Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Prevalence of carnitine palmitoyltransferase 1A (CPT1A) variant p.P479L and risk of infant mortality… Collins, Sorcha Alexia 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2011_spring_collins_sorcha.pdf [ 1.17MB ]
Metadata
JSON: 24-1.0071546.json
JSON-LD: 24-1.0071546-ld.json
RDF/XML (Pretty): 24-1.0071546-rdf.xml
RDF/JSON: 24-1.0071546-rdf.json
Turtle: 24-1.0071546-turtle.txt
N-Triples: 24-1.0071546-rdf-ntriples.txt
Original Record: 24-1.0071546-source.json
Full Text
24-1.0071546-fulltext.txt
Citation
24-1.0071546.ris

Full Text

PREVALENCE	
  OF	
  CARNITINE	
  PALMITOYLTRANSFERASE	
  1A	
  (CPT1A)	
  VARIANT	
   p.P479L	
  AND	
  RISK	
  OF	
  INFANT	
  MORTALITY	
  IN	
  NUNAVUT,	
  NORTHWEST	
   TERRITORIES,	
  AND	
  YUKON	
    by	
  	
   	
    	
    SORCHA	
  ALEXIA	
  COLLINS	
   BSc,	
  the	
  University	
  of	
  Victoria,	
  2005	
   	
    A	
  THESIS	
  SUBMITTED	
  IN	
  PARTIAL	
  FULFILLMENT	
  OF	
   THE	
  REQUIREMENTS	
  FOR	
  THE	
  DEGREE	
  OF	
   MASTER	
  OF	
  SCIENCE	
   in	
   THE	
  FACULTY	
  OF	
  GRADUATE	
  STUDIES	
   (Genetics)	
   	
   THE	
  UNIVERSITY	
  OF	
  BRITISH	
  COLUMBIA	
   (Vancouver)	
   	
   	
   January	
  2011	
   ©	
  Sorcha	
  Alexia	
  Collins,	
  2010	
   	
    ABSTRACT	
   	
   Introduction:	
   The	
   p.P479L	
   (c.1436C>T)	
   variant	
   of	
   hepatic	
   CPT1A	
   is	
   frequent	
   in	
   Inuit	
   and	
   British	
  Columbia	
  First	
  Nations	
  populations	
  of	
  Canada.	
  CPT1A	
  is	
  a	
  major	
  regulatory	
  point	
  in	
   long	
   chain	
   fatty	
   acid	
   oxidation	
   in	
   the	
   liver.	
   CPT1A	
   deficiency	
   is	
   an	
   autosomal	
   recessive	
   disorder	
   that	
   causes	
   metabolic	
   decompensation	
   triggered	
   by	
   fasting,	
   which	
   can	
   progress	
   to	
   seizures	
  and	
  sudden	
  death,	
  if	
  not	
  treated.	
  This	
  study	
  assesses	
  prevalence	
  and	
  clinical	
  impact	
   of	
   the	
   P479L	
   variant	
   in	
   the	
   Canadian	
   territories	
   and	
   reviews	
   modifiable	
   risk	
   factors	
   associated	
  with	
  infant	
  mortality	
  (IM)	
  in	
  Nunavut.	
   Methods:	
  Ethics	
  approval	
  was	
  obtained	
  from	
  university	
  REBs	
  and	
  local	
  research	
  institutes,	
   with	
  consultation	
  with	
  territorial	
  Aboriginal	
  groups.	
  Newborn	
  screening	
  blood	
  spots	
  from	
  all	
   infants	
  born	
  in	
  2006	
  (n=1584)	
  and	
  sudden	
  death	
  in	
  infancy	
  cases	
  (n=31;	
  1999-­‐2008)	
  in	
  the	
   territories	
  were	
  genotyped	
  for	
  the	
  P479L	
  variant.	
  	
  	
   Results:	
  P479L	
  homozygosity	
  in	
  each	
  territory	
  was	
  64%,	
  3%,	
  and	
  1%	
  for	
  Nunavut,	
  NWT,	
  and	
   Yukon,	
  respectively.	
  Within	
  NWT,	
  homozygosity	
  was	
  highest	
  in	
  Inuvialuit	
  (21%)	
  and	
  very	
  low	
   in	
  First	
  Nations	
  (1%).	
  Homozygosity	
  in	
  sudden	
  death	
  cases	
  was	
  highest	
  in	
  Nunavut	
  (18/20)	
   and	
   associated	
   with	
   an	
   increased	
   risk	
   (OR:	
   5.15;	
   95%	
   CI:	
   1.19-­‐22.38).	
   Homozygosity	
   was	
   29%	
  for	
  NWT	
  cases	
  (2/7),	
  67%	
  in	
  NWT	
  Inuvialuit	
  (2/3),	
  and	
  was	
  not	
  present	
  in	
  Yukon	
  cases	
   (0/4).	
  	
   Review	
   of	
   Nunavut	
   IM	
   cases	
   (n=78;	
   1999-­‐2008)	
   identified	
   Sudden	
   Infant	
   Death	
   Syndrome	
   (SIDS)	
  and	
  Sudden	
  Unexpected	
  Death	
  in	
  Infancy	
  (SUDI)	
  as	
  the	
  leading	
  causes	
  of	
  infant	
  death	
   	
    ii	
    (47%),	
   followed	
   by	
   death	
   due	
   to	
   infectious	
   disease	
   (28%).	
   At	
   least	
   23%	
   of	
   IM	
   cases	
   were	
   premature.	
  	
   Discussion:	
   The	
   P479L	
   variant	
   is	
   very	
   frequent	
   in	
   the	
   Inuit/Inuvialuit	
   of	
   Canada.	
   Although	
   the	
   sample	
   size	
   was	
   small,	
   there	
   was	
   an	
   associated	
   risk	
   for	
   sudden	
   death	
   in	
   infants	
   homozygous	
   for	
   the	
   variant	
   in	
   Nunavut.	
   SIDS	
   and	
   SUDI	
   are	
   the	
   leading	
   causes	
   of	
   infant	
   death	
  in	
  Nunavut,	
  followed	
  by	
  death	
  due	
  to	
  infectious	
  disease.	
  Since	
  deaths	
  in	
  these	
  two	
   categories	
   are	
   largely	
   preventable,	
   prevention	
   strategies	
   and	
   further	
   exploration	
   into	
   the	
   P479L	
   variant	
   and	
   other	
   determinants	
   are	
   indicated.	
   Management	
   strategies,	
   including	
   newborn	
   screening	
   for	
   the	
   P479L	
   variant,	
   need	
   to	
   be	
   developed	
   in	
   consultation	
   with	
   health	
   authorities,	
  local	
  medical	
  professionals,	
  and	
  local	
  communities.	
  	
    	
    iii	
    PREFACE	
   	
   This	
   research	
   was	
   conducted	
   with	
   ethics	
   approval	
   and	
   regulatory	
   approval	
   from	
   UBC	
   Research	
   ethics	
   board	
   (Appendix	
   A)	
   Aurora	
   Research	
   Institute	
   (NWT),	
   Stanton	
   Territorial	
   Health	
   Authority	
   (NWT),	
   Nunavut	
   Research	
   Institute,	
   and	
   the	
   University	
   of	
   Manitoba.	
   Territorial	
  Aboriginal	
  organisation	
  consultation	
  included:	
  Nunavut	
  Tunngavik	
  Inc.	
  (NTI),	
  the	
   Inuvialuit	
  Regional	
  Corporation	
  (NWT),	
  the	
  Dene	
  Nation	
  (NWT),	
  and	
  the	
  Yukon	
  First	
  Nations	
   Health	
  Commission.	
   Dr.	
   Laura	
   Arbour	
   (LA)	
   identified	
   the	
   overall	
   CPT1	
   project,	
   developed	
   the	
   concept	
   of	
   the	
   project	
   through	
   consultation	
   with	
   stakeholders	
   and	
   offered	
   guidance,	
   structure	
   and	
   overview	
   during	
   the	
   project.	
   I	
   planned	
   the	
   details	
   of	
   data	
   collection,	
   methods	
   of	
   analysis	
   and	
  carried	
  out	
  the	
  analysis	
  for	
  the	
  project.	
  Sarah	
  McIntosh	
  submitted	
  ethics	
  applications	
   and	
  assisted	
  in	
  the	
  maintenance	
  of	
  ethics	
  approvals	
  throughout	
  the	
  project.	
   A	
  version	
  of	
  chapter	
  2	
  has	
  been	
  published.	
  Collins	
  SA,	
  Sinclair	
  G,	
  McIntosh	
  S,	
  Bamforth	
  F,	
   Thompson	
  R,	
  Sobol	
  I,	
  Osborne	
  G,	
  Corriveau	
  A,	
  Santos	
  M,	
  Hanley	
  B,	
  Greenberg	
  CR,	
  Vallance	
   H,	
  Arbour	
  L.	
  Carnitine	
  palmitoyltransferase	
  1A	
  (CPT1A)	
  P479L	
  prevalence	
  in	
  live	
  newborns	
  in	
   Yukon,	
   Northwest	
   Territories,	
   and	
   Nunavut.	
   Mol.	
   Genet.	
   Metab.	
   2010	
   Nov;101(2-­‐3):200-­‐ 204.	
   I	
   conducted	
   genotyping	
   of	
   dried	
   blood	
   spot	
   samples	
   for	
   the	
   Yukon,	
   Northwest	
   Territories	
   and	
   the	
   Qikiqtani/Baffin	
   Island	
   and	
   Kitikmeot	
   regions	
   of	
   Nunavut	
   in	
   the	
   BC	
   newborn	
  screening	
  lab,	
  Vancouver	
  BC	
  under	
  the	
  supervision	
  of	
  LA,	
  Dr.	
  Hilary	
  Vallance,	
  and	
   Dr.	
   Graham	
   Sinclair.	
   I	
   analyzed	
   the	
   genotyping	
   results	
   and	
   wrote	
   the	
   manuscript.	
   LA	
   assisted	
   with	
   editing	
   and	
   structure	
   of	
   the	
   manuscript.	
   The	
   Newborn	
   Screening	
   Program,	
   Cadham	
   Provincial	
   Laboratory,	
   Manitoba	
   genotyped	
   samples	
   from	
   the	
   Kivalliq	
   region,	
   Nunavut.	
  	
   A	
   version	
   of	
   chapter	
   3	
   will	
   be	
   submitted	
   for	
   publication.	
   I	
   conducted	
   the	
   chart	
   review	
   of	
   infant	
  mortality	
  cases	
  in	
  Nunavut	
  under	
  the	
  supervision	
  of	
  LA,	
  Geraldine	
  Osborne,	
  Deputy	
   Chief	
  Medical	
  Officer	
  of	
  Health,	
  Nunavut,	
  and	
  Tim	
  Neily,	
  Chief	
  Coroner,	
  Nunavut.	
  I	
  assisted	
   in	
   review	
   of	
   infant	
   mortality	
   cases	
   for	
   NWT	
   with	
   Maria	
   Santos,	
   Epidemiologist	
   for	
   NWT	
   under	
   advisement	
   of	
   Andre	
   Corriveau,	
   then	
   Chief	
   Medical	
   Officer	
   of	
   Health,	
   NWT.	
   I	
   conducted	
   genotyping	
   of	
   cases	
   for	
   NWT	
   and	
   Kitikmeot,	
   Nunavut.	
   Other	
   cases	
   were	
   genotyped	
  at	
  time	
  of	
  birth	
  or	
  death.	
  Yukon	
  samples	
  were	
  genotyped	
  by	
  Dr.	
  Graham	
  Sinclair.	
   Dr.	
  Sinclair	
  and	
  I	
  genotyped	
  BC	
  First	
  Nations	
  2004	
  DBS	
  samples	
  under	
  the	
  supervision	
  of	
  Dr.	
   Hilary	
  Vallance	
  and	
  with	
  the	
  support	
  of	
  LA.	
   A	
   version	
   of	
   chapter	
   4	
   will	
   be	
   submitted	
   for	
   publication.	
   I	
   conducted	
   the	
   chart	
   review	
   as	
   described	
   above	
   for	
   chapter	
   3.	
   I	
   analysed	
   the	
   data	
   and	
   wrote	
   the	
   manuscript.	
   LA	
   offered	
   guidance	
   and	
   assisted	
   with	
   editing	
   of	
   the	
   manuscript.	
   Sam	
   Lauson	
   worked	
   with	
   Nunavut	
   Vital	
  Statistics	
  to	
  cross-­‐reference	
  coroner	
  infant	
  mortality	
  case	
  data	
  with	
  the	
  vital	
  statistics	
   database.	
  	
   	
    iv	
    TABLE	
  OF	
  CONTENTS	
   Abstract	
  ............................................................................................................................................	
  ii	
   Preface	
  .............................................................................................................................................	
  iv	
   Table	
  of	
  Contents	
  ............................................................................................................................	
  v	
   List	
  of	
  Tables	
  ................................................................................................................................	
  viii	
   List	
  of	
  Figures	
  ................................................................................................................................	
  ix	
   List	
  of	
  Abbreviations	
  .....................................................................................................................	
  x	
   Acknowledgements	
  .....................................................................................................................	
  xi	
   Dedication	
  ......................................................................................................................................	
  xii	
   Chapter	
  1.	
   Introduction	
  ...........................................................................................................	
  1	
   1.1	
   Purpose	
  of	
  Study	
  ............................................................................................................................	
  1	
   1.2	
   Study	
  Rationale	
  ..............................................................................................................................	
  1	
   1.3	
   Literature	
  Review	
  .........................................................................................................................	
  2	
   1.3.1	
   Infant	
  Mortality	
  in	
  Canada’s	
  North	
  ..................................................................................................	
  2	
   1.3.1.1	
   1.3.1.2	
   1.3.1.3	
   1.3.1.4	
    The	
  Canadian	
  Territories	
  ..............................................................................................................................	
  2	
   The	
  Inuit	
  and	
  Inuvialuit	
  of	
  Canada	
  ...........................................................................................................	
  3	
   Inuit	
  Traditional	
  Diet	
  ......................................................................................................................................	
  4	
   Infant	
  Mortality	
  in	
  the	
  Territories	
  ............................................................................................................	
  5	
    1.3.2	
   Sudden	
  Infant	
  Death	
  Syndrome	
  and	
  Sudden	
  Unexpected	
  Death	
  in	
  Infancy	
  ..................	
  7	
   1.3.2.1	
   SIDS/SUDI	
  Risk	
  Factors	
  .................................................................................................................................	
  8	
   1.3.2.2	
   SUDI	
  and	
  Fatty	
  Acid	
  Oxidation	
  Disorders	
  ..............................................................................................	
  9	
    1.3.3	
   Carnitine	
  Palmitoyltransferase	
  1A	
  Deficiency	
  .........................................................................	
  10	
   1.3.3.1	
   1.3.3.2	
   1.3.3.3	
   1.3.3.4	
   1.3.3.5	
    Carnitine	
  Palmitoyltransferase	
  1	
  (CPT1)	
  and	
  the	
  CPT	
  Pathway	
  ..............................................	
  10	
   Malonyl-­‐CoA	
  ....................................................................................................................................................	
  14	
   Hormones	
  and	
  CPT1A	
  Expression	
  .........................................................................................................	
  14	
   Classical	
  CPT1A	
  Deficiency	
  .......................................................................................................................	
  15	
   The	
  p.P479L	
  CPT1A	
  Variant	
  and	
  CPT1A	
  Deficiency	
  ......................................................................	
  16	
    1.3.4	
   P479L	
  Impact	
  on	
  Health	
  ....................................................................................................................	
  17	
   1.3.4.1	
   P479L	
  Advantage?	
  ........................................................................................................................................	
  17	
   1.3.4.2	
   P479L	
  and	
  Infant	
  Morbidity	
  and	
  Mortality	
  ........................................................................................	
  18	
    1.3.5	
   Newborn	
  Screening	
  .............................................................................................................................	
  20	
    Chapter	
  2.	
   Carnitine	
  Palmitoyltransferase	
  1A	
  (CPT1A)	
  p.P479L	
  Prevalence	
  in	
   Live	
  Newborns	
  in	
  Nunavut,	
  Northwest	
  Territories,	
  and	
  Yukon	
  ..................................	
  24	
   2.1	
   Introduction	
  .................................................................................................................................	
  24	
   	
    v	
    2.2	
   Methods	
  .........................................................................................................................................	
  26	
   2.2.1	
   2.2.2	
   2.2.3	
   2.2.4	
    Ethics	
  ..........................................................................................................................................................	
  26	
   Sample	
  Collection	
  .................................................................................................................................	
  26	
   Genotype	
  Analysis	
  ................................................................................................................................	
  27	
   Statistical	
  Analysis	
  ................................................................................................................................	
  28	
    2.3	
   Results	
  ............................................................................................................................................	
  28	
   2.4	
   Discussion	
  .....................................................................................................................................	
  30	
    Chapter	
  3.	
   Does	
  the	
  CPT1A	
  p.P479L	
  Variant	
  Play	
  a	
  Role	
  in	
  Excess	
  Infant	
   Mortality	
  Cases	
  of	
  Nunavut,	
  NWT,	
  and	
  Yukon?	
  .................................................................	
  34	
   3.1	
   Introduction	
  .................................................................................................................................	
  34	
   3.2	
   Methods	
  .........................................................................................................................................	
  35	
   3.2.1	
   3.2.2	
   3.2.3	
   3.2.4	
    Ethics	
  ..........................................................................................................................................................	
  35	
   Sample	
  Collection	
  .................................................................................................................................	
  35	
   Genotype	
  Analysis	
  ................................................................................................................................	
  37	
   Statistical	
  Analysis	
  ................................................................................................................................	
  37	
    3.3	
   Results	
  ............................................................................................................................................	
  37	
   3.4	
   Discussion	
  .....................................................................................................................................	
  40	
    Chapter	
  4.	
   Retrospective	
  Review	
  of	
  Infant	
  Mortality	
  in	
  Nunavut	
  (1999-­‐2008)	
  .	
  46	
   4.1	
   Introduction	
  .................................................................................................................................	
  46	
   4.2	
   Methods	
  .........................................................................................................................................	
  47	
   4.3	
   Results	
  ............................................................................................................................................	
  49	
   4.3.1	
   4.3.2	
   4.3.3	
   4.3.4	
   4.3.5	
   4.3.6	
    All	
  Causes	
  of	
  Death	
  ...............................................................................................................................	
  51	
   Neonatal	
  and	
  Post-­‐Neonatal	
  Deaths	
  .............................................................................................	
  52	
   Prematurity	
  .............................................................................................................................................	
  53	
   SIDS/SUDI	
  ................................................................................................................................................	
  54	
   The	
  P479L	
  Variant	
  of	
  CPT1A	
  ...........................................................................................................	
  55	
   Other	
  Factors	
  ..........................................................................................................................................	
  55	
    4.4	
   Discussion	
  .....................................................................................................................................	
  55	
   4.5	
   Conclusion	
  ....................................................................................................................................	
  59	
    Chapter	
  5.	
   General	
  Discussion	
  &	
  Future	
  Directions	
  .....................................................	
  60	
   5.1	
   The	
  P479L	
  Variant	
  in	
  Canada’s	
  North	
  .................................................................................	
  60	
   5.2	
   Modifiable	
  Risk	
  Factors	
  of	
  Infant	
  Mortality	
  in	
  Nunavut	
  ................................................	
  62	
   5.3	
   Is	
  There	
  a	
  P479L	
  Variant	
  Advantage?	
  .................................................................................	
  63	
   5.4	
   Conclusion	
  and	
  Future	
  Research	
  Directions	
  .....................................................................	
  65	
   5.4.1	
   Public	
  Health	
  Programs	
  .....................................................................................................................	
  65	
   5.4.2	
   Implications	
  of	
  Newborn	
  Screening	
  for	
  the	
  P479L	
  Variant	
  ...............................................	
  66	
   	
    vi	
    5.4.3	
   Characterisation	
  of	
  the	
  P479L	
  Variant	
  ........................................................................................	
  67	
   5.4.4	
   Historical	
  Significance	
  of	
  the	
  P479L	
  Variant	
  ............................................................................	
  68	
   5.4.5	
   Infant	
  Mortality	
  in	
  Nunavut	
  .............................................................................................................	
  69	
   5.5	
   Limitations	
  ...................................................................................................................................	
  69	
    References	
  .....................................................................................................................................	
  72	
   Appendix	
  A.	
  ...................................................................................................................................	
  89	
   	
   	
    	
    vii	
    LIST	
  OF	
  TABLES	
  	
   Table	
  1.1	
    Leading	
  causes	
  of	
  infant	
  death	
  for	
  all	
  of	
  Canada,	
  2000-­‐2005	
  ............................................	
  6	
    Table	
  1.2	
    Infant	
  mortality	
  rates,	
  birth	
  rates,	
  and	
  Aboriginal	
  population	
  of	
  the	
  Canadian	
   Territories	
  .................................................................................................................................................	
  7	
    Table	
  2.1	
    Distribution	
  of	
  CPT1A	
  P479L	
  genotypes	
  with	
  estimated	
  allele	
  frequencies	
  in	
   infants	
  born	
  in	
  2006	
  in	
  the	
  Northern	
  territories	
  of	
  Canada.	
  ...........................................	
  29	
    Table	
  3.1	
    Distribution	
  of	
  CPT1A	
  P479L	
  genotypes	
  with	
  estimated	
  allele	
  frequencies	
  in	
  infant	
   mortality	
  cases	
  (sudden	
  death	
  in	
  infancy	
  and	
  infant	
  deaths	
  due	
  to	
  infectious	
   disease)	
  and	
  in	
  infants	
  born	
  in	
  2006	
  in	
  the	
  territories	
  of	
  Canada	
  ................................	
  39	
    Table	
  4.1	
    Information	
  reported	
  for	
  infant	
  mortality	
  cases	
  as	
  documented	
  in	
  Nunavut	
  (n=78;	
   July	
  1,	
  1999-­‐June	
  30,	
  2008)	
  ............................................................................................................	
  50	
    Table	
  4.2	
    Infant	
  mortality	
  rates	
  and	
  causes	
  of	
  death	
  as	
  documented	
  in	
  Nunavut	
  by	
  region	
   (n=78;	
  July	
  1,	
  1999-­‐June	
  30,	
  2008)	
  .............................................................................................	
  51	
    Table	
  4.3	
    Gestational	
  age	
  specific	
  rates	
  for	
  infant	
  mortality	
  cases	
  documented	
  in	
  Nunavut	
   (n=43;	
  2000-­‐2007)	
  ............................................................................................................................	
  53	
    Table	
  4.4	
    Information	
  reported	
  for	
  SIDS/SUDI	
  cases	
  as	
  documented	
  in	
  Nunavut	
  (n=78;	
  July	
   1,	
  1999-­‐June	
  30,	
  2008)	
  .....................................................................................................................	
  54	
    Table	
  A.1	
    Variables	
  included	
  from	
  coroner’s	
  report	
  for	
  infant	
  mortality	
  cases	
  documented	
  in	
   Nunavut	
  (n=78;	
  July	
  1,	
  1999-­‐June	
  30,	
  2008)	
  ..........................................................................	
  89	
    Table	
  A.2	
    Causes	
  of	
  death	
  as	
  stated	
  by	
  autopsy	
  report	
  for	
  infant	
  mortality	
  cases	
  documented	
   in	
  Nunavut	
  (n=78;	
  July	
  1,	
  1999-­‐June	
  30,	
  2008)	
  ....................................................................	
  90	
    	
    	
    viii	
    LIST	
  OF	
  FIGURES	
   Figure	
  1.1	
    2006	
  Census	
  Subdivisions	
  (CSDs)	
  within	
  Inuit	
  Nunaat	
  with	
  an	
  Inuit	
  identity	
   population	
  of	
  100	
  or	
  more	
  ................................................................................................................	
  3	
    Figure	
  1.2	
    Carnitine	
  palmitoyltransferase	
  pathway	
  .................................................................................	
  12	
    Figure	
  1.3	
    Wilson	
  and	
  Jungner	
  classic	
  screening	
  criteria	
  .......................................................................	
  20	
    Figure	
  1.4	
    World	
  Health	
  Organization	
  amendments	
  to	
  Wilson	
  and	
  Jungner	
  criteria	
  for	
   screening	
  	
  ...............................................................................................................................................	
  21	
    Figure	
  3.1	
    Distribution	
  of	
  CPT1A	
  P479L	
  homozygosity	
  in	
  infant	
  mortality	
  cases	
  and	
  in	
  infants	
   born	
  in	
  2006	
  in	
  the	
  territories	
  of	
  Canada.	
  ...............................................................................	
  38	
    Figure	
  4.1	
    Infant	
  mortality	
  rates	
  as	
  documented	
  in	
  Nunavut	
  by	
  region	
  (n=78;	
  July	
  1,	
  1999-­‐ June	
  30,	
  2008)	
  ......................................................................................................................................	
  50	
    Figure	
  4.2	
    Nunavut	
  infant	
  mortality	
  cases	
  by	
  cause	
  of	
  death	
  categories	
  (n=78;	
  July	
  1,	
  1999-­‐ June	
  30,	
  2008)	
  ......................................................................................................................................	
  52	
    	
    	
    ix	
    LIST	
  OF	
  ABBREVIATIONS	
  	
   AFLP	
  –	
  acute	
  fatty	
  liver	
  of	
  pregnancy	
   CPT1	
  –	
  carnitine	
  palmitoyltransferase	
  1	
   DBS	
  –	
  dried	
  blood	
  spot	
  card	
   FAO	
  –	
  fatty	
  acid	
  oxidation	
   FAOD	
  –	
  fatty	
  acid	
  oxidation	
  disorder	
   IM	
  –	
  infant	
  mortality	
  	
   IMR	
  –	
  infant	
  mortality	
  rate	
   NBS	
  –	
  newborn	
  screening	
   SIDS	
  –	
  sudden	
  infant	
  death	
  syndrome	
   SUDI	
  –	
  sudden	
  unexpected	
  death	
  in	
  infancy	
   	
   	
   	
   	
    	
    x	
    ACKNOWLEDGEMENTS	
  	
   I	
  would	
  like	
  to	
  thank	
  Laura	
  Arbour	
  (LA)	
  for	
  her	
  guidance	
  and	
  support	
  over	
  the	
  project	
  and	
   the	
  ongoing	
  input	
  and	
  support	
  of	
  Sarah	
  McIntosh	
  and	
  Sam	
  Lauson.	
  I	
  would	
  also	
  like	
  to	
  thank	
   Hilary	
  Vallance,	
  Graham	
  Sinclair,	
  and	
  the	
  members	
  of	
  the	
  Newborn	
  screening	
  lab	
  at	
  BCCWH	
   in	
  Vancouver	
  for	
  their	
  assistance	
  and	
  allowing	
  me	
  to	
  use	
  their	
  facilities,	
  Cheryl	
  Greenberg	
   (Dept	
   of	
   Pediatrics	
   and	
   Child	
   Health,	
   UMan,	
   MB),	
   Robert	
   Thompson	
   (Cadham	
   Provincial	
   Laboratory,	
   MB),	
   and	
   Fiona	
   Bamforth	
   (Dept	
   of	
   Laboratory	
   Medicine	
   and	
   Pathology,	
   University	
  of	
  Alberta	
  Hospital,	
  AB),	
  for	
  their	
  contributions	
  to	
  the	
  project,	
  and	
  Sylvie	
  Langlois	
   and	
  Andrew	
  Kmetic	
  for	
  the	
  advice	
  throughout	
  the	
  project.	
   The	
   project	
   could	
   not	
   have	
   been	
   completed	
   without	
   the	
   support	
   of	
   the	
   Chief	
   Medical	
   Officers	
   of	
   Health	
   for	
   each	
   territory,	
   Isaac	
   Sobol	
   (Nunavut),	
   Geraldine	
   Osborne	
   (Deputy	
   CMOH,	
   Nunavut),	
   Andre	
   Corriveau	
   (former	
   CMOH,	
   NWT),	
   and	
   Brendan	
   Hanley	
   (Yukon).	
   I	
   would	
  also	
  like	
  to	
  acknowledge	
  the	
  assistance	
  of	
  Tim	
  Neily	
  (former	
  Chief	
  Coroner,	
  Nunavut),	
   Cathy	
  Menard	
  (Coroner,	
  NWT),	
  Percy	
  Kinney	
  (Coroner,	
  NWT),	
  Maria	
  Santos	
  (Epidemiologist,	
   NWT),	
  and	
  Sharon	
  Hanley	
  (Chief	
  Coroner,	
  Yukon).	
   The	
   research	
   was	
   funded	
   by	
   CIHR	
   team	
   grant	
   on	
   circumpolar	
   health	
   (CIHR-­‐CTP-­‐78953)	
   to	
   T.	
   Kue	
  Young	
  and	
  LA.	
  	
   Throughout	
  my	
  program,	
  I	
  have	
  been	
  privileged	
  to	
  have	
  the	
  encouragement	
  and	
  support	
  of	
   many	
  friends	
  and	
  family	
  members,	
  for	
  which	
  I	
  am	
  deeply	
  grateful.	
   	
    	
    xi	
    DEDICATION	
   To	
  my	
  family,	
  both	
  the	
  human	
  and	
  four-­‐legged	
  members.	
   	
    	
    xii	
    CHAPTER	
  1. INTRODUCTION	
   1.1  PURPOSE	
  OF	
  STUDY	
    To	
   determine	
   the	
   prevalence	
   of	
   the	
   p.P479L	
   variant	
   of	
   carnitine	
   palmitoyltransferase	
   1A	
   (CPT1A)	
  in	
  Canadian	
  northern	
  populations	
  and	
  in	
  sudden	
  unexpected	
  infant	
  death	
  cases	
  of	
   Nunavut,	
  Northwest	
  Territories	
  (NWT),	
  and	
  Yukon,	
  to	
  determine	
  if	
  the	
  variant	
  plays	
  a	
  role	
  in	
   excess	
  infant	
  mortality	
  in	
  these	
  populations	
  and	
  to	
  assess	
  risk	
  factors	
  associated	
  with	
  infant	
   mortality	
  in	
  Nunavut.	
  	
    1.2  STUDY	
  RATIONALE	
    Canada’s	
  northern	
  Aboriginal	
  populations	
  have	
  demonstrably	
  higher	
  infant	
  mortality	
  rates	
   than	
  those	
  found	
  in	
  the	
  Canadian	
  non-­‐Aboriginal	
  population	
  [1-­‐5].	
  Studies	
  of	
  Canadian	
  and	
   Greenland	
  Inuit,	
  British	
  Columbia	
  (BC)	
  First	
  Nations,	
  and	
  Alaska	
  Natives	
  have	
  found	
  a	
  high	
   prevalence	
   of	
   the	
   P479L	
   variant	
   of	
   CPT1A	
   in	
   these	
   populations	
   [6-­‐9].	
   To	
   date,	
   more	
   than	
   40	
   infants	
  homozygous	
  for	
  the	
  P479L	
  variant	
  have	
  presented	
  clinically	
  with	
  features	
  of	
  CPT1A	
   deficiency,	
  including	
  non-­‐ketotic	
  hypoglycemia,	
  seizures,	
  and,	
  in	
  rare	
  cases,	
  sudden	
  death,	
   often	
  occurring	
  during	
  fasting	
  and/or	
  intercurrent	
  illness	
  [6,10,11].	
  All	
  affected	
  infants	
  have	
   been	
   of	
   First	
   Nations,	
   Inuit,	
   or	
   Alaska	
   Native	
   ancestry.	
   Therefore,	
   it	
   is	
   important	
   to	
   determine	
  whether	
  P479L	
  homozygous	
  infants	
  are	
  at	
  increased	
  risk	
  for	
  impaired	
  fatty	
  acid	
   oxidation	
   and	
   sudden	
   death.	
   If	
   the	
   variant	
   does	
   confer	
   risk,	
   management	
   strategies	
   will	
   need	
   to	
   be	
   implemented,	
   which	
   may	
   include	
   newborn	
   screening	
   and/or	
   public	
   and	
   medical	
   professional	
  education	
  programs.	
  	
   	
   1	
    1.3  LITERATURE	
  REVIEW	
    1.3.1 INFANT	
  MORTALITY	
  IN	
  CANADA’S	
  NORTH	
   1.3.1.1 The	
  Canadian	
  Territories	
  	
   The	
   three	
   Canadian	
   territories	
   comprise	
   the	
   entire	
   northern	
   landmass	
   of	
   Canada	
   above	
   60°	
   north	
   and	
   comprises	
   40%	
   of	
   Canada’s	
   landmass	
   (Figure	
   1.1).	
   Approximately	
   50%	
   of	
   the	
   inhabitants	
   of	
   the	
   territories	
   are	
   Aboriginal;	
   25%	
   in	
   Yukon,	
   50%	
   in	
   Northwest	
   Territories	
   (NWT),	
   and	
   86%	
   in	
   Nunavut	
   [12].	
   The	
   northern	
   Canadian	
   Aboriginal	
   groups	
   are	
   the	
   Inuit,	
   Inuvialuit,	
  First	
  Nations,	
  Métis,	
  and	
  Dene	
  [12].	
  	
   The	
   northern	
   Canadian	
   territory	
   of	
   Nunavut	
   has	
   the	
   highest	
   infant	
   mortality	
   rate	
   in	
   Canada	
   at	
   14.3/1,000	
   live	
   births	
   (1999-­‐2007)	
   which	
   is	
   3	
   times	
   the	
   Canadian	
   national	
   average	
   [1].	
   Nunavut	
  is	
  divided	
  into	
  3	
  regions,	
  Qikiqtani,	
  which	
  contains	
  the	
  territorial	
  general	
  hospital	
   (QGH),	
   Kitikmeot,	
   and	
   Kivalliq.	
   The	
   health	
   care	
   system	
   in	
   Nunavut	
   depends	
   on	
   a	
   series	
   of	
   community-­‐based	
   health	
   centres,	
   which	
   are	
   supported	
   by	
   regional	
   hospitals	
   and	
   partnerships	
   with	
   southern	
   tertiary	
   care	
   hospitals	
   in	
   the	
   neighbouring	
   provinces	
   (British	
   Columbia,	
  Saskatchewan,	
  Manitoba,	
  Ontario,	
  and	
  Quebec)	
  [13].	
  Patients	
  requiring	
  intensive	
   care	
  are	
  evacuated	
  to	
  regional	
  hospitals	
  or	
  out	
  of	
  territory	
  to	
  tertiary	
  care	
  centres	
  in	
  these	
   other	
  jurisdictions	
  [14].	
  	
   	
    	
    2	
    	
   Figure	
  1.1	
   2006	
   Census	
   Subdivisions	
   (CSDs)	
   within	
   Inuit	
   Nunaat	
   with	
   an	
   Inuit	
   identity	
   population	
   of	
   100	
   or	
   more.	
   Source:	
   2006	
   Census	
   of	
   Canada.	
   Produced	
   by	
   the	
   Geography	
   Division,	
  Statistics	
  Canada,	
  2007©	
  [15].	
   	
   1.3.1.2 The	
  Inuit	
  and	
  Inuvialuit	
  of	
  Canada	
  	
   The	
  Inuit	
  population	
  of	
  Canada	
  live	
  throughout	
  Canada’s	
  arctic	
  and	
  the	
  lands	
  they	
  inhabite	
   are	
   collective	
   called	
   the	
   Inuit	
   Nunaat	
   (“Inuit	
   Homeland”;	
   Figure	
   1.1)	
   [12].	
   The	
   term	
   ‘Inuit’	
   is	
   used	
  to	
  describe	
  a	
  number	
  of	
  closely	
  related	
  northern	
  populations,	
  which	
  are	
  divided	
  into	
   three	
   linguistic	
   branches;	
   Inuit/Inupiaq,	
   Yupik,	
   and	
   Aleut,	
   all	
   which	
   belong	
   to	
   the	
   Eskimo-­‐ Aleut	
  family.	
  The	
  Inuit/Inupiaq	
  inhabit	
  Northern	
  Alaska,	
  Canada,	
  and	
  Greenland.	
  The	
  Yupik	
   	
    3	
    inhabit	
  central	
  and	
  southern	
  Alaska	
  and	
  the	
  Chukotka	
  peninsula	
  of	
  Russia.	
  The	
  Aleut	
  inhabit	
   the	
  Aleutian	
  Islands	
  of	
  Alaska	
  and	
  the	
  Commander	
  Island	
  of	
  Russia	
  [16].	
  The	
  Inuit	
  of	
  Canada	
   are	
   descended	
   from	
   the	
   Thule,	
   who	
   arrived	
   in	
   the	
   Canadian	
   arctic	
   1000	
   to	
   1600	
   AD	
   [17].	
   The	
  Inuvialuit	
  inhabit	
  the	
  coastal	
  north-­‐western	
  areas	
  of	
  the	
  Canadian	
  arctic	
  in	
  NWT	
  and	
  are	
   more	
   closely	
   related	
   to	
   the	
   northern	
   coastal	
   Alaska	
   Native	
   populations	
   than	
   other	
   Inuit	
   populations	
  in	
  the	
  rest	
  of	
  Canada	
  [17].	
  Nunavut	
  is	
  home	
  to	
  the	
  largest	
  Inuit	
  population	
  in	
   Canada	
  (24,635;	
  49%)	
  and	
  approximately	
  85%	
  of	
  the	
  residents	
  are	
  Inuit	
  [12].	
  An	
  estimated	
   700	
   infants	
   are	
   born	
   in	
   Nunavut	
   each	
   year,	
   with	
   at	
   least	
   90%-­‐95%	
   of	
   those	
   infants	
   being	
   born	
  to	
  Inuit	
  women	
  [12,18,19].	
  	
