UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Matrix metalloproteinase regulation of inflammatory proteins Starr, Amanda E. 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2011_spring_starr_amanda.pdf [ 4.3MB ]
Metadata
JSON: 24-1.0071555.json
JSON-LD: 24-1.0071555-ld.json
RDF/XML (Pretty): 24-1.0071555-rdf.xml
RDF/JSON: 24-1.0071555-rdf.json
Turtle: 24-1.0071555-turtle.txt
N-Triples: 24-1.0071555-rdf-ntriples.txt
Original Record: 24-1.0071555-source.json
Full Text
24-1.0071555-fulltext.txt
Citation
24-1.0071555.ris

Full Text

MATRIX METALLOPROTEINASE REGULATION OF INFLAMMATORY PROTEINS by Amanda E. Starr B.Sc., University of Guelph, 1998 M.Sc., University of Guelph, 2002  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Biochemistry and Molecular Biology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) December 2010  © Amanda E. Starr, 2010  ABSTRACT Recruitment of leukocytes is a hallmark feature of inflammation, as is the dissipation of the infiltrate for healing. Continual recruitment and leukocyte activation results in host tissue damage that is pathognomonic of chronic inflammatory disease. Matrix metalloproteases (MMPs) are an important family of endopeptidases that are elevated and associated with inflammatory diseases. Historically considered to promote cellular invasion by degrading components of the extracellular matrix, it is now recognized that MMPs specifically process bioactive molecules to alter the function of these proteins. A novel substrate discovery method identified that MMP truncation of the first 4 amino acid residues of the monocyte chemoattractant cytokine (chemokine) CCL7 produced a receptor antagonist that is capable of reversing the inflammatory response in vivo. Since this first discovery, nearly half of all chemokines have been identified as MMP substrates, resulting in products that promote and inhibit neutrophil recruitment, and inhibit monocyte recruitment and so implicating MMPs as major regulators of innate immunity. I hypothesized that MMP processing of select chemokines would promote monocyte recruitment, and that neutrophil-specific membrane-type (MT)6-MMP processes chemokines and other inflammatory mediators during neutrophil migration through the endothelium and stroma. To identify chemokines activated by MMP-processing, I systematically evaluated all monocyte attracting CC chemokines, finding that all are cleaved by at least one MMP. Moreover, in vitro functional assays showed that MMP processing of CCL16 increases glycosaminoglycan binding of the chemokine, whereas CCL15 and CCL23 products have enhanced agonist activity. To identify substrates of MT6-MMP, chemokine cleavage was evaluated in vitro, and the proteomics method terminal amino isotopic labeling of substrates (TAILS) was applied to soluble and membrane-associated human lung fibroblast and human microendothelial cell proteomes. 14 chemokines, as well as vimentin, insulin-like growth factor binding protein-7, cystatin C, and galectin-1 were confirmed to be substrates of MT6-MMP. I propose that MT6-MMP has pleiotropic roles in inflammation by potentiating and then inhibiting neutrophil recruitment, contributing to monocyte recruitment, and promoting wound healing. Contributing to our understanding of the roles of MMPs in inflammation, ii  my work also suggests new modalities whereby perturbing MMP regulation promotes inflammatory disease.  iii  PREFACE The chapters presented herein are all first-authored manuscripts prepared by the candidate with guidance from the graduate supervisor, Dr. Christopher Overall. The data presented in the manuscript in Chapter 2 were acquired by the candidate except for the neutrophil activation chemotaxis assay, and calcium mobilization assay for the CCL23 (5-23) peptide, which was performed by Josephine Maier under the direction of the candidate. Blood cell isolation was approved by the UBC Clinical Research Ethics Board (H6-00047; Appendix C) The candidate acquired the data for Chapter 3, with the following exceptions. Chemotaxis assays of THP-1 cells toward vimentin were performed by Dr. Caroline Bellac and Dr. Verena Goebler. In addition, Dr. Bellac performed the cleavage assays and gels for cystatin C, galectin-1, SPARC and IGFBP-7. Dr. Pitter Huesgen is acknowledged for preparation of the tryptic library for the PICS assay. Jason Rogalski is acknowledged for operating the QStar XL Hybrid ESI mass spectrometer. For Chapter 4, Jason Rogalski is acknowledged for operating the QStar XL Hybrid ESI mass spectrometer. All other data was acquired and analyzed by the candidate.  iv  TABLE OF CONTENTS ABSTRACT ..................................................................................................................... ii PREFACE ...................................................................................................................... iv TABLE OF CONTENTS .................................................................................................. v LIST OF TABLES ...........................................................................................................vii LIST OF FIGURES........................................................................................................ viii LIST OF ABBREVIATIONS ............................................................................................. x ACKNOWLEDGEMENTS............................................................................................... xi CHAPTER 1: INTRODUCTION....................................................................................... 1 MATRIX METALLOPROTEINASES .................................................................................... 3 MT6-MMP .....................................................................................................................8 CHEMOKINES ................................................................................................................11 MMPS IN THE ACUTE INFLAMMATORY RESPONSE ............................................................27  THEME AND HYPOTHESES .......................................................................................... 31 CHAPTER 2: MATRIX METALLOPROTEINASE PROCESSING OF MONOCYTE CHEMOATTRACTANTS: CCL15 AND CCL23 ARE ACTIVATED WHEREAS CCL16 CLEAVAGE INCREASES GLYCOSAMINOGLYCAN BINDING ................................... 33 SYNOPSIS ................................................................................................................. 33 INTRODUCTION .......................................................................................................... 34 MATERIALS AND METHODS ......................................................................................... 36 RESULTS .................................................................................................................. 40 DISCUSSION .............................................................................................................. 60  v  CHAPTER 3: MT6-MMP PROCESSES PROTEINS INVOLVED IN LEUKOCYTE MIGRATION AND MATRIX REMODELING TO PROGRESS TO WOUND HEALING . 67 SYNOPSIS ................................................................................................................. 67 INTRODUCTION .......................................................................................................... 67 MATERIAL AND METHODS ........................................................................................... 70 RESULTS .................................................................................................................. 76 DISCUSSION .............................................................................................................. 98 CHAPTER 4: DETERMINATION OF THE MT6-MMP SUBSTRATE DEGRADOME BY ITRAQ-TAILS QUANTITATIVE PROTEOMICS .......................................................... 105 SYNOPSIS ............................................................................................................... 105 INTRODUCTION ........................................................................................................ 105 MATERIAL AND METHODS ......................................................................................... 107 RESULTS ................................................................................................................ 112 DISCUSSION ............................................................................................................ 133 CHAPTER 5: CONCLUSIONS AND PERSPECTIVES ............................................... 138 REFERENCES............................................................................................................ 147 APPENDIX A: PEPTIDES IDENTIFIED IN HFL SECRETOME ANALYSIS ................ 164 APPENDIX B: PEPTIDES IDENTIFIED FROM HFL OR HMEC FRACTIONS............ 176 APPENDIX C: CLINICAL RESEARCH ETHICS BOARD APPROVAL........................ 221  vi  LIST OF TABLES Table 1.1 Human chemokine receptor preferences and truncation variants ................. 15 Table 2.1 MMP-truncation products of CC chemokines ................................................ 41 Table 3.1 Highest confident candidate substrates of MT6-MMP ................................... 92 Table 3.2 High confident candidate substrates of MT6-MMP. ....................................... 94 Table 3.3 Candidate substrates of MT6-MMP. .............................................................. 95 Table 4.1 Number of proteins (and peptides) identified in HFL experiments............... 113 Table 4.2 Number of proteins (and peptides) identified in HMEC experiments ........... 115 Table 4.3 Highest confident candidate substrates from HFL conditioned medium ...... 118 Table 4.4 Candidate substrates from HFL conditioned medium.................................. 118 Table 4.5 Highest confident candidate substrates from HFL membrane fractions ...... 119 Table 4.6 Candidate substrates from HFL membrane fractions .................................. 120 Table 4.7 Highest confident candidate substrates from HMEC conditioned medium .. 121 Table 4.8 Candidate substrates from HMEC conditioned medium .............................. 122 Table 4.9 Highest confident candidate substrates from HMEC membrane fractions... 123 Table 4.10 Candidate substrates from HMEC membrane fraction .............................. 125  vii  LIST OF FIGURES Figure 1.1 MMP structural characteristics ....................................................................... 4 Figure 1.2 MMP and chemokine receptor expression ..................................................... 7 Figure 1.3 Chemokine structure .................................................................................... 12 Figure 2.1 All MMPs evaluated processed CCL16. ....................................................... 43 Figure 2.2 Heparin binding is enhanced upon CCL16 processing................................. 46 Figure 2.3 All MMPs evaluated processed CCL15 at one or more sites. ...................... 48 Figure 2.4 Kinetics of CCL15 processing by MMPs. ..................................................... 49 Figure 2.5 All MMPs evaluated processed CCL23 at one or more sites. ...................... 52 Figure 2.6 MMP-mediated cleavages of CCL15 and CCL23 results in increased agonism in calcium mobilization assays................................................................. 54 Figure 2.7 Chemotactic potential of CCL15 and CCL23 is enhanced by MMPprocessing.............................................................................................................. 56 Figure 2.8 A 19-mer peptide corresponding to CCL23 (5-23) had no identifiable function. ............................................................................................................................... 57 Figure 2.9 Synovial fluid MMP and serine proteases cleave CCL15. ............................ 58 Figure 2.10 Model of chemokine propogation of inflammation ...................................... 66 Figure 3.1 Expression and purification of soluble active and catalytically inactive MT6MMP mutants. ........................................................................................................ 77 Figure 3.2 PICS analysis of MT6-MMP cleavage site specificity. .................................. 80 Figure 3.3 Kinetic analysis of MT6-MMP and inhibition by TIMPs................................. 82 Figure 3.4 MT6-MMP cleavage of gelatin and casein. .................................................. 83 Figure 3.5 CXC chemokine processing by MT6-MMP................................................... 85 Figure 3.6 CC chemokine processing by MT6-MMP. .................................................... 87 Figure 3.7 Venn diagram of the number of peptides identified by TAILS analysis......... 88 Figure 3.8 Natural N-termini distribution........................................................................ 90 Figure 3.9 Distribution of all peptides. ........................................................................... 91 Figure 3.10 Vimentin cleavage by MMPs results in a loss of chemotactic potential. ..... 96 Figure 3.11 Confirmation of novel MT6-MMP substrates. ............................................. 99 Figure 4.1 Schematic of method.................................................................................. 109 Figure 4.2 Venn diagrams of the identified peptides. .................................................. 114 Figure 4.3 Distribution of HFL iTRAQ ratios. ............................................................... 116 viii  Figure 4.4 Distribution of HMEC iTRAQ ratios. ........................................................... 117 Figure 4.5 Distribution of subcellular and extracellular proteins identified by iTRAQlabeled peptides. .................................................................................................. 127 Figure 4.6 Schematic to describe changes in iTRAQ ratios. ....................................... 128 Figure 4.7 IceLogo analysis of TAILS data.................................................................. 131 Figure 5.1 Model of MMP cleavage of inflammatory proteins...................................... 139  ix  LIST OF ABBREVIATIONS APMA  4-aminophenylmercuric acetate  CD  Cluster of differentiation  DAMP s  Damage associated molecular patterns  DMEM  Dulbeccos’ modified essential medium  ESI-QUAD-TOF  Electrospray ionization quadropule time of flight  HFL  Human fetal lung fibroblast  HMEC  Human microvascular endothelial cell  IGFBP  Insulin-like growth factor binding protein  IL  Interleukin  LIX  LPS-inducible CXC chemokine  LPS  Lipopolysaccharide  MALDI-TOF  Matrix-assisted laser desorption/ionization-time of flight  MMP  Matrix metalloproteinase  PAMPs  Pathogen association molecular patterns  PBS  Phosphate buffered saline  PICS  Proteomic identification of protease cleavage sites  PMN  Polymorphonuclear neutrophils  PMSF  Phenylmethylsulfonyl fluoride  RPMI  Roswell park memorial institute medium  SDS  Sodium dodecyl sulfate  SPARC  Secreted protein, acidic and rich in cysteine  TAILS  Terminal amine isotopic labeling of substrates  TIMP  Tissue inhibitor of metalloproteinase  TPP  TransProteomic pipeline  x  ACKNOWLEDGEMENTS First and foremost, I would like to thank Dr. Chris Overall for his support and encouragement as a supervisor. He has taught me that optimism is a necessity for scientific discovery, and to take a chance – how bad can it be. I would also like to thank my supervisory committee for their involvement and discussions that provided me with alternative perspectives to ultimately benefit this research, namely Dr. Leonard Foster, Dr. Francois Jean and Dr. Pauline Johnson. Over the course of this research, there have been many people that have worked in the Overall lab; each has contributed directly through research or indirectly through excellent and thought provoking discussions. Thanks especially to my fellow graduate students Jen, for our 5-minute power talks and sharing windows to the chemokine world, and Patrick for 3 o’clock breaks, Friday afternoons and shared interests in between. Thanks to George for important conversations, guilt-free “5-dolla” diversions and a shared love of Fluevog; Rich and Caroline for providing guidance when I needed it and daily conversations in our shared space; Reini for her positive attitude and keeping the lab running; Anna and Verena for direction in the lab and “sew” much fun outside of it; Charlotte for helping me get started; Alain, Oded, Oliver, Olivier, Philipp, Pitter, Rich F. and Ulrich for sharing their expertise; the latin quarter, Magda and David, for their energy; and Yili “the purifier” for reminding me to do one thing at a time, and to do it right. Despite the challenges of science, I always looked forward to going to the lab, in large part because of the people that I spent my day with. Thanks to each of them for their insight and their friendship. I want to express my thanks to my parents, Mike and Betty, and my in-laws, John and Nancy, who have always been encouraging and have made themselves available when we have needed extra support at home. Thanks to my amazing children Caleb and Caidra for understanding when I wasn’t always home at bedtime, or able to play on the weekend and especially during this most recent period when they encouraged me to “finish my paperwork” soon. Most of all, I want to thank my husband Greg for his neverending support; celebrating successes, encouraging me through failures, and enabling me to get to this stage in my education. xi  CHAPTER 1: INTRODUCTION Inflammation is the host response to infection or injury, intended to remove the stimulus and initiate healing. The cardinal signs of inflammation – redness, heat, swelling, pain, and loss of function – are due to vascular changes including increased blood flow, and a migration of cells and fluid into the affected tissue (reviewed in (1)). The predominant white blood cells (leukocytes) of the innate immune response are polymorphonuclear neutrophils (PMNs, neutrophils) and mononuclear phagocytes. Neutrophils are the most abundant circulating leukocyte, responding rapidly to infection. During bone marrow development, proteins that are responsible for neutrophil function are incorporated into characteristic primary (azurophilic), secondary (specific), and tertiary (gelatinase) granules, and secretory vesicles (2). In a targeting-by-timing hypothesis, the contents of these granules are associated with the timing of the protein biosynthesis and so represent a continuum rather then exact division into these granules (2). Included amongst these proteins are β2-integrins, antimicrobial peptides and proteases (3-8). Neutrophils contribute to bacterial clearance through production of reactive oxygen and nitrogen species (9), antimicrobial peptides release (10), neutrophil extracellular traps (NETS) (11), and phagocytosis. The mononuclear phagocyte system includes a subgroup of leukocytes originally described as myeloid-derived circulating blood monocytes that differentiate into macrophages during inflammation. This traditional definition has recently undergone revision, recognizing that lymphoid precursors can differentiate into dendritic cells and macrophages (12) and that there is heterogeneity within monocyte populations (13,14), though notably differences between human and murine cell populations (12,15). The majority of circulating monocytes are inflammatory (classical) monocytes (human CD14+CD16-; similar to murine Gr1+/Ly6Chigh) (13,15), recruitment of which begins within hours after the initial assault and continues for days (16). Patrolling (nonclassical) monocytes (human CD14lowCD16+; similar to murine Gr1-/Ly6Clow) represent about 10% of the monocyte population; these cells crawl along the endothelium in steady-state conditions to respond rapidly to infection (17) but also at the late stage of  1  injury-induced inflammation to promote healing through vascular endothelial growth factor and the stimulation of collagen production (18). Under inflammatory conditions, monocytes differentiate into M1-type or M2-type macrophages (19,20). M1-type (or classical) macrophages, which are pro-inflammatory with significant production of reactive nitrogen and oxygen species (ROS) (19), produce IL-12 and IL-23 (21) and express monocytes and T-cells chemoattractants (19) . M2type (or alternatively activated) macrophages that have enhanced endocytic clearance capabilities and scavenger receptor expression (22), promote T cell responses, and are involved in matrix deposition and tissue remodeling (23). Acute inflammation, a rapid response initiated by cells resident at the affected site, is characterized by the predominance of recruited neutrophils, and is resolved within hours to days (1). The acute inflammatory response is actively terminated by the downregulation of proinflammatory mediators and by the production of anti-inflammatory mediators that inhibit continued cell recruitment and promote resolution and wound healing. Chronic inflammation is a persistent response, predominated by mononuclear phagocytes (1), that involves concurrent resolution and destruction of host tissues in what has been termed frustrated repair. Chronic inflammation can progress to diseases including rheumatoid arthritis, chronic obstructive pulmonary disease, and cancer. Tissue damage is mediated in part by dysregulated activity of proteases (proteincleaving enzymes), which are capable of degrading extracellular matrices but also specifically process and alter the function of inflammatory proteins that are critical mediators of intercellular signaling. These enzymes may be released as a component of the recruited cells’ antimicrobial arsenal or be upregulated by stromal cells in response to injury. The altered activity of matrix metalloproteinases (MMPs) observed in human diseases, and the disease causing effects observed with naturally occurring human MMP mutations and MMP knockout murine models (reviewed in (24)) have provided evidence of the critical, biological involvement of MMPs in homeostasis and disease (25-28).  2  Matrix metalloproteinases MMPs are a family of calcium and zinc dependent proteases that were first described in tadpole development following the observation that fibrillar collagen was degraded during tadpole tail metamorphosis (29). A similar observation in human gingival tissue (30) led to the isolation of the first human MMP (31). Now, 23 human and 24 murine MMPs have been described (32). Historically, MMPs were considered to degrade all components of the extracellular matrix and thus contribute to diseases such as cancer and arthritis by creating passages in the basement membrane and extracellular matrix to allow cell migration. The extracellular matrix degrading activity of overexpressed MMPs in destructive inflammatory diseases was thought to account for the degenerative and destructive changes associated with chronic inflammation. Nonetheless, broad inhibition clinical trials of MMPs were unsuccessful (33) because, as we now understand, MMPs have a broad substrate profile with involvement in both homeostasis and disease (34-38). Moreover, in certain diseases, MMPs play a protective role (33,3941). Therefore, continued substrate discovery of individual MMPs is critical to understanding their functions in vivo. Conserved features of MMPs include a signal sequence, an amino-terminal prodomain responsible for latency, a protease catalytic domain and a C-terminal hemopexin domain connected to the protease domain by a flexible proline-rich linker (Fig 1.1) (4244). In addition to the basic MMP structure, the gelatinases MMP-2 and -9 have fibronectin type II repeats that bind gelatin and collagen (45). MMPs are either secreted or membrane-bound, termed membrane-type (MT)-MMPs. Membrane-anchoring mechanisms include a transmembrane domain or a glycosphatidylinositol (GPI)-anchor (Fig 1.1). The prodomain of MMPs contains the conserved sequence PRCXXPD (46,47), the cysteine of which binds the catalytically required zinc atom to maintain enzyme latency. Termed the cysteine-switch (47) disruption of the cysteine/zinc bond permits the replacement of the thiol group by a water molecule that facilitates nucleophilic attack of substrates. MMPs are generally secreted as zymogens that undergo proteolytic activation in vivo (48), though in vitro activation can be achieved with mercurial compounds, such as 4-aminophenylmercuric acetate, that disrupt the interaction 3  Figure 1.1 MMP structural characteristics The domain compositions of the 23 human MMPs are shown. The basic structure consists of a signal sequence (S), prodomain (PRO), catalytic domain, and hemopexin domain attached by a linker domain. The prodomain cysteine (C) associates with the catalytic zinc (Zn) to inhibit activity. Gelatin-binding MMPs have additional fibronectindomain inserts (Fn) in the catalytic domain. Proprotein convertase-activated MMPs have a consensus furin-like cleavage sequence (F) upstream of the catalytic domain. Additionally, membrane anchored MMPs have a transmembrane (TM) and cytoplasmic domain (Cs) or a glycosphotidylinositol (GPI) anchoring domain, or a cysteine-rich (Cys) and Ig domain.  4  5  between the prodomain and catalytic domain (49). Alternatively, membrane-type (MT)MMPs, and MMP-11 and -28 contain the consensus cleavage sequence of proprotein convertases, RXXR, (50) in the residues at the C-terminus of the prodomain, which signals for removal of the prodomain by furin-like proteases within the trans-Golgi network and thus are activated intracellularly (51-55) The catalytic domain (reviewed in (56)) of MMPs is roughly spherical, with a shallow active-site cleft that requires substrate binding in an extended conformation (57). MMPs contain the highly conserved HEXGHXXGXXH sequence at the active site that coordinates the catalytic zinc. A mutation of the glutamate residue is sufficient to prevent enzyme activity (58,59). Substrate specificity for each MMP is mainly determined by the S1’ specificity loop, a pocket into which the residue C-terminal to the scissile bond fits. The hemopexin domain is a four-bladed propeller with a central calcium-containing pore. Absent from MMP-7 and MMP-26, the hemopexin domain present on all other MMPs contributes to substrate binding and specificity (60,61). A recombinant hemopexin domain of MMP-2 binds fibronectin and heparin in a calcium-dependent manner (62). The collagenase activity of MMP-1 and MMP-2 requires the hemopexin domain for processing of native collagen, in the case of MMP-2 this was shown to be through the unwinding of the collagen (63-65) Similarly, MMP-8, MMP-13 and MT1MMP also bind collagen through the hemopexin domain (65-67). In addition to substrate recognition, the hemopexin domain can contribute to cell signaling as observed by MMP-9 hemopexin domain binding to low-density lipoprotein receptor-related protein to promote migration of schwann cells (68). Regulation of MMP activity is maintained not only by latency in a zymogen form but also at the level of gene expression, by protease inhibition, and by specific localization. MMPs are generally expressed in response to external induction by cytokines, integrinderived signals, cell stress and shape changes (reviewed in (69)) though exceptions to this include the constitutive production of MMP-2 (70) and MMP-7 (71), and neutrophil granule-stored MMPs, which are secreted following cell activation (5,72). MMP activity is inhibited by non-specific protease inhibitors including α2-macroglobulin and clusterin, and more specifically by four tissue inhibitors of metalloproteinases (TIMPs) (73). MMPs are produced by stromal cells and by immune cells (Fig 1.2) (25,74). While there is 6  Figure 1.2 MMP and chemokine receptor expression Simplified view of the overlap in the distribution of both MMPs and chemokine receptors by multiple cell types including neutrophils (pink), mononuclear phagocytes (purple), endothelial cells (yellow), fibroblasts (orange) and lymphocytes (brown). The expression of MMP-8 and MMP-25/MT6-MMP is restricted to neutrophils, MMP-12 to mononuclear phagocytes, and MMP-26 and MMP-27 to lymphocytes.  7  considerable overlap in the source of some MMPs, others are specific to one cell type. MMP-2 and MMP-9 are widely distributed enzymes present in cells such as neutrophils, macrophages and fibroblasts (25). In contrast, MMP-8 (neutrophil collagenase/collagenase 2) and MT6-MMP (MMP-25/leukolysin) are found only in neutrophils (52,72,75,76), whereas MMP-12 (metalloelastase) is a macrophage-specific enzyme (77). Given the cellular localization, a role in inflammation is probable for these leukocyte-specific MMPs. Indeed, MMP-8, MMP-12 and MT6-MMP have all been implicated in inflammatory disease through the identification of elevated levels ((78-84)) or phenotypic effects in murine knockout models ((39,85)reviewed in (24)) . To understand the direct role of MMPs in disease is dependent upon knowing the substrate repertoire; what proteins are cleaved by a given MMP and what are the functional consequences. While both MMP-8 and MMP-12 have been shown to alter leukocyte recruitment through processing of inflammatory mediators (86-89), very little is known in regards to substrates of MT6-MMP. MT6-MMP MT6-MMP was first identified by Expressed Sequence Tag database searching against MT4-MMP (52). Tissue specificity was identified within peripheral leukocytes, thus the initial naming of the protein as leukolysin, and later confirmed to be specific to neutrophils (52,72). The C-terminus of the prodomain contains a sequence of five arginine residues, which correspond to the consensus cleavage sequence (RXXR) of furin-like proprotein convertases (PPC) (50) indicating the intracellular activation of MT6-MMP by PPCs (52). Based upon a hydrophobic segment at the C-terminus and no apparent cytosolic domain in the primary sequence, it was proposed and later confirmed that MT6-MMP was GPI-anchored to the plasma membrane (51,52,72). GPI-anchors are post-translational modifications that occur in the endoplasmic reticulum (ER) composed of a phosphoethanolamine linker between the protein and glycan core, joined to a phospholipid tail for cell-surface anchoring (90). The GPI-anchor is synthesized within the ER where it is exchanged with the hydrophobic stretch of residues on the target protein (e.g. MT6-MMP) through a transamidation reaction (91). GPI-anchored proteins traverse through the trans-Golgi network and traffic to appropriate endosomes or lipid rafts in the cell membrane (92,93). In addition to MT68  MMP, neutrophil expressed GPI-anchored proteins include the protease urokinase plasminogen activator (uPA) (94), uPA receptor (95), the complement regulatory protein cluster of differentiation (CD)59 (96), the β2 integrin-associated protein GPI-80 (97), and a lipopolysaccharide co-receptor CD14 (98). GPI-anchored proteins can be released from the cell surface by bacterial phosphoinsoitol-specific phospholipase (PL)C or serum-derived GPI-specific PLC (99,100). Fractionation studies showed that MT6-MMP is located predominantly in tertiary granules and secretory vesicles but also on the plasma membrane and in secondary granules of resting neutrophils (72,99-101). Cell membrane-bound MT6-MMP is predominantly, though not exclusively, a homodimer through the hemopexin domain residue Cys532 (83,102). Stimulation of neutrophils by the chemokine CXCL8 or interferon (IFN)-gamma induces the release of MT6-MMP from intracellular stores (72), whereas stimulation and induction of apoptosis by PMA increases neutrophil surface localization of the enzyme (72,101). In a flow-cytometry based study with antibody to the MMP linker region, Fortin and colleagues could not detect MT6-MMP on the extracellular surface of resting neutrophils but only in permeabilized cells or on the extracellular surface of apoptotic cells, and so proposed that the enzyme faces inward. Yet, MT6-MMP is released from the resting neutrophil cell surface by PLC (72). An alternative hypothesis is that the structure of the enzyme is modified such that the epitope that this antibody detected is not available in resting cells. As with other MMPs, enzymatic activity of MT6-MMP is regulated by TIMPs, including TIMP-1, -2, and -3, (101,103,104). Using a catalytic domain of MT6-MMP, English and colleagues identified TIMP-2 and TIMP-3 inhibitory activity to be greater than that of TIMP-1 (103). In contrast TIMP-1 inhibition was shown to be equivalent to that of TIMP2 against a soluble form of MT6-MMP containing the hemopexin domain (83,105), again highlighting the importance of this domain in protein interaction. The abundant serum protein clusterin is an additional inhibitor of MT6-MMP, identified by co-purification of the two proteins in a recombinant mammalian system and validated by addition to active protease (105).  9  Several studies have implicated MT6-MMP in both development and disease due to enhanced expression (83,84,106,107). Northern blot analysis of MT6-MMP identified elevated RNA levels in certain brain tumors, namely anaplastic astrocytomas and glioblastomas, but not in healthy brain tissue (84). Similarly, RNA was increased in a colon carcinoma cell line (84) and detected by in situ analysis in colon cancer tissue (83). Transformation of a colon cancer cell line with MT6-MMP resulted in cells with enhanced tumor growth in a murine model compared with the parent cell line (83). Increased expression of MT6-MMP was detected in a human NK cell line with enhanced migratory ability compared with an NK cell line lacking MMP expression (108). Together, these studies suggest a role for MT6-MMP in disease through the promotion of cell migration, though the substrates of MT6-MMP that are directly responsible have yet to be determined. Several directed approaches have identified few MT6-MMP substrates. Proteolysis of myelin basic protein isoforms by MMPs, predominantly MT6-MMP, results in an immunogenic peptide proposed to contribute to MS pathogenesis (109). The activation of MMP-2 by MT6-MMP has been extensively studied, though with conflicting results. While a catalytic domain or a cell-associated form of MT6-MMP could not activate MMP-2 (51,84,103), a catalytically inactive MMP-2 was processed in the presence of catalytic MT6-MMP (110). The few other MT6-MMP substrates identified are extracellular matrix proteins (type IV collagen, gelatin, fibronectin, fibrin), alpha-1 proteinase inhibitor, and uPAR (103,109,111,112); galectin-3 has been reported, though no evidence has been shown (113). To identify disease-relevant substrates of MT6MMP a novel approach, that has proven successful for other proteases, is required. Unlike other proteases such as the aforementioned proprotein convertases that have a consensus cleavage sequence, MMPs have a broad specificity. Neither substrate nor cleavage site identification can be determined by analysis of the primary sequence of a protein. Therefore, substrate identification of MMPs requires biochemical analysis. To this end a number of methods have been successfully applied. A hypothesis-directed approach that evaluated MMP-8 proteolysis of all neutrophil-attracting chemokines in vitro revealed MMP-8 activation of the murine chemokine (m)CXCL5/LIX and human CXCL8/IL8, and showed this to be a critical step in the recruitment of neutrophils in vivo 10  (89). Using a novel exosite scanning method, the Overall lab identified that CCL7/MCP3 bound to the hemopexin C-domain of MMP-2 in the yeast two-hybrid system, and confirmed this as a substrate (114). Proteolytic processing of CCL7/MCP-3 by MMP-2 resulted in an N-terminal truncation of the chemokine to remove the first 4 aminoterminal residues; a truncation that results in a strong receptor antagonist that is capable of reversing inflammatory responses in vivo (114,115). In a cell-based proteomics approach comparing Mmp2-/- cells expressing MMP-2 or inactive MMP-2, increased processing of heparin affin regulatory peptide (HARP) and connective tissue growth factor (CTGF) were observed and shown to decrease the inhibitory activity of these vascular endothelial growth factor (VEGF) binding proteins (116). Significant progress has been made in the last decade to identify bioactive substrates of MMPs and their functional effects (reviewed by (34,38,117,118)). It is now recognized that MMPs process proteins involved in all stages of the inflammatory response. One family of proteins that is critical to inflammation, and half of which are confirmed substrates of MMPs, are chemokines. Chemokines The chemokine superfamily represents over 48 structurally related proteins that are required for the directional migration of leukocytes, both in homeostasis and disease (119). Though chemokine amino acid similarity ranges from 20-95%, all chemokines have the same general structure (120). This includes a flexible N-terminus prior to conserved cysteine residues, followed by a loop of ~10 amino acids (termed the 30s loop), a single-turn helix and three beta-strands leading into the C-terminal alpha-helix (120) (Fig 1.3). Division into four chemokine subfamilies is based on the pattern of the N-terminal cysteine residues, corresponding to C, CC (beta), CXC (alpha) and CX3C chemokines where X represents any amino acid (121). A further subdivision of CC chemokines is N6Ckines, so called due to the presence of an extended N-terminus and an additional disulfide bond. N6Ckines include mCCL6 and mCCL9 in mice and human (h)CCL15 and hCCL23 (122). The recent renaming of mCCL6 and mCCL9 (Chemokine Gordon Conference, 2010) to mCCL15 and mCCL23 is due to tertiary, but not primary structural homology. A sub-division of CXC chemokines is based upon the presence or absence of a Glu-Leu-Arg (ELR) sequence that is critical for agonist activity (123,124). 11  Figure 1.3 Chemokine structure Schematic of the conserved structural features of chemokines. The N-terminus (NH2) is separated from the N loop by the conserved cysteine (C) residues. A β-strand leads into the 30s loop, which contains a cysteine that forms a disulfide bond with an N-terminal cysteine. The second and third β-strand are followed by a fourth conserved cysteine residue, involved in a disulfide bond with the N-terminus, and finally an α-helix in the carboxy-terminus that is involved in glycosaminoglycan binding.  12  Chemokines can alternatively be divided functionally into homeostatic and inflammatory proteins. While homeostatic chemokines (CXCL12, CCL19, CCL20, CCL21, CCL25, CCL27) are constitutively produced and function primarily in directing cell migration in the bone marrow and lymphatics (125), inflammatory chemokines are upregulated in response to inflammatory stimuli (126,127), and function primarily in directing leukocytes to the affected tissue (128). In response to an inflammatory stimulus, local cells release chemokines that form a haptotactic (substrate-bound) gradient by binding of the chemokine C-terminal α-helix to glycosaminoglycan (GAG) side-chains of proteoglycans (129,130). Heparan sulphate is ubiquitously expressed whereas heparin, chondroitin sulphate and dermatan sulphate have cell and organ specific localization (131). The interaction between negatively charged GAGs and chemokines is dependent upon a positively charged motif. The BBXB motif, where X is a basic residue, observed in CCL5 (132) is common to other chemokines (133-135). Through the use of chemokine mutations it was shown that in vivo, in addition to creating a high local concentration, GAG interaction permits oligomerization that is required for activation of cells by some chemokines, including CCL5 (129). Following chemokine arrest and gradient formation on GAGs, residues within the 30s-loop and N-loop or N-terminus of the chemokine bind residues in the extracellular domains of cognate leukocyte-expressed chemokine receptors (136-139). Chemokine receptors have an extracellular N terminus, seven transmembrane domains and an intracellular C-terminal domain that interacts with signaling molecules (140). Currently, there are 19 known G protein-coupled receptors (GPCR) that signal upon binding of chemokines (Table 1.1) (141,142) and an additional 4 receptors that bind but do not signal, thereby acting as decoy receptors (143). There is promiscuity among chemokines and their receptors in that more than one chemokine may bind to one receptor, and likewise one chemokine may bind multiple receptors (141,142). Yet, binding is generally restricted within subclasses, thus receptor nomenclature correlates with subclass specificity such that receptors binding to CC chemokines are termed CCR1 through CCR10. Chemokine receptor expression is not limited to leukocytes, but also occurs on endothelial, fibroblast and tumor cells (Fig 1.2), however, their exact roles here are less well studied. Similarly, chemokines reportedly have antimicrobial 13  (144,145) and angiogenic functions (146) though the mechanisms are less well understood than the effects on cell migration. Following ligand binding, dissociation of the G protein initiates a cascade of events leading to calcium mobilization from intracellular stores, gene expression and ultimately cell polarization and migration (reviewed in (147,148)). While not fully understood, it appears that there are differences in chemokine activation of GPCR pathways through the G subunits involved in the intracellular signaling, perhaps providing selectivity in chemokine responses (149). Phosphorylation of Ser and Thr residues in the intracellular loops and carboxyl-terminus of the chemokine receptor can result in receptor desensitization and recruitment of adaptor molecules to promote clathrin-mediated endocytosis (150,151). Alternatively, internalization of some chemokine receptors is mediated through caveolae (152). Given its role in receptor binding and activation, post-translational modification of the chemokine N-terminus results in significant functional effects (153). Similarly, changes to the C-terminus can alter the GAG-binding capacity, and thus the haptotactic potential of chemokines (154). A significant post-translational modification that has been observed to alter function of chemokines both in vitro and in vivo is proteolytic truncation of the termini (reviewed in (155,156)) (Table 1.1). The functional effect of chemokine processing is cleavage site and chemokine specific (Table 1.1). Yet, in general, the ELR+ CXC chemokines have enhanced activity following N-terminus proteolysis provided that the ELR motif remains intact (124,157). In contrast, ELR- CXC chemokine agonist function is reduced or eliminated by removal of any residues at the N-terminus. A distinction is less apparent among the CC chemokines though it appears from those that have been evaluated that N-terminus truncation results in a loss of agonist activity (Table 1.1). Notable exceptions are truncations of CCL14, CCL15 and CCL23 (122,158,159). Both exopeptidases, such as dipeptidyl peptidase (DPIV), and endopeptidases, including MMPs and the serine proteases, have roles in chemokine processing (Table 1.1) (155).  14  Table 1.1 Human chemokine receptor preferences and truncation variants No differentiation is made between monocyte (Mono) subtypes or macrophage (Mφ) subtypes. Other cells types represented include neutrophil (PMN), dendritic cells (DC) and natural killer cells (NK). Italics indicates assumed by similarity (no experimental evidence); *indicates truncations identified in biological samples Chemokine Receptors Cell Source  Target Cell  Truncations  Functional Effect  Protease  Reference  CXC (ELR+) CXCL1  CXCR2,  (1-73)  CXCR1  CXCL2  CXCR2  Mono  Mono, PMN  PMN,  (4-73)  Increased activity (30x)  Unknown*  (160)  Endothelial  (5-73)  Increased activity (30x)  Unknown*  (160)  (6-73)  Increased activity (30x)  Unknown*  (160)  Degraded  Clearance  MMP9  (161)  (5-73)  Decrease hematopoietic progenitor MMP-1  PMN  (1-73)  cell proliferation  (87,162)  MMP-9 MMP-12  CXCL3  CXCR2  (1-73) CXCL4  CXCR3B  CXCR1,  (1-78)  CXCR2,  ND  MMP-12  (87)  Mono,  PMN,  (5-73)  Increased activity (5x)  Unknown*  (160)  Endothelial  Endothelial  (7-73)  ND  MMP-12  (87)  Platelet  PMN, Mono  (17-70)  Inhibit endothelial cell proliferation  Unknown*  (163)  Degraded  Clearance  MMP9  (161)  (5-78)  Increased neutrophil activation  Cathepsin G  (164)  (6-78)  ND  MMP-9,  (87)  (1-70)  CXCL5  (7-73)  Mono  PMN  DARC  MMP-12 (8-78)  Increased activity  MMP-1,  (87,89)  MMP-8  15  Chemokine Receptors Cell Source  CXCL6  CXCR1,  Fibroblast,  (1-77)  CXCR2,  Epithelial  Target Cell  PMN  DARC  Truncations  Functional Effect  Protease  Reference  (9-78)  Increased neutrophil activation  Cathepsin G  (164)  (10-78)  Reduced neutrophil activation  Cathepsin G  (89,164)  (11-78)  ND  MMP-12  (87)  (3-77)  No change  DPIV  (165)  (5-77)  Increased activity  Unknown  (166)  (9-77)  Increased activity  Unknown*  (166)  (15-77)  ND  MMP-12  (87)  MMP-1  (87)  Degraded  MMP-9 CXCL7  CXCR2,  (1-70)  DARC  Platelet  Mono, PMN  PMN, Fibroblast (1-57)  ND  MMP-12  (87)  (1-63)  Increased activity  Unknown*  (167)  (1-66)  Increased activity  Unknown*  (167,168)  (1-68)  Increased antimicrobicidal  Unknown*  (169)  Degraded  Clearance  MMP-9  (161)  PMN,  ND  Increased activity (10x)  MMP-9  (170)  CXCL8  CXCR1,  (1-77)  CXCR2,  Basophil,  (5-77)  Increased activity (5x)  Thrombin  (171)  DARC  T cell  (6-77)  Increased activity  MMP-8,  (89,172)  MMP-13, MMP-14 Thrombin (7-77)  Increase CXCR1>CXCR2 (10x)  MMP-1,  (87,89,161,173)  MMP-9,  16  Chemokine Receptors Cell Source  Target Cell  Truncations  Functional Effect  Protease  Reference  MMP-12  (7-72)  No change to heparin binding  Synthesized  (173)  (10-77)  Inactivating  MMP-12  (87)  (1-69)  Decrease heparin binding  Synthesized  (173)  No change to inhibition of CXCL8  DPIV  (174,175)  (1-66) (1-63) (1-60) (1-58) (1-54) (1-51)  CXC (ELR-) CXCL9  CXCR3  (1-103)  CXCL10  Fibroblast,  T cells  (3-70)  Endothelial  CXCR3  Keratinocyte  angiogenic activity  T cells, Mono  (1-90)  ND  MMP-8  (154)  3-77  Receptor antagonist  DPIV,  (174-176)  Decreased receptor binding  DPVIII  (1-77) (5-77)  MMP-2,  (6-77)  MMP-9  (1-73)  No change to inhibition of CXCL8  (177)  MMP-8  (154,174)  MMP-8  (154)  angiogenic activity (1-71)  ND  17  Chemokine Receptors Cell Source CXCL11  CXCR3,  Mono,  (1-73)  CXCR7,  Fibroblast,  DARC  Endothelial  Target Cell T Cell  Truncations  Functional Effect  CXCR4,  T cell, DC, B  α (1-67)  CXCR7  cell, Mono  Reference  (3-73)  Decreased activity  DPVIII  (174-176)  (4-73)  R antagonist  Synthesized  (178)  (5-73)  Receptor antagoinist  MMP-8,  (154)  (5-58)  Loss of GAG binding  MMP-9,  (6-63) CXCL12  Protease  MMP-12  (3-67)  Loss of CXCR4 activity  DPIV  (175,179)  (4-67)  Loss of CXCR4 activity  Elastase  (180)  (5-67)  Loss of CXCR4 activity  MMP-1  (181-183)  CXCR3-mediated neurotoxicity  MMP-2 MMP-3 MMP-9 MMP-13 MMP-14  (6-67) CXCL13  CXCR5  B cell, T cell  CXCL16  CXCR6  T cell, NK  Loss of CXCR4 activity  Cathepsin G  (184)  Shedding  ADAM10  (185,186)  ND  (32-107)  CCL  18  Chemokine Receptors Cell Source  Target Cell  CCL1  CCR8,  T cell,  PMN, T cell,  (1-73)  CCR1,  Endothelial,  Mono  Truncations  Functional Effect  Protease  Reference  ND  DARC, D6 Mφ CCL2  CCR2,  Mφ, Fibroblast, Mono, T cell,  (1-76)  CCR1,  Endothelial,  DARC,  Basophil,  D6  Smooth  (1+9-97)  CCR2 anataontist  Synthesized  (187)  (2-76)  Increase eosinophil acivity  Synthesized  (188)  Synthesized  (188)  In vivo reduction of cell migration  MMP-1,  (87,114,115,177)  No change to basophil and  MMP-2,  (188)  eosinophil activity  MMP-3,  baso  muscle  Decrease basophil activity (4-76)  No change to basophil and eosinophil activity  (5-76)  MMP-8, MMP-9, MMP-12 MMP-13, MMP-14,  CCL3  CCR1  (1-70)  CCR5  cell, Basophil,  D6  DC  Mφ, T cell  Mono, Mφ, T  (6-76)  Loss of activity  Synthesized  (188)  Unknown  Loss of activity  MMP8  (88)  19  Chemokine Receptors Cell Source  Target Cell  CCL4  CCR1,  Mφ, T cell, B  Mono, Mφ, T  (1-69)  CCR5,  cell  cell, NK,  CCR8,  Truncations  Functional Effect  Protease  Reference  Degraded  Clearance  Cathepsin D  (189)  (3-69)  Increase CCR1 activity  DPIV  (175,190)  Loss of Dimeric properties  Synthesized  (191)  Degraded  Clearance  Cathepsin D  (189)  (3-68)  Decrease CCR1, CCR3 Activity  No change to CCR5  Basophil, DC  D6  (7-69) (8-69) (9-69)  CCL5  CCR1,  T cell, platelet, Mono, Mφ, T  (1-68)  CCR3,  Fibroblast  cell, NK,  Increase CCR5  CCR5,  Basophil,  Increase anti-HIV activity  DARC,  Eosinophil, DC  D6  (4-68)  Receptor antagonist  (165,175,192-194)  Unknown*  (195)  Decrease anti-HIV activity  CCL7  CCR2,  Mφ, Mono,  Mono, T cell,  (1-76)  CCR1,  Fibroblast  Eosinophil,  CCR3,  (9-68)  Receptor antagonist  Synthesized  (196)  (5-76)  Receptor antagonist  MMP-1,  (87,115)  In vivo reduction of cell migration  MMP-2,  Basophil, DC  MMP-3,  CCR4,  MMP-12  DARC, D6  MMP-13, MMP-14, (6-76)  Receptor antagonist  Unknown*  (197)  (10-76)  Receptor antagonist  Synthesized  (196)  20  Chemokine Receptors Cell Source  Target Cell  CCL8  CCR2,  Fibroblast,  Mono, T cell,  (1-76)  CCR1,  mono  Eosinophil,  CCR3,  Basophil  CCR5,  Truncations  Functional Effect  (5-76)  Protease  Reference  MMP-3  (115)  MMP-12  (87)  (1-73)  MMP-12  (87)  (5-73)  MMP-12  (87)  D6 CCL11  CCR3,  (1-74)  CCR5,  Mφ, Epithelial Mono,  (3-74)  Decrease CCR3 activity  DPIV  (198,199)  (4-74)  No change  Unknown*  (200)  CCR3 antagonist  MMP-1,  (115)  Eosinophil  D6, CXCR3 CCL13  CCR2,  Mφ,  Mono, T cell,  (4-75)  (1-75)  CCR3,  Endothelial,  Eosinophil,  (5-75)  CCR1,  Epithelial  Basophil, DC  MMP-3  CCR5,  (8-75)  CCR3 antagonist  MMP-1  (115)  DARC,  (5-72)  ND  MMP-12  (87)  Mono, T cells,  (3-74)  ND  Unknown*  (201)  D6 CCL14  CCR1,  (1-74)  CCR3,  PMN,  (4-74)  ND  Unknown*  (201)  CCR5,  Eosinophil  (6-74)  Ca2+ mobilization  Synthesized  (202)  (7-74)  Increase CCR1, CCR3 and CCR5  Synthesized  (202)  Synthesized  (203)  uPA, Plasmin  (158,203,204)  D6  Epithelial  activity (8-74)  Increase CCR1, CCR3 and CCR5 activity  (9-74)  Increase CCR1, CCR3 and CCR5  21  Chemokine Receptors Cell Source  Target Cell  Truncations  Functional Effect  Protease  Reference  activity Increased Anti-HIV1 activity *further degraded by plasmin (10-74)  Highest agonist activity  Synthesized  (202)  (11-74)  Increase CCR1, CCR3 and CCR5  Synthesized  (202)  Synthesized  (202)  Synthesized  (205)  activity (12-74)  Increase CCR1, CCR3 and CCR5 activity  CCL15  CCR1,  Mφ, T cell, B  Mono, T cell,  (1-92)  CCR3,  cell, NK,  DC, PMN?  