDK[272.20]LYR 0.78 IPI00449049 Natural 0.82 2 1259.7059 0.0216 Ac-lysine n[43.02]AEVEETLK[272.20]R 0.6 IPI00063849 Natural 0.96 2 1342.7743 0.0053 Ac-lysine n[43.02]AGLNSLEAVK[272.20]R 0.67 IPI00010779 Natural 0.98 3 1514.8633 -0.0027 Ac-lysine n[43.02]AK[272.20]PLTDQEK[272.20]R 0.95 IPI00783313 Natural 0.96 3 1473.854 0.0146 Ac-lysine n[43.02]AK[272.20]PLTDSEK[272.20]R 0.85 IPI00004358 Natural 0.96 2 1587.768 0.0247 Ac-lysine n[43.02]AQDQGEK[272.20]ENPMR 0.48 IPI00376798 Natural 0.98 3 1832.0664 0.0417 Ac-lysine n[43.02]ASSDIQVK[272.20]ELEK[272.20]R 0.93 IPI00479997 Natural 0.99 2 1445.7413 0.0181 Ac-lysine n[43.02]ASSGAGDPLDSK[272.20]R 0.46 IPI00022277 Natural 0.90 2 1389.7669 0.0084 Ac-lysine n[43.02]ATDELATK[272.20]LSR 0.85 IPI00060181 Natural 0.98 2 1630.8967 0.017 Ac-lysine n[43.02]AVPPTYADLGK[272.20]SAR 0.54 IPI00216308 Natural 0.99 2 1198.7444 0.0288 Ac-lysine n[43.02]AVSTGVK[272.20]VPR 0.59 IPI00019600 Natural 0.92 2 1499.8024 0.0282 Ac-lysine n[43.02]AVTLDK[272.20]DAYYR 0.78 IPI00026970 Natural 0.95 3 2938.3902 0.0705 Ac-lysine n[43.02]DDDIAALVVDNGSGMC[160.03]K[272.20]AGFAGDDAPR 0.54 IPI00021439 Natural 0.97 3 1848.0238 0.0371 Ac-lysine n[43.02]GDAPSPEEK[272.20]LHLITR 0.63 IPI00007074 Natural 0.99 2 1672.9123 0.0183 Ac-lysine n[43.02]MDGIVPDIAVGTK[272.20]R 0.71 IPI00179964  187 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI # Natural 0.81 3 1917.9868 0.0159 Ac-lysine n[43.02]MEEEGVK[272.20]EAGEK[272.20]PR 0.48 IPI00332493 Natural 0.99 3 1748.9533 -0.0009 Ac-lysine n[43.02]SGELPPNINIK[272.20]EPR 0.46 IPI00009368 Natural 0.89 3 1844.0383 0.05 Ac-lysine n[43.02]SK[272.20]SESPK[272.20]EPEQLR 0.89 IPI00215965 Natural 0.93 2 1429.637 0.017 Ac-lysine n[43.02]SSNEC[160.03]FK[272.20]C[160.03]GR 0.61 IPI00430813 Neo 0.92 3 1997.0712 0.1001 Ac-lysine n[43.02]TDLEK[272.20]DIISDTSGDFR 1.78 IPI00334627 Natural 0.96 2 1364.7313 0.0255 Ac-lysine n[43.02]TGYTPDEK[272.20]LR 0.35 IPI00219385   188 Appendix B.6 Peptides identified by iTRAQ-TAILS in membrane fractions of HFL2. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 116) or sMT6EΔA (iTRAQ 117) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI # Neo 0.95 2 1002.5231 -0.0349 iTRAQ n[145.11]AAISQVDR 0.38 IPI00014587 Neo 0.98 3 1695.7414 -0.0243 iTRAQ n[145.11]AAMADTFLEHMC[160.03]R 0.27 IPI00220644 Natural 0.95 2 1200.5745 -0.0112 iTRAQ n[145.11]AANYSSTSTR 0.26 IPI00301280 Neo 1.00 3 1758.0072 0.0445 iTRAQ n[145.11]AAQTSPSPK[272.20]AGAATGR 0.29 IPI00303476 Neo 1.00 3 1666.9365 0.0488 iTRAQ n[145.11]ADAINTEFK[272.20]NTR 0.13 IPI00418471 Neo 1.00 3 1774.9705 0.0288 iTRAQ n[145.11]ADANLEAGNVK[272.20]ETR 0.11 IPI00328113 Neo 0.96 2 1303.5889 -0.0423 iTRAQ n[145.11]ADC[160.03]ISEPVNR 0.27 IPI00017895 Neo 0.98 2 1319.5845 0.0138 iTRAQ n[145.11]AEGPDEDSSNR 0.19 IPI00009904 Natural 0.87 2 1232.6904 -0.0095 iTRAQ n[145.11]AELPPVPGGPR 0.28 IPI00290614 Natural 0.93 2 1341.7489 -0.0249 iTRAQ n[145.11]AEVQVLVLDGR 0.48 IPI00304612 Neo 0.99 2 1119.5366 -0.0064 iTRAQ n[145.11]AGFAGDDAPR 0.243 IPI00008603 Natural 1.00 3 2126.0824 -0.0458 iTRAQ n[145.11]AGPPPIQDGEFTFLLPAGR 0.27 IPI00009976 Neo 0.92 2 1345.6698 -0.0259 iTRAQ n[145.11]AILEDEQTQR 0.39 IPI00215743 Neo 0.99 3 2145.2496 0.0349 iTRAQ n[145.11]AIVFIK[272.20]QPSSQDALQGR 0.19 IPI00168813 Neo 0.92 4 2267.3767 0.0003 iTRAQ n[145.11]ALAPSTMK[272.20]IK[272.20]IIAPPER 0.18 IPI00008603 Neo 0.88 3 1504.8559 0.0106 iTRAQ n[145.11]ALK[272.20]GTNESLER 0.2 IPI00418471 Natural 1.00 3 1519.766 -0.0092 iTRAQ n[145.11]ALSAETESHIYR 0.21 IPI00013026 Neo 0.85 2 1224.7374 -0.0302 iTRAQ n[145.11]ALTQPLGLLR 0.3 IPI00102685 Natural 1.00 3 1700.8666 -0.0121 iTRAQ n[145.11]APAMQPAEIQFAQR 0.33 IPI00032374 Natural 0.88 2 1159.5558 -0.0186 iTRAQ n[145.11]APDPGFQER 0.26 IPI00296141 Natural 0.91 2 1214.4876 -0.1141 iTRAQ n[145.11]APDQDEIQR 0.317 IPI00021794 Natural 0.92 3 1790.017 -0.0011 iTRAQ n[145.11]APLDLDK[272.20]YVEIAR 0.1 IPI00012970 Natural 0.99 4 2393.2701 0.0227 iTRAQ n[145.11]APPAAGQQQPPREPPAAPGAWR 0.28 IPI00002802 Natural 0.98 3 1694.918 -0.0046 iTRAQ n[145.11]APVEHVVADAGAFLR 0.26 IPI00022373 Neo 0.91 2 1114.5828 -0.0025 iTRAQ n[145.11]AQPPSSAASR 0.32 IPI00442069 Natural 0.85 2 1100.6072 0.0012 iTRAQ n[145.11]AQTAAATAPR 0.25 IPI00294911 Natural 0.99 2 1324.6148 -0.0349 iTRAQ n[145.11]ASEGGFTATGQR 0.44 IPI00003351 Natural 1.00 3 1855.9678 -0.0359 iTRAQ n[145.11]ASGANFEYIIAEK[272.20]R 0.15 IPI00024993 Natural 1.00 3 1916.8873 -0.0324 iTRAQ n[145.11]ASGGGVPTDEEQATGLER 0.26 IPI00021785 Natural 0.93 4 2022.0411 0.0352 iTRAQ n[145.11]ASHMTK[272.20]DMFPGPYPR 0.17 IPI00028883 Neo 0.98 2 1208.5182 -0.1089 iTRAQ n[145.11]ASSPGGVYATR 0.163 IPI00418471 Neo 0.90 2 1568.8132 0.0175 iTRAQ n[145.11]ATLDVYNPFETR 0.31 IPI00453116 Neo 0.88 2 1088.6304 -0.016 iTRAQ n[145.11]AVFPSIVGR 0.23 IPI00008603 Neo 1.00 4 2438.3102 -0.0093 iTRAQ n[145.11]AVPIAQK[272.20]SEPHSLSSEALMR 0.26 IPI00008418 Neo 0.92 2 1081.6116 -0.0251 iTRAQ n[145.11]AVTVAPPGAR 0.2 IPI00479217  189 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI # Neo 0.85 2 1074.5668 -0.0276 iTRAQ n[145.11]AWDLASLR 0.22 IPI00045800 Neo 0.97 3 2008.021 0.0071 iTRAQ n[145.11]C[160.03]EVDALK[272.20]GTNESLER 0.14 IPI00418471 Natural 0.91 4 3277.8942 0.0542 iTRAQ n[145.11]DAAVSFAK[272.20]DFLAGGVAAAISK[272.20]TAVAPIER 0.1 IPI00007188 Neo 0.99 3 1595.8747 0.024 iTRAQ n[145.11]DAINTEFK[272.20]NTR 0.1 IPI00418471 Natural 1.00 3 1664.8461 -0.003 iTRAQ n[145.11]DAPEEEDHVLVLR 0.32 IPI00010796 Natural 1.00 3 2265.1239 0.0392 iTRAQ n[145.11]DDEVDVDGTVEEDLGK[272.20]SR 0.16 IPI00027230 Neo 1.00 4 2885.4594 -0.081 iTRAQ n[145.11]DDLEALK[272.20]K[272.20]K[272.20]GC[160.03]PPDDIENPR 0.06 IPI00217561 Natural 1.00 3 1503.6877 -0.104 iTRAQ n[145.11]DGVGGDPAVALPHR 0.3 IPI00026530 Neo 0.98 2 1625.8468 -0.0213 iTRAQ n[145.11]DIPPITC[160.03]VQNGLR 0.35 IPI00297646 Neo 0.91 4 2445.2407 -0.0968 iTRAQ n[145.11]DK[272.20]EK[272.20]NLLHVTDTGVGMTR 0.23 IPI00027230 Neo 0.99 3 1589.8502 0.0245 iTRAQ n[145.11]DNADSSPVVDK[272.20]R 0.1 IPI00328753 Neo 0.93 3 1612.9581 0.0077 iTRAQ n[145.11]DNIQGITK[272.20]PAIR 0.15 IPI00453473 Neo 0.96 3 1665.8784 -0.0146 iTRAQ n[145.11]DSK[272.20]VFGDLDQVR 0.14 IPI00184375 Neo 0.99 3 2539.0883 0.0366 iTRAQ n[145.11]DVK[272.20]C[160.03]DMEVSC[160.03]PDGYTC[160.03]C[160.03]R 0.27 IPI00181753 Neo 1.00 3 1658.776 0.0133 iTRAQ n[145.11]DVLLEAC[160.03]C[160.03]ADGHR 1.17 IPI00218803 Neo 0.98 2 1330.6426 -0.0421 iTRAQ n[145.11]EAGLETESPVR 0.23 IPI00009885 Neo 1.00 3 2290.0943 -0.0997 iTRAQ n[145.11]ELGPLHQQESQSLQLHFR 0.4 IPI00306604 Natural 0.92 3 1402.7165 -0.0122 iTRAQ n[145.11]ESAGADTRPTVR 0.34 IPI00025796 Natural 0.98 2 1507.7247 -0.06 iTRAQ n[145.11]ESETTTSLVLER 0.28 IPI00029744 Neo 0.99 3 1779.8578 -0.0118 iTRAQ n[145.11]ETVHC[160.03]DLQPVGPER 0.22 IPI00017567 Neo 0.90 3 1848.0212 0.0375 iTRAQ n[145.11]EVDALK[272.20]GTNESLER 0.07 IPI00418471 Neo 0.88 3 2659.1705 -0.1312 iTRAQ n[145.11]FEK[272.20]NEAIQAAHDAVAQEGQC[160.03]R 0.53 IPI00018352 Neo 0.98 2 1396.5923 -0.0414 iTRAQ n[145.11]FGSDQSENVDR 0.26 IPI00258804 Neo 0.95 2 1278.6862 -0.0014 iTRAQ n[145.11]FNLDVMGALR 0.27 IPI00014478 Natural 0.86 2 1225.6445 0.0228 iTRAQ n[145.11]FNPFVTSDR 0.33 IPI00007144 Neo 0.99 2 1497.7012 -0.0325 iTRAQ n[145.11]FQSDIGPYQSGR 0.18 IPI00749245 Neo 0.99 3 2014.1094 0.0367 iTRAQ n[145.11]FSLADAINTEFK[272.20]NTR 0.11 IPI00418471 Neo 0.97 3 1677.7825 -0.023 iTRAQ n[145.11]GAFEGTHMGPFVER 0.61 IPI00100980 Natural 0.95 2 1127.6458 0.0141 iTRAQ n[145.11]GAGGALFVHR 0.49 IPI00291328 Neo 0.97 2 1238.6849 -0.0256 iTRAQ n[145.11]GAPEVLVSAPR 0.39 IPI00143921 Neo 1.00 3 2368.0797 -0.015 iTRAQ n[145.11]GDVC[160.03]QDC[160.03]IQMVTDIQTAVR 0.58 IPI00012503 Neo 0.86 2 1381.6747 -0.0035 iTRAQ n[145.11]GGTTMYPGIADR 0.31 IPI00008603 Natural 0.93 2 968.5062 -0.0099 iTRAQ n[145.11]GGVGEPGPR 0.39 IPI00028040 Natural 0.96 3 1671.9224 0.0036 iTRAQ n[145.11]GK[272.20]DYYQTLGLAR 0.13 IPI00015947 Neo 0.85 2 942.5436 -0.0301 iTRAQ n[145.11]GLAAAALGR 0.42 IPI00514494 Neo 1.00 3 1391.823 -0.0137 iTRAQ n[145.11]GLHLGVTPSVIR 0.24 IPI00298237 Neo 0.91 2 1317.672 -0.0447 iTRAQ n[145.11]GNPITIFQER 0.29 IPI00219018 Neo 0.90 2 1361.692 -0.0137 iTRAQ n[145.11]GPNPFTTLTDR 0.55 IPI00019901 Neo 0.95 3 1516.8771 0.0132 iTRAQ n[145.11]GPVLGLK[272.20]EC[160.03]TR 0.27 IPI00012503 Natural 1.00 3 2171.0577 0.05 iTRAQ n[145.11]GQNDLMGTAEDFADQFLR 0.41 IPI00005737 Neo 0.90 3 1428.81 0.0131 iTRAQ n[145.11]GQTFEYLK[272.20]R 0.26 IPI00218337 Neo 0.97 2 1395.71 -0.0169 iTRAQ n[145.11]GSPPGISTSFFR 0.31 IPI00414591 Natural 0.87 2 1332.6418 -0.0279 iTRAQ n[145.11]GSTWGSPGWVR 0.25 IPI00031000 Neo 0.85 2 1048.4855 -0.0416 iTRAQ n[145.11]GTNESLER 0.37 IPI00025363  190 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI # Neo 0.99 2 1457.6893 -0.0704 iTRAQ n[145.11]GVQVETISPGDGR 0.42 IPI00413778 Neo 0.84 4 2491.1319 -0.0991 iTRAQ n[145.11]HAFEK[272.20]EWIEC[160.03]AHGIGYTR 0.23 IPI00220063 Neo 0.92 3 1519.8405 0.0178 iTRAQ n[145.11]IERPTYTNLNR 0.27 IPI00007750 Neo 0.93 2 1168.6727 -0.0323 iTRAQ n[145.11]IGGIGTVPVGR 0.17 IPI00014424 Neo 0.87 2 1059.5592 -0.0276 iTRAQ n[145.11]IISAPEMR 0.61 IPI00029236 Neo 0.98 2 1108.5876 -0.0121 iTRAQ n[145.11]INVTDFTR 0.2 IPI00019502 Neo 0.99 3 1651.9259 -0.003 iTRAQ n[145.11]IQNK[272.20]PLYFADR 0.29 IPI00418169 Neo 1.00 3 1741.0094 -0.0243 iTRAQ n[145.11]ITPAEVGVLVGK[272.20]DR 0.21 IPI00216691 Neo 1.00 3 1391.7463 0.0062 iTRAQ n[145.11]K[272.20]AGFAGDDAPR 0.3 IPI00008603 Neo 0.99 3 1622.9318 0.0083 iTRAQ n[145.11]K[272.20]IYVVDLSNER 0.2 IPI00290039 Neo 0.99 3 1291.7626 0.0139 iTRAQ n[145.11]K[272.20]LPASFDAR 0.1 IPI00295741 Neo 0.99 3 1779.9437 -0.029 iTRAQ n[145.11]LADAINTEFK[272.20]NTR 0.08 IPI00418471 Neo 0.94 2 1313.7316 0.0004 iTRAQ n[145.11]LEPTVIDEVR 0.29 IPI00166768 Neo 0.96 2 1175.6494 -0.0323 iTRAQ n[145.11]LGSATALMIR 0.28 IPI00006970 Neo 0.98 2 1373.6334 -0.0943 iTRAQ n[145.11]LGSDAELQIER 0.31 IPI00182126 Neo 1.00 3 1334.8115 -0.0041 iTRAQ n[145.11]LHLGVTPSVIR 0.36 IPI00298237 Neo 1.00 3 1404.8061 -0.0276 iTRAQ n[145.11]LK[272.20]LPASFDAR 0.19 IPI00295741 Neo 0.97 3 1554.8357 -0.0131 iTRAQ n[145.11]LPDGQVITIGNER 0.32 IPI00003269 Neo 0.86 3 1240.6713 -0.0085 iTRAQ n[145.11]LQVNFHSPR 0.49 IPI00002478 Natural 0.99 3 1937.9102 -0.0475 iTRAQ n[145.11]LRPGDC[160.03]EVC[160.03]ISYLGR 0.29 IPI00328748 Neo 1.00 3 1876.9835 -0.0402 iTRAQ n[145.11]LSGAPQASAADVVVVHGR 0.24 IPI00011522 Neo 1.00 3 1546.8003 -0.0224 iTRAQ n[145.11]LSNTTAIAEAWAR 0.37 IPI00007750 Neo 0.99 2 1501.7584 -0.0063 iTRAQ n[145.11]LSQTQGPPDYPR 0.24 IPI00013195 Neo 0.99 3 1610.9424 0.0076 iTRAQ n[145.11]LTEAPLNPK[272.20]ANR 0.21 IPI00008603 Neo 0.93 2 1179.6152 -0.0105 iTRAQ n[145.11]LTFEELER 0.28 IPI00180404 Neo 0.98 3 1971.08 -0.0377 iTRAQ n[145.11]LVASNLNLK[272.20]PGEC[160.03]LR 0.18 IPI00219219 Neo 1.00 3 2200.0627 -0.014 iTRAQ n[145.11]LYSSSDDVIELTPSNFNR 0.25 IPI00299571 Natural 1.00 3 1440.8557 0.019 iTRAQ n[145.11]MAPEVLPK[272.20]PR 0.31 IPI00015972 Natural 0.98 2 1819.8795 0.0108 iTRAQ n[145.11]MFLQYYLNEQGDR 0.25 IPI00032853 Natural 0.99 3 1418.8052 -0.0475 iTRAQ n[145.11]MK[272.20]DSLVLLGR 0.2 IPI00008791 Natural 0.99 3 1628.8264 -0.0323 iTRAQ n[145.11]MK[272.20]FNPFVTSDR 0.22 IPI00007144 Natural 0.98 4 2164.3709 0.167 iTRAQ n[145.11]MK[272.20]HYEVEILDAK[272.20]TR 0.08 IPI00100656 Natural 0.97 2 1466.7887 0.033 iTRAQ n[145.11]MLSLDFLDDVR 0.3 IPI00104128 Natural 0.98 2 1611.8666 0.0061 iTRAQ n[145.11]MPPYTVVYFPVR 0.36 IPI00219757 Neo 1.00 3 1654.8555 -0.0392 iTRAQ n[145.11]MQNPQILAALQER 0.24 IPI00023860 Neo 1.00 3 1842.9214 -0.0203 iTRAQ n[145.11]MSTGTFVVSQPLNYR 0.47 IPI00479877 Natural 0.91 2 1365.7104 -0.0092 iTRAQ n[145.11]MVNFTVDQIR 0.26 IPI00186290 Natural 0.89 2 1244.7278 -0.0119 iTRAQ n[145.11]MVNLLQIVR 0.33 IPI00025725 Neo 1.00 3 1937.1405 -0.0332 iTRAQ n[145.11]MVPPVQVSPLIK[272.20]LGR 0.21 IPI00218848 Natural 0.96 2 1182.5975 -0.0212 iTRAQ n[145.11]MYLQVETR 0.3 IPI00001578 Neo 0.94 3 1478.8247 0.016 iTRAQ n[145.11]NEATGGK[272.20]YVPR 0.21 IPI00007752 Natural 0.92 2 1177.5681 -0.0168 iTRAQ n[145.11]PDYLGADQR 0.24 IPI00021435 Natural 0.99 3 1642.8821 0.0021 iTRAQ n[145.11]PFLELDTNLPANR 0.3 IPI00293867 Natural 1.00 3 2241.1758 -0.0119 iTRAQ n[145.11]PGGLLLGDVAPNFEANTTVGR 0.24 IPI00220301  191 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI # Natural 1.00 3 1813.8772 -0.0245 iTRAQ n[145.11]PGHLQEGFGC[160.03]VVTNR 0.42 IPI00410693 Natural 0.99 3 1513.701 -0.0597 iTRAQ n[145.11]PGPTPSGTNVGSSGR 0.26 IPI00220835 Natural 1.00 3 2003.1147 0.01 iTRAQ n[145.11]PGVTVK[272.20]DVNQQEFVR 0.18 IPI00215780 Natural 0.99 10 1430.7768 -0.0058 iTRAQ n[145.11]PMFIVNTNVPR 0.24 IPI00293276 Natural 0.93 3 1618.8616 -0.0571 iTRAQ n[145.11]PNFSGNWK[272.20]IIR 0.11 IPI00216088 Natural 0.97 2 1613.7546 -0.005 iTRAQ n[145.11]PQYQTWEEFSR 0.22 IPI00216125 Natural 1.00 3 1787.0144 -0.0153 iTRAQ n[145.11]PSK[272.20]GPLQSVQVFGR 0.15 IPI00221092 Natural 1.00 3 1695.9873 -0.0042 iTRAQ n[145.11]PVPPLPEYGGK[272.20]VR 0.16 IPI00029133 Natural 1.00 3 1983.0511 0.0325 iTRAQ n[145.11]QK[272.20]TGTAEMSSILEER 0.2 IPI00440493 Neo 0.98 3 1616.8665 -0.0132 iTRAQ n[145.11]QSIYPLHDVFVR 0.36 IPI00419880 Neo 0.94 2 1252.6479 -0.0528 iTRAQ n[145.11]SAADVVVVHGR 0.27 IPI00011522 Natural 0.98 2 1147.6134 -0.0553 iTRAQ n[145.11]SASVVSVISR 0.28 IPI00009407 Natural 1.00 3 1730.8784 0.0157 iTRAQ n[145.11]SDMPPLTLEGIQDR 0.3 IPI00022442 Natural 1.00 3 1782.825 -0.0144 iTRAQ n[145.11]SDVLELTDDNFESR 0.27 IPI00025252 Neo 0.87 2 1269.627 -0.0207 iTRAQ n[145.11]SFVNDIFER 0.18 IPI00003935 Neo 0.97 2 1468.7003 -0.0099 iTRAQ n[145.11]SGGTTMYPGIADR 0.28 IPI00008603 Neo 0.86 2 858.3944 -0.0737 iTRAQ n[145.11]SGLPGER 0.52 IPI00304962 Neo 1.00 3 1826.905 0.0403 iTRAQ n[145.11]SGMC[160.03]K[272.20]AGFAGDDAPR 0.16 IPI00021439 Neo 0.99 3 1962.9338 -0.0067 iTRAQ n[145.11]SGTLGHPGSLDETTYER 0.3 IPI00217745 Natural 1.00 3 1750.7692 0.0176 iTRAQ n[145.11]SHGSQETDEEFDAR 0.41 IPI00025086 Natural 1.00 3 1649.7699 -0.0221 iTRAQ n[145.11]SHIEDQAEQFFR 0.46 IPI00022543 Neo 1.00 3 1875.9457 -0.047 iTRAQ n[145.11]SIAAHLDNQVPVESPR 0.27 IPI00018120 Neo 0.94 3 1512.7866 0.0299 iTRAQ n[145.11]SK[272.20]DNEGSWFR 0.12 IPI00304435 Neo 0.97 3 1866.9589 -0.0458 iTRAQ n[145.11]SLADAINTEFK[272.20]NTR 0.13 IPI00418471 Neo 1.00 3 1764.8292 -0.0105 iTRAQ n[145.11]SLEDALSSDTSGHFR 0.83 IPI00002459 Neo 0.96 3 1624.8518 0.0218 iTRAQ n[145.11]SLEDENK[272.20]EAFR 0.24 IPI00010800 Neo 0.98 2 1486.8488 -0.0139 iTRAQ n[145.11]SNIPFITVPLSR 0.28 IPI00008982 Neo 0.98 2 1581.8367 -0.012 iTRAQ n[145.11]SPAGGPLEDVVIER 0.25 IPI00303300 Neo 1.00 