    1.3.1.3 Inuit	
  Traditional	
  Diet	
   Most	
   Inuit	
   populations	
   of	
   Canada	
   traditionally	
   subsisted	
   on	
   a	
   diet	
   consisting	
   mainly	
   of	
   marine	
   mammals	
   (beluga	
   and	
   seal),	
   fish,	
   and	
   caribou,	
   which	
   were	
   eaten	
   cooked	
   or	
   raw	
   and	
   including	
  skin,	
  blubber,	
  and	
  internal	
  organs	
  like	
  liver	
  [17,20].	
  This	
  traditional	
  diet	
  was	
  high	
  in	
   omega	
   3	
   fatty	
   acids,	
   moderate	
   in	
   protein,	
   and	
   very	
   low	
   in	
   carbohydrate	
   [20].	
   Due	
   to	
   considerable	
   changes	
   to	
   both	
   lifestyle	
   and	
   diet,	
   traditional	
   foods	
   are	
   quickly	
   being	
   replaced	
   with	
  western	
  market	
  foods	
  that	
  are	
  high	
  in	
  carbohydrates	
  and	
  fats	
  and	
  low	
  in	
  nutrients.	
  In	
   Greenland	
  Inuit,	
  traditional	
  food	
  source	
  contribution	
  to	
  daily	
  energy	
  has	
  dropped	
  from	
  83%	
   in	
  1901	
  to	
  18%	
  in	
  2006;	
  a	
  drop	
  that	
  was	
  more	
  marked	
  in	
  young	
  Inuit	
  (<35	
  years	
  of	
  age)	
  [21].	
   Study	
   of	
   current	
   dietary	
   practices	
   of	
   2	
   communities	
   in	
   Nunavut	
   found	
   that	
   the	
   most	
   commonly	
  consumed	
  foods	
  were	
  simple	
  carbohydrate	
  rich	
  foods	
  and	
  that	
  ~20%	
  of	
  dietary	
   energy	
  came	
  from	
  sweetened	
  drinks	
  and	
  sugar,	
  with	
  traditional	
  foods	
  comprising	
  ~12%	
  of	
   	
    4	
    dietary	
   intake	
   [20].	
   Traditional	
   foods	
   are	
   not	
   only	
   important	
   for	
   physical	
   health,	
   but	
   also	
   social	
   and	
   cultural	
   health	
   of	
   individuals	
   and	
   communities.	
   Factors	
   influencing	
   the	
   consumption	
   of	
   traditional	
   foods	
   include	
   availability	
   and	
   accessibility	
   of	
   sources,	
   knowledge,	
   and	
   skills	
   on	
   procurement	
   and	
   use,	
   environmental	
   contaminants,	
   and	
   availability	
   of	
   time	
   to	
   devout	
   to	
   hunting	
   and	
   harvesting	
   [22].	
   These	
   factors	
   have	
   resulted	
   in	
   the	
   reliance	
   on	
   non-­‐perishable	
   processed	
   foods	
   as	
   many	
   remote	
   northern	
   communities	
   have	
  very	
  limited	
  access	
  to	
  fresh	
  foods	
  (fruits,	
  vegetables	
  and	
  dairy)	
  [23,24].	
   1.3.1.4 Infant	
  Mortality	
  in	
  the	
  Territories	
   Infant	
   mortality	
   is	
   a	
   key	
   indicator	
   of	
   child	
   health	
   in	
   a	
   population	
   and	
   can	
   reflect	
   health	
   disparities	
   between	
   populations	
   [25,26].	
   Infant	
   mortality	
   rates	
   are	
   calculated	
   using	
   the	
   number	
   of	
   infants	
   less	
   than	
   1	
   year	
   of	
   age	
   that	
   die	
   for	
   every	
   1,000	
   live	
   births	
   in	
   that	
   jurisdiction.	
  The	
  leading	
  causes	
  of	
  infant	
  death	
  in	
  Canada	
  are	
  listed	
  in	
  Table	
  1.1	
  [27].	
  Most	
   infant	
   deaths	
   in	
   Canada	
   occur	
   during	
   the	
   neonatal	
   period	
   (less	
   the	
   28	
   days),	
   which	
   are	
   commonly	
  related	
  to	
  perinatal	
  complications,	
  prematurity,	
  congenital	
  anomalies,	
  obstetric	
   care,	
   and	
   neonatal	
   health	
   [27].	
   However,	
   the	
   fourth	
   leading	
   cause	
   of	
   death	
   in	
   all	
   of	
   Canada	
   is	
   Sudden	
   Infant	
   Death	
   Syndrome	
   (SIDS),	
   which,	
   along	
   with	
   other	
   causes	
   like	
   infectious	
   diseases,	
  commonly	
  occurs	
  during	
  the	
  post-­‐neonatal	
  period	
  (28	
  days	
  to	
  1	
  year	
  after	
  birth)	
   [28].	
   Post-­‐neonatal	
   mortality	
   rates	
   for	
   Canadian	
   Aboriginal	
   populations	
   are	
   consistently	
   higher	
  than	
  for	
  their	
  non-­‐Aboriginal	
  counterparts	
  [5].	
  	
    	
    5	
    Table	
  1.1	
   Leading	
  causes	
  of	
  infant	
  death	
  for	
  all	
  of	
  Canada,	
  2000-­‐2005	
   CAUSE	
  OF	
  DEATH	
    2000	
   2001	
   2002	
   2003	
   2004	
   2005	
    Congenital	
  malformations,	
  deformations	
   and	
  chromosomal	
  abnormalities	
    1	
    1	
    1	
    1	
    1	
    1	
    Disorders	
  related	
  to	
  short	
  gestation	
  and	
   low	
  birth	
  weight,	
  not	
  elsewhere	
  classified	
    2	
    2	
    2	
    2	
    2	
    2	
    Newborn	
  affected	
  by	
  maternal	
   complications	
  of	
  pregnancy	
    5	
    3	
    3	
    3	
    3	
    3	
    Sudden	
  infant	
  death	
  syndrome	
    4	
    4	
    3	
    5	
    5	
    4	
    Newborn	
  affected	
  by	
  complications	
  of	
   placenta,	
  cord	
  and	
  membranes	
    3	
    5	
    5	
    4	
    4	
    5	
    Intrauterine	
  hypoxia	
  and	
  birth	
  asphyxia	
    6	
    6	
    6	
    6	
    6	
    6	
    Neonatal	
  haemorrhages	
    8	
    9	
    7	
    7	
    8	
    8	
    Newborn	
  affected	
  by	
  other	
  complications	
   of	
  labour	
  and	
  delivery	
    11	
    10	
    8	
    8	
    7	
    7	
    Respiratory	
  distress	
  of	
  newborn	
    7	
    8	
    9	
    9	
    9	
    9	
    Bacterial	
  sepsis	
  of	
  newborn	
    9	
    7	
    10	
    10	
    10	
    10	
    Accidents	
  (unintentional	
  injuries)	
    10	
    11	
    11	
    13	
    14	
    12	
    Adapted	
  from	
  Statistics	
  Canada	
  [27]	
   	
   The	
   three	
   Canadian	
   territories,	
   Nunavut,	
   NWT,	
   and	
   Yukon,	
   experience	
   some	
   of	
   Canada’s	
   highest	
  infant	
  mortality	
  rates	
  in	
  Canada	
  (Table	
  1.2),	
  which	
  exceed	
  the	
  national	
  average	
  by	
  3,	
   1.3,	
   and	
   1.6	
   times,	
   respectively	
   [1].	
   Nunavut	
   has	
   the	
   highest	
   infant	
   and	
   post-­‐neonatal	
   mortality	
   rates	
   in	
   Canada,	
   which	
   have	
   remained	
   consistently	
   high	
   since	
   1999	
   (14.3	
   and	
   7.9/1,000	
   live	
   births,	
   respectively;	
   1999-­‐2007);	
   values	
   twice	
   that	
   of	
   NWT,	
   which	
   borders	
   Nunavut	
   [1].	
   The	
   leading	
   causes	
   of	
   infant	
   and	
   post-­‐neonatal	
   mortality	
   in	
   Inuit	
   inhabited	
   areas	
  of	
  Canada	
  are	
  Sudden	
  Infant	
  Death	
  Syndrome/Sudden	
  Unexpected	
  Death	
  in	
  Infancy	
   	
    6	
    (SIDS/SUDI)	
  and	
  deaths	
  due	
  to	
  infectious	
  disease	
  [2].	
  SIDS	
  and	
  SUDI	
  deaths	
  comprise	
  19%	
  of	
   child	
  deaths	
  <	
  5	
  years	
  of	
  age	
  in	
  NWT	
  (1997-­‐2006)	
  [29].	
  	
   Table	
  1.2	
   Infant	
  mortality	
  rates,	
  birth	
  rates,	
  and	
  Aboriginal	
  population	
  of	
  the	
  Canadian	
   Territories.	
   Region	
  	
    IMR1	
   Births/year2	
   Aboriginal	
  Population3	
    Nunavut	
   14	
    746	
    86%	
  	
  (Inuit	
  85%)	
    NWT	
    7	
    698	
    50%	
  	
  (Dene	
  31%,	
  Inuvialuit	
  10%,	
  Métis	
  9%)	
    Yukon	
    6	
    355	
    25%	
  	
  (First	
  Nations	
  21%,	
  Métis	
  3%,	
  Inuit	
  1%)	
    Canada	
    5	
    348,898	
    4%	
    1  Averaged	
  infant	
  mortality	
  rates	
  per	
  1000	
  live	
  births	
  (1999-­‐2007)	
  [1]	
   Total	
  number	
  of	
  births	
  averaged	
  over	
  5	
  years	
  (2003-­‐2008)	
  [30]	
   3 Statistics	
  Canada	
  2006	
  Census	
  [31]	
   2  	
   1.3.2 SUDDEN	
   INFANT	
   DEATH	
   SYNDROME	
   AND	
   SUDDEN	
   UNEXPECTED	
   DEATH	
   IN	
   INFANCY	
  	
   The	
  risk	
  of	
  Sudden	
  Infant	
  Death	
  Syndrome	
  (SIDS)	
  and	
  Sudden	
  Unexpected	
  Death	
  in	
  Infancy	
   (SUDI)	
   is	
   3	
   to	
   4	
   times	
   greater	
   for	
   Aboriginal	
   Canadians	
   than	
   for	
   non-­‐Aboriginal	
   Canadians	
   [32]	
   and	
   accounts	
   for	
   a	
   larger	
   proportion	
   of	
   the	
   Inuit	
   infant	
   mortality	
   rates	
   than	
   in	
   other	
   regions	
   of	
   Canada	
   [2,3].	
   SIDS	
   is	
   defined	
   as	
   the	
   sudden	
   death	
   of	
   an	
   infant	
   less	
   than	
   one	
   year	
   of	
   age	
   that	
   cannot	
   be	
   explained	
   after	
   a	
   thorough	
   investigation	
   is	
   conducted,	
   including	
   a	
   complete	
  autopsy,	
  examination	
  of	
  the	
  death	
  scene,	
  and	
  review	
  of	
  the	
  clinical	
  history	
  [33].	
   SUDI,	
   sometimes	
   abbreviated	
   as	
   SUID	
   (Sudden,	
   Unexpected	
   Infant	
   Death),	
   is	
   a	
   broader	
   category	
   defined	
   as	
   the	
   sudden	
   and	
   unexpected	
   death	
   of	
   an	
   infant,	
   which	
   may	
   be	
   accompanied	
  by	
  an	
  illness	
  not	
  normally	
  expected	
  to	
  cause	
  death,	
  or	
  may	
  have	
  risk	
  factors	
   	
    7	
    present	
  for	
  overlay	
  or	
  asphyxia	
  [34].	
  Due	
  to	
  diagnostic	
  overlap,	
  SIDS	
  and	
  SUDI	
  are	
  combined	
   in	
   this	
   study	
   to	
   allow	
   for	
   comparison	
   of	
   rates	
   across	
   jurisdictions	
   and	
   periods	
   [34].	
   SIDS	
   and	
   SUDI	
  together	
  comprise	
  approximately	
  9%	
  of	
  infant	
  deaths	
  in	
  Canada	
  [35].	
  	
   1.3.2.1 SIDS/SUDI	
  Risk	
  Factors	
   SIDS	
   and	
   SUDI	
   are	
   complex,	
   multi-­‐factorial	
   events	
   and	
   likely	
   due	
   to	
   a	
   combination	
   of	
   environmental,	
   medical,	
   developmental,	
   and	
   genetic	
   factors	
   [36-­‐40].	
   The	
   ‘triple	
   risk	
   hypothesis’,	
  which	
  has	
  undergone	
  refinement	
  since	
  its	
  first	
  use	
  in	
  1972,	
  states	
  that	
  SIDS	
  is	
   due	
  to	
  the	
  combination	
  of	
  three	
  risk	
  factors,	
  a	
  vulnerable	
  infant	
  with	
  predisposing	
  factors,	
  a	
   critical	
   development	
   period,	
   and	
   an	
   exogenous	
   stressor	
   [41].	
   Reducing	
   or	
   eliminating	
   the	
   risk	
  from	
  any	
  one	
  of	
  these	
  factors	
  may	
  decrease	
  the	
  risk	
  of	
  SIDS/SUDI	
  [42],	
  indicating	
  a	
  need	
   to	
   explore	
   a	
   variety	
   of	
   risk	
   factors	
   for	
   SIDS/SUDI,	
   including	
   environmental	
   and	
   genetic	
   factors,	
  which	
  may	
  be	
  contributing	
  to	
  the	
  higher	
  rates	
  of	
  SIDS	
  and	
  SUDI	
  observed	
  in	
  NWT	
   and	
  Nunavut	
  [2,3,29,43].	
   Medical	
  and	
  environmental	
  risk	
  factors	
  for	
  SIDS	
  and	
  SUDI	
  include	
  sleeping	
  in	
  any	
  position	
   other	
  than	
  supine	
  (i.e.	
  sleeping	
  on	
  stomach	
  or	
  side),	
  prematurity,	
  young	
  maternal	
  age,	
  age	
   of	
   infant	
   less	
   than	
   6	
   months,	
   maternal	
   (pre	
   and	
   post-­‐natal)	
   smoking,	
   exposure	
   to	
   environmental	
   smoke,	
   male	
   sex,	
   not	
   being	
   breast-­‐fed,	
   bed-­‐sharing,	
   overheating,	
   the	
   presence	
   of	
   loose	
   bedding,	
   and	
   soft	
   sleep	
   surface	
   [34,41,44-­‐51].	
   Traditionally,	
   there	
   were	
   seasonal	
  trends	
  in	
  SIDS	
  incidence,	
  with	
  a	
  peak	
  during	
  the	
  winter	
  months.	
  This	
  increased	
  risk	
   may	
  have	
  been	
  due	
  to	
  exposure	
  to	
  viral	
  infections	
  or	
  overheating	
  due	
  to	
  bundling	
  [52,53].	
   However,	
  studies	
  conducted	
  since	
  the	
  introduction	
  of	
  the	
  ‘Back	
  to	
  Sleep’	
  campaign,	
  which	
   	
    8	
    advocated	
   placing	
   infants	
   to	
   sleep	
   on	
   the	
   backs	
   (supine	
   position),	
   have	
   demonstrated	
   a	
   decrease	
   in	
   this	
   seasonality	
   [52,54].	
   It	
   is	
   possible	
   that	
   the	
   combined	
   risk	
   factors	
   of	
   respiratory	
   illness,	
   cold	
   climate,	
   cramped	
   housing,	
   environmental	
   smoking,	
   and	
   prone	
   sleeping	
  account	
  for	
  the	
  majority	
  of	
  the	
  excess	
  post-­‐neonatal	
  mortality	
  and	
  SIDS	
  and	
  SUDI	
   rates	
  in	
  northern	
  communities	
  [34,55-­‐57].	
   Genetic	
  and/or	
  biological	
  factors,	
  including	
  cardiac	
  conduction	
  abnormalities	
  (i.e.	
  Long	
  QT	
   syndrome;	
  LQTS)	
  and	
  fatty	
  acid	
  oxidation	
  disorders	
  (FAOD),	
  may	
  also	
  increase	
  risk	
  for	
  SIDS	
   and	
  SUDI	
  [37,44,58,59].	
  Undiagnosed	
  metabolic	
  disorders	
  are	
  considered	
  to	
  account	
  for	
  3-­‐ 6%	
  of	
  SIDS	
  and	
  SUDI	
  cases	
  in	
  all	
  populations	
  [60,61].	
  	
  	
   1.3.2.2 SUDI	
  and	
  Fatty	
  Acid	
  Oxidation	
  Disorders	
   Retrospective	
   screening	
   of	
   sudden	
   unexplained	
   infant	
   deaths	
   has	
   found	
   that	
   FAODs	
   contribute	
   to	
   3-­‐6%	
   of	
   these	
   deaths	
   [60,61].	
   Infants	
   with	
   inherited	
   fatty	
   acid	
   oxidation	
   disorders	
  (FAOD)	
  are	
  normally	
  asymptomatic	
  at	
  birth	
  and	
  may	
  present	
  with	
  symptoms	
  on	
   the	
   second	
   day	
   of	
   life	
   onwards	
   or	
   when	
   exposed	
   to	
   secondary	
   exogenous	
   stressors,	
   like	
   intercurrent	
   illness	
   and	
   fasting	
   [37,62].	
   The	
   initial	
   clinical	
   features	
   of	
   non-­‐ketotic	
   hypoglycemia	
  may	
  progress	
  to	
  neurologic	
  deterioration	
  and	
  liver	
  damage	
  if	
  the	
  infant	
  is	
  not	
   treated.	
  Metabolic	
  disorders	
  may	
  also	
  increase	
  risk	
  for	
  SUDI	
  due	
  to	
  high	
  metabolic	
  demands	
   during	
   early	
   development	
   [60].	
   FAODs	
   reported	
   to	
   contribute	
   to	
   SUDI	
   include	
   medium-­‐ chain	
   acyl-­‐CoA	
   dehydrogenase,	
   very	
   long-­‐chain	
   acyl-­‐CoA	
   dehydrogenase	
   (VLCAD),	
   long-­‐  	
    9	
    chain	
   3-­‐hydroxy-­‐acyl-­‐CoA	
   dehydrogenase,	
   infantile-­‐type	
   carnitine	
   palmitoyltransferase	
   2,	
   and	
  carnitine	
  palmitoyltransferase	
  1A	
  deficiencies	
  [60,61,63].	
  	
   Although	
   carnitine	
   palmitoyltransferase	
   1A	
   (CPT1A)	
   deficiency	
   is	
   a	
   very	
   rare	
   FAOD,	
   gene	
   variants	
   in	
   CPT1A	
   that	
   are	
   associated	
   with	
   the	
   disorder	
   are	
   common	
   in	
   certain	
   populations,	
   including	
   Hutterite,	
   Inuit,	
   Alaska	
   Native,	
   and	
   BC	
   First	
   Nations	
   populations	
   [6-­‐9,64-­‐69].	
   CPT1A	
  deficiency	
  commonly	
  presents	
  as	
  hypoketotic	
  hypoglycemia	
  after	
  prolonged	
  fasting	
   or	
   during	
   intercurrent	
   illness	
   and	
   may	
   rapidly	
   progress	
   to	
   seizures,	
   liver	
   damage,	
   and	
   sudden	
  death,	
  if	
  not	
  treated	
  [63].	
  	
   1.3.3 CARNITINE	
  PALMITOYLTRANSFERASE	
  1A	
  DEFICIENCY	
   1.3.3.1 Carnitine	
  Palmitoyltransferase	
  1	
  (CPT1)	
  and	
  the	
  CPT	
  Pathway	
   The	
  carnitine	
  palmitoyltransferase	
  (CPT)	
  pathway	
  is	
  a	
  critical	
  pathway	
  for	
  flux	
  of	
  long	
  chain	
   fatty	
   acids	
   into	
   the	
   mitochondrion	
   for	
   use	
   in	
   fatty	
   acid	
   oxidation	
   (FAO)	
   and	
   is	
   critical	
   for	
   providing	
  ketone	
  bodies	
  for	
  use	
  as	
  energy	
  during	
  periods	
  of	
  fasting	
  and	
  prolonged	
  exercise	
   [70].	
  CPT1	
  is	
  the	
  first	
  protein	
  in	
  the	
  CPT	
  pathway	
  and	
  a	
  key	
  regulatory	
  point	
  for	
  flux	
  through	
   to	
  FAO.	
  	
   The	
   oxidation	
   of	
   fatty	
   acids	
   represents	
   the	
   major	
   source	
   of	
   energy	
   in	
   heart	
   and	
   muscle;	
   however,	
   oxidation	
   of	
   fatty	
   acids	
   in	
   the	
   liver	
   is	
   usually	
   active	
   only	
   during	
   prolonged	
   fasting,	
   illness,	
   or	
   prolonged	
   muscle	
   activity	
   [71].	
   The	
   primary	
   substrates	
   for	
   FAO	
   are	
   long	
   chain	
   fatty	
  acids	
  (LCFAs),	
  which	
  need	
  to	
  be	
  transported	
  into	
  the	
  mitochondrion	
  for	
  oxidation	
  by	
   the	
  CPT	
  pathway	
  (Figure	
  1.2)	
  [70].	
  LCFAs	
  are	
  released	
  from	
  triglycerol	
  in	
  adipose	
  tissue	
  by	
   	
    10	
    lipases	
  and	
  enter	
  the	
  cell	
  passively	
  or	
  by	
  FA	
  transporters	
  like	
  CD36	
  [72].	
  Once	
  inside	
  the	
  cell,	
   LCFAs	
   are	
   activated	
   by	
   acyl-­‐CoA	
   synthease	
   (ACS).	
   The	
   CPT1	
   enzyme,	
   in	
   the	
   outer	
   mitochondrial	
  membrane,	
  catalyzes	
  the	
  first	
  step	
  of	
  LCFA	
  transport	
  into	
  the	
  mitochondria	
   by	
   transferring	
   the	
   fatty	
   acyl	
   group	
   from	
   acyl-­‐CoA	
   to	
   carnitine.	
   Carnitine	
   translocase	
   transports	
   the	
   resulting	
   acylcarnitine	
   across	
   the	
   mitochondrial	
   matrix	
   to	
   CPT2,	
   which	
   replaces	
  the	
  carnitine	
  on	
  the	
  fatty	
  acyl	
  with	
  CoA	
  (reversing	
  the	
  CPT1	
  reaction).	
  This	
  transfer	
   allows	
  the	
  fatty	
  acyl	
  group	
  to	
  be	
  transported	
  into	
  the	
  mitochondrion	
  for	
  subsequent	
  FAO.	
   CPT1	
  activity,	
  and	
  the	
  CPT	
  pathway,	
  is	
  regulated	
  by	
  malonyl-­‐CoA	
  [63,70,73,74].	
  	
  	
    	
    11	
    	
    	
   Figure	
  1.2	
   Carnitine	
  palmitoyltransferase	
  pathway.	
  During	
  the	
  fed	
  state,	
  ACC	
  is	
  active	
  and	
   converts	
   the	
   glucose	
   product	
   acetyl-­‐CoA	
   into	
   malonyl-­‐CoA.	
   Accumulation	
   of	
   malonyl-­‐CoA	
   inhibits	
  CPT1	
  activity.	
  During	
  fasting,	
  glucagon	
  signals	
  activation	
  of	
  AMPKK,	
  which	
  triggers	
   the	
  deactivation	
  of	
  ACC	
  via	
  phosphorylation.	
  Malonyl-­‐CoA	
  levels	
  drop	
  and	
  CPT1	
  is	
  released	
   from	
   inhibition.	
   CPT1	
   exchanges	
   the	
   CoA	
   molecule	
   for	
   carnitine	
   on	
   long	
   chain	
   fatty	
   acyl-­‐ CoA,	
   which	
   is	
   then	
   shuttled	
   across	
   the	
   mitochondrial	
   intermembrane	
   space	
   to	
   the	
   inner	
   membrane	
  by	
  CACT.	
  CPT2	
  reverses	
  the	
  CPT1	
  reaction.	
  Free	
  carnitine	
  returns	
  to	
  the	
  cellular	
   cytoplasm	
  and	
  fatty	
  acyl-­‐CoA	
  is	
  transported	
  into	
  the	
  mitochondria	
  for	
  fatty	
  acid	
  oxidation	
   (FAO)	
   [63,70,73,74].	
   ACC,	
   acetyl-­‐CoA	
   carboxylase:	
   ACS,	
   acyl-­‐CoA	
   synthetase:	
   AMPK,	
   AMP-­‐ activated	
   protein	
   kinase:	
   AMPKK,	
   AMP-­‐activated	
   protein	
   kinase	
   kinase:	
   CPT1,	
   carnitine	
   palmitoyltransferase	
  1:	
  CPT2,	
  carnitine	
  palmitoyltransferase	
  2:	
  CACT,	
  carnitine	
  translocase:	
   MCD,	
  malonyl-­‐CoA	
  decarboxylase.	
  	
   	
   	
   	
   	
    12	
    There	
   are	
   three	
   tissue-­‐specific	
   isoforms	
   of	
   CPT1,	
   A	
   (liver,	
   kidneys,	
   brain),	
   B	
   (muscle	
   and	
   heart),	
   and	
   C	
   (brain,	
   testis),	
   encoded	
   by	
   separate	
   genes	
   (11q13.1,	
   22q13.31,	
   and	
   19q13.3	
   respectively)	
  [75,76].	
  CPT1A	
  and	
  B	
  are	
  localised	
  in	
  the	
  mitochondrial	
  outer	
  membrane	
  with	
   active	
   sites	
   exposed	
   to	
   the	
   cytosolic	
   side	
   of	
   the	
   mitochondrion	
   [77].	
   CPT1A	
   is	
   the	
   major	
   hepatic	
  isoform,	
  but	
  is	
  also	
  found	
  in	
  the	
  spleen,	
  lung,	
  kidney,	
  adipose	
  tissue,	
  hypothalamus,	
   and	
   heart	
   [73,78].	
   Although	
   CPT1B	
   is	
   the	
   major	
   form	
   expressed	
   in	
   the	
   adult	
   heart,	
   CPT1A	
   is	
   also	
   present	
   in	
   fetal	
   and	
   neonatal	
   heart	
   tissue.	
   Cook	
   et	
   al.	
   [79]	
   found	
   that	
   CPT1A	
   is	
   expressed	
   in	
   fetal	
   and	
   neonatal	
   rat	
   heart	
   and	
   that	
   this	
   expression	
   switches	
   to	
   CPT1B	
   during	
   development	
   [79].	
   The	
   CPT1A	
   is	
   also	
   expressed	
   in	
   the	
   hypothalamus,	
   where	
   it	
   plays	
   an	
   important	
  role	
  in	
  appetite	
  control	
  and	
  glucose	
  production	
  [78].	
   The	
   catalytic	
   function	
   of	
   CPT1C	
   is	
   controversial	
   and	
   has	
   not	
   been	
   well	
   defined.	
   Although	
   studies	
  have	
  found	
  that	
  CPT1C	
  may	
  not	
  be	
  active	
  in	
  the	
  mitochondria,	
  it	
  is	
  known	
  to	
  bind	
   malonyl-­‐CoA	
   and	
   may	
   have	
   a	
   role	
   in	
   the	
   endoplasmic	
   reticulum	
   [75,80,81].	
   Researchers	
   hypothesize	
  that	
  its	
  function	
  may	
  be	
  in	
  satiety	
  and	
  body	
  weight	
  regulation	
  due	
  to	
  its	
  high	
   expression	
   in	
   the	
   hypothalamus	
   [75].	
   CPT1C	
   knock	
   out	
   mice	
   had	
   decreased	
   food	
   intake	
   and	
   weight,	
   but	
   become	
   obese	
   when	
   fed	
   a	
   high	
   fat	
   diet	
   [82].	
   All	
   three	
   CPT1	
   isoforms	
   bind	
   malonyl-­‐CoA;	
  however,	
  CPT1B	
  is	
  very	
  sensitive	
  to	
  inhibition	
  from	
  malonyl-­‐CoA	
  and	
  has	
  an	
   IC50	
   ~100-­‐fold	
   lower	
   then	
   CPT1A	
   [73].	
   In	
   molecular	
   and	
   genetic	
   characterisation	
   of	
   CPT1,	
   mutations	
   that	
   cause	
   the	
   CPT1	
   deficiency	
   have	
   only	
   been	
   found	
   in	
   the	
   CPT1A,	
   the	
   liver	
   isoform	
  [83].	
    	
    13	
    1.3.3.2 Malonyl-­‐CoA	
   Malonyl-­‐CoA	
  is	
  both	
  a	
  precursor	
  of	
  fatty	
  acid	
  biosynthesis	
  and	
  a	
  critical	
  signalling	
  molecule	
   for	
  maintaining	
  the	
  energetic	
  flux	
  between	
  fatty	
  acid	
  biosynthesis	
  and	
  FAO.	
  When	
  a	
  dietary	
   source	
  of	
  energy	
  is	
  available	
  (i.e.	
  glucose,	
  ‘fed	
  state’),	
  malonyl-­‐CoA	
  levels	
  accumulate	
  and	
   CPT1	
   activity	
   is	
   inhibited	
   [70].	
   In	
   the	
   absence	
   of	
   dietary	
   glucose	
   (‘fasted	
   state’),	
   and	
   once	
   glycogen	
   stores	
   have	
   been	
   depleted,	
   the	
   body	
   becomes	
   dependent	
   on	
   FAO	
   for	
   energy.	
   During	
  fasting,	
  hepatic	
  FAO	
  produces	
  ketones	
  for	
  tissues	
  to	
  use	
  in	
  lieu	
  of	
  glucose.	
  Hormones	
   like	
  glucagon	
  activate	
  FAO	
  by	
  signalling	
  adipose	
  tissue	
  to	
  release	
  fatty	
  acyls	
  into	
  the	
  blood	
   stream	
  [72].	
  Glucagon	
  also	
  stimulates	
  FAO	
  in	
  the	
  liver	
  by	
  inhibiting	
  malonyl-­‐CoA	
  synthesis	
   through	
   the	
   phosphorylation	
   of	
   acetyl-­‐CoA	
   carboxylase	
   (ACC)	
   [72].	
   As	
   malonyl-­‐CoA	
   levels	
   drop,	
   CPT1	
   is	
   released	
   from	
   inhibition	
   and	
   fatty-­‐acyls	
   are	
   transported	
   into	
   the	
   mitochondrion	
  for	
  FAO	
  for	
  use	
  as	
  energy	
  or	
  to	
  be	
  used	
  in	
  ketogenesis	
  in	
  the	
  liver	
  [70].	
  	
   1.3.3.3 Hormones	
  and	
  CPT1A	
  Expression	
   Both	
   insulin	
   and	
   the	
   thyroid	
   hormone	
   play	
   a	
   role	
   in	
   regulating	
   CPT1A	
   activity	
   and/or	
   expression.	
  Insulin	
  signalling	
  via	
  the	
  insulin	
  growth	
  factor	
  receptor	
  decreases	
  CPT1A	
  activity	
   by	
  increasing	
  CPT1A	
  sensitivity	
  to	
  malonyl-­‐CoA	
  and	
  decreasing	
  CPT1A	
  mRNA	
  levels	
  [84,85].	
   This	
   relationship	
   may	
   be	
   disrupted	
   in	
   diabetic	
   patients.	
   Park	
   et	
   al.	
   [84]	
   found	
   that	
   CPT1A	
   expressed	
   in	
   diabetic	
   rats	
   had	
   reduced	
   malonyl-­‐CoA	
   sensitivity,	
   causing	
   increased	
   hepatic	
   CPT1A	
  activity	
  and	
  FAO.	
  Thyroid	
  hormone	
  decreases	
  hepatic	
  CPT1A	
  sensitivity	
  to	
  malonyl-­‐ CoA	
  and	
  increases	
  expression	
  of	
  CPT1A	
  mRNA	
  five	
  fold	
  in	
  rats	
  [79].	
    	
    14	
    1.3.3.4 Classical	
  CPT1A	
  Deficiency	
  	
   First	
   reported	
   in	
   1981,	
   classical	
   CPT1A	
   deficiency	
   is	
   a	
   rare	
   autosomal	
   recessive	
   disorder,	
   with	
   only	
   ~40	
   cases	
   reported	
   in	
   the	
   literature	
   worldwide.	
   CPT1A	
   deficient	
   individuals	
   present	
   clinically	
   in	
   early	
   life	
   with	
   metabolic	
   decompensation,	
   including	
   hypoketotic	
   hypoglycaemia	
   that	
   may	
   also	
   be	
   accompanied	
   by	
   hepatic	
   encephalopathy,	
   heart	
   dysfunction	
   (cardiomegaly,	
   fatty	
   infiltration	
   of	
   the	
   heart,	
   bradycardia),	
   liver	
   enlargement	
   and	
   fatty	
   infiltration,	
   increased	
   carnitine	
   and	
   liver	
   enzymes,	
   and	
   decreased	
   long-­‐chain	
   acylcarnitines	
   [63,64,70,73,74,86].	
   CPT1A	
   deficiency	
   is	
   normally	
   detected	
   during	
   newborn	
   screening	
   using	
   tandem	
   mass	
   spectrometry	
   to	
   measure	
   the	
   ratio	
   of	
   free	
   carnitine	
   to	
   long	
   chain	
   acylcarnitine	
   (C0/(C16+C18)	
   >130)	
   [9,87].	
   Mutations	
   that	
   cause	
   classical	
   CPT1A	
   deficiency	
   affect	
   enzyme	
   activity	
   directly	
   through	
   functional	
   mutations	
   or	
   indirectly	
   by	
   structural	
  changes	
  [88].	
   Infants	
  have	
  limited	
  glycogen	
  stores	
  and	
  are	
  highly	
  dependent	
  on	
  long	
  chain	
  FAO	
  for	
  energy	
   [89].	
  Subsequently,	
  CPT1A	
  deficient	
  individuals	
  are	
  more	
  susceptible	
  during	
  their	
  first	
  two	
   years	
  of	
  life	
  [64].	
  Symptoms	
  of	
  CPT1A	
  deficiency	
  are	
  precipitated	
  by	
  high-­‐energy	
  demands	
   (intercurrent	
   illness),	
   prolonged	
   fasting,	
   and	
   are	
   exacerbated	
   by	
   fever,	
   infection,	
   and	
   dehydration.	
  Untreated	
  acute	
  metabolic	
  decompensation	
  can	
  progress	
  to	
  seizures,	
  hepatic	
   encephalopathy,	
  seizures	
  secondary	
  to	
  recurrent	
  hypoglycaemia,	
  coma,	
  and,	
  in	
  rare	
  cases,	
   sudden	
   unexpected	
   death	
   [74].	
   Parents	
   of	
   infants	
   diagnosed	
   with	
   CPT1A	
   deficiency	
   are	
   advised	
   to	
   prevent	
   the	
   onset	
   of	
   metabolic	
   decompensation	
   by	
   avoidance	
   of	
   fasting,	
   oral	
    	
    15	
    administering	
  glucose	
  (i.e.	
  juice),	
  medium-­‐chain	
  triglyceride	
  (MCT)	
  oil	
  supplementation,	
  and	
   seeking	
  medical	
  aid	
  if	
  the	
  child	
  becomes	
  ill	
  with	
  an	
  accompanying	
  fever	
  [62].	
   1.3.3.5 The	
  p.P479L	
  CPT1A	
  Variant	
  and	
  CPT1A	
  Deficiency	
   In	
   2000,	
   Innes	
   et	
   al.	
   [90]	
   described	
   an	
   Inuit	
   family	
   in	
   which	
   two	
   infants	
   were	
   determined	
   to	
   have	
   CPT1A	
   deficiency.	
   The	
   mother	
   of	
   the	
   infants	
   initially	
   presented	
   in	
   pregnancy	
   with	
   features	
  of	
  acute	
  fatty	
  liver	
  of	
  pregnancy	
  (AFLP)	
  and	
  with	
  hyperemesis	
  gravidarum	
  during	
   the	
   subsequent	
   pregnancy,	
   complications	
   which	
   are	
   not	
   normally	
   associated	
   with	
   CPT1A	
   deficiency.	
   Although	
   both	
   infants	
   were	
   born	
   healthy,	
   the	
   second	
   infant	
   presented	
   with	
   bronchopneumonia	
   and	
   low	
   normal	
   blood	
   glucose	
   levels	
   (3.3mmol/L)	
   at	
   6	
   weeks	
   of	
   age.	
   Biochemical	
   investigation	
   of	
   mother	
   and	
   children	
   found	
   that	
   both	
   children	
   had	
   markedly	
   decreased	
  CPT1A	
  enzyme	
  activity	
  (2%	
  of	
  normal)	
  and	
  the	
  mother	
  had	
  moderately	
  reduced	
   CPT1A	
  activity	
  (36%	
  of	
  normal).	
  Both	
  children	
  were	
  diagnosed	
  with	
  CPT1A	
  deficiency	
  [6,90].	
   In	
  a	
  separate	
  study	
  in	
  2001,	
  Brown	
  et	
  al.	
  [65]	
  reported	
  a	
  BC	
  First	
  Nations	
  adult	
  male	
  patient	
   presenting	
   with	
   features	
   more	
   commonly	
   associated	
   with	
   CPT2	
   deficiency	
   (adult	
   on-­‐set,	
   muscle	
  cramping,	
  and	
  pain).	
  The	
  patient	
  was	
  investigated	
  for	
  mutations	
  in	
  both	
  CPT1A	
  and	
   CPT2	
  and	
  was	
  found	
  to	
  have	
  a	
  c.1436CàT	
  transition	
  mutation	
  in	
  CPT1A,	
  causing	
  a	
  proline	
   to	
  leucine	
  substitution	
  (P479L)	
  in	
  the	
  CPT1A	
  enzyme	
  [65].	
  The	
  proline	
  found	
  at	
  479	
  is	
  highly	
   conserved	
  and	
  lies	
  within	
  the	
  binding	
  site	
  for	
  malonyl-­‐CoA,	
  the	
  regulator	
  of	
  CPT1A	
  activity	
   [75,91].	
   Fibroblasts	
   studies	
   of	
   the	
   P479L	
   variant	
   found	
   the	
   protein	
   had	
   diminished	
   enzymatic	
   activity	
   (2-­‐54%	
   of	
   normal)	
   and	
   reduced	
   response	
   to	
   inhibition	
   by	
   malonyl-­‐CoA	
   (68%	
   of	
   normal),	
   indicating	
   that	
   the	
   protein	
   may	
   be	
   constitutively	
   active,	
   even	
   in	
   the	
   fed	
   	
    16	
    state	
   [6,65].	
   Fibroblasts	
   studies	
   also	
   determined	
   that	
   the	
   reduced	
   activity	
   of	
   the	
   P479L	
   variant	
  did	
  not	
  greatly	
  diminish	
  FAO	
  at	
  normal	
  body	
  temperatures	
  (37°C);	
  however,	
  there	
   was	
   a	
   marked	
   reduction	
   in	
   FAO	
   at	
   high	
   temperatures	
   (41°C),	
   suggesting	
   instability	
   of	
   the	
   variant	
  [6,65].	
  The	
  Inuit	
  family	
  described	
  by	
  Innes	
  et	
  al.	
  [90]	
  were	
  subsequently	
  genotyped	
   for	
   the	
   P479L	
   variant,	
   which	
   determined	
   that	
   the	
   mother	
   was	
   heterozygous	
   and	
   her	
   children	
  were	
  homozygous	
  for	
  the	
  P479L	
  variant	
  of	
  CPT1A	
  [6].	
  	