CCR5,  Epithelial  DARC  (5-92)  Increase CCR1 activity Decrease CCR3 activity  (22-92)  increase CCR1  Elastase  (122,159)  (24-92)  increase CCR1  Cathepsin G  (159)  (25-92)  Increase CCR1 activity  Synthesized  (Lee et al., 2002)  (27-92)  increase CCR1  Cathepsin G  (159)  (28-92)  increase CCR1  Synthesized  (Lee et al., 2002)  (29-92)  increase CCR1  Cathepsin G  (122) (Lee et al, 2002)  Chymase (30-92) CCL16  CCR1  Mφ, NK, T cell Mono  (1-97)  CCR5  CCL17  CCR4  Mφ,  (1-71)  CCR8  Lymphocyte  increase CCR1  (Lee et al., 2002)  ND  T cell, DC, NK ND  22  Chemokine Receptors Cell Source  Target Cell  Truncations  Functional Effect  Protease  Reference  DARC D6 CCL18  Unknown  Mφ, DC  T cell  (3-69)  ND  Unknown*  (4-69)  ND  Unknown*  (1-68)  ND  Unknown*  (8-38)  CCR7 antagonist  Unknown*  (206)  Mono, T cell,  (1-52)  Loss of activity  Cathepsin D  (207)  DC  (1-55) No change  Cathepsin B  (207)  Loss of activity  Cathepsin D  (189)  Effect Th cell response; Decrease  DPIV  (175,208,209)  DPIV  (208)  (1-69)  CCL19  CCR7,  (1-77)  CCXCKR  CCL20  CCR6  Mφ  T cell, DC, B  (171)  cell Mφ  (1-70)  (1-66) CCL21  CCR7, 8  (1-111)  CCXCKR,  (1-58),  CXCR3  (59-111)  Mφ  CCL22  CCR4,  Mφ, mDC,  (1-69)  D6  mono  T cell, B cell  DC, NK, T cell (3-69)  CCR4 activity; Maintain anti-HIV activity  (5-69)  Decrease CCR4 activity Maintain anti-HIV activity  CCL23  CCR1,  (1-92)  D6  Mono  Mono, T cell,  (19-99)  Increase ccr1  Unknown*  (122)  DC, PMN  (22-99)  Increase ccr1  Unknown*  (122)  (splice variant) (24-99)  Increase ccr1  Unknown*  (210)  (25-99)  Increase ccr1  Unknown*  (210)  (27-99)  Increase ccr1  Cathepsin G  (122)  23  Chemokine Receptors Cell Source  Target Cell  Truncations  Functional Effect  Protease  Reference  Chymase (30-99) CCL24  CCR3,  (1-93)  CCR5,  Eosinophil,  D6  Basophil  CCL25  CCR9,  (1-127)  CCXCKR  CCL26  CCR3  Mφ, T cell  T cell,  Elastase  (122)  ND  DC  T cell  ND  Mφ  Eosinophil,  ((2-9)-77)  (1-77)  Increase ccr1  Receptor antagoinst  (211)  Basophil  CCL27  CCR10,  (1-88)  CCR3  CCL28  CCR10,  (1-101)  CCR3  Epithelial  T cell  ND  Epithelial  T cell,  ND  Eosinophil  CXCL CX3CL1  CX3CR1,  (1-316)  DARC  Endothelial  Mono, T cell  Shedding (4-71)  *extra-cellular  ADAM10  (212-215)  MMP-2  (216)  XCL XCL1  XCR1  T cell, NK  ND  XCR1  T cell  ND  (1-93) XCL2 (1-93)  24  CXCL8 (1-77), the prodigal human neutrophil chemoattractant, is an ELR+ chemokine (with Glu at position 9) processed by MMP-8, MMP-13 (89), plasmin (217), thrombin (172), and cathepsin L (218) to the product CXCL8 (6-77) with increased chemotactic potential. The range of proteases capable of cleaving at this specific site indicate the importance of this activation, though additional activating truncation sites have also been identified including (7-77) (89), (8-77) (219) and (9-77) (217). Similarly, murine CXCL5/LIX (1-92), the orthologue of human CXCL8, is efficiently cleaved by MMP-1, 2, 8, 9 and 13 to the N-terminus truncation product (5-92) that has enhanced neutrophil chemotactic potential in vitro (89). In an air pouch model of inflammation, subcutaneous injection of LPS or mCXCL5/LIX (1-92) resulted in significantly decreased neutrophil influx in Mmp8-/- mice compared with wild-type counterparts (89). Injection of mCXCL5/LIX (5-92) into air pouches in Mmp8-/- mice resulted in equivalent cellular recruitment to that observed in the wild-type mouse (89), implicating MMP-8 in promoting cellular recruitment, and supporting previous results in which Mmp8-/- mice showed abrogated neutrophil recruitment in a skin carcinogenesis model and decreased mCXCL5/LIX processing in LPS-stimulated bronchoalveolar lavage fluid (39). The role of MMP-8 processing is an example of a positive feedback mechanism for neutrophil recruitment. A similar amplification is suggested for cathepsin G processing, and for MMP-8 and MMP-9 processing of human CXCL5 (89,164,220). CXCL12 is an ELR- chemokine with two main isoforms (α and β) that differ at the Cterminus. Carboxy-peptidase activity on CXCL12α reduces the activity of the chemokine (221), whereas N-terminus truncation by DPIV (165,222-224), elastase (180), cathepsin G (184) and MMP-1, 2, 9, 13, 14 (181) results in a loss of CXCR4 agonist activity. Moreover, the MMP-truncated product CXCL12 (5-67) gains CXCR3 binding and signaling activity (182) wherein it is a potent and specific neurotoxin (183). The first identification of a role of MMP processing of chemokines was made through a novel yeast two-hybrid screen using the MMP-2 hemopexin domain that identified the monocyte chemoattractant CCL7 as a binding protein (114). Further analysis showed that the interaction between CCL7 and MMP-2 was dependent upon the hemopexin domain, and was specific to CCL7 and not the related chemokine CCL2 (114). Additional work demonstrated specific N-termini proteolysis by MMPs of CCL2, CCL7, 25  CCL8 and CCL13 to result in products capable of binding but not activating CCR2 and CCR3, thereby transitioning to receptor antagonists (87,114,115). Moreover, in zymosan-induced murine intraperitoneal or carrageenan-stimulated rat paw inflammation models, injection of the MMP-truncated chemokines attenuated cell recruitment, demonstrating the capacity of truncated chemokines to halt the inflammatory response (114,115). Using an anti-neo-epitope antibody that recognizes the residues corresponding to the MMP-cleavage site, truncated CCL7 was identified in synovial fluid from arthritic patients, indicating that the cleavage occurs in vivo (114). However, it is evident from this finding that in chronic inflammatory disease other biological systems have overcome this apparent mechanism to inhibit cellular recruitment. In contrast to the inactivation of those CC chemokines, serine proteases elastase, chymase and cathepsin G processing of the two human N6Ckines, CCL15 and CCL23, result in multiple products with enhanced CCR1 agonist activity (122,159). N-terminally truncated CCL15 and CCL23 were both identified in synovial fluid from arthritic patients at concentrations of 10- to 100-fold that of CCL3 and CCL5 (122). Elevated levels of CCL15, wherein the full-length and truncated forms were not differentiated, have also been detected in patients with sarcoidosis (225) and melanoma (226), while CCL23 is overexpressed in acute myeloid leukemia (227). While most chemokines have an 8-10 residue N-terminus, CCL15 and CCL23 have 31 and 32 amino acids N-terminal to the conserved cysteine residues. Neither CCL15 nor CCL23 are potent chemoattractants in the full-length form (210,228) though they reportedly suppress myeloid cell differentiation (228,229). In recombinant expression systems, truncation variants were produced naturally and found to have enhanced agonist activity (210,230). In an in vitro assay, CCL15 (1-92) and CCL23 (1-99) were processed by synovial fluid from arthritic patients to the products CCL15 (25-92) and CCL23 (19-99) (122). Predicting a role for serine proteases in the processing of these chemokines, in vitro analysis was performed (122). Cathepsin G cleavage of CCL15 (192) resulted in the truncation products (24-92), (27-92) and, as with chymase, the product (29-92). Both neutrophil supernant and elastase proteolysis produced CCL15 (22-92). Cathepsin G and chymase processing of CCL23 (1-99) produced (27-99) while 26  the product of elastase cleavage was (30-99). Therefore none of the serine proteases analyzed were responsible for the cleavages observed by synovial fluid, implicating other proteases in these truncations. Yet, this was the first report of an activating truncation of CC chemokines. Moreover, the presence of truncated CCL15 and CCL23 in synovial fluid indicates that these truncated chemokines may contribute to the cellular recruitment that is observed in chronic inflammation. While the role of MMPs in chemokine regulation to attract monocytes has yet to be demonstrated, CCL15 and CCL23 are likely MMP-candidates. It is important to identify the proteases responsible for this potentially important cell recruitment mechanism. MMPs in the acute inflammatory response Following an initiating stimulus, vascular damage induces the release of lipid mediators that contribute to vasodilation, cellular recruitment and ROS production. Further, host injury results in cell necrosis and thus the release of intracellular molecules and the upregulation of extracellular matrix components that are capable of initiating an inflammatory response (231). These endogenous factors, or alarmins bind to pattern recognition receptors on the surface of stromal cells to activate multiple interconnected systems. Tissue factor (TF), exposed on the injured vessel wall, interacts with plasma factor VIIIa, leading to the activation of the coagulation cascade. MMPs processing and decreasing activity of TF pathway inhibitor promotes coagulation (232,233). Ultimately, activated thrombin converts fibrinogen to fibrin for clot formation to limit blood loss. The kallikrein-kinin system is activated by factor XIIa conversion of prekallikrein to kallikrein, a protease responsible for processing of high molecular weight kininogen to the vasoactive amine bradykinin. Bradykinin, a MMP-8 substrate (234), induces vasodilation and the production of proinflammatory cytokines and tissue-type plasminogen activator (tPA). Proinflammatory cytokines, including TNF-α and IL-1β, stimulate the release of chemoattractant cytokines, upregulate cellular adhesion molecules that mediate white blood cell rolling and attachment to the endothelial surface, and induce leukocyte activation. TNF-α activation in vivo appears to be due primarily to ADAM-17 (235), though both TNF-α and IL-1β are activated by MMPs in vitro (236,237), The fibrinolysis system is activated by tPA, kallikrein, or factor XIIa conversion of plasminogen to the fibrin-degrading enzyme plasmin, which regulates clot 27  formation. MMP-3, 7, 8, 12, 13, 14, and 17 promote fibrinolysis through cleavage of fibrin or degradation of fibrinogen (238-242). In addition, inhibition of the clotting cascade occurs through MMP degradation of factor XII (238,239). Similar, to alarmins, infectious agents express non-self molecules, including LPS, bacterial proteins and proteoglycans, collectively termed pathogen-associated molecular patterns (PAMPs). Collectively, PAMPS and alarmins are termed damage associated molecular patterns (DAMPs) (231). PAMPS activate the complement system (reviewed by (243)), which contributes to opsonization and elimination of pathogens. Additionally, plasmin, factor XII and thrombin activate components of the complement system, which in turn promotes coagulation through induction of tissue factor and plasminogen-activator inhibitor (PAI-1). Complement inhibition may occur through the MMP-14 processing of C3b (244). Alarmins are recognized by PRRs on the patrolling monocyte surface. These cells rapidly migrate into the tissue and, through production of proinflammatory cytokines including chemokines, promote the recruitment of neutrophils, which precedes the recruitment of inflammatory monocytes. Neutrophil recruitment in inflammation is rapid, occurring within hours and lasting for up to 24 hours. This responsiveness is due in part to presence of neutrophil chemoattractants as pre-stored proteins, or those enzymatically activated rather than requiring de novo synthesis (15). The predominant neutrophil-attracting chemokines CXCL5 and CXCL8 are enzymatically activated by MMP-8, 9, 12 (87,89,220) (Table 1.1), and bind to CXCR1 and CXCR2 on the neutrophil surface (Fig 1.2). Additionally, the MMP-8 cleavage of type I collagen produces the neutrophil chemoattractant peptide Pro-Gly-Pro (245). Cell migration is also enhanced through MMP-7 cleavage of E-cadherin to reduce inter-endothelial cell contacts (246). Within tissue, activated neutrophils amplify the inflammatory response through leukotriene B4 release (247) and de novo synthesis of cytokines, chemokines and growth factors (248). Neutrophils release neutrophil extracellular traps (NETs) to contain bacteria (11,249), secrete antibacterial α-defensins, produce ROS and phagocytose bacteria. MMPs contribute to bacteria removal indirectly through MMP-7 activation of α28  defensin (250,251). Neutrophils also release monocyte chemoattractants to progress the inflammatory response. Following activation, degranulation and phagocytosis, neutrophils undergo apoptosis. Through the presentation of neutrophil proteins and charge changes on the surface (252) neutrophil apoptosis is an amplifying event for the recruitment and polarization of mononuclear phagocytes (253). Inflammatory monocytes express CCR1, CCR2, CCR6, CXCR2 and CX3CR1 (Fig 1.2). Some of the ligands that bind to these receptors are produced by endothelial cells (CCL2), neutrophils (CCL3, CCL4), and by macrophages (CCL15, CCL23). Notably, the role of MMPs in activating monocyte recruitment has not been identified. The production of proinflammatory cytokines is lower in inflammatory monocytes than patrolling monocytes, but they have a higher bacterial clearance capacity. As outlined above, the differentiation of monocytes to macrophages is dependent upon cellular signals. It is likely that in infection, monocytes exposed to LPS and IFN-gamma would differentiate to M1-type macrophages, which produce IL-23, CCL5, CXCL9 and CXCL10 (19). Both CXCL9 and CXCL10 recruit Th1 cells, though MMP-8 processing of these chemokines results in receptor antagonists (154). M2b-type macrophages release pro-inflammatory mediators including TNF-α, IL-1β, IL-6 and CCL1. M2a-type cells produce IL-10, CCL2, CCL17, CCL18, CCL22 and CCL24, which may promote progression towards resolution through T-cell recruitment and M2c-type macrophage differentiation (19). M2c-type macrophages produce transforming growth factor (TGF)-β and the B-cell chemoattractant CXCL13. Macrophages function to eliminate pathogens through multiple pathways, the levels of which depend upon the subtype; pathogens are recognized by toll-like receptors on the macrophage surface, bacteria are eliminated by phagocytosis and the production of antimicrobial peptides or ROS. While leukocytes are critical to the elimination of pathogens and debris resulting from injury, an unregulated response causes host tissue damage. Oxidizing agents including superoxide and nitric oxide, as well as proteases and antimicrobial proteins are capable of damaging host tissue, which propagates the inflammatory response. As such, the termination of leukocyte recruitment is a critical step in inflammation resolution. This is achieved by a lipid-mediator class switch (254,255), inhibition of leukocyte recruitment and production of anti-inflammatory cytokines. Neutrophil interaction with platelets and 29  endothelial cells induces the production of lipoxin (254), a lipid mediator that inhibits neutrophil migration through cell arrest (256). In contrast, lipoxin induces intracellular calcium mobilization, and thus chemotaxis, of monocytes (256-258), though the type of monocyte (inflammatory or patrolling) is unknown. Neutrophil-derived resolvins inhibit neutrophil migration and stimulate anti-inflammatory pathways in monocytes and macrophages (259,260). MMP-7 cleavage of syndecan eliminates the haptotactic gradient required for cell migration (261). Cleavage of intercellular adhesion molecule-1 by MMP-13 and MMP-14 (262-264), and of β2 integrin by MMP-9 (265) would inhibit leukocyte-endothelial interactions required for leukocyte migration. The down-regulation of chemokines is achieved in part through the upregulation of decoy receptors – including CCR5 expression on apoptotic neutrophils and lymphocytes (266), and the non-signaling receptor D6 (267) thereby reducing inflammatory monocyte recruitment. In addition, proteolysis of chemokines is a critical step to modify their function, eliminating agonist activity and creating receptor antagonists to stop neutrophil and monocyte recruitment (87,114,115). CXCL1, CXCL2 and CXCL3 cleavage by MMP-9, MMP-12, and in the case of CXCL2 also by MMP-1, eliminate receptor activation and chemotactic potential toward neutrophils, suggesting a negative feedback mechanism (87). Processing of the monocyte chemoattractants CCL2, CCL7, CCL8 and CCL13 by MMPs results in receptor antagonists, and in the case of CCL7 a product that reverses the inflammatory response in vivo (114,115). So far there is very little evidence for any proteolytic regulation of chemokine receptors, however this is difficult to study and so it is possible that this is yet another level of regulation. Annexin A1, released from neutrophil granules, promotes neutrophil apoptosis and, along with complement C1q and thrombospondin, promotes phagocytosis by macrophages (268-270). C1q binding protein is cleaved by MMP-14 (244) as is mannose binding lectin, which is also involved in complement activation (271) and therefore cleavage may inhibit this activity. Macrophage phagocytosis of neutrophils reduces TNF-α, IL-1β and CXCL8 production while upregulating the anti-inflammatory cytokine TGF-β1 (272-274). Further MMP-1, 2, 3, and 9 process and inactivate IL-1β (275) while TGF-β1 is activated in vitro by MMP-2, 3, 9 and 14 (276-278). 30  TGF-β1 induces fibroblast differentiation and the production of matrix components while down-regulating several MMPs, with the exception of MMP-2, which has been proposed to remove misfolded collagen (279,280). Moreover, MMP-2 cleavage and inactivation of CCL chemokines to generate receptor antagonists down regulates monocyte recruitment (114,115). A provisional, fibronectin-rich matrix (281) is formed for the temporary adhesion of cells and initiation of angiogenesis. This is replaced by a collagen-rich matrix initially composed of type I collagen and ultimately a more permanent and durable collagen such as type III (279,282). Macrophage phagocytosis of neutrophils results in the secretion of VEGF (283) and MMP cleavage of CTGF and HARP, mobilizes VEGF, thus promoting angiogenic activity (65,116,284). As such, resolution of inflammation and wound healing begin.  Theme and Hypotheses The broad focus of the research presented herein is the role of MMPs in regulating inflammation. Specifically, I am interested in the events that occur after neutrophils are recruited, predominantly the role of the neutrophil-specific protease MMP-25/MT6-MMP, and the recruitment of inflammatory monocytes. At the time that this thesis research began, there was minimal information regarding substrates of MT6-MMP and thus little indication as to the functions of this enzyme. The following themes and hypotheses are addressed in this thesis. i) In Chapter 2, I hypothesize that monocyte chemoattractants are MMP substrates, and that processing of these alters the inflammatory process. Therefore, I performed a family-wide screen of MMP-proteolysis of the 14 CC chemokines involved in monocyte recruitment. I found that all of the chemokines were processed by one or more MMPs. Furthermore, MMP-processing of CCL16 increased the glycosaminoglycan binding of the protein whereas a comprehensive analysis of the two N6C chemokines CCL15 and CCL23 revealed that processing by MMPs resulted in more potent receptor agonists. ii) In Chapter 3, I hypothesize that MT6-MMP substrates would include extracellular matrix proteins, chemokines and proteins secreted from fibroblasts. I expressed and purified a soluble form of MT6-MMP to evaluate the in vitro processing of potential 31  substrates. Additionally, I applied a proteomics approach to identify novel substrates of MT6-MMP amongst the secreted proteins (secretome) of human fetal lung fibroblasts, identifying cystatin C, SPARC, galectin-1, insulin-like growth factor binding protein-7 and vimentin as substrates. Further, I identified vimentin as a chemotactic factor for THP-1 cells, a function that is terminated by MMP cleavage. These studies confirmed 19 substrates of MT6-MMP, and identified an additional 50 candidate substrates. iii) In their recruitment to sites of inflammation and in situ, neutrophils interact with the endothelial layer and tissue. Thus, in Chapter 4 I hypothesize that both fibroblasts and endothelial cells produce proteins that are substrates of neutrophil MT6-MMP. To evaluate this, I grew human fetal lung fibroblast cells and human microvascular endothelial cells in the presence of active or catalytically inactive soluble MT6-MMP. I then performed proteomic analyses on both the conditioned media and membraneenriched protein fractions from these cells to identify novel substrates of MT6-MMP. Candidate substrates include prosaposin, progranulin, cluster of differentiation 59 and endoplasmic reticulum-golgi intermediate compartment (ERGIC)-53. This research has advanced our knowledge of the function and mechanisms by which MMPs contribute to the progression of the acute inflammatory response towards wound healing, and how an overactive response could transition to chronic inflammation.  32  CHAPTER 2: MATRIX METALLOPROTEINASE PROCESSING OF MONOCYTE CHEMOATTRACTANTS: CCL15 AND CCL23 ARE ACTIVATED WHEREAS CCL16 CLEAVAGE INCREASES GLYCOSAMINOGLYCAN BINDING Synopsis Chemokines are structurally related chemoattractant cytokines that orchestrate leukocyte migration and activation in inflammation upon binding to G-protein coupled receptors. The matrix metalloproteinases (MMPs) are an important family of proteases responsible for maintaining the homeostatic signaling and extracellular matrix environment of connective tissue cells in health and inflammation. We have reported that MMP processing can activate or inactivate chemokines, generate antagonist forms, switch receptor specificity or alter glycosaminoglycan binding, and thus modulate chemokine roles in cellular recruitment. Here, we performed a family-wide investigation of MMP processing of all monocyte-directed CC chemokines. All 14 chemokines are cleaved by one or more MMPs. We identified and sequenced 149 MMP cleavage sites, 28 of which are novel, including the first reported instance of CCL1, CCL16 and CCL17 proteolysis. MMP processing of the 97 amino acid residue CCL16 (1-97) generates two products: CCL16 (8-77) and CCL16 (8-85) that exhibit enhanced glycosaminoglycan binding in vitro. CCL23 (1-99) and the related CCL15 (1-92) are unusual chemokines with 31 and 32 amino acid residue extended amino (N)-termini from the characteristic Cys-Cys motif. Both CCL23 and CCL15 were cleaved by MMPs at 8 and 5 sites respectively within these extensions. The most prominent product of CCL23 processing by MMPs, CCL23 (26-99), exhibited increased agonist activity compared with the fulllength counterparts in calcium flux and Transwell migration assays using THP-1 cells and CCR1 receptor transfectants. MMPs process CCL15 (1-92) to CCL15 (25-92) and CCL15 (28-92). While CCL15 (25-92) has been previously identified ex vivo, the corresponding protease could not be identified. Here, the processing of CCL15 by proteases in synovial fluid was confirmed to occur by both MMPs and serine proteases. The generation of CCL25 (25-92) by proteases in synovial fluid indicates that this truncated form may be involved in the pathogenesis of chronic inflammatory diseases. This reveals for the first time that MMPs activate CCL15 and CCL23, which are responsible for monocyte recruitment during an inflammatory response.  33  Introduction Infection or injury initiates a cascade of tightly regulated events that culminate in an inflammatory response. Resident cells, including macrophages, produce mediators that are involved in the recruitment of leukocytes from the circulation into the affected tissue. Within hours, neutrophils are recruited and then subside by 24 to 48 h when inflammatory monocytes are recruited. These latter cells differentiate into macrophages and persist in the tissue until inflammation is resolved. Recruited cells are involved in resolution and repair in part through production of cytokines, free radicals and by phagocytosis. Yet, continual recruitment and activation of leukocytes results in host tissue damage as observed in chronic inflammatory diseases such as rheumatoid arthritis. Thus, regulation of cellular recruitment and termination of this intercellular signaling is critical to control the inflammatory response. Chemokines are an important superfamily of chemoattractant cytokines that mediate directional leukocyte migration in innate and acquired host defense responses. Through interaction of residues in the chemokine carboxy (C)-termini α-helix with negatively charged glycosaminoglycans (GAGs), chemokines form a haptotactic gradient (129,130). The concentration of chemokine in tissue and on the endothelial surface, produced by local cells following stimulation by damage or pathogen associated molecular patterns, promotes the recruitment of leukocytes to an inflammatory site. There are four subfamilies of chemokines based upon the proximity of the conserved amino-terminal cysteine residues, the largest being the CXC and CC subfamilies. Chemokines exert activity by binding to receptors on leukocyte surfaces; CXC chemokines bind to CXC receptors (CXCRs) whereas CC chemokines bind CCRs. The predominant CXCRs, namely CXCR1 and CXCR2, are expressed by neutrophils whereas monocytes express CCR1, CCR2, CCR3, CCR5 and CCR8 (141,142). The flexible amino (N)-terminus of a chemokine is involved in binding and activating its cognate receptor (136,137). Receptor activation causes intracellular signaling, including calcium mobilization, resulting in cell activation that is characterized by cell migration, gene transcription, relocation of receptors to the cell membrane, and the release of further inflammatory mediators.  34  Post-translational modifications of both the N- and C-termini of chemokines by proteolytic processing is a versatile mechanism of regulation; trimming chemokines into stronger agonists for recruitment of appropriate cells, into antagonists to terminate intercellular signaling events, or alternatively modifying the GAG binding domain to prevent haptotactic gradient formation (87,89,115,122,154,181,285). A number of chemokines are processed in vitro by proteases, and in particular by matrix metalloproteases (MMPs) (87,89,115,154,181). MMPs are an important family of extracellular endopeptidases that are upregulated in stromal cells and leukocytes following cell stimulation, and are associated with chronic inflammatory diseases. For example, fibroblasts express MMP-1, -2, -3, -7, -9, -13 and -14 but MMP-8 and MMP-12 are only expressed by neutrophils and macrophages, respectively, though these latter cells express other MMPs including MMP-9. The activity of MMPs is regulated in vivo by tissue inhibitors of metalloproteinases (TIMPs) and therapeutically by hydroxymate inhibitors including Marimastat (286). MMPs degrade multiple components of the extracellular matrix and thus were thought to enable cell migration in inflammation by creating passages through the basement membrane and extracellular matrix. Due in part to work in our laboratory, it is now recognized that MMPs process bioactive molecules, including chemokines, to regulate intercellular signaling in innate immunity. Neutrophil chemoattractants CXCL8 and CXCL5 are processed by MMPs to become potent receptor agonists, a critical step for neutrophil recruitment (89,161). In contrast, all seven neutrophil CXCL agonists are inactivated by macrophage-derived MMP-12, terminating the recruitment of neutrophils (87). Proteolytic processing of CCL7 by MMP-2 removes the first 4 N-terminus residues; this truncation results in a strong receptor antagonist that is capable of reversing inflammatory responses in vivo (114). Although we have found that MMPs generate potent CCR1, CCR2 and CCR5 receptor antagonists by cleaving CCL2, 7, 8 and 13, roles for MMPs in promoting monocyte recruitment are yet to be determined. Given the critical role of macrophages in progression and resolution of the inflammatory response, understanding the recruitment of progenitor monocyte cells is essential. Herein, we evaluate MMP-processing of all 14 CC chemokines that are involved in monocyte recruitment. We report that MMP processing, and specifically MMP-12 proteolysis, of CCL16, CCL15 and CCL23 results in increased GAG binding and receptor activation, 35  and thus identify a role for MMPs in promoting monocyte recruitment. Further, these results implicate feed-forward mechanisms whereby macrophages and synovial fluid proteases promote the recruitment of monocytes, potentiating the transition of inflammation to a chronic response.  Materials and Methods Proteinases and chemokines: Recombinant human MMP-1, -2, -3, -8, -9, -12, -13, and soluble MMP-14 were expressed and purified using standard techniques (287); MMP-7 was purchased from U. S. Biochemical Corporation. All full-length chemokines were chemically synthesized using t-Boc solid phase chemistry, purified by high-performance liquid chromatography and validated for activity as previously described (288). A 19-mer peptide corresponding to CCL23 (5-23) was chemically synthesized (Sigma). CCL15 (25-92, 28-92), CCL16 (8-77, 8-85) and CCL23 (26-99) utilized for in vitro experiments were the fully truncated products of MMP-12 cleavage of full-length counterparts; these preparations lack full-length chemokine as detected by matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry (MS). Controls for functional assays, namely full-length chemokine and MMP-12 alone, were prepared at the same time.  Cells: Human CCR1-transfected B300-19 (PreB) cells were kindly provided by Dr B. Moser (Bern, Switzerland) and cultured in RPMI 1640 supplemented with 10% fetal bovine serum, 2 mM glutamine, 50 µM β-mercaptoethanol, and 1.5 µg/ml puromycin. The monocytic cell line of human THP-1 cells (ATCC) were grown in RPMI 1640 supplemented with 10% fetal bovine serum. Human peripheral neutrophils and monocytes were isolated from healthy volunteers as approved by the University of British Columbia Clinical Ethics Review Board (Appendix C). Peripheral blood was drawn into ACD-treated vaccutainers and layered on 6% Dextran/0.9% NaCl solution; the leukocyte-containing plasma was pelleted and leukocytes layered over Histopaque 1077 (Sigma) and monocytes or neutrophils were isolated as per the manufacturer’s protocol, resuspending in Hank’s balanced salt solution supplemented with 0.1% BSA, or appropriate buffer for analysis. Cells were greater than 95% viable and pure as determined by trypan blue or Wright’s-Giemsa staining of cytospins, respectively. E. coli 36  K12MG1655 and S. aureus RN4220, were kindly provided by Dr J. Davies (University of British Columbia, Canada).  Chemokine cleavage assays: The proenzymes MMP-1, -2, -8, -9, -13 and -14 were activated by incubation with 1 mM p-aminophenylmercuric acetate (APMA) for 45 min at 37°C. MMP-7 and -12 lacked a prodomain and so did not require chemical activation. MMP-3 was activated by incubation with 0.25 µM chymotrypsin for 30 min at 37°C, and then the chymotrypsin activity inhibited by addition of 1 mM phenylmethylsulfonyl fluoride (PMSF); all experiments with MMP-3 included a chymotrypsin/PMSF only control. The concentration of active MMPs was determined by active-site titration against TIMP-1 or TIMP-2 in a quenched fluorescence (QF) synthetic peptide cleavage assay with QF 24. In vitro chemokine cleavage assays with recombinant MMPs were performed in 50 mM Tris, 200 mM NaCl, 5 mM CaCl2, pH 7.4 for 16 h at 37°C. Initially, an enzyme to substrate molar ratio of 1:10 was assessed to screen for cleavage activity, followed by lower enzyme concentrations to confirm biological relevance. Cleavage assay products were analyzed, as previously described (289), by MALDI-TOF MS on a Voyager-DE STR (Applied Biosystems) or a 4700 (Applied Biosystems) using the matrices sinapic acid or α-cyano-4-hydroxycinnamic acid, respectively, and confirmed by silver-staining following 15% Tris-Tricine SDS-PAGE. Chemokine cleavage was defined to be positive when the mass spectrometry spectra showed a cleavage product with greater than 20% intensity of the full-length chemokine. For kinetic analysis gels were stained with Coomassie Brilliant Blue R-250 and bands were quantified by densitometry using Alpha-imager software. Glycosaminoglycan binding: HiTrapTM cation exchange Sepharose or heparinSepharose (GE healthcare) 1 ml columns were washed and equilibrated before manual loading of 25 µg of chemokine diluted to 1 ml in 10 mM potassium phosphate, pH 7.5. Using an Akta Purifier (Amersham), columns were washed with 10 column volumes of 10 mM potassium phosphate and then a linear gradient was applied from 0 to 1.5 M NaCl over 30 min at a flow rate of 1 ml/min and monitored by in-line absorbance at 215 nm. Ascii files were imported into Prism (GraphPad) and normalized against baseline. The effects of soluble GAGs, namely heparan sulfate and chondroitin sulfate A, B, and 37  C (Seikagaku), on the in vitro cleavage of CCL15 by MMP-12 was assessed with a chemokine to GAG ratio of 1:5 (w/w) at an enzyme to substrate ratio of 1:25 (w/w). Calcium mobilization: THP-1 or CCR1-transfected B300-19 cells resuspended at 1 x 107 cells/ml in RPMI 1640 media supplemented with 1% fetal calf serum were loaded with 2 µM Fluo-4-acetoxymethyl ester (Fluo-4, Molecular Probes) for 30 min at 37 ºC, 5% CO2. To remove unincorporated Fluor-4, cells were washed three times with assay buffer (Ca2+/Mg2+-free Hank’s balanced salt solution (HBSS; Invitrogen), 20 mM HEPES, 2.5 mM probenecid (Sigma), 0.1% bovine serum albumin (BSA)) and resuspended at 1 x 106 cells/ml in fresh assay buffer. Assays were performed on 6.5 x 105 cells in 800 µl cuvettes on an LS50B spectrofluorimeter (Perkin Elmer) in timedrive mode with excitation and emission at 494 and 515 nm, respectively. Cells were allowed to equilibrate for 3 min at 37 ºC before the addition of ligand. Calibration was made by addition of 5 µM ionomycin (Sigma) followed by 1 mM MnCl2 (FisherBiotech) to determine Fmax and Fmin, respectively. Absolute Ca2+ was calculated as Kd x [(FFmin)/(Fmax-F)] where the Kd of Fluo-4 is 345 nM (Molecular Probes). Experiments were carried out in duplicate and repeated a minimum of three times. Transwell migration: THP-1 and CCR1-transfected cells were washed and resuspended at 1 x 106 cells/ml in RPMI 1640 media supplemented 0.1% or 1.0% BSA, respectively. Chemokine, or MMP and buffer controls, diluted in the same media in the lower chamber were separated from 2 x 105 cells/ml in the upper chamber of a 96-well Boyden chamber (Neuroprobe) by a 5 µM pore filter. Assays performed at 37 ºC, 5% CO2 were 90 min for THP-1 and 3 h for CCR1-transfected cells. Non-migrating cells were aspirated and the upper chamber washed with 2 mM EDTA. The contents of the lower chamber was transferred to a Maxisorb 96-well plate and frozen at -80 ºC for a minimum of 2 h. DNA content was determined by addition of CyQuant reagent (Invitrogen) to the thawed lysate and fluorescence evaluated by excitation/emission at 485/538 nm. The chemotactic index was calculated by the ratio of the relative fluorescence of samples from cells migrating in response to chemokine compared with the media control. Experiments were carried out in quadruplicate and repeated a minimum of three times. Statistical significance of cleaved versus full-length chemokines were evaluated by 2-way ANOVA and Bonferroni post-tests in Prism. 38  Neutrophil activation: Isolated neutrophils resuspended at 106 cell/ml were stimulated with 1 to 1000 nM CCL23 (5-23), 0.5% Triton or PBS for times ranging from 0 to 45 min in a 0.35 ml volume. At each time point, 150 µl of cell-free supernatant was assayed for myeloperoxidase (MPO) activity by the addition of the MPO substrate o-dianisidine (Sigma) in the presence of 1% hydrogen peroxide. Colorimetric change was evaluated at 405 nm. Generation of reactive oxygen species: The measurement of reactive oxygen species (ROS) was performed with modification of the method described by Wang and Joseph (290). Briefly, THP-1 cells were resuspended at 106 cell/ml in complete HBSS (Invitrogen). Cells were treated with 10 to 1000 nM of each ligand, or 1 mM hydrogen peroxide as a positive control, in the presence of 0.1 mM 2,7-dichlorofluorescein diacetate. ROS production was measured kinetically at an excitation/emission of 485/520 nm using a Polarstar Optima 96-well fluorimeter (BMG). Antimicrobial activity assays: The antimicrobial activity of chemokines and the peptide CCL23 (5-23) against E. coli and S. aureus were evaluated by three methods - zone of inhibition, colony forming unit production, and microtitre assay. For the zone of inhibition assay, bacteria in logarithmic growth stage were plated in a soft agar overlaid onto LB plates. Ligands, including kanamycin or buffer as a positive and negative controls, were applied to sterile paper discs (Avantec) and then placed onto the soft agar prior to overnight growth. A lack of growth in the area around the paper disc indicates antimicrobial activity. The colony forming unit assay was performed as described previously (144). Briefly, bacteria in logarithmic growth were grown in liquid culture in the presence of ligands for 2 h. Serially dilutions were then plated on LB plates for overnight growth and the number of colonies were counted. As a modification to this, aliquots of liquid culture were diluted in a microtitre plate and growth inhibition was measured by optical density at 595 nm. Chemokine cleavage in synovial fluid: Cleavage of 2.5 µg of CCL15 (1-92) in 0.25 µg of synovial fluid pooled from eight rheumatoid arthritis patients was performed at 37 ºC for 16 h in cleavage assay buffer in the absence or presence of 1 mM PMSF (general serine proteinase inhibitor), 10 µM Marimastat (general metalloproteinase inhibitor), 100 39  µM TIMP-1 (inhibitor of specific metalloproteinases), 100 µM TIMP-2 (inhibititor of specific metalloproteinases), 10 µM E64 (cysteine protease inhibitor), 10 µM pepstatin (aspartyl protease inhibitor) and 100 µM leupeptin (inhibitor of specific serine and cysteine proteases) either alone or in combination. Cleavage of CCL15 was assessed by MALDI-TOF mass spectrometry and 15% Tris-Tricine SDS-PAGE, as detailed above. Results All monocytic responsive CC ligands are processed by MMPs To evaluate the MMPprocessing capacity of all monocyte chemoattractants in the CC subfamily of chemokines, recombinant MMP-1, -2, -3, -7, -8, -9, -12, -13, and -14 were incubated for 16 h at 37°C with CCR1, 3, 5 and 8 ligands at a 1:10 molar ratio. All chemokines evaluated were cleaved by one or more MMPs (Table 2.1) to result in a product of greater then 20% signal intensity of the full-length chemokine by MALDI-TOF. Of the 149 cleavage sites identified in the 14 chemokines, 32 are novel MMP cleavage sites, and 28 of these are novel truncations wherein the cleavage results in a new N- or Ctermini of the chemokine. The broadest specificities observed are for MMP-7 and -12, which processed 14 and 13 chemokines, respectively. Unlike the other MMPs used in this study, MMP-7 and -12 lack a hemopexin domain, indicating that the hemopexin domain may define the substrate specificity of MMPs and thus restrict their activity. The processing of CCL2, 7, 8 and 13 by MMP-7 contradicts the relative absence of activity of MMP7 we previously reported (115) due to improved procedures for preparing and storing active MMP-7.  40  Table 2.1 MMP-truncation products of CC chemokines Truncation products following MMP cleavage were deconvoluted from MALDI-TOF mass spectra. The residue numbers are shown in brackets. Sites in black represent novel truncation sites; grey numbers represent truncations previously identified. NC indicates that the full-length chemokine was not cleaved by that MMP. ND indicates that the cleavage site could not be determined MMP Chemokine CCL1 (1-73)  1  2  3  7  8  9  12  13  14  NC  NC  (8-73)  NC  NC  (7-73)  (6-73)  NC  CCL2 (1-76)  (5-76)  NC  (5-76)  (5-76)  (5-76)  (5-76)  (5-76)  NC  CCL3 (1-70)  (1-47)  NC  NC  ND  (1-47)  NC  CCL4 (1-69)  (16-62)  (6-44)  CCL5 (1-69) CCL7 (1-76)  NC (5-76)  (6-44) (7-69) NC (5-76)  (7-73) (7-70) (5-67) (5-76) (9-63) (1-47) (1-61) (6-69) (1-65) (7-76) (5-76)  CCL8 (1-76)  (1-73) (5-73)  (1-73)  (5-76)  CCL11 (1-74) CCL13 (1-75)  NC (5-72)  (10-74) (5-75)  NC (4-75) (5-75)  (6-44) (7-69) NC (9-76) (7-76) (5-76) (6-76) (5-73) (1-73) NC (4-75)  CCL14 (1-74)  NC  NC  NC  CCL15 (1-92)  (25-92)  CCL16 (1-97)  (8-85)  CCL17 (1-71) CCL23 (1-99)  NC (11-99) (17-99) (23-99) (26-99) (28-99) (30-99)  NC (5-76)  (16-64) (16-64) (7-69)  (14-61)  (7-69)  NC  NC NC  NC (5-76)  NC (5-76)  (5-69) (5-76)  (1-73) (5-73)  (1-73) (5-73)  NC  (1-73)  (10-74) (6-75) (4-75) (5-72) (1-70) (1-66)  NC (5-72)  NC (5-72)  (7-76) (1-73) (5-73) (10-74) (5-72)  NC  NC  NC (5-72)  (1-71) NC NC (4-72) (7-74) (14-92) (17-92) (17-88) (25-92) (25-92) (25-92) (25-92) (14-92) (25-92) (25-92) (17-92) (28-92) (28-92) (28-92) (27-92) (27-92) (27-92) (28-92) (25-92) (28-92) (28-92) (5-97) (8-85) (8-85) (8-85) (8-85) (5-97) (8-85) (5-97) (8-77) (8-77) (8-85) (8-77) (8-85) (8-77) NC NC (4-69) (9-71) NC (4-69) (4-71) NC (11-99) (11-99) (11-99) (11-99) (11-99) (11-99) (28-99) (14-99) (17-99) (21-99) (17-99) (17-99) (28-99) (17-99) (1-90) (30-99) (26-99) (26-99) (23-99) (26-99) (23-99) (28-99) (1-90) (26-99) (26-99) (1-90)  41  CCL15, CCL16 and CCL23 are most susceptible to processing, being cleaved by all of the MMPs evaluated. Conversely, processing of CCL5 and CCL14 is limited to MMP-7 plus MMP-13 or MMP-12, respectively. Proteolysis of CCL1, CCL16 and CCL17 had not been observed previously. This is the first identification of both N and C-termini proteolysis sites in CCL3. The truncation by MMP-8 to CCL3 (16-64) is likely the processing recently observed in vivo (291). The removal of the 5 to 8 N-terminus residues from CCL4 has been shown to alter dimeric properties (191) whereas the truncation product CCL4 (14-61) is reported to lack activity (292). The CCL5 (5-69) product produced by MMP-13 activity is most likely to lose the chemokine activity similar to the CCL5 (3-69) and (4-69) products previously evaluated (194,195). A novel Nterminus truncation resulting in CCL11 (10-74) is observed following processing by MMP-2, -7 and -12. Unlike previously identified CCL11 truncations of 2 or 3 residues, which do not alter the chemoattractive potential (200), this MMP-processing occurs between the two conserved cysteine residues at PTTC9 ↓10CFNL, so likely inactivates the chemokine. The MMP-processing of CCL14 to CCL14 (7-74) product was previously shown to alter calcium mobilization (203), but C-terminal truncations of the chemokine have not previously been identified. Selective processing of CCL16 by MMPs: CCL16 (1-97) is processed by MMPs at both the N and C-termini (Fig 2.1). This is the first identification of CCL16 (1-97) proteolysis. A CCL16 (5-97) product was observed by MMP-2, -8 and 14, and CCL16 (8-85) or (877) were observed by all MMPs tested (Fig 2.2). By silver-stained gel the activity of MMP-1 appears minimal (Fig 2.1A), though a CCL16 (8-85) product was observed on MALDI-TOF mass spectrometry (Fig 2.1B). Conversely, MMP-14 appears to degrade CCL16 (1-97), yet both the CCL16 (5-97) and (8-85) products represent > 20% intensity in the mass spectra (results not shown). MMP-12 processing of CCL16 (1-97) at a 1:10 molar ratio results in complete truncation to two products that are evident by MALDITOF (Fig 2.1D); this preparation was used for in vitro functional assays.  42  Figure 2.1 All MMPs evaluated processed CCL16. Human CCL16 (1-97) was incubated with recombinant MMP-1, -2, -3, -7, -8, -9, -12, 13, and -14 at 1:10 molar ratios at 37 ºC for 16 h. A) Cleavage assay products were visualized on silver-stained 15% Tris-Tricine gels. (B) Cleavage products were assigned by MALDI-TOF mass spectrometry by comparison of measured with predicted mass to charge ratios (m/z) with +1 charge ionization ([M + H]+). (C) Cleavage sites observed by each MMP are indicated on the CCL16 sequence. (D) Mass spectra of cleavage assay products of CCL16 in the absence (left) or presence (right) of MMP-12, showing that the predominant truncated forms CCL16 (8-77) and (8-85) are both present in the form used for functional assays.  43  44  Heparin binding affinity of CCL16 is increased by MMP-processing Given the role of chemokine C-termini in GAG binding, we hypothesized that cleavage of the C-terminus of CCL16 (1-97) would alter GAG binding of the MMP-truncated chemokine compared with the full-length counterpart. The binding of MMP-12-processed chemokine CCL16 (8-77, 8-85) compared with uncleaved CCL16 (1-97) was characterized using heparinSepharose chromatography (Fig 2.2A). The truncated CCL16 has greater affinity for heparin-Sepharose than full-length chemokine, eluting at 0.71 M versus 0.52 M NaCl, respectively. To control for charge effects, an equivalent experiment was performed with a strong cation exchange Sepharose column (Fig 2.2B). CCL16 (1-97) eluted at 0.51 M NaCl whereas CCL16 (8-77, 8-85) eluted at 0.56 M NaCl. The effect on the strong cation exchange column was not as marked as the heparin column suggesting that the interaction of specific amino acid residues or their spatial arrangement and not charge alone, is responsible for the increased GAG binding. Since the MMP-processed form of CCL16 includes both N- and C-termini truncations, the effect of each terminus on GAGbinding could not be determined. Processing of CCL16 by MMP-12 was not inhibited by the presence of soluble GAGs (Fig 2.2C), as was previously observed for CXCL11 (154), indicating that cleavage could occur to both soluble and GAG-bound full-length chemokine in vivo. Selective processing of CCL15 by MMPs: CCL15 (1-92) is processed by all MMPs tested at the N-terminus (Fig 2.3) and by high concentrations of MMP-7 at the Cterminus. All MMPs processed CCL15 (1-92) to CCL15 (25-92), a product previously observed from recombinant production in insect cells (230). By silver-stained gel the activity of MMP-9 appears minimal (Fig 2.3B), though both CCL15 (25-92) and CCL15 (28-92) cleavage products are observed on MALDI-TOF mass spectrometry (Fig 2.3A). MMP-12 processing of CCL15 (1-92) at a 1:25 mole ratio results in complete truncation to two products that are evident by MALDI-TOF (Fig 2.3C); this heterogeneous preparation was used for in vitro functional assays. Kinetics analysis of CCL15 processing: We incubated each of the MMPs with CCL15 at increasing molar ratios to compare the efficiency of processing (Fig 2.4). Using the equation kcat/Km = (ln2)/(E)(t1/2), we applied densitometry to Coomassie Brilliant Blue 45  Figure 2.2 Heparin binding is enhanced upon CCL16 processing. Elution profiles of CCL16 (1-97) and MMP-cleaved CCL16 (8-77, 8-85) from (A) heparin-Sepharose column or (B) strong cation exchange column. The absorbance at 215 nM was measured during a 30 mL gradient that reached 1.5 M NaCl. (C) CCL16 (197) was incubated with recombinant MMP-12 at 1:10 molar ratios in the presence of heparan sulfate (HS), chondrotin sulphate (CS)A, CSB or CSC in 5 –fold excess (w/w) at 37 ºC for 16 h. Cleavage assay products were visualized on silver-stained 15% TrisTricine gels. (D) Transwell migration of THP-1 cells for 90 min towards full-length or truncated chemokine through a 5 µm pore-sized filter. Migrated cells were quantified by CyQUANT assay and displayed as chemotactic index, defined as the ratio of cells migrating in response to stimulus compared with buffer control. Results shown are the mean +/- SEM of 2 biological replicates of experiments completed in quadruplicate.  46  47  Figure 2.3 All MMPs evaluated processed CCL15 at one or more sites. Human CCL15 (1-92) was incubated with recombinant MMP-1, -2, -3, -7, -8, -9, -12, 13, and -14 for 16 h at a 1:10 molar ratios at 37 ºC. (A) Cleavage products were assigned by MALDI-TOF mass spectrometry by comparison of measured with predicted mass to charge ratios (m/z) with +1 charge ionization ([M + H]+). Corresponding sequences are shown. (B) Cleavage assay products were visualized on silver-stained 15% Tris-Tricine gels. (C) Mass spectra of cleavage assay products of CCL15 in the absence (left) or presence (right) of MMP-12, showing that the predominant truncated forms CCL15 (25-92) and (28-92) are both present in the form used for functional assays. 48  Figure 2.4 Kinetics of CCL15 processing by MMPs. CCL15 (1-92) was incubated with increasing concentrations of recombinant MMP-1, -2, -3, -7, -8, -9, -12, -13, and -14 for 16 h at a 1:10 molar ratios at 37ºC. (A) Cleavage assay products were visualized on Coomassie Brilliant Blue R-250 stained 15% TrisTricine gels. (B) kcat/Km was determined by densitometry of gels.  49  50  stained SDS-PAGE gels to analyze the kinetics of cleavage of CCL15 by all MMPs (Fig 2.4). MMP-12 most efficiently processed CCL15, with a rate of 3,000 M-1s-1; this is > 100-fold faster than the least efficient CCL15 processing MMP, namely MMP-1. Interestingly, 2 of the most efficient MMPs with the fastest rates were leukocyte-specific MMPs, MMP-12 and MMP-8. Selective processing of CCL23 by MMPs: CCL23 (1-97) is processed by all MMPs assessed at the N-terminus, and at the C-terminus by MMP-3, -7, and -13 (Fig 2.5). The detection of CCL23 (26-99) and the counterpart CCL23 (1-25) by MALDI-TOF mass spectrometry following MMP-1, -2, -3, -7, -8, and -12 cleavage (Fig 2.5A) suggests that although multiple cleavages can occur within the first 25 residues of CCL23 (1-99), CCL23 (26-99) is the predominant product. Similarly, both fragments resulting from cleavage of CCL23 (1-99) by MMP-14 were observed, namely CCL23 (1-29) and CCL23 (30-99). CCL23 (30-99) was previously reported to result from elastase processing of CCL23 (1-99) (122). From densitometry of gels shown in Fig 2.5C, MMP12 processing of CCL23 (1-99) was deduced to occur at 95 M-1s-1, which is comparable to MMP-processing of other chemokines (154). The preparation used for in vitro functional assays lacks full-length chemokine and is solely CCL23 (26-99), as shown MALDI-TOF MS (Fig 2.5D). Calcium mobilization in CCR1 transfected B300-19 and THP-1 cells in response to MMP-processed CCL15 and CCL23: MMP-truncated chemokines were tested for activity with human CCR1-transfected B300-19 cells. At a concentration of 10 nM chemokine, there was a significant increase in the activity of CCL15 (25-92, 28-92) and CCL23 (26-99) compared with the full-length counterparts (Fig 2.6A). Similar results were obtained with THP-1 cells (Fig 2.6B). MMP-processed chemokines caused a dose-dependent increase in THP-1 cell intracellular calcium mobilization whereas the response of CCL15 (1-92) and CCL23 (1-99) were elevated only at the highest concentration evaluated (Fig 2.6C). A calcium mobilization response was not observed following stimulation with the 19-mer peptide that corresponds to CCL23 (5-23), cleavage assay buffer, or MMP-12 (results not shown).  51  Figure 2.5 All MMPs evaluated processed CCL23 at one or more sites. Human CCL23 (1-99) was incubated with recombinant MMP-1, -2, -3, -7, -8, -9, -12, 13, and -14 for 16 h at a 1:10 molar ratios at 37ºC. (A) Cleavage products were assigned by MALDI-TOF mass spectrometry by comparison of measured with predicted mass to charge ratios (m/z) with +1 charge ionization ([M + H]+). Corresponding sequences are shown. (B) Cleavage assay products were visualized on silver-stained 15% Tris-Tricine gels. (C) Mass spectra of cleavage assay products of CCL23 in the absence (left) or presence (right) of MMP-12, showing that the predominant truncated form CCL23 (26-99) is present in the form used for functional assays.  52  53  Figure 2.6 MMP-mediated cleavages of CCL15 and CCL23 results in increased agonism in calcium mobilization assays. Representative trace of calcium flux, shown as burst in relative fluorescence units (RFU) following addition of 10 nM of full-length of MMP-truncated chemokine in (A) CCR1-transfected B300-19 and (B) THP-1 cells loaded with Fluo-4 calcium indicator reagent. (C) Calcium mobilization dose response of THP-1 cells. Calcium concentrations were calculated from relative fluorescence based on calibration with ionomycin and MnCl2.  54  Chemotactic response of CCR1 transfectants and THP-1 cells to MMP-processed CCL15 and CCL23: To confirm the calcium mobilization results, CCR-1 transfected B300-19 and THP-1 cells were evaluated for chemotaxis toward full-length and MMPtruncated CCL15 and CCL23. Both cell types had a dose dependent response, with the characteristic hyperbolic curve, to CCL15 (25-92, 28-92) and CCL23 (26-99) with minimal response to CCL15 (1-92) and CCL23 (1-99) (Fig 2.7). The response of THP-1 cells to CCL15 (25-92, 28-92) was highest at 1 nM, and showed equivalent chemotactic potential to a 10-fold higher concentration of CCL7—a prodigal monocyte chemoattractant (Fig 2.7B). The observed responses were due to chemokine since neither cleavage assay buffer nor MMP-12 controls induced chemotaxis. The 19-mer peptide corresponding to CCL23 (5-23) did not have chemotactic potential for THP-1 cells (Fig 2.8C). Selective processing by CCL23 (5-23) 19-mer peptide: CCL15 and CCL23 have a high degree of homology in the N-termini, and particularly at residues 5-23 (Fig 2.8A). While both CCL15 (1-92) and CCL23 (1-99) are processed at Ser13 ↓ Lys14 and Pro16 ↓ Leu17, only CCL23 (1-99) is processed by MMP-3 at Pro20 ↓ Val21. We evaluated the capacity of MMPs to process a peptide corresponding to CCL23 (5-23), and thus differing from CCL15 at Phe10 and Val21. All MMPs processed the peptide to result in a product of CCL23 (11-23) (Fig 2.8B), a product observed for all MMPs, except MMP-14, from the full-length CCL23 (1-99). Similarly, the product CCL23 (17-23) was observed from processing of both the full-length and peptide. Since MMPs are not exopeptidases, the finding that MMP-3 did not process CCL23 (5-23) at Pro20 - Val21 was expected. We evaluated the peptide CCL23 (5-23) for activity in antimicrobial assays, ROS production, neutrophil degranulation and monocyte maturation but were unable to identify any function. Synovial fluid processing of CCL15: CCL15 (Fig 2.9B) was added to synovial fluid pooled from arthritic patients (Fig 2.9A) to evaluate the role of MMP-processing ex vivo. Four peaks were observed following a 16 h incubation at 37 °C (Fig 2.9C). The m/z of 7,066, 7,438, 7,553, and 7,766 were deconvoluted to be CCL15 (28-92), CCL15 (2592), CCL15 (24-92) and CCL15 (22-92), respectively (Fig 2.9G). To determine the 55  Figure 2.7 Chemotactic potential of CCL15 and CCL23 is enhanced by MMPprocessing. Transwell migration of (A) CCR1-transfected B300-19 for 3 h or (B) THP-1 cells for 90 min towards full-length or truncated chemokine through a 5 µm pore-sized filter. Migrated cells were quantified by CyQUANT assay and displayed as chemotactic index, defined as the ratio of cells migrating in response to stimulus compared with buffer control. Results shown are the mean +/- SEM of 3 or more biological replicates of experiments completed in quadruplicate. Statistical analysis by two-way ANOVA with Bonferroni post-test; the level of significance comparing full-length to MMP-cleaved counterpart are *p<0.05, **p<0.01, ***p<0.001.  56  Figure 2.8 A 19-mer peptide corresponding to CCL23 (5-23) had no identifiable function. (A) Homologous regions between CCL15 and CCL23 N-termini are shown in black. A peptide corresponding to CCL23 (5-23) was synthesized, differing from CCL15 at the Leu and Val residues, indicated in bold. (B) All MMPs cleaved CCL23 (5-23) as indicated, following deconvolution by MALDI-TOF. (C) Transwell migration of THP-1 cells for 90 min towards CCL23 (5-23) alone or in combination with 10 nM CCL7 through a 5 µm pore-sized filter. Migrated cells were quantified by CyQUANT assay and displayed as chemotactic index, defined as the ratio of cells migrating in response to stimulus compared with buffer control.  57  Figure 2.9 Synovial fluid MMP and serine proteases cleave CCL15. Synovial fluid (SF) from eight rheumatoid arthritis patients were pooled and 25 µg were incubated with 2.5 µg CCL15 in the absence or presence of inhibitors for 16 h at 37°C. Mass spectra of C18 ZipTip prepared samples after 16 h incubation of (A) SF, (B) CCL15 (1-92), (C) SF+CCL15, (D) SF+CCL15+marimastat (E) SF+CCL15+PMSF, and (F) SF+CCL15+marimastat+PMSF. (G) Cleavage products were assigned by MALDITOF mass by comparison of measured with predicted mass to charge ratios (m/z) with +1 charge ionization ([M + H]+) (H) Cleavage was visualized on silver-stained 15% TrisTricine gels.  58  59  protease classes responsible for CCL15 processing, the metalloproteinase inhibitors TIMP-1, TIMP-2, and Marimastat were added to the synovial fluid. For serine proteases PMSF, for cysteine E64, and aspartic proteases pepstatin or leupeptin were added either alone or in combination prior to the addition of chemokine. Two peaks, corresponding to CCL15 (28-92) (m/z 7066) and CCL15 (25-92) (m/z 7738) were eliminated when TIMPs or Marimastat were present (Fig 2.9D), indicating that these cleavage products are due to MMP activity, confirming our in vitro findings. The peak corresponding to CCL15 (24-92) (m/z 7553) was eliminated, and that for CCL15 (22-92) (m/z 7766) was significantly reduced in the presence of PMSF (Fig 2.9E, 9G), implicating a role for serine proteases. Synovial fluid cleavage products were visualized by gel electrophoresis (Fig 2.9H). Of note E64, pepstatin or leupeptin had no effect on processing of CCL15 (results not shown). Discussion We report here the first instance of MMP-processing of three chemokines implicated in monocyte recruitment, specifically by cleavage of CCL16, CCL15 and CCL23. Further, my results suggest the utlization of two mechanisms - enhanced haptotactic gradient formation and the generation of more potent receptor agonists with increased chemotactic potential. A distinctive feature of CCL16, CCL15 and CCL23 is the protein size; at 97, 92 and 99 amino acids in length, respectively, they are much longer than standard chemokines which consist of 65-80 amino acids. The C-terminus of CCL16 extends 44 amino acids after the conserved fourth cysteine residue, whereas CCL15 and CCL23 have extended N-termini of 31 and 32 amino acids, respectively. Unlike all other chemokines evaluated, these three chemokines were cleaved by all MMPs tested (Table 2.1), suggesting that the extended termini, most likely showing increased disorder, improve their susceptibility to proteolysis and hence proteolytic regulation. Truncated forms of both CCL15 and CCL23, but not CCL16, have been previously observed. E. coli and HEK-293 cells produced a recombinant CCL15 protein of the expected 92 amino acids (228,293), insect cells produced CCL15 (25-92) (294), whereas Pichia production resulted in CCL15 (27-92) (295). Similarly, recombinant expression in a baculovirus system generated CCL23 (1-99), (24-99) and (25-99) (210). The presence of N-termini truncation variants in disease was recently shown through 60  the use of separate antibodies to each terminus (122); the C-termini, but not N-termini, of CCL15 and CCL23 were identified in synovial fluid from rheumatoid arthritis patients. While the exact truncation sites could not be identified, Berahovich and colleagues showed that synovial fluid cleaved CCL15 (1-92) to a (25-92) product in vitro. Despite attempts by multiple groups (122) (159), the enzyme responsible for this processing could not be identified. We now show that MMP-1, -2, -3, -7, -8, -9, -12, and -13 cleave CCL15 (1-92) to the (25-92) product (Fig 2. 2 and 2.3). Using a pool of synovial fluid obtained from arthritic patients, we confirmed the processing of CCL15 (1-92) to a (25-92) product observed in vitro biochemical assays has biological relevance in human disease. In addition, we observed stable cleavage products corresponding to (22-92), (24-92) and (28-92). By the addition of inhibitors, we determined that both serine proteases and MMPs were involved. Neutrophil elastase cleaves CCL15 (1-92) to a (22-92) product whereas cathepsin G processing results in products of (24-, 27-, and 29-92) (122,159) and so these may be the responsible serine proteases. Interestingly, in previous studies using PMN supernantant the CCL15 (2592) product was not identified (122) (159). Perhaps, these preparations were primarily azurophilic granular contents – including elastase and cathepsin G – and did not represent specific or gelatinase granules, which contain MMP-8 and MMP-9, respectively. Alternatively, while all MMPs are capable of processing CCL15 in vitro, the in vivo response may be specific to one MMP due to other factos such as limited expression, interactors or localization. This observation is supported by the finding that while several MMPs are capable of processing murine CXCL5/LIX in vitro, MMP-8 cleavage of the chemokine is critical in vivo and not compensated for by elevated MMP9 levels in the Mmp8 -/- neutrophils (89). Kinetic analysis of the MMP processing of CCL15 indicates that the macrophage specific MMP-12 is the most efficient MMP in conversion of the chemokine to truncated products (Fig 2.4). Previous studies of the neutrophil chemoattractants CXCL8 and CXCL5 have shown that MMP-processing of the N-termini results in products with 10-fold higher chemotactic potential than the full-length counterpart (89,164,220,296). Though these neutrophil chemoattractants do not have extended termini like CCL15 and CCL23, the selective processing and maintenance of the critical ELR residues enables for more 61  efficient activation of the cognate receptors. While select monocyte chemoattractants have increased activity following dipeptidyl peptidase, cathepsin, urokinase-type plasminogen activator and chymase proteolysis (122,158,297) ours is the first study to identify MMP-activation of monocyte chemoattractants. We have confirmed previous findings that used chemically synthesized CCL15 (25-92) (295) (205,298) to show that MMP-processed CCL15 (25-92) induces significantly greater calcium mobilization than the full-length counterpart in THP-1 cells (Fig 2. 6B, C), and that this is through CCR1 activity (Fig 2.6A). Similarly, CCL23 (26-99) causes enhanced calcium mobilization in both THP-1 and CCR1-transfected B300-19 cells compared with CCL23 (1-99) (Fig 2.6C). Further, the chemotactic response of MMP-processed CCL15 (25-92, 28-92) and CCL23 (26-99) are significantly elevated in THP-1 cells and in CCR1-transfected cells (Fig 2.7). In contrast, MMP-processing of CCL16 (1-97) to CCL16 (5-97, 8-77, 8-85) did not alter the chemotactic response (Fig 2.2D) or calcium mobilization (results not shown) of THP-1 cells, as compared with full-length chemokine. In agreement with previous findings (299,300), a chemotactic response toward CCL16 was observed only at concentrations greater then 10 nM. These results indicate that MMP-processing of CCL15 (1-92) and CCL23 (1-99), but not CCL16 (1-97), generates more potent receptor agonists than the full-length counterparts. Our results support the findings of Howard and colleagues (299) who describe the chemotactic potential of CCL16 as minimal, and suggest that it may have a more important role in cell adhesion. Immobilization on the cell-surface, and presentation to circulating leukocytes, through high affinity interactions with GAG side chains of proteoglycans are critical for the in vivo activity of many chemokines (129). By creating a high, localized concentration of chemokine, the haptotactic gradient provides the directionality for leukocytes as well as potentially placing the chemokine in a correct orientation for chemokine-receptor interactions (301). Disruption of the gradient by proteolysis of the proteoglycan core protein can decrease chemotaxis (261). Previous work in our laboratory showed that MMP-truncation of chemokines reduces GAG binding efficiency, specifically of CXCL11 (154). Unlike this previous report, we find that MMP-processing of CCL16 results in a product with enhanced GAG binding. CCL16 (877, 8-85) interacts more tightly with heparin Sepharose then does the full-length counterpart (Fig 2.2A), an effect that cannot be explained by salt interactions alone (Fig 62  2.2B). Removal of 12 and 20 amino acids may allow for previously buried residues to form stronger interactions with the heparin. Specifically, the residues 47KRNR50 correlate with the BBXB signature GAG binding motif, where B represents a basic amino acid, that is found in other CC chemokines (132-134). These results suggest that processing at the C-terminus results in increased GAG binding in vitro, and thus a stronger haptotactic gradient could be formed in vivo. Retention of chemokine at the cell surface would result in a localized concentration of chemokine, thereby promoting monocyte migration. In addition to the identification of the truncated chemokine forms of CCL23 by MALDITOF MS, the N-termini CCL23 (1-25) and (1-29) were identified (Fig 2.5A). This suggests that the N-terminus is released as a complete segment and therefore may have functionality. The N-terminus of CCL15 at residues Asp4 – Leu23 are 89.5% homologous and 94.7% similar to CCL23 (Fig 2.8A), suggesting that functionality for both chemokines may lie within this peptide. An alternatively spliced chemokine form of CCL23 not yet found in human tissue but isolated from THP-1 cells, termed CCL23β, contains an insert of 18 amino acids between Asp24 – Phe25, termed SHAAGtide, that is chemotactic for both monocytes and neutrophils through FPRL1 binding (302). In contrast to SHAAGtide, CCL23 (5-23) did not chemoattract THP-1 cells or isolated peripheral blood neutrophils, nor did it alter THP-1 cell chemotaxis to CCL7 (Fig 2.8C). Further, in three different assays the peptide did not have antibacterial properties against E. coli or S. aueus, though we were unable to confirm the antimicrobial activities of CCL15 (1-92) previously published (144)(results not shown). Finally, CCL23 (5-23) did not activate THP-1 cells or neutrophils, as assayed by reactive oxygen species production and degranulation respectively (results not shown). It is possible that a longer peptide, including the first four residues of CCL23 would have proinflammatory function given that the chemotactic potential of SHAAGtide was significantly reduced when lacking the residue Met1 (302). As with SHAAGtide, CCL23 (5-23) was proteolytically processed in vitro, with cleavage sites comparable to those observed for CCL23 (Fig 2.8B). The exception to this is MMP-14, which cleaves CCL23 into the products CCL23 (14-99) and CCL23 (30-99). The identification of CCL23 (1-29) by MALDI-TOF suggests that both cleavages occur 63  concurrently and are not dependent upon the other. Yet, the identification of CCL23 (1123) from the peptide, but not from the full-length chemokine suggests that additional sites within the full chemokine modify the MMP preference, this may be due in part to exosite interactions of the MMP and chemokine that sterically hinder access by MMP-14 to Phe10 - Met11. While the predominant, stable product of MMP-1, -2, -3, 7, -8 and -12 processing of CCL23 was CCL23 (26-99) an additional seven novel sites were identified. With the exception of MMP-14, all MMPs processed CCL23 (1-99) to (11-99) and (28-99), though the latter of these was only observed at high MMP concentrations. By silverstained electrophoresis (Fig 2.5C), it is apparent that processivity exists, in that the MMP cleaves the chemokine at a preferred site, which then modifies the structure sufficiently that another cleavage site is available. A similar observation can be made for the CCL15 (1-92) cleavage by MMPs (Fig 2.4A). This is the first study to show proteolytic activity within the first 21 residues or CCL15, namely to produce (14-92) and (17-92) forms that were results of MMP-2, -13, -14 or MMP-3, and -7 processing. Yet, unlike CCL15 (25-92) we were unable to isolate these forms, suggesting that they are transient products whereas CCL15 (25-92) is a stable product. Moreover, this stable product has a high degree of functionality when compared with other CCL15 truncation variants described by Escher and colleagues (205). The presence of four CCL15 truncation variants following processing by synovial fluid suggests that serine proteases and MMPs work in concert. Further, processing by one protease family is not dependent upon another given the presence of 2 products when one class of proteases was inhibited. While beyond the scope of this study, these results present a number of questions regarding the processing of a single protein at multiple sites, and by multiple proteases. Is this simply biological redundancy? Do the truncation variants have significantly different effects in vivo, such as the recruitment of different cell types, or do they function in antigenicity? In the case of arthritis, a chronic inflammatory disease, a combination of these is likely – and thus a reason for the disease state. In homeostasis or acute inflammation, protease activity is tightly regulated by latency as a zymogen, localization, and endogenous inhibitors and so a single protease or class may be responsible for normal function. In the synovial fluid 64  used in these experiments, the proteolytic activity was significant—completely processing a 10-fold excess of chemokine compared with total protein in the fluid. This suggests that in chronic disease the regulation mechanisms are overcome and thus multiple proteases can contribute to disease progression through redundant processing of chemokines. In our previous work, we proposed a model whereby macrophages produce MMP-12 to terminate neutrophil recruitment (87). We now build upon that model by suggesting that macrophage MMP-12 acts in a positive feed-back mechanism to process CCL15, CCL16 and CCL23 to promote monocyte recruitment (Fig 2.10). Further, continual production of these chemokines and processing by MMPs could promote a transition from an acute to a chronic response. This study suggests that CCL16, CCL15 and CCL23 are expressed as prochemokines, perhaps with roles in homeostasis including basic antimicrobial activity (144) although we could not confirm such activity, but upon stimulation of an inflammatory response, the associated increased activity of MMPs results in processing of the full-length proteins to promote leukocyte chemoattraction through improved gradient formation or receptor activation.  65  Figure 2.10 Model of chemokine propogation of inflammation Following and initiating stimulus (1), resident cells including macrophages produce MMPs including MMP12 and the chemokines CCL15, CCL23 and CCL16. MMP cleavage (2) of CCL16 results in a product with enhanced glycosaminoglycan-binding and thus improved gradient formation (3) whereas MMP cleavage of CCL15 and CCL23 results in strong agonists that promote monocyte recruitment (4). Interstitially, inflammatory monocytes differentiate into macrophages (5) that release more MMP and chemokine, propogating the response in a positive feed-back manner.  66  CHAPTER 3: MT6-MMP PROCESSES PROTEINS INVOLVED IN LEUKOCYTE MIGRATION AND MATRIX REMODELING TO PROGRESS TO WOUND HEALING Synopsis Matrix metalloproteinases (MMPs) are a family of endopeptidases originally identified for their role in degradation of the extracellular matrix (ECM), but now recognized to process bioactive molecules and particularly to modify inflammatory responses. Membrane-type matrix metalloproteinase (MT)6-MMP/MMP-25, a neutrophil-specific MMP, is implicated in diseases including cancer and multiple sclerosis, though the functionality of this membrane protease is not yet known. To elucidate the biological roles of MT6-MMP, it is critical to identify the target substrates. Limited biochemical data has identified less than 10 extracellular matrix molecules and protease inhibitors as substrates. Herein, we expressed a soluble FLAG-tagged proprotein convertases mutant and a catalytically inactive mutant to assess the biochemical features of MT6MMP and for in vitro cleavage assays of ECM proteins and chemokines we hypothesize are substrates. Further, we employed a proteomics approach to identify novel MT6MMP substrates that are produced by human lung fibroblast cells. MT6-MMP processes 7 of each of the CXC and CC subfamilies of chemokines. Specifically, the neutrophil chemoattractant CXCL5 results in a product with increased agonist activity as do the monocyte chemoattractants CCL15 and CCL23. Further, we identified 58 candidate substrates of MT6-MMP in human lung fibroblast secretome, and following biochemical confirmation of vimentin as an MT6-MMP substrate we showed monocyte chemoattraction towards full-length vimentin that was reduced upon MMP-cleavage. We also confirmed cystatin C, insulin-like growth factor binding protein (IGFBP)-7, SPARC (secreted protein acidic and rich in cysteine), and galectin-1 as substrates for MT6MMP. This work more than doubles the number of MT6-MMP substrates known, and through the processing of IGFBP-7 suggests a role for the enzyme in priming the tissue for wound healing. Introduction Polymorphonuclear neutrophils (PMNs) are critical components of the innate immune system in the defense against infection and in the progression of inflammation. Neutrophils are granulocytes, storing components within secretory vesicles and tertiary 67  granules that are required for transendothelial migration, and within primary and secondary granules that are antibacterial and proinflammatory (2). Within hours after injury, neutrophils are recruited to tissue wherein they release neutrophil extracellular traps (NETS) to contain bacteria (11), antimicrobial peptides, proteases, and proinflammatory cytokines and chemokines to propogate the response, phagocytose pathogens and then ultimately die by apoptosis. Recent work has identified roles for neutrophils in monocyte recruitment and macrophage activation, through the release of soluble mediators (255,259,303) and presentation of “eat-me” signaling proteins on the apoptotic membranes (268,304-306). Recruited monocytes differentiate into macrophages that are involved in resolution of inflammation. The recruitment of neutrophils and monocytes is dependent in part upon chemoattracting cytokines, termed chemokines, which are produced and released from resident cells as well as recruited neutrophils. Of the two main chemokine subfamilies, CXC chemokines primarily recruit neutrophils whereas CC chemokines are more important in the recruitment of monocytes. Proteolysis of chemokine termini results in significant functional changes. Matrix metalloproteinases (MMPs) are family of enzymes, upregulated in inflammatory conditions, which are important for proteolysis of chemokine structure to modify cellular recruitment and inflammation in vivo (89,114). In Chapter 2, I showed the role of MMPs in activation of monocyte chemoattractants CCL15 and CCL23, and proposed a positive feed-forward mechanism. In contrast, monocyte chemoattractants CCL2, 7, 8, and 13 are inactivated by proteolysis of MMPs (87,114,115), including macrophage-specific MMP-12, implicating a negative feed-back mechanism for leukocyte control. The neutrophil human chemoattractants CXCL8 and CXCL5 and murine CXCL5/LIX are activated by stromal MMPs (87,89,220), and neutrophil-specific MMP-8, whereas human CXCL1, 2 and 3 are inactivated by MMP-1, -9 and the macrophage-specific MMP-12 (87). This leukocyte-specific MMP regulation of neutrophil and monocyte chemokines led us to question the role of the neutrophilspecific MT6-MMP in processing chemokines, for which limited substrates have been identified. MT6-MMP is membrane-associated through a GPI-anchor, and contains a furin-like cleavage sequence for intracellular activation in the golgi (51,52). As with other MMPs, 68  enzymatic activity of MT6-MMP is regulated by tissue inhibitors of metalloproteinases (TIMPs), including TIMP-1, -2, -3, and -4, but also by the abundant serum protein clusterin (101,103,104). MT6-MMP is localized primarily to neutrophil gelatinase granules, but is also found in specific granules and secretory vesicles, and in lipid rafts on the plasma membrane of resting cells (72,101). Stimulation of neutrophils by CXCL8 and interferon (IFN)-gamma induces the release MT6-MMP, whereas stimulation and induction of apoptosis by PMA relocates MT6-MMP to the neutrophil surface (72,101). Together, these findings suggest a role for MT6-MMP not only in cellular migration but also in the functional effects observed for neutrophils interstitially and during apoptosis. There have been several studies implicating MT6-MMP in development and increased expression of the protease in inflammatory disease and cancers (83,84,307-310), yet few substrates of the protein have been identified. Through hypothesis-directed approaches, extracellular matrix proteins (type IV collagen, gelatin, fibronectin, fibrin), alpha-1 proteinase inhibitor, urokinase plasminogen activator receptor, and myelin basic protein have been identified as MT6-MMP substrates (103,109,111,112). In the last decade, a significant amount of research in the protease field has been directed at the development of unbiased approaches for elucidating a protease’s substrate repertoire, termed the substrate degradome (311) (reviewed in (312)) wherein protease activity can be evaluated in a more relevant and complex biological system. Quantitiative shotgun proteomics has been successful in comparing proteomes differing in enzyme activity (116,216,287,313), though less abundant proteins may often go undetected. Therefore, enrichment strategies to isolate substrates from non-proteolyzed proteins are the current focus of research (314-318). Proteolysis at a single site results in a new (neo) amino (N)-terminus and a neo carboxy (C)-terminus, corresponding to residues at the prime and non-prime side of the substrate scissile bond respectively. Positive or negative selection techniques utilize the neo-N-terminus to enrich for substrates within the proteome prior to mass spectrometry analysis. We developed a method termed terminal amine isotopic labeling of substrates (TAILS) in which neo-Ntermini in proteomes are differentially labeled (e.g. treated with active vs. inactive protease), combined, digested into peptides and then N-termini enriched by negative selection through an amine reactive polymer; peptide analysis by mass spectrometry provides quantitative identification of substrates and cleavage sites (318). The use of 69  isobaric tags for relative and absolute quantification (iTRAQ) reagents (iTRAQ-TAILS) enables for multiplex experimentation (319). Using TAILS, we have identified novel substrates for MMP-2, MMP-9, and MMP-11 (318,319). To better understand the functional roles of MT6-MMP in neutrophil-dependent inflammation-promoting events, we expressed and purified a soluble form of MT6-MMP for use in a hypothesis directed approach and in a hypothesis generating proteomics approach to identify novel substrates of this enzyme. We evaluated the ability of MT6MMP to cleave both neutrophil and monocyte chemoattractants to evaluate potential positive feed-back and feed-forward mechanisms. In addition, using a human fetal lung fibroblast (HFL) secretome as a relevant proteome that would be encountered by migrating neutrophils, we applied iTRAQ-TAILS to identify novel MT6-MMP substrates. The results of this research provide insight into the role of this enzyme in the potentiation and resolution of inflammation.  Material and Methods Proteins (chemokines, proteases, sources of ECM): Recombinant human MMP-1, -2, 3, -8, -9, -12, -13, and soluble MMP-14, and recombinant murine TIMP-1, 2 and 4 were expressed and purified from mammalian systems using standard techniques (65,287,320); MMP-7 was purchased from U. S. Biochemical Corporation. All chemokines were chemically synthesized using t-Boc solid phase chemistry and purified by high-performance liquid chromatography and validated for activity as previously described (288). Marimastat was chemically synthesized as previously described (321). Recombinant human vimentin and galectin was purchased from R&D systems. DQ gelatin was purchase from Molecular Probes. Insulin-like growth factor binding protein (IGFBP)-7 protein and antibody, and cystatin C, were kindly provided by Kaoru Miyazaki (Yokohama City University, Japan) Magnus Abrahamson (University of Lund, Lund, Sweden). Recombinant human MT6-MMP protein expression and purification: A pcDNA3.1 vector containing full-length MT6-MMP was kindly provided by Dr D. Pei (Guangzhou Institutes of Biomedicine and Health, China). A HindIII site was introduced at the 5’ end of the 70  construct using the forward primer 5’-CCGAAGCTTATGCGGCTGCGGCTCCGG-3’, allowing for 18 bp overlap with the original construct. Additionally, a FLAG tag, EcoRI site and stop sequence were exchanged with residues corresponding to the GPI-anchor region starting after Gly-514 to create soluble (s)MT6 using the forward primer 5’CGGGAATTCCTACTTGTCATCG TCGTCCTTGTAGTCACCAGAGCTCGGGGCGGG3’. The product of a PCR reaction over 35 cycles at 95 °C for 30 sec, 60 °C for 30 sec, and 72 °C for 60 sec was visualized on 1% agarose gel electrophoresis, excised and extracted using the QIAGEN gel extraction kit in accordance with the manufacturers protocol. The purified product was digested with HindIII and EcoRI, separated by 1% agaose gel electrophoresis and again purified by QIAGEN gel extraction kit. After a 30 min A-tailing reaction of the purified digest product at 70 °C, it was ligated into pGEM-T for 16 h at 12 °C. To produce a protein with increased stability in storage, the furin-like activation site of sMT6 was mutated at 103RRRRR107 to 103GAGAG107 resulting in sMT6Δfurin, hereafter termed sMT6ΔF. The site-directed mutagenesis was accomplished by reaction of 50 ng of sMT6 plasmid with 125 ng of each of the primers 5’-GGGGCTGGTCGGTGCCGG T GCCGGTTACG CTGTCAG-3’ and 3’-CCCCGACCAGCCACGGCCACGGCCAATGCG AGACTC-5’, where the bold text indicates the loop-in region. Reactions were carried out over 18 cycles of 95 °C for 30 sec, 55 °C for 60 sec, and 68 °C for 13.5 minutes. Separately, a second point-mutation was introduced into the sMT6 construct using the forward primer 5’-GGCTGTCCATGCGTTTGGCCACGCC-5’ and a reverse primer 3’CCGACA GGTACGCAAACCGGTGCGG-5’ to mutate the catalytic Glu345 to Ala345, to produce sMT6EΔA. All PCR products were confirmed by DNA sequencing. The three mutant constructs were separately ligated into pGW1GH vector and then transfected, in parallel with a vector control, into CHO-K1 cells by electroporation. After 24 h clonal selection was initiated by the addition of MPA to DMEM supplemented with 10% cosmic calf serum, HT supplement (Invitrogen) and xanthine. Surviving clones were screened for positive expression from 24 h conditioned media by Western blot using the M2-αFLAG primary antibody. A separate positive stable clone was used for expression of each of sMT6, sMT6ΔF and sMT6EΔA protein. 71  The protein purification procedure for each MT6-MMP construct was equivalent. Briefly, stable-transfectant CHO-K1 cells were grown to 90% confluency in MPA-containing growth media. Cells were washed three times with PBS and then media replaced with CHO-SFM. Conditioned media was collected every 24 h for 5 to 10 days. Media was clarified by centrifugation at 1500 x g for 10 min and filtered with 0.2 mm filter. A green Sepharose column (Sigma), resuspended in water, was used as a first purification step; after washing, proteins were eluted with 0.5 to 1.5 M NaCl. Eluates were pooled and dialyzed against Tris-buffered saline. Dialyzed samples were loaded onto a column prepared with αFLAG-agarose and eluted with 0.1 mM αFLAG-peptide (Sigma), according to the manufacturers protocol. Purity of proteins were confirmed by silverstained 15% SDS-PAGE, and by Western blot using both M2αFLAG and rabbit αMT6MMP (ab39031, Abcam). Proteins were quantified by Bradford assay, and activity of both sMT6 and sMT6ΔF quantified by active-site titration with recombinant TIMP-1 and TIMP-2 against the universal MMP quenched fluorescent substrate QF-24, having the sequence Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2, at excitation/emission of 320/405. Peptide-based active site evaluation of MT6-MMP: Proteomic identification of cleavage sites (PICS) was completed in accordance with the method previously described (322). Briefly, 0.8 µg of active sMT6ΔF was added to 200 µg of tryptic peptide library prepared from K562 cells (ATCC #CCL-243) and incubated for 16 h at 37 °C in 50 mM HEPES, 10 mM CaCl2, 200 mM NaCl at pH 7.8. The reaction was heat inactivated at 70 °C for 30 min. The products were biotinylated with 0.5 mM sulfosuccinimidyl 2-(biotinamido)ethyl-1,3-dithiopropionate (Pierce) at 22 °C for 2 h. In a 16 h reaction at 22 °C, biotinlabelled peptides were bound to streptavidin Sepharose (GE Healthcare) that was equilibrated in 50 mM HEPES, 150 mM NaCl, pH 7.4. Unbound peptides were removed by buffer washing and centrifugation at 1000 x g for 1 min in Spin Columns (Pierce). Bound peptides were eluted with 40 mM DTT in 50 mM HEPES. Impurities were removed with C18 Sep-Pak cartridges, eluting with 80% acetonitrile and the volume decreased under vacuum centrifugation. Peptide analysis was completed by LC-MS/MS on a QSTAR. Wiff files were searched with both Mascot and X!Tandem and results applied to WebPics (http://clipserve.dentistry.ubc.ca/pics/) and to IceLogo (http://iomics.ugent.be/icelogoserver/main.html) analysis (323). 72  Kinetic evaluation of fluorescent substrates: The kinetics of sMT6, sMT6ΔF and sMT6EΔA were evaluated against two quenched fluorescent (QF) substrates, namely QF24 and QF35, and compared to the relative fluorescence of 5 nM Mca. Increasing amounts of active site titrated enzyme were added to substrate and the reaction kinetics evaluated at excitation/emission of 320/405. The initial velocity (Vi) was calculated by ((ΔRFU/t) x [MCA])/RFUMCA where RFU is the relative fluorescent units due to enzyme activity, and t is time. This value was entered into the equation kcat/Km = Vi/([E][S]), to solve for kcat/Km. Reactions were carried out at 37 °C on a Polarstar Optima 96-well fluorimeter (BMG). Inhibition of MT6-MMP: To evaluate the Ki of sMT6ΔF, the enzyme was incubated in the presence of increasing concentrations of recombinant murine TIMP-1, TIMP-2, TIMP-4 or Marimastat at 37 °C for 2 hours before the addition of QF24. The kinetics of the reactions were assessed at 37 °C on a Polarstar Optima 96-well fluorimeter. Data was imported and calculations for Morrison Ki were completed in Prism (GraphPad). In vitro cleavage assays: In vitro assays by sMT6ΔF were performed in 50 mM HEPES, 200 mM NaCl, 5 mM CaCl2, pH 7.4. Cleavage of chemokines, vimentin, IGFBP-7, cystatin C, MMP-1, galectin-1 and Secreted protein, acidic and rich in cysteine (SPARC) were performed at enzyme to substrate 1:20 (w/w) ratios for 16 h at 37 °C. Collagen cleavage was performed for 16 h at 28 °C, or at 37 °C after enzyme-free collagen denaturation at 60 °C for 15 min. Chemokine cleavage assay products were analyzed, as previously described (289), by MALDI-TOF MS on a Voyager-DE STR (Applied Biosystems) or a 4700 (Applied Biosystems) using the matrices sinapinic acid or CHCA, respectively, and confirmed by silver-stained 15% Tris-Tricine SDS-PAGE. Chemokine cleavage was defined to be positive when the mass spectrometry spectra showed a cleavage product with greater than 20% intensity of the full-length chemokine. Cystatin C processing was confirmed by silver-stained 15% Tris-Tricine SDS-PAGE. Vimentin, IGFBP-7, MMP-1, galectin-1 and SPARC, and collagen cleavages were confirmed by silver-stained 15% or 7.5% Tris-glycine SDS-PAGE. Gelatin and casein processing were evaluated by zymography of gels polymerized in the presence of protein at 0.2 mg/ml. MMP processing of 25 µg/ml DQ gelatin was evaluated by an increase in 73  fluorescence at excitiation/emission of 495/515 nm on a Polarstar Optima 96-well fluorimeter (BMG). HFL-1 secretome preparation: Human fetal lung fibroblast-1 cells (obtained from Dr. C Roberts, Vancouver, Canada) were grown to 90% confluency in DMEM containing 10% fetal calf serum. Cells were washed with PBS x3 and then with serum-free media x2, before adding fresh serum-free DMEM. After 16 h, serum-free media was clarified by centrifugation at 1500 x g for 10 min and filtered with 0.2 mm filter. Conditioned media was concentrated, and buffer exchanged to 50 mM HEPES, by ultracentrifugation at using 3-kDa-cutoff membranes (Amicon). The protein concentration was measured by Bradford assay (Bio-Rad). Proteome digestion and terminal amine isotopic labeling of substrates (TAILS): Active sMT6ΔF or sMT6EΔA were added to concentrated, serum-free human fetal lung fibroblast (HFL-1) secretome in a 1:250 w/w ratio in 50 mM HEPES, 150 mM NaCl and 5 mM CaCl2, and incubated for 16 h at 37 °C. To enrich for N-terminus peptides, the resulting cleavage products were subjected to TAILS as a 2-plex iTRAQ experiment (318,319). Briefly, GuHCl and HEPES were added to HFL-1 cleavage assay products to a final concentration of 2.5 M and 250 mM respectively. Proteins were denatured with 1 mM tris(2-carboxyethyl)phosphine at 65 °C, and cysteines alkylated with 5 mM iodoacetamide. Proteins from sMT6ΔF or sMT6EΔA treatment were labeled in 50% DMSO with iTRAQ labels 114 and 115 respectively. After 30 min at 25 °C, the reaction was quenched with 100 mM ammonium bicarbonate. Labeled samples were combined and precipitated with 9 volumes of acetone/ methanol (8:1 volume ratio) at -20 °C. Protein precipitate was pelleted by centrifugation at 2500 x g for 30 min at 4 °C, washed with methanol, and resuspended in 50 mM HEPES for digestion with TrypsinGold (Promega) at a 1:100 enzyme:protein ratio for 16 h at 37 °C. Complete digestion was confirmed by silver-stained 15% SDS-PAGE. N-termini enrichment was attained under acidic conditions at 37 °C for 16 h using a dendritic polyglycerol aldehyde polymer to deplete internal and C-terminal peptides. N-terminally blocked peptides, due to iTRAQ labeling or natural acetylation, were obtained from the unbound fraction by ultracentrifugation in 10,000-kDa-cutoff membranes (Amicon). 74  Samples were fractionated on a 1,200 series HPLC (Agilent Technologies) using a polysulfoethyl A 100 x 4.6 mm, 5 µM, 300 column (PolyLC Inc). Peptides were bound to the column and washed for 15 min in 10 mM potassium phosphate and 25% acetonitrile, pH 2.7. Peptides were eluted with a 22 min gradient to 0.3 M NaCl, then 6 min to 0.4 NaCl and 2 min to reach 1 M NaCl. Fractions collected every 1.5 min were concentrated under vacuum and desalted using C18 OMIX tips. Peptide samples were analyzed by nanospray LC-MS/MS using a C18 column interfaced with a QStar XL Hybrid ESI mass spectrometer (Applied Biosystems). TAILS data analysis: Acquired MS2 scans were searched by both Mascot (version 2.2.2, Matrix Science) and X! Tandem (2007.07.01 release) against a human International Protein Index (IPI) protein database (v.3.69). Search parameters were: Semi-Arg-C cleavage specificity with up to 2 missed cleavages; fixed modifications of cysteine carbamidomethylation and lysine iTRAQ; variable modifications of N-terminal iTRAQ, N-terminal acetylation, methionine oxidation; peptide tolerance and MS/MS tolerance at 0.4 Da; scoring scheme was ESI-QUAD-TOF. Search results were analyzed with the TransProteomic Pipeline (TPP) (TPPv.4.3, rev 0, Build 200902191420) using PeptideProphet for peptide identification and Libra for quantification of iTRAQ reporter ion intensities (324,325). Each data set was modeled by TPP and included only the peptides with an iProphet probability error rate ≤ 0.05. Using in house software (321), termed Clipper, data sets were converted to a common format using ClipperConvert. Mascot and X! Tandem lists were combined for each experiment and analyzed as a single experiment or in tandem by Clipper. The data was normalized using a correction factor obtained by analysis of the average log2(ratio) natural N-termini peptides. Candidate substrates were identified as those having a ratio ≥ 2 standard deviation from the mean. The highest confidence substrates were proteins identified by the same peptide in biological replicate experiments. High confidence substrates were identified by multiple spectra in one experiment, whereas candidate substrates requiring biochemical validation were identified by only one spectra. Transwell migration: THP-1 cells (ATCC) grown in RPMI 1640 supplemented with 10% fetal bovine serum were washed and resuspended at 1 x 106 cells/ml in RPMI 1640 media supplemented 0.1% bovine serum albumin. Chemoattractant, or MMP and buffer 75  controls, diluted in the same media in the lower chamber were separated from 2 x 105 cells/ml in the upper chamber of a 48-well Boyden chamber (Neuroprobe) by a 5 µm pore filter. Assays performed at 37 ºC, 5% CO2 were 90 min for THP-1. Non-migrating cells were aspirated and the upper chamber washed with 2 mM EDTA. The contents of the lower chamber was transferred to a Maxisorb 96-well plate and frozen at -80 ºC for a minimum of 2 h. DNA content was determined by addition of CyQuant reagent (Invitrogen) to the thawed lysate and fluorescence evaluated by excitation/emission at 485/538 nm. The chemotactic index was calculated by the ratio of the relative fluorescence of samples from cells migrating in response to chemokine compared with the media control. Experiments were carried out in ≥ quadruplicate and repeated two times. Statistical significance of cleaved versus full-length chemokine was evaluated by t-test. Results Purification of recombinant sMT6ΔF and sMT6EΔA: To prepare soluble forms of MT6MMP that could be chemically activated (sMT6ΔF) or remain catalytically inactive (sMT6EΔA), the hydrophobic stem region was exchanged for a FLAG tag, and mutations made to the furin-like cleavage site or catalytic glutamate residue, respectively (Fig 3.1A). The proteins were expressed by CHO-K1 stable transfectants, and secreted into the media. The silver-stained 15% SDS-PAGE and Western blot of purified sMT6EΔA show comparable results under both reducing and non-reducing conditions (Fig 3.1B,C). A band corresponding to 46.5 kDa represents the catalytically inactive protein, lacking the prodomain, confirmed by Edman sequencing to start with 108  YALSG112. A lower band, present at equimolar concentrations, was found by Western  blot to be TIMP-2 (Fig 3.1D). This is consistent with previous studies that have identified TIMP-2 complexed with MT6-MMP (104). Silver-stained 15% SDS-PAGE of purified sMT6ΔF protein revealed a doublet at ~47 kDa under-non-reducing conditions but under reducing conditions at ~27 kDa, and additional banding was evident at ~20 kDa (Fig 3.1B). Western blot detection of the same protein using an antibody to the linker region of MT6-MMP identified the additional degradation products under non-reducing conditions, and a triplicate at ~27 kDa under reducing conditions (Fig 3.1C). Edman sequencing revealed that the bands at 27 kDa 76  Figure 3.1 Expression and purification of soluble active and catalytically inactive MT6MMP mutants. (A) Domain structures of MT6-MMP proteins that result from site-directed mutagenesis, indicating the signal peptide (S; yellow), propeptide (Pro; blue) with a furin-cleavage site (Navy), catalytic domain (green), flexible linker (grey), hemopexin domain (red), stalk and hydrophobic tail for GPI-anchoring (ST, orange). The stalk was truncated and a FLAG tag (black) appended to create a soluble MT6-MMP construct. An additional mutation to sMT6 was made to remove the furin cleavage site, resulting in the activatable sMT6ΔF protein. Alternatively, an additional mutation to sMT6 was made to remove the catalytic Glu residue, replacing it with Ala, resulting in the catalytically inactive sMT6EΔA protein. (B) Purified sMT6EΔA and sMT6ΔF proteins were visualized under non-reducing or reducing conditions on silver-stained 15% SDS-PAGE gels. Edman sequencing confirmed the N-termini of sMT6EΔA to be Tyr108 (arrow), for sMT6ΔF to be Leu101 (double arrows) and a degradation product of sMT6ΔF to occur within the hemopexin domain at Leu348 (double grey arrows). (C) Non-reduced or reduced sMT6EΔA and sMT6ΔF proteins analyzed by Western blot using a primary antibody against the linker region of MT6-MMP. (D) Western blot analysis of purified sMT6ΔF, sMT6EΔA and the control TIMP-2 with a primary antibody to TIMP-2 indicate the presence of TIMP-2 in the sMT6EΔA but not sMT6ΔF preparation. (E) Schematic of the predicted sMT6ΔF structure, indicating the catalytic domain (green) joined by linker (grey) to the FLAG-tagged (black) hemopexin domain (red). The hemopexin domain is cleaved, but the C-termini portion in bound to the N-termini of the hemopexin domain by disulfide bond.  77  78  correspond to 101LVGAG105, likely representing glycosylation variants (102). This indicates that despite mutation of the furin-like cleavage site at 103RRRRR107, the prodomain of sMT6ΔF is still cleaved off intracellularly, though this occurs 7 residues upstream of the natural start of the MT6-MMP catalytic domain. The bands at ~20 kDa have the N-terminal seqence 348LVSPR352, representing degradation of MT6-MMP wherein the hemopexin domain is separated from the catalytic domain. Proteolysis at 348  LVSPR352 was previously observed in an sMT6 construct that was expressed by  MDCK cells (105). Together, this data suggests that the disulfide bonded (C317 and Cys508, by homology with other MMPs) hemopexin domain of sMT6ΔF is cleaved, with the C-terminal fragment being retained to the catalytic domain by the disulfide bond (Fig 3.1E). Further, the lack of hemopexin domain degradation in the sMT6EΔA that was observed in the sMT6ΔF protein, suggests that this is an autocatalytic event and that sMT6ΔF is catalytically active despite the remnant prodomain amino acids at the Nterminal of purified sMT6ΔF. While the N-terminus is not directly involved in catalysis it may stabilize the active site. The MMP-8 N-terminus 79Phe ammonium group forms a salt-bridge through the carboxylate group of the conserved 232Asp in helix C to stabilize the catalytic site for enhance activity that is not observed in a 80Met truncated variant. Thus the activity of this purified sMT6ΔF with a 101Gly N-terminus may be slower than that of MT6-MMP with an N-terminus at 108Tyr (326). Peptide identification of cleavage site specificity: To identify the preferred sequence cleavage site of sMT6ΔF, we employed the PICS technique, which enables the detection of prime side cleavage residues by mass spectrometry and for the bioinformatic identification of non-prime residues (322). PICS analysis of a tryptic peptide library used as diverse library of proteome derived peptides was incubated with sMT6ΔF resulting in the identification of 286 cleavage sites in the cleaved peptides. WebPics analysis of the data indicates a strong preference for Leu at P1’ and Val at P2’, and preferences for Pro/Val at P3 and Ala/Glu at P1 (Fig 3.2A). After adjusting for amino acid abundance, the IceLogo of the PICS confirm these preferences but also highlight preferences for Asn residues in P2 and P1 that are not observed in the heat map (Fig 3.2B). In general, these findings are consistent with other MMPs (Schilling et al, in preparation). Notably, MMP-2 and MT5-MMP have a preference for Gly at P1 79  Figure 3.2 PICS analysis of MT6-MMP cleavage site specificity. (A) Heat map of the amino acid occurrence at positions P6 to P6’ (Schecter and Berger nomenclature (327)) of the 286 peptides analyzed and identified by MS/MS following PICS analysis of sMT6ΔF cleavage of a tryptic library. (B) IceLogo analysis of the PICS data, adjusting for relative abundance of the amino acids in the homo sapien proteome, indicating the relative occurrence of amino acids at positions P6 to P6’ from the 286 peptides analyzed and identified.  80  (322) Goebler and Overall, unpublished data) which MT6-MMP does not. Characterization of catalytic activity and inhibition: To confirm the catalytic activity of the recombinant sMT6 preparations, we evaluated the kinetics of processing of fluorescent MMP substrates (Fig 3.3A). As expected, sMT6ΔF, but not sMT6EΔA, was catalytically active against QF24; the activity was not increased by the addition of chemical activators such as p-aminophenylmercuric acetate (results not shown). The kcat/Km of sMT6ΔF was found to be 171 M-1s-1 for QF24 and 36 for QF35. In agreement with the findings for the catalytic domain of MT6-MMP by Nie and Pei (110) that contrasted with those of English and colleagues (103), sMT6ΔF showed a clear preference for QF24 over QF35 (Fig 3.3B). Yet, sMT6ΔF processing of the substrates is significantly lower than that of MT1-MMP, as is sMT6, suggesting that this is not the ideal substrate for MT6-MMP. This reduced activity is consistent with the different preferences observed by PICS analysis, specifically the preference for Gly at P1 by several MMPs that is not present for MT6-MMP, but is present in QF24 (Fig 3.3A). English and colleagues found TIMP2 and TIMP3 to be much stronger inhibitors than TIMP1 of a catalytic domain construct of MT6-MMP (103), whereas other groups observed similar inhibition by TIMP1 and TIMP2 of both catalytic domain and sMT6 constructs of MT6-MMP (104,105). Despite the tight binding observed by TIMP-2 in purification of sMT6EΔA, TIMP-1 and TIMP-4 were stronger inhibitors of the sMT6ΔF protein, and all were significantly stronger inhibitors than the small molecule drug inhibitor Marimastat (Fig 3.3C). Proteolysis of extracellular matrix components: The gelatinolytic activity of the catalytic domain of MT6-MMP has been shown by zymography and in vitro for type I gelatin (52,103,110) yet this is not consistent with the results of cell expressed full-length MT6MMP (84). In agreement with Radichev and colleagues (104), we found that the gelatinolytic activity of sMT6ΔF is minimal. By gelatin zymography, 1,000 ng of sMT6ΔF resulted in only a slight clearing whereas 10 ng of MMP-9 results in a strong signal (Fig 3.4A). Further, in an assay using DQ-gelatin, in which a fluorescent signal is observed only upon gelatin cleavage, there was minimal activity of 10-fold more sMT6ΔF 81  Figure 3.3 Kinetic analysis of MT6-MMP and inhibition by TIMPs. (A) Sequences of the quenched fluorescent substrates used to evaluate MMP activity. (B) The cleavages of QF substrates by 3 nM MMP at 24 or 36°C were compared by measurement of the increase in fluorescence at excitation/emission of 320/405 nM. (C) Inhibition of 3 nM sMT6ΔF processing of 1000 nM QF24 by increasing concentrations of TIMP-1, -2, and -4, and by Marimastat was evaluated by measurement of fluorescence at excitation/emission of 320/405 nm and Morrision Ki calculated in Prism (GraphPad). 82  Figure 3.4 MT6-MMP cleavage of gelatin and casein. (A) Gelatin zymography, wherein a clear band indicates proteolysis of gelatin that is polymerized within the SDS-PAGE gel. 10 ng of MMP-9 resulted in a clear band (arrow) whereas 100 and 1000 ng of sMT6ΔF results in only a slight clearance, indicating weak gelatinolytic activity. (B) Quenched fluorescein-conjugated gelatin processing by sMT6ΔF compared with MMP-2 processing was monitored at excitation/emission of 485/530. (C) Casein processing by sMT6ΔF was evaluated by zymography, wherein a clear band indicates significant proteolysis. 10 ng of MMP-7 resulted in a clear band (arrow) whereas 100 and 1000 ng of sMT6ΔF results in only a slight clearance (arrow), indicating weak that casein is not a strong substrate for sMT6ΔF. 83  compared with MMP-2 (Fig 3.4B). Similar results were observed by casein zymography, in that 1,000 ng of sMT6ΔF cleaves casein only slightly compared with 10 ng of MMP-7 (Fig 3.4C). Chemokine processing by MT6-MMP: MMP processing of chemokines is a critical event in the control of inflammation (114). To evaluate the role of the neutrophil-specific MT6MMP in modulating neutrophil recruitment, we evaluated sMT6ΔF in vitro processing of 14 neutrophil chemoattractants, specifically CXC chemokines. Cleavage sites were identified in 7 CXC chemokines (Fig 3.5). Cleavage of CXCL2 resulted in a product lacking the four N-termini residues as is common for many MMP cleaved chemokines. Cleavage was not observed in the related chemokines CXCL1 and CXCL3, which have Ser-Val residues where Pro-Leu are observed in P3-P2 of CXCL2. Similarly, murine (m) CXCL1 and mCXCL2 were not cleaved by sMT6ΔF; mCXCL1 has an Asn instead of Thr at the P1’ position of hCXCL2 whereas mCXCL2 has the sequence AVVASELR. Both human and murine CXCL5 were processed by sMT6ΔF at the N-terminus. The products hCXCL5 (8-78) and mCXCL5 (5-92) were previously shown to have increased agonist activity (89,164,220,296). The product mCXCL5 (10-92) had not been previously identified. CXCL6 was cleaved to a product that lacks the first 28 residues. Cleavage by MMPs beyond the conserved cysteine residues is rarely observed outside of degradation, yet this product was observed at all enzyme to chemokine ratios evaluated and was the only product observed. Further, this product resulted following incubation with all other MMPs evaluated (Fig 3.5C). The truncation product observed from CXCL9 incubation with sMT6ΔF of CXCL9 (1-90) was previously observed following MMP-7, -9 and -12 activity, though a change to function has not been evaluated (154,220). Processing of CXCL12 by sMT6ΔF showed results consistent with those of other MMPs, removing four N-termini residues; this product has been shown to result in a loss of CXCR4 activity and increased neurotoxic activity (181,183). Notably, in addition to those previously mentioned, human CXCL7, 8, 10 and 11 were not cleaved by sMT6ΔF (Fig 3.5D).  84  Figure 3.5 CXC chemokine processing by MT6-MMP. (A) Human CXCL chemokines were incubated with recombinant sMT6ΔF at 1:20 molar ratios, or in the cases of CXCL6 at 1:250 – 1:1000, at 37ºC for 16 h. Cleavage assay products were visualized on silver-stained 15% Tris-Tricine gels. (B) Human CXCL6 was incubated with recombinant sMT6ΔF or MMP-1, -2, -3, -7, -8, -9, -12, -13, and -14 at 1:10 molar ratios at 37ºC for 16 h. Cleavage assay products were visualized on silver-stained 15% Tris-Tricine gels. (C) Cleavages of the CXCL chemokines listed were not detectable by MALDI-TOF following incubation at a 1:20 molar ratio with sMT6ΔF at 37ºC for 16 h. (D) Cleavage products were assigned by MALDI-TOF mass spectrometry by comparison of measured with predicted mass to charge ratios (m/z) with +1 charge ionization ([M + H]+). An arrow indicates deconvoluted cleavage sites in the corresponding sequence. 85  As with CXC chemokines, 7 CC chemokines were processed by sMT6ΔF (Fig 3.6). The removal of 4 N-terminus residues from CCL2, CCL7, and CCL13 by sMT6ΔF is consistent with the previous findings of processing by multiple MMPs; these products are receptor antagonists (Chapter 2) (87,114,115). CCL4 (1-69) was cleaved by sMT6ΔF to the product CCL4 (7-69), which is known to have reduced dimeric properties (191). CCL15 and CCL23 were cleaved at multiple sites by sMT6ΔF. These truncation products have enhanced agonist activity (Chapter 2). The processing of CCL16 by sMT6ΔF to result in truncation of the first 4 N-termini residues was previously identified by MMP-2, -8, and -14 processing, though appeared as an intermediate truncation form (Chapter 2). TAILS analysis to identify MT6-MMP substrates: Secretomes from HFL-1 cells were incubated with sMT6ΔF or the catalytically inactive sMT6EΔA as control to identify substrates for MT6-MMP. Samples from two biological replicates were processed by TAILS, using iTRAQ labels 114 and 115 for active and inactive enzyme treatment, respectively. From Exp1, 312 and 224 unique peptides at >95% confidence were identified by Mascot and X! Tandem respectively (Fig 3.7A) combined to 407 unique peptides. From Exp 2, Mascot and X! Tandem searched identified 224 and 166 unique peptides with >95% confidence respectively for a combined total of 300 unique identifications. Clipper analysis of Exp1 and Exp2, requiring identification in both experiments (written as Exp1XExp2), identified 89 common peptides (Fig 3.7B) (Appendix A.1). Separate Clipper analysis, which has extremely stringent requirements for the quality of the spectra to peptide assignment, identified an additional 219 and 112 peptides in the Exp1 and Exp2 data sets that were not common to Exp1XExp2 (Fig 3.7) (Appendix A.2, A.3). The N-terminal semi-tryptic peptides derived from the natural N-terminus of full-length proteins (± N-terminal methionine or ± signal peptide) were assumed to be unchanged and equally distributed in both sMT6ΔF- and sMT6EΔA-treated secretomes. The natural N-termini peptides were equally distributed between natural unblocked termini that were now labeled by iTRAQ and natural blocked peptides that were identified as being  86  Figure 3.6 CC chemokine processing by MT6-MMP. (A) Human CCL chemokines were incubated with recombinant sMT6ΔF at 1:20 molar ratios at 37ºC for 16 h. Cleavage assay products were visualized on silver-stained 15% Tris-Tricine gels. (B) Cleavages of the CCL chemokines listed were not detectable by MALDI-TOF following incubation at a 1:20 molar ratio with sMT6ΔF at 37ºC for 16 h. (C) Cleavage products were assigned by MALDI-TOF mass spectrometry by comparison of measured with predicted mass to charge ratios (m/z) with +1 charge ionization ([M + H]+). An arrow indicates deconvoluted cleavage sites in the corresponding sequence.  87  Figure 3.7 Venn diagram of the number of peptides identified by TAILS analysis. (A) Four-way Venn diagram of unique peptide identifications, with ≥95% confidence, by Mascot and X!Tandem in experiments (Exp)1 and Exp2. (B) Two-way Venn diagram of all unique peptides identified, after combining Mascot and X!Tandem search results for one experiment, only in Sec1, Sec2, or in both experiments. (C) Two-way Venn diagram of unique peptides that have reached the experimental cutoff for that dataset identified in Sec1, Sec2, or in both experiments.  88  acetylated (Fig 3.8)—distributions that are similar to previous TAILS analyses of secretomes (318,319). The mean log2(ratio) of natural N-terminus peptides was used for data normalization. The Exp1xExp2 data set included 32 unique peptides that were used for normalization (Appendix A.1) having a standard deviation of 0.24 (Fig 3.9A). The Exp1 data set included 82 unique peptides that were used for normalization (Appendix A.2), having a standard deviation of 0.27 (Fig 3.9B). The Exp2 data set included 31 unique peptides used for normalization (Appendix A.3), having a standard deviation of 0.60 (Fig 3.9C). We assumed that MT6-MMP processing of soluble substrates would result in an iTRAQ ratio of 114(sMT6ΔF)/115(sMT6EΔA) ≥ 1 whereas a ratio ≤ 1 would indicate degradation of the n-terminus. To have increased confidence in the substrates identified, the value of the cutoff ratio for each experiment ≥ 2 standard deviations from the mean. Ultimately, 171 peptides corresponding to 58 unique proteins met the criteria for inclusion. Proteins that were identified in biological replicate experiments were considered to be the highest confidence candidate substrates of MT6-MMP (Table 3.1) whereas those identified by more ≥ 2 spectra or by 1 spectra were considered to be high confident (Table 3.2) or candidate substrates of MT6-MMP (Table 3.3) requiring biochemical validation, respectively. Vimentin has chemotactic potential for THP-1 cells that is lost following MMPprocessing: We identified vimentin as a highest confidence substrate of MT6-MMP (Table 3.1) by 10 different peptides, three of which were common to both experiments. The location of the peptides identified are indicated on the vimentin sequence (Fig 3.10A). Previous proteomics experiments have identified vimentin as a substrate for MMPs but this was never biochemically validated (Overall lab, unpublished data). By in vitro cleavage assay, we confirmed that vimentin is cleaved not only by sMT6ΔF but also by all MMPs evaluated (3.10B). Vimentin is expressed on the surface of apoptotic neutrophils (328), and increases macrophage activity (329). Based on this information, we reasoned that vimentin may be a monocyte chemoattractant, acting as an “eat-me” signal (305). In a Transwell migration assay, we show that full-length vimentin is a chemoattractant for THP-1 cells whereas MMP-cleaved vimentin is not (Fig 3.10C). The 89  Figure 3.8 Natural N-termini distribution. Analysis of peptides identified in biological replicate experiments. Distribution of Nterminal modifications among original N-termini identified by TAILS analysis of (A) Exp1xExp2 (n=133 peptides). (B) Exp1 (n=82 peptides). (C) Exp2 (n= 31 peptides).  90  Figure 3.9 Distribution of all peptides. Histogram distribution of log2(iTRAQ ratio) of all normalized peptides (A) Exp1xExp2, (B) Exp1, (C) Exp2. Vertical lines indicate the cut-off ratio for each experiment. 91  Table 3.1 Highest confident candidate substrates of MT6-MMP Substrates were identified by the same peptide in biological replicates following HFL secretome treatment with sMT6ΔF (114 label) or sMT6EΔA (115 label). *indicates additional peptide identification in Exp1, §indicates additional peptide identification in Exp2. Protein Ratio Peptide 114/115 2 26S protease regulatory 1.82 ALDGPEQMELEEGKAGSGLR subunit 8 22 Actin 0.64 GFAGDDAPR 31 2.22 AVFPSIVGR 107 11.14 LTEAPLNPKANR 300 4.41 VLSGGTTMYPGIADR 8 4.53 LVVDNGSGMCKAGFAGDDAPR* 45 26.19 VMVGMGQKDSYVGDEAQSKR§ 54 21.62 SYVGDEAQSKR§ 1001 Collagen type I α-1 chain 10.29 GPPGLAGPPGESGR 977 31.73 GPSGEPGKQGPSGASGER§ 1004 10.98 GLAGPPGESGR§ 36.17 1005 LAGPPGESGR§ 42.57 1006 AGPPGESGR§ 12.67 1050 APGAPGPVGPAGKSGDR§ 12.27 1052 GAPGPVGPAGKSGDR§ 0.36 1075 AGPVGPVGAR§ 6.55 1237 SLSQQIENIR§ 23.76 1239 SQQIENIR§ 868 Collagen type I α-2 chain 1.42 GAPGILGLPGSR 333 2.33 VGAAGATGAR 1141 4.68 SLNNQIETLLTPEGSR 113 17.94 FQGPAGEPGEPGQTGPAGAR§ 115 14.84 GPAGEPGEPGQTGPAGAR§ 121 0.65 GEPGQTGPAGAR* 331 20.15 GPVGAAGATGAR§ 370 48.93 GPPGPSGEEGKR§ 385 1.48 GEAGSAGPPGPPGLR* 559 43.99 GPSGPAGEVGKPGER§ 784 7.94 GMTGFPGAAGR§ 808 23.30 GPPGPAGKEGLR§ 868 3.10 GAPGILGLPGSR§ 967 24.51 GPVGPAGKHGNR§ 1103 38.25 VSGGGYDFGYDGDFYR§ 1109 10.94 DFGYDGDFYR§ 14.89 1110 FGYDGDFYR§ 29.73 1111 GYDGDFYR§ 27.86 1112 YDGDFYR§ 20.83 1144 NQIETLLTPEGSR§ 39.22 1142 LNNQIETLLTPEGSR§ 25.98 1143 NNQIETLLTPEGSR§ 92  Protein  Cystatin-C  IGFBP-5  IGFBP-7  MT6-MMP  Transgelin Tropomyosin α-4 chain  Vimentin  YIPF3  Ratio 114/115 42.37 22.07 5.54 26.71 26.35 7.48 31.22 0.63 2.97 0.18 0.29 1.46 2.42 6.72 32.03 8.38 36.59 8.67 4.41 8.83 23.62 8.73 17.25 0.66 3.56 0.68 19.62 15.24 0.58 2.05 1.55 0.30 0.65 35.77 0.39 8.83 2.69 4.21 0.71  Peptide 1146 1149 35 35 36 37 42 164 213 165 166 98 98 99 100 318 29 254 255 318 359 386 473 2 133 16 115 134 55 87 88 54 91 114 258 295 296 330 321  IETLLTPEGSR§ LLTPEGSR§ LVGGPMDASVEEEGVRR LVGGPMDASVEEEGVR VGGPMDASVEEEGVR§ GGPMDASVEEEGVR§ ASVEEEGVR§ KFVGGAENTAHPR AVYLPNCDR FVGGAENTAHPR§ VGGAENTAHPR* AGAAAGGPGVSGVCVCKSR AGAAAGGPGVSGVCVCKSR§ GAAAGGPGVSGVCVCKSR§ AAAGGPGVSGVCVCKSR§ EGNFDAIANIR VSLGVDWLTR* FYQGPVGDPDKYR* YQGPVGDPDKYR* EGNFDAIANIR* FWEGLPAQVR§ SGPQFWVFQDR* GDTYFFKGAHYWR* ANKGPSYGMSR LVILEGELER ALQQQADEAEDR* AKHIAEEADR§ VILEGELER§ SSPGGVYATR SLADAINTEFKNTR LADAINTEFKNTR ASSPGGVYATR§ AINTEFKNTR* FANYIDKVR§ VDVSKPDLTAALR§ FADLSEAANR§ ADLSEAANR§ VDALKGTNESLER§ DIPAMLPAAR  93  Table 3.2 High confident candidate substrates of MT6-MMP. Substrates were identified by ≥ 2 spectra following HFL secretome treatment with sMT6ΔF (114 label) or sMT6EΔA (115 label). *indicates peptide identification in Exp1, §indicates peptide identification in Exp2. Protein Ratio Peptide No. of 114/115 Spectra 13 Α-actinin-1 24.56 MQPEEDWDR§ 2 576 Collagen type II α-1 chain 43.76 GPAGPAGER§ 2 825 § 8.59 GATGFPGAAGR 2 76 Collagen type IV α-2 chain 6.84 GLQGFPGLQGR§ 1 461 § 20.66 FPGLPGSPGAR 1 651 32.24 GPAGTPGQIDCDTDVKR§ 1 655 § 5.81 TPGQIDCDTDVKR 1 443 Collagen type VI α-1 chain 1.71 GDPGEAGPQGDQGR* 1 497 16.85 GPPGDPGLMGER§ 2 500 § 7.81 GDPGLMGER 1 Collagen type VI α-3 chain 2.96 3106 LTETDICKLPKDEGTCR§ 1 131 § Dickkopf-related protein 3 33.89 TVITSVGDEEGR 2 54 15.46 VEELMEDTQHKLR§ 1 252 § 51.66 ITWELEPDGALDR 1 20 Extracellular matrix protein 0.15 ASEGGFTATGQR§ 3 1 25 Fibrillin-1 precursor 0.37 ADANLEAGNVKETR§ 2 328 MMP-1 4.98 LEAAYEFADR* 2 364 7.30 IYSSFGFPR* 1 9 Peptidyl-prolyl cis-trans 7.88 DIAVDGEPLGR§ 3 isomerase A 8 8.52 FDIAVDGEPLGR§ 1 309 § Procollagen C37.52 SPSAPDAPTCPKQCR 2 endopeptidase enhancer 1 59 Protein-lysine 6-oxidase 0.61 SLGSQYQPQR* 2 57 4.75 LLSLGSQYQPQR* 2 22 § 0.39 APPAAGQQQPPR 1 58 2.12 LSLGSQYQPQR* 1 139 Serpin H1 0.23 SVSFADDFVR* 2 565 § Sulfhydryl oxidase 1 42.01 AMGALELESR 7 566 32.69 MGALELESR§ 2 84 § Stromal cell derived factor 12.27 GKDLGGFDEDAEPR 1 4 precursor 88 7.94 GGFDEDAEPR§ 1 24 Syndecan-4 7.00 TEVIDPQDLLEGR§ 2 26 § 7.49 VIDPQDLLEGR 1 170 Tropomyosin 3 6.84 LVIIEGDLER§ 1 171 38.06 VIIEGDLER§ 2 22 § Tropomyosin beta chain 41.62 AEQAEADKKQAEDR 2 24 48.86 QAEADKKQAEDR§ 1 74 § 17.45 AEKKATDAEADVASLNR 1 151 23.20 AKHIAEDSDR§ 1 94  Table 3.3 Candidate substrates of MT6-MMP. Substrates were identified by 1 spectra following HFL secretome treatment with sMT6ΔF (114 label) or sMT6EΔA (115 label). *indicates peptide identification in Exp1, §indicates peptide identification in Exp2. Protein Ratio Peptide 114/115 90 40S ribosomal protein SA 4.33 FAAATGATPIAGR§ 425 5,6-dihydroxyindole-221.06 FPLENAPIGHNR§ carboxylic acid oxidase 1 60S ribosomal protein L260.57 MKFNPFVTSDR* like 1 708 α2-macroglobulin 8.24 YESDVMGR* 53 Calumenin precursor 10.54 LGAEEAKTFDQLTPEESKER§ 45 Cellular nucleic acid-binding 50.29 FVSSSLPDICYR§ protein 51 Dihydrolipoyllysine-residue 0.66 DDLVTVKTPAFAESVTEGDVR* succinyltransferase 60 Elongation factor 1-delta 2.58 SLAGSSGPGASSGTSGDHGELVVR§ 170 Fibulin-1 precursor 36.94 EQEDPYLNDR§ Filamin-C 4.27 2304 FTVGPLGEGGAHKVR§ 35 Galectin-1 3.22 LGKDSNNLCLHFNPR§ 447 Galectin-3-binding protein 9.49 FQAPSDYR§ 404 Gelsolin precursor 1.47 GLGLSYLSSHIANVER* 4 Glyceraldehyde-36.84 VKVGVNGFGR* phosphate dehydrogenase Latent-transforming growth 1.48 1729 FEGLQAEECGILNGCENGR* factor beta-binding protein 2 249 5.36 SSAAGEGTLAR§ Nestin 5.54 1397 LLDPAAWDR* 344 Polymerase I and transcript 11.70 VGADDDEGGAER§ release factor 72 Protein disulfide-isomerase 0.45 LYSSSDDVIELTPSNFNR* A6 precursor 56 Protein-lysine 6-oxidase 0.25 SLLSLGSQYQPQR§ 319 Sodium-dependent 51.66 ISSVLQANLR§ phosphate transport protein 156 SPARC 0.63 LDSELTEFPLR* 251 Spondin-2 25.78 FIPPAPVLPSR§ 34 Sulfhydryl oxidase 1 51.66 ALYSPSDPLTLLQADTVR§ precursor 2 Transcription elongation 0.65 ALETVPKDLR* factor SPT4 92 Tubulin α-4A chain 6.46 LITGKEDAANNYAR* 112 VEGF C 1.52 AHYNTEILKSIDNEWR* 2 V-type proton ATPase 2.03 ASQSQGIQQLLQAEKR* subunit G 1 8 WD repeat-containing 6.84 VFASLPQVER§ protein 1 95  Figure 3.10 Vimentin cleavage by MMPs results in a loss of chemotactic potential. (A) Protein sequence of vimentin. Green and red indicate peptides identified with increased or decreased iTRAQ-ratio by TAILS analysis respectively. (B) Vimentin was incubated in the presence of MT6-MMP (25), MMP-1, 2, 7, 8, 9, 12, 13, and 14 at a 1:20 molar ratio for 16 h at 37°C. Cleavage assay products were visualized by silver-stained 15% SDS-PAGE. Arrow indicates full-length vimentin; broken arrow indicates cleavage product in the presence of MT6-MMP. (C) Transwell migration response of THP-1 cells to full-length of MMP-12 cleaved vimentin for 90 min through a 5 µm pore-sized filter. Migrated cells were quantified by CyQUANT assay and displayed as chemotactic index, defined as the ratio of cells migrating in response to stimulus compared with buffer control. Results shown are the mean +/- SEM of 2 biological replicates of experiments completed with 8 replicates.  