3 1522.7745 -0.0482 iTRAQ n[145.11]SPALTIENEHIR 0.36 IPI00012989 Natural 0.98 2 1219.59 -0.0015 iTRAQ n[145.11]SQDASDGLQR 0.31 IPI00009276 Natural 0.99 3 1842.0448 0.0358 iTRAQ n[145.11]SSEAPPLINEDVK[272.20]R 0.14 IPI00025874 Neo 0.97 2 1252.5825 -0.0345 iTRAQ n[145.11]SSGSGPFTDVR 0.16 IPI00022418 Neo 1.00 3 2197.2651 0.0674 iTRAQ n[145.11]SSLGAPAISAASFLQDLIHR 0.25 IPI00479918 Neo 0.87 2 1137.5339 -0.0561 iTRAQ n[145.11]SSPGGVYATR 0.11 IPI00418471 Neo 0.99 3 1573.9237 0.021 iTRAQ n[145.11]SSSGVIPNEK[272.20]IR 0.14 IPI00154473 Neo 0.88 2 1146.5478 -0.0637 iTRAQ n[145.11]STAAQQELR 0.16 IPI00019502 Neo 0.99 2 1390.7429 -0.0108 iTRAQ n[145.11]STISEVALQSGR 0.25 IPI00419869 Neo 1.00 3 1856.9906 -0.0171 iTRAQ n[145.11]STQAATQVVLNVPETR 0.3 IPI00289535 Neo 0.99 3 1615.8035 -0.0292 iTRAQ n[145.11]STVIHYEIPEER 0.19 IPI00001872 Neo 0.83 2 1094.4916 -0.0055 iTRAQ n[145.11]SVMC[160.03]PDAR 0.44 IPI00182138 Neo 0.83 2 1221.5477 -0.0271 iTRAQ n[145.11]SYSPEPDQR 0.22 IPI00298237 Neo 0.95 3 1497.8579 0.0072 iTRAQ n[145.11]TEAPLNPK[272.20]ANR 0.27 IPI00008603 Natural 0.84 3 1466.822 0.0243 iTRAQ n[145.11]TGYTPDEK[272.20]LR 0.17 IPI00219385 Natural 0.99 3 1612.7872 0.0305 iTRAQ n[145.11]THEAEQNDSVSPR 0.2 IPI00005564  192 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI # Neo 1.00 3 1897.0488 0.0153 iTRAQ n[145.11]TK[272.20]PPQC[160.03]VDIPADLR 0.13 IPI00749245 Neo 0.92 2 1796.8541 0.009 iTRAQ n[145.11]TTFNIQDGPDFQDR 0.31 IPI00017799 Natural 0.82 2 1017.5271 -0.0316 iTRAQ n[145.11]VAGMLMPR 0.24 IPI00014898 Neo 0.98 3 1718.9706 0.0299 iTRAQ n[145.11]VDALK[272.20]GTNESLER 0.15 IPI00418471 Neo 1.00 3 1671.9564 -0.0203 iTRAQ n[145.11]VDVSK[272.20]PDLTAALR 0.09 IPI00418471 Neo 0.88 2 1258.6309 -0.0328 iTRAQ n[145.11]VELQELNDR 0.17 IPI00418471 Neo 0.95 2 1023.5647 -0.03 iTRAQ n[145.11]VGPAGAVGPR 0.2 IPI00304962 Neo 0.98 2 1619.8545 0.0238 iTRAQ n[145.11]VGSLNLEELSEMR 0.25 IPI00186581 Natural 1.00 3 1443.8951 -0.0216 iTRAQ n[145.11]VK[272.20]LFIGNLPR 0.14 IPI00003704 Natural 0.95 2 1307.6928 -0.0279 iTRAQ n[145.11]VLAELYVSDR 0.29 IPI00306960 Natural 0.98 2 1821.0456 0.0449 iTRAQ n[145.11]VLLESEQFLTELTR 0.27 IPI00293434 Natural 0.89 3 1612.9454 -0.0123 iTRAQ n[145.11]VMEK[272.20]PSPLLVGR 0.13 IPI00009057 Natural 0.85 2 949.4195 -0.0212 iTRAQ n[145.11]VNDGDMR 0.45 IPI00023673 Natural 0.94 2 1234.6738 -0.0053 iTRAQ n[145.11]VNFTVDQIR 0.279 IPI00186290 Neo 0.96 3 1457.8742 -0.0067 iTRAQ n[145.11]VSK[272.20]PDLTAALR 0.12 IPI00418471 Neo 0.90 3 1550.9031 0.0334 iTRAQ n[145.11]VSTSSMGTLPK[272.20]R 0.18 IPI00293564 Neo 0.98 2 1316.6614 -0.0233 iTRAQ n[145.11]VSVPWDDSLR 0.18 IPI00010800 Neo 0.99 3 1525.9484 0.03 iTRAQ n[145.11]VVPGGDLAK[272.20]VQR 0.13 IPI00007750 Natural 1.00 4 1863.9208 -0.0505 iTRAQ n[145.11]WELTILHTNDVHSR 0.27 IPI00009456 Neo 0.94 3 2140.9045 -0.1312 iTRAQ n[145.11]WK[272.20]FEHC[160.03]NFNDVTTR 0.4 IPI00011302 Neo 0.85 4 2231.8926 -0.0794 iTRAQ n[145.11]YEC[160.03]GEK[272.20]GHYAYDC[160.03]HR 0.41 IPI00003377 Neo 1.00 3 1439.7878 0.0261 iTRAQ n[145.11]YVGDEAQSK[272.20]R 0.2 IPI00003269 Natural 0.94 3 1828.9376 -0.0105 Ac-lysine n[43.02]AAGFK[272.20]TVEPLEYYR 0.45 IPI00552920 Natural 1.00 3 1584.8009 -0.0328 Ac-lysine n[43.02]AATASAGAGGIDGK[272.20]PR 0.28 IPI00219729 Natural 0.97 3 1737.9 0.0006 Ac-lysine n[43.02]AATFFGEVVK[272.20]APC[160.03]R 0.2 IPI00030770 Natural 0.98 2 1328.6865 -0.0672 Ac-lysine n[43.02]AATTGSGVK[272.20]VPR 0.25 IPI00472498 Natural 0.92 2 1199.6644 -0.0351 Ac-lysine n[43.02]AAVDLEK[272.20]LR 0.13 IPI00332371 Natural 0.95 3 1797.0327 -0.039 Ac-lysine n[43.02]AAVK[272.20]TLNPK[272.20]AEVAR 0.13 IPI00027626 Natural 0.99 3 2157.0122 -0.1034 Ac-lysine n[43.02]AC[160.03]GLVASNLNLK[272.20]PGEC[160.03]LR 0.38 IPI00219219 Natural 0.87 2 1356.7316 -0.0167 Ac-lysine n[43.02]ADEIAK[272.20]AQVAR 0.2 IPI00239077 Natural 1.00 3 1750.8356 0.0225 Ac-lysine n[43.02]ADK[272.20]EAAFDDAVEER 0.22 IPI00328319 Natural 0.98 3 1764.8383 -0.006 Ac-lysine n[43.02]ADLAEC[160.03]NIK[272.20]VMC[160.03]R 0.21 IPI00012837 Natural 0.99 3 1798.9884 -0.0026 Ac-lysine n[43.02]ADLDK[272.20]LNIDSIIQR 0.29 IPI00005705 Natural 1.00 3 1845.8797 -0.028 Ac-lysine n[43.02]ADLEEQLSDEEK[272.20]VR 0.33 IPI00026182 Natural 0.82 2 1571.8656 0.0229 Ac-lysine n[43.02]ADPK[272.20]YADLPGIAR 0.2 IPI00220503 Natural 0.91 2 1459.6464 -0.0383 Ac-lysine n[43.02]ADQGEK[272.20]ENPMR 0.25 IPI00746438 Natural 0.99 3 2056.0095 0.0137 Ac-lysine n[43.02]AEDWLDC[160.03]PALGPGWK[272.20]R 0.3 IPI00438701 Natural 0.98 2 1253.602 -0.0353 Ac-lysine n[43.02]AESSDK[272.20]LYR 0.22 IPI00449049 Natural 0.88 2 1259.6605 -0.0242 Ac-lysine n[43.02]AEVEETLK[272.20]R 0.3 IPI00063849 Natural 1.00 3 2114.137 -0.0387 Ac-lysine n[43.02]AFLASGPYLTHQQK[272.20]VLR 0.35 IPI00255052 Natural 0.94 2 1343.7893 -0.0001 Ac-lysine n[43.02]AGITTIEAVK[272.20]R 0.25 IPI00218319 Natural 0.99 2 1342.7114 -0.0573 Ac-lysine n[43.02]AGLNSLEAVK[272.20]R 0.247 IPI00010779 Natural 0.83 2 1398.8049 -0.009 Ac-lysine n[43.02]AK[272.20]LLSC[160.03]VLGPR 0.34 IPI00033075 Natural 1.00 3 2041.0353 0.0406 Ac-lysine n[43.02]AK[272.20]VSELYDVTWEEMR 0.3 IPI00014149  193 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI # Natural 0.89 2 1200.5838 -0.0171 Ac-lysine n[43.02]AK[272.20]WGEGDPR 0.22 IPI00030706 Natural 0.94 2 1326.7329 -0.03 Ac-lysine n[43.02]ALETVPK[272.20]DLR 0.17 IPI00002895 Natural 0.95 2 1352.6193 -0.0435 Ac-lysine n[43.02]ANK[272.20]GPSYGMSR 0.21 IPI00216138 Natural 0.96 2 1587.6718 -0.0715 Ac-lysine n[43.02]AQDQGEK[272.20]ENPMR 0.27 IPI00376798 Natural 0.97 2 1270.6496 -0.0619 Ac-lysine n[43.02]AQNLK[272.20]DLAGR 0.258 IPI00027252 Natural 0.91 4 2437.2985 -0.0258 Ac-lysine n[43.02]ASGVAVSDGVIK[272.20]VFNDMK[272.20]VR 0.17 IPI00012011 Natural 0.97 2 1755.8442 0.0335 Ac-lysine n[43.02]ASK[272.20]EMFEDTVEER 0.21 IPI00395865 Natural 0.98 3 1832.0258 0.0011 Ac-lysine n[43.02]ASSDIQVK[272.20]ELEK[272.20]R 0.21 IPI00479997 Natural 0.98 2 1445.721 -0.0022 Ac-lysine n[43.02]ASSGAGDPLDSK[272.20]R 0.23 IPI00022277 Natural 0.93 2 1389.7258 -0.0327 Ac-lysine n[43.02]ATDELATK[272.20]LSR 0.25 IPI00060181 Natural 0.84 2 1089.5659 -0.0427 Ac-lysine n[43.02]ATGQK[272.20]LMR 0.25 IPI00000792 Natural 0.97 2 1571.8774 -0.0231 Ac-lysine n[43.02]ATVTATTK[272.20]VPEIR 0.23 IPI00009104 Natural 0.88 2 1470.8638 0.0111 Ac-lysine n[43.02]AVEELQSIIK[272.20]R 0.18 IPI00074604 Natural 0.97 2 1630.8433 -0.0367 Ac-lysine n[43.02]AVPPTYADLGK[272.20]SAR 0.27 IPI00216308 Natural 0.97 2 1198.6695 -0.0461 Ac-lysine n[43.02]AVSTGVK[272.20]VPR 0.28 IPI00019600 Natural 0.89 2 1499.7362 -0.038 Ac-lysine n[43.02]AVTLDK[272.20]DAYYR 0.21 IPI00026970 Natural 0.95 3 2938.3593 0.0396 Ac-lysine n[43.02]DDDIAALVVDNGSGMC[160.03]K[272.20]AGFAGDDAPR 0.28 IPI00021439 Natural 0.99 3 1847.9435 -0.0432 Ac-lysine n[43.02]GDAPSPEEK[272.20]LHLITR 0.32 IPI00007074 Natural 0.87 3 2043.1005 0.0398 Ac-lysine n[43.02]GDVK[272.20]NFLYAWC[160.03]GK[272.20]R 0.13 IPI00844578 Natural 0.97 2 1672.895 0.001 Ac-lysine n[43.02]MDGIVPDIAVGTK[272.20]R 0.2 IPI00179964 Natural 0.99 3 2221.0787 0.0311 Ac-lysine n[43.02]MDNSGK[272.20]EAEAMALLAEAER 0.41 IPI00009253 Neo 0.87 2 1411.8107 0.013 Ac-lysine n[43.02]MEK[272.20]PSPLLVGR 0.29 IPI00009057 Natural 0.91 2 1630.8363 -0.0354 Ac-lysine n[43.02]MEK[272.20]TLETVPLER 0.25 IPI00396378 Natural 0.95 3 1874.9187 -0.0317 Ac-lysine n[43.02]MEPLAAYPLK[272.20]C[160.03]SGPR 0.19 IPI00291695 Natural 0.89 2 1009.5209 -0.0288 Ac-lysine n[43.02]MFAK[272.20]ATR 0.26 IPI00029656 Natural 0.91 2 1152.6253 0.0018 Ac-lysine n[43.02]MFSWLK[272.20]R 0.22 IPI00100980 Natural 0.96 2 1411.688 -0.0157 Ac-lysine n[43.02]MFSWVSK[272.20]DAR 0.22 IPI00017184 Natural 0.98 2 1773.9564 -0.0005 Ac-lysine n[43.02]MLGPEGGEGFVVK[272.20]LR 0.22 IPI00003881 Neo 0.83 2 1178.5362 -0.0295 Ac-lysine n[43.02]MNK[272.20]DAQMR 0.26 IPI00024620 Natural 0.98 2 1553.7341 -0.0077 Ac-lysine n[43.02]MQPASAK[272.20]WYDR 0.17 IPI00015029 Natural 0.97 2 1364.6736 -0.0181 Ac-lysine n[43.02]MVGEEK[272.20]MSLR 0.22 IPI00644020 Neo 0.98 3 1557.7151 0.0092 Ac-lysine n[43.02]QEYDESGPSIVHR 1.04 IPI00021439 Neo 0.94 3 1975.713 -0.2667 Ac-lysine n[43.02]RPGGK[272.20]TGSGGVASSSESNR 0.3 IPI00017341 Natural 0.93 3 1413.7354 -0.0163 Ac-lysine n[43.02]SALEK[272.20]SMHLGR 0.48 IPI00007694 Natural 0.98 3 2163.0962 -0.0115 Ac-lysine n[43.02]SGGK[272.20]YVDSEGHLYTVPIR 0.26 IPI00009236 Natural 0.88 2 1099.6587 -0.0248 Ac-lysine n[43.02]SGGLLK[272.20]ALR 0.22 IPI00183500 Natural 0.97 2 1134.5299 -0.0818 Ac-lysine n[43.02]SK[272.20]NTVSSAR 0.23 IPI00007280 Natural 0.98 2 1439.7147 -0.034 Ac-lysine n[43.02]SK[272.20]SFQQSSLSR 0.18 IPI00017297 Natural 0.99 2 1678.8101 -0.0186 Ac-lysine n[43.02]SQAEFEK[272.20]AAEEVR 0.31 IPI00010182 Natural 1.00 3 1633.7825 -0.068 Ac-lysine n[43.02]SSK[272.20]TASTNNIAQAR 0.4 IPI00221232 Natural 0.96 2 1429.5753 -0.0447 Ac-lysine n[43.02]SSNEC[160.03]FK[272.20]C[160.03]GR 0.26 IPI00430813 Natural 0.94 2 1314.7992 -0.0001 Ac-lysine n[43.02]TAIIK[272.20]EIVSR 0.23 IPI00012587 Natural 0.84 2 1364.685 -0.0208 Ac-lysine n[43.02]TGYTPDEK[272.20]LR 0.26 IPI00219385 Natural 1.00 4 1993.0509 -0.0358 Ac-lysine n[43.02]VEEVQK[272.20]HSVHTLVFR 0.3 IPI00002624  194 Appendix B.7 Peptides identified by iTRAQ-TAILS in conditioned medium of HMEC1xHMEC2. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 114) or sMT6EΔA (iTRAQ 115) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated.  N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 114/ iTRAQ 115 IPI # Neo 0.99 2 1254.7116 -0.0301 iTRAQ n[145.11]AATLILEPAGR 1.5 IPI00220906 Neo 1.00 3 1666.8534 -0.0343 iTRAQ n[145.11]ADAINTEFK[272.20]NTR 1.93 IPI00418471 Neo 1.00 3 1774.856 -0.0857 iTRAQ n[145.11]ADANLEAGNVK[272.20]ETR 1.89 IPI00328113 Neo 0.99 2 1199.5159 -0.0208 iTRAQ n[145.11]AEFSSEAC[160.03]R 2.09 IPI00030877 Neo 1.00 2 1319.493 -0.0777 iTRAQ n[145.11]AEGPDEDSSNR 1.3 IPI00009904 Neo 1.00 3 1904.9186 -0.0641 iTRAQ n[145.11]AEPEGGPASEGAARPLPR 1.96 IPI00015881 Neo 1.00 2 1710.691 -0.1393 iTRAQ n[145.11]AGASATFPMQC[160.03]SALR 1.41 IPI00376005 Neo 1.00 2 1119.5127 -0.03 iTRAQ n[145.11]AGFAGDDAPR 1.29 IPI00008603 Neo 1.00 3 2468.1535 -0.1328 iTRAQ n[145.11]AGGAAQLALDK[272.20]SDSHPSDALTR 1.69 IPI00028031 Natural 1.00 3 1692.8532 -0.0495 iTRAQ n[145.11]AGGEAGVTLGQPHLSR 2.11 IPI00297982 Neo 1.00 2 1431.7123 -0.0324 iTRAQ n[145.11]AGMAMAGQSPVLR 1.52 IPI00179964 Neo 0.98 3 1480.7483 -0.0758 iTRAQ n[145.11]AINTEFK[272.20]NTR 1.329 IPI00418471 Neo 0.99 3 1504.7377 -0.1076 iTRAQ n[145.11]ALK[272.20]GTNESLER 1.233 IPI00418471 Natural 1.00 3 1997.0869 -0.0644 iTRAQ n[145.11]APAEILNGK[272.20]EISAQIR 2.01 IPI00218342 Natural 0.96 2 1214.588 -0.0137 iTRAQ n[145.11]APDQDEIQR 1.23 IPI00021794 Neo 1.00 3 2187.9769 -0.1533 iTRAQ n[145.11]APGLQC[160.03]HPPK[272.20]DDEAPLR 0.86 IPI00029235 Natural 0.99 3 1360.6871 -0.0466 iTRAQ n[145.11]APPAAGQQQPPR 1.29 IPI00002802 Natural 1.00 3 1969.0164 -0.0712 iTRAQ n[145.11]APSVPAAEPEYPK[272.20]GIR 1.59 IPI00172460 Natural 1.00 2 1324.6291 -0.0206 iTRAQ n[145.11]ASEGGFTATGQR 1.307 IPI00003351 Natural 1.00 3 1855.9327 -0.071 iTRAQ n[145.11]ASGANFEYIIAEK[272.20]R 2.34 IPI00024993 Neo 0.89 2 952.4375 -0.0472 iTRAQ n[145.11]ASQNSFR 1.03 IPI00296053 Neo 1.00 3 1595.83 -0.0207 iTRAQ n[145.11]DAINTEFK[272.20]NTR 2.09 IPI00418471 Natural 1.00 3 1664.8005 -0.0482 iTRAQ n[145.11]DAPEEEDHVLVLR 1.45 IPI00010796 Natural 1.00 3 2264.9178 -0.1669 iTRAQ n[145.11]DDEVDVDGTVEEDLGK[272.20]SR 2.95 IPI00027230 Neo 0.96 3 1383.6616 -0.0248 iTRAQ n[145.11]DENEHQLSLR 0.88 IPI00220740 Neo 0.97 2 1197.6327 -0.033 iTRAQ n[145.11]DIPAMLPAAR 1.55 IPI00329688 Neo 1.00 3 1612.9356 -0.0148 iTRAQ n[145.11]DNIQGITK[272.20]PAIR 1.3 IPI00453473 Neo 1.00 3 2554.9764 -0.0703 iTRAQ n[145.11]DVK[272.20]C[160.03]DMEVSC[160.03]PDGYTC[160.03]C[160.03]R 1.98 IPI00181753 Natural 0.98 2 1398.6561 -0.0296 iTRAQ n[145.11]EEQPPETAAQR 1.12 IPI00386755 Neo 1.00 2 1506.7566 -0.0391 iTRAQ n[145.11]EFQTNLVPYPR 1.77 IPI00007750 Neo 0.88 2 1316.5959 -0.0308 iTRAQ n[145.11]EQAPGTAPC[160.03]SR 1.08 IPI00010277 Natural 1.00 2 1507.7234 -0.0613 iTRAQ n[145.11]ESETTTSLVLER 1.72 IPI00029744 Neo 0.89 2 995.4601 -0.0049 iTRAQ n[145.11]EVC[160.03]MASR 1.19 IPI00166039  195 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 114/ iTRAQ 115 IPI # Neo 0.99 2 991.4251 -0.0596 iTRAQ n[145.11]FAGDDAPR 0.873 IPI00008603 Neo 1.00 2 1396.6022 -0.0315 iTRAQ n[145.11]FGSDQSENVDR 1.81 IPI00258804 Neo 1.00 3 2013.9954 -0.0773 iTRAQ n[145.11]FSLADAINTEFK[272.20]NTR 3.78 IPI00418471 Neo 1.00 2 1238.6521 -0.0586 iTRAQ n[145.11]GAPEVLVSAPR 1.31 IPI00143921 Neo 1.00 3 1844.8065 -0.0492 iTRAQ n[145.11]GENTSNMTHLEAQNR 0.8 IPI00010414 Neo 0.99 3 2568.9577 -0.268 iTRAQ n[145.11]GETGHVAINC[160.03]SK[272.20]TSEVNC[160.03]YR 1.26 IPI00430812 Neo 1.00 2 1377.6953 -0.0174 iTRAQ n[145.11]GFDVASVQQQR 1.36 IPI00106668 Neo 1.00 3 1297.6138 -0.0147 iTRAQ n[145.11]GHGSGWAETPR 1.33 IPI00026089 Natural 0.99 3 1551.7261 -0.0556 iTRAQ n[145.11]GHQQLYWSHPR 1.53 IPI00182289 Neo 1.00 3 1512.8862 -0.0365 iTRAQ n[145.11]GIVPDIAVGTK[272.20]R 1.88 IPI00179964 Natural 1.00 3 1671.8703 -0.0485 iTRAQ n[145.11]GK[272.20]DYYQTLGLAR 2 IPI00015947 Natural 0.99 3 1648.8947 -0.116 iTRAQ n[145.11]GK[272.20]VK[272.20]VGVNGFGR 1.25 IPI00219018 Neo 0.95 2 1774.8715 -0.0872 iTRAQ n[145.11]GLVETPTGYIESLPR 1.02 IPI00023860 Neo 1.00 3 1825.8132 -0.0585 iTRAQ n[145.11]GPAAEAEPEHSFDGLR 1.1 IPI00014898 Natural 0.96 4 1968.0746 -0.0403 iTRAQ n[145.11]GPAK[272.20]SPYQLVLQHSR 1.66 IPI00018219 Neo 0.99 2 1061.5145 -0.0262 iTRAQ n[145.11]GPNIC[160.03]TTR 0.94 IPI00220350 Neo 0.99 2 1229.653 -0.0317 iTRAQ n[145.11]GQVITIGNER 1.03 IPI00003269 Neo 1.00 2 1364.6879 -0.0288 iTRAQ n[145.11]GTQTVNYVPSR 1.09 IPI00302592 Neo 0.96 3 1750.8106 -0.1772 iTRAQ n[145.11]GVK[272.20]K[272.20]FDVPC[160.03]GGR 1.28 IPI00306322 Neo 1.00 3 1587.8164 -0.0439 iTRAQ n[145.11]GVPEGAQLQGPVHR 0.91 IPI00031801 Neo 0.93 2 943.4834 -0.0373 iTRAQ n[145.11]GVPVEGSR 1.02 IPI00031801 Neo 1.00 2 1457.7455 -0.0142 iTRAQ n[145.11]GVQVETISPGDGR 0.993 IPI00413778 Neo 1.00 2 1275.5715 -0.0502 iTRAQ n[145.11]GYSFTTTAER 1 IPI00021439 Natural 1.00 3 1437.6964 -0.0159 iTRAQ n[145.11]HWPSEPSEAVR 1.57 IPI00028911 Neo 1.00 2 1168.6392 -0.0655 iTRAQ n[145.11]IGGIGTVPVGR 1.13 IPI00014424 Neo 0.97 3 1658.8092 -0.0347 iTRAQ n[145.11]IWHHTFYNELR 0.67 IPI00021428 Neo 1.00 10 1391.721 -0.0187 iTRAQ n[145.11]K[272.20]AGFAGDDAPR 1.66 IPI00008603 Neo 1.00 4 1670.8654 -0.0442 iTRAQ n[145.11]K[272.20]FVGGAENTAHPR 0.84 IPI00029236 Neo 0.92 3 1236.7034 -0.0403 iTRAQ n[145.11]K[272.20]PVSLSYR 1.3 IPI00413781 Neo 1.00 3 1334.7602 -0.0555 iTRAQ n[145.11]LHLGVTPSVIR 1.9 IPI00298237 Natural 1.00 3 1937.8745 -0.0832 iTRAQ n[145.11]LRPGDC[160.03]EVC[160.03]ISYLGR 2.17 IPI00328748 Natural 0.99 2 1611.8261 -0.0346 iTRAQ n[145.11]MPPYTVVYFPVR 1.35 IPI00219757 Natural 1.00 3 1639.7881 -0.0503 iTRAQ n[145.11]MQPASAK[272.20]WYDR 1.44 IPI00015029 Neo 0.99 3 1497.8898 -0.0337 iTRAQ n[145.11]NIQGITK[272.20]PAIR 2.55 IPI00453473 Natural 0.98 3 1304.6745 -0.0369 iTRAQ n[145.11]PAVSK[272.20]GDGMR 1.52 IPI00016621 Natural 1.00 2 1513.6791 -0.0816 iTRAQ n[145.11]PGPTPSGTNVGSSGR 2.9 IPI00220835 Natural 1.00 3 2003.0287 -0.0757 iTRAQ n[145.11]PGVTVK[272.20]DVNQQEFVR 1.82 IPI00215780 Natural 0.99 2 1480.7627 -0.057 iTRAQ n[145.11]PPYTVVYFPVR 1.77 IPI00219757 Natural 1.00 2 1613.6974 -0.0623 iTRAQ n[145.11]PQYQTWEEFSR 1.29 IPI00216125 Natural 0.98 2 1149.5803 -0.0344 iTRAQ n[145.11]PTVEELYR 1.52 IPI00006684 Neo 0.98 2 1131.6135 -0.0232 iTRAQ n[145.11]SAINEVVTR 0.83 IPI00026302 Natural 1.00 2 1349.5069 -0.0568 iTRAQ n[145.11]SAPGEDEEC[160.03]GR 1.07 IPI00217882 Neo 0.98 2 1257.556 -0.0697 iTRAQ n[145.11]SAPLAAGC[160.03]PDR 0.935 IPI00003176 Natural 1.00 2 1782.7935 -0.0462 iTRAQ n[145.11]SDVLELTDDNFESR 1.84 IPI00025252  196 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 114/ iTRAQ 115 IPI # Neo 1.00 3 1527.6771 -0.0446 iTRAQ n[145.11]SGSMDPSGAHPSVR 0.66 IPI00008575 Neo 1.00 3 1962.8901 -0.0504 iTRAQ n[145.11]SGTLGHPGSLDETTYER 1.56 IPI00217745 Neo 1.00 3 1595.8192 -0.0315 iTRAQ n[145.11]SK[272.20]FADLSEAANR 1.25 IPI00418471 Neo 0.94 3 1387.8268 -0.0487 iTRAQ n[145.11]SK[272.20]LVVITQGR 1.14 IPI00413916 Neo 1.00 3 1522.7837 -0.0388 iTRAQ n[145.11]SPALTIENEHIR 1.68 IPI00012989 Natural 0.95 3 1260.6825 -0.0276 iTRAQ n[145.11]SPVLHFYVR 1.32 IPI00004534 Natural 0.98 2 1219.5316 -0.0599 iTRAQ n[145.11]SQDASDGLQR 1.06 IPI00009276 Neo 1.00 3 1467.7621 -0.0296 iTRAQ n[145.11]SQLLGSAHEVQR 1 IPI00744706 Neo 0.98 2 1146.5606 -0.0511 iTRAQ n[145.11]STAAQQELR 1.12 IPI00019502 Neo 1.00 3 1901.8274 -0.0433 iTRAQ n[145.11]STAYEDYYYHPPPR 0.64 IPI00012074 Neo 1.00 3 1800.9143 -0.0834 iTRAQ n[145.11]SVPAAEPEYPK[272.20]GIR 1.92 IPI00172460 Neo 0.91 2 1221.514 -0.0608 iTRAQ n[145.11]SYSPEPDQR 1 IPI00298237 Neo 0.99 3 1481.8394 -0.0523 iTRAQ n[145.11]TAAAPK[272.20]AGPGVVR 0.65 IPI00017596 Neo 0.95 2 1260.5637 -0.025 iTRAQ n[145.11]TPAPETC[160.03]EGR 1.17 IPI00030241 Neo 0.87 3 1371.7874 -0.0244 iTRAQ n[145.11]TTTLAFK[272.20]FR 1.65 IPI00375704 Neo 1.00 3 1671.9087 -0.068 iTRAQ n[145.11]VDVSK[272.20]PDLTAALR 2.38 IPI00418471 Natural 1.00 2 1483.7179 -0.0618 iTRAQ n[145.11]VDYYEVLGVQR 1.34 IPI00024523 Neo 1.00 3 1432.745 -0.0367 iTRAQ n[145.11]VK[272.20]MAAAGGGGGGGR 1.09 IPI00027834 Natural 0.97 2 949.436 -0.0049 iTRAQ n[145.11]VNDGDMR 1.23 IPI00023673 Natural 0.99 2 1234.6465 -0.0322 iTRAQ n[145.11]VNFTVDQIR 1.27 IPI00186290 Neo 1.00 3 1457.8546 -0.0263 iTRAQ n[145.11]VSK[272.20]PDLTAALR 1.6 IPI00418471 Natural 0.97 3 1725.9471 -0.0784 iTRAQ n[145.11]YALSGSVWK[272.20]K[272.20]R 2.88 IPI00014758 Neo 1.00 3 1556.6404 -0.0403 iTRAQ n[145.11]YYGYDYHNYR 1.54 IPI00018140 Natural 0.98 2 1116.6093 -0.0284 Ac-lysine n[43.02]AAAAVSSAK[272.20]R 1.35 IPI00220567 Neo 0.99 2 1652.7729 -0.0988 Ac-lysine n[43.02]AAPAQQTTQPGGGK[272.20]R 0.63 IPI00465054 Natural 1.00 2 1584.7349 -0.0993 Ac-lysine n[43.02]AATASAGAGGIDGK[272.20]PR 14.53 IPI00219729 Natural 1.00 2 1328.6557 -0.098 Ac-lysine n[43.02]AATTGSGVK[272.20]VPR 1.27 IPI00472498 Natural 1.00 3 1797.0347 -0.0369 Ac-lysine n[43.02]AAVK[272.20]TLNPK[272.20]AEVAR 1.3 IPI00027626 Natural 0.88 2 1231.7166 -0.0611 Ac-lysine n[43.02]AAYK[272.20]LVLIR 1.49 IPI00374975 Natural 1.00 10 2157.0034 -0.1122 Ac-lysine n[43.02]AC[160.03]GLVASNLNLK[272.20]PGEC[160.03]LR 2.63 IPI00219219 Natural 0.99 3 1822.7568 -0.0159 Ac-lysine n[43.02]ADEGK[272.20]SYSEHDDER 10.85 IPI00033153 Natural 1.00 2 1750.7767 -0.036 Ac-lysine n[43.02]ADK[272.20]EAAFDDAVEER 1.55 IPI00328319 Natural 0.99 3 2207.0452 -0.1085 Ac-lysine n[43.02]ADK[272.20]MDMSLDDIIK[272.20]LNR 3.2 IPI00328840 Natural 0.91 3 1267.6455 -0.0187 Ac-lysine n[43.02]AEAELHK[272.20]ER 7.4 IPI00032064 Natural 1.00 2 1661.7797 -0.022 Ac-lysine n[43.02]AEFTSYK[272.20]ETASSR 4.68 IPI00296830 Neo 0.95 3 1570.6049 -0.073 Ac-lysine n[43.02]AEK[272.20]FDC[160.03]HYC[160.03]R 1.26 IPI00014398 Natural 0.98 2 1253.6022 -0.0355 Ac-lysine n[43.02]AESSDK[272.20]LYR 1.45 IPI00449049 Natural 0.98 4 2324.1549 -0.1183 Ac-lysine n[43.02]AFK[272.20]DTGK[272.20]TPVEPEVAIHR 3.2 IPI00012493 Natural 0.98 2 1343.6399 -0.1498 Ac-lysine n[43.02]AGITTIEAVK[272.20]R 1.81 IPI00218319 Natural 1.00 2 1342.641 -0.1277 Ac-lysine n[43.02]AGLNSLEAVK[272.20]R 1.44 IPI00010779 Natural 0.93 3 1578.7674 -0.0537 Ac-lysine n[43.02]AK[272.20]HHPDLIFC[160.03]R 1.67 IPI00005511 Natural 0.97 2 1403.6539 -0.0839 Ac-lysine n[43.02]AK[272.20]ISSPTETER 1.02 IPI00013895 Natural 0.98 3 1514.8366 -0.0294 Ac-lysine n[43.02]AK[272.20]PLTDQEK[272.20]R 1.56 IPI00783313 Natural 0.98 3 1473.7912 -0.0482 Ac-lysine n[43.02]AK[272.20]PLTDSEK[272.20]R 1.77 IPI00004358  197 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 114/ iTRAQ 115 IPI # Natural 0.96 2 1352.5875 -0.0752 Ac-lysine n[43.02]ANK[272.20]GPSYGMSR 1.15 IPI00216138 Natural 0.98 2 1185.635 -0.0237 Ac-lysine n[43.02]ANNDAVLK[272.20]R 4.72 IPI00006252 Natural 1.00 3 1699.8982 -0.0595 Ac-lysine n[43.02]AQAK[272.20]INAK[272.20]ANEGR 3.69 IPI00000643 Natural 0.99 2 1587.6366 -0.1067 Ac-lysine n[43.02]AQDQGEK[272.20]ENPMR 3.66 IPI00376798 Natural 0.94 2 1270.6556 -0.0561 Ac-lysine n[43.02]AQNLK[272.20]DLAGR 22.8 IPI00027252 Natural 1.00 2 1393.6798 -0.0269 Ac-lysine n[43.02]AQYK[272.20]GAASEAGR 1.88 IPI00030098 Natural 1.00 3 2437.2088 -0.1155 Ac-lysine n[43.02]ASGVAVSDGVIK[272.20]VFNDMK[272.20]VR 2.87 IPI00012011 Natural 1.00 2 1755.7678 -0.0429 Ac-lysine n[43.02]ASK[272.20]EMFEDTVEER 1.54 IPI00395865 Natural 0.99 3 1831.9967 -0.028 Ac-lysine n[43.02]ASSDIQVK[272.20]ELEK[272.20]R 1.85 IPI00479997 Natural 0.99 2 1499.7051 -0.0686 Ac-lysine n[43.02]AVTLDK[272.20]DAYYR 1.65 IPI00026970 Natural 1.00 4 2047.9958 -0.0715 Ac-lysine n[43.02]AWK[272.20]SGGASHSELIHNLR 2.03 IPI00411680 Natural 0.98 3 2994.303 -0.0787 Ac-lysine n[43.02]EEEIAALVIDNGSGMC[160.03]K[272.20]AGFAGDDAPR 1.36 IPI00021440 Natural 0.97 2 1656.8493 -0.0494 Ac-lysine n[43.02]MDGIVPDIAVGTK[272.20]R 2.21 IPI00179964 Natural 1.00 2 1630.8001 -0.0716 Ac-lysine n[43.02]MEK[272.20]TLETVPLER 1.52 IPI00396378 Natural 1.00 3 2301.9432 -0.1378 Ac-lysine n[43.02]MESGFTSK[272.20]DTYLSHFNPR 1.74 IPI00027681 Natural 1.00 4 2402.1643 -0.0725 Ac-lysine n[43.02]MQSNK[272.20]TFNLEK[272.20]QNHTPR 2.22 IPI00304596 Natural 0.99 2 1731.8477 -0.065 Ac-lysine n[43.02]SDSEK[272.20]LNLDSIIGR 0.76 IPI00027423 Natural 1.00 3 2368.1308 -0.0659 Ac-lysine n[43.02]SK[272.20]K[272.20]ISGGSVVEMQGDEMTR 1.78 IPI00027223 Natural 0.98 2 1134.5827 -0.029 Ac-lysine n[43.02]SK[272.20]NTVSSAR 0.93 IPI00007280 Natural 0.98 3 1843.9029 -0.0854 Ac-lysine n[43.02]SK[272.20]SESPK[272.20]EPEQLR 1.686 IPI00215965 Natural 0.99 2 1439.7107 -0.038 Ac-lysine n[43.02]SK[272.20]SFQQSSLSR 1.28 IPI00017297 Natural 0.99 3 1877.1025 -0.0282 Ac-lysine n[43.02]SK[272.20]SLK[272.20]K[272.20]LVEESR 2.69 IPI00017256 Natural 1.00 2 1678.7666 -0.0621 Ac-lysine n[43.02]SQAEFEK[272.20]AAEEVR 1.63 IPI00010182 Natural 1.00 2 1633.8133 -0.0374 Ac-lysine n[43.02]SSK[272.20]TASTNNIAQAR 1.22 IPI00221232 Neo 0.97 2 1569.8446 -0.0401 Ac-lysine n[43.02]VDVSK[272.20]PDLTAALR 1.47 IPI00418471   198 Appendix B.8 Peptides identified by iTRAQ-TAILS in conditioned medium of HMEC1. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 114) or sMT6EΔA (iTRAQ 115) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated.  N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 114/ iTRAQ 115 IPI # Neo 0.98 2 1217.6205 -0.0282 iTRAQ n[145.11]AAAVASTGPSSR 1.49 IPI00220113 Neo 0.77 2 1431.7072 -0.0185 iTRAQ n[145.11]AASPC[160.03]SVVNDLR 1.41 IPI00549189 Neo 0.99 2 1254.7116 -0.0301 iTRAQ n[145.11]AATLILEPAGR 1.50 IPI00220906 Neo 1.00 3 1666.8534 -0.0343 iTRAQ n[145.11]ADAINTEFK[272.20]NTR 2.46 IPI00418471 Neo 1.00 3 1774.9127 -0.029 iTRAQ n[145.11]ADANLEAGNVK[272.20]ETR 2.43 IPI00328113 Neo 0.99 2 1199.5159 -0.0208 iTRAQ n[145.11]AEFSSEAC[160.03]R 2.09 IPI00030877 Neo 0.99 2 1319.5489 -0.0218 iTRAQ n[145.11]AEGPDEDSSNR 1.60 IPI00009904 Neo 1.00 3 1904.9186 -0.0641 iTRAQ n[145.11]AEPEGGPASEGAARPLPR 1.96 IPI00015881 Neo 1.00 2 1710.7888 -0.0419 iTRAQ n[145.11]AGASATFPMQC[160.03]SALR 1.48 IPI00376005 Neo 1.00 2 1119.5127 -0.03 iTRAQ n[145.11]AGFAGDDAPR 1.64 IPI00008603 Neo 1.00 3 2468.2118 -0.0749 iTRAQ n[145.11]AGGAAQLALDK[272.20]SDSHPSDALTR 3.30 IPI00028031 Natural 1.00 3 1692.8532 -0.0495 iTRAQ n[145.11]AGGEAGVTLGQPHLSR 2.11 IPI00297982 Neo 1.00 2 1431.7123 -0.0324 iTRAQ n[145.11]AGMAMAGQSPVLR 1.63 IPI00179964 Neo 0.98 3 1480.7571 -0.067 iTRAQ n[145.11]AINTEFK[272.20]NTR 2.24 IPI00418471 Neo 0.92 3 1504.811 -0.0343 iTRAQ n[145.11]ALK[272.20]GTNESLER 2.15 IPI00418471 Neo 0.98 2 1161.5662 -0.0235 iTRAQ n[145.11]ALYHTEER 1.38 IPI00301109 Natural 1.00 3 1997.0869 -0.0644 iTRAQ n[145.11]APAEILNGK[272.20]EISAQIR 2.01 IPI00218342 Natural 0.96 2 1214.588 -0.0137 iTRAQ n[145.11]APDQDEIQR 1.35 IPI00021794 Neo 1.00 3 2187.9769 -0.1533 iTRAQ n[145.11]APGLQC[160.03]HPPK[272.20]DDEAPLR 1.17 IPI00029235 Neo 0.67 3 1267.7365 -0.0239 iTRAQ n[145.11]APLNPK[272.20]ANR 2.38 IPI00008603 Natural 0.99 3 1360.7236 -0.0097 iTRAQ n[145.11]APPAAGQQQPPR 1.89 IPI00002802 Natural 1.00 3 1969.0164 -0.0712 iTRAQ n[145.11]APSVPAAEPEYPK[272.20]GIR 1.59 IPI00172460 Neo 0.76 2 1703.7598 -0.1499 iTRAQ n[145.11]AQAK[272.20]QWGWTQGR 1.51 IPI00394699 Natural 1.00 2 1324.6291 -0.0206 iTRAQ n[145.11]ASEGGFTATGQR 1.47 IPI00003351 Natural 1.00 3 1855.9327 -0.071 iTRAQ n[145.11]ASGANFEYIIAEK[272.20]R 2.34 IPI00024993 Neo 0.98 2 1208.5982 -0.0285 iTRAQ n[145.11]ASSPGGVYATR 1.99 IPI00418471 Natural 1.00 3 2488.1009 -0.0518 iTRAQ n[145.11]C[160.03]SC[160.03]SPVHPQQAFC[160.03]NADVVIR 1.51 IPI00027166 Neo 1.00 3 1595.83 -0.0207 iTRAQ n[145.11]DAINTEFK[272.20]NTR 2.09 IPI00418471 Natural 1.00 3 1664.8005 -0.0482 iTRAQ n[145.11]DAPEEEDHVLVLR 1.55 IPI00010796 Neo 0.99 3 1340.6048 -0.0183 iTRAQ n[145.11]DAPQDFHPDR 1.42 IPI00302592 Natural 1.00 3 2265.0207 -0.0645 iTRAQ n[145.11]DDEVDVDGTVEEDLGK[272.20]SR 3.70 IPI00027230 Neo 0.96 3 1383.6616 -0.0248 iTRAQ n[145.11]DENEHQLSLR 1.22 IPI00220740 Neo 0.97 2 1197.6327 -0.033 iTRAQ n[145.11]DIPAMLPAAR 1.55 IPI00329688  199 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 114/ iTRAQ 115 IPI # Neo 0.98 2 1362.621 -0.0357 iTRAQ n[145.11]DLEPGTMDSVR 1.58 IPI00007752 Neo 1.00 3 1503.755 -0.0366 iTRAQ n[145.11]DLGPHAEGQLAPR 1.13 IPI00443799 Neo 1.00 3 1612.9356 -0.0148 iTRAQ n[145.11]DNIQGITK[272.20]PAIR 1.68 IPI00453473 Neo 0.95 3 2430.1579 -0.0688 iTRAQ n[145.11]DSVDFSLADAINTEFK[272.20]NTR 2.95 IPI00418471 Neo 1.00 4 1936.0119 -0.0503 iTRAQ n[145.11]DTGK[272.20]TPVEPEVAIHR 1.75 IPI00012493 Neo 1.00 3 2554.9764 -0.0703 iTRAQ n[145.11]DVK[272.20]C[160.03]DMEVSC[160.03]PDGYTC[160.03]C[160.03]R 2.76 IPI00181753 Natural 0.88 2 1792.9129 -0.0468 iTRAQ n[145.11]DWVIPPINLPENSR 1.25 IPI00290085 Neo 0.95 3 1396.7888 -0.0139 iTRAQ n[145.11]EAPLNPK[272.20]ANR 3.14 IPI00008603 Natural 0.98 2 1398.6561 -0.0296 iTRAQ n[145.11]EEQPPETAAQR 1.33 IPI00386755 Neo 1.00 2 1506.7566 -0.0391 iTRAQ n[145.11]EFQTNLVPYPR 1.77 IPI00007750 Neo 0.99 3 2068.9207 -0.048 iTRAQ n[145.11]EGDGGWRPGGPGAVAEEER 0.87 IPI00045473 Natural 0.95 3 2532.1453 -0.1074 iTRAQ n[145.11]EPAVYFK[272.20]EQFLDGDGWTSR 1.92 IPI00020599 Neo 0.88 2 1316.5959 -0.0308 iTRAQ n[145.11]EQAPGTAPC[160.03]SR 1.33 IPI00010277 Natural 0.66 4 1655.8441 -0.0384 iTRAQ n[145.11]ESAGADTRPTVRPR 0.30 IPI00025796 Natural 1.00 2 1507.7234 -0.0613 iTRAQ n[145.11]ESETTTSLVLER 1.72 IPI00029744 Neo 0.89 2 995.4601 -0.0049 iTRAQ n[145.11]EVC[160.03]MASR 1.63 IPI00166039 Neo 0.89 2 1236.6024 -0.0193 iTRAQ n[145.11]FADLSEAANR 1.78 IPI00418471 Neo 0.94 2 991.4623 -0.0224 iTRAQ n[145.11]FAGDDAPR 1.70 IPI00008603 Neo 1.00 2 1396.6022 -0.0315 iTRAQ n[145.11]FGSDQSENVDR 1.97 IPI00258804 Neo 1.00 3 2013.9954 -0.0773 iTRAQ n[145.11]FSLADAINTEFK[272.20]NTR 3.78 IPI00418471 Neo 1.00 2 1238.6521 -0.0586 iTRAQ n[145.11]GAPEVLVSAPR 1.31 IPI00143921 Neo 1.00 3 1844.8065 -0.0492 iTRAQ n[145.11]GENTSNMTHLEAQNR 0.92 IPI00010414 Neo 1.00 3 2842.0576 -0.1736 iTRAQ n[145.11]GESGHLAK[272.20]DC[160.03]DLQEDAC[160.03]YNC[160.03]GR 1.67 IPI00430813 Neo 0.99 3 2569.0621 -0.1636 iTRAQ n[145.11]GETGHVAINC[160.03]SK[272.20]TSEVNC[160.03]YR 1.61 IPI00430812 Neo 1.00 2 1377.6953 -0.0174 iTRAQ n[145.11]GFDVASVQQQR 1.36 IPI00106668 Neo 1.00 3 1297.6138 -0.0147 iTRAQ n[145.11]GHGSGWAETPR 1.33 IPI00026089 Natural 0.89 3 1551.7224 -0.0593 iTRAQ n[145.11]GHQQLYWSHPR 1.89 IPI00182289 Neo 1.00 3 1512.8862 -0.0365 iTRAQ n[145.11]GIVPDIAVGTK[272.20]R 1.88 IPI00179964 Natural 1.00 3 1671.8703 -0.0485 iTRAQ n[145.11]GK[272.20]DYYQTLGLAR 2.00 IPI00015947 Natural 0.88 3 1648.9929 -0.0178 iTRAQ n[145.11]GK[272.20]VK[272.20]VGVNGFGR 2.46 IPI00219018 Neo 0.95 2 1774.8715 -0.0872 iTRAQ n[145.11]GLVETPTGYIESLPR 1.02 IPI00023860 Neo 1.00 3 1825.8132 -0.0585 iTRAQ n[145.11]GPAAEAEPEHSFDGLR 1.10 IPI00014898 Natural 0.96 4 1968.0746 -0.0403 iTRAQ n[145.11]GPAK[272.20]SPYQLVLQHSR 1.66 IPI00018219 Neo 0.99 2 1061.5145 -0.0262 iTRAQ n[145.11]GPNIC[160.03]TTR 1.10 IPI00220350 Natural 1.00 3 1710.8856 -0.0441 iTRAQ n[145.11]GQEK[272.20]FFGDQVLR 1.79 IPI00008894 Neo 0.99 2 1229.653 -0.0317 iTRAQ n[145.11]GQVITIGNER 1.03 IPI00003269 Neo 1.00 2 1364.6879 -0.0288 iTRAQ n[145.11]GTQTVNYVPSR 1.22 IPI00302592 Neo 0.66 3 1750.9608 -0.027 iTRAQ n[145.11]GVK[272.20]K[272.20]FDVPC[160.03]GGR 2.45 IPI00306322 Neo 1.00 3 1587.8164 -0.0439 iTRAQ n[145.11]GVPEGAQLQGPVHR 0.91 IPI00031801 Neo 0.87 2 943.5036 -0.0171 iTRAQ n[145.11]GVPVEGSR 1.15 IPI00031801 Neo 1.00 2 1457.7455 -0.0142 iTRAQ n[145.11]GVQVETISPGDGR 1.08 IPI00413778 Neo 0.82 2 1212.4952 -0.0335 iTRAQ n[145.11]GWAC[160.03]C[160.03]PYR 1.02 IPI00181753 Neo 1.00 2 1275.5715 -0.0502 iTRAQ n[145.11]GYSFTTTAER 1.00 IPI00021439 Neo 0.85 3 1920.8065 -0.1621 iTRAQ n[145.11]HEGGQSYK[272.20]IGDTWR 0.98 IPI00022418  200 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 114/ iTRAQ 115 IPI # Natural 1.00 3 1437.6964 -0.0159 iTRAQ n[145.11]HWPSEPSEAVR 2.38 IPI00028911 Neo 0.99 3 2155.8793 -0.0594 iTRAQ n[145.11]HWYVGEGMEEGEFSEAR 1.59 IPI00007750 Neo 1.00 2 1168.6392 -0.0655 