   Since	
   its	
   discovery,	
   the	
   P479L	
   variant	
   has	
   been	
   found	
   to	
   be	
   very	
   common	
   in	
   Inuit	
   populations	
  of	
  Kivalliq	
  (Nunavut)	
  and	
  Greenland	
  (70%	
  and	
  54%	
  homozygous,	
  respectively)	
   and	
   the	
   coastal	
   regions	
   of	
   Alaska	
   (51%	
   homozygous)	
   [6,8-­‐10].	
   As	
   well,	
   9.8%	
   of	
   BC	
   First	
   Nations	
  are	
  homozygous	
  for	
  the	
  variant	
  (Sinclair	
  and	
  Vallance,	
  personal	
  communication).	
   1.3.4 P479L	
  IMPACT	
  ON	
  HEALTH	
   1.3.4.1 P479L	
  Advantage?	
   Fats	
  from	
  marine	
  mammals	
  are	
  rich	
  in	
  omega	
  3	
  fatty	
  acids	
  and	
  high	
  intake	
  of	
  these	
  fats	
  has	
   an	
   inverse	
   relation	
   to	
   circulating	
   plasma	
   triacylglycerol	
   concentrations	
   and	
   decreased	
   risk	
   factors	
   for	
   ischemic	
   heart	
   disease	
   and	
   diabetes	
   in	
   obese	
   individuals	
   [92].	
   Therefore,	
   the	
   traditional	
   Inuit	
   diet	
   may	
   have	
   had	
   protective	
   effects	
   on	
   Inuit	
   health,	
   which	
   may	
   include	
   P479L	
   homozygous	
   individuals	
   [6,8].	
   Research	
   into	
   the	
   impact	
   of	
   the	
   P479L	
   variant	
   on	
   modern	
   Aboriginal	
   adult	
   health	
   and	
   risk	
   for	
   diabetes	
   and	
   obesity	
   is	
   another	
   important	
   avenue	
  of	
  research.	
  Studies	
  of	
  CPT1A	
  expression	
  in	
  rats	
  found	
  that	
  neonates	
  who	
  breastfed	
   from	
  dams	
  eating	
  a	
  high	
  fat	
  diet	
  through	
  gestation	
  and	
  lactation	
  had	
  higher	
  level	
  of	
  hepatic	
   	
    17	
    CPT1A	
   expression	
   than	
   neonates	
   whose	
   dams	
   who	
   ate	
   a	
   carbohydrate	
   rich	
   diet	
   [93].	
   P479L	
   homozygous	
  infants	
  breastfed	
  by	
  mothers	
  eating	
  a	
  traditional	
  high	
  fat	
  diet	
  may	
  have	
  been	
   protected	
  from	
  any	
  adverse	
  effects	
  of	
  the	
  variant	
  by	
  an	
  increased	
  expression	
  of	
  the	
  CPT1A	
   protein;	
  however,	
  research	
  is	
  needed	
  to	
  support	
  this	
  possibility.	
   1.3.4.2 P479L	
  and	
  Infant	
  Morbidity	
  and	
  Mortality	
   Does	
  P479L	
  confer	
  risk	
  for	
  sudden	
  unexpected	
  infant	
  death?	
  Many	
  infants	
  homozygous	
  for	
   the	
   variant	
   have	
   presented	
   with	
   symptoms	
   of	
   CPT1A	
   deficiency,	
   including	
   sudden	
   unexpected	
  death	
  [6,7,90,10].	
  To	
  date,	
  all	
  reported	
  affected	
  individuals	
  have	
  been	
  of	
  Inuit,	
   Alaska	
   Native,	
   or	
   First	
   Nations	
   ancestry.	
   This	
   variant	
   is	
   of	
   particular	
   concern	
   as	
   Inuit	
   and	
   First	
  Nations	
  populations	
  of	
  Canada	
  experience	
  infant	
  mortality	
  rates	
  that	
  far	
  exceed	
  their	
   non-­‐aboriginal	
   counterparts	
   [5],	
   raising	
   questions	
   as	
   to	
   whether	
   the	
   P479L	
   CPT1A	
   variant	
   could	
  be	
  playing	
  a	
  role	
  in	
  the	
  excess	
  infant	
  mortality	
  cases	
  in	
  these	
  populations.	
  	
   The	
   P479L	
   variant	
   CPT1A	
   protein	
   may	
   cause	
   CPT1A	
   deficiency	
   and	
   confer	
   risk	
   for	
   metabolic	
   decompensation	
  during	
  periods	
  of	
  fever	
  and	
  other	
  illness.	
  The	
  P479L	
  variant	
  is	
  thermolabile	
   (42°C;	
   in	
   vitro)	
   [65,6],	
   so	
   may	
   have	
   a	
   reduced	
   ability	
   to	
   participate	
   in	
   FAO	
   during	
   intercurrent	
   illness	
   and	
   fever.	
   For	
   P479L	
   homozygous	
   infants	
   and	
   children,	
   the	
   protein’s	
   proposed	
   suboptimal	
   function	
   under	
   circumstances	
   of	
   fever	
   and	
   infection	
   might	
   result	
   in	
   symptoms	
   consistent	
   with	
   CPT1A	
   deficiency,	
   namely,	
   non-­‐ketotic	
   hypoglycemia,	
   seizures,	
   and	
  even	
  sudden	
  death.	
  Seven	
  of	
  10	
  Inuit	
  infants	
  that	
  died	
  in	
  Kivalliq	
  from	
  2004-­‐2006	
  with	
   causes	
   of	
   febrile	
   illness	
   or	
   no	
   known	
   cause	
   were	
   homozygous	
   for	
   P479L	
   variant	
   [6].	
   However,	
  as	
  the	
  Kivalliq	
  population	
  homozygosity	
  for	
  the	
  study	
  period	
  was	
  70%,	
  this	
  is	
  not	
   	
    18	
    evidence	
   of	
   a	
   statistically	
   significant	
   risk.	
   Similar	
   sudden	
   unexpected	
   deaths	
   have	
   been	
   reported	
   in	
   P479L	
   homozygous	
   infants	
   in	
   Alaska	
   and	
   BC	
   [7,10,94].	
   In	
   Gessner	
   et	
   al.’s	
   [94]	
   prospective	
   review	
   of	
   infant	
   mortality	
   in	
   Alaska	
   Native	
   infants,	
   they	
   report	
   higher	
   infant	
   mortality	
   rates	
   for	
   infants	
   homozygous	
   for	
   variant	
   (5/152)	
   over	
   heterozygous	
   (2/219)	
   and	
   wild	
  type	
  (0/245)	
  infants;	
  however	
  their	
  study	
  was	
  very	
  small	
  (cases=7).	
  The	
  P479L	
  variant	
   of	
  CPT1A	
  has	
  been	
  identified	
  as	
  a	
  concern	
  by	
  the	
  BC	
  Coroner’s	
  Office	
  in	
  its	
  five	
  years	
  review	
   of	
  infant	
  death	
  in	
  the	
  province	
  [95].	
  Retrospective	
  genotyping	
  of	
  First	
  Nations	
  infants	
  who	
   died	
  suddenly	
  in	
  BC	
  since	
  1999	
  has	
  found	
  that	
  of	
  the	
  48	
  cases,	
  19	
  (~40%)	
  were	
  homozygous	
   for	
   the	
   P479L	
   variant.	
   The	
   P479L	
   genotype	
   frequency	
   in	
   the	
   healthy	
   FN	
   population	
   was	
   compared	
   to	
   the	
   P479L	
   frequency	
   in	
   sudden	
   death	
   cases.	
   For	
   mid-­‐Vancouver	
   Island	
   the	
   odds	
   ratio	
   is	
   3.87	
   (95%	
   CI:	
   1.4-­‐10.9)	
   p<	
   0.006	
   (Sinclair	
   and	
   Vallance,	
   personal	
   communication).	
   When	
   we	
   combine	
   this	
   information	
   with	
   the	
   high	
   infant	
   mortality	
   rates	
   in	
   Nunavut,	
   NWT,	
   and	
   Yukon,	
   we	
   hypothesize	
   that	
   P479L	
   homozygous	
   infants	
   may	
   be	
   at	
   increased	
  risk	
  of	
  metabolic	
  decompensation	
  and	
  sudden	
  unexpected	
  death	
  during	
  periods	
   of	
  high	
  fever	
  and	
  fasting.	
   This	
   study	
   will	
   determine	
   the	
   prevalence	
   of	
   P479L	
   homozygosity	
   in	
   all	
   infants	
   born	
   in	
   these	
   regions	
   in	
   2006	
   and	
   in	
   infants	
   that	
   died	
   unexpectedly	
   from	
   1999	
   to	
   2008	
   in	
   all	
   three	
   territories.	
   Comparison	
   of	
   the	
   two	
   groups	
   will	
   allow	
   assessment	
   of	
   whether	
   there	
   is	
   an	
   increased	
   risk	
   of	
   sudden	
   unexpected	
   death	
   for	
   infants	
   homozygous	
   for	
   the	
   P479L	
   variant.	
   This	
   is	
   a	
   retrospective	
   anonymous	
   review	
   requiring	
   ethics	
   approval	
   from	
   the	
   university,	
   each	
  territory,	
  and	
  consultation	
  with	
  Aboriginal	
  organisations	
  within	
  the	
  three	
  territories.	
   	
    19	
    1.3.5 NEWBORN	
  SCREENING	
   The	
   goal	
   of	
   newborn	
   screening	
   (NBS)	
   is	
   to	
   diagnose	
   diseases	
   prior	
   to	
   the	
   onset	
   of	
   symptoms.	
   Disorders	
   that	
   are	
   amenable	
   to	
   newborn	
   screening	
   should	
   have	
   an	
   effective	
   treatment	
   that	
   increases	
   health	
   outcomes	
   when	
   initiated	
   in	
   a	
   pre-­‐symptomatic	
   stage.	
   	
   In	
   1968,	
  Wilson	
  and	
  Jungner	
  outlined	
  a	
  series	
  of	
  criteria	
  for	
  consideration	
  before	
  a	
  condition	
   could	
  be	
  included	
  into	
  newborn	
  screening	
  programs	
  (Figure	
  1.3)	
  [96].	
  	
   Figure	
  1.3	
   Wilson	
  and	
  Jungner	
  classic	
  screening	
  criteria	
  [96]	
  (adapted	
  from	
  [97])	
   1. 2. 3. 4. 5. 6. 7.  The	
  condition	
  sought	
  should	
  be	
  an	
  important	
  health	
  problem.	
   There	
  should	
  be	
  an	
  accepted	
  treatment	
  for	
  patients	
  with	
  recognized	
  disease.	
   Facilities	
  for	
  diagnosis	
  and	
  treatment	
  should	
  be	
  available.	
   There	
  should	
  be	
  a	
  recognizable	
  latent	
  or	
  early	
  symptomatic	
  stage.	
   There	
  should	
  be	
  a	
  suitable	
  test	
  or	
  examination.	
   The	
  test	
  should	
  be	
  acceptable	
  to	
  the	
  population.	
   The	
   natural	
   history	
   of	
   the	
   condition,	
   including	
   development	
   from	
   latent	
   to	
   declared	
  disease,	
  should	
  be	
  adequately	
  understood.	
   8. There	
  should	
  be	
  an	
  agreed	
  policy	
  on	
  whom	
  to	
  treat	
  as	
  patients.	
   9. The	
   cost	
   of	
   case-­‐finding	
   (including	
   diagnosis	
   and	
   treatment	
   of	
   patients	
   diagnosed)	
   should	
   be	
   economically	
   balanced	
   in	
   relation	
   to	
   possible	
   expenditure	
  on	
  medical	
  care	
  as	
  a	
  whole.	
   10. Case-­‐finding	
   should	
   be	
   a	
   continuing	
   process	
   and	
   not	
   a	
   “once	
   and	
   for	
   all”	
   project.	
   Although	
   these	
   criteria	
   have	
   since	
   been	
   amended	
   or	
   clarified,	
   they	
   still	
   reflect	
   the	
   importance	
   of	
   reviewing	
   the	
   impact	
   of	
   newborn	
   screening	
   on	
   infants	
   and	
   their	
   families	
   (Figure	
  1.4)	
  [97].	
  	
    	
    20	
    Figure	
  1.4	
   World	
   Health	
   Organization	
   amendments	
   to	
   Wilson	
   and	
   Jungner	
   criteria	
   for	
   screening	
  [97]	
   § § § § § § § § § §  The	
  screening	
  programme	
  should	
  respond	
  to	
  a	
  recognized	
  need.	
   The	
  objectives	
  of	
  screening	
  should	
  be	
  defined	
  at	
  the	
  outset.	
   There	
  should	
  be	
  a	
  defined	
  target	
  population.	
   There	
  should	
  be	
  scientific	
  evidence	
  of	
  screening	
  programme	
  effectiveness.	
   The	
   programme	
   should	
   integrate	
   education,	
   testing,	
   clinical	
   services	
   and	
   programme	
  management.	
   There	
   should	
   be	
   quality	
   assurance,	
   with	
   mechanisms	
   to	
   minimize	
   potential	
   risks	
  of	
  screening.	
   The	
   programme	
   should	
   ensure	
   informed	
   choice,	
   confidentiality	
   and	
   respect	
   for	
  autonomy.	
   The	
  programme	
  should	
  promote	
  equity	
  and	
  access	
  to	
  screening	
  for	
  the	
  entire	
   target	
  population.	
   Programme	
  evaluation	
  should	
  be	
  planned	
  from	
  the	
  outset.	
   The	
  overall	
  benefits	
  of	
  screening	
  should	
  outweigh	
  the	
  harm	
    	
   In	
   Canada,	
   each	
   province	
   determines	
   which	
   tests	
   to	
   include	
   in	
   their	
   provincial	
   newborn	
   screening,	
  subsequently	
  the	
  disorders	
  Canadian	
  infants	
  are	
  tested	
  for	
  varies	
  from	
  province	
   to	
   province	
   (and	
   territory).	
   NBS	
   for	
   infants	
   born	
   in	
   the	
   three	
   Canadian	
   territories	
   is	
   conducted	
   by	
   adjoining	
   provinces.	
   Yukon	
   samples	
   are	
   tested	
   in	
   Vancouver,	
   Kivalliq	
   (Nunavut)	
   samples	
   are	
   tested	
   in	
   Winnipeg,	
   and	
   NWT,	
   Kitikmeot	
   (Nunavut),	
   and	
   Qikiqtani/Baffin	
   Island	
   (Nunavut)	
   samples	
   are	
   tested	
   in	
   Edmonton.	
   In	
   2006,	
   the	
   American	
   College	
   of	
  Medical	
  Genetics	
   released	
   a	
   review	
   of	
   tests	
   available	
   for	
   newborn	
   screening	
   and	
   recommended	
  29	
  conditions	
  which	
  should	
  be	
  core	
  or	
  primary	
  tests	
  in	
  all	
  NBS	
  programs,	
  as	
   well	
   as	
   outlining	
   secondary	
   target	
   tests	
   that	
   would	
   be	
   picked	
   up	
   by	
   tandem	
   mass	
   spectrometry,	
  which	
  included	
  CPT1A	
  deficiency	
  [98].	
    	
    21	
    Newborn	
   screening	
   programs	
   are	
   responsible	
   for	
   primary	
   screening	
   as	
   well	
   as	
   patient	
   follow-­‐up,	
   secondary	
   testing,	
   diagnosing	
   of	
   disorders,	
   and	
   evaluating	
   patients	
   undergoing	
   treatment	
   [98].	
   Expansion	
   of	
   newborn	
   screening	
   has	
   become	
   contentious	
   as	
   many	
   disorders	
   now	
   included,	
   or	
   in	
   consideration	
   to	
   be	
   included,	
   do	
   not	
   adhere	
   to	
   NBS	
   criteria	
   (Figures	
   1.3	
   and	
   1.4)	
   [97].	
   Any	
   new	
   test	
   to	
   be	
   added	
   the	
   newborn	
   screening	
   should	
   be	
   able	
   to	
   demonstrate	
   that	
   it	
   adheres	
   to	
   the	
   criteria	
   for	
   newborn	
   screening,	
   especially	
   disorders	
   with	
  variable	
  penetrance	
  or	
  when	
  there	
  is	
  uncertainty	
  as	
  to	
  whether	
  individuals	
  will	
  present	
   clinically	
   [99].	
   In	
   these	
   situations,	
   it	
   is	
   critical	
   that	
   medical	
   professionals,	
   parents,	
   and	
   communities	
  understand	
  the	
  implications	
  of	
  a	
  positive	
  screen	
  test.	
  A	
  positive	
  screen	
  test	
  for	
   such	
   disorders	
   can	
   impact	
   families	
   in	
   a	
   variety	
   of	
   ways,	
   including	
   invasive	
   follow-­‐up	
   testing,	
   hospitalisation	
   of	
   otherwise	
   healthy	
   infants,	
   expensive	
   dietary	
   requirements,	
   complicated	
   care	
   requirements,	
   and	
   psychosocial	
   impacts	
   like	
   medicalisation	
   of	
   healthy	
   infants	
   and	
   disruption	
  of	
  the	
  parent-­‐infant	
  bond	
  [100].	
  	
   There	
  is	
  currently	
  no	
  P479L	
  screening	
  available	
  to	
  parents	
  of	
  infants	
  born	
  in	
  any	
  of	
  Canada’s	
   three	
  territories.	
  Before	
  health	
  programs	
  targeting	
  the	
  variant,	
  which	
  may	
  include	
  newborn	
   screening,	
  can	
  be	
  initiated,	
  an	
  evidenced	
  based	
  process	
  is	
  needed	
  to	
  determine	
  if	
  there	
  is	
   an	
   increase	
   risk	
   for	
   morbidity	
   and	
   mortality	
   associated	
   with	
   the	
   variant.	
   If	
   there	
   is	
   an	
   associated	
   risk	
   with	
   homozygosity	
   for	
   the	
   variant,	
   then	
   it	
   may	
   be	
   appropriate	
   to	
   offer	
   newborn	
   screening	
   for	
   the	
   P479L	
   variant	
   in	
   Inuit	
   and	
   BC	
   First	
   Nations	
   populations.	
   Screening	
   for	
   P479L	
   in	
   early	
   infancy	
   during	
   the	
   disease-­‐free	
   interval	
   between	
   birth	
   and	
    	
    22	
    onset	
  of	
  symptoms	
  would	
  allow	
  an	
  early	
  diagnosis	
  and	
  appropriate	
  clinical	
  management	
  of	
   CPT1A	
  deficient	
  infants,	
  avoiding	
  CPT1A	
  deficiency	
  clinical	
  manifestations	
  [101].	
    	
    23	
    CHAPTER	
  2. CARNITINE	
   PALMITOYLTRANSFERASE	
   1A	
   (CPT1A)	
   p.P479L	
  PREVALENCE	
  IN	
  LIVE	
  NEWBORNS	
  IN	
  NUNAVUT,	
   NORTHWEST	
  TERRITORIES,	
  AND	
  YUKON1	
   	
    2.1  INTRODUCTION	
    First	
  reported	
  in	
  1981,	
  classic	
  carnitine	
  palmitoyltransferase	
  1A	
  (CPT1A)	
  deficiency	
  is	
  a	
  rare	
   autosomal	
   recessive	
   disorder	
   that	
   confers	
   risk	
   for	
   non-­‐ketotic	
   hypoglycaemia,	
   hepatic	
   encephalopathy,	
   seizures,	
   and	
   Sudden	
   Unexpected	
   Death	
   in	
   Infancy	
   (SUDI)	
   [63,64,70,74].	
   The	
  CPT1	
  enzyme	
  is	
  located	
  on	
  the	
  outer	
  mitochondrial	
  membrane	
  and	
  is	
  required	
  for	
  the	
   import	
  of	
  long	
  chain	
  fats	
  into	
  the	
  mitochondria	
  for	
  use	
  in	
  fatty	
  acid	
  oxidation	
  (FAO;	
  Figure	
   1.2)	
   [63,70,73,74].	
   CPT1A	
   encodes	
   the	
   liver	
   isoform	
   of	
   CPT1;	
   the	
   other	
   two	
   isoforms	
   are	
   CPT1B	
  (heart	
  and	
  muscle)	
  and	
  CPT1C	
  (brain)	
  [73,75].	
  Those	
  homozygous	
  for	
  a	
  thermolabile	
   variant	
  of	
  CPT1A,	
  p.P479L	
  (c.1436C>T),	
  have	
  decreased	
  CPT1A	
  activity	
  (2%-­‐54%	
  of	
  normal	
   with	
   a	
   mean	
   of	
   22%);	
   and	
   may	
   be	
   at	
   risk	
   of	
   decompensation	
   during	
   times	
   of	
   fever	
   and	
   intercurrent	
  illness	
  [6,65,102].	
  Several	
  Nunavut	
  Inuit	
  and	
  British	
  Columbia	
  (BC)	
  First	
  Nations	
   infants	
  and	
  children	
  have	
  presented	
  symptomatically	
  with	
  features	
  consistent	
  with	
  CPT1A	
   deficiency	
   or	
   with	
   sudden	
   unexpected	
   death	
   and	
   were	
   subsequently	
   found	
   to	
   be	
   homozygous	
   for	
   the	
   P479L	
   variant	
   [6,7,10,66].	
   However,	
   population	
   studies	
   of	
   the	
   P479L	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
   	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
   	
   1  A	
  version	
  of	
  chapter	
  2	
  has	
  been	
  published.	
  Collins	
  SA,	
  Sinclair	
  G,	
  McIntosh	
  S,	
  Bamforth	
  F,	
  Thompson	
   R,	
  Sobol	
  I,	
  Osborne	
  G,	
  Corriveau	
  A,	
  Santos	
  M,	
  Hanley	
  B,	
  Greenberg	
  CR,	
  Vallance	
  H,	
  Arbour	
  L.	
  (2010)	
   Carnitine	
  palmitoyltransferase	
  1A	
  (CPT1A)	
  P479L	
  prevalence	
  in	
  live	
  newborns	
  in	
  Yukon,	
  Northwest	
   Territories,	
  and	
  Nunavut.	
  Mol	
  Genet	
  Metab.	
  2010	
  Nov;101(2-­‐3):200-­‐204	
   	
    24	
    variant	
  have	
  not	
  yet	
  confirmed	
  whether	
  the	
  variant	
  is	
  contributing	
  to	
  the	
  adverse	
  outcomes	
   observed,	
  or	
  if	
  it	
  is	
  simply	
  observed	
  due	
  to	
  the	
  high	
  P479L	
  frequency	
  in	
  these	
  populations.	
   All	
   those	
   presenting	
   with	
   apparent	
   clinical	
   features	
   to	
   date	
   have	
   been	
   reported	
   in	
   First	
   Nations	
  and	
  Inuit	
  children	
  [6,7,10,66].	
   Classic	
   CPT1A	
   deficiency	
   is	
   normally	
   detectable	
   through	
   newborn	
   screening	
   by	
   measuring	
   the	
   ratio	
   of	
   free	
   carnitine	
   to	
   2	
   long	
   chain	
   acylcarnitines	
   (C16	
   +	
   C18)	
   using	
   tandem	
   mass	
   spectrometry	
  [87].	
  Although	
  this	
  standard	
  method	
  has	
  been	
  used	
  to	
  identify	
  a	
  number	
  of	
   Alaskan	
   infants	
   with	
   abnormal	
   acylcarnitine	
   profiles,	
   not	
   all	
   infants	
   homozygous	
   for	
   the	
   P479L	
  variant	
  are	
  identified	
  using	
  the	
  standard	
  cut	
  off	
  values.	
  	
  Furthermore,	
  many	
  infants	
   homozygous	
   for	
   the	
   variant	
   are	
   asymptomatic	
   [6,66,90].	
   Targeted	
   genotyping	
   of	
   CPT1A	
   has	
   been	
   a	
   routine	
   component	
   of	
   expanded	
   newborn	
   screening	
   in	
   Manitoba	
   targeted	
   only	
   to	
   Hutterite	
   newborns	
   with	
   classical	
   CPT1A	
   deficiency,	
   where	
   the	
   disease	
   causing	
   mutation	
   (c.2129GàA;	
   p.G710E)	
   is	
   prevalent	
   (homozygosity	
   rate	
   of	
   ~1/400)	
   and	
   is	
   associated	
   with	
   severe	
  disease	
  [64].	
  Whether	
  a	
  similar	
  DNA-­‐based	
  expanded	
  newborn	
  screening	
  should	
  be	
   instituted	
   for	
   those	
   newborns	
   at	
   risk	
   for	
   adverse	
   outcomes	
   due	
   to	
   the	
   CPT1A	
   P479L	
   variant	
   remains	
   to	
   be	
   determined.	
   Previous	
   reports	
   have	
   suggested	
   that	
   the	
   P479L	
   variant	
   is	
   frequent	
  in	
  the	
  Inuit	
  of	
  the	
  Kivalliq	
  region	
  of	
  Nunavut	
  and	
  the	
  Inuit	
  of	
  Greenland	
  (81%	
  and	
   73%,	
   respectively)	
   [6,8].	
   To	
   date,	
   screening	
   for	
   the	
   variant	
   in	
   the	
   three	
   territories	
   has	
   not	
   yet	
   been	
   implemented	
   since	
   there	
   is	
   controversy	
   as	
   to	
   whether	
   P479L	
   homozygosity	
   confers	
  risk	
  for	
  infant	
  morbidity	
  and	
  mortality.	
  For	
  that	
  reason,	
  an	
  evidence-­‐based	
  process	
   was	
  initiated	
  to	
  determine	
  the	
  population	
  implications	
  of	
  the	
  variant	
  in	
  the	
  three	
  northern	
   	
    25	
    territories	
   where	
   50%	
   of	
   the	
   inhabitants	
   are	
   Aboriginal	
   (25%	
   in	
   Yukon,	
   50%	
   in	
   Northwest	
   Territories	
  (NWT),	
  and	
  86%	
  in	
  Nunavut)	
  [12].	
  	
   We	
   present	
   the	
   results	
   of	
   our	
   background	
   study	
   to	
   determine	
   the	
   allele	
   frequency	
   across	
   Canada’s	
   North.	
   These	
   results	
   of	
   this	
   study	
   will	
   be	
   combined	
   with	
   results	
   from	
   study	
   of	
   P479L	
  frequency	
  in	
  infant	
  mortality	
  cases	
  in	
  the	
  three	
  territories	
  to	
  provide	
  an	
  assessment	
   as	
  to	
  whether	
  newborn	
  screening	
  or	
  other	
  public	
  health	
  measures	
  should	
  be	
  considered.	
  	
    2.2  METHODS	
    2.2.1 ETHICS	
   Ethics	
   and	
   regulatory	
   approval	
   was	
   obtained	
   from	
   UBC	
   Research	
   Ethics	
   Board,	
   Aurora	
   Research	
   Institute	
   (NWT),	
   Stanton	
   Territorial	
   Health	
   Authority	
   (NWT),	
   Nunavut	
   Research	
   Institute,	
   and	
   the	
   University	
   of	
   Manitoba.	
   Territorial	
   Aboriginal	
   organisations	
   consultation	
   included:	
   Nunavut	
   Tunngavik	
   Inc.	
   (NTI),	
   the	
   Inuvialuit	
   Regional	
   Corporation	
   (NWT),	
   the	
   Dene	
  Nation	
  (NWT),	
  and	
  the	
  Yukon	
  First	
  Nations	
  Health	
  Commission.	
   2.2.2 SAMPLE	
  COLLECTION	
   In	
   collaboration	
   with	
   the	
   Newborn	
   Screening	
   program	
   at	
   the	
   BC	
   Children’s	
   Hospital,	
   the	
   Alberta	
  Newborn	
  Screening	
  Program,	
  and	
  the	
  Newborn	
  Screening	
  program	
  at	
  the	
  Cadham	
   Provincial	
   Laboratory	
   in	
   Manitoba,	
   newborn	
   dried	
   blood	
   spots	
   (DBS)	
   were	
   collected	
   for	
   infants	
  born	
  in	
  2006	
  in	
  the	
  Yukon,	
  NWT,	
  and	
  Nunavut	
  and	
  were	
  genotyped	
  for	
  the	
  p.P479L	
   variant	
   of	
   CPT1A.	
   Due	
   to	
   samples	
   not	
   being	
   available	
   prior	
   to	
   April	
   2006	
   from	
   the	
   Qikiqtani	
   	
    26	
    region,	
  spots	
  from	
  a	
  full	
  calendar	
  year	
  from	
  April	
  6,	
  2006	
  to	
  March	
  30,	
  2007	
  were	
  tested.	
   The	
   DBS	
   cards	
   were	
   identified	
   and	
   accessed	
   from	
   storage	
   based	
   on	
   patient	
   health	
   identification	
   number,	
   location	
   of	
   birth,	
   or	
   mother’s	
   place	
   of	
   residence.	
   All	
   samples	
   were	
   anonymized	
  and	
  provided	
  with	
  a	
  unique	
  identifier.	
  Individual	
  Aboriginal	
  identity	
  according	
   to	
   genotype	
   could	
   be	
   determined	
   for	
   samples	
   from	
   NWT,	
   where	
   the	
   maternal	
   health	
   number	
  is	
  informative	
  for	
  First	
  Nations,	
  Inuvialuit,	
  Métis,	
  and	
  non-­‐Aboriginal	
  ancestry.	
  This	
   method	
   should	
   identify	
   all	
   Aboriginal	
   residents	
   receiving	
   benefits	
   allocated	
   to	
   Aboriginal	
   groups	
  in	
  NWT;	
  however,	
  there	
  may	
  be	
  some	
  Aboriginal	
  individuals	
  not	
  identified	
  as	
  such	
   by	
  their	
  health	
  care	
  number	
  and,	
  in	
  some	
  rare	
  cases,	
  individuals	
  identified	
  as	
  Aboriginal	
  by	
   their	
  health	
  care	
  numbers	
  who	
  are	
  not	
  ethnically	
  Aboriginal.	
  	
   2.2.3 GENOTYPE	
  ANALYSIS	
   DNA	
  was	
  extracted	
  from	
  3mm	
  bloodspot	
  punches	
  using	
  the	
  Gentra	
  Generation	
  Capture	
  Kit	
   following	
  the	
  manufacture’s	
  protocol	
  (Qiagen,	
  Mississauga,	
  Ont.).	
  Genotyping	
  of	
  the	
  Kivalliq	
   region	
  samples	
  was	
  conducted	
  using	
  the	
  PCR-­‐RFLP	
  technique,	
  as	
  previously	
  described	
  [6].	
   All	
   other	
   samples	
   were	
   genotyped	
   using	
   TaqMan	
   allelic	
   discrimination	
   RT-­‐PCR	
   assay.	
   DNA	
   was	
   amplified	
   by	
   PCR	
   using	
   a	
   25	
   µl	
   reaction	
   mixture	
   containing:	
   2.5µl	
   of	
   purified	
   DNA,	
   12.5μL	
   TaqMan	
   Universal	
   PCR	
   Master	
   Mix	
   (Applied	
   Biosystems,	
   Mississauga,	
   ON),	
   9.375µl	
   of	
   dH2O,	
   and	
   0.625μL	
   CPT1A	
   Probe	
   and	
   Primer	
   Mix	
   “CPT1a-­‐CPT1,	
   SNP	
   AbD”	
   (containing	
   primers:	
   GGCCTCAACGCTGAACACT	
   (5’);	
   GTGAAAACTCACCTCCCAAAGGT	
   (3’);	
   normal	
   reporter:	
   CPT1A-­‐CPT1V2,	
   CACGATCGGCGCATC,	
   VIC;	
   mutant	
   reporter:	
   CPT1A-­‐CPT1M2,	
   CACGATCAGCGCATC).	
   PCR	
   amplification	
   was	
   conducted	
   using	
   a	
   PRISM	
   7000	
   sequence	
   	
    27	
    detection	
  system	
  (Applied	
  Biosystems).	
  Reaction	
  conditions	
  were	
  2	
  min	
  at	
  50°C,	
  10	
  min	
  at	
   95°C,	
   followed	
   by	
   40	
   thermal	
   cycles	
   of	
   15s	
   at	
   95°C	
   and	
   1min	
   at	
   60°C.	
   Sample	
   genotype	
   was	
   determined	
   using	
   the	
   ABI	
   Prism	
   7000	
   SDS	
   software	
   by	
   analysing	
   the	
   allelic	
   specific	
   fluorescence	
  data.	
   2.2.4 STATISTICAL	
  ANALYSIS	
   Genotype	
  frequencies	
  were	
  calculated	
  and	
  statistically	
  analyzed	
  using	
  the	
  Χ2	
  test	
  to	
  analyse	
   deviation	
   from	
   predicted	
   frequencies	
   from	
   the	
   Hardy-­‐Weinberg	
   equation	
   with	
   p<0.05	
   significance	
   level	
   using	
   STATA	
   10	
   (StataCorp.	
   2007.	
   Stata	
   Statistical	
   Software:	
   Release	
   10.	
   College	
  Station,	
  TX:	
  StataCorp	
  LP).	
  Hardy-­‐Weinberg	
  equilibrium	
  (HWE)	
  analysis	
  was	
  carried	
   out	
  in	
  Aboriginal	
  specific	
  populations	
  when	
  possible.	
  	
    2.3  RESULTS	
    The	
   P479L	
   variant	
   genotype	
   frequencies,	
   shown	
   in	
   Table	
   2.1,	
   varied	
   throughout	
   Canada’s	
   North.	
   The	
   highest	
   prevalence	
   was	
   in	
   Nunavut.	
   The	
   allele	
   frequency	
   varied	
   in	
   the	
   three	
   Nunavut	
   regions,	
   with	
   the	
   Kitikmeot	
   region	
   having	
   the	
   highest	
   (0.85;	
   95%CI:	
   0.81-­‐0.89),	
   followed	
   by	
   Kivalliq	
   (0.83;	
   95%CI:	
   0.80-­‐0.86),	
   and	
   Qikiqtani	
   (0.68;	
   95%CI:	
   0.64-­‐0.72).	
   The	
   P479L	
  variant	
  deviated	
  from	
  HWE	
  (p<0.001)	
  in	
  the	
  Qikiqtani	
  region.	
  Aboriginal	
  status	
  was	
   not	
  available	
  for	
  the	
  Nunavut	
  DBS	
  samples;	
  however,	
  ~90%	
  of	
  births	
  are	
  to	
  Inuit	
  women,	
  or	
   approximately	
   272	
   of	
   the	
   302	
   infants	
   born	
   in	
   2006	
   in	
   Qikiqtani	
   [2].	
   If	
   all	
   heterozygotes	
   (n=89)	
  and	
  P479L	
  homozygotes	
  (n=162)	
  in	
  the	
  Qikiqtani	
  region	
  were	
  of	
  Inuit	
  ancestry,	
  the	
   allele	
  frequency	
  would	
  be	
  0.76	
  in	
  this	
  reduced	
  sample	
  and	
  would	
  be	
  within	
  HWE	
  (p=0.083).	
  	
   	
    28	
    Table	
  2.1	
   Distribution	
   of	
   CPT1A	
   P479L	
   genotypes	
   with	
   estimated	
   allele	
   frequencies	
   in	
   infants	
  born	
  in	
  2006	
  in	
  the	
  Northern	
  territories	
  of	
  Canada.	
   	
    	
    	
    n	
   	
    	
    	
    	
   	
    wt/wta	
   	
   wt/P479L	
   	
   P479L/P479L	
   	
    P479L	
  allele	
    n	
    f	
    f	
   	
    	
   n	
   	
   	
    f	
   	
    	
   	
   	
    n	
    f	
   	
    	
   	
   	
    95%	
  CI	
   	
    695	
   	
    67	
   0.10	
   	
   186	
   0.27	
   	
    442	
   0.64	
    	
   0.77b	
   0.75-­‐0.79	
    Qikiqtani	
    302	
   	
    51	
   0.17	
   	
   89	
   0.30	
   	
    162	
   0.54	
    	
   0.68b	
   0.64-­‐0.72	
    Kivalliq	
    243	
   	
    11	
   0.05	
   	
   62	
   0.26	
   	
    170	
   0.70	
    	
   0.83	
  	
  	
   0.80-­‐0.86	
    Kitikmeot	
    150	
   	
    5	
   0.03	
   	
   35	
   0.23	
   	
    110	
   0.73	
    	
   0.85	
   0.81-­‐0.89	
    Nunavut	
    	
    	
   	
    NWT	
    	
   	
    	
    	
   	
    	
    Métis	
    	
    	
   	
    	
   0.08b	
   0.06-­‐0.10	
    23	
   0.33	
   	
   32	
   0.46	
   	
    15	
   0.21	
    	
   0.44	
  	
   0.36-­‐0.52	
    233	
   	
   216	
   0.93	
   	
   14	
   0.06	
   	
    3	
   0.01	
    	
   0.04b	
   0.02-­‐0.06	
    70	
   	
    First	
  Nations	
    	
   	
   18	
   0.03	
    564	
   	
   494	
   0.88	
   	
   52	
   0.09	
   	
    Inuit/Inuvialuit	
    31	
   	
    31	
   1.00	
   	
    0	
   0.00	
   	
    0	
   0.00	
    	
   0.00	
   -­‐	
    Non-­‐Aboriginal	
   227	
   	
   221	
   0.97	
   	
    6	
   0.03	
   	
    0	
   0.00	
    	
   0.01	
   0.00-­‐0.02	
    undefined	
    0	
   0.00	
   	
    0	
   0.00	
    	
   0.00	
   -­‐	
    3	
   	
    	
    	
   	
    Yukon	
   	
    	
    3	
   1.00	
   	
   	
   	
    	
    	
   	
    	
    325	
   	
   312	
   0.96	
   	
   13	
   0.04	
   	
   	
    	
   	
    	
    	
   	
    	
    	
   	
    	
   	
   0	
   0.00	
   	
    	
    	
   	
    	
   0.02	
   0.01-­‐0.03	
   	
   	
    	
    CI:	
  Confidence	
  Interval	
   a Wild	
  type	
   b Genotype	
  frequencies	
  deviated	
  from	
  HWE	
  (p<0.05)	
   	
   In	
   NWT,	
   the	
   territorial	
   allele	
   frequency	
   was	
   substantially	
   lower	
   than	
   in	
   Nunavut,	
   at	
   0.08	
   (95%CI:	
   0.06-­‐0.10).	
   The	
   Inuvialuit	
   had	
   the	
   highest	
   frequency	
   (0.44;	
   95%CI:	
   0.36-­‐0.52),	
   followed	
  by	
  First	
  Nations	
  (0.04;	
  95%CI:	
  0.02-­‐0.06).	
  There	
  were	
  6	
  heterozygotes	
  in	
  the	
  non-­‐ Aboriginal	
   group.	
   The	
   P479L	
   variant	
   was	
   not	
   detected	
   in	
   those	
   with	
   maternal	
   self-­‐ identification	
  as	
  Métis	
  (n=31).	
  The	
  P479L	
  allele	
  distribution	
  in	
  the	
  Inuvialuit	
  was	
  within	
  HWE	
   	
    29	
    but	
  not	
  in	
  the	
  NWT	
  First	
  Nations,	
  where	
  no	
  P479L	
  homozygotes	
  would	
  be	
  expected	
  at	
  an	
   allele	
  frequency	
  of	
  0.04.	
   In	
   the	
   Yukon,	
   there	
   were	
   no	
   P479L	
   allele	
   homozygotes	
   but	
   13	
   heterozygotes.	
   Since	
   Aboriginal	
  status	
  was	
  not	
  available	
  for	
  Yukon	
  DBS	
  samples,	
  it	
  was	
  not	
  possible	
  to	
  determine	
   if	
   all	
   heterozygous	
   infants	
   were	
   of	
   Aboriginal	
   ancestry.	
   In	
   2006,	
   21.7%	
   (n=71)	
   of	
   Yukon	
   births	
   were	
   to	
   Status	
   Indian	
   mothers.	
   If	
   all	
   13	
   heterozygotes	
   were	
   Aboriginal,	
   this	
   would	
   result	
  in	
  an	
  allele	
  frequency	
  of	
  0.09	
  in	
  the	
  Aboriginal	
  population	
  (carrier	
  rate	
  of	
  1/6).	
  	