96  97  peak response was observed at 450 nM, which is high compared with classical chemoattractants including CCL7 (included as a positive control), but comparable with that of other intracellular proteins with chemoattractant potential (330). Validation of TAILS candidate proteins: In addition to vimentin, we biochemically validated highest candidate substrates, and candidate substrates using biochemical cleavage assays of proteins identified by TAILS analysis. By gel electrophoresis, the shift of cystatin C following sMT6ΔF processing is evident and appears complete (Fig 3.11A). Cystatin C processing has previously been shown by MMP-2 (216). By gel electrophoresis and Western blot analysis, sMT6ΔF cleavage of IGFBP-7 was confirmed (Fig 3.11B). IGFBP-7 was previously identified to be an MMP-2 substrate, but was not confirmed. Related to IGFBP-7, IGFBP-1, -2, -3, -4, and -6 were previously confirmed MMP substrates (216,319,331-337). Galectin-1 and SPARC were both identified by only one spectra and so required biochemical validation for inclusion as substrates for MT6-MMP (Table 3.3). A shift is observed by gel electrophoresis in the band corresponding to galectin-1, confirming processing by MT6-MMP (Fig 3.11C); galectin-1 is also processed by MMP-2 and -14 (216,313). SPARC was previously identified as a substrate of MMP-2, 3, 7, 9 and 13 (338,339), and we now confirm processing by sMT6ΔF (Fig 3.11D). Notably, unlike the other proteins validated in vitro, the experiment iTRAQ ratio for SPARC was decreased, indicating degradation. Consistent with this, there is a complete loss of the full-length SPARC band (Fig 3.11D). Discussion Since MT6-MMP is a neutrophil-specific proteinase our hypothesis was that the activity of this cell surface proteinase would be involved in cleavage and regulation of specific inflammatory molecules and pathways involved in innate inflammatory processes. Indeed, 14 chemokines that recruit neutrophils and monocytes were precisely cleaved by MT6-MMP leading to inactivation or activation of their biological activities (Fig 3.5, 3.6). Further, using TAILS proteomics we identified with high confidence 26 candidate substrates and an additional 28 potential substrate of MT6-MMP (Tables 3.1-3.3), several of which are known to contribute to inflammation through leukocyte migration and extracellular matrix remodeling. Gelatin was a poor substrate (Fig 3.4) and with only 20% of the substrates identified in our screens being ECM proteins, rather than being 98  Figure 3.11 Confirmation of novel MT6-MMP substrates. Candidate substrates (A) Cystatin C, (B) IGFBP7, (C) Galectin-1, or (D) SPARC were incubated in the presence of sMT6ΔF at a 1:20 molar ratio for 16 h at 37°C. Cleavage assay products were visualized by silver-stained SDS-PAGE. Arrow indicates full-length protein; broken arrow indicates cleavage product in the presence of MT6-MMP.  99  primarily an extracellular matrix degrader, MT6-MMP appears to be primarily involved in inflammatory cell regulation. Neutrophils are amongst the first cells recruited, and remain present for the first two days of the early phase of wound healing. The predominant neutrophil chemoattractant CXCL8 is produced by macrophages, monocytes and neutrophils, and is activated by MMP-8, -9, -12, -13, and -14 (87,89,220,287). Similarly, the murine (m) orthologue CXCL5/LIX is activated by MMP-8, and -9 (89,220). In an air pouch model of inflammation, mice lacking neutrophil-specific MMP-8, specifically Mmp8-/- mice, had deficient cellular recruitment to LPS and full-length mCXCL5/LIX but an equivalent response to truncated mCXCL5/LIX when compared with wild-type counterparts, indicating that MMP-8 is important for chemokine activation in vivo (89). Moreover, this suggests a positive feedback mechanism wherein recruited neutrophils propagate the inflammatory response by both releasing and activating the chemokine responsible for further neutrophil recruitment. Following activation by CXCL8 and IFN-gamma, neutrophils express MT6-MMP on the surface and release the enzyme in an active, soluble form (72,101). We identified that MT6-MMP processes the neutrophil chemoattractants CXCL2 and CXCL5 to the products CXCL2 (5-73) and CXCL5 (8-78) (Fig 3.5D). CXCL2 (5-73) has enhanced agonist activity with stronger calcium mobilization and chemotactic potential than full-length CXCL2 (162). Similarly, CXCL5 (8-78) is a stronger receptor agonist than CXCL5 (1-78) (89,164,220,296). Together, these results suggest a role for MT6-MMP in promoting neutrophil migration, acting in a positive feedback manner similar to that observed for MMP-8 activation of CXCL8. Notably, while mCXCL5/LIX was cleaved by MT6-MMP (Fig 3.5A), CXCL8 was not (Fig 3.5C), suggesting that the two neutrophil-specific enzymes function differently, perhaps in a temporal-dependent manner to amplify the CXCL8 response. In contrast, the MT6-MMP cleavage of the neutrophil chemoattractant CXCL6, which was also observed from all MMPs evaluated (Fig 3.5B), is likely to cause chemokine inactivation since truncation occurs beyond the conserved cysteine residues. While in vitro cleavage assays provide an indication of in vivo substrates of proteases, it lacks the temporal and spatial regulation that would occur in vivo. As yet, there has not been a comprehensive study to elucidate the kinetics of chemokine production. Further, 100  abundance of chemokine, as detected by ELISA, does not indicate the functionality of chemokines in acute or chronic inflammation. Yet, we predict that, based on cellular sources, CXCL2 and CXCL5 released by activated neutrophils and epithelial cells, respectively, are activated by MT6-MMP for early recruitment of neutrophils. CXCL6 production is more tightly regulated then CXCL5, and appears to be more critical in disease than in acute inflammation (340,341). In addition to promoting neutrophil recruitment, we propose that MT6-MMP promotes the recruitment of monocytes to progress the inflammatory response to the next cellular stage. Both CCL15 and CCL23 are produced by macrophages and monocytes, but are relatively weak CCR1 receptor agonists in the full-length form. In vitro processing of CCL15 and CCL23 by MT6-MMP results in N-termini-truncated forms (Fig 3.6A, 3.6C) that were previously shown to have increased agonist activity with increased chemotactic potential (Chapter 2). This suggests a role for neutrophils, through MT6MMP, in a positive feed-forward mechanism to progress the inflammatory response through increased recruitment of monocytes expressing CCR1. In contrast to CCL15 and CCL23, which require proteolytic activation, CXCL12, CCL2, CCL7, CCL13 lost agonist activity or become receptor antagonists following N-termini truncation (87,114,115,181), which was observed by MT6-MMP proteolysis (Fig 3.5D, 3.6C). Once recruited to tissue, monocyte receptor expression changes from CCR1high (binding CCL15 and CCL23) to CCR2high (CCL2) thus this differential processing of chemokines by MT6-MMP may function to halt recruited cells—signaling that they have reached the target site. In addition to chemoattractant processing, cleavage of the proteoglycans can alter haptotactic gradients to contribute to cell recruitment. Syndecan is a proteoglycan with heparan sulfate glycosaminoglycans. MMP-7 processing of syndecan enabled for passage of the chemokine-bound proteoglycan into the alveolar space to contribute to chemotactic gradient formation (342). We have identified syndecan-4 processing by MT6-MMP in the extracellular region of the protein (Table 3.2), suggesting that a similar role may exist for MT6-MMP processing in developing a chemotactic gradient. In contrast, inhibition of cell migration by MT6-MMP may occur through modification of GAG binding. The lymphocyte chemoattractant CXCL9 is processed in the C-termini by 101  MT6-MMP to CXCL9 (1-90) (Fig 3.5A, D) a site previously observed by MMP-7, 8, and 12 proteolysis (154,343). The significance of this cleavage was not ascertained, though in removing five positively charged residues, we predict that there would be a reduction in GAG binding, and thus loss of the chemotactic gradient associated with this chemokine. A similar effect was previously observed following MMP-truncation within the C-termini of CXCL11 (154). One of the highest candidate substrates by TAILS analysis was vimentin (Table 3.1). Intracellularly, vimentin functions to anchor organelles within the cytosol, but recent studies have suggested a bona fide extracellular role for this “moonlighting” protein (34). Vimentin is actively secreted by macrophages following TNF- α stimulation to increase ROS production (329), In addition, vimentin is expressed on the surface of apoptotic neutrophils, though only detected by antibodies to regions in the C-termini (328). Neutrophil apoptosis is a final critical event, important for chemotaxis and activation of macrophages (268,304-306), and during which there is enhanced surface expression of MT6-MMP (101). We found that full-length vimentin is chemotactic for THP-1 monocytic cells, but this chemotactic potential is lost following MMP processing (Fig 3.10C). Therefore, we propose that MT6-MMP processes necrosis-released vimentin, whereas cell-surface bound vimentin chemoattracts and signals to macrophages for specific cell clearance by phagocytosis. A number of proteins identified by TAILS analysis are components of cell proliferation collagen production, likely to be involved in the early phase of wound healing. Peptides for insulin-like growth factor binding protein (IGFBP)-5 and -7 were found increased in the secretome treated with active MT6-MMP compared with inactive enzyme (Table 3.1). IGFBP-7 was confirmed to be a substrate of MT6-MMP by SDS-PAGE (Fig 3.11B) and Western blot (results not shown) of in vitro cleavage assay products. Similarly, TAILS analysis suggests that IGFBP-5 is a candidate substrate of MT6-MMP (Table 3.1). IGFBP-1, -2, -3 and -4 and -6 were previously shown to be MMP substrates (116,287,313,319,331-335,337). IGFBPs are critical regulators of IGF; sequestering and inhibiting the activity of approximately 99% of circulating IGF (344,345). Unbound IGF binds surface expressed IGF receptor to promote cell growth (346,347). Thus, cleavage and inactivation of IGFBPs would promote IGF activity. 102  Galectin-1 and SPARC were both identified by only one spectra and so required biochemical validation for inclusion as substrates for MT6-MMP (Table 3.3). Both are matricellular proteins with multifunctional roles including proinflammatory function, and wound healing (348-350). Galectin-1 is a substrate of MMP-2 and -14 (216,313), whereas SPARC is cleaved by MMP-1, -3, -7, -9 and -13 (338,339). We now confirm processing of both proteins by MT6-MMP in vitro (Fig 3.11C, D). This result highlights the strength of this TAILS analysis, to identify protease substrates by single spectra. Consistent with this, type IV collagen was previously shown to be a substrate of MT6MMP (103), though was identified in only one experiment (Table 3.2). In contrast, type I collagen was identified by biological replicate experiments by 24 peptides (Table 3.1) but previously found to not be a substrate by catalytic domain MT6-MMP (103). The MMP hemopexin domain is required for binding and perturbing the structure of native collagen (65) and thus could explain the differences observed. Alternatively, the collagen type I proteolysis observed in the TAILS analysis by MT6-MMP might be through an indirect effect by increasing the activity of a stronger collagenase. The cysteine protease cathepsin K has strong collagenase activity (351) that would normally be inhibited by cystatin C. Previously shown to be a substrate of MMP-2 (116), cystatin C was identified as one of the highest confidence candidate substrate for MT6-MMP by 5 peptides with increased ratios (Table 3.1). Mutational loss of cystatin C activity is linked with diseases associated with protein deposition (352,353), likely through loss of inhibitory activity towards cysteine protease and the metalloprotease meprin (354). MT6-MMP proteolysis of cystatin C is complete in vitro, confirming the protease inhibitor to be a substrate for MT6-MMP (Fig 3.11A) and implicating MT6-MMP in modification of the ‘protease web’. Through hypothesis-directed and hypothesis-generating approaches, we have confirmed and identified a number of candidate MT6-MMP substrates. These results implicate MT6-MMP in contributing to neutrophil recruitment through the activation of CXCL2 and CXCL5, and in the progression of the acute inflammatory response toward monocyte recruitment by activation of CCL15 and CCL23. Further, interstitial roles for MT6-MMP are proposed wherein monocyte chemoattractants, including vimentin, are processed to halt haptotaxis. In view of the biological activities of the new MT6-MMP 103  substrates and cleavage products we propose a model whereby MT6-MMP contributes to this regulatory environment of inflammation and wound healing at multiple stages.  104  CHAPTER 4: DETERMINATION OF THE MT6-MMP SUBSTRATE DEGRADOME BY ITRAQ-TAILS QUANTITATIVE PROTEOMICS Synopsis Proteolysis of signaling proteins, cell-surface molecules and intercellular signaling molecules is an irreversible modification that alters the function of these proteins. As such, identification of protease substrates is critical to understanding the biological role of a protease in vivo. Membrane-type (MT) 6-matrix metalloproteinase (MMP) is implicated in inflammatory disease and is associated with a number of cancers, yet few substrates have been identified for this neutrophil-specific protease. We applied the quantitative proteomics method isobaric tag for relative and absolute quantitation terminal amine isotopic labeling of substrates (iTRAQ-TAILS), to identify novel substrates of MT6-MMP. Since neutrophils traverse through vascular endothelium to the subjacent connective tissue we examined conditioned media proteins and membraneenriched proteins from human microvascular endothelial (HMEC) cells and human fetal lung fibroblasts (HFL-1) grown in the presence of exogenous soluble, constitutively active MT6-MMP protein (sMT6ΔF) or an inactive counterpart (sMT6EΔA). From 463 proteins identified, 218 showed a significant change in iTRAQ ratios and are considered candidate substrates of MT6-MMP. Known substrates of other MMPs, including prosaposin, galectin-1, progranulin and cluster of differentiation (CD)59 were identified indicating they were high confidence MT6-MMP substrates, as was a protein not previously identified to be an MMP-substrate, namely endoplasmic reticulum-Golgi intermediate compartment (ERGIC)-53. This unbiased approach provides a reference to begin to more fully elucidate the roles of MT6-MMP.  Introduction Proteolysis is a non-reversible modification of protein structure. While degradation is the cleavage of proteins at multiple sites leading to the clearing of a protein, specific proteolytic processing results in a modified protein with a new amino (N)-terminus, termed the neo-N-terminus, often with an altered or even completely different function. Understanding how a protease functions depends upon knowing the substrate repertoire. A number of methods have been used to identify the substrates of a given 105  protease—including directed approaches using the knowledge base of related proteases, to more sophisticated unbiased screens. Recently, proteomics approaches, and more specifically, mass spectrometry-based techniques have led the way in substrate identification (312,355,356) We recently developed a method for the quantitative identification of N-termini (318). Termed terminal amine isotopic labeling of substrates (TAILS), this method enriches for N-termini through the use of an amine reactive polymer. Originally using dimethylation for quantification, TAILS was enhanced by the introduction of isobaric tags for relative and absolute quantification (iTRAQ) labels (319). In brief, primary amines from samples treated with and without protease are differentially iTRAQ labeled at the protein level, combined and then digested with trypsin. This results in a mixture of peptides with labeled natural N-termini, neo-N-termini, and lysine residues but unlabeled internal peptides. Using an amine-reactive polymer, only unlabeled internal peptides are removed, thus enriching for the natural and neo-N-termini. This is a powerful approach and an important advance in the identification of matrix metalloproteinases (MMPs) that has been applied to elucidate substrates of MMP-2, MMP-8 and MMP-9 (318,319,321). The MMPs are a family of 23 endopeptidases with a broad specificity and diverse substrate repertoire. First identified by the collagenolytic activity of MMP-1, the role of MMPs was traditionally considered to reside in degradation of the extracellular matrix. Due to substrate discovery methods including yeast 2-hybrid (114) and TAILS, it is now recognized that MMPs have a critical role in the processing of bioactive molecules including those involved in cell adhesion, proliferation, migration and inflammation. Some MMPs have been well investigated resulting in significant knowledge of their substrate repertoire. In contrast, membrane-type (MT)6-MMP has been the focus of very few studies. MT6-MMP is produced primarily by neutrophils (52). It is membrane bound through a GPI-anchor (51) and located both in neutrophil granules and in lipid rafts in the plasma membrane (101). Following neutrophil activation, MT6-MMP is released from granules (72) presumably as a component of the neutrophil arsenal as it passes through the endothelium into infected tissue where these cells are critical in the elimination of 106  pathogens and the progression of the acute inflammatory response to promote healing. Despite evidence for a role of MT6-MMP in development, inflammatory diseases and cancer, the number of known substrates is limited. Substrates include collagen IV, gelatin, fibronectin, fibrin (103), α1-proteinase inhibitor (109,112) and myelin basic protein isoforms (109). In addition, we previously identified candidate substrates of MT6-MMP from a human fetal lung fibroblast (HFL) secretome (Chapter 3), including galectin-1, insulin-like growth factor binding protein (IGFBP)-7, cystatin C and chemokines, suggesting roles for the protease in inflammation and wound healing. To build upon this data, we sought to evaluate MT6-MMP proteolysis in a cellular system as we have done previously for MT1-MMP and MMP-2 (116,216,313). To represent the proteome that MT6-MMP is likely to encounter we used proteomes from both HFL and human microvascular endothelial cells (HMEC). Despite the challenge of analyzing data that is subject to biological effects such as protein synthesis and endocytosis, our approach has successfully identified candidate substrates for this previously modestly characterized MMP.  Material and Methods Proteins: Recombinant human soluble, constitutively active MT6-MMP protein (sMT6ΔF) and its inactive counterpart (sMT6EΔA) were expressed and purified as previously described (Chapter 2). Bradford assay (Bio-Rad) was used to quantify the amount of sMT6EΔA, whereas sMT6ΔF was quantified by active-site titration with recombinant TIMP-1 against the universal MMP quenched fluorescent substrate having the sequence Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2, at excitation/emission wavelengths of 320/405 nm. Cell culture and proteome preparation: HFL-1 cells (obtained from Dr C. Roberts, University of British Columbia, Canada) were grown to 80-90% confluency in DMEM containing 10% fetal bovine serum. HMEC cells at passage number 17 were grown to 80-90% confluency in MCDB 131 media supplemented with 10% fetal bovine serum, 10 ng/ml endothelial growth factor, antibiotics (penicillin and streptomycin) And glutamine. Cells were washed three times with phosphate-buffered saline (PBS) and then twice 107  with serum-free media. Cells were grown in appropriate serum-free containing sMT6ΔF or sMT6EΔA at a final concentration of 0.1 µg/ml for 20 h at 37 °C, 5% CO2. For conditioned medium preparation, media was harvested, and protease inhibitors were added (1 mM phenylmethylsulfonyl fluoride, 1 mM EDTA, 1 µM pepstatin, 5 µM E64). The conditioned medium was clarified by centrifugation at 1,500 X g for 10 min and filtered (0.22 µm filter). Conditioned media was concentrated 100-fold, and buffer exchanged to 50 mM HEPES, pH 8.0, by ultracentrifugation using 3-kDa cutoff membranes according to manufacturers instructions (Centricon; Amicon). The protein concentration was measured by Bradford assay (Bio-Rad) and stored at -70 °C prior to iTRAQ labeling. After removal of conditioned medium, membrane-enriched protein fractions were prepared as previously described (357). Briefly, cells were washed with PBS and detached in versine (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 . 7H2O, 1.8 mM NaH2PO4, 0.5 mM EDTA, 1.1 mM glucose, pH 7.4). Cells were then washed in cold membrane buffer (50 mM HEPES, 200 mM NaCl, 10 mM CaCl2, pH 6.8), pelleted by centrifugation and resuspended in fresh membrane buffer containing protease inhibitors (as above). Cells were lysed on ice by nitrogen decompression for 30 min at 600 lb/in2 N2 in a cell disruption bomb (Parr Instrument Co., Moline, IL). Following rapid decompression and cell lysis, the cell lysate was centrifuged at 1,100 X g for 10 min at 4 °C. The supernatant was then centrifuged at 48,000 X g for 60 min at 4 °C. Membrane pellets were resuspended in an equal volume (less than150 µl) of 8.0 M GuHCl and 100 mM HEPES, pH 8.0. The protein concentration was measured by Bradford assay (BioRad) and stored at -70 °C prior to iTRAQ labeling. Terminal amine isotopic labeling of substrates (TAILS): To enrich for N-terminus peptides a 4-plex iTRAQ-TAILS was applied for each HFL or HMEC experiment (318,319). The method is outlined schematically in Figure 4.1. The four conditions came sMT6ΔF- or sMT6EΔA-treatment comparisons of both conditioned medium and membrane fractions. Briefly, GuHCl and HEPES were added to conditioned media and membrane-fractions to a final concentration of 2.5 M and 250 mM respectively, in a final 108  Figure 4.1 Schematic of method. Overview of the method for analysis of the TAILS analysis of conditioned medium and cell membrane fractions. Cells (HFL or HMEC) were treated with active (sMT6ΔF) or catalytically inactive (sMT6EΔA) protease in serum-free medium for 20 h at 37°C. Conditioned medium was collected and concentration, and membrane fractions prepared. Fractions were labeled with iTRAQ reagents and then combined for the TAILS procedure. Precipitated proteins were labeled, digested with trypsin and then the N-terminome was enriched by incubation with an amine-reactive polymer. Unbound (natural blocked or neo-N-termini) peptides were fractionated and fractions then evaluated by LC MS/MS. Mascot searches and X-Tandem searches were performed and analyzed with the TransProteomic Pipeline separately. Mascot and X!Tandem search results were then combined by Clipper and analyzed. Conditioned medium and membrane fractions were analyzed separately, and compared with biological replicate experiment in Clipper.  109  110  volume of 541 µl. Proteins were denatured with 1 mM tris(2-carboxyethyl)phosphine at 65 °C, and cysteines were alkylated with 5 mM iodoacetamide. Proteins from conditioned medium treated with sMT6ΔF or sMT6EΔA were labeled with iTRAQ labels 114 and 115, respectively. Proteins from membranes treated with sMT6ΔF or sMT6EΔA were labeled with iTRAQ labels 116 and 117, respectively. The amounts of protein labeled within one experiment were equal, though between experiments ranged from 250-350 µg/label. After 30 min at 25 °C, the reaction was quenched with 100 mM ammonium bicarbonate. Labeled samples were combined and precipitated with 9 volumes of acetone/ methanol (8:1 volume ratio) at -20 °C. Protein precipitate was pelleted by centrifugation at 2,500 X g for 30 min at 4 °C, washed with methanol, and resuspended in 50 mM HEPES for digestion with TrypsinGold (Promega) at a 1:100 enzyme:protein ratio for 16 h at 37 °C. Complete digestion was confirmed by silverstained 15% SDS-PAGE. Enrichment of N-termini was carried out under acidic conditions at 37 °C for 16 h using a dendritic polyglycerol aldehyde polymer to deplete internal and C-terminal peptides. N-terminally blocked peptides, due to iTRAQ labeling or natural acetylation, were obtained from the unbound fraction by centrifugation through 10-kDa cut-off membranes (Centricon; Amicon). Samples were fractionated on a 1,200 series HPLC (Agilent Technologies) using a polysulfoethyl A 100 x 4.6 mm, 5 µm, 300 column (PolyLC Inc). Peptides were bound to the column and washed for 15 min with 10 mM potassium phosphate, 25% acetonitrile, pH 2.7. Peptides were eluted with a 22 min gradient from 0-0.3 M NaCl, then 6 min from 0.3-0.4 NaCl and 2 min 0.4-1.0 M NaCl. Fractions collected every 1.5 min were concentrated under vacuum and desalted using C18 OMIX tips. Peptide samples were analyzed by nanospray LC-MS/MS using a C18 column interfaced with a QStar XL Hybrid ESI mass spectrometer (Applied Biosystems). TAILS analysis: Acquired MS2 scans were searched using both Mascot (version 2.2.2 Matrix Science) and X! Tandem (2007.07.01 release) against a human International Protein Index (IPI) protein database (v.3.69). Search parameters were: Semi-ArgC cleavage specificity with up to 2 missed cleavages; fixed modifications of cysteine carbamidomethylation and lysine iTRAQ; variable modifications of N-terminal iTRAQ, N111  terminal acetylation, methionine oxidation; peptide tolerance and MS/MS tolerance at 0.4 Da; scoring scheme was ESI-QUAD-TOF. Search results were analyzed with the TransProteomic Pipeline (TPP) (TPPv.4.3, rev 0, Build 200902191420) using PeptideProphet for peptide identification and Libra for quantification of iTRAQ reporter ion intensities (324,325). Each data set was modeled by TPP and included only the peptides with an iProphet probability error rate ≤ 5%. Using in house software (321), termed Clipper, data sets were converted to a common format using ClipperConvert. Mascot and X! Tandem lists were combined for each experiment. To obtain high confidence substrates, tandem analysis of biological replicate experiments by Clipper was performed with the requirement that peptides must be identified by both experiments. In addition, a separate evaluation of each experiment was performed in Clipper, requiring identification only once but so forming a lower confidence peptide list. Conditioned medium and membrane fractions were then separated for analysis. The data was normalized using a correction factor obtained by analysis of the average log2(ratio) for all labeled peptide pairs in that data set. Candidate substrates were identified as those having a ratio ≥ 1 standard deviation from the mean. These results were narrowed to include only proteins identified by ≥ 2 spectra. Analysis of cleavage specificity sequence: To determine the preferred sequence specificity of MT6-MMP, TAILS data sets were analyzed with the iceLogo web application (http://iomics.ugent.be/icelogoserver/main.html) (323) against the homo sapiens reference library. The sequence was determined for residues P4-P4’ from all unique neo-N-terminus peptides identified by TAILS that did not include Arg at the P1 position. A second analysis was performed with the further condition that the included peptides must also have a ratio ≥ 1 standard deviation for the data set that it was identified in (i.e. only peptides from substrate candidates).  Results The majority of proteins were identified by a single peptide. This is not unexpected since TAILS analysis enriches for N-termini and so the measure of success of a TAILS 112  experiment is exactly this. In the case of natural N-termini, the few proteins that were identified by multiple peptides represent peptides differing in the presence of the initiating Met residue (e.g. HFL2 conditioned medium: Elongation factor 2) or missed tryptic cleavage (e.g. HFL2 conditioned medium: protein-lysine 6-oxidase). For neo-Ntermini, multiple peptide identifications represent different internal sites of proteolysis (e.g. vimentin). All identified peptides are provided in Appendix B. From HFL conditioned medium, a total of 121 unique proteins were identified with 20% overlap between biological replicates whereas 234 unique proteins were identified in HFL membranes with 23% overlap between biological replicates (Table 4.1; Fig 4.2B). Similarly, the number of unique proteins identified in the conditioned media of HMEC cells was lower than that of the membrane fraction at 230 versus 280 respectively. Further, 32% and 20% of the proteins were identified by replicate experiments from HMEC conditioned medium and membrane fractions respectively (Table 4.2; Fig 4.2C). The low degree of overlap between biological replicates is due in part to the effects of biology that can not be controlled in an open system such as used here, wherein protein synthesis and secretion is modified by exogenous protein. Additionally, under-sampling is an inherent issue in mass spectrometry, in that a limited number of peptides are sequenced and identified.  Table 4.1 Number of proteins (and peptides) identified in HFL experiments based on IPI identification Conditioned Medium HFL1 HFL2 Total 35 (37) 110 (135)  Membrane HFL1 HFL2 74 (85) 214 (255)  Natural N-termini  19 (19)  61 (63)  43 (45)  127 (130)  Neo N-termini  16 (18)  52 (72)  31 (30)  92 (125)  113  Figure 4.2 Venn diagrams of the identified peptides. Mascot and X!Tandem analysis of TAILS data indicating the number and overlap of peptides found from each experiment. (A) Number of peptides identified in the conditioned medium in the experiments HFL1, HFL2, HMEC1 or HMEC2). (B) Number of peptides identified in the membrane fraction in the experiments HFL1, HFL2, HMEC1 or HMEC2).  114  Table 4.2 Number of proteins (and peptides) identified in HMEC experiments based on IPI identification  Total  Conditioned Medium HMEC1 HMEC2 180 (214) 123 (146)  Membrane HMEC1 HMEC2 263 (296) 72 (77)  Natural N-Termini  107 (108)  50 (51)  169 (176)  46 (50)  Neo N-Termini  79 (106)  75 (95)  101 (120)  26 (27)  iTRAQ-TAILS analysis: Under the assumption that the majority of peptides identified would not be altered due to MT6-MMP proteolysis, the data was normalized using the mean ratio for each data set. All data sets conformed to a Gaussian distribution, suggesting that this assumption is accurate. The histograms of the HFL data sets are shown in Figure 4.3, and the HMEC data sets are shown in Figure 4.4. Recently, a statistical approach was developed to set a cut-off value for TAILS data that enables confident substrate identification (321). This approach works well for a system in which biological variance is limited, such as addition of exogenous protease to a previously harvested secretome in vitro (319,321) but is not appropriate for a system that is subject to perturbation by exogenous protease activity, such as cultured cells. In fluid systems, such as that evaluated here, the cutoff ratio for determining proteasegenerating peptides is based on known substrates (216,313,358). Since very few MT6MMP substrates have been identified, a combination of these techniques was applied. The cut-off ratio was set to 1 standard deviation from the mean. Tables 4.3 to 4.6 list the candidate substrates of MT6-MMP identified by biological replicate experiments or by multiple spectra in one experiment from conditioned medium and membrane fractions of HFL treated cells. The corresponding lists from HMEC cells are shown in Tables 4.7 to 4.10.  115  Figure 4.3 Distribution of HFL iTRAQ ratios. Histogram distribution of log2(iTRAQ ratio) of all normalized peptides in (A) HFL1xHFL2 conditioned media, (B) HFL1 conditioned media (C) HFL2 conditioned media (D) HFL1xHFL2 membrane fraction (E) HFL1 membrane fraction (F) HFL2 membrane fraction. Bars represent all peptides, red squares are neo-N-termini, and blue squares are natural N-termini.  116  Figure 4.4 Distribution of HMEC iTRAQ ratios. Histogram distribution of log2 (iTRAQ ratio) of all normalized peptides in (A) HMEC1xHMEC2 conditioned media, (B) HMEC1 conditioned media (C) HMEC2 conditioned media (D) HMEC1xHMEC2 membrane fraction (E) HMEC1 membrane fraction (F) HMEC2 membrane fraction. Bars represent all peptides, red squares are neo-N-termini, and blue squares are natural N-termini.  117  Table 4.3 Highest confident candidate substrates from HFL conditioned medium Secreted or soluble candidate substrates of MT6-MMP were identified by the same peptide in biological replicates from HFL conditioned medium following cell treatment with sMT6ΔF (114 label) or sMT6EΔA (115 label). N-termini Protein Ratio Peptide 114/115 2 Natural 60S ribosomal protein L11 6.22 AQDQGEKENPMR 2 Coiled-coil domain-containing protein 56 9.84 ASSGAGDPLDSKR 2 Dynein light chain roadblock-type 1 2.50 AEVEETLKR 2 Mitochondrial 2-oxoglutarate/malate carrier protein 10.89 AATASAGAGGIDGKPR 8 Neo 3--ketoacyl-CoA 0.08 LSGAPQASAADVVVVHGR 238 Kinectin 0.26 DNADSSPVVDKR Table 4.4 Candidate substrates from HFL conditioned medium Secreted or soluble candidate substrates of MT6-MMP were identified by peptides found in ≥2 spectra in one experiment from HFL conditioned medium following cell treatment with sMT6ΔF (114 label) or sMT6EΔA (115 label). § Indicates peptide identification in HFL1 experiment, *indicates peptide identification in HFL2 N-termini Ratio No. of 114/115 Spectra Protein Peptide 2 Natural Galectin-1 2.58 ACGLVASNLNLKPGECLR* 7 2 Kinesin-1 heavy chain 2.48 ADLAECNIKVMCR* 2 2 Poly [ADP-ribose] polymerase 1 2.44 AESSDKLYR* 2 2 Prohibitin-2 5.62 AQNLKDLAGR* 2 2 Stathmin 2.06 ASSDIQVKELEKR§ 2 15 Neo ACAA1 (aceyltranserase) 0.06 SAADVVVVHGR* 1 8 0.03 LSGAPQASAADVVVVHGR* 1  118  Table 4.5 Highest confident candidate substrates from HFL membrane fractions Candidate substrates of MT6-MMP were identified by the same peptide in biological replicates from HFL membrane fractions following cell treatment with sMT6ΔF (116 label) or sMT6EΔA (117 label). §indicates additional peptide identification in HFL1 experiment, *indicates additional peptide identification in HFL2 experiment. N-termini Protein Ratio 116/117 Peptide 44 Natural ATP synthase subunit alpha 0.69 QKTGTAEMSSILEER 42 Cytochrome c oxidase subunit 5A 1.35 SHGSQETDEEFDAR 2 Glycogen phosphorylase 2.17 AKPLTDSEKR 2 NADH dehydrogenase [ubiquinone] 1 0.71 TGYTPDEKLR 1 Polypyrimidine tract-binding protein 1 1.48 MDGIVPDIAVGTKR 2 Stathmin 1.71 ASSDIQVKELEKR 108 Neo Actin 1.58 TEAPLNPKANR 360 4.27 QEYDESGPSIVHR* 484 Annexin VI isoform 2 1.81 SLEDALSSDTSGHFR 65 Beta-1C of Integrin beta-1 precursor 0.64 DDLEALKKKGCPPDDIENPR 412 EH domain-containing protein 2 1.55 GAFEGTHMGPFVER 25 Fibrillin-1 precursor 0.56 ADANLEAGNVKETR 30 Protocadherin gamma-C3 precursor 0.64 STVIHYEIPEER 195 Prosaposin 1.40 GDVCQDCIQMVTDIQTAVR 87 Vimentin 0.56 SLADAINTEFKNTR 90 1.60 DAINTEFKNTR 329 0.29 EVDALKGTNESLER* 88 0.33 LADAINTEFKNTR 258 0.37 VDVSKPDLTAALR* 86 0.45 FSLADAINTEFKNTR* 55 0.45 SSPGGVYATR* 260 0.49 VSKPDLTAALR* 89 0.53 ADAINTEFKNTR* 328 0.57 CEVDALKGTNESLER* 330 0.62 VDALKGTNESLER* 91 1.31 AINTEFKNTR§ 89 1.42 ADAINTEFKNTR§ 119  Table 4.6 Candidate substrates from HFL membrane fractions Candidate substrates of MT6-MMP were identified by peptides found in ≥2 spectra in one experiment from HFL membrane fractions following cell treatment with sMT6ΔF (116 label) or sMT6EΔA (117 label). § indicates peptide identification in HFL1 experiment, *indicates peptide identification in HFL2 experiment. Ratio No. of 116/117 Spectra N-termini Protein Peptide 2 Natural 40S ribosomal protein S16 0.62 PSKGPLQSVQVFGR* 2 1 Alpha-soluble NSF attachment protein 1.68 MDNSGKEAEAMALLAEAER* 2 32 Cytochrome c oxidase subunit 5B 0.66 ASGGGVPTDEEQATGLER§ 4 Dolichyl-diphosphooligosaccharide-25 protein glycosyltransferase subunit 1 0.57 SSEAPPLINEDVKR* 2 28 Enoyl-CoA hydratase 0.62 ASGANFEYIIAEKR* 4 20 Extracellular matrix protein 1 1.80 ASEGGFTATGQR* 3 2 Galectin-1 1.56 ACGLVASNLNLKPGECLR* 7 28 GPI-anchor transamidase 1.89 SHIEDQAEQFFR* 2 2 Surfeit locus protein 4 1.68 GQNDLMGTAEDFADQFLR* 4 Plasminogen activator inhibitor 1 RNA2 1.72 PGHLQEGFGCVVTNR* 4 binding protein 2 § Protein transport protein Sec61 subunit β 0.66 PGPTPSGTNVGSSGR 2 2 T-complex protein 1 subunit zeta 0.53 AAVKTLNPKAEVAR* 2 95 Neo Brain of Clathrin light chain A 1.56 AAISQVDR* 2 65 CD59 glycoprotein 1.64 WKFEHCNFNDVTTR* 2 30 Fibulin-1 precursor 4.80 DVLLEACCADGHR* 4 205 Progranulin 0.44 SVMCPDAR* 1+M 101 0.74 DVKCDMEVSCPDGYTCCR§ 1+M 21 KDEL motif-containing protein 2 precursor 1.60 GAPEVLVSAPR* 2 39 Peptidyl-prolyl cis-trans isomerase 1.72 GVQVETISPGDGR* 2  120  Table 4.7 Highest confident candidate substrates from HMEC conditioned medium Secreted or soluble candidate substrates of MT6-MMP were identified by the same peptide in biological replicates from HMEC conditioned medium following cell treatment with sMT6ΔF (114 label) or sMT6EΔA (115 label). § indicates additional peptide identification in HMEC1 experiment, *indicates additional peptide identification in HMEC2 experiment. Ratio N-termini Protein 114/115 Peptide 2 Natural 40S ribosomal protein S20 2.04 AFKDTGKTPVEPEVAIHR 2 60S ribosomal protein L11 2.34 AQDQGEKENPMR 2 Actin-related protein 2/3 complex subunit 5 0.59 SKNTVSSAR Aminoacyl tRNA synthase complex-interacting 2 3.01 ANNDAVLKR multifunctional protein 1 2 BAG family molecular chaperone regulator 2 2.35 AQAKINAKANEGR 2 Cofilin-1 1.83 ASGVAVSDGVIKVFNDMKVR 22 Endoplasmin 1.88 DDEVDVDGTVEEDLGKSR 2 Galectin-1 1.68 ACGLVASNLNLKPGECLR 2 Leucine zipper protein 1 2.99 AEFTSYKETASSR MT6-MMP 1.84 108 YALSGSVWKKR 2 Mitochondrial 2-oxoglutarate/malate carrier protein 9.27 AATASAGAGGIDGKPR 2 Nuclear RNA export factor 1 6.92 ADEGKSYSEHDDER 2 PALM2-AKAP2 protein isoform 1 4.72 AEAELHKER 2 Prohibitin-2 14.55 AQNLKDLAGR 2 Protein phosphatase 1; catalytic subunit; alpha isoform 3 0.49 SDSEKLNLDSIIGR 2 Protein transport protein Sec61 subunit β 1.85 PGPTPSGTNVGSSGR 2 Ras suppressor protein 1 1.72 SKSLKKLVEESR 2 THO complex subunit 4 2.04 ADKMDMSLDDIIKLNR 15 Neo 60S ribosomal protein L31 0.53 SAINEVVTR 87 Actin 0.43 IWHHTFYNELR 23 0.56 FAGDDAPR 197 0.52 GYSFTTTAER§ DNA-binding protein A 0.58 270 GVPEGAQLQGPVHR Heterogeneous nuclear ribonucleoprotein R 0.41 428 STAYEDYYYHPPPR 121  N-termini  Protein Insulin-like growth factor-binding protein 5 Insulin-like growth factor-binding protein 6 KH domain-containing; RNA-binding; signal transductionassociated protein 1 Microtubule-associated protein RP/EB family member 1 Nucleophosmin PDZ and LIM domain protein 1 THUMPD1 Putative uncharacterized protein DKFZp686C1054 Vimentin  Ratio 114/115 Peptide 0.54 164 KFVGGAENTAHPR 79 0.55 APGLQCHPPKDDEAPLR 0.42 0.41 0.56 0.51 0.40 2.41 0.53  18 169 36 55 88 86 262  SGSMDPSGAHPSVR TAAAPKAGPGVVR DENEHQLSLR GENTSNMTHLEAQNR AAPAQQTTQPGGGKR FSLADAINTEFKNTR KPDLTAALR*  Table 4.8 Candidate substrates from HMEC conditioned medium Secreted or soluble candidate substrates of MT6-MMP were identified by peptides found in ≥2 spectra in one experiment from HMEC conditioned medium following cell treatment with sMT6ΔF (114 label) or sMT6EΔA (115 label). § indicates peptide identification in HFL1 experiment, *indicates peptide identification in HFL2 experiment. Ratio No. of N-termini Protein 114/115 Peptide Spectra 42 § Natural Cytochrome c oxidase subunit 5A 2.63 SHGSQETDEEFDAR 2 35 CXCL1 21.58 ASVATELR* 6 246 Neo Beta-actin-like protein 2 0.53 GQVITIGNER 5 243 Follistatin-related protein 1 2.23 GAETEVDCNR* 2 205 Progranulin 1.62 SVMCPDAR* 1+M 360 0.53 GWACCPYR§ 1+M 255 MT6-MMP 38.59 YQGPVGDPDKYR* 3 58 Nucleosome assembly protein 1-like 1 0.53 GLVETPTGYIESLPR 2 588 WW domain-binding protein 11 0.51 ENKGATAAPQR* 1  122  Table 4.9 Highest confident candidate substrates from HMEC membrane fractions Candidate substrates of MT6-MMP were identified by the same peptide in biological replicates from HMEC membrane fractions following cell treatment with sMT6ΔF (116 label) or sMT6EΔA (117 label). § indicates additional peptide identification in HFL1 experiment, *indicates additional peptide identification in HFL2 experiment. Ratio 116/117 Peptide N-termini Protein 2 Natural 40S ribosomal protein S16 1.26 PSKGPLQSVQVFGR 2 40S ribosomal protein S19 1.39 PGVTVKDVNQQEFVR 2 40S ribosomal protein S29 0.79 GHQQLYWSHPR 1 Actin-binding protein anillin 0.68 MDPFTEKLLER 2 Annexin IV 1.26 AMATKGGTVKAASGFNAMEDAQTLR 43 ATP synthase subunit b 1.38 PVPPLPEYGGKVR 2 Cytochrome c oxidase subunit 6C 0.78 APEVLPKPR 31 ERGIC-53 1.31 DGVGGDPAVALPHR 2 FAM50A 0.79 AQYKGAASEAGR 2 Galectin-1 0.74 ACGLVASNLNLKPGECLR 1 Glutathione S-transferase P 1.40 MPPYTVVYFPVR 2 GPI transamidase component PIG-S 0.77 AAAGAAATHLEVAR Guanine nucleotide-binding protein G(I)/G(S)/G(O) 2 1.37 SGSSSVAAMKKVVQQLR subunit gamma-5 1 Heterogeneous nuclear ribonucleoproteins A2/B1 0.62 MEKTLETVPLER 2 Histone-binding protein RBBP4 0.75 ADKEAAFDDAVEER 22 Mesencephalic astrocyte-derived neurotrophic factor 0.65 LRPGDCEVCISYLGR 1 Nicotinamide N-methyltransferase 1.25 MESGFTSKDTYLSHFNPR 1 Non-POU domain-containing octamer-binding protein 1.28 MQSNKTFNLEKQNHTPR 2 PHD finger-like domain-containing protein 5A 0.75 AKHHPDLIFCR 2 Phosphoribosylformylglycinamidine synthase 1.27 SPVLHFYVR 2 Plasminogen activator inhibitor 1 RNA-binding protein 1.44 PGHLQEGFGCVVTNR 2 Poly [ADP-ribose] polymerase 1 0.62 AESSDKLYR 2 Probable ribosome biogenesis protein NEP1 0.67 AAPSDGFKPR Protein-L-isoaspartate(D-aspartate) O2 0.68 AWKSGGASHSELIHNLR methyltransferase 123  N-termini  Neo  Protein Protein-tyrosine phosphatase-like member B Ras suppressor protein 1 RuvB-like 2 Serine/threonine-protein kinase PAK 2 Signal peptidase complex catalytic subunit SEC11A Similar to small nuclear ribonucleoprotein polypeptide A' SNRPA1 Sulfate transporter Acyl-CoA dehydrogenase; mitochondrial precursor Acyl-coenzyme A thioesterase 2; mitochondrial precursor A-kinase anchor protein 12 isoform 2 Integrin beta-1 precursor CXCL12 chemokine (C-X-C motif) ligand 12 gamma Cytochrome b-c1 complex subunit Rieske FKBP1A Peptidyl-prolyl cis-trans isomerase Heterogeneous nuclear ribonucleoprotein R Isoleucyl-tRNA synthetase; mitochondrial precursor Kinectin Mitochondrial of Fumarate hydratase Neuroblast differentiation-associated protein AHNAK Polypyrimidine tract-binding protein 1 Sialomucin core protein 24 Spectrin alpha chain Splicing factor; arginine/serine-rich 7 Vimentin  Ratio 116/117 Peptide 2 1.43 AAVAATAAAKGNGGGGGR 2 1.34 SKSLKKLVEESR 2 0.76 ATVTATTKVPEIR 2 1.51 SDNGELEDKPPAPPVR 1 0.76 MLSLDFLDDVR 2.52 1.76 1.26 0.73 0.71 1.43 1.46 0.80 0.70 1.50 0.49 0.77 1.52 1.49 1.25 0.75 0.80 0.70 0.74 0.71 0.72 0.77  2 2 87 64 320 65 22 79 39 428 45 238 45 578 173 55 1206 107 54 38 54 332  VKLTAELIEQAAQYTNAVR SSESKEQHNVSPR AGGAAQLALDKSDSHPSDALTR AATLILEPAGR EVHVSTVEER DDLEALKKKGCPPDDIENPR KPVSLSYR SHTDIKVPDFSEYR GVQVETISPGDGR STAYEDYYYHPPPR VSGASNHQPNSNSGR DNADSSPVVDKR ASQNSFR VAAPKVKGGVDVTLPR AGMAMAGQSPVLR TPAPETCEGR SQLLGSAHEVQR YECGEKGHYAYDCHR ASSPGGVYATR YSLGSALRPSTSR§ ASSPGGVYATR§ ALKGTNESLER§  124  Table 4.10 Candidate substrates from HMEC membrane fraction Candidate substrates of MT6-MMP were identified by ≥2 peptides in one experiment from HMEC membrane fraction following cell treatment with sMT6ΔF (116 label) or sMT6EΔA (117 label). § indicates peptide identification in HFL1 experiment, *indicates peptide identification in HFL2 experiment. Ratio No. of 116/117 Peptide spectra N-termini Protein Natural ATP synthase subunit b 1.40 2 43 PVPPLPEYGGKVR§ Heterogeneous nuclear ribonucleoprotein A1 0.77 3 2 SKSESPKEPEQLR§ Histone H1.0 1.36 2 1 MTENSTSAPAAKPKR* NADH dehydrogenase [ubiquinone] iron-sulfur protein 3 1.32 2 37 ESAGADTRPTVR§ Neo 14-3-3 protein beta/alpha 1.32 MDKSELVQKAKLAEQAER§ 2 3 acyl-CoA dehydrogenase 1.43 2 87 AGGAAQLALDKSDSHPSDALTR* A-kinase anchor protein 12 isoform 2 0.72 320 EVHVSTVEER§ 2 ATP synthase subunit beta; mitochondrial 0.77 4 precursor 47 AAQTSPSPKAGAATGR§ ATPase inhibitory factor 1 isoform 3 precursor 0.64 2 26 GSDQSENVDR* Citrate synthase; mitochondrial precursor 1.32 2 26 ASASSTNLKDILADLIPKEQAR§ Fumarate hydratase; mitochondrial precursor 1.37 ASQNSFR* 2 45 Histone H3.2 0.53 1 74 EIAQDFKTDLR§ 0.71 YQKSTELLIR§ 1 55 Peptidyl-prolyl cis-trans isomerase FKBP9 0.73 2 30 LGSDAELQIER§ Protein disulfide-isomerase A4 0.77 AEGPDEDSSNR§ 2 24 Serine protease HTRA1 0.69 3 30 SAPLAAGCPDR§  125  Interestingly, the cellular distributions of the proteins identified within the conditioned medium versus membrane-enriched fraction were similar (Fig 4.5). In particular, of the candidate substrates identified in the conditioned medium, 14% are considered extracellular (Fig 4.5C) whereas 11% were extracellular when the entire proteome was considered (Fig 4.5A). This is in contrast to an evaluation of MMP-2 substrates (216), wherein the extracellular proteins represented 50% of identified proteins. The lack of a significant increase of extracellular proteins in the conditioned medium may be due to the shedding of membrane-associated proteins from the cell surface in the presence of MT6-MMP. Further, the incomplete annotation of proteins in the databases is reflected here. For example, while vimentin is most abundant within the cell and is annotated as intracellular, it can also be expressed on the cell surface (329). The membrane fraction showed a slight increase in membrane-annotated proteins, from 19% in the identified proteome to 22% representing the candidate substrates identified from the membrane fractions (Fig 4.5D). Candidate Substrates of MT6-MMP: We predicted that, aside from the biological consequences due to altered protein synthesis (which can also provide functional information), the effect of MT6-MMP proteolysis would be observed by a change of both natural and neo-N-termini, evaluated as the ratio of peptides observed from cells treated with active compared with inactive protease (sMT6ΔF/sMT6EΔA). We developed a model to comprehend how a change in natural or neo-N-terminus peptides in either the conditioned medium or membrane fraction could result from proteolytic activity on the associated protein (Fig 4.6). In general, MT6-MMP substrates would have increased ratios in the conditioned medium and decreased ratio on the membrane due to shedding, though increased neo-N-termini on the membrane would also represent an MT6-MMP substrate. Other changes to natural or neo-Ntermini in the medium and membrane fraction would represent indirect proteolysis or degradation. Aside from the biological effects due to altered cell synthesis or protein expression, a reduced iTRAQ ratio could represent addition cleavages within a semitryptic peptide so that this alternative peptide is undetected by mass spectrometry due to reduced ionization, or is unidentified by bioinformatic analysis.  126  Figure 4.5 Distribution of subcellular and extracellular proteins identified by iTRAQlabeled peptides. (A) in conditioned medium and membrane fractions by iTRAQ-labeled tryptic peptides (B) in conditioned medium and membrane fractions having a ratio ≥ 1 standard deviation from the mean (C) in conditioned medium having a ratio ≥ 1 standard deviation from the mean (D) in conditioned medium having a ratio ≥ 1 standard deviation from the mean.  127  Figure 4.6 Schematic to describe changes in iTRAQ ratios. Comparison of the untreated cell (left) and protease treated cell (right, black scissors) in conditioned media and membrane fractions showing the effects on (A) natural Ntermini (Blue N) and (B) neo-N-termini (Red N).  128  129  The majority of candidate substrates identified in the conditioned medium by the natural N-termini have increased iTRAQ ratios (Table 4.3, 4.4, 4.7, 4.8). Amongst these, galectin-1 and endoplasmin are confirmed MMP substrates (Table 4.8) (216,318,358) while several others, including ribosomal proteins (Table 4.3, 4.7) are currently under investigation (Overall lab, unpublished results). Interestingly, CXCL1 was identified at significantly elevated levels (Table 4.8), though when evaluated in vitro cleavage was not observed (Chapter 2) suggesting increased expression of the protein in response to MT6-MMP activity affecting signaling. A limited number of proteins were identified with increased neo-N-termini in the conditioned medium. These include vimentin (Table 4.7), previously confirmed to be an MT6-MMP substrate (Chapter 2), MT6-MMP (Table 4.8), indicating autoproteolysis of the exogenous sMT6ΔF protein, and the two novel substrates follistatin-related protein 1 and progranulin (Table 4.8). Notably, decreased ratios of different peptides for vimentin and progranulin were observed. In the case of vimentin, this could represent cell-associated regions of the protein that remain cell-attached, as was observed upon peptide mapping of MMP-2 substrates (216). For progranulin, this may represent different processing of the precursor protein that is required for the production of active granulin proteins (359). The majority of unique proteins were identified within membrane fractions (Tables 4.5, 4.6, 4.9, 4.10). A number of natural N-terminal peptides that were decreased correspond to intracellular components including ribosomal proteins (Table 4.5, 4.9), heterogeneous nuclear ribonucleoproteins (Tables 4.9, 4.10), and ERGIC-53 (Table 4.9). Galectin 1, noted above as increased in the conditioned medium (Table 4.7), was reduced in the corresponding membrane fraction (Table 4.9), confirming the shedding from the cell surface. Further cleavage at the membrane is indicated by the increase in neo-N-termini in the conditioned medium of CD59, peptidyl-prolyl cis-trans isomerase, annexin VI, prosaposin, and integrin β1 precursor (Tables 4.5, 4.6, 4.9). CXCL12, a confirmed MT6-MMP substrate (Chapter 3), was identified with increased neo-Ntermini iTRAQ ratios in a membrane fraction (Table 4.9). Peptides identified in membrane fractions with a decreased neo-N-termini ratio included progranulin, fibrillin130  Figure 4.7 IceLogo analysis of TAILS data. The cleavage site specificity of MT6-MMP was analyzed by iceLogo using TAILS data of (A) all annotated peptides (B) peptides with iTRAQ ratios >1 standard deviation. (C) IceLogo of MT6-MMP evaluated by PICS analysis.  131  1 precursor, kinectin and peptidyl-prolyl cis-trans isomerase (Tables 4.5, 4.6, 4.9, 4.10), indicates further processing of these proteins. Cleavage site specificity of MT6-MMP: Using the peptides identified by TAILS analysis, the preferred consensus sequence for MT6-MMP was evaluated with iceLogo. From the 593 neo-N-terminus peptides identified, only 300 peptides were unique and lacked an Arg at position P1; the resulting iceLogo is shown in Figure 4.7A. Narrowing the peptide list to peptides with ratios ≥ 1 standard deviation, 103 peptides remained (Fig 4.7B). The narrowing of criteria did not significantly affect the iceLogo obtained for MT6-MMP. For comparison purposes, the iceLogo from PICS analysis (Chapter 3), where MT6-MMP cleavage of a peptide library is used to define cleavage specificity (322), is shown in Fig 4.7C. The current method identified Cys at P1 whereas this was absent from the PICS analysis; the modification of cysteine residues prior to the addition of protease in PICS analysis could interfere with the protease-peptide interaction and thus go unidentified (322). Similarly, the Arg at P2 from the TAILS data is lacking in the peptide-based logo since the peptide library was prepared with trypsin. This may be overcome by preparing the library with a protease that cleaves after other residues, such as GluC. Both methods identified Asp in the P1 position, and a preference for hydrophobic residues on the prime side. A Pro is characteristically found at P3 according to PICS analysis of MMPs (Schilling et al, 2010) but surprisingly this is lacking in the proteome-based analysis of MT6MMP. Additionally, the Gly and Ser residues on the prime side of the cleavage site are not characteristic of MMPs. An under-representation of Pro at P1 and P1’ observed from the TAILS data may explain the low collagenolytic activity that we previously observed for MT6-MMP (Chapter 3). Since MMPs are proteases with a broad specificity and diverse substrate repertoires, these results highlight complementary approaches for evaluating MMP cleavage preferences.  132  Discussion Proteomics represents an unbiased approach to substrate discovery. As such, a number of qualitative techniques have been developed, and quantitative labels applied in the identification of degradomes (312,355-357). TAILS enrichment of N-termini represents a high-throughput approach that enables both substrate and cleavage site identification (318). The use of iTRAQ labels enables multiplex experimentation with quantitative results (216). To determine roles for MT6-MMP through substrate identification, iTRAQ-TAILS (319,321) was applied to conditioned medium and membrane fractions from protease-treated cells. By comparing active (sMT6ΔF) with inactive (sMT6EΔA) protease-treated fractions, the effects due to MT6-MMP catalytic activity could be inferred. Furthermore, the use of two different cell lines, namely HFL1 and HMEC, expanded the experimental proteome to more closely represent the proteome that is encountered in vivo by inflammation-recruited neutrophils wherein MT6-MMP would be released from secretory vesicles and tertiary granules during transendothelial migration, and function interstitially on the membrane surface. The iTRAQ-TAILS methodology is straightforward, though data analysis is complex. iTRAQ-TAILS was validated during evaluation of MMP-2 and MMP-9 proteolysis of isolated secretomes (319,321). Therein, a statistical method was applied to determine a critical iTRAQ ratio cutoff, separating potential from highly confident substrates (321). While an important advancement to iTRAQ-TAILS analysis, this system could not be accurately applied to the data presented herein. Here, the protease was added to cells, rather than an isolated secretome, and since few MT6-MMP substrates have been identified, the statistical method could not be validated for this dynamic system. Hierarchical substrate winnowing is an alternative approach, in which ratio cutoffs are based upon those obtained for known substrates (216,313,318). Again, this could not be applied here. Hence, due to the limited information on MT6-MMP a hybrid approach was applied. Specifically, only peptides with ratios >1 standard deviation from the normalized mean contributed to the identification of candidate substrates, which were identified by two or more spectra (either biological replicates or from one experiment). Among the 218 candidate substrates identified from 377 unique peptides, were proteins that we previously confirmed as MT6-MMP substrates (vimentin, CXCL12 133  (Table 4.9) [Chapter 3]), that are family members of MT6-MMP substrates (IGFBPs, galectins (Table 4.7) (Chapter 3), and are substrates of other MMPs (annexins (Table 3.9) (319,358,360)). Notably, CXCL5 was previously confirmed to be an MT6-MMP substrate (Chapter 3), but did not fulfill the requirements to be considered a candidate substrate in this TAILS analysis since the identification was made only by one spectra, indicating the stringency of our analyses (IPI00292936, Appendix B.9). Candidate substrates identified in these analyses include proteins involved in activation of the inflammatory response, chemotaxis, cell and matrix adhesion. Activation of the inflammatory response involves vascular changes and activation of the complement system. ERGIC-53 protein, identified by an increased ratio for the natural N-terminus peptide in HMEC membrane fractions (Table 4.9), has a critical function in coagulation (361). Mutations in the ERGIC-53 gene cause factor IV and factor VIII deficiency (361) as it plays a direct role in export of these coagulation factors (362).CD59 (Table 4.5) is an inhibitor of complement activation. An increased ratio for the neo-N-termini peptide commencing at residue 65Trp in HMEC membrane fractions suggests that the inhibitory activity found within residues 44-55 (363-365) would be lost. This implicates a role for MT6-MMP in promoting neutrophil activation of the complement system. We previously identified a number of chemokines as MT6-MMP substrates (Chapter 3). Two chemokines, namely CXCL1 and CXCL12, were identified from HMEC cells (Table 4.8, 4.10). Notably, both chemokines were identified by their natural N-termini. While CXCL1 is not a substrate of MT6-MMP, CXCL12 processing by MT6-MMP was confirmed in vitro (Chapter 3). The increase of CXCL12 on the membrane of HMEC cells indicates that the chemokine is binding to the cell through its unusually high affinity for glycosaminoglycans (GAGs) (130). MT6-MMP cleavage of CXCL12 occurs between 4Ser-Leu5 (Chapter 3) and so the resulting semi-tryptic neo-N-terminus peptide would be only four residues long, which is too small for detection and accurate identification by MS, possibly explaining the lack of identification of CXCL12 in conditioned medium. Alternately, both CXCL12 and CXCL1 might be upregulated in response to MT6-MMP. The identification of chemokines, generally present in 134  nanomolar concentrations, is a further indication of the sensitivity and dynamic range of the TAILS method. Vimentin, identified in this study by one peptide in conditioned medium and several peptides in membrane fractions, was previously shown to have chemotactic activity for THP-1 cells. Moreover, we showed a loss of this chemotactic activity following MMP processing (Chapter 3). Similar to vimentin, the candidate substrate family of peptidylprolyl cis-trans isomerases is classically defined as intracellular, yet is known to be secreted and act as a chemoattractant during the inflammatory response (366). Several prolyl cis-trans isomerases have been identified in proteomics screens for MMP substrates and prolyl cis-trans isomerase A was validated as a substrate of MT1MMP, MMP-2 and MMP-9, strengthening our finding that they are MT6-MMP substrates (313,318,319). In addition to those mentioned above, several other intracellular proteins were identified in this TAILS study. Prosaposin (Table 4.6), ribosomal proteins (e.g. 60S ribosomal protein L11) (Tables 4.3, 4.5, 4.7, 4.9), and heterogeneous nuclear ribonucleoproteins (HNRPs) (Tables 4.7, 4.9, 4.10) were identified by multiple peptides. Though cell lysis, and thus sample contamination seems an obvious explanation for the identification of the proteins, this does not explain the significant change in the iTRAQ ratio between sMT6ΔF and sMT6EΔA-treated cells, and cell morphology did not appear different between conditions (results not shown). Further, only specific peptides were identified from a subset of intracellular proteins. Rather, two other hypotheses have recently developed, which may explain these results (34,117,355,357,367). As recognized for vimentin and prolyl cis-trans isomerases, it was recently proposed that a number of “intracellular” proteins actually have a functional role in the extracellular environment as “moonlighting” proteins (117,357,367). Cauwe proposed that intracellular proteins reach the extracellular environment due to lysis, and are proteolyzed to inhibit autoantigen production (117). In contrast, Butler has suggested that intracellular proteins are actively secreted from the intracellular environment 135  through non-classical mechanisms, and have yet to be discovered functionality in the extracellular environment (357,367). An alternative explanation for the identification of these intracellular proteins is in conflict to the long-held belief that MMPs function only in the extracellular environment. MMP-2, MMP-3, and MT1-MMP were shown to be in the nucleus (368-370), where MMP-3 is proposed to regulate transcription of connective tissue growth factor and MT1-MMP reportedly degrades pericentrin and causes chromosomal instability (371,372). MMP-2 processing of troponin I, α-actinin and myosin light chain 1 at the sarcomere attenuates contraction of cardiomyocytes (373). MT6-MMP, though present on the plasma membrane, is primarily contained within neutrophil granules (72). Further, the MT6-MMP that is localized in the lipid rafts of the plasma membrane reportedly faces into the cell, rather than outward, and inverts to the extracellular space following neutrophil activation wherein it can be released from the cells (101). Together, these studies suggest that MT6-MMP may play a homeostatic role within the cell, but is released during inflammation wherein it processes inflammatory mediators. Growth promoting factors are an additional group of candidate substrates for MT6MMP. The neo-N-terminus peptide 205SVMCPDAR of progranulin was identified with a decreased ratio on the membrane and increased ratio in conditioned medium (though from different experiments), suggesting shedding (Table 4.5, 4.9). Progranulin, a substrate of MT1-MMP (313), is a protein that is proteolytically processed into 8 different peptides shown to modify cell growth (359). The natural N-terminus of granulin-3 is at Val205, suggesting that MT6-MMP may be shedding granulin-2 from the membrane surface. Other growth promoting proteins that were identified as candidate MT6-MMP substrates include IGFBP-5, IGFBP-6, galectin-1 and follistatin-1 (Table 4.4, 4.5, 4.7, 4.8). IGFBP-7 is a confirmed substrate of MT6-MMP and IGFBP-5 was found to be a candidate substrate in that study (Chapter 3), while other family members including IGFBP-6 are confirmed substrates of MMP-2 (116,318,319,358). Similarly, galectin-1 is a confirmed substrate of MT6-MMP and MMP-2 (Chapter 3, (116,318)). While the functional effects of MMP-processing of these growth-promoting proteins have yet to be determined, the identification and validation of their processing provides further evidence that these are MT6-MMP substrates. 136  Further evaluation of the candidate substrates for MT6-MMP indicates a number of matrix and cell adhesion molecules. Neo-N-termini peptides were altered for the proteins fibrillin, fibulin, integrin β1 and kinectin. Notably lacking from this list are collagen proteins, which were identified by MT6-MMP secretome analysis (Chapter 3). A cell-based proteomics study with MMP-2, which also identified the candidate substrates galectin-1, prosaposin and IGFBP-7, identified nine different collagen isoforms (116). Using the candidate substrate cleavage sites, iceLogo analysis of MT6-MMP shows a lack of Pro and Gly at P3 and P1, respectively. These are residues observed at high levels in collagen and which were observed by iceLogo analysis of MMP-2 TAILS data (321). Together, these results support our previous finding that, unlike MMP-2, MT6-MMP is not collagenolytic. Further, these results highlight the importance of unbiased substrate identification for MMPs. Applying iTRAQ-TAILS to a cell-based approach, we have identified 218 candidate substrates for MT6-MMP. Experimentation in a dynamic system where shedding of membrane-associated proteins can be analyzed in both the membrane and the conditioned medium, provides greater insight into the biological function of a protease, and is a progression of the iTRAQ-TAILS technique previously applied to an isolated secretome. Amongst the candidate substrates of MT6-MMP are proteins involved in complement activation, cell migration and growth promotion. We provide here not only a starting point for future studies on the role of MT6-MMP, but an approach to future protease degradome analysis, moving beyond the secretome to identify authentically presented MMP substrates.  137  CHAPTER 5: CONCLUSIONS AND PERSPECTIVES MMP regulation of multiple stages of inflammation The most significant findings of this research are identifying substrates of MT6-MMP that contribute to inflammation through to wound healing by defining a role for the enzyme in a positive feed-back of neutrophil chemoattraction, positive feed-forward of monocyte chemoattraction, and in the progression of the inflammatory response (Chapter 3, 4). Furthermore, identifying that MMPs are responsible for the activating truncation of the monocyte chemoattractants CCL15 and CCL23, and characterizing the first proteolysis of CCL16, which translates functionally to a novel enhanced glycosaminoglycan binding, are important aspects in understanding acute and chronic inflammation (Chapter 2, 3). The intent of this research was to focus on the roles and interactions of MMPs and chemokines in modification of neutrophil and mononuclear phagocyte recruitment, though the effects of the MMP-modified chemokines identified are likely to go beyond what is explored herein. For example, CCL15 promotes chemotaxis not only of monocytes but also lymphocytes (228), indicating a role in adaptive immunity. In addition, while CCL11 can attract monocytes, it is predominantly involved in eosinophil chemoattraction (374). Therefore, the family-wide approach to evaluating the MMPprocessing of monocyte chemoattractants (Chapter 2) has not only given insight into the innate immune response, but also provides a starting point for the evaluation of the functional effects in other systems. Further, in combination with previous results that have evaluated the effects of other truncation variants, this study provides a global perspective and thus insight into the many potential roles of MMP regulation of chemokine function. Combining our knowledge about cellular sources of MMPs and chemokines, and now knowing which MMPs may be responsible for chemokine cleavage in vivo, I propose a temporal model (Fig 5.1) of positive feed-back and feed-forward mechanisms that promote both neutrophil and monocyte recruitment, and inhibition of recruitment following injury. Potentiating these chemokine-specific effects would be the functional 138  Figure 5.1 Model of MMP cleavage of inflammatory proteins MT6-MMP from neutrophils contributes to complement activation through cleavage of CD59, and propagates neutrophil recruitment through activation of CXCL5. MMPs, including MT6-MMP, activate CCL15 and CCL23 which recruit monocytes. 1) MMP-9 produced by resident macrophages and fibroblasts process and activate locally produced CXCL8 for early recruitment of neutrophils (89), 2) in a positive feedback mechanism, neutrophils release more chemokine, which is then activated by neutrophil-specific MT6-MMP and MMP-8 (Chapter 2, (89)), 3) MMP-cleavage of CCL16 enhances GAG-binding to promote haptotaxis of CCR1 expressing cells, 4) recruited and resident cells activate CCL15 and CCL23 through MMP-processing to promote inflammatory monocyte recruitment (Chapter 2, Chapter 3) 5) inflammatory macrophages produce MMP-12, which then inactivates neutrophil chemoattractants (87) as does MT6-MMP (Chapter 3), 6) monocyte recruitment is reduced through MMP inactivation of monocyte chemoattractants (Chapter 2, (87)). MMP-independent mechanisms are required for inactivation of CCL15 and CCL23.  139  140  effects of MT6-MMP processing of candidate substrates. For example, MT6-MMP processing of CD59 (Chapter 4) could promote complement activation to enhance inflammation. As debris and complement fixed antigens are removed, wound healing begins in part through MT6-MMP cleavage and inactivation of IGFBP-5, -6, and -7 (Chapter 3 and 4) to release growth-promoting IGF. Additionally, apoptotic neutrophils produce short and tight gradients by alternative chemoattractants including vimentin (Chapter 2) as “eat-me” signals to macrophages. The phagocytosis of apoptotic neutrophils by macrophages leads to a change in the inflammatory cytokine profile, increasing TGF-β production, reducing TNF-α and IL-1β cytokines which is an important step in the transition to resolution of the inflammatory response (272). The identification of CCL15 (25-92) in expression systems (Forssman et al., 2002) and in disease tissue (Berahovich et al., 2005, Haringman et al., 2006) prompted several groups to evaluate potential proteases involved. Despite these efforts the responsible proteases were not identified, until now. Using a systematic approach I have shown that in fact nearly all MMPs are capable of processing CCL15 to this potent truncation variant. In addition, all MMPs activate CCL23 and process CCL16 into a chemokine with stronger haptotactic potential. However, this result raises the question as to which are the relevant enzymes in vivo. Using Mmp8-/- mice in an air pouch model of cellular recruitment towards murine CXCL5/LIX, we showed the in vivo lack of redundancy in chemokine processing that was observed in vitro (89). Based upon kinetic data alone MMP-12 appears to be the most likely candidate for CCL15 activation (Chapter 2). Yet, when considering the temporal events, MMP-12 processing of CCL15 and CCL23 is less likely to be important initially since it is produced by macrophages, which are significantly outnumbered by neutrophils in the first 24 hours following initiation of inflammation. Thus despite the better kinetic properties of MMP-12, neutrophil produced MT6-MMP may be involved in early activation of these monocyte chemoattractants (Chapter 3). It is likely that MMP-12 activation of these monocyte chemoattractants would potentiate the response and could lead to chronic inflammation, as proposed in Chapter 2. 141  Previous work by several groups has identified proteolytic mechanisms that result in antagonists or loss of agonist receptor activity for both neutrophil and monocyte chemokines (Table 1.1) (reviewed in (155)). While we have shown a role for MMP activation of CCL15 and CCL23, we have not identified an inactivating truncation for these chemokines by MMPs (Chapter 2), indicating the involvement of a different protease family or different mechanism for down-regulation. The serine proteases neutrophil elastase, cathepsin G and chymase also result in activating truncations (122) though other serine or cysteine proteases should be evaluated. Alternatively, degradation rather than specific proteolysis resulting in inactivation of the chemokines may occur as it does for several CXC chemokines by elastase (Cox, unpublished data). Reduced production of CCL15 and CCL23 is also a strong possibility, as is decoy receptor binding (143,375). While it is recognized that mononuclear phagocytes are the primary source of these chemokines, recent research has highlighted that not all monocytes and macrophages are created equally (12,14). Patrolling and inflammatory monocytes express different receptors, and have different capacities for proinflammatory mediator production and phagocytosis (14). Similarly, M1-type and M2-type macrophages differentiate under different conditions, have different functions, and specific chemokine receptor expression and ligand production (19). Perhaps CCL15 and CCL23 are not inactivated, but rather produced only by transient patrolling monocytes - providing an initial burst of a strong chemoattractant before the cells differentiate or migrate out of the tissue. Due to the limited studies on this cell type, this is a hypothesis requiring further investigation. Along with specific cell-type expression of chemokines, there appears a lack of knowledge in temporal production of chemokines. While elevated levels of chemokines in disease tissue provides prognostic evidence that the chemokine is promoting cellular recruitment (376), the temporal pattern and functionality are often overlooked. The elevated levels of CCL7 and CCL15 detected in arthritic synovial fluid by antibodies indicates that these proteins are mediators of the disease (377) yet the presence of active MMPs, as observed by synovial fluid processing of CCL15 (Chapter 2) suggests that the chemokines may be present in truncated forms, which have 142  significantly different functions than the full-length counterparts. In fact, using antibodies directed towards the N- and C-termini, Berahovich identified N-terminally truncated forms of CCL15 in arthritic synovial fluid, though the truncation site could not be identified (122). With knowledge of the truncation site for the chemokine, neoepitope polyclonal antibodies that recognized the new N-terminus of CCL7 successfully identified truncated CCL7 in synovial fluid (114). The antibody did not recognize the full-length form but was specific to the truncated CCL7; conversely an antibody toward the original CCL7 N-terminus did not identify the truncated chemokine. The use of neo-epitope antibodies has also been successfully applied to the identification of truncated CXCL12 in brain tissue of HIV-infected individuals (182). Similar to the directed approach with neo-epitope antibodies, a mass spectrometry method could not only identify but also quantify full-length and truncated chemokine in tissue. Selected reaction monitoring (SRM) is a tandem mass spectrometry based method for quantifying specific peptides within a known m/z window (378). Internal standards synthesized and isotopically labeled that correspond to the semi-tryptic peptide of the original N- or C-terminus and the neo-terminus added to a complex sample can be used to identify a particular chemokine and truncation variant. By multiplexing the reaction (multiple reaction monitoring), several chemokines and truncation forms could be evaluated in one experiment to provide evidence of not only the presence but also the functionality of the proteins. This method could be applied to other substrate families of the MMPs. Application of this, or similar proteomics methods for the identification of chemokine functional states in biological samples is a much needed step in identifying therapeutic targets in disease. The potential role of MMP-12 in contributing to the transition from an acute to a chronic inflammatory response through activation of CCL15 and CCL23 implicates MMP-12 as a potential therapeutic target. While in the past many clinical trials of MMP inhibitors failed as a result of negative side effects, this was due in part to the broad specificity of the inhibitors and thus inhibition of anti-targets – MMPs with beneficial activity (286). A recently developed selective inhibitor of MMP-12 has shown promising results in a murine lung inflammation model and is being evaluated for the treatment of chronic obstructive pulmonary disease (379). Several other selective inhibitors of MMP-12 are 143  also under development for the treatment of rheumatoid arthritis, cancer, and lung diseases including asthma and emphysema (380,381). Based on the MT6-MMP proteomics data presented in Chapters 3 and 4, and in combination with previous studies (216,319,358,360) there are a number of protein families, aside from chemokines, that are likely to be regulated by MMPs with specificity occurring at the individual protein level. IGFBP-7 was confirmed and IGFBP5 and 6 both identified as candidate substrates of MT6-MMP, whereas IGFBP-1, 2, 3, 4, and 6 are confirmed substrates of other MMPs (331,332,334,336,337). IGFBPs inhibit the growth promoting activity of IGF by binding circulating IGF, and thus preventing the interaction between IGF and its cognate receptor. IGFs are upregulated locally for wound healing, but over-activity is associated with disease progression, specifically cancer. Thus, while the processing of IGFBPs by MT6-MMP and other MMPs is likely an important mechanism to initiate wound healing during an acute inflammatory response, the over-expression of MMPs may precede the enhanced IGF activity. Similarly, Galectin-1 was confirmed to be an MT6-MMP substrate and, along with galectin-3, was previously shown to be a substrate of MMPs (216,313,382,383). As with IGF, galectin-1 contributes to cancer growth, but does so by promoting vascular growth (384) and by inhibiting T cell function and tumor avoidance of immune attack (385). Further, galectin-1 has anti-inflammatory activity through the inhibition of leukocyte migration (386-388). Therefore, in the acute inflammatory response, MT6MMP may contribute to leukocyte recruitment through the cleavage and decreasing the inhibitory activity of galectin-1. Vimentin was identified by all TAILS analysis (Chapter 2 and 3) to be a substrate of MT6-MMP. While often overlooked in proteomics screens due to the high abundance of the protein and assumption that it is a byproduct of cell lysis, studies have shown that it is preferentially released to the surface of apoptotic neutrophils (328) and secreted by activated macrophages (329) – implicating a function in innate immunity. Surprisingly, Vim-/- mice did not show significant phenotypes in response to acute inflammatory stimuli including an LPS air pouch model (389). However, Vim-/- mice do 144  have impaired wound healing (390). The phagocytosis of neutrophils by macrophages is a critical step in the progression of the inflammatory response. Together these results combined with the finding in Chapter 3 that vimentin has chemotactic properties for THP-1 monocytic cells suggests that as a surface expressed molecule, vimentin contributes to the progression of inflammation. Further investigation in a complex biological system could elucidate the functional effects of MMP-processing of vimentin, and the contribution of both these proteins in wound healing. The identification of an extracellular function for vimentin supports recent proposals of “moonlighting” proteins. In addition to vimentin, a number of proteins that are annotated as intracellular proteins met the criteria to be considered MMP substrates in the proteomics studies presented in this thesis, as well as in other MMP proteomics studies. Upon further evaluation, several of these were processed by MMPs in vitro. The proposal that the role of MMPs is to degrade these “intracellular” proteins to prevent autoantigenicity (117,355) is reminiscent of the constrained definition of MMPs as degraders of the extracellular matrix. While MMPs can degrade some proteins, more often they function in specific processing of bioactive molecules to alter the functional role. Similarly, while some “intracellular” proteins may be degraded by MMPs, these proteins may have extracellular functions that are altered by specific processing to contribute to either homeostasis or disease. Proteomics analyses are a means to identify protease substrates in an unbiased manner, therefore candidate substrates should be impartially evaluated, starting with in vitro analysis, through cells and ultimately to complex biological systems. Murine models of inflammation are an excellent system to evaluate functional effects of proteases (24). While an MT6-MMP knockout mouse has not yet been developed, the phenotypic responses of the mice would provide clues on the role of this protease. Given the common cell specificity of the two enzymes I predict that the phenotype of Mt6-/- mice would have some similarity to Mmp8-/- mice, including an altered neutrophil infiltration and accumulation in a disease specific-manner (39,89,391). Yet, the divergent granule and membrane localization within the neutrophil, and thus temporal release of the enzymes, combined with different substrate profiles in vitro (including collagen and chemokines) indicates that the function of the enzymes does 145  not completely overlap. Given the substrates identified in Chapter 3 and 4, I predict that Mt6-/- mice would have a prolonged inflammatory response with delays in wound healing in response to acute stimuli. In contrast to the proposed function of MMP-12 as a mediator of chronic inflammation and thus a therapeutic target outlined above, MT6MMP may be an anti-target in inflammatory disease. In conclusion, the research presented in this thesis highlights the roles of MMPs in inflammation. I have built upon the information obtained in earlier work to provide evidence that MMPs both activate and inactivate the recruitment of neutrophils and monocytes. Through MT6-MMP, I have shown that this can occur not only through processing of chemokines, but also of vimentin, an intracellular protein with an extracelluar function. Moreover, I have more than doubled the number of substrates for the neutrophil-specific enzyme MT6-MMP, providing evidence for a role of this protease not only in cell migration but also in progressing the inflammatory response. This thesis provides a starting point for the evaluation of novel MMP substrates, to understand the mechanisms involved in acute inflammation and to provide insight into the progression toward chronic inflammation.  146  REFERENCES 1. Lawrence, T., Willoughby, D. A., and Gilroy, D. W. (2002) Nat Rev Immunol 2(10), 787-795 2. Borregaard, N., and Cowland, J. B. (1997) Blood 89(10), 3503-3521 3. Faurschou, M., and Borregaard, N. (2003) Microbes Infect 5(14), 1317-1327 4. Feuk-Lagerstedt, E., Movitz, C., Pellme, S., Dahlgren, C., and Karlsson, A. (2007) Proteomics 7(2), 194-205 5. Lominadze, G., Powell, D. W., Luerman, G. C., Link, A. J., Ward, R. A., and McLeish, K. R. (2005) Mol Cell Proteomics 4(10), 1503-1521 6. Tomazella, G. G., da Silva, I., Laure, H. J., Rosa, J. C., Chammas, R., Wiker, H. G., de Souza, G. A., and Greene, L. J. (2009) Proteome Sci 7, 32 7. Tomazella, G. G., daSilva, I., Thome, C. H., Greene, L. J., Koehler, C. J., Thiede, B., Wiker, H. G., and de Souza, G. A. (2010) J Proteome Res 9(4), 2030-2036 8. Uriarte, S. M., Powell, D. W., Luerman, G. C., Merchant, M. L., Cummins, T. D., Jog, N. R., Ward, R. A., and McLeish, K. R. (2008) J Immunol 180(8), 55755581 9. Bogdan, C. (2001) Nat Immunol 2(10), 907-916 10. Cederlund, A., Agerberth, B., and Bergman, P. (2010) J Innate Immun 11. Brinkmann, V., Reichard, U., Goosmann, C., Fauler, B., Uhlemann, Y., Weiss, D. S., Weinrauch, Y., and Zychlinsky, A. (2004) Science 303(5663), 1532-1535 12. Doulatov, S., Notta, F., Eppert, K., Nguyen, L. T., Ohashi, P. S., and Dick, J. E. (2010) Nat Immunol 11(7), 585-593 13. Geissmann, F., Gordon, S., Hume, D. A., Mowat, A. M., and Randolph, G. J. (2010) Nat Rev Immunol 10(6), 453-460 14. Geissmann, F., Manz, M. G., Jung, S., Sieweke, M. H., Merad, M., and Ley, K. (2010) Science 327(5966), 656-661 15. Soehnlein, O., and Lindbom, L. (2010) Nat Rev Immunol 10(6), 427-439 16. Soehnlein, O., Zernecke, A., Eriksson, E. E., Rothfuchs, A. G., Pham, C. T., Herwald, H., Bidzhekov, K., Rottenberg, M. E., Weber, C., and Lindbom, L. (2008) Blood 112(4), 1461-1471 17. Auffray, C., Fogg, D., Garfa, M., Elain, G., Join-Lambert, O., Kayal, S., Sarnacki, S., Cumano, A., Lauvau, G., and Geissmann, F. (2007) Science 317(5838), 666-670 18. Nahrendorf, M., Swirski, F. K., Aikawa, E., Stangenberg, L., Wurdinger, T., Figueiredo, J. L., Libby, P., Weissleder, R., and Pittet, M. J. (2007) J Exp Med 204(12), 3037-3047 19. Mantovani, A., Sica, A., Sozzani, S., Allavena, P., Vecchi, A., and Locati, M. (2004) Trends Immunol 25(12), 677-686 20. Martinez, F. O., Gordon, S., Locati, M., and Mantovani, A. (2006) J Immunol 177(10), 7303-7311 21. Verreck, F. A., de Boer, T., Langenberg, D. M., Hoeve, M. A., Kramer, M., Vaisberg, E., Kastelein, R., Kolk, A., de Waal-Malefyt, R., and Ottenhoff, T. H. (2004) Proc Natl Acad Sci U S A 101(13), 4560-4565 22. Gordon, S. (2003) Nat Rev Immunol 3(1), 23-35 23. Mosser, D. M. (2003) J Leukoc Biol 73(2), 209-212 24. Fanjul-Fernandez, M., Folgueras, A. R., Cabrera, S., and Lopez-Otin, C. (2010) Biochim Biophys Acta 1803(1), 3-19 147  25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55.  Kessenbrock, K., Plaks, V., and Werb, Z. (2010) Cell 141(1), 52-67 Lagente, V., and Boichot, E. J Mol Cell Cardiol 48(3), 440-444 Le, N. T., Xue, M., Castelnoble, L. A., and Jackson, C. J. (2007) Front Biosci 12, 1475-1487 Murphy, G., and Nagase, H. (2008) Nat Clin Pract Rheumatol 4(3), 128-135 Gross, J., and Lapiere, C. M. (1962) Proc Natl Acad Sci U S A 48, 1014-1022 Bennick, A., and Hunt, A. M. (1967) Arch Oral Biol 12(1), 1-10 Bauer, E. A., Eisen, A. Z., and Jeffrey, J. J. (1970) Biochim Biophys Acta 206(1), 152-160 Overall, C. M., and Lopez-Otin, C. (2002) Nat Rev Cancer 2(9), 657-672 Overall, C. M., and Kleifeld, O. (2006) Nat Rev Cancer 6(3), 227-239 Butler, G. S., and Overall, C. M. (2009) Nat Rev Drug Discov 8(12), 935-948 Gill, S. E., and Parks, W. C. (2008) Int J Biochem Cell Biol 40(6-7), 1334-1347 Manicone, A. M., and McGuire, J. K. (2008) Semin Cell Dev Biol 19(1), 34-41 Parks, W. C., Wilson, C. L., and Lopez-Boado, Y. S. (2004) Nat Rev Immunol 4(8), 617-629 Morrison, C. J., Butler, G. S., Rodriguez, D., and Overall, C. M. (2009) Curr Opin Cell Biol 21(5), 645-653 Balbin, M., Fueyo, A., Tester, A. M., Pendas, A. M., Pitiot, A. S., Astudillo, A., Overall, C. M., Shapiro, S. D., and Lopez-Otin, C. (2003) Nat Genet 35(3), 252257 Gutierrez-Fernandez, A., Inada, M., Balbin, M., Fueyo, A., Pitiot, A. S., Astudillo, A., Hirose, K., Hirata, M., Shapiro, S. D., Noel, A., Werb, Z., Krane, S. M., Lopez-Otin, C., and Puente, X. S. (2007) Faseb J 21(10), 2580-2591 Jost, M., Folgueras, A. R., Frerart, F., Pendas, A. M., Blacher, S., Houard, X., Berndt, S., Munaut, C., Cataldo, D., Alvarez, J., Melen-Lamalle, L., Foidart, J. M., Lopez-Otin, C., and Noel, A. (2006) Cancer Res 66(10), 5234-5241 Nagase, H., Visse, R., and Murphy, G. (2006) Cardiovasc Res 69(3), 562-573 Sternlicht, M. D., and Werb, Z. (2001) Annu Rev Cell Dev Biol 17, 463-516 Visse, R., and Nagase, H. (2003) Circ Res 92(8), 827-839 Steffensen, B., Wallon, U. M., and Overall, C. M. (1995) J Biol Chem 270(19), 11555-11566 Springman, E. B., Angleton, E. L., Birkedal-Hansen, H., and Van Wart, H. E. (1990) Proc Natl Acad Sci U S A 87(1), 364-368 Van Wart, H. E., and Birkedal-Hansen, H. (1990) Proc Natl Acad Sci U S A 87(14), 5578-5582 Murphy, G., Stanton, H., Cowell, S., Butler, G., Knauper, V., Atkinson, S., and Gavrilovic, J. (1999) Apmis 107(1), 38-44 Stetler-Stevenson, W. G., Krutzsch, H. C., Wacher, M. P., Margulies, I. M., and Liotta, L. A. (1989) J Biol Chem 264(3), 1353-1356 Roebroek, A. J., Creemers, J. W., Ayoubi, T. A., and Van de Ven, W. J. (1994) Biochimie 76(3-4), 210-216 Kojima, S., Itoh, Y., Matsumoto, S., Masuho, Y., and Seiki, M. (2000) FEBS Lett 480(2-3), 142-146 Pei, D. (1999) Cell Res 9(4), 291-303 Pei, D., and Weiss, S. J. (1995) Nature 375(6528), 244-247 Wang, X., and Pei, D. (2001) J Biol Chem 276(38), 35953-35960 Yana, I., and Weiss, S. J. (2000) Mol Biol Cell 11(7), 2387-2401 148  56. 57. 58. 59. 60. 61. 62. 63. 64. 65. 66. 67. 68. 69. 70. 71. 72. 73. 74. 75. 76. 77. 78. 79. 80.  Tallant, C., Marrero, A., and Gomis-Ruth, F. X. (2010) Biochim Biophys Acta 1803(1), 20-28 Bode, W., Fernandez-Catalan, C., Grams, F., Gomis-Ruth, F. X., Nagase, H., Tschesche, H., and Maskos, K. (1999) Ann N Y Acad Sci 878, 73-91 Arza, B., De Maeyer, M., Felez, J., Collen, D., and Lijnen, H. R. (2001) Eur J Biochem 268(3), 826-831 Crabbe, T., Zucker, S., Cockett, M. I., Willenbrock, F., Tickle, S., O'Connell, J. P., Scothern, J. M., Murphy, G., and Docherty, A. J. (1994) Biochemistry 33(21), 6684-6690 Overall, C. M. (2002) Mol Biotechnol 22(1), 51-86 Overall, C. M., McQuibban, G. A., and Clark-Lewis, I. (2002) Biol Chem 383(78), 1059-1066 Wallon, U. M., and Overall, C. M. (1997) J Biol Chem 272(11), 7473-7481 Murphy, G., Allan, J. A., Willenbrock, F., Cockett, M. I., O'Connell, J. P., and Docherty, A. J. (1992) J Biol Chem 267(14), 9612-9618 Gioia, M., Monaco, S., Fasciglione, G. F., Coletti, A., Modesti, A., Marini, S., and Coletta, M. (2007) J Mol Biol 368(4), 1101-1113 Tam, E. M., Moore, T. R., Butler, G. S., and Overall, C. M. (2004) J Biol Chem 279(41), 43336-43344 Hirose, T., Patterson, C., Pourmotabbed, T., Mainardi, C. L., and Hasty, K. A. (1993) Proc Natl Acad Sci U S A 90(7), 2569-2573 Knauper, V., Cowell, S., Smith, B., Lopez-Otin, C., O'Shea, M., Morris, H., Zardi, L., and Murphy, G. (1997) J Biol Chem 272(12), 7608-7616 Mantuano, E., Inoue, G., Li, X., Takahashi, K., Gaultier, A., Gonias, S. L., and Campana, W. M. (2008) J Neurosci 28(45), 11571-11582 Yan, C., and Boyd, D. D. (2007) J Cell Physiol 211(1), 19-26 Nuttall, R. K., Pennington, C. J., Taplin, J., Wheal, A., Yong, V. W., Forsyth, P. A., and Edwards, D. R. (2003) Mol Cancer Res 1(5), 333-345 Saarialho-Kere, U. K., Crouch, E. C., and Parks, W. C. (1995) J Invest Dermatol 105(2), 190-196 Kang, T., Yi, J., Guo, A., Wang, X., Overall, C. M., Jiang, W., Elde, R., Borregaard, N., and Pei, D. (2001) J Biol Chem 276(24), 21960-21968 Brew, K., and Nagase, H. (2010) Biochim Biophys Acta 1803(1), 55-71 Bar-Or, A., Nuttall, R. K., Duddy, M., Alter, A., Kim, H. J., Ifergan, I., Pennington, C. J., Bourgoin, P., Edwards, D. R., and Yong, V. W. (2003) Brain 126(Pt 12), 2738-2749 Lazarus, G. S., Brown, R. S., Daniels, J. R., and Fullmer, H. M. (1968) Science 159(3822), 1483-1485 Murphy, G., Reynolds, J. J., Bretz, U., and Baggiolini, M. (1977) Biochem J 162(1), 195-197 Shapiro, S. D., Kobayashi, D. K., and Ley, T. J. (1993) J Biol Chem 268(32), 23824-23829 Liu, M., Sun, H., Wang, X., Koike, T., Mishima, H., Ikeda, K., Watanabe, T., Ochiai, N., and Fan, J. (2004) Arthritis Rheum 50(10), 3112-3117 Marcaccini, A. M., Novaes, A. B., Jr., Meschiari, C. A., Souza, S. L., Palioto, D. B., Sorgi, C. A., Faccioli, L. H., Tanus-Santos, J. E., and Gerlach, R. F. (2009) Clin Chim Acta 409(1-2), 117-122 Molet, S., Belleguic, C., Lena, H., Germain, N., Bertrand, C. P., Shapiro, S. D., Planquois, J. M., Delaval, P., and Lagente, V. (2005) Inflamm Res 54(1), 31-36 149  81. 82. 83. 84. 85. 86. 87. 88. 89. 90. 91. 92. 93. 94. 95. 96. 97. 98. 99. 100. 101. 102. 103. 104. 105. 106.  Pradhan-Palikhe, P., Vikatmaa, P., Lajunen, T., Palikhe, A., Lepantalo, M., Tervahartiala, T., Salo, T., Saikku, P., Leinonen, M., Pussinen, P. J., and Sorsa, T. (2010) Scand J Immunol 72(2), 150-157 Rajasekhar, L., Liou, L. B., Chan, C. Y., Tsai, W. P., and Cheng, C. Y. (2004) Clin Exp Rheumatol 22(5), 597-602 Sun, Q., Weber, C. R., Sohail, A., Bernardo, M. M., Toth, M., Zhao, H., Turner, J. R., and Fridman, R. (2007) J Biol Chem 282(30), 21998-22010 Velasco, G., Cal, S., Merlos-Suarez, A., Ferrando, A. A., Alvarez, S., Nakano, A., Arribas, J., and Lopez-Otin, C. (2000) Cancer Res 60(4), 877-882 Hautamaki, R. D., Kobayashi, D. K., Senior, R. M., and Shapiro, S. D. (1997) Science 277(5334), 2002-2004 Churg, A., Wang, R. D., Tai, H., Wang, X., Xie, C., Dai, J., Shapiro, S. D., and Wright, J. L. (2003) Am J Respir Crit Care Med 167(8), 1083-1089 Dean, R. A., Cox, J. H., Bellac, C. L., Doucet, A., Starr, A. E., and Overall, C. M. (2008) Blood 112(8), 3455-3464 Quintero, P. A., Knolle, M. D., Cala, L. F., Zhuang, Y., and Owen, C. A. (2010) J Immunol 184(3), 1575-1588 Tester, A. M., Cox, J. H., Connor, A. R., Starr, A. E., Dean, R. A., Puente, X. S., Lopez-Otin, C., and Overall, C. M. (2007) PLoS One 2(3), e312 Paulick, M. G., and Bertozzi, C. R. (2008) Biochemistry 47(27), 6991-7000 Kinoshita, T., Ohishi, K., and Takeda, J. (1997) J Biochem 122(2), 251-257 Chatterjee, S., and Mayor, S. (2001) Cell Mol Life Sci 58(14), 1969-1987 Sangiorgio, V., Pitto, M., Palestini, P., and Masserini, M. (2004) Ital J Biochem 53(2), 98-111 Hoyer-Hansen, G., Pessara, U., Holm, A., Pass, J., Weidle, U., Dano, K., and Behrendt, N. (2001) Biochem J 358(Pt 3), 673-679 Ploug, M., Ronne, E., Behrendt, N., Jensen, A. L., Blasi, F., and Dano, K. (1991) J Biol Chem 266(3), 1926-1933 Sugita, Y., Nakano, Y., Oda, E., Noda, K., Tobe, T., Miura, N. H., and Tomita, M. (1993) J Biochem 114(4), 473-477 Yoshitake, H., Takeda, Y., Nitto, T., and Sendo, F. (2002) J Leukoc Biol 71(2), 205-211 Simmons, D. L., Tan, S., Tenen, D. G., Nicholson-Weller, A., and Seed, B. (1989) Blood 73(1), 284-289 Sharom, F. J., and Lehto, M. T. (2002) Biochem Cell Biol 80(5), 535-549 Tsujioka, H., Misumi, Y., Takami, N., and Ikehara, Y. (1998) Biochem Biophys Res Commun 251(3), 737-743 Fortin, C. F., Sohail, A., Sun, Q., McDonald, P. P., Fridman, R., and Fulop, T. (2010) Int Immunol 22(8), 637-649 Zhao, H., Sohail, A., Sun, Q., Shi, Q., Kim, S., Mobashery, S., and Fridman, R. (2008) J Biol Chem 283(50), 35023-35032 English, W. R., Velasco, G., Stracke, J. O., Knauper, V., and Murphy, G. (2001) FEBS Lett 491(1-2), 137-142 Radichev, I. A., Remacle, A. G., Shiryaev, S. A., Purves, A. N., Johnson, S. L., Pellecchia, M., and Strongin, A. Y. (2010) J Biol Chem 285(21), 16076-16086 Matsuda, A., Itoh, Y., Koshikawa, N., Akizawa, T., Yana, I., and Seiki, M. (2003) J Biol Chem 278(38), 36350-36357 Dong, Z., Katar, M., Alousi, S., and Berk, R. S. (2001) Invest Ophthalmol Vis Sci 42(13), 3223-3227 150  107. 108. 109. 110. 111. 112. 113. 114. 115. 116. 117. 118. 119. 120. 121. 122. 123. 124. 125. 126. 127. 128. 129. 130. 131. 132.  Fortunato, S. J., and Menon, R. (2002) J Assist Reprod Genet 19(10), 483-486 Edsparr, K., Johansson, B. R., Goldfarb, R. H., Basse, P. H., Nannmark, U., Speetjens, F. M., Kuppen, P. J., Lennernas, B., and Albertsson, P. (2009) Immunol Cell Biol 87(6), 489-495 Shiryaev, S. A., Savinov, A. Y., Cieplak, P., Ratnikov, B. I., Motamedchaboki, K., Smith, J. W., and Strongin, A. Y. (2009) PLoS One 4(3), e4952 Nie, J., and Pei, D. (2003) Cancer Res 63(20), 6758-6762 Andolfo, A., English, W. R., Resnati, M., Murphy, G., Blasi, F., and Sidenius, N. (2002) Thromb Haemost 88(2), 298-306 Nie, J., and Pei, D. (2004) Exp Cell Res 296(2), 145-150 Sohail, A., Sun, Q., Zhao, H., Bernardo, M. M., Cho, J. A., and Fridman, R. (2008) Cancer Metastasis Rev 27(2), 289-302 McQuibban, G. A., Gong, J. H., Tam, E. M., McCulloch, C. A., Clark-Lewis, I., and Overall, C. M. (2000) Science 289(5482), 1202-1206 McQuibban, G. A., Gong, J. H., Wong, J. P., Wallace, J. L., Clark-Lewis, I., and Overall, C. M. (2002) Blood 100(4), 1160-1167 Dean, R. A., Butler, G. S., Hamma-Kourbali, Y., Delbe, J., Brigstock, D. R., Courty, J., and Overall, C. M. (2007) Mol Cell Biol 27(24), 8454-8465 Cauwe, B., Martens, E., Proost, P., and Opdenakker, G. (2009) Integr Biol (Camb) 1(5-6), 404-426 Cauwe, B., Van den Steen, P. E., and Opdenakker, G. (2007) Crit Rev Biochem Mol Biol 42(3), 113-185 Luster, A. D. (1998) N Engl J Med 338(7), 436-445 Fernandez, E. J., and Lolis, E. (2002) Annu Rev Pharmacol Toxicol 42, 469-499 Zlotnik, A., and Yoshie, O. (2000) Immunity 12(2), 121-127 Berahovich, R. D., Miao, Z., Wang, Y., Premack, B., Howard, M. C., and Schall, T. J. (2005) J Immunol 174(11), 7341-7351 Clark-Lewis, I., Schumacher, C., Baggiolini, M., and Moser, B. (1991) J Biol Chem 266(34), 23128-23134 Hebert, C. A., Vitangcol, R. V., and Baker, J. B. (1991) J Biol Chem 266(28), 18989-18994 Sallusto, F., and Lanzavecchia, A. (2000) Immunol Rev 177, 134-140 Sica, A., Matsushima, K., Van Damme, J., Wang, J. M., Polentarutti, N., Dejana, E., Colotta, F., and Mantovani, A. (1990) Immunology 69(4), 548-553 Sica, A., Wang, J. M., Colotta, F., Dejana, E., Mantovani, A., Oppenheim, J. J., Larsen, C. G., Zachariae, C. O., and Matsushima, K. (1990) J Immunol 144(8), 3034-3038 Strieter, R. M., Standiford, T. J., Huffnagle, G. B., Colletti, L. M., Lukacs, N. W., and Kunkel, S. L. (1996) J Immunol 156(10), 3583-3586 Proudfoot, A. E., Handel, T. M., Johnson, Z., Lau, E. K., LiWang, P., ClarkLewis, I., Borlat, F., Wells, T. N., and Kosco-Vilbois, M. H. (2003) Proc Natl Acad Sci U S A 100(4), 1885-1890 Laguri, C., Arenzana-Seisdedos, F., and Lortat-Jacob, H. (2008) Carbohydr Res 343(12), 2018-2023 Proudfoot, A. E. (2006) Biochem Soc Trans 34(Pt 3), 422-426 Proudfoot, A. E., Fritchley, S., Borlat, F., Shaw, J. P., Vilbois, F., Zwahlen, C., Trkola, A., Marchant, D., Clapham, P. R., and Wells, T. N. (2001) J Biol Chem 276(14), 10620-10626 151  133. 134. 135. 136. 137. 138. 139. 140. 141. 142. 143. 144. 145. 146. 147. 148. 149. 150. 151. 152. 153. 154. 155. 156.  Graham, G. J., Wilkinson, P. C., Nibbs, R. J., Lowe, S., Kolset, S. O., Parker, A., Freshney, M. G., Tsang, M. L., and Pragnell, I. B. (1996) Embo J 15(23), 6506-6515 Laurence, J. S., Blanpain, C., De Leener, A., Parmentier, M., and LiWang, P. J. (2001) Biochemistry 40(16), 4990-4999 Amara, A., Lorthioir, O., Valenzuela, A., Magerus, A., Thelen, M., Montes, M., Virelizier, J. L., Delepierre, M., Baleux, F., Lortat-Jacob, H., and ArenzanaSeisdedos, F. (1999) J Biol Chem 274(34), 23916-23925 Baysal, C., and Atilgan, A. R. (2001) Proteins 43(2), 150-160 Blanpain, C., Doranz, B. J., Bondue, A., Govaerts, C., De Leener, A., Vassart, G., Doms, R. W., Proudfoot, A., and Parmentier, M. (2003) J Biol Chem 278(7), 5179-5187 Pease, J. E., Wang, J., Ponath, P. D., and Murphy, P. M. (1998) J Biol Chem 273(32), 19972-19976 Zoffmann, S., Chollet, A., and Galzi, J. L. (2002) Mol Pharmacol 62(3), 729-736 Allen, S. J., Crown, S. E., and Handel, T. M. (2007) Annu Rev Immunol 25, 787820 Murphy, P. M. (2002) Pharmacol Rev 54(2), 227-229 Murphy, P. M., Baggiolini, M., Charo, I. F., Hebert, C. A., Horuk, R., Matsushima, K., Miller, L. H., Oppenheim, J. J., and Power, C. A. (2000) Pharmacol Rev 52(1), 145-176 Graham, G. J. (2009) Eur J Immunol 39(2), 342-351 Kotarsky, K., Sitnik, K. M., Stenstad, H., Kotarsky, H., Schmidtchen, A., Koslowski, M., Wehkamp, J., and Agace, W. W. (2009) Mucosal Immunol Nguyen, L. T., Chan, D. I., Boszhard, L., Zaat, S. A., and Vogel, H. J. (2010) Biochim Biophys Acta 1798(6), 1062-1072 Strieter, R. M., Belperio, J. A., Burdick, M. D., and Keane, M. P. (2005) Curr Drug Targets Inflamm Allergy 4(1), 23-26 Mellado, M., Serrano, A., Martinez, C., and Rodriguez-Frade, J. M. (2006) Methods Mol Biol 332, 141-157 Thelen, M., and Stein, J. V. (2008) Nat Immunol 9(9), 953-959 Tian, Y., New, D. C., Yung, L. Y., Allen, R. A., Slocombe, P. M., Twomey, B. M., Lee, M. M., and Wong, Y. H. (2004) Eur J Immunol 34(3), 785-795 Krupnick, J. G., and Benovic, J. L. (1998) Annu Rev Pharmacol Toxicol 38, 289319 Ferguson, S. S., Downey, W. E., 3rd, Colapietro, A. M., Barak, L. S., Menard, L., and Caron, M. G. (1996) Science 271(5247), 363-366 Manes, S., Lacalle, R. A., Gomez-Mouton, C., del Real, G., Mira, E., and Martinez, A. C. (2001) Semin Immunol 13(2), 147-157 Mortier, A., Van Damme, J., and Proost, P. (2008) Pharmacol Ther 120(2), 197217 Cox, J. H., Dean, R. A., Roberts, C. R., and Overall, C. M. (2008) J Biol Chem 283(28), 19389-19399 Wolf, M., Albrecht, S., and Marki, C. (2008) Int J Biochem Cell Biol 40(6-7), 1185-1198 Cox, J. H., and Overall, C. M. (2008) Cytokine substrates: MMP regulation of inflammatory signalling molecules. In: Edwards, D., Hoyer-Hansen, G., Blasi, F., and Sloane, B. F. (eds). Proteases and cancer biology, Springer, New York 152  157. 158. 159. 160. 161. 162. 163. 164. 165. 166. 167. 168. 169. 170. 171. 172. 173. 174. 175.  Clark-Lewis, I., Dewald, B., Geiser, T., Moser, B., and Baggiolini, M. (1993) Proc Natl Acad Sci U S A 90(8), 3574-3577 Detheux, M., Standker, L., Vakili, J., Munch, J., Forssmann, U., Adermann, K., Pohlmann, S., Vassart, G., Kirchhoff, F., Parmentier, M., and Forssmann, W. G. (2000) J Exp Med 192(10), 1501-1508 Richter, R., Bistrian, R., Escher, S., Forssmann, W. G., Vakili, J., Henschler, R., Spodsberg, N., Frimpong-Boateng, A., and Forssmann, U. (2005) J Immunol 175(3), 1599-1608 Wuyts, A., Govaerts, C., Struyf, S., Lenaerts, J. P., Put, W., Conings, R., Proost, P., and Van Damme, J. (1999) Eur J Biochem 260(2), 421-429 Van den Steen, P. E., Proost, P., Wuyts, A., Van Damme, J., and Opdenakker, G. (2000) Blood 96(8), 2673-2681 King, A. G., Johanson, K., Frey, C. L., DeMarsh, P. L., White, J. R., McDevitt, P., McNulty, D., Balcarek, J., Jonak, Z. L., Bhatnagar, P. K., and Pelus, L. M. (2000) J Immunol 164(7), 3774-3782 Gupta, S. K., Hassel, T., and Singh, J. P. (1995) Proc Natl Acad Sci U S A 92(17), 7799-7803 Nufer, O., Corbett, M., and Walz, A. (1999) Biochemistry 38(2), 636-642 Proost, P., Struyf, S., Schols, D., Durinx, C., Wuyts, A., Lenaerts, J. P., De Clercq, E., De Meester, I., and Van Damme, J. (1998) FEBS Lett 432(1-2), 7376 Starckx, S., Wuyts, A., Opsomer, I., Van Coillie, E., Proost, P., Arnold, B., Van Damme, J., and Opdenakker, G. (2002) J Interferon Cytokine Res 22(9), 965974 Ehlert, J. E., Gerdes, J., Flad, H. D., and Brandt, E. (1998) J Immunol 161(9), 4975-4982 Ehlert, J. E., Petersen, F., Kubbutat, M. H., Gerdes, J., Flad, H. D., and Brandt, E. (1995) J Biol Chem 270(11), 6338-6344 Krijgsveld, J., Zaat, S. A., Meeldijk, J., van Veelen, P. A., Fang, G., Poolman, B., Brandt, E., Ehlert, J. E., Kuijpers, A. J., Engbers, G. H., Feijen, J., and Dankert, J. (2000) J Biol Chem 275(27), 20374-20381 Starckx, S., Van den Steen, P. E., Wuyts, A., Van Damme, J., and Opdenakker, G. (2002) Leuk Lymphoma 43(2), 233-241 Schutyser, E., Struyf, S., Proost, P., Opdenakker, G., Laureys, G., Verhasselt, B., Peperstraete, L., Van de Putte, I., Saccani, A., Allavena, P., Mantovani, A., and Van Damme, J. (2002) J Biol Chem 277(27), 24584-24593 Hebert, C. A., Luscinskas, F. W., Kiely, J. M., Luis, E. A., Darbonne, W. C., Bennett, G. L., Liu, C. C., Obin, M. S., Gimbrone, M. A., Jr., and Baker, J. B. (1990) J Immunol 145(9), 3033-3040 Webb, L. M., Ehrengruber, M. U., Clark-Lewis, I., Baggiolini, M., and Rot, A. (1993) Proc Natl Acad Sci U S A 90(15), 7158-7162 Proost, P., Schutyser, E., Menten, P., Struyf, S., Wuyts, A., Opdenakker, G., Detheux, M., Parmentier, M., Durinx, C., Lambeir, A. M., Neyts, J., Liekens, S., Maudgal, P. C., Billiau, A., and Van Damme, J. (2001) Blood 98(13), 3554-3561 Lambeir, A. M., Proost, P., Durinx, C., Bal, G., Senten, K., Augustyns, K., Scharpe, S., Van Damme, J., and De Meester, I. (2001) J Biol Chem 276(32), 29839-29845  153  176. 177. 178. 179. 180.  181. 182. 183. 184. 185.  186. 187.  188. 189. 190. 191. 192. 193. 194. 195.  Ajami, K., Pitman, M. R., Wilson, C. H., Park, J., Menz, R. I., Starr, A. E., Cox, J. H., Abbott, C. A., Overall, C. M., and Gorrell, M. D. (2008) FEBS Lett 582(5), 819-825 Denney, H., Clench, M. R., and Woodroofe, M. N. (2009) Biochem Biophys Res Commun 382(2), 341-347 Clark-Lewis, I., Mattioli, I., Gong, J. H., and Loetscher, P. (2003) J Biol Chem 278(1), 289-295 Campbell, T. B., and Broxmeyer, H. E. (2008) Front Biosci 13, 1795-1805 Valenzuela-Fernandez, A., Planchenault, T., Baleux, F., Staropoli, I., LeBarillec, K., Leduc, D., Delaunay, T., Lazarini, F., Virelizier, J. L., Chignard, M., Pidard, D., and Arenzana-Seisdedos, F. (2002) J Biol Chem 277(18), 1567715689 McQuibban, G. A., Butler, G. S., Gong, J. H., Bendall, L., Power, C., ClarkLewis, I., and Overall, C. M. (2001) J Biol Chem 276(47), 43503-43508 Vergote, D., Butler, G. S., Ooms, M., Cox, J. H., Silva, C., Hollenberg, M. D., Jhamandas, J. H., Overall, C. M., and Power, C. (2006) Proc Natl Acad Sci U S A 103(50), 19182-19187 Zhang, K., McQuibban, G. A., Silva, C., Butler, G. S., Johnston, J. B., Holden, J., Clark-Lewis, I., Overall, C. M., and Power, C. (2003) Nat Neurosci 6(10), 1064-1071 Delgado, M. B., Clark-Lewis, I., Loetscher, P., Langen, H., Thelen, M., Baggiolini, M., and Wolf, M. (2001) Eur J Immunol 31(3), 699-707 Abel, S., Hundhausen, C., Mentlein, R., Schulte, A., Berkhout, T. A., Broadway, N., Hartmann, D., Sedlacek, R., Dietrich, S., Muetze, B., Schuster, B., Kallen, K. J., Saftig, P., Rose-John, S., and Ludwig, A. (2004) J Immunol 172(10), 63626372 Gough, P. J., Garton, K. J., Wille, P. T., Rychlewski, M., Dempsey, P. J., and Raines, E. W. (2004) J Immunol 172(6), 3678-3685 Jarnagin, K., Grunberger, D., Mulkins, M., Wong, B., Hemmerich, S., Paavola, C., Bloom, A., Bhakta, S., Diehl, F., Freedman, R., McCarley, D., Polsky, I., Ping-Tsou, A., Kosaka, A., and Handel, T. M. (1999) Biochemistry 38(49), 16167-16177 Weber, M., Uguccioni, M., Baggiolini, M., Clark-Lewis, I., and Dahinden, C. A. (1996) J Exp Med 183(2), 681-685 Wolf, M., Clark-Lewis, I., Buri, C., Langen, H., Lis, M., and Mazzucchelli, L. (2003) Am J Pathol 162(4), 1183-1190 Guan, E., Wang, J., Roderiquez, G., and Norcross, M. A. (2002) J Biol Chem 277(35), 32348-32352 Laurence, J. S., LiWang, A. C., and LiWang, P. J. (1998) Biochemistry 37(26), 9346-9354 Oravecz, T., Pall, M., Roderiquez, G., Gorrell, M. D., Ditto, M., Nguyen, N. Y., Boykins, R., Unsworth, E., and Norcross, M. A. (1997) J Exp Med 186(11), 1865-1872 Schols, D., Proost, P., Struyf, S., Wuyts, A., De Meester, I., Scharpe, S., Van Damme, J., and De Clercq, E. (1998) Antiviral Res 39(3), 175-187 Struyf, S., De Meester, I., Scharpe, S., Lenaerts, J. P., Menten, P., Wang, J. M., Proost, P., and Van Damme, J. (1998) Eur J Immunol 28(4), 1262-1271 Lim, J. K., Burns, J. M., Lu, W., and DeVico, A. L. (2005) J Leukoc Biol 78(2), 442-452 154  196. 197. 198. 199. 200. 201. 202. 203. 204. 205. 206. 207. 208. 209. 210.  211. 212. 213. 214. 215. 216.  Gong, J. H., Uguccioni, M., Dewald, B., Baggiolini, M., and Clark-Lewis, I. (1996) J Biol Chem 271(18), 10521-10527 Proost, P., Struyf, S., Couvreur, M., Lenaerts, J. P., Conings, R., Menten, P., Verhaert, P., Wuyts, A., and Van Damme, J. (1998) J Immunol 160(8), 40344041 Lambeir, A. M., Durinx, C., Proost, P., Van Damme, J., Scharpe, S., and De Meester, I. (2001) FEBS Lett 507(3), 327-330 Struyf, S., Proost, P., Schols, D., De Clercq, E., Opdenakker, G., Lenaerts, J. P., Detheux, M., Parmentier, M., De Meester, I., Scharpe, S., and Van Damme, J. (1999) J Immunol 162(8), 4903-4909 Noso, N., Bartels, J., Mallet, A. I., Mochizuki, M., Christophers, E., and Schroder, J. M. (1998) Eur J Biochem 253(1), 114-122 Richter, R., Schulz-Knappe, P., John, H., and Forssmann, W. G. (2000) Biochemistry 39(35), 10799-10805 Richter, R., Casarosa, P., Standker, L., Munch, J., Springael, J. Y., Nijmeijer, S., Forssmann, W. G., Vischer, H. F., Vakili, J., Detheux, M., Parmentier, M., Leurs, R., and Smit, M. J. (2009) J Immunol 183(2), 1229-1237 Stropes, M. P., Schneider, O. D., Zagorski, W. A., Miller, J. L., and Miller, W. E. (2009) J Virol 83(19), 10016-10027 Vakili, J., Standker, L., Detheux, M., Vassart, G., Forssmann, W. G., and Parmentier, M. (2001) J Immunol 167(6), 3406-3413 Escher, S. E., Forssmann, U., Frimpong-Boateng, A., Adermann, K., Vakili, J., Sticht, H., and Detheux, M. (2004) J Pept Res 63(1), 36-47 Pilkington, K. R., Clark-Lewis, I., and McColl, S. R. (2004) J Biol Chem 279(39), 40276-40282 Hasan, L., Mazzucchelli, L., Liebi, M., Lis, M., Hunger, R. E., Tester, A., Overall, C. M., and Wolf, M. (2006) J Immunol 176(11), 6512-6522 Proost, P., Struyf, S., Schols, D., Opdenakker, G., Sozzani, S., Allavena, P., Mantovani, A., Augustyns, K., Bal, G., Haemers, A., Lambeir, A. M., Scharpe, S., Van Damme, J., and De Meester, I. (1999) J Biol Chem 274(7), 3988-3993 Struyf, S., Proost, P., Sozzani, S., Mantovani, A., Wuyts, A., De Clercq, E., Schols, D., and Van Damme, J. (1998) J Immunol 161(6), 2672-2675 Macphee, C. H., Appelbaum, E. R., Johanson, K., Moores, K. E., Imburgia, C. S., Fornwald, J., Berkhout, T., Brawner, M., Groot, P. H., O'Donnell, K., O'Shannessy, D., Scott, G., and White, J. R. (1998) J Immunol 161(11), 62736279 Shinkai, A., Komuta-Kunitomo, M., Sato-Nakamura, N., and Anazawa, H. (2002) Protein Eng 15(11), 923-929 Garton, K. J., Gough, P. J., Blobel, C. P., Murphy, G., Greaves, D. R., Dempsey, P. J., and Raines, E. W. (2001) J Biol Chem 276(41), 37993-38001 Hundhausen, C., Misztela, D., Berkhout, T. A., Broadway, N., Saftig, P., Reiss, K., Hartmann, D., Fahrenholz, F., Postina, R., Matthews, V., Kallen, K. J., RoseJohn, S., and Ludwig, A. (2003) Blood 102(4), 1186-1195 Hundhausen, C., Schulte, A., Schulz, B., Andrzejewski, M. G., Schwarz, N., von Hundelshausen, P., Winter, U., Paliga, K., Reiss, K., Saftig, P., Weber, C., and Ludwig, A. (2007) J Immunol 178(12), 8064-8072 Andrzejewski, M. G., Koelsch, A., Kogel, T., Dreymueller, D., Schwarz, N., and Ludwig, A. (2010) Biochem Biophys Res Commun 395(2), 178-184 Dean, R. A., and Overall, C. M. (2007) Mol Cell Proteomics 6(4), 611-623 155  217. 218. 219. 220. 221. 222. 223. 224.  225. 226. 227. 228. 229. 230. 231. 232. 233. 234. 235. 236. 237. 238.  Nakagawa, H., Hatakeyama, S., Ikesue, A., and Miyai, H. (1991) FEBS Lett 282(2), 412-414 Ohashi, K., Naruto, M., Nakaki, T., and Sano, E. (2003) Biochim Biophys Acta 1649(1), 30-39 Padrines, M., Wolf, M., Walz, A., and Baggiolini, M. (1994) FEBS Lett 352(2), 231-235 Van Den Steen, P. E., Wuyts, A., Husson, S. J., Proost, P., Van Damme, J., and Opdenakker, G. (2003) Eur J Biochem 270(18), 3739-3749 Davis, D. A., Singer, K. E., De La Luz Sierra, M., Narazaki, M., Yang, F., Fales, H. M., Yarchoan, R., and Tosato, G. (2005) Blood 105(12), 4561-4568 Christopherson, K. W., 2nd, Hangoc, G., and Broxmeyer, H. E. (2002) J Immunol 169(12), 7000-7008 Ohtsuki, T., Hosono, O., Kobayashi, H., Munakata, Y., Souta, A., Shioda, T., and Morimoto, C. (1998) FEBS Lett 431(2), 236-240 Shioda, T., Kato, H., Ohnishi, Y., Tashiro, K., Ikegawa, M., Nakayama, E. E., Hu, H., Kato, A., Sakai, Y., Liu, H., Honjo, T., Nomoto, A., Iwamoto, A., Morimoto, C., and Nagai, Y. (1998) Proc Natl Acad Sci U S A 95(11), 63316336 Arakelyan, A., Kriegova, E., Kubistova, Z., Mrazek, F., Kverka, M., du Bois, R. M., Kolek, V., and Petrek, M. (2009) Clin Exp Immunol 155(3), 457-465 Harlin, H., Kuna, T. V., Peterson, A. C., Meng, Y., and Gajewski, T. F. (2006) Cancer Immunol Immunother 55(10), 1185-1197 Steinbach, D., Schramm, A., Eggert, A., Onda, M., Dawczynski, K., Rump, A., Pastan, I., Wittig, S., Pfaffendorf, N., Voigt, A., Zintl, F., and Gruhn, B. (2006) Clin Cancer Res 12(8), 2434-2441 Youn, B. S., Zhang, S. M., Lee, E. K., Park, D. H., Broxmeyer, H. E., Murphy, P. M., Locati, M., Pease, J. E., Kim, K. K., Antol, K., and Kwon, B. S. (1997) J Immunol 159(11), 5201-5205 Han, I. S., Ra, J. S., Kim, M. W., Lee, E. A., Jun, H. Y., Park, S. K., and Kwon, B. S. (2003) Mol Cells 15(2), 176-180 Forssmann, U., Magert, H. J., Adermann, K., Escher, S. E., and Forssmann, W. G. (2001) J Leukoc Biol 70(3), 357-366 Bianchi, M. E. (2007) J Leukoc Biol 81(1), 1-5 Belaaouaj, A. A., Li, A., Wun, T. C., Welgus, H. G., and Shapiro, S. D. (2000) J Biol Chem 275(35), 27123-27128 Cunningham, A. C., Hasty, K. A., Enghild, J. J., and Mast, A. E. (2002) Biochem J 367(Pt 2), 451-458 Diekmann, O., and Tschesche, H. (1994) Braz J Med Biol Res 27(8), 18651876 Mohan, M. J., Seaton, T., Mitchell, J., Howe, A., Blackburn, K., Burkhart, W., Moyer, M., Patel, I., Waitt, G. M., Becherer, J. D., Moss, M. L., and Milla, M. E. (2002) Biochemistry 41(30), 9462-9469 English, W. R., Puente, X. S., Freije, J. M., Knauper, V., Amour, A., Merryweather, A., Lopez-Otin, C., and Murphy, G. (2000) J Biol Chem 275(19), 14046-14055 Schonbeck, U., Mach, F., and Libby, P. (1998) J Immunol 161(7), 3340-3346 Tschesche, H., Lichte, A., Hiller, O., Oberpichler, A., Buttner, F. H., and Bartnik, E. (2000) Adv Exp Med Biol 477, 217-228 156  239. 240. 241. 242. 243. 244. 245. 246. 247. 248. 249. 250. 251. 252. 253. 254. 255. 256. 257. 258. 259. 260. 261. 262. 263. 264.  Hiller, O., Lichte, A., Oberpichler, A., Kocourek, A., and Tschesche, H. (2000) J Biol Chem 275(42), 33008-33013 Bini, A., Itoh, Y., Kudryk, B. J., and Nagase, H. (1996) Biochemistry 35(40), 13056-13063 Bini, A., Wu, D., Schnuer, J., and Kudryk, B. J. (1999) Biochemistry 38(42), 13928-13936 Hiraoka, N., Allen, E., Apel, I. J., Gyetko, M. R., and Weiss, S. J. (1998) Cell 95(3), 365-377 Ricklin, D., Hajishengallis, G., Yang, K., and Lambris, J. D. (2010) Nat Immunol 11(9), 785-797 Rozanov, D. V., Savinov, A. Y., Golubkov, V. S., Postnova, T. I., Remacle, A., Tomlinson, S., and Strongin, A. Y. (2004) J Biol Chem 279(45), 46551-46557 Lin, M., Jackson, P., Tester, A. M., Diaconu, E., Overall, C. M., Blalock, J. E., and Pearlman, E. (2008) Am J Pathol 173(1), 144-153 McGuire, J. K., Li, Q., and Parks, W. C. (2003) Am J Pathol 162(6), 1831-1843 Tager, A. M., and Luster, A. D. (2003) Prostaglandins Leukot Essent Fatty Acids 69(2-3), 123-134 Borregaard, N., Sorensen, O. E., and Theilgaard-Monch, K. (2007) Trends Immunol 28(8), 340-345 Papayannopoulos, V., and Zychlinsky, A. (2009) Trends Immunol 30(11), 513521 Ayabe, T., Satchell, D. P., Pesendorfer, P., Tanabe, H., Wilson, C. L., Hagen, S. J., and Ouellette, A. J. (2002) J Biol Chem 277(7), 5219-5228 Wilson, C. L., Schmidt, A. P., Pirila, E., Valore, E. V., Ferri, N., Sorsa, T., Ganz, T., and Parks, W. C. (2009) J Biol Chem 284(13), 8301-8311 Peter, C., Waibel, M., Radu, C. G., Yang, L. V., Witte, O. N., Schulze-Osthoff, K., Wesselborg, S., and Lauber, K. (2008) J Biol Chem 283(9), 5296-5305 Chalaris, A., Rabe, B., Paliga, K., Lange, H., Laskay, T., Fielding, C. A., Jones, S. A., Rose-John, S., and Scheller, J. (2007) Blood 110(6), 1748-1755 Levy, B. D., Clish, C. B., Schmidt, B., Gronert, K., and Serhan, C. N. (2001) Nat Immunol 2(7), 612-619 Serhan, C. N., and Savill, J. (2005) Nat Immunol 6(12), 1191-1197 Chiang, N., Serhan, C. N., Dahlen, S. E., Drazen, J. M., Hay, D. W., Rovati, G. E., Shimizu, T., Yokomizo, T., and Brink, C. (2006) Pharmacol Rev 58(3), 463487 Maddox, J. F., Colgan, S. P., Clish, C. B., Petasis, N. A., Fokin, V. V., and Serhan, C. N. (1998) Faseb J 12(6), 487-494 Maddox, J. F., Hachicha, M., Takano, T., Petasis, N. A., Fokin, V. V., and Serhan, C. N. (1997) J Biol Chem 272(11), 6972-6978 Arita, M., Ohira, T., Sun, Y. P., Elangovan, S., Chiang, N., and Serhan, C. N. (2007) J Immunol 178(6), 3912-3917 Serhan, C. N. (2008) J Periodontol 79(8 Suppl), 1520-1526 Li, Q., Park, P. W., Wilson, C. L., and Parks, W. C. (2002) Cell 111(5), 635-646 Essick, E., Sithu, S., Dean, W., and D'Souza, S. (2008) Mol Cell Biochem 314(1-2), 151-159 Sithu, S. D., English, W. R., Olson, P., Krubasik, D., Baker, A. H., Murphy, G., and D'Souza, S. E. (2007) J Biol Chem 282(34), 25010-25019 Tarin, C., Gomez, M., Calvo, E., Lopez, J. A., and Zaragoza, C. (2009) Arterioscler Thromb Vasc Biol 29(1), 27-32 157  265. 266. 267. 268. 269. 270. 271. 272. 273. 274. 275. 276. 277. 278. 279. 280. 281. 282. 283. 284. 285. 286. 287. 288. 289. 290. 291.  Xu, D., Suenaga, N., Edelmann, M. J., Fridman, R., Muschel, R. J., and Kessler, B. M. (2008) Mol Cell Proteomics 7(11), 2215-2228 Ariel, A., Fredman, G., Sun, Y. P., Kantarci, A., Van Dyke, T. E., Luster, A. D., and Serhan, C. N. (2006) Nat Immunol 7(11), 1209-1216 Jamieson, T., Cook, D. N., Nibbs, R. J., Rot, A., Nixon, C., McLean, P., Alcami, A., Lira, S. A., Wiekowski, M., and Graham, G. J. (2005) Nat Immunol 6(4), 403411 Kennedy, A. D., and DeLeo, F. R. (2009) Immunol Res 43(1-3), 25-61 Perretti, M., and D'Acquisto, F. (2009) Nat Rev Immunol 9(1), 62-70 Scannell, M., Flanagan, M. B., deStefani, A., Wynne, K. J., Cagney, G., Godson, C., and Maderna, P. (2007) J Immunol 178(7), 4595-4605 Butler, G. S., Sim, D., Tam, E., Devine, D., and Overall, C. M. (2002) J Biol Chem 277(20), 17511-17519 Fadok, V. A., Bratton, D. L., Konowal, A., Freed, P. W., Westcott, J. Y., and Henson, P. M. (1998) J Clin Invest 101(4), 890-898 Huynh, M. L., Fadok, V. A., and Henson, P. M. (2002) J Clin Invest 109(1), 4150 Lucas, M., Stuart, L. M., Savill, J., and Lacy-Hulbert, A. (2003) J Immunol 171(5), 2610-2615 Ito, A., Mukaiyama, A., Itoh, Y., Nagase, H., Thogersen, I. B., Enghild, J. J., Sasaguri, Y., and Mori, Y. (1996) J Biol Chem 271(25), 14657-14660 Karsdal, M. A., Larsen, L., Engsig, M. T., Lou, H., Ferreras, M., Lochter, A., Delaisse, J. M., and Foged, N. T. (2002) J Biol Chem 277(46), 44061-44067 Maeda, S., Dean, D. D., Gomez, R., Schwartz, Z., and Boyan, B. D. (2002) Calcif Tissue Int 70(1), 54-65 Yu, Q., and Stamenkovic, I. (2000) Genes Dev 14(2), 163-176 Overall, C. M., Wrana, J. L., and Sodek, J. (1989) Connect Tissue Res 20(1-4), 289-294 Overall, C. M., Wrana, J. L., and Sodek, J. (1991) J Periodontal Res 26(3 Pt 2), 279-282 Xu, J., and Clark, R. A. (1996) J Cell Biol 132(1-2), 239-249 Wrana, J. L., Overall, C. M., and Sodek, J. (1991) Eur J Biochem 197(2), 519528 Golpon, H. A., Fadok, V. A., Taraseviciene-Stewart, L., Scerbavicius, R., Sauer, C., Welte, T., Henson, P. M., and Voelkel, N. F. (2004) Faseb J 18(14), 17161718 Hashimoto, G., Inoki, I., Fujii, Y., Aoki, T., Ikeda, E., and Okada, Y. (2002) J Biol Chem 277(39), 36288-36295 Gong, J. H., and Clark-Lewis, I. (1995) J Exp Med 181(2), 631-640 Overall, C. M., and Kleifeld, O. (2006) Br J Cancer 94(7), 941-946 Butler, G. S., Tam, E. M., and Overall, C. M. (2004) J Biol Chem 279(15), 15615-15620 Clark-Lewis, I., Vo, L., Owen, P., and Anderson, J. (1997) Methods Enzymol 287, 233-250 Starr, A. E., and Overall, C. M. (2009) Methods Enzymol 461, 281-307 Wang, H., and Joseph, J. A. (1999) Free Radic Biol Med 27(5-6), 612-616 Quintero, P. A., Knolle, M. D., Cala, L. F., Zhuang, Y., and Owen, C. A. J Immunol 184(3), 1575-1588 158  292. 293. 294. 295. 296. 297. 298. 299. 300. 301. 302. 303. 304. 305. 306. 307. 308. 309. 310. 311. 312. 313. 314. 315.  Ryu, O. H., Choi, S. J., Firatli, E., Choi, S. W., Hart, P. S., Shen, R. F., Wang, G., Wu, W. W., and Hart, T. C. (2005) J Biol Chem 280(17), 17415-17421 Wang, W., Bacon, K. B., Oldham, E. R., and Schall, T. J. (1998) J Clin Immunol 18(3), 214-222 Forssmann, U., Delgado, M. B., Uguccioni, M., Loetscher, P., Garotta, G., and Baggiolini, M. (1997) FEBS Lett 408(2), 211-216 Pardigol, A., Forssmann, U., Zucht, H. D., Loetscher, P., Schulz-Knappe, P., Baggiolini, M., Forssmann, W. G., and Magert, H. J. (1998) Proc Natl Acad Sci U S A 95(11), 6308-6313 Wuyts, A., D'Haese, A., Cremers, V., Menten, P., Lenaerts, J. P., De Loof, A., Heremans, H., Proost, P., and Van Damme, J. (1999) J Immunol 163(11), 6155-6163 Proost, P., Menten, P., Struyf, S., Schutyser, E., De Meester, I., and Van Damme, J. (2000) Blood 96(5), 1674-1680 Escher, S. E., Sticht, H., Forssmann, W. G., Rosch, P., and Adermann, K. (1999) J Pept Res 54(6), 505-513 Howard, O. M., Dong, H. F., Shirakawa, A. K., and Oppenheim, J. J. (2000) Blood 96(3), 840-845 Nomiyama, H., Hieshima, K., Nakayama, T., Sakaguchi, T., Fujisawa, R., Tanase, S., Nishiura, H., Matsuno, K., Takamori, H., Tabira, Y., Yamamoto, T., Miura, R., and Yoshie, O. (2001) Int Immunol 13(8), 1021-1029 Kuschert, G. S., Coulin, F., Power, C. A., Proudfoot, A. E., Hubbard, R. E., Hoogewerf, A. J., and Wells, T. N. (1999) Biochemistry 38(39), 12959-12968 Miao, Z., Premack, B. A., Wei, Z., Wang, Y., Gerard, C., Showell, H., Howard, M., Schall, T. J., and Berahovich, R. (2007) J Immunol 178(11), 7395-7404 Bliss, S. K., Marshall, A. J., Zhang, Y., and Denkers, E. Y. (1999) J Immunol 162(12), 7369-7375 Guzik, K., Bzowska, M., Smagur, J., Krupa, O., Sieprawska, M., Travis, J., and Potempa, J. (2007) Cell Death Differ 14(1), 171-182 Guzik, K., and Potempa, J. (2008) Biochimie 90(2), 405-415 Parente, L., and Solito, E. (2004) Inflamm Res 53(4), 125-132 Brown, G. D., and Nazarali, A. J. (2010) BMC Dev Biol 10(1), 93 Emingil, G., Kuula, H., Sorsa, T., and Atilla, G. (2006) J Periodontol 77(4), 664671 Kuula, H., Salo, T., Pirila, E., Hagstrom, J., Luomanen, M., GutierrezFernandez, A., Romanos, G. E., and Sorsa, T. (2008) Arch Oral Biol 53(2), 175186 Wallard, M. J., Pennington, C. J., Veerakumarasivam, A., Burtt, G., Mills, I. G., Warren, A., Leung, H. Y., Murphy, G., Edwards, D. R., Neal, D. E., and Kelly, J. D. (2006) Br J Cancer 94(4), 569-577 Lopez-Otin, C., and Overall, C. M. (2002) Nat Rev Mol Cell Biol 3(7), 509-519 Impens, F., Colaert, N., Helsens, K., Plasman, K., Van Damme, P., Vandekerckhove, J., and Gevaert, K. (2010) Proteomics 10(6), 1284-1296 Butler, G. S., Dean, R. A., Tam, E. M., and Overall, C. M. (2008) Mol Cell Biol 28(15), 4896-4914 Gevaert, K., Goethals, M., Martens, L., Van Damme, J., Staes, A., Thomas, G. R., and Vandekerckhove, J. (2003) Nat Biotechnol 21(5), 566-569 Gray, D. C., Mahrus, S., and Wells, J. A. (2010) Cell 142(4), 637-646 159  316. 317. 318. 319. 320. 321. 322. 323. 324. 325. 326. 327. 328. 329. 330. 331. 332. 333. 334. 335. 336. 337. 338. 339.  