iTRAQ n[145.11]IGGIGTVPVGR 1.13 IPI00014424 Neo 0.97 3 1658.8092 -0.0347 iTRAQ n[145.11]IWHHTFYNELR 0.67 IPI00021428 Neo 1.00 10 1391.721 -0.0187 iTRAQ n[145.11]K[272.20]AGFAGDDAPR 1.66 IPI00008603 Neo 0.92 3 1236.7034 -0.0403 iTRAQ n[145.11]K[272.20]PVSLSYR 1.76 IPI00413781 Neo 1.00 3 1779.9292 -0.0435 iTRAQ n[145.11]LADAINTEFK[272.20]NTR 2.72 IPI00418471 Neo 0.92 2 1157.5871 -0.0296 iTRAQ n[145.11]LDADPSLQR 1.82 IPI00306959 Neo 1.00 2 1373.7077 -0.02 iTRAQ n[145.11]LGSDAELQIER 1.58 IPI00182126 Neo 1.00 3 1334.7602 -0.0555 iTRAQ n[145.11]LHLGVTPSVIR 1.90 IPI00298237 Neo 0.76 2 1246.7641 -0.0216 iTRAQ n[145.11]LIK[272.20]TVETR 2.87 IPI00418471 Neo 0.74 3 2137.1563 -0.1685 iTRAQ n[145.11]LISTLILVILSYTYIIR 2.42 IPI00399342 Natural 1.00 3 1937.8745 -0.0832 iTRAQ n[145.11]LRPGDC[160.03]EVC[160.03]ISYLGR 2.17 IPI00328748 Neo 1.00 3 1876.967 -0.0567 iTRAQ n[145.11]LSGAPQASAADVVVVHGR 0.20 IPI00011522 Neo 0.89 3 2166.1749 -0.0418 iTRAQ n[145.11]LYGK[272.20]APQTPYDK[272.20]PTR 15.08 IPI00014758 Neo 0.94 4 2649.3547 -0.1423 iTRAQ n[145.11]MDK[272.20]SELVQK[272.20]AK[272.20]LAEQAER 4.37 IPI00216318 Natural 0.93 2 1278.5866 -0.0321 iTRAQ n[145.11]MIEVVC[160.03]NDR 1.27 IPI00013241 Natural 1.00 3 1628.8211 -0.0376 iTRAQ n[145.11]MK[272.20]FNPFVTSDR 1.61 IPI00007144 Natural 0.99 2 1611.8261 -0.0346 iTRAQ n[145.11]MPPYTVVYFPVR 1.35 IPI00219757 Natural 1.00 3 1639.7881 -0.0503 iTRAQ n[145.11]MQPASAK[272.20]WYDR 1.83 IPI00015029 Neo 0.99 3 1497.8898 -0.0337 iTRAQ n[145.11]NIQGITK[272.20]PAIR 2.55 IPI00453473 Natural 0.89 3 1304.6843 -0.0271 iTRAQ n[145.11]PAVSK[272.20]GDGMR 3.60 IPI00016621 Natural 0.89 2 1177.562 -0.0227 iTRAQ n[145.11]PDYLGADQR 1.72 IPI00021435 Natural 0.99 2 1642.8144 -0.0653 iTRAQ n[145.11]PFLELDTNLPANR 2.26 IPI00293867 Natural 0.99 2 1513.7386 -0.0221 iTRAQ n[145.11]PGPTPSGTNVGSSGR 2.90 IPI00220835 Natural 1.00 3 2003.0287 -0.0757 iTRAQ n[145.11]PGVTVK[272.20]DVNQQEFVR 2.65 IPI00215780 Natural 1.00 2 1430.6875 -0.0952 iTRAQ n[145.11]PMFIVNTNVPR 1.58 IPI00293276 Natural 0.99 2 1480.7627 -0.057 iTRAQ n[145.11]PPYTVVYFPVR 1.77 IPI00219757 Natural 1.00 2 1613.6974 -0.0623 iTRAQ n[145.11]PQYQTWEEFSR 1.57 IPI00216125 Natural 0.98 2 1149.5803 -0.0344 iTRAQ n[145.11]PTVEELYR 1.91 IPI00006684 Natural 0.96 2 1068.5731 -0.0316 iTRAQ n[145.11]PVAGSELPR 1.66 IPI00103732 Neo 0.98 2 1131.6135 -0.0232 iTRAQ n[145.11]SAINEVVTR 0.83 IPI00026302 Natural 1.00 2 1349.5378 -0.0259 iTRAQ n[145.11]SAPGEDEEC[160.03]GR 1.46 IPI00217882 Neo 0.97 2 1257.594 -0.0317 iTRAQ n[145.11]SAPLAAGC[160.03]PDR 1.12 IPI00003176 Natural 1.00 2 1782.7935 -0.0462 iTRAQ n[145.11]SDVLELTDDNFESR 1.84 IPI00025252 Neo 1.00 2 1327.5715 -0.0172 iTRAQ n[145.11]SGQGAFGNMC[160.03]R 0.74 IPI00003918 Neo 1.00 3 1527.6771 -0.0446 iTRAQ n[145.11]SGSMDPSGAHPSVR 0.71 IPI00008575 Neo 1.00 3 1962.8901 -0.0504 iTRAQ n[145.11]SGTLGHPGSLDETTYER 1.56 IPI00217745 Neo 1.00 3 1704.93 -0.0467 iTRAQ n[145.11]SGYLAGDK[272.20]LLPQR 1.68 IPI00219365 Natural 1.00 3 1750.6974 -0.0543 iTRAQ n[145.11]SHGSQETDEEFDAR 5.10 IPI00025086 Neo 1.00 3 1595.8192 -0.0315 iTRAQ n[145.11]SK[272.20]FADLSEAANR 1.93 IPI00418471 Neo 0.94 3 1387.8268 -0.0487 iTRAQ n[145.11]SK[272.20]LVVITQGR 1.70 IPI00413916 Neo 1.00 3 1939.895 -0.0527 iTRAQ n[145.11]SMPPAQQQITSGQMHR 1.76 IPI00298994 Neo 1.00 3 1522.7837 -0.0388 iTRAQ n[145.11]SPALTIENEHIR 1.68 IPI00012989  201 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 114/ iTRAQ 115 IPI # Natural 0.95 3 1260.6825 -0.0276 iTRAQ n[145.11]SPVLHFYVR 1.64 IPI00004534 Natural 0.92 2 1219.567 -0.0247 iTRAQ n[145.11]SQDASDGLQR 1.37 IPI00009276 Natural 0.98 4 2310.2565 -0.053 iTRAQ n[145.11]SSVLASC[160.03]PK[272.20]K[272.20]PVSSYLR 6.50 IPI00020928 Neo 0.95 2 1165.5198 -0.0139 iTRAQ n[145.11]SSVMC[160.03]PDAR 1.91 IPI00182138 Neo 0.98 2 1146.5764 -0.0353 iTRAQ n[145.11]STAAQQELR 1.32 IPI00019502 Neo 1.00 3 1901.8274 -0.0433 iTRAQ n[145.11]STAYEDYYYHPPPR 0.64 IPI00012074 Neo 0.99 2 1172.6141 -0.0126 iTRAQ n[145.11]STHTLDLSR 1.40 IPI00023673 Neo 1.00 3 1800.954 -0.0437 iTRAQ n[145.11]SVPAAEPEYPK[272.20]GIR 2.64 IPI00172460 Neo 0.88 2 1221.5552 -0.0195 iTRAQ n[145.11]SYSPEPDQR 1.39 IPI00298237 Neo 0.99 3 1481.8581 -0.0336 iTRAQ n[145.11]TAAAPK[272.20]AGPGVVR 1.00 IPI00017596 Neo 0.91 3 1497.8182 -0.0325 iTRAQ n[145.11]TEAPLNPK[272.20]ANR 2.33 IPI00008603 Neo 0.99 3 1253.6408 -0.019 iTRAQ n[145.11]TINGHNAEVR 2.11 IPI00386854 Neo 0.95 2 1260.5637 -0.025 iTRAQ n[145.11]TPAPETC[160.03]EGR 1.67 IPI00030241 Neo 1.00 2 1796.7846 -0.0601 iTRAQ n[145.11]TTFNIQDGPDFQDR 1.76 IPI00017799 Natural 0.90 3 2236.1498 -0.1169 iTRAQ n[145.11]TTIAGVVYK[272.20]DGIVLGADTR 2.52 IPI00003217 Neo 0.87 3 1371.7874 -0.0244 iTRAQ n[145.11]TTTLAFK[272.20]FR 1.65 IPI00375704 Neo 1.00 3 1671.9087 -0.068 iTRAQ n[145.11]VDVSK[272.20]PDLTAALR 2.56 IPI00418471 Natural 1.00 2 1483.7179 -0.0618 iTRAQ n[145.11]VDYYEVLGVQR 1.34 IPI00024523 Neo 1.00 3 1432.745 -0.0367 iTRAQ n[145.11]VK[272.20]MAAAGGGGGGGR 1.62 IPI00027834 Natural 0.88 3 1612.9069 -0.0508 iTRAQ n[145.11]VMEK[272.20]PSPLLVGR 2.60 IPI00009057 Natural 0.97 2 949.436 -0.0049 iTRAQ n[145.11]VNDGDMR 1.64 IPI00023673 Natural 0.99 2 1234.6465 -0.0322 iTRAQ n[145.11]VNFTVDQIR 1.27 IPI00186290 Neo 1.00 3 1457.8546 -0.0263 iTRAQ n[145.11]VSK[272.20]PDLTAALR 1.98 IPI00418471 Natural 0.98 3 2158.2655 -0.0762 iTRAQ n[145.11]VSK[272.20]PTLK[272.20]EVVIVSATR 2.70 IPI00030363 Natural 0.88 3 1726.002 -0.0235 iTRAQ n[145.11]YALSGSVWK[272.20]K[272.20]R 6.18 IPI00014758 Neo 1.00 3 1720.7853 -0.0434 iTRAQ n[145.11]YDEAAARPDPGYPR 20.68 IPI00014758 Neo 0.97 3 1909.9382 -0.0705 iTRAQ n[145.11]YSAPWK[272.20]PTWPAYR 2.14 IPI00026941 Neo 1.00 3 1556.6404 -0.0403 iTRAQ n[145.11]YYGYDYHNYR 1.54 IPI00018140 Natural 0.98 2 1116.6093 -0.0284 Ac-lysine n[43.02]AAAAVSSAK[272.20]R 1.64 IPI00220567 Natural 0.97 2 1584.7545 -0.0792 Ac-lysine n[43.02]AATASAGAGGIDGK[272.20]PR 14.53 IPI00219729 Natural 0.93 2 1328.6532 -0.1005 Ac-lysine n[43.02]AATTGSGVK[272.20]VPR 1.37 IPI00472498 Natural 1.00 3 1797.0347 -0.0369 Ac-lysine n[43.02]AAVK[272.20]TLNPK[272.20]AEVAR 1.50 IPI00027626 Natural 0.88 2 1231.7166 -0.0611 Ac-lysine n[43.02]AAYK[272.20]LVLIR 1.49 IPI00374975 Natural 1.00 10 2157.0034 -0.1122 Ac-lysine n[43.02]AC[160.03]GLVASNLNLK[272.20]PGEC[160.03]LR 2.63 IPI00219219 Natural 0.99 3 1822.7568 -0.0159 Ac-lysine n[43.02]ADEGK[272.20]SYSEHDDER 10.85 IPI00033153 Natural 1.00 2 1750.7767 -0.036 Ac-lysine n[43.02]ADK[272.20]EAAFDDAVEER 1.55 IPI00328319 Natural 0.99 3 2207.0452 -0.1085 Ac-lysine n[43.02]ADK[272.20]MDMSLDDIIK[272.20]LNR 3.20 IPI00328840 Natural 0.98 3 1786.9527 -0.0254 Ac-lysine n[43.02]ADVVVGK[272.20]DK[272.20]GGEQR 2.69 IPI00010158 Natural 0.91 3 1267.6455 -0.0187 Ac-lysine n[43.02]AEAELHK[272.20]ER 7.40 IPI00032064 Natural 1.00 2 1661.7797 -0.022 Ac-lysine n[43.02]AEFTSYK[272.20]ETASSR 4.68 IPI00296830 Neo 0.92 3 1570.6482 -0.0297 Ac-lysine n[43.02]AEK[272.20]FDC[160.03]HYC[160.03]R 1.90 IPI00014398 Natural 0.99 3 2695.314 -0.0737 Ac-lysine n[43.02]AELVQGQSAPVGMK[272.20]AEGFVDALHR 4.48 IPI00063245 Natural 0.98 2 1253.6022 -0.0355 Ac-lysine n[43.02]AESSDK[272.20]LYR 1.45 IPI00449049 Natural 0.91 2 1259.6552 -0.0295 Ac-lysine n[43.02]AEVEETLK[272.20]R 2.80 IPI00063849  202 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 114/ iTRAQ 115 IPI # Natural 0.98 4 2324.1549 -0.1183 Ac-lysine n[43.02]AFK[272.20]DTGK[272.20]TPVEPEVAIHR 3.20 IPI00012493 Natural 0.86 3 1442.8455 -0.0362 Ac-lysine n[43.02]AGIAAK[272.20]LAK[272.20]DR 9.80 IPI00289758 Natural 0.98 2 1343.6399 -0.1498 Ac-lysine n[43.02]AGITTIEAVK[272.20]R 1.81 IPI00218319 Natural 1.00 3 2073.0808 -0.0766 Ac-lysine n[43.02]AGK[272.20]QAVSASGK[272.20]WLDGIR 6.30 IPI00220416 Natural 1.00 2 1342.641 -0.1277 Ac-lysine n[43.02]AGLNSLEAVK[272.20]R 1.44 IPI00010779 Natural 0.93 3 1578.7674 -0.0537 Ac-lysine n[43.02]AK[272.20]HHPDLIFC[160.03]R 1.67 IPI00005511 Natural 0.87 2 1403.7009 -0.0368 Ac-lysine n[43.02]AK[272.20]ISSPTETER 1.74 IPI00013895 Natural 0.98 3 1514.8366 -0.0294 Ac-lysine n[43.02]AK[272.20]PLTDQEK[272.20]R 1.56 IPI00783313 Natural 0.98 3 1473.7912 -0.0482 Ac-lysine n[43.02]AK[272.20]PLTDSEK[272.20]R 2.30 IPI00004358 Natural 0.91 2 1352.642 -0.0207 Ac-lysine n[43.02]ANK[272.20]GPSYGMSR 1.44 IPI00216138 Natural 0.98 2 1185.635 -0.0237 Ac-lysine n[43.02]ANNDAVLK[272.20]R 4.72 IPI00006252 Natural 0.99 3 1699.9229 -0.0348 Ac-lysine n[43.02]AQAK[272.20]INAK[272.20]ANEGR 3.69 IPI00000643 Natural 0.97 2 1587.7153 -0.0284 Ac-lysine n[43.02]AQDQGEK[272.20]ENPMR 4.58 IPI00376798 Natural 0.94 2 1270.6556 -0.0561 Ac-lysine n[43.02]AQNLK[272.20]DLAGR 22.80 IPI00027252 Natural 1.00 2 1393.6798 -0.0269 Ac-lysine n[43.02]AQYK[272.20]GAASEAGR 2.12 IPI00030098 Natural 1.00 3 2437.2088 -0.1155 Ac-lysine n[43.02]ASGVAVSDGVIK[272.20]VFNDMK[272.20]VR 2.87 IPI00012011 Natural 1.00 2 1755.7678 -0.0429 Ac-lysine n[43.02]ASK[272.20]EMFEDTVEER 1.54 IPI00395865 Natural 0.99 3 1831.9967 -0.028 Ac-lysine n[43.02]ASSDIQVK[272.20]ELEK[272.20]R 2.46 IPI00479997 Natural 0.99 2 1499.7051 -0.0686 Ac-lysine n[43.02]AVTLDK[272.20]DAYYR 1.65 IPI00026970 Natural 1.00 4 2047.9958 -0.0715 Ac-lysine n[43.02]AWK[272.20]SGGASHSELIHNLR 2.03 IPI00411680 Natural 0.98 3 2994.303 -0.0787 Ac-lysine n[43.02]EEEIAALVIDNGSGMC[160.03]K[272.20]AGFAGDDAPR 1.36 IPI00021440 Natural 0.97 2 1656.8493 -0.0494 Ac-lysine n[43.02]MDGIVPDIAVGTK[272.20]R 2.21 IPI00179964 Natural 0.97 4 2574.2508 -0.1656 Ac-lysine n[43.02]MDK[272.20]NELVQK[272.20]AK[272.20]LAEQAER 4.41 IPI00021263 Neo 1.00 3 2547.294 -0.1117 Ac-lysine n[43.02]MDK[272.20]SELVQK[272.20]AK[272.20]LAEQAER 4.75 IPI00216318 Natural 0.82 3 2314.9547 -0.1 Ac-lysine n[43.02]MDWVMK[272.20]HNGPNDASDGTVR 1.01 IPI00013877 Natural 0.99 3 1917.9259 -0.045 Ac-lysine n[43.02]MEEEGVK[272.20]EAGEK[272.20]PR 5.30 IPI00332493 Neo 0.96 2 1411.7694 -0.0283 Ac-lysine n[43.02]MEK[272.20]PSPLLVGR 1.84 IPI00009057 Natural 1.00 3 2589.3148 -0.1379 Ac-lysine n[43.02]MEK[272.20]TELIQK[272.20]AK[272.20]LAEQAER 3.99 IPI00018146 Natural 1.00 2 1630.8001 -0.0716 Ac-lysine n[43.02]MEK[272.20]TLETVPLER 1.52 IPI00396378 Natural 0.66 3 2006.1372 -0.0373 Ac-lysine n[43.02]MEMK[272.20]K[272.20]K[272.20]INLELR 3.93 IPI00165393 Natural 1.00 3 2301.9432 -0.1378 Ac-lysine n[43.02]MESGFTSK[272.20]DTYLSHFNPR 1.74 IPI00027681 Natural 0.82 3 1443.7443 -0.0305 Ac-lysine n[43.02]MK[272.20]K[272.20]SYSGGTR 4.11 IPI00784614 Natural 1.00 3 2087.0705 -0.0442 Ac-lysine n[43.02]MNNQK[272.20]QQK[272.20]PTLSGQR 2.34 IPI00180128 Neo 0.83 3 1986.0333 -0.0954 Ac-lysine n[43.02]MNQEK[272.20]LAK[272.20]LQAQVR 2.41 IPI00221035 Natural 1.00 4 2402.1643 -0.0725 Ac-lysine n[43.02]MQSNK[272.20]TFNLEK[272.20]QNHTPR 3.13 IPI00304596 Natural 0.97 3 2289.1761 -0.0966 Ac-lysine n[43.02]SDK[272.20]LPYK[272.20]VADIGLAAWGR 3.00 IPI00012007 Natural 0.97 3 1993.9834 -0.0366 Ac-lysine n[43.02]SDK[272.20]PDLSEVEK[272.20]FDR 2.34 IPI00167110 Natural 0.99 2 1731.8477 -0.065 Ac-lysine n[43.02]SDSEK[272.20]LNLDSIIGR 0.76 IPI00027423 Natural 1.00 3 2368.1308 -0.0659 Ac-lysine n[43.02]SK[272.20]K[272.20]ISGGSVVEMQGDEMTR 2.40 IPI00027223 Natural 0.98 2 1134.5827 -0.029 Ac-lysine n[43.02]SK[272.20]NTVSSAR 1.31 IPI00007280 Natural 0.94 3 1843.9584 -0.0299 Ac-lysine n[43.02]SK[272.20]SESPK[272.20]EPEQLR 2.10 IPI00215965 Natural 0.99 2 1439.7107 -0.038 Ac-lysine n[43.02]SK[272.20]SFQQSSLSR 1.28 IPI00017297 Natural 0.99 3 1877.1025 -0.0282 Ac-lysine n[43.02]SK[272.20]SLK[272.20]K[272.20]LVEESR 2.69 IPI00017256 Natural 1.00 2 1678.7666 -0.0621 Ac-lysine n[43.02]SQAEFEK[272.20]AAEEVR 1.63 IPI00010182  203 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 114/ iTRAQ 115 IPI # Natural 1.00 2 1633.8133 -0.0374 Ac-lysine n[43.02]SSK[272.20]TASTNNIAQAR 1.51 IPI00221232 Natural 0.82 3 2499.206 -0.0897 Ac-lysine n[43.02]SSTQFNK[272.20]GPSYGLSAEVK[272.20]NR 2.09 IPI00015262 Natural 0.94 3 2092.0825 -0.0518 Ac-lysine n[43.02]TVGK[272.20]SSK[272.20]MLQHIDYR 2.68 IPI00027285 Neo 0.97 2 1569.8446 -0.0401 Ac-lysine n[43.02]VDVSK[272.20]PDLTAALR 1.47 IPI00418471 Neo 0.76 3 1435.7538 -0.0618 Ac-lysine n[43.02]YQK[272.20]STELLIR 1.15 IPI00171611   204 Appendix B.9 Peptides identified by iTRAQ-TAILS in conditioned medium of HMEC2. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 114) or sMT6EΔA (iTRAQ 115) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 114/ iTRAQ 115 IPI # Neo 1.00 3 1757.8896 -0.0732 iTRAQ n[145.11]AAQTSPSPK[272.20]AGAATGR 0.81 IPI00303476 Neo 1.00 3 1666.8285 -0.0592 iTRAQ n[145.11]ADAINTEFK[272.20]NTR 0.93 IPI00418471 Neo 1.00 3 1774.856 -0.0857 iTRAQ n[145.11]ADANLEAGNVK[272.20]ETR 0.99 IPI00328113 Neo 1.00 2 1550.6784 -0.1023 iTRAQ n[145.11]ADGTQTVNYVPSR 0.77 IPI00302592 Neo 1.00 2 1319.493 -0.0777 iTRAQ n[145.11]AEGPDEDSSNR 0.98 IPI00009904 Neo 0.89 3 1732.8508 -0.0689 iTRAQ n[145.11]AENQVELEEK[272.20]TR 0.72 IPI00000184 Neo 1.00 2 1710.691 -0.1393 iTRAQ n[145.11]AGASATFPMQC[160.03]SALR 1.05 IPI00376005 Neo 1.00 2 1119.4826 -0.0601 iTRAQ n[145.11]AGFAGDDAPR 0.60 IPI00008603 Neo 1.00 3 2468.1535 -0.1328 iTRAQ n[145.11]AGGAAQLALDK[272.20]SDSHPSDALTR 0.93 IPI00028031 Neo 0.99 3 1949.0393 -0.0874 iTRAQ n[145.11]AGGTEIGK[272.20]TLAEK[272.20]SR 0.81 IPI00029400 Neo 1.00 2 1431.655 -0.0898 iTRAQ n[145.11]AGMAMAGQSPVLR 0.81 IPI00179964 Natural 0.97 2 968.5325 -0.0562 iTRAQ n[145.11]AGPAAAVLR 4.30 IPI00292936 Neo 0.98 3 1480.7483 -0.0758 iTRAQ n[145.11]AINTEFK[272.20]NTR 0.78 IPI00418471 Neo 0.96 3 1302.7149 -0.035 iTRAQ n[145.11]AK[272.20]LAEQAER 0.60 IPI00000816 Neo 0.99 3 1504.7377 -0.1076 iTRAQ n[145.11]ALK[272.20]GTNESLER 0.81 IPI00418471 Natural 0.96 2 1214.5244 -0.0773 iTRAQ n[145.11]APDQDEIQR 0.91 IPI00021794 Neo 0.99 3 2187.9221 -0.2081 iTRAQ n[145.11]APGLQC[160.03]HPPK[272.20]DDEAPLR 0.40 IPI00029235 Natural 0.99 3 1360.6871 -0.0466 iTRAQ n[145.11]APPAAGQQQPPR 0.53 IPI00002802 Natural 0.97 2 1100.5485 -0.0572 iTRAQ n[145.11]AQTAAATAPR 0.76 IPI00294911 Natural 1.00 2 1324.5669 -0.0828 iTRAQ n[145.11]ASEGGFTATGQR 0.51 IPI00003351 Neo 0.95 3 2020.0742 -0.1052 iTRAQ n[145.11]ASGK[272.20]IEK[272.20]YNVPLNR 0.90 IPI00008918 Neo 0.89 2 952.4375 -0.0472 iTRAQ n[145.11]ASQNSFR 1.03 IPI00296053 Natural 0.87 2 989.5133 -0.0494 iTRAQ n[145.11]ASVATELR 16.95 IPI00013874 Natural 0.88 3 2515.007 -0.1817 iTRAQ n[145.11]C[160.03]TC[160.03]VPPHPQTAFC[160.03]NSDLVIR 0.81 IPI00032292 Natural 1.00 3 1664.777 -0.0717 iTRAQ n[145.11]DAPEEEDHVLVLR 0.77 IPI00010796 Neo 0.90 2 1273.5629 -0.0758 iTRAQ n[145.11]DATSPLQENR 1.18 IPI00002214 Natural 1.00 3 2264.9178 -0.1669 iTRAQ n[145.11]DDEVDVDGTVEEDLGK[272.20]SR 0.56 IPI00027230 Neo 0.96 2 987.4341 -0.0406 iTRAQ n[145.11]DDGEVGPR 0.62 IPI00477611 Neo 0.89 3 1383.6627 -0.0237 iTRAQ n[145.11]DENEHQLSLR 0.55 IPI00220740 Neo 0.99 3 1612.8745 -0.0759 iTRAQ n[145.11]DNIQGITK[272.20]PAIR 0.86 IPI00453473 Neo 1.00 3 1641.7605 -0.0592 iTRAQ n[145.11]DSYVGDEAQSK[272.20]R 0.64 IPI00008603 Neo 0.97 4 2414.0738 -0.1036 iTRAQ n[145.11]DTAENETTEK[272.20]EEK[272.20]SESR 0.58 IPI00014516 Neo 1.00 3 2538.9121 -0.1396 iTRAQ n[145.11]DVK[272.20]C[160.03]DMEVSC[160.03]PDGYTC[160.03]C[160.03]R 0.82 IPI00181753 Neo 1.00 3 1687.8258 -0.0729 iTRAQ n[145.11]EAPK[272.20]VVEEQESR 0.79 IPI00032258 Neo 1.00 3 2024.8206 -0.0811 iTRAQ n[145.11]EDGDEDEEAESATGK[272.20]R 0.64 IPI00385149 Neo 0.88 2 1032.4818 -0.0504 iTRAQ n[145.11]EEGAAVASR 0.68 IPI00019439  205 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 114/ iTRAQ 115 IPI # Natural 0.98 2 1398.6069 -0.0788 iTRAQ n[145.11]EEQPPETAAQR 0.85 IPI00386755 Neo 0.96 2 1275.5586 -0.0591 iTRAQ n[145.11]ENGAEASADLR 0.73 IPI00219365 Neo 0.98 3 1429.7449 -0.0432 iTRAQ n[145.11]ENK[272.20]GATAAPQR 0.40 IPI00170786 Neo 0.86 2 1316.5509 -0.0756 iTRAQ n[145.11]EQAPGTAPC[160.03]SR 0.69 IPI00010277 Neo 0.85 2 995.4225 -0.0422 iTRAQ n[145.11]EVC[160.03]MASR 0.89 IPI00166039 Neo 0.99 2 991.4251 -0.0596 iTRAQ n[145.11]FAGDDAPR 0.66 IPI00008603 Neo 1.00 2 1108.4706 -0.0561 iTRAQ n[145.11]FDSDAASPR 0.90 IPI00004657 Neo 1.00 2 1396.5538 -0.0799 iTRAQ n[145.11]FGSDQSENVDR 0.79 IPI00258804 Neo 1.00 2 1522.626 -0.1057 iTRAQ n[145.11]FMGNTGPTGAVGDR 0.65 IPI00306322 Neo 1.00 3 1398.6694 -0.0433 iTRAQ n[145.11]FVGGAENTAHPR 1.09 IPI00029236 Neo 1.00 2 1293.5149 -0.0588 iTRAQ n[145.11]GAETEVDC[160.03]NR 1.75 IPI00029723 Neo 0.96 3 1413.7541 -0.0466 iTRAQ n[145.11]GAK[272.20]PEPVAMAR 0.66 IPI00013290 Neo 1.00 2 1523.6096 -0.0911 iTRAQ n[145.11]GAQTQTEEEMTR 0.87 IPI00029723 Neo 1.00 3 1844.7682 -0.0875 iTRAQ n[145.11]GENTSNMTHLEAQNR 0.67 IPI00010414 Neo 0.99 3 2568.9577 -0.268 iTRAQ n[145.11]GETGHVAINC[160.03]SK[272.20]TSEVNC[160.03]YR 0.74 IPI00430812 Neo 1.00 2 1048.4639 -0.0418 iTRAQ n[145.11]GFAGDDAPR 0.79 IPI00008603 Natural 0.99 3 1551.7261 -0.0556 iTRAQ n[145.11]GHQQLYWSHPR 0.76 IPI00182289 Natural 0.99 3 1648.8947 -0.116 iTRAQ n[145.11]GK[272.20]VK[272.20]VGVNGFGR 0.86 IPI00219018 Neo 0.98 3 1691.7932 -0.0685 iTRAQ n[145.11]GMNAPK[272.20]GQTGNSSR 0.86 IPI00012079 Neo 0.99 2 1061.4933 -0.0474 iTRAQ n[145.11]GPNIC[160.03]TTR 0.75 IPI00220350 Neo 0.92 3 1516.797 -0.0669 iTRAQ n[145.11]GPVLGLK[272.20]EC[160.03]TR 0.70 IPI00012503 Neo 0.97 2 1249.4881 -0.0776 iTRAQ n[145.11]GSDQSENVDR 0.60 IPI00258804 Neo 1.00 2 1364.6457 -0.071 iTRAQ n[145.11]GTQTVNYVPSR 0.97 IPI00302592 Neo 0.95 3 1477.7392 -0.0585 iTRAQ n[145.11]GTVEEDLGK[272.20]SR 0.89 IPI00027230 Neo 0.96 3 1750.8106 -0.1772 iTRAQ n[145.11]GVK[272.20]K[272.20]FDVPC[160.03]GGR 0.70 IPI00306322 Neo 0.93 2 943.4834 -0.0373 iTRAQ n[145.11]GVPVEGSR 0.70 IPI00031801 Neo 1.00 2 1457.5554 -0.2043 iTRAQ n[145.11]GVQVETISPGDGR 0.74 IPI00413778 Natural 0.99 3 1437.6549 -0.0574 iTRAQ n[145.11]HWPSEPSEAVR 0.65 IPI00028911 Neo 1.00 4 1670.8654 -0.0442 iTRAQ n[145.11]K[272.20]FVGGAENTAHPR 0.84 IPI00029236 Neo 0.96 3 1271.7442 -0.0363 iTRAQ n[145.11]K[272.20]PDLTAALR 0.42 IPI00418471 Neo 0.98 3 1474.7467 -0.0516 iTRAQ n[145.11]K[272.20]PQSSSTEPAR 0.41 IPI00013290 Neo 0.88 3 1236.7093 -0.0344 iTRAQ n[145.11]K[272.20]PVSLSYR 0.63 IPI00413781 Neo 1.00 3 1347.6758 -0.0379 iTRAQ n[145.11]K[272.20]QTDFEHR 0.86 IPI00009790 Neo 1.00 3 2001.0496 -0.0971 iTRAQ n[145.11]K[272.20]TTTLSGTAPAAGVVPSR 0.55 IPI00220113 Natural 1.00 3 2040.9729 -0.1208 iTRAQ n[145.11]K[272.20]VEQAVETEPEPELR 0.47 IPI00021842 Neo 0.81 2 942.4974 -0.0394 iTRAQ n[145.11]LANTQPR 0.75 IPI00020513 Natural 0.92 2 1207.4643 -0.0614 iTRAQ n[145.11]MGGEQEEER 0.86 IPI00550746 Natural 0.92 3 1349.7589 -0.0358 iTRAQ n[145.11]MK[272.20]LTDSVLR 0.67 IPI00152695 Natural 0.97 3 1639.7668 -0.0716 iTRAQ n[145.11]MQPASAK[272.20]WYDR 0.86 IPI00015029 Natural 1.00 3 1861.7866 -0.0791 iTRAQ n[145.11]NEGSVTGSC[160.03]YC[160.03]GK[272.20]R 0.51 IPI00004946 Neo 0.96 4 3052.562 -0.1649 iTRAQ n[145.11]NVNFQK[272.20]AINEK[272.20]LGQYASPTAK[272.20]R 0.42 IPI00032258 Natural 0.98 3 1304.6745 -0.0369 iTRAQ n[145.11]PAVSK[272.20]GDGMR 0.56 IPI00016621 Natural 1.00 3 2003.0072 -0.0972 iTRAQ n[145.11]PGVTVK[272.20]DVNQQEFVR 1.14 IPI00215780 Natural 1.00 2 1613.6397 -0.12 iTRAQ n[145.11]PQYQTWEEFSR 0.75 IPI00216125  206 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 114/ iTRAQ 115 IPI # Natural 0.94 2 1149.5511 -0.0641 iTRAQ n[145.11]PTVEELYR 0.68 IPI00006684 Neo 1.00 3 2145.0531 -0.0963 iTRAQ n[145.11]SAAQAAAQTNSNAAGK[272.20]QLR 0.52 IPI00410693 Natural 1.00 2 1349.5069 -0.0568 iTRAQ n[145.11]SAPGEDEEC[160.03]GR 0.78 IPI00217882 Neo 0.98 2 1257.556 -0.0697 iTRAQ n[145.11]SAPLAAGC[160.03]PDR 0.76 IPI00003176 Neo 0.99 2 1755.712 -0.1429 iTRAQ n[145.11]SATAGSEGGFLAPEYR 0.52 IPI00019439 Neo 0.96 3 1588.809 -0.0574 iTRAQ n[145.11]SEETPAISPSK[272.20]R 0.67 IPI00375015 Neo 0.93 3 1717.943 -0.0887 iTRAQ n[145.11]SGAGLK[272.20]WK[272.20]NVAR 0.61 IPI00010882 Neo 1.00 3 1620.7819 -0.0638 iTRAQ n[145.11]SGGASHSELIHNLR 0.70 IPI00411680 Neo 1.00 3 2019.9273 -0.0975 iTRAQ n[145.11]SGPPVFAPSNHVSEAQPR 0.77 IPI00332493 Neo 1.00 3 1527.6798 -0.0424 iTRAQ n[145.11]SGSMDPSGAHPSVR 0.63 IPI00008575 Neo 0.90 3 1492.7739 -0.035 iTRAQ n[145.11]SGSSESPASLK[272.20]R 0.50 IPI00220592 Neo 1.00 3 1595.7666 -0.0841 iTRAQ n[145.11]SK[272.20]FADLSEAANR 0.61 IPI00418471 Neo 0.88 3 1387.8057 -0.07 iTRAQ n[145.11]SK[272.20]LVVITQGR 0.54 IPI00413916 Neo 0.99 3 1358.7597 -0.0528 iTRAQ n[145.11]SK[272.20]PDLTAALR 0.65 IPI00418471 Neo 0.92 4 2183.1497 -0.0639 iTRAQ n[145.11]SK[272.20]VGSTENIK[272.20]HQPGGGR 0.65 IPI00220113 Neo 0.99 3 2328.0107 -0.132 iTRAQ n[145.11]SLAGSSGPGASSGTSGDHGELVVR 1.04 IPI00023048 Natural 0.91 3 1260.6605 -0.0496 iTRAQ n[145.11]SPVLHFYVR 0.78 IPI00004534 Natural 0.98 2 1219.5316 -0.0599 iTRAQ n[145.11]SQDASDGLQR 0.88 IPI00009276 Neo 1.00 3 1467.731 -0.0606 iTRAQ n[145.11]SQLLGSAHEVQR 1.00 IPI00744706 Neo 0.98 2 1146.5606 -0.0511 iTRAQ n[145.11]STAAQQELR 0.90 IPI00019502 Neo 0.87 2 1094.4477 -0.0494 iTRAQ n[145.11]SVMC[160.03]PDAR 1.27 IPI00182138 Neo 1.00 3 1800.9143 -0.0834 iTRAQ n[145.11]SVPAAEPEYPK[272.20]GIR 0.78 IPI00172460 Neo 0.91 2 1221.514 -0.0608 iTRAQ n[145.11]SYSPEPDQR 0.75 IPI00298237 Neo 0.99 3 1481.8394 -0.0523 iTRAQ n[145.11]TAAAPK[272.20]AGPGVVR 0.55 IPI00017596 Natural 0.98 4 1889.0118 -0.0578 iTRAQ n[145.11]TENSTSAPAAK[272.20]PK[272.20]R 0.81 IPI00550239 Neo 1.00 4 2002.0467 -0.0705 iTRAQ n[145.11]TK[272.20]EAEGAPQVEAGK[272.20]R 0.86 IPI00014516 Neo 0.90 2 1260.532 -0.057 iTRAQ n[145.11]TPAPETC[160.03]EGR 0.73 IPI00030241 Neo 0.96 3 1691.9062 -0.0582 iTRAQ n[145.11]TPSGTNSGAGK[272.20]K[272.20]R 1.01 IPI00003386 Neo 1.00 2 1465.6108 -0.0849 iTRAQ n[145.11]TSEMVNGATEQR 0.87 IPI00005614 Neo 0.81 2 1160.5682 -0.0589 iTRAQ n[145.11]TTAAQQELR 0.75 IPI00397526 Natural 0.87 3 2194.0932 -0.1325 iTRAQ n[145.11]TVGK[272.20]SSK[272.20]MLQHIDYR 0.89 IPI00027285 Neo 0.95 2 1058.5433 -0.0524 iTRAQ n[145.11]VASVQQQR 0.65 IPI00106668 Neo 0.94 3 1671.8443 -0.1324 iTRAQ n[145.11]VDVSK[272.20]PDLTAALR 0.55 IPI00418471 Neo 0.99 3 2340.1746 -0.1411 iTRAQ n[145.11]VGVDTK[272.20]HQTLQGVAFPISR 0.91 IPI00183508 Neo 0.94 3 1432.7138 -0.0679 iTRAQ n[145.11]VK[272.20]MAAAGGGGGGGR 0.71 IPI00027834 Natural 0.91 2 949.4001 -0.0406 iTRAQ n[145.11]VNDGDMR 0.78 IPI00023673 Neo 0.98 2 1512.6529 -0.0948 iTRAQ n[145.11]VPTQC[160.03]DVPPNSR 0.98 IPI00293088 Neo 0.99 3 1457.8075 -0.0734 iTRAQ n[145.11]VSK[272.20]PDLTAALR 0.67 IPI00418471 Natural 0.97 3 1725.9471 -0.0784 iTRAQ n[145.11]YALSGSVWK[272.20]K[272.20]R 0.48 IPI00014758 Neo 0.97 3 1681.794 -0.0728 iTRAQ n[145.11]YQGPVGDPDK[272.20]YR 30.31 IPI00014758 Neo 0.90 2 1006.4799 -0.0408 iTRAQ n[145.11]YVEPAER 0.51 IPI00013897 Neo 1.00 3 1436.7759 -0.0468 iTRAQ n[145.11]YVPSTTK[272.20]TPR 0.67 IPI00011875 Natural 0.93 2 1116.5229 -0.1148 Ac-lysine n[43.02]AAAAVSSAK[272.20]R 1.05 IPI00220567 Neo 0.99 2 1652.7729 -0.0988 Ac-lysine n[43.02]AAPAQQTTQPGGGK[272.20]R 0.63 IPI00465054  207 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 114/ iTRAQ 115 IPI # Natural 1.00 2 1328.6557 -0.098 Ac-lysine n[43.02]AATTGSGVK[272.20]VPR 0.75 IPI00472498 Natural 0.99 3 2137.9548 -0.0899 Ac-lysine n[43.02]AAVK[272.20]DSC[160.03]GK[272.20]GEMATGNGR 0.83 IPI00334159 Natural 0.91 3 1796.968 -0.1037 Ac-lysine n[43.02]AAVK[272.20]TLNPK[272.20]AEVAR 0.61 IPI00027626 Natural 0.93 2 1387.6098 -0.0715 Ac-lysine n[43.02]ADNEK[272.20]LDNQR 1.01 IPI00012578 Natural 0.88 2 1459.5914 -0.0933 Ac-lysine n[43.02]ADQGEK[272.20]ENPMR 0.58 IPI00746438 Neo 0.95 3 1570.6049 -0.073 Ac-lysine n[43.02]AEK[272.20]FDC[160.03]HYC[160.03]R 0.72 IPI00014398 Natural 0.87 3 1475.761 -0.0477 Ac-lysine n[43.02]AHYK[272.20]AADSK[272.20]R 0.61 IPI00554793 Natural 0.97 2 1403.6539 -0.0839 Ac-lysine n[43.02]AK[272.20]ISSPTETER 0.79 IPI00013895 Natural 0.94 3 1473.7952 -0.0445 Ac-lysine n[43.02]AK[272.20]PLTDSEK[272.20]R 1.22 IPI00004358 Natural 0.96 2 1352.5875 -0.0752 Ac-lysine n[43.02]ANK[272.20]GPSYGMSR 0.81 IPI00216138 Natural 0.99 2 1587.6366 -0.1067 Ac-lysine n[43.02]AQDQGEK[272.20]ENPMR 2.00 IPI00376798 Natural 0.99 2 1393.6281 -0.0786 Ac-lysine n[43.02]AQYK[272.20]GAASEAGR 0.74 IPI00030098 Natural 0.98 3 1831.8896 -0.1351 Ac-lysine n[43.02]ASSDIQVK[272.20]ELEK[272.20]R 0.81 IPI00479997 Natural 0.88 3 1788.8726 -0.0735 Ac-lysine n[43.02]ATEEK[272.20]K[272.20]PETEAAR 0.95 IPI00005492 Natural 0.97 4 2402.1155 -0.1213 Ac-lysine n[43.02]MQSNK[272.20]TFNLEK[272.20]QNHTPR 0.60 IPI00304596 Natural 1.00 3 2368.0526 -0.1441 Ac-lysine n[43.02]SK[272.20]K[272.20]ISGGSVVEMQGDEMTR 0.75 IPI00027223 Natural 0.97 2 1134.5405 -0.0712 Ac-lysine n[43.02]SK[272.20]NTVSSAR 0.70 IPI00007280 Natural 0.98 3 1843.9029 -0.0854 Ac-lysine n[43.02]SK[272.20]SESPK[272.20]EPEQLR 0.63 IPI00215965 Natural 0.92 2 1408.6749 -0.0795 Ac-lysine n[43.02]SQPGQK[272.20]PAASPR 0.86 IPI00760715 Natural 1.00 2 1633.7452 -0.1055 Ac-lysine n[43.02]SSK[272.20]TASTNNIAQAR 0.70 IPI00221232 Natural 0.92 2 1429.5226 -0.0974 Ac-lysine n[43.02]SSNEC[160.03]FK[272.20]C[160.03]GR 0.79 IPI00430813 Natural 1.00 3 1786.8867 -0.0914 Ac-lysine n[43.02]TENSTSAPAAK[272.20]PK[272.20]R 0.90 IPI00550239   208 Appendix B.10 Peptides identified by iTRAQ-TAILS in membrane fractions of HMEC1xHMEC2. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 116) or sMT6EΔA (iTRAQ 117) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated.  N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI Natural 1.00 2 1451.7554 -0.0413 iTRAQ n[145.11]AAAGAAATHLEVAR 1.28 IPI00465308 Natural 0.99 2 1200.5305 -0.0552 iTRAQ n[145.11]AANYSSTSTR 1.72 IPI00301280 Neo 1.00 3 1757.9215 -0.0412 iTRAQ n[145.11]AAQTSPSPK[272.20]AGAATGR 1.46 IPI00303476 Neo 0.99 2 1254.7116 -0.0301 iTRAQ n[145.11]AATLILEPAGR 1.22 IPI00220906 Natural 1.00 3 1743.8892 -0.0695 iTRAQ n[145.11]AAVAATAAAK[272.20]GNGGGGGR 2.38 IPI00384497 Neo 1.00 3 1666.8534 -0.0343 iTRAQ n[145.11]ADAINTEFK[272.20]NTR 1.61 IPI00418471 Neo 1.00 3 1774.856 -0.0857 iTRAQ n[145.11]ADANLEAGNVK[272.20]ETR 2.06 IPI00328113 Neo 0.99 2 1199.5159 -0.0208 iTRAQ n[145.11]AEFSSEAC[160.03]R 1.37 IPI00030877 Neo 1.00 2 1319.493 -0.0777 iTRAQ n[145.11]AEGPDEDSSNR 1.41 IPI00009904 Neo 1.00 2 1119.5127 -0.03 iTRAQ n[145.11]AGFAGDDAPR 1.72 IPI00008603 Neo 1.00 3 2468.1535 -0.1328 iTRAQ n[145.11]AGGAAQLALDK[272.20]SDSHPSDALTR 2.10 IPI00028031 Natural 1.00 3 1692.8532 -0.0495 iTRAQ n[145.11]AGGEAGVTLGQPHLSR 1.83 IPI00297982 Neo 1.00 2 1431.7123 -0.0324 iTRAQ n[145.11]AGMAMAGQSPVLR 2.08 IPI00179964 Neo 0.99 3 1504.7377 -0.1076 iTRAQ n[145.11]ALK[272.20]GTNESLER 1.44 IPI00418471 Natural 1.00 3 1997.0869 -0.0644 iTRAQ n[145.11]APAEILNGK[272.20]EISAQIR 2.02 IPI00218342 Natural 0.96 2 1214.588 -0.0137 iTRAQ n[145.11]APDQDEIQR 1.47 IPI00021794 Natural 0.88 3 1293.7654 -0.0363 iTRAQ n[145.11]APEVLPK[272.20]PR 1.30 IPI00015972 Neo 1.00 4 1850.9669 -0.0568 iTRAQ n[145.11]APHNPAPPTSTVIHIR 1.94 IPI00303726 Natural 1.00 3 1969.0164 -0.0712 iTRAQ n[145.11]APSVPAAEPEYPK[272.20]GIR 1.63 IPI00172460 Natural 1.00 2 1100.5873 -0.0184 iTRAQ n[145.11]AQTAAATAPR 1.72 IPI00294911 Natural 1.00 3 1855.9327 -0.071 iTRAQ n[145.11]ASGANFEYIIAEK[272.20]R 1.76 IPI00024993 Natural 1.00 2 1916.7826 -0.1371 iTRAQ n[145.11]ASGGGVPTDEEQATGLER 1.50 IPI00021785 Neo 0.89 2 952.4375 -0.0472 iTRAQ n[145.11]ASQNSFR 2.54 IPI00296053 Neo 0.98 2 1208.5982 -0.0285 iTRAQ n[145.11]ASSPGGVYATR 1.24 IPI00418471 Neo 1.00 3 1595.83 -0.0207 iTRAQ n[145.11]DAINTEFK[272.20]NTR 1.52 IPI00418471 Natural 1.00 3 1664.8005 -0.0482 iTRAQ n[145.11]DAPEEEDHVLVLR 1.41 IPI00010796 Natural 1.00 3 2264.9178 -0.1669 iTRAQ n[145.11]DDEVDVDGTVEEDLGK[272.20]SR 1.78 IPI00027230 Neo 1.00 4 2885.3433 -0.1971 iTRAQ n[145.11]DDLEALK[272.20]K[272.20]K[272.20]GC[160.03]PPDDIENPR 2.38 IPI00217561 Natural 1.00 3 1503.7384 -0.0533 iTRAQ n[145.11]DGVGGDPAVALPHR 2.18 IPI00026530 Neo 1.00 3 1589.7966 -0.0291 iTRAQ n[145.11]DNADSSPVVDK[272.20]R 1.28 IPI00328753 Neo 1.00 3 1612.9356 -0.0148 iTRAQ n[145.11]DNIQGITK[272.20]PAIR 1.71 IPI00453473 Neo 1.00 3 2554.9764 -0.0703 iTRAQ n[145.11]DVK[272.20]C[160.03]DMEVSC[160.03]PDGYTC[160.03]C[160.03]R 1.87 IPI00181753 Neo 0.99 2 1330.6684 -0.0163 iTRAQ n[145.11]EAGLETESPVR 1.42 IPI00009885  209 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI Neo 0.99 2 1263.6006 -0.0171 iTRAQ n[145.11]EAGSTAGAAETR 1.76 IPI00220002 Natural 0.98 2 1398.6561 -0.0296 iTRAQ n[145.11]EEQPPETAAQR 1.46 IPI00386755 Natural 0.98 3 1787.9424 -0.0793 iTRAQ n[145.11]ENSTSAPAAK[272.20]PK[272.20]R 1.45 IPI00550239 Neo 0.88 2 1316.5959 -0.0308 iTRAQ n[145.11]EQAPGTAPC[160.03]SR 1.90 IPI00010277 Natural 0.96 3 1402.6743 -0.0544 iTRAQ n[145.11]ESAGADTRPTVR 1.79 IPI00025796 Natural 1.00 2 1507.7234 -0.0613 iTRAQ n[145.11]ESETTTSLVLER 1.44 IPI00029744 Neo 1.00 3 1779.8166 -0.053 iTRAQ n[145.11]ETVHC[160.03]DLQPVGPER 1.71 IPI00017567 Neo 0.74 3 1240.6123 -0.0199 iTRAQ n[145.11]EVAPPEYHR 1.82 IPI00409675 Neo 1.00 3 1327.65 -0.0357 iTRAQ n[145.11]EVHVSTVEER 1.19 IPI00217683 Neo 1.00 2 1396.6022 -0.0315 iTRAQ n[145.11]FGSDQSENVDR 1.40 IPI00258804 Natural 1.00 2 1127.6005 -0.0312 iTRAQ n[145.11]GAGGALFVHR 1.47 IPI00291328 Neo 1.00 2 1238.6521 -0.0586 iTRAQ n[145.11]GAPEVLVSAPR 1.42 IPI00143921 Neo 0.99 3 2568.9577 -0.268 iTRAQ n[145.11]GETGHVAINC[160.03]SK[272.20]TSEVNC[160.03]YR 1.64 IPI00430812 