    2.4  DISCUSSION	
    Hepatic	
  CPT1A	
  imports	
  long-­‐chain	
  fatty	
  acids	
  into	
  mitochondria	
  for	
  use	
  in	
  FAO	
  (Figure	
  1.2)	
   [63,70,73,74].	
  CPT1A	
  is	
  active	
  during	
  fasting	
  to	
  maintain	
  energy	
  and	
  blood	
  glucose	
  levels.	
  In	
   the	
   fed	
   state,	
   CPT1A	
   is	
   inhibited	
   by	
   malonyl-­‐CoA,	
   a	
   product	
   of	
   glycolysis	
   and	
   substrate	
   of	
   fatty	
   acid	
   synthesis.	
   Classic	
   CPT1A	
   deficiency	
   is	
   a	
   rare	
   autosomal	
   recessive	
   disorder	
   and	
   presents	
   in	
   infancy	
   with	
   hypoketotic	
   hypoglycemia,	
   which	
   can	
   lead	
   to	
   seizures,	
   hepatoencephalopathy,	
  and,	
  in	
  rare	
  cases,	
  sudden	
  death	
  [63,70,74].	
   A	
  CPT1A	
  variant,	
  p.P479L	
  (c.1436	
  C>T),	
  is	
  present	
  in	
  Canadian	
  and	
  Greenland	
  Inuit,	
  BC	
  First	
   Nations,	
   and	
   Alaska	
   Natives	
   [6,8,66].	
   In	
   vitro,	
   the	
   P479L	
   variant	
   protein	
   is	
   constitutively	
   active	
  due	
  to	
  reduced	
  inhibition	
  by	
  malonyl-­‐CoA	
  and	
  it	
  has	
  decreased	
  thermostability	
  and	
   functional	
   activity	
   (<50%)	
   [6,65].	
   Although	
   the	
   pathogenic	
   link	
   between	
   the	
   variant	
   and	
   infant	
   mortality	
   and	
   morbidity	
   has	
   not	
   yet	
   been	
   established,	
   it	
   may	
   confer	
   risk	
   when	
   combined	
  with	
  secondary	
  exogenous	
  stressors,	
  i.e.	
  fever	
  and	
  illness.	
  A	
  number	
  of	
  Inuit	
  and	
   	
    30	
    BC	
   First	
   Nations	
   children,	
   all	
   homozygous	
   for	
   the	
   allele,	
   have	
   presented	
   with	
   clinical	
   features	
   such	
   as	
   hypoglycaemia,	
   seizures,	
   and	
   sudden	
   unexpected	
   death;	
   symptoms	
   that	
   are	
   consistent	
   with	
   a	
   condition	
   of	
   impaired	
   FAO	
   [6,66].	
   Autopsy	
   findings	
   of	
   infants	
   homozygous	
   for	
   the	
   allele	
   have	
   included	
   fatty	
   infiltrates	
   into	
   the	
   liver	
   and,	
   in	
   one	
   case,	
   into	
   the	
  right	
  ventricle	
  (unpublished	
  data).	
  A	
  study	
  of	
  the	
  Kivalliq	
  region	
  of	
  Nunavut	
  found	
  that	
   70%	
   of	
   infants	
   who	
   died	
   unexpectedly	
   during	
   the	
   study	
   period	
   were	
   homozygous	
   for	
   the	
   P479L	
  variant,	
  but	
  this	
  did	
  not	
  exceed	
  the	
  population	
  homozygosity	
  (69.7%;	
  294/422)	
  [6].	
  	
   This	
   study	
   suggests	
   a	
   high	
   frequency	
   of	
   the	
   P479L	
   variant	
   in	
   Nunavut	
   and	
   Inuit/Inuvialuit	
   infants	
   born	
   in	
   2006,	
   which	
   is	
   consistent	
   with	
   results	
   from	
   previous	
   studies	
   of	
   Inuit	
   populations	
  in	
  the	
  Kivalliq	
  region	
  of	
  Nunavut	
  and	
  in	
  Greenland	
  [6,8].	
  The	
  allele	
  distribution	
   was	
   not	
   consistent	
   with	
   HWE	
   (p<0.001)	
   in	
   Nunavut	
   as	
   a	
   whole,	
   but	
   this	
   may	
   not	
   be	
   true	
   within	
  the	
  Inuit	
  population	
  of	
  this	
  region.	
  Both	
  Kitikmeot	
  and	
  Kivalliq	
  were	
  within	
  HWE,	
  as	
   are	
  the	
  Greenland	
  Inuit	
  and	
  coastal	
  Alaska	
  Natives	
  [8,9].	
  However,	
  in	
  the	
  Qikiqtani	
  region,	
   genotype	
   frequencies	
   did	
   deviate	
   from	
   HWE.	
   Approximately	
   90%	
   of	
   infants	
   born	
   in	
   this	
   region	
   are	
   to	
   Inuit	
   mothers	
   [2].	
   Although	
   it	
   was	
   not	
   possible	
   to	
   identify	
   ethnicity	
   for	
   the	
   Nunavut	
   samples;	
   if	
   it	
   is	
   assumed	
   that	
   all	
   P479L	
   homozygotes	
   (n=162)	
   and	
   heterozygotes	
   (n=89)	
   in	
   the	
   Qikiqtani	
   region	
   were	
   of	
   Inuit	
   ancestry,	
   the	
   genotype	
   frequencies	
   in	
   the	
   reduce	
  sample	
  size	
  (n=272)	
  do	
  not	
  deviate	
  from	
  those	
  expected	
  under	
  HWE	
  (p>0.05).	
   The	
  P479L	
  allele	
  frequency	
  in	
  the	
  Inuvialuit	
  of	
  NWT	
  (0.44)	
  was	
  markedly	
  lower	
  than	
  in	
  the	
   Nunavut	
   Inuit	
   and	
  coastal	
   Alaskan	
   Natives	
   (51%)	
   [9].	
  The	
  allele	
  prevalence	
   in	
   the	
   NWT	
   First	
   Nations	
   and	
   in	
   the	
   general	
   population	
   of	
   Yukon	
   was	
   low	
   (0.04,	
   0.02	
   respectively),	
   with	
   only	
   	
    31	
    1%	
   homozygosity	
   in	
   NWT	
   First	
   Nations	
   and	
   no	
   homozygotes	
   present	
   in	
   the	
   Yukon	
   during	
   our	
   study.	
   The	
   low	
   homozygosity	
   in	
   these	
   groups	
   was	
   unexpected	
   as	
   Gessner	
   et	
   al.	
   [9]	
   report	
  P479L	
  homozygosity	
  of	
  33%	
  (n=378)	
  in	
  central,	
  southern	
  and	
  eastern	
  Alaska	
  Native	
   populations	
  and	
  it	
  is	
  estimated	
  that	
  9.8%	
  of	
  BC	
  First	
  Nations	
  are	
  homozygous	
  for	
  the	
  allele	
   (Sinclair	
   and	
   Vallance,	
   personal	
   communication).	
   Ethnicity	
   was	
   not	
   available	
   for	
   Yukon	
   samples;	
  however,	
  if	
  all	
  P479L	
  carriers	
  detected	
  in	
  the	
  Yukon	
  were	
  of	
  First	
  Nations	
  ancestry,	
   the	
  allele	
  frequency	
  would	
  0.09	
  in	
  this	
  population.	
  	
   Genotype	
  frequencies	
  in	
  the	
  NWT	
  First	
  Nations	
  deviated	
  from	
  those	
  expected	
  under	
  HWE.	
   P479L	
  genotype	
  frequencies	
  also	
  deviated	
  from	
  HWE	
  in	
  the	
  central,	
  southern	
  and	
  eastern	
   Alaska	
   Native	
   populations	
   [9]	
   and	
   in	
   BC	
   First	
   Nations	
   (Sinclair	
   and	
   Vallance,	
   personal	
   communication).	
   The	
   Hardy	
   Weinberg	
   disequilibrium	
   in	
   First	
   Nations	
   and	
   in	
   Alaskan	
   non-­‐ Inuit	
   populations	
   may	
   represent	
   admixture	
   of	
   these	
   populations	
   or	
   it	
   may	
   represent	
   an	
   advantage	
  of	
  P479L	
  and	
  wildtype	
  homozygosity	
  over	
  heterozygosity.	
   The	
  high	
  prevalence	
  of	
  the	
  variant	
  in	
  the	
  Inuit	
  populations	
  may	
  be	
  due	
  to	
  founder	
  effect,	
   genetic	
  drift,	
  linkage	
  to	
  another	
  polymorphism	
  that	
  is	
  advantageous,	
  or	
  it	
  may	
  represent	
  an	
   historical	
  benefit	
  for	
  those	
  with	
  the	
  P479L	
  variant	
  in	
  these	
  regions.	
  The	
  traditional	
  diet	
  of	
   populations	
   in	
   Canada’s	
   North	
   was	
   a	
   high	
   fat,	
   moderate	
   protein	
   diet	
   with	
   little	
   to	
   no	
   carbohydrate	
   sources	
   available	
   [103].	
   The	
   constitutively	
   active,	
   malonyl-­‐CoA	
   resistant,	
   P479L	
  CPT1A	
  protein	
  may	
  have	
  been	
  advantageous	
  by	
  maintaining	
  FAO	
  and	
  ketogenesis	
  at	
   all	
  times;	
  this	
  would	
  be	
  especially	
  advantageous	
  during	
  periods	
  of	
  diet	
  change	
  when	
  high	
  fat	
   food	
   sources	
   were	
   limited	
   [6].	
   Study	
   of	
   plasma	
   HDL-­‐cholesterol	
   and	
   associated	
   apoA-­‐I	
   in	
   	
    32	
    Greenland	
   Inuit	
   found	
   a	
   possible	
   protective	
   effect	
   associated	
   with	
   the	
   variant	
   against	
   cardiovascular	
   disease	
   in	
   adults,	
   although	
   this	
   information	
   alone	
   does	
   not	
   likely	
   explain	
   a	
   selective	
  advantage	
  for	
  the	
  variant	
  [8].	
  The	
  presence	
  of	
  the	
  variant	
  in	
  the	
  distantly	
  related	
   populations	
   of	
   Inuit	
   and	
   Inuvialuit	
   of	
   Nunavut	
   and	
   NWT,	
   the	
   Inuit	
   of	
   Greenland,	
   and	
   the	
   Yupik	
  Alaskan	
  Natives	
  indicates	
  that	
  this	
  variant	
  may	
  have	
  a	
  place	
  in	
  the	
  migration	
  history	
  of	
   these	
  populations.	
  The	
  relationship	
  of	
  the	
  variant	
  in	
  BC	
  First	
  Nations	
  as	
  a	
  dietary	
  advantage	
   remains	
  unclear,	
  as	
  does	
  the	
  ancestral	
  relationship	
  to	
  Inuit	
  populations.	
  	
   Although	
  the	
  high	
  prevalence	
  of	
  the	
  P479L	
  variant	
  reduces	
  the	
  likelihood	
  that	
  homozygosity	
   for	
   the	
   variant	
   was	
   deleterious	
   historically,	
   it	
   is	
   possible	
   that	
   current	
   dietary	
   practices,	
   including	
   the	
   consumption	
   of	
   carbohydrate	
   rich	
   foods	
   and	
   decreased	
   length	
   of	
   breast	
   feeding,	
   could	
   play	
   a	
   role	
   in	
   increasing	
   risk	
   for	
   infants	
   who	
   might	
   be	
   affected	
   with	
   accompanying	
   intercurrent	
   illness	
   [20,104].	
   Further	
   study	
   is	
   currently	
   underway	
   to	
   determine	
   the	
   prevalence	
   of	
   the	
   P479L	
   variant	
   in	
   infant	
   mortality	
   cases	
   in	
   all	
   three	
   territories.	
  Results	
  from	
  the	
  current	
  study	
  will	
  be	
  combined	
  with	
  that	
  study	
  to	
  determine	
  if	
   the	
   P479L	
   variant	
   plays	
   a	
   role	
   in	
   the	
   excess	
   infant	
   mortality	
   cases	
   found	
   in	
   the	
   Canadian	
   Northern	
  territories.	
    	
    33	
    CHAPTER	
  3. DOES	
   THE	
   CPT1A	
   p.P479L	
   VARIANT	
   PLAY	
   A	
   ROLE	
   IN	
   EXCESS	
   INFANT	
   MORTALITY	
   CASES	
   OF	
   NUNAVUT,	
   NWT,	
   AND	
  YUKON?	
   	
    3.1  INTRODUCTION	
    Classical	
   CPT1A	
   deficiency	
   is	
   a	
   rare	
   autosomal	
   recessive	
   disorder,	
   with	
   only	
   ~40	
   cases	
   reported	
   in	
   the	
   literature	
   worldwide.	
   CPT1A	
   deficiency	
   can	
   cause	
   hypoketotic	
   hypoglycaemia,	
   and	
   metabolic	
   decompensation.	
   If	
   untreated,	
   this	
   can	
   progress	
   to	
   hepatic	
   encephalopathy,	
   seizures,	
   coma,	
   and,	
   in	
   rare	
   cases,	
   Sudden	
   Unexpected	
   Death	
   in	
   Infancy	
   (SUDI)	
  [63,64,70,74].	
  	
   Discovered	
  by	
  Brown	
  et	
  al.	
  in	
  2001,	
  the	
  P479L	
  variant	
  of	
  CPT1A	
  has	
  been	
  found	
  to	
  be	
  very	
   common	
   in	
   Inuit/Inuvialuit	
   populations	
   of	
   Nunavut,	
   NWT,	
   Alaska,	
   and	
   Greenland	
   (64%,	
   21%,	
   51%,	
   and	
   54%	
   homozygosity)	
   [6,8,9,105].	
   The	
   variant	
   also	
   has	
   an	
   estimated	
   homozygosity	
   of	
   approximately	
   9.8%	
   in	
   BC	
   First	
   Nations	
   (Sinclair	
   and	
   Vallance,	
   personal	
   communication).	
   Although	
   the	
   variant	
   is	
   prevalent	
   in	
   these	
   populations,	
   more	
   than	
   40	
   infants	
   homozygous	
   for	
   the	
   variant	
   have	
   presented	
   with	
   features	
   of	
   CPT1A	
   deficiency,	
   including	
   seizures	
   and	
   sudden	
   unexpected	
   death	
   [6,10,90].	
   To	
   date,	
   all	
   reported	
   affected	
   individuals	
  have	
  been	
  of	
  Inuit,	
  Alaska	
  Native,	
  or	
  First	
  Nations	
  ancestry.	
  	
   Classical	
   CPT1A	
   deficiency	
   is	
   detected	
   during	
   newborn	
   screening	
   by	
   measuring	
   free	
   carnitine	
   to	
   long	
   chain	
   acyl-­‐carnitines	
   (C0/16+C18)	
   using	
   tandem	
   mass	
   spectrometry.	
   Current	
   cut-­‐offs	
   values	
   of	
   130	
   for	
   this	
   ratio	
   would	
   need	
   to	
   be	
   substantially	
   reduced	
   to	
   	
    34	
    reliably	
   identify	
   infants	
   homozygous	
   for	
   the	
   P479L	
   variant,	
   which	
   would	
   reduce	
   the	
   specificity	
  of	
  the	
  test	
  [7,94].	
  Secondary	
  genotyping	
  for	
  the	
  P479L	
  variant	
  of	
  CPT1A	
  for	
  those	
   above	
  a	
  lowered	
  cut-­‐off	
  would	
  be	
  costly	
  but	
  would	
  reduce	
  false	
  positive	
  results.	
   This	
  study	
  determined	
  the	
  P479L	
  genotype	
  for	
  infant	
  mortality	
  cases	
  in	
  the	
  three	
  territories	
   from	
  1999	
  to	
  2008	
  for	
  deaths	
  due	
  to	
  infectious	
  disease	
  and	
  SUDI,	
  which	
  includes	
  SIDS,	
  and	
   compared	
   the	
   frequency	
   of	
   the	
   allele	
   in	
   these	
   cases	
   to	
   the	
   prevalence	
   of	
   the	
   allele	
   in	
   newborns	
  born	
  in	
  each	
  territory	
  in	
  2006.	
  This	
  data	
  will	
  aid	
  in	
  determining	
  whether	
  infants	
   homozygous	
  for	
  the	
  P479L	
  CPT1A	
  variant	
  are	
  at	
  increased	
  risk	
  for	
  infant	
  mortality.	
    3.2  METHODS	
    3.2.1 ETHICS	
   Ethics	
   and	
   regulatory	
   approval	
   was	
   obtained	
   from	
   UBC	
   Research	
   Ethics	
   Board,	
   Aurora	
   Research	
   Institute	
   (NWT),	
   Stanton	
   Territorial	
   Health	
   Authority	
   (NWT),	
   Nunavut	
   Research	
   Institute,	
   and	
   the	
   University	
   of	
   Manitoba.	
   Territorial	
   Aboriginal	
   organisations	
   consultation	
   included:	
   Nunavut	
   Tunngavik	
   Inc.	
   (NTI),	
   the	
   Inuvialuit	
   Regional	
   Corporation	
   (NWT),	
   the	
   Dene	
  Nation	
  (NWT),	
  and	
  the	
  Yukon	
  First	
  Nations	
  Health	
  Commission.	
   3.2.2 SAMPLE	
  COLLECTION	
   Newborn	
  dried	
  blood	
  spots	
  (DBS)	
  cards	
  were	
  collected	
  for	
  infants	
  born	
  in	
  the	
  Yukon,	
  NWT,	
   and	
   Nunavut	
   and	
   were	
   genotyped	
   for	
   the	
   p.P479L	
   variant	
   of	
   CPT1A	
   in	
   collaboration	
   with	
   the	
   Newborn	
   Screening	
   program	
   at	
   the	
   BC	
   Children’s	
   Hospital,	
   the	
   Alberta	
   Newborn	
   Screening	
   Program,	
   and	
   the	
   Newborn	
   Screening	
   program	
   at	
   the	
   Cadham	
   Provincial	
   	
    35	
    Laboratory	
  in	
  Manitoba.	
  Infant	
  mortality	
  cases	
  (birth	
  to	
  one	
  year	
  of	
  age)	
  during	
  the	
  period	
   of	
  January	
  1,	
  1999	
  to	
  December	
  31,	
  2008	
  were	
  reviewed	
  by	
  the	
  coroner	
  for	
  each	
  territory.	
   To	
   be	
   included	
   in	
   the	
   study,	
   cases	
   had	
   causes	
   of	
   death	
   listed	
   as:	
   infectious	
   disease,	
   SUDI,	
   SIDS,	
   unexplained	
   death,	
   or	
   cause	
   of	
   death	
   unknown.	
   The	
   dried	
   blood	
   spot	
   cards	
   (DBS)	
   cards	
   were	
   matched	
   with	
   case	
   information	
   using	
   date	
   of	
   birth,	
   name,	
   place	
   of	
   birth,	
   maternal	
   health	
   identification	
   number,	
   and/or	
   mother’s	
   place	
   of	
   residence.	
   All	
   samples	
   were	
   anonymized	
   and	
   provided	
   with	
   a	
   unique	
   identifier.	
   Individual	
   Aboriginal	
   identity	
   according	
   to	
   genotype	
   could	
   be	
   determined	
   for	
   samples	
   from	
   NWT,	
   where	
   the	
   maternal	
   health	
   number	
   is	
   informative	
   for	
   First	
   Nations,	
   Inuvialuit,	
   Métis,	
   and	
   non-­‐Aboriginal	
   ancestry.	
  This	
  method	
  should	
  identify	
  all	
  Aboriginal	
  residents	
  receiving	
  benefits	
  allocated	
  to	
   Aboriginal	
   groups	
   in	
   NWT;	
   however,	
   there	
   may	
   be	
   some	
   Aboriginal	
   individuals	
   not	
   identified	
  as	
  such	
  by	
  their	
  health	
  care	
  number	
  and,	
  in	
  some	
  rare	
  cases,	
  individuals	
  identified	
   as	
  Aboriginal	
  by	
  their	
  health	
  care	
  numbers	
  who	
  are	
  not	
  ethnically	
  Aboriginal.	
  	
   Between	
  the	
  years	
  of	
  1999	
  and	
  2008,	
  79	
  cases	
  were	
  identified	
  in	
  the	
  three	
  territories,	
  59	
  in	
   Nunavut,	
   16	
   in	
   NWT,	
   and	
   4	
   in	
   the	
   Yukon.	
   Of	
   the	
   59	
   Nunavut	
   cases,	
   20	
   samples	
   were	
   available	
  for	
  testing	
  or	
  had	
  already	
  been	
  tested	
  at	
  time	
  of	
  birth	
  (Kivalliq	
  region)	
  or	
  death;	
   4/27	
   from	
   the	
   Qikiqtani	
   Region,	
   5/15	
   from	
   Kitikmeot	
   region	
   and	
   11/17	
   from	
   the	
   Kivalliq	
   region.	
   Of	
   the	
   16	
   cases	
   in	
   NWT,	
   7	
   samples	
   were	
   available	
   for	
   testing.	
   Of	
   the	
   48	
   missing	
   samples	
   from	
   Nunavut	
   and	
   NWT,	
   31	
   samples	
   had	
   been	
   destroyed	
   and	
   17	
   were	
   either	
   unavailable	
   or	
   could	
   not	
   be	
   linked	
   to	
   cases.	
   All	
   4	
   cases	
   from	
   the	
   Yukon	
   were	
   available.	
    	
    36	
    Newborn	
  blood	
  spots	
  cards	
  for	
  the	
  cases	
  not	
  previously	
  tested	
  were	
  pulled	
  and	
  tested	
  for	
   the	
  P479L	
  variant	
  (n=7).	
  Data	
  was	
  anonymised	
  and	
  aggregated.	
  	
   3.2.3 GENOTYPE	
  ANALYSIS	
   Genotyping	
  of	
  samples	
  from	
  the	
  Kivalliq	
  region	
  of	
  Nunavut	
  was	
  conducted	
  using	
  the	
  PCR-­‐ RFLP	
   technique,	
   as	
   previously	
   described	
   [6].	
   All	
   other	
   samples	
   were	
   genotyped	
   using	
   TaqMan	
  allelic	
  discrimination	
  RT-­‐PCR	
  assay	
  as	
  previously	
  described	
  in	
  Chapter	
  2.	
   3.2.4 STATISTICAL	
  ANALYSIS	
   Genotype	
  frequencies	
  were	
  calculated	
  and	
  the	
  Χ2	
  test	
  was	
  used	
  to	
  analyse	
  deviation	
  from	
   predicted	
   frequencies	
   from	
   the	
   Hardy-­‐Weinberg	
   equation	
   with	
   p<0.05	
   significance	
   level.	
   Hardy-­‐Weinberg	
   equilibrium	
   (HWE)	
   analysis	
   was	
   carried	
   out	
   in	
   Aboriginal	
   specific	
   populations	
   when	
   possible.	
   Odds	
   ratios	
   were	
   calculated	
   for	
   case	
   P479L	
   homozygosity	
   compared	
   with	
   known	
   population	
   homozygosity	
   of	
   infants	
   born	
   (see	
   Chapter	
   2)	
   in	
   2006	
   with	
  95%	
  confidence	
  intervals	
  using	
  STATA	
  10	
  (StataCorp.	
  2007.	
  Stata	
  Statistical	
  Software:	
   Release	
  10.	
  College	
  Station,	
  TX:	
  StataCorp	
  LP).	
  Due	
  to	
  small	
  sample	
  sizes,	
  Fishers	
  exact	
  test	
   was	
  used	
  to	
  calculate	
  p	
  values	
  and	
  assess	
  risk.	
    3.3  RESULTS	
    Homozygosity	
   rates	
   for	
   each	
   territory	
   and	
   for	
   the	
   NWT	
   Inuvialuit	
   are	
   illustrated	
   in	
   Figure	
   3.1.	
   Of	
   the	
   59	
   cases	
   documented	
   in	
   Nunavut	
   that	
   met	
   the	
   criteria,	
   20	
   were	
   available	
   for	
   testing.	
   The	
   homozygosity	
   rate	
   within	
   the	
   Nunavut	
   cases	
   was	
   90%,	
   with	
   18	
   cases	
   homozygous	
  for	
  the	
  variant,	
  2	
  were	
  heterozygous,	
  and	
  no	
  cases	
  that	
  were	
  homozygous	
  wild	
   	
    37	
    type.	
  The	
  population	
  allele	
  frequency	
  for	
  the	
  P479L	
  variant	
  in	
  Nunavut	
  using	
  all	
  infants	
  born	
   in	
   2006	
   as	
   an	
   estimate	
   is	
   0.77	
   (95%	
   CI:	
   0.75-­‐0.79;	
   see	
   chapter	
   2).	
   The	
   odds	
   ratio	
   for	
   homozygosity	
  in	
  cases	
  was	
  5.15	
  (95%	
  CI:	
  1.22-­‐46.1;	
  Table	
  3.1)	
  based	
  on	
  64%	
  homozygosity	
   in	
  that	
  population.	
  	
    	
   Figure	
  3.1	
   Distribution	
  of	
  CPT1A	
  P479L	
  homozygosity	
  in	
  the	
  Canadian	
  territories	
  in	
  infant	
   mortality	
   cases	
   (1999-­‐2008)	
   and	
   in	
   the	
   population.	
   Population	
   homozygosity	
   estimated	
   using	
  data	
  for	
  all	
  infants	
  born	
  in	
  2006	
  (see	
  Chapter	
  1).	
  Error	
  bars	
  indicate	
  95%	
  confidence	
   intervals.	
   Nunavut	
   and	
   NWT	
   population	
   data	
   were	
   not	
   in	
   Hardy	
   Weinberg	
   equilibrium	
   (HWE).	
  	
   	
   	
    	
    38	
    Table	
  3.1	
   Distribution	
   of	
   CPT1A	
   P479L	
   genotypes	
   with	
   estimated	
   allele	
   frequencies	
   in	
   infant	
   mortality	
   cases	
   (sudden	
   death	
   in	
   infancy	
   and	
   infant	
   deaths	
   due	
   to	
   infectious	
   disease)	
  and	
  in	
  infants	
  born	
  in	
  2006	
  in	
  the	
  territories	
  of	
  Canada	
   	
   	
    	
    wt/wt	
   n	
   f	
    n	
    	
    	
    	
    wt/P479L	
   n	
   f	
   	
    	
    P479L/P479L	
   n	
   f	
   	
    	
    P479L	
  allele	
   f	
   	
    Odds	
  Ratio	
   OR	
   95%	
  CI	
   	
    	
    	
   0	
   67	
    	
   0.00	
   0.10	
    	
   	
   2	
   0.10	
   186	
   0.27	
    	
   18	
   442	
    	
   0.90	
   0.64	
    Qikiqtani	
   Cases	
   4	
   Popn	
   302	
    	
   0	
   51	
    	
   0.00	
   0.17	
    	
   	
   0	
   0.00	
   89	
   0.29	
    	
   4	
   162	
    	
   1.00	
   0.54	
    	
   1.00	
    Kivalliq	
   Cases	
   Popn	
    	
   11	
   243	
    	
   0	
   11	
    	
   0.00	
   0.05	
    	
   	
   1	
   0.09	
   62	
   0.26	
    	
   10	
   170	
    	
   0.91	
   0.70	
    	
   0.95	
   0.83	
    	
   	
   4.29	
   0.59-­‐188.83	
   	
   	
    Kitikmeot	
   Cases	
   5	
   Popn	
   150	
    	
   0	
   5	
    	
   0.00	
   0.03	
    	
   	
   1	
   0.20	
   35	
   0.23	
    	
   4	
   110	
    	
   0.80	
   0.73	
    	
   0.90	
   0.85	
    	
   1.45	
   	
    0.14-­‐73.39	
    	
   	
   7	
   4	
   564	
   494	
    	
   0.57	
   0.88	
    	
   	
   1	
   0.14	
   52	
   0.09	
    	
   2	
   18	
    	
   0.29	
   0.03	
    	
   0.36	
    	
   	
   	
    	
   	
   	
    3	
   70	
    	
   0	
   23	
    	
   0.00	
   0.33	
    	
   	
   1	
   0.33	
   32	
   0.46	
    	
   2	
   15	
    	
   0.67	
   0.21	
    	
   0.83	
   0.44	
    First	
  Nations	
   Cases	
   3	
   Popn	
   233	
    	
   3	
   216	
    	
   1.00	
   0.94	
    	
   	
   0	
   0.00	
   14	
   0.06	
    	
   0	
   3	
    	
   0.00	
   0.01	
    	
   	
    Non-­‐Ab	
   Cases	
   Popn	
    1	
   227	
    1	
   221	
    1.00	
   0.97	
    Yukon	
   Cases	
   Popn	
    	
   	
   4	
   4	
   325	
   312	
    	
   1.00	
   0.96	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    58	
   	
    	
    0.82	
   	
    	
    	
    	
   	
   	
    	
    	
    	
   	
   7.33	
   0.35-­‐440.19	
   	
   	
    	
    	
    	
    0.04*	
    	
   	
   	
    	
   	
   	
    	
    	
    	
    0.00	
   0.00	
    	
   	
   0.01	
    	
   	
   	
    	
   	
   	
    	
   	
   0	
   0.00	
   13	
   0.04	
    	
   0	
   0	
    	
   0.00	
   0.00	
    	
   	
   0.02	
    	
   	
   	
    	
   	
   	
    	
    	
    	
    	
    	
    	
    0.18	
   	
    	
    	
    0	
   0	
    13	
    	
    	
   	
   	
    	
    	
    0.08*	
    	
    	
   	
   	
    	
    0.00	
   0.03	
    	
    	
    	
    	
    	
    	
    	
    1.22-­‐46.1	
    	
    	
    	
    	
    	
    0	
   6	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    Yukon	
  Ab	
   71	
   	
    	
    	
    	
    	
   5.15	
   	
   	
    0.68*	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    	
    Inuvialuit	
   Cases	
   Popn	
    	
    	
    	
    	
    NWT	
   Cases	
   Popn	
    	
    0.95	
   0.77*	
    	
    	
    Nunavut	
   	
   Cases	
   20	
   Popn	
   695	
    	
    	
    	
    	
    	
    0	
   0.003	
   	
    	
    	
    	
    0.09	
    	
    	
    	
   	
    	
    	
   	
    CI:	
  Confidence	
  Interval	
   *Genotype	
  frequencies	
  deviated	
  from	
  HWE	
  (p<0.05)	
    	
    39	
    Within	
   the	
   18	
   homozygous	
   cases,	
   the	
   leading	
   causes	
   of	
   death	
   were	
   SIDS/SUDI	
   (39%,	
   7)	
   and	
   respiratory	
  infection	
  (39%,	
  7).	
  Most	
  of	
  the	
  deaths	
  occurred	
  during	
  the	
  post-­‐neonatal	
  period	
   (94%,	
  17).	
  There	
  was	
  limited	
  reporting	
  of	
  gestational	
  age	
  and	
  no	
  clear	
  trends	
  were	
  evident	
   (13	
  of	
  18).	
  	
   There	
   were	
   16	
   infant	
   mortality	
   cases	
   documented	
   in	
   NWT	
   from	
   1999-­‐2008	
   that	
   met	
   the	
   criteria.	
   Samples	
   were	
   available	
   for	
   7	
   cases	
   (3	
   Inuvialuit,	
   3	
   First	
   Nations,	
   and	
   1	
   non-­‐ Aboriginal).	
   Within	
   those	
   7	
   cases,	
   the	
   P479L	
   variant	
   was	
   present	
   only	
   in	
   the	
   Inuvialuit	
   samples,	
  2	
  (67%)	
  were	
  homozygous	
  for	
  the	
  variant	
  and	
  1	
  heterozygous.	
  All	
  other	
  samples	
   were	
   homozygous	
   wild	
   type.	
   Using	
   data	
   from	
   infants	
   born	
   in	
   2006,	
   the	
   estimated	
   CPT1A	
   P479L	
   allele	
   frequency	
   for	
   NWT	
   Inuvialuit	
   is	
   0.44	
   (95%	
   CI:	
   0.36-­‐0.52).	
   Odds	
   ratio	
   for	
   Inuvialuit	
  cases	
  was	
  not	
  significant.	
   Between	
  the	
  years	
  of	
  1999-­‐2007,	
  there	
  were	
  4	
  cases	
  of	
  sudden	
  infant	
  death	
  in	
  Yukon.	
  All	
  of	
   the	
  cases	
  were	
  available	
  for	
  testing	
  and	
  all	
  were	
  homozygous	
  wild	
  type	
  at	
  site	
  479.	
  This	
  is	
   not	
  surprising	
  as	
  the	
  P479L	
  variant	
  is	
  rare	
  in	
  this	
  territory	
  with	
  an	
  estimated	
  allele	
  frequency	
   of	
   9%	
   in	
   the	
   First	
   Nations	
   population	
   within	
   the	
   territory.	
   There	
   were	
   no	
   cases	
   of	
   homozygosity	
  in	
  the	
  population	
  study.	
  	
    3.4  DISCUSSION	
    Homozygosity	
   for	
   P479L	
   variant	
   of	
   CPT1A	
   is	
   associated	
   with	
   symptoms	
   consistent	
   with	
   CPT1A	
   deficiency,	
   including	
   sudden	
   unexpected	
   death.	
   All	
   infants	
   and	
   children	
   who	
   have	
   presented	
   with	
   these	
   symptoms	
   have	
   been	
   of	
   Inuit,	
   Alaska	
   Native,	
   or	
   BC	
   First	
   Nations	
   	
    40	
    ancestry	
  [6,7,10].	
  However,	
  population	
  studies	
  of	
  the	
  Alaska	
  Native	
  and	
  the	
  Canadian	
  and	
   Greenland	
   Inuit	
   have	
   determined	
   that	
   the	
   allele	
   is	
   very	
   frequent	
   in	
   these	
   populations	
   [6-­‐ 8,10,105].	
  Within	
  Canada,	
  the	
  highest	
  P479L	
  allele	
  frequencies	
  are	
  found	
  in	
  Nunavut	
  (0.68-­‐ 0.86)	
   and	
   NWT	
   Inuvialuit	
   (0.44)	
   [105].	
   The	
   high	
   frequency	
   of	
   the	
   variant	
   in	
   these	
   populations	
  has	
  raised	
  uncertainty	
  regarding	
  the	
  variant’s	
  clinical	
  significance.	
  	
   This	
  study	
  demonstrated	
  that	
  homozygosity	
  for	
  the	
  variant	
  is	
  associated	
  with	
  an	
  increased	
   risk	
  for	
  sudden	
  unexpected	
  death	
  in	
  Nunavut	
  infants.	
  However,	
  the	
  numbers	
  for	
  the	
  study	
   were	
  small,	
  only	
  34%	
  (31/79)	
  of	
  the	
  cases	
  identified	
  in	
  the	
  three	
  territories	
  were	
  available	
   to	
  be	
  genotyped.	
  	
   In	
   a	
   concurrent	
   study	
   of	
   the	
   variant	
   in	
   British	
   Columbia	
   (BC)	
   (Sinclair	
   and	
   Vallance,	
   presented	
  with	
  permission	
  pre-­‐publication),	
  the	
  P479L	
  variant	
  homozygosity	
  was	
  assessed	
   in	
   symptomatic	
   and	
   sudden	
   unexpected	
   death	
   cases	
   (SIDS,	
   SUDI,	
   and	
   sudden	
   death	
   with	
   infection)	
   in	
   infants	
   and	
   children	
   (<2	
   years	
   of	
   age)	
   with	
   First	
   Nations	
   ancestry.	
   Symptomatic	
   cases	
   presented	
   with	
   any	
   number	
   of	
   clinical	
   features	
   associated	
   with	
   CPT1A	
   deficiency,	
   including	
   hypoglycaemia,	
   seizures,	
   and	
   liver	
   dysfunction.	
   Population	
   prevalence	
   of	
   the	
   P479L	
  variant	
  was	
  estimated	
  by	
  genotyping	
  newborn	
  blood	
  spots	
  for	
  First	
  Nations	
  infants	
   born	
   in	
   2004	
   (n=2332;	
   identified	
   using	
   the	
   maternal	
   designation	
   of	
   “Status	
   Indian”	
   in	
   BC	
   Vital	
  Statistics	
  database).	
  	