McDonald, L., Robertson, D. H., Hurst, J. L., and Beynon, R. J. (2005) Nat Methods 2(12), 955-957 Van Damme, P., Staes, A., Bronsoms, S., Helsens, K., Colaert, N., Timmerman, E., Aviles, F. X., Vandekerckhove, J., and Gevaert, K. (2010) Nat Methods 7(7), 512-515 Kleifeld, O., Doucet, A., auf dem Keller, U., Prudova, A., Schilling, O., Kainthan, R. K., Starr, A. E., Foster, L. J., Kizhakkedathu, J. N., and Overall, C. M. (2010) Nat Biotechnol 28(3), 281-288 Prudova, A., auf dem Keller, U., Butler, G. S., and Overall, C. M. (2010) Mol Cell Proteomics 9(5), 894-911 Bigg, H. F., Morrison, C. J., Butler, G. S., Bogoyevitch, M. A., Wang, Z., Soloway, P. D., and Overall, C. M. (2001) Cancer Res 61(9), 3610-3618 auf dem Keller, U., Prudova, A., Gioia, M., Butler, G. S., and Overall, C. M. (2010) Mol Cell Proteomics 9(5), 912-927 Schilling, O., and Overall, C. M. (2008) Nat Biotechnol 26(6), 685-694 Colaert, N., Helsens, K., Martens, L., Vandekerckhove, J., and Gevaert, K. (2009) Nat Methods 6(11), 786-787 Deutsch, E. W., Mendoza, L., Shteynberg, D., Farrah, T., Lam, H., Tasman, N., Sun, Z., Nilsson, E., Pratt, B., Prazen, B., Eng, J. K., Martin, D. B., Nesvizhskii, A. I., and Aebersold, R. (2010) Proteomics 10(6), 1150-1159 Pedrioli, P. G. (2010) Methods Mol Biol 604, 213-238 Reinemer, P., Grams, F., Huber, R., Kleine, T., Schnierer, S., Piper, M., Tschesche, H., and Bode, W. (1994) FEBS Lett 338(2), 227-233 Schechter, I., and Berger, A. (1967) Biochem Biophys Res Commun 27(2), 157162 Moisan, E., and Girard, D. (2006) J Leukoc Biol 79(3), 489-498 Mor-Vaknin, N., Punturieri, A., Sitwala, K., and Markovitz, D. M. (2003) Nat Cell Biol 5(1), 59-63 Oppenheim, J. J., Dong, H. F., Plotz, P., Caspi, R. R., Dykstra, M., Pierce, S., Martin, R., Carlos, C., Finn, O., Koul, O., and Howard, O. M. (2005) J Leukoc Biol 77(6), 854-861 Coppock, H. A., White, A., Aplin, J. D., and Westwood, M. (2004) Biol Reprod 71(2), 438-443 Fowlkes, J. L., Suzuki, K., Nagase, H., and Thrailkill, K. M. (1994) Endocrinology 135(6), 2810-2813 Manes, S., Llorente, M., Lacalle, R. A., Gomez-Mouton, C., Kremer, L., Mira, E., and Martinez, A. C. (1999) J Biol Chem 274(11), 6935-6945 Miyamoto, S., Yano, K., Sugimoto, S., Ishii, G., Hasebe, T., Endoh, Y., Kodama, K., Goya, M., Chiba, T., and Ochiai, A. (2004) Cancer Res 64(2), 665671 Park, H. I., Turk, B. E., Gerkema, F. E., Cantley, L. C., and Sang, Q. X. (2002) J Biol Chem 277(38), 35168-35175 Sadowski, T., Dietrich, S., Koschinsky, F., and Sedlacek, R. (2003) Mol Biol Cell 14(11), 4569-4580 Wu, H. B., Lee, C. Y., and Rechler, M. M. (1999) Horm Metab Res 31(2-3), 186191 Sage, E. H., Reed, M., Funk, S. E., Truong, T., Steadele, M., Puolakkainen, P., Maurice, D. H., and Bassuk, J. A. (2003) J Biol Chem 278(39), 37849-37857 Sasaki, T., Miosge, N., and Timpl, R. (1999) Matrix Biol 18(5), 499-508 160  340. 341. 342. 343. 344. 345. 346. 347. 348. 349. 350. 351. 352. 353. 354. 355. 356. 357. 358. 359. 360. 361.  362. 363. 364. 365.  Fillmore, R. A., Nelson, S. E., Lausch, R. N., and Oakes, J. E. (2003) Invest Ophthalmol Vis Sci 44(8), 3432-3437 Wuyts, A., Struyf, S., Gijsbers, K., Schutyser, E., Put, W., Conings, R., Lenaerts, J. P., Geboes, K., Opdenakker, G., Menten, P., Proost, P., and Van Damme, J. (2003) Lab Invest 83(1), 23-34 Dunsmore, S. E., Saarialho-Kere, U. K., Roby, J. D., Wilson, C. L., Matrisian, L. M., Welgus, H. G., and Parks, W. C. (1998) J Clin Invest 102(7), 1321-1331 Van den Steen, P. E., Husson, S. J., Proost, P., Van Damme, J., and Opdenakker, G. (2003) Biochem Biophys Res Commun 310(3), 889-896 Firth, S. M., and Baxter, R. C. (2002) Endocr Rev 23(6), 824-854 Pollak, M. (2008) Nat Rev Cancer 8(12), 915-928 Clemmons, D. R., Sleevi, M., Allan, G., and Sommer, A. (2007) J Clin Endocrinol Metab 92(7), 2652-2658 Liu, X. J., Malkowski, M., Guo, Y., Erickson, G. F., Shimasaki, S., and Ling, N. (1993) Endocrinology 132(3), 1176-1183 Almkvist, J., and Karlsson, A. (2004) Glycoconj J 19(7-9), 575-581 Chlenski, A., and Cohn, S. L. (2010) Semin Cell Dev Biol 21(1), 55-65 Malik, R. K., Ghurye, R. R., Lawrence-Watt, D. J., and Stewart, H. J. (2009) Glycobiology 19(12), 1402-1407 Dejica, V. M., Mort, J. S., Laverty, S., Percival, M. D., Antoniou, J., Zukor, D. J., and Poole, A. R. (2008) Am J Pathol 173(1), 161-169 Levy, E., Lopez-Otin, C., Ghiso, J., Geltner, D., and Frangione, B. (1989) J Exp Med 169(5), 1771-1778 Zurdel, J., Finckh, U., Menzer, G., Nitsch, R. M., and Richard, G. (2002) Br J Ophthalmol 86(2), 214-219 Hedrich, J., Lottaz, D., Meyer, K., Yiallouros, I., Jahnen-Dechent, W., Stocker, W., and Becker-Pauly, C. (2010) Biochemistry Cauwe, B., and Opdenakker, G. (2010) Crit Rev Biochem Mol Biol 45(5), 351423 Doucet, A., Butler, G. S., Rodriguez, D., Prudova, A., and Overall, C. M. (2008) Mol Cell Proteomics 7(10), 1925-1951 Butler, G. S., Dean, R. A., Smith, D., and Overall, C. M. (2009) Methods Mol Biol 528, 159-176 Butler, G. S., and Overall, C. M. (2007) Curr Pharm Des 13(3), 263-270 Bateman, A., and Bennett, H. P. (1998) J Endocrinol 158(2), 145-151 Tam, E. M., Morrison, C. J., Wu, Y. I., Stack, M. S., and Overall, C. M. (2004) Proc Natl Acad Sci U S A 101(18), 6917-6922 Zhang, B., Cunningham, M. A., Nichols, W. C., Bernat, J. A., Seligsohn, U., Pipe, S. W., McVey, J. H., Schulte-Overberg, U., de Bosch, N. B., Ruiz-Saez, A., White, G. C., Tuddenham, E. G., Kaufman, R. J., and Ginsburg, D. (2003) Nat Genet 34(2), 220-225 Zheng, C., Liu, H. H., Yuan, S., Zhou, J., and Zhang, B. (2008) Blood Yu, J., Abagyan, R., Dong, S., Gilbert, A., Nussenzweig, V., and Tomlinson, S. (1997) J Exp Med 185(4), 745-753 Yu, J., Dong, S., Rushmere, N. K., Morgan, B. P., Abagyan, R., and Tomlinson, S. (1997) Biochemistry 36(31), 9423-9428 Zhao, X. J., Zhao, J., Zhou, Q., and Sims, P. J. (1998) J Biol Chem 273(17), 10665-10671 161  366. 367. 368. 369. 370. 371. 372. 373. 374. 375. 376. 377. 378. 379. 380. 381. 382. 383. 384. 385. 386. 387.  Sherry, B., Yarlett, N., Strupp, A., and Cerami, A. (1992) Proc Natl Acad Sci U S A 89(8), 3511-3515 Butler, G. S., and Overall, C. M. (2009) Biochemistry 48(46), 10830-10845 Ip, Y. C., Cheung, S. T., and Fan, S. T. (2007) Mol Carcinog 46(3), 225-230 Kwan, J. A., Schulze, C. J., Wang, W., Leon, H., Sariahmetoglu, M., Sung, M., Sawicka, J., Sims, D. E., Sawicki, G., and Schulz, R. (2004) Faseb J 18(6), 690-692 Si-Tayeb, K., Monvoisin, A., Mazzocco, C., Lepreux, S., Decossas, M., Cubel, G., Taras, D., Blanc, J. F., Robinson, D. R., and Rosenbaum, J. (2006) Am J Pathol 169(4), 1390-1401 Eguchi, T., Kubota, S., Kawata, K., Mukudai, Y., Uehara, J., Ohgawara, T., Ibaragi, S., Sasaki, A., Kuboki, T., and Takigawa, M. (2008) Mol Cell Biol 28(7), 2391-2413 Golubkov, V. S., Boyd, S., Savinov, A. Y., Chekanov, A. V., Osterman, A. L., Remacle, A., Rozanov, D. V., Doxsey, S. J., and Strongin, A. Y. (2005) J Biol Chem 280(26), 25079-25086 Schulz, R. (2007) Annu Rev Pharmacol Toxicol 47, 211-242 Ponath, P. D., Qin, S., Ringler, D. J., Clark-Lewis, I., Wang, J., Kassam, N., Smith, H., Shi, X., Gonzalo, J. A., Newman, W., Gutierrez-Ramos, J. C., and Mackay, C. R. (1996) J Clin Invest 97(3), 604-612 Savino, B., Borroni, E. M., Torres, N. M., Proost, P., Struyf, S., Mortier, A., Mantovani, A., Locati, M., and Bonecchi, R. (2009) J Biol Chem 284(38), 26207-26215 Sharma, M. (2010) Crit Rev Biotechnol 30(1), 1-22 Haringman, J. J., Smeets, T. J., Reinders-Blankert, P., and Tak, P. P. (2006) Ann Rheum Dis 65(3), 294-300 Huttenhain, R., Malmstrom, J., Picotti, P., and Aebersold, R. (2009) Curr Opin Chem Biol 13(5-6), 518-525 Li, W., Li, J., Wu, Y., Wu, J., Hotchandani, R., Cunningham, K., McFadyen, I., Bard, J., Morgan, P., Schlerman, F., Xu, X., Tam, S., Goldman, S. J., Williams, C., Sypek, J., and Mansour, T. S. (2009) J Med Chem 52(7), 1799-1802 Devel, L., Garcia, S., Czarny, B., Beau, F., Lajeunesse, E., Vera, L., Georgiadis, D., Stura, E., and Dive, V. (2010) J Biol Chem Norman, P. (2009) Expert Opin Ther Pat 19(7), 1029-1034 Ochieng, J., Fridman, R., Nangia-Makker, P., Kleiner, D. E., Liotta, L. A., Stetler-Stevenson, W. G., and Raz, A. (1994) Biochemistry 33(47), 1410914114 Ochieng, J., Green, B., Evans, S., James, O., and Warfield, P. (1998) Biochim Biophys Acta 1379(1), 97-106 Thijssen, V. L., Barkan, B., Shoji, H., Aries, I. M., Mathieu, V., Deltour, L., Hackeng, T. M., Kiss, R., Kloog, Y., Poirier, F., and Griffioen, A. W. (2010) Cancer Res 70(15), 6216-6224 Rubinstein, N., Alvarez, M., Zwirner, N. W., Toscano, M. A., Ilarregui, J. M., Bravo, A., Mordoh, J., Fainboim, L., Podhajcer, O. L., and Rabinovich, G. A. (2004) Cancer Cell 5(3), 241-251 Cooper, D., Norling, L. V., and Perretti, M. (2008) J Leukoc Biol 83(6), 14591466 Norling, L. V., Sampaio, A. L., Cooper, D., and Perretti, M. (2008) Faseb J 22(3), 682-690 162  388. 389. 390. 391.  Rabinovich, G. A., Sotomayor, C. E., Riera, C. M., Bianco, I., and Correa, S. G. (2000) Eur J Immunol 30(5), 1331-1339 Moisan, E., Chiasson, S., and Girard, D. (2007) Clin Exp Immunol 150(1), 158168 Eckes, B., Colucci-Guyon, E., Smola, H., Nodder, S., Babinet, C., Krieg, T., and Martin, P. (2000) J Cell Sci 113 ( Pt 13), 2455-2462 Cox, J. H., Starr, A. E., Kapplehoff, R., Yan, R., Roberts, C. R., and Overall, C. M. (2010) Arthritis Rheum 62  163  APPENDIX A: PEPTIDES IDENTIFIED IN HFL SECRETOME ANALYSIS Appendix A.1 Peptides identified by iTRAQ-TAILS in Exp1xExp2. Combined list of Mascot and X!Tandem entries, sorted by peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 114) or sMT6EΔA (iTRAQ 115) treated secretome. iTRAQ ratios represent uncorrected values; peptides used for normalization are highlighted with yellow. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. #  Prob  Precursor Mass  z  Error [Da]  N-term  Peptide  iTRAQ 114/ iTRAQ 115  IPI#  1  1.00  3  1774.9877  0.046  iTRAQ  n[145.11]ADANLEAGNVK[272.20]ETR  0.70  IPI00328113  2  0.98  2  1089.5605  0.0069  iTRAQ  n[145.11]ADLSEAANR  1.06  IPI00418471  3  0.98  2  1319.5791  0.008  iTRAQ  n[145.11]AEGPDEDSSNR  0.96  IPI00009904  4  0.97  2  1245.611  0.0039  iTRAQ  n[145.11]AEQNDSVSPR  0.86  IPI00005564  5  1.00  3  2048.1435  0.0936  iTRAQ  n[145.11]AGAAAGGPGVSGVC[160.03]VC[160.03]K[272.20]SR  1.27  IPI00016915  6  0.99  2  1119.535  -0.0081  iTRAQ  n[145.11]AGFAGDDAPR  1.16  IPI00008603  7  0.94  2  1214.5412  -0.0601  iTRAQ  n[145.11]APDQDEIQR  0.80  IPI00021794  8  0.99  10  1360.6693  -0.064  iTRAQ  n[145.11]APPAAGQQQPPR  0.89  IPI00002802  9  1.00  3  2631.2742  0.0195  iTRAQ  n[145.11]AQEPTGNNAEIC[160.03]LLPLDYGPC[160.03]R  0.87  IPI00009198  10  1.00  2  1324.5832  -0.0665  iTRAQ  n[145.11]ASEGGFTATGQR  0.67  IPI00003351  11  0.98  2  1208.635  0.0079  iTRAQ  n[145.11]ASSPGGVYATR  0.96  IPI00418471  12  0.90  2  1088.6363  -0.0104  iTRAQ  n[145.11]AVFPSIVGR  1.93  IPI00008603  13  0.94  2  1250.6166  -0.0033  iTRAQ  n[145.11]AVYLPNC[160.03]DR  2.58  IPI00029236  14  1.00  2  1523.7077  -0.066  iTRAQ  n[145.11]DAGEFVDLYVPR  0.76  IPI00017448  15  1.00  3  1664.7441  -0.105  iTRAQ  n[145.11]DAPEEEDHVLVLR  1.02  IPI00010796  16  0.97  3  1340.5895  -0.0336  iTRAQ  n[145.11]DAPQDFHPDR  0.76  IPI00302592  17  0.85  2  931.4782  -0.0063  iTRAQ  n[145.11]DDANVVR  0.98  IPI00297646  18  1.00  3  2265.1457  0.0605  iTRAQ  n[145.11]DDEVDVDGTVEEDLGK[272.20]SR  0.76  IPI00027230  19  1.00  3  1503.8389  0.0473  iTRAQ  n[145.11]DGVGGDPAVALPHR  0.98  IPI00026530  20  0.97  2  1197.6032  -0.0629  iTRAQ  n[145.11]DIPAMLPAAR  0.62  IPI00329688  21  0.96  2  1362.6771  0.02  iTRAQ  n[145.11]DLEPGTMDSVR  1.10  IPI00007752  22  0.99  2  1428.699  -0.0592  iTRAQ  n[145.11]DLEPTVIDEVR  0.82  IPI00166768  23  0.94  3  1658.6747  -0.088  iTRAQ  n[145.11]DVLLEAC[160.03]C[160.03]ADGHR  1.15  IPI00218803  24  0.99  2  1343.5743  -0.0694  iTRAQ  n[145.11]EAGEQGDIEPR  0.88  IPI00012442  25  1.00  2  1506.7115  -0.0842  iTRAQ  n[145.11]EFQTNLVPYPR  1.11  IPI00007750  164  #  Prob  Precursor Mass  z  Error [Da]  iTRAQ 114/ iTRAQ 115  N-term  Peptide  0.0219  iTRAQ  n[145.11]EGNFDAIANIR  7.28  IPI00014758  IPI#  26  0.99  2  1362.7232  27  1.00  3  2296.0773  0.0436  iTRAQ  n[145.11]FEGLQAEEC[160.03]GILNGC[160.03]ENGR  1.04  IPI00292150  28  1.00  2  1497.6704  -0.0633  iTRAQ  n[145.11]FQSDIGPYQSGR  0.84  IPI00749245  29  0.99  3  2014.0746  0.0019  iTRAQ  n[145.11]FSLADAINTEFK[272.20]NTR  0.76  IPI00418471  30  1.00  3  1398.7356  0.023  iTRAQ  n[145.11]FVGGAENTAHPR  0.63  IPI00029236  31  1.00  3  2207.0958  -0.0695  iTRAQ  n[145.11]FYTK[272.20]PPQC[160.03]VDIPADLR  1.08  IPI00749245  32  0.99  2  1237.6386  -0.0881  iTRAQ  n[145.11]GAPGILGLPGSR  1.23  IPI00304962  33  0.99  2  1213.6913  0.0013  iTRAQ  n[145.11]GASSAGLGPVVR  0.89  IPI00018305  34  0.99  2  1048.4493  -0.0564  iTRAQ  n[145.11]GFAGDDAPR  0.56  IPI00008603  35  0.99  2  1391.7565  0.0286  iTRAQ  n[145.11]GPPGLAGPPGESGR  8.94  IPI00297646  36  1.00  2  1457.7211  -0.0386  iTRAQ  n[145.11]GVQVETISPGDGR  0.91  IPI00413778  37  0.98  2  1168.7094  0.0044  iTRAQ  n[145.11]IGGIGTVPVGR  0.76  IPI00014424  38  0.87  2  1162.591  -0.0042  iTRAQ  n[145.11]ISSPTETER  1.12  IPI00013895  39  1.00  10  1670.9223  0.0127  iTRAQ  n[145.11]K[272.20]FVGGAENTAHPR  0.55  IPI00029236  40  0.99  3  1601.9943  0.0347  iTRAQ  n[145.11]K[272.20]LVIIESDLER  0.91  IPI00000230  41  0.94  3  1779.9023  -0.07  iTRAQ  n[145.11]LADAINTEFK[272.20]NTR  1.35  IPI00418471  42  0.99  2  1373.7478  0.0206  iTRAQ  n[145.11]LGSDAELQIER  0.82  IPI00182126  43  0.85  2  1019.4965  -0.0557  iTRAQ  n[145.11]LPASFDAR  0.92  IPI00295741  44  1.00  10  1962.7976  -0.1031  iTRAQ  n[145.11]LQAEEC[160.03]GILNGC[160.03]ENGR  0.91  IPI00220249  45  0.97  3  1938.0001  0.0424  iTRAQ  n[145.11]LRPGDC[160.03]EVC[160.03]ISYLGR  0.97  IPI00328748  46  0.94  3  1610.9928  0.0581  iTRAQ  n[145.11]LTEAPLNPK[272.20]ANR  9.67  IPI00008603  47  1.00  2  1803.8284  -0.0513  iTRAQ  n[145.11]LVGGPMDASVEEEGVR  23.20  IPI00032293  48  0.98  3  1960.0246  0.044  iTRAQ  n[145.11]LVGGPMDASVEEEGVRR  4.81  IPI00032293  49  0.97  2  1313.6862  -0.0814  iTRAQ  n[145.11]LVILEGELER  3.09  IPI00010779  50  0.99  2  1611.8739  0.0134  iTRAQ  n[145.11]MPPYTVVYFPVR  0.76  IPI00219757  51  1.00  3  2241.2008  0.0131  iTRAQ  n[145.11]PGGLLLGDVAPNFEANTTVGR  0.86  IPI00220301  52  0.95  2  1480.7433  -0.0767  iTRAQ  n[145.11]PPYTVVYFPVR  0.89  IPI00219757  53  1.00  2  1466.6345  -0.0782  iTRAQ  n[145.11]SAGDVDTLAFDGR  0.93  IPI00374563  54  0.99  2  1257.5589  -0.0668  iTRAQ  n[145.11]SAPLAAGC[160.03]PDR  0.83  IPI00003176  55  0.99  2  1714.8958  0.0276  iTRAQ  n[145.11]SDMPPLTLEGIQDR  0.92  IPI00022442  56  1.00  2  1782.7434  -0.0963  iTRAQ  n[145.11]SDVLELTDDNFESR  0.93  IPI00025252  57  1.00  3  1595.899  0.0479  iTRAQ  n[145.11]SK[272.20]FADLSEAANR  0.98  IPI00418471  58  1.00  3  1867.0747  0.0704  iTRAQ  n[145.11]SLADAINTEFK[272.20]NTR  1.78  IPI00418471  59  0.99  2  1619.9115  0.0362  iTRAQ  n[145.11]SLLSLGSQYQPQR  0.67  IPI00002802  165  #  Prob  z  Precursor Mass  Error [Da]  N-term  Peptide  iTRAQ 114/ iTRAQ 115  IPI#  60  1.00  2  1914.9535  -0.0597  iTRAQ  n[145.11]SLNNQIETLLTPEGSR  4.06  IPI00304962  61  0.90  2  1026.4892  -0.0688  iTRAQ  n[145.11]SLPEAGPGR  0.82  IPI00017968  62  1.00  3  1522.8515  0.029  iTRAQ  n[145.11]SPALTIENEHIR  1.07  IPI00012989  63  0.97  2  1219.5808  -0.0109  iTRAQ  n[145.11]SQDASDGLQR  0.93  IPI00009276  64  0.94  2  1137.5298  -0.0602  iTRAQ  n[145.11]SSPGGVYATR  0.50  IPI00418471  65  0.97  3  1615.8491  0.0164  iTRAQ  n[145.11]STVIHYEIPEER  0.65  IPI00001872  66  0.99  2  1934.0204  0.0337  iTRAQ  n[145.11]SYELPDGQVITIGNER  1.03  IPI00003269  67  0.99  3  1671.8865  -0.0902  iTRAQ  n[145.11]VDVSK[272.20]PDLTAALR  0.88  IPI00418471  68  0.99  2  973.5266  -0.0161  iTRAQ  n[145.11]VGAAGATGAR  2.02  IPI00304962  69  1.00  2  1680.7951  -0.0676  iTRAQ  n[145.11]VLSGGTTMYPGIADR  3.83  IPI00008603  70  0.97  2  1234.6085  -0.0707  iTRAQ  n[145.11]VNFTVDQIR  0.89  IPI00186290  71  0.96  2  1286.6425  -0.072  iTRAQ  n[145.11]YTVVYFPVR  1.22  IPI00219757  72  1.00  2  1328.6829  -0.0705  Ac-lysine  n[43.02]AATTGSGVK[272.20]VPR  1.00  IPI00472498  73  0.97  2  1231.7108  -0.0669  Ac-lysine  n[43.02]AAYK[272.20]LVLIR  0.91  IPI00374975  74  1.00  2  1750.759  -0.0537  Ac-lysine  n[43.02]ADK[272.20]EAAFDDAVEER  0.88  IPI00328319  75  0.94  2  1343.7946  0.0052  Ac-lysine  n[43.02]AGITTIEAVK[272.20]R  0.76  IPI00218319  76  0.99  2  1342.7025  -0.0665  Ac-lysine  n[43.02]AGLNSLEAVK[272.20]R  0.83  IPI00010779  77  0.98  3  2272.1472  0.0345  Ac-lysine  n[43.02]ALDGPEQMELEEGK[272.20]AGSGLR  1.58  IPI00023919  78  0.94  2  1352.6585  -0.0043  Ac-lysine  n[43.02]ANK[272.20]GPSYGMSR  0.57  IPI00216138  79  0.87  3  2188.0652  0.0105  Ac  n[43.02]ARSASAAAMGVQVETISPGDGR  na  IPI00413778  80  0.99  3  1831.9619  -0.0628  Ac-lysine  n[43.02]ASSDIQVK[272.20]ELEK[272.20]R  0.71  IPI00479997  81  0.87  2  1389.751  -0.0075  Ac-lysine  n[43.02]ATDELATK[272.20]LSR  1.01  IPI00060181  82  0.93  2  1198.7136  -0.002  Ac-lysine  n[43.02]AVSTGVK[272.20]VPR  0.82  IPI00019600  83  0.98  3  2938.2397  -0.08  Ac-lysine  n[43.02]DDDIAALVVDNGSGMC[160.03]K[272.20]AGFAGDDAPR  0.86  IPI00021439  84  0.83  3  2994.4559  0.0742  Ac-lysine  n[43.02]EEEIAALVIDNGSGMC[160.03]K[272.20]AGFAGDDAPR  0.80  IPI00021440  85  0.99  2  1630.808  -0.0637  Ac-lysine  n[43.02]MEK[272.20]TLETVPLER  0.87  IPI00396378  86  0.95  2  1134.6073  -0.0042  Ac-lysine  n[43.02]SK[272.20]NTVSSAR  0.70  IPI00007280  87  0.99  2  1678.8586  0.0302  Ac-lysine  n[43.02]SQAEFEK[272.20]AAEEVR  0.91  IPI00010182  88  0.86  2  1429.652  0.032  Ac-lysine  n[43.02]SSNEC[160.03]FK[272.20]C[160.03]GR  0.91  IPI00430813  89  0.98  2  1569.9127  0.0279  Ac-lysine  n[43.02]VDVSK[272.20]PDLTAALR  0.82  IPI00418471  166  Appendix A.1 Peptides identified by iTRAQ-TAILS in Exp1. Combined list of Mascot and X!Tandem entries, sorted by peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 114) or sMT6EΔA (iTRAQ 115) treated secretome. iTRAQ ratios represent uncorrected values; peptides used for normalization are highlighted with yellow. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. # 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34  Prob. 0.99 0.91 0.89 0.94 0.91 0.97 0.92 0.90 0.91 0.99 0.97 0.98 0.99 1.00 0.96 0.88 0.89 0.95 0.92 0.99 1.00 0.99 0.94 0.96 0.92 1.00 0.98 0.99 0.91 1.00 0.99 0.95 0.98 0.92  z 3 3 2 2 3 2 4 2 2 2 3 2 2 3 3 2 3 3 3 2 3 2 2 2 2 3 3 3 2 3 4 2 3 2  Precursor Mass 1797.0499 1758.0221 1254.767 1093.5718 1666.9326 1931.8637 2539.4065 1199.5294 1081.5782 1770.9684 2312.3004 1408.7693 1594.7997 2544.2327 2276.1764 1345.7106 1480.8309 2145.2505 1504.8758 1516.7525 1856.0639 1652.9418 989.5478 1753.8731 1129.6684 2692.3416 1595.9039 1981.1147 1125.5266 2536.3792 2199.1601 1159.6308 1580.8435 1212.5675  Error [Da] 0.0648 0.0593 0.0253 -0.0169 0.0444 -0.0766 0.0934 -0.0069 -0.0107 0.0298 0.0817 0.022 0.0176 -0.042 -0.0029 0.0147 0.0068 0.0355 0.0301 0.0286 0.0602 0.0563 -0.0149 0.0369 0.0107 -0.0371 0.0532 0.0271 0.0093 0.0527 0.0945 -0.0011 0.0155 0.0108  N-term iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]AAK[272.20]FDGILGMAYPR n[145.11]AAQTSPSPK[272.20]AGAATGR n[145.11]AATLILEPAGR n[145.11]AAYEEVIR n[145.11]ADAINTEFK[272.20]NTR n[145.11]ADGFYGDAVTAK[272.20]NC[160.03]R n[145.11]AEEAK[272.20]TFDQLTPEESK[272.20]ER n[145.11]AEFSSEAC[160.03]R n[145.11]AELSYSLR n[145.11]AEQQVPLVLWSSDR n[145.11]AFK[272.20]QMEQISQFLQAAER n[145.11]AGEFVDLYVPR n[145.11]AGEPGEPGQTGPAGAR n[145.11]AGHPSLK[272.20]QDAC[160.03]QGDSGGVFAVR n[145.11]AHYNTEILK[272.20]SIDNEWR n[145.11]AILEDEQTQR n[145.11]AINTEFK[272.20]NTR n[145.11]AIVFIK[272.20]QPSSQDALQGR n[145.11]ALK[272.20]GTNESLER n[145.11]ALQQQADEAEDR n[145.11]ASGANFEYIIAEK[272.20]R n[145.11]ASPAGGPLEDVVIER n[145.11]ASVATELR n[145.11]ASVPTTC[160.03]C[160.03]FNLANR n[145.11]AVLSAEQLR n[145.11]AVTVETSDHDNSLSVSIPQPSPLR n[145.11]DAINTEFK[272.20]NTR n[145.11]DAPSWDPVALK[272.20]LPER n[145.11]DASGTNDFR n[145.11]DDLVTVK[272.20]TPAFAESVTEGDVR n[145.11]DEAIHC[160.03]PPC[160.03]SEEK[272.20]LAR n[145.11]DEATALQLR n[145.11]DEEVHAGLGELLR n[145.11]DGEFSMDLR  iTRAQ 114/ iTRAQ 115 1.28 0.83 0.96 1.12 1.07 0.85 0.96 0.97 0.96 0.81 1.27 1.20 0.86 1.16 1.34 0.83 0.57 0.66 0.83 0.60 0.75 0.71 0.87 0.93 0.93 0.75 0.85 0.98 0.90 0.58 0.88 0.87 1.18 1.11  IPI # IPI00011229 IPI00303476 IPI00220906 IPI00003406 IPI00418471 IPI00375294 IPI00014537 IPI00030877 IPI00298793 IPI00552748 IPI00550363 IPI00017448 IPI00304962 IPI00296165 IPI00028076 IPI00215743 IPI00418471 IPI00168813 IPI00418471 IPI00010779 IPI00024993 IPI00303300 IPI00013874 IPI00019945 IPI00032140 IPI00027377 IPI00418471 IPI00329482 IPI00016112 IPI00384016 IPI00305380 IPI00014898 IPI00032140 IPI00216691  167  # 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78  Prob. 0.96 0.83 0.96 0.98 0.96 1.00 1.00 0.93 1.00 0.95 0.99 0.86 0.96 0.94 0.96 0.96 1.00 1.00 0.90 0.91 0.98 0.98 0.99 0.98 0.85 0.96 0.94 0.92 0.94 0.85 0.97 0.98 0.98 1.00 0.97 0.99 0.98 0.99 0.96 0.94 0.91 0.96 0.99 1.00  z 2 2 3 2 2 3 3 3 3 2 3 2 2 2 2 2 2 3 2 4 3 2 2 2 3 2 2 4 2 4 3 3 2 2 4 2 2 2 2 3 2 2 3 3  Precursor Mass 1660.7877 1018.5128 1589.8614 1411.6715 1574.8468 2161.148 1768.048 1665.9548 2430.3027 1045.6097 1641.8732 1336.6954 1368.6814 1272.6151 1496.7031 1466.7117 1382.7015 2619.0719 1398.7158 2060.1943 1624.8857 1699.9386 1507.8143 1361.7215 1848.0448 991.4714 1139.5453 2659.2664 1396.6584 2325.2831 1828.9918 1677.8374 1238.7319 1483.7193 1934.9834 1462.7941 1469.6609 1337.7341 1240.6523 1788.0879 1381.6981 1394.8031 1671.9502 1859.0205  Error [Da] 0.0386 -0.0037 0.0361 0.0192 0.0082 0.0223 0.0506 0.0621 0.0756 0.0207 0.0535 0.0097 0.0167 0.0261 0.0279 -0.0006 0.0393 -0.0524 0.0301 0.1108 0.038 0.0371 0.0292 0.0154 0.0616 -0.0131 0.0126 -0.0352 0.0243 -0.0339 0.0571 0.0319 0.0212 0.0419 0.0163 0.0294 -0.0122 0.0244 0.0241 0.0589 0.0199 0.0279 0.0315 0.0182  N-term iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]DLDGSEDWVYYR n[145.11]DLSEAANR n[145.11]DNADSSPVVDK[272.20]R n[145.11]DNEAIYDIC[160.03]R n[145.11]DQALEALSASLGTR n[145.11]DQDFYSLLGVSK[272.20]TASSR n[145.11]DSK[272.20]LTFDAITTIR n[145.11]DSK[272.20]VFGDLDQVR n[145.11]DSVDFSLADAINTEFK[272.20]NTR n[145.11]DSVLDVVR n[145.11]DSYVGDEAQSK[272.20]R n[145.11]EANAPGPVPGER n[145.11]EATTEFSVDAR n[145.11]EDC[160.03]NELPPR n[145.11]EDDETIPSEYR n[145.11]EEAENTLQSFR n[145.11]EEATLNEMFR n[145.11]EEGQC[160.03]VC[160.03]DEGFAGVDC[160.03]SEK[272.20]R n[145.11]EEQPPETAAQR n[145.11]EK[272.20]IWHHTFYNELR n[145.11]ELQQAVLHMEQR n[145.11]EQQVPLVLWSSDR n[145.11]ESETTTSLVLER n[145.11]ESPAVAAPAYSR n[145.11]EVDALK[272.20]GTNESLER n[145.11]FAGDDAPR n[145.11]FDSDAASQR n[145.11]FEK[272.20]NEAIQAAHDAVAQEGQC[160.03]R n[145.11]FGSDQSENVDR n[145.11]FK[272.20]DTGK[272.20]APVEPEVAIHR n[145.11]FYQGPVGDPDK[272.20]YR n[145.11]GAFEGTHMGPFVER n[145.11]GAPEVLVSAPR n[145.11]GDPGEAGPQGDQGR n[145.11]GDTYFFK[272.20]GAHYWR n[145.11]GEAGSAGPPGPPGLR n[145.11]GEDC[160.03]LWYLDR n[145.11]GEFVDLYVPR n[145.11]GEPGQTGPAGAR n[145.11]GFPGTPGLPGFK[272.20]GIR n[145.11]GGTTMYPGIADR n[145.11]GIPGPVGAAGATGAR n[145.11]GK[272.20]DYYQTLGLAR n[145.11]GLGLSYLSSHIANVER  iTRAQ 114/ iTRAQ 115 0.83 0.93 0.69 0.96 0.89 0.92 0.64 0.94 0.88 1.01 0.87 0.96 1.00 0.81 0.69 0.96 1.27 1.01 0.72 0.81 0.91 0.72 0.95 0.74 0.78 1.10 0.88 1.04 0.75 0.58 7.65 0.77 0.85 1.51 15.22 1.31 0.96 0.74 0.57 0.74 1.23 0.77 0.79 1.30  IPI # IPI00036578 IPI00418471 IPI00328753 IPI00007750 IPI00220857 IPI00293260 IPI00008561 IPI00184375 IPI00418471 IPI00007752 IPI00008603 IPI00301144 IPI00302592 IPI00029739 IPI00220857 IPI00418471 IPI00002714 IPI00867560 IPI00386755 IPI00021428 IPI00295542 IPI00552748 IPI00029744 IPI00025512 IPI00418471 IPI00008603 IPI00472013 IPI00018352 IPI00258804 IPI00176655 IPI00014758 IPI00100980 IPI00143921 IPI00291136 IPI00014758 IPI00304962 IPI00514190 IPI00017448 IPI00304962 IPI00304962 IPI00008603 IPI00304962 IPI00015947 IPI00026314  168  # 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122  Prob. 0.99 0.97 0.94 0.99 0.98 0.90 1.00 1.00 0.90 0.91 0.90 0.99 0.95 1.00 0.97 0.97 1.00 0.93 1.00 0.99 0.96 0.99 0.85 1.00 0.97 0.84 0.98 0.98 0.98 0.96 1.00 0.98 0.86 0.94 0.99 1.00 0.88 0.98 0.95 0.99 0.98 0.95 1.00 0.95  z 2 2 3 2 2 2 3 3 2 2 3 3 2 3 3 3 3 3 3 2 2 2 3 3 4 2 2 2 2 2 2 2 3 2 2 3 3 2 2 2 3 3 2 2  Precursor Mass 1384.6188 1317.7038 1650.9688 1365.6409 1258.5391 1275.6142 1437.7421 2156.0091 1053.6618 1303.7144 2206.1322 1709.9516 1216.6345 1391.7772 1586.0061 1790.063 2061.1567 2206.2426 2041.1721 1462.7947 1327.6581 1350.8027 2239.1765 1823.0475 2425.1005 1199.6199 1463.9151 1532.8693 1257.7433 1879.9943 1581.8121 1419.7563 2125.2004 1179.6375 1574.8363 2424.2278 2200.0873 1126.6406 1333.7613 1522.7945 1418.8919 1628.9291 1654.9159 1365.7073  Error [Da] 0.0141 -0.0129 0.0391 0.0279 0.0055 -0.0075 0.0298 0.07 -0.005 -0.0223 0.1715 0.0579 -0.0017 0.0375 0.0415 0.0336 0.0435 0.0589 0.0786 0.0158 0.0051 -0.0078 0.0308 0.0694 -0.0328 -0.0221 0.0205 0.026 0.0084 -0.0603 0.0174 -0.0029 0.004 0.0118 0.0267 0.0508 0.0106 0.0119 0.0315 0.0261 0.0396 0.0704 0.0213 -0.0124  N-term iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]GMEEGEFSEAR n[145.11]GNPITIFQER n[145.11]GNSTAIQELFK[272.20]R n[145.11]GSTAEDEEQTR n[145.11]GYGNDGFDDR n[145.11]GYSFTTTAER n[145.11]HWPSEPSEAVR n[145.11]HWYVGEGMEEGEFSEAR n[145.11]IALDLLPR n[145.11]IEGAGNFLAIR n[145.11]ISGGMGSMNSVTGGMGMGLDR n[145.11]ITGK[272.20]EDAANNYAR n[145.11]IYSSFGFPR n[145.11]K[272.20]AGFAGDDAPR n[145.11]K[272.20]LVILEGELER n[145.11]K[272.20]QDIVFDGIAQIR n[145.11]K[272.20]SPQELLC[160.03]GASLISDR n[145.11]K[272.20]SYELPDGQVITIGNER n[145.11]K[272.20]VEQAVETEPEPELR n[145.11]LDSELTEFPLR n[145.11]LEAAYEFADR n[145.11]LGAPGILGLPGSR n[145.11]LGRPSEEDEELVVPELER n[145.11]LITGK[272.20]EDAANNYAR n[145.11]LK[272.20]C[160.03]LYHTEGEHC[160.03]QFC[160.03]R n[145.11]LLDPAAWDR n[145.11]LLGAPGILGLPGSR n[145.11]LLSLGSQYQPQR n[145.11]LMNLGGLAVAR n[145.11]LPVC[160.03]GK[272.20]PVNPVEQR n[145.11]LSGGTTMYPGIADR n[145.11]LSLGSQYQPQR n[145.11]LSTC[160.03]K[272.20]TIDMELVK[272.20]R n[145.11]LTFEELER n[145.11]LVDLEPGTMDSVR n[145.11]LVVDNGSGMC[160.03]K[272.20]AGFAGDDAPR n[145.11]LYSSSDDVIELTPSNFNR n[145.11]MAPTPIPTR n[145.11]MFIVNTNVPR n[145.11]MGPPGLAGPPGESGR n[145.11]MK[272.20]DSLVLLGR n[145.11]MK[272.20]FNPFVTSDR n[145.11]MQNPQILAALQER n[145.11]MVNFTVDQIR  iTRAQ 114/ iTRAQ 115 1.27 0.92 1.10 0.80 1.09 1.20 0.69 0.76 0.83 0.85 0.89 1.14 6.44 1.17 0.78 0.84 1.00 0.85 1.01 0.56 4.39 1.12 0.80 5.70 0.90 4.89 1.19 4.19 1.13 0.87 1.07 1.87 0.93 0.92 1.22 4.00 0.40 0.87 0.66 0.93 1.07 0.50 0.89 0.79  IPI # IPI00007750 IPI00219018 IPI00007752 IPI00180404 IPI00013877 IPI00021439 IPI00028911 IPI00007750 IPI00470607 IPI00036578 IPI00555833 IPI00007750 IPI00008561 IPI00008603 IPI00010779 IPI00027780 IPI00019568 IPI00008603 IPI00021842 IPI00014572 IPI00008561 IPI00304962 IPI00005908 IPI00007750 IPI00013976 IPI00010800 IPI00304962 IPI00002802 IPI00550363 IPI00296165 IPI00008603 IPI00002802 IPI00000075 IPI00180404 IPI00007752 IPI00021439 IPI00299571 IPI00003406 IPI00293276 IPI00297646 IPI00008791 IPI00007144 IPI00023860 IPI00186290  169  # 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166  Prob. 0.99 0.99 0.98 0.98 0.96 0.93 0.94 0.99 0.86 1.00 0.98 0.93 0.86 0.99 1.00 0.88 0.86 0.96 0.99 0.99 0.99 0.99 0.97 0.98 1.00 1.00 0.92 0.99 0.99 0.98 0.92 0.99 0.99 0.94 0.92 0.97 0.94 0.99 0.96 1.00 1.00 0.98 1.00 0.99  z 3 2 3 3 2 1 2 2 3 3 3 2 2 2 3 3 2 2 2 2 2 2 2 2 3 3 2 2 2 2 2 2 2 2 2 3 3 2 3 3 3 3 3 2  Precursor Mass 1967.1637 1642.87 1787.0728 2302.1244 1253.603 1297.2918 1291.6674 1502.8165 1787.9833 2018.1376 1527.8511 1509.7438 1099.5612 1264.7029 1962.9659 1358.8339 1415.7593 1306.6816 1463.7542 1489.7323 1433.7232 2184.9829 1085.6274 1252.623 3158.5171 2796.4982 1146.5985 1696.9111 1285.6375 1589.8447 1092.5848 1212.6342 1360.6724 1221.5928 1168.6711 3156.3986 1307.7296 1540.7416 1886.0138 1612.8073 1710.8841 1897.1102 2702.1942 1358.8074  Error [Da] 0.0553 -0.01 0.043 -0.0488 -0.0092 -0.3539 -0.0009 0.0354 0.0827 0.0219 0.0262 -0.0049 -0.0132 0.0019 0.0254 0.0212 -0.005 0.0065 0.0131 0.0193 -0.0152 0.0692 -0.0041 0.006 0.0904 0.0595 -0.013 0.0422 -0.005 0.0276 0.0131 -0.0031 -0.0207 0.018 0.0025 0.0083 0.0185 0.0176 0.0504 0.0506 0.0142 0.0767 0.0046 0.0247  N-term iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]NEFSILK[272.20]SPGSVVFR n[145.11]PFLELDTNLPANR n[145.11]PSK[272.20]GPLQSVQVFGR n[145.11]QK[272.20]IC[160.03]DQWDALGSLTHSR n[145.11]SEGGFTATGQR n[145.11]SEMYLEGLGR n[145.11]SFYTAYLQR n[145.11]SGAQASSTPLSPTR n[145.11]SGEPGK[272.20]QGPSGASGER n[145.11]SGISGPPGPPGPAGK[272.20]EGLR n[145.11]SGPAGEVGK[272.20]PGER n[145.11]SGPQFWVFQDR n[145.11]SGPSGLPGER n[145.11]SGPVGPAGAVGPR n[145.11]SGTLGHPGSLDETTYER n[145.11]SK[272.20]PDLTAALR n[145.11]SLGAWNLENLR n[145.11]SLGSQYQPQR n[145.11]SLNLEELSEMR n[145.11]SLQEQADAAEER n[145.11]SNTTAIAEAWAR n[145.11]SQQTNDYMQPEEDWDR n[145.11]SSAGLGPVVR n[145.11]SSGSGPFTDVR n[145.11]SSSDTC[160.03]GPC[160.03]EPASC[160.03]PPLPPLGC[160.03]LLGETR n[145.11]SSSSLEK[272.20]SYELPDGQVITIGNER n[145.11]STAAQQELR n[145.11]STGGISVPGPMGPSGPR n[145.11]SVSFADDFVR n[145.11]SVSVSVPWDDSLR n[145.11]SVVDLTC[160.03]R n[145.11]SWDLPAAPGR n[145.11]SYGGMLSAYLR n[145.11]SYSPEPDQR n[145.11]TAPAAGVVPSR n[145.11]TC[160.03]GQGYQLSAAK[272.20]DQC[160.03]EDIDEC[160.03]QHR n[145.11]TDAAVEMK[272.20]R n[145.11]TDATNPPEGPQDR n[145.11]TFNSIMK[272.20]C[160.03]DVDIR n[145.11]THEAEQNDSVSPR n[145.11]THPEFAIEEELPR n[145.11]TK[272.20]PPQC[160.03]VDIPADLR n[145.11]TLEHSDC[160.03]AFMVDNEAIYDIC[160.03]R n[145.11]TLMNLGGLAVAR  iTRAQ 114/ iTRAQ 115 0.87 0.85 0.96 0.80 0.79 0.88 1.13 0.89 0.80 0.93 1.09 7.70 1.02 0.98 0.82 0.99 0.75 0.54 0.83 0.75 0.99 0.83 0.97 0.95 0.81 1.26 0.72 0.97 0.20 0.89 0.91 0.96 0.94 0.99 0.91 1.16 0.73 0.88 1.21 1.07 1.08 0.62 0.98 0.85  IPI # IPI00168884 IPI00293867 IPI00221092 IPI00013808 IPI00003351 IPI00026580 IPI00003590 IPI00021405 IPI00297646 IPI00304962 IPI00304962 IPI00014758 IPI00304962 IPI00304962 IPI00217745 IPI00418471 IPI00010800 IPI00002802 IPI00186581 IPI00216134 IPI00007750 IPI00013508 IPI00018305 IPI00022418 IPI00016915 IPI00008603 IPI00019502 IPI00297646 IPI00032140 IPI00010800 IPI00022430 IPI00006166 IPI00296141 IPI00298237 IPI00220113 IPI00220249 IPI00003406 IPI00008780 IPI00003269 IPI00005564 IPI00012490 IPI00749245 IPI00007750 IPI00550363  170  # 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210  Prob. 0.96 0.95 0.90 0.88 0.99 1.00 0.97 0.96 1.00 0.99 0.99 0.87 0.93 0.93 0.91 0.98 0.90 0.97 0.94 0.99 0.98 0.83 1.00 0.85 0.98 0.94 1.00 0.91 0.96 0.84 1.00 0.94 0.93 0.95 0.91 0.98 0.97 0.97 0.98 0.93 0.99 0.85 0.99 1.00  z 2 2 3 2 2 3 2 2 2 3 2 3 3 2 2 2 2 3 2 3 2 2 2 2 3 2 3 2 3 2 2 2 3 3 2 2 2 3 2 3 2 2 3 2  Precursor Mass 1363.6908 1178.596 1875.0581 1260.5919 1796.8882 2236.2643 1544.7922 1483.8027 1402.6642 1251.6548 1619.863 1680.0056 1319.8419 1307.7346 1378.7448 1512.7651 1130.6882 1457.9246 1288.7261 1594.9231 1316.6818 998.5886 1099.506 1209.6291 1681.9316 1285.6634 1439.7875 1199.6888 1797.1451 1356.7685 1845.9534 1387.6716 1418.8498 1473.8579 1326.7396 1185.6521 1587.7607 2437.416 1755.8475 1970.0772 1571.9306 1499.7991 1848.0082 1672.9275  Error [Da] -0.0231 0.0059 0.064 0.0029 0.043 -0.0028 0.0329 0.0234 -0.0031 0.0106 0.032 0.0609 0.0502 0.0139 0.0121 0.0174 0.0101 0.0437 0 0.0196 -0.0029 -0.0109 -0.003 0.0027 0.0648 0.0209 0.0258 -0.0107 0.0735 0.0202 0.0457 -0.0097 0.0261 0.0185 -0.0231 -0.0066 0.0174 0.0917 0.0368 0.0106 0.0301 0.0249 0.0219 0.0335  N-term iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[145.11]TLSMIEEEIR n[145.11]TLTSEEEAR n[145.11]TNEK[272.20]VELQELNDR n[145.11]TPAPETC[160.03]EGR n[145.11]TTFNIQDGPDFQDR n[145.11]TTIAGVVYK[272.20]DGIVLGADTR n[145.11]TWELEPDGALDR n[145.11]VDYYEVLGVQR n[145.11]VGFYESDVMGR n[145.11]VGGAENTAHPR n[145.11]VGSLNLEELSEMR n[145.11]VIFSK[272.20]VDVNTDR n[145.11]VK[272.20]VGVNGFGR n[145.11]VLAELYVSDR n[145.11]VLPGPEEPGGQR n[145.11]VPTQC[160.03]DVPPNSR n[145.11]VSAVLTELR n[145.11]VSK[272.20]PDLTAALR n[145.11]VSLGVDWLTR n[145.11]VSPAAGSSPGK[272.20]PPR n[145.11]VSVPWDDSLR n[145.11]VVNGIPTR n[145.11]YESDVMGR n[145.11]YNPEPPPPR n[145.11]YQGPVGDPDK[272.20]YR n[145.11]YVDDTQFVR n[145.11]YVGDEAQSK[272.20]R n[43.02]AAVDLEK[272.20]LR n[43.02]AAVK[272.20]TLNPK[272.20]AEVAR n[43.02]ADEIAK[272.20]AQVAR n[43.02]ADLEEQLSDEEK[272.20]VR n[43.02]ADNEK[272.20]LDNQR n[43.02]AK[272.20]PAQGAK[272.20]YR n[43.02]AK[272.20]PLTDSEK[272.20]R n[43.02]ALETVPK[272.20]DLR n[43.02]ANNDAVLK[272.20]R n[43.02]AQDQGEK[272.20]ENPMR n[43.02]ASGVAVSDGVIK[272.20]VFNDMK[272.20]VR n[43.02]ASK[272.20]EMFEDTVEER n[43.02]ASQSQGIQQLLQAEK[272.20]R n[43.02]ATVTATTK[272.20]VPEIR n[43.02]AVTLDK[272.20]DAYYR n[43.02]GDAPSPEEK[272.20]LHLITR n[43.02]MDGIVPDIAVGTK[272.20]R  iTRAQ 114/ iTRAQ 115 0.80 1.21 0.71 0.96 0.79 0.92 1.11 0.79 1.01 0.26 0.76 1.15 6.04 0.85 1.04 0.91 0.88 0.79 32.29 0.92 1.19 0.92 7.27 0.89 3.89 0.79 1.04 0.98 0.95 0.83 0.91 0.89 0.99 0.90 0.57 0.88 0.96 0.65 0.92 1.79 0.87 1.15 1.08 1.02  IPI # IPI00032064 IPI00217966 IPI00418471 IPI00030241 IPI00017799 IPI00003217 IPI00002714 IPI00024523 IPI00478003 IPI00029236 IPI00186581 IPI00009794 IPI00219018 IPI00306960 IPI00010800 IPI00293088 IPI00008079 IPI00418471 IPI00014758 IPI00032293 IPI00010800 IPI00025767 IPI00478003 IPI00025084 IPI00014758 IPI00004657 IPI00003269 IPI00332371 IPI00027626 IPI00239077 IPI00026182 IPI00012578 IPI00002459 IPI00004358 IPI00002895 IPI00006252 IPI00376798 IPI00012011 IPI00395865 IPI00025285 IPI00009104 IPI00026970 IPI00007074 IPI00179964  171  # 211 212 213 214 215 216 217 218 219  Prob. 0.89 0.98 0.99 0.98 0.99 1.00 0.98 0.97 0.92  z 3 4 2 3 2 3 2 2 2  Precursor Mass 1429.7488 2605.5822 1427.6909 2144.1194 1773.9461 2003.9775 1553.7462 1633.8715 1709.9083  Error [Da] 0.0199 0.1348 -0.008 0.0782 -0.0108 0.0041 0.0044 0.021 0.0377  N-term Ac Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac Ac-lysine Ac-lysine Ac-lysine  Peptide n[43.02]MDIAIHHPWIR n[43.02]MEK[272.20]TELIQK[272.20]AK[272.20]LAEQAER n[43.02]MFSWVSK[272.20]DAR n[43.02]MGQK[272.20]DSYVGDEAQSK[272.20]R n[43.02]MLGPEGGEGFVVK[272.20]LR n[43.02]MNVDHEVNLLVEEIHR n[43.02]MQPASAK[272.20]WYDR n[43.02]SSK[272.20]TASTNNIAQAR n[43.02]TTTTTFK[272.20]GVDPNSR  iTRAQ 114/ iTRAQ 115 na 1.04 1.26 0.69 1.05 na 0.78 0.95 0.66  IPI # IPI00021369 IPI00018146 IPI00017184 IPI00008603 IPI00003881 IPI00514113 IPI00015029 IPI00221232 IPI00007764  172  Appendix A.3 Peptides identified by iTRAQ-TAILS in Exp2. Combined list of Mascot and X!Tandem entries, sorted by peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 114) or sMT6EΔA (iTRAQ 115) treated secretome. iTRAQ ratios represent uncorrected values; peptides used for normalization are highlighted with yellow. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. # 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34  Prob 1.00 0.94 0.90 0.93 0.99 0.93 0.83 1.00 0.99 0.99 0.98 0.97 0.83 0.88 0.96 0.99 0.86 0.97 0.94 0.94 0.95 0.95 1.00 0.98 0.96 0.99 0.97 0.89 0.90 0.95 0.87 0.99 0.97 0.98  z 3 3 3 2 2 3 3 2 2 3 2 3 3 2 2 2 2 2 2 2 2 2 2 2 3 2 2 2 2 3 2 3 3 2  Precursor Mass 1919.935 2220.5196 2020.2764 970.428 1023.5295 1428.7246 1426.7439 2103.0622 1219.566 1777.9083 1118.5129 2007.9143 2488.0126 887.3977 1397.556 1284.6056 1135.5162 1792.8884 1882.7145 986.4581 1316.5719 1421.5947 1346.6575 1236.5628 1412.7483 1431.6792 1282.5166 1336.7201 1198.595 1507.7211 1126.4918 2023.9223 1812.2126 1586.7445  Error [Da] -0.0563 0.3119 0.2217 -0.0677 -0.0652 -0.0321 -0.0328 -0.0715 -0.0692 -0.0594 -0.056 -0.0996 -0.1401 -0.0493 -0.045 -0.0741 -0.0582 -0.0713 -0.1982 -0.0574 -0.0909 -0.0597 -0.0852 -0.0592 -0.0534 -0.0685 -0.0571 -0.0788 -0.0631 -0.0806 -0.0611 -0.0614 0.1879 -0.044  N-term iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]AAAGGPGVSGVC[160.03]VC[160.03]K[272.20]SR n[145.11]AEK[272.20]K[272.20]ATDAEADVASLNR n[145.11]AEQAEADK[272.20]K[272.20]QAEDR n[145.11]AGPPGESGR n[145.11]AGPVGPVGAR n[145.11]AK[272.20]HIAEDSDR n[145.11]AK[272.20]HIAEEADR n[145.11]ALYSPSDPLTLLQADTVR n[145.11]AMGALELESR n[145.11]APGAPGPVGPAGK[272.20]SGDR n[145.11]ASVEEEGVR n[145.11]C[160.03]EVDALK[272.20]GTNESLER n[145.11]C[160.03]SC[160.03]SPVHPQQAFC[160.03]NADVVIR n[145.11]DEEVPR n[145.11]DFGYDGDFYR n[145.11]DIAVDGEPLGR n[145.11]DIGPYQSGR n[145.11]DWVIPPINLPENSR n[145.11]EC[160.03]K[272.20]TGYYFDGISR n[145.11]EDDIPVR n[145.11]EQAPMAGALNR n[145.11]EQEDPYLNDR n[145.11]FAAATGATPIAGR n[145.11]FADLSEAANR n[145.11]FANYIDK[272.20]VR n[145.11]FDIAVDGEPLGR n[145.11]FGYDGDFYR n[145.11]FIPPAPVLPSR n[145.11]FPGLPGSPGAR n[145.11]FPLENAPIGHNR n[145.11]FQAPSDYR n[145.11]FQGPAGEPGEPGQTGPAGAR n[145.11]FTVGPLGEGGAHK[272.20]VR n[145.11]FVSSSLPDIC[160.03]YR  iTRAQ 114/ iTRAQ 115 24.8 13.51 32.23 32.96 0.28 17.96 15.19 40 32.531 9.81 24.17 0.48 0.83 0.75 8.47 6.1 0.74 0.92 1.1 1.37 1.02 28.6 3.35 6.84 27.7 6.6 11.53 19.96 16 16.31 7.35 13.89 3.31 38.94  IPI # IPI00016915 IPI00013991 IPI00013991 IPI00297646 IPI00297646 IPI00013991 IPI00010779 IPI00003590 IPI00003590 IPI00297646 IPI00032293 IPI00418471 IPI00027166 IPI00023283 IPI00304962 IPI00419585 IPI00749245 IPI00290085 IPI00218803 IPI00032258 IPI00396078 IPI00218803 IPI00398958 IPI00418471 IPI00418471 IPI00419585 IPI00304962 IPI00305975 IPI00306322 IPI00015913 IPI00023673 IPI00304962 IPI00178352 IPI00430812  173  35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80  0.94 0.99 0.95 1.00 0.90 1.00 1.00 0.98 0.88 0.99 0.97 0.99 0.98 0.89 0.98 0.99 0.85 0.90 0.99 1.00 0.99 0.96 0.99 0.99 0.96 0.99 0.82 0.98 0.99 0.86 0.92 0.99 0.84 1.00 0.99 0.99 1.00 1.00 0.97 0.86 0.94 1.00 0.99 0.99 0.99 0.98  2 3 3 2 2 2 2 3 3 2 2 2 2 2 3 2 3 3 3 3 2 3 2 2 3 2 2 2 4 3 2 2 3 2 2 2 2 2 3 3 3 2 2 3 2 2  1345.6667 1976.962 1609.8187 1104.5172 1074.4551 1235.4923 1575.6616 1792.8147 1648.9633 1140.5409 1272.6347 1164.5269 1748.7819 954.4344 2073.9656 1325.5847 1422.7701 1454.9361 1941.9281 1681.8306 1127.5604 1433.9651 1135.4562 1358.6798 1323.7747 1243.6279 1657.7677 1083.5204 2709.7163 2072.3019 1015.5237 1827.9168 2467.5464 1299.6662 1164.5323 1348.5347 1714.8315 1600.7863 1476.698 1819.9496 2328.0706 1330.66 1581.7966 1958.8951 1130.5557 1162.5577  -0.06 -0.0508 -0.0593 -0.0625 -0.0696 -0.0614 -0.0705 -0.069 -0.0474 -0.06 -0.071 -0.0558 -0.0748 -0.0661 -0.0701 -0.0673 -0.0486 0.1644 -0.0467 -0.0685 -0.0563 0.1554 -0.0495 -0.0729 -0.073 -0.1091 -0.076 -0.0591 0.2977 0.2192 -0.0547 -0.0649 0.2687 -0.0855 -0.0607 -0.0492 -0.0652 -0.0684 -0.0827 -0.0261 -0.0721 -0.0727 -0.0518 -0.0595 -0.0608 -0.0487  iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  n[145.11]FWEGLPAQVR n[145.11]GAAAGGPGVSGVC[160.03]VC[160.03]K[272.20]SR n[145.11]GAPGPVGPAGK[272.20]SGDR n[145.11]GATGFPGAAGR n[145.11]GDPGLMGER n[145.11]GGFDEDAEPR n[145.11]GGPMDASVEEEGVR n[145.11]GK[272.20]DLGGFDEDAEPR n[145.11]GK[272.20]VK[272.20]VGVNGFGR n[145.11]GLAGPPGESGR n[145.11]GLQGFPGLQGR n[145.11]GMTGFPGAAGR n[145.11]GPAGEPGEPGQTGPAGAR n[145.11]GPAGPAGER n[145.11]GPAGTPGQIDC[160.03]DTDVK[272.20]R n[145.11]GPPGDPGLMGER n[145.11]GPPGPAGK[272.20]EGLR n[145.11]GPPGPSGEEGK[272.20]R n[145.11]GPSGEPGK[272.20]QGPSGASGER n[145.11]GPSGPAGEVGK[272.20]PGER n[145.11]GPVGAAGATGAR n[145.11]GPVGPAGK[272.20]HGNR n[145.11]GYDGDFYR n[145.11]IETLLTPEGSR n[145.11]IK[272.20]IIAPPER n[145.11]ISSVLQANLR n[145.11]ITWELEPDGALDR n[145.11]LAGPPGESGR n[145.11]LGAEEAK[272.20]TFDQLTPEESK[272.20]ER n[145.11]LGK[272.20]DSNNLC[160.03]LHFNPR n[145.11]LLTPEGSR n[145.11]LNNQIETLLTPEGSR n[145.11]LTETDIC[160.03]K[272.20]LPK[272.20]DEGTC[160.03]R n[145.11]LVIIEGDLER n[145.11]MGALELESR n[145.11]MQPEEDWDR n[145.11]NNQIETLLTPEGSR n[145.11]NQIETLLTPEGSR n[145.11]PGPDGPAASGPAAIR n[145.11]QAEADK[272.20]K[272.20]QAEDR n[145.11]SLAGSSGPGASSGTSGDHGELVVR n[145.11]SLSQQIENIR n[145.11]SPAGGPLEDVVIER n[145.11]SPSAPDAPTC[160.03]PK[272.20]QC[160.03]R n[145.11]SQQIENIR n[145.11]SSAAGEGTLAR  18.29 5.2 9.5 6.65 6.05 6.15 5.79 9.5 0.82 8.5 5.3 6.15 11.49 33.88 24.96 13.05 18.04 37.89 24.57 34.06 15.6 18.98 23.02 32.81 1.31 40 40 28.01 8.16 2.49 17.09 30.37 2.29 5.3 25.31 19.02 20.12 16.13 1.27 37.83 2 5.07 1.74 29.05 18.4 4.15  IPI00014758 IPI00016915 IPI00297646 IPI00186460 IPI00291136 IPI00009794 IPI00032293 IPI00009794 IPI00219018 IPI00297646 IPI00306322 IPI00304962 IPI00304962 IPI00186460 IPI00306322 IPI00291136 IPI00304962 IPI00304962 IPI00297646 IPI00304962 IPI00304962 IPI00304962 IPI00304962 IPI00304962 IPI00003269 IPI00023208 IPI00002714 IPI00297646 IPI00014537 IPI00219219 IPI00304962 IPI00304962 IPI00022200 IPI00183968 IPI00003590 IPI00013508 IPI00304962 IPI00304962 IPI00292020 IPI00013991 IPI00023048 IPI00297646 IPI00303300 IPI00299738 IPI00297646 IPI00292150  174  81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112  0.97 1.00 0.94 1.00 0.82 1.00 0.99 1.00 1.00 0.94 0.93 0.91 0.83 0.91 0.99 0.88 0.99 0.99 0.99 0.99 0.99 0.89 0.87 0.95 0.97 0.91 0.92 0.93 1.00 0.94 0.96 0.97  3 2 3 2 3 3 2 2 2 2 2 2 3 2 2 2 2 2 3 2 2 2 2 2 2 2 2 2 2 3 2 2  1526.9612 1627.7864 1791.865 1405.6748 1718.8745 1915.1906 1288.6684 1333.5192 1674.7394 1397.6838 1186.6077 1200.6052 2616.6384 949.3849 1917.7508 1078.4232 1352.6242 1330.4906 2156.999 962.4041 1094.4972 958.4089 1217.395 1403.6817 1224.4793 1387.6629 905.3244 941.3861 1142.5035 1881.7533 859.3476 1042.4289  0.1675 -0.0673 -0.0379 -0.0423 -0.0661 0.1829 -0.0573 -0.0676 -0.0613 -0.0798 -0.0602 -0.0784 0.3017 -0.0558 -0.0779 -0.0605 -0.0455 -0.0631 -0.1166 -0.0529 -0.0649 -0.0532 -0.231 -0.0561 -0.069 -0.0548 -0.0457 -0.097 -0.0434 -0.0709 -0.046 -0.0577  iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ Ac Ac-lysine Ac Ac Ac Ac Ac-lysine Ac Ac-lysine Ac Ac Ac Ac Ac Ac  n[145.11]SYVGDEAQSK[272.20]R n[145.11]TEVIDPQDLLEGR n[145.11]TPGQIDC[160.03]DTDVK[272.20]R n[145.11]TVITSVGDEEGR n[145.11]VDALK[272.20]GTNESLER n[145.11]VEELMEDTQHK[272.20]LR n[145.11]VFASLPQVER n[145.11]VGADDDEGGAER n[145.11]VGGPMDASVEEEGVR n[145.11]VIDPQDLLEGR n[145.11]VIIEGDLER n[145.11]VILEGELER n[145.11]VMVGMGQK[272.20]DSYVGDEAQSK[272.20]R n[145.11]VNDGDMR n[145.11]VSGGGYDFGYDGDFYR n[145.11]YDGDFYR n[145.11]YVLDDSDGLGR n[43.02]AAGGDHGSPDSYR n[43.02]AC[160.03]GLVASNLNLK[272.20]PGEC[160.03]LR n[43.02]AEASPHPGR n[43.02]AGLGHPAAFGR n[43.02]AGVSFSGHR n[43.02]AIITC[160.03]C[160.03]LLGR n[43.02]AK[272.20]ISSPTETER n[43.02]ASGEHSPGSGAAR n[43.02]ASNVTNK[272.20]TDPR n[43.02]MEEYHR n[43.02]RLFGDHR n[43.02]SAAEAGGVFHR n[43.02]SGDHLHNDSQIEADFR n[43.02]SSAHFNR n[43.02]TMLADHAAR  16.74 5.42 4.5 26.24 3.26 11.97 5.3 9.06 20.4 5.8 29.47 11.8 20.28 1.09 29.62 21.57 0.72 na 1.04 na na na na 0.73 na 0.51 na na na na na na  IPI00008603 IPI00011564 IPI00306322 IPI00002714 IPI00418471 IPI00002714 IPI00216256 IPI00176903 IPI00032293 IPI00011564 IPI00183968 IPI00010779 IPI00008603 IPI00023673 IPI00304962 IPI00304962 IPI00008790 IPI00026904 IPI00219219 IPI00155562 IPI00220342 IPI00003406 IPI00639851 IPI00013895 IPI00647400 IPI00216592 IPI00020885 IPI00748682 IPI00305010 IPI00413611 IPI00021264 IPI00298961  175  APPENDIX B: PEPTIDES IDENTIFIED FROM HFL OR HMEC FRACTIONS Appendix B.1 Peptides identified by iTRAQ-TAILS in conditioned medium of HFL1xHFL2. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 114) or sMT6EΔA (iTRAQ 115) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. N-termini Neo Neo Natural Neo Natural Neo Neo Neo Neo Neo Neo Neo Neo Natural Natural Neo Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural  Prob 1.00 0.99 0.99 0.99 1.00 0.99 0.99 1.00 0.99 1.00 0.97 0.99 1.00 1.00 0.98 0.95 1.00 1.00 1.00 0.98 0.88 0.99 0.96 0.96 0.98 0.99 0.93 0.99 0.92 0.96  z 3 2 2 3 3 3 3 3 2 3 3 2 3 10 2 3 3 2 10 2 2 2 3 2 3 2 2 2 2 2  Precursor Mass 1774.9752 1119.5694 1324.6681 1595.8747 1664.876 1589.842 1665.9093 1658.7858 1497.7012 1398.7245 1677.7825 1457.6893 1877.0269 1782.825 1219.59 1497.8579 1584.8604 1328.764 1750.8356 1253.6487 1259.6605 1342.7114 1473.854 1587.6718 1832.0258 1445.7413 1389.7258 1198.7444 1499.8024 1429.5753  Error [Da] 0.0335 0.0263 0.0184 0.024 0.0269 0.0163 0.0166 0.0231 -0.0325 0.0118 -0.023 -0.0704 0.0028 -0.0144 -0.0015 0.0072 0.0262 0.0106 0.0225 0.0114 -0.0242 -0.0573 0.0146 -0.0715 0.0011 0.0181 -0.0327 0.0288 0.0282 -0.0447  N-term iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[145.11]ADANLEAGNVK[272.20]ETR n[145.11]AGFAGDDAPR n[145.11]ASEGGFTATGQR n[145.11]DAINTEFK[272.20]NTR n[145.11]DAPEEEDHVLVLR n[145.11]DNADSSPVVDK[272.20]R n[145.11]DSK[272.20]VFGDLDQVR n[145.11]DVLLEAC[160.03]C[160.03]ADGHR n[145.11]FQSDIGPYQSGR n[145.11]FVGGAENTAHPR n[145.11]GAFEGTHMGPFVER n[145.11]GVQVETISPGDGR n[145.11]LSGAPQASAADVVVVHGR n[145.11]SDVLELTDDNFESR n[145.11]SQDASDGLQR n[145.11]TEAPLNPK[272.20]ANR n[43.02]AATASAGAGGIDGK[272.20]PR n[43.02]AATTGSGVK[272.20]VPR n[43.02]ADK[272.20]EAAFDDAVEER n[43.02]AESSDK[272.20]LYR n[43.02]AEVEETLK[272.20]R n[43.02]AGLNSLEAVK[272.20]R n[43.02]AK[272.20]PLTDSEK[272.20]R n[43.02]AQDQGEK[272.20]ENPMR n[43.02]ASSDIQVK[272.20]ELEK[272.20]R n[43.02]ASSGAGDPLDSK[272.20]R n[43.02]ATDELATK[272.20]LSR n[43.02]AVSTGVK[272.20]VPR n[43.02]AVTLDK[272.20]DAYYR n[43.02]SSNEC[160.03]FK[272.20]C[160.03]GR  iTRAQ 114/ iTRAQ 115 1.51 1.44 1.4 1.6 1.11 0.41 0.9 1.6 1.305 1.68 1.23 1.194 0.12 1.11 1.23 1.56 17.39 1.24 1.54 3.93 3.87 1.485 0.74 9.94 2.03 15.72 1.72 1.29 1.03 1.21  IPI # IPI00328113 IPI00008603 IPI00003351 IPI00418471 IPI00010796 IPI00328753 IPI00184375 IPI00218803 IPI00749245 IPI00029236 IPI00100980 IPI00413778 IPI00011522 IPI00025252 IPI00009276 IPI00008603 IPI00219729 IPI00472498 IPI00328319 IPI00449049 IPI00063849 IPI00010779 IPI00004358 IPI00376798 IPI00479997 IPI00022277 IPI00060181 IPI00019600 IPI00026970 IPI00430813  176  Appendix B.2 Peptides identified by iTRAQ-TAILS in conditioned medium of HFL1. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 114) or sMT6EΔA (iTRAQ 115) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. N-termini Neo Neo Neo Natural Natural Natural Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Natural Natural Neo Neo Neo Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Neo  Prob 1.00 0.99 0.95 0.99 1.00 0.98 0.99 0.99 1.00 0.99 0.98 1.00 0.98 0.98 0.99 1.00 0.99 1.00 0.90 0.83 1.00 0.98 1.00 1.00 0.99 0.98 0.82 0.98 0.96 0.96 0.98 0.90 0.99 0.92 0.97  z 3 2 3 2 3 3 3 3 3 3 2 3 2 2 3 3 2 10 2 3 3 2 3 2 2 2 2 3 3 2 3 2 2 2 3  Precursor Mass 1774.9752 1119.5694 1480.8527 1324.6681 1664.876 2264.7461 1589.842 1665.9093 1658.7858 2619.0955 1497.7559 1398.7446 1048.5111 1457.7791 1667.8801 1877.0269 1466.7557 1782.8676 1219.6125 1497.852 1594.934 1352.6924 1584.8604 1328.764 1750.8487 1253.6487 1259.7059 1514.8633 1473.854 1587.768 1832.0664 1389.7669 1198.7444 1499.8024 2075.1224  Error [Da] 0.0335 0.0263 0.0286 0.0184 0.0269 -0.3386 0.0163 0.0166 0.0231 -0.0288 0.0222 0.0319 0.0052 0.0194 0.0412 0.0028 0.043 0.0279 0.021 0.0013 0.0305 0.0227 0.0262 0.0106 0.0356 0.0114 0.0216 -0.0027 0.0146 0.0247 0.0417 0.0084 0.0288 0.0282 0.09  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[145.11]ADANLEAGNVK[272.20]ETR n[145.11]AGFAGDDAPR n[145.11]AINTEFK[272.20]NTR n[145.11]ASEGGFTATGQR n[145.11]DAPEEEDHVLVLR n[145.11]DDEVDVDGTVEEDLGK[272.20]SR n[145.11]DNADSSPVVDK[272.20]R n[145.11]DSK[272.20]VFGDLDQVR n[145.11]DVLLEAC[160.03]C[160.03]ADGHR n[145.11]EEGQC[160.03]VC[160.03]DEGFAGVDC[160.03]SEK[272.20]R n[145.11]FQSDIGPYQSGR n[145.11]FVGGAENTAHPR n[145.11]GFAGDDAPR n[145.11]GVQVETISPGDGR n[145.11]HPVGTDEEPLQFR n[145.11]LSGAPQASAADVVVVHGR n[145.11]SAGDVDTLAFDGR n[145.11]SDVLELTDDNFESR n[145.11]SQDASDGLQR n[145.11]TEAPLNPK[272.20]ANR n[145.11]VSPAAGSSPGK[272.20]PPR n[145.11]YVLDDSDGLGR n[43.02]AATASAGAGGIDGK[272.20]PR n[43.02]AATTGSGVK[272.20]VPR n[43.02]ADK[272.20]EAAFDDAVEER n[43.02]AESSDK[272.20]LYR n[43.02]AEVEETLK[272.20]R n[43.02]AK[272.20]PLTDQEK[272.20]R n[43.02]AK[272.20]PLTDSEK[272.20]R n[43.02]AQDQGEK[272.20]ENPMR n[43.02]ASSDIQVK[272.20]ELEK[272.20]R n[43.02]ATDELATK[272.20]LSR n[43.02]AVSTGVK[272.20]VPR n[43.02]AVTLDK[272.20]DAYYR n[43.02]QGDVIGIPFNVDVSSFPSR  iTRAQ 114/ iTRAQ 115 0.71 0.93 0.6 0.74 0.89 1.34 0.41 0.76 1.09 0.9 0.86 1.12 1.21 1.07 0.96 0.25 0.91 0.91 0.73 1.56 0.65 0.87 10.43 0.95 0.83 2.98 2.55 1.08 0.74 9.91 2.23 1.07 0.98 0.83 1.16  IPI # IPI00328113 IPI00008603 IPI00418471 IPI00003351 IPI00010796 IPI00027230 IPI00328753 IPI00184375 IPI00218803 IPI00867560 IPI00749245 IPI00029236 IPI00008603 IPI00413778 IPI00022418 IPI00011522 IPI00374563 IPI00025252 IPI00009276 IPI00008603 IPI00032293 IPI00008790 IPI00219729 IPI00472498 IPI00328319 IPI00449049 IPI00063849 IPI00783313 IPI00004358 IPI00376798 IPI00479997 IPI00060181 IPI00019600 IPI00026970 IPI00299890  177  N-termini Natural Natural  Prob 0.89 0.93  z 3 2  Precursor Mass 1844.0383 1429.637  Error [Da] 0.05 0.017  N-term Modification Ac-lysine Ac-lysine  Peptide n[43.02]SK[272.20]SESPK[272.20]EPEQLR n[43.02]SSNEC[160.03]FK[272.20]C[160.03]GR  iTRAQ 114/ iTRAQ 115 0.92 1.11  IPI # IPI00215965 IPI00430813  178  Appendix B.3 Peptides identified by iTRAQ-TAILS in conditioned medium of HFL2. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 114) or sMT6EΔA (iTRAQ 115) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. N-termini Neo Neo Neo Neo Neo Neo Neo Natural Natural Natural Natural Natural Neo Neo Neo Neo Neo Natural Neo Neo Neo Neo Neo Natural Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo  Prob 0.95 1.00 0.92 0.99 0.92 0.99 0.88 0.88 0.91 0.99 0.99 0.99 0.98 0.90 0.88 0.92 0.97 0.99 0.99 0.89 0.92 0.96 1.00 0.98 0.99 0.93 0.90 0.88 0.98 0.99 0.99 1.00 0.97 0.97 0.86  z 2 3 2 2 2 3 3 2 2 3 4 2 2 2 2 2 3 3 3 2 2 3 3 2 3 2 3 3 2 2 3 3 3 2 2  Precursor Mass 1002.5231 1774.9705 1245.622 1119.5366 1345.6698 2145.2496 1504.8559 1159.5558 1214.4876 1360.6797 2393.2701 1324.6148 1208.5182 1568.8132 1088.6304 1081.6116 2008.021 2488.1173 1595.8747 931.4721 1197.6579 1665.8784 1658.776 1507.7247 1779.8578 995.4234 1848.0212 2659.1705 1396.5923 1497.7012 2014.1094 1398.7245 1677.7825 1238.6849 1381.6747  Error [Da] -0.0349 0.0288 0.0153 -0.0064 -0.0259 0.0349 0.0106 -0.0186 -0.1141 -0.0536 0.0227 -0.0349 -0.1089 0.0175 -0.016 -0.0251 0.0071 -0.0354 0.024 -0.0124 -0.0082 -0.0146 0.0133 -0.06 -0.0118 -0.0413 0.0375 -0.1312 -0.0414 -0.0325 0.0367 0.0118 -0.023 -0.0256 -0.0035  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]AAISQVDR n[145.11]ADANLEAGNVK[272.20]ETR n[145.11]AEQNDSVSPR n[145.11]AGFAGDDAPR n[145.11]AILEDEQTQR n[145.11]AIVFIK[272.20]QPSSQDALQGR n[145.11]ALK[272.20]GTNESLER n[145.11]APDPGFQER n[145.11]APDQDEIQR n[145.11]APPAAGQQQPPR n[145.11]APPAAGQQQPPREPPAAPGAWR n[145.11]ASEGGFTATGQR n[145.11]ASSPGGVYATR n[145.11]ATLDVYNPFETR n[145.11]AVFPSIVGR n[145.11]AVTVAPPGAR n[145.11]C[160.03]EVDALK[272.20]GTNESLER n[145.11]C[160.03]SC[160.03]SPVHPQQAFC[160.03]NADVVIR n[145.11]DAINTEFK[272.20]NTR n[145.11]DDANVVR n[145.11]DIPAMLPAAR n[145.11]DSK[272.20]VFGDLDQVR n[145.11]DVLLEAC[160.03]C[160.03]ADGHR n[145.11]ESETTTSLVLER n[145.11]ETVHC[160.03]DLQPVGPER n[145.11]EVC[160.03]MASR n[145.11]EVDALK[272.20]GTNESLER n[145.11]FEK[272.20]NEAIQAAHDAVAQEGQC[160.03]R n[145.11]FGSDQSENVDR n[145.11]FQSDIGPYQSGR n[145.11]FSLADAINTEFK[272.20]NTR n[145.11]FVGGAENTAHPR n[145.11]GAFEGTHMGPFVER n[145.11]GAPEVLVSAPR n[145.11]GGTTMYPGIADR  iTRAQ 114/ iTRAQ 115 1.42 2.17 2.03 1.81 1.41 1.82 1.76 1.49 1.26 1.52 1.51 1.506 1.82 1.31 1.46 1.44 1.45 1.02 2.47 1.53 1.4 1.16 1.78 1.94 1.05 1.4 2.53 1.59 1.34 1.391 1.615 1.8 1.23 1.25 2.04  IPI # IPI00014587 IPI00328113 IPI00005564 IPI00008603 IPI00215743 IPI00168813 IPI00418471 IPI00296141 IPI00021794 IPI00002802 IPI00002802 IPI00003351 IPI00418471 IPI00453116 IPI00008603 IPI00479217 IPI00418471 IPI00027166 IPI00418471 IPI00297646 IPI00329688 IPI00184375 IPI00218803 IPI00029744 IPI00017567 IPI00166039 IPI00418471 IPI00018352 IPI00258804 IPI00749245 IPI00418471 IPI00029236 IPI00100980 IPI00143921 IPI00008603  179  N-termini Neo Natural Neo Neo Neo Neo Neo Neo Neo Natural Neo Neo Neo Neo Neo Neo Natural Neo Natural Natural Natural Natural Natural Natural Neo Neo Natural Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Natural Neo Neo Neo Neo Neo  Prob 1.00 0.92 0.90 0.95 0.85 0.99 0.93 0.87 0.99 0.92 0.96 0.98 1.00 0.93 0.98 1.00 0.98 1.00 0.91 0.92 1.00 0.99 0.93 0.97 0.94 1.00 1.00 1.00 0.97 0.86 0.99 1.00 0.97 0.96 1.00 0.88 0.98 1.00 0.98 0.97 0.87 0.88 0.99 0.83  z 3 4 2 3 2 2 2 2 3 3 2 2 3 2 3 3 2 3 2 2 3 10 3 2 2 4 3 3 2 2 3 3 3 3 3 2 2 3 2 2 2 2 3 2  Precursor Mass 1858.9819 1968.1049 1361.692 1516.8771 1048.4855 1457.6893 1168.6727 1059.5592 1779.9437 2239.1072 1175.6494 1373.6334 1876.9835 1179.6152 1971.08 2200.0627 1611.8666 1654.8555 1365.7104 1177.5681 2241.1758 1430.7768 1618.8616 1613.7546 1252.6479 2290.1525 1782.825 1711.7646 1468.7003 858.3944 1962.9338 1875.9457 1866.9589 1624.8518 1619.8502 1026.5232 1581.8367 1522.7745 1219.59 1252.5825 1137.5339 1146.5478 1615.8035 1221.5477  Error [Da] -0.0208 -0.01 -0.0137 0.0132 -0.0416 -0.0704 -0.0323 -0.0276 -0.029 -0.0385 -0.0323 -0.0943 -0.0402 -0.0105 -0.0377 -0.014 0.0061 -0.0392 -0.0092 -0.0168 -0.0119 -0.0058 -0.0571 -0.005 -0.0528 -0.0204 -0.0144 -0.0001 -0.0099 -0.0737 -0.0067 -0.047 -0.0458 0.0218 -0.0251 -0.0345 -0.012 -0.0482 -0.0015 -0.0345 -0.0561 -0.0637 -0.0292 -0.0271  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]GLGLSYLSSHIANVER n[145.11]GPAK[272.20]SPYQLVLQHSR n[145.11]GPNPFTTLTDR n[145.11]GPVLGLK[272.20]EC[160.03]TR n[145.11]GTNESLER n[145.11]GVQVETISPGDGR n[145.11]IGGIGTVPVGR n[145.11]IISAPEMR n[145.11]LADAINTEFK[272.20]NTR n[145.11]LGRPSEEDEELVVPELER n[145.11]LGSATALMIR n[145.11]LGSDAELQIER n[145.11]LSGAPQASAADVVVVHGR n[145.11]LTFEELER n[145.11]LVASNLNLK[272.20]PGEC[160.03]LR n[145.11]LYSSSDDVIELTPSNFNR n[145.11]MPPYTVVYFPVR n[145.11]MQNPQILAALQER n[145.11]MVNFTVDQIR n[145.11]PDYLGADQR n[145.11]PGGLLLGDVAPNFEANTTVGR n[145.11]PMFIVNTNVPR n[145.11]PNFSGNWK[272.20]IIR n[145.11]PQYQTWEEFSR n[145.11]SAADVVVVHGR n[145.11]SAVHHPPSYVAHLASDFGVR n[145.11]SDVLELTDDNFESR n[145.11]SGGC[160.03]FWDNGHLYR n[145.11]SGGTTMYPGIADR n[145.11]SGLPGER n[145.11]SGTLGHPGSLDETTYER n[145.11]SIAAHLDNQVPVESPR n[145.11]SLADAINTEFK[272.20]NTR n[145.11]SLEDENK[272.20]EAFR n[145.11]SLLSLGSQYQPQR n[145.11]SLPEAGPGR n[145.11]SPAGGPLEDVVIER n[145.11]SPALTIENEHIR n[145.11]SQDASDGLQR n[145.11]SSGSGPFTDVR n[145.11]SSPGGVYATR n[145.11]STAAQQELR n[145.11]STVIHYEIPEER n[145.11]SYSPEPDQR  iTRAQ 114/ iTRAQ 115 1.22 1.6 1.1 1.62 1.4 1.42 2.52 1.58 1.32 1.45 1.7 1.97 0.05 1.58 1.67 1.5 1.7 0.53 1.96 2.38 1.74 1.37 1.42 1.33 0.09 1.73 1.25 1.21 1.45 1.83 1.89 1.02 1.31 2.1 2.26 1.63 1.91 1.51 1.44 1.08 1.87 1.31 1.2 1.67  IPI # IPI00026314 IPI00018219 IPI00019901 IPI00012503 IPI00025363 IPI00413778 IPI00014424 IPI00029236 IPI00418471 IPI00005908 IPI00006970 IPI00182126 IPI00011522 IPI00180404 IPI00219219 IPI00299571 IPI00219757 IPI00023860 IPI00186290 IPI00021435 IPI00220301 IPI00293276 IPI00216088 IPI00216125 IPI00011522 IPI00007118 IPI00025252 IPI00298388 IPI00008603 IPI00304962 IPI00217745 IPI00018120 IPI00418471 IPI00010800 IPI00002802 IPI00017968 IPI00303300 IPI00012989 IPI00009276 IPI00022418 IPI00418471 IPI00019502 IPI00001872 IPI00298237  180  N-termini Natural Neo Natural Neo Neo Neo Neo Neo Natural Natural Natural Natural Neo Neo Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural  Prob 0.99 0.92 0.82 0.98 1.00 0.88 0.95 0.98 0.95 0.85 0.94 0.99 0.96 0.98 0.94 1.00 0.97 0.98 0.92 0.95 0.99 0.87 1.00 0.98 0.99 1.00 0.91 0.99 0.98 0.88 0.99 0.89 0.95 0.96 0.97 0.91 0.97 0.98 0.98 0.93 0.84 0.97 0.97 0.89  z 3 2 2 3 3 2 2 2 2 2 2 3 3 2 3 3 3 2 2 3 3 2 3 3 3 3 2 3 2 2 2 2 2 2 2 4 2 3 2 2 2 2 2 2  Precursor Mass 1612.7872 1796.8541 1017.5271 1718.9706 1671.9564 1258.6309 1023.5647 1619.8545 1307.6928 949.4195 1234.6738 2089.1775 1457.8742 1316.6614 1828.9376 1584.8009 1737.9 1328.6865 1199.6644 1797.0327 2157.0122 1356.7316 1750.8356 1764.8383 1798.9884 1845.8797 1459.6464 2056.0095 1253.602 1259.6605 1342.7114 1200.5838 1352.6193 1587.6718 1270.6496 2437.2985 1755.8442 1832.0258 1445.721 1389.7258 1089.5659 1571.8774 1198.6695 1499.7362  Error [Da] 0.0305 0.009 -0.0316 0.0299 -0.0203 -0.0328 -0.03 0.0238 -0.0279 -0.0212 -0.0053 0.0808 -0.0067 -0.0233 -0.0105 -0.0328 0.0006 -0.0672 -0.0351 -0.039 -0.1034 -0.0167 0.0225 -0.006 -0.0026 -0.028 -0.0383 0.0137 -0.0353 -0.0242 -0.0573 -0.0171 -0.0435 -0.0715 -0.0619 -0.0258 0.0335 0.0011 -0.0022 -0.0327 -0.0427 -0.0231 -0.0461 -0.038  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[145.11]THEAEQNDSVSPR n[145.11]TTFNIQDGPDFQDR n[145.11]VAGMLMPR n[145.11]VDALK[272.20]GTNESLER n[145.11]VDVSK[272.20]PDLTAALR n[145.11]VELQELNDR n[145.11]VGPAGAVGPR n[145.11]VGSLNLEELSEMR n[145.11]VLAELYVSDR n[145.11]VNDGDMR n[145.11]VNFTVDQIR n[145.11]VNPTVFFDIAVDGEPLGR n[145.11]VSK[272.20]PDLTAALR n[145.11]VSVPWDDSLR n[43.02]AAGFK[272.20]TVEPLEYYR n[43.02]AATASAGAGGIDGK[272.20]PR n[43.02]AATFFGEVVK[272.20]APC[160.03]R n[43.02]AATTGSGVK[272.20]VPR n[43.02]AAVDLEK[272.20]LR n[43.02]AAVK[272.20]TLNPK[272.20]AEVAR n[43.02]AC[160.03]GLVASNLNLK[272.20]PGEC[160.03]LR n[43.02]ADEIAK[272.20]AQVAR n[43.02]ADK[272.20]EAAFDDAVEER n[43.02]ADLAEC[160.03]NIK[272.20]VMC[160.03]R n[43.02]ADLDK[272.20]LNIDSIIQR n[43.02]ADLEEQLSDEEK[272.20]VR n[43.02]ADQGEK[272.20]ENPMR n[43.02]AEDWLDC[160.03]PALGPGWK[272.20]R n[43.02]AESSDK[272.20]LYR n[43.02]AEVEETLK[272.20]R n[43.02]AGLNSLEAVK[272.20]R n[43.02]AK[272.20]WGEGDPR n[43.02]ANK[272.20]GPSYGMSR n[43.02]AQDQGEK[272.20]ENPMR n[43.02]AQNLK[272.20]DLAGR n[43.02]ASGVAVSDGVIK[272.20]VFNDMK[272.20]VR n[43.02]ASK[272.20]EMFEDTVEER n[43.02]ASSDIQVK[272.20]ELEK[272.20]R n[43.02]ASSGAGDPLDSK[272.20]R n[43.02]ATDELATK[272.20]LSR n[43.02]ATGQK[272.20]LMR n[43.02]ATVTATTK[272.20]VPEIR n[43.02]AVSTGVK[272.20]VPR n[43.02]AVTLDK[272.20]DAYYR  iTRAQ 114/ iTRAQ 115 1.78 1.24 0.78 2.22 1.54 1.61 1.72 2.11 1.4 1.89 1.99 1 1.78 1.66 2.3 20.33 2.02 1.48 4.18 1.94 4.46 1.43 1.87 4.29 5.1 2.31 7.97 6 4.22 4.8 1.498 1.62 1.67 9.95 9.73 3.97 2.01 1.84 7.96 2.12 1.69 1.73 1.6 1.17  IPI # IPI00005564 IPI00017799 IPI00014898 IPI00418471 IPI00418471 IPI00418471 IPI00304962 IPI00186581 IPI00306960 IPI00023673 IPI00186290 IPI00419585 IPI00418471 IPI00010800 IPI00552920 IPI00219729 IPI00030770 IPI00472498 IPI00332371 IPI00027626 IPI00219219 IPI00239077 IPI00328319 IPI00012837 IPI00005705 IPI00026182 IPI00746438 IPI00438701 IPI00449049 IPI00063849 IPI00010779 IPI00030706 IPI00216138 IPI00376798 IPI00027252 IPI00012011 IPI00395865 IPI00479997 IPI00022277 IPI00060181 IPI00000792 IPI00009104 IPI00019600 IPI00026970  181  N-termini Natural Neo Natural Neo Natural Natural Natural Natural Natural Natural Neo Natural  Prob 0.95 0.87 0.91 0.83 0.98 0.88 0.97 0.99 1.00 0.96 0.94 1.00  z 3 2 2 2 2 2 2 2 3 2 2 4  Precursor Mass 2938.3593 1411.8107 1630.8363 1178.5362 1553.7341 1099.6587 1134.5299 1678.8101 1633.7825 1429.5753 1569.8349 1993.0509  Error [Da] 0.0396 0.013 -0.0354 -0.0295 -0.0077 -0.0248 -0.0818 -0.0186 -0.068 -0.0447 -0.0499 -0.0358  N-term Modification Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[43.02]DDDIAALVVDNGSGMC[160.03]K[272.20]AGFAGDDAPR n[43.02]MEK[272.20]PSPLLVGR n[43.02]MEK[272.20]TLETVPLER n[43.02]MNK[272.20]DAQMR n[43.02]MQPASAK[272.20]WYDR n[43.02]SGGLLK[272.20]ALR n[43.02]SK[272.20]NTVSSAR n[43.02]SQAEFEK[272.20]AAEEVR n[43.02]SSK[272.20]TASTNNIAQAR n[43.02]SSNEC[160.03]FK[272.20]C[160.03]GR n[43.02]VDVSK[272.20]PDLTAALR n[43.02]VEEVQK[272.20]HSVHTLVFR  iTRAQ 114/ iTRAQ 115 1.36 1.69 1.71 2.05 1.28 0.63 1.46 1.6 1.44 1.33 1.61 17.4  IPI # IPI00021439 IPI00009057 IPI00396378 IPI00024620 IPI00015029 IPI00183500 IPI00007280 IPI00010182 IPI00221232 IPI00430813 IPI00418471 IPI00002624  182  Appendix B.4 Peptides identified by iTRAQ-TAILS in membrane fractions of HFL1xHFL2. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 116) or sMT6EΔA (iTRAQ 117) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. N-termini Neo Neo Neo Neo Neo Neo Neo Natural Natural Natural Neo Natural Natural Neo Natural Neo Neo Neo Neo Natural Natural Neo Neo Neo Natural Neo Neo Neo Neo Natural Natural Natural Natural Natural Neo  Prob 0.92 0.95 1.00 1.00 0.96 0.99 0.99 0.99 1.00 1.00 0.99 1.00 1.00 1.00 1.00 0.99 0.99 0.99 0.99 0.96 0.99 0.99 0.97 1.00 0.93 0.99 0.98 1.00 1.00 1.00 0.99 1.00 1.00 1.00 1.00  z 2 2 3 3 2 2 2 2 3 10 3 3 3 4 3 3 3 3 10 3 2 2 3 3 2 2 2 3 3 3 3 3 10 10 3  Precursor Mass 1254.7463 1254.7554 1666.9365 1774.9752 1303.5889 1319.5981 1119.5694 1324.6681 1855.9678 1916.8873 1595.8747 1664.876 2265.1239 2885.4594 1503.8209 1589.842 1612.9537 1665.9093 2555.1197 1402.7717 1507.7948 1497.7012 1677.7825 2368.0797 968.5062 1457.6893 1313.7609 1877.0269 1610.9477 1440.8557 1513.701 1983.0511 1730.8784 1782.825 1962.9902  Error [Da] -0.0179 0.0137 0.0488 0.0335 -0.0423 0.0274 0.0263 0.0184 -0.0359 -0.0324 0.024 0.0269 0.0392 -0.081 0.0292 0.0163 0.0033 0.0166 0.0734 0.043 0.0097 -0.0325 -0.023 -0.015 -0.0099 -0.0704 0.0296 0.0028 0.013 0.019 -0.0597 0.0325 0.0157 -0.0144 0.0495  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]AAINQILGRR n[145.11]AATLILEPAGR n[145.11]ADAINTEFK[272.20]NTR n[145.11]ADANLEAGNVK[272.20]ETR n[145.11]ADC[160.03]ISEPVNR n[145.11]AEGPDEDSSNR n[145.11]AGFAGDDAPR n[145.11]ASEGGFTATGQR n[145.11]ASGANFEYIIAEK[272.20]R n[145.11]ASGGGVPTDEEQATGLER n[145.11]DAINTEFK[272.20]NTR n[145.11]DAPEEEDHVLVLR n[145.11]DDEVDVDGTVEEDLGK[272.20]SR n[145.11]DDLEALK[272.20]K[272.20]K[272.20]GC[160.03]PPDDIENPR n[145.11]DGVGGDPAVALPHR n[145.11]DNADSSPVVDK[272.20]R n[145.11]DNIQGITK[272.20]PAIR n[145.11]DSK[272.20]VFGDLDQVR n[145.11]DVK[272.20]C[160.03]DMEVSC[160.03]PDGYTC[160.03]C[160.03]R n[145.11]ESAGADTRPTVR n[145.11]ESETTTSLVLER n[145.11]FQSDIGPYQSGR n[145.11]GAFEGTHMGPFVER n[145.11]GDVC[160.03]QDC[160.03]IQMVTDIQTAVR n[145.11]GGVGEPGPR n[145.11]GVQVETISPGDGR n[145.11]LEPTVIDEVR n[145.11]LSGAPQASAADVVVVHGR n[145.11]LTEAPLNPK[272.20]ANR n[145.11]MAPEVLPK[272.20]PR n[145.11]PGPTPSGTNVGSSGR n[145.11]QK[272.20]TGTAEMSSILEER n[145.11]SDMPPLTLEGIQDR n[145.11]SDVLELTDDNFESR n[145.11]SGTLGHPGSLDETTYER  iTRAQ 116/ iTRAQ 117 0.43 0.38 0.48 0.22 0.4 0.43 0.326 0.44 0.3 0.33 0.63 0.419 0.35 0.25 0.34 0.48 0.6 0.34 0.33 0.38 0.34 0.33 0.61 0.55 0.36 0.51 0.38 0.39 0.39 0.47 0.31 0.27 0.33 0.39 0.33  IPI # IPI00003325 IPI00220906 IPI00418471 IPI00328113 IPI00017895 IPI00009904 IPI00008603 IPI00003351 IPI00024993 IPI00021785 IPI00418471 IPI00010796 IPI00027230 IPI00217561 IPI00026530 IPI00328753 IPI00453473 IPI00184375 IPI00181753 IPI00025796 IPI00029744 IPI00749245 IPI00100980 IPI00012503 IPI00028040 IPI00413778 IPI00166768 IPI00011522 IPI00008603 IPI00015972 IPI00220835 IPI00440493 IPI00022442 IPI00025252 IPI00217745  183  N-termini Natural Neo Neo Neo Neo Natural Natural Neo Neo Neo Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural  Prob 1.00 0.94 0.97 1.00 0.99 0.98 1.00 0.99 0.95 1.00 1.00 1.00 1.00 0.98 0.88 0.99 0.96 0.96 0.98 0.99 0.93 0.98 0.99 0.92 0.95 0.99 0.99 0.99 0.96 0.96  z 3 3 3 3 2 2 3 3 3 3 3 2 10 2 2 2 3 2 3 2 2 2 2 2 3 3 2 3 2 2  Precursor Mass 1750.8092 1512.7866 1866.9589 1764.8862 1581.8851 1219.59 1842.0493 1615.8035 1497.8579 1439.7878 1584.8604 1328.764 1750.8356 1253.6487 1259.6605 1342.7114 1473.854 1587.6718 1832.0258 1445.7413 1389.7258 1630.8967 1198.7444 1499.8024 2938.3902 1847.9435 1672.9123 1748.9533 1429.5753 1364.7313  Error [Da] 0.0575 0.0299 -0.0458 0.0462 0.0367 -0.0015 0.0403 -0.0292 0.0072 0.0261 0.0262 0.0106 0.0225 0.0114 -0.0242 -0.0573 0.0146 -0.0715 0.0011 0.0181 -0.0327 0.017 0.0288 0.0282 0.0705 -0.0432 0.0183 -0.0009 -0.0447 0.0255  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[145.11]SHGSQETDEEFDAR n[145.11]SK[272.20]DNEGSWFR n[145.11]SLADAINTEFK[272.20]NTR n[145.11]SLEDALSSDTSGHFR n[145.11]SPAGGPLEDVVIER n[145.11]SQDASDGLQR n[145.11]SSEAPPLINEDVK[272.20]R n[145.11]STVIHYEIPEER n[145.11]TEAPLNPK[272.20]ANR n[145.11]YVGDEAQSK[272.20]R n[43.02]AATASAGAGGIDGK[272.20]PR n[43.02]AATTGSGVK[272.20]VPR n[43.02]ADK[272.20]EAAFDDAVEER n[43.02]AESSDK[272.20]LYR n[43.02]AEVEETLK[272.20]R n[43.02]AGLNSLEAVK[272.20]R n[43.02]AK[272.20]PLTDSEK[272.20]R n[43.02]AQDQGEK[272.20]ENPMR n[43.02]ASSDIQVK[272.20]ELEK[272.20]R n[43.02]ASSGAGDPLDSK[272.20]R n[43.02]ATDELATK[272.20]LSR n[43.02]AVPPTYADLGK[272.20]SAR n[43.02]AVSTGVK[272.20]VPR n[43.02]AVTLDK[272.20]DAYYR n[43.02]DDDIAALVVDNGSGMC[160.03]K[272.20]AGFAGDDAPR n[43.02]GDAPSPEEK[272.20]LHLITR n[43.02]MDGIVPDIAVGTK[272.20]R n[43.02]SGELPPNINIK[272.20]EPR n[43.02]SSNEC[160.03]FK[272.20]C[160.03]GR n[43.02]TGYTPDEK[272.20]LR  iTRAQ 116/ iTRAQ 117 0.53 0.39 0.22 0.71 0.35 0.4 0.485 0.25 0.62 0.35 0.33 0.32 0.3 0.37 0.4 0.304 0.85 0.34 0.67 0.35 0.5 0.33 0.42 0.41 0.37 0.39 0.58 0.46 0.42 0.28  IPI # IPI00025086 IPI00304435 IPI00418471 IPI00002459 IPI00303300 IPI00009276 IPI00025874 IPI00001872 IPI00008603 IPI00003269 IPI00219729 IPI00472498 IPI00328319 IPI00449049 IPI00063849 IPI00010779 IPI00004358 IPI00376798 IPI00479997 IPI00022277 IPI00060181 IPI00216308 IPI00019600 IPI00026970 IPI00021439 IPI00007074 IPI00179964 IPI00009368 IPI00430813 IPI00219385  184  Appendix B.5 Peptides identified by iTRAQ-TAILS in membrane fractions of HFL1. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 116) or sMT6EΔA (iTRAQ 117) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. N-termini Neo Neo Neo Neo Neo Neo Neo Neo Natural Neo Natural Natural Natural Neo Natural Natural Neo Natural Neo Neo Neo Neo Neo Neo Natural Natural Neo Neo Neo Natural Neo Neo Neo Neo Neo  Prob 0.92 0.98 0.95 0.97 1.00 0.92 0.99 0.99 1.00 0.95 1.00 1.00 0.99 0.94 1.00 0.98 0.94 1.00 0.99 0.99 0.99 0.99 0.82 0.95 0.96 0.99 0.98 1.00 0.98 0.84 0.84 0.98 1.00 0.84 0.98  z 2 2 2 3 3 2 2 2 3 3 3 3 2 3 3 3 4 3 3 3 3 4 3 2 3 2 2 3 2 2 2 2 3 3 2  Precursor Mass 1254.7463 1702.9756 1254.7554 1666.9057 1774.9752 1303.6443 1319.5981 1119.5694 2441.306 1480.8527 1969.0752 1856.0295 1916.954 1595.8718 1664.876 2264.7461 2885.5283 1503.8209 1589.842 1612.9537 1665.9093 2555.1197 1897.0006 1248.5643 1402.7717 1507.7948 1497.7559 2368.148 1048.5111 968.5332 1229.6903 1457.7791 2259.0867 2206.2136 1313.7609  Error [Da] -0.0179 0.0268 0.0137 0.0175 0.0335 0.0131 0.0274 0.0263 -0.0067 0.0286 -0.0124 0.0258 0.0342 0.0207 0.0269 -0.3386 -0.0121 0.0292 0.0163 0.0033 0.0166 0.0734 0.0181 0.0306 0.043 0.0097 0.0222 0.0533 0.0052 0.0171 0.0053 0.0194 0.03 0.0299 0.0296  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]AAINQILGRR n[145.11]AAPELPVPTGGPAVGAR n[145.11]AATLILEPAGR n[145.11]ADAINTEFK[272.20]NTR n[145.11]ADANLEAGNVK[272.20]ETR n[145.11]ADC[160.03]ISEPVNR n[145.11]AEGPDEDSSNR n[145.11]AGFAGDDAPR n[145.11]AIAAK[272.20]EK[272.20]DIQEESTFSSR n[145.11]AINTEFK[272.20]NTR n[145.11]APSVPAAEPEYPK[272.20]GIR n[145.11]ASGANFEYIIAEK[272.20]R n[145.11]ASGGGVPTDEEQATGLER n[145.11]DAINTEFK[272.20]NTR n[145.11]DAPEEEDHVLVLR n[145.11]DDEVDVDGTVEEDLGK[272.20]SR n[145.11]DDLEALK[272.20]K[272.20]K[272.20]GC[160.03]PPDDIENPR n[145.11]DGVGGDPAVALPHR n[145.11]DNADSSPVVDK[272.20]R n[145.11]DNIQGITK[272.20]PAIR n[145.11]DSK[272.20]VFGDLDQVR n[145.11]DVK[272.20]C[160.03]DMEVSC[160.03]PDGYTC[160.03]C[160.03]R n[145.11]EEGK[272.20]EVWDYVTVR n[145.11]EGPDEDSSNR n[145.11]ESAGADTRPTVR n[145.11]ESETTTSLVLER n[145.11]FQSDIGPYQSGR n[145.11]GDVC[160.03]QDC[160.03]IQMVTDIQTAVR n[145.11]GFAGDDAPR n[145.11]GGVGEPGPR n[145.11]GQVITIGNER n[145.11]GVQVETISPGDGR n[145.11]K[272.20]ESSETPDQFMTADETR n[145.11]K[272.20]SYELPDGQVITIGNER n[145.11]LEPTVIDEVR  iTRAQ 116/ iTRAQ 117 0.43 0.45 0.38 0.77 0.3 0.47 0.56 0.45 0.58 0.71 0.53 0.5 0.36 0.77 0.53 0.56 0.62 0.43 0.63 0.81 0.53 0.4 0.39 0.46 0.4 0.51 1.05 0.5 0.49 0.31 0.91 0.58 0.73 0.61 0.58  IPI # IPI00003325 IPI00007812 IPI00220906 IPI00418471 IPI00328113 IPI00017895 IPI00009904 IPI00008603 IPI00783271 IPI00418471 IPI00172460 IPI00024993 IPI00021785 IPI00418471 IPI00010796 IPI00027230 IPI00217561 IPI00026530 IPI00328753 IPI00453473 IPI00184375 IPI00181753 IPI00012426 IPI00009904 IPI00025796 IPI00029744 IPI00749245 IPI00012503 IPI00008603 IPI00028040 IPI00003269 IPI00413778 IPI00297160 IPI00008603 IPI00166768  185  N-termini Neo Neo Neo Natural Natural Natural Neo Natural Natural Natural Neo Natural Neo Neo Neo Neo Natural Natural Neo Neo Natural Neo Neo Neo Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural  Prob 0.98 1.00 1.00 1.00 0.98 1.00 0.87 0.99 0.99 1.00 1.00 1.00 0.93 0.92 1.00 0.99 0.90 1.00 0.94 0.83 0.95 0.97 0.80 0.98 0.93 0.85 1.00 1.00 0.99 0.98 0.82 0.96 0.98 0.96 0.96 0.98 0.99 0.90 0.98 0.99 0.92 0.95 0.97 0.99  z 3 3 3 3 3 3 3 3 2 10 3 3 3 3 3 2 2 3 3 3 3 3 3 2 2 2 3 2 2 2 2 2 3 3 2 3 2 2 2 2 2 3 3 2  Precursor Mass 1605.8575 1877.0269 1610.9477 1440.8401 1513.7891 1898.0651 1531.8587 1983.0578 1730.8856 1782.8676 1962.9902 1750.8092 1512.7817 1867.0549 1764.8862 1581.8851 1219.6125 1842.0493 1615.8425 1497.852 2791.3542 1477.8252 1439.7924 1352.6924 1212.6752 1230.672 1584.8604 1328.764 1750.8487 1253.6487 1259.7059 1342.7743 1514.8633 1473.854 1587.768 1832.0664 1445.7413 1389.7669 1630.8967 1198.7444 1499.8024 2938.3902 1848.0238 1672.9123  Error [Da] 0.0378 0.0028 0.013 0.0035 0.0284 0.0144 0.014 0.0391 0.0229 0.0279 0.0495 0.0575 0.025 0.0506 0.0462 0.0367 0.021 0.0403 0.0098 0.0013 0.0525 0.016 0.0307 0.0227 0.0168 0.0241 0.0262 0.0106 0.0356 0.0114 0.0216 0.0053 -0.0027 0.0146 0.0247 0.0417 0.0181 0.0084 0.017 0.0288 0.0282 0.0705 0.0371 0.0183  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[145.11]LNTPSDK[272.20]SEDGR n[145.11]LSGAPQASAADVVVVHGR n[145.11]LTEAPLNPK[272.20]ANR n[145.11]MAPEVLPK[272.20]PR n[145.11]PGPTPSGTNVGSSGR n[145.11]PSVPAAEPEYPK[272.20]GIR n[145.11]QK[272.20]LIEVDDER n[145.11]QK[272.20]TGTAEMSSILEER n[145.11]SDMPPLTLEGIQDR n[145.11]SDVLELTDDNFESR n[145.11]SGTLGHPGSLDETTYER n[145.11]SHGSQETDEEFDAR n[145.11]SK[272.20]DNEGSWFR n[145.11]SLADAINTEFK[272.20]NTR n[145.11]SLEDALSSDTSGHFR n[145.11]SPAGGPLEDVVIER n[145.11]SQDASDGLQR n[145.11]SSEAPPLINEDVK[272.20]R n[145.11]STVIHYEIPEER n[145.11]TEAPLNPK[272.20]ANR n[145.11]TGSSAQEEASGVALGEAPDHSYESLR n[145.11]VSSAAQTEK[272.20]GGR n[145.11]YVGDEAQSK[272.20]R n[145.11]YVLDDSDGLGR n[43.02]AAEADGPLK[272.20]R n[43.02]AAPSDGFK[272.20]PR n[43.02]AATASAGAGGIDGK[272.20]PR n[43.02]AATTGSGVK[272.20]VPR n[43.02]ADK[272.20]EAAFDDAVEER n[43.02]AESSDK[272.20]LYR n[43.02]AEVEETLK[272.20]R n[43.02]AGLNSLEAVK[272.20]R n[43.02]AK[272.20]PLTDQEK[272.20]R n[43.02]AK[272.20]PLTDSEK[272.20]R n[43.02]AQDQGEK[272.20]ENPMR n[43.02]ASSDIQVK[272.20]ELEK[272.20]R n[43.02]ASSGAGDPLDSK[272.20]R n[43.02]ATDELATK[272.20]LSR n[43.02]AVPPTYADLGK[272.20]SAR n[43.02]AVSTGVK[272.20]VPR n[43.02]AVTLDK[272.20]DAYYR n[43.02]DDDIAALVVDNGSGMC[160.03]K[272.20]AGFAGDDAPR n[43.02]GDAPSPEEK[272.20]LHLITR n[43.02]MDGIVPDIAVGTK[272.20]R  iTRAQ 116/ iTRAQ 117 0.51 0.55 0.53 0.56 0.36 0.75 0.53 0.52 0.42 0.54 0.4 0.62 0.55 0.4 0.5 0.51 0.7 0.587 0.4 0.73 0.44 0.43 0.47 0.29 0.49 0.24 0.44 0.43 0.56 0.78 0.6 0.67 0.95 0.85 0.48 0.93 0.46 0.85 0.54 0.59 0.78 0.54 0.63 0.71  IPI # IPI00106966 IPI00011522 IPI00008603 IPI00015972 IPI00220835 IPI00172460 IPI00021840 IPI00440493 IPI00022442 IPI00025252 IPI00217745 IPI00025086 IPI00304435 IPI00418471 IPI00002459 IPI00303300 IPI00009276 IPI00025874 IPI00001872 IPI00008603 IPI00011416 IPI00024317 IPI00003269 IPI00008790 IPI00025292 IPI00025347 IPI00219729 IPI00472498 IPI00328319 IPI00449049 IPI00063849 IPI00010779 IPI00783313 IPI00004358 IPI00376798 IPI00479997 IPI00022277 IPI00060181 IPI00216308 IPI00019600 IPI00026970 IPI00021439 IPI00007074 IPI00179964  186  N-termini Natural Natural Natural Natural Neo Natural  Prob 0.81 0.99 0.89 0.93 0.92 0.96  z 3 3 3 2 3 2  Precursor Mass 1917.9868 1748.9533 1844.0383 1429.637 1997.0712 1364.7313  Error [Da] 0.0159 -0.0009 0.05 0.017 0.1001 0.0255  N-term Modification Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[43.02]MEEEGVK[272.20]EAGEK[272.20]PR n[43.02]SGELPPNINIK[272.20]EPR n[43.02]SK[272.20]SESPK[272.20]EPEQLR n[43.02]SSNEC[160.03]FK[272.20]C[160.03]GR n[43.02]TDLEK[272.20]DIISDTSGDFR n[43.02]TGYTPDEK[272.20]LR  iTRAQ 116/ iTRAQ 117 0.48 0.46 0.89 0.61 1.78 0.35  IPI # IPI00332493 IPI00009368 IPI00215965 IPI00430813 IPI00334627 IPI00219385  187  Appendix B.6 Peptides identified by iTRAQ-TAILS in membrane fractions of HFL2. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 116) or sMT6EΔA (iTRAQ 117) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. N-termini Neo Neo Natural Neo Neo Neo Neo Neo Natural Natural Neo Natural Neo Neo Neo Neo Natural Neo Natural Natural Natural Natural Natural Natural Neo Natural Natural Natural Natural Natural Neo Neo Neo Neo Neo  Prob 0.95 0.98 0.95 1.00 1.00 1.00 0.96 0.98 0.87 0.93 0.99 1.00 0.92 0.99 0.92 0.88 1.00 0.85 1.00 0.88 0.91 0.92 0.99 0.98 0.91 0.85 0.99 1.00 1.00 0.93 0.98 0.90 0.88 1.00 0.92  z 2 3 2 3 3 3 2 2 2 2 2 3 2 3 4 3 3 2 3 2 2 3 4 3 2 2 2 3 3 4 2 2 2 4 2  Precursor Mass 1002.5231 1695.7414 1200.5745 1758.0072 1666.9365 1774.9705 1303.5889 1319.5845 1232.6904 1341.7489 1119.5366 2126.0824 1345.6698 2145.2496 2267.3767 1504.8559 1519.766 1224.7374 1700.8666 1159.5558 1214.4876 1790.017 2393.2701 1694.918 1114.5828 1100.6072 1324.6148 1855.9678 1916.8873 2022.0411 1208.5182 1568.8132 1088.6304 2438.3102 1081.6116  Error [Da] -0.0349 -0.0243 -0.0112 0.0445 0.0488 0.0288 -0.0423 0.0138 -0.0095 -0.0249 -0.0064 -0.0458 -0.0259 0.0349 0.0003 0.0106 -0.0092 -0.0302 -0.0121 -0.0186 -0.1141 -0.0011 0.0227 -0.0046 -0.0025 0.0012 -0.0349 -0.0359 -0.0324 0.0352 -0.1089 0.0175 -0.016 -0.0093 -0.0251  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]AAISQVDR n[145.11]AAMADTFLEHMC[160.03]R n[145.11]AANYSSTSTR n[145.11]AAQTSPSPK[272.20]AGAATGR n[145.11]ADAINTEFK[272.20]NTR n[145.11]ADANLEAGNVK[272.20]ETR n[145.11]ADC[160.03]ISEPVNR n[145.11]AEGPDEDSSNR n[145.11]AELPPVPGGPR n[145.11]AEVQVLVLDGR n[145.11]AGFAGDDAPR n[145.11]AGPPPIQDGEFTFLLPAGR n[145.11]AILEDEQTQR n[145.11]AIVFIK[272.20]QPSSQDALQGR n[145.11]ALAPSTMK[272.20]IK[272.20]IIAPPER n[145.11]ALK[272.20]GTNESLER n[145.11]ALSAETESHIYR n[145.11]ALTQPLGLLR n[145.11]APAMQPAEIQFAQR n[145.11]APDPGFQER n[145.11]APDQDEIQR n[145.11]APLDLDK[272.20]YVEIAR n[145.11]APPAAGQQQPPREPPAAPGAWR n[145.11]APVEHVVADAGAFLR n[145.11]AQPPSSAASR n[145.11]AQTAAATAPR n[145.11]ASEGGFTATGQR n[145.11]ASGANFEYIIAEK[272.20]R n[145.11]ASGGGVPTDEEQATGLER n[145.11]ASHMTK[272.20]DMFPGPYPR n[145.11]ASSPGGVYATR n[145.11]ATLDVYNPFETR n[145.11]AVFPSIVGR n[145.11]AVPIAQK[272.20]SEPHSLSSEALMR n[145.11]AVTVAPPGAR  iTRAQ 116/ iTRAQ 117 0.38 0.27 0.26 0.29 0.13 0.11 0.27 0.19 0.28 0.48 0.243 0.27 0.39 0.19 0.18 0.2 0.21 0.3 0.33 0.26 0.317 0.1 0.28 0.26 0.32 0.25 0.44 0.15 0.26 0.17 0.163 0.31 0.23 0.26 0.2  IPI # IPI00014587 IPI00220644 IPI00301280 IPI00303476 IPI00418471 IPI00328113 IPI00017895 IPI00009904 IPI00290614 IPI00304612 IPI00008603 IPI00009976 IPI00215743 IPI00168813 IPI00008603 IPI00418471 IPI00013026 IPI00102685 IPI00032374 IPI00296141 IPI00021794 IPI00012970 IPI00002802 IPI00022373 IPI00442069 IPI00294911 IPI00003351 IPI00024993 IPI00021785 IPI00028883 IPI00418471 IPI00453116 IPI00008603 IPI00008418 IPI00479217  188  N-termini Neo Neo Natural Neo Natural Natural Neo Natural Neo Neo Neo Neo Neo Neo Neo Neo Neo Natural Natural Neo Neo Neo Neo Neo Natural Neo Neo Neo Natural Neo Neo Neo Natural Natural Neo Neo Neo Neo Neo Natural Neo Neo Natural Neo  Prob 0.85 0.97 0.91 0.99 1.00 1.00 1.00 1.00 0.98 0.91 0.99 0.93 0.96 0.99 1.00 0.98 1.00 0.92 0.98 0.99 0.90 0.88 0.98 0.95 0.86 0.99 0.99 0.97 0.95 0.97 1.00 0.86 0.93 0.96 0.85 1.00 0.91 0.90 0.95 1.00 0.90 0.97 0.87 0.85  z 2 3 4 3 3 3 4 3 2 4 3 3 3 3 3 2 3 3 2 3 3 3 2 2 2 2 3 3 2 2 3 2 2 3 2 3 2 2 3 3 3 2 2 2  Precursor Mass 1074.5668 2008.021 3277.8942 1595.8747 1664.8461 2265.1239 2885.4594 1503.6877 1625.8468 2445.2407 1589.8502 1612.9581 1665.8784 2539.0883 1658.776 1330.6426 2290.0943 1402.7165 1507.7247 1779.8578 1848.0212 2659.1705 1396.5923 1278.6862 1225.6445 1497.7012 2014.1094 1677.7825 1127.6458 1238.6849 2368.0797 1381.6747 968.5062 1671.9224 942.5436 1391.823 1317.672 1361.692 1516.8771 2171.0577 1428.81 1395.71 1332.6418 1048.4855  Error [Da] -0.0276 0.0071 0.0542 0.024 -0.003 0.0392 -0.081 -0.104 -0.0213 -0.0968 0.0245 0.0077 -0.0146 0.0366 0.0133 -0.0421 -0.0997 -0.0122 -0.06 -0.0118 0.0375 -0.1312 -0.0414 -0.0014 0.0228 -0.0325 0.0367 -0.023 0.0141 -0.0256 -0.015 -0.0035 -0.0099 0.0036 -0.0301 -0.0137 -0.0447 -0.0137 0.0132 0.05 0.0131 -0.0169 -0.0279 -0.0416  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]AWDLASLR n[145.11]C[160.03]EVDALK[272.20]GTNESLER n[145.11]DAAVSFAK[272.20]DFLAGGVAAAISK[272.20]TAVAPIER n[145.11]DAINTEFK[272.20]NTR n[145.11]DAPEEEDHVLVLR n[145.11]DDEVDVDGTVEEDLGK[272.20]SR n[145.11]DDLEALK[272.20]K[272.20]K[272.20]GC[160.03]PPDDIENPR n[145.11]DGVGGDPAVALPHR n[145.11]DIPPITC[160.03]VQNGLR n[145.11]DK[272.20]EK[272.20]NLLHVTDTGVGMTR n[145.11]DNADSSPVVDK[272.20]R n[145.11]DNIQGITK[272.20]PAIR n[145.11]DSK[272.20]VFGDLDQVR n[145.11]DVK[272.20]C[160.03]DMEVSC[160.03]PDGYTC[160.03]C[160.03]R n[145.11]DVLLEAC[160.03]C[160.03]ADGHR n[145.11]EAGLETESPVR n[145.11]ELGPLHQQESQSLQLHFR n[145.11]ESAGADTRPTVR n[145.11]ESETTTSLVLER n[145.11]ETVHC[160.03]DLQPVGPER n[145.11]EVDALK[272.20]GTNESLER n[145.11]FEK[272.20]NEAIQAAHDAVAQEGQC[160.03]R n[145.11]FGSDQSENVDR n[145.11]FNLDVMGALR n[145.11]FNPFVTSDR n[145.11]FQSDIGPYQSGR n[145.11]FSLADAINTEFK[272.20]NTR n[145.11]GAFEGTHMGPFVER n[145.11]GAGGALFVHR n[145.11]GAPEVLVSAPR n[145.11]GDVC[160.03]QDC[160.03]IQMVTDIQTAVR n[145.11]GGTTMYPGIADR n[145.11]GGVGEPGPR n[145.11]GK[272.20]DYYQTLGLAR n[145.11]GLAAAALGR n[145.11]GLHLGVTPSVIR n[145.11]GNPITIFQER n[145.11]GPNPFTTLTDR n[145.11]GPVLGLK[272.20]EC[160.03]TR n[145.11]GQNDLMGTAEDFADQFLR n[145.11]GQTFEYLK[272.20]R n[145.11]GSPPGISTSFFR n[145.11]GSTWGSPGWVR n[145.11]GTNESLER  iTRAQ 116/ iTRAQ 117 0.22 0.14 0.1 0.1 0.32 0.16 0.06 0.3 0.35 0.23 0.1 0.15 0.14 0.27 1.17 0.23 0.4 0.34 0.28 0.22 0.07 0.53 0.26 0.27 0.33 0.18 0.11 0.61 0.49 0.39 0.58 0.31 0.39 0.13 0.42 0.24 0.29 0.55 0.27 0.41 0.26 0.31 0.25 0.37  IPI # IPI00045800 IPI00418471 IPI00007188 IPI00418471 IPI00010796 IPI00027230 IPI00217561 IPI00026530 IPI00297646 IPI00027230 IPI00328753 IPI00453473 IPI00184375 IPI00181753 IPI00218803 IPI00009885 IPI00306604 IPI00025796 IPI00029744 IPI00017567 IPI00418471 IPI00018352 IPI00258804 IPI00014478 IPI00007144 IPI00749245 IPI00418471 IPI00100980 IPI00291328 IPI00143921 IPI00012503 IPI00008603 IPI00028040 IPI00015947 IPI00514494 IPI00298237 IPI00219018 IPI00019901 IPI00012503 IPI00005737 IPI00218337 IPI00414591 IPI00031000 IPI00025363  189  N-termini Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Natural Neo Neo Neo Neo Neo Neo Neo Natural Natural Natural Natural Natural Natural Natural Neo Neo Natural Natural Neo Natural Neo Natural Natural Natural  Prob 0.99 0.84 0.92 0.93 0.87 0.98 0.99 1.00 1.00 0.99 0.99 0.99 0.94 0.96 0.98 1.00 1.00 0.97 0.86 0.99 1.00 1.00 0.99 0.99 0.93 0.98 1.00 1.00 0.98 0.99 0.99 0.98 0.97 0.98 1.00 1.00 0.91 0.89 1.00 0.96 0.94 0.92 0.99 1.00  z 2 4 3 2 2 2 3 3 3 3 3 3 2 2 2 3 3 3 3 3 3 3 2 3 2 3 3 3 2 3 3 4 2 2 3 3 2 2 3 2 3 2 3 3  Precursor Mass 1457.6893 2491.1319 1519.8405 1168.6727 1059.5592 1108.5876 1651.9259 1741.0094 1391.7463 1622.9318 1291.7626 1779.9437 1313.7316 1175.6494 1373.6334 1334.8115 1404.8061 1554.8357 1240.6713 1937.9102 1876.9835 1546.8003 1501.7584 1610.9424 1179.6152 1971.08 2200.0627 1440.8557 1819.8795 1418.8052 1628.8264 2164.3709 1466.7887 1611.8666 1654.8555 1842.9214 1365.7104 1244.7278 1937.1405 1182.5975 1478.8247 1177.5681 1642.8821 2241.1758  Error [Da] -0.0704 -0.0991 0.0178 -0.0323 -0.0276 -0.0121 -0.003 -0.0243 0.0062 0.0083 0.0139 -0.029 0.0004 -0.0323 -0.0943 -0.0041 -0.0276 -0.0131 -0.0085 -0.0475 -0.0402 -0.0224 -0.0063 0.0076 -0.0105 -0.0377 -0.014 0.019 0.0108 -0.0475 -0.0323 0.167 0.033 0.0061 -0.0392 -0.0203 -0.0092 -0.0119 -0.0332 -0.0212 0.016 -0.0168 0.0021 -0.0119  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]GVQVETISPGDGR n[145.11]HAFEK[272.20]EWIEC[160.03]AHGIGYTR n[145.11]IERPTYTNLNR n[145.11]IGGIGTVPVGR n[145.11]IISAPEMR n[145.11]INVTDFTR n[145.11]IQNK[272.20]PLYFADR n[145.11]ITPAEVGVLVGK[272.20]DR n[145.11]K[272.20]AGFAGDDAPR n[145.11]K[272.20]IYVVDLSNER n[145.11]K[272.20]LPASFDAR n[145.11]LADAINTEFK[272.20]NTR n[145.11]LEPTVIDEVR n[145.11]LGSATALMIR n[145.11]LGSDAELQIER n[145.11]LHLGVTPSVIR n[145.11]LK[272.20]LPASFDAR n[145.11]LPDGQVITIGNER n[145.11]LQVNFHSPR n[145.11]LRPGDC[160.03]EVC[160.03]ISYLGR n[145.11]LSGAPQASAADVVVVHGR n[145.11]LSNTTAIAEAWAR n[145.11]LSQTQGPPDYPR n[145.11]LTEAPLNPK[272.20]ANR n[145.11]LTFEELER n[145.11]LVASNLNLK[272.20]PGEC[160.03]LR n[145.11]LYSSSDDVIELTPSNFNR n[145.11]MAPEVLPK[272.20]PR n[145.11]MFLQYYLNEQGDR n[145.11]MK[272.20]DSLVLLGR n[145.11]MK[272.20]FNPFVTSDR n[145.11]MK[272.20]HYEVEILDAK[272.20]TR n[145.11]MLSLDFLDDVR n[145.11]MPPYTVVYFPVR n[145.11]MQNPQILAALQER n[145.11]MSTGTFVVSQPLNYR n[145.11]MVNFTVDQIR n[145.11]MVNLLQIVR n[145.11]MVPPVQVSPLIK[272.20]LGR n[145.11]MYLQVETR n[145.11]NEATGGK[272.20]YVPR n[145.11]PDYLGADQR n[145.11]PFLELDTNLPANR n[145.11]PGGLLLGDVAPNFEANTTVGR  iTRAQ 116/ iTRAQ 117 0.42 0.23 0.27 0.17 0.61 0.2 0.29 0.21 0.3 0.2 0.1 0.08 0.29 0.28 0.31 0.36 0.19 0.32 0.49 0.29 0.24 0.37 0.24 0.21 0.28 0.18 0.25 0.31 0.25 0.2 0.22 0.08 0.3 0.36 0.24 0.47 0.26 0.33 0.21 0.3 0.21 0.24 0.3 0.24  IPI # IPI00413778 IPI00220063 IPI00007750 IPI00014424 IPI00029236 IPI00019502 IPI00418169 IPI00216691 IPI00008603 IPI00290039 IPI00295741 IPI00418471 IPI00166768 IPI00006970 IPI00182126 IPI00298237 IPI00295741 IPI00003269 IPI00002478 IPI00328748 IPI00011522 IPI00007750 IPI00013195 IPI00008603 IPI00180404 IPI00219219 IPI00299571 IPI00015972 IPI00032853 IPI00008791 IPI00007144 IPI00100656 IPI00104128 IPI00219757 IPI00023860 IPI00479877 IPI00186290 IPI00025725 IPI00218848 IPI00001578 IPI00007752 IPI00021435 IPI00293867 IPI00220301  190  N-termini Natural Natural Natural Natural Natural Natural Natural Natural Natural Neo Neo Natural Natural Natural Neo Neo Neo Neo Neo Natural Natural Neo Neo Neo Neo Neo Neo Neo Neo Natural Natural Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Natural Natural  Prob 1.00 0.99 1.00 0.99 0.93 0.97 1.00 1.00 1.00 0.98 0.94 0.98 1.00 1.00 0.87 0.97 0.86 1.00 0.99 1.00 1.00 1.00 0.94 0.97 1.00 0.96 0.98 0.98 1.00 0.98 0.99 0.97 1.00 0.87 0.99 0.88 0.99 1.00 0.99 0.83 0.83 0.95 0.84 0.99  z 3 3 3 10 3 2 3 3 3 3 2 2 3 3 2 2 2 3 3 3 3 3 3 3 3 3 2 2 3 2 3 2 3 2 3 2 2 3 3 2 2 3 3 3  Precursor Mass 1813.8772 1513.701 2003.1147 1430.7768 1618.8616 1613.7546 1787.0144 1695.9873 1983.0511 1616.8665 1252.6479 1147.6134 1730.8784 1782.825 1269.627 1468.7003 858.3944 1826.905 1962.9338 1750.7692 1649.7699 1875.9457 1512.7866 1866.9589 1764.8292 1624.8518 1486.8488 1581.8367 1522.7745 1219.59 1842.0448 1252.5825 2197.2651 1137.5339 1573.9237 1146.5478 1390.7429 1856.9906 1615.8035 1094.4916 1221.5477 1497.8579 1466.822 1612.7872  Error [Da] -0.0245 -0.0597 0.01 -0.0058 -0.0571 -0.005 -0.0153 -0.0042 0.0325 -0.0132 -0.0528 -0.0553 0.0157 -0.0144 -0.0207 -0.0099 -0.0737 0.0403 -0.0067 0.0176 -0.0221 -0.047 0.0299 -0.0458 -0.0105 0.0218 -0.0139 -0.012 -0.0482 -0.0015 0.0358 -0.0345 0.0674 -0.0561 0.021 -0.0637 -0.0108 -0.0171 -0.0292 -0.0055 -0.0271 0.0072 0.0243 0.0305  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]PGHLQEGFGC[160.03]VVTNR n[145.11]PGPTPSGTNVGSSGR n[145.11]PGVTVK[272.20]DVNQQEFVR n[145.11]PMFIVNTNVPR n[145.11]PNFSGNWK[272.20]IIR n[145.11]PQYQTWEEFSR n[145.11]PSK[272.20]GPLQSVQVFGR n[145.11]PVPPLPEYGGK[272.20]VR n[145.11]QK[272.20]TGTAEMSSILEER n[145.11]QSIYPLHDVFVR n[145.11]SAADVVVVHGR n[145.11]SASVVSVISR n[145.11]SDMPPLTLEGIQDR n[145.11]SDVLELTDDNFESR n[145.11]SFVNDIFER n[145.11]SGGTTMYPGIADR n[145.11]SGLPGER n[145.11]SGMC[160.03]K[272.20]AGFAGDDAPR n[145.11]SGTLGHPGSLDETTYER n[145.11]SHGSQETDEEFDAR n[145.11]SHIEDQAEQFFR n[145.11]SIAAHLDNQVPVESPR n[145.11]SK[272.20]DNEGSWFR n[145.11]SLADAINTEFK[272.20]NTR n[145.11]SLEDALSSDTSGHFR n[145.11]SLEDENK[272.20]EAFR n[145.11]SNIPFITVPLSR n[145.11]SPAGGPLEDVVIER n[145.11]SPALTIENEHIR n[145.11]SQDASDGLQR n[145.11]SSEAPPLINEDVK[272.20]R n[145.11]SSGSGPFTDVR n[145.11]SSLGAPAISAASFLQDLIHR n[145.11]SSPGGVYATR n[145.11]SSSGVIPNEK[272.20]IR n[145.11]STAAQQELR n[145.11]STISEVALQSGR n[145.11]STQAATQVVLNVPETR n[145.11]STVIHYEIPEER n[145.11]SVMC[160.03]PDAR n[145.11]SYSPEPDQR n[145.11]TEAPLNPK[272.20]ANR n[145.11]TGYTPDEK[272.20]LR n[145.11]THEAEQNDSVSPR  iTRAQ 116/ iTRAQ 117 0.42 0.26 0.18 0.24 0.11 0.22 0.15 0.16 0.2 0.36 0.27 0.28 0.3 0.27 0.18 0.28 0.52 0.16 0.3 0.41 0.46 0.27 0.12 0.13 0.83 0.24 0.28 0.25 0.36 0.31 0.14 0.16 0.25 0.11 0.14 0.16 0.25 0.3 0.19 0.44 0.22 0.27 0.17 0.2  IPI # IPI00410693 IPI00220835 IPI00215780 IPI00293276 IPI00216088 IPI00216125 IPI00221092 IPI00029133 IPI00440493 IPI00419880 IPI00011522 IPI00009407 IPI00022442 IPI00025252 IPI00003935 IPI00008603 IPI00304962 IPI00021439 IPI00217745 IPI00025086 IPI00022543 IPI00018120 IPI00304435 IPI00418471 IPI00002459 IPI00010800 IPI00008982 IPI00303300 IPI00012989 IPI00009276 IPI00025874 IPI00022418 IPI00479918 IPI00418471 IPI00154473 IPI00019502 IPI00419869 IPI00289535 IPI00001872 IPI00182138 IPI00298237 IPI00008603 IPI00219385 IPI00005564  191  N-termini Neo Neo Natural Neo Neo Neo Neo Neo Natural Natural Natural Natural Natural Natural Neo Neo Neo Neo Natural Neo Neo Neo Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural  Prob 1.00 0.92 0.82 0.98 1.00 0.88 0.95 0.98 1.00 0.95 0.98 0.89 0.85 0.94 0.96 0.90 0.98 0.99 1.00 0.94 0.85 1.00 0.94 1.00 0.97 0.98 0.92 0.95 0.99 0.87 1.00 0.98 0.99 1.00 0.82 0.91 0.99 0.98 0.88 1.00 0.94 0.99 0.83 1.00  z 3 2 2 3 3 2 2 2 3 2 2 3 2 2 3 3 2 3 4 3 4 3 3 3 3 2 2 3 3 2 3 3 3 3 2 2 3 2 2 3 2 2 2 3  Precursor Mass 1897.0488 1796.8541 1017.5271 1718.9706 1671.9564 1258.6309 1023.5647 1619.8545 1443.8951 1307.6928 1821.0456 1612.9454 949.4195 1234.6738 1457.8742 1550.9031 1316.6614 1525.9484 1863.9208 2140.9045 2231.8926 1439.7878 1828.9376 1584.8009 1737.9 1328.6865 1199.6644 1797.0327 2157.0122 1356.7316 1750.8356 1764.8383 1798.9884 1845.8797 1571.8656 1459.6464 2056.0095 1253.602 1259.6605 2114.137 1343.7893 1342.7114 1398.8049 2041.0353  Error [Da] 0.0153 0.009 -0.0316 0.0299 -0.0203 -0.0328 -0.03 0.0238 -0.0216 -0.0279 0.0449 -0.0123 -0.0212 -0.0053 -0.0067 0.0334 -0.0233 0.03 -0.0505 -0.1312 -0.0794 0.0261 -0.0105 -0.0328 0.0006 -0.0672 -0.0351 -0.039 -0.1034 -0.0167 0.0225 -0.006 -0.0026 -0.028 0.0229 -0.0383 0.0137 -0.0353 -0.0242 -0.0387 -0.0001 -0.0573 -0.009 0.0406  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[145.11]TK[272.20]PPQC[160.03]VDIPADLR n[145.11]TTFNIQDGPDFQDR n[145.11]VAGMLMPR n[145.11]VDALK[272.20]GTNESLER n[145.11]VDVSK[272.20]PDLTAALR n[145.11]VELQELNDR n[145.11]VGPAGAVGPR n[145.11]VGSLNLEELSEMR n[145.11]VK[272.20]LFIGNLPR n[145.11]VLAELYVSDR n[145.11]VLLESEQFLTELTR n[145.11]VMEK[272.20]PSPLLVGR n[145.11]VNDGDMR n[145.11]VNFTVDQIR n[145.11]VSK[272.20]PDLTAALR n[145.11]VSTSSMGTLPK[272.20]R n[145.11]VSVPWDDSLR n[145.11]VVPGGDLAK[272.20]VQR n[145.11]WELTILHTNDVHSR n[145.11]WK[272.20]FEHC[160.03]NFNDVTTR n[145.11]YEC[160.03]GEK[272.20]GHYAYDC[160.03]HR n[145.11]YVGDEAQSK[272.20]R n[43.02]AAGFK[272.20]TVEPLEYYR n[43.02]AATASAGAGGIDGK[272.20]PR n[43.02]AATFFGEVVK[272.20]APC[160.03]R n[43.02]AATTGSGVK[272.20]VPR n[43.02]AAVDLEK[272.20]LR n[43.02]AAVK[272.20]TLNPK[272.20]AEVAR n[43.02]AC[160.03]GLVASNLNLK[272.20]PGEC[160.03]LR n[43.02]ADEIAK[272.20]AQVAR n[43.02]ADK[272.20]EAAFDDAVEER n[43.02]ADLAEC[160.03]NIK[272.20]VMC[160.03]R n[43.02]ADLDK[272.20]LNIDSIIQR n[43.02]ADLEEQLSDEEK[272.20]VR n[43.02]ADPK[272.20]YADLPGIAR n[43.02]ADQGEK[272.20]ENPMR n[43.02]AEDWLDC[160.03]PALGPGWK[272.20]R n[43.02]AESSDK[272.20]LYR n[43.02]AEVEETLK[272.20]R n[43.02]AFLASGPYLTHQQK[272.20]VLR n[43.02]AGITTIEAVK[272.20]R n[43.02]AGLNSLEAVK[272.20]R n[43.02]AK[272.20]LLSC[160.03]VLGPR n[43.02]AK[272.20]VSELYDVTWEEMR  iTRAQ 116/ iTRAQ 117 0.13 0.31 0.24 0.15 0.09 0.17 0.2 0.25 0.14 0.29 0.27 0.13 0.45 0.279 0.12 0.18 0.18 0.13 0.27 0.4 0.41 0.2 0.45 0.28 0.2 0.25 0.13 0.13 0.38 0.2 0.22 0.21 0.29 0.33 0.2 0.25 0.3 0.22 0.3 0.35 0.25 0.247 0.34 0.3  IPI # IPI00749245 IPI00017799 IPI00014898 IPI00418471 IPI00418471 IPI00418471 IPI00304962 IPI00186581 IPI00003704 IPI00306960 IPI00293434 IPI00009057 IPI00023673 IPI00186290 IPI00418471 IPI00293564 IPI00010800 IPI00007750 IPI00009456 IPI00011302 IPI00003377 IPI00003269 IPI00552920 IPI00219729 IPI00030770 IPI00472498 IPI00332371 IPI00027626 IPI00219219 IPI00239077 IPI00328319 IPI00012837 IPI00005705 IPI00026182 IPI00220503 IPI00746438 IPI00438701 IPI00449049 IPI00063849 IPI00255052 IPI00218319 IPI00010779 IPI00033075 IPI00014149  192  N-termini Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Neo Natural Natural Natural Natural Natural Natural Neo Natural Natural Neo Neo Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural  Prob 0.89 0.94 0.95 0.96 0.97 0.91 0.97 0.98 0.98 0.93 0.84 0.97 0.88 0.97 0.97 0.89 0.95 0.99 0.87 0.97 0.99 0.87 0.91 0.95 0.89 0.91 0.96 0.98 0.83 0.98 0.97 0.98 0.94 0.93 0.98 0.88 0.97 0.98 0.99 1.00 0.96 0.94 0.84 1.00  z 2 2 2 2 2 4 2 3 2 2 2 2 2 2 2 2 3 3 3 2 3 2 2 3 2 2 2 2 2 2 2 3 3 3 3 2 2 2 2 3 2 2 2 4  Precursor Mass 1200.5838 1326.7329 1352.6193 1587.6718 1270.6496 2437.2985 1755.8442 1832.0258 1445.721 1389.7258 1089.5659 1571.8774 1470.8638 1630.8433 1198.6695 1499.7362 2938.3593 1847.9435 2043.1005 1672.895 2221.0787 1411.8107 1630.8363 1874.9187 1009.5209 1152.6253 1411.688 1773.9564 1178.5362 1553.7341 1364.6736 1557.7151 1975.713 1413.7354 2163.0962 1099.6587 1134.5299 1439.7147 1678.8101 1633.7825 1429.5753 1314.7992 1364.685 1993.0509  Error [Da] -0.0171 -0.03 -0.0435 -0.0715 -0.0619 -0.0258 0.0335 0.0011 -0.0022 -0.0327 -0.0427 -0.0231 0.0111 -0.0367 -0.0461 -0.038 0.0396 -0.0432 0.0398 0.001 0.0311 0.013 -0.0354 -0.0317 -0.0288 0.0018 -0.0157 -0.0005 -0.0295 -0.0077 -0.0181 0.0092 -0.2667 -0.0163 -0.0115 -0.0248 -0.0818 -0.034 -0.0186 -0.068 -0.0447 -0.0001 -0.0208 -0.0358  N-term Modification Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[43.02]AK[272.20]WGEGDPR n[43.02]ALETVPK[272.20]DLR n[43.02]ANK[272.20]GPSYGMSR n[43.02]AQDQGEK[272.20]ENPMR n[43.02]AQNLK[272.20]DLAGR n[43.02]ASGVAVSDGVIK[272.20]VFNDMK[272.20]VR n[43.02]ASK[272.20]EMFEDTVEER n[43.02]ASSDIQVK[272.20]ELEK[272.20]R n[43.02]ASSGAGDPLDSK[272.20]R n[43.02]ATDELATK[272.20]LSR n[43.02]ATGQK[272.20]LMR n[43.02]ATVTATTK[272.20]VPEIR n[43.02]AVEELQSIIK[272.20]R n[43.02]AVPPTYADLGK[272.20]SAR n[43.02]AVSTGVK[272.20]VPR n[43.02]AVTLDK[272.20]DAYYR n[43.02]DDDIAALVVDNGSGMC[160.03]K[272.20]AGFAGDDAPR n[43.02]GDAPSPEEK[272.20]LHLITR n[43.02]GDVK[272.20]NFLYAWC[160.03]GK[272.20]R n[43.02]MDGIVPDIAVGTK[272.20]R n[43.02]MDNSGK[272.20]EAEAMALLAEAER n[43.02]MEK[272.20]PSPLLVGR n[43.02]MEK[272.20]TLETVPLER n[43.02]MEPLAAYPLK[272.20]C[160.03]SGPR n[43.02]MFAK[272.20]ATR n[43.02]MFSWLK[272.20]R n[43.02]MFSWVSK[272.20]DAR n[43.02]MLGPEGGEGFVVK[272.20]LR n[43.02]MNK[272.20]DAQMR n[43.02]MQPASAK[272.20]WYDR n[43.02]MVGEEK[272.20]MSLR n[43.02]QEYDESGPSIVHR n[43.02]RPGGK[272.20]TGSGGVASSSESNR n[43.02]SALEK[272.20]SMHLGR n[43.02]SGGK[272.20]YVDSEGHLYTVPIR n[43.02]SGGLLK[272.20]ALR n[43.02]SK[272.20]NTVSSAR n[43.02]SK[272.20]SFQQSSLSR n[43.02]SQAEFEK[272.20]AAEEVR n[43.02]SSK[272.20]TASTNNIAQAR n[43.02]SSNEC[160.03]FK[272.20]C[160.03]GR n[43.02]TAIIK[272.20]EIVSR n[43.02]TGYTPDEK[272.20]LR n[43.02]VEEVQK[272.20]HSVHTLVFR  iTRAQ 116/ iTRAQ 117 0.22 0.17 0.21 0.27 0.258 0.17 0.21 0.21 0.23 0.25 0.25 0.23 0.18 0.27 0.28 0.21 0.28 0.32 0.13 0.2 0.41 0.29 0.25 0.19 0.26 0.22 0.22 0.22 0.26 0.17 0.22 1.04 0.3 0.48 0.26 0.22 0.23 0.18 0.31 0.4 0.26 0.23 0.26 0.3  IPI # IPI00030706 IPI00002895 IPI00216138 IPI00376798 IPI00027252 IPI00012011 IPI00395865 IPI00479997 IPI00022277 IPI00060181 IPI00000792 IPI00009104 IPI00074604 IPI00216308 IPI00019600 IPI00026970 IPI00021439 IPI00007074 IPI00844578 IPI00179964 IPI00009253 IPI00009057 IPI00396378 IPI00291695 IPI00029656 IPI00100980 IPI00017184 IPI00003881 IPI00024620 IPI00015029 IPI00644020 IPI00021439 IPI00017341 IPI00007694 IPI00009236 IPI00183500 IPI00007280 IPI00017297 IPI00010182 IPI00221232 IPI00430813 IPI00012587 IPI00219385 IPI00002624  193  Appendix B.7 Peptides identified by iTRAQ-TAILS in conditioned medium of HMEC1xHMEC2. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 114) or sMT6EΔA (iTRAQ 115) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated.  N-termini Neo Neo Neo Neo Neo Neo Neo Neo Neo Natural Neo Neo Neo Natural Natural Neo Natural Natural Natural Natural Neo Neo Natural Natural Neo Neo Neo Neo Natural Neo Neo Natural Neo  Prob 0.99 1.00 1.00 0.99 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.98 0.99 1.00 0.96 1.00 0.99 1.00 1.00 1.00 0.89 1.00 1.00 1.00 0.96 0.97 1.00 1.00 0.98 1.00 0.88 1.00 0.89  z 2 3 3 2 2 3 2 2 3 3 2 3 3 3 2 3 3 3 2 3 2 3 3 3 3 2 3 3 2 2 2 2 2  Precursor Mass 1254.7116 1666.8534 1774.856 1199.5159 1319.493 1904.9186 1710.691 1119.5127 2468.1535 1692.8532 1431.7123 1480.7483 1504.7377 1997.0869 1214.588 2187.9769 1360.6871 1969.0164 1324.6291 1855.9327 952.4375 1595.83 1664.8005 2264.9178 1383.6616 1197.6327 1612.9356 2554.9764 1398.6561 1506.7566 1316.5959 1507.7234 995.4601  Error [Da] -0.0301 -0.0343 -0.0857 -0.0208 -0.0777 -0.0641 -0.1393 -0.03 -0.1328 -0.0495 -0.0324 -0.0758 -0.1076 -0.0644 -0.0137 -0.1533 -0.0466 -0.0712 -0.0206 -0.071 -0.0472 -0.0207 -0.0482 -0.1669 -0.0248 -0.033 -0.0148 -0.0703 -0.0296 -0.0391 -0.0308 -0.0613 -0.0049  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]AATLILEPAGR n[145.11]ADAINTEFK[272.20]NTR n[145.11]ADANLEAGNVK[272.20]ETR n[145.11]AEFSSEAC[160.03]R n[145.11]AEGPDEDSSNR n[145.11]AEPEGGPASEGAARPLPR n[145.11]AGASATFPMQC[160.03]SALR n[145.11]AGFAGDDAPR n[145.11]AGGAAQLALDK[272.20]SDSHPSDALTR n[145.11]AGGEAGVTLGQPHLSR n[145.11]AGMAMAGQSPVLR n[145.11]AINTEFK[272.20]NTR n[145.11]ALK[272.20]GTNESLER n[145.11]APAEILNGK[272.20]EISAQIR n[145.11]APDQDEIQR n[145.11]APGLQC[160.03]HPPK[272.20]DDEAPLR n[145.11]APPAAGQQQPPR n[145.11]APSVPAAEPEYPK[272.20]GIR n[145.11]ASEGGFTATGQR n[145.11]ASGANFEYIIAEK[272.20]R n[145.11]ASQNSFR n[145.11]DAINTEFK[272.20]NTR n[145.11]DAPEEEDHVLVLR n[145.11]DDEVDVDGTVEEDLGK[272.20]SR n[145.11]DENEHQLSLR n[145.11]DIPAMLPAAR n[145.11]DNIQGITK[272.20]PAIR n[145.11]DVK[272.20]C[160.03]DMEVSC[160.03]PDGYTC[160.03]C[160.03]R n[145.11]EEQPPETAAQR n[145.11]EFQTNLVPYPR n[145.11]EQAPGTAPC[160.03]SR n[145.11]ESETTTSLVLER n[145.11]EVC[160.03]MASR  iTRAQ 114/ iTRAQ 115 1.5 1.93 1.89 2.09 1.3 1.96 1.41 1.29 1.69 2.11 1.52 1.329 1.233 2.01 1.23 0.86 1.29 1.59 1.307 2.34 1.03 2.09 1.45 2.95 0.88 1.55 1.3 1.98 1.12 1.77 1.08 1.72 1.19  IPI # IPI00220906 IPI00418471 IPI00328113 IPI00030877 IPI00009904 IPI00015881 IPI00376005 IPI00008603 IPI00028031 IPI00297982 IPI00179964 IPI00418471 IPI00418471 IPI00218342 IPI00021794 IPI00029235 IPI00002802 IPI00172460 IPI00003351 IPI00024993 IPI00296053 IPI00418471 IPI00010796 IPI00027230 IPI00220740 IPI00329688 IPI00453473 IPI00181753 IPI00386755 IPI00007750 IPI00010277 IPI00029744 IPI00166039  194  N-termini Neo Neo Neo Neo Neo Neo Neo Neo Natural Neo Natural Natural Neo Neo Natural Neo Neo Neo Neo Neo Neo Neo Neo Natural Neo Neo Neo Neo Neo Neo Natural Natural Natural Neo Natural Natural Natural Natural Natural Natural Neo Natural Neo Natural  Prob 0.99 1.00 1.00 1.00 1.00 0.99 1.00 1.00 0.99 1.00 1.00 0.99 0.95 1.00 0.96 0.99 0.99 1.00 0.96 1.00 0.93 1.00 1.00 1.00 1.00 0.97 1.00 1.00 0.92 1.00 1.00 0.99 1.00 0.99 0.98 1.00 1.00 0.99 1.00 0.98 0.98 1.00 0.98 1.00  z 2 2 3 2 3 3 2 3 3 3 3 3 2 3 4 2 2 2 3 3 2 2 2 3 2 3 10 4 3 3 3 2 3 3 3 2 3 2 2 2 2 2 2 2  Precursor Mass 991.4251 1396.6022 2013.9954 1238.6521 1844.8065 2568.9577 1377.6953 1297.6138 1551.7261 1512.8862 1671.8703 1648.8947 1774.8715 1825.8132 1968.0746 1061.5145 1229.653 1364.6879 1750.8106 1587.8164 943.4834 1457.7455 1275.5715 1437.6964 1168.6392 1658.8092 1391.721 1670.8654 1236.7034 1334.7602 1937.8745 1611.8261 1639.7881 1497.8898 1304.6745 1513.6791 2003.0287 1480.7627 1613.6974 1149.5803 1131.6135 1349.5069 1257.556 1782.7935  Error [Da] -0.0596 -0.0315 -0.0773 -0.0586 -0.0492 -0.268 -0.0174 -0.0147 -0.0556 -0.0365 -0.0485 -0.116 -0.0872 -0.0585 -0.0403 -0.0262 -0.0317 -0.0288 -0.1772 -0.0439 -0.0373 -0.0142 -0.0502 -0.0159 -0.0655 -0.0347 -0.0187 -0.0442 -0.0403 -0.0555 -0.0832 -0.0346 -0.0503 -0.0337 -0.0369 -0.0816 -0.0757 -0.057 -0.0623 -0.0344 -0.0232 -0.0568 -0.0697 -0.0462  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]FAGDDAPR n[145.11]FGSDQSENVDR n[145.11]FSLADAINTEFK[272.20]NTR n[145.11]GAPEVLVSAPR n[145.11]GENTSNMTHLEAQNR n[145.11]GETGHVAINC[160.03]SK[272.20]TSEVNC[160.03]YR n[145.11]GFDVASVQQQR n[145.11]GHGSGWAETPR n[145.11]GHQQLYWSHPR n[145.11]GIVPDIAVGTK[272.20]R n[145.11]GK[272.20]DYYQTLGLAR n[145.11]GK[272.20]VK[272.20]VGVNGFGR n[145.11]GLVETPTGYIESLPR n[145.11]GPAAEAEPEHSFDGLR n[145.11]GPAK[272.20]SPYQLVLQHSR n[145.11]GPNIC[160.03]TTR n[145.11]GQVITIGNER n[145.11]GTQTVNYVPSR n[145.11]GVK[272.20]K[272.20]FDVPC[160.03]GGR n[145.11]GVPEGAQLQGPVHR n[145.11]GVPVEGSR n[145.11]GVQVETISPGDGR n[145.11]GYSFTTTAER n[145.11]HWPSEPSEAVR n[145.11]IGGIGTVPVGR n[145.11]IWHHTFYNELR n[145.11]K[272.20]AGFAGDDAPR n[145.11]K[272.20]FVGGAENTAHPR n[145.11]K[272.20]PVSLSYR n[145.11]LHLGVTPSVIR n[145.11]LRPGDC[160.03]EVC[160.03]ISYLGR n[145.11]MPPYTVVYFPVR n[145.11]MQPASAK[272.20]WYDR n[145.11]NIQGITK[272.20]PAIR n[145.11]PAVSK[272.20]GDGMR n[145.11]PGPTPSGTNVGSSGR n[145.11]PGVTVK[272.20]DVNQQEFVR n[145.11]PPYTVVYFPVR n[145.11]PQYQTWEEFSR n[145.11]PTVEELYR n[145.11]SAINEVVTR n[145.11]SAPGEDEEC[160.03]GR n[145.11]SAPLAAGC[160.03]PDR n[145.11]SDVLELTDDNFESR  iTRAQ 114/ iTRAQ 115 0.873 1.81 3.78 1.31 0.8 1.26 1.36 1.33 1.53 1.88 2 1.25 1.02 1.1 1.66 0.94 1.03 1.09 1.28 0.91 1.02 0.993 1 1.57 1.13 0.67 1.66 0.84 1.3 1.9 2.17 1.35 1.44 2.55 1.52 2.9 1.82 1.77 1.29 1.52 0.83 1.07 0.935 1.84  IPI # IPI00008603 IPI00258804 IPI00418471 IPI00143921 IPI00010414 IPI00430812 IPI00106668 IPI00026089 IPI00182289 IPI00179964 IPI00015947 IPI00219018 IPI00023860 IPI00014898 IPI00018219 IPI00220350 IPI00003269 IPI00302592 IPI00306322 IPI00031801 IPI00031801 IPI00413778 IPI00021439 IPI00028911 IPI00014424 IPI00021428 IPI00008603 IPI00029236 IPI00413781 IPI00298237 IPI00328748 IPI00219757 IPI00015029 IPI00453473 IPI00016621 IPI00220835 IPI00215780 IPI00219757 IPI00216125 IPI00006684 IPI00026302 IPI00217882 IPI00003176 IPI00025252  195  N-termini Neo Neo Neo Neo Neo Natural Natural Neo Neo Neo Neo Neo Neo Neo Neo Neo Natural Neo Natural Natural Neo Natural Neo Natural Neo Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Neo Natural Natural Natural Natural Natural Natural Natural Natural  Prob 1.00 1.00 1.00 0.94 1.00 0.95 0.98 1.00 0.98 1.00 1.00 0.91 0.99 0.95 0.87 1.00 1.00 1.00 0.97 0.99 1.00 0.97 1.00 0.98 0.99 1.00 1.00 1.00 0.88 1.00 0.99 1.00 0.99 0.91 1.00 0.95 0.98 0.98 0.98 1.00 0.93 0.97 0.98 0.98  z 3 3 3 3 3 3 2 3 2 3 3 2 3 2 3 3 2 3 2 2 3 3 3 2 2 2 2 3 2 10 3 2 3 3 2 3 2 4 2 2 3 2 3 3  Precursor Mass 1527.6771 1962.8901 1595.8192 1387.8268 1522.7837 1260.6825 1219.5316 1467.7621 1146.5606 1901.8274 1800.9143 1221.514 1481.8394 1260.5637 1371.7874 1671.9087 1483.7179 1432.745 949.436 1234.6465 1457.8546 1725.9471 1556.6404 1116.6093 1652.7729 1584.7349 1328.6557 1797.0347 1231.7166 2157.0034 1822.7568 1750.7767 2207.0452 1267.6455 1661.7797 1570.6049 1253.6022 2324.1549 1343.6399 1342.641 1578.7674 1403.6539 1514.8366 1473.7912  Error [Da] -0.0446 -0.0504 -0.0315 -0.0487 -0.0388 -0.0276 -0.0599 -0.0296 -0.0511 -0.0433 -0.0834 -0.0608 -0.0523 -0.025 -0.0244 -0.068 -0.0618 -0.0367 -0.0049 -0.0322 -0.0263 -0.0784 -0.0403 -0.0284 -0.0988 -0.0993 -0.098 -0.0369 -0.0611 -0.1122 -0.0159 -0.036 -0.1085 -0.0187 -0.022 -0.073 -0.0355 -0.1183 -0.1498 -0.1277 -0.0537 -0.0839 -0.0294 -0.0482  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[145.11]SGSMDPSGAHPSVR n[145.11]SGTLGHPGSLDETTYER n[145.11]SK[272.20]FADLSEAANR n[145.11]SK[272.20]LVVITQGR n[145.11]SPALTIENEHIR n[145.11]SPVLHFYVR n[145.11]SQDASDGLQR n[145.11]SQLLGSAHEVQR n[145.11]STAAQQELR n[145.11]STAYEDYYYHPPPR n[145.11]SVPAAEPEYPK[272.20]GIR n[145.11]SYSPEPDQR n[145.11]TAAAPK[272.20]AGPGVVR n[145.11]TPAPETC[160.03]EGR n[145.11]TTTLAFK[272.20]FR n[145.11]VDVSK[272.20]PDLTAALR n[145.11]VDYYEVLGVQR n[145.11]VK[272.20]MAAAGGGGGGGR n[145.11]VNDGDMR n[145.11]VNFTVDQIR n[145.11]VSK[272.20]PDLTAALR n[145.11]YALSGSVWK[272.20]K[272.20]R n[145.11]YYGYDYHNYR n[43.02]AAAAVSSAK[272.20]R n[43.02]AAPAQQTTQPGGGK[272.20]R n[43.02]AATASAGAGGIDGK[272.20]PR n[43.02]AATTGSGVK[272.20]VPR n[43.02]AAVK[272.20]TLNPK[272.20]AEVAR n[43.02]AAYK[272.20]LVLIR n[43.02]AC[160.03]GLVASNLNLK[272.20]PGEC[160.03]LR n[43.02]ADEGK[272.20]SYSEHDDER n[43.02]ADK[272.20]EAAFDDAVEER n[43.02]ADK[272.20]MDMSLDDIIK[272.20]LNR n[43.02]AEAELHK[272.20]ER n[43.02]AEFTSYK[272.20]ETASSR n[43.02]AEK[272.20]FDC[160.03]HYC[160.03]R n[43.02]AESSDK[272.20]LYR n[43.02]AFK[272.20]DTGK[272.20]TPVEPEVAIHR n[43.02]AGITTIEAVK[272.20]R n[43.02]AGLNSLEAVK[272.20]R n[43.02]AK[272.20]HHPDLIFC[160.03]R n[43.02]AK[272.20]ISSPTETER n[43.02]AK[272.20]PLTDQEK[272.20]R n[43.02]AK[272.20]PLTDSEK[272.20]R  iTRAQ 114/ iTRAQ 115 0.66 1.56 1.25 1.14 1.68 1.32 1.06 1 1.12 0.64 1.92 1 0.65 1.17 1.65 2.38 1.34 1.09 1.23 1.27 1.6 2.88 1.54 1.35 0.63 14.53 1.27 1.3 1.49 2.63 10.85 1.55 3.2 7.4 4.68 1.26 1.45 3.2 1.81 1.44 1.67 1.02 1.56 1.77  IPI # IPI00008575 IPI00217745 IPI00418471 IPI00413916 IPI00012989 IPI00004534 IPI00009276 IPI00744706 IPI00019502 IPI00012074 IPI00172460 IPI00298237 IPI00017596 IPI00030241 IPI00375704 IPI00418471 IPI00024523 IPI00027834 IPI00023673 IPI00186290 IPI00418471 IPI00014758 IPI00018140 IPI00220567 IPI00465054 IPI00219729 IPI00472498 IPI00027626 IPI00374975 IPI00219219 IPI00033153 IPI00328319 IPI00328840 IPI00032064 IPI00296830 IPI00014398 IPI00449049 IPI00012493 IPI00218319 IPI00010779 IPI00005511 IPI00013895 IPI00783313 IPI00004358  196  N-termini Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Neo  Prob 0.96 0.98 1.00 0.99 0.94 1.00 1.00 1.00 0.99 0.99 1.00 0.98 0.97 1.00 1.00 1.00 0.99 1.00 0.98 0.98 0.99 0.99 1.00 1.00 0.97  z 2 2 3 2 2 2 3 2 3 2 4 3 2 2 3 4 2 3 2 3 2 3 2 2 2  Precursor Mass 1352.5875 1185.635 1699.8982 1587.6366 1270.6556 1393.6798 2437.2088 1755.7678 1831.9967 1499.7051 2047.9958 2994.303 1656.8493 1630.8001 2301.9432 2402.1643 1731.8477 2368.1308 1134.5827 1843.9029 1439.7107 1877.1025 1678.7666 1633.8133 1569.8446  Error [Da] -0.0752 -0.0237 -0.0595 -0.1067 -0.0561 -0.0269 -0.1155 -0.0429 -0.028 -0.0686 -0.0715 -0.0787 -0.0494 -0.0716 -0.1378 -0.0725 -0.065 -0.0659 -0.029 -0.0854 -0.038 -0.0282 -0.0621 -0.0374 -0.0401  N-term Modification Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[43.02]ANK[272.20]GPSYGMSR n[43.02]ANNDAVLK[272.20]R n[43.02]AQAK[272.20]INAK[272.20]ANEGR n[43.02]AQDQGEK[272.20]ENPMR n[43.02]AQNLK[272.20]DLAGR n[43.02]AQYK[272.20]GAASEAGR n[43.02]ASGVAVSDGVIK[272.20]VFNDMK[272.20]VR n[43.02]ASK[272.20]EMFEDTVEER n[43.02]ASSDIQVK[272.20]ELEK[272.20]R n[43.02]AVTLDK[272.20]DAYYR n[43.02]AWK[272.20]SGGASHSELIHNLR n[43.02]EEEIAALVIDNGSGMC[160.03]K[272.20]AGFAGDDAPR n[43.02]MDGIVPDIAVGTK[272.20]R n[43.02]MEK[272.20]TLETVPLER n[43.02]MESGFTSK[272.20]DTYLSHFNPR n[43.02]MQSNK[272.20]TFNLEK[272.20]QNHTPR n[43.02]SDSEK[272.20]LNLDSIIGR n[43.02]SK[272.20]K[272.20]ISGGSVVEMQGDEMTR n[43.02]SK[272.20]NTVSSAR n[43.02]SK[272.20]SESPK[272.20]EPEQLR n[43.02]SK[272.20]SFQQSSLSR n[43.02]SK[272.20]SLK[272.20]K[272.20]LVEESR n[43.02]SQAEFEK[272.20]AAEEVR n[43.02]SSK[272.20]TASTNNIAQAR n[43.02]VDVSK[272.20]PDLTAALR  iTRAQ 114/ iTRAQ 115 1.15 4.72 3.69 3.66 22.8 1.88 2.87 1.54 1.85 1.65 2.03 1.36 2.21 1.52 1.74 2.22 0.76 1.78 0.93 1.686 1.28 2.69 1.63 1.22 1.47  IPI # IPI00216138 IPI00006252 IPI00000643 IPI00376798 IPI00027252 IPI00030098 IPI00012011 IPI00395865 IPI00479997 IPI00026970 IPI00411680 IPI00021440 IPI00179964 IPI00396378 IPI00027681 IPI00304596 IPI00027423 IPI00027223 IPI00007280 IPI00215965 IPI00017297 IPI00017256 IPI00010182 IPI00221232 IPI00418471  197  Appendix B.8 Peptides identified by iTRAQ-TAILS in conditioned medium of HMEC1. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 114) or sMT6EΔA (iTRAQ 115) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated.  N-termini Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Natural Neo Neo Neo Neo Natural Natural Neo Neo Natural Natural Neo Natural Natural Neo Natural Neo Natural Neo Natural Neo Neo  Prob 0.98 0.77 0.99 1.00 1.00 0.99 0.99 1.00 1.00 1.00 1.00 1.00 1.00 0.98 0.92 0.98 1.00 0.96 1.00 0.67 0.99 1.00 0.76 1.00 1.00 0.98 1.00 1.00 1.00 0.99 1.00 0.96 0.97  z 2 2 2 3 3 2 2 3 2 2 3 3 2 3 3 2 3 2 3 3 3 3 2 2 3 2 3 3 3 3 3 3 2  Precursor Mass 1217.6205 1431.7072 1254.7116 1666.8534 1774.9127 1199.5159 1319.5489 1904.9186 1710.7888 1119.5127 2468.2118 1692.8532 1431.7123 1480.7571 1504.811 1161.5662 1997.0869 1214.588 2187.9769 1267.7365 1360.7236 1969.0164 1703.7598 1324.6291 1855.9327 1208.5982 2488.1009 1595.83 1664.8005 1340.6048 2265.0207 1383.6616 1197.6327  Error [Da] -0.0282 -0.0185 -0.0301 -0.0343 -0.029 -0.0208 -0.0218 -0.0641 -0.0419 -0.03 -0.0749 -0.0495 -0.0324 -0.067 -0.0343 -0.0235 -0.0644 -0.0137 -0.1533 -0.0239 -0.0097 -0.0712 -0.1499 -0.0206 -0.071 -0.0285 -0.0518 -0.0207 -0.0482 -0.0183 -0.0645 -0.0248 -0.033  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]AAAVASTGPSSR n[145.11]AASPC[160.03]SVVNDLR n[145.11]AATLILEPAGR n[145.11]ADAINTEFK[272.20]NTR n[145.11]ADANLEAGNVK[272.20]ETR n[145.11]AEFSSEAC[160.03]R n[145.11]AEGPDEDSSNR n[145.11]AEPEGGPASEGAARPLPR n[145.11]AGASATFPMQC[160.03]SALR n[145.11]AGFAGDDAPR n[145.11]AGGAAQLALDK[272.20]SDSHPSDALTR n[145.11]AGGEAGVTLGQPHLSR n[145.11]AGMAMAGQSPVLR n[145.11]AINTEFK[272.20]NTR n[145.11]ALK[272.20]GTNESLER n[145.11]ALYHTEER n[145.11]APAEILNGK[272.20]EISAQIR n[145.11]APDQDEIQR n[145.11]APGLQC[160.03]HPPK[272.20]DDEAPLR n[145.11]APLNPK[272.20]ANR n[145.11]APPAAGQQQPPR n[145.11]APSVPAAEPEYPK[272.20]GIR n[145.11]AQAK[272.20]QWGWTQGR n[145.11]ASEGGFTATGQR n[145.11]ASGANFEYIIAEK[272.20]R n[145.11]ASSPGGVYATR n[145.11]C[160.03]SC[160.03]SPVHPQQAFC[160.03]NADVVIR n[145.11]DAINTEFK[272.20]NTR n[145.11]DAPEEEDHVLVLR n[145.11]DAPQDFHPDR n[145.11]DDEVDVDGTVEEDLGK[272.20]SR n[145.11]DENEHQLSLR n[145.11]DIPAMLPAAR  iTRAQ 114/ iTRAQ 115 1.49 1.41 1.50 2.46 2.43 2.09 1.60 1.96 1.48 1.64 3.30 2.11 1.63 2.24 2.15 1.38 2.01 1.35 1.17 2.38 1.89 1.59 1.51 1.47 2.34 1.99 1.51 2.09 1.55 1.42 3.70 1.22 1.55  IPI # IPI00220113 IPI00549189 IPI00220906 IPI00418471 IPI00328113 IPI00030877 IPI00009904 IPI00015881 IPI00376005 IPI00008603 IPI00028031 IPI00297982 IPI00179964 IPI00418471 IPI00418471 IPI00301109 IPI00218342 IPI00021794 IPI00029235 IPI00008603 IPI00002802 IPI00172460 IPI00394699 IPI00003351 IPI00024993 IPI00418471 IPI00027166 IPI00418471 IPI00010796 IPI00302592 IPI00027230 IPI00220740 IPI00329688  198  N-termini Neo Neo Neo Neo Neo Neo Natural Neo Natural Neo Neo Natural Neo Natural Natural Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Natural Neo Natural Natural Neo Neo Natural Neo Natural Neo Neo Neo Neo Neo Neo Neo Neo Neo  Prob 0.98 1.00 1.00 0.95 1.00 1.00 0.88 0.95 0.98 1.00 0.99 0.95 0.88 0.66 1.00 0.89 0.89 0.94 1.00 1.00 1.00 1.00 1.00 0.99 1.00 1.00 0.89 1.00 1.00 0.88 0.95 1.00 0.96 0.99 1.00 0.99 1.00 0.66 1.00 0.87 1.00 0.82 1.00 0.85  z 2 3 3 3 4 3 2 3 2 2 3 3 2 4 2 2 2 2 2 3 2 3 3 3 2 3 3 3 3 3 2 3 4 2 3 2 2 3 3 2 2 2 2 3  Precursor Mass 1362.621 1503.755 1612.9356 2430.1579 1936.0119 2554.9764 1792.9129 1396.7888 1398.6561 1506.7566 2068.9207 2532.1453 1316.5959 1655.8441 1507.7234 995.4601 1236.6024 991.4623 1396.6022 2013.9954 1238.6521 1844.8065 2842.0576 2569.0621 1377.6953 1297.6138 1551.7224 1512.8862 1671.8703 1648.9929 1774.8715 1825.8132 1968.0746 1061.5145 1710.8856 1229.653 1364.6879 1750.9608 1587.8164 943.5036 1457.7455 1212.4952 1275.5715 1920.8065  Error [Da] -0.0357 -0.0366 -0.0148 -0.0688 -0.0503 -0.0703 -0.0468 -0.0139 -0.0296 -0.0391 -0.048 -0.1074 -0.0308 -0.0384 -0.0613 -0.0049 -0.0193 -0.0224 -0.0315 -0.0773 -0.0586 -0.0492 -0.1736 -0.1636 -0.0174 -0.0147 -0.0593 -0.0365 -0.0485 -0.0178 -0.0872 -0.0585 -0.0403 -0.0262 -0.0441 -0.0317 -0.0288 -0.027 -0.0439 -0.0171 -0.0142 -0.0335 -0.0502 -0.1621  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]DLEPGTMDSVR n[145.11]DLGPHAEGQLAPR n[145.11]DNIQGITK[272.20]PAIR n[145.11]DSVDFSLADAINTEFK[272.20]NTR n[145.11]DTGK[272.20]TPVEPEVAIHR n[145.11]DVK[272.20]C[160.03]DMEVSC[160.03]PDGYTC[160.03]C[160.03]R n[145.11]DWVIPPINLPENSR n[145.11]EAPLNPK[272.20]ANR n[145.11]EEQPPETAAQR n[145.11]EFQTNLVPYPR n[145.11]EGDGGWRPGGPGAVAEEER n[145.11]EPAVYFK[272.20]EQFLDGDGWTSR n[145.11]EQAPGTAPC[160.03]SR n[145.11]ESAGADTRPTVRPR n[145.11]ESETTTSLVLER n[145.11]EVC[160.03]MASR n[145.11]FADLSEAANR n[145.11]FAGDDAPR n[145.11]FGSDQSENVDR n[145.11]FSLADAINTEFK[272.20]NTR n[145.11]GAPEVLVSAPR n[145.11]GENTSNMTHLEAQNR n[145.11]GESGHLAK[272.20]DC[160.03]DLQEDAC[160.03]YNC[160.03]GR n[145.11]GETGHVAINC[160.03]SK[272.20]TSEVNC[160.03]YR n[145.11]GFDVASVQQQR n[145.11]GHGSGWAETPR n[145.11]GHQQLYWSHPR n[145.11]GIVPDIAVGTK[272.20]R n[145.11]GK[272.20]DYYQTLGLAR n[145.11]GK[272.20]VK[272.20]VGVNGFGR n[145.11]GLVETPTGYIESLPR n[145.11]GPAAEAEPEHSFDGLR n[145.11]GPAK[272.20]SPYQLVLQHSR n[145.11]GPNIC[160.03]TTR n[145.11]GQEK[272.20]FFGDQVLR n[145.11]GQVITIGNER n[145.11]GTQTVNYVPSR n[145.11]GVK[272.20]K[272.20]FDVPC[160.03]GGR n[145.11]GVPEGAQLQGPVHR n[145.11]GVPVEGSR n[145.11]GVQVETISPGDGR n[145.11]GWAC[160.03]C[160.03]PYR n[145.11]GYSFTTTAER n[145.11]HEGGQSYK[272.20]IGDTWR  iTRAQ 114/ iTRAQ 115 1.58 1.13 1.68 2.95 1.75 2.76 1.25 3.14 1.33 1.77 0.87 1.92 1.33 0.30 1.72 1.63 1.78 1.70 1.97 3.78 1.31 0.92 1.67 1.61 1.36 1.33 1.89 1.88 2.00 2.46 1.02 1.10 1.66 1.10 1.79 1.03 1.22 2.45 0.91 1.15 1.08 1.02 1.00 0.98  IPI # IPI00007752 IPI00443799 IPI00453473 IPI00418471 IPI00012493 IPI00181753 IPI00290085 IPI00008603 IPI00386755 IPI00007750 IPI00045473 IPI00020599 IPI00010277 IPI00025796 IPI00029744 IPI00166039 IPI00418471 IPI00008603 IPI00258804 IPI00418471 IPI00143921 IPI00010414 IPI00430813 IPI00430812 IPI00106668 IPI00026089 IPI00182289 IPI00179964 IPI00015947 IPI00219018 IPI00023860 IPI00014898 IPI00018219 IPI00220350 IPI00008894 IPI00003269 IPI00302592 IPI00306322 IPI00031801 IPI00031801 IPI00413778 IPI00181753 IPI00021439 IPI00022418  199  N-termini Natural Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Natural Neo Neo Neo Natural Natural Natural Natural Neo Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Neo Natural Neo Natural Neo Neo Neo Neo Natural Neo Neo Neo Neo  Prob 1.00 0.99 1.00 0.97 1.00 0.92 1.00 0.92 1.00 1.00 0.76 0.74 1.00 1.00 0.89 0.94 0.93 1.00 0.99 1.00 0.99 0.89 0.89 0.99 0.99 1.00 1.00 0.99 1.00 0.98 0.96 0.98 1.00 0.97 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.94 1.00 1.00  z 3 3 2 3 10 3 3 2 2 3 2 3 3 3 3 4 2 3 2 3 3 3 2 2 2 3 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 3 3  Precursor Mass 1437.6964 2155.8793 1168.6392 1658.8092 1391.721 1236.7034 1779.9292 1157.5871 1373.7077 1334.7602 1246.7641 2137.1563 1937.8745 1876.967 2166.1749 2649.3547 1278.5866 1628.8211 1611.8261 1639.7881 1497.8898 1304.6843 1177.562 1642.8144 1513.7386 2003.0287 1430.6875 1480.7627 1613.6974 1149.5803 1068.5731 1131.6135 1349.5378 1257.594 1782.7935 1327.5715 1527.6771 1962.8901 1704.93 1750.6974 1595.8192 1387.8268 1939.895 1522.7837  Error [Da] -0.0159 -0.0594 -0.0655 -0.0347 -0.0187 -0.0403 -0.0435 -0.0296 -0.02 -0.0555 -0.0216 -0.1685 -0.0832 -0.0567 -0.0418 -0.1423 -0.0321 -0.0376 -0.0346 -0.0503 -0.0337 -0.0271 -0.0227 -0.0653 -0.0221 -0.0757 -0.0952 -0.057 -0.0623 -0.0344 -0.0316 -0.0232 -0.0259 -0.0317 -0.0462 -0.0172 -0.0446 -0.0504 -0.0467 -0.0543 -0.0315 -0.0487 -0.0527 -0.0388  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]HWPSEPSEAVR n[145.11]HWYVGEGMEEGEFSEAR n[145.11]IGGIGTVPVGR n[145.11]IWHHTFYNELR n[145.11]K[272.20]AGFAGDDAPR n[145.11]K[272.20]PVSLSYR n[145.11]LADAINTEFK[272.20]NTR n[145.11]LDADPSLQR n[145.11]LGSDAELQIER n[145.11]LHLGVTPSVIR n[145.11]LIK[272.20]TVETR n[145.11]LISTLILVILSYTYIIR n[145.11]LRPGDC[160.03]EVC[160.03]ISYLGR n[145.11]LSGAPQASAADVVVVHGR n[145.11]LYGK[272.20]APQTPYDK[272.20]PTR n[145.11]MDK[272.20]SELVQK[272.20]AK[272.20]LAEQAER n[145.11]MIEVVC[160.03]NDR n[145.11]MK[272.20]FNPFVTSDR n[145.11]MPPYTVVYFPVR n[145.11]MQPASAK[272.20]WYDR n[145.11]NIQGITK[272.20]PAIR n[145.11]PAVSK[272.20]GDGMR n[145.11]PDYLGADQR n[145.11]PFLELDTNLPANR n[145.11]PGPTPSGTNVGSSGR n[145.11]PGVTVK[272.20]DVNQQEFVR n[145.11]PMFIVNTNVPR n[145.11]PPYTVVYFPVR n[145.11]PQYQTWEEFSR n[145.11]PTVEELYR n[145.11]PVAGSELPR n[145.11]SAINEVVTR n[145.11]SAPGEDEEC[160.03]GR n[145.11]SAPLAAGC[160.03]PDR n[145.11]SDVLELTDDNFESR n[145.11]SGQGAFGNMC[160.03]R n[145.11]SGSMDPSGAHPSVR n[145.11]SGTLGHPGSLDETTYER n[145.11]SGYLAGDK[272.20]LLPQR n[145.11]SHGSQETDEEFDAR n[145.11]SK[272.20]FADLSEAANR n[145.11]SK[272.20]LVVITQGR n[145.11]SMPPAQQQITSGQMHR n[145.11]SPALTIENEHIR  iTRAQ 114/ iTRAQ 115 2.38 1.59 1.13 0.67 1.66 1.76 2.72 1.82 1.58 1.90 2.87 2.42 2.17 0.20 15.08 4.37 1.27 1.61 1.35 1.83 2.55 3.60 1.72 2.26 2.90 2.65 1.58 1.77 1.57 1.91 1.66 0.83 1.46 1.12 1.84 0.74 0.71 1.56 1.68 5.10 1.93 1.70 1.76 1.68  IPI # IPI00028911 IPI00007750 IPI00014424 IPI00021428 IPI00008603 IPI00413781 IPI00418471 IPI00306959 IPI00182126 IPI00298237 IPI00418471 IPI00399342 IPI00328748 IPI00011522 IPI00014758 IPI00216318 IPI00013241 IPI00007144 IPI00219757 IPI00015029 IPI00453473 IPI00016621 IPI00021435 IPI00293867 IPI00220835 IPI00215780 IPI00293276 IPI00219757 IPI00216125 IPI00006684 IPI00103732 IPI00026302 IPI00217882 IPI00003176 IPI00025252 IPI00003918 IPI00008575 IPI00217745 IPI00219365 IPI00025086 IPI00418471 IPI00413916 IPI00298994 IPI00012989  200  N-termini Natural Natural Natural Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Natural Neo Neo Natural Neo Natural Natural Natural Neo Natural Natural Neo Neo Neo Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Neo Natural Natural Natural  Prob 0.95 0.92 0.98 0.95 0.98 1.00 0.99 1.00 0.88 0.99 0.91 0.99 0.95 1.00 0.90 0.87 1.00 1.00 1.00 0.88 0.97 0.99 1.00 0.98 0.88 1.00 0.97 1.00 0.98 0.97 0.93 1.00 0.88 1.00 0.99 1.00 0.99 0.98 0.91 1.00 0.92 0.99 0.98 0.91  z 3 2 4 2 2 3 2 3 2 3 3 3 2 2 3 3 3 2 3 3 2 2 3 3 3 3 3 3 2 2 2 3 2 10 3 2 3 3 3 2 3 3 2 2  Precursor Mass 1260.6825 1219.567 2310.2565 1165.5198 1146.5764 1901.8274 1172.6141 1800.954 1221.5552 1481.8581 1497.8182 1253.6408 1260.5637 1796.7846 2236.1498 1371.7874 1671.9087 1483.7179 1432.745 1612.9069 949.436 1234.6465 1457.8546 2158.2655 1726.002 1720.7853 1909.9382 1556.6404 1116.6093 1584.7545 1328.6532 1797.0347 1231.7166 2157.0034 1822.7568 1750.7767 2207.0452 1786.9527 1267.6455 1661.7797 1570.6482 2695.314 1253.6022 1259.6552  Error [Da] -0.0276 -0.0247 -0.053 -0.0139 -0.0353 -0.0433 -0.0126 -0.0437 -0.0195 -0.0336 -0.0325 -0.019 -0.025 -0.0601 -0.1169 -0.0244 -0.068 -0.0618 -0.0367 -0.0508 -0.0049 -0.0322 -0.0263 -0.0762 -0.0235 -0.0434 -0.0705 -0.0403 -0.0284 -0.0792 -0.1005 -0.0369 -0.0611 -0.1122 -0.0159 -0.036 -0.1085 -0.0254 -0.0187 -0.022 -0.0297 -0.0737 -0.0355 -0.0295  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[145.11]SPVLHFYVR n[145.11]SQDASDGLQR n[145.11]SSVLASC[160.03]PK[272.20]K[272.20]PVSSYLR n[145.11]SSVMC[160.03]PDAR n[145.11]STAAQQELR n[145.11]STAYEDYYYHPPPR n[145.11]STHTLDLSR n[145.11]SVPAAEPEYPK[272.20]GIR n[145.11]SYSPEPDQR n[145.11]TAAAPK[272.20]AGPGVVR n[145.11]TEAPLNPK[272.20]ANR n[145.11]TINGHNAEVR n[145.11]TPAPETC[160.03]EGR n[145.11]TTFNIQDGPDFQDR n[145.11]TTIAGVVYK[272.20]DGIVLGADTR n[145.11]TTTLAFK[272.20]FR n[145.11]VDVSK[272.20]PDLTAALR n[145.11]VDYYEVLGVQR n[145.11]VK[272.20]MAAAGGGGGGGR n[145.11]VMEK[272.20]PSPLLVGR n[145.11]VNDGDMR n[145.11]VNFTVDQIR n[145.11]VSK[272.20]PDLTAALR n[145.11]VSK[272.20]PTLK[272.20]EVVIVSATR n[145.11]YALSGSVWK[272.20]K[272.20]R n[145.11]YDEAAARPDPGYPR n[145.11]YSAPWK[272.20]PTWPAYR n[145.11]YYGYDYHNYR n[43.02]AAAAVSSAK[272.20]R n[43.02]AATASAGAGGIDGK[272.20]PR n[43.02]AATTGSGVK[272.20]VPR n[43.02]AAVK[272.20]TLNPK[272.20]AEVAR n[43.02]AAYK[272.20]LVLIR n[43.02]AC[160.03]GLVASNLNLK[272.20]PGEC[160.03]LR n[43.02]ADEGK[272.20]SYSEHDDER n[43.02]ADK[272.20]EAAFDDAVEER n[43.02]ADK[272.20]MDMSLDDIIK[272.20]LNR n[43.02]ADVVVGK[272.20]DK[272.20]GGEQR n[43.02]AEAELHK[272.20]ER n[43.02]AEFTSYK[272.20]ETASSR n[43.02]AEK[272.20]FDC[160.03]HYC[160.03]R n[43.02]AELVQGQSAPVGMK[272.20]AEGFVDALHR n[43.02]AESSDK[272.20]LYR n[43.02]AEVEETLK[272.20]R  iTRAQ 114/ iTRAQ 115 1.64 1.37 6.50 1.91 1.32 0.64 1.40 2.64 1.39 1.00 2.33 2.11 1.67 1.76 2.52 1.65 2.56 1.34 1.62 2.60 1.64 1.27 1.98 2.70 6.18 20.68 2.14 1.54 1.64 14.53 1.37 1.50 1.49 2.63 10.85 1.55 3.20 2.69 7.40 4.68 1.90 4.48 1.45 2.80  IPI # IPI00004534 IPI00009276 IPI00020928 IPI00182138 IPI00019502 IPI00012074 IPI00023673 IPI00172460 IPI00298237 IPI00017596 IPI00008603 IPI00386854 IPI00030241 IPI00017799 IPI00003217 IPI00375704 IPI00418471 IPI00024523 IPI00027834 IPI00009057 IPI00023673 IPI00186290 IPI00418471 IPI00030363 IPI00014758 IPI00014758 IPI00026941 IPI00018140 IPI00220567 IPI00219729 IPI00472498 IPI00027626 IPI00374975 IPI00219219 IPI00033153 IPI00328319 IPI00328840 IPI00010158 IPI00032064 IPI00296830 IPI00014398 IPI00063245 IPI00449049 IPI00063849  201  N-termini Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Neo Natural Natural Neo Natural Natural Natural Natural Natural Natural Neo Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural  Prob 0.98 0.86 0.98 1.00 1.00 0.93 0.87 0.98 0.98 0.91 0.98 0.99 0.97 0.94 1.00 1.00 1.00 0.99 0.99 1.00 0.98 0.97 0.97 1.00 0.82 0.99 0.96 1.00 1.00 0.66 1.00 0.82 1.00 0.83 1.00 0.97 0.97 0.99 1.00 0.98 0.94 0.99 0.99 1.00  z 4 3 2 3 2 3 2 3 3 2 2 3 2 2 2 3 2 3 2 4 3 2 4 3 3 3 2 3 2 3 3 3 3 3 4 3 3 2 3 2 3 2 3 2  Precursor Mass 2324.1549 1442.8455 1343.6399 2073.0808 1342.641 1578.7674 1403.7009 1514.8366 1473.7912 1352.642 1185.635 1699.9229 1587.7153 1270.6556 1393.6798 2437.2088 1755.7678 1831.9967 1499.7051 2047.9958 2994.303 1656.8493 2574.2508 2547.294 2314.9547 1917.9259 1411.7694 2589.3148 1630.8001 2006.1372 2301.9432 1443.7443 2087.0705 1986.0333 2402.1643 2289.1761 1993.9834 1731.8477 2368.1308 1134.5827 1843.9584 1439.7107 1877.1025 1678.7666  Error [Da] -0.1183 -0.0362 -0.1498 -0.0766 -0.1277 -0.0537 -0.0368 -0.0294 -0.0482 -0.0207 -0.0237 -0.0348 -0.0284 -0.0561 -0.0269 -0.1155 -0.0429 -0.028 -0.0686 -0.0715 -0.0787 -0.0494 -0.1656 -0.1117 -0.1 -0.045 -0.0283 -0.1379 -0.0716 -0.0373 -0.1378 -0.0305 -0.0442 -0.0954 -0.0725 -0.0966 -0.0366 -0.065 -0.0659 -0.029 -0.0299 -0.038 -0.0282 -0.0621  N-term Modification Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[43.02]AFK[272.20]DTGK[272.20]TPVEPEVAIHR n[43.02]AGIAAK[272.20]LAK[272.20]DR n[43.02]AGITTIEAVK[272.20]R n[43.02]AGK[272.20]QAVSASGK[272.20]WLDGIR n[43.02]AGLNSLEAVK[272.20]R n[43.02]AK[272.20]HHPDLIFC[160.03]R n[43.02]AK[272.20]ISSPTETER n[43.02]AK[272.20]PLTDQEK[272.20]R n[43.02]AK[272.20]PLTDSEK[272.20]R n[43.02]ANK[272.20]GPSYGMSR n[43.02]ANNDAVLK[272.20]R n[43.02]AQAK[272.20]INAK[272.20]ANEGR n[43.02]AQDQGEK[272.20]ENPMR n[43.02]AQNLK[272.20]DLAGR n[43.02]AQYK[272.20]GAASEAGR n[43.02]ASGVAVSDGVIK[272.20]VFNDMK[272.20]VR n[43.02]ASK[272.20]EMFEDTVEER n[43.02]ASSDIQVK[272.20]ELEK[272.20]R n[43.02]AVTLDK[272.20]DAYYR n[43.02]AWK[272.20]SGGASHSELIHNLR n[43.02]EEEIAALVIDNGSGMC[160.03]K[272.20]AGFAGDDAPR n[43.02]MDGIVPDIAVGTK[272.20]R n[43.02]MDK[272.20]NELVQK[272.20]AK[272.20]LAEQAER n[43.02]MDK[272.20]SELVQK[272.20]AK[272.20]LAEQAER n[43.02]MDWVMK[272.20]HNGPNDASDGTVR n[43.02]MEEEGVK[272.20]EAGEK[272.20]PR n[43.02]MEK[272.20]PSPLLVGR n[43.02]MEK[272.20]TELIQK[272.20]AK[272.20]LAEQAER n[43.02]MEK[272.20]TLETVPLER n[43.02]MEMK[272.20]K[272.20]K[272.20]INLELR n[43.02]MESGFTSK[272.20]DTYLSHFNPR n[43.02]MK[272.20]K[272.20]SYSGGTR n[43.02]MNNQK[272.20]QQK[272.20]PTLSGQR n[43.02]MNQEK[272.20]LAK[272.20]LQAQVR n[43.02]MQSNK[272.20]TFNLEK[272.20]QNHTPR n[43.02]SDK[272.20]LPYK[272.20]VADIGLAAWGR n[43.02]SDK[272.20]PDLSEVEK[272.20]FDR n[43.02]SDSEK[272.20]LNLDSIIGR n[43.02]SK[272.20]K[272.20]ISGGSVVEMQGDEMTR n[43.02]SK[272.20]NTVSSAR n[43.02]SK[272.20]SESPK[272.20]EPEQLR n[43.02]SK[272.20]SFQQSSLSR n[43.02]SK[272.20]SLK[272.20]K[272.20]LVEESR n[43.02]SQAEFEK[272.20]AAEEVR  iTRAQ 114/ iTRAQ 115 3.20 9.80 1.81 6.30 1.44 1.67 1.74 1.56 2.30 1.44 4.72 3.69 4.58 22.80 2.12 2.87 1.54 2.46 1.65 2.03 1.36 2.21 4.41 4.75 1.01 5.30 1.84 3.99 1.52 3.93 1.74 4.11 2.34 2.41 3.13 3.00 2.34 0.76 2.40 1.31 2.10 1.28 2.69 1.63  IPI # IPI00012493 IPI00289758 IPI00218319 IPI00220416 IPI00010779 IPI00005511 IPI00013895 IPI00783313 IPI00004358 IPI00216138 IPI00006252 IPI00000643 IPI00376798 IPI00027252 IPI00030098 IPI00012011 IPI00395865 IPI00479997 IPI00026970 IPI00411680 IPI00021440 IPI00179964 IPI00021263 IPI00216318 IPI00013877 IPI00332493 IPI00009057 IPI00018146 IPI00396378 IPI00165393 IPI00027681 IPI00784614 IPI00180128 IPI00221035 IPI00304596 IPI00012007 IPI00167110 IPI00027423 IPI00027223 IPI00007280 IPI00215965 IPI00017297 IPI00017256 IPI00010182  202  N-termini Natural Natural Natural Neo Neo  Prob 1.00 0.82 0.94 0.97 0.76  z 2 3 3 2 3  Precursor Mass 1633.8133 2499.206 2092.0825 1569.8446 1435.7538  Error [Da] -0.0374 -0.0897 -0.0518 -0.0401 -0.0618  N-term Modification Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[43.02]SSK[272.20]TASTNNIAQAR n[43.02]SSTQFNK[272.20]GPSYGLSAEVK[272.20]NR n[43.02]TVGK[272.20]SSK[272.20]MLQHIDYR n[43.02]VDVSK[272.20]PDLTAALR n[43.02]YQK[272.20]STELLIR  iTRAQ 114/ iTRAQ 115 1.51 2.09 2.68 1.47 1.15  IPI # IPI00221232 IPI00015262 IPI00027285 IPI00418471 IPI00171611  203  Appendix B.9 Peptides identified by iTRAQ-TAILS in conditioned medium of HMEC2. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 114) or sMT6EΔA (iTRAQ 115) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. N-termini Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Natural Neo Neo Neo Natural Neo Natural Natural Natural Neo Neo Natural Natural Natural Neo Natural Neo Neo Neo Neo Neo Neo Neo Neo Neo  Prob 1.00 1.00 1.00 1.00 1.00 0.89 1.00 1.00 1.00 0.99 1.00 0.97 0.98 0.96 0.99 0.96 0.99 0.99 0.97 1.00 0.95 0.89 0.87 0.88 1.00 0.90 1.00 0.96 0.89 0.99 1.00 0.97 1.00 1.00 1.00 0.88  z 3 3 3 2 2 3 2 2 3 3 2 2 3 3 3 2 3 3 2 2 3 2 2 3 3 2 3 2 3 3 3 4 3 3 3 2  Precursor Mass 1757.8896 1666.8285 1774.856 1550.6784 1319.493 1732.8508 1710.691 1119.4826 2468.1535 1949.0393 1431.655 968.5325 1480.7483 1302.7149 1504.7377 1214.5244 2187.9221 1360.6871 1100.5485 1324.5669 2020.0742 952.4375 989.5133 2515.007 1664.777 1273.5629 2264.9178 987.4341 1383.6627 1612.8745 1641.7605 2414.0738 2538.9121 1687.8258 2024.8206 1032.4818  Error [Da] -0.0732 -0.0592 -0.0857 -0.1023 -0.0777 -0.0689 -0.1393 -0.0601 -0.1328 -0.0874 -0.0898 -0.0562 -0.0758 -0.035 -0.1076 -0.0773 -0.2081 -0.0466 -0.0572 -0.0828 -0.1052 -0.0472 -0.0494 -0.1817 -0.0717 -0.0758 -0.1669 -0.0406 -0.0237 -0.0759 -0.0592 -0.1036 -0.1396 -0.0729 -0.0811 -0.0504  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]AAQTSPSPK[272.20]AGAATGR n[145.11]ADAINTEFK[272.20]NTR n[145.11]ADANLEAGNVK[272.20]ETR n[145.11]ADGTQTVNYVPSR n[145.11]AEGPDEDSSNR n[145.11]AENQVELEEK[272.20]TR n[145.11]AGASATFPMQC[160.03]SALR n[145.11]AGFAGDDAPR n[145.11]AGGAAQLALDK[272.20]SDSHPSDALTR n[145.11]AGGTEIGK[272.20]TLAEK[272.20]SR n[145.11]AGMAMAGQSPVLR n[145.11]AGPAAAVLR n[145.11]AINTEFK[272.20]NTR n[145.11]AK[272.20]LAEQAER n[145.11]ALK[272.20]GTNESLER n[145.11]APDQDEIQR n[145.11]APGLQC[160.03]HPPK[272.20]DDEAPLR n[145.11]APPAAGQQQPPR n[145.11]AQTAAATAPR n[145.11]ASEGGFTATGQR n[145.11]ASGK[272.20]IEK[272.20]YNVPLNR n[145.11]ASQNSFR n[145.11]ASVATELR n[145.11]C[160.03]TC[160.03]VPPHPQTAFC[160.03]NSDLVIR n[145.11]DAPEEEDHVLVLR n[145.11]DATSPLQENR n[145.11]DDEVDVDGTVEEDLGK[272.20]SR n[145.11]DDGEVGPR n[145.11]DENEHQLSLR n[145.11]DNIQGITK[272.20]PAIR n[145.11]DSYVGDEAQSK[272.20]R n[145.11]DTAENETTEK[272.20]EEK[272.20]SESR n[145.11]DVK[272.20]C[160.03]DMEVSC[160.03]PDGYTC[160.03]C[160.03]R n[145.11]EAPK[272.20]VVEEQESR n[145.11]EDGDEDEEAESATGK[272.20]R n[145.11]EEGAAVASR  iTRAQ 114/ iTRAQ 115 0.81 0.93 0.99 0.77 0.98 0.72 1.05 0.60 0.93 0.81 0.81 4.30 0.78 0.60 0.81 0.91 0.40 0.53 0.76 0.51 0.90 1.03 16.95 0.81 0.77 1.18 0.56 0.62 0.55 0.86 0.64 0.58 0.82 0.79 0.64 0.68  IPI # IPI00303476 IPI00418471 IPI00328113 IPI00302592 IPI00009904 IPI00000184 IPI00376005 IPI00008603 IPI00028031 IPI00029400 IPI00179964 IPI00292936 IPI00418471 IPI00000816 IPI00418471 IPI00021794 IPI00029235 IPI00002802 IPI00294911 IPI00003351 IPI00008918 IPI00296053 IPI00013874 IPI00032292 IPI00010796 IPI00002214 IPI00027230 IPI00477611 IPI00220740 IPI00453473 IPI00008603 IPI00014516 IPI00181753 IPI00032258 IPI00385149 IPI00019439  204  N-termini Natural Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Natural Natural Neo Neo Neo Neo Neo Neo Neo Neo Neo Natural Neo Neo Neo Neo Neo Neo Natural Neo Natural Natural Natural Natural Neo Natural Natural Natural  Prob 0.98 0.96 0.98 0.86 0.85 0.99 1.00 1.00 1.00 1.00 1.00 0.96 1.00 1.00 0.99 1.00 0.99 0.99 0.98 0.99 0.92 0.97 1.00 0.95 0.96 0.93 1.00 0.99 1.00 0.96 0.98 0.88 1.00 1.00 1.00 0.81 0.92 0.92 0.97 1.00 0.96 0.98 1.00 1.00  z 2 2 3 2 2 2 2 2 2 3 2 3 2 3 3 2 3 3 3 2 3 2 2 3 3 2 2 3 4 3 3 3 3 3 3 2 2 3 3 3 4 3 3 2  Precursor Mass 1398.6069 1275.5586 1429.7449 1316.5509 995.4225 991.4251 1108.4706 1396.5538 1522.626 1398.6694 1293.5149 1413.7541 1523.6096 1844.7682 2568.9577 1048.4639 1551.7261 1648.8947 1691.7932 1061.4933 1516.797 1249.4881 1364.6457 1477.7392 1750.8106 943.4834 1457.5554 1437.6549 1670.8654 1271.7442 1474.7467 1236.7093 1347.6758 2001.0496 2040.9729 942.4974 1207.4643 1349.7589 1639.7668 1861.7866 3052.562 1304.6745 2003.0072 1613.6397  Error [Da] -0.0788 -0.0591 -0.0432 -0.0756 -0.0422 -0.0596 -0.0561 -0.0799 -0.1057 -0.0433 -0.0588 -0.0466 -0.0911 -0.0875 -0.268 -0.0418 -0.0556 -0.116 -0.0685 -0.0474 -0.0669 -0.0776 -0.071 -0.0585 -0.1772 -0.0373 -0.2043 -0.0574 -0.0442 -0.0363 -0.0516 -0.0344 -0.0379 -0.0971 -0.1208 -0.0394 -0.0614 -0.0358 -0.0716 -0.0791 -0.1649 -0.0369 -0.0972 -0.12  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]EEQPPETAAQR n[145.11]ENGAEASADLR n[145.11]ENK[272.20]GATAAPQR n[145.11]EQAPGTAPC[160.03]SR n[145.11]EVC[160.03]MASR n[145.11]FAGDDAPR n[145.11]FDSDAASPR n[145.11]FGSDQSENVDR n[145.11]FMGNTGPTGAVGDR n[145.11]FVGGAENTAHPR n[145.11]GAETEVDC[160.03]NR n[145.11]GAK[272.20]PEPVAMAR n[145.11]GAQTQTEEEMTR n[145.11]GENTSNMTHLEAQNR n[145.11]GETGHVAINC[160.03]SK[272.20]TSEVNC[160.03]YR n[145.11]GFAGDDAPR n[145.11]GHQQLYWSHPR n[145.11]GK[272.20]VK[272.20]VGVNGFGR n[145.11]GMNAPK[272.20]GQTGNSSR n[145.11]GPNIC[160.03]TTR n[145.11]GPVLGLK[272.20]EC[160.03]TR n[145.11]GSDQSENVDR n[145.11]GTQTVNYVPSR n[145.11]GTVEEDLGK[272.20]SR n[145.11]GVK[272.20]K[272.20]FDVPC[160.03]GGR n[145.11]GVPVEGSR n[145.11]GVQVETISPGDGR n[145.11]HWPSEPSEAVR n[145.11]K[272.20]FVGGAENTAHPR n[145.11]K[272.20]PDLTAALR n[145.11]K[272.20]PQSSSTEPAR n[145.11]K[272.20]PVSLSYR n[145.11]K[272.20]QTDFEHR n[145.11]K[272.20]TTTLSGTAPAAGVVPSR n[145.11]K[272.20]VEQAVETEPEPELR n[145.11]LANTQPR n[145.11]MGGEQEEER n[145.11]MK[272.20]LTDSVLR n[145.11]MQPASAK[272.20]WYDR n[145.11]NEGSVTGSC[160.03]YC[160.03]GK[272.20]R n[145.11]NVNFQK[272.20]AINEK[272.20]LGQYASPTAK[272.20]R n[145.11]PAVSK[272.20]GDGMR n[145.11]PGVTVK[272.20]DVNQQEFVR n[145.11]PQYQTWEEFSR  iTRAQ 114/ iTRAQ 115 0.85 0.73 0.40 0.69 0.89 0.66 0.90 0.79 0.65 1.09 1.75 0.66 0.87 0.67 0.74 0.79 0.76 0.86 0.86 0.75 0.70 0.60 0.97 0.89 0.70 0.70 0.74 0.65 0.84 0.42 0.41 0.63 0.86 0.55 0.47 0.75 0.86 0.67 0.86 0.51 0.42 0.56 1.14 0.75  IPI # IPI00386755 IPI00219365 IPI00170786 IPI00010277 IPI00166039 IPI00008603 IPI00004657 IPI00258804 IPI00306322 IPI00029236 IPI00029723 IPI00013290 IPI00029723 IPI00010414 IPI00430812 IPI00008603 IPI00182289 IPI00219018 IPI00012079 IPI00220350 IPI00012503 IPI00258804 IPI00302592 IPI00027230 IPI00306322 IPI00031801 IPI00413778 IPI00028911 IPI00029236 IPI00418471 IPI00013290 IPI00413781 IPI00009790 IPI00220113 IPI00021842 IPI00020513 IPI00550746 IPI00152695 IPI00015029 IPI00004946 IPI00032258 IPI00016621 IPI00215780 IPI00216125  205  N-termini Natural Neo Natural Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Natural Natural Neo Neo Neo Neo Neo Neo Natural Neo Neo Neo Neo Neo Natural Neo Neo Neo Neo Natural Neo Neo Natural Neo Neo Neo Natural Neo  Prob 0.94 1.00 1.00 0.98 0.99 0.96 0.93 1.00 1.00 1.00 0.90 1.00 0.88 0.99 0.92 0.99 0.91 0.98 1.00 0.98 0.87 1.00 0.91 0.99 0.98 1.00 0.90 0.96 1.00 0.81 0.87 0.95 0.94 0.99 0.94 0.91 0.98 0.99 0.97 0.97 0.90 1.00 0.93 0.99  z 2 3 2 2 2 3 3 3 3 3 3 3 3 3 4 3 3 2 3 2 2 3 2 3 4 4 2 3 2 2 3 2 3 3 3 2 2 3 3 3 2 3 2 2  Precursor Mass 1149.5511 2145.0531 1349.5069 1257.556 1755.712 1588.809 1717.943 1620.7819 2019.9273 1527.6798 1492.7739 1595.7666 1387.8057 1358.7597 2183.1497 2328.0107 1260.6605 1219.5316 1467.731 1146.5606 1094.4477 1800.9143 1221.514 1481.8394 1889.0118 2002.0467 1260.532 1691.9062 1465.6108 1160.5682 2194.0932 1058.5433 1671.8443 2340.1746 1432.7138 949.4001 1512.6529 1457.8075 1725.9471 1681.794 1006.4799 1436.7759 1116.5229 1652.7729  Error [Da] -0.0641 -0.0963 -0.0568 -0.0697 -0.1429 -0.0574 -0.0887 -0.0638 -0.0975 -0.0424 -0.035 -0.0841 -0.07 -0.0528 -0.0639 -0.132 -0.0496 -0.0599 -0.0606 -0.0511 -0.0494 -0.0834 -0.0608 -0.0523 -0.0578 -0.0705 -0.057 -0.0582 -0.0849 -0.0589 -0.1325 -0.0524 -0.1324 -0.1411 -0.0679 -0.0406 -0.0948 -0.0734 -0.0784 -0.0728 -0.0408 -0.0468 -0.1148 -0.0988  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ Ac-lysine Ac-lysine  Peptide n[145.11]PTVEELYR n[145.11]SAAQAAAQTNSNAAGK[272.20]QLR n[145.11]SAPGEDEEC[160.03]GR n[145.11]SAPLAAGC[160.03]PDR n[145.11]SATAGSEGGFLAPEYR n[145.11]SEETPAISPSK[272.20]R n[145.11]SGAGLK[272.20]WK[272.20]NVAR n[145.11]SGGASHSELIHNLR n[145.11]SGPPVFAPSNHVSEAQPR n[145.11]SGSMDPSGAHPSVR n[145.11]SGSSESPASLK[272.20]R n[145.11]SK[272.20]FADLSEAANR n[145.11]SK[272.20]LVVITQGR n[145.11]SK[272.20]PDLTAALR n[145.11]SK[272.20]VGSTENIK[272.20]HQPGGGR n[145.11]SLAGSSGPGASSGTSGDHGELVVR n[145.11]SPVLHFYVR n[145.11]SQDASDGLQR n[145.11]SQLLGSAHEVQR n[145.11]STAAQQELR n[145.11]SVMC[160.03]PDAR n[145.11]SVPAAEPEYPK[272.20]GIR n[145.11]SYSPEPDQR n[145.11]TAAAPK[272.20]AGPGVVR n[145.11]TENSTSAPAAK[272.20]PK[272.20]R n[145.11]TK[272.20]EAEGAPQVEAGK[272.20]R n[145.11]TPAPETC[160.03]EGR n[145.11]TPSGTNSGAGK[272.20]K[272.20]R n[145.11]TSEMVNGATEQR n[145.11]TTAAQQELR n[145.11]TVGK[272.20]SSK[272.20]MLQHIDYR n[145.11]VASVQQQR n[145.11]VDVSK[272.20]PDLTAALR n[145.11]VGVDTK[272.20]HQTLQGVAFPISR n[145.11]VK[272.20]MAAAGGGGGGGR n[145.11]VNDGDMR n[145.11]VPTQC[160.03]DVPPNSR n[145.11]VSK[272.20]PDLTAALR n[145.11]YALSGSVWK[272.20]K[272.20]R n[145.11]YQGPVGDPDK[272.20]YR n[145.11]YVEPAER n[145.11]YVPSTTK[272.20]TPR n[43.02]AAAAVSSAK[272.20]R n[43.02]AAPAQQTTQPGGGK[272.20]R  iTRAQ 114/ iTRAQ 115 0.68 0.52 0.78 0.76 0.52 0.67 0.61 0.70 0.77 0.63 0.50 0.61 0.54 0.65 0.65 1.04 0.78 0.88 1.00 0.90 1.27 0.78 0.75 0.55 0.81 0.86 0.73 1.01 0.87 0.75 0.89 0.65 0.55 0.91 0.71 0.78 0.98 0.67 0.48 30.31 0.51 0.67 1.05 0.63  IPI # IPI00006684 IPI00410693 IPI00217882 IPI00003176 IPI00019439 IPI00375015 IPI00010882 IPI00411680 IPI00332493 IPI00008575 IPI00220592 IPI00418471 IPI00413916 IPI00418471 IPI00220113 IPI00023048 IPI00004534 IPI00009276 IPI00744706 IPI00019502 IPI00182138 IPI00172460 IPI00298237 IPI00017596 IPI00550239 IPI00014516 IPI00030241 IPI00003386 IPI00005614 IPI00397526 IPI00027285 IPI00106668 IPI00418471 IPI00183508 IPI00027834 IPI00023673 IPI00293088 IPI00418471 IPI00014758 IPI00014758 IPI00013897 IPI00011875 IPI00220567 IPI00465054  206  N-termini Natural Natural Natural Natural Natural Neo Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural  Prob 1.00 0.99 0.91 0.93 0.88 0.95 0.87 0.97 0.94 0.96 0.99 0.99 0.98 0.88 0.97 1.00 0.97 0.98 0.92 1.00 0.92 1.00  z 2 3 3 2 2 3 3 2 3 2 2 2 3 3 4 3 2 3 2 2 2 3  Precursor Mass 1328.6557 2137.9548 1796.968 1387.6098 1459.5914 1570.6049 1475.761 1403.6539 1473.7952 1352.5875 1587.6366 1393.6281 1831.8896 1788.8726 2402.1155 2368.0526 1134.5405 1843.9029 1408.6749 1633.7452 1429.5226 1786.8867  Error [Da] -0.098 -0.0899 -0.1037 -0.0715 -0.0933 -0.073 -0.0477 -0.0839 -0.0445 -0.0752 -0.1067 -0.0786 -0.1351 -0.0735 -0.1213 -0.1441 -0.0712 -0.0854 -0.0795 -0.1055 -0.0974 -0.0914  N-term Modification Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[43.02]AATTGSGVK[272.20]VPR n[43.02]AAVK[272.20]DSC[160.03]GK[272.20]GEMATGNGR n[43.02]AAVK[272.20]TLNPK[272.20]AEVAR n[43.02]ADNEK[272.20]LDNQR n[43.02]ADQGEK[272.20]ENPMR n[43.02]AEK[272.20]FDC[160.03]HYC[160.03]R n[43.02]AHYK[272.20]AADSK[272.20]R n[43.02]AK[272.20]ISSPTETER n[43.02]AK[272.20]PLTDSEK[272.20]R n[43.02]ANK[272.20]GPSYGMSR n[43.02]AQDQGEK[272.20]ENPMR n[43.02]AQYK[272.20]GAASEAGR n[43.02]ASSDIQVK[272.20]ELEK[272.20]R n[43.02]ATEEK[272.20]K[272.20]PETEAAR n[43.02]MQSNK[272.20]TFNLEK[272.20]QNHTPR n[43.02]SK[272.20]K[272.20]ISGGSVVEMQGDEMTR n[43.02]SK[272.20]NTVSSAR n[43.02]SK[272.20]SESPK[272.20]EPEQLR n[43.02]SQPGQK[272.20]PAASPR n[43.02]SSK[272.20]TASTNNIAQAR n[43.02]SSNEC[160.03]FK[272.20]C[160.03]GR n[43.02]TENSTSAPAAK[272.20]PK[272.20]R  iTRAQ 114/ iTRAQ 115 0.75 0.83 0.61 1.01 0.58 0.72 0.61 0.79 1.22 0.81 2.00 0.74 0.81 0.95 0.60 0.75 0.70 0.63 0.86 0.70 0.79 0.90  IPI # IPI00472498 IPI00334159 IPI00027626 IPI00012578 IPI00746438 IPI00014398 IPI00554793 IPI00013895 IPI00004358 IPI00216138 IPI00376798 IPI00030098 IPI00479997 IPI00005492 IPI00304596 IPI00027223 IPI00007280 IPI00215965 IPI00760715 IPI00221232 IPI00430813 IPI00550239  207  Appendix B.10 Peptides identified by iTRAQ-TAILS in membrane fractions of HMEC1xHMEC2. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 116) or sMT6EΔA (iTRAQ 117) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated.  N-termini Natural Natural Neo Neo Natural Neo Neo Neo Neo Neo Neo Natural Neo Neo Natural Natural Natural Neo Natural Natural Natural Natural Neo Neo Neo Natural Natural Neo Natural Neo Neo Neo Neo  Prob 1.00 0.99 1.00 0.99 1.00 1.00 1.00 0.99 1.00 1.00 1.00 1.00 1.00 0.99 1.00 0.96 0.88 1.00 1.00 1.00 1.00 1.00 0.89 0.98 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.99  z 2 2 3 2 3 3 3 2 2 2 3 3 2 3 3 2 3 4 3 2 3 2 2 2 3 3 3 4 3 3 3 3 2  Precursor Mass 1451.7554 1200.5305 1757.9215 1254.7116 1743.8892 1666.8534 1774.856 1199.5159 1319.493 1119.5127 2468.1535 1692.8532 1431.7123 1504.7377 1997.0869 1214.588 1293.7654 1850.9669 1969.0164 1100.5873 1855.9327 1916.7826 952.4375 1208.5982 1595.83 1664.8005 2264.9178 2885.3433 1503.7384 1589.7966 1612.9356 2554.9764 1330.6684  Error [Da] -0.0413 -0.0552 -0.0412 -0.0301 -0.0695 -0.0343 -0.0857 -0.0208 -0.0777 -0.03 -0.1328 -0.0495 -0.0324 -0.1076 -0.0644 -0.0137 -0.0363 -0.0568 -0.0712 -0.0184 -0.071 -0.1371 -0.0472 -0.0285 -0.0207 -0.0482 -0.1669 -0.1971 -0.0533 -0.0291 -0.0148 -0.0703 -0.0163  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]AAAGAAATHLEVAR n[145.11]AANYSSTSTR n[145.11]AAQTSPSPK[272.20]AGAATGR n[145.11]AATLILEPAGR n[145.11]AAVAATAAAK[272.20]GNGGGGGR n[145.11]ADAINTEFK[272.20]NTR n[145.11]ADANLEAGNVK[272.20]ETR n[145.11]AEFSSEAC[160.03]R n[145.11]AEGPDEDSSNR n[145.11]AGFAGDDAPR n[145.11]AGGAAQLALDK[272.20]SDSHPSDALTR n[145.11]AGGEAGVTLGQPHLSR n[145.11]AGMAMAGQSPVLR n[145.11]ALK[272.20]GTNESLER n[145.11]APAEILNGK[272.20]EISAQIR n[145.11]APDQDEIQR n[145.11]APEVLPK[272.20]PR n[145.11]APHNPAPPTSTVIHIR n[145.11]APSVPAAEPEYPK[272.20]GIR n[145.11]AQTAAATAPR n[145.11]ASGANFEYIIAEK[272.20]R n[145.11]ASGGGVPTDEEQATGLER n[145.11]ASQNSFR n[145.11]ASSPGGVYATR n[145.11]DAINTEFK[272.20]NTR n[145.11]DAPEEEDHVLVLR n[145.11]DDEVDVDGTVEEDLGK[272.20]SR n[145.11]DDLEALK[272.20]K[272.20]K[272.20]GC[160.03]PPDDIENPR n[145.11]DGVGGDPAVALPHR n[145.11]DNADSSPVVDK[272.20]R n[145.11]DNIQGITK[272.20]PAIR n[145.11]DVK[272.20]C[160.03]DMEVSC[160.03]PDGYTC[160.03]C[160.03]R n[145.11]EAGLETESPVR  iTRAQ 116/ iTRAQ 117 1.28 1.72 1.46 1.22 2.38 1.61 2.06 1.37 1.41 1.72 2.10 1.83 2.08 1.44 2.02 1.47 1.30 1.94 1.63 1.72 1.76 1.50 2.54 1.24 1.52 1.41 1.78 2.38 2.18 1.28 1.71 1.87 1.42  IPI IPI00465308 IPI00301280 IPI00303476 IPI00220906 IPI00384497 IPI00418471 IPI00328113 IPI00030877 IPI00009904 IPI00008603 IPI00028031 IPI00297982 IPI00179964 IPI00418471 IPI00218342 IPI00021794 IPI00015972 IPI00303726 IPI00172460 IPI00294911 IPI00024993 IPI00021785 IPI00296053 IPI00418471 IPI00418471 IPI00010796 IPI00027230 IPI00217561 IPI00026530 IPI00328753 IPI00453473 IPI00181753 IPI00009885  208  N-termini Neo Natural Natural Neo Natural Natural Neo Neo Neo Neo Natural Neo Neo Natural Neo Natural Natural Neo Neo Neo Neo Neo Neo Neo Neo Neo Natural Natural Natural Natural Natural Natural Natural Natural Natural Neo Natural Natural Natural Natural Natural Natural Natural Natural  Prob 0.99 0.98 0.98 0.88 0.96 1.00 1.00 0.74 1.00 1.00 1.00 1.00 0.99 0.99 0.96 1.00 0.99 0.99 0.84 0.99 1.00 1.00 0.97 1.00 0.92 1.00 0.91 1.00 1.00 0.97 0.99 1.00 0.99 1.00 0.97 0.99 0.98 0.92 1.00 1.00 1.00 0.99 1.00 1.00  z 2 2 3 2 3 2 3 3 3 2 2 2 3 3 4 3 3 2 3 2 2 2 3 10 3 3 2 3 3 2 3 2 2 3 3 3 3 3 3 2 3 2 2 3  Precursor Mass 1263.6006 1398.6561 1787.9424 1316.5959 1402.6743 1507.7234 1779.8166 1240.6123 1327.65 1396.6022 1127.6005 1238.6521 2568.9577 1551.7261 1785.9192 1671.8703 1648.8947 1061.5145 1428.7547 1229.653 1457.7455 1275.5715 1658.8092 1391.721 1236.7034 1334.7602 1019.5365 1937.8745 1424.816 1441.7582 1608.9102 1466.7272 1611.8261 1639.7881 1630.8429 1497.8898 1304.6745 1222.7357 1813.8548 1513.6791 2003.0287 1480.7627 1613.6974 1786.9826  Error [Da] -0.0171 -0.0296 -0.0793 -0.0308 -0.0544 -0.0613 -0.053 -0.0199 -0.0357 -0.0315 -0.0312 -0.0586 -0.268 -0.0556 -0.0425 -0.0485 -0.116 -0.0262 -0.0422 -0.0317 -0.0142 -0.0502 -0.0347 -0.0187 -0.0403 -0.0555 -0.0152 -0.0832 -0.0257 -0.0295 -0.0275 -0.0285 -0.0346 -0.0503 -0.0761 -0.0337 -0.0369 -0.0284 -0.0469 -0.0816 -0.0757 -0.057 -0.0623 -0.0471  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]EAGSTAGAAETR n[145.11]EEQPPETAAQR n[145.11]ENSTSAPAAK[272.20]PK[272.20]R n[145.11]EQAPGTAPC[160.03]SR n[145.11]ESAGADTRPTVR n[145.11]ESETTTSLVLER n[145.11]ETVHC[160.03]DLQPVGPER n[145.11]EVAPPEYHR n[145.11]EVHVSTVEER n[145.11]FGSDQSENVDR n[145.11]GAGGALFVHR n[145.11]GAPEVLVSAPR n[145.11]GETGHVAINC[160.03]SK[272.20]TSEVNC[160.03]YR n[145.11]GHQQLYWSHPR n[145.11]GK[272.20]AEELHYPLGER n[145.11]GK[272.20]DYYQTLGLAR n[145.11]GK[272.20]VK[272.20]VGVNGFGR n[145.11]GPNIC[160.03]TTR n[145.11]GQTFEYLK[272.20]R n[145.11]GQVITIGNER n[145.11]GVQVETISPGDGR n[145.11]GYSFTTTAER n[145.11]IWHHTFYNELR n[145.11]K[272.20]AGFAGDDAPR n[145.11]K[272.20]PVSLSYR n[145.11]LHLGVTPSVIR n[145.11]LPASFDAR n[145.11]LRPGDC[160.03]EVC[160.03]ISYLGR n[145.11]MAPEVLPK[272.20]PR n[145.11]MFLYNLTLQR n[145.11]MK[272.20]PILLQGHER n[145.11]MLSLDFLDDVR n[145.11]MPPYTVVYFPVR n[145.11]MQPASAK[272.20]WYDR n[145.11]MTK[272.20]GTSSFGK[272.20]R n[145.11]NIQGITK[272.20]PAIR n[145.11]PAVSK[272.20]GDGMR n[145.11]PEVLPK[272.20]PR n[145.11]PGHLQEGFGC[160.03]VVTNR n[145.11]PGPTPSGTNVGSSGR n[145.11]PGVTVK[272.20]DVNQQEFVR n[145.11]PPYTVVYFPVR n[145.11]PQYQTWEEFSR n[145.11]PSK[272.20]GPLQSVQVFGR  iTRAQ 116/ iTRAQ 117 1.76 1.46 1.45 1.90 1.79 1.44 1.71 1.82 1.19 1.40 1.47 1.42 1.64 1.32 1.54 1.50 1.82 1.57 1.73 1.87 1.16 1.56 1.78 1.84 2.43 1.64 1.38 1.08 1.74 1.65 1.51 1.26 2.33 1.96 1.83 1.54 1.67 1.44 2.40 1.99 2.32 1.77 1.88 2.10  IPI IPI00220002 IPI00386755 IPI00550239 IPI00010277 IPI00025796 IPI00029744 IPI00017567 IPI00409675 IPI00217683 IPI00258804 IPI00291328 IPI00143921 IPI00430812 IPI00182289 IPI00029628 IPI00015947 IPI00219018 IPI00220350 IPI00218337 IPI00003269 IPI00413778 IPI00021439 IPI00021428 IPI00008603 IPI00413781 IPI00298237 IPI00295741 IPI00328748 IPI00015972 IPI00179138 IPI00012795 IPI00104128 IPI00219757 IPI00015029 IPI00220871 IPI00453473 IPI00016621 IPI00015972 IPI00410693 IPI00220835 IPI00215780 IPI00219757 IPI00216125 IPI00221092  209  N-termini Natural Natural Natural Natural Natural Natural Neo Natural Neo Neo Neo Neo Neo Natural Natural Neo Natural Neo Neo Natural Natural Neo Neo Neo Natural Natural Neo Natural Natural Neo Neo Neo Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural  Prob 0.98 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.99 1.00 0.79 0.94 1.00 0.95 0.98 1.00 1.00 0.98 1.00 1.00 0.98 0.95 0.98 1.00 1.00 1.00 1.00 0.97 0.99 0.98 1.00 0.98 0.98 0.78 1.00 1.00 1.00 1.00 0.99 1.00 0.99 1.00 0.98 0.98  z 2 3 3 2 2 2 3 3 4 3 3 3 3 3 2 3 3 2 3 3 3 2 3 3 2 3 3 2 2 3 3 4 3 2 2 2 3 10 3 2 3 2 2 4  Precursor Mass 1149.5803 1695.9429 1982.9787 1349.5069 1714.7934 1782.7935 1962.8901 1750.6974 1980.9733 1875.9628 1578.7728 1387.8268 1522.7837 1260.6825 1219.5316 1467.7621 2177.1591 1146.5606 1901.8274 1469.7212 1466.7537 1260.5637 2038.2353 1671.9087 1483.7179 2405.3059 1432.745 949.436 1234.6465 1654.7528 2140.8295 2231.8266 1357.8135 1230.6062 1584.7349 1328.6557 1797.0347 2157.0034 1822.7568 1750.7767 2207.0452 1661.7797 1253.6022 2324.1549  Error [Da] -0.0344 -0.0488 -0.04 -0.0568 -0.0743 -0.0462 -0.0504 -0.0543 -0.0416 -0.0296 -0.0269 -0.0487 -0.0388 -0.0276 -0.0599 -0.0296 -0.0856 -0.0511 -0.0433 -0.0384 -0.044 -0.025 -0.0274 -0.068 -0.0618 -0.0458 -0.0367 -0.0049 -0.0322 -0.0365 -0.2062 -0.1454 -0.0514 -0.0415 -0.0993 -0.098 -0.0369 -0.1122 -0.0159 -0.036 -0.1085 -0.022 -0.0355 -0.1183  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[145.11]PTVEELYR n[145.11]PVPPLPEYGGK[272.20]VR n[145.11]QK[272.20]TGTAEMSSILEER n[145.11]SAPGEDEEC[160.03]GR n[145.11]SDMPPLTLEGIQDR n[145.11]SDVLELTDDNFESR n[145.11]SGTLGHPGSLDETTYER n[145.11]SHGSQETDEEFDAR n[145.11]SHTDIK[272.20]VPDFSEYR n[145.11]SIAAHLDNQVPVESPR n[145.11]SK[272.20]DGGAWGTEQR n[145.11]SK[272.20]LVVITQGR n[145.11]SPALTIENEHIR n[145.11]SPVLHFYVR n[145.11]SQDASDGLQR n[145.11]SQLLGSAHEVQR n[145.11]SSLGVVTC[160.03]GSVVK[272.20]LLNTR n[145.11]STAAQQELR n[145.11]STAYEDYYYHPPPR n[145.11]SVTVHSSEPEVR n[145.11]TGYTPDEK[272.20]LR n[145.11]TPAPETC[160.03]EGR n[145.11]VAAPK[272.20]VK[272.20]GGVDVTLPR n[145.11]VDVSK[272.20]PDLTAALR n[145.11]VDYYEVLGVQR n[145.11]VK[272.20]LTAELIEQAAQYTNAVR n[145.11]VK[272.20]MAAAGGGGGGGR n[145.11]VNDGDMR n[145.11]VNFTVDQIR n[145.11]VSGASNHQPNSNSGR n[145.11]WK[272.20]FEHC[160.03]NFNDVTTR n[145.11]YEC[160.03]GEK[272.20]GHYAYDC[160.03]HR n[43.02]AAAK[272.20]VALTK[272.20]R n[43.02]AAPSDGFK[272.20]PR n[43.02]AATASAGAGGIDGK[272.20]PR n[43.02]AATTGSGVK[272.20]VPR n[43.02]AAVK[272.20]TLNPK[272.20]AEVAR n[43.02]AC[160.03]GLVASNLNLK[272.20]PGEC[160.03]LR n[43.02]ADEGK[272.20]SYSEHDDER n[43.02]ADK[272.20]EAAFDDAVEER n[43.02]ADK[272.20]MDMSLDDIIK[272.20]LNR n[43.02]AEFTSYK[272.20]ETASSR n[43.02]AESSDK[272.20]LYR n[43.02]AFK[272.20]DTGK[272.20]TPVEPEVAIHR  iTRAQ 116/ iTRAQ 117 2.07 2.30 1.70 1.66 1.69 1.51 1.84 1.72 1.34 1.46 1.84 1.84 1.46 2.11 1.70 1.33 1.39 1.62 2.50 1.99 1.97 1.25 2.48 1.91 1.73 4.20 1.62 1.72 2.02 0.81 1.38 1.17 1.61 1.12 1.70 1.49 1.68 1.24 1.74 1.25 1.81 1.89 1.04 1.69  IPI IPI00006684 IPI00029133 IPI00440493 IPI00217882 IPI00022442 IPI00025252 IPI00217745 IPI00025086 IPI00026964 IPI00018120 IPI00219219 IPI00413916 IPI00012989 IPI00004534 IPI00009276 IPI00744706 IPI00293167 IPI00019502 IPI00012074 IPI00001754 IPI00219385 IPI00030241 IPI00021812 IPI00418471 IPI00024523 IPI00183920 IPI00027834 IPI00023673 IPI00186290 IPI00017283 IPI00011302 IPI00003377 IPI00007084 IPI00025347 IPI00219729 IPI00472498 IPI00027626 IPI00219219 IPI00033153 IPI00328319 IPI00328840 IPI00296830 IPI00449049 IPI00012493  210  N-termini Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural  Prob 0.98 1.00 0.93 0.97 1.00 0.98 0.98 1.00 1.00 0.98 1.00 0.99 0.94 1.00 1.00 1.00 0.99 1.00 0.99 0.99 1.00 0.98 0.95 1.00 1.00 0.96 1.00 1.00 0.98 0.99 1.00 1.00 1.00 0.98 0.98 0.99 0.99 1.00 0.99 1.00 1.00  z 2 2 3 2 3 3 3 3 3 2 3 2 2 2 3 2 3 2 2 2 4 3 2 2 3 2 4 3 2 2 3 3 3 2 3 2 3 2 3 2 3  Precursor Mass 1343.6399 1342.641 1578.7674 1403.6539 1418.7843 1514.8366 1473.7912 2855.3277 1831.8842 1185.635 1699.8982 1587.6366 1270.6556 1393.6798 2437.2088 1755.7678 1831.9967 1571.8623 1630.8341 1499.7051 2047.9958 2994.303 1563.767 1630.8001 2301.9432 1411.6603 2402.1643 1917.9971 1905.9135 1731.8477 2163.0045 2105.0964 2368.1308 1134.5827 1843.9029 1439.7107 1877.1025 1678.7666 1669.7689 1633.8133 1786.8867  Error [Da] -0.1498 -0.1277 -0.0537 -0.0839 -0.0394 -0.0294 -0.0482 -0.124 -0.0645 -0.0237 -0.0595 -0.1067 -0.0561 -0.0269 -0.1155 -0.0429 -0.028 -0.0384 -0.0456 -0.0686 -0.0715 -0.0787 -0.0417 -0.0716 -0.1378 -0.0434 -0.0725 -0.0214 -0.0422 -0.065 -0.1032 -0.0906 -0.0659 -0.029 -0.0854 -0.038 -0.0282 -0.0621 -0.0452 -0.0374 -0.0914  N-term Modification Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[43.02]AGITTIEAVK[272.20]R n[43.02]AGLNSLEAVK[272.20]R n[43.02]AK[272.20]HHPDLIFC[160.03]R n[43.02]AK[272.20]ISSPTETER n[43.02]AK[272.20]PAQGAK[272.20]YR n[43.02]AK[272.20]PLTDQEK[272.20]R n[43.02]AK[272.20]PLTDSEK[272.20]R n[43.02]AMATK[272.20]GGTVK[272.20]AASGFNAMEDAQTLR n[43.02]AMHNK[272.20]AAPPQIPDTR n[43.02]ANNDAVLK[272.20]R n[43.02]AQAK[272.20]INAK[272.20]ANEGR n[43.02]AQDQGEK[272.20]ENPMR n[43.02]AQNLK[272.20]DLAGR n[43.02]AQYK[272.20]GAASEAGR n[43.02]ASGVAVSDGVIK[272.20]VFNDMK[272.20]VR n[43.02]ASK[272.20]EMFEDTVEER n[43.02]ASSDIQVK[272.20]ELEK[272.20]R n[43.02]ATVTATTK[272.20]VPEIR n[43.02]AVPPTYADLGK[272.20]SAR n[43.02]AVTLDK[272.20]DAYYR n[43.02]AWK[272.20]SGGASHSELIHNLR n[43.02]EEEIAALVIDNGSGMC[160.03]K[272.20]AGFAGDDAPR n[43.02]MDPFTEK[272.20]LLER n[43.02]MEK[272.20]TLETVPLER n[43.02]MESGFTSK[272.20]DTYLSHFNPR n[43.02]MFSWVSK[272.20]DAR n[43.02]MQSNK[272.20]TFNLEK[272.20]QNHTPR n[43.02]MTENSTSAPAAK[272.20]PK[272.20]R n[43.02]SDNGELEDK[272.20]PPAPPVR n[43.02]SDSEK[272.20]LNLDSIIGR n[43.02]SGGK[272.20]YVDSEGHLYTVPIR n[43.02]SGSSSVAAMK[272.20]K[272.20]VVQQLR n[43.02]SK[272.20]K[272.20]ISGGSVVEMQGDEMTR n[43.02]SK[272.20]NTVSSAR n[43.02]SK[272.20]SESPK[272.20]EPEQLR n[43.02]SK[272.20]SFQQSSLSR n[43.02]SK[272.20]SLK[272.20]K[272.20]LVEESR n[43.02]SQAEFEK[272.20]AAEEVR n[43.02]SSESK[272.20]EQHNVSPR n[43.02]SSK[272.20]TASTNNIAQAR n[43.02]TENSTSAPAAK[272.20]PK[272.20]R  iTRAQ 116/ iTRAQ 117 1.49 1.57 1.25 1.44 1.78 1.93 1.79 2.10 1.40 1.43 1.56 1.73 1.48 1.31 1.83 1.78 1.97 1.27 1.84 1.59 1.14 1.71 1.13 1.04 2.08 1.78 2.13 2.01 2.51 1.81 1.60 2.29 1.86 1.43 1.47 1.58 2.24 1.55 2.94 1.86 1.92  IPI IPI00218319 IPI00010779 IPI00005511 IPI00013895 IPI00002459 IPI00783313 IPI00004358 IPI00793199 IPI00009373 IPI00006252 IPI00000643 IPI00376798 IPI00027252 IPI00030098 IPI00012011 IPI00395865 IPI00479997 IPI00009104 IPI00216308 IPI00026970 IPI00411680 IPI00021440 IPI00032958 IPI00396378 IPI00027681 IPI00017184 IPI00304596 IPI00550239 IPI00419979 IPI00027423 IPI00009236 IPI00027240 IPI00027223 IPI00007280 IPI00215965 IPI00017297 IPI00017256 IPI00010182 IPI00032107 IPI00221232 IPI00550239  211  Appendix B.11 Peptides identified by iTRAQ-TAILS in membrane fractions of HMEC1. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 116) or sMT6EΔA (iTRAQ 117) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. N-termini Natural Natural Neo Neo Neo Natural Neo Neo Neo Neo Neo Neo Natural Neo Neo Neo Natural Neo Natural Natural Neo Neo Neo Natural Natural Neo Natural Natural Natural Natural Neo Neo Natural Neo Natural  Prob 1.00 0.98 1.00 0.77 0.99 0.98 1.00 1.00 0.99 0.99 1.00 1.00 1.00 0.94 0.99 1.00 1.00 0.95 1.00 1.00 0.98 0.67 0.92 1.00 0.77 0.98 1.00 0.96 0.85 1.00 1.00 0.67 1.00 0.76 1.00  z 2 2 3 2 2 3 3 3 2 2 2 3 3 2 2 2 3 2 4 3 3 3 3 3 3 2 3 2 3 3 4 3 3 2 2  Precursor Mass 1451.7554 1200.5667 1757.9215 1431.7072 1254.7116 1743.9514 1666.8534 1774.9127 1199.5159 1319.5489 1119.5127 2468.2118 1692.8532 1135.6082 1013.5835 1431.7123 2126.0901 1165.5724 2468.1491 2441.2481 1480.7571 1289.767 1504.811 1211.6401 1519.7585 1161.5662 1997.0869 1214.588 1293.7628 2493.2855 1850.9742 1267.7365 1969.0164 1703.7598 1100.5873  Error [Da] -0.0413 -0.019 -0.0412 -0.0185 -0.0301 -0.0069 -0.0343 -0.029 -0.0208 -0.0218 -0.03 -0.0749 -0.0495 -0.0135 -0.0272 -0.0324 -0.0386 -0.0273 -0.0758 -0.0646 -0.067 -0.024 -0.0343 -0.0136 -0.0172 -0.0235 -0.0644 -0.0137 -0.0384 -0.0982 -0.0495 -0.0239 -0.0712 -0.1499 -0.0184  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]AAAGAAATHLEVAR n[145.11]AANYSSTSTR n[145.11]AAQTSPSPK[272.20]AGAATGR n[145.11]AASPC[160.03]SVVNDLR n[145.11]AATLILEPAGR n[145.11]AAVAATAAAK[272.20]GNGGGGGR n[145.11]ADAINTEFK[272.20]NTR n[145.11]ADANLEAGNVK[272.20]ETR n[145.11]AEFSSEAC[160.03]R n[145.11]AEGPDEDSSNR n[145.11]AGFAGDDAPR n[145.11]AGGAAQLALDK[272.20]SDSHPSDALTR n[145.11]AGGEAGVTLGQPHLSR n[145.11]AGGGVHIEPR n[145.11]AGLAAAALGR n[145.11]AGMAMAGQSPVLR n[145.11]AGPPPIQDGEFTFLLPAGR n[145.11]AHEFTVYR n[145.11]AHESVVK[272.20]SEDFSLPAYMDR n[145.11]AIAAK[272.20]EK[272.20]DIQEESTFSSR n[145.11]AINTEFK[272.20]NTR n[145.11]AK[272.20]VSSLIER n[145.11]ALK[272.20]GTNESLER n[145.11]ALPFGSSPHR n[145.11]ALSAETESHIYR n[145.11]ALYHTEER n[145.11]APAEILNGK[272.20]EISAQIR n[145.11]APDQDEIQR n[145.11]APEVLPK[272.20]PR n[145.11]APGQLALFSVSDK[272.20]TGLVEFAR n[145.11]APHNPAPPTSTVIHIR n[145.11]APLNPK[272.20]ANR n[145.11]APSVPAAEPEYPK[272.20]GIR n[145.11]AQAK[272.20]QWGWTQGR n[145.11]AQTAAATAPR  iTRAQ 116/ iTRAQ 117 1.28 1.65 1.26 1.86 1.22 2.17 1.61 2.06 1.37 1.26 1.72 1.62 1.83 1.37 1.19 2.08 1.18 1.41 2.50 2.08 1.30 1.47 1.27 1.59 2.14 1.27 2.02 1.36 1.29 1.90 2.09 0.99 1.48 1.14 1.73  IPI # IPI00465308 IPI00301280 IPI00303476 IPI00549189 IPI00220906 IPI00384497 IPI00418471 IPI00328113 IPI00030877 IPI00009904 IPI00008603 IPI00028031 IPI00297982 IPI00004872 IPI00514494 IPI00179964 IPI00009976 IPI00470649 IPI00006579 IPI00783271 IPI00418471 IPI00031479 IPI00418471 IPI00329054 IPI00013026 IPI00301109 IPI00218342 IPI00021794 IPI00015972 IPI00289499 IPI00303726 IPI00008603 IPI00172460 IPI00394699 IPI00294911  212  N-termini Neo Neo Natural Natural Neo Neo Natural Neo Neo Neo Neo Natural Natural Neo Neo Natural Neo Neo Neo Neo Neo Neo Neo Natural Natural Natural Neo Natural Natural Natural Neo Neo Neo Neo Natural Neo Neo Natural Neo Natural Neo Neo Natural Natural  Prob 0.99 1.00 1.00 1.00 0.98 1.00 0.92 0.91 0.94 0.96 1.00 1.00 1.00 1.00 0.93 1.00 0.91 1.00 1.00 1.00 0.99 0.99 0.95 0.98 0.98 0.95 0.88 0.91 0.66 1.00 1.00 0.74 1.00 0.94 0.99 1.00 0.82 1.00 1.00 0.76 1.00 0.99 0.94 0.89  z 3 3 3 2 2 2 2 2 2 2 3 3 3 4 3 3 3 3 3 3 2 2 3 2 3 3 2 3 4 2 3 3 3 2 3 2 3 2 2 3 3 3 2 3  Precursor Mass 1865.0871 2772.4765 1855.9327 1916.8714 1208.5982 1339.6198 1113.5652 871.5206 1218.6514 1081.6086 1595.83 1664.8005 2265.0207 2885.3433 2536.1992 1503.7384 2445.1659 1589.7966 1612.9356 2554.9764 1330.6684 1263.6006 1396.7888 1398.6561 1787.9424 2532.1453 1316.5959 1402.7061 1655.8441 1507.7234 1779.8166 1240.6123 1327.65 991.4623 2216.2282 1396.6022 1531.7951 1127.6005 1238.6521 1713.8456 2842.0576 2569.0621 968.4992 1551.7224  Error [Da] -0.0266 -0.0942 -0.071 -0.0483 -0.0285 -0.0289 -0.0185 -0.0151 -0.0333 -0.0281 -0.0207 -0.0482 -0.0645 -0.1971 -0.1275 -0.0533 -0.1718 -0.0291 -0.0148 -0.0703 -0.0163 -0.0171 -0.0139 -0.0296 -0.0793 -0.1074 -0.0308 -0.0226 -0.0384 -0.0613 -0.053 -0.0199 -0.0357 -0.0224 -0.0755 -0.0315 -0.0276 -0.0312 -0.0586 -0.0991 -0.1736 -0.1636 -0.0165 -0.0593  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]ASASSK[272.20]ELLMK[272.20]LR n[145.11]ASASSTNLK[272.20]DILADLIPK[272.20]EQAR n[145.11]ASGANFEYIIAEK[272.20]R n[145.11]ASGGGVPTDEEQATGLER n[145.11]ASSPGGVYATR n[145.11]ASSYSASAEPAR n[145.11]ATLNQMHR n[145.11]AVAAVAAR n[145.11]AVPSPPPASPR n[145.11]AVTVAPPGAR n[145.11]DAINTEFK[272.20]NTR n[145.11]DAPEEEDHVLVLR n[145.11]DDEVDVDGTVEEDLGK[272.20]SR n[145.11]DDLEALK[272.20]K[272.20]K[272.20]GC[160.03]PPDDIENPR n[145.11]DDLVTVK[272.20]TPAFAESVTEGDVR n[145.11]DGVGGDPAVALPHR n[145.11]DK[272.20]EK[272.20]NLLHVTDTGVGMTR n[145.11]DNADSSPVVDK[272.20]R n[145.11]DNIQGITK[272.20]PAIR n[145.11]DVK[272.20]C[160.03]DMEVSC[160.03]PDGYTC[160.03]C[160.03]R n[145.11]EAGLETESPVR n[145.11]EAGSTAGAAETR n[145.11]EAPLNPK[272.20]ANR n[145.11]EEQPPETAAQR n[145.11]ENSTSAPAAK[272.20]PK[272.20]R n[145.11]EPAVYFK[272.20]EQFLDGDGWTSR n[145.11]EQAPGTAPC[160.03]SR n[145.11]ESAGADTRPTVR n[145.11]ESAGADTRPTVRPR n[145.11]ESETTTSLVLER n[145.11]ETVHC[160.03]DLQPVGPER n[145.11]EVAPPEYHR n[145.11]EVHVSTVEER n[145.11]FAGDDAPR n[145.11]FAK[272.20]LVRPPVQVYGIEGR n[145.11]FGSDQSENVDR n[145.11]GAAGRPLELSDFR n[145.11]GAGGALFVHR n[145.11]GAPEVLVSAPR n[145.11]GAYK[272.20]YIQELWR n[145.11]GESGHLAK[272.20]DC[160.03]DLQEDAC[160.03]YNC[160.03]GR n[145.11]GETGHVAINC[160.03]SK[272.20]TSEVNC[160.03]YR n[145.11]GGVGEPGPR n[145.11]GHQQLYWSHPR  iTRAQ 116/ iTRAQ 117 1.50 2.17 1.76 1.46 1.19 2.00 1.71 1.85 1.42 1.59 1.52 1.41 1.72 2.38 1.70 2.18 1.34 1.31 1.71 1.92 1.44 1.76 1.67 1.38 1.45 1.47 1.90 2.17 1.33 1.44 1.71 1.82 1.19 1.71 1.84 1.42 0.87 1.55 1.42 2.00 1.41 1.78 1.50 1.42  IPI # IPI00021016 IPI00025366 IPI00024993 IPI00021785 IPI00418471 IPI00306159 IPI00005692 IPI00011454 IPI00001663 IPI00479217 IPI00418471 IPI00010796 IPI00027230 IPI00217561 IPI00384016 IPI00026530 IPI00027230 IPI00328753 IPI00453473 IPI00181753 IPI00009885 IPI00220002 IPI00008603 IPI00386755 IPI00550239 IPI00020599 IPI00010277 IPI00025796 IPI00025796 IPI00029744 IPI00017567 IPI00409675 IPI00217683 IPI00008603 IPI00007611 IPI00258804 IPI00030131 IPI00291328 IPI00143921 IPI00470528 IPI00430813 IPI00430812 IPI00028040 IPI00182289  213  N-termini Neo Natural Natural Natural Natural Neo Neo Neo Neo Neo Natural Neo Neo Neo Neo Neo Neo Natural Neo Neo Neo Neo Neo Neo Neo Neo Neo Neo Natural Neo Natural Natural Neo Natural Neo Natural Natural Natural Natural Natural Natural Natural Natural Natural  Prob 0.96 1.00 0.99 0.88 0.91 0.97 1.00 0.99 0.70 0.99 0.94 0.66 0.87 1.00 0.82 1.00 0.85 0.81 0.97 1.00 1.00 0.92 0.92 1.00 1.00 0.76 0.74 1.00 0.91 0.69 1.00 0.92 1.00 1.00 0.94 1.00 0.97 0.93 0.90 1.00 0.99 1.00 0.69 0.99  z 4 3 3 3 2 2 3 2 3 2 2 3 2 2 2 2 3 3 3 10 3 3 2 2 3 2 3 3 2 3 3 2 2 3 4 2 2 2 3 3 3 2 3 2  Precursor Mass 1785.9192 1671.8703 1517.7494 1648.9929 986.5129 1168.5447 1316.5604 1061.5145 1428.7585 1229.653 1332.6047 1750.9608 943.5036 1457.7455 1212.4952 1275.5715 1920.8065 1326.6902 1658.8092 1391.721 1597.764 1236.7034 1157.5871 1373.7077 1334.7602 1246.7641 2137.1563 2049.0276 1019.5365 1866.8526 1937.8745 1945.9295 2199.997 1424.816 2649.3547 1819.8278 1441.7582 1278.5866 1716.9898 1628.8211 1608.9102 1466.7272 1742.9782 1611.8261  Error [Da] -0.0425 -0.0485 -0.0296 -0.0178 -0.0138 -0.015 -0.0263 -0.0262 -0.0384 -0.0317 -0.065 -0.027 -0.0171 -0.0142 -0.0335 -0.0502 -0.1621 -0.0628 -0.0347 -0.0187 -0.0268 -0.0403 -0.0296 -0.02 -0.0555 -0.0216 -0.1685 -0.0611 -0.0152 -0.1856 -0.0832 -0.0262 -0.0797 -0.0257 -0.1423 -0.0409 -0.0295 -0.0321 -0.0389 -0.0376 -0.0275 -0.0285 -0.0296 -0.0346  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]GK[272.20]AEELHYPLGER n[145.11]GK[272.20]DYYQTLGLAR n[145.11]GK[272.20]GGNQGEGAAER n[145.11]GK[272.20]VK[272.20]VGVNGFGR n[145.11]GLADASGPR n[145.11]GPDEDLSHR n[145.11]GPGHGYDGEER n[145.11]GPNIC[160.03]TTR n[145.11]GQTFEYLK[272.20]R n[145.11]GQVITIGNER n[145.11]GSTWGSPGWVR n[145.11]GVK[272.20]K[272.20]FDVPC[160.03]GGR n[145.11]GVPVEGSR n[145.11]GVQVETISPGDGR n[145.11]GWAC[160.03]C[160.03]PYR n[145.11]GYSFTTTAER n[145.11]HEGGQSYK[272.20]IGDTWR n[145.11]ISFHLPINSR n[145.11]IWHHTFYNELR n[145.11]K[272.20]AGFAGDDAPR n[145.11]K[272.20]C[160.03]NTATC[160.03]ATQR n[145.11]K[272.20]PVSLSYR n[145.11]LDADPSLQR n[145.11]LGSDAELQIER n[145.11]LHLGVTPSVIR n[145.11]LIK[272.20]TVETR n[145.11]LISTLILVILSYTYIIR n[145.11]LLSSAYVDSHK[272.20]WEAR n[145.11]LPASFDAR n[145.11]LPTPK[272.20]C[160.03]HTPPLYR n[145.11]LRPGDC[160.03]EVC[160.03]ISYLGR n[145.11]LWPWPQNFQTSDQR n[145.11]LYSSSDDVIELTPSNFNR n[145.11]MAPEVLPK[272.20]PR n[145.11]MDK[272.20]SELVQK[272.20]AK[272.20]LAEQAER n[145.11]MFLQYYLNEQGDR n[145.11]MFLYNLTLQR n[145.11]MIEVVC[160.03]NDR n[145.11]MK[272.20]EEVK[272.20]GIPVR n[145.11]MK[272.20]FNPFVTSDR n[145.11]MK[272.20]PILLQGHER n[145.11]MLSLDFLDDVR n[145.11]MLTK[272.20]FETK[272.20]SAR n[145.11]MPPYTVVYFPVR  iTRAQ 116/ iTRAQ 117 1.54 1.50 1.75 1.82 1.66 1.54 1.99 1.67 1.53 1.87 2.41 2.20 2.03 1.16 1.27 1.56 3.65 1.63 1.78 1.84 0.34 2.43 1.28 1.20 1.63 1.77 1.36 2.22 1.38 1.54 1.08 1.41 2.14 1.73 2.15 0.82 1.65 1.40 2.82 1.75 1.51 1.26 2.27 2.33  IPI # IPI00029628 IPI00015947 IPI00183786 IPI00219018 IPI00107312 IPI00307572 IPI00290452 IPI00220350 IPI00218337 IPI00003269 IPI00031000 IPI00306322 IPI00031801 IPI00413778 IPI00181753 IPI00021439 IPI00022418 IPI00028055 IPI00021428 IPI00008603 IPI00023679 IPI00413781 IPI00306959 IPI00182126 IPI00298237 IPI00418471 IPI00399342 IPI00022002 IPI00295741 IPI00026202 IPI00328748 IPI00027851 IPI00299571 IPI00015972 IPI00216318 IPI00032853 IPI00179138 IPI00013241 IPI00175193 IPI00007144 IPI00012795 IPI00104128 IPI00295857 IPI00219757  214  N-termini Neo Natural Natural Natural Natural Neo Natural Natural Neo Neo Neo Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Neo Natural Neo Neo Natural Neo Natural Natural Natural Neo Neo Neo Neo Natural Neo Neo Neo  Prob 1.00 1.00 0.95 0.97 0.88 1.00 0.99 0.98 0.99 1.00 0.96 0.89 0.99 0.89 0.92 0.99 0.73 1.00 0.99 1.00 1.00 0.99 1.00 1.00 0.98 0.96 1.00 1.00 1.00 0.77 1.00 1.00 0.97 0.97 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.99 1.00 0.79  z 2 3 3 4 3 3 2 2 3 3 3 3 3 2 3 2 3 3 2 3 2 2 2 3 2 2 3 3 3 4 3 2 2 2 2 2 3 2 3 3 3 4 3 3  Precursor Mass 1654.8514 1639.7881 1404.6852 2129.1592 1630.8858 1921.0945 1372.73 1182.5946 1497.8898 1832.9711 1431.7539 1304.6843 1987.9496 1177.562 1222.7357 1642.8144 1670.9305 1813.8548 1513.7386 2003.0287 1430.6875 1480.7627 1613.6974 1786.9826 1149.5803 1068.5731 1695.9429 2659.1842 1982.9787 3053.2222 1233.6139 1349.5378 1257.594 1147.6463 1714.7934 1782.7935 1675.8932 1327.5715 1962.8901 1704.93 1750.6974 1980.9733 1875.9628 1578.7728  Error [Da] -0.0433 -0.0503 -0.0305 -0.0543 -0.0329 -0.0842 -0.0357 -0.0241 -0.0337 -0.0486 -0.0778 -0.0271 -0.0391 -0.0227 -0.0284 -0.0653 -0.0155 -0.0469 -0.0221 -0.0757 -0.0952 -0.057 -0.0623 -0.0471 -0.0344 -0.0316 -0.0488 -0.1734 -0.04 -0.1562 -0.0085 -0.0259 -0.0317 -0.0224 -0.0743 -0.0462 -0.0416 -0.0172 -0.0504 -0.0467 -0.0543 -0.0416 -0.0296 -0.0269  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]MQNPQILAALQER n[145.11]MQPASAK[272.20]WYDR n[145.11]MRPLTEEETR n[145.11]MRPQQAPVSGK[272.20]VFIQR n[145.11]MTK[272.20]GTSSFGK[272.20]R n[145.11]MVPPVQVSPLIK[272.20]LGR n[145.11]MWTPELAILR n[145.11]MYLQVETR n[145.11]NIQGITK[272.20]PAIR n[145.11]NVDVETQSGK[272.20]TVIR n[145.11]PAPPTSTVIHIR n[145.11]PAVSK[272.20]GDGMR n[145.11]PDSWDK[272.20]DVYPEPPR n[145.11]PDYLGADQR n[145.11]PEVLPK[272.20]PR n[145.11]PFLELDTNLPANR n[145.11]PFSNSHNALK[272.20]LR n[145.11]PGHLQEGFGC[160.03]VVTNR n[145.11]PGPTPSGTNVGSSGR n[145.11]PGVTVK[272.20]DVNQQEFVR n[145.11]PMFIVNTNVPR n[145.11]PPYTVVYFPVR n[145.11]PQYQTWEEFSR n[145.11]PSK[272.20]GPLQSVQVFGR n[145.11]PTVEELYR n[145.11]PVAGSELPR n[145.11]PVPPLPEYGGK[272.20]VR n[145.11]QK[272.20]AMTAK[272.20]GGDISVC[160.03]EWYQR n[145.11]QK[272.20]TGTAEMSSILEER n[145.11]RDDSFFGETSHNYHK[272.20]FDSEYER n[145.11]SAHAGTYEVR n[145.11]SAPGEDEEC[160.03]GR n[145.11]SAPLAAGC[160.03]PDR n[145.11]SASVVSVISR n[145.11]SDMPPLTLEGIQDR n[145.11]SDVLELTDDNFESR n[145.11]SEVELAAALSDK[272.20]R n[145.11]SGQGAFGNMC[160.03]R n[145.11]SGTLGHPGSLDETTYER n[145.11]SGYLAGDK[272.20]LLPQR n[145.11]SHGSQETDEEFDAR n[145.11]SHTDIK[272.20]VPDFSEYR n[145.11]SIAAHLDNQVPVESPR n[145.11]SK[272.20]DGGAWGTEQR  iTRAQ 116/ iTRAQ 117 1.78 2.20 1.12 2.59 2.09 2.01 1.63 1.46 1.54 1.89 2.14 1.24 1.87 2.20 1.00 2.17 1.30 2.40 1.99 2.19 1.88 1.77 1.88 2.10 2.07 1.98 2.30 1.04 1.70 1.38 2.54 1.58 1.13 1.71 1.69 1.51 1.24 2.00 1.84 1.45 1.56 1.34 1.46 1.84  IPI # IPI00023860 IPI00015029 IPI00007175 IPI00480022 IPI00220871 IPI00218848 IPI00183938 IPI00001578 IPI00453473 IPI00021812 IPI00008922 IPI00016621 IPI00074489 IPI00021435 IPI00015972 IPI00293867 IPI00022977 IPI00410693 IPI00220835 IPI00215780 IPI00293276 IPI00219757 IPI00216125 IPI00221092 IPI00006684 IPI00103732 IPI00029133 IPI00216085 IPI00440493 IPI00017297 IPI00019385 IPI00217882 IPI00003176 IPI00009407 IPI00022442 IPI00025252 IPI00009771 IPI00003918 IPI00217745 IPI00219365 IPI00025086 IPI00026964 IPI00018120 IPI00219219  215  N-termini Neo Neo Neo Neo Neo Natural Natural Natural Neo Natural Natural Natural Neo Neo Neo Natural Neo Natural Neo Neo Neo Neo Natural Neo Neo Natural Natural Neo Natural Natural Natural Natural Natural Natural Neo Natural Neo Neo Neo Neo Neo Neo Natural Natural  Prob 0.94 0.72 1.00 0.98 1.00 0.99 0.95 0.92 1.00 0.99 1.00 0.98 0.95 0.98 1.00 1.00 0.91 0.97 0.86 0.95 0.98 1.00 0.90 0.98 1.00 1.00 1.00 1.00 0.83 1.00 0.88 0.97 0.99 0.88 0.98 0.98 1.00 0.99 0.98 0.88 1.00 0.89 0.96 0.78  z 3 3 3 2 3 2 3 2 3 3 3 4 2 2 3 3 3 3 3 2 2 2 3 3 3 2 3 3 2 2 3 2 2 2 3 3 3 2 4 3 3 3 3 2  Precursor Mass 1387.8268 1261.6007 1939.895 1486.8185 1522.7837 1554.8 1260.6825 1219.567 1467.7621 1841.9615 2177.1591 2310.2565 1165.5198 1146.5764 1901.8274 1469.7212 1497.8182 1466.7699 2004.1287 1260.5637 1314.6904 1796.7846 2236.1498 2038.2353 1671.9087 1483.7179 2405.3059 1432.745 1133.6264 1205.6385 1612.9069 949.436 1234.6465 1097.6545 1654.7528 2158.2655 2140.8295 1672.9133 2231.8266 1623.8913 1913.7812 1537.7832 1357.8349 1230.6062  Error [Da] -0.0487 -0.0166 -0.0527 -0.0442 -0.0388 -0.0527 -0.0276 -0.0247 -0.0296 -0.0472 -0.0856 -0.053 -0.0139 -0.0353 -0.0433 -0.0384 -0.0325 -0.0278 -0.0294 -0.025 -0.0113 -0.0601 -0.1169 -0.0274 -0.068 -0.0618 -0.0458 -0.0367 -0.0303 -0.0172 -0.0508 -0.0049 -0.0322 -0.0502 -0.0365 -0.0762 -0.2062 -0.0294 -0.1454 -0.0164 -0.0335 -0.0502 -0.03 -0.0415  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ Ac-lysine Ac-lysine  Peptide n[145.11]SK[272.20]LVVITQGR n[145.11]SLESQHDFR n[145.11]SMPPAQQQITSGQMHR n[145.11]SNIPFITVPLSR n[145.11]SPALTIENEHIR n[145.11]SPTPPLFSLPEAR n[145.11]SPVLHFYVR n[145.11]SQDASDGLQR n[145.11]SQLLGSAHEVQR n[145.11]SSEAPPLINEDVK[272.20]R n[145.11]SSLGVVTC[160.03]GSVVK[272.20]LLNTR n[145.11]SSVLASC[160.03]PK[272.20]K[272.20]PVSSYLR n[145.11]SSVMC[160.03]PDAR n[145.11]STAAQQELR n[145.11]STAYEDYYYHPPPR n[145.11]SVTVHSSEPEVR n[145.11]TEAPLNPK[272.20]ANR n[145.11]TGYTPDEK[272.20]LR n[145.11]TLPTK[272.20]ETIEQEK[272.20]R n[145.11]TPAPETC[160.03]EGR n[145.11]TSTAPAASPNVR n[145.11]TTFNIQDGPDFQDR n[145.11]TTIAGVVYK[272.20]DGIVLGADTR n[145.11]VAAPK[272.20]VK[272.20]GGVDVTLPR n[145.11]VDVSK[272.20]PDLTAALR n[145.11]VDYYEVLGVQR n[145.11]VK[272.20]LTAELIEQAAQYTNAVR n[145.11]VK[272.20]MAAAGGGGGGGR n[145.11]VLDLDLFR n[145.11]VMAEGTAVLR n[145.11]VMEK[272.20]PSPLLVGR n[145.11]VNDGDMR n[145.11]VNFTVDQIR n[145.11]VNLLQIVR n[145.11]VSGASNHQPNSNSGR n[145.11]VSK[272.20]PTLK[272.20]EVVIVSATR n[145.11]WK[272.20]FEHC[160.03]NFNDVTTR n[145.11]WSNIPFITVPLSR n[145.11]YEC[160.03]GEK[272.20]GHYAYDC[160.03]HR n[145.11]YEVEILDAK[272.20]TR n[145.11]YSHGSQETDEEFDAR n[145.11]YSLGSALRPSTSR n[43.02]AAAK[272.20]VALTK[272.20]R n[43.02]AAPSDGFK[272.20]PR  iTRAQ 116/ iTRAQ 117 1.76 1.65 1.94 1.63 1.46 1.38 2.11 1.81 1.43 1.99 1.39 1.84 1.38 1.56 2.50 1.99 2.05 2.45 2.65 1.21 1.38 2.06 1.71 2.48 1.91 1.73 4.20 1.34 3.30 1.64 1.45 1.57 2.02 2.10 0.81 1.72 1.38 1.59 1.17 1.97 2.21 1.16 1.49 1.12  IPI # IPI00413916 IPI00151710 IPI00298994 IPI00008982 IPI00012989 IPI00305374 IPI00004534 IPI00009276 IPI00744706 IPI00025874 IPI00293167 IPI00020928 IPI00182138 IPI00019502 IPI00012074 IPI00001754 IPI00008603 IPI00219385 IPI00220827 IPI00030241 IPI00299402 IPI00017799 IPI00003217 IPI00021812 IPI00418471 IPI00024523 IPI00183920 IPI00027834 IPI00220637 IPI00386122 IPI00009057 IPI00023673 IPI00186290 IPI00025725 IPI00017283 IPI00030363 IPI00011302 IPI00008982 IPI00003377 IPI00100656 IPI00025086 IPI00418471 IPI00007084 IPI00025347  216  N-termini Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Neo Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Neo Natural Natural Natural Natural Natural Neo Natural  Prob 0.97 0.93 1.00 1.00 0.99 1.00 0.99 0.99 0.99 1.00 0.98 1.00 0.92 0.98 0.91 0.98 1.00 0.98 1.00 1.00 0.93 0.87 1.00 0.98 0.98 1.00 1.00 0.91 0.98 0.99 0.97 0.94 1.00 1.00 1.00 0.99 1.00 1.00 0.99 0.99 1.00 0.99 0.99 0.98  z 2 2 3 10 3 2 3 2 2 2 3 2 3 2 2 4 3 2 3 2 3 2 3 3 3 3 3 2 2 3 2 2 2 3 2 3 3 2 2 2 4 3 3 3  Precursor Mass 1584.7545 1328.6532 1797.0347 2157.0034 1822.7568 1750.7767 2207.0452 1798.9673 1571.8122 1648.8539 1786.9527 1661.7797 1570.6482 1253.6022 1259.6552 2324.1549 2114.0723 1343.6399 2073.0808 1342.641 1578.7674 1403.7009 1418.7843 1514.8366 1473.7912 2855.3277 1831.8842 1352.642 1185.635 1699.9229 1587.7153 1270.6556 1393.6798 2437.2088 1755.7678 1831.9967 2653.2767 1571.8623 1630.8341 1499.7051 2047.9958 2922.2026 1510.856 2994.303  Error [Da] -0.0792 -0.1005 -0.0369 -0.1122 -0.0159 -0.036 -0.1085 -0.0234 -0.0305 -0.0368 -0.0254 -0.022 -0.0297 -0.0355 -0.0295 -0.1183 -0.1034 -0.1498 -0.0766 -0.1277 -0.0537 -0.0368 -0.0394 -0.0294 -0.0482 -0.124 -0.0645 -0.0207 -0.0237 -0.0348 -0.0284 -0.0561 -0.0269 -0.1155 -0.0429 -0.028 -0.097 -0.0384 -0.0456 -0.0686 -0.0715 -0.1221 -0.0029 -0.0787  N-term Modification Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[43.02]AATASAGAGGIDGK[272.20]PR n[43.02]AATTGSGVK[272.20]VPR n[43.02]AAVK[272.20]TLNPK[272.20]AEVAR n[43.02]AC[160.03]GLVASNLNLK[272.20]PGEC[160.03]LR n[43.02]ADEGK[272.20]SYSEHDDER n[43.02]ADK[272.20]EAAFDDAVEER n[43.02]ADK[272.20]MDMSLDDIIK[272.20]LNR n[43.02]ADLDK[272.20]LNIDSIIQR n[43.02]ADPK[272.20]YADLPGIAR n[43.02]ADSVK[272.20]TFLQDLAR n[43.02]ADVVVGK[272.20]DK[272.20]GGEQR n[43.02]AEFTSYK[272.20]ETASSR n[43.02]AEK[272.20]FDC[160.03]HYC[160.03]R n[43.02]AESSDK[272.20]LYR n[43.02]AEVEETLK[272.20]R n[43.02]AFK[272.20]DTGK[272.20]TPVEPEVAIHR n[43.02]AFLASGPYLTHQQK[272.20]VLR n[43.02]AGITTIEAVK[272.20]R n[43.02]AGK[272.20]QAVSASGK[272.20]WLDGIR n[43.02]AGLNSLEAVK[272.20]R n[43.02]AK[272.20]HHPDLIFC[160.03]R n[43.02]AK[272.20]ISSPTETER n[43.02]AK[272.20]PAQGAK[272.20]YR n[43.02]AK[272.20]PLTDQEK[272.20]R n[43.02]AK[272.20]PLTDSEK[272.20]R n[43.02]AMATK[272.20]GGTVK[272.20]AASGFNAMEDAQTLR n[43.02]AMHNK[272.20]AAPPQIPDTR n[43.02]ANK[272.20]GPSYGMSR n[43.02]ANNDAVLK[272.20]R n[43.02]AQAK[272.20]INAK[272.20]ANEGR n[43.02]AQDQGEK[272.20]ENPMR n[43.02]AQNLK[272.20]DLAGR n[43.02]AQYK[272.20]GAASEAGR n[43.02]ASGVAVSDGVIK[272.20]VFNDMK[272.20]VR n[43.02]ASK[272.20]EMFEDTVEER n[43.02]ASSDIQVK[272.20]ELEK[272.20]R n[43.02]ATK[272.20]GGTVK[272.20]AASGFNAMEDAQTLR n[43.02]ATVTATTK[272.20]VPEIR n[43.02]AVPPTYADLGK[272.20]SAR n[43.02]AVTLDK[272.20]DAYYR n[43.02]AWK[272.20]SGGASHSELIHNLR n[43.02]DDDIAALVVDNGSGMC[160.03]K[272.20]AGFAGDDAPR n[43.02]DNIQGITK[272.20]PAIR n[43.02]EEEIAALVIDNGSGMC[160.03]K[272.20]AGFAGDDAPR  iTRAQ 116/ iTRAQ 117 1.63 1.49 1.68 1.24 1.74 1.25 1.81 1.46 1.39 1.63 2.28 1.89 1.61 1.04 2.00 1.69 1.91 1.49 1.86 1.57 1.25 1.33 2.06 1.93 1.83 2.10 1.40 1.51 1.43 1.48 1.84 1.48 1.31 1.83 1.78 1.92 2.23 1.27 1.84 1.59 1.14 1.38 1.44 1.71  IPI # IPI00219729 IPI00472498 IPI00027626 IPI00219219 IPI00033153 IPI00328319 IPI00328840 IPI00005705 IPI00220503 IPI00023185 IPI00010158 IPI00296830 IPI00014398 IPI00449049 IPI00063849 IPI00012493 IPI00255052 IPI00218319 IPI00220416 IPI00010779 IPI00005511 IPI00013895 IPI00002459 IPI00783313 IPI00004358 IPI00793199 IPI00009373 IPI00216138 IPI00006252 IPI00000643 IPI00376798 IPI00027252 IPI00030098 IPI00012011 IPI00395865 IPI00479997 IPI00793199 IPI00009104 IPI00216308 IPI00026970 IPI00411680 IPI00021439 IPI00453473 IPI00021440  217  N-termini Neo Natural Natural Neo Natural Natural Natural Natural Natural Neo Natural Natural Natural Natural Natural Natural Natural Natural Natural Neo Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Neo  Prob 0.81 1.00 0.97 1.00 1.00 0.95 0.82 0.99 0.96 0.96 1.00 1.00 0.66 1.00 0.98 0.96 0.82 0.95 1.00 0.83 1.00 1.00 1.00 0.97 0.98 0.99 1.00 1.00 0.95 1.00 0.98 0.94 0.99 0.99 1.00 0.99 1.00 0.82 0.99 0.94 0.76  z 3 3 4 3 3 2 3 3 3 2 3 2 3 3 2 2 3 4 3 3 2 4 3 3 2 2 3 3 3 3 2 3 2 3 2 3 2 3 3 3 3  Precursor Mass 1520.7789 2042.9881 2574.2508 2547.294 2221.0058 1563.767 2314.9547 1917.9259 1750.797 1411.7694 2589.3148 1630.8001 2006.1372 2301.9432 1009.5365 1411.6603 1443.7443 2052.0571 2087.0705 1986.0333 1537.7151 2402.1643 1917.9971 2289.1761 1905.9135 1731.8477 2163.0045 2105.0964 1885.8886 2368.1308 1134.5827 1843.9584 1439.7107 1877.1025 1678.7666 1669.7689 1633.8133 2499.206 1786.9464 2092.0825 1435.7538  Error [Da] -0.0167 -0.0726 -0.1656 -0.1117 -0.0419 -0.0417 -0.1 -0.045 -0.046 -0.0283 -0.1379 -0.0716 -0.0373 -0.1378 -0.0132 -0.0434 -0.0305 -0.0635 -0.0442 -0.0954 -0.0316 -0.0725 -0.0214 -0.0966 -0.0422 -0.065 -0.1032 -0.0906 -0.0631 -0.0659 -0.029 -0.0299 -0.038 -0.0282 -0.0621 -0.0452 -0.0374 -0.0897 -0.0313 -0.0518 -0.0618  N-term Modification Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[43.02]EIAQDFK[272.20]TDLR n[43.02]GDVK[272.20]NFLYAWC[160.03]GK[272.20]R n[43.02]MDK[272.20]NELVQK[272.20]AK[272.20]LAEQAER n[43.02]MDK[272.20]SELVQK[272.20]AK[272.20]LAEQAER n[43.02]MDNSGK[272.20]EAEAMALLAEAER n[43.02]MDPFTEK[272.20]LLER n[43.02]MDWVMK[272.20]HNGPNDASDGTVR n[43.02]MEEEGVK[272.20]EAGEK[272.20]PR n[43.02]MEGHDPK[272.20]EPEQLR n[43.02]MEK[272.20]PSPLLVGR n[43.02]MEK[272.20]TELIQK[272.20]AK[272.20]LAEQAER n[43.02]MEK[272.20]TLETVPLER n[43.02]MEMK[272.20]K[272.20]K[272.20]INLELR n[43.02]MESGFTSK[272.20]DTYLSHFNPR n[43.02]MFAK[272.20]ATR n[43.02]MFSWVSK[272.20]DAR n[43.02]MK[272.20]K[272.20]SYSGGTR n[43.02]MMGHRPVLVLSQNTK[272.20]R n[43.02]MNNQK[272.20]QQK[272.20]PTLSGQR n[43.02]MNQEK[272.20]LAK[272.20]LQAQVR n[43.02]MQPASAK[272.20]WYDR n[43.02]MQSNK[272.20]TFNLEK[272.20]QNHTPR n[43.02]MTENSTSAPAAK[272.20]PK[272.20]R n[43.02]SDK[272.20]LPYK[272.20]VADIGLAAWGR n[43.02]SDNGELEDK[272.20]PPAPPVR n[43.02]SDSEK[272.20]LNLDSIIGR n[43.02]SGGK[272.20]YVDSEGHLYTVPIR n[43.02]SGSSSVAAMK[272.20]K[272.20]VVQQLR n[43.02]SHPSPQAK[272.20]PSNPSNPR n[43.02]SK[272.20]K[272.20]ISGGSVVEMQGDEMTR n[43.02]SK[272.20]NTVSSAR n[43.02]SK[272.20]SESPK[272.20]EPEQLR n[43.02]SK[272.20]SFQQSSLSR n[43.02]SK[272.20]SLK[272.20]K[272.20]LVEESR n[43.02]SQAEFEK[272.20]AAEEVR n[43.02]SSESK[272.20]EQHNVSPR n[43.02]SSK[272.20]TASTNNIAQAR n[43.02]SSTQFNK[272.20]GPSYGLSAEVK[272.20]NR n[43.02]TENSTSAPAAK[272.20]PK[272.20]R n[43.02]TVGK[272.20]SSK[272.20]MLQHIDYR n[43.02]YQK[272.20]STELLIR  iTRAQ 116/ iTRAQ 117 0.87 1.62 2.24 2.18 2.32 1.13 0.97 1.69 1.56 1.78 2.13 1.04 2.53 2.08 1.25 1.78 1.38 1.62 2.00 2.10 1.41 1.83 1.61 1.88 2.51 1.81 1.64 2.29 1.46 1.86 1.40 1.26 1.41 2.24 1.55 2.94 1.92 2.17 1.47 1.10 1.16  IPI # IPI00171611 IPI00844578 IPI00021263 IPI00216318 IPI00009253 IPI00032958 IPI00013877 IPI00332493 IPI00455134 IPI00009057 IPI00018146 IPI00396378 IPI00165393 IPI00027681 IPI00029656 IPI00017184 IPI00784614 IPI00290770 IPI00180128 IPI00221035 IPI00015029 IPI00304596 IPI00550239 IPI00012007 IPI00419979 IPI00027423 IPI00009236 IPI00027240 IPI00003927 IPI00027223 IPI00007280 IPI00215965 IPI00017297 IPI00017256 IPI00010182 IPI00032107 IPI00221232 IPI00015262 IPI00550239 IPI00027285 IPI00171611  218  Appendix B.12 Peptides identified by iTRAQ-TAILS in membrane fractions of HMEC2. Combined list of Mascot and X!Tandem entries, sorted by Peptide, as identified by iTRAQ-TAILS analysis of proteins from sMT6ΔF (iTRAQ 116) or sMT6EΔA (iTRAQ 117) treated cells. iTRAQ ratios represent uncorrected values. Spectra assigned to quantifiable peptides with an iProphet probability (Prob) of > 0.95 were further analyzed. The amino (N)-termini is indicated as either natural or neo.The charge (z) state of the peptide, precursor mass and error, N-terminus modification, and associated international protein index (IPI) number are indicated. N-termini Natural Neo Natural Neo Neo Neo Natural Natural Neo Natural Natural Natural Neo Neo Natural Natural Neo Neo Neo Natural Natural Natural Neo Natural Neo Natural Natural Neo Neo Neo Natural Neo Neo Neo Natural Natural  Prob 0.99 1.00 1.00 0.96 1.00 1.00 0.96 0.88 1.00 0.85 0.97 1.00 0.89 0.93 1.00 1.00 0.98 1.00 0.93 0.81 0.98 0.96 1.00 0.99 0.99 0.99 0.99 0.99 0.84 0.97 0.86 0.99 0.99 0.83 0.99 0.92  z 2 3 3 2 2 3 2 3 4 3 2 2 2 2 3 3 3 3 2 2 2 3 2 2 3 3 3 2 3 2 3 3 4 2 3 3  Precursor Mass 1200.5305 1757.8896 1743.8892 1303.5632 1319.493 2468.1535 1214.5244 1293.7654 1850.9669 1968.9726 1100.5485 1916.7826 952.4375 1208.5462 2264.9178 1671.8137 1589.7864 2538.9121 1330.612 973.5182 1398.6069 1402.6743 1396.5538 1127.5732 2568.9577 1551.7261 1648.8947 1061.4933 1428.7547 1249.4881 1438.6857 1334.7671 1997.037 1006.4765 1424.7887 1349.7589  Error [Da] -0.0552 -0.0732 -0.0695 -0.0685 -0.0777 -0.1328 -0.0773 -0.0363 -0.0568 -0.1151 -0.0572 -0.1371 -0.0472 -0.0805 -0.1669 -0.0647 -0.0393 -0.1396 -0.0727 -0.0496 -0.0788 -0.0544 -0.0799 -0.0585 -0.268 -0.0556 -0.116 -0.0474 -0.0422 -0.0776 -0.0472 -0.0486 -0.0568 -0.0553 -0.053 -0.0358  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ  Peptide n[145.11]AANYSSTSTR n[145.11]AAQTSPSPK[272.20]AGAATGR n[145.11]AAVAATAAAK[272.20]GNGGGGGR n[145.11]ADC[160.03]ISEPVNR n[145.11]AEGPDEDSSNR n[145.11]AGGAAQLALDK[272.20]SDSHPSDALTR n[145.11]APDQDEIQR n[145.11]APEVLPK[272.20]PR n[145.11]APHNPAPPTSTVIHIR n[145.11]APSVPAAEPEYPK[272.20]GIR n[145.11]AQTAAATAPR n[145.11]ASGGGVPTDEEQATGLER n[145.11]ASQNSFR n[145.11]ASSPGGVYATR n[145.11]DDEVDVDGTVEEDLGK[272.20]SR n[145.11]DITDGNSEHLK[272.20]R n[145.11]DNADSSPVVDK[272.20]R n[145.11]DVK[272.20]C[160.03]DMEVSC[160.03]PDGYTC[160.03]C[160.03]R n[145.11]EAGLETESPVR n[145.11]EAVVISGR n[145.11]EEQPPETAAQR n[145.11]ESAGADTRPTVR n[145.11]FGSDQSENVDR n[145.11]GAGGALFVHR n[145.11]GETGHVAINC[160.03]SK[272.20]TSEVNC[160.03]YR n[145.11]GHQQLYWSHPR n[145.11]GK[272.20]VK[272.20]VGVNGFGR n[145.11]GPNIC[160.03]TTR n[145.11]GQTFEYLK[272.20]R n[145.11]GSDQSENVDR n[145.11]GTTAK[272.20]EEMER n[145.11]LHLGVTPSVIR n[145.11]LTPTHYLTK[272.20]HDVER n[145.11]LWSSAGSR n[145.11]MAPEVLPK[272.20]PR n[145.11]MK[272.20]LTDSVLR  iTRAQ 116/ iTRAQ 117 1.93 1.65 2.96 2.04 1.90 2.64 2.11 1.34 1.76 2.64 1.71 1.97 2.54 1.85 2.24 1.76 1.24 1.45 1.34 2.39 1.68 1.44 1.11 1.14 1.32 0.96 1.82 1.36 2.05 1.18 2.09 1.68 1.83 2.40 1.74 3.00  IPI # IPI00301280 IPI00303476 IPI00384497 IPI00017895 IPI00009904 IPI00028031 IPI00021794 IPI00015972 IPI00303726 IPI00172460 IPI00294911 IPI00021785 IPI00296053 IPI00418471 IPI00027230 IPI00009950 IPI00328753 IPI00181753 IPI00009885 IPI00011307 IPI00386755 IPI00025796 IPI00258804 IPI00291328 IPI00430812 IPI00182289 IPI00219018 IPI00220350 IPI00218337 IPI00258804 IPI00016968 IPI00298237 IPI00028635 IPI00744711 IPI00015972 IPI00152695  219  N-termini Natural Natural Natural Natural Natural Natural Natural Natural Neo Neo Natural Neo Neo Neo Neo Natural Natural Neo Natural Neo Neo Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural Natural  Prob 0.97 0.97 0.98 0.83 1.00 1.00 1.00 1.00 0.85 0.88 0.98 1.00 0.91 0.87 0.98 0.98 0.98 0.94 0.91 1.00 0.94 0.98 1.00 1.00 0.99 0.93 0.88 0.87 0.97 1.00 0.94 1.00 0.99 0.97 1.00 0.98 0.97 0.98 0.97 1.00 1.00  z 3 3 3 3 2 3 2 3 3 3 2 3 3 2 2 4 3 3 2 3 3 3 3 2 3 2 2 3 2 3 3 3 2 4 3 3 2 3 2 2 3  Precursor Mass 1639.7668 1630.8429 1304.6745 1222.7342 1513.6791 2003.0072 1349.5069 1750.6703 1512.7088 1387.8057 1219.5316 1467.731 1573.8509 977.4842 1146.5606 1889.0118 1466.7537 1432.7138 949.4001 1477.7691 1439.7134 1357.8135 2263.0467 1584.7349 2137.9548 1387.6098 1459.5914 1475.761 1403.6539 1418.7366 1473.7952 1699.8982 1587.6366 2402.1155 1917.9372 2162.989 1134.5405 1843.9029 1439.6522 1633.7452 1786.8867  Error [Da] -0.0716 -0.0761 -0.0369 -0.0299 -0.0816 -0.0972 -0.0568 -0.0814 -0.0477 -0.07 -0.0599 -0.0606 -0.0522 -0.0425 -0.0511 -0.0578 -0.044 -0.0679 -0.0406 -0.0406 -0.0483 -0.0514 -0.1003 -0.0993 -0.0899 -0.0715 -0.0933 -0.0477 -0.0839 -0.0871 -0.0445 -0.0595 -0.1067 -0.1213 -0.0813 -0.1187 -0.0712 -0.0854 -0.0965 -0.1055 -0.0914  N-term Modification iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ iTRAQ Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine Ac-lysine  Peptide n[145.11]MQPASAK[272.20]WYDR n[145.11]MTK[272.20]GTSSFGK[272.20]R n[145.11]PAVSK[272.20]GDGMR n[145.11]PEVLPK[272.20]PR n[145.11]PGPTPSGTNVGSSGR n[145.11]PGVTVK[272.20]DVNQQEFVR n[145.11]SAPGEDEEC[160.03]GR n[145.11]SHGSQETDEEFDAR n[145.11]SK[272.20]DNEGSWFR n[145.11]SK[272.20]LVVITQGR n[145.11]SQDASDGLQR n[145.11]SQLLGSAHEVQR n[145.11]SSSGVIPNEK[272.20]IR n[145.11]SSTSTVPR n[145.11]STAAQQELR n[145.11]TENSTSAPAAK[272.20]PK[272.20]R n[145.11]TGYTPDEK[272.20]LR n[145.11]VK[272.20]MAAAGGGGGGGR n[145.11]VNDGDMR n[145.11]VSSAAQTEK[272.20]GGR n[145.11]YVGDEAQSK[272.20]R n[43.02]AAAK[272.20]VALTK[272.20]R n[43.02]AAAMDVDTPSGTNSGAGK[272.20]K[272.20]R n[43.02]AATASAGAGGIDGK[272.20]PR n[43.02]AAVK[272.20]DSC[160.03]GK[272.20]GEMATGNGR n[43.02]ADNEK[272.20]LDNQR n[43.02]ADQGEK[272.20]ENPMR n[43.02]AHYK[272.20]AADSK[272.20]R n[43.02]AK[272.20]ISSPTETER n[43.02]AK[272.20]PAQGAK[272.20]YR n[43.02]AK[272.20]PLTDSEK[272.20]R n[43.02]AQAK[272.20]INAK[272.20]ANEGR n[43.02]AQDQGEK[272.20]ENPMR n[43.02]MQSNK[272.20]TFNLEK[272.20]QNHTPR n[43.02]MTENSTSAPAAK[272.20]PK[272.20]R n[43.02]SGGK[272.20]YVDSEGHLYTVPIR n[43.02]SK[272.20]NTVSSAR n[43.02]SK[272.20]SESPK[272.20]EPEQLR n[43.02]SK[272.20]SFQQSSLSR n[43.02]SSK[272.20]TASTNNIAQAR n[43.02]TENSTSAPAAK[272.20]PK[272.20]R  iTRAQ 116/ iTRAQ 117 1.37 1.53 2.13 2.02 1.97 2.55 1.78 2.41 2.27 1.98 1.49 1.24 5.00 2.13 1.73 3.28 1.74 2.16 2.07 2.51 1.58 1.90 1.12 2.14 1.36 2.02 1.59 2.13 1.52 1.58 1.70 1.72 1.42 3.80 2.51 1.15 1.46 2.27 2.24 1.62 2.39  IPI # IPI00015029 IPI00220871 IPI00016621 IPI00015972 IPI00220835 IPI00215780 IPI00217882 IPI00025086 IPI00304435 IPI00413916 IPI00009276 IPI00744706 IPI00154473 IPI00032875 IPI00019502 IPI00550239 IPI00219385 IPI00027834 IPI00023673 IPI00024317 IPI00003269 IPI00007084 IPI00003386 IPI00219729 IPI00334159 IPI00012578 IPI00746438 IPI00554793 IPI00013895 IPI00002459 IPI00004358 IPI00000643 IPI00376798 IPI00304596 IPI00550239 IPI00009236 IPI00007280 IPI00215965 IPI00017297 IPI00221232 IPI00550239  220  APPENDIX C: CLINICAL RESEARCH ET