Natural 0.99 3 1551.7261 -0.0556 iTRAQ n[145.11]GHQQLYWSHPR 1.32 IPI00182289 Neo 0.96 4 1785.9192 -0.0425 iTRAQ n[145.11]GK[272.20]AEELHYPLGER 1.54 IPI00029628 Natural 1.00 3 1671.8703 -0.0485 iTRAQ n[145.11]GK[272.20]DYYQTLGLAR 1.50 IPI00015947 Natural 0.99 3 1648.8947 -0.116 iTRAQ n[145.11]GK[272.20]VK[272.20]VGVNGFGR 1.82 IPI00219018 Neo 0.99 2 1061.5145 -0.0262 iTRAQ n[145.11]GPNIC[160.03]TTR 1.57 IPI00220350 Neo 0.84 3 1428.7547 -0.0422 iTRAQ n[145.11]GQTFEYLK[272.20]R 1.73 IPI00218337 Neo 0.99 2 1229.653 -0.0317 iTRAQ n[145.11]GQVITIGNER 1.87 IPI00003269 Neo 1.00 2 1457.7455 -0.0142 iTRAQ n[145.11]GVQVETISPGDGR 1.16 IPI00413778 Neo 1.00 2 1275.5715 -0.0502 iTRAQ n[145.11]GYSFTTTAER 1.56 IPI00021439 Neo 0.97 3 1658.8092 -0.0347 iTRAQ n[145.11]IWHHTFYNELR 1.78 IPI00021428 Neo 1.00 10 1391.721 -0.0187 iTRAQ n[145.11]K[272.20]AGFAGDDAPR 1.84 IPI00008603 Neo 0.92 3 1236.7034 -0.0403 iTRAQ n[145.11]K[272.20]PVSLSYR 2.43 IPI00413781 Neo 1.00 3 1334.7602 -0.0555 iTRAQ n[145.11]LHLGVTPSVIR 1.64 IPI00298237 Natural 0.91 2 1019.5365 -0.0152 iTRAQ n[145.11]LPASFDAR 1.38 IPI00295741 Natural 1.00 3 1937.8745 -0.0832 iTRAQ n[145.11]LRPGDC[160.03]EVC[160.03]ISYLGR 1.08 IPI00328748 Natural 1.00 3 1424.816 -0.0257 iTRAQ n[145.11]MAPEVLPK[272.20]PR 1.74 IPI00015972 Natural 0.97 2 1441.7582 -0.0295 iTRAQ n[145.11]MFLYNLTLQR 1.65 IPI00179138 Natural 0.99 3 1608.9102 -0.0275 iTRAQ n[145.11]MK[272.20]PILLQGHER 1.51 IPI00012795 Natural 1.00 2 1466.7272 -0.0285 iTRAQ n[145.11]MLSLDFLDDVR 1.26 IPI00104128 Natural 0.99 2 1611.8261 -0.0346 iTRAQ n[145.11]MPPYTVVYFPVR 2.33 IPI00219757 Natural 1.00 3 1639.7881 -0.0503 iTRAQ n[145.11]MQPASAK[272.20]WYDR 1.96 IPI00015029 Natural 0.97 3 1630.8429 -0.0761 iTRAQ n[145.11]MTK[272.20]GTSSFGK[272.20]R 1.83 IPI00220871 Neo 0.99 3 1497.8898 -0.0337 iTRAQ n[145.11]NIQGITK[272.20]PAIR 1.54 IPI00453473 Natural 0.98 3 1304.6745 -0.0369 iTRAQ n[145.11]PAVSK[272.20]GDGMR 1.67 IPI00016621 Natural 0.92 3 1222.7357 -0.0284 iTRAQ n[145.11]PEVLPK[272.20]PR 1.44 IPI00015972 Natural 1.00 3 1813.8548 -0.0469 iTRAQ n[145.11]PGHLQEGFGC[160.03]VVTNR 2.40 IPI00410693 Natural 1.00 2 1513.6791 -0.0816 iTRAQ n[145.11]PGPTPSGTNVGSSGR 1.99 IPI00220835 Natural 1.00 3 2003.0287 -0.0757 iTRAQ n[145.11]PGVTVK[272.20]DVNQQEFVR 2.32 IPI00215780 Natural 0.99 2 1480.7627 -0.057 iTRAQ n[145.11]PPYTVVYFPVR 1.77 IPI00219757 Natural 1.00 2 1613.6974 -0.0623 iTRAQ n[145.11]PQYQTWEEFSR 1.88 IPI00216125 Natural 1.00 3 1786.9826 -0.0471 iTRAQ n[145.11]PSK[272.20]GPLQSVQVFGR 2.10 IPI00221092  210 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI Natural 0.98 2 1149.5803 -0.0344 iTRAQ n[145.11]PTVEELYR 2.07 IPI00006684 Natural 1.00 3 1695.9429 -0.0488 iTRAQ n[145.11]PVPPLPEYGGK[272.20]VR 2.30 IPI00029133 Natural 1.00 3 1982.9787 -0.04 iTRAQ n[145.11]QK[272.20]TGTAEMSSILEER 1.70 IPI00440493 Natural 1.00 2 1349.5069 -0.0568 iTRAQ n[145.11]SAPGEDEEC[160.03]GR 1.66 IPI00217882 Natural 1.00 2 1714.7934 -0.0743 iTRAQ n[145.11]SDMPPLTLEGIQDR 1.69 IPI00022442 Natural 1.00 2 1782.7935 -0.0462 iTRAQ n[145.11]SDVLELTDDNFESR 1.51 IPI00025252 Neo 1.00 3 1962.8901 -0.0504 iTRAQ n[145.11]SGTLGHPGSLDETTYER 1.84 IPI00217745 Natural 1.00 3 1750.6974 -0.0543 iTRAQ n[145.11]SHGSQETDEEFDAR 1.72 IPI00025086 Neo 0.99 4 1980.9733 -0.0416 iTRAQ n[145.11]SHTDIK[272.20]VPDFSEYR 1.34 IPI00026964 Neo 1.00 3 1875.9628 -0.0296 iTRAQ n[145.11]SIAAHLDNQVPVESPR 1.46 IPI00018120 Neo 0.79 3 1578.7728 -0.0269 iTRAQ n[145.11]SK[272.20]DGGAWGTEQR 1.84 IPI00219219 Neo 0.94 3 1387.8268 -0.0487 iTRAQ n[145.11]SK[272.20]LVVITQGR 1.84 IPI00413916 Neo 1.00 3 1522.7837 -0.0388 iTRAQ n[145.11]SPALTIENEHIR 1.46 IPI00012989 Natural 0.95 3 1260.6825 -0.0276 iTRAQ n[145.11]SPVLHFYVR 2.11 IPI00004534 Natural 0.98 2 1219.5316 -0.0599 iTRAQ n[145.11]SQDASDGLQR 1.70 IPI00009276 Neo 1.00 3 1467.7621 -0.0296 iTRAQ n[145.11]SQLLGSAHEVQR 1.33 IPI00744706 Natural 1.00 3 2177.1591 -0.0856 iTRAQ n[145.11]SSLGVVTC[160.03]GSVVK[272.20]LLNTR 1.39 IPI00293167 Neo 0.98 2 1146.5606 -0.0511 iTRAQ n[145.11]STAAQQELR 1.62 IPI00019502 Neo 1.00 3 1901.8274 -0.0433 iTRAQ n[145.11]STAYEDYYYHPPPR 2.50 IPI00012074 Natural 1.00 3 1469.7212 -0.0384 iTRAQ n[145.11]SVTVHSSEPEVR 1.99 IPI00001754 Natural 0.98 3 1466.7537 -0.044 iTRAQ n[145.11]TGYTPDEK[272.20]LR 1.97 IPI00219385 Neo 0.95 2 1260.5637 -0.025 iTRAQ n[145.11]TPAPETC[160.03]EGR 1.25 IPI00030241 Neo 0.98 3 2038.2353 -0.0274 iTRAQ n[145.11]VAAPK[272.20]VK[272.20]GGVDVTLPR 2.48 IPI00021812 Neo 1.00 3 1671.9087 -0.068 iTRAQ n[145.11]VDVSK[272.20]PDLTAALR 1.91 IPI00418471 Natural 1.00 2 1483.7179 -0.0618 iTRAQ n[145.11]VDYYEVLGVQR 1.73 IPI00024523 Natural 1.00 3 2405.3059 -0.0458 iTRAQ n[145.11]VK[272.20]LTAELIEQAAQYTNAVR 4.20 IPI00183920 Neo 1.00 3 1432.745 -0.0367 iTRAQ n[145.11]VK[272.20]MAAAGGGGGGGR 1.62 IPI00027834 Natural 0.97 2 949.436 -0.0049 iTRAQ n[145.11]VNDGDMR 1.72 IPI00023673 Natural 0.99 2 1234.6465 -0.0322 iTRAQ n[145.11]VNFTVDQIR 2.02 IPI00186290 Neo 0.98 3 1654.7528 -0.0365 iTRAQ n[145.11]VSGASNHQPNSNSGR 0.81 IPI00017283 Neo 1.00 3 2140.8295 -0.2062 iTRAQ n[145.11]WK[272.20]FEHC[160.03]NFNDVTTR 1.38 IPI00011302 Neo 0.98 4 2231.8266 -0.1454 iTRAQ n[145.11]YEC[160.03]GEK[272.20]GHYAYDC[160.03]HR 1.17 IPI00003377 Natural 0.98 3 1357.8135 -0.0514 Ac-lysine n[43.02]AAAK[272.20]VALTK[272.20]R 1.61 IPI00007084 Natural 0.78 2 1230.6062 -0.0415 Ac-lysine n[43.02]AAPSDGFK[272.20]PR 1.12 IPI00025347 Natural 1.00 2 1584.7349 -0.0993 Ac-lysine n[43.02]AATASAGAGGIDGK[272.20]PR 1.70 IPI00219729 Natural 1.00 2 1328.6557 -0.098 Ac-lysine n[43.02]AATTGSGVK[272.20]VPR 1.49 IPI00472498 Natural 1.00 3 1797.0347 -0.0369 Ac-lysine n[43.02]AAVK[272.20]TLNPK[272.20]AEVAR 1.68 IPI00027626 Natural 1.00 10 2157.0034 -0.1122 Ac-lysine n[43.02]AC[160.03]GLVASNLNLK[272.20]PGEC[160.03]LR 1.24 IPI00219219 Natural 0.99 3 1822.7568 -0.0159 Ac-lysine n[43.02]ADEGK[272.20]SYSEHDDER 1.74 IPI00033153 Natural 1.00 2 1750.7767 -0.036 Ac-lysine n[43.02]ADK[272.20]EAAFDDAVEER 1.25 IPI00328319 Natural 0.99 3 2207.0452 -0.1085 Ac-lysine n[43.02]ADK[272.20]MDMSLDDIIK[272.20]LNR 1.81 IPI00328840 Natural 1.00 2 1661.7797 -0.022 Ac-lysine n[43.02]AEFTSYK[272.20]ETASSR 1.89 IPI00296830 Natural 0.98 2 1253.6022 -0.0355 Ac-lysine n[43.02]AESSDK[272.20]LYR 1.04 IPI00449049 Natural 0.98 4 2324.1549 -0.1183 Ac-lysine n[43.02]AFK[272.20]DTGK[272.20]TPVEPEVAIHR 1.69 IPI00012493  211 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI Natural 0.98 2 1343.6399 -0.1498 Ac-lysine n[43.02]AGITTIEAVK[272.20]R 1.49 IPI00218319 Natural 1.00 2 1342.641 -0.1277 Ac-lysine n[43.02]AGLNSLEAVK[272.20]R 1.57 IPI00010779 Natural 0.93 3 1578.7674 -0.0537 Ac-lysine n[43.02]AK[272.20]HHPDLIFC[160.03]R 1.25 IPI00005511 Natural 0.97 2 1403.6539 -0.0839 Ac-lysine n[43.02]AK[272.20]ISSPTETER 1.44 IPI00013895 Natural 1.00 3 1418.7843 -0.0394 Ac-lysine n[43.02]AK[272.20]PAQGAK[272.20]YR 1.78 IPI00002459 Natural 0.98 3 1514.8366 -0.0294 Ac-lysine n[43.02]AK[272.20]PLTDQEK[272.20]R 1.93 IPI00783313 Natural 0.98 3 1473.7912 -0.0482 Ac-lysine n[43.02]AK[272.20]PLTDSEK[272.20]R 1.79 IPI00004358 Natural 1.00 3 2855.3277 -0.124 Ac-lysine n[43.02]AMATK[272.20]GGTVK[272.20]AASGFNAMEDAQTLR 2.10 IPI00793199 Natural 1.00 3 1831.8842 -0.0645 Ac-lysine n[43.02]AMHNK[272.20]AAPPQIPDTR 1.40 IPI00009373 Natural 0.98 2 1185.635 -0.0237 Ac-lysine n[43.02]ANNDAVLK[272.20]R 1.43 IPI00006252 Natural 1.00 3 1699.8982 -0.0595 Ac-lysine n[43.02]AQAK[272.20]INAK[272.20]ANEGR 1.56 IPI00000643 Natural 0.99 2 1587.6366 -0.1067 Ac-lysine n[43.02]AQDQGEK[272.20]ENPMR 1.73 IPI00376798 Natural 0.94 2 1270.6556 -0.0561 Ac-lysine n[43.02]AQNLK[272.20]DLAGR 1.48 IPI00027252 Natural 1.00 2 1393.6798 -0.0269 Ac-lysine n[43.02]AQYK[272.20]GAASEAGR 1.31 IPI00030098 Natural 1.00 3 2437.2088 -0.1155 Ac-lysine n[43.02]ASGVAVSDGVIK[272.20]VFNDMK[272.20]VR 1.83 IPI00012011 Natural 1.00 2 1755.7678 -0.0429 Ac-lysine n[43.02]ASK[272.20]EMFEDTVEER 1.78 IPI00395865 Natural 0.99 3 1831.9967 -0.028 Ac-lysine n[43.02]ASSDIQVK[272.20]ELEK[272.20]R 1.97 IPI00479997 Natural 1.00 2 1571.8623 -0.0384 Ac-lysine n[43.02]ATVTATTK[272.20]VPEIR 1.27 IPI00009104 Natural 0.99 2 1630.8341 -0.0456 Ac-lysine n[43.02]AVPPTYADLGK[272.20]SAR 1.84 IPI00216308 Natural 0.99 2 1499.7051 -0.0686 Ac-lysine n[43.02]AVTLDK[272.20]DAYYR 1.59 IPI00026970 Natural 1.00 4 2047.9958 -0.0715 Ac-lysine n[43.02]AWK[272.20]SGGASHSELIHNLR 1.14 IPI00411680 Natural 0.98 3 2994.303 -0.0787 Ac-lysine n[43.02]EEEIAALVIDNGSGMC[160.03]K[272.20]AGFAGDDAPR 1.71 IPI00021440 Natural 0.95 2 1563.767 -0.0417 Ac-lysine n[43.02]MDPFTEK[272.20]LLER 1.13 IPI00032958 Natural 1.00 2 1630.8001 -0.0716 Ac-lysine n[43.02]MEK[272.20]TLETVPLER 1.04 IPI00396378 Natural 1.00 3 2301.9432 -0.1378 Ac-lysine n[43.02]MESGFTSK[272.20]DTYLSHFNPR 2.08 IPI00027681 Natural 0.96 2 1411.6603 -0.0434 Ac-lysine n[43.02]MFSWVSK[272.20]DAR 1.78 IPI00017184 Natural 1.00 4 2402.1643 -0.0725 Ac-lysine n[43.02]MQSNK[272.20]TFNLEK[272.20]QNHTPR 2.13 IPI00304596 Natural 1.00 3 1917.9971 -0.0214 Ac-lysine n[43.02]MTENSTSAPAAK[272.20]PK[272.20]R 2.01 IPI00550239 Natural 0.98 2 1905.9135 -0.0422 Ac-lysine n[43.02]SDNGELEDK[272.20]PPAPPVR 2.51 IPI00419979 Natural 0.99 2 1731.8477 -0.065 Ac-lysine n[43.02]SDSEK[272.20]LNLDSIIGR 1.81 IPI00027423 Natural 1.00 3 2163.0045 -0.1032 Ac-lysine n[43.02]SGGK[272.20]YVDSEGHLYTVPIR 1.60 IPI00009236 Natural 1.00 3 2105.0964 -0.0906 Ac-lysine n[43.02]SGSSSVAAMK[272.20]K[272.20]VVQQLR 2.29 IPI00027240 Natural 1.00 3 2368.1308 -0.0659 Ac-lysine n[43.02]SK[272.20]K[272.20]ISGGSVVEMQGDEMTR 1.86 IPI00027223 Natural 0.98 2 1134.5827 -0.029 Ac-lysine n[43.02]SK[272.20]NTVSSAR 1.43 IPI00007280 Natural 0.98 3 1843.9029 -0.0854 Ac-lysine n[43.02]SK[272.20]SESPK[272.20]EPEQLR 1.47 IPI00215965 Natural 0.99 2 1439.7107 -0.038 Ac-lysine n[43.02]SK[272.20]SFQQSSLSR 1.58 IPI00017297 Natural 0.99 3 1877.1025 -0.0282 Ac-lysine n[43.02]SK[272.20]SLK[272.20]K[272.20]LVEESR 2.24 IPI00017256 Natural 1.00 2 1678.7666 -0.0621 Ac-lysine n[43.02]SQAEFEK[272.20]AAEEVR 1.55 IPI00010182 Natural 0.99 3 1669.7689 -0.0452 Ac-lysine n[43.02]SSESK[272.20]EQHNVSPR 2.94 IPI00032107 Natural 1.00 2 1633.8133 -0.0374 Ac-lysine n[43.02]SSK[272.20]TASTNNIAQAR 1.86 IPI00221232 Natural 1.00 3 1786.8867 -0.0914 Ac-lysine n[43.02]TENSTSAPAAK[272.20]PK[272.20]R 1.92 IPI00550239   212 Appendix B.11 Peptides identified by iTRAQ-TAILS in membrane fractions of HMEC1. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 116) or sMT6EΔA (iTRAQ 117) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI # Natural 1.00 2 1451.7554 -0.0413 iTRAQ n[145.11]AAAGAAATHLEVAR 1.28 IPI00465308 Natural 0.98 2 1200.5667 -0.019 iTRAQ n[145.11]AANYSSTSTR 1.65 IPI00301280 Neo 1.00 3 1757.9215 -0.0412 iTRAQ n[145.11]AAQTSPSPK[272.20]AGAATGR 1.26 IPI00303476 Neo 0.77 2 1431.7072 -0.0185 iTRAQ n[145.11]AASPC[160.03]SVVNDLR 1.86 IPI00549189 Neo 0.99 2 1254.7116 -0.0301 iTRAQ n[145.11]AATLILEPAGR 1.22 IPI00220906 Natural 0.98 3 1743.9514 -0.0069 iTRAQ n[145.11]AAVAATAAAK[272.20]GNGGGGGR 2.17 IPI00384497 Neo 1.00 3 1666.8534 -0.0343 iTRAQ n[145.11]ADAINTEFK[272.20]NTR 1.61 IPI00418471 Neo 1.00 3 1774.9127 -0.029 iTRAQ n[145.11]ADANLEAGNVK[272.20]ETR 2.06 IPI00328113 Neo 0.99 2 1199.5159 -0.0208 iTRAQ n[145.11]AEFSSEAC[160.03]R 1.37 IPI00030877 Neo 0.99 2 1319.5489 -0.0218 iTRAQ n[145.11]AEGPDEDSSNR 1.26 IPI00009904 Neo 1.00 2 1119.5127 -0.03 iTRAQ n[145.11]AGFAGDDAPR 1.72 IPI00008603 Neo 1.00 3 2468.2118 -0.0749 iTRAQ n[145.11]AGGAAQLALDK[272.20]SDSHPSDALTR 1.62 IPI00028031 Natural 1.00 3 1692.8532 -0.0495 iTRAQ n[145.11]AGGEAGVTLGQPHLSR 1.83 IPI00297982 Neo 0.94 2 1135.6082 -0.0135 iTRAQ n[145.11]AGGGVHIEPR 1.37 IPI00004872 Neo 0.99 2 1013.5835 -0.0272 iTRAQ n[145.11]AGLAAAALGR 1.19 IPI00514494 Neo 1.00 2 1431.7123 -0.0324 iTRAQ n[145.11]AGMAMAGQSPVLR 2.08 IPI00179964 Natural 1.00 3 2126.0901 -0.0386 iTRAQ n[145.11]AGPPPIQDGEFTFLLPAGR 1.18 IPI00009976 Neo 0.95 2 1165.5724 -0.0273 iTRAQ n[145.11]AHEFTVYR 1.41 IPI00470649 Natural 1.00 4 2468.1491 -0.0758 iTRAQ n[145.11]AHESVVK[272.20]SEDFSLPAYMDR 2.50 IPI00006579 Natural 1.00 3 2441.2481 -0.0646 iTRAQ n[145.11]AIAAK[272.20]EK[272.20]DIQEESTFSSR 2.08 IPI00783271 Neo 0.98 3 1480.7571 -0.067 iTRAQ n[145.11]AINTEFK[272.20]NTR 1.30 IPI00418471 Neo 0.67 3 1289.767 -0.024 iTRAQ n[145.11]AK[272.20]VSSLIER 1.47 IPI00031479 Neo 0.92 3 1504.811 -0.0343 iTRAQ n[145.11]ALK[272.20]GTNESLER 1.27 IPI00418471 Natural 1.00 3 1211.6401 -0.0136 iTRAQ n[145.11]ALPFGSSPHR 1.59 IPI00329054 Natural 0.77 3 1519.7585 -0.0172 iTRAQ n[145.11]ALSAETESHIYR 2.14 IPI00013026 Neo 0.98 2 1161.5662 -0.0235 iTRAQ n[145.11]ALYHTEER 1.27 IPI00301109 Natural 1.00 3 1997.0869 -0.0644 iTRAQ n[145.11]APAEILNGK[272.20]EISAQIR 2.02 IPI00218342 Natural 0.96 2 1214.588 -0.0137 iTRAQ n[145.11]APDQDEIQR 1.36 IPI00021794 Natural 0.85 3 1293.7628 -0.0384 iTRAQ n[145.11]APEVLPK[272.20]PR 1.29 IPI00015972 Natural 1.00 3 2493.2855 -0.0982 iTRAQ n[145.11]APGQLALFSVSDK[272.20]TGLVEFAR 1.90 IPI00289499 Neo 1.00 4 1850.9742 -0.0495 iTRAQ n[145.11]APHNPAPPTSTVIHIR 2.09 IPI00303726 Neo 0.67 3 1267.7365 -0.0239 iTRAQ n[145.11]APLNPK[272.20]ANR 0.99 IPI00008603 Natural 1.00 3 1969.0164 -0.0712 iTRAQ n[145.11]APSVPAAEPEYPK[272.20]GIR 1.48 IPI00172460 Neo 0.76 2 1703.7598 -0.1499 iTRAQ n[145.11]AQAK[272.20]QWGWTQGR 1.14 IPI00394699 Natural 1.00 2 1100.5873 -0.0184 iTRAQ n[145.11]AQTAAATAPR 1.73 IPI00294911  213 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI # Neo 0.99 3 1865.0871 -0.0266 iTRAQ n[145.11]ASASSK[272.20]ELLMK[272.20]LR 1.50 IPI00021016 Neo 1.00 3 2772.4765 -0.0942 iTRAQ n[145.11]ASASSTNLK[272.20]DILADLIPK[272.20]EQAR 2.17 IPI00025366 Natural 1.00 3 1855.9327 -0.071 iTRAQ n[145.11]ASGANFEYIIAEK[272.20]R 1.76 IPI00024993 Natural 1.00 2 1916.8714 -0.0483 iTRAQ n[145.11]ASGGGVPTDEEQATGLER 1.46 IPI00021785 Neo 0.98 2 1208.5982 -0.0285 iTRAQ n[145.11]ASSPGGVYATR 1.19 IPI00418471 Neo 1.00 2 1339.6198 -0.0289 iTRAQ n[145.11]ASSYSASAEPAR 2.00 IPI00306159 Natural 0.92 2 1113.5652 -0.0185 iTRAQ n[145.11]ATLNQMHR 1.71 IPI00005692 Neo 0.91 2 871.5206 -0.0151 iTRAQ n[145.11]AVAAVAAR 1.85 IPI00011454 Neo 0.94 2 1218.6514 -0.0333 iTRAQ n[145.11]AVPSPPPASPR 1.42 IPI00001663 Neo 0.96 2 1081.6086 -0.0281 iTRAQ n[145.11]AVTVAPPGAR 1.59 IPI00479217 Neo 1.00 3 1595.83 -0.0207 iTRAQ n[145.11]DAINTEFK[272.20]NTR 1.52 IPI00418471 Natural 1.00 3 1664.8005 -0.0482 iTRAQ n[145.11]DAPEEEDHVLVLR 1.41 IPI00010796 Natural 1.00 3 2265.0207 -0.0645 iTRAQ n[145.11]DDEVDVDGTVEEDLGK[272.20]SR 1.72 