   The	
   overall	
   P479L	
   homozygosity	
   for	
   BC	
   First	
   Nations	
   was	
   9.8%.	
   P479L	
   variant	
   homozygosity	
   was	
   highest	
   in	
   coastal	
   First	
   Nations	
   communities	
   on	
   southern	
   and	
   mid	
   Vancouver	
   Island	
   	
    41	
    (25.3%	
   and	
   22.8%,	
   respectively).	
   P479L	
   homozygosity	
   was	
   lowest	
   in	
   the	
   BC	
   South	
   Interior	
   and	
   the	
   lower	
   mainland	
   (4.3%	
   and	
   4.6%,	
   respectively).	
   Within	
   the	
   high	
   homozygosity	
   regions,	
   there	
   were	
   32	
   sudden	
   death	
   and	
   84	
   symptomatic	
   cases.	
   Homozygosity	
   for	
   the	
   variant	
   was	
   associated	
   with	
   an	
   increased	
   risk	
   sudden	
   death	
   in	
   the	
   mid	
   Vancouver	
   Island	
   region	
   (OR:	
   3.36;	
   95%	
   CI:	
   1.07-­‐10.51),	
   as	
   well	
   as	
   in	
   symptomatic	
   cases	
   in	
   the	
   high	
   homozygosity	
  regions	
  (OR:	
  30.46;	
  95%	
  CI:	
  10.94-­‐84.68).	
  However,	
  symptoms	
  of	
  the	
  clinical	
   cases	
  referred	
  for	
  testing	
  were	
  variable	
  and	
  non-­‐specific	
  including	
  hypoglycemia,	
  seizures,	
   and	
   liver	
   dysfunction.	
   It	
   is	
   difficult	
   to	
   interpret	
   the	
   results	
   for	
   the	
   symptomatic	
   cases	
   without	
  a	
  more	
  clearly	
  defined	
  phenotype.	
  	
   The	
  high	
  prevalence	
  of	
  the	
  P479L	
  variant	
  in	
  Inuit,	
  Alaska	
  Native,	
  and	
  coastal	
  BC	
  First	
  Nations	
   populations	
  suggests	
  that	
  this	
  variant	
  may	
  have	
  been	
  historically	
  beneficial	
  for	
  populations	
   living	
  in	
  coastal	
  areas	
  subsisting	
  on	
  high	
  fat,	
  moderate	
  protein	
  diets	
  rich	
  in	
  fish	
  and	
  marine	
   mammals	
  [17,103].	
  However,	
  current	
  transitions	
  of	
  diets	
  to	
  high	
  carbohydrate	
  sources	
  and	
   the	
   reduction	
   of	
   breast-­‐feeding	
   may	
   confer	
   risk	
   for	
   infants	
   homozygous	
   for	
   the	
   variant,	
   especially	
  if	
  there	
  is	
  accompanying	
  intercurrent	
  illness	
  [20,21,104].	
  	
   Risks	
  for	
  SIDS/SUDI	
  and	
  infant	
  mortality	
  in	
  Inuit	
  and	
  First	
  Nations	
  populations	
  of	
  Canada	
  are	
   2.2	
   and	
   7	
   times	
   the	
   national	
   averages	
   [2,4].	
   It	
   is	
   unlikely	
   that	
   it	
   would	
   be	
   possible	
   to	
   demonstrate	
  a	
  large	
  impact	
  of	
  the	
  variant	
  on	
  such	
  multi-­‐factorial	
  outcomes.	
  However,	
  study	
   results	
   from	
   BC	
   and	
   Nunavut	
   suggest	
   an	
   increase	
   risk	
   for	
   sudden	
   death	
   with	
   the	
   P479L	
   variant.	
   This	
   study	
   did	
   not	
   assess	
   other	
   risk	
   factors,	
   but	
   cannot	
   exclude	
   the	
   interaction	
   of	
   social,	
   medical,	
   nutritional,	
   environmental	
   or	
   other	
   genetic	
   factors.	
   Risk	
   factors	
   for	
   	
    42	
    SUDI/SIDS	
   and	
   death	
   due	
   to	
   infectious	
   disease	
   include	
   prematurity,	
   not-­‐breast	
   feeding,	
   maternal	
   smoking	
   or	
   smoking	
   in	
   environment,	
   crowded	
   housing,	
   and	
   sleep	
   position	
   other	
   than	
   supine	
   [33,34,45,46,56,106-­‐108].	
   All	
   of	
   these	
   are	
   factors	
   of	
   concern	
   for	
   infants	
   in	
   Nunavut	
   [1,30,109,110].	
   Nunavut	
   has	
   the	
   highest	
   rate	
   of	
   premature	
   birth	
   in	
   Canada	
   and	
   many	
  of	
  these	
  premature	
  births	
  have	
  associated	
  risk	
  factors	
  [18,30].	
  In	
  a	
  survey	
  of	
  maternal	
   smoking	
  in	
  Canada,	
  64%	
  of	
  Nunavut	
  mothers	
  reported	
  smoking	
  during	
  pregnancy,	
  5	
  times	
   the	
  national	
  average	
  of	
  16%	
  [109].	
  In	
  other	
  studies	
  of	
  Qikiqtani	
  only,	
  the	
  rate	
  is	
  even	
  higher	
   [18,111].	
  Placing	
  infants	
  to	
  sleep	
  on	
  their	
  backs	
  is	
  the	
  key	
  recommendation	
  to	
  reduce	
  risk	
   for	
   SIDS	
   and	
   SUDI	
   [45,112,113].	
   However,	
   only	
   46%	
   of	
   Nunavut	
   women	
   report	
   placing	
   their	
   infant	
  to	
  sleep	
  on	
  their	
  back	
  [109].	
  	
   Classical	
  CPT1A	
  deficiency	
  is	
  normally	
  detectable	
  through	
  newborn	
  screening	
  by	
  analysing	
   levels	
  of	
  free	
  carnitine	
  over	
  acylcarnitine	
  profiles	
  (C0/(C16	
  +	
  C18)	
  >	
  130)	
  using	
  tandem	
  mass	
   spectrometry	
   and	
   indicates	
   the	
   activity	
   of	
   CPT1	
   indirectly	
   by	
   the	
   accumulation	
   of	
   free	
   carnitine	
  in	
  relation	
  to	
  its	
  incorporation	
  in	
  to	
  fatty	
  acylcarnitine	
  [87].	
  However,	
  the	
  current	
   cut-­‐off	
   value	
   of	
   >130	
   for	
   this	
   ratio	
   does	
   not	
   identify	
   most	
   P479L	
   homozygous	
   infants.	
   Substantially	
  dropping	
  the	
  cut-­‐off	
  would	
  identify	
  most	
  homozygotes,	
  but	
  would	
  also	
  lower	
   the	
  sensitivity	
  of	
  the	
  test	
  [9].	
  Although	
  Alaska	
  has	
  been	
  using	
  the	
  standard	
  value	
  of	
  130	
  to	
   identify	
   Alaska	
   Native	
   infants	
   with	
   abnormal	
   acylcarnitine	
   profiles,	
   not	
   all	
   infants	
   homozygous	
  for	
  the	
  P479L	
  variant	
  are	
  identified	
  using	
  the	
  standard	
  cut	
  off	
  values	
  and	
  many	
   infants	
   homozygous	
   for	
   the	
   variant	
   are	
   asymptomatic	
   [6,7,9].	
   An	
   alternative	
   method	
   for	
   detecting	
  P479L	
  homozygous	
  infants	
  is	
  DNA	
  testing,	
  which	
  could	
  be	
  conducted	
  as	
  a	
  2nd	
  tier	
   	
    43	
    after	
   initial	
   screening	
   for	
   C0/(C16+C18).	
   However,	
   this	
   variant	
   is	
   highly	
   prevalent	
   in	
   these	
   populations.	
   Further	
   assessment	
   of	
   the	
   clinical	
   impact	
   of	
   the	
   variant	
   and	
   effectiveness	
   of	
   treatment	
   are	
   needed.	
   There	
   is	
   currently	
   no	
   P479L	
   screening	
   available	
   to	
   parents	
   of	
   infants	
   born	
   in	
   any	
   of	
   Canada’s	
   three	
   territories.	
   Screening	
   for	
   P479L	
   in	
   early	
   infancy	
   during	
   the	
   disease-­‐free	
  interval	
  between	
  birth	
  and	
  onset	
  of	
  symptoms	
  would	
  allow	
  an	
  early	
  diagnosis	
   and	
   appropriate	
   dietary	
   management	
   of	
   infants,	
   avoiding	
   CPT1A	
   deficiency	
   clinical	
   manifestations	
  [101].	
   Although	
   sample	
   sizes	
   for	
   this	
   study	
   are	
   small,	
   homozygosity	
   for	
   the	
   variant	
   was	
   associated	
   with	
   increased	
   risk	
   for	
   sudden	
   death	
   in	
   Nunavut	
   infants.	
   The	
   information	
   from	
   this	
   study	
   will	
   aid	
   in	
   determining	
   appropriate	
   management	
   strategies	
   for	
   the	
   variant.	
   Any	
   programs	
   must	
   include	
   dialogue	
   with	
   health	
   authorities,	
   local	
   medical	
   professionals,	
   and	
   communities.	
   Expanding	
   newborn	
   screening	
   to	
   include	
   the	
   P479L	
   variant	
   may	
   not	
   be	
   appropriate	
   without	
   better	
   understanding	
   of	
   the	
   natural	
   history	
   of	
   the	
   deficiency	
   and	
   benefits	
  of	
  treatment.	
  Currently,	
  there	
  is	
  no	
  evidence	
  that	
  preventative	
  treatment	
  will	
  alter	
   health	
  outcomes	
  for	
  those	
  homozygous	
  for	
  the	
  variant.	
  The	
  high	
  population	
  frequency	
  for	
   the	
   allele	
   and	
   low	
   reported	
   symptomatic	
   cases	
   in	
   Nunavut	
   indicates	
   that	
   the	
   allele	
   may	
   have	
   low	
   penetrance,	
   suggesting	
   that	
   larger	
   population	
   studies	
   are	
   needed	
   to	
   determine	
   the	
  penetrance	
  of	
  the	
  allele	
  [114].	
  Expanding	
  newborn	
  screening	
  would	
  have	
  a	
  significant	
   impact	
   on	
   resources,	
   primary	
   care	
   physicians,	
   families,	
   and	
   communities.	
   Clear	
   and	
   meaningful	
   communication,	
   appropriate	
   medical	
   follow-­‐up,	
   and	
   strong	
   social	
   support	
   are	
   critical	
  to	
  the	
  health	
  and	
  welfare	
  of	
  both	
  the	
  infant	
  and	
  the	
  family	
  when	
  communicating	
  a	
   	
    44	
    screen-­‐positive	
   result	
   [115,116].	
   Primary	
   care	
   physicians	
   and	
   public	
   health	
   nurses	
   would	
   be	
   responsible	
   for	
   communicating	
   screen-­‐positive	
   results	
   in	
   manner	
   that	
   avoids	
   creating	
   anxiety	
  in	
  parents	
  and	
  families,	
  as	
  well	
  as	
  for	
  medical	
  follow-­‐up.	
  In	
  order	
  to	
  understand	
  and	
   communicate	
   the	
   implications	
   of	
   a	
   positive	
   screen	
   result,	
   local	
   medical	
   professionals	
   would	
   require	
   detailed	
   and	
   concise	
   information	
   regarding	
   the	
   disorder	
   and	
   the	
   P479L	
   variant	
   [117,118].	
   Many	
   Inuit	
   and	
   First	
   Nations	
   individuals	
   seek	
   guidance	
   on	
   medical	
   issues	
   from	
   informed	
   community	
   members	
   and	
   family,	
   so	
   information	
   regarding	
   CPT1A	
   P479L	
   should	
   also	
  come	
  from	
  within	
  communities	
  and	
  incorporate	
  culturally	
  appropriate	
  icons	
  and	
  local	
   languages	
  [115].	
  	
   As	
  with	
  all	
  studies	
  where	
  small	
  numbers	
  are	
  used,	
  the	
  results	
  from	
  this	
  study	
  must	
  be	
  taken	
   with	
   caution.	
   The	
   new	
   Nunavut	
   Qiturngatta	
   Surveillance	
   System	
   follows	
   infants	
   from	
   the	
   prenatal	
  period	
  to	
  5	
  years	
  of	
  age	
  and	
  includes	
  medical	
  conditions	
  throughout	
  childhood.	
  If	
   newborn	
  screening	
  for	
  the	
  variant	
  is	
  initiated	
  in	
  Nunavut,	
  either	
  as	
  a	
  pilot/research	
  program	
   or	
  on	
  a	
  territory-­‐wide	
  basis,	
  testing	
  results	
  could	
  be	
  included	
  in	
  this	
  database.	
  This	
  would	
   allow	
   prospective	
   study	
   of	
   infants	
   through	
   the	
   first	
   five	
   years	
   of	
   their	
   life	
   and	
   better	
   characterisation	
  of	
  the	
  clinical	
  impact	
  of	
  the	
  variant.	
    	
    45	
    CHAPTER	
  4. RETROSPECTIVE	
   REVIEW	
   OF	
   INFANT	
   MORTALITY	
   IN	
   NUNAVUT	
  (1999-­‐2008)	
   	
    4.1  INTRODUCTION	
    The	
   northern	
   Canadian	
   territory	
   of	
   Nunavut	
   has	
   the	
   highest	
   infant	
   mortality	
   rate	
   in	
   Canada	
   at	
  14.3/1,000	
  live	
  births	
  (1999-­‐2007);	
  a	
  rate	
  almost	
  3	
  times	
  the	
  Canadian	
  national	
  average	
   of	
  5.3/1,000	
  live	
  births	
  and	
  twice	
  that	
  of	
  the	
  bordering	
  territory,	
  the	
  Northwest	
  Territories	
   [1].	
   The	
   rate	
   of	
   infant	
   mortality	
   in	
   Nunavut	
   has	
   remained	
   consistently	
   high	
   despite	
   substantial	
   reductions	
   in	
   other	
   jurisdictions	
   of	
   Canada	
   [1-­‐3].	
   Nunavut	
   is	
   divided	
   into	
   3	
   regions,	
   Qikiqtani,	
   which	
   contains	
   the	
   territorial	
   general	
   hospital	
   (QGH),	
   Kitikmeot,	
   and	
   Kivalliq.	
   The	
   Nunavut	
   health	
   care	
   system	
   depends	
   on	
   a	
   series	
   of	
   community-­‐based	
   health	
   centres	
  and	
  partnerships	
  with	
  southern	
  tertiary	
  care	
  hospitals	
  in	
  Manitoba,	
  the	
  Northwest	
   Territories,	
  Ontario,	
  and	
  Quebec	
  [13].	
  Infants	
  requiring	
  intensive	
  care	
  are	
  evacuated	
  to	
  the	
   QGH	
  or	
  out	
  of	
  territory	
  to	
  tertiary	
  care	
  centres	
  in	
  these	
  other	
  jurisdictions	
  [14].	
  	
   Nunavut	
   has	
   the	
   largest	
   Inuit	
   population	
   in	
   Canada	
   with	
   85%	
   of	
   Nunavut	
   residents	
   being	
   Inuit	
  [12].	
  Approximately	
  90%	
  of	
  the	
  700	
  births	
  in	
  Nunavut	
  each	
  year	
  are	
  to	
  Inuit	
  women	
   [12,19,18].	
  Nunavut	
  has	
  the	
  highest	
  rate	
  of	
  preterm	
  birth	
  in	
  Canada	
  and	
  preterm	
  infants	
  are	
   at	
   greater	
   risk	
   of	
   mortality	
   [25,30,119,106].	
   Factors	
   that	
   increase	
   risk	
   for	
   preterm	
   birth	
   include	
  maternal	
  smoking,	
  infection	
  during	
  pregnancy,	
  and	
  low	
  maternal	
  weight	
  gain	
  during	
   pregnancy,	
  all	
  of	
  which	
  are	
  factors	
  that	
  are	
  associated	
  with	
  preterm	
  birth	
  in	
  Nunavut	
  [120-­‐ 122].	
   	
    46	
    Nunavut	
  leads	
  Canada	
  with	
  the	
  highest	
  post-­‐neonatal	
  mortality	
  rate	
  of	
  7.9/1,000	
  live	
  births,	
   a	
  rate	
  5	
  times	
  the	
  national	
  average	
  (1999-­‐2007)	
  [1].	
  Sudden	
  Infant	
  Death	
  Syndrome	
  (SIDS),	
   Sudden	
  Unexpected	
  Death	
  in	
  Infancy	
  (SUDI),	
  and	
  infectious	
  disease	
  are	
  the	
  leading	
  causes	
   of	
   post-­‐neonatal	
   mortality	
   in	
   Inuit	
   regions	
   [2].	
   Medical	
   and	
   environmental	
   risk	
   factors	
   for	
   SIDS	
  and	
  SUDI	
  include	
  sleeping	
  in	
  any	
  position	
  other	
  than	
  supine	
  (i.e.	
  sleeping	
  on	
  stomach	
   or	
  side),	
  prematurity,	
  young	
  maternal	
  age,	
  age	
  of	
  infant	
  less	
  than	
  6	
  months,	
  maternal	
  (pre	
   and	
  post-­‐natal)	
  smoking,	
  exposure	
  to	
  environmental	
  smoke,	
  male	
  sex,	
  not	
  being	
  breast-­‐fed,	
   bed-­‐sharing,	
  overheating,	
  the	
  presence	
  of	
  loose	
  bedding,	
  and	
  soft	
  sleep	
  surface	
  [34,41,44-­‐ 51,106-­‐108].	
   Genetic	
   and/or	
   biological	
   factors,	
   including	
   cardiac	
   conduction	
   abnormalities	
   (i.e.	
  Long	
  QT	
  syndrome;	
  LQTS)	
  and	
  fatty	
  acid	
  oxidation	
  disorders	
  (FAOD),	
  may	
  also	
  increase	
   risk	
  for	
  SIDS	
  and	
  SUDI	
  [37,58-­‐61].	
  	
   This	
  retrospective	
  study	
  presents	
  an	
  overview	
  of	
  all	
  causes	
  of	
  infant	
  mortality	
  available	
  in	
   Nunavut	
   from	
   July	
   1,	
   1999-­‐June	
   30,	
   2008.	
   This	
   report	
   aims	
   to	
   provide	
   insights	
   into	
   the	
   overall	
   contributors	
   and	
   the	
   likely	
   multi-­‐factorial	
   nature	
   of	
   the	
   increased	
   rate	
   of	
   infant	
   mortality	
  in	
  Nunavut.	
    4.2  METHODS	
    All	
  infant	
  deaths	
  occurring	
  in	
  Nunavut	
  are	
  reported	
  to	
  the	
  Chief	
  Coroner	
  and	
  subsequently	
   to	
  the	
  office	
  of	
  the	
  Chief	
  Medical	
  Officer	
  of	
  Health	
  (CMOH).	
  Detailed	
  reports	
  for	
  65	
  infant	
   deaths	
   as	
   reported	
   to	
   the	
   office	
   of	
   the	
   CMOH	
   from	
   July	
   1,	
   1999-­‐June	
   30,	
   2008	
   were	
   reviewed	
   and	
   cross-­‐referenced	
   with	
   Nunavut	
   Bureau	
   of	
   Statistics	
   where	
   an	
   additional	
   13	
   cases	
   were	
   documented	
   (total=78).	
   All	
   prenatally	
   occurring	
   deaths	
   (stillbirths)	
   were	
   	
    47	
    excluded	
   for	
   this	
   review.	
   Information	
   collected,	
   when	
   available,	
   included:	
   cause	
   of	
   death,	
   age	
  at	
  death,	
  gestational	
  age	
  at	
  delivery,	
  infant	
  chronic	
  health	
  conditions,	
  condition	
  of	
  the	
   infant	
   prior	
   to	
   death,	
   concurrent	
   illnesses,	
   breast	
   feeding	
   practices,	
   sleep	
   circumstances,	
   known	
   care	
   giver	
   use	
   of	
   alcohol	
   and	
   cigarettes,	
   autopsy	
   information,	
   and	
   CPT1A	
   P479L	
   genotyping	
   results	
   (Appendix	
   Tables	
   A.1	
   and	
   A.2).	
   Region	
   of	
   residence	
   was	
   determined	
   using	
  mother’s	
  place	
  of	
  residence	
  at	
  the	
  time	
  of	
  the	
  infant’s	
  death.	
  Bed-­‐sharing	
  was	
  defined	
   as	
   those	
   infants	
   sharing	
   a	
   sleep	
   surface	
   with	
   another	
   person	
   as	
   documented	
   when	
   the	
   death	
  occurred	
  [123].	
   Case	
   data	
   were	
   aggregated	
   and	
   reviewed	
   for	
   causes	
   of	
   death	
   and	
   trends	
   in	
   risk	
   factors.	
   Comparison	
   data	
   for	
   Canadian	
   mortality	
   rates	
   per	
   1,000	
   live	
   births	
   were	
   obtained	
   using	
   the	
   Statistics	
  Canada	
  CANSIM	
  database.	
  Nunavut	
  Bureau	
  of	
  Statistics	
  prepared	
  total	
  number	
  of	
   live	
  births	
  to	
  mothers	
  residing	
  in	
  Nunavut	
  and	
  by	
  region	
  within	
  Nunavut	
  for	
  the	
  years	
  1999-­‐ 2008	
  (May	
  19,	
  2009).	
  Gestational	
  age	
  specific	
  infant	
  mortality	
  rates	
  were	
  calculated	
  using	
   cases	
   born	
   between	
   2000-­‐2007	
   full	
   calendar	
   years	
   (n=43)	
   and	
   compared	
   live	
   births	
   by	
   gestational	
   age	
   reported	
   by	
   Statistics	
   Canada	
   for	
   Nunavut	
   [30].	
   Cause	
   specific	
   rates	
   were	
   calculated	
   using	
   live	
   births	
   reported	
   by	
   Statistics	
   Canada	
   for	
   Nunavut	
   during	
   the	
   same	
   period.	
  These	
  rates	
  were	
  compared	
  to	
  national	
  rates	
  when	
  possible	
  [30].	
   The	
   rate	
   of	
   homozygosity	
   for	
   the	
   P479L	
   variant	
   of	
   CPT1A	
   in	
   cases	
   was	
   compared	
   with	
   known	
   population	
   rates	
   of	
   infants	
   born	
   in	
   2006.	
   Odds	
   ratios	
   with	
   95%	
   confidence	
   intervals,	
   and	
  p	
  values	
  with	
  Fishers	
  exact	
  test	
  were	
  calculated	
  to	
  assess	
  risk.	
    	
    48	
    Research	
  ethics	
  review	
  approval	
  was	
  received	
  by	
  UBC	
  Research	
  Ethics	
  Board	
  and	
  NRI.	
  The	
   review	
  occurred	
  under	
  the	
  supervision	
  of	
  the	
  Deputy	
  Medical	
  Officer	
  of	
  Health	
  (GO).	
    4.3  RESULTS	
    From	
  July	
  1,	
  1999	
  to	
  June	
  30,	
  2008,	
  a	
  total	
  of	
  78	
  infant	
  mortality	
  cases	
  were	
  documented	
   within	
  Nunavut,	
  65	
  through	
  the	
  CMOH	
  and	
  another	
  13	
  in	
  the	
  Nunavut	
  Bureau	
  of	
  Statistics.	
   None	
  of	
  the	
  13	
  additional	
  cases	
  documented	
  in	
  the	
  Nunavut	
  Bureau	
  of	
  Statistics	
  had	
  cause	
   of	
   death	
   information;	
   however,	
   8	
   of	
   those	
   occurred	
   during	
   the	
   first	
   week	
   of	
   life.	
   In	
   total,	
   82%	
   (64	
   cases)	
   had	
   sufficient	
   information	
   to	
   determine	
   cause	
   of	
   death,	
   97%	
   reported	
   exact	
   age	
   at	
   death,	
   59%	
   included	
   gestational	
   age	
   at	
   delivery,	
   45%	
   had	
   bed-­‐sharing	
   information,	
   and	
   40%	
   recorded	
   sleep	
   position	
   placed	
   and/or	
   found	
   (Table	
   4.1)	
   The	
   average	
   infant	
   mortality	
   rate	
   for	
   Nunavut	
   was	
   10.6/1,000	
   live	
   births.	
   Kitikmeot	
   had	
   a	
   consistently	
   higher	
   infant	
  mortality	
  rate	
  than	
  the	
  rest	
  of	
  Nunavut;	
  Qikiqtani	
  had	
  the	
  lowest	
  (Figure	
  4.1).	
   	
    	
    49	
    Table	
  4.1	
   Information	
   reported	
   for	
   infant	
   mortality	
   cases	
   as	
   documented	
   in	
   Nunavut	
   (n=78;	
  July	
  1,	
  1999-­‐June	
  30,	
  2008)	
  	
   Category	
   Cause	
  of	
  death	
   Age	
  at	
  death	
   Gestational	
  age	
  	
   Birth	
  weight	
  	
   CPT1A	
  P479L	
  status	
   Sleep	
  position	
  	
   (found	
  or	
  placed)***	
   Bed-­‐sharing	
   Sleep	
  surface	
   Loose	
  bedding	
    Cases	
   reporting*	
  (%	
  of	
   total	
  cases)	
   64	
  (82.1)	
   76	
  (97.4)	
   46	
  (59.0)	
   44	
  (56.4)	
   22	
  (28.2)	
   31	
  (39.7)	
   35	
  (44.9)	
   35	
  (44.9)	
   11	
  (14.1)	
    Risk	
  association	
   	
   <6mths	
   <37	
  weeks	
  gestation	
   <2500g	
   Homozygous	
   Prone	
  or	
  side	
   Present	
   Sofa	
  or	
  other	
  soft	
  surface	
   Present	
    n	
  (%)**	
   reporting	
  cases	
   with	
  RF	
   	
    65	
  (86.0)	
   18	
  (39.1)	
   7	
  (15.9)	
   20	
  (90.9)	
   21	
  (67.7)	
   25	
  (71.4)	
   6	
  (17.1)	
   11	
  (100.0)	
    *N	
   indicates	
   the	
   number	
   of	
   cases	
   during	
   the	
   study	
   period	
   (78)	
   reporting	
   on	
   the	
   category	
   indicated.	
   **Percentage	
   of	
   cases	
   that	
   reported	
   information	
   for	
   the	
   category	
   and	
   had	
   the	
   risk	
  factor.	
  ***4	
  cases	
  did	
  not	
  indicate	
  position	
  found,	
  but	
  stated	
  position	
  paced,	
  supine	
  (3)	
   or	
  side	
  (1)	
   	
   	
    	
   Figure	
  4.1	
   Infant	
  mortality	
  rates	
  as	
  documented	
  in	
  Nunavut	
  by	
  region	
  (n=78;	
  July	
  1,	
  1999-­‐ June	
  30,	
  2008)	
   	
   	
    50	
    4.3.1 ALL	
  CAUSES	
  OF	
  DEATH	
   Table	
  4.2	
  lists	
  cause	
  of	
  death	
  information	
  for	
  the	
  64	
  cases	
  for	
  which	
  this	
  information	
  was	
   available	
   by	
   Nunavut	
   region.	
   The	
   leading	
   causes	
   of	
   death	
   were	
   SIDS/SUDI	
   (47%)	
   and	
   respiratory	
  infection	
  (19%)	
  in	
  Nunavut	
  as	
  a	
  whole,	
  as	
  well	
  as	
  for	
  each	
  of	
  the	
  three	
  regions	
   (Figure	
   4.2).	
   SIDS/SUDI	
   accounted	
   for	
   42%	
   to	
   53%	
   of	
   deaths	
   in	
   the	
   three	
   regions.	
   The	
   male/female	
   ratio	
   for	
   all	
   infant	
   mortality	
   cases	
   was	
   equal,	
   with	
   small	
   excesses	
   of	
   male	
   deaths	
   due	
   to	
   respiratory	
   infection	
   and	
   female	
   deaths	
   due	
   to	
   infections	
   other	
   than	
   respiratory,	
  which	
  were	
  not	
  statistically	
  significant.	
  Deaths	
  designated	
  as	
  SIDS	
  or	
  SUDI	
  were	
   combined	
  in	
  this	
  study,	
  since	
  differentiation	
  of	
  the	
  two	
  was	
  often	
  difficult	
  even	
  with	
  careful	
   review	
  of	
  autopsy	
  reports.	
  	
   	
   Table	
  4.2	
   Infant	
   mortality	
   rates	
   and	
   causes	
   of	
   death	
   as	
   documented	
   in	
   Nunavut	
   by	
   region	
  (n=78;	
  July	
  1,	
  1999-­‐June	
  30,	
  2008)	
  	
   	
  	
   Rate	
  /	
  1,000	
  births*	
   	
   Qikiqtani	
   Kitikmeot	
   Kivalliq	
   Nunavut	
   Infant	
  mortality	
  rate	
   9.62	
   17.50	
   11.64	
   11.67	
   Neonatal	
  mortality	
  rate	
   1.41	
   3.68	
   2.43	
   2.09	
   Post-­‐neonatal	
  mortality	
  rate	
   7.92	
   12.89	
   9.22	
   9.28	
   Cause	
  of	
  Death	
   SIDS/SUDI	
   Respiratory	
  infection	
   Other	
  infection	
   Congenital	
  defect	
  /	
  anomalies	
   Unknown	
    	
   5.09	
   1.13	
   1.41	
   0.57	
   1.41	
    	
   8.29	
   3.68	
   1.84	
   1.84	
   1.84	
    	
   4.85	
   3.40	
   	
   0.49	
   2.91	
    	
   5.54	
   2.24	
   1.05	
   0.75	
   2.09	
    *Rates	
   calculated	
   using	
   total	
   births	
   for	
   each	
   region	
   and	
   Nunavut	
   as	
   a	
   whole,	
   as	
   reported	
   by	
   Statistics	
  Canada	
  for	
  the	
  study	
  period	
  (July	
  1,	
  1999	
  to	
  June	
  30,	
  2008)	
   	
   	
   	
    51	
    	
   	
   Figure	
  4.2	
   Nunavut	
   infant	
   mortality	
   cases	
   by	
   cause	
   of	
   death	
   categories	
   (n=78;	
   July	
   1,	
   1999-­‐June	
   30,	
   2008).	
   Medical	
   causes	
   were	
   respiratory	
   infection,	
   other	
   infections,	
   and	
   congenital	
   anomalies.	
   Unknown	
   (18%)	
   indicates	
   those	
   cases	
   that	
   did	
   not	
   have	
   a	
   cause	
   of	
   death	
   recorded	
   in	
   the	
   data	
   available	
   in	
   Nunavut;	
   10%	
   of	
   the	
   unknown	
   cases	
   were	
   perinatal	
   deaths	
  that	
  occurred	
  out	
  of	
  territory.	
   	
   The	
   cause-­‐specific	
   infant	
   mortality	
   rates	
   for	
   SIDS/SUDI	
   and	
   respiratory	
   infections	
   were	
   5.54	
   and	
  2.24/1,000	
  live	
  births	
  respectively,	
  based	
  on	
  the	
  number	
  of	
  births	
  reported	
  by	
  Statistics	
   Canada.	
   Deaths	
   due	
   to	
   respiratory	
   infections	
   were	
   higher	
   in	
   the	
   Kitikmeot	
   and	
   Kivalliq	
   regions	
   (3.68	
   and	
   3.40/1,000	
   live	
   births,	
   respectively)	
   than	
   in	
   the	
   Qikiqtani	
   region	
   (1.13/1,000	
   live	
   births).	
   The	
   proportion	
   of	
   post-­‐neonatal	
   deaths	
   for	
   SIDS/SUDI	
   and	
   death	
   due	
  to	
  infectious	
  disease	
  were	
  57%	
  and	
  29%,	
  respectively.	
   4.3.2 NEONATAL	
  AND	
  POST-­‐NEONATAL	
  DEATHS	
   During	
  the	
  study	
  period,	
  80%	
  of	
  the	
  deaths	
  recorded	
  within	
  Nunavut	
  occurred	
  during	
  the	
   post-­‐neonatal	
   period,	
   providing	
   a	
   post-­‐neonatal	
   mortality	
   rate	
   of	
   9.28/1,000	
   live	
   births;	
   	
    52	
    more	
  than	
  6	
  times	
  the	
  national	
  rate	
  of	
  1.4/1,000	
  live	
  births	
  for	
  1999-­‐2006	
  [1].	
  The	
  leading	
   causes	
   of	
   death	
   during	
   the	
   post-­‐neonatal	
   period	
   were	
   SIDS/SUDI	
   (55%)	
   and	
   infection	
   (respiratory	
  or	
  other;	
  31%).	
  The	
  neonatal	
  mortality	
  rate	
  from	
  the	
  study	
  data	
  was	
  2.1/1,000	
   live	
  births	
  (n=14),	
  which	
  is	
  substantially	
  lower	
  than	
  the	
  rates	
  reported	
  by	
  Statistics	
  Canada	
   for	
  Nunavut	
  and	
  for	
  all	
  of	
  Canada	
  (6.5	
  and	
  3.8/1,000	
  live	
  births,	
  respectively)	
  for	
  the	
  same	
   period	
  [1].	
  	
   4.3.3 PREMATURITY	
   Gestational	
  age	
  at	
  birth	
  was	
  available	
  for	
  46	
  cases	
  with	
  39%	
  of	
  those	
  (17	
  cases)	
  reported	
  as	
   premature.	
   The	
   infant	
   mortality	
   rate	
   (2000-­‐2007;	
   Table	
   4.3)	
   for	
   premature	
   infants	
   was	
   24.5/1,000	
   live	
   premature	
   births,	
   4	
   times	
   the	
   rate	
   for	
   term	
   infants	
   (5.4/1,000	
   live	
   term	
   births).	
  The	
  leading	
  causes	
  of	
  death	
  for	
  both	
  premature	
  and	
  term	
  infants	
  were	
  SIDS/SUDI	
   and	
  respiratory	
  infection.	
   	
   Table	
  4.3	
   Gestational	
   age	
   specific	
   rates	
   for	
   infant	
   mortality	
   cases	
   documented	
   in	
   Nunavut	
  (n=43;	
  2000-­‐2007)	
  	
   	
   Premature*	
   Term	
   (per	
  1,000	
  live	
   (per	
  1,000	
  live	
   	
   premature	
  births**)	
   term	
  births**)	
   Mortality	
  rate	
   24.5	
   5.4	
   Cause	
  of	
  death	
   	
   	
   SIDS	
   12.8	
   2.9	
   Respiratory	
  infection	
   5.7	
   1.2	
   Other	
  infection	
   12.7	
   6.4	
   Congenital	
  defect	
  /	
  anomalies	
   12.7	
   4.7	
   *Premature	
  is	
  defined	
  as	
  less	
  than	
  37	
  weeks	
  of	
  gestation	
  at	
  birth.	
  **Cases	
  included	
  in	
  this	
   analysis	
   were	
   restricted	
   to	
   those	
   born	
   between	
   2000-­‐2007	
   calendar	
   years,	
   allowing	
   comparison	
  with	
  reported	
  live	
  births	
  by	
  gestational	
  age	
  for	
  Nunavut	
  [30].	
   	
    53	
    	
   	
   4.3.4 SIDS/SUDI	
  	
   There	
   were	
   37	
   SIDS	
   and	
   SUDI	
   cases	
   during	
   the	
   study	
   period;	
   28	
   occurred	
   between	
   1	
   month	
   and	
   5	
   months	
   of	
   age	
   and	
   33	
   were	
   less	
   than	
   6	
   months	
   of	
   age	
   (Table	
   4.4)	
   There	
   was	
   no	
   evidence	
  of	
  excess	
  of	
  males	
  among	
  the	
  SIDS/SUDI	
  cases	
  (male	
  =	
  18).	
  	
   Sleep	
   position	
   other	
   than	
   supine	
   (found	
   or	
   placed)	
   was	
   reported	
   in	
   17	
   cases	
   and	
   bed-­‐ sharing	
  occurred	
  in	
  29	
  cases.	
  Sleep	
  surface	
  was	
  a	
  sofa	
  or	
  soft	
  surface	
  in	
  at	
  least	
  6	
  cases.	
  Two	
   or	
   more	
   sleep-­‐related	
   risk	
   factors	
   were	
   present	
   in	
   24	
   cases.	
   Only	
   2	
   SIDS/SUDI	
   cases	
   reported	
  no	
  sleep	
  circumstance	
  risk	
  factors.	
  	
   	
   Table	
  4.4	
   Information	
   reported	
   for	
   SIDS/SUDI	
   cases	
   as	
   documented	
   in	
   Nunavut	
   (n=78;	
   July	
  1,	
  1999-­‐June	
  30,	
  2008)	
  	
   Categories	
  	
    Cases	
  reporting	
   N	
  (%)*	
   25	
  (67.6)	
   24	
  (64.9)	
   37	
  (100)	
   9	
  (24.3)	
   24	
  (64.9)	
    Risk	
  association	
    n	
  (%)**	
  reporting	
   cases	
  with	
  RF	
   10	
  (40.0)	
   4	
  (16.7)	
   33	
  (89.2)	
   7	
  (77.8)	
   17	
  (70.8)	
    Gestational	
  age	
  	
   <37	
  weeks	
  gestation	
   Birth	
  weight	
  	
   <2500g	
   Age	
  at	
  death	
   <6mth	
   CPTI	
  P479L	
  status	
   Homozygous	
   Sleep	
  position	
  	
   Prone	
  or	
  side	
   (found	
  or	
  placed)***	
   Bed-­‐sharing	
   29	
  (78.4)	
   Present	
   22	
  (75.9)	
   Sleep	
  surface	
   26	
  (70.3)	
   Sofa	
  or	
  other	
  soft	
  surface	
   6	
  (23.0)	
   Loose	
  bedding	
   8	
  (21.6)	
   Present	
   8	
  (100)	
   *N	
   indicates	
   the	
   number	
   of	
   cases	
   during	
   the	
   study	
   period	
   (78)	
   reporting	
   on	
   the	
   category	
   indicated.	
   **Percentage	
   of	
   cases	
   that	
   reported	
   information	
   for	
   the	
   category	
   and	
   had	
   the	
   risk	
  factor.	
  ***3	
  cases	
  did	
  not	
  indicate	
  position	
  found,	
  but	
  stated	
  position	
  paced,	
  supine	
  (2)	
   or	
  side	
  (1)	
   	
   	
   	
    54	
    4.3.5 THE	
  P479L	
  VARIANT	
  OF	
  CPT1A	
   The	
  P479L	
  CPT1A	
  genotype	
  results	
  were	
  available	
  for	
  22	
  cases,	
  all	
  had	
  at	
  least	
  one	
  copy	
  of	
   the	
   variant,	
   and	
   20	
   were	
   homozygous	
   (had	
   2	
   copies)	
   for	
   the	
   variant.	
   Most	
   of	
   the	
   deaths	
   occurred	
   during	
   the	
   post-­‐neonatal	
   period	
   (90%).	
   The	
   cases	
   included	
   deaths	
   due	
   to	
   SIDS/SUDI	
   (n=9),	
   infectious	
   disease	
   (n=11),	
   or	
   congenital	
   anomalies	
   (n=2).	
   The	
   results	
   for	
   two	
   cases	
   of	
   severe	
   congenital	
   anomalies	
   were	
   excluded	
   from	
   risk	
   analysis,	
   leaving	
   18	
   homozygous	
   cases.	
   The	
   genotyping	
   results	
   were	
   compared	
   to	
   the	
   variant	
   population	
   homozygosity	
   for	
   Nunavut	
   (0.64;	
   Chapter	
   2),	
   which	
   resulted	
   in	
   a	
   significant	
   odds	
   ratio	
   of	
   5.15	
  (95%	
  CI	
  1.22-­‐46.1;	
  p=0.016).	
  	
   4.3.6 OTHER	
  FACTORS	
   Maternal	
  age	
  was	
  available	
  for	
  40	
  cases;	
  11	
  mothers	
  under	
  20	
  years	
  of	
  age,	
  21	
  between	
  the	
   ages	
   of	
   20-­‐29,	
   and	
   8	
   over	
   the	
   age	
   of	
   30.	
   Information	
   on	
   maternal	
   or	
   household	
   member	
   smoking	
   (n=8)	
   or	
   substance	
   use	
   (n=10)	
   was	
   limited	
   for	
   the	
   78	
   infant	
   mortality	
   cases.	
   Information	
  on	
  breast-­‐feeding	
  was	
  available	
  for	
  21	
  cases.	
  The	
  deaths	
  were	
  evenly	
  divided	
   between	
  breast-­‐feeding	
  alone,	
  breast	
  and	
  bottle,	
  and	
  bottle	
  alone.	
    4.4  DISCUSSION	
    Indigenous	
   populations	
   worldwide	
   experience	
   infant	
   mortality	
   rates	
   that	
   are	
   substantially	
   higher	
  than	
  national	
  averages	
  [1-­‐3,26,32,124-­‐126].	
  This	
  is	
  true	
  in	
  the	
  Inuit	
  regions	
  of	
  Canada	
   and	
  in	
  the	
  territory	
  of	
  Nunavut	
  where	
  infant	
  mortality	
  rates	
  are,	
  on	
  average,	
  2	
  to	
  3	
  times	
   the	
   national	
   rate,	
   respectively	
   [1,2].	
   Our	
   review	
   revealed	
   that	
   SIDS/SUDI	
   and	
   respiratory	
   	
    55	
    infections	
   were	
   the	
   leading	
   causes	
   of	
   infant	
   mortality	
   in	
   Nunavut	
   with	
   cause-­‐specific	
   mortality	
   rates	
   consistent	
   with	
   those	
   reported	
   by	
   Luo	
   et	
   al.	
   [2]	
   (5.54	
   and	
   2.24/1,000	
   live	
   births,	
  respectively).	
  During	
  the	
  study	
  period,	
  the	
  proportion	
  of	
  post-­‐neonatal	
  deaths	
  due	
  to	
   SIDS/SUDI	
  and	
  infectious	
  disease	
  in	
  Nunavut	
  were	
  2	
  and	
  3	
  times	
  the	
  reported	
  averages	
  for	
   all	
   of	
   Canada	
   (27.5	
   and	
   10.3%,	
   respectively;	
   2004)	
   [28].	
   The	
   cause-­‐specific	
   mortality	
   rates/1,000	
   for	
   SIDS/SUDI	
   and	
   infection	
   (including	
   respiratory	
   infection)	
   were	
   significantly	
   higher	
   than	
   the	
   national	
   rates	
   due	
   to	
   Nunavut’s	
   disproportionately	
   high	
   post-­‐neonatal	
   mortality	
  rate,	
  which	
  is	
  6	
  times	
  the	
  national	
  average	
  [1,28].	
   The	
  neonatal	
  mortality	
  rate	
  in	
  this	
  study	
  is	
  lower	
  than	
  rates	
  reported	
  by	
  Statistics	
  Canada	
   and	
   by	
   Luo	
   et	
   al.	
   (6.5	
   and	
   5.1/1,000,	
   respectively)	
   [1,2].	
   The	
   reduced	
   number	
   of	
   neonatal	
   cases	
   from	
   data	
   available	
   in	
   Nunavut	
   may	
   be	
   due	
   to	
   under	
   reporting	
   of	
   perinatal	
   deaths	
   occurring	
  out	
  of	
  territory	
  to	
  Nunavut	
  Bureau	
  of	
  Statistics.	
  The	
  post-­‐neonatal	
  mortality	
  rate	
   determined	
   by	
   this	
   study	
   was	
   consistent	
   with	
   that	
   reported	
   by	
   Statistics	
   Canada	
   for	
   the	
   region	
  [1].	
   Premature	
   infants	
   have	
   a	
   3-­‐6	
   times	
   higher	
   risk	
   for	
   mortality	
   than	
   term	
   infants,	
   including	
   higher	
  risks	
  for	
  deaths	
  due	
  to	
  infections	
  and	
  SIDS	
  [107,127].	
  Although	
  gestational	
  age	
  was	
   not	
   available	
   for	
   all	
   cases,	
   premature	
   infants	
   comprised	
   at	
   least	
   23%	
   of	
   the	
   total	
   infant	
   mortality	
  cases	
  in	
  this	
  study	
  and	
  had	
  a	
  4.5	
  times	
  greater	
  risk	
  for	
  mortality	
  than	
  term	
  infants.	
   Infants	
  exposed	
  to	
  cigarette	
  smoke	
  in	
  utero	
  and	
  in	
  their	
  environment	
  are	
  at	
  increased	
  risk	
   for	
   prematurity,	
   lower	
   respiratory	
   infection,	
   infant	
   mortality,	
   and	
   SIDS	
   and	
   SUDI	
   [56,128,129].	
   Nunavut	
   women	
   living	
   in	
   the	
   Qikiqtani	
   region	
   who	
   reported	
   smoking	
   more	
   	
    56	
    than	
  10	
  cigarettes	
  per	
  day	
  had	
  twice	
  the	
  risk	
  of	
  having	
  a	
  preterm	
  infant	
  [129].	
  Maternal	
  or	
   household	
   smoke	
   exposure	
   information	
   was	
   rarely	
   available	
   for	
   infant	
   mortality	
   cases	
   in	
   this	
   review;	
   however,	
   between	
   60-­‐80%	
   of	
   Nunavut	
   women	
   self-­‐report	
   that	
   they	
   smoked	
   during	
  pregnancy,	
  which	
  is	
  5	
  times	
  greater	
  than	
  the	
  national	
  average	
  of	
  16%	
  [28,109,129].	
  	
   Our	
   study	
   found	
   that	
   death	
   due	
   to	
   respiratory	
   infection	
   was	
   the	
   second	
   leading	
   cause	
   of	
   infant	
  mortality	
  in	
  Nunavut.	
  Infants	
  in	
  Nunavut	
  have	
  the	
  highest	
  rate	
  of	
  hospitalisation	
  for	
   lower	
  respiratory	
  tract	
  infections	
  worldwide,	
  with	
  an	
  average	
  of	
  306/1,000	
  infants	
  [14,57].	
   Environmental	
  tobacco	
  smoke	
  is	
  present	
  in	
  ~90%	
  of	
  Nunavut	
  homes,	
  which	
  are	
  small,	
  house	
   an	
  average	
  of	
  6	
  people,	
  and	
  have	
  low	
  air	
  change	
  rates	
  [110].	
  Environmental	
  tobacco	
  smoke,	
   overcrowding,	
  and	
  poor	
  ventilation	
  are	
  critical	
  risk	
  factors	
  for	
  respiratory	
  infection	
  [56].	
  	
   Information	
  on	
  maternal	
  age	
  was	
  limited,	
  but	
  was	
  consistent	
  with	
  population	
  demographics	
   for	
  maternal	
  age	
  at	
  birth	
  compared	
  to	
  a	
  2003-­‐2006	
  cross	
  sectional	
  study	
  of	
  woman	
  giving	
   birth	
  in	
  Nunavut	
  [129].	
   There	
   was	
   a	
   significant	
   increased	
   risk	
   for	
   sudden	
   death	
   associated	
   with	
   homozygosity	
   for	
   the	
   P479L	
   variant	
   of	
   CPT1A	
   (OR	
   5.15;	
   95%	
   CI:	
   1.22-­‐46.1;	
   p=0.016),	
   however	
   this	
   result	
   must	
   be	
   taken	
   with	
   caution,	
   as	
   the	
   case	
   sample	
   size	
   was	
   small	
   (n=20).	
   These	
   results	
   are	
   consistent	
  with	
  results	
  from	
  studies	
  of	
  the	
  variant	
  in	
  mid-­‐Vancouver	
  Island,	
  BC	
  First	
  Nations	
   (OR:	
   3.87;	
   95%	
   CI:	
   1.4-­‐10.9,	
   p<0.006;	
   Sinclair	
   and	
   Vallance,	
   personal	
   communication).	
   The	
   clinical	
  implications	
  of	
  the	
  common	
  P479L	
  variant	
  of	
  CPT1A	
  are	
  not	
  well	
  defined.	
  The	
  results	
   from	
   this	
   study	
   suggest	
   that	
   infants	
   homozygous	
   for	
   the	
   variant	
   may	
   be	
   at	
   increased	
   risk	
   of	
   sudden	
   death,	
   especially	
   during	
   periods	
   of	
   fever	
   and	
   intercurrent	
   illness,	
   however	
   the	
   	
    57	
    sample	
   size	
   for	
   this	
   study	
   were	
   vey	
   small.	
   Prospective	
   studies	
   on	
   the	
   variant	
   are	
   planned	
   in	
   Nunavut.	
  	
   Initial	
   recommendations	
   to	
   reduce	
   risk	
   of	
   SIDS	
   were	
   released	
   in	
   Canada	
   in	
   1993	
   [130].	
   Despite	
  this,	
  SIDS	
  and	
  SUDI	
  rates	
  in	
  Inuit	
  regions	
  of	
  Canada	
  have	
  remained	
  7	
  times	
  higher	
   than	
  the	
  rest	
  of	
  Canada	
  [2].	
  In	
  this	
  review,	
  89%	
  of	
  the	
  deaths	
  occurred	
  before	
  the	
  age	
  of	
  6	
   months	
   and,	
   although	
   not	
   all	
   cases	
   reported	
   gestational	
   age,	
   the	
   risk	
   of	
   SIDS/SUDI	
   was	
   4	
   times	
  higher	
  for	
  premature	
  infants	
  than	
  term	
  infants.	
  Unsafe	
  sleep	
  circumstances,	
  including	
   factors	
  like	
  sleep	
  position,	
  sleep	
  surface,	
  loose	
  bedding,	
  and	
  bed-­‐sharing	
  were	
  reported	
  in	
   the	
  majority	
  of	
  SIDS	
  and	
  SUDI	
  cases,	
  and	
  65%	
  of	
  the	
  cases	
  had	
  2	
  or	
  more	
  sleep	
  related	
  risk	
   factors	
   present.	
   Placing	
   infants	
   to	
   sleep	
   on	
   their	
   backs	
   (supine	
   position)	
   is	
   the	
   key	
   recommendation	
   to	
   reduce	
   the	
   risk	
   of	
   SIDS	
   [45,112,113].	
   In	
   a	
   2006	
   survey	
   (Canadian	
   Maternity	
  experiences),	
  only	
  46%	
  of	
  women	
  from	
  Nunavut	
  reported	
  placing	
  their	
  infants	
  to	
   sleep	
   in	
   the	
   supine	
   position	
   (on	
   their	
   backs)	
   [109].	
   Information	
   on	
   sleep	
   position	
   was	
   available	
  for	
  over	
  half	
  of	
  the	
  SIDS	
  and	
  SUDI	
  cases	
  and	
  our	
  results	
  support	
  that	
  public	
  health	
   reminders	
  about	
  sleep	
  position	
  are	
  needed.	
   Bed-­‐sharing	
   is	
   a	
   possible	
   risk	
   factor	
   for	
   SIDS,	
   especially	
   when	
   it	
   occurs	
   on	
   a	
   soft	
   sleep	
   surface	
   (i.e.	
   sofa),	
   if	
   the	
   infant	
   is	
   premature	
   or	
   had	
   a	
   low	
   birth	
   weight,	
   or	
   the	
   bed-­‐sharing	
   is	
   with	
   a	
   caregiver	
   that	
   smokes	
   [113,131].	
   The	
   issue	
   of	
   bed-­‐sharing	
   itself	
   as	
   a	
   risk	
   factor	
   for	
   infant	
   mortality	
   is	
   controversial	
   and	
   could	
   be	
   a	
   proxy	
   for	
   other	
   risk	
   factors	
   which	
   are	
   associated	
  with	
  bed-­‐sharing	
  (i.e.	
  loose	
  bedding).	
  Bed-­‐sharing	
  may	
  be	
  beneficial	
  to	
  infants	
  by	
    	
    58	
    promoting	
   breastfeeding	
   [112],	
   as	
   breast	
   feeding	
   may	
   reduce	
   risk	
   for	
   SIDS	
   and	
   SUDI	
   [132,133].	
  The	
  implications	
  of	
  bed-­‐sharing	
  require	
  further	
  population	
  discussion	
  and	
  study.	
  	
    4.5  CONCLUSION	
    A	
  greater	
  proportion	
  of	
  infants	
  in	
  Nunavut	
  die	
  of	
  SIDS	
  and	
  infectious	
  disease	
  than	
  infants	
  in	
   the	
   rest	
   of	
   Canada.	
   Factors	
   like	
   sleep	
   position,	
   bed-­‐sharing,	
   and	
   exposure	
   to	
   cigarette	
   smoke	
   may	
   play	
   a	
   role	
   in	
   these	
   results,	
   as	
   well	
   as	
   homozygosity	
   for	
   the	
   P479L	
   variant	
   of	
   CPT1A.	
   Studies	
   are	
   now	
   planned	
   to	
   explore	
   issues	
   around	
   sleep	
   practices	
   and	
   to	
   provide	
   culturally	
   appropriate	
   information	
   to	
   the	
   mothers	
   and	
   health	
   care	
   providers	
   of	
   Nunavut.	
   Improved	
   prenatal	
   and	
   post-­‐natal	
   data	
   collection	
   will	
   enhance	
   the	
   understanding	
   of	
   the	
   increased	
   rates	
   of	
   infant	
   mortality.	
   The	
   Qiturngatta	
   Surveillance	
   System,	
   which	
   is	
   now	
   underway	
   throughout	
   Nunavut,	
   collects	
   information	
   from	
   the	
   prenatal	
   period	
   through	
   to	
   early	
   childhood	
   (to	
   five	
   years	
   of	
   age).	
   The	
   system	
   includes	
   key	
   factors,	
   such	
   as	
   pregnancy	
   medical	
   risk	
   factors,	
   prenatal	
   care	
   and	
   nutrition,	
   and	
   substance	
   use	
   and	
   would	
   allow	
   prospective	
  study	
  and	
  analysis	
  of	
  risk	
  factors	
  not	
  commonly	
  available	
  for	
  this	
  review.	
    	
    59	
    CHAPTER	
  5. GENERAL	
  DISCUSSION	
  &	
  FUTURE	
  DIRECTIONS	
   5.1  THE	
  P479L	
  VARIANT	
  IN	
  CANADA’S	
  NORTH	
    Since	
   its	
   discover	
   in	
   2001,	
   the	
   P479L	
   variant	
   of	
   CPT1A	
   has	
   been	
   of	
   increasing	
   concern	
   regarding	
   the	
   possible	
   associated	
   risk	
   for	
   infant	
   morbidity	
   and	
   mortality.	
   A	
   number	
   of	
   symptomatic	
  and	
  sudden	
  death	
  cases,	
  all	
  homozygous	
  for	
  the	
  variant,	
  have	
  been	
  reported	
   in	
  the	
  literature	
  and,	
  subsequently,	
  some	
  jurisdictions	
  have	
  expanded	
  newborn	
  screening	
  to	
   include	
  CPT1A	
  deficiency	
  in	
  populations	
  estimated	
  to	
  have	
  high	
  homozygosity	
  for	
  the	
  P479L	
   variant	
   [6,10,11,65,90].	
   To	
   date,	
   there	
   has	
   not	
   yet	
   been	
   evidence-­‐based	
   research	
   to	
   determine	
  the	
  prevalence	
  and	
  impact	
  of	
  the	
  variant	
  in	
  those	
  populations.	
  This	
  study	
  is	
  the	
   first	
   to	
   systematically	
   determine	
   the	
   prevalence	
   of	
   the	
   variant	
   in	
   all	
   three	
   northern	
   territories	
   and	
   to	
   determine	
   if	
   there	
   is	
   an	
   increased	
   risk	
   associated	
   with	
   the	
   variant	
   in	
   sudden	
   death	
   cases	
   from	
   those	
   territories.	
   This	
   study	
   also	
   examines	
   other	
   risk	
   factors	
   associated	
  with	
  infant	
  mortality	
  in	
  Nunavut.	
  	
   This	
  study	
  determined	
  that	
  the	
  P479L	
  variant	
  is	
  highly	
  prevalent	
  in	
  Nunavut,	
  results	
  that	
  are	
   consistent	
  with	
  Rajakumar	
  et	
  al.’s	
  [8]	
  and	
  Gessner	
  et	
  al.’s	
  [9]	
  reported	
  prevalences	
  for	
  the	
   Greenland	
   Inuit	
   and	
   the	
   Inuit	
   and	
   Yupik	
   regions	
   of	
   Alaska.	
   The	
   prevalences	
   of	
   the	
   variant	
   in	
   the	
  Inuvialuit	
  population	
  of	
  NWT	
  and	
  the	
  BC	
  coastal	
  First	
  Nations	
  populations	
  were	
  similar	
   and	
  substantially	
  lower	
  than	
  in	
  the	
  Inuit.	
  There	
  was	
  very	
  low	
  frequency	
  of	
  the	
  variant	
  in	
  the	
   First	
  Nations	
  populations	
  of	
  the	
  NWT	
  and	
  Yukon	
  and	
  interior	
  populations	
  of	
  BC.	
  Most	
  of	
  the	
   First	
   Nations	
   populations	
   in	
   Yukon	
   and	
   NWT	
   are	
   in-­‐land	
   populations,	
   so	
   this	
   may	
   be	
   	
    60	
    supportive	
   of	
   the	
   hypothesis	
   that	
   the	
   variant	
   was	
   historically	
   beneficial	
   to	
   coastal	
   populations.	
  	
   The	
  P479L	
  allele	
  frequency	
  was	
  in	
  Hardy-­‐Weinberg	
  equilibrium	
  in	
  the	
  Kitikmeot	
  and	
  Kivalliq	
   regions	
   of	
   Nunavut	
   and	
   the	
   Inuvialuit	
   of	
   NWT,	
   which	
   is	
   consistent	
   with	
   results	
   for	
   coastal	
   Alaska	
   Native	
   populations	
   and	
   Greenland	
   Inuit	
   [8,9].	
   However,	
   the	
   allele	
   was	
   not	
   in	
   HWE	
   in	
   the	
   Qikiqtani	
   region	
   of	
   Nunavut.	
   It	
   is	
   possible	
   that	
   this	
   represents	
   admixture	
   of	
   this	
   population,	
   as	
   an	
   estimated	
   90%	
   of	
   the	
   population	
   are	
   born	
   to	
   Inuit	
   mothers	
   in	
   this	
   region.	
   Reduction	
   of	
   the	
   sample	
   to	
   90%	
   and	
   assuming	
   that	
   all	
   homozygotes	
   and	
   heterozygotes	
   were	
  within	
  that	
  90%	
  gave	
  values	
  for	
  P479L	
  homozygosity	
  (60%)	
  and	
  heterozygosity	
  (33%)	
   that	
  did	
  not	
  deviate	
  from	
  those	
  expected	
  by	
  HWE	
  (p>0.05).	
  However,	
  the	
  NWT	
  First	
  Nations	
   population	
  did	
  deviate	
  from	
  HWE,	
  as	
  did	
  results	
  for	
  Alaska	
  Native	
  populations	
  in	
  non-­‐Inuit	
   and	
   Yupik	
   regions	
   [9].	
   In	
   both	
   populations	
   there	
   was	
   a	
   decrease	
   in	
   expected	
   heterozygosity	
   in	
  favour	
  of	
  P479L	
  homozygosity,	
  suggesting	
  either	
  founder	
  effect	
  or	
  a	
  possible	
  benefit	
  to	
   P479L	
  homozygosity.	
   There	
   was	
   a	
   significantly	
   increased	
   risk	
   for	
   sudden	
   death	
   in	
   infants	
   homozygous	
   for	
   the	
   variant	
  in	
  Nunavut.	
  The	
  evidence	
  for	
  increased	
  risk	
  from	
  this	
  study	
  alone	
  is	
  weak,	
  but	
  the	
   results	
   are	
   consistent	
   with	
   those	
   of	
   BC	
   First	
   Nations	
   and	
   Alaska	
   Native	
   studies,	
   which	
   demonstrated	
   similar,	
   increased	
   mortality	
   risks	
   for	
   infants	
   homozygous	
   for	
   the	
   variant	
   in	
   mid	
   Vancouver	
   Island,	
   BC	
   (OR:	
   3.87;	
   95%	
   CI:	
   1.4-­‐10.9;	
   Sinclair	
   and	
   Vallance,	
   personal	
   communication)	
  and	
  Alaska	
  (OR:	
  7.6;	
  95%CI:	
  1.5-­‐38.9)	
  [94].	
  	
  	
    	
    61	
    The	
   information	
   from	
   this	
   study	
   is	
   a	
   first	
   step	
   and	
   will	
   aid	
   public	
   health	
   efforts	
   in	
   determining	
  how	
  best	
  to	
  approach	
  the	
  management	
  of	
  the	
  variant	
  in	
  their	
  jurisdictions.	
  It	
   will	
  also	
  function	
  as	
  a	
  baseline	
  for	
  studies	
  on	
  other	
  health	
  impacts	
  of	
  the	
  variant	
  in	
  these	
   populations,	
  including	
  the	
  possible	
  beneficial	
  impacts	
  in	
  late	
  life.	
    5.2  MODIFIABLE	
  RISK	
  FACTORS	
  OF	
  INFANT	
  MORTALITY	
  IN	
  NUNAVUT	
    Nunavut	
   has	
   the	
   highest	
   infant	
   and	
   post-­‐neonatal	
   mortality	
   rates	
   in	
   Canada.	
   Earlier	
   this	
   year,	
  Luo	
  et	
  al.	
  [2]	
  reported	
  on	
  birth	
  outcomes	
  in	
  Inuit	
  populations	
  of	
  Canada,	
  including	
  high	
   rates	
   of	
   infant	
   mortality,	
   SIDS,	
   and	
   infant	
   deaths	
   due	
   to	
   infectious	
   diseases.	
   This	
   study	
   further	
   describes	
   the	
   infant	
   mortality	
   cases	
   in	
   Nunavut	
   and	
   associated	
   risk	
   factors.	
   The	
   majority	
  of	
  post-­‐neonatal	
  infant	
  deaths	
  in	
  Nunavut	
  were	
  attributed	
  to	
  preventable	
  causes	
   such	
   as	
   SIDS/SUDI	
   (55%)	
   and	
   infectious	
   disease	
   (31%),	
   at	
   proportions	
   that	
   were	
   2	
   and	
   3	
   times	
  greater	
  than	
  the	
  national	
  averages	
  [28].	
  	
   The	
   CPT1A	
   P479L	
   was	
  associated	
  increased	
  risk	
  for	
  sudden	
  death	
  and	
  may	
  be	
  playing	
  a	
  role	
   in	
   the	
   excess	
   cases	
   of	
   post-­‐neonatal	
   mortality	
   cases	
   in	
   Nunavut;	
   however,	
   small	
   case	
   numbers	
   and	
   the	
   inability	
   to	
   obtain	
   all	
   case	
   samples	
   limited	
   the	
   strength	
   of	
   the	
   study.	
   Prospective	
  studies	
  are	
  planned	
  in	
  Nunavut	
  to	
  further	
  explore	
  the	
  effect	
  of	
  this	
  variant	
  in	
   early	
  childhood.	
  	
   This	
  study	
  has	
  highlighted	
  possible	
  factors	
  that	
  can	
  be	
  explored	
  in	
  efforts	
  to	
  reduce	
  infant	
   mortality	
  in	
  Nunavut	
  such	
  as	
  public	
  health	
  efforts	
  to	
  encourage	
  safe	
  sleep	
  positioning	
  and	
   other	
   sleep	
   practices,	
   and	
   exposure	
   to	
   cigarette	
   smoke.	
   The	
   results	
   of	
   this	
   study	
   add	
   to	
   	
    62	
    existing	
   data	
   and	
   will	
   aid	
   in	
   development	
   of	
   future	
   health	
   programs	
   and	
   research	
   regarding	
   birth	
   outcomes	
   in	
   Nunavut	
   as	
   well	
   as	
   other	
   jurisdictions	
   with	
   large	
   Inuit	
   populations.	
   Studies	
   are	
   now	
   planned	
   to	
   explore	
   issues	
   around	
   sleep	
   practices	
   and	
   smoking	
   and	
   to	
   provide	
   culturally	
   appropriate	
   information	
   to	
   the	
   mothers	
   and	
   health	
   care	
   providers	
   of	
   Nunavut.	
  Improved	
  prenatal	
  and	
  post-­‐natal	
  data	
  collection	
  will	
  enhance	
  the	
  understanding	
   of	
   the	
   increased	
   rates	
   of	
   infant	
   mortality.	
   The	
   Qiturngatta	
   Surveillance	
   System,	
   which	
   is	
   now	
   underway	
   throughout	
   Nunavut,	
   collects	
   information	
   from	
   the	
   prenatal	
   period	
   through	
   to	
   early	
   childhood	
   (to	
   five	
   years	
   of	
   age)	
   and	
   includes	
   key	
   factors	
   often	
   not	
   available	
   for	
   infant	
   mortality	
   review,	
   such	
   as	
   pregnancy	
   medical	
   risk	
   factors,	
   prenatal	
   care	
   and	
   nutrition,	
   and	
   substance	
   use.	
   Future	
   study	
   of	
   infant	
   mortality	
   in	
   Nunavut	
   should	
   look	
   beyond	
   the	
   descriptive	
   data	
   and	
   identify	
   those	
   modifiable	
   factors	
   that	
   will	
   improve	
   and	
   support	
   individual	
  and	
  community	
  health	
  [22,134].	
  	
    5.3  IS	
  THERE	
  A	
  P479L	
  VARIANT	
  ADVANTAGE?	
    This	
   study	
   demonstrates	
   a	
   high	
   frequency	
   of	
   the	
   P479L	
   variant	
   in	
   the	
   Inuit	
   population	
   of	
   Nunavut,	
  which	
  is	
  consistent	
  with	
  prevalence	
  reported	
  for	
  other	
  Inuit	
  populations	
  [8,9].	
  A	
   gene	
   variant/polymorphism	
   may	
   occur	
   with	
   such	
   high	
   frequency	
   in	
   a	
   population	
   due	
   to	
   the	
   founder	
   effect,	
   genetic	
   drift,	
   a	
   conferred	
   advantage,	
   or	
   linkage	
   to	
   another	
   polymorphism	
   that	
   confers	
   an	
   advantage.	
   The	
   variant	
   is	
   especially	
   frequent	
   in	
   the	
   Canadian	
   and	
   Greenlandic	
   Inuit,	
   the	
   northern	
   and	
   western	
   regions	
   of	
   Alaska	
   [6,8,94].	
   It	
   is	
   also	
   very	
   frequent	
  in	
  the	
  NWT	
  Inuvialuit	
  and	
  coastal	
  BC	
  First	
  Nations	
  populations.	
  This	
  suggests	
  that	
    	
    63	
    there	
  may	
  have	
  been	
  an	
  advantage	
  to	
  individuals	
  with	
  the	
  P479L	
  variant	
  living	
  in	
  northern	
   coastal	
  environments	
  subsisting	
  on	
  diets	
  rich	
  in	
  marine	
  fats	
  [10].	
  	
   The	
  P479L	
  CPT1A	
  variant	
  has	
  lower	
  enzymatic	
  activity	
  and	
  reduced	
  sensitivity	
  to	
  malonyl-­‐ CoA	
  (over	
  controls,	
  in	
  vitro),	
  suggesting	
  that	
  the	
  variant	
  protein	
  is	
  persistently	
  active,	
  even	
   when	
  glucose	
  is	
  present	
  [65,6].	
  The	
  reduced	
  sensitivity	
  to	
  malonyl-­‐CoA	
  may	
  be	
  due	
  to	
  the	
   position	
   of	
   the	
   P479L	
   substitution	
   near	
   or	
   within	
   the	
   malonyl-­‐CoA	
   binding	
   site	
   [77].	
   The	
   traditional	
   Inuit	
   diet	
   is	
   a	
   ketogenic	
   diet	
   with	
   high	
   fat,	
   moderate	
   protein,	
   and	
   minimal	
   carbohydrate	
   [20].	
   However,	
   historically,	
   there	
   was	
   often	
   a	
   temporary	
   increased	
   reliance	
   lean	
   protein	
   (i.e.	
   rabbit)	
   during	
   the	
   spring,	
   which	
   may	
   have	
   shut	
   off	
   ketogenesis	
   and	
   was	
   associated	
   with	
   symptoms	
   of	
   lethargy	
   and	
   headaches	
   [135].	
   P479L	
   homozygous	
   and,	
   to	
   a	
   lesser	
   extent,	
   heterozygous	
   individuals	
   may	
   have	
   avoided	
   the	
   negative	
   effects	
   of	
   diet	
   transitions	
  by	
  preserving	
  ketogenesis	
  [6,135].	
  	
   The	
   P479L	
   variant	
   may	
   be	
   also	
   beneficial	
   in	
   adulthood	
   by	
   reducing	
   risk	
   for	
   cardiovascular	
   disease	
   by	
   benefiting	
   adult	
   lipid-­‐profiles.	
   Rajakumar	
   et	
   al.’s	
   [8]	
   study	
   the	
   P479L	
   variant’s	
   impact	
  on	
  lipid	
  profiles	
  and	
  cardiovascular	
  disease	
  in	
  adult	
  Greenland	
  Inuit	
  found	
  a	
  possible	
   protective	
   effect	
   for	
   P479L	
   homozygous	
   adults	
   against	
   cardiovascular	
   disease.	
   Homozygous	
   individuals	
   had	
   higher	
   levels	
   of	
   HDL-­‐cholesterol	
   and	
   associated	
   apoA-­‐I	
   than	
   heterozygous	
   and	
   homozygous	
   wild	
   type	
   individuals.	
   Interestingly,	
   heterozygous	
   were	
   intermediate	
   between	
   P479L	
   homozygous	
   and	
   wild	
   type	
   homozygous.	
   However,	
   the	
   potential	
   dietary	
   and	
  lipid	
  profile	
  benefit	
  of	
  the	
  variant	
  is	
  one	
  that	
  is	
  noted	
  in	
  adult	
  health	
  and,	
  subsequently,	
    	
    64	
    but	
   does	
   not	
   explain	
   why	
   there	
   might	
   be	
   a	
   selective/reproductive	
   advantage	
   for	
   those	
   homozygous	
  for	
  the	
  variant.	
  	
   Alternatively,	
   the	
   P479L	
   variant	
   may	
   have	
   been	
   benign	
   or	
   may	
   not	
   have	
   been	
   subject	
   to	
   negative	
   selective	
   pressure	
   in	
   populations	
   surviving	
   on	
   a	
   low	
   carbohydrate	
   diet.	
   Free	
   LCFAs	
   have	
   been	
   found	
   to	
   induce	
   hepatic	
   CPT1A	
   expression	
   in	
   both	
   rats	
   and	
   mice	
   [85,136].	
   Female	
   neonatal	
   mice	
   offspring	
   of	
   dams	
   fed	
   a	
   high-­‐unsaturated	
   fat,	
   high	
   protein,	
   low	
   carbohydrate	
   diet	
   during	
   gestation	
   and	
   lactation	
   had	
   hepatic	
   CPT1A	
   protein	
   levels	
   that	
   were	
   ~52%	
   higher	
   than	
   those	
   female	
   offspring	
   of	
   dams	
   fed	
   a	
   carbohydrate	
   diet	
   [93].	
   Alternatively,	
  inhibition	
  of	
  CPT1A	
  activity	
  in	
  the	
  hypothalamus	
  reduces	
  feeding	
  behaviour	
  in	
   obese	
   rats	
   [137].	
   The	
   traditional	
   high	
   fat	
   diet	
   of	
   the	
   Inuit	
   may	
   have	
   compensated	
   for	
   the	
   reduced	
  activity	
  of	
  the	
  P479L	
  CPT1A	
  variant	
  by	
  increasing	
  overall	
  CPT1A	
  expression.	
    5.4  CONCLUSION	
  AND	
  FUTURE	
  RESEARCH	
  DIRECTIONS	
    5.4.1 PUBLIC	
  HEALTH	
  PROGRAMS	
   This	
   paper	
   demonstrates	
   that	
   SIDS,	
   SUDI,	
   and	
   infectious	
   disease	
   comprise	
   the	
   majority	
   of	
   infant	
   deaths	
   in	
   Nunavut.	
   It	
   also	
   demonstrates	
   that	
   infants	
   homozygous	
   for	
   the	
   P479L	
   variant	
   have	
   a	
   moderate	
   but	
   significant	
   increased	
   risk	
   for	
   death	
   due	
   SIDS/SUDI	
   and	
   infectious	
   disease.	
   While	
   the	
   results	
   from	
   this	
   study	
   must	
   be	
   viewed	
   with	
   caution	
   due	
   to	
   small	
  numbers,	
  it	
  is	
  still	
  appropriate	
  to	
  consider	
  public	
  health	
  programs	
  targeted	
  to	
  affected	
   communities	
   and	
   the	
   medical	
   professionals	
   serving	
   those	
   communities.	
   This	
   may	
   include	
   public	
  health	
  education	
  programs	
  advising	
  parents	
  and	
  extended	
  families	
  to	
  ensure	
  infants	
   	
    65	
    are	
   carefully	
   monitored	
   when	
   ill,	
   and	
   inclusion	
   of	
   the	
   P479L	
   variant	
   testing	
   in	
   newborn	
   screening.	
  Any	
  public	
  health	
  programs	
  will	
  need	
  to	
  consider	
  the	
  importance	
  of	
  family	
  and	
   consultative	
   structure	
   in	
   Aboriginal	
   communities	
   [138].	
   Programs	
   should	
   be	
   developed	
   in	
   partnership	
   with	
   community	
   members	
   and	
   leaders	
   regarding	
   how	
   information	
   regarding	
   the	
  P479L	
  variant	
  and	
  CPT1A	
  deficiency	
  should	
  be	
  conveyed	
  to	
  parents	
  and	
  families.	
  	
  	
   Traditional	
   lifestyle,	
   breast-­‐feeding,	
   and	
   diet	
   may	
   play	
   a	
   protective	
   role	
   for	
   those	
   homozygous	
   for	
   the	
   P479L	
   variant.	
   A	
   cohort	
   study	
   assessing	
   factors	
   around	
   infancy	
   and	
   through	
  childhood	
  may	
  allow	
  better	
  characterisation	
  of	
  the	
  disorder	
  and	
  those	
  factors	
  that	
   may	
   ameliorate	
   the	
   presence	
   of	
   the	
   variant.	
   This	
   could	
   include	
   assessment	
   of	
   whether	
   consumption	
   of	
   a	
   traditional	
   high-­‐unsaturated	
   fat	
   diet	
   during	
   gestation	
   and	
   lactation	
   improves	
   outcomes	
   for	
   P479L	
   homozygous	
   infants.	
   Information	
   from	
   the	
   Nunavut	
   Qiturngatta	
  Surveillance	
  System	
  may	
  be	
  helpful	
  in	
  the	
  identification	
  of	
  such	
  factors.	
   5.4.2 IMPLICATIONS	
  OF	
  NEWBORN	
  SCREENING	
  FOR	
  THE	
  P479L	
  VARIANT	
   Newborn	
   screening	
   for	
   the	
   variant,	
   combined	
   with	
   a	
   surveillance	
   system,	
   would	
   allow	
   territorial	
   health	
   authorities	
   to	
   prospectively	
   study	
   the	
   impact	
   of	
   P479L	
   variant,	
   including	
   rates	
   of	
   sudden	
   unexpected	
   death	
   and	
   effectiveness	
   of	
   treatment.	
   Screening	
   would	
   also	
   allow	
   parents	
   and	
   health	
   care	
   providers	
   to	
   monitor	
   P479L	
   homozygous	
   infants	
   closely	
   during	
  times	
  of	
  fever	
  and	
  illness.	
  Lowering	
  standard	
  cut-­‐offs	
  (C0/(C16+C18	
  >	
  20)	
  followed	
   by	
  secondary	
  genotyping	
  would	
  capture	
  most	
  homozygous	
  and	
  some	
  heterozygous	
  infants	
   [9].	
   However,	
   the	
   high	
   prevalence	
   of	
   the	
   variant	
   in	
   Inuit,	
   Inuvialuit	
   and	
   BC	
   First	
   Nations	
   populations	
  suggests	
  that	
  further	
  characterisation	
  of	
  the	
  clinical	
  impact	
  of	
  the	
  variant	
  and	
   	
    66	
    clarification	
  of	
  effective	
  treatment	
  are	
  needed	
  to	
  allow	
  primary	
  care	
  health	
  care	
  providers	
   to	
   properly	
   advise	
   parents	
   of	
   homozygous	
   infants.	
   The	
   intent	
   of	
   the	
   newborn	
   screening	
   program	
   is	
   to	
   avoid	
   harm	
   to	
   infants	
   and	
   families,	
   therefore,	
   information	
   regarding	
   CPT1A	
   deficiency	
   and	
   the	
   risks	
   associated	
   with	
   homozygosity	
   for	
   the	
   P479L	
   allele	
   must	
   be	
   disseminated	
  in	
  a	
  manner	
  that	
  does	
  not	
  unduly	
  alarm	
  parents	
  or	
  health	
  care	
  professionals.	
   Education	
  programs	
  will	
  need	
  to	
  be	
  respectful	
  of	
  the	
  different	
  cultural	
  perspectives	
  of	
  the	
   affected	
  Inuit	
  and	
  First	
  Nations	
  communities	
  and	
  avoid	
  ‘medicalising’	
  healthy	
  children.	
  	
   5.4.3 CHARACTERISATION	
  OF	
  THE	
  P479L	
  VARIANT	
   This	
   research	
   demonstrates	
   the	
   high	
   prevalence	
   of	
   the	
   variant	
   in	
   Inuit	
   populations	
   of	
   northern	
   Canada	
   and	
   demonstrates	
   that	
   the	
   natural	
   history	
   aetiology	
   and	
   clinical	
   impact	
   of	
   the	
   P479L	
   variant	
   needs	
   better	
   characterisation.	
   This	
   could	
   be	
   addressed	
   in	
   a	
   variety	
   of	
   ways,	
   including	
   clarification	
   of	
   the	
   symptomatic	
   phenotype,	
   prospective	
   studies	
   of	
   infants	
   homozygous	
   for	
   the	
   variant,	
   and	
   mouse	
   modelling	
   to	
   better	
   characterise	
   the	
   biochemical	
   significance	
   of	
   the	
   variant	
   as	
   well	
   as	
   to	
   clarify	
   environmental	
   factors	
   that	
   may	
   affect	
   the	
   penetrance	
  of	
  the	
  variant.	
  	