IPI00027230 Neo 1.00 4 2885.3433 -0.1971 iTRAQ n[145.11]DDLEALK[272.20]K[272.20]K[272.20]GC[160.03]PPDDIENPR 2.38 IPI00217561 Neo 0.93 3 2536.1992 -0.1275 iTRAQ n[145.11]DDLVTVK[272.20]TPAFAESVTEGDVR 1.70 IPI00384016 Natural 1.00 3 1503.7384 -0.0533 iTRAQ n[145.11]DGVGGDPAVALPHR 2.18 IPI00026530 Neo 0.91 3 2445.1659 -0.1718 iTRAQ n[145.11]DK[272.20]EK[272.20]NLLHVTDTGVGMTR 1.34 IPI00027230 Neo 1.00 3 1589.7966 -0.0291 iTRAQ n[145.11]DNADSSPVVDK[272.20]R 1.31 IPI00328753 Neo 1.00 3 1612.9356 -0.0148 iTRAQ n[145.11]DNIQGITK[272.20]PAIR 1.71 IPI00453473 Neo 1.00 3 2554.9764 -0.0703 iTRAQ n[145.11]DVK[272.20]C[160.03]DMEVSC[160.03]PDGYTC[160.03]C[160.03]R 1.92 IPI00181753 Neo 0.99 2 1330.6684 -0.0163 iTRAQ n[145.11]EAGLETESPVR 1.44 IPI00009885 Neo 0.99 2 1263.6006 -0.0171 iTRAQ n[145.11]EAGSTAGAAETR 1.76 IPI00220002 Neo 0.95 3 1396.7888 -0.0139 iTRAQ n[145.11]EAPLNPK[272.20]ANR 1.67 IPI00008603 Natural 0.98 2 1398.6561 -0.0296 iTRAQ n[145.11]EEQPPETAAQR 1.38 IPI00386755 Natural 0.98 3 1787.9424 -0.0793 iTRAQ n[145.11]ENSTSAPAAK[272.20]PK[272.20]R 1.45 IPI00550239 Natural 0.95 3 2532.1453 -0.1074 iTRAQ n[145.11]EPAVYFK[272.20]EQFLDGDGWTSR 1.47 IPI00020599 Neo 0.88 2 1316.5959 -0.0308 iTRAQ n[145.11]EQAPGTAPC[160.03]SR 1.90 IPI00010277 Natural 0.91 3 1402.7061 -0.0226 iTRAQ n[145.11]ESAGADTRPTVR 2.17 IPI00025796 Natural 0.66 4 1655.8441 -0.0384 iTRAQ n[145.11]ESAGADTRPTVRPR 1.33 IPI00025796 Natural 1.00 2 1507.7234 -0.0613 iTRAQ n[145.11]ESETTTSLVLER 1.44 IPI00029744 Neo 1.00 3 1779.8166 -0.053 iTRAQ n[145.11]ETVHC[160.03]DLQPVGPER 1.71 IPI00017567 Neo 0.74 3 1240.6123 -0.0199 iTRAQ n[145.11]EVAPPEYHR 1.82 IPI00409675 Neo 1.00 3 1327.65 -0.0357 iTRAQ n[145.11]EVHVSTVEER 1.19 IPI00217683 Neo 0.94 2 991.4623 -0.0224 iTRAQ n[145.11]FAGDDAPR 1.71 IPI00008603 Natural 0.99 3 2216.2282 -0.0755 iTRAQ n[145.11]FAK[272.20]LVRPPVQVYGIEGR 1.84 IPI00007611 Neo 1.00 2 1396.6022 -0.0315 iTRAQ n[145.11]FGSDQSENVDR 1.42 IPI00258804 Neo 0.82 3 1531.7951 -0.0276 iTRAQ n[145.11]GAAGRPLELSDFR 0.87 IPI00030131 Natural 1.00 2 1127.6005 -0.0312 iTRAQ n[145.11]GAGGALFVHR 1.55 IPI00291328 Neo 1.00 2 1238.6521 -0.0586 iTRAQ n[145.11]GAPEVLVSAPR 1.42 IPI00143921 Natural 0.76 3 1713.8456 -0.0991 iTRAQ n[145.11]GAYK[272.20]YIQELWR 2.00 IPI00470528 Neo 1.00 3 2842.0576 -0.1736 iTRAQ n[145.11]GESGHLAK[272.20]DC[160.03]DLQEDAC[160.03]YNC[160.03]GR 1.41 IPI00430813 Neo 0.99 3 2569.0621 -0.1636 iTRAQ n[145.11]GETGHVAINC[160.03]SK[272.20]TSEVNC[160.03]YR 1.78 IPI00430812 Natural 0.94 2 968.4992 -0.0165 iTRAQ n[145.11]GGVGEPGPR 1.50 IPI00028040 Natural 0.89 3 1551.7224 -0.0593 iTRAQ n[145.11]GHQQLYWSHPR 1.42 IPI00182289  214 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI # Neo 0.96 4 1785.9192 -0.0425 iTRAQ n[145.11]GK[272.20]AEELHYPLGER 1.54 IPI00029628 Natural 1.00 3 1671.8703 -0.0485 iTRAQ n[145.11]GK[272.20]DYYQTLGLAR 1.50 IPI00015947 Natural 0.99 3 1517.7494 -0.0296 iTRAQ n[145.11]GK[272.20]GGNQGEGAAER 1.75 IPI00183786 Natural 0.88 3 1648.9929 -0.0178 iTRAQ n[145.11]GK[272.20]VK[272.20]VGVNGFGR 1.82 IPI00219018 Natural 0.91 2 986.5129 -0.0138 iTRAQ n[145.11]GLADASGPR 1.66 IPI00107312 Neo 0.97 2 1168.5447 -0.015 iTRAQ n[145.11]GPDEDLSHR 1.54 IPI00307572 Neo 1.00 3 1316.5604 -0.0263 iTRAQ n[145.11]GPGHGYDGEER 1.99 IPI00290452 Neo 0.99 2 1061.5145 -0.0262 iTRAQ n[145.11]GPNIC[160.03]TTR 1.67 IPI00220350 Neo 0.70 3 1428.7585 -0.0384 iTRAQ n[145.11]GQTFEYLK[272.20]R 1.53 IPI00218337 Neo 0.99 2 1229.653 -0.0317 iTRAQ n[145.11]GQVITIGNER 1.87 IPI00003269 Natural 0.94 2 1332.6047 -0.065 iTRAQ n[145.11]GSTWGSPGWVR 2.41 IPI00031000 Neo 0.66 3 1750.9608 -0.027 iTRAQ n[145.11]GVK[272.20]K[272.20]FDVPC[160.03]GGR 2.20 IPI00306322 Neo 0.87 2 943.5036 -0.0171 iTRAQ n[145.11]GVPVEGSR 2.03 IPI00031801 Neo 1.00 2 1457.7455 -0.0142 iTRAQ n[145.11]GVQVETISPGDGR 1.16 IPI00413778 Neo 0.82 2 1212.4952 -0.0335 iTRAQ n[145.11]GWAC[160.03]C[160.03]PYR 1.27 IPI00181753 Neo 1.00 2 1275.5715 -0.0502 iTRAQ n[145.11]GYSFTTTAER 1.56 IPI00021439 Neo 0.85 3 1920.8065 -0.1621 iTRAQ n[145.11]HEGGQSYK[272.20]IGDTWR 3.65 IPI00022418 Natural 0.81 3 1326.6902 -0.0628 iTRAQ n[145.11]ISFHLPINSR 1.63 IPI00028055 Neo 0.97 3 1658.8092 -0.0347 iTRAQ n[145.11]IWHHTFYNELR 1.78 IPI00021428 Neo 1.00 10 1391.721 -0.0187 iTRAQ n[145.11]K[272.20]AGFAGDDAPR 1.84 IPI00008603 Neo 1.00 3 1597.764 -0.0268 iTRAQ n[145.11]K[272.20]C[160.03]NTATC[160.03]ATQR 0.34 IPI00023679 Neo 0.92 3 1236.7034 -0.0403 iTRAQ n[145.11]K[272.20]PVSLSYR 2.43 IPI00413781 Neo 0.92 2 1157.5871 -0.0296 iTRAQ n[145.11]LDADPSLQR 1.28 IPI00306959 Neo 1.00 2 1373.7077 -0.02 iTRAQ n[145.11]LGSDAELQIER 1.20 IPI00182126 Neo 1.00 3 1334.7602 -0.0555 iTRAQ n[145.11]LHLGVTPSVIR 1.63 IPI00298237 Neo 0.76 2 1246.7641 -0.0216 iTRAQ n[145.11]LIK[272.20]TVETR 1.77 IPI00418471 Neo 0.74 3 2137.1563 -0.1685 iTRAQ n[145.11]LISTLILVILSYTYIIR 1.36 IPI00399342 Neo 1.00 3 2049.0276 -0.0611 iTRAQ n[145.11]LLSSAYVDSHK[272.20]WEAR 2.22 IPI00022002 Natural 0.91 2 1019.5365 -0.0152 iTRAQ n[145.11]LPASFDAR 1.38 IPI00295741 Neo 0.69 3 1866.8526 -0.1856 iTRAQ n[145.11]LPTPK[272.20]C[160.03]HTPPLYR 1.54 IPI00026202 Natural 1.00 3 1937.8745 -0.0832 iTRAQ n[145.11]LRPGDC[160.03]EVC[160.03]ISYLGR 1.08 IPI00328748 Natural 0.92 2 1945.9295 -0.0262 iTRAQ n[145.11]LWPWPQNFQTSDQR 1.41 IPI00027851 Neo 1.00 2 2199.997 -0.0797 iTRAQ n[145.11]LYSSSDDVIELTPSNFNR 2.14 IPI00299571 Natural 1.00 3 1424.816 -0.0257 iTRAQ n[145.11]MAPEVLPK[272.20]PR 1.73 IPI00015972 Neo 0.94 4 2649.3547 -0.1423 iTRAQ n[145.11]MDK[272.20]SELVQK[272.20]AK[272.20]LAEQAER 2.15 IPI00216318 Natural 1.00 2 1819.8278 -0.0409 iTRAQ n[145.11]MFLQYYLNEQGDR 0.82 IPI00032853 Natural 0.97 2 1441.7582 -0.0295 iTRAQ n[145.11]MFLYNLTLQR 1.65 IPI00179138 Natural 0.93 2 1278.5866 -0.0321 iTRAQ n[145.11]MIEVVC[160.03]NDR 1.40 IPI00013241 Natural 0.90 3 1716.9898 -0.0389 iTRAQ n[145.11]MK[272.20]EEVK[272.20]GIPVR 2.82 IPI00175193 Natural 1.00 3 1628.8211 -0.0376 iTRAQ n[145.11]MK[272.20]FNPFVTSDR 1.75 IPI00007144 Natural 0.99 3 1608.9102 -0.0275 iTRAQ n[145.11]MK[272.20]PILLQGHER 1.51 IPI00012795 Natural 1.00 2 1466.7272 -0.0285 iTRAQ n[145.11]MLSLDFLDDVR 1.26 IPI00104128 Natural 0.69 3 1742.9782 -0.0296 iTRAQ n[145.11]MLTK[272.20]FETK[272.20]SAR 2.27 IPI00295857 Natural 0.99 2 1611.8261 -0.0346 iTRAQ n[145.11]MPPYTVVYFPVR 2.33 IPI00219757  215 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI # Neo 1.00 2 1654.8514 -0.0433 iTRAQ n[145.11]MQNPQILAALQER 1.78 IPI00023860 Natural 1.00 3 1639.7881 -0.0503 iTRAQ n[145.11]MQPASAK[272.20]WYDR 2.20 IPI00015029 Natural 0.95 3 1404.6852 -0.0305 iTRAQ n[145.11]MRPLTEEETR 1.12 IPI00007175 Natural 0.97 4 2129.1592 -0.0543 iTRAQ n[145.11]MRPQQAPVSGK[272.20]VFIQR 2.59 IPI00480022 Natural 0.88 3 1630.8858 -0.0329 iTRAQ n[145.11]MTK[272.20]GTSSFGK[272.20]R 2.09 IPI00220871 Neo 1.00 3 1921.0945 -0.0842 iTRAQ n[145.11]MVPPVQVSPLIK[272.20]LGR 2.01 IPI00218848 Natural 0.99 2 1372.73 -0.0357 iTRAQ n[145.11]MWTPELAILR 1.63 IPI00183938 Natural 0.98 2 1182.5946 -0.0241 iTRAQ n[145.11]MYLQVETR 1.46 IPI00001578 Neo 0.99 3 1497.8898 -0.0337 iTRAQ n[145.11]NIQGITK[272.20]PAIR 1.54 IPI00453473 Neo 1.00 3 1832.9711 -0.0486 iTRAQ n[145.11]NVDVETQSGK[272.20]TVIR 1.89 IPI00021812 Neo 0.96 3 1431.7539 -0.0778 iTRAQ n[145.11]PAPPTSTVIHIR 2.14 IPI00008922 Natural 0.89 3 1304.6843 -0.0271 iTRAQ n[145.11]PAVSK[272.20]GDGMR 1.24 IPI00016621 Natural 0.99 3 1987.9496 -0.0391 iTRAQ n[145.11]PDSWDK[272.20]DVYPEPPR 1.87 IPI00074489 Natural 0.89 2 1177.562 -0.0227 iTRAQ n[145.11]PDYLGADQR 2.20 IPI00021435 Natural 0.92 3 1222.7357 -0.0284 iTRAQ n[145.11]PEVLPK[272.20]PR 1.00 IPI00015972 Natural 0.99 2 1642.8144 -0.0653 iTRAQ n[145.11]PFLELDTNLPANR 2.17 IPI00293867 Natural 0.73 3 1670.9305 -0.0155 iTRAQ n[145.11]PFSNSHNALK[272.20]LR 1.30 IPI00022977 Natural 1.00 3 1813.8548 -0.0469 iTRAQ n[145.11]PGHLQEGFGC[160.03]VVTNR 2.40 IPI00410693 Natural 0.99 2 1513.7386 -0.0221 iTRAQ n[145.11]PGPTPSGTNVGSSGR 1.99 IPI00220835 Natural 1.00 3 2003.0287 -0.0757 iTRAQ n[145.11]PGVTVK[272.20]DVNQQEFVR 2.19 IPI00215780 Natural 1.00 2 1430.6875 -0.0952 iTRAQ n[145.11]PMFIVNTNVPR 1.88 IPI00293276 Natural 0.99 2 1480.7627 -0.057 iTRAQ n[145.11]PPYTVVYFPVR 1.77 IPI00219757 Natural 1.00 2 1613.6974 -0.0623 iTRAQ n[145.11]PQYQTWEEFSR 1.88 IPI00216125 Natural 1.00 3 1786.9826 -0.0471 iTRAQ n[145.11]PSK[272.20]GPLQSVQVFGR 2.10 IPI00221092 Natural 0.98 2 1149.5803 -0.0344 iTRAQ n[145.11]PTVEELYR 2.07 IPI00006684 Natural 0.96 2 1068.5731 -0.0316 iTRAQ n[145.11]PVAGSELPR 1.98 IPI00103732 Natural 1.00 3 1695.9429 -0.0488 iTRAQ n[145.11]PVPPLPEYGGK[272.20]VR 2.30 IPI00029133 Neo 1.00 3 2659.1842 -0.1734 iTRAQ n[145.11]QK[272.20]AMTAK[272.20]GGDISVC[160.03]EWYQR 1.04 IPI00216085 Natural 1.00 3 1982.9787 -0.04 iTRAQ n[145.11]QK[272.20]TGTAEMSSILEER 1.70 IPI00440493 Neo 0.77 4 3053.2222 -0.1562 iTRAQ n[145.11]RDDSFFGETSHNYHK[272.20]FDSEYER 1.38 IPI00017297 Neo 1.00 3 1233.6139 -0.0085 iTRAQ n[145.11]SAHAGTYEVR 2.54 IPI00019385 Natural 1.00 2 1349.5378 -0.0259 iTRAQ n[145.11]SAPGEDEEC[160.03]GR 1.58 IPI00217882 Neo 0.97 2 1257.594 -0.0317 iTRAQ n[145.11]SAPLAAGC[160.03]PDR 1.13 IPI00003176 Natural 0.97 2 1147.6463 -0.0224 iTRAQ n[145.11]SASVVSVISR 1.71 IPI00009407 Natural 1.00 2 1714.7934 -0.0743 iTRAQ n[145.11]SDMPPLTLEGIQDR 1.69 IPI00022442 Natural 1.00 2 1782.7935 -0.0462 iTRAQ n[145.11]SDVLELTDDNFESR 1.51 IPI00025252 Neo 1.00 3 1675.8932 -0.0416 iTRAQ n[145.11]SEVELAAALSDK[272.20]R 1.24 IPI00009771 Neo 1.00 2 1327.5715 -0.0172 iTRAQ n[145.11]SGQGAFGNMC[160.03]R 2.00 IPI00003918 Neo 1.00 3 1962.8901 -0.0504 iTRAQ n[145.11]SGTLGHPGSLDETTYER 1.84 IPI00217745 Neo 1.00 3 1704.93 -0.0467 iTRAQ n[145.11]SGYLAGDK[272.20]LLPQR 1.45 IPI00219365 Natural 1.00 3 1750.6974 -0.0543 iTRAQ n[145.11]SHGSQETDEEFDAR 1.56 IPI00025086 Neo 0.99 4 1980.9733 -0.0416 iTRAQ n[145.11]SHTDIK[272.20]VPDFSEYR 1.34 IPI00026964 Neo 1.00 3 1875.9628 -0.0296 iTRAQ n[145.11]SIAAHLDNQVPVESPR 1.46 IPI00018120 Neo 0.79 3 1578.7728 -0.0269 iTRAQ n[145.11]SK[272.20]DGGAWGTEQR 1.84 IPI00219219  216 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI # Neo 0.94 3 1387.8268 -0.0487 iTRAQ n[145.11]SK[272.20]LVVITQGR 1.76 IPI00413916 Neo 0.72 3 1261.6007 -0.0166 iTRAQ n[145.11]SLESQHDFR 1.65 IPI00151710 Neo 1.00 3 1939.895 -0.0527 iTRAQ n[145.11]SMPPAQQQITSGQMHR 1.94 IPI00298994 Neo 0.98 2 1486.8185 -0.0442 iTRAQ n[145.11]SNIPFITVPLSR 1.63 IPI00008982 Neo 1.00 3 1522.7837 -0.0388 iTRAQ n[145.11]SPALTIENEHIR 1.46 IPI00012989 Natural 0.99 2 1554.8 -0.0527 iTRAQ n[145.11]SPTPPLFSLPEAR 1.38 IPI00305374 Natural 0.95 3 1260.6825 -0.0276 iTRAQ n[145.11]SPVLHFYVR 2.11 IPI00004534 Natural 0.92 2 1219.567 -0.0247 iTRAQ n[145.11]SQDASDGLQR 1.81 IPI00009276 Neo 1.00 3 1467.7621 -0.0296 iTRAQ n[145.11]SQLLGSAHEVQR 1.43 IPI00744706 Natural 0.99 3 1841.9615 -0.0472 iTRAQ n[145.11]SSEAPPLINEDVK[272.20]R 1.99 IPI00025874 Natural 1.00 3 2177.1591 -0.0856 iTRAQ n[145.11]SSLGVVTC[160.03]GSVVK[272.20]LLNTR 1.39 IPI00293167 Natural 0.98 4 2310.2565 -0.053 iTRAQ n[145.11]SSVLASC[160.03]PK[272.20]K[272.20]PVSSYLR 1.84 IPI00020928 Neo 0.95 2 1165.5198 -0.0139 iTRAQ n[145.11]SSVMC[160.03]PDAR 1.38 IPI00182138 Neo 0.98 2 1146.5764 -0.0353 iTRAQ n[145.11]STAAQQELR 1.56 IPI00019502 Neo 1.00 3 1901.8274 -0.0433 iTRAQ n[145.11]STAYEDYYYHPPPR 2.50 IPI00012074 Natural 1.00 3 1469.7212 -0.0384 iTRAQ n[145.11]SVTVHSSEPEVR 1.99 IPI00001754 Neo 0.91 3 1497.8182 -0.0325 iTRAQ n[145.11]TEAPLNPK[272.20]ANR 2.05 IPI00008603 Natural 0.97 3 1466.7699 -0.0278 iTRAQ n[145.11]TGYTPDEK[272.20]LR 2.45 IPI00219385 Neo 0.86 3 2004.1287 -0.0294 iTRAQ n[145.11]TLPTK[272.20]ETIEQEK[272.20]R 2.65 IPI00220827 Neo 0.95 2 1260.5637 -0.025 iTRAQ n[145.11]TPAPETC[160.03]EGR 1.21 IPI00030241 Neo 0.98 2 1314.6904 -0.0113 iTRAQ n[145.11]TSTAPAASPNVR 1.38 IPI00299402 Neo 1.00 2 1796.7846 -0.0601 iTRAQ n[145.11]TTFNIQDGPDFQDR 2.06 IPI00017799 Natural 0.90 3 2236.1498 -0.1169 iTRAQ n[145.11]TTIAGVVYK[272.20]DGIVLGADTR 1.71 IPI00003217 Neo 0.98 3 2038.2353 -0.0274 iTRAQ n[145.11]VAAPK[272.20]VK[272.20]GGVDVTLPR 2.48 IPI00021812 Neo 1.00 3 1671.9087 -0.068 iTRAQ n[145.11]VDVSK[272.20]PDLTAALR 1.91 IPI00418471 Natural 1.00 2 1483.7179 -0.0618 iTRAQ n[145.11]VDYYEVLGVQR 1.73 IPI00024523 Natural 1.00 3 2405.3059 -0.0458 iTRAQ n[145.11]VK[272.20]LTAELIEQAAQYTNAVR 4.20 IPI00183920 Neo 1.00 3 1432.745 -0.0367 iTRAQ n[145.11]VK[272.20]MAAAGGGGGGGR 1.34 IPI00027834 Natural 0.83 2 1133.6264 -0.0303 iTRAQ n[145.11]VLDLDLFR 3.30 IPI00220637 Natural 1.00 2 1205.6385 -0.0172 iTRAQ n[145.11]VMAEGTAVLR 1.64 IPI00386122 Natural 0.88 3 1612.9069 -0.0508 iTRAQ n[145.11]VMEK[272.20]PSPLLVGR 1.45 IPI00009057 Natural 0.97 2 949.436 -0.0049 iTRAQ n[145.11]VNDGDMR 1.57 IPI00023673 Natural 0.99 2 1234.6465 -0.0322 iTRAQ n[145.11]VNFTVDQIR 2.02 IPI00186290 Natural 0.88 2 1097.6545 -0.0502 iTRAQ n[145.11]VNLLQIVR 2.10 IPI00025725 Neo 0.98 3 1654.7528 -0.0365 iTRAQ n[145.11]VSGASNHQPNSNSGR 0.81 IPI00017283 Natural 0.98 3 2158.2655 -0.0762 iTRAQ n[145.11]VSK[272.20]PTLK[272.20]EVVIVSATR 1.72 IPI00030363 Neo 1.00 3 2140.8295 -0.2062 iTRAQ n[145.11]WK[272.20]FEHC[160.03]NFNDVTTR 1.38 IPI00011302 Neo 0.99 2 1672.9133 -0.0294 iTRAQ n[145.11]WSNIPFITVPLSR 1.59 IPI00008982 Neo 0.98 4 2231.8266 -0.1454 iTRAQ n[145.11]YEC[160.03]GEK[272.20]GHYAYDC[160.03]HR 1.17 IPI00003377 Neo 0.88 3 1623.8913 -0.0164 iTRAQ n[145.11]YEVEILDAK[272.20]TR 1.97 IPI00100656 Neo 1.00 3 1913.7812 -0.0335 iTRAQ n[145.11]YSHGSQETDEEFDAR 2.21 IPI00025086 Neo 0.89 3 1537.7832 -0.0502 iTRAQ n[145.11]YSLGSALRPSTSR 1.16 IPI00418471 Natural 0.96 3 1357.8349 -0.03 Ac-lysine n[43.02]AAAK[272.20]VALTK[272.20]R 1.49 IPI00007084 Natural 0.78 2 1230.6062 -0.0415 Ac-lysine n[43.02]AAPSDGFK[272.20]PR 1.12 IPI00025347  217 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI # Natural 0.97 2 1584.7545 -0.0792 Ac-lysine n[43.02]AATASAGAGGIDGK[272.20]PR 1.63 IPI00219729 Natural 0.93 2 1328.6532 -0.1005 Ac-lysine n[43.02]AATTGSGVK[272.20]VPR 1.49 IPI00472498 Natural 1.00 3 1797.0347 -0.0369 Ac-lysine n[43.02]AAVK[272.20]TLNPK[272.20]AEVAR 1.68 IPI00027626 Natural 1.00 10 2157.0034 -0.1122 Ac-lysine n[43.02]AC[160.03]GLVASNLNLK[272.20]PGEC[160.03]LR 1.24 IPI00219219 Natural 0.99 3 1822.7568 -0.0159 Ac-lysine n[43.02]ADEGK[272.20]SYSEHDDER 1.74 IPI00033153 Natural 1.00 2 1750.7767 -0.036 Ac-lysine n[43.02]ADK[272.20]EAAFDDAVEER 1.25 IPI00328319 Natural 0.99 3 2207.0452 -0.1085 Ac-lysine n[43.02]ADK[272.20]MDMSLDDIIK[272.20]LNR 1.81 IPI00328840 Natural 0.99 2 1798.9673 -0.0234 Ac-lysine n[43.02]ADLDK[272.20]LNIDSIIQR 1.46 IPI00005705 Natural 0.99 2 1571.8122 -0.0305 Ac-lysine n[43.02]ADPK[272.20]YADLPGIAR 1.39 IPI00220503 Natural 1.00 2 1648.8539 -0.0368 Ac-lysine n[43.02]ADSVK[272.20]TFLQDLAR 1.63 IPI00023185 Natural 0.98 3 1786.9527 -0.0254 Ac-lysine n[43.02]ADVVVGK[272.20]DK[272.20]GGEQR 2.28 IPI00010158 Natural 1.00 2 1661.7797 -0.022 Ac-lysine n[43.02]AEFTSYK[272.20]ETASSR 1.89 IPI00296830 Neo 0.92 3 1570.6482 -0.0297 Ac-lysine n[43.02]AEK[272.20]FDC[160.03]HYC[160.03]R 1.61 IPI00014398 Natural 0.98 2 1253.6022 -0.0355 Ac-lysine n[43.02]AESSDK[272.20]LYR 1.04 IPI00449049 Natural 0.91 2 1259.6552 -0.0295 Ac-lysine n[43.02]AEVEETLK[272.20]R 2.00 IPI00063849 Natural 0.98 4 2324.1549 -0.1183 Ac-lysine n[43.02]AFK[272.20]DTGK[272.20]TPVEPEVAIHR 1.69 IPI00012493 Natural 1.00 3 2114.0723 -0.1034 Ac-lysine n[43.02]AFLASGPYLTHQQK[272.20]VLR 1.91 IPI00255052 Natural 0.98 2 1343.6399 -0.1498 Ac-lysine n[43.02]AGITTIEAVK[272.20]R 1.49 IPI00218319 Natural 1.00 3 2073.0808 -0.0766 Ac-lysine n[43.02]AGK[272.20]QAVSASGK[272.20]WLDGIR 1.86 IPI00220416 Natural 1.00 2 1342.641 -0.1277 Ac-lysine n[43.02]AGLNSLEAVK[272.20]R 1.57 IPI00010779 Natural 0.93 3 1578.7674 -0.0537 Ac-lysine n[43.02]AK[272.20]HHPDLIFC[160.03]R 1.25 IPI00005511 Natural 0.87 2 1403.7009 -0.0368 Ac-lysine n[43.02]AK[272.20]ISSPTETER 1.33 IPI00013895 Natural 1.00 3 1418.7843 -0.0394 Ac-lysine n[43.02]AK[272.20]PAQGAK[272.20]YR 2.06 IPI00002459 Natural 0.98 3 1514.8366 -0.0294 Ac-lysine n[43.02]AK[272.20]PLTDQEK[272.20]R 1.93 IPI00783313 Natural 0.98 3 1473.7912 -0.0482 Ac-lysine n[43.02]AK[272.20]PLTDSEK[272.20]R 1.83 IPI00004358 Natural 1.00 3 2855.3277 -0.124 Ac-lysine n[43.02]AMATK[272.20]GGTVK[272.20]AASGFNAMEDAQTLR 2.10 IPI00793199 Natural 1.00 3 1831.8842 -0.0645 Ac-lysine n[43.02]AMHNK[272.20]AAPPQIPDTR 1.40 IPI00009373 Natural 0.91 2 1352.642 -0.0207 Ac-lysine n[43.02]ANK[272.20]GPSYGMSR 1.51 IPI00216138 Natural 0.98 2 1185.635 -0.0237 Ac-lysine n[43.02]ANNDAVLK[272.20]R 1.43 IPI00006252 Natural 0.99 3 1699.9229 -0.0348 Ac-lysine n[43.02]AQAK[272.20]INAK[272.20]ANEGR 1.48 IPI00000643 Natural 0.97 2 1587.7153 -0.0284 Ac-lysine n[43.02]AQDQGEK[272.20]ENPMR 1.84 IPI00376798 Natural 0.94 2 1270.6556 -0.0561 Ac-lysine n[43.02]AQNLK[272.20]DLAGR 1.48 IPI00027252 Natural 1.00 2 1393.6798 -0.0269 Ac-lysine n[43.02]AQYK[272.20]GAASEAGR 1.31 IPI00030098 Natural 1.00 3 2437.2088 -0.1155 Ac-lysine n[43.02]ASGVAVSDGVIK[272.20]VFNDMK[272.20]VR 1.83 IPI00012011 Natural 1.00 2 1755.7678 -0.0429 Ac-lysine n[43.02]ASK[272.20]EMFEDTVEER 1.78 IPI00395865 Natural 0.99 3 1831.9967 -0.028 Ac-lysine n[43.02]ASSDIQVK[272.20]ELEK[272.20]R 1.92 IPI00479997 Neo 1.00 3 2653.2767 -0.097 Ac-lysine n[43.02]ATK[272.20]GGTVK[272.20]AASGFNAMEDAQTLR 2.23 IPI00793199 Natural 1.00 2 1571.8623 -0.0384 Ac-lysine n[43.02]ATVTATTK[272.20]VPEIR 1.27 IPI00009104 Natural 0.99 2 1630.8341 -0.0456 Ac-lysine n[43.02]AVPPTYADLGK[272.20]SAR 1.84 IPI00216308 Natural 0.99 2 1499.7051 -0.0686 Ac-lysine n[43.02]AVTLDK[272.20]DAYYR 1.59 IPI00026970 Natural 1.00 4 2047.9958 -0.0715 Ac-lysine n[43.02]AWK[272.20]SGGASHSELIHNLR 1.14 IPI00411680 Natural 0.99 3 2922.2026 -0.1221 Ac-lysine n[43.02]DDDIAALVVDNGSGMC[160.03]K[272.20]AGFAGDDAPR 1.38 IPI00021439 Neo 0.99 3 1510.856 -0.0029 Ac-lysine n[43.02]DNIQGITK[272.20]PAIR 1.44 IPI00453473 Natural 0.98 3 2994.303 -0.0787 Ac-lysine n[43.02]EEEIAALVIDNGSGMC[160.03]K[272.20]AGFAGDDAPR 1.71 IPI00021440  218 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI # Neo 0.81 3 1520.7789 -0.0167 Ac-lysine n[43.02]EIAQDFK[272.20]TDLR 0.87 IPI00171611 Natural 1.00 3 2042.9881 -0.0726 Ac-lysine n[43.02]GDVK[272.20]NFLYAWC[160.03]GK[272.20]R 1.62 IPI00844578 Natural 0.97 4 2574.2508 -0.1656 Ac-lysine n[43.02]MDK[272.20]NELVQK[272.20]AK[272.20]LAEQAER 2.24 IPI00021263 Neo 1.00 3 2547.294 -0.1117 Ac-lysine n[43.02]MDK[272.20]SELVQK[272.20]AK[272.20]LAEQAER 2.18 IPI00216318 Natural 1.00 3 2221.0058 -0.0419 Ac-lysine n[43.02]MDNSGK[272.20]EAEAMALLAEAER 2.32 IPI00009253 Natural 0.95 2 1563.767 -0.0417 Ac-lysine n[43.02]MDPFTEK[272.20]LLER 1.13 IPI00032958 Natural 0.82 3 2314.9547 -0.1 Ac-lysine n[43.02]MDWVMK[272.20]HNGPNDASDGTVR 0.97 IPI00013877 Natural 0.99 3 1917.9259 -0.045 Ac-lysine n[43.02]MEEEGVK[272.20]EAGEK[272.20]PR 1.69 IPI00332493 Natural 0.96 3 1750.797 -0.046 Ac-lysine n[43.02]MEGHDPK[272.20]EPEQLR 1.56 IPI00455134 Neo 0.96 2 1411.7694 -0.0283 Ac-lysine n[43.02]MEK[272.20]PSPLLVGR 1.78 IPI00009057 Natural 1.00 3 2589.3148 -0.1379 Ac-lysine n[43.02]MEK[272.20]TELIQK[272.20]AK[272.20]LAEQAER 2.13 IPI00018146 Natural 1.00 2 1630.8001 -0.0716 Ac-lysine n[43.02]MEK[272.20]TLETVPLER 1.04 IPI00396378 Natural 0.66 3 2006.1372 -0.0373 Ac-lysine n[43.02]MEMK[272.20]K[272.20]K[272.20]INLELR 2.53 IPI00165393 Natural 1.00 3 2301.9432 -0.1378 Ac-lysine n[43.02]MESGFTSK[272.20]DTYLSHFNPR 2.08 IPI00027681 Natural 0.98 2 1009.5365 -0.0132 Ac-lysine n[43.02]MFAK[272.20]ATR 1.25 IPI00029656 Natural 0.96 2 1411.6603 -0.0434 Ac-lysine n[43.02]MFSWVSK[272.20]DAR 1.78 IPI00017184 Natural 0.82 3 1443.7443 -0.0305 Ac-lysine n[43.02]MK[272.20]K[272.20]SYSGGTR 1.38 IPI00784614 Natural 0.95 4 2052.0571 -0.0635 Ac-lysine n[43.02]MMGHRPVLVLSQNTK[272.20]R 1.62 IPI00290770 Natural 1.00 3 2087.0705 -0.0442 Ac-lysine n[43.02]MNNQK[272.20]QQK[272.20]PTLSGQR 2.00 IPI00180128 Neo 0.83 3 1986.0333 -0.0954 Ac-lysine n[43.02]MNQEK[272.20]LAK[272.20]LQAQVR 2.10 IPI00221035 Natural 1.00 2 1537.7151 -0.0316 Ac-lysine n[43.02]MQPASAK[272.20]WYDR 1.41 IPI00015029 Natural 1.00 4 2402.1643 -0.0725 Ac-lysine n[43.02]MQSNK[272.20]TFNLEK[272.20]QNHTPR 1.83 IPI00304596 Natural 1.00 3 1917.9971 -0.0214 Ac-lysine n[43.02]MTENSTSAPAAK[272.20]PK[272.20]R 1.61 IPI00550239 Natural 0.97 3 2289.1761 -0.0966 Ac-lysine n[43.02]SDK[272.20]LPYK[272.20]VADIGLAAWGR 1.88 IPI00012007 Natural 0.98 2 1905.9135 -0.0422 Ac-lysine n[43.02]SDNGELEDK[272.20]PPAPPVR 2.51 IPI00419979 Natural 0.99 2 1731.8477 -0.065 Ac-lysine n[43.02]SDSEK[272.20]LNLDSIIGR 1.81 IPI00027423 Natural 1.00 3 2163.0045 -0.1032 Ac-lysine n[43.02]SGGK[272.20]YVDSEGHLYTVPIR 1.64 IPI00009236 Natural 1.00 3 2105.0964 -0.0906 Ac-lysine n[43.02]SGSSSVAAMK[272.20]K[272.20]VVQQLR 2.29 IPI00027240 Natural 0.95 3 1885.8886 -0.0631 Ac-lysine n[43.02]SHPSPQAK[272.20]PSNPSNPR 1.46 IPI00003927 Natural 1.00 3 2368.1308 -0.0659 Ac-lysine n[43.02]SK[272.20]K[272.20]ISGGSVVEMQGDEMTR 1.86 IPI00027223 Natural 0.98 2 1134.5827 -0.029 Ac-lysine n[43.02]SK[272.20]NTVSSAR 1.40 IPI00007280 Natural 0.94 3 1843.9584 -0.0299 Ac-lysine n[43.02]SK[272.20]SESPK[272.20]EPEQLR 1.26 IPI00215965 Natural 0.99 2 1439.7107 -0.038 Ac-lysine n[43.02]SK[272.20]SFQQSSLSR 1.41 IPI00017297 Natural 0.99 3 1877.1025 -0.0282 Ac-lysine n[43.02]SK[272.20]SLK[272.20]K[272.20]LVEESR 2.24 IPI00017256 Natural 1.00 2 1678.7666 -0.0621 Ac-lysine n[43.02]SQAEFEK[272.20]AAEEVR 1.55 IPI00010182 Natural 0.99 3 1669.7689 -0.0452 Ac-lysine n[43.02]SSESK[272.20]EQHNVSPR 2.94 IPI00032107 Natural 1.00 2 1633.8133 -0.0374 Ac-lysine n[43.02]SSK[272.20]TASTNNIAQAR 1.92 IPI00221232 Natural 0.82 3 2499.206 -0.0897 Ac-lysine n[43.02]SSTQFNK[272.20]GPSYGLSAEVK[272.20]NR 2.17 IPI00015262 Natural 0.99 3 1786.9464 -0.0313 Ac-lysine n[43.02]TENSTSAPAAK[272.20]PK[272.20]R 1.47 IPI00550239 Natural 0.94 3 2092.0825 -0.0518 Ac-lysine n[43.02]TVGK[272.20]SSK[272.20]MLQHIDYR 1.10 IPI00027285 Neo 0.76 3 1435.7538 -0.0618 Ac-lysine n[43.02]YQK[272.20]STELLIR 1.16 IPI00171611   219 Appendix B.12 Peptides identified by iTRAQ-TAILS in membrane fractions of HMEC2. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 116) or sMT6EΔA (iTRAQ 117) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI # Natural 0.99 2 1200.5305 -0.0552 iTRAQ n[145.11]AANYSSTSTR 1.93 IPI00301280 Neo 1.00 3 1757.8896 -0.0732 iTRAQ n[145.11]AAQTSPSPK[272.20]AGAATGR 1.65 IPI00303476 Natural 1.00 3 1743.8892 -0.0695 iTRAQ n[145.11]AAVAATAAAK[272.20]GNGGGGGR 2.96 IPI00384497 Neo 0.96 2 1303.5632 -0.0685 iTRAQ n[145.11]ADC[160.03]ISEPVNR 2.04 IPI00017895 Neo 1.00 2 1319.493 -0.0777 iTRAQ n[145.11]AEGPDEDSSNR 1.90 IPI00009904 Neo 1.00 3 2468.1535 -0.1328 iTRAQ n[145.11]AGGAAQLALDK[272.20]SDSHPSDALTR 2.64 IPI00028031 Natural 0.96 2 1214.5244 -0.0773 iTRAQ n[145.11]APDQDEIQR 2.11 IPI00021794 Natural 0.88 3 1293.7654 -0.0363 iTRAQ n[145.11]APEVLPK[272.20]PR 1.34 IPI00015972 Neo 1.00 4 1850.9669 -0.0568 iTRAQ n[145.11]APHNPAPPTSTVIHIR 1.76 IPI00303726 Natural 0.85 3 1968.9726 -0.1151 iTRAQ n[145.11]APSVPAAEPEYPK[272.20]GIR 2.64 IPI00172460 Natural 0.97 2 1100.5485 -0.0572 iTRAQ n[145.11]AQTAAATAPR 1.71 IPI00294911 Natural 1.00 2 1916.7826 -0.1371 iTRAQ n[145.11]ASGGGVPTDEEQATGLER 1.97 IPI00021785 Neo 0.89 2 952.4375 -0.0472 iTRAQ n[145.11]ASQNSFR 2.54 IPI00296053 Neo 0.93 2 1208.5462 -0.0805 iTRAQ n[145.11]ASSPGGVYATR 1.85 IPI00418471 Natural 1.00 3 2264.9178 -0.1669 iTRAQ n[145.11]DDEVDVDGTVEEDLGK[272.20]SR 2.24 IPI00027230 Natural 1.00 3 1671.8137 -0.0647 iTRAQ n[145.11]DITDGNSEHLK[272.20]R 1.76 IPI00009950 Neo 0.98 3 1589.7864 -0.0393 iTRAQ n[145.11]DNADSSPVVDK[272.20]R 1.24 IPI00328753 Neo 1.00 3 2538.9121 -0.1396 iTRAQ n[145.11]DVK[272.20]C[160.03]DMEVSC[160.03]PDGYTC[160.03]C[160.03]R 1.45 IPI00181753 Neo 0.93 2 1330.612 -0.0727 iTRAQ n[145.11]EAGLETESPVR 1.34 IPI00009885 Natural 0.81 2 973.5182 -0.0496 iTRAQ n[145.11]EAVVISGR 2.39 IPI00011307 Natural 0.98 2 1398.6069 -0.0788 iTRAQ n[145.11]EEQPPETAAQR 1.68 IPI00386755 Natural 0.96 3 1402.6743 -0.0544 iTRAQ n[145.11]ESAGADTRPTVR 1.44 IPI00025796 Neo 1.00 2 1396.5538 -0.0799 iTRAQ n[145.11]FGSDQSENVDR 1.11 IPI00258804 Natural 0.99 2 1127.5732 -0.0585 iTRAQ n[145.11]GAGGALFVHR 1.14 IPI00291328 Neo 0.99 3 2568.9577 -0.268 iTRAQ n[145.11]GETGHVAINC[160.03]SK[272.20]TSEVNC[160.03]YR 1.32 IPI00430812 Natural 0.99 3 1551.7261 -0.0556 iTRAQ n[145.11]GHQQLYWSHPR 0.96 IPI00182289 Natural 0.99 3 1648.8947 -0.116 iTRAQ n[145.11]GK[272.20]VK[272.20]VGVNGFGR 1.82 IPI00219018 Neo 0.99 2 1061.4933 -0.0474 iTRAQ n[145.11]GPNIC[160.03]TTR 1.36 IPI00220350 Neo 0.84 3 1428.7547 -0.0422 iTRAQ n[145.11]GQTFEYLK[272.20]R 2.05 IPI00218337 Neo 0.97 2 1249.4881 -0.0776 iTRAQ n[145.11]GSDQSENVDR 1.18 IPI00258804 Natural 0.86 3 1438.6857 -0.0472 iTRAQ n[145.11]GTTAK[272.20]EEMER 2.09 IPI00016968 Neo 0.99 3 1334.7671 -0.0486 iTRAQ n[145.11]LHLGVTPSVIR 1.68 IPI00298237 Neo 0.99 4 1997.037 -0.0568 iTRAQ n[145.11]LTPTHYLTK[272.20]HDVER 1.83 IPI00028635 Neo 0.83 2 1006.4765 -0.0553 iTRAQ n[145.11]LWSSAGSR 2.40 IPI00744711 Natural 0.99 3 1424.7887 -0.053 iTRAQ n[145.11]MAPEVLPK[272.20]PR 1.74 IPI00015972 Natural 0.92 3 1349.7589 -0.0358 iTRAQ n[145.11]MK[272.20]LTDSVLR 3.00 IPI00152695  220 N-termini Prob z Precursor Mass Error [Da] N-term Modification Peptide iTRAQ 116/ iTRAQ 117 IPI # Natural 0.97 3 1639.7668 -0.0716 iTRAQ n[145.11]MQPASAK[272.20]WYDR 1.37 IPI00015029 Natural 0.97 3 1630.8429 -0.0761 iTRAQ n[145.11]MTK[272.20]GTSSFGK[272.20]R 1.53 IPI00220871 Natural 0.98 3 1304.6745 -0.0369 iTRAQ n[145.11]PAVSK[272.20]GDGMR 2.13 IPI00016621 Natural 0.83 3 1222.7342 -0.0299 iTRAQ n[145.11]PEVLPK[272.20]PR 2.02 IPI00015972 Natural 1.00 2 1513.6791 -0.0816 iTRAQ n[145.11]PGPTPSGTNVGSSGR 1.97 IPI00220835 Natural 1.00 3 2003.0072 -0.0972 iTRAQ n[145.11]PGVTVK[272.20]DVNQQEFVR 2.55 IPI00215780 Natural 1.00 2 1349.5069 -0.0568 iTRAQ n[145.11]SAPGEDEEC[160.03]GR 1.78 IPI00217882 Natural 1.00 3 1750.6703 -0.0814 iTRAQ n[145.11]SHGSQETDEEFDAR 2.41 IPI00025086 Neo 0.85 3 1512.7088 -0.0477 iTRAQ n[145.11]SK[272.20]DNEGSWFR 2.27 IPI00304435 Neo 0.88 3 1387.8057 -0.07 iTRAQ n[145.11]SK[272.20]LVVITQGR 1.98 IPI00413916 Natural 0.98 2 1219.5316 -0.0599 iTRAQ n[145.11]SQDASDGLQR 1.49 IPI00009276 Neo 1.00 3 1467.731 -0.0606 iTRAQ n[145.11]SQLLGSAHEVQR 1.24 IPI00744706 Neo 0.91 3 1573.8509 -0.0522 iTRAQ n[145.11]SSSGVIPNEK[272.20]IR 5.00 IPI00154473 Neo 0.87 2 977.4842 -0.0425 iTRAQ n[145.11]SSTSTVPR 2.13 IPI00032875 Neo 0.98 2 1146.5606 -0.0511 iTRAQ n[145.11]STAAQQELR 1.73 IPI00019502 Natural 0.98 4 1889.0118 -0.0578 iTRAQ n[145.11]TENSTSAPAAK[272.20]PK[272.20]R 3.28 IPI00550239 Natural 0.98 3 1466.7537 -0.044 iTRAQ n[145.11]TGYTPDEK[272.20]LR 1.74 IPI00219385 Neo 0.94 3 1432.7138 -0.0679 iTRAQ n[145.11]VK[272.20]MAAAGGGGGGGR 2.16 IPI00027834 Natural 0.91 2 949.4001 -0.0406 iTRAQ n[145.11]VNDGDMR 2.07 IPI00023673 Neo 1.00 3 1477.7691 -0.0406 iTRAQ n[145.11]VSSAAQTEK[272.20]GGR 2.51 IPI00024317 Neo 0.94 3 1439.7134 -0.0483 iTRAQ n[145.11]YVGDEAQSK[272.20]R 1.58 IPI00003269 Natural 0.98 3 1357.8135 -0.0514 Ac-lysine n[43.02]AAAK[272.20]VALTK[272.20]R 1.90 IPI00007084 Natural 1.00 3 2263.0467 -0.1003 Ac-lysine n[43.02]AAAMDVDTPSGTNSGAGK[272.20]K[272.20]R 1.12 IPI00003386 Natural 1.00 2 1584.7349 -0.0993 Ac-lysine n[43.02]AATASAGAGGIDGK[272.20]PR 2.14 IPI00219729 Natural 0.99 3 2137.9548 -0.0899 Ac-lysine n[43.02]AAVK[272.20]DSC[160.03]GK[272.20]GEMATGNGR 1.36 IPI00334159 Natural 0.93 2 1387.6098 -0.0715 Ac-lysine n[43.02]ADNEK[272.20]LDNQR 2.02 IPI00012578 Natural 0.88 2 1459.5914 -0.0933 Ac-lysine n[43.02]ADQGEK[272.20]ENPMR 1.59 IPI00746438 Natural 0.87 3 1475.761 -0.0477 Ac-lysine n[43.02]AHYK[272.20]AADSK[272.20]R 2.13 IPI00554793 Natural 0.97 2 1403.6539 -0.0839 Ac-lysine n[43.02]AK[272.20]ISSPTETER 1.52 IPI00013895 Natural 1.00 3 1418.7366 -0.0871 Ac-lysine n[43.02]AK[272.20]PAQGAK[272.20]YR 1.58 IPI00002459 Natural 0.94 3 1473.7952 -0.0445 Ac-lysine n[43.02]AK[272.20]PLTDSEK[272.20]R 1.70 IPI00004358 Natural 1.00 3 1699.8982 -0.0595 Ac-lysine n[43.02]AQAK[272.20]INAK[272.20]ANEGR 1.72 IPI00000643 Natural 0.99 2 1587.6366 -0.1067 Ac-lysine n[43.02]AQDQGEK[272.20]ENPMR 1.42 IPI00376798 Natural 0.97 4 2402.1155 -0.1213 Ac-lysine n[43.02]MQSNK[272.20]TFNLEK[272.20]QNHTPR 3.80 IPI00304596 Natural 1.00 3 1917.9372 -0.0813 Ac-lysine n[43.02]MTENSTSAPAAK[272.20]PK[272.20]R 2.51 IPI00550239 Natural 0.98 3 2162.989 -0.1187 Ac-lysine n[43.02]SGGK[272.20]YVDSEGHLYTVPIR 1.15 IPI00009236 Natural 0.97 2 1134.5405 -0.0712 Ac-lysine n[43.02]SK[272.20]NTVSSAR 1.46 IPI00007280 Natural 0.98 3 1843.9029 -0.0854 Ac-lysine n[43.02]SK[272.20]SESPK[272.20]EPEQLR 2.27 IPI00215965 Natural 0.97 2 1439.6522 -0.0965 Ac-lysine n[43.02]SK[272.20]SFQQSSLSR 2.24 IPI00017297 Natural 1.00 2 1633.7452 -0.1055 Ac-lysine n[43.02]SSK[272.20]TASTNNIAQAR 1.62 IPI00221232 Natural 1.00 3 1786.8867 -0.0914 Ac-lysine n[43.02]TENSTSAPAAK[272.20]PK[272.20]R 2.39 IPI00550239   221 APPENDIX C: CLINICAL RESEARCH ETHICS BOARD APPROVAL


Citation Scheme:


Citations by CSL (citeproc-js)