   Study	
  of	
  symptomatic	
  cases	
  has	
  been	
  difficult	
  due	
  to	
  the	
  highly	
  variable	
  symptoms	
  of	
  cases.	
   A	
  clearly	
  defined	
  phenotype	
  is	
  needed	
  to	
  determine	
  risk	
  associated	
  with	
  the	
  allele	
  and	
  the	
   benefits	
  of	
  treatment,	
  including	
  recommending	
  fast	
  avoidance	
  is	
  appropriate.	
  This	
  issue	
  can	
   only	
  be	
  addressed	
  by	
  prospective	
  study	
  of	
  cases	
  sent	
  for	
  CPT1A	
  P479L	
  testing.	
    	
    67	
    A	
  mouse	
  model	
  for	
  the	
  P479L	
  variant	
  of	
  CPT1A	
  would	
  allow	
  characterisation	
  of	
  the	
  variant	
   under	
  a	
  variety	
  of	
  physiological	
  conditions	
  as	
  well	
  as	
  the	
  impact	
  of	
  maternal	
  diet	
  and	
  health	
   of	
  neonates.	
  It	
  would	
  also	
  aid	
  in	
  determining	
  if	
  the	
  variant	
  is	
  thermolabile	
  and	
  its	
  activity	
   and	
   malonyl-­‐CoA	
   binding	
   affinity	
   in	
   vivo.	
   A	
   CPT1A	
   knock-­‐out	
   mouse	
   has	
   been	
   developed	
   and	
   haplo-­‐insufficiency	
   of	
   the	
   heterozygous	
   mice	
   demonstrated	
   information	
   that	
   characterised	
   CPT1A	
   deficiency	
   [139].	
   A	
   P479L	
   CPT1A	
   mouse	
   model	
   could	
   also	
   help	
   determine	
   the	
   presence	
   of	
   increased	
   sensitivity	
   to	
   fasting	
   and	
   fever	
   in	
   P479L	
   CPT1A	
   homozygous	
  mice	
  and	
  be	
  compared	
  to	
  the	
  CPT1A	
  knock-­‐out	
  heterozygous	
  mice	
  to	
  assess	
   how	
  the	
  two	
  genotypes	
  differ	
  in	
  CPT1A	
  activity,	
  response	
  to	
  treatment,	
  and	
  overall	
  health	
   outcomes.	
   As	
   CPT1A	
   is	
   also	
   expressed	
   in	
   the	
   hypothalamus	
   and	
   is	
   involved	
   in	
   feeding	
   behaviour,	
   the	
   effect	
   of	
   P479L	
   CPT1A	
   variant	
   on	
   satiety	
   could	
   also	
   be	
   investigated.	
   This	
   model	
   could	
   also	
   help	
   determine	
   any	
   benefits	
   of	
   an	
   Inuit	
   traditional	
   style	
   diet	
   for	
   those	
   homozygous	
  for	
  the	
  variant.	
   5.4.4 HISTORICAL	
  SIGNIFICANCE	
  OF	
  THE	
  P479L	
  VARIANT	
   The	
  presence	
  of	
  a	
  variant	
  in	
  the	
  distantly	
  related	
  Inuit,	
  Yupik,	
  Inuvialuit,	
  Alaska	
  Native,	
  and	
   coastal	
  First	
  Nations	
  populations	
  of	
  BC	
  raises	
  questions	
  as	
  to	
  an	
  advantage	
  associated	
  with	
   the	
  allele,	
  and	
  whether	
  the	
  mutation	
  occurred	
  in	
  a	
  common	
  ancestor	
  of	
  all	
  populations,	
  or	
   whether	
   the	
   mutation	
   occurred	
   independently	
   in	
   some	
   or	
   all	
   of	
   these	
   populations.	
   Determining	
  the	
  prevalence	
  of	
  the	
  variant	
  in	
  the	
  Yupik	
  of	
  the	
  Russian	
  Chukotka	
  peninsula	
   would	
  aid	
  in	
  answering	
  this	
  question.	
  	
  	
    	
    68	
    5.4.5 INFANT	
  MORTALITY	
  IN	
  NUNAVUT	
   This	
   paper	
   has	
   identified	
   a	
   variety	
   of	
   risk	
   factors	
   and	
   data	
   concerns	
   relating	
   to	
   infant	
   mortality	
   cases	
   in	
   Nunavut.	
   Better	
   surveillance	
   will	
   improve	
   data	
   collection	
   of	
   risk	
   factors	
   surrounding	
   infant	
   mortality	
   cases	
   in	
   the	
   territory	
   and	
   will	
   allow	
   analysis	
   for	
   adverse	
   health	
   outcomes.	
   Better	
   communications	
  tools	
  regarding	
  sleep	
   position	
   and	
   smoke	
   exposure	
   are	
   also	
  needed.	
  These	
  tools	
  should	
  utilise	
  the	
  extensive	
  communication	
  networks	
  within	
  and	
   between	
   Nunavut	
   communities	
   and	
   should	
   be	
   developed	
   in	
   partnership	
   with	
   community	
   leaders,	
  parents,	
  families,	
  and	
  public	
  health	
  nurses	
  to	
  ensure	
  that	
  the	
  message	
  is	
  consistent	
   and	
  culturally	
  meaningful.	
   Dialogue	
   with	
   community	
   members	
   and	
   leaders	
   would	
   help	
   researchers	
   and	
   health	
   care	
   professionals	
  to	
  characterise	
  factors	
  that	
  may	
  hinder	
  access	
  to	
  information	
  and	
  resources	
  as	
   well	
   as	
   to	
   better	
   understand	
   both	
   traditional	
   and	
   modern	
   perceptions	
   of	
   infant	
   mortality	
   and	
  associated	
  risk	
  factors.	
  Engagement	
  of	
  all	
  stakeholders,	
  including	
  elders	
  and	
  community	
   members,	
  would	
  help	
  to	
  identify	
  positive	
  and	
  modifiable	
  factors	
  that	
  could	
  aid	
  in	
  reducing	
   infant	
  mortality	
  in	
  communities.	
  	
    5.5  LIMITATIONS	
    This	
   study	
   was	
   the	
   first	
   study	
   to	
   assess	
   the	
   prevalence	
   of	
   the	
   P479L	
   variant	
   of	
   CPT1A	
   in	
   infants	
  of	
  all	
  three	
  territories,	
  and	
  compared	
  it	
  with	
  the	
  frequency	
  of	
  homozygosity	
  of	
  those	
   who	
   died	
   unexpectedly.	
   There	
   are,	
   however,	
   several	
   limitations	
   to	
   this	
   study,	
   which	
   must	
   be	
   kept	
   in	
   mind	
   when	
   reviewing	
   these	
   results.	
   The	
   low	
   samples	
   size	
   for	
   infant	
   deaths	
   	
    69	
    greatly	
   reduced	
   the	
   ability	
   to	
   determine	
   risk	
   associated	
   with	
   the	
   variant.	
   Although	
   the	
   case	
   numbers	
   analysed	
   in	
   this	
   study	
   were	
   small,	
   they	
   were	
   higher	
   than	
   those	
   reported	
   in	
   Gessner	
   et	
   al.	
   [94].	
   The	
   case	
   numbers	
   were	
   further	
   limited	
   by	
   the	
   unavailability	
   of	
   dried	
   blood	
   spot	
   samples	
   for	
   many	
   of	
   the	
   cases	
   identified	
   for	
   inclusion	
   in	
   the	
   study.	
   Newborn	
   blood	
   spot	
   samples	
   were	
   only	
   available	
   for	
   39%	
   (31/79)	
   of	
   sudden	
   death	
   cases	
   for	
   all	
   three	
   territories	
  and	
  34%	
  (20/59)	
  of	
  Nunavut	
  cases.	
  This	
  reduced	
  ability	
  to	
  assess	
  risk	
  associated	
   with	
   the	
   variant,	
   especially	
   for	
   a	
   multi-­‐factorial	
   outcome	
   like	
   SUDI	
   or	
   death	
   to	
   infectious	
   disease.	
   However,	
   the	
   study	
   was	
   still	
   able	
   to	
   demonstrate	
   a	
   moderate	
   increased	
   risk	
   for	
   infants	
   homozygous	
   for	
   the	
   variant	
   in	
   Nunavut.	
   This	
   study	
   was	
   a	
   candidate	
   gene	
   study,	
   which	
  may	
  be	
  influenced	
  by	
  population	
  stratification.	
  Although	
  we	
  tried	
  to	
  control	
  for	
  this	
   in	
  the	
  study,	
  it	
  was	
  not	
  possible	
  to	
  completely	
  control	
  for	
  this	
  in	
  Nunavut	
  or	
  Yukon	
  samples	
   as	
  no	
  ethnicity	
  information	
  was	
  available	
  for	
  population	
  samples,	
  as	
  discussed	
  in	
  Chapter	
  2,	
   and	
  this	
  is	
  a	
  concern	
  for	
  these	
  data.	
  Another	
  limitation	
  was	
  the	
  inability	
  to	
  conduct	
  cluster	
   analysis	
  of	
  territorial	
  data	
  to	
  determine	
  whether	
  there	
  are	
  geographical	
  clusters	
  trends	
  in	
   P479L	
  variant	
  frequency	
  in	
  the	
  three	
  territories.	
   This	
   review	
   of	
   risk	
   factors	
   for	
   infant	
   mortality	
   cases	
   in	
   Nunavut	
   was	
   a	
   retrospective	
   case	
   review	
   study,	
   with	
   limited	
   available	
   risk	
   determinant	
   information.	
   Many	
   mortality	
   subgroups	
   presented	
   in	
   this	
   study	
   were	
   too	
   small	
   for	
   statistical	
   analysis.	
   Caution	
   must	
   be	
   used	
  when	
  interpreting	
  mortality	
  data	
  in	
  such	
  small	
  numbers.	
  Review	
  of	
  Nunavut	
  Bureau	
  of	
   Statistics	
   indicated	
   that	
   out	
   of	
   territory	
   perinatal	
   deaths	
   were	
   likely	
   under-­‐reported	
   to	
    	
    70	
    Nunavut.	
  In	
  particular,	
  detailed	
  information	
  for	
  these	
  deaths	
  was	
  unavailable	
  to	
  the	
  Chief	
   Medical	
  Officer	
  of	
  Health	
  limiting	
  analysis	
  of	
  contributing	
  factors.	
  	
    	
    71	
    REFERENCES	
   1.	
    Statistics	
  Canada.	
  Table	
  102-­‐0507	
  -­‐	
  Infant	
  mortality,	
  by	
  age	
  group,	
  Canada,	
  provinces	
   and	
  territories,	
  annual,	
  CANSIM	
  (database)	
  [Internet].	
  2010	
  Feb	
  22	
  [cited	
  2009	
  Jun	
   17];Available	
  from:	
  http://cansim2.statcan.gc.ca/cgi-­‐ win/cnsmcgi.exe?Lang=E&amp;CNSM-­‐Fi=CII/CII_1-­‐eng.htm	
    	
   2.	
    Luo	
  Z,	
  Senecal	
  S,	
  Simonet	
  F,	
  Guimond	
  E,	
  Penney	
  C,	
  Wilkins	
  R.	
  Birth	
  outcomes	
  in	
  the	
   Inuit-­‐inhabited	
  areas	
  of	
  Canada.	
  CMAJ.	
  2010	
  Feb	
  23;182(3):235-­‐42.	
  	
    	
   3.	
    Macaulay	
  A,	
  Orr	
  P,	
  Macdonald	
  S,	
  Elliott	
  L,	
  Brown	
  R,	
  Durcan	
  A,	
  et	
  al.	
  Mortality	
  in	
  the	
   Kivalliq	
  Region	
  of	
  Nunavut,	
  1987-­‐1996.	
  Int	
  J	
  Circumpolar	
  Health.	
  2004;63	
  Suppl	
  2:80-­‐ 85.	
  	
    	
   4.	
    Luo	
  Z,	
  Kierans	
  WJ,	
  Wilkins	
  R,	
  Liston	
  RM,	
  Uh	
  S,	
  Kramer	
  MS,	
  et	
  al.	
  Infant	
  mortality	
  among	
   First	
  Nations	
  versus	
  non-­‐First	
  Nations	
  in	
  British	
  Columbia:	
  temporal	
  trends	
  in	
  rural	
   versus	
  urban	
  areas,	
  1981-­‐2000.	
  Int.	
  J.	
  Epidemiol.	
  2004	
  Dec	
  1;33(6):1252-­‐1259.	
  	
    	
   5.	
    Smylie	
  J,	
  Fell	
  D,	
  Ohlsson	
  A.	
  A	
  review	
  of	
  Aboriginal	
  infant	
  mortality	
  rates	
  in	
  Canada:	
   striking	
  and	
  persistent	
  Aboriginal/non-­‐Aboriginal	
  inequities.	
  Can	
  J	
  Public	
  Health.	
  2010	
   Apr;101(2):143-­‐148.	
  	
    	
   6.	
    Greenberg	
  CR,	
  Dilling	
  LA,	
  Thompson	
  GR,	
  Seargeant	
  LE,	
  Haworth	
  JC,	
  Phillips	
  S,	
  et	
  al.	
  The	
   paradox	
  of	
  the	
  carnitine	
  palmitoyltransferase	
  type	
  Ia	
  P479L	
  variant	
  in	
  Canadian	
   Aboriginal	
  populations.	
  Mol	
  Genet	
  Metab.	
  2009	
  Apr;96(4):201-­‐207.	
  	
    	
   7.	
    Sinclair	
  G,	
  Ma	
  J,	
  Macleod	
  PM,	
  Arbour	
  L,	
  Vallance	
  HD.	
  Retrospective	
  genotyping	
  of	
   newborn	
  screening	
  cards	
  for	
  the	
  P479L	
  carnitine	
  palmitoyltransferase	
  (CPT1)	
  variant:	
   Correlation	
  with	
  acylcarnitine	
  profiles	
  and	
  estimation	
  of	
  incidence	
  in	
  British	
  Columbia	
   [abstract].	
  Mol	
  Genet	
  Metab.	
  2007	
  Mar;90(3):262.	
  	
    	
   	
    72	
    8.	
    Rajakumar	
  C,	
  Ban	
  MR,	
  Cao	
  H,	
  Young	
  TK,	
  Bjerregaard	
  P,	
  Hegele	
  RA.	
  Carnitine	
   palmitoyltransferase	
  IA	
  polymorphism	
  P479L	
  is	
  common	
  in	
  Greenland	
  Inuit	
  and	
  is	
   associated	
  with	
  elevated	
  plasma	
  apolipoprotein	
  A-­‐I.	
  J	
  Lipid	
  Res.	
  2009	
  Jun;50(6):1223-­‐ 1228.	
  	
    	
   9.	
    Gessner	
  BD,	
  Gillingham	
  MB,	
  Johnson	
  MA,	
  Richards	
  CS,	
  Lambert	
  WE,	
  Sesser	
  D,	
  et	
  al.	
   Prevalence	
  and	
  distribution	
  of	
  the	
  c.1436C→T	
  sequence	
  variant	
  of	
  carnitine	
   palmitoyltransferase	
  1A	
  among	
  Alaska	
  Native	
  infants.	
  J	
  Pediatr	
  [Internet].	
  2010	
  Sep	
  13	
   [cited	
  2010	
  Oct	
  20];Available	
  from:	
  http://www.ncbi.nlm.nih.gov/pubmed/20843525	
    	
   10.	
   Raff	
  ML,	
  Trahms	
  C,	
  Hahn	
  SH,	
  Parisi	
  MA,	
  Hannibal	
  M,	
  Glass	
  IA,	
  et	
  al.	
  Clinical	
   manifestations	
  and	
  consequences	
  of	
  the	
  P479L	
  mutation	
  of	
  carnitine	
  palmitoyl	
   transferase	
  type	
  1	
  deficiency	
  in	
  the	
  Alaskan	
  native	
  population	
  [abstract].	
  2007	
  Oct	
  25	
   [cited	
  2008	
  Dec	
  20];Available	
  from:	
   http://www.ashg.org/genetics/ashg07s/f21300.htm	
   	
   11.	
   Popescu	
  O,	
  McFadden	
  D,	
  Vallance	
  HD,	
  Sinclair	
  G,	
  Schreiber	
  R.	
  Hepatic	
  and	
  renal	
   histopathology	
  in	
  Cpt1a	
  P479l	
  homozygous	
  sudden	
  death	
  cases	
  [abstract].	
  Pediatric	
   and	
  Developmental	
  Pathology.	
  2010	
  3;13(2):145.	
  	
   	
   12.	
   Statistics	
  Canada.	
  Aboriginal	
  Peoples	
  in	
  Canada	
  in	
  2006:	
  Inuit,	
  Métis	
  and	
  First	
  Nations,	
   2006	
  census:	
  findings	
  [Internet].	
  	
  2008	
  [cited	
  2010	
  Jan	
  8].	
  Available	
  from:	
   http://www12.statcan.ca/census-­‐recensement/2006/as-­‐sa/97-­‐558/index-­‐ eng.cfm?CFID=3614683&CFTOKEN=94792438	
   	
   13.	
   Young	
  TK.	
  Northern	
  Canada.	
  	
  In:	
  Health	
  Transitions	
  in	
  Arctic	
  Populations.	
  	
  University	
  of	
   Toronto	
  Press;	
  2008.	
  	
  p.	
  39-­‐52.	
   	
   14.	
   Creery	
  D,	
  Lyer	
  P,	
  Samson	
  L,	
  Coyle	
  D,	
  Osborne	
  G,	
  MacDonald	
  A.	
  Costs	
  associated	
  with	
   infant	
  bronchiolitis	
  in	
  the	
  Baffin	
  region	
  of	
  Nunavut.	
  Int	
  J	
  Circumpolar	
  Health.	
  2005	
   Feb;64(1):38-­‐45.	
  	
   	
   15.	
   Statistics	
  Canada.	
  Inuit	
  Regions.	
  2006	
  Census	
  Subdivisions	
  (CSDs)	
  within	
  Inuit	
  Nunaat	
   	
    73	
    with	
  an	
  Inuit	
  Identity	
  Population	
  of	
  100	
  or	
  more	
  (map).	
  “Thematic	
  maps.”	
  “2006	
   Census:	
  Geography.”	
  Census.	
  [Internet].	
  	
  [cited	
  2010	
  Jul	
  12];Available	
  from:	
   http://www12.statcan.gc.ca/census-­‐recensement/2006/as-­‐sa/97-­‐558/maps-­‐ cartes/Inuit/InuitRegionsAboriginal_TotalIDPop_ec.pdf	
   	
   16.	
   Bjerregaard	
  P,	
  Young	
  TK.	
  Inuit.	
  	
  In:	
  Health	
  Transitions	
  in	
  Arctic	
  Populations.	
  	
  University	
   of	
  Toronto	
  Press;	
  2008.	
  	
  p.	
  119-­‐144.	
   	
   17.	
   McMillan	
  AD.	
  Native	
  peoples	
  and	
  cultures	
  of	
  Canada.	
  	
  2nd	
  ed.	
  	
  Douglas	
  &	
  McIntyre;	
   1995.	
  	
   	
   18.	
   Muggah	
  E,	
  Way	
  D,	
  Muirhead	
  M,	
  Baskerville	
  B.	
  Preterm	
  delivery	
  among	
  Inuit	
  women	
  in	
   the	
  Baffin	
  Region	
  of	
  the	
  Canadian	
  Arctic.	
  Int	
  J	
  Circumpolar	
  Health.	
  2004;63	
  Suppl	
   2:242-­‐247.	
  	
   	
   19.	
   Bureau	
  of	
  Statistics,	
  Government	
  of	
  Nunavut.	
  Births	
  in	
  Nunavut	
  for	
  2006.	
  	
  2010.	
  	
   	
   20.	
   Sharma	
  S,	
  Cao	
  X,	
  Roache	
  C,	
  Buchan	
  A,	
  Reid	
  R,	
  Gittelsohn	
  J.	
  Assessing	
  dietary	
  intake	
  in	
  a	
   population	
  undergoing	
  a	
  rapid	
  transition	
  in	
  diet	
  and	
  lifestyle:	
  the	
  Arctic	
  Inuit	
  in	
   Nunavut,	
  Canada.	
  Br.	
  J.	
  Nutr.	
  2010	
  Mar;103(5):749-­‐759.	
  	
   	
   21.	
   Bjerregaard	
  P,	
  Jeppesen	
  C.	
  Inuit	
  dietary	
  patterns	
  in	
  modern	
  Greenland.	
  Int	
  J	
   Circumpolar	
  Health.	
  2010	
  Feb;69(1):13-­‐24.	
  	
   	
   22.	
   Richmond	
  CAM,	
  Ross	
  NA.	
  The	
  determinants	
  of	
  First	
  Nation	
  and	
  Inuit	
  health:	
  a	
  critical	
   population	
  health	
  approach.	
  Health	
  Place.	
  2009	
  Jun;15(2):403-­‐411.	
  	
   	
   23.	
   Wesche	
  SD,	
  Chan	
  HM.	
  Adapting	
  to	
  the	
  impacts	
  of	
  climate	
  change	
  on	
  food	
  security	
   among	
  Inuit	
  in	
  the	
  western	
  Canadian	
  arctic.	
  Ecohealth	
  [Internet].	
  2010	
  Aug	
  3	
  [cited	
   2010	
  Aug	
  13];Available	
  from:	
  http://www.ncbi.nlm.nih.gov/pubmed/20680394	
   	
   	
    74	
    24.	
   Bjerregaard	
  P,	
  Young	
  TK,	
  Dewailly	
  E,	
  Ebbesson	
  SOE.	
  Indigenous	
  health	
  in	
  the	
  Arctic:	
  an	
   overview	
  of	
  the	
  circumpolar	
  Inuit	
  population.	
  Scand	
  J	
  Public	
  Health.	
  2004;32(5):390-­‐ 395.	
  	
   	
   25.	
   Saigal	
  S,	
  Doyle	
  LW.	
  An	
  overview	
  of	
  mortality	
  and	
  sequelae	
  of	
  preterm	
  birth	
  from	
   infancy	
  to	
  adulthood.	
  Lancet.	
  2008	
  Jan	
  19;371(9608):261-­‐269.	
  	
   	
   26.	
   Tomashek	
  KM,	
  Qin	
  C,	
  Hsia	
  J,	
  Iyasu	
  S,	
  Barfield	
  WD,	
  Flowers	
  LM.	
  Infant	
  Mortality	
  Trends	
   and	
  Differences	
  Between	
  American	
  Indian/Alaska	
  Native	
  Infants	
  and	
  White	
  Infants	
  in	
   the	
  United	
  States,	
  1989-­‐1991	
  and	
  1998-­‐2000.	
  Am	
  J	
  Public	
  Health.	
  2006	
  Dec	
   1;96(12):2222-­‐2227.	
  	
   	
   27.	
   Statistics	
  Canada.	
  Table	
  102-­‐0562	
  -­‐	
  Leading	
  causes	
  of	
  death,	
  infants,	
  by	
  age	
  group	
  and	
   sex,	
  Canada,	
  annual,	
  CANSIM	
  (database).	
  [Internet].	
  2009	
  Mar	
  30	
  [cited	
  2010	
  May	
   11];Available	
  from:	
  http://cansim2.statcan.gc.ca/cgi-­‐win/cnsmcgi.exe?Lang=E&CNSM-­‐ Fi=CII/CII_1-­‐eng.htm	
   	
   28.	
   Public	
  Health	
  Agency	
  of	
  Canada	
  Government	
  of	
  Canada.	
  Canadian	
  Perinatal	
  Health	
   Report,	
  2008	
  Edition	
  [Internet].	
  	
  Ottawa:	
  2008	
  [cited	
  2010	
  Jun	
  9].	
  Available	
  from:	
   http://www.phac-­‐aspc.gc.ca/publicat/2008/cphr-­‐rspc/index-­‐eng.php	
   	
   29.	
   Zalan	
  J,	
  Santos	
  M.	
  Sudden	
  infant	
  death	
  syndrome.	
  EpiNorth.	
  2007	
  Oct;19(3):5-­‐9.	
  	
   	
   30.	
   Statistics	
  Canada.	
  Table	
  102-­‐4512	
  -­‐	
  Live	
  births,	
  by	
  weeks	
  of	
  gestation	
  and	
  sex,	
  Canada,	
   provinces	
  and	
  territories,	
  annual,	
  CANSIM	
  (database)	
  [Internet].	
  2009	
  Sep	
  21	
  [cited	
   2010	
  May	
  11];Available	
  from:	
  http://cansim2.statcan.gc.ca/cgi-­‐ win/cnsmcgi.exe?Lang=E&CNSM-­‐Fi=CII/CII_1-­‐eng.htm	
   	
   31.	
   Statistics	
  Canada.	
  2006	
  Aboriginal	
  Population	
  Profile.	
  2006	
  census	
  [Internet].	
  2007	
   [cited	
  2010	
  Feb	
  3];Available	
  from:	
  http://www.statcan.gc.ca/bsolc/olc-­‐cel/olc-­‐ cel?catno=92-­‐594-­‐XWE&lang=eng	
   	
   	
    75	
    32.	
   Allard	
  YE,	
  Wilkins	
  R,	
  Berthelot	
  J.	
  Premature	
  mortality	
  in	
  health	
  regions	
  with	
  high	
   Aboriginal	
  populations.	
  Health	
  Reports.	
  2004	
  Jan;15(1):51-­‐60.	
  	
   	
   33.	
   Willinger	
  M,	
  James	
  LS,	
  Catz	
  C.	
  Defining	
  the	
  sudden	
  infant	
  death	
  syndrome	
  (SIDS):	
   deliberations	
  of	
  an	
  expert	
  panel	
  convened	
  by	
  the	
  National	
  Institute	
  of	
  Child	
  Health	
  and	
   Human	
  Development.	
  Pediatr	
  Pathol.	
  1991	
  Oct;11(5):677-­‐684.	
  	
   	
   34.	
   Moon	
  RY,	
  Horne	
  RSC,	
  Hauck	
  FR.	
  Sudden	
  infant	
  death	
  syndrome.	
  Lancet.	
  2007	
  Nov	
   3;370(9598):1578-­‐1587.	
  	
   	
   35.	
   Statistics	
  Canada.	
  Table	
  102-­‐0538	
  -­‐	
  Deaths,	
  by	
  cause,	
  Chapter	
  XVIII:	
  Symptoms,	
  signs	
   and	
  abnormal	
  clinical	
  and	
  laboratory	
  findings,	
  not	
  elsewhere	
  classified	
  (R00	
  to	
  R99),	
   age	
  group	
  and	
  sex,	
  Canada,	
  annual	
  (number),	
  CANSIM	
  (database)	
  [Internet].	
  2010	
  May	
   3	
  [cited	
  2009	
  Jun	
  17];Available	
  from:	
  http://cansim2.statcan.gc.ca/cgi-­‐ win/cnsmcgi.pgm	
   	
   36.	
   Krous	
  HF,	
  Beckwith	
  JB,	
  Byard	
  RW,	
  Rognum	
  TO,	
  Bajanowski	
  T,	
  Corey	
  T,	
  et	
  al.	
  Sudden	
   infant	
  death	
  syndrome	
  and	
  unclassified	
  sudden	
  infant	
  deaths:	
  a	
  definitional	
  and	
   diagnostic	
  approach.	
  Pediatrics.	
  2004	
  Jul	
  1;114(1):234-­‐238.	
  	
   	
   37.	
   Olpin	
  SE.	
  The	
  metabolic	
  investigation	
  of	
  sudden	
  infant	
  death.	
  Ann	
  Clin	
  Biochem.	
  2004	
   Jul	
  1;41(4):282-­‐293.	
  	
   	
   38.	
   Weese-­‐Mayer	
  DE,	
  Ackerman	
  MJ,	
  Marazita	
  ML,	
  Berry-­‐Kravis	
  EM.	
  Sudden	
  infant	
  death	
   syndrome:	
  review	
  of	
  implicated	
  genetic	
  factors.	
  Am.	
  J.	
  Med.	
  Genet.	
  A.	
  2007	
  Apr	
   15;143A(8):771-­‐788.	
  	
   	
   39.	
   Ottaviani	
  G,	
  Bergui	
  GC.	
  Sudden	
  unexpected	
  death	
  in	
  infancy	
  (SUDI):	
  a	
  new	
  anatomo-­‐ clinical	
  approach.	
  Europace.	
  2009	
  Mar;11(3):395.	
  	
   	
   40.	
   Blair	
  PS,	
  Sidebotham	
  P,	
  Berry	
  PJ,	
  Evans	
  M,	
  Fleming	
  PJ.	
  Major	
  epidemiological	
  changes	
   in	
  sudden	
  infant	
  death	
  syndrome:	
  a	
  20-­‐year	
  population-­‐based	
  study	
  in	
  the	
  UK.	
  Lancet.	
   	
    76	
    2006	
  Jan	
  28;367(9507):314-­‐319.	
  	
   	
   41.	
   Guntheroth	
  WG,	
  Spiers	
  PS.	
  The	
  triple	
  risk	
  hypotheses	
  in	
  sudden	
  infant	
  death	
   syndrome.	
  Pediatrics.	
  2002	
  Nov;110(5):e64.	
  	
   	
   42.	
   Hunt	
  CE,	
  Hauck	
  FR.	
  Sudden	
  infant	
  death	
  syndrome.	
  CMAJ.	
  2006	
  Jun	
  20;174(13):1861– 1869.	
  	
   	
   43.	
   Rusen	
  ID,	
  Liu	
  S,	
  Sauve	
  R,	
  Joseph	
  KS,	
  Kramer	
  MS.	
  Sudden	
  infant	
  death	
  syndrome	
  in	
   Canada:	
  trends	
  in	
  rates	
  and	
  risk	
  factors,	
  1985-­‐1998.	
  Chronic	
  Dis	
  Can.	
  2004;25(1):1-­‐6.	
  	
   	
   44.	
   Causey	
  TN,	
  Bodurtha	
  JN,	
  Ford	
  N.	
  A	
  genetic	
  perspective	
  on	
  infant	
  mortality.	
  South	
  Med	
   J	
  [Internet].	
  2010	
  Apr	
  6	
  [cited	
  2010	
  Apr	
  19];Available	
  from:	
   http://www.ncbi.nlm.nih.gov/pubmed/20375941	
   	
   45.	
   Mitchell	
  EA.	
  What	
  is	
  the	
  mechanism	
  of	
  SIDS?	
  Clues	
  from	
  epidemiology.	
  Dev	
   Psychobiol.	
  2009	
  Apr;51(3):215-­‐222.	
  	
   	
   46.	
   Malloy	
  MH,	
  Hoffman	
  HJ.	
  Prematurity,	
  sudden	
  infant	
  death	
  syndrome,	
  and	
  age	
  of	
   death.	
  Pediatrics.	
  1995	
  Sep	
  1;96(3):464-­‐471.	
  	
   	
   47.	
   Hunt	
  CE.	
  Sudden	
  infant	
  death	
  syndrome	
  and	
  other	
  causes	
  of	
  infant	
  mortality.	
   Diagnosis,	
  mechanisms,	
  and	
  risk	
  for	
  recurrence	
  in	
  siblings.	
  Am.	
  J.	
  Respir.	
  Crit.	
  Care	
   Med.	
  2001	
  Aug	
  1;164(3):346-­‐357.	
  	
   	
   48.	
   Glasgow	
  J,	
  Thompson	
  A,	
  Ingram	
  P.	
  Sudden	
  unexpected	
  death	
  in	
  infancy:	
  place	
  and	
   time	
  of	
  death.	
  Ulster	
  Med	
  J.	
  2006	
  Jan;75(1):65-­‐71.	
  	
   	
   49.	
   Lahr	
  M,	
  Rosenberg	
  K,	
  Lapidus	
  J.	
  Maternal-­‐Infant	
  Bedsharing:	
  Risk	
  Factors	
  for	
   Bedsharing	
  in	
  a	
  Population-­‐Based	
  Survey	
  of	
  New	
  Mothers	
  and	
  Implications	
  for	
  SIDS	
   	
    77	
    Risk	
  Reduction.	
  Maternal	
  and	
  Child	
  Health	
  Journal.	
  2007	
  May	
  1;11(3):277-­‐286.	
  	
   	
   50.	
   Escott	
  A,	
  Elder	
  DE,	
  Zuccollo	
  JM.	
  Sudden	
  unexpected	
  infant	
  death	
  and	
  bedsharing:	
   referrals	
  to	
  the	
  Wellington	
  Coroner	
  1997-­‐2006.	
  N.	
  Z.	
  Med.	
  J.	
  2009;122(1298):59-­‐68.	
  	
   	
   51.	
   Landi	
  K,	
  Gutierrez	
  C,	
  Sampson	
  B,	
  Harruff	
  R,	
  Rubio	
  I,	
  Balbela	
  B,	
  et	
  al.	
  Investigation	
  of	
  the	
   sudden	
  death	
  of	
  infants:	
  a	
  multicenter	
  analysis.	
  Pediatr.	
  Dev.	
  Pathol.	
  2005	
   Dec;8(6):630-­‐638.	
  	
   	
   52.	
   Mage	
  DT.	
  Seasonality	
  of	
  SIDS	
  in	
  Canada	
  between	
  1985-­‐1989	
  and	
  1994-­‐1998.	
  Chronic	
   Dis	
  Can.	
  2005;26(4):121-­‐122;	
  author	
  reply	
  123.	
  	
   	
   53.	
   Walter	
  SD.	
  Seasonality	
  of	
  SIDS	
  in	
  Canada.	
  Chronic	
  Dis	
  Can.	
  2006;27(2):92-­‐93.	
  	
   	
   54.	
   Möllborg	
  P,	
  Alm	
  B.	
  Sudden	
  infant	
  death	
  syndrome	
  during	
  low	
  incidence	
  in	
  Sweden	
   1997-­‐2005.	
  Acta	
  Paediatr.	
  2010	
  Jan;99(1):94-­‐98.	
  	
   	
   55.	
   Blair	
  PS,	
  Sidebotham	
  P,	
  Evason-­‐Coombe	
  C,	
  Edmonds	
  M,	
  Heckstall-­‐Smith	
  EMA,	
  Fleming	
   P.	
  Hazardous	
  cosleeping	
  environments	
  and	
  risk	
  factors	
  amenable	
  to	
  change:	
  case-­‐ control	
  study	
  of	
  SIDS	
  in	
  south	
  west	
  England.	
  BMJ.	
  2009;339:b3666.	
  	
   	
   56.	
   Banerji	
  A,	
  Greenberg	
  D,	
  White	
  LF,	
  Macdonald	
  WA,	
  Saxton	
  A,	
  Thomas	
  E,	
  et	
  al.	
  Risk	
   factors	
  and	
  viruses	
  associated	
  with	
  hospitalization	
  due	
  to	
  lower	
  respiratory	
  tract	
   infections	
  in	
  Canadian	
  Inuit	
  children	
  :	
  a	
  case-­‐control	
  study.	
  Pediatr.	
  Infect.	
  Dis.	
  J.	
  2009	
   Aug;28(8):697-­‐701.	
  	
   	
   57.	
   Banerji	
  A,	
  Bell	
  A,	
  Mills	
  EL,	
  McDonald	
  J,	
  Subbarao	
  K,	
  Stark	
  G,	
  et	
  al.	
  Lower	
  respiratory	
   tract	
  infections	
  in	
  Inuit	
  infants	
  on	
  Baffin	
  Island.	
  CMAJ.	
  2001	
  Jun	
  26;164(13):1847-­‐1850.	
  	
   	
   58.	
   Arnestad	
  M,	
  Crotti	
  L,	
  Rognum	
  TO,	
  Insolia	
  R,	
  Pedrazzini	
  M,	
  Ferrandi	
  C,	
  et	
  al.	
  Prevalence	
   	
    78	
    of	
  Long-­‐QT	
  syndrome	
  gene	
  variants	
  in	
  sudden	
  infant	
  death	
  syndrome.	
  Circulation.	
   2007	
  Jan	
  23;115(3):361-­‐367.	
  	
   	
   59.	
   Schwartz	
  PJ,	
  Stramba-­‐Badiale	
  M,	
  Segantini	
  A,	
  Austoni	
  P,	
  Bosi	
  G,	
  Giorgetti	
  R,	
  et	
  al.	
   Prolongation	
  of	
  the	
  QT	
  Interval	
  and	
  the	
  sudden	
  infant	
  death	
  yyndrome.	
  N	
  Engl	
  J	
  Med.	
   1998	
  Jun	
  11;338(24):1709-­‐1714.	
  	
   	
   60.	
   Chace	
  DH,	
  DiPerna	
  JC,	
  Mitchell	
  BL,	
  Sgroi	
  B,	
  Hofman	
  LF,	
  Naylor	
  EW.	
  Electrospray	
   tandem	
  mass	
  spectrometry	
  for	
  analysis	
  of	
  acylcarnitines	
  in	
  dried	
  postmortem	
  blood	
   specimens	
  collected	
  at	
  autopsy	
  from	
  infants	
  with	
  unexplained	
  cause	
  of	
  death.	
  Clin.	
   Chem.	
  2001;47(7):1166-­‐1182.	
  	
   	
   61.	
   Boles	
  RG,	
  Buck	
  EA,	
  Blitzer	
  MG,	
  Platt	
  MS,	
  Cowan	
  TM,	
  Martin	
  SK,	
  et	
  al.	
  Retrospective	
   biochemical	
  screening	
  of	
  fatty	
  acid	
  oxidation	
  disorders	
  in	
  postmortem	
  livers	
  of	
  418	
   cases	
  of	
  sudden	
  death	
  in	
  the	
  first	
  year	
  of	
  life.	
  J	
  Pediatr.	
  1998	
  Jun;132(6):924-­‐33.	
  	
   	
   62.	
   Kompare	
  M,	
  Rizzo	
  WB.	
  Mitochondrial	
  fatty-­‐acid	
  oxidation	
  disorders.	
  Semin	
  Pediatr	
   Neurol.	
  2008	
  Sep;15(3):140-­‐149.	
  	
   	
   63.	
   Bonnefont	
  J,	
  Demaugre	
  F,	
  Prip-­‐Buus	
  C,	
  Saudubray	
  JM,	
  Brivet	
  M,	
  Abadi	
  N,	
  et	
  al.	
   Carnitine	
  palmitoyltransferase	
  deficiencies.	
  Mol	
  Genet	
  Metab.	
  1999	
  Dec;68(4):424-­‐ 440.	
  	
   	
   64.	
   Prasad	
  C,	
  Johnson	
  JP,	
  Bonnefont	
  J,	
  Dilling	
  LA,	
  Innes	
  AM,	
  Haworth	
  JC,	
  et	
  al.	
  Hepatic	
   carnitine	
  palmitoyl	
  transferase	
  1	
  (CPT1	
  A)	
  deficiency	
  in	
  North	
  American	
  Hutterites	
   (Canadian	
  and	
  American):	
  evidence	
  for	
  a	
  founder	
  effect	
  and	
  results	
  of	
  a	
  pilot	
  study	
  on	
   a	
  DNA-­‐based	
  newborn	
  screening	
  program.	
  Mol	
  Genet	
  Metab.	
  2001	
  May;73(1):55-­‐63.	
  	
   	
   65.	
   Brown	
  NF,	
  Mullur	
  RS,	
  Subramanian	
  I,	
  Esser	
  V,	
  Bennett	
  MJ,	
  Saudubray	
  J,	
  et	
  al.	
   Molecular	
  characterization	
  of	
  L-­‐CPT	
  I	
  deficiency	
  in	
  six	
  patients:	
  insights	
  into	
  function	
  of	
   the	
  native	
  enzyme.	
  J	
  Lipid	
  Res.	
  2001	
  Jul	
  1;42(7):1134-­‐1142.	
  	
   	
   	
    79	
    66.	
   Koeller	
  DM.	
  Carnitine	
  palmitoyltransferase	
  1A	
  deficiency	
  &	
  newborn	
  screening:	
   Implications	
  for	
  public	
  health	
  [abstract].	
  Mol	
  Genet	
  Metab.	
  2008	
  Mar	
  2;93:229.	
  	
   	
   67.	
   Bennett	
  MJ,	
  Boriack	
  RL,	
  Narayan	
  SB,	
  Rutledge	
  SL,	
  Raff	
  ML.	
  Novel	
  mutations	
  in	
  CPT	
  1A	
   define	
  molecular	
  heterogeneity	
  of	
  hepatic	
  carnitine	
  palmitoyltransferase	
  I	
  deficiency.	
   Mol	
  Genet	
  Metab.	
  2004	
  May;82(1):59-­‐63.	
  	
   	
   68.	
   Gobin	
  S,	
  Bonnefont	
  J,	
  Prip-­‐Buus	
  C,	
  Mugnier	
  C,	
  Ferrec	
  M,	
  Demaugre	
  F,	
  et	
  al.	
   Organization	
  of	
  the	
  human	
  liver	
  carnitine	
  palmitoyltransferase	
  1	
  gene	
  (CPT1A)	
  and	
   identification	
  of	
  novel	
  mutations	
  in	
  hypoketotic	
  hypoglycaemia.	
  ASHG	
  Annual	
   Meeting.	
  2002;111(2):179-­‐189.	
  	
   	
   69.	
   Korman	
  SH,	
  Waterham	
  HR,	
  Gutman	
  A,	
  Jakobs	
  C,	
  Wanders	
  RJA.	
  Novel	
  metabolic	
  and	
   molecular	
  findings	
  in	
  hepatic	
  carnitine	
  palmitoyltransferase	
  I	
  deficiency.	
  Mol.	
  Genet.	
   Metab.	
  2005	
  Nov;86(3):337-­‐343.	
  	
   	
   70.	
   McGarry	
  JD,	
  Mannaerts	
  GP,	
  Foster	
  DW.	
  A	
  possible	
  role	
  for	
  malonyl-­‐CoA	
  in	
  the	
   regulation	
  of	
  hepatic	
  fatty	
  acid	
  oxidation	
  and	
  ketogenesis.	
  J	
  Clin	
  Invest.	
  1977	
   Jul;60(1):265–270.	
  	
   	
   71.	
   Ibdah	
  J.	
  Acute	
  fatty	
  liver	
  of	
  pregnancy:	
  an	
  update	
  on	
  pathogenesis	
  and	
  clinical	
   implications.	
  World	
  J.	
  Gastroenterol.	
  2006	
  Dec	
  14;12(46):7397-­‐7404.	
  	
   	
   72.	
   Zechner	
  R,	
  Kienesberger	
  PC,	
  Haemmerle	
  G,	
  Zimmermann	
  R,	
  Lass	
  A.	
  Adipose	
   triglyceride	
  lipase	
  and	
  the	
  lipolytic	
  catabolism	
  of	
  cellular	
  fat	
  stores.	
  J.	
  Lipid	
  Res.	
  2009	
   Jan;50(1):3-­‐21.	
  	
   	
   73.	
   McGarry	
  JD,	
  Brown	
  NF.	
  The	
  mitochondrial	
  carnitine	
  palmitoyltransferase	
  system.	
  From	
   concept	
  to	
  molecular	
  analysis.	
  Eur	
  J	
  Biochem.	
  1997	
  Feb	
  15;244(1):1-­‐14.	
  	
   	
   74.	
   Bougnères	
  PF,	
  Saudubray	
  JM,	
  Marsac	
  C,	
  Bernard	
  O,	
  Odièvre	
  M,	
  Girard	
  J.	
  Fasting	
   hypoglycemia	
  resulting	
  from	
  hepatic	
  carnitine	
  palmitoyl	
  transferase	
  deficiency.	
  J	
   	
    80	
    Pediatr.	
  1981	
  May;98(5):742-­‐6.	
  	
   	
   75.	
   Price	
  N,	
  van	
  der	
  Leij	
  F,	
  Jackson	
  V,	
  Corstorphine	
  C,	
  Thomson	
  R,	
  Sorensen	
  A,	
  et	
  al.	
  A	
   novel	
  brain-­‐expressed	
  protein	
  related	
  to	
  carnitine	
  palmitoyltransferase	
  I.	
  Genomics.	
   2002	
  Oct;80(4):433-­‐442.	
  	
   	
   76.	
   Britton	
  CH,	
  Mackey	
  DW,	
  Esser	
  V,	
  Foster	
  DW,	
  Burns	
  DK,	
  Yarnall	
  DP,	
  et	
  al.	
  Fine	
   chromosome	
  mapping	
  of	
  the	
  genes	
  for	
  human	
  liver	
  and	
  muscle	
  carnitine	
   palmitoyltransferase	
  I	
  (CPT1A	
  and	
  CPT1B).	
  Genomics.	
  1997	
  Feb	
  15;40(1):209-­‐211.	
  	
   	
   77.	
   Morillas	
  M,	
  Gomez-­‐Puertas	
  P,	
  Roca	
  R,	
  Serra	
  D,	
  Asins	
  G,	
  Valencia	
  A,	
  et	
  al.	
  Structural	
   model	
  of	
  the	
  catalytic	
  core	
  of	
  carnitine	
  palmitoyltransferase	
  I	
  and	
  carnitine	
   octanoyltransferase	
  (COT):	
  mutation	
  of	
  CPT	
  I	
  histidine	
  473	
  and	
  alanine	
  381	
  and	
  COT	
   alanine	
  238	
  impairs	
  the	
  catalytic	
  activity.	
  J	
  Biol	
  Chem.	
  2001	
  Nov	
  30;276(48):45001-­‐ 45008.	
  	
   	
   78.	
   Obici	
  S,	
  Feng	
  Z,	
  Arduini	
  A,	
  Conti	
  R,	
  Rossetti	
  L.	
  Inhibition	
  of	
  hypothalamic	
  carnitine	
   palmitoyltransferase-­‐1	
  decreases	
  food	
  intake	
  and	
  glucose	
  production.	
  Nat	
  Med.	
  2003	
   Jun;9(6):756-­‐761.	
  	
   	
   79.	
   Cook	
  GA,	
  Edwards	
  TL,	
  Jansen	
  MS,	
  Bahouth	
  SW,	
  Wilcox	
  HG,	
  Park	
  EA.	
  Differential	
   regulation	
  of	
  carnitine	
  palmitoyltransferase-­‐I	
  gene	
  isoforms	
  (CPT-­‐I	
  alpha	
  and	
  CPT-­‐I	
   beta)	
  in	
  the	
  rat	
  heart.	
  J.	
  Mol.	
  Cell.	
  Cardiol.	
  2001	
  Feb;33(2):317-­‐329.	
  	
   	
   80.	
   Lane	
  MD,	
  Wolfgang	
  M,	
  Cha	
  S,	
  Dai	
  Y.	
  Regulation	
  of	
  food	
  intake	
  and	
  energy	
  expenditure	
   by	
  hypothalamic	
  malonyl-­‐CoA.	
  Int	
  J	
  Obes	
  (Lond).	
  2008	
  Sep;32	
  Suppl	
  4:S49-­‐54.	
  	
   	
   81.	
   Sierra	
  AY,	
  Gratacos	
  E,	
  Carrasco	
  P,	
  Clotet	
  J,	
  Urena	
  J,	
  Serra	
  D,	
  et	
  al.	
  CPT1c	
  is	
  localized	
  in	
   endoplasmic	
  reticulum	
  of	
  neurons	
  and	
  has	
  carnitine	
  palmitoyltransferase	
  activity.	
  J.	
   Biol.	
  Chem.	
  2008	
  Mar	
  14;283(11):6878-­‐85.	
  	
   	
   82.	
   Wolfgang	
  MJ,	
  Lane	
  MD.	
  Control	
  of	
  energy	
  homeostasis:	
  role	
  of	
  enzymes	
  and	
   	
    81	
    intermediates	
  of	
  fatty	
  acid	
  metabolism	
  in	
  the	
  central	
  nervous	
  system.	
  Annu	
  Rev	
  Nutr.	
   2006;26:23-­‐44.	
  	
   	
   83.	
   Bonnefont	
  J,	
  Djouadi	
  F,	
  Prip-­‐Buus	
  C,	
  Gobin	
  S,	
  Munnich	
  A,	
  Bastin	
  J.	
  Carnitine	
   palmitoyltransferases	
  1	
  and	
  2:	
  biochemical,	
  molecular	
  and	
  medical	
  aspects.	
  Mol	
   Aspects	
  Med.	
  2004	
  Dec;25(5-­‐6):495-­‐520.	
  	
   	
   84.	
   Park	
  EA,	
  Mynatt	
  RL,	
  Cook	
  GA,	
  Kashfi	
  K.	
  Insulin	
  regulates	
  enzyme	
  activity,	
  malonyl-­‐CoA	
   sensitivity	
  and	
  mRNA	
  abundance	
  of	
  hepatic	
  carnitine	
  palmitoyltransferase-­‐I.	
  Biochem.	
   J.	
  1995	
  Sep	
  15;310	
  (	
  Pt	
  3):853-­‐858.	
  	
   	
   85.	
   Chatelain	
  F,	
  Kohl	
  C,	
  Esser	
  V,	
  McGarry	
  JD,	
  Girard	
  J,	
  Pegorier	
  JP.	
  Cyclic	
  AMP	
  and	
  fatty	
   acids	
  increase	
  carnitine	
  palmitoyltransferase	
  I	
  gene	
  transcription	
  in	
  cultured	
  fetal	
  rat	
   hepatocytes.	
  Eur.	
  J.	
  Biochem.	
  1996	
  Feb	
  1;235(3):789-­‐798.	
  	
   	
   86.	
   Hu	
  Z,	
  Dai	
  Y,	
  Prentki	
  M,	
  Chohnan	
  S,	
  Lane	
  MD.	
  A	
  role	
  for	
  hypothalamic	
  malonyl-­‐CoA	
  in	
   the	
  control	
  of	
  food	
  intake.	
  J	
  Biol	
  Chem.	
  2005	
  Dec	
  2;280(48):39681-­‐3.	
  	
   	
   87.	
   Fingerhut	
  R,	
  Röschinger	
  W,	
  Muntau	
  AC,	
  Dame	
  T,	
  Kreischer	
  J,	
  Arnecke	
  R,	
  et	
  al.	
  Hepatic	
   carnitine	
  palmitoyltransferase	
  I	
  deficiency:	
  acylcarnitine	
  profiles	
  in	
  blood	
  spots	
  are	
   highly	
  specific.	
  Clin	
  Chem.	
  2001	
  Oct;47(10):1763-­‐1768.	
  	
   	
   88.	
   Gobin	
  S,	
  Thuillier	
  L,	
  Jogl	
  G,	
  Faye	
  A,	
  Tong	
  L,	
  Chi	
  M,	
  et	
  al.	
  Functional	
  and	
  structural	
  basis	
   of	
  carnitine	
  palmitoyltransferase	
  1A	
  deficiency.	
  J.	
  Biol.	
  Chem.	
  2003	
  Dec	
   12;278(50):50428-­‐50434.	
  	
   	
   89.	
   Dowell	
  P,	
  Hu	
  Z,	
  Lane	
  MD.	
  Monitoring	
  energy	
  balance:	
  metabolites	
  of	
  fatty	
  acid	
   synthesis	
  as	
  hypothalamic	
  sensors.	
  Annu.	
  Rev.	
  Biochem.	
  2005;74:515-­‐534.	
  	
   	
   90.	
   Innes	
  AM,	
  Seargeant	
  LE,	
  Balachandra	
  K,	
  Roe	
  CR,	
  Wanders	
  RJ,	
  Ruiter	
  JP,	
  et	
  al.	
  Hepatic	
   carnitine	
  palmitoyltransferase	
  I	
  deficiency	
  presenting	
  as	
  maternal	
  illness	
  in	
  pregnancy.	
   Pediatr	
  Res.	
  2000	
  Jan;47(1):43-­‐45.	
  	
   	
    82	
    91.	
   Morillas	
  M,	
  Gomez-­‐Puertas	
  P,	
  Rubí	
  B,	
  Clotet	
  J,	
  Ariño	
  J,	
  Valencia	
  A,	
  et	
  al.	
  Structural	
   model	
  of	
  a	
  malonyl-­‐CoA-­‐binding	
  site	
  of	
  carnitine	
  octanoyltransferase	
  and	
  carnitine	
   palmitoyltransferase	
  I:	
  mutational	
  analysis	
  of	
  a	
  malonyl-­‐CoA	
  affinity	
  domain.	
  J	
  Biol	
   Chem.	
  2002	
  Mar	
  29;277(13):11473-­‐11480.	
  	
   	
   92.	
   Harris	
  WS.	
  Fish	
  oils	
  and	
  plasma	
  lipid	
  and	
  lipoprotein	
  metabolism	
  in	
  humans:	
  a	
  critical	
   review.	
  J.	
  Lipid	
  Res.	
  1989	
  Jun;30(6):785-­‐807.	
  	
   	
   93.	
   Zhang	
  J,	
  Wang	
  C,	
  Terroni	
  PL,	
  Cagampang	
  FRA,	
  Hanson	
  M,	
  Byrne	
  CD.	
  High-­‐unsaturated-­‐ fat,	
  high-­‐protein,	
  and	
  low-­‐carbohydrate	
  diet	
  during	
  pregnancy	
  and	
  lactation	
  modulates	
   hepatic	
  lipid	
  metabolism	
  in	
  female	
  adult	
  offspring.	
  Am.	
  J.	
  Physiol.	
  Regul.	
  Integr.	
  Comp.	
   Physiol.	
  2005	
  Jan;288(1):R112-­‐118.	
  	
   	
   94.	
   Gessner	
  BD,	
  Gillingham	
  MB,	
  Birch	
  S,	
  Wood	
  T,	
  Koeller	
  DM.	
  Evidence	
  for	
  an	
  association	
   between	
  infant	
  mortality	
  and	
  a	
  carnitine	
  palmitoyltransferase	
  1A	
  genetic	
  variant.	
   Pediatrics	
  [Internet].	
  2010	
  Oct	
  11	
  [cited	
  2010	
  Nov	
  1];Available	
  from:	
   http://www.ncbi.nlm.nih.gov/pubmed/20937660	
   	
   95.	
   Child	
  Death	
  Review	
  Unit,	
  BC	
  Coroners	
  Service.	
  Safe	
  and	
  sound:	
  a	
  five	
  year	
   retrospective	
  on	
  sudden	
  infant	
  death	
  in	
  sleep-­‐related	
  circumstances	
  [Internet].	
  	
  2009	
   [cited	
  2010	
  Apr	
  27].	
  Available	
  from:	
  http://www.pssg.gov.bc.ca/coroners/child-­‐death-­‐ review/index.htm	
   	
   96.	
   Wilson	
  JM,	
  Jungner	
  YG.	
  Principles	
  and	
  practice	
  of	
  mass	
  screening	
  for	
  disease.	
  Bol	
   Oficina	
  Sanit	
  Panam.	
  1968	
  Oct;65(4):281-­‐393.	
  	
   	
   97.	
   Andermann	
  A,	
  Blancquaert	
  I,	
  Beauchamp	
  S,	
  Déry	
  V.	
  Revisiting	
  Wilson	
  and	
  Jungner	
  in	
   the	
  genomic	
  age:	
  a	
  review	
  of	
  screening	
  criteria	
  over	
  the	
  past	
  40	
  years.	
  Bull.	
  World	
   Health	
  Organ.	
  2008	
  Apr;86(4):317-­‐319.	
  	
   	
   98.	
   Newborn	
  screening:	
  toward	
  a	
  uniform	
  screening	
  panel	
  and	
  system-­‐-­‐executive	
   summary.	
  Pediatrics.	
  2006	
  May;117(5	
  Pt	
  2):S296-­‐307.	
  	
   	
    83	
    99.	
   Orzalesi	
  M,	
  Danhaive	
  O.	
  Ethical	
  problems	
  with	
  neonatal	
  screening.	
  Ann.	
  Ist.	
  Super.	
   Sanita.	
  2009;45(3):325-­‐330.	
  	
   	
   100.	
   Wilcken	
  B,	
  Wiley	
  V.	
  Newborn	
  screening.	
  Pathology.	
  2008	
  Feb;40(2):104-­‐115.	
  	
   	
   101.	
   Prip-­‐Buus	
  C,	
  Thuillier	
  L,	
  Abadi	
  N,	
  Prasad	
  C,	
  Dilling	
  L,	
  Klasing	
  J,	
  et	
  al.	
  Molecular	
  and	
   enzymatic	
  characterization	
  of	
  a	
  unique	
  carnitine	
  palmitoyltransferase	
  1A	
  mutation	
  in	
   the	
  Hutterite	
  community.	
  Mol	
  Genet	
  Metab.	
  2001	
  May;73(1):46-­‐54.	
  	
   	
   102.	
   Seargeant	
  LE,	
  Stier	
  A,	
  Prasad	
  C,	
  Grewar	
  DA,	
  Chan	
  A,	
  Bamforth	
  F,	
  et	
  al.	
  Preliminary	
   evidence	
  for	
  high	
  frequency	
  of	
  combined	
  CPT1	
  and	
  CPT2	
  mutations	
  in	
  the	
  Canadian	
   Inuit	
  [abstract].	
  J	
  Inherit	
  Metab	
  Dis.	
  2003	
  Jan	
  1;26(Suppl	
  2):97.	
  	
   	
   103.	
   Dewailly	
  E,	
  Blanchet	
  C,	
  Lemieux	
  S,	
  Sauvé	
  L,	
  Gingras	
  S,	
  Ayotte	
  P,	
  et	
  al.	
  n-­‐3	
  Fatty	
  acids	
   and	
  cardiovascular	
  disease	
  risk	
  factors	
  among	
  the	
  Inuit	
  of	
  Nunavik.	
  Am	
  J	
  Clin	
  Nutr.	
   2001	
  Oct;74(4):464-­‐473.	
  	
   	
   104.	
   Guèvremont	
  A,	
  Kohen	
  D.	
  Inuit	
  Children's	
  Health:	
  A	
  Report	
  Using	
  the	
  2001	
  Aboriginal	
   Peoples	
  Survey	
  (Children	
  and	
  Youth	
  Component)	
  [Internet].	
  	
  Statistics	
  Canada;	
  2007	
   [cited	
  2009	
  Nov	
  17].	
  Available	
  from:	
  http://www.statcan.gc.ca/pub/89-­‐627-­‐x/89-­‐627-­‐ x2007003-­‐eng.htm	
   	
   105.	
   Collins	
  SA,	
  Sinclair	
  G,	
  McIntosh	
  S,	
  Bamforth	
  F,	
  Thompson	
  R,	
  Sobol	
  I,	
  et	
  al.	
  Carnitine	
   palmitoyltransferase	
  1A	
  (CPT1A)	
  P479L	
  prevalence	
  in	
  live	
  newborns	
  in	
  Yukon,	
   Northwest	
  Territories,	
  and	
  Nunavut.	
  Mol.	
  Genet.	
  Metab.	
  2010	
  Nov;101(2-­‐3):200-­‐204.	
  	
   	
   106.	
   Tomashek	
  KM,	
  Shapiro-­‐Mendoza	
  CK,	
  Davidoff	
  MJ,	
  Petrini	
  JR.	
  Differences	
  in	
  mortality	
   between	
  late-­‐preterm	
  and	
  term	
  singleton	
  infants	
  in	
  the	
  United	
  States,	
  1995-­‐2002.	
  J.	
   Pediatr.	
  2007	
  Nov;151(5):450-­‐456,	
  456.e1.	
  	
   	
   107.	
   Kramer	
  MS,	
  Demissie	
  K,	
  Yang	
  H,	
  Platt	
  RW,	
  Sauvé	
  R,	
  Liston	
  R.	
  The	
  contribution	
  of	
  mild	
   and	
  moderate	
  preterm	
  birth	
  to	
  infant	
  mortality.	
  Fetal	
  and	
  Infant	
  Health	
  Study	
  Group	
   	
    84	
    of	
  the	
  Canadian	
  Perinatal	
  Surveillance	
  System.	
  JAMA.	
  2000	
  Aug	
  16;284(7):843-­‐849.	
  	
   	
   108.	
   Ostfeld	
  BM,	
  Esposito	
  L,	
  Perl	
  H,	
  Hegyi	
  T.	
  Concurrent	
  risks	
  in	
  sudden	
  infant	
  death	
   syndrome.	
  Pediatrics.	
  2010	
  Mar	
  1;125(3):447-­‐453.	
  	
   	
   109.	
   Public	
  Health	
  Agency	
  of	
  Canada.	
  What	
  Mothers	
  Say:	
  The	
  Maternity	
  Experiences	
  Survey	
   [Internet].	
  	
  Ottawa:	
  2009	
  [cited	
  2010	
  Jun	
  8].	
  Available	
  from:	
  http://www.phac-­‐ aspc.gc.ca/rhs-­‐ssg/survey-­‐eng.php	
   	
   110.	
   Kovesi	
  T,	
  Creery	
  D,	
  Gilbert	
  NL,	
  Dales	
  R,	
  Fugler	
  D,	
  Thompson	
  B,	
  et	
  al.	
  Indoor	
  air	
  quality	
   risk	
  factors	
  for	
  severe	
  lower	
  respiratory	
  tract	
  infections	
  in	
  Inuit	
  infants	
  in	
  Baffin	
   Region,	
  Nunavut:	
  a	
  pilot	
  study.	
  Indoor	
  Air.	
  2006	
  Aug;16(4):266-­‐275.	
  	
   	
   111.	
   Mehaffey	
  K,	
  Higginson	
  A,	
  Cowan	
  J,	
  Osborne	
  GM,	
  Arbour	
  LT.	
  Maternal	
  smoking	
  at	
  first	
   prenatal	
  visit	
  as	
  a	
  marker	
  of	
  risk	
  for	
  adverse	
  pregnancy	
  outcomes	
  in	
  the	
  Qikiqtaaluk	
   (Baffin)	
  Region.	
  Rural	
  Remote	
  Health.	
  2010	
  Sep;10(3):1484.	
  	
   	
   112.	
   Task	
  Force	
  on	
  Sudden	
  Infant	
  Death	
  Syndrome.	
  The	
  changing	
  concept	
  of	
  sudden	
  infant	
   death	
  syndrome:	
  diagnostic	
  coding	
  shifts,	
  controversies	
  Regarding	
  the	
  sleeping	
   environment,	
  and	
  new	
  variables	
  to	
  consider	
  in	
  reducing	
  risk.	
  Pediatrics.	
  2005	
  Nov	
   1;116(5):1245-­‐1255.	
  	
   	
   113.	
   Blair	
  PS,	
  Platt	
  MW,	
  Smith	
  IJ,	
  Fleming	
  PJ.	
  Sudden	
  infant	
  death	
  syndrome	
  and	
  sleeping	
   position	
  in	
  pre-­‐term	
  and	
  low	
  birth	
  weight	
  infants:	
  an	
  opportunity	
  for	
  targeted	
   intervention.	
  Arch	
  Dis	
  Child.	
  2006	
  Feb;91(2):101-­‐106.	
  	
   	
   114.	
   Waalen	
  J,	
  Beutler	
  E.	
  Genetic	
  Screening	
  for	
  Low-­‐Penetrance	
  Variants	
  in	
  Protein-­‐Coding	
   Genes.	
  Annu.	
  Rev.	
  Genom.	
  Human	
  Genet.	
  2009	
  9;10(1):431-­‐450.	
  	
   	
   115.	
   Smylie	
  J,	
  Kaplan-­‐Myrth	
  N,	
  McShane	
  K.	
  Indigenous	
  knowledge	
  translation:	
  baseline	
   findings	
  in	
  a	
  qualitative	
  study	
  of	
  the	
  pathways	
  of	
  health	
  knowledge	
  in	
  three	
  indigenous	
   communities	
  in	
  Canada.	
  Health	
  Promot	
  Pract.	
  2009	
  Jul;10(3):436-­‐446.	
  	
   	
    85	
    116.	
   Harrell	
  H.	
  Currents	
  in	
  contemporary	
  ethics:	
  the	
  role	
  of	
  parents	
  in	
  expanded	
  newborn	
   screening.	
  J	
  Law	
  Med	
  Ethics.	
  2009;37(4):846-­‐851.	
  	
   	
   117.	
   Faulkner	
  LA,	
  Feuchtbaum	
  LB,	
  Graham	
  S,	
  Bolstad	
  JP,	
  Cunningham	
  GC.	
  The	
  newborn	
   screening	
  educational	
  gap:	
  what	
  prenatal	
  care	
  providers	
  do	
  compared	
  with	
  what	
  is	
   expected.	
  American	
  Journal	
  of	
  Obstetrics	
  and	
  Gynecology.	
  2006	
  Jan;194(1):131-­‐137.	
  	
   	
   118.	
   Yusupov	
  R,	
  Finegold	
  DN,	
  Naylor	
  EW,	
  Sahai	
  I,	
  Waisbren	
  S,	
  Levy	
  HL.	
  Sudden	
  death	
  in	
   medium	
  chain	
  acyl-­‐coenzyme	
  a	
  dehydrogenase	
  deficiency	
  (MCADD)	
  despite	
  newborn	
   screening.	
  Mol	
  Genet	
  Metab	
  [Internet].	
  2010	
  Jun	
  9	
  [cited	
  2010	
  Jul	
  23];Available	
  from:	
   http://www.ncbi.nlm.nih.gov/pubmed/20580581	
   	
   119.	
   Zeitlin	
  J,	
  Draper	
  ES,	
  Kollee	
  L,	
  Milligan	
  D,	
  Boerch	
  K,	
  Agostino	
  R,	
  et	
  al.	
  Differences	
  in	
  rates	
   and	
  short-­‐term	
  outcome	
  of	
  live	
  births	
  before	
  32	
  weeks	
  of	
  gestation	
  in	
  Europe	
  in	
  2003:	
   results	
  from	
  the	
  MOSAIC	
  cohort.	
  Pediatrics.	
  2008	
  Apr;121(4):e936-­‐944.	
  	
   	
   120.	
   Goldenberg	
  RL,	
  Culhane	
  JF,	
  Iams	
  JD,	
  Romero	
  R.	
  Epidemiology	
  and	
  causes	
  of	
  preterm	
   birth.	
  Lancet.	
  2008	
  Jan	
  5;371(9606):75-­‐84.	
  	
   	
   121.	
   Heaman	
  MI,	
  Blanchard	
  JF,	
  Gupton	
  AL,	
  Moffatt	
  MEK,	
  Currie	
  RF.	
  Risk	
  factors	
  for	
   spontaneous	
  preterm	
  birth	
  among	
  Aboriginal	
  and	
  non-­‐Aboriginal	
  women	
  in	
  Manitoba.	
   Paediatr	
  Perinat	
  Epidemiol.	
  2005	
  May;19(3):181-­‐193.	
  	
   	
   122.	
   Mook-­‐Kanamori	
  DO,	
  Steegers	
  EAP,	
  Eilers	
  PH,	
  Raat	
  H,	
  Hofman	
  A,	
  Jaddoe	
  VWV.	
  Risk	
   factors	
  and	
  outcomes	
  associated	
  with	
  first-­‐trimester	
  fetal	
  growth	
  restriction.	
  JAMA.	
   2010	
  Feb	
  10;303(6):527-­‐534.	
  	
   	
   123.	
   Canadian	
  Paediatric	
  Society.	
  Recommendations	
  for	
  safe	
  sleeping	
  environments	
  for	
   infants	
  and	
  children.	
  Paediatr	
  Child	
  Health.	
  2004	
  Nov;9(9):659-­‐663.	
  	
   	
   124.	
   Kermode-­‐Scott	
  B.	
  Rates	
  of	
  infant	
  mortality	
  higher	
  among	
  indigenous	
  children	
  in	
   Canada,	
  the	
  US,	
  Australia,	
  and	
  New	
  Zealand.	
  BMJ.	
  2009	
  4;338(apr02	
  1):b1379-­‐b1379.	
  	
   	
    86	
    125.	
   Hill	
  K,	
  Barker	
  B,	
  Vos	
  T.	
  Excess	
  Indigenous	
  mortality:	
  are	
  Indigenous	
  Australians	
  more	
   severely	
  disadvantaged	
  than	
  other	
  Indigenous	
  populations?	
  Int	
  J	
  Epidemiol.	
  2007	
   Jun;36(3):580-­‐589.	
  	
   	
   126.	
   Trovato	
  F.	
  Aboriginal	
  mortality	
  in	
  Canada,	
  the	
  United	
  States	
  and	
  New	
  Zealand.	
  J	
  Biosoc	
   Sci.	
  2001	
  Jan;33(1):67-­‐86.	
  	
   	
   127.	
   Mathews	
  TJ,	
  MacDorman	
  MF.	
  Infant	
  mortality	
  statistics	
  from	
  the	
  2004	
  period	
  linked	
   birth/infant	
  death	
  data	
  set.	
  Natl	
  Vital	
  Stat	
  Rep.	
  2007	
  May	
  2;55(14):1-­‐32.	
  	
   	
   128.	
   Johansson	
  ALV,	
  Dickman	
  PW,	
  Kramer	
  MS,	
  Cnattingius	
  S.	
  Maternal	
  smoking	
  and	
  infant	
   mortality:	
  does	
  quitting	
  smoking	
  reduce	
  the	
  risk	
  of	
  infant	
  death?	
  Epidemiology.	
  2009	
   Jul;20(4):590-­‐597.	
  	
   	
   129.	
   Mehaffey	
  K,	
  Higginson	
  A,	
  Cowan	
  J,	
  Osborne	
  G,	
  Arbour	
  L.	
  Maternal	
  smoking	
  at	
  first	
   prenatal	
  visit	
  as	
  a	
  marker	
  of	
  risk	
  for	
  adverse	
  pregnancy	
  outcomes	
  in	
  the	
  Qikiqtaaluk	
   (Baffin)	
  region.	
  2010;	
   	
   130.	
   Injury	
  Prevention	
  Committee,	
  Canadian	
  Paediatric	
  Society.	
  Reducing	
  the	
  risk	
  of	
  sudden	
   infant	
  death.	
  Paediatr	
  Child	
  Health.	
  1996;1:63-­‐7.	
  	
   	
   131.	
   Horsley	
  T,	
  Clifford	
  T,	
  Barrowman	
  N,	
  Bennett	
  S,	
  Yazdi	
  F,	
  Sampson	
  M,	
  et	
  al.	
  Benefits	
  and	
   harms	
  associated	
  with	
  the	
  practice	
  of	
  bed	
  sharing:	
  A	
  systematicreview.	
  Arch	
  Pediatr	
   Adolesc	
  Med.	
  2007	
  Mar	
  1;161(3):237-­‐245.	
  	
   	
   132.	
   Ip	
  S,	
  Chung	
  M,	
  Raman	
  G,	
  Chew	
  P,	
  Magula	
  N,	
  DeVine	
  D,	
  et	
  al.	
  Breastfeeding	
  and	
   maternal	
  and	
  infant	
  health	
  outcomes	
  in	
  developed	
  countries.	
  Evid	
  Rep	
  Technol	
  Assess	
   (Full	
  Rep).	
  2007	
  Apr;(153):1-­‐186.	
  	
   	
   133.	
   McVea	
  KLSP,	
  Turner	
  PD,	
  Peppler	
  DK.	
  The	
  role	
  of	
  breastfeeding	
  in	
  sudden	
  infant	
  death	
   syndrome.	
  J	
  Hum	
  Lact.	
  2000	
  Feb	
  1;16(1):13-­‐20.	
  	
   	
    87	
    134.	
   Cunningham	
  C.	
  Focus	
  Inuit	
  research	
  agenda	
  on	
  best	
  outcomes.	
  CMAJ.	
  2010	
  Feb	
   23;182(3):228-­‐229.	
  	
   	
   135.	
   Phinney	
  SD.	
  Ketogenic	
  diets	
  and	
  physical	
  performance.	
  Nutr	
  Metab	
  (Lond).	
  2004	
   8;1(1):2.	
  	
   	
   136.	
   Louet	
  JF,	
  Chatelain	
  F,	
  Decaux	
  JF,	
  Park	
  EA,	
  Kohl	
  C,	
  Pineau	
  T,	
  et	
  al.	
  Long-­‐chain	
  fatty	
  acids	
   regulate	
  liver	
  carnitine	
  palmitoyltransferase	
  I	
  gene	
  (L-­‐CPT	
  I)	
  expression	
  through	
  a	
   peroxisome-­‐proliferator-­‐activated	
  receptor	
  alpha	
  (PPARalpha)-­‐independent	
  pathway.	
   Biochem.	
  J.	
  2001	
  Feb	
  15;354(Pt	
  1):189-­‐197.	
  	
   	
   137.	
   Pocai	
  A,	
  Lam	
  TKT,	
  Obici	
  S,	
  Gutierrez-­‐Juarez	
  R,	
  Muse	
  ED,	
  Arduini	
  A,	
  et	
  al.	
  Restoration	
  of	
   hypothalamic	
  lipid	
  sensing	
  normalizes	
  energy	
  and	
  glucose	
  homeostasis	
  in	
  overfed	
  rats.	
   J.	
  Clin.	
  Invest.	
  2006	
  Apr;116(4):1081-­‐1091.	
  	
   	
   138.	
   Port	
  RV,	
  Arnold	
  J,	
  Kerr	
  D,	
  Glavish	
  N,	
  Gravish	
  N,	
  Winship	
  I.	
  Cultural	
  enhancement	
  of	
  a	
   clinical	
  service	
  to	
  meet	
  the	
  needs	
  of	
  indigenous	
  people;	
  genetic	
  service	
  development	
   in	
  response	
  to	
  issues	
  for	
  New	
  Zealand	
  Maori.	
  Clin.	
  Genet.	
  2008	
  Feb;73(2):132-­‐138.	
  	
   	
   139.	
   Nyman	
  LR,	
  Cox	
  KB,	
  Hoppel	
  CL,	
  Kerner	
  J,	
  Barnoski	
  BL,	
  Hamm	
  DA,	
  et	
  al.	
  Homozygous	
   carnitine	
  palmitoyltransferase	
  1a	
  (liver	
  isoform)	
  deficiency	
  is	
  lethal	
  in	
  the	
  mouse.	
  Mol.	
   Genet.	
  Metab.	
  2005	
  Oct;86(1-­‐2):179-­‐187.	
  	
   	
    	
    88	
    APPENDIX	
  A.	
   	
   Table	
  A.1	
   Variables	
   included	
   from	
   coroner’s	
   report	
   for	
   infant	
   mortality	
   cases	
   documented	
  in	
  Nunavut	
  (n=78;	
  July	
  1,	
  1999-­‐June	
  30,	
  2008)	
   Field	
   Date	
  of	
  Birth	
   Date	
  of	
  Death	
   Cause	
  of	
  Death	
   Gender	
   Gestational	
  Age	
  (wks)	
   Place	
  of	
  Residence	
   CPT-­‐1	
  P479L	
  Tested	
   Sleep	
  Position	
  -­‐	
  found	
  	
   Sleep	
  Position	
  -­‐	
  placed	
   Bed-­‐sharing	
   Loose	
  bedding	
  present	
   Sleep	
  surface	
   Smoking	
  present	
  in	
  environment	
   Alcohol	
  present	
  in	
  environment	
   Breast	
  feeding	
   	
    	
    89	
    Table	
  A.2	
   Causes	
   of	
   death	
   as	
   stated	
   by	
   autopsy	
   report	
   for	
   infant	
   mortality	
   cases	
   documented	
  in	
  Nunavut	
  (n=78;	
  July	
  1,	
  1999-­‐June	
  30,	
  2008)	
  	
   Cause	
  of	
  Death	
   Known	
  medical	
  cause	
   Respiratory	
  infection	
  including	
  pneumonia,	
  bronchiolitis	
   Other	
  infection,	
  including	
  H	
  influenza	
  type	
  A	
  Sepsis,	
  other	
  sepsis,	
  H	
  influenza	
   type	
   B	
   meningitis,	
   other	
   meningitis/encephalitis,	
   pericarditis,	
   and	
   viral	
   myocarditis.	
  	
   Congenital	
   defect	
   /	
   anomalies,	
   including	
   heart	
   defects,	
   neuromuscular,	
   brain	
   malformation,	
  and	
  respiratory	
  system	
  malformation.	
  	
   SIDS/SUDI	
   SIDS	
   SUDI	
   Unknown	
   Unknown	
  -­‐	
  perinatal	
  death	
  -­‐	
  died	
  out	
  of	
  territory	
   Unknown	
  -­‐	
  died	
  out	
  of	
  territory	
   Total	
    n	
   27	
   15	
   7	
   5	
   37	
   24	
   13	
   14	
   8	
   5	
   78	
    	
    	
    90	
    

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0071546/manifest

